key: cord-0326479-5axbadmw
authors: Verplaetse, Emilie; André-Leroux, Gwenaëlle; Duhutrel, Philippe; Coeuret, Gwendoline; Chaillou, Stéphane; Nielsen-Leroux, Christina; Champomier-Vergès, Marie-Christine
title: Heme uptake in Lactobacillus sakei evidenced by a new ECF-like transport system
date: 2019-12-06
journal: bioRxiv
DOI: 10.1101/864751
sha: da2f823542eda7811615932f6af690ea1b67f8d5
doc_id: 326479
cord_uid: 5axbadmw

Lactobacillus sakei is a non-pathogenic lactic acid bacterium and a natural inhabitant of meat ecosystems. Although red meat is a heme-rich environment, L. sakei does not need iron or heme for growth, while possessing a heme-dependent catalase. Iron incorporation into L. sakei from myoglobin and hemoglobin was formerly shown by microscopy and the L. sakei genome reveals a complete equipment for iron and heme transport. Here, we report the characterization of a five-gene cluster (lsa1836-1840) encoding a putative metal iron ABC transporter. Interestingly, this cluster, together with a heme dependent catalase gene, is also conserved in other species from the meat ecosystem. Our bioinformatic analyses revealed that the locus might refer to a complete machinery of an Energy Coupling Factor (ECF) transport system. We quantified in vitro the intracellular heme in wild-type (WT) and in our Δlsa1836-1840 deletion mutant using an intracellular heme sensor and ICP-Mass spectrometry for quantifying incorporated 57Fe heme. We showed that in the WT L. sakei, heme accumulation occurs fast and massively in the presence of hemin, while the deletion mutant was impaired in heme uptake; this ability was restored by in trans complementation. Our results establish the main role of the L. sakei Lsa1836-1840 ECF-like system in heme uptake. This research outcome shed new light on other possible functions of ECF-like systems. Importance Lactobacillus sakei is a non-pathogenic bacterial species exhibiting high fitness in heme rich environments such as meat products, although it does not need iron nor heme for growth. Heme capture and utilization capacities are often associated with pathogenic species and are considered as virulence-associated factors in the infected hosts. For these reasons, iron acquisition systems have been deeply studied in such species, while for non-pathogenic bacteria the information is scarce. Genomic data revealed that several putative iron transporters are present in the genome of the lactic acid bacterium L. sakei. In this study, we demonstrate that one of them, is an ECF-like ABC transporter with a functional role in heme transport. Such evidence has not yet been brought for an ECF, therefore our study reveals a new class of heme transport system.

sakei from myoglobin and hemoglobin was formerly shown by microscopy and the L. sakei 23 genome reveals a complete equipment for iron and heme transport. Here, we report the 24 characterization of a five-gene cluster (lsa1836-1840) encoding a putative metal iron ABC 25 transporter. Interestingly, this cluster, together with a heme dependent catalase gene, is also 26 conserved in other species from the meat ecosystem. Our bioinformatic analyses revealed 27 that the locus might refer to a complete machinery of an Energy Coupling Factor (ECF) 28 transport system. We quantified in vitro the intracellular heme in wild-type (WT) and in our 29

Dlsa1836-1840 deletion mutant using an intracellular heme sensor and ICP-Mass 30 spectrometry for quantifying incorporated 57 Fe heme. We showed that in the WT L. sakei, 31 heme accumulation occurs fast and massively in the presence of hemin, while the deletion 32 mutant was impaired in heme uptake; this ability was restored by in trans complementation. Due to the conservation of the operon lsa1836-1840, each of the five sequences was analyzed 205 comprehensively using bioinformatics. It includes multiple sequence alignment, as well as 3D 206 structure, proteins network and export peptide predictions. Lsa1836 shows a sequence 207 similarity of more than 30%, associated to a probability above 99% with an e-value of 8. e -15 , 208 to share structural homology with the membrane-embedded substrate-binding protein 209 component S from an ECF transporter of the closely related L. brevis, as computed by 210

HHpred (44). Accordingly, its sequence is predicted to be an integral membrane component 211 with six transmembrane helices, and a very high rate of hydrophobic and apolar residues, 212 notably 11 tryptophan amino-acid residues among the 230 residues of the full-length protein 213 ( Fig. 2A) . HHpred analysis indicates that Lsa1837 shares more than 50 % sequence similarity 214 with the ATPase subunits A and A' of the same ECF in L. brevis ( Fig. 2A) . With 100% of 215 probability and a e-value of 1. e -35 , Lsa1837 describes two repetitive domains, positioned at 9-216 247 and 299-531, where each refers structurally to one ATPase very close in topology to the 217 solved ATPase subunits, A and A' of ECF from L. brevis, respectively. Appropriately, the N-218 terminal and C-terminal ATPases, are predicted to contain an ATP-binding site. Lsa1837 219 could correspond to the fusion of ATPase subunits, A and A'. Protein Lsa1838 shows 220 sequence similarity of above 30%, with a probability of 100 % and e-value of 1. e -30 , to share 221 structural homology with the membrane-embedded substrate-binding protein component T 222 from the ECF transporter of L. brevis ( Fig. 2A) . Interestingly, similar bioinformatic analysis 223 of sequence and structure prediction demonstrates that Lsa1839 and Lsa1840 share both 224 99.8% structural homology, and e-value of 1. e -24 and of 1. e -21 , with the b and a domains of 225 human transcobalamin, respectively ( Fig. 2A) . Consistently, both proteins have an export 226 signal located at their N-terminal end. Taken together, these results predict with high 227 confidence that the transcriptional unit encodes the complete machinery of an ECF, including 228 the extracellular proteins that initiate the scavenging of iron-containing heme ( Fig. 2A) . Each 229 protein compartment is predicted through the presence/absence of its signal peptide as being 230 extracellular, embedded in the membrane or cytosolic. Correspondingly, every protein 231 sequence associates appropriate subcellular location with predicted function. In line with that, 232 the network computed by String for the set of proteins of the operon shows that they interact 233 together from a central connection related to Lsa1837, which corresponds to the ATP-motor 234 couple of ATPases (45). The transcriptional unit also encompasses Lsa1839 and Lsa1840, 235 highly homologous to b and a subunits of transcobalamin respectively, that are highly 236 hypothesized to initiate the scavenging of heme from the extracellular medium. To address 237 the capacity of those subunits of transcobalamin-like binding domain to bind a heme moiety, 238

we homology-modeled Lsa1839 and Lsa1840. We then assembled the biological unit 239 composed of the heterodimer formed by b and a subunits, using the related 3D templates of 240 corresponding subunit of haptocorrin and transcobalamin. Subsequently, an iron-containing 241 heme moiety was docked into the groove, located at the interface of the complex formed by 242 the two proteins. The redocking of cobalamin in haptocorrin and cyanocobalamin in 243 transcobalamin shows a binding energy of -17 and -12 kcal/mol, respectively (Fig. 2B ). With 244 a binding energy of -9 kcal/mol, the heme bound to the crevice formed by Lsa1839 and 245

Lsa1840 displays an affinity in the same range than the endogenous ligands, and emphasizes 246 that the assembly composed of Lsa1839 and Lsa1840 could be compatible with the 247 recognition and binding of a heme (Fig. 2B ). To resume, Lsa1836-1840 describes a complete 248 machinery that could be able to internalize a heme instead or additionally to a cobalamin 249 molecule. Importantly, this operon includes also the extracellular scavenging band a-like 250 subunits of transcobalamin, which advocates for that the S-component Lsa1836 is possibly 251 very specific for iron-containing heme. In line with that, despite a closely conserved fold, the 252 S-component does not display the strictly conserved residues known to bind cobalt-containing 253

No heme synthesis enzymes are present in L. sakei genome, nevertheless a gene coding for a 255 putative heme-degrading enzyme of the Dyp-type peroxidase family, lsa1831, was identified 256 in the L. sakei genome. Its structure is predicted to be close to DypB from Rhodococcus jostii 257 (46). Interestingly, residues of DypB involved in the porphyrin-binding, namely Asp153, 258

His226 and Asn246, are strictly conserved in Lsa1831 (47). Markedly, the lsa1831 gene is 259 located upstream of the lsa1836-1840 operon putatively involved in the active heme transport 260 across the membrane. To confirm the above transporter as involved in heme trafficking across the membrane, a 269 lsa1836-1840 deletion mutant was constructed by homologous recombination. The L. sakei 270

Dlsa1836-1840 mutant was analyzed for its capacity to internalize heme using an intracellular 271 heme sensor developed by . This molecular tool consists in a 272 multicopy plasmid harboring a transcriptional fusion between the heme-inducible promoter of 273 hrtR, the hrtR coding sequence and the lacZ reporter gene, the pPhrt hrtR-lac (Table 2 ). In L. 274 13 lactis, HrtR is a transcriptional regulator that represses the expression of a heme export 275 system, HrtA and HrtB, as well as its own expression in the absence of heme. Upon heme 276 binding, the repression is alleviated allowing the expression of the export proteins (24). As L. 277 sakei possesses the lacLM genes, it was necessary to construct the Dlsa1836-1840 mutant in 278 the L. sakei RV2002 strain, a L. sakei 23K ∆lacLM derivative, yielding the RV4057 strain 279

( Table 2 ). The pPhrt hrtR-lac was then introduced in the RV2002 and RV4057 strains, yielding 280 the RV2002 hrtR-lac and the RV4057 hrtR-lac strains ( Table 2) . β-Galactosidase (β-Gal) 281 activity of the RV4057 hrtR-lac strain grown in a chemically defined medium (MCD) (48) in 282 the presence of 0.5, 1 and 5 µM hemin was determined and compared to that of the RV2002 283 hrtR-lac used as control (Fig. 4A ). We showed that hemin reached the intracellular 284 compartment as β-Gal expression was induced by hemin. Relative β-Gal activity of the 285 RV4057 hrtR-lac mutant strain showed a slight increase as compared to the WT at 0.5 µM 286 heme but a statistically significant two-fold reduction was measured at 1 µM heme and 287 further, a 40% reduced activity was shown at higher hemin concentration. This indicates that 288 the intracellular abundance of heme is significantly reduced in the RV4057 bacterial cells at 1 289 and 5 µM heme, while it is similar to the WT at low heme concentrations. The method 290 described above did not allow to quantify the absolute amount of heme incorporated by 291 bacteria as only cytosolic heme may interact with HrtR. Therefore, we used hemin labeled 292 with the rare 57 iron isotope ( 57 Fe-Hemin) combined with Inductively Coupled Plasma Mass 293 Spectrometry (ICP-MS) to measure with accuracy the total heminic-iron content of cells. 294

Quantification of 57 Fe was used as a proxy to quantify heme. The absolute number of heme 295 molecules incorporated by the ∆lsa1836-1840 mutant was also quantified using 57 Fe-hemin. 296

The ∆lsa1836-1840 mutant was constructed in the WT L. sakei 23K genetic background to 297 obtain the RV4056 strain (Table 2) . Bacteria were incubated in the MCD, in the absence or in 298 the presence of 1, 5 or 40 µM of 57 Fe-hemin. ICP-MS quantification indicated that the 57 Fe 299 content of the two strains was similar at 1 µM 57 Fe-hemin. A 5-fold reduction in the 57 Fe 300 content of the RV4056 strain was measured at 5 µM heme concentrations and a 8-fold at 40 301 µM heme, by comparison with the WT (Fig. 4B) . 302

To confirm the major role of the lsa1836-1840 gene products in heme acquisition, we 303 analyzed the 57 Fe content of the RV4056 strain harboring the pPlsa1836-1840, a multicopy 304 plasmid that expresses the lsa1836-1840 operon under its own promoter, and compared it to 305 the WT. The quantification of the 57 Fe atoms in the RV4056 pPlsa1836-1840 bacteria shows 306 a 1.3 time and a 7 times higher iron content at 5 and 40 µM 57 Fe-hemin, respectively, by 307 comparison with measurements done on WT bacteria (Fig. 4C) . 308

These experiments confirm that the Lsa1836-1840 system is involved in vitro in the active 309 incorporation of heme in L. sakei. 310 311

We then addressed the ability for L. sakei to consume heme or iron to survive. We knew from 313 a previous study that L. sakei incorporates preferentially heminic-compounds from the 314 medium, probably as an adaptation to its meat environment (13). Data obtained previously 315

showed that the incorporation of heme molecules are qualitatively correlated with both the 316 concentration of heme in the growth medium, and the survival properties of the bacteria in 317 stationary phase, suggesting that L. sakei could use heme or iron for its survival (See 318

Supplemental text, Fig. S1 and S2). Nevertheless, heme incorporation could not be quantified 319 with accuracy in the previous studies. To tackle that, the intracellular heme levels 320 incorporated by L. sakei were quantified. The RV2002 hrtR-lac strain (Table 2 ) was grown in 321 MCD in the presence of increasing concentration of hemin, and the β-Gal activity of cells was 322 measured (Fig. 5A ). We showed that the β-Gal activity increased with the concentration of 323 the hemin molecule in the growth medium. A plateau was reached when cells were grown in 324 0.75 -2.5 µM hemin. Incubation of cells in higher hemin concentrations did not allow to 325 increase further β-Gal activity. 326 327

The absolute number of heme molecules incorporated by L. sakei 23K (Table 2) In L. lactis, the fhuCBGDR operon has been reported to be involved in heme uptake as a 357 fhuD mutant is defective in respiration metabolism, suggesting a defect in heme import (15). 358

A genome analysis of several lactic acid bacteria has revealed that a HupC/FepC heme uptake 359 protein is present in L. lactis, L. plantarum, Lactobacillus brevis and L. sakei (15). This latter 360

in L. sakei 23K may correspond to locus lsa0399 included in a fhu operon. An IsdE homolog 361 has also been reported in L. brevis genome but the identity of this protein has not been 362 experimentally verified (15). 363

The genome analysis of L. sakei 23K (12), when focused on heme/iron transport systems and 364 heme utilization enzymes, led to the identification of several putative iron transport systems, 365 heme transport systems and heme-degrading enzymes. This heme uptake potential is 366 completely consistent within the meat environment-adapted L. sakei. Similarly, the membrane 367 transport system encoded by the lsa1194-1195 genes, whose function is poorly defined, 368 seems to be important for the bacterial physiology as a lsa1194-1195 deletion affects the 369 survival properties of this strain (see Supplemental text, Fig. S3 and Fig. S4) . 370

Meanwhile, here, we report that the transcriptional unit lsa1836-1840 shows exquisite 371 structure/function homology with the cobalamin ECF transporter, a new class of ATP-binding 372 cassette importer recently identified in the internalization of cobalt and nickel ions ( Fig. 2 and  373   Fig. 3) . Indeed, a comprehensive bioinformatics analysis indicates/supports that the lsa1836-374 1840 locus codes for 5 proteins that assemble together to describe a complete importer 375 machinery called Energy Coupling Factor. Any canonical ECF transporter comprises an 376 energy-coupling module consisting of a transmembrane T protein (EcfT), two nucleotide-377 binding proteins (EcfA and EcfA'), and another transmembrane substrate-specific binding S 378 protein (Ecsf). Indeed, Lsa1836-Lsa1838 shows high structural homology with Ecf-S, EcfA- Additionally, we were able to quantify the amount of heme internalized in the three genetic 403 contexts using isotope-labeled hemin and ICP-MS as well as to evaluate the intracellular 404 content of heme using the transcriptional fusion tool. We observed that the intracellular 405 abundance of heme increases with the concentration of heme in the growth medium and can 406 be detected with the intracellular sensor in the 0 -2.5 µM heme range (Fig. 5A) . The drop in 407 the β-gal activity at higher heme concentrations may result from regulation of heme/iron 408 homeostasis either through exportation of heme, degradation of the intracellular heme or 409 storage of the heme molecules, making them unable to interact with HrtR and promoting lacZ 410

repression. However, data obtained with the intracellular sensor at higher heme concentration 411

(5-40 µM) contrast with microscopic observations (Fig. S2) and ICP-MS measurements (Fig.  412 5B) that reported a higher heminic-iron content in cells grown in 40 µM heme than in 5 µM. 413

Indeed, β-gal activity reflecting the abundance of intracellular heme was maximal when cells 414

were grown in a medium containing 1-2.5 µM hemin (Fig. 5A) , while ICP-MS measurements 415 showed a 4.5 fold and 8 fold higher number of 57 Fe atoms in bacteria growing in 5 µM or 40 416 µM 57 Fe-Hemin, respectively, than in 1 µM 57 Fe-Hemin (Fig. 4B) . These data are in good 417 agreement with EELS analysis (Fig. S2) , which strengthens the hypothesis that heme 418 homeostasis occurs in L. sakei and that the incorporated heme molecules would be degraded 419 while iron is stored inside iron storage proteins like Dps, of which orthologous genes exist in 420 L. sakei. Thus iron is detected in L. sakei cells but not bound to heme and unable to interact The different bacterial strains used throughout this study are described in Table 1 . 

Analyses were performed in the sequenced L. sakei 23K genome as described in (12). Each 464 fasta sequence of every gene of the operon comprised between lsa1836 and lsa1840 was 465 retrieved from UnitProtKB server at http//www.uniprot.org/uniprot, uploaded then analyzed 466 using HHpred server (44) that detects structural homologues. For Lsa1839 and Lsa1840, that 467 partly shares strong structural homology with Geranyl-geranyltransferase type-I (pdb id 5nsa, 468 chain A) (51), and b domain of human haptocorrin (pdb id 4kki chain A) (52), intrinsic factor 469 with cobalamin (pdb id 2pmv) (53) and transcobalamin (pdb id 2bb6 chainA) (54) 470 respectively, homology modeling was performed using Modeler, version Mod9v18 (55). The 471 heterodimer was then formed with respect to the functional and structural assembly of a and 472 b domains of the native haptocorrin (52). Upon dimer formation, the best poses for heme 473 within the groove, located at the interface of this heterodimer, were computed using 474 22 2) was transformed by electroporation into the corresponding mother strains. 500

For complementation, a pPlsa1836-1840 plasmid (Table 2 ) was constructed as follows: a 501 DNA fragment encompassing the promoter and the 5 genes of the lsa1836-1840 operon was 502 PCR amplified using the primers pair Lsa1836R/Lsa1840F (Table 3 ). The 5793 bp amplified 503 fragment was cloned into plasmid pRV566 at XmaI and NotI sites. The construct was verified 504 by sequencing the whole DNA insert using the 566-F and 566-R primers (Table 3 ) as well as 505 internal primers. The pPlsa1836-1840 was introduced into RV4056 bacteria by 506 electroporation and transformed bacteria were selected for erythromycin resistance, yielding 507 the RV4056c complemented mutant strain. 508 509 β-galactosidase assay 510

Liquid cultures were usually grown in MCD into exponentially phase corresponding to a A600 511 equal to 0,5-0.8 and then incubated for 1 h at 30°C with hemin at the indicated concentration. 512 β-Galactosidase (β-Gal) activity was assayed on bacteria permeabilized as described. β-Gal 513 activity was quantified by luminescence in an Infinite M200 spectroluminometer (Tecan) 514 using the β-Glo® assay system as recommended by manufacturer (Promega). 515 516

The various strains were grown in MCD to A600 = 0.5-0.7 at 30°C prior to addition or not of 518 0.1, 1, 5 or 40 µM 57 Fe-labelled hemin (Frontier Scientific). Cells were then incubated at 519 30°C for an additional hour and overnight (19 hours). Cells were washed three times in H2O 520 supplemented with 1mM EDTA. Cell pellets were desiccated and mineralized by successive 521 incubations in 65% nitric acid solution at 130°C. 57 Fe was quantified by Inductively Coupled 

Microbial Iron Compounds

Heme 537 and menaquinone induced electron transport in lactic acid bacteria

Iron requirement and search for siderophores 540 in lactic acid bacteria

Genomic identification 542 of meat Lactobacilli as Lactobacillus sake

Protective cultures inhibit growth of 544

Listeria monocytogenes and Escherichia coli O157:H7 in cooked, sliced, vacuum-and gas-545 packaged meat

Modeling Bacteriocin Resistance and 547

Inactivation of Listeria innocua LMG 13568 by Lactobacillus sakei CTC 494 under Sausage 548

Evaluation of meat born lactic acid 550 bacteria as protective cultures for the biopreservation of cooked meat products

Quantification and efficiency of Lactobacillus sakei strain mixtures used as 554 protective cultures in ground beef

Effect of chemicals on the microbial evolution in foods

Total Heme and Non-558

heme Iron in Raw and Cooked Meats

Regulation of the Expression of the Catalase Gene katA of Lactobacillus sakei LTH677

The complete

genome sequence of the meat-borne lactic acid bacterium Lactobacillus sakei 23K

Iron Sources Used by the Nonpathogenic Lactic Acid Bacterium Lactobacillus 568 sakei as Revealed by Electron Energy Loss Spectroscopy and Secondary-Ion Mass 569

Extracellular Heme Uptake and the Challenge of Bacterial 571

Heme Utilization by Heme-Auxotrophic Bacteria

Heme Synthesis and Acquisition in Bacterial Pathogens

Overcoming the Heme Paradox: Heme Toxicity and 578

Tolerance in Bacterial Pathogens

Intracellular metalloporphyrin metabolism in 580 Staphylococcus aureus

Molecular and Evolutionary Analysis 582 of NEAr-Iron Transporter (NEAT) Domains

Structure of a 610 pantothenate transporter and implications for ECF module sharing and energy coupling of 611 group II ECF transporters

Crystal 613 structure of a folate energy-coupling factor transporter from Lactobacillus brevis

A novel class of modular 617 transporters for vitamins in prokaryotes

Mechanism of folate transport in 619

Lactobacillus casei: evidence for a component shared with the thiamine and biotin transport 620 systems

The riboflavin transporter RibU in Lactococcus lactis: molecular characterization of 623 gene expression and the transport mechanism

Inactivation of an Iron Transporter in 625

Lactococcus lactis Results in Resistance to Tellurite and Oxidative Stress

CCC1 Is a Transporter That Mediates 628

Vacuolar Iron Storage in Yeast

Two Coregulated Efflux Transporters Modulate Intracellular Heme and Protoporphyrin IX 631

PLoS Pathog 6:e1000860. 632 38. von Heijne G. 1992. Membrane protein structure prediction. Hydrophobicity analysis 633 and the positive-inside rule

Iron acquisition 635 systems for ferric hydroxamates, haemin and haemoglobin in Listeria monocytogenes

Heme interplay between IlsA and IsdC: Two 639 structurally different surface proteins from Bacillus cereus

Surface Protein IsdC and Sortase B 642

Are Required for Heme-Iron Scavenging of Bacillus anthracis

Passage of heme-iron across the envelope 645 of Staphylococcus aureus

An iron-regulated sortase 647 anchors a class of surface protein during Staphylococcus aureus pathogenesis

The HHpred interactive server for protein 650 homology detection and structure prediction

STRING v11: protein-653 protein association networks with increased coverage, supporting functional discovery in 654 genome-wide experimental datasets

Characterization of Dye-Decolorizing Peroxidases from Rhodococcus jostii RHA1

Distal Heme Pocket 659 Residues of B-type Dye-decolorizing Peroxidase: ARGININE BUT NOT ASPARTATE IS 660 ESSENTIAL FOR PEROXIDASE ACTIVITY

Carbohydrate utilization in Lactobacillus sake

Respiration capacity and consequences in Lactococcus 666 lactis

Using heme as an energy boost for lactic acid bacteria

Structure of the human 671 transcobalamin beta domain in four distinct states

Structural Basis for

Universal Corrinoid Recognition by the Cobalamin Transport Protein Haptocorrin

Crystal structure of human intrinsic factor: Cobalamin complex at 2.6-A resolution

Structural basis for mammalian vitamin B12 transport by transcobalamin

Comparative Protein Structure Modeling Using MODELLER

Automated docking using a Lamarckian genetic algorithm and an empirical binding 685 free energy function

MicroScope-an integrated microbial resource for the curation and 690 comparative analysis of genomic and metabolic data

Efficient transformation of Lactobacillus sake by electroporation

Development of Genetic Tools for 695

Lactobacillus sakei: Disruption of the β-Galactosidase Gene and Use of lacZ as a Reporter 696

Gene To Study Regulation of the Putative Copper ATPase

Single-crossover 699 integration in the Lactobacillus sake chromosome and insertional inactivation of the ptsI and 700 lacL genes

Theta-Type Plasmid from Lactobacillus sakei: a Potential Basis for Low-Copy-Number 703

Autodock4 tool (56). The protocol and grid box were previously validated with the redocking 475 of cyanocobalamin within human haptocorrin (4kki) (42) and of cobalamin within bovine 476 transcobalamin (2bb6). To compute the binding energy of every complex, the parameters of 477 the cobalt present in the cobalamin and cyanocobalamin were added to the parameter data 478 table, the iron parameters of the heme are already in the parameter data table. Then the 479 docking poses were explored using the Lamarckian genetic algorithm. The poses of the 480 ligands were subsequently analyzed with PyMOL of the Schrödinger suite (57). 481Comparative genomic analysis for conservation of gene synteny between meat-borne bacteria 482 was carried out with the MicroScope Genome Annotation plateform, using the Genome 483Synteny graphical output and the PkGDB Synteny Statistics (58) 484 485

All the primers and plasmids used in this study are listed in Table 2 and 3. The lsa1836-1840 487 genes were inactivated by a 5118 bp deletion using double cross-over strategy. Upstream and 488 downstream fragments were obtained using primers pairs PHDU-lsa1836F/PHDU-lsa1836R 489 (731 bp) and PHDU-lsa1840F/PHDU-lsa1840R (742 bp) (Table 3) . PCR fragments were 490 joined by SOE using primers PHDU-lsa1836F/PHDU-lsa1840R and the resulting 1456 bp 491 fragment was cloned between EcoRI and KpnII sites in pRV300 yielding the pRV441 (Table  492 2). pRV441 was introduced in the L. sakei 23K and the L. sakei 23K DlacLM (RV2002) 493 strains by electroporation as described previously (59). Selection was done on erythromycin 494 sensitivity. Second cross-over erythromycin sensitive candidates were screened using primers 495 PHDU-crblsa1840F and PHDU-crblsa1840R (Table 3) . Deletion was then confirmed by 496 sequencing the concerned region and the lsa1836-1840 mutant strains were named RV4056 497 and RV4057 (Table 2) . 498To construct the RV2002 hrtR-lac and the RV4057 hrtR-lac strains, the pPhrthrtR-lac ( AAAAGCGGCCGCGCCTCCTTATAAAAACTG NotI