key: cord-0315102-e3gwzit5
authors: Khattab, Sadat Mohamed Rezk; Watanabe, Takashi
title: Production the industrial levels of bioethanol from glycerol by engineered yeast “Bioethanol-4th generation”
date: 2020-06-05
journal: bioRxiv
DOI: 10.1101/2020.06.04.132589
sha: 906d2053a5285d9c2c63a8fef91ac78e026aa449
doc_id: 315102
cord_uid: e3gwzit5

Besides the pledges for expanding uses of biofuels to sustain the humanosphere, abruptly massive needs emerged for sanitizers with turns COVID-19 to a pandemic. Therefore, ethanol is topping the social-demanding, although the three generations of production, from molasses/starch, lignocelluloses, and algae. Owing to the limited-availability of fermentable sugars from these resources, we addressed glycerol as a fourth bio-based carbon resource from biodiesel, soap, and fatty acid industries, which considers as a non-applicable source for bioethanol production. Here, we show the full strategy to generate efficient glycerol fermenting yeast by innovative rewriting the oxidation of cytosolic nicotinamide-adenine-dinucleotide (NADH) by O2-dependent dynamic shuttle while abolishing glycerol biosynthesis route. Besides, imposing a vigorous glycerol-oxidative pathway, the engineered strain demonstrated a breakthrough in conversion efficiency (up to 98%). Its capacity extending to produce up to 90g /l ethanol and > 2 g 1-1 h-1, which promoting the industrial view. Visionary metabolic engineering here provides horizons for further tremendous economic and health benefits with assuring for its enhancing for the other scenarios of biorefineries. Summary Efficiently fermenting glycerol in yeast was developed by comprehensive engineering the glycerol pathways and rewriting NADH pathways.

resources, we addressed glycerol as a fourth bio-based carbon resource from biodiesel, soap, and 9 fatty acid industries, which considers as a non-applicable source for bioethanol production. Here, we 10 show the full strategy to generate efficient glycerol fermenting yeast by innovative rewriting the 11 oxidation of cytosolic nicotinamide-adenine-dinucleotide (NADH) by O2-dependent dynamic 12 shuttle while abolishing glycerol biosynthesis route. Besides, imposing a vigorous glycerol-oxidative 13 pathway, the engineered strain demonstrated a breakthrough in conversion efficiency (up to 98%). 14 Its capacity extending to produce up to 90g /l ethanol and > 2 g l -l h -l , which promoting the industrial 15 view. Visionary metabolic engineering here provides horizons for further tremendous economic and 16 health benefits with assuring for its enhancing for the other scenarios of biorefineries. One of the challenges for sustaining the future humanosphere is producing adequate bio -21 based chemicals and fuels from renewable resources with the footprint toward reducing 22 greenhouse gas emissions. The paradigm of using advanced sciences with metabolic engineering 23 and biotechnologies for apt emerging needs of biofuels, materials, and chemicals has been 24 envisioned and created on a commodity scale 1-3 . An abruptly massive needs in ethanol arose for 25 medical uses as sanitizers, with turns COVID-19 to a pandemic; it had confirmed the efficiencies 26 of 62-71% of ethanol for deactivating infection of the viruses' attached to the hands and ward -off 27 the infectious germs on persistent inanimate surfaces like metal, glass, and plastic 4 . Baker's yeast 28 (Saccharomyces cerevisiae), has several superior characteristics such as the ancient history with 29 the safety of use, unicellular structure, short life cycle, distinguished powers of fermentation, 30 robustness against inhibitors, stress-tolerance during different industrial levels of production, 31 global infrastructures for production of bioethanol from starch and molasses, and the availability 32 the toolboxes of genetic recombination. Besides, it is subjecting to the adaptive evolutions or 33 even the hybridization, thence a Baker's yeast had appointed as a top model platform of microbial 34 cell factories for several biotechnological applications 5-7 . The first generation of bioethanol 35 globally has successfully established with its uses for blending with gasoline as transportation 36 biofuel. Owing to environmental, political, security, bio-economic issues, the demanding for 37 bioethanol increases, although the resources for fermentation limited and the attempts are still 38 enduring of overcoming the drawbacks of application of second and third generation of 39 bioethanol from lignocellulosic biomass and the algae; basically, through evolving the maximum 40 efficiencies in ethanol production during xylose fermentation with glucose or even coupled to 41 acetic acid [8] [9] [10] [11] [12] . 42 In the last decade, glycerol producing industries, especially biodiesel, have expanded and 43 accumulated substantial quantities of glycerol, which led to dropping its price 13 . Although the 44 reductive merit in glycerol (C3H8O3) higher than other fermentable sugars 14 , glycerol is classifying 45 as a non-fermentable carbon in the native S. cerevisiae 5 , besides, it is used poorly as feedstock, 46 mainly through the glycerol 3-phosphate pathway, referred to as G3P pathway here, which 47 composed of glycerol kinase (GUT1), and FAD-dependent-mitochondrial-glycerol-3-phosphate-48 dehydrogenase (GUT2) 15 . Conversely, yeast biosynthesizes glycerol for mitigating the osmotic stress 49 and optimize the redox balance 16 , with subjection to the repression and transcriptional regulation of 50 glucose through respiratory factors (RSF), and GUT1 and GUT2 genes [17] [18] [19] [20] . The importance of 51 glycerol as a carbon source, which could be utilized by yeast cells, has recognized. It promoted a 52 study of the relationship between the molecular inheritance and the physiology of glycerol uptake 53 and its metabolism. This study revealed a high interspecies diversity ranged from the good-glycerol 54 grower to negative-glycerol grower in 52 of S. cerevisiae strains on a synthetic medium without 55 supporting supplements and that the glycerol growth phenotype is a quantitative trait. It has 56 confirmed that GUT1 is one of these genetic loci that sharing glycerol growth phenotype in one of 57 these good-glycerol grower strains, a haploid segregant CBS 6412-13A 21 . Hereafter, two further 58 superior alleles of cytoplasmic-ubiquitin protein-ligase-E3 (UBR2) and cytoplasmic-phosphorelay- 59 intermediate osmosensor and regulator (SSK1) had found to link with GUT1 for the growing on the 60 synthetic medium without supporting supplements 22 . These pivotal roles of UBR2 and GUT1 during 61 glycerol assimilation by yeast had further confirmed by another study that re-sequenced the whole-62 genomes a glycerol-evolved strains 23, 24 . Although G3P-pathway has evidenced the main catabolic-63 pathway for glycerol catabolism in S. cerevisiae, its heterologous-replacing with DHA-pathway that 64 combined glycerol facilitator (FPS) resulted in restores the similar growth of the parental strain. 65 Furthermore, this replacement in a negative-glycerol grower strain bearing the swapped 66 UBR2CBS6412-13A allele had guided the growth rate to the highest specific growth rate ever reported on 67 glycerol-synthetic medium 25 . 68 On the other hand, we developed a novel pretreatment method for biomass using glycerolysis 91 with the catalysis of alum AlK(SO4)2, with additionally promoted by a microwave 30 . Hence, there 92 emerged a need for evolving a model of yeast that can ferment glycerol efficiently after this 93 glycerolysis for complete establishing our scenario by synergist current 4 th generation of bioethanol 94 with its analog of the second or third generation, as well as either first generation. In this study, we 95 report the details of how is the modeling of yeast cell to redirect the glycerol traffic to bioethanol 96 production until the industrial levels even in the presence of glucose through the innovation of the 97 forthcoming systematic metabolic engineering showed in (Fig 1) : I) abolishing the inherent glycerol 98 biosynthesis pathway by knocking-out NAD-dependent glycerol 3-phosphate dehydrogenase 99 (GPD1) and retaining the second isoform GPD2 for requirements of glycerol 3-phosphate for lipid 100 metabolism. II) Replacing cytosolic NADH-oxidation through the GPD1 shuttle by a more effective 101 O2-dependent dynamic shuttle of water forming NADH-oxidase (NoxE) to renovate NAD + for that 102 integrated gene of glycerol dehydrogenase (GDH). III) Knocking out the first gene of the G3P 103 pathway (GUT1). IV) Imposing a vigorous oxidative pathway via overexpressing two copies of both 104 the heterologous-genes of glycerol dehydrogenase OpGDH, and the glycerol facilitator CuFPS1, 105 besides, the endogenous genes of TPI1, and DAK1 with one copy of DAK2. 

Effect of Systematic metabolic engineering: 110 Step no. 1: vigorous glycerol dehydrogenase is an essential opener to initiate glycerol (Table 1) . The strain harboring the GDH gene, which named GDH, is 116 consuming glycerol faster than GF2 with an increase of 21% in ethanol production, whereas it was 117 only 10% in GF2 compared with the parental strain (Fig. 2) . In full aerobic fermentation (1/10 118 liquid culture/flask volume) of mixed glucose and glycerol using GDH strain improved the glycerol 119 consumption and ethanol production from 25% to 40% and from 21%-64%, respectively, before 120 switching to the re-utilization of ethanol when compared with the previous semi-aerobic condition 121 ( Figs. 2 and 3) . These results indicating the first step for the efficiency of glycerol fermentation 122 should be through an effective GDH started here with an act of OpGDH. Furthermore, we confirmed 123 that glycerol consumption was through the constructed DHA, where glycerol consumption has not 124 significantly decreased after knocked-out the ScGUT1 gene, which is the first gene in the G3P 125 pathway (Fig. 2) . Also, activating the genes of the G3P pathway (ScSTL1, ScGUT1, ScGUT2, and 126 ScTPI1) in a recombinant strain named GA2 (Table 1) did not impose significant improvement in 127 the ethanol production (Fig. 2) .

glycerol biosynthesis was 82%, where glycerol secretion from ∆ GPD1 was 0.47g/2.56g of wild 140 type WT; while it was 23% (2.08g/2.56g WT) with ∆ GPD2 ( Step no. 3: integrating GDH and NoxE with ∆GPD1. Owing to the previous results from the 157 recombinant GDH strain and the data of replaced the shuttles of oxidizing the cytosolic NADH by 158 LiNoxE, therefore, we studied the recycling outputs of NAD + /NADH between the GDH and 159 LiNoxE. In addition to this recycling, deleting GPD1 during that substitution with LiNoxE will 160 abolish glycerol formation and decreases the ramification of DHAP, which consolidates the 161 straightforward to glycolysis route. As a result of that thinking, we engineered a further strain that 162 combined GDH with LiNoxE with a ∆ GPD1 as listed in table 1. This round of recombination 163 (GDH+NOXE strain) has tested for ability fermenting glycerol in comparison with GDH or 164 LiNoxE, as well as the wild type strain. This innovative integration clearly showed improvements 165 in both efficiency of glycerol conversion to ethanol and delayed in the time of reprogramming the 166 cell to utilize a produced ethanol. In figure 3 at 6h, both strains of the ancestor, and the 167 engineered GPD1/LlNoxE started their re-utilize the produced ethanol from glucose without 168 significant consumption in glycerol, where maximum ethanol produced was 4.7 g/l ethanol. In 169 GDH strain, the time of reusing the produced ethanol delayed to 26h with raises in the ethanol 170 production to 11.82 g/l, which represents 0.27 g ethanol/ the consumed glucose and glycerol. In 171 the case of GDH+NOXE, the integration here not only boosted the ethanol production to 13.27 g/l 172 (0.31g ethanol/ the consumed glucose and glycerol) at 26h, but also extended the fermentation 173 time to 32h, and further raised production of ethanol to 14.42 g/l before the switching to consume 174 that ethanol (Fig. 3) . (Table 1) . Unequivocally, this fourth step of recombination 187 solved one of the main problems in this study, where is prevented the phenomena of the switching 188 to utilizing ethanol before the full consumption of glycerol. A consumption rate reached 1 g l -1 h -1 189 and produced 20.95 g/l of ethanol by this recombinant strain. Nonetheless, its conversion 190 efficiency of ethanol production appeared to be less than 48% of the theoretical value (Fig. 3) . promoter-ATP15 terminator, TDH3 promoter-mutated d22DIT1 terminator, and FBA1 promoter-201 TDH3 terminator, respectively with genes CuFBS1, OpGDH, ScDAK1, and ScTPI1. Therefore, 202 we intensified a whole glycerol oxidation pathway by integrating another copy of 203 genes CuFPS1, OpGDH, ScDAK1, and ScTPI1 during the replacement of the GUT1, which 204 abolished the G3P pathway, for continuing the overcoming of the previous inadequacies in this 205 fifth stage of recombination. Interestingly, we griped unique findings with step five of 206 recombination in the glycerol consumption and ethanol production that never reported in any 207 organism with the evolved strain GDH-NOXE-FDT-M1 named SK-FGG (Table 1, Fig.3 ). Its 208 consumption rate reached 2.6 g l -l h -l from glycerol at the described experimental conditions, and 209 the productivity paced 1.38 g l -l h -l of ethanol with conversion efficiency reached 0.44g ethanol/g 210 glucose and glycerol (Fig. 4) .

Osmotolerance of the engineered strain (SK-FGG) and the effect of higher aeration: the 213 strain SK-FGG exhibiting outstanding performance in aerobic conditions at that higher initial 214 concentration of glycerol in YP medium, where its conversion efficiency reached 0.49 g 215 ethanol/g glycerol with a production rate of> 1 g l -l h -l of ethanol (Fig. 4a) . Even with the 216 mixing of glucose with glycerol at the same initial concentration, its conversion efficiency was 217 comparatively the same (Fig 4b) . Interestingly, the strain engineered here glows in its capacity 218 to harmonize fermenting the glycerol with glucose, as well as, accumulation of 9% of 219 bioethanol with additional fed-batching of glycerol, although the efficiency decreased to 0.43 g 220 ethanol/g glycerol (Fig. 4c) . Notably, increasing the aeration by increasing the volume of 221 flasks with keeping the constant of the broth volume accelerated the glycerol consumption 222 remarkably to >5 g l -l h -l . Also, the rate of ethanol production increased to >2 g l -l h -l . 223 Nonetheless, its conversion efficiency decreased to 0.42 g ethanol/g glycerol (Fig. 4d) . We 224 observed some other minor uncharacterized peaks during the analysis of these samples, as a 225 further point for research in the future. It is also worth mentioning that a strain SK -FGG has 226 proved its capability to convert glycerol at larger volumes where we scaled up the 227 experimental capacities to 1, and 3 liters via the mini-jar 5L fermentor (see Methods section). 228 Nonetheless, its rates and efficiencies decreased due to higher fluctuating of the dissolved 229 oxygen during the fermentation by our available system, where a more advanced control 230 system is required.

Recently, microbial technologies for exploiting glycerol as a carbon source for producing 235 valuable products have gained higher attention, where a considerable amount of glycerol as an 236 unavoidable by-product from the expansion of biodiesel industries had accumulated. In our other 237 scenario, glycerol has evidenced as a delignifing agent during pretreating biomass with alum in the 238 glycerolysis process 30 . Therefore, working on engineering the yeast genetically for generating the 239 ability to convert glycerol into ethanol becomes inevitable for such all of these perspectives. S. Further studies are needed to reveal this point or ranking its growth rate with that previous well 253 studied strains 21 to quantify trait the growth alleles on synthetic medium. In addition to these 254 unstudied points, we decided to use the rich medium represented in yeast peptone (YP), where it 255 showed a significant accumulated amount of ethanol onset fermentation of glycerol with engineered 256 for production of 1, 2-propanediol 26 . 257 Although revoking the TPI1 gene has considered a pivotal hub for the production of glycerol 258 from glucose 40 , which is the reverse direction here, it hasn't integrated with the previous study that 259 examined overexpressing the native DHA-pathway 28 . Therefore, we combined the overexpression of 260 the TPI1 gene with the DHA pathway to track the restrictions in that oxidative pathway in 261 fermenting glycerol. Hence, we constructed a strain named GF2, which overexpressed its genes 262 ScSTL1, ScGCY1, ScDAK1, ScDAK2, and ScTPI1. Concurrently, we recognized the limited 263 activity of the ScGCY gene compared with a glycerol dehydrogenase from Ogataea polymorpha 41 . 264 Therefore, we constructed a yeast harbored OpGDH named GDH to be testing with GF2 during 265 fermenting glycerol. As a result of these comparing studies, such an active OpGDH gene is the first 266 key for deciphering glycerol fermentation, although the sole integration of OpGDH not enough to 267 induce an efficient fermentation (Fig. 2) . On the other hand, overexpressing the native glycerol 268 catabolic pathway G3P in strain named GA2 did not demonstrate promising results as this oxidative 269 pathway. The assumption that may be contemplating here is the limit of the respiratory chain during Investigation of the nine constructed strains of either deleted or replaced GPD1 or/and GPD2 by the 293 NoxE gene, showed replacing GPD1 by LiNoxE is the best approach, where glycerol biosynthesis 294 effectively abolished by 98%, and an improvement in the fermentation efficiency by 9% (Table 2) . 295 Expectedly, this single replacement will not exhibit further progress toward glycerol 296 fermentation (Fig.3) . Assuredly, we referred to the act of the low activity of native glycerol 297 dehydrogenase ScGCY1 41 . As detailed above, a ramification of DHAP represents another hindrance 298 for the straightforward toward glycolysis from glycerol. In this juncture, a reduced circulation of 299 DHAP into the G3P pathway had confirmed to be efficient for glycerol fermentation by integrating 300 this replacement of GPD1 by LiNoxE within the GDH strain. As expected, the strain harbored this 301 unique point of integration (GDH-NOXE) in this regard showed substantial improvement in ethanol 302 production from glycerol reached 28 % compared with GDH strain at that studied conditions, which 303 not considered the other parameters such as oxygen level (Fig.3) . The role of abolishing GPD1 had 304 explicitly calculated from the data of fig. 3 , which has represented 43 % of that improved ratio. 305 Utilize the recycles of cofactors NADH/NAD + for production of 1, 2-propanediol has been well 306 studied during fermenting glycerol 26 . Nevertheless, it seems non-stoichiometries of cofactors in the 307 engineered pathway have compensated with the flowed to the ethanol accumulation relatively with 308 rich media and the faster growth rates at the onset of fermentation and lately with re-consumption of 309 ethanol by alcohol dehydrogenase (ADH2) 26 . 310 The importance around the activation of the other genes in the DHA pathway has confirmed, 311 through the continued bioethanol production until the full consumption of glycerol (Fig.3) . Although However, integrate one copy of the whole DHA-pathway with NoxE generated the ability of 332 yeast to convert all supplemented glucose and glycerol to ethanol. Nonetheless, we recognized that 333 conversion efficiency may still be affected by the robustness of native programed-glycolysis. 334 Thence, further strengthening of the whole genes in the DHA pathway by another copy under 335 different expression systems could overcome this obstacle. Interestingly, the other copy 336 of CuFPS1, OpGDH, ScDAK1, and ScTPI1 that replaced GUT1 met our expectations and reaches 337 by efficiencies and the production rates to that comparable with the industrial application, where the 338 efficient conversions reached 98% of theoretical ratio with production rates 1.38 g l -l h -l . A potential 339 using the strategy of multi-copy with optimizing the stoichiometries of the metabolic pathway had 340 considerably boosted the production, e. g. six copies of the farnesene synthase gene, which 341 integrated into yeast to improve the synthesize of farnesene 2 . Here, with the second copy of 342 integration, we further selected highly constitutive expressing system in yeast 33-36 to extend the 343 production levels and efficiencies, where TEF1 promoter-CYC1 terminator, TYS1 promoter-ATP15 344 terminator, TDH3 promoter-mutated d22DIT1 terminator, and FBA1 promoter-TDH3 terminator, 345 respectively with genes CuFBS1, OpGDH, ScDAK1, and ScTPI1. Owing to the efficient SK-FGG 346 strain generated, and its introduced pathway, oxygen supplements were the limit. Surprisingly, 347 fermentation rates doubled with increasing aeration to >2 g l -l h -l . Nonetheless, we are currently 348 working on further improvements to increase the efficiency during such production rates, as well as 349 utilize glycerol's high reduction merit for improving the fermentation efficiencies of other carbons. 350 In this study, we are reporting the discovery for the modeling of glycerol traffic to the 351 industrial levels of bioethanol production. This modeling includes the integration of (i) Impose (Table 3) . We further replaced the URA3 391 gene in a pPGK-URA3 plasmid with a gene of HIS3 (Ref59) using the feature of a synthetically 392 adding an overlapped sequences from pPGK plasmid to HIS3 marker using PCR and primes and 393 vice-versa (Section 3table S1). Then, a Gibson Assembly Master Mix assembles the overlapping 394 ends of the two fragments to form PGK-HIS3 plasmid. With construct pPGK-HIS3 plasmid (Table   395 3), we granted HIS3 locus for homologous recombination in S. cerevisiae after linearizing the 396 plasmid at the BsiWI site. We obtained the previous plasmids and confirming their genes sequences 397 by sequencing, detailed relevant primers listed in (Section 2table S1). Next, we cut XhoI/SalI- Ultimately, pPGK-ScTPI1-ScDAK2-ScDAK1-ScGCY1-ScSTL1 plasmid was constructed (Table   404 3). Continuing with the same procedures, the plasmid pPGK-ScTPI1-ScGUT2-ScGUT1-ScSTL1 405 also established. (Section 4 -417   table S1 ). Then, cohesive the ends of that couple of DNA fragments by restriction enzymes XhoI, 418 NotI for the first fragment and NotI, SalI for the second one. After purification of the fragments 419 using agarose gel and columns of Nippon Genetics Co., Ltd., one-step cloning coupled the TDH3 420 promoter and mutated DITI terminator into XhoI/SalI of PGK/URA3 plasmid. Then TDH3p-421 d22DIT1t-URA3 plasmid constructed (Table 3) . (Section 4 of Table S1 ), and full 428 sequences are available in (Table S2) . Takara Bio,   464 Inc., Japan, and the primers used to establish this plasmid listed in (Section 6table S1). A full 465 sequence for cassette, PGK-CuFPS1-RPL41Bt, transferred to (table S2) (Table   472 S1), using restriction enzymes Xhol-SalI and re-inserted that set of cassettes, ScTPI1, ScDAK2, 473 and ScDAK1, into the SalI site of pAUR101-PGK-CuFPS1-RPL41B plasmid (Table 3) . 476 At first, we obtained all fragments which will form the module M1 separately by PCR (Fig. S2 ); 477 also, CuFPS1and OpGDH genes mutated d22DIT terminator amplified from their synthetic DNA 478 stocks, whereas other fragments magnified from the genomic DNA of the D452-2 strain (Fig. S2) . 479 The full sequence of the module M1 is also accessible in (table S2) , and the details of the primer 480 listed in (Section 7table S1). Purification of the 12 amplified DNA fragments was carried out on 481 1%-2% agarose gel and then recovered by the FastGene Gel/PCR Extraction Kit (Nippon Genetics 482 Co. Ltd) according to the manufacturer's protocol. Accordingly, we obtained highly purified 483 fragments before the onset of assembles using the Gibson Assembly Master Mix. Effectively, we 484 joined the first three parts seamlessly, as well as for every next three fragments (Gibson's protocol). 485 Also, we directly amplified each set by PCR and then purified them again on the agarose gel. 486 Repeatedly, we gathered the first six parts, as well as the other six fragments, and then assembled the 487 whole module M1. We further added the SacI site to the upstream of the module M1and SmaI site to 488 the downstream as well. These restriction sites provided for cloning the module M1 into SacI-SmaI 489 sites of pAUR101 vector to form pAUR 101-M1 (table 3) . Finally, we transferred that vector, pAUR (Table S1 ). Furthermore, we 506 cultivated up to 10 generations of the selected evolved strains to confirm the loss of pCAS plasmid 507 and to re-confirm the recombination. All recombination strains and their genotypes were listed 508 (Table 1) Ethanol production g/l F1 REV primer (CuFPS-TEF1p ) 5'-gtaattctcctgtcattttgtaattaaaacttagattagattgctatgctttctttc-3' F2 FOR primer (TEF1p -CuPS) 5'-ctaagttttaattacaaaatgacaggagaattacttgctagtggtgaag-3' F2 REV primer (CYC1t -CuFPS) 5'ggaaaaggggcctgttcaagcgtcaagacgaccgtggctagcctccg -3' F3 FOR primer (CuFPS-CYC1t ) 5'cgtcttgacgcttgaacaggccccttttcctttgtcgatatcatg -3' F3 REV primer (TYS1p-CYC1t) 5'-gtaagcgcaaggacaaattaaagccttcgagcgtcccaaaacc-3' F4 FOR primer (CYC1t-TYS1p) 5'cgctcgaaggctttaatttgtccttgcgcttactcgaataggcctccctagc-3' F4 REV primer (OpGDH-TYS1p) 5'cctttcatgttatcgtcaattagagtatgcggttatggatgc-3' F5 FOR-TYS1p-linked-OpGDH gene syntheticaly 5'-catactctaattgacgataacatgaaaggtttacttta F6 FOR-OpGDH gene-link ATP15t syntheticaly 5-ctccgaacgaggtgtcctagtttaacgcttcctgggaactgcagctc -3'

F6 REV primer (ATP15t-TDH3p) 5'-gataaactcgaactgagaggctgaaggcagagaagtttctggaac-3' F7 FOR primer (ATP15t-TDH3p) 5'-cttctctgccttcagcctctcagttcgagtttatcattatcaatactgccatttc-3' F7 REV primer (DAK1-TDH3p) 5'-cgatttagcggacattttgtttgtttatgtgtgtttattcgaaac-3' F8 FOR primer (TDH3p-DAK1) 5'-cacacataaacaaacaaaatgtccgctaaatcgtttgaagtcacagatcc-3' F8 REV Primer (d22-DITIt -DAK1) 5'-gcgctcttactttattacaaggcgctttgaacccccttcaaaaactc-3' F9 FOR DAK1-linked-d22DITIt synthetically 5'-ggggttcaaagcgccttgtaataaagtaagagcgc F10 FOR FBA1p-linked-d22DITIt synthetically 5'gcctttcttttcatcataacaatactgacagtac F10 REV Primer (TPI1-FBA1p) 5'-caaagaaagttctagccattttgaatatgtattacttggttatgg-3' F11 FOR primer (FBA1p-TPI1) 5'-ccaagtaatacatattcaaaatggctagaactttctttgtcggtggtaac-3' F11 REV Primer (TDH3t-TPI1) 5'-gatttaaagtaaattcacttagtttctagagttgatgatatcaac-3' F12 FOR primer (TPI1-TDH3t) 5'-caactctagaaactaagtgaatttactttaaatcttgcatttaaataaattttc-3' F12 REV Primer (GUT1-TDH3t) 5'-tggagaggaatataaaattatggaaattacattgttaatagaaattatttatgttgaagggaaagatatgagctatacag-3' F6 extend Rev2 5'tattgataatgataaactcgaactgagagg F7 extend For2 5'cagaaacttctctgccttcagcct Sac1-GUT1p M1 For2 5'-agcgagctcgaaccatataaaatatacca Sma1-Gut1t M1 Rev2 5'-aacccgggtggagaggaatataaaattat Section 7.1-Primes for preparing multiplex pCAS-gRNA-GUT1 plasmids pCAS-gRNA target 628 GUT1 F 5'-attctgtggtcccgccgcacgttttagagctagaaatagc pCAS-gRNA target 628 GUT1 R 5'-gtgcggcgggaccacagaataaagtcccattcgccacccg Section 7.2-Primes for confirming multiplex pCAS-gRNA-GUT1 system GUT1p integ. Check F 5'-cggataaggtgtaataaaatgtg F1 REV primer (CuFPS-TEF1p ) 5'-gtaattctcctgtcattttgtaattaaaacttagattagattgctatgctttctttc-3' 

The yeast 646 osmostress response is carbon source dependent

Increasing NADH 648 oxidation reduces overflow metabolism in Saccharomyces cerevisiae

The initial step of the glycerolipid pathway: identification of glycerol

phosphate/dihydroxyacetone phosphate dual substrate acyltransferases in Saccharomyces 652 cerevisiae

Characterization 654 of methylglyoxal synthase in Saccharomyces cerevisiae

The 657 importance of the glycerol 3-phosphate shuttle during aerobic growth of Saccharomyces 658 cerevisiae

Glycerol metabolism in yeasts pathways of utilization 660 and production

Dihydroxyacetone kinases in saccharomyces cerevisiae 662 are involved in detoxification of dihydroxyacetone

Inhibition of triosephosphate 664 isomerase by phosphoenolpyruvate in the feedback-regulation of glycolysis

Glycerol secreted (g) Acetic secreted (g) Ethanol produced (g) TAGTTATGTCACGCTTACATTCACGCCCTCCTCCCACATCCGCTCTAACCGAAAAGG  AAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTTAATAGTTATGTTA  GTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAAACGCGTGTA  CGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGC  TTTAATTTGTCCTTGCGCTTACTCGAATAGGCCTCCCTAGCTATTCTTCAACCTTTCG  AACCATCCATACTTCTTACTATCATAATTTTTATTTTATCATGGAGGCGAGAAGGTCC  TTATTCGAGCATCACTAAGAACGGAACTCGAACATTTACAAAGTAGAAAAATTTTAT  GAAAATTAATTGTTCTTTCTTCAGAATACAAATTAGTCATTGTCAAAAAGAGATTAG  CATCCATAACCGCATACTCTAATTGACGATAACatgaaaggtttactttattacggtacaaacgatattcgcta  ctccgaaacggttcctgaaccggagatcaaaaaccccaacgatgtcaagatcaaagtcagctactgtggaatctgtggcacagacctgaaa  gaattcacatattctggaggccctgtttttttccctaaacacggcaccaaggacaagatctcgggatacgagcttcctctctgtcctggacatga  attcagcggaacagtgattgaggttggctctggtgtcaccagtgtgaaacctggtgacagggtcgcagttgaagctacgtcccattgctccg  acagatcgcgctacaaagacacggtcgcccaggacctcgggctctgtatggcctgcaagagcggatctccaaactgctgtgtgtcgctga  gcttctgcggtttgggtggtgccagcggcggttttgccgagtacgtcgtttacggtgaggaccacatggtcaagcttccagactcgattcccg  acgatatcggagcattggttgagcctattgctgttgcctggcatgctgttgaacgcgctagattccagcctggccagacggccctggttcttg  gaggaggtcctatcggccttgccaccattcttgctctgcaaggccaccgtgccggcaaaattgtgtgttccgagccggccttgattagaaga  cagtttgcaaaggaactgggcgctgaagtgtttgatccttctacatgtgatgacgcaaatgccgttctcaaggctatggtgccggaaaacgaa   53   ggattccacgcagccttcgactgctctggaattcctcagacattcaccacctctattgtcgccacaggcccttcgggaatcgccgtcaacgtg  gccatttggggagaccacccaattggattcatgccaatgtctctgacttaccaagagaaatacgctaccggctccatgtgctacaccgtcaag  gacttccaggaagttgtcggggccttggaagatggtctcatatctttggacaaggcgcgcaagatgattacaggcaaagtccacctaaggg  acggagtcgagaagggctttagacagctcatcgagcacaaggaaaccaatgtcaagatcctggtgactccgaacgaggtgtcctagTTT  AACGCTTCCTGGGAACTGCAGCTCTTTTTTTACTCGCTGATATACATTTTAAATATTC  TAGCAACTGTGTATGAAAACTTACGTACTTTTATACGGGAAACTAATAATGACTACA  ATGATATTGAATACTGGCCGCTTCGAAGAGTGGTATAAAGTTTGTATCATTGCATTA  AAAGAAAAAGAAATATATGTCCCATCATCGCCAATCGCAATGTTGAATGGTCGTTTA  CCACTTTTGCGGCTGGGCATATGCAGAAACATGCTGTCCCGTCCCCGACTGGCTAAA  CTGCCATCTATAAGGTTTCGGTCTTTGGTCACCCCTTCTTCATCGCAGCTCATTCCTC  TCAGTCGGTTGTGTTTAAGGTCACCTGCAGTTGGAAAATCACTAATTTTACAAAGTT  TTAGATGTAATTCATCCAAAACAGTTCCAGAAACTTCTCTGCCTTCAGCCTCTCAGTT  CGAGTTTATCATTATCAATACTGCCATTTCAAAGAATACGTAAATAATTAATAGTAG  TGATTTTCCTAACTTTATTTAGTCAAAAAATTAGCCTTTTAATTCTGCTGTAACCCGT  ACATGCCCAAAATAGGGGGCGGGTTACACAGAATATATAACATCGTAGGTGTCTGG  GTGAACAGTTTATTCCTGGCATCCACTAAATATAATGGAGCCCGCTTTTTAAGCTGG  CATCCAGAAAAAAAAAGAATCCCAGCACCAAAATATTGTTTTCTTCACCAACCATCA  GTTCATAGGTCCATTCTCTTAGCGCAACTACAGAGAACAGGGGCACAAACAGGCAA  AAAACGGGCACAACCTCAATGGAGTGATGCAACCTGCCTGGAGTAAATGATGACAC  AAGGCAATTGACCCACGCATGTATCTATCTCATTTTCTTACACCTTCTATTACCTTCT  GCTCTCTCTGATTTGGAAAAAGCTGAAAAAAAAGGTTGAAACCAGTTCCCTGAAATT  ATTCCCCTACTTGACTAATAAGTATATAAAGACGGTAGGTATTGATTGTAATTCTGT  AAATCTATTTCTTAAACTTCTTAAATTCTACTTTTATAGTTAGTCTTTTTTTTAGTTTT  AAAACACCAAGAACTTAGTTTCGAATAAACACACATAAACAAACAAAatgtccgctaaatcg  tttgaagtcacagatccagtcaattcaagtctcaaagggtttgcccttgctaacccctccattacgctggtccctgaagaaaaaattctcttcag  aaagaccgattccgacaagatcgcattaatttctggtggtggtagtggacatgaacctacacacgccggtttcattggtaagggtatgttgagt  ggcgccgtggttggcgaaatttttgcatccccttcaacaaaacagattttaaatgcaatccgtttagtcaatgaaaatgcgtctggcgttttattg  attgtgaagaactacacaggtgatgttttgcattttggtctgtccgctgagagagcaagagccttgggtattaactgccgcgttgctgtcatagg  tgatgatgttgcagttggcagagaaaagggtggtatggttggtagaagagcattggcaggtaccgttttggttcataagattgtaggtgccttc  gcagaagaatattctagtaagtatggcttagacggtacagctaaagtggctaaaattatcaacgacaatttggtgaccattggatcttctttaga  ccattgtaaagttcctggcaggaaattcgaaagtgaattaaacgaaaaacaaatggaattgggtatgggtattcataacgaacctggtgtgaa  agttttagaccctattccttctaccgaagacttgatctccaagtatatgctaccaaaactattggatccaaacgataaggatagagcttttgtaaa  gtttgatgaagatgatgaagttgtcttgttagttaacaatctcggcggtgtttctaattttgttattagttctatcacttccaaaactacggatttcttaa  aggaaaattacaacataaccccggttcaaacaattgctggcacattgatgacctccttcaatggtaatgggttcagtatcacattactaaacgc  cactaaggctacaaaggctttgcaatctgattttgaggagatcaaatcagtactagacttgttgaacgcatttacgaacgcaccgggctggcc  aattgcagattttgaaaagacttctgccccatctgttaacgatgacttgttacataatgaagtaacagcaaaggccgtcggtacctatgactttg  acaagtttgctgagtggatgaagagtggtgctgaacaagttatcaagagcgaaccgcacattacggaactagacaatcaagttggtgatggt  gattgtggttacactttagtggcaggagttaaaggcatcaccgaaaaccttgacaagctgtcgaaggactcattatctcaggcggttgcccaa  atttcagatttcattgaaggctcaatgggaggtacttctggtggtttatattctattcttttgtcgggtttttcacacggattaattcaggtttgtaaatc  aaaggatgaacccgtcactaaggaaattgtggctaagtcactcggaattgcattggatactttatacaaatatacaaaggcaaggaagggat   54   catccaccatgattgatgctttagaaccattcgttaaagaatttactgcatctaaggatttcaataaggcggtaaaagctgcagaggaaggtgc  taaatccactgctacattcgaggccaaatttggcagagcttcgtatgtcggcgattcatctcaagtagaagatcctggtgcagtaggcctatgt  gagtttttgaagggggttcaaagcgccttgtaaTAAAGTAAGAGCGCTACATTGGTCTACCTTTTTCTTTT  ACTTAAACATTAGTTAGTTCGTTTTCTTTTTCTTTTTTTATGTTTCCCCCCCAAAGTTC  TGATTTTATAATATTTTATTTCACACAATTCCATTTAACAGAGGGGGAATAGATTCTT  TAGCTTAGAAAATTAGTGATCAATATATATTTGCCTTTCTTTTCATCATAACAATACT  GACAGTACTAAATAATTGCCTACTTGGCTTCACATACGTTGCATACGTCGATATAGA  TAATAATGATAATGACAGCAGGATTATCGTAATACGTAATAGTTGAAAATCTCAAA  AATGTGTGGGTCATTACGTAAATAATGATAGGAATGGGATTCTTCTATTTTTCCTTTT  TCCATTCTAGCAGCCGTCGGGAAAACGTGGCATCCTCTCTTTCGGGCTCAATTGGAG  TCACGCTGCCGTGAGCATCCTCTCTTTCCATATCTAACAACTGAGCACGTAACCAAT  GGAAAAGCATGAGCTTAGCGTTGCTCCAAAAAAGTATTGGATGGTTAATACCATTTG  TCTGTTCTCTTCTGACTTTGACTCCTCAAAAAAAAAAAATCTACAATCAACAGATCG  CTTCAATTACGCCCTCACAAAAACTTTTTTCCTTCTTCTTCGCCCACGTTAAATTTTAT  CCCTCATGTTGTCTAACGGATTTCTGCACTTGATTTATTATAAAAAGACAAAGACAT  AATACTTCTCTATCAATTTCAGTTATTGTTCTTCCTTGCGTTATTCTTCTGTTCTTCTTT  TTCTTTTGTCATATATAACCATAACCAAGTAATACATATTCAAAatggctagaactttctttgtcggt  ggtaactttaaattaaacggttccaaacaatccattaaggaaattgttgaaagattgaacactgcttctatcccagaaaatgtcgaagttgttatct  gtcctccagctacctacttagactactctgtctctttggttaagaagccacaagtcactgtcggtgctcaaaacgcctacttgaaggcttctggt  gctttcaccggtgaaaactccgttgaccaaatcaaggatgttggtgctaagtgggttattttgggtcactccgaaagaagatcttacttccacga  agatgacaagttcattgctgacaagaccaagttcgctttaggtcaaggtgtcggtgtcatcttgtgtatcggtgaaactttggaagaaaagaag  gccggtaagactttggatgttgttgaaagacaattgaacgctgtcttggaagaagttaaggactggactaacgtcgttgtcgcttacgaacca  gtctgggccattggtaccggtttggctgctactccagaagatgctcaagatattcacgcttccatcagaaagttcttggcttccaagttgggtga  caaggctgccagcgaattgagaatcttatacggtggttccgctaacggtagcaacgccgttaccttcaaggacaaggctgatgtcgatggttt  cttggtcggtggtgcttctttgaagccagaatttgttgatatcatcaactctagaaactaaGTGAATTTACTTTAAATCTTGC  ATTTAAATAAATTTTCTTTTTATAGCTTTATGACTTAGTTTCAATTTATATACTATTTT  AATGACATTTTCGATTCATTGATTGAAAGCTTTGTGTTTTTTCTTGATGCGCTATTGC  ATTGTTCTTGTCTTTTTCGCCACATGTAATATCTGTAGTAGATACCTGATACATTGTG  GATGCTGAGTGAAATTTTAGTTAATAATGGAGGCGCTCTTAATAATTTTGGGGATAT  TGGCTTTTTTTTTTAAAGTTTACAAATGAATTTTTTCCGCCAGGATAACGATTCTGAA  GTTACTCTTAGCGTTCCTATCGGTACAGCCATCAAATCATGCCTATAAATCATGCCTA  TATTTGCGTGCAGTCAGTATCATCTACATGAAAAAAACTCCCGCAATTTCTTATAGA  ATACGTTGAAAATTAAATGTACGCGCCAAGATAAGATAACATATATCTAGATGCAG  TAATATACACAGATTCCCGCGGACGTGGGAAGGAAAAAATTAGATAACAAAATCTG  AGTGATATGGAAATTCCGCTGTATAGCTCATATCTTTCCCTTCAACATAAATAATTTC  TATTAACAATGTAATTTCCATAATTTTATATTCCTCTCCACCCGGG