key: cord-0430256-rodw6t4i
authors: Lee, W. L.; Gu, X.; Armas, F.; Chandra, F.; Chen, H.; Wu, F.; Leifels, M.; Xiao, A.; Chua, F. J. D.; Kwok, G. W.; Jolly, S.; Lim, C. Y. J.; Thompson, J.; Alm, E. J.
title: Quantitative SARS-CoV-2 tracking of variants Delta, Delta plus, Kappa and Beta in wastewater by allele-specific RT-qPCR
date: 2021-08-06
journal: nan
DOI: 10.1101/2021.08.03.21261298
sha: c71ff1c29d51aa1a84927d2326bb7f3c03233ec9
doc_id: 430256
cord_uid: rodw6t4i

The Delta (B.1.617.2) variant has caused major devastation in India and other countries around the world. First detected in October 2020, it has now spread to more than 100 countries, prompting WHO to declare it as a global variant of concern (VOC). The Delta (B.1.617.2), Delta plus (B.1.617.2.1) and Kappa (B.1.617.1) variants are all sub-lineages of the original B.1.617 variant. Prior to the inception of B.1.617, vaccine rollout, safe-distancing and timely lockdowns greatly reduced COVID-19 hospitalizations and deaths. However, the Delta variant, allegedly more infectious and for which existing vaccines seemed less effective, has catalyzed the resurgence of cases. Therefore, there is an imperative need for increased surveillance of the B.1.617 variants. Efforts have been made to utilize wastewater-based surveillance for community-based tracking of SARS-CoV-2 variants, however wastewater with its low SARS-CoV-2 viral titers and mixtures of viral variants, requires assays to be variant-specific yet accurately quantitative for meaningful interpretation. Following on the design principles of our previous assays for the Alpha variant, here we report allele-specific RT-qPCR assays targeting mutations T19R, D80A, K417N, T478K and E484Q, for quantitative detection and discrimination of the Delta, Delta plus, Kappa and Beta variants in wastewater. This method is open-sourced and can be implemented using commercially available RT-qPCR protocols, and would be an important tool for tracking the spread of B.1.617 and the Beta variants in communities.

). Kappa ( B.1.617.1) and Delta (B.1.617.2) variants first emerged in India in October, 2020 (PHE, 2021 . The Delta variant has been predicted to be 40-60 % more transmissible than the Alpha variant (Mahase, 2021; PHE, 2021) . In comparison to the Alpha variant, the Delta variant is more resistant to vaccine-and infection-induced immunity (Lustig et al., 2021; Bernal et al., 2020) , with reduced sensitivity to antibody neutralization (Planas et al., 2021a) . The Delta variant has spread rapidly to 104 countries, catalysing waves of COVID-19 infections worldwide (WHO, 2021) . In mid March 2021, sequences of the Delta variant with a mutation K417N in the spike protein were detected. This was dubbed the Delta plus (B.1.617.2.1) variant. This K417N mutation is also present in the VOC Beta (B.1.351), which was first discovered in South Africa in 2020 and now reported in 123 countries. While its global prevalence has fallen in the presence of the Delta variant, there remains vigilance on the spread of the Beta variant due to it being more vaccine-resistant than others in circulation (Planas et al., 2021b , Charmet et al., 2021 .

The emergence of VOCs and VOIs means that tracking their introduction and spread in populations becomes essential to manage the pandemic. This has mainly been performed via genomic sequencing of clinical samples (Behrmann and Spiegel, 2020) .

However genomic sequencing of individual clinical samples is expensive and requires specialized infrastructure (Gwinn et al., 2019) . Furthermore, for effective surveillance, a significant fraction of infected individuals need to be tested. A companion to clinical surveillance is wastewater-based surveillance, which has been shown to be effective at capturing temporal trends in viral circulation during this COVID-19 pandemic (Hassard et al., 2021; Thompson et al., 2020; Wu et al., 2020a) . Current mainstream methods for variant tracking in wastewater rely on enriching and sequencing of the environmental SARS-CoV-2 genome (Napit et al., 2021 , Crits-Christoph et al., 2021 Fontenele et al., 2021) . This method, constrained by the same bottlenecks of cost and infrastructure requirement as clinical sequencing, is further hampered by challenges in detection of low-frequency variants and is poorly quantitative due to the lack of robust modelling to quantify variant titers (Fuqua et al., 2021; Van Poelvoorde et al., 2021) . RT-qPCR-based methods have been developed for variant identification in clinical samples (Clark et al., 2021; Vogels et al., 2021; Wang et al., 2021) but are not yet validated for quantification of variant mixtures, which are expected in wastewater samples. This motivates the development of specialized methods for quantification of variant mixtures in environmental samples such as wastewater (Graber et al., 2021; Yaniv et al., 2021a Yaniv et al., , 2021b Wurtzer et al., 2021 ) . While RT-qPCR methods cannot discover new variants or identify variants beyond what they are designed for, they are more sensitive and quantitative, providing a readout from sample to data, in just hours.

In our previous work, we developed and validated Allele-Specific RT-qPCR (AS RT-qPCR) assays for quantitative detection of Alpha variant B.1.1.7 in wastewater, tracking its occurrence over time in 19 communities across the United States .

Here, we develop a similar AS RT-qPCR-based assay for the tracking of the Delta, Delta plus, Kappa and Beta variants by targeting five loci -T19R, D80A, K417N, T478K and E484Q that would identify and differentiate these variants . These assays could be performed as individual reactions or for increased throughput, as triplexes. The AS RT-qPCR assay for variant tracking is easily implementable in the conventional RT-qPCR based surveillance workflow commonly used worldwide.

Following the methodology established in our previous study demonstrating single nucleotide discrimination for mutations associated with the SARS-CoV-2 Alpha variant , we developed an Allele-Specific RT-qPCR (AS RT-qPCR) panel for tracking mutations indicative of the SARS-CoV-2 variants Delta (B.1.617.2), Delta plus ( B.1.617.2.1) , Kappa (B.1.617.1) and Beta (B.1.351) and validated this approach for synthetic mixtures of Beta and Kappa VOC RNA in a wastewater RNA matrix (Delta assay validation is currently in progress, subject to availability of commercial RNA standards). To design allele specific primers we screened a panel of primers targeting mutations characteristic of four variants -Delta, Delta plus, Kappa and Beta, and identified primers targeting five loci -T19R, D80A, K417N, T478K and E484Q as having optimal sensitivity and specificity. These five targets are highly predictive for detection and discrimination of Delta, Delta plus, Kappa and Beta variants among currently circulating strains ( Figure 1 ) is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101 https://doi.org/10. /2021 We tabulated the presence of these mutations across SARS-CoV-2 variants (Table   1 ) Assays can be run as individual singleplex assays ( Figure 1 ) or for increased throughput, as triplex assays depending on the variants to be tracked ( Figure 2 is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint 

Here we present analytical validation of the sensitivity and specificity of these five pairs of primer-probe sets. Setups are shown in Table 3 . To improve readability, primers targeting WT are indicated as the amino acid, followed by the position of the amino acid in the protein sequence i.e. T19, D80, K417, T478 and E484 while primers targeting the variants are indicated by a suffix designating the mutant residue i.e. T19R, D80A, K417N, T478K and E484Q. Loci are respectively named T19/R, D80/A, K417/N, T478/K and E484/Q to refer to the loci on both WT and mutant sequences.

We examined the specificity of the AS RT-qPCR assays for Beta and Kappa variant loci D80/A, K417/N and E484/Q by screening them against their respective WT and mutant genome targets in the SARS-CoV-2 RNA ( Figure 3 ). Specificity data for T19/R and T478/K . CC-BY 4.0 International license It is made available under a perpetuity.

is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint is shown in Figure 4 . Synthetic RNA of the Beta variant was used for D80A and K417N, and Kappa RNA for E484Q. The amplification efficiency of each primer and probe set were between 89.3 to 104% for the correct RNA (i.e. Kappa assay for Kappa RNA, Beta assay for Beta RNA and WT assay for WT RNA). All three assays for mutant sequences and two of three assays for WT sequences were highly specific with cross reactivity only observed at or above 10 3 copies of non-target sequence per PCR. WT assay K417 had lower specificity indicating cross reactivity at 10 2 RNA copies of the mutant genotype. All assays were sufficiently specific to support quantification of mixtures at concentrations of SARS-CoV-2 RNA commonly observed in wastewater RNA preparations (Wu et al., 2020a (Wu et al., , b, 2021 .

. CC-BY 4.0 International license It is made available under a perpetuity.

is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; 

As commercial Delta variant RNA was not available in the laboratory at the time of this work, primers targeting Delta variant loci T19/R and T478/K were validated against synthetic DNA containing WT and variant sequences ( Figure 4a ) (DNA sequences shown in Table 5 ) and full length synthetic WT RNA ( Figure 4b ). The assays targeting T478/K appeared more specific than those targeting T19/R, though all remain discriminant up to at least 10 2 copies of DNA of the opposite genotype. Screening against WT RNA ( Figure 4b ), the amplification efficiencies for the T19 and T478 primers were between 74.0-98.2%.

Mutant primers targeting T19R and T478K did not cross react with up to 10 3 copies of WT RNA. is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint Exact concentrations of synthetic DNA and RNA were obtained by ddPCR and RT-ddPCR respectively. Data shown reflect two sets of independent measurements taken on different days. Colored symbols represent tests against the matching genotype (WT-specific primers to WT DNA and mutant specific primers to mutant DNA) and grey symbols denote tests against DNA of the opposite genotype. Diamonds and squares denote tests using primers designed to target WT and variant templates respectively. qPCR and RT-qPCR efficiencies and y-intercept cycle threshold (Ct) values were calculated for the primers against their respective RNA target sequences and shown in the table.

The validation so far suggests most primer-probe sets to be discriminant, with minimal cross-reactivity against at least 10 2 copies of the opposite genotype. To improve throughput of these assays, we explored which of these primer-probe sets could be multiplexed by combining primers targeting WT loci in the same reaction and primers targeting mutant loci in the other reaction. We found that K417/N and E484/Q cannot be combined in the same multiplex due to primer interference. Further, while primers targeting T478/K were more specific than those for T19/R for identifying the Delta variant, only the latter was incorporated into the triplex assays given overlapping primers, with T478/K being very close in proximity to E484Q.

As such, we developed two triplexes ( Figure 2, Table 4 ). The first triplex (Triplex 1) can identify Kappa (E484Q), Delta (including Delta plus) (T19R) and Beta (D80A) variants within the same reaction. Triplex 2 can identify and differentiate Delta (T19R), Delta plus (T19R, K417N) and Beta (D80A, K417N) variants, using D80A to differentiate Delta plus from the Beta variant. Amplification efficiencies between the singleplex and the two triplexes appeared similar for most of the loci ( Figure 5 and 6 ). is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint We tested the singleplex and triplex assays in a mixture of WT, Beta and Kappa RNA in the presence and absence of wastewater RNA derived from SARS-CoV-2 negative wastewater. We confirm no amplification with the singleplex and triplex assays targeting Beta, Kappa and Delta variants against wastewater RNA without adding synthetic SARS-CoV-2 RNA. Both the assays (singleplex and triplex) were able to robustly detect synthetic SARS-CoV-2 variant RNA, down to an abundance of 2.5% against a backdrop of 1000 SARS-CoV-2 RNA copies. Similar Ct values were acquired in both assays, when conducted in the presence or absence of wastewater RNA. On average, SARS-CoV-2 RNA derived across wastewater samples tend to be below 10 3 viral copies per ml, which gives rise to less than 10 3 viral RNA per RT-qPCR reaction (Wu et al., 2020a (Wu et al., , b, 2021 . This confirms that the singleplex and multiplex assays are specific and quantitative in wastewater RNA.

. CC-BY 4.0 International license It is made available under a perpetuity.

is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint

The present study presents five assays that could be applied to detecting and differentiating SARS-CoV-2 variants Delta (B.1.617.2), Delta plus (B.1.617.2.1), Kappa (B.1.617.1) and Beta (B.1.351) in wastewater. We followed the screening and validation strategy developed in our previous work on the alpha variant to yield reliable assays that enable discrimination of single nucleotide mutations . Primer-probe sets were developed for targeting both WT and mutant sequences on loci T19/R, D80/A, K417/N, T478/K and E484/Q. To increase throughput, we propose primer-probe sets that could be combined into triplexes for parallel interrogation of more loci within the same reaction. One of these triplexes enables detection of the Delta, Kappa and Beta variants while the other detects and discriminates Delta and Beta from Delta plus variants. We confirm low cross-reactivity for all the primers to at least 10 2 copies of RNA of the opposite genotype and similar quantitative performance of singleplex and triplex assays.

Assays for T19/R and T478/K were only validated on synthetic DNA carrying WT and mutant sequences and synthetic WT RNA. Amplification efficiencies were only derived for T19/R and T478/K against synthetic WT RNA and not Delta variant RNA. However WT and mutant assays differ by only a single nucleotide and hybridization kinetics should be similar.

Nonetheless detailed analytical validation against the Delta variant RNA will be performed and reported as an update to this preprint.

In this work, we developed primer-probe sets targeting both WT and mutant loci, though variant detection and quantitation would only require performing the reactions targeting the mutant loci. As shown in our previous manuscript , quantification of both WT and mutant loci in wastewater enables determination of the proportion of WT to variant sequence at each target loci. Validation of the assays reported herein in SARS-CoV-2 positive wastewater is commencing and will be reported when available. This work expands on the utility of AS RT-qPCR for the quantitative detection of variants in wastewater for population-based tracking of SARS-CoV-2 variants.

. CC-BY 4.0 International license It is made available under a perpetuity.

is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ;

We designed AS RT-qPCR reactions to detect five non-synonymous single nucleotide variants in the spike gene. Primers and probes were designed following our previous work and using the Integrated DNA Technologies (IDT)'s PrimerQuest Tool.

Target mutations were placed at the 3' end of either the forward or reverse primer. All primers were designed to have a melting temperature in the range of 59-65°C and the probes in the range of 64-72°C. Probes were designed to anneal to the same strand as the AS primer, with the probe as close to the 3′-end of the AS primers as possible. Guanines are avoided at the 5′-end of the probe. AS primers were designed to include an artificial mismatch near the 3' terminal nucleotide to improve discrimination. All primers and probes were purchased from IDT ( Table 2 ) . is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; Table 3 . The AS RT-qPCR panel for identification and discimination of Delta, Delta plus, Kappa and Beta variants. is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101 https://doi.org/10. /2021 DNA standards and their quantification by ddPCR DNA standards were synthesised by IDT. Sequences (shown in Table 5 ) were designed to span the primer and probe sets of each assay and then concatenated into a single sequence. This DNA were quantified using ddPCR Supermix for Probes #1863026 (Bio-Rad) following manufacturer's recommendations. Reaction mixtures consisted of 10 μl of 2× Supermix, 900nM primers, 250 nM probe, 1 μl of DNA, topped up with molecular grade water to a final volume of 20 μl. A Bio-Rad QX200 ddPCR droplet generator (Bio-Rad, USA) was used to convert the reaction mix into droplets. Thermal cycling was performed on a Bio-Rad CFX96 as follows: 10 min at 95˚C, followed by 40 cycles of 30 s at 94˚C and 1 min at 60˚C (ramp rate of 2°C/sec), followed by enzyme inactivation at 98˚C for 10 min and holding at 4˚C. °C) A single reverse or forward primer and probe was used with each set of allele-specific forward or reverse primers ( Table 3 )

Twist synthetic SARS-CoV-2 RNA Controls, control 2 (Wuhan-Hu-1), control 16 (South Africa/KRISP-EC-K005299/2020), control 18 (India/CT-ILSGS00361/2021), were used as RNA standards, representing WT, Beta (B.1.351) and Kappa (B.1.617.1) variants respectively. RNA standards were prepared as single-use aliquots. Controls 2, 16, and 18 were quantified by digital droplet PCR (ddPCR) to be 4.11 × 10 5 , 8.08 × 10 5 , and 3.24 × 10 5 copies/μL, respectively. Quantification was performed using One-Step RT-ddPCR Advanced Kit for Probes #1864022 (Bio-Rad) following manufacturer's recommendations. is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint

AS RT-qPCR was performed using the Taqman Virus 1-Step master mix (Thermofisher #4444434) with technical duplicates, at a final volume of 10 µL, according to the manufacturer's recommendations. For singleplex reactions, a single reverse or forward primer and probe was used with each set of allele-specific forward or reverse primers ( Table 3 ). The final concentration of the AS RT-qPCR primers were 500 nM, probe at 200 nM, with 1 µL of template. Multiplex reactions were set up with wild-type targeting primer-probe sets in the same reaction, and mutation targeting primer-probe sets in the other reaction, as shown in Table 4 , with final concentration of each AS RT-qPCR primer as 500 nM and probe at 200 nM. No template controls were included for each assay and none of them amplified. The reactions are setup using electronic pipettes (Eppendorf) and performed on a Bio-Rad CFX384 real-time PCR instrument under the following conditions , 5 min at 50 °C and 20 s at 95 °C, followed by 45 cycles of 3 s at 95 °C and 30 s at 60 °C. WT-T19R-G142D -L452R-T478K-P 681R-D950N   TGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCA  GAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGT  TTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTC  AGGACTTGTTCTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTA  CTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTT  CAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAA  CAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAAT  AATTGCACTTTTGAATATGTCTCTCAGCCTTTTCCAGGGCAAACTG  GAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGC  TGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTG  GTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAAC  CTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCAC  ACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAAT  CATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAG  AGTAGTAGTACCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGG  GCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCAC  TTGGTGCACCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGAC  TCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTG  GTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTA  GCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATCCTTTCA  CGTCTTGACAAAGTTGAGGCTGAAGTGCAAAT  961 . CC-BY 4.0 International license It is made available under a perpetuity.

is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021. ; https://doi.org/10.1101/2021.08.03.21261298 doi: medRxiv preprint

Data was analysed using Microsoft Excel and Graphpad prism. Graphs were presented using Graphpad Prism.

Source data will be made available upon request.

EJA is an advisor to Biobot Analytics and holds shares in the company. TGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTAGAACCA  GAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTT  TATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCA  GGACTTGTTCTTGGTACTACTTTAGACTCGAAGACCCAGTCCCTAC  TTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCA  ATTTTGTAATGATCCATTTTTGGATGTTTATTACCACAAAAACAACAA  AAGTTGGATGAAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATT  GCACTTTTGAATATGTCTCTCAGCCTTTTCCAGGGCAAACTGGAAA  GATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGT  TATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTA  TAATTACCGGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGA  GAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCAAACCTTGT  AATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGT  TTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAG  TACCTAGTTATCAGACTCAGACTAATTCTCGTCGGCGGGCACGTAG  TGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAC  CAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTT  CCACAGCAAGTGCACTTGGAAAACTTCAAAATGTGGTCAACCAAA  ATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTT  GGTGCAATTTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAA  AGTTGAGGCTGAAGTGCAAAT  961 . CC-BY 4.0 International license It is made available under a perpetuity.

is the author/funder, who has granted medRxiv a license to display the preprint in (which was not certified by peer review) preprint

The copyright holder for this this version posted August 6, 2021.

through an RCE award to Singapore Centre for Environmental Life Sciences Engineering (SCELSE).

EJA and JT conceptualized the project. WLL designed the experiments. WLL, XG, FA, FC, HC, FW, ML, AX, SJ and CYJL analyzed the data. WLL, FJDC, SJ and CYJL performed experiments. All authors contributed to writing the manuscript. WLL, JT and EJA supervised the project. All authors read and approved the manuscript.

COVID-19: from rapid genome sequencing to fast decisions

Effectiveness of COVID-19 vaccines against the B.1.617.2 variant

SARS-CoV-2 Variant Classifications and Definitions

Multiplex Fragment Analysis Identifies SARS-CoV-2 Variants

High-throughput sequencing of SARS-CoV-2 in wastewater provides insights into circulating variants

A rapid assessment of wastewater for genomic surveillance of SARS-CoV-2 variants at sewershed scale in Louisville

An allele-specific primer extension assay to quantify the proportion of B.1.1.7-specific SARS-CoV-2 RNA in wastewater

Next-Generation Sequencing of Infectious Pathogens

Innovation in wastewater near-source tracking for rapid identification of COVID-19 in schools

Genetic Variants of SARS-CoV-2-What Do They Mean?

Tracking in Wastewater by Allele-Specific RT-qPCR

Neutralising capacity against Delta (B.1.617.2) and other variants of concern following

BioNTech/Pfizer) vaccination in health care workers

Delta variant: What is happening with transmission, hospital admissions, and restrictions?

Rapid genomic surveillance of SARS-CoV-2 in a dense urban community using environmental (sewage) samples. medRxiv

SARS-CoV-2 variants of concern and variants under investigation in England

Sensitivity of infectious SARS-CoV-2 B.1.1.7 and B.1.351 variants to neutralizing antibodies

Reduced sensitivity of SARS-CoV-2 variant Delta to antibody neutralization

Making waves: Wastewater surveillance of SARS-CoV-2 for population-based health management

Strategy and performance evaluation of low-frequency variant calling for SARS-CoV-2 in wastewater using targeted deep Illumina sequencing

Multiplex qPCR discriminates variants of concern to enhance global surveillance of SARS-CoV-2

CoV-2 Genotyping PCR for Population-Level Variant Screening and Epidemiologic Surveillance

Weekly epidemiological update on COVID-19 -6

Situational Update

SARS-CoV-2 titers in wastewater foreshadow dynamics and clinical presentation of new COVID-19 cases

Titers in Wastewater Are Higher than Expected from Clinically Confirmed Cases. mSystems

Wastewater surveillance of SARS-CoV-2 across 40 U.S. states from February to

Monitoring the propagation of SARS CoV2 variants by tracking identified mutation in wastewater using specific RT-qPCR

SARS-CoV-2 variants of concern, Gamma (P.1) and Delta (B.1.617), sensitive detection and quantification in wastewater employing direct RT-qPCR

RT-qPCR assay for detection of British (B.1.1.7) and South Africa (B.1.351) variants of SARS-CoV-2

Comment] The COVID-19 pandemic as a scientific and social challenge in the 21st century

We thank members of the Biobot Analytics, Inc team for helpful discussions.