key: cord-0000786-ty6lv18n
authors: Aubry, Camille; Corr, Sinéad C.; Wienerroither, Sebastian; Goulard, Céline; Jones, Ruth; Jamieson, Amanda M.; Decker, Thomas; O'Neill, Luke A. J.; Dussurget, Olivier; Cossart, Pascale
title: Both TLR2 and TRIF Contribute to Interferon-β Production during Listeria Infection
date: 2012-03-14
journal: PLoS One
DOI: 10.1371/journal.pone.0033299
sha: 2305cbae32a50cf9923356cd30ca3152944d6d38
doc_id: 786
cord_uid: ty6lv18n

Synthesis of interferon-β (IFN-β) is an innate response to cytoplasmic infection with bacterial pathogens. Our recent studies showed that Listeria monocytogenes limits immune detection and IFN-β synthesis via deacetylation of its peptidoglycan, which renders the bacterium resistant to lysozyme degradation. Here, we examined signaling requirements for the massive IFN-β production resulting from the infection of murine macrophages with a mutant strain of L. monocytogenes, ΔpgdA, which is unable to modify its peptidoglycan. We report the identification of unconventional signaling pathways to the IFN-β gene, requiring TLR2 and bacterial internalization. Induction of IFN-β was independent of the Mal/TIRAP adaptor protein but required TRIF and the transcription factors IRF3 and IRF7. These pathways were stimulated to a lesser degree by wild-type L. monocytogenes. They operated in both resident and inflammatory macrophages derived from the peritoneal cavity, but not in bone marrow-derived macrophages. The novelty of our findings thus lies in the first description of TLR2 and TRIF as two critical components leading to the induction of the IFN-β gene and in uncovering that individual macrophage populations adopt different strategies to link pathogen recognition signals to IFN-β gene expression.

Detection of microbial pathogens by pattern recognition receptors, such as Toll-like receptors (TLRs) triggers innate immune responses as a first line of defense against infections [1] [2] [3] . Pathogen-associated molecular patterns (PAMPs) such as bacterial cell walls and their structural components induce a vast variety of biological effects in host organisms. The innate response against infection with intracellular pathogens includes the synthesis of type I IFNs (IFN-I). Whereas this cytokine family generally protects against viruses, its impact on bacterial infections can be either detrimental or advantageous for the host organism [4] .

Listeria monocytogenes is a bacterial pathogen which replicates in the cytoplasm of infected cells. Cytosolic pattern recognition receptors (PRRs) respond to cytosolic bacterial products and contribute to the induction of the innate immune response [5, 6] . Previous studies in bone marrow-derived macrophages (BMM) and epithelial cells show that in these cell types the synthesis of IFN-I in response to infection with L. monocytogenes is independent of TLRs and their adapters, relying exclusively on signals originating from cytosolic sensors [5] [6] [7] [8] . DNA as well as cyclic dinucleotides released from lysed bacteria were suggested to function as the relevant L. monocytogenes PAMPs [9] [10] [11] . Several cytosolic proteins with the ability to sense pathogen-derived nucleic acids have recently been described [11] [12] [13] [14] [15] [16] [17] [18] [19] . Cytosolic recognition of L. monocytogenes causes the activation of the serine/threonine kinase TBK1 and the phosphorylation of its substrate transcription factors IRF3 and IRF7 [7, 8] . Both IRF3 and IRF7 participate in the formation of an enhanceosome at the IFN-b promoter [20] .

During uptake by host cells L. monocytogenes is exposed to plasma membrane and endosomal TLRs. Among these, TLR2 which recognizes lipotechoic acids and lipopeptides, contributes to the innate response against infection [21] [22] [23] . Reportedly, TLR2 signals through the interacting adapter proteins Mal/TIRAP and MyD88 and does not contribute to the synthesis of type I IFN in Listeria-infected BMM [7] [8] [9] . Signaling through TRIF, an adapter protein known to connect TLRs 3 and 4 with the IFN-I genes was similarly ruled out for Listeria-infected BMM [7] .

In order to establish a successful infection, pathogens must survive host defense systems or else mitigate the activities of PRRs. Consequently, they have evolved to modify the structural components which normally trigger PRR responses. Bacterial PGN is a hetero-polymer consisting of alternating residues of b-1,4-linked N-acetylglucosamine and N-acetylmuramic acid to which a peptide chain is attached [24] . Interestingly, L. monocytogenes modifies its PGN, with fifty per cent of the muropeptide composition being N-deacetylated [25] . We previously reported that a PGN N-deacetylase gene, pgdA, is responsible for this modification [25] . PGN deacetylation confers resistance to the action of lysozyme, one of the most important and widespread antimicrobial agents of the innate defense system, thus preventing degradation and release of immunostimulants. A strain of L. monocytogenes mutated in its ability to alter its PGN, DpgdA, is sensitive to lysozyme and induces an enhanced IFN-b response in macrophages compared to the isogenic parental strain [25] .

The aim of the present study was to decipher the signaling pathways involved in this response to DpgdA infection. We reveal that IFN-b production in peritoneal macrophages requires TLR2 signaling and the TRIF adapter protein.

Listeria DpgdA mutant in a TLR2-dependent manner A L. monocytogenes pgdA mutant induced a much higher IFN-b response than the parental strain [25] . To definitively establish a role for the peptidoglycan deacetylase PgdA in the downregulation of IFN-b production, we complemented our original pgdA mutant with the wild-type gene and we measured IFN-b secretion of peptone elicited peritoneal macrophages (PEM) infected with wild-type EGDe, DpgdA and a complemented DpgdA strain (Fig. 1) . Inactivation of pgdA led to a strong induction of IFNb secretion in wild-type macrophages. In contrast, the complemented strain did not induce any massive IFN-b secretion, similar to wild-type EGDe. Thus, PgdA directly contributes to downregulation of IFN-b production.

Consistent with our previous report measuring secretion of IFNb protein in PEM, IFN-b mRNA synthesis induced by L. monocytogenes infection of PEM required TLR2 ( Fig. 2A) , while TLR2-deficient BMM showed no impairment in their synthesis of IFN-b mRNA (Fig. 2B) . Moreover, IFN-b secretion was strongly reduced in tlr2 2/2 PEM infected with both the DpgdA mutant ( Fig. 2C ) and the complemented DpgdA strain (Fig. 2D) , definitively establishing the TLR2 dependence of IFN-b production.

We next analyzed the pathways by which Listeria induces IFN-b. Our previous study and the above results strongly suggested the critical involvement of TLR2 [25] . TLR2 signaling depends on Mal/TIRAP and MyD88 adaptor proteins. We had previously shown that MyD88 contributed to full IFN-b induction by Listeria [25] . We then compared IFN-b production by wild-type and mal/ tirap 2/2 macrophages infected with EGDe or DpgdA (Fig. 3A) . Surprisingly, production of IFN-b was not decreased in infected macrophages deficient in Mal/TIRAP, indicating that the normal TLR2 adaptor Mal/TIRAP was not required for Listeria-mediated induction of IFN-b.

The adapter TRIF is employed by TLRs 3 and 4 to signal through the TBK1-IRF3/7-IFN-b pathway. There is no previous evidence of an association or functional interaction between TRIF and TLR2. In spite of this, the link between TRIF and the IRF pathway on the one hand, and the unusual employment of TLR2 for signaling to the IFN-b gene in PEM on the other suggested the possibility of a role for TRIF. To test this hypothesis we compared induction of IFN-b expression in wild-type and trif 2/2 PEM or BMM infected with EGDe or DpgdA strains. IFN-b induction strongly decreased in TRIF-deficient macrophages infected with any of the two Listeria strains compared to wild-type PEM, showing the requirement for TRIF (Fig. 3B ). In contrast, BMM showed a TRIF-independent IFN-b production (Fig. S1 ).

The PEM used in our studies are recruited to the peritoneal cavity by injection of the sterile irritant proteose peptone. Hence they differ from BMM not only regarding their anatomical location, but also their partially inflammatory character. To distinguish which of these differences was responsible for the TLR2 and TRIF signaling pathways, we examined IFN-b production by resident PEM. Figure 3C demonstrates a requirement for TLR2 and TRIF by the resident macrophage population. Thus, location to the peritoneal cavity rather than inflammatory character determines the difference in signaling to the IFN-b gene between BMM and PEM.

To examine the role of TLR3, which uses TRIF to trigger IFNb synthesis, we compared induction of IFN-b in wild-type and tlr3 2/2 PEM infected with EGDe or DpgdA strains. IFN-b production was decreased in TLR3-deficient PEM infected with EGDe or DpgdA (Fig. 4A) . We also compared induction of IFN-b in wild-type and tlr4 2/2 PEM infected with EGDe or DpgdA strains, as TLR4 can mediate TRIF-dependent synthesis of IFN-b. In contrast to TLR3-deficient PEM, TLR4-deficient PEM did not show a decrease in IFN-b response to EGDe or DpgdA (Fig. 4B ). Thus, IFN-b induction in response to Listeria infection relies in part on TLR3 and does not require TLR4.

Induction of IFN-b via TLR2 is no longer an exception. It has recently been shown that vaccinia virus-induced IFN-b production was dependent on TLR2 signaling and it was reported that this was occuring from late endosomes [26] . To investigate if an intracellular localization was also required in the case of Listeria, we pretreated cells with cytochalasin D to prevent internalization and measured IFN-b secretion by macrophages infected with EGDe or the DpgdA mutant (Fig. 5A ). In both cases, IFN-b induction was strongly reduced. Thus, internalization is critical for Listeriamediated IFN-b production. We also used dynasore, a dynamin inhibitor and chloroquine, which inhibits endosome acidification, and measured IFN-b induction in macrophages infected with EGDe or the DpgdA mutant ( Fig. 5B -C). IFN-b synthesis was strongly diminished by both dynasore and chloroquine treatments. Together, these results suggest that the TLR2-dependent IFN-b induction is triggered intracellularly.

In BMM rapid synthesis of IFN-b is entirely dependent on IRF3, but not on IRF7, whereas in bone marrow-derived myeloid DC IFN-b synthesis requires both IRF3 and IRF7 [27] . We investigated the role of IRF3 and IRF7 in the production of IFN-b by PEM. To this end we infected irf3 2/2 and irf7 2/2 macrophages with EGDe or the DpgdA strains. Inactivation of IRF3 totally abrogated IFN-b mRNA induction in response to both strains (Fig. 6 ). IFN-b induction in IRF7-deficient macrophages was also strongly affected highlighting the important role of both transcription factors in response to Listeria infection (Fig. 6 ). PEM thus resemble bone marrow-derived myeloid DC, not BMM, in relation to their IRF requirement for Listeria-mediated IFN-b synthesis.

In addition to IRF3/7, NFkB contributes to the formation of the IFN-b enhanceosome [20, 28] . We therefore examined the involvement of the NFkB pathway by measuring induced synthesis of an NFkB-dependent mRNA. IkB is an NFkB-dependent gene and thus a read-out for NFkB activation in response to Listeria infection. We measured the induction of IkB expression in PEM infected with EGDe or the DpgdA mutant. Both strains induced IkB expression and this required internalization as treatment with dynasore reduced the level of IkB induction (Fig. 7A) . Degradation of the IkB protein was examined in PEM infected with EGDe by immunoblot using anti-IkB antibodies. IkB level was reduced rapidly after infection of wild-type PEM (Fig. S2A ). In contrast, IkB degradation was not observed in tlr2 2/2 PEM infected with Listeria (Fig. S2B ). Infection of wild-type, tlr2 2/2 and trif 2/2 macrophages with EGDe or DpgdA showed that both TLR2 and the adaptor were required for full induction of IkB mRNA in response to EGDe and DpgdA strains (Fig. 7B) . These results suggest that TLR2 and TRIF contribute to NFkB activation. The comparison between EGDe and DpgdA strains showed that both caused similar magnitudes of IkB mRNA synthesis. Thus, the activation of NFkB by Listeria is independent of PgdA, suggesting that the increased IFN-b production after infection with DpgdA relies on activation of other transcription factors such as IRFs.

Nucleic acids released intracellularly are critical for IFN-b induction TLR2 or TRIF deficiency strongly reduced, but did not completely shut off IFN-b synthesis. This suggested a potential contribution of intracellular, nucleic acid-dependent pathways to IFN-b synthesis, particularly after infection with DpgdA. We therefore examined whether these pathways are able to signal in PEM.

Since inactivation of PgdA increases Listeria sensitivity to peptidoglycan-targeting antimicrobials such as lysozyme, and thus induces bacterial degradation, we measured the DNA and RNA released by EGDe and DpgdA strains following lysozyme exposure. As expected, DpgdA released significantly higher amounts of DNA and RNA than wild-type and complemented DpgdA strains, raising the possibility that both DNA and RNA could be involved in IFNb production (Fig. 8A) . We thus measured IFN-b induction in THP1 macrophages transfected with Listeria DNA, either undigested or treated with DNase. Intact but not DNase-treated DNA significantly induced IFN-b (Fig. 8B ). Macrophages were then transfected with lysozyme-digested EGDe or DpgdA, either untreated or digested with DNase. Treatment with DNase significantly reduced IFN-b production (Fig. 8C) . Taken together, these results show that Listeria DNA can induce IFN-b, strongly indicating that destruction of DpgdA bacteria intracellularly activates DNA sensors.

We had recently reported that a PGN modification involving a N-deacetylase gene, pgdA, was playing a key role in L. monocytogenes virulence [25] . A DpgdA strain of L. monocytogenes which is unable to modify its PGN, was shown to be extremely sensitive to the bacteriolytic activity of lysozyme, normally found within macrophage vacuoles and its virulence was strongly attenuated [25] . Furthermore, this mutant induced a much higher TLR2dependent IFN-b response than the parental strain [25] . We hypothesised that this unconventional IFN-b response induced by the pgdA mutant was due to an enhanced accessibility of bacterial cell wall components to TLR2. Here we have shown that IFN-b production requires bacterial internalization and is triggered by Mal/TIRAP-independent pathways which involve TLR2, TRIF, IRF3 and IRF7.

It was surprising to see a role for TLR2, as, based on results in BMM and epithelial cells, type I IFNs production is usually not known to result from TLR2 signaling [5] [6] [7] [8] . Classical TLR2 signaling leads to NF-kB-dependent production of inflammatory cytokines [21] . However, in support of an unconventional role for TLR2, recent studies reported roles for TLR2-dependent induction of IFN-b in response to vaccinia virus or synthetic ligands [26, 29] . In the vaccinia virus study, a specific inflammatory monocyte population -Ly6C hi -was shown to be the source of IFNb [26] . In the present study we show that TLR2-dependent IFN-b synthesis is a property of both resident and recruited inflammatory PEM. Furthermore, the two previous studies documented that TLR2 activation of type I IFN responses to TLR ligands occurs within intracellular compartments, and that TLR2 signals from the phagosome in response to viral infection or synthetic TLR2 ligands [26, 29] . These results challenged the view that TLR2 signals solely from the plasma membrane. In our experiments, pretreatment of PEM with either cytochalasin D, an inhibitor of actin polymerization and thus internalization, dynasore, an inhibitor of the endocytic effector dynamin, or chloroquine, which inhibits endosome acidification [30, 31] , significantly impaired the induction of IFN-b following Listeria infection, strongly suggesting that phagocytosis of L. monocytogenes and intracellular location of TLR2 trigger this response. These observations also correlate with our early hypothesis that the inflammatory response induced by DpgdA is due to an enhanced release or accessibility of bacterial cell wall components to TLR2.

Induction of the IFN-b gene was independent of the TLR adapter Mal/TIRAP, but, unexpectedly required the TLR3/4 adapter TRIF. Francisella tularensis has recently been shown to signal through TLR2 from the phagosome in a Mal/TIRAP independent manner [32] , and it was shown that Mal/TIRAP is dispensable in TLR2 signaling at high concentrations of ligands [33] . Thus our study reinforces the view that TLR2 can act independently from Mal/TIRAP. In addition our report suggests a synergy between a TLR2 pathway and TRIF, an adapter previously known to trigger the synthesis of pro-inflammatory cytokines and type I IFNs upon engagement of TLR3 and TLR4. TLR3 is known to bind viral dsRNA to induce secretion of type I IFN and lead to control of viral infections [3, 34, 35] . To our knowledge Chlamydia muridarum is the only bacterium reported to induce a TLR3-dependent IFN-b response specifically in murine oviduct epithelial cells [36] . We tested whether the dual requirement for TLR2 and TRIF resulted from a functional or physical interaction between TLR2 and TLR3. In fact, IFN-b production was reduced in TLR3-deficient macrophages, but significantly less so than in trif2/2 PEM. Therefore, there is no evidence for a putative TLR2/TLR3 interaction. Another possibility to incorporate TRIF into the pathway stimulated in PEM by Listeria would be a cooperation of TLR2 and TLR4. This was ruled out by showing that Listeria-infected tlr4 2/2 PEM produced a similar amount of IFN-b as their wild-type counterparts. TRIF could possibly orchestrate an additional pathway. Along these lines, TRIF has recently been shown to be required for IFN-b synthesis by dendritic cells upon activation of the cytosolic receptor complex DDX1/DDX21/DDX36 by viral RNA [19] .

Engagement of TLRs by various microbe-associated molecular patterns induces activation and translocation to the nucleus of NF-kB, IRF3, IRF7 and/or activator protein-1 (AP-1), which collaborate to induce transcription of type I IFNs [37] . We addressed the role of these transcriptional activators in the IFN-b response to wild-type Listeria and DpgdA, and revealed that inactivation of IRF3 totally abrogated this response to both strains while IFN-b induction was significantly but not totally impaired in IRF7-deficient macrophages, indicating that both of these transcription factors are required for induction of IFN-b following infection with L. monocytogenes. We also assessed the involvement of NF-kB in this response using induction of the IkB gene as a readout. We observed an induction of IkB expression in macrophages which was similar after infection with EGDe or DpgdA. Thus, activation of NF-kB by Listeria is independent of PgdA, strongly suggesting that the elevated IFN-b production by the DpgdA mutant mostly relies on IRF3.

The increased IFN-b response to the DpgdA strain probably results from the fact that within the phagosome, its lysozymesensitive cell wall is degraded, releasing PAMPs able to interact with TLR2 and other PRRs, including cytoplasmic ones. As recent studies have highlighted novel DNA-sensing pathways in the induction of type I IFNs [9, [14] [15] [16] [17] 38] , we thus also investigated the involvement of bacterial nucleic acids in the IFN-b induction, Firstly, we showed that inactivation of PgdA, which confers a higher susceptibility to lysozyme, leads to increased release of DNA. We then showed that DNA from L. monocytogenes can induce IFN-b expression in PEM, suggesting that this macrophage population employs cytoplasmic nucleic acid sensing similar to macrophages or macrophage lines derived from different anatomical locations [9, 38] . Which -if any-of the recently described nucleic acid sensors are used by PEM for the recognition of Listeria DNA remains subject to future investigation. Nevertheless, other bacterial components could participate in IFN-b production upon infection with the DpgdA mutant. For example, the second messenger molecule cyclic diadenosine monophosphate (c-di-AMP), was shown to be secreted by Listeria multidrug efflux pumps triggering type I IFN response [10] and could be involved in the process.

In conclusion, this study describes a novel mechanism leading to induction of type I IFNs in which intracellular sensing plays an important role, ultimately showing how these different recognition pathways can synergise to induce innate immune responses which are required to control infection. In this regard cooperation between TLR2 and TRIF may reflect the need for convergence of the NF-kB and IRF pathways at the IFN-b promoter, with TLR2 being responsible mainly for NF-kB activation and TRIF being instrumental for activation of IRF3 and IRF7. By employing the strategy of PGN modification, L. monocytogenes can avoid immune detection by TLR and evade the innate immune response, thus enabling the infectious process to occur. It is important to recall that pgdA orthologs are found in other pathogenic bacteria, such as Streptococcus pneumoniae, Bacillus cereus, Bacillus anthracis and Helicobacter pylori, strongly suggesting that PGN N-deacetylation is a general mechanism evolved by microbes to escape from pattern recognition receptor-mediated immune recognition [39] [40] [41] [42] .

Bacterial strains and growth conditions L. monocytogenes EGDe (BUG1600, ATCC BAA-679), L. monocytogenes isogenic mutant DpgdA (BUG2288, [25] ) and L. monocytogenes DpgdA complemented strain (BUG2382) were grown in brain heart infusion (BHI, Oxoid), aerobically at 37uC and 200 rpm.

A DNA fragment containing the pgdA gene (lmo0415) and its promoter was generated by PCR using oligonucleotides lmo0415-1 (59-AAGGATCCCACAATATGTTAGTTTTCAGGGG-39) and lmo0415-2 (59-AAGGATCCTTATTTCACCATTCTT-GAATCTG-39). The fragment was integrated into pCR-Blunt-II-TOPO (Invitrogen) and the construct was verified by sequencing. After digestion of the construct by BamHI, the fragment was purified on agarose gel and cloned into the integrative vector pPL2 [43] , previously digested by BamHI, constructing pOD98. The pOD98 was electroporated into DpgdA at 2,500 V, 200 V and 25 mF. Transformants were selected at 37uC on BHI agar containing chloramphenicol (7 mg/mL). The presence of the pgdA gene in the complemented strain was confirmed by PCR using oligonucleotides lmo0415-1 and lmo0415-2.

Mice were used for obtaining peptone-elicited peritoneal macrophages, resident peritoneal macrophages and bone marrow-derived macrophages. Animal experiments were performed in accordance with protocols approved by the Animal Experimentation Ethics Committee of the Institut Pasteur (permit #03-49) and following Austrian law in accordance with protocols approved by the Ethics Committee of the University of Veterinary Medicine, Vienna (#GZ680 205/67-BrGt/2003).

Isolation and culture of murine peptone-elicited peritoneal macrophages (PEM) PEM were isolated from 7 to 10 week-old C57BL/6J and genetically-matched tlr2 2/2 , tlr3 2/2 , tlr4 2/2 , mal/tirap 2/2 , trif 2/2 , irf3 2/2 and irf7 2/2 mice as previously described [44] . The percentage of macrophages was determined by flow cytometry using CD11b (1:100, eBiosciences) and F4/80 (1:100, eBiosciences) antibodies. More than 90% of the cells were macrophages. PEM were seeded onto 6-well plates at a concentration of 2610 6 cells per well in DMEM (PAA) supplemented with 10% FCS, 10% L929 conditioned medium (LCM) and 1% penicillin-streptomycin or RPMI-1640 (Gibco) supplemented with 10% FBS and 1% penicillin-streptomycin.

Resident macrophages were isolated from 6 to 8 week-old C57BL/6J and genetically-matched tlr2 2/2 , trif 2/2 mice by washing the peritoneum twice with 10 mL DMEM (PAA) supplemented with 10% FBS, 10% LCM and 1% penicillinstreptomycin. Harvested cells were centrifuged at 300 g for 5 minutes and resuspended in complete medium. The percentage of macrophages was determined by flow cytometry analysis as above. Cells were seeded onto 6-well plates (Nunc) at a concentration of 2610 6 cells per well.

Tibia and femur from 6 to 8 week-old C57BL/6J and genetically-matched tlr2 2/2 , trif 2/2 mice were collected in ice cold PBS. Bones were sterilized with 70% ethanol and flushed with a 25-G needle using cold DMEM supplemented with 10% FCS, 10% LCM and 1% penicillin-streptomycin. Cells were seeded onto 6-well plates (Nunc) at a concentration of 10 6 cells per well and incubated at 37uC with 5% CO 2 . After 4 days, complete medium was added and cells were split at a ratio of 1:2. After 8 days, macrophages were fully differentiated.

Human acute monocytic leukemia THP-1 cells (ATCC TIB202) were maintained in RPMI-1640 supplemented with 10% FBS and 1% penicillin-streptomycin. Cells were seeded onto a 24-well plate at a concentration of 4610 5 cells per well in antibiotic-free media supplemented with 12.5 ng/mL phorbol myristate acetate and incubated for 24 h at 37uC with 5% CO 2 . Differentiation was determined to be successful upon formation of a confluent adherent monolayer. HEK-blue type I IFN cells (Invivogen) were grown in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin. Cells were seeded at a concentration of 5.6610 4 cells per well onto a 96-well plate.

For cytokine analysis, macrophages were infected with Listeria strains at MOI 10:1, centrifuged at 300 g for 2 min and incubated at 37uC for 15 min. Following phagocytosis, monolayers were washed twice followed by incubation in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) and gentamicin (20 mg/mL). Supernatants were collected at various time points, for detection of IFN-b by ELISA. For transcript analysis, macrophages were infected with Listeria strains at MOI 20:1 and incubated at 37uC for 1 h to allow phagocytosis. Monolayers were washed and incubated in DMEM supplemented with 10% FCS and gentamicin (5 mg/mL). After 2 h, medium was changed to DMEM supplemented with 10% FCS and gentamicin (1 mg/mL). Cells were lysed at various time points and RNA collected for qPCR analysis.

For inhibition of bacterial internalization, cell monolayers were pretreated either for 2 h with 100 mM cytochalasin-D (Sigma-Aldrich), or 30 min with 80 mM dynasore (Sigma-Aldrich) or 30 min with 100 mM chloroquine (Sigma-Aldrich) prior to infection assays.

Listeria were grown overnight in BHI at 37uC and cultures were centrifuged at 8000 g for 5 min. Bacterial pellets were resuspended in 75 mg/mL lysozyme and incubated at 37uC for 1 h. DNA was then extracted using the DNeasy blood and tissue kit (Qiagen) and quantified by spectrophotometry (Nanodrop). For transfection assays, THP-1 macrophages were transfected with 200 ng/mL DNA with 2% lipofectamine 2000 (Invitrogen) and incubated for 24 h. Following incubation, supernatants were collected for IFN-b analysis. For pretreatment of DNA with DNase, DNase was added at final concentration of 100 mg/mL for 45 min at 37uC.

Bacterial cultures were treated with 10 mg/mL lysozyme, a concentration leading to lysis of DpgdA but not EGDe, and incubated at 37uC and 200 rpm for 1 h. Following lysozyme treatment, lysed bacterial cultures were centrifuged at 5000 rpm during 10 min. Two types of experiments were performed on supernatants. First, nucleic acid release was quantified. DNA was purified using the Qiagen DNeasy blood and tissue kit omitting lysis steps and quantified by spectrophotometry (Nanodrop). RNA was purified using Qiagen RNeasy kit and quantified by spectrophotometry (Nanodrop). Data shown are representatives of at least three independent experiments. Second, 100 mL of each supernatants were treated by DNase during 30 min at 37uC. Enzymes were inactivated and treated-or untreated-supernatants were transfected in PEM. 8 h after transfection, supernatants of cells were recovered and the IFNb was quantified.

Detection of type I IFN by ELISA and HEK-blue type I IFN cell assay Murine IFN-b production was detected in macrophage supernatants by ELISA according to the manufacturer's procedure (PBL Biomedical Laboratories). For the HEK-blue type I IFN assay, supernatant from THP-1 macrophage assays was collected and 20 mL added onto HEK-blue type I IFN cells plated in 96-well plates, which were incubated at 37uC overnight. Supernatant from HEK-blue cells was collected and 40 mL added to 160 mL of Quanti-blue reagent (Invivogen) for 20 min at 37uC. The colorimetric reaction was measured at 625 nm on a plate reader. Data was normalised against absorbance for the untreated cells and plotted as relative fold increases. Data shown are representatives of at least three independent experiments.

PEM from WT or tlr2 2/2 C57BL/6J mice were infected with EGDe. Cells were lysed 0, 0.5, 1, 1.5, 2, 2.5, or 3 h post-infection. IkB and tubulin were detected in lysates by immunoblotting using anti-IkB (Santa Cruz, 1:100) and anti-a-tubulin (Sigma, 1:5000) antibodies.

RNA preparation was performed using NucleoSpin RNA II kit (Macherey-Nagel) according to the manufacturer's instructions. Quantitative real-time PCR was performed on a Mastercycler EP realplex S (Eppendorf). Primers for HPRT (housekeeping gene control), IFNb and IkBa mRNA expression were as follows: HPRT forward GTTGGATACAGGCCAGACTTTGTTG, HPRT reverse GAGGGTAGGCTGGCCTATTGGCT, IFNb forward 59-TCAGAATGAGTGGTGGTTGC-39, IFNb reverse 59-GACCTTTCAAATGCAGTAGATTCA-39; IkBa forward 59-GCAATTTCTGGCTGGTGGG-39, IkBa reverse 59GATCC-GCCAGGTGAAGGG-39. Data shown are representatives of at least three independent experiments.

Results are expressed as means of at least three values, with error bars representing standard deviations. Student's t tests were performed to determine statistical significance where * indicates P,0.05, ** indicates P,0.01 and *** indicates P,0.0001. Figure S1 TRIF is not required for IFN-b response to Listeria in bone marrow macrophages. BMM from C57BL/6J or trif 2/2 mice were infected with the parental EGDe strain (black bars) or the DpgdA mutant (grey bars). After 4 h of infection, IFN-b induction was measured by qRT-PCR. Data are mean 6 SD (NS, non significant, n = 3). (EPS) Figure S2 TLR2 is required for optimal activation of NF-kB. (A) PEM from WT C57BL/6J mice were infected with EGDe. Cells were lysed 0, 0.5, 1, 1.5, 2, 2.5, or 3 h post-infection. Activation of NF-kB was measured by determination of IkB degradation relative to tubulin following immunodetection. (B) PEM from tlr2 2/2 mice were infected with EGDe. Cells were lysed 0, 0.5, 1, 1.5, 2, 2.5, or 3 h post-infection. Activation of NF-kB was measured by determination of IkB degradation relative to tubulin following immunodetection. (EPS)

TLRs, NLRs and RLRs: a trinity of pathogen sensors that co-operate in innate immunity

Innate recognition of intracellular pathogens: detection and activation of the first line of defense

Pathogen recognition and inflammatory signaling in innate immune defenses

The Yin and Yang of type I interferon activity in bacterial infection

A specific gene expression program triggered by Gram-positive bacteria in the cytosol

Innate recognition of bacteria by a macrophage cytosolic surveillance pathway

IFN regulatory factor 3-dependent induction of type I IFNs by intracellular bacteria is mediated by a TLR-and Nod2-independent mechanism

Immune activation of type I IFNs by Listeria monocytogenes occurs independently of TLR4, TLR2, and receptor interacting protein 2 but involves TNFR-associated NF kappa B kinase-binding kinase 1

Recognition of cytosolic DNA activates an IRF3-dependent innate immune response

) c-di-AMP secreted by intracellular Listeria monocytogenes activates a host type I interferon response

STING is a direct innate immune sensor of cyclic di-GMP

Intracellular DNA recognition

RIGorous detection: exposing virus through RNA sensing

RIG-I-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-transcribed RNA intermediate

RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway

IFI16 is an innate immune sensor for intracellular DNA

The cytosolic nucleic acid sensor LRRFIP1 mediates the production of type I interferon via a b-catenindependent pathway

DNA makes RNA makes innate immunity

DDX1, DDX21, and DHX36 helicases form a complex with the adaptor molecule TRIF to sense dsRNA in dendritic cells

An atomic model of the interferonbeta enhanceosome

The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors

CD14 works with Toll-like receptor 2 to contribute to recognition and control of Listeria monocytogenes infection

Toll-like receptor 2 is required for optimal control of Listeria monocytogenes infection

Structural variation in the glycan strands of bacterial peptidoglycan

A critical role for peptidoglycan N-deacetylation in Listeria evasion from the host innate immune system

Toll-like receptor 2 on inflammatory monocytes induces type I interferon in response to viral but not bacterial ligands

Characterization of the interferon-producing cell in mice infected with Listeria monocytogenes

The enhanceosome

Murine Toll-like receptor 2 activation induces type I interferon responses from endolysosomal compartments

Chloroquine is a potent inhibitor of SARS coronavirus infection and spread

Toll-like receptor 9 binds single-stranded CpG-DNA in a sequence-and pH-dependent manner

Phagosomal retention of Francisella tularensis results in TIRAP/Mal-independent TLR2 signaling

MyD88 adaptor-like is not essential for TLR2 signaling and inhibits signaling by TLR3

Structural basis of Toll-like receptor 3 signaling with double-stranded RNA

Role of adaptor TRIF in the MyD88-independent Tolllike receptor signaling pathway

The Chlamydia muridarum-induced IFN-beta response is TLR3-dependent in murine oviduct epithelial cells

Innate immune responses: crosstalk of signaling and regulation of gene transcription

TLR-independent type I interferon induction in response to an extracellular bacterial pathogen via intracellular recognition of its DNA

Peptidoglycan N-acetylglucosamine deacetylases from Bacillus cereus, highly conserved proteins in Bacillus anthracis

The pgdA gene encodes for a peptidoglycan N-acetylglucosamine deacetylase in Streptococcus pneumoniae

Peptidoglycan N-acetylglucosamine deacetylase, a putative virulence factor in Streptococcus pneumoniae

Oxidative stress-induced peptidoglycan deacetylase in Helicobacter pylori

Construction, characterization, and use of two Listeria monocytogenes site-specific phage integration vectors

Role of transferrin, transferrin receptors, and iron in macrophage listericidal activity

We thank members of the Cossart laboratory for helpful discussions.