key: cord-0008929-hnch8f5i
authors: Williams, A.K.; Wang, L.; Sneed, L.W.; Collisson, E.W.
title: Analysis of a hypervariable region in the 3' non-coding end of the infectious bronchitis virus genome()
date: 2002-11-12
journal: Virus Res
DOI: 10.1016/0168-1702(93)90086-3
sha: 31a220e44c108ebeec0cf7f2f45336c435626030
doc_id: 8929
cord_uid: hnch8f5i

Previous studies on infectious bronchitis virus (IBV) cDNA have identified a region of about 184 bases in the 3' non-coding terminus of both the U.S. prototype strain (Beaudette) and a Japanese strain (KB8523), that was not present in an antigenically closely related U.S. strain, Massachusetts (Mass) 41 (Boursnell et al., 1985; Sutou et al., 1988). In order to investigate the origin and function of this region and its occurrence in nature, the cDNA sequences of the 3' non-coding regions of three additional strains of IBV, Gray, Arkansas (Ark) 99 and Holland (Holl) 52, were determined and compared to the sequences of the Beaudette, KB8523 and Mass41 strains. Not only was this U-rich sequence absent from the 3' non-coding region of the Mass41 strain, it was also highly variable, especially in comparison to the highly conserved 3' non coding region downstream of this sequence. Computer analyses of the sequences adjacent to this hypervariable region (HVR) showed that the 3' end of the IBV genome was highly conserved downstream of this region, with 94.3 to 97.8% similarity. However, the similarities for the HVR ranged from 53.2% between Ho1152 and Ark99, to 92.8% between Beaudette and Gray. The flanking sequences were not only conserved but these sequences upstream and downstream of the HVR also formed mirrored images.

Beaudette and Gray. The flanking sequences were not only conserved but these sequences upstream and downstream of the HVR also formed mirrored images.

Infections bronchitis virus; Hypervariable region; Sequencing; 3' non-coding region Avian infectious bronchitis virus (IBV) is a highly contagious pathogen of chickens with many strains varying widely in virulence, serotype, and pathotype (Darbyshire et al., 1979; Hopkins, 1974) . For exampie, Beaudette is a highly attenuated strain of IBV, Ho1152 is a vaccine strain, Gray and a Japanese strain (KB8523) are both known to be nephropathogeni~ but have also been associated with respiratory disease, and Ark99 and Mass41 are generally thought to result in severe respiratory disease in the absence of gross kidney lesions (Beaudette and Hudson, 1937; Cumming, 1963; Darbyshire et al., 1979; Johnson and Marquardt, 1986; Hungherr et al., 1956; Sutou et al., 1988; Winterfield and Hitchener, 1962) . ArkDPI strains ~emb~onating chicken egg passages 11 and 75) belong to the same serogroup as Ark99 (Sneed et al., 1989) .

IBV was the first coronavirus to be completely sequenced and is the prototype of the family Coronaviridae (BoursnelI et ai., 3987). The IBV genome is 27.6kb in length and consists of single-stranded RNA of positive Polaris with a poIyA tail {Schochetman et al., 1977) . Viral replication takes place under the control of a viral RNA-dependent RNA polymerase produced by translation of the genomic RNA. The polymerase presumably binds to the 3' end of the genomic RNA to initiate transcription, resulting in the production of negative sense RNA, either full length or subgenomic length, from which mRNAs can be transcribed (Boursnell et al., 1987 , Sethna et al., 1989 .

Previous studies on IBV cDNA for the 3' non-coding terminus of both a U.S. strain (Beaudette) and a Japanese strain (K38523) identified a region of 184 bp with a higher U content that the remainder of the genomic RNA (Boursnell et al., 1985; Sutou et al., 1988) . This region, however, was not present in Mass41, an antigeni~ally closely related strain. The 3" non-coding regions of additional strains were cloned and sequenced in order to investigate functional importance and to determine the extent of this U-rich sequence within the IBV group of Coron-lau&u,seg. A similar U-rich region of 184 bases was found in the sequence of the Ark99 genome immediately downstream of the nucleocapsid gene where it had been described in the Mass-related strains. A 40-base synthetic oligonucleotide was synthesized that was complementary to the middle of this Ark99 U-rich region, and was labelled at the 3' end using "2P-dCTP and terminal deoxy transferase (Sambrook et al., 1989) . Four IBV RNAs, Mass41, Ho1152 and 2 Arkansas isolates (ArkDPI-11 and ArkDPI-75) were applied to and baked on a nitrocellulose membrane. The RNA was applied in four-fold dilutions, starting with 1 pg, and dot blot hybridisation was performed at 42°C overnight in the presence of formamide (Sambrook et al_ 1989).

ArkDPI-75 @ @ a rl)

Fig. 1. Dot blot of RNA from 4 strains of IBV. RNA was immobilized onto a nitrocellulose membrane and probed with a 32P-labelled synthetic oligonucleotide complementary to a portion of the U-rich region in the 3' non-coding region of Ark99.

Hybridization studies with this Ark99-derived probe detected similar sequences in genomic RNA from the ArkDPI-11 and ArkDPI-75 strains, but not in Mass41 or Ho1152 RNA, indicating, as expected, the presence of a similar U-rich sequence in ArkDPI-11 and ArkDPI-75 ( Fig. 1) . However, this probe also did not hybridize to Ho1152, suggesting either that the strain did not contain this region or that it was too dissimilar to be recognized by the Ark99-derived probe. The cDNA sequences of two additional strains, Gray and Ho1152, were then examined, and a comparable region was found in both.

Since the 3' non-coding region of the IBV genome should be important in the recognition and/or binding of polymerase, we examined the sequences of this region of the genome. The viral isolates used in this study, previously described by Sneed et al. (1989) , were propagated at 37°C for 36-48 h following allantoic sac inoculation into 11-day-old specific pathogen-free embryonating chicken eggs. The eggs were then refrigerated at 4°C for 5 h, and the allantoic fluid collected and clarified by centrifugation at 10K rpm for 20 min. Virus was precipitated overnight with 8% polyethylene-glycol, 2.33% NaCl, and concentrated by centrifugation at 10K rpm for 20 min. Virus pellets were reconstituted in l/50 vol. 20 mM Tris, 1 mM EDTA, 100 mM NaCl, pH 7.4 and banded on a 30-50% glycerol/potassium tartrate gradient for 2 h at 28K rpm. After concentrating by ultracentrifugation at 28K rpm for 1 h, virus pellets were resuspended in 0.1 M NaOAc, pH 5.2, and the virions were disrupted with 1 mg/ml proteinase K and 1% SDS at 37°C for 1 h. The RNA was extracted first with phenol and then with chloroform/isoamyl alcohol followed by ethanol precipitation (Wang et al., 1988) . Presence of IBV genomic RNA was confirmed by electrophoresis of a sample of the RNA on a 1% agarose gel and the remaining RNA was reprecipitated with ethanol.

Purified RNA was pelleted and dried in a Savant vacuum drier. RNA was resuspended in 7 ~1 deionized H,O (dH,O) and denatured in 6 mM methyl mercuric hydroxide for 10 min at room temperature. First strand cDNA synthesis was carried out using 5 units of AMV reverse transcriptase at 42°C for 2 h in the presence of 14 mM 2-mercaptoethanol (2MEI, 50 mM Tris pH 8.3, 50 mM KCl, 8 mM MgCl,, 0.8 mm dNTP, 20 pg/ml of 3' end primer (5' GGATCCGCTC-TAACTCTATACTAGCCTAT 3') and 20 units of RNasin (Promega, Madison, WI). Following phenol extraction and ethanol precipitation of the RNA/cDNA hybrid, the RNA was eliminated by exposure to highly alkaline conditions at 37°C for 3 h. The cDNA was then neutralized, concentrated by ethanol precipitation, and amplified using the polymerase chain reaction (PCR). PCR was performed with the same 3' end primer as above and a primer from the upstream intergenic region (S'GAATI'CCCGCGTGTACCTCTCTAGTA 3') in the presence of 4 mM dNTP, 1 X Tuq buffer (1.5 mM MgCl,, 50 mM KCl, 10 mM Tris-HCl, pH 8) and 0.5 ~1 Taq polymerase (Perkin Elmer, Norwalk, CT). The PCR was performed with a primary denaturation step at 95°C for 3 min, annealing at 50°C for 30 s, extension at 72°C for 1 min, and subsequent denaturation steps at 95°C for 1 min. A total of 30 cycles were used with a final extension step of 3 min at 72°C. Resulting PCR products were cloned into the pCRlOO0 vector, utilizing the single T overhang at the insertion site (Invitrogen, San Diego, CA) and sequenced using the Sequenase rit (USB, Cleveland, OH). Nucleotide sequences were processed using the GCG Seqed program and compared with the Gap and Bestfit programs. Sequences were aligned using Pileup and predicted secondary structures of the 3' non-coding region were derived from Fold and Squiggles.

The nucleotide sequences of the 3' non-coding regions of the Ark99, Gray and Ho1152 strains of IBV were compared with the published sequences for Mass41, Beaudette and KB8523 (Boursnell et al., 1985; Sutou et al., 1988) . Fig. 2 shows the alignment of these sequences and demonstrates the high degree of similarity among the strains.

However, the U-rich region upstream of the 3' non-coding region, that was absent from Mass41, was found in HollS2, as we11 as Gray and Ark99, and was described as the 3' h~e~ariable region (HVR) because of the extent of its variation among strains. This HVR ranged from 184 (Gray1 to 196 (Ho11521 nucleotides in length and the nucleotide sequence homologies among the strains containing this sequence ranged from 53.2% to 92.8%, with the Ho1142 strain showing the greatest divergence (Table 1 ). The greater variability of the Ho1152 strain compared to the other strains in this region immediately downstream of the nucleocapsid gene would explain why this region was not detected with the Ark99 probe ( Fig. 1 ). In comparison, the non-coding region downstream of this HVR was highly conserved, ranging from 94.3% to 97.5% identity (Table 2 ). Fig. 3 shows a plot of the similarity of the nucleotide sequences of the 3' non-coding regions of all 6 strains of IBV. The HVR is clearly seen immediately after the nucleocapsid gene and can be compared to the remaining 3' non-coding region which has very high similarity scores. This HVR could be considered either an insertion or a deletion since it is not present in Mass41. However, the higher U content in comparison to the rest of the IBV genome suggests that it is of exogenous origin (Boursnell et al., 1985) . The fact that it has at least 53.2% identity among various strains suggests a common ancestry for this sequence.

If the IBV genome acquired the HVR as exogenous RNA, this region could be a site for recombination. Sequences upstream and downstream of the HVR were analyzed to identify any distinctive patterns which would suggest that this region is of functional significance, such as being involved in recombination. Not only are the sequences flanking the 3' HVR highly conserved, the 5' flanking sequence also resembles the cutting site (5' TTAA 3') of retrovius DNA and transposons TnlO and Tn3 (Shoemaker et al., 1980) . It was of special interest that a unique pattern, that may be of functional importance, was observed in the oligonucleotides flanking the HVR. Several nucleotides downstream of this 3' HVR were mirrored in the sequences upstream. That is, the same sequences were seen in reverse orientation on either side of the 3' HVR. An example can be seen in the Gray strain where the sequence TGAGAATG appears 5' of the HVR and the sequence 0.0-i s I I I,   I  I  I  I,  I  I  I  I,  0  I  I  I,  I  I  I,,  I  I  I   0  100 200 300 400 500 Position GTAAGAGT is in the 3' flanking sequence ( Table 3 ). The function of these mirrored sequences is unknown; however, they may be important in preventing folding of the RNA in this region, as mirrored sequences should prevent complementary base pairing. The sequence relationships of the 3' non-coding regions were examined with a phylogenetic tree (Fig. 4) . The Ho1152 and KEC3523 strains were shown to be more distantly related to the other strains. The 3' non-coding sequences of Mass41, in spite of the absence of the HVR, appeared to be closely related to the Beaudette, and to a lesser extent to the Gray and Ark99 strains. The program used to determine this tree counts the absence of this whole HVR in Mass41 as the result of one recombination event, so only the remainder of the 3' non-coding region of the Mass41 strain was considered for the construction of the phylogenetic tree.

The location of the 3' non-coding HVR is conserved at a position immediately downstream from the stop codon of the nuc~eocapsid gene. There is no evidence as yet to show that this HVR has any effect on virulence or pathogenesis. There are no detectable protein products from the 3' HVR and no methionines with a preceding putative consensus ribosomal binding site. Since it is completely absent in the Mass41 strain, it would appear that it is not an absolute requirement for viral replication, at least for Mass41. Any specific function of this HVR apparently does not dictate that the sequences be highly conserved but its function may depend on the secondary structure of the RNA. The variability of this HVR as compared to the conservation of the remaining 3' non-coding sequences suggests that the primary sequence itself may not be as functionally important as its influence on the secondary structure of the 3' end of the genome. It is possible that the presence of the HVR may increase the comple~ty of the secondary structure of the RNA which could in turn affect its association with replication machinery, such as RNA binding proteins. 

Cultivation of the virus of infectious bronchitis

Sequences of the nucleocapsid genes from two strains of avian infectious bronchitis virus

Completion of the sequence of the genome of the coronavirus avian infectious bronchitis virus

infectious avian nephrosis (uraemia) in Australia

Taxonomic studies on strains of avian infectious bronchitis virus using neutralization tests in tracheal organ cultures

Serologic comparisons of strains of infectious bronchitis using plaque-purified isolates

We thank Peggy M. Billingsley for her excellent technical assistance. This work was supported by the Southeastern Poultry and Egg Association, #29 and #460; Formula Animal Health (section 14331, #TEXO-6824 and TATRP #999902-063.