key: cord-0005166-xg2bv9gy
authors: Dayer, Mohammad Reza; Dayer, Mohammad Saaid; Rezatofighi, Seyedeh Elham
title: Mechanism of Preferential Packaging of Negative Sense Genomic RNA by Viral Nucleoproteins in Crimean-Congo Hemorrhagic Fever Virus
date: 2015-01-30
journal: Protein J
DOI: 10.1007/s10930-015-9601-6
sha: 0c77f28ceba9f46431dba25d738cc3482b4f0639
doc_id: 5166
cord_uid: xg2bv9gy

The Crimean-Congo Hemorrhagic Fever (CCHF) is an infectious disease of high virulence and mortality caused by a negative sense RNA nairovirus. The genomic RNA of CCHFV is enwrapped by its nucleoprotein. Positively charged residues on CCHFV nucleoprotein provide multiple binding sites to facilitate genomic RNA encapsidation. In the present work, we investigated the mechanism underlying preferential packaging of the negative sense genomic RNA by CCHFV nucleoprotein in the presence of host cell RNAs during viral assembly. The work included genome sequence analyses for different families of negative and positive sense RNA viruses, using serial docking experiments and molecular dynamic simulations. Our results indicated that the main determinant parameter of the nucleoprotein binding affinity for negative sense RNA is the ratio of purine/pyrimidine in the RNA molecule. A negative sense RNA with a purine/pyrimidine ratio (>1) higher than that of a positive sense RNA (<1) exhibits higher affinity for the nucleoprotein. Our calculations revealed that a negative sense RNA expresses about 0.5 kJ/mol higher binding energy per nucleotide compared to a positive sense RNA. This energy difference produces a binding energy high enough to make the negative sense RNA, the preferred substrate for packaging by CCHFV nucleoprotein in the presence of cellular or complementary positive sense RNAs. The outcome of this study may contribute to ongoing researches on other viral diseases caused by negative sense RNA viruses such as Ebola virus which poses a security threat to all humanity.

CCHFV is a tri-segmented negative sense RNA virus with S (small), M (medium) and L (large) segments [12, 13] . These segments of RNA in CCHFV encode nucleoprotein, glycoprotein and polymerase, respectively [14] [15] [16] [17] . As in other negative sense RNA viruses, RNA of CCHFV is enwrapped by nucleoproteins forming a complex called ribonucleoprotein particle (RNP) which protects genomic RNA against degradation by host cell nucleases and helps packaging the newly synthesized genomic RNA to form virions [15, [18] [19] [20] [21] .

The CCHFV nucleoprotein comprises 482 amino acid residues in its primary structure and 18 alpha helices in the secondary structure as its predominant regular structure. The alpha helices include about 54 % of amino acid residues whereas beta strand structures include only 2.5 % of amino acids [22, 23] . In the three dimensional structure, nucleoprotein has two domains; a stalk and a head domains [24] .

Sequence analyses indicated the existence of highly positively charged regions along the nucleoprotein that suggest its ability to bind negative back-bones of RNA molecules [19, 25, 26] . A region comprising residues Lys 339 , Lys 343 , Lys 346 , Arg 384 , Lys 411 , His 453 and Gln 457 and a region with Arg 134 , Arg 140 and Gln 468 in the head domain, on the one hand, and a region with Arg 195 , His 197 , Lys 222 , Arg 282 and Arg 286 in the stalk domain, on the other hand, provide suitable binding motifs for a genomic RNA [24, 26] . Considering the low sequence similarity of nucleoproteins in Bunyaviridae family, it is thought that the binding properties of nucleoproteins are not sequence specific [5-7, 15, 16] . The genomic RNA of negative sense RNA viruses, as in CCHFV, is in opposite sense to mRNA. Therefore, it should be transcribed to complementary RNA by viral polymerase prior to becoming suitable for translation by host cell machinery [26] [27] [28] .

It is well known that the viral polymerase specifically recognizes and binds the genomic RNA encapsidated in RNPs rather than the naked one and transcribe it to a positive RNA [29] [30] [31] . However, the presence of the nucleoprotein is essential for safe elongation of the transcription process as it likely plays a pivotal helicase activity to prevent pairing of the genomic RNA and the newly synthesized complementary RNA as a double stranded structure [30, [32] [33] [34] . There are reports suggesting that the helicase activity results from the nucleoprotein different affinities for negative and positive sense RNA strands i.e. with higher affinity for a negative (viral) RNA and lower affinity for a positive sense (complementary) RNA [35] [36] [37] [38] .

In the present work, by analyzing genomic sequences of RNA viruses either with negative or positive sense, performing different docking experiments and carrying out molecular dynamic (MD) simulations, we undertook to study the mechanism conferring different affinities to CCHFV nucleoprotein for negative and positive sense RNAs'. The outcomes of this study may give a better understanding of packaging mechanism for CCHFV negative sense genomic RNA.

The available two coordinate structures for monomeric and trimeric forms of CCHFV nucleoprotein were obtained from Protein Data Bank archive under PDB ID numbers: 3U3I, 4AQG and 4AQF respectively [39] . These structures were constructed based on crystallographic data at 2-3 Å of resolutions prior to being used as starting structures to perform experiments.

For the purpose of this study, the negative and positive sense RNAs were prepared by dissociating a short double strand RNA of 21 nucleotides obtained from PDB (ID: 2KE6) and a long double stranded RNA of 42 base pairs which had been constructed using ArgusLab, a free docking software [40] . The sequence of the negative strand of the short RNA was: 5 0 AAUUUAAAAAUACAAUCAAGC3 0 with a purine/pyrimidine ratio of 1.65, whereas that of positive strand was: 5 0 GCUUGAUUGUAUUUUUAAAU U3 0 with a purine/pyrimidine ratio of 0.615. Also, the sequence of the negative strand of the long RNA was: 5 0 GUGACGUGACGUGACGUGACGUGAGUGACGUG-ACGUGACGUG3 0 with a purine to pyrimidine ratio of 1.47, whereas that of the positive strand was: 5 0 CACGUCACGUCACGUCACUCACGUCACGUCCA-CGUCACGUCAC3 0 with a purine to pyrimidine ratio of 0.68.

The coordinate structures of both short and long RNAs (negative and positive senses) were hydrated and energy minimized by gromacs prior to being used in docking or MD experiments. It should be noted that these positive and negative RNAs were selected to have distant purine to pyrimidine ratio enough to magnify their difference in terms of their physicochemical properties in a bid to elucidate their differential behaviors.

Docking experiments were carried out on hydrated and optimized structures of CCHFV nucleoproteins and RNA molecules using Hex software version 6.3 (http://www. loria.fr/*ritchied/hex/) [41] . Docking results were scored based on their energy and the first 100 docked structures were averaged and used for energy calculations.

For MD experiments, the best docked structures of CCHFV nucleoprotein in complex with short and long negative or positive sense RNAs were placed separately in the center of rectangular boxes having dimensions of 6.97 9 7.48 9 9.60, 6.97 9 7.50 9 9.65, 9.64 9 9.65 9 13.20 and 8.94 9 9.85 9 13.49 nm respectively. The simulated boxes were filled and coverd with a water layer modeled by the SPC/E model within a radiuos of 1.0 nm.

Setting up the systems: GROMACS 4.5.5 with double precision implemented on UBUNTU-12.04 were used for MD simulations using amber99sb-ildn force filed for parameterizations [42] . Systems charge neutralities were checked by GROMACS machine and neutralized by adding sodium ions. Systems were optimized for system constituents including solvent, ions and hydrogen atoms by more than 1,400 steps of energy minimization using steepest decent algorithm with the total energy below 350 kJ/mol. LINCS and SETTLE algorithms were used to constrain bond length and water geometry. Short 500 ps-MD simulations with bond restraints were carried out prior to full length simulations [43] . Final 20 ns-MD simulations were performed at 37°C using Berendsen thermostat and at 1 atmosphere pressure using Berendsen barostat for coupling temperature and pressure respectively. Electrostatic interactions were treated with particle mesh Ewald (PME) and the neutral pH was set using Asp, Glu, Arg, and Lys amino acids in ionized forms [44, 45] .

The results were analyzed statistically using the Statistical Package for the Social Science (SPSS-PC, version 15. SPSS, Inc., Chicago, IL). The parameters were considered significantly different at p \ .05.

The transcription of viral negative sense RNA by a polymerase to a complementary positive sense RNA results in replacement of purine nucleotides (G and A) with their pyrimidine counterparts (C and U) and vise versa. Depending on proportional nucleotide content of a parental RNA, the complementary chain may differ in its overall purine to pyrimidine ratio when contrasted to the parental chain. In order to calculate purine/pyrimidine ratios of negative and positive RNAs, we analyzed a large set of genomic information of well characterized negative and positive sense RNA viruses in terms of their corresponding sequences. Tables 1 and 2 list the negative and positive sense RNA viruses obtained from www.ncbi.nlm.nih.gov/ nuccore for the same purpose.

Sequence analyses showed that the average purine/ pyrimidine ratios are 1.10 ± 0.06 and 0.96 ± 0.05 (Average ± SD) for negative and positive sense RNA respectively. Although, the difference seemed trivial, but statistical analyses indicated significantly higher ratio for negative sense RNA compared to positive sense one at p value \.05. Given their higher abundance, the larger purine bases bind stronger (via stacking and/or hydrogen bonding) to counter amino acids residues on CCHFV nucleoprotein than pyrimidine bases. In order to test this hypothesis, we first constructed four mono nucleotides of G, A, C and U by ArgusLab software and optimized their chemical structures. The optimized nucleotides then were docked to CCHFV nucleoproteins (3U3I and 4AQG for monomeric and 4AQF for trimeric forms) using Hex 6.3 and blind mode of docking. Binding energy of the best 100 docked structures then averaged as binding affinity. As expected, our data showed that the binding energy of mononucleotides to 3U3I nucleoprotein were -454.58, -128.84, -122.78 and -122.56 kJ/mol for G, A, U and C respectively. The same patterns were seen when using monomeric 4AQG and trimeric 4AQF nucleoproteins as targets (data not shown). As evidenced, purine nucleotides show higher binding energies than pyrimidine nucleotides. Furthermore, the content of each nucleotides in the genomes of negative sense RNA viruses calculated as percentage (mean ± SD) were 31.20 ± 2.44, 21.09 ± 2.07, 26.46 ± 1.97 and 21.22 ± 2.09 for A, G, T and C nucleotide respectively, showing prominently higher content for A nucleotide. The same calculation for genome composition of positive sense RNA viruses indicated 28.49 ± 2.10, 20.45 ± 2.57, 31.74 ± 3.14 and 19.31 ± 3.87 % for A, G, T and C nucleotide contents respectively. Interestingly, when the actual count of genomic nucleotides for negative and positive sense RNA viruses (as listed in Tables 1, 2) are multiplied by their corresponding energies, the resulting total binding energy of negative sense RNA become significantly higher than that of positive sense RNA by 0.5 kJ/mol per nucleotide. This energy builds up a significant barrier for positive sense RNA to be packaged, as genetic material, by CCHFV nucleoprotein instead of/or concomitantly with negative sense RNA during virus assembly. This confers the negative sense RNA with a greater affinity for CCHFV nucleoproteins and hence preferential binding, As evidenced, this binding preference is driven by higher proportion of adenine rather than other nucleotides. What remains to be answered, at this stage, is whether the preferential binding of CCHFV nucleoproteins Viral Nucleoproteins in CCHFV 93

to the negative sense RNA is a sequence specific property or not. Using single-stranded oligonucleotides with 2-8 nucleotides long, our serial docking experiments revealed that the binding interface of CCHFV nucleoprotein and RNA involves only 3-4 nucleotides and their counter residues. Therefore, to study the effect of nucleotide sequence on binding energy, we constructed 64 possible sequences of trimeric and 256 possible sequences of tetrameric nucleotides using G, A, C and U nucleotides and optimized their chemical structures. These nucleotide structures were then docked to optimized structures of CCHFV nucleoproteins (3U3I and 4AQG for monomeric and 4AQF for trimeric forms). ANOVA analysis of the best 100 resulted structures from each docking experiments showed that the binding energies of trimeric and tetrameric sequences are significantly sequence independent (p value \.05). In other words, the binding energy of oligonucleotides is only dependent to the total content of purine bases but not to the sequence of nucleotides in RNA string. In the next step, a short RNA (21 nucleotides) as well as a long RNA (42 nucleotide) both in negative and positive sense states were used and docked to monomeric (3U3I and 4AQG) and trimeric (4AQF) forms of CCHFV nucleoproteins. Figure 1 plots average binding energies obtained for the best 100 structures of each negative and positive sense RNAs with different nucleoprotein structures. As indicated, negative sense RNA exhibited significantly higher binding energy than positive sense RNA (p value \.05) with either monomeric (3U3I and 4AQG) or trimeric (4AQF) nucleoproteins as docking targets. This finding suggests that CCHFV nucleoproteins bind more tightly to negative sense RNA than positive one. Figure 1 , also, shows that irrespective of their senses, long RNAs have comparatively higher affinities to nucleoprotein than short RNAs.

Based on the results of aforementioned docking experiments, we then selected CCHFV nucleoproteins-RNA complexes of maximum binding energies for positive and negative sense RNAs (both short and long) to carry out MD simulations. The complexes were then placed in cubic boxes filled with SPCE water at 37°C and 1 atmosphere pressure and energy minimized to lower than 300 kJ/mol prior to MD simulations. Table 3 summarizes simulation history for these systems.

The simulation trajectories, all of 20 ns duration, were then processed using gromacs commands. In all cases, the same outputs were obtained for short and long RNAnucleoprotein complexes. Figure 2a shows root mean square displacement (RMSD) curve of CCHFV nucleoprotein during simulation of its complexes with both negative and positive sense RNAs. The curve indicates that CCHFV nucleoprotein undergoes similar patterns of structural alterations in the presence of either senses of RNA which ultimately converge towards equilibrated states. As the structural alterations exerted by MD force are similar during these simulations, therefore, both systems may be used for further comparative studies. Figure 2b illustrates RMSD change of RNA chains against protein back-bone for both negative and positive sense RNA complexes. This curve provides a good tool to explore the movement of RNA relative to protein backbone during simulation. The initial phase of RMSD curve (0-5,000 ps) marks a sharper increase in RMSD for the negative sense RNA in contrast to positive sense RNA. Towards formation of RNA-CCHFV nucleoprotein complexes, the faster movement of negative sense RNA means that this docked RNA chain has a closer position to that in the final conformation and so proceeds faster to reach the final state. After this initial phase has elapsed, the negative sense RNA reaches a more stable state which restricts further movement, hence, its RMSD curve progresses with steeper slope than that of its counter RNA (Fig. 2b) . However, the positive sense RNA does not reach a stable state until about 12,000 ps of simulation after which both systems of RNA chains attain certain stable conformations with no further reasonable increase in RMSD values.

The root mean square fluctuation (RMSF) of nucleoprotein alpha carbons during 20 ns of simulation is shown in Fig. 3 . The RMSF curve is a very useful index for protein flexibility during simulation with hot (or more flexible) points being at the picks of the curve. As depicted, the total RMSF of the negative sense RNA is significantly lower (*8 tenth) than that of the positive sense RNA. The lower RMSF of CCHFV nucleoprotein complex with negative sense RNA compared to its complex with positive sense RNA indicates lower flexibility and therefore more stable conformation of the former complex. This confirms the postulated preferential binding of the negative sense RNA to CCHFV nucleoprotein based on binding energy calculations (Fig. 1) .

The trend of mean square displacement (MSD) curve (Fig. 4) for the negative and positive sense RNAs during simulation is a reliable index for the extent of movement or diffusion of RNA chains inside CCHFV nucleoprotein. This Fig. 1 Binding energy for CCHFV nucleoproteins (monomers of 3U3I, 4AQG and trimer of 4AQF) to negative and positive sense RNAs' with short and long length obtained from blind docking experiments using Hex 6.1 software parameter indirectly reflects the stability of RNA-nucleoprotein complex against applied MD forces. The sharper increase of MSD curve for the positive sense RNA indicates reduced stability of its complex with CCHFV nucleoprotein and its free movement inside protein during simulation. This finding is yet another indication on the stability of the negative sense RNA-nucleoprotein complex. Figure 5 shows the hydrophobic solvent accessible surface (SAS) of the nucleoprotein for complex formation with negative and positive RNA during simulation. Increase in SAS during simulation could be interpreted as to be the result of structural alterations of nucleoprotein which leads to orientation of hydrophobic residues towards outside for RNA binding. Showing an elevated SAS curve, the negative sense RNA seems to exert more structural alterations in CCHFV nucleoprotein during simulation than its counter RNA does. This is again another indication of a stronger binding of the negative sense RNA with the nucleoprotein. The stronger binding of the negative sense RNA is also confirmed by a significant decrease in the content of the protein secondary structure of alpha helix (p value \.05) from 35.14 ± 2.5 to 30.2 ± 3.0 % (mean ± SD) as shown in Fig. 6 . This finding also is in agreement with increased changes in nucleoprotein structure caused by the presence of negative sense RNA. Figure 7a represents the final conformation of positive and negative sense RNA complexes with CCHFV nucleoprotein. In order to clarify the binding pattern, we only showed the secondary structure elements of the protein instead of showing all atoms. Helices of a 5 and a 6 which are placed in the vicinity of CCHFV binding site are shown in blue, while RNA molecules are shown as balls and sticks. As seen, negative sense RNA (right scheme) fits better to CCHFV binding site in the region between head and stalk domains. In contrast, positive sense RNA (left scheme) is placed somewhat far from binding site. Figure 7a -b reconfirm the fact that the negative sense RNA binds better and fits more effectively than the positive sense RNA to its binding crevice throughout simulation.

The agent of the Crimean-Congo Hemorrhagic Fever is a negative sense RNA virus which causes one of most life threatening and lethal infectious diseases in human [10, 11] . This virus is, therefore, worthy to be extensively [24] [25] [26] . The main objective of the present study was to pick up some useful hints for better understanding of infection process of such a terrible disease. It seemed, therefore, sensible to start with the negative sense properties of CCHFV and its ability to be enwrapped by viral nucleoprotein [15, 16] .

The preferential packaging of the negative sense RNA by CCHFV nucleoprotein in viral assembly seems to be assisted by specific structure recognition characteristics which differentiates between negative sense RNA and positive sense one. This differentiation may be performed based on nucleotides composition and/or their assortment (sequence) within RNA chains [42, [44] [45] [46] [47] . In the first run, we collected the complete sequences of genomic RNA for positive and negative senses viruses listed in Tables 1 and 2 [39] . Using Microsoft Excel, we calculated the total numbers of four nucleotides including G, A, C and U for each virus listed in the tables. Then, we calculated the ratio of purines to pyrimidines for the negative and positive sense RNA viruses.

Our results show that the negative sense RNA has higher ratio of purines to pyrimidines (ratio [ 1) than its counter positive sense RNA which has a ratio of less than unity (ratio \ 1). Having bigger bases as well as polar groups, purine nucleotides such as G with highest binding energy and A with higher frequency amongst nucleotides interact stronger with their amino acid counterparts on CCHFV nucleoprotein. Our docking experiments confirm higher binding energies of 0.5 kJ/mol per nucleotide for negative sense RNA. This energy seems to be the main cause for preferential binding of the negative RNA to CCHFV nucleoprotein.

Our MD simulations indicate that the negative sense RNA makes a more stable complex with CCHFV nucleoprotein ( Fig. 2a-b) . The retained diffusion of the negative RNA inside nucleoprotein with lowered slope of MSD curve (Fig. 4 ) also confirms this claimed stability. Attenuated curve of RMSF for CCHFV nucleoprotein in complex with the negative sense RNA compared to the positive sense RNA (Fig. 3) indicates the formation of a more stable complex with lower flexibility in CCHFV nucleoprotein. Moreover, curves of the hydrophobic solvent accessible surface (SAS) (Fig. 5 ) and the significant decrease in secondary structure (Fig. 6 ) confirmed stronger interactions between the negative sense RNA and CCHFV nucleoprotein during simulation hence inducing structural alterations of CCHFV nucleoprotein. Finally the extracted structures of binding site residues indicated the presence of more positive residues in CCHFV for negative sense RNA binding ( Fig. 7a-b) . 

It was shown that Lassa virus nucleoprotein binding site for RNA is closed by a 5 and a 6 helices in closed conformation of trimeric structures. Outward movement of these helices in gating mechanism open the binding site and permit RNA entrance and binding to virus nucleoprotein [46] . Nevertheless the negative and the positive sense RNAs here bind almost to the same binding site reported for Lassa Virus (Fig. 7) . However, our simulation trajectories indicate that there is neither a significant movement in a 5 and a 6 helices nor a significant disturbance in residues string of 112-122 to support the gating mechanism. Instead, we conclude that CCHFV nucleoprotein may act via different mechanism. Cocrystallization of CCHFV nucleoproteins with negative and positive sense RNAs, X-ray crystallography and performing MD simulations in conditions similar to those in virus seems to be the only way to elucidate the precise mechanism underlying RNA binding to CCHFV nucleoprotein.

Crimean-Congo hemorrhagic fever virus glycoprotein proteolytic processing by subtilase SKI-1

RNA binding properties of bunyamwera virus nucleocapsid protein and selective binding to an element in the 5 0 terminus of the negative-sense S segment

Evidence of segment reassortment in Crimean-Congo haemorrhagic fever virus

Structure of Crimean-Congo hemorrhagic fever virus nucleoprotein: superhelical homo-oligomers and the role of caspase-3 cleavage

Crimean-Congo hemorrhagic fever

Crimean-Congo haemorrhagic fever

The complete genome sequence of a Crimean-Congo hemorrhagic fever virus isolated from an endemic region in Kosovo

Bunyaviruses and climate change

Crimean-Congo hemorrhagic fever: risk for emergence of new endemic foci in Europe

Bunyaviridae: the viruses and their replication

Evidence for recombination in Crimean-Congo hemorrhagic fever virus

Crystal structure of the borna disease virus nucleoprotein

Recent progress in molecular biology of Crimean-Congo hemorrhagic fever

Crimean-Congo hemorrhagic fever

Structural characteristics of nairoviruses (genus Nairovirus, Bunyaviridae)

The hexamer structure of Rift Valley fever virus nucleoprotein suggests a mechanism for its assembly into ribonucleoprotein complexes

Structure of the Rift Valley fever virus nucleocapsid protein reveals another architecture for RNA encapsidation

The glycoprotein cytoplasmic tail of Uukuniemi virus (Bunyaviridae) interacts with ribonucleoproteins and is critical for genome packaging

Electron cryo-microscopy and single-particle averaging of Rift Valley fever virus: evidence for GN-GC glycoprotein heterodimers

Crimean-Congo hemorrhagic fever virus genomics and global diversity

Essential amino acids of the hantaan virus N protein in its interaction with RNA

Crimean-Congo hemorrhagic fever virus nucleoprotein reveals endonuclease activity in bunyaviruses

Crystal structure of the borna disease virus nucleoprotein

Structural comparisons of the nucleoprotein from three negative strand RNA virus families

Structure of the influenza virus A H5N1 nucleoprotein: implications for RNA binding, oligomerization, and vaccine design

Monomeric nucleoprotein of influenza A virus

Structure of influenza virus RNP. I. Influenza virus nucleoprotein melts secondary structure in panhandle RNA and exposes the bases to the solvent

Structure of the RNA inside the vesicular stomatitis virus nucleocapsid

Role of the nucleocapsid protein in regulating vesicular stomatitis virus RNA synthesis

RNA polymerase of influenza virus: role of NP in RNA chain elongation

Nucleoproteins and nucleocapsids of negative-strand RNA viruses

Complex formation with vesicular stomatitis virus phosphoprotein NS prevents binding of nucleocapsid protein N to nonspecific RNA

An N-terminal domain of the Sendai paramyxovirus P protein acts as a chaperone for the NP protein during the nascent chain assembly step of genome replication

Rabies virus chaperone: identification of the phosphoprotein peptide that keeps nucleoprotein soluble and free from non-specific RNA

Structure, function, and evolution of the Crimean-Congo hemorrhagic fever virus nucleocapsid protein

Differential inhibition of cytosolic PEPCK by substrate analogues. Kinetic and structural characterization of inhibitor recognition

Molecular docking using ArgusLab, an efficient shape-based search algorithm and the AScore scoring function

HexServer: an FFT-based protein docking server powered by graphics processors

Whiskers-less HIV-protease: a possible Way for HIV-1 deactivation

The interpretation of protein structures: estimation of static accessibility

Characterization of the pH titration shifts of ribonuclease A by one-and two-dimensional nuclear magnetic resonance spectroscopy

Essential dynamics of lipase binding sites: the effect of inhibitors of different chain length

Crystal structure of the Lassa virus nucleoprotein-RNA complex reveals a gating mechanism for RNA binding

Acknowledgments The financial support of Shahid Chamran University of Ahvaz and Tarbiat Modares University, Tehran, are acknowledged.

There are no conflicts of interest to disclose.