key: cord-0017919-2lgfr2xe
authors: Qin, Ming; Chen, Wei; Li, Zhixin; Wang, Lixue; Ma, Lixia; Geng, Jinhong; Zhang, Yu; Zhao, Jing; Zeng, Yongqing
title: Role of IFNLR1 gene in PRRSV infection of PAM cells
date: 2021-05-10
journal: J Vet Sci
DOI: 10.4142/jvs.2021.22.e39
sha: c85cd7151536a725bfe9ea58b17e6f38bcc36f04
doc_id: 17919
cord_uid: 2lgfr2xe

BACKGROUND: Interferon lambda receptor 1 (IFNLR1) is a type II cytokine receptor that clings to interleukins IL-28A, IL29B, and IL-29 referred to as type III IFNs (IFN-λs). IFN-λs act through the JAK-STAT signaling pathway to exert antiviral effects related to preventing and curing an infection. Although the immune function of IFN-λs in virus invasion has been described, the molecular mechanism of IFNLR1 in that process is unclear. OBJECTIVES: The purpose of this study was to elucidate the role of IFNLR1 in the pathogenesis and treatment of porcine reproductive and respiratory syndrome virus (PRRSV). METHODS: The effects of IFNLR1 on the proliferation of porcine alveolar macrophages (PAMs) during PRRSV infection were investigated using interference and overexpression methods. RESULTS: In this study, the expressions of the IFNLR1 gene in the liver, large intestine, small intestine, kidney, and lung tissues of Dapulian pigs were significantly higher than those in Landrace pigs. It was determined that porcine IFNLR1 overexpression suppresses PRRSV replication. The qRT-PCR results revealed that overexpression of IFNLR1 upregulated antiviral and IFN-stimulated genes. IFNLR1 overexpression inhibits the proliferation of PAMs and upregulation of p-STAT1. By contrast, knockdown of IFNLR1 expression promotes PAMs proliferation. The G0/G1 phase proportion in IFNLR1-overexpressing cells increased, and the opposite change was observed in IFNLR1-underexpressing cells. After inhibition of the JAK/STAT signaling pathway, the G2/M phase proportion in the IFNLR1-overexpressing cells showed a significant increasing trend. In conclusion, overexpression of IFNLR1 induces activation of the JAK/STAT pathway, thereby inhibiting the proliferation of PAMs infected with PRRSV. CONCLUSION: Expression of the IFNLR1 gene has an important regulatory role in PRRSV-infected PAMs, indicating it has potential as a molecular target in developing a new strategy for the treatment of PRRSV.

Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped positivestranded RNA virus within the family Arteriviridae, order Nidovirales [1] . The latest classification of the International Committee on Taxonomy of Viruses (ICTV) indicates that PRRSV is a porcine arterivirus (Porartevirus; https://talk.ictvonline.org/ictv-reports/ ictv_online_report/). Pigs of different ages, breeds, and genders can be infected with PRRSV, with pregnant sows and piglets less than one month being the most susceptible. Porcine reproductive and respiratory syndrome (PRRS) is characterized by sow miscarriages, piglet dyspnea, and high mortality. Since the PRRSV was detected in wild boars in Europe and North America in 1987, it has resulted in substantial economic losses to the global pig industry [2] . Previous studies have shown that the persistence of the PRRSV within swine herds is often related to the recurrence of secondary infections [3, 4] . PRRSV infection can elicit poor innate interferon and cytokine responses [5, 6] . Therefore, PRRSV has been speculated to have immunosuppressive effects in pigs. In previous study, a large number of positive selection genes were identified in Dapulian pigs by performing specific-locus amplified fragment sequencing (SLAF) analysis. These genes are under positive selection pressure to adapt to environmental changes during species evolution [7] . Historically, Dapulian pigs are known for their resistance and immune properties [8] . The interferon lambda receptor 1 (IFNLR1) gene is one such positive selection gene and may have an important role in the disease resistance and adaptability of Dapulian pigs. The encoded protein product of this gene is a member of the type II cytokine receptor family [9] . Interferon (IFN)-λ identifies and combines with the dimer receptor complex formed by the IFNLR1 and IL10Rβ chains, subsequently activating the Janus kinase (JAK)-signal transducer and activator of transcription (STAT), phosphorylated (p)-protein kinase B, and mitogenactivated protein kinase/extracellular signal-regulated kinases signaling pathways, which exert antiviral and growth-suppressive activity in vitro and in vivo [10] [11] [12] . After IFN secretion activates the downstream signaling pathways, a variety of IFN-stimulated genes (ISGs) are transcribed to initiate the host defense response to the virus.

Interferon is an inducible protein. Normal cells generally do not produce interferon spontaneously, only having the potential to synthesize interferon, and the interferon gene is in a suppressed quiescent state. IFN-λs are usually induced in virus-infected cells but, like IFN-α and IFN-β, can also be induced by other mechanisms. IFN-λ is considered an epithelial cytokine, which is mainly expressed in antigen-presenting cells. Since the IFNLR1 gene is most abundantly expressed in epithelial-derived cells, this determines the tropism of the IFN-λ responses [13] . For example, PRRSV induces IFN-λ1 and IFN-λ3 expression at the mRNA level after the infection of porcine alveolar macrophages (PAMs) [14] . Recently, additional research has indicated that IFNLR1 is also widely expressed in immune cells. In viral infection or acute inflammation, IFN-λ can directly or indirectly act on immune cells to exert immunoregulatory functions [15] . Neutrophils can express IFNLR1 in mice infected with the influenza virus [16] . Over the past few years, IFNLR1 has been broadly investigated for its mutations associated with various diseases in humans [17, 18] . It has been reported that West Nile virus (WNV) infection in vivo in the brain and spinal cord of IFNLR1(-/-) mice can replicate and spread quickly [19] . Although IFNLR1 is involved in biological activities induced by IFN-λs, including antiviral, antitumor, and immune regulation, research on these activities is still needed.

The anti-cell proliferation activity of IFN-λs varies greatly among different cell lines, and it has a close relationship with the expression of its IFNLR1 receptor. Cell proliferation is not only a cell life activity, but also is a necessary process for cell maintenance and for compensating for cell damage. Completion of this process is mainly accomplished by regulating the cell cycle. The cell cycle can be split into four phases: G1, S, G2, and mitosis (M), and cells that are no longer cycling are said to be quiescent or in phase G0. Mammalian cells regulate cell growth, genome replication, and cell division, all of which occur during the cell cycle [20] . The two gap phases, G1 and G2, are separated by the S phase, during which DNA is replicated and are followed by mitosis, in which the DNA is divided between two new nuclei. After mitosis, the cell itself divides and each daughter cell repeats the cycle being at G1 or exits the cell cycle at G0. Under normal circumstances, the initiation and orderly progress of the cell cycle requires strict regulation by various regulatory factors. Cell-cycle proteins (cyclins), cyclin-dependent kinases (CDKs), and cyclin-dependent kinase inhibitors (CKIs) are the three main cell-cycle regulatory molecules. In addition, cell-cycle checkpoints are important in determining the transition of cells from one phase to the next [21] . So far, the effect of IFNLR1 on the cell cycle and its corresponding molecular mechanism have not been reported.

At present, there are few studies on the role of IFNLR1 in resisting PRRSV infection. After the PRRSV enters the pig body, it first invades PAMs, causing severe pneumonia. This study used interference and overexpression methods to analyze the effect of IFNLR1 on PAM proliferation. The purpose of the study was to elucidate the potential role of the IFNLR1 gene in the prevention and treatment of PRRSV.

Twelve two-month-old PRRSV-negative pigs, including six Dapulian pigs and six Landrace pigs, were purchased from the Jining breeding farm in Shandong province, China. All pigs were raised u the same environment and management conditions. After slaughter at the indicated time, tissue samples, including lung, liver, large intestine, spleen, lymph gland, kidney, heart, small intestine, tonsil, and muscle, were immediately frozen in liquid nitrogen and stored at −80°C. All animal care and treatment procedures were approved by the Animal Ethics Committee of Shandong Agricultural University, China and performed following that committee's guidelines and regulations (Approval No.: 2004006).

HP-PRRSV strain TA-12 (GenBank Accession No. HQ416720) was provided by Professor Yihong Xiao of Shandong Agricultural University. The PAMs were preserved in the laboratory.

Total RNA was extracted with TRIzol reagent (TaKaRa, Dalian, China), and cDNA preparation was performed using a PrimeScript First Strand cDNA Synthesis Kit (TaKaRa, Dalian, China) according to the manufacturer's protocol. The mRNA expression of IFNLR1 was detected and analyzed by quantitative real-time PCR (qRT-PCR). HPRT1 was used as an internal control.

After reverse transcription, qRT-PCR was performed on a Roche LightCycler96 machine using a 20 µL system and SYBR Green. The fold change values for changes in expression were obtained by applying the 2 -ΔΔCT method. The primer sequences are listed in Table 1 .

The antibody against p-STAT1 (P42224 rabbit phospho-STAT1[S727] antibody) was purchased from Abcepta Biotech (Suzhou, China). Antibody against STAT1 (bs-9584R rabbit anti-STAT1 antibody) was purchased from Bioss Biotech (Beijing, China). Antibody against β-Actin (AF0003 β-Actin mouse monoclonal antibody) was purchased from Beyotime Biotech (Shanghai, China). Antibody against IFNLR1 (abs120780 rabbit anti-IL-28R polyclonal antibody) was purchased from Absin Biotech (Shanghai, China). The RNA interference fragment was obtained from GenePharma (Shanghai, China). JAK inhibitor I (HY-50856) was purchased from MedChemExpress Biotech (Shanghai, China).

PAMs were cultured in Hyclone1640 culture medium containing 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, and 1% MEM nonessential amino acids solution, under CO 2 in a constant-temperature incubator at 37°C (5% CO 2 and 95% humidity). The medium was changed every day, and cells subcultured every other day.

PAMs were infected and incubated with HP-PRRSV-12 at multiplicity of infection (MOI) levels of 0.05, 0.1, 0.5, and 1.0. Incubated cells were harvested at 0, 6, 24, and 48 h post-infection, and qRT-PCR was performed to detect IFN-λ1, IFN-λ3, and IFNLR1 mRNA expression.

Polymerase chain reaction (PCR) was carried out using IFNLR1 primers (sequences are shown in Table2), and the products were cloned into the pcDNA3.1(+) vector and bidirectionally sequenced. The siRNA was designed according to porcine IFNLR1. The siRNA sequence of IFNLR1 had the same composition as the siRNA of the negative control but had no homology. All interference fragments were synthesized by GenePharma (Shanghai GenePharma Co., Shanghai, China), and the sequences are listed in Table 3 . When PAMs were at 50-70% confluence, 2500 ng pcDNA3.1(+), pcDNA3.1 (+)-IFNLR1 plasmid, SiNC, or 20 mL siRNA were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The results of western blot analysis showed that both the plasmid and interference fragment were successfully transfected. The treated group was infected with HP-PRRSV-12 at MOI = 0.5 for 48 h after transfection. 

Marc-145 cells were seeded into 96-well plates for culture overnight. After plasmid or siRNA transfection, the HP-PRRSV strain was diluted with DMEM 10 times to a series of concentrations, and cells from 10 wells were added to each dilution concentration. When the cells were inoculated with PRRSV for 48h, the number of cells with a cytopathic effect (CPE) was observed under an inverted microscope. Finally, the 50% tissue culture infected dose (TCID50) was determined using the Reed-Muench method.

PAMs were seeded in 96-well plates at a density of 1 × 10 4 cells/well in 100 μL of growth medium. The test grouping and treatment methods are the same as above. Then, 10 μL of Cell Counting Kit 8 (CCK8) reagent (Beyotime Biotech, Beijing, China) were added to each well, and incubation continued for 3 h at 37°C. Finally, an automatic microplate reader (Molecular Devices, Sunnyvale) was used to determine the cell proliferation index at 450 nm, per the manufacturer's instructions.

Protein extracts from cultured cells were prepared and underwent western blot analysis. Protein concentrations were determined using a BCA Protein Assay kit (Tiangen Biotech, Beijing, China). Total protein samples (30 µg) were separated by SDS-PAGE (12%) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Shanghai, China). The membranes were incubated overnight with the indicated antibodies at 4°C. Then the secondary antibody was added, and the membranes incubated for 1.5 h. The membranes were then subjected to ECL reagents to detect immunoreactivities, and β-actin was used as an internal control.

PAMs were cultured in 6-well plates (1 × 10 6 cells/well) with 2 mL of growth medium. The cells were collected by conventional digestion centrifugation and washed with PBS solution before the cell concentration was adjusted to 1 × 10 6 mL -1 . Finally, cells were fixed in 70% ethanol overnight at −20°C before applying the Cell Cycle Analysis Kit (Beyotime Biotech, Beijing, China). Subsequently, the cells were analyzed by performing flow cytometry (BD LSRFortessa Flow Cytometer, BD Biosciences, USA). All data were analyzed by using FlowJo Software v10.0.7. Table 2. The gene-specific primer sequences used for polymerase chain reaction analysis  Gene  Primer sequences  IFNLR1-F0  GGGAGGTGGGAACGGGT  IFNLR1-R0  TCACCTGTGCAGTGTCATCC  IFNLR1-F1  GAACGGGTCCCACCCTG  IFNLR1-R2 AGGTCATAGGACAGGTGGCT Table 3 . The primer sequences for the assessed siRNAs Gene Primer sequences

Si-NC-F UUCUCCGAACGUGUCACGUTT Si-NC-R ACGUGACACGUUCGGAGAATT Si-IFNLR1-F CCAAGCCUACCUGCUUCUUTT Si-IFNRL1-R AAGAAGCAGGUAGGCUUGGTT

The data are expressed as means ± standard deviations (n = 3). Statistical testing was performed using one-way analysis of variance (ANOVA). The means were compared by using Duncan's multiple range test as contained in SAS 9.2 software (SAS Institute Inc., USA). Data were plotted using GraphPad Prism 5 and are presented as mean ± standard deviation values. Statistical significance (p < 0.05) of differences is indicated by the presence of a-d letters within a column; different letters within a column denote a significant difference between means.

In this study, qRT-PCR was used to detect the relative expression level of the IFNLR1 gene in ten tissue types sampled from two-month-old Dapulian and Landrace pigs. The statistical analysis results are shown in Fig. 1A , which show that IFNLR1 was expressed in all tissues of both breeds. Between the two pig breeds, the expressions of the liver, large intestine, small intestine, kidney, and lung tissues were significantly higher in Dapulian pigs than in Landrace pigs (p < 0.05). Furthermore, western blot analysis was used to examine the expression levels of IFNLR1 protein in the lung tissues of Dapulian and Landrace pigs (Fig. 1B) . The results were consistent with the quantitative results, indicating the accuracy of the fluorescence-based quantitative results.

To investigate whether the expression of type III IFNs was affected by PRRSV inoculation, we utilized a PAM cell line shown to be infected by PRRSV. When PAMs were infected with PRRSV, the IFN-λ1 and IFN-λ3 mRNAs were upregulated, peaking at 48 h after inoculation, as shown by the qRT-PCR results ( Fig. 2A and B 

The mRNA expression of IFNLR1 was changed in PAMs after transfection by pcDNA3.1(+), pcDNA3.1(+)-IFNLR1, si-NC, and si-IFNLR1 plasmids. The qRT-PCR results indicated that the IFNLR1 knockdown efficiency was 62.55% (Fig. 3A) . Compared with the pcDNA3.1(+) group, the expression of IFNRL1 in the pcDNA3.1(+)-IFNLR1 group was significantly higher (p < 0.05; Fig. 3B ). Western blot analysis was performed to verify the presence of IFNLR1 expression (Fig. 3C) . These results show that the overexpression plasmid was successfully transfected into PAMs, which was consistent with our expectations, indicating the PAMs could be used for further functional study of IFNLR1. After interference, the mRNA level of the PRRSV N protein was elevated significantly (p < 0.05; Fig. 4A ). After overexpression, the TCID 50 was measured at 48 h post-infection, and the results showed that the control group virus titer was significantly higher than that of the pcDNA3.1(+)-IFNLR1 group (p < 0.01; Fig. 4D ). In addition, the PRRSV N protein level changes were consistent with the viral titer changes (Fig. 4E ).

To investigate the effect of IFNLR1 gene expression on the JAK/STAT signaling pathway, Western blot analysis was used to detect the STAT1 level in each treatment group. The results demonstrated that the level of STAT1 phosphorylation was higher in IFNLR1-overexpressing PAMs than in the control group PAMs. Conversely, the opposite result was obtained in the IFNLR1-knockdown PAMs (Fig. 5) . 

In order to further clarify the changes in the IFN signal pathway, the mRNA expressions of interferon regulator factor 7 (IRF7), interferon-induced protein with tetratricopeptide repeats 1 (IFIT1), and interferon-stimulated gene 15 (ISG15) in each treatment group were assessed. Compared with the control and pcDNA3.1(+)groups, the expression levels of the three IFN-stimulated genes were markedly increased (p < 0.01; Fig. 6A) ; to the contrary, IFNLR1-silencing yielded opposite results. To explore the effect of the IFNLR1 on the mRNA expression levels of the antiviral genes 2′-5′-oligoadenylate synthetase 1 (OAS1), protein kinase R (PKR), and myxoma resistance protein 1 (MX1), qRT-PCR analysis was performed. As Fig. 6B shows, the mRNA level of PKR and MX1 in the IFNLR1 overexpression group was significantly higher than those in the other three treatment groups and the non-transfected control group (p < 0.01; Fig. 6B ). In contrast, there was no statistically significant difference in OAS gene expression between the pcDNA3.1(+) and pcDNA3.1(+)-IFNLR1 groups (p > 0.05).

Absorption values were detected by microplate reader at a 450 nm wavelength in each group after incubation for 24 h and 48 h. The results are represented in Fig. 7 

Relative expression of IRF mRNA pcDNA3.1(+) group (p < 0.01; Fig. 7A ). On the contrary, the proliferation ability of the IFNLR1 knockdown PAMs had significantly increased (p < 0.01; Fig. 7B ).

To investigate the effects of PRRSV on cell proliferation, cell-cycle phase changes were detected by performing flow cytometry. PRRSV infection disrupted the normal PAM cell cycle. At 48 h, the proportion of PAMs in the G0/G1 phase was reduced, while the PAMs at the S and G2/M phases increased significantly. The results demonstrated that the G0/G1 phase (56.67%) and S phase (19.53%) PAMs in the transfected IFNLR1 group were significantly greater than those in the transfected pcDNA3.1(+) group (51.60% and 15.50%, respectively; p < 0.05). In the transfected IFNLR1 group, 10.01% of the PAMs were at the G2/M phase compared to 17.70% in the transfected pcDNA3.1 group, a notable difference between the two groups (p < 0.01). In contrast, the main cell-cycle phase change in the IFNLR1 knockout group was an increase of PAMs at the G2/M phase (p < 0.01; Fig. 8A and B) .

When JAK inhibitor I (800 nM), an inhibitor of the JAK/STAT pathway, was added to pcDNA3.1(+) PAMs and IFNLR1 overexpression PAMs, the phosphorylation level of STAT1 was obviously decreased (Fig. 9A) . Furthermore, a CCK8-based assessment was performed to determine the level of PAM proliferation in each group. The results showed that proliferation ability increased after JAKI was added, suggesting that the inhibition of PAM proliferation by IFNLR1 was reduced (Fig. 9B) . When the JAK/STAT pathway inIFNLR1-overexpressing PAMs was inhibited, the percentage of PAMs at the G2/M phase increased (Fig. 10) in biological activities, including antivirus, antitumor, and immunomodulation activities. However, little has been reported about the expression pattern and immune reactions of porcine IFNLR1 in response to PRRSV stimulation in vitro. The current research revealed for the first time that the IFNLR1 gene has a vital role in defending against PRRSV invasion.

The study results confirming the tissue distribution of porcine IFNLR1 were useful in revealing the recognition, induction, and inflammatory reaction of the host to the pathogen. The results showed an abundance of IFNLR1 in lung and lymph gland tissues both Dapulian and Landrace pigs, although the abundance was higher in the Dapulian pigs. Those results indicate that the IFNLR1 gene has a crucial role in the immune system of both pig breeds. This could be due to the stimulation from viruses or bacteria in the external environment, which subsequently promotes activation of the type III interferon signaling pathway. The lung is one of the most important organs of the animal body, and its primary function is to exchange gas with the outside world. Because lungs are directly connected to the outside world, it is an organ that is very vulnerable to external invasion. Previous studies have shown that when PRRSV invades the body, it first attacks macrophages in alveoli [6, 22] . These results indicate that the IFNLR1 gene has a significant role in the antiviral infection-related processes in porcine lungs.

PRRSV infection promotes the expression of type III interferon but inhibits IFNLR1 gene expression, further indicating the IFN signal pathway feature of IFNLR1. After knockout, the virus titer increases, which may be due to the specific binding of IFNλs that participate in signal transduction, which reduces antiviral and antitumor efficacy. The response of IFN-λs in vitro depends on the expression of its receptor, IFNLR1. Prior research displayed that overexpression of IL-28Ra, a response of non-responding cells to IFN-λ, was restored [23] . Our results are similar to those in the following research studies. Taniguchi et al. [24] constructed type III IFN receptor knockout H358 cells by adding interference fragments and compared the Measles virus (MeV) proliferation between normal and knockout cells. In all cases, virus titers of IFNLR1 knockout cells (IFNLR1 KO1 and KO2 clones) were significantly higher than those in control cells.

IFNs do not have a direct antiviral effect; instead, they initiate a series of signal transduction cascades to induce the expression of ISGs to exert their antiviral effects [25] . protein and inhibit the virus [26] . IFIT1 is generally expressed in IFN-dependent inducible expression in cells and has been reported to affect virus replication. Correct addition of the mRNA cap structure during the infection inhibits virus transcription and protein synthesis [27] . This study showed that IFNLR1 overexpression could induce upregulation of ISG15, IFIT1, and IRF7 in PAMs. This further indicates that the downstream signal pathway activated by the binding of the IFNLR1 gene and the interferon ligand has an important role in inhibiting PRRSV infection. Several studies have shown that OAS1, PRK, and MX1 proteins have natural resistances to viruses and can act directly on viruses [28] [29] [30] . Our results show that IFNLR1 induces significant upregulation of PKR and MX1 mRNA levels, but a change in OAS gene expression was not noticeable. We speculate that this may be due to the type III interferon signaling pathway mainly relying on PRK and MX1 antiviral proteins to produce an antiinfective effect after being stimulated by PRRSV. Also, there may be synergy or antagonism among them, but follow-up experiments are needed to investigate that suggestion.

As further elucidation of the therapeutic mechanism of IFNLR1, our results demonstrated that overexpression of IFNLR1 could inhibit the proliferation of PAMs infected with PRRSV, whereas IFNLR1 knockdown promoted PAM proliferation. In addition, overexpression of IFNLR1 significantly increased the proportion of G0/G1 and S phase PAMs and decreased the proportion at the G2/M phase. . Our results are consistent with these reports. The proportion of PAMs in the G2/M phase increased significantly after PRRSV infection. We further detected cell cycle changes after transfection with the pcDNA3.1(+)-IFNLR1 plasmid. The results indicate that, compared to the control group, the G2/M percentage was markedly decreased in IFNLR1-overexpressing cells. Interestingly, cyclins are a class of proteins that can precisely regulate the cell cycle, and they have an important role in regulating cell proliferation and division. Therefore, the effect of IFNLR1 on cyclin function needs to be studied.

In order to evade the host's innate immune system, PRRSV has evolved a variety of strategies to protect itself while fighting with the host, including interfering with the host's JAK/STAT signaling pathway. Previous study has shown that PRRSV infection can inhibit JAK/STAT signal transduction and ISGs expression induced by type I interferon [48] . Recently, it was reported that PRRSV nsp1β inhibits the activity of JAK/STAT signaling pathway by inhibiting the expression of karyopherin-α1 (KPNA1) and preventing the IFN-stimulated gene factor (ISGF3) complex from entering the nucleus [49]. These results strongly suggest that the JAK/ STAT pathway can have an immunomodulatory role in PRRSV infection. Among the signaling pathways associated with IFNLR1, the JAK/STAT pathway is the most classic [50]. After IFNλs bind to specific receptors, Jak1 and Tyk2 protein kinases are activated through tyrosine phosphorylation, and STAT1 and STAT2 are phosphorylated by the activated JAK protein, promoting the expression of IFN-stimulated genes (ISGs). Researchers have previously reported that activation of the IFNLR1 signaling pathway can increase the phosphorylation level of STAT protein in different cell types [51, 52] . Moreover, the anti-growth effect of IFNλs is inseparable from the expression of JAK1 and STAT1. In our study, after transfection of the pcDNA3.1(+)-IFNLR1 plasmid, the phosphorylation level of STAT1 was significantly increased, and immediately after the JAK inhibitor was added, the IFNLR1 gene inhibition 

of cell proliferation weakened. These results indicate that the inhibitory effect of IFNLR1 on PAM proliferation was partly dependent on the activation of STAT1 phosphorylation. IFNLR1 and its signaling pathway induce the expression of antiviral proteins (such as MX1 and PKR) and promote the release of proinflammatory cytokines and chemokines (such as CXCL10 and CXCL11) for participation in antiviral immune responses. However, an excessive inflammatory response due to a large number of inflammatory factors is usually fatal. Therefore, the molecular mechanisms of IFNLR1 and the associated signaling pathway involved in regulating the expression of inflammatory factors need to be further explored.

In summary, overexpression of IFNLR1 inhibits the proliferation of PRRSV-infected PAMs by changing cell-cycle progression. We speculate that IFNLR1 is an important target gene involved in the pathogenesis of PRRSV and may have potential in its treatment.

Nidovirales: a new order comprising Coronaviridae and Arteriviridae

Reproduction failure of unknown etiology

Identification of nonessential regions of the nsp2 replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for replication in cell culture

Porcine reproductive and respiratory syndrome virus entry into the porcine macrophage

IFN-lambda (IFN-lambda) is expressed in a tissuedependent fashion and primarily acts on epithelial cells in vivo

Regulation of type III interferon response after rrsv infection of alveolar macrophages in pigs

Type III interferonmediated signaling is critical for controlling live attenuated yellow fever virus infection in vivo

Interferon-λ mediates non-redundant front-line antiviral protection against influenza virus infection without compromising host fitness

Genetic variation in IL28RA is associated with the outcomes of HCV infection in a high-risk Chinese population

IL28RA polymorphism (rs10903035) is associated with insulin resistance in HIV/HCV-coinfected patients

Interferon-λ restricts West Nile virus neuroinvasion by tightening the blood-brain barrier

Distinct mechanisms act in concert to mediate cell cycle arrest

Cell cycle regulation during viral infection

Variability of neutrophil and pulmonary alveolar macrophage function in swine

Type III interferon (IFN) induces a type I IFN-like response in a restricted subset of cells through signaling pathways involving both the Jak-STAT pathway and the mitogen-activated protein kinases

Both type I and type III interferons are required to restrict measles virus growth in lung epithelial cells

Identification of genes differentially regulated by interferon α, β, or γ using oligonucleotide arrays

High interferon-stimulated gene ISG-15 expression affects HCV treatment outcome in patients co-infected with HIV and HCV

ISG56/IFIT1 is primarily responsible for interferon-induced changes to patterns of parainfluenza virus type 5 transcription and protein synthesis

Porcine 2′, 5′-oligoadenylate synthetases inhibit Japanese encephalitis virus replication in vitro

Mechanism of activation of the double-stranded-RNA-dependent protein kinase, PKR: role of dimerization and cellular localization in the stimulation of PKR phosphorylation of eukaryotic initiation factor-2 (eIF2)

Both foot-and-mouth disease virus and bovine viral diarrhea virus replication are inhibited by Mx1 protein originated from porcine