key: cord-0036658-bhqtip9x
authors: Vogel, Hans Gerhard
title: Cardiovascular Activity
date: 2008
journal: Drug Discovery and Evaluation
DOI: 10.1007/978-3-540-70995-4_2
sha: d2c7714f9582780b64e0a1568760a0a214a66812
doc_id: 36658
cord_uid: bhqtip9x

nan

α 1 -adrenoceptors are widely distributed and are activated either by norepinephrine released from sympathetic nerve terminals or by epinephrine released from the adrenal medulla. Receptor activation mediates a variety of functions, including contraction of smooth muscle, cardiac stimulation, cellular proliferation and activation of hepatic gluconeogenesis and glycolysis. In the CNS, the activation of α 1 -adrenoceptors results in depolarization and increased neuronal firing rate.

The α-adrenoreceptor population of plasma membranes from rat heart ventricles consists only of the α 1adrenoreceptor subtype. A constant concentration of the radioligand 3 H-prazosin (0.2-0.3 nM) is incubated with increasing concentrations of a non-labeled test drug (0.1 nM-1 mM) in the presence of plasma membranes from rat heart ventricles. If the test drug exhibits any affinity to α-adrenoceptors, it is able to compete with the radioligand for receptor binding äsites. Thus, the lower the concentration range of the test drug, in which the competition reaction occurs, the more potent is the test drug. The assay is used to evaluate the concentrationbinding characteristics of drugs atria the α 1 -adrenoceptor. 

Male Sprague-Dawley rats (200-300 g) are sacrificed by decapitation and the dissected hearts are placed in ice-cold preparation buffer A. After removal of the atria, ventricles (approx. 30 g from 40 rats) are minced with a scalpel into 2-3 mm pieces.

Ventricles are homogenized by Ultra-Turrax (1 g tissue/20 ml preparation buffer A), the homogenate is filtered through gauze, and centrifuged at 2000 g (4°C) for 10 min. The pellets are discarded; the supernatant is collected, and centrifuged again at 40,000 g for 20 min. The resulting pellets are resuspended in approx. 300 ml preparation buffer B, homogenized by Ultra-Turrax and centrifuged as before. The final pellets are dissolved (by Ultra-Turrax) in preparation buffer B, corresponding to 1 g ventricle wet weight/4 ml buffer. The membrane suspension is immediately stored in aliquots of 5-20 ml at -77°C. Protein content of the membrane suspension is determined according to the method of Lowry et al. with bovine serum albumin as a standard. At the day of the experiment the required volume of the membrane suspension is slowly thawed and centrifuged at 40,000 g (4°C) for 20 min. The pellets are resuspended in a volume of ice-cold rinse buffer, yielding a membrane suspension with a protein content of 1.0-1.5 mg/ml. After homogenization by Ultra-Turrax, the membrane suspension is stirred under cooling for 20-30 min until the start of the experiment.

For each concentration samples are prepared in triplicate.

The total volume of each incubation sample is 200 µl (microtiter plates). The binding reaction is started by adding 100 µl membrane suspension per incubation sample (1.0-1.5 mg protein/ml). The samples are incubated for 30 min in a shaking bath at 25°C. The reaction is stopped by withdrawing the total incubation volume by rapid vacuum filtration over glass fiber filters. Thereby the membrane-bound radioactivity is separated from the free activity. Filters are washed immediately with approx. 20 ml ice-cold rinse buffer per sample. The retained membrane-bound radioactivity on the filter is measured after addition of 2 ml liquid scintillation cocktail per sample in a liquid scintillation counter.

The following parameters are calculated:

• total binding • non-specific binding • specific binding = total binding-non-specific binding

The dissociation constant (K i ) of the test drug is determined from the competition experiment of 3 Hprazosin versus non-labeled drug by a computer-supported analysis of the binding data.

IC 50 = concentration of the test drug, which competes 50% of specifically bound 3 H-prazosin in the competition experiment [ 3 H] = concentration of 3 H-prazosin in the competition experiment.

K D 3 H = dissociation constant of 3 H-prazosin, determined from the saturation experiment.

The K i -value of the test drug is the concentration, at which 50% of the receptors are occupied by the test drug. The affinity constant K i [mol/l] is recorded and serves as a parameter to assess the efficacy of the test drug.

Binding of 3 H-WB 4101 to α 1 -adrenergic receptors in brain is used to test hypotensive activity as a possible side effect of neuroleptic drugs. The test E.5.1.6 is described in the chapter on neuroleptic activity. Couldwell et al. (1993) found that the rat prostate gland possesses a typical α 1 -adrenoceptor similar to that found in the vas deferens.

Several subtypes of the α 1 -adrenoceptor have been identified by pharmacological means (α 1A and α 1B , α 1C , α 1D ; α 1H , α 1L and α 1N adrenoceptors; Endoh et al. 1992; García-Sáinz et al. 1992 Ohmura et al. 1992; Regan and Cotecchia 1992; Satoh et al. 1992; Schwinn and Lomasney 1992; Veenstra et al. 1992; Aboud et al. 1993; Oshita et al. 1993; Vargas et al. 1993; Ruffolo et al. 1994; Minneman and Esbenshade 1994; Alexander et al. 2001) or by recombinant technology (α 1a/d , α 1b , α 1c adrenoceptors). They correspond to the pharmacologically defined α 1A , α 1B ,and α 1D adrenoceptors in native tissues (Bylund et al. 1994 (Bylund et al. , 1998 Hieble et al. 1995; Graham et al. 1996; Hieble and Ruffolo 1996; Alexander et al. 2001; Hawrylyshyn et al. 2004; Waitling 2006) .

Binding of the radioligand [ 3 H]-prazosin to the α 1A -adrenoceptor subtype can be measured in membranes prepared from male Wistar rat submaxillary glands (Michel et al. 1989 ).

Binding of the radioligand [ 3 H]-prazosin to the α 1B -adrenoceptor subtype can be measured in membranes prepared from male Wistar rat livers (Adolfo et al. 1989 ).

According to Eltze and Boer (1992) , the adrenoceptor agonist SDZ NVI 085 discriminates between α 1Aand α 1B -adrenoceptor subtypes in vas deferens, kidney and aorta of the rat and may therefore be used as a tool either to detect (rat vas deferens or kidney) or exclude (rat aorta) the functional involvement of "α 1Aadrenoceptors in smooth muscle contraction.". Stam et al. (1998) found that (+)-cyclazosin, which behaves as a selective, high-affinity α 1B -adrenoceptor ligand in binding experiments, did not show the profile of a α 1B -adrenoceptor antagonist in functional tissues.

Decreased blood pressure response in mice deficient of the α 1b -adrenergic receptor was found by Cavalli et al. (1997) . Kenny et al. (1995) used the contractile response of rat aorta to adrenaline after the application of various α 1 -adrenoceptor antagonists for characterization of a α 1D -adrenoceptor.

α 2 -adrenoceptors are widely distributed and are activated by norepinephrine released from sympathetic nerve terminals or by epinephrine released from the adrenal medulla or from some neurons in the CNS. The most extensively characterized action is the prejunctionally mediated inhibition of the release of neurotransmitters from many peripheral and central neurons. α 2 -adrenoceptors are also present at postjunctional sites, where they mediate actions such as smooth muscle contraction, platelet aggregation and inhibition of insulin secretion. Activation of postsynaptic α 2adrenoceptors in the brainstem results in an inhibition of sympathetic outflow in the periphery.

Clonidine is a centrally-acting antihypertensive agent, which lowers blood pressure mostly through reducing sympathetic tone by acting at the nucleus tractus solitarius in the brain stem (Kobinger and Walland 1967) . Clonidine can, however, act at both peripheral and central α 2 -receptors. Peripherally administered clonidine causes a brief increase in blood pressure followed by a prolonged decrease (Rand and Wilson 1968) . Functional studies ( 3 H-NE release) indicate a presynaptic mechanism for clonidine (Langer 1977 (Langer , 1981 Starke 1977) . However, lesioning studies fail to confirm a presynaptic location for clonidine receptors in either the CNS or periphery (U'Prichard et al. 1979; Bylund and Martinez 1981; U'Prichard et al. 1980) . No change in clonidine receptor sites was seen after 6hydroxydopamine lesions in cerebral cortex. This may be due to the fact that α 2 -receptors are both pre-and postsynaptic (Hieble et al. 1988) .

Alpha-adrenergic agonists most potently displace 3 H-clonidine. Ergot compounds, dopamine agonists and mianserin are also fairly potent (U'Prichard et al. 1977) . A survey on functions mediated by alpha-2 adrenergic receptors was given by Ruffolo et al. (1988) and on the role of neurotransmitters in the central regulation of the cardiovascular system by McCall (1990) . Although clonidine relieves the autonomic symptoms of morphine withdrawal (Gold et al. 1978) , there is no evidence for a direct α 2 /opiate-receptor interaction.

The purpose of this assay is to assess the interaction of hypotensive agents with central α 2 -receptors and determine possible clonidine-like mechanisms of action. Clonidine binding may also be relevant to the activity of other classes of drugs such as antidepressants that interact with α 2 -receptors. This yields 0.05 M Tris HCl, pH 7.7; containing NaCl (120 mM), KCl (5 mM), CaCl 2 (2 mM) and MgCl 2 (1 mM) 3. [4-3 H]-Clonidine hydrochloride (20) (21) (22) (23) (24) (25) (26) (27) (28) (29) (30) is obtained from New England Nuclear.

For IC 50 determinations: 3 H-Clonidine is made up to a concentration of 120 nM and 50 µl are added to each tube (yielding a final concentration of 3 nM in the 2 ml volume assay).

A stock solution of 0.1 mM clonidine is made up to determine non-specific binding. This yields a final concentration of 1 µM in the assay (20 µl to 2 ml). 5. Test compounds:

For most assays, a 1 mM stock solution is made up in a suitable solvent and serially diluted, so that the final concentrations in the assay range from 10 −5 to 10 −8 M. Seven concentrations are used for each assay and higher or lower concentrations can be used, depending on the potency of the drug.

Male Wistar rats are sacrificed by decapitation and the cortical tissue is rapidly dissected. The tissue is homogenized in 50 volumes of 0.05 M Tris buffer pH 7.7 (buffer 1b) with the Brinkman Polytron, and centrifuged at 40,000 g for 15 min. The supernatant is discarded and the final pellet rehomogenized in 50 volumes of buffer 2b. This tissue suspension is then stored on ice. The final tissue concentration is 10 mg/ml. Specific binding is 1% of the total added ligand and 80% of total bound ligand. Tissue homogenates are incubated for 20 min at 25°C with 3 nM 3 H-clonidine and varying drug concentrations, and immediately filtered under reduced pressure on Whatman GF-B filters. The filters are washed with 3 five ml volumes of 0.05 M Tris buffer pH 7.7, and transferred to scintillation vials. Specific clonidine binding is defined as the difference between total bound radioactivity and that bound in the presence of 1 µM clonidine.

IC 50 calculations are performed using log-probit analysis. The percent inhibition at each drug concentration is the mean of triplicate determinations.

Perry and U'Prichard (1981) described [ 3 H]rauwolscine (α-yohimbine) as a specific radioligand for brain α 2 -adrenergic receptors. Goldberg and Robertson (1983) reviewed yohimbine as a pharmacological probe for the study of the α 2 -adrenoreceptor. Pimoule et al. (1983) characterized [ 3 H]RX 781094 [(imidazolinyl-2)-2 benzodioxane-1,4] as a specific α 2 -adrenoceptor antagonist radioligand. Murphy and Bylund (1988) characterized alpha-2 adrenergic receptors in the OK cell, an opossum kidney cell line.

Binding of the radioligand [ 3 H]-rauwolscine to the α 2A -adrenoceptor subtype can be measured in membranes prepared from rabbit spleens (Michel et al. 1989) .

Binding of the radioligand [ 3 H]-yohimbine to the α 2B -adrenoceptor subtype can be measured in membranes prepared from male Wistar rat kidney cortices (Connaughton and Docherty 1989) .

Using 3 H-rauwolscine as ligand Broadhurst et al. (1988) studied the existence of two alpha 2 -adrenoreceptor subtypes. Bylund et al. (1988) used [ 3 H]-yohimbine and [ 3 H]rauwolscine to study alpha-2A and alpha-2B adrenergic subtypes in tissues and cell lines containing only one subtype. Brown et al. (1990) found that [ 3 H]-yohimbine labels at α 2A -and α 2B -adrenoceptors whereas [ 3 H]idazoxan labels the α 2A -adrenoceptor and, in addition, an imidazoline binding site.

Several subtypes of the α 2 -adrenoceptor have been identified by pharmacological means (α 2A -, α 2B -, α 2C -, and α 2D -adrenoceptors; Ruffulo 1990; Uhlén and Wikberg 1990; Gleason and Hieble 1992; Satoh and Takayanagi 1992; Takano et al. 1992; Ruffolo et al. 1993) or by recombinant technology as α 2a -, α 2b -, α 2cadrenoceptors (Bylund et al. 1994; Hieble et al. 1995; Hieble and Ruffolo 1996; Alexander et al. 2001; Waitling 2006) . Gleason and Hieble (1992) reported that the α 2adrenoreceptors of the human retinoblastoma cell line (Y79) may represent an additional example of the α 2Cadrenoceptor. Marjamäki et al. (1993) recommended the use of recombinant human α 2 -adrenoceptors to characterize subtype selectivity of antagonist binding.

All three α 2 -adrenoceptor types serve as autoreceptors in postganglionic sympathetic neurons (Trendelenburg et al. 2003) . Uhlén et al. (1994) found that the α 2 -adrenergic radioligand [ 3 H]-MK912 is α 2C -selective among human α 2A -, α 2B -and α 2C -adrenoceptors. Uhlén et al. (1998) tested the binding of the radioligand [ 3 H]RS79948-197 to human, guinea pig and pig α 2A -, α 2B -and α 2C -adrenoceptors and compared the values with MK912, RX821002, rauwolscine and yohimbine. [ 3 H]RS79948-197 was non-selective for the α 2 -adrenoceptor subtypes, showing high affinity for all three.

The existence of presynaptic receptors which regulate the evoked release of neurotransmitters has been functionally demonstrated in both peripheral and central nervous system (Langer 1981; Starke 1981; Raiteri et al. 1984; Miller 1998) . Presynaptic adrenergic α 2 -receptors regulate the evoked release of norepinephrine, comprising a short negative feedback loop. Alpha-2 agonists, such as clonidine and guanabenz, inhibit evoked release and alpha-2 antagonists, such as yohimbine and idazoxan, enhance evoked release.

The assay is used as a biochemical screen for agents which enhance or inhibit release of [ 3 H]norepinephrine ( 3 H-NE) and is particularly useful for testing receptor function of α 2 -adrenergic agonists and antagonists.

The procedures used emphasize delicate care of slices. By treating slices with great care, one is able to incubate at low tracer concentrations of 3 H-NE (25 nM), thus minimizing nonspecific labeling of releasable pools other than those in noradrenergic nerve terminals. It also permits the use of low (and more physiological) stimulation parameters, which allow the neurons to recover easily between stimulations and do not flood the synaptic cleft with released NE, which would compete with any applied drug thus decreasing sensitivity.

This assay is based on the method described by Zahniser et al. (1986) are made individually and removed from the razor blade by twirling an artist's paint brush underneath the slice. Care should be taken not to compress the slice or impale it on the bristles. The slices are placed in cold, oxygenated buffer (10-20 ml) and incubated at 35°C for 30 min under oxygen. After this incubation, the buffer is decanted, leaving the slices behind. Then 5 ml of cold oxygenated buffer is added, and enough [ 3 H]NE to bring the final concentration to 25 nM. This is then incubated and shaken for 30 min at 35°C under oxygen. After this step, the buffer is decanted and the "loaded" slices are rapidly placed on the nylon mesh in the stimulation chambers using a cut-off pipetman tip. D Assay

To establish a stable baseline, control buffer is pumped through the chamber for 1 h at a flow rate of 0.7 ml/min before the first stimulation. One hour is allowed to pass before the second stimulation. When drugs are used, each concentration is prepared in a separate flask in control buffer and allowed to equilibrate with the tissue slice 20 min before the second stimulation. The experiment is stopped 40 min after the second stimulation. Stimulation parameters are set at 5 Hz (2 ms duration) for 60 s, with 1 ms delay and voltage setting of 440 SIU (250 ). After the experiment is completed, the chambers are washed with distilled water for at least 20 min, then 200 ml of 20% methanol in distilled water, then distilled water again for at least 20 min.

After conversion of dpm, percent fractional release is calculated for each fraction, using the spreadsheet program. Percent fractional release is defined as the amount of radiolabeled compound released divided by the amount present in the tissue at that moment in time. "Spontaneous release" (SP) values are the average of the two fractions preceding and the first fraction in that range after the stimulation period. "Stimulated" (S) are the summed differences between the percent fractional release during stimulation and the appropriate SP value.

The effects of drugs can be reported as S 2 /S 1 ratios. To normalize the data, drug effects can be estimated by first calculating S 2 /S 1 values for control and drug-treated slices and then expressing the S 2 /S 1 value for the drug-treated slices as a percentage of the S 2 /S 1 value for the control slices for each experiment. Each condition should be tested in slices from each animal.

Langer SZ (1981) Imidazoline receptors constitute a family of nonadrenergic high-affinity binding sites for clonidine, idazoxan, and allied drugs. Drugs selectively binding to imidazoline receptors are expected to have less side effects than clonidine (Ernsberger et al. 1992 (Ernsberger et al. , 1997 Molderings et al. 1992; Limon et al. 1992) . One major subclass, the I 1 receptors, being mainly distributed in the brain and brain stem, partly mediates the central hypotensive action of clonidine-like drugs. The I 2 receptors, an other subclass, are mitochondrial, not G protein coupled, and have diversified functions. They may be involved in neuroprotection for cerebral ischemia. Two binding sites of [ 3 H]p-aminoclonidine, α 2 -adrenoceptors and imidazoline binding sites, could be separated (Ernsberger et al. 1987; Bricca et al. 1988; Kamisaki et al. 1990 ). At least 3 subtypes of imidazoline/guanidinium-receptive sites have been found by photoaffinity labeling (Lanier et al. 1993) . Several endogenous ligands for imidazoline receptors, collectively termed clonidine displacing substances (CDSs), have been detected in tissues and serum (Reis et al. 1995; Chan et al. 1997 ).

An endogenous substance with clonidine-like properties originally isolated from brain which binds selectively to imidazoline receptors was described by Atlas and Burstein (1984) , Ernsberger et al. (1988) , Atlas (1991) , Meeley et al. (1992) , Dontenwill et al. (1992, Ragunathan and Reis 1996) . The endogenous substance agmatine, a decarboxylated arginine, may be the physiological agonist at imidazoline receptors acting as neurotransmitter Gonzales et al. 1996; Head et al. 1997; Herman 1997; Reis and Regu-nathan 2000) . Further candidates of endogenous ligands are discussed (Reis and Ragunathan 1998) .

A critical review on imidazoline binding sites is given by Eglen et al. (1998) .

Whole bovine brains and adrenal glands are obtained from a local slaughterhouse. The lateral medulla oblongata is isolated by a sagittal section through the lateral margin of the pyramids and then bisected. The ventral half is defined as the ventrolateral medulla.

Fresh bovine adrenal glands are perfused retrogradely through the adrenal vein twice with 25 ml icecold Krebs-Henseleit bicarbonate buffer. The glands are perfused again with 25 ml ice-cold Krebs-Henseleit buffer containing 0.025% collagenase (type I, Sigma Chemical), incubated at room temperature for 1 h, then perfused with 25 ml fresh buffer containing collagenase and incubated for 30 min at 35°C. The digested glands are split, and the medulla is removed from the cortex. Adrenal medullae are minced and incubated while being stirred for 30 min at 37°C. The digest is filtered and centrifuged at 200 g for 30 min at 20°C. The cell pellet is resuspended in 30 ml Krebs' solution without collagenase, recentrifuged, flash-frozen, and stored at -70°C.

Fresh bovine ventrolateral medulla and collagenase-digested rat renal medulla are homogenized with a Polytron (Tekmar Tissumizer; setting 80 for 15 s twice) in 20 vol of ice-chilled HEPES-buffered isotonic sucrose (pH 7.4) containing the protease inhibitors 1,10phenanthroline (100 µM) and phenylmethylsulfonyl fluoride (50 µM). Bovine adrenomedullary chromaffin cells are homogenized in 15 ml HEPES-buffered isotonic sucrose by 10 strokes in a glass/glass handhold homogenizer. The homogenates are centrifuged at 1000 g for 5 min at 4°C to remove nuclei and debris. The pellets (P1) are resuspended in 20 ml of homogenization buffer and centrifuged again at 1000 g for 5 min. The supernatants are centrifuged at 48,000 g for 18 min at 4°C, and the resulting pellet (P2) is resuspended in 10-25 vol 50 mM Tris-HCl buffer (pH 7.7) containing 5 mM EDTA. After recentrifugation at 48,000 g for 18 min, the resulting membrane pellet is resuspended in Tris-HCl containing 25 mM NaCl, preincubated for 30 min at 25°C, chilled on ice, centrifuged again, resuspended a final time in Tris-HCl alone, centrifuged, flash-frozen, and stored at -70°C.

For determination of specific binding to I 1 -imidazoline sites and α 2 -adrenergic receptors radioligand binding assays are performed with [ 3 H]clonidine, [ 3 H]piodoclonidine, or [ 3 H] moxonidine. Membranes are slowly thawed and resuspended in Tris-HCl or Tris-HEPES buffer (pH 7.7, 25°C). Assays are conducted in a total volume of 250 µl in polypropylene 96 well plates (Beckman Macrowell). Each well contains 125 µl membrane suspension, 25 µl radioligand, and 100 µl drug or vehicle. Incubations are initiated by the addition of membrane suspension and carried out for 40 min at 25°C. Nonspecific binding is defined in the presence of either piperoxan or phentolamine (0.1 mM), which are imidazoline-adrenergic agents. Specific α 2 -adrenergic binding is defined by epinephrine (0.1 mM). In experiments with catecholamines, all samples contain ascorbic acid in a final concentration of 0.001%. Incubations are terminated by vacuum filtration over Reeves-Angel or Whatman GF/C fiberglass filters using a cell harvester (Brandel) . The filters are washed four times with 5 ml ice-cold Tris-HCl, placed in scintillation vials, covered with 4 ml scintillation cocktail and counted at 50% efficiency. Protein is assayed by a modified Lowry et al. method (Peterson 1977) using a deoxycholate-trichloroacetic acid protein precipitation technique which provides a rapid quantitative recovery of soluble and membrane proteins from interfering substances even in very dilute solutions. Sodium dodecyl sulfate is added to alleviate possible nonionic and cationic detergent and lipid interferences, and to provide mild conditions for rapid denaturation of membrane and proteolipid proteins.

Data are obtained as disintegrations per min and transferred to the Equilibrium Binding Data Analysis program (McPherson 1985) . Then, several experiments are analyzed simultaneously with the LIGAND program for non-linear curve fitting (Munson and Rodbard 1980) . IC 50 values are estimated from inhibition curves by non-linear curve fitting (Mutolsky and Ransnas 1987) . Protein assay data are also analyzed by non-linear curve fitting (McPherson 1985) . Tesson et al. (1991) defined the subcellular localization of imidazoline-guanidinium-receptive sites by performing binding studies with the radioligand [ 3 H]idazoxan. Lanier et al. (1993) visualized multiple imidazoline/guanidinium-receptive sites with the photoaffinity adduct 2- [3-azido-4-[ 125 I]iodo-phenoxy]methyl imidazoline. Molderings et al. (1991) characterized imidazoline receptors involved in the modulation of noradrenaline release in the rabbit pulmonary artery pre-incubated with [ 3 H]noradrenaline.

Molderings and Göthert (1995) determined electrically or K + -evoked tritium overflow from superfused rabbit aortic strips pre-incubated with [ 3 H]noradrenaline in order to characterize presynaptic imidazoline receptors which mediate noradrenaline release and compared them with I 1 -and I 2 -imidazoline radioligand binding sites. Ernsberger et al. (1995) described optimization of radioligand binding assays for I 1 imidazoline sites. Munk et al. (1996) reported the synthesis and pharmacological evaluation of a potent imidazoline-1 receptor specific agent. Piletz et al. (1996) compared the affinities of several ligands for [ 125 I]p-iodoclonidine binding at human platelet I 1 imidazole binding sites.

Several selective ligands for imidazoline I 2 receptors have been identified, such as:

• LSL 60101 (Alemany et al. 1995; Menargues et al. 1995) , • RS-45041-190 (MacKinnon et al. 1995; Brown et al. 1995) , • RX801077 ( = 2-BFI = 2-(2-benzofuranoyl)-2-imidazoline and analogues (Jordan et al. 1996; Lione et al. 1996; Alemany et al. 1997; Hosseini et al. 1997; Wiest and Steinberg 1997; Hudson et al. 1997) .

β-adrenoceptors are widely distributed, found at both central and peripheral sites, and are activated either via norepinephrine released from sympathetic nerve terminals or via epinephrine released from the adrenal medulla. Important physiological consequences of βadrenoceptor activation include stimulation of cardiac rate and force, relaxation of vascular, urogenital and bronchial smooth muscle, stimulation of renin secretion from the juxtaglomerular apparatus, stimulation of insulin and glucagon secretion from the endocrine pancreas, stimulation of glycogenolysis in liver and skeletal muscle and stimulation of lipolysis in the adipocyte. Three β-adrenoceptor proteins have been cloned, and the characteristics of these recombinant receptors correspond with those of the three well characterized β-adrenoceptors on native tissue, designated as β 1 , β 2 and β 3 . The possible roles of β 3 -adrenoceptors in the cardiovascular system were discussed by Gauthier et al. (2000) . An additional β-adrenoceptor modulatingcardiac contractility has been designated as the β 4adrenoceptor (Kaumann et al. 1998) .

While it was initially thought that cardiac stimulation involved primarily the β 1 -adrenoceptor, it now appears that all of the receptor subtypes may be involved. Bronchodilation appears to be mediated by the β 2 -adrenoceptor. The β 3 -adrenoceptor is responsible for lipolysis in white adipose tissue and thermogenesis in the brown adipose tissue found in rodents. Renin release appears to be mediated by the β 1 -adrenoceptor (Waitling 2006) .

The β-adrenoceptor population of plasma membranes from bovine heart ventricles consists of 75-80% β 1 -and 20-25% β 2 -adrenoceptors. The use of this tissue allows a parallel investigation of the binding characteristics of drugs at both the β 1 -and β 2 -adrenoceptors. Both, the β 1 -and β 2 -adrenoceptors coexist in rat ventricular myocytes, but stimulation of these receptor subtypes elicits qualitatively different cell responses at the levels of ionic channels, the myofilaments, and sarcoplasmic reticulum (Xiao and Lakatta 1993) .

A constant concentration of the radioligand 3 Hdihydroalprenolol ( 3 H-DHA) (4-6 nM) is incubated with increasing concentrations of a non-labeled test drug (0.1 nM-1 mM) in the presence of plasma membranes from bovine heart ventricles. If the test drug exhibits any affinity to β-adrenoceptors, it is able to compete with the radioligand for receptor binding sites. Thus, the lower the concentration range of the test drug, in which the competition reaction occurs, the more effective is the test drug. The binding reaction is started by adding 100 µl membrane suspension per incubation sample (approx. 2 mg protein/ml). The samples are incubated for 60 min in a shaking water bath at 25°C. The reaction is stopped by rapid vacuum filtration of the total incubation volume over glass fiber filters. Thereby the membranebound radioactivity is separated from the free activity. Filters are washed immediately with approx. 20 ml icecold rinse buffer per sample. The retained membranebound radioactivity on the filter is measured after addition of 2 ml liquid scintillation cocktail per sample in a Packard liquid scintillation counter.

The following parameters are calculated:

• total binding • non-specific binding • specific binding = total binding-non-specific binding

The dissociation constant (K i ) of the test drug is determined from the competition experiment of 3 H-DHA versus non-labeled drug by a computer-sup- (U'Prichard et al. 1978; Bylund and Snyder 1976) and ( 125 I)-iodohydroxypindolol (Weiland et al. 1980) . DHA is a potent β-antagonist (Mukherjee et al. 1975) , which labels both β 1 and β 2 adrenergic receptors. The binding characteristics of this ligand in brain were described by Bylund and Snyder (1976) , who showed that antagonists competed potently and agonists less potently although stereospecificity was maintained. The pharmacology of binding was consistent with β 1 -receptor occupancy. Lesioning studies (Wolfe et al. 1982) , combined with non-linear regression analysis of data have shown that while βreceptors in rat cerebellum are primarily of the β 2 subtype, the β 1 occurring in rat cerebral cortex are physiologically more significant. The assay can be used to evaluate the direct interaction of drugs with β-receptors labelled by [ 3 H]-dihydroalprenolol.

Tris buffer, pH 8.0 1. a) 44.4 g Tris HCl q.s. to 1 liter (0.5 M Tris, pH 8.0) 26.5 g Tris base b) Dilute 1:10 in distilled water.

(0.05 M Tris, pH 8.0) 2. (-)-[propyl-1,2,3-3 H] Dihydroalprenolol hydrochloride (45-52 Ci/mmol) is obtained from New England Nuclear. For IC 50 determinations: A stock solution of 20 nM 3 H-DHA is made up in distilled H 2 O and 50 µl is added to each tube (this yields a final concentration of 1 nM in the 1 ml assay). 3. (±)-propranolol HCl is obtained from Ayerst.

A 1 mM propranolol stock solution is made up in distilled water and further diluted 1:20 in distilled water to give 50 µM propranolol solution. Twenty µl of dilute stock solution is added to 3 tubes to determine nonspecific binding (yields a final concentration of 1 µM in a 1 ml assay). 4. Test compounds:

For most assays, a 1 mM stock solution is made up in a suitable solvent and serially diluted, such that the final concentration in the assay ranges from 10 −5 to 10 −8 M. Seven concentrations are used for each assay. Higher or lower concentrations may be used depending on the potency of the compound.

Male rats are decapitated and the brains rapidly removed. The cerebral cortices are dissected free, weighed and homogenized in 50 ml of ice-cold 0.05 Tris buffer, pH 8.0. This homogenate is centrifuged at 40,000 g, the supernatant decanted and the pellet resuspended and recentrifuged at 40,000 g. The final pellet is resuspended in the initial volume of fresh 0.05 Tris buffer, pH 8.0. This tissue suspension is then stored on ice. The final tissue concentration in the assay is 10 mg/ml. Specific binding is about 3% of the total added ligand and 80% of the total bound ligand.

Assay 380 µl H 2 O 50 µl 0.5 Tris buffer, pH 8.0 20 µl Vehicle (for total binding) or 50 µM (±) propranolol (for nonspecific binding) or appropriate drug concentration 50 µl 3 H-DHA stock solution 500 µl tissue suspension.

The tissue homogenates are incubated for 15 min at 25°C with 1 nM 3 H-DHA and varying drug concentrations. With each binding assay, triplicate samples are incubated with 1 µM (±)-propranolol under identical conditions to determine nonspecific binding. The assay is stopped by vacuum filtration through Whatman GF/B filters which are washed 3 times with 5 ml of ice-cold 0.05 Tris buffer, pH 8.0. The filters are counted in 10 ml of Liquiscint scintillation cocktail.

The percent inhibition of each drug concentration is the mean of triplicate determinations. IC 50 values are obtained by computer-derived log-probit analysis. Dooley et al. (1986) recommended CGP 20712 A as a useful tool for quantitating β 1 and β 2 adrenoceptors. Lands et al. (1967) classified β-receptors into β 1 and β 2 subtypes according to differences in the action of various catecholamines. Synthesis of more selective β-antagonists has helped to confirm the existence of receptor subtypes. Based on catecholamine pharmacology and differences in the tissue distribution, it has been suggested that the β 1 -receptor serves as the receptor for norepinephrine acting as a neurotransmitter and the β 2 -receptor serves as a receptor for epinephrine acting as a hormone. (Nahorski 1981; Ariens and Simonis 1983; Lefkowitz et al. 1983; Minneman 1983 ). Since [ 3 H]-dihydroalprenolol is a nonspecific ligand, it is necessary to select a tissue which is enriched in β 2 -receptors in order to convey specificity to this assay. Tissues with predominantly β 2receptors include lung (U'Prichard et al. 1978; Ariens and Simonis 1983; Lefkowitz et al. 1983 ), cerebellum (Lefkowitz et al. 1983 Minneman et al. 1983 ), rat and frog erythrocytes (Mukherjee et al. 1975; Lefkowitz et al. 1983 ) and ciliary process (Nathanson 1985) whereas, forebrain, heart and avian erythrocytes are relatively enriched in the β 1 -subtype (Lefkowitz et al. 1983 ). Due to poor binding characteristics in cerebellum, rat lung is chosen as the tissue for β 2 -adrenergic receptors.

A compound with β 2 -selectivity would be less likely to produce cardiac effects but more likely to produce bronchiolar constriction. The test is used to determine the affinity of compounds for the β 2 -adrenergic receptor subtype. A measure of receptor subtype selectivity can be determined when data are compared with those obtained in the β 1 -adrenergic assay in rat cerebral cortex.

The present nomenclature of β 1 , β 2 , and β 3 receptors was reviewed by Alexander et al. (2001) .

The tissue homogenates are incubated for 15 min at 25°C with 1 nM 3 H-DHA and varying drug concentrations. In each binding assay, triplicate samples are incubated with 1 µM (±)-propranolol under identical conditions to determine nonspecific binding. The assay is stopped by vacuum filtration through Whatman GF/B filters which are washed 3 times with 5 ml of icecold 0.05 Tris buffer, pH 8.0. The filters are counted in 10 ml of Liquiscint scintillation cocktail.

The percent inhibition of each drug concentration is the mean of triplicate determinations. IC 50 values are obtained by computer-derived log-probit analysis. Dooley et al. (1986) recommended CGP 20712 as a useful tool for quantitating β 1 -and β 2 -adrenoceptors.

McCrea and Hill (1993) described salmeterol as a long-acting β-adrenoceptor agonist mediating cyclic AMP accumulation in the B50 neuroblastoma cell line. Sarsero et al. (1998) recommended (-)[ 3 H]-CGP 12177A as radioligand for the putative β 4 -adrenoceptor. McConnell et al. (1991 McConnell et al. ( , 1992  Owicki and Parce 1992) used a special apparatus, the 'cytosensor microphysiometer' which measures the rate of proton excretion from cultured cells. Chinese hamster ovary cells were transfected with human β 2 -adrenergic receptors. The β 2 -adrenergic receptor activates adenylate cyclase resulting in an increase in the cyclic AMP concentration within the cell which can be measured as acidification. Addition of 10 µM isoproterenol, 500 µM 8bromo cyclic AMP, or 10 µg/ml forskolin induced a reversible acidification. Hoffmann et al. (2004) compared human βadrenergic receptor subtypes using characterization of stably transfected receptors in CHO cells.

cDNA of human β-adrenergic receptors cDNAs coding for human β-adrenergic receptors in pcDNA3 expression vectors were verified by sequencing and comparison with the respective GeneBank entries. The translated amino acid sequences corresponded to the published sequences for the β 1 -adrenergic receptor (Frielle et al. 1987) , β 2 -adrenergic receptor (Schofield et al. 1987) , and β 3 -adrenergic receptor (Emorine et Y al. 1989) . With respect to polymorphisms, the βadrenergic receptors used in this study corresponded to the following variants: β 1 -receptor 49-Ser, 389-Gly; β 2 -receptor 16-Arg, 27-Gln, 164-Thr; β 3 -receptor 64-Trp. All of the variants correspond to the sequences originally termed wild-type.

Chinese hamster ovary cells (CHO-K1 cells; CCL61, American Type Culture Collection, Rockville, Md., USA) were transfected with plasmid DNA for stable expression using the calcium phosphate precipitation method (Chen and Okayama 1987) as described for the rat A 1 adenosine receptor (Freund et al. 1994) . Positive clones were selected with 600 µg/ml of the neomycin analog G-418, and single clonal lines were isolated by limiting dilution. Expression of the receptor was verified by radioligand binding.

Cell culture and membrane preparation Chinese hamster ovary cells stably transfected with human β-adrenergic receptor subtypes were grown adherently and maintained in Dulbecco's Modified Eagle's Medium with nutrient mixture F12 (DMEM/F12), containing 10% fetal calf serum, penicillin (100 U/ml), streptomycin (100 µg/ml), L-glutamine (2 mM) and geneticin (G-418, 0.2 mg/ml) at 37°C in 5% CO 2 /95% air. Cells were split 2 or 3 times weekly at a ratio of between 1:5 and 1:15. In order to harvest cells the culture medium was removed, cells were washed twice with PBS and membranes were prepared or cells were frozen on the dishes for later preparation of membranes. Crude membrane fractions were pre-pared from fresh (measurement of adenylyl cyclase) or frozen cells (radioligand binding). The resulting membrane pellets were resuspended in 50 mM Tris/HCl buffer pH 7.4 to give a final protein concentration of 1-2 mg/ml.

The radioligand binding experiments were performed with membranes prepared as described above. Assays were done in a volume of 200 µl in 50 mM Tris/HCl, pH 7.4 (assay buffer) in the presence of 100 µM GTP to ensure monophasic binding curves for agonists. For saturation binding experiments at human β 1 -and β 2receptors up to 400 pM 125 I-CYP and for β 3 -receptors up to 1,500 pM 125 I-CYP were used. Non-specific binding was determined in the presence of 10 µM alprenolol. For competition binding, 50 pM 125 I-CYP in the case of β 1 -and β 2 -receptors, or 80 pM 125 I-CYP for β 3 -receptors were used. For most of the competition binding experiments membranes with intermediate receptor expression (β 1 : 367 ± 75 fmol/mg protein, β 2 : 282 ± 19 fmol/mg protein, β 3 : 377 ± 82 fmol/mg protein) were used. For selected compounds it was demonstrated that higher receptor expression did not affect K i values (data not shown). Membranes were incubated for 90 min at 30°C, filtered through Whatman GF/C filters, and washed 3 times with ice-cold assay buffer. Samples were counted in a γ -counter (Wallac 1480 wizard 3). K D -values for 125 I-CYP were calculated by non-linear curve fitting with the program SCT-FIT. Ligand IC 50 values were calculated using Origin 6.1 (OriginLab Corporation, Northampton, Mass., USA) and were transformed to K i values according to Cheng and Prusoff (1973) .

Adenylyl cyclase activity in cell membranes was determined according to Jakobs et al. (1976) . Membrane protein (50 µg) was added to an incubation mixture with final concentrations of 50 mM Tris/HCl pH 7.4, 100 µM cAMP, 0.2% BSA, 10 µM GTP, 100 µM ATP, 1 mM MgCl 2 , 100 µM IBMX, 15 mM phosphocreatine, and 300 U/ml of creatine kinase. Membranes were incubated with about 200,000 cpm of [α-32 P]-ATP for 20 min in the incubation mixture as described (Klotz et al. 1985) . Accumulation of [α-32 P]-cAMP was linear over at least 20 min under all conditions. The reaction was stopped by addition of 400 µl of 125 mM ZnAc-solution and 500 µl of 144 mM Na 2 CO 3 . Samples were centrifuged for 5 min at 14,000 rpm in a laboratory microcentrifuge. Then, 800 µl of the resulting supernatant wase finally applied to alumina WN-6 (Sigma) columns that were eluted twice with 2 ml of 100 mM Tris/HCl pH 7.4. U'Prichard DC, Bylund DB, Snyder SH (1978) (±)-3 H-Epinephrine and (-)-3 H-dihydroalprenolol binding to β 1 and β 2 noradrenergic receptors in brain, heart and lung membranes. J Biol Chem 253:5090-5102

Adenosine receptors belong to the class of purinoceptors (Burnstock 1972 (Burnstock , 1981 Olsson and Pearson 1990) . Purinoceptors are divided into two general types on the basis of recognized natural ligands: P 1 receptors recognize adenosine and AMP and P 2 receptors recognize ATP and AMP. Fredholm et al. (1994) , Abbracchio and Burnstock (1994, Jacobson et al. 2000 ) proposed a nomenclature system which is now widely accepted: two families of P2 purinoceptors, P2X ionotropic ligand-gated ion channel receptors (North 2002) and P2Y metabotropic G-proteincoupled receptors (Costanzi et al. 2004 ). The nomenclature of seven subtypes of P2X receptors and six subtypes of P2Y receptors has been agreed by the NC-IUPHAR Subcommittee (Burnstock 2001; Alexander et al. 2001; Waitling 2006) .

The effects of adenosine are mediated effects through cAMP (Sattin and Rall 1970; VanCalker et al. 1978) . It was discovered that adenosine could either inhibit or stimulate the formation of cAMP. The discovery of dual effects on adenylate cyclase led to the proposal of two distinct adenosine receptors referred to as the A 1 and A 2 receptors. The A 1 subtype of adenosine receptor mediates the inhibition of adenylate cyclase; whereas, the A 2 subtype mediates stimulation of adenylate cyclase. The methylxanthines are relatively nonselective inhibitors of adenosine receptor subtypes and their pharmacological properties are thought to be mostly due to antagonism of these receptors.

Comparison of adenosine receptors with other Gprotein linked receptors indicates that they comprise a family of G protein coupled receptors that can be grouped by subtypes or by species. Thus, in addition to A 1 and A 2 , several authors described A 1a , A 1b , A 2a , A 2b , A 3 , and A 4 receptors with species dependent differences (Jacobson et al. 1992 (Jacobson et al. 1996 Zhou et al. 1992; Linden et al. 1993; Salvatore et al. 1993; Linden et al. 1994; Fredholm et al. 1994; Alexander et al. 2001) . The nomenclature and classification of adenosine receptors were published by Fredholm et al. (2001) and Waitling (2006) . Klotz (2000) reviewed adenosine receptors and their ligands. The four subtypes of adenosine receptors referred to as A 1 , A 2A , A 2B , and A 3 are members of the superfamily of G-protein-coupled receptors. The most recently discovered member of the adenosine receptor family, the A3 receptor, has a unique pharmacological profile (Salvatore et al. 1993; Avila et al. 2002) .

The purpose of this assay is to measure the affinity of test compounds for adenosine (A 1 ) receptors. Evidence for an A 1 adenosine receptor in the guinea pig atrium was given by Collis (1983) . Adenosine plays a physiological role in many systems, including platelet aggregation, lipolysis, steroidogenesis and smooth muscle tone (Daly 1982) .The vasodilatory and cardiac depressant effects of adenosine are well known. In addition to cardiovascular effects, adenosine has marked effects in the CNS including depression of electrophysiological activity (Siggins and Schubert 1981) , anticonvulsant activity, analgesic properties (Ahlijanian and Takemori 1985) and inhibition of neurotransmitter release (Harms et al. 1979) .

The agonist, [ 3 H]cyclohexyladenosine (CHA), has affinity for the A 1 receptor in the nanomolar concentration range and has proven to be a suitable ligand for A 1 receptor assays (Bruns et al. 1980; Bruns et al. 1986 ). Selective A 1 (Schingnitz et al. 1991 ) and A 2 antagonists (Shimada et al. 1992; Jacobson et al. 1993 ) have been described. Adenosine and its nucleotides have not only a cardiovascular but predominantly a cerebral activity (Phillis and Wu 1981; Daly 1982; Fredholm et al. 1982 ).

1. a) 0.5 M Tris buffer, pH 7.7 b) 0.05 M Tris buffer, pH 7.7 2. Adenosine deaminase is obtained from Sigma Chemical Co. Adenosine deaminase is added to 0.05 M Tris-HCl buffer, pH 7.7 for final resuspension of the membrane pellet, such that the concentration in the assay is 0.1 U/ml of tissue. 3. Cyclohexyladenosine, N 6 -[Adenine-2,8- 3 A 100 mM stock solution is made up in deionized water. 20 µl are added to each of 3 tubes for the de-termination of nonspecific binding, yielding a 1 mM final concentration in the assay.

For most assays, a 1 mM stock solution is prepared in DMSO and serially diluted, such that the final concentrations in the assay range from 10 −5 to 10 −8 M. Seven concentrations are used for each assay. Higher or lower concentrations may be used depending on the potency of the drug.

Male Wistar rats are sacrificed by decapitation. Whole brains minus cerebellum are removed, weighed and homogenized in 10 volumes of ice-cold 0.05 M Tris buffer, pH 7.7. The homogenate is centrifuged at 48,000 g for 10 min, the supernatant decanted, the pellet resuspended in the same volume of buffer and centrifuged again as before. The final pellet is resuspended in 0.05 M Tris buffer containing 0.1 U/ml of adenosine deaminase. The tubes are incubated for 2 hours at 25°C. The assay is stopped by vacuum filtration through Whatman GF/B filters which are then washed 3 times with 5 ml of 0.05 M Tris buffer. The filters are then placed into scintillation vials with 10 ml liquiscintillation cocktail, left to soak overnight and counted.

Specific binding is defined as the difference between total binding and binding in the presence of 1 mM theophylline. IC 50 values are calculated from the percent specific binding at each drug concentration.

The complexity of interaction of adenosine ligands with receptors (Bruns et al. 1986 ) precludes the simple calculation of K i values by the Cheng-Prusoff equation. Stiles et al. (1985) used 125 I-labeled N 6 -2-(4-aminophenyl)ethyladenosine as a selective ligand to probe the structure of A 1 receptors.

Lohse et al. (1987) described 8-cyclopentyl-1,3dipropylxanthine (DPCPX) as a high affinity antagonist radioligand for A 1 adenosine receptors. Klotz et al. (1989) described 2-chloro-N 6 -[ 3 H]cyclopentyladenosine ([ 3 H]CCPA) as a high affinity agonist radioligand for A 1 adenosine receptors.

Von Lubitz et al. (1995) studied the therapeutic implications of chronic NMDA receptor stimulation on adenosine A 1 receptors.

The partial agonism of theophylline-7-riboside on the adenosine A 1 receptor has been reported by Ijzerman et al. (1994) . Libert et al. (1992) reported the cloning and functional characterization of a human A 1 adenosine receptor.

Adenosine deaminase is added to 0.05 M Tris-HCl buffer, pH 7.7, containing 12 mM CaCl 2 for final resuspension of the membrane pellet, such that the concentration in the assay is 0.1 U/ml of tissue. adenosine (specific activity 23-40 mCi/mmol) is obtained from Amersham. For IC 50 determinations: 3 H-NECA is made up to a concentration of 80 nM and 50 µl is added to each tube. This yields a final concentration of 4 nM in the assay. 4. Cyclopentyladenosine (CPA) is obtained from Research Biochemicals Inc. A 5 mM stock solution is made up in DMSO. 20 µl are added to each of 3 tubes for the determination of nonspecific binding, yielding a 100 µM final concentration in the assay.

Since [ 3 H]NECA is not a specific ligand for A 2 receptors, CPA is added to all other tubes to mask the A 1 receptors at a final concentration of 50 nM.

For most assays, a 1 mM stock solution is made up in a suitable solvent and serially diluted, such that the final concentration in the assay ranges from 2 × 10 −5 to 2 × 10 −8 M. Seven concentrations are used for each assay. Higher or lower concentrations may be used depending on the potency of the drug.

Male Wistar rats are sacrificed by decapitation. Striata are removed, weighed and homogenized in 10 volumes of ice-cold 0.05 M Tris buffer, pH 7.7. The homogenate is centrifuged at 48,000 g for 10 min, the supernatant decanted, the pellet resuspended in the same volume of buffer and centrifuged again as before. The final pellet is resuspended in 100 volumes of 0.05 M Tris buffer containing 10 mM CaCl 2 and 0.1 U/ml of adenosine deaminase.

Assay 830 µl tissue suspension 100 µl CPA 20 µl vehicle or CPA or appropriate concentration of test compound 50 µl 3 H-NECA The tubes are incubated at 25°C for 2 hours. The assay is stopped by vacuum filtration through Whatman GF/B filters which are then washed 3 times with 5 ml of 0.05 M Tris buffer. The filters are then placed into scintillation vials with 10 ml Liquiscint scintillation cocktail, left to soak overnight and counted.

Specific binding is defined as the difference between total binding and binding in the presence of 100 µM CPA. IC 50 values are calculated from the percent specific binding at each drug concentration.

The complexity of interaction of adenosine ligands with receptors precludes the simple calculation of K i values by the Cheng-Prusoff equation. Jarvis et al. (1989) reported on [ 3 H]CGS 21 680, a selective A 2 adenosine receptor agonist which directly labels A 2 receptors in rat brain. [ 3 H]CGS 21 680 binding was greatest in striatal membranes with negligible specific binding obtained in rat cortical membranes. Gurden et al. (1993) described the functional characterization of three adenosine receptor types. Hutchinson et al. (1990) described 2-(arylalkylamino)adenosin-5 -uronamides as a new class of highly selective adenosine A 2 receptor ligands.

A 2A Adenosine receptors from rat striatum and rat pheochromocytoma PC12 cells have been characterized with radioligand binding and by activation of adenylate cyclase (Hide et al. 1992) . Nonaka et al. (1994) reported on KF17837 ((E)-8-(3,4-dimethoxystyryl)-1,3-dipropyl-7-methylxantine), a potent and selective adenosine A 2 receptor antagonist.

The in vitro pharmacology of ZM 241385, a potent, non-xanthine, A 2a selective adenosine receptor antagonist has been reported by Poucher et al. (1955) . Monopoli et al. (1994) described the pharmacology of the selective A 2α adenosine receptor agonist 2hexynyl-5 -N-ethylcarboxamidoadenosine. Jacobson et al. (1993) described structure-activity relationships of 8-styrylxanthines as A 2 -selective adenosine antagonists. Varani et al. (1996) reported pharmacological and biochemical characterization of purified A 2a adenosine receptors in human platelet membranes by [ 3 H]-CGS 21680 binding. Van der Ploeg et al. (1996) characterized adenosine A 2 receptors in human T-cell leukemia Jurkat cells and rat phaeochromocytoma PC12 cells using adenosine receptor agonists.

Bruns RF, Lu GH, Pugsley TA (1986) The A 3 adenosine receptor has been cloned and characterized by Zhou et al. (1992) . A possible role in reproduction has been discussed. The role of central A 3 adenosine receptors may be the mediation of behavioral depressant effects (Jacobson et al. 1993 ). The design of selective ligands of A 3 adenosine receptors and the therapeutic concepts including effects on locomotor activity, cardiovascular effects, effects in cerebral ischemia (von Lubitz et al. 1994) , in cardiac preconditioning and as antagonists in inflammation and asthma has been discussed by Jacobson et al. (1995) . Von Lubitz et al. (1995) noticed some anticonvulsive activity of the adenosine A 3 receptor selective agonist IB-MECA (N 6 -(3-iodobenzyl) adenosine-5 -Nmethyl-carboxamide). Stimulation of the A 3 adenosine receptor facilitates release of allergic mediators in mast cells (Ramkumar et al. 1993) inducing hypotension in the rat (Hannon et al. 1995) . A binding site model and structure-activity relationships for the rat A 3 adenosine receptor are described by van Galen et al. (1994) .

125 I-4-aminobenzyl-5 -N-methylcarboxamidoadenosine has been recommended as a high affinity radioligand for the rat A 3 adenosine receptor (Olah et al. 1994) . Molecular cloning and functional expression of a sheep A 3 adenosine receptor has been reported by Linden et al. (1993) .

G protein-dependent activation of phospholipase C by adenosine A 3 receptors in rat brain was reported by Abbracchio et al. (1995) .

Molecular cloning and characterization of the human A 3 adenosine receptor was reported by Salvatore et al. (1993) .

The differential interaction of the rat A 3 adenosine receptor with multiple G-proteins has been described by Palmer et al. (1995) . Baraldi and Borea (2000) described new potent and selective human adenosine A 3 receptor antagonists using radioligand binding studies to the human A 3 receptor.

Abbracchio MP, Brambilla R, Ceruti S, Kim HO, von Lu- bitz DKJE, Jacobson KA, Cattabeni F (1995) G protein-dependent activation of phospholipase C by adenosine A 3 receptors in rat brain. Mol Pharmacol 48:1038-1045 Baraldi PG, Borea PA (2000) New potent and selective human adenosine A 3 receptor antagonists. Trends Pharmacol Sci 21:456-459 Cheng YC, Prusoff WH (1973) Relationship between the inhibition constant (K i ) and the concentration of the inhibitor which causes 50% inhibition (IC 50 

Adenosine regulates multiple physiological functions in animals and humans. It plays a potent neuromodulatory role mainly by inhibiting the presynaptic transmitter release, e. g. of glutamate and aspartate. It is released by synaptic stimulation and during hypoxia in the central and peripheral nervous system. Adenosine plays a neuroprotective role in hypoxia and ischemia since it reduces the excessive stimulation of the NMDA receptors. The use of adenosine uptake inhibitors has been proposed as a new therapeutic strategy for hypoxic/ischemic disease. Due to its vasodilatory action adenosine plays a key role in the regulation of coronary and cerebral blood flow. The rapid cellular uptake of adenosine by erythrocytes is a reason for the short duration of action of adenosine. Human erythrocytes are used as a cellular model to detect adenosine uptake inhibitors. Erythrocytes are treated with test compound and thereafter incubated with 3 H-adenosine. The uptake of 3 H-adenosine is evaluated in relation to the untreated control group.

Dipyridamole is a potent inhibitor of adenosine uptake (IC 50 of 3 × 10 −7 M). Buffer-washed fresh human erythrocytes are depleted of ATP by incubation in an isotonic glycyl-glycine buffer at 37°C. Aliquots of the erythrocyte suspensions are incubated for 2 min in fresh glycyl-glycine buffer solution containing additional 10 mM glucose and testor standard compound. In screening assays, test compounds are added at a concentration of 5 × 10 −4 M. Drugs showing an effect in this assays, are further tested at a concentration range of 10 −5 -5 × 10 −4 M to determine IC 50 values (triplicate samples for each concentration).

The suspension is then incubated with 5 µM radioactively labelled 2-[ 3 H]-adenosine for 30 s. The adenosine uptake is stopped by adding cold buffer (4°C) containing 5 µM adenosine, 10 µM glucose and 7.4 µM dipyridamole. After centrifugation, the tritium radioactivity is determined in the supernatant.

The percent change of 3 H-adenosine uptake relative to the vehicle control group is determined. The 3 Hadenosine uptake of the control group is taken as 100%; subsequent results are expressed as percentages of this.

IC 50 values are determined by plotting the percent inhibition against test compound concentration; IC 50 is defined as the dose of drug leading to a 50% inhibition of adenosine uptake.

Statistical evaluation is performed by means of the Student's t-test.

Standard data:

• IC 50 of dipyridamole 3 × 10 −7 M Marangos et al. (1982) , Verma and Marangos (1985) recommended [ 3 H ]nitrobenzylthioinosine binding as a probe for the study of adenosine uptake sites in brain of various species. The highest density of binding sites were found in the caudate and hypothalamus of human and rat brain.

Bowmer CJ, Yates MS (1989) Therapeutic potential for new selective adenosine receptor ligands and metabolism inhibitors. Trends Pharmacol Sci 10:339-341 Geiger JD, Fyda DM (1991) Adenosine transport in nervous system tissues. In: Stone TW (ed) Adenosine in the Nervous System. Academic Press, London, San Diego, New York, pp 1-23 Marangos PJ, Patel J, Clark-Rosenberg R, Martino AM (1982) [ 3 H]Nitrobenzylthioinosine binding as a probe for the study of adenosine uptake sites in brain. J Neurochem 39: 184-191 Porsche E (1982) Effects of methylxanthine derivates on the adenosine uptake in human erythrocytes. IRCS Med Sci 10:389 Rudolphi KA, Schubert P, Parkinson FE, Fredholm BB (1992) Adenosine and brain ischemia. Cerebrovasc Brain Metab Rev 4:346-369 Verma A, Marangos PJ (1985) Nitrobenzylthioinosine binding in brain: an interspecies study. Life Sci 36:283-290 Winn HR, Rubio GR, Berne RM (1981) The role of adenosine in the regulation of cerebral blood flow. J Cerebr Blood Flow Metab 1:239-244

Vasopeptidase inhibitors (VPIs) inhibit both angiotensin converting enzyme (ACE) and neprilysin (NEP) and can thus reduce the activity of the reninangiotensin system and potentiate the vasodilatory, natriuretic and antiproliferative effects of bradykinin and natriuretic peptides (Burnett 1999; Bralet and Schwartz 2001) . Combined inhibition of neutral endopeptidase 24.11 (NEP) and ACE is a candidate therapy for hypertension and cardiac failure (Duncan et al. 1999) . Heath et al. (1995) described the quantification of a dual ACE-I-converting enzymeneutral endopeptidase inhibitor and the active thiol metabolite in dog plasma by high-performance liquid chromatography with ultraviolet absorption detection. Dumoulin et al. (1995) studied the metabolism of bradykinin by the rat coronary vascular bed and found that combined treatment with the ACE inhibitor enalaprilate and the NEP inhibitor retrothiorphan reduced bradykinin degradation to lower values than enalaprilate alone. Hubner et al. (2001) reported in-vitro and in-vivo inhibition of rat neutral endopeptidase and ACE with the vasopeptidase inhibitor gemopatrilat. Dumoulin et al. (2001) compared the effects of a vasopeptidase inhibitor with those of neutral endopeptidase and ACE inhibitors on bradykinin metabolism in the rat coronary bed. Crackower et al. (2002) described type-2 ACE (ACE2) as an essential regulator of heart function. In three different rat models of hypertension, ACE2 messenger RNA and protein expression were markedly reduced. Targeted disruption of ACE2 in mice resulted in a severe cardiac contractility defect. Comparison of a vasopeptidase inhibitor with neutral endopeptidase and angiotensin-converting enzyme inhibitors on bradykinin metabolism in the rat coronary bed. J Cardiovasc Pharmacol 37:359-366 Duncan AM, James GM, Anastasopoulos F, Kladis A, Briscoe TA, Campbell DJ (1999) Interaction between neutral endopeptidase and angiotensin converting enzyme in rats with myocardial infarction: effects on cardiac hypertrophy and angiotensin and bradykinin peptide levels. J Pharmacol Exp Ther 289:295-303 Heath TG, Massad DD, Carroll JI, Mathews BS, Chang J, Scott DO, Kuo BS, Toren PC (1995) Quantification of a dual angiotensin I-converting enzyme-neutral endopeptidase inhibitor and the active thiol metabolite in dog plasma by high-performance liquid chromatography with ultraviolet absorption detection. J Chromatogr B670:91-101 Hubner RA, Kubota E, Casley DJ, Johnston CI, Burrell LM (2001) In-vitro and in vivo inhibition of rat neutral endopeptidase and angiotensin converting enzyme with the vasopeptidase inhibitor gemopatrilat. J Hypertens 19:941-946

An in vitro system can be used to screen potential angiotensin-converting enzyme inhibitors. Fluorescence generated by an artificial substrate in presence or absence of the inhibitor is measured to detect inhibitory activity.

1. 50 mM Tris-HCl buffer, pH 8.0 + 100 mM NaCl 2. 10 mM potassium phosphate buffer, pH 8. 3 3. Substrate: O-aminobenzoylglycyl-p-nitro-L-phenylalanyl-L-proline (molecular weight 482) (Bachem Gentec. Inc., Torrance, California, USA) a) stock solution: 10 mg substrate in 10 ml 50 mM Tris-HCl buffer, pH 8.0 + 100 mM NaCl b) working solution: 2 ml stock solution is added to 18 ml 50 mM Tris-HCl buffer, pH 8.0 + 100 mM NaCl; final concentration in the assay is 170.2 µM.

Compounds are made up to a concentration of 1 mM in 50 mM Tris-HCl buffer, pH 8.0 + 100 mM NaCl or 10% methanol in Tris/NaCl if insoluble in aqueous buffer alone. This will give a final concentration in the assay of 0.1 mM. If inhibition is seen, further dilution in Tris/NaCl should be made.

Lung tissue from 10 rats is diced and homogenized in a blender with 3 pulses of 15 s each. The homogenate is centrifuged at 5000 g for 10 min. The pellet is discarded, the supernatant is dialyzed against three 1 liter changes of 10 mM potassium phosphate buffer, pH 8.3 overnight in the cold and then centrifuged at 40,000 g for 20 min. The pellet is discarded, 390 mg (NH 4 ) 2 SO 4 is added for each ml of supernatant. This will give 60% saturation. The solution is stirred on ice for 15 min. The pellet formed is dissolved in 15 ml potassium phosphate buffer, pH 8.3 and dialyzed against the same buffer overnight in the cold with three 1 liter changes. Some protein will precipitate during dialysis. The suspension is centrifuged at 40,000 g for 20 min and the supernatant is discarded. The final solubilized enzyme preparation can be aliquoted and stored at -20°C at least 6 months.

Enzyme inhibition studies 1. Enzyme activity is measured with a Perkin Elmer LS-5 Fluorescence Spectrophotometer or equivalent at an excitation wavelength of 357 nm and an emission wavelength of 424 nm. 2. Enzyme assay 50 µl vehicle or inhibitor solution and 40 µl enzyme are preincubated for 5 min, then 410 µl substrate working solution is added. Samples are mixed by drawing fluid back up into the pipette and by pipetting into the cuvette. For the initial control run of the day, the auto zero is pushed immediately after placing the sample in the cuvette.

The individual fluorescence slope is measured and % inhibition is calculated as follows: % inhibition = % inhibition = 100 − slope in presence of inhibitor control slope × 100

Inhibitor concentrations on either side of the IC 50 should be tested to generate a dose-response curve.

The IC 50 is calculated using Litchfield-Wilcoxon logprobit analysis. Standard data:

• IC 50 values for inhibition of angiotensin I-converting enzyme • Compound IC 50 [M] • Captopril 6.9 × 10 −9

Other assays use the cleavage of hippuric acid from tripeptides (Hip-Gly-Gly or Hip-His-Leu) whereby hippuric acid is either tritium labelled or determined spectrophotometrically (Cushman and Cheung 1969 Cheung , 1971 Friedland and Silverstein 1976; Santos et al. 1985; Hecker et al. 1994) . Bünning (1984) studied the binding and inhibition kinetics of ramipril and ramiprilate (Hoe 498 diacid) with highly purified angiotensin converting enzyme using furanacryloyl-Phe-Gly-Gly as substrate.

The importance of tissue converting enzyme inhibition in addition to inhibition in plasma has been verified in several studies (Unger et al. 1984 (Unger et al. , 1985 Linz and Schölkens 1987) . Eriksson et al. (2002) , Oudit et al. (2003) , and Danilczyk et al. (2003 Danilczyk et al. ( , 2004 discussed the role of the homolog of angiotensin-converting enzyme ACE2 in cardiovascular physiology. ACE2 appears to negatively regulate the renin-angiotensin system and cleaves Ang I and Ang II into the inactive Ang 1-9 and Ang 1-7. ACE2 differs in its specificity and physiological role from ACE. 

Neutral endopeptidase cleaves various peptides, such as enkephalins, kinins, chemotactic peptide, atrial natriuretic factor, and substance P. Reviews on neutral endopeptidase 24.11 (enkephalinase) were given by Erdös and Skidgel (1989) and by Roques et al. (1993) . Structural requirements were investigated by Santos et al. (2002) .

Several enzymatic assays have been developed for measuring neutral endopeptidase (NEP) activity, such as radiolabeled methods (Vogel and Altstein 1977; Llorens et al. 1982) and colorimetric assays (Almenoff et al. 1981; Almenoff and Orlowsky 1984) ; fluorometric assay (Florentin et al. 1984; Goudreau et al. 1994) . Burell et al. (1997) and Hubner et al. (2001) used the selective NEP inhibitor radioligand 125 I-labelled RB104. Cavalho et al. (1995 Cavalho et al. ( , 1996 described a highly selective assay for neutral endopeptidase based on the cleavage of a fluorogenic substrate related to Leuenkephalin.

A recombinant soluble form of NEP (rNEP) was expressed using a baculovirus/insect-cell system and purified by immunoaffinity.

The substrate (10 nmol) was incubated with rNEP (100 ng) in a final volume of 100 µl of 50 mM Tris-HCl buffer, pH 7.4, at 37°C for 30 min. For the inhibition assays, the enzyme was preincubated with 1 µM thiorphan or 1 µM captopril for 20 min before its incubation with the substrate. The reaction was stopped by heating for 5 min at 100°C. After centrifugation at 10,000 g for 10 min, the supernatant fraction was injected into an HPLC column and eluted with a 20%-40% gradient of acetonitrile containing 0.05% trifluoroacetic acid over a period of 30 min, at a flow rate of 1 ml/min. The substrate and products, detected by both UV absorbance (220 nm) and fluorescence (λ em = 420 nm, λ ex = 320 nm) with the detectors arranged in series, were collected to identify the cleavage site by amino acid analysis.

Kinetic parameters for the NEP-catalyzed hydrolysis were determined from the double-reciprocal Lineweaver-Burkq plots. Sulpizio et al. (2004) described the determination of NEP activity in tissues after in vivo treatment of rats with ACE inhibitors. After sacrifice of the animals, approximately 250 mg of kidney tissue was homogenized in 6 volumes of 0.1 M KH 2 PO 4 , pH 8.3, 0.3 M NaCl, and 1 µM ZnSO 4 , using a Teflon-glass motor-driven pestle. NEP activity was measured by adding 35 µl of homogenate to wells containing 5 µl buffer or 10 phosphoramidon. Next, 10 µl of 2.5 mM N-dansyl-D-alagly-p-nitro-phe-gly substrate (Florentin et al. 1984) was added to each sample to yield a 0.5 mM final concentration and incubated for 4 min at 37°C. Subsequently, 100 µl of 10% TCA was added and plates were centrifuged to pellet precipitated proteins. Then 50 µl of supernatant was added to 100 µl of 100% ethanol and 50 µl of 1 N NaOH in a black fluorometric plate. After 10 min, plates were read at 590 nm emission, 320 nm excitation in a fluorometer. described an ELISA for the neuropeptide endopeptidase 3.4.24.11 in human serum and leukocytes. Gros et al. (1989) studied the protection of atrial natriuretic factor against degradation and the diuretic and natriuretic responses after in vivo inhibition of enkephalinase (EC 3.4.24 .11) by acetorphan. Increased tissue neutral endopeptidase 24.11 activity in spontaneously hypertensive hamsters was reported by Vishwanata et al. (1998) . Graf et al. (1998) studied regulation of neutral endopeptidase 24.11 in human vascular smooth muscle cells by glucocorticoids and protein kinase C. Pham et al. (1992) described the effects of a selective endopeptidase inhibitor on renal function and blood pressure in conscious normotensive Wistar and hypertensive DOCA-salt rats.

NEP is involved in organ systems other than the cardiovascular system, for example the brain and lung. Ratti et al. (2001) studied the correlation between neutral endopeptidase (NEP) in serum and the degree of bronchial hyperreactivity. Shirotani et al. (2001) found that neprilysin degrades both amyloid β peptides 1-40 and 1-42 very rapidly and efficiently. Newell et al. (2003) found that thiorphan-induced neprilysin inhibition raises amyloid β levels in rabbit cortex and cerebrospinal fluid. Facchinetti et al. (2003) described the ontogeny, regional and cellular distribution of metalloprotease neprilysin 2 (NEP2) in the rat in comparison with neprilysin and endothelin-converting enzyme-1. Cavalho KM, Boileau G, Camargo ACM, Juliano L (1996) A highly selective assay for neutral endopeptidase based on the cleavage of a fluorogenic substrate related to Leuenkephalin. Anal Biochem 237:167-173 Erdös EG, Skidgel RA (1989) Neutral endopeptidase 24.11 (enkephalinase) and related regulatory peptide hormones. FASB J 3:145-151 Facchinetti P, Rose C, Schwartz JC, Ouimet T (2003) Ontogeny, regional and cellular distribution of the novel metalloprotease neprilysin 2 in the rat: a comparison with neprilysin and endothelin-converting enzyme-1. Neuroscience 118:627-639 Florentin D, Sassi A, Roques BP (1984) A highly sensitive fluorometric assay for "enkephalinase", a neutral metalloendopeptidase that releases tyrosine-glycine-glycine from enkephalins. Anal Biochem 141:62-69 Goudreau N, Guis C, Soleilhac JM, Roques BP (1994) Dns-gly-(p-NO 2 )phe-βala, a specific fluorogenic substrate for neutral endopeptidase 24.11. Anal Biochem 219:87-95 Graf K, Schäper C, Gräge M, Fleck E, Kunkel G (1998) Johnston CI, Burrell LM (2001) In-vitro and in vivo inhibition of rat neutral endopeptidase and angiotensin converting enzyme with the vasopetidase inhibitor gemopatrilat. J Hypertens 19:941-946 Llorens C, Malfroy B, Schwartz JC, Gacel G, Roques BP, Mor- gat JL, Javoy-Agid F, Agid Y (1982) Enkephalin dipeptidyl carboxypeptidase (enkephalinase) activity: selective radioimmunoassay, properties and regional distribution in human brain. J Neurochem 39:1081-1089 Newell AJ, Sue LI, Scott S, Rauschkolb PK, Walker DG, Potter PE, Beach TG (2003) Thiorphan-induced neprilysin inhibition raises amyloid β levels in rabbit cortex and cerebrospinal fluid. Neurosci Lett 350:178-180 Pham I, el Amrani AI, Fournie-Zaluski MC, Corvol P, Roques B, Michel JB (1992) Effects of the selective endopeptidase inhibitor, retrothiophan, on renal function and blood pressure in conscious normotensive Wistar and hypertensive DOCA-salt rats. J Cardiovasc Pharmacol 20:847-857 Ratti H, Zhang M, Kunkel G (2001) Cardiac angiotensin converting enzyme can be quantified in tissue, such as in rat hearts with chronic infarction after left coronary ligation, by computerized in vitro autoradiography (Kohzuki et al. 1996) PROCEDURE Myocardial infarction is induced in Wistar rats by left coronary artery ligation (see A.3.2.2). After various time intervals (1-8 months) the animals are decapitated, the hearts rapidly removed, and snap-frozen in isopentane at -40°C. Frozen section (20 µm) are cut in a cryostat at -20°C. The sections are thaw-mounted onto gelatin-coated slides, dried in a desiccator for 2 h at 4°C and then stored at -80°C.

Radioligand: MK351A is a tyrosyl derivative of lisinopril, a potent competitive inhibitor of ACE. MK351A is iodinated by the chloramine T method and separated free from 125 I by SP Sephadex C25 column chromatography. 125 I-MK351A binding: The sections are preincubated in 10 mmol/L sodium phosphate buffer, pH 7.4, containing 150 mmol/L NaCl and 2% bovine serum albumin for 15 min at 20°C. The sections are then incubated with 11.1 KBq/ml 125 I-MK351A in the same buffer for 60 min at 20°C. Nonspecific binding is determined in the presence of 10 −6 mol/L MK351A or lisinopril. Binding isotherms are determined using a set of serial sections incubated with 10 −12 -10 −6 mol/L lisinopril for 60 min.

After incubation, the sections are rapidly dried under a stream of cold air, placed in X-ray cassettes, and exposed to Agfa Scopix CR3 X-ray film for 12-72 h at room temperature. After exposure, the sections are fixed in formaldehyde and stained with haematoxylin and eosin. The optical density of the X-ray films is quantified using an imaging device controlled by a personal computer.

The optical density of the autoradiographs is calibrated in terms of the radioactivity density in dpm/mm 2 with reference standards maintained through the procedure. The apparent binding site concentration (B max ) and binding affinity constant (K A ) in all the areas (excluding coronary arteries) of the right ventricle, intraventricular septum, the infarcted area in the left ventricle and the non-infarcted area in the left ventricle are estimated by an iterative non-linear model-fitting computer program LIGAND (Munson and Rodbard 1980) .

Kohzuki M, Johnston CI, Chai SY, Jackson B, Perich R, Paxton D, Mendelson FAO (1991) Measurement of angiotensin converting enzyme induction and inhibition using quantitative in vitro autoradiography: tissue selective induction after chronic lisinopril treatment. J Hypertens 9:579-587 Kohzuki M, Kanazawa M, Yoshida K, Kamimoto M, Wu XM, Jiang ZL, Yasujima M Abe K, Johnston CI, Sato T (1996) Cardiac angiotensin converting enzyme and endothelin receptor in rats with chronic myocardial infarction. Jpn Circ J 60:972-980 Mendelsohn FAO, Chai S, Dunbar SY et al (1984) In vitro autoradiographic localization of angiotensin-converting enzyme in rat brain using 125 I-labelled MK351A. J Hypertens 2, Suppl 3:41-44 Munson PJ, Rodbard D (1980) LIGAND, a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem 107:220-239

The renin-angiotensin-aldosterone hormonal axis is the major long-term control for regulation of both arterial blood pressure and sodium balance. It supports normotension or hypertension via angiotensin vasoconstriction and angiotensin plus aldosterone-induced renal sodium retention (Laragh 1993; Unger and Schölkens 2004) . Volpe et al. (1995) Wagner et al. (1996) showed that regulation of aldosterone biosynthesis by adrenal renin is mediated through AT 1 receptors in renin transgenic rats.

Easthope and Jarvis (2002) reviewed pharmacological, pharmacokinetic and clinical data on the angiotensin II antagonist candesartan cilexetil. Lee MA, Trimarco B (1995) Regulation of aldosterone biosynthesis by adrenal renin is mediated through AT 1 receptors in renin transgenic rats. Circ Res 77:73-79 Wagner J, Thile F, Ganten D (1996) The renin-angiotensin system in transgenic rats. Pediatr Nephrol 10:108-112

A.1.1.14.1 Angiotensin II Receptor Binding

Angiotensin II receptor subtypes, AT 1 and AT 2 , have been identified by structurally dissimilar antagonists, by different distribution in organs of various species and with specific radioligands (Chiu et al. 1989 (Chiu et al. , 1990 (Chiu et al. , 1992 (Chiu et al. , 1993 Chang and Lotti 1991; Gibson et al. 1991; Chansel et al. 1992; Steckelings et al. 1992; Aiyar et al. 1993; Barnes et al. 1993; Bossé et al. 1993; Bottari et al. 1993; Dzau et al. 1993; Feuillan et al. 1993; van Meel et al. 1993; Alexander et al. 2001 ). These two types of receptors have been cloned (Sasaki et al. 1991; Murphy et al. 1991; Mukoyama et al. 1993; Kambayashi et al. 1993) . Two other mammalian receptors named AT 3 and AT 4 have been described (de Gasparo et al. 1998 ). The functional correlates of angiotensin II receptors have been discussed by Timmermans et al. (1992 Timmermans et al. ( , 1993 Bernstein and Berk 1993) . Most effects of angiotensin are mediated via the AT 1 receptors, but a possible role of angiotensin II subtype AT 2 receptors in endothelial cells and isolated ischemic rat hearts has been suggested (Wiemer et al. 1993a, b) . Clearance studies in dogs indicated that the angiotensin type 2 receptor may be related to water handling in the kidney (Keiser et al. 1992) .

Evidence for AT 1 receptor subtypes (AT 1A and AT 1B ) has been reported (Iwai and Inagami 1992; Kakar et al. 1992; Balmforth et al. 1994; Matsubara et al. 1994; Bauer and Reams 1995; de Gasparo et al. 1998) . Chai et al. (2004) described the properties of the angiotensin IV/AT 4 receptor.

The assay described below is used to determine the affinity of test compounds to the angiotensin II receptor by measuring their inhibitory activity on the bind-ing of 3 H-angiotensin II to a plasma membrane preparation from rat or bovine adrenal cortex.

Fresh bovine adrenal glands are obtained from the local slaughter house. For rat adrenal glands, male Sprague-Dawley rats weighing 250-300 g are sacrificed. The adrenals are separated from fat tissue and the medullae removed. The cortices are minced and homogenized in 5 mM Tris buffer containing 1 mM MgCl 2 and 250 mM sucrose, pH 7.4, using a chilled Potter homogenizer. The homogenate is centrifuged at 3000 g and 4°C for 10 min. The supernatant is recentrifuged at 39,000 g and 4°C for 10 min. The pellets are resuspended in 75 mM Tris buffer containing 25 mM MgCl 2 , pH 7.4, and recentrifuged twice at 39,000 g and 4°C for 10 min. After the last centrifugation, the pellets are suspended in 75 mM Tris buffer containing 25 mM MgCl 2 and 250 mM sucrose, pH 7.4. Samples of 0.5 ml are frozen in liquid nitrogen and stored at -70°C.

In the competition experiment, 50 µl 3 H-angiotensin II (one constant concentration of 0.5-1 × 10 −9 M), and 50 µl test compound (6 concentrations, 10 −5 -10 −10 M) and 100 µl membrane suspension from rat or bovine adrenal cortex (approx. 250 mg wet weight/ml) per sample are incubated in a bath shaker at 25°C for 60 min. The incubation buffer contains 50 mM HEPES, 0.1 mM EDTA, 100 mM NaCl, 5 mM MgCl 2 and 0.2% bovine serum albumin, pH 7.4.

Saturation experiments are performed with 12 concentrations of 3 H-angiotensin II (15-0.007 × 10 −9 M). Total binding is determined in the presence of incubation buffer, non-specific binding is determined in the presence of non-labeled angiotensin II (10 −6 M).

The reaction is stopped by rapid vacuum filtration through glass fiber filters. Thereby the membranebound radioactivity is separated from the free one. The retained membrane-bound radioactivity on the filter is measured after addition of 3 ml liquid scintillation cocktail per sample in a liquid scintillation counter.

The following parameters are calculated:

• total binding of 3 H-angiotensin II • non-specific binding: binding of in the presence of mepyramine or doxepine • specific binding = total binding-non-specific binding • % inhibition of 3 H-angiotensin II binding: 100-specific binding as percentage of control value

The dissociation constant (K i ) and the IC 50 value of the test drug are determined from the competition experiment of 3 H-angiotensin II versus non-labeled drug by a computer-supported analysis of the binding data (McPherson 1985) . Olins et al. (1993) performed competition studies in rat uterine smooth muscle membranes and rat adrenal cortex membranes using [ 125 I] labeled angiotensin II.

Membranes from cultured rat aortic smooth muscle cells and from human myometrium were used for binding studies with [ 125 I] labeled angiotensin II by Criscone et al. (1993) . Wiener et al. (1993) used membrane preparations from rat lung and adrenal medulla for binding studies with [ 125 I] labeled angiotensin II. Bradbury et al. (1993) used a guinea pig adrenal membrane preparation to study nonpeptide angiotensin II receptor antagonists. Cazaubon et al. (1993) prepared purified plasma membranes from rat livers for [ 125 I] AII binding assays. Noda et al. (1993) described the inhibition of rabbit aorta angiotensin II (AII) receptor by a non-peptide AII antagonist. Kushida et al. (1995) tested AT II receptor binding in particulate fractions of rat mesenteric artery and rat adrenal cortex and medulla with 125 I-AT II. Chang et al. (1995) used rabbit aorta, rat adrenal and human AT 1 receptors in CHO cells and AT 2 receptors from rat adrenal and brain to characterize a nonpeptide angiotensin antagonist. Aiyar et al. (1995) tested inhibition of [ 125 I]angiotensin II or [ 125 I]angiotensin II (Sar 1 ,Ile 8 ) binding in various membrane and cell preparations, such as rat mesenteric artery, rat adrenal cortex, rat aortic smooth muscle cell, human liver, recombinant human AT 1 receptor, bovine cerebellum, and bovine ovary. Caussade et al. (1995) tested [ 125 I]Sar 1 ,Ile 8 -angiotensin II binding to rat adrenal membranes and rat aortic smooth muscle cells.

Using [ 125 I]Sar 1 ,Ile 8 -angiotensin II as radioligand, de Gasparo and Whitebread (1995) compared the affinity constants of valsartan and losartan in liver and adrenal of rat and marmoset, human adrenal and in rat aortic smooth muscle cells. Webb et al. (1993) transfected the vascular angiotensin II receptor cDNA (AT 1A ) into Chinese hamster ovary cells to generate the stable cell line CHO-AT 1A and recommended these cells as a useful model to study AT 1A receptor domains, which are critical to signaling pathways. Kiyama et al. (1995) used COS cells transfected with a cDNA encoding a human AT 1 angiotensin II receptor to evaluate nonpeptide angiotensin II receptor antagonists. Mizuno et al. (1995) used bovine adrenal cortical membranes, Nozawa et al. (1997) membrane fractions from rat aorta, bovine cerebellum and human myocardium and [ 125 I]angiotensin II as radioligand. Renzetti et al. (1995a, b) used membranes from rat adrenal cortex and bovine cerebellum for binding assays with [ 3 H]angiotensin II as radioligand.

Inter-species differences in angiotensin AT 1 receptors were investigated by Kawano et al. (1998) .

The angiotensin II receptor subtype having a high affinity for lorsatan has been designated angiotensin AT 1 receptor and the receptor having a high affinity for PD123177 (1- (3-methyl-4-aminophenyl) methyl-5diphenylacetyl-4,5,6,7-tetrahydro-1H-imidazo [3,5c] pyridine-6-carboxylic acid) as angiotensin AT 2 receptor (Bumpus et al. 1991; Nozawa et al. 1994; Chang et al. 1995) .

In order to determine affinity for the angiotensin AT 1 subtype in a radioligand binding assay with 125 Isarcosine 1 , isoleucine 8 angiotensin II, Chang and Lotti (1991) , Chang et al. 1995) , Wong et al. (1995) incubated membranes of tissues with both AT 1 and AT 2 receptors in the presence of 1 µM PD121981 (which occupied all the AT 2 binding sites) and for the angiotensin AT 2 subtype in the presence of 1 µM lorsatan (which occupied all the AT 1 binding sites). Hilditch et al. (1995) used membranes from rat livers and [ 3 H]-AT II for the determination of binding affinity at AT 1 receptors, or membranes from bovine cerebellum and [ 125 I]-Tyr 4 -AT II for AT 2 receptors. Lu et al. (1995) studied the influence of freezing on the binding of 125 I-sarcosine 1 , isoleucine 8 angiotensin II to angiotensin II receptor subtypes in the rat. The results suggested that studies of AII receptor subtypes that involve freezing of the tissue underestimate the density and affinity of the AT 1 receptor subtype.

In addition to the AT 1 receptor, the AT 2 receptor has attracted increasing interest (Gallinat et al. 2000; Nouet and Nahmias 2000) . Steckelings et al. (2005) reviewed the knowledge of AT2 receptor distribution, signaling and function with an emphasis on growth/anti-growth, differentiation, and the regeneration of neuronal tissue. Wan et al. (2004a Wan et al. ( , 2004b ) described a porcine myometrial membrane AT 2 receptor assay.

Myometrial membranes are prepared from porcine uteri. Nielsen et al. (1997) found that in myometrium from non-pregnant sows, the Ang II receptors were almost exclusively AT 2 receptors. A presumable interference by binding to AT 1 receptors was blocked by addition of 1 µM losartan. Binding of [ 125 I]Ang II to membranes was conducted in a final volume of 0.5 ml containing 50 mM Tris-HCl (pH 7.4), 100 mM NaCl, 10 mM MgCl 2 , 1 mM EDTA, 0.025% bacitracin, 0.2% BSA, homogenate corresponding to 10 mg of the original tissue weight, [ 125 I]Ang II (80,000-85,000cpm, 0.03 nM), and variable concentration of test substance. Samples were incubated at 25°C for 1.5 h, and binding was terminated by filtration through Whatman GF/B glass-fiber filter sheets, which had been pre-soaked overnight with 0.3% polyethylamine, using a Brandel cell harvester. The filters were washed with 3 × 3 ml of Tris-HCl (pH 7.4) and transferred to tubes. The radioactivity was measured in a γ -counter. All determinations were performed in triplicate.

The characteristics of the Ang-II-binding AT 2 receptor were determined by using six different concentrations (0.03-5 nmol/l) of the labeled [ 125 I]-Ang II. Non-specific binding was determined in the presence of 1 µM Ang II. The specific binding was determined by subtracting the non-specific binding from the total bound [ 125 I]-Ang II. IC 50 was determined by Scatchard analysis of data obtained with Ang II by using GraFit (Erithacus Software, UK). Whitebread et al. (1991) described the radioligand CGP 42112A as a high-affinity and highly selective ligand for the characterization of angiotensin AT 2 receptors. Heemskerk and Saavedra (1995) performed quantitative autoradiography of Ang II AT 2 receptors with [ 125 I]CGP 42112. Heerding et al. (1997) performed mutational analysis of the Ang II type 2 receptor in order to study the contribution of conserved extracellular amino acids. Hoe et al. (2003) reported the molecular cloning, characterization, and distribution of the gerbil Ang II AT 2 receptor. Utsunomiya et al. (2005) described Ang II AT 2 receptor localization in cardiovascular tissues by its antibody developed in AT 2 gene-deleted mice.

Gallinat S, Busche S, Raizada MK, Summers C (2000) The angiotensin II type 2 receptor: an enigma with multiple variation. Am J Physiol 278:E357-E374 Heemskerk FJM, Saavedra JM (1995) The isolated rabbit aorta has been used to evaluate angiotensin II agonists (Liu 1993) and angiotensin II antagonists (Chang et al. 1992 (Chang et al. , 1994 Noda et al. 1993; Aiyar et al. 1995; Cirillo et al. 1995; Kushida et al. 1995; Mochizuki et al. 1995; Renzetti et al. 1995; Wong et al. 1995; Hong et al. 1998; Kawano et al. 1998 ).

New Zealand White male rabbits weighing 2-3 kg are sacrificed and exsanguinated. The thoracic aorta is removed and cleaned from adherent fat and connective tissue. The vascular endothelium is removed by gently rubbing the intimal surface of the vessel. Spiral aortic strips (2-3 mm wide and 30 mm long) are prepared and mounted in 5 ml organ baths containing Krebs-Henseleit solution (120 mM NaCl, 4.7 mM KCl, 4.7 mM MgSO 4 , 1.2mM KH 2 PO 4 , 2.5mM

CaCl 2 , 25 mM NaHCO 3 , glucose 10 mM, pH 7.4). The organ baths are kept at 37°C and gassed continuously with 95% O 2 /5% CO 2 . Strips are attached to isometric transducers connected to a polygraph and a resting tension of 1 g is applied to each strip. Changes in contraction are analyzed with a digital computer. Aortic strips are allowed to equilibrate for 1 h and washed every 15 min. Two consecutive contractile-response curves to cumulative addition of ATII (0.1-300 mM) are constructed. After each curve the strips are washed 4 times and allowed to relax to the baseline tension. Afterward, each strip is incubated for 30 min with the vehicle or with a single concentration of the antagonist (1 -10 -100 -1000 mM) before a third concentrationresponse curve to angiotensin II is obtained.

The result of each concentration is expressed as a percentage of maximum response to AII. The pA 2 and pD 2 values are calculated (van Rossum 1963) .

Isolated guinea pig aortas were used by Mizuno et al. (1995) . Cirillo et al. (1995) evaluated the antagonism against AII-induced vasoconstriction in rat isolated perfused kidney. Chang et al. (1992 Chang et al. ( , 1994 determined AII-induced aldosterone release in rat adrenal cells and AII-induced [ 3 H]inositol phosphate accumulation in cultured rat aorta smooth muscle cells. Shibouta et al. (1993) described the pharmacological profile of a highly potent and long-acting Ang II receptor antagonist and its prodrug. Ojima et al. (1997) studied the mechanisms of the insurmountable antagonism of candesartan, an angiotensin AT 1 receptor antagonist, on Ang-II-induced rabbit aortic contraction in contraction and binding studies.

The effect of ATII antagonists on blood pressure has been measured in anesthetized (Olins et al. 1993; Beauchamp et al. 1995; Kawano et al. 1998 ), in pithed (Cazes et al. 1995 Christophe et al. 1995; Cirillo et al. 1995; Deprez et al. 1995; Häuser et al. 1998 ) and in conscious (Junggren et al. 1996; Nozawa et al. 1997; Shibasaki et al. 1997; Hashimoto et al. 1998 ) normotensive and hypertensive rats.

Male Sprague-Dawley rats are anesthetized with 100 mg/kg i.p. Inactin and placed on servo-controlled heating pads to maintain body temperature between 37°C and 38°C. PE50 catheters are implanted in the femoral artery and vein to measure arterial blood pressure and administer compounds, respectively. A catheter is placed in the trachea to ensure airway patency. Arterial pressure is measured continuously by connecting the arterial catheter to transducer coupled to a Gould pressure transducer. The output is recorded on a polygraph. Mean arterial pressure is derived electronically. After a 30-45 min stabilization period, autonomic transmission is blocked by treatment with mecamylamine (3 mg/kg i.v.) and atropine (0.4 mg/kg i.v.). After arterial pressure has stabilized, angiotensin is infused i.v. in isotonic saline with a syringe pump. When the pressure response to angiotensin has stabilized, angiotensin II antagonists are given in increasing doses. The doses are given intravenously in a cumulative fashion, i. e., the next highest dose is given at the time of maximum response to the prior dose.

Data are presented as percent inhibition of the angiotensin pressor response to each dose of the antagonists and plotted against the log of the cumulative doses of antagonist. Linear regression is used to calculate the dose at which the response to angiotensin is inhibited 50% (ID 50 ) for each rat. Means ±SEM are calculated. Olins et al. (1993) , Cirillo et al. (1995) determined also the antihypertensive effects in conscious spontaneously hypertensive rats and in conscious sodium-deficient dogs. Stasch et al. (1997) studied the long-term blockade of the angiotensin II receptor in renin trangenic rats, salt-loaded Dahl rats, and stroke-prone spontaneously hypertensive rats. Nishioka et al. (1998) , Richter et al. (1998) used the (mRen-2)27 transgenic (Tg + ) rat, a hypertensive model dependent on increased expression of the renin angiotensin system, to explore the role of angiotensin AT 2 receptors in the control of cardiovascular and renal excretory function.

Simoes e Silva et al. (1998) evaluated the effects of chronic administration of an angiotensin antagonist on diuresis and natriuresis in normotensive and spontaneously hypertensive rats. Kai et al. (1998) examined the effects of an angiotensin II type 1 antagonist on cardiac hypertrophy and nephropathy using Tsukuba hypertensive mice (THM) carrying both human renin and angiotensinogen genes. Kivlighn et al. (1995a, b) , Gabel et al. (1995) , studied angiotensin II antagonists in conscious rats, dogs, rhesus monkeys and chimpancees. Keiser et al. (1995) studied arterial blood pressure in conscious renal hypertensive rats, conscious sodium-depleted dogs, conscious sodium-depleted monkeys and conscious renal hypertensive monkeys. Kim et al. (1997) examined the effects of an angiotensin AT 1 receptor antagonist on volume overloadinduced cardiac gene expression in rats. Cardiac volume overload was prepared by abdominal aortocaval shunt. Cardiac tissue mRNA was measured by Northern blot analysis with specific probes. Yamamoto et al. (1997) , Ogilvie et al. (1998) , studied angiotensin II receptor antagonists in acute heart failure induced by coronary artery ligation in anesthetized dogs and in chronic heart failure induced by left ventricular rapid-pacing in conscious dogs. Massart et al. (1998) evaluated the cumulative hypotensive effects of angiotensin II-and endothelin-1receptor antagonists in a model renovascular hypertension in dogs. Hayashi et al. (1997) examined the hemodynamic effects of an angiotensin II type 1 receptor antagonist in rats with myocardial infarction induced by coronary ligation. Kivlighn et al. (1995c) studied the effects of a nonpeptide that mimics the biological actions of angiotensin II in anesthetized rats. Huckle et al. (1996) evaluated angiotensin II receptor antagonists for their ability to inhibit vascular intimal thickening in a porcine coronary artery model of vascular injury.

Beauchamp HT, Chang RSL, Siegl PKS, Gibson RE (1995) In contrast to other enzymes, renin shows a rather high species specificity. To be relevant for humans human renin has to be used. One of the reasons that human renin is specific for human angiotensinogen lies in the sequence of human angiotensinogen itself. Inhibition of renin is measured by angiotensinogen formed in the presence of angiotensinase inhibitors. The following procedure is used to determine the effect of potential renin inhibitors on purified human kidney renin without interference from plasma proteins or lipids.

The synthetic substrate represents the first fourteen amino acids of the N-terminus of human angiotensinogen: Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His-Leu-Val-Ile-His-Asn. The assay mixture is composed of phosphate buffer (pH 7.5), bovine serum albumin, 3 mM EDTA, 0.01 mM phenylmethylsulfonyl fluoride (PMSF), 0.002% Genapol PF 10, test compound (dissolved in DMSO), substrate (3 µM) and purified human kidney renin (Calbiochem GmbH, Frankfurt/M., Germany; cat. no. 553861). The mixture is incubated for two hours at 37°C. Then the reaction is stopped by transfer of 450 µl into preheated (95°C) Eppendorf tubes. The amount of angiotensin I liberated is measured by RIA (Renin MAIA kit, Serono Diagnostika GmbH, Freiburg, Germany). Human angiotensinogen (0.2 µM) may be used as a substrate instead of the tetradekapeptide. The pH value of the incubation mixture may be lowered to 6.0 by using a maleic acid buffer; this results in higher renin activity. HEPES (N-2-hydroxyethylpiperazine-N -2-ethane sulfonic acid) may be substituted for phosphate in the pH 7.5 buffer.

Renin activity, i. e. angiotensin I production (ng/ml × 2 h), is corrected for an angiotensin Ilike immunoreactivity which can be measured in the assay samples even in the absence of added renin. IC 50 values are determined from a plot of renin activity (as per cent of control) vs. molar concentration of the test compound. Wang et al. (1993) described a continuous fluorescence assay of renin activity employing a new fluorigenic peptide substrate.

Inhibition of plasma renin activity in blood samples from various species can be determined in order to evaluate the species specificity of a renin inhibitor Blood samples are obtained from dogs, sheep and rhesus monkeys by venipuncture. Wistar rats and guinea pigs are anesthetized with Nembutal (60 mg/kg intraperitoneally) and the blood is collected by puncture of the abdominal aorta. Human blood is collected from volunteers (Donafix blood collecting set, Braun Melsungen AG, Melsungen, FR Germany) in cooled bottles. All blood samples are anticoagulated with Na-EDTA (final concentration 10-15 mM). The renin is dissolved in DMSO as 10 −2 M stock solution and diluted before each experiment in DMSO. The endogenous formation of ANG I in plasma during incubation at 37°C is determined as the measure of renin activity. Generation and quantitation of ANG I are performed using a commercial radio immunoassay kit (Renin-MAIA, Serono Diagnostika GmbH, Freiburg, FR Germany). Plasma samples are thawed on ice and centrifuged after addition of 100 µl PMSF solution (kit) per 10 ml. The assay mixture contains 450 µl plasma plus 1% (v/v) PMSF solution, 45 µl buffer (phosphate buffer, pH = 7.4, + 10 −5 M ramiprilate) and 5 µl renin inhibitor solution (diluted in DMSO as required) or pure DMSO for controls. The assay is incubated for an appropriate time (2-3 hours) at 37°C. ANG I is measured in 100 µl samples (triplicate determinations). Basal ANG I immunoreactivity of the plasma is determined from an unincubated control assay (0°C). This pre-incubation value is subtracted from all measurements. The renin activity in the presence of the renin inhibitor is calculated as percent activity in relation to control samples containing only DMSO. The IC 50 value is determined from a semilogarithmic plot of percent renin activity versus concentration of the renin inhibitor. Wood et al. (1990) determined the activity of a synthetic renin inhibitor against rat, mouse, dog, guinea pig, rabbit, cat, marmoset and human renin using plasma pools from these species. Plasma from each species was collected using EDTA as an anticoagulant. Samples of plasma were incubated at 37°C in the presence or absence of varying concentrations of test compound. The ANG I formed was measured by radioimmunoassay. Shibasaki et al. (1991) used squirrel monkeys to study the in vivo activity of a specific renin inhibitor after intravenous and oral application. Bohlender et al. (1996) reconstructed the human renin-angiotensin system in transgenic rats overexpressing the human angiotensin gene TGR(hOGEN) 1623 by chronically injecting human recombinant renin intravenously using Alzet pumps. Salimbeni et al. (1996) tested the in vitro inhibition of human plasma renin activity by two synthetic angiotensinogen transition state analogues. Wood et al. (2003) determined the inhibitory potency of an orally effective renin inhibitor in vitro against human renin. Human recombinant renin (0.33 ng/ml) was incubated with a synthetic tetradecapeptide substrate (TDP, 13.33 µM) corresponding to the 14 terminal amino acids of human angiotensinogen, in 0.33 M Tes buffer, pH 7.2, containing 1% human serum albumin and 0.1% neomycin sulphate for 1 h at 37°C. The enzymatic reaction was stopped by adding 1 ml ice-cold 0.1 M Tris-acetate buffer, pH 7.4, containing 0.1% HSA. The angiotensin generated during the incubation was measured by radioimmunoassay. The oral activity was confirmed in hypertensive patients (Gradman et al. 2005) .

(4-amino-1-piperidinyl-carbonyl)-2(R)-benzylpropionyl)-L-histidinyl]-(2S,3R,4S)-1-cyclohexyl-3,4-dihydroxy-6(2pyridyl)-hexane-2-amide acetate (S 2864) (2004) showed in PAF-deficient mice that the absence of platelet-activating factor receptor protects mice from osteoporosis following ovariectomy, a model of postmenopausal osteoporosis.

PAF is also implicated in estrogen-induced angiogenesis via nuclear factor-κB activation (Seo et al. 2004 ) and in delaying corneal wound healing (Bazan 2005) .

The PAF receptor belongs to the superfamily of G protein-coupled receptors (Chao and Olson 1993, Izumi and Shimizu 1995) . Cloning studies have indicated a single human PAF receptor gene containing an intron at the 5 flanking region, providing alternative sequences (Ishi and Shimizu 2000) .

The following procedure is used to detect compounds that inhibit binding of 3 H-PAF (platelet activating factor) in rabbit platelets (PAF receptor).

Crude rabbit platelets are incubated in plastic tubes for 15 min at 25°C in a buffer solution (0.54 g/l KH 2 PO 4 , 0.6 g/l Na 2 HPO 4 , 5.8 g/l NaCl, 1.0 g/l BSA, pH 7.1) with 1 nM synthetic 3 H-labeled PAF (1-O-[1,2-3 H 2 ]alkyl-2-O-acetyl-sn-glycero-3-phosphocholine) and various concentrations of test compound. Nonspecific binding is determined in the presence of 10 µM CV 3988. Bound ligand is separated from the incubation medium by rapid filtration through Whatman GF/C glass fibre filters. Following rinsing with ice-cold buffer (3 × 5 ml) , the filters are placed in 10 ml scintillation cocktail for radioactivity determination.

The following parameters are calculated:

• total binding of 3 H-PAF • non-specific binding in the presence of 10 µM CV 3988 • specific binding = total binding-non-specific binding • % inhibition: 100-specific binding as percentage of the control value Compounds are first tested at a single high concentration (5000 nM) in triplicate. For those showing more than 50% inhibition a displacement curve is constructed using 7 different concentrations of test compound. Binding potency of compounds is expressed either as a "relative binding affinity" (RBA) with respect to the standard compound (CV 3988) which is tested in parallel or as an IC 50 . RBA = IC 50 standard compound IC 50 compound × 100%

Standard data:

• CV 3988 IC 50 : 276 nM ± 24 (n = 20)

Several authors (Casals-Stenzel et al. 1987; Dent et al. 1989a, b; Ring et al. 1992; Ukena et al. 1988 Endothelin is an endothelium-derived peptide family consisting of three peptides (ET-1, ET-2, and ET-3) with very potent and long-lasting vasoconstrictive activity (Yanagisawa et al. 1988a, b; King et al. 1989; Yanagisawa and Masaki 1989; Inoue et al. 1989; Shinmi et al. 1989; Vanhoutte et al. 1992; Davenport 2002; Masaki 2004) . ET-1 is processed from prepro ET-1, pro-ET-1 to big ET-1, which is converted to ET-1 by the endothelinconverting-enzyme (ECE).

Subtypes of endothelin receptors have been described (Takayanagi et al. 1991; Miyazaki et al. 1992) .

Molecular characterization of the ET A and ET B receptors was reported by Miyazaki et al. (1992) , Sakuarai et al. (1992) .

In addition, the existence of a third type, ET C , was found in Xenopus laevis (Karne et al. 1993) .

The comparison of recombinant endothelin receptors shows different affinity rank orders to the three endothelins (Masaki et al. 1994) . Grant et al. (1997) reported the in vitro expression of endothelin-1 (ET-1) and the ET A and ET B ET receptors by prostatic epithelium and stroma.

The ET peptides not only elicit potent and longlasting contractions of isolated strips of various blood vessels in vitro but also increase blood pressure in vivo suggesting that this peptide family may be involved in the pathogenesis of cardiovascular diseases (Simonson and Dunn 1990; Masaki 1991; Doherty 1992; Goto et al. 1996; Gray and Webb 1996; Douglas and Ohlstein 1997) . Sarafotoxin S6c, originally isolated from snake venom, is an agonist which distinguishes between endothelin subtypes (Williams et al. 1991) .

Endothelin is degradeted by vascular smooth muscle cells (Bernmek et al. 1996 Denudation is confirmed by the absence of relaxation to 10 −5 M acetylcholine in rings precontracted with 10 −7 M norepinephrine. Resting force is adjusted to the optimum resting tension of 0.75 g for pulmonary artery rings and 1.0 g for aortic rings. Maximum contraction to 8 × 10 −2 M KCl is determined and subsequent responses to endothelin are expressed as a percentage of maximum KCl contraction for determination of maximum effectiveness or as a percentage of maximum endothelin contraction for determination of potency.

Concentration-response curves are compared using the method of Carpenter (1986) . Data are expressed as means ± SEM and statistical comparisons are performed using Student's t-test, with P < 0.05 considered significant. Lembeck et al. (1989) studied the effects of endothelin on the cardiovascular system and on smooth muscle preparations in different species. Reynolds and Mok (1990) studied the role of thromboxane A 2 /prostaglandin H 2 receptor in the vasoconstrictor response of rat aorta to endothelin. Pang et al. (1990) studied the cellular mechanisms of action of endothelin in isolated canine coronary arteries. Lüscher et al. (1992) used perfused and pressurized mesenteric resistance arteries of rats and human internal mammary arteries to study the interaction between endothelin and endothelium-derived relaxing factors. Michel et al. (2003) studied the endothelin system in various animal models of pulmonary hypertension. Advenier et al. (1990) studied the contractile activity of three endothelins (ET-1, ET-2 and ET-3) on the human isolated bronchus. Wallace et al. (1989) compared the effects of endothelin-1 and endothelin-3 on the rat stomach.

Aldosterone secretion in cultured calf zona glomerulosa cells was stimulated by ET-1 and sarafotoxin S6b to a similar degree, but less than by angiotensin II (Gomez-Sanchez 1990) . Brock and Danthuluri (1992) used cultured vascular smooth muscle cells to study the cellular actions of endothelin.

Pigment dispersion in cultured dermal melanophores from Xenopus laevis was used as indicator of ET C receptor mediated responses (Karne et al. 1993 ). J Biol Chem 268:19126-19133 Lembeck F, Decrinis M, Pertl C, Amann R, Donnerer J (1989) Effects of endothelin on the cardiovascular system and on smooth muscle preparations in different species. Naunyn-Schmiedeberg's Arch Pharmacol 340:744-751 Lüscher TF, Boulanger C, Yang Z, Dohi Y (1992) Competitive endothelin antagonists are of therapeutic interest (Ihara et al. 1991; Fujimoto et al. 1992; Fukuroda et al. 1992; Urade et al. 1992; Breu et al. 1993; Mihara and Fujimoto 1993; Sogabe et al. 1993; Warner 1994; Opgenorth 1995; Brunner 1998) . A sensitive sandwich-enzyme immunoassay for human endothelin has been established by Suzuki et al. (1989) .

The ventricles of rat hearts are minced with scissors and homogenized in 7 vol of ice-cold 20 mM NaHCO 3 containing 0.1 mM PMSF (Phenylmethylsulfonyl fluoride), pH 7.4, with a Polytron homogenizer (Brinkman Instruments Inc., Westberg, NY). The homogenates are centrifuged at 1000 g for 10 min, and then the pellet discarded. The supernatant is centrifuged at 30,000 g for 30 min. The pellet is washed once and resuspended in Tris buffer (50 mM, pH 7.4 at 25°C) containing 0.1 mM PMSF, and stored at -80°C until use.

For binding studies (Gu et al. 1989 ) cardiac membranes (0.21 mg/ml as protein) are incubated with 25 pM [ 125 I]ET-1 or [ 125 I]ET-3 (New England Nuclear) in a final assay volume of 0.1 ml in borosilicated glass tubes, containing 50 mM Tris-HCl, 0.1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 10 µg/ml pepstatin A, 250 µg/ml bacitracin, and 10 µg/ml soybean trypsin inhibitor (pH 7.4). Binding is performed for 60 min at 37°C. The binding reaction is terminated by the addition of 2.5 ml of ice-cold 50 mM Tris-HCl (pH 7.4), followed by a rapid filtration through a Whatman GF/C glass fibre filter (presoaked in 1% polyethyleneimine) under reduced pressure. The filters are then quickly washed 4 times with 2.5 ml of the buffer. Radioactivity retained on the filter is counted.

Non-specific binding is defined in the presence of ET-1. Specific binding is the difference between total and non-specific binding. K i -values and Scatchard plots are calculated.

The nomenclature of endothelin receptors has been reviewed by Alexander et al. (2001) . Cain et al. (1991) described an endothelin-1 receptor binding assay for high throughput chemical screening using the clonal cell line A10 of smooth muscle cells, derived from embryonic rat thoracic aorta.

Functional endothelin/sarafotoxin receptors were described in rat heart myocytes (Galron et al. 1989) and in the rat uterus (Bousso-Mittler 1989) . Mihara and Fujimoto (1993) cultured rat aortic smooth muscle A7r5 cells expressing ET A receptors (Takuwa et al. 1990 ) and human Girardi heart cells expressing ET B receptors (Mihara and Fujimoto 1992) . Receptor specificity could be demonstrated. Mihara et al. (1994) characterized the nonpeptide endothelin receptor antagonist 97-139, both in vitro (rat aortic smooth muscle cells and Girardi heart cells) and in vivo (ET1-antagonism in pithed rats) and compared it with another endothelin receptor antagonist . Discrepancies between in vitro and in vivo data were explained by different plasma binding. Aramori et al. (1993) studied the receptor-binding properties and the antagonistic activities of an endothelin antagonist in transfected Chinese ovary hamster cells permanently expressing the two ET receptor subtypes (ET A and ET B ).

De Juan et al. (1993) characterized an endothelin receptor subtype B in the retina of rats. Clozel et al. (1994) performed binding assay on cells or membranes from baculovirus infected insect cells that expressed recombinant ET A or ET B receptor, CHO cells that expressed recombinant ET A or ET B receptor, cultured human vascular smooth muscle cells from umbilical veins, rat mesangial cells (for ET A ), microsomal membranes from human placenta and from porcine cerebellum (for ET B1 ) and from porcine trachea (for ET B2 , using BQ-3020 or sarafotoxin S6C as ligand). Williams et al. (1995) used CHO cells expressing cloned ET A or ET B receptors directly in binding and functional assays without preparing membranes from them. Reynolds et al. (1995) used CHO-K1 cells expressing recombinant human ET B receptor, Ltk − cells expressing human ET A receptor and rabbit renal artery vascular smooth muscle cells expressing rabbit ET A receptor for evaluation of an ET A receptor antagonist.

Rat or bovine cerebella were used for differentiation of receptor subtypes (Williams et al. 1991) .

Peter and Davenport (1995) proposed a selective ligand for ET A receptors. Ihara et al. (1992) , Watakabe et al. (1992) described radioligands for endothelin (ET B ) receptors. Vigne et al. (1996) described the properties of an endothelin-3-sensitive Eta-like endothelin receptor in brain capillary endothelial cells.

The human type-B endothelin receptor was cloned from human lung poly A+RNA and expressed in CHO cells by Chiou et al. (1997) . Dissociation characteristics of endothelin receptor agonists and antagonists were determined. Stables et al. (1997) described a bioluminescent assay for agonist activity at G-protein-coupled receptors, such as the endothelin ET A receptor. Transient expression of apoaequorin in CHO cells and reconstitution with the cofactor coelenterazine resulted in a large, concentration dependent agonist-mediated luminescent response following cotransfection with the endothelin ET A , angiotensin AT II , TRH and neurokinin NK 1 receptors, all of which interact predominantly with the Gα q -like phosphoinositidase-linked Gproteins. (Hickey et al. 1985; Yanagisawa et al. 1988 Yanagisawa et al. , 1989 Inoue et al. 1989; Kimura et al. 1989; Ihara et al. 1991; Fukuroda et al. 1991) .

Since the smooth musculature is considered to contain mainly ET A receptors the preparation is used to test ET A antagonists.

Left anterior descending coronary arteries are isolated from fresh porcine hearts. Connective tissues and adherent fat are removed. For removal of vascular endothelium, the intimal surface of spiral strips is rubbed gently with filter paper. The endothelium-denuded arteries are cut into spiral strips about 10 mm long and 1 mm wide. Each strip is suspended in an organ bath containing Krebs-Henseleit solution bubbled with 95% O 2 /5% CO 2 at 37°C. After equilibration, reference contraction is isometrically obtained with 50 mM KCl. Concentration-response curves for ET-1 are obtained by cumulative additions of ET-1. Antagonists are added 20 min before the cumulative additions of ET-1.

The pA 2 values and slopes are obtained by analysis of Schild plots. Opgenorth et al. (1996) characterized an orally active and highly potent ET A -selective receptor antagonist by in vitro and in vivo methods. Calo et al. (1996) investigated three rabbit vessels, the carotid, the pulmonary artery, and the jugular vein to identify vascular monoreceptor systems, either ET(A) or ET(B), for structure-activity studies of endothelins and their antagonists. Vedernikov et al. (1993) used rings of the left circumflex coronary artery from dogs which were denuded of endothelium and exposed to anoxic periods. August et al. (1989 ), Urade et al. (1992 used rat aortic smooth muscle denuded of the epithelium and Sogabe et al. (1993) spirally cut strips of rabbit aorta. Williams et al. (1995) used rat aorta, rabbit iliac and pulmonary artery for contractile assays, and anesthetized ferrets and conscious normotensive dogs as in vivo models to characterize a nonpeptidyl endothelin antagonist. Itoh et al. (1993) studied the preventive effect of an ET A receptor antagonist on experimental cerebral vasospasm in dogs using a two-hemorrhage model of subarachnoid hemorrhage. Clozel et al. (1993) performed similar experiments in rats.

The vasodilating effect in the isolated perfused rat mesentery which is found after infusion of rat endothelin (Warner et al. 1989 ) and after the selective ET B receptor agonist sarafotoxin S6c (Williams et al. 1991) can be antagonized by an endothelin receptor antagonist (Clozel et al. 1993) . Ercan et al. (1996) found an increase of digoxininduced ectopic ventricular complexes by endothelin peptides in isolated guinea pig hearts, which could be antagonized by an endothelin-A receptor antagonist.

The endothelin-induced sustained increase of blood pressure in anesthetized rats was studied by Yanagisawa et al. (1988) , Inoue et al. (1989 ), Ihara et al. (1991 . Intravenous bolus injection of endothelin causes a biphasic blood pressure response: a transient decrease, probably mediated from the release of vasodilator mediators (prostacyclin and EDRF), and a sustained increase (Rubanyi and Bothelho 1991) . Nishikibe et al. (1993) examined the antihypertensive effect of an endothelin antagonist in a genetic hypertensive model (stroke-prone spontaneously hypertensive rats). Watanabe et al. (1995) characterized the pharmacological profile of a non-selective endothelin receptor antagonist and studied the inhibition of myocardial infarct size in rats.

The contractile activity of the isolated guinea pig trachea without epithelium and of the guinea pig longitudinal muscle was used by Urade et al. (1992) for determination of ET B receptor mediated responses. Spinella et al. (1991) assessed bioactivity of a specific endothelin-1 antagonist in an isolated perfused guinea pig lung preparation in which pulmonary artery pressure was monitored. Gosselin et al. (2002) demonstrated the effects of a selective ET A -receptor antagonist in murine models of allergic asthma. Tabrizchi and Ford (2003) studied the haemodynamic effects of the endothelin receptor antagonist tezosentan in anaesthetized rats treated with tumor necrosis factor-alpha. 

Radioligand: Endothelin-1 is iodinated with 125 Iodine using Iodogen (Pierce Chemical Co, IL, USA) 125 I-ET-1 binding: The sections are preincubated for 15 min at 20°C in 20 mmol/L Hepes buffer, pH 7.4, containing 135 mmol/L NaCl, 2 mmol/L CaCl 2 , 0.2% BSA, and 0.01% bacitracin. The sections are then incubated with 11.1 KBq/ml 125 I-ET-1 in the same buffer for 60 min at 20°C. Nonspecific binding is determined in the presence of 10 −6 mol/L ET-1. Binding isotherms are determined using a set of serial sections incubated with 10 −12 to 10 −6 mol/L unlabelled ET-1 for 60 min.

After incubation, the sections are rapidly dried under a stream of cold air, placed in X-ray cassettes, and exposed to Agfa Scopix CR3 X-ray film for 12-72 h at room temperature. After exposure, the sections are fixed in formaldehyde and stained with hematoxylin and eosin. The optical density of the X-ray films is quantified using an imaging device controlled by a personal computer.

The optical density of the autoradiographs is calibrated in terms of the radioactivity density in dpm/mm 2 with reference standards maintained through the procedure. The apparent binding site concentration (B max ) and binding affinity constant (K A ) in all the areas (excluding coronary arteries) of the right ventricle, intraventricular septum, the infarcted area in the left ventricle and the non-infarcted area in the left ventricle are estimated by an iterative non-linear model-fitting computer program LIGAND (Munson and Rodbard 1980).

Endothelin converting enzyme inhibitors suppress the biosynthesis of endothelin are therefore potential antihypertensive drugs (De Lombaert et al. 1994; Trapani et al. 1995; Morita et al. 1994; Bihovsky et al. 1995; Claing et al. 1995; Descombes et al. 1995; Chackalamannil et al. 1996; Jeng 1997; Jeng and De Lombaert 1997; Brunner 1998) .

Purification of rat and porcine endothelin converting enzyme (ECE) was reported by Ohmaka et al. (1993 ), Takahashi et al. 1993 . Molecular cloning and characterization of the enzyme ECE-1 was performed from rat (Shimada et al. 1994 ), bovine (Ikura et al. 1994 Schmidt et al. 1994; Xu et al. 1994) , and human tissue (Schmidt et al. 1994; Shimada et al. 1995; Yorimitsu et al. 1995) .

A second enzyme, termed ECE-2, was cloned (Emoto and Yanagisawa 1995) . Walkden and Turner (1995) described the expression of endothelin converting enzyme and related membrane peptidases, e. g., the endopeptidase E-24.11, in the human endothelial cell line EA.hy926.

A rapid and selective in vitro assay for endothelin-converting enzyme was described by Fawzi et al. (1994) . The assay is based on the quantitative determination of [ 125 I]endothelin-1 released from (3-[ 125 I]iodotyrosyl 13 )big endothelin-1 by binding to the membrane bound endothelin receptor.

For the preparation of lung membranes, frozen guinea pig lungs are weighed and homogenized in 10 times gram tissue weight of solution A (50 mM Tris-HCl, pH 7.4, 025 M sucrose, and 2 mM EDTA) using a Polytron tissue homogenizer. Homogenization is repeated 4 times with 5-to 8-min intervals between homogenization. Homogenates are spun for 30 min at 2000 g. Supernatants containing membranes are carefully decanted and saved. Pellets are rehomogenized in solution A and homogenates are spun at 2000 g for 30 min. Supernatants are removed, mixed with supernatants from the first spin and spun at 100,000 g for 60 min. Pellets containing membranes are suspended in solution B (10 mM Tris-HCl, pH 7.4, and 0.125 M sucrose) using a Dounce homogenizer. Samples are divided into 1-ml fractions, rapidly frozen in a dry icemethanol bath, and stored at −80°C.

Rat liver membranes are prepared with the same method and further purified over a sucrose step gradient. The membranes are suspended in solution C (10 mM Tris-HCl, pH 7.4) containing 44% sucrose at a protein concentration of 2 mg/ml. Samples of 25 ml are placed in ultraclear centrifuge tubes for the Beckman SW 28 rotor, overlaid with 10 ml solution C containing 42.3% sucrose, and spun for 2 h at 27,000 rpm (100,000 g). Top layers containing membrane are collected and diluted with solution C to obtain an 8% sucrose concentration. Samples are spun in a 45 Ti rotor (100,000 g) for 1 h. Supernatants are discarded. Pellets containing membrane are suspended in solution B, divided into 1-ml samples, rapidly frozen in dry icemethanol bath, and stored at −80°C.

For the endothelin (ET) binding assay, membrane preparations are incubated with selected concentrations of [ 125 I]endothelin-1 (final reaction volume = 500 µl) in a solution D containing 60 mM Tris-HCl, pH 7.4, 150 mM NaCl and 6 mg/ml BSA for 90 min at 37°C. Reactions are terminated by the addition of 4 ml of solution E containing 10 mM Tris-HCl, pH 7.4, and 150 mM NaCl at 4°C followed by rapid filtration on Whatman GF/B glass microfiber filters. Filters are presoaked for 1 h at 4°C in a solution containing 50 mM Tris-HCl, pH 7.4, 10 mg/ml BSA and 0.1% sodium azide. Test tubes and filters are washed four times with 4 ml of solution E at 4°C, and radioactivity retained on the filters is counted in a gamma counter. Nonspecific binding is determined in the presence of 1 µM unlabeled ET-1 in the reaction mixture.

For the endothelin converting enzyme assay, samples containing 10 µg of protein are incubated in a solution containing 50 mM Tris-HCl, pH 7.0, 100 mM NaCl and 5 mg/ml BSA in a final volume of 100 µl. Conversion reactions are initiated by addition of [ 125 I]big endothelin-1 to obtain a final concentration of 500 pM. Samples are incubated for 2 h at 37°C. To measure [ 125 I]endothelin-1 released from [ 125 I]big endothelin-1 conversion, 50 µg of purified rat liver membranes (as a source of ET receptors) is added to the reaction mixture, and reaction volume is adjusted to 500 µl and solution composition is adjusted to that of solution D of the endothelin binding assay. Following a 90-min incubation at 37°C to reach equilibrium in binding, reactions are terminated by addition of a solution E at 4°C followed by rapid filtration on Whatman GF/B glass microfiber filters. Nonspecific binding is determined in the presence of 1 µM unlabeled ET-1 in the reaction mixture. Specific ET-1 binding is used as an index of endothelin converting enzyme activity.

To test the effect of endothelin converting enzyme inhibitors, endothelin converting enzyme assays are carried out in the presence of desired concentrations of the compounds.

Endothelin converting enzyme activity in the presence of compounds is expressed as a percentage of control endothelin converting enzyme activity in the membrane preparation which is determined simultaneously. The concentration of compounds producing a 50% inhibition of endothelin converting enzyme activity (IC 50 values) is determined from a plot of the percentage of control endothelin converting enzyme activity versus log concentration of compounds.

Male Sprague Dawley rats weighing 300-400 g are anesthetized with ether, spinalized and placed under artificial respiration. The vagus nerves are cut and the carotid arteries ligated. A catheter is placed in one of the carotid arteries to allow measurement of arterial blood pressure. The second catheter in placed into the penile vein to allow infusion or injection of drugs. After stabilization, the animals receive a first injection of either ET-1, big ET-1, norepinephrine, angiotensin I or AT II, The pressor responses are recorded and after return to the baseline, a second injection of the agonist is given either in the presence or the absence of the inhibitor.

Data are calculated as mean ± SEM. Student's t-test for paired and unpaired observations is used to analyze the results. Little et al. (1994) developed a two-step protocol for high-throughput assays of endothelin converting enzyme activity. Human umbilical vein and human aorta endothelial cells were found to preferentially convert the big endothelin-1 isopeptide through a membranebound, thiorphan-insensitive, and phophoramidonsensitive zinc metalloendopeptidase. Endothelins are quantified by a separate step using either enzyme immunoassays or radioceptor assays in 96-well formats. The method can be used to either characterize ECE from different tissues or screen for inhibitors of a specific ECE activity. McMahon et al. (1993) tested the effects of endothelin converting enzyme inhibitors and endothelin receptor subtype A antagonists on blood pressure in spontaneously and renal hypertensive rats.

Changes of vascular resistance in isolated perfused kidneys were used by Descombes et al. (1995) to characterize a selective inhibitor of big ET-1 responses. The studies were performed on kidneys taken from adult male Wistar rats (300-400 g). The rats were anesthetized with sodium pentobarbital (50 mg/kg i.p.) and the left kidney was prepared for infusion with Tyrode solution. The changes in renal vascular resistance were recorded as changes in perfusion pressure monitored at constant flow (6 ml/min). After stabilization, a bolus injection of ET-1 or big ET-1 was administered and the resulting pressure responses were recorded. On return to baseline levels, a second injection of the endothelins was given either under control conditions or in presence of the putative enzyme inhibitor.

Because increasing evidence implicates that endothelin plays a role in the pathophysiology of cerebral insults, Kwan et al. (1997) studied the prevention and reversal of cerebral vasospasm in an experimental model of subarachnoid hemorrhage. Three ml of arterial blood was withdrawn from the ear artery of rabbits and injected into the cisterna magna under anesthesia. Drugs were administered either before or 24 h after this procedure. Forty-eight hours later, the animals were anesthetized again and perfusion fixation was performed with Hank's balanced salt solution followed by a mixture with 2% paraformaldehyde and 2.5% glutaraldehyde. Cross sections of the basilar arteries were analyzed by computer-assisted morphometry.

A review on the knowledge of molecular pharmacology of endothelin converting enzymes was given by Turner and Murphy (1996) .

Johnson and Ahn (2000) developed an internally quenched fluorescent substrate selective for endothelin-converting enzyme-1.

Luciani et al. (2001) described highly sensitive and selective fluorescence assays for rapid screening of endothelin-converting enzyme inhibitors. The endothelium releases a labile, diffusable vasorelaxing substance that has been termed endothelium-derived relaxing factor = EDRF endothelium-derived relaxing factor. (Furchgott and Zawadszki 1980) . Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor (Palmer et al. 1987; Vanhoutte 1999) . Nitric oxide plays a role in a wide range of physiological processes including regulation of blood flow and arterial pressure via endothelium-dependent relaxation of blood vessels (Rees et al. 1989; Moncada et al. 1991; Umans and Levi 1995; Huraux et al. 1999; McIntyre et al. 1999; Zanzinger 1999; Hropot et al. 2003) , ischemia/reperfusion injury (Gao et al. 2002; Schulz et al. 2004) , peripheral nitregric transmission at smooth muscle (Rand and Li 1995) , intracellular communication in the CNS with activation of guanylyl cyclase in target neurons (Southam and Garthwaite 993), experimental stroke (Willmot et al. 2005) , learning and memory (Susswein et al. 2004) , in neurogenic inflammation (Kajekar et al. 1995) , in the regulation of leukocyte recruitment (Hickey 2001), and macrophage defense mechanisms following exposure to bacterial products (Förstermann et al. 1992; Förstermann and Kleinert 1995; Moncada 1994). Fiorucci et al. (2002) discussed the effects of nitric oxide-releasing NSAIDs.

NO-donor drugs, such as sodium nitrite, sodium nitroprusside, S-nitroso-N-acetyl-D,L-penicillamine (SNAP), 3-morpholino-sydnonimine (SIN-1) are used as vasodilators (Schör et al. 1989; Megson 2000) . N G -Nitro-L-arginine was described as an antagonist of endothelium-dependent dilator responses by inhibiting endothelium-derived relaxing factor release (Moore et al. 1990; Lamontagne et al. 1991) . Ribero et al. (1992) proposed inhibition of nitric oxide synthesis by long-term treatment of rats with nitro-L-arginine as a new model of arterial hypertension.

Excessive production of NO damages DNA and activates poly(ADP-ribose)polymerase (PARP) (Pieper et al. 1999) . In cases of massive NO production, neurons enter the PARP-suicide pathway. NO damages DNA via to major pathways: the first involves nitrosation of primary or secondary amines and nucleic acid bases, whereas the second involves the combination of NO with superoxide to from peroxinitrite (Szabó et al. 1996 (Szabó et al. , 1997 . The most likely reactive oxidant intermediate responsible for DNA breakage is peroxynitrous acid which rapidly oxidizes sulphydryl groups, and also nitrates and hydroxylates aromatic compounds including tyrosine, tryptophan, and guanosine (Halliwell 1997) . Downstream DNA damage that follows excessive NO production results in significant activation of poly(ADP-ribose)polymerase which leads to rapid energy depletion and cell death (Feihl et al. 2001) . Davis et al. (2001) reviewed the non-3 ,5 -cyclicguanosine-monophosphate-mediated effects of NO including modifications of proteins, lipids, and nucleic acids.

Andreadis et al. (2003) described oxidative and nitrosative events in asthma. EDRF release from arterial endothelium can be studied by a sandwich technique using donor tissue with intact endothelium facing with its intimal side the intimal side of a detector tissue.

Rabbits are subjected to various kinds of treatment, e. g., atherogenic diet or drug treatment for prevention of arteriosclerosis. Aorta segments, about 2 cm in length, are prepared, cut open along their longitudinal axis and pinned to a tissue suspender without damaging the endothelium. These segments serve as donor tissue for EDRF. Circumferential aorta strips from the abdominal aorta of untreated control rabbits are de-endothelialized by gently blotting their luminal surfaces on wet filter paper. These denuded abdominal aorta strips are pinned opposite the donor segments (intimal surface facing intimal surface) and function as detector for luminally released EDRF. Each sandwich preparation is suspended in a 40-ml organ bath, filled with oxygenated Krebs-Ringer buffer at 37°C containing 10 mM indomethacin. After connecting the detector strip to a force transducer, the angle between the detector strip and the donor segment is minimized and the distance between donor and detector tissue standardized. After one hour stabilization, the strips are brought to their optimum length-tension relationship by repeated exposure to 80 mM KCl. When a stable contractile response is established, the strips are precontracted with phenylephrine to 80-100% of their KCl-induced contraction. After stabilization of plateau phase, cumulative doses of acetylcholine (0.01-10 mM) are added to induce EDRF release from donor tissues.

Relaxations of the detector strip induced by EDRF release from treated donor rabbit aortas are compared with aortas from control rabbits.

An other bioassay for measuring function of cultured endothelial cells using a computer system for the acquisition and analysis of vascular contractility has been published by Winn et al. (1992) . Endothelial cells are able to synthesize and release potent vasoconstrictive agents, such as endothelin and angiotensin as well as vasodilating agents, such as EDRF.

In isolated arterial segments the endothelial surface can be functionally destroyed allowing a differentiation between a direct action of drugs on the smooth muscle cells and an indirect effect via the endothelium. Isolated rings of rabbit or rat aorta are useful models to study the effects of endothelium derived factors such as EDRF or endothelins and their antagonists (Linz et al. 1986; Tracey et al. 1990; Fujimoto et al. 1992; Fukuroda et al. 1992; Wiemer et al. 1992) . A survey of the history and on techniques leading to the discovery of endothelium-dependent relaxation was given by Furchgott (1993) .

The descending thoracic aorta from rabbits of either sex (weighing 2.5-3.5 kg) is excised and dissected free from connective tissue. Care is taken to avoid damage of the endothelium. The aorta is divided into 2 mm wide rings and cut off in small strips. From some strips, the endothelium is removed by gently rubbing the intimal surfaces between the fingers for approximately 30 s. The strips are suspended in a 25 ml organ bath containing Krebs-bicarbonate solution at 37°C being gassed continuously with 5% CO 2 /95% O 2 . Contractions of the strips are recorded isometrically with a load of 2 g on the tissues. After an equilibration period of 2 h a stable baseline tone is reached.

To study the vasodilating effects of a compound, the strips are contracted with norepinephrine (10 −8 M), or angiotensin II (10 −7 M), or potassium chloride (20 mM). When a stable contraction plateau has been reached, the vasodilating agent is added in various concentrations. In these concentrations, norepinephrine, angiotensin II and KCl evoke a response of 60-80% of maximal contraction in intact rings of rabbit aorta. Rings without endothelium exhibit a response which is significantly enhanced in comparison with the response of the intact preparation after norepinephrine and angiotensin II precontraction.

To indicate the functional removal of the endothelium, the responsiveness of each preparation is tested with the known endothelium-dependent dilator, acetylcholine. In endothelium-intact rings, acetylcholine relaxes contractions induced by norepinephrine or angiotensin II. In precontracted rings devoid of endothelium, acetylcholine does not show any relaxing effect or causes contractions by itself at higher concentrations (Furchgott and Zawadzki 1980). As an example, atriopeptin III causes a similar concentration-dependent relaxation of all precontracted preparations with intact and with functionally destroyed endothelium indicating a direct effect on the smooth muscle cells. The relaxation is accompanied by an increase of cGMP.

Statistical analyses are performed by regression analysis of dose response curves to determine EC 50 values. Data are given as means ± standard deviation.

The isolated aortic ring of rabbits with and without functionally intact endothelium is a useful tool to differentiate direct effects on the arterial smooth musculature from effects mediated by the endothelium. Fujimoto et al. (1992) used the thoracic aorta from rats to study the effects between endothelin and an endothelin receptor antagonist. In transverse strips from ratthoracic aorta, 2 mm wide and 4-5 mm long, the endothelium was removed by gently rubbing the interior surface of the aorta. Concentration-response curves of contractions after ET-1 in the presence and the absence of the inhibitor were compared. Pellisier et al. (1992) perfused the isolated mesenteric vascular bed of the rat with Tyrode solution and measured the perfusion pressure after injection of graded doses of norepinephrine and the dose-dependent relaxation due to acetylcholine in the vascular bed precontracted by norepinephrine infusion. In order to destroy the endothelial layer, the perfusate was changed to a hypotonic Tyrode solution containing all of the constituents present in normal Tyrode solution but in one-tenth of the concentration resulting in disruption of more than 95% of the endothelial cells. The effect of norepinephrine was enhanced, whereas the effect of acetylcholine was abolished.

Legan and Sisson (1990) described a method to denude rat aortic endothelium in vitro with saponin. Bohn and Schönafinger (1989) used helical strips of pulmonary arteries of guinea pigs in which the endothelium has been removed for biological detection of NO. Fukuroda et al. (1992) used spiral strips from porcine coronary artery and vein and from intrapulmonary artery and vein removing the intimal surface by lightly rubbing with wet filter paper. Concentrationcontraction curves for ET-1 and ET-3 were obtained with and without an endothelin antagonist. Hayashi et al. (1988) described functional and anatomical recovery of endothelium after balloon denudation of the left circumflex coronary artery in dogs.

Endothelial denudation of the left circumflex coronary artery was used by Chu and Cobb (1987) to study the vasoactive effects of serotonin on proximal coronary arteries in awake dogs.

Experiments in isolated rings of the left circumflex or left anterior descending coronary artery of dogs with and without endothelium were performed by Desta et al. (1995) . Terrón (1996) analyzed the effects of 5-HT 1receptor antagonists on 5-HT and sumatriptan induced isometric contractions in endothelium denuded segments of canine coronary arteries. Ren et al. (1993) isolated coronary arteries from Japanese monkeys (Macaca fuscata) with and without endothelium to study muscarinic receptor subtypes mediating vasodilatation and vasoconstriction. Endothelial cells are able to synthesize and to release not only potent vasoconstrictor peptides such as an-giotensin and endothelin but also potent dilators such as nitric oxide (NO), ATP, substance P, and bradykinin. NO-formation can be assessed by determination of intracellular cyclic GMP in cultured endothelial cells, whereas release of NO from these cells can be measured by the stimulatory effect of NO on the activity of soluble guanylyl cyclase (Lückhoff et al. 1988; Wiemer et al. 1991; Linz et al. 1992; Bogle et al. 1992; review by Moncada et al. 1991 ).

Bovine or porcine aorta is obtained from local slaughter houses. Endothelial cells are isolated by digestion with dispase (Lückhoff et al. 1988) . The cells are seeded on 6-or 24-well plates (e. g., Nunc Intermed, Wiesbaden, Germany) and grown to confluence. Dulbecco's modified Eagle's/Ham's F-12 medium containing 20% fetal calf serum is supplemented with penicillin (10 U/ml), streptomycin (10 µg/ml), L-glutamate (1 mM/l), glutathione (5 mg/ml), and L(+)ascorbic acid (5 mg/ml); (Biotect protection medium).

Primary cultures of endothelial cells are used. After removal of the culture medium by aspiration, the monolayer is washed twice with 2 ml HEPES-Tyrode's solution (37°C). Thereafter, the cells are preincubated for 15 min at 37°C with 3-isobutyl-1-methylxanthine (IBMX), (10 −4 M/l). After this time, drugs or solvents are added. After predetermined periods, the incubation medium is quickly removed. The cells are then immediately extracted with 0.6 ml 6% trichloroacetic acid and scraped off with a rubber scraper. The cell suspension is sonicated for 10 s before being centrifuged for 5 min at 4000 g. The supernatants are extracted with four volumes of water saturated diethylether, and the samples frozen (-20°C) until analysis. The protein contents of the samples are measured according to Lowry et al. (1951) . Cyclic GMP can be determined in the acetylated samples by various methods (Heath et al. 1992 ), e. g., using a commercially available radioimmunoassay (New England Nuclear). Cyclic GMP content is expressed as picomoles GMP per milligram protein.

Release of NO from endothelial cells is assayed on the basis of the stimulatory effect of NO on the activity of soluble guanylyl cyclase (purified from bovine lung) (Gerzer et al. 1981) . The activity of the enzyme is determined in terms of the formation of cyclic [ 32 P]GMP from α-[ 32 P]GTP. Reactions are carried out in a reaction mixture containing 30 mM triethanolamine-HCl (pH 7.4), 1 mM reduced glutathione, 4 mM MgCl 2 , 1 mM cGMP and 0.1 mg/ml bovine γ -globulin (total volume of 0.18 ml) at 37°C in the presence of α-[ 32 P]GTP (0.03 mM; 0.2 µCi) and soluble guanylyl cyclase (4 µg). Ten-µl samples are quickly transferred to the reaction mixture. Enzymatic formation of cGMP is allowed to proceed for 60 s and then stopped by the addition of 450 µl zinc acetate (120 mM) and 500 µl sodium carbonate (120 mM). A complete inhibition of cGMP formation can be achieved by preincubation of the monolayers for 30 min with the stereospecific inhibitor of NO synthase, N G -nitro-L-arginine.

Time-response curves and dose-response curves after addition of various activators or inhibitors of NO synthase are established. Data are reported as mean values ±SEM of cGMP (pmol/mg protein) or guanylyl cyclase activity (nmol/mg/min). Statistical evaluation is performed with Student's t-test.

The clinical pharmacology of L-arginine has been reviewed by Böger and Bode-Böger (2001) .

Isolation of porcine cerebral capillary endothelial cells has been described by Wiemer et al. (1994) . Feelisch and Noack (1987) and Nakazawa et al. (1992) used chemiluminescence techniques for determination of NO.

A method for on-line detection of nitric oxide formation in liquid aqueous phase by electron paramagnetic resonance spectroscopy was described by Mordvintcev et al. (1991) . Similar methods were used by Ichimori et al. (1992 ), Lancester et al. (1992 , Steel-Goodwin et al. (1992) . Hecker et al. (1995) used a cascade superfusion bioassay to characterize a stable L-arginine-derived relaxing factor released from cytokine-stimulated vascular smooth muscle cells.

Electrochemical microprobes for direct measurement of NO in tissues have been developed (Shibuki 1990; Ishida et al. 1996; Smits and Lefebvre 1997) . Malinski and Taha (1992) , Linz et al. (1999) measured nitric oxide release by a porphyrinic-based microsensor with a detection limit of 10 nmol/L. The amperometric signal at a constant potential of 0.67 V was measured with a voltametric analyzer (PAR model 273, Princeton Applied Research) interfaced with an IBM 80486 computer with data acquisition and software. Gabriel et al. (1997) developed a method for the detection of intracellular nitric oxide generation in dissociated cerebellar granule cells using dichlorofluorescin diacetate and flow cytometry. Sumpio et al. (1987) found that cyclic mechanical stress stimulates cultured bovine aortic endothelial cells to proliferate.

Using this method, Rosales et al. (1997) found that exposure of endothelial cells to cyclic strain induces elevations of cytosolic Ca 2+ concentration through mobilization of intracellular and extracellular pools.

Böger RH, Bode-Böger SM (2001) The clinical pharmacology of L-arginine. Annu Rev Pharmacol Toxicol 41:79-99 Bogle RG, Coade SB, Moncada S, Pearson JD, Mann GE (1992) Bradykinin stimulates L-arginine transport and nitric oxide release in vascular endothelial cells. formation in cytokinetreated rat hepatocytes and in blood and liver during sepsis. Properties of various forms of nitric oxide synthase (NOS) have been described by Mayer et al. (1992) , Leone et al. (1992) , Hevel et al. (1992 ), Förstermann et al. (1992 , (Salter et al. 1992 ), Pollock et al. (1992 , Schmidt et al. (1992), and Mungrue et al. (2003) , among them type I, which is constitutively expressed in neurons; the inducible type II which is found in macrophages and hepatocytes, but also in the brain (Moro et al. 1998) , where it may contribute to NO-mediated neurotoxicity; and type III, which is constitutively expressed in endothelial cells (Knowles and Moncada 1994) . NOS can be inhibited by several routes, e. g., competition with L-arginine, NADPH, flavin or tetrahydrobiopterin, interaction of the haeme group of NOS, interference with Ca 2+ availability or calmodulin binding to the enzyme (Fukuto and Chaudhuri 1995). A widely used inhibitor is L-NAME (Vargas et al. 1991) . Selective inhibition of constitutive NOS can by achieved by 7-nitroindazole (Moore et al. 1993) ; of the inducible NOS by aminoguanidine hydrochloride (Griffiths et al. 1993 ) and by 2-amino-5,6dihydro-6-methyl-4H-1,3-thiazine ( = AMT) (Nakane et al. 1995) . Linz et al. (1999) determined NOS in the left cardiac ventricle of hypertensive rats.

Tissues are ground at the temperature of liquid nitrogen using a microdismembranator (Braun). The powders are extracted for 1 h on ice with 10 mmol/l Tris-HCl, pH 7.4, containing 1% SDS and protease inhibitors (complete, Boehringer Mannheim). Debris is removed by a 30-min centrifugation at 4°C (>100,000 g). 100 µg of total of the protein extracts are subjected to SDS-PAGE electrophoresis and transferred to nitrocellulose membranes (Hybond, Amersham). The eNOS protein is detected by use of a specific antibody (monoclonal anti-NOS III), Transduction Laboratories) and visualized by enhanced chemifluorescence with a commercially available kit (Amersham). As a secondary antibody, an anti-mouse IgG antibody coupled to alkaline phosphatase is used (Jackson ImmunoResearch Laboratories) . Chemifluorescence is analyzed and quantified by scanning with a Fluorimager 595-system (Molecular Dynamics).

The data are given as mean ± SEM. ANOVA is used followed by Tuckey's test for post-ANOVA multiple pair comparisons. Linz et al. (1997) measured expression of ec-NOS in the carotid artery of hypertensive rats by Western blot analysis. Frozen (-70°C) vessels were thawed and extracted with guanidium isothiocyanate/phenol/chloroform (Chomczynski and Sacchi 1987) . Crude protein fractions were obtained by alcohol precipitation of the phenol phase. A total of 100 µg of the protein extracts was subjected to SDS-PAGE and transferred to nitrocellulose membranes (Bio-Rad). Ponceau staining was performed to verify the quality of the transfer and the equipartition of protein in each lane. EcNOS protein was detected with a specific antibody (mouse NOS III, Transduction Laboratories) and visualized by enhanced chemifluorescence with a commercially available kit (Amersham). The autoradiographs were analyzed by scanning densitometry. McCall et al. (1991) identified N-iminoethyl-Lornithine as an irreversible inhibitor of nitric oxide synthase. Bauersachs et al. (1998 Bauersachs et al. ( , 1999 ) measured vascular reactivity in isolated rat aortic rings mounted in an organ bath (Föhr Medical Instruments, Seeheim Germany) for isometric force measurement and determined superoxide anion production by lucigenin-enhanced chemiluminescence and endothelial nitric ox-ide synthase and soluble guanylyl cyclase expression by reverse transcription-polymerase chain reaction.

Von der Leyen et al. (1995) reported gene therapy inhibiting neointimal vascular lesions in rats. After denudation of the endothelium of carotid arteries by balloon injury, endothelial cell nitric oxidase expression in the vessel wall was restored by using the Sendai virus/liposome in vivo gene transfer technique. Lund et al. (2000) found that gene transfer of endothelial nitric oxide synthase improves relaxation of carotid arteries from diabetic rabbits. Mungrue et al. (2002) discussed lessons from murine genetic models on the role of NOS in heart failure. Rho is a member of the Ras-related family of small molecular weight GTP-binding proteins, and Rho works as a molecular switch by shuttling between the GDP-bound inactive form and the GTP-bound active form. Rho is involved in cell motility, cell adhesion, cytokinesis, Ras-induced transformation, transcriptional activation, and cell cycle progression. These actions, through Rho signaling, are mediated by downstream Rho effectors, such as the ROCK family of Rho-associated serine/threonine protein kinases. Studies with ROCK-specific inhibitors indicate that the ROCK pathway works in the contraction of vascular smooth muscle. Several studies indicate that Rhokinase may be a novel therapeutic target in the treatment of cardiovascular disease (Kobayashi et al. 2002; Shimokawa 2002; Ito et al. 2003 Ito et al. , 2004 Nakakuki et al. 2005; Budzyn et al. 2006; Winaver et al. 2006) . Ishizaki et al. (2000) described the pharmacological properties of a specific inhibitor of Rho-associated kinases.

Recombinant ROCK-I, ROCK-II, PKN, or citron kinase was expressed in HeLa cells as a Myc-tagged protein by transfection using lipofectamine, and was precipitated from the cell lysates by the use of 9E10 monoclonal anti-Myc antibody coupled to G protein-Sepharose (Ishizaki et al. 1997) . Recovered immunocomplexes were incubated with various concentrations of [ 32 P]ATP and 10 µg of histone type 2 as substrates, in the absence or presence of various concentrations of test compounds at 30°C for 30 min in a total volume of 30 µl of the kinase buffer containing 50 mM HEPES-NaOH, pH 7.4, 10 mM MgCl 2 , 5 mM MnCl 2 , 0.02% Briji 35, and 2 mM dithiothreitol. PKCα was incubated with 5 µM [ 32 P]ATP and 200 µg/ml histone type 2 as substrates in the absence or presence of various concentrations of test compounds at 30°C for 10 min in a kinase buffer containing 50 mM Tris-HCl, pH 7.5, 0.5 mM CaCl 2 , 5 mM magnesium acetate, 25 µg/ml phosphatidyl serine, 50 ng/ml 12-O-tetradecanoylphorbol-13-acetate and 0.001% leupeptin in a total volume of 30 µl. Incubation was terminated by the addition of 10 µl of 4 × Laemmli sample buffer. After boiling for 5 min, the mixture was subjected to SDS-polyacrylamide gel electrophoresis on a 16% gel. The gel was stained with Coomassie Brilliant Blue, and then dried. The bands corresponding to histone type 2 were excised, and the radioactivity was measured.

K i values were either determined by the double reciprocal plot or calculated from the equation K i = IC 50 /(1 + S/K m ), where S and K m are the concentration of ATP and the K m value for ATP, respectively. (1976) in a study of intestinal and renal brush border vesicles. The plasma membrane Na + /H + exchanger is an ubiquitous pH regulating cellular ion transport system. It is driven by the Na + gradient and extrudes protons from the cytosol in exchange for extracellular Na + ions (Aronson 1985; Frelin et al. 1988; Fliegel and Dyck 1995; Orlowski and Grinstein 1997; Wakabayashi et al. 1997; Dibrov and Fliegel 1998) . Six mammalian Na + /H + exchangers: NHE1, NHE2, NHE3; NHE4, NHE5 (Attaphitaya et al. 1999; Szabo et al. 2000) , and NHE6 have been described (Tse et al. 1994; Orlowski 1999; Counillon and Pouysségur 2000) .

In cardiac tissue the exchanger has a major role in the control of intracellular pH. At the onset of cardiac ischemia and during reperfusion, Na + /H + exchange is excessively activated by low intracellular pH. Since the deleterious Na + influx in this condition was found to originate mainly from Na + /H + exchange (Frelin et al. 1984; Schömig et al. 1988) , the exchanger seems to be responsible for an increase of cytosolic sodium in ischemic cells. The accumulation of intracellular Na + causes an activation of Na + /K + ATPase (Frelin et al. 1984; Rasmussen et al. 1989 ) which in turn increases ATP consumption.

During ischemia the aerobic metabolism of glucose terminates in lactic acid. A vicious circle leads to a further decrease of intracellular pH and to a further activation of Na + /H + exchange, resulting in energy depletion, cellular Na + overload and finally due to the coupling of Na + and Ca 2+ transport via Na + /Ca 2+ exchange, cellular Ca 2+ overload (Lazdunski et al. 1985; Tani and Neely 1990; Scholz and Albus 1993) . Especially in ischemic cardiac tissue, where Na + /H + exchange is the predominant pH regulating ion transport system (Weissenberg et al. 1989 ), these pathological events can lead to increased excitability and precipitation of cellular death. Therefore, it is desirable to find potent and well tolerated inhibitors of Na + /H + exchange which should be able to interrupt this vicious cycle, to conserve cellular energy stores and to diminish cellular excitability and necrosis during cardiac ischemia. Such effects have been found with relatively weak inhibitors of Na + /H + exchange at high toxic doses, such as amiloride and ethyl isopropyl amiloride (Scholz et al. 1992) .

The myocardial Na + /H + exchanger is regarded as a therapeutic target for the prevention of myocardial ischemic and reperfusion injury and attenuation of postinfarction heart failure (Karmazyn et al. 2001) .

More potent Na + /H + exchange inhibitors showed beneficial effects on ischemia/reperfusion injury (see A.5.0.7 and A.5.0.8) in rats (Aye et al. 1997; Myers et al. 1998; Aihara et al. 2000 ), dogs (Gumina et al. 1998 and pigs (Portman et al. 2001) . Heart hypertrophy and heart failure after myocardial infarction is reduced (Yoshida and Karmazyn 2000; Kusumoto et al. 2001) . Ischemia-induced apoptosis in isolated rat hearts is attenuated by sodium-hydrogen exchange inhibitors (Chakrabarti et al. 1997) . Linz and Busch (2003) demonstrated the effects of NHE-1 inhibition from protection during acute ischemia/reperfusion to prevention of myocardial remodeling. The inhibition of Na + /H + exchange has been studied in platelets by measuring the optical density after osmotic cell swelling (Rosskopf et al. 1991 ).

About 5 ml blood is withdrawn by venipuncture from human donors or from the vena jugularis externa of Beagle dogs or from the aorta of anesthetized Wistar rats (weighing 250-350 g). Coagulation is inhibited by 0.8 ml citrate acid dextrose (65 mM citric acid, 11 mM glucose, 85 mM trisodium citrate). Plateletrich plasma (PRP) is obtained by centrifugation of whole blood at 90 g for 10 min at room temperature. Platelet count is measured, e. g., with a Casey 1 multichannelyser (Schärfe System, Reutlingen, Germany). Each of the experiments is performed with 10-50 µl PRP containing 20 × 10 6 platelets in a volume of 100 µl with saline. To activate Na + /H + exchange in the platelets by intracellular acidification, 500 µl propionate buffer (135 mM Na-propionate, 1 mM HCl, 1 mM CaCl 2 , 1 mM MgCl 2 , 10 mM glucose, 20 mM HEPES, pH 6.7, 22°C) are added to the PRP/NaCl solution. Swelling of the platelets results in a decrease of optical density which can be measured with an aggregometer, e. g. with a Turbitimer (Behringwerke, Marburg, Germany). The system is activated photometrically by the addition of the propionate buffer to the cuvette. The experiments are performed with and without the addition of the Na + /H + exchange inhibitor to be tested. The inhibitors are added in concentrations between 10 −4 and 10 −8 mol/l. 5-(N-ethyl-Nisopropyl)amiloride (EIPA) is used as standard. During the experiments all solutions are kept at 22°C in a temperature controlled water bath.

Results are given as means ± SD. Student's t-test is employed for statistical evaluation. IC 50 values are calculated from dose-response curves.

Rosskopf D, Morgenstern E, Scholz W, Osswald U, Siffert W (1991) Rapid determination of the elevated Na + -K + exchange in platelets of patients with essential hypertension using an optical swelling assay. J Hypertens 9:231-238

The inhibition of Na + /H + exchange has been studied in cholesterol activated rabbit erythrocytes by flame photometry of sodium (Scholz et al. 1992 (Scholz et al. , 1993 .

White rabbits (New Zealand strain, Ivanovas) are fed with a rabbit standard chow with 2% cholesterol for 6 weeks to increase the Na + /H + exchange (Scholz et al. 1990 ) and to make the erythrocytes suitable for measurement of sodium influx via Na + /H + exchange by flame photometry. Blood is drawn from the ear artery of the rabbits and coagulation prevented with 25 IU/ml potassium heparin. The hematocrit of the samples is determined in duplicate by centrifugation. Aliquots of 100 µl are taken to measure the initial sodium content of the erythrocytes.

To determine the amiloride sensitive sodium influx into erythrocytes, 100 µl of each blood sample are added to 5 ml of buffer made hyperosmolar by sucrose (140 mM NaCl, 3 mM KCl, 150 mM sucrose, 0.1 mM ouabain, 20 mM tris-hydroxymethylaminomethane, pH 7.4) and incubated for 60 min at 37°C. Subsequently, the erythrocytes are washed three times in ice-cold MgCl 2 -ouabain-solution (112 mM MgCl 2 , 0.1 mM ouabain).

For determination of intracellular sodium content, the cells are hemolyzed in distilled water, the cell membranes are centrifuged and the sodium concentration of the haemolysate is measured by flame photometry. Net influx of sodium into the erythrocytes is calculated from the difference between the initial sodium content and the sodium content after incubation. Amiloride-sensitive sodium influx is calculated from the difference between sodium content of erythrocytes incubated with and without amiloride (3 × 10 −4 M). Each experiment is done with the erythrocytes from 6 different animals. In each case, the comparison of Na + contents is based on erythrocytes from the same animal. Doses between 10 −4 and 10 −7 M of the inhibitor are tested.

Statistical analysis of the data obtained is performed with Student's t-test for paired groups. IC 50 values are calculated from dose-response curves. The inhibition of Na + /H + exchange has been studied in cultured cardiac myocytes (Scholz et al. 1992 ).

Rat myocardial cells are isolated from hearts of neonatal rats by trypsin digestion. The cells are cultured in 35 mm dishes and grown to confluence in Dulbecco's Minimum Essential Medium (DMEM, GIBCO) in an atmosphere containing 10% CO 2 . After confluence, the cells are used for measurement of 22 Na + influx. The cells are washed twice with Krebs-Ringer-solution buffered with HEPES/Tris (KRB) in which sodium chloride has been replaced by choline chloride (Choline chloride 130 mM, CaCl 2 1.5 mM, KCl 5 mM, MgCl 2 1 mM, HEPES 20 mM, pH 7.0 with Tris) and then incubated for 20 min at 37°C in the same buffer with added 0.1% bovine serum albumin (BSA) and 10 mM/l glucose. The culture dishes are then incubated for another 10 min with Na +propionate for cytosolic acidification and stimulation of Na + /H + exchange. The compounds are dissolved in 500 µl/dish KRB in which 50% of the sodium chloride has been replaced by choline chloride containing additionally 2 µCi/ml 22 Na + -bicarbonate, and 5-(N-ethyl-N-isopropyl)amiloride (EIPA). After the stimulation period, sodium influx is terminated by washing the cells twice with ice-cold stop solution (0.1 mM MgCl 2 , 10 mM Tris, pH 7.0). Subsequently, the cells are lyzed with 250 µl trichloroacetic acid and scraped from the dishes. Radioactivity is determined in a Packard gamma counter. Doses between 3 × 10 −4 and 10 -8 mM/l of standard and new compounds are tested. Six dishes are used for each concentration of test compounds.

Mean values ± SD are compared with Student's t-test. IC 50 values are calculated from dose-response curves. The inhibition of Na + /H + exchange has been studied in endothelial cells (Scholz et al. 1993) 

Changes of the intracellular pH of cultured bovine endothelial cells have been fluorometrically monitored using the pH-dye 2 ,7 -bis(carboxyethyl)carboxyfluorescein (BCECF) by Kitazano et al. (1988) . This method has been used to study the activity of inhibitors of Na + /H + exchange .

For preparation of isolated rat ventricular muscular cells (Yazawa et al. 1990 ), hearts of male Wistar rats are dissected, mounted on a Langendorff apparatus and perfused first at 37°C for 3 min with Tyrode solution adjusted to pH 7.4, second for 5-7 min with nominally calcium free Tyrode solution and finally with calcium free Tyrode solution containing 0.12-0.2 mg/ml collagenase (Sigma type I). After 15-20 min collagenase treatment, the heart is washed with storage solution (composition in mmol/L: KOH 70, l-glutamic acid 50, KCl 40, taurine 20, KH 2 PO 4 20, MgCl 2 3, glucose 20, HEPES 10, and EGTA 0.5, pH 7.4). The ventricles are cut into small pieces and myocytes are dispersed by gently shaking and finally by filtration through a nylon mesh (365 µm). Thereafter, the cells are washed twice by centrifugation at 600-1000 rpm for 5 min and kept at 4°C until use. For the pH recovery experiment the cells are loaded with the membrane permeable acetoxymethyl ester (AM) form of the fluorescent indicator 2 ,7 -bis(carboxyethyl)-5(6)carboxyfluorescein (BCECF). BCECF-AM is dissolved in DMSO and diluted to a 1.25 µM storage solution. Cardiomyocytes are loaded in this solution for 30 min at room temperature and are then centrifuged and resuspended in storage solution. The measure-ments are performed in bicarbonate-free NaCl solution (NaCl 140, KCl 4.7, CaCl 2 1.3, MgCl 2 1, glucose 10, and HEPES 10 mM/L, pH 7.4) at 34°C using an apparatus according to Nitschke et al. (1991) . The pHdependent signal of BCECF is obtained by illuminating at 490 and 437 nm and dividing the emitted light signals (520-560 nm). The background signal, determined by closing the shutter, is subtracted from the total signal. The autofluorescence determined by illuminating unloaded cells can be ignored. In order to investigate the function of the Na + /H + exchange system, the intracellular pH (pH i ) of the cells is decreased by the NH 4 Cl prepulse technique and the rate of return to resting pH i is determined. Test compounds are dissolved in the incubation medium. For each test concentration, the recovery of pH i is first recorded in control NaCl solution.

Data are analyzed by fitting a straight line to the initial (5 min) data points of the pH recovery curve. For statistical presentation, the slopes of the linear curves are demonstrated. All reported data are presented as means ± SEM. Statistical comparisons are made using either a paired or unpaired t-test.

The pH-sensitive fluorescence dye C-SNARF-1 ( = carboxy-semi-naphtho-rhoda-fluor 1) was used by Yatsutake et al. (1996 ), Shipolini et al. (1997 ), and Yokoyama et al. (1998 ). Fischer et al. (1999 tested new drugs for the Na + /H + exchanger in Chinese hamster ovary cells which are enriched with the NHE-1 isoform of the Na + /H + anti-porter. The Na + /H + exchanger was stimulated with NaCl and the rate of extracellular acidification was quantified with the Cytosensor. − -free to inhibit the Na + -dependent Cl − /HCO 3 − exchanger of LAP1 cells) to an 25-µl aliquot of cells ( ∼ =25,000 cells). The pH i recovery is recorded with a dual-grating Deltascan single-photon counting fluorometer (Photon Technology International, South Brunswick, NJ, USA) with exci-tation wavelength of 505 nm and 440 nm and an emission wavelength of 535 nm. The measurement time varies between subtypes (120 s for NHE1, 300 s for NHE2, 180 s for NHE3). The inhibitors are first dissolved in DMSO, diluted in recovery medium and added in a volume of 975 µl to this medium.

A cloned opossum kidney cell line (Helmle-Kolb et al. 1990 ) is used additionally. Cells are grown as a monolayer in growth medium (1:1 mixture of nutrient mixture Ham F12 and Dulbecco's modified medium Eagle with 10% fetal calf serum). For subcultivation and pH-recovery experiments, the cells are detached from the surface of the culture vessels with trypsin-EDTA solution (2.5 g trypsin+0.2 g EDTA per liter in Dulbecco's phosphate-buffered saline) and suspended in growth medium. Measurement time in pH i recovery experiments is 400 s.

Porcine renal brush-border membrane vesicles (BBMV) prepared by a Mg 2+ precipitation technique are loaded with 150 mmol/l NaCl, 5 mmol/l HEPES/Tris, pH 7.0, and pre-incubated for 10 min at 37°C with various concentrations of NHE inhibitors. Intravesicular acidification through Na + /H + exchange is started by diluting BBMV into Na + -free buffer (150 mmol/l tetramethylammonium chloride, 5 mmol HEPES/Tris, pH 7.0) containing the appropriate concentrations of the NHE inhibitors and the fluorescent pH indicator acridine orange (12 µmol/l). The fluorescence changes of acridine orange are recorded continuously by a Hitachi F-2000 spectrofluorometer at 495 nm excitation and 525 nm emission wavelength. The initial acridine orange fluorescence quenching in controls (no inhibitor) is set to 100%.

Values are presented as means ± SD (four measurement per concentration). The IC 50 values and Hill coefficients are calculated using the Sigma plot software. Statistical significance is calculated by means of the distribution-independent H-test and non-parametric Utest. P < 0.05 is considered as significant. Counillon et al. (1993) , Scholz et al. (1995) determined the NHE subtype specificity of Na + /H + antiporters by their ability to inhibit initial rates of amiloride sensitive 22 Na + uptake in fibroblast cell lines separately expressing the NHE-1, NHE-2 and NHE-3 isoforms. Ko et al. (2004) determined the inhibitory effects of flavonoids on phosphodiesterase isozymes from guinea pig and their structure-activity relationships.

Counillon LT, Scholz W, Lang HJ, Pouysségour J (1993) Pharmacological characterization of stably transfected Na + /H + antiporter isoforms using amiloride analogs and a new inhibitor exhibiting anti-ischemic properties. (2006) reviewed the nomenclature and structure-function relationships of cyclic nucleotide-regulated channels. Mongillo et al. (2004) reported fluorescence resonance energy transfer-based analysis of cAMP dynamics in live neonatal rat cardiac myocytes, revealing distinct functions of compartmentalized phosphodiesterases. Studying real-time monitoring of PDE2 activity in live cells, Nikolaev et al. (2005) found that hormone-stimulated cAMP hydrolysis is faster than hormone-stimulated cAMP synthesis. Snyder et al. (2005) studied the role of cyclic nucleotide phosphodiesterases in the regulation of adipocyte lipolysis. Zhang et al. (2004) desribed a glutamine switch mechanism for nucleotide selectivity by phosphodiesterases. 

Male Sprague-Dawley rats (250-300 g) are decapitated. Hearts are perfused with 0.15 M NaCl through the aorta to remove the blood. The ventricles are minced in 5 vol. of 10 mM Tris-HCl buffer containing 0.32 M sucrose, 1 mM EDTA, 5 nM DTT and 0.1 mM PMSF at pH 7.5. The suspension is homogenized in a glass-glass Potter-Elvejhem. The homogenate is then centrifuged at 105,000 g for 60 min. The 105,000 g supernatant is stored at -75 o C until injection on the HPLC column.

The cytosolic fraction from rat ventricles (5-8 mg of protein) is loaded at the rate of 1 ml/min on a Mono Q HPLC column which has been previously equilibrated with buffer A (50 mM Tris-HCl, 2 mM EDTA, 14 mM 2-mercaptoethanol, 0.1 mM PMSF, pH 7.5). Under these conditions, greater than 95% of the PDE activity is bound to the column. PDE activity is eluted at a flow rate of 1 ml/min using the following step by step and linear gradients of NaCl in buffer A: 25 ml of 0.16 M NaCl, 20 ml of 0.23 M NaCl, 30 ml from 0.23 to 0.29 M NaCl, 15 ml of 0.29 M NaCl, 30 ml from 0.29 to 0.50 M NaCl. The separation is done at 4°C. Fractions of 1 ml are collected and stored at -75°C in the presence of 20% glycerol. The fractions are tested for PDE activity, and the peaks containing the different isoenzymes are identified. Fractions containing preferentially one isoenzyme are pooled.

PDE activity is assayed by a two-step radioisotopic procedure according to Thompson et al. (1974) , Boudreau and Drummond (1975), Prigent et al. (1981 

Phosphodiesterase activity can be determined using 32 P-labelled GPT (Reinsberg 1999). The reaction is performed using an Eppendorf cup with 10 mM GTP, the test solution and [ 32 P]GTP. The reaction is started with 1 mM sodium nitroprusside solution. After an incubation period of 20 min at 37°C, the reaction is stopped with 500 µl of 120 mM sodium carbonate and 400 µl of zinc acetate, whereby the zinc carbonate and the substrate GTP are almost (about 90%) all precipitated, and so separated from cGMP. The precipitate is separated by centrifugation and the supernatant submitted to chromatography on an aluminum oxide column. The column is first treated with Tris HCl buffer. From the supernatant, 900 ml is applied. After two washing periods, the cGMP is eluted in five fractions. These fractions are measured and the highest activities are pooled. The PDE activity is calculated from the difference between applied [ 32 P]GTP minus unaltered [ 32 P]GTP. 

The PDE3 family is composed of two genes, PDE3A and PDE3B. PDE3A mRNA is enriched in blood vessels, heart, megakaryocytes and oocytes, whereas PDE3B is highest in in adipocytes, hepatocytes, brain, renal collecting duct epithelium, and developing spermatocytes (Reinhardt et al. 1995) . PDE3 inhibitors have been extensively investigated and developed as non-glycoside, non-sympathomimetic, cardiotonic agents for the treatment of heart failure. Milrinone is the most studied and most extensively used PDE3 inhibitor and is used in the acute treatment of heart failure (Cruickshank 1993). Trequinsin (HL 725) inhibits PDE3 in a nanomolar range (Ruppert and Weithmann 1982) ; it also inhibits PDE1, PDE2, and PDE4 in submicromolar concentrations (Stoclet et al. 1995) . Boswell-Smith et al. (2006) studied the pharmacology of two long-acting trequinsin-like phosphodiesterase 3/4 inhibitors, RPL554 and RPL565. Hambleton et al. (2005) studied isoforms of cyclic nucleotide phosphodiesterase PDE3 and their contribution to cAMP hydrolytic activity in subcellular fractions of human myocardium. Masciarelli et al. (2004) described mice deficient of cyclic nucleotide phosphodiesterase 3A as a model of female infertility. Adachi et al. (2005) reported the effects of a phosphodiesterase 3 inhibitor, olprinone, on rhythmical change in the tension of human gastroepiploic artery.

Abbott and Thompson (2006) performed analysis of anti-PDE3 activity of 2-morpholinochromone derivates revealing multiple mechanisms of antiplatelet activity.

PDE4 is mainly present in the brain (Houslay et al. 1998), inflammatory cells (Tenor and Schudt 1996) , cardiovascular tissues (Stoclet et al. 1995) , and smooth muscles, but is lacking in the platelets. Four PDE4 genes (PDE4A-D) yield a large number of distinct PDE4 varaints. These enzymes, which result from the use of alternate promoters and extensive splicing of PDE4 mRNAs, are stratified into long or short forms (Conti et al. 2003) .

One PDE4A, three PDE4B (PDE4B1, PDE4B2, and PDE4B3), and three PDE4D (PDE4D1, PDE4D2, PDE4D3) variants are expressed in rat and human cardiac tissue (Houslay and Adams 2003). Two PDE4D gene-derived variants, PDE4D3 and PDE4D6, are expressed in human and rat aortic, mesenteric, and femoral contractile/quiescent and synthetic/activated vascular smooth muscle cells (Liu et al. 2000) .

The role of cAMP-specific PDE4 phosphodiesterases in cellular signaling was reviewed by Houslay and Adams (2003) and Conti et al. (2003) . Huai et al. (2003) studied the three-dimensional structures of PDE4D in a complex with roliprams and the implication for inhibitor selectivity. Baillie et al. (2003) found that β-arrestin-mediated PDE4 cAMP phosphodiesterase recruitment regulates β-adrenoceptor switching from G s to G i .

The antidepressant compound rolipram (ZK 62711) is a selective inhibitor of PDE4 (Schwabe et al. 1976; Komas et al. 1989) . O'Donnell and Zhang (2004) described the antidepressant effects of inhibitors of cAMP phosphodiesterase (PDE4). Many analogs were studied as PDE4 inhibitors for treatment of asthma and chronic obstructive pulmonary disease (COPD) as well as anti-inflammatory drugs; however, most failed due to emetic side-effects (Giembycz 2002).

Selective inhibitors of cyclic guanosine monophosphate (cGMP) phosphodiesterase type 5 (PDE5) were found to be effective in the treatment of erectile dysfunction in men (Jeremy et al. 1997; Ballard et al. 1998; Chuang et al. 1998; Stief et al. 1998; Corbin and Francis 1999; Turko et al. 1999; Wallis et al. 1999; Hosogai et al. 2001; Rotella 2001; Saenz de Tejada et al. 2001; Ukita et al. 2001) .

The PDE5 family consists of a single PDE5 gene that can encode three distinct proteins (PDE5A1-3) (Loughney et al. 1998). Wang et al. (2001) characterized type 5 phosphodiesterases in the corpus cavernosum of several species. Qiu et al. (2000) demonstrated that rabbit corpus cavernosum smooth muscle shows a different phosphodiesterase profile than human corpus cavernosum. Kim et al. (2001) compared the inhibition of cyclic GMP hydrolysis in human corpus cavernosum smooth muscle cells by vardenafil with that by sildenafil.

The discovery of novel, potent, and selective PDE5 inhibitors was reported by Bi et al. (2001) . Corbin et al. (2004) described the structural basis for the higher potency of vardenafil compared with sildenafil in inhibiting cCMP-specific phosphodiesterase-5 (PDE5).

PDE5 inhibitors such as sildenafil can be used in the treatment of pulmonary arterial hypertension (Galié et al. 2005) . Cohen et al. (1996) found that inhibition of cGMPspecific phosphodiesterase selectively vasodilates the pulmonary circulation in rats made chronically hypoxic by exposure to a simulated high altitude. Chronic hypoxia augments protein kinase G-mediated Ca 2+ desensitization in pulmonary vascular smooth muscle through inhibition of RhoA/Rho kinase signaling (Jernigan et al. 2004) . Thompson et al. (2001) studied the effect of sildenafil on corpus cavernosal smooth muscle relaxation and cGMP formation in the diabetic rabbit. Tantini et al. (2005) found an antiproliferative effect of sildenafil on human pulmonary artery smooth muscle cells.

The families of PDE6 to PDE11 have been identified as a result of bioinformatics-based genomic screening (Soderling and Beavo 2000) . The search for inhibitors is just beginning. Gillespie and Beavo (1989) discussed inhibition and stimulation of photoreceptor phosphodiesterases (later on termed PDE6) by dipyridamole and M&B 22,948. D'Armours et al. (1999) investigated the potency and mechanism of action of E4021, a type 5 phosphodiesterase isozyme-selective inhibitor, on the photoreceptor phosphodiesterase. Zhang et al. (2005) described the efficacy and selectivity of phosphodiesterase-targeted drugs in inhibiting photoreceptor phosphodiesterase (PDE6) in retinal photoreceptors. Smith et al. (2004) reported the discovery of a selective inhibitor of phosphodiesterase 7.

The discovery of thiadiazoles as a novel structural class of potent and selective PDE7 inhibitors was reported by Vergne et al. (2004a Vergne et al. ( , 2004b Metzger and Lindner (1981) discovered that the positive inotropic and vasodilatory effects of forskolin were correlated with the stimulation of adenylate cyclase and cAMP-dependent protein kinase. Subsequent studies by Seamon (1981) demonstrated that forskolin, unlike hormones, guanine nucleotides, fluoride or cholera toxin could stimulate cyclase activity in the absence of the guanine nucleotide regulatory protein. Since those reports, hundreds of papers have been published on the effects of forskolin in numerous mammalian organ and cell systems. Several comprehensive review articles have also been published (Seamon and Daly 1981 Daly , 1983 Daly 1984) . While forskolin has proven to be an invaluable research tool for investigations of adenylate cyclase systems (Salomon et al. 1974; Seamon et al. 1981 Seamon et al. , 1983 , reports on its effects on cardiovascular (Lindner et al. 1978) , pulmonary (Chang et al. 1984 ) and ocular physiology (Caprioli and Sears 1983; Caprioli 1985) suggest a therapeutic potential (Seamon 1984) as well.

Described here is an in vitro assay which can be used to compare the potency of forskolin, forskolin analogs or other direct or indirect adenylate cyclase activators for the stimulation of adenylate cyclase in heart membranes. The purpose of this assay is to determine and compare the potency of direct or indirect activators of adenylate cyclase for an ability to stimulate heart membrane adenylate cyclase in vitro.

The hearts of the Wistar rat, Hartley guinea pig, golden Syrian hamster or cardiomyopathic hamster (CHF-146) are used as a source of adenylate cyclase for this assay. . Serial dilutions are made such that the final concentration in the assay ranges from 3 × 10 −4 to 3 × 10 −7 M. The concentration of vehicle in the assay is 1%.

One entire heart from rat, guinea pig or hamster is dissected, weighed and homogenized in 50 volumes of ice-cold 0.05 M Tris buffer, pH 7.4 containing 0.1 mM CaCl 2 (reagent 2) using a Brinkman Polytron (setting 7 for 15 s). The homogenate is centrifuged at 10,000 g for 20 min at 4°C. The resulting pellet is resuspended in 50 volumes of homogenizing buffer and recentrifuged as before. The supernatant of this spin is discarded and the resulting pellet is finally resuspended in 10 volumes of the homogenizing buffer, for rat and hamster and 60 volumes for guinea pig tissue. This final preparation is filtered through a thin layer of gauze and kept on ice until used in the assay. The protein concentration is approximately 250-350 mg/ml. Protein concentrations from an aliquot of the tissue suspension are determined on the day of the experiment by the method of Bradford (1976) The tubes are incubated for 5 min at 37°C and the reaction is then stopped by placing the tubes into a boiling water bath for 4 min. The tubes are then centrifuged at 1000 g for 10 min and cAMP levels determined in a 15 µl aliquot of the supernatant using a radioimmunoassay kit (Code TRK432) obtained from Amersham according to the manufacturer's protocol.

Test principle: The method is based on the competition between unlabeled cAMP and a fixed quantity of 3 H-labelled cAMP for binding to a protein which has high specificity and affinity for cyclic AMP. The amount of labelled cAMP-protein complex formed is inversely related to the amount of unlabelled cAMP present in the assay sample. The concentration of cAMP in the unknown is determined by comparison with a linear standard curve.

The data are expressed as pmol cAMP/mg protein/min and dose-response stimulation curves are subjected to logic analysis to determine the concentration of compound which exhibits 50% of maximal stimulation (ED 50 ).

The β-blocking activities of compounds can be determined by their activities, by which they counteract the isoproterenol and GTP induced stimulation of rat heart membrane bound adenylate cyclase (Greenslade et al. 1979 

This assay is used to identify compounds which demonstrate high affinity [nM] for association with forskolin binding sites in vitro as a preliminary screen in conjunction with stimulation of adenylate cyclase to determine the potential for cardiac chronotropic and inotropic and other effects of forskolin. Guinea pig heart tissue and rat brain tissue are used as sources of binding assays. Tubes are incubated at 23°C for 60 min. The incubate is then diluted with 5 ml of ice-cold 0.05 M Tris-HCl buffer, pH 7.4 (reagent 2) and immediately vacuum filtered through glass fiber filters (Whatman GF/B) by using a Brandel Cell Harvester. The filters are rapidly washed three times with 5 ml aliquots of Tris-HCl buffer (reagent 2), added to 10 ml scintillation cocktail and analyzed for radioactivity.

Specific binding is defined as the difference between binding of 3 H-forskolin in the absence and presence of 10 µM forskolin and represents 85-90% of total binding at 10 nM 3 H-forskolin.

Results of the dose-response inhibition curves are analyzed by determining the concentration of competing compound which inhibits 50% of the 3 H-forskolin binding sites (IC 50 ). This value is determined by computer-derived log-probit analysis.

The activity of various forskolin analogs are based on IC 50 values and are categorized as follows: To compare the activity of various compounds from experiment to experiment, an inhibition constant (K I ) is determined as described by Cheng and Prusoff (1973) . The K I is determined from the equation: 

The introduction of the patch clamp technique (Neher and Sakmann 1976) revolutionized the study of cellular physiology by providing a high-resolution method of observing the function of individual ionic channels in a variety of normal and pathological cell types. By the use of variations of the basic recording methodology, cellular function and regulation can be studied at a molecular level by observing currents through individual ionic channels (Liem et al. 1995; Sakmann and Neher 1995) . The most intriguing method is called the "on-cell" or "cell-attached" configuration, because ion channels can be recorded on an intact cell (Jackson 1993 ). This mode is well suited for investigation of ion channels that are activated by hormonal stimulation and triggered by intracellular second messengers.

Another versatile mode is the "cell-excised" configuration (Hamill 1993) . It is obtained by suddenly removing the patch pipette from the cell, so that the membrane patch is pulled off the cell. This mode easily allows the investigator to expose the channel proteins to drugs by changing the bath solution. The single channel currents are recorded on a videotape and are analyzed off-line by a computer system. Various parameters are evaluated, such as the single channel conductance, open and closed times of the channel, and the open-state probability, which is the percentage of time the channel stays in its open state.

In addition to these modes, which enable the recording of single channel currents, it is also possible to measure the current flowing through the entire cell. This "whole-cell mode" is obtained by rupturing the membrane patch in the cell-attached mode (Hamill et al. 1981; Dietzel et al. 1993 ). This is achieved by applying suction to the interior of the patch pipette. The "whole-cell mode" allows not only the recording of electrical current, but also the measurement of cell potential. Moreover, the cell interior is dialyzed by the electrolyte solution contained in the patch pipette.

The fabrication of patch clamp pipettes has been described by Sakmann and Neher (1995) and Cavalié et al. (1993) .

Variations of the patch clamp technique have been used to study neurotransmitter transduction mechanisms (Smith 1995) .

High throughput methods are required when developing drugs that work on ion channel function (Mathes 2003; Bennett and Guthrie 2003) . Patch clamping suffers from low throughput, which is not acceptable for drug screening. Fertig et al. (2002) and Brueggemann et al. (2004 Brueggemann et al. ( , 2006 presented nanopatch clamp technology, which is based on a planar, microstructured glass chip, which enables automatic whole-cell patch clamp experiments. Planar glass substrates containing a single microaperture produced by ion track etching are used to record currents through ion channels in living mammalian cells. Falconer et al. (2002) reported high throughput screening for ion channel modulators setting up a Beckman/Sagian core system to fully automate functional fluorescence-based assays that measure ion channel function. Voltage-sensitive fluorescent probes were applied and the activity of channels was measured using Aurora's Voltage/Ion Probe Reader (VIPR). The system provides a platform for fully automated high throughput screening as well as pharmacological characterization of ion channel modulators.

Schroeder et al. (2003) described a high throughput electrophysiology measurement platform consisting of computer-controlled fluid handling, recording electronics, and processing tools capable of voltage clamp whole-cell recordings from thousands of individual cells per day. The system uses a planar, multiwell substrate (a PatchPlate). The system positions one cell into a hole separating two fluid compartments in each well of the substrate. Voltage control and current recordings from the cell membrane are made subsequent to gaining access to the cell interior by applying a permeabilizing agent to the intracellular side.

Willumsen's group recommended ion channel screening with QPatch (Asmild et al. 2003; Kutchisky et al. 2003; Krzywkowski et al. 2004) . This system claims to allow fast and accurate electrophysiological characterization of ion channels, e. g., for determination of IC 50 values for ion channel blockers. The system comprises 16 parallel patch clamp sites, each based on a silicon chip with a micro-etched patch clamp hole. Intra-and extra-cellular fluids are administered by laminar flow through integrated miniature flow channels. The generation of an action potential in heart muscle cells depends on the opening and closing of ion-selective channels in the plasma membrane. The patch clamp technique enables the investigation of drug interactions with ion-channel-forming proteins at the molecular level.

Isolated cells from ventricular muscle of rat and guinea pig are prepared as described by Yazawa et al. (1990) Hamill et al. 1981) , the isolated cells are placed into a thermostat-controlled chamber, mounted on the stage of an inverted microscope equipped with differential interference contrast optics. Under optical control (magnification 400×) a glass micropipette, having a tip opening of about 1 µm, is placed onto the cell. The patch pipettes are fabricated from borosilicate glass tubes (outer diameter 1.5 mm, inner diameter 0.9 mm) by means of an electrically heated puller. In order to prevent damage of the cell membrane, the tip of the micropipette is fire polished, by moving a heated platinum wire close to the tip. The patch pipette is filled with either high-NaCl or KCl solution and is mounted on a micro manipulator. A silver chloride wire connects the pipette solution to the head stage of an electronic amplifier. A second silver chloride wire is inserted into the bath and serves a ground electrode.

After establishing contact with the cell membrane, a slight negative pressure is applied to the inside of the patch pipette by means of a syringe. Consequently, a small patch of membrane is slightly pulled into the opening of the micro pipette and close contact between the glass and membrane is formed, leading to an increase of the electrical input resistance into the giga-ohm range (about 10 10 Ohm). This high input resistance enables the recording of small electrical currents in the range of picosiemens (10 −12 S), which flow through channel-forming proteins situated in the membrane patch. The electrical current is driven by applying an electrical potential across the membrane patch, and/or by establishing an appropriated chemical gradient for the respective ion species.

The patch clamp methods allows one to investigate the interaction of drugs with all ion channels involved in the functioning of the heart muscle cell (K + , Na + , Ca 2+ and eventually Cl − channels). Moreover, the different types of K + channels existing in cardiomyocytes can be distinguished by their different single-channel characteristics or by appropriate voltage-pulse protocols in the whole-cell mode.

Concentration-response curves of drugs which inhibit or activate ion channels can be recorded either at the single channel level or by measuring the whole-cell current. IC 50 and EC 50 values (50% inhibition or activation, respectively) can be obtained with both methods.

The patch clamp technique has been used for evaluation of anti-arrhythmic agents (Bennett et al. 1987; Anno and Hondeghem 1990; Gwilt et al. 1991) . Gögelein et al. (1998) used isolated ventricular myocytes from guinea pigs to study a cardioselective inhibitor of the ATP-sensitive potassium channel.

Multiple types of calcium channels have been identified by patch clamp experiments (Tsien et al. 1988) .

The effects of potassium channel openers have been measured (Terzic et al. 1994) . Ryttsén et al. (2000) characterized electroporation of single NG108-15 cells with carbon-fiber microelectrodes by patch clamp recordings and fluorescence microscopy.

Monyer and Lambolez (1995) reviewed the molecular biology and physiology at the single cell level, discussing the value of the polymerase chain reaction at the single cell level and the use of patch pipettes for collecting the contents of a single cell on which the reverse transcription is performed.

The patch clamp technique was found to be very versatile in the investigation of ion channels in atrial myocytes, especially from dogs or humans. Cell were obtained from atria either in sinus rhythm or in atrial fibrillation (reviewed in Bosch et al. 1999 ). 

The epithelial Na + channel plays an important role in epithelial Na + absorption in the distal colon, urinary bladder, salivary and sweat ducts, respiratory tract and, most importantly, in the distal tubules of the kidney (Catterall 1986; Palmer 1992) . Regulation of this epithelial Na + channel has a major impact on Na + balance, blood volume, and blood pressure. Inhibition of epithelial Na + channel expression is used for the treatment of hypertension (Endou and Hosoyamada 1995). Busch et al. (1995) studied the blockade of epithelial Na + channels by triamterenes using two-microelectrode voltage clamp experiments in Xenopus oocytes expressing the three homologous subunits (α, β, and γ ) of the rat epithelial Na + channel (rENaC).

Xenopus laevis oocytes are injected with the appropriate cRNA encoding for the α, β, and γ -subunits (Canessa et al. 1993 ) of the rat epithelial Na + channel (rENaC). The cRNA for the wild-type α-subunit and its deletion mutant 278-273 is always coinjected with an equal amount of β and γ -subunit cRNA (10 ng/oocyte). Then, 2-8 days after cRNA injection, the two-microelectrode voltage clamp method is used to record currents from Xenopus oocytes. Recordings are performed at 22°C using a Geneclamp amplifier (Axon Instruments, Foster City, Calif., USA), and MacLab D/A converter and software for data acquisition and analysis (AD Instruments, Castle Hill, Australia). The ND 96 solution (control) contains (mM): NaCl 96, KCl 2, CaCl 2 1.8, MgCl 2 1, HEPES5, pH7.0. In some experiments, Na + is replaced by N-methyl-Dglucamine (NMDG) solution. The microelectrodes are filled with 3 M KCl solution and have resistances in the range 0.5-0.9 M . Chemicals (e. g., triamterene as standard) are added at concentrations between 0.2 and 100 µM. The amplitude of the induced currents varies considerably, depending on the day of channel expression and the batch of oocytes. The mutant channel induces considerably smaller currents than the wild-type channel. The total Na + current amplitude is determined at least once for each experimental day by superfusion with NMDG solution, or with 3 µM or 5 µM amiloride solution at the beginning and at the end of each set of experiments.

Data are presented as means ± SEM. A paired Student's t-test is used. The level of statistical significance is set at P < 0.05. Nawada et al. (1995) studied the effects of a sodium, calcium, and potassium antagonistic agent on the sodium current by the whole cell voltage clamp technique (tip resistance = 5 M [Na] i and [Na] o 10 mmol/l at 20°C) in guinea pig isolated ventricular cells. Sunami and Hiraoka (1996) studied the mechanism of cardiac Na + channel block by a charged class I antiarrhythmic agent, in guinea pig ventricular myocytes using patch clamp techniques in the whole-cell, cellattached and inside-out configurations. Erdõ et al. (1996) compared the effects of Vinca derivatives on voltage-gated Na + channels in cultured cells from rat embryonic cerebral cortex. Effects on Na + currents were measured by applying voltage steps (20 ms duration) to -10 mV from a holding potential of -70 mV every 20 s. Steady-state inactivation curves were obtained by clamping the membrane at one of a series of 15-s prepulse potentials, followed 1 ms later by a 20-ms test pulse to -10 mV. Ragsdal et al. (1993) examined the actions of a Na + channel blocker in whole-cell voltage clamp recordings from Chinese hamster ovary cells transfected with a cDNA encoding the rat brain type IIA Na + channel and from dissociated rat brain neurons. Taglialatela et al. (1996) studied cloned voltage-dependent Na + currents expressed in Xenopus oocytes upon injection of the cRNA encoding α-subunits from human and rat brain. investigated pharmacological targeting of long QT mutant sodium channels. Eller et al. (2000) measured the effects of a calcium antagonist on inward Na + currents (I Na ) in GH3cells with the whole-cell configuration of the patch clamp technique. I Na was recorded after depolarization from a holding potential of -80 mV to a test potential of +5 mV. Initial "tonic" block (resting statedependent block) was defined as peak I Na inhibition during the first pulse 2 min after drug application as compared with I Na in the absence of drug. "Use-(frequency-) dependent" block of I Na was measured during trains of 5-or 50-ms test pulses (3 Hz) applied from -80 mV to a test potential of +5 mV after a 2-min equilibrium period in the drug-containing solution. Use-dependent block was expressed as the percentage decrease of peak I Na during the last pulse of the train as compared with I Na during the first pulse. Khalifa et al. (1999) characterized the effects of an antidepressant agent on the fast inward current (I Na ) in isolated guinea pig ventricular myocytes. Currents were recorded in the whole-cell configuration of the patch clamp technique in the presence of Ca 2+ and K + channel blockers. Haeseler et al. (1999) measured the effects of 4chloro-m-cresol, a preservative added to a wide variety of drugs, on heterologously expressed wild-type, Paramyotonia congenita (R1448H) and hyperkalemic periodic paralysis (M1360V) mutant α-subunits of human muscle sodium channels using whole-cell and inside-out voltage clamp experiments. Song et al. (2000) studied the effects of Nethyl-maleimide, an alkylating agent to protein sulfhydryl groups, on tetrodotoxin-sensitive (TTX-S) and tetrodotoxin-resistant (TTX-R) sodium channels in rat dorsal root neurons using the whole-cell configuration of the patch clamp technique. Rats at the age of 2-6 days were anesthetized with isoflurane and the spinal cord was removed and cut longitudinally. Dorsal root ganglia were plucked from the area between the vertebrae of the spinal column, and incubated in phosphate-buffered saline solution containing 2.5 mg/ml trypsin at 37°C for 30 min. After enzyme treatment, ganglia were rinsed with Dulbecco's Modified Eagle Medium supplemented with 10% horse serum. Single cells were mechanically dissociated by trituration with a fire-polished Pasteur pipette and plated on poly-L-lysine-coated glass coverslips. Cells attached to the coverslips were transferred into a recording chamber on the stage of an inverted microscope. Ionic currents were recorded under voltage clamp conditions by the whole-cell patch clamp technique. The solution in the pipette contained (in mM): CsCl 125, NaF 20, HEPES 5, EGTA 5. The pH was adjusted to 7.2 with CsOH and the osmolarity was 279 mosmol/l on average. The external solution contained (in mM): NaCl 50, choline chloride 90, tetramethylammonium chloride 20, D-glucose 5, HEPES 5, MgCl 2 1, CaCl 2 1. Lanthanum (LaCl 3 , 10 µM) was used to block calcium channel current. The solution was adjusted to pH 7.4 with tetramethylammonium hydroxide and the osmolarity was 304 mosmol/l on average. An Ag-AgCl pellet/3 M KCl-agar bridge was used for the reference electrode. Membrane currents were recorded using an Axopatch-1D amplifier. Signals were digitized by a 12-bit analog-to-digital interface, filtered with a lowpass Bessel filter at 5 kHz and sampled at 50 kHz using pCLAMP6 software (Axon Instruments) on an IBMcompatible PC. Series resistance was compensated 60%-70%. Capacitative and leakage currents were subtracted by using a P + P/4 procedure (Bezanilla and Armstrong 1977) . The liquid junction potential between internal and external solutions was on average -1.7 mV. TTX (100 nM) was used to separate TTX-R sodium currents from TTX-S sodium currents. For the study of TTX-S sodium channels, cells that expressed only TTX-S sodium channels were used. TTX-S sodium channels were completely inactivated within 2 ms when currents were evoked by depolarizing steps to 0 mV, while TTX-R sodium channels persisted for more than 20 ms. The difference in kinetics was used to identify the type of sodium current. Abriel et al. (2000) described the molecular pharmacology of the sodium channel mutation DI790G linked to long QT syndrome. Makielski et al. (2003) showed that a ubiquitous splice variant and a common polymorphism affect heterologous expression of recombinant human SCN5AS heart sodium channels. Viswanathan et al. (2001) studied gating mechanisms for flecainide action in SNCN5A-linked arrhythmia syndromes.

Abriel H, Wehrens XHT, Benhorin J, Kerem B, Kass RS (2000) Molecular pharmacology of the sodium channel mutation DI790G linked to the long-QT-syndrome. 

Potassium channels represent a very large and diverse collection of membrane proteins which participate in important cellular functions regulating neuronal and cardiac electrical patterns, release of neurotransmitters, muscle contractility, hormone secretion, secretion of fluids, and modulation of signal transduction pathways. The main categories of potassium channels are gated by voltage or an increase of intracellular calcium concentration (Escande and Henry 1993; Kaczorowski and Garcia 1999; Alexander et al. 2001) . For ATP-sensitive potassium channels see Sect. K.6.6.12.

The delayed outward potassium current in heart muscle cells of several species is made up of a rapidly (I Kr ) and a slowly (I Ks ) activating component (Sanguinetti and Jurkiewicz 1990; Wang et al. 1994; Gintant 1996; Lei and Brown 1996; Carmeliet and Mubagawa 1998) . Several potent and selective blockers of the I Kr channel have been shown to prolong the effective refractory period, but have a reverse rate-dependent activity with both normal and elevated extracellular potassium concentrations (Colatsky et al. 1990 ). Inhibitors of the slow component I Ks were developed in order to circumvent the negative rate dependence of I Kr channel blockers in the effective refractory period (Busch et al. 1996; Suessbrich et al. 1996 Suessbrich et al. , 1997 Bosch et al. 1998) . Gögelein et al. (2000) studied the effects of a potent inhibitor of I Ks channels in Xenopus oocytes and guinea pig ventricular myocytes.

Xenopus oocytes are performed with the two-microelectrode voltage clamp method. For isola-tion of the oocytes, the toads are anesthetized using a 1 g/l solution of 3-aminobenzoic acid ethyl ester and placed on ice. A small incision is made to retrieve sacs of oocytes and is subsequently closed with absorbable surgical suture. On waking up, the toads are placed back into the aquarium. The ovaries are cut up into small pieces and the oocytes are washed in Ca 2+free Or-2 solution (82.5 mM NaCl, 2 mM KCl, 1 mM MgCl 2 , 5 mM HEPES; pH 7.4) and subsequently digested in Or-2 containing collagenase A (1 mg/ml, Worthington, type II) until follicles are not longer detectable on the oocyte's surface. The oocytes are stored at 18°C in recording solution ND-96 (NaCl 96 mM, KCl 2 mM, CaCl 2 1.8 mM, MgCl 2 1 mM, HEPES 5 mM, pH 7.4) with added sodium pyruvate (275 mg/l), theophylline (90 mg/l), and gentamicin (50 mg/l).

For electrophysiological recordings, the two-microelectrode voltage clamp configuration is used to record ion currents from Xenopus oocytes. Injection of cRNA is performed according to Methfessel et al. (1986) and Golding (1992) . Oocytes are injected individually with cRNA encoding for the human protein minK, guinea pig Kir2.1, human Herg, human Kv1.5, mouse Kv1.3, or human HNC2. In the case of minK the functional potassium channel is a heteromultimer composed of the endogenous (Xenopus) KvLQT1 and the injected human minK. This heteromultimeric potassium current in then called I Ks (Barhanin et al. 1996; Sanguinetti et al. 1996) .

The electrophysiological recordings are performed at room temperature, using a Geneclamp amplifier (Axon Instruments), and MacLab D/A converter. The amplitudes of the recorded currents are measured at the end of the test voltage steps. To amplify the inward potassium current through Kir2.1 and HNC2, the external potassium concentration is raised to 10 mM KCl and the NaCl concentration lowered to 88 mM (ND-88). The microelectrodes are filled with 3 M KCl and have a resistance between 0.5 M and 1 M . During the recordings the oocytes are continuously perfused with ND-96 (or ND-88 in the case of Kir2.1 and HCN2). The test compounds are dissolved in dimethylsulfoxide (DMSO) and added to the buffer ND-96 or ND-88. The current amplitude is determined after 5 min of wash-in time.

For the isolation of ventricular myocytes, guinea pigs (weight about 400 g) or Sprague-Dawley rats of either sex are sacrificed by cervical dislocation. The hearts are dissected and perfused retrogradely via the aorta at 37°C: first with nominally Ca 2+ -free Tyrode solution (in mmol/l): 143 NaCl, 5.4 KCl, 0.5 MgCl 2 , 0.25 NaH 2 PO 4 , 10 glucose, 5 HEPES, pH 7.2, then with Tyrode solution containing 20 mmol/l Ca 2+ and 3 mg/ml collagenase type CLS II (Biochrom, Berlin Germany). After 5-10 min collagenase treatment the ventricles are cut up into small pieces in the storage solution (in mmol/l): 50 L-glutamic acid monopotassium salt, 40 KCl, 20 taurine, 20 KH 2 PO 4 , 1 MgCl 2 , 10 glucose, 0.2 EGTA, pH 7.2. The myocytes are then dispersed by gentle shaking followed by filtration through a nylon mesh (365 μm). The cells are finally washed twice by centrifugation at 90 g for 5 min and kept in the storage solution at room temperature.

Whole-cell currents are recorded in the tight-seal whole-cell mode of the patch clamp technique, using an EPC-9 amplifier (HEKA Elektronik, Lambrecht, Germany). Patch pipettes are pulled from borosilicate glass capillaries (wall thickness 0.3 mm, outer diameter 1.5 mm) and their tips are fire-polished. Series resistance is in the range of 1-10 M and 50% compensated by means of the EPC's compensation circuit.

The I Ks , I Kr , and I K1 currents in guinea pig ventricular myocytes are investigated. The voltage pulses for recording the current components are as follows: I Ks current: holding potential -80 mV to -50 mV (200 ms) to +60 mV (3 s) to -40 mV (2 s) to -80 mV; I Kr current: holding potential -80 mV to -50 mV (200 ms) to -10 mV (3 s) to -40 mV (2 s) to -80 mV. I Kr is evaluated as the tail current evoked by a voltage pulse from -10 mV to -40 mV; I K1 : holding potential -80 mV to -120 mV (200 ms) to -80 mV. In order to suppress the L-type Ca 2+ current, 5 mmol/l nifedipine is added to the bath solution.

All average data are presented as means ±SEM. Student's t-test is used to determine the significance of paired observations. Differences are considered as significant at P < 005.

Using the whole-cell configuration of the patch clamp technique, Grissmer et al. (1994) analyzed the biophysical and pharmacological properties of five cloned voltage-gated K + channels stably expressed in mammalian cell lines.

Sanchez-Chapula (1999) studied the block of the transient outward K + channel (I to ) by disopyramide in isolated rat ventricular myocytes using whole-cell patch clamp techniques.

Using the patch clamp technique, Cao et al. (2001) investigated the effects of a centrally acting muscle re-laxant and structurally related compounds on recombinant small-conductance Ca 2+ -activated K + channels (rSK2 channels) in HEK mammalian cells. Tagliatela et al. (2000) discussed the block of the K + channels encoded by the human ether-á-go-gorelated gene (HERG), termed K V(r) , which are the molecular determinants of the rapid component of the cardiac repolarizing current I K(Vr) , involved in the cardiotoxic potential and CNS effects of first-generation antihistamines and may be therapeutic targets for antiarrhythmic agents (Vandenberg et al. 2001; Zhou et al. 2005) . Chabbert et al. (2001) investigated the nature and electrophysiological properties of Ca 2+ -independent depolarization-activated potassium currents in acutely isolated mouse vestibular neurons using the wholecell configuration of the patch clamp technique. Three types of currents were identified.

Furthermore, Longobardo et al. (1998) studied the effects of a quaternary bupivacaine derivative on delayed rectifier K + currents stably expressed in Ltk − cells using the whole-cell configuration of the patch clamp technique. Moreno et al. (2003) studied the effects of a selective angiotensin II type 1 receptor antagonist on cloned potassium channels involved in human cardiac repolarization. Sanchez-Chapula et al. (2002) investigated the voltage-dependent block of wild-type and mutant HERG K + channels by the antimalarial compound chloroquine. Anson et al. (2004) published molecular and functional characterization of common polymorphism in HERG (KCNH2) potassium channels.

For more information on the evaluation of HERG potassium channels in safety pharmacology see Chap. I.D by Brian D. Guth. 

Treatment of atrial fibrillation/flutter with available potassium channel blockers (Class III antiarrhythmic agents which mainly block the delayed rectifier current I kr ) is associated with ventricular proarrhythmia. Prolongation of ventricular repolarization leads to early after-depolarization from which torsades de pointes can evolve. Therefore, blockade of a cardiac current of exclusive relevance in the atria is highly desirable as it is expected to be devoid of ventricular proarrhythmic effects. The ultrarapid delayed rectifier potassium current (I kur ) seems an ideal atrial antiarrhythmic target since it is found to contribute to the action potential in the atrium but not in the ventricle. The molecular correlate of the human cardiac ultrarapid delayed rectifier potassium current is the potassium channel Kv1.5, which therefore gained much interest Longobardo et al. 1998; Perchenet and Clément-Chomienne 2000; Caballero et al. 2000 Caballero et al. , 2001 Caballero et al. , 2004 Bachmann et al. 2001; Kobayashi et al. 2001; Matsuda et al. 2001; Choi et al. 2002; Moreno et al. 2003; Choe et al. 2003; Fedida et al. 2003; Godreau et al. 2002 Godreau et al. , 2003 Peukert et al. 2003 Peukert et al. , 2004 Plane et al. 2005) .

For in vivo studies on atrial fibrillation see A.5.0.9, A.5.0.9.1, A.5.0.9.2, A.5.0.9. 3. Gögelein et al. (2004) studied the effects of the antiarrhythmic drug AVE0118 on cardiac ion channels.

Human Kv1.5 cDNA was subcloned into the eukaryotic expression vectors pcDNA3.1 and pcDNA3.1/zeo (Invitrogen, Groningen, the Netherlands), cDNA encoding human Kv4.3 long (Kv4.3l; Dilks et al. 1999) was subcloned into pcDNA3.1, and the cDNA encoding human KChIP2 short (KChIP2.2; Decher et al. 2001) was subcloned into pcDNA3.1/zeo expression vector. Chinese hamster ovary (CHO) cells were transfected with either hKv1.5 or hKv4.3 and KChIP2.2 expression constructs. Transfection was carried out using lipofectamine (Life Technologies/Gibco BRL, Karlsruhe, Germany) according to the manufacturer's instructions. To boost Kv1.5 channel expression, CHO cells were consecutively transfected with both Kv1.5 expression constructs. Both hKv1.5 and hKv4.3 + hKChIP2.2 were stably expressed in CHO cells, which were maintained in ISCOVE's medium (Biochrom KG, Berlin, Germany), supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 350 µg/ml Zeocin (Invitrogen) and 400 µg/ml G418 (PAA Laboratories). HERG, the potassium channel underlying I Kr currents in human hearts, was cloned and transfected into CHO cells as described previously (Rampe et al. 1997) . Cells used for patch clamping were seeded on glass or plastic coverslips 12-36 h before use.

Polyadenylated RNA was isolated from pig cardiac tissues with the Oligotex mRNA purification kit (Qiagen) and 10 µg per tissue was resolved by denaturing formaldehyde electrophoresis and blotted on a positively charged nylon membrane. The membrane was hybridized with a DIG-labeled riboprobe (DIG RNA labeling kit, Roche) encompassing the entire coding sequence of human Kv1.5 and exposed on a Lumi-Imager (Roche). The pig Kv1.5 was cloned by 5 -rapid amplification and 3 -rapid amplification of cDNA ends (RACE) reactions. An adapter ligated, double-stranded cDNA library was prepared from pig heart mRNA with the Marathon cDNA amplification kit (Clontech). The 5 -RACE and 3 -RACE reactions were performed with oligonucleotide primers derived from a partial pig Kv1.5 nucleotide sequence (GenBank accession number AF348084). Overlapping cDNA clones were obtained by repeated reactions and the DNA sequence determined by automated DNA sequencing on both strands (ABI 310, Perkin Elmer). A full-length cDNA clone was established by recombinant PCR. It encodes an open reading frame of 1,083 bp and a protein with 86% overall sequence similarity to the human Kv1.5 protein. The sequence of the pig Kv1.5 cDNA was submitted to GenBank (accession number: AY635585).

For Xenopus oocyte expression, cDNAs encoding Kv1.5, Kv4.3, and KChip2.2 were cloned into the oocyte expression vector pSGEM (Villmann et al. 1997) , and capped cRNA was synthesized using the T7 mMessage mMachine kit (Ambion, Austin, Tex., USA).

Handling and injection of Xenopus oocytes were performed according to Bachmann et al. (2001) . Adult female Xenopus laevis frogs were anesthetized with 3aminobenzoic acid ethyl ester solution (1 g/l) and intact ovary lobes were removed. The oocytes were defolliculated by treatment with 40 mg collagenase dissolved in 20 ml buffer (in mM: NaCl 82.5, KCl 2, MgCl 2 1, HEPES 5, titrated to pH 7.5 with NaOH) for 120-150 min at 18°C. Oocytes were injected with 50 nl cRNA using a microinjector (World Precision Instruments, Sarasota, Fla., USA). Oocytes were stored under gentle shaking at 18°C in a buffer containing (in mM): NaCl 96, KCl 2, CaCl 2 1.8, MgCl 2 1, HEPES 5, Na-pyruvate 2.5, theophylline 0.5, gentamicin 50 µg/ml, titrated to pH 7.5 with NaOH. They were used for experiments 1-3 days after injection.

Two-electrode voltage clamp recordings were performed at room temperature in a medium containing (in mM): NaCl 96, KCl 2, CaCl 2 1.8, MgCl 2 1, HEPES 5, pH 7.5 with NaOH. Microelectrodes were pulled from filament borosilicate glass capillaries (Hilgenberg, Malsfeld, Germany) using a horizontal microelectrode puller (Zeitz, Augsburg, Germany). After filling with 3 M KCl, pipettes had a resistance of 0.3-1.3 M . To activate hKv1.5 and hKv4.3 channels, oocytes were clamped from a holding potential of -80 mV to 40 mV for 500 ms. Data were recorded with a Turbo Tec 10CX amplifier (NPI, Tamm, Germany) using an ITC-16 interface (Instrutech Corporation, Long Island, USA) and the Pulse software (HEKA Elektronik, Lambrecht, Germany).

Cells expressing Kv1.5 or Kv4.3 plus KChIP2.2 were assayed using the standard whole-cell patch clamp technique (Hamill et al. 1981) . Cells were mechanically removed from the tissue culture flask and placed in a perfusion chamber with a solution containing (in mM): NaCl 140, KCl 4.7, CaCl 2 2, MgCl 2 1.1, HEPES 10, pH adjusted to 7.4 with NaOH. Patch pipettes were pulled from borosilicate glass capillaries and heat polished. After filling with (in mM): NaCl 10, KCl 120, EGTA 1, HEPES 10, MgCl 2 1.1 (pH 7.2 with potassium hydroxide, KOH), pipettes had resistances of 2-3 M . Experiments were carried out at 36 ± 1°C. For the recording of hKv1.5, voltage pulses of 450 ms duration were applied from the holding potential of -30 mV to +20 mV at a frequency of 1 Hz. For recording of the hKv4.3+KChIP2.2, the holding potential was -50 mV and test pulses of 200 ms duration were applied to -10 mV at a frequency of 1 Hz. Data were recorded with an EPC-9 patch clamp amplifier (HEKA Elektronik) and the Pulse software (HEKA Elektronik) and stored on a PC for later analysis. Series resistance was in the range of 4-9 M and was compensated by 80% by means of the EPC9's compensation circuit. The experiments were performed under continuous superfusion of the cells with solution heated to 36 ± 1°C.

HERG channel currents were recorded at room temperature using the whole-cell configuration of the patch clamp technique with an Axopatch 200B amplifier (Axon Instruments). Briefly, electrodes (3-6 M resistance) were fashioned from TW150F glass capillary tubes (World Precision Instruments) and filled with pipette solution (in mM: potassium aspartate 120, KCl 20, Na 2 ATP 4, HEPES 5, MgCl 2 1, pH 7.2 adjusted with KOH). HERG currents were initiated by a positive voltage pulse (20 mV) followed by a negative pulse (-40 mV) and were recorded for off-line analyses. Once HERG current from a cell perfused with control external solution (in mM: NaCl 130, KCl 5, sodium acetate 2.8, MgCl 2 1, HEPES 10, glucose 10, CaCl 2 1 at pH 7.4 adjusted with NaOH) was stabilized, the cell was perfused with external solution containing the compound at a specific concentration for percentage inhibition. For each concentration from each cell, peak amplitude of the steady-state HERG tail current at -40 mV was measured. The peak amplitude for each concentration was compared with that for the control solution from the same cell and expressed as percent control.

Male pigs weighing 15-30 kg of the German Landrace were anesthetized with pentobarbital exactly as described previously (Wirth and Knobloch 2001) . After a left thoracotomy the lung was retracted, the pericardium incised and the heart was quickly removed and placed in oxygenated nominally Ca 2+ -free Tyrode solution containing (in mM): NaCl 143, KCl 5.4, MgCl 2 0.5, NaH 2 PO 4 0.25, HEPES 5 and glucose 10, pH adjusted to 7.2 with NaOH. The hearts were then mounted on a Langendorff apparatus and perfused via the left circumflex coronary artery with Tyrode solution (37°C) with constant pressure (80 cmH 2 O). All coronary vessels descending to the ventricular walls were ligated, ensuring sufficient perfusion of the left atrium. When the atrium was clear of blood and contraction had ceased (≈5 min), perfusion was continued with the same Tyrode solution, which now contained 0.015 mM CaCl 2 and 0.03% collagenase (type CLS II, Biochrom KG, Berlin, Germany), until atrial tissue softened (≈20 min). Thereafter, left atrial tissue was cut into small pieces and mechanically dissociated by trituration. Cells were then washed with storage solution containing (in mM): L-glutamic acid 50, KCl 40, taurine 20, KH 2 PO 4 20, MgCl 2 1, glucose 10, HEPES 10, EGTA 2 (pH 7.2 with KOH) and filtered through a nylon mesh. The isolated cells were kept at room temperature in the storage solution.

Ventricular myocytes were isolated by enzymatic digestion according to Gögelein et al. (1998) . Dunkin Hardley Pirbright White guinea pigs (weight about 400 g) were sacrificed by cervical dislocation. The hearts were dissected and perfused retrogradely via the aorta at 37°C with the same solutions as used for isolation of pig atrial myocytes.

Whole-cell currents were recorded with an EPC-9 patch clamp amplifier (HEKA Elektronik) as described above for CHO cells. A small aliquot of cell-containing solution was placed in a perfusion chamber and after a brief period allowing for cell adhesion to the chamber, the cells were perfused with (in mM): NaCl 140, KCl 4.7, CaCl 2 1.3, MgCl 2 1.0, HEPES 10, glucose 10, pH adjusted to 7.4 with NaOH. Patch pipettes were pulled from borosilicate glass capillaries and heat polished. After filling with (in mM) KCl 130, MgCl 2 1.2, HEPES 10, EGTA 10, K 2 ATP 1, GTP 0.1, and phosphocreatine 5 (pH 7.2 with KOH) pipettes had a resistance of 2-3 M . Series resistance was in the range of 6-12 M and was compensated by 60%-70%. Offset voltages generated when the pipette was inserted in NaCl solution (1-5 mV) were zeroed before formation of the seal.

Effects of AVE0118 on the I KACh were recorded from pig left atrial myocytes by applying voltage pulses of 500 ms duration from the holding potential of -80 mV to -100 mV. Carbachol (10 µM) was added in order to evoke the I KACh . After stabilization of the I KACh (3 min), AVE0118 was added in increasing concentrations in the continuous presence of carbachol. The current was measured at the end of the pulse after 3 min of incubation at each concentration and inhibition of the carbachol-activated current was calculated.

In some experiments, AVE0118 was washed out before application of the next higher concentration.

Also the L-type Ca 2+ current was investigated in pig left atrial cells. In these experiments, KCl in the pipette was replaced by CsCl and voltage pulses of 300 ms duration were applied from the potential of -40 mV to 0 mV. Possible effects of AVE0118 on the currents I K1 , I Ks , I Kr and I KATP were investigated in guinea pig ventricular myocytes. I K1 currents were recorded by a voltage step from -80 mV to -120 mV lasting for 200 ms. When I Ks and I Kr currents were recorded, 1 µM nisoldipine was added to the bath to block the L-type Ca 2+ current. I Ks was assessed by voltage pulse to +60 mV for 3 s, starting from -40 mV. I Kr was evaluated as the tail current evoked by a voltage pulse from -10 mV to -40 mV. I KATP was evoked by adding 1 µM rilmakalim (Krause et al. 1995) to the bath and by applying voltage ramps from -130 mV to +80 mV for 500 ms. The rilmakalim-activated current was recorded at the potential 0 mV. All patch clamp experiments were performed under continuous superfusion of the cells with solution heated to 36±1°C.

All averaged data are presented as the mean ± SEM. The Student's t-test was used to determine the significance of paired or unpaired observations. Differences were considered significant at P < 0.05. The values for half-maximal inhibition (IC 50 ) and the Hill coefficient were calculated by fitting the data points of the concentration-response curves to the logistic function:

where a represents the plateau value at low drug concentration and d the plateau value at high drug concentration; c represents the IC 50 value and n the Hill coefficient. The curve-fitting and the Student's t-test were performed with the computer program Sigma-Plot 5.0. 

Calcium influx through voltage-gated Ca 2+ channels mediates a range of cytoplasmatic responses, including muscle contraction, release of neurotransmitters, Ca 2+ dependent gene transcription and the regulation of neuronal excitability has been reviewed by several authors (Augustine et al. 1987; Bean 1989; Miller 1987; Zamponi 1997; Snutch et al. 2001 ). In addition to their normal physiological function, Ca 2+ channels as calcium antagonists are also implicated in a number of human disorders (see also A.4.0.1). Using patch clamp techniques, the structure and regulation of voltage-gated Ca 2+ channels has been studied by many authors (Sculptoreanu et al. 1993; Catterall 2000) . Berjukow et al. (2000) analyzed the role of the inactivated channel conformation in molecular mechanism of Ca 2+ channel block by a dihydropyridine derivative in L-type channel constructs and mutants in Xenopus oocytes and described the electrophysiological evaluation.

Inward barium currents (I Ba ) are studied with two microelectrode voltage-clamp of Xenopus oocytes 2-7 days after microinjection of approximately equimolar cRNA mixtures of constructs of L-channel mutants. All experiments are carried out at room temperature in a bath solution with the following composition: 40 mM Ba(OH) 2 , 50 mM NaOH, 5 mM HEPES, 2 mM CsOH (pH adjusted to 7.4 with methanesulfonic acid). Voltage recording and current injecting microelectrodes are filled with 2.8 M CsCl, 0.2 M CsOH, 10 mM EGTA, 10 mM HEPES (pH 7.4) with resistances of 0.3-2 M . Resting channel block is estimated as peak I Ba inhibition during 100-ms test pulses from -80 to 20 mV at a frequency of 0.033 Hz until steady state is reached. The dose response curves of I Ba inhibition were fitted using the Hill equation:

where IC 50 is the concentration at which I Ba inhibition is half-maximal, C is the applied drug concentration, A is the fraction of I Ba that is not blocked, and nH is the Hill coefficient. Recovery from inactivation is studied at a holding potential of -80 mV after depolarizing Ca 2+ channels during a 3-s prepulse to 20 mV by applying 30-ms test pulses (to 20 mV) at various time intervals after the conditioning prepulse. Peak I Ba values are normalized to the peak current measured during the prepulse, and the time course of I Ba recovery from inactivation is fitted to a mono-or biexponential function

Voltage dependence of inactivation under quasi-steady state conditions is measured using a multi step protocol to account for run-down (less than 10%). A control test pulse (50 ms to 20 mV) is followed by a 1.5-s step to -100 mV followed by a 30-s conditioning step, a 4-ms step to -100 mV, and a subsequent test pulse to 20 mV (corresponding to the peak potential of the I-V curves). Inactivation during the 30 s conditioning pulse is calculated as follows.

The pulse sequence is applied every 3 min from a holding potential of -100 mV. Inactivation curves are drawn according to the following Boltzmann equation.

where V is the membrane potential, V 0.5 is the midpoint voltage, k is the slope factor, and I SS is the fraction of non inactivating current. Steady state inactivation of the mutate channels at -80 mV is estimated by shifting the membrane holding potential from -80 to -100 mV. Subsequent monitoring of the corresponding changes in I Ba amplitudes until steady state reveals the fraction of Ca 2+ channels in the inactivated state at -80 mV. Steady state inactivation of different L-type channel constructs at -30 mV is estimated by fitting time course of current inactivation to a biexponential function.

The I Ba inactivation time constants are estimated by fitting the I Ba decay to a mono-or biexponential function.

Data are given as the means ± SE. Statistical significance is calculated according to Student's unpaired ttest.

Besides Xenopus oocytes (Waard and Campell 1995; Hering et al. 1997; Kraus et al. 1998) , several other cell types and constructs, such as CHO cells (Sculptoreanu et al. 1993; Stephens et al. 1997) , HEK293 (human embryonic kidney) cells (Lacinová et al. 1999) , tsA-201 cells, a subclone of HEK293, McHugh et al. 2000) , cardiac myocytes from rats (Scamps et al. 1990; Tohse et al. 1992; Gomez et al. 1994 ) and rabbits (Xu et al. 2000) , isolated atrial myocytes from failing and non-failing human hearts (Cheng et al. 1996) , skeletal muscle myotubes from mice and rabbits, (Johnson et al. 1994) , myocytes of guinea pig mesentery artery (Morita et al. 1999), dendrites from rat pyramidal and olfactory bulb neurons (Markram and Sakmann 1994; Stuart and Spruston 1995; Koester and Sakmann 1998; Margie et al. 2001) , rat amygdala neurons (Foehring and Srcoggs 1994; Young et al. 2001 ) were used to study the function of calcium channels.

Using the whole-cell variation of the patch-clamp technique, Yang et al. (2000) studied cellular T-type and L-type calcium channel currents in mouse neuroblastoma N1E115 cells. The cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum at 37°C in a humidified atmosphere of 5% CO 2 in air. The medium was changed every 3-4 days. After mechanical agitation, 3 × 10 4 cells were replanted in 35-mm tissue culture dishes containing 4 ml of bath solution. After cell attachment, the dish was mounted on the stage of an inverted phasecontrast microscope for Ca 2+ channel current recording. These cells expressed predominantly T channel currents. In experiments where L channels were specifically sought, the cells were grown and maintained at confluence for 3-4 weeks under the same culture conditions with the addition of 2% dimethylsulfoxide (Narahash et al. 1987) . Three to 5 days before use, the cells were replanted with the same medium. These cells expressed predominantly L channel currents. A small number of these cells also expressed T channel currents. Hence, cells were selected so that at a holding potential of -40 mV, the T channel component was very small and the inward current measured was conducted predominantly by L channels.

By using whole-cell and perforated patch-clamp techniques, Wu et al. (2000) showed that mifrabidile, a non-dihydropyridine compound, has an inhibitory effect on both T-and L-type Ca 2+ currents in pancreatic β-cells. 

Cl − channels are a large, ubiquitous and highly diverse group of ion channels involved in many physiological key processes including: regulation of electrical excitability; muscle contraction; secretion; and sensory signal transduction. Cl − channels belong to several distinct families characterized in detail: voltage-gated Cl − channels, the cAMP-regulated channel CFTR (cystic fibrosis transmembrane conductance regulator), ligand-gated Cl − channels that open upon binding to the neurotransmitters GABA or glycine, and Cl − channels that are regulated by the cytosolic Ca 2+ concentration (Jentsch and Günther 1997; Frings et al. 2000) . Cliff and Frizel (1990) studied the cAMP-and Ca 2+ -activated secretory Cl − conductances in the Cl − secreting colonic tumor epithelial cell line T84 using the whole-cell voltage-clamp technique.

T84 cells are used 1-3 days after plating on collagencoating coverslips. The cells are maintained at 37°C. At this temperature, the responsiveness of the cells to secretagogues, particularly to cAMP-dependent agonists, is improved. Increases in Cl − and K + conductances are the major electrical events during stimulation of Cl − secretion. Accordingly, bath-pipette ion gradients are chosen so that transmembrane Cl − and K + currents can be monitored independently at clamp voltages equal to the reversal potentials of these ions. The pipette solution is: 115 MM KCl, 25 mM N-methyl-D-glucamine (NMDG) glutamate, 0.5 mM EGTA, 0.19 mM CaCl 2 , 2 mM MgCl 2 , 2 mM Na 2 ATP, 0.05 mM Na 3 GPT, 5 mM HEPES, pH 7.2. The bath solution is: 115 mM NaCl, 40 mM NMDG glutamate, 5 mM potassium glutamate, 2 mM MgCl 2 , 1 mM CaCl 2 , 5 mM HEPES, pH 7.2. Bath Na + and Cl − concentrations are reduced by substituting NMDG chloride or sodium glutamate for NaCl. When Na + and K + free solutions are used, Na + and K + are replaced by NMDG + , and Cl − is reduced by replacing Cl − by glutamate.

During whole-cell recording, the membrane potential is clamped alternately to three different voltages, each for 500-msec duration. Computer-controlled voltage-clamp protocols are used to generate current-voltage (I-V) relations when the transmembrane currents are relatively stable by stepping the clamp voltage between −100 and +100 mV at 20 mV intervals.

Test drugs (e. g., 8-(4-chlorophenylthio) adenosine 3 ,5 -cyclic monophosphate, A23187, forskolin, or ionomycin) are solubilized in stock solutions (ethanol of DMSO) and diluted.

Instantaneous relations are constructed from currents recorded 6 msec after a voltage step. Maertens et al. (2000) used the whole-cell patch-clamp technique to study the effect of an antimalarial drug on the volume-regulated anion channel (VRAC) in cultured bovine pulmonary artery endothelial cells. They also examined the effects on other Cl − channels, i. e., the Ca 2+ activated Cl − channel and the cystic fibrosis transmembrane conductance regulator to assess the specificity for VRAC.

Pusch et al. (2000) characterized chloride channels belonging to the ClC family. Chiral clofibric acid derivates were tested on the human ClC-1 channel, a skeletal muscle chloride channel, after heterologous expression in Xenopus laevis oocytes by means of two microelectrode voltage clamp recordings. The hyperpolarization-activated cation currents (termed I f , I h , or I q ) play a key role in the initiation of cardiac and neuronal pacemaker depolarizations. Unlike most voltage-gated channels, they are activated by hyperpolarizing voltage steps to potentials negative to -60 mV, near the resting potential of most cells. This property earned them the designation of I f for "funny" or I q for "queer." The funny current, or pacemaker (I f ) current, was first described in cardiac pacemaker cells of the mammalian sino-atrial node as a current that slowly activates on hyperpolarization at voltages in the diastolic voltage range, and contributes to the generation of cardiac rhythmic activity and to its control by sympathetic and parasympathetic innervations (DiFrancesco et al. 1986; Accili et al. 1997 Accili et al. , 2002 Robinson and Siegelbaum 2003}; Baruscotti et al. 2005) . In sino-atrial cells, f-channels are modulated by cAMP independently of phosphorylation, through a mechanism involving direct interaction of cAMP with the intracellular side of the channels (DiFrancesco and Tortora 1991; Bois et al. 1996) . A significant advancement in the study of molecular properties of pacemaker channels was achieved when a new family of channels was cloned, the HCN (hyperpolarization-activated, cyclic nucleotide gated) channels (Ishii et al. 1999; Kaupp and Seifert 2001; Biel et al. 2002; Macri et al. 2002) . The HCN family is related to the cyclic nucleotide-gated channel and eag potassium channel family and belongs to the superfamily of voltage-gated cation channels. HCN channels are characterized by six membrane-spanning segments (S1-S6) including voltage-sensing (S4) and pore (between S5 and S6) regions. In the C-terminal region they contain a consensus sequence for binding of cyclic nucleotides. In the heart, neurotransmitterinduced control of cardiac rhythm is mediated by I f through its second-messenger cAMP, whose synthesis is stimulated and inhibited by β-adrenoceptor and muscarinic agonists, respectively.

Inhibition of the I f channel was recommended for induction of bradycardia and treatment of coronary disease (Thollon et al. 1994 (Thollon et al. , 1997 Simon et al. 1995; Bois et al. 1996; Deplon et al. 1996; Acilli et al. 1997; Rocchetti et al. 1999; Monnet et al. 2001 Monnet et al. , 2004 Bucchi et al. 2002; Cerbai et al. 2003; Rigg et al. 2003; Vilaine et al. 2003; Albaladejo et al. 2004; Colin et al. 2004; DiFrancesco and Camm 2004; Moreno et al. 2004; Mulder et al. 2004; Vilaine 2004; Chatelier et al. 2005; Leoni et al. 2005; Romanelli et al. 2005; Schipke et al. 2006) . Romanelli et al. (2005) reported the design, synthesis and preliminary biological evaluation of zatebradine analogs as potential blockers of hyperpolarization-activated current and Chatelier et al. (2005) described that a calmodulin antagonist directly inhibits f-type current in rabbit sino-atrial cells.

Sino-atrial node myocytes of the rabbit were isolated (DiFrancesco et al. 1986 ). Cells were allowed to settle in Petri dishes, and were superfused with normal Tyrode solution containing (mM): NaCl 140, KCl 5.4, CaCl 2 1.8, MgCl 2 1, D-glucose 5.5, Hepes-NaOH 5; pH 7.4.

In macro-patch experiments the temperature was kept at 27°C-28°C and the patch pipette solution contained (mM): NaCl 70, KCl 70, CaCl 2 1.8, MgCl 2 1, BaCl 2 1, MnCl 2 2, Hepes-KOH 5; pH 7.4. The control solution perfusing the intracellular side of the membrane patches contained (mM): potassium aspartate 130, NaCl 10, CaCl 2 2, EGTA 5, Hepes-KOH 10; pH 7.2, pCa = 7. In some experiments, the calcium concentration of the bath solution was reduced to 0.1 nM according to the calculation of Fabiato and Fabiato (1979) and the correction of Tsien and Rink (1980) . Macro-patches containing hundreds of f-channels were formed using a large-tipped pipette (0.5 to 2 M ) (DiFrancesco and Tortora 1991). The test compound or calmodulin (Calbiochem) was dissolved in either distilled water and ethanol (50/50) or distilled water, respectively, divided into aliquots, and stored at −20°C until use. Ethanol was added to control solutions at the same concentration used in test solutions (lower than 0.1%).

The time course of macro-patch I f under the influence of the modifying compounds was recorded by applying hyperpolarizing steps of 3 s duration at a frequency of 1/15 Hz. At steady-state, the voltage dependence of I f was described by the equation:

where g f is the conductance, g fmax the fully activated conductance, y ∞ (E) the steady-state activation parameter and E f the reversal potential (DiFrancesco and Noble 1985) . Steady-state current/voltage (I/V) curves were measured by applying 1-minlong hyperpolarizing voltage ramps with a rate of −115 mV/min from a holding potential of −35 mV. Conductance-voltage (g f /E) relations were then obtained from the above equation as ratios between steady-state I/V curves (i f /E) and E−E f , where E f was set to −12.24 mV (DiFrancesco and Mangoni 1994). Conductance curves were fitted by Boltzmann function:

where E 1 / 2 is the half-maximal voltage of activation and p is the inverse-slope factor. This allowed estimation of the shifts of the voltage dependence of conductance (i. e., of the activation parameter y ∞ ) measured as changes in E 1 / 2 . Shifts of the I f activation curve caused by cAMP were also determined by a quicker method not requiring measurement of the conductance-voltage relation (Accili and DiFrancesco 1996) . Shifts were obtained by applying hyperpolarizing steps from −35 mV to near the mid-point of the I f activation curve and adjusting the holding potential (−35 mV in the control solution) until the cAMP-induced change in I f was compensated and the control I f magnitude fully restored. Since the compensation involved a change of the test voltage (from E to E + s m , where s m is the measured displacement of the holding potential in mV), a correction was introduced to obtain the shift of the activation curve (s, mV), according to the relation:

When comparing different sets of data, statistical analysis was performed with either the Student's t-test or analysis of variance (ANOVA). Values of P < 0.05 were considered significant. Statistical data were given as mean ± SEM values. 

Intracellular free Ca-concentration can be measured in cultured endothelial cells with a fluorometric methods (Tsien et al. 1982; Grynkiewicz et al. 1985; Lückhoff et al. 1988; Busse and Lamontagne 1991; Hock et al. 1991 ).

Cultured endothelial cells from the pig are seeded on quartz coverslips and grown to confluence. The cells are loaded with the fluorescent probe indo-1 by incubation with 2 µmol indo-1/AM and 0.025% Pluronic F-127, a non-ionic detergent. Thereafter, the coverslips are washed and transferred to cuvettes, filled with HEPES buffer.

Fluorescence is recorded in a temperature controlled (37°C) spectrofluorophotometer (excitating wavelength 350 nm, emission wavelength simultaneously measured at 400 and 450 nm). Lee et al. (1987) measured cytosolic calcium transients from the beating rabbit heart using indo-1 AM as indicator. Yangisawa et al. (1989) measured intracellular Ca 2+ concentrations in coronary arterial smooth muscle of dogs with fura-2. Makujina et al. (1995) measured intracellular calcium by fura-2 fluorescence simultaneously with tension in everted rings of porcine coronary artery denuded of endothelium.

Hayashi and Miyata (1994) described the properties of the commonly used fluorescent indicators for intracellular calcium: Fura-2, Indo-1, and Fluo-3.

Monteith et al. (1994) studied the Ca 2+ pumpmediated efflux in vascular in spontaneously hypertensive rats.

Busse R, Lamontagne D (1991) Endothelium-derived bradykinin is responsible for the increase in calcium produced by angiotensin-converting enzyme inhibitors in human endothelial cells. Eschenhagen et al. (1997) developed a method for culturing embryonic cardiomyocytes in a collagen matrix to produce a coherently contracting 3-dimensional model heart tissue that allows direct measurement of isometric contractile force.

Ventricles from 9-11 day incubated chicken embryos (Cavanaugh 1955) are minced in Dulbecco's minimal essential medium (DMEM), washed once with 0.25% trypsin/0.1% EDTA in phosphate buffered saline (PBS), pH 7.45, and then digested in fresh trypsin/EDTA for 15 min at 37°C. The supernatant is discarded and the pellet is subjected to digestion with 0.1% collagenase (144 U/mg) in PBS, pH 7.45, for 30 min at 37°C. This supernatant is discarded and the pellet digested further with several cycles of collagenase for 10-20 min each until the pellet is completely digested. DNase I (40 µl, 1 mg/ml in PBS) is added between cycles depending on the presence of viscous DNA. The isolated cells are kept in Petri dishes in DMEM supplemented with 15% heat-inactivated fetal calf serum in the CO 2 incubator. After completion of the digestion, the cells are incubated for another 30-60 min in the CO 2 incubator (preplating). The cell suspension is centrifuged at 250 rpm (12 g). The pellet is resuspended in 10 ml culture medium (DMEM, 10% inactivated horse serum, 2% chicken embryo extract (Gibco BRL), 2 mmol/l glutamine, 10 µg/ml streptomycin, and 100 U/ml penicillin G, recentrifuged at 250 rpm, and finally resuspended in culture medium at 2-3 × 10 6 cells per ml. For casting cardiomyocyte-populated collagen gels, strips of Velcro are glued with silicone rubber to glass tubes (13 mm length, 3 mm outer diameter, 2 mm inner diameter). Pairs of Velcro-coated tubes, kept at a fixed distance by a stainless steel wire spacer, are placed in rectangular wells (15 × 17 × 4 mm) cut into a layer of silicone rubber in a 100 mm polymethylenepentene Petri dish. This assembly is autoclaved before use. For each gel, 1 ml of an ice-cold collagen/cell mixture is poured into each well between the Velcro-coated glass tubes. This mixture has the same composition as the culture medium and contains in addition to 1 mg neutralized collagen I from rat tail (Upstate Biotechnology, Inc.), 1 × 10 6 cardiomyocytes, the acetic acid in the collagen solution, and the NaOH to neutralize it. The mixture is allowed to gel at 37°C for 60 min before culture medium is added to the dish. Medium changes are performed after overnight and then every other day.

After 6-11 days in culture, the gels are removed from the culture dish, the spacers are withdrawn, and one of the glass tubes is mounted on a fixed electrode; the other tube is connected by an inelastic silk string to an isometric force transducer attached to a Wekagraph thermal array recorder (Föhr Instruments, Heidelberg, Germany). The preparation is adjusted to its original (spacer) length before it is immersed in a convential water bath filled with modified Tyrode's solution maintained at 35°C and continuously gassed with 95% O 2 and 5% CO 2 .

After a 30-60 min equilibration period without pacing, force and frequency reaches a stable value. Gels are then electrically stimulated with rectangular pulses (10 ms, 20-40 V) at a standard frequency of 1.5 Hz. Preload is stepwise adjusted to L max , the length at which the preparation develops maximal force. Cumulative doses of inotropic compounds, e. g. isoprenaline or forskoline, are added. All gels are exposed to a concentration-response curve for calcium (1.8-12.6 mmol/l) and one or two additional inotropic stimuli.

All values are presented as arithmetic means ± SEM. Student's t-test for paired observations is used to compare force of contraction, resting tension, or beating frequency before and after other interventions. Ferrara et al. (1997) studied the role of Gi-proteins and β-adrenoceptors in the age-related decline of contraction in guinea-pig ventricular myocytes. The isolated myocytes were placed in Krebs-Henseleit solution in a Perspex chamber on the stage of a Zeiss IM inverted microscope and superfused with Krebs-Henseleit so-lution containing 1 mmol/l Ca 2+ at 2 ml/min and 32°C. Cells were selected using the following criteria: rod shaped, without sarcolemmal blebs, no spontaneous contractions, stable baseline contraction to electrical stimulation at 0.5 Hz and sarcomere length not shorter than 1.67 µm. The image of the cells was displayed on a TV monitor and the length change measured with a video motion detector. Contraction amplitude and velocity was expressed as change in sarcomere length, calculated from the change in length of the myocyte and its original sarcomere length.

Using 

Adrenomedullin is a 52-amino acid peptide originally discovered in human adrenal pheochromocytoma by monitoring the elevating activity of platelet cAMP (Kitamura et al. 1993 ). Molecular cloning of rat adrenomedullin was reported by Sakata et al. (1993) . The genomic structure of human adrenomedullin gene was reported by Ishimitsu et al. (1994) . Adrenomedullin and proadrenomedullin Nterminal 20 peptide (PAMP) which are both hypotensive and bronchodilating, are derived from preproadrenomedullin (Kanazawa et al. 1995; Iwasaki et al. 1996; Shimosawa and Fujita 1996; Hinson et al. 1998; Samson 1998; Autelitano and Tang 1999; Jimenez et al. 1999; Lopez et al. 1999; Tajima et al. 1999) . Adrenomedullin is found ubiquitously in tissues and organs, especially in cardiovascular tissues and in the kidney, lung, brain and endocrine glands (Wimalawansa 1996; Van Rossum et al. 1997; Eto et al. 1999; Jougasaki and Burnett 2000; Kitamuro et al. 2000) . The main biological effect is vasodilatation (Ishiyama et al. 1993; Nikitenko et al. 2002) . A hypotensive effect has been found in rats (Khan 1997), rabbits (Fukuhara et al. 1995) , and man (Lainchbury et al. 1997) . Adrenomedullin belongs to the calcitonin gene-related peptide/calcitonin peptide family as it shares approximately 25% homology with calcitonin gene-related peptide (Kitamura et al. 1993) . Several pharmacological studies are related to the vasodilating effect of adrenomedullin, e. g., in mouse aorta (Ashton et al. 2000) , in the mesenteric vascular bed (see A.8.2.5), (Santiago et al. 1995) , in the hind limb vascular bed (see A.8.2.1), (Santiago et al. 1994; , in the pulmonary vascular bed (see A.8.2.6), (DeWitt et al. 1994; Lippton et al. 1994; Heaton et al. 1995; Nossaman et al. 1995) , on cerebral blood flow in dogs (Baskaya et al. 1995) and in cats (Takao et al. (1999) , on renal hemodynamics in dogs (see A.8.2.3) Yukawa 1998) , or on vasodilation in perfused rat kidneys (Hayakawa et al. 1999) . Intravenous infusion of adrenomedullin exerted diuresis and natriuresis without major changes in blood pressure and produced beneficial hemodynamic and renal vasodilator effects in rats with compensated heart failure (Vari et al. 1996; Nagaya et al. 1999) . In isolated perfused, paced rat heart preparations, adrenomedullin showed a dose-dependent inotropic effect (Szokodi et al. 1998) . Pulmonary vasodilator responses and vasorelaxant effects in isolated pulmonary artery rings were found by Gumusel et al. (1998) . Adrenomedullin is a growth-promoting factor for cultured vascular smooth muscle cells (Iwasaki et al. 1998 ) and fibroblasts (Isumi et al. 1998) . Willenbrock et al. (1999) showed a beneficial effect of adrenomedullin on renal function in rats with aortocaval shunt.

Adrenomedullin inhibits gastric secretion in rats with chronic gastric fistula (see J.3.1.3), (Rossowski et al. 1997 ) and inhibits reserpine-induced gastric lesions in rats (Clementi et al. 1998) . Tsuchida et al. (1999) found an inhibition of cholecystokinin-stimulated amylase secretion by adrenomedullin in rat pancreatic acini. Rademaker et al. (2003) discussed the role of adrenomedullin in the pathophysiology of heart failure.

Lewis et al. (1998) described a specific and sensitive radioimmunoassay for human adrenomedullin. Ohta et al. (1999) developed an one-step direct assay for adrenomedullin with monoclonal antibodies.

N-terminal fragments of adrenomedullin show vasopressor activities (Watanabe et al. 1996) .

Adrenotensin, an other adrenomedullin gene product, contract in an endothelium-dependent manner pulmonary blood vessels (Gumusel et al. 1996) . Specific adrenomedullin binding sites were described in human brain (Sone et al. 1997) , in the rat spinal cord (Owji et al. 1996) , in cultured brain cells (Zimmermann et al. 1996) , and in cultured rat mesangial cells (Osajima et al. 1996) .

Human brain is obtained at autopsy. For preparation of membranes, tissues are homogenized in ice-cold 50 mM HEPES buffer, pH 7.6; containing 0.25 M sucrose, 10 µg/ml soybean trypsin inhibitor, 0.5 µg/ml pepstatin, 0.5 µg/ml leupeptin, 0.5 µg/ml antipain, 0.1 mg/ml benzamidine, 0.1 mg/ml bacitracin, and 30 µg/ml aprotinin. The homogenates are centrifuged at 1500 g for 20 min at 4°C. The pellets are resuspended in 10 vol of the above buffer without sucrose and centrifuged at 100,000 g for 1 h at 4°C. The final pellets are resuspended to a concentration of 2-10 mg protein/ml, aliquoted, and stored at -80°C.

For the receptor binding assay, brain membranes (100 µg protein) are incubated at 4°C in 0.5 ml binding buffer (20 mM HEPES buffer, pH 7.4, containing 5 mM MgCl 2 , 10 mM NaCl, 4 mM KCl, 1 mM EDTA, and 0.3% BSA) containing 0.3 nM 125 I-human adrenomedullin in siliconized microcentrifuge tubes. Pellets are washed with 0.5 ml binding buffer at 4°C and counted in a γ -counter.

Nonspecific binding is determined in the presence of 200 nM unlabeled human adrenomedullin. Specific binding is defined as total binding minus nonspecific binding. Data are calculated as mean ± SEM. Eguchi et al. (1994) studied the binding of human adrenomedullin and analogs and the adenylate cyclase activity in cultured rat vascular smooth muscle cells. Zimmermann et al. (1995) showed that adrenomedullin and calcitonin gene-related peptide interact with the same receptor in cultured human neuroblastoma SK-N-MC cells. Moody et al. (1997) investigated the binding affinity of adrenomedullin in C6 glioma cells.

Findings of Belloni et al. (1998) suggested the existence of different receptor subtypes for adrenomedullin in the human adrenal cortex. Mazzocchi et al. (1999) found abundant [ 125 I]adrenomedullin binding sites in both zona glomerulosa and adrenal medulla in the rat adrenal gland. 

The atria of mammalian hearts synthesize and secrete peptides with potent natriuretic and vasoactive properties known as ANF = atrial natriuretic factor (de Bold et al. 1981) . The atrial natriuretic peptide hormonal system consists of a 126-amino acids prohormone synthesized within myocytes of the heart and stored in storage granules within the heart before release into circulation (Kangawa and Matsuo 1984; Oikawa et al. 1984; Vesely 1992 ). This hormonal system contains several peptides from the 126-amino acid-prohormone with blood pressure lowering, natriuretic, diuretic and/or kaliuretic properties (Martin et al. 1990; Vesely et al. 1994 ). Thus, peptides consisting of amino acid 1 to 30 (LANP = long-acting natriuretic peptide), 31 to 67 (vessel dilator), 79 to 98 (kaliuretic peptide) and 99 to 126 (ANF) each have blood pressure lowering, natriuretic, diuretic and/or kaliuretic properties both in humans and in animals. Human and rat atria predominantly secrete a peptide of 28 amino acid residues, ANF-(99-126), which represents the Cterminus of a precursor sequence of 126 amino acid residues. In addition, vessel dilator and LANP circulate as distinct entities after having been proteolytically cleaved from the rest of the amino terminus by proteases (Ackerman et al. 1997) . Plasma immunoreactive ANF-(99-126) concentration increases in normal rats after volume expansion, while infusion of the peptide lowers blood pressure in several animal models of hypertension.

An international standard for atrial natriuretic factor was established by an international collaborative study (Poole et al. 1988 ). Human ANF-(99-126) was synthesized, highly purified and distributed to several laboratories, who performed radioimmunoassays, ra-dioreceptor assays and an in vitro assay using the vasorelaxant activity in precontracted rat aortic strips.

The C-type natriuretic peptide is a 22-amino acid peptide that was initially identified in the central nervous system (Ogawa et al. 1992 ; Barr et al. 1996; Amin et al. 1996) . The distribution of C-type natriuretic peptide, which has structural homology with atrial and brain natriuretic peptides and also similar activities, is wide and includes the endothelium, myocardium, gastrointestinal and genitourinary tracts. Brain natriuretic peptide has been described as a novel cardiac hormone (Nakao et al. 1991) . Yasue et al. (1994) studied the localization and mechanism of secretion of B-type natriuretic peptide in comparison with those of A-type natriuretic peptide in normal subjects and patients with heart failure. N-terminal pro-brain natriuretic peptide became a diagnostic screening tool to differentiate between patients with normal and left ventricular systolic function (Bay et al. 2003; Gardner et al. 2003) .

Jiao and Baertschi (1993) reviewed the neural control of the endocrine rat heart. Stimulation of cardiac sympathetic nerves potently stimulates ANF secretion.

ANF inhibits proliferation in non-myocardial cells and is anti-hypertrophic in cardiomyocytes. Silberbach et al. (1999) reported that activation of an extracellular signal-regulated protein kinase is required for the antihypertrophic effect of atrial natriuretic factor in neonatal rat ventricular myocytes.

Ackerman BH, Overton RM, McCormick MT, Schocken DD, Vesely DL (1997) Disposition of vessel dilator and longacting natriuretic peptide in healthy humans after one-hour infusion. J Pharm Exp Ther 282:603-608 Amin J, Carretero OA, Ito S (1996) Mechanism of action of atrial natriuretic factor and C-type natriuretic peptide. Hypertension 27:684-687 Barr CS, Rhodes P, Struthers AD (1996) Matsui et al. (1987) described a rapid bioassay for quantification of atrial natriuretic polypeptides in rats with continuous recording of the conductivity of the urine, urine flow and blood pressure.

Male Sprague Dawley rats weighing 180-240 g are anesthetized with 60 mg/kg i.p. pentobarbital sodium. Anesthesia is maintained by injection of supplemental doses of pentobarbital sodium. After tracheotomy, catheters are placed into the left jugular vein and the right carotid artery for injection of samples or infusion of 10% mannitol in 0.9% saline and for blood pressure recording. Through a small suprapubic incision the bladder is cannulated for collection of urine, and the cannula is connected to a device for continuous measurement of urine conductivity, by which the electrolyte concentration is estimated. Urine flow rate is recorded using a drop counter, and urine samples are collected in a plastic tube. After completion of surgery, 0.6-0.8 ml of 10% mannitol in 0.9% saline is administered into the jugular vein and is continuously infused at a rate of 4.0 ml/h by a syringe pump. Following an equilibration of 45-60 min, the bioassay is started when the urine flow is increased to 50-75 µl/min. All test samples with a volume of 100 µl are directly injected into the jugular vein followed by a wash injection of ∼30 µl of saline. Mean arterial blood pressure, urine conductivity, and urine flow rate are simultaneously recorded.

For dose-response curves, serial dilutions of human ANF (α-hANP) and of test substance are prepared. Vehicle and various doses of α-hANP or test substance are injected in a randomized sequence. Immediately after the injection, urine is collected for 10 min. Urine volumes are determined by weighing, and urinary sodium and potassium concentrations are measured by flame photometry.

Linear-regression analyses by the method of least squares are used for evaluating dose-response relationship. One-way analysis of variance for repeated measures and the Newman-Keuls test are used to detect statistical differences. Petersen et al. (1988) determined atrial content and plasma levels of atrial natriuretic peptides in rats with chronic renal failure. The natriuretic activity in the bioassay was estimated as the increase in Na excretion in urine samples from the control period to the maximal natriuretic response.

Allen and Gellai (1987) measured cardioinhibitory effects of atrial peptide in conscious chronically instrumented rats. The hemodynamic and renal excretory responses were measured with and without replacement of urinary fluid losses. Thibault et al. (1984) characterized the biological activities of atrial natriuretic factor-related peptides in vivo by a natriuretic bioassay and in vitro by relaxation of contracted intestinal smooth muscle (chick rectum). Schiller et al. (1986) tested synthetic analogs of atrial natriuretic peptide in the rabbit aorta assay and in a bioassay monitoring suppression of aldosterone secretion from bovine zona glomerulosa cells.

Dlouha and McBroom (1986) measured diuretic and natriuretic activity of atrial extracts of taurinetreated normal and cardiomyopathic hamsters by urine flow and Na + excretion in the rat bioassay.

St.-Louis and Schiffrin (1988) measured vasorelaxant effects of different atrial natriuretic peptides on rat aortic and mesenteric artery rings and compared the results with the potency of the same peptides to displace 125 I-labeled ANP on membrane preparations of aorta and of mesenteric vein bed.

Kohse et al. (1992) described a bioassay for quantitative determination of natriuretic peptides in human biological samples using bovine aortic and bovine kidney epithelial cultured cells. The amount of cyclic AMP produced by these cells was measured by radioimmunoassay. Kecskemeti et al. (1996) studied the effects of atrial natriuretic peptide (ANP) on action potential characteristics in various (human, rabbit, guinea-pig) atrial and guinea pig ventricular papillary muscles. The data suggested that ANP inhibits the slow inward Ca 2+ channel activity and facilitates the K + channel activity.

Salt-sensitive hypertension was found in ANP knockout mice (Melo et al. 1998 ). Allen DE, Gellai M (1987) Schiffrin et al. (1985) described receptors for atrial natriuretic factor in the rat.

Synthetic ANF-(99-126) is iodinated with 125 I by a modification (Gutskowska et al. 1984 ) of the chloramine T method (Greenwood and Hunter 1963). Separation of radiolabeled ANF from free iodine is achieved by immunoaffinity chromatography followed by C-18 reverse phase high pressure liquid chromatography.

For preparation of membranes, Sprague Dawley rats weighing 300 g are sacrificed by decapitation. The atria, ventricles, renal arteries, mesentery, the mesentery vascular bed, and adrenals are processed for binding studies. Adrenal capsules are separated by manual compression. The tissues are immersed in 0.25 M sucrose solution, finely minced with scissors, and homogenized in a Polytron (setting 8, 10 s twice). The homogenate is centrifuged at 1550 g for 10 min at 4°C; the supernatant is decanted and recentrifuged. The final supernatant is filtered through a cheesecloth, then centrifuged at 10,400 g for 30 min. The pellet is resuspended in a 0.05 M Tris-HCl buffer, pH 7.4, containing 120 mM NaCl, 5 mM MgCl 2 , 0.5 mM phenyl methyl sulfonyl fluoride, 0.1% bacitracin, and 1 µM aprotinin. Proteins are measured by the Coomassie blue method (Spector 1978). Next, bovine serum is added at a concentration of 0.2%, and the membranes are diluted to a protein concentration of 0.25 to 1 mg/ml in the Trisbuffer containing 0.2% albumin.

The 125 I-AFN binding assay uses 30-50 pM of labeled ANF and 10 −13 to 10 −6 unlabeled ANF in competition experiments. In saturation experiments, increasing concentrations of 125 I-AFN (6-200 pM) are used, and nonspecific binding is determined by incubation in the presence of 1 µM unlabeled ANF for each point of the saturation curves. Incubation is done with 25-100 µg of receptor protein per tube, at 4°C for 60 min. All assays are performed in duplicate. Separation of bound and free radioactivity is achieved by rapid filtration through polyethylenimine-treated Whatman GF/C filters soaked with the assay buffer. The filters are washed twice with 3 ml of 0.9% NaCl, then are allowed to dry and are counted in a gamma counter.

Binding data are analyzed by computer assisted nonlinear regression analysis using the LIGAND program (Munson and Rodbard 1980). The inhibition constant K i is calculated according the Cheng and Prussoff equation.

Misono (2000) found that the binding of atrial natriuretic factor to its receptor is dependent on chloride concentration. 

Production of atrial natriuretic factor and brain natriuretic peptide can be measured by gene expression using total RNA extraction and Northern blot analysis and the quantitative competitive reverse transcription polymerase chain reaction (Hama et al. 1995; Ogawa et al. 1996 Ogawa et al. , 1997 Ogawa et al. , 1998 Ogawa et al. , 1999 .

Plasma samples are acidified by adding 100 µl/ml of 1 mol/l HCl and passed through Sep-Pak C 18 cartridges (Millipore) that are pre-wetted with 5 ml of 80% acetonitrile in 0.1% trifluoroacetic acid (TFA) and 10 ml of 0.1% TFA. The cartridges with the absorbed peptides are washed with 20 ml of 0.1% TFA and eluted with 3 ml of 60% acetonitrile in 0.1% TFA.

Tissue samples are homogenized in 10 vol of an extracting mixture consisting of 0.1 N HCl, 1.0 mol/l acetic acid, and 1% NaCl and centrifuged at 10,000 g for 30 min at 4°C. The supernatants are then extracted with the use of Sep-Pak C 18 cartridges by elution with 80% acetonitrile in 0.1% TFA. The eluates from tissue or plasma are freeze-dried and processed for RIA.

Atrial and ventricular tissue samples from individual rats are extracted using Trizol (GIBCO BRL). Total RNA from the atrium (10 µg) and ventricle (20 µg) are electrophoretically separated in an agarose-formaldehyde gel followed by blotting to nylon membranes (Hybond N+, Amersham) overnight. Membranes are prehybridized in 2.5 × Denhardt's solution, 5 × SSC, 50% formamide, 25 mmol/l KH 2 PO 4 , pH 6.4, 0.2% SDS, and 0.2 mg/mL herring sssDNA for 3 h at 42°C for cDNA probes, or prehybridized in 5 × Denhardt's solution, 6 × SSC, 50 mmol/l NaH 2 PO 4 , 0.5% SDS, and 0.2 mg/ml herring sssDNA for 3 h at 5°C below the calculated T m for oligonucleotide probes. Hybridization is then carried out for 16 h at the same temperature and the same solution as the prehybridization condition except for the presence of the radiolabeled probes. Five cDNA probes and two oligonucleotide probes are used. The cDNA probes used are as follows: (1) a 900bp EcoRI/HindIII fragment containing the full-length rat ANF cDNA, (2) a 595-bp SalI fragment containing full-length rat BNP cDNA, (3) a 5-kb EcoRI/SalI fragment of the mouse 28S rRNA cDNA probe, (4) a 2-kb BamHI/BglII fragment of the mouse PGK gene cDNA, and (5) rat α 1 -III collagen cDNA containing 1300 bp of the 3 noncoding and coding regions. The two oligonucleotide probes are 39 and 24 base fragments specific for unique regions in the 3 untranslated regions of the rat α-MHC and β-MHC genes. The α-sequence is 5 GGGATAGCAACAGCGAGGCTCT TTCTGCTGGACAGGTTA-3 (T m = 60°C),and the β-

The cDNAs are labeled with 5 -[α 32 P]dCTP (3000 Ci/mmol, Amersham) using the Megaprime DNA labeling system (Amersham). The oligonucleotides are labeled with [γ -32 P]ATP (3000 Ci/mmol, Amersham) using a 5 -end-labeling kit (Amersham). At the end of hybridization, the membranes are washed twice at 42°C with 2 × SSC and 1% SDS and twice at 55°C with 1 × SSC and 0.1% SDS for the cDNA probes or are washed once at 30°C with 5 × SSC and 0.1% SDS and twice at the same temperature as the hybridization with 1 × SSC and 0.1% SDS for the oligonucleotide probes. Before additional probing, bound counts are completely stripped from the membranes by washing twice in 10 mmol/l sodium citrate, pH 6.8, 0.25% SDS for 10 min at 100°C. Autoradiographs are scanned with an Ultrascan XL laser densitometer (LKB Produckter) and LKB 2400 Gelscan XL software package. The scanning values of ANF, BNP, collagen-III, and α-MHC and β-MHC mRNAs are normalized to 28S ribosomal RNA or PGK mRNA as internal controls to correct for differences in the amount of RNA applied and transfer efficiency.

Plasma and cardiac tissue concentrations of immunoreactive ANF and BNP are determined by RIA with anti-rat ANF 99-126 and anti-rat BNP 64-95 sera, respectively, from Peninsula Laboratories.

RNA samples are reverse transcribed with Super Script II RNase H 2 Reverse Transcriptase and oligo(dT)12-18 primer with the use of a reverse transcription kit (GIBCO BRL). An aliquot of the cDNA product is used for PCR amplification with ANF primers. A dilution series of total RNA (5 mg) aliquots is prepared for each sample. Each dilution is spiked with competitor RNA. After the PCR, aliquots (5 ml) of the PCR product are electrophoresed on a 2% agarose gel and visualized by ethidium bromide staining. Photographs are taken with Polaroid 55 film, and the negatives are scanned with the use of an Ultrascan XL laser densitometer and Gelscan XL 2000 software package. The ratio of the density of the competitor RNA to the target RNA is plotted against the amount of the competitor RNA added to each reaction.

All results are expressed as mean ± SEM. A level of P < 0.5 is considered significant. ANOVA is performed to determine statistical differences among multiple groups. When significance is obtained by ANOVA, Fisher's least squares difference post hoc analysis is used to determine pairwise differences. Ramirez et al. (1997) reported that the nuclear δ B isoform of Ca 2+ /calmodulin-dependent protein kinase II regulates atrial natriuretic gene expression in cultured neonatal rat ventricular myocytes. Thuerauf et al. (1998) found that the p38 mitogenactivated protein kinase mediates the transcriptional induction of the atrial natriuretic factor gene through a serum response element and discussed the potential role for the transcription factor ATF6. Kakita et al. (1999) studied p300 protein as a coactivator of the transcription factor GATA-5 in the transcription of cardiac-restricted atrial natriuretic factor gene.

Bianciotti and de Bold (2000) investigated the effect of selective ET A receptor blockade on natriuretic peptide gene expression in DOCA-salt hypertension in rats. Gutkowska et al. (1984) developed a direct radioimmunoassay of atrial natriuretic factor (ANF). The method uses a synthetic 26-amino-acid fragment (8-33 ANF) of the native peptide.

Because 8-33 ANF is a small molecule, it is necessary to covalently conjugate the peptide to a larger protein (bovine thyroglobulin) for immunization. To 50 mg thyroglobulin dissolved in 2 ml distilled water, pH 7.4, 30 mg CDI [1-ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl] is added in 1 ml distilled water, pH 7.4. Then 5 mg 8-33 ANF in water is added dropwise while stirring. The solution is kept overnight at 4°C, then another 30 mg CDI is added and the mixture is kept for 2 h at room temperature with constant stirring. The cloudy mixture is dialyzed for 24 h at 4°C against 0.9% saline. The dialyzed material is then fractionated and stored at -70°C. For immunization, 100 µg of the ANF-thyroglobulin complex are suspended in 1 ml saline, thoroughly mixed with 1 ml complete Freund's adjuvant and injected into the shaved backs of New Zealand white rabbits. Each animal receives also 0.5 ml Bordetella pertussis vaccine subcutaneously with the primary immunization. The animals are reimmunized at monthly intervals with 100 µg of antigen in incomplete Freund's adjuvant and bled by ear artery 10 days after the booster injection.

For iodination, 5 µg ANF in 5 µl 0.01 M ammonium acetate, pH 5.0 is introduced in a 1.5 ml Eppendorf vial followed by the addition of 1 mCi Na 125 I in a volume of 25 µl. Chloramine T 10 µg/10 µl is added to the reaction vial and 30 s later sodium metabisulfide (20 µg/10 µl) is added. Each addition is followed by mixing. Purification of the iodinated tracer is achieved by HPLC on a µBondapax C 18 column, eluted with a linear gradient of 20 to 50% acetonitrile with 0.1% trifluoroacetic acid with a slope of 0.5%/min and a flow rate of 1 ml/ min.

The radioimmunoassay procedure is performed in polystyrene tubes at 4°C by mixing 100 µl of standard or sample, 100 µl of antiserum diluted 1:4000, 100 µl of 125 I-ANF and 300 µl of the same buffer containing 1% BSA. After incubation for 24 h at 4°C the free from antigen-bound 125 I-ANF is separated by dextrancoated charcoal. One ml of dextran-charcoal suspension is added to each tube. After 5 s agitation the tubes are centrifuged at 4000 rpm at 4°C for 10 min. The supernatant is decanted and the radioactivity counted in a gamma counter.

Dose-response curves are prepared and Scatchard analysis is performed.

Radioimmunoassays were also developed for longacting natriuretic peptide and vessel dilator (Vesely et al. 1994; Winters et al. 1989 ). 

Urotensin II is a cyclic peptide originally isolated from the urophysis, the hormone storage-secretion organ of the caudal neurosecretory system of teleost fishes, such as Gillichthys mirabilis (Pearson et al. 1980; Maguire and Davenport 2002) . Several structural forms of urotensin II have been reported in different species ). These peptides show smooth muscle contracting activity. Itoh et al. (1987) reported contraction of major artery segments of rat, especially of the thoracic aorta, by urotensin II.

Human urotensin II is an 11-amino-acid peptide that retains the cyclic portion typical of fish urotensin II. It has been found in vascular and cardiac tissues and is a very potent constrictor of certain human isolated arteries and veins as well as of several vessels of other species Douglas 2003) .

The potency of urotensin II as a vasoconstrictor is an order of magnitude greater than that of endethelin-1, making human urotensin II the most potent vasoconstrictor identified so far.

Human urotensin II is also a potent endothelium-dependent relaxant in rat precontracted arteries (Katano et al. 2000) and in human small pulmonary and systemic abdominal resistance arteries (Stirrat et al. 2001) . Bottrill et al. (2000) found that human urotensin II contracted endothelium-intact rat isolated left anterior descending coronary arteries. The contractile response was significantly enhanced by removal of the endothelium. However, human urotensin II caused concentration-dependent relaxation of 5-HT-precontracted arteries, which was abolished by N-nitro-L-arginine methyl ester (L-NAME) or removal of the endothelium.

Using merino ewes as experimental animals, Watson et al. (2003) found that urotensin II acts centrally to increase epinephrine and adrenocorticotrophic hormone (ACTH) release and causes potent inotropic and chronotropic actions. Coy et al. (2002) investigated structural requirements at the N-terminus of urotensin II octapeptides. Carotenuto et al. (2004) investigated the active conformation of urotensin II by CD spectroscopy and NMR analysis in SDS micelles.

Watson and May (2004) Most studies on urotensin analogs, agonists and antagonists used the isolated thoracic aorta of rats as a pharmacological model (Itoh et al. 1988; Nothacker et al. 1999; Sauzeau et al. 2001; Camarda et al. 2002a; Grieco et al. 2002a Grieco et al. , 2002b Rossowski et al. 2002) . Several urotensin II antagonists have been tested in this model (Behm et al. 2002; Herold et al. 2003) . Patacchine et al. (2003) tested urantide, an ultrapotent urotensin II antagonist peptide, in the rat aorta.

Male albino rats (Wistar strain, 275-350 g) are decapitated under ether anesthesia. The thoracic aorta is cleared of surrounding tissue and excised from the aortic arch to the diaphragm. From each vessel, a helically cut strip is prepared, and then it is cut into two parallel strips. The endothelium is removed by gently rubbing the vessel intimal surface with a cotton-tip applicator; the effectiveness of this maneuver is assessed by the loss of relaxation response to acetylcholine (1 µM) in preparations precontracted with noradrenaline (1 µM). All preparations are placed in 5-ml organ baths filled with oxygenated normal Krebs-Henseleit solution. Motor activity of the strips is recorded isotonically (load 5 mN). A cumulative concentration-response curve to hU-II is constructed on one of the two strips, which serves as control. The other strip receives the antagonist peptide under examination and, after a 30-min incubation period, hU-II is administered cumulatively. Maximal contractile responses of preparations to hU-II are obtained by administration of KCl (80 mM) at the end of the cumulative curves.

Antagonist activity is expressed in terms of pK B (negative logarithm of the antagonist dissociation constant) and, assuming a slope of -1.0, is estimated as the mean of the individual values obtained with the equation: pK B = log[dose ratio-1]-log[antagonist concentration] (Kenakin 1997). Competitive antagonism is checked by the Schild plot method: a plot with linear regression line and slope not significantly different from unity is considered as proof of simple reversible competition (Kenakin 1997). Gibson et al. (1988) studied the influence of urotensin II on calcium flux in rat aorta. Urotensin II caused an increase in uptake of 45 Ca by segments of rat aorta. This increase was abolished by calcium channel blocking drugs. Douglas et al. (2000) found differential vasoconstrictor activity of human urotensin II in vascular tissue isolated from the rat, mouse, dog, pig, marmoset and cynomolgus monkey depending on species and anatomical localization. Camarda et al. (2002b) studied the effects of human urotensin II in isolated vessels (aorta, large arteries, veins) of various species (rats, guinea pigs, rabbits, pigs, human) and compared them with other vasoactive agents (noradrenaline, angiotensin II, endothelin I). Watanabe et al. (2001) found a synergistic effect of urotensin II with serotonin on rabbit vascular smooth muscle cell proliferation. Tamura et al. (2003) examined the effects of urotensin II on activation of extracellular signal-regulated kinase and focal adhesion kinase in cultured vascular smooth muscle cells. Tzanidis et al. (2003) studied direct actions of urotensin II on the heart in a rat model of heart failure after myocardial infarction and the implications for cardiac fibrosis and hypertrophy. Matsushita et al. (2003) showed that urotensin II is an autocrine/paracrine growth factor for the porcine renal epithelial cell line LLCPK1. Behm et al. (2004) investigated the role of urotensin II in the etiology of essential hypertension. Intravenous injection in anesthetized cats induced an increase in systemic blood pressure and peripheral vascular resistance. , USA), are exposed to excitation (488 nm) from a 6-W argon laser. Fluorescence is monitored at 566 nm emission for all 96 wells simultaneously, and data are read every 1 s for 1 min and then every 3 s thereafter. Agonist is added after 10 s and concentration-response curves are obtained by calculating the maximal fluorescence counts above background after the addition of each concentration of agonist. For antagonist studies, BIM-23127 (Bachem, King of Prussia, Pa., USA) is added 10 min prior to the addition of hU-II (California Peptide Research, Napa, Calif., USA).

Concentration-response curves are analyzed by nonlinear regression using GraphPad Prism 3.0 software (GraphPad, San Diego, Calif., USA).

Flohr et al. (2002) (2002) used a functional mammalian cell-based R-SAT assay (ACADIA Pharmaceuticals, San Diego, Calif., USA) to identify non-peptide agonists of the CRP14/urotensin II receptor in highthroughput screening. According to Shapiro et al. (2002) NIH-3T3 cells were grown in 96-well tissue culture plates to 70%-80% confluence in Dulbecco's modified Eagle's medium supplemented with 10% calf serum and 1% penicillin/streptomycin/Gln. Cells were transfected for 12-16 h with plasmid DNAs using Superfect Reagent (Qiagen, Valencia, Calif., USA) according to the manufacturer's protocols. R-SATs were performed with 0.5-50 ng/well receptor and 20 ng/well β-galactosidase plasmid DNA. After overnight transfection, medium was replaced with serum-free Dulbecco's modified Eagle's medium containing 2% cyto-sf3 (Kemp Biotechnologies, Frederick, Md., USA) and 1% penicillin/streptomycin/Gln and varying concentrations of drug. Cells were grown in a humidified atmosphere with 5% ambient CO 2 for 4-6 days. Medium was removed from the plates, and β-galactosidase activity was measured by the addition of o-nitrophenyl β-D-galactopyranoside (in phosphate-buffered saline with 5% Nonidet P-40 detergent). The resulting colorimetric reaction was measured using a spectrophotometric plate reader (Titertek, Huntsville, Ala., USA) at 420 nM. For HTS, NIH-3T3 cells transiently transfected with the urotensin II receptor expression vector and plasmid were frozen and for the assay thawed, plated and exposed to drug. 

The G-protein-coupled receptor GPR14/SENR was described by Marchese et al. (1995) and Tal et al. (1995) . Liu et al. (1999) and Mori et al. (1999) identified urotensin II as the endogenous ligand for the orphan G-protein-coupled receptor GPR14. It was renamed as urotensin II (UT) receptor by UPHAR (Douglas and . Human, rat, mouse and monkey receptors have been cloned. The amino acid sequence identity of the monkey UT receptor is 97% and 77% identical to the human and rat sequences respectively, while the mouse UT receptor is 76% and 93% identical to the human and rat sequences, respectively. Brkovic et al. (2003) performed functional and binding characterizations of urotensin-II-related peptides in human and rat urotensin II receptor assays.

The following fluorenylmethyloxycarbonyl-protected amino acids were purchased from Chem-Impex International (Wood Dale, Ill., USA): Ala, Cys(Trt), His(Trt), Phe, Trp, Lys-(Boc), Tyr(tBu), Asp(OtBu), Glu(OtBu), Pro, Gln(Trt), Thr(tBu), Arg(Pbf), Orn(Boc), HomoCys(Trt), Cys(Acm), and D-Trp. Biograde TFA was obtained from Halocarbon (River Edge, N.J., USA). Diisopropylethylamine was from Aldrich (Milwaukee, Wis., USA). Wang resin and benzotriazol-1-yl-oxy-tris(dimethylamino)-phosphonium hexafluorophosphate were purchased from Albatross (Montreal, QC).

Basal ISCOVE medium and fetal calf serum (FCS) were from Biochrom (Berlin, Germany). The GC-melt PCR kit as well as the human and rat genomic DNA were purchased from CLONTECH (Palo Alto, Calif., USA). The pEAK8 mammalian episomal expression vector and the selection marker puromycin were from Edge Biosystems (Gaithersburg, Md., USA). Dulbecco's modified Eagle's medium (DMEM), L-glutamine, HEPES, LipofectAMINE reagent, and penicillin-streptomycin were from Invitrogen (Carlsbad, Calif., USA). The pCDNA3.1(+) mammalian expression vector was from Invitrogen. The calcium-sensitive fluorescence dye Fluo-4 and Pluronic F-127 were obtained from Molecular Probes (Eugene, Ore., USA). Flashplates PLUS and monoiodinated human [ 125 I-Tyr9]urotensin II for radioligand binding assays were from Perkin Elmer Life Sciences (Boston, Mass., USA). Gentamicin, the transfection reagent FuGene 6, and Complete protease inhibitor were purchased from Roche (Basel, Switzerland). Bacitracin, EDTAdisodium salt, probenecid, MgCl 2 , NaCl, and sucrose were obtained from Sigma-Aldrich (St. Louis, Mo., USA).

As the putative human urotensin II receptor sequence is intronless, this protein was cloned from human genomic DNA via PCR. PCR conditions, established to amplify the human GPR14 sequence, were 94°C; 10 min followed by 35 cycles of 94°C, 1 min, 60°C, 1 min, 72°C, and 2 min using the GC-melt kit. Primers designed to amplify the coding sequence contained a BamHI site in the forward and a XbaI site in the reverse primer, respectively. The urotensin receptor coding region, flanked by BamHI/XbaI sites, was cloned into the pCDNA3.1(+) mammalian expression vector and sequenced in both directions. For generation of stable cell lines, the human U-II receptor coding sequence flanked by a 5 EcoRI site and a 3 EcoRV site was cloned into the mammalian episomal expression vector pEAK8.

The rat U-II receptor coding sequence flanked by a 5 EcoRI and 3 NotI site was amplified via PCR from rat kidney cDNA and cloned into the mammalian pEAK8 expression vector. Sequences of all urotensin-II-receptor-expressing plasmids were verified by dideoxy sequencing in both directions.

CHO K1-cells were grown in basal ISCOVE medium supplemented with 10% FCS, 2 mM L-glutamine, penicillin-streptomycin (10,000 IU/ml -10,000 µg/ml), and 25 mg/ml gentamicin at 37°C in a humidified 5% CO 2 incubator. Cells were transiently transfected with the U-II receptor cDNAs using the LipofectAMINE reagent according to the manufacturer's protocol. After 18-24 h following the transfection, cells were split into blackwalled 96-well plates at a density of 50,000 cells/well and cultured for an additional 18-to 24-h period before being used in the functional fluorescence imaging plate reader (FLIPR) assay (described below in detail) measuring intracellular Ca 2+ release upon receptor activation.

Cells were loaded in 96-well plates for 1 h (37°C, 5% CO 2 ) with 100 µl of PBS (without Ca 2+ , Mg 2+ and NaHCO 3 ) containing 4 µM of the fluorescent calcium indicator Fluo-4, 0.22% Pluronic F-127 in dimethyl sulfoxide, 2.5 mM probenecid, 1 mM EGTA, and 1% FCS. Cells were then washed three times with PBS (without Ca 2+ , Mg 2+ and NaHCO 3 ) containing 1 mM EDTA, 0.5 mM MgCl 2 , and 2.5 mM probenecid. After the final wash, a 100-µl residual volume remained on the cells. Peptides were aliquoted as 2 × solutions in 96-well plates and transferred by the instrument from the ligand plate to the cell plate. Fluorescence was recorded with the fluorometric imaging plate reader FLIPR (Molecular Devices, Sunnyvale, Calif., USA) over a period of 3 min. Fluorescence was recorded simultaneously in all wells at 3-s intervals during the first minute and at 10-s intervals during the last 2 min. Fluorescence data were generated in duplicate and repeated at least three times.

For the generation of stable cell lines expressing the human and rat urotensin II receptor, HEK293 cells were transfected with human-and rat-pEAK8 constructs using the FuGene 6 transfection reagent according to the supplier's protocol. Two days after transfection, cells were selected in DMEM, supplemented with 10% FCS, 20 mM HEPES, penicillin-streptomycin (10,000 IU/ml -10,000 µg/ml), and 1 µg/ml puromycin for a period of 4 weeks (37°C, 5% CO 2 , 95% relative humidity). Functional activity of the urotensin-II-receptor-expressing cell population was verified with a FLIPR assay recording urotensin-II-mediated intracellular Ca 2+ release, as described above.

HEK293 cells stably expressing human or rat urotensin II receptors were cultured up to 80% confluency in DMEM, supplemented with 10% FCS, 20 mM HEPES, penicillin-streptomycin (10,000 IU/ml -10,000 µg/ml), and 1 µg/ml puromycin (37°C, 5% CO 2 , 95% relative humidity). Cells were washed once with ice-cold PBS and a second time with PBS containing the protease inhibitor cocktail (Complete). Cells were scraped off and centrifuged gently. The pellet was resuspended in a buffer containing 5 mM HEPES, 1 mM EDTA-disodium salt, and the cocktail of protease inhibitor Complete and then incubated on ice for 15 min. Cells were pelleted again and resuspended with a homogenizer (Unit F8B, Constant cell disruption systems; Honiley, Warwickshire, UK). The supernatant and resuspended pellet were combined and centrifuged at 50,000 g (Beckman Avanti J251). The cell membrane pellet was resuspended in a buffer consisting of 20 mM HEPES, 1 mM EDTA-disodium salt, 150 mM NaCl, and 10% sucrose. Membrane aliquots were stored at -80°C. One day before the binding assay, membranes were thawed, pelleted, and resuspended in the assay buffer consisting of 20 mM HEPES, 150 mM NaCl, 1 mM EDTA-disodium salt, 160 µg/ml bacitracin, and Complete protease inhibitor (two tablets per 100 ml).

Membranes were distributed into 96-well wheatgerm-agglutinin Flashplates PLUS, incubated overnight for adsorption, and then the Flashplates PLUS were washed twice with the assay buffer. For equilibrium binding assays, 0.2 nM human [ 125 I-Tyr9]urotensin II (initial specific activity 2200 Ci/ mmol, or 81,400 GBq/mmol) was incubated with the indicated amounts of unlabeled competitors for 4 h and radioactivity counted in a 1450 Microbeta Wallac Jet (Wallac, Turku, Finland).

Data of the FLIPR assay were analyzed by non-linear curve fitting using GraphPad Prism version 3.0 (GraphPad Software, San Diego, Calif., USA).

Non-specific binding was determined in the radioligand binding assays in the presence of 10 µM human U-II and corresponded to 31 ± 2% (n = 5, mean ± SEM) of the total binding for membranes expressing the human urotensin II receptor and to 8 ± 1% (n = 5, mean ± SEM) of the total binding for membranes expressing the rat urotensin II receptor. Data analysis was performed with GraphPad Prism 3.0. Flohr et al. (2002) identified non-peptide urotensin II receptor antagonists by virtual screening on a phamacophore model derived from structure-activity relationships and nuclear magnetic resonance studies on urotensin II.

The UT receptor is expressed in vascular tissue (Ames et al. 1999; Maguire et al. 2000) . A direct link between U-II, the UT receptor and vasoconstriction has to be assumed (Ames et al. 1999; Douglas and Ohlstein 2001) . Behm et al. (2003) used homologous recombination in embryonic stem (ES) cells to generate mice lacking the UT receptor coding region to determine the effect(s) of this receptor on vascular reactivity both in vivo and in vitro and to verify that U-II exerts its effects on vascular smooth muscle tone via an interaction with UT.

Gene targeting was performed in murine E14.1 ES cells, replacing the single coding exon of the UT receptor locus with a positive selection cassette containing the neomycin phosphotransferase gene (Neo) driven by the phosphoglycerate kinase I (PGK) promoter. 5 -and 3 -homology arms, both of ∼4.0 kb, were cloned from a 129SVJ mouse genomic bacterial artificial chromosome (BAC) library and placed on either side of the positive selection cassette. Homologous recombination in neomycin-resistant ES cells was confirmed by Southern blot of BamHI-digested genomic DNA using an ∼800-bp BamHI/ SmaI restriction fragment as the 5 external probe (which detects 6.5-and 6.0-kb bands at the wild-type and targeted locus, respectively). Approximately 1 in 80 G418-resistant clones had undergone homologous recombination. Homologous recombination at the 3 end was confirmed in these ES cell clones by Southern blot of HindIII-digested genomic DNA using a ∼700-bp XmnI/HindIII restriction fragment as the 3 -external probe (which detects 5.5-and 5.0-kb bands at the wildtype and targeted locus, respectively). Three targeted clones were injected into C57B16/J-derived blastocysts. Male chimeras were crossed with C57B16/J females to give N1F0 offspring, which were subsequently intercrossed to generate N1F1 offspring. In addition, N1F0 offspring were successively backcrossed to C57B16/J females to generate N5F0 mice. These were intercrossed to create an N5F1 population.

N1F1 and N5F1 study populations were genotyped by polymerase chain reaction (PCR) and Southern blot of genomic DNA isolated from the hearts of animals used in the studies. Hearts of wild-type (UT (+/+) ) and UT receptor knockout (UT (-/-) ) mice were cut into small pieces (∼1 mm) and placed into polypropylene tubes. Extraction buffer [2 ml; 10 mM Tris-HCl pH 8.0, 50 mM NaCl, 100 mM ethylenediaminetetraacetic acid (EDTA), 0.5% SDS, 20 µg ml −1 RNase, 100 µg ml −1 proteinase K] was added and samples were incubated at 50°C-55°C for 4 h until completely lysed. The mixture was then extracted two times each with phenol, phenol/chloroform and chloroform (Maniatis et al. 1989) . Genomic DNA was precipitated by adding 2.5 vols of cold ethanol, washed with 70% v/v ethanol (-20°C) and dissolved in 200 µl of 10 mM Tris-HCl, 1 mM EDTA TE, pH 8.0. Once dissolved, the purity and concentration of the DNA were measured by spectrophotometry (absorbency at 260 and 280 nm wavelength).

PCR amplification was performed using 50-µl aliquots (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 17 mM MgCl 2 , 200 nM 2 -deoxynucleotide 5triphosphates (dNTPs), 10% v/v dimethylsulfoxide, 1.25U Taq DNA polymerase; (Perkin-Elmer, Norwalk, Conn., USA) using 200 ng of genomic DNA as the template and PCR primers specific to the neomycin resistance gene present at the targeted locus (5 -TGA ACA AGA TGG ATT GCA CGC AGG TTC TCC GGC-3 and 5 -GCC AAG CTC TTC AGC AAT ATC ACG GGT AGC-3 , yielding an ∼700-bp product)) and mouse UT gene-specific primers (5 -CTG GCT GAC CTG CTG TAT CTG CT-3 and 5 -CAG GGT CAC ACA AAG CAC TCT CA-3 , yielding an ∼900-bp product). A 500-bp mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplicon was used as the internal control (5 -TGG CCA AGG TCA TCC ATG AC-3 and 5 -GTC CAC CAC CCT GTT GCT GTA G-3 , yielding an ∼500-bp product). Amplification was performed for 30 cycles at 60°C annealing for 30 s, 72°C extension for 90 s and 94°C denaturing for 30 s. Amplification of a 500-bp (GAPDH)/700-bp doublet alone corresponded to a UT (-/-) genotype and a 500-bp (GAPDH)/900-bp doublet alone corresponded to a UT (+/+) genotype.

Genomic DNA (20 µg) was digested with BamHI and run on an agarose gel (1%). The agarose gel was then treated with denaturing solution (0.5 M NaOH, 1.5 M NaCl) for 45 min, followed by neutralization with 0.5 M Tris-HCl (pH 7.5), 1.5 M NaCl for 30-40 min. The DNA was transferred to a nylon membrane (GeneScreen Plus, NEN Life Science Products, Mass., USA) and probed with cDNA corresponding to the full-length mouse UT receptor open reading frame (ORF). cDNA fragments were labeled with [α-32 P] 2 -deoxycytidine 5 -triphosphate (dCTP) using standard random primed methods (T7 Quick-Prime; Pharmacia Biotech, Piscataway, N.J., USA). Membranes were prehybridized for 2 h at 42°C and incubated overnight at 42°C with 1 × 10 9 cpm µg −1 denatured radiolabeled probe in standard buffer [50% deionized formamide, 6 × sodium chloride, sodium citrate (SSC), 5 × Denhardt's reagent, 0.5% sodium dodecyl sulfate (SDS), 100 µg ml −1 denatured, fragmented salmon sperm DNA]. Membranes were washed under conditions of low stringency (three 15-min washes in 1 × SSC, 0.1% SDS at 28°C) followed by a high stringency wash in 0.1 × SSC/0.1% SDS for 30 min at 55°C. Hybridization signals were detected by conventional X-ray autoradiography (Hyper film, Amersham Life Science, UK) and phosphor imaging (Storm 860, Molecular Dynamics, Sunnyvale, Calif., USA).

Male wild-type (UT (+/+) ) and homozygous UT receptor knockout (UT (-/-) ) mice, anesthetized with 1.5% isoflurane, underwent transthoracic echocardiographic determination of left ventricular end-diastolic volume (EDV), end-systolic volume (ESV), stroke volume (SV), cardiac output (CO) and ejection fraction (EF). Further to this, mice were re-anesthetized the following day for hemodynamic evaluation where a fluidfilled catheter was inserted into the left carotid artery for the measurement of mean arterial blood pressure (MAP) and heart rate (HR). The catheter was then advanced into the left ventricle (LV) to obtain measurements of left ventricular end-systolic (LVESP) and end-diastolic pressure (LVEDP). At the end of the study, selected organs (right and left kidney, heart, right and left ventricle and lungs) were isolated and wet weights were measured.

Male (4 months; 27 g) wild-type (UT (+/+) ) and UT receptor knockout (UT (-/-) ) mice were anesthetized with inhaled isoflurane (5% in O 2 ) and killed by cervical dislocation. Proximal descending thoracic aortae were isolated and cleaned of adherent tissue. Vessels approximately 3 mm in length were suspended in 10-ml organ baths containing Krebs solution of the following composition (mM): NaCl 112.0, KCl 4.7, KH 2 PO 4 1.2, MgSO 4 1.2, CaCl 2 2.5, NaHCO 3 25.0, dextrose 11.0. Krebs solution was maintained at 37 ± 1°C and aerated with 95% O 2 , 5% CO 2 (pH 7.4). For contraction studies, vessels were denuded of endothelium by rubbing with a fine forceps and indomethacin (10 mM) was added to the buffer. Changes in isometric force were measured under 0.5 g optimal resting tension using FT03 force-displacement transducers (Grass Instruments, Quincy, Mass., USA) coupled to Model 7D polygraphs.

The Halpern-Mulvany wire myograph (Model 610M; Danish Myo Technology, Denmark) was used for measurement of isometric force development of endothelium-intact superior mesenteric arteries (optimal resting tension of 0.5 g) and data were recorded using a Grass 7400 direct thermal recorder.

Following a 60-min equilibration period, vessels were treated with standard concentrations of KCl (60 mM) and phenylephrine (1 mM) to which subsequent agonist-induced responses were normalized.

Once the contractile response to phenylephrine had plateaued, carbachol (10 µM) was added to the vessels in order to evaluate endothelial integrity.

Cumulative concentration-response curves to phenylephrine (0.1 nM to 10 µM), angiotensin II (0.1 nM to 10 µM), endothelin-1 (0.1 nM to 1 mM) and hU-II (0.01 nM to 3 µM) were obtained for each vessel by adding the spasmogen to the tissue bath in half-log increments. During relaxation studies, vessels were preconstricted with an EC 80 concentration of phenylephrine and contractile tone was reversed by adding cumulative amounts of carbachol (1 nM to 30 µM) or sodium nitroprusside (0.1 nM to 1 µM). Each response was allowed to plateau before the addition of subsequent agonist concentrations. Vessels were allowed to recover for at least 30 min between subsequent agonist-response curves, and were not exposed to subsequent agonists after treatment with either endothelin-1 or hU-II.

All values are expressed as mean ± SEM and n represents the total number of animals from which the vessels were isolated. Statistical comparisons were made using an unpaired, two-tailed t-test or Fisher's exact tests and differences were considered significant when P < 0.05. Concentration-response curves were fitted to a logistic equation as previously described (Douglas et al. 1995) . Coulouarn et al. (1998) reported cloning of the cDNA encoding the urotensin II precursor (Prepro-UII cDNA) in frog and human. Intense expression of the urotensin gene in motoneurons of the spinal cord was found indicating important physiological functions of urotensin II.

Elshourbagy et al. (2002) reported molecular and pharmacological characterization of genes encoding urotensin II peptides and their cognate G-protein-coupled receptors from the mouse and monkey. Monkey and mouse preproU-II genes were identified to encode 123 and 125 amino acids. Monkey and mouse UT receptors were 389, and 386 amino acids, respectively. Expression of mouse and monkey U-II/UT receptor mRNA was found also in extravascular tissues, including lung, pancreas, skeletal muscle, kidney and liver. (1993) , sharing close identity to the angiotensin receptor. In rats, the greatest expression of APJ mRNA was detected in the lung, suggesting that APJ and its ligand play an important role in the pulmonary system (Hosoya et al. 2000) . Cloning, pharmacological characterization and brain distribution of the rat apelin receptor were reported by De Mota et al. (2000) , and the physiological role of apelin and its receptor in rat brain by Reaux et al. (2001) . The hypothalamic and hypophyseal distribution of the receptor suggested an involvement of apelin in the control of neuro-and adenohypophyseal hormone release, whereas the presence in the pineal gland and in discrete higher brain structures pointed to possible roles in the regulation of circadian rhythms and of water and food intake behavior.

Studying the distribution of apelin-synthesizing neurons in the adult rat brain, Reaux et al. (2002) Boucher et al. (2005) found in isolated mouse and human adipocytes that apelin is upregulated by insulin and obesity. (2000). Ashley et al. (2005) found that apelin improves cardiac contractility and reduces cardiac loading in vivo in mice.

Male C57Bl/ 6 mice were used. The following studies were performed: magnetic resonance imaging of the heart, pressure-volume hemodynamics, effects of chronic apelin infusion, assessment of ventricular hypertrophy after sacrifice, and expression of the APJ receptor.

Pressure-volume hemodynamics were assessed using the Aria system (Millar Instruments, Houston, Tex., USA), This measurement platform, specifically designed for small rodents, comprises an ultra-miniature 1.4 F (0.47 mm outer diameter) catheter, which incorporates pressure and conductance sensors, possessing hardware including analog-digital conversion and analysis software. Pressure is measured directly in mmHg, while the conductivity of blood is used to estimate volume and allow construction of pressure-volume relationships in real time.

Male mice aged 8-16 weeks were anesthetized with 1%-2% isoflurane in oxygen. The internal jugular vein was cannulated with PE tubing and a 10% albumin solution infused at 5 µl/min following a bolus of 150 µl over 5 min. After tracheostomy, a 19gauge cannula was inserted into the trachea and the animal was ventilated at a tidal volume of 200 µl at 100 breaths per minute. Following an incision just dorsal to the xyphoid cartilage, the diaphragm was visualized from below, and after diaphragmatic incision, the left ventricular apex was visualized. The pressure-volume catheter was inserted along the long axis of the left ventricle, from where it was adjusted to obtain rectangular-shaped pressure-volume loops. Baseline loops were recorded following volume replacement, at which point the inferior vena cava was visualized within the chest and occlusion parameters were recorded during and after a 5-s manual occlusion of the vessel. Next, the albumin solution was replaced by one containing 100 nM apelin, which was infused at 5 µl/min for 20 min, following which baseline and occlusion loops were recorded once again.

Signals from the catheter were digitized using the Powerlab system and stored for offline analysis using the PVAN software. This allows analyses of pressure (e. g., end-systolic pressure, end-diastolic pressure) and derivation of pressure-time and volume-time parameters at steady state.

For magnetic resonance imaging, male C57Bl/6 mice aged 16 weeks were scanned twice on subsequent days. The animals underwent general anesthesia while breathing spontaneously via a nose cone fitted carefully to minimize escape of anesthetic into the environment. Two percent isoflurane was adminis-tered with an oxygen flow rate of 1-2 l/min. Platinum needle ECG leads were inserted subcutaneously. Respiration was monitored by means of a pneumatic pillow sensor positioned against the abdomen. Mouse body temperature was maintained during scanning at 37°C by a flow of heated air thermostatically controlled by a rectal temperature probe. Magnetic resonance images were acquired on a 4.7 T Oxford magnet controlled by a Varian Inova console (Varian, Palo Alto, Calif., USA) using a transmit-receive, quadrature, volume coil with an inner diameter of 3.5 cm. Image acquisition was gated to respiration and to the ECG R wave (SA Instruments, Stony Brook, N.Y., USA). Coronal and sagittal scout images led to the acquisition of multiple contiguous 1-mm-thick, short axis slices orthogonal to the interventricular septum. Nine cine frames were taken at each slice level with the following sequence parameters: TE = 2.8 ms, NEX = 12, FOV = 3 × 3 cm, matrix = 128 × 128, flip angle = 60°. Cine frames were spaced 16 ms apart and acquired through slightly more than one cardiac cycle guaranteeing acquisition of systole and diastole. On the second day of scanning, mice received 300 µg/kg body weight of apelin as an intraperitoneal injection 1 h prior to scanning. A pilot study had previously identified 1 h as an appropriate time within which to identify apelin effects resulting from peritoneal absorption. Planimetry measurements of end-diastolic and end-systolic dimensions were derived offline from short axis views of the left ventricle at the level of the papillary muscles using ImageJ software (National Institutes of Health, Bethesda, Md., USA). Ejection fraction was calculated as [LVEDA-LVESA]/LVEDA, where LVEDA is left ventricular end-diastolic area and LVESA is left ventricular end-systolic area.

Data were analyzed using Student's t statistic (paired) or repeated measures analysis of variance using the post hoc comparison of Fisher. Katugampola et al. (2001 Katugampola et al. ( , 2002 described [ 125 I](Pyr 1 )apelin as a radioligand for localizing the APJ orphan receptor in human and rat tissues. Kasai et al. (2004) found that apelin worked as an angiogenic factor in the retinal endothelial cell line RF/6A. The transient receptor potential (TRP 1 ) ion channels are named after the role of the channels in Drosophila phototransduction (Montell 2001). The mammalian genes are encoded by at least 28 channel subunit genes (Clapham 2003; Moran et al. 2004; Clapham et al. 2005) . Six protein families comprise the mammalian TRP superfamily: the classic TRPs (TRPCs), the vanilloid receptor TRPs (TRPVs), the melastatin or long TRPs (TRPMs), the mucolipins (TRPMLs), the polycystins (TRPPs), and ankyrin transmembrane protein 1 (ANKTM1, TRPA1). The TRP channel primary structures predict six transmembrane (TM) domains with a pore domain between the fifth (S5) and sixth (S6) segments and both C and N termini presumably located intracellularly (Vannier et al. 1998 ).

The TRP superfamily includes > 20 related cation channels that play critical roles in processes ranging from sensory physiology to vasorelaxation and male fertility. Defects in TRP channels have been associated with changes in growth control and one TRP-related protein may be a tumor suppressor. Moreover, mutations in a member of the TRP superfamily are a common cause of polycystic kidney disease, while disruption of another is responsible for mucolipidosis, a neurodegenerative disease. TRP proteins are widely expressed in the nervous system, and, in non-excitable cells, TRP-related channels may be the primary mode of Ca 2+ entry. TRP proteins are cation channels; however, they vary significantly in their selectivity and mode of activation. Nevertheless, members of the TRP superfamily share significant sequence homology and predicted structural similarities.

Based on primary amino acid homology, the conventional TRP proteins can be classified into three subfamilies: TRPC, TRPV, and TRPM (Birnbaumer et al. 2003) . Three additional, more distantly related subfamilies have recently been defined: ANKTM1, a Ca 2+ -permeant, non-selective cation channel, is the only mammalian member of the TRPA branch of TRP proteins. It is activated by noxious cold temperature, pungent mustard oil compounds and may additionally serve as a mechanosensitive transduction channel in auditory hair cells as well as an ionotropic cannabinoid receptor. The three mucolipins, TRPML1, 2, and 3, appear to be ion channels in intracellular vesicles. Mutations in TRPML1 cause mucolipidosis type IV, a neurodegenerative lysosomal storage disorder, while genetic defects in TRPP2, a member of the TRPP subfamily, are frequently encountered in patients suffering from autosomal dominant polycystic kidney disease.

Albert AP, Large WA (2003) The TRPC family can be divided into three subgroups by sequence homology as well as functional similarities: C1/C4/C5, C3/C6/C7, and C2. TRPC1 was the first member of the mammalian TRP family purported to form an ion channel (Zitt et al. 1996) . Given the widespread expression of TRPC1 and its ability to coassemble with other TRPC subunits (Xu et al. 1997; Lintschinger et al. 2000; Strübing et al. 2003) , TRPC1 might be a component of different heteromeric TRP complexes. The subgroup most closely related to TRPC1 comprises TRPC4 and TRPC5. TRPC4 and TRPC5 are PDZ motif-containing proteins that can form homomeric cation channels that are activated following stimulation of G q -coupled receptors (Okada et al. 1999 ) as well as receptor tyrosine kinases (Schaefer et al. 2000) . Xu and Beech (2001) found that TRPC1 is a membrane-spanning subunit of store-operated Ca 2+ channels in native vascular smooth muscle cells.

Vandebrouck et al. (2002) described involvement of TRPC in the abnormal calcium influx observed in dystrophic (mdx) mouse skeletal muscle fibers. Venkatachalam et al. (2003) discussed regulation of canonical transient receptor potential (TRPC) channel function by diacylglycerol and protein kinase C. Bergdahl et al. (2003) found that cholestrerol depletion impairs vascular reactivity to endothelin-1 by reducing store-operated Ca 2+ entry dependent on TRPC1.

Amiri et al. (2003) published FRET-based analysis of TRPC subunit stoichiometry. Jho et al. (2005) reported that angiopoietin-1 opposes VEGF-induced increase in endothelial permeability by inhibiting TRPC1-dependent Ca 2+ influx. Rao and Kaminski (2006) found that induction of intracellular elevation by 9 -tetrahydrocannabinol in T cells involves TRPC1 channels. Takai et al. (2004) distinguished two types of nonselective cation channels by muscarinic stimulation with carbachol in bovine muscle cells. Kumar et al. (2006) studied upregulated TRPC1 channel in vascular injury in vivo and its role in human neointimal hyperplasia.

Less information is available about TRPC2, which shares approximately 30% sequence identity with the TRPC3/6/7 subfamily. Full-length TRPC2 mRNA and several N-terminal splice variants have been found in mouse and rat tissue, but TRPC2 seems to be a pseudogene in humans (Vannier et al. 1999; Liman 2003) . TRPC2 protein was localized to neuronal micovilli in rat vomeronasal organ (Liman 2003) and in the head of mouse sperm (Jungnickel et al. 2001) .

TRPC3, TRPC6, and TRPC7 are 75% identical. When expressed they constitute non-selective cation currents that rectify in both the inward (-voltages) and outward (+ voltages) directions. TRPC3, TRPC6, and TRPC7 are inwardly and outwardly rectifying, have relatively low selectivity for Ca 2+ over Na + , and are ac-tivated by diacylglycerol (DAG) (Hofmann et al. 1999; Okada et al. 1999; Putney et al. 2004 ). These channels seem to play important roles in vascular and airway smooth muscle (Trebak et al. 2003; Yu et al. 2003; Corteling et al. 2004) .

Groschner and Rosker C (2005) described TRPC3 as a versatile transducer molecule that serves integration and diversification of cellular signals. Graziani et al. (2006) investigated the potential role of membrane cholesterol as a regulator of cellular TRPC3 conductance.

Smyth et al. (2006) found a dissociation of regulated trafficking of TRPC3 channels in the plasma membrane from their activation by phospholipase C.

TRPC4 and TRPD5 are receptor-operated Ca 2+permeable non-selective cation channels (Plant and Schaefer 2003) . Odell et al. (2005) found that epidermal growth factor induces tyrosine phosphorylation, membrane insertion and activation of transient receptor potential channel 4.

Saleh et al. (2006) described that angiotensin II activates two cation channels with distinct TRPC1 and TRCP6 channel properties in rabbit mesenteric artery myocytes. Shimizu et al. (2006) reported that Ca 2+calmodulin-dependent myosin light chain kinase is essential for activation of TRPC5 channels expressed in HEK293 cells. Shi et al. (2004) described multiple regulation by calcium of murine homologs of transient receptor potential proteins TRP6 and TRP7 expressed in HEK293 cells. Xu et al. (2006) identified sphingosine-1-phosphate as an activator of the calcium channel TRPC5, which controls vascular smooth muscle activity. Estacion et al. (2004) studied activation of human TRPC6 channels by receptor stimulation. Basora et al. (2003) reported that 20-hydroxyeicosatetraenoic acid (20-HETE) activates mouse TRPC6 channels expressed in HEK293 cells. Maruyama et al. (2006) found that heteromultimeric TRPC6-TRPC7 channels contribute to arginine vasopressin-induced cation current of A7r5 vascular smooth muscle cells. (2004a, 2004b) reported inhibition of TRPM2 channels by the antifungal agents clotrimazole and econazole as well as by flufenamic acid; Kraft et al. (2006) by N-(p-amylcinnamoyl)anthranilic acid.

Identified first by sequencing projects, the function of TRPM3 is poorly understood. The hTRPM3 gene maps to human chromosome 9q-21.12 and encodes a 1555-amino-acid protein.

TRPM4 and TRPM5 have similar characteristics. TRPM4b, a splice variant of TRPM4, and TRPM5 are Ca 2+ -activated, voltage-modulated, monovalent-selective cation channels with 25-pS single-channel conductances (Launay et al. 2002; Hofmann et al. 2003; Nilius et al. 2003) . Pérez et al. (2003) studied the ion channel TRPM5 in taste receptor cells.

TRPM6 and TRPM7 comprise a unique subfamily of TRP proteins with both channel and kinase activities. TRPM7, which has 1863 amino acid residues, was identified in a yeast two-hybrid screen as a protein interacting with phospholipase C (PLC) (Runnels et al. 2001; Schmitz et al. 2003) . It seems to be ubiquitously expressed. Takezawa et al. (2004) described receptormediated regulation of the TPRM7 channel through its endogenous protein kinase domain.

TRPM8 is a 1104-amino-acid protein that does not seem to contain associated enzymatic domains. TRPM8 is a non-selective, voltage-modulated conductance. At colder temperatures (8 o C-28°C) or in the presence of menthol, TRPM8 current is activated at a more physiological range of voltages (Brauchi et al. 2004; Voets et al. 2004 ). This channel is expressed in small-diameter primary sensory neurons, where it presumably functions as a thermosensor (McKemy et al. 2002; Peier et al. 2002) . The TRPV subfamily is named after the first mammalian member of the subfamily, vanilloid receptor 1 (Caterina et al. 1997; Benham et al. 2002; Montell et al. 2002; Clapham 2003; Mutai and Heller 2003) . TRPV5 and TRPV6 are highly Ca 2+ -selective TRP channels that mediate trans-epithelial Ca 2+ transport in kidney and intestine (Hoenderop et al. 2003) .

The TRPV channel subfamily has six members divided into two groups: V1/V2/V3/V4 and V5/V6. The vanilloid receptor, TRPV1, is the best understood ion channel in this class (Caterina et al. 1997; Caterina and Julius 2001) .

TRPV channels as temperature sensors were reviwed by Benham et al. (2003) .

The expressed TRPV1 capsaicin receptor is a heat/proton/lipid/voltage-modulated Ca 2+ -permeant (P Ca /P Na 10) ion channel. A more voltag-gatingcentric explanation is that at warmer temperatures (> 37°C) or in the presence of capsaicin, TRPV1 current is activated by a more physiological range of voltages (Brauchi et al. 2004 ). TRPV1 is desensitized by internal Ca 2+ ; it is not activated by store depletion. TRPV1, V2, and V3 are activated by the synthetic compound 2-aminoethoxydiphenylborate (2-APB) (Chung et al. 2004; Hu et al. 2004) . Endogenous cannabinoid receptor ligands, such as anandamide, are potential TRPV1 agonists.

The vanilloid receptor-like channel TRPV2 is 50% identical to TRPV1, but is insensitive to capsaicin (Caterina et al. 1999) . Like TRPV1 it is more permeable to Ca 2+ than to Na + (P Ca /P Na = 3:1). It has been proposed to mediate high-threshold noxious heat sensation, perhaps in the lightly myelinated A nociceptors, but its presence in non-sensory tissue suggests other functions as well.

TRPV3 is expressed widely but most strikingly in skin. Increasing temperature from 22 to 40°C in mammalian cells transfected with hTRPV3 elevates intracellular calcium by activating a non-selective cationic conductance (P Ca /P Na 10:1) (Peier et al. 2002; Smith et al. 2002; Xu et al. 2002) . As in sensory neurons, the current is steeply dependent on temperature, sen-sitizes with repeated heating, and displays a striking hysteresis on heating and cooling, but the extent of expression in sensory neurons is controversial. Based on these properties, TRPV3 is thermosensitive in the physiological range of temperatures between TRPM8 and TRPV1 and may play a role in pain.

TRPV4 is 40% identical to TRPV1 and TRPV2 (Liedtke et al. 2000; Strotmann et al. 2000) . When expressed in mammalian cells it comprises a moderately selective cation channel (P Ca /P Na = 6), which, like TRPV1, displays a gently outwardly rectifying I-V relation. TRPV4 is 40% identical to TRPV1 and TRPV2 (Liedtke et al. 2000; Strotmann et al. 2000) . When expressed in mammalian cells it comprises a moderately selective cation channel (P Ca /P Na = 6), which, like TRPV1, displays a gently outwardly rectifying I-V relation.

TRPV5 and TRPV6 comprise a separate subfamily of TRPVs with only 30% identity with TRPV1. The expressed channels strongly inwardly rectify and are the most Ca 2+ -selective (P Ca /P Na > 100) (Nilius et al. 2000; Vennekens et al. 2000; Yue et al. 2001; Den Dekker et al. 2003 ) of all TRP channels. These properties are consistent with proposed mechanisms for Ca 2+ -selective channels in which negatively charged glutamic or aspartic acid residues provide a binding site for divalents within the pore. Intra-and extracellular [Ca 2+ ] (Yue et al. 2001; Hirnet et al. 2003; Bödding and Flockerzi 2004) and calmodulin (Lambers et al. 2004 ) regulate TRPV6 activity. The localization of TRPV5 and TRPV6 to the proximal small intestine and collecting duct of the kidney, along with mouse knockout data, suggests that this family is important in calcium uptake via epithelial cells (Hoenderop et al. 2005) . Lee et al. (2005) reported that PIP 2 activates TRPV5 and releases its inhibition by intracellular Mg 2+ .

Benham CD, Davis JB, Randall AD (2002) The vanilloid receptor-1 (TRPV1) is a non-selective cation channel, predominantly expressed by peripherally sensory neurons, which is known to play a key role in the detection of noxious painful stimuli, such as capsaicin and heat. Smart et al. (2000 Smart et al. ( , 2001 found that the endogenous lipid anandamide is a full agonist at the human vanilloid receptor and characterized human vanilloid VR1 pharmacology using FLIPR. With these methods, Gunthorpe et al. (2004) identified and characterized a potent and selective vanilloid receptor (VR1/TRPV1) antagonist.

Human VR1 cDNA was identified using the published rat VR1 sequence (GenBank accession AF029310) to search public nucleotide databases. Expressed sequence tag T48002 was identified and its sequence extended by rapid amplification of the cDNA ends using cDNA templates from a number of tissue sources. The full cDNA was amplified from brain cDNA, inserted into the expression vector pcDNA3.1, double-strand sequenced, and stably expressed in HEK293 cells. Rat VR1 cDNA was amplified from rat DRG cDNA and similarly expressed in HEK293 cells.

Cell Culture hVR1-HEK293 cells were grown as monolayers in minimum essential medium (MEM) supplemented with non-essential amino acids, 10% fetal calf serum, and 0.2 mM L-glutamine, and maintained under 95%/5% O 2 /CO 2 at 37°C. Cells were passaged every 3-4 days and the highest passage number used was 20. Dissociated rat neonatal DRG cultures were prepared as described by Skaper et al. (1990) .

Cells were plated and cultured on glass coverslips at 26,000 cells cm −2 and whole-cell voltage clamp recordings were performed at room temperature (20-24°C), using standard methods. The extra-cellular solution consisted of (mM): NaCl 130, KCl 5, CaCl 2 2, MgCl 2 1, glucose 30, HEPES-NaOH 25, pH 7.3. For anandamide application this solution was supplemented with 0.2% lipid-free bovine serum albumin. Patch pipettes of resistance 2-5 M were fabricated on a Sutter Instruments P-87 electrode puller and were filled with the following solution (mM): CsCl 140, MgCl 2 4, EGTA 10, HEPES-CsOH 10, pH 7.3. All recordings were made from single, well isolated, phase-bright cells. Currents were recorded at a holding potential of -70 mV using an Axopatch 200B amplifier. Data acquisition and analysis were performed using the pClamp7 software suite. Drug applications were affected with an automated fast-switching solution exchange device (Warner Instruments SF-77B; time for solution exchange ≈30 ms).

hVR1-HEK293 cells were seeded into black-walled clear-base 96-well plates (Costar, UK) at a density of 25,000 cells per well in MEM, supplemented as above, and cultured overnight. The cells were then incubated with MEM containing the cytoplasmic calcium indicator Fluo-3AM (4 µM; Teflabs, Austin, Tex., USA) at 25°C for 120 min. The cells were washed four times with, and finally cultured in, Tyrode's medium containing 0.2% BSA, before being incubated for 30 min at 25°C with either buffer alone (control) or buffer containing various antagonists. The plates were then placed into a FLIPR (Molecular Devices, UK) to monitor cell fluorescence (λ EX = 488 nM, λ EM = 540 nM) (Sullivan et al. 1999 ) before and after the addition of various agonists.

Responses were measured as peak fluorescence intensity (FI) minus basal FI, and where appropriate were expressed as a percentage of a maximum capsaicin-induced response. Data are expressed as mean ± SEM unless otherwise stated. Curve-fitting and parameter estimation were carried out using Graph Pad Prism 3.00 (GraphPad Software, Calif., USA). pK B values were generated from IC 50 curves for the antagonist vs a fixed EC 80 concentration of agonist using the Cheng-Prusoff equation. Rao and Kaminski (2006) reported that induction of intracellular elevation by 9 -tetrahydrocannabinol in T cells involves TRPC1 channels. 

Noradrenaline and other sympathomimetic drugs increase vascular smooth muscle tone by stimulation of α-adrenergic receptors. Contractions can be antagonized by α-adrenergic receptor blocking agents such as phentolamine. Drugs can be tested for their capacity of reducing vascular smooth muscle contractions induced by the adrenergic receptor-activating agent noradrenaline. Moreover, effects of peptides, such as bradykinin, can be tested with strips of aorta or pulmonary artery.

As donor animals Pirbright White guinea pigs of either sex weighing about 400 g, or Chinchilla rabbits weighing about 3.5 kg, or Sprague-Dawley rats weighing 200-300 g are used. The vessels to be tested are the thoracic aorta or the arteria pulmonalis. The animals are sacrificed by stunning and exsanguination. The pulmonary artery or the thoracic aorta is quickly removed and cut into helical strips of 1-2 mm width and 15-20 mm length. The strips are mounted in an organ bath with a preload of 1 g. Krebs-Henseleit buffer solution containing 11.5 M glucose is maintained at 37°C and oxygenated with 95% O 2 , 5% CO 2 . Isotonic or isometric registration is performed. Changes in length are recorded isotonically using a lever transducer (368 type B, Hugo Sachs Elektronik Freiburg). Isometric force is measured with a force transducer (UC-2 Gould-Statham, Oxnard, USA).

Following an equilibration period of 60 min, contractions are induced by repeated administrations of (-)noradrenaline HCl in concentrations of 2 × 10 −6 M for testing the contractions of the pulmonary artery and in concentrations of 2 × 10 −8 M for testing the contractions of the aorta. After obtaining a stable plateau of identically sized contractions, cumulative doses of the test compound are added into the organ bath. Consecutive concentrations are given when the response of the previous dose has reached a plateau.

Controls at the end of the experiment: If a compound does not show vasorelaxing activity at any dose, the sensitivity of the preparation is tested by adding phentolamine (1 × 10 −7 M).

If a compound shows vasorelaxing activity, the reversibility of the relaxation is tested by increasing the noradrenaline concentration.

The contractile force is determined before and after drug administration.

Percent inhibition of spasmogen-induced contraction by test drug is calculated as compared to the maximal contraction with a spasmogen alone ( = 100%).

IC 50 values are determined from the individual dose-response curves. IC 50 is defined as the dose of drug leading to a 50% relaxation of noradrenaline-induced contraction.

The isolated vena cava of rabbits can be used for assaying α-adrenolytic activity. The rabbit is sacrificed by CO 2 anesthesia. The vena cava inferior is removed and cut into strips. The percent inhibition of epinephrine or norepinephrine induced contractions is determined.

The effects of bradykinin and bradykinin antagonists can be tested in isolated guinea pig artery and isolated rabbit aorta which contains predominantly the BK 1 -receptor type (Regoli and Barabé 1980; Hock et al. 1991) . Wisskirchen et al. (1998) tested agonists of calcitonin gene-related peptide, homologues and antagonists in rat isolated pulmonary artery. Endotheliumintact pulmonary artery rings were contracted with 3 × 10 −8 M phenylephrine and a cumulative doseresponse curve of relaxation was constructed.

Furchgott RF (1967) The seminal vesicles of guinea pigs and rats are tubular organs whose longitudinal and annular muscles are innervated by the sympathetic system. The inhibition of contractions induced by norepinephrine or the α 1 -selective agonist phenylephrine indicates αsympatholytic activity. Sharif and Gokhale (1986) recommended the use the isolated rat seminal vesicle as a rather sensitive and specific model.

Male guinea pigs weighing 300 to 600 g are sacrificed by a blow to the neck. Both seminal vesicles are prepared and placed in Ringer's solution in an organ bath maintained at 32°C and being oxygenated with 95% O 2 /5% CO 2 . Isotonic or isometric registration is performed. Changes in length are recorded isotonically using a lever transducer (368 type B, Hugo Sachs Elektronik Freiburg). Isometric force is measured with a force transducer (UC-2 Gould-Statham, Oxnard, USA).

Following an equilibration period of 30 min, contractions are induced by repeated administration of (-)norepinephrine HCl in concentrations of 1 to 5 µg/ml or phenylephrine HCl in concentrations of 10 to 50 µg/ml. After obtaining a stable plateau of identical contractions, the test compound is added into the organ bath. Three min later, the previous concentration of norepinephrine or phenylephrine is added. As standard phentolamine is used in concentrations of 3 to 30 × 10 −7 M.

Contractions of the seminal vesicle induced by the αadrenergic agonists after addition of the test compound are compared with the initial values and expressed as percentage thereof. For in depth analysis, full doseresponse curves of the agonist are recorded before and after addition of various doses of the antagonist. A parallel shift to the right indicates competitive antagonism which can be evaluated as pA x -values according to Schild (1947) 

Leitch (1954) recommended the use of isolated seminal vesicles of rats for the assay of sympatholytic drugs. 

The vas deferens of the guinea pig or preferably the rat is used for quantitative evaluation of adrenergic antagonists. The response of this organ to α-adrenergic agonists consists of a strong rapid contraction followed by quick relaxation on washing the agonists out of the tissue.

Male Wistar rats weighing about 300 g are used. The animals are sacrificed by a sharp blow to the neck, the vasa deferentia are dissected free from the extraneous tissues and suspended in a organ bath containing Tyrode solution being oxygenated with a 95% O 2 and 5% CO 2 mixture at 32°C. Isotonic registration is performed at a preload of 0.5 g. Changes in length are recorded isotonically using a lever transducer (e. g., 368 type B, Hugo Sachs Elektronik, Freiburg, FRG).

Following an equilibration period of 30 min, contractions are induced by repeated administration of (-)norepinephrine HCl in concentrations of 0.5, 1.0, 2.0, or 4.0 µg/ml. After obtaining a stable plateau of identical contractions, the test compound is added into the organ bath. Three min later, the previous concentration of norepinephrine is added. As standard phentolamine is used in concentrations of 3 to 30 × 10 −7 M.

Contractions of the vas deferens induced by the αadrenergic agonist after addition of the test compound are compared with the initial values and expressed as percentage thereof. For in depth analysis, full doseresponse curves of the agonist are recorded before and after addition of various doses of the antagonist. A parallel shift to the right indicates competitive antagonism which can be evaluated as pA x -values according to Schild (1947) .

Electrical stimulation of the isolated ductus deferens results in the release of norepinephrine. Stimulation induced contractions of this organ are inhibited by clonidine which impairs adrenergic neurotransmission by activating inhibitory α-receptors. The ductus deferens is suspended in an organ bath bubbled with carbogen and maintained at 37°C. Tension is adjusted to 25 mN. Following a 45 min equilibration period, supramaximal amplitude stimulation by a HSE type 2 stimulator (Hugo Sachs Elektronik, Freiburg) is applied. After stabilization of the response, clonidine is added to the organ bath in accumulated doses. Test compounds are added 5 min prior to clonidine administration. The percent potentiation of clonidine induced inhibition of contractions is determined. Taylor et al. (1983) used the rat deferens for pharmacological characterization of purinergic receptors.

Nerve-muscle preparations of the vas deferens have been reviewed by Holman (1975) . Hughes et al. (1974) used the electrically stimulated mouse vas deferens for assessment of the agonistic and antagonistic activities of narcotic analgesic drugs. Ross et al. (2001) used the mouse vas deferens to study structure-activity relationship for the endogenous cannabinoid, anadamide, and certain of its analogues at vanilloid receptors. Oka et al. (1980) recommended the vas deferens from rabbits as a specific bioassay for opioid κreceptor agonists.

Mutafova-Yambolieva and Radmirov (1993) studied the effects of endothelin-1 on electrically-or druginduced contractile responses mediated by purinergic or adrenergic receptors in the isolated prostatic portion of rat vas deferens. Ward et al. (1990) used isolated vasa deferentia preparations from rat and mouse to study the pharmacological profile of the analgesic pravadoline.

Hukovic (1961) described an isolated ductus deferens preparation together with the sympathetic hypogastric nerve of the guinea pig.

Cordellini and Sannomiya (1984) pretreated guinea pigs with reserpine. In the isolated vasa deferentia concentration-effects curves to phenylephrine were established in the presence of cocaine. The antagonistic effect of phenoxybenzamine was used for receptor occupancy studies. Donoso et al. (1992) studied neurotransmission in epididymal and prostatic segments of isolated superfused rat vas deferens preparations.

Vaupel and Su (1987) used the vas deferens preparation of guinea pigs to study sigma and phencyclidine receptors.

Eltze (1988) used the field-stimulated (95% of maximum voltage, 0.1 Hz, 0.5 ms) portion of rabbit vas deferens to study muscarinic M 1 and M 2 -receptors. Dumont et al. (1997) used the isolated guinea pig heart and the isolated rat vas deferens for in vitro bioassays of calcitonin gene-related peptide (CGRP) agonists and antagonists. Poyner et al. (1999) found concentration-dependent inhibitions of the electrically stimulated twitch responses of guinea pig vas deferens by calcitonin generelated peptide, amylin and adrenomedullin. Couldwell et al. (1993) found that the rat prostate gland possesses a typical α 1 -adrenoceptor similar to that found in the vas deferens. Wisskirchen et al. (1998) tested agonists of calcitonin gene-related peptide, homologues and antagonists in rat isolated vas deferens. The prostatic half was suspended under 0.5 g resting tension and equilibrated in Krebs solution at 37°C. Contractile responses of the prostatic vas were induced by electrical field stimulation at 0.2 Hz, 1.0 ms and 60 V through parallel platinum electrodes either side of the tissue. α-Stimulant agents (such as epinephrine, norepinephrine) or electrical stimulation induce contractions in sympathetically innervated organs such as spleen smooth muscle. These effects can be antagonized by drugs with α-blocking activities such as phentolamine.

Male Sprague-Dawley rats weighing 180-220 g are used. The animal is sacrificed in CO 2 anesthesia. The spleen is removed and cut longitudinally into two halves. Each part is placed in an organ bath containing nutritive solution. The bath solution is bubbled with carbogen and maintained at 37°C. Following a 30 min incubation period under a tension of 0.5 g, contractions are elicited by administration of epinephrine (10 −6 g/ml) or norepinephrine 10 −6 g/ml). After obtaining 3 approximately identical spasms, the test compound is administered followed by the addition of the spasmogen 5 min later. The contractile response is allowed to plateau and recorded.

Standard compound:

• phentolamine

The contractile force is recorded at its maximal level before and after drug administration. The percent inhibition of epinephrine or norepinephrine induced contraction is determined. The rat anococcygeus muscle as pharmacological tool was introduced by Gillespie (1972 Gillespie ( , 1980 , Gibson and Gillespie (1973) . This smooth muscle has a dense adrenergic innervation and contracts to noradrenaline, acetylcholine, 5-hydroxytryptamine, but not to histamine. Moreover, the muscle contracts to field stimulation or stimulation of extrinsic nerves. The preparation can be used to assess the pre-and post-synaptic α-adrenoceptor blocking activity of drugs (Doggrell 1980 (Doggrell , 1983 .

The two anococcygeus muscles arise from the upper coccygeal vertebra close to one another in the midline of the pelvic cavity. The muscles pass caudally, lying first behind and the to one side of the colon, finally joining together to form a ventral bar in front of the colon a few mm from the anus. The extrinsic nerves pass in a branch of the perineal nerve on either side to enter the deep surface of each muscle just before the formation of the ventral bar. After sacrifice, the abdomen of rats is opened in the mid-line, the pelvis split and the bladder and urethra removed. Care is required in clearing the lower part of the urethra to avoid damage to the ventral bar of muscle, the only region lying ventral to the colon. The colon is then cut through at the pelvic brim, the pelvic portion pulled forward and the delicate connective tissue behind cleared until the anococcygeus muscles come into view. The muscles are isolated, in some instances with the extrinsic nerve intact. The extrinsic nerves on either side run in the posterior scrotal branch of the perineal nerve and leave it to enter the deep surface of the anococcygeal muscles as the lie on the lateral surface of the colon. The ventral bar is cut through and each muscle mounted in a 100 ml bath containing Krebs solution at 36°C. The solution is gassed with 95% O 2 +5% CO 2 . Tension is measured with isometric transducers and displayed on a polygraph. Field stim-ulation of the intramural nerves is applied after drawing the muscles through a pair of electrodes similar to those described by Burn and Rand (1960) ; when the muscles are stimulated through their extrinsic nerves the nerves are drawn through similar electrodes. Stimulation of either intramural or extrinsic nerves is with 1 ms pulses at 20 Hz, and at a supramaximal voltage.

Dose-response curves are established with doses of 2 × 10 −7 to 4 × 10 −6 M noradrenaline, 4 × 10 −7 to 4 × 10 −5 M acetylcholine or with graded frequencies of electrical stimulation.

The effect of noradrenaline is abolished by αadrenergic antagonists, such as 10 −6 M phentolamine. Dose-response curves show a parallel shift characteristic of competitive antagonism.

Contractions of the anococcygeus muscle induced by an α-adrenergic agonist after addition of the test compound are compared with the initial values and expressed as percentage thereof. For in depth analysis, full dose-response curves of the agonist are recorded before and after addition of various doses of the antagonist. A parallel shift to the right indicates competitive antagonism which can be evaluated as pA x -values according to Schild (1947) . Gibson et al. (1990) found L-N G -nitroarginine to be a potent inhibitor of non-adrenergic, non-cholinergic relaxations in the rat anococcygeus muscle. Oliveira and Bendhack (1992) found that dopamine has a dual effect in the rat anococcygeus muscle: a partial effect due to an indirect sympathomimetic action and a partial effect due the interaction with postjunctional receptors. Brave et al. (1993) investigated the interaction between motor sympathetic and inhibitory non-adrenergic, non-cholinergic nerves in the rat anococcygeus muscle using L-N G -nitroarginine, an inhibitor of Larginine:NO synthase.

Cakici et al. (1993) described a coaxial bioassay system consisting of guinea pig trachea as donor organ for epithelial derived-relaxing factors and phenylepinephrine-precontracted rat anococcygeus muscle as assay tissue.

Iravani and Zar (1993) found differential effects of nifedipine on nerve-mediated and noradrenalineevoked contractions of rat anococcygeus muscle.

Rand and Li (1993) studied the modulation of acetylcholine-induced contractions of the rat anococcygeus muscle by activation of nitrergic nerves. Mudumbi and Leighton (1994) investigated the mechanisms of action of relaxation induced by bradykinin and by electrical field stimulation in isolated rat anococcygeus muscle, where contractile tone had been elevated with clonidine. Gwee et al. (1995) investigated the prejunctional and postjunctional inhibition of adrenergic transmission in the rat isolated anococcygeus muscle by cimetidine. Najbar et al. (1996) found that smooth muscle cells in the rat anococcygeus muscle are endowed with two distinct P-2-purinoreceptors which subserve contractions.

De Godoy et al. (2003) evaluated the inhibitory effects of atropine and hexamethonium on the angiotensin-II-induced contraction of rat anococcygeus muscles. Pettibone et al. (1993) examined the inhibitory potency and selectivity of an oxytocin antagonist against oxytocin-stimulated contractions if the mouse anococcygeus muscle. Dehpour et al. (1993) and Radjaee et al. (1996) used isolated anococcygeus muscles from rabbits and found an extremely regular activity induced by methoxamine or clonidine. 

The β-agonist isoprenaline (isoproterenol) induces an increase in the frequency and force of contraction of spontaneously beating isolated right atrias and potentiates contractions of electrically stimulated isolated left atria. Drugs with β-sympatholytic activity inhibit these isoprenaline-induced effects. β-receptor blocking activity of drugs can be evaluated in isolated right (a) and left (b) guinea pig atria. Since the heart contains predominantly β 1 -adrenoreceptors, β 1 -blocking activity is assessed by this test.

Pirbright White guinea pigs of either sex weighing 250-300 g are used. The animal is sacrificed by stunning and exsanguination. The heart is removed, the right or the left atrium is cut off and mounted in a 50 ml organ bath with a preload of 100 mg. The Krebs-Henseleit solution is maintained at 32°C and aerated with 95% O 2 /5% CO 2 . Contractions are recorded isotonically using a lever transducer (368 type B, Hugo Sachs Elektronik, Freiburg).

After an equilibration period of 30 min, isoprenaline is administered into the organ bath to potentiate inotropy and frequency of the isolated right atrium. Cumulative doses of isoprenaline are added starting from a concentration of 0.05 µg/ml; consecutive doses are administered at 3 min intervals. When a stable maximum plateau of the effect is achieved, the organ bath is thoroughly flushed for 1 min; flushing is repeated twice 5 and 20 min later. The whole procedure is repeated with the same isoprenaline concentrations (control baseline values = 100%).

The test compound is then added into the organ bath and 5 min later, again isoprenaline is given at cumulative doses.

If the test compound has β-receptor blocking activity (β-sympatholytic), 1. higher isoprenaline concentrations are necessary to induce the same potentiation of inotropy and frequency or 2. at the same isoprenaline concentrations added as before, the increase in inotropy and frequency is reduced. At the end of the experiment, again a cycle without test drug is performed.

The left atrium is stimulated by a square wave stimulator with 2 impulses/s at a voltage of 15 V and an impulse duration of 1 ms. After an equilibration period of 30 min, the β-agonist isoprenaline is added at concentrations of 0.05-0.1 mg/ml. The organ bath is then thoroughly flushed for 1 min. Flushing is repeated twice 5 and 20 min later. The whole procedure is repeated with the same cumulative isoprenaline concentrations (control baseline values = 100%) and flushing procedure.

When a stable plateau of contractions is achieved, the test compound is added into the organ bath and 3 min later, isoprenaline is added again at cumulative concentrations.

If the test compound has β-receptor blocking activity (β-sympatholytic), the isoprenaline-induced effects are inhibited.

In addition, refractory period is determined before and after drug administration. EVALUATION a) Percent inhibition of (a) isoprenaline-induced or (b) electrically-induced and isoprenaline-potentiated increased inotropy and frequency by test drug is calculated as compared to pre-drug activity ( = 100%). b) Percent change in refractory period is calculated.

IC 50 values are determined from the individual dose-response curves.

Statistical evaluation is performed by means of the paired t-test.

Standard compounds:

• propranolol HCl, • amrinon, • nifedipine, • and milrinone.

A detailed description of the use of isolated atrial preparations has been given by Levy (1971) .

Instead of the right atrium, Doggrell and Hughes (1986) used the isolated right ventricle of the rat for the assessment of the β-adrenoreceptor blocking activity of propranolol and investigated the competitive nature of the isoproterenol antagonism at various doses with Schild-plot analysis. Doggrell (1988) used the isolated left atria of the rat for simultaneous assessment of membrane-stabilizing and β-adrenoreceptor blocking activity.

Berthold et al. (1990) described a method for testing cardiotonic sodium channel activators in isolated, electrically stimulated left guinea pig atria after potassium depolarization. Olson et al. (1995) studied the function of isolated rat left atria and papillary muscles and quantified the voltage-response relationship between punctate and field electrical stimulation after pretreatment with reserpine or β-blockers. 

Male Pirbright White guinea pigs weighing 250-300 g are used. The animals are sacrificed by stunning and exsanguination. The trachea is removed and cut into individual rings. Six rings are connected in series by means of short loops of silk thread. The tracheal chain is mounted in an 50 ml organ bath with a preload of 1 g for isotonic registration. To the nutritive solution (Tyrode) containing ascorbic acid and 1.0 g/L glucose, the α-receptor blocking agent phentolamine (0.1 µg/ml) and the spasmogen carbachol (80 ng/ml) are added. The solution is maintained at 34°C and aerated with 95% O 2 , 5% CO 2

After an equilibration period of 30 min, cumulative doses of 10 −10 to 10 −7 M of the spasmolytic agent isoprenaline are added. When maximal relaxation is obtained, the organ bath is flushed and the procedure repeated. After the two control relaxations with isoprenaline, the tissue is rinsed thoroughly and the first dose of the test compound is administered. Three min later, cumulative doses of isoprenaline are administered as before. Following a 10 min washout and recovery period, the next dose of the test compound is given. Up to 10 drug concentrations can be tested with one organ.

Standard compounds:

• propranolol • practolol EVALUATION Percent inhibition of isoprenaline-induced relaxation under drug treatment is calculated compared to maximal relaxation induced by isoprenaline alone (control = 100%).

A competitive antagonism of test compound is evaluated and can be quantitated from the dose-response curve.

O'Donnell and Wanstall (1980) used guinea pig tracheal preparations, where K + -depolarization was achieved by replacing all the Na + in Krebs solution by an equivalent amount of K + causing a sustained contraction of the preparations. A dose-dependent relaxation effect of isoprenaline could be obtained provided that the preparations were repolarized by washing in normal Krebs solution between curves. pA 2 values were in good agreement with values obtained in other types of tracheal preparations.

Guinea pig superfused trachea and dispersed tracheal cells have been used by Buckner et al. (1995) to compare the effects of isoproterenol and forskolin on immunologic and nonimmunologic histamine release. Lundblad and Persson (1988) found that epithelial removal is of little consequence for the pharmacology of the guinea pig tracheal open ring preparation in vitro.

The rat portal vein has been recommended as model for assessment of β 2 adrenoceptor blocking activity of drugs by Doggrell (1990) . 

The angiotensin-converting enzyme (ACE) is responsible for the formation of the active angiotensin II from the inactive angiotensin I. The same enzyme is responsible for the degradation of the active peptide bradykinin to inactive products. ACE activity can therefore be measured in two ways: activity of the newly formed angiotensin II and inhibition of the activity of bradykinin. ACE inhibition results in decreased activity of the precursor angiotensin I and potentiation of the bradykinin effect. The guinea pig ileum contracts in response to both peptides, angiotensin II and bradykinin, and can be used for quantitative determination of ACE inhibiting activity.

Guinea pigs of either sex weighing 300 to 500 g are used. They are sacrificed by stunning and exsanguination. The abdomen is opened with scissors. Just distal to the pylorus, a cord is tied around the intestine which is then severed above the cord. The intestine is gradually removed, and the mesentery is being cut away as necessary. When the colon is reached, the intestine is cut free. Below the cord, the intestine is cut halfway through, so that a glass tube can be inserted. Tyrode's solution is passed through the tube and the intestine until the effluent is clear. Mesentery is cut away from the intestine that was joined to the colon. Pieces of 3 cm length are cut. Preferably, the most distal piece is used being the most sensitive one. This piece is fixed with a tissue clamp and brought into an organ bath with Tyrode's solution at 37°C being oxygenated with O 2 . The other end is fixed to an isometric force transducer (UC 2 Gould-Statham, Oxnard USA). Responses are recorded on a polygraph.

After an equilibrium time of 30 min, angiotensin I is added in a concentration of 10 ng/ml bath solution. The force of contraction is recorded and the angiotensin I dosage is repeated once or twice until the responses are identical. Then the potential ACE inhibitor is added. After 5 min incubation time, again angiotensin I is added. The contraction is diminished depending on the activity of the ACE inhibitor.

Pieces of guinea pig ileum are prepared as described before. After an equilibrium time of 30 min bradykinin is added in a concentration of 15 ng/ml bath solution.

The force of contraction is recorded and bradykinin additions are repeated once or twice until the response is identical. Then the potential ACE inhibitor is added. After 5 min incubation time, again bradykinin is added. The contraction is potentiated depending on the activity of the ACE inhibitor.

The contraction after addition of the ACE inhibitor is expressed as percentage of contraction without the ACE inhibitor. Using various doses of the ACE inhibitor IC 50 values (concentrations inducing 50% inhibition) are calculated. As standards ramipril, enalapril, and captopril are used.

The increase of the contraction after addition of the ACE inhibitor is expressed as percentage of contraction without the ACE inhibitor. As standard ramiprilate is used.

The classical method of the isolated guinea pig ileum has been proven to be a reliable method for screening of potential ACE inhibitors. The contractile process within the vascular smooth muscle results from an increase in the concentration of intracellular Ca 2+ . Inhibition of vasoconstriction occurs by addition of calcium antagonists or by removal of extracellular calcium. The vasorelaxing effects of compounds can be tested in isolated rodent arteries (pulmonary artery, thoracic aorta). Arterial rings or strips with or without endothelial lining are contracted with different agents, e. g., extracellular K + and Ca 2+ , the α-adrenoceptor agonists phenylephrine and noradrenaline, the Ca 2+ ionophore A23187 or the thromboxane receptor agonist U46619. Compounds with vasodilating activity antagonize the induced contractions.

Potassium channel openers such as cromakalin, nicorandil, pinacidil or HOE 234 induce relaxation of contracted smooth musculature (Bolton et al. 1998 ). These effects are explained by data from patch clamp technique and ion flux experiments as well as by antagonism against potassium channel blockers. They indicate the potential use as antihypertensive and anti-asthmatic drugs (Hamilton and Weston 1989; Weston 1990, 1993; Weston and Edwards 1992) . The studies are complicated by the high diversity of potassium channels including ATP-sensitive, voltage-sensitive and Ca 2+ -activated channels (Mourre et al. 1986; Blatz and Magleby 1987; Ashcroft and Ashcroft 1990; Jan and Jab 1990; Pongs 1992; Wann 1993) . Since each functional channel appears to consist of four different subunits, the possibility exists that there may be hundreds of different voltage-sensitive K channels, depending on their subunit composition. Ashcroft and Gribble (2000) discussed new windows on the mechanism of action of K ATP channel openers.

Glibenclamide is an antagonist of the ATP-modulated K + channel allowing the localization of the binding sites (Eltze 1989; French et al. 1990; Mourre et al. 1990; Miller et al. 1991 Animals are sacrificed by stunning and exsanguination. At least 4 isolated organs are tested per drug. The heart and the pulmonary artery are quickly removed and immersed in PSS I at room temperature. The artery is dissected into rings and endothelial cells are removed by gently rubbing the intimal surface. Spirally cut strips of 15-20 mm length and 1-1.5 mm width are suspended at a resting force of 380 mg in an organ bath containing 20 ml oxygenated (95% O 2 , 5% CO 2 ) PSS I at 37°C. Changes in length are recorded isotonically using a lever transducer (368 type B, Hugo Sachs Elektronic, Freiburg).

To test the effect of compounds on vessels with intact endothelial lining, the thoracic aorta of rats is isolated and dissected free from surrounding tissue. Rings of 3 mm width are cut and suspended in the organ bath containing PSS I. Isometric force is measured with a force transducer (UC-2, Gould-Statham, Oxnard, USA) under a resting tension of 500 mg.

The functional integrity of the endothelium is tested before drug administration. One µM acetylcholine in the organ bath should result in a transient relaxation.

After an equilibration period of 1 h, contraction of each vessel strip or ring is induced by addition of one of the contracting agents into the organ bath.

To induce contractions of potassium-depolarized vessels, three different PSS solutions are used (PSS I for 30 min, PSS II for 3 × 15 min and PSS III). Contraction is induced in the presence of PSS III by adding 0.5 mM Ca 2+ into the organ bath.

When a stable plateau of contraction is achieved, cumulative concentrations of the test compound are added into the organ bath to obtain drug-response curves. Consecutive concentrations are added either at 1 h-intervals or when the response of the previous dose has reached a steady state level.

In order to study the time course of relaxation and the duration of action, only one concentration is tested.

To test whether the mechanism of action of a vasorelaxing agent is related to the liberation of nitric oxide, methylene blue or oxyhemoglobin (10 µM) are added to the organ bath 15-30 min prior to the cumulative administration of the test compound. Methylene blue or oxyhemoglobin block selectively NO induced relaxation.

Mean values of relaxation ± SEM are calculated. The height of contraction before the first drug administration is taken as 100%.

IC 50 values are determined from the individual dose-response curves. IC 50 is defined as the dose of drug leading to a 50% relaxation of the contraction induced by KCl or other agonists.

Statistical evaluation is performed by means of the t-test. Calderone et al. (1996) compared four rat aortic preparation (single ring, spiral strip, zig-zag strip, and multiple ring) on the basis of responses to noradrenaline and acetylcholine. They recommended the multiple ring preparation as the most suitable of all four for the study of vasoactive drugs because of the reproducibility of both contracturant and relaxing responses. Kent et al. (1982) used rat aortic strips contracted to a stable tension by either phenylephrine or barium chloride for comparison of vasodilators. Wilson et al. (1988) studied in isolated rings of rat aorta precontracted with noradrenaline the antagonism of glibenclamide against the vasorelaxation induced by cromakalin. Löhn et al. (2002) cannulated cerebral arteries from mice with glass cannulas on both sides, allowing an application of hydrostatic pressure to the vessel. Diameter was measured by using a videomicroscopic system (Nikon Diaphot, Düsseldorf, Germany) connected to a personal computer with appropriate software for detection of changes of vessel diameter (TSE, Bad Homburg, Germany).

Nishimura and tested the contractile responses to 5-HT in basilar arteries, superior mesenteric arteries and thoracic aortas from strokeprone spontaneously hypertensive rats in comparison to normal Wistar-Kyoto rats and found that that the hyperresponsiveness to 5-HT is mediated by different 5-HT receptor subtypes. Fouda et al. (1991) used the isolated tail arteries from rats. Differences of the vasoconstrictor response to potassium and norepinephrine between tail arteries from spontaneously hypertensive, renovascular hypertensive, and various strains of normotensive rats were found. Hamilton et al. (1986) , Dacquet et al. (1987) studied the effects of calcium entry blockers in rat portal vein. Bråtveit and Helle (1984) studied the inhibition of vascular smooth muscle by vasoactive intestinal peptide (VIP) in the isolated rat portal vein.

Shetty and Weiss (1987) studied the inhibition of spontaneous rhythmic movements and norepinephrine-induced tension responses in the rat portal vein. Edwards et al. (1991) compared the effects of several potassium-channel openers on rat bladder and rat portal vein in vitro. Smith et al. (1993) tested the ability of C-terminally truncated fragments of human α-calcitonin generelated peptide to relax mesenteric arteries precontracted with norepinephrine studied the contractile effects of noradrenaline and neuropeptide Y given alone or in combination on isolated rat mesenteric resistance vessels. Gurden et al. (1993) used guinea pig aorta relaxation for functional characterization of adenosine receptor types.

Eltze (1989) studied the antagonism of glibenclamide against potassium channel openers in the isolated guinea pig pulmonary artery. Szentmiklósi et al. (1995) used circular segments from the proximal part of the main pulmonary artery of guinea pigs to study contractile and relaxant effects of adenosine receptors.

Pikkers and Hughes (1995) examined the effect of hydrochlorothiazide on intracellular calcium concentration [Ca 2+ ] i and tone in guinea pig mesenteric arteries. Vessels were mounted on a microvascular myograph and loaded with the Ca 2+ -sensitive fluorescent dye, Fura-2. Nishimura et al. (1998) used isolated aorta rings from Syrian hamsters. Contractile responses were recorded with an isometric transducer (TSE, Bad Homburg, Germany) and stored (TSE Data acquisition software). Meisheri et al. (1990) recommended the use of the isolated rabbit mesentery artery as a sensitive in vitro functional assay to detect K + -channel-dependent vasodilators.

Mironneau and Gargouil (1979) studied the influence on electrophysiological and mechanical parameters of longitudinal smooth muscle strips isolated from rabbit portal vein by means of a double sucrose gap method associated with a photoelectric device for recording contractions.

Lauth et al. (2001) performed superfusion assays with rabbit jugular vein. Four venous ring segments (3-4 mm long) were tested simultaneously by mounting them between force transducers and a rigid support for measurement of isometric force. Increasing doses of bradykinin were applied as bolus injections and the ensuing constrictor response was monitored with the aid of a PC-operated analysis System (Biosys, TSE, Bad Homburg, Germany). McBean et al. (1986 McBean et al. ( , 1988 used isolated segments of the arteria basilaris of pigs to detect compounds with antivasoconstrictive properties. Contraction is elicited by PGF 2α , serotonin or norepinephrine. Specimens are obtained from adult pigs (strain: Deutsche Landrasse) within 30 min after slaughter from the local slaughter house and stored in nutritive solution. The vessels are trimmed to a length of 4 mm, and the segments are suspended between 2 L-shaped metal hooks in a bath containing 20 ml modified Krebs Henseleit solution (NaCl 148 mM, KCl 5.4 mM, CaCl 2 2.2 mM, NaHCO 3 12 mM, glucose 12 mM). The bath solution is maintained at 37°C and continuously gassed with carbogen to produce a resulting pH of 7.35-7.45. The preparation is incubated under a tension of 37.28 mN (optimal passive load producing the largest contractile response to 3 × 10 −6 M PGF 2α ). Following a 60 minute stabilization period, the vessels are sensitized with 30 mM KCl for 10 min. The vessels are washed for 1 minute, and allowed to recover for 30 min with additional 1 minute washes at 15 and 30 min. Thereafter, contractions of the vessels are induced by adding PGF 2α at 3 × 10 −6 M. The contractile response is allowed to plateau, then the test compound is administered at cumulative doses.

For each test compound a dose-response curve is recorded. The EC 50 is obtained graphically or by means of a Hill plot. The EC 50 is defined as the dose of drug producing half maximal response. Werner et al. (1991) studied the vascular selectivity of calcium antagonists using porcine isolated ventricular trabeculae and right coronary arteries. Merkel et al. (1992) used isolated porcine coronary artery rings precontracted with prostaglandin F 2α to demonstrate the vasorelaxant activity of an A 1selective adenosine agonist. Miwa et al. (1993) compared the effect of a K +channel opener with cromakalim, nitroglycerin and nifedipine on endothelin-1-induced contraction of porcine coronary artery. Satoh et al. (1993) investigated in isolated porcine large coronary arteries whether or not the vasorelaxant actions of nicorandil and cromakalim would be selective using seven different vasoconstrictor agonists. Yokoyama et al. (1994) studied the vasodilating mechanisms of several pyridinecarboximidamide derivatives in isolated porcine coronary arteries. Makujina et al. (1995) described a procedure that facilitates the eversion of vascular smooth muscle. Vascular segments of porcine coronary artery, approximately 2 cm in length, were sutured to portions of polyethylene tubing inserted into the lumen of the vessel. After being secured and stabilized by the tubing, the vessel was everted while immersed in physiological buffer. Intracellular calcium concentrations (measured by fura-2AM fluorometry) and tension were registered simultaneously in everted rings denuded of endothelium. Izumi et al. (1996) tested a K + -channel opener and related compounds in isolated porcine coronary arteries contracted with 25 mM KCl. Frøbert et al. (1996) described impedance planimetry as a new catheter-based technique to measure porcine coronary artery pharmacodynamics and compared the results with the commonly used wiremounted isometric tension technique after in vitro application of nifedipine in various concentrations. A four-electrode impedance measuring system was located inside a 12-mm long balloon which was introduced into 3-4 cm long segments of the left anterior descending coronary artery obtained from 70-90-kg Danish Landrace-Yorkshire pigs. Hamel et al. (1993) dissected segments (3-4 mm long) of temporal ramifications of the middle cerebral artery from bovine brains and mounted them between two L-shaped metal prongs in a tissue bath containing Krebs-Ringer solution at 37°C. Changes in muscle tension were measured by a force displacement transducer and recorded on a polygraph. Several 5-HT receptor agonists were tested for their ability to induce vasoconstriction and their potencies were compared to that of 5-HT. The authors concluded that bovine pial arteries appear to be the best available model for the human cerebrovascular 5-HT 1D receptor.

De la Lande et al. (1996) used isolated segments from proximal (4.5 mm i.d.) and distal (0.5 mm i.d.) bovine coronary arteries and found a heterogeneity of response to glyceryl trinitrate.

The isolated human coronary artery was used to study the vasoconstriction by acutely acting antimigraine drugs (Saxena et al. 1996a (Saxena et al. , b, 1997 

The isolated guinea pig ureter shows phasic-rhythmic contractions after addition of KCl to the organ bath. Inhibition of this effect can be explained as a modulation of potassium channels.

Male unfasted guinea pigs weighing 400-500 g are sacrificed and both ureters removed immediately without the part directly connected to the pelvis in order to exclude the pacemaker region responsible for spontaneous activity. Each segment of 2 cm length is placed in a Petri dish containing Tyrode solution at 37°C, freed of surrounding connective tissue and then suspended at a baseline tension of 0.5 p in a 25 ml organ bath containing Tyrode solution at 37°C being aerated with 5% CO 2 /95% O 2 , pH 7.4. Contractions are measured isometrically using Gould/Statham UC 2 transducers. After a 15 min equilibration period, KCl is added to the bath in a final concentration of 3 × 10 −2 Mol/l and left in the bath for 2 min. KCl induces a constant series of phasic-rhythmic contractions without a rise in baseline tone. Subsequent washing causes the immediate disappearance of the rhythmic contractions. This addition of KCl is repeated and the values of these two experiments are used as initial values. The antagonistic activity is studied by addition of the test drug one min prior to the KCl challenge. Percentage of the following parameters are determined: mean height of contractions, frequency of contractions and the product of mean height and frequency of contractions. For interaction studies the potassium channel blocker glibenclamide 10 −6 mol/l is added 1 min prior to the test drug.

Arithmetic means and standard deviations of the data are calculated and compared with initial values using Student's t-test.

The isolated guinea pig ureter stimulated with KCl can be used for studies on the modulation of potassium channels.

Yoshida and Kuga (1980) recorded electrical activities in a preparation consisting of the pelvic region and the upper ureter of the guinea pig. Train field stimulation of the pelvic region evoked a train of nerve action potentials followed by a multiphasic smooth muscle action potential after a latency of about 2.5-8.0 s. This smooth muscle response was abolished by tetrodotoxin and dibucaine, and also by cholinergic blocking agents. The effects of veratridine and of yohimbine on the efflux of norepinephrine from electrically stimulated guinea pig ureters were studied by Kalsner (1992) . Maggi and Giuliani (1994) studied the excitability and refractory period of the guinea pig ureter to electrical field stimulation. Roza and Laird (1995) , Laird and Cervero (1996) studied the pressor responses to distension of the ureter in anesthetized rats as a model of acute visceral pain.

A simple method for measurement of ureteric peristaltic function in vivo in anesthetized rats was published by Kontani et al. (1993) . 

The isolated corpus cavernosum of rabbits has gained interest as pharmacological model since selective inhibitors of cyclic guanosine monophosphate (cGMP) phosphodiesterase type 5 (PDE5) were found to be effective in the treatment of erectile dysfunction in man (Ballard et al. 1996; Jeremy et al. 1997; Chuang et al. 1998; Liu et al. 1998; Turko et al. 1999; Wallis 1999; Wallis et al. 1999; Stief 2000; Aydin et al. 2001; Thompson et al. 2001; Lin et al. 2002) .

Male New Zealand White rabbits weighing 3-4 kg are sedated with an intramuscular injection of 25 mg/kg ketamine+6 mg/kg xylazine. Anesthesia is maintained by intravenous injection of 25 mg/kg nembutal. The penis is removed at the level of the attachment of the corporal bodies to the ischium. The corpus cavernosum (total length about 20 mm) is sharply dissected from tunica albuginea and two longitudinal strips with unstretched length about 10 mm are made from the proximal, more muscular portion. Corporal strips are placed in organ baths containing 10 ml Tyrode's buffer (NaCl 124.9 mmol/l, KCl 12.5 mmol/l, MgCl 2 ·6H 2 O 0.5 mmol/l, NaH 2 PO 4 H 2 O 0.4 mmol/l, CaCl 2 1.8 mmol/l and glucose 5.5.mmol/l) at 37°C. Each tissue is equilibrated with a mixture of 95% O 2 and 5% CO 2 at pH 7.4. One end of each strip is connected to a force displacement transducer, and changes in muscle tension are measured and recorded with a polygraph. After zeroing and balancing transducers and strip chart, 2.0 g of tension is placed on each strip, and the strips are allowed to equilibrate for 30 min.

Each strip is prestimulated with 10 µM phenylephrine, then relaxed by electrical field stimulation with square wave pulses of 80 V, 1 ms duration at 2-16 Hz frequency. Then sodium nitroprusside (0.01-100 µM) is added ad NO donor. Finally, the standard (sildenafil 1 nM to 1 µM) or the test compound is added.

The dose-dependent increase of relaxation after test compound and standard is measured. From dose-response curves activity ratios can be calculated. Wallis et al. (1999) studied the inhibition of human phosphodiesterases PDE1 to PDE6 by sildenafil in various tissues, such as cardiac ventricle, corpus cavernosum, skeletal muscle and retina. Park et al. (1997) reported functional characterization of angiotensin II receptors in rabbit corpus cavernosum. Yildirim et al. (1997) investigated the effects of castration and testosterone on the constricting effect of phenylephrine and endothelium-dependent andindependent relaxing effects of different agonists in the corpus cavernosum of male rabbits. Liu et al. (1998) analyzed the pharmacological effects of in vitro ischemia on rabbit corpus cavernosum. found that activation of G icoupled postsynaptic α 2 -adrenoceptors causes contraction of smooth muscles in the corpus cavernosum of rabbits. Teixeira et al. (1998) used a bioassay cascade to study the effect of Tityus serrulatus scorpion venom on the rabbit isolated corpus cavernosum.

Cellec and Moncada (1998) used the clitoral corpus cavernosum of female rabbits to study the role of nitrergic neurotransmission in non-adrenergic non-cholinergic relaxation responses.

The isolated corpus cavernosum of rats has been used by Tong and Cheng (1997 ), Gemalmaz et al. (2001 ), and Wingard et al. (2003 , of mice by Gocmen et al. (1997) and Mizusawa et al. (2001) , of dogs by Hayashida et al. (1996 ), Comiter et al. (1997 , of monkeys by Okamura et al. (1998) , of horses by Recio et al. (1997) .

Studies in isolated human corpus cavernosum were performed by Holmquist et al. (1992) , Bush et al. (1992) , Rajfer et al. (1992) , Cellek and Moncada (1997) , Ballard et al. (1998 ), Omote (1999 , Wallis et al. (1999) , Lin et al. (2000 ), and Stief et al. (1998 .

In vivostudies measuring intracavernous pressure in rats were performed by Ari et al. (1996 ), Chan et al. (1996 In vivo studies on penile erection were performed in cats by .

Intracavernous pressure was measured in vivo in anesthetized dogs by Ayajiki et al. (1997 ), Sarikaya et al. (1997 , Carter et al. (1998), and Noto et al. (2000) . Bischoff and Schneider (2000) decribed a simple and quantitative model to study agents that influence penile erection in conscious rabbits. Erection was assessed by measuring the length of uncovered mucosa before and after the intravenous administration of agents. Anmals did not require anesthesia during the course of the study. 

The test is used to detect the effect of compounds on blood pressure and heart rate of anesthetized rats and to check for possible interference with adrenergic receptors. Antihypertensive agents with different mechanisms of action can be detected with this test.

Male Sprague-Dawley rats weighing 250-400 g are used. At least 2 animals are necessary for screening of one compound. The rats are anesthetized by intraperitoneal injection of 8 ml/kg of a solution of 8% urethane and 0.6% chloralose. The trachea is cannulated to facilitate spontaneous respiration. Body temperature is maintained at 38°C by placing the animal on a heating pad.

The left femoral vein is cannulated for drug administration, which is standardized to injections of 0.2 ml/100 g body weight over a period of 1 min. For measurement of hemodynamic parameters and for intra-arterial administration of test compound, a cannula is inserted retrogradely into the right carotid artery. The tip of the catheter is positioned close to the origin of the subclavian artery. This allows most of the injected substances to reach the CNS via the vertebral artery before going into the general circulation.

For continuous monitoring of blood pressure (systolic and diastolic pressure) and heart rate, the catheter is connected to a pressure transducer (Statham DB 23).

When stable hemodynamic conditions are achieved for at least 20 min (control values), test boli of adrenaline (1 mg/kg) and isoprenaline (0.25 mg/kg) are administered. When baseline values are again established, increasing doses of the test substance (0.01, 0.1, 3.0 mg/kg) are given intra-arterially. In case of no effect, the interval between successive doses is 15 min, otherwise 60 min. To check for αor β-blocking activity, adrenaline and isoprenaline administration is repeated after injection of the highest dose of test compound. If the test compound shows no effect, a standard antihypertensive compound is administered for control purpose.

Hemodynamic parameters are recorded continuously during the whole experiment.

Changes in blood pressure and heart rate after drug administration are compared to control values obtained during the 20 min pre-drug period.

Maximal changes in BP and HR and duration of the effect are reported.

The results are scored relative to the efficacy of standard compounds for the degree of the effect and the duration of the effect.

Statistical significance is not tested because of the small number of animals used (n = 2, sometimes 3 or 4) but larger numbers of animals have to be used for quantitative evaluation.

Due to the administration of the test compounds via the right common carotid artery not only peripherally acting vasodilators and neuron blockers but also compounds affecting the blood pressure regulating mechanisms in the CNS are detected. Bolus injections of adrenaline and isoprenaline reveal possible αor βantagonistic effects.

Standard data:

The following compounds at the doses indicated lead to a strong decrease in blood pressure:

• Clonidine 0.008 mg/kg • Dihydralazine 1.0 mg/kg • Phentolamine 3.0 mg/kg • Prazosin 0.1 mg/kg • Propranolol 1.0 mg/kg • Urapidil 1.0 mg/kg • Verapamil 0.1 mg/kg

Several authors (Mervaala et al. 1999; Wallerath et al. 1999; Rothermund et al. 2000; Baltatu et al. 2001) monitored arterial pressure and heart rate using a pressure transducer system and continuously recorded on a computer-based registration system (TSE, Bad Homburg, Germany).

A procedure for differential intra-arterial pressure recordings from different arteries in the rat was described by Pang and Chan (1985) .

DeWildt and Sangster (1983) described the evaluation of derived aortic flow parameters measured by means of electromagnetic flowmetry as indices of myocardial contractility in anesthetized rats.

Using a special Millar ultraminiature catheter pressure transducer and a thermodilution microprobe, Zimmer et al. (1987 Zimmer et al. ( , 1988 ) measured right ventricular functional parameters in anesthetized, closed-chest rats. Veelken et al. (1990) published improved methods for baroreceptor investigations in chronically instrumented rats.

Salgado and Krieger (1988), de Abreu and Salgado (1990), Da Silva et al. (1994) studied the function of thebaroreceptor reflex in thiopental anesthetized rats. The left aortic nerve was isolated and supported by a bipolar stainless steel electrode and carefully insulated with silicone rubber. Carotid pressure was recorded simultaneously with aortic nerve discharges on an oscilloscope and monitored with a loudspeaker. King et al. (1987) developed a cross circulation technique in rats to distinguish central from peripheral cardiovascular actions of drugs. The right common carotid arteries were ligated, and the left common carotid arteries and left and right external jugular veins of two phenobarbital-anesthetized rats were connected with polyethylene tubing so that peripheral blood from one rat, A, supplied the head of another rat, B, and then returned to the body of A, and vice versa, for peripheral blood from rat B. Each rat was artificially ventilated with O 2 , the chest was opened, and both subclavian arteries were ligated. Prior to the ligation of the subclavian arteries, blood flow from rat A supplied its own brain and both brain hemispheres but not the brain stem of rat B. Following subclavian artery ligation, blood flow from rat A did not supply A's brain, but supplied both hemispheres and brain stem of rat B.

The head of each rat was, therefore, rendered dependent on the carotid arterial blood supply from another rat. This rat cross-circulation preparation can be used to separate the central and peripheral cardiovascular actions of drugs. Zavisca et al. (1994) studied the hypertensive responses to defined electrical and mechanical stimuli in anesthetized rats. Rats were given etomidate, 3.8 mg/kg/h intravenously following carotid artery and jugular vein cannulation. At 15 min after beginning the infusion, 4 types of noxious stimuli were administered sequentially at 1-min intervals: Type 1: Square electrical waves 125 cps, 1.6 ms, 2-s duration, varying current from 0.4 to 12 mA; Type 2: A single 10-mA electrical stimulus, 5-s train duration; Type 3: Tail clamping; Type 4: Skin incision. After each stimulus, maximum change in systolic blood pressure was measured. Graded electrical stimulation allowed the best quantitative evaluation of the hypertensive response to noxious stimuli. Hyman et al. (1998) described a novel catheterization technique for the in vivo measurements of pulmonary vascular responses in rats. Male Charles River rats weighing 26-340 g were anesthetized and strapped in supine position to a fluoroscopic table. They breathed air enriched with oxygen through an endotracheal tube inserted by tracheostomy. Catheters were inserted into the femoral blood vessels. The venous catheters were passed to the right atrium under fluoroscopy. A F-1 thermistor catheter was passed from the left carotid artery into the ascending aorta under fluoroscopy, and a PE-50, 150-mm plastic catheter with a specially constructed curved tip was passed fluoroscopically from the left jugular vein into the main pulmonary artery. A plastic radiopaque 22-gauge catheter 100 mm in length with a curved tip was passed with a 0.025 mm soft-tip coronary guiding catheter from the right jugular vein through the right atrium to the inferior vena cava. The coronary softtip guide was then withdrawn. A specially curved 102.5-mm transseptal needle, 0.4 mm in diameter, was then passed though the catheter. Both the needle and catheter were withdrawn into the superior portion of the right atrium under fluoroscopic guidance so that the needle and catheter both rotated freely. With the rat in a slight left anterior oblique position, the catheter and needle were carefully rotated anteriorly to the intraatrial septum. With gentle pressure, the catheter and needle can be felt and seen fluoroscopically to pass through the atrial septum. As the needle was withdrawn, the curve of the catheter permitted passage of the tip into the vein draining either the left or right lower lobe. The catheter was carefully positioned near the pulmonary venoatrial junction and fixed in place. Mean pressures in the femoral artery, pulmonary artery and pulmonary vein at the venoatrial junction were measured with pressure transducers and recorded on a polygraph. Cardiac output was obtained in triplicate by delivering 0.1 ml normal saline at room temperature into the femoral venous catheter at the right venoatrial junction and determining thermodilution cardiac output with the thermistor catheter in the ascending aorta. Hayes (1982) described a technique for determining contractility, intraventricular pressure, and heart rate in the anesthetized guinea pig by inserting a needle, attached to a pressure transducer, through the chest wall into the left ventricle. Williams et al. (1995) used castrated male ferrets anesthetized by intramuscular injection of a mixture of 55 mg/kg ketamine and 4 mg/kg xylazine to measure the effects of a nonpeptidyl endothelin antagonist on endothelin-induced pressor responses. 

The pithed rat has been proposed for assessing pressor substances by Shipley and Tilden (1947) . The preparation is frequently used to evaluate drug action on the cardiovascular system since this preparation is devoid of neurogenic reflex control that may otherwise modulate the primary drug effect.

Male rats weighing 250-350 g are prepared for pithing under halothane anesthesia. The left carotid artery is cannulated for blood pressure monitoring and blood sampling. Furthermore, the trachea and the right jugular vein are cannulated. The rats are pithed inserting a steel rod, 2.2 mm in diameter and about 11 cm in length, through the orbit and foramen magnum down the whole length of the spinal canal. Via the tra-cheotomy tube, the animals are ventilated with a small animal ventilation pump. Inspirated air is oxygen-enriched by providing a flow of oxygen across a Tpiece attached to the air intake of the ventilation pump (Harvard Apparatus model 680). The rats are ventilated at a frequency of 60 cycles/min with a tidal volume of 2 ml/100 body weight. Thirty min after pithing, a 0.3 ml blood sample is withdrawn from the carotid cannula and immediately analyzed for pO 2 , pCO 2 , pH, and derived bicarbonate concentration using an automatic blood gas analyzer. By alterations of the respiratory stroke volume of the pump, the values are adjusted to: pCO 2 30-43 mm Hg, pH 7.36-7.50, pO 2 87-105 mm Hg. Continuous registration of blood pressure and cardiac frequency (Hellige He 19 device and Statham P 23 Db transducer) is performed via the left carotid artery.

In order to measure α 1 and α 2 antagonism, first dose-response curves are registered using doses of 0.1-30 µg/kg i.v. phenylephrine (a selective α 1 agonist), and 1-1000 µg/kg i.v. BHT 920, (a selective α 2 agonist). The test drug is administered intravenously and the agonist dose-response curves are repeated again 15 min later.

If the curve of blood pressure response to the agonists is shifted, dose-response curves are plotted on a logarithmic probit scale and potency ratios are calculated. Gillespie and Muir (1967) described a method of stimulating the complete sympathetic outflow from the spinal cord to blood vessels in the pithed rat by coating those parts of the pithing rod which lay in the sacral and cervical region of the spinal cord with highresistance varnish to restrict stimulation to the thoracolumbar region. The steel rod is insulated with an adhesive throughout its length except for a 5 cm section which provides sufficient a stimulation area of the lower thoracolumbar nerves. For stimulating nerves fibers supplying exclusively the heart, a pithing rod is used which is insulated throughout its length except for a 0.5 cm section 7 cm proximal to the tip. The spinal cord is stimulated electrically using the pithing rod as the cathode and a hypodermic needle which is inserted under the skin near the right hind-limb, as the anode. Varying the intensity and/or the duration of the stimulation, dose-response curves can be registered which are altered after treatment with drugs. Curtis et al. (1986) described an improved pithed rat method by mounting the preparation vertically with the head pointing downward resulting in considerably higher blood pressure and heart rate. MacLean and Hiley (1988) studied the effect of artificial respiratory volume on the cardiovascular responses to an α 1 -and α 2 -adrenoceptor agonist in the air-ventilated pithed rat using microsphere technique and analysis of arterial blood gases and pH. Trolin (1975) used decerebrated rats to study the clonidine-induced circulatory changes. Balt et al. (2001) compared the angiotensin II type 1 (AT1) receptor blockers losartan, irbesartan, telmirsatan and the ACE inhibitor captopril on inhibition of angiotensin-II-induced facilitation of sympathetic neurotransmission in the pithed rat. 

The method is used to demonstrate direct vasodilator activity of potential antihypertensive agents. The experimental model is an anesthetized, ganglion-blocked rat whose blood pressure is maintained by an intravenous infusion of angiotensin II. The test allows to differentiate between centrally acting antihypertensives and peripheral vasodilators.

Male Wistar rats weighing 275-450 g are anesthetized with a combination of urethane (800 mg/kg) and chloralose (60 mg/kg) administered intraperitoneally in a volume of 10 ml/kg. Following induction of anesthesia, chlorisondamine (2.5 mg/kg) is injected into the peritoneal cavity to abolish sympathetic and parasympathetic nerve activity. The right femoral artery is cannulated to monitor blood pressure (Statham pressure transducer P23Db) and heart rate. Both femoral veins are cannulated to administer drugs or infuse angiotensin II. The trachea is intubated and animals are allowed to breathe spontaneously. Following a stabilization interval of 10-15 min, angiotensin II is infused at a rate of 0.25 or 3.5 µg/min in a volume equivalent to 0.05 ml/min (Harvard infusion pump).

After an increase of blood pressure, a new elevated steady-state pressure is established within 15-20 min. Drugs are subsequently injected intravenously over an interval of 3 min in a volume of 2 ml/kg. Mean arterial pressure is recorded on a polygraph at 5, 10, 15, 20 and 30 min after initiation of drug administration. Seven to 9 animals are used for each drug and dose level studied.

α-adrenoreceptor blockade can be determined in ganglion-blocked rats. Pressor responses to graded doses of phenylephrine injected intravenously are obtained before and 15 min after administration of test compounds. Sufficient concentrations of phenylephrine have to be given to ensure a rise in mean arterial blood pressure of 50 mm Hg or more. Data obtained from 5 or 6 animals are averaged and resultant doseresponse curves plotted. The dose of phenylephrine required to elicit a 50 mm Hg increase in mean arterial blood pressure is interpolated from dose response curves.

Standard data:

The following compounds are used as standards and, at the doses indicated, lower mean arterial blood pressure by about 50 mm Hg: 

Mean values ± SEM are given for mean arterial blood pressure and heart rate. Changes of these parameters after drug administration are compared to control values obtained immediately before the application of the test compound. Statistical significance is assessed by means of the paired t-test.

A hypotensive response in this model appears to correlate more closely with antihypertensive activity in DOCA-salt hypertensive rats than does a vasodilator response in the perfused hind limb of anesthetized dogs and allows a distinction between central anti-hypertensive and vasodilators. Santajuliana et al. (1996) developed a standard ganglionic blockade protocol to assess neurogenic pressor activity in conscious rats. Rats were instrumented with arterial and venous catheters for measurement of arterial pressure and heart rate and for administration of three different ganglionic blockers (trimethaphan, hexamethonium, and chlorisondamine). 

Rats with spontaneous or experimentally induced hypertension are widely used for screening of potentially antihypertensive compounds. The indirect tail cuff method allows the determination of systolic blood pressure according to the following principle: The cuff is quickly inflated to well above suspected systolic blood pressure; the pulse will then be obliterated. Thereafter, pressure in the cuff is slowly released and, as the pressure falls below systolic blood pressure, the pulse will reappear. The method is analogous to sphygmomanometry in human and can be applied not only at the tail of awake rats but also in dogs and small primates. The indirect tail cuff method is widely used to evaluate the influence of antihypertensive drugs in spontaneously and experimentally hypertensive rats.

Male spontaneous hypertensive rats (Charles River) weighing 300-350 g or rats with experimentally induced hypertension are used.

Male Sprague-Dawley rats weighing 80-100 g are anesthetized by intraperitoneal injection of 0.8 ml 4% chloralhydrate solution. Both kidneys are exposed retroperitoneally. To induce renal hypertension, a silver clip (0.2 mm diameter, 4 mm length) is placed onto both renal arteries, the kidneys are reposed and the wound is closed by suture.

Within 5-6 weeks, operated animals attain a renal hypertension with a systolic blood pressure (BPs) of 170-200 mm Hg (mean normal physiological BPs for rats is 100 mm Hg). Only animals with a BPs = 180 mm Hg are used for the tests.

The procedure is the same for spontaneously and experimentally hypertensive rats. Groups of 6 animals are used per dose. The control group receives saline only. To reduce spontaneous variations in blood pressure, animals are adjusted to the experimental cage by bringing them into the restraining cage which is enclosed in a 31-32°C measuring chamber 3-4 times before the start of the experiment for a period of 30-60 min.

To measure blood pressure, a tubular inflatable cuff is placed around the base of the tail and a piezoelectric pulse detector is positioned distal to the cuff. The cuff is inflated to approximately 300 mm Hg. As the pressure in the cuff is slowly released, the systolic pressure is detected and subsequently recorded on a polygraph.

The test substance is administered intraperitoneally or by gavage once per day over a period of 5 days. The usual screening dose of a new compound is 25 mg/kg. Blood pressure and heart rate measurements are taken at the following times: day 1: predose and 2 h postdrug day 3: predose and 2 h postdrug day 5: predose, 2 h postdrug and 4 h postdrug.

Between measurements, animals are returned to their home cages.

Standard compounds:

• endralazine ( Scores for % decrease in systolic blood pressure and for the duration of the effect are allotted.

The indirect tail-cuff method is being used in many laboratories with many modifications of the devices. Pfeffer et al. (1971) found a good correlation between values obtained with the indirect tail-cuff method and values measured directly with indwelling carotid arterial cannulae, whereas Buñag et al. (1971) reported a lack of correlation between direct and indirect measurement of arterial pressure in unanesthetized rats and Patten and Engen (1971) found difficulties to measure accurate systolic values at higher blood pressure. A good correlation between direct blood pressure data from the carotid artery in rats and readings with the tail cuff method was found by Matsuda et al. (1987) who developed a six-channel automatic blood pressure measuring apparatus with a highly sensitive photoelectric sensor for the detection of tail arterial blood flow and a microcomputer system for automatic measurement of systolic blood pressure and heart rate and for data acquisition and processing.

Details of the tail-cuff method in rats have been discussed by Stanton (1971) .

Special equipment for measuring blood pressure in rats is commercially available (e. g., TSE GmbH, Bad Homburg, Germany).

Widdop and Li (1997) described a simple versatile method for measuring tail cuff systolic blood pressure in conscious rats. A tail cuff consisting of a metal Tpiece tube with latex rubber inside the tube is placed around the tail at the proximal end. A piezoelectric transducer (model MLT1010) is strapped to the ventral surface of the tail to record the pulse signal from the caudal artery and connected directly to a MacLab data-acquisition system ADInstruments Pty Ltd.).

The tail-cuff method for measurement blood pressure has been adapted for dogs, monkeys (Wiester and Iltis 1976), and cats (Mahoney and Brody 1978) .

Blood pressure can be measured from the hind leg of the rat using a leg cuff and a photoelectric cell situated at the dorsal surface of the foot (Kersten et al. 1947) . When the leg is occluded, the foot swells and the amount of light striking the photocell is reduced. When the pressure in the cuff is released, the arterial blood flow is restored, the increase of foot volume is decreased and the amount of light transversing the paw increases. The method first described by Weeks (1960) allows the direct measurement of arterial pressure in conscious rats eliminating the influence of anesthesia on cardiovascular regulation.

In order to prepare the cannulae 7 cm and 12 cm long pieces are cut from PE 10 and PE 20 tubings respectively. A stylet wire is inserted into the PE 10 tubing and the PE 20 tubing is also slipped over the stylet wire. The ends of the tubings are heated in a current of hot air and fused together. Ridges are made to anchor the cannula in the animal's tissue. In order to make a ridge, the stylet wire is left inside the cannula and the cannula is heated in a fine jet of hot air. When the polyethylene at the point of heating becomes soft, the cannula is pressed slightly and thus a ridge is formed. One ridge is formed at the PE 20 tubing, about 0.5 cm away from the junction with the PE 10 tubing, and 3 more ridges are formed on the PE 20 tubing at a distance of about 1 cm from each other, first one being situated about 3 cm away from the free end of the PE 20 tubing. The stylet wire is then removed from the cannula and the PE 10 portion of the cannula near the junction with the PE 20 tubing is wound around a glass rod with a diameter of 4 mm. Two rounds are made. Then it is dipped in a boiling water bath for about 5 s. When taken out of the bath, the cannula retains its circles, forming a spring-like structure.

Male Sprague-Dawley rats weighing about 300 g are used. The rat is anesthetized with 45 mg/kg pentobarbital i.p. The area of the neck and the abdomen are shaved and cleaned with 70% alcohol. The viscera are exposed through a midline abdominal incision. A segment of the abdominal aorta is exposed just above the bifurcation. A trocar is passed through the psoas muscles adjacent to this segment of the aorta, through the muscles of the back and under the skin until it emerges from the skin of the neck. Then the cannula is inserted into the trocar and the trocar is withdrawn from the body. The end of the cannula thus comes out from the neck, being anchored by silk sutures to the neck skin and to the psoas muscle. The cannula is filled with heparin solution and the end which is projecting out from the neck skin is blocked with a tight fitting stainless steel needle. Then the other end of the cannula is implanted into the aorta. The aorta is wiped with a cottontipped applicator stick above the bifurcation, occluded above this segment and punctured with a bent 27 gauge hypodermic needle. The tip of the PE 10 catheter is inserted through the needle and advanced up the aorta. The intestines are replaced and the wound sutured. The rats are allowed to recover for one week.

The occluding stainless steel needle is removed and the cannula flushed with diluted heparin solution. The rat is placed in a small cage to restrict its movements, even so it is free to move. The cannula is connected to a Statham P 23 Db pressure transducer and blood pressure is recorded on a polygraph. Test drugs or standards are administered either subcutaneously or orally.

Recordings are taken before and after administration of drug over a period of 1 h.

Changes of blood pressure are measured for degree and duration. Five rats are used for each dose and compound. The maximal changes of each group are averaged and compared with the standard.

Direct measurement of arterial blood pressure in unanesthetized rats originally introduced by Weeks (1960) has become a valuable and widely used tool in cardiovascular research.

A detailed description of a slightly modified Week's method has been given by Stanton (1971) . Improvements of the method for continuous direct recording of arterial blood pressure and heart rate in rats have been described by Buñag et al. (1971 ), Laffan et al. (1972 ), Buckingham (1976 , Garthoff and Towart (1981) , Garthoff (1983) . A detailed description of permanent cannulation of the iliolumbar artery was given by Remie et al. (1990) . Wixson et al. (1987) described a technique for chronic catheterization of the carotid artery in the rat.

Prepared cannulas are commercially available (IRC Life Science, Woodland Hills CA).

A newer modification uses the access to the aorta via the common carotid artery (Linz et al. 1992) . Rats are prepared under thiopental anesthesia with arterial PE-50 lines (Intramedic from Clay Adams, USA). The lines are introduced into the ascending aorta via the right carotid artery for direct measurement of arterial blood pressure and into the jugular vein for i.v. application of test compounds. Both lines, filled with saline containing heparin, are surfaced on the neck. The animals are allowed to recover for at least 2 days. Blood pressure is monitored through Statham R P23 Db transducers connected to a recording device. During measurements the lines are kept open with counter current saline infusion at a rate of 1 ml/h. Bao et al. (1991) placed one catheter via the right femoral artery in the abdominal aorta in rats for recording mean arterial pressure and two additional catheters via the left carotid artery into the descending aorta for application of bradykinin and bradykinin antagonists.

Arterial pressure was recorded in unanesthetized rats after induction of severe hypertension by complete ligation of the aorta between the origin of the renal arteries by Sweet and Columbo (1979) .

Hilditch et al. (1978) described a device for the direct recording of blood pressure in conscious dogs.

Akrawi and Wiedlund (1987) described a method for chronic portal vein infusion in unrestrained rats. Hepatic drug metabolism can be studied by infusion into the portal vein and blood collection from the femoral vein. Robineau (1988) described a method for recording electrocardiograms in conscious, unrestrained rats. Electrodes were implanted subcutaneously and a socket connector was sutured on the head of the animal. A flexible cord leading to a swivel collector was linked to an ECG amplifier. Kurowski et al. (1991) reported on an improved method to implant, maintain, and protect arterial and venous catheters in conscious rats for extended periods of time. Schenk et al. (1992) measured cardiac left ventricular pressure in conscious rats using a fluid-filled catheter.

Tsui et al. (1991) recommended a reliable technique for chronic carotid arterial catheterization in the rat.

Hagmüller et al. (1992) described a tail-artery cannulation method for the study of blood parameters in freely moving rats.

Liebmann et al. (1995) described an in vivo long-term perfusion system which is based on au-tomated, computer-controlled high-frequency heparin (10 U/ml) flushing of a cannula inserted into the tail artery of freely moving rats. Santajuliana et al. (1996) used conscious rats instrumented with arterial and venous catheters to assess neurogenic pressor activity after administration of ganglionic blockers.

Rezek and Havlicek (1975) described simple cannula systems for the infusion of experimental substances in chronic, unrestrained animals. A cannula with a removable cap is used for infusions into various parts of the digestive tract. Intravenous infusions can be performed through a closed system cannula which avoids a possible introduction of air into the circulation.

Kimura et al. (1988) described a method for chronic portal venous, aortic, and gastric cannulation to determine portal venous and aortic glucose and lactate levels in conscious rats. Permanent cannulation of the jugular vein in rats in combination with a head attachment apparatus allowing easy connection of cannulae was first introduced by Steffens (1969). Modifications were described by Brown and Hege (1972) , Nicolaidis et al. (1974) and

by Dons and Havlik (1986) . A detailed description was given by Remie et al. (1990) .

Rats are anesthetized with N 2 O 2 /O 2 /halothane. The shaven neck of the animal on the right side is disinfected with chlorhexidine solution. The incision is made just above the right clavicle. Connective and adipose tissue are pushed aside with blunt forceps and the jugular vein is exposed. The external jugular vein is followed and the division into the maxillary vein, the facial and the linguofacial vein identified. The largest vein is chosen and mobilized for a distance of about 5 mm. Small artery forceps are used to clamp the vessel. The vein is then ligated rostral to the clamp with 6-0 silk, and a second ligature is put loosely around the vessel, but not tightened. Using iridectomy scissors, a V-shaped hole is cut in the vein 2 mm rostral from the bifurcation. Prior to its insertion into the vessel, a sterile cannula is connected to a 1 ml syringe filled with a heparinized saline solution. The vessel is dilated by means of a sharp pointed jeweler's forceps, the cannula slit between the legs of the forceps and gently pushed into the vessel until the tip is at the level of the right atrium. Then the forceps is removed, the caudal ligature gently tied, and the rostral ligature used to anchor the cannula to the vessel. The cannula is tunneled to emerge at the top of the head. While the skin in the neck is held firmly, the artery forceps is inserted subcutaneously in caudal direction over a distance of about 3 cm, then turned anti-clockwise in the direction of the incision in the neck. The cannula is grasped with the forceps. Then the forceps is pulled back until the cannula emerges at the crown of the head and closed by a small microvascular clamp. The cannula is slid over the short end of a 20G stainless steel needle bent to a 90°angle. The catheter is flushed with saline and filled with polyethylene/heparin solution. The long end of the L-shaped stainless steel adapter is closed with a piece of heat-sealed PE-tubing and the wounds are closed with sutures.

Hutchaleelaha et al. (1997) described a simple apparatus for serial blood sampling from the external jugular vein which permits simultaneous measurement of locomotor activity in freely moving rats.

Brown MR, Hedge GA (1972) Thyroid secretion in the unanesthetized, stress-free rat and its suppression by pentobarbital. A detailed description for permanent cannulation of the renal vein in rats was given by Remie et al. (1990) .

Rats are anesthetized with N 2 O 2 /O 2 /halothane. After opening the abdominal wall, the intestines are lifted out and laid next to the animal on the right side (as viewed by the surgeon) on gauze moistened with warm saline solution. This provides an excellent view to the vena cava. At its confluence with the vena cava, the right renal vein is stripped of its adipose tissue and the peritoneum is opened. Using small anatomical forceps the peritoneum is detached from the vena cava by making small spreading movements with the forceps just beneath the peritoneum. Subsequently, the vena cava and the renal vein are mobilized for approximately 1.5 cm, to allow for clamping of the vessel. A four or five fine-stitch purse-string is placed in the vessel at the confluence of the vena cava and the right renal vein. Using a Barraquer needle holder and a cottonwool stick, the 7-0 silk suture, armed with a BV-1 needle, is guided through the vessel. After each stitch, any bleeding has to be immediately arrested by applying light pressure using a cotton-wool stick. Having completed the suture a single knot is made with the drawstrings. Three microvascular clips are then placed on the vena cava and the renal vein; first the proximal clip on the vena cava, followed by the clip on the renal vein and finally the distal vena cava clip. A small aperture is cut immediately inside the purse-string suture using iridectomy scissors and jeweler's forceps. The cannula, which is filled with a heparinized saline solution, is pushed into the opening as far as possible. Subse-quently, the purse-string suture is pulled taut and the clip of the renal vein removed, while pushing the cannula further. The proximal clip on the vena cava is now removed as quickly as possible. The patency of the cannula is checked and the drawstrings of the pursestring suture are used to anchor the cannula. The cannula is laid kink-free in the abdominal cavity and sutured to the internal abdominal cavity near the xiphoid cartilage. The abdomen is closed in two layers and the cannula tunneled to the top of the head. The cannula together with a L-shaped adapter is fixed to the skull. Remie et al. (1990) . After additional application of platinum electrodes around the portal vein in close proximity to the catheter tip, this model can also be used to study the presynaptic regulation of neurotransmitter release from nonadrenergic nerve terminals (Remie and Zaagsma 1986; Remie et al. 1988 Remie et al. , 1989 .

Rats are anesthetized with N 2 O 2 /O 2 /halothane. After opening the abdominal wall, the intestines are lifted out and laid next to the animal on the right side (as viewed by the surgeon) on gauze moistened with warm saline solution. Using a micro needle holder and a cotton-wool stick, a four or five, fine stitch purse-string suture (7-0 silk suture armed with a BV-1 needle) is placed in the wall of the portal vein at the side opposite the gastroduodenal vein. The diameter of the purse-string should be about 1 mm. After the suture has been completed a single knot is made with the drawstrings. The portal vein is clamped with a small curved hemostatic bulldog clamp. Using iridectomy scissors and a pair of jeweler's forceps the center of the purse-string is cut, a cannula filled with heparinized saline is inserted into the vessel and pushed upwards. The purse-string is gently tightened taking care not to obstruct the cannula. The drawstrings of the suture are used to anchor the cannula. The cannula is laid kinkfree in the abdominal cavity and sutured to the internal abdominal cavity near the xiphoid cartilage. The abdomen is closed in two layers and the cannula tunneled to the top of the head. The cannula together with a L-shaped adapter is fixed to the skull. Collection of lymph is rather difficult and has performed mainly in dogs (Biedl and Offer 1907; Gryaznova 1962 Gryaznova , 1963 Vogel 1963) . Some techniques have been described for the rat (Bollman et al. 1948; Girardet 1975) . Remie et al. (1990) did not obstruct the duct by placing a purse-string suture in the wall of the duct, by which the cannula is secured. The animal's lymph can be collected during the experiment, and after refilling the cannula the lymph flow remains undisturbed.

Rats are anesthetized with N 2 O 2 /O 2 /halothane. After opening the abdominal cavity, the intestines are placed in gauze moistened with warm saline and laid to the left of the animal. The suprarenal abdominal artery is located and mobilized by gently tearing the connective tissue. Using blunt dissection technique, the thoracic duct is mobilized along the dorsolateral surface of the aorta. A small three to four fine stitch pursestring suture is placed in the wall of the duct, using a 9-0 Ethilon suture. A hole is cut inside the pursestring with a very fine pair of scissors, while holding the wall with angled jeweler's forceps. The cannula which is filled with heparinized saline solution and is inserted into the duct using anatomical forceps.

After the tip of the cannula has been inserted into the thoracic duct, the curved forceps are removed and the total tip is pushed into the duct. The ligature is then closed and some lymph will flow into the cannula. The cannula is secured within the abdominal cavity by attaching it to the abdominal muscle near the xiphoid cartilage with a 7-0 silk suture. Following the closure of the abdominal wall and the tunneling of the cannula to the crown of the head, a Lshaped adapter is placed on the cannula, filled with PVP-solution and closed with a heat-sealed polyethylene cap.

In 1877 the Russian surgeon Eck reported the achievement of successful portacaval shunts in dogs. Lee and Fischer (1961 ), Funovics et al. (1975 ), de Boer et al. (1986 , described portacaval shunt in the rat. A detailed description of surgery for portacaval anastomosis in rats was given by van Dongen et al. (1990) .

Rats are anesthetized with N 2 O 2 /O 2 in combination with either enflurane, methoxyflurane or isoflurane. After opening the abdominal wall, the intestines are placed left to the animal on gauze moistened with warm saline solution. Proximally and distally to the animal's right renal vein, the vena cava is then stripped of its adipose and connective tissue, and the retroperitoneal cavity is opened. Using anatomical forceps the peritoneum is dissected from the vena cava by making small spreading movements with the forceps just above the vena cava. The portal vein is pulled slightly to the left using straight anatomical forceps and freed from the hepatic artery and the gastroduodenal artery with curved anatomical forceps. Rostral to the celiac artery, the abdominal artery which is covered with peritoneum is freed from its lateral muscle bed over a length of approximately 5 mm providing enough space for placing a small bulldog clamp at a later stage of the operation. Without occlusion a six fine-stitch purse-string is placed in the wall of the vena cava close to its confluence with the right renal vein. Using a Barraquer needle holder and a cotton wool stick, the 7-0 silk suture armed with a BV-1 needle is guided through the vessel. After each stitch, bleeding has to be arrested immediately, by applying light pressure on the area, again using the cotton wool stick. After the suture has been completed, a single knot is made with the drawstrings. The drawstrings should come together at the rostral part of the purse-string. A bulldog clamp, modified to resemble a Satinsky vascular clamp, is then placed on the vena cava. Before clamping the abdominal aorta rostral to the celiac artery with a small bulldog clamp, a ligature (7-0 silk) is placed around the portal vein as close as possible to the hilus of the liver. Subsequently, the clamp is placed on the aorta and the ligature tightened. A Heifetz clip is then placed transversely onto the portal vein at its confluence with the gastroduodenal vein. The portal vein is cut just distally from the ligature. A prepared button is slipped over the lefthand straight small anatomical forceps, while the righthand forceps are used to pass the portal vein to the left-hand anatomical forceps. The vein is then grasped and pulled through the button. Subsequently, the button is pushed as close as possible to the Heifetz clip, and clamped to the clip using a Pilling bulldog clamp.

Using small straight, and curved anatomical forceps the portal vein is reversed around the button and fixed with a previously prepared 7-0 silk suture. The Pilling bulldog clamp is then removed and replaced at the end of the Satinsky clamp for reasons of stability. The vena cava is then somewhat elevated, bringing it into closer contact with the portal vein button.

A longitudinal cut is made in the purse-string suture using iridectomy scissors and jeweler's forceps. One drawstring of the suture is clamped with a small hemostat and put under slight tension in a rostral direction. The button manipulated by its grip, is pushed into the vena cava. The purse-string is tightened with the left hand whilst the right hand still holds the button in position. The button is released and two additional knots tied. The Satinsky clamp is removed first followed by the Heifetz clamp and the bulldog clamp on the aorta. After replacing the intestines the abdominal wall is closed in two layers. 

To fully utilize the potential of mouse models with specific gene mutations, it is necessary to study the functional consequences of genetic manipulations in fully intact mice. Lorenz and Robbins (1997) developed and validated a methodology to study cardiovascular parameters in closed-chest mice.

Adult mice of either sex weighing 25-35 g are anesthetized by intraperitoneal injection of 50 mg/kg ketamine and 100 mg/kg thiobutabarbital. After the mice are placed on a thermally controlled surgical table with body temperature continually monitored via a rectal probe, a tracheotomy is performed with a short length (< 1 cm) of PE-90 tubing. The right femoral artery is then cannulated with polyethylene tubing which is pulled over a flame to a small diameter (∼0.4 mm OD). The catheter is advanced ∼1 cm, near the level of the aorta, and connected directly to a low-compli-ance COBE CDXIII fixed-dome pressure transducer for the measurement of arterial blood pressure. The right femoral vein is then cannulated with the same type of small-diameter tubing and connected to a microinjection pump for the infusion of experimental drugs. To assess myocardial performance, the right carotid artery is cannulated with a 2F Millar MIKRO-TIP transducer (Model SPR-407, Millar Instruments, Houston TX). This high-fidelity transducer, which has a tip diameter of ∼0.67 mm, has a reported frequency response that is flat up to 10,000 Hz and therefore can be used to accurately monitor the high frequency of the mouse ventricular pulse pressure. During continual monitoring of the blood pressure wave to ascertain the anatomic position of the catheter, the tip of the transducer is carefully advanced through the ascending aorta and into the left ventricle. When the stable waveform of the ventricular pressure profile is achieved, the transducer is anchored in place with 7-0 silk sutures. After completion of the surgery, all wounds are closed with cyanoacrylate to minimize evaporative loss of fluid, and the animals are allowed to stabilize for 30-45 min.

Blood pressure signals from the COBE transducer and from the Millar transducer are amplified and the output is recorded and analyzed with a MacLab 4/s data acquisition system connected to a Macintosh 7100/80 computer which allows the calculation of the following parameters: dP/dt first derivative of the ventricular pressure wave, MAP mean arterial pressure, HR heart rate, LVP systolic and diastolic left ventricular pressure, LVEDP left ventricular enddiastolic pressure.

Further indices of ventricular performance can be calculated from dP/dt. Champion et al. (2000) described a right-heart catheterization technique for in vivo measurement of vascular responses in lungs of intact mice. CD1 mice weighing 25-38 g were anesthetized with thiopentobarbital (85-95 mg/kg i.p.) and ketamine 3 mg/kg i.p.) and were strapped in supine position to a thermoregulated fluoroscopic table. The trachea was cannulated and the animals breathed with room air enriched with 95% O 2 /5% CO 2 . A femoral artery was cannulated for the measurement of systemic arterial pressure. Heart rate was electronically monitored from the systolic pressure pulses with a tachometer (Grass model 7P44A). The left jugular vein was cannulated for the administration of agonists and antagonists.

For measuring pulmonary arterial pressure, a special single lumen catheter was constructed. The catheter was 145 mm in length and 0.25 mm in outer diameter, with a specially curved tip to facilitate passage through the right heart, main pulmonary artery, and the left or right pulmonary artery. Before the catheter was introduced, the catheter curve was initially straightened with a 0.010-in. straight angioplastic guide wire to facilitate passage from the right jugular vein into the right atrium at the tricuspid valve under fluoroscopic guidance. As the straight wire was removed, the natural curve facilitated entry of the catheter into the right ventricle. A 0.010-in. soft-tip coronary artery guide wire was then inserted, and the catheter was passed over the guide wire into the main pulmonary artery under fluoroscopic guidance. Pressure in the main pulmonary artery was measured with a pressure transducer, and mean pulmonary artery pressure was derived electronically and recorded continuously.

Cardiac output was measured by the thermodilution technique. A known volume (20 µl plus catheter dead space) of 0.9% NaCl solution at 23°C was injected into the right atrium, and changes in blood temperature were measured at the root of the aorta. A cardiac output computer equipped with a small-animal interface was used. The thermistor microprobe was inserted into the right carotid artery and advanced to the aortic arch, where changes in aortic blood temperature were measured. A catheter placed in the right jugular vein was advanced to the right atrium or main pulmonary artery for rapid bolus injection of saline. The saline solution was injected with a constant-rate syringe to ensure rapid and repeatable injection of the saline indicator solution. Thermodilution curves were recorded on a chart recorder and pulmonary and systemic blood pressure monitored continuously. Catheter placement was verified by postmortem examination. At least 5 min are allowed between challenge doses to permit the measured parameters to return to baseline. Test drugs are injected at various doses followed by injections of the challenging drugs.

Dose-response curves of challenging drugs are established before and after injections of the test drugs.

Blood pressure experiments in anesthetized cats are very valuable as screening techniques for cardiovascular agents. Moreover, potentiation of norepinephrine response has been used as screening procedure for antidepressants with norepinephrine uptake inhibiting activity.

Sander (1965) investigated the vasoconstrictor and vasodilator effects of procaine in spinal cats. The animals were anesthetized with ether and ventilated with a positive pressure pump via a tracheal cannula. The spinal cord was then cut between the second and third vertebrae, and ether administration stopped. The remaining portion of the spinal cord above the transection was destroyed by passing a curette through the spinal canal. Yardley et al. (1989) studied cardiovascular parameters in spinal cats. The animals were anesthetized with 80 mg/kg intravenously administered αchloralose. The spinal cord was transected or crushed at the first cervical segment after tetracaine hydrochloride (0.125 mg in 0.1 ml) had been injected into this region of the cord. Systemic blood pressure was supported at a level sufficient to maintain constricted pupils (mean value 45 ± 5 mm Hg) by volume expansion with blood from a donor (10-20 ml) or an infusion of dextran. 

Sympathomimetic and cholinomimetic compounds as well as angiotensin II and carotid occlusion exert characteristic responses in blood pressure of anesthetized dogs. Antagonism or potentiation of these responses allow to characterize the cardiovascular activity of a new compound.

Adult Beagle dogs of either sex weighing between 8 and 15 kg are anesthetized with 15 mg/kg sodium thiopental, 200 mg/kg sodium barbital and 75 mg/kg sodium pentobarbital. Additional doses of sodium pentobarbital are given as needed. The dogs are intubated with a cuffed endotracheal tube and placed on a Harvard respirator (20 ml/kg, 10-15 cycles/min). A femoral vein and artery are cannulated using polyethylene tubing for drug administration and determination of arterial blood pressure, respectively. The animals are bilaterally vagotomized. The arterial cannula is connected to a Statham model P23Gb transducer. All recordings are made on a polygraph. Heart rate is determined with a Beckman Cardiotach connected to a voltage/pressure-pulse coupler.

Drug challenges: One of the following combinations of drugs is administered i.v. to the dogs. The challenges are given in a fixed order: at least twice prior to test drug administration to insure consistent responses and again starting 15 min post test drug. Epinephrine and norepinephrine (1 µg/kg), isoproterenol (0.25 µg/kg), carbachol (0.25 µg/kg), tyramine (100 µg/kg) are used; bilateral carotid occlusion (45 s), phenylephrine (10 µg/kg), isoproterenol (0.25 µg/kg) angiotensin II (0.2 µg/kg) and carbachol (0.25 µg/kg) for cardiovascular drugs. At least 5 min are allowed between challenge doses to permit the measured parameters to return to baseline. Challenge drug doses are sometimes varied to keep the mean arterial pressure within the following limits: epinephrine (+30 to +60 mm Hg), norepinephrine (-30 to +70 mm Hg), tyramine (+30 to +70 mm Hg), isoproterenol (-30 to -50 mm Hg), carbachol (-30 to -50 mm Hg), phenylephrine (-30 to +70 mm Hg), angiotensin II (+30 to +50 mm Hg), and bilateral carotid occlusion (+30 to +70 mm Hg).

The recordings are studied to detect any changes in the arterial pressure response to the challenge drug before and after test-drug administration and to observe any changes in blood pressure and heart rate. Results are expressed as the percentage change from the predrug response. 

The hemodynamic effects of compounds supposed to affect the cardiovascular system are evaluated by measuring preload and afterload of the heart, contractility, heart rate, cardiac output and peripheral or coronary flow. To measure these cardiovascular parameters accurately, the use of larger animals such as dogs or pigs is necessary. This experimental model allows the classification of test drugs according to their action as having:

• positive inotropic effects • negative inotropic effects (Ca 2+ -antagonist, anti-arrhythmic?) • hypertensive effects • hypotensive effects • coronary-dilating effects • β-blocking effects • α-blocking effects • anti-anginal effects • peripheral-vasodilating effects PROCEDURE Male or female inbred Beagle or Labrador-Harrier dogs weighing between 15 and 25 kg are used. They are anesthetized with a bolus injection of 35-40 mg/kg pentobarbital, and continued with an infusion of 4-6 mg/kg/h. A catheter is placed into the cephalic vein for intravenous injections. Another catheter is placed into the duodenum for enteral administration. Respiration is maintained with room air through a tracheal tube using a positive pressure respirator, e. g., Bird-Mark-7-respirator. Blood gas analyses are performed at regular time intervals. Oxygen is supplied via the respirator as needed.

Blood pressure is recorded through a cannula inserted into the left femoral artery and connected to a Statham pressure transducer (Statham P 23 DB).

For determination of LVP, a Millar microtip catheter (type PC 350) is inserted via the left common carotid artery into the left ventricle. LVEDP is measured on a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate is counted. The LVP-signal also triggers a cardiotachometer.

Cardiac output, pulmonary artery pressure (PAP) and stroke volume are measured by a thermodilution technique using a Cardiac Output Computer (Gould/Statham SP 1245) and a balloon-tip triple lumen catheter (Gould SP 5105, 5F) with the thermistor positioned in the pulmonary artery via the jugular vein.

Myocardial oxygen consumption (MVO 2 ) is calculated as pressure-work-index according to Rooke and Feigl (1982) .

Femoral blood flow and coronary flow are measured with electromagnetic flow probes attached to the femoral artery and the circumflex branch of the left coronary artery (LCX), respectively.

When stable hemodynamic conditions and blood gas values of pO 2 >100 mm Hg and pCO 2 < 35 mm Hg are achieved for at least 20 min (control values), the test substance is administered through a catheter inserted into a cephalic vein in doses of 0.1, 0.3, 1.0, and 3.0 mg/kg or into the duodenum in doses of 0.3, 1.0, 3.0, and 10.0 mg/kg.

All parameters are recorded continuously during the whole experiment. Results are presented as mean ± SEM with n > 3. Statistical significance is assessed by means of the paired t-test.

The effect of drugs on the carotid artery occlusion effect can be studied in anesthetized dogs. The occlusion of right and left common carotid arteries is performed by squeezing them between a polyethylene tubing and a twine which is passed inside the tubing and around the carotid artery. An occlusion of the carotid arteries for 30 s causes an increase of systolic blood pressure by 40-50 mm Hg. Inhibition of this effect by drugs is tested.

Studies in anesthetized dogs can be used to determine the influence of cardiotonic drugs on propranolol induced cardiac insufficiency (Rajagopalan et al. 1993) Instead of dogs, pigs (German landrace) weighing between 20-35 kg can be used. They are pretreated with ketamine 500 mg/5 ml i.m., methomidate hydrochloride 200 mg/4 ml i.p., xylazine 60 mg/3 ml i.m., and anaesthetized with 15-20 mg/kg pentobarbital sodium, followed by continuous infusion of 12 mg/kg/h. The parameters are evaluated similarly to the experiments in dogs.

Measurement of cardiac output by the thermodilution method in rats was described by Richardson et al. (1962) and Müller and Mannesmann (1981) .

Thermodilution methods were used by Rosas et al. (1964) in anesthetized rats, by Carbonell et al. (1985) and by Salyers et al. (1988) in conscious rats to determine hemodynamic parameters.

Oxygen pressure, carbon dioxide pressure and pH in coronary venous and common carotid arterial blood of anesthetized dogs has been measured using a blood gas analyzer (Aisaka et al. 1988) .

Acute ischemic left ventricular failure can be induced in anesthetized dogs by repeated injections of plastic microspheres into the left coronary artery (Smiseth and Mjøs 1982; Sweet et al. 1984; Schölkens et al. 1986) . A coronary catheter was introduced through the right femoral artery and advanced under fluoroscopy to the left coronary ostium, guided by injection of small amounts of contrast medium. After reaching baseline values, acute left ventricular failure was induced by subsequent intra-coronary injections of plastic microspheres (52.9 ±2.48 µm non-radioactive tracer microspheres). The microspheres were suspended in saline with a drop of Tween 80 and sonified before use, 1 mg microspheres/1 ml saline corresponding to approximately 12,000 microspheres. (13-16 injections of microspheres or 3.4-5.0 mg/kg). Microspheres were injected every 5 min for 70-90 min. Each microsphere injection effected an immediate and stepwise increase in LVEDP. With this procedure, LVEDP can be increased to a desired level in a very controlled manner. In the 30 min following embolization, LVEDP continued to increase by approximately 5 mm Hg. Animal with arrhythmias had to be excluded from the study. Thirty min after the end of embolization, when hemodynamic parameters had stabilized, drug administrations were started. Valdes-Cruz et al. (1984) developed an open-chest preparation in dogs to validate the accuracy of a twodimensional Doppler echocardiographic method for estimating pressure drops across discrete stenotic obstructions.

In order to assess the potential of a single breath technique (using freon-22) as an effective way to estimate cardiac output non-invasively, Franks et al. (1990) measured simultaneously with the single breath technique the aortic flow using an electromagnetic flowmeter in anesthetized dogs. 

The potency of a cardiovascular drug depends on the direct effects at the cellular level and on the response of the cardiovascular control mechanisms. The latter are often markedly influenced by anesthesia. The chronically instrumented conscious dog with renal hypertension is therefore a more realistic test model to evaluate the effects of antihypertensive, anti-anginal and cardiotonic compounds. The test is used to evaluate hemodynamic drug effects in conscious dogs, an experimental model with chronic arterial and ventricular catheterization and renal artery constriction.

Male or female Labrador-Harrier dogs weighing 15-25 kg are used. They are anaesthetized with 1 mg/kg xylazine i.m., followed by 1 mg/kg xylazine i.v. and 18 mg/kg pentobarbital sodium i.v. For chronic instrumentation and induction of renal hypertension, fluid-filled catheters are implanted into the abdominal aorta and into the left ventricle. The catheters are tunneled subcutaneously and exteriorized on the nape of the neck dorsally. Renal hypertension is induced by placing silastic constrictors around both renal arteries. Hemodynamic measurements are performed after a two-week recovery period or later.

To familiarize the dogs to the test surroundings, they are brought into the laboratory 2-3 times before the start of the study. Thus, drug testing is possible without sedation. During the experiment the animal rests quietly on a laboratory table.

Hemodynamic measurements are performed by connecting the two implanted catheters to Statham pressure transducers. Pressure signals, electronically dif-ferentiated LVP dp/dt max and heart rate are recorded with a polygraph.

After reaching stable hemodynamic conditions for at least 20 min (control baseline values), the test compound is administered either orally in a gelatin capsule or by intravenous injection into the cephalic vein.

Hemodynamic parameters are recorded continuously starting 30 min before to 120 min after drug administration, and thereafter at 1 h intervals until 6 h after dosage.

The following parameters are monitored:

• 

Mann et al. (1987) described a simple procedure for direct blood pressure measurement in conscious dogs using the Vascular-Access-Port™, consisting of a 33 × 13 mm reservoir body affixed to a silicon rubber catheter.

Müller-Schweinitzer (1984) described a method for the assessment of vasoconstrictor agents by recording venous compliance in the conscious dog. Changes in the diameter of the canine saphenous vein, produced by inflation to 45 mm Hg of a sphygmomanometer cuff placed on the upper hind leg, were recorded.

Hintze and Vatner (1983) compared the effects of nifedipine and nitroglycerin in conscious dogs, instrumented for instantaneous and continuous measurements of coronary arterial and left ventricular diameters with an ultrasonic dimension gauge, arterial and left ventricular pressure with implanted miniature gauges, and coronary blood flow with an electromagnetic flowmeter or a Doppler ultrasonic flowmeter. Shimshak et al. (1986) studied the recovery of regional myocardial contractile function after a 10 min coronary artery occlusion in chronically instrumented conscious dogs.

Wright et al. (1987) described a minimally invasive technique which allows assessment of histamine H 1receptor antagonist activity in conscious dogs based on the inhibition of tachycardia caused by intravenous ad-ministration of the H 1 -receptor agonist, 2-pyridylethylamine. Hashimoto et al. (1991) studied the coronary effects of nicorandil in comparison with nitroglycerin in chronic conscious dogs instrumented with ultrasonic crystals and electromagnetic flowmeters in the circumflex coronary artery.

Hartman and Warltier (1990) described a model of multivessel coronary artery disease using conscious, chronically instrumented dogs. A hydraulic occluder and Ameroid constrictor were implanted around the left anterior descending and the left circumflex coronary arteries. Pairs of piezoelectric crystals were implanted within the subendocardium of the left anterior descending and the left circumflex coronary artery perfusion territories to measure regional contractile function. A catheter was placed in the left atrial appendage for injection of radioactive microspheres to measure regional myocardial perfusion. Hof et al. (1990) used the Doppler method for measuring cardiac output in conscious rabbits. Grohs et al. (1993) simultaneously assessed cardiac output with pulsed Doppler and electromagnetic flowmeters during cardiac stimulation. 

Prior to studies in human beings, studies of cardiovascular effects of new drugs in monkeys are necessary in some instances.

Rhesus monkeys of either sex, weighing between 5 and 8 kg are anesthetized with 20 mg/kg ketamine hydrochloride followed by 50 mg/kg pentobarbital-Na given slowly i.v. A small side-branch of the femoral or radial artery is surgically exposed and cannulated for blood pressure recordings using a blood pressure transducer (P23 ID). Heart rate is determined from a conventional ECG lead by a biotachometer. Compounds are administered either intravenously or via a gastric fibroscope, e. g., Olympus XP 10, into the duodenum under visual control. The cardiovascular parameters are registered for a pretest period of 30 min and then during 60 min after intravenous administration or 2 h after intragastric administration of the test drug. Three to 6 animals are used for evaluation.

Mean values ± SD are calculated for the pretest period and for the cardiovascular effects every min for 5 min after i.v. administration and then every 5 min. After intragastric administration the values are registered every 5 min up to 30 min and then every 10 min. The values after administration of the test compound are compared statistically with the pretest values using the Student's t-test.

Lacour et al. (1993) studied cardiovascular parameters in conscious cynomolgus monkeys (Macaca fascicularis). A silicone catheter (internal and external diameter 0.64 and 1.19 mm, respectively) was implanted under aseptic conditions into the thoracic aorta via a carotid artery after the monkeys had been anesthetized with 40 mg/kg ketamine and 0.5 mg/kg acepromazine intramuscularly. The vascular catheter (filled with an aqueous solution of 40% polyvinylpyrolidone and 20% heparin) was inserted into a carotid artery. A patch of silicone was sewn around the artery to maintain the catheter in position, the latter being routed subcutaneously and exteriorized at the top of the head into a stainless steel connector. This connector was fixed to the skull with screws and dental cement, and sealed with a plug to protect the catheter from damage. The monkeys were permitted a 3-week minimum recovery period. Before the experiment was performed the monkeys were placed in a primate-restraining chair on several occasions, of gradually increasing duration, for experiment acclimatization.

Pulsatile arterial pressure was recorded by connecting the arterial catheter to a polygraph via a Statham P23Id pressure transducer. Mean arterial pressure and heart rate were derived from the pulse pressure signal and recorded. A catheter was inserted acutely into a saphenous vein for administration of compounds.

Lacour C, Roccon A, Cazaubon C, Segondy D, Nisato D (1993) Pharmacological study of SR 47436, a non-peptide angiotensin II AT 1 -receptor antagonist, in conscious monkeys. J Hypertens 11:1187-1194 Linz W, Klaus E, Albus U, Becker R, Mania D, Englert HC, Schölkens BA (1992) Cardiovascular effects of the novel potassium channel opener (3S,4R)-3-hydroxy-2,2-dimethyl-4-(2-oxo-1-pyrrolidinyl)-6-phenylsulfonylchromane hemihydrate. Arzneim-Forsch/Drug Res 42:1180-1185

The microsphere technique allows the measurement of cardiac output and regional blood flow. Using different radionuclides, repeated determinations are possible. The method is applicable not only for dogs, cats, and minipigs (Hof et al. 1980 ) but also for rats (McDevitt and Nies 1976; Bonnacrossi et al. 1978; Ishise et al. 1980; Stanek et al. 1985) using microspheres of appropriate size.

Male Sprague-Dawley rats weighing 265-375 g are anesthetized with 35 mg/kg i.p. pentobarbital. The right carotid and right femoral arteries are cannulated. Using pressure monitoring, a carotid cannula is manipulated into the left ventricle. Carbonized microspheres (15 ± 5 µ diameter) labelled with 85 Sr are drawn into a glass injection chamber and suspended in 0.3 ml 6% dextran so that each chamber contains 60000 to 80,000 microspheres. The radioactivity in each chamber is determined by gamma scintillation counting before and after microsphere injection, the difference being the amount of radioactivity injected. The microspheres are injected into the left ventricle in a total volume of 0.8 ml 6% dextran over 20 s. Simultaneously, arterial blood from the femoral artery is withdrawn at 0.8 ml/min for 90 s with a syringe withdrawal pump.

This reference blood sample is used to calculate the cardiac output by the formula:

cardiac output = counts injected × reference sample withdrawal rate reference sample counts

After obtaining the reference sample, the animals are sacrificed with pentobarbital and the organs dissected, placed in counting vials, and counted for 5 min. Regional distribution of the cardiac output is calculated by comparing the radioactivity in each organ with the total injected radioactivity. Organ flow is determined by multiplying the cardiac output by the fractional distribution of the cardiac output to the organ.

Problems associated with the microsphere technique in rats are the hemodynamic effects of the solutions used to inject the microspheres and the effects of blood withdrawal after repeated determinations (Stanek et al. 1985) .

For repeated determinations, other nuclides have been used, such as 46 Sc, 51 Cr, 141 Ce, 125 I (Hof et al. 1980) . Kovách et al. (1992) used up to 5 radiolabelled microspheres ( 57 Co, 113 Sn, 85 Sr, 95 Nb and 46 Sc) for measurement of regional cerebral blood flow in cats.

Faraci and Heistad (1992) measured blood flow with radioactive microspheres (15 µ diameter) labeled with 46 Sc, 95 Nb, 153 Gd, 85 Sr, and 141 Ce in anesthetized rabbits. Grover et al. (1990) , Gross et al. (1992) measured myocardial blood flow in dogs with the radioactive microsphere technique.

Kowallik et al. (1991) measured regional myocardial blood flow with multiple colored microspheres. The method yielded values very similar to those obtained with radioactive microspheres. The skin on the ventral side of the neck is carefully shaved and disinfected. The course of the carotid artery is outlined by palpation along the tracheal border. About 2 cm of skin is taken on each side marking the width of the flap. The medial incision is made slightly above the thyroid cartilage and is extended caudal to a point about 1 cm lateral and 1 cm above the manubrium sterni. The lateral incision again lies about 2 cm from the line of the carotid artery and parallel to it. The lateral incision is only half as long as the medial one. The incisions are made down to the subcutaneous tissue over the platysma muscle. Between the skin and the muscle, the flap is undermined. All bleeding points are carefully clamped and tied.

The subcutaneous tissue, the platysma myoides muscle and the anterior fascia of the neck are incised in the course of the midline incision down to the plane of cleavage between the sternohyoid and sternomastoid muscle. By blunt dissection, these muscles are separated, disclosing at their depth the neurovascular bundle over which lies the internal jugular vein. The floor of the space so isolated is formed by the longus capitis muscle. By careful dissection, these muscles are separated at least 1 cm above and below the limits of the incision in the skin. The superior thyroid artery marks the uppermost portion of the carotid artery suitable for exteriorization. The plane of cleavage is followed caudal to the origin of the sternocleidomastoid muscle at the manubrium sterni. Throughout the limits of the incision the artery is dissected free from the internal jugular vein and then from the vagus nerve.

The first step in the exteriorization of the artery is the reapproximation of the muscle borders beneath the vessel by mattress sutures. In order to prevent tension on the completed loop due to contraction of the sternomastoid and sternohyoid muscle, it is important to reapproximate these muscles throughout their course. Sutures are placed at the edges of skin. The tubular flap of skin is then approximated loosely around the carotid artery. It is essential that the skin flap fits loosely around the artery. A continuous suture of fine silk is started at the place where the vessel emerges from the muscle borders. The suture is so placed as to include the artery in a sling of skin which isolates the vessel from the line of suture of the underside of the completed loop. Finally, the proximal and distal quarters of the flap are closed with sutures, while the skin tube is closed with a continuous suture. Antibiotics are given locally and systemically.

One thickness of gauze is placed beneath the loop and along each border a strip of gauze in order to relieve the loop from the pressure caused by the reminder of dressings. Around the neck is wrapped a gauze bandage several turns of which have passed behind the forelimbs in order to prevent the dressing from riding upwards on the animal's neck. Over this is placed a plaster roll protecting the loop from the animal's efforts of scratching. The dressings are changed on the fifth and seventh day when the sutures can be removed.

Blood pressure measurements can be made according to Riva-Rocci's principle by placing a inflatable cuff around the loop.

The carotid artery loop method needs some surgical experience and very meticulous caretaking of the animals. 

Ultrasonic transducers are constructed and implanted as described by Stinson et al. (1974) .

To measure left ventricular external diameter (LVED), two ultrasonic transducers are fixed to the left ventricular wall. One crystal is sutured to the posterior wall within the rectangular area formed by the left circumflex coronary artery and the left posterior descending artery. The other one is placed near the first diagonal branch of the left anterior descending coronary artery. Exact positioning is assured with an oscilloscope.

To measure left ventricular internal diameter (LVID), the transducers are placed in the same anatomical area as for the epicardial crystals. However, they are pushed through the wall of the left ventricle through stab wound incisions. The crystals are positioned across the greatest transverse diameter of the left ventricle, one on the anterior and the other on the posterior endocardial wall.

Bleeding during the implantation procedure is controlled by umbilical tapes around the cranial and caudal veins and by purse string sutures at the implan-tation sites. The pericardial incision and the chest is closed by sutures and the transducer wires are connected to the recording equipment.

In each dog, either LVED or LVID is measured together with the other hemodynamic parameters.

Blood pressure is recorded through a cannulated femoral artery by a pressure transducer (Statham P 23 DB).

For determination of LVP, a Millar microtip catheter (type PC 350) is inserted via the left A. carotis communis. LVEDP is measured on a high-sensitivity scale. From the pressure curve, dp/dtmax is differentiated and heart rate is calculated.

Hemodynamic parameters are recorded continuously during the whole experiment.

When stable hemodynamic conditions are achieved for at least 30 min (control values), the test substance is administered by intravenous or intraduodenal injection.

Readings are taken at times 0, 15, 30, 45, 60, 75, 90 and 120 after drug administration. Left ventricular dimensions are measured at the end of the diastole and systole.

Characteristics:

• blood pressure -systolic blood pressure -diastolic blood pressure • left ventricular pressure, LVP • left ventricular enddiastolic pressure • left ventricular contractility, dp/dt • heart rate, HR • left ventricular external diameter, LVED • left ventricular internal diameter, LVID

Changes in parameters after drug administration are compared to control values obtained during the 30 min pre-drug period.

Statistical significance is assessed by means of the paired t-test.

Since a change in the diameter of the left ventricle is a reasonable accurate index of left ventricular volume, a reduction of LVED or LVID with no change in dp/dt and HR can be considered as a strong indicator for "venous pooling" and thus an anti-anginal activity of a compound.

Scores are allotted relative to the efficacy of standard compounds assessing the intensity as well as the duration of the effect.

Standard data: 

Radiotelemetry allows the recording of cardiovascular parameters in conscious, free-moving animals. Several authors (Brockway et al. 1991; Mattes and Lemmer 1991; Guiol et al. 1992; Morimoto et al. 1992; Basil et al. 1993; Brockway and Hassler 1993; Lemmer et al. 1993 Lemmer et al. , 1994 Lemmer et al. , 1995 Calhoun et al. 1994; Diamant et al. 1993; Kramer et al. 1993a Kramer et al. , 1995 Griffin et al. 1994; Kuwahara et al. 1994; Sato et al. , 1995 van den Buuse et al. 1994; Kinter 1996; Becker et al. 1997; Witte et al. 1998 ) used commercially available systems with some modifications to study the circadian rhythm of blood pressure and the influence of drugs on heart rate, blood pressure and motility in rats.

The telemetry and data acquisition system (e. g., Data Sciences International, Inc., St Paul MN) consists of four parts: 1. the implantable transmitter, which measures the pressure. This device contains a highly stable, ionimplant, semiconductor, strain-gauge sensor and battery-powered electronics to process the information from the pressure sensor and to telemeter it from within the animal. Arterial pressure is transmitted to the sensor via a 0.7-mm diameter, fluidfilled catheter; 2. the receiver which detects the signal from the implanted transmitter and converts it to a form readable by computer; 3. the pressure reference module, which measures atmospheric pressure to allow for the telemetered absolute pressure to be converted to a gauge pressure; 4. the data acquisition software, which accepts data from the reference module and the receivers, filters corrupt samples from the incoming data stream, converts the telemetered pressure to millimeters of mercury, subtracts atmospheric pressure from the telemetered pressure, and stores the data for retrieval, plotting, and analysis. Under pentobarbital anesthesia, the telemetry transmitter is implanted into rats. The descending aorta is exposed between the renal arteries. A vascular clamp is made by putting two surgical threads on the proximal and distal part of the artery. The catheter tip is inserted through an incision in the vessel. A drop of cyanoacrylate glue is applied to the dried entry point. The transmitter is sutured to the abdominal musculature.

Data from individual animals are recorded over long periods of time which allow the investigator to follow the circadian rhythm under several experimental conditions. Hess et al. (1996) monitored pulmonary arterial pressure in freely moving rats by inserting the sensing catheter of a telemetric system through a small hole and pushing it into the pulmonary artery.

Further cardiovascular studies in rats using the telemetric system were reported by Sgoifo et al. (1998 ), Webb et al. (1998 . Kramer et al. (1993b) used telemetry to record electrocardiogram and heart rate in freely moving mice.

Carlson and Wyss (2000) used small telemetry probes for long term recording of arterial pressure and heart rate in mice after implantation to the carotid artery or the abdominal aorta. DePasquale et al. (1994) used radiotelemetry to monitor cardiovascular function in conscious guinea pigs.

Telemetric ECG recordings in cardiomyopathic hamsters were reported by Desjardins et al. (1996) .

Van den Buuse and Malpas (1997) studied cardiovascular parameters in rabbits by radiotelemetry.

Astley et al. (1991), Smith et al. (1993) used telemetric systems to monitor cardiovascular responses in baboons.

Schnell and Wood (1993) measured blood pressure and heart rate by telemetry in conscious, unrestrained marmosets.

An ultrasonic blood flowmeter telemetry system for cats and rabbits has been described by Yonezawa et al. (1989 Yonezawa et al. ( , 1992 .

Telemetry was used by Symons et al. (1992) to monitor the severity of events representing myocardial dysfunction in miniswine.

Savory and Kostal (1997) applied the telemetric system for chronic measurement of cardiovascular and other parameters in chicken.

Radiotelemetry has also been used for other pharmacological experiments, such as field potential analysis by radioelectroencephalography (see Sect. E.1.2.6), step through passive avoidance (see Sect. F.3.1.2), shock-prod burying test in rats (see Sect. E.2.5.3), measurement of body temperature (see Sect. H.4.0.2) and motility in rats and mice (Clement et al. 1989; Guillet et al. 1990; Diamant et al. 1993 ; van den Buuse 1994). 

Several drugs, like α 2 -adrenergic agonists, act primarily at central sites. Their effects can be most clearly demonstrated after injection into the cerebroventricular system. The first experiments have been performed in cats. The method has been adapted to rats.

Rats of either sex weighing 250-350 g are anesthetized with 100 mg/kg hexobarbital i.p. The scalp is cut in a sagittal line. With a dental drill a hole of 1-1.5 mm diameter is drilled through the cranial bone 1 mm lateral and 2 mm caudal of the bregma. A PVC-catheter is introduced perpendicular to the bone to a depth of 3 mm in order to reach the lateral cerebral ventricle. The catheter is fixed with dental cement and the wound closed. Test substances are administered through the catheter. To measure blood pressure one catheter is placed in one carotid artery and connected to a Statham transducer. Blood pressure and heart rate are recorded on a polygraph over a period of at least 30 min. For long acting drugs registration periods up to 2 h are necessary. After the experiment, the animal is sacrificed and the brain removed to confirm the site of injection.

Systolic and diastolic blood pressure as well as heart rate after intracerebroventricular injection are expressed as percentage of pretreatment values. The response is compared with the standard clonidine which is effective in doses of 4-60 µg. 

Orthostatic hypotension with dizziness up to unconsciousness is a syndrome occurring in many human individuals. Moreover, several drugs are known to cause orthostatic hypotension. In several animal species, such as rabbit, cat and dog, this syndrome can be evoked by changing the usual horizontal position into a vertical position with the head upwards using a tilting table.

Cats of either sex weighing 2.0-3.0 kg are temporarily anesthetized with ether. Anesthesia is maintained by intravenous injection of 70 mg/kg chloralose. The animal is fixed with its legs on a heated operating table which can be tilted by 90 degrees. The carotid artery is cannulated for measuring blood pressure through a Statham P 23 Db transducer on a 6 channel Hellige recorder. The femoral vein is cannulated for injection of the test compound. After the blood pressure is stabilized for 30 min, the animal is quickly tilted to a vertical position for 1 minute. Due to the change of position and gravitational force, there is a rapid fall in blood pressure which recovers as soon as the animal is restored to its original position. After taking the control reading, the test compound is administered intravenously and the same procedure is repeated. The fall in blood pressure is recorded.

A significant increase in postural hypotension with respect to the control would indicate that the test compound may produce orthostatic hypotension in human. Moreover, some compounds, like sympathomimetics, can reduce or prevent postural hypotension.

Sponer et al. (1981) Humphrey and McCall (1982) described a model for predicting orthostatic hypotension during acute and chronic antihypertensive drug therapy in rats anesthetized with chloralose, urethane and pentobarbital using a heated tilting table. Lee et al. (1982) evaluated postural hypotension induced by drugs in conscious restrained normotensive rats. Blood pressure was recorded after cannulation of the femoral artery under light ether anesthesia. A special tilting table was build for simultaneous studies in four rats. Martel et al. (1996 Martel et al. ( , 1998 ) studied the phenomenon of cardiovascular deconditioning observed in crew members of space flights in rats after tail suspension. Socci et al. (2000) studied cardiovascular responses to simulated microgravity in Sprague-Dawley rats. Microgravity is known to induce orthostatic intolerance and baroreflex impairment in astronauts. The authors used 30°head-down tilt, 24-h whole-body suspension or 7-day tail suspension to mimic microgravity and to find treatment ameliorating the symptoms. Baum et al. (1981) studied antihypertensive and orthostatic responses to drugs in conscious dogs. A catheter was placed in the subclavian artery for measurement of blood pressure and exteriorized at the back of the neck some days prior to the experiment. The animals were placed into a sling and tilted to the 90°upright position for periods of 60 s. every hour by lifting their forelimbs. Blood pressure response before and after treatment with test drugs was measured.

A none human primate model for evaluating the potential of antihypertensive drugs to cause orthostatic hypotension was described by Pals and Orley (1983) Polyvinyl catheters were implanted in the abdominal aorta and the vena cava via an external iliac artery and vein to cynomolgus monkeys during ketamine anesthesia. The catheters were routed subcutaneously from the groin area to the top of the head and exteriorized. After recovery the animals were placed in restraining chairs allowing the change from vertical to horizontal position. 

The circulatory collapse after intravenous injection of veratrine has been first described in cats and is known as BEZOLD-JARISCH-reflex (Bezold and Hirt 1867; Jarisch and Richter 1939a, b, Jarisch 1940; Aviado and Guavera-Aviado 2001). Fleckenstein et al. (1950) recommended this as a suitable animal model of shock. The original observation was a triphasic blood pressure response in cats or dogs characterized by a short lasting fall in blood pressure accompanied by bradycardia, followed by a short lasting increase and than a long-lasting decrease of blood pressure after intravenous injection of veratridin or other veratrum alkaloids. Kalkman et al. (1984) showed that three distinct subtypes of serotonergic receptors mediate the triphasic blood pressure response to serotonin observed in the Bezold-Jarisch reflex.

The Bezold-Jarisch reflex has been studied in several species, such as cats (Takei et al. 1995; Vayssettes-Couchay et al. 1997) , dogs (Zucker and Cornish 1981; Barron and Bishop 1982; Harron and Kobinger 1984; Giles and Sander 1986; Baugh et al. 1989; Watson et al. 1995) , ferrets (Andrews and Bhandari 1993), rabbits (Chen 1979) , guinea pigs, rats (Fozard 1984; Gylys et al. 1988; Cohen et al. 1989; Blower 1990; Miyata et al. 1991; Turconi et al. 1991; Matsumoto et al. 1992; Meller et al. 1992; Robertson et al. 1992; Kishibayashi et al. 1993; Geissler et al. 1993; Haga et al. 1994; Hegde et al. 1994; Eglen et al. 1995; Göthert et al. 1995; Delagrange et al. 1996; De Vries 1997; Malinowska et al. 2001; Godlewski et al. 2003) and mice (Eglen et al. 1994; Middlefell et al. 1996) , whereby species differences have been observed (Yamono et al. 1995) .

In cats and dogs, the Bezold-Jarisch reflex was elicited by veratrine and veratridine, but also by capsaicin and the 5-HT 3 receptor agonists 2-methyl-5-HT, phenylbiguanide, chlorophenylbiguanide and serotonin itself.

In rats, mostly 5-HT or 2-methyl-5-HT were used as stimuli to characterize 5-HT 3 receptor antagonists.

Male Sprague Dawley rats weighing 250-380 g are given food and water ad libitum, except those used for intraduodenal drug administration; these rats are deprived of food overnight. The animals are anesthetized by intraperitoneal injection of 1.5 g/kg urethane. Body temperature is maintained at 37°C by placing the animal on a heating pad. The left jugular vein or duodenum, trachea and left femoral vein are cannulated for drug administration (i.v. or i.d.), facilitation of respiration and injection of 2-methyl 5-HT, respectively. Heart rate is derived from a limb lead II ECG monitored via subdermal platinum electrodes and is recorded with amplifiers on a polygraph. A dose-response curve to 2-methyl 5-HT (5-100 µg/kg, i.v.) is constructed in each rat to establish a submaximal dose (usually 10 or 20 µg/kg, i.v.) which elicits a reproducible bradycardic response. Each rat receives then a single dose of test drug or standard and is then challenged with 2-methyl 5-HT at 5, 15, 30, 60, 120, 180, 240, 300, 360, 420, and 480 min post dosing. A separate group of rats receiving vehicle (saline for i.v., deionized water for i.d.) is similarly tested in each study.

Duration of action of the compounds is assessed by determining the period of time for which the inhibitory effects remain significantly different from vehicle controls. Statistical analysis of the data is performed by a repeated measure analysis of variance (ANOVA) followed by pairwise comparisons against control at each time period using Fisher's multiple comparison test.

Harron and Kobinger (1984) used capsaicin to elicit the Bezold-Jarisch reflex in anesthetized artificially respirated dogs pretreated with a beta-adrenoceptor antagonist to evaluate the activity of clonidine-like drugs on central alpha 2 adrenoceptors after intracisternal administration.

The Bezoold-Jarisch reflex in rats has been used for evaluation of 5-HT 3 receptor agonists (Rault et al. 1996; López-Tudanca et al. 2003) . Rocha et al. (2003) found an enhancement of the Bezold-Jarisch reflex in the acute phase of myocardial infarction of the anesthetized rabbit.

Andrews PLR, Bhandari P (1993) Resinferatoxin, an ultrapotent capsaicin analogue, has anti-emetic properties in the ferret. 

Many bacterial infections as well as allergic reactions are known to induce pathophysiological events that may lead to shock in man. When experimental animals are injected with endotoxin and galactosamine, shock and death occur in all untreated animals 5-7 h after injection. The endotoxin induced shock is marked by pulmonary embolism, bronchospasm and renal failure. Bacterial liposaccharides (endotoxins) play an important role in the pathogenicity of Gram-negative infections. The reactivity of animals to endotoxin may be enhanced by simultaneous administration of galactosamine. Galactosamine is a specific hepatotoxic agent that leads to early metabolic alterations and consequent cellular liver damage. The following procedure is used to detect compounds that prevent the occurrence of endotoxin-induced shocks.

Cardiovascular parameters of endotoxin induced shock are greatly influenced by various anesthetics. For this reason, a model was proposed by Brackett et al. (1985) and Schaefer et al. (1987) to study the circulatory shock pattern after endotoxemia in conscious unrestrained rats.

Male Sprague-Dawley rats weighing 300 ± 10 g are anesthetized with 5% enflurane. A tracheal cannula is connected to a rodent respirator delivering 2% enflurane. Via the right jugular vein the tip of one catheter is placed just adjacent to the right atrium for injection of endotoxin, monitoring of central venous pressure, and rapid injection of room-temperature saline to produce thermodilution curves for calculation of cardiac output. The right carotid artery is cannulated with a thermistor-catheter combination for measurement of thermodilution cardiac output curves and aortic blood pressure. The thermistor tip is placed in the aortic arch just distal to the aortic valve. The catheters are guided under the skin exiting through the back of the neck just below the base of the skull.

The animals are allowed to regain consciousness and are then placed in cages that allow unrestrained movements about the cage at all times throughout the study with no further handling. The experimental animals receive a 20-sec infusion of 40 mg/kg endotoxin (E. coli, Difco) being paired with sham animals with identical catheters but receiving an equal volume of saline. Test compounds are injected intravenously 10 min prior to endotoxin injection. Cardiac outputs are measured using the thermodilution technique by rapidly injecting a volume calculated to deliver 100 µl of room temperature saline to the circulatory system. Central venous and aortic blood pressure and heart rate are continuously monitored for the following 4 h. Cardiac output measurements are made 5, 15, 30, 60, 120, 180, and 240 min after endotoxin. At the end of the study, the animals are sacrificed and the catheters checked visually to ensure proper placement.

Central venous pressure, arterial pressure, and cardiac output of drug treated animals receiving endotoxin are compared with animals receiving endotoxin only and saline sham treated animals. Furthermore, cardiac index, total peripheral resistance, and stroke volume are calculated. The small intestines of all rats are examined for severity of hemorrhage using a five point scale. Repeated-measures analysis of variance is used to analyze the data. Lindenbaum et al. (1990) studied the effect of E. coli endotoxin on cardiovascular parameters of anesthetized dogs. Inhibition of the detoriation of metabolic functions and improvement of cardiovascular parameters were found after cocarboxylase treatment.

Endotoxin induced shock has been tested in mice (Galanos et al. 1979 ). Groups of 10 male C57 BL/6 mice weighing 20-22 g are injected intravenously with a mixture of 0.01 µg of Salmonella abortus equi lipopolysaccharide and 7.5-15 mg galactosamine in 0.02 ml phosphate buffered saline. The test compound is administered either intravenously at the same time or orally 45 min prior challenge. Twenty-four hours later, the number of surviving mice is determined.

Metz and Sheagren (1990) Male CD mice (20-22 g) were treated intraperitoneally with zymosan (500 mg/kg, suspended in saline solution) or with zymosan and drug (rosiglitazone 3 mg/kg, intraperitoneally) at 1 and 6 h after zymosan. Eighteen hours after administration of zymosan, animals were assessed for nonseptic shock. Clinical severity of systemic toxicity was scored for the whole experimental period (12 days) in the mice after zymosan or saline injection on a subjective scale ranging from 0 to 3: 0 = absence, 1 = mild, 2 = moderate, 3 = serious. The ranging scale was used for each of the toxic signs (conjunctivitis, ruffled fur, diarrhea, and lethargy) observed in the animals. The final score was the sum of the single evaluation (maximum value 12).

Overbergh et al. (2003) studied acute shock induced by antigen in NOD mice. The 8-week-old NOD, BALB/c, and C57BL/6 mice were immunized by injection of 100 µg antigen [Hen egg white lysozyme (HEL), GAD65 (p524-542) (SRLSKVAPVIKARM-MEYGTT), bovine insulin B (ins-B) chain, heat shock protein (hsp)-65, PLP peptide (amino acids 135-151), ovalbumin, keyhole limpet hemocyanine (KLH), and tetanus toxin] emulsified at a 1:1 concentration in complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (Difco Laboratories, Detroit, Mich., USA) in the hind footpads. NOD-scid mice were injected with 100 µg HEL antigen suspended in CFA. All mice were reinjected with the same antigen 3 weeks later in a similar manner. Clinical evolution and survival rate after sensitization with various peptides were monitored in different mouse strains. Shock was characterized by pilo-erection, prostration, erythema of the tail, ears, and footpads, and dyspnea with shallow breathing. Serum for antibody measurement and spleens for quantification of mRNA levels were collected before immunization and again before booster administration. Baldwin et al. (1991) tested the effect of Polymyxin B on experimental shock from meningococcal lipooligosaccharide and Escherichia coli lipopolysaccharide endotoxins in anesthetized rabbits.

Muacevic and Heuer (1992) tested the effect of platelet-activating factor antagonists in anesthetized rats. Otterbein et al. (1993) tested the effects of peptides on survival of mice injected with 50 mg/kg lipopolysaccharide endotoxin in mice and on survival of rats with fecal peritonitis. Mountz et al. (1995) reported an increased susceptibility of fas mutant MRL-Ipr/Ipr mice to Staphylococcal enterotoxin B-induced septic shock. 

Hemorrhagic shock is one of the most severe consequences of accidents. Several animal models in various species have been developed to resemble the conditions in man and to test therapeutic or prophylactic measures (Lamson and de Turk 1945; Selkurt and Rothe 1961; Mills 1976) . A method for hemorrhagic shock in anesthetized as well as in unanesthetized rats has been described by van der Meer et al. (1987) . Experimental hemorrhagic shock is defined as a situation in which the cardiovascular system, after a period of hypovolemia followed by complete re-infusion of the shed blood, gradually detoriates ending in the death of the animal.

Female rats weighing 170-190 g are anesthetized by i.p. injection of sodium pentobarbital, 25 m/kg, followed after 20 min by 20 mg/kg, and kept in a chamber at 30°C and relative humidity over 80%. The left femoral vein is cannulated for application of the test drug. The right common iliac artery is cannulated and the cannula (polyvinyl chloride, 14 cm long, inner diameter 2 mm) is filled with heparin and exteriorized in the neck. After intraarterial injection of 0.2 ml heparin 500 IU/ml, the cannula is connected to a siliconized calibrated glass reservoir (inner diameter 18 mm), the height of which can be changed to adjust the surface of the shed blood to a fixed level. The test drug is injected i.v. 5 min prior to bleeding. Bleeding is performed against (at heart level) 30 mm Hg for 1 h, 25 mm Hg for 0.5 h, 30 mm Hg for 1 h, 25 mm Hg for 0.5 h, and finally 30 mm Hg for 1 h. The shed blood is partially taken up again spontaneously. After 4 h, re-infusion is started by increasing the pressure to 60 mm Hg for 5 min, to 80 mm Hg for 5 min, and (if necessary) to 100 mm Hg. During the hypovolemic phase respiration becomes gradually slower. If respiration arrest is imminent 0.5 ml 5% glucose are injected intra-arterially, thus avoiding death during the period of hypovolemia. Practically all rats die at an average of 4 h after complete re-infusion.

Survival time is taken as the time between complete re-infusion and death. Average survival time of treated animals is compared with that of controls. Furthermore, after autopsy the number of gastrointestinal lesions, subendocardial hemorrhage, kidney tubular necrosis and liver cell necrosis are registered by histological examination.

In spite of the fact that hemorrhagic shock does not reflect the situation of traumatic shock in man in every aspect, the condition is close enough to use the model for testing compounds which potentially inhibit or ameliorate shock in man.

A method to study hemorrhagic shock in dogs has been described in detail by Mills (1967) . Large dogs weighing 20-30 kg are anesthetized by an i.v. injection of 25 mg/kg sodium pentobarbital. The animals are respirated by means of a Harvard respirator set at a stroke volume of 400 ml and a rate of 20 respiration/min. Blood pH is regulated between 7.37 and 7.42 by varying the gas flow between 100% O 2 and a mixture of 95% O 2 and 5% CO 2 . Central arterial blood pressure is recorded by inserting a catheter through one femoral artery to the aortic arch. Pulmonary artery pressure is measured by inserting a PE 50 catheter through a small neck vein, reaching the right ventricle and allowing to float into the pulmonary artery. The right atrial catheter is also inserted through a small neck vein. After the chest is opened, the left atrial catheter is tied in place through a small opening in the left atrial appendage. Blood flow is measured in the ascending aorta (cardiac output), carotid, superior mesenteric, renal and femoral arteries using electromagnetic flowmeters. Furthermore, pulse rate is monitored from the electrocardiogram.

The test drug is injected i.v. 10 min prior bleeding. Blood is removed either at a specific volume or until a selected reduction of blood pressure has occurred. The cardiovascular parameters of treated animals are compared with those of controls.

Shock associated with hemoconcentration was produced in dogs by Davis (1941) by bleeding from the carotid artery and injections of 25% sodium chloride solution subcutaneously in doses of 25 ml.

The effect of insulin on glucose uptake in the soleus muscle of rats during hemorrhagic shock was studied by Chaudry et al. (1975) . Bauer et al. (1995) used hemorrhagic shock in rats to evaluate the influence of interleukin-1 on leukocyteendothelial cell interactions and the microcirculation in the liver by means of intravital microscopy after application of an interleukin-1 receptor antagonist. Kitajima et al. (1995) studied gastric mucosal injury induced by hemorrhagic shock in rats. 

Compression of extremities in man by heavy objects for periods of several hours results in the so-called crush syndrome. The rescued individual shows immediately a favorable response to therapy, but within a few hours symptoms of shock develop followed by signs of progressive renal damage leading to death (Duncan and Blalock 1942) . Moreover, arterial bleeding after accidents needs the applications of tourniquets. During surgical procedures on extremities a tourniquet may be necessary (Wilgis 1971), the time of which has to be limited in order to avoid fatal consequences. The pathophysiological mechanisms of tourniquet induced shock remain still to be elucidated. Nevertheless, animal models in rats (Chandra and Dave 1970) , rabbits (Little 1974), and dogs (Goto et al. 1988 ) had to be developed to evaluate drugs capable to inhibit the fatal consequences of crush and tourniquet shock.

Wistar rats of either sex weighing 250-280 g are anesthetized with phenobarbital. The tourniquets consist of rubber tubes (internal diameter 4 mm, external diameter 5.8 mm). Both tights are fastened by the rubber tubes and the pressure which is monitored by a miniature pressure sensor and an amplifier (e. g. Kyowa Electronic Instruments Co, Tokyo) is adjusted to 1.5 kg/cm 2 . The rubber tubes are knotted and the sensor removed. After 3 h the animals are treated with the test compound or the control solution. The tourniquet is left in place for 6 h while the animals remain under pentobarbital anesthesia. Then, the rubber tubes are removed, and the rats are returned to their cages. Within a few min, the reperfused hind limbs, which have been pale blue, turn pink. The animals are then allowed free access to food and water. Blood is withdrawn at different intervals during the tourniquet and afterwards for measurement of hematocrit, transaminases, urea nitrogen and total protein. Time to death is registered.

Statistical evaluation of the survival intervals is performed with the log rank test according to Peto et al. (1976) . Blood chemical data are analyzed using the Kruskal-Wallis (1952) rank sum test. Multiple comparisons are corrected by the Bonferroni's method (1980) .

These methods are valuable to find drugs effective in this life-threatening situation. Ghussen et al. (1979) studied the effect of methylprednisolone on the experimental tourniquet shock in dogs. Haugan and Kirkebo (1984) used a model in anesthetized rats with tourniquet shock by bilateral hindlimb occlusion for 3 1/2 h, and burn shock by scalding the hind 50% of the body surface for 30 s in 90°C water. Horl and Horl (1985) investigated the effect of tourniquet ischemia on carbohydrate metabolism in dog skeletal muscle Sáez et al. (1982) followed the time course of appearance of lactic dehydrogenase enzymes in the serum of rats after different periods of ischemia by bilateral application of rubber band tourniquets to the hind legs. Sáez et al. (1986) studied the effects of allopurinol on biochemical changes of the gastrocnemius muscle in rats subjected to tourniquet shock followed by reperfusion.

Little RA (1974) 

Heat stroke is a medical emergency where quick diagnosis and treatment of victims are essential for positive prognosis. Several animal models have been established by investigators in heat related studies. Rats (Francesconi and Mager 1978; Hubbard et al. 1977 Hubbard et al. , 1979 Kielblock et al. 1982) , rabbits (Shih et al. 1984 ), dogs (Bynum et al. 1977 ) and sheep (Tayeb and Marzouki 1990) are considered to be the most suitable models because of their similarity to man in response to high temperature.

Male Sprague Dawley rats weighing 450 to 550 g are fasted 18-24 h before the experiment. For prevention studies the animals are treated subcutaneously 1 h before either being restrained in an appropriate wire cage which is placed into an environmental chamber set at 41.5°C ambient temperature or being exercised in a motor-driven treadmill. Core temperature (rectal probe inserted 6.5 cm) are measured using copper/constantan thermocouples in conjunction with a thermocouple reference oven and a 10-channel data acquisition system with a teletype printout. After reaching exhaustion or a predetermined core temperature, all rats are monitored at 26°C ambient temperature while resting in plastic cages lined with wood shavings. After recovery, animals are returned to their cages and allowed water but no food for 24 h.

LD 50 values are determined in treated and control animals. Kielblock et al. (1982) analyzed cardiovascular function by direct recording of arterial blood pressure and ECG-analysis. Francesconi and Mager (1978) studied pathochemical indices, such as serum lactate concentration, potassium levels and plasma creatine phosphokinase. Kregel et al. (1988) investigated peripheral vascular responses to hyperthermia in the rat by implantation of Doppler flow probes on the superior mesenteric, left iliac or left renal, and external caudal arteries. They concluded that a selective loss of compensatory vasoconstriction triggers the cascade of events that characterize heat stroke.

Shido and Nagasaka (1990) studied thermoregulatory responses to acute body heating in rats acclimated to continuous heat exposure. Indirect external warming was performed by raising the jacket water temperature surrounding the calorimeter from 24 to 39°C. Intraperitoneal heating was made through an electric heater implanted chronically in the peritoneal cavity. Chiu et al. (1995) reported an increased survival in rat heatstroke by reducing hypothalamic serotonin release after administration of interleukin-1 receptor antagonist. 

A simple method to test mydriatic substances is the test on the mouse pupil as described by Pulewka (1932) . The diameter of the pupil is narrowed by intensive light illumination. A dose-dependent increase of pupil diameter can be achieved by intraperitoneal application of atropine and synthetic mydriatics (Ing et al. 1950; Burn et al. 1950) . The mydriatic effect of hexamethonium analogues has been measured by Blackman et al. (1956) . Mydriasis is induced by norepinephrine, epinephrine and isoproterenol and can be antagonized by αor β-blockers (Freundt 1965).

Male mice weighing 15-20 g are used. They are kept for at least 30 min in separate beakers under bright illumination before the pupil diameters are measured with a dissecting microscope containing an arbitrary scale in the eyepiece. To make the illumination as uniform as possible, the beakers containing the mice are placed beneath long low-power fluorescent tubes and on top of glossy white paper. The pupil diameter is measured in mm before and at various time intervals after treatment. Groups of 5-10 mice are used for each dose of compound and for vehicle control.

To test sympatholytic activity, various doses of the αor β-blocker are injected subcutaneously 30 min prior to intravenous injection of 0.1 mg/kg norepinephrine, or 0.05 mg/kg epinephrine, or 20 mg/kg isoproterenol. The effect of norepinephrine is blocked by α-blockers, but not by β-blockers, the effect of epinephrine by both αand β-blockers, and the effect of isoproterenol by β-blockers, but not by α-blockers.

The mean values of diameters in the groups treated with αor β-blockers are compared with those of an-imals treated with norepinephrine, epinephrine or isoproterenol only. Edge (1953) used mydriasis in the mouse as a quantitative method of estimating parasympathetic ganglion block. Håkanson et al. (1987) used the isolated iris sphincter of pigmented rabbits to test multiple tachykinin pools in sensory nerve fibres. The eyes were taken out within 1 min after sacrifice and opened by an incision 2-3 mm posterior to the limbus, followed by excision of the iris from the ciliary margin. The iris sphincter muscle was then opened, cut in half and mounted vertically on a Perspex holder in a 7 ml tissue bath maintained at 35 o C. The mechanical activity after electrical stimulation was recorded isometrically using a force displacement transducer and a polygraph. Kern (1970) used isolated sphincter and dilator muscles from human eyes obtained at autopsy for studies on sympathomimetics and adrenergic blocking agents. Cholinotropic and αand β-adrenergic receptors were identified.

Responses to bradykinin and or capsaicin of the isolated iris sphincter were considered to be mediated by substance P released from the trigeminal nerve (Ueda et al. 1984) .

Pupillary dilatation can be used as an index for central nervous system α 2 -adrenoreceptor activation (Koss 1986).

Clonidine induces mydriasis which is mediated by α 2 -adrenoreceptors located in the brain (Berridge et al. 1983; Hey et al. 1985) . Blockade of presynaptically located α 2 -adrenoreceptors is considered as a possible mechanism for antidepressant drugs. Mianserin was able to antagonize clonidine-induced mydriasis in the rat.

Gower at al (1988) studied a large number of psychotropic drugs in this model with the aim to reveal in vivo α 2 -adrenoreceptor blocking effects of new compounds.

Male Wistar rats weighing 230-300 g were anesthetized with pentobarbital, 60 mg/kg i.p., and a polyethylene catheter was inserted into the femoral vein for drug administration. The rat's head rested on the base platform of a binocular Olympus microscope positioned so that the pupil diameter of the right eye could be measured by means of a micrometer inserted into one eyepiece of the microscope. A constant light intensity was maintained throughout the experiment. Rats were first injected with saline 25 min after anesthesia induction. The pupil diameter was measured 1 min after injection. Five min after measurement, mydriasis was induced by clonidine (0.1 mg/kg, i.v.) and the diameter was measured 1 min after injection. This was followed by the test compound, injected at 6 min intervals at increasing doses. The pupil was measured at 1 min after each injection. The dose inhibiting 50% of the clonidine-induced mydriasis (ID 50 ) was determined per rat from the cumulative dose-response curve. Savontaus et al. (1997) studied the effect of an imidazoline derivative against detomidine-induced mydriasis in anesthetized rats. 

In young chicks, clonidine causes a loss of righting reflex which is antagonized by mianserin (Pommier et al. 1982) . This phenomenon was used to measure α 2adrenoceptor blockade in vivo by Gower et al. (1988) .

Male white Leghorn chicks are used either a few hours after hatching or 1 or 2 days later. Clonidineinduced loss of righting reflex (sleep) is determined with 8 animals at a time. Two animals are treated with placebo and 2 with each of 3 dose levels of the test compound. Tests with groups of 8 animals are continued until 10 animals are tested per dose level or placebo treatment. The chicks are marked with ink and injected intraperitoneally with placebo or the test compound. Ten min later, 1.2 mg/kg clonidine is injected into a leg muscle and the animals are placed individually in small Macrolon cages. The beginning of sleep time is defined as the moment at which the animals can be placed on their back and remain in this position. Sleep time is recorded until they return to their feet spontaneously or another attempt to put them on their back fails. Sleep time is recorded for a maximum period of 30 min.

Statistical evaluations of differences in median sleeping times are done with the Mann-Whitney U-test. Dose-response relations for various drugs can be calculated.

Compounds with known α 2 -adrenoceptor blocking activity antagonize clonidine-induced sleep in chicks dose-dependently. Yohimbine is one of the most active compounds. However, also other centrally active compounds of which their main effect is not α 2 -blockade, reduce clonidine-induced sleeping time. One of the most potent is apomorphine acting on dopamine D 2receptors. Therefore, the clonidine-induced sleeping test in chicks can not be regarded as highly specific for α 2 -adrenoceptors. 

The relative potency of catecholamines as stimulants of β-adrenoreceptor mediated responses vary in different tissues indicating the existence of two subtypes of β-receptors (β 1 and β 2 ) (Lands et al. 1967) . βadrenoreceptors in the heart have been classified as being of the β 1 -subtype. β-adrenoreceptors in the uterus, diaphragm, bronchioles and small intestine have been classified as being of the β 2 -subtype, since in these tissues, epinephrine is more potent than norepinephrine. These observations led to the development of selective agonists and antagonists. Isolated organs (see below) having predominantly one receptor subtype, such as the isolated heart and the isolated atrium for β 1 , and the isolated uterus or the isolated tracheal chain for β 2 , are used to test compounds for selective activity. Assessing both activities in the same animal in vivo results in the advantage that pharmacokinetic and metabolic influences of the drug being tested are the same for both parameters.

Female Sprague-Dawley rats (200-220 g) are anesthetized with 60 mg/kg pentobarbital i.p. prior to pithing (Gillespie and Muir 1967) . The animals are artificially respired with room air using a Harvard small animal ventilator (90 strokes/min at a pressure of 7 cm H 2 O). Body temperature is maintained by placing the animals on a heated operating table. The left carotid artery is cannulated for continuous monitoring of blood pressure via a Statham p23Id pressure transducer. The blood pressure signal is used to trigger an instantaneous rate meter for continuous monitoring of heart rate. A femoral vein is cannulated for intravenous administration of drugs. A midline incision is made to expose one horn of the uterus. The ovarian artery is cut, tied and one horn dissected free from the ovary leaving the myometrial blood supply intact. A cotton thread is attached to the free end of the uterine horn, passed through a glassjacketed organ bath and connected to an isometric (Pioden UF1) transducer for measurement of spontaneous contractions. A cannula is inserted into the peritoneal cavity for administration of drugs by the i.p. route. The organ bath is positioned such that it surrounds the uterine horn without touching it. The tissue is perifused with Krebs-Henseleit solution being gassed with 95% O 2 /5% CO 2 and maintained at 37°C. A resting tension of 0.2 g is applied to the tissue, which is allowed to stabilize until spontaneous contractions are constant over a period of 5-10 min. All recordings are made on a polygraph.

Dose-response curves after i.v. injection are established for isoprenaline (nonselective between β 1and β 2 -adrenoreceptors), salbutamol (selective for β 2adrenoreceptors), and noradrenaline (selective for β 1adrenoreceptors) in increasing heart rate (beats/min) and decreasing the height of uterine contraction (calculated as percentage of the original amplitude). Animals given noradrenaline are pretreated with phenoxybenzamine (3.3 mmol/kg i.v.) in order to antagonize irreversibly the α-adrenoreceptors. Agonist dose-response curves (n > 4) on heart rate and uterine relaxation are carried out by assessing the activity of at least 3 doses of each agonist. New synthetic compounds can be tested after intraperitoneal administration additionally.

The ability of a non-selective β-blocker, such as propranolol (1 mmol/kg i.v.), a β 1 -selective β-blocker, such as atenolol, and a β 2 -selective β-blocker to inhibit responses to isoprenaline on both heart rate and uterine relaxation is assessed by comparing the log linear portion of the dose-response curve to isoprenaline in the absence and in the presence of the βadrenoreceptor antagonist in the same animal. Dose ratios for each antagonist are calculated.

The method described by Piercy (1988) has the advantage to measure both agonistic and antagonistic activity and to differentiate between effects on β 1 -and β 2adrenoreceptors. Compared to tests in isolated organs, in vivo activity can be determined after intraperitoneal or intraduodenal administration. Härtfelder et al. (1958) studied the influence of various agents on the contractions of electrically stimulated isolated uteri of rabbits and guinea pigs. Nathason (1985) evaluated the activity of betablockers to inhibit the cardio-acceleratory effect of systemically administered isoproterenol in unanesthetized, restrained albino rabbits together with the effect on membrane bound adenylate cyclase in homogenized ciliary process villi in order to find compounds selectively lowering intraocular pressure. Gillespie JS, Muir TC (1967) Intravenous administration of isoprenaline (isoproterenol) stimulates β 1 -receptors of the heart which can be detected as an increase in contractility (dp/dt max). Intraarterial injection of isoprenaline stimulates β 2receptors of peripheral blood vessels leading to an increased peripheral blood flow. Therefore, a β 1 -or β 2blocking activity of a compound is revealed by the inhibition of the effects of isoprenaline. The following tests are used to evaluate β-blocking activity of drugs. A β-blocker screening is done in anesthetized dogs (a); in addition, the test allows a differentiation between β 1 -and β 2 -receptor activity and the determination of ED 50 values (b).

Male or female Beagle dogs weighing about 20 kg are used. Animals are premedicated with 1 g Inactin(i.v.) and anesthetized by intravenous administration of 20 mg/kg chloralose and 250 mg/kg urethane. In addition, they receive a subcutaneous injection of 2 mg/kg morphine 1 h after the start of anesthesia. Animals are heparinized. Respiration is maintained through a tracheal tube using a positive pressure respirator. Endexpiratory CO 2 content is measured continuously; respiratory rate and depth of respiration are adjusted to 4.5-6 vol% end-expiratory CO 2 . For administration of isoprenaline, a peripheral vein is cannulated.

For recording of peripheral systolic and diastolic blood pressure, a cannula inserted into a femoral artery is connected to a pressure transducer (Statham p 23 DB). For determination of LVP, a Millar microtip catheter (PC 350) is inserted via the left arteria carotis communis. LVEDP is measured from a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate is counted. Peripheral blood flow in the femoral artery is measured with an electromagnetic flow probe.

Following a steady-state period of 30-60 min, isoprenaline is administered intravenously 2-3 times to the anesthetized animal and hemodynamic parameters are recorded (control values = 100%). Then, the test substance is injected intravenously at cumulative doses (final concentrations of 0.01, 0.05 and 0.15 mg/kg). For each dose, 10 min "drug effects" are monitored by measuring hemodynamic parameters. Then the effect of isoprenaline is tested again (3 times) .

In other experiments, a single dose of the drug is administered to determine the duration of action.

If a test compound does not show an inhibitory influence on isoprenaline effects, a second test compound is administered.

All hemodynamic parameters are registered continuously during the whole experiment. 50 Following a steady-state period of 30-60 min, isoprenaline is administered for i.v. administration (β 1 -test) twice at a dose of 0.5 µ g/kg and for intraarterial administration (β 2 -test) twice at a dose of 0.05 µg/kg. Hemodynamic parameters are recorded (control values = 100%). Then, the test substance is injected intravenously at cumulative doses. Consecutively increasing doses are given at 15-min intervals. For each dose, 10 min "drug effects" are monitored by measuring hemodynamic parameters. Thereafter isoprenaline is given intravenously and 5 min later intra-arterially.

All hemodynamic parameters are registered continuously during the whole experiment. β 1 -receptor antagonism is measured as a decrease in contractility (dp/dt max).

Inhibition of the isoprenaline-induced elevation of heart rate is considered as an indicator for non-selective β-blockade. For cardioselective β-receptor blockers the increase in dp/dt max is inhibited with lower doses of test drug than the rise in heart rate.

β 2 -receptor blockade by a test drug is measured as inhibition of the isoprenaline-induced increase in peripheral blood flow.

The different hemodynamic parameters are determined.

Percent inhibition of the isoprenaline-induced effects by a test compound is calculated and compared to the isoprenaline effects before drug administration ( = 100%).

ED 50 values for β 1 -and β 2 -antagonism are calculated by log-probit analyses. ED 50 is defined as the dose of drug leading to a 50% inhibition of the isoprenaline effects.

An ED 50 β 1 /ED 50 β 2 -ratio of < 1 indicates that a βblocking agent predominantly influences β 1 -receptors (cardioselectivity). READING Turner RA (1971) β-adrenergic blocking agents. In: Turner RA, Hebborn P (eds) Screening methods in pharmacology. Vol II. pp 21-40. Academic Press, New York and London

β-blocking agents can be classified as • β-blocking agents with intrinsic sympathomimetic activity (ISA), • β-blocking agents with membrane stabilizing activity (MSA), • β-blocking agents with organ selectivity (high affinity to heart β 1 -receptors).

In the following procedure with reserpine-pretreated dogs, β-blocking agents with intrinsic sympathomimetic activity can be identified. Reserpine administration 24 h before the start of the experiment leads to a depletion of catecholamine depots. Thus, it is possible to differentiate between indirectly acting sympathomimetics such as tyramine and directly acting ones such as noradrenaline. This test is used to identify β-blocking drugs with intrinsic sympathomimetic activity.

Male or female Beagle dogs weighing about 15 kg are used. Twenty-four h before the test, dogs receive an intramuscular injection of 0.3 mg/kg reserpine. At the day of the experiment, the animals are anesthetized by intravenous administration of 10-20 mg/kg pentobarbital sodium. Respiration through a tracheal tube using a positive pressure respirator is controlled by measuring end-expiratory CO 2 concentrations (4-5 vol%).

For recording of peripheral systolic and diastolic blood pressure, a femoral artery is cannulated and connected to a pressure transducer (Statham p 23 DB). For determination of LVP, a Millar microtip catheter (PC 350) is inserted into the left ventricle via the left common carotid artery. LVEDP is measured from a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate is counted.

The test substance is administered by continuous intravenous infusion of 0.02 mg/kg (1 ml/min) until a cumulative dose of 3 mg/kg is achieved (within approximately 150 min). Thereafter, the velocity of infusion is doubled (0.04 mg/kg, 2 ml/min). The test is finished when a cumulative dose of 7 mg/kg is achieved (after a total time of approximately 250 min).

Hemodynamic parameters are registered continuously during the entire experiment.

Characteristics:

• blood pressure -systolic blood pressure -diastolic blood pressure • left ventricular pressure, LVP • left ventricular enddiastolic pressure, LVED • dp/dt max • heart rate, HR

The different hemodynamic parameters are determined. As a measure for intrinsic sympathomimetic activity (ISA), the increase in dp/dt max and in heart rate are evaluated. Absolute and relative differences of these parameters in drug-treated animals are compared to vehicle control values. Statistical evaluations are performed by means of the Student's t-test if n > 4.

Scores are allotted relative to the efficacy of standard compounds for intensity as well as for duration of the effect.

DiPalma (1964) 

Nicotinic acetylcholine receptors are involved in the ganglionic neurotransmission. Various subtypes are described for nicotinic acetylcholine receptors (Sargent 1993; McGehee and Role 1995; Karlin and Akabas 1995; Alexander et al. 2001) . The nictitating membrane of the cat has been used extensively in pharmacological studies to evaluate ganglion blocking activity because of the ease with which its movements can be recorded, because of the simplicity of its innervation (the purely adrenergic fibres have their cell bodies in the easily accessible superior cervical ganglion of the same site) and because its blood supply (via the external carotid artery) is accessible for intraarterial injections. Preganglionic and postganglionic stimulation allow the interpretation of the mode of action of vasoactive drugs.

The animal is anesthetized with 35 mg/kg pentobarbitalsodium i.p. Tracheostomy is performed and a tra-cheal cannula is inserted. On one side, the sympathetic nerve is exposed, separated from the vagus nerve and prepared in order to place electrodes for preganglionic and postganglionic stimulation. Preferably, the vagus nerve at this site is severed at the central end. The head of the animal is fixed in a head holder to prevent head movements. A linear transducer is fixed at the mid of the border of the nictitating membrane allowing the registration of the contractions on a polygraph. Preganglionic and postganglionic stimuli are exerted by a square wave stimulator, with a pulse width of 0.3 to 0.5 ms, an amplitude of 1-3 V, and a frequency of 20/min. The amplitude and pulse width varies from animal to animal. The sympathetic nerve is stimulated before and after the administration of the compound and the changes in the contraction of the nictitating membrane are noted. Furthermore, the response of the nictitating membrane to exogenous adrenaline is registered.

The decrease of the response after drug application is expressed as percentage of the control before drug. Ganglionic blockers decrease the response to preganglionic stimulation but have no influence on postganglionic stimulation or exogenous adrenaline. Neuronal blockers decrease the response to both preganglionic and postganglionic stimulation but do not affect the response to exogenous adrenaline which may even be enhanced. α-receptor blockers decrease the response to both preganglionic and postganglionic stimulation as well as decrease the effect of exogenous adrenaline. Catecholamine uptake inhibitors increase the response to both preganglionic and postganglionic stimulation as well as enhance the response to exogenous adrenaline.

The nictitating membrane preparation has been widely used for differentiation of cardiovascular effects. Since the use of higher animals such as cats has been limited to a great extent, this model is now being used only exceptionally.

As alternative, the contraction of the inferior eyelid of anesthetized rats after preganglionic electrical stimulation of the superior cervical ganglion has been recommended (Gertner 1956; Steinbrecher and Schmid-Wand 1986) . In the modification used by Steinbrecher and Schmid-Wand (1986) the method is suitable for testing compounds with potential adrenergic and antiadrenergic activity but not for testing ganglion blocking activities.

Male Sprague Dawley rats are anesthetized with 100 mg/kg thiobutabarbital i.p. and kept on a heated operation table at a rectal temperature of 37°C. One femoral vein is cannulated and filled with 4% heparin solution. One femoral artery is cannulated for registration of blood pressure. Tracheotomy is performed and a polyethylene catheter of 5 cm length inserted. The head of the animal is fixed carefully. The vibrissae at the lower eyelid on the right side are cut, a thread attached at the margin of this eyelid and attached to a strain-gauge. To immobilize the musculature of the face, the mouth of the animal is sutured and the head support attached. The right sympathetic nerve is exposed, separated from the vagus nerve and prepared in order to place electrodes for preganglionic stimulation. For calibration, stimulation is performed twice with an interval until contraction is back to baseline. Furthermore, a dose of 0.001 mg/kg adrenaline is given as bolus injection. Eyelid contraction and blood pressure increase are recorded. Then the putative adrenergic blocker or the standard 1.0 mg/mg phentolamine are injected intravenously. Eyelid contraction after electrical stimulation or after adrenaline is reduced dosedependently. Quilliam and Shand (1964) assessed the selectivity of drugs by comparing the effects on ganglionic transmission and on the pre-and post-ganglionic nerves in the isolated superior cervical ganglion preparation of the rat.

Langer and Trendelenburg (1969) performed experiments with normal nictitating membranes of pithed cats as well as with isolated normal nictitating membranes.

Koss and Hey (1992) used frequency-dependent nictitating membrane responses by sympathetic nerve stimulation in anesthetized cats to determine the potential role of prejunctional histamine H 3 receptors. Gurtu et al. (1992) used contractions of the cat nictitating membrane to explore the effects of calcium channel blockers on neurotransmission in vivo, by comparing the effects of verapamil and nifedipine on contractions of nictitating membrane following either electrical stimulation of the superior cervical ganglion or intravenous injection of phenylephrine.

Koss (1992) compared the peripheral and central nervous system sympatholytic actions of prazosin using the cat nictitating membrane. Submaximal contractions of the nictitating membranes were evoked by electrical stimulation of the preganglionic cervical sympathetic nerve trunk and by stimulation of the posterior hypothalamus in anesthetized cats. Badio et al. (1996) evaluated spiropyrrolizidines, a new structural class of blockers of nicotinic receptor channels with selectivity for ganglionic type receptors in rat pheochromocytoma PC12 cells (with an α 3 β 4(5) -nicotinic receptor) and human medulloblastoma TE671 cells (with an α 1 β 1 γ δ-nicotinic receptor). 

The use of the bovine retractor penis muscle for the assessment of ganglion-blocking activity of neuromuscular blocking drugs has been recommended by Alaranta et al. (1990) and Klinge et al. (1993) . Klinge and Sjöstrand (1974) performed not only extensive studies on the physiology and pharmacology of the retractor penis in the bull, but also discussed the various hypotheses on inhibitory and excitatory innervation of this muscle, which is present in many vertebrates such as horses, cats, dogs and rats, but not in men and rabbits. They also found that the effects on the isolated retractor penis muscle and on penile arteries are rather similar. The excitatory innervation was found to be predominantly α-adrenergic (Klinge et al. 1970; Klinge and Sjöstrand 1977) whereas other transmitters such as histamine and bradykinin were effective only in some species. Relaxation of the isolated retractor penis muscle could be elicited by nicotine and other nicotinic agonists (Klinge et al. 1988 ). In the studies on ganglion-blocking activity, strips of the retractor penis muscle are precontracted by 5-hydroxytryptamine. Relaxation induced by nicotine is antagonized by ganglion-blockers.

Retractor penis muscles are obtained from bulls of different breeds weighing 250-500 kg. Samples are dissected 10-30 cm distal to the points where the paired muscle bundles pass the anal orifice. Immediately after slaughter, the samples are freed from fat and other surrounding tissue and placed into Tyrode solution at 2-4°C. Strips, 15-25 mm in length and 2-3 mm wide, are prepared and mounted in 20-ml organ baths containing Tyrode solution at 35°C aerated with 95% O 2 and 5% CO 2 . An equilibrium time of 2 to 4 h is allowed. During the equilibrium period washed are performed at about 60-min intervals. Changes in tension are recorded by means of Grass FT 03 force displacement transducers coupled to a polygraph.

A high-enough tone for studying the nicotineinduced relaxation, usually 8-15 g, is generated by adding 5-HP in a concentration between 0.1 and 6 µM to the organ bath. Washing is performed 2 min after application of nicotine; 60-80 min later the tone is again raised and the application of nicotine is repeated. The effect of a neuromuscular blocking drug is studied only if the relaxations caused by nicotine in two consecutive controls are equal in size.

The blocking activity of a certain concentration of a drug is expressed as % reduction in the relaxation of the muscle strip, according to the following equation:

Where A is the size of the control relaxation in millimeters, and B is the size of the relaxation of the blocking drug. In order to construct regression lines, the activity of four or five dose levels from the assumed linear part of the concentration-effect curve is studied. The activity of each dose level is studied in at least 5 strips obtained from different animals. IC 50 values are calculated from the regression lines. The parallelism of the regression lines is tested by covariance analysis.

Molar potency ratios of known ganglion-blocking agents obtained with this method were compared with the results of other methods, such as inhibition of contraction of cat nictitating membrane evoked by preganglionic sympathetic stimulation (Bowman and Webb 1972; see 1.3.29), inhibition of nicotine-induced contraction of the isolated guinea pig ileum (Feldberg 1951) , inhibition of contraction of guinea pig vas deferens evoked by preganglionic stimulation of the hypogastric nerve in vitro (Birmingham and Hussain 1980), depression of postganglionic action potentials evoked by preganglionic stimulation of the superior cervical ganglion of the rat in vitro (Quilliam and Shand 1964) , induction of mydriasis in mouse by blocking the ciliary ganglion (Edge 1953). A fair but not a complete agreement between the results obtained with various methods was found. Gillespie and Sheng (1990) studied the effects of pyrogallol and hydroquinone on the response to nonadrenergic, non-cholinergic nerve stimulation in the rat anococcygeus and the bovine retractor penis muscles. Parkkisenniemi and Klinge (1996) used samples of retractor penis muscles and penile arteries from bulls for functional characterization of endothelin receptors. La et al. (1997) studied the inhibition of nitrergic nerve-induced relaxations in rat anococcygeus and bovine retractor penis muscles by hydroxycobalamin. 

After the blood pressure has reached a constant value, doses of 1, 2, 4 and 16 µg/kg of the test compound are injected via the jugular vein. Blood pressure is recorded.

In 10 min intervals doses of 0.5; 1.0; and 2.0 µg/kg angiotensin II are injected to establish dose-response curves. After 10 min, continuous infusion is started of the potential angiotensin II blocker in a dosage of 10 µg/kg/0.1 ml/min. Ten min after beginning of the infusion, again doses of 0.5; 1.0; and 2.0 µg/kg angiotensin II are injected.

In this set-up, angiotensin II is administered as continuous infusion at a dosage of 1 µg/kg/0.02 ml/min. When blood pressure has reached an elevated steady state level, 0.1 mg/kg of the angiotensin II antagonist is administered. Intensity and duration of the fall of blood pressure are recorded.

An increase of blood pressure indicates the intrinsic agonistic activity.

Increases of blood pressure after graduated doses of angiotensin II during the infusion is expressed as per-centage of the increase before infusion. The results are compared with known angiotensin II antagonists.

In this test not only potency and duration of activity but also the intrinsic agonistic activity of an angiotensin II antagonist can be tested.

Various other pharmacological models have been used to test angiotensin II antagonists:

Blood pressure in conscious unrestrained rats with chronically implanted catheters with normal blood pressure, spontaneous hypertension and chronic renal hypertension (Vogel et al. 1976; Chiu et al. 1989; Brooks et al. 1992; Aiyar et al. 1995; Deprez et al. 1995; Gabel et al. 1995; Hilditch et al. 1995; Keiser et al. 1995; Nagura et al. 1995; Nozawa et al. 1995; Renzetti et al. 1995; Wong 1995; Junggren et al. 1996) , Blood pressure in conscious spontaneously hypertensive and in anesthetized ganglion-blocked rats (Olins et al. 1993) , Blood pressure in pithed and in conscious renovascular hypertensive rats (Criscone et al. 1993; Wienen et al. 1993; Deprez et al. 1995; Kivlighn et al. 1995a; Kushida et al. 1995) , Blood pressure in rats after intracerebroventricularly injected angiotensin II (Vogel et al. 1976; Batt et al. 1988 ), Blood pressure in conscious angiotensin I-infused and renin-dependent hypertensive dogs (Brooks et al. 1992; Cazaubon et al. 1993; Aiyar et al. 1995; Deprez et al. 1995; Gabel et al. 1995; Keiser et al. 1995; Wong et al. 1995) , Blood pressure and heart rate in conscious sodiumdepleted and sodium-repleted cynomolgus monkeys (Lacour et al. 1993; Cazaubon et al. 1993; Keiser et al. 1995) , Angiotensin II induced pressor responses in marmosets (Nagura et al. 1995) , Blood pressure and heart rate in conscious rhesus monkeys and anesthetized chimpanzees (Gabel et al. 1995; Kivlighn et al. 1995b; Kivlighn et al. 1995c) .

Inhibition of angiotensin II-induced contraction in isolated aorta rings or strips from rabbits (Chui et al. 1989 (Chui et al. , 1990 Criscione et al. 1993; Cazaubon et al. 1993; Olins et al. 1993; Wienen et al. 1993; Aiyar et al. 1995; Caussade et al. 1995; Hilditch et al. 1995; Keiser et al. 1995; Kushida et al. 1995; Nagura et al. 1995; Renzetti et al. 1995; Wong et al. 1995) , from rats (Nozawa et al. 1997) , from neonatal rats (Keiser et al. 1993) , from guinea pigs (Mizuno et al. 1995) , Inhibition of angiotensin II-induced contraction in isolated rat pulmonary artery (Chang et al. 1995) , Antagonism against angiotensin II in isolated strips of rabbit aorta, rabbit jugular vein, rabbit pulmonary artery, rat portal vein, rat stomach, rat urinary bladder, human urinary bladder, human colon, human ileum (Rhaleb et al. 1991) ,

Contractions of guinea pig ileum in situ (Khairallah and Page 1961) , Antagonism against angiotensin II in the isolated rat uterus (Wahhab et al. 1993) , Contractile force and prostaglandin E synthesis in electrically stimulated rabbit isolated vas deferens (Trachte et al. 1990) , Antagonism against angiotensin II-induced aldosterone release in bovine adrenal glomerulosa cells. (Criscione et al. 1993) , and in rat dispersed adrenal capsular cells (Chang et al. 1995) , Antagonism against angiotensin II-induced inhibition of guanylate cyclase activity in the rat pheochromocytoma cell line PC12W (Brechler et al. 1993) . Brooks et al. (1995) compared the cardiovascular and renal effects of an angiotensin II receptor antagonist and captopril in rats with chronic renal failure induced by 5/6 nephrectomy. Under sodium pentobarbital anesthesia the right kidney was removed and approximately two thirds of the left kidney was infarcted by ligating two or three branches of the left renal artery. Kim et al. (1997) studied the effects of an angiotensin AT 1 receptor antagonist on volume overload-induced cardiac gene expression in rats. An abdominal aortacaval shunt was prepared in 9-weeks old male Wistar rats under sodium pentobarbital anesthesia. The vena cava and the abdominal aorta were exposed by opening the abdominal cavity via a midline incision. The aorta was punctured at the union of the segment two thirds caudal to the renal artery and one third cephalic to the aortic bifurcation with a 18-gauge disposable needle. The needle was advanced into the aorta, perforating its adjacent wall and penetrating the vena cava. After the aorta was clamped, the needle was withdrawn, and a drop of cyanoacrylate glue was used to seal the aortic puncture point. The patency of the shunt was verified visually by swelling of the vena cava and mixing of arterial and venous blood. The rats were treated either with vehicle or the angiotensin antagonist. Four days after the preparation of the AC shunt, 24 h-urine volume, electrolytes and aldosterone were measured. Six days after the AC shunt blood was collected by puncture of a tail vein and plasma renin activity and aldosterone were measured. Seven days after AC shunt, hemodynamic studies were performed in pentobarbital anesthesia. Afterwards, the heart was rapidly excised, left and right atria and ventricles were separated and frozen in liquid nitrogen for the extraction and measurement of cardiac tissue RNA. Shibasaki et al. (1997) tested the effect on the reninangiotensin-aldosterone system in conscious rats after cannulation of the abdominal aorta under anesthesia 3-4 days before the experiment. After oral dosing of the angiotensin II receptor antagonist blood samples were withdrawn and plasma renin and aldosterone determined by radioimmunoassay.

Similar to the effects of ACE inhibitors, lifespan of hypertensive rats could be doubled by long-term treatment with an angiotensin II type 1 receptor blocker (Linz et al. 2000) . Ledingham and Laverty (1996) treated genetically hypertensive New Zealand rats with a specific AT 1 receptor antagonist via osmotic minipumps for several weeks and measured the effects on blood pressure, cardiac hypertrophy and the structure of resistance arteries.

Transgenic animals were recommended for further studies to influence the human renin-angiotensin system (Müller et al. 1995; Wagner et al. 1995; Bohlender et al. 1996) . 

The angiotensin-converting enzyme (ACE) is responsible for the cleavage of the almost inactive angiotensin I to the active angiotensin II. The same enzyme (kininase II) is responsible for the degradation of the active peptide bradykinin to inactive products. ACE activity can therefore be measured in two ways: activity of the newly formed angiotensin II and diminution of the activity of bradykinin. ACE inhibition results in decreased activity of the precursor angiotensin I and potentiation of the bradykinin effect.

The cardiovascular system is sensitive to both peptides, reacting with an increase of blood pressure to angiotensin II and with a decrease to bradykinin. These reactions can be used for quantitative determination of ACE inhibiting activity.

Male Sprague-Dawley rats weighing 300-400 g are used. The animals are anesthetized by i.p. injection of 70 mg/hg pentobarbital. After intubation of the trachea they are artificially respirated with 30 strokes/min and a stroke volume of 6-8 ml. The right carotid artery is cannulated and blood pressure registered with a Statham-element (P 23 Db) and a polygraph. One jugular vein is cannulated for i.v. injections. After laparotomy a catheter is inserted into the duodenum for enteral administration and the wound closed again. Blood pressure is stabilized 30% below the normal level by i.m. injection of 5 mg/kg pentolinium. In order to prevent excessive mucus production in the bronchial system, 40 µg/kg atropine sulfate are injected intramuscularly.

After stabilization of blood pressure, 310 ng/kg angiotensin I is injected intravenously in 0.1 ml saline. The injection is repeated in 5-min intervals until an identical pressure reaction occurs. The test compounds are administered at doses of 1 and 10 mg/kg intravenously or 25 mg/kg intraduodenally. 3 min after iv. injection or 10 min after i.d. administration, again 310 ng/kg angiotensin I is injected. Standards are ramipril, enalapril or captopril.

A low dose of bradykinin has to be chosen in order to visualize the bradykinin potentiation. One µg/kg, eventually 3 µg/kg bradykinin are injected intravenously at 5 min intervals until a stable reaction is achieved. Three min after i.v. injection or 10 min after intraduodenal administration of the test substance, the bradykinin injection is repeated.

The diminution of the pressure reaction to angiotensin I after administration of a potential ACE inhibitor is the parameter for the activity of the new compound. The inhibition is calculated as percent of controls. Using various doses of the ACE inhibitor, doseresponse curves can be established and ID 50 values be calculated.

Potentiation of bradykinin induced vasodepression is expressed as percentage of controls. Using various doses of the test compound and the standard, doseresponse curves can be established and potency ratios calculated.

Both parameters, inhibition of angiotensin I response and potentiation of bradykinin-induced vasodepression have been proven as reliable parameters for evaluation of ACE inhibitors. Natoff et al. (1981) used the ratio of responses to angiotensin I and angiotensin II in spontaneously hypertensive rats, either pithed or anesthetized with urethane, to determine the degree and the duration of effect of captopril. Blood levels of angiotensin II can also be measured by radioimmunoassay.

Several studies in rats showed the beneficial effects of prolonged treatment with ACE inhibitors. Postoperative mortality in rats with left ventricular hypertrophy and myocardial infarction was decreased by ACE inhibition .

Inhibition of angiotensin I-induced pressure response by administration of ACE-inhibitors can be measured not only in anesthetized rats, but also in anesthetized dogs, conscious rats and conscious dogs (Becker et al. 1984) .

Life-long ACE inhibition doubles lifespan of hypertensive rats not only if the treatment is started at the age of one month (Linz et al. 1997) , but ramipril also increases survival in old spontaneously hypertensive rats if treatment is started at the age of 15 months (Linz et al. 1999) . Panzenbeck et al. (1995) reported that captoprilinduced hypotension is inhibited by the bradykinin blocker HOE 140 in Na + depleted marmosets.

Becker RHA, Schölkens BA, Metzger M, Schulze KJ (1984) Pharmacological 

Highly specific inhibitors of the enzyme renin are considered to be potential antihypertensive agents. These agents cause a fall in blood pressure of sodium-deficient dogs and decrease plasma renin activity as well as angiotensin II level.

Adult mongrel dogs (8-14 kg) of either sex are given water ad libitum and maintained on a low sodium diet for 1-2 weeks before the experiment. A single intramuscular injection of 5 mg/kg furosemide is given 48 h before the experiment. On the day of the experiment the dogs are anesthetized with sodium pentobarbital (30 mg/kg i.v.) and a cuffed endotracheal tube is positioned to allow artificial respiration. To measure arterial blood pressure a femoral artery is catheterized with polyethylene tubing. The right and left femoral veins are catheterized for drug administration and delivery of a maintenance infusion of sodium pentobarbital (5 mg/kg/h). Blood pressure is measured directly through the catheter, which is connected to a Gould-Statham pressure transducer. Blood samples are collected from the arterial catheter. Increasing doses of the potential renin inhibitor are infused over 30 min followed by a 30 min recovery period. Immediately after the last recovery period, the dogs are given an i.v. infusion of the angiotensin receptor antagonist saralasin (20 µg/kg/min) for 30 min. For measurement of plasma renin activity and an-giotensin II levels, the dogs are infused over a period of 30 min with the test compound and blood is withdrawn at 0, 15, 30, 60, 90, 120, 180 , and 240 min after the start of the infusion. After the final blood drawing, 20 µg/kg/min saralasin is infused for 30 min.

The antibody-trapping method is preferred to measure plasma renin activity (PRA). In this procedure PRA is determined at pH 7.4 by RIA quantification of angiotensin I (ANG I) generated and then trapped by excess anti-ANG I antibody (Poulsen and Jorgensen 1973; Nussberger et al. 1987) . In tubes coated with rabbit anti-ANG I antibody (Gamma Coat ™ 125 I Plasma renin activity RIA kit; Baxter Travenol Diagnostics) and incubated in an ice-water bath, 75 µl plasma are mixed with 7 µl 3 M TRIS base buffer (pH 7.2) containing 200 mM EDTA, and 3 µl 0.2 M TRIS base (pH 7.5) containing 3 g/L human serum albumin (fraction V, Sigma). Tubes are vortexed and incubated at 37°C for 60 min. The incubation is terminated by placing the tubes in an ice-water bath. Next, 75 µl of the TRIS albumin buffer are added, followed by 1 ml phosphate RIA buffer (Gamma Coat ™ ) containing 15,000 cpm of 125 I ANG I. Standard ANG I (0.2-50 ng/ml) is also incubated at 37°C for 60 min with 10 µl TRIS/albumin buffer. In an ice-water bath, low renin plasma (75 µl) is added to the standards before the addition of a 1 ml tracer solution. Samples and standards are incubated for 24 h at 4°C. Tubes are then aspirated and counted in a gamma counter.

Levels of immunoreactive angiotensin II (ir-ANG II) are measured using a procedure described by Nussberger et al. (1985) . Two-three ml of whole blood are collected in prechilled glass tubes containing 125 µl of the following "inhibitor" solution: 2% ethanol, 25 mM phenanthroline, 125 mM EDTA, 0.5 mM pepstatin A, 0.1 mM captopril, 2 g/l neomycin sulfate, and 0.1 mM of the renin inhibitor CGP 38560. The tubes are then centrifuged and the plasma quickly frozen in liquid nitrogen and stored at -70°C. For extraction of angiotensin peptides, Bond-Elut cartridges (Bond-Elut-pH) containing 100 mg phenylsilica are used, along with a Vac Elut SPS24 vacuum manifold (Analytichem; Harbor City, CA). Each cartridge is preconditioned with 1.0 ml methanol (HPLC grade) followed by 1.0 ml of water (HPLC grade) at a vacuum pressure of 5 mm Hg. One ml of the thawed sample is then applied to the cartridge and washed with 3 ml HPLC grade water. The angiotensin peptides retained at the columns are eluted with 0.5 ml methanol (HPLC grade, vacuum pressure less than 5 mm Hg) into polypropylene tubes coated with a buffer containing 0.2 M TRIS, 0.02% NaN 3 , and 2.5 mg/ml fatty acid-free bovine serum albumin (pH 7.4 with glacial acetic acid). The methanol is evaporated at 40°C and ir-ANG II measured using an antibody (IgG Corp., Nashville, TN) with greater than 1000-fold selectivity for ANG II.

All data are expressed as mean ± SEM. The hypotensive responses after various doses of the renin antagonist are compared with the inhibition of plasma renin activity and the decrease of immunoreactive angiotensin II.

The antibody-trapping method, reported here, gives a better correlation with the blood pressure lowering effect in dogs than the conventional method based on RIA for generated ANG I (Palmer et al. 1993 ). Pals et al. (1990) described a rat model for evaluating inhibitors of human renin using anesthetized, nephrectomized, ganglion-blocked rats. The blood pressure rise induced by sustained infusion of renin was dosedependently decreased by a renin inhibitor. 

The renin-angiotensin-system as the main regulator of blood pressure can be influenced in several ways.

One approach involves the inhibition of renin. Renin is an aspartyl protease that hydrolyzes angiotensinogen to release the dekapeptide angiotensin I, which is subsequently converted to angiotensin II by angiotensin-converting-enzyme. Sequencing of renin and angiotensinogen from various species revealed marked species differences for both the enzyme and the substrate. Inhibitors developed for human renin show a high specificity for primate renin and show only weak inhibition of renin from subprimate species. This means that the most common laboratory animals, such as rats and dogs, are not suitable for the in vivo evaluation of renin inhibitors. The marmoset was chosen by Wood et al. (1985 Wood et al. ( , 1989 ) as a primate model.

Marmosets (Callithrix jacchus) of both sexes weighing between 300 and 400 g are fed a pellet diet supplemented with fruit. Two days prior to the experiment the animals are anesthetized and catheters are implanted in a femoral artery for measurement of blood pressure and in a lateral tail vein for injection or infusion of test substances. Thirty min before the experiment, the animals receive an intravenous injection of 5 mg/kg furosemide in order to stimulate renin release. During the experiment, the marmosets are sedated with diazepam (0.3 mg/kg i.p.) and kept in restraining boxes. Mean blood pressure is recorded continuously, and heart rate is measured at fixed intervals. The test compound or the standard are injected at various doses by intravenous infusion or administered orally.

Blood pressure is recorded after 30 min of intravenous infusion and 30 min after stopping the infusion. Comparing the changes from pretreatment values after various doses, dose-response curves can be established. Fischli et al. (1991) monitored arterial pressure in conscious and chronically instrumented monkeys using a telemetry system. One week before the experiment, the animals were anesthetized, and a 3F high fidelity pressure tip transducer (Millar Instruments, Inc.) was inserted into the abdominal aorta through the right femoral artery. Then the catheter was tunneled subcutaneously to the back of the monkey in the interscapular region. The proximal part of the catheter was connected to a transmitter located in a jacket worn by the monkey. The blood pressure was transmitted continu-ously to a receiver, which transformed the signal to an analogue value of blood pressure. reported on the effects of renin inhibitors in anesthetized rhesus monkeys weighing between 5 and 13 kg. The animals are sodium-depleted by administration of 10 mg/kg/day furosemide-Na for 6 consecutive days. At day 7, 10 mg/kg furosemide is given i.v. 30 min before the start of the experiment. Anesthesia is induced with 20 mg/kg ketaminehydrochloride i.m. and continued with 40 mg/kg pentobarbitone-Na, slow i.v. drip. After completion of surgical procedures and after insertion of catheters under fluoroscopic control, the following hemodynamic parameters are measured: Pulse rate, and systolic and diastolic blood pressures are registered with a transducer (Statham P23 ID) in one femoral artery. A catheter tip manometer (Millar Instruments, Houston, Texas, USA) is introduced into the left ventricular cavity for the determination of left ventricular pressure. Contractility is electronically deduced from left ventricular pressure with appropriate amplifiers (Hellige GmbH, Freiburg, Germany). The electrocardiogram (ECG) from conventional lead II is taken using an ECG transducer (Hellige GmbH). Heart rate is measured from QRS-peaks using a biotachometer (Hellige GmbH). Cardiac output is determined using the thermodilution method. Thermodilution is integrated and converted to cardiac output readings by commercially available equipment (HMV 7905, Hoyer, Bremen). To determine cardiac output, 2 ml chilled 0-5°C isotonic glucose solution (5%) is injected rapidly into the right ventricle by a catheter via the right jugular vein. A thermistor is placed into the aortic arch via the right carotid artery.

Hemodynamics are monitored for 30 min following i.v. injection of various doses of the potential renin inhibitor. At the end of the experiments the ACE inhibitor ramiprilat 100 µg/kg is given i.v. to probe for an additional blood pressure lowering effect. Blood samples for the determination of ANG II concentration, renin inhibition and plasma drug levels are withdrawn at 10, 30 and 60 min after i.v. injection of the renin inhibitor. The volume is replaced by i.v. injections of isotonic glucose solution (5%). After all data and blood samples have been obtained, animals are sacrificed by an overdose of pentobarbitone-Na.

For experiments after intraduodenal administration sodium depletion and anesthesia are done as described above. A small side branch of the femoral or radial artery is surgically exposed and cannulated for blood pressure measurements using a pressure transducer (P23 ID). Heart rate is determined from a conventional ECG lead by a biotachometer. Blood samples are withdrawn via a catheter placed into the saphenous vein. A gastric fiberscope (Olympus XP 10) is introduced into the duodenum under visual control and the renin inhibitor is administered intraduodenally through the service channel of the fiberscope in a volume of 5 ml. Blood samples are withdrawn before and at 15, 30, 45, 60, 90 and 120 min after intraduodenal administration. Wood et al. (2005) tested an orally effective renin inhibitor (aliskiren) in marmosets. Blood pressure and heart rate were measured by telemetry in conscious animals moving freely in their home cages. Pressure transmitters (AM Unit, model TA11PA-C40Data Sciences, USA) were implanted into the peritoneal cavity under aseptic conditions and light anesthesia. The sensor catheter was placed in the aorta below the renal artery pointing upstream.

Due to the high species specificity of renin and its substrate, angiotensinogen, renin inhibitors for treatment of hypertension have to be tested in primate models. The marmoset as well as the rhesus monkey have been proven to be suitable models. Wood JM, Schnell CR, Cumin F, Menard J, Webb RL (2005) Aliskiren, a novel, orally effective renin inhibitor, lowers blood pressure in marmosets and spontaneously hypertensive rats. J Hypertens 23:417-426

The discovery of inhibitors of phosphodiesterase as effective drugs for patients with erectile dysfunction (Klotz et al. 2001; Porst et al. 2001 ) has stimulated the use of appropriate in vivo animal models. In particular, rabbits have been recommended as models for impotence research (Bischoff and Schneider 2000, 2001; Bischoff 2001; Saenz de Tejada et al. 2001) confirming earlier work in this area (Thielen et al. 1969; Sjöstrand and Kline 1979; Naganuma et al. 1993; Lin and Lin 1996) .

Adult male Chinchilla rabbits weighing 3.5-4.5 kg are housed in individual cages for at least 1 week after arrival, at room temperature with water and food ad libitum.

For the study, an indwelling catheter filled with saline is inserted into a marginal ear vein and taped in position. The drugs are injected into the ear vein, followed by a small volume of saline. The time is noted and at appropriate times the animal gently removed from the cage and held by one research worker. The rabbit penis is not visible when it is not erect (Naganuma et al. 1993) . However, when erection occurs, it is possible to examine the pudendal area and measure the length of the uncovered penile mucosa with sliding calipers.

Penile erection is evaluated by measuring the length to the nearest millimeter of the uncovered penile mucosa with a sliding caliper at 5, 10, 15, 30, 50, 60, 90, and 120 min after administration of the test compounds and continued hourly for up to 5 h. Mean values are calculated and results expressed as means ± SEM. The area under the curve is calculated by an integration program. Choi et al. (2002) compared the efficacy of verdenafil and sildenafil in facilitating penile erection in anesthetized rabbits. Penile erections were elicited by submaximal pelvic nerve stimulation every 5 min for 30 min. Response was assessed by continuously recording intracavernosal pressure and systemic arterial pressure. Min et al. (2000) tested the augmentation of pelvicnerve-mediated sexual arousal in anesthetized female rabbits by sildenafil. The following parameters were measured before, during and after pelvic nerve stimulation at 4, 16, and 32 Hz: (1) hemoglobin concentration and oxygen saturation in female genital (vaginal, labial, clitoral) tissues by laser oximetry; (2) clitoral blood flow by laser Doppler flowmetry; (3) vaginal luminal pressure by a balloon catheter pressure transducer; (4) vaginal lubrication by tampon. Carter et al. (1998) tested the effect of the selective phosphodiesterase type 5 inhibitor sildenafil on erectile dysfunction in pentobarbital-anesthetized dogs. Increases in intracavernosal pressure in the corpus cavernosum and penile blood flow were induced by pelvic nerve stimulation over a frequency range of 1-16 Hz. The effects of increasing doses of sildenafil on electricstimulated intracavernosal pressure, penile blood flow, blood pressure, and heart rate were evaluated. 

Since the classical experiments of Goldblatt et al. (1934) there is clear evidence that the ischemia of the kidneys causes elevation of blood pressure by activation of the renin-angiotensin system. The principle can be used both for acute and chronic hypertension. In rats acute renal hypertension is induced by clamping the left renal artery for 4 h. After reopening of the vessel, accumulated renin is released into circulation. The protease renin catalyzes the first and rate-limiting step in the formation of angiotensin II leading to acute hypertension. The test is used to evaluate antihypertensive activities of drugs.

Male Sprague-Dawley rats weighing 300 g are used. The animals are anesthetized by intraperitoneal injection of 100 mg/kg hexobarbital sodium. A PVC-coated Dieffenbach clip is placed onto the left hilum of the kidney and fixed to the back muscles. The renal artery is occluded for 3.5-4 h.

3.5 h following the surgery, the animals are anesthetized by intraperitoneal injection of 30-40 mg/kg pentobarbital sodium. The trachea is cannulated to facilitate spontaneous respiration. To measure systolic and diastolic blood pressure, the cannula in the carotid artery is connected to a pressure transducer (Statham P 23 Db).

For administration of the test compound, a jugular vein is cannulated.

Following a stable blood pressure state, ganglionic blockade is performed with pentolinium (10 mg/kg i.v.). After obtaining stable reduced blood pressure values, the renal arterial clip is removed. This leads to a rise in blood pressure as a consequence of elevated plasma renin level. Within 15 min a stable hypertension is achieved (control = 100%).

The test substance is then administered by intravenous injection at doses of 10 and 100 µg/kg. Blood pressure is monitored continuously until a renewed increase to the starting level is obtained.

Ten-twelve animals are used per compound.

Increase in blood pressure after reopening of the renal artery and reduction in blood pressure after administra 

A sharp and transient in systemic arterial blood pressure associated with reflex bradycardia can be elicited by injection of 5-hydroxytryptamine, cyanide, nicotine or lobeline into the coronary artery blood stream of dogs (Berthold et al. 1989 ). The phenomenon is named the cardiogenic hypertensive chemoreflex and 5-HT proved to be the most powerful agent for its initiation (James et al. 1975 ). 

On the basis of the findings of Goldblatt et al. (1934) that ischemia of the kidneys induces hypertension, various modifications of the technique have been described for several animal species. One of the most effective modifications in rats is the so called 1-kidney-1-clip method.

Male Sprague-Dawley rats weighing 200-250 g are anaesthetized with 50 mg/kg i.p. pentobarbital. The fur on the back is shaved and the skin disinfected. In the left lumbar area a flank incision is made parallel to the long axis of the rat. The renal pedicel is exposed with the kidney retracted to the abdomen. The renal artery is dissected clean and a U-shaped silver clip is slipped around it near the aorta. Using a special forceps (Schaffenburg 1959) the size of the clip is adjusted so that the internal gap ranges from 0.25-0.38 mm. The right kidney is removed through a flank incision after tying off the renal pedicle. The skin incisions are closed by wound clips. 4-5 weeks after clipping blood pressure is measured and rats with values higher than 150 mm Hg selected for the experiments. Blood pressure readings are taken on each of 3 days prior to drug treatment. Drugs are administered orally in volumes of 10 ml/kg. The rats are divided into 4 animals per dose and each animal is used as his own control. Compounds are administered for 3 days and predrug and 2 h postdrug blood pressure readings are taken.

Changes in systolic blood pressure are expressed in mm Hg. Activity is determined by comparing treatment blood pressure values with the control blood pressure value (Day 1, predrug blood pressure). Comparisons are made using the paired t-test for evaluation of statistical significance. Duan et al. (1996) induced renal hypertension in male Hartley guinea pigs by a two-step procedure consisting of ligation of the left caudal renal artery and right nephrectomy. Arterial blood pressure and heart rate were monitored in conscious animals. ACE-inhibitors reduced blood pressure in sham-operated and in renal hypertensive guinea pigs, whereas renin inhibitors were effective only in renal hypertensive animals.

Boura ALA, 

Production of hypertension by clamping renal arteries has been first described by Goldblatt et al. (1934) in dogs. Later on, the method has been modified, e. g., as the "wrapping" technique (Abram and Sobin 1947).

Dogs weighing 8-12 kg are anesthetized with i.v. injection of 15 mg/kg thiopental. Anesthesia is maintained with a halothane-oxygen mixture. Under aseptic conditions, a midline abdominal incision is made. One kidney is exposed and wrapped in cellophane and then replaced. The contralateral kidney is exposed. The artery, vein and ureter are ligated and the kidney is removed. The abdomen is closed by sutures and clips. On the day of surgery and for 3 days following, the dogs are given antibiotics. Body temperature is measured twice daily for 4 days following surgery. Six weeks following surgery, blood pressure is measured using a tail-cuff method. For recording, the tailcuff is attached to a polygraph. Only animals with a systolic blood pressure higher than 150 mm Hg are considered to be hypertensive and can participate in studies evaluating potential antihypertensive compounds.

For the experiment, blood pressure is recorded either by the indirect tail-cuff method or by direct measurement via an implanted arterial cannula. On day 1 readings are made every 2 h, just before, and 2 and 4 h after oral treatment with the potential antihypertensive compound. Drug administration is repeated for 5 days. On days 3 and 5 blood pressure readings are taken before and 2 and 4 h after treatment. At least 3 dogs are used per dose and compound.

The starting value is the average of the 2 readings before application of the drug. Each of the following readings is subtracted from this value and recorded as fall of blood pressure at the various recording times.

Renal hypertension in rats has been achieved by many modifications of the method (Stanton 1971) such as the technique according to Grollman (1944) . The kidney is exposed through a lumbar incision, the renal capsule is removed by gentle traction, and a figure-8 ligature is applied being tight enough to deform the kidney but not tight enough to cut the tissue.

Renal hypertension may be induced in the rat by encapsulating both kidneys with latex rubber capsules (Abrams and Sobin 1947) . Moulds are formed from plastic using a rat kidney as a model. The capsules are prepared by dipping the moulds in liquid latex allowing them to dry in the air. Three applications of latex are applied before the capsules are toughened by placing them under warm running tap water. The kidney is exposed by lumbar incision, the renal capsule gently removed and the capsule applied. 

Vasodilator and depressor reflexes, originating in the baroreceptor areas of the carotid sinus and aortic arch, play an important part in the regulation of blood pressure. Stimulation of the afferent buffer fibres exerts an inhibitory influence on the vasomotor center, and their sectioning leads to a persistent rise in blood pressure. In this way, acute neurogenic hypertension can be induced in dogs.

Adult dogs of either sex weighing 10-15 kg are anesthetized using 15 mg/kg sodium thiopental, 200 mg/kg sodium barbital and 60 mg/kg sodium pentobarbital i.v. A femoral vein and artery are cannulated using polyethylene tubing to administer compounds i.v. and record arterial pressure and heart rate, respectively. Left ventricular pressure and dp/dt are recorded via the left common carotid artery (post-deafferentiation) using a Millar microtip pressure transducer. P max is recorded by speeding up the chart paper. Cardiac output is determined by introducing a Swan-Ganz catheter into the right heart and pulmonary artery via a jugular vein. Five ml of cold 5% dextrose is injected into the right atrium and an Edwards Cardiac output computer is used to calculate the cardiac output from the temperature change in the pulmonary artery. All recordings are made with a polygraph. Both of the carotid arteries are cleared up to the bifurcation of the internal and external carotid arteries. The carotid sinus nerves are isolated, ligated and sectioned and a bilateral vagotomy is performed to produce neurogenic hypertension (mean arterial pressure more than 150 mm Hg). The dog is allowed to equilibrate for approximately 30 min and a bolus of the test compound is administered by intravenous injection. Heart rate, arterial pressure, left ventricular pressure, Pmax and dp/dt are monitored for 90 min. A minimum of 3 dogs are used for each compound.

Changes of the cardiovascular parameters are expressed as percentage of the values before administration of the drug.

Neurogenic hypertension through baroreceptor denervation has also been described in rabbits (Angell-James 1984) and in rats (Krieger 1984) .

The neurogenic hypertension is useful for acute experiments. However, it is less useful for chronic experiments since the elevated blood pressure caused by buffer nerve section is more labile than that caused by renal ischemia. 

Mineralocorticoid-induced hypertension is thought to be due to the sodium retaining properties of the steroid causing increases in plasma and extracellular volume. The hypertensive effect is increased by salt loading and unilateral nephrectomy in rats.

Male Sprague Dawley rats weighing 250-300 g are anesthetized with ether. Through a flank incision the left kidney is removed. The rats are injected twice weekly with 20 mg/kg s.c. desoxycorticosteroneacetate in olive oil for 4 weeks. Drinking water is replaced with a 1% NaCl solution. Blood pressure starts to rise after one week and reaches systolic values between 160 and 180 mm Hg after 4 weeks.

The regimen to induce DOCA-salt hypertension has been modified by many authors (Stanton 1971). DOCA pellets (Peterfalvi and Jequier 1960; Passmore and Jimenez 1990) or implants in silastic devices (Ormsbee and Ryan 1973; King and Webb 1988) were used instead of repeated injections.

DOCA-salt hypertension can also be achieved without nephrectomy (Bockman et al. 1992) .

Using kininogen-deficient Brown Norway Katholiek (BN-Ka) rats, Majima et al. (1991 Majima et al. ( , 1993 showed suppression of rat desoxycorticosterone-salt hypertension by the kallikrein-kinin system. examined small-artery structure on a wire myograph and quantified endothelin-1 messenger RNA by Northern blot analysis in DOCA-salt hypertensive rats after administration of an ACE-inhibitor, a calcium channel antagonist and a nitric oxide synthase inhibitor. Ullian (1997) described the Wistar-Furth rat as a model of mineralocorticoid resistance. These rats de-veloped two-kidney, one-clip hypertension to the same degree as did Wistar rats and reacted to glucocorticoid treatment with a rapid onset of hypertension, but were resistant to the development of DOCA-NaCl hypertension.

Studies in DOCA-salt hypertensive mice were reported by Gross et al. (1998 Gross et al. ( , 1999 , Honeck et al. (2000) , Peng et al. (2001) . (1997) The Wistar-Furth rat as a model of mineralocorticoid resistance. Kidney Internat 52: Suppl 61:S10-S13

Increases in dietary carbohydrate intake can raise blood pressure in experimental animals. The increased intake of either sucrose or glucose was shown to enhance the development of either spontaneous hypertension or salt hypertension in rats (Hall and Hall 1966; Preuss and Preuss 1980; Young and Landsberg 1981) . Hwang et al. (1987) first reported that hypertension could be induced in normal rats by feeding a high-fructose diet. Fructose feeding was also found to cause insulin resistance, hyperinsulinemia, and hypertriglyceridemia in normal rats (Zavaroni et al. 1980; Tobey et al. 1982) . Dai and McNeill (1995) studied the concentration-and duration-dependence of fructoseinduced hypertension in rats.

Groups of 8 male Wistar rats weighing 210-250 g are used. The are housed two per cage on a 12-h light 12h dark cycle and are allowed free access to standard laboratory diet (Purina rat chow) and drinking fluid. Drinking fluid consists either of tap water or 10%fructose solution. Body weight, food intake and fluid intake of each rat are measured every week during treatment. Using the tail-cuff method, systolic blood pressure and pulse rate is measured before and every week during treatment. Blood samples are collected before and every second week during treatment for determination of plasma glucose, insulin, and triglycerides.

Since maximum effects on the chosen parameters are achieved after 6 weeks, the duration of treatment can be limited to this time. Statistical analysis is performed using a one-way or two-way analysis of variance, followed by the Newman-Keuls test. Reaven et al. (1988 Reaven et al. ( , 1989 found an attenuation of fructose-induced hypertension by exercise training and an inhibition by somatostatin treatment. Brands et al. (1991 Brands et al. ( , 1992 found an increase of arterial pressure during chronic hyperinsulinemia in conscious rats. Hall et al. (1995) reported the effects of 6 weeks of a high-fat diet on cardiovascular, renal, and endocrine functions in chronically instrumented conscious dogs. Body weight increased by approximately 16.9 kg, whereas MAP, cardiac output, and heart rate increased by 28%, 77%, and 68%, respectively. 

Inherited hypertension in rats has been described by Smik and Hall 1958; Phelan and Smirk 1960; Laverty and Smirk 1961; Phelan 1968 as genetically hypertensive (GH) rats (Simpson and Phelan 1984) . Okamoto et al. (1963 Okamoto et al. ( , 1966 reported the development of a strain of spontaneously hypertensive rats from mating one Wistar male rat with spontaneously occurring high blood pressure with a female with slightly elevated blood pressure. By inbreeding over several generations a high incidence of hypertension with blood pressure values of 200 mm Hg or more was achieved. These strains were called "Spontaneously hypertensive rats (Akamoto-Aoki)" = SHR or "Wistar-Kyoto rats" = WKY. Hypertension in these rats is clearly hereditary and genetically determined, thus comparable to primary hypertension in humans. Cardiac hypertrophy (Sen et al. 1974 ) and cellular ionic transport abnormalities have been observed (Yamori 1984) .

Inbred strains being salt-hypertension-sensitivey and salt-hypertension-resistant (RD) have been developed by Dahl et al. (1962 Dahl et al. ( , 1963 , Rapp (1984) , Cicila et al. (1993) . Inoko et al. (1994) reported the transition from compensatory hypertrophy to dilated, failing left ventricles in Dahl salt-sensitive rats.

Two strains of rats with inbred dissimilar sensitivity to DOCA-salt hypertension ("Sabra strain") have been separated by Ben-Ishay et al. (1972 .

Another hypertensive strain derived from Wistar rats was produced by brother-sister mating in the group of Bianchi et al. (1974 Bianchi et al. ( , 1986 at the University of Milan called "Milan hypertensive strain" = MHS. These rats show a cell membrane defect resulting in abnormal kidney function. Salvati et al. (1990) studied the diuretic effect of bumetanide in isolated perfused kidneys of Milan hypertensive rats. Furthermore, the "Lyon" strains of hypertensive, normotensive and low-blood-pressure rats were developed (Dupont et al. 1973; Vincent et al. 1984; Dubay et al. 1993) . These rats show a genetically determined defect in central nervous function.

Spontaneously hypertensive rats which develop failure before 18 months have been selectively bred. Several substrains of spontaneous hypertensive rats were separated by the group of Okamoto et al. (1974) including the stroke-prone strain SHR = SHRSP. These rats have an increased sympathetic tone and show a high incidence of hemorrhagic lesions of the brain with motor disturbances followed by death (Yamori 1984; Feron et al. 1996) .

A strain of obese spontaneously hypertensive rats has been described by Koletsky (1975 ), Ernsberger et al. (1993 .

With new techniques of genetic engineering, transgenic rats with hypertension could be created. Increase of blood pressure of spontaneously hypertensive rat is determined by multiple genetic loci (Deng and Rapp 1992; Dubay et al. 1993) . With new technology not only these loci could be defined but also new models in hypertension research and models to detect antihypertensive drugs could be established (Bohlender et al. 1997; Pinto et al. 1998) . Mullins et al. (1990) reported fulminant hypertension in transgenic rats harboring the mouse Re-2 gene.

A rat strain TGR(mREN2)27 as a monogenetic model in hypertension research was described by Peters et al. (1993) , Lee et al. (1996 ), Langheinrich et al. (1996 ), and Ohta et al. (1996 . Bohlender et al. (1996) reconstructed the human renin-angiotensin system in transgenic rats overexpressing the human angiotensin gene TGR(hOGEN) 1623 by chronically injecting human recombinant renin intravenously using Alzet pumps. Zolk et al. (1998) described the effects of quinapril, losartan and hydralazine on cardiac hypertrophy and β-adrenergic neuroeffector mechanisms in transgenic TGR(mREN2)27 rats.

The use of spontaneously hypertensive rats to detect potential antihypertensive compounds is well established. On the basis of available data no preference can be given to a particular strain. The most abundant experience has been gained with the Wistar-Kyoto strain. Transgenic rats with well defined genomes are gaining more importance. Pijl et al. (1994) described streptozotocin-induced diabetes mellitus in spontaneously hypertensive rats as a pathophysiological model for the combined effects of hypertension and diabetes. Rosenthal et al. (1997) used rats of the Cohen-Rosenthal diabetic hypertensive strain to examine the effects of an ACE-inhibitor, an ATII antagonist and a calcium antagonist on systolic pressure and spontaneous blood glucose levels. Holycross et al. (1997) used hypertensive SHHF/ Mcc-facp rats to study plasma renin activity during development of heart failure. Linz et al. (1997) compared the outcome of lifelong treatment with the ACE inhibitor ramipril in young prehypertensive stroke-prone spontaneously hypertensive rats and age-matched normotensive Wistar-Kyoto rats. Lifelong ACE inhibition doubled the lifespan in hypertensive rats matching that of normotensive rats.

Studies in genetically hypertensive mice were reported by Rosenberg et al. (1985) , Hamet et al. (1990 ) Meneton et al. (2000 . Ohkubo et al. (1990) generated transgenic mice with elevated blood pressure by introduction of the rat renin and angiotensinogen genes. Generation of transgenic mice with elevated blood pressure by introduction of the rat renin and angiotensinogen genes. Proc Natl Acad Sci USA 87:5153-5156 Ohta K, Kim S, Wanibuchi H, Ganten D, Iwao K (1996) Contribution of local renin-angiotensin system to cardiac hypertrophy, phenotypic modulation, and remodelling in TGR (mREN2) Yang et al. (1996) found an increase of vascular angiotensin II receptor expression after chronic inhibition of NO synthase in spontaneously hypertensive rats. The detrimental sequels of chronic NO synthase inhibition in rats can be inhibited by treatment with ACE inhibitors (Hropot et al. 1994; Küng et al. 1995) . Hsieh et al. (2004) reported that NO inhibition by L-NAME accelerates hypertension and induces perivascular inflammation in rats. Hropot et al. (2003) reported that angiotensin II subtype AT 1 receptor blockade prevents hypertension and renal insufficiency induced by chronic NO synthase inhibition in rats.

Male Wistar rats at an age of 7-8 weeks weighing 210 ± 10 g were placed at random in metabolic cages, divided in four to six groups of six to eight rats each. Group 1 (control) had free access to tap water and food. Groups 2-4 were treated with 0.02% L-NAME water solution for 6 weeks in a daily dose of 25 mg/kg. Groups 3 and 4 received the angiotensin receptor antagonists fonsartan (10 mg/kg) or lorsatan (30 mg/kg) for 6 weeks daily per stomach tube. Groups 5 and 6 received fonsartan and lorasatan alone. At the end of the study, 24-h urine samples were collected and retrobulbar blood samples were taken in short inhalation anesthesia. Plasma values of creatine, PRA and electrolytes were determined. For clearance evaluation rats were anesthetized with 50 mg/kg thiopentone i.p. In order to determine glomerular filtration rate and renal plasma flow, clearances of inulin and para-aminohippurate were performed. After the clearance experiments, the rats were sacrificed and hearts and kidneys removed. Hearts were perfused in the isolated working heart preparation via the aorta with modified Krebs-Henseleit buffer containing solvents or drugs. After a preischemic period of 20 min, acute regional myocardial ischemia was produced by clamping the left coronary artery close to its origin for 15 min (ischemic period). Thereafter, the clip was removed and changes during reperfusion were monitored (reperfusion period). The following cardio-dynamic and cardio-metabolic parameters were measured: incidence and duration of ventricular fibrillation, left ventricular pressure, contractility (dP/dt max), heart rate and coronary flow; in the coronary effluent lactate dehydrogenase, creatine kinase and lactate; in the myocardial tissue lactate, glycogen, ATP and creatine phosphate. Left ventricular pressure was measured with a Statham pressure transducer (P 23 DB) which on differentiation yielded LV dP/dt max and heart rate. Coronary flow was determined by electromagnetic flow probes in the aortic cannula. For the determination of lactate release, lactate dehydrogenase (LDH) and creatine kinase (CK) activities in the perfusate samples were taken from the coronary effluent and analyzed spectrophotometrically.

Results are presented as arithmetical means ± SEM. A one-way ANOVA was calculated with SYSTAT for Windows (SYSTAT, Evanston, Ill., USA) followed by multiple pairwise comparisons according to Tukey. Arnal et al. (1993) measured cardiac weight of rats in hypertension induced by NO synthase blockade. Linz et al. (1999) reviewed the interactions between ACE, kinins and NO. Sampaio et al. (2002) reported that hypertension plus diabetes mimics the cardiomyopathy induced by NO inhibition in rats. Rossi et al. (2003) found that chronic inhibition of NO synthase induces hypertension and cardiomyocyte mitochondrial and myocardial remodeling in the absence of hypertrophy. 

The pyrrolizidine alkaloid monocrotaline, derived from Crotalaria spectabilis, is hepatotoxic and pneumotoxic in the rat. A single injection of monocrotaline leads to progressive pulmonary hypertension resulting in right ventricular hypertrophy and cardiac failure (Gillespie et al. , 1988 Todorovich-Hunter et al. 1988) . Pathologic changes and hemodynamic changes associated with monocrotaline administration include blebbing of the lung, degeneration and fragmentation of endothelial cells, perivascular edema, extravasation of red blood cells, and muscularization of the pulmonary arteries and arterioles (Valdiva et al. 1967; Lalich et al. 1977; Huxtable et al. 1978; Hislop and Reid 1979; Meyrick and Reid 1979; Meyrick et al. 1980; Ghodsi and Will 1981; Hilliker et al. 1982; Sugita et al. 1983; Hilliker and Roth 1985; Stenmark et al. 1985; Altieri et al. 1986; Molteni et al. 1986; Lai et al. 1996) . Rats given monocrotaline develop severe right ventricular hypertrophy often accompanied by ascites and pleural effusions (Ceconi et al. 1989) . Amelioration by angiotensin-converting enzyme inhibitors and by penicillamine has been demonstrated (Molteni et al. 1985 (Molteni et al. , 1986 .

Treatment of male Sprague Dawley rats weighing 200-225 g with the test drug (angiotensin converting enzyme inhibitor or vehicle) is started one week prior to a single subcutaneous injection of 100 mg/kg monocrotaline up to sacrifice 4, 7, or 14 days later by pentobarbital anesthesia and exsanguination. Heart and lungs are excised from thoracic cavity. After removing atria from the heart, the right ventricle is separated from the left ventricle plus septum which are blotted and weighed separately. Left lung is blotted, weighed, minced and reweighed after drying at room temperature for 14 days. Three pulmonary artery segments, main pulmonary artery, right extrapulmonary artery and an intrapulmonary artery from the from the right lower lobe, are isolated for study of vascular responsiveness. Cylindrical segments of each vessel are suspended between stainless steel hooks in 10-ml isolated tissue baths containing modified Krebs-Henseleit buffer aerated with 95% O 2 /5% CO 2 at 37°C. At the end of each experiment, vessel segments are blotted and weighed and their dimensions measured. Crosssectional area of each artery is determined from tissue weight and diameter.

Arteries are equilibrated for 1 h at 1 g of passive applied load and then are made to contract to KCl (6 × 10 −2 M). After washout, the procedure is repeated with applied loads increased by 1 g increments. Responses are normalized to the maximum active force development generated by an artery in each experiment and the data are plotted as a function of ap-plied force. Changes in isometric force are monitored through force displacement transducers (Grass FT03) and recorded on a polygraph.

Responsiveness to contractile and relaxant agonists is assessed in pulmonary arteries from salineand monocrotaline-treated rats both in verum-and placebo-treated groups. Cumulative concentration-response curves to hypertonic KCl, angiotensin II and norepinephrine are generated sequentially in vessels at resting tone. Arteries are then contracted submaximally with norepinephrine and cumulative concentration-response curves to the vasorelaxants isoproterenol and acetylcholine are determined.

Contractions are expressed as active tension development, force generated per cross-sectional area and relaxations are normalized to precontraction tone. Both contractile and relaxation responses are plotted as a function of the negative logarithm of agonist concentration. Differences in mean responses are compared by a t-test for grouped data. Molteni et al. (1986) treated rats continuously with monocrotaline in the drinking water at a concentration of 2.4 mg/kg/day for a period of 6 weeks. Test rats received an ACE-inhibitor during this time in the drinking water and controls the vehicle only. At the end of the experiment, hearts and lungs were weighed and examined by light and electron microscopy. Madden et al. (1995) determined L-arginine-related responses to pressure and vasoactive agents in monocrotaline-treated rat pulmonary arteries. Ono et al. (1995) studied the effects of prostaglandin E 1 (PGE 1 ) on pulmonary hypertension and lung vascular remodelling in the rat monocrotaline model of human pulmonary hypertension. Yamauchi et al. (1996) studied the effects of an orally active endothelin antagonist on monocrotalineinduced pulmonary hypertension in rats. Gout et al. (1999) evaluated the effects of adrenomedullin in isolated vascular rings from rats treated with monocrotaline (60 mg/kg s.c.) causing pulmonary hypertension and ventricular hypertrophy within 3 to 4 weeks. Kanno et al. (2001) studied the effect of an angiotensin-converting enzyme inhibitor on pulmonary arterial hypertension and endothelial nitric oxide synthase expression in monocrotaline-treated rats. For evaluation of right ventricular hypertrophy as a result of pulmonary arterial hypertension, multislice spin-echo MRI images were acquired at 8-12 time points in a cardiac cycle with respiratory and ECG gating (Kanno et al. 2000) at 2, 3, 4, and 5 weeks after monocrotaline treatment. Kang et al. (2003) reported that a phosphodiesterase-5 inhibitor attenuated monocrotaline-induced pulmonary hypertension in rats. used this model to study the role of nitric oxide and endothelin-1 in rat portal hypertension.

Male Sprague-Dawley rats were anesthetized with 50 mg/kg Nembutal intraperitoneally. The portal vein was isolated and stenosis created by a single ligature of 3-0 silk placed around the portal vein and a 20-gauge blunt-tipped needle after devascularization of the left renal vein. This devascularization is indispensable in preventing the development of excess collateral vessels, which inhibit the formation of esophageal varices and the portal hypertensive state. The needle was then removed from the ligature. In addition, 3-0 silk was also placed at the area of partial ligation (loose ligation), and both ends were then drawn out through the abdominal wall. Five days after the operation, the ends of the silk that had been placed in the flank were simultaneously pulled to induce complete portal vein ligation. Two weeks later, this portal hypertension model was completed. Portal venous pressure, blood flow volume in the intra-abdominal viscera, plasma NO and plasma endothelin-1 were measured.

Results were expressed as mean ± standard deviation. The Student's t-test was used to determine significance between portal hypertension rats and sham-operated controls.

Portal hypertension by portal vein ligation without devascularization of the left renal vein was used by Lee et al. (1985) , Braillon et al. (1986 ), Oren et al. (1995 , Fernandez et al. (1996) , Moreno et al. (1996) 

The isolated heart-lung of the dog was introduced by Knowlton and Starling (1912) . Since then, the dog model has been used for many physiological and pharmacological studies (Krayer 1931; Krayer and Mendez 1942; Somani and Blum 1966; Takeda et al. 1973; Ishikawa et al. 1978 Ishikawa et al. , 1983 Ono et al. 1984a, b; Caffrey et al. 1986; Hausknecht et al. 1986; Fessler et al. 1988; Seifen et al. 1987 Seifen et al. , 1988 Naka et al. 1989 ). More recently, the rat model has been preferred (Dietz 1984 (Dietz , 1987 Onwochei et al. 1987 Onwochei et al. , 1988 Kashimoto et al. 1987 , Fukuse et al. 1995 .

Wistar rats weighing 300-320 g are anesthetized with 50 mg/kg pentobarbitone i.p. Tracheotomy is performed and intermittent positive pressure ventilation is instituted with air. The chest is opened and flooded with ice-cold saline and the heart arrested. Cannulae are inserted into the aorta and the superior (for measurement of central venous pressure) and inferior venae cavae. The heart-lung preparation is perfused with a solution containing rat blood cells from another rat and Krebs-Ringer bicarbonate buffer, with hematocrit and pH of 25% and 7.4, respectively. Concentration of the buffer constituents (mM): NaCl 127, KCl 5.1, CaCl 2 2.2, KH 2 PO 4 1.3, MgSO 4 2.6, NaHCO 3 15, glucose 5.5 and heparin. The perfusate pumped from the aorta passes through a pneumatic resistance and is collected in a reservoir maintained at 37°C and then returned to the inferior vena cava. In this model, no other organs except the heart and lung are perfused. Cardiac output is determined by the inflow as long as the heart does not fail. Mean arterial pressure is regulated by the pneumatic resistance. Heart rate is recorded by a bioelectric amplifier and cardiac output is measured with an electromagnetic blood flow meter. Arterial pressure and right atrial pressure are measured with transducers and amplifiers. The heart is perfused initially with cardiac output of 30 ml/min and mean arterial pressure of 80 mm Hg. Test drugs are administered into the perfusate 5 min after start of the experiment.

Hemodynamic data within groups are analyzed by two-way analysis of variance (ANOVA) with repeated measures. Recovery time is measured by the Kruskal-Wallis test. The other data are analyzed by one-way ANOVA followed by the Dunnett test for multiple comparisons.

Using the Starling heart-lung preparation in dogs, Wollenberger (1947) studied the energy-rich phosphate supply of the failing heart. Shigei and Hashimoto (1960) studied the mechanism of the heart failure induced by pentobarbital, quinine, fluoroacetate and dinitrophenol in dog's heartlung preparation and effects of sympathomimetic amines and ouabain on it. Imai et al. (1961) used heart-lung preparations of the dog to study the cardiac actions of methoxamine with special reference to its antagonistic action to epinephrine.

Capri and Oliverio (1965), Beaconsfield et al. (1974) used the heart-lung preparation of the guinea pig.

Robicsek et al. (1985) studied the metabolism and function of an autoperfused heart-lung preparation of the dog.

The dog heart-lung preparation was used by Seifen et al. (1988) to study the interaction of a calcium channel agonist with the effects of digoxin, by Somani and Blum (1966) to study blockade of epinephrine-and ouabain-induced cardiac arrhythmias in the dog, by Riveron et al. (1988) to investigate the energy expenditure of an autoperfusing heart-lung preparation, by Namakura et al. (1987) to study the role of pulmonary innervation in an in situ lung-perfusion preparation as a new model of neurogenic pulmonary edema, by Hausknecht et al. (1986) to investigate the effects of lung inflation on blood flow during cardiopulmonary resuscitation, by Caffrey et al. (1986) to evaluate the effect of naloxone on myocardial responses to isoproterenol, by Ono et al. (1984) to estimate the cardiodepressant potency of various beta-blocking agents, by Ishikawa et al. (1983) for a graphical analysis of drug effects in the dog heart-lung preparation -with particular reference to the pulmonary circulation and effects of norepinephrine and 5-hydroxytryptamine, by Iizuka (1983) to study the cardiac effects of acetylcholine and its congeners, by Fessler et al. (988) to investigate the mechanism of reduced LV afterload by systolic and diastolic positive pleural pressure, by Takeda et al. (1973) to study the cardiac actions of oxprenolol. Beaconsfield et al. (1974) used the heart-lung preparation of guinea pigs to study the cardiac effect of delta-9-tetrahydrocannabinol.

The rabbit autoperfusing heart-lung preparation was used by Muskett et al. (1986 Muskett et al. ( , 1988 .

The isolated heart-lung preparation in the cat was described by Beaufort et al. (1993) . Kontos et al. (1987 Kontos et al. ( , 1988 harvested heart-lung blocks from calves.

Beaconsfield P, Oakley C, Carpi A, Rainsbury R, del Basso P (1974a) Cardiac effect of delta-9-tetrahydrocannabinol on a heart-lung preparation and on the intact animal. Eur J Cardiol 2:167-173 Beaconsfield P, Oakley C, Carpi A (1974b) Cardiac effect of delta-9-tetrahydrocannabinol on a heart-lung preparation and on the intact animal. Eur Miller M, Rabkin MS (1986) Preservation in the rabbit autoperfusing heart-lung preparation: a potential role of indomethacin. Surgical Forum 37:252-254 Muskett AD, Burton NA, Grossman M, Gay WA Jr (1988) The rabbit autoperfusing heart-lung preparation. J Surg Res 44:104-108 Namakura J, Zhang S, Ishikawa N (1987) 

More than 100 years ago Langendorff (1895) described studies on isolated surviving mammalian hearts using mainly cats as donors. Since then, the method has been improved from the technical site and is nowadays used for studies with guinea-pig, rabbit or rat hearts. In principle, the heart is perfused in retrograde direction from the aorta either at constant pressure or at constant flow with oxygenated saline solutions. Retrograde perfusion closes the aortic valves, just as in the in situ heart during diastole. The perfusate is displaced through the coronary arteries flowing off the coronary sinus and the opened right atrium. In this original set-up the ventricles do not fill with perfusate and therefore do not perform pressure-volume work. Parameters usually measured are: contractile force, coronary flow and cardiac rhythm.

Guinea pigs of either sex weighing 300-500 g are sacrificed by stunning. For studies of biochemical parameters in tissue and perfusate, removal of the heart dur-ing barbiturate anesthesia and artificial respiration is recommended. The heart is removed as quickly as possible and placed in a dish containing Ringer's solution at 37°C. Associated pericardial and lung tissue are removed. The aorta is located and cut just below the point of its division. A glass or plastic cannula is introduced into the aorta, tied with two threads and perfusion is started with oxygenated Ringer's solution or Krebs-Henseleit buffer. The heart is transferred to a double walled plexiglass perfusion apparatus which is kept at 37°C by the water from a thermostat. Oxygenated Ringer's solution is perfused at a constant pressure of 40 mm Hg and at a temperature of 37°C from a reservoir. A small steel hook with a string is attached to the apex of the heart. Contractile force is measured isometrically by a force transducer with a preload of 2.5 g and recorded on a polygraph. Coronary flow is measured by a drop counter. Alternatively, flow measurements can be performed using a mechanic-electronic flow meter consisting of a vertical pipe and a magnetic valve (Hugo Sachs Electronic KG, Germany). Heart rate is measured through a chronometer coupled to the polygraph. Drugs are injected into the perfusion medium just above the aortic cannula.

A reappraisal of the LANGENDORFF heart preparation was given by Broadley (1979) underlining the usefulness to test coronary vasodilating drugs. The value of the LANGENDORFF method can be best assessed by demonstrating a few of its applications in physiology and pharmacology. Direct effects can be measured as well as the antagonism against various physiological and pharmacological agents.

A survey on various modifications of the LANGEN-DORFF-technique and the isolated working heart preparation has been given by Ross (1972) . Neely et al. (1967) inserted a second cannula into a pulmonary vein or the left atrium. Perfusate from a reservoir flows via this cannula through the mitral valve into the left ventricle. During the systole of the heart, the left ventricle repumps the perfusate through the aorta into the reservoir. The perfusate flowing through the coronary arteries and dripping off from the outside of the heart is collected in a vessel below the heart and recirculated into the reservoir with a roller pump. Flynn et al. (1978) underlined the difference of this working heart preparation to the original LAN-GENDORFF method and reported the effects of histamine and noradrenaline on peak left ventricular systolic pressure, contractility, sinus rate, coronary flow, aortic flow, total cardiac output, and external pressurevolume work. Therefore, this method is reported separately. Ishiu et al. (1996) measured simultaneously Ca 2+dependent indo-1 fluorescence and left ventricular pressure on a beat-to-beat basis in Langendorff guinea pig hearts and investigated the changes in Ca +2 transient and left ventricular function during positive inotropic stimulation and myocardial ischemia.

Hukovic and Muscholl (1962) described the preparation of the isolated rabbit heart with intact sympathic nervous supply from the right stellate ganglion. Hendrikx et al. (1994) used the isolated perfused rabbit heart to test the effects of an Na + /H + exchange inhibitor on postischemic function, resynthesis of high-energy phosphate and reduction of Ca 2+ overload. Michio et al. (1985) modified the Langendorff method in rabbits to a working heart preparation by cannulating the left atrium. At a pressure of 20 cm H 2 O in the left atrium, the heart pumped the solution against a hydrostatic pressure of 100 cm H 2 O. Aortic flow, systolic aortic pressure, coronary flow, and heart rate were measured.

The influence of an ACE-inhibitor on heart rate, lactate in the coronary effluate and GTP-level in the myocardium after 60-min hypothermic cardiac arrest was studied in working heart preparation of rabbits by Zegner et al. (1996) . Gottlieb and Magnus (1904) introduced the so called "balloon method". A small balloon fixed to the tip of a catheter is filled with water and inserted into the left ventricle via one of the pulmonary veins, the left atrium and the mitral valve. The balloon size has to fit the volume of the left ventricle and therefore its size depends on the animal species and body weight. The catheter can be fixed by tying the pulmonary vein stems. Via a three-way valve, the balloon can be extended to a given preload. The beating heart now exerts a rhythmic force to the balloon and thus to the membrane of a pressure transducer. The advantages of this method are that force development and preload can be stated reproducibly in pressure units [mm Hg], left ventricular contraction curves can be used for further calculations, and continuous heart rate recordings can be carried out without any problems when using a rate meter. Sakai et al. (1983) reported a similar method adapted to mice. Bardenheuer and Schrader (1983) described a method whereby the balloon is inserted into the left ventricle as described above. However, isovolumetric pressure in the left ventricle is not measured. Instead, the fluid in the balloon is pumped through the cannula into a closed extra corporal circulation. The fluid is forced into one direction by 2 recoil valves. The balloon is made of silicone material using a Teflon form (Linz et al. 1986 ). The dimensions of the form are derived from casts of the left ventricle of K + -arrested heart by injection of dental cement (Palavit 55, Kulzer and Co, GmbH, Germany). During each heart beat the fluid volume expelled from the balloon corresponding to the stroke volume of the heart, can be recorded by means of a flow meter probe and an integrator connected in series. Preload and afterload can be adjusted independently from each other. The perfusate flow (retrograde into the aorta and through the coronary arteries) is recorded separately.

The following parameters were measured in isolated rat hearts (Linz et al. 1986; Linz et al. 1990 ):

• LVP (left ventricular pressure) with Statham pressure transducer P 23 DB, which on differentiation yielded LV dp/dt max and HR (heart rate). Cardiac output and coronary flow (CF) are determined by electromagnetic flow probes in the outflow system and in the aortic cannula, respectively. Coronary venous pO 2 is measured with a catheter placed in the pulmonary artery by a type E 5046 electrode connected to a PMH 73 pH/blood gas monitor (Radiometer). An epicardial electrocardiogram recording is obtained via two silver electrodes attached to the heart. All parameters are recorded on a Brush 2600 recorder. • Myocardial oxygen consumption (MWO 2 ) [ml/min/g wet weight] is calculated according to the equation:

where CF is the coronary flow [ml/min/g], P a is the oxygen partial pressure of arterial perfusate (650 mm Hg), P v is the oxygen partial pressure of the venous effluent perfusate [mm Hg], and c is the 0.0227 ml O 2 /ml perfusate representing the Bunsen solubility coefficient of oxygen dissolved in perfusate at 37°C (Zander and Euler 1976).

For the determination of lactate dehydrogenase (LDH) and creatine kinase (CK) activities in the perfusate, samples are taken from the coronary effluent.

After the experiments, hearts are rapidly frozen in liquid nitrogen and stored at -80°C. Of the left ventricle, 500 mg are taken, put into 5 ml ice-cold HClO 4 and disrupted with an Ultra-Turrax (Junke and Kunkel, Ika-Werk, Type TP). Glycogen is hydrolyzed with amyloglycosidase (pH 4.8) and determined as glucose. Furthermore, ATP and creatine phosphate are measured. Avkiran and Curtis (1991) constructed a dual lumen aortic cannula which permits independent perfusion of left and right coronary beds in isolated rat hearts without necessitating the cannulation of individual arteries. Igic (1996) described a modification of the isolated perfused working rat heart. A special double cannula was designed consisting of an outer cannula that is inserted into the aorta and an inner cannula that is advanced into the left ventricle. The perfusion fluid flows through the inner cannula into the left ventricle, and is ejected from there into the aorta. If the outer cannula system is closed, the fluid perfuses the coronary vessels and drips off outside the heart. When the outer cannula is open and certain pressure resistance is applied, a fraction of the ejected fluid perfuses coronary vessels and the rest is expelled. Because the inner cannula can be easily retracted into the outer cannula, which is placed in the aorta, the preparation provides an opportunity to use the same heart as a "working" or "non-working" model for investigating functions of the heart.

By labeling glucose, lactate, or fatty acids in the perfusate with 3 H or 14 C, Barr and Lopaschuk (1997) directly measured energy metabolism in the isolated rat heart. Krzeminski et al. (1991) described a new concept of the isolated heart preparation with on-line computerized data evaluation. Left ventricular pressure was recorded by means of a balloon-catheter, while special suction electrodes obtained the high-amplitude, noisefree electrogram recordings. The coronary effluent partial pressure of oxygen was continuously monitored, which enabled the calculation of myocardial oxygen consumption (MVO 2 ). The effluent partial pressure of carbon dioxide and pH value were also measured simultaneously. A computerized system of data acquisition, calculation, storage, and end report was described. Döring and Dehnert (1988) described continuous simultaneous ultrasonic recording of two cardiac diameters in an isolated perfused guinea-pig heart. For the measurement of the left ventricular transversal diameter the ultrasonic transmitter was positioned at the epicardium at the largest cardiac diameter. The cor-responding ultrasonic receiver was inserted through the right atrium into the right ventricle to approximately the same height as the transmitter. In the right ventricle, which is empty in the isolated perfused LANGENDORFF-heart, it was automatically positioned opposite to the transmitter. Additional transducers were placed both at the heart's base and apex for assessment of the ventricular longitudinal diameter.

Several authors used the isolated perfused mouse heart. Bittner et al. (1996) described a work-performing heart preparation for myocardial performance analysis in murine hearts using a modified Langendorff apparatus.

Sumaray and Yellon (1998a, b) constructed a specially designed Langendorff apparatus that allows perfusion of the isolated mouse heart. These authors reported that ischemic preconditioning reduces infarct size following global ischemia in the murine myocardium. Brooks and Apstein (1996) measured left ventricular systolic and diastolic pressures in the isovolumically contracting (balloon in the left ventricle) mouse hearts. Sutherland et al. (2003) reviewed characteristics and cautions in the use of the isolated perfused heart of mice. Wang et al. (2001) studied the relationship between ischemic time and ischemia/reperfusion injury in isolated Langendorff-perfused mouse hearts. Tejero-Taldo et al. (2002) reported that α-adrenergic receptor stimulation produces late preconditioning through inducible nitric oxide synthase in mouse heart. Ross et al. (2003) found that the α 1B -adrenergic receptor decreases the inotropic response in the mouse Langendorff heart model. Bratkovsky et al. (2004) measured coronary flow reserve in isolated hearts from mice. Plumier et al. (1995) generated transgenic mice expressing the human heart heat shock protein 70. Upon reperfusion of the hearts after 30 min of ischemia in the Langendorff preparation, transgenic hearts versus non transgenic hearts showed significantly improved recovery of contractile force. Hannan et al. (2000) compared ENOS knockout and wild-type mouse hearts which were perfused in a Langendorff apparatus with Krebs bicarbonate buffer and subjected to 20 min of global normothermic ischemia followed by 30 min of reperfusion. Myocardial function was measured using a ventricular balloon to determine time to onset of contraction, left ventricular developed pressure (LVDP), left ventricular end-diastolic pressure (LVEDP), and heart rate-pressure product (RPP). Sheikh et al. (2001) generated transgenic mice overexpressing fibroblast growth factor (FGF)-2 protein in the heart. An isolated mouse heart model of ischemiareperfusion injury was used to assess the potential of endogenous FGF-2 for cardioprotection.

While negative inotropic substances can be tested in a heart beating with normal force, the evaluation of a positive inotropic compound usually requires that cardiac force is first reduced. Acute experimental heart failure can be induced by an overdose of barbiturates, such as sodium thiopental, or calcium antagonists. This kind of cardiac failure can be reversed by β-sympathomimetic drugs, cardiac glycosides, or increased Ca +2 concentration. In this way, the potential β-sympathomimetic activity of a new drug can be measured using isoproterenol as standard. After thiopental-Na treatment, left ventricular pressure (LVP) and dp/dt max decrease considerably, whereas coronary flow is slightly enhanced. β-Sympathomimetic drugs restore LVP and dp/dt max and keep coronary blood flow elevated.

Cardiac glycosides increase LVP and dp/dt max and leave coronary flow unchanged.

The effects of a β-sympathomimetic drug such as isoproterenol at doses of 0.05 to 0.2 µg increasing contractile force as well as heart frequency are registered. After injection of a β-blocker, the effects of isoproterenol are attenuated. The effects of a potential βblocking agent can be tested comparing the isoproterenol inhibition versus a standard such as propranolol (0.1 mg).

The LANGENDORFF heart has been extensively used for assessing the coronary dilating activity of drugs (Broadley 1979) . Rothaul and Broadley (1982) demonstrated the release of coronary vasodilator mediators from guinea pig isolated hearts by a technique employing donor and recipient hearts in series.

In order to demonstrate the effect of calcium-antagonists, 1 to 5 mg BaCl 2 are injected which induce a pronounced spasm of the coronary arteries thereby reduc-ing the coronary flow. Five min later, the test drug is injected. Active compounds have a relaxing effect on coronary arteries indicated by an increase of coronary flow. After this effect has weaned, BaCl 2 is injected again and the test drug or a standard drug, e. g. nifedipine, is tested. The increase of coronary flow is expressed as percentage of flow during BaCl 2 spasm and compared with the effect of the standard. Using various doses, dose-response curves can be established. Lindner and Hajdu (1968) described a method using the LANGENDORFF heart in which contractile force, coronary flow, and the potassium content in the coronary outflow was determined by flame photometry. Increase in potassium outflow correlates well with the positive inotropic effect. Lindner and Grötsch (1973) measured the enzymes creatine phosphokinase (CPK), lactate dehydrogenase (LDH), α-hydroxybutyrate dehydrogenase (α-HBDH), and glutamicoxalacetic transaminase (GOT) in the effluent of a guinea pig heart preparation under varying degrees of hypoxia. Potassium content and oxygen tension in the inflowing and outflowing solution were determined. The heart rate, the amplitude of contraction and the rate of coronary vessel perfusion were recorded additionally.

Using 31 P, studies on metabolism of nucleotides and phosphorylated intermediates of carbohydrates in isolated hearts have been performed (Garlick et al. 1977; Jacobus et al. 1977; Hollis et al. 1978; Matthews and Radda 1984) .

The LANGENDORFF heart preparation is also used to test the influence of compounds on cardiac rhythm. For recording monophasic action potentials, suction electrodes are applied on the heart. Ventricular fibrillation can be induced by simultaneous injection of digitoxin (12.5-25.0 µg) and aconitine (12.5-25.0 µg) into the perfusion fluid (Lindner 1963) . Cardiac glycosides shorten the refractory period, decrease the conduction velocity and increase heterotopic stimulus generation. Aconitine increases markedly heterotopic stimulus generation. Both compounds together induce invariably ventricular fibrillation. Anti-arrhythmic com-pounds can be tested in this way. Fibrillation is inhibited, at least partially, by 20 µg prenylamine, 10-20 µg quinidine or 20 µg ajmaline. Takeo et al. (1992) described protective effects of anti-arrhythmic agents on oxygen-deficiency-induced contractile dysfunction of isolated perfused hearts. Hypoxia in isolated rabbit hearts was induced by perfusing the heart for 20 min with Krebs-Henseleit buffer saturated with a gas mixture of 95% N 2 and 5% CO 2 containing 11 mM mannitol. After hypoxic perfusion, the heart was reoxygenated for 45 min with oxygenated buffer containing glucose. Dhein et al. (1989) studied the pathway and time course of the epicardial electrical activation process by means of a computer-assisted epicardial potential mapping, using a matrix of 256 unipolar AgCl electrodes (1 mm spatial and 0.25 ms temporal resolution) in isolated rabbit hearts perfused according to the Langendorff technique. From the activation times of the surrounding electrodes, the direction and velocity of activation for each electrode were calculated, thereby allowing construction of an epicardial vector field. The method was used for the assessment of arrhythmogenic and anti-arrhythmic drug activity.

Ventricular fibrillation can be induced in the LAN-GENDORFF preparation by reducing the glucose content of the perfusion medium to 0.25 g/1000 ml and the KCl content to 0.12 g/1000 ml. (Burn et al. 1957 (Burn et al. , 1960 Lindner 1963) . After a perfusion period of 20 min, 10 µg epinephrine are injected into the perfusion cannula. Immediately afterwards, the heart is stimulated with a current of 40 Hz and 5 mA for 2 min. This procedure is repeated every 10 min. Standard conditions are achieved when the fibrillation continues without further electrical stimulation. Hearts treated in this way serve as controls. Other hearts stimulated in the same way are treated with continuous infusion of the test drug or the standard via the perfusion medium. Differences in the incidence of fibrillations are calculated using the χ 2 test. Balderston et al. (1991) modified the Langendorff technique in rabbit hearts in order to perform electrophysiologic studies. His bundle electrograms were measured with a plunge electrode and allowed atrioventricular nodal physiology to be evaluated directly. Atrial conduction and refractoriness, atrioventricular node conduction and refractoriness, His-Purkinje conduction, and ventricular conduction and refractoriness could be accurately measured. The effects of verapamil and flecainide were described. Lamontagne et al. (1992) isolated platelets from blood of healthy human donors and injected platelets boluses into the perfusion line of the Langendorff preparation of a rabbit heart. In the effluent cyclic GMP was determined as an index for EDRF release. Gottlieb R, Magnus R (1904) Nakano T (1996) Changes 

In working heart preparations of rats, ischemia can be induced by clamping the left coronary artery close to its origin. After removal of the clip, changes in the reperfusion period can be observed. Prevention of these symptoms can be an indicator of the efficacy of coronary drugs.

The preparation used is a modification of an isolated working heart preparation originally used for guinea pig hearts (Bardenheuer and Schrader 1983) . Wistar rats of either sex weighing 280-300 g are sacrificed by decapitation. The hearts are removed and dissected free from the epicard and surrounding connective tissue. A cannula is introduced into the aorta from where the coronary vessels are perfused with the non-recirculated perfusion medium according to the Langendorff technique. In the left ventricle a balloon closely fitting the ventricular cavity is placed and connected to an artificial systemic circulation. The fluid in the balloon is pumped through a cannula into the closed extra corporal circulation being forced into one direction by 2 recoil valves. The balloon is made of silicone material using a Teflon form (Linz et al. 1986 ). The dimensions of the form are derived from casts of the left ventricle of K + -arrested heart by injection of dental cement (Palavit 55, Kulzer and Co, GmbH, Germany). During each heart beat the fluid volume pressed from the balloon, corresponding to the stroke volume of the heart, can be recorded by means of a flow meter probe and an integrator connected in series. Preload and afterload can be adjusted independently from each other. The perfusate flow (retrograde into the aorta and through the coronary arteries) is recorded separately.

The following parameters were measured in isolated rat hearts (Linz et al. 1986 ):

LVP (left ventricular pressure) with Statham pressure transducer P 23 DB, which on differentiation yielded LV dp/dt max and HR (heart rate). Cardiac output and coronary flow (CF) are determined by electromagnetic flow probes in the outflow system and in the aortic cannula, respectively. Coronary venous pO 2 is measured with a catheter placed in the pulmonary artery by a type E 5046 electrode connected to a PMH 73 pH/blood gas monitor (Radiometer). An epicardial electrocardiogram recording is obtained via two silver electrodes attached to the heart. All parameters are recorded on a Brush 2600 recorder.

Myocardial oxygen consumption (MWO 2 ) [ml/ min/g wet weight] is calculated according to the equation:

where CF is the coronary flow [ml/min/g], P a is the oxygen partial pressure of arterial perfusate (650 mm Hg), P v is the oxygen partial pressure of the venous effluent perfusate [mm Hg], and c is the 0.0227 ml O 2 /ml perfusate representing the Bunsen solubility coefficient of oxygen dissolved in perfusate at 37°C (Zander and Euler 1976).

For coronary artery occlusion experiment (Scholz et al. 1992 (Scholz et al. , 1993 , the isolated working hearts are perfused for a period of 20 min (pre-ischemic period) with modified Krebs-Henseleit buffer at a constant pressure of 65 mm Hg. Thereafter, acute myocardial ischemia is produced by clamping the left coronary artery close to is origin for 15 min (ischemic period). The clip is then reopened, and changes during reperfusion are monitored for 30 min (reperfusion period). After coronary artery ligation and reperfusion the hearts develop ventricular fibrillation.

From the coronary effluent samples are taken for lactate, lactate dehydrogenase (LDH), and creatine kinase (CK) determinations. After the experiment, glycogen, lactate, ATP, and creatine phosphate in myocardial tissue are measured.

The test drugs are given into the perfusion medium either before occlusion or 5 min before reperfusion. For ex vivo studies, the rats are treated orally with the test drug 1 h before sacrifice and preparation of the isolated working heart.

The incidence and duration of ventricular fibrillation after treatment with coronary drugs is compared with controls. Left ventricular pressure, LV dP/dt max, and coronary flow are reduced after coronary constriction by angiotensin II, whereas enzyme activities in the effluent are increased and the myocardial content of glycogen, ATP and creatine phosphate are decreased. Cardiac protective drugs have the opposite effects. The values of each parameter are statistically compared with controls. Vogel and Lucchesi (1980) described an isolated, blood perfused, feline heart preparation for evaluating pharmacological interventions during myocardial ischemia. Ventricular function was measured with a fluid-filled latex balloon within the left ventricle. Vleeming et al. (1989) ligated the left coronary artery in rats after thoracotomy in ether anesthesia. Forty-eight hours after the operation, the hearts were prepared for retrograde constant pressure perfusion, according to the Langendorff technique. Igic (1996) presented a new method for the isolated working rat heart. A special double cannula was designed consisting of an outer cannula that is inserted in the aorta and an inner cannula that is advanced into the left ventricle. The perfusion fluid flows through the inner cannula into the left ventricle, and is ejected from there into the aorta. If the outer cannula system is closed, the fluid perfuses the coronary vessels and drips off outside the heart. When the outer cannula is open and certain pressure resistance is applied, a fraction of the ejected fluid perfuses the coronary vessels and the rest is expelled. Because the inner cannula can easily be retracted into the outer cannula, which is placed in the aorta, this preparation provides an opportunity to use the same heart as a "working" or "non-working" model for investigating functions of the heart.

Pepe and McLennan (1993) described a maintained afterload model of ischemia in erythrocyte-perfused isolated working hearts of rats.

Further characterization of the pathophysiological reactions or the isolated working heart was performed by Linz et al. (1999) . The external heart power (EHP) [mJ/min/g] was calculated using the formula:

LVwwt SV indicates stroke volume; MAP, mean aortic pressure; LAP, mean left arterial pressure; d, specific weight perfusate (1.004 g/cm 3 ); r, inner radius of aortic cannula; e, ejection time; HR, heart rate; LV, left ventricle; LVwwt, left ventricular wet weight. The function of the left ventricle was altered by changing the aortic pressure (afterload) at constant left atrial filling load (preload). By adjusting the Starling resistance, the aortic outflow could be switched during 1 min from the fixed baseline afterload to a preset higher afterload producing step-wise rises in mean arterial pressure. Lee et al. (1988) studied the effects of acute global ischemia on cytosolic calcium transients in perfused isolated rabbit hearts with the fluorescent calcium indicator indo 1. Indo 1-loaded hearts were illuminated at 360 nm, and fluorescence was recorded simultaneously at 400 and 550 nm from the epicardial surface of the left ventricle. The F 400 /F 550 ratio was calculated by an analog circuit, which allowed cancellation of optical motion artifact. The resulting calcium transients were registered simultaneously with the ventricular pressure and demonstrated a rapid upstroke and slow decay similar to those recorded in isolated ventricular myocytes. Global ischemia rapidly suppressed contraction, but it produced a concurrent increase in the systolic and diastolic levels of calcium transients, together with an increase in the duration of the peak. Effects of nicainoprol on reperfusion arrhythmia in the isolated working rat heart and on ischemia and reperfusion arrhythmia and myocardial infarct size in the anesthetized rat. Eur J Pharmacol 143:391-401 Pepe S, McLennan PL (1993) A maintained afterload model of ischemia in erythrocyte-perfused isolated working hearts. J Pharm Toxicol Meth 29:203-210 Rajagopalan R, Ghate AV, Subbarayan P, Linz W, Schoelkens BA (1993) Cardiotonic activity of the water soluble forskoline derivative 8,13-epoxy-6β-(piperidinoacetoxy)-1α,7β,9α-trihydro-xy-labd-14-en-11-one. Arzneim Forsch/Drug Res 43:313-319 Schölkens BA, Linz W, Lindpaintner K, Ganten D (1987) Angiotensin deteriorates but bradykinin improves cardiac function following ischaemia in isolated rat hearts. J Hypertens 5: Suppl 5:S7-S9 

The model of chronic heart failure in spontaneously hypertensive rats described by Itter et al. (2004a) (see A.6.0.1.2) has been used by the same group to study the isolated working heart in rats after chronic infarction (Itter et al. 2004b ).

WKY/NHsd and SHR/NHsd rats at an age of 4 months were randomized into two groups -sham and myocardial infarction (MI). The sham procedure consisted of opening the pericardium and placing a superficial suture in the epicardium of the left ventricle (LV). Chronic heart failure (CHF) was induced by permanent (8 weeks) occlusion of the left coronary artery 2 mm distal to the origin from the aorta resulting in a large infarction of the free left ventricular wall. Eight weeks after surgery, parameters indicating CHF were measured. Cardiac hypertrophy, function and geometric properties were determined by the "working heart" mode and in vivo determinations by MRI and heart weight.

The rats were anesthetized with a mixture of ketamine/xylazine (35/2 mg/kg i.p.). The left ventrolateral thorax was shaved and prepared to create a disinfected surgical access area. When stable anesthesia was achieved the animals were placed on a small animal operation table, intubated and ventilated with room air using a small animal ventilator (KTR-4, Hugo Sachs Elektronik, March-Hugstedten, Germany). The level of anesthesia was deemed as adequate following loss of the pedal withdrawal reflex and absence of the palpebral reflex. Reflexes were evaluated before surgery. The operation took 5 min. The tidal volume was adjusted at 3-5 ml and the ventilation rate was 40 breaths/min. Left thoracotomy was performed via the third intercostal space. The heart was exposed and the pericardium opened. The left main coronary artery was ligated with Perma-Hand silk 4-0 USP (Ethicon, Nordersredt, Germany) near its origin at the aorta (2 mm distal to the edge of the left atrium). Ligation resulted in infarction of the free left ventricular wall. Ligation was deemed successful when the anterior wall of the left ventricle turned pale. At this point the lungs were hyperinflated by increasing the positive end-expiratory pressure, and the chest was closed. The rats were placed on a heating pad and covered with a layer of unbleached tissue paper. The rats were extubated following return of reflexes. They were continuously monitored until they started moving in their cages. To avoid ventricular arrhythmias, lidocaine (2 mg/kg i.m.) was given before surgery. To prevent acute lung edema, the rats received furosemide (Lasix, 2 mg/kg body weight twice daily for 3 days) via the drinking water. To avoid pain and distress the rats received metamizol treatment (Novalgin, 0.1 mg/kg body weight i.m.) once, directly after the recovery period.

Before killing the animals 8 weeks after MI, non-invasive sequential nuclear magnetic resonance (NMR) measurements of heart geometric properties were done. Thereafter the animals were anesthetized with pentobarbitone (180 mg/kg i.p. Pentobarbital) and subsequently heparinized (Heparin Natrium 500 I.U./100 g body weight i.p.). Once stable anesthesia was achieved (stage III 3, reflexes absent), the animals were connected to an artificial respirator via a PE (polyethylene) tube inserted into the trachea and ventilated with room air. A transverse laparotomy and a right anterolateral thoracotomy were performed, and the heart was rapidly removed for the evaluation of its function in the working heart mode. The heart was immersed in physiological buffer chilled to 4°C. The aorta was dissected free and mounted onto a cannula (internal diameter: 1.4 mm) attached to perfusion apparatus. The hearts were perfused according to the method of Langendorff with an oxygenated (95% O2/5% CO 2 ) non-circulating Krebs-Henseleit solution of the following compositions (mM): NaCl, 118; KCl, 4.7; CaCl 2 , 2.52; MgSO 4 , 1.64; NaHCO 3 , 24.88; KH 2 PO 4 , 1.18; glucose, 5.55; and Na pyruvate, 2.0 at a perfusion pressure of 60 mmHg. Any connective tissue, thymus or lung was carefully removed. A catheter placed into the pulmonary artery drained the coronary effluent perfusate that was collected for the determination of coronary flow and venous pO 2 measurements. The left atrium was cannulated via an incision of the left auricle. All pulmonary veins were ligated close to the surface of the atria.

When a tight seal with no leaks had been established and after a 15-min equilibration period, the hearts were switched into the working mode, using a filling pressure (preload) of 12 mmHg in WKY/NHsd and 18 mmHg in SH rats. The afterload pressure was 60 mmHg in WKY/NHsd and 80 mmHg in SH rats. After validation of the basis parameters the afterload pressure was enhanced in a cumulative manner from an additional 20 mmHg to 140 mmHg. Thereafter the isovolumetric maxima were determined by enhancing the preload pressure in steps of 5 mmHg to 30 mmHg.

Flow and pressure signals for computation were obtained from the PLUGSYS-measuring system (Hugo Sachs Elektronik, March-Hugstedten, Germany). Computation of data was performed with a sampling rate of 500 Hz, averaged every 2 s, using the software Aquire Plus V1.21f (PO-NE-MAH, Hugo Sachs Elektronik, March-Hugstedten, Germany).

After the evaluation of the external heart work, the total heart weight, and the left and right ventricular weights were determined. The left ventricle was then sectioned transversely into four slices from the apex to the base. Eight pictures were taken of each rat heart, two from each slice. Total infarct size was determined by planimetry of the projected and magnified slices. The areas of infarcted tissue as well as the intact myocardium of each slice were added together and averaged. The infarcted fraction of the left ventricle was calculated from these measurements and expressed as a percentage of the left ventricular mass. The left ventricular perimeter, diameter, infarct scar length, as well as wall thickness and infarct wall thinning were determined as well.

The data are given as mean ± SEM. Statistics were performed using the SAS system statistics package (SAS Insititute, Cary, N.C., USA) with a sequential rejection t-test according to Holm (1979) .

Holm S (1979) A simple sequential rejective multiple test procedure. Scand J Stat 6:65-70 Itter G, Jung W, Juretschke P, Schölkens BA, Linz W (2004a) A model of chronic heart failure in spontaneous hypertensive rats (SHR 

Freshly slaughtered beef hearts are immersed in cold oxygenated Krebs solution and immediately transported in a thermos flask to the laboratory. The left descending coronary artery and several of its primary branches are cut into spiral strips (about 20 mm long and 2-3 mm wide). The specimens can be stored up to 48 h at 4°C. The artery strips are suspended in a 4 ml organ bath under an initial tension of 2 g and immersed in a Krebs' bicarbonate solution at 37°C being gassed with oxygen containing 5% CO 2 throughout the experiment. The Krebs solution contains a mixture of antagonists to inhibit any actions from endogenous acetylcholine, 5-hydroxytryptamine, histamine or catecholamines (hyoscine hydrobromide 10 −7 g/ml, methysergide maleate 2 × 10 −7 g/ml, mepyramine maleate 10 −7 g/ml, propranolol hydrochloride 2 × 10 −6 g/ml). The strips are superfused with a solution of the test compounds in concentrations of 0.01, 0.1, 1.0 µg/ml at a rate of 10-20 ml/min with oxygenated Krebs solution containing the mixture of antagonists. Isometric contractions are recorded with Grass force-displacement transducers (type FT 03 C) on a Grass polygraph. The strips are superfused with Krebs' solution 3 h prior to the experiment. Standard compounds are 100 ng/ml PGE 2 inducing contraction and 100 ng/ml PGI 2 inducing pronounced relaxation.

The relaxation induced by the test compound is expressed as percentage of maximal response to 100 ng/ml PGI 2 . Campell and Paul (1993) measured the effects of diltiazem on isometric force generation, [Ca 2+ ] i , and energy metabolism in the isolated porcine coronary artery. determined the ability of analogues of human α-calcitonin gene-related peptide to relax isolated porcine coronary arteries precontracted with 20 mM KCl. 

Cardiac necrosis can be produced by injection of natural and synthetic sympathomimetics in high doses. Infarct-like myocardial lesions in the rat by isoproterenol have been described by Rona et al. (1959) . These lesions can be totally or partially prevented by several drugs such as sympatholytics or calcium-antagonists.

Groups of 10 male Wistar rats weighing 150-200 g are pretreated with the test drug or the standard either s.c. or orally for 1 week. Then, they receive 5.25 and 8.5 mg/kg isoproterenol s.c. on two consecutive days. Symptoms and mortality in each group are recorded and compared with those of rats given isoproterenol alone. Forty-eight hours after the first isoproterenol administration, the rats are sacrificed and autopsied. The hearts are removed and weighed, and frontal sections are embedded for histological examination.

Microscopic examination allows the following grading: Grade 0: no change Grade 1: focal interstitial response Grade 2: focal lesions in many sections, consisting of mottled staining and fragmentation of muscle fibres Grade 3: confluent retrogressive lesions with hyaline necrosis and fragmentation of muscle fibres and sequestrating mucoid edema Grade 4: massive infarct with occasionally acute aneurysm and mural thrombi For each group the main grade is calculated with the standard deviation to reveal significant differences.

The test has been used by many authors for evaluation of coronary active drugs, such as calcium-antagonists and other cardioprotective drugs like nitroglycerin and molsidomine (Vértesy et al. 1991; Classen et al. 1993 ). Yang et al. (1996) reported a protective effect of human adrenomedullin 13-52 , a C-terminal fragment of adrenomedullin 10-52 on the myocardial injury produced by subcutaneous injection of isoproterenol into rats. 

Ligation of the left coronary artery in rats as described by induces an acute reduction in pump function and a dilatation of left ventricular chamber. The method has been used to evaluate beneficial effects of drugs after acute (Chiariello et al. 1980; Flaim and Zelis 1981; Bernauer 1985) or chronic (Innes and Weisman 1981; treatment.

Male Sprague Dawley rats weighing 200-300 g are anesthetized with diethylether. The chest is opened by a left thoracotomy, and a thread is inserted near the middle of the lateral margin of the cutaneous wound and carried through a tunnel of the left pectoral muscle around the cranial half of the incision. The heart is gently exteriorized by pressure on the abdomen. A ligature is placed around the left coronary artery, near its origin, and is tightened. Within seconds, the heart is repositioned in the thoracic cavity, and the ends of the musculocutaneous thread are tightened to close the chest wall and enable the animal to breathe spontaneously.

The speed of the procedure renders mechanical respiration unnecessary.

To evaluate drug effects, the rats are treated 5 min after and 24 h after occlusion by subcutaneous injection (standard 5 mg/kg propranolol).

Two days after surgery, the rats are anesthetized with 60 mg/kg i.p. pentobarbital and the right carotid artery is cannulated with a polyethylene catheter connected to a pressure transducer. The fluid-filled catheter is then advanced into the left ventricle through the aortic valve for measurement of left ventricular systolic and end-diastolic pressure.

After hemodynamic measurements, the heart is arrested by injecting 2 ml of 2.5 M potassium chloride. The chest is opened, and the hearts are isolated and rinsed with 300 mM KCl to maintain a complete diastole. A double-lumen catheter is advanced into the left ventricle through the ascending aorta, the right and left atria are tied off with a ligature, and the right ventricle is opened. The left ventricular chamber is filled with a cryostatic freeze medium through the smaller of the two catheter lumens and connected to a hydrostatic pressure reservoir maintained at a level corresponding to the end-diastolic pressure measured in vivo. The outlet (larger lumen) is then raised to the same level as the inlet to allow fluid in the two lumens to equilibrate. The heart is rapidly frozen with hexane and dryice.

The hearts are serially cut with a cryostat into 40µm-thick transverse sections perpendicularly to the longitudinal axis from apex to base. At a fixed distance, eight sections are obtained from each heart and collected on gelatin-coated glass slides. Sections are air-dried and incubated at 25°C for 30 min with 490 µM nitroblue tetrazolium and 50 mM succinic acid in 0.2 M phosphate buffer (pH 7.6), rinsed in cold distilled water, dehydrated in 95% ethyl alcohol, cleared in xylene, and mounted with a synthetic resin medium. Viable tissue appears dark blue, contrasting with the unstained necrotic tissue.

The infarct size can be determined by planimetry and expressed as percentage of left ventricular area, and thickness can be expressed as percentage of noninfarcted ventricular wall thickness Chiariello 1980; Roberts et al. 1983 ). An automatic method for morphometric analysis with image acquisition and computer processing was described by Porzio et al. (1995) .

Myocardial infarction following coronary artery ligation in Sprague-Dawley rats is a widely used rat model of heart failure. If the left coronary artery is not completely ligated, heart failure may occur as a consequence of chronic myocardial ischemia ). Johns and Olson (1954) described the coronary artery patterns for mouse, rat, hamster and guinea pig. Kaufman et al. (1959) , Fishbein et al. (1978 Fishbein et al. ( , 1980 used various histochemical methods for identification and quantification of border zones during the evolution of myocardial infarction. Sakai et al. (1981) described an experimental model of angina pectoris in the intact anesthetized rat. In anesthetized rats the tip of a special carotid cannula was placed closely to the right and left coronary ostium. Single intra-aortic injections of methacholine or acetylcholine (in the presence of physostigmine) developed a reproducible elevation of the ST segment and the T wave of the electrocardiogram. Coronary drugs were tested to prevent these changes. Ytrehus et al. (1994) analyzed the effects of anesthesia, perfusate, risk zone, and method of infarct sizing in rat and rabbit heart infarction. Leprán et al. (1981) placed a loose ligature of atraumatic silk around the left anterior descending coronary artery under ether anesthesia in rats. Ten days later, acute myocardial infarction was produced by tightening the ligature. Kouchi et al. (2000) found an increase in G iα protein accompanying progression of post-infarction remodelling in hypertensive cardiomyopathy in rats. G protein α subunits were studied with immunoblotting techniques (Böhm et al. 1990 ). The polyclonal antiserum MB1 was raised in rabbits against the carboxyl-terminal decapeptide of retinal transduction (KENLKDCGLF) coupled to keyhole limpet hemocyanine. The MB1 recognized G iα1 and G iα2 but not G 0α and G iα3 (Böhm et al. 1994) . The membrane fractions were electrophoresed in SDS-polyacrylamide gels and were transferred to nitrocellulose filters. The filters were incubated with the first antibodies for G iα (MB1) or G sα (RM/1) and then with the second antibody (horseradish peroxidase-conjugated goat anti-rabbit IgG, Amersham). Immunoreactive signals were detected by means of the ECL kit (Amersham). Liu et al. (1997) found that ligation of the left descending coronary artery in Lewis inbred rats pro-duces an uniformly large infarct with low mortality. The model may be superior to the usual model in Sprague-Dawley rats with a marked variability in infarct size and cardiac dysfunction.

Coronary artery ligation induces left ventricular remodeling with cardiomyocyte apoptosis, myocardial fibrosis indicated by morphological studies and by collagen accumulation, which can be prevented by drug treatment Belichard et al. 1994; Nguyen et al. 1998; Sia et al. 2002; Bäcklund et al. 2004) .

The naturally occurring peptide N-acety-serylaspartyl-lysyl-proline (Ac-SDKP) is a inhibitor of pluripotent hematopoietic stem cell proliferation and is normally present in human plasma and circulating mononuclear cells. It is cleaved to an inactive form by the NH 2 -terminal catalytic domain of ACE (Azizi et al. 1996) . Acute angiotensin converting enzyme inhibition increases the plasma level of N-acetyl-serylaspartyl-lysyl-proline (Azizi et al. 1996) . By morphological studies and collagen determinations, Rasoul et al. (2004) found an antifibrotic effect of Ac-SDKP and angiotensin converting enzyme inhibition in hypertension in rats. Similarly, found that Ac-SDKP reverses inflammation and fibrosis in rats with heart failure after myocardial infarction.

Moreover, and Le Meur et al. (1998) discussed whether the plasma Ac-SDKP level is a reliable marker of chronic angiotensin converting enzyme inhibition in hypertensive patients. An AcS-DKP EIA Kit is available from Cayman, Ann Arbor, Mich., USA. Chen et al. (2004) found inhibition and reversal of myocardial -infarction-induced hypertrophy and heart failure by NHE-1 inhibition.

Johns and Olson (1954) described a method of experimental myocardial infarction by coronary occlusion in small animals, such as mouse, hamster, rat and guinea pig. Scholz et al. (1995) described a dose-dependent reduction of myocardial infarct size in rabbits by a selective sodium-hydrogen exchange subtype 1 inhibitor. Gomoll and Lekich (1990) tested the ferret for a myocardial ischemia/salvage model. Varying combinations of duration of left anterior descending coronary occlusion and reperfusion were evaluated.

Coronary artery ligation in mice Michael et al. (1995 Michael et al. ( , 1999 , and Gould et al. (2001) described the surgical procedure to induce myocardial ischemia in mice by ligation of the left anterior descending branch of the left coronary artery.

Male C57BL/6 mice 12-16 weeks of age (22.5-30.5 g body weight) were used. Anesthesia was produced by an intraperitoneal injection of pentobarbital sodium (4 mg/ml; 10 µl/g body weight). Mice were placed in a supine position with paws taped to the operating table. With direct visualization of the trachea, an endotracheal tube was inserted and connected to a Harvard rodent volume-cycled ventilator cycling at 100 /min with volume sufficient to adequately expand the lungs but not overexpand. The inflow valve was supplied with 100% oxygen.

For studies of the myocardial response to permanent occlusion, ligation of the anterior descending branch of the left coronary artery was achieved by tying an 8-0 silk suture around the artery. The suture was passed under the artery at a position ∼ 1 mm from the tip of the normally positioned left auricle.

For studies of the effect of reperfusion after coronary artery occlusion, the ligature was tied at the same location on the coronary artery used for the permanent occlusion. However, to allow subsequent reestablishment of blood flow, occlusion was produced by placing a 1-mm length of polyethylene (PE) tubing (OD = 0.61 mm) on the artery and fixing it in place with the ligature. The artery was then compressed by tightening the ligature, producing myocardial blanching and electrocardiographic (ECG) S-T segment elevation as observed in permanent ligations. After occlusion for the desired time, blood flow was restored by removing the ligature and PE tubing. The chest wall was then closed by a 6-0 Ticron suture with one layer through the chest wall and muscle and a second layer through the skin and subcutaneous layer.

After surgical closing of the chest, the endotracheal tube was removed, warmth was provided by a heat lamp, and 100% oxygen was provided via a nasal cone. The animal was given 0.1 mg/kg butorphanol tartrate as an analgesic, and it became sternally recumbent within 1 h. After surviving the experimental infarct the mice recovered, and this allowed postoperative physiological measurement. Sham-operated mice underwent an identical procedure with placement of the ligature but did not undergo coronary artery occlusion. Guo et al. (1998) demonstrated the effects of an early and a late phase of ischemic preconditioning in mice. The results demonstrated that, in the mouse, a robust infarct-sparing effect occurred during both the early and the late phases of ischemic preconditioning, although the early phase was more powerful. Guo et al. (2005) found that late preconditioning induced by NO donors, adenosine A 1 receptor agonists, and δ 1 -opioid receptor agonists is mediated by inducible NO synthase. Lutgens et al. (1999) reported cardiac structural and functional changes after chronic myocardial infarction in the mouse.

Scherrer-Crosbie et al. (1999) described echocardiographic determination of risk area in a murine model of myocardial ischemia. Myocardial contrast echocardiography was performed before and after coronary artery ligation in anesthetized mice by intravenous injection of contrast microbubbles and transthoracic echo imaging. Time-video intensity curves were obtained for the anterior, lateral, and septal myocardial walls. After myocardial ischemia, myocardial contrast echocardiography defects were compared with the area of no perfusion measured by Evans blue staining.

Jones and Lefer (2001) described cardioprotective actions of acute HMG-CoA reductase inhibition in the setting of myocardial infarction. Janssens et al. (2004) reported that cardiomyocytespecific overexpression of NO synthase 3 (NOS3) improves left ventricular (LV) performance and reduces compensatory hypertrophy after myocardial infarction. The effect of cardiomyocyte-restricted overexpression of one NO synthase isoform, NOS3, on LV remodeling after myocardial infarction in mice was tested. LV structure and function before and after permanent left anterior descending (LAD) coronary artery ligation were compared in transgenic mice with cardiomyocyte-restricted NOS3 overexpression (NOS3-TG) and their wild-type littermates (WT). Before myocardial infarction, systemic hemodynamic measurements, echocardiographic assessment of LV fractional shortening (FS), heart weight, and myocyte width (as assessed histologically) did not differ in NOS3-TG and WT mice. The inotropic response to graded doses of isoproterenol was significantly reduced in NOS3-TG mice. One week after LAD ligation, the infarcted fraction of the LV did not differ in WT and NOS3-TG mice. Four weeks after myocardial infarction, however, end-systolic LV internal diameter (LVID) was greater, and FS and maximum and minimum rates of LV pressure development were less in WT than in NOS3-TG mice. LV weight/body weight ratio was greater in WT than in NOS3-TG mice. LaPointe et al. (2004) found that inhibition of cyclooxygenase-2 (COX-2) improves cardiac function after myocardial infarction in the mouse. Myocardial infarction was produced by ligation of the LAD coro-nary artery in mice. Two days later, mice were treated with a selective COX-2 inhibitor, or vehicle in drinking water for 2 weeks. After the treatment period, mice were subjected to two-dimensional M-mode echocardiography to determine cardiac function. Hearts were then analyzed for determination of infarct size, interstitial collagen content, brain natriuretic peptide (BNP) mRNA, myocyte cross-sectional area, and immunohistochemical staining for transforming growth factor (TGF)β and COX-2. Shibuya et al. (2005) reported that N-acetyl-serylaspartyl-lysine-proline prevents renal insufficiency and matrix expansion in diabetic db/db mice. Weinberg et al. (2005) found in coronary ligation experiments in mice, that rosuvastatin reduces experimental left ventricular infarct size after ischemiareperfusion injury but not total coronary occlusion. Yang et al. (2005) found that the infarct-sparing effect of A 2A -adenosine receptor activation is due primarily to its action on lymphocytes. Chimeric mice were created by bone marrow transplantation from A 2A AR-knockout or green fluorescent protein (GFP) donor mice to irradiated congenic C57BL/6 (B6) recipients. In the GFP chimeras, we were unable to detect GFP-producing cells in the vascular endothelium, indicating that bone-marrow-derived cells were not recruited to endothelium at appreciable levels after bone marrow transplantation and/or acute myocardial infarction. Injection of 5 or 10 µg/kg of a potent and selective agonist of A 2A adenosine receptor had no effect on hemodynamic parameters but reduced infarct size in B6 mice after 45 min of LAD artery occlusion followed by 24 h of reperfusion. Kanno et al. (2003) found connexin43 to be a determinant of myocardial infarct size following coronary occlusion in mice.

Regulation of myocardial connexins during hypertrophic remodeling was reviewed by Teunissen et al. (2004) . Kuhlmann et al. (2006) reported that granulocyte colony stimulating factor (G-CSF), alone or in combination with stem cell factor (SCF), can improve hemodynamic cardiac function after myocardial infarction in mice and reduces inducible arrhythmias in the infarcted heart potentially via increased connexin43 expression and arteriogenesis. 

The size of infarcts is studied after proximal occlusion of the left anterior descending coronary artery in openchest dogs. Compounds potentially reducing infarctsize are tested. To delineate the post-mortem area at risk, coronary arteriograms are made after injection of a BaSO 4 -gelatin mass into the left coronary ostium. The infarct's area is visualized with nitro-blue tetrazolium chloride in myocardial sections.

Dogs of either sex weighing approximately 30 kg are used. The animals are anesthetized by intravenous injection of pentobarbital sodium (bolus of 35 mg/kg followed by continuous infusion of 4 mg/kg/h). The animals are placed in the right lateral position. Respiration is maintained through a tracheal tube using a positive pressure respirator. Arterial blood gases are checked, and the ventilation rate and/or oxygen flow rate are adjusted to achieve physiological blood gas values (P O2 : 100-140 mm Hg, P CO2 : 32-40 mm Hg, and pH 7.47). A peripheral vein (saphenous vein) is cannulated for the administration of test compound. The ECG is recorded continuously from lead II (Einthoven).

For recording of peripheral systolic and diastolic blood pressure, the cannula of a femoral vein is connected to a pressure transducer (Statham P 23 DB). For determination of left ventricular pressure (LVP), a Millar microtip catheter (PC 350) is inserted via the left carotid artery. Left ventricular enddiastolic pressure (LVEDP) is measured from a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate is counted.

The heart is exposed through a left thoracotomy between the fourth and fifth intercostal space, the pericard is opened and the left anterior descending coronary artery (LAD) is exposed. After reaching steady state conditions for the hemodynamic parameters (approx. 45 min), the LAD is ligated just below the first diagonal branch for 360 min. No attempt is made to suppress arrhythmic activity after the ligation. The test substance or the vehicle (controls) is administered by intravenous bolus injection and/or continuous infusion. The schedule of administration may vary. Hemodynamic parameters are registered continuously during the whole experiment. At the end of the experiment, the animals are sacrificed with an overdose of pentobarbital sodium and the heart is dissected.

Coronary arteriograms are made according to Schaper et al. (1979) to delineate the anatomic post-mortem area at risk. A purse-string suture is placed around the left coronary ostium in the sinus of Valsalva; a cannula is then placed in the ostium and the purse-string suture is tightened. Micronized BaSO 4 suspended in 12% gelatin solution (37°C) is injected under increasing pressure (2 min at 100 mm Hg, 2 min at 150 mm Hg and 2 min at 200 mm Hg). The heart is placed in crushed ice to gel the injectate. The right ventricle is removed and the left ventricle plus septum is cut into transverse sections (approx. 1 cm thick) from the apex to the level of the occlusion (near the base). From each slice angiograms are made with a X-ray tube at 40 kV to assess the post-mortem area at risk (by defect opacity: reduction of BaSO 4 -filled vessels in infarct tissue).

The slices are then incubated in p-nitro-blue tetrazolium solution (0.25 g/L in Sörensen phosphate buffer, pH 7.4, containing 100 mM D,L-maleate) in order to visualize the infarct tissue (blue/violet-stained healthy tissue, unstained necrotic tissue). The slices are photographed on color transparency film for the determination of the infarct area.

Left ventricle and infarct area, and area at risk are measured by planimetry from projections of all slices with the exclusion of the apex and of the slice containing the ligature.

Mortality and the different hemodynamic parameters are determined. Changes of parameters in drug-treated animals are compared to vehicle controls. The different characteristics are evaluated separately. Mean values ± SEM of infarct area and of area at risk are calculated. Statistical analyses consist of regression and correlation analyses and of the Student's t-test. Results are considered significant at p < 0.05. Nachlas and Shnitka (1963) described the macroscopic identification of early myocardial infarcts by alterations in dehydrogenase activity in dogs by staining the cardiac tissue with Nitro-BT [2,2di-p-nitrophenyl-5,5 diphenyl-3,3 -(3,3 -dimethoxy-4,4 -biphenylene) ditetrazolium chloride] yielding a dark blue formazan in viable muscle but not in necrotic muscle fibers. Chiariello et al. (1976) compared the effects of nitroprusside and nitroglycerin on ischemic injury during acute myocardial infarction in dogs. Black et al. (1995) studied the cardioprotective effects of heparin or N-acetylheparin in an in vivo dog model of myocardial and ischemic reperfusion injury. The hearts were removed after 90 min of coronary occlusion and a 6 h-reperfusion period. Area at risk was determined by the absence of Evans blue dye after perfusion of the aorta in a retrograde fashion and infarct zone by the absence of formazan pigment within the area at risk after perfusion of the circumflex coronary artery with triphenyltetrazolium chloride. Reimer et al. (1985) tested the effect of drugs to protect ischemic myocardium in unconscious and conscious dogs. In the conscious model, dogs of either sex weighing 10-25 kg were anesthetized with thiamyal sodium (30-40 mg/kg i.v.) and underwent thoracotomy through the 4th intercostal space. Heparinfilled polyvinyl chloride catheters were positioned in the aortic root, the left atrium via the left atrial appendage, and a systemic vein. A mechanical adjustable snare type occluder was placed around the proximal left circumflex coronary artery above or below the first marginal branch, so that temporary occlusion resulted in cyanosis of at least 75% of the inferior wall. The catheters and snare were either exteriorized or positioned in a subcutaneous pocket at the back of the neck. Penicillin, 1000,000 units, and streptomycin, 1.0 g, were given i.m. for the first 4 postoperative days, and at least 7 days were allowed for recovery from surgery.

Dogs were fasted overnight prior to the study. After exteriorization and flushing of the catheters, 30-40 min were allowed for the animals to adjust to laboratory conditions. Morphine sulfate, 0.25 mg/kg, i.m., was given 30 min before occlusion, and an additional 0.25 mg/kg, i.v., was given 20 min later. Heart rate and aortic and left atrial pressures were monitored continuously. Permanent coronary occlusion was produced by a sudden one-stage tightening of the snare occluder. Drugs were administered by continuous i.v. infusion over 6 h. Hemodynamic measurements were taken 5 min before occlusion and 10, 25, 105, 180, and 360 min after occlusion. Raberger et al. (1986) described a model of transient myocardial dysfunction in conscious dogs. Mongrel dogs, trained to run on a treadmill, were chronically instrumented with a miniature pressure transducer in the left ventricle and a hydraulic occluder placed around the circumflex branch of the left coronary artery. Two pairs of piecoelectrical crystals for sonomicrometry were implanted subendocardially to measure regional myocardial functions. Comparable episodes of regional dysfunction of the left coronary artery area during treadmill runs were found after partial left coronary artery stenosis induced by external filling of the occluder.

Hartman and Warltier (1990) described a model of multivessel coronary artery disease using conscious, chronically instrumented dogs. A hydraulic occluder was implanted around the left anterior descending coronary artery (LAD) and an Ameroid constrictor around the left circumflex coronary artery (LCCA). Pairs of piecoelectric crystals were implanted within the subendocardium of the LAD and LCCA perfusion territories to measure regional contractile function. A catheter was placed in the left atrial appendage for injection of radioactive microspheres to measure regional myocardial perfusion. Bolus injections of adenosine were administered daily via the left atrium to evaluate LAD and LCCA coronary reserve. After stenosis by the Ameroid constrictor, radioactive microspheres were administered to compare regional perfusion within normal myocardium to flow in myocardium supplied by the occluded or stenotic coronary arteries. Holmborn et al. (1993) compared triphenyltetrazolium chloride staining versus detection of fi-bronectin in experimental myocardial infarction in pigs. Klein et al. (1995) used intact pigs and found myocardial protection by Na + /H + exchange inhibition in ischemic reperfused hearts. Klein et al. (1997) measured the time delay of cell death by Na + /H + exchange inhibition in regionally ischemic, reperfused porcine hearts. Garcia-Dorado et al. (1997) determined the effect of Na + /H + exchange blockade in ischemic rigor contracture and reperfusion-induced hypercontracture in pigs submitted to 55 min of coronary occlusion and 5 h reperfusion. Myocardial segment length analysis with ultrasonic microcristals was used to detect ischemic rigor (reduction in passive segment length change) and hypercontracture (reduction in end-diastolic length). Symons et al. (1998) tested the attenuation of regional dysfunction in response to 25 cycles of ischemia (2 min) and reperfusion (8 min) of the left circumflex coronary artery in conscious swine after administration of a Na + /H + exchange inhibitor. The animals were instrumented to measure arterial blood pressure, regional myocardial blood flow (colored microspheres), systolic wall thickening in the normally perfused left anterior descending and left circumflex coronary artery regions (sonomicrometry), left circumflex coronary artery blood flow velocity (Doppler) and reversibility to occlude the left circumflex coronary artery (hydraulic occluder). Etoh et al. (2001) studied myocardial and interstitial matrix metalloproteinase activity after acute myocardial infarction in pigs.

Severe left ventricular failure is induced by repeated injections of 50 µm plastic microspheres into the left main coronary artery of anesthetized dogs. Hemodynamic measurements are performed under theses conditions testing drugs which potentially improve cardiac performance. The test can be used to evaluate the influence of drugs on myocardial performance during acute ischemic left ventricular failure in dogs.

Dogs of either sex weighing approximately 30 kg are anesthetized by an intravenous bolus injection of 35-40 mg/kg pentobarbital sodium continued by an infusion of 4 mg/kg/h. The animals are placed in the right lateral position. Respiration is maintained through a tracheal tube using a positive pressure respirator and controlled by measuring end-expiratory CO 2 concentration as well as blood gases. Two peripheral veins are cannulated for the administration of narcotic (brachial vein) and test compounds (saphenous vein). The ECG is recorded continuously in lead II (Einthoven).

For recording of peripheral systolic and diastolic blood pressure, the cannula of the right femoral vein is connected to a pressure transducer (Statham P 23 DB). For determination of left ventricular pressure (LVP), a Millar microtip catheter (Gould PC 350) is inserted via the left carotid artery. Left ventricular enddiastolic pressure (LVEDP) is measured on a high-sensitivity scale. From the pressure curve, dp/dt max is differentiated and heart rate (HR) is counted. To measure right ventricular pressure, a Millar microtip catheter is inserted via the right femoral vein. Systolic, diastolic and mean pulmonary artery pressure (PAP), mean pulmonary capillary pressure, and cardiac output are measured by a thermodilution technique using a Cardiac Index Computer (Gould SP 1435) and a balloontip triple lumen catheter (Gould SP 5105, 5F) with the thermistor positioned in the pulmonary artery via the jugular vein.

The heart is exposed through a left thoracotomy between the fourth and fifth intercostal space, the pericard is opened and the left circumflex coronary artery (LCX) is exposed. To measure coronary blood flow, an electromagnetic flow probe (Hellige Recomed) is placed on the proximal part of the LCX.

Polystyrol microspheres (3M Company, St. Paul, Minnesota, USA) with a diameter of 52.5 ± 2.24 µm are diluted with dextran 70, 60 mg/ml and saline at a concentration of 1 mg microspheres/ml (1 mg = approx. 12,000 beads). For administration of microspheres, an angiogram catheter (Judkins-Schmidt Femoral-Torque, William Cook, Europe Aps. BP 7) is inserted into the left ostium via the left femoral artery.

The microspheres are injected through the angiogram catheter into the left ostium initially as 10 ml and later as 5 ml boluses about 5 min apart. The microsphere in-jections produce stepwise elevations of LVEDP. Embolization is terminated when LVEDP has increased to 16-18 mm Hg and/or PAPm has increased to 20 mm Hg and/or heart rate has reached 200 beats/min. The embolization is completed in about 70 min and by injection of an average dose of 3-5 mg/kg microspheres. Hemodynamic variables are allowed to stabilize after coronary embolization for at least 30 min.

The test substance or the vehicle (controls) is then administered by intravenous bolus injection or continuous infusion, or by intraduodenal application.

Recordings are obtained Changes of parameters in drug-treated animals are compared to vehicle controls; statistical significance of the differences is calculated with the Student's t-test.

Mean embolization times, doses of microspheres and number of microsphere applications are evaluated. Gorodetskaya et al. (1990) described a simple method to produce acute heart failure by coronary vessel embolization with microspheres in rats. 

Damage to the mammalian heart produced by prolonged ischemia and reperfusion can be reduced by "preconditioning" the myocardium via a brief cycle of ischemia and reperfusion prior to the protracted ischemic event. Ischemic preconditioning has been shown to decrease infarct size and increase recovery of post-ischemic ventricular function (Murray et al. 1986) , and to reduce leakage of cellular marker proteins indicative for cardiac myocyte death (Volovsek et al. 1992 ). In addition, preliminary preconditioning also attenuates cardiac arrhythmia associated with subsequent occlusion and reperfusion (Vegh et al. 1990 ).

The mechanistic basis of this phenomenon is under discussion (Parratt 1994; Parratt and Vegh 1994) . Adenosine receptor involvement in myocardial protection after ischemic preconditioning in rabbits has been shown by Baxter et al. (1994) . Adenosine (A 1 receptor) antagonists have been demonstrated to block the protection produced by preconditioning (Liu et al. 1991) , and short term administration of adenosine was shown to simulate the protective effects of ischemic preconditioning (Toombs et al. 1993) . These observations together suggest that adenosine is generated by the short preconditioning ischemia. Other recent pharmacological studies (Gross and Auchampach 1992; Yao and Gross 1994) indicate the involvement of the ATP-sensitive potassium channel. Recent investigations indicate that an increase of NO production after ACE inhibitors may be a part of the protective mechanism (Linz et al. 1992 . Moreover, the involvement of prostanoids and bradykinin in the preconditioning process has been discussed (Wiemer et al. 1991) . Gho et al. (1994) found a limitation of myocardial infarct size in the rat by transient renal ischemia, supporting the hypothesis that the mechanism leading to cardiac protection by ischemic preconditioning may not only reside in the heart itself.

New Zealand rabbits of either sex weighing 2.5-3.5 kg are initially anesthetized with an intramuscular injection of ketamine (50 mg/ml) /xylazine (10 mg/ml) solution at a dose of 0.6 ml per kg body weight. A tracheotomy is performed to facilitate artificial respiration. The left external jugular vein is cannulated to permit a constant infusion (0.15-0.25 ml/min) of xylazine (2 mg/ml in heparinized saline) to assist in maintaining anesthesia and fluid volume. Anesthesia is also maintained by i.m. injections (0.4-0.6 ml) of ketamine (80 mg/ml) and xylazine (5 mg/ml) solution. After the xylazine infusion is started, animals are respired with room air at a tidal volume of 10 ml/kg and a frequency of 30 inflations per min (Harvard Apparatus, USA). Thereafter, ventilation is adjusted or inspiratory room air is supplemented (5% CO 2 /95% O 2 ) to maintain arterial blood chemistry within the following ranges: pH 7.35-7.45, P CO2 25-45 mm Hg, P O2 90-135 mm Hg. The right femoral artery and vein are isolated and catheterized for measurement of arterial pressure and administration of drugs, respectively.

A thoracotomy is performed in the fourth intercostal space, and the lungs are retracted to expose the heart. The pericardium is cut to expose the left ventricle, and a solid-state pressure transducer catheter (e. g., Mi-croTip 3F, Millar Instruments, Houston, USA) is inserted through an apical incision and secured to enable measurement of pulsatile left ventricular pressure. The maximal rate of increase in left ventricular pressure (LVdP/dt max) is determined by electronic differentiation of the left ventricular pressure wave form. A segment of 4-0 prolene suture is looped loosely around a marginal branch of the left main coronary artery to facilitate coronary occlusion during the experiment. Needle electrodes are inserted subcutaneously in a lead II configuration to enable recording of an ECG in order to determine heart rate and help confirm the occurrence of ischemia (ST segment elevation) and reperfusion of the myocardium distal to the coronary occlusion. Continuous recording of pulsatile pressure, ECG, heart rate, and LVdP/dt are simultaneously displayed on a polygraph (e. g. Gould chart recorder, Gould Inc., Valley View, USA) and digitized in real time by a personal computer. Hemodynamic data are condensed for summary and later statistical analysis.

Ischemic preconditioning is induced by tightening the prolene loop around the coronary artery for 5 min and then loosening to reperfuse the affected myocardium for 10 min prior to a subsequent 30 min occlusion. After surgical preparation, and prior to 30 min of occlusion, rabbits are randomly selected to receive ischemic preconditioning, no preconditioning, or ischemic preconditioning plus treatment with test drugs. After 30 min of occlusion, the ligature is released and followed by 120 min of reperfusion. Occlusion is verified by epicardial cyanosis distal to the suture, which is usually accompanied by alterations in hemodynamics and ECG. Reperfusion is validated by return of original color. Systemic hemodynamics are summarized for each experimental period. The experiment is terminated after 120 min of reperfusion, and the heart is excised for determinations of infarct size and area at risk.

Immediately before the animal is sacrificed, the marginal branch of the left coronary artery is reoccluded and India ink is rapidly injected by syringe with a 18-g needle into the left ventricular chamber to demarcate blackened normal myocardium from unstained area at risk. After the rabbits are sacrificed, the heart is removed and sectioned in a breadloaf fashion from apex to base perpendicular to the long axis. The right ventricle is removed from each slice leaving only the left ventricle and septum. After each slice is weighed, the portions are washed and incubated in a phosphate buffered saline solution of triphenyl tetrazolium chloride (1 g/ml, Sigma) for 10-15 min. Salvaged myocardium in the area at risk stains brick red, whereas infarcted tissue remains unaltered in color. Slices are then placed between sheets of Plexiglas and the areas (normal, risk, infarct) of each slice are traced on a sheet of clear acetate. Traces are then digitized and analyzed using computerized planimetry to compare the relative composition of each slice with respect to normal tissue, area at risk, and infarcted myocardium. Planimetry is performed with a computerized analysis system, e. g., Quantimet 570C image analysis system (Leica, Deerfield, USA).

Surface areas of normal tissue, area at risk, and infarcted myocardium on both sides of each slide are averaged for the individual slide. The contribution of each slide to total infarcted and area at risk (%) and area at risk as a percentage of total left ventricular mass for the entire left ventricle is prorated by the weight of each slice (Garcia-Dorado et al. 1987) . By adding the adjusted contributions from each slice to infarcted tissue, area at risk, and left ventricular mass, a threedimensional mathematical representation of total myocardial infarct size and risk zone can be calculated for each rabbit, and a mean tabulated for each treatment group for statistical comparison.

All data are presented as mean ± SD. Systemic hemodynamic data are analyzed by ANOVA using Statistica/W software. Means are considered significantly different at p < 0.05. Li et al. (1990) found in dog experiments that preconditioning with one brief ischemic interval is as effective as preconditioning with multiple ischemic periods.

In contrast, Vegh et al. (1990) found in other dog experiments that two brief preconditioning periods of coronary occlusion, with an adequate period of reperfusion between, reduce the severity of arrhythmias. Yang et al. (1996) found a second window of protection after ischemic preconditioning in conscious rabbits which minimizes both infarction and arrhythmias.

Late preconditioning against myocardial stunning in conscious pigs together with an increase of heat stress protein (HSP) 70 was described Sun et al. (1995) . Szilvassy et al. (1994) described the anti-ischemic effect induced by ventricular overdrive pacing as a conscious rabbit model of preconditioning. Rabbits were equipped with right ventricular electrode catheters for pacing and intracavital recording and polyethylene cannulae in the left ventricle and right carotid artery to measure intraventricular pressure and blood pressure. One week after surgery in conscious animals, ventricular overdrive pacing at 500 beats/min over 2, 5, or 10 min resulted in an intracavital S-T segment elevation, shortening of ventricular effective refractory period, decrease in maximum rate of pressure development and blood pressure, and increase in left ventricular end-diastolic pressure proportional to the duration of stimulus. A 5-min preconditioning ventricular overdrive pacing applied 5 or 30 min before a 10min ventricular overdrive pacing markedly attenuated ischemic changes, whereas a 2-min ventricular overdrive pacing had no effect.

The ventricular overdrive pacing induced preconditioning effect was lost in atherosclerotic rabbits (Szilvassy et al. 1995) , however, delayed cardiac protection could be induced in these animals (Szekeres et al. 1997) . Park SW, Qiu Y, Bolli R (1995) Late preconditioning against myocardial stunning. An endogenous protective mechanism that confers resistance to post-ischemic dysfunction 24 h after brief ischemia in conscious pigs. Volovsek A, Subramanian R, Reboussin D (1992) Effects of duration of ischaemia during preconditioning on mechanical function, enzyme release and energy production in the isolated working rat heart. J Mol Cell Cardiol 24:1011-1019 Wiemer G, Schölkens BA, Becker RHA, Busse R (1991) Ramiprilat enhances endothelial autacoid formation by inhibiting breakdown of endothelium-derived bradykinin. 

Magnetic resonance imaging (MRI) is the preferred technique for the visualization of lesions in the brain and spinal cord of patients with MS. It visualizes the resonance signals of tissue protons when they are placed in a time-varying strong magnetic field. The most frequently used parameters measured in MS are the spin-lattice relaxation time (T 1 ) and the spin-spin relaxation time (T 2 ). MRI is routinely used as a tomographic imaging technique, where anatomical pictures are created of 1-mm-thick tissue sections. The contrast differences between brain structures in most MRI techniques are determined by the different densities and diffusion of protons, as well as differences in relaxation times. T 2 images are sensitive to water and, because all pathological alterations in MS brains are associated with altered distribution of tissue water (edema), this technique is highly useful for visualization of the spatial distribution of lesions. Contrast in T 1 images is determined mainly by different lattice densities. Dense structures, such as compact white matter, have low T 1 values, whereas relatively loose structures, such as grey matter or lesions, have higher T 1 values.

To distinguish inflammatory active from inactive lesions, the paramagnetic dye gadolinium-DTPA is intravenously injected (0.1-0.3 mmol kg −1 ) and, in areas of increased blood-brain barrier permeability, leaks into the brain parenchyma, causing local enhancement of the T 1 -weighted signal intensity.

A third important MRI technique in MS is magnetization transfer ratio (MTR) imaging. The MTR of a given tissue is defined as the ratio of free protons versus protons bound to tissue macromolecules.

MRI has emerged as a highly accurate and quantitative tool for the evaluation of cardiac function (Peshock et al. 1996) . Al-Shafei et al. (2000a performed MRI analysis of cardiac cycle events in diabetic rats and tested the effect of angiotensin-converting enzyme inhibition.

Diabetes was induced in Wistar rats at an age of 7, 10, and 13 weeks. The rats were anesthetized using 1%-2% halothane in oxygen, their blood glucose levels were checked. They were then given a single intraperitoneal injection of streptozotocin 65 mg/kg body weight. The control rats received sham injections of the citrated buffer when they were 7 weeks old. One diabetic group was treated with 2 g/l captopril in the drinking water

For MR imaging, rats were anesthetized using 1%-2% halothane in oxygen, weighed and their systolic blood pressures measured non-invasively using a rat tail blood pressure monitor both before and after imaging sessions to confirm physiological stability. Electrocardiographic (ECG) monitoring used shielded subcutaneous electrodes and a Tektronix 2225 oscilloscope. The cine imaging protocols were performed with the anesthetized animal placed in a specially designed home-built half-sine-spaced birdcage radiofrequency (RF) probe unit contained within a cylindrical plastic holder fitted within a gradient set of internal diameter 11 cm. The RF probe unit was made up of a half-sine spaced birdcage RF probe of internal diameter of 4.5 cm with open ends, an RF shield consisting of a cylinder of copper gauze surrounding and sliding over the birdcage, a tuning capacitor and a coaxial cable to carry the RF (Ballon et al. 1990 ). The assembly included ECG leads, attachment plugs for the ECG leads and a unit to anchor anesthetic delivery tubes near the nose of the animal. All experiments used a 2 T Oxford Instruments (UK) superconducting magnet with a horizontal internal bore of 31 cm. A gated cine protocol synchronized line acquisition to set times following alternate electrocardiographic R waves. This acquisition was then repeated at the same slice position at 12 equally incremented times through the cardiac cycle. This sequence in turn was repeated for each of the 128 lines to generate each 128 × 128 image, which itself was acquired twice for signal averaging. The preceding procedure was in turn repeated 12 times to obtain signal-averaged images for every one of the 12 contiguous transverse slices examined. Each imaging session therefore required (128 × 12 × 2 × 2) times the cardiac cycle duration. The effective repeat time (TR) was approximately 13 ms. The short echo time (TE) of 4.3 ms reduced motion artifacts and ensured good contrast between blood and myocardium.

The image data were transferred from the MRI console using in-house hardware and software to remote UNIX workstations for quantitative analysis using inhouse software based on CaMReS libraries (CaMReS, Dr N. J. Herrod, Herchel Smith Laboratory for Medicinal Chemistry, University of Cambridge). used non-invasive MRI techniques in a model of chronic heart failure in spontaneously hypertensive rats. Bryant et al. (1998) and Franco et al. (1999) described MRI and invasive evaluation of development of heart failure in transgenic mice with myocardial expression of tumor necrosis factor-α. Wiesmann et al. (2002) reported analysis of right ventricular function in healthy mice and a murine model of heart failure byin vivo MRI. Kraitchman et al. (2003) described quantitative ischemia detection during cardiac magnetic resonance stress testing by use of fast harmonic phase MTI (FastHARP) in dogs. Reddy et al. (2004) discussed the feasibility of a porcine model of healed myocardial infarction by integration of cardiac MRI with three-dimensional electroanatomic mapping to guide left ventricular catheter manipulation. Pelzer et al. (2005) reported that the estrogen receptor-α agonist 16α-LE2 inhibits cardiac hypertrophy and improves hemodynamic function in estrogendeficient spontaneously hypertensive rats. Improved left ventricular function upon 16α-LE2 treatment was also observed in cardiac MRI studies. mals were housed individually and provided with food and water ad libitum. Inbred Brown Norway (BN; RT1 n ) and DA (RT1 a ) rats were obtained from Harlan Sprague Dawley (Indianapolis, Ind).

Under anesthesia with injection of 35 mg/kg body weight of sodium pentobarbital IP, 500 U/kg body weight of heparin was injected. In the syngeneic group, an en bloc donor heart and lung were taken from a BN rat and transplanted to another BN rat. In the allogeneic group, a graft from a DA rat was transplanted to a BN rat. This group was divided into two groups: one group was treated with 3 mg/kg per day ciclosporin (CsA), and the other group was not given CsA. Graft survival was monitored every day by palpating contraction of the transplanted heart.

Operative procedures have been described by Kanno et al. (2000) . In brief, after the chest wall of the donor rat was opened, the left lung was ligated and excised. The azygos vein with the left superior and right superior venae cavae was ligated and divided. The descending thoracic aorta was transected, and 10 ml of cold University of Wisconsin solution (UW solution, Dupont Pharma) was infused into the inferior vena cava until the fluid draining from the aorta was clear, followed by ligation and division of the inferior vena cava. The ascending aorta was dissected and transected at the portion between the left common carotid artery and the left subclavian artery, followed by ligation and division of the right brachiocephalic artery and the left common carotid artery. After removal of the heart and lung from the donor, the right lung was washed 3 times through the bronchus with UW solution containing penicillin G. The grafts were then placed into cold UW solution for ≈5 min until transplantation. Next, the left inguinal portion of the recipient rat was opened and dissected to make enough space for the transplanted organs. The left lower part of the abdominal wall was opened in a transverse fashion from the left femoral vessels to the midline. The abdominal organs were retracted to the right, and both the aorta and the inferior vena cava just beyond the bifurcation were dissected. The vessels were clamped, and an appropriate opening of the aorta was made to receive the aorta of the graft in an end-to-side fashion. Rhythmic heartbeats commenced spontaneously as the heart and the lung regained circulation after removal of the clamp. After hemostasis of the surgical field, the abdominal wall was sutured, with care taken not to kink or obstruct the aorta of the graft.

MRI measurements were carried out on a 4.7-T/40cm Bruker AVANCE DRX MR instrument equipped with 15-cm, 10-gauss/cm shielded gradients. In vivo MR images of transplanted heart-lung were obtained over a period of 24 h after infusion of dextran-coated ultrasmall superparamagnetic iron oxide (USPIO) particles. The imaging sequence consisted of a gradient echo sequence, triggered to ECG and ventilator (60 strokes/min, 10 ml/kg), with TR/TE 500/10 ms, flip angle equal to Ernst angle, slice thickness 1 mm, field of view 6.0 cm, data matrix size 256 × 130 (zero-filled to 256 × 256), and scan time 5 min. ECG leads were placed on both of the hind limbs of the rat with the transplant to pick up the heartbeat from the transplanted heart more effectively. The change of MRI signal intensity was measured in whole ventricular wall in each transplanted heart. The MR signal intensity of the heart was normalized to that of the leg muscle, because USPIO particles are not readily taken up by muscular tissue, according to Gellissen et al. (1999) Dextran-coated USPIO particles were synthesized according to the method of Palmacci and Josephson (1993) with slight modifications (Dodd et al. 1999) The MR relaxivities R 1 (spin-lattice relaxation rate constant, 1/T 2 , per mol of Fe in USPIO) and R 2 (spin-spin relaxation rate constant, 1/T 2 , per mol of Fe in USPIO) measured at 4.7 T were 3.8 × 10 4 and 9.1 × 10 4 (mol/l)/s, respectively. For in vivo studies, dextran-coated USPIO particles were dialyzed against PBS solution and diluted to a concentration of 18 µmol Fe/ml, and 0.8 ml of the suspension (i. e., ≈3 mg Fe/kg body weight) was injected intravenously for each study.

At 6 days after transplantation, dextran-coated US-PIO particles were injected intravenously as mentioned above, and the animals were subjected to MRI. Then 24 h later, these animals were again placed inside the magnet and scanned. The regions of interest were defined manually with Bruker software. MR signal intensity in the entire ventricular wall in the plane was measured. After injection of USPIO particles at postoperative day (POD) 6, animals with allotransplants were given CsA for 4 (POD 7 to 10) or 7 (POD 7 to 13) days and reinjected with USPIO particles on POD 14.

After an MR experiment was completed, the transplanted hearts were extirpated, fixed in 3.7% formaldehyde, and embedded in paraffin for 5-µm sections. Hematoxylin-eosin staining and Perl's Prussian blue staining were performed in the Transplantation Pathol-ogy Laboratory of the University of Pittsburgh Medical Center. Histological analysis for pathological grading of heart rejection, which is based on the criteria established by the International Society for Heart and Lung Transplantation, was also performed by this laboratory in a blinded manner. Monoclonal antirat macrophage antibody (ED1, Serotec) was used as a primary antibody for macrophages. Immunohistochemistry was carried out with the ABC staining system (Santa Cruz Biotechnology) according to the manufacturer's protocol.

The results are presented as mean ± SD. The results were analyzed by ANOVA with StatView software (SAS Institute). A value of P < 0.05 was considered to be statistically significant.

Dodd SJ, Williams M, Suhan JP et al (1999) 

Prolonged administration of coronary drugs has been shown to increase the number and size of interarterial collaterals of dogs and pigs after coronary occlusion (Vineberg et al. 1962; Meesmann and Bachmann 1966) . An increased rate of development of collateral arteries was observed after physical exercise in dogs (Schaper et al. 1965) , as well as after chronic administration of coronary dilating drugs (Lumb and Hardy 1963 ). An even more effective stimulus for collateral development is an acute or gradual occlusion of one or several major coronary branches. Filling the arterial coronary bed with a plastic provides the possibility to make the collaterals visible and to quantify them (Schmidt and Schmier 1966; Kadatz 1969) .

Dogs weighing 10-15 kg are anesthetized with pentobarbital sodium 30 mg/kg i.v. They are respirated artificially and the thorax is opened. After opening of the pericard, Ameroid cuffs are placed around major coronary branches. Gradual swelling of the plastic material occludes the lumen within 3-4 weeks. The dogs are treated daily with the test drug or placebo. After 1 week recovery period they are submitted to exercise on a treadmill ergometer. After 6 weeks treatment, the animals are sacrificed, the heart removed and the coronary bed flushed with saline. The liquid plastic Araldite is used to fill the whole coronary tree from the bulbus aortae. The aortic valves are glued together in order to prevent filling of the left ventricle. Red colored Araldite is used to fill the arterial tree. The venous part of the coronary vasculature can be filled with blue colored Araldite from the venous sinus. The uniformity of the filling pressure, the filling time, and the viscosity of the material are important. Polymerization is complete after several hours. Then, the tissue is digested with 35% potassium hydroxide. The method gives stable preparations which can be preserved for a long time.

Plastic casts from drug treated animals are compared with casts from dogs submitted to the same procedure without drug treatment.

The procedure allows impressive demonstration of the formation of arterial collaterals. The results of post mortem Araldit impletion agree with the functional results of experimental coronary occlusion. Boor and Reynolds (1977) Cellular calcium flux is regulated by receptor-operated and voltage-dependent channels, which are sensitive to inhibition by calcium entry blockers. The term calcium antagonist was introduced by Fleckenstein (1964 Fleckenstein ( , 1967 when two drugs, prenylamine and verapamil, originally found as coronary dilators in the LANGEN-DORFF-experiment, were shown to mimic the cardiac effects of simple Ca 2+ -withdrawal, diminishing Ca 2+dependent high energy phosphate utilization, contractile force, and oxygen requirement of the beating heart without impairing the Na + -dependent action potential parameters. These effects were clearly distinguishable from β-receptor blockade and could promptly be neutralized by elevated Ca 2+ , β-adrenergic catecholamines, or cardiac glycosides, measures that restore the Ca 2+ supply to the contractile system. In the following years many Ca 2+ -antagonists were introduced to therapy. Specific Ca 2+ -antagonists interfere with the uptake of Ca 2+ into the myocardium and prevent myocardial necrotization arising from deleterious intracellular Ca 2+ overload. They act basically as spe-cific inhibitors of the slow transsarcolemnal Ca 2+ influx but do not or only slightly affect the fast Na + current that initiates normal myocardial excitation. Calcium channels and the sites of action of drugs modifying channel function have been classified (Bean 1989; Porzig 1990; Tsien and Tsien 1990; Spedding and Paoletti 1992) .

Nomenclature and structure-function relationships of voltage-gated calcium channels were reviewed by Catterall et al. (2005) . Kochegarow (2003) reviewed the therapeutic application of modulators of voltage-gated calcium channels.

Four main types of voltage dependent calcium channels are described:

1. L type (for long lasting), 2. T type (for transient), 3. N type (for neuronal), and 4. P type (for Purkinje cells).

They differ not only by their function (Dolphin 1991) and localization in tissues and cells but also by their sensitivity to pharmacological agents (Ferrante and Triggle 1990; Dascal 1990; Kitamura et al. 1997 ) and by their specificity to radioligands.

The widely distributed L-type channels exist in isoforms (L1, 2, 3, 4) and consist of several subunits, known as α 1 , α 2 , β, γ , δ. They are sensitive to dihydropyridines, phenylalkylamines or benzothiazepines, but insensitive to ω-conotoxin and ωagatoxin. The segments required for antagonist binding have been analyzed (Peterson et al. (1996 , Schuster et al. 1996 Mitterdorfer et al. 1996; Hockerman et al. 1997; Striessnig et al. 1998; Catterall 1998) . Berjukow et al. (2000) discussed the molecular mechanism of calcium channel block by israpidine. Striessnig et al. (2004) described the role of L-type Ca 2+ channels in Ca 2+ channelopathies.

The T-type channels are located mainly in the cardiac sinoatrial node and have different electrophysiological characteristics from L-type channels (Massie 1997; Perez-Reyes et al. 1998 ).

Reviews of molecular physiology of low-voltageactivated T-type calcium channels were given by Perez-Reyes (2003 , 2006 . N-and P-type calcium channels blockers occur in neuronal cells and are involved in neurotransmitter release (Olivera et al. 1987; Bertolino and Llinás 1992; Mintz et al. 1992; Woppmann et al. 1994; Diversé-Pierluissi et al. 1995; Miljanich and Ramachandran 1995; Fisher and Bourque 1996; Ikeda 1996; Ertel et al. 1997; Sinnegger et al. 1997) .

Radiolabeled dihydropyridine calcium channel antagonists such as 3 H-nitrendipine (Salter and Grover 1987; Campiani et al. 1996) are selective ligands for a drug receptor site associated with the voltage-dependent calcium channel. A constant concentration of the radioligand 3 H-nitrendipine (0.3-0.4 nM) is incubated with increasing concentrations of a non-labeled test drug (0.1 nM-1 mM) in the presence of plasma membranes from bovine cerebral cortices. If the test drug exhibits any affinity to calcium channels, it is able to compete with the radioligand for channel binding sites. Thus, the lower the concentration range of the test drug, in which the competition reaction occurs, the more potent is the test drug. Two freshly slaughtered bovine brains are obtained from the slaughterhouse and placed in ice-cold preparation buffer. In the laboratory, approx. 5 g wet weight of the two frontal cerebral cortices are separated from the brains.

The tissue is homogenized (glass Teflon potter) in ice-cold preparation buffer, corresponding to 1 g cerebral wet weight/50 ml buffer, and centrifuged at 48,000 g (4°C) for 10 min. The resulting pellets are resuspended in approx. 270 ml preparation buffer, and the homogenate is centrifuged as before. The final pellets are dissolved in preparation buffer, corresponding to 1 g cerebral cortex wet weight/30 ml buffer. The membrane suspension is immediately stored in aliquots of 5-10 ml at -77°C. Protein content of the membrane suspension is determined according to the method of Lowry et al. (1951) with bovine serum albumin as a standard.

At the day of the experiment, the required volume of the membrane suspension is slowly thawed and centrifuged at 48,000 g (4°C) for 10 min. The resulting pellets are resuspended in a volume of ice-cold incubation buffer, yielding a membrane suspension with a protein content of 0.6-0.8 mg/ml. After homogenization (glass Teflon potter), the membrane suspension is stirred under cooling for 20-30 min until the start of the experiment.

As 1,4-dihydropyridines tend to bind to plastic material, all dilution steps are done in glass tubes.

For each concentration samples are prepared in triplicate. The total volume of each incubation sample is 200 µl (microtiter plates). The binding reaction is started by adding 100 µl membrane suspension per incubation sample (0.6-0.8 mg protein/ml). The samples are incubated for 60 min in a bath shaker at 25°C. The reaction is stopped by subjecting the total incubation volume to rapid vacuum filtration over glass fibre filters. Thereby the membrane-bound is separated from the free radioactivity. Filters are washed immediately with approx. 20 ml ice-cold rinse buffer per sample. The retained membrane-bound radioactivity on the filter is measured after addition of 2 ml liquid scintillation cocktail per sample in a Packard liquid scintillation counter.

The following parameters are calculated:

• total binding • non-specific binding • specific binding = total binding -non-specific binding

The dissociation constant (K i ) of the test drug is determined from the competition experiment of 3 Hnitrendipine versus non-labeled drug by a computersupported analysis of the binding data. The K i -value of the test drug is the concentration, at which 50% of the receptors are occupied by the test drug.

The affinity constant K i [mol/l] is recorded and serves as a parameter to assess the efficacy of the test drug.

Standard data:

• nifedipine K i = 2-4 × 10 −9 mol/l

[ 3 H](+)-PN200-100 (israpidine) has been used by many authors as the labeled ligand for binding experiments (Grassegger et al. 1989; Nokin et al. 1990; Striessnig et al. 1991; Yaney et al. 1991; Miwa et al. 1992; Ichida et al. 1993; Kalasz et al. 1993; Ikeda et al. 1994; Rutledge and Triggle 1995; Shimasue et al. 1996; He et al. 1997; Natale et al. 1999; Matthes et al. 2000; Peri et al. 2000) . Yaney et al. (1991) performed binding experiments with [ 3 H](+)-PN200-110 to membranes of RINm5F cells.

The RINm5F pancreatic β-cells were grown on plastic culture flasks in medium RPMI 1640 supplemented with 10% fetal bovine serum, 100 µg/ml of streptomycin and 100 U/ml penicillin. The cells were kept in humidified incubators at 37°C in 5% CO 2 -95% air. Maintenance flasks were subcultured every 4-5 days at ∼80% confluency. For binding experiments of [ 3 H](+)-PN200-110 to membranes, cells were removed from the flasks by incubation for 15-20 min in 10 mM MOPS [3-(N-morpholino) propanesulfonic acid] and 1 mM EGTA (pH 7.4) at 4°C. The osmotically ruptured cells were homogenized with a Brinkmann Polytron followed by centrifugation at 20,000 g for 15 min. The pellet was resuspended and washed twice. The final pellet was resuspended in 1 mM CaCl 2 and 20 mM MOPS (pH 7.4) at a protein concentration of 0.2-0.4 mg/ml. Membranes were incubated at room temperature with (+)-[ 3 H]PN200-110 in a final volume of 500 µl (Weiland and Oswald 1985) . Bound and free radioligand were separated by vacuum filtration through a glass fiber filter (no. 32, Schleicher and Schüll) followed by three washes of the filter with 3 ml incubation buffer. Non-specific binding was determined in the presence of 1 µM nitrendipine. Radioactivity retained by the filters was determined by liquid scintillation counting. The concentration of free radioligand was calculated by scintillation counting of aliquots of incubation mixtures under nonspecific conditions before and after centrifugation.

Several other calcium entry blockers, such as nimodipine, diltiazem, verapamil and desmethoxyverapamil, have been labeled and used for binding studies in order to elucidate the calcium channel recognition sites and may be used for further classification of calcium antagonists (Ferry and Glossmann 1982; Glossmann et al. 1983; Goll et al. 1984; Lee et al. 1984; Glossmann et al. 1985; Schoemaker and Langer 1985; Ruth et al. 1985; Reynolds et al. 1986 ). Vaghy et al. (1987) identified of a 1,4-dihydropyridine-and phenylalkylamine-binding polypeptide in calcium channel preparations. Naito et al. (1989) described photoaffinity labeling of the purified skeletal muscle calcium antagonist receptor by [ 3 H]azidobutyryl diltiazem. Watanabe et al. (1993) reported that azidobutyryl clentiazem labels the benzothiazepine binding sites in the α 1 subunit of the skeletal muscle calcium channel. Tissue heterogeneity of calcium channel antagonist binding sites has been demonstrated by Gould et al. (1983) .

Photoaffinity labeling of the cardiac calcium channel with 1,4-dihydropyridine(-)-[3H]azidopine was described by . Knaus et al. (1992) described a unique fluorescent phenylalkylamine probe for L-type Ca 2+ channels.

Binding sites for ω-conotoxin appear to be primarily associated with the N-type of voltage-dependent calcium channels (Feigenbaum et al. 1988; Wagner et al. 1988) . Cohen et al. (1992) recommended the peptide ωagatoxin IIIA as a valuable pharmacological tool being the only known ligand that blocks L-type calcium channels with high affinity at all voltages and causes, unlike the 1,4-dihydropyridines, no block of T-type calcium channels.

Intracellular action potential in the guinea pig papillary muscle is recorded. Partial depolarization is achieved by potassium enriched Ringer solution and by addition of isoproterenol. Resting potential is increased to 40 mV resulting in inactivation of the fast sodium channel. Under these conditions, upstroke velocity is an indicator for calcium flux through the membrane, which is decreased by calcium blockers.

Guinea pigs of either sex (Pirbright White strain) weighing 300-400 g are sacrificed by stunning, the carotid arteries are severed, and the thoracic cage is opened immediately. The heart is removed, placed in a container of prewarmed, pre-oxygenated Ringer solution, and the pericardium and the atria are trimmed away. The left ventricle is opened and the two strongest papillary muscles removed. They are fixed between a suction electrode for electrical stimulation and a force transducer for registration of contractions. Initially, normal Ringer solution oxygenated with carbogen (95% O 2 /5% CO 2 ) at a temperature of 36°C is used. A standard micro electrode technique is applied to measure the action potential via a glass micro electrode containing 3 M KCl solution, which is inserted intracellularly. The papillary muscle is stimulated with rectangular pulses of 1 V and of 1 ms duration at intervals of 500 ms. The interval between two stimuli is variable in order to determine refractory periods. The intensity of the electrical current is just below the stimulation threshold. The intracellular action potential is amplified, differentiated for registration of upstroke velocity (Hugo Sachs micro electrode amplifier), together with the contraction force displayed on an oscilloscope (Gould digital storage oscilloscope OS 4000), and recorded (Gould 2400 recorder) .

After an incubation period of 30 min the Ringer solution is changed to the following composition containing 5 times more potassium and 10% less sodium.

• NaCl 8,1 g/L • KCl 1,0 g/L • CaCl 2 0,2 g/L • NaHCO 3 0,1 g/L • glucose 5,0 g/L For further depolarization, isoproterenol (1.0 mg per 100 ml) is added. By this measure, resting potential is increased to about 40 mV, resulting in inactivation of the fast inward sodium channel. The resulting slow rising action potential is sensitive to calcium antagonistic drugs (Kohlhardt and Fleckenstein 1977) .

The test compound is added at a concentration of 1 µg/ml. Effective compounds are tested at lower concentrations and compared with the standard (nifedipin at concentrations of 0.01 and 0.1 µg/ml)

The decrease of upstroke velocity is tested at various concentrations of the test compound and compared with the standard. k-Strophanthine (and other cardiac glycosides) inhibit the membrane-bound Na + /K + -activated ATP-ase which leads to an increase in intracellular Ca 2+concentration. Ca 2+ ions activate the contractile apparatus, causing a distinctive enhancement of contractions. The procedure can be used to evaluate a compound's calcium channel blocking activity by measuring its ability to decrease atrial contractions induced by k-strophanthine.

HSE-stimulator 1 (Hugo Sachs Elektronik, D-79232 March-Hugstetten, Germany) Stimulation data:

• frequency 1.5 Hz • duration 3 ms • voltage 3-8 V

Guinea pigs of either sex weighing 200-500 g are sacrificed with a blow to the nape of the neck and exsanguinated. The left atrium is removed, placed in an organ bath and attached to an isotonic strain gauge, its base being wired to an electrode of the stimulator. The Ringer-solution is aerated with carbogen and kept at 36°C. The atrium is continuously stimulated via stimulator 1, the voltage being slowly increased up to the threshold level. Contractions are recorded on a polygraph. Prior to drug administration, two prevalues are obtained by adding 2 µg/ml k-strophanthine-α (Cymarin) to the organ bath and measuring the increase in contractile force. Following a 15 min washout and recovery period, the test drug is added to the bath followed by administration of k-strophanthine-α 10 min later. The change in contractile force is always measured 10 min after the addition of k-strophanthine-α. Standard compounds:

• Verapamil hydrochloride • Nifedipine

The percent inhibition of k-strophanthine-α induced contraction is determined.

Calcium antagonists can also be evaluated in the LAN-GENDORFF heart preparation . Leboeuf et al. (1992) reported the protective effect of bepridil and flunarizine against veratrine-induced contracture in rat atria concluding from the results in this model that these agents may be more effective as L-type calcium ion-channel blockers in protecting against calcium overload during ischaemia and reperfusion injury.

Contraction of aorta rings is induced by adding potassium chloride or norepinephrine to the organ bath containing slightly modified Krebs bicarbonate buffer. Test drugs with calcium channel blocking activity have a relaxing effect.

Rabbits of either sex weighing 3-4 kg are sacrificed with an overdose of pentobarbital sodium. The chest cavity is opened and the descending thoracic aorta (from the level of the aortic arch to the level of the diaphragm) is rapidly removed and placed in a beaker of oxygenated Krebs bicarbonate buffer at 37°C.

The content of magnesium and calcium is slightly diminished in the Krebs bicarbonate buffer resulting in the following composition: The tissue is then transferred to a dish containing fresh oxygenated, warmed Krebs solution. Fat and loose connective tissue are carefully removed while keeping the tissue moist with the solution. Eight rings of 4-5 mm width are obtained and each is mounted in a 20 ml tissue bath which contains the oxygenated warmed Krebs solution. Initial tension is set at 1.0 g. The tissue is allowed to incubate over a period of 2 h, during which time the Krebs solution is changed every 15 min. Also during this time, tension is maintained at 1.0 g. Just prior to the end of the 2 h equilibration period, the Krebs solution is changed again and the tissue is allowed to stabilize at 1.0 g tension. A sustained contraction is then generated by addition of either 40 mM KCl or 2.9 × 10 -3 mM norepinephrine.

Twenty min after addition of the agonist, the test drug is added so that the final concentration in the bath is 1 × 10 −5 M. The percent relaxation reading is taken 30 min after addition of the test drug. If at least 30% relaxation occurs, an accumulative concentration-relaxation curve is established. There is a 30 min period of time between the addition of each concentration of test compound.

Active tension is calculated for the tissue at the time point just prior to the addition of the test compound and also at the point 30 min after the addition of each concentration of test compound. Active tension is defined as the difference between the generated tension and the baseline tension. The percent relaxation from the predrug, precontracted level is calculated for each concentration of test compound. A number of 5 experiments constitutes a dose range. An ID 50 is calculated by linear regression analysis. Hof and Vuorela (1983) compared three methods for assessing calcium antagonism on rabbit aorta smooth muscle. Matsuo et al. (1989) reported a simple and specific screening method for Ca-entry blockers. In the presence of various Ca-channel blockers, 1 × 10 −4 M Ca 2+ causes relaxation of rat uterine smooth muscle that has been tonically contracted with oxytocin in calciumfree medium after prolonged preincubation with 3 mM EGTA. Micheli et al. (1990) used spirally cut preparations of rat aorta and rings of rabbit ear artery to test calcium entry blocker activity. Rüegg et al. (1985) described a smooth muscle cell line originating from fetal rat aorta to be suitable for the study of voltage sensitive calcium channels. Calcium channel antagonists inhibited both the basal and the potassium chloride stimulated 45 Ca 2+ uptake. Hof RP, Vuorela HJ (1983) Guinea pigs (Pirbright White strain) of either sex weighing 400-500 g are sacrificed by stunning. The pulmonary artery is removed and cut spirally at an angle of 45°. The resulting strip is cut to lengths of 2 cm and one piece is suspended in oxygenated normal Tyrode solution in an organ bath at 37°C with a preload of 1 g. Contractions are registered with an isotonic strain transducer and recorded on a polygraph.

After 1 h equilibrium time, normal solution is exchanged with potassium enriched Tyrode solution. The artery strip reacts with a contraction which achieves after 10 min 90-95% of its maximum. After an additional 10 min, exchange to normal Tyrode solution is performed. Ten min later again a contraction is induced by potassium enriched solution. When the height of the contraction has reached a constant level, the test substance is added and again potassium induced contraction recorded. The height of the contraction is expressed as percent of initial potassium induced contraction.

After lavage, the procedure is repeated with a higher dose or the standard.

For calculation of a regression line, the decrease of contraction versus control after various doses is measured in mm. The percentage of inhibition after various doses is taken for calculation of an ED 50 .

Using the cardioaccelerator response in pithed rats, calcium entry blockers can be distinguished from other agents which have modes of action not involving direct blockade of calcium entry (Clapham 1988 ).

Male Sprague-Dawley rats (250-350 g) are anaesthetized with methohexitone sodium (50 mg/kg i.p.). Following cannulation of the trachea, the rats are pithed through one orbit with a stainless steel rod and immediately artificially respired with room air (78 strokes/min, 1 ml/100 g body weight) via a Palmer small animal respiration pump. A jugular vein is cannulated for administration of drugs. Arterial blood pressure is recorded from a carotid artery using a pressure transducer. Heart rate is derived from the phasic arterial pressure signal with a phase lock loop ratemeter (BRL Instrument Services). Both parameters are displayed on a recorder. The animals are kept warm by an incandescent lamp positioned about 25 cm above them. The pithing rod is withdrawn so that the tip lays in the thoracic portion of the spinal cord. All rats then receive (+)tubocurarine (1.5 mg/kg i.v.) and are bilaterally vagotomized.

The cardioaccelerator response is obtained by continuous electrical stimulation of the thoracic spinal cord with square wave pulses of 0.5 ms duration, at supramaximal voltage at a frequency of 0.5 Hz using the pithing rod as a stimulating electrode. An indifferent electrode is inserted subcutaneously in the femoral region. Only rats with a resulting tachycardia of more than 100 beats/min are included into the experiments.

When the cardioaccelerator response has stabilized for about 3-5 min, cumulative intravenous doses of drug or corresponding vehicle are administered. Succeeding doses are given when the response to the previous dose has stabilized.

Calcium antagonists and β-blockers inhibit dosedependent the tachycardia elicited by electrical stimulation of the spinal cord, whereas lignocaine and nicorandil are not effective.

Doses of β-blockers or calcium-antagonists, which reduce the tachycardia to 50% are tested again. Three min after administration of the drug, calcium gluconate (1 mg/min) or water (0.1 ml/min) are infused using a Harvard apparatus compact infusion pump. The effects of calcium entry blockers, but not of βadrenoreceptor blockers, are antagonized.

The level of tachycardia immediately prior to drug administration is taken as 100% and responses to drugs are expressed as a percentage of this predose tachycardia. If an inhibitory effect > 50% is seen, then an ID 50 (with 95% confidence limits) is interpolated from linear regression analysis. Significance of differences between the groups receiving calcium gluconate and their parallel vehicle controls is calculated by Student's ttest.

Differentiation between the effects of β-blockers and calcium-antagonists can be achieved in a relatively simple in vivo model.

Guidelines for the study of arrhythmias in man and animals regarding the experimental design as well as the classification, quantification, and analysis were given as the Lambeth Conventions by Walker et al. (1988) .

Anti-arrhythmic drugs have been classified into various groups and subgroups , 1975 Borchard et al. 1989; Frumin et al. 1989; Colatsky and Follmer 1990; Podrid 1990; Coromilas 1991; Nattel 1991; Rosen and Schwartz 1991; Scholz 1991; Woosley 1991; Ravens 1992; Sanguinetti 1992; Grant 1992; Nattel 1993; Scholz 1994) . This classification is based on electrophysiological effects (e. g., action potential) and on interaction with membrane receptors and ion channels. The heterogeneity of classification criteria resulted in vivid discussions (The Sicilian Gambit 1991; Vaughan Williams 1991 . In particular, a clinical study (CAST investigators 1990) challenged the therapeutic value of some anti-arrhythmic drugs.

Weirich and Antoni (1990 Antoni ( , 1991 proposed a subdivision of class-1-anti-arrhythmic drugs according to the saturation behavior of frequency-dependent block and its onset-kinetics.

Class I anti-arrhythmic drugs directly alter membrane conductance of cations, particularly those of Na + and K + . They reduce upstroke velocity, V max , of the cardiac action potential by blockade of the fast Na + channel. This leads to a depression of conduction velocity, a prolongation of the voltage-and time-dependent refractory period and an increase in the threshold of excitability in cardiac muscle. Class I anti-arrhythmic drugs are subclassified according their effect on the action potential duration.

Class I A anti-arrhythmic drugs (Quinidine-like substances, e. g., disopyramide, procainamide, ajmaline) lengthen the action potential duration which is reflected in the ECG as lengthening of the QT-interval. This effect is added to that on fast sodium channel resulting in delayed recovery from inactivation. (lidoacaine-like drugs, e. g., mexiletine, phenytoin, tocainide) , in contrast, shorten the action potential duration.

Class I C anti-arrhythmic drugs (e. g., encainide, flecainide, propafenone, indecainide) produce quinidine-and lidocaine-like effects and exert differential actions on the duration of action potential in Purkinje fibres (shortening) and ventricular muscle.

Class II anti-arrhythmic drugs are β-adrenergic antagonists. They exert their anti-arrhythmic effects by antagonizing the electrophysiological effects of catecholamines which are mainly mediated by an increase in slow calcium inward current.

Class III anti-arrhythmic drugs (e. g., amiodarone, bretylium, sotalol) prolong the action potential and lead to a corresponding increase in the effective refractory period. The action is mainly due to a block of outward repolarizing currents. However, activation of sodium and calcium inward currents that prolong the plateau of the action potential may also be involved.

Class IV anti-arrhythmic drugs (e. g., verapamil, diltiazem) are slow calcium channel blockers suppressing the slow calcium inward current and calciumdependent slow action potentials. Winslow (1984) reviewed the methods for the detection and assessment of antiarrhythmic activity. Szekeres (1979) suggested a rational screening program for the selection of effective antiarrhythmic drugs.

Arrhythmia models in the rat were reviewed by Cheung et al. (1993) .

Arrhythmogenic stimuli can be divided into three groups: chemical, electrical and mechanical (Szekeres and Papp 1975; Wilson 1984) .

A large number of chemical agents alone or in combination are capable of inducing arrhythmias. Administration of anesthetics like chloroform, ether, halothane (sensitizing agents) followed by a precipitating stimulus, such as intravenous adrenaline, or cardiac glycosides (usually ouabain), aconitine, and veratrum alkaloids cause arrhythmias. The sensitivity to these arrhythmogenic substances differs among various species.

The possibilities to produce arrhythmias by electrical stimulation of the heart and the difficulties for evaluation of anti-arrhythmic drugs by this approach have been discussed by Szekeres (1971) . Serial electrical stimulation result in flutter and fibrillation and it is possible to reproduce some of the main types of arrhythmias of clinical importance. The flutter threshold or the ventricular multiple response threshold may be determined in anesthetized dogs before or after the administration of the test drug.

Arrhythmias can be induced directly by ischemia or by reperfusion. After ischemia either by infarction or by coronary ligation several phases of arrhythmias are found. The two stage coronary artery ligation technique described by Harris (1950) focuses on late arrhythmias. Curtis and Walker (1988) examined seven scores in an attempt to validate the use of arrhythmia scores in an in vivo model of conscious rats.

The influence on reperfusion arrhythmias can be tested in various species, e g., rat, pig, dog and cat (Bergey et al. 1982; Winslow 1984; Curtis et al. 1987; 

Recording of the electrocardiogram is an essential tool in the evaluation of anti-arrhythmic drugs (Johnston et al. 1983; Curtis and Walker 1986; Adaikan et al. 1992) . Similar to the heart rate, the electrocardiogram is different between various species (Bazett 1920; Kisch 1953; Heise and Kimbel 1955; Beinfield and Lehr 1968; Budden et al. 1981; Driscoll 1981; Osborn 1981; Hayes et al. 1994) . Many authors used the bipolar lead II between right foreleg and left hindleg, which is in line with the neutrally placed heart. Additionally, lead I (between right and left foreleg) stated to lie in the axis of the horizontal heart, and lead III (between left foreleg and left hindleg) in line with the vertical heart, may be used as well as unipolar leads (usually designed as V 1 to V 6 ) and the unipolar leads designed as aVL, aVR, and aVF. Out of several species being used the procedure for rats (Penz et al. 1992; Hayes et al. 1994 ) is described.

Male Sprague Dawley rats weighing 250-300 g are anesthetized by intraperitoneal injection of 60 mg/kg pentobarbitone. The right jugular vein is cannulated for injections, while the left coronary artery is cannulated for recording blood pressure on a polygraph. The ECG is recorded using a Lead type II of configuration along the anatomical axis of the heart as determined by palpation. ECGs are recorded at a standard chart speed of 100 mm/s on a polygraph and simultaneously on a storage oscilloscope. Measurements of intervals are made on the chart recorder and from the memory trace of the monitor.

Since in the rat it is difficult to detect a T-wave that corresponds exactly with the T-wave seen in other species (Beinfeld and Lehr 1968; Driscoll 1981; Surawicz 1987 ) T-wave calculations are made on the basis of the repolarization wave that follows the QRS complex. The following variables are measured: σ T = time for the depolarization wave to cross the atria, P-R interval, QRS interval, Q-T interval, and RSh (the height between the peak of R and S wave). The RSh magnitude is taken as a measure of the extent of Swave depression as exerted by class I sodium channel blocking antiarrhythmics.

Statistical analyses are based on ANOVA followed by Duncan's test for differences of means. In order to demonstrate the relationships between and drug effects, standard cumulative dose-response curves are constructed. Osborne (1973 Osborne ( , 1981 described a restraining device facilitating electrocardiogram recording in conscious rats. Curtis and Walker (1986) , Johnston et al. (1983) studied the responses to ligation of a coronary artery and the actions of antiarrhythmics in conscious rats. Hayes et al. (1994) studied the ECG in guinea pigs, rabbits and primates. Stark et al. (1989) described an epicardic surface and stimulation technique (SST-ECG) in Langendorff perfused guinea pig hearts.

Epicardial His bundle recordings in the guinea pig in vivo were described by Todt and Raberger (1992) .

Chronic recording from the His bundle in awake nonsedated dogs was reported by Karpawich et al. (1983) and by Atlee et al. (1984) . Van de Water et al. (1989) reported a formula to correct the QT interval of the electrocardiogram in dogs for changes in heart rate. described a dual electrophysiologic test for atrial anti-reentry and ventricular antifibrillatory studies in anesthetized dogs. The reentry portion of the model was created surgically by a Y-shaped crushing around the tissue between the superior and inferior vena cava and tissue parallel to the AV groove. The pacing induced tachycardia that results from circus movements around the tricuspid ring was very persistent in duration and regular in cycle length. The antifibrillatory activities were assessed by determination of the ventricular fibrillation threshold using a trainstimuli method. Weissenburger et al. (1991) developed an experimental model of the long QT syndrome in conscious dogs for screening the bradycardia-dependent proarrhythmic effects of drugs and for studying the electrophysiology of "torsades de pointes." Bauer et al. (2004) described pro-and antiarrhythmic effects of fast cardiac pacing in a canine model of acquired long QT syndrome.

Holter monitoring in conscious dogs was described by Krumpl et al. (1989a, b) . Coker (1989) recommended the anesthetized rabbit as a model for ischemia-and reperfusion-induced arrhythmias.

Baboons and monkeys (Macaca sp.) were used by Adaikan et al. (1992) .

The plant alkaloid aconitine persistently activates sodium channels. Infusion of aconitine in the anesthetized rat causes ventricular arrhythmias. Drugs considered to have anti-arrhythmic properties can be tested in aconitine-intoxicated rats.

Male Ivanovas rats weighing 300-400 g are used. The animals are anesthetized by intraperitoneal injection of 1.25 g/kg urethane. Five µg/kg aconitine dissolved in 0.1 N HNO 3 is administered by continuous infusion into the saphenous vein of 0.1 ml/min and the ECG in lead II is recorded every 30 seconds. The test compound is injected orally or intravenously at a screening dose of 3 mg/kg 5 min before the start of the aconitine infusion. Eight-ten animals are used per compound.

The anti-arrhythmic effect of a test compound is measured by the amount of aconitine/100 g animal (duration of infusion) which induces • ventricular extrasystoles • ventricular tachycardia • ventricular fibrillation • and death.

Higher doses of aconitine in the treated group as compared to an untreated control group are an indication of anti-arrhythmic activity.

Statistical significance between the groups is assessed by the Student's t-test.

The scores are allotted for the intensity and the duration of the effect relative to the efficacy of standard compounds.

Standard data:

• Procainamid, 5 mg/kg i.v. and lidocaine, 5 mg/kg, i.v. lead to an increase in LD 100 by 65% (corresponds to LD 100 of approximately 9 µg/100 g).

Aconitine -antagonism in vivo has been proven as a valuable screening method for anti-arrhythmic activity. Scherf (1947) studied the auricular tachycardia caused by aconitine administration in dogs. Scherf et al. (1960) provoked atrial flutter and fibrillation in anesthetized dogs by application of a few crystals of aconitine or delphinine to the surface of the right atrium in the appendix area near the head of the sinus node.

Mc Leod and Reynold (1962) induced arrhythmia by aconitine in the isolated rabbit atrium. Nwangwu et al. (1977) used aconitine as arrhythmogenic agent for screening of anti-arrhythmic agents in mice. Yamamoto et al. (1993) used urethane-anesthetized rats under artificial respiration with tubocurarine pretreatment. After thoracotomy and incision of the pericardium, a piece of filter paper soaked with aconitine solution was applied to the right atrium. Test drugs were applied by continuous i.v. infusion. In addition to ECG lead II, intra-atrial ECG was monitored.

Aconitine-antagonism in conscious mice as screening procedure has been recommended by Dadkar and Bhattacharya (1974) and in anesthetized mice by Winslow (1980) . Nakayama et al. (1971) described the topical application of aconitine in a small cup placed on the right atrium of dogs to induce supraventricular arrhythmias.

A method using the cat has been developed by Winslow (1981) .

In addition to the aconitine model Vaille et al. (1992) demonstrated the selectivity of a CaCl 2 continuous infusion screening method in rats for the evaluation of antiarrhythmic calcium antagonists. A mouse chloroform model was recommended by Lawson (1968) . Vargaftig et al. (1969) induced ventricular fibrillation in mice by inhalation of chloroform. Papp et al. (1967) proposed the experimental BaCl 2 -arrhythmia as a quantitative assay of anti-arrhythmic drugs. used calcium chloride-induced arrhythmias for anti-arrhythmic activity evaluation in anesthetized male rats. Cardiac arrhythmias were induced by a single intravenous injection of 10% CaCl 2 (50 mg/kg). The induced arrhythmias were then analyzed for magnitude of initial bradycardia, onset, incidence and duration of the induced fibrillations. After the induction of the arrhythmia, the animal was allowed to recover completely (15-20 min) and the test compound was injected in different doses intravenously. The effect of the test compound on the basal heart rate was then examined and the percentage change in the heart rate was calculated. Seven min later, the arrhythmogenic dose of CaCl 2 was readministered and the effect of the treatment on the induced arrhythmia parameters was evaluated as percentage change in the measured parameters or as protection or non-protections against the induced fibrillations.

Tripathi and Thomas (1986) described a method for the production of ventricular tachycardia in the rat and guinea pig by exposing the animals to benzene vapors for 2 min followed by an intravenous adrenaline injection.

Arrhythmias could be induced by changing the medium of cultured rat heart muscle cells (Wenzel and Kloeppel 1978) .

In isolated rat hearts ventricular fibrillation was induced by isoprenaline and a catechol-O-methyl transferase inhibitor at high perfusion temperature (Sono et al. 1985) . Takei (1994) described experimental arrhythmia in guinea pigs induced by grayanotoxin-I, a biologically active diterpenoid from the plant family of Ericaceae.

Overdose of cardiac glycosides, such as digoxin, induces ventricular extrasystoles, ventricular fibrillation, and finally death. The occurrence of these symptoms can be delayed by anti-arrhythmic drugs.

Male guinea pigs (Marioth strain) weighing 350-500 g are anesthetized with 35 mg/kg pentobarbital sodium intraperitoneally. Trachea, one jugular vein and one carotid artery are catheterized. Positive pressure ventilation is applied with a respiratory pump (Rhema GmbH, Germany) at 45 breaths/min. The carotid artery is used for monitoring systemic blood pressure via a pressure transducer. Digoxin is infused into the jugular vein with a perfusion pump (ASID BONZ PP 50) at a rate of 85 µg/kg in 0.266 ml/min until cardiac arrest. The electrocardiogram (lead III) is recorded with subcutaneous steel-needle electrodes (Hellige 19).

Treated groups (n = 5-10 animals) receive the test drug either orally 1 h or intravenously 1 min prior to the infusion. The control group (n = at least 5 animals) receives the digoxin infusion only. The period until the onset of ventricular extrasystoles, ventricular fibrillation, and cardiac arrest is recorded. The total amount of infused digoxin (µg/kg) to induce ventricular fibrillation is calculated. Standard drugs are lidocaine (3 mg/kg i.v.) or ramipril (1 mg/kg p.o.).

Using Student's t-test the doses of digoxin needed to induce ventricular extrasystoles, or ventricular fibrillation, or cardiac arrest, respectively, after treatment with anti-arrhythmic drugs are compared statistically with controls receiving digoxin only. tebrachii) . For intraduodenal administration of the test drug, the duodenum is cannulated. Electrocardiogram is registered with needle electrodes from lead II. Heart frequency is derived from R-peaks of ECG. Two-three animals are used for one compound. Strophanthin K is administered by continuous i.v.infusion at a rate of 3 µg/kg/min. Thirty-fourty min later, signs of cardiac glycoside intoxication appear leading to ventricular tachycardia or to multifocal ventricular arrhythmias. When this state is achieved, the strophanthin infusion is terminated. When the arrhythmias are stable for 10 min, the test substance is administered intravenously in doses between 1.0 and 5.0 mg/kg or intraduodenally in doses between 10 and 30 mg/kg. ECG II recordings are obtained at times: -0.5, 1, 2, 5 and 10 min following administration of test drug.

For i.v. administration: A test compound is considered to have an anti-arrhythmic effect if the extrasystoles immediately disappear. If the test compound does not show a positive effect, increasing doses are administered at 15 min-intervals. If the test substance does reverse arrhythmias, the next dose is administered after the reappearance of stable arrhythmias.

For i.d. administration: A test compound is considered to have a definite anti-arrhythmic effect if the extrasystoles disappear within 15 min. The test drug is considered to have "no effect" if it does not improve strophanthin intoxication within 60 min following drug administration.

Evaluation of the therapeutic effect of a drug is difficult and somewhat arbitrary since there is no clear-cut correlation between effectiveness of a test compound and duration of its effect, i. e. return to normal ECGs. The standard drugs ajmaline, quinidine and lidocaine re-establish normal sinus rhythm at doses of 1 and 3 mg/kg (i.v.) and 10 mg/kg (i.d.) . Arrhythmias are eliminated for 20 min (i.v.) and for > 60 min (i.d.) following drug administration. Ettinger et al. (1969) used arrhythmias in dogs induced by ouabain to study the effects of phentolamine in arrhythmia. Garrett et al. (1964) studied the antiarrhythmic activity of N,N-diisopropyl-N'-diethylaminoethylurea hydrochloride in anesthetized dogs with arrhythmias induced by ouabain, aconitine or acetylcholine. Furthermore, ultra-low frequency ballistocardiograms with ECG registration were performed in dogs. Raper and Wale (1968) studied the effects on ouabain-and adrenaline-induced arrhythmias in cats. Kerr et al. (1985) studied the effects of a vasodilator drug on ouabain-induced arrhythmias in anesthetized dogs.

A modified method for the production of cardiac arrhythmias by ouabain in anesthetized cats was published by Rao et al. (1988) . infused ouabain intravenously to guinea pigs and determined the onset of ventricular extrasystoles and of fibrillation. Thomas and Tripathi (1986) studied the effects of α-adrenoreceptor agonists and antagonists with different affinity for α 1 -and α 2 -receptors on ouabain-induced arrhythmias and cardiac arrest in guinea pigs. Krzeminski (1991) and Wascher et al. (1991) used of ouabain-induced arrhythmia in guinea pigs for the evaluation of potential antidysrhythmic agents. used ouabain-induced arrhythmias in anesthetized Wistar rats for evaluation of cyclopenteno[b]thiophene derivatives as antiarrhythmic agents.

The use of anti-arrhythmic drugs in the treatment of ventricular arrhythmias aims to prevent the development of ventricular fibrillation. Several electrical stimulation techniques have been used to measure ventricular fibrillation threshold such as single pulse stimulation, train of pulses stimulation, continuous 50-Hz stimulation and sequential pulse stimulation.

Adult dogs weighing 8-12 kg are anesthetized with sodium pentobarbital (35 mg/kg) and ventilated with air using a Harvard respiratory pump. Systolic arte-rial pressure is monitored and body temperature maintained by a thermal blanket. The chest is opened by a midline sternotomy and the heart suspended in a pericardial cradle. The sinus node is crushed and a 2.0 mm diameter Ag-AgCl stimulating electrode is embedded in a Teflon disc sutured to the anterior surface of the left ventricle. The heart is then driven by 3-ms square anodal constant current pulses for 400 ms of the basic cycle and is prematurely stimulated by one 3-ms test stimulus through the driving electrode. Electrical stimulation is programmed by a digital stimulator. A recording electrode is placed on the surface of each ventricle. A silver plate is implanted under the skin in the right femoral region as indifferent electrode. Lead II of the body surface electrocardiogram is monitored. To determine ventricular fibrillation threshold (VFT), a 0.2-to 1.8-second train of 50-Hz pulses is delivered 100 ms after every eighteenth basic driving stimulus. The current intensity is increased from the diastolic threshold in increments of 10 µA to 1.0 mA or until ventricular fibrillation occurs. The minimal current intensity of the pulse train required to induce sustained ventricular fibrillation is defined as the VFT. When ventricular fibrillation occurs, the heart is immediately defibrillated and allowed to recover to control conditions for 15 to 20 min. Anti-arrhythmic drugs are administered through the femoral vein.

Ventricular fibrillation threshold (VFT) is determined before and after administration of test drugs at given time intervals. The mean values of 10 experiments are compared using Student's t-test. Marshall et al. (1981) and Winslow (1984) suggested to determine VFT in the pentobarbitone anesthetized rat. Wu et al. (1989) recommended a conscious dog model for re-entrant atrial tachycardia. described a dual electrophysiologic test for atrial anti-re-entry and ventricular antifibrillatory studies in dogs. The re-entry portion of the model was created surgically by a Y-shaped crushing around the tissue between the superior and inferior vena cava and tissue parallel to the AV groove. The antifibrillatory activities were assessed by determination of the ventricular fibrillation threshold using a train-stimuli method.

A chronically prepared rat model of electrically induced arrhythmias was described by Walker and Beatch (1988) .

Coronary artery ligation in anesthetized rats results in arrhythmias and myocardial infarction. Following occlusion of the left main coronary artery, very marked ventricular dysrhythmias occur. Electrocardiogram is recorded during ligation and subsequent reperfusion. The amount of infarcted tissue is measured by means of p-nitro-blue tetrazolium chloride-staining in myocardial sections. The model is used to test drugs with potential anti-arrhythmic activities.

Groups of 8-10 male Sprague-Dawley rats weighing 350-400 g are used. The animals are anesthetized by intraperitoneal injection of 60 mg/kg pentobarbital sodium. The trachea is intubated to allow artificial ventilation (Starling pump). A catheter is placed in an external jugular vein for administration of test com-pounds. Peripheral blood pressure is recorded from the common carotid artery using a pressure transducer and a polygraph. The chest is opened by left thoracotomy at the forth intercostal space. After opening the pericard, the heart is exteriorized by gentle pressure on the chest walls and a thin silk thread (Ethicon 1.5 metric, 4-0) attached to an atraumatic needle is placed around the left coronary artery about 2-3 mm distal of the origin of the left coronary artery for later ligation. From that point on, the animal is ventilated with room air using a stroke volume of 1 ml/100 g body weight at a rate of 54 strokes/min. The heart is then placed back in the chest cavity. Any animal in which this procedure itself produces dysrhythmias or a sustained fall in mean arterial blood pressure to less than 70 mm Hg has to be discarded from the study.

After an equilibration time of approx. 45 min, the test substance or the vehicle (control) is administered by intravenous injection. Five min later, the ligature at the left coronary artery is closed either for 15 or 90 min (in case infarct-size is assessed) and subsequently reperfused for 30 min. For oral application, the test compounds are dissolved or suspended in the vehicle 30 min before occlusion. Peripheral blood pressure and ECG lead II are recorded continuously during the whole experiment. Rectal temperature is maintained at 38°C. The numbers of ventricular premature beats (VPB), ventricular tachycardia (VT) and ventricular fibrillation (VF) are counted in the occlusion and reperfusion periods and evaluated according to the guidelines of the Lambeth Convention ).

At the end of the reperfusion period, the animal is sacrificed with an overdose of pentobarbital sodium, the heart is dissected and cut into transversal sections (approx. 1 mm thick) from the apex to the base. The slices are stained with p-nitro-blue tetrazolium chloride solution (0.25 g/L p-nitro-blue tetrazolium chloride in Sörensen phosphate buffer, containing 100 mM D, L-maleate) in order to visualize the infarct tissue (blue/violet-stained healthy tissue, unstained necrotic tissue). The slices are photographed on color transparency film for the determination of infarct area. Left ventricle and infarct area are measured by planimetry from projections of all slices with the exclusion of the apex and the slice containing the ligature.

The following parameters are evaluated: The different characteristics are evaluated separately and compared with a positive control (5 mg/kg nicainoprol i.v.).

Changes of parameters in drug-treated animals are compared to vehicle control values.

Statistical significance is assessed by the Student's t-test. Linz et al. (1997) reported that in isolated rat hearts with ischemia-reperfusion injuries, perfusion with bradykinin reduces the duration and incidence of ventricular fibrillations, improves cardiodynamics, reduces release of cytosolic enzyme, end preserves energy-rich phosphate and glycogen stores. Mulder et al. (1998) studied the effects of chronic treatment with calcium antagonists in rats with chronic heart failure induced by coronary artery ligation.

The effect of antihypertensive agents on cardiac and vascular remodelling was discussed by Mallion et al. (1999) . Armstrong JM (1994) An in vitro method for evaluation of antiarrhythmic and antiischemic agents by using programmed electrical stimulation of rabbit heart. J Pharmacol Toxicol Meth 31:31-40 Bernier M, Hearse DJ, Manning AS (1986) Reperfusion-induced arrhythmias and oxygen-derived free radicals. Studies with "anti-free radical" interventions and a free radicalgenerating system in the isolated perfused rat heart. Circ Res 58:331-340 Black SC, Rodger IW (1996) Linz W, Göbel H, Petry P, Schölkens BA (1987) Effects of nicainoprol on reperfusion arrhythmia in the isolated working heart and on ischemia and reperfusion arrhythmia and myocardial infarct size in the anesthetized rat. Eur J Pharmacol 143:391-401 Mulder P, Richard V, Thuillez C (1998) 

Coronary artery occlusion in anesthetized dogs is accompanied by an increase in heart rate, heart contractility, left ventricular end-diastolic pressure, and blood pressure as well as by ventricular arrhythmias. During a subsequent reperfusion period, a high percentage of control animals die from ventricular fibrillation. Drugs with potential protective effects are tested which reduce both hemodynamic and electrical changes.

Dogs of either sex weighing 20-25 kg are used. Anesthesia is induced by intravenous injection of 30 mg/kg thiobutobarbital sodium and maintained by i.v. administration of 20 mg/kg chloralose and 250 mg/kg urethane followed by subcutaneous administration of 2 mg/kg morphine. The animals are placed in the right lateral position. Respiration is maintained through a tracheal tube using a positive pressure respirator (Bird Mark 7). A peripheral vein (saphenous vein) is cannulated for the administration of test compound. The ECG is recorded continuously in lead II (Einthoven).

For recording of peripheral systolic and diastolic blood pressure, the cannula of a femoral artery is connected to a pressure transducer (Statham P 23 DB). For determination of left ventricular pressure (LVP), a Millar microtip catheter (PC 350) is inserted via the left carotid artery. Left ventricular end-diastolic pressure (LVEDP) is measured on a high-sensitivity scale; heart rate (HR) is determined from the LVP wave form. Myocardial contractility is measured as the rate of rise of LVP (dp/dt max). The sum of ST-segment elevations is calculated from five values of the peripheral limbs in ECG lead II. The pressure-rate index (PRI = BPs × HR) serves as a measure of oxygen consumption.

The heart is exposed through a left thoracotomy between the fourth and fifth intercostal space, the pericard is opened and the left anterior descending coronary artery (LAD) is prepared. A silk suture is placed around the LAD, just below the first diagonal branch.

After an equilibration period of approx. 45 min., the test substance or the vehicle (controls) is administered as an intravenous bolus. Twenty min later, the ligature at the coronary artery is closed for 90 min. During the occlusion period, the test compound or the vehicle (controls) are given by continuous infusion. After release of the coronary obstruction, the animal is monitored for a 30 min reperfusion period. All parameters are recorded during the whole experiment. At the end of the test, surviving animals are sacrificed by an overdose of pentobarbital sodium.

The following parameters are evaluated:

• mortality • hemodynamics • arrhythmias -ventricular extrasystoles ( = premature ventricular contractions) (PVC) -percent animals with PVC -number of PVC/5 or 30 min -ventricular tachycardia (VT) (VT defined as any sequence of seven or more consecutive ventricular extrasystoles) -duration [s] of VT/5 or 30 min -ventricular fibrillation (VF) -percent animals with VF The different characteristics are evaluated separately. Changes of parameters in drug-treated animals are compared to vehicle controls. Statistical significance of the differences is calculated by means of the Student's t-test.

Standard data: Mortality: In an representative experiment, 10 out of 12 of control animals died from ventricular fibrillation during the 30 min reperfusion period. One out of 8 molsidomine-treated animals died and the death was also from ventricular fibrillation during the reperfusion phase. (Molsidomine was given as a continuous infusion of 0.5 mg/kg/ml/min during the occlusion period; controls received saline).

Varma and Melville (1963) described ventricular fibrillation induced by coronary occlusion during hypothermia in dogs.

Wilkerson and Downey (1978) described a technique for producing ventricular arrhythmias in dogs through coronary occlusion by an embolus (glass beads) being introduced into the coronary circulation via a rigid cannula which is inserted through the carotid artery. Weissenburger et al. (1991) described a model in dogs suitable for screening the bradycardia-dependent proarrhythmic effects of drugs and for studying the electrophysiology of "torsades de pointes". Coker (1989) recommended the anesthetized rabbit as a model for ischemia-and reperfusion-induced arrhythmias.

Thiemermann et al. (1989) described a rabbit model of experimental myocardial ischemia and reperfusion. Drugs were administered by intravenous infusion 5 min after the occlusion of the left anterior-lateral coronary artery and continued during the 60 min occlusion and subsequent 3 h reperfusion periods. Hendrikx et al. (1994) reported that the Na + -H + exchange inhibitor HOE 694 improves post-ischemic function and high-energy phosphate resynthesis and reduced Ca 2+ overload in the isolated perfused rabbit heart. Barrett et al. (1997) described a method of recording epicardial monophasic action potentials and is-chemia-induced arrhythmias following coronary artery ligation in intact rabbits. Naslund et al. (1992) described a closed chest model in pigs. Occlusion was induced in pentobarbitone anesthetized, mechanically ventilated pigs by injection of a 2 mm ball into a preselected coronary artery. Reperfusion was achieved by retraction of the ball via an attached filament. D'Alonzo et al. (1994) evaluated the effects of potassium channel openers on pacing-and ischemiainduced ventricular fibrillation in anesthetized pigs. Sack et al. (1994) described the effects of a Na + /H + antiporter inhibitor on post-ischemic reperfusion in pig heart. Premaratne et al. (1995) used a baboon open chest model of myocardial ischemia and reperfusion. Baboons underwent occlusion of the left anterior descending coronary artery for 2 h. Fifteen min after occlusion, the treated group received hyaluronidase i.v. over a 10-min period. The ischemic period was followed by 22 h of reperfusion. At the end of the reperfusion period, the hearts were excised and the perfusion bed at risk for infarction was determined by infusion of a microvascular dye. Todt H, Schunder-Tatzber S, Raberger G (1990) Programmed electrical stimulation after myocardial infarction and reperfusion in conscious dogs. J Pharmacol Meth 23:155-169 Linz W, Schölkens BA (1992) Role of bradykinin in the cardiac effects of angiotensin-converting enzyme inhibitors. J Cardiovasc Pharmacol 20(Suppl 9):S83-S90 Linz W, Wiemer G, Gohlke P, Unger T, Schölkens BA (1994) The contribution of bradykinin to the cardiovascular actions of ACE inhibitors. In Lindpaintner K, Ganten D In 1950, Harris found that the mortality in dogs after coronary occlusion with a 2-stage ligation procedure was lower than with 1-stage ligation. The left descending coronary artery is partially occluded for 30 min after which time total ligation is performed. Under these conditions arrhythmias develop within 4-7 h, reach a peak between 24 and 48 h and abate within 3-5 days.

Dogs of either sex are anesthetized by intravenous injection of methohexitone sodium (10 mg/kg), an endotracheal tube is inserted, and anesthesia maintained with halothane. The heart is exposed through an incision in the fourth or fifth intercostal space. The anterior descending branch of the left coronary artery is dissected free below its second branch and ligated in two stages. Two ligatures are placed around the artery and a 21 gauge needle. The first ligature is tied round the artery and the needle, which is then removed. Thirty min later, the second ligature is tied tightly round the artery. The chest is closed in layers 30 min after the second ligature has been tied, and the dog is allowed to recover.

Further observations are made when the dogs are conscious, e. g., 22-24 h after ligation of the coronary artery. The dogs are positioned to lie on their side and remain in this position throughout the experiment. Mean blood pressure is recorded from a catheter placed in the femoral artery. Lead II and aV L of the electrocardiogram and blood pressure are continuously recorded for a control period of 30 min before and during drug administration. Drugs are administered either by injection or by continuous infusion via a hind leg vein.

The number of sinus and ectopic beats are counted for each successive 5-min period. Beats with a distinct P wave preceding a mean frontal QRS vector of normal duration are counted as sinus in origin; all others are denoted as ectopic.

The model which resembles late arrhythmias occurring in postinfarction patients has been used with modifications by many authors (e. g., Kerr et al. 1985; Reynolds and Brown 1986; Gomoll 1987; Garthwaite et al. 1989; Krumpl et al. 1989a, b; Trolese-Mongheal et al. 1985 Spinelli et al. 1991) . Methods for producing experimental complete atrioventricular block in dogs were described and reviewed by Dubray et al. (1983) and by Boucher and Duchene-Marullaz (1985) . Gomoll AW (1987) The group of Lucchesi described an experimental dog model to test protection against sudden coronary death (Patterson et al. 1982; Uprichard et al. 1989a, b; Chi et al. 1990a Chi et al. , b, 1991 Kitzen et al. 1990; Black et al. 1991 Black et al. , 1993 .

Purpose-bred male mongrel dogs weighing 14-22 kg are anesthetized with 30 mg/kg pentobarbital i.v. The dogs are ventilated with room air through a cuffed endotracheal tube and a Harvard respirator. A cannula is inserted in the left external jugular vein. A left thoracotomy is performed between the fourth and fifth ribs, and the heart is exposed and suspended in a pericardial cradle. The left anterior descending coronary artery (LAD) is isolated at the tip of the left atrial appendage, and the left circumflex coronary artery (LCX) is iso-lated ∼1 cm from its origin. After a 20-gauge hypodermic needle has been placed on the LAD, a ligature is tied around the artery and the needle. The needle is then removed, resulting in critical stenosis of the vessel. The LAD is perfused for 5 min in the presence of the critical stenosis. Ischemic injury of the anterior ventricular myocardium is achieved by 2-h occlusion of the LAD by a silicon rubber snare. The vessel is reperfused after 2 h in the presence of the critical stenosis. During the period of LAD reperfusion, an epicardial bipolar electrode (1-mm silver posts, 3mm interelectrode separation) is sutured on the left atrial appendage for subsequent atrial pacing. A bipolar plunge electrode (25-gauge stainless steel, 5 mm long, 3 mm separation) is sutured on the interventricular septum, adjacent to the occlusion site and overlying the right ventricular outflow tract (RVOT). Two similar stainless steel bipolar plunge electrodes are sutured to the left ventricular (LV) wall: one at the distribution of the LAD distal to the occlusion (infarct zone, IZ), and the second in the distribution of the LCX (non-infarct zone, NZ). A 30-gauge silver-coated copper wire electrode is passed through the wall and into the lumen of the LCX and sutured to the adjacent surface of the heart. Silver disc electrodes are implanted subcutaneously for ECG monitoring. The surgical incision is closed and the animals are allowed to recover.

The animals are treated after the recovery period during the 3 days of programmed electrical stimulation either with the test drug or with the solvent. 

A direct anodal 15 µA current from a 9-V nickel-cadmium battery is passed through a 250 Ohm resistor and applied to the electrode in the lumen of the left circumflex coronary artery. The cathode of the battery is connected to a s.c. implanted disc electrode. Lead II ECG is recorded for 30 s every 15 min on a cardiocassette recorder. After 24 h of constant anodal current or development of ventricular fibrillation, the animals are sacrificed, the hearts are excised and the thrombus mass in the LCX is removed and weighed. The heart is sectioned transversely and incubated for 15 min at 37°C in a 0.4% solution of tetrazolium triphenyl chloride for identification of infarcted areas. Time of onset of ventricular ectopy and of lethal arrhythmia is provided from recordings of the cardiocassette.

Non-sustained and sustained tachyarrhythmias are evaluated.

Sudden coronary death is one of the leading causes of death in developed countries. These facts warrant the use of complicated models in higher animals for search of active drugs. described an experimental preparation for sudden cardiac death in dogs. The animals were chronically instrumented and studied 1 month after an anterior myocardial infarction. A balloon catheter around the circumflex coronary artery was inflated to produce acute myocardial ischemia and the occlusion was maintained for 2 min. Several days later, the animals were subjected to a submaximal stress on a motor-driven treadmill for 12-18 min. During the last minute of exercise the left coronary artery was occluded, the treadmill stopped, and the occlusion was maintained for a second minute. Schwartz et al. (1988) analyzed the baroreceptor reflexes in conscious dogs with and without a myocardial infarction to get insights in the mechanisms of sudden death. Cahn and Cervoni (1990) reviewed of the use of animal models of sudden cardiac death for drug development. Pak et al. (1997) found that canine tachycardia-induced cardiomyopathy is a useful model for studying mechanisms and therapy of sudden cardiac death in heart failure. Adamson et al. (1994) performed a longitudinal study in dogs at high and low risk for sudden death and found an unexpected interaction between βadrenergic blockade and heart rate variability before and after myocardial infarction. Basso et al. (2004) recommended arrhythmogenic right ventriculopathy causing sudden death in boxer dogs as an animal model of human disease. Schwartz Billman and his group developed methods to evaluate antiarrhythmic drugs for their activity in cardiovascular parameters in an exercise-plus-ischemia test.

Mongrel dogs, weighing 15.4 to 19.1 kg, are anesthetized and instrumented to measure left circumflex CBF, left ventricular pressure and ventricular electrogram (Billman and Hamlin 1996; Billman et al. 1993 Billman et al. , 1997 . The animals are given Innovar Vet (0.02 mg/kg fentanyl citrate and 1 mg/kg hydroperidol i.v.) as a preanesthetic, whereas a surgical plane of anesthesia is induced with sodium pentobarbital (10 mg/kg i.v.). A left thoracotomy is made in the fourth intercostal space, and the heart is exposed and supported by a pericardial cradle. A 20-MHz pulsed Doppler flow transducer and a hydraulic occluder are placed around the left circumflex artery. A pair of insulated silver-coated wires are sutured to the epicardial surface of both the left and right ventricles. These electrodes are used for ventricular pacing or to record a ventricular electrogram from which HR is determined using a Gould Biotachometer (Gould Instruments, Cleveland, OH) . A precalibrated solid-state pressure transducer (Konigsberg Instruments, Pasadena, CA) is inserted into the left ventricle via a stab wound in the apical dimple. Finally, a two-stage occlusion of the left anterior descending coronary artery is performed approximately one third the distance from the origin to induce an anterior wall myocardial infarction. This vessel is partially occluded for 20 min and then tied off. All leads from the cardiovascular instrumentation are tunneled under the skin to exit on the back of the animal's neck. A transdermal fentanyl patch that delivers 75 µg/h for 72 h is placed on the back of the neck (secured with adhesive tape) to decrease postoperative discomfort. In addition, bupivacaine HCl, a long-acting local anesthetic, is injected to block the intercostal nerves (i. e., pain fibers) in the area of the incision. Each animal is placed on prophylactic antibiotic therapy (amoxicillin 500 mg p.o.) three times daily for 7 days. The animals are placed in an "intensive care" setting for the first 24 h and placed on antiarrhythmic therapy (Billman and Hamlin 1996; Billman et al. 1993 Billman et al. , 1997 .

The studies begin 3 to 4 weeks after the production of the myocardial infarction. The animals are walked on a motor-driven treadmill and trained to lie quietly without restraint on a laboratory table during this recovery period. Susceptibility to VF is then tested. The animals run on a motor-driven treadmill while workload is increased every 3 min for a total of 18 min. The protocol begins with a 3-min warm-up period, during which the animals run at 4.8 km/h at 0% grade. The speed is increased to 6.4 km/h, and the grade is increased every 3 min as follows: 0%, 4%, 8%, 12% and 16%. During the last minute of exercise, the left circumflex coronary artery is occluded, the treadmill is stopped and the occlusion is maintained for 1 additional min (total occlusion time, 2 min). Large metal plates (diameter, 11 cm) are placed across the animal's chest so that electrical defibrillation can be achieved with minimal delay but only after the animal is unconscious (10-20 s after VF begin). The occlusion is immediately released if VF occur.

The animals then receive one or more of the following treatments: 1 the exercise-plus-ischemia test is repeated after pretreatment with the standard drug glibenclamide (1.0 mg/kg i.v.). The drug is injected in a cephalic vein; 3 min before exercise begins. 2 The exercise-plus-ischemia test is repeated after pretreatment with the test drug 3 Finally, a second control (saline) exercise plus ischemia test is performed 1 week after the last drug test. At least 5 days are intermitted between drug treatments. Drugs are given in a random order.

On a subsequent day, the effective refractory period is determined using a Medtronic model 5325 programmable stimulator, both at rest and during myocardial ischemia. The heart is paced for 8 beats (S 1 ; in-trastimulus interval, 300 ms; pulse duration, 1.8 ms at twice-diastolic threshold of ∼6 mA). The intrastimulus interval is progressively shortened between the last paced beat and a single extrastimulus (S 2 ). The refractory period represents the shortest interval capable of generating a cardiac response and is measured using either the left or right ventricular electrodes. This procedure is completed within 30 s. Once the control values are determined, refractory period measurements are repeated after the standard drug glibenclamide (1.0 mg/kg i.v.), or the test drug. After the completion of these studies, refractory period is determined during myocardial ischemia (2-min occlusion of the left circumflex coronary artery) ∼60 s after the onset of the coronary occlusion.

The K ATP has been implicated in vascular regulation, particularly CBF (Aversano et al. 1991; Belloni and Hintze 1991; Daut et al. 1990 ). Therefore, the effects of standard and test drug on the response to brief interruptions in CBF are also evaluated. Animals are placed on a laboratory The data are averaged over the past 5 s of each exercise level. The coronary occlusion data are averaged over the last 5 s before and at the 60-s line point (or VF onset) after occlusion onset. The total area between the peak CBF and return to base line is measured for each 15-s occlusion, and the percent repayment is calculated. The reactive hyperemia response to each occlusion is then averaged to obtain one value for each animal. The data are then analyzed using analysis of variance for repeated measures. When the F ratio is found to exceed a critical value (P < 0.05), Scheffe's test is used to compare the mean values. The effects of the drug intervention on arrhythmia formation are determined using a χ 2 test with Yates' correction for continuity. All data are reported as mean ± SEM. Cardiac arrhythmias, PR interval and QT interval are evaluated at a paper speed of 100 mm/s. QT interval is corrected for HR using Bazett's method.

Tests combining coronary constriction with physical exercise may resemble most closely the situation in coronary patients. Morillo et al. (1995) published a model of sustained atrial fibrillation by chronic rapid atrial pacing in dogs.

Halothane-anesthetized mongrel dogs underwent insertion of a transvenous lead at the right atrial appendage that was continuously paced at 400 beats/min for 6 weeks. Two-dimensional echocardiography was performed to assess the effects of rapid atrial pacing on atrial size. Atrial vulnerability was defined as the ability to induce sustained repetitive atrial responses during programmed electrical stimulation. Effective refractory period (ERP) was measured at two endocardial sites of the right atrium. Sustained atrial fibrillation (AV) was defined as AF ≥15 min. In animals with sustained AF, 10 quadripolar epicardial electrodes were surgically attached to the left and right atria. The local atrial fibrillatory cycle length (AFCL) was measured in a 20-s window. Marked biatrial enlargement was documented after 6 weeks of continuous rapid atrial pacing. An increase in atrial area of at least 40% was necessary to induce sustained AF. More studies using this method were performed by Gaspo et al. (1997a Gaspo et al. ( , 1997b , Yue et al. (1997) , Sun et al. (1998) , and Nattel and Li (2000) . Shiroshita-Takeshita et al. (2004) studied the effect of drugs on atrial fibrillation promotion by atrialtachycardia remodeling on dogs.

Mongrel dogs were anesthetized with ketamine (5.3 mg/kg i.v.), diazepam (0.25 mg/kg i.v.) and halothane (1.5%). Unipolar leads were inserted through jugular veins into the right ventricular apex and the right atrial appendage and connected to pacemakers (Medtronic) in subcutaneous pockets in the neck. A bipolar electrode was inserted into the right atrium for stimulation and recording during serial electrophysiological study. AV block was created by radiofrequency ablation of control ventricular response during atrial tachypacing. The right ventricular pacemaker was programmed to 80 beats/min.

After 24 h for recovery, a baseline closed-chest serial electrophysiological study was performed under ketamine/diazepam/isoflurane anesthesia, and then atrial tachypacing (400 beats/min) was initiated. The closed-chest electrophysiological study was repeated at 2, 4, and 7 days of atrial tachypacing, and a final open-chest electrophysiological study was performed on day 8 under morphine-chloralose anesthesia.

Results of atrial tachypacing in drug-treated dogs were compared with results of dogs without treatment (controls).

Dogs were anesthetized and ventilated mechanically. The atrial pacemaker was deactivated and a right atrium appendage effective refractory period was measured at basic lengths of 150, 200, 250, 300, and 360 ms with 10 basic stimuli (S 1 ) followed by a premature extra-stimulus (S 2 ) with 5-ms decrements. The longest S 1 -S 2 failing to capture defined the effective refractory period. AF was induced by atrial burst pacing at 10 Hz and 4 times threshold current. To estimate mean AF duration in each dog, AF was induced 10 times if AF duration was < 20 min and 5 times if AF lasted 20-30 min and then averaged. If AF lasted longer than 30 min, it was considered sustained and was terminated by DC cardioversion. A 20-min rest period was then allowed before continuing measurements.

For open-chest electrophysiological studies, dogs were anesthetized and ventilated mechanically. A femoral artery and both femoral veins were cannulated for pressure monitoring and drug administration. A median sternotomy was performed, and bipolar electrodes were hooked to the right atrial and left atrial appendages for recording and stimulation. A programmable stimulator (Digital Cardiovascular Instruments) was used to deliver twice-threshold currents. Five silicon sheets containing 240 bipolar electrodes were sutured onto the atrial surface (Fareh et al. 2001) . Atrial effective refractory periods were measured as multiple basic cycle lengths in the right and left atrial appendages and at basic cycle length 300 ms in six additional sites: right and left atrium posterior wall, right and left atrium inferior wall, and right and left atrium Bachmann's bundle. Atrial fibrillation vulnerability was determined as the percentage of atrial sites at which AF could be induced by single extra-stimuli.

Data are presented as mean ± SEM. Multiple-group comparisons were obtained by ANOVA. AF duration data were analyzed after logarithmic transformation. Bonferroni-corrected t tests were used to evaluate individual-mean differences.

Atrial fibrillation is the most common tachyarrhythmia in humans. It causes palpitations, decreased cardiac output, heart failure and systemic thromboembolism, and is associated with significant mortality. Wijffels et al. (1995) demonstrated in a chronically instrumented conscious goat model, that episodes of atrial fibrillation may be self-perpetuating ("Atrial fibrillation begets atrial fibrillation") and have suggested that there may be a purely electrophysiological explanation (termed atrial electrical remodeling) for the increase of atrial fibrillation with time. This model has been extensively used to study pathophysiological mechanism and the influence of drugs (Wijffels et al. 1997 (Wijffels et al. , 1999 (Wijffels et al. , 2000 Allessie et al. 1998; Tieleman et al. 1999; Duytschaever et al. 2000 Duytschaever et al. , 2005 Garratt and Fynn 2000; Van der Velden 2000a , 2000b Veloso 2001; Brendel and Peukert 2003; Shan et al. 2004; Blaauw et al. 2004a) . Blaauw et al. (2004b) studied the efficacy and atrial selectivity of a blocker of the early ultrarapid compo-nent of the delayed rectifier (I kur ) in remodeled atria of the goat.

Female goats weighing 52 ± 2 kg were used. According to the method of Duytschaever et al. (2001) , Teflon-felt plaques with multiple electrodes were sutured onto the free wall of each atrium, Bachmann's bundle, and the left ventricle. All leads were tunnelled subcutaneously to the neck and exteriorized by four 30-pole connectors. Experiments were started 3-4 weeks after surgery. Atrial fibrillation was induced by a fibrillation pacemaker (Wijffels et al. 1995) .

The atria were paced with biphasic stimuli of 2 ms duration and 4 × threshold. The atrial effective refractory period was measured at the free wall of the right and left atria during regular pacing (interval, 400-200 ms) . Single interpolated stimuli were applied after eight basic stimuli, starting within the refractory period. The longest interval that failed to capture the atria (2-ms increments) was taken as the atrial effective refractory period. Atrial conduction velocity was measured along Bachmann's bundle during right atrial pacing. The distance over which conduction velocity was measured ranged from 3.5 to 5 cm.

The length of the fibrillation waves was determined at the right atrial free wall by measuring the refractory period and conduction velocity during AF. The refractory period was measured by slow, fixed-rate pacing (1 Hz), resulting in a series of single, randomly coupled, premature stimuli. Local capture of AF was evidenced by radial spread of activation from the pacing site and a short delay between stimulus and response. For each coupling interval, the percentage of capture was determined. The shortest interval capturing the atrium ≥50% was taken as the refractory period. Conduction velocity was determined with a mapping electrode containing 5 × 6 electrodes (interelectrode distance, 4 mm) from the local conduction vectors within areas of 3 × 3 electrodes. At least 50 AF cycles were used to determine conduction velocity.

Inducibility of AF was measured at the right and left atria by single premature stimuli applied during regular pacing (400 ms). In case a premature beat induced a rapid irregular rhythm lasting > 1 s, AF was considered inducible. The AF cycle length was measured automatically by an algorithm detecting the negative intrinsic deflection of the fibrillation electrogram. A median value of 300 consecutive intervals was calculated. QT duration was measured during atrial pacing and persistent AF from either an epicardial electrogram or a precordial ECG. Because Bazett's for-mula cannot be applied during AF, another approach was used to correct QT duration. In each goat, the relationship between the RR interval and QT duration was determined during 20 s of AF. The RR-QT relationship after drug administration was compared with the normal RR-QT relation.

The electrophysiological effects of the test drug and a conventional class III drug were measured before and after 48 h (1-4 days) of AF. The drugs were infused intravenously over 1 h, during which time AF cycle length was monitored. After 30 min of infusion, refractory period, conduction velocity, median RR interval, and QT duration were measured. Successful cardioversion was defined as termination of AF within ≤1 h of drug administration.

Differences between groups were evaluated by paired Student's t-test or by two-way repeated ANOVA with post hoc Bonferroni's t-test. McNemar's test was used to compare AF inducibility. Changes in corrected QT duration were calculated by the one-sample t-test. Differences were considered significant at P < 0.05. Results are presented as mean ± SEM. Blockade of cardiac potassium channels and the resulting prolongation of repolarization and refractoriness is the mode of action of class III antiarrhythmic drugs. In the human heart, the ultrarapid delayed rectifier potassium current (I Kur ) was identified in atrial, but not in ventricular tissue. It appears to contribute to action potential repolarization in the atrium but not the ventricle. The molecular correlate of the human cardiac ultrarapid delayed rectifier potassium current seems to be the Kv1.5 protein (Fedida et al. 1993; Wang et al. 1993; Feng et al. 1997 Feng et al. , 1998 . Since prolongation of ventricular repolarization seems to be invariably associated with proarrhythmia (early afterdepolarizations leading to torsades de pointes arrhythmia) as shown with available potassium channel blockers (class III drugs) such as the highly se-lective and potent I Kr -channel blocker dofetilide (Torp-Pedersen et al. 1999 ), blockade of a cardiac current that is exclusively present in the atria is highly desirable as it is expected to be devoid of ventricular proarrhythmic effects. Therefore, the atrial Kv1.5 channel is a highly attractive target in the search for new and safer atrial antiarrhythmic drugs (Nattel and Singh 1999) .

In a series of studies, Wirth and Knobloch (2001) , Knobloch et al. (2002 Knobloch et al. ( , 2004 , and Wirth et al. (2003) investigated electrophysiological and antiarrhythmic effects of I Kur channel blockers on left versus right pig atrium in vivo in comparison with I Kr blockers in pigs.

Castrated male pigs (24-30 kg) of the German Landrace were premedicated with 3 ml Rompun 2% i.m. (xylacine HCL, 23.3 mg/ml = 3 mg/kg i.m.) and 6 ml Hostaket (ketamine HCl, 115 mg/ml = 20 mg/kg i.m.) and anesthetized with an i.v. bolus of 5 ml Narcoren (pentobarbital, 160 mg/ml = 25-30 mg/kg i.v.) followed by a continuous intravenous infusion of 12-17 mg/kg per h pentobarbital. Animals were ventilated with room air and oxygen by a respirator (ABV-Intensiv; Stephan, Gackenbach, Germany). After a left thoracotomy the lung was retracted, the pericardium incised and the heart suspended in a pericardial cradle. Bipolar body surface ECG was recorded using subcutaneous needle electrodes in the classical lead II or lead III arrangement.

Atrial effective refractory period (ERP) measurements at different basic cycle lengths (BCL 240/300/400 ms) were performed (Wirth and Knobloch 2001) . Atrial responses to the pacing procedure were visualized via monophasic action potential (MAP) from the left and right atrium as will be described below. A conditioning train of ten basic stimuli (S1) at twice-diastolic pacing threshold was followed by a diastolic extrastimulus (S2, pulse duration 1 ms) starting about 30 ms above the expected ERP with a 5-ms decrement (UHS 20, universal heart stimulator; Biotronik, Berlin, Germany). The longest coupling interval unable to elicit a propagated atrial response was taken as the atrial ERP.

Left atrial ERP was measured via a MAP pacing catheter (EP Technologies, Model 1675; Boston Scientific, La Garenne-Colombes, France), which was fixed in each pig in the middle of the left atrial free wall in an approximately perpendicular position by a holding device (Yuan et al. 1994) . The tip of the MAP pacing catheter was covered by a sponge. Programmed stimulation was performed by the MAP pacing catheter. Right atrial MAP for ERP measurement was taken from the endocardium of the right atrium also via a steerable MAP pacing catheter. The catheter, inserted via the V. femoralis, was used for atrial stimulation too. Its position in the right atrium was checked by palpitation and by the typical atrial MAP morphology and duration and, additionally, by short rapid atrial pacing at a BCL of 240 ms, which the ventricle was not able to follow 1:1 as indicated by frequent p-waves dissociated from the QRS complex. There were no significant differences between endocardial and epicardial ERP measurements in the free walls of either atrium at baseline and after drug.

During the ERP measurement procedure the mere S2extrastimulus, which followed the ten conditioning S1 stimuli during the ERP-measurement procedure, frequently triggered runs of atrial tachycardia in the left, not the right, atrium. The occurrence of tachycardias was primarily unintended, but then exploited as a parameter for the judgement of the antiarrhythmic efficacy of compounds (referred to as left atrial vulnerability). Whether or not a run of S2-triggered atrial tachyarrhythmia occurred during the ERP-measurement procedure at a given BCL was noted. The occurrences of triggered tachyarrhythmias were summed up for the three BCLs tested over three time points (during a 30min period before or after a drug). Thus, the maximal occurrence of S2-tachyarrhythmias during the control or drug period in an individual animal was nine.

Drugs were dissolved in polyethyleneglycol (PEG) 400 (Riedel-de Haen, Seelze, Germany) and administered i.v. over 5 min in a volume of 3 ml. Vehicle was injected at least 30 min before each drug. For each drug a separate group of pigs was used.

All data were presented as means ± SEM. Two-way ANOVA for repeated measures followed by Student's t-test was used for the calculation of statistically significant differences between left and right atrial ERP prolongations at the three basic cycle lengths and the inhibition of left atrial vulnerability. A value of P < 0.05 was accepted as significant. The longest ERP at each pacing rate after drug administration was taken and expressed as absolute or percent increase from vehicle control. Interatrial difference in refractoriness was calculated as the difference between the left and right atrial ERP.

According to anti-arrhythmic drugs are divided into 4 different classes depending on their mode of action. Class I anti-arrhythmic agents decrease the upstroke velocity of the action potential through blockade of Na + channels. Class II drugs block β-receptors. Class III anti-arrhythmic agents prolong action potential duration, presumably through blockade of K + channels. Class IV anti-arrhythmic agents inhibit the slow calcium influx during the plateau of the action potential through Ca 2+ channel blockade. These electrophysiological actions also have functional manifestations, e. g., Na + channel blockade decreases excitability, K + channel blockade lengthens refractory period, and Ca 2+ channel blockade decreases tension of cardiac muscle. A simple and accurate non-microelectrode method is necessary to identify and classify potential anti-arrhythmic drugs into the classes I, III, and IV. In right ventricular guinea pig papillary muscle developed tension (DT), excitability (EX), and effective refractory period (ERP) are measured.

Guinea pigs of either sex weighing 200-400 g are stunned, the carotid arteries are severed, and the thoracic cage is opened immediately. The heart is removed, placed into a container of prewarmed, preoxygenated physiologic solution and the pericardium, atria, and other tissues are removed. The heart is then pinned to a dissection dish, and the right ventricle is opened. The tendinous end of the papillary muscle is ligated with a silk thread, and the chordae tendinae are freed from the ventricle. The opposite end of the papillary muscle is then cut free close to the ventricular wall. The non-ligated end of the papillary muscle is clamped into a tissue holder, the end of which is a leucite block containing platinum wire field electrodes.

The preparation is transferred to a tissue bath containing 75 ml of a physiological salt solution that is gassed continuously with 95% O 2 /5% CO 2 and maintained at a temperature of 35°C and a pH of 7.4. The silk thread is used to connect the muscle to a Grass FT03C force transducer. An initial resting tension of 1 g is established. Muscles are field stimulated to contract isometrically. The stimulus duration is 1 ms, the frequency 1 Hz, and the voltage twice threshold. Pulses are delivered with the use of a Grass S88 constant voltage stimulator, and developed tension is recorded with the use of a polygraph recorder. The preparation is equilibrated in this manner for 90 min with bath solution changes every 15 min. Control measurements of the force-frequency curve, stimulus strength-duration curve and the effective refractory period are made following the 75 min bath exchange, i. e., during the last 15 min of equilibration.

The force-frequency curve is obtained by measuring developed tension over a range of stimulation frequencies (0.3, 0.5, 0.8, 1.0, and 1.2 Hz). The tissue is contracted for 90 s at each of these frequencies with a brief period of stimulation at 1.5 Hz inserted between increments. The purpose of the 1.5 Hz insert is to keep "pacing history" constant as well as to minimize progressive, nonspecific depression during the lower frequency stimulation series. Both pre-and postdrug developed tension (at each frequency) are expressed as a percentage of the predrug developed tension at 1 Hz. The percent change in post treatment (versus pretreatment) developed tension at 1 Hz is used to quantitate an agent's inotropic effect.

The stimulus strength-duration curves are determined by varying the stimulus duration (0.1, 0.4, 0.8, 1.0, 1.5, 3.0, and 3.4 ms) and finding the threshold voltage that produced a 1:1 correspondence between stimulus and response at each duration. The degree of shift in the strength-duration curve is measured by computing the area between the pre-and post-treatment curves. The boundaries for the area are determined by the first (x-axis parallel) and the last (x-axis perpendicular) durations and by lines from the origin to the second and fourth durations.

Effective refractory period (ERP) is measured at 1 Hz using twin pulse stimuli. After every 8-10 pulses, a second delayed stimulus (S 2 ) identical to the basic drive pulse (S 1 ) is introduced. This procedure is repeated, shortening the delay (S 1 -S 2 ) by 5 ms increments. The value of the ERP is taken as the longest delay (S 1 -S 2 ) for which there is a single response to twin pulses. The change in ERP is computed as the difference (ms) between the pre-and post-treatment ERP values.

At the conclusion of the 90 min predrug equilibration period, an aliquot of the test drug designed to achieve the desired final concentration is added to the bath. The tissue must equilibrate for 1 h in the drug solution before postdrug measurements of the forcefrequency curve, stimulus strength-duration curve, and effective refractory period are obtained.

The changes in effective refractory period (ERP) (post treatment minus pretreatment), the degree of shift in the strength-duration curve (geometrical area between pre-and post-treatment curves), and the percent changes in post treatment developed tension at 1 Hz are calculated. The results of these calculations are used to classify the compound as a class I, III, or IV anti-arrhythmic agent on the basis of its effect on de-veloped tension, excitability, and effective refractory period. An upward and right shift of the strength-duration curve (decrease in excitability) is characteristic for a class I anti-arrhythmic agent, such disopyramide. Selective prolongation of effective refractory period is characteristic for class III anti-arrhythmic agents, such as sotalol. Depression of developed tension, and/or flattening or reversal of the force-frequency curve is characteristic for a class IV anti-arrhythmic agent, such as verapamil.

The model of the electrically stimulated isolated guinea pig papillary muscle is a simple method to classify anti-arrhythmic agents. Some drugs have multiple actions and, therefore, belong in more than one class. For further characterization analysis of the action potential is necessary.

O'Donoghue and Platia (1991) recommended the use of monophasic action potential recordings for the evaluation of anti-arrhythmic drugs. Shibuya et al. (1993) studied the effects of the local anesthetic bupivacaine on contraction and membrane potential in isolated canine right ventricular papillary muscles. From analysis of action potential it is concluded that at low concentrations contraction is depressed mainly due to a Na + channel block, whereas at high concentrations also Ca 2+ channels may be blocked. Kodama et al. (1992) , Maryuama et al. (1995) studied the effects of potential antiarrhythmics on maximum upstroke velocity and duration of action potential in isolated right papillary muscles of guinea pigs as well as the influence of these agents on single ventricular myocytes. Borchard et al. (1982) described a method for inducing arrhythmias or asystolia by the application of 50 Hz alternating current (ac) to electrically driven isolated left atria and right papillary muscles of the guinea pig. An increase in driving frequency from 1 to 3 Hz effected a significant reduction of the threshold of ac-arrhythmia in guinea pig papillary muscle, but no change in atria. A decrease in temperature from 31°C to 25°C and an increase in Ca 2+ from 1.25 to 5 mmol/l elevated the threshold for ac-arrhythmia and -asystolia. Fast sodium channel inhibitors increased threshold of acarrhythmia in left atria and papillary muscles, whereas the slow channel inhibitor verapamil was ineffective in concentrations up to 6 µmol/l.

Intracellular action potential in the left ventricular guinea pig papillary muscle is recorded after electrical stimulation. The stimulation frequency is varied in order to determine the refractory period. Resting potential, upstroke velocity, duration of action potential, threshold, refractory period and contractile force can be measured in vitro. Compounds which affect the duration of the effective refractory period may have antiarrhythmic or pro-arrhythmic effects. In addition, the inotropic effect (positive or negative) of the test compound is determined.

Guinea pigs of either sex (Marioth strain) weighing 250-300 g are sacrificed by stunning, the carotid arteries are severed, and the thoracic cage is opened immediately. The heart is removed, placed in a container of prewarmed, pre-oxygenated Ringer solution, and the pericardium and the atria are trimmed away. The left ventricle is opened and the two strongest papillary muscles removed. They are fixed between a suction electrode for electrical stimulation and a force transducer for registration of contractions. Ringer solution oxygenated with carbogen (95% O 2 /5% CO 2 ) at a temperature of 36°C is used.

A standard micro electrode technique is applied to measure the action potential via a glass micro electrode containing 3 M KCl solution, which is inserted intracellularly. The papillary muscle is stimulated with rectangular pulses of 1 V and of 1 ms duration at an interval of 500 ms. The interval between two stimuli is variable in order to determine refractory periods. The intensity of the electrical current is just below the stimulation threshold.

The intracellular action potential is amplified, differentiated for registration of upstroke velocity (dV/dt) (Hugo Sachs micro electrode amplifier), together with the contraction force displayed on an oscilloscope (Gould digital storage oscilloscope OS 4000), and recorded (Gould 2400 recorder).

The effects on fast sodium channels as well as on calcium channels can be studied. The former requires measurement of the normal action potential and the latter the slow action potential obtained at 30 mM K + . To estimate the relative refractory periods, the second stimuli are set in decremental intervals until contraction ceases. Relative refractory period is defined as the minimum time interval of two stimuli at which each of the stimuli is answered by a contraction. The stimulation threshold is also measured.

After an equilibrium time of 30 min the test compound is added. After 15 and 30 min the following parameters are compared with the predrug values:

• Resting potential mV • upstroke velocity V/s • duration of action potential ms • stimulation threshold V • refractory period ms • contraction force mg

The organ bath is flushed thoroughly between two consecutive applications of increasing test drug doses.

Contractile force [mm] and relative refractory period [ms] are determined before and after drug administration. ED 25 ms -and ED 50 ms -values are determined. ED 25ms or ED 50ms is defined as the concentration of test drug in the organ bath at which the relative refractory period is reduced or prolonged by 25 ms or 50 ms.

Since many anti-arrhythmic agents possess additionally negative inotropic effects, changes in the force of contraction are also determined.

ED 50 values are calculated from log-probit analyses. Scores are allotted relative to the efficacy of standard compounds (lidocaine, propranolol, quinidine).

The following changes are indicators for anti-arrhythmic activity:

• increase of stimulation threshold • decrease of upstroke velocity • prolongation of action potential • increase of refractory period.

Upstroke velocity and duration of action potential are used for classification purposes. Tande et al. (1990) studied the electromechanical effects of a class III anti-arrhythmic drug on guinea pig and rat papillary muscles and atria using conventional microelectrode technique. Shirayama et al. (1991) studied with a similar technique the electrophysiological effects of sodium channel blockers in isolated guinea pig left atria. Dawes (1946) described a method of examining substances acting on the refractory period of cardiac muscle using isolated rabbit auricles.

The same method was recommended as first step of a screening program for quinidine-like activity by Schallek (1956) . Wellens et al. (1971) studied the decrease of maximum driving frequency of isolated guinea pig auricles after antiarrhythmic drugs and beta-blockers. Salako et al. (1976) recorded electropotentials along the conducting system after stimulation of the proximal part of the His bundle in rabbits. Brown (1989) , Wu et al. (1989) , Gwilt et al. (1991a, b) Blood flow restriction of the aorta in rats induces not only hypertension but also cardiac hypertrophy within several weeks. Angiotensin converting enzyme inhibitors, even at subantihypertensive doses, but not other antihypertensive drugs, inhibit cardiac hypertrophy Schölkens et al. 1991; Gohlke et al. 1992; Linz 1992a; Bruckschlegel et al. 1995; Ogawa et al. 1998 ).

Male Sprague Dawley rats weighing 270-280 g are fasted 12 h before surgery. Anesthesia is induced by i.p. injection of 200 mg/kg hexobarbital. The abdomen is shaved, moistened with a disinfectant and opened by a cut parallel to the linea alba. The intestine is moistened with saline and placed in a plastic cover to prevent desiccation. The aorta is prepared free from connective tissue above the left renal artery and underlaid with a silk thread. Then, a cannula no. 1 (0.9 × 40 mm) is placed longitudinally to the aorta and both aorta and cannula are tied. The cannula is removed, leaving the aortic lumen determined by the diameter of the cannula. The intestine is placed back into the abdominal cavity with the application of 5.0 mg rolitetracycline (Reverin). In sham-operated controls no banding is performed. The skin is closed by clipping. The animals are treated once daily over a period of 6 weeks with doses of the ACE-inhibitor or other antihypertensive drugs found previously effective to lower blood pressure in rats. At the end of the experiment blood pressure is measured under hexobarbital anesthesia (200 mg/kg i.p.) via indwelling catheters in the left carotid artery. Blood pressure measurement in conscious rats with the convential tail-cuff method is not possible due to the large pressure difference across the ligature. Therefore, only one measurement at the end of the study is possible. The hearts are removed, rinsed in saline until free of blood and gently blotted to dryness. Total cardiac mass is determined by weighing on an electronic balance to the nearest 0.1 mg. The atria and all adjacent tissues are trimmed off and the weight of the left ventricle including the septum as well as the remaining cardiac tissue representing the right ventricle are determined separately. Weights are calculated per 100 g body weight.

Total cardiac mass, weight of left and right ventricle of treated rats are compared with operated controls and sham-operated controls.

Uetmasu et al. (1989) described a simple method for producing graded aortic insufficiencies in rats and subsequent development of cardiac hypertrophy. Selective perforation of the right cup of the aortic valve or in combination with that of the left valve cup was performed using a plastic rod inserted from the right common carotid artery. Hypertrophy of the heart, but no hypertension or cardiac insufficiency, was observed. Similar methods were used by Yamazaki et al. (1989) to study the alterations of cardiac adrenoceptors and calcium channels subsequent to aortic insufficiency, by Umemura et al. (1992) to study baroreflex and β-adrenoceptor function and by Ishiye et al. (1995) to study the effects of an angiotensin II antagonist on the development of cardiac hypertrophy due to volume overload.

Hyperplastic growth response of vascular smooth muscle cells in the thoracic aorta was found following induction of acute hypertension in rats by aortic coarctation by Owens and Reidy (1985) . Changes in cardiac gene expression during compensated hypertrophy and the transition to cardiac decompensation in rats with aortic banding were studied by Feldman et al. (1993) . Muders et al. (1995) produced aortic stenosis in rats by placing a silver clip (inner diameter 0.6 mm) on the ascending aorta. Schunkert et al. (1995) studied alteration of growth responses in established cardiac pressure overload hypertrophy in rats with aortic banding. Prevention of cardiac hypertrophy after aortic banding by ACE inhibitors probably mediated by bradykinin could be shown (Linz et al. 1989 (Linz et al. , 1992a (Linz et al. , b, 1993 Linz and Schölkens 1992; Schölkens et al. 1991; Weinberg et al. 1994) . Weinberg et al. (1997) studied the effect of angiotensin AT 1 receptor inhibition on hypertrophic remodelling and ACE expression in rats with pressureoverload hypertrophy due to ascending aortic stenosis. Rat models of heart failure were reviewed by . Chronic heart failure can be induced in rats by occlusion of coronary arteries. One of the first reports was by . More recent reports are by Pfeffer et al. (1979) , Hodsman et al. (1988) , Van Veldhuisen et al. (1994 , , Gómez et al. (1997) , Liu et al. (1997a Liu et al. ( , 1997b , and Jadavo et al. (2005) . described a model of chronic heart failure (CHF) in spontaneously hypertensive rats.

Adult male 4-month-old SHR/NHsd and WKY/NHsd rats (Harlan Sprague Dawley, Winkelmann, Germany) weighing 250-300 g were used. Cardiovascular failure was induced by permanent (8 weeks) occlusion of the left coronary artery 2 mm distal to the origin from the aorta resulting in a large infarction of the free left ventricular wall.

Eight weeks after surgery, parameters indicating CHF were measured. Cardiac hypertrophy, function, and geometric properties were determined by the "working heart" mode and in vivo determinations by MRI and heart weight. Hydroxyproline/proline ratio was measured as an indicator of heart fibrosis.

The rats were anesthetized with a mixture of ketamine/xylazine (35/2 mg/kg) i.p. The left ventrolateral thorax was shaved and prepared to create a disinfected surgical access area. When a stable anesthesia was achieved the animals were placed on a small animal operation table, intubated and ventilated with room air using a small animal ventilator (KTR-4, Hugo Sachs Elektronik, March-Hugstedten, Germany). The level of anesthesia was deemed as adequate following loss of the pedal withdrawal reflex and absence of the palpebral reflex. The tidal volume was adjusted at 3-5 ml and the ventilation rate was 40 breaths/min. Left thoracotomy was performed via the third intercostal space. The heart was exposed and the pericardium opened. The left main coronary artery was ligated with Perma-Hand silk 4-0 USP (Ethicon, Norderstedt, Germany) near its origin at the aorta (2 mm distal to the edge of the left atrium). Ligation resulted in infarction of the free left ventricular wall. Ligation was deemed successful when the anterior wall of the left ventricle turned pale. At this point the lungs were hyperinflated by increasing the positive endexpiratory pressure, and the chest was closed. The rats were placed on a heating pad. They were continuously monitored until they start moving in their cages. To avoid ventricular arrhythmias, lidocaine (2mg/kg i.m.) was given before surgery. The sham procedure consisted of opening the pericardium and placing a superficial suture in the epicardium of the LV. To prevent acute lung edema, the rats received furosemide 2 mg/kg twice daily for 3 days via the drinking water.

Before killing the animals 8 weeks after MI, non-invasive sequential nuclear magnetic resonance (NMR) measurements of heart geometric properties were done. Thereafter the animals were anesthetized with pentobarbitone (180 mg/kg i.p.) and subsequently heparinized (Heparin sodium 500 IU/100 g body weight i.p.). Once stable anesthesia was achieved (stage III 3, reflexes absent), the animals were connected to an artificial respirator via a PE tube inserted into the trachea and ventilated with room air. The right carotid artery was cannulated with a polyethylene catheter to monitor mean blood pressure, systolic blood pressure, diastolic blood pressure and heart rate over a stable time course of 10 min.

A transverse laparotomy and a right anterolateral thoracotomy were performed, and the heart was rapidly removed for the evaluation of its function in the working heart mode. Thereafter the heart weight, and the left and right ventricular weights were determined. For infarct size determination the left ventricle was sectioned transversely into four slices from the apex to the base. The infarct size was determined by planimetry and expressed as a percentage of LV mass. Lung weight and further lung histology sections were evaluated. Hydroxyproline/proline ratio was determined in paraffin-embedded slices of the left ventricle.

The animals were monitored by MRI at day 7 and day 42 post-MI. The rats were anesthetized with a mixture of 1% halothane and 30/70 N 2 O/oxygen with a specially manufactured rat mask. The fully anesthetized rats (phase III 3) were placed on a cradle made of Plexiglas in a supine position. Respiration and ECG were monitored continuously. MRI experiments were performed according to Rudin et al. (1991) . The images were acquired by a spinecho sequence SE (500/20), the field of view was 50 mm, the image resolution was 256 × 256 pixels with a dimension of 0.2 × 0.2 mm. Four adjacent transverse slices were recorded; slice thickness was 1.5 mm. Before the acquisition of data, a coronary pilot scan was measured for adequate positioning of the transverse slices. MRI data acquisition was gated to the cardiac cycle by a Physiograd SM 785 MR monitoring system (Bruker, Karlsruhe, Germany). Two sets of transverse images were acquired, one at end-systole and another at enddiastole. End-diastole was defined as the image obtained 8 ms after the onset of the R wave of the ECG, corresponding to the largest cavity area. End-systole was defined as the image with the smallest LV cavity area. The image analysis was done using Bruker software (Karlsruhe, Germany). The parameters of left ventricular end-diastolic volume (LVEDV), left ventricular end-systolic volume (LVESV), septum size, infarct size, ejection fraction (EF), left ventricular chamber diameter (r) and circumference were measured. EF was estimated in percentage terms by the subtraction LVEDV-LVESV. After the procedure the rats were ventilated with oxygen, the mask was replaced, and they were brought back into their cages. They were monitored until they started moving in the cage.

The animals were anesthetized with pentobarbitone (180 mg/kg i.p.) and subsequently heparinized (Heparin sodium 500 IU/100 g body weight i.p.). Once stable anesthesia was achieved, the animals were connected to an artificial respirator via a PE tube inserted into the trachea and ventilated with room air. The right carotid artery was cannulated with a polyethylene catheter. The catheter was connected to a PLUGSYS measuring system (Hugo Sachs Elektronik, March-Hugstedten, Germany) to monitor mean blood pressure, systolic blood pressure, diastolic blood pressure and heart rate over a stable time course of 10 min.

For the final investigations, the heart of the anesthetized rat was rapidly removed and immersed in physiological buffer chilled to 4°C. The aorta was dissected free and mounted onto a cannula (internal diameter: 1.4 mm) attached to a perfusion apparatus. The hearts were perfused according to the method of Langendorff with an oxygenated (95% O 2 /5% CO 2 ) noncirculating Krebs-Henseleit solution of the following compositions (mM): NaCl, 118; KCl, 4.7; CaCl 2 , 2.52; MgSO 4 , 1.64; NaHCO 3 , 24.88; KH 2 PO 4 , 1.18; glucose, 5.55; and Na-pyruvate, 2.0 at a perfusion pressure of 60 mmHg. Any connective tissue, thymus or lung was carefully removed. A catheter placed into the pulmonary artery drained the coronary effluent perfusate that was collected for the determination of coronary flow and venous pO 2 measurements. The left atrium was cannulated via an incision of the left auricle. All pulmonary veins were ligated close to the surface of the atria. When a tight seal with no leaks had been established and after a 15-min equilibration period, the hearts were switched into the working mode, using a filling pressure (preload) of 12 mmHg in WKY/NHsd and 18 mmHg in SH rats. The afterload pressure was 60 mmHg in WKY/NHsd and 80 mmHg in SH rats. After validation of the basis parameters the afterload pressure was enhanced in a cumulative manner from an additional 20 mmHg to 140 mmHg. Thereafter the isovolumetric maxima were determined by enhancing the preload pressure in steps of 5 mmHg to 30 mmHg. Flow and pressure signals for computation were obtained from the PLUGSYS-measuring system. Computation of data was performed with a sampling rate of 500 Hz, averaged every 2 s, using the software Aquire Plus V1.21f (PO-NE-MAH, Hugo Sachs Elektronik, March-Hugstedten, Germany).

After the evaluation of the external heart work, the total heart weight, the left and right ventricular weights were determined. The left ventricle was then sectioned transversely into four slices from the apex to the base. Eight pictures were taken of each rat heart, two from each slice. Total infarct size was determined by planimetry of the projected and magnified slices.

The area of infarcted tissue as well as the intact myocardium of each slice were added together and averaged. The infarcted fraction of the left ventricle was calculated from these measurements and expressed as a percentage of the LV mass. The left ventricular perimeter, diameter, infarct scar length, as well as wall thickness and infarct wall thinning were determined as well. According to and , rats with infarct sizes < 20% and > 40% were excluded from the study.

After lung weight determination, the organ was immersed in 4% formalin (pH 7.0-7.5; 0.1 M). The lung was cut into small pieces, dehydrated and embedded in paraffin. Hematoxylin and eosin (HE) sections were evaluated by light microscopy.

After embedding, the rest of the fixed left ventricular tissue was freeze-dried. Proline and hydroxyproline was then analyzed according to the method of López de León and Rojkind (1985) and the ratio of both were calculated.

The data are given as mean ± SEM. Statistics were performed using the SAS system statistics package (SAS Institute, Cary, N.C., USA) with a sequential rejection t-test. Jain et al. (2000) studied the effects of angiotensin II receptor blockade after coronary ligation and exercise training on treadmill in rats. Medvedev and Gorodetskaya (1993) induced heart failure in rats by microembolization of coronary vessels with 15-µm plastic microspheres. Katona et al. (2004) found that selective sensory denervation by capsaicin aggravates adriamycin-induced cardiomyopathy in rats.

A simple and rapid method of developing high output heart failure and cardiac hypertrophy in rats by producing aortacaval shunts was described by Garcia and Diebold (1990) . Rats weighing 180-200 g were anesthetized with 30 mg/kg i.p. pentobarbitone. The vena cava and the abdominal aorta were exposed by opening the abdominal cavity via a midline incision. The aorta was punctured at the union of the segment two-thirds caudal to the renal artery and one-third cephalic to the aortic bifurcation with an 18-gauge disposable needle. The needle was advanced into the aorta, perforating its adjacent wall and penetrating in the vena cava. A bulldog vascular clamp was placed across the aorta caudal to the left renal artery. Once the aorta was clamped, the needle was fully withdrawn and a drop of cyanoacrylate glue was used to seal the aorta-punctured point. The clamp was removed 30 s later. The patency of the shunt was verified visually by swelling vena cava and the mixing of arterial and venous blood. The peritoneal cavity was closed with silk thread stitches and the skin with metallic clips. Rats with aorta-caval shunts developed cardiac hypertrophy with significantly higher absolute and relative heart weights.

Other studies with aortocaval shunts in rats were published by Flaim et al. (1979) and Liu et al. (1991) . Isoyama et al. (1988) studied myocardial hypertrophy after creating aortic insufficiency in rats. Terlink et al. (1998) studied ventricular dysfunction in rats with diffuse isoproterenol-induced myocardial necrosis. described a model of chronic heart failure produced by multiple sequential coronary microembolizations in dogs. Rockman et al. (1991 Rockman et al. ( , 1993 developed a model of ventricular hypertrophy in the intact mouse by use of microsurgical techniques.

Eight-week-old adult mice weighing 18-22 g are anesthetized by intraperitoneal injection of a mixture of 100 mg/kg ketamine, 5 mg/kg xylazine, and 2.5 mg/kg morphine. Animals are placed under a dissecting microscope in the supine position and a midline cervical incision is made to expose the trachea and carotid arteries. After endotracheal intubation, the cannula is connected to a volume cycled rodent ventilator on supplemental oxygen with a tidal volume of 0.2 ml and a respiratory rate of 110 per min. Both left and right carotid arteries are cannulated with flame stretched PE50 tubing. Catheters are connected to modified P50 Statham transducers.

The chest cavity is entered in the second intercostal space at the left upper sternal border through a small incision and the thymus is gently deflected out of the field of view to expose the aortic arch. After the transverse aorta is isolated between the carotid arteries, it is constricted by a 7.0 nylon suture ligature against a 27-gauge needle, the latter being promptly removed to yield a constriction of 0.4 mm diameter and provide a reproducible transverse aortic constriction of 65-75%.

The hemodynamic effects of acute and chronic constriction are followed by monitoring the pressure gradient between the two carotid arteries in anesthetized animals. Systolic and mean arterial pressure at baseline, during total occlusion when the ligature is tied, and early (15 min) and late (7 days) after transverse aortic constriction are recorded. The increase in systolic pressure provides an adequate mechanical stimulus for the development of cardial hypertrophy.

To confirm myocardial hypertrophy, both shamoperated and aortic-constricted hearts are examined 7 days after operation. Hearts examined for cell size are perfused with 4% paraformaldehyde/1% glutaraldehyde through the apex, immersed in osmium tetroxide, dehydrated in graded alcohols, and embedded in araldite. Tissue blocks are sectioned at a thickness of 1 µm, mounted on slides, and stained with tolu-idine blue. Cell areas are measured by manually tracing the cell outline on an imaging system connected to a computer.

At the end of the experiment, mice were sacrificed in anesthesia, heart excised and weighed, the atria and ventricles separately frozen in liquid nitrogen for Northern blot analysis. Total RNA is extracted by a single step extraction with guanidinium thiocyanate. The RNA is size fractionated by agarose gel electrophoresis, transferred to nylon membranes by vacuum blotting, and hybridized with the appropriate complementary DNA probes labeled with 32 P by random priming to a specific activity of 0.95-1.2 × 10 6 cpm/ng.

Variables measured are expressed as mean ± SD. Statistical significance of differences between shamoperated and thoracic aortic-constricted animals is assessed by Student's t-test. Dom et al. (1994) studied myosin heavy chain regulation and myocytes' contractile depression after LV hypertrophy in aortic-banded mice. Okada et al. (2004) subjected mice to transverse aortic constriction. Echocardiographic analysis demonstrated cardiac hypertrophy and failure 1 and 4 weeks after surgery. Cardiac expression of endoplasmatic reticulum chaperones was significantly increased indicating that pressure overload by transverse aortic constriction induced prolonged endoplasmatic reticulum stress. Several authors reported the development of murine models of cardiac failure (Kaplan et al. 1994; Rockman et al. 1994; Balasubramaniam et al. 2004; Suzuki et al. 2004; Walther et al. 2004; Wang et al. 2004; Liao et al. 2005) . Xu et al. (2004) studied cardioprotection in mice with heart failure by dual inhibition of angiotensin converting enzyme (ACE) and neutral endopeptidase (NEP).

Mice with a targeted deletion of the B 2 kinin receptor gene or C57BL/6J mice at an age of 10-12 weeks were anesthetized with 50 mg/kg sodium pentobarbital i.p., intubated and ventilated with room air using a positive-pressure respirator. A left thoracotomy was performed via the fourth intercostal space; the lungs were retracted to expose the heart, and the pericardium was opened. The left anterior descending coronary artery was ligated with an 8-0 nylon suture near its origin between the pulmonary outflow tract and the edge of the left atrium. Acute myocardial ischemia was considered successful when the anterior wall of the left ventricle turned pale and an obvious ST segment elevation was observed. The lungs were inflated by increasing positive end-expiratory pressure and the thoracotomy site was closed. Sham-operated mice were subjected to the same procedure except that the suture around the left anterior coronary artery was not tied.

Systolic blood pressure was measured in conscious mice using a non-invasive computerized tail-cuff system. Cardiac geometry and function were evaluated with a Doppler echocardiographic system. LV diastolic dimension was measured and ejection fraction was calculated from [(LVAd -LVAs)/LVAd] × 100, where LVAd is LV diastolic area and LVAs is LV systolic area.

Four weeks after surgery, each strain was separated into one group treated with an ACE inhibitor, one group treated with a NEP inhibitor, one group treated with both inhibitors and one control group. All drugs were administered in drinking water for 20 weeks.

At the end of the study, all mice were anesthetized with pentobarbital and the heart stopped at diastole by intraventricular injection of 15% KCl. The heart, lungs, and liver were weighed to assess hypertrophy and congestion. Infarct size was determined by Gomori trichrome staining and expressed as the ration of the infarcted portion to total LV circumference.

Sections (6 µm) from each slice were doublestained with fluorescein-labeled peanut agglutinin to delineate the myocyte cross-sectional area and interstitial space and rhodamine-labeled Griffonia simplicifolia lectin I to show the capillaries. To calculate interstitial collagen fraction, the total surface area (microscopic field), interstitial space (collagen plus capillaries), and area occupied by capillaries alone were measured by computer-assisted videodensometry.

After 20 weeks of treatment, plasma renin was measured.

Data were expressed as mean ± SE. Mortality rates were compared using χ 2 tests. For the echo, blood pressure, heart weight, lung weight, infarct size, plasma renin concentration, and histology data, paired or two-sample tests using non-parametric methods were used to perform all comparisons of interest.

Congestive heart failure in man is characterized by cardiac hypertrophy, peripheral edema, lung and liver congestion, dyspnea, hydrothorax and ascites. Effective treatment is achieved by cardiac glycosides. Based on techniques reported by a method was developed to induce congestive heart failure in guinea pigs with symptoms very close to human pathology (Vogel and Marx 1964; Vogel et al. 1965 ).

Male guinea pigs weighing 250-400 g are used. The fur at the ventral thorax is shaved and the skin disin-fected. The animal is anesthetized with ether. The skin is cut with scissors on the left side at a length of 4 cm. The left musculus pectoralis is cut at the costal insertion and elevated. The forth intercostal space is opened with two blunted forceps. The heart is pressed against the opening with the left hand. The pericardium is opened with a fine forceps and pulled back to the basis of the heart. The beating heart is extruded from the thorax wound by pressure with the left hand on the right thorax wall. A ring-shaped clamp covered with a thin rubber tube is placed around the basis of the heart keeping the heart outside of the thorax without closing off the blood circulation. A thread soaked with diluted disinfectant solution is placed as a loop around the apex of the heart and tightened so that the apical third of both ventricles is tied off. The degree of tightening of the loop is essential. Complete interruption of blood supply to the apical third resulting in necrosis has to be avoided as well as the loop's slipping off. Technical skill is necessary to place the loop around the beating heart into the correct position. After removal of the clamp the heart is placed back, the incision between the forth and fifth costal rib closed and the musculus pectoralis placed over the wound. Intrathoracal air forming a pneumothorax is removed by pressure on both sides of the thorax. After application of an antibiotic emulsion the skin wound is closed. The surgical procedure has to be finished within a short period of time.

The animals develop symptoms of severe congestive heart failure with a death rate of 80% within 14 days. Lung weight and relative heart weight are significantly increased. Exudate in the thorax cavity and ascites amount between 3.5 and 7.5 ml with extreme values of 17.5 ml. Lung edema and liver congestion are found histologically. Peripheral edema and preterminal dyspnea and tachypnea are observed. When treated with various doses (0.1 to 100 µg/kg) of cardiac glycosides s.c. or i.m. over a period of 14 days the symptoms of cardiac insufficiency, e. g., volumes of transudate as well as death rate, are dose-dependent diminished.

From survival rate, ED 50 values of cardiac glycosides can be calculated which are in the same dosage range as therapeutic doses in man.

The experimental model in guinea pigs reflects very closely the symptoms of cardiac insufficiency in man, e. g., lung congestion, hydrothorax, liver congestion, ascites, peripheral edema and cardiac hypertrophy. The therapeutic potency of cardiac glycosides can be evaluated with this method. Additional factors being known to enhance the symptoms of congestive heart failure in man, like salt load and diphtheria toxin, further increase mortality and hydropic symptoms. The method can be used for special purposes, however, it needs considerable training and technical skill.

Cardiomyopathy in Syrian hamsters has been described by Bajusz et al. (1966) , Bajusz and Lossnitzer (1968) , Bajusz (1969) , Bajusz et al. (1969a, b) , Homburger and Bajusz (1970) , Gertz (1972) . The disease originates from an autosomal, recessively transmissible disorder, which leads to degenerative lesions in all striated muscles and in particular in the myocardium. Histopathological changes consist of myocytolytic necrosis followed by fibrosis and calcification. The evolution of the cardiomyopathic disease can be characterized by five distinct phases: A prenecrotic stage, in which no pathology is evident, a time of active myocytolysis and cellular necrosis, a phase of fibrosis and calcium deposition, an overlapping period of reactive hypertrophy of the remaining viable myocytes, and a final stage of depressed myocardial performance and failure.

The model of cardiomyopathy in Syrian hamsters has been used by several authors. One has to note, that several strains of cardiomyopathic hamsters have been used: strain Bio 53:58 by Capasso et al. (1989 Capasso et al. ( , 1990 and by Chemla et al. (1992 Chemla et al. ( , 1993 , strain BIO 14.6 by Tapp et al. (1989) and by Sen et al. (1990) , strain CHF 146 CM by van Meel et al. (1989) and by Haleen et al. (1991) , strain BIO82.62 by ver Donck et al. (1991) , strain J-2-N by Kato et al. (1992) , strain CHF 147 by Desjardins et al. (1989) , Hanton et al. (1993) .

Various experimental protocols have been described. Most authors use survival rate and heart weight as end point (e. g., van Meel et al. 1989; ver Donck et al. 1991; Hanton et al. 1993) . Generally, the experiments are started with animals at an age of 120 to 200 days. Capasso et al. (1989 Capasso et al. ( , 1990 ) studied the mechanical and electrical properties of cardiomyopathic hearts of Syrian hamsters using isolated left ventricular posterior papillary muscles. Tapp et al. (1989) tested stress-induced mortality in cardiomyopathic hamsters by five consecutive daily 2h periods supine immobilizations at 4°C. Sen et al. (1990) tested the inotropic and calcium kinetic effects of calcium channel agonists and antagonists in primary cultures of isolated cardiac myocytes. Haleen et al. (1991) tested the effects of an angiotensin converting enzyme inhibitor not only on survival, but also on left ventricular failure in the isolated Langendorff heart by measurement of left ventricular end-diastolic pressure, dP/dt max and mean coronary flow. Dixon et al. (1997) tested the effect of an AT 1 receptor antagonist on cardiac collagen remodelling in the cardiomyopathic Syrian hamster.

In addition to the effects on left ventricular papillary muscles strips, Chemla et al. (1992) tested the effects on diaphragm contractility in the cardiomyopathic Syrian hamster. Whitmer et al. (1988) and Kuo et al. (1992) tested sarcolemmal and sarcoplasmatic reticulum calcium transport in the cardiomyopathic Syrian hamster. Nigro et al. (1997) identified the Syrian hamster cardiomyopathy gene. Tanguay et al. (1997) tested the coronary and cardiac sensitivity to a vasoselective benzothiazepine-like calcium antagonist in isolated, perfused failing hearts of Syrian hamsters. Bilate et al. (2003) recommended the Syrian hamster as a model for the dilated cardiomyopathy of Chagas' disease. Female hamsters were infected via the intraperitoneal route with Trypanosoma cruzi Y strain blood trypomastigotes. Survival was monitored, echocardiography was performed after 4 and 12 months, and histopathological examinations were carried out at the end of the study period.

Positive effects of various drugs have been found in the cardiomyopathic hamster, such as cardiac glycosides, inotropic compounds, beta-blockers, calcium antago-nists, and ACE-inhibitors. The specificity of the effects has to be challenged.

The tight-skin (TSK) mouse is a genetic model of pulmonary emphysema connected with right ventricular hypertrophy Gardi et al. 1994) . into the right ventricle under pressure guidance. A transvenous screw-in pacemaker lead (Medtronic) was advanced through the catheter into the ventricular apex and implanted endocardially. The pacemaker was implanted subcutaneously into the right abdominal wall and the pacemaker lead was connected subcutaneously with the pacemaker. Rapid ventricular pacinginduced heart failure could be induced with a transvenously implanted pacemaker system. All rabbits were allowed to recover for at least 10 days after surgery before the pacemaker was started for the induction of heart failure. Proper pacemaker function was checked intraoperatively, at the time of programming, and subsequently all 10 days.

Rabbits (CHF group) underwent pacing with a stepwise increase of stimulation frequencies over 30 days. During the first 10 days, animals were paced at 330 beats/min (bpm). This protocol results in ELVD, as defined by significant LV systolic dysfunction with cardiac enlargement and decreased perfusion pressure but no clinical signs failure The pacing rate was then increased to 360 bpm for 10 days and 380 bpm for another 10 days and ELVD evolved to CHF with further cardiac enlargement and further decreased perfusion pressure together with clinical signs of fluid retention (ascites). At baseline (control), after being paced at 330 bpm for 10 days (ELVD) and at the end of the protocol (CHF), conscious arterial pressure was measured invasively via the medial ear artery and a 2-D guided M-mode echocardiogram was obtained. At the end of the pacing protocol, rabbits were killed by i.v. euthanasia and tissue was rapidly harvested. Hearts were trimmed on ice, snap frozen in liquid nitrogen and stored at -80 o C until further processing.

Echocardiography A long and short-axis echocardiogram (HP Sonos 5500, 12 MHz probe) was performed under light sedation (5 mg midazolam i.m.) in a supine position from the left parasternal window. LV end-diastolic (LVEDd) and end-systolic (LVESd) dimensions and diastolic and systolic thickness of the left ventricular anterior wall (AEDth and AESth) and posterior wall (PEDth and PESth) as well as left atrial diameter (LAd) were determined from three repeated 2-D guided M-mode tracings using the ASE convention. From those measurements, fractional shortening (FS) was calculated as: FS = (LVEDd-LVESd) /LVEDd.

Analytical methods For analysis of cardiac natriuretic peptide expression, mRNA was extracted from all atrial and left ventricular samples utilizing a commercial kit (Fasttrack, Invitrogen).

As a probe for brain natriuretic peptide (BNP), a 750-bp EcoR1/HindIII DNA restriction fragment containing the gene for rabbit BNP was used.

Results of the quantitative studies were expressed as mean ± SEM. Comparisons between the control, ELVD and CHF groups were performed by analysis of variance (ANOVA) followed by Fisher's least significant difference test. Comparison between the atrial and LV tissues as well as between atrial natriuretic peptide (ANP) and BNP were performed by paired Student's t-test. Statistical significance was defined as P < 0.05. Arnolda et al. (1985) studied adriamycin cardiomyopathy in the rabbit. Klimtova et al. (2002) performed a comparative study of chronic toxic effects of daunorubicin and doxorubicin in rabbits. Alexander et al. (1993) studied electrographic changes following corona-virus-induced myocarditis and dilated cardiomyopathy in rabbits. described a transgenic model for human troponin I-based hypertrophic cardiomyopathy in the rabbit. excretion and no clinical signs of heart failure. The pacing rate was then increased weekly to 200, 210, 220 and 240 bpm, and early left ventricular dysfunction evolved to overt congestive heart failure with avid sodium retention and clinical signs of congestion. At baseline (control), after dogs had been paced at 180 bpm for 10 days and at the end of the protocol (overt CHF), urine was collected for measurement of sodium excretion; conscious mean arterial pressure was measured via a port catheter; a 2-D guided Mmode echogram was obtained; and arterial blood was drawn. Cardiac filling pressures and cardiac output were measured by the thermodilution method at baseline and at the end of the protocol. Arterial blood was collected in EDTA tubes for measurement of ANP, BNP, cGMP, PRA, aldosterone, and Ang II. After euthanasia, hearts were rapidly trimmed and left ventricles weighted for calculation of the index LV weight to body weight.

Results were expressed as mean ± SE. Comparison between the control, early LV dysfunction, and overt CHF were performed by ANOVA followed by Fisher's least significant difference test. Kleaveland et al. (1988) and Nagatsu et al. (1994) used the technique of experimental mitral regurgitation in dogs to induce left ventricular dysfunction. A 30-cm, 7F sheath was introduced across the aortic valve through the carotid artery. A urologic calculus retrieval forceps was advanced through the sheath to the mitral valve apparatus and was used to sever chordae tendineae. When pulmonary capillary wedge pressure rose to 20 mmHg and forward stroke volume was reduced to 50% of its baseline, a ventriculogram was performed to confirm angiographically that severe mitral regurgitation had been created.

Dell 'Italia et al. (1995) and Su et al. (1999) induced mitral regurgitation by percutaneous chordal rupture in dogs. Kinney et al. (1991) published a method to induce acute, reversible tricuspid insufficiency in anesthetized dogs. A wire spiral is advanced through the atrioventricular canal from the right atrium. The spiral causes regurgitation by preventing complete apposition of the valve leaflets while permitting retrograde flow to occur through the spiral lumen. The degree of regurgitation can be controlled by the use of spirals of different size. Creation of tricuspid insufficiency was demonstrated by onset of right atrial pressure V waves, a ballooning of the right atrium during ventricular systole, palpation of an atrial thrill, or by color Doppler echocardiography. The model is reversible and allows repeated trials of various grades of regurgitation. Carlyle and Cohn (1983) described a non-chirurgical model of chronic left ventricular dysfunction. The method is accomplished by repetitive DC shock with a guidewire introduced percutaneously and positioned in the left ventricle along the intraventricular septum and an external paddle at the left ventricular apex. produced localized left ventricular necrosis without obstruction of the coronary blood flow in dogs by transmyocardial direct-current shock. Sabbah et al. ( , 1993 Sabbah et al. ( , 1994 and Gengo et al. (1992) produced chronic heart failure in dogs by multiple sequential intracoronary embolizations with microspheres. The dogs underwent three to nine intracoronary embolizations with polystyrene latex microspheres (70-102 µm in diameter) performed 1-3 weeks apart. Embolizations were discontinued when left ventricular ejection fraction was less than 35%. used multiple coronary microembolizations in dogs, whereby three to nine embolizations were performed 1 week apart. The first three embolizations consisted of 2 ml of microsphere suspension injected subselectively into either the left anterior descending or left circumflex coronary artery in an alternating fashion. Subsequent embolizations consisted of 3-6 ml of microspheres divided equally between the left anterior descending or left circumflex coronary artery until LV ejection fraction was < 35%. Magovern et al. (1992) described a canine model of left ventricular dysfunction caused by five weekly intracoronary infusions of adriamycin. Koide (1997) described premorbid determinants of left ventricular dysfunction in a model of gradually induced pressure overload in dogs. Mongrel dogs were studied through 8 weeks of gradually imposed ascending aortic constriction with the use of a novel banding technique. During banding, an initial gradient of 30 mmHg was created. Before banding, at 2, 4, and 6 weeks after banding, hemodynamics and left ventricular mechanics were examined at cardiac catheterization; then the pressure overload was increased by tightening the band. Valentine et al. (1988) and Devaux et al. (1993) described X-linked muscular dystrophy in dogs with cardiac insufficiency similar to Duchenne muscular dystrophy in men and recommended this as an animal model for cardiac insufficiency. Cardiac failure was studied in pigs using several experimental procedures. Chow et al. (1990) recommended rapid ventricular pacing in pigs as an experimental model of congestive heart failure. Farrar et al. (1993) studied pacing-induced dilated cardiomyopathy in pigs. Congestive heart failure was produced by rapid ventricular pacing at 230 bpm for 1 week. Spinale et al. (1990a Spinale et al. ( , 1990b Spinale et al. ( , 1991 Spinale et al. ( , 1992 ) examined the consequences of chronic supraventricular tachycardia on various parameters of ventricular dysfunction and subendocardial changes in pigs. Carroll et al. (1995) investigated gene expression in a swine model of ventricular hypertrophy during pressure overload. Multani et al. (2001) studied long-term angiotensin converting enzyme and angiotensin I-receptor inhibition in pacing-induced heart failure in pigs. Heart failure was induced by rapid atrial pacing (240 bpm for 3 weeks). Kassab et al. (1993 Kassab et al. ( , 2000 investigated remodeling of right ventricular branches after hypertrophy in pigs. Krombach et al. (1999) studied the effects of amlodipine in congestive heart failure in pigs at rest and after treadmill exercise.

Left thoracotomy was performed in Yorkshire pigs in anesthesia. Catheters connected to a vascular access port were placed in the thoracic aorta, the pulmonary artery, and the left atrium. The access ports were then placed in a subcutaneous pocket. A 20-mm flow probe was placed around the pulmonary artery immediately distal to the pulmonary catheter and the electrical connection exteriorized through the thoracolumbar fascia. A shielded stimulating electrode was sutured onto the left atrium, connected to a programmable pacemaker and buried in a subcutaneous pocket. The thoracotomy was closed in layers and the pleural space evacuated of air. After a 14-to 21-day recovery, measurements were performed under normal resting conditions and after exercise. The pacemakers were activated to 240 bpm for a period of 21 days. During the last 3 days, one group was treated with drug, the other served as control. At the day of the study, electrocardiograms were performed, and the pacemakers deactivated. After a 30-min stabilization period, 2-D and M-mode echocardiographic studies were used to image the left ventricle from the parasternal approach. Left ventricular fractional shortening was calculated as (end-diastolic dimension -end-systolic dimension)/diastolic dimension, and was expressed as a percentage. The access ports were entered and pressures obtained using externally calibrated transducers. The flow probe was connected to a digital flowmeter. From the digitized flow signal, stroke volume was computed on a beat-to-beat basis and averaged for a minimum of 25 ejections. Pulmonary and systemic vascular resistances were computed as the mean pressure divided by cardiac output multiplied by the constant 80 to convert to resistance units of dyne· s·cm −5 . Samples were drawn from the pulmonary artery and atrial catheters for measurement of oxygen saturation and hemoglobin content. The plasma samples were assayed for renin activity, endothelin concentration, and catecholamine levels.

Results were presented as mean ± SEM. Pairwise tests of individual group means were compared using Bonferroni probabilities. Zhang et al. (1996) studied functional and bioenergetic consequences of post-infarction left remodeling in a porcine model. Proximal left coronary artery occlusion was used to generate a myocardial infarction in young pigs. The animals were then followed over sev-eral months while remodeling of the left ventricle developed. Left ventricular wall thickness, ejection fraction, and wall stress were measured by MRI. Myocardial ATP, creatine phosphate, and inorganic phosphate levels were measured by spatially localized 31 P-NMR spectroscopy, and regional myocardial blood flow was measured with radioactive microspheres.

All MRI studies were performed on the standard Siemens Medical System VISION operating at 1.5 T. The animals were anesthetized with sodium pentobarbital. A catheter was placed into the femoral artery and advanced into the LV chamber for LV pressure recording. Animals then were placed on their left side in a Helmholtz coil with a diameter of 18 cm, which was used to improve signal to noise. To compute LV wall stress, the image acquisition was triggered by the LV pressure through the fluid-filled LV catheter. All of the imaging sequences were synchronized to the LV pressure trace. The electronic LV pressure signal was recorded and fed to a comparator set to a threshold level of 10% of the upslope of the LV pressure curve at the beginning of systole. The signal from the comparator was sent to a pulse former and then fed to the ECG port of the magnetic resonance system, where it was treated like the standard electrographic input to run the pulse sequences. Scout images were taken in the axial plane with a single-shot, ultrafast gradient echo sequence Wilke et al. 1993; Geiger et al. 1995) . From the axial image, both horizontal and vertical long-axis images were obtained. By alternating back and forth several times, a true vertical long axis of the left ventricle was obtained. From the long-axis scout image, short-axis segmented cine turboflash slices were prescribed to cover the myocardium from apex to base. The doubleoblique, short-axis turboflash images cover the heart from apex to base with a slice thickness of 10 mm, with no interslice gap.

The parameters of the segmented cine sequence were TR/TE/flip angle = 33 ms/6.1 ms/25 degrees with an FOV = 17.5 cm and a matrix of 87 × 128 (pixel size, 2 mm × 1.4 mm) and slice thickness of 7-10 mm (Atkinson et al. 1991) . The sequence used segmented k-space acquisition such that three phase-encoded lines were gathered per cardiac phase per heartbeat. Total image acquisition required approximately 52 heartbeats for each slice location. The temporal im-age resolution (data acquisition window) of this sequence was 33 ms per cardiac image. Each myocardial level took < 1.5 min to acquire, since two acquisitions were used and the average heart rate of the animals was 120 bpm. The average number of short-axis slices needed to image the entire myocardium from apex to base was six to eight. This 10-min protocol provided high signal-to-noise cine sequences covering the entire heart.

To obtain high-resolution anatomic heart images, multislice, single-phase spin-echo images trigged in the systolic phase were acquired to cover the entire heart. These images permitted the precise delineation of the extent of the scar region of the heart. Images were taken with a slice thickness of 5 mm and a FOV of 17.5 cm, resulting in a true spatial resolution of 2 mm × 1.4 mm pixel size. The TR for this sequence equals the RR interval (500 ms) and the echo time TE was set to 30 ms. Total measurement time for an average of 10-14 slices was 5 min.

The imaging data were archived to optical disk and copied to a SUN SPARC 10 workstation for evaluation with the use of an automatic segmentation program (ImageView, Siemens Cooperate Research). The program is based on robust deformable models of endocardial and epicardial border segmentation of ventricular boundaries in cardiac magnetic resonance images. This segmentation technique has been combined with a user interface that allows one to load, sort, visualize, and analyze a cardiac study in < 20 min. The segmentation algorithm is based on the steepest descent as well as dynamic programming strategies integrated via multiscale analysis for minimizing the energy function of the resulting contour. The ventricular boundaries are used to construct a three-dimensional model for visualization and to compute hemodynamic parameters. Automatic segmentation of endocardial and epicardial boundaries was performed for calculation of ventricular volumes, EF, LV diastolic and systolic volumes, and absolute myocardial mass from multislice, multiphase magnetic resonance cine images. Starting with a user-specified approximate boundary or an interior point of the ventricle for one starting image in one slice, the algorithm generated automatic contours corresponding to the epicardium and the endocardium and automatically propagated them to other slices in the cardiac phase (spatial propagation) and to other phases for a given slice location (temporal propagation) of the cardiac study. The observer then could make some manual corrections to the six or seven pairs of contours in the first column of the temporal-spatial matrix. Manual modifications generally were made on the apex and base levels.

Mean LV wall thickness for each short-axis ring was averaged from three measurements of the remote zone (anterior wall and septum wall). The thickness of the scar was averaged from three measurements of the scar area. LVSA measurement in each slice was computed by subtracting the total area enclosed by the endocardium from that enclosed by the subepicardium; the resultant area was multiplied by the slice thickness to obtain the volume of each slice; the total LV mass volume was calculated by adding up the volumes of all the short-axis slices. The total LVSA was obtained by dividing the total LV wall mass volume by the mean of LV wall thickness of each slice. Similarly, the LVSSA was obtained by dividing the total scar volume, which was the sum of the scar volume of each short axis, by the mean of the scar thickness of each short axis. LV mass was computed by the total LV wall mass volume multiplied by 1.05 (specific gravity of myocardium) to calculate the LV mass. The LV enddiastolic volume (V d ) and end-systolic volume (V s ) of each slice were represented by the area enclosed by the endocardium. The total LV volume was computed by adding the volumes of all slices. LVEF was calculated by 100 × (V-V s )/V d %. Interobserver and intraobserver errors for the calculations of LV mass and LV volumes have been shown to be < 3 mg and 3 ml, respectively (McDonald et al. 1994) . Meridional wall stress was computed from the LV pressure and simultaneously obtained short-axis view of LV MRI (LV cavity diameter and average thickness the remote LV wall) as described by Grossman et al. (1975) .

Measurements were performed in a 40-cm-bore, 4.7-T magnet interfaced with a SISCO (Spectroscopy Imaging Systems Corporation) console. The LV pressure signal was used to gate NMR data acquisition to the cardiac cycle, while respiratory gating was achieved by triggering the ventilator to the cardiac cycle between data acquisitions (Robitaille et al. 1990 ). 31 Pand 1 H-NMR frequencies were 81 and 200.1 MHz, respectively. Spectra were recorded in late diastole with a pulse repetition time of 6-7 s. This repetition time allowed full relaxation for ATP and P i resonances and ≈90% relaxation for the CP resonance (Zhang and McDonald 1995) . CP resonance intensities were corrected for this minor saturation; the correction factor was determined for each heart from two spectra recorded consecutively without transmural differentiation, one with 15-s repetition time to allow full relaxation and the other with the 6-to 7-s repetition time used in all the other measurements.

Radiofrequency transmission and signal detection were performed with a 25-mm-diameter surface coil. The coil was cemented to a sheet of silicone rubber 0.7 mm in thickness and ≈50% larger in diameter than the coil itself. A capillary containing 15 µl of 3 M phosphonoacetic acid was placed at the coil center to serve as a reference. The proton signal from water detected with the surface coil was used to homogenize the magnetic field and to adjust the position of the animal in the magnet so that the coil was at or near the magnet and gradient isocenters. This was accomplished with a spin-echo experiment and a readout gradient. The information gathered in this step also was used to determine the spatial coordinates for spectroscopic localization. Chemical shifts were measured relative to CP, which was assigned a chemical shift of -2.55 ppm relative to 85% phosphoric acid at 0 ppm. Spatial localization across the LV wall was performed with the RAPP-ISIS/FSW method (Hendrich et al. 1991) . Signal origin was restricted with the use of B 0 gradients and adiabatic inversion pulses to a column coaxial with the surface coil perpendicular to the LV wall. The column dimensions were 17 × 17 mm. Within this column, the signal was further localized using the B 1 gradient to five voxels centered about 45°, 60°, 90°, 120°, and 135°spin rotation increments. FSW localization used a nine-term Fourier series expansion. The Fourier coefficients, the number of free induction decays acquired for each term in the Fourier expansion, and the multiplication factors used to construct the voxels have been reported previously. The position of the voxels relative to the coil was set using the B 1 magnitude at the coil center, which was experimentally determined in each case by measurement of the 90°pulse length for the phosphonoacetic acid reference located in the coil center. Each set of spatially localized transmural spectra were acquired in 10 min. A total of 96 scans was accumulated within each 10min block.

Resonance intensities were quantified with the use of integration routines provided by the SISCO software. ATPγ resonance was used for ATP determination. Since data were acquired with the transmitter fre-quency being positioned between the ATPγ and CP resonance, the off-resonance effects on these peaks were negligible. The numeric values for CP and ATP in each voxel were expressed as ratios of CP/ATP. P i levels were measured as changes from baseline values ( P i ) with the use of integrals obtained in the region covering the P i resonance.

Various methods have been used to induce cardiac failure in sheep: pressure overload after aortic banding (Aoyagi et al. 1993; Charles et al. 1996) , volume loading after myocardial infarction (Charles et al. 2003) , rapid ventricular pacing (Rademaker 1997 (Rademaker , 2002b (Rademaker , 2005 Byrne et al. 2002; Moreno et al. 2005) , coronary microembolization Monreal et al. 2004) . Rademaker et al. (2002a) studied combined angiotensin converting enzyme inhibition and adrenomedullin in an ovine model of heart failure induced by rapid ventricular pacing.

Coopworth ewes (38 ± 47 kg) were instrumented via a left lateral thoracotomy. Under general anesthesia (induced by 17 mg/kg thiopentone; maintained with halothane/nitrous oxide), two polyvinyl chloride catheters were inserted in the left atrium for blood sampling and left atrial pressure (LAP) determination; a Konigsberg pressure-tip transducer was inserted in the aorta to record mean arterial pressure (MAP); an electromagnetic flow probe was placed around the ascending aorta to measure cardiac output (CO); a 7 French Swan-Ganz catheter was inserted in the pulmonary artery for infusions; and a 7 French Hisbundle electrode was stitched subepicardially to the wall of the left ventricle for left ventricular pacing. All leads were externalized through incisions in the back. A bladder catheter was inserted per urethra for urine collections.

The animals were allowed to recover for 14 days before commencing the study protocol. During the experiments, the animals were held in metabolic cages, had free access to water and ate a diet of chaff and sheep pellets (containing 40 mmol/day sodium and 200 mmol/day potassium). A further 40 mmol of sodium was administered orally daily as NaCl tablets using an applicator.

Heart failure was induced by 7 days of rapid left ventricular pacing (225 bpm) [15] and maintained by continuous pacing for the duration of the study. On four separate days with a rest day between each, the sheep received, in random order, a vehicle control (Haemaccel), human adrenomedullin alone (50 ng/min per kg infusion for 3 h), an ACE inhibitor alone (captopril: 25 mg bolus + 2 mg/h infusion for 3 h), and both agents combined. Infusions were administered in a total volume of 60 ml via the pulmonary artery catheter, commencing at 10:00 hours.

Mean arterial pressure, left atrial pressure, cardiac output and calculated total peripheral resistance (CTPR = mean arterial pressure/cardiac output) were recorded at 15-min intervals in the 1-h prior to infusion (baseline), and at 15, 30, 45, 60, 90, 120 and 180 min during both the 3-h infusion and postinfusion periods. Hemodynamic measurements were determined by on-line computer-assisted analysis.

Blood samples were drawn from the left atrium at 30 min and immediately pre-infusion (baseline), and at 30, 60, 120 and 180 min during the 3-h infusion and post-infusion periods. Samples were taken into tubes on ice, centrifuged at 3939 g for 10 min at 4°C and stored at either -20°C or -80°C before assay for immunoreactive (ir-) adrenomedullin, cAMP, plasma renin activity, angiotensin II, aldosterone, atrial natriuretic peptide, brain natriuretic peptide, endothelin-1, catecholamines and cortisol.

All samples from individual animals were measured in the same assay to avoid inter-assay variability. Plasma electrolytes and hematocrit were measured in every sample taken. Urine volume and samples for the measurement of urine cAMP, sodium, potassium and creatinine excretion were collected every 1 h. Creatinine clearance was calculated as urine creatinine/plasma creatinine.

Results are expressed as mean ± SEM. Baseline hemodynamic and hormone values represent the means of the four and two measurements respectively made in the 1 h immediately pre-infusion. Statistical analysis was performed by repeated-measures ANOVA. Baseline data from all treatments were compared. Treatment-and time-related differences between all four study limbs were determined using a twoway ANOVA (treatment-time interactions are quoted in the text). Statistical significance was assumed when P < 0.05

After hemodynamic stability was ensured and baseline data were recorded, intravenous dobutamine was infused at 5-min intervals at upwardly titrated rates of 2.5, 5.0, 7.5, and 10.0 µg·kg −1 ·min −1 to examine the effects of β 1 -adrenergic stimulation. The dose range of catecholamine for these studies was chosen to alter inotropic and lusitropic states without causing an untoward increase in heart rate. Steady-state hemodynamic measurements were made during minutes 4 and 5 of each infusion period. At each level, the pacemaker was briefly turned off to determine the effect of dobutamine on the heart rate.

Four of the animals in this group were studied with incremental pacing both before and after β-adrenergic blockade with esmolol (0.3 mg·kg −1 ·min −1 i.v.V). The pacing protocol and the results from a larger group of animals studied before β-adrenergic blockade were detailed in a previous report. Briefly, atrial pacing was instituted at a rate above the intrinsic heart rate to avoid competing rhythms and was increased at 0.2-Hz increments until the critical heart rate was achieved. The critical heart rate was defined as the rate at which dP/dt max and τ reached a maximum and minimum, respectively, during progressive increases in heart rate. We showed previously that hyperthyroidism significantly increases the critical heart rates for both dP/dt max and τ .

The EC 50 of dobutamine for LV dP/dt max was determined by fitting log(dose)-transformed data to a sigmoidal relation with software from Graph Pad.

Additional animals were chronically instrumented so that we could examine the effects of β 2 -adrenergic stimulation. One animal died suddenly after receiving thyroid hormone for 20 days. In the remaining three animals, the β 2 -adrenergic agonist terbutaline was infused both before and after production of the hyperthyroid state. Incremental doses of terbutaline (15 min/dose) were infused over a dosing range of 25 to 300 ng·kg −1 ·min −1 .

Thyroid function tests were performed before the baseline experiment in the euthyroid state and before the terminal experiment (within 24 h of the last dose of T 4 ) in the hyperthyroid state. T 3 radioimmunoassay, T 4 , and free T 4 levels were measured at each state.

Paired mean data were compared by Student's t-test. The effects of thyroid status, catecholamine dose, and β-blockade on hemodynamic and dimension variables were examined with repeated-measures ANOVA (Su-perAnova, Abacus Concepts) . When significant differences were found, group means were compared with contrasts. A value of P < 0.05 was considered significant. Unless specified, data are expressed as mean ± SD.

Various species have been used to study experimental cardiac failure. Breisch et al. (1984) studied the effects of pressureoverload hypertrophy in the left myocardium of young adult cats. Hypertrophy was induced by a 90% constriction of the ascending aorta. Genao et al. (1996) recommended dilated cardiomyopathy in turkeys as an animal model for the study of human heart failure. Do et al. (1997) studied energy metabolism in normal and hypertrophied right ventricle of the ferret heart. Wang et al. (1994) studied Ca 2+ handling and myofibrillar Ca 2+ sensitivity in ferret cardiac myocytes with pressure-overload hypertrophy.

Bovine hereditary cardiomyopathy was recommended as an animal model of human dilated cardiomyopathy by Eschenhagen et al. (1995) . Kojima et al. (1994) , Komuro et al. (1990 Komuro et al. ( , 1991 Komuro et al. ( , 1993 , Yamazaki et al. (1993 Yamazaki et al. ( , 1994 Yamazaki et al. ( , 1996 described a method to induce hypertrophy of cardiomyocytes by mechanical stress in vitro.

Primary cultures from cardiomyocytes are prepared from ventricles of 1-day-old neonatal Wistar Kyoto rats. According to the method of Simpson and Savion (1982) , the cultures are treated for 3 days with 0.1 mM bromodeoxyuridine to suppress proliferation of nonmyocardial cells. Elastic culture dishes (2 × 4 × 1 cm) are made by vulcanizing liquid silicone rubber consisting of methylvinyl polysiloxane and dimethyl hydrogen silicone resin using platinum as a catalyst. The bottom of the disc is 1-mm thick, and it is highly transparent because of no inorganic filler in either component. Cells are plated in a field density of 1 × 10 5 cells/cm 2 in culture medium consisting of Dulbecco's modified Eagle's medium with 10% fetal bovine serum. Mechanical stress on cardiac cells is applied by gently pulling and hanging the dish on pegs. A 10% change in length of the dish results in an almost identical change in the length of the cell along a single axis (Kimuro et al. 1990 ). Cardiocytes are stretched by 5%, 10%, or 20%. Drugs, e. g., an angiotensin-II receptor antagonist, are added 30 min before stretch.

For protein analysis, the silicone dishes are stretched for 24 h after 2 days of serum starvation and [ 3 H]phenylalanine (1 µCi/ml) is added for 60 min. At the end of each stress, the cells are rapidly rinsed four times with ice-cold phosphate-buffered saline and incubated for 20 min on ice with 1 ml of 5% trichloroacetic acid. The total trichloroacetic acidinsoluble radioactivity in each dish is determined by liquid scintillation counting.

For determination of mitogen-activated protein kinase, cardiomyocytes are lysed on ice and centrifuged. Aliquots of the supernatants of myocyte extracts are incubated in kinase buffer (25 mM/l Tris-HCl, pH 7.4, 10 mM/l MgCl 2 , 1 mM/l dithiothreitol, 40 µM/l APT, 2 µCi [γ -32 P]ATP, 2 µM/l protein kinase inhibitor peptide, and 0.5 mM/l EGTA) and substrates (25 µg myelin basic protein). The reaction is stopped by adding stopping solution containing 0.6% HCl, 1 mM/l ATP, and 1% bovine serum albumin. Aliquots of the supernatant are spotted on P81 paper (Whatman), washed in 0.5% phosphoric acid, dried and counted.

For determination ofc-fos mRNA, Northern blot analysis is performed.

Values are expressed as mean ± SEM. Comparisons between groups are made by one-way ANOVA followed by Dunnett's modified t-test.

The interesting approach to induce hypertrophy of cardiac cells in vitro has been used predominantly by one research group. Confirmation by other research groups including modifications of the mechanical procedures seems to be necessary. Komuro Biological standardization of cardiac glycosides was necessary as long as the drugs used in therapy were plant extracts or mixtures of various glycosides. They were standardized in units of an international standard. Some of the pharmacological methods used for these purposes and adopted by many pharmacopoeias have nowadays historical interest only. This holds true for the frog method and the pigeon method (Burn et al. 1950 ). Particularly, the frog method was used for standardization. The method adopted by the U.S Pharmacopoeia X was the 1 h test. Healthy frogs (Rana pipiens) weighing 20-30 g were selected from the cold storage room. One hour before assay, their weight was recorded and they were placed in wire cages with a water depth of 1 cm. The doses of digitalis were calculated so that they approximated 0.015 ml/g body weight. Injections were made into the ventral lymph sac. One hour later, the animals were pithed and the heart removed and examined. Systolic arrest of the ventricle and widely dilated atrium indicated the typical result. Calculations of activity in terms of International Units were made from the percentage of dead animals in the test group versus those in the group receiving the international standard.

The pigeon method introduced by Hanzlik (1929) and adopted by USP XVII depends on the observation that intravenously injected cardiac glycosides have an emetic action in pigeons. In the original test, adult pi-geons weighing 300-400 g are injected with a solution of the cardiac glycoside into a suitable wing vein in the axillary region. Vomiting occurring within 15 min is regarded as positive result. Two doses of test solution and standard are injected and percentage of vomiting pigeons registered. This 4 point assay allows calculation of ED 50 values and of the potency ratio compared with the standard.

Modifications of other methods, such as the cat method introduced by and described in detail by Lind van Wijngarden (1926) , the guinea pig method described by and the isolated cat papillary muscle method introduced by Catell and Gold (1938) still being used for evaluation of synthetic cardioglycosides and other positive inotropic compounds are referenced in detail below.

Surveys on the evaluation of cardiac glycosides have been given by Bahrmann and Greef (1981) , for the use of the isolated papillary muscle by and for other isolated heart preparations by . Moreover, the influence on Na + /K + -ATPase, an in vitro model specific for cardiac glycosides (Gundert-Remy and Weber 1981), is described.

The mechanisms of action have been reviewed by Scholz (1984) and Grupp (1987) .

Analogous to antiarrhythmic agents, Feldmann (1993) proposed a classification system that categorizes inotropic agents according to their supposed mode of action:

Class I: Inotropic agents that increase intracellular cyloAMP, including β-adrenergic agonists and phosphodiesterase inhibitors, Class II: Inotropic agents affecting sarcolemmal ion pumps and channels, in particular cardiac glycosides inhibiting Na + /K + -ATPase, Class III: Agents that modulate intracellular calcium mechanisms (no therapeutic inotropic agents in this kind yet available), Class IV: Inotropic agents having multiple mechanisms of action bound enzyme couples ATP hydrolysis to the translocation of Na + and K + ions across the plasma membrane through a series of conformational transitions between the E 1 and E 2 states of the enzyme. The enzyme is a heterodimer consisting of a catalytic subunit (110 kDa) associated with a glycosylated β subunit (55 kDa). Three alpha (α 1 , α 2 , α 3 ) subunits have been identified by cDNA cloning. In the heart, enzyme Na + /K + ATPase is the target of the positive inotropic glycosides. Therefore, it is of interest for the characterization of positive inotropic compounds. The test is based on the determination of phosphate generated from ATP under special conditions. Inhibition of bovine cerebral Na + /K + ATPase prepared according to Schoner et al. (1967) is measured after addition of various concentrations of the test compound compared with those of the standard ).

1.00 ml 133 mM imidazole pH 7.3 0.04 ml 160 mM MgCl 2 0.02 ml DPNH (10 mg/ml) 0.04 ml 310 mM NH 4 Cl 0.04 ml 100 mM ATP 0.02 ml 40 mM phosphoenol-pyruvate 0.05 ml pyruvate-kinase (1 mg/ml = 150 U/ml) 0.04 ml lactate-dehydrogenase (0.5 mg/ml = 180 U/ml) 0.20 ml 1 M NaCl 0.01-0.02 ml bovine cerebral ATPase (depending on activity of the enzyme) up to 2.0 ml distilled water

The enzyme activity is started by addition of the ATP solution at 37°C. After 4 min the inhibitor (various concentrations of the cardiac glycoside) is added. Na + /K + ATPase activity is measured by a coupled optical assay. The reaction is continuously recorded and corrected for Mg 2+ -activated ATPase by inhibition of Na + /K + ATPase with 10 −3 M ouabain.

Inhibition of ATPase is measured after addition of various concentrations of the test compound. Doseresponse curves are established and compared with the standard (k-strophanthin). Potency ratios can be calculated. Brooker and Jelliffe (1972) and Marcus et al. (1975) described an in vitro assay based on displacement of radiolabeled ouabain bound to ATPase by various glycosides. Another method is based on the inhibition of rubidium uptake into erythrocytes (Lowenstein 1965; Belz 1981) . prepared (Na + +K + )-ATPasecontaining cardiac cell membranes from rat hearts. Maixent et al. ( , 1991 described two Na,K-ATPase isoenzymes in canine cardiac myocytes as the molecular basis of inotropic and toxic effects of digitalis.

The effect of ouabain on Na + /K + ATPase activity in cells of the human rhabdomyosarcoma cell line TE671 was studied by Miller et al. (1993) with a special equipment, the microphysiometer (McConnell et al. 1992 ).

The in vitro methods being used for determinations of plasma levels of glycosides (Maixent et al. 1995) have been largely substituted by radioimmunoassays specific for individual glycosides. Nevertheless, the inhibition of Na + /K + ATPase can be used as an indicator of activity of new semisynthetic cardiac glycosides.

Isolated cardiac tissue has been chosen to study the decrease of performance after prolonged electrical stim-ulation and during restoration of force under the influence of cardiac glycosides. described a method using cat papillary muscle.

Cats of either sex weighing 2.5-3 kg are used. The animal is anesthetized with ether and the thorax is opened rapidly. The heart is removed and a papillary muscle from the right ventricle is isolated and fixed in an organ bath containing oxygenated Ringer's solution at 36°C. One end of the muscle is tied to an tissue holder and the other one to a strain gauge. The muscle is stimulated electrically with 4-6 V, 2 ms duration and a rate of 30/min. The contractions are recorded on a polygraph. After 1 h, the muscle begins to fail and the force of contraction diminishes to a fraction of control. At this point, the cardiac glycoside is added to the bath, restoring the contractile force to levels approaching control. The standard dose is 300 ng/ml ouabain. The potency of natural and semisynthetic glycosides can be determined with this method. Catecholamines, like adrenaline (10 ng/ml) or isoprenaline (10 ng/ml), are active as well.

The increase of contractile force is calculated as percentage of the predose level. Dose-response curves can be established using various doses.

The use of isolated papillary muscle strips can be recommended for evaluation of inotropic compounds of various chemical classes.

Instead of cat papillary muscle the isolated left atrium of guinea pigs can be used (see Sect. A.1.2.6). For testing cardiac glycosides, the calcium content in the Ringer solution is reduced to 50%.

Andersom (1983) compared responses of guinea pig paced left atria to various positive inotropic agents at two different calcium concentrations (1.25 and 2.50 mM). Consistently good results were obtained at the lower calcium concentration with isoproterenol, ouabain, amrinone, and 3-isobutyl-1-methylxanthine. Böhm et al. (1989) studied positive inotropic substances like isoprenaline and milrinone in isolated cardiac preparations from different sources. They used isolated papillary muscles from Wistar-Kyoto rats and from spontaneously hypertensive rats, but also human papillary muscle strips from patients with moderate heart failure (NYHA II-III) and compared the effects with papillary muscle strips from patients with severe heart failure (NYHA IV). They recommended that new positive inotropic agents should be screened in human myocardial tissue from patients with heart failure. Labow et al. (1991) recommended a human atrial trabecular preparation for evaluation of inotropic substances. Böhm et al. (1989) tested positive inotropic agents in isolated cardiac preparations from different sources, e. g., human papillary muscle strips from patients with severe heart failure (NYHA IV), human papillary muscle strips from patients with moderate heart failure (NYHA II-III), human atrial trabeculae, isolated papillary muscles from Wistar-Kyoto rats, and isolated papillary muscles from spontaneous hypertensive rats. They suggested that positive inotropic effects should be screened in isolated myocardium from patients with heart failure.

Special strains of Syrian hamsters develop cardiomyopathy. These animals can be used for evaluation of cardiotonic drugs (see Sect. A.6.0.4).

Hamsters with cardiomyopathy (Bio 14/6) at the age of 50 weeks are used. Controls are normal Syrian hamsters (FIB hybrids) at the same age. The animals are pretreated with heparin (5 mg/kg i.p.) and 20 min later the heart is prepared according the method of Langendorff and perfused with heart Ringer solution under 75 mm H 2 O hydrostatic pressure. The preparation is allowed to equilibrate in the isolated state for 60 min at 32°C with a diastolic preload of 1.5 g. The force of contractions is recorded isometrically by a strain gauge transducer on a polygraph, e. g., Heliscriptor He 19 recorder (Hellige GmbH, Freiburg, Germany). From these signals, the heart rate is measured by a chronometer. The coronary flow is measured by an electromagnetic flowmeter. Compounds are injected via the aortic cannula into the inflowing heart-Ringer solution.

The contractile force and the coronary flow in hearts from diseased and normal animals is registered before and after application of the test drugs. Mean values and standard deviation are calculated before and after drug application and statistically compared using Student's t-test. Jasmin et al. (1979) showed after prolonged in vivo administration beneficial effects of a variety of cardiovascular drugs, including verapamil, prenylamine, dibenamine and propranolol.

After chronic administration (4 or 12 weeks subcutaneously), Weishaar et al. (1987) found beneficial effects of the calcium channel blocker diltiazem, but not by the administration of digitalis.

In contrast, in the experiments of Ottenweller et al. (1987) hamsters treated orally with digoxin survived and showed significant amelioration of the pathological syndrome of heart failure.

Ottenweller JE, Tapp WN, Natelson BH (1987) The effect of chronic digitalis therapy on the course of heart failure and on endocrine function in cardiomyopathic hamsters. Res Commun Chem Pathol Pharmacol 58:413-416 Rajagopalan R, Ghate AV, Subbarayan P, Linz W, Schoelkens BA (1993) Cardiotonic activity of the water soluble forskoline derivative 8,13-epoxy-6β-(piperidinoacetoxy)-1α,7β,9α-trihydroxy-labd-14-en-11-one. Arzneim Forsch/Drug Res 43(I) 313-319 Weishaar RE, Burrows SD, Kim SN, Kobylarz-Singer DC, Andrews LK, Quade MM, Overhiser R, Kaplan HR (1987) Protection of the failing heart: comparative effects of chronic administration of digitalis and diltiazem on myocardial metabolism in the cardiomyopathic hamster. J Appl Cardiol 2:339-360

Cardiac glycosides induce a net loss of potassium from cardiac tissue due to their inhibition of the Na + /K + AT-Pase. Therefore, potassium is increased in the effluent of the isolated guinea pig heart. This phenomenon can be used as parameter for the activity of digitalis-like compounds (Lindner and Hajdu 1968) .

The isolated heart of guinea pigs according to LAN-GENDORFF is prepared as described in Sect. A.3.1.1. The coronary outflow is measured by counting the drops of the effluent by a photocell. The effluent is collected in a funnel with a thin upwards shaped outlet allowing to withdraw small fluid samples for analysis by a flame photometer. A pump attached to a 4way valve changes the samples to the flame photometer every 15 s in the following sequence: effluent Tyrode-solution from the heart, distilled water, Tyrodesolution used for perfusion, distilled water. The potassium content of affluent and effluent Tyrode-solution is compared and registered on a Varian-recorder. The difference is attributed to the potassium outflow from the heart. The dose-response curve is flat in the therapeutic range, much steeper in the toxic range.

The following parameters are recorded and calculated:

• coronary flow [ml/min] • contractile force • potassium loss [mVal/min]

A good correlation was found between the measured potassium loss and the positive inotropic effect of cardiac glycosides. The method is suitable for the quick determination of efficacy of digitalis-like substances and facilitates the discrimination from other positive inotropic compounds like adrenaline.

The purpose of the method, originally introduced by and described in detail by Lind van Wijingaarden (1926) , was to establish "cat units" for cardiac glycoside preparations. Hatcher and Brody defined "the cat unit as the amount of crystalline ouabain which is fatal within about ninety minutes to a kilogram of a cat when the drug in injected slowly and almost continuously into the femoral vein". Time to cardiac arrest after intravenous infusion of a solution with defined concentration of the standard was used as reference and the unknown solution of the test preparation compared with the standard. The method can be used for testing natural and semisynthetic glycosides.

Cats of either sex weighing 2-3.5 kg are temporarily anesthetized with ether. Anesthesia is maintained with 70 mg/kg chloralose given intravenously. The animal is fixed on its legs on a heated operating table.

Tracheostomy is performed and a tracheal cannula is inserted. ECG is recorded from lead II. Then, intravenous infusion of the test solution is started. The endpoint is cardiac arrest which should be reached within 30-60 min by proper adjustment of the concentration of the infused solution.

Hatcher's original method has been modified by many authors. The method using guinea pigs, introduced by Knaffl- is in its essentials similar to the cat method. Guinea pigs weighing 400-600 g are anesthetized with urethane (1.75 g/kg i.m.) The animal is secured on a operating table and the trachea is cannulated. The jugular vein is cannulated for infusion of the test preparation. Cardiac arrest is recorded from ECG lead II.

Dogs and guinea pigs were used by . 

The Mongolian gerbil (Meriones unguiculatus) is extremely susceptible to carotid occlusion because of the peculiar anatomical occurrence of an incomplete circle of Willis without posterior communicating artery and a frequently rudimentary anterior communicating artery. Clamping of both carotid arteries induces a bilateral temporary brain ischemia (Levine and Sohn 1969; Bosma et al. 1981; Mršulja et al. 1983; Hossmann et al. 1983; Chandler et al. 1985) . This pathological animal model allows the simulation of circulatory disturbances in the human brain. The hippocampus is one of the most vulnerable regions of the brain to ischemia and anoxia. The gerbil is known to develop selective neuronal damage in the CA1 sector of the hippocampus following brief periods of forebrain ischemia. This damage differs from conventionally described ischemic neuronal injury because of its slow development (Ito et al. 1975; Kirino 1982; Hossmann et al. 1983 ). The occlusion time can be varied allowing determination of various parameters, e. g. ischemia induced amnesia (see Sect. F.3.1.8).

Male Mongolian gerbils (strain: Hoe GerK jirds) weighing 48-88 g are randomly divided into groups (10-15 animals for each test and control group). Prior to testing, the animals are housed in a climate-controlled environment (21°C) with food and water available ad libitum. Fifteen minutes before surgery, the gerbils receive the test compound by oral or intraperitoneal administration. The control group is treated with vehicle alone. The exposure of the common carotid arteries is performed under anesthesia with sodium pentobarbital (32 mg/kg i.p.), chloralhydrate (100 mg/kg i.p.) and atropine sulfate (0.8 mg/kg i.p.). The carotid arteries are isolated from surrounding tissue and a loop of un-waxed dental floss is placed around each artery. A 2 cm length of double lumen catheter is passed from the level of carotid artery through the muscle layers of the dorsal surface of the neck. Each end of dental floss is threaded through a separate lumen, leaving a loose loop around the artery. Two days later, occlusion of each artery is produced by gently pulling the dental floss until the artery is completely occluded between the floss and the center wall of the catheter. Heifitz clips are placed on the floss against the exterior end of the tubing to maintain occlusion. After various intervals (5 to 30 min), the clips are removed and circulation is restored.

Complete bilateral occlusion of the arteries is confirmed by behavioral symptoms, i. e., depression of spontaneous motor activity, shallow and rapid respiration, and ptosis. Care is taken to avoid a drop of body temperature during any stage of the experiment. After experimental manipulations, animals are placed on a heating pad until complete recovery of motor activity.

Subjects are placed in individual observation glasses which are kept at a temperature of 29°C. They are observed for neurological symptoms (such as circling behavior, jumping and rolling seizures, opisthotonus, tonic convulsions, etc.) for 90 min.

After various intervals, the gerbils are sacrificed and their brains are removed.

The following parameters are measured two hours after occlusion:

Degree of brain edema: water content (difference in weight of wet and dry brain) Content of sodium and potassium. The hemispheres are separated and put on pre-weighted watch glasses to determine the wet weight. Then the hemispheres are dried in an open Petri dish for 2 days at a temperature of 95°C. After cooling off, the dry weight is noted. Sodium and potassium concentrations in the dried brain hemispheres are determined by flame photometry. The Na + /K + -ratio is calculated.

For histological examinations, the animals are sacrificed at 2 or 4 days after ischemia under ether anesthesia by decapitation. The brains are then removed and frozen in CO 2 . Hippocampi are sectioned coronally with a cryostat at -14°C. The section thickness for Nissl and glial fibrillary acid protein (GFAP) staining is 20 µm and for the histochemical localization of calcium 30 µm.

Nissl staining and its quantitative evaluation. The sections are mounted by thawing on glass slides, Nissl stained, and cover slipped with Permount. In order to standardize the histological procedure and to rule out the possibility that differences in the staining intensity were due to technical inconsistency, slides from control and experimental groups are processed together, stained for 5 min, and differentiated in a series of alcohols for 3 min each. The extent of hippocampal nerve cell damage (as reflected by cell loss and decreased stainability) is assessed by measuring the amount of Nissl-stained material in a predetermined representative region of the CA1 area with the aid of a guided densitometer (Leitz Texture Analysis System). The measuring field is 50 × 500 µm, fitting to the width of the CA1 soma layer (about 40 µm).

Calcium localization. A modification of technique described by Kashiwa and Atkinson (1963) is used for the cytochemical localization of ionic calcium. The principle of the technique is that calcium complexes with a chelating agent producing an insoluble chromophore.

Stock solutions: Two solutions were used: a) glyoxalbis-(2-hydroxyanil) (GBHA), 0.4 g/100 ml absolute ethanol (2 ml 0.4% GBHA); and b) NaOH, 5 g/100 ml distilled water (0.3 ml 5% NaOH).

Staining procedure: First, cryostat sections are placed immediately in cold absolute acetone for rapid fixation for 5 min. Next, floating sections are transferred into 96% alcohol for 5 min and then transferred to staining solution for 3-4 min. Sections are then placed in 96% alcohol and mounted on glass slides. Because of quenching, it is necessary to view and photograph immediately.

GFAP (glial fibrillary acid proteinglial fibrillary acid protein) fluorescencemicroscopy. Following slide mounting, cryostat sections are fixed for 15 min in 3.5% formaldehyde solution in 0.01 M phosphatebuffered saline (PBS). The sections are incubated with mouse primary antibody against GFAP (Boehringer, Mannheim, FRG) for 30 min diluted 1:50 PBS. This antibody shows cross reactions also with GFAP from pigs and rats, indicating low species selectivity (Graber and Kreutzberg, 1986) . The sections are rinsed in PBS and incubated to tetramethylrhodamine isothiocyanate (TRITC) specific for mouse immunoglobulin G (T-5393 from Sigma) diluted 1:50 in PBS. Control sections are incubated with PBS instead of primary antibody.

Measurements, expressed as extinction units per measuring field, are taken from three slides of each animal and averaged. Statistical analysis is done by Student's t-test.

"Sensitive" gerbils can be selected according to the method of Delbarre et al. (1988) . In this method, pupil dilatation is obtained with atropine sulfate (1%) 20 min before anesthesia. Ocular fundus is examined with direct ophthalmoscope (Heine) before ligation and 5 min later. Only animals with an absence of retinal blood flow after ligation are considered as positive.

Using 31 P nuclear magnetic resonance spectroscopy, Sasaki et al. (1989) studied energy metabolism of the ischemic brain of gerbils in vivo.

An unanesthetized-gerbil model of cerebral ischemia was described by Chandler et al. (1985) .

Using microdialysis, adenosine and its metabolites were measured directly in the brain of male gerbils by Dux et al. (1990) . Two microdialysis probes (CMA/10, Carnegie Medicine, Sweden) were implanted stereotactically in the brain of the animals, one in the left dorsal hippocampus and one in the right striatum. The fibres were fixed to the cranium using dental wax. The dialysate was collected in 5 min intervals, and the concentrations of adenosine, hypoxanthine and inosine were determined by HPLC (Zetterström et al. 1982; Fredholm et al. 1984) . Kindy et al. (1992) measured glial fibrillary acid protein and vimentine on mRNA level by Northern blot analysis and protein content by immunoblot analysis in the gerbil neocortex, striatum and hippocampus after transient ischemia. McRae et al. (1994) studied the effect of drug treatment on activated microglial antigens in hippocampal sections after ischemia in gerbils with cerebral fluid from patients with Alzheimer's disease and the amyloid precursor protein. Nurse and Corbett (1996) found neuroprotection in gerbils with global cerebral ischemia after several days of mild, drug-induced hypothermia. The protection by the AMPA-antagonist NBQX may be due to a decrease in body temperature. A protracted period of subnormal temperature during the postischemic period can obscure the interpretation of preclinical studies. Smith et al. (1984) described a model of forebrain ischemia in rats induced by transient occlusion of both carotid arteries and exsanguination to a blood pressure of 40 mm Hg. This method has been used extensively (Nuglisch et al. 1990; Oberpichler et al. 1990; Rischke and Krieglstein 1990; Krieglstein and Peruche 1991; Nuglisch et al. 1991; Prehn et al. 1991; Rischke and Krieglstein 1991; Seif el Nasr et al. 1992; Peruche et al. 1995) .

Male Wistar rats weighing 250-300 g are anesthetized with 3.5% halothane and then connected to a Starling type respirator delivering 0.8% halothane and 30% O 2 in N 2 O. The jugular vein and the tail artery are catheterized for withdrawal of blood and for monitoring blood pressure. Anticoagulation is achieved by intravenous heparin (200 IU/kg) application. Blood gases, blood pH, blood pressure, and blood glucose are measured 5 min prior to ischemia and 10 min after ischemia.

Halothane, but not N 2 O, is discontinued and the rats are allowed to recover for 30 min. During this period, muscle paralysis is maintained with 5 mg/kg suxamethonium chloride, repeated every 15 min. After injection of trimethaphan camphor sulfonate (5 mg/kg), forebrain ischemia is induced by clamping of both carotid arteries and exsanguination to a blood pressure of 40 mm Hg. To prevent decay of intra-ischemic brain temperature, the environmental temperature is adjusted to 30°C by means of a infrared heating lamp. After 10 min of ischemia, the carotid clamps are removed and blood pressure is restored by re-infusing the shed blood. To minimize systemic acidosis, the rats receive intravenously 50 mg/kg NaHCO 3 . The animals are removed from the respirator when they regain spontaneous respiration.

Various parameters are used to evaluate the consequences of transient forebrain ischemia and the effectiveness of drug treatment:

• Local cerebral blood flow determination with the [ 14 C]iodoantipyrine method ), • Histological assessment of ischemic cell damage in the hippocampus on day 7 after ischemia (Seif el Nasr et al. 1990; Nuglisch et al. 1990 ),

• Local cerebral glucose utilization using the [ 14 C]deoxyglucose method described by , • Quantitative analysis of the electrocorticogram (Peruche et al. 1995) . Kochhar et al. (1988) used two focal cerebral ischemia models in rabbits: a multiple cerebral embolic model by injection of microspheres into the internal carotid circulation and a spinal chord ischemia model by occluding the aorta for predetermined periods. Gilboe et al. (1965) described the isolation and mechanical maintenance of the dog brain. Andjus et al. (1967) and Krieglstein et al. (1972) described the preparation of the isolated perfused rat brain for studying effects on cerebral metabolism. A cerebral ischemia model with conscious mice was described by Himori et al. (1990) .

The electrical activity of the brain is dependent on a continuous energy supply. Hypoxia is induced in test animals by inhalation of nitrogen. Marked hypoxia depresses cerebral metabolism resulting in an electrical failure of the brain. The procedure is used to investigate the ability of test compounds to antagonize the hypoxia-induced electrical failure of the brain by measuring the hypoxia-tolerance and the EEG recovery.

Male Sprague Dawley rats or stroke-prone rats weighing 250-300 g are used. They are anesthetized with hexobarbital sodium (100-120 mg/kg, i.p) and surgically implanted with 2 epidural EEG-electrodes and a reference electrode to the parietal frontal cortex. After a minimum of a one week recovery period, testing can be started. The rats receive the test compound by intravenous or intraperitoneal administration. The control group is treated with vehicle alone. Thirty to 60 min after i.p. administration (immediately after i.v. administration) the animals are anaesthetized by hexobarbital sodium at 100-120 mg/kg, i.p. When the stage of surgical anesthesia is reached, the animals are placed in a hypoxia chamber. EEG and ECG are recorded using a Hellige recorder.

Hypoxia is induced by inhalation of nitrogen (1200 l/h). On reaching an isoelectric EEG, the nitrogen inhalation is terminated and the animals are allowed to breath room air. The recording is continued until EEG potentials can again be registered.

The following parameters are measured in the test and control groups • Hypoxia tolerance (HT): The time from the start of nitrogen inhalation until the onset of isoelectric EEG. • Latency of EEG recovery: The time from the end of nitrogen inhalation until the onset of EEG potentials.

• The values of test and control groups are compared.

The percent change is calculated. Statistics: Student's t-test by unpaired comparison.

The permanent middle cerebral artery (MCA) occlusion technique in rats has been widely employed to evaluate various kinds of neuroprotective agents in cerebral ischemia (Ginsberg and Busto 1989) . Focal cerebral infarction is achieved using a modification of the MCA occlusion model described by Tamura et al. (1981) and Pak et al. (1992) .

Adult male Sprague-Dawley rats weighing 300-400 g are used in the experiments. The animals are anesthetized with a nitrous oxide-oxygen mixture (70:30%) containing 1.0 to 1.2% halothane. A mask is put on the nose and self-respiration is maintained during surgery, which takes around 20 to 30 min. The right femoral artery and vein are catheterized for monitoring blood pressure, blood sampling and administration of the drug. Left MCA occlusion is performed via a subtemporal approach without removal of zygomatic arch or temporal muscle. Under high magnification of a surgical microscope, the left MCA is coagulated with a microbipolar coagulator from the olfactory tract to the most proximal portion of the MCA through a cranial window, about 3 to 4 mm in diameter, and cut afterward. Anesthesia is stopped just after MCA occlusion. The arterial catheter is removed soon after MCA occlusion, but the venous catheter is maintained for constant infusion of the drug by a swivel system (Harvard Apparatus, UK.). The animals are maintained normothermic (37°C) by a homeothermic system (Homeothermic Blanket System, Harvard Apparatus, UK.). During the surgery, mean arterial blood pressure (MABP) is recorded continuously (Model 7E polygraph, Grass, USA). Arterial gases and pH (178 pH/blood gas analyzer, Corning, USA) as well as hematocrit and blood glucose are measured twice, once about 15 min before MCA occlusion and the other just following MCA occlusion. Bilateral temporal muscle temperature (Therm 2250-1, Ahlborn Mess-und Regelungstechnik, Germany) is monitored during the surgery and several minutes before sacrifice.

Two, six, twelve and twenty-four hours after discontinuing anesthesia, each rat's level of consciousness and motor activity are evaluated using a grading scale of 0 to 3 (0: normal activity; 1: spontaneous ac-tivity+/-; 2: not arousable by tactile stimulation; 3: not arousable by painful stimulation, no spontaneous activity). Immediately before sacrifice, neurological status is examined using a grading scale of 0 to 3 (0: no observable deficit; 1: forelimb flexion; 2: decreased resistance to lateral push without circling; 3: the same status as grade 2, with circling). Four groups of rats are studied: vehicle-treated controls, and drug-treated animals at 3 different doses.

All the rats are re-anesthetized 24 h after MCA occlusion and sacrificed by intravenous injection of KCl. Immediately after sacrifice the brain is removed and frozen at -10°C for 10 min. The forebrain is cut into eight coronal slices by a rat brain slicer which are processed with the tetrazolium chloride (TTC) emulsion technique. Areas of brain not stained by TTC are drawn on a diagram at 8 preselected coronal levels of forebrain without knowledge of the experimental treatment. The areas of ischemic damage in the cerebral hemisphere, cerebral cortex, and caudate nucleus, drawn in the diagram are measured with a planimeter (KP-21, Koizumi, Japan) and integrated to determine the volumes. Salom et al. (1999) subjected female goats to 20 min global cerebral ischemia under halothane/N 2 O anesthesia. An episode of transient global ischemia was achieved by occlusion of the two external carotid arteries and simultaneous external compression of the jugular veins by a neck tourniquet. A reperfusion period started when the occlusions were released, and it was monitored for 2 h.

De Ley et al. (1988) studied experimental thromboembolic stroke induced by injection of a single autologous blood clot into the internal cerebral artery in dogs bypositron emission tomography.

Focal cerebral ischemia in rats can be induced by irradiation with intensive green light via a fibre optic through the skull after injection of the dye Rose Bengal. The resulting cerebral infarct can be studied for various parameters, such as infarct volume, water content, local cerebral blood flow and glucose utilization.

Male Sprague-Dawley rats (300-350 g) are used. Anesthesia is induced with 3% halothane in oxygen and is maintained with 1% halothane in oxygen applied via a face mask. A small incision is made in the skin over the right femoral vein and a thin catheter is inserted. One ml of the dye Rose Bengal (in a concentration of 5 mg/ml of saline) is injected. A midline head incision is made and the right side of the skull is exposed. An intense green light, produced by a xenon lamp (75W, Zeiss, FRG) and then passed through a filter (wavelength 570 nm, Schott, Mainz, FRG) and a heat filter (Schott, Mainz, FRG), is directed on the skull at the level of the bregma for 15 min. The 3 mm diameter of the illuminated circle is determined by passing the light through a fibre optic (Schott, Mainz, FRG) while in close contact to the skull. The temperature of the skull underneath the fibre optic does not change during the time of illumination. At the end of the induction period, the temporary catheter is removed from the femoral vein which remains patent following the closure of the catheterization site with liquid suture (Histoacryl, Braun, Melsungen, FRG), and the incisions in the leg and head are likewise sutured after liberal application of local anesthetic. The anesthetic gas mixture is discontinued and the rats are allowed to recover consciousness in a warm environment until such times as the appropriate experiment is to be performed. Due to the non-invasive nature of this technique it is not possible to measure blood pressure or blood gases during the ischemic period. However, rectal temperature and plasma glucose concentrations are controlled.

Osmotically controlled mini-pumps (Model 2ML1 Alzet, USA) are placed into the peritoneum of two groups of six male Sprague Dawley rats (body weight 300-350 g). The mini-pumps are fitted via thin polyethylene catheters to the femoral vein of the rats. Each pump contains either 2 ml of physiological saline or 2 ml of a solution of the drug to be studied. The animals are then given an ischemic insult as described in the previous section. Seventy-two hours after the induction of ischemia, the rats are sacrificed by decapitation and the brains removed and frozen at -50°C. Coronal sections (20 µ) are cut in a cryotome at -20°C, fixed in Haidenhain's Susa and stained with Cresyl Violet. The ischemic area on 90 sections is measured and the volume of ischemic change is then calculated using a linear trapezoidal extrapolation of the areas measured.

Three groups each of six rats are used. One group receives no ischemic lesion (the illumination with green light is omitted from the experimental protocol) and two groups are lesioned as described above. One le-sioned group receives the test drug orally at 15 min, 30 min, 1, 3 and 5 h after the induction of the ischemia or sham operation. The other group is treated with saline at the same time-points. Twenty-four hours later the rats are sacrificed by decapitation. The brains are rapidly removed and placed on a cutting block with 1 mm gradations. Two cuts are made 1 mm or less anterior and posterior to the lesion. The thick section so produced is then divided into left (non-lesioned) and right (lesioned) halves and placed in pre-weighed vials and the wet weights of the tissue samples are carefully measured. The tissue is then frozen in liquid nitrogen and then left under vacuum (less than 0.1 Torr) for 24 h. On removal the vials are sealed to prevent rehydration and reweighed to obtain the dry weight of tissue from which the water content (expressed as percentage of wet weight of tissue) is calculated.

All data are presented as mean ± SD of the mean. For left (contralateral to the lesion) against right (ipsilateral to the lesion) comparisons, a t-test with paired comparison was used (P < 0.05). Statistical differences between groups were calculated using the unpaired ttest. Boquillon et al. (1992) produced cerebral infarction in mice by intravenous injection of 10 mg/kg rose bengal, and by focal illumination of the intact skull surface for 3 min with a laser source, operating at 570 nm with power levels of 2, 5, 10, and 20 mW. Matsuno et al. (1993) used a similar model to induce cerebral ischemia in rats based on middle cerebral artery occlusion by the photochemical reaction of rose bengal after irradiation with high intensity green light. Stieg et al. (1999) studied neuroprotection by the NMDA receptor-associated open-channel blocker memantine in a photothrombotic model of cerebral focal ischemia in neonatal rat. An excellent correlation between infarct size determined by magnetic resonance imaging (MRI) and histopathological analysis in the same animals was found.

Matsuno H, Uematsu T, Umemura K, Tagiguchi Y, Asai Y, Murakana Y, Nakashima M (1993) A simple and reproducible cerebral thrombosis model in rats induced by a photochemical reaction and the effect of a plasmin-plasminogen activator chimera in this model. J Pharm Toxicol Meth 29:165-173 Stieg PE, Sathi S, Warach S, Le DA, Lipton SA (1999) Neuroprotection by the NMDA receptor-associated open-channel blocker memantine in a photothrombotic model of cerebral focal ischemia in neonatal rat. Eur J Pharmacol 375:115-120 A.8.1.6

Transient global ischemia can be induced in rats by electrocauterization of the vertebral arteries followed by clamping of the carotid arteries.

Male Wistar rats weighing 280-340 g are used.

The rats are anesthetized with methohexital sodium (60 mg/kg i.v.) and the vertebral arteries are electrocauterized (Pulsinelli and Brierley 1979) . The rats are fasted overnight and re-anesthetized on the following day with halothane and intubated. The femoral artery and vein are cannulated to allow blood sampling, blood withdrawal and recording of mean arterial pressure (MAP). Samples of blood are taken at regular time intervals and blood gas/acid base status is analyzed (Instrumentation Laboratory, 1306). Rectal temperature is measured with a thermistor and controlled at 37°C by means of a heating lamp. Four-vessel occlusion ischemia is induced for 20 min by bilateral carotid clamping followed by a period of reflow.

The head of the rat is fixed in a stereotactic frame. The skin is incised over the head, pulled apart and a 3 × 3 mm hole is drilled through the cranium. A microdialysis probe (Sandberg et al. 1986 ) is implanted into CA1 region of the hippocampus (2.2 mm lateral and 3.8 mm dorsal to bregma, and the window of the dialysis membrane 1.4-2.9 mm below the cortical surface). The electroencephalogram (EEG) is measured continuously with a tungsten electrode attached to the dialysis probe. The probe is perfused at a rate of 2.5 µl/min with a modified Ringer solution. Dialysates are sampled every 10 min and analyzed for purines (Hagberg et al. 1987 ) and amino acids (Lindroth et al. 1985) . One group receives the test drug i.p. 15 min prior to ischemia whereas the control group obtains saline. The animals are followed during 20 min of ischemia and 2 h of reflow. HPLC analyses are carried out using a reversephase C 18 column (Waters 10 µm µBondapak) with isocratic elution, a flow rate of 1.0 ml/min and at ambient temperature. For adenosine, inosine and hypoxanthine the mobile phase is 10 mM NH 4 H 2 PO 4 , pH 6.0, 13% methanol.

During ischemic insult and for 20 min of reflow, the temperature of the temporalis muscle is controlled at 37°C. Immediately following ischemia the rats are divided into two groups. One group is treated with the test drug and the other with saline. A bolus injection is administered i.p. 15 min after ischemia and a miniosmotic pump is implanted into the abdominal cavity which delivers the test drug for 7 days. Control animals receive a bolus of saline and mini-osmotic pumps filled with saline. Seven days later the rats are anesthetized with pentobarbital and perfusion-fixed with formol saline. The histological evaluation is done "blind". The hippocampal damage is semiquantified according to the following scoring system: 0 = no damage 1 = scanty damage, 2 = moderate damage 3 = severe damage 4 = complete loss of pyramidal cells in the hippocampus.

The purine and amino acid data are expressed as means ± SEM and differences are evaluated with the nonparametric Mann-Whitney test. The neuroprotective efficacy of the test drug is evaluated with two-tailed Student's t-test.

In addition to the assessment of neuronal damage, Block et al. (1996) tested spatial learning of treated rats one week after 4-vessel occlusion in a Morris water maze.

The in vitro release of adenosine, inosine, and hypoxanthine from rat hippocampal slices can be determined with and without drug.

Male Sprague-Dawley rats weighing 150-275 g are decapitated, the hippocampi isolated and cut into 400 µm thick slices which are placed into KRB (4°C) containing (mM) NaCl (118), KCl (4.85), MgSO 4 (1.15), KH 2 PO 4 (1.15), NaHCO 3 (25), glucose (5.5), CaCl 2 (1.3) equilibrated with 95% O 2 / 5% CO 2 . The incubation medium is brought up to room temperature over a period of 30 min. The KRB is then replaced with fresh medium and the slices are incubated for a further 30 min at room temperature, followed by 30 min at 37°C in fresh KRB. Following the initial incubations, slices are labelled for 45 min with 3 H-adenine (5 µCi/ml) at 37°C. Two labelled slices are transferred into plastic cylinders which have nylon net bases and these, together with the slices, are placed into glass superfusion chambers. Slices are superfused at a flow rate of 0.5 ml/min with KRB at 37°C. After a 60 min wash, collection of 5 min fractions begins, which continues throughout the remainder of the experiment. A 1.25 ml aliquot of the fractions is taken for determination of radioactivity using scintillation spectrometry (scintillation fluid: Picofluor 15). The remaining 1.25 ml is taken for HPLC analysis of purines and amino acids.

Hypoxia/hypoglycemia is induced by superfusion with KRB containing no glucose and 95% N 2 and 5% CO 2 for 35 min followed by recovery. All other procedures are as described above. The test drug is added to the perfusion fluid at an appropriate concentration. The 1.25 ml aliquots taken for HPLC analysis are pooled with two other aliquots (total 3.75 ml), lyophilized and concentrated 10 fold before analysis. Samples are analyzed for adenosine, inosine and hypoxanthine with HPLC. The radioactivity associated with each of these fractions is also determined by collecting the eluent from the column at the appropriate times. HPLC analyses are carried out using a reversephase C 18 column (Waters 10 µm µBondapak) with isocratic elution, a flow rate of 1.0 ml/min and at ambient temperature. For adenosine, inosine and hypoxanthine the mobile phase is 10 mM NH 4 H 2 PO 4 , pH 6.0, 13% methanol.

Values for adenosine, inosine and hypoxanthine can be expressed in two ways: (1) release rate per slice (pmol/min × slice); (2) percentage of the total amount of released radioactivity (% total 3 H-label released). The purine data are expressed as means ± SEM and differences are evaluated with the non-parametric Mann-Whitney test.

Dunwiddie TV (1986) The use of in vitro brain slices in neuropharmacology. In: Electrophysiological Techniques in Pharmacology. Alan R Liss, Inc., pp 65-90 Hagberg H, Andiné P, Fredholm B, Rudolphi K (1990) Effect of the adenosine uptake inhibitor propentofylline on the extracellular adenosine and glutamate and evaluation of its neuroprotective efficacy after ischemia in neonatal and adult rats. In: Krieglstein J, Oberpichler (eds) Pharmacology of Cerebral Ischemia. Wissenschaftliche Verlagsgesellschaft mbH, Stuttgart, pp 427-437 A.8.1.8

Cerebral glucose utilization can be determined using [ 14 C]-2-deoxyglucose according to . Local cerebral blood flow using [ 14 C]iodoantipyrine is measured as described by . Rogers et al. (1994) synthesized 18 F-labelled vesamicol derivates to be evaluated in small animal positron emission tomography. Hume et al. (1997) measured in vivo saturation kinetics of two dopamine transporter probes using a small animal positron emission tomography scanner.

Cerebral blood flow and cerebrovascular resistance can be measured by injection of inert radioactive gas ( 133 Xenon) and evaluation of the 133 Xe clearance curve in anesthetized baboons.

The experiments are performed on baboons (Papio or cynocephalus) weighing 9-13 kg. Initial sedation with phencyclidine (10 mg i.m.) is followed by an intravenous injection of sodium thiopental (75 mg/kg). The animals are intubated to a positive pressure ventilator delivering 70:30% nitrous oxide and oxygen in open circuit. A continuous intravenous infusion of phencyclidine (0.01 mg/kg/min) is given throughout the course of the experiment. Suxamethonium (50 mg i.m.) is administered every 30 min in order to assist control of ventilation with the respiratory pump.

During the experiments, the end tidal concentration of CO 2 is continuously measured and the ventilating pump adjusted to maintain an arterial CO 2 tension (PaCO 2 ) of between 37 and 40 mm Hg for the control measurements. Arterial blood samples are taken during every measurement of cerebral blood flow (CBF) to measure PaCO 2 , PaO 2 , and pH by direct reading electrodes (Corning). Body temperature is maintained around 37°C by means of an electrically heated blanket and infrared heating lamps.

Catheters are inserted into the aorta via femoral arteries for the continuous measurement of arterial blood pressure and for the withdrawal of arterial blood samples. Both femoral veins are cannulated, one for the continuous infusion of phencyclidine and the other for the infusion of the test drug. A catheter is inserted into the right lingual artery so that its tip lays just distal to the carotid bifurcation. This catheter is flushed at regular intervals with heparinized saline to prevent platelet aggregation at the tip. In the studies with required intravenous administration of test drug, the other branches of the external carotid artery are ligated. Where the requirement is for intracarotid administration of test drug, another catheter is retrogradely advanced into the external carotid artery so that its tip lays next to the tip of the lingual catheter. This catheter is then attached to a constant-rate infusion pump (Sage Instruments). Heparinized saline is infused at a rate of 0.2 ml/min to act as a control for drug infusion.

A burr hole is made over the midline fissure and a catheter inserted into the sagittal sinus for the withdrawal of cerebral venous blood samples. The hole is sealed with plaster of Paris. The scalp and temporalis muscle are removed with diathermy down to the level of the zygomatic arch.

A collimated scintillation crystal is placed over the temporal region of the exposed skull on the right side and angled in such a way that viewed only brain and overlying skull.

Approximately 260 µCi of 133 Xenon dissolved in 0.5 ml sterile heparinized saline (500 IU) is injected over 1 s into the catheter in the lingual branch of the carotid artery. The gamma-ray emission of the 133 Xe are detected by the scintillation counter attached to a photomultiplier. The pulses are amplified and subjected to pulse height analysis (peak 81 KeV ± 8 KeV) to reduce Compton scatter before fed into a rate meter and scaler. The output from the rate meter is displayed on a chart recorder. Cerebral blood flow is calculated from the height/area equation (Høedt-Rasmussen et al. 1966) . The formula used is

where F is CBF in ml blood per 100 g brain tissue per min; λ = brain tissue/blood partition coefficient for 133 Xe (the figure of 1.1 is used [Veall and Mallett 1966] ); H i = maximum initial height of the 133 Xe clearance curve in counts per min as taken from the chart recorder; H 10 = height of the clearance curve 10 min after the peak height in counts per s; A 10 = total integrated counts over the 10 min of clearance as taken from the scaler and corrected for background activity over that period.

Cerebral oxygen consumption is measured from the product of the DBF and the difference in oxygen content between the arterial blood and cerebral venous blood sampled from the sagittal sinus. Blood oxygen is measured by a charcoal-fuel cell system (Lex-O 2 -Con).

An estimate of cerebrovascular resistance is obtained by subtracting the mean sagittal sinus pressure from the mean arterial pressure and dividing this pressure difference by the CBF.

Electroencephalographic readings are recorded bilaterally throughout the experiment. A series of holes are drilled in the calvarium 10 mm apart in two rows. Each row is 14 mm lateral to the sagittal suture. The holes are threaded to receive nylon screws in which silver-silver chloride ball electrodes are fixed loosely. The electrodes are positioned epidurally and the free ends are soldered to a multi-channel socket which is mounted on the calvarium with plaster of Paris.

Following completion of the surgery, the animals are left undisturbed for 1 h. At least three control estimations of CBF and other parameters are made until steady conditions of flow, arterial blood pressure, and blood gas tensions are obtained.

Intravenous administration. After stable control values have been established, the infusion is started. The CBF is measured at 5 min after the start and again at 25 min. The infusion is stopped 10 min after this flow period, giving a total infusion time of 35 min. Further flow measurements are made at 10, 30, and 50 min after stopping the infusion.

Intracarotid administration. After establishing control values, the intracarotid infusion of the test drug is begun. The CBF is measured at 10, 30, 50 and 70 min. The infusion is stopped 80 min after commencing, and post infusion measurements are made after 20, 40, and 60 min.

Data are presented as mean values ± SEM Evaluation of statistical significance is performed by means of Student's t-test with Bonferroni correction. Kozniewska et al. (1992) , Wang et al. (1992) measured cerebral blood flow in rats by intracarotid injection of 133 Xe. Solomon et al. (1985) and Clozel and Watanabe (1993) induced cerebral vasoconstriction by injection of autologous blood in the cisterna magna of rats. Cerebral blood flow was measured with the radioactive microsphere technique. Lin et al. (2003) described a model of subarachnoid hemorrhage-induced cerebral vasospasm in mice. Adult mice received injections of autologous blood into the cisterna magna. The diameters of large intracranial vessels were measured 1 h to 7 days after the subarachnoid hemorrhage. A diffuse blood clot was evident in both the anterior and posterior circulations. Vascular wall thickening, lumenal narrowing, and corrugation of the internal elastic lamina were observed. Both acute (6-12 h) and delayed (1-3 days) phases of vasoconstriction occurred after subarachnoid hemorrhage. Overall mortality was only 3%. The model is recommended for screening of therapeutic candidates.

Delayed cerebral vasospasm was induced in anesthetized dogs by removal of 4 ml cerebrospinal fluid and injection of the same volume of fresh autologous arterial nonheparinized blood into the cisterna magna by Varsos et al. (1983) as a model of subarachnoid hemorrhage. The procedure was repeated on the third day and angiograms were taken of the vertebral-basilar vessels. The reduction of diameter of the basilar artery was taken as endpoint. Imaizumi et al. (1996) produced experimental subarachnoid hemorrhage by intracisternal injection of arterial blood in rabbits. The degree of vasospasm and the effect of calcitonin gene-related peptide were evaluated angiographically by measuring the basilar artery diameter. Inoue et al. (1996) produced experimental subarachnoid hemorrhage in cynomolgus monkeys by placing a clot around the internal carotid artery. A series of angiographic analyses were performed, before subarachnoid hemorrhage and on days 7 and 14 after treatment with calcitonin gene-related peptide to examine changes in the diameter of the ipsilateral internal carotid artery, middle cerebral artery, and anterior cerebral artery. Hughes et al. (1994) adapted the 133 xenon clearance technique for simultaneous measurement of cutaneous blood flow in rabbits at a large number of skin sites within the same animal.

Cerebral blood flow in anaesthetized cats an be measured by fluvography. The heat transfer coefficient of the brain can be measured with a probe representing an indirect blood flow value.

In this method, the measuring device consists of a thermo probe, which is attached to the tissue in order to record continually the heat transport (Hensel, 1956) . The device depends on having an electrically heated part and an unheated reference point. The difference in temperature between the heated part of the device and the unheated reference point is a function of local blood flow. An increase in flow tends to lower the local temperature by carrying away the heat gain and vice versa.

Cats of either sex weighing 2.5-4.0 kg are anaesthetized by intraperitoneal administration of pentobarbital sodium (35 mg/kg) and intubated with a tracheal tube. The left femoral vein and the right femoral artery are cannulated for i.v. drug administration and determination of arterial blood pressure, respectively. The arterial cannula is connected to a Statham transducer P 23 Db.

For intraduodenal drug administration the duodenum is cannulated following laparotomy.

Before actually starting the experiment, the arterial blood gas concentrations are determined.

Animals are only used for further testing if they show normal blood gas concentrations. During the course of the experiment, blood flow, blood pressure and blood gas concentrations are regularly monitored.

The head of the animal is fixed in a stereotactic device. The skull cap and the dura are opened, the probes are placed on the surface of the cortex in the region of the marginal frontal gyrus, and the exposed brain is covered with moist swabs. The Fluvograph (Hart-mann+Braun, Frankfurt) is used with the appropriate thermo probes.

To test the correct position of the thermocouple and the response of the animal, inhalations of carbon dioxide/ air or injections of epinephrine (adrenaline) are used, leading to a distinctive increase in cerebral blood flow. Following stabilization of the parameters mentioned above, the standard compound is administered and the change in blood flow is recorded. Five min after obtaining the original values, the test compound is administered.

Standard compound:

• pentoxifylline 1 and 3 mg/kg (i.v. administration) 10 and 30 mg/kg (i.d. administration)

The percent change in the heat transfer coefficient is used as an indirect measure for the change of cerebral blood flow. Statistics: Student's t-test is performed by unpaired comparison.

The principle of the Laser Doppler effect is based on the fact that a laser light beam directed on tissue is scattered in static structures as well as in moving cells. Light beams scattered in moving red cells undergo a frequency shift according to the Doppler effect, while beams scattered in static tissue alone remain unshifted in frequency. The number of Doppler shifts per time is recorded as a measure for erythrocyte flow in a given volume. This means, that the direction of flow cannot be determined, but relative changes in micro circulatory blood flow can be recorded. The procedure can be used to detect test compounds that improve the blood supply of the brain or the flow of red blood cells in the ischemic skeletal muscle.

Male Sprague-Dawley rats weighing 300-500 g are anaesthetized with pentobarbital sodium (60 mg/kg i.p.). The trachea is exposed and intubated with a short tracheal tube to allow ventilation. The following vessels have to be cannulated: The femoral vein is cannulated for test drug administration. The femoral artery is cannulated for blood pressure recording and blood gas analysis. Before actually starting the experiment, the arterial blood gas concentrations are determined. Animals are only used for further testing if they show normal blood gas concentrations (pa CO 2 : 32-42 mm Hg; pa O 2 : 70-110 mm Hg). The mean arterial blood pressure should not drop below 100 mm Hg. During the course of the experiment, blood flow, blood pressure and blood gas concentrations are regularly monitored.

The head of the animal is fixed in a stereotactic device. After trepanation of the skull (opening 3 mm in diameter), the Laser Doppler probe is placed 1 mm above the surface of the brain. Values are measured with the Laser Doppler apparatus (Periflux F2, Perimed KB, Stockholm).

Following stabilization of the parameters mentioned above, the standard compound is administered and the change in blood flow is recorded. Five min after obtaining the original values, the test compound is infused. Following two administrations of the test compound, the standard compound is administered again. Duration of the effect is measured as half life in seconds.

A small area of the femoral artery of the right hind limb is exposed and the Laser Doppler probe is placed 1 mm above the muscle surface. Before actually starting the experiment, the arterial blood gas concentrations are determined. Animals are only used for further proceeding if they show normal blood gas concentrations. During the course of the experiment, the blood pressure is recorded. The RBC flux is recorded continuously and after stabilization of the output signal, the femoral artery is occluded leading to underperfusion of the muscles of the right pelvic limb. At this stage, the test compound is administered by intravenous infusion for 10 min (0.05 ml/min).

Standard compound for cerebral blood flow is propentofylline (1 mg/kg, i.v.). The percent increase in blood flow produced by propentofylline ranges between 40% and 60%.

The percent increase in blood flow after test drug administration is determined (compared to the value before drug administration).

Statistics: Student's t-test by unpaired comparison, test substance versus standard. Iadecola (1992) , Prado et al. (1992) , Raszkiewicz et al. (1992) measured the influence of nitric oxide on cortical cerebral blood flow in anesthetized rats by Laser-Doppler flowmetry. Benessiano et al. (1985) measured aortic blood flow with range-gated Doppler flowmeter in anesthetized rats. Partridge (1991) measured nerve blood flow in the sciatic nerve of anesthetized rats with a Laser Doppler Flowmeter after application of local anesthetics and of epinephrine.

resulting in sustained sensory/motor and cognitive defects. Tang et al. (1997) reported impairment in learning and memory in an experimental model of concussive brain injury in mice. Bemana and Nago (1998) induced acute intercranial hypertension in cats by continuous inflation of an extradural balloon with physiological saline at a constant rate of 0.5 ml/h for 3 h. At this point, inflation was discontinued and the balloon remained expanded for an additional hour after which it was deflated.

A model of traumatic injury to the spinal cord was used by Springer et al. (1997) . Female Long Evans rats weighing 200-250 g were anesthetized with pentobarbital and a dorsal laminectomy was performed to expose the spinal cord at thoracic level T 10. The vertebral column was stabilized by clamping the column at vertebra 8 and 11. The New York University (NYU) impactor device was used which produces accurate and reproducible damage to the rat spinal cord (Gruner 1992; Basso et al. 1996) . This device is a weight drop apparatus that uses optical potentiometers to record the movement of a 10-g impact rod and the vertebral column following impact and is connected to a PC that monitors rod and vertebral movements during impact. and 1600 s/mm 2 ). ADC maps were calculated pixelwise using the monoexponential model (Le Bihan et al. 1986 ).

Perfusion-weighted imaging was performed with an ultrafast version of the arterial spin tagging technique (Kerskens et al. 1996; Franke et al. 2000) in four rats per group. In independent experiments, three coronal slices were recorded, thus covering the central part of the ischemic lesion. Measurement parameters were: TE = 3.5 ms, TR = 7.4 ms, MATRIX = 128 × 64, AV-ERAGE = 8. Each experiment consisted of two image acquisitions separated by a recovery period. During the first acquisition, blood flowing through the neck was adiabatically inverted (preparation TIME = 3 s; zgradient = 5 mT/m; B1 FIELD = 150 mG; off-resonance FREQUENCY = 6000 Hz; mean preparation DIS-TANCE = 2.8 cm upstream from the imaging plane); in the second acquisition, inflowing spins were left undisturbed. Both phases were separated by a recovery period of 10 s. In each perfusion experiment, the two images suffered the same signal loss due to magnetization transfer effects but differed in the magnetization of the inflowing blood. Perfusion-weighted images were obtained by subtraction of the acquisitions with and without prior adiabatic spin inversion. In the second acquisition, inflowing spins were left undisturbed. Perfusion-weighted images were obtained by subtraction of the acquisitions with and without prior adiabatic spin inversion.

Data were transferred to a PC and image analysis was carried out using the image processing software Scion Image for Windows (Scion Corporation, Frederick, Md., USA). Lesion volumes were calculated using ADC maps, as the ischemic lesion area was estimated by summing up all pixels with a relative ADC < 80% compared to the healthy, contralateral hemisphere (Hoehn-Berlage et al. 1995) . Perfusion signal intensities are referred to the homologous contralateral regions and given as ratios of ipsilateral to contralateral values.

were 70 ms for the T 2 WI and DWI and 28 ms for the PDWI. For DWI, diffusion-sensitizing gradients (bvalue 590 × 10 −3 s/mm 2 ) were applied along the inferior to superior axis of the brain. Two averages were acquired per phase encode step. The images were collected at an in-plane resolution of 0.31 × 0.31 mm from 18 contiguous, 1-mm-thick slices, with a total acquisition time of 43 min.

Perfusion of the hindquarter in rats with a constant flow rate allows the evaluation of the effect of drugs on the peripheral vascular bed. Since constant blood flow is maintained, changes in the vascular resistance of the perfused bed are directly proportional to changes in the perfusion pressure.

Various methods exist to measure peripheral blood flow in rats, such as the microsphere technique, electromagnetic flowmetry and Doppler ultrasonic flowmetry.

Radioactive microspheres are used to calculate the distribution of blood from the heart to various organs and tissues before and after the administration of test compounds. In this method, microspheres are injected into the left cardiac ventricle. It is postulated that the first contraction of the cardiac muscle will expel these spheres into the circulation. Consequently the microspheres can be trapped in different organs according to the organ's perfusion rate. It is not a primary screening method but it is a useful test for distinguishing compounds with blood flow altering activities.

The microspheres used are 14 µ in diameter. They are marked with isotopes. In this test, four different radioactive elements are used (Cr 51 , Sr 85 , Sc 46 , Ce 141 ), allowing the determination of blood flow before dosing and after the administration of 3 different compounds or 3 different doses (of the same compound).

Male Wistar rats weighing 500-550 g are anaesthetized with pentobarbital. The trachea is exposed and intubated with a short endotracheal tube to allow ventilation. Prior to testing the jugular vein is cannulated for administration of test drugs. The carotid artery is cannulated and later on the catheter is passed retrograde into the ventricle. Ventricular pressure is recorded to assure the correct emplacement of the catheter tip in the ventricle. This catheter is connected to another catheter allowing the injection of microspheres into the left ventricle later on. The right arteria brachialis is cannulated and connected to a Hellige blood pressure recorder. During the course of the test, blood pressure will be measured continuously. The left femoral artery is cannulated and connected to an infusion pump. During the experiment blood will be withdrawn from this artery.

After these preparations the rat is allowed 15-30 min to recover. Before actually starting the experiment, the arterial blood gas concentration of each animal is measured. Animals are only used for the experiment if they show normal blood gas concentrations. During the following procedure blood pressure, ventricular pressure and the heart rate are continuously recorded. To determine baseline blood flow animals receive 0.2 ml vehicle/min over a 3 min period. In the 4th minute rats receive the first injection of microspheres (Cr 51 ). Simultaneously 0.5 ml/min blood is withdrawn from the femoral artery catheter for one minute, the pump thus being used as a reference organ. The animals are allowed 20 min to recover before the administration of drugs. The test compound is infused into the jugular vein at a rate of 0.2 ml/min for 3 min followed by injection of the second microsphere (Sr 85 ). The same procedure is repeated using the other two microspheres (Sc 46 and Ce 141 ) following administration of the second and third test compound.

At the end of the experiment blood gas concentrations are measured. The animals are killed and their organs are removed. Usually blood flow is determined in the following organs: To determine effects of test compounds on the blood flow in the underperfused skeletal muscle the same experiment can be performed with the right femoral artery being clamped. In this way effects of the test drug on the ischemic and normal skeletal muscle (left thoracic limb) can be compared in the same animal.

The rate of blood flow/tissue at a certain time is determined by measuring radioactivity in the different tissues and comparing the results to that of the blood sample.

Blood flow in various peripheral organs, e. g., renal blood, flow can be measured with electromagnetic flowmeters (e. g., Transflow 601, Skalar Medical, Holland) or with Doppler ultrasonic flowmetry (Shaffer and Medvedev 1991) . Lappe et al. (1986) studied regional vascular resistance in conscious spontaneously hypertensive rats which were chronically instrumented with pulse Doppler flow probes to allow measurement of renal, mesenteric and hind quarters blood flow. Hartman et al. (1994) validated a transit-time ultrasonic volume flow meter by simultaneous measurements with an electromagnetic flow metering method. Lepore et al. (1999) used electron paramagnetic resonance to investigate the time course of nitric oxide generation and its susceptibility of nitric oxide synthase in ischemia-reperfusion injury to rat skeletal muscle in vivo. Total hind limb ischemia was applied for 2 h using a rubber band tourniquet method. At the end of ischemia the tourniquet was removed and the limb allowed to reperfuse for various time intervals. Beattie et al. (1995) measured carotid arterial vascular resistance in anesthetized rabbits. Carotid blood flow was measured by a Doppler flow probe placed around the right common carotid artery. Doseresponse curves of reduction of carotid arterial vascular resistance were constructed after injection of various doses of substance P-methyl ester via the right lingual artery. Intravenous injection of various doses of a selective tachykinin NK 1 receptor antagonist inhibited this effect dose-dependently.

Effects on blood pressure have to be analyzed whether they are mediated by central, cardial, or peripheral action. By injecting small doses of the test compound directly into a vascular bed, thus avoiding changes of central hemodynamics, peripheral vasodilating activity of a compound can be tested. This test is used to evaluate direct vasodilating or constricting activities of drugs in vivo-measurements of blood flow.

Male or female Beagle or Labrador-Harrier dogs weighing 15-25 kg are used. The dogs are premedi-cated intravenously with heparin (bolus of 500 IU/kg and successive injections of 50 IU/kg every 30 min) and anesthetized by intravenous injection of thiobarbital sodium (0.5 mg/kg i.v.), chloralose (20 mg/kg i.v.) and urethane (250 mg/kg i.v.). Respiration is maintained with room air through a tracheal tube using a positive pressure respirator. Blood gas analysis is performed at regular time intervals. Oxygen is supplied via the respirator as needed.

To measure peripheral blood flow and to administer the test substance, a bypass is inserted into a femoral artery incorporating an electromagnetic flow probe and a port for injections. The other femoral artery is also equipped with a bypass used for the administration of a reference compound or a second test drug.

For recording of peripheral blood pressure and heart rate, one of the bypasses is connected to a pressure transducer (Statham P 23 BD).

All parameters are recorded continuously during the whole experiment.

When stable hemodynamic conditions are achieved for at least 20 min, the vehicle is administered (control), and 10 min later the test compound. Immediately after each administration, the port is flushed with physiological saline. Successive doses are administered after recovery to baseline values.

Readings are taken at times 0, 0.5, 1, 2, 5 and 10 min, and, if necessary, at additional 10 min-intervals following drug administration.

Standard compound:

• carbocromene 1 mg/kg Characteristics: • blood pressure -systolic, BPs -diastolic, BPd • heart rate, HR • peripheral blood flow, PF

Changes in blood pressure, heart rate and peripheral blood flow at different times after drug administration are compared to vehicle control values obtained in the 10 min pre-drug period.

With n > 2, results are presented as mean ± SEM. Statistical significance is assessed by means of the paired t-test. Scores are compared to the efficacy of standard compounds for intensity and for duration of the effect.

Regional blood flow can be determined by the use of microspheres (Rudolph and Heyman 1967) . The method is based on the principle that biologically inert microspheres will be trapped due their diameter in the microvasculature (Hales and Cliff 1977) . The use of radioactive microspheres has some disadvantages (Buckberg et al. 1971) . The use of fluorescent labeled microspheres for measurement of regional organ perfusion has been recommended (Glenny et al. 1993; Prinzen and Glenny 1994; van Oosterhout et al. 1995) . Raab et al. (1999) , Thein et al. (2000) described the automation of the use of fluorescent microspheres using a special sample processing unit. A Zymate-Robotic System (Zymark, Idstein, Germany) was modified to handle a special filtration device. measured renal blood flow in dogs after intrarenal arterial infusion of adrenomedullin.

Local oxygen pressure is directly related to oxygen supply to peripheral organs, e. g., muscle (Luebbers 1969; . The local oxygen pressure (PO 2 ) is recorded directly on the muscle surface. In the following procedure the effect of test compounds on the local oxygen pressure (PO 2 ) of the normal and the ischemic skeletal muscle is determined.

Male Beagle dogs weighing 15-20 kg are used. The dog is anesthetized by intraperitoneal administration of pentobarbital sodium (Nembutal). Prior to testing, the following vessels have to be cannulated: The V. femoralis of the left pelvic limb is cannulated for administration of test compounds. The A. femoralis of the left pelvic limb is cannulated for blood pressure recording. The V. femoralis of the right pelvic limb is cannulated. During the course of this test blood will be withdrawn from this vein to monitor lactate concentrations.

Small areas of muscles of the right pelvic limb and the right thoracic limb are exposed. Muscle relaxation is induced by intravenous injection of 0.1 mg/kg alcuronium chloride (Alloferin) and maintained by i.p. administration of 0.05 mg/kg Alloferin at 30 min intervals. The trachea is exposed and intubated to assist the dog's respiration.

A PO 2 electrode is placed on the exposed muscle area of the right hind limb. After stabilization of PO 2 curves, the femoral artery of the right hind limb is occluded by putting a clip around the vessel. Muscle PO 2 drops rapidly. Following stabilization, test compounds are given by intravenous infusion for 10 min or by intraduodenal administration at this stage. The PO 2 of the non ischemic muscle is recorded simultaneously via a second electrode on the right thoracic extremity. The clip is removed after maximally one hour. This procedure can be repeated up to four times in one animal. Blood gas concentrations and pH are determined at the beginning and end of each experiment.

Standard compound:

• pentoxifylline

The following parameters are determined:

• Maximal increase in PO 2 (mm Hg) after administration of test drug • duration of effect by determining the half life

Blood flow in the mesenteric vascular bed in situ Eikenburg 1984; Randall et al. 1989; Jackson and Inagami 1990) can be studied in rats in a way similar to that of the perfused hindquarter.

Wistar rats of either sex weighing 250-300 g are anesthetized with a combination of urethane (500 mg/kg i.v.) and sodium pentobarbitone (30 mg/ kg). The abdomen is opened by a midline incision and a segment of the superior mesenteric artery is exposed by careful dissection of the surrounding tissue. Care is taken to avoid damage to the accompanying nerve terminals. One cannula is inserted into the carotid artery and the other into the superior mesenteric artery. Blood from the carotid artery is forced by a peristaltic pump (Desaga) into the superior mesenteric artery, using a glass coil kept at 40°C. Blood required to fill the tubing initially is obtained from donor rats. Heparin is administered intravenously to the animals prior to cannulation of the mesenteric artery. The blood pressure and the perfusion pressure are measured by Statham P 23 Db pressure transducers and recorded through a 2channel Hellige recorder. The pump speed is initially adjusted so that the perfusion pressure equals the systemic blood pressure. Intraarterial injections into the mesenteric vascular bed are made by puncturing the tubing going towards the periphery. Intravenous injections are made through a cannula inserted into the external jugular vein.

Changes in the vascular resistance are measured by comparing perfusion pressure before and after drug administration. If constant blood flow is maintained, changes in the vascular resistance of the perfused bed are directly proportional to changes in the perfusion pressure.

During controlled pulmonary blood flow, lobar arterial pressure can be measured in anesthetized cats (Lippton et al. 1984; Hyman et al. 1989; McMahon and Kadowitz 1993; deWitt et al. 1994) .

Adult cats of either sex weighing 2.5 to 4.5 kg are sedated with ketamine hydrochloride (10-15 mg/kg i.m.) and anesthetized with pentobarbital sodium (30 mg/ kg i.v.). The animals are fixed in supine position and supplemental doses of anesthetic are administered to maintain a uniform level of anesthesia. The trachea is intubated and the animals breath room air enriched with 95% O 2 /5% CO 2 . Systemic arterial pressure is measured from a catheter inserted into the aorta from a femoral artery, and intravenous injections are made from a catheter positioned in the inferior vena cava from a femoral vein.

For perfusion of the left lower lung lobe, a special designed 28-cm 6F triple-lumen balloon perfusion catheter (Arrow International, Reading, PA) is passed under fluoroscopic guidance from the left external jugular vein into the artery to the left lower lobe. The animal is heparinized by 1000 IU/kg i.v., and the lobar artery is isolated by distension of the balloon cuff on the perfusion catheter. The lobe is then perfused by way of the catheter lumen beyond the balloon cuff, with blood withdrawn from a femoral artery with a perfusion pump. Lobar arterial pressure is measured from a second port 5 mm from the cuff on the perfusion catheter. The perfusion rate is adjusted so that lobar arterial perfusion pressure approximates mean pressure in the main pulmonary artery. Left atrial pressure is measured with a 6F double-lumen catheter passed transseptally into the vein draining the left lower lobe. The catheter tip is positioned so that the left atrial pressure port on the distal lumen is 1-2 cm into the lobar vein and the second catheter port is near the venoatrial junction.

Lobar arterial pressure can be elevated to an high steady state level by the administration of N ω -nitro-Larginine ω , followed by an intralobar infusion of the stable prostaglandin/endoperoxide analogue U-46619.

Dose-response curves after administration of graded doses of drugs, e. g., decrease of lobar arterial pressure

Skeletal muscle is stimulated until it reaches its maximal force of contraction. This means that the muscle is forced to function at a level near exhaustion and has to use maximally the substrate supplied by the circulation. Then, the femoral artery is occluded, leading to underperfusion and a subsequent lack of substrate. As a consequence, the muscle's force of contraction decreases rapidly. Measuring the change in contractile force caused by drug administration reveals a drug's ability to restore ischemic muscle functions. In the following procedure, the drugs are tested for their effect on the force of contraction of the ischemic skeletal muscle.

Male Wistar rats weighing 400-450 g are anaesthetized by intraperitoneal administration of pentobarbital (Nembutal) (35 mg/kg). A tracheal tube is placed to assist the rat's ventilation. The left carotid artery is cannulated for blood pressure recording and the left jugular vein is cannulated for the i.v. administration of test drugs. An incision is made to the skin of the right pelvic limb distal to the groin and the skeletal muscle is exposed down to the ankle. The skin is carefully trimmed away from the muscle to assure that contractions cannot be impaired by retraction of the skin. The major nerve supply is severed and a small length of the descending branch of the femoral artery is prepared free. The freely hanging muscle is attached to the force transducer (range 0-500 g, Z 6, Rhema, Germany) and a resting tension of 50 g is placed on the muscle. To prevent dehydration, the skin is left attached to the muscle and the muscle is kept moist by the continuous drip of a 0.9% NaClsolution.

After these preparations, the rat is allowed to recover at least 30 min. Two needle electrodes are inserted into the muscle. Square impulses of 40 ms are generated with Stimulator 1 (Hugo Sachs Elektronik, Freiburg, Germany). The muscle is stimulated with a frequency of about 80 contractions per minute. The amplitude is increased gradually up to the muscle's maximal contractile force (usually between 2.0 and 3 mA). Following stabilization, the femoral artery is occluded with a clip for 5 min and subsequently reopened. After at least 15 min, test drugs are administered by intravenous infusion (0.075 ml/min) for 10 min. Five minutes after starting drug infusion, the artery is clamped again (for 5 min) while drug infusion is still going on. The force of contraction is continuously recorded. After declamping the artery, the rat is allowed to recover for at least 30 min before the whole procedure is repeated with another test drug. In this way, 3 different compounds can be tested in the same animal.

Standard compound:

• pentoxifylline

The following parameters are measured:

• the percent inhibition of contractile force before drug administration (artery being clamped) • the percent inhibition of contractile force after drug administration (artery being clamped)

The percent increase in contractile force after drug administration is calculated.

An attempt is made to measure not only the effects of the drug on vasculature tonus but also on muscle metabolism. Weselcouch and Demusz (1990) studied drug effects in the ischemic hindlimbs of ferrets. The hindlimb was stimulated to contract isometrically via supramaximal electrical stimulation of the sciatic nerve. Ischemia was induced by partial occlusion of the abdominal aorta. Pentoxifylline attenuated the loss of function in a dose-related manner. Okyayuz-Baklouti et al. (1992) studied the functional, histomorphological and biochemical changes in atrophying skeletal muscle using a novel immobilization model in the rat.

Le Tallec et al. (1996) reported the effects of dimethylformamide on in vivo fatigue and metabolism in rat skeletal muscle measured by 31P nuclear magnetic resonance spectroscopy.

compounds. The isolated rabbit's ear is used to determine the effect of test compounds on its perfusion rate. Administration of norfenephrine induces vasoconstriction leading to a decrease in perfusion rate. A compound with vasodilatory properties will inhibit the norfenephrine induced fall in perfusion rate whereas a vasoconstrictor will potentiate this effect. Miyahara et al. (1993) used arterial rings rabbit ear arteries in vitro which were contracted by perivascular nerve stimulation, or 5 × 10 −7 noradrenaline or high potassium (29.6 mM) solution. High doses of dexamethasone or clobetasol-17-propionate decreased the amplitude of contractions. Furthermore, the authors performed in vivo experiments in albino rabbits, whereby the fur was removed from the distal parts of the ear by applying a depilatory cream at least 24 h before the experiments. The apical regions of the ear were then stripped with adhesive tape 7 times to remove the keratinous epidermal layer. The rabbit was anesthetized and the experimental parts of the ear were placed under a high resolution magnifying camera and immobilized using bilayer adhesive tapes. The vascular reactions induced by topical application of corticosteroids were recorded chronically using videotapes.

Aoki and Chiba (1993) described a method for separate intraluminal and extraluminal perfusion of the basilar artery in dogs. A polyethylene roof was designed to cover the canine basilary artery so that an extraluminal superfusion stream could pass over the artery that simultaneously received an intraluminal perfusion.

Veins can be classified into two groups: those that respond and those that do not respond to epinephrine, acetylcholine and sympathetic nerve stimulation. As studies in dogs have shown (Rice et al. 1966 ) the reactive veins have a considerable amount of smooth muscle whereas the nonreactive ones lack any appreciable amount of smooth muscle fibres in the tunica media. A special preparation allows the registration of localized venous vasoconstriction.

Dogs weighing 20-30 kg are anesthetized with 35 mg/kg pentobarbital sodium i.v. The trachea is cannulated and the dog ventilated with a respiration pump. The femoral vein is cannulated for systemic injections. After administration of 5 mg/kg heparin sodium i.v., the saphenous vein and the femoral artery are cannulated. The venous cannula is placed approximately 1 cm distal to its junction with another vein. After the non-perfused branch of the junction is ligated, constant blood flow is maintained from the femoral artery by using a Sigmamotor pump. The flow is adjusted so that a normal physiologic pressure in the vein is maintained. Perfusion pressure is measured between the pump and the vein so that any changes in pressure reflect changes in venous resistance. The peak changes in perfusion pressure are used to measure pressure changes from recorded data. The blood flow is maintained on a constant level. Therefore, changes in pressure must reflect changes in resistance. Pressure is recorded with a polygraph using an Statham pressure transducer (P23AA). In addition to recording perfusion pressure, venous pressure is measured at two additional points along the vein. In order to record venous pressure centrally from the site of perfusion, the shaft of a 27-gauge needle is placed into the end of a 10 cm piece of a thin Silastic tubing. At the other end, a 27 gauge needle is inserted and attached to a Statham pressure transducer (P23B). Pressure is recorded on a polygraph. One needle is inserted into the vein just proximal of the junction of the two veins. The second needle is placed into the vein so that the distance between the tip of the perfusion cannula and the first needle is the same as the distance between the two needles. In this way pressure decreases across the junction and an adjacent segment can be measured simultaneously. Injections of test compounds are made into the cannula between the pump and the saphenous vein. Changes in pressure measured by the three transducers are recorded. As standard, doses of 0.1-1.0 µg norepinephrine are injected.

Responses to test drugs are measured in mm Hg and calculated as percentage of response to norepinephrine.

clinic standard to diagnose abdominal aortic aneurysm some proliferator-activated receptor γ ligands are potent inhibitors of angiogenesis in vitro and in vivo. J Biol Chem 274:9116-9121

The chick chorioallantoic membrane assay, originally described by Auerbach et al. (1974) , has been used with some modifications by several authors to test angiogenesis and inhibition of angiogenesis, e. g., by Taylor and Folkman (1982) , , Vu et al. (1985) , McNatt et al. (1992 , , , Gagliardi and Collins (1993) , , Ribatti et al. (1995) , , Oikawa and Shimamura (1996) , , O' Reilly et al. (1997 ), Iurlaro et al. (1998 , , .

Fertilized White Leghorn chicken eggs are incubated at 37°C at constant humidity. On incubation day 3, a square window is opened in the shell and 2 to 3 ml of albumen is removed to allow detachment of the developing chorioallantoic membrane (CAM). The window is sealed with a glass and the eggs are returned to the incubator. On day 8, 1 mm 3 gelatin sponges loaded with 3 µl phosphate-buffered saline alone as the negative control or containing 3 µg (1 mg/ml) of the angiogenic recombinant basic fibroblast growth factor alone as positive control, or together with various doses of test compound, are implanted on top of the CAM. The sponge traps the sample and allows slow release of the product. CAM are examined daily until day 12, when the angiogenic response peaks. On day 12, blood vessels entering the sponge within the focal plane of the CAM are recognized microscopically, counted by two observers in a double-blind fashion under a Zeiss SR stereomicroscope, and photographed in ovo with the MC63 Camera system (Zeiss, Oberkochen, Germany). To better highlight vessels, the CAM are injected into a large allantoic vein with India ink solution, fixed in Serra's fluid, dehydrated in graded ethanols, and rendered transparent in methylbenzoate. On day 12, after microscopic counting, the embryos and their membranes are fixed in ovo in Bouin's fluid. The sponges and the underlying and immediately adjacent CAM portions are removed, embedded in paraffin, sectioned at 8 µm along a plane parallel to the CAM surface, and stained with a 0.5% aqueous solution of toluidine blue.

Angiogenesis is measured by a planimetric point count method ): four to six 250 × magnification fields covering almost the whole of every third section within 30 serial slides of each sponge per sample are analyzed within a superimposed 144 intersection point square reticulum of 0.125 mm 2 . Only transversely sectioned microvessels, ie, capillaries and venules with or without a 3 to 10 µm lumen occupying the intersection points, are counted and calculated as the mean ± 1 SD per section, per CAM, and groups of CAM. Statistical significance of differences is calculated by comparing the data from each experiment to their controls using Student's t-test. Oh et al. (1997) studied the lymphatics of differentiated avian chorioallantoic membrane using microinjection of Mercox resin, semi-and ultrathin sectioning, immunohistochemical detection of fibronectin and α-smooth muscle actin, and in situ hybridization with vascular endothelial growth factor VEGFR-2 and VEGFR-3 probes.

Using the chick chorioallantoic membrane assay, Giannopoulou et al. (2003) showed that amifostine, an inorganic thiophosphate-cytoprotective agent, inhibits angiogenesis in vivo. Lichtenberg et al. (1997 Lichtenberg et al. ( , 1999 recommended the subcutaneous air sac model in rats as a simple method for in vivo screening of antiangiogenesis. Subcutaneous injection of air in the rat results in the formation of an air pouch. If air pouches are kept inflated by repeated injections of air the develop a structure of synovial lining (Edwards et al. 1981) . The subcutaneous air pouch appears more like a bursal cavity than a synovial joint (Kowanko et al. 1986 ) and after 8-10 days the cells of the air sac appear as a transparent membrane on which the formation of new vessels can be studied.

Under anesthesia 10-15 ml of air is introduced dorsally to female Sprague Dawley rats weighing 150-180 g by subcutaneous injections using a 25 gauge needle to produce an air sac located approximately 4-5 cm behind the head of the animal. The air sacs are re-inflated every forth day. The wall of the air sac becomes progressively thicker with time and after approximately 10 days a sufficient lining of cells has been established. For sponge implantation, the animals are anesthetized again. A 1.5 cm incision is made through the clipped skin covering the air sac and blunt dissection is used to open a 2 cm deep cavity towards the cranial base of the air sac by careful separation of the skin from the membrane. A cellulose implant (Spontex sponge) with a diameter of 8 mm is carefully pressed into the cavity of the membrane away from the incision site and the incision closed by sutures. The animals are treated for 10 days with various doses of test compound in a volume of 10 ml/kg or vehicle. The subcutaneous injection is made under light CO 2 /O 2 anesthesia into the hind leg 5-7 cm away from the air sac. This injection site is chosen to eliminate any risk of inducing irritative side-effects on the membrane. After 10 days treatment, the animals are sacrificed after having received 20 min before an injection of 1 µCi of 125 I-labelled immunoglobulin via the tail vein. The overlying skin of the air sac is removed to expose the transparent membrane. The extent of vascular proliferation is scored in situ: 1+: slight background vascularization; 2+: few new vessels reach the sponge; 3+: many new vessels reach and penetrate the implant; 4+: very intense formation of new vessels which reach and penetrate the implant.

Following in situ scoring, the implant and the membrane from each animal are placed in the same plastic vial containing 10% formalin and the radioactivity is measured in a γ -counter. The implants are examined microscopically after staining with haematoxylin and eosin.

The extent of vascular proliferation scored in situ is compared between vehicle and treated animals by the Wilcoxon test. The angiogenic response measured by 125 I-activity in cpm is subjected to analysis of variance followed by Dunnett's t-test to compare each dose with the vehicle. The cpm's are log-transformed to obtain variance homogeneity. The correlation between in situ scores and cpm is estimated by Spearman's rank correlation coefficient after ranking cpm values.

In a further study, Lichtenberg et al. (1999) inoculated vascular endothelial growth factor producing tumor cells subcutaneously directly on the membrane, and the formation of vessels was measured 8 days later. Furthermore, slow-release pellets containing angiogenic factors, basic fibroblast growth factor or vascular endothelial growth factor, were implanted on the subcutaneous membrane. Nakamura et al. (1999) studied suppression of angiogenesis induced by S-180 mouse tumor cells in the dorsal air sac assay in mice. Funahashi et al. (1999) developed a mouse dorsal air sac model for quantifying in vivo tumor-induced angiogenesis which is determined by measuring the blood volume in an area of skin held in contact with a tumor cell-containing chamber, using 51 Cr-labeled red blood cells. Schreiber et al. (1986) described the hamster cheek pouch assay for testing angiogenic/antiangiogenic activity. a new and simple method for in vivo screening of antiangiogenesis. Pharmacol Toxicol 81:280-284 Lichtenberg J, Hjarnaa P JV, Kristjansen PEG, Hansen D, Binderup L (1999) The rat subcutaneous air sac model: A quantitative assay of antiangiogenesis in induced vessels. Pharmacol Toxicol 84:34-40 Nakamura M, Katsuki Y, Shibutani Y, Oikawa T (1999) Dienogest, a synthetic steroid, suppresses both embryonic and tumor-cell-induced angiogenesis. Eur J Pharmacol 386:33-40 Schreiber AB, Winkler ME, Derynk R (1986) Transforming growth factor-α: a more potent angiogenic factor than epidermal growth factor. Science 232:1250-1253 Norrby et al. (1986 Norrby et al. ( , 1990 Norrby et al. ( , 1995 described the mesenteric window assay in rats for quantitative measurement of induction and inhibition of angiogenesis. The tissue being used is the membranous, 'window'-like parts of the mesentery which is normally vascularized and appears to lack significant physiologic angiogenesis. Since the mesenteric window natively measures only 5-10 µm in thickness, the vasculature is virtually two-dimensional. Due to the structural and metabolic simplicity of the test tissue, the mesenteric window microvasculature is regarded as an ideal test system for establishing the functional influences of defined factors (Zweifach 1973 ).

Angiogenesis is induced by i.p. injection of the mastcell secretagogue compound 48/80 twice daily for 4.5 days to male Sprague Dawley rats weighing about 225 g. Test compounds or saline are injected s.c. 1 h before each injection of compound 48/80. Angiogenesis is quantified by microscopically counting the number of vessel profiles per unit length of the mesenteric window in 4 microtome sections per specimen, cut perpendicularly to the surface, from the central part of the window. This reflects the degree of branching, the degree of tortuosity and the degree of spatial expansion of the vasculature. Four specimens per animal are analyzed.

Four mesenteric window specimens are spread, fixed on objective slides and stained with toluidine blue to measure the relative vascularized area. Three randomly selected vascular view fields per mesentericwindow spread are analyzed for microvascular length per unit area of vascularized tissue. The total microvascular length is computed from the vascularized area of each animal multiplied by the mean microvascular length for the corresponding treatment group.

The non-parametric two-tailed Mann-Whitney U rank sum test for unpaired observations is used for statistical analysis. C expression and secretion using a polyclonal anti-VEGF-C antiserum.

The cells were grown to 80% confluence in 75cm 2 tissue culture flasks (Nunc, Roskilde, Denmark). Conditioned media was collected under low-serum (2%) growth conditions. Tumor tissues were snapfrozen in liquid nitrogen and homogenized in RIPA buffer (0.1% SDS, 1% IGEPAL CA-630, 0.5% Na-deoxycholate, protease-inhibitor cocktail in phosphatebuffered saline).

The VEGF-C antibody 4080 was isolated from serum using HiTrap Protein-A Sepharose columns. Then, depletion of the anti-his antibody fraction was done by antigen-affinity purification using 10 mg of immobilized 6H-tagged TxnTb protein [Tryparedoxin (Txn) from Trypanosoma brucei (Tb)]. Antigen-affinity purification for the antibody 4080 was performed by immobilizing 1 mg rat VEGF-C on an NHS-activated Hi-Trap column (Amersham Bioscience, Freiburg). The development of a highly sensitive and specific sandwich ELISA for VEGF-C was done using standard methods. Rabbit IgG 4080 (10 µg/ml) was used for coating and the antigen-affinity purified and biotinylated antibody 4080 at 1 µg/ml was used as a detector antibody. Biotinylation of antibody 4080 was done with 6 mg IgG in 100 mM carbonate buffer, pH 8.5 at 3 mg/ml with using biotin-amidohexanoic acid NHS (Sigma, St. Louis, Mo., USA). The molecular ratio biotin:protein was 30:1. As a standard, human and rat dNdC-VEGF-C was used over a concentration range between 0.1 and 6.25 ng/ml. For visualization of the detector, streptavidin-enzyme conjugate was used (Endogen, Woburn, Mass., USA) followed by the addition of TMB (tetra-methyl-benzidine; Roche Mannheim, Germany).

After stopping the reaction with 1 M H 2 SO 4 , the absorbance was measured at 450 and 620 nm with an ELISA plate reader (Labsystems, Finland). Generally, the samples were analyzed in different dilutions, measuring each dilution in duplicate. Samples were diluted at least 1:2 with sample diluent (BenderMedSystems, Vienna). Rissanen et al. (2003) found that VEGF-D is the strongest angiogenesis and lymphangiogenetic factor among VEGFs delivered into skeletal muscle via adenoviruses. overnight, embedded in OCT, cryostat sectioned, and viewed by fluorescence microscopy.

A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding

The pathogenesis and medical management of glaucoma

Forskolin lowers intraocular pressure in rabbits, monkeys and man

Bronchodilating activity of forskolin in vitro and in vivo

Forskolin, adenylate cyclase and cell physiology: An overview

Newquist KL (1979) Labetalol binding to specific alpha-and beta-adrenergic sites in vitro and its antagonism of adrenergic responses in vivo

Cardiac adenylate cyclase activity, positive chronotropic and inotropic effects of forskolin analogs with either low, medium or high binding site activity

The cyclic AMP cascade: A signal transduction system

Cardiotonic and coronary vasodilator responses to milrinone, forskolin, and analog P87-7692 in the anesthetized dog

Vasodilatory effect of adrenomedullin in mouse aorta

Coexpression of preproadrenomedullin with a putative adrenomedullin receptor gene in vascular smooth muscle

Effects of adrenomedullin, calcitonin gene-related peptide, and amylin on cerebral circulation in dogs

), a novel analog of adrenomedullin, possesses potent vasodilator activity in the hindlimb vascular bed of the cat

Analysis of the responses to human synthetic adrenomedullin and calcitonin generelated peptides in the hindlimb vascular bed of the cat

Effect of centrally or peripherally injected adrenomedullin on reserpine-induced gastric lesions

Comparison of responses to adrenomedullin and calcitonin gene-related peptide in the pulmonary vascular bed of the cat

Effect of adrenomedullin on renal hemodynamics and function in dogs

Biological and clinical roles of adrenomedullin in circulation control and vascular diseases

Cardiovascular and neurohormonal effects of intravenous adrenomedullin in conscious rabbits

Adrenotensin: An adrenomedullin gene product contracts pulmonary blood vessels

Analyses of responses to adrenomedullin-(-3.52) in the pulmonary vascular bed of rats

Role of nitric oxide-cAMP pathway in REFERENCES AND FURTHER READING

Human urotensin II is an endothelium-dependent vasodilator in rat small arteries

Unravelling the active conformation of urotensin II

Structural requirements at the N-terminus of urotensin II octapeptides

Differential vasoconstrictor activity of human urotensin II in vascular tissue isolated from the rat, mouse, dog, pig, marmoset and cynomolgus monkey

Human urotensin-II as a novel cardiovascular target: "heart" of the matter or simply a fishy "tail

Recent structure-activity studies of the peptide hormone urotensin II, a potent vasoconstrictor

Contraction of major artery segments of rat by fish neuropeptide urotensin II

Vasodilator effect of urotensin II, one of the most potent vasoconstricting factors, on rat coronary arteries

Is urotensin-II the new endothelin?

Urotensin II: a somatostatinlike peptide in the caudal neurosecretory system of fishes

Animal techniques for evaluating sympathomimetic and parasympathomimetic drugs

Techniques for the collection of lymph from the liver, small intestine, or thoracic duct of the rat

Surgical technique for long-term studies of thoracic duct circulation in the rat

Ligation of the thoracic duct in dogs

Ligation of the thoracic duct in dogs

Permanent cannulation of the thoracic duct

Unpublished data REFERENCES AND FURTHER READING

Animal techniques for measuring drug effects on various peripheral vascular beds

Effect of Polymyxin B on experimental shock from meningococcal and Escherichia coli endotoxins

Evaluation of cardiac output, total peripheral vascular resistance, and plasma concentrations of vasopressin in the conscious, unrestrained rat during endotoxemia

Suppression of ischemia-reperfusion injury by liposomal superoxide dismutase in rats subjected to tourniquet shock

Effect of dipyrone on tourniquet shock

The uniform production of experimental shock by crush injury: possible relationship to clinical crush syndrome

The effect of methylprednisolone on the experimental tourniquet shock in dogs

Effect of high-dose of methylprednisolone on tourniquet ischaemia

Local blood flow changes in the renal cortex during tourniquet and burn shock in rats

Effect of tournique ischemia on carbohydrate metabolism in dog skeletal muscle

Use of ranks in one-criterion variance analysis

Substrate specificity and inhibitor structure-activity relationships of recombinant human renin: implications in the in vivo evaluation of renin inhibitors

RO 42-5892 is a potent orally active renin inhibitor in primates

Renin inhibitors

A highly potent and long-acting oral inhibitor of human renin

Effects of the renin inhibitor N-[N-(3-(4-amino-1-piperidinylcarbonyl)-2(R)-benzylpropionyl)-L-histidinyl]-(2S,3R,4S)-1-cyclohexyl-3,4-dihydroxy-6(2-pyridyl)-hexane-2-amide acetate (S 2864) in anesthetized rhesus monkeys

Effects of a specific and long-acting renin inhibitor in the marmoset

Haemodynamic effects of acute and chronic renin inhibition in marmosets

CGP 38 560: orally active, low-molecular-weight renin inhibitor with high potency and specificity

Rabbits as models for impotence research

The oral efficacy of verdenafil hydrochloride for inducing penile erection in a conscious rabbit model

A conscious rabbit model is able to demonstrate the efficacy of verdenafil and sildenafil on penile erection

A conscious-rabbit model to study verdenafil hydrochloride and other agents that induce penile erection

Effect of the selective phosphodiesterase type 5 inhibitor sildenafil on erectile dysfunction in the anaesthetized dog

Efficacy of verdenafil and sildenafil in facilitating penile erection in an animal model

Verdenafil increases penile rigidity and tumescence in erectile dysfunction patients: a RigiScan and pharmacokinetic study

The rabbit as an intracavernous injection study model

Sildenafil augments pelvic nervemediated female sexual arousal in the anesthetized rabbit

Neuroleptics induce penile erection in the rabbit

The efficacy and tolerability of vardenafil, a new, oral, selective phosphodiesterase type 5

patients with erectile dysfunction: the first athome clinical trial

The phosphodiesterase inhibitory selectivity and the in vitro and in vivo potency of the new PDE5 inhibitor verdenafil

Principal mechanisms controlling penile retraction and protrusion in rabbits

Medullary regions controlling the erection and retraction of the penis in rabbits

Experimental and Genetic Models of Hypertension

Antihypertensive agents

Enhanced release of endothelium-derived relaxing factor in mineralocorticoid hypertension

Dietary suppression of prostaglandin synthesis does not accelerate DOCA/salt hypertension in rats

Elevated arterial cyclic AMP levels during the development of one kidney, one clip and DOCA hypertension in rats

The relation of cellular sodium to the onset of hypertension induced by DOCA-saline in the rat

Cortical and medullary hemodynamics in desoxycorticosterone acetate-salt hypertensive mice

Chronic effects of lovastatin and bezafibrate on cortical and medullary hemodynamics in desoxycorticosterone acetatesalt hypertensive mice

Metabolic studies of uridine in rats with DOCA-salt hypertension and on high sodium diet

Cytochrome P450-dependent renal arachidonic acid metabolism in desoxyxcorticosterone acetate-salt hypertensive mice

The endothelium partially obscures enhanced microvessel reactivity in DOCA hypertensive rats

Effect of antihypertensive treatment and N ω -nitro-L-arginine methyl ester on cardiovascular structure in deoxycorticosterone acetate-salt hypertensive rats

Suppression of rat desoxycorticosterone-salt hypertension by the kallikrein-kinin system

High sensitivity to salt in kininogen-deficient Brown Norway Katholiek rats

Role of the antiglucocorticoid RU 486 in the prevention of steroid-induced hypertension

Production of hypertension with desoxycorticosterone acetate-impregnated silicone rubber implants

Separate hemodynamic roles for chloride and sodium in deoxycorticosterone acetate-salt hypertension

Altered pulmonary vascular smooth muscle responsiveness in monocrotaline-induced pulmonary hypertension

Noradrenaline, atrial natriuretic peptide, bombesin and neurotensin in myocardium and blood of rats in congestive cardiac failure

Changes in pulmonary structure and function induced by monocrotaline intoxication

Vascular hyperresponsiveness in perfused lungs from monocrotaline-treated rats

Interleukin-1 bioactivity in the lungs of rats with monocrotaline-induced pulmonary hypertension

Impaired endothelium-dependent relaxation by adrenomedullin in monocrotaline-treated rat arteries

Increased vascular responsiveness in lungs of rats with pulmonary hypertension induced by monocrotaline pyrrole

Pneumotoxicity and thrombocytopenia after single injection of monocrotaline

Arterial changes in Crotalaria spectabilis-induced pulmonary hypertension in rats

The effect of a pyrrolizidine alkaloid, monocrotaline, and a pyrrole, dehydroretronecine, on the biochemical functions of the pulmonary endothelium

DA-8159, a potent cGMP phosphodiesterase inhibitor, attenuates monocrotaline-induced pulmonary hypertension in rats

Attenuation of myocardial ischemia/reperfusion injury by superinduction of inducible nitric oxide synthase

Angiotensinconverting enzyme inhibitor preserves p21 and endothelial nitric oxide synthase expression in monocrotaline-induced pulmonary arterial hypertension in rats

Hypoxemia and elevated tachykinins in rat monocrotaline pneumotoxicity

Fibrin thrombosis in monocrotaline pyrrole induced cor pulmonale in rats

L-arginine-related responses to pressure and vasoactive agents in monocrotaline-treated rat pulmonary arteries

Development of pulmonary arterial changes in rats fed Crotalaria spectabilis

Development of Crotonolaria pulmonary hypertension: A hemodynamic and structural study

Monocrotaline-induced pulmonary fibrosis in rats: Amelioration by captopril and penicillamine

Monocrotaline-induced cardiopulmonary damage in rats: amelioration by the angiotensin-converting enzyme inhibitor CL242817

Effects of prostaglandin E 1 (PGE 1 ) on pulmonary hypertension and lung vascular remodelling in a rat monocrotaline model of human pulmonary hypertension

Independent dual perfusion of left and right coronary arteries in isolated rat hearts

Electrophysiologic evaluation of cardiovascular agents in the isolated intact rabbit heart

Relationship between myocardial oxygen consumption, coronary flow, and adenosine release in an improved isolated working heart preparation of guinea pigs

Direct measurement of energy metabolism in the isolated rat heart

A workperforming heart preparation for myocardial performance analysis in murine hearts

Measurement of coronary flow reserve in isolated hearts from mice

The Langendorff heart preparation -Reappraisal of its role as a research and teaching model for coronary vasoactive drugs

Effect of treppe on isovolumic function in the isolated blood-perfused mouse heart

Cardiovascular activity of sympathomimetic amines

Anoxia and ventricular fibrillation: With a summary of evidence on the cause of fibrillation

Effect of lack of glucose and of lack of oxygen on ventricular fibrillation

Screening of inotropic drugs on isolated rat and guinea pig hearts

The potential of epicardial activation mapping in isolated hearts for the assessment of arrhythmogenic and antiarrhythmic drug activity

The isolated perfused warm-blooded heart according to LANGENDORFF. Technique -Function -Application

Characterization of an isolated, working heart guinea-pig heart including effects of histamine and noradrenaline

Phosphorus NMR studies on perfused heart

Effect of iloprost on serum creatine kinase and lactate dehydrogenase isoenzymes after isoprenaline-induced cardiac damage in rats

Exercise training, indomethacin, and isoproterenol-induced myocardial necrosis in rats

Effects of diltiazem on force, [Ca 2+ ] i , and energy metabolism in porcine coronary artery

Protective effect of the new calcium antagonist Anipamil against isoprenaline-induced cardionecrosis in rats

Catecholamine-induced cardiac necroses: Protective effect of leucocytopenia, influence of an S2 antagonist, thromboxansynthetase inhibitor and prostacyclin analogue

Isoproterenol-induced myocardial necrosis. A histochemical and electron microscopic study

Quantitative assessment of infarct size in isoproterenol-infarcted rats

Isoproterenol-induced myocardial infarction in animals

Determinants of resistance to the cardiotoxicity of isoproterenol in rats

Quantification of myocardial necrosis and cardiac hypertrophy in isoproterenol-treated rats

Acute angiotensin-converting enzyme inhibition increases the plasma level of the natural stem cell regulator N-acetylseryl-aspartyl-lysyl-proline

Acute angiotensin-converting enzyme inhibition increases the plasma level of the natural stem cell regulator N-acetylseryl-aspartyl-lysyl-proline

High plasma level of N-acetyl-seryl-aspartyl-lysyl-proline. A new marker of chronic angiotensin-converting enzyme inhibition

Sustained cardiomyocyte apoptosis and left ventricular remodelling after myocardial infarction in experimental diabetes

Markedly different effects on ventricular remodelling result in a decrease in inducibility of ventricular arrhythmias

The effect of β-adrenoreceptor blocking agents on evolving myocardial necrosis in coronary ligated rats with and without reperfusion

Increase of G iα in human hearts with dilated but not ischemic cardiomyopathy

Radioimmunochemical quantification of G iα in right and left ventricles from patients with ischemic and dilated cardiomyopathy and predominant left ventricular failure

Inhibition and reversal of myocardial infarction-induced hypertrophy and heart failure by NHE-1 inhibition

Protective effects of simultaneous alpha and beta adrenergic receptor blockade on myocardial cell necrosis after coronary arterial occlusion in rats

Models of myocardial ischemia and reperfusion injury: Role of inflammatory mediators in determining infarct size. Pharmacological Methods in the Control of Inflammation

Experimental myocardial infarction in the rat. Qualitative and quantitative changes during pathologic evolution

Identification and quantification of histochemical border zones during the evolution of myocardial infarction in the rat

Diltiazem pretreatment reduces experimental myocardial infarct size in rat

Use of the ferret for a myocardial ischemia/salvage model

Heart failure and greater infarct expansion in middle-aged mice: a relevant model for postinfarction failure

Demonstration of an early and a late phase of ischemic preconditioning in mice

Late preconditioning induced by NO donors, adenosine A 1 receptor agonists, and δ 1 -opioid receptor agonists is mediated by iNOS

Reduction in the severity of myocardial infarction by sulfinpyrazone

Cardiomyocyte-specific overexpression of nitric oxide synthase 3 improves left ventricular performance and reduces compensatory hypertrophy after myocardial infarction

Experimental myocardial infarction. I. A method of by coronary occlusion in small animals

Cardioprotective actions of acute HMG-CoA reductase inhibition in the setting of myocardial infarction

Myocyte cellular hyperplasia and myocyte cellular hypertrophy contribute to chronic ventricular remodeling in coronary artery narrowing-induced cardiomyopathy in rats

Connexin43 as a determinant of myocardial infarct size following coronary occlusion in mice

Experimental myocardial infarction in the rat

Increase in G iα protein accompanies progression of post-infarction remodelling in hypertensive cardiomyopathy

G-CSF/SCF reduces inducible arrhythmias in the infracted heart potentially via increased connexin43 expression and arteriogenesis

Inhibition of cyclooxygenase-2 improves cardiac function after myocardial infarction in the mouse

Is plasma Ac-SDKP level is a reliable marker of chronic angiotensin-converting enzyme inhibition in hypertensive patients

Effect of non-steroid antiinflammatory drugs in experimental myocardial infarction in rats

ACE inhibition decreases postoperative mortality in rats with left ventricular hypertrophy and myocardial infarction

Chronic heart failure induced by coronary artery ligation in Lewis inbred rats

Chronic myocardial infarction in the mouse: cardiac structural and functional changes

Long-term preservation of ischemic myocardium after experimental coronary artery occlusion

Myocardial ischemia and reperfusion: a murine model

Myocardial infarction and remodeling in mice: effect of reperfusion

Postinfarction survival and inducibility of ventricular arrhythmias in the spontaneously hypertensive rat. Effects of ramipril and hydralazine

Influence of chronic captopril therapy on the infarcted left ventricle of the rat

A simple, automatic method for morphometric analysis of the left ventricle in rats with myocardial infarction

Antifibrotic effect of Ac-SDKP and angiotensin converting enzyme inhibition in hypertension

Topographic changes in the left ventricle after experimentally induced myocardial infarction in the rat

Evaluation of drug effects in a new experimental model of angina pectoris in the intact anesthetized rat

Echocardiographic determination of risk area in a murine model of myocardial ischemia

Protective effects of HOE 642, a selective sodium-hydrogen exchange subtype 1 inhibitor, on cardiac ischemia and reperfusion

Simple techniques for the surgical occlusion of coronary vessels in the rat

N-Acetyl-seryl-aspartyl-lysine-proline prevents renal insufficiency and matrix expansion in diabetic db/db mice

Beneficial effects of long-term use of the antioxidant probucol in heart failure in the rat

Regulation of myocardial connexins during hypertrophic remodelling

Myocardial ischemia and infarction

Effects of the β-blocking agent Atenolol on arrhythmias especially ventricular fibrillation and fibrillation threshold after acute experimental coronary artery occlusion

Cardioprotective effects of heparin or N-acetylheparin in an in vivo model of myocardial and ischemic reperfusion injury

Comparison between the effects of nitroprusside and nitroglycerin on ischemic injury during acute myocardial infarction

Myocardial and interstitial matrix metalloproteinase activity after acute myocardial infarction in pigs

Prevention of ischemic rigor contracture during coronary occlusion by inhibition of Na + -H + exchange

A model of multivessel coronary artery disease using conscious, chronically instrumented dogs

Comparison of triphenyltetrazolium chloride (TTC) staining versus detection of fibronectin in experimental myocardial infarction

Myocardial protection by Na + /H + exchange inhibition in ischemic, reperfused porcine hearts

Time delay of cell death by Na + /H + exchange inhibition in regionally ischemic, reperfused porcine hearts

Comparison of various methods for assessing infarct-size in the dog

Reduction of infarct size by local angiotensin-converting enzyme inhibition is abolished by a bradykinin antagonist

Macroscopic identification of early myocardial infarcts by alterations in dehydrogenase activity

A model of transient myocardial dysfunction in conscious dogs

Animal models for protecting ischemic myocardium: Results of the NHLBI cooperative study. Comparison of unconscious and conscious dog models

Experimental coronary artery occlusion. I. Measurement of infarct size

Characterization and localization of ventricular arrhythmias resulting from myocardial ischemia and infarction

Na-H exchange inhibition with cariporide limits functional impairment due to repetitive ischemia

Non-invasive magnetic resonance assessment of myocardial changes and the effects of angiotensin-converting enzyme inhibition in diabetic rats

Magnetic resonance imaging analysis of cardiac cycle events in diabetic rats: the effect of angiotensin-converting enzyme inhibition

A 64 MHz half-birdcage resonator for clinical imaging

Cardiac failure in transgenic mice with myocardial expression of tumor necrosis factor-α

Magnetic resonance imaging and invasive evaluation of development of heart failure in transgenic mice with myocardial expression of tumor necrosis factor-α

A model of chronic heart failure in spontaneous hypertensive rats (SHR)

Quantitative ischemia detection during cardiac magnetic resonance stress testing by use of FastHARP

The estrogen receptorα agonist 16α-LE2 inhibits cardiac hypertrophy and improves hemodynamic function in estrogen-deficient spontaneously hypertensive rats

Quantitative MR imaging of the heart

Integration of cardiac magnetic resonance imaging with three-dimensional electroanatomic mapping to guide left ventricular catheter manipulation. Feasibility of a porcine model of healed myocardial infarction

Analysis of right ventricular function in healthy mice and a murine model of heart failure by in vivo MRI

A simple planimetric method for determination of left ventricular mass and necrotic myocardial mass in postmortem hearts

Biochemistry, molecular pharmacology, and functional control of Ca 2+ -channels

Classes of calcium channels in vertebrate cells

Molecular mechanism of calcium channel block by israpidine

The central role of voltage-activated and receptor-operated calcium channels in neuronal cells

Receptor sites for blockers of L-type calcium channels

Molecular properties of dihydropyridine-sensitive calcium channels

International Union of Pharmacology. XLVIII. Nomenclature and structure-function relationships of voltage-gated calcium channels

Analysis and functional characteristics of dihydropyridine-sensitive and -insensitive calcium channel proteins

Transmitter-mediated inhibition of N-type calcium channels in sensory neurons involves multiple GTP-binding proteins and subunits

Regulation of calcium channel activity by GTP binding proteins and second messengers

T-Type calcium channels and pharmacological blockade: Potential pathophysiological relevance

Drug-and disease-induced regulation of voltage-dependent calcium channels

Calcium-channel subtypes in the somata and axon terminals of magnocellular neurosecretory cells

Die Bedeutung der energiereichen Phosphate für Kontraktilität und Tonus des Myocards

History of calcium antagonists

Zum Wirkungsmechanismus neuartiger Koronardilatatoren mit gleichzeitig Sauerstoff einsparenden Myocardeffekten, Prenylamin, Irpoveratril

Consequences of uncontrolled calcium entry and its prevention with calcium antagonists

Antihypertensive and arterial anticalcinotic effects of calcium antagonists

Regulation of calcium channels in aortic muscle cells by protein kinase C activators (diacylglycerol and phorbol esters) and by peptides (vasopressin and bombesin) that stimulate phosphoinositide breakdown

Molecular determinants of drug binding and action on L-type calcium channels

Ltype channels in cardiac and skeletal muscle: purification and phosphorylation

Voltage-dependent modulation of N-type calcium channels by G-protein βγ -subunits

Calcium channel subtypes in porcine adrenal chromaffin cells

Pharmacological modulators of voltage-gated calcium channels and their therapeutic application

Neurochemical evidence of N-type calcium channels in transmitter secretion from peripheral nerve endings of sensory nerves in guinea pigs

Mibefradil: A selective T-type calcium antagonist

Antagonists of neuronal calcium channels: structure, function and therapeutic implications

P-Type calcium channels in rat central and peripheral neurons

Two amino acid residues in the IIIS5 segment of L-type calcium channels differentially contribute to 1,4-dihydropyridine sensitivity

Omegaconotoxin binding decreases in aged rat brain

Solubilization and reconstitution of voltage-dependent calcium channel from bovine cardiac muscle. Ca 2+ influx assay using the fluorescent dye Quin2

Neuronal calcium channel antagonists. Discrimination between calcium channel subtypes using ω-conotoxin from Conus magnus venom

Molecular characterization of T-type calcium channels

Molecular physiology of low-voltage-activated T-type calcium channels

Molecular characterization of T-type calcium channels

Molecular determinants of high affinity dihydropyridine binding in L-type calcium channels

Pharmacological modulation of voltage-dependent calcium channels in intact cells

New synthetic ligands for Ltype voltage-gated calcium channels

Prod'Hom B (1988) Calcium channels in the heart. Properties and modulation by dihydropyridine enantiomers

Solubilization, partial purification, and properties of ω-conotoxin receptors associated with voltage-dependent calcium channels

The IVS6 segment of the L-type calcium channel is critical for the action of dihydropyridines and phenylalkylamines

Nine L-type amino acid residues confer full 1,4-dihydropyridine sensitivity to the neuronal calcium channel α 1A subunit

Classification of calcium channels and the sites of action of drugs modifying channel function

Structural basis of drug binding to L Ca 2+ channels

L-type Ca 2+ channels in Ca 2+ channelopathies

Calcium channels, stores and oscillations

Calcium channel subtypes in rat brain: Biochemical characterization of the high-affinity receptors for ω-conopeptides SNX-230 (synthetic MVIIC), SNX-183 (SVIB), and SNX-111 (MVIIA)

Effects of bepridil and diltiazem on [ 3 H] nitrendipine binding to canine cardiac sarcolemma. Potentiation of pharmacological effects of nitrendipine by bepridil

H]-Nitrendipine, a potent calcium antagonist, binds with high affinity to cardiac membranes

Temperature-dependent modulation of [ 3 H]nitrendipine binding by the calcium channel antagonists verapamil and diltiazem in rat brain synaptosomes

Novel interactions of cations with dihydropyridine calcium antagonist binding sites in brain

Characterization of binding of the Ca 2+ channel antagonist, [ 3 H]nitrendipine, to guinea pig ileal smooth muscle

Cardiovascular characterization of pyrrolo[2,1-d] [1,5]benzothiazepine derivatives binding selective to the peripheral-type benzodiazepine receptor (PBR): from dual PBR affinity and calcium antagonist activity to novel and selective calcium entry blockers

Relationship between the inhibition constant (K I ) and the concentration of inhibitor which causes 50 per cent inhibition (I 50 ) of an enzymatic reaction

High affinity block of myocardial L-type calcium channels by the spider toxin ω-agatoxin IIIA: advantages over 1,4-dihydropyridines

The interaction of [ 3 H]nitrendipine with receptors for calcium antagonists in the cerebral cortex and heart of rats

The binding of [ 3 H]nitrendipine to receptors for calcium channel antagonists in the heart, cerebral cortex, and ileum of rats

Evidence for distinct sites coupled with high affinity ω-conotoxin receptors in rat brain synaptic plasma membrane vesicles

Identification of putative calcium channels in skeletal muscle microsomes

H-desmethoxyverapamil labelling of putative calcium channels in brain: autoradiographic distribution and allosteric coupling to 1,4-dihydropyridine and diltiazem binding sites

Photoaffinity labelling of the cardiac calcium channel

Specific pharmacology of calcium in myocardium, cardiac pacemakers and vascular smooth muscle

Assay for calcium channels

Temperature-dependent regulation of d-cis-[ 3 H]diltiazem binding to Ca 2+ channels by 1,4-dihydropyridine channel agonists and antagonists

Calcium channels: Basic properties as revealed by radioligand binding studies

Calcium channels and calcium channel drugs: Recent biochemical and biophysical findings

Resolving the structure of the Ca 2+ channel by photoaffinity labelling

3 H]Desmethoxyverapamil, a novel Ca 2+ channel probe

3 H]Nitrendipinelabeled calcium channels discriminate inorganic calcium agonists and antagonists

Tissue heterogeneity of calcium channel antagonist binding sites labeled by [ 3 H]nitrendipine

3 H]HOE 166 defines a novel calcium antagonist drug receptor -distinct from the 1,4-dihydropyridine binding domain

Motif III S5 of L-type channels is involved in the dihydropyridine binding site

Akimoto T (1993) Specific bindings of [ 3 H](+)PN200-110 and [ 125 ]omega-conotoxin to crude membranes from differentiated NG 108-15 cells

Binding of [ 3 H](+)PN200-110 to aortic membranes from normotensive and spontaneously hypertensive rats

Characteristics of the binding of [ 3 H]nitrendipine to rabbit ventricular membranes: Modification by other Ca 2+ channel antagonists and by the Ca 2+ channel agonist Bay K 8644

Identification of 1,4-dihydropyridine binding domains within the primary structure of the α 1 subunit of the skeletal muscle L-type calcium channel

Glossmann H (1992) A unique fluorescent phenylalkylamine probe for L-type Ca 2+ channels

High affinity specific [ 3 H](+)PN 200-110 binding to dihydropyridine receptors associated with calcium channels in rat cerebral cortex and heart

Pharmacodynamic interaction between mibefradil and other calcium channel blockers

Effects of diltiazem and verapamil on (+)-PN 200-110 binding kinetics in dog cardiac membranes

Specific calcium antagonist binding sites in brain

Photoaffinity labeling of the purified skeletal muscle calcium antagonist receptor by a novel benzodiazepine, [ 3 H]azidobutyryl diltiazem

Lipophilic 4-isoxazolyl-1,4-dihydropyridines: synthesis and structure-activity relationships

Chatelain P (1990) SR 33557, a novel calcium entry blocker. II Interactions with 1,4-dihydropyridine, phenylalkylamine, and benzodiazepine binding sites in rat heart sarcolemmal membranes

Permanently charged chiral 1,4-dihydropyridines: molecular probes of L-type calcium channels. Synthesis and pharmacological characterization of methyl-(ω-trimethylalkylammonium 1,4-dihydro-2,6-dimethyl-4-(3-nitro-phenyl)-3,5-pyridinecarboxylate iodide, calcium channel antagonists

(-)-[ 3 H]Desmethoxyverapamil labels multiple calcium channel modulator receptors in brain and skeletal muscle membranes: Differentiation by temperature and dihydropyridines

Characterization of binding sites for nimodipine and (-)-desmethoxyverapamil in bovine sarcolemma

The binding interactions of Ro 40-5967 at the L-type Ca 2+ channel in cardiac tissue

Characterization and solubilization of the nitrendipin binding protein from canine small intestinal circular smooth muscle

3 H]diltiazem binding to calcium channel antagonists recognition sites in rat cerebral cortex

Effects of anadamide and arachidonic acid on specific binding of (+)-PN200-110 and (?)-desmethoxyverapamil to L-type Ca 2+ channel

Dihydropyridine receptor of L-type Ca 2+ channels: identification of binding domains for [ 3 H](+)-PN200-110 and [ 3 H]azidopine within the α1 subunit

Identification of a novel 1,4-dihydropyridine-and phenylalkylaminebinding polypeptide in calcium channel preparations

) ω-Conotoxin GVIA binding to a high-affinity receptor in brain: Characterization, calcium sensitivity, and solubilization

Azidobutyryl clentiazem, a new photoactivable diltiazem analog, labels benzothiazepine binding sites in the α 1 subunit of the skeletal muscle calcium channel

The mechanism of binding of dihydropyridine calcium channel blockers to rat brain membranes

Binding of the dihydropyridine calcium channel blocker (+)-[ 3 H]isopropyl-4-(2,1,3-benzoxadiazol-4-yl)-1,4-dihydro-5-methoxy-carbonyl-2,6-dimethyl-3-pyridinecarboxylate (PN200-110) to RINm5F membranes and cells. Characterization and functional significance

Calcium antagonistic drugs. Mechanism of action

Protective effect of bepridil and against veratrine-induced contracture in rat atria

Effects of calcium antagonists on coronary spasm and pulmonary artery contraction in comparison to their antagonistic action against K-strophanthin in isolated guinea-pig atria

Cardiotonic activity of the water soluble forskoline derivative 8,13-epoxy-6β-(piperidinoacetoxy)-1α,7β,9α-trihydroxy-labd-14-en-11-one

Investigations to characterize a new anti-arrhythmic drug, ORG 6001, including a simple test for calcium antagonism

Sympathetic nerve blockade

Effects of Ca 2+ antagonists on coronary spasm and pulmonary artery contraction in comparison to their antagonistic action against k-strophanthin in isolated guinea-pig atria

Evidence for a distinct Ca 2+ antagonist receptor for the novel benzothiazinone compound Hoe 166

A method for in vivo assessment of calcium slow channel blocking drugs

Acute coronary artery occlusion-reperfusion-induced arrhyhythmias in rats, dogs, and pigs: antiarrhythmic evaluation of quinidine, procainamide and lidocaine

Classification and action of antiarrhythmic drugs

Broad sensitivity of rodent arrhythmia models to class I, II, III, and IV antiarrhythmic agents

Arrhythmia models in the rat

Potassium channels as targets for antiarrhythmic drug action

Classification of antiarrhythmic agents: electropharmacologic basis and clinical relevance

Quantification of arrhythmias using scoring systems: an examination of seven scores in an in vivo model of regional myocardial ischemia

Models for the study of arrhythmia in myocardial ischaemia and infarction: the use of the rat

Screening of drugs for antiarrhythmic activity

Classification of antiarrhythmic drugs

On the mechanism of action of antiarrhythmic agents

Delayed development of ventricular ectopic rhythms following experimental coronary occlusion

Classification of antiarrhythmic drugs based on ventricular fibrillation threshold

Antiarrhythmic drug classifications. A critical appraisal of their history, present status, and clinical relevance

Comparative mechanisms of action of antiarrhythmic drugs

The oral antiarrhythmic drugs

Einteilungsprinzipien der Antiarrhythmika bei Herzrhythmusstörungen

The Sicilian Gambit. A new approach to the classification of antiarrhythmic drugs based on their actions on arrhythmogenic mechanisms

Modulation of potassium channels by antiarrhythmic and antihypertensive drugs

New classification of antiarrhythmic drugs. The modulated receptor hypothesis

Classification and mechanism of action of antiarrhythmic drugs

Evaluation of antifibrillatory effects of drugs

Experimental models for the study of antiarrhythmic agents

Production of experimental arrhythmias and methods for evaluating antiarrhythmic action

Experimental Production of Diseases, Part 3, Heart and Circulation

The cardiac arrhythmia suppression trial (CAST) investigators (1990) Preliminary report: Effect of encainide and flecainide on mortality in a randomized trial of arrhythmia suppression after myocardial infarction

Classification of antiarrhythmic drugs

Classification of antidysrhythmic drugs

A classification of antiarrhythmic actions reassessed after a decade of new drugs

Classification of antiarrhythmic actions

Significance of classifying antiarrhythmic actions since the cardiac arrhythmia suppression trial

Classifying antiarrhythmic actions: by facts or speculation

The Lambeth Conventions: guidelines for the study of arrhyth-REFERENCES AND FURTHER READING

Antiarrhythmic actions of Tedisamil: Studies in rats and primates

Chronic recording from the His bundle in the awake dog

Pro-and antiarrhythmic effects of fast cardiac pacing in a canine model of acquired long QT syndrome

An analysis of the time-relations of electrocardiograms

QRS-T variations in the rat electrocardiogram

The rat ECG in acute pharmacology and toxicology

The anesthetized rabbit as a model for ischemia-and reperfusion-induced arrhythmias: Effects of quinidine and bretylium

The mechanisms of action of the optical enantiomers of verapamil against ischaemiainduced arrhythmias in the conscious rat

The normal rat electrocardiogram

Relationship between QaT and RR intervals in rats, guinea pigs, rabbits and primates

Das normale Elektrokardiogramm der Ratte

Responses to ligation of a coronary artery in conscious rats and the actions of antiarrhythmics

Chronic epicardial His bundle recordings in awake nonsedated dogs: a new method

The heart rate and the electrocardiogram of small animals

Holter monitoring in conscious dogs. Assessment of arrhythmias occurring during ischemia and in the early reperfusion phase

Holter monitoring in conscious dogs. Assessment of arrhythmias occurring in the late reperfusion phase after coronary occlusion

A restraining device facilitating electrocardiogram recording in rats

The electrocardiogram (ECG) of the rat

A new ECG measure (RSh) for detecting possible sodium channel blockade in vivo in rats

Assessment of the conduction of the cardiac impulse by a new epicardic surface and stimulation technique (SST-ECG) in Langendorff perfused mammalian hearts

The QT interval and cardiac arrhythmias

Epicardial His bundle recordings in the guinea pig in vivo

An improved method to correct the QT interval of the electrocardiogram for changes in heart rate

Methods and limitations an experimental model of the long QT syndrome

A dual electrophysiologic test for atrial antireentry and ventricular antifibrillatory studies. Effects of bethanidine, procainamide and WY-48986

Synthesis and biological evaluation of new cyclopenteno[b]-thiophene derivatives as local anesthetic and antiarrhythmic agents

Putrescine reverses aconitine-induced arrhythmia in rats

Effects of dantrolene sodium in rodent models of cardiac arrhythmia

A rapid screening procedure for antiarrhythmic activity in the mouse

Antiarrhythmic activity of some isoquinoline derivatives determined by a rapid screening procedure in the mouse

R 56 865, a Na + /Ca 2+ -overload inhibitor, protects against aconitine-induced cardiac arrhythmias in vivo

Comparison of the effects of various β-adrenergic blocking agents with known antiarrhythmic drugs on aconitinearrhythmia produced by the cup method

A rapid in vivo technique for preliminary screening of antiarrhythmic agents in mice

The effects of quinidine, ajmaline, papaverine and adrenergic beta-receptor inhibitors in experimental BaCl 2 -arrhythmia developed for the quantitative assay of antiarrhythmic drugs

The effect of bisaramil on experimental arrhythmias

Studies on auricular tachycardia caused by aconitine administration

The effect of diphenylhydantoin (Dilantin) on atrial flutter and fibrillation provoked by focal application of aconitine or delphinine

A new model of ventricular fibrillation induced by isoprenaline and catechol-O-methyl transferase inhibitor at high perfusion temperature in isolated rat hearts

Grayanotoxin-I induced experimental arrhythmia in guinea pig

A simple method for the production of ventricular tachycardia in the rat and guinea pig

Selectivity of a CaCl 2 continuous infusion screening method in rats

A critical evaluation of three methods for the study of adrenergic beta-blocking and anti-arrhythmic agents

Arrhythmias induced by changing the medium of cultured rat heart muscle cells: a model for assessment of antiarrhythmic agents

Evaluation of antagonism of aconitineinduced dysrhythmias in mice as a method of detecting and assessing antidysrhythmic activity

Hemodynamic and arrhythmogenic effects of aconitine applied to the left atria of anesthetized cats. Effects of amiodarone and atropine

Anti-arrhythmic effects of a new calcium antagonist, Monopetil, AJ-2615, in experimental arrhythmic models

Effects of dantrolene sodium in rodent models of cardiac arrhythmia

Synthesis and biological evaluation of new cyclopenteno[b]thiophene derivatives as local anesthetic and antiarrhythmic agents

Broad sensitivity of rodent arrhythmia models to class I, II, III, and IV antiarrhythmic agents

Zur Frage der Beziehungen zwischen Strophanthintoxicität und Größe der Coronardurchblutung. Arch exper

The effect of propranolol and the dextro and laevo isomers of H 56/28 upon ouabain-induced ventricular tachycardia in unanaesthetized dogs

Phentolamine: use in digitalis-induced arrhythmias

Antiarrhythmic activity of N,N-diisopropyl-Ndiethylamino-ethylurea hydrochloride

Suppression of ventricular arrhythmias after coronary artery ligation by Pinacidil, a vasodilator drug

A rapid in vivo technique for the screening of potential anti-dysrhythmic agents

Modified method for the production of cardiac arrhythmias by ouabain in anesthetized cats

Propranolol, MJ-1999 and Ciba-39089-Ba in ouabain and adrenaline induced cardiac arrhythmias

Effects of α-adrenoreceptor agonists and antagonists on ouabain-induced arrhythmias and cardiac arrest in guinea pig

Antiarrhythmic effects of two new propafenone related drugs. A study on four animals models of arrhythmia

Influence of test site on ventricular fibrillation threshold

Classification of antiarrhythmic drugs based on ventricular fibrillation threshold

The relationship between the repetitive extrasystole threshold and the ventricular fibrillation threshold in the dog

Comparative antidysrhythmic and hemodynamic effects of orally or intravenously administered mexiletine and Org 6001 in the anesthetized rat

Effects of antiarrhythmic drugs on the repetitive extrasystole threshold and ventricular fibrillation threshold

Analysis of the mechanism of adrenaline actions on ventricular vulnerability

Evaluation of antifibrillatory effects of drugs

Fibrillation threshold curves and anti-arrhythmic drugs

Electrically induced arrhythmias in the rat

Methods for detection and assessment of antiarrhythmic activity

Effects of AHR-12234 on cardiac transmembrane action potentials, in situ cardiac electrophysiology and experimental models of arrhythmia

A dual electrophysiologic test for atrial anti-re-entry and ventricular antifibrillatory studies

Methods for producing experimental complete atrioventricular block in dogs

Arrhythmias following experimental coronary occlusion and their response to drugs

A method for determining the atrial effective refractory period in the unanaesthetized dog

Efficacy and plasma concentrations of SC-36602 in canine models of ventricular arrhythmia

Unexpected interaction between βadrenergic blockade and heart rate variability before and after myocardial infarction. A longitudinal study in dogs at high and low risk for sudden death

Arrhythmogenic right ventriculopathy causing sudden death in boxer dogs. A new animal model of human disease

The antifibrillatory actions of UK 68,798, a class III antiarrhythmic agent

Protection against programmed stimulation-induced ventricular tachycardia and sudden coronary death by NE-10064, a class III antiarrhythmic drug

Current concepts and animal models of sudden cardiac death for drug development

Antiarrhythmic and electrophysiologic actions of CK-3579 and sematilide in a conscious canine model of sudden coronary death

Profibrillatory actions of pinacidil in a conscious canine model of sudden coronary death

Electrophysiology and antiarrhythmic actions of E-4031 in the experimental animal model of sudden coronary death

Effects of combined thromboxane synthase inhibition/thromboxane receptor antagonism in two models of sudden cardiac death in the canine: limited role of thromboxane

Repolarization, abnormalities, arrhythmia and sudden death in canine tachycardia-induced cardiomyopathy

Ventricular fibrillation resulting from a site remote from previous myocardial infarction. A conscious canine model for sudden coronary death

Autonomic mechanisms in ventricular fibrillation induced by myocardial ischemia during exercise in dogs with healed myocardial infarction. An experimental preparation for sudden cardiac death

Blockade of the ATP-sensitive potassium channel modulates reactive hyperemia in the canine coronary circulation

Glibenclamide attenuates adenosine-induced bradycardia and vasodilation

Role of ATP sensitive potassium channel in extracellular potassium accumulation and cardiac arrhythmias during myocardial ischaemia

The effects of mifebradil, a novel calcium channel antagonist on ventricular arrhythmias induced by ischemia and programmed electrical stimulation

Effects of the ATP-dependent potassium channel antagonist, glyburide, on coronary blood flow and susceptibility to ventricular fibrillation in unanesthetized dogs

Beta 2 -adrenergic receptor antagonists protect against ventricular fibrillation: in vivo and in vitro evidence for enhanced sensitivity to beta 2 -adrenergic stimulation in animals susceptible to sudden death

HMR 1883, a novel cardioselective inhibitor of the ATP-sensitive potassium channel. Part II: Effects on susceptibility to ventricular fibrillation induced by myocardial ischemia in conscious dogs

Autonomic response to coronary occlusion in animals susceptible to ventricular fibrillation

Hypoxic dilation of coronary arteries is mediated by ATP-sensitive potassium channels

Autonomic mechanisms in ventricular fibrillation induced by myocardial ischemia during exercise in dogs with healed myocardial infarction

Chronic inhibition of Na + /H + -exchanger attenuates cardiac hypertrophy and prevents cellular remodelling in heart failure

Electrical remodelling of the epicardial border zone in the canine infracted heart: a computational analysis

Ionic targets for drug therapy and atrial-fibrillation-induced electrical remodelling: insights from a mathematical model

Differential efficacy of Land T-type calcium channel blockers in preventing tachycardia-induced atrial remodelling in dogs

Tachycardia-induced changes in Na + current in a chronic dog model of atrial fibrillation

Functional mechanisms underlying tachycardia-induced sustained atrial fibrillation in a chronic dog model

Chronic rapid atrial pacing. Structural, functional, and electrophysiological characteristics of a new model of sustained atrial fibrillation

Ionic remodelling in the heart. Pathophysiological significance and therapeutic opportunities for atrial fibrillation

Electrical remodelling in ischemia and infarction

Mathematical analysis of canine atrial action potentials: rate, regional factors, and electrical remodelling

Enalapril prevents perpetuation of atrial fibrillation by suppressing atrial fibrosis and over-expression of connexion43 in a canine model of atrial pacing-induced left ventricular dysfunction

Effect of simvastatin and antioxidant vitamins on atrial fibrillation promotion by atrial-tachycardia remodelling on dogs

Cellular mechanisms of atrial dysfunction caused by sustained atrial tachycardia

Direction-dependent conduction abnormalities on a canine model of atrial fibrillation due to chronic atrial dilatation

Rapid stimulation causes electrical remodelling in cultured atrial myocytes

Ionic remodelling underlying action potential changes in a canine model of atrial fibrillation

Mechanisms of pharmacological cardioversion of atrial fibrillation by Class I drugs

Inhibitors of the Na + /H + exchanger cannot prevent atrial electrical remodeling in the goat

Early" class III drugs for the treatment of atrial fibrillation. Efficacy and atrial selectivity of AVE0118 in remodeled atria of the goat

Blockers of the Kv1.5 channel for the treatment of atrial hypertension

Profibrillatory effects of verapamil but not of digoxin in the goat model of atrial fibrillation

Methods for determining the refractory period and excitable gap during persistent atrial fibrillation in the goat

Consequences of atrial electrical remodeling for the anti-arrhythmic action of class IC and class III drugs

Atrial electrical remodeling and atrial fibrillation

Fractionation of electrograms and linking of activation during pharmacological cardioversion of persistent atrial fibrillation in the goat

Identity of a novel delayed rectifier current from human heart with a cloned K + channel current

Antisense oligodeoxynucleotides directed against Kv1.5 mRNA specifically inhibit ultrarapid delayed rectifier K + current in cultured adult human atrial myocytes

Ultrarapid delayed rectifier current inactivation in human atrial myocytes: properties and consequences

Electrophysiological and antiarrhythmic effects of the novel I Kur channel blockers, S9947 and S20951, on left vs. right pig atrium in vivo in comparison with the I Kr blockers dofetilide, azimilide, d,lsotalol and ibutilide

Atrial-selective antiarrhythmic actions of novel I Kur vs. I Kr , I Ks , and I Kach class Ic drugs and βblockers in pigs

Adrenergic modulation of ultrarapid delayed rectifier K + current in human atrial myocytes

Evolution, mechanisms, and classification of antiarrhythmic drugs: focus on class III actions

Dofetilide in patients with congestive heart failure and left ventricular dysfunction

Sustained depolarization-induced outward current in human atrial myocytes: evidence for a novel delayed rectifier K + current similar to Kv1.5 cloned channel currents

Differential effects of dofetilide, amiodarone, and class Ic drugs on left and right atrial refractoriness and left atrial vulnerability in pigs

Atrial effects of the novel K + -channel-blocker AVE0118 in anesthetized pigs

Monophasic action potentials: concepts to practical applications

Mechanism of action of antiarrhythmic drugs: A matrical approach

Characterization of antiarrhythmic drugs by alternating current induced arrhythmias in isolated heart tissues

Simple in vitro method to characterize anti-arrhythmic agents

Electrophysiological effects of diprafenone, a dimethyl congener of propafenone on guinea pig ventricular cells

Electrophysiological effects of Ro 22-9194, a new antiarrhythmic agent, on guinea pig ventricular cells

Monophasic action potential recordings: evaluation of antiarrhythmic drugs

Two components of cardiac delayed rectifier K + current

Effects of bupivacaine on contraction and membrane potential in isolated canine papillary muscles

Classification of antiarrhythmic drugs

Effects of a novel class III anti-arrhythmic agent, E-4031, on reentrant tachycardias in rabbit right atrium

Electrophysiological effects of ACC-9358, a novel class I antiarrhythmic agent, on isolated canine REFERENCES AND FURTHER READING

Animal models of human cardiovascular disease, heart failure and hypertrophy

Animal models of chronic heart failure

Experimental models of heart failure

Blockade of the renin-angiotensin system in cardiac pressure-overload hypertrophy in rats

Selective changes in cardiac gene expression during compensated hypertrophy and the transition to cardiac decompensation in rats with aortic banding

Cardiac and vascular effects of chronic angiotensin converting enzyme inhibition at subantihypertensive doses

Effects of losartan, an angiotensin II antagonist, on the development of cardiac hypertrophy due to volume overload

A specific B 2 -bradykinin receptor antagonist Hoe 140 abolishes the antihypertrophic effect of ramipril

Converting enzyme inhibition specifically prevents the development and induces regression of cardiac hypertrophy in rats. Clin Exper Hypert

Role of angiotensin II receptor antagonism and converting enzyme inhibition in the progression and regression of cardiac hypertrophy in rats

Ramipril prevents left ventricular hypertrophy with myocardial fibrosis without blood pressure reduction: a one year study in rats

Contribution of bradykinin to the cardiovascular effects of ramipril

Bradykinin prevents left ventricular hypertrophy in rats

The contribution of bradykinin to the cardiovascular actions of ACE inhibitors

ACE inhibition decreases postoperative mortality in rats with left ventricular hypertrophy and myocardial infarction

Central vasopressin in experimental aortic stenosis in the rat

Regulation of aortic atrial natriuretic factor and angiotensinogen in experimental hypertension

Hyperplastic growth response of vascular smooth muscle cells following induction of acute hypertension in rats by aortic coarctation

Experimental cardiovascular benefits of angiotensin-converting enzyme inhibitors: Beyond blood pressure reduction

Alteration of growth responses in established cardiac pressure overload hypertrophy in rats with aortic banding

Chronic arteriovenous shunt: evaluation of a model for heart failure in rat

Simple, rapid, and effective method of producing aortacaval shunts in the rat

Defective excitation-contraction coupling in experimental cardiac hypertrophy and heart failure

Neurohumoral responses to chronic myocardial infarction in rats

A model of chronic heart failure in spontaneous hypertensive rats (SHR)

The effect of myocardial adaptation to volume overload in the rat

NHE-1 inhibition improves impaired mitochondrial permeability transition and respiratory function during postinfarction remodelling in the rat

Angiotensin II receptor blockade attenuates the deleterious effects of exercise training on post-MI ventricular remodelling in rats

Myocyte cellular hyperplasia and myocytes cellular hypertrophy contribute to chronic ventricular remodelling in coronary artery narrowing-induced cardiomyopathy in rats

Selective sensory denervation by capsaicin aggravates adriamycin-induced cardiomyopathy in rats

Regional changes in hemodynamics and cardiomyocyte size in rats with aortacaval fistulas. 1. Developing and established hypertrophy

Effects of angiotensin-converting enzyme inhibitors and angiotensin II type 1 receptor antagonists in rats with heart failure

Chronic heart failure induced by coronary artery ligation in Lewis inbred rats

A simple method for collagen and total protein determination in formalin-.fixed paraffin-embedded sections

Systemic and regional hemodynamic effects of perindopril in experimental heart failure

Animal models of chronic heart failure

Myocardial infarct size and ventricular function in rats

Ventricular enlargement and reduced survival after myocardial infarction

Survival after an experimental myocardial infarction: beneficial effects of long-term therapy with captopril

Determination of rat heart morphology and function in vivo in two models of cardiac hypertrophy by means of magnetic resonance imaging

A canine model of chronic heart failure produced by multiple sequential coronary microembolizations

Simple techniques for the surgical occlusion of coronary vessels in the rat

Effect of left ventricular sphericity on the evolution of ventricular dysfunction in rats with diffuse isoproterenol-induced myocardial necrosis

Neurohumoral and hemodynamic effects of ibopamine in a rat model of chronic myocardial infarction and heart failure

Relation between myocardial REFERENCES AND FURTHER READING

Nifedipine and diltiazem suppress ventricular arrhythmogenesis and calcium release in mouse hearts

Cardiac adaptations to chronic exercise in mice

Benidipine, a long-acting calcium channel blocker, inhibits cardiac remodeling in pressure-overloaded mice

Molecular and physiological alterations in murine ventricular dysfunction

) βARK1 inhibition improves survival in a mouse model of heart failure induced by myocardial infarction

Angiotensin deficiency in mice leads to dilated cardiomyopathy

Role of a selective aldosterone blocker in mice with chronic heart failure

Dual inhibition of ACE and NEP provides greater cardioprotection in mice with heart failure

MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure

Reversible cardiac fibrosis and heart failure induced by conditional expression of an antisense mRNA of the mineralocorticoid receptor in cardiomyocytes

Cardiac muscle diseases in genetically engineered mice: evolution of molecular physiology

Chronic xanthine oxidase inhibition prevents myofibrillar protein oxidation and preserves cardiac function in a transgenic mouse model of cardiomyopathy

Cardiomyopathy in transgenic myf5 mice

A mouse model for mitochondrial myopathy and cardiomyopathy resulting from a deficiency in the heart/muscle isoforms of the adenine nucleotide translocator

Genetic modification of the heart: transgenic modification of cardiac lipid and carbohydrate utilization

Many good reasons to have STAT3 in the heart

Cardiomyopathy induced by cardiac Gs α overexpression

Remodelling of ionic currents in hypertrophied and failing hearts of transgenic mice overexpressing calsequestrin

Reversal of amyloid-induced heart disease in desmin-related cardiomyopathy

Increased vulnerability to atrial fibrillation in transgenic mice with selective atrial fibrosis caused by overexpression of TGF-β1

A stable ovine congestive heart failure model. A suitable substrate for left ventricular assist device assessment

Differential changes in cardiac phospholamban and sarcoplasmic reticular Ca 2+ -ATPase protein levels. Effects on Ca 2+ transport and mechanics in compensated pressure-overload hypertrophy and congestive heart failure

Hemodynamic benefits and prolonged survival with long-term captopril therapy in rats with myocardial infarction and heart failure

Simple techniques for the surgical occlusion of coronary vessels in the rat

Compensatory hypertrophy and failure in gradual pressure-overloaded guinea pig heart

Depressed intracellular calcium transients and contraction in myocytes from hypertrophied and failing guinea pig hearts

Assessment of subrenal banding of the abdominal aorta as a method of inducing cardiac hypertrophy in the guinea pig

Untersuchungen an der experimentellen hydropischen Herzinsuffizienz des Meerschweinchens

Über die experimentelle hydropische Herzinsuffizienz am Meerschweinchen. Operationstechnik, Einfluß zusätzlicher Faktoren und Effekt von Herzglykosiden

Hereditary cardiomyopathy: a new disease model

A new disease model of chronic congestive heart failure: Studies on its pathogenesis

The heart muscle in muscular dystrophy with special reference to involvement of the cardiovascular system in the hereditary myopathy of the hamster

Spontaneous hereditary myocardial degeneration and congestive heart failure in a strain of Syrian hamsters

Dissociation of factors influencing myocardial degeneration and generalized cardiocirculatory failure

The Syrian hamster as a model for the dilated cardiomyopathy of Chagas' disease: a quantitative echocardiographical and histopathological analysis

Mechanical and electrical properties of cardiomyopathic hearts of Syrian hamsters

Chronic calcium channel blockade prevents the progression of myocardial contractile and electrical dysfunction in the cardiomyopathic Syrian hamster

Effects of perindopril on myocardial inotropy, lusitropy and economy, and on diaphragm contractility in the cardiomyopathic Syrian hamster

Myocardial effects of early therapy with perindopril during experimental cardiomyopathy

Effects of milrinone treatment in cardiomyopathic hamsters (CHF 147) with severe congestive heart failure

Non-invasive evaluation of the cardiac function in golden retriever dogs by radionuclide angiography

Cardiac collagen remodelling in the cardiomyopathic Syrian hamster and the effect of losartan

The pathogenesis of clinical and experimental congestive cardiomyopathy: recent concepts

Microvascular spasm in the cardiomyopathic Syrian hamster: a preventable cause of focal myocardial necrosis

Myocardial contractility in relation to hypertrophy and failure in myopathic Syrian hamsters

Cardiac collagen changes during the development of right ventricular hypertrophy in tight-skin mice with emphysema

Cardiomyopathic Syrian hamster: A possible model of human disease

Effects of Quinapril, a new angiotensin converting enzyme inhibitor, on left ventricular failure and survival in the cardiomyopathic hamster

Effects of hydrochlorothiazide and captopril on the survival and heart weight of cardiomyopathic hamsters

Myopathy of hamster dystrophy: history and morphological aspects

New models of human disease in Syrian hamsters

Hereditary polymyopathy and cardiomyopathy in the Syrian hamster: I. Progression of heart and skeleton muscle lesions in the UM-X7.1 line

Calcium and myocardial cell injury. An appraisal in the cardiomyopathic hamster

Effects of angiotensin converting enzyme inhibitors and the role of the renin-angiotensin-aldosterone system in J-2-N cardiomyopathic hamsters

Simultaneous reduction of the sarcolemmal and SR calcium APTase activities and gene expression in cardiomyopathic hamster

Multiple cardiac contractile protein abnormalities in myopathic Syrian hamsters (Bio 53:58)

Tsk mice with genetic emphysema. Right ventricular hypertrophy occurs without hypertrophy of muscular pulmonary arteries or muscularization of arterioles

Identification of the Syrian hamster cardiomyopathy gene

Inotropic and calcium kinetic effects of calcium channel agonist and antagonist in isolated cardiac myocytes from cardiomyopathic hamsters

Hereditary and acquired cardiomyopathies in experimental animals: Mechanical, biochemical and structural features

Coronary and cardiac sensitivity to the vasoselective benzothiazepine-like calcium antagonist, clentiazem, in experimental heart failure

Alprazolam reduces stress-induced mortality in cardiomyopathic hamsters

Pimobendan increases survival of cardiomyopathic hamsters

Nebivolol increases survival in cardiomyopathic hamsters with congestive heart failure

Calcium transport properties of cardiac sarcoplasmic reticulum from cardiomyopathic Syrian hamsters (BIO 53.58 and 14.6): evidence for a quantitative defect in dilated myopathic hearts not evident in hypertrophic hearts

Increased sensitivity of ventricular myocardium to intracellular calcium-overload in Syrian cardiomyopathic hamster

Electrographic changes following rabbit coronavirus-induced myocarditis and dilated cardiomyopathy

Adriamycin cardiomyopathy in the rabbit: an animal model of low output cardiac failure with activation of vasoconstrictor mechanisms

SR calcium handling and calcium after-transients in a rabbit model of heart failure

H + -exchange activity is the cause of increased [Na + ] i and underlies disturbed calcium handling in the rabbit pressure and volume overload heart failure model

Betaadrenoceptors and adenylate cyclase activity in hypertrophied and failing rabbit left ventricle

Enhanced phosphorylation of phospholamban and downregulation of sarco/endoplasmatic reticulum Ca 2+ ATPase type 2 SERCA2) in cardiac sarcoplasmatic reticulum from rabbits with heart failure

Cellular uncoupling during ischemia in hypertrophied and failing rabbit ventricular myocardium: effects of preconditioning

Myosin heavy chain synthesis during progression of chronic tachycardia induced heart failure in rabbits

Increased negative inotropic effect of calcium-channel blockers in hypertrophied and failing rabbit heart

Rapidly adapting receptors in a rabbit model of mitral regurgitation

Protein turnover in compensated chronic aortic regurgitation

Comparative study of chronic toxic effects of daunorubicin and doxorubicin in rabbits

Attenuated outward potassium currents in carotid body glomus cells of heart failure rabbit: involvement of nitric oxide

Fibrosis, myocyte degeneration and heart failure in chronic aortic regurgitation

Differential expression of cardiac ANP and BNP in a rabbit model of progressive left ventricular dysfunction

Hypertrophic and functional response to experimental chronic aortic regurgitation

Heart failure due to chronic aortic regurgitation

Dynamic arterial baroreflex in rabbits with hear failure induced by rapid pacing

Altered oscillatory work by ventricular myofilaments from a rabbit coronary artery ligation model of heart failure

Protein kinase C activity and expression in rabbit left ventricular hypertrophy

Animal models of chronic heart failure

Echocardiographic changes after myocardial infarction in a model of left ventricular dysfunction

Upregulation of Na + /Ca 2+ exchanger expression and function in an arrhythmogenic rabbit model of heart failure

Tachycardia heart failure alters rabbit aortic smooth muscle responsiveness to angiotensin II

Matrix metalloproteinase expression in cardiac myocytes following myocardial infarction in the rabbit

Molecular correlates to altered expression of potassium currents in failing rabbit myocardium

Transgenic model for human troponin I-based hypertrophic cardiomyopathy

Sequential changes in sympatho-neuronal regulation and contractile function following aortic regurgitation in rabbit heart

Rapid ventricular pacing in the dog: pathophysiological studies of heart failure

A nonchirurgical model of chronic left ventricular dysfunction

Effect of heart failure on the mechanism of exercise-induced augmentation of mitral valve flow

Compensatory asymmetry in down-regulation and inhibition of the myocardial Ca 2+ cycle in congestive heart failure in dogs by idiopathic dilated cardiomyopathy and rapid ventricular pacing

Increased ACE and chymase-like activity in cardiac tissue of dogs with chronic mitral regurgitation

Early left ventricular dysfunction elicits activation of sympathetic drive and attenuation of parasympathetic tone in the paced canine model of congestive heart failure

Influence of heart rate on left ventricular performance in conscious dogs

Myocardial beta receptor and voltage sensitive calcium channel changes in a canine model of chronic heart failure

Acute, reversible tricuspid insufficiency: creation of a canine model

Factors involved in delaying the rise in peripheral resistance in developing heart failure

Volume overload hypertrophy in a closedchest model of mitral regurgitation

Premorbid determinants of left ventricular dysfunction in a novel model of gradually induced pressure overload in the adult canine

Alterations in left ventricular diastolic function in conscious dogs with pacing-induced heart failure

Exhaustion of Frank-Starling mechanism in conscious dogs with heart failure

Angiotensin II in the evolution of experimental heart failure

A model of left ventricular dysfunction caused by intracoronary adriamycin

Hemodynamic, left ventricular structural and hormonal changes after discrete myocardial damage in the dog

Native β-adrenergic support for left ventricular dysfunction in experimental mitral regurgitation normalizes indexes of pump and contractile function

Mechanism of altered patterns of left ventricular filling during the development of congestive heart failure

Mechanisms of altered excitation-contraction coupling in canine tachycardia-induced heart failure. I: experimental studies

Tachycardiainduced failure alters contractile properties of canine ventricular myocytes

Abnormalities in intracellular calcium regulation and contractile function in myocardium from dogs with pacing-induced heart failure

Cardiorenal and neurohumoral function in a canine model of left ventricular dysfunction

A canine model of chronic heart failure produced by multiple sequential coronary microembolizations

Decreases proportion of type I myofibers in skeletal muscle of dogs with chronic heart failure

Effects of longterm monotherapy with enalapril, metoprolol, and digoxin on the progression of left ventricular dysfunction and dilation in dogs with reduced ejection fraction

Tachycardia-induced cardiomyopathy: a review of animal models and clinical studies

Angiotensin-converting enzyme inhibition and the progression of congestive cardiomyopathy

Differential expression of angiotensin-converting enzyme and chymase in dogs with chronic mitral regurgitation

Hemodynamic and neurohumoral response in heart failure produced by rapid ventricular pacing

Canine X-linked muscular dystrophy. An animal model of Duchenne muscular dystrophy: Clinical studies

Experimental models of heart failure

Decrease in myocardial ryanodine receptors and altered ex-REFERENCES AND FURTHER READING

Cineangiography of the heart in a single breath hold with segmented turboflash sequence

Gene expression in a swine model of ventricular hypertrophy: Intercellular adhesion molecule, vascular endothelial growth factor and plasminogen activators are upregulated during pressure overload

Rapid ventricular pacing in pigs: an experimental model of congestive heart failure

Pacing-induced dilated cardiomyopathy increases left-to-right ventricular systolic interaction

Dynamic programming for detecting, tracking and matching deformable contours

Wall stress and patterns of hypertrophy in human left ventricle

Phase modulated rotating frame spectroscopic localization using an adiabatic plane rotation pulse and a single surface coil

Coronary arterial tree remodelling in right ventricular hypertrophy

Remodeling of the bifurcation asymmetry of right ventricular braches in hypertrophy

Amlodipine therapy in congestive heart failure: hemodynamic and neurohormonal effects at rest and after treadmill exercise

Rapid, accurate and simultaneous noninvasive assessment of right and left ventricular mass with nuclear magnetic resonance imaging using the snapshot gradient method

Abnormal myocardial bioenergetics in canine asymptomatic left ventricular dysfunction

Longterm angiotensin-converting enzyme and angiotensin Ireceptor inhibition in pacing-induced heart failure. Effects on myocardial interstitial bradykinin levels

Ugurbil K (1990) Transmural high energy phosphate distribution and response to alterations in workload in the normal canine myocardium as studied with spatially localized 31P NMR spectroscopy

Chronic supraventricular tachycardia causes ventricular dysfunction and subendocardial injury in swine

Relationship between bioimpedance, thermodilution, and ventriculographic measurements in experimental congestive heart failure

Collagen remodelling and changes in LV function during development and recovery from supraventricular tachycardia

Relation between ventricular and myocytes function with tachycardia-induced cardiomyopathy

Contrast-enhanced first pass myocardial perfusion imaging: correlation between myocardial blood flow in dogs at rest and during hyperemia

Bioenergetic consequence of left ventricular remodeling secondary to discrete myocardial infarction

From AHL (1996) Functional and bioenergetic consequences of postinfarction left remodelling in a new porcine model

Transition from compensated hypertrophy to intrinsic myocardial dysfunction during development of left ventricular pressure-overload hypertrophy in conscious sheep. Systolic dysfunction precedes diastolic dysfunction

An ovine model of tachycardia-induced degenerative dilated cardiomyopathy and heart failure with prolonged onset

Natriuretic peptides in sheep with pressure overload left ventricular hypertrophy

Natriuretic peptides maintain sodium homoeostasis during chronic volume loading post-myocardial infarction in sheep

Remodeling of chronic severely failing ischemic sheep heart after coronary microembolization: functional, energetic, structural, and cellular responses

Selective microembolization of the circumflex coronary artery in an ovine model: dilated, ischemic cardiomyopathy and left ventricular dysfunction

Effect of remodelling, stretch and ischemia on ventricular fibrillation frequency and dynamics in a heart failure model

Beneficial hemodynamic and renal effects of adrenomedullin in an ovine model of heart failure

Combined angiotensin-converting enzyme inhibition and adrenomedullin in an ovine model of heart failure

Four-day urocortin-I administration has sustained beneficial hemodynamic, hormonal, and renal effects in experimental heart failure

Disparate effects of early pressure overload hypertrophy and force-dependent indices of ventricular performance in the conscious baboon

Effects of angiotensin II generated by an angiotensin converting enzyme-independent pathway on left ventricular performance in the conscious baboon

Effects of thyroid hormone on cardiac βadrenergic responsiveness in conscious baboons

The effects of a thyroid hormone analog on left ventricular performance and contractile and calcium cycling proteins in the baboon

Role of hypertension in ischemic heart disease and cerebral vascular disease in the cynomolgus monkey with coarctation of the aorta

Effects of thyroid hormone on left ventricular performance and regulation of contractile and Ca 2+ -cycling proteins in the baboon

Cardiotoxic and possible leukemogenic effects of adriamycin in nonhuman primates

Hemodynamic determinants of the time course of fall in canine left ventricular pressure

Myocardial characteristics of pressure overload hypertrophy. A structural and functional study

Energy metabolism in normal and hypertrophied right ventricle of the ferret heart

Bovine hereditary cardiomyopathy: an animal model of human dilated cardiomyopathy

Dilated cardiomyopathy in turkeys: an animal model for the study of human heart failure

Ca 2+ handling and myofibrillar Ca 2+ sensitivity in ferret cardiac myocytes with pressure-overload hypertrophy

Angiotensin II receptor antagonist TCV-116 induces regression of hypertensive left ventricular hypertrophy in vivo and inhibits the intercellular signaling pathway of stretch-mediated cardiomyocyte hypertrophy in vitro

Control of cardiac gene expression by mechanical stress

Stretching cardiac myocytes stimulates protooncogene expression

Evaluation of cardiac glycosides in the intact animal

Influence of digitalis glycosides on the force of contraction of mammalian cardiac muscle

Chicago Feldman AM (1993) Classification of positive inotropic agents

Evaluation of cardiac glycosides in isolated heart preparations other than papillary muscle

Selective updates on mechanisms of action of positive inotropic agents

ATPase for the determination of cardiac glycosides. Handbook of Experimental Pharmacology 56/I:83-94

The biological standardization of drugs

The physiological assay of preparations of digitalis

Untersuchungen über die Wirkungsstärke von Digitalispräparaten. II. Mitteilung: Über die Genauigkeit der Dosiseichung an der Katze

The use of the isolated papillary muscle for the evaluation of positive inotropic effects of cardioactive steroids

Ouabain-receptor interactions in (Na + +K + )-ATPase preparations from different tissues and species. Determination of kinetic constants and dissociation constants

Ouabain-receptor interactions in (Na + +K + )-ATPase preparations. IV. The molecular structure of different cardioactive steroids and other substances and their affinity to the glycoside receptor

Cardiac glycoside receptor, (Na + +K + )-ATPase activity and force of contraction in rat heart

Respective involvements of high-and low-affinity digitalis receptors in the inotropic response of isolated rat heart to ouabain

Two Na,K-ATPase isoenzymes in canine cardiac myocytes. Molecular basis of inotropic and toxic effects of digitalis

Cordil reversibly inhibits the Na,K-ATPase from outside the cell membrane. Role of K-dependent dephosphorylation

Rapid determination of inorganic phosphate in biological systems by a highly sensitive photometric method

The role of Na + , K + -ATPase in the inotropic action of digitalis

Rubidium uptake in erythrocytes

Specific activity of Na + +K + -activated ATPase in rats and guinea pigs with hypoadrenalism

Serum cardiac glycoside assay based upon displacement of 3 H-ouabain from Na-K AT-Pase

The enzymatic assay of plasma digitoxin levels

Ouabain binding sites and Na + ,K + )-ATPase activity in rat cardiac hypertrophy. Expression of the neonatal forms

Cardiac glycoside receptor, (Na + +K + )-ATPase activity and force of contraction in rat heart

Prolonged responsiveness to ouabain in hypertrophied rat heart: physiological and biochemical evidence

Änderungen der Wirkungsdauer und Wirkungsstärke von Herzglykosiden durch Abwandlungen der Zucker

A method for measuring plasma levels of digitalis glycosides

Two Na,K-ATPase isoenzymes in canine cardiac myocytes. Molecular basis of inotropic and toxic effects of digitalis

Tissue localization of Na,K-ATPase isoenzymes by determination of their profile of inhibition with ouabain, digoxin, digitoxigenin and LND 796, a new aminosteroid cardiotonic

Cordil reversibly inhibits the Na,K-ATPase from outside the cell membrane. Role of K-dependent dephosphorylation

Relation of plasma concentrations to positive inotropic effect of intravenous administration of cordil in dogs

Ca 2+ -free perfusion of rat heart reveals a (Na + +K + )ATPase form highly sensitive to ouabain

The reactivity of derivatives of digoxin and digitoxin as measured by the Na-K-ATPase displacement assay and by radioimmunoassay

The Cytosensor microphysiometer

Cholinergic stimulation of the Na + /K + adenosine triphosphatase as revealed by microphysiometry

Heterogeneity of ouabain specific binding sites and (Na + +K + )-ATPase inhibition in microsomes from rat heart

On the mechanism of Na + -and K + -stimulated hydrolysis of adenosine triphosphate

The sodium-and potassium activated adenosine-triphosphatase system

The Na 2 K-ATPase

Cardenolide analogs. An explanation for the unusual properties of AY 22241

An improved model for assessment of positive inotropic activity in vitro

Screening of positive inotropic agents in isolated cardiac preparations from different sources

Cardiovascular activity of sympathomimetic amines

Influence of digitalis glycosides on the force of contraction of mammalian cardiac muscle

Animal and Clinical Pharmacologic Techniques in Drug Evaluation

Validation of a human atrial trabecular preparation for evaluation of inotropic substances

Schoelkens BA (1993) Cardiotonic activity of the water soluble forskoline derivative 8,13-epoxy-6β-(piperidinoacetoxy)-1α,7β,9α-trihydroxy-labd-14-en-11-one

The use of the isolated papillary muscle for the evaluation of positive inotropic effects of cardioactive steroids. Handbook of Experimental Pharmacology 56/I:153-159

Therapeutic trials in hamster dystrophy

Evaluation of cardiac glycosides in isolated heart preparations other than papillary muscle

Evaluation of cardiac glycosides in the intact animal

Zur Frage der Beziehungen zwischen Strophanthintoxicität und Größe der Coronardurchblutung. Arch exper

The biological standardization of drugs

The physiological assay of preparations of digitalis

Untersuchungen über die Wirkungsstärke von Digitalispräparaten. II. Mitteilung: Über die Genauigkeit der Dosiseichung an der Katze

Evaluation of cardiac glycosides in the intact animal

Herzglykoside und deren Aglykone

Änderungen der Wirkungsdauer und Wirkungsstärke von Herzglykosiden durch Abwandlungen der Zucker

Efficacy and safety of the novel Na + ,K + -ATPase inhibitor 20R 14β-amino 3β-rhamnosyl 5β-pregnan 20β-ol in a dog model of heart failure

Cerebral ischemia in gerbils using a modified vascular occlusion model

An unanesthetizedgerbil model of cerebral ischemia-induced behavioral changes

A suitable method to select gerbils with incomplete circle of Willis

Ischemia-induced neuronal cell death, calcium accumulation, and glial response in the hippocampus of the Mongolian gerbil and protection by propentofylline (HWA 285)

Protective effect of adenosine and a novel xanthine derivative propentofylline on the cell damage after bilateral carotid occlusion in the gerbil hippocampus

Levels of adenosine and adenine nucleotides in slices of rat hippocampus

Astrocytes increase in glial fibrillary acidic protein during retrograde changes of facial motor neurons

Experimental infarcts in cats, gerbils and rats

Experimental cerebral ischemia in Mongolian gerbils. 1. Light microscopic observations

The applicability of a new Schiff base glyoxal bis (2-hydroxy-anil), for the cytochemical localization of ionic calcium

Transient ischemia stimulates glial fibrillary acid protein and vimentine gene expression in the gerbil neocortex, striatum and hippocampus

Delayed neuronal death in the gerbil hippocampus following ischemia

Cerebral ischemia in infant and adult gerbils

Morphometric evaluation of brain infarcts in rats and gerbils

Propentofylline depresses amyloid and Alzheimer's CSF antigens after ischemia

Gerbil stroke model: an approach to the study of therapeutic aspects of postischemic brain edema

Neuroprotection after several days of mild, drug-induced hypothermia

Effect of theophylline on ischemically induced hippocampal damage in Mongolian gerbils: A behavioral and histopathological study

Effects of propentofylline on energy metabolism of the ischemic brain studied by in vivo 31 P nuclear magnetic resonance spectroscopy

Purine levels in the intact rat brain. Studies with an implanted hollow fibre

An isolated, perfused rat brain preparation, its spontaneous and stimulated activity

Isolation and mechanical maintenance of the dog brain

Cerebral ischemia model with conscious mice. Involvement of NMDA receptor activation and derangement of learning and memory ability

Glutamate antagonist therapy reduces neurologic deficits produced by focal central nervous system ischemia

Suitability of the isolated perfused rat brain for studying effects on cerebral metabolism

Pharmakologische Grundlagen der Therapie der zerebralen Ischämie

Protective effect of nimodipine against neuronal damage in rat hippocampus without changing postischemic cerebral blood flow

Preischemic administration of flunarizine or phencyclidine reduces local cerebral glucose utilization in rat hippocampus seven days after ischemia

PAF antagonist ginkgolide B reduces postischemic neuronal damage in rat brain hippocampus

Quantitative analysis of the electrocorticogram after forebrain ischemia in the rat

Neuroprotective properties of 5-HT 1A receptor agonists in rodent models of focal and global cerebral ischemia

Effects of Vinpocetin on local cerebral blood flow and glucose utilization seven days after forebrain ischemia in the rat

Postischemic neuronal damage causes astroglial activation and increase in local cerebral glucose utilization in rat hippocampus

Measurement of local cerebral blood flow with iodo[ 14 C]-antipyrine

Neuroprotective effect of memantine demonstrated in vivo and in vitro

Prevention of ischemia-induced cerebral hypothermia by controlling the environmental temperature

The density and distribution of ischemic brain injury in the rat following 2-10 min of forebrain ischemia

Models for studying long-term recovery following forebrain ischemia in the rat. 2. A 2-vessel occlusion model

The [ 14 C]deoxyglucose method for the measurement of local cerebral glucose utilization: Theory, procedure, and normal values in the conscious and anesthetized albino rat

Experimental infarcts in cats, gerbils and rats

REFERENCES AND FURTHER READING Significance of the differences between the control and the treated groups is assessed by analysis of variance with subsequent inter group comparison by Student's t-test with Bonferroni correction

A mouse model of focal cerebral ischemia for screening neuroprotective drug effects

Rat middle cerebral artery occlusion: Evaluation of the model and development of a neurologic examination

Evaluation of 2,3,5-triphenyltetrazolium chloride as a stain for detection and quantification of experimental cerebral infarction in rats

Experimental thromboembolic stroke studied by positron emission tomography: immediate versus delayed reperfusion by fibrinolysis

Additive neuroprotective effects of dextrorphan and cycloheximide in rats subjected to transient focal cerebral ischemia

Kynurenate inhibition of cell excitation decreases stroke size and deficits

Rodent models of cerebral ischemia

Ifenprodil and SL 82.0715 as cerebral antiischemic agents. I. Evidence for efficacy in models of focal cerebral ischemia

Reduced brain edema and infarction volume in mice lacking the neuronal isoform of nitric oxide synthase after transient MCA occlusion

Inhibition of interleukin 1β converting enzyme family proteases reduces ischemic and excitotoxic neuronal damage

Treatment of experimental cerebral ischemia

Experimental brain infarcts in cats. I. Pathophysiological observations

Targeted disruption of the neuronal nitric oxide synthase gene

A new model of experimental thromoboembolic stroke in cynomolgus monkey. Naunyn-Schmiedeberg's

Antiischemic effects of propentofylline (HWA 285) against focal cerebral infarction in rats

Efficacy of D-CPPene, a competitive N-methyl-D-aspartate antagonist in focal cerebral ischemia in the rat

Relaxant effects of sodium nitroprusside and NONOates in goat middle cerebral artery: Delayed impairment by global ischemia-reperfusion

Recirculation model following MCA occlusion in rats. Cerebral blood flow, cerebrovascular permeability, and brain edema

Cerebroprotective effect of a non-N-methyl-D-aspartate antagonist, GYKI 52466, after focal ischemia in the rat

Experimental cerebral infarction: Retro-orbital, extradural approach for occluding the middle cerebral artery

Focal cerebral ischaemia in the rat: 1. Description of technique and early neuropathological consequences following middle cerebral artery occlusion

Effect of lactacidosis on pyridine nucleotide stability during ischemia in mouse brain

Propentofylline attenuates microglial reaction in the rat spinal cord induced by middle cerebral artery occlusion

Inhibition of nitric oxide synthesis increases focal ischemic infarction in rat

Edema, cation content and ATPase activity after middle cerebral artery occlusion in rats

Photochemically induced, graded cerebral infarction in the mouse by laser irradiation. Evolution of brain edema

Effect of chronic intravenous administration of propentofylline (HWA 285) on the volume of focal ischemic damage in the rat

Elevation of the extracellular concentrations of glutamate and aspartate in rat hippocampus during transient cerebral ischemia monitored by intracerebral microdialysis

Pretreatment but not post-treatment with GYKI 52466 reduces functional deficits and neuronal damage after global ischemia in rats

Methods for antagonizing glutamate neurotoxicity

Extracellular adenosine, inosine, hypoxanthine, and xanthine in relation to tissue nucleotides and purines in rat striatum during transient ischemia

Effect of the adenosine uptake inhibitor propentofylline on the extracellular adenosine and glutamate and evaluation of its neuroprotective efficacy after ischemia in neonatal and adult rats

Liquid chromatographic determination of amino acids after precolumn fluorescence derivatization

A new model of bilateral hemispheric ischemia in the unanesthetized rat

Extracellular overflow of neuroactive amino acids during severe insulin-induced hypoglycemia: In vivo dialysis of the rat hippocampus

Effect of ginseng pretreatment on cerebral glucose metabolism in ischemic rats using animal positron emission tomography (PET) and ([ 18 F]-FDG)

In vivo benzodiazepine receptor occupancy by CL 218,872 visualized by positron emission tomography in the brain of the living baboon: Modulation by GABAergic transmission and relation with anticonvulsant activity

Differential effects of xanthine derivatives on local cerebral blood flow and glucose utilization in the conscious rat

An animal model for in vivo evaluation of tumor glycolytic rates with positron emission tomography

In vivo saturation kinetics of two dopamine transporter probes measured using a small animal positron emission tomography scanner

Measurement of cerebral glucose utilization from brain uptake of [ 14 C]2-deoxyglucose and [ 3 H]3-O-methylglucose in the mouse

Rapid analysis of 11 C-labelled drugs: fate of [ 11 C]-S-4-(tert.-butylamino-2-hydroxypropoxy)-benzimidazol-2-one in the dog

SPECT and PET ligands for CNS imaging

Validity of cerebral blood flow measurements obtained with quantitative tracer techniques

Noninvasive measurement of cerebral blood flow and glucose metabolic rate in the rat with high-resolution animal positron emission tomography (PET): A novel in vivo approach for assessing drug action in the brains of small animals

Effect of apomorphine on the relationship between local cerebral glucose utilization and local cerebral blood flow. (with an appendix on its statistical analysis)

18 F-labelled vesamicol derivates: Syntheses and preliminary in vivo small animal positron emission tomography evaluation

Measurement of local cerebral blood flow with iodo( 14 C)-antipyrine

Age-related changes in local rates of cerebral glucose utilization in the rat

The [ 14 C]deoxyglucose method for the measurement of local cerebral glucose utilization: Theory, procedure, and normal values in the conscious and anesthetized albino rat

The role of adenosine in the regulation of cerebral blood flow

Effects of γ -butyrolactone on local cerebral glucose utilization in the rat

BQ-123, a peptidic endothelin ET A receptor antagonist, prevents the early cerebral vasospasm following subarachnoid hemorrhage after intracisternal but not after intravenous injection

Cerebrovascular effects of a xanthine derivative propentofylline (HWA 285)

Regional cerebral blood flow in man determined by intraarterial injection of radioactive inert gas

Assessment of blood flow changes at multiple sites in rabbit skin using a 133 xenon clearance technique

Effect of calcitonin gene-related peptide on delayed vasospasm after experimental subarachnoid hemorrhage in rabbits

Prevention of cerebral vasospasm by calcitonin gene-related peptide slow-release tablet after subarachnoidal hemorrhage in monkeys

Effects of endotheliumderived nitric oxide on cerebral circulation during normoxia and hypoxia in the rat

Validity of cerebral blood flow measurements obtained with quantitative tracer techniques

A murine model of subarachnoid hemorrhageinduced cerebral vasospasm

Muscle blood flow in man studied with the local radioisotope method

Decrease in cerebral blood flow in rats after experimental sub-archnoid hemorrhage: a new animal model

Delayed cerebral vasospasm is not reversible by aminophylline, nifedipine, or papaverine in a "two-hemorrhage" canine model

Regional cerebral blood flow determination by 133 Xe inhalation and external recording: The effect of arterial recirculation

Effect of nitric oxide blockade by N G -nitro-L-arginine on cerebral blood flow response to changes in carbon dioxide tension

Local heat clearance from the brain as a measure of blood flow in acute and chronic experiments

Durchblutungsmessungen mit Waerme-Elementen

Validity of cerebral blood flow measurements obtained with quantitative tracer techniques

Instantaneous aortic blood flow measurement with range-gated Doppler flowmeter in anesthetized rat

Does nitric oxide mediate the increases in cerebral blood flow elicited by hypercapnia?

Oxygen supply and muscle blood flow in normal and diseased muscle

Differential effects of general anesthetics on regional vasoconstrictor responses in the rat

The effects of local anesthetics and epinephrine on rat sciatic nerve blood flow

Endothelium-derived nitric oxide synthase inhibition. Effects on cerebral blood flow, pial artery diameter, and vascular morphology in rats

Nitric oxide synthase is critical in mediating basal forebrain regulation of cortical cerebral circulation

Sciatic nerve blood flow measured by laser Doppler flowmetry and [ 14 C]iodoantipyrine

the most widely employed technique is fluid percussion, which produces brain injury by rapid injection of fluid into the closed cranial cavity

Most authors used rats, however, other species, such ad cats

Graded histological and locomotor outcomes after spinal cord contusion using the NYU weight-drop device versus transection

Effects of Niravoline (RU 51599), a selective kappa-opioid receptor agonist on intracranial pressure in gradually expanding extradural mass lesion

Experimental cerebral percussion

A controlled cortical impact model of traumatic brain injury in the rat

Application of glial fibrillary acidic protein histochemistry in the quantification of astrocytes in the rat brain

Comparison of single and combination drug treatment strategies in experimental brain trauma

The role of excitatory amino acids and NMDA receptors in traumatic brain injury

Sustained sensory/motor and cognitive deficits with neuronal apoptosis following controlled impact brain injury in the mouse

A monitored contusion model of spinal cord injury in the rat

Studies on experimental concussion. Relation of physiological effect to time duration of intracranial pressure increase at impact

Effects of the 21-amino-steroid U74006F on experimental head injury in mice

Metabolic, behavioral and electrophysiological correlates of experimental brain injury in the cat

Activation of pontine cholinergic sites implicated in unconsciousness following cerebral percussion in cats

Models of traumatic brain injury

Production and distribution of intracranial and intraspinal pressure changes at sudden extradural fluid volume input in rabbits

Multimodal early onset stimulation combined with enriched environment is associated with reduced CNS lesion volume and enhanced reversal of neuromotor dysfunction after traumatic brain injury in rats

A new model of diffuse brain injury in rats

Traumatic brain injury in the rat: characterization of a lateral fluid-percussion model

Effect of noncompetitive blockade of N-methyl-D-aspartate receptors on the neurochemical sequelae of experimental brain injury

Reduction of the neurological deficit in mice with traumatic brain injury by nitric oxide synthase inhibitors

Experimental head injury in the rat. Part 1. Mechanics, Ommaya AK, Gennarelli TA (1974) Cerebral concussion and traumatic unconsciousness. Correlation of experimental and clinical observations on blunt head injuries

Reduction of traumatic brain injury-induced cerebral oedema by a free radical scavenger

Long-term effect of HU211, a novel non-competitive NMDA antagonist, on motor and memory functions after closed head injury in the rat

Mattson MP (1997) 4-Hydroxynonenal, a lipid peroxidation product, rapidly accumulates following traumatic spinal cord injury and inhibits glutamate uptake

Fluid-percussion model of mechanical brain injury in the cat

Neuroprotective effects of 619C89, a use-dependent sodium channel blocker, in rat traumatic brain injury

A concussive-like brain injury model in mice: impairment in learning and memory

Pentoxifylline prevents spontaneous brain ischemia in strokeprone rats

Techniques: magnetic resonance imaging of the lung provides potential for non-invasive preclinical evaluation of drugs

Magnetic resonance imaging in drug discovery: lessons from disease areas

Middle cerebral artery occlusion in the rat by intraluminal suture: neurological and pathological evaluation of an improved model

Neuroprotective effect of aminoguanidine on transient focal ischaemia in the rat brain

Imaging brain function with positron emission tomography

Oedema reduction by levemopamil in focal cerebral ischaemia of spontaneously hypertensive rats studied by magnetic resonance imaging

Magnetic resonance imaging study on the effect of levemopamil on the size of intracerebral hemorrhage in rats

Arterial spin tagging perfusion imaging of rat brain: dependency on magnetic field strength

Functional magnetic resonance imaging during hypotension in the developing animal

Evolution of regional changes in apparent diffusion coefficient during focal ischemia of rat brain: the relationship of quantitative diffusion NMR imaging to reduction of cerebral blood flow and metabolic disturbances

Ultrafast perfusionweighted MRI of functional brain activation in rats during forepaw stimulation: comparison with T 2 *-weighted MRI

MR imaging of intravoxel incoherent motions: application to diffusion and perfusion in neurologic disorders

Pharmacological magnetic resonance imaging: a new application for functional MRI

Application of in vivo and ex vivo magnetic resonance imaging for the evaluation of tranilast on neointima formation following balloon angioplasty of the rat coronary artery

Effects of fluid management on edema volume and midline shift in a rat model of ischemic stroke

In vivo neuroprotective effects of ACEA 1021 confirmed by magnetic resonance imaging in ischemic stroke

A photothrombotic model of small early ischemic infarcts in the rat brain with histologic and MRI correlation

Regional brain activation by bicucculine visualized by functional magnetic resonance imaging. Time-resolved assessment of bicucculine-induced changes in local cerebral blood volume using an intravascular contrast agent

Diffusion-and T 2-weighted imaging: evaluation of oedema reduction in focal cerebral ischaemia by the calcium and serotonin antagonist levemopamil

Spermine reduces infarction and neurological deficit following a rat model of middle cerebral artery occlusion: a magnetic resonance imaging study

Prolonged exercise induces angiogenesis and increases cerebral blood flow in primary motor cortex of the rat

Reversible middle cerebral artery occlusion without craniectomy in rats

Vascular reactivity of perfused vascular bed in spontaneously hypertensive and normotensive rats

Perfusion of the isolated rat hind limb. An analysis of the technique

A method for the study of peripheral vascular responses in the rat

), a novel analog of adrenomedullin, possesses potent vasodilator activity in the hindlimb vascular bed of the cat

Analysis of the responses to human synthetic adrenomedullin and calcitonin generelated peptides in the hindlimb vascular bed of the cat

The effect of tyramine on peripheral vasculature of the spontaneously hypertensive rat

Background of increased flow resistance and vascular reactivity in spontaneously hypertensive rats

Pharmacology of 6,7-dihydroxy-2-dimethylaminotetralin (TL-99). I. Cardiovascular activity in the dog and cat

Development of a near anesthetic-free isolated canine hindlimb model. The effects of halothane and atropine sulfate on vascular resistance

Hind-limb perfusion. In: Perfusion techniques in biochemistry. A laboratory manual in the use of isolated perfused organs in biochemical experimentation

Evaluation of the isolated perfused rat hind-quarter for the study of muscle metabolism

Analysis of responses to bradykinin: effects of Hoe-140 in the hindquarters vascular bed of the cat

Response of chemosensitive nerve fibres of group III and IV to metabolic changes in rat muscles

Reflex increases in heart-rate induced by perfusing the hind leg of the rat with solutions containing lactic acid

Continuous measurement of hindquarter resistance changes to nerve stimulation and intra-arterial drug administration in rats

Der Einfluß einiger Lokalanästhetika auf die erregende Wirkung von Bradykinin am glatten Muskel. 1. Mitteilung: Die Verstärkung der vasokonstriktorischen Wirkung von Bradykinin an der isolierten Hinterpfote der Katze

The pharmacology of GR203040, a novel, potent and selective tachykinin NK 1 receptor antagonist

In vivo validation of a transit-time ultrasonic volume flow meter

Comparison between hydrogen clearance and microsphere technique for rCBF measurement

Validation studies for the use of the microsphere method in cats and young minipigs

Effect of fenoldopam on regional vascular resistance in conscious spontaneously hypertensive rats

Nitric oxide synthase-independent generation of nitric oxide in rat skeletal muscle ischemic-perfusion injury

Total and regional cerebral blood flow measurements with 7-10, 15, 25 and 50 µm microspheres

New applications of a 20-Mhz Doppler ultrasonic flowmeter

Regional blood flow determination in rats by the microsphere method during i.v. infusion of vasodilating agents

Some sources of error in measuring blood flow with radioactive microspheres

Effect of adrenomedullin on renal hemodynamics and function in dogs

Validation of fluorescent-labeled microspheres for measurement of regional organ perfusion

Direct observations of the behavior of microspheres in the microvasculature

Development of non-radioactive microsphere technique for blood flow measurement

A new sample-processing unit for the fluorescent microsphere method

The circulation of the fetus in utero; methods for studying distribution of cardiac output and organ blood flow

Automation of the use of fluorescent microspheres for the determination of blood flow

Fluorescent microspheres to measure organ perfusion: validation of o simplified sample processing technique

Skeletal muscle microcirculation: the effects of limited blood flow and treatment with torbafylline

Sauerstoffdruckwerte im ischaemischen Muskelgewebe von Patienten mit chronischen arteriellen Verschlußerkrankungen

Possibilities of measuring oxygen pressure fields in tissue by multiwire platinum electrodes

Monitoring of tissue perfusion and cellular function

Oxygen supply and muscle blood flow in normal and diseased muscle

Principle of construction and application of various platinum electrodes

Vascular reactivity of perfused mesenteric vascular bed in spontaneously hypertensive and normotensive rats

The rabbit isolated arterially perfused intestinal segment preparation: A model for vascular dopamine receptors

Effects of HOE 140 on systemic depressor responses to bradykinin and mesenteric vascular reactivity in vivo in pregnant Wistar-Kyoto rats

Functional characterization of the pre-and postjunctional α-adrenoceptors in the in situ perfused rat mesenteric vascular bed

Effect of three 'loop' diuretics and prostaglandins E 2 & I 2 on the isolated perfused rat mesenteric vasculature

Release of leukotriene C 4 by isolated, perfused rat small intestine in response to platelet-activating factor

Blockade of the pre-and postjunctional effects of angiotensin in vivo with a non-peptide angiotensin receptor antagonist

Vasoconstrictor response induced by 5-hydroxytryptamine released from vascular adrenergic nerves by periarterial nerve stimulation

Characterization of the isolated rat mesenteric vascular-intestinal loop preparation

Pharmacological studies of smooth muscle from Dahl salt-sensitive and salt-resistant rats

Responses of the isolated perfused mesenteric vasculature from diabetic rats: the significance of appropriate control tissues

Perfusion of the intact and partially isolated mesenteric vascular bed: Application to vessels from hypertensive and normotensive rats

Vascular effects of capsaicin in isolated perfused rat mesenteric bed

The effect of temperature on the αadrenoreceptor antagonist potency of indoramin and labetalol in the rat perfused mesenteric vascular bed

The effect of sympathetic nerve stimulation on vasoconstrictor responses in perfused mesenteric blood vessels of the rat

Contractile properties of small arterial resistance vessels in spontaneously hypertensive and normotensive rats

The influence of phenelzine and tranylcypromine on the release of prostaglandins from the rat mesenteric vascular bed

Structureactivity study of chicken calcitonin gene-related peptide (CGRP) on vasorelaxation in rat mesenteric resistance vessels

Removal of the endothelial layer in perfused mesenteric vascular bed of the rat

Mechanical and contractile properties of in situ localized mesenteric arteries in normotensive and spontaneously hypertensive rats

Effect of phenobarbitone pretreatment upon endothelium-dependent relaxation to acetylcholine in rat superior mesenteric arterial bed

Vascular activities of endothelin-1 and some alanyl substituted analogues in resistance beds of the rat

Inhibitory effects of Hoe 140 on vascular responses to bradykinin in the mesenteric vascular bed of the cat

Comparison of responses to adrenomedullin and adrenomedullin analogs in the mesenteric vascular bed of the cat

Prostaglandins and thromboxane outflow from the perfused mesenteric vascular bed in spontaneously hypertensive rats

Responses of pulmonary vascular segments to angiotensin and norepinephrine

An isolated perfused rat lung preparation for the study aerosolized drug deposition and absorption

Analysis of responses to bradykinin in the pulmonary vascular bed of the cat

Comparison of responses to adrenomedullin and calcitonin gene-related peptide in the pulmonary vascular bed of the cat

Estimation of the filtration coefficient of pulmonary exchange vessels

Effective pulmonary flow, aortic flow and cardiac output: in vitro and in vivo comparison in the dog

Pulmonary vasodilation to adrenomedullin: A novel peptide in humans

Methylene blue selectively inhibits pulmonary vasodilator response in cats

Adrenomedullin dilates the pulmonary vascular bed in vivo

Influence of cyclo-oxygenase blockade on responses to isoproterenol, bradykinin and nitroglycerin in the feline pulmonary vascular bed

Effect of tumor necrosis factor on hypoxic pulmonary vasoconstriction

Analysis of responses to substance P in the pulmonary vascular bed of the cat

Angiotensin-converting enzyme activity in the isolated perfused guinea pig lung

Comparative effects of adrenomedullin, an adrenomedullin analog, and CGRP in the pulmonary vascular bed of the cat and the rat

Effects of milrinone on lung water content in dogs with acute pulmonary hypertension

The effect of 7-(2 -oxopropyl)-1,3-di-n-butyl-xanthine (BRL 30892 on ischaemic skeletal muscle pO 2 , pH and contractility in cats and rats

Effects of dimethylformamide on in vivo fatigue and metabolism in rat skeletal muscle measured by 31P-NMR

The effects of torbafylline on blood flow, pO 2 , and function of rat ischemic skeletal muscle

Novel immobilization model in the rat: functional, histomorphological and biochemical changes in atrophying skeletal muscle

Pentoxifylline, a review of its pharmacodynamic and pharmacokinetic properties

Drug effects on function in the ferret ischemic hindlimb

Techniques for studying adrenergic transmitter release in an isolated perfused artery

A new cannula-inserting method for measuring vascular responsiveness. Separate intraluminal and extraluminal perfusion of canine basilar artery

Low volume perfusion-superfusion system for measurement of transmitter release from blood vessels in vitro

A simple isolated nerve-blood vessel preparation

The influence of sympathetic innervation on vascular sensitivity to noradrenaline

Depressants of peripheral sympathetic nerve function

Actions of bradykinin antagonists on bradykinin-induced plasma extravasation, venoconstriction, prostaglandin E 2 release, nociceptor stimulation and contraction of the iris sphincter muscle of the rabbit

Über die Wirkung von Giften auf die

New, long-acting, potent bradykinin antagonists

Cellular mechanisms of the steroid-induced vascular responses in the rabbit ear artery

Über den Einfluss der Temperatur auf die peripherischen Gefässe

Untersuchungen über den Adrenalingehalt des Blutes

Einfluß von Novalgin und kolloidalem Eisen auf die Ödembildung am isolierten Kaninchenohr. Naunyn-Schmiedeberg's Arch exp

Inhibition of adrenergic transmission by parasympathicomimetics in the rabbit ear artery

The perfused rabbit ear. In: Screening methods in pharmacology

Localisation of venoconstrictor responses

Elastase-induced experimental aneurysms in rats

LRP: role in vascular wall integrity and protection from atherosclerosis

Age of onset, pattern of distribution, and histology of aneurysm development in a genetically predisposed mouse

Experimental techniques and models in the study of the development and treatment of abdominal aortic aneurysm

Murine aortic aneurysm produced by periarterial application of calcium chloride

Mouse models of abdominal aortic aneurysms

Pathophysiology and pathogenesis of aortic aneurysms. Current concepts

Animal models of aneurysms

Abdominal aortic aneurysm

Influence of hypercholesterolemia and adventitial inflammation on the development of aortic aneurysms in rabbits

Aneurysms of the rabbit common carotid artery induced by periarterial application of calcium chloride in vivo

LRP: a multifunctional scavenger and signaling receptor

Massive xanthomatosis and atherosclerosis in cholesterolfed low density lipoprotein receptor-negative mice

Enhanced atherosclerosis and kidney dysfunction in eNOS(-)/(-)Apo(-)/(-) mice are ameliorated by enalapril treatment

Accelerated atherosclerosis, aortic aneurysms formation, and ischemic heart disease in apolipoprotein E/endothelial nitric oxide synthase double-knockout mice

Experimental abdominal aortic aneurysms in mice lacking expression of inducible nitric oxide synthase

Matrix metalloproteinases 2 and 9 work in concert to produce aortic aneurysms

Inactivation of the lysyl oxidase gene Lox leads to aortic aneurysms, cardiovascular dysfunction, and perinatal death in mice

Salt-sensitive aortic aneurysms and rupture in hypertensive transgenic mice that overproduce angiotensin II

Effects of two inhibitors of renin-angiotensin system on attenuation of postoperative remodeling after left ventricular aneurysm repair in rats

Effect of matrix metalloproteinase inhibition on progression of atherosclerosis and aneurysm in LDL receptor-deficient mice overexpressing MMP-3, MMP-12, and MMP-13 and on restenosis in rats after balloon injury

Targeted disruption of matrix metalloproteinase-9 (gelatinase B) suppresses development of experimental aortic aneurysms

Hydrocortisone rapidly induces aortic rupture in a genetically susceptible mouse

Persistence of atherosclerotic plaque but reduced aneurysm formation in mice with stromelysin-1 (MMP-3) gene inactivation

Reduced atherosclerotic plaque but enhanced aneurysm formation in mice with inactivation of the tissue inhibitor of metalloproteinase-1 (TIMP-1) gene

Angiotensin II promotes atherosclerotic lesions and aneurysms in apolipoprotein E-deficient mice

Antagonism of AT2 receptors augments angiotensin II-induced abdominal aortic aneurysms and atherosclerosis

Urokinase-type plasminogen activator plays a critical role in angiotensin II-induced abdominal aortic aneurysm

Development of heart failure and congenital septal defects in mice lacking endothelial nitric oxide synthase

Suggested standards for reporting on arterial aneurysms: Subcommittee on Reporting Standards for Arterial Aneurysms, Ad Hoc Committee on Reporting Standards, Society for Vascular Surgery and North American Chapter

Enhanced atherosclerosis and kidney dysfunction in eNOS(-)/(-)Apo(-)/(-) mice are ameliorated by enalapril treatment

Abdominal aortic aneurysms: fresh insights from a novel animal model of the disease

Differential effects of doxycycline, a broad-spectrum matrix metalloproteinase inhibitor, on angiotensin II-induced atherosclerosis and abdominal aortic aneurysms

β-estradiol attenuates development of angiotensin II-induced aortic abdominal aneurysm in apolipoprotein E-deficient mice

Aortic dissection precedes formation of aneurysms and atherosclerosis in angiotensin II-infused, apolipoprotein E-deficient mice

Tumor necrosis factoralpha induces apoptosis via inducible nitric oxide synthase in neonatal mouse cardiomyocytes

Increased aortic stiffness assessed by pulse wave velocity in apolipoprotein E-deficient mice

Angiotensin II increases urokinase-type plasminogen activator expression and induces aneurysms in the abdominal aorta of apolipoprotein E-deficient mice

Fasudil, a Rho-kinase inhibitor, attenuates angiotensin II-induced abdominal aortic aneurysm in apolipoprotein E-deficient mice by inhibiting apoptosis and proteolysis

CYR61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth

Inhibition of angiogenesis by somatostatin and somatostatin-like compounds is structurally dependent

Mouse model of angiogenesis

Cloning, expression, and in vitro activity of human endostatin

Primary structure of bovine pituitary basic fibroblast growth factor (FGF) and comparison with the amino-terminal sequence of bovine brain acidic FGF

Interferon alfa-2a therapy for life-threatening hemangiomas in infancy

The biology of vascular endothelial growth factor

Isolation and characterization of angiogenin, an angiogenic protein from human carcinoma cells

Angiogenic factors

A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin

The angiogenic activity of the fibroblast and epidermal growth factor

Regulators of angiogenesis

Macrophage-induced angiogenesis is mediated by tumor necrosis factor alpha

Vascular endothelial growth factor is a secreted angiogenic mitogen

Angiogenesis in human coronary atherosclerotic plaques

Angiostatin, a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma

Angiostatin induces and sustains dormancy of human primary tumors in mice

Endostatin: an endogenous inhibitor of angiogenesis and tumor growth

Vasostatin, a calreticulin fragment, inhibits angiogenesis and suppresses tumor growth

Transforming growth factor-alpha: a more potent angiogenic mediator than epidermal growth factor

Vascular endothelial growth factor, a potent and selective angiogenic agent

Transforming growth factor 1-induced changes in cell migration, proliferation, and angiogenesis in the chicken chorioallantoic membrane

The mouse aorta model: Influence of genetic background and aging on bFG-and VEGF-induced angiogenic sprouting

Tradipil inhibits endothelial cell proliferation and angiogenesis in the chick chorioallantoic membrane and in the rat cornea

Hepatocyte growth factor is a potent angiogenic growth factor which stimulates endothelial cell motility and growth

Suppression of angiogenesis and tumor growth by the inhibitor K1-5 generated by plasmin-mediated proteolysis

The 16-kilodalton N-terminal fragment of human prolactin is a potent inhibitor of angiogenesis

Inhibition of angiogenesis by the somatostatin analogue octreotide acetate (SMS 201-995)

Long-term culture of capillary endothelial cells

Neomycin inhibits angiogenin-induced angiogenesis

Antiangiogenesis by cyclosporine

Eponemycin, a novel antibiotic, is a highly powerful angiogenesis inhibitor

Endostatin: an endogenous inhibitor of angiogenesis and tumor growth

Vasostatin, a calreticulin fragment, inhibits angiogenesis and suppresses tumor growth

Antiangiogenesis is produced by nontoxic doses of vinblastine

A simple procedure for the long-term cultivation of chicken embryos

Inhibition of angiogenesis by somatostatin and somatostatin-like compounds is structurally dependent

Tradipil inhibits endothelial cell proliferation and angiogenesis in the chick chorioallantoic membrane and in the rat cornea

Suppression of angiogenesis and tumor growth by the inhibitor K1-5 generated by plasmin-mediated proteolysis

The 16-kilodalton N-terminal fragment of human prolactin is a potent inhibitor of angiogenesis

A new class of steroids inhibits angiogenesis in the presence of heparin or a heparin fragment

Inhibition of angiogenesis by the somatostatin analogue octreotide acetate (SMS 201-995)

Inhibition of angiogenesis by antiestrogens

Amifostine inhibits angiogenesis in vivo

New activity of spironolactone. Inhibition of angiogenesis in vitro and in vivo

Antiangiogenesis by cyclosporine

Angiostatic activity and metabolism of cortisol in the chorioallantoic membrane (CAM) of the chick embryo

Angiostatic activity of steroids in the chick embryo CAM and rabbit cornea models of neovascularization

VEGF and VEGF-C: Specific induction of angiogenesis and lymphangiogenesis in the differentiated avian chorioallantoic membrane

Potent inhibition of angiogenesis by wortmannin, a fungal metabolite

Endostatin: an endogenous inhibitor of angiogenesis and tumor growth

Endogenous basic fibroblast growth factor is implicated in the vascularization of the chick chorioallantoic membrane

Human erythropoietin induces a proangiogenic phenotype in cultured endothelial cells and stimulates neovascularization in vivo

Protamine is an inhibitor of angiogenesis

Antiangiogenesis is produced by nontoxic doses of vinblastine

An evaluation of methods to quantitate the chick chorioallantoic membrane assay in angiogenesis

CYR61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth

The rabbit cornea. A model for the study of angiogenic factors

Topical formulations of novel angiostatic steroids inhibit rabbit corneal neovascularization

Suppression of angiogenesis and tumor growth by the inhibitor K1-5 generated by plasmin-mediated proteolysis

A new class of steroids inhibits angiogenesis in the presence of heparin or a heparin fragment

Intracorneal bovine albumin: an immunologic model of corneal angiogenesis

Inhibition of inflammatory angiogenesis in rats by locoregional administration of hydrocortisone and protamine

Tumor growth and neo-vascularization: an experimental model using the rabbit cornea

Topical application of methotrexate for inhibition of corneal angiogenesis

A model of angiogenesis in the mouse cornea

New activity of spironolactone. Inhibition of angiogenesis in vitro and in vivo

Angiostatic activity of steroids in the chick embryo CAM and rabbit cornea models of neovascularization

Peroxisome proliferator-activated receptor γ ligands are potent inhibitors of angiogenesis in vitro and in vivo

The formation of a structure with the features of synovial lining by subcutaneous injection of air. An in vivo tissue culture system

Establishment of a quantitative mouse dorsal air sac model and its application to evaluate a new angiogenesis inhibitor

The subcutaneous air pouch model of synovium and the inflammatory response to heat aggregated gammaglobulin

The rat subcutaneous air sac model: REFERENCES AND FURTHER READING

Evidence of a dual role of endogenous histamine in angiogenesis

Mast cell-mediated angiogenesis. A novel experimental model using the rat mesentery. Virchow's Arch B

Quantitative angiogenesis in spreads of intact mesenteric windows

The microcirculation in the intestinal mesentery

Functions of the VEGF receptor-1 (FLT-1) in the vasculature

Vascular endothelial growth factor-C: A growth factor for lymphatic and blood vascular endothelial cell

EG-VEGF and Bv8: a novel family of tissue-restricted angiogenic factors

VEGF-C signaling pathways through VEGFR-2 and VEGFR-3 in vasculoangiogenesis and hematopoiesis

Detection and quantification of complexed and free soluble human vascular endothelial growth factor receptor-1 (sVEDFR-1) by ELISA

Vascular endothelial growth factors VEGF-B and VEGF-C

Characterization of indolines which preferentially inhibit VEGF-Cand VEGF-D-induced activation of VEGFR-3 rather than VEGFR-2

VeGF-D is the strongest angiogenesis and lymphangiogenetic factor among VEGFs delivered into skeletal muscle via adenoviruses

Quantification of vascular endothelial growth factor-C (VEGF-C) by a novel ELISA

Baka et al. 2006). In particular, VEGF Trap, a soluble decoy receptor comprising portions of VEGF receptors 1 and 2, has been studied

found that vascular endothelial growth factor-Trap decreases tumor burden, inhibits ascites, and causes dramatic vascular remodeling in an ovarian cancer model

A review on the latest clinical compounds that inhibit VEGF in pathological angiogenesis

Vascular endothelial growth factor-Trap decreases tumor burden, inhibits ascites, and causes dramatic vascular remodeling in an ovarian cancer model

Anti-VEGF receptor-2 monoclonal antibody prevents portal-system collateral vessel formation in hypertensive mice

Vascular endothelial growth factor Trap suppresses ovarian function at all stages of the luteal phase in the macaque

Vascular endothelial growth factor-Trap suppresses tumorigenicity of multiple pancreatic cancer cell lines

A new class of potent vascular endothelial growth factor receptor tyrosine kinase inhibitors. Structure-activity relationships for a series of 9-alkoxymethyl-12-(3-hydroxypropyl)indeno[2,1-a]pyrrolo[3,4-c]carbazole-5-ones and the identification of CEP-52144 and its dímethylglycine ester prodrug clinical candidate CEP-7055

High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein

A novel noncontaiining-nitrogen biphosphonate inhibits both in vitro and in vivo angiogenesis

VEGF-Trap: a VEGF blocker with potent antitumor effects

Building a better trap

Inhibition of phosphatidylinositol 3 -kinase increases efficacy of paclitaxel in in vitro and in vivo ovarian cancer models

Vascular endothelial growth factor Trap combined with Paclitaxel strikingly inhibits tumor and ascites, prolonging survival in a human ovarian cancer model

Potent VEGF blockade causes regression of coopted vessels in a model of neuroblastoma

Technology evaluation: VEGF Trap (cancer). Regeneron/Sanofi-aventis

A vascular gene trap screen defines RasGRP3 as an angiogenesis-regulated gene required for the endothelial response to phorbol esters

Differentiation stage-specific inhibition of the Raf-MEK-ERK pathway by Akt

VEGF-Trap (R1R2) suppresses choroidal neovascularization and VEGF-induced breakdown of the blood-retinal barrier

Angiopoietin-1 protects the adult vasculature against plasma leakage

Vascular endothelial growth factor and its inhibitors. Drug Today 39

ZM32881, a novel inhibitor of vascular endothelial growth factor-receptor-2 tyrosine kinase activity

Luteal angiogenesis: prevention and intervention by treatment with vascular endothelial growth factor Trap A40

 Leprán et al. (1983) placed a loose silk loop around the left coronary artery and passed the thread through a cylinder shaped polyethylene tube outside the thorax. The rats were allowed to recover from primary surgery. The loose ligature was tightened 7-10 days thereafter and arrhythmias recorded by ECG tracings. Johnston et al. (1983) described the responses to ligation of a coronary artery in conscious rats and the actions of anti-arrhythmics.As reported in Sect. A.3.1.2 and A.3.1.3, the isolated heart according to LANGENDORFF and the isolated working rat heart preparation can be used for ligation experiments inducing arrhythmias. Lubbe et al. (1978) reported ventricular arrhythmias associated with coronary artery occlusion and reperfusion in the isolated perfused rat heart as a model for assessment of anti-fibrillatory action of anti-arrhythmic agents.Bernier et al. (1986) described reperfusion-induced arrhythmias in the isolated perfused rat heart. The isolated rat heart was perfused according the LANGEN-DORFF-technique. A ligature was placed around the left anterior descending coronary artery close to its ori-gin. The arterial occlusion was maintained for 10 min followed by reperfusion. Test compounds were included in the perfusion medium. With epicardial ECGelectrodes the number of premature ventricular complexes, the incidence and duration of ventricular fibrillation, and the incidence of ventricular tachycardia were recorded. Abraham et al. (1989) tested antiarrhythmic properties of tetrodotoxin against occlusion-induced arrhythmias produced by ligation of the left anterior descending coronary artery in the rat. MacLeod et al. (1989) tested a long acting analogue of verapamil for its actions against arrhythmias induced by ischemia and reperfusion in conscious and anesthetized rats, as well as for effects on epicardial intracellular action potentials. Harper et al. (1993) found that the inhibition of Na + /H + exchange preserves viability, restores mechanical function, and prevents the pH paradox in reperfusion injury to rat neonatal myocytes. Scholz et al. (1993 Scholz et al. ( , 1995 reported protective effects of HOE642, a selective sodium-hydrogen exchange subtype 1 inhibitor, on cardiac ischaemia and reperfusion in rats. Likewise, Yasutake et al. (1994) found protection against reperfusion-induced arrhythmias in rats by intracoronary infusion of a Na + /H + exchange inhibitor. Aye et al. (1997) tested the effects of a Na + /H + exchange inhibitor on reperfusion ventricular arrhythmias in rat hearts. Ferrara et al. (1990) studied the effect of flecainide acetate on reperfusion-and barium-induced ventricular tachyarrhythmias in the isolated perfused rat heart by monitoring heart rate, coronary flow rate, left ventricular systolic pressure, dp/dt max , and the voltage of the epicardial electrogram.Heterogeneity of ventricular remodeling after acute myocardial infarction in rats has been reported by Capasso et al. (1992) . Bellemin-Baurreau et al. (1994) described an in vitro method for evaluation of antiarrhythmic and antiischemic agents by using programmed electrical stimulation of the isolated rabbit heart after ligation of the left ventricular branch of the coronary artery and a reperfusion period of 15 min.The use of the rat in models for the study of arrhythmias in myocardial ischemia and infarction has been reviewed by Curtis et al. (1987) . Black and Rodger (1996) , Black (2000) reviewed the methods used to study experimental myocardial ischemic and reperfusion injury in various animal species. described a canine model of atrial fibrillation due to chronic atrial dilatation. Courtemanche et al. (1999) and Ramirez et al. (2000) published mathematical models of fibrillationinduced electrical remodeling and of canine atrial action potentials. Pinto and Boyden (1999) reviewed electrical remodeling in ischemia and infarction. Cabo and Boyden (2003) performed a computational analysis of electrical remodeling of the epicardial border zone in the canine infarcted heart. Sakabe et al. (2004) reported that enalapril prevents perpetuation of atrial fibrillation by suppressing atrial fibrosis and over-expression of connexin43 in a canine model of atrial pacing-induced left ventricular dysfunction. Baartscheer et al. (2005) induced combined volume and pressure overload in New Zealand white rabbits. In a first surgical procedure, volume overload was produced by rupture of the aortic valve until pulse pressure increased by about 100%, and after 3 weeks, pressure overload was created by suprarenal abdominal aortic constriction of 50%. In these animals, chronic inhibition of the Na + /H + exchanger attenuated cardiac hypertrophy and prevented cellular remodeling in heart failure.

Using cultured atrial myocytes (HL-1 cells), Yang et al. (2005) found that rapid field stimulation (300 beats/min) causes electrical remodeling.

Several hundreds of papers on transgenic mice and heart failure are published. Only a few can be mentioned here. Chien (1995) described cardiac muscle diseases in genetically engineered mice. Edwards et al. (1996) described severe cardiomyopathy in transgenic mice overexpressing the skeletal muscle myogenic regulator myf5. Arber et al. (1997) found that MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Graham et al. (1997) described a mouse model for mitochondrial myopathy and cardiomyopathy resulting from a deficiency in the heart/muscle isoforms of the adenine nucleotide translocator. Iwase et al. (1997) studied cardiomyopathy in transgenic mice induced by overexpression of the cardiac stimulatory G protein α subunit. Knollmannn et al. (2000) reported remodeling of ionic currents in hypertrophied and failing hearts of transgenic mice overexpressing calsequestrin. Beggah et al. (2002) described reversible cardiac fibrosis and heart failure induced by conditional expression of an antisense mRNA of the mineralocorticoid receptor in cardiomyocytes. found increased vulnerability to atrial fibrillation in transgenic mice with selective atrial fibrosis caused by overexpression of TGF-β1. Duncan et al. (2005) found that chronic xanthine oxidase inhibition prevents myofibrillar protein oxidation and preserves cardiac function in a transgenic mouse model of cardiomyopathy. Hartil and Charron (2005) reviewed mouse models where transgenic technology has been utilized to alter expression of genes involved in cardiac uptake and metabolism of either lipid or carbohydrate. Hilfiker-Kleiner et al. (2005) reported that STAT3knockout mice harboring a cardiomyocyte-restricted deletion of STAT3 showed enhanced susceptibility to cardiac injury caused by myocardial ischemia, systemic inflammation, or drug toxicity. studied reversal of amyloid-induced heart disease in desmin-related cardiomyopathy. Siri et al. (1989 Siri et al. ( , 1991 produced left ventricular hypertrophy in the guinea pig by gradually increasing ventricular afterload. A mildly constricting band was placed around the ascending aorta of very young guinea pigs (225-275 g) . With growth to 500-1000 g, left ventricular systolic pressure increased and ventricular hypertrophy developed. Only some of the animals developed dyspnea and severe ventricular dysfunction. Kiss et al. (1995) studied the effects on Ca 2+ transport and mechanics in compensated pressure-overload hypertrophy and congestive heart failure in guinea pigs. The descending aorta was banded for 4 and 8 weeks in adult guinea pigs. Tweedle et al. (1995) assessed subrenal banding of the abdominal aorta as a method of inducing cardiac hypertrophy in the guinea pig. induced myocardial infarction in rats by ligation of the left coronary artery and found hemodynamic benefits and prolonged survival with long-term captopril therapy.

Acute ischemic left ventricular failure can be induced in anesthetized dogs by repeated injections of plastic microspheres into the left coronary artery (see A.3.2.4) . Huang et al. (1997) created congestive heart failure in sheep by selective sequential intracoronary injection of 90 µm microspheres under 1.5% isofluorane injection.

Rabbit models of heart failure were reviewed by .Rapid pacing was used by Masaki et al. (1994) , Porsa et al. (1994) , Eble et al. (1998 , and Rose et al. (2005) ; coronary artery ligation by Pennock et al. (1997) , Currie and Smith (1999) , Romanic et al. (2001), and Miller et al. (2004) ; combined pressure and volume overload by Ezzaher et al. (1991) , Mohammadi et al. (1997) , Dekker et al. (1998 ), and Baartscheer et al. (2003a , 2003b ; aortic insufficiency and aortic constriction by Bouanani et al. (1991) and Pogwizd et al. (1999) ; regurgitation after damage of the mitral valve by Gunawardena et al. (1999) ; regurgitation after aortic valve destruction by Magid et al. (1988 Magid et al. ( , 1994 , Yoshikawa et al. (1993) , King et al. (1997), and Liu et al. (1998); Luchner et al. (2001) used a rabbit model of progressive left ventricular dysfunction to investigate differential expression of cardiac atrial natriuretic peptide and brain natriuretic peptide. Ventricular pacing-induced heart failure could be induced with a transvenously implanted pacemaker system.

Male rabbits (chinchilla bastard) underwent implantation of a programmable cardiac pacemaker (Medtronic Minix 8340, Minneapolis, Mn., USA). Under anesthesia (ketamine 60 mg/kg xylazine 5 mg/kg i.m.), the right internal jugular vein was dissected and cannulated with a single-lumen central venous catheter (Braun, Germany). The catheter was then advanced A.6.0.6 Congestive Heart Failure in Dogs PURPOSE AND RATIONALE Several methods are described, to induce congestive heart failure in dogs, such as rapid ventricular pacing (Armstrong et al. 1986; Freeman et al. 1987; Wilson et al. 1987; Komamura et al. 1992 Komamura et al. , 1993 Perreault et al. 1992; Travill et al. 1992; Cheng et al. 1993; Redfield et al. 1993; Cory et al. 1994; Kiuchi et al. 1994; Ohno et al. 1994; Vatner et al. 1994; Wang et al. 1994; Williams et al. 1994; Eaton et al. 1995; Spinale et al. 1995; Wolff et al. 1995; Zile et al. 1995; Ravens et al. 1996; Shinbane et al. 1997; O'Rourke et al. 1999; Winslow et al. 1999) . Luchner et al. (1996) assessed circulating, renal, cardiac, and vascular angiotensin II in a canine model of rapid ventricular pacing-induced heart failure that evolves from early left ventricular dysfunction to overt congestive heart failure.

Male mongrel dogs underwent implantation of a programmable cardiac pacemaker (Medtronic). Under pentobarbital sodium anesthesia and artificial respiration, the heart was exposed via a small left lateral thoracotomy and pericardiotomy, and a screw-in epicardial pacemaker lead was implanted into the right ventricle. The pacemaker was implanted subcutaneously into the left chest wall and connected to the pacemaker lead. The dogs were allowed to recover for at least 10 days after surgery before the pacemaker was started. During the first 10 days dogs were paced at A.6.0.9 Cardiac Failure in Monkeys

Several authors used monkeys for studies of cardiac failure. Hollander et al. (1977) investigated the role of hypertension in ischemic heart disease in the cynomolgus monkey with coarctation of the aorta. Sieber et al. (1980) studied cardiotoxic effects of adriamycin in macaques.Various studies were performed by the group of Hoit and Walsh in baboons (Hoit et al. 1955a (Hoit et al. , 1955b (Hoit et al. , 1997a (Hoit et al. , 1997b Khoury et al. 1996) . Hoit et al. (1997a) studied the effects of thyroid hormone on cardiac βadrenergic responsiveness in conscious baboons.

Adult male baboons (Papio anubis) weighing 21-30 kg were pre-instrumented for physiological monitoring in a lightly anesthetized, sedated state. Animals were pre-instrumented with a Konigsburg micromanometer and a polyvinyl catheter in the LV apex, miniaturized sonomicrometer pairs (3 MHz, 6 mm) across the LV anteroposterior minor axis, a polyvinyl catheter in the right atrium for central venous access, and pacing wires on the right atrial appendage. Wires and tubes were tunneled subcutaneously into the interscapular area for later use. Postoperative pain was reduced by the use of Buprenex (0.01 mg/kg i.m., q 6 h), and postoperative antibiotic (Monocid 25 mg/kg) was administered for 5 days to reduce the risk of infection. Baseline hemodynamic studies were performed after a minimum of 1 week for postoperative recovery.Hemodynamic data acquisition and analysis The micromanometers and fluid-filled catheters were calibrated with a mercury manometer. Zero drift of the micromanometer was corrected by matching the LV enddiastolic pressure measured simultaneously through the LV catheter. The fluid-filled LV catheter was connected to a pre-calibrated Statham 23 dB transducer with zero pressure at the level of the mid right atrium. The transit time of ultrasound between the ultrasonic dimension crystals was measured with a multichannel sonomicrometer (Triton Technology) and converted to distance assuming a constant velocity of sound in blood of 1.55 mm/ms.The analog LV dP/dI signal was obtained online by electronic differentiation of the high-fidelity LV pressure signal. τ was derived from the highfidelity LV pressure tracing by the method of Weiss et al. (1976) , which assumes a monoexponential decay of LV pressure to a zero asymptote and has been shown to be directionally equivalent to other mathematical approaches for quantification of isovolumic pressure decay. τ is equal to the time in milliseconds for LV pressure to decay to 1/e; thus, decreases in τ reflect improved isovolumic ventricular relaxation.Fractional shortening of the LV minor axis was calculated as (EDD-ESD)/EDD, where EDD is LV enddiastolic dimension and ESD is LV end-systolic dimension. LV end-diastole was defined as the time in which LV dP/dt max increased by ≥ 150 mmHg/s for 50 ms, and LV end-systole was defined as the time of the maximum ratio of LV pressure to LV minor-axis dimension. LV volumes were derived from minor-axis diameter (D) measurements: LV volume = π/6(D) 3 .V cf was calculated as LV fractional shortening divided by LV ejection time; LV ejection time was defined as the time from peak positive to peak negative dP/dt.Analog signals for high-fidelity and fluid-filled LV pressures, LV short-axis dimension, LV dP/dt, and the ECG were recorded on-line on a Gould multichannel recorder at 25 and 100 mm/s paper speed and digitized through an analog-to-digital board (Dual Control Systems) interfaced to an IBM AT computer at 500 Hz and stored on a floppy disk. Data were analyzed using an algorithm and software developed in our laboratory. Steady-state data were acquired over 5-10 s during spontaneous respiration and averaged.

Hemodynamic studies were performed a minimum of 1 week after instrumentation and were repeated after 22-30 (26.8 ± 2.7) days of thyroid T 4 administration. Animals were tranquilized with Valium (1-5 mg) and ketamine (100 mg), and cholinergic blockade was achieved with atropine (0.4-0.8 mg i.v.); additional ketamine was administered as necessary, to a maximum cumulative dose of 40 mg/kg. Animals were atrially paced at a rate 40% to 50% greater than the control heart rate in order to obtain data at matched heart rates after thyrotoxicosis was produced.

Cardiac glycosides can be characterized by their binding kinetics (association process, equilibrium binding, and dissociation process) on the ouabain receptor.

Heart sarcolemma preparations are obtained from rat or dog heart. From a canine heart or from rat hearts submitted to coronary perfusion myocytes are isolated by collagenase digestion. The isolated membrane fractions consist mainly of myocyte sarcolemma. [ 3 H]ouabain with a specific radioactivity of about 20 Ci/mmol is incubated with ligands to be tested in 10 ml of binding medium consisting of 1 mM MgCl 2 , 1 mM inorganic phosphate, and 50 mM Tris-HCl, pH 7.4 at 37°C for 10 min.Association process: After temperature equilibration in the presence of either 10 or 100 nM [ 3 H]ouabain, 200 µg of membrane preparation are added to initiate the reaction. At various times, 4.5 ml are removed and rapidly filtered.Equilibrium binding: At the end of the temperature equilibration carried out in the presence of increasing concentrations of [ 3 H]ouabain ranging from 10 nM to 3 µ M, 40 µg of membranes are added. After 30 min, duplicate aliquots of 4.5 ml are removed and filtered.Dissociation process: Once equilibrium has been achieved under the experimental conditions used to study association, 10 ml of prewarmed Mg 2+ plus P i Tris-HCl solution supplemented with 0.2 mM unlabeled ouabain are added to initiate dissociation of [ 3 H]ouabain. At various times, aliquots of 0.9 ml are removed and rapidly filtered.All aliquots are filtered under vacuum on HAWP Millipore filters (0.45 µ m) and rinsed three times with 4 ml of ice-cold buffer. The radioactivity bound to the filters and the specific binding measurements are determined.

Kinetic parameters for the association and the dissociation process are calculated. The results of equilibrium binding are analyzed by Scatchard plots.

The basic principle of Hatcher's or Knaffl-Lenz's method is suitable to determine decay rates of cardiac glycosides. The decay of efficacy can by due to excretion or metabolic degradation of the glycoside.

Beagle dogs of either sex weighing 8-20 kg are anesthetized with 35 mg/kg pentobarbital sodium i.v. The animal is fixed on its legs on a heated operating table. Tracheostomy is performed and a tracheal cannula inserted. The vena femoralis is cannulated for continuous infusion of a defined concentration (µg/kg/min) of the test compound. ECG is recorded from lead II. The signs of first toxic effects, e. g., extra systoles, AV-block) are recorded. At this time, the infusion is terminated and the total dose/kg of the applied glycoside registered. After 4, 8, 12, or 24 h the infusion procedure is repeated. Within this period of time the glycoside administered with the first dose is only partially metabolized or excreted. Therefore, the dose needed for observation of ECG changes during the second infusion will be lower than in the first experiment.

The dose required in the second experiment for induction of ECG changes is equal to the amount of metabolized or excreted glycoside. This value is expressed as percentage of the amount required in the first experiment and indicates the decay rate of the glycoside. Testing after various time intervals, the decay rate can be visualized graphically and half life times be calculated.

Rhesus monkeys have been used since their response to cardiac glycosides is more similar to that of man than that of dogs .The basic principle of Hatcher's or Knaffl-Lenz's method is also suitable to determine enteral absorption of cardiac glycosides. Again, for this purpose dogs are preferred instead of cats or guinea pigs. The dose to induce cardiac arrest is determined in 3-6 dogs. To other dogs, the same test compound is given intraduodenally at a dose below the intravenous lethal dose. Ninety or 180 min afterwards, the intravenous infusion with the same infusion speed and the same concentration of the test compound as in the previous experiments is started and time until cardiac arrest determined. The higher the duodenal resorption of the compound, the lower the dose of the intravenous infusion will be. For evaluation, the intravenous dose needed in the second experimental series (with enteral predosing) is subtracted from the dose of the first series (without enteral predosing) and indicates the amount of absorbed compound. This value is expressed as percentage of the value of the first series and indicates the absorption rate.The efficacy and safety of a novel Na + ,K + -ATPase inhibitor has been tested in dogs with propranolol-induced heart failure by Maixent et al. (1992) . Hossmann (1982) reviewed the experimental models of cerebral ischemia. Yamamoto et al. (1992) studied the inhibition of NO biosynthesis on the volume of focal ischemic infarction produced by occlusion of the middle cerebral artery in spontaneously hypertensive rats. Shigeno et al. (1985) described a recirculation model following middle cerebral artery occlusion in rats. The trunk of the middle cerebral artery was isolated between the rhinocortical branch and the lenticulostriate artery and encircled with a loose-fitting suture of nylon thread. The thread was exteriorized through a small polyethylene catheter, which was previously introduced into the craniectomy site through a burr hole in the zygoma. The artery was occluded by retraction of the thread, which was then fixed with biological glue. Recirculation was achieved by cutting and removing the thread. Bederson et al. (1986a) occluded the middle cerebral artery at different sites in six groups of normal rats and characterized the anatomical sites that produce uniform cerebral infarction. A neurological system was developed that can be used to evaluate the effects of cerebral ischemia. Bederson et al. (1986b) evaluated the use of 2,3,5triphenyltetrazolium chloride as a histopathological stain for identification and quantification of infarcted brain tissue after middle cerebral artery occlusion in rats. Yang et al. (1992) found a reduction of Na,K-ATPase activity in the ischemic hemisphere shortly after middle cerebral artery occlusion in rats. Du et al. (1996) induced transient focal cerebral ischemia in rats by a 90 min period of ligation of the right middle cerebral artery and both common carotid arteries. Germano et al. (1987) found a decrease of stroke size and deficits in rats with middle cerebral artery occlusion after treatment with kynurenic acid, a broad spectrum antagonist of excitatory amino acid receptors. Wu et al. (1999) reported that propentofylline attenuates microglial reaction in the rat spinal cord induced by middle cerebral artery occlusion. Gotti et al. (1988) found a reduction of the volume of infarcted tissue due to occlusion of the middle cerebral artery in rats and cats after administration of NMDA receptor antagonists. Hossmann and Schuier (1980) studied experimental brain infarcts in cats after occlusion of the left middle cerebral artery.

Retro-orbital occlusion of the middle cerebral artery in cats was performed by Sundt and Waltz (1966) and by Gotti et al. (1988) . Welsh et al. (1987) , Backhauß et al. (1992) described focal cerebral ischemia in mice after permanent occlusion of the middle cerebral artery. Hara et al. (1997) found a reduction of ischemic and excitotoxic neuronal damage by inhibition of interleukin 1β-converting enzyme family proteases after occlusion of the middle cerebral artery in mice and rats. Nylon filaments were introduced from the carotid artery which were withdrawn after 2 h. One day later, the animals were tested for neurological deficits and the brains analyzed for infarct size and interleukin 1β levels. Huang et al. (1994) produced knock-out mice deficient in the neuronal isoform of NO synthase by targeted disruption of the neuronal nitric oxide synthase gene. In these mice, Hara et al. (1996) found reduced brain edema and infarction volume after transient middle coronary artery occlusion. Nishimura et al. (1998) described an experimental model of thromboembolic stroke without craniotomy in cynomolgus monkeys by delivering an autologous blood clot to the middle cerebral artery. A chronic catheter was implanted in the left carotid artery in male cynomolgus monkeys. A 5 cm long piece of an autologous blood clot was flushed into the internal carotid artery with physiological saline. A neurological score was assigned at 0.167, 0.5, 1, 2, 4, 6, and 24 h after embolization. In the acute phase after embolization, typical behavior consisted of circling gait and moderate deviation towards the side of embolization, long-lasting and strong extensor hypotonia of the contralateral lower and upper limbs, and mild to severe incoordination. Contralateral hemiplegia was observed over the following 24 h. At 24 h the animals were sacrificed immediately after the last neurological scoring, and the cerebral vasculature was inspected for the location of the clot. The brain was then cut into 2 mm thick coronal sections. Cerebral infarction size and location were ascertained by the triphenyl-2H-tetrazolium chloride staining method. The lesions involved mostly the caudate nucleus, internal capsule, putamen and thalamus.

The experiments are performed on male Sprague-Dawley rats (260-300 g). Catheters are placed, under light halothane (1%) anesthesia, into the femoral vein and artery of each hind limb (for the measurement of mean arterial pressure, the sampling of arterial blood and the intravenous administration of drugs and radioisotopic tracer). The wound sites are then infused with local anesthetic, sutured, and protected by pads. The lower abdomen is covered by an elastic stocking, followed by a loose-fitting plaster coat. Anesthesia is discontinued and the rats are allowed at least two hours to recover before any further manipulations are performed.

The rats are given an intravenous infusion (50 µl/min) of either saline or the test drug dissolved in saline. This infusion is maintained throughout the measurement of local cerebral blood flow or local cerebral glucose utilization.

A full description of the method for measuring local cerebral glucose utilization using [ 14 C]-2-deoxyglucose has been published . Five minutes after the administration of the test drug, the experiment is started with the intravenous administration of [ 14 C]-2-deoxyglucose (125 µCi/kg). Fourteen timed arterial blood samples are taken during the following forty-five minutes. These samples are centrifuged and the plasma is measured for glucose concentration (using an automated glucose analyzer) and [ 14 C] levels (by liquid scintillation counting). At the end of this period the rats are sacrificed by decapitation, the brain rapidly removed and frozen at -45°C. Twenty micron thick coronal sections are cut in a cryostat (-22°C) and autoradiograms are prepared by placing these sections in an array against Kodak SB-5 Xray film along with pre-calibrated plastic standards range (55-851 nCi/g) for seven days in light-tight cassettes.

The autoradiographic measurement of local cerebral blood flow using [ 14 C]-iodoantipyrine is carried out as described by . [ 14 C]iodoantipyrine (125 µCi/kg) is administered fifteen minutes after the infusion of the test drug has commenced. In a period of sixty seconds, eighteen timed arterial samples are collected in pre-weighed filterpaper discs from a free flowing arterial catheter. The discs are reweighed and the [ 14 C] concentration of each is measured by liquid scintillation counting. At the end of one minute, the rat is decapitated and autoradiograms are prepared in the same manner as for the measurement of local cerebral glucose utilization.

Tissue [ 14 C] concentrations were determined using a densitometer system (Zeiss, FRG) by reference to the images of the precalibrated standards. For each structure of interest, bilateral determination of optical densities are made on six different autoradiographic images in which the structure is best defined.The mean optical density is used to calculate [ 14 C] concentrations. From this value, and the history of [ 14 C] in the blood, values of local cerebral blood flow and glucose utilization are obtained using the respective operational equations of these methods .

Groups of data are statistically compared by t-test with unpaired comparison using the BONFERRONI correction factor for multiple group analyses. Linear regression data for comparing cerebral blood flow (CBF) and glucose utilization (GU) undergo log transformation as recommended by McCulloch et al. (1982) . Ito et al. (1990) measured glucose utilization in the mouse brain by the simultaneous use of [ 14 C]2-deoxyglucose and [ 3 H]3-O-methylglucose.

High-resolution animal positron emission tomography was recommended by Magata et al. (1995) for noninvasive measurement of cerebral blood flow with 15 O-water and glucose metabolic rate with 18 F-2fluoro-2-deoxyglucose.The effect of ginseng pretreatment on cerebral glucose metabolism in ischemic rats using animal positron emission tomography (PET) with [ 18 F]-2 fluoro-2-deoxy-D-glucose ([ 18 F]-FDG) was described by Choi et al. (1997) . Hawkins et al. (1993) developed a method for evaluating tumor glycolytic rates in vivo with nude mice injected with 2-[ 18 F]fluoro-2-deoxy-D-glucose and a dedicated animal positron emission tomography scanner.Positron emission tomography has been used with specific ligands for CNS imaging (de la Sayette 1991; Jones et al. 1991; Kung 1993) .

Male Sprague Dawley rats weighing from 400 to 500 g are anesthetized with ketamine (80 mg/kg, i.m.) and sodium pentobarbital (20 mg/kg, i.p.). During surgical preparation and throughout the experiment, all wounds are infused with a topical anesthetic (lidocaine hydrochloride 2.0%). Catheters are inserted into the femoral vein for drug administration and into the femoral artery for blood pressure/blood gas monitoring. A 2.0 mm hollow female Leur-Loc fitting (to induce trauma) is rigidly fixed with dental cement to the animal's skull in a craniectomy centered over the left parietal cortex 5 mm from lambda, 5 mm from bregma, 4 mm from sagittal suture. The dura is left intact at this opening. Immediately following surgical preparation, a constant i.v. infusion of sodium barbital (15 mg/kg/h) is begun and maintained for the duration of the studies.

Drugs or equal volumes of saline are administered through the femoral vein over 10 min by constant infusion beginning 15 min before trauma.

The fluid-percussion device consists of a Plexiglas cylindrical reservoir, 60 cm long and 4.5 cm in diameter, bounded at one end by a Plexiglas, corkcovered piston mounted on O-rings. The opposite of the reservoir is fitted with a 2-cm-long metal housing on which a transducer is mounted and connected to a 5-mm tube (2 mm inner diameter) that terminates with a male Luer-Loc fitting. At the time of injury the tube is connected with the female Luer-Loc fitting that has been chronically implanted over the exposed dura of the rat. After the entire system is filled with 37°C isotonic saline, injury is induced by a metal pendulum which strikes the piston of the device from a predetermined height. The device produces a pulse of increased intracranial pressure of fairly constant duration (21-23 ms) by injecting various volumes of saline into the closed cranial cavity. Brief displacement and deformation of neural tissue results from the rapid epidural injection of saline. The magnitude of injury is regulated by varying the height of the pendulum, which results in corresponding variations of the intracranial pressure expressed in atmospheres. The pressure pulses are measured extracranially by a transducer and recorded on a storage oscilloscope.

Posttraumatic deficits are evaluated at 24 h, 1 week and 2 weeks following trauma. Outcomes include forelimb flexion (right and left), lateral pulsion (right and left) and angle score (left, right and vertical position). Scores range from 0 (maximal deficits) to 5 (normal) for each task, By combining scores of all tests, a composite neuroscore is determined, ranging from 0 to 35 (Faden 1993) .

At 2 weeks, following final neurological scoring, the rats are sacrificed by decapitation. The brain is removed, quickly frozen in isopentane and stored in a -80°C freezer until sectioning. Coronal brain sections are selected to span the longitudinal axis of the dorsal hippocampus between -3.2 and -3.8 Bregma. Sections (16 mm thick) are cut at -18°C in a microtome-cryostat and thaw-mounted onto chrome-gelatin rubbed microscope glass slides and kept at -80°C for histological study.Sections are stained with Crystal violet. CA1 and CA3 pyramidal cells with a distinct nucleus and nucleolus are counted as viable neurons, in one reticle within CA3 and in three reticles (R1, R2 and R3) within the subfield of the hippocampus, in both right and left hemispheres. The number of viable neurons is counted twice at 400 × microscope field.An immunochemical method is used to detect glial fibrillary acidic protein (GFAP)-positive astrocytes in the hippocampus (Faddis and Vijayan 1988) . Counting of the number of cells is done under 400 × light microscopy in the dorsal CA1 subfield between medial and lateral regions.

Neuroscores from forelimb flexion tests, lateral pulsion tests and angle board tests are statistically analyzed by non-parametric Mann-Whitney U-tests. Histological data are analyzed by one way ANOVA test, followed by Scheffe's test. Shohami et al. (1995) tested the effect of a non-psychotropic cannabinoid which acts as a non-competitive NMDA antagonist on motor and memory functions after closed head injury in the rat. Fox et al. (1998) developed a mouse model of traumatic brain injury using a device that produces controlled cortical impact, permitting independent manipulation of tissue deformation and impact velocity and

Over the past several years, magnetic resonance imaging (MRI) has become an established tool in the drug discovery and development process. The main advantages of MRI are its high resolution, non-invasiveness and versatility, which allow comprehensive characterization of a disease state and the effects of drug intervention. Recent advances now allow the application of this technique to the characterization of models of lung inflammation in rats and to the profiling of anti-inflammatory drugs. Repeated measurements can be carried out on the same animal, and time-courses of events can be easily assessed. Furthermore, the prospect of using MRI to detect non-invasively a sustained mucus hypersecretory phenotype induced by endotoxin brings an important new perspective to models of chronic obstructive pulmonary disease in animals. Importantly, it might be possible to extend the use of this technique to the clinical study of inflammation in the lung and the consequences of drug treatment (Beckmann et al. 2003 (Beckmann et al. , 2004 .Functional magnetic resonance imaging has been developed as pharmacological magnetic resonance imaging for pharmacodynamic assays and to establish brain-penetrating parameters (Leslie and James 2000) . Although the regional cerebral metabolic rate of glucose is strongly increased during cerebral activity, the cerebral metabolic rate of O 2 is not increased in direct proportion. The result is that the relative uptake of O 2 from blood actually decreases. The veins and capillaries draining from the activated region are "arterialized" and their deoxyhemoglobin concentration is reduced. Deoxygenated and oxygenated hemoglobin have different magnetization properties; thus the changes in the ratio of these two entities can be detected by bloodoxygen-level-dependent (BOLD) magnetic resonance imaging. At least for studies in animals, these methods may be preferred to positron emission tomography (Cherry and Phelps 1996) . Petty et al. (2003) studied the in vivo neuroprotective effects of a systemically active antagonist of the NMDA receptor glycine site by magnetic resonance imaging in ischemic stroke in rats.

In the right common carotid artery was ligated. The transient model of middle cerebral artery occlusion was based on techniques described by Zea Longa et al. (1989) and Belayev et al. (1996) . By means of an operating microscope, the right common carotid artery was exposed through a midline neck incision. The right superior thyroid, occipital, and pterygopalatine arteries were ligated and cut. A poly-L-lysine-coated 3-0 nylon monofilament with a heat-blunted tip was inserted through the proximal external carotid artery into the internal carotid artery and pushed forward a distance of 19 or 20 mm from the carotid bifurcation, depending on the weight of the rat, so as to occlude the origin of the middle cerebral artery. After suture placement, the neck incision was closed and the animal was allowed to regain consciousness. Two hours following occlusion of the artery, the rats were tested on a standard neurological battery to confirm the presence of a neurological deficit. Animals that did not exhibit a forelimb flexion were excluded from further study. At this time, the rats were re-anesthetised and the intraluminal suture was completely withdrawn to restore the blood supply.

Measurements were performed 30 min, 3 h, and 24 h after the onset of ischemia on a 7-T Bruker BIOSPEC experimental scanner (DBX; Bruker Medical, Ettlingen, Germany) with a 30-cm bore magnet and actively shielded gradient coils (200 mT/m; rise time < 80 µs).A 72-mm resonator was used for rf transmission; signals were detected with a 35-mm inductively coupled surface coil placed over the skull of the animal. The rf coils were decoupled from each other -the transmitter coil actively and the receiver coil passively.Using gradient-echo imaging, sagittal pilot scans were performed to ensure accurate positioning of the animal in the magnet. For this purpose, the coronal plane 5.9 mm posterior to the rhinal fissure was placed in the isocenter of the magnet, thus focusing on the center of the ischemic territory resulting from the middle cerebral artery occlusion.For the determination of the temporal evolution of the ischemic lesion, two NMR imaging modalities were used. A field of view of 3.2 cm, a slice thickness of 1.5 mm, and an interslice distance of 2 mm were used for both sequences. Multislice packages were recorded by placing the center of the multislice imaging packet 5.9 mm posterior to the rhinal fissure.Diffusion-weighted imaging was performed using a Stejskal-Tanner spin-echo sequence [echo time (TE) = 37.2 ms, repetition time (TR) = 2325 ms, eight slices] in six rats per group. To enable quantification of the apparent diffusion coefficient (ADC) of brain water, three b values were used (b = 50, 825,

Edema following middle cerebral artery occlusion in spontaneously hypertensive rats was measured by magnetic resonance imaging (Seega and Elger 1993; Elger et al. 1994a ). Magnetic resonance imaging was also used to determine the size of intracerebral hemorrhage in rats induced by stereotactic microinfusion of collagenase into the caudate putamen (Elger et al. 1994b ). Reese et al. (2000) visualized regional brain activation by bicucculine by functional magnetic resonance imaging. Time-resolved assessment of bicucculine-induced changes in local cerebral blood volume was achieved using magnetite nanoparticles as an intravascular contrast agent. Pevsner et al. (2001) described a photothrombotic method of acute small stroke induction in rats with histopathologic and in vivo magnetic resonance imaging (MRI) observations from 3 to 6 h after irradiation, which is homologous to a human autopsy specimen. Utilizing 30 min of irradiation with minimal beam intensity (0.1 W/cm 2 ) cold white light in conjunction with 20 mg of intravenous (i.v.) rose bengal as a rapid infusion, small infarcts were induced photochemically in the frontal lobes of rats.Using in vivo and ex vivo magnetic resonance imaging, Ohlstein et al. (2000) evaluated the effects of tranilast, an antiallergic drug, on neointima formation following balloon angioplasty of the rat coronary artery. Swain et al. (2003) employed T-two-star (T 2 *)weighted and flow-alternating inversion recovery (FAIR) functional magnetic resonance imaging to assess chronic changes in blood volume and flow as a result of exercise in rats. Prolonged exercise induced angiogenesis and increased cerebral blood flow in primary motor cortex.Using MRI evaluation of brain damage, Banfi et al. (2004) demonstrated that pentoxifylline prevents spontaneous brain ischemia in stroke-prone rats. Henderson et al. (2004) studied functional magnetic resonance imaging during hypotension in young and adult cats.In a magnetic resonance imaging study Shirhan et al. (2004) found that spermine reduces infarction and neurological deficit a rat model of middle cerebral artery occlusion. Paczynski et al. (2000) studied the effects of fluid management on edema volume and midline shift in a rat model of ischemic stroke. MRI were obtained 24 h after the onset of ischemia so that the ratio of hemispheric volumes ipsilateral and contralateral to the infarct and the extent of midline shift could be obtained. Cash et al. (2001) evaluated the effectiveness of aminoguanidine as a neuroprotective agent in a rat model of transient middle cerebral artery occlusion using serial magnetic resonance imaging.The MRI protocol consisted of three interleaved imaging regimens: proton density-weighted imaging (PDWI), T 2 -weighted imaging (T 2 WI) and diffusionweighted imaging (DWI). Repetition time (TR) was 3 s for each of the three regimens and echo times (TE) PROCEDURE Male Wistar rats weighing between 250 and 300 g are pre-treated with heparin (1000 units/kg i.v.) and anesthetized with pentobarbital sodium (50 mg/kg i.p.) The animals are intubated with a tracheal tube and positive pressure ventilation is maintained with a Harvard Rodent Respirator at 4-6 ml/stroke and 50 strokes/min. The right jugular vein is cannulated with polyethylene tubing for administration of drugs.The lumbar sympathetic chain is isolated dorsal to the inferior mesenteric branches via an abdominal midline incision. The aorta is freed from the vena cava and two silk ligatures are placed around the aorta. The aorta is ligated and cannulated proximal as well as distally with polyethylene tubings. A short piece of rubber tubing is inserted at the distal end to allow intraarterial injections of drugs. Two "T" junctions allow the measurement of arterial pressure and perfusion pressure by Statham P 23 Db pressure transducers being recorded through a Hellige physiological recorder. From the proximal part of the aorta, blood is forced to its distal part by a peristaltic pump (Desaga) through a glass coil kept at 40°C. Flow rate is adjusted to produce a stable perfusion pressure as close to the systemic pressure as possible. After initial adjustment, flow rate is not altered for the remainder of the experiment.Following perfusion pressure stabilization, the sympathetic chain is isolated and a small (1 mm wide, 2 mm long) curved bipolar electrode is placed around the nerve for electrical stimulation. Square-wave pulses from a Grass stimulator are used to activate the nerve with a constant current of 2.5 milliamps, supramaximal voltage and varying frequencies of 5 ms duration.A dose-response curve is established for norepinephrine by giving doses of 0.01 µg, 0.03 µg, 0.1 µg, 0.3 µg, 1.0 µg, and 3.0 µg intra-arterially and measuring perfusion pressure changes. Similarly, a frequencyresponse curve to nerve stimulation is established by stimulation at 3 Hz, 6 Hz, and 10 Hz for 30 s. Two predrug readings are taken to insure consistent responses.A minimum of four animals is used for each test compound.

The first predrug dose-response curves are compared with the second predrug, 5 min and 60 min postdrug dose-response curves. From regression equations for norepinephrine and nerve stimulation, mean responses and potency values with 95% confidence limits are calculated. Folkow et al. (1970) perfused the hindquarters of spontaneously hypertensive rats and control rats at a constant rate of flow with an oxygenated plasma substitute in order to study the increased flow resistance and vascular reactivity. The hindquarters were isolated from the upper part of the body by standardized mass ligatures at identical levels until the aorta and the inferior caval vein provided the only intact circulatory connections between the two parts of each animal. Thimm et al. (1984) described reflex increases in heart-rate induced by perfusing the hind leg of the rat with solutions containing lactic acid. Thimm and Baum (1987) obtained spike recordings from chemosensitive nerve fibres of group III and IV of the rat nervus peroneus. Applications were performed either by perfusion of the circulatory isolated hindleg or by superfusion of the isolated musculus extensor digitorum longus. Kitzen et al. (1978) used the perfused hind limb of the dog with sympathetic nerve stimulation for cardiovascular analysis. Reitan et al. (1991) developed a near anesthetic-free isolated hindlimb model in the dog and studied the effects of halothane and atropine sulfate on vascular resistance. Wiegershausen and Deptalla (1969) used the isolated perfused hindlimb of the cat to study the influence of local anesthetics on the vasoconstrictor actions induced by bradykinin, epinephrine and histamine. Santiago et al. (1994) analyzed the responses to bradykinin in the hindquarters vascular bed of the cat. analyzed the responses of human synthetic adrenomedullin, an analog of adrenomedullin and calcitonin gene-related peptides in the hindlimb vascular bed of the cat.

Reactivity in the mesenteric vascular bed can be tested in an isolated preparation (McGregor 1965; Kawasaki and Takasaki 1984; Laher and Triggle 1984; McAdams 1984; Foy and Nuhu 1985; Longhurst and Head 1985; Soma et al. 1985; Hsueh et al. 1986; Longhurst et al. 1986; Manzini and Perretti 1988; Nassar et al. 1988; Randall and Hiley 1988) . The abdomen of anesthetized rats is opened and the superior mesenteric artery is separated from surrounding tissue in the region of the aorta. A cannula is inserted into the superior mesenteric artery at its origin from the abdominal aorta. The cannula is filled with heparinized Krebs solution. The ileocoeliac branch of the artery is tied off and the intestine separated from the mesentery by cutting close to the intestinal border of the mesentery. The cannulated artery and its vascular bed are dissected out and mounted in an organ bath. The preparation is perfused with oxygenated Krebs-bicarbonate buffer (pH 7.4) at 37°C. Perfusion pressure is recorded via a side arm of the arterial cannula using a Statham pressure transducer. The flow rate is adjusted to give a baseline perfusion pressure of 20-30 mm Hg. The test substances are infused into another side arm of the arterial cannula for 15 s using an infusion pump. After three stimuli with norepinephrine (1 µg) or potassium chloride (1 mg), the test drugs are infused followed by further stimulation. The inhibition of increase of perfusion pressure after test drugs is expressed as percentage of control. Nuki et al. (1994) compared the vasodilating activity of chicken calcitonin gene-related peptide with human α-CGRP and rat CGRP in the precontracted mesenteric vascular bed of rats.The rabbit isolated arterially perfused intestinal segment preparation was used by Brown et al. (1983) as a model for vascular dopamine receptors. Komidori et al. (1992) recommended the isolated rat mesenteric vascular-intestinal loop preparation as an excellent model fort demonstrating resistance changes in isolated vascular beds while simultaneously measuring endogenous catecholamine overflow. Pelissier et al. (1992) showed that perfusion with hypotonic solutions removed the endothelial layer in the isolated perfused mesenteric vascular bed of the rat, allowing the study of endothelial-dependent vascular responses. Santiago et al. (1993) used the mesenteric vascular bed of the cat to study the inhibitory effects of the bradykinin receptor antagonist Hoe 140 on vascular responses to bradykinin.The responses of adrenomedullin and adrenomedullin analogs in the mesenteric vascular bed of the cat were compared by Santiago et al. (1995) . Chu and Beilin (1994) studied the mesenteric vascular reactivity which is reduced in pregnant rats after application of bradykinin and the bradykinin receptor antagonist Hoe 140. Mulavi and Halpern (1977) , Qiu et al. (1995) studied the mechanical and contractile properties of in situ localized mesenteric arteries in normotensive and spontaneously hypertensive rats.after various doses of bradykinin, are established. The effects of antagonists, e. g. HOE 140, can be studied. Liu et al. (1992) used a blood-perfused rat lung preparation to study pulmonary vasoconstriction or endothelium-dependent relaxation. Byron et al. (1986) studied the deposition and airway-to-perfusate transfer of disodium fluorescein from 3-4 µm solid aerosols in an isolated perfused lung preparation of rats. Mor et al. (1990) determined angiotensin-converting enzyme activity in the isolated perfused guinea pig lung. Franks et al. (1990) used in Beagle dogs a single breath technique employing freon-22 as the soluble marker gas simultaneously with measurement of aortic blood flow by an electromagnetic flowmeter. Tanaka et al. (1992) measured lung water content in dogs with acute pulmonary hypertension induced by injection of glass beads. Drake et al. (1978) studied filtration characteristics of the exchange vessels in isolated dog lung by calculating the volume conductance with use of different components of the weight-gain curve following changes in capillary pressure. Heaton et al. (1995) studied the effects of human adrenomedullin on the pulmonary vascular bed of isolated, blood perfused rat lung. DeWitt et al. (1994) , Lippton et al. (1994) investigated the effects of adrenomedullin in the pulmonary and systemic vascular bed of the cat. Nossaman et al. (1995) compared the effects of adrenomedullin, an adrenomedullin analog, and CGRP in the pulmonary vascular bed of the cat and the rat.

The procedure was described as early as 1914 by Pissemski, based on experiments of Krawkow (1913) in fish gills. It can be used to elucidate vasoactive properties (both vasoconstrictive and vasodilating) of PROCEDURE A rabbit of either sex weighing 1.5-3 kg is sacrificed by CO 2 narcosis and its ears are severed immediately. The ear is placed on a glass disc, the posterior auricular artery is exposed and cannulated. The cannula is connected to a tubing with a T-branch allowing the infusion of different solutions. Ringer's solution, kept at room temperature, is infused under 40 cm water column pressure via the cannula. The perfusion flow volume is recorded using a time ordinate recorder and a CONDON tipper or a photoelectric drop counter.Prior to drug administration, the pH of the Ringer solution (containing test compound) must be determined. If the pH is greater than 8.5 or smaller than 6.5, it should be adjusted by adding a diluted NaOH-or HCl-solution.

Norfenephrine is infused at a concentration of 0.5 µg/ ml until the maximal contraction is reached. The test compound is prepared in Ringer's solution at a concentration of 100 µg/ml. A volume of 30 ml is infused via the cannula over a 15 min period under constant pressure. The change of perfusion rate is determined. If there is a positive response (increase in perfusion rate), the test may be repeated using lower concentrations. If there is a negative response (further decrease in perfusion rate), the compound can be tested for vasoconstrictive activity.

This test is repeated as described above without administration of norfenephrine.Standard compounds:• as vasodilator -dihydralazine -theophylline -pentoxyfylline 100 µg/ml • as vasoconstrictor -norfenephrine (Novadral)

The perfusion rate of the ear vessel is determined during the course of the test: R = perfusion rate of vehicle perfused vessel RN = perfusion rate of norfenephrine constricted vessel RNP = perfusion rate of norfenephrine constricted vessel following compound administrationThe percent inhibition of norfenephrine induced decrease in perfusion pressure is calculated using the following formula:

The normal perfusion rate (ear vessel perfused with Ringer's solution) is taken as 100%. The percent inhibition of perfusion rate following compound administration is determined. Schlossmann (1927) used the isolated rabbit ear preparation according to Pissemski for determination of the adrenaline content in blood.

De la Lande and Rand (1965), de la Lande et al. (1967) described a method of perfusing the isolated central artery of the rabbit ear. Small segments of the artery, taken from the base of the ear, were perfused at a constant rate with Krebs solution at 37°C. To enable drugs to be applied either to the intima or the adventitia, the artery was double cannulated so that the intraluminal and extraluminal perfusion media did not mix. Constrictor responses were measured by the maximum rise in perfusion pressure. Steinsland et al. (1973) studied the inhibition of adrenergic transmission by parasympathicomimetics in the isolated central ear artery of the rabbit. Perfusion was performed at a constant flow rate with Krebs' solution and perfusion pressure was recorded with a transducer. Allen et al. (1973) incubated isolated segments of rabbit ear artery with ( 3 H)-(-)-noradrenaline and measured the amount of tritium released into the luminal perfusate and into the extraluminal superfusate. Budai et al. (1990) used isolated proximal 3-4-cm segments of the rabbit ear artery or rat tail artery in a low volume perfusion-superfusion system for measurement of transmitter release from blood vessels in vitro.

Abdominal aortic aneurysms represent a life-threatening condition characterized by chronic inflammation, destructive remodeling of the extracellular matrix and segmental dilatation of the aortic wall (Dobrin 1989; Ernst 1993) . Several authors described animal models of aneurysms (Carrell et al. 1999; Dobrin 1999; Daugherty and Cassis 2004) . Most studies were performed in mice. Abdominal aortic aneurysms are evoked by genetically defined defects in extracellular matrix maturation, increased degradation of elastin and collagen, aberrant cholesterol homeostasis, or enhanced production of angiotensin peptides.The Blotchy mouse has an X-linked trait that leads to aortic aneurysms and subsequent fatal rupture in nearly all affected male mice (Brophy et al. 1988; Reilly et al. 1990 ). Maki et al. (2002) showed that inactivation of the lysyl oxidase gene Lox leads to aortic aneurysms, cardiovascular dysfunction, and perinatal death in mice.Aneurysm development has been noted in a number of mice with deficiencies in the components of the matrix metalloproteinase system (Silence et al. 2001 (Silence et al. , 2002 .The use of mice in atherosclerosis research was escalated by the development of mice that are deficient in either apoE or LDL receptors susceptible to aneurysm development (Ishibashi et al. 1994; Prescott et al. 1999) .Accelerated atherosclerosis, aortic aneurysms formation, and ischemic heart disease were found in apolipoprotein E and endothelial nitric oxide synthase double-knockout mice (Kuhlencordt et al. 2001) . ACE inhibition reduces some symptoms of vascular pathology in apoE and eNOS compound-deficient mice . Mice with deficiency of the LDL receptor-related protein (LRP) showed pathological changes in the aortic arch and abdominal aorta with substantial lengthening, dilatation, thickening and large aneurysms (Herz and Strickland 2001; Boucher et al. 2003) .Salt-sensitive aortic aneurysms and rupture in hypertensive transgenic mice that overproduce angiotensin II were described by Nishijo et al. (1998) .The infusion of elastase into the infrarenal segment has been used as model for abdominal aorta aneurysms in rats (Anidjar et al. 1990 ) and mice (Pyo et al. 2000) . Lee et al. (2001) described abdominal aortic aneu rysms in mice lacking expression of inducible nitric oxide synthase.Periarterial application of calcium chloride was used to induce aneurysms of the rabbit common carotid artery (Gertz et al. 1988 ) and in the rabbit aorta (Freestone et al. 1997) .This technique has been used in mice by Chiou et al. (2001) and Longo et al. (2002) . Nomoto et al. (2003) described the effects of two inhibitors of renin-angiotensin system on attenuation of postoperative remodeling after left ventricular aneurysm repair in rats.

Angiotensin II promotes atherosclerotic lesions and aneurysms in apolipoprotein E-deficient mice (Daugherty et al. 2000 (Daugherty et al. , 2001 Wang et al. 2001; Manning et al. 2002 Manning et al. , 2003 Deng et al. 2003; Martin-McNulty et al. 2003; Saraff et al. 2003) . Wang et al. (2005) reported that a Rho-kinase inhibitor attenuated angiotensin II-induced abdominal aortic aneurysm in apolipoprotein E-deficient mice by inhibiting apoptosis and proteolysis.

Osmotic minipumps (model 2004, Alzet) containing either PBS or Ang II (1.44 mg/kg per day) in PBS were implanted subcutaneously in 6-month-old apoE-KO male mice (Jackson Laboratories) . Two days before saline and Ang II infusion, mice were provided with water (Ang IIgroup) or water containing test compound at a concentration of 0.5 mg/ml (low-dose group) or 1.0 mg/ml (high-dose group). Age-matched apoE-KO mice without any treatment were used as naïve controls. At the end of the 30-day treatment period, mice were euthanized, and the hearts were perfused with DEPC in saline. The arterial tree was rapidly dissected from fat and connective tissue and snap-frozen in liquid nitrogen.

After the aorta was dissected free from the surrounding connective tissue, images were recorded with a digital camera and later used to measure the outer diameter of the suprarenal aorta at the midpoint between the diaphragm and right renal artery. A commonly used is an increase in aortic diameter of ≈50% (Johnston et al. 1991) . The average diameter of the normal suprarenal aorta in naïve control mice is 0.8 mm. A threshold of 1.22 mm was set as evidence of an incidence of aneurysm formation. Aneurysm severity was assessed with a scoring system described by Daugherty et al. (2001) : type 0, no aneurysm (the suprarenal region of the aorta was not obviously different from naïve apoE-KO mice without Ang II treatment); type I, a dilated lumen with no thrombus; type II, remodeled tissue often containing thrombus; type III, a pronounced bulbous form of type II containing thrombus; and type IV, multiple aneurysms containing thrombus. To analyze this measurement semiquantitatively, the numerical score assigned to the type of aneurysm for each animal in a group was averaged to generate a pathology score for statistical comparison.

The left and right carotid arteries and the aortic arch were dissected, excised, opened longitudinally, and pinned down on wax-coated Petri dishes. Atherosclerotic lesions were visible without staining. Images of the open luminal surface of the vessels were captured with a digital camera (Sony) mounted on a dissecting microscope. The atherosclerotic lesion area was quantified by use of the C-Simple system (Compix) and expressed as a percentage of the total luminal surface area (Wang et al. 2000 (Wang et al. , 2001 Martin-McNulty et al. 2003) .

Two representative suprarenal aortas from each group were fixed in formalin, embedded in paraffin, and cut into 5-µm-thick sections. The adjacent sections were stained with hematoxylin and eosin or by the immunohistochemical method. To identify macrophages in the aortic wall, a purified rat anti-mouse Mac-3 monoclonal antibody (BD Pharmingen) was used for immunochemistry staining (PhenoPath Laboratories). To localize cells undergoing nuclear DNA fragmentation, in situ terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) was performed using an in situ apoptosis detection kit (Roche Biochemicals) (Song et al. 2000; Feng et al. 2002) . Paraffin sections were deparaffinized and rehydrated. Sections were then washed with PBS and incubated with proteinase K (20 µg/ml) for 20 min. Endogenous peroxidase was inactivated with 3% hydrogen peroxide in methanol at room temperature. TdT, which catalyzes a template-independent addition of deoxyribonucleotide to 3-OH ends of DNA, was used to incorporate digoxigenin-conjugated dUTP to the ends of DNA fragment in situ. The TUNEL signal was then detected with an anti-digoxigenin antibody conjugated with peroxidase and developed with diaminobenzidine as a chromogen. Sections were counterstained with hematoxylin, dehydrated, and cleared before coverslips were placed. Both positive and negative control slides were processed at the same time in each experiment. The presence of apoptotic cells was scored as nuclear staining, with a distinctive morphological appearance associated with cell shrinkage and chromatin condensation.

Results are presented as mean ± SE for the number of animals used. Statistical comparison for the incidence of abdominal aortic aneurysms was performed by χ 2 analysis. Multiple comparison of mean values was performed by ANOVA, followed by a subsequent Student-Newman-Keuls test for repeated measures. Differences were considered statistically significant at a value of P < 0.05.

Regulation of new blood vessel formation, angiogenesis, is precisely programmed throughout the lifetime of vertebrates. Besides the role of angiogenesis in normal function, it is an essential component of disease processes, including tumor growth, rheumatoid arthritis, psoriasis, and diabetic retinopathy (Folkman and Klagsbrun 1987; Klagsbrun and D'Amore 1991; Folkman and Shing 1992) . Multiple factors that stimulate angiogenesis either directly or indirectly have been described, including the fibroblast growth factor family (Esch et al. 1985) , vascular endothelial growth factor (Leung et al. 1990; Thomas 1996; Ferrara and Davis-Smyth 1997) , epidermal growth factor (Gospadarowicz et al. 1979) , transforming growth factor-α and -β (Schreiber et a 1986; Yang and Moses 1990) , tumor necrosis factor-α (Leibovich et al. 1987) , angiogenin (Fett et al. 1985) , CYR61, a product of a growth factorinducible immediate early gene ect.The pharmacological inhibition of angiogenesis is of considerable interest in the development of new therapeutic modalities for the treatment of diseases such as diabetic retinopathy, atherosclerosis, hemangiomas, rheumatoid arthritis and cancer, in which pathological angiogenesis occurs (Ezekowitz et al. 1992; Folkman and Shing 1992; Fan and Brem 1992; O'Brien et al. 1994) . Several natural inhibitors of angiogenesis were described, such as thrombospondin (Good et al. 1990 ), somatostatin , angiostatin, isolated from a subclone of Lewis lung carcinoma, (O'Reilly et al. 1994 (O'Reilly et al. , 1996 , endostatin, a 20 kDa angiogenesis inhibitor from a murine hemangioendothelioma which is a C-terminal fragment of collagen XVIII (O' Reilly et al. 1997; Dhanabal et al. 1999) , vasostatin .Angiogenesis was studied ex vivo by culturing rat or mouse aortic rings in collagen gel (Zhu et al. 2003) . Unlike rat aorta explants, unstimulated mouse aortic rings were unable to spontaneously produce an angiogenic response under serum-free conditions. They, however, responded to basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF), generating networks of branching neovessels. Couffinhal et al. (1998) published a mouse model of angiogenesis. The femoral artery of one hind-limb was ligated and excised. Laser Doppler perfusion imaging was employed to document the consequent reduction in hind-limb blood-flow, which typically persisted for up to 7 days. Neovascularization was shown to develop in association with augmented expression of VEGF mRNA and protein from skeletal myocytes as well as endothelial cells from the ischemic hind-limb.

Human umbilical vein endothelial cells (HUVEC) were used by various authors to study endothelial cell proliferation (Bussolino et al. 1992; Hu 1998; Iurlaro et al. 1998; ).

The HUV-EC-C human endothelial cells (American Type Culture Collection, Rockville, MD) are cultured at 37°C and 5% CO 2 in 90% Ham's F12K, 10% fetal bovine serum, 30 µg/ml endothelial cell growth factor, 100 µg/ml heparin, and 4 mM L-glutamine. The effect of test compound on HUV-EC-C cell proliferation is evaluated on 3 × 10 3 cells/well in 24-well plates. After 24 h, the test compound in various concentrations of the vehicle are added, and plates are incubated for 72 h. Cells are then harvested with trypsin/EDTA and counted by an hemocytometer.

Results are expressed as number of cells in vehicle and compound-treated cultures and are the mean of three separate experiments ± SE.

In addition to human umbilical veil endothelial cells, used fetal bovine heart endothelial cells and measured DNA synthesis by [ 3 H]thymidine deoxyribose uptake. Oikawa et al. (1991) used vascular cells from bovine carotid arteries and tested cell proliferation in a collagen gel and cell migration in a Boyden chamber.Bovine capillary endothelial cells were used by Folkman et al. (1979) , , O 'Reilly et al. (1997) , .

Neovascularization of the rabbit cornea has been used by several authors to study inhibition of angiogenesis (Gimbrone et al. 1974; BenEzra et al. 1987 BenEzra et al. , 1997 Joussen et al. 1999 ).

New Zealand White rabbits are anesthetized for surgery and quantification of newly developed blood vessels with 5 mg/kg xylazine hydrochloride and 35 mg/kg ketamine hydrochloride i.m. Corneal blood vessels are induced by basic fibroblast growth factor which is applied in carrier pellets. These pellets are produced by dispersing 50 µl of 2% methylcellulose containing 500 ng human recombinant basic fibroblast growth factor diluted in 10 µl phosphate-buffered saline in plastic rods with a diameter of 4 mm. Dried pellets are folded twice and implanted intrastromally in the 12 o'clock position into a corneal tunnel. This tunnel is created by a central cut of approximately 50% depth and extended into the peripheral cornea to a point 2.0 mm away from the limbus. Following implantation, the central entrance of the tunnel is closed with a single 10-0 nylon suture in order to ensure that the tear film does not dissolve the pellet and uncontrolled liberation of the growth factor is prevented.The test substance is dissolved in a viscous gel containing 0.002% polyacrylic acid, 0.04% sorbitol, and 0.001% cetrimide in a watery base. The eyes are treated once daily with 0.1 ml of this gel which is applied in the lower conjunctiva sac. The eyes are closed for several seconds to avoid loss of the substance. Each animal's contralateral eye receives gel without test substance and serves as control. Control animals receive the viscous gel without test substance.Animals are observed daily under an operating microscope, and vascular growth is documented on days 6, 9, 12, and 16 after surgery. The number of blood vessels, their length and the dimension of the vascularized area are quantified with a caliper under the operating microscope as well as on standardized photographs. On every observation day corneas are stained with fluorescein in order to show epithelial irregularities due to the topical treatment.

Differences between treated eyes and controls are tested for significance using unpaired Student's t-test. Damms et al. (1997) characterized the neovascularization that follows the intracorneal injection of bovine albumin in rabbits as a model of angiogenesis. New Zealand white rabbits received intracorneal injections of phosphate buffered saline with and without various amounts of bovine albumin. The rabbits were co-sensitized or pre-sensitized by intramuscular bovine albumin. The corneal response was quantified by ranking photographs taken periodically after the injection. Babic et al. (1998) tested an angiogenesis promotor in the corneal pocket angiogenesis assay in rats. studied inhibitors of angiogenesis in the corneal angiogenesis assay in rats. A 1.5 mm incision was made approximately 1 mm from the center of the cornea in anesthetized Sprague Dawley rats. Using a curved spatula, the incision was bluntly dissected through the stroma toward the outer canthus of the eye. A hydron pellet (2 × 20 mm) containing 200 ng vascular endothelial growth factor and 100 ng sucralfrate was inserted into the base of the pocket. Foschi et al. (1994) , , studied neovascularization of rat cornea induced by chemical injury. Both eyes of ether-anesthetized rats were cauterized by applying a AgNO 3 / KNO 3 (1:1, w/w) applicator to the surface of the cornea eccentrically at a point approximately 2 mm from the corneoscleral limbus. Rats were treated 4 times daily for 6 days with eye drops. The eyes were examined by slit-lamp microscopy daily for 6 days to the evaluate the growth of the vessels. On the 6th day after cauterization, the rats were anesthetized and the upper body perfused through a cannula inserted in the ascending aorta with Ringer's solution until the normal pink color of the fundi disappeared and then with a mixture of 10% India ink/6% gelatin in Ringer's solution. The eyes were enucleated and placed in 4% formaldehyde. The cornea and a 1 mm rim of adjacent scleral tissue were dissected from the rest of the globe and three full thickness peripheral radial cuts were made to allow flattening of the cornea. The corneas were then placed on a glass slide in mounting media, magnified, and photographed. The area occupied by blood vessels was calculated and the area vascularization of drug treated animals was compared to that of control rats. Kenyon et al. (1996) , performed the corneal micropocket assay in mice.

Vascular endothelial growth factor (VEGF) has achieved considerable therapeutic interest (Clauss 1998; Enholm et al. 1998; Ferrara et al. 2004) . Weich et al. (2004) described an ELISA for quantification of vascular endothelial growth factor-C.

The fully processed rat protein dNdC-VEGF-C and dNdC-VEGF-D were produced in insect cells and purified from supernatants (Kirkin et al. 2001) . Human dNdC-VEGF-C and soluble VEGFR-3 production was achieved according to (Joukov et al. 1997; Hornig et al. 1999) . A polyclonal antibody against rat VEGF-C was developed in rabbits (antibody 4080; BioGenes Berlin). A total amount of 1.2 mg rat VEGF-C (containing a C-terminal 6His-tag) was used for immunization of two New Zealand white rabbits. After immunization with 0.1 mg protein, each rabbit was boosted on days 7, 14, 28, 56 and 84 with the same amount. The dilution of the serum for half-maximal titer was 1:10,000. Total IgG from rabbit serum was isolated using HiTrap Protein A Sepharose columns (Amersham Bioscience, Freiburg).

Experiments were conducted using three human (PC-3 cells, 293 cells, COLO 800 cells) and four rat (10AS, ARIP, BRL3A, MT-450) tumour cell lines and 1640 medium (Gibco-BRL, Bethesda, Md., USA). Stable transfected clones were selected and tested for VEGF-

Ascites fluid from athymic mice previously inoculated with OVCAR-3 cells was used. Cells from the SKOV-3 human cystadenocarcinoma cell line were grown in McCoy's 5a medium with 1.5 mM L-glutamine, penicillin, and streptomycin, supplemented with 10% FCS. Cells were grown to confluence and harvested by trypsinization with 0.25 mg/ml trypsin/EDTA and suspended in PBS before inoculation into mice.

Athymic Balb c nu/nu mice were housed under pathogen-free conditions and fed autoclaved pellets and water.

The pLZR Phoenix vector was modified by the addition of a MCS followed by an internal ribosome entry sequence-GFP cassette (Rommel et al. 1999 ). Thus, genes subcloned into the MCS produce bicistronic constructs under the control of the viral 5 long terminal repeat. The entire coding sequence of mVEGF 164 was inserted into the MCS for the construct used to transduce cells with VEGF, whereas the MCS was left empty for the GFP-only vector. Constructs were transfected into Amphotrophic packaging lines to produced infective virus using standard techniques (Grignani et al. 1998 ).

SKOV-3 cell lines were infected with Amphotrophic viruses encoding either mVEGF 164 and GFP or GFP only. Cells that were successfully transduced with the retroviruses were collected by FACS using a Cytomation MoFlo (Fort Collins, Colo., USA) with fluorescence emission from GFP measured with a 530/540 nm bandpass filter. More than 50% of the cells were GFP positive after infection, allowing > 4.0 × 10 5 cells to be collected and used to establish cell lines. To verify viral transduction, cells were resorted several days later and found to be > 80% positive for GFP expression. Cells were then expanded, aliquoted, and frozen. All experiments were performed with an aliquot expanded by four to five passages and tested for viability before injection.

Adenoviral constructs were achieved according to Thurston et al. (2000) . Adenoviral plaque-forming units (5.0 × 10 8 ) or 1.0 × 10 7 SKOV-3 cells were suspended in a volume of 300-400 µl of PBS or serum-free cell culture medium and injected i.p. into female nude mice. VEGF-Trap or control buffer was delivered twice weekly at 25 mg/kg via s.c. injection in a volume of 50-200 µl. Mice were assessed daily for general health and development of ascites and weighed at least twice weekly. Animals were sacrificed if they had lost > 10% of body weight or had persistent ascites on three consecutive assessments. After sacrifice, ascites was removed with a sterile thin caliber plastic transfer pipette and quantified, and hematocrit was measured.

OVCAR-3 cells obtained from ascites fluid were prepared . Briefly, 2 × 10 6 cells in 500 µl of RPMI 1640 were injected i.p. into athymic Balb/C nude (nu/nu) mice. Fourteen days after inoculation, blinded administration of VEGF-Trap or human Fc as control was initiated at a dose of 25 mg/kg. Injections were given s.c. in the nape of the neck using a 28.5gauge needle and a 0.5-ml insulin syringe. Injections (0.05 ml) were administered twice weekly throughout the experimental period. Body weight and abdominal circumference were quantified twice weekly. In addition, animals were monitored daily for evidence of advanced disease (listlessness, extensive swelling of the abdominal cavity). At the end of the experiment, all remaining mice underwent euthanasia with CO 2 followed by cervical dislocation. The volume of ascites was measured, and tumors were excised and weighed. Immediately before sacrifice, mice received i.v. injection with FITC lycopersicon lectin (see below).

According to Holash et al. (2002) s.c. tumors were established. After small s.c. tumors became palpable (1 week after implantation), treatment with the VEGF-Trap was initiated. VEGF-Trap or an equivalent volume of vehicle was delivered twice weekly s.c. at the nape of the neck. Tumor vasculature was visualized by using antibodies to platelet-endothelial cell adhesion molecule for immunohistochemistry.VEGF-Trap-treated OVCAR-3 tumor-bearing mice and control, untreated tumor-bearing mice were anesthetized by i.m. injection with ketamine (87 mg/kg) and xylazine (13 mg/kg), followed by i.v. injection with 100 µl of FITC lycopersicon lectin or 100 µg of Cy3 albumin (Jackson Immunology Research, West Grove, Pa., USA). Then 10 min later, mice were perfused through the ascending aorta with 4% paraformaldehyde in PBS for 2 min. Tumors and control organs were extracted and placed in fixative for 1-2 h followed by immersion in 30% sucrose/PBS