key: cord-0066093-akpvnhsu
authors: Volná, Adriana; Bartas, Martin; Karlický, Václav; Nezval, Jakub; Kundrátová, Kristýna; Pečinka, Petr; Špunda, Vladimír; Červeň, Jiří
title: G-Quadruplex in Gene Encoding Large Subunit of Plant RNA Polymerase II: A Billion-Year-Old Story
date: 2021-07-09
journal: Int J Mol Sci
DOI: 10.3390/ijms22147381
sha: e855ba7c960f1cd1d9b2a985d123cb35f18292b0
doc_id: 66093
cord_uid: akpvnhsu

G-quadruplexes have long been perceived as rare and physiologically unimportant nucleic acid structures. However, several studies have revealed their importance in molecular processes, suggesting their possible role in replication and gene expression regulation. Pathways involving G-quadruplexes are intensively studied, especially in the context of human diseases, while their involvement in gene expression regulation in plants remains largely unexplored. Here, we conducted a bioinformatic study and performed a complex circular dichroism measurement to identify a stable G-quadruplex in the gene RPB1, coding for the RNA polymerase II large subunit. We found that this G-quadruplex-forming locus is highly evolutionarily conserved amongst plants sensu lato (Archaeplastida) that share a common ancestor more than one billion years old. Finally, we discussed a new hypothesis regarding G-quadruplexes interacting with UV light in plants to potentially form an additional layer of the regulatory network.

G-quadruplexes (G4s) in nucleic acids are noncanonical four-stranded structures, which are different from classical double-stranded DNA (B-DNA form) described in 1953 by James Watson, Francis Crick, and Rosalind Franklin [1, 2] . The basic building block for a G4 is a so-called guanine quartet formed by a G:G Hoogsteen base pairing, a structure which was first proposed by Gellert and his colleagues in 1962 [3, 4] . G4 formation usually requires monovalent cations with a positive charge, such as potassium (K + ) and sodium (Na + ) ions [5] . It has been demonstrated that G4s have the potential to frequently occur in specific genomic loci, generally called G4-forming sequences or putative G4 sites. These regions are widely found in various eukaryotes [6] [7] [8] , prokaryotes [9] [10] [11] , and even viruses [12] [13] [14] [15] . There is direct evidence of the functional relevance of such a structure; that is, G4s generally slow the replication process and induce instability during leading-strand replication [16, 17] , affect transcription by arresting RNA polymerase [18] [19] [20] , and stop translation of the protein if a stable G4 is formed in the transcribed mRNA [19, 21] . There are also studies suggesting that G4s are sensitive to UV light in vitro [22, 23] . However, G4s are still a neglected area in plant research when compared to humans and model animals. Limited knowledge on the topic was reviewed in [24] stating the unknown function of most plant G4s. In this study, we inspected the RPB1 gene, which encodes the large subunit of RNA polymerase II. RNA polymerase II (DNA directed RNA polymerase II) is usually associated with transcription of most structural genes. Eukaryotic RNA polymerase II consists of 12 subunits encoded by different genes [25, 26] , and in 2005, an exact 3D structure 2 of 13 of RNA-polymerase II from Saccharomyces cerevisiae was resolved [27] . The activity of RNA polymerase II is precisely regulated on several levels, but there are large differences among species, especially between mammals and plants. For example, mammalian RNA polymerase II is localized to the so-called transcription factories in the nucleus, while in plants, RNA polymerase II is rather more evenly distributed in the nucleoplasm [28] . Moreover, in plants, specialized polymerases have evolved (RNA polymerases IV and V, and organellespecific polymerases), so the specificity of substrates slightly differs [29] . Recently, a novel role of plant RNA polymerase II has been described-they silence retrotransposons and, thus, maintain genome stability [30] . RNA polymerase II is a multi-subdomain complex; the number of domains, as well as their positions, differs between plant species, which points to a complicated evolution for this enzyme, as reviewed in [26] . RNA polymerase protein complexes are considered to be one of the main regulators of gene expression processes in all living organisms [31, 32] . Thus, we decided to carry out our G4 analysis in the coding regions of the RPB1 gene in different evolutionarily distant organisms belonging to the plant kingdom. Although regulation of gene expression is more complex, levels of active RNA polymerase II are important for the overall level of transcription. Therefore, stable G4(s) in the coding sequence of the large subunit of RNA polymerase II could significantly reduce the level of transcription.

At first, we decided to study the conservation of potential G4-forming RBP1 sequences in evolutionarily distant plants. We aligned the RPB1 coding sequences of various representative green plants (Viridiplantae) and their closest relative groups, Rhodophyta and Glaucophyta, which all belong to the Archaeplastida supergroup [33] ; see Table 1 . The alignment revealed a single highly conserved G4 site (Figure 1a) , which we inspected further using in silico G4 predictions. It was found that at least 18 of the 20 sequences analyzed had a G4-forming potential. [35] . Mainly the second (II) and fourth (IV) guanine tracks show strong conservation of guanine residues. (b) Taxonomic tree with the time of branching estimations (MYA) constructed using the TimeTree tool [36] . Coccomyxa subellipsoidea is omitted here because of its unclear phylogeny. . The alignment was constructed using the MUSCLE algorithm [34] via UGENE workflow [35] . Mainly the second (II) and fourth (IV) guanine tracks show strong conservation of guanine residues. (b) Taxonomic tree with the time of branching estimations (MYA) constructed using the TimeTree tool [36] . Coccomyxa subellipsoidea is omitted here because of its unclear phylogeny.

The identified region was approximately 40 nucleotides long and contained four wellconserved guanine tracks. Their G4 forming potential was verified by four different methods, including QGRS mapper [37] ; the G4Hunter [38] algorithm; and the G4RNAscreener web server [39] , which comprises cGcC [40] and neural network approaches [41] . Considering the RPB1 CDS sequence from Arabidopsis thaliana (NM_119746.4), the G4 locus started at nucleotide position 1257 and ended at nucleotide position 1296. For the whole genome, the identified region occupies the coordinates of chromosome 4, 16,966,308-16,966,347. The fourth guanine track is 100% conserved, while the other tracks contain a certain plasticity, which can play an important role in the resulting conformation of the formed G4 ( Figure 1a ). From an evolutionary perspective, it is remarkable that this G4 locus has remained preserved for more than one billion years ( Figure 1b ). This finding was highly unexpected, because the vast majority of G4 loci are highly divergent and non-conserved, even between closely related species [42, 43] .

It can be hypothesized that the coding region of the RPB1 CDS is a priori conserved to maintain the unaltered amino acid sequence of the RNA polymerase II large subunit. Therefore, we inspected the whole RPB1 CDS (app. 6000 bp) and found that the 40-bp-long potential G4 locus is the most conserved (based on a multiple sequence alignment of RPB1 gene in plants; details are enclosed in the Supplementary Material S2). Although the G4 locus of the RPB1 gene is perfectly conserved among evolutionarily distant plant species, its paralogs in Arabidopsis thaliana (rpa1, rpc1, rpd1a, and rpd1b) have this locus modified by deletions and/or substitutions that disrupt G4-forming potential (see Supplementary Material S3). The largest and catalytic component of RNA polymerase II (RPB1) synthesizes mRNA precursors and many functional non-coding RNAs. RPB1 forms the polymerase active center [44] . Therefore, it is possible that the G4 characterized in our study plays an important regulatory role in vivo by affecting transcription of the RPB1 gene, thus forming a negative feedback loop, because it is generally accepted that G4s inhibit transcription rates [45] [46] [47] . Currently, there is also a whole-genome experimental map of G4s in multiple species, including Arabidopsis thaliana [48] , but no signal for the whole RPB1 gene was identified via this analysis. We suggest that this could possibly stem from the low-sequencing coverage of this particular site. In addition, only 2407 G4s were mapped across the five Arabidopsis thaliana chromosomes using this approach. More specifically, the total number of putative G4 sites in Arabidopsis thaliana is supposed to be at minimum five times higher if the strict threshold (1.4) of the G4Hunter prediction algorithm [49] is used. When using data from the Arabidopsis thaliana isoform sequencing [50] , we found that there is probably an RPB1 gene isoform comprising exons 1-8 (RPB1 has 13 exons in total). It is known that G4s can induce premature transcription termination [51] . However, the identified G4 locus is located within exon 6, which is relatively far away from the transcription termination site, so its possible role in this particular event is rather speculative. Nonetheless, various minor non-canonical splice site combinations were recently detected [52] .

Next, we inspected the G4-forming potential of selected sequences via circular dichroism (CD) measurements ( Figure 2a ). All inspected homologous sequences showed clear G4 signatures in differential CD spectra with the characteristic positive peaks at specific wavelength ranges depicted (Figure 2a ) by grey vertical dashed lines, whereas the negative control had no significant positive differential CD signal in this spectral region. Interestingly, we found sequence-dependent differences in molar ellipticity across tested species. Such variability might be caused by the different composition of tested sequences, resulting in different folding motifs and, thus, structure. When compared with G4-forming potential (Table 1) , only a single discrepancy was identified in the Cyanidioschyzon merolae sequence. More specifically, the RPB1 locus of this unicellular organism has low theoretical potential to form a G4 structure, and, therefore, the obtained CD signal was unexpected. This may be due to the involvement of other nucleotide residues in G4 tetrads (so-called mixed tetrads) that comprise, for example, cytosine residue(s) [53] . Unfortunately, no tool is currently available to determine the G4s formed by other nucleotides than guanine residues. However, existence of such G4s in vitro has been documented [54, 55] . [53] . Unfortunately, no tool is currently available to determine the G4s formed by other nucleotides than guanine residues. However, existence of such G4s in vitro has been documented [54, 55] . To better visualize the structure of a parallel G4 in the RPB1 gene, we selected one representative sequence from Bathycoccus prasinos and modeled its parallel G4 structure in silico. The model is based on information obtained by CD measurement, and it mimics parameters of existing PDB structures using the 3DNus algorithm [56] (Figure 2b ).

To further validate temperature stability and the reversibility of G4 folding, we performed thermal denaturation followed by the subsequent renaturation and a CD measurement at all three points (Figure 3a-j) . Temperatures above 80 °C are generally considered to be enough to melt all common G4 structures [57] , and our plots clearly show a decreasing G4 signature in the CD spectrum at 90 °C. After cooling and a short incubation period at 20 °C, the G4 structures renatured, serving as direct evidence of G4 formation. This phenomenon was not observed in the NC sample (Figure 3k ). To better visualize the structure of a parallel G4 in the RPB1 gene, we selected one representative sequence from Bathycoccus prasinos and modeled its parallel G4 structure in silico. The model is based on information obtained by CD measurement, and it mimics parameters of existing PDB structures using the 3DNus algorithm [56] (Figure 2b) .

To further validate temperature stability and the reversibility of G4 folding, we performed thermal denaturation followed by the subsequent renaturation and a CD measurement at all three points (Figure 3a-j) . Temperatures above 80 • C are generally considered to be enough to melt all common G4 structures [57] , and our plots clearly show a decreasing G4 signature in the CD spectrum at 90 • C. After cooling and a short incubation period at 20 • C, the G4 structures renatured, serving as direct evidence of G4 formation. This phenomenon was not observed in the NC sample (Figure 3k) .

In natural conditions, plants are often exposed to stress factors that may cause substantial DNA damage, such as high soil salinity, drought, or high irradiation. Plants need light for their growth; however, UV light of all wavelengths (UVC, UVB, and even UVA) induces DNA damage, mainly in the form of cyclobutane pyrimidine dimers [58] . Recently, it was found that low-energy UV radiation (266 nm) can photo-ionize human telomeric G-quadruplexes (GGG(TTAGGG)3) in the presence of K + ions in vitro [59] . Here, for the first time, we propose a hypothesis that G4s might function as additional UV sensors, allowing plants to rapidly regulate the rate of DNA replication, gene expression, and protein binding (Figure 4 ). need light for their growth; however, UV light of all wavelengths (UVC, UVB, and even UVA) induces DNA damage, mainly in the form of cyclobutane pyrimidine dimers [58] .

Recently, it was found that low-energy UV radiation (266 nm) can photo-ionize human telomeric G-quadruplexes (GGG(TTAGGG)3) in the presence of K + ions in vitro [59] .

Here, for the first time, we propose a hypothesis that G4s might function as additional UV sensors, allowing plants to rapidly regulate the rate of DNA replication, gene expression, and protein binding (Figure 4 ).

Schematic of UV interacting with G4s. Solar UV radiation penetrates the cell wall, cytoplasmic membrane, and nuclear membrane, and it can directly interact with genomic DNA. We hypothesize that G4s are exceptionally sensitive to UV due to their central metallic K + stabilizing ions and Hoogsteen base pairs forming stacked G4 tetrads. Generally, we propose that the interaction of G4s with UV leads to partial destabilization of the G4 structure and, thus, allows relatively rapid and finely tuned changes of molecular process rates, which affects signaling pathways and plant responses to UV irradiation.

To explore our hypothesis of G4 structures being a regulatory element of gene expression in plant cells, we exposed induced G4s to UV for one hour. Interestingly, we found that UV irradiation has a partial inhibitory effect on G4 folding, which is depicted in Figure 3a -j by the dashed lines. It is noteworthy that the decrease in molar ellipticity caused by UV varies between G4-forming oligonucleotides from different plant species. For example, Cyanidioschyzon merolae showed a mild decrease, and Arabidopsis thaliana showed a medium decrease. In contrast, Bathycoccus prasinos or Micromonas pusilla displayed a highly pronounced decrease in molar ellipticity associated with G4 presence (Figure 5a ). The described variability between plant species is obviously caused by a different nucleotide composition, and, thus, different folding substructures lead to variable G4 sensitivity to UV light. We also confirmed that there were no strand breaks in the oligonucleotides by polyacrylamide gel electrophoresis (PAGE) and that G4s were preserved before and after UV treatment, as verified by thioflavin T (ThT) staining (Supplementary Material S5), which is in accordance with the CD spectroscopy measurements. Figure 5b schematically depicts G4 with adjacent thymines in the loop resulting in thymine dimer formation and G4 structure loosening. Cyclobutane pyrimidine dimers can later be repaired by direct photoreactivation and/or excision repair [60] [61] [62] . . Schematic of UV interacting with G4s. Solar UV radiation penetrates the cell wall, cytoplasmic membrane, and nuclear membrane, and it can directly interact with genomic DNA. We hypothesize that G4s are exceptionally sensitive to UV due to their central metallic K + stabilizing ions and Hoogsteen base pairs forming stacked G4 tetrads. Generally, we propose that the interaction of G4s with UV leads to partial destabilization of the G4 structure and, thus, allows relatively rapid and finely tuned changes of molecular process rates, which affects signaling pathways and plant responses to UV irradiation.

To explore our hypothesis of G4 structures being a regulatory element of gene expression in plant cells, we exposed induced G4s to UV for one hour. Interestingly, we found that UV irradiation has a partial inhibitory effect on G4 folding, which is depicted in Figure 3a -j by the dashed lines. It is noteworthy that the decrease in molar ellipticity caused by UV varies between G4-forming oligonucleotides from different plant species. For example, Cyanidioschyzon merolae showed a mild decrease, and Arabidopsis thaliana showed a medium decrease. In contrast, Bathycoccus prasinos or Micromonas pusilla displayed a highly pronounced decrease in molar ellipticity associated with G4 presence (Figure 5a ). The described variability between plant species is obviously caused by a different nucleotide composition, and, thus, different folding substructures lead to variable G4 sensitivity to UV light. We also confirmed that there were no strand breaks in the oligonucleotides by polyacrylamide gel electrophoresis (PAGE) and that G4s were preserved before and after UV treatment, as verified by thioflavin T (ThT) staining (Supplementary Material S5), which is in accordance with the CD spectroscopy measurements. Figure 5b schematically depicts G4 with adjacent thymines in the loop resulting in thymine dimer formation and G4 structure loosening. Cyclobutane pyrimidine dimers can later be repaired by direct photoreactivation and/or excision repair [60] [61] [62] .

In vivo evidence of G4s has been studied in connection with cancer [63] ; genomic instability [64, 65] ; telomere formation [19] ; and the general ability to regulate transcription [66, 67] , translation [68] , and replication [69, 70] . It has been shown that chromatin remodeling, which affects G4 formation, can lead to parental loss of chromatin marks [71] , showing the important role of epigenetic modifications. Recently, a single-molecule fluorescent probe, which allows visualization of formed G4s in single DNA molecules in living cells, has been developed [72] . Unfortunately, none of these in vivo experiments were, to the best of our knowledge, performed in plants. However, as there is evidence of in vivo G4 formation in different model organisms, we expect that even in in vivo chromatin G4s can form in plants. It has been well documented for several decades that UV-A can induce thymine dimer formation in vivo even in algae [73] ; thus, G4s could serve as a sensor for UV radiation. Therefore, their partial disruption could lead to the initiation of specific processes, possibly resulting in the modulation of gene expression. [22] , which lead to conformational change and/or unfolding of G4 structure. Pyrimidine dimers are then repaired by photoreactivation and/or excision repair [60] [61] [62] , and G4s can then reform via refolding. Concurrently, important molecular processes (DNA replication and transcription) can take place.

In vivo evidence of G4s has been studied in connection with cancer [63] ; genomic instability [64, 65] ; telomere formation [19] ; and the general ability to regulate transcription [66, 67] , translation [68] , and replication [69, 70] . It has been shown that chromatin remodeling, which affects G4 formation, can lead to parental loss of chromatin marks [71] , showing the important role of epigenetic modifications. Recently, a single-molecule fluorescent probe, which allows visualization of formed G4s in single DNA molecules in living cells, has been developed [72] . Unfortunately, none of these in vivo experiments were, to the best of our knowledge, performed in plants. However, as there is evidence of in vivo G4 formation in different model organisms, we expect that even in in vivo chromatin G4s can form in plants. It has been well documented for several decades that UV-A can induce thymine dimer formation in vivo even in algae [73] ; thus, G4s could serve as a sensor for UV radiation. Therefore, their partial disruption could lead to the initiation of specific processes, possibly resulting in the modulation of gene expression. [22] , which lead to conformational change and/or unfolding of G4 structure. Pyrimidine dimers are then repaired by photoreactivation and/or excision repair [60] [61] [62] , and G4s can then reform via refolding. Concurrently, important molecular processes (DNA replication and transcription) can take place.

RPB1 coding regions (CDSs) from 40 model plant species that are evolutionarily distant from one another (Supplementary Material S6) were chosen for the bioinformatic analysis. The MUSCLE algorithm [34] running via UGENE workflow [35] was employed to construct multiple alignments of RPB1 coding regions (Supplementary Material S7). Analyzed RPB1 paralogs (FASTA sequences) in Arabidopsis thaliana are enclosed in Supplementary Material S8.

The potential to form G4s was predicted via the QGRS mapper [37] and G4screener web server [39] , and the resulting scores for the inspected putative G4 sites (obtained by four independent approaches) are enclosed in the supporting data for this article (Supplementary Material S1). The taxonomic tree with the time of branching estimations was constructed using the TimeTree tool [36] . G4 from Bathycoccus prasinos was modeled in a 3DNus environment [56] using a supervised approach based on a typical parallel conformation measured by CD assessment. The resulting structure was visualized using UCSF Chimera [74] .

All G4-forming oligonucleotides were purchased in HPLC purity from Elisabeth Pharmacon (Czech Republic) and inducted as reported earlier [75] . CD spectra were recorded in the range of 200-350 nm with a J-815 spectropolarimeter (Jasco, Tokyo, Japan). Spectra were recorded in steps of 0.5 nm with an integration time of 1 s, a bandwidth of 2 nm, and a scanning speed of 50 nm·min −1 with 3 accumulations. For all CD analyses, a final concentration of 50 mM KCl was used. To denature the G4 structures, a heating rate of 10 • C·min −1 was maintained using a programmable Peltier thermostat up to 90 • C followed by cooling to 20 • C for the CD spectra measurement of renatured G4 structures. A quartz glass cell with a 10 mm path length was used for all CD measurements. The sequence of negative control (NC) was as follows: AAGGGCAAGGAGTGGAGAGTGCGCGTGAATCTCATGTGCAA (designed using the G4Killer tool) [76] . To determine whether the prepared G4 structures have the potential to be a regulatory element, the oligonucleotides were illuminated by a lamp (Philips, TL 20W/12RS UV-B medical, Made in Holland) in a quartz glass cuvette for one hour at 4.1 W/m 2 UV-A and 4.1 W/m 2 UV-B radiation. The control and UV-irradiated samples were compared with respect to height of the CD peak (decrease in molar ellipticity for approximately half was judged as high). The decrease in molar ellipticity was computed, and, for later purposes, it was expressed on the categorical scale (low, moderate, and high decrease in molar ellipticity) using the highest and lowest decreases as borders and then evenly divided into these categories. For the detailed spectrum of the UV lamp used in this study, see the Supplementary Material S9. Differential CD spectra are enclosed in Supplementary Material S10.

Gel electrophoresis of the selected G4 samples was performed on a nondenaturing 15% acrylamide gel supplemented with 10 mM KCl. The gel was electrophoresed at room temperature (20 • C). After electrophoresis, the gel was stained in a bath of 0.5 µM ThT (which is a widely used fluorescent light-up probe for G4 formation [77] 

Informed Consent Statement: Not applicable.

Data Availability Statement: All supporting data generated for this manuscript are freely available here together with a short commentary: https://zenodo.org/record/4541573#.YCrckWj0lPY (accessed on 7 July 2021).

Molecular Structure of Nucleic Acids: A Structure for Deoxyribose Nucleic Acid

Rosalind Franklin and the Discovery of the Structure of DNA

Helix Formation by Guanylic Acid

RNA G-Quadruplex Structures Exist and Function in Vivo in Plants

Metal Ions Confinement Defines the Architecture of G-Quartet, G-Quadruplex Fibrils and Their Assembly into Nematic Tactoids

Genome-Wide Discovery of G-Quadruplex Forming Sequences and Their Functional Relevance in Plants

G-Quadruplex Nucleic Acids: Methods and Protocols

Analysis of Putative Quadruplex-Forming Sequences in Fungal Genomes: Novel Antifungal Targets? Microb

The Presence and Localization of G-Quadruplex Forming Sequences in the Domain of Bacteria

Quadruplexes in the Archaea Domain. Biomolecules 2020

More than Just a Kink in Microbial Genomes

Depth Bioinformatic Analyses of Nidovirales Including Human SARS-CoV-2, SARS-CoV, MERS-CoV Viruses Suggest Important Roles of Non-Canonical Nucleic Acid Structures in Their Lifecycles

Analyses of Viral Genomes for G-Quadruplex Forming Sequences Reveal Their Correlation with the Type of Infection

Quadruplexes in Viruses: Function and Potential Therapeutic Applications

New Frontiers in Virus Pathogenesis and Antiviral Therapy

Quadruplex-Induced Instability during Leading-Strand Replication

Replication of G Quadruplex DNA

Transcription Arrest by a G Quadruplex Forming-Trinucleotide Repeat Sequence from the Human c-Myb Gene

Friend or Foe: The Role of the G-Quartet in Anticancer Strategies

Alternative DNA Secondary Structure Formation Affects RNA Polymerase II Promoter-Proximal Pausing in Human

Conformational Dynamics of the RNA G-Quadruplex and Its Effect on Translation Efficiency

Single-Molecule Analysis of Thymine Dimer-Containing G-Quadruplexes Formed from the Human Telomere Sequence

Photocrosslinking of Human Telomeric G-Quadruplex Loops by Anti Cyclobutane Thymine Dimer Formation

Plant G-Quadruplex (G4) Motifs in DNA and RNA.; Abundant, Intriguing Sequences of Unknown Function

Subunit Compositions of Arabidopsis RNA Polymerases I and III Reveal Pol I-and Pol III-Specific Forms of the AC40 Subunit and Alternative Forms of the C53 Subunit

Step-Wise and Lineage-Specific Diversification of Plant RNA Polymerase Genes and Origin of the Largest Plant-Specific Subunits

Structures of Complete RNA Polymerase II and Its Subcomplex, Rpb4/7

Abundance and Distribution of RNA Polymerase II in Arabidopsis Interphase Nuclei

Multisubunit RNA Polymerases IV and V: Purveyors of Non-Coding RNA for Plant Gene Silencing

Inhibition of RNA Polymerase II Allows Controlled Mobilisation of Retrotransposons for Plant Breeding

Promoter-Proximal Pausing of RNA Polymerase II: A Nexus of Gene Regulation

RNA Polymerase II Activity Revealed by GRO-Seq and PNET-Seq in Arabidopsis

Kingdom-Wide Comparison Reveals the Evolution of Diurnal Gene Expression in Archaeplastida

MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput

A Unified Bioinformatics Toolkit

TimeTree: A Resource for Timelines, Timetrees, and Divergence Times

A Web-Based Server for Predicting G-Quadruplexes in Nucleotide Sequences

G4Hunter Web Application: A Web Server for G-Quadruplex Prediction

User Focused Interface for RNA G-Quadruplex Prediction

New Scoring System to Identify RNA G-Quadruplex Folding

Motif Independent Identification of Potential RNA G-Quadruplexes by G4RNA Screener

The Essential Schizosaccharomyces Pombe Pfh1 DNA Helicase Promotes Fork Movement Past G-Quadruplex Motifs to Prevent DNA Damage

Thermodynamically Stable and Genetically Unstable G-Quadruplexes Are Depleted in Genomes across Species

Architecture of RNA Polymerase II and Implications for the Transcription Mechanism

Direct Evidence for a G-Quadruplex in a Promoter Region and Its Targeting with a Small Molecule to Repress c-MYC Transcription

Quadruplex Formation within the Promoter of the KRAS Proto-Oncogene and Its Effect on Transcription

Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance. Front

Whole Genome Experimental Maps of DNA G-Quadruplexes in Multiple Species

Re-Evaluation of G-Quadruplex Propensity with G4Hunter

Transcript Isoform Sequencing Reveals Widespread Promoter-Proximal Transcriptional Termination in Arabidopsis

Mechanism and Manipulation of DNA: RNA Hybrid G-Quadruplex Formation in Transcription of G-Rich DNA

Animal, Fungi, and Plant Genome Sequences Harbor Different Non-Canonical Splice Sites

Structural Insights into the Anti-Cancer Activity of Quercetin on G-Tetrad, Mixed G-Tetrad, and G-Quadruplex DNA Using Quantum Chemical and Molecular Dynamics Simulations

The Consequences of Overlapping G-Quadruplexes and i-Motifs in the Platelet-Derived Growth Factor Receptor β Core Promoter Nuclease Hypersensitive Element Can Explain the Unexpected Effects of Mutations and Provide Opportunities for Selective Targeting of Both Structures by Small Molecules To Downregulate Gene Expression

Adenine Base Quartets: Possible Roles of Protons and Metal Ions in Their Stabilization

A Web Server for Automated Modeling and Visualization of Non-Canonical 3-Dimensional Nucleic Acid Structures

How Long Is Too Long? Effects of Loop Size on G-Quadruplex Stability

The Plant DNA Damage Response: Signaling Pathways Leading to Growth Inhibition and Putative Role in Response to Stress Conditions

Guanine Radicals Generated in Telomeric G-Quadruplexes by Direct Absorption of Low-Energy UV Photons: Effect of Potassium Ions

The Cell: A Molecular Approach

DNA Repair in Higher Plants; Photoreactivation Is the Major DNA Repair Pathway in Non-Proliferating Cells While Excision Repair (Nucleotide Excision Repair and Base Excision Repair) Is Active in Proliferating Cells

Protecting DNA from Errors and Damage: An Overview of DNA Repair Mechanisms in Plants Compared to Mammals

Structure of Two G-Quadruplexes in Equilibrium in the KRAS Promoter

G-Quadruplex DNA Drives Genomic Instability and Represents a Targetable Molecular Abnormality in ATRX-Deficient Malignant Glioma

FANCJ Helicase Defective in Fanconia Anemia and Breast Cancer Unwinds G-Quadruplex DNA to Defend Genomic Stability

Transcriptional Control by G-Quadruplexes: In Vivo Roles and Perspectives for Specific Intervention

Promoter G-Quadruplex Folding Precedes Transcription and Is Controlled by Chromatin

Irregular G-Quadruplexes Found in the Untranslated Regions of Human MRNAs Influence Translation

Rif1 Binds to G Quadruplexes and Suppresses Replication over Long Distances

Determinants of G Quadruplex-Induced Epigenetic Instability in REV1-Deficient Cells

Single-Molecule Visualization of DNA G-Quadruplex Formation in Live Cells

Wavelength-Dependent Induction of Thymine Dimers and Growth Rate Reduction in the Marine Diatom Cyclotella Sp. Exposed to Ultraviolet Radiation

UCSF Chimera-A Visualization System for Exploratory Research and Analysis

Bioinformatics Analyses and in Vitro Evidence for Five and Six Stacked G-Quadruplex Forming Sequences

G4Killer Web Application: A Tool to Design G-Quadruplex Mutations

Thioflavin T as a Fluorescence Light-up Probe for G4 Formation

Our acknowledgment belongs to the University of Ostrava for friendly and supportive working conditions, our collaborators who often contributed with good advice, and our colleagues from the Institute of Biophysics in Brno for their valuable comments and recommendations.

The authors declare no conflict of interest.