key: cord-0032874-7ryos5r7
authors: Xiao, Ya; Wang, Xiaona; Li, Yue; Li, Fengsai; Zhao, Haiyuan; Shao, Yilan; Zhang, Liu; Ding, Guojie; Li, Jiaxuan; Jiang, Yanping; Cui, Wen; Shan, Zhifu; Zhou, Han; Wang, Li; Qiao, Xinyuan; Tang, Lijie; Li, Yijing
title: Evaluation of the Immunogenicity in Mice Orally Immunized with Recombinant Lactobacillus casei Expressing Porcine Epidemic Diarrhea Virus S1 Protein
date: 2022-04-25
journal: Viruses
DOI: 10.3390/v14050890
sha: 31501ea1457d922cea136a3a17b5e313e9dcbbf7
doc_id: 32874
cord_uid: 7ryos5r7

Porcine epidemic diarrhea (PED), characterized by diarrhea, vomiting, and dehydration, is an acute enteric infectious disease of pigs. The disease is caused by porcine epidemic diarrhea virus (PEDV), which infects the intestinal mucosal surface. Therefore, mucosal immunization through the oral route is an effective method of immunization. Lactic acid bacteria, which are acid resistant and bile-salt resistant and improve mucosal immunity, are ideal carriers for oral vaccines. The S1 glycoprotein of PEDV mediates binding of the virus with cell receptors and induces neutralizing antibodies against the virus. Therefore, we reversely screened the recombinant strain pPG-SD-S1/Δupp ATCC 393 expressing PEDV S1 glycoprotein by Lactobacillus casei deficient in upp genotype (Δupp ATCC 393). Mice were orally immunized three times with the recombinant bacteria that had been identified for expression, and the changes of anti-PEDV IgG and secreted immunoglobulin A levels were observed over 70 days. The results indicated that the antibody levels notably increased after oral administration of recombinant bacteria. The detection of extracellular cytokines on the 42nd day after immunization indicated high levels of humoral and cellular immune responses in mice. The above results demonstrate that pPG-SD-S1/Δupp ATCC 393 has great potential as an oral vaccine against PEDV.

Porcine epidemic diarrhea (PED) is an acute viral disease of pigs that causes huge economic losses to the global agriculture industry [1, 2] . Presently, the RNA vaccine and inactivated whole virus vaccine developed by Harrisvaccines TM and Zoetis, respectively, are widely used and effective against PEDV [3] . Porcine epidemic diarrhea virus (PEDV), which mainly causes intestinal epithelial cell damage in neonatal pigs, is the etiological agent of PED; therefore, oral vaccines that effectively stimulate the intestinal mucosal immune response have proven valuable for practical application [4] . To achieve an adequate level of mucosal immune response at the relevant site, oral vaccines must be protected Constitutive cell surface expression plasmid pPG-T7g10-PPT (a), cloning vector pMD19Ts-SD-S1 (b) and recombinant plasmid pPG-SD-S1 (c). Fusion DNA fragment SD-S1 (Lactobacillus Ribosome Binding Site sequence (SD) and PEDV S1 glycoprotein gene) obtained from pMD19Ts-SD-S1 by SnaB I and Apa I digestion was inserted into the corresponding sites of plasmid pPG-T7g10-PPT, generating recombinant plasmid pPG-SD-S1. CTTATCGTCGTCATCCTTGTAATCAAGTCGAC-CATCAGCTTTAACTGTTG S1 S1F GTCGACTTGATTACAAGGATGACGACGATAAGTG-CATTGGTTAT 1518 bp S1R GGGCCCCTAGTAAAAGAAACCAGGCAACTC Bold type indicates restriction enzyme recognition sites used for cloning.

The strain pPG-SD-S1/Δupp ATCC 393 was inoculated into MRS broth (1:100) and incubated for 12 h at 37 °C. Next, the culture was centrifuged at 4 °C, and the pellet and supernatant obtained were sonicated. Further, proteins in the sonicated supernatant and pellet were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were electrotransferred onto polyvinylidene fluoride membranes (Millipore, Milford, MA, USA). The membranes were incubated with mouse S1 monoclonal antibody (stored in our laboratory) as the primary antibody for 1 h at 37 °C and horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (1:5000) (Thermo Scientific, Durham, NC, USA) as the secondary antibody for 1 h at 37 °C. The results were observed using a chemiluminescent substrate reagent (Solarbio, Beijing, China) according to the manufacturer's instructions. Constitutive cell surface expression plasmid pPG-T7g10-PPT (a), cloning vector pMD19Ts-SD-S1 (b) and recombinant plasmid pPG-SD-S1 (c). Fusion DNA fragment SD-S1 (Lactobacillus Ribosome Binding Site sequence (SD) and PEDV S1 glycoprotein gene) obtained from pMD19Ts-SD-S1 by SnaB I and Apa I digestion was inserted into the corresponding sites of plasmid pPG-T7g10-PPT, generating recombinant plasmid pPG-SD-S1. 

The strain pPG-SD-S1/ ∆upp ATCC 393 was inoculated into MRS broth (1:100) and incubated for 12 h at 37 • C. Next, the culture was centrifuged at 4 • C, and the pellet and supernatant obtained were sonicated. Further, proteins in the sonicated supernatant and pellet were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were electrotransferred onto polyvinylidene fluoride membranes (Millipore, Milford, MA, USA). The membranes were incubated with mouse S1 monoclonal antibody (stored in our laboratory) as the primary antibody for 1 h at 37 • C and horseradish peroxidase (HRP)conjugated goat anti-mouse IgG antibody (1:5000) (Thermo Scientific, Durham, NC, USA) as the secondary antibody for 1 h at 37 • C. The results were observed using a chemiluminescent substrate reagent (Solarbio, Beijing, China) according to the manufacturer's instructions.

To evaluate the immunogenicity of pPG-SD-S1/ ∆upp L. casei 393 as an oral vaccine, 35-day-old female specific pathogen-free (SPF) BALB/c mice (n = 90) were housed in an SPF environment and provided with adequate water and food for the standard. The recombinant strains were inoculated in MRS broth (1:100) and cultured for 14 h at 37 • C. Further, the cultures were washed and diluted to a final concentration of 10 10 colonuforming units (CFU)/mL with phosphate-buffered saline (PBS). Three groups of mice were administered 200 µL PBS, ∆upp ATCC 393, or pPG-SD-S1/ ∆upp ATCC 393 (30 mice each mouse was immunized three times with an  immunization cycle of 3 days, and each immunization was 14 days apart. To detect IgG  and SIgA, the sera, tears, nasal fluid, genital mucus, intestinal mucus, and feces of the  immunized mice were collected at 0, 7, 14, 21, 28, 35, 42, 49, 56, 63 , and 70 days after the first immunization and stored at −40 • C until use. Of these, the intestinal mucus and feces required pretreatment. Intestinal mucus was flushed from the intestine using HEPES buffer. After incubation and centrifugation, the supernatant was stored at −40 • C until further use. In addition, 400 µL of 1% bovine serum albumin (BSA) and 1 mmol/L phenylmethylsulfonyl fluoride (Sigma, Ronkonkoma, NY, USA) were added to 0.1 g of feces, processed, and saved as previously described [24] .

To evaluate the immunogenicity of pPG-SD-S1/Δupp L. casei 393 as an oral vaccine, 35-day-old female specific pathogen-free (SPF) BALB/c mice (n = 90) were housed in an SPF environment and provided with adequate water and food for the standard. The recombinant strains were inoculated in MRS broth (1:100) and cultured for 14 h at 37 °C. Further, the cultures were washed and diluted to a final concentration of 10 10 colonuforming units (CFU)/mL with phosphate-buffered saline (PBS). Three groups of mice were administered 200 µL PBS, Δupp ATCC 393, or pPG-SD-S1/Δupp ATCC 393 (30 mice per group). As shown in Figure 2 , each mouse was immunized three times with an immunization cycle of 3 days, and each immunization was 14 days apart. To detect IgG and SIgA, the sera, tears, nasal fluid, genital mucus, intestinal mucus, and feces of the immunized mice were collected at 0, 7, 14, 21, 28, 35, 42, 49, 56, 63 , and 70 days after the first immunization and stored at −40 °C until use. Of these, the intestinal mucus and feces required pretreatment. Intestinal mucus was flushed from the intestine using HEPES buffer. After incubation and centrifugation, the supernatant was stored at −40 °C until further use. In addition, 400 µL of 1% bovine serum albumin (BSA) and 1 mmol/L phenylmethylsulfonyl fluoride (Sigma, Ronkonkoma, NY, USA) were added to 0.1 g of feces, processed, and saved as previously described [24] . The timeline of mice immunization procedure and sample collection. Mice (n = 90) were equally divided into three groups. The black font represents the days of immunization; a sample was collected every seven days. Spleen lymphocyte proliferation assay and cytokine detection were performed on day 42.

Changes in anti-PEDV IgG in serum were detected by indirect ELISA. The same method was used to monitor the levels of the SIgA antibody. Briefly, after overnight storage at 4 °C, PEDV was coated with polystyrene microtiter plates. The plates were washed with 100 µL PBS-0.1% Tween 20, 5% skim milk was added to each well, and the plate was incubated for 2 h at 37 °C. After the 100 µL samples were added (each sample was added in triplicates), the plate was incubated for 2 h at 37 °C. Further, 100 µL HRP-conjugated goat anti-mouse IgG/IgA antibody (1:5000) (Thermo Scientific, Durham, NC, USA) was added to the plate for 1 h at 37 °C. Finally, o-phenylenediamine dihydrochloride (Sigma, Ronkonkoma, NY, USA) was added as substrate, and absorbance was recorded at 490 nm.

To determine the neutralizing activity of anti-PEDV IgG in serum, 50 µL of serum from each immunized mouse was collected on the 42nd day after immunization and serially diluted (two-fold). The mixture of diluted serum and 50 µL of 50% tissue culture infected (TCID50) PEDV was plated at 37 °C, incubated for 1 h, and placed on a Vero-L cell monolayer in a 96-well plate at 37 °C for 1 h. The culture medium was replenished after discarding the solution. The presence of a PEDV-specific cytopathic effect was observed after two days incubation at 37 °C and 5% CO2. In this study, eight biological replicates and three technical replicates were set for each sample. In addition, a negative serum, positive serum, blank, and virus control were included in each experiment. The timeline of mice immunization procedure and sample collection. Mice (n = 90) were equally divided into three groups. The black font represents the days of immunization; a sample was collected every seven days. Spleen lymphocyte proliferation assay and cytokine detection were performed on day 42.

Changes in anti-PEDV IgG in serum were detected by indirect ELISA. The same method was used to monitor the levels of the SIgA antibody. Briefly, after overnight storage at 4 • C, PEDV was coated with polystyrene microtiter plates. The plates were washed with 100 µL PBS-0.1% Tween 20, 5% skim milk was added to each well, and the plate was incubated for 2 h at 37 • C. After the 100 µL samples were added (each sample was added in triplicates), the plate was incubated for 2 h at 37 • C. Further, 100 µL HRP-conjugated goat anti-mouse IgG/IgA antibody (1:5000) (Thermo Scientific, Durham, NC, USA) was added to the plate for 1 h at 37 • C. Finally, o-phenylenediamine dihydrochloride (Sigma, Ronkonkoma, NY, USA) was added as substrate, and absorbance was recorded at 490 nm.

To determine the neutralizing activity of anti-PEDV IgG in serum, 50 µL of serum from each immunized mouse was collected on the 42nd day after immunization and serially diluted (two-fold). The mixture of diluted serum and 50 µL of 50% tissue culture infected (TCID 50 ) PEDV was plated at 37 • C, incubated for 1 h, and placed on a Vero-L cell monolayer in a 96-well plate at 37 • C for 1 h. The culture medium was replenished after discarding the solution. The presence of a PEDV-specific cytopathic effect was observed after two days incubation at 37 • C and 5% CO 2 . In this study, eight biological replicates and three technical replicates were set for each sample. In addition, a negative serum, positive serum, blank, and virus control were included in each experiment.

Three mice from each group were sacrificed on the 42nd day, and spleen cells were obtained under sterile conditions for the detection of spleen lymphocyte proliferation. Briefly, splenocytes at a concentration of 5 × 10 6 cells/mL (three replicates) were cultured in 96-well plates with RPMI1640 + 20% fetal bovine serum at 37 • C and 5% CO 2 . Splenocytes were stimulated with purified PEDV S1 protein at 1, 5, or 25 µg/mL for 60 h at 37 • C with 5% CO 2 . Simultaneously, 5 µg/mL concanavalin A (Con A) was set as a positive control, and RPMI1640 medium was set as a negative control. Spleen lymphocytes proliferation, Viruses 2022, 14, 890 5 of 12 detected by the CellTiter 96 ® AQueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI, USA), was evaluated at 570 nm absorbance, according to the manufacturer's instructions. Bars represented mean ± standard error of each group. According to the manufacturer's instructions (Biosource International Inc., Camarillo, CA, USA), serum interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4, IL-12, IL-10, and IL-17 levels were detected using antigen capture ELISA. All of the above experiments were repeated three times, and the cytokine concentration was calculated based on the standard curve.

The data are the mean of three replicates for a single sample ± standard error. Graph-Pad Prism v 5.0 (San Diego, CA, USA) was used for the statistical analysis of the data. Tukey's multiple comparison test and two-way analysis of variance (ANOVA) were used to analyze the significance of differences between the means. Differences with p values less than 0.05 (p < 0.05) and less than 0.01 (p < 0.01) were considered significant and highly significant, respectively.

pPG-SD-S1/ ∆upp ATCC 393 and ∆upp ATCC 393 were cultured overnight, centrifuged, and lysed for Western blotting. The bands of predictable size appeared in the supernatant and pellet of the pPG-SD-S1/ ∆upp ATCC 393 lysate but not in the supernatant and pellet of the ∆upp ATCC 393 lysate, indicating that the target protein was effectively expressed (Figure 3a ). To confirm that the recombinant bacteria stably expressed the target protein, overnight cultures from the 10th, 20th, 30th, 40th, and 50th generations of pPG-SD-S1/ ∆upp ATCC 393 were collected, centrifuged, and lysed for Western blotting. Predictable bands appeared in the 10th to 50th generation of pPG-SD-S1/ ∆upp ATCC 393 lysates (Figure 3b ), whereas bands were not visible in the ∆upp ATCC 393 lysates. The above results indicate that the recombinant bacteria stably expressed the target protein.

obtained under sterile conditions for the detection of spleen lymphocyte proliferation. Briefly, splenocytes at a concentration of 5 × 10 6 cells/mL (three replicates) were cultured in 96-well plates with RPMI1640 + 20% fetal bovine serum at 37 °C and 5% CO2. Splenocytes were stimulated with purified PEDV S1 protein at 1, 5, or 25 µg/mL for 60 h at 37 °C with 5% CO2. Simultaneously, 5 µg/mL concanavalin A (Con A) was set as a positive control, and RPMI1640 medium was set as a negative control. Spleen lymphocytes proliferation, detected by the CellTiter 96 ® AQueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, WI, USA), was evaluated at 570 nm absorbance, according to the manufacturer's instructions. Bars represented mean ± standard error of each group. According to the manufacturer's instructions (Biosource International Inc., Camarillo, CA, USA), serum interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4, IL-12, IL-10, and IL-17 levels were detected using antigen capture ELISA. All of the above experiments were repeated three times, and the cytokine concentration was calculated based on the standard curve.

The data are the mean of three replicates for a single sample ± standard error. GraphPad Prism v 5.0 (San Diego, CA, USA) was used for the statistical analysis of the data. Tukey's multiple comparison test and two-way analysis of variance (ANOVA) were used to analyze the significance of differences between the means. Differences with p values less than 0.05 (p < 0.05) and less than 0.01 (p < 0.01) were considered significant and highly significant, respectively.

pPG-SD-S1/Δupp ATCC 393 and Δupp ATCC 393 were cultured overnight, centrifuged, and lysed for Western blotting. The bands of predictable size appeared in the supernatant and pellet of the pPG-SD-S1/Δupp ATCC 393 lysate but not in the supernatant and pellet of the Δupp ATCC 393 lysate, indicating that the target protein was effectively expressed (Figure 3a ). To confirm that the recombinant bacteria stably expressed the target protein, overnight cultures from the 10th, 20th, 30th, 40th, and 50th generations of pPG-SD-S1/Δupp ATCC 393 were collected, centrifuged, and lysed for Western blotting. Predictable bands appeared in the 10th to 50th generation of pPG-SD-S1/Δupp ATCC 393 lysates (Figure 3b ), whereas bands were not visible in the Δupp ATCC 393 lysates. The above results indicate that the recombinant bacteria stably expressed the target protein. Figure 3 . The expression and stability of the target protein was identified in Western blots using a mouse anti-S1 monoclonal antibody (a,b). pPG-SD-S1/Δupp ATCC 393 lysate supernatant [pPG-SD-S1/Δupp ATCC393 (S)] and pellet [pPG-SD-S1/Δupp ATCC393 (P)] show relevant immunoreactive bands, but the supernatant (Δupp ATCC393 (S)) and pellet (Δupp ATCC393 (P)) of Δupp ATCC 393 lysate do not. The relevant immunoreactive bands are evident in the pPG-SD-S1/Δupp ATCC 393 lysate from the 10th to 50th generations, but not in Δupp ATCC 393. M: protein molecular weight marker. Figure 3 . The expression and stability of the target protein was identified in Western blots using a mouse anti-S1 monoclonal antibody (a,b). pPG-SD-S1/ ∆upp ATCC 393 lysate supernatant [pPG-SD-S1/ ∆upp ATCC393 (S)] and pellet [pPG-SD-S1/ ∆upp ATCC393 (P)] show relevant immunoreactive bands, but the supernatant (∆upp ATCC393 (S)) and pellet (∆upp ATCC393 (P)) of ∆upp ATCC 393 lysate do not. The relevant immunoreactive bands are evident in the pPG-SD-S1/∆upp ATCC 393 lysate from the 10th to 50th generations, but not in ∆upp ATCC 393. M: protein molecular weight marker.

Changes in anti-PEDV IgG antibody levels induced by pPG-SD-S1/ ∆upp ATCC 393 were detected by ELISA. As shown in Figure 4a , anti-PEDV IgG levels started to increase on day 7 and peaked on day 42 of the oral immunization with recombinant bacteria. In contrast, anti-PEDV IgG levels in the PBS and ∆upp ATCC 393 groups did not change significantly (p < 0.05). In addition, the sera from immunized mice exhibited anti-PEDV neutralizing activity. The anti-PEDV neutralizing antibodies (IgG) in the serum obtained from mice orally immunized with pPG-SD-S1/∆upp ATCC 393 (1:28) were significantly higher than that with oral PBS (1:2) and ∆upp ATCC 393 (1:2) (Figure 4b) . The above results Changes in anti-PEDV IgG antibody levels induced by pPG-SD-S1/Δupp ATCC 393 were detected by ELISA. As shown in Figure 4a , anti-PEDV IgG levels started to increase on day 7 and peaked on day 42 of the oral immunization with recombinant bacteria. In contrast, anti-PEDV IgG levels in the PBS and Δupp ATCC 393 groups did not change significantly (p < 0.05). In addition, the sera from immunized mice exhibited anti-PEDV neutralizing activity. The anti-PEDV neutralizing antibodies (IgG) in the serum obtained from mice orally immunized with pPG-SD-S1/Δupp ATCC 393 (1:28) were significantly higher than that with oral PBS (1:2) and Δupp ATCC 393 (1:2) (Figure 4b) . The above results show that oral immunization with recombinant bacteria can effectively induce high levels of anti-PEDV immune response in mice. 

To evaluate the mucosal immune response induced by oral recombinant bacteria in mice, ELISA was used to detect anti-PEDV SIgA levels in the tears, nasal fluid, genital mucus, intestinal mucus, and fecal samples. Figure 5e ) in the oral pPG-SD-S1/Δupp ATCC 393 immunized group were significantly higher than those in the oral PBS and Δupp ATCC 393 groups and increased significantly on day 7 and peaked at 42 days. In contrast, anti-PEDV SIgA in the oral PBS and Δupp ATCC 393 groups did not show a significant change. The above results indicate that pPG-SD-S1/Δupp ATCC 393 could effectively induce a mucosal immune response in mice. 

To evaluate the mucosal immune response induced by oral recombinant bacteria in mice, ELISA was used to detect anti-PEDV SIgA levels in the tears, nasal fluid, genital mucus, intestinal mucus, and fecal samples. The levels of SIgA in the nasal fluid (Figure 5a ), tears (Figure 5b) , genital mucus (Figure 5c ), intestinal mucus (Figure 5d ), and feces (Figure 5e ) in the oral pPG-SD-S1/∆upp ATCC 393 immunized group were significantly higher than those in the oral PBS and ∆upp ATCC 393 groups and increased significantly on day 7 and peaked at 42 days. In contrast, anti-PEDV SIgA in the oral PBS and ∆upp ATCC 393 groups did not show a significant change. The above results indicate that pPG-SD-S1/∆upp ATCC 393 could effectively induce a mucosal immune response in mice.

To determine the type of immune response induced by oral recombinant bacteria, changes in cytokine levels were detected on the 42nd day. Compared to the oral PBS and ∆upp ATCC 393 groups, the levels of cytokines IL-2, IFN-γ, IL-4, IL-12, IL-10, and IL-17 in the sera of the oral pPG-SD-S1/∆upp ATCC 393 group were significantly increased ( Figure 6 ). These results show that oral administration of pPG-SD-S1/∆upp ATCC 393 could significantly stimulate the generation of Th1, Th2, and Th17 cellular immunity in mice.

Using Con A as a positive control and RPMI1640 as a negative control, isolated splenocytes were restimulated in vitro with PEDV S1 pure protein, followed by 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Compared with the oral PBS and ∆upp ATCC 393 groups, the stimulation index of the oral pPG-SD-S1/∆upp ATCC 393 immunization group was significantly increased and showed a dose-dependent phenomenon (Figure 7) . To determine the type of immune response induced by oral recombinant bacteria, changes in cytokine levels were detected on the 42nd day. Compared to the oral PBS and Δupp ATCC 393 groups, the levels of cytokines IL-2, IFN-γ, IL-4, IL-12, IL-10, and IL-17 in the sera of the oral pPG-SD-S1/Δupp ATCC 393 group were significantly increased ( Figure  6 ). These results show that oral administration of pPG-SD-S1/Δupp ATCC 393 could significantly stimulate the generation of Th1, Th2, and Th17 cellular immunity in mice. 

Using Con A as a positive control and RPMI1640 as a negative control, isolated splenocytes were restimulated in vitro with PEDV S1 pure protein, followed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Compared with the oral PBS and Δupp ATCC 393 groups, the stimulation index of the oral pPG-SD-S1/Δupp ATCC 393 immunization group was significantly increased and showed a dose-dependent phenomenon (Figure 7 ).

Lymphocyte proliferation in immunized mice was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. With purified PEDV S1 protein as the stimulation source, the stimulation index of spleen lymphocytes isolated from immunized mice was detected by the MTT assay. Bars represent mean ± standard error in each group (** p < 0.01, compared to controls: PBS and Δupp ATCC 393). 

Using Con A as a positive control and RPMI1640 as a negative control, isolated splenocytes were restimulated in vitro with PEDV S1 pure protein, followed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Compared with the oral PBS and Δupp ATCC 393 groups, the stimulation index of the oral pPG-SD-S1/Δupp ATCC 393 immunization group was significantly increased and showed a dose-dependent phenomenon ( Figure 7 ).

Lymphocyte proliferation in immunized mice was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. With purified PEDV S1 protein as the stimulation source, the stimulation index of spleen lymphocytes isolated from immunized mice was detected by the MTT assay. Bars represent mean ± standard error in each group (** p < 0.01, compared to controls: PBS and Δupp ATCC 393). Figure 7 . Lymphocyte proliferation in immunized mice was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. With purified PEDV S1 protein as the stimulation source, the stimulation index of spleen lymphocytes isolated from immunized mice was detected by the MTT assay. Bars represent mean ± standard error in each group (** p < 0.01, compared to controls: PBS and ∆upp ATCC 393).

Currently, PED has become one of the major infectious diseases in pig farms, leading to heavy economic losses to the farming industry. The main surface antigen of PEDV is the spike protein (S), which is present on the capsular membrane [25] . The S protein interacts with specific host cell receptors, mediating the fusion of the virus with the cell membrane and permitting the virus to enter susceptible cells [26] ; therefore, the protein is crucial for viral infection. Experimental results prove that neutralizing antibodies, which are closely associated with immune protection against viruses, could be induced by the S protein [27] . Based on the classic PEDV CV777 strain, the S protein is divided into the S1 (AA 1-726) and S2 (AA 727-1386) functional regions [28] . The plants such as tobacco or rice callus have been used for expressing PEDV S1 protein, and significant humoral and mucosal immune responses were induced in animals after feeding on them [29, 30] . Therefore, in this study, the S1 glycoprotein gene amplified from the PEDV epidemic strain, with over 97% similarity with PEDV strains prevalent in recent years, was selected as the target gene. The strain contains the neutralizing antibody epitope and is a good candidate antigen for vaccines [31] .

Presently, most vaccines against PEDV are intramuscular inactivated vaccines [32] . As PEDV infections mainly occur on the intestinal mucosal epithelial surface, mucosal immunity plays a crucial role in preventing PEDV infections [33] . Oral immunization effectively stimulates the digestive tract to produce local mucosal immunity, causing a systemic Viruses 2022, 14, 890 9 of 12 immune response [34] . LAB, having advantages such as acid resistance, bile salt resistance, avoidance of immune tolerance, and mucosal immunity improvement, are extensively used as oral vaccine carriers [35] . Research has shown that L. casei ATCC 393, expressing a fusion protein of the PCV2 capsid protein and E. coli thermolabile toxin B subunit, stimulates a strong mucosal immune response against PCV2 in mice after oral immunization [36] . In addition, L. plantarum, which expresses severe acute respiratory syndrome coronavirus 2, can generate an immune response in the respiratory tract. These results suggest that LAB have the potential to become mucosal vaccines against COVID-19 [37] . Therefore, LAB is an ideal carrier for oral vaccines.

In this study, the SD sequence, the RBS and signal peptide sequence of Lactobacillus casei to improve protein expression, and the PEDV S1 glycoprotein were expressed by the shuttle vector E. coli-LAB in ∆upp ATCC 393. The recombinant strain was used for oral immunization to evaluate its immune efficacy in mice. In view of the highly mutant form of the PEDV S protein, the S1 gene selected in this experiment was amplified from the PEDV epidemic strains. Therefore, recombinant bacteria have practical applications, and the results of oral immunization in mice corroborate this fact. The experimental results showed that the oral administration of pPG-SD-S1/∆upp ATCC 393 could stimulate an increase in anti-PEDV IgG and SIgA levels in mice, indicating that pPG-SD-S1/∆upp ATCC 393 has the potential to act as a PEDV oral vaccine.

The gut is the primary site of PEDV infection and transmission; therefore, high levels of IgG and SIgA are required for an effective mucosal immune response against PEDV [38] . In addition, SIgA is also one of the evaluation criteria for the degree of virus infection and protective efficacy of vaccines [39, 40] . The experimental results showed that anti-PEDV IgG antibodies increased after the oral administration of pPG-SD-S1/∆upp ATCC 393, and this increase was more notable after booster immunization. Furthermore, antibody neutralization experiments demonstrated that IgG on day 42 after immunization (anti-PEDV-specific IgG antibody levels peak on this day) could complement immune defense by reducing the aggressiveness of PEDV. IgA has been shown to peak at six weeks in piglets and decrease at eight weeks [4] . Neonatal pigs could only be protected after 35 days of durable immunity. Therefore, changes in SIgA levels were monitored at 70 days after the primary immunization. The oral administration of pPG-SD-S1/∆upp ATCC 393 effectively induced the production of high levels of SIgA in the nasal fluid, tears, genital mucus, intestinal mucus, and feces of mice. Meanwhile, the levels of SIgA peaked at 42 days after the primary immunization, indicating that oral administration of pPG-SD-S1/∆upp ATCC 393 could effectively elicit the mucosal immune response.

Additionally, the secretion levels of cytokines IL-2, IFN-γ, IL-10, IL-4, IL-12, and IL-17 were significantly increased after oral immunization with pPG-SD-S1/∆upp ATCC 393, indicating that the recombinant bacteria significantly stimulated the production of Th1, Th2, and Th17 cellular immunity in mice. Th1 responses are connected to cell-mediated immunity, whereas Th2 responses are related to humoral immunity [41] . IFN-γ and IL-2, which are Th1-type cytokines, assist antibody production, participate in cellular immune response, T cell proliferation, and induce cytotoxic effects [42, 43] . IL-12 stimulates differentiation of T cells into Th1 or committed Th1 cells [44] . IL-4 stimulates the growth and differentiation of B lymphocytes, as well as antibody production. Moreover, IL-4 can also stimulate dendritic cells to produce IFN-γ, displaying a synergistic effect with IL-12 [44] . Both Th1 and Th2 cells can induce the production of IL-10 [43] . IL-17, which is produced by Th17 cells, is involved in neutrophil excitation, further stimulating the production of pro-inflammatory responses [45] . In this study, the cytokines level in serum was significantly increased on the 14th day after the third round of immunization, but oral administration of ∆upp ATCC 393 could not produce a significant difference with the oral PBS group, indicating that oral administration of pPG-SD-S1/∆upp ATCC 393 can induce strong humoral and cellular immunity in mice simultaneously. Similar results were observed in spleen lymphocyte proliferation experiments.

In conclusion, oral immunization of pPG-SD-S1/∆upp ATCC 393 could stimulate mice to produce specific immune responses against PEDV. This study can be used as a reference to develop PEDV vaccines for piglets. In the future, we will insert the SD-S1 sequence into the genome of Lactobacillus casei, using the upp gene deficiency as a counter-selection marker, by homologous recombination. Future experiments will focus on the immune protection effect of the recombinant strains in a porcine model.

In conclusion, we developed an anti-PEDV vaccine for oral administration using recombinant L. casei to deliver the S1 antigen and demonstrated that the recombinant bacteria pPG-SD-S1/∆upp ATCC 393, reverse screened by ∆upp ATCC 393, effectively induces an immune response against PEDV; therefore, this recombinant strain can be a potential oral PEDV vaccine.

Supplementary Materials: The following supporting information can be downloaded at: https:// www.mdpi.com/article/10.3390/v14050890/s1, Figure S1 : The S1 gene sequence used in this study. 

Immune evasion of porcine enteric coronaviruses and viral modulation of antiviral innate signaling

Porcine epidemic diarrhoea virus: A comprehensive review of molecular epidemiology, diagnosis, and vaccines

Status of vaccines for porcine epidemic diarrhea virus in the United States and Canada

Immunogenicity of eGFP-Marked Recombinant Lactobacillus casei against Transmissible Gastroenteritis Virus and Porcine Epidemic Diarrhea Virus

A novel mucosal vaccine targeting Peyer's patch M cells induces protective antigen-specific IgA responses

Recombinant Lactobacillus plantarum NC8 strain expressing porcine rotavirus VP7 induces specific antibodies in BALB/c mice

Expression of S1 gene of porcine transmissible gastroenteritis virus in food graded lactococcus lactis

A comparative study of the preventative effects exerted by three probiotics, Bifidobacterium lactis, Lactobacillus casei and Lactobacillus acidophilus, in the TNBS model of rat colitis

Studies on Mucosal Immunity Induced by Transmissible Gastroenteritis Virus Nucleocapsid Protein Recombinant Lactobacillus casei in Mice and Sow

Lactobacillus casei DBN023 protects against jejunal mucosal injury in chicks infected with Salmonella pullorum CMCC-533

Recombinant Lactobacillus casei expressing Clostridium perfringens toxoids α, β2, ε and β1 gives protection against Clostridium perfringens in rabbits

Construction of upp deletion mutant strains of Lactobacillus casei and Lactococcus lactis based on counterselective system using temperature-sensitive plasmid

Homologous gene knockout in the archaeon Halobacterium salinarum with ura3 as a counterselectable marker

Global analysis of carbohydrate utilization by Lactobacillus acidophilus using cDNA microarrays

Display of Porcine Epidemic Diarrhea Virus Spike Protein on Baculovirus to Improve Immunogenicity and Protective Efficacy

S1 domain of the porcine epidemic diarrhea virus spike protein as a vaccine antigen

Proteolytic activation of the porcine epidemic diarrhea coronavirus spike fusion protein by trypsin in cell culture

Cell Attachment Domains of the Porcine Epidemic Diarrhea Virus Spike Protein Are Key Targets of Neutralizing Antibodies

Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus

S1 Subunit of Spike Protein from a Current Highly Virulent Porcine Epidemic Diarrhea Virus is an Important Determinant of Virulence in Piglets

Secretory component: A new role in secretory IgA-mediated immune exclusion in vivo

Comparative innate immune interactions of human and bovine secretory IgA with pathogenic and non-pathogenic bacteria

Up-regulation of MDP and tuftsin gene expression in Th1 and Th17 cells as an adjuvant for an oral Lactobacillus casei vaccine against anti-transmissible gastroenteritis virus

Oral Delivery of Probiotics Expressing Dendritic Cell-Targeting Peptide Fused with Porcine Epidemic Diarrhea Virus COE Antigen: A Promising Vaccine Strategy against PEDV

Effect of route of inoculation on innate and adaptive immune responses to porcine epidemic diarrhea virus infection in suckling pigs

Oral recombinant Lactobacillus vaccine targeting the intestinal microfold cells and dendritic cells for delivering the core neutralizing epitope of porcine epidemic diarrhea virus

Oral immunization with a Lactobacillus casei-based anti-porcine epidemic diarrhoea virus (PEDV) vaccine expressing microfold cell-targeting peptide Co1 fused with the COE antigen of PEDV

Identification of a peptide derived from the heptad repeat 2 region of the porcine epidemic diarrhea virus (PEDV) spike glycoprotein that is capable of suppressing PEDV entry and inducing neutralizing antibodies

Expression of a Cholera Toxin B Subunit-Neutralizing Epitope of the Porcine Epidemic Diarrhea Virus Fusion Gene in Transgenic Lettuce (Lactuca sativa L.)

Cloning and sequence analysis of the Korean strain of spike gene of porcine epidemic diarrhea virus and expression of its neutralizing epitope in plants

Oral Immunization against PEDV with Recombinant Lactobacillus casei Expressing Dendritic Cell-Targeting Peptide Fusing COE Protein of PEDV in Piglets

Vaccines for porcine epidemic diarrhea virus and other swine coronaviruses

Expression Pattern Analysis of Antiviral Genes and Inflammatory Cytokines in PEDV-Infected Porcine Intestinal Epithelial Cells

Construction of a Recombinant Lactococcus lactis Strain Expressing a Variant Porcine Epidemic Diarrhea Virus S1 Gene and Its Immunogenicity Analysis in Mice

Adjuvant Strategies for Lactic Acid Bacterial Mucosal Vaccines

Oral Immunization with Lactobacillus casei Expressing the Porcine Circovirus Type 2 Cap and LTB Induces Mucosal and Systemic Antibody Responses in Mice

Lactiplantibacillus plantarum as a Potential Adjuvant and Delivery System for the Development of SARS-CoV-2 Oral Vaccines. Microorganisms

Isolation and Identification of Porcine Epidemic Diarrhea Virus and Its Effect on Host Natural Immune Response

Defensins, lectins, mucins, and secretory immunoglobulin A: Microbe-binding biomolecules that contribute to mucosal immunity in the human gut

Detection and correlation analysis of digestive tract specific SIgA by oral inactivated porcine epidemic diarrhea virus

Colitogenic Th1 cells are present in the antigen-experienced T cell pool in normal mice: Control by CD4+ regulatory T cells and IL-10

Distinct Effects of T-bet in TH1 Lineage Commitment and IFN-γ Production in CD4 and CD8 T Cells

In vitro generation of IL-10-producing regulatory CD4+ T cells is induced by immunosuppressive drugs and inhibited by Th1-and Th2-inducing cytokines

Synergistic effects of IL-4 and IL-18 on IL-12-dependent IFN-gamma production by dendritic cells

IL-17/Th17 promotes type 1 T cell immunity against pulmonary intracellular bacterial infection through modulating dendritic cell function

The authors declare no conflict of interest.