key: cord-0318059-cqky5053
authors: Zhao, Pingzhi; Wang, Ning; Yao, Xiangmei; Zhu, Changxiang; Hogenhout, Saskia A.; Liu, Shu-sheng; Zhou, Xueping; Fang, Rongxiang; Ye, Jian
title: Herbivore-induced activation of viral phosphatase disarms plant antiviral immunities for pathogen transmission
date: 2020-06-18
journal: bioRxiv
DOI: 10.1101/2020.06.17.158212
sha: 618bccc21a34b1e0c097aad9dbc40fed1314e5de
doc_id: 318059
cord_uid: cqky5053

The survival of pathogens depends on their ability to overcome host immunity, especially arthropod-borne viruses (arboviruses) which must withstand the immune responses of both the host and the arthropod vector. Successful arboviruses often modify host immunity to accelerate pathogen transmission; however, few studies have explored the underlying mechanism. Here we report attracted herbivore infestation on the virus-infected plants promote transmission by the associated vector herbivore. This herbivore-induced defense suppression underpins a subversive mechanism used by Begomovirus, the largest genus of plant viruses, to compromise host defense for pathogen transmission. Begomovirus-infected plants accumulated βC1 proteins in the phloem where they were bound to host defense regulators, transcription factor WRKY20 and two mitogen-activated protein kinases MPK3 and MPK6. Once perceiving whitefly herbivory or endogenous secreted peptide PEP1, the plants started dephosphorylation on serine33 and stimulated βC1 protein as a phosphatase. βC1 dephosphorylated MPK3/6 and WRKY20, the latter negatively regulated salicylic acid signaling and vascular callose deposition. This viral hijacking of WRKY20 accumulated more vascular callose by which enforced whitefly prolonged salivation and phloem sap ingestion, therefore impelling more virus transmission among plants. We present a scenario in which viruses dynamically respond to the presence of their vectors, suppressing host immunity and promoting pathogen transmission only when needed.

response to begomovirus infection and whitefly feeding. 141 Two opposing hypotheses may be proposed to explain the herbivory-induced host 142 defense suppression. One is that the host protein may be repressed e.g. via salivary 143 effector Bsp9 of whitefly that shuts down host defense system reported previously Thus, βC1 protein specifically cleaves the CO-P bond of the phosphopeptide and may 194 function like a typical protein phosphatase to inactivate MAPK. 195 We previously demonstrated that βC1 was phosphorylated by tomato SnRK1 no internal relationship between this phosphatase activity and its previously known 206 function as a RNA silencing suppressor for βC1, likely due to that βC1 S33D mutant did 207 not decrease the activity as a RNA silencing suppressor compared with βC1 protein 208 (Supplementary Figure 1) . Therefore, phosphatase activity of βC1 protein might be 209 independent for its known silencing suppressor activity. . The Pep1-treatment resulted in even much stronger effect of 261 reduction on SnRK genes expression than those of whitefly-infestated plants. If the 262 expression of these SnRK genes was reduced, we would expected that the repression of 263 phosphorylation of βC1 protein would be alleviated upon whitefly herbivory. As we 264 expected, phosphorylation levels of βC1 protein was dramatically and gradually 265 reduced by whitefly herbivore or Pep1-treatment in N. benthamiana plants ( Figure 3B ).

This whitefly-triggered reduction of phosphorylation level of βC1 seems be specific to infestation had little impact on the phosphorylation level of βC1 S33D protein ( Figure 3D ).

Meanwhile, we speculated that more phosphorylation level of βC1 would highly 276 dampen its roles in promoting virus transmission. We further found that the constitutive 277 phosphorylation on serine 33 of βC1 much decreased the quantity of virus transmitted; 278 the quantity in the mutant was only 37% of that in the wild type βC1 protein ( Figure   279 3E). Together, these results show that the serine 33 of βC1 is essential for evading host 280 SnRK-mediated defense and contributes to enhance virus transmission. Figure 4A ). As expected, βC1 strongly suppressed the Pep1-triggered Ca 2+ elevation, 293 partially phenocopying MAPK-deficient mutants. ROS is a key host free radical- whether MPK3 or MPK6 phosphorylates WRKY20, we first conducted an in vitro 333 phosphorylation assay. Figure 5A shows that WRKY20 can be phosphorylated by 334 MPK6 in vitro, suggesting that WRKY20 is a direct substrate of MAPKs. We further 335 conducted in vivo phosphorylation assay to check whether WRKY20 could be 336 phosphorylated in plant cell. Total soluble WRKY20 proteins were purified by YFP-337 tagged beads. Multiple phosphorylation modification bands of WRKY20 could be more 338 easily detected ( Figure 5B ). If βC1 could interfere with the interaction between MPK3 339 or MPK6 and WRKY20, then we would expect that phosphorylation cascade of 340 MAPKs-WRKY20 will be weakened. Consistent with this prediction, phosphorylation 341 levels of WRKY20 were obviously decreased when co-treated with purified βC1 342 protein in YFP-WRKY20 overexpression plants ( Figure 5B ). These results demonstrate 343 that βC1 interacts with three host MAPK cascade proteins (MPK3/6 and WRKY20) 344 and impairs this phosphorylation cascade from MPK3/6 to WRKY20. 345 WRKY20 modulates callose response in a vascular-specific pattern 346 Upon pathogen or herbivore attacks, the defense phytohormone SA signaling is 347 activated and callose deposition will then be enhanced to inhibit pathogen invasion (Fu whiteflies. The quantity of virus transmitted into wkry20 mutants was 3-4 fold higher 416 than that in wild-type Col-0 plants ( Figure 6D ). WRKY20 deficiency would make the Figure 6A ). The quantity of virus in WRKY20 overexpression plants was reduced to 422 only 25% of that in Col-0 plants ( Figure 6D ). Together, the results demonstrate that In addition, proteomic analysis in combination with metabolic analysis of βC1-501 expressing plants, myc2-1, wrky20, and mutations in autophagy machinery will also be 502 very helpful to ascertain the exact roles of autophagy, MYC2 and WRKY20 in βC1-503 mediated whitefly-begomovirus mutualism.

The significance of this HIDS in nature and agricultural ecology warrants more In vitro pull-down assay 618 The in vitro binding assay was performed as preciously described (Ye et al., 2015) . Seven-week old Arabidopsis leaves were infiltrated with water, 1 μM Pep1, 1 μM Flg22, 704 or ten-day old Arabidopsis cotyledon were treated by whiteflies and aphids. Leaves 705 were harvested after treatment for 12 hours, cleared, and stained with aniline blue for 706 callose as previously described (Adam and Somerville, 1996) . Leaves were mounted in 707 50% glycerol, and epifluorescence was visualized with a fluorescence microscope 708 under ultraviolet light. The number of callose deposits was counted by Image J software. a a a a a a a a a a a influence the interaction with WRKY20. BiFC analysis shows interaction between wild-type βC1 and WRKY20 or the phosphorylation mimic mutant βC1 S33D and WRKY20. Fluorescence was observed when βC1 or βC1 S33D fused with the C-terminal part of EYFP complemented WRKY20 fused with the N-terminal part of EYFP.

Unfused nEYFP was used as a negative control. Scale bars = 50 μm.

Bright Field Fluorescence Merged βC1-cEYFP + nEYFP-WRKY20 βC1 S33D -cEYFP + nEYFP-WRKY20 

Genetic characterization of five powdery mildew disease resistance 763 loci in Arabidopsis thaliana

A viral protease relocalizes in the 766 presence of the vector to promote vector performance

The family of Peps and their precursors in Arabidopsis: differential expression and 770 localization but similar induction of pattern-triggered immune responses

Host calcium channels and pumps in viral infections

AtMPK3-BamH1-F CAAGGGATCCATGAACACCGGCGGTGGCCA Cloning