key: cord-0032738-8z65p1dn
authors: Sousa, Diana A.; Gaspar, Ricardo; Ferreira, Celso J. O.; Baltazar, Fátima; Rodrigues, Ligia R.; Silva, Bruno F. B.
title: In Vitro CRISPR/Cas9 Transfection and Gene-Editing Mediated by Multivalent Cationic Liposome–DNA Complexes
date: 2022-05-19
journal: Pharmaceutics
DOI: 10.3390/pharmaceutics14051087
sha: 6b32d779c2429c632a87ced31d55e3949fb16d7c
doc_id: 32738
cord_uid: 8z65p1dn

Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated nuclease 9 (Cas9) gene-editing offers exciting new therapeutic possibilities for disease treatment with a genetic etiology such as cancer, cardiovascular, neuronal, and immune disorders. However, its clinical translation is being hampered by the lack of safe, versatile, and effective nonviral delivery systems. Herein we report on the preparation and application of two cationic liposome–DNA systems (i.e., lipoplexes) for CRISPR/Cas9 gene delivery. For that purpose, two types of cationic lipids are used (DOTAP, monovalent, and MVL5, multivalent with +5e nominal charge), along with three types of helper lipids (DOPC, DOPE, and monoolein (GMO)). We demonstrated that plasmids encoding Cas9 and single-guide RNA (sgRNA), which are typically hard to transfect due to their large size (>9 kb), can be successfully transfected into HEK 293T cells via MVL5-based lipoplexes. In contrast, DOTAP-based lipoplexes resulted in very low transfection rates. MVL5-based lipoplexes presented the ability to escape from lysosomes, which may explain the superior transfection efficiency. Regarding gene editing, MVL5-based lipoplexes achieved promising GFP knockout levels, reaching rates of knockout superior to 35% for charge ratios (+/−) of 10. Despite the knockout efficiency being comparable to that of Lipofectamine 3000(®) commercial reagent, the non-specific gene knockout is more pronounced in MVL5-based formulations, probably resulting from the considerable cytotoxicity of these formulations. Altogether, these results show that multivalent lipid-based lipoplexes are promising CRISPR/Cas9 plasmid delivery vehicles, which by further optimization and functionalization may become suitable in vivo delivery systems.

The discovery of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated nuclease 9 (Cas9) has opened new possibilities to knockout or repair genes, revolutionizing the concept of gene therapy and promoting new exciting therapeutic possibilities [1, 2] . CRISPR/Cas9 is a two-component system composed of Cas9, an RNA-guided endonuclease capable of cleaving double-stranded DNA, and a 20-nucleotide target-specific sequence specified by single-guide RNA (sgRNA), which directs the Cas9 to a target site for DNA cleavage. The cleavages can be repaired by the nonhomologous end-joining (NHEJ) or homology-directed repair (HDR) pathways [3, 4] .

MVL5/GMO complexes also showing superior performance in the presence of serum and in harder-to-transfect human cell lines [53] .

In this work, we aimed to study the suitability of multivalent cationic lipid-DNA complexes for delivery and transfection of CRISPR/Cas9 DNA plasmids to in vitro human cells (HEK 293T) and the resulting gene knockout. MVL5, a pentavalent cationic lipid, introduced by Ewert and Safinya in 2002 [55] , is now commercially available and was chosen as the multivalent lipid. Besides the charge of the liposome membrane, also its elastic properties and propensity to form non-bilayer structures are thought to be important in facilitating the fusion of lipoplexes with the endosomal membrane and improving transfection [43, 56, 57] . Hence, three different helper lipids, DOPC, GMO, and 1,2-dioleoyl-snglycero-3-phosphoethanolamine (DOPE), were used in addition to MVL5, to produce four different binary lipid formulations (MVL5:DOPC 50:50, MVL5:GMO 50:50, MVL5:DOPE 50:50, and MVL5:DOPE 75: 25) . While all resulting lipid-DNA complexes are expected to show a lamellar-type nanostructure for the used compositions [33, 57] , the DOPE and GMO lipids have a higher propensity to form inverted lipid phases, such as reverse hexagonal and, in the case of GMO, also bicontinuous cubic phases [56] [57] [58] . Hence, by combining a highly-charged lipid with three lipids with different propensities to form non-bilayer structures, we hope to identify a regime of suitable transfection efficiency for the large plasmids containing the Cas9 and sgRNA sequences. For comparison purposes, we used also analogous formulations using the monovalent 2,3-Dioleyloxypropyltrimethylammonium chloride (DOTAP) lipid, which is one of the most used lipids in transfection, as well as the commercial Lipofectamine 3000 ® .

To measure the TE of the CRISPR/Cas9 plasmid, the plasmid that fuses the reporter green fluorescence protein (GFP) gene and the Cas9 expression cassette (pSpCas9(BB)-2A-GFP (PX458)) was used to facilitate the detection of Cas9 expression in the transfected cells ( Figure 1a ). Moreover, a Cas9 expression plasmid containing a sgRNA to target the GFP gene (PX459-sgRNA-GFP) was constructed ( Figure 1b) to evaluate the gene knockout efficiency, being the knockout efficiency determined by the loss of GFP signal. To account for the loss of GFP signal caused by toxicity or non-specific knockout, the PX459 empty vector was also used as a control. fection and gene silencing. Lipoplexes composed of MVL5 and different helper lipids, including monoolein (GMO), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and cholesterol, were shown to have superior TE compared to monovalent cationic lipid formulations, with MVL5/GMO complexes also showing superior performance in the presence of serum and in harder-to-transfect human cell lines [53] .

In this work, we aimed to study the suitability of multivalent cationic lipid-DNA complexes for delivery and transfection of CRISPR/Cas9 DNA plasmids to in vitro human cells (HEK 293T) and the resulting gene knockout. MVL5, a pentavalent cationic lipid, introduced by Ewert and Safinya in 2002 [55] , is now commercially available and was chosen as the multivalent lipid. Besides the charge of the liposome membrane, also its elastic properties and propensity to form non-bilayer structures are thought to be important in facilitating the fusion of lipoplexes with the endosomal membrane and improving transfection [43, 56, 57] . Hence, three different helper lipids, DOPC, GMO, and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), were used in addition to MVL5, to produce four different binary lipid formulations (MVL5:DOPC 50:50, MVL5:GMO 50:50, MVL5:DOPE 50:50, and MVL5:DOPE 75: 25) . While all resulting lipid-DNA complexes are expected to show a lamellar-type nanostructure for the used compositions [33, 57] , the DOPE and GMO lipids have a higher propensity to form inverted lipid phases, such as reverse hexagonal and, in the case of GMO, also bicontinuous cubic phases [56] [57] [58] . Hence, by combining a highly-charged lipid with three lipids with different propensities to form non-bilayer structures, we hope to identify a regime of suitable transfection efficiency for the large plasmids containing the Cas9 and sgRNA sequences. For comparison purposes, we used also analogous formulations using the monovalent 2,3-Dioleyloxypropyltrimethylammonium chloride (DOTAP) lipid, which is one of the most used lipids in transfection, as well as the commercial Lipofectamine 3000 ® .

To measure the TE of the CRISPR/Cas9 plasmid, the plasmid that fuses the reporter green fluorescence protein (GFP) gene and the Cas9 expression cassette (pSpCas9(BB)-2A-GFP (PX458)) was used to facilitate the detection of Cas9 expression in the transfected cells ( Figure 1a ). Moreover, a Cas9 expression plasmid containing a sgRNA to target the GFP gene (PX459-sgRNA-GFP) was constructed ( Figure 1b) to evaluate the gene knockout efficiency, being the knockout efficiency determined by the loss of GFP signal. To account for the loss of GFP signal caused by toxicity or non-specific knockout, the PX459 empty vector was also used as a control. is detected by flow cytometry and fluorescence microscopy. To distinguish between CRISPR-mediated GFP knockout and non-specific GFP reduction (e.g., caused by cytotoxicity), a similar plasmid without the sgRNA targeting sequence is used. U6: U6 promoter; sgRNA: contains a target sequence; CMV: CMV promoter, Cas9: Cas9 expression cassette; 2A: 2A self-cleaving peptide; GFP: GFP selection marker; Puro: Puromycin selection marker.

Plasmids pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) and pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) were a gift from Feng Zhang [59] . Endotoxinfree plasmids were extracted using ZymoPURE II Plasmid Maxiprep Kit from Zymo Research. Lipofectamine™3000, Texas-Red DHPE, and LysoSensor Green DND-189 were purchased from ThermoFisher Scientific. 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl-2Htetrazolium bromide (MTT) and paraformaldehyde and dimethyl sulfoxide (DMSO) were purchased from Sigma. 4 ,6-diamidino-2-phenylindole (DAPI) was purchased from Biotium. All cell culture reagents were purchased from Biochrom. Venor™ GeM Mycoplasma Detection Kit was purchased from Merck. The gene target sequences were synthesized by Alfagene. Lipids MVL5, DOTAP, DOPC, and DOPE were purchased from Avanti Polar Lipids (USA). GMO was purchased from Nu-Chek Prep (Elysian, MN, USA). All lipids were used as received. F-Luc-GFP lentivirus was purchased from Capital Biosciences.

Liposomes were prepared with different lipid compositions and membrane charge densities (σ M ). To achieve this, cationic DOTAP or MVL5 ( Figure 2a) were mixed with different helper lipids DOPC, DOPE, or GMO at different molar fractions. Lipid stocks dissolved in chloroform were mixed in the desired ratios. For cellular uptake and intracellular distribution studies, liposomes included also 0.1 mol% of total lipid of Texas-Red-DHPE. The resulting mixture was dried using a constant nitrogen gas stream and then placed in a vacuum overnight. The lipid film was resuspended in ultrapure nuclease-free Milli-Q water. The suspensions were vortexed and sonicated using a tip sonicator for 1 min, with 10% amplitude and 50% duty cycle using a Branson Digital Sonifier 250 Model.

For lipoplex formation, equal volumes of liposomes and DNA solutions were mixed to the desired concentration. Lipoplexes were prepared with a cationic-to-anionic CR (+/−) of 3 and 10. The CR (+/−) is calculated as the total number of positive charges (from the number and valence of DOTAP or MVL5 molecules) divided by the total number of negative charges (from the number and valence of DNA molecules). The nominal charge of +5e was assumed for MVL5, although experimental data at near-physiological conditions indicate that the average charge is closer to +4.5e [33] . The resulting mixtures were promptly vortexed for 30 s and left at least 30 min under stirring conditions. The formed complexes were stored at 4 • C. The sizes and zeta potential of the liposome solutions were determined with Dynamic Light Scattering (DLS), using an SZ-100 device from Horiba, measuring scattering at a detection angle of 173 • . The autocorrelation (AC) function is fitted using the cumulants method, which provides the diffusion coefficient of the particles and respective polydispersity index (PDI) [60] . In some cases, samples showed AC curves evidencing two size populations. In such cases, the AC curves were fitted with a biexponential decay model, providing the diffusion coefficient of both populations. The particle size (hydrodynamic diameter) is then obtained through the Stokes-Einstein relation. Each sample was measured for three runs of 60 s.

The stability of the MVL5-based lipoplexes was assessed by DLS measurements of the hydrodynamic diameter of the multivalent CL-DNA complexes incubated with cellcultured medium (DMEM) at 37 • C for 24 h. Formulations marked with "*" were fitted with a biex nential decay model.

For lipoplex formation, equal volumes of liposomes and DNA solutions were mi to the desired concentration. Lipoplexes were prepared with a cationic-to-anionic CR ( of 3 and 10. The CR (+/−) is calculated as the total number of positive charges (from number and valence of DOTAP or MVL5 molecules) divided by the total number of n ative charges (from the number and valence of DNA molecules). The nominal charge +5e was assumed for MVL5, although experimental data at near-physiological conditi indicate that the average charge is closer to +4.5e [33] . The resulting mixtures w promptly vortexed for 30 s and left at least 30 min under stirring conditions. The form complexes were stored at 4 °C. The sizes and zeta potential of the liposome solutions w determined with Dynamic Light Scattering (DLS), using an SZ-100 device from Hor measuring scattering at a detection angle of 173°. The autocorrelation (AC) function fitted using the cumulants method, which provides the diffusion coefficient of the pa cles and respective polydispersity index (PDI) [60] . In some cases, samples showed curves evidencing two size populations. In such cases, the AC curves were fitted wit biexponential decay model, providing the diffusion coefficient of both populations. T 

The human embryonic kidney (HEK) 293T (ATCC CRL-3216) cell line and HEK 293T cell line with stable GFP expression were cultured in Dulbecco's minimal essential medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin-streptomycin. Cells were grown in polystyrene tissue culture flasks in a humidified atmosphere of 5% CO 2 and 37 • C and subcultured using 0.25% Trypsin-EDTA solution. Mycoplasma testing by PCR was carried out routinely using Venor™ GeM Mycoplasma Detection Kit.

HEK293T stably expressing GFP (HEK293T-GFP) cell line was generated by transduction with F-Luc-GFP lentivirus in which GFP was expressed under the puromycin resistance marker. The infection was carried out at a multiplicity of infection (MOI) of 10 in a complete medium supplemented with 5 µg/mL of Polybrene. Stably transduced cells were selected by adding 2 µg/mL of Puromycin, and the selection was conducted for 14 days. 

To evaluate in vitro transfection, HEK 293T cells were transfected with the pSpCas9(BB)-2A-GFP (PX458) plasmid, which contains both Cas9/sgRNA and GFP expression cassettes. Cells were plated at a density of 2 × 10 5 cells/well in a 6-well plate and grown to approximately 60-70% confluency before transfection. All CL-DNA complexes, containing 1 or 2 µg of PX458, were diluted to a final volume of 1 mL in DMEM medium (in absence of serum) and transferred onto cells. Then, 4 h post-transfection, the complexes were removed, and the medium was replaced by a complete DMEM medium for an additional 48 h of incubation. Lipofectamine ® 3000-DNA complexes were used as a positive control according to the manufacturer's instructions. GFP gene expression was measured on an EC800 Flow Cytometry Analyzer (Sony Biotechnology Inc., San Jose, CA, USA) by counting at least 20,000 events. Analysis of data was performed on the FlowJo 10.8.0 software to calculate the percentage of GFP-positive cells. In addition to flow cytometry, GFP-expressing cells were also visualized by fluorescence microscopy. For this, cells transfected beforehand were fixed with 4% paraformaldehyde for 40 min at room temperature, followed by counterstaining with DAPI for 15 min at room temperature. Cells were observed in a fluorescence microscope [OLYMPUS BX51] incorporated with a high-sensitivity camera Olympus DP71 at 10× magnification. Images were analyzed by ImageJ (Version 1.51q, National Insitutes of Health, Bethesda, MD, USA).

The colorimetric MTT assay was used to evaluate the effect of CL-DNA complexes incorporating Cas9/sgRNA plasmid on cell viability. Then, 1 × 10 4 HEK 293T cells were plated on 96-well culture plates and incubated overnight. Then, cells were incubated with CL-DNA complexes containing 0.1 µg DNA per well for 4 h. After incubation, the CL-DNA complex solution was replaced by DMEM complete medium. Cell viability was measured after 48 h by adding to each well 0.5 mg/mL of MTT and incubating for 4 h at 37 • C. The blue formazan crystals formed by viable cells were dissolved in DMSO, and their optical density was assessed at a wavelength of 570 nm in a microplate reader (Cytation 3, BioTek, Winooski, VT, USA).

To observe cellular uptake and intracellular distribution of cationic liposomes incorporating CRISPR/Cas9 DNA plasmids, monovalent and multivalent cationic liposomes at CR (+/−) 3 were prepared using Texas-Red-labelled liposomes, as described above. The CL-DNA complexes were formulated with CRISPR/DNA plasmid (PX458) and added to HEK 293T cells previously seeded on coverslips in a 24-well plate (5 × 10 4 cells/well) at a final concentration of 2 µg/mL of DNA. The transfected cells were incubated for 4 h at 37 • C, and then 1 µM of LysoSensor Green DND-189 was added to each sample to label lysosomes and sustained for 30 min at 37 • C. Next, the medium was removed, and the coverslips were observed using a 60× and 100× oil immersion objective in a fluorescence microscope [OLYMPUS BX51] incorporated with a high-sensitivity camera Olympus DP71. Images were analyzed by ImageJ software.

A single-guide RNA (sgRNA) was selected to target GFP sequence (sgRNA-GFP: GGGCACGGGCAGCTTGCCGG). The sgRNA was inserted into the BbSI sites of pSpCas9(BB)-2A-Puro (PX459) plasmid. The multivalent CL-DNA complexes were formed incorporating 2 µg of PX459-sgRNA-GFP (Figure 1b) , and then transferred onto HEK 293T-GFP cells, seeded beforehand on a 6-well plate at 2 × 10 5 cells/well. Cells were exposed to CL-DNA complexes for 4 h in a free-serum medium, and then the CL-DNA complex solution was replaced by DMEM complete medium. The unmodified PX459 plasmid was used as a negative control, and Lipofectamine ® 3000-DNA complexes were used as a positive control in GFP gene disruption. GFP knockout was assessed 72 h after transfection by the percentage of GFP-negative cells, evaluated using EC800 Flow Cytometry Analyzer (Sony Biotechnology Inc., San Jose, CA, USA). A total of 15,000 events were counted.

Data were expressed as mean ± standard deviation (SD) of at least two independent experiments. One-way ANOVA with Dunnett's multiple comparisons test and two-way ANOVA with Sidak's multiple comparisons test were performed using GraphPad Prism 8.3.0 (GraphPad Software, Inc., San Diego, CA, USA) to identify differences among multiple groups, considering a significance level of 95%. (Table S1 ).

The zeta potential of the CL-DNA complexes was also assessed. Both DOTAP and MVL5-based lipoplex formulations are positively charged (Figure 2d The stability of the multivalent lipoplexes was evaluated by incubating these with a cell culture medium (DMEM) at 37 • C. Figure 3f shows the hydrodynamic diameter of the CL-DNA complexes prior to the medium addition (T0 no medium) and after the dilution in DMEM at three time points (0, 4, and 24 h). The hydrodynamic diameter of the DOPC and GMO complexes showed a small increase in size immediately after the medium change, and a moderate increase during the following 24 h. This indicates suitable colloidal stability of these CRISPR delivery systems. In contrast, the MVL5/DOPE formulations increased their size to more than twice already at T0 and continued to increase over time until strong aggregation was observed, making it not possible to measure their size at the 24 h time point.

To evaluate the in vitro transfection, HEK 293T cells were exposed for 4 h to monovalent or multivalent CL-DNA complexes encapsulating the Cas9/sgRNA-GFP plasmid (PX458). This plasmid design facilitates the detection of positively transfected cells through the expression of GFP (Figure 1a ). The number of GFP-positive cells was determined after 48 h of incubation by flow cytometry. Lipofectamine 3000, the most potent commercially available in vitro transfection reagent, was chosen as the positive control. Figure 3a shows the percentage of GFP-expressing cells after treatment with monovalent lipoplexes with CR (+/−) fixed at three and different cationic to neutral lipid ratios (30:70 and 80:20) . This CR (+/−) of three was found to be optimal for transfection of mouse L-cells with monova- [61] . However, HEK 293T cells treated with DOTAP-based lipoplexes at a final DNA concentration of 2 µg/mL showed a very low percentage of GFP-positive cells in comparison to the commercial transfection reagent (p < 0.0001). Even though HEK 293T cells are not particularly easy to transfect with monovalent cationic lipoplexes, we were expecting a measurable improvement with the 80:20 lipoplexes, as evidenced by transfection with luciferase reporter genes [62] . This lack of improvement suggests that the larger size of the Cas9 plasmid, which is almost twice the size of the luciferase reporter genes, makes it harder to transfect cells efficiently, and demonstrates that these formulations are not able to improve gene delivery for CRISPR/Cas9-based applications.

based formulations exhibiting larger zeta potential values. The DOTAP/DOPC mixtures exhibited the highest potential, corresponding to 82 ± 6 mV and 81 ± 3 mV for the molar ratio of 30:70 and 80:20, respectively. Regarding the MVL5-based lipoplexes, all formulations showed similar values of potential (around 40-50 mV), except for the 75:25 MVL5:DOPE mixture, which displayed the lowest value (26.5 ± 9.1 mV).

The stability of the multivalent lipoplexes was evaluated by incubating these with a cell culture medium (DMEM) at 37 °C. Figure 3f shows the hydrodynamic diameter of the CL-DNA complexes prior to the medium addition (T0 no medium) and after the dilution in DMEM at three time points (0, 4, and 24 h). The hydrodynamic diameter of the DOPC and GMO complexes showed a small increase in size immediately after the medium change, and a moderate increase during the following 24 h. This indicates suitable colloidal stability of these CRISPR delivery systems. In contrast, the MVL5/DOPE formulations increased their size to more than twice already at T0 and continued to increase over time until strong aggregation was observed, making it not possible to measure their size at the 24 h time point. . Two-way ANOVA indicates statistically significant differences within the group assessed by Sidak's multiple comparisons test and denoted as follows: **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.1, and ns p > 0.05.

In stark contrast, the MVL5-based lipoplexes (Figure 3b ,c and Figure S1 ) showed meaningful levels of transfection for all the tested formulations, reaching values such as those with lipofectamine in some cases. This may be caused by the significantly higher lipid membrane charge density of the multivalent complexes, which has been suggested to facilitate the escape of the lipoplexes to the cytosol through the fusion of the lipid and endosomal membranes [32] .

Interestingly, the increase of DNA concentration from 1 to 2 µg/mL produced a strong increase in the TE, especially at CR (+/−) of 3. Increasing the CR (+/−) from 3 to 10 also improved the TE, but this effect was much more visible for the 1 µg/mL CL-DNA complexes. For the 2 µg/mL CL-DNA solutions, the increase in CR (+/−) produced a milder improvement in the TE. The milder improvement at CR (+/−) 10 may be the result of a much higher concentration of cationic lipid in the cells, which may, in turn, result in some additional cytotoxicity that hampers the TE, as discussed below.

Regarding the type of neutral lipid used, the MVL5-based formulations exhibited similar transfection efficiencies under the same conditions, which may be an indication that the interactions of these complexes with cells, and ensuing TE, are dominated by the strong charge emanating from the multivalent cationic lipids, and that the type of neutral lipid, whereas it is more fusogenic or not, plays a weaker role. This is not entirely surprising, since these lipoplex compositions are expected to have similar internal structures of the multilamellar type, hence, favoring similar mechanisms of interaction with cells.

In addition to the flow cytometry results, transfection by MVL5 lipoplexes at 2 µg/mL DNA was also analyzed by fluorescence microscopy imaging (Figure 3d ). Such results show bright green fluorescence signals resulting from GFP-expressing cells, being more evident for CR (+/−) 10 lipoplexes and corroborating the flow cytometry results. Both flow cytometry and fluorescence microscopy data demonstrate that multivalent CL-DNA complexes at CR (+/−) 10 are effective vectors for plasmid-based CRISPR/Cas9 systems in vitro, encouraging further investigation in its potential translation for in vivo applications.

While the two-component lipid formulations based on DOTAP were shown to have a poor performance, recent studies have successfully demonstrated the delivery of CRISPR/Cas9 systems using more complex DOTAP-based lipoplexes [63] [64] [65] . For instance, Hosseini et al. [64] showed that the DOTAP/DOPE/Chol-Polyethylene Glycol system can successfully transfect the Cas9/sgRNA plasmid into HEK 293 cells stably expressing GFP, leading to a GFP gene knockout of 39%. This achievement may be partly explained by the incorporation of cholesterol, which is known to improve the TE in monovalent CL-DNA complexes [66] and some studies have demonstrated its important role in intracellular trafficking [67] [68] [69] . In the present work, we showed that replacing DOTAP with MVL5 in simple two-lipid formulations leads to a pronounced improvement in the transfection of Cas9/sgRNA plasmids. By further optimization of the multivalent cationic lipid formulations, i.e., by adjusting the DNA concentration and CR (+/−), as well as incorporating additional lipids such as cholesterol, these formulations may become highly efficient and compete with viral-delivery methods.

The evaluation of cell viability impact is particularly relevant for the development of safe and effective gene delivery systems because cytotoxicity influences the transfection rate efficiency. Cytotoxicity of CL-DNA complexes was assessed using the standard colorimetric MTT assay. HEK 293T cells were transfected by CL-DNA complexes for 48 h, and untreated cells were used as a positive control and normalized to 100% cell viability. According to ISO 10993-5, no cytotoxic effect is considered in cell viability for values greater than 70%. As shown in Figure 3e , monovalent CL-DNA complexes at CR (+/−) 3 demonstrated biosafety, except for 80:20 and 30:70 DOTAP/GMO formulations, which exhibited a survival rate of 67.9 ± 6.6% and 48.1 ± 4.5%, respectively. Regarding the complexes at CR (+/−) of 10, there was a significant decrease of cell viability for nearly all the formulations compared to those at lower CR (+/−) after 48 h of transfection. The 80:20 DOTAP/DOPC and 30:70 DOTAP/DOPE formulations exhibited the most significant increase in toxicity (p < 0.0001), followed by 80:20 DOTAP/DOPE (p < 0.001) and 80:20 DOTAP/GMO (p < 0.01).

Concerning multivalent CL-DNA complexes (Figure 3f) , the same trend was observed. All multivalent CL-DNA complexes at CR (+/−) 3 were demonstrated to be safe enough for gene delivery since no obvious cytotoxic impact was observed on HEK 293T transfected cells. The average cell viability of CR (+/−) 3 formulations (86%) was significantly superior to those prepared at CR (+/−) 10 (57%). Moreover, both monovalent and multivalent cationic systems at CR (+/−) 3 exhibited less cytotoxicity than the commercial transfection reagent Lipofectamine 3000. These results suggest that the CR (+/−) influences the viability of the transfected cells. This is not surprising since for a fixed DNA concentration, increasing the CR (+/−) results in an increase in the lipid concentration used, and therefore, in an increase in cytotoxicity.

Overall, the observed interdependence between the DNA concentration and CR (+/−) on the TE (Figure 3b ,c) suggests that by careful tuning of these two parameters, the TE and cytotoxicity can be adjusted to an effective and safe CRISPR/Cas9 delivery system.

To understand the TE differences exhibited by monovalent and multivalent CL-DNA complexes, cellular uptake and intracellular distribution studies of these lipoplexes were performed. The TE of lipoplexes greatly depends on their ability to overcome intracellular barriers to deliver exogenous DNA into the cell nucleus of the host cell and enable its expression. The cellular uptake mechanism and trafficking to lysosomes are critical for efficient delivery since the rearrangement of lipoplexes structure during those stages influences the DNA escape process and release into the cytoplasm [70] . Therefore, colocalization analysis of fluorescence signals from labeled lipoplexes (red, Texas-Red-DHPE) and lysosomes (green, LysoSensor Green DND-189) was performed to evaluate the intracellular fate of lipoplexes. Despite both monovalent and multivalent lipoplexes being uptaken by HEK 293T cells, DOTAP-based lipoplexes were predominantly found in the lysosomes originating a yellowish signal derived from the colocalization of lipoplexes and lysosomes ( Figure 4 ). This observation suggests that DOTAP-based lipoplexes have a poor endosomal release capacity in HEK 293T cells, eventually undergoing lysosomal degradation, which results in low TE. In contrast, the absence of colocalization of the MVL5-based lipoplexes with LysoSensor suggests that these formulations can elude metabolic degradation and escape from lysosomal entrapment. This remark might explain the superior TE of MVL5based lipoplexes over monovalent lipoplexes, highlighting the potential of MVL5 to boost the TE of lipid-DNA complexes. Interestingly, no differences were obvious between using DOPC or GMO as the helper lipid, which as pointed out above, hints that fusion of the lipoplex membranes with the endosomes and subsequent endosomal escape is dominated by the high membrane charge density imposed by MVL5.

To evaluate the potential of MVL5-lipoplexes to deliver Cas9/sgRNA plasmids and induce gene disruption in vitro, HEK 293T-GFP cells were used, and a plasmid encoding the Cas9 protein and sgRNA targeting the GFP gene (PX459-sgRNA-GFP) was designed (Figure 1b) . The GFP gene disruption efficiency was quantitatively determined with flow cytometry by measuring the decrease in the number of green fluorescence positive cells. The PX459 empty vector was used as a negative control to assess any non-specific effect of the vector/backbone itself on GFP gene expression in HEK293T-GFP cells. The loss of GFP signal resulting from the PX459-sgRNA-GFP and PX459 plasmid transfection are plotted as total knockout (K T ) and non-specific gene knockout (K NS ), respectively (Figures 5 and S2 ).

based lipoplexes with LysoSensor suggests that these formulations can elude metabolic degradation and escape from lysosomal entrapment. This remark might explain the superior TE of MVL5-based lipoplexes over monovalent lipoplexes, highlighting the potential of MVL5 to boost the TE of lipid-DNA complexes. Interestingly, no differences were obvious between using DOPC or GMO as the helper lipid, which as pointed out above, hints that fusion of the lipoplex membranes with the endosomes and subsequent endosomal escape is dominated by the high membrane charge density imposed by MVL5. 

To evaluate the potential of MVL5-lipoplexes to deliver Cas9/sgRNA plasmids and induce gene disruption in vitro, HEK 293T-GFP cells were used, and a plasmid encoding the Cas9 protein and sgRNA targeting the GFP gene (PX459-sgRNA-GFP) was designed ( Figure 1b) . The GFP gene disruption efficiency was quantitatively determined with flow cytometry by measuring the decrease in the number of green fluorescence positive cells. The PX459 empty vector was used as a negative control to assess any non-specific effect of the vector/backbone itself on GFP gene expression in HEK293T-GFP cells. The loss of GFP signal resulting from the PX459-sgRNA-GFP and PX459 plasmid transfection are plotted as total knockout (KT) and non-specific gene knockout (KNS), respectively ( Figures  5 and S2 ). As shown in Figure 5a , for CR (+/−) of 3, the K T of MVL5 lipoplexes is relatively low when compared to that of lipofectamine, but it increases substantially when the CR (+/−) is increased to 10 (Figure 5b) . However, the non-specific gene knockout (K NS ) is also more pronounced in those formulations. These expressive values of K NS could be explained by the toxic effects caused by these formulations at CR (+/−) 10, which are particularly high for the MVL5/DOPE 75:25 and MVL5/GMO 50:50 as previously demonstrated (Figure 3f ). The discrepancy between transfection and knockout results from MVL5-based complexes when compared to lipofectamine could be associated with the higher toxicity observed for the former, that is, cells incubated with MVL5-lipoplexes are still able to express Cas9, but the subsequent gene knockout processes are hampered by the formulations cytotoxicity. Yet, all MVL5-based formulations at CR (+/−) 10 show a total K T superior to 35%.

GFP expression was also observed by fluorescence microscopy (Figure 5c ). Analyzing the images, it is possible to observe that the GFP signal is weaker in cells transfected with Lipofectamine 3000 in comparison to MVL5-based lipoplexes, which is in agreement with the flow cytometry results.

Overall, these results show that MVL5-based lipoplexes enabled the delivery of Cas9/sgRNA plasmids to human epithelial kidney cells and mediated GFP knockout via the CRISPR/Cas9 system at levels comparable with the commercial transfection reagent Lipofectamine 3000 ® . The knockout efficiency was especially high for CR (+/−) 10, although cytotoxicity from the formulations was also significant and may have contributed to a significant level of non-specific gene silencing. Nevertheless, these MVL5-based formulations can still be optimized by further adjusting the CR (+/−) and DNA concentration, which can lead to a better cytotoxic profile while keeping a suitable TE and gene knockout efficiency. They can also be modified to include additional lipids (e.g., cholesterol) or surface modifications (e.g., PEGylation and targeting ligands) to improve transfection and knockout efficiencies in vitro and in vivo even further, which is difficult to achieve with the available commercial transfection reagents.

In this work, we investigated the suitability of simple multivalent cationic-DNA complexes to deliver a Cas9/sgRNA expressing plasmid for genome editing. The liposomes used are composed of two lipids, one cationic and one helper lipid. Whereas all the monovalent DOTAP-based formulations resulted in extremely inefficient transfection, MVL5-based formulations exhibited both high transfection efficiency as well as gene knockout ability for all the helper lipids used. In addition, MVL5-based lipoplexes were also found to have lower colocalization with lysosomes, which suggests enhanced endosomal release when compared with DOTAP formulations. Overall, this suggests that the higher membrane charge density imposed by MVL5 is the main factor contributing to fusion with the endosomal membrane and consequent enhancement of transfection efficiency. Despite the transfection efficiency rates being comparable to lipofectamine 3000 ® commercial reagent, the GFP gene knockout was demonstrated to be slightly inferior. One drawback is that the MVL5-based formulations also showed considerable non-specific gene knockout, probably resulting from their higher cytotoxicity. Nevertheless, the versatility of these formulations provides significant opportunities for further optimization, either by tuning the cationic-to-anionic CR (+/−) to lower cytotoxicity or by including additional lipids or surface functionalization, which is important for in vivo applications. These results show that multivalent lipid-based lipoplexes are promising CRISPR/Cas9 plasmid delivery systems, and by further optimization and functionalization may constitute an alternative to viral-delivery methods and to ionizable lipid mRNA-based delivery lipid nanoparticles.

Supplementary Materials: The following supporting information can be downloaded at: https:// www.mdpi.com/article/10.3390/pharmaceutics14051087/s1, Table S1 : Biophysical characterization of monovalent (DOTAP) and multivalent (MVL5) lipoplexes; Figure S1 : Flow cytometry of HEK293T cells transfected with the Cas9/sgRNA-GFP plasmid (PX458); Figure S2 : Flow cytometry histograms illustrating the GFP signal in HEK 293T-GFP cells. 

The authors declare no conflict of interest. 

RNA-Guided Human Genome Engineering via Cas9

Development and Applications of CRISPR-Cas9 for Genome Engineering

The New Frontier of Genome Engineering with CRISPR-Cas9

CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes

CRISPR-Cas9: A Preclinical and Clinical Perspective for the Treatment of Human Diseases

Delivering CRISPR: A Review of the Challenges and Approaches

Therapeutic Genome Editing of Triple-Negative Breast Tumors Using a Noncationic and Deformable Nanolipogel

A Single Administration of CRISPR/Cas9 Lipid Nanoparticles Achieves Robust and Persistent In Vivo Genome Editing

Lipid Nanoparticle-Mediated Codelivery of Cas9 MRNA and Single-Guide RNA Achieves Liver-Specific in Vivo Genome Editing of Angptl3

Non-Viral Strategies for Delivering Genome Editing Enzymes

Engineered Viruses as Genome Editing Devices

Engineering the Delivery System for CRISPR-Based Genome Editing

CRISPR/Cas9-Based Genome Editing for Disease Modeling and Therapy: Challenges and Opportunities for Nonviral Delivery

Lipid Nanoparticle-Mediated Efficient Delivery of CRISPR/Cas9 for Tumor Therapy

Co-Encapsulation of Cas9 MRNA and Guide RNA in Polyplex Micelles Enables Genome Editing in Mouse Brain

Lipofection: A Highly Efficient, Lipid-Mediated DNA-Transfection Procedure

Cationic Liposome-Nucleic Acid Complexes for Gene Delivery and Gene Silencing

Non-Viral Vectors for Gene-Based Therapy

Delivery of Oligonucleotides with Lipid Nanoparticles

Self-Organization of Nucleic Acids in Lipid Constructs

The Onpattro Story and the Clinical Translation of Nanomedicines Containing Nucleic Acid-Based Drugs

Lipid-Based DNA Therapeutics: Hallmarks of Non-Viral Gene Delivery

Lipid-Nucleic Acid Complexes: Physicochemical Aspects and Prospects for Cancer Treatment

Cationic Liposomes as Vectors for Nucleic Acid and Hydrophobic Drug Therapeutics

A Review of the Tortuous Path of Nonviral Gene Delivery and Recent Progress

Microfluidic Formulation of Dna-Loaded Multicomponent Lipid Nanoparticles for Gene Delivery

Gemini Cationic Lipid-Type Nanovectors Suitable for the Transfection of Therapeutic Plasmid Dna Encoding for pro-Inflammatory Cytokine Interleukin-12

Cationic Single-Chained Surfactants with a Functional Group at the End of the Hydrophobic Tail Dna Compacting Efficiency

PEGylated Cationic Liposome-DNA Complexation in Brine Is Pathway-Dependent

Fluorescence Cross-Correlation Spectroscopy as a Valuable Tool to Characterize Cationic Liposome-DNA Nanoparticle Assembly

Three-Dimensional Imaging of Lipid Gene-Carriers: Membrane Charge Density Controls Universal Transfection Behavior in Lamellar Cationic Liposome-DNA Complexes

New Multivalent Cationic Lipids Reveal Bell Curve for Transfection Efficiency versus Membrane Charge Density: Lipid-DNA Complexes for Gene Delivery

Surface Functionalized Cationic Lipid-DNA Complexes for Gene Delivery: PEGylated Lamellar Complexes Exhibit Distinct DNA-DNA Interaction Regimes

Diffusible-PEG-Lipid Stabilized Plasmid Lipid Particles

Structural Evolution of Environmentally Responsive Cationic Liposome-DNA Complexes with a Reducible Lipid Linker

Endosomal Escape and Transfection Efficiency of PEGylated Cationic Liposome-DNA Complexes Prepared with an Acid-Labile PEG-Lipid

Design of Multifunctional Non-Viral Gene Vectors to Overcome Physiological Barriers: Dilemmas and Strategies

Uptake and Transfection Efficiency of PEGylated Cationic Liposome-DNA Complexes with and without RGD-Tagging

Cancer Nanotechnology: The Impact of Passive and Active Targeting in the Era of Modern Cancer Biology

Microfluidic Self-Assembly of Folate-Targeted Monomolecular SiRNA-Lipid Nanoparticles

Lipid Nanoparticles for Cell-Specific in Vivo Targeted Delivery of Nucleic Acids

Rational Design of Cationic Lipids for SiRNA Delivery

Successful Reprogramming of Cellular Protein Production through MRNA Delivered by Functionalized Lipid Nanoparticles

Safety and Efficacy of the BNT162b2 MRNA Covid-19 Vaccine

Efficacy and Safety of the MRNA-1273 SARS-CoV-2 Vaccine

CRISPR-Cas9 In Vivo Gene Editing for Transthyretin Amyloidosis

Plasmid DNA Size Does Not Affect the Physicochemical Properties of Lipoplexes but Modulates Gene Transfer Efficiency

Plasmid DNA Size Does Affect Nonviral Gene Delivery Efficiency in Stem Cells

Successful Delivery of Large-Size CRISPR/Cas9 Vectors in Hard-to-Transfect Human Cells Using Small Plasmids

Formation of Stable Cationic Lipid/DNA Complexes for Gene Transfer

Structure and Gene Silencing Activities of Monovalent and Pentavalent Cationic Lipid Vectors Complexed with SiRNA

Optimizing Cationic and Neutral Lipids for Efficient Gene Delivery at High Serum Content

Synthesis and Use of an Amphiphilic Dendrimer for SiRNA Delivery into Primary Immune Cells

Efficient Synthesis and Cell-Transfection Properties of a New Multivalent Cationic Lipid for Nonviral Gene Delivery

An Inverted Hexagonal Phase of Cationic Liposome-DNA Complexes Related to DNA Release and Delivery

Nanogyroids Incorporating Multivalent Lipids: Enhanced Membrane Charge Density and Pore Forming Ability for Gene Silencing

Structural Dynamics and Physicochemical Properties of PDNA/DODAB:MO Lipoplexes: Effect of PH and Anionic Lipids in Inverted Non-Lamellar Phases versus Lamellar Phases

Genome Engineering Using the CRISPR-Cas9 System

Making Sense of Brownian Motion: Colloid Characterization by Dynamic Light Scattering

Activation of Host Antitumoral Responses by Cationic Lipid/DNA Complexes

A Columnar Phase of Dendritic Lipid−Based Cationic Liposome−DNA Complexes for Gene Delivery: Hexagonally Ordered Cylindrical Micelles Embedded in a DNA Honeycomb Lattice

In Vivo Genome Editing of Mucopolysaccharidosis I Mice Using the CRISPR/Cas9 System

Cholesterol-Rich Lipid-Mediated Nanoparticles Boost of Transfection Efficiency, Utilized for Gene Editing by CRISPR-Cas9

Human Papillomavirus Oncogene Manipulation Using Clustered Regularly Interspersed Short Palindromic Repeats/Cas9 Delivered by PH-Sensitive Cationic Liposomes

The Role of Cholesterol and Structurally Related Molecules in Enhancing Transfection of Cationic Liposome−DNA Complexes

Lipoplex-Mediated Transfection of Mammalian Cells Occurs through the Cholesterol-Dependent Clathrin-Mediated Pathway of Endocytosis

Transfection Efficiency Boost of Cholesterol-Containing Lipoplexes

Cholesterol-Dependent Macropinocytosis and Endosomal Escape Control the Transfection Efficiency of Lipoplexes in CHO Living Cells

Formation and Intracellular Trafficking of Lipoplexes and Polyplexes