key: cord-0281181-plktu52y
authors: Solis, Oscar; Beccari, Andrea R.; Iaconis, Daniela; Talarico, Carmine; Ruiz-Bedoya, Camilo A.; Nwachukwu, Jerome C.; Cimini, Annamaria; Castelli, Vanessa; Bertini, Riccardo; Montopoli, Monica; Cocetta, Veronica; Borocci, Stefano; Prandi, Ingrid G.; Flavahan, Kelly; Bahr, Melissa; Napiorkowski, Anna; Chillemi, Giovanni; Ooka, Masato; Yang, Xiaoping; Zhang, Shiliang; Xia, Menghang; Zheng, Wei; Bonaventura, Jordi; Pomper, Martin G.; Hooper, Jody E.; Morales, Marisela; Rosenberg, Avi Z.; Nettles, Kendall W.; Jain, Sanjay K.; Allegretti, Marcello; Michaelides, Michael
title: The SARS-CoV-2 spike protein binds and modulates estrogen receptors
date: 2022-05-23
journal: bioRxiv
DOI: 10.1101/2022.05.21.492920
sha: 2565190b584bcf18eba89a5bb413dd46c9fdab3b
doc_id: 281181
cord_uid: plktu52y

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike (S) protein binds angiotensin-converting enzyme 2 (ACE2) at the cell surface, which constitutes the primary mechanism driving SARS-CoV-2 infection. Molecular interactions between the transduced S and endogenous proteins likely occur post-infection, but such interactions are not well understood. We used an unbiased primary screen to profile the binding of full-length S against >9,000 human proteins and found significant S-host protein interactions, including one between S and human estrogen receptor alpha (ERα). After confirming this interaction in a secondary assay, we used bioinformatics, supercomputing, and experimental assays to identify a highly conserved and functional nuclear receptor coregulator (NRC) LXD-like motif on the S2 subunit and an S-ERα binding mode. In cultured cells, S DNA transfection increased ERα cytoplasmic accumulation, and S treatment induced ER-dependent biological effects and ACE2 expression. Noninvasive multimodal PET/CT imaging in SARS-CoV-2-infected hamsters using [18F]fluoroestradiol (FES) localized lung pathology with increased ERα lung levels. Postmortem experiments in lung tissues from SARS-CoV-2-infected hamsters and humans confirmed an increase in cytoplasmic ERα expression and its colocalization with S protein in alveolar macrophages. These findings describe the discovery and characterization of a novel S-ERα interaction, imply a role for S as an NRC, and are poised to advance knowledge of SARS-CoV-2 biology, COVID-19 pathology, and mechanisms of sex differences in the pathology of infectious disease.

To identify discrete structural domains involved in S-ER interactions we used bioinformatics and 116 the EXaSCale smArt pLatform Against paThogEns (EXSCALATE) supercomputing platform 21 . First, 117 a network analysis confirmed prominent interactions between ERα, ERβ, and other proteins (Fig. 118 2a) including known interactions with NR coactivators 1, 2, and 3 (NCOA1, NCOA2, NCOA3) 119 (Extended Table 2 ). NCOAs bind to the activation function 2 (AF-2) region on ERs to modulate 120 ligand-mediated activation of ER transcription via a region called the NR box which includes an LXD 121 motif, known as the LXXLL core consensus sequence (where L is leucine and X is any amino acid) 122 22 (Extended Data Fig. 1) . This motif is necessary and sufficient for NRC binding to ligand-bound 123 ERs and for ER function. Using this information and the EXSCALATE platform, we identified two 124 ER-interacting LXD-like motifs in the S sequence (Fig. 2b) . We then analyzed and compared the Table 3 ) to search for conserved LDX-like motifs. We found discrete shared amino acid 128 patterns across species (Extended Data Fig. 2) , suggesting a conserved functional role of these 129 regions. We then verified the conservation of the two LDX-like motifs and found the LPPLL pattern 130 at residues 861-865 conserved among SARS-CoV-2, SARS-CoV, HCoV and MERS-CoV (Fig. 2c,   131 Extended Data Fig. 2) , while the LXD-like pattern IEDLL at residues 818-822 is also conserved 132 among the same viruses. It is also worth noting that a standard LEDLL pattern is found in HCoV-133 HKU1 in the same position. Notably, this LXD-like region, which is solvent-exposed in the S 134 experimental structures, retains well-defined 3D structural characteristics (alpha-helix folding, red in 135 Fig. 2c) found in the ER-NCOA complexes 3UUD 23 and 3OLL 24 . On the contrary, the LXXLL motif, 136 less solvent-exposed, is unstructured (blue in Fig. 2c) . It is well known, however, that the motif 137 region may assume the alpha-helix folding only after the binding with ER 25 , implying a conformational 138 rearrangement of the two molecular partners. 139 We then performed in silico molecular docking simulations to identify a putative S-ER binding 140 mode. An S-ERα 3D model was built based on PDB 6VYB in its wild-type and fully glycosylated 141 form and PDB 3OLL, which contained both E2 and NCOA1 24 . For protein-protein docking, S in 142 glycosylated form and ERα/β were used as receptor and ligand, respectively. The top 100 predicted 143 complex structures were selected, and the ten best hypotheses were visually inspected to confirm 144 the reliability of the calculation 26 . Since the revised LXD-like motifs identified were located outside 145 the S RBD, the ability of ER to interact outside this region was evaluated by means of blind-146 docking 26 . The best binding hypothesis included evidence of a high-affinity ER interaction towards 147 the lateral region of S, which includes the so-called "fusion peptide portion" (Extended Data Fig. 3) . 148 The structural information that ER residues are recognized by NCOA was then used to guide S-ER 149 docking studies by optimizing protein-protein interactions. The best binding hypothesis obtained 150 highlighted the binding of ER to the S region containing the two described LDX-like motifs (Fig. 2d , 151 e). Several Molecular Dynamics (MD) simulations of the best docking complexes were then carried 152 out. MD results showed the formation of a strong interaction between ER and S even in the first 153 phase of the recognition (Extended Data Fig. 4 ) We then extracted 9 peptide sequences (SP1-9) 154 based on their proximity to the putative S-ER binding region and their LXD-like domain sequence 155 similarities (Fig. 2f) , synthesized each peptide and examined their effects on ERα-mediated 156 transcriptional activation (GeneBLAzer™ ERα/β-UAS-bla GripTite™ cells). One peptide, (SP7), 157 which solely contained the LPPLL motif, significantly increased the potency of E2 in stimulating ERα 158 transcriptional activation (Fig. 2g, Extended Data Fig. 5 ).

159 160 S modulates ER-dependent biological functions 161 We used MCF-7 nuclear extracts and the TransAM TM ER assay 27 to measure E2-stimulated ERα 162 DNA binding. We found that full-length S (IC50 = 2.4 ± 1.5 nM) and S trimer (IC50 = 72 ± 2.6 nM), but 163 not S-RBD, inhibited E2-stimulated ERα DNA binding (Fig. 3a, Extended Data Fig. 6a, b) . We also 164 assessed whether S affected ER-mediated transcriptional activation using ERα-LBD and ERβ-LBD nuclear-enriched distribution pattern and no S signal (Fig. 3c) . In contrast, overexpression of either 175 WT or mutant S increased ERα cytoplasmic labeling (Fig. 3c) , indicating that S, either with or without 176 an intact furin cleavage site, leads to an increase in ERα and its redistribution from the nucleus to 177 the cytoplasm. Notably, the S-induced increase in cytoplasmic ERα labeling was not due to 178 increases in ERα mRNA, though S transfection did significantly alter the expression of GREB1, a 179 known ERα-target gene (Extended Data Fig. 7) . 180 E2 increases MCF-7 cell proliferation, whereas raloxifene, a potent selective ER modulator 181 (SERM), blocks MCF-7 cell proliferation 28 . As expected, E2 treatment increased MCF-7 cell 182 proliferation and this effect was blocked by raloxifene (2 µM) (Fig. 3d) . Intriguingly, S (10 ng/ml) 183 itself also increased MCF-7 cell proliferation, and this effect was also blocked by raloxifene (2 µM) 184 indicating it was ER-dependent. Notably, exposure of MCF-7 cells to E2 and S did not lead to an 185 additive proliferation response and neither E2 nor S induced proliferation in an ER-lacking cell line 186 (MDA-MB-231) (Extended Data Fig. 8) . 187 E2 inhibition of osteoclast differentiation is an ERα-dependent effect linked to its therapeutic 188 use 21,29,30 . RAW264.7, a murine macrophage cell line that expresses ERα, was induced to differentiate into osteoclasts by receptor activator of NF-κB ligand (RANKL) treatment in the 190 presence or absence of either E2 (1 nM), S (10 ng/ml), or their combination. E2 or S, as well as their 191 combination, abolished RANKL-induced osteoclast differentiation (Fig. 3e) and these effects were 192 completely blocked by raloxifene (2 µM), indicating they were ER-dependent. 193 To assess the relevance of S and ER signaling to SARS-CoV-2 cell entry mechanisms, we first 194 assessed the effect of E2 (1 nM) and S (10 ng/ml) on ACE2 levels in MCF-7 cells via ELISA. E2 or 195 S, as well as their combination, significantly increased ACE2 levels and in both cases, these effects 196 were blocked by raloxifene (2 µM) (Fig. 3f) , indicating the ACE2 increases were ER-dependent. We 197 also tested the effect of S and E2 on ACE2 expression in Calu-3 cells, a human airway epithelial 198 cell line used to study SARS-CoV-2 infection. Both E2 (200 nM) and S (10 ng/mL) increased ACE2 199 mRNA ( Fig. 3g, h) and ACE2 membrane protein expression (Fig. 3i, j) . In both cases, raloxifene 200 (20 µM) reverted these effects indicating they were ER-dependent. (Fig. 4a) . A 90-minute dynamic PET acquisition was performed immediately after 214 intravenous [ 18 F]FES injection to visualize the hamster body from the eyes to thighs (starting at the 215 skull vertex). Following PET, a CT scan was immediately performed as previously described 31 . (Fig. 4b-d) . No distinguishable [ 18 F]FES uptake was present in the lungs at Day -1 219 (Fig. 4b) . In contrast, the pattern of lung lesions detected via CT overlapped with the lung [ 18 F]FES 220 uptake at Day 7 (Fig. 4b) . Specifically, lung [ 18 F]FES uptake at Day 7 was significantly higher in 221 infected lung regions compared to these same sites at Day -1 and at unaffected areas at Day 7 ( Fig.   222 4c, d). Furthermore, [ 18 F]FES lung uptake at Day 7 was significantly after pretreatment with a 223 pharmacological dose (1 mg/kg, i.v.) of E2, indicating it reflected specific ERα binding (Fig. 4c, d) . 224 To further corroborate these findings, we performed ex vivo biodistribution studies using [ 18 F]FES.

At 120 min after [ 18 F]FES dosing, hamsters were euthanized, and the lungs were harvested and 226 counted for radioactivity. In line with the PET data, SARS-CoV-2-infected hamsters had significantly 227 greater lung [ 18 F]FES uptake compared to both uninfected hamsters and SARS-CoV-2-infected 228 hamsters pretreated with E2 (Fig. 4e) . 229 We exposed additional cohorts of male hamsters to SARS-CoV-2 as above and then sacrificed 230 them at Day 7 post-infection along with uninfected controls and collected their lungs to perform 231 fluorescent immunohistochemistry (IHC) with anti-S and anti-ERα antibodies. As expected, we 232 observed no S or ERα signal in uninfected hamster tissue (Extended Data Fig. 9 ). In contrast, the 233 vast majority of cells from infected hamsters that were positive for S exhibited ERα immunoreactivity 234 ( Fig. 4f and Extended Data Fig. 9 ). In infected hamsters, S-positive cells accounted for 14 ± 5%, 235 while ERα-positive cells accounted for 13 ± 5% of lung cells. Moreover, ERα in these cells showed hamsters, whereas uninfected hamsters showed low ERα labeling (Extended Data Fig. 9 ). 243 Interestingly, the vast majority of cells from infected hamsters with ERα labeling constituted alveolar 244 macrophages (Extended Data Fig. 9 ) and in such cells, we specifically observed gold nanoparticle 245 accumulation at the surface of SARS-CoV-2 virions (Fig. 4g) , confirming that S-ERα interact in vivo. 246 Finally, to extend these findings to humans, we performed S and ERα IHC in postmortem lung Indeed, as compared to female patients, hyperactivation of ER signaling in pulmonary tissue in 297 males has been associated with lower frequency but more severe progression of vascular 298 obliteration in pulmonary arterial hypertension 50 . In this context, our data support the notion that S-299 ERα interactions may lead to an overall dysregulation of ERα signaling and lung lesion development. In conclusion, we report novel interactions between the SARS-CoV-2 S and ERα that may have SoftwareX 1-2, 19-25 (2015) . To an eppendorf vial was added 0.25 M phosphate buffer pH 7.5 (80 µL), SARS-CoV-2 S (R683A, 556 R685A), His Tag (20 µg) (Acro Biosystems, #SPN-C52H4) in water, lactoperoxidase (2 µg), Na125I 557 (0.7 mCi), H2O2 (0.4E-03%). After incubation for 60 minutes at 35°C the reaction was quenched with 558 ascorbic acid (0.1 mg). The mixture was allowed to stand for 10 minutes, and then bovine serum 559 albumin (3 mg) was added. The mixture was then applied to a G-25 desalting column (GE 560 Healthcare) to separate the radioiodinated S from unreacted radioiodine. Approximately 0.2 mCi of 561 product was obtained. The purified radiolabeled protein was formulated with 1% BSA and 10% 562 sucrose, divided into aliquots and stored at -20 °C. The Invitrogen ProtoArray® Human Protein Arrays (ThermoFisher Scientific) are high-density 589 microarrays that contain more than 9,000 unique human proteins individually purified and arrayed 590 onto a nitrocellulose-coated slide. We followed the manufactured instructions to probe the arrays for 591 small tritiated molecules. Briefly, protein microarrays were blocked for 30-40 min in blocking buffer 592 (50 HEPES, 250 NaCl, 20 glutathione, 1 DTT, 1% (or 2%) BSA, 0.1% Tween). The blocking buffer 593 was then gently aspirated off and replaced with incubation buffer (Phosphate buffered saline, 0.1% 594 Tween, 1% (or 2 %) BSA, w/wo 1 nM 3H-E2) containing the radioligand ([125I] S (20 nM)). To 595 determine non-specific binding, 300 nM of S was added to the incubation mix. Every condition was 596 tested in duplicate. After incubation, slides were washed 3 times in ice-cold washing buffer 597 (Phosphate buffered saline, 0.1% Tween) and rinsed with ice-cold distilled water. Slides were then 598 air dried and placed into a Hypercassette™ and covered by a tritium-sensitive phosphor screen (GE 599 healthcare), exposed for 1 day and then scanned on a PerkinElmer Cyclone® scanner. The digitized 600 images were also analyzed using ProtoArray Prospector v5.2 and potential hits were identified using 601 the software's algorithm.

Surface plasmon resonance using immobilized SARS-CoV-2 S 604 SPR measurements were performed using a Biacore apparatus (Biacore) using CM5 sensor chips.

To find out the optimal pH for S (Acro Biosystems) immobilization, we conducted pH scouting. The 606 S was prepared in 10 mM sodium acetate buffer at pH 4.0 to 5.5. The best pH for immobilization 607 was 4.0 (Extended Data Fig. 11a) . After covalent immobilization there was approximately 8500 608 RUs of S on the sensor surface (Extended Data Fig. 11b) Interactome analysis 620 The STRING database 52 , that integrates all known and predicted associations between proteins, 621 including both physical interactions as well as functional associations has been used to analyses 622 functional associations between biomolecules. Each protein-protein interaction is annotated with a 623 'scores'. This score does not indicate the strength or the specificity of the interaction but the 624 confidence. All scores rank from 0 to 1, with 1 being the highest possible confidence. For the ER, the XRAY PDB model with code 3OLL was used, containing E2 and Nuclear receptor 647 coactivator 1 24 .

Protein-Protein Docking procedure 650 The input of two individual proteins, one for receptor and the other for ligand, were provided. In 651 particular, the S and ER was used as receptor and ligand respectively. Then, the HDOCK tool will 652 perform docking to sample putative binding modes through an FFT-based search method and then 653 scoring the protein-protein interactions. Finally, the top 100 predicted complex structures are 654 provided, and the best ten hypotheses were visually inspected to confirm the reliability of the were represented as the ratio of the emission wavelengths (460nm/530nm).

Human ERα transcriptional activation assays 685 The ERα activity was determined by the ERα transcription factor activation assay kit (ab207203, 686

Abcam) according to manufacturer's directions. Briefly, MCF-7 nuclear extracts (5 μg

Abcam) were treated with either S (0.01-300 nM; Acro Biosystems) S-RBD (1-100 nM

Extracts 689 were added to each well coated with the ER consensus binding site

:2000, 1 h, RT) and horseradish-691 conjugated secondary antibody (1:2000, 1 h, RT) that were provided with the kit. Colorimetric 692 reaction was measured by spectrophotometry at a wavelength of 450 nm

000 MCF-7 cells were placed in each chamber of a 4-well chamber slide

177399) containing 500 µl of Dulbecco's Modified Eagle Medium (DMEM) + 10%

The next day, cells 698 in each well were transfected with 1.5 µl of ViaFect reagent (Promega, cat no. E498A) and 0.5 µg 699 of empty pcDNA3.1 vector, or an expression vector for the wild-type (WT) SARS-CoV2 S with a C-700 terminal hemagglutinin (HA) epitope tag (pBOB-CAG-SARS-CoV2-S-HA) or the double mutant

RRID:Addgene_141347). pCAGGS-SARS2-S-FKO

After 48 hours, the cells were fixed in 4% 706 formaldehyde for 20 min at room temperature, rinsed with 1X phosphate-buffered saline

MB-070). The cells were then incubated 709 at 4°C overnight with 2 µg/ml each of anti-ER⍺ (H222) rat IgG1 monoclonal antibody (mAb

:100) and HA-probe (F-7) mouse IgG2a mAb

A-11006, 1:500). The cells were then washed 4 times with PBS-T 717 for 5 minutes in the dark and rinsed with PBS. Each slide was carefully detached from its gasket, 718 and immediately mounted with a 1.5T glass coverslip using EverBrite Hardset Mounting Medium 719 with DAPI (Biotium, cat no. 23004). The mounted slides were allowed to cure for 24 hours in the 720 dark at room temperature, and stored in a slide box at 4°C. The slides were imaged at

Each image represents the average of 16 scans

-23 cells were obtained from ATCC and growth in DMEM without phenol red, 726 supplemented with 10% fetal bovine serum (FBS), penicillin/streptomycin at 37 °C in a 5% CO2 and 727 95% humidified atmosphere

Before treatments, to reduce estrogen levels in FBS and avoiding any interference, cells were 729 cultured for 24h in medium containing 5% dextran-coated charcoal treated serum. Then, cells were 730 treated for 24h with E2 (Sigma-Aldrich; Cat: E1024; Batch: SLCC8875), S (R&D Systems; Cat

Cell proliferation was measured using a 5-bromo-2-deoxyuridine (BrdU) labeling and a proliferation 735

BrdU was added to 736 wells for 24h and then cells were fixed using Fixing Solution. Then, cells were washed and were 737 incubated with detector anti-BrdU antibody for 1 hour at RT. After the incubation cells were washed 738 and incubated with the horseradish peroxidase conjugated goat anti-mouse antibody for 30 minutes 739 at RT. For the detection the chromogenic substrate tetra-methylbenzidine (TMB) was added and the 740 colored product has been detected using a spectrophotometer (450/550 nm). Values were given as 741 percentage of cells grown only in serum-free medium

At day 3, cells were examined 749 under the microscope and refed with fresh medium containing RANKL. At day 6, RAW-OC 750 population was prevalent and ready for treatments and then biochemical studies. Cells were treated 751 with E2 (1 nM), S (10 ng/ml) and raloxifene (2 µM) and the combination of them for 24h. After 24 h 752 of treatment, we quickly collect the cells by sterile tubes and resuspended the cells using PBS (pH 753 7.4) to dilute cell suspension to the concentration of approximately 1 million/ml. Then, cells were 754 subjected to repeated freeze-thaw cycles to let out the inside components

Tartrate Resistant Acid Phosphatase (TRAP) activity was performed using an ELISA kit from 757

The standard curve, reagents and samples were prepared following 758 manufacturer's protocol. Briefly, 50 µl of standard were added to standard wells and 40 µl of sample-759 to-sample wells and then added 10 µl of anti-TRAP antibody to sample wells and 50 µl of 760 streptavidin-HRP to sample wells and standard wells. The plate was incubated 1 hour at 37℃. The 761 plate was washed 5 times with wash buffer and 50 µl of substrate solution A were added to each 762 well plus 50 µl of substrate solution B and incubated 10 minutes at 37℃ in the dark. Finally, 50 µl of 763 stop solution to each well were added and the optical density was immediately

Fluorescence-based assay for ACE2 in MCF-7 cells

penicillin/streptomycin at 37 °C in a 5% CO2 and 95% humidified 768 atmosphere. For each assay cells were seeded at the density of 10 4 cells/cm 2 . Before treatments, 769 to reduce estrogen levels in FBS and avoiding any interference, cells were cultured for 24h in 770 medium containing 5% dextran-coated charcoal treated serum

particular, the concentration tested 772 for S was 10 ng/ml, for raloxifene 2 µM

Cells were cultured in a 96-well plate. Cells were washed in ice-cold PBS and then fixed with 2%

After further washes, to prevent the non-specific binding, 775 cells were blocked with a 10% Bovine Serum Albumin solution in PBS for 20 minutes and then 776 incubated with the Alexafluor 647-conjugated antibody for Human ACE-2 (R&D Systems)

Calu-3 cell line was obtained from ATCC and maintained in Eagle's Minimum Essential Medium 782 (EMEM; Lonza) supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine and 1% 783 penicillin/streptomycin solution at 37°C in a humidified atmosphere of 5% CO2

RNA extraction and qRT-PCR

Total RNA was extracted from cell lines 788 using RNeasy® Plus Mini Kit (Qiagen). cDNA was made using GenePro thermal cycler (Bioer)

Primers for GAPDH (forward primer AATCCCATCACCATCTTCCA; reverse primer 792 TGGACTCCACGACGTACTCA) and ACE2 (forward primer AAAGTGGTGGGAGATGAAGC

793 reverse primer GAGATGCGCGGTCACAGTAT) were used. Samples were assayed in runs which 794 were composed of 3 stages: hold stage at 95°C for 20 minutes, PCR stage at 60°C for 25 minutes 795 and melt curve stage 95°C for 1 minute, 60°C for 20 minutes, and 95°C for 1 minute again

After 72 hours, cells were washed, fixed with 4% formaldehyde, permeabilized 802 with 0.1% Triton X-100 in PBS and stained overnight at 4°C with ACE2 protein-specific antibody 803 (Abcam Ab15348)

Invitrogen Life Technologies) for 1 hour at 37°C. Nuclei were labeled with Hoechst 33342 805 (Thermo Fisher Scientific) for nuclear staining for 20 minutes

) and images were 807 acquired through confocal microscope LSM 800, magnification 60X, software ZN 2.1 blue Edition 808 (Carl Zeiss, Jenza, Germany) and analyzed with ImageJ software

Animal studies 814 All animal protocols were approved by the Johns Hopkins University Biosafety, Radiation Safety, 815 and Animal Care and Use Committees. Male golden Syrian hamsters (7 to 8 weeks of age) were