key: cord-0264123-9mrde93x
authors: Labadie, Thomas; Roy, Polly
title: A non-enveloped arbovirus released in lysosome-derived extracellular vesicles induces super-infection exclusion
date: 2020-08-11
journal: bioRxiv
DOI: 10.1101/2020.06.11.146357
sha: 6a66ff47e5130951f6a69954a563530bba4aee6c
doc_id: 264123
cord_uid: 9mrde93x

Recent developments on extracellular vesicles (EVs) containing multiple virus particles challenge the rigid definition of non-enveloped viruses. However, how non-enveloped viruses hijack cell machinery to promote non-lytic release in EVs, and their functional roles, remain to be clarified. Here we used Bluetongue virus (BTV) as a model of a non-enveloped arthropod-borne virus and observed that the majority of viruses are released in EVs, both in vitro and in the blood of infected animals. Based on the cellular proteins detected in these EVs, and use of inhibitors targeting the cellular degradation process, we demonstrated that these extracellular vesicles are derived from secretory lysosomes, in which the acidic pH is neutralized upon the infection. Moreover, we report that secreted EVs are more efficient than free-viruses for initiating infections, but that they trigger super-infection exclusion that only free-viruses can overcome. Author summary Recent discoveries of non-enveloped virus secreted in EVs opened the door to new developments in our understanding of the transmission and pathogenicity of these viruses. In particular, how these viruses hijack the host cellular secretion machinery, and the role of these EVs compared with free-virus particles remained to be explored. Here, we tackled these two aspects, by studying BTV, an emerging arthropod-borne virus causing epidemics worldwide. We showed that this virus is mainly released in EVs, in vivo and in the blood of infected animals, and that inhibition of the cell degradation machinery decreases the release of infectious EVs, but not free-virus particles. We found that BTV must neutralize the pH of lysosomes, which are important organelles of the cell degradation machinery, for efficient virus release in EVs. Our results highlight unique features for a virus released in EVs, explaining how BTV transits in lysosomes without being degraded. Interestingly, we observed that EVs are more infectious than free-virus particles, but only free-viruses are able to overcome the super-infection exclusion, which is a common cellular defense mechanism. In conclusion, our study stresses the dual role played by both forms, free and vesicular, in the virus life cycle.

We also confirmed this phenomenon in vivo in bovine blood samples positive for BTV-8 (S1B Fig)  139 collected during BTV outbreaks in France in 2019 (Fig 2A) . Viral titrations of the EVs and free virus 140 particles fractions separated by differential centrifugation revealed that virus particles were mainly 141 contained within EVs (Fig 2B) . However, no significant difference in infectivity between free virus To determine the origin of EVs containing BTV virus particles, we tested the presence of specific 155 cellular markers. Among the different markers of EVs assessed, we determined the presence of 156 Annexin A2, the tumour susceptibility gene 101 (TSG101), LC3-I and LC3-II, and the lysosomal 157 associated protein LAMP1 by western blot (Fig 3B and S2A Fig). Note that TSG101 is a MVBs 158 marker and LC3B an autophagy related protein. To identify the cellular mechanisms involved in virus 159 packaging in EVs, we first investigated the potential role of autophagy, using the 3-methyladenin 160

(3-MA) that inhibits class III PI3K activity. We observed that 3-MA failed to significantly decrease the secretion of infectious EVs from sheep cells infected at a MOI of 10 ( Fig 3B) , suggesting that the 162 induction of autophagy is not essential for the secretion of infectious EVs. However, inhibition of 163 autophagosome -lysosome fusion with chloroquine (CQ), led to a significant reduction of infectious 164

EVs released as compared to the control (Fig 3B) , indicating that the late steps of autophagy are 165 necessary for infectious EVs. In addition, inhibition of MVBs regulator protein HSP90 using 166 geldanamycin in BTV-infected cells (MOI=10) also led to a significant reduction of infectivity 167 measured in the EVs fraction, as compared to the control, indicating a possible role for MVBs in the 168 release of infectious EVs. In contrast, GW4869, a drug that inhibits the release of exosomes (small 169 vesicles ~200nm) derived from MVBs, did not affect the secretion levels of EVs containing BTV 170 ( Fig 3B) . As expected, except for GW4869, these drugs also had an inhibitory effect on the virus 171 However, these EVs cannot be exosomes, based on the results obtained with the GW4869 inhibitor. 175

Following recent description that autophagy and MVBs share common molecular machinery and 176 organelles such as amphisomes [18], we asked if EVs could be derived from secreted lysosomes after 177 the fusion with amphisomes. Therefore, we purified the EVs using an isopycnic ultracentrifugation 178 and found that most of the infectivity was associated with the low-density fractions (~1.05 to 1.08 179 g/mL), along with the cathepsin enzymes, a lysosomal marker ( Fig 3C) . Interestingly, the ratio of cell 180 surface LAMP1 to cytosolic LAMP1 was also significantly higher in infected cells (Fig 3D) , 181

indicating an increase of LAMP1 located at the plasma membrane in infected cells. The presence of 182 viral proteins was then investigated in the lysosomes of BTV infected cells. 183

Using super resolution microscopy, we observed that in infected cells only, outer capsid protein VP5 184 as well as LAMP1 co-localised with the MVBs marker HSP90 (Fig 3E) , indicating a fusion between 185

MVBs and the autophagy compartments. Supporting these results, we also observed the co-186 localisation of LAMP1 and VP5 with TSG101, another MVBs marker (S2D Fig), NS3 is the only viral membrane protein and it is likely to be involved in the mechanism of EV 210

secretion. Therefore, we tested the presence of virus in EVs ( Fig 4A) following infection with 211 available NS3 mutants [14, 21, 22] . Two of these mutants impair the synthesis of the two 212 NS3 isoforms, respectively NS3 (mutant NS3M1) and NS3A (mutant NS3M14), while another with a 213 modified late domain motif (NS3GAAP) cannot bind TSG101 and one, unable to bind the outer capsid 214 protein VP2 (NS3stop211). Of the four mutant viruses, only BTV NS3M14 significantly reduced virus 215 particle release in EVs (Fig 4A) . To understand this phenotype, we analysed the localisation of the 216 mutant virus particles in infected cells and observed that the outer capsid protein VP5, and NS3, were 217 still co-localised with the lysosomal markers LAMP1 and cathepsin (Fig 4B, S3 Fig) , suggesting that 218 the absence of BTV NS3M14 in EVs was not due to a defect in virus trafficking. We then examined 219 lysosomes in cells infected with wild type BTV (BTVWT) and non-infected cells expressing a 220 LAMP1-GFP fusion protein in the presence of a fluorescent lysotracker specific to acidic organelles 221 ( Fig 4C) . Confocal microscopy revealed a significant decrease of lysotracker fluorescence intensity 222 in the lysosomes of BTVWT infected cells, when compared to non-infected cells, suggesting that 223 BTVWT neutralises the acidic pH of lysosomes ( Fig 4D) . The number of lysosomes detected in 224 infected cells was also significantly higher than in non-infected cells (Fig 3E and 3G ). In contrast, 225 cells infected with BTV NS3M14 showed comparable levels of lysotracker fluorescence to non-226 infected cells, suggesting that BTV NS3M14 was unable to counter lysosomes acidification. To provide 227 further confirmation, cells infected with BTV NS3M14 and non-infected cells were examined in the 228 presence of the lysosomal V-ATPase inhibitory drug bafilomycin A1 (Fig 3E and 3G ). Interestingly, 229 bafilomycin A1 significantly increased the levels of BTV NS3M14 in EVs (Fig 4H) , while not affecting 230 the intracellular replication of BTV NS3M14, whereas the drug had a strong inhibitory effect on the 231 replication of BTVWT (S2B Fig) . Consistent with this model, we observed that the intracellular 232 calcium levels of cells infected with BTVWT were significantly higher than the calcium levels in BTV 233 NS3M14 and non-infected cells (Fig 4I and 4J ). Together, our data strongly support that newly 234 synthesised BTV particles are released via EVs derived from secretory lysosomes after pH 235 neutralisation. 

We next considered if differences between EVs and free virus particles are due to cell defence 307 mechanisms, such as super-infection exclusion. Although not always understood, this cell defence 308 mechanism in which infected cells become resistant to a second infection has been observed for 309 several viruses. We first evaluated the presence of a super-infection exclusion mechanism in sheep 310 cells infected with BTV, using two different viruses, a non-modified BTV (BTVWT) and a fluorescent 311 BTV (BTVUnaG) encoding a fluorescent fusion protein VP6-UnaG. After controlling that BTVUnaG 312 virus particles are also mainly released in EVs (Fig 6A) , we first infected sheep cells with BTVWT, 313 followed by a second infection with BTVUnaG immediately (0 hpi) or at 1, 2, 3, 4 or 5 hpi (Fig 6B) . Supporting this mechanism, we observed the presence of the lysosomal cathepsin proteins in the same 393 low-density fractions as the viral particles after isopycnic density centrifugation, as well as co-394 localisation of the lysosomal markers LAMP1 and cathepsin with the viral proteins. Interestingly, the 395 BTV NS3M14 virus, which has a mutated first start codon and is only able to synthesis an NS3A 396 isoform of NS3 (lacking the N-terminal 13 amino-acids) [21], released significantly less virus 397 particles in EVs than BTVWT. Conversely, the BTV NS3M1 mutant (with a mutation in the second 398 start codon preventing the synthesis of the NS3A isoform) showed comparable levels of infectious 399

EVs to the BTVWT. We did not observe a change in the co-localisation of VP5 or NS3 with the 400 lysosomal markers in cells infected with BTV NS3M14 compared with BTVWT. In contrast, we found 401 that lysosome acidity was higher in non-infected cells and cells infected with BTV NS3M14, compared 402 with BTVWT. This suggests that NS3M14 is unable to counter lysosomal acidification as shown for 403 WT NS3. We were able to revert this phenotype using bafilomycin A1, an inhibitor of the vacuolar 404 type H+-ATPase, and showed that lysosomal pH disruption in BTV NS3M14 infected cells restored Interestingly, it has been proposed that the endoplasmic reticulum, in close spatial association with 411 lysosomes, regulates the calcium storage in these organelle [29, 30] . We previously showed that NS3 412 transits though the endoplasmic reticulum (ER), and that disrupting NS3 trafficking through the ER 413 causes release of immature particles. It would be thus interesting to explore the interplay between 414 NS3, the ER and lysosomes in order to determine how NS3 could regulate the secretion of 415 BTV particles in EVs. Altogether, our data support an original model of a virus particles release 416 mechanism involving MVBs and secretory lysosomes. Interestingly, this phenomenon is not 417 restricted to viruses, as it has also been described for intracellular uropathogenic E. coli [20] EVs on BTV induced pathogenicity, as infected ruminants variably respond to BTV infection, with cattle being mainly asymptomatic and sheep exhibiting more severe clinical signs, such as 437 haemorrhage and ulcer in the gastro-intestinal tract or muscle necrosis [35] . In this study, we were 438 able to identify infectious EVs in the blood of bovines infected in 2019, but it was not possible to 439 obtain any evidence of infectious EVs in blood samples of infected sheep. However, we note that 440 extracting EVs from frozen whole blood could potentially alter the integrity and the shape of the 441 observed membranes structure, and further experiments will be needed to explore these aspects in 442 more detail. It is important to note that BTV pathogenesis is markedly different in sheep and cattle 443 and is also dependent on the virus serotype by centrifugation (500xg -10 min), and infectivity was quantified by a TCID50 method. PT infected 505 cells were lysed by three cycle of freeze thawing. Lysed cells were resuspended in PBS and cell debris 506 was spun down at 500 g for 5 min. Viral RNA extraction was then performed on the harvested 507 supernatant as indicated below. 508

Extraction of the viral RNA was performed with a Qiamp viral RNA mini kit (Qiagen), followed by 510 a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of 511 BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) 512

System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified 513 with a real time quantitative PCR (qPCR), using the 2x SYBR Green qPCR Master Mix (Bimake, 514

Houston, TX, USA) and segment 7 specific primers (BTV1 S7/322F, 5′ 515 GACGCCAGAGATACCTTTTAC 3′; BTV1 S7/478R, 5′ CTTGAATCATATCCGGACCAC 3′) or 516 segment 10 specific primers (BTV1 S10/249F, 5' CATTCGCATCGTACGCAGAA 3'; BTV1 517 S10/464R, 5' GCTTAAACGCCACGCTCATA 3'). For absolute quantification of the cDNA copy 518 numbers, a standard curve was produced using a 10-fold serial dilution of a pT7-S7 plasmid of known 519 concentration as a template for amplification. Thermofisher Scientific) and centrifuged at 500xg for 10 min, followed by a 2000xg centrifugation 541 step for 10 min in order to completely removed lysed erythrocytes. Finally, a 10,000xg centrifugation 542 step was performed for 30 min and the pellet was resuspended in 60 µL PBS. All centrifugation steps 543 were performed at 4°C. 544

EVs purification by isopycnic gradient centrifugation was performed at 150,000xg for 4 hours at 4°C, 546 using a SW41 TI swinging bucket rotor (Beckman Coulter). EVs resuspended in 900 µL D-MEM 547 and diluted with 100 µL iodixanol (45%) to a final 5% concentration. EVs were layered on top of a 548 10-45% iodixanol discontinue gradient and harvested in 9 fractions, from the bottom of the tube using 549 a syringe. Fraction density was calculated by measuring the absorbance at 244nm after a 1:10,000 550 dilution and using a standard curve obtained by serial dilution of iodixanol. 551

Specific infectivity of BTV in EVs and free virus fractions correspond to the number of particles 553 required to infect a cell. We approximated the particles/mL as the genome copy number/mL measured 554 by qPCR using S10 specific primers after extraction and reverse transcription of the viral genome. 555

The number of pfu/mL was obtained by virus titration using a plaque assay.

Proteins were detected from either resuspended EVs or cell lysates. Cell monolayers were washed 558 twice with a PBS solution and lysed for 30 min at 4°C with a RIPA lysis buffer, 1X protease inhibitor 559 cocktail, and 5 mM EDTA (78438, Thermofisher scientific). Cell lysates, or EVs, were diluted in 4X 560

NuPAGE™ LDS Sample Buffer (Thermofisher scientific) to a final 1x concentration and incubated 561 at 95°C for 5 min. Proteins were then separated on a 10% SDS gel and blotted on a PVDF membrane. 562

When indicated, the membranes were cut horizontally for incubation with different antibodies. The Biotechnology), were incubated overnight at 4°C, followed by a 2 hours incubation with respective 567

Horseradish peroxidase-coupled secondary antibody (anti-mouse IgG ab97023, anti-guinea pig IgG 568 ab97155 and anti-rabbit IgG ab97051, Abcam). Luminescence was then detected using SuperSignal 569

West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific). The ImageJ software was 570 used to perform linear contrast enhancement. 571

To image EVs without sectioning, purified EVs were resuspended in D-MEM, adsorbed onto a 573 carbon-coated copper grid, and stained with a 1% solution of uranyl acetate. For imaging of EVs 574 sections, purified EVs were resuspended in 30 µL D-MEM (0% FCS) and mixed with a low volume 575 of Glutaraldehyde 25% (final concentration = 2.5%) (16220, Electron Microscopy Sciences). After 576 10 min of fixation at RT, EVs were briefly warmed to 37°C, and 16 µL of EVs were dropped on 4 577 µL of pre-melted low-melting agar (5% in water) and kept at 42°C before the addition of EVs. 578 so that drugs did not interfere with viral entry. These concentrations were selected because they were 599 already validated by previous studies on BTV from us and others [43, 44] . At 24 hpi, cell supernatants 600 were harvested for isolation of EVs and analysis of infectivity. For intracellular virus particle 601 quantification in presence or absence of the different drugs, the media culture of PT infected cells 602 was removed at 24 hpi, and cell monolayers were rinsed twice with PBS. Cells were then lysed by 3 603 successive cycles of freeze/thaw at -80°C/35°C. Cell lysates were then resuspended in 500 µL DMEM 604 and virus particles were quantified using a TCID50 method. 605

Cell surface protein expression of LAMP1 was measured by immunofluorescence using flow 607 cytometry. PT cells were seeded in 6-well plates for 24 h before infection with BTV-1 (MOI=10).

For superinfection exclusion analysis, sheep cells in 6 well-plates were infected with BTV-1 (BTVWT, 686 MOI=5) as described above. Simultaneously (0 hpi), or at 1, 2, 3, 4 or 5 hpi, cells were inoculated 687 with purified EVs or free virus particles of BTVUnaG (MOI=5) and placed at 35°C in a humidified 688 incubator (5% CO2) for 1 hour. BTVUnaG inoculum was then removed and replaced with D-MEM 689 (1% FCS). At 12 hpi (7 hpi of BTVUnaG infection), cell monolayers were washed twice with PBS, re-690 suspended using trypsin-EDTA (Thermo Fisher Scientific), fixed with paraformaldehyde 2% (w/v) 691 for 10 min, permeabilised with a solution of PBS-Triton x100 (0. (https://gitlab.com/inkscape/inkscape) 707

All relevant data are within the manuscript and its Supporting Information files. 709

Cell Walls and the Convergent Evolution of the Viral Envelope

How non-enveloped viruses hijack host machineries to cause 714 infection

A pathogenic picornavirus 716 acquires an envelope by hijacking cellular membranes

Coxsackievirus B 719 Exits the Host Cell in Shed Microvesicles Displaying Autophagosomal Markers

Hepatitis E 722 virus egress depends on the exosomal pathway, with secretory exosomes derived from 723 multivesicular bodies

Nonlytic viral spread enhanced by 726 autophagy components

Phosphatidylserine 729 Vesicles Enable Efficient En Bloc Transmission of Enteroviruses

JC 732 Polyomavirus Uses Extracellular Vesicles To Infect Target Cells

BK 735 Polyomavirus Hijacks Extracellular Vesicles for En Bloc Transmission

Vesicle-Cloaked Virus 738 Clusters Are Optimal Units for Inter-organismal Viral Transmission

Localization of the non-structural protein NS3 in 745 bluetongue virus-infected cells

A Viral Nonstructural Protein Regulates Bluetongue Virus Trafficking and 748 Release

Bluetongue Virus Nonstructural Protein 3 Orchestrates Virus 750 Maturation and Drives Non-Lytic Egress via Two Polybasic Motifs

Influence of Cellular Trafficking Pathway on Bluetongue 753 Virus Infection in Ovine Cells

Genome Segmentation Can Result from a Trade-Off between Genetic Content and Particle 756 Stability

The interplay between exosomes and autophagy -partners in 758 crime

760 Regulated lysosomal exocytosis mediates cancer progression

A TRP Channel Senses Lysosome Neutralization 763 by Pathogens to Trigger Their Expulsion

Interaction of Calpactin Light Chain (S100A10/p11) and a Viral NS Protein 766 Is Essential for Intracellular Trafficking of Nonenveloped Bluetongue Virus

Nonstructural Protein 3 of Bluetongue Virus Assists Virus 769 Release by Recruiting ESCRT-I Protein Tsg101

JC Virus infected choroid plexus 772 epithelial cells produce extracellular vesicles that infect glial cells independently of the virus 773 attachment receptor

Hepatitis A virus structural protein pX 775 interacts with ALIX and promotes the secretion of virions and foreign proteins through 776 exosome-like vesicles

Lysosome enlargement 781 during inhibition of the lipid kinase PIKfyve proceeds through lysosome coalescence

A Gene 784 Network Regulating Lysosomal Biogenesis and Function

Transcriptional Activation of Lysosomal Exocytosis Promotes Cellular Clearance

Lysosomes shape Ins(1,4,5)P3-evoked 792 Ca2+ signals by selectively sequestering Ca2+ released from the endoplasmic reticulum

β-Coronaviruses 795 use lysosomal organelles for cellular egress

Bluetongue virus coat 798 protein VP2 contains sialic acid-binding domains, and VP5 resembles enveloped virus fusion 799 proteins

Extracellular Vesicles Mediate Receptor-801 Independent Transmission of Novel Tick-Borne Bunyavirus

Extracellular vesicles: a new communication paradigm?

The Pathology and Pathogenesis of 806 Bluetongue

Bluetongue and epizootic 809 hemorrhagic disease viruses: recent developments with these globally re-emerging arboviral 810 infections of ruminants. Current Opinion in Virology

Persistent infection of BHK21/WI-2 cells with 813 rubella virus and characterization of rubella variants

The viral envelope is not sufficient 816 to transfer the unique broad cell tropism of Bungowannah virus to a related pestivirus

Picornavirus infection induces temporal release of multiple extracellular vesicle subsets 820 that differ in molecular composition and infectious potential

In vitro reconstitution of Bluetongue virus infectious cores

Bluetongue Virus Serotype 1 in French Corsica Island in

Bluetongue Virus Serotype 8 in France

Hsp90 Chaperones Bluetongue Virus Proteins and Prevents Proteasomal 831 Degradation

Autophagy Activated by Bluetongue Virus 833 Infection Plays a Positive Role in Its Replication

Mapping 836 molecular assemblies with fluorescence microscopy and object-based spatial statistics

The authors are very grateful to Stephan Zientara and Corinne Sailleau for providing the animal blood 464 samples (BTV national reference centre, ANSES, Maisons-Alfort, France). We also thank Eiko

(Thermo Fisher Scientific). Cells used for analysing the LAMP1 cytosolic content were fixed with 610 paraformaldehyde 2% (w/v) for 10 min and permeabilised with a PBS-Triton x100 (0.05% v/v) 611 solution for 5 min. The cells were then blocked using bovine serum albumin (PBS-BSA 1%) for 30 612 min and incubated with rabbit anti LAMP1 (Ab208943, Abcam) targeting the luminal domain, or an 613 isotope control antibody (ab172730, Abcam) for 2 hours at room temperature. Cells used for 614 analysing the cell surface LAMP1 content were labelled with the anti LAMP1 antibody for 2 hours 615 at 4°C prior fixation. Then all labelled cells were incubated for 2 h at RT in the presence of a species-616 specific A488 conjugated secondary antibodies (A21071, Thermo Fisher Scientific). After Thermofisher scientific), and A488-conjugated wheat germ agglutinin as a membrane label (W11261, 676Thermofisher scientific) for 10 min at RT prior cells permeabilisation. Microscopy images were 677 analysed with Icy, and VIBs were detected using the spot detector plugin, which provided NS2 spot 678 surfaces. Cell counting was performed based on the number of nuclei detected in images. For data 679 analysis, a cut-off was applied to keep all detected NS2 spots with a surface above 22µm 2 . The 680 frequency distribution of VIBs surface values were performed with a bin width of 15µm 2 and the 681 lognormal regression of the frequency distribution of the number of VIBs per cells were performed 682 after confirming that data were following a lognormal distribution. The total number of VIBs 683 measured at each time points is indicated in the S1 table.