key: cord-0255545-tfh15h9a
authors: Shmerling, Moriya; Chalik, Michael; Smorodinsky, Nechama I.; Meeker, Alan; Roy, Sujayita; Sagi-Assif, Orit; Meshel, Tsipi; Danilevsky, Artem; Shomron, Noam; Levinger, Shmuel; Nishry, Bar; Baruchi, David; Shargorodsky, Avital; Ziv, Ravit; Sarusi-Portuguez, Avital; Lahav, Maoz; Ehrlich, Marcelo; Braschi, Bryony; Bruford, Elspeth; Witz, Isaac P.; Wreschner, Daniel H.
title: LY6S, a New Interferon-Inducible Human Member of the Ly6a-Subfamily Expressed by Spleen Cells and Associated with Inflammation and Viral Resistance
date: 2021-12-17
journal: bioRxiv
DOI: 10.1101/2021.12.16.472998
sha: f651d68f0096b74f1e558507a884d12f1a829975
doc_id: 255545
cord_uid: tfh15h9a

Syntenic genomic loci on human chromosome 8 (hChr8) and mouse chromosome 15 (mChr15) code for LY6/Ly6 (lymphocyte antigen 6) family proteins. The 23 murine Ly6 family genes include eight genes that are flanked by the murine Ly6e and Ly6l genes and form an Ly6 subgroup referred to here as the Ly6a subfamily gene cluster. Ly6a, also known as Sca1 (Stem Cell Antigen-1) and TAP (T-cell activating protein), is a member of the Ly6a subfamily gene cluster. No LY6 genes have been annotated within the syntenic LY6E to LY6L human locus. We report here on LY6S, a solitary human LY6 gene that is syntenic with the murine Ly6a subfamily gene cluster, and with which it shares a common ancestry. LY6S codes for the interferon-inducible GPI-linked LY6S-iso1 protein that contains only 9 of the 10 consensus LY6 cysteine residues and is most highly expressed in a non-classical cell population. Its expression leads to distinct shifts in patterns of gene expression, particularly of genes coding for inflammatory and immune response proteins, and LY6S-iso1 expressing cells show increased resistance to viral infection. Our findings reveal the presence of a previously un-annotated human interferon-stimulated gene, LY6S, which has a one to eight ortholog relationship with the genes of the Ly6a subfamily gene cluster, is most highly expressed in spleen cells of a non-classical cell-lineage and whose expression induces viral resistance and is associated with an inflammatory phenotype and with the activation of genes that regulate immune responses. One Sentence Summary LY6S is a newly discovered human interferon-inducible gene associated with inflammation and with resistance to viral replication.

The human genome contains at least 48 genes and the mouse genome at least 61 genes, all 42 coding for proteins that contain a signature pattern of 10 cysteine residues, resulting in a 43 distinctive disulfide bonding pattern. Originally discovered as GPI-linked cell-surface proteins predicted by GenScan (Fig. 1c) is in the opposite direction to that of a known gene, C8orf31. 146 C8orf31, taxonomically restricted to primates, is transcribed from the complementary strand and 147 shows extensive exon overlap with exons from the GenScan predicted human LY6 gene. 148 Therefore, forward and reverse primers for the predicted chr8_73.103 gene serve respectively for 149 the C8orf31 transcripts as reverse and forward primers, and our initial attempts to identify The primers (F7 and R10, see Fig. 3c and Table S1 ) are specific solely for the predicted i', lane 2). In line with these results, increasing the number of PCR cycles to 40 showed, as 188 expected, highest expression in spleen followed by testis (Fig. S2a, lanes 14 and 16,   189 respectively). Significant expression was also detected in the parietal lobe of the brain and in the 190 spinal cord, and lower levels in the thalamus and temporal lobe (Fig. S2a, lanes 8, 13, 17 and 15 191 respectively). Because of the therapeutic implications of expression of LY6S in the human brain 192 (see Discussion) and in order to confirm these results, this experiment was repeated using a 193 different set of primers, the F8 and R12 forward and reverse primers (Table S1 ). Highest 194 expression was again observed in the spleen with significant expression observed in the parietal 195 lobe and corpus callosum with lower levels in the cerebral cortex and temporal lobe (Fig. S2b, 196 lanes 1, 8, 9, 4 and 7 respectively). With both sets of primers, namely the [F7 and R10] and [F8 197 and R12] pairs, the sizes of the observed RT-PCR products correlated precisely to those expected Both Ly6a, as well as other mouse Ly6 genes such as Ly6c1 (immediately distal to Ly6a) are 203 known to be highly induced by interferons and human LY6E located immediately upstream to 204 LY6S is induced by both Type I (alpha/beta) and Type II (gamma) interferons. We thus 205 postulated that LY6S may also be interferon-inducible. A perfect interferon-stimulated response 206 element (ISRE) positioned about 500 bp upstream to the LY6S gene supports this notion. The 207 ISRE appears as TTCCTGTGAAATGGAAATTCAGGA (underlined sequence is identical to the 208 ISRE conferring interferon inducibility on one of the human IFN-alpha genes), and conforms 209 precisely to the tandem GAAANNGAAA element that appears in most Type I Interferon 210 Stimulated Genes (ISGs). Furthermore, this same stretch of 24 nucleotides contains the small 211 palindromic consensus sequence TTCN2-4GAA (TTCCTGTGAA) that conforms to the consensus 212 gamma interferon activation site (GAS). We thus assessed LY6S expression in different human 213 cell lines, either untreated or exposed to IFN-alpha, IFN-beta or IFN-gamma, and compared for detailed information on LY6S-iso1 and iso2) corresponding to: (1) a LY6S protein, which 230 received a perfect GPI score from the GPI anchor predictor tool PredGPI, (Fig. S4 ) indicating 231 that it is a GPI-linked membrane bound protein (isoform #1, designated LY6S-iso1, in 3 out of 8 232 sequenced TOPO clones, Fig. 4a , isoform #1), (2) a C-terminally truncated LY6S protein, likely 233 to be secreted from the cell that retains both exon 1 (SP) and exon 2 coding sequences, but uses 234 an alternative splice donor site towards the 3'-end of exon 2 (isoform #2, designated LY6S-iso2, 235 for 4 out of 8 sequenced TOPO clones, Fig 4. b, isoform #2) and (3) a protein that retains the 236 exon 1 signal peptide (SP), but by use of an alternative splice acceptor site produces a frame-237 shifted protein C-terminal to the SP, that is also likely to be secreted from the cell (isoform #3, 238 for 1 out of 8 sequenced TOPO clones, Fig. 4c ). All the isoforms conformed to consensus splice 239 donor and splice acceptor sites ("gt" and "ag" and their flanking sequences, Fig. 4d ). Providing Although belonging to the LY6/uPAR family of proteins which normally contain 10 consensus 258 cysteine residues, the LY6S-iso1 protein described here is special in that it contains a non- immunizing peptide E abrogated staining (Fig. 6g , panel iii) confirming antibody specificity, 401 whereas peptide C which was not used for immunization (Fig. 6g, panel ii) had no effect. LY6S-402 iso1 localized to the cell surface (Fig. 6g, panel iv') , but was also observed within the cell (Fig. 403 6g, panel iv). LY6S-iso1 protein expression was barely detectable in other lymphoid tissues such 404 as thymus and tonsils, as assessed by immunohistochemical staining (Fig. 6h, panels ii and iii) , 405 yet was seen clearly in spleen cells (Fig. 6h, panel i) , stained under identical conditions. Spleen viruses, were at all times higher than those seen in fetal tissues (Fig. 3e, inset) and (b) that LY6S 444 expression was observed only following cytokine treatment of cells ( Fig. 3f and 3g, Fig. 6f , and Granulocyte colony-stimulating factor (CSF3) (Fig. 10) . The following inflammation-associated genes (see Table S2 ) were also upregulated in all three 563 LY6S-iso1-expressing cell lines-NRG1 (7. The present study documents a previously un-annotated human gene now designated LY6S. reasonable to assume, therefore, that the LY6S-iso1 protein also adopts a TFP structure.

Although the data indicate that human LY6S is homologous to the Ly6a subfamily of LY6 genes, Table S1 ). The arrow to the 

Lymphocyte antigens: Ly-4, Ly-6, and Ly-7. 879 Transplant Proc

Three-finger snake neurotoxins and Ly6 proteins targeting nicotinic acetylcholine 881 receptors: pharmacological tools and endogenous modulators

Emerging Role of Lymphocyte Antigen-6 Family of Genes in Cancer and Immune 884 Cells

Evolution and Medical Significance of LU Domain-Containing Proteins

PATE gene clusters code for multiple, secreted TFP/Ly-6/uPAR proteins that are 888 expressed in reproductive and neuron-rich tissues and possess neuromodulatory activity

Conserved structural determinants in three-891 fingered protein domains

CD59, an LY-6-like protein expressed in human lymphoid cells, regulates the 893 action of the complement membrane attack complex on homologous cells

Human protectin (CD59), an 18,000-20,000 MW complement lysis restricting 896 factor, inhibits C5b-8 catalysed insertion of C9 into lipid bilayers

Localization of the disulfide bonds in the NH2-terminal domain of the cellular 898 receptor for human urokinase-type plasminogen activator. A domain structure belonging to a 899 novel superfamily of glycolipid-anchored membrane proteins

Highly conserved cysteines within the Ly6 domain of GPIHBP1 are crucial 902 for the binding of lipoprotein lipase

Mapping the topographic epitope landscape on the urokinase plasminogen 904 activator receptor (uPAR) by surface plasmon resonance and X-ray crystallography

GPIHBP1, an endothelial cell transporter for lipoprotein lipase

Organization, evolution and functions of the human and mouse Ly6/uPAR 909 family genes

Concise review: stem cell antigen-1: expression, function, and 911 enigma

Transient expansion of Mac1+Ly6-913

G+Ly6-C+ early myeloid cells with suppressor activity in spleens of murine radiation marrow 914 chimeras: possible implications for the graft-versus-host and graft-versus-leukemia reactivity of 915 donor lymphocyte infusions

Phenotypic, morphological, and functional heterogeneity of splenic 917 immature myeloid cells in the host response to tularemia

IFN-gamma differentially regulates subsets of Gr-1(+)CD11b(+) myeloid cells in 919 chronic inflammation

Exploring the full spectrum of macrophage activation

Monocytes: subsets, origins, fates and functions

ADAR1, inosine and the immune sensing system: 925 distinguishing self from non-self

Intestinal epithelial cell up-regulation of LY6 molecules during colitis results in 927 enhanced chemokine secretion

Suppression of Tumorigenicity-14, encoding 929 matriptase, is a critical suppressor of colitis and colitis-associated colon carcinogenesis

Genenames.org: the HGNC and VGNC resources in 2019

Using native and syntenically mapped cDNA 934 alignments to improve de novo gene finding

Comparative genomics search for losses of long-established genes on the human 936 lineage

Three-dimensional solution structure of the extracellular region of the 938 complement regulatory protein CD59, a new cell-surface protein domain related to snake 939 venom neurotoxins

Structure-function relationships in the receptor for urokinase-type 941 plasminogen activator. Comparison to other members of the Ly-6 family and snake venom 942 alpha-neurotoxins

The phenotype of inflammatory macrophages is stimulus 944 dependent: implications for the nature of the inflammatory response

Inflammatory monocytes activate memory CD8(+)

T and innate NK lymphocytes independent of cognate antigen during microbial pathogen 948 invasion

The persistence of low-grade inflammatory monocytes contributes to aggravated 950 atherosclerosis

Bone-Marrow-Resident NK Cells Prime Monocytes for Regulatory Function 952 during Infection

Chronic stress promotes colitis by disturbing the gut microbiota and triggering 954 immune system response

Distinct regulatory mechanisms for 956 interferon-alpha/beta (IFN-alpha/beta)-and IFN-gamma-mediated induction of Ly-6E gene in B 957 cells

LY6E impairs coronavirus fusion and confers immune control of viral disease

LY6E mediates an evolutionarily conserved enhancement of virus infection by 961 targeting a late entry step

RNA interference screen for human genes associated with West Nile virus 963 infection

Identification of a 965 lineage of multipotent hematopoietic progenitors

Identification of clonogenic common lymphoid progenitors 967 in mouse bone marrow

Interferon-inducible LY6E Protein Promotes HIV-1 Infection

Cre-dependent selection yields AAV variants for widespread gene transfer 971 to the adult brain

Ly6a Differential Expression in Blood-Brain Barrier Is Responsible for Strain 973 Specific Central Nervous System Transduction Profile of AAV-PHP

The GPI-Linked Protein LY6A Drives AAV-PHP.B Transport across the Blood-976 Brain Barrier

Delivering genes across the blood-brain barrier: LY6A, a novel cellular receptor 978 for AAV-PHP.B capsids

The Neurotropic Properties of AAV-PHP.B Are Limited to C57BL/6J Mice

The metastatic microenvironment: Claudin-1 suppresses the malignant 982 phenotype of melanoma brain metastasis

ProtTest 3: fast selection of best-fit models of 984 protein evolution

STAR: ultrafast universal RNA-seq aligner

HTSeq--a Python framework to work with high-throughput 987 sequencing data

Moderated estimation of fold change and dispersion for RNA-989 seq data with DESeq2

Causal analysis approaches in Ingenuity 991 Pathway Analysis

The 1016 arrow at the right indicates the approximate position for the expected sizes of the LY6S RT-PCR 1017 products with these primers (236/220 bp for iso1 and iso2, respectively). (Panel c) RT-PCR of 1018 cDNAs prepared from the melanoma cells M2CB3 and YCB3 (panels [i] and [ii] respectively) 1019 and from MCF7 cells (panel [iii]) done with LY6S primers F8 and R12 (see Table S1). The cells 1020 were either treated with interferon beta (lanes 2) or not treated (lanes 1), as indicated. 1021 1022 1023 indicated by GC and AG. The initation and termination codons are in green and red underlined 1035 fonts

The signal peptide (SP) in both LY6S-iso1 and LY6-iso2 is indicated in green, bold, 1037 underlined fonts, and the first amino acid of the mature

Consensus cysteine (C) 1039 residues of LY6-like proteins present in LY6S-iso1 and LY6-iso2 are indicated in bold red fonts 1040 against a yellow background. In LY6S-iso1 the atypical S (serine) residue that replaces the LY6 1041 consensus sixth cysteine is shown by a bold white font against a blue background. The C-1042 terminal hydrophobic tail in LY6S-iso1 protein

(in blue bold fonts) provides the signal for addition of the GPI-anchor, as predicted 1044 with high probability and a 100% specificity by the PredGPI algorithm. The omega-site position 1045 to which the GPI-anchor attaches is the asparagine (N) residue immediately upstream to this C-1046 terminal sequence. The C-terminal dipeptide sequence VK (valine-lysine) present only in LY6-1047 iso2 and followed by a termination codon

S6 Sequence homology analysis of the Ly6a-2/Ly6e-1 (Ly6a) protein from the North 1073

American deer mouse (Peromyscus maniculatus bairdii) with human LY6S-iso1 and with 1074 all other LY6 proteins from the human chr8 LY6 locus. Panel a-The amino acid sequence of 1075 human LY6S-iso1 was compared with that of the Ly6a (synonymous with Ly6a-2/Ly6e-1) 1076 proteins from the North American deer mouse (Peromyscus maniculatus bairdii

ERAQGL peptide sequence forming the signature 1079 'fingerprint' of all Ly6a subfamily cluster proteins is boxed by the red rectangle. Panel b-The 1080 locations of all human LY6 genes (green arrows, transcriptional direction as indicated) on 1081 chromosome 8. LY6S is indicated by the red slashed arrow. Panels c, d and e-Homology 1082 comparison of Peromyscus maniculatus bairdii deer mouse Ly6a (designated perLY6a) protein 1083 with LY6S-iso1 and with all other LY6 proteins derived from the human chr8 LY6 genes. The 1084 'ERAQGL' sequence conserved in the C-terminal part of the signal peptides of the Ly6a 1085 subfamily cluster of genes cluster proteins is indicated in bold blue fonts; identical amino acids 1086 appearing in both perLY6-Sca-1 and hLY6S are in red bold fonts in both sequences

The number of amino acid identities as well as the percent identity with the reference PerLy6a 1089 sequence is indicated at the right. The proteins are divided into sequences from Exon SP

Exon C1-C5 (exon 2, coding for LY6 consensus cysteine residues 1-5) and Exon C6-C10 1091

Amino acid and nucleotide sequences and genomic derivations of the variable 1095 domains of anti-LY6S-iso1 mAb-5E12 The sequences of the anti-LY6S-iso1 mAb-5E12 mAb 1096 were determined as described in Materials and Methods, and its genomic derivation is as shown 1097 at the top of the Fig. s

S8 Detection of LY6S-iso1 protein with anti-LY6S-iso1 mAb 5E12 on the cell surface 1101 of cytokine treated melanoma and glioblastoma cells Human melanoma (M12C, panels i" and 1102 i'") or human glioblastoma (U87, panels ii") cells were grown with interferon-beta

) as indicated and assessed by flow cytometry with 1104 secondary antibody alone (red lines) or with mAb-5E12 followed by the fluorescently labelled 1105 anti-mouse secondary antibodies (blue lines). 1106 1107 1108 1109 (green staining, panels a', b', c' and d') or with DAPI (panels a, b, c and d)

YDFR-pQCXIP) or YDFR cells expressing 1121 LY6S-iso1 taken at an early passage or late passage [YDFR-iso1 (early passage) and YDFR-iso1 1122 (late passage)] were seeded in wells of a 96-well culture plate (15,000 cells were seeded per well 1123 for the experiment at the left and 20,000 cells were seeded for the experiment at the right). Cell 1124 growth was monitored by the alkaline phosphatase assay. Note that in the 96 well format early 1125 passage YDFR-iso1 cells (at the left) initially grew very slowly, then remained stationary 1126 followed by loss of cell viability

Profiling of selected cytokines/chemokines secreted by control and LY6S-iso1 1136 expressing U87 glioblastoma cells Panel a-Spent culture medium from U87 cells stably 1137 transfected with control pQCXIP plasmid (U87[control], panels a-i and a-i') or from U87 cells 1138 stably transfected with plasmid coding for LY6S-iso1

Cytokines/chemokines whose expression is increased in the 1142 LY6S-iso1 expressing cells are indicated in red fonts, whereas cytokines/chemokines whose 1143 expression remains unchanged are indicated by the grey fonts (note that CCL2 and CXCL12 1144 appear to be slightly down regulated in the LY6S-iso1 expressing cells and are indicated with 1145 dark grey fonts). Panel b-Side-by-side comparisons of the chemokines/cytokines upregulated in U87[LY6S-iso1] cells using optimal exposure times to demonstrate the upregulation. An internal 1147 control for equal loading of spent medium from both cell types was provided by MIF (lower two 1148 panels)

Quantitation for the fold increase in the secreted cytokines was performed by ImageJ 1150 analyses-as no signal was seen in the control cells for MIP-1alpha, its fold increase in LY6S-1151 iso1-expressing cells could not be calculated

CXCL2 C-X-C motif chemokine ligand 2 4.5 Produced by monocytes, neutrophils-expressed at sites of inflammation 2,393 CX3CL1 fractalkine, C-X3-C motif chemokine ligand 1 3.5The soluble form is chemotactic for T-cells and monocytes and not for neutrophils 925 CXCL5 C-X-C motif chemokine ligand 5 3.4 Involved in neutrophil activation 643 CXCL8 interleukin-8, granulocyte chemotactic protein 1 3.6 Involved in neutrophil activation, released in response to an inflammatory stimulus 3,269 CCL20 chemokine (C-C motif) ligand 20, MIP-3-alpha 2.1 Chemotactic factor, attracts lymphocytes and neutrophils, but not monocytes 1,281 CXCL1 C-X-C chemokine 1, neutrophilactivating protein 3 2.