key: cord-0681770-2bizx2m4
authors: Notarangelo, M.; Quattrone, A.; Pizzato, M.; Mansy, S. S.; Toparlak, O. D.
title: Inexpensive and colorimetric RNA detection by E. coli cell-free protein synthesis platform at room temperature
date: 2021-12-02
journal: nan
DOI: 10.1101/2021.11.29.21267025
sha: 11b03de3f3c64dc2c2edc2515fff6c2745a117ba
doc_id: 681770
cord_uid: 2bizx2m4

We report colorimetric detection of SARS-CoV-2 viral RNA by an in vitro transcription/translation assay with crude E. coli extracts at room temperature, with the aid of body heat. Clinically-relevant concentrations of viral RNA (ca. 600 copies/test) were detected from synthetic RNA samples. The activation of cell-free gene expression was achieved by toehold-switch-mediated riboregulatory elements that are specific to viral RNA sequences. The colorimetric output was generated by the -complementation of {beta}-galactosidase {omega}-fragment (LacZ-{omega}) with cell-free expressed LacZ-, using an X-gal analogue as a substrate. The estimated cost of single reaction is less than 1 euro/test, which may facilitate diagnostic kit accessibility in developing countries.

Early days of COVID-19 pandemic has proved that rapid and efficient diagnostic tools are indispensable to cope with the emerging infections to mitigate the detrimental effects of lockdowns. To this end, many laboratories and companies around the world have deployed their resources towards generation of fast and cheap diagnostic tools [1] [2] [3] . In this context, cell-free protein expression (CFPS) platforms emerged as attractive tools, as they are relatively simple, cheap and straightforward to engineer [4] [5] [6] [7] . Moreover, freeze-drying of cell-free components to rehydrate with aqueous samples enabled cell-free biomanufacturing as a possibility within reach [8] [9] [10] . Further efforts were diverted to adapt CFPS platforms for efficient virus-specific detection, in particular with CRISPR/Cas nucleases [11] [12] [13] [14] . In parallel, multiple rapid, enzymatic RNA amplification methods were also developed with colorimetric output [15] [16] [17] . Many of these platforms detect viral RNAs with high specificity at attomolar concentrations; but also suffer from relatively high costs per run, since they rely on commercial reagents and need trained workers. Furthermore, they also require re-cycling or incubation at above room temperature for optimal efficiency, rendering them problematic for field applications.

During unexpected global pandemics, resources may become scarce and limited. If massive diagnostic scaleup is necessary for screening the entire population, relying on commercial sources of reagents can crucially limit the diagnostic capacity. As the emerging SARS-CoV-2 variants continuously remind us, fighting a highly infectious respiratory virus requires a global strategy. To facilitate this goal, we need accessible and inexpensive diagnostic tools that are easy-to-deploy and affordable, especially in developing countries. With these strategic goals in mind, here, we report the potential of detection of viral RNA sequences by repurposing the E. coli cellfree transcription/translation system with colorimetric output (Scheme 1). We adapted toehold-switch-mediated riboregulatory elements for gene expression activation, preceded by isothermal RNA amplification aided with body heat. Using minimal equipment and cell-free reactions operating at room temperature, high-attomolar (ca. 110 aM) concentrations of viral RNA were detected from synthetic samples. The colorimetric output was generated by -complementation of -galactosidase fragment using an X-gal analogue as a color-changing substrate with enzyme activity. In principle, the colorimetric diagnostic platform can be coupled to magnetic-bead-driven

RNA isolation, where a proof-of-principle was demonstrated from saliva. We estimate the total cost of the colorimetric detection assay to be ca. 0.72 euro/test.

We in silico designed and functionally verified 11 different toehold-switch-mediated riboregulatory constructs that are complementary to the 5' and 3' untranslated regions (5' UTR and 3' UTR) of the SARS-CoV-2 genome ( Figure S1 ). UTR was specifically chosen because, during the coronavirus replication cycle, discontinuous RNA synthesis generates higher-copy numbers of UTR sections than the rest of the genome ( Figure S2 ) [18] [19] [20] . For initial characterization of the riboregulatory elements and cell-free extracts, we used superfolder GFP (sfGFP), controlled by T7 promoter ( Figure 1A) . The activation of cell-free gene expression with different toehold-switches was triggered by a complementary DNA oligonucleotide for initial screening. All riboregulatory elements activated the cellfree gene expression only in the presence of complementary oligonucleotides, but worked at different efficiencies ( Figure 1B and S3A). The most promising construct, TH001, gave ca. 15-fold increase in gene expression, thus it was chosen for subsequent experiments. In E. coli cell-free systems, the innate nucleic acid detection limit, that is without any preamplification step, was found to be ca. 1 nM ( Figure 1C and S3B). Such levels of toehold-switch activation are on par with the detection limit of PURExpress-based cellfree systems 6, 21 . Thus, we concluded that a preamplification step was necessary to detect clinicallyrelevant concentrations of viral RNA.

Point-of-care (POC) and inexpensive diagnostic tools may need exclusively room temperature operations, especially if instrumentation is scarce. To this end, cellfree reaction conditions and extract preparation protocols were tested for room temperature work-up ( Figure S4 ). That is, E. coli extracts were prepared following post-log-phase growth at 23 C. E. coli extracts were found to retain 50% activity compared to regular 37 C growth ( Figure S4A ). To minimize the dependency to expensive instruments, the functionality of cell-free reactions was tested and verified without freeze-drying but only after drying ( Figure S4B ). This way, we potentially eliminated the need for expensive freeze-drying equipment for preparation of lyophilized cell-free reactions. At last, POC diagnostics may use one-step viral inactivation from bodily fluids, followed by the cell-free reactions. To this end, the cell-free reactions were tested for compatibility with human saliva. As a reaction additive, saliva did not inhibit the reactions, as long as dilution was used between 1/20 th and 1/100 th of the reaction volume ( Figure S4C ).

Following these optimization efforts of the cell-free extract, we focused on development of cell-freecompatible isothermal RNA amplification strategies. To this end, nucleic acid sequence-based amplification (NASBA) 22 , reverse transcriptase-recombinase polymerase amplification (RT-RPA) 23, 24 and reverse transcriptase rolling circle amplification (RT-RCA) 25 reactions were tested (see supplementary materials). Out of all pre-amplification methods, RT-RPA proved to be the most efficient technique, both at recommended temperatures and at 30 C ( Figure 1C and S5). Nevertheless, we decided to put further effort in optimization of NASBA reactions, which can be assembled in-house and used in high-throughput sequencing-based diagnostics 26 . Our goal was to minimize the dependency of diagnostic tools to commercial components and kits -proven to be detrimentally scarce at the early days of COVID-19 pandemic.

We assembled NASBA reactions using past reports as guide 27, 28 and additionally tested different parameters. Our major goal was two-fold: (1) to couple NASBA to cell-free reactions; (2) to minimize temperature cycling and preferably operate solely at room temperature (22  2 C). Initially, we screened 10 different reaction (B) Activation of gene expression by the target viral sequences, provided as a DNA oligonucleotide. (C) Isothermal amplification of SARS-CoV-2 viral RNA at various conditions. Note that body-heat warmed (hand-held) reactions worked as good as 37 C incubation. (D) Colorimetric assay reactions on-paper-disk from serial dilution of synthetic RNA with RT-RPA. NT 'No Template' stands for full cell-free reaction assembly but without any complementary nucleic acid present template reaction.

additives inside a unique buffer composition that is suitable for all enzymes in the cocktail. ( Figure S5A , supplementary methods). The additives that elicited the most positive impact were 10% (v/v) DMSO and 1 M betaine.

Past reports showed that "unoccupied" T7 bacteriophage RNA polymerase (T7 RNAP) can trigger transcription of random, non-specific RNA duplexes 29 . In order to alleviate this issue, random DNA oligonucleotide duplex was added to the mixture to minimize non-specific transcription by T7 RNAP (Figure S5B ) 30 . The NASBA reaction conditions were further tested with decreasing enzyme concentrations at room temperature ( Figure 5C ). Yet, none of the methods allowed for efficient RNA amplification at room temperature, including RT-RPA ( Figure S5C and S5D). However, conditions for optimal enzyme activity in pre-amplification steps were conductive to a putative single-pot lysis of human cells and extraction of viral particles. Coupling with lysis buffer, the presence of 0.5% (v/v) Triton X-100 in the NASBA reaction mixture improved the amplification efficiency ( Figure S6A ). Nevertheless, the process of cell lysis from human saliva did not overlap with RNA amplification in NASBA reaction, as a "ready-to-use" reagent ( Figure S6B ).

To minimize dependency of temperature cycling, we further tested NASBA without pre-heating at 65 C for primer annealing. A pre-heating step proved to be non-. CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint detrimental for amplification, albeit at a cost of decreased efficiency ( Figure S6C ). Given the intrinsic toxicity of low concentrations of glycerol for E. coli cell-free expression system 31 , and well-known sensitivity of T7 RNAP to reducing storage conditions, we conclude that a system independent of T7 RNAP is the best choice for reproducible results. In the end, the lysis buffer composition was also more compatible with RT-RPA than NASBA ( Figure S6C ) to single-pot purification and amplification of viral RNA from saliva samples. Moreover, since field conditions require minimal instruments, we confirmed that RT-RPA works as good as 37 C, when 8-strip tubes were hand-held and warmed by body heat (Scheme 1 and Figure 1C ). We find this approach significant, since healthcare workers or the patients themselves can perform the test without any instrumentation apart from micro pipettors.

Having determined the most conductive preamplification mode as RT-RPA, we set out to modify our reporter system from fluorometric to colorimetric output. To this end, maltose-binding protein (MBP)-tagged galactosidase -fragment (LacZ) was expressed in E. coli NEB5 strain, purified via Amylose Resin and rescued from MBP by TEV protease digestion ( Figure  S7A ). For -complementation, LacZ subunit gene expression was placed under the control of endogenous E. coli promoters ( Figure S7B and Table S1 ). To test the complemented LacZ activity, 2 mM (final or 12 µg/µL) Chlorophenol Red-β-D-galactopyranoside (CPRG) was used as a substrate to give an expected color change from yellow to reddish-purple (we note that the precise color change is heavily dependent on the solid support) 32 .

E. coli BL21-derivative strains are regularly employed for cell-free extract preparation and contain an endogenous copy of LacZ, which was not suitable for complementation ( Figure S8A ) To this end, we set out to prepare cell-free extracts from E. coli strains of JM109 and DH10, which have genotypes with a LacZ15 mutation. The cell-free gene expression from the crude extracts of JM109 and DH10 was verified and, in the presence of toehold-switch triggering complementary DNA oligonucleotide, the colorimetric assays showed the color change from yellow/orange to orange/red within 1 hour, demonstrating the functionality of our reporter system ( Figure S8C ).

Having shown the cell-free reactions generated colorimetric output at room temperature, we next set out to couple RT-RPA amplification step to cell-free reactions. First, RT-RPA was run for 30 min at 37 C and then added to cell-free reaction at a 1:20 dilution. Within 8 hours after rehydration, the reddish color was developed down to ca. 110 attomolar (aM) final concentration of RNA, that is ca. 667 copies of RNA per reaction, which was verified by qRT-PCR having cycle threshold (Ct) value higher than 28.79  0.36 ( Figure 1D and S9). In other words, as long as the RT-RPA amplified RNA generated a Ct value above 10-12, we detected a color change ( Figure S10A ).

Subsequently, we wanted to render all steps compatible at room temperature, in a proof-of-concept experiment: (1) cell lysis + viral inactivation, (2) RNA capture in saliva, (3) RT-RPA and (4) cell-free colorimetric assay. We chose saliva as a biofluid for the test, since saliva can be autonomously self-tested by the users in a non-invasive manner. Synthetic RNAs were spiked-in human saliva and isolated by magnetic bead separation. Nevertheless, the isolated RNA could not be efficiently amplified with RT-RPA, suggesting an incompatibility in buffer compositions, as the effect of saliva on RT-RPA was not completely inhibitory ( Figure  S6C ). In the end, we examined the clinical relevance of the proposed magnetic-bead isolation. That is, we tested whether we can reveal the presence of viral RNA in patient samples. First, positive patient samples were identified by 5' UTR-specific qRT-PCR (1 hit out of 7 samples) and later samples were amplified by RT-RPA ( Figure S10B ). The amplified RNA was isolated from saliva spiked-in samples, verifying our approach inprinciple, but requiring further optimization efforts to combine all the steps together in one-pot. The clinical translation of our findings, in part, can be achieved if the subsequent research maintains the goal to reduce the duration of the cell-free reactions as well as the target reaction costs at low levels after scale-up.

Here, we reported colorimetric detection of clinically relevant concentrations of RNA with a low-cost cell-free assay, with all operating conditions at room temperature. In theory, this assay does not require any instrumentation apart from the micro-pipettors (and magnetic racks). The current system may be suffering from suboptimal reaction conditions and E. coli extract compositions. Such focused efforts are likely to decrease the detection limit to lowattomolar concentrations and even reduce the incubation times. We estimate the overall cost of the single test as low as ~0.23 euro (see Supplementary Text and Table S2 ), including the labor costs to perform the test. Given that future efforts can be diverted to optimization of this assay as an end-user-friendly diagnostic, further cost reductions can be anticipated. At the moment, largest limiting factor appears to be the commercial dependence to RT-RPA reactions. Nevertheless, low µL volume RT-RPA and future scale-up efforts for E. coli extracts can also bring the assay costs substantially lower than our estimates, up to 50% reduction 10 . Finally, we excitedly point out that the colorimetric detection can be coupled to cell phone applications 11 or wearable devices 17 , bringing cell-free synthetic biology technologies in our everyday lives. The clinical and translational potential of paper-based biosensors has once more highlighted with our work, . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint given the raised limitations were addressed and optimization studies were performed.

Homemade E. coli cell-free extracts that are used for insolution reactions were prepared from Rosetta 2(DE3) Singles strain (Novagen), using published protocols as a guide 33 . For on-paper reactions, the E. coli strains JM109 and DH10 were used. This crude extract preparation did not include the dialysis step. For details, see supplementary materials.

Reverse Transcriptase Recombinase Polymerase Amplification (RT-RPA) reactions were by from TwistAmp  Basic kit, and assembled according to manufacturer's instructions (TwistDx). The reactions were assembled in 10 µL volumes and contained 1 µL of template (either clinical samples or synthetic RNA) and 0.2 µL (40 U) of RevertAid Reverse Transcriptase (ThermoScientific). The final RT-RPA volume was 0.525 µL in a 10.5 µL cell-free reaction (1:20 dilution). For details on the NASBA and RT-RCA, see supplementary materials.

All in vitro transcription-translation reactions were performed in a final volume of 10.5 µL. For in-solution reactions, the sfGFP fluorescence was measured by Rotor-Gene Q qPCR machine (Qiagen) or by a multiwell plate reader (Varioskan, ThermoFisher). For onpaper reactions, the amino acid solution mix and energy solution compositions were taken from the literature 33 . The supplementary solution additionally contained 10 mM maltose, glutamate salts (Mg 2+ and K + ) and 2% (w/v) PEG4000 as a molecular crowding agent. Purified LacZ (50 ng/µL) and LacZ substrate CPRG (0.12 µg/µL). Template plasmid DNA was at a final concentration of 30 nM.

Prior to on-paper reaction, 1 µg of MBP-LacZ was digested by 1 µL TEV protease (New England Biolabs) in a 50 µL at 30 C for 5 h. Then, 5% (w/v) BSA-blocked, air-dried (16 h) paper-disks were put in in clear bottom 96-well plate (Costar) and the E. coli cell-free reactions were added on top. Both synthetic RNA (pre-amplified) and clinical samples (purified and pre-amplified) were provided at a 1:20 final dilution. Then, the reactions were let air-dry and monitored for color change at room temperature.

The sequence of 5' UTR(+) region of the wild-type SARS-CoV-2 was taken from NCBI (265 bp), obtained as a dsDNA gene fragment (GenScript) and cloned into an expression cassette under the control of consensus T7 promoter. In vitro transcription was performed by T7 RNA polymerase for 12 h at 37 C from PCR-amplified template. Synthesized RNAs were initially cleaned up by TRIzol, ethanol precipitated and subsequently purified by NucleoSpin RNA Clean-up kit (Macherey-Nagel).

The RNA from infected patients was derived from anonymized saliva samples collected with ethical committee approval of the Azienda Provinciale per i Servizi Sanitari of the Autonomous Province of Trento (P.A.T.). Prior to the proof-of-concept RNA spike-in tests, saliva was diluted up to 5 or 10 times with PBS to reduce its viscosity.

Magnetic-bead-mediated RNA isolation was by biotinylated complementary DNA oligonucleotides to capture, and streptavidin-coated magnetic beads to isolate with a magnetic rack (Invitrogen). The experiments were performed using manufacturer's instructions as a general guide, i.e., high-salt buffer to bind and low-salt buffer to wash; with significant modifications as specified in supplementary methods.

Prior to qRT-PCR, cDNAs were synthesized by reverse transcription with iScript cDNA synthesis kit (Bio-Rad). For clinical samples, the template was 14 µL (max. amount in 20 µL). qRT-PCR was performed by SsoAdvanced SYBR  Supermix (BioRad). qPCR was run at Bio-Rad CFX96 Real-Time machine and acquisition was at FAM channel. qRT-PCR primer pairs were designed by online software Primer3, optimized for Tm = 57-60 C, to generate an amplicon size of ca. 100 bp. Standard curve was generated by serial dilutions with 1:10 and primer efficiency was calculated as the slope of cycle threshold vs dilution factor.

The toehold switches were designed using previously published principles (details in the supplementary methods) 34 . All clonings were performed by homemade Gibson Assembly mix 35 . All expression plasmids were with pSB1A3 backbone from iGEM Parts Registry. dsDNAs were obtained by PCR, gBlocks or in-house assembly of DNA primer-stitched templates. LacZ was cloned into a modified pMAL-c4X backbone containing N-terminus Maltose Binding Protein (MBP) with TEV protease recognition site flanked by (GS)2 linker sequence. E. coli NEB5 strain transformed with MBP-TEV-LacZ expressing plasmid was grown in Terrific Broth at 37 C. The fusion protein was overexpressed with Autoinduction Medium 36 with overall growth of 24 h. The MBP-fusion protein was purified by Amylose Resin (New England Biolabs), eluted with 10 mM maltose.

. CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint

The Supporting Information is available free of charge on the ACS Publications website (link). The PDF contains details on methods, supplementary text, figures and tables.

Correspondence to: omerduhan.toparlak@alumni.unitn.it or odtoparlak@gmail.com 

This work was funded by "Fondazione per la Valorizzazione della Ricerca Trentina", granted to Ö.D.T. and S.S.M., which is gratefully acknowledged.

No competing financial interests have been declared.

Authors are grateful for Serge Nader, Anna Helander and Mirko De Pascalis for logistic support. We thank Max Mundt and the members of Mansy/Quattrone Labs for their comments on this work. 9 Figure S1 . Overview of riboregulatory elements with respect to coronavirus replication cycle. Figure S2 . Design of different toehold-switch-mediated riboregulatory elements. Figure S3 . Functional screening of different toehold-switch-mediated riboregulatory elements. Figure S4 . Optimization of E. coli cell-free protein expression system for RNA diagnostics. Figure S5 . Optimization and screening of isothermal RNA amplification platforms. Figure S6 . Testing compatibility of one-pot lysis buffer with isothermal RNA amplification. Figure S7 . Expression and purification of -galactosidase -fragment (LacZ). Figure S8 . Characterization of E. coli cell-free protein expression systems for colorimetric output. Figure S9 . qRT-PCR verification of synthetic SARS-CoV-2 RNA [5' UTR(+)] copy number. Figure 10 . qRT-PCR verification of SARS-CoV-2 RNA [5' UTR(+)] copy number from synthetic and clinical RNA. Figure S11 . Plate pictures for Fig.1 . Table S1 . Cost calculations and limitations. Table S2 . List of primers, genetic constructs and plasmids used in this study.

. CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. 

All in vitro transcription/translation components were purchased from Sigma-Aldrich (Merck) with highest possible purity, unless otherwise noted. The -galactosidase (LacZ) substrate Chlorophenol Red-β-Dgalactopyranoside was from Cayman Chemicals. E. coli Rosetta 2(DE3) Singles strain (Novagen) was used for the preparation of the generic E. coli extract for in-solution reactions. E. coli NEB5α (New England Biolabs) was used for general molecular cloning and recombinant protein expression. E. coli JM109 (Promega) was used for on-paper reactions. Whatman® α-cellulose filter papers were from Sigma-Aldrich (Merck) and cut with a generic paper hole puncher.

Homemade E. coli cell-free extracts were prepared using published protocols as a guide 33 . Strain-of-choice was cultured overnight (15 h) in 2xYT+P without antibiotics, except for Rosetta 2(DE3) Singles strain (with chloramphenicol 34 µg/mL), initiated from freezer stocks 37 . The next day, the culture is transferred to larger volume conical flask with pre-warmed growth media with 1:100 dilution and incubated with shaking (220 rpm) without disturbing for 3.5 h (temperature varies). The cells were then harvested by centrifugation for 10 min at 6000 g, 4 C. The bacterial pellets were briefly washed, resuspended in pre-chilled S12A buffer (14 mM Mg 2+ -glutamate, 60 mM K + -glutamate, 2 mM DTT, 50 mM Tris-Cl, pH 7.7 adjusted with concentrated acetic acid), centrifuged at 6000 g, 4 C for 10 min. Following, the residual buffer was removed after another round of centrifugation at 6000 g, 4 C for 2 min, and the wet pellet weight was determined. S12A buffer (0.9x dry cell weight) and 100 µm diameter glass beads were added and mixed thoroughly (5x dry cell weight). The resulting slurry-bead mixture was carefully transferred to bead beating tubes using 1 mL syringes without a needle. Bead beating was performed thrice for cell lysis, at a beat rate of 6.5 m/s for 30 s in cold-room (MP Biomedicals). The extract was separated from the glass beads by centrifugation at 6000 g, 4 C for 10 min, with Bio-Rad Bio-Spin columns. The yellowcolored crude extract was then transferred to 2 mL tubes to remove the cellular debris by centrifuging once at 12000 g 4 C for 10 min. The extract was then incubated at 37 C with shaking (220 rpm) for 80 min in open-capped tubes and clarified by centrifuging twice at 12000 g 4 C for 10 min. The resulting crude extract was aliquoted, flash frozen in liquid nitrogen and stored at -80 C until use.

Homemade NASBA reactions were performed as following, with indicated changes in the main text and supplementary figures. In general, the buffer composition was 50 mM Tris-Cl at pH: 8.0, 50 mM KCl, 6 mM MgCl2, 2 mM spermidine, 10 mM DTT, 0.1 mg/mL BSA, 0.5% (v/v) Triton X-100 (prepared as 10x and diluted to 1x in final reaction). Final reaction mixture contained 1x reaction buffer, deoxyribonucleotide mix (1 mM each), ribonucleotide mix (2 mM each), forward and reverse primers ([final] = 1 µM each), 0.01 U of Yeast inorganic pyrophosphatase (YIPP, New England Biolabs), 0.4 U RiboLock RNase inhibitor (ThermoFisher), 0.08 U RNaseH (New England Biolabs), RevertAid Reverse Transcriptase 128 U (ThermoFisher), 32 U Hi  -T7 RNA polymerase (New England Biolabs), 500 nM random duplex primer pair, 1 µL of template RNA (varying amounts), 10% (v/v) DMSO, filled up to 10 µL of final volume with RNase/DNase-free water. If the reactions were performed with preincubation step at 65 C for 3 min, the enzyme cocktail was assembled prior to the reaction and provided after the pre-incubation step.

Commercial NASBA kit was by AMS-Biotechnology (AMS.NLK.10). The NASBA reactions were assembled according to manufacturer's instructions with following exceptions. The reaction mixture contained random primer duplex CF130/CF131 and the lyophilized mixture was rehydrated in final volume of 5 µL for each reaction, assembled with 1 µL of template RNA (added last). The reactions were performed at 41 C for 90 min with 65 C pre-incubation step for 3 min, and the enzymes were added after pre-incubation, as recommended by the manufacturer.

Commercial Reverse-Transcriptase RPA (RT-RPA) was by TwistAmp  Basic Kit (TwistDx, UK). The reactions were assembled according to manufacturer's recommendations with following exceptions. The total volume of each reaction was 10 µL. The RPA reactions contained 0.2 µL (40 U) RevertAid Reverse Transcriptase. For testing . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021.

the clinical samples, the magnesium acetate (MgOAc) was not added last, instead, the template RNA was added last to start the reactions. The primers for all amplification methods are provided in Table S2 . Reverse-Transcriptase Rolling Circle Amplification (RT-RCA) was assembled in-house as following. Phi29 DNA polymerase (ThermoFisher) was provided at 10 U/µL, with the commercial buffer. The reaction mixture contained RevertAid Reverse Transcriptase (20 U) and T4 RNA Ligase 2 (10 U) or SplintR® RNA Ligase (10 U) with the splinting DNA oligonucleotide (ca. 22-25 bp overlaps) that is complementary to the 5' and 3' ends of the template RNA, which was 5' UTR(+) sequence of SARS-CoV-2. The primers used for attempted amplification was given in Table S2 . The total volume of each reaction was 10 µL. 

Prior to on-paper reaction, 1 µg of MBP-LacZ was digested by 1 µL TEV protease (New England Biolabs) in a 50 µL at 30 C for 5 h. Upon completion of the digestion, the mixture was kept at 4C (<12 h), until flash-freezing by liquid nitrogen. The paper disks were cut with an office paper hole punch, and blocked with 5% (w/v) BSA for 16 h with orbital shaking (50 rpm) at room temperature. Then, the paper disks were washed with RNase/DNase-free water 5 min for 3 times and let air-dry for 16 h. Prior to colorimetric assay, the paper-disks were put in in clear bottom 96-well plate (Costar) and the E. coli cell-free reactions were added on top (10 µL). The synthetic RNA was amplified by RT-RPA and added as 0.525 µL (1:20 dilution). Clinical RNA samples were either amplified by RT-RPA or magnetic-bead isolated and then amplified by RT-RPA and also provided as 0.525 µL (1:20 dilution). Then, the reactions were again let air-dry and monitored for color change at room temperature.

For synthetic sample preparation, the sequence of 5' UTR(+) region of the wild-type SARS-CoV-2 (265 bp) was taken from the website of National Center for Biotechnology Information (NCBI, RefSeq: NC_045512.2). The sequence was synthesized as a dsDNA gene fragment from GenScript and cloned into an expression cassette (in plasmid pSB1A3) under the control of consensus T7 promoter, with additional 5' flanking ATT and 3' flanking GG sequences. In vitro transcription reaction was assembled in-house and performed by T7 RNA polymerase for 12 h at 37 C. The final reaction mixture contained 100 µg/mL Bovine Serum Albumin Fraction V (BSA), 10 mM dithiothreitol (DTT), 2 mM ribonucleotide mix (each), 1 U Yeast Inorganic Pyrophosphatase, 0.4 U RiboLock RNase inhibitor (ThermoFisher), 500 U Hi  -T7 RNA polymerase (New England Biolabs), in vitro transcription buffer (1X: 100 mM K + -HEPES at pH 7.5, 5 mM MgCl2, 1 mM spermidine), and a column-purified template DNA PCR product (1 µg) in a total of 100 µL reaction volume filled-up by RNase/DNase-free water. Freshly synthesized RNAs were initially cleaned up by TRIzol and ethanol precipitated as following: acidification by 300 mM sodium acetate pH: 5.2, followed by 100% ice-cold ethanol, incubation at -20 C for 2 h, centrifuged down at 15000 g for 30 min, and washed twice with 70% ethanol and cleaned by subsequent centrifugations. The air-dried pellets were resuspended in 50 µL water and further purified by NucleoSpin RNA Clean-up kit (Macherey-Nagel), aliquoted and dried by vacuum (CentriVap, Labconco) at ambient temperature for 16 h. . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; 12 viral particles in the samples were inactivated by 6 M guanidinium chloride and RNA was purified with TRIzol reagent. (7 samples were used in this study) For RNA isolation by magnetic beads, biotinylated DNA oligonucleotides (0.4-1 nmol, 25 bp) were complementary to 5' UTR(+) region. Approximately 0.2-1 mg streptavidin-coated magnetic beads were used to capture the complementary RNA. For experiments used synthetic RNA spiking inside the saliva, the saliva samples were diluted 1:5 in phosphatebuffered saline (PBS) and cellular debris was cleared by centrifugation at 500 g for 5 min at room temperature. Subsequently, the RNA dilutions were spiked-in the sample. Prior to RNA isolation, magnetic beads were washed once and equilibrated for 10 min in high-salt binding buffer (50 mM Tris-Cl at pH: 7.5, 500 mM NaCl, 1 mM EDTA and 0.5% (v/v) Triton X-100). The separation was by a magnetic rack by Invitrogen. Then, the sample and magnetic beads were mixed and, hand-warmed for 1 min and let incubate at room temperature for 10 min without agitation. The magnetic beads were then captured out of the solution by magnets, and the beads were washed once with high-salt buffer without Triton X-100 and twice with ice-cold low-salt wash buffer (50 mM Tris-Cl at pH: 7.5, 150 mM NaCl, 1 mM EDTA). The captured RNA was then eluted by TE buffer (10 mM Tris-Cl, 1 mM EDTA at pH: 7.5) from the final magnetic bead slurry at 65-70 C.

Prior to qRT-PCR, complementary DNA (cDNA) was synthesized by reverse transcription with iScript cDNA synthesis kit (Bio-Rad). For clinical RNA samples, the template was 1 µL (in 20 µL total volume). For magnetic-bead isolated clinical RNA samples, the template was 14 µL (max. amount in 20 µL). qRT-PCR was performed by SsoAdvanced SYBR  Supermix (BioRad), with primer pairs DT146/DT147 or DT152/DT153 (see Table S2 ). qPCR was run at Bio-Rad CFX96 Real-Time machine and acquisition with FAM channel. The PCR cycling program included initial denaturation for 30 sec at 95 C, and cycling denaturation for 10 sec at 95 C followed by annealing/extension for 30 sec at 60 C that was for 40 cycles with plate reading at every cycle. At the end of the run, a melting curve was generated from 65 C to 95 C with 0.5C/step increments. qRT-PCR primer pairs were designed by online software by MIT-Primer3 and Integrated DNA Technologies (IDT), optimized for Tm = 57-60 C, to generate an amplicon size of 100-130 bp. Standard curve was generated by serial dilutions of cDNA at 1:10 increments and primer efficiency was calculated as the slope of cycle threshold vs dilution factor. Efficiency between 90-110% was considered as acceptable.

Design of toehold switches: Toehold switches were designed by taking previously published reports as a guide 34, 38 . In brief, the viral complementary sequences were joint with an 11-bp stem-region. The secondary structure predictions were obtained by NUPACK software (http://www.nupack.org/). Stem-region melting temperatures were calculated according to Primer3 software defaults (Santa Lucia 1998). The goal melting temperature was above 25 C. The overall target Gibbs free energy of the secondary structure (G) was above -35 kcal/mol. In particular, complex secondary structures were avoided in the 25 bp toehold-flanking sequences.

All clonings were performed by in-house assembled Gibson Assembly mix 35 . All gene expression plasmids were with pSB1A3 backbone from iGEM Parts Registry. dsDNAs were obtained by PCR, gBlocks or in-house assembly of DNA primer-stitched templates. -galactosidase -fragment (LacZ) was cloned into a modified pMAL-c4X backbone containing N-terminus Maltose Binding Protein (MBP) with TEV protease recognition site flanked by (GS)2 linker sequence. E. coli NEB5 strain transformed with MBP-TEV-LacZ expressing plasmid was grown in Terrific Broth at 37 C. The fusion protein was overexpressed with Autoinduction Medium 36 with overall growth of 24 h. The MBPfusion protein was purified by Amylose Resin (New England Biolabs) according to manufacturer's instructions and eluted by 10 mM maltose. After elution, first four fractions that contain the MBP-LacZ was pooled, flash frozen in liquid nitrogen and stored at -80 C until use. The concentration of the proteins was determined by Pierce™ BCA Protein Assay Kit (ThermoFisher). The list of primers, genetic constructs and plasmids can be found at Table S2 , including their sequences.

. CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint Figure S2 . Design of different toehold-switch-mediated riboregulatory elements. The predicted secondary structures were obtained with NUPACK online software at 30 C (http://www.nupack.org/). . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint We also note that under reported reaction conditions, our initial attempts for RT-RCA did not yield amplification.

. CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. We also take into account that incurred plasmid preparation costs and general buffers/chemicals included in the reaction mixture.

Notably, we used an RT-RPA system, decreased down to 5 µL volume in a single proof-ofconcept reaction, which did not require any additional incubators or thermocyclers. Given the amount used in the final test, which is 0.525 µL, the RT-RPA can also be performed in even smaller volumes such as 1 µL, reducing the associated costs further 5x-2.5x fold. is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. ; be reused up to 5 times). 15 mg is enough for 300 tests (for 50 µg/reaction), with final cost of 0.33 EUR/test; (with commercial TEV protease used at 0.035 EUR/test). Overall cost can be reduced down to ca. 0.033 EUR/test (10fold), if one would like to adapt Ni 2+ -NTA-based purification (IMAC systems) instead of Amylose resin. Overall mix of colorimetric components were added as 0.525 µL in 10 µL test (1:20 dilution). Further, the MBP-LacZ can be digested in bulk, and at higher concentrations (we tested 4x more) and flash-frozen in liquid N2, and thawed for bulk testing at once. Taken altogether, the cost of colorimetric components is estimated as 0.36 EUR/test, with a lowest end estimated to be ~0.068 EUR/test).

The labor is considered from active work time as 0.227 EUR/µL reaction 40 . Generally, we reduced the lysate preparation times and costs by omitting the dialysis step (e.g., 1 h less active time) and adapted more streamlined workplan with ~5 h of active time, provided no laborious purification steps are needed as opposed to OnePot PURE (additional ~2 h active time deducted from 8 h estimate) 39, 40 . Including all culture growth phases, the lysate preparation takes 1.5 labor days. We assumed assembly (actual test) duration is same for all, ~1 h, totaling of ~6 h active time. If one would like to make a total time estimate, we can conclude that our assay can be finished in less than 36 h from the first inoculation.

Biotinylated-oligonucleotide requires 100-500 pmol per capture, at a cost of ca. 1.5 euro/100 pmol. Streptavidin-coated magnetic beads are used at 100-500 µg per reaction (2-10 euro/sample). Nevertheless, this step is optional and subject to further optimization for reduction in mass of beads used; thus, this cost is not essentially relevant to the final cost estimation of our assay.

. CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted December 2, 2021. is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted December 2, 2021. ; AATCACGATGCTCTGTATCGCTGGATTAAGAGCGTC  GACCCGTCACGTCCGGTTCAATATGAAGGTGGTGGC  GCAGATACCACTGCGACCGATATCATCTGCCCGATG  TACGCGCGCGTGGACGAGGATCAACCGTTTCCGGCG  GTGCCAAAGTGGTCAATAAAGAAGTGGCTGTCTTTA  CCGGGTGAGACCCGTCCGCTGATCCTTTGCGAATAT  GCTCACGCAATGGGTAACAGCCTTGGTGGTTTTGCG  AAGTACTGGCAAGCCTTCCGCCAGTATCCGCGTTTG  CAGGGTGGTTTTGTTTGGGACTGGGTGGACCAGAGC  TTGATTAAATACGATGAGAACGGTAATCCGTGGTCG  GCGTATGGCGGCGACTTTGGAGATACCCCGAACGAC  CGCCAATTCTGCATGAATGGCCTGGTGTTTGCGGAC  CGTACCCCGCATCCCGCGCTGACCGAAGCCAAGCAT  CAACAACAATTCTTTCAGTTCCGTCTCTCTGGCCAA  ACCATTGAGGTTACCTCCGAGTATTTGTTCAGGCAC  AGCGATAATGAGCTGCTCCACTGGATGGTTGCACTG  GACGGCAAACCGCTGGCGTCCGGCGAAGTACCGCTG  GACGTTGCGCCACAGGGTAAGCAACTGATCGAGTTA  CCGGAATTGCCACAGCCGGAGAGCGCGGGCCAGCTG  TGGCTGACCGTACGCGTGGTTCAGCCTAATGCGACC  GCTTGGTCGGAGGCTGGTCACATTTCTGCTTGGCAA  CAATGGCGTTTAGCTGAGAACCTGTCTGTGACCCTG  CCGGCGGCAAGCCACGCGATTCCGCACCTGACGACC  AGCGAGATGGATTTCTGCATTGAGTTGGGTAATAAA  CGCTGGCAGTTCAACCGCCAAAGCGGGTTCCTGTCC  CAGATGTGGATTGGTGATAAAAAGCAACTGCTGACG  CCACTGAGAGATCAGTTCACCCGTGCTCCGCTTGAT  AACGACATCGGCGTGAGCGAAGCGACCAGGATCGAT  CCGAACGCCTGGGTCGAGCGTTGGAAAGCGGCGGGT  CACTACCAGGCGGAGGCAGCGCTGTTACAATGTACC  GCTGACACCCTGGCGGACGCGGTGCTGATCACCACG  GCGCATGCGTGGCAGCATCAGGGTAAGACCCTGTTC  ATTTCCCGTAAAACCTACCGTATCGACGGCAGCGGC  CAAATGGCAATTACTGTGGACGTCGAGGTTGCGAGC  GACACACCCCACCCGGCTCGTATCGGACTGAATTGT  CAGTTGGCTCAAGTGGCTGAACGTGTCAACTGGTTG  GGACTAGGACCGCAAGAAAATTACCCGGATCGTTTG  ACTGCTGCATGTTTTGACCGATGGGATTTGCCATTA  AGCGATATGTATACCCCGTATGTATTTCCCAGCGAA  AACGGCCTGCGCTGCGGCACACGCGAACTCAACTAC  GGTCCGCACCAGTGGCGCGGTGACTTTCAGTTCAAC  ATTTCCCGTTACAGCCAGCAACAGCTTATGGAAACT  TCGCATCGTCATCTGCTTCACGCGGAGGAAGGCACC  TGGCTCAACATCGACGGGTTCCACATGGGTATTGGT  GGCGACGATTCCTGGTCACCGTCCGTCTCCGCGGAA  TTTCAACTGTCTGCCGGTCGTTACCATTACCAGTTG  GTTTGGTGCCAGAAATAA   Table S2 . List of primers, genetic constructs and plasmids used in this study. Plasmid sequences are given without backbone. Start codons, stop codons and TEV protease recognition site (along with flexible linker) are highlighted in purple and green, respectively.

. CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted December 2, 2021. ; https://doi.org/10.1101/2021.11.29.21267025 doi: medRxiv preprint

Development of a Laboratory-Safe and Low-Cost Detection Protocol for SARS-CoV-2 of the Coronavirus Disease 2019 (COVID-19)

All-in-One Dual CRISPR-Cas12a (AIOD-CRISPR) Assay: A Case for Rapid, Ultrasensitive and Visual Detection of Novel Coronavirus SARS-CoV-2 and HIV Virus

Assay Techniques and Test Development for COVID-19 Diagnosis

Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components

Synthetic Biology Devices for in Vitro and in Vivo Diagnostics

Toehold Switches: De-Novo-Designed Regulators of Gene Expression

Paper-Based Synthetic Gene Networks

On-Demand Biomolecular Manufacturing

Cell-Free Gene Expression: An Expanded Repertoire of Applications

Cell-Free Biomanufacturing

Amplification-Free Detection of SARS-CoV-2 with CRISPR-Cas13a and Mobile Phone Microscopy

Detection of SARS-CoV-2 with SHERLOCK One-Pot Testing

A Novel Miniature CRISPR-Cas13 System for SARS-CoV-2 Diagnostics

Isothermal Amplified Detection of DNA and RNA

Saliva Twostep for Rapid Detection of Asymptomatic Sars-Cov-2 Carriers

Wearable Materials with Embedded Synthetic Biology Sensors for Biomolecule Detection

Continuous and Discontinuous RNA Synthesis in Coronaviruses

Direct RNA Sequencing and Early Evolution of SARS-CoV-2

The Architecture of SARS-CoV-2 Transcriptome

Towards Detection of SARS-CoV-2 RNA in Human Saliva: A Paper-Based Cell-Free Toehold Switch Biosensor with a Visual Bioluminescent Output

Nucleic Acid Sequence-Based Amplification

Recombinase Polymerase Amplification: Basics, Applications and Recent Advances

INSIGHT: A Population-Scale COVID-19 Testing Strategy Combining Point-of-Care Diagnosis with Centralized High-Throughput Sequencing

A Spinach Molecular Beacon Triggered by Strand Displacement

Real-Time NASBA Detection of SARS-Associated Coronavirus and Comparison with Real-Time Reverse Transcription-PCR

Promoter-Independent Activity of T7 RNA Polymerase Suggests a General Model for DNA/RNA Editing in Single Subunit RNA Polymerases

Highly Specific, Multiplexed Isothermal Pathogen Detection with Fluorescent Aptamer Readout

Cell-Free Protein Expression Kit

Impact of Porous Matrices and Concentration by Lyophilization on Cell-Free Expression

Protocols for Implementing an <em>Escherichia Coli</Em> Based TX-TL Cell-Free Expression System for Synthetic Biology

Low-Cost Detection of Norovirus Using Paper-Based Cell-Free Systems and Synbody-Based Viral Enrichment

Enzymatic Assembly of DNA Molecules up to Several Hundred Kilobases

Protein Production by Auto-Induction in High Density Shaking Cultures

Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components

Robust, and Low-Cost Method To Produce the PURE Cell-Free System

Decentralizing Cell-Free RNA Sensing With the Use of Low-Cost Cell Extracts

 27   GATCTGCTGCCGAACCCGCCAAAAACCTGGGAAGAG  ATCCCGGCGCTGGATAAAGAACTGAAAGCGAAAGGT  AAGAGCGCGCTGATGTTCAACCTGCAAGAACCGTAC  TTCACCTGGCCGCTGATTGCTGCTGACGGGGGTTAT  GCGTTCAAGTATGAAAACGGCAAGTACGACATTAAA  GACGTGGGCGTGGATAACGCTGGCGCGAAAGCGGGT  CTGACCTTCCTGGTTGACCTGATTAAAAACAAACAC  ATGAATGCAGACACCGATTACTCCATCGCAGAAGCT  GCCTTTAATAAAGGCGAAACAGCGATGACCATCAAC  GGCCCGTGGGCATGGTCCAACATCGACACCAGCAAA  GTGAATTATGGTGTAACGGTACTGCCGACCTTCAAG  GGTCAACCATCCAAACCGTTCGTTGGCGTGCTGAGC  GCAGGTATTAACGCCGCCAGTCCGAACAAAGAGCTG  GCAAAAGAGTTCCTCGAAAACTATCTGCTGACTGAT  GAAGGTCTGGAAGCGGTTAATAAAGACAAACCGCTG  GGTGCCGTAGCGCTGAAGTCTTACGAGGAAGAGTTG  GTGAAAGATCCGCGGATTGCCGCCACTATGGAAAAC  GCCCAGAAAGGTGAAATCATGCCGAACATCCCGCAG  ATGTCCGCTTTCTGGTATGCCGTGCGTACTGCGGTG  ATCAACGCCGCCAGCGGTCGTCAGACTGTCGATGAA  GCCCTGAAAGACGCGCAGACTAATTCGAGCTCGAAC  AACAACAACAATAACAATAACAACAACCTCGGGATC  GAGGGAAGGATTTCAGAATTCGGATCCtcggaaaac  ctgtattttcagggcagcggcagcggcATGACAATG  ATAACTGATTCACTAGCTGTAGCGCGTACCGATAGA  CCGAGCCAGCAACTGCGTAGCCTCAACGGCGAATGG  CGTTTCGCGTGGTTTCCGGCACCGGAAGCCGTTCCG  GAAAGCTGGTTGGAATGTGATCTGCCGGAGGCCGAT  ACCGTTGTGGTGCCGAGCAATTGGCAGATGCATGGT  TACGATGCCCCGATTTATACCAATGTTACCTATCCG  ATCACCGTTAACCCACCGTTCGTGCCGACGGAAAAC  CCGACCGGTTGTTATAGCCTGACGTTTAACGTTGAT  GAGTCTTGGCTCCAGGAAGGTCAGACCCGCATCATC  TTTGACGGCGTGAACTCTGCGTTTCACCTGTGGTGC  AATGGCAGGTGGGTTGGTTACGGTCAGGATAGCCGC  CTGCCGTCCGAGTTCGACCTGTCCGCGTTCCTGCGC  GCGGGTGAAAACCGTCTGGCCGTTATGGTCCTGCGC  TGGTCAGACGGTTCCTATCTGGAAGATCAGGATATG  TGGCGTATGTCTGGTATTTTCCGCGACGTCTCTTTG  CTGCACAAACCTACGACGCAGATTAGCGACTTCCAT  GTTGCGACCCGCTTCAACGATGACTTCAGCCGTGCT  GTGTTGGAAGCGGAGGTACAAATGTGCGGTGAACTG  AGAGATTACCTGCGCGTTACCGTGAGCCTGTGGCAG  GGCGAGACGCAAGTTGCTAGCGGTACCGCGCCGTTT  GGTGGCGAGATTATTGACGAGAGAGGTGGGTACGCA  GACCGTGTCACGCTGCGTCTGAATGTTGAGAACCCG  AAGCTGTGGAGCGCCGAGATCCCGAACCTGTACCGT  GCAGTCGTAGAACTGCACACCGCGGACGGCACCCTG  ATCGAGGCCGAAGCCTGCGACGTGGGCTTCCGCGAG  GTTCGTATCGAAAACGGTTTGCTGCTTCTCAACGGC  AAACCGTTATTGATCCGTGGTGTTAACCGTCACGAA  CATCATCCGTTGCACGGTCAGGTGATGGATGAGCAG  ACCATGGTGCAGGACATTCTGCTGATGAAACAAAAC  AACTTTAACGCTGTGCGTTGCTCCCACTACCCGAAC  CACCCATTATGGTATACGCTGTGCGATCGCTATGGT  CTGTACGTGGTGGACGAGGCTAATATCGAGACGCAT  GGCATGGTTCCGATGAATCGTCTTACTGACGACCCG  CGTTGGTTGCCTGCAATGAGTGAACGTGTTACCCGT  ATGGTTCAACGTGATCGTAATCATCCGTCTGTGATC