key: cord-0000035-kvhoa2se
authors: Suzuki, T; Ueda, T; Watanabe, K
title: The 'polysemous' codon--a codon with multiple amino acid assignment caused by dual specificity of tRNA identity.
date: 1997-03-03
journal: EMBO J
DOI: 10.1093/emboj/16.5.1122
sha: ada57a9f084a016deb20b6f83c442072e6e37955
doc_id: 35
cord_uid: kvhoa2se

In some Candida species, the universal CUG leucine codon is translated as serine. However, in most cases, the serine tRNAs responsible for this non-universal decoding (tRNA(Ser)CAG) accept in vitro not only serine, but also, to some extent, leucine. Nucleotide replacement experiments indicated that m1G37 is critical for leucylation activity. This finding was supported by the fact that the tRNA(Ser)CAGs possessing the leucylation activity always have m1G37, whereas that of Candida cylindracea, which possesses no leucylation activity, has A37. Quantification of defined aminoacetylated tRNAs in cells demonstrated that 3% of the tRNA(Ser)CAGs possessing m1G37 were, in fact, charged with leucine in vivo. A genetic approach using an auxotroph mutant of C.maltosa possessing this type of tRNA(Ser)CAG also suggested that the URA3 gene inactivated due to the translation of CUG as serine was rescued by a slight incorporation of leucine into the polypeptide, which demonstrated that the tRNA charged with multiple amino acids could participate in the translation. These findings provide the first evidence that two distinct amino acids are assigned by a single codon, which occurs naturally in the translation process of certain Candida species. We term this novel type of codon a 'polysemous codon'.

(termed tRNA Ser CAG), and revealed its decoding mechan-Bioscience and Biotechnology, Tokyo Institute of Technology, ism by means of an in vitro translational assay system Nagatsuta, Midori-ku, Yokohama 227, Japan (Yokogawa et al., 1992; Suzuki et al., 1994) . Furthermore, 2 Corresponding authors when we investigated the distribution of this non-universal genetic code in fungi, as well as C.cylindracea, eight other In some Candida species, the universal CUG leucine

Candida species-C.albicans, C.zeylanoides, C.lusitaniae, codon is translated as serine. However, in most cases, C.tropicalis, C.melbiosica, C.parapsilosis, C.guilliermonthe serine tRNAs responsible for this non-universal dii and C.rugosa-were found to utilize the codon CUG decoding (tRNA Ser CAG) accept in vitro not only serine, for serine instead of leucine, all having tRNA Ser CAG as but also, to some extent, leucine. Nucleotide replacethe mediator in the unusual decoding (Ohama et al., 1993 ; ment experiments indicated that m 1 G37 is critical for Ueda et al., 1994) . Several other investigators have also leucylation activity. This finding was supported by the shown that the codon CUG is actually translated as serine fact that the tRNA Ser CAGs possessing the leucylation in vivo in C.albicans and C.maltosa (Santos and Tuite, activity always have m 1 G37, whereas that of Candida 1995a; Sugiyama et al., 1995; Zimmer and Schunck, 1995) .

One of the most remarkable structural features observed A37. Quantification of defined aminoacetylated tRNAs in most of these tRNA Ser CAGs is that the nucleotide 5Јin cells demonstrated that 3% of the tRNA Ser CAGs adjacent to the anticodon (position 33) is occupied not by possessing m 1 G37 were, in fact, charged with leucine the conserved U residue (U33) but by a G residue (G33).

It has been speculated that U33 is necessary for forming of C.maltosa possessing this type of tRNA Ser CAG also the U-turn structure of the anticodon loop in all tRNAs suggested that the URA3 gene inactivated due to the reported so far (Quigley and Rich, 1976 ; Sprinzl et al., translation of CUG as serine was rescued by a slight 1996) . Moreover, the nucleotide at position 37, 3Ј-adjacent incorporation of leucine into the polypeptide, which to the anticodon CAG, is 1-methyl guanosine (m 1 G) in demonstrated that the tRNA charged with multiple almost all tRNA Ser CAGs except for that of C.cylindracea amino acids could participate in the translation. These (A37), while all the serine tRNAs in fungi corresponding findings provide the first evidence that two distinct Introduction Normanly and Abelson, 1989; Shimizu et al., 1992; McClain, 1993; Schimmel et al., 1993) . This line of study The universality of the genetic code was once considered began with the artificial conversion of leucine tRNA of to be one of the essential characteristics of life, which led Escherichia coli to serine tRNA by Abelson's group 10 to the conception of the 'frozen accident theory'. This years ago (Normanly et al., 1986) . Recently, tRNA identity theory proposes that all extant living organisms use the elements of Saccharomyces cerevisiae leucine tRNA were universal genetic code, which was born by accident and elucidated using unmodified variants synthesized by T7 'frozen', and that they originate from a single, closely RNA polymerase (Soma et al., 1996) , indicating that in interbreeding population (Crick, 1968) . However, in recent addition to the discriminator base, A73, the second letter years a number of non-universal genetic codes have been of the anticodon, A35, and the nucleotide 3Ј-adjacent to reported in various non-plant mitochondrial systems, as the anticodon, m 1 G37, are important for recognition by well as in several nuclear systems (reviewed in Osawa leucyl-tRNA synthetase (LeuRS). The majority of Candida et al., 1992; Osawa, 1995) , which contradict the frozen tRNA Ser CAGs have A35 and m 1 G37, while the discriminaccident theory.

Among these deviations from the universal codes, ator is occupied by a nucleoside other than adenosine (mostly G73). In this respect, tRNA Ser CAG seems to be a potentially chimeric tRNA molecule capable of being recognized not only by seryl-but also by leucyl-tRNA synthetases.

Previously, we showed that these tRNA Ser CAGs would have originated from the serine tRNA corresponding to codon UCG . This suggests an evolutionary pathway in which conversion from A to m 1 G would have taken place at position 37 just after the emergence of tRNA Ser CAG had brought about a change in the universal code. Since such a mutation at position 37 might potentially result in the leucylation of tRNA Ser CAG, we attempted to elucidate the charging properties of these tRNA Ser CAGs both in vitro and in vivo. Based on the results of in vitro aminoacylation reactions using tRNA variants constructed by the microsurgery method, the direct analysis of aminoacylated tRNAs in cells and a genetic approach, we demonstrate here that these serine tRNAs are actually leucylated both in vitro and in vivo. Furthermore, m 1 G at position 37 was found to be indispensable for the leucylation of tRNA Ser CAGs. In fact, the tRNA Ser CAG of C.cylindracea, which has A at position 37, exhibits no leucylation activity. C.cylindracea has a high GϩC content (63%) and utilizes CUG as a major serine codon. However, the other Candida species have no such high GϩC content and utilize the CUG as a minor serine codon (Kawaguchi et al., 1989; Lloyd and Sharp, 1992; our unpublished observation) . Considering the relationship between the usage of the codon CUG as serine and the leucylation properties of tRNA Ser CAG, it seems that only Candida species with a genome in which the incidence of the CUG serine codon is very low possess serine tRNA Ser CAG that can be leucylated. Furthermore, such tRNA Ser CAGs charged with heterogeneous amino acids should be utilized equally in the translation process. This is the first demonstration that a single tRNA species is assigned to two different amino acids in the cell. We propose designating this type of codon having multiple amino acid assignment as a 'polysemous codon'. The correlation between the dual-assignment state and the pathway of genetic code diversification is also discussed. 

and C.cylindracea (Yokogawa et al., 1992; Ohama et al., 1993 ). The numbering system and abbreviations for modified nucleotides conform Candida zeylanoides tRNA Ser CAG is leucylated to Sprinzl et al. (1996) and Crain and McCloskey (1996), respectively. in vitro (B) Time-dependent aminoacylation with SerRS or LeuRS from First the leucylation of tRNA Ser CAGs from C.zeylanoides C.zeylanoides cells. Aminoacylation reactions were carried out with and C.cylindracea was examined using LeuRS partially 0.7 µM tRNAs and with same amounts of enzyme activities calculated using cognate tRNAs. Serylation and leucylation are shown by dotted purified from C.zeylanoides, since it is known that leucine and solid lines, respectively. The right-hand frame shows the solid tRNAs of yeast have one of their identity determinants at curves from left-hand frame plotted with an enlarged ordinate. The position 37 (Soma et al., 1996) and tRNA Ser CAGs of aminoacylation of C.zeylanoides tRNA Ser CAG (s) and of C.zeylanoides and C.cylindracea have different nucleo-C.cylindracea tRNA Ser CAG (u) are compared; C.cylindracea tRNA Ser GCU (j), having no leucylation activity, is shown as a tides at this position (m 1 G and A, respectively) (Figure control. (C) TLC analysis of acetylleucyl-tRNA fragments derived 1A). Both tRNAs showed almost full serylation activity from leucylated tRNA Ser CAGs. After leucylation with [ 14 C]leucine, (~1200-1500 pmol/A 260 unit), as shown in Figure 1B . The leucyl-tRNAs were acetylated with acetic anhydride. Acetyl-tRNA Ser CAG of C.zeylanoides was evidently leucylated leucylated at all, as was the case when another species tRNA Ser CAG by gel-electrophoresis under acidic con- observed with LeuRSs from both C.cylindracea and S.cerevisiae (data not shown). of serine tRNA specific for codon AGY (Y: U or C) m 1 G37 is responsible for recognition by (tRNA Ser GCU) was employed as a control substrate leucyl-tRNA synthetase ( Figure 1B , right-hand graph). The K m value of C.zeylan-Among the tRNA Ser CAGs of several Candida species, oides LeuRS towards tRNA Ser CAG (5.0 µM) is only one that of C.cylindracea is unique because it alone possesses order of magnitude larger than that of the serylation of no leucylation capacity. A sequence comparison of these this tRNA (0.22 µM) as well as that of leucylation toward tRNAs ( Figure 1A ) prompts us to speculate that the the cognate leucine tRNAs of S.cerevisae (0.34 µM; Soma nucleotide at position 37 is strongly associated with et al., 1996) .

leucylation, because all tRNA Ser CAGs possessing leucyl-In order to verify that the leucylation activity observed ation activity have m 1 G in common, while only the for the tRNA Ser CAG of C.zeylanoides actually came from tRNA Ser CAG of C.cylindracea, which possesses no leucylthe tRNA Ser CAG itself, and not from a trace amount ation activity, has A at this position. of leucine tRNA contaminating the tRNA sample, the To examine the validity of this speculation, a series of leucylated 3Ј-terminal RNA fragment derived from leucyl-tRNA Ser CAG variants was constructed by the in vitro tRNA Ser CAG was analyzed in the following manner. 14 Ctranscription method using T7 RNA polymerase, as well leucylated tRNA Ser CAG from C.zeylanoides was first as by the microsurgery method, and the leucylation activity acetylated with acetic anhydride to prevent deacylation, of each variant was measured. When the tRNA Ser CAG of and then digested with RNase T1. The resulting 3Ј-C.zeylanoides synthesized by in vitro transcription was terminal fragment with 14 C-labeled acetylleucine was employed as a substrate, no leucylation activity was analyzed by cellulose TLC. The results are shown in detected, not even for the tRNA transcript having G37 Figure 1C . If leucylated tRNA Ser CAG were digested ( Figure 3A ). On the other hand, as shown in Figure 3A , with RNase T1, 14 C-labeled acetylleucyl-CCA should be serylation activity exceeded 1000 pmol/A 260 unit. These released as a labeled fragment ( Figure 1C , lane 3), because results strongly suggested that some nucleoside modifica-G is located at position 73 of the tRNA Ser CAG (Figure tion is necessary in tRNA Ser CAG for recognition by 1A, left-hand structure). Any contaminated leucine tRNAs, LeuRS. We thus attempted to replace the m 1 G37 of if they exist, will give some 14 C-labeled fragments larger C.zeylanoides tRNA Ser CAG with G (the variant is symbolthan the tetramer ( Figure 1C , lane 4), because all the ized as m 1 G37G) or A (m 1 G37A), by the microsurgery leucine tRNAs of yeasts so far analyzed (Sprinzl et al., method (Figure 2A and B; for details, see Materials 1996) including those of C.zeylanoides (T. Suzuki, unpuband methods) to examine the contribution of m 1 G37 to lished result) are known to have A73 at their 3Ј-ends, leucylation and the contribution of A37 of C.cylindracea which are resistant to RNase T1. The mobility of the tRNA Ser CAG to the prevention of leucylation. acetylleucyl-oligonucleotide derived from tRNA Ser CAG When aminoacylation of m 1 G37A and m 1 G37G was from C.zeylanoides ( Figure 1C , lane 1) was identical to examined ( Figure 3A ), the results indicated that both that of acelylleucyl-CCA prepared from the RNase U2 substitutions lead to complete loss of leucylation (Figure digests of leucyl-tRNA Leu s from C.zeylanoides (lane 3).

3A, right-hand graph), although no apparent influence was This observation clearly demonstrates that leucine is observed on serylation ( Figure 3A , left-hand graph). These definitely attached to the tRNA possessing G73; the tRNA findings strongly indicate that the methyl group of m 1 G37 therefore must be tRNA Ser CAG and not tRNA Leu . Thus, plays a crucial role in enhancing the leucylation activity it is concluded that the tRNA which incorporated leucine of tRNA Ser CAG. in vitro is in fact tRNA Ser CAG. This deduction is supported

The slight reduction in leucylation activity observed in by the results of an additional experiment: incorporation the control variant z-G33G ( Figure 2A ) compared with of [ 14 C]leucine into the tRNA Ser CAG sample with LeuRS native tRNA ( Figure 3A , right-hand graph) was found to was reduced by the addition of SerRS and non-labeled have resulted from the partial deacetylation of 4-acetyl serine to the reaction mixture (data not shown), which cytidine (ac 4 C) due to acid treatment of the 5Ј-half clearly indicates that the same tRNA molecule is comfragment of tRNA Ser CAG (see Materials and methods). petitively aminoacylated by these two enzymes. This is considered further in the Discussion. To conclude that tRNA Ser CAG is aminoacylated with leucine, we carried out a further experiment. The G33 acts as a modulator of leucylation tRNA Ser CAG was charged with serine and serylated In addition to m 1 G37, another unique feature of the serine tRNA Ser CAGs in these Candida species is the presence tRNA Ser CAG was separated from non-aminoacylated The effect of mutation at position 33 in these two each variant was confirmed to have been replaced as expected (shown tRNAs was found to be quite different. In the case of the by arrows).

C.cylindracea tRNA, none of the mutations at position 33 caused leucylation of the tRNA, as was observed with the native tRNA Ser CAG, and there was no reduction in of G at position 33, where a pyrimidine (mostly U) is completely conserved in usual tRNAs (Sprinzl et al., serylation activity ( Figure 3C ). In contrast, the replacement of G33 by pyrimidines in C.zeylanoides tRNA Ser CAG 1996). Since we considered it is possible that this notable feature may be in some way related to the unusual considerably enhanced the leucylation activity ( Figure 3B , right-hand graph), while no significant difference was aminoacylation characteristics described above and/or to the translation of non-universal genetic code, we examined observed in the serylation activity ( Figure 3B , left-hand graph). The kinetic parameters of leucylation for the the effect of residue 33 on the aminoacylation and transla- show the spots corresponding to acetylleucine and acetylserine as markers, respectively. (D) Analysis of acetylamino acids attached to tRNA fragments on a TLC plate. Lane 2 shows the spot corresponding to the acetylamino acids derived from the RNase T1 fragment of C.zeylanoides tRNA Ser CAG. Lanes 1 and 3 indicate the spots corresponding to acetylleucine and acetylserine, respectively. Ten micrograms of [ 14 C]acetylaminoacyl-tRNA Ser CAG from C.zeylanoides was digested with RNase T1 and developed on cellulose TLC plates under the same conditions as (C). CCA fragments with [ 14 C]acetylamino acids were scraped from the plate from which the fragments were eluted with H20 and desalted by Sep-pak C18 under the conditions described in the literature (Wang et al., 1990) .

[ 14 C]acetylamino acids discharged from the fragments were developed on TLC and visualized by an imaging analyzer (BAS-1000, Fuji Photo Systems). variants of C.zeylanoides tRNA are shown in Table I . It

Evidence for leucylation of C.zeylanoides tRNA Ser CAG in vivo is notable that the K m values of the two pyrimidine At this point, we had established that the tRNA Ser CAG mutants, z-G33U (1.4 µM) and z-G33C (1.3 µM), are of C.zeylanoides is actually able to accept leucine in vitro. clearly lower than those of the two purine mutants, z-G33A However, considering the facts that SerRS and LeuRS (6.7 µM) and z-G33G (5.6 µM). The V max value of z-G33U coexist in cells and, judging from their K m values, that (1.2 pmol/min) is 39% of that of z-G33C (3.1 pmol/min), the affinity of tRNA Ser CAG toward SerRS is one order of which could explain why z-G33U shows lower leucylation magnitude higher than that toward LeuRS, we needed to activity than z-G33C despite having nearly the same K m ascertain whether the tRNA Ser CAG of C.zeylanoides is in value ( Figure 3B , right-hand graph). Judging from the fact leucylated in vivo. For this purpose, we adopted a sequence analysis (data not shown), the slight reduction newly developed method for quantifying an individual in the leucylation of z-G33G (5.6 µM) compared with aminoacyl-tRNA in cells (Suzuki et al., 1996) . that of the native tRNA Ser CAG (5.0 µM) is probably due Aminoacyl-tRNAs separately prepared from cells of to the partial deacetylation of ac 4 C at position 12, as C.zeylanoides and C.cylindracea were immediately submentioned above. This was confirmed by the observation jected to acetylation using [1-14 C]acetic anhydride to label of a slight reduction in leucylation activity also in acidthe amino acids as well as to stabilize the aminoacylated treated native tRNA Ser CAG (data not shown). It is thus tRNAs. From each of the acetylated aminoacyl-tRNA concluded that replacement of a pyrimidine by a purine mixtures, tRNA Ser CAGs from C.zeylanoides and C.cylindat position 33 has a repressive effect on leucylation of the racea were fished out by a solid-phase-attached DNA tRNA Ser CAG of C.zeylanoides.

probe as described previously (Tsurui et al., 1994 ; Wakita The translation efficiencies of the variants with a muta et al., 1994) . A single band for each of the aminoacyltion at position 33 were also examined in a cell-free tRNAs was detected by staining ( Figure 4A ) with which translation system of C.cylindracea (Yokogawa et al., the radioactivity coincided in each case ( Figure 4B ). 1992; Suzuki et al., 1994) , to evaluate the effect of G33.

Acetylated amino acids attached to these tRNAs were A change from G to U at position 33 apparently enhanced deacylated by alkaline treatment and analyzed by TLC. the translation activity 2.5-fold, although their decoding As shown in Figure 4C , acetylserine was observed as a properties did not change at all (data not shown). We thus major amino acid derivative in both tRNA Ser CAGs, but consider that G33 serves as a modulator of leucylation of acetylleucine was detected only in the C.zeylanoides tRNA Ser CAG, despite a slight disadvantage in transla-tRNA Ser CAG; the acetylserine and acetylleucine spots were identified as described previously (Suzuki et al., tion activity. 1996) . The radioactivities remaining on the origins probably came from the direct acetylation of some nucleotides in the tRNAs, as discussed previously (Suzuki et al., 1996) . From comparison with the radioactivity of acetylserine, it was calculated that~3% of the tRNA Ser CAG was attached with acetylleucine. These results were reproducible.

Digestion of purified acetyl-aminoacyl tRNA Ser CAG with RNase T1 also gave only a 14 C-labeled CCA fragment, as shown in Figure 1C . When the acetylated amino acid released from the fragment purified from the corresponding spot on TLC was analyzed by TLC, the ratio of acetylleucine to acetylserine was also found to be 3% ( Figure  4D ), indicating that acetylleucine is covalently attached to the tRNA Ser CAG fragment with G73. It thus became clear that the tRNA Ser CAG of C.zeylanoides was in fact charged with leucine by 3% of the amount of serylation of the same tRNA Ser CAG in C.zeylanoides cells.

Aminoacylation has generally been considered to be the final stage determining translational accuracy (reviewed in Parker, 1989; Kurland, 1992; Farabaugh, 1993) . However, in the case of tRNA Gln charged with glutamate in the chloroplast, Glu-tRNA Gln is rejected by an elongation factor so that the chloroplast translation machinery does not employ the mischarged aminoacyl-tRNA (Stanzel et al., 1994) . It is likely that this is an exceptional case due to the lack of glutamyl-tRNA synthetase in the chloroplast.

In order to prove that leucylated tRNA Ser CAGs actually participate in the translation process in Candida cells without such a rejection mechanism, we utilized a URA3 gene expression system derived from S.cerevisiae in C.maltosa, which was developed by Sugiyama et al. (1995) . Candida maltosa utilizes the codon CUG as serine and possesses the relevant tRNA Ser CAG gene (Sugiyama et al., 1995; Zimmer and Schunck, 1995) . Since the et al., 1995) . In the present study, this URA3 gene, with the CTG codon replaced by various leucine or serine codons, was utilized as a marker gene ( Figure 5A ). First, ADE1/ura3::C-ADE1) (Ohkuma et al., 1993) , the growth of which was monitored on minimal medium SD plates a plasmid in which the S.cerevisiae URA3 gene was inserted downstream of a C.maltosa-specific promoter in the presence and absence of uracil. When uracil was supplied to the SD plate for the (C-p) was constructed and designated as pCSU-CTG (Sugiyama, 1995) . As controls, mutant plasmids of pCSU-positive control experiments, all the transformants grew normally ( Figure 5B , middle row). However, in the absence CTG, in which the codon CTG was replaced by either the serine codon TCT or the leucine codon CTC, were of uracil, cells harboring pCCU and pCSU-CTC showed normal growth, whereas no growth was observed in those constructed and named pCSU-TCT and pCSU-CTC, respectively. In addition, a plasmid (pCCU) consisting of harboring pCSU-TCT and pUTH18 that contained no URA3 gene insertion. Cells harboring pCSU-CTG showed the URA3 gene of C.maltosa having a CTT leucine codon at the corresponding site, combined with the C.maltosa-weak but significant growth ( Figure 5B, uppermost row) . These results demonstrate that if the codon at position 45 specific promoter, was also used as a positive control. These variant plasmids were introduced into a URA3-is translated as leucine, active ODCase will be produced and the cells will be able to grow, but translation of the defective C.maltosa strain CHU1 (his5, ade1, ura3::C-codon with serine will produce inactive ODCase and the We believe that tRNA Ser CAG is the only molecule responsible for the leucine insertion corresponding to cells will be unable to grow. The result with cells harboring pCSU-CTG clearly demonstrates that the URA3 mutation codon CUG in C.maltosa cells, based on the following obervations. We have purified and sequenced a number on the C.maltosa chromosome was in some way complemented by the introduced pCSU-CTG plasmid, suggesting of leucine and serine tRNAs from Candida species, in which codon CUG is translated as serine, and failed in that the CTG codon was read at least partially as leucine in C.maltosa cells possessing tRNA Ser CAG.

finding tRNA with the anticodon sequence potentially complementary to codon CUG other than tRNA Ser CAG In order to quantify the growth rate of the cells harboring pCSU-CTG, the viability of the cells was examined in (Yokogawa et al., 1992; Ohama et al., 1993; Suzuki et al., 1994; Ueda et al., 1994; our unpublished observation) . liquid medium without uracil. As shown in Figure 5C , whereas translation of the CTG codon as serine completely Futhermore, tRNA genes for serine and leucine from these Candida species were sequenced following the blocked cell growth in the case of pCSU-TCT, and full complementation was observed in the case of pCSU-CTC amplification by cloning and/or PCR methods, and we found that only tRNA Ser CAG is able to translate codon in which the CTC codon was read as leucine, intermediate cell growth was observed in the case of pCSU-CTG, CUG (Yokogawa et al., 1992; Ohama et al., 1993; Suzuki et al., 1994; Ueda et al., 1994 ; our unpublished observ-indicating that ODCase was expressed in an active form, albeit at a low level, when there was a slight incorporation ation). Thus, it could be concluded that only the tRNA Ser CAG species inserts leucine into polypeptide of leucine at the CTG codon. The slow growth of the cells harboring pCSU-CTG was not due to the spontaneous corresponding to codon CUG. reversion of the CTG codon to another leucine codon or due to any other mutation, because the cells harvested Discussion from the colony on the SD-plate show the same growth phenotype. These results are unlikely to reflect the different The observations presented here clearly demonstrate that, in certain living organisms, a single codon can be simul-expression levels of the URA3 gene variants because the URA3 mRNA level is not altered by mutations at position taneously assigned to two distinct amino acids. Most codons in the genetic code degenerate, but our findings 45 (Ohkuma, 1993) . Furthermore, the possibility that the URA3 gene with CTG at position 45 is translated more show that some amino acids are also able to degenerate with respect to a particular codon. Such codon ambiguity efficiently than the gene with TCT at the same site due to codon preference (Ikemura, 1982) is excluded by the is governed by a tRNA acceptable to two amino acids simultaneously, as described above. We propose to desig-fact that the TCT codon is the most preferred of all the serine codons, including the CUG codon, in C.maltosa nate a codon corresponding to multiple amino acids a 'polysemous codon'. (Sugiyama et al., 1995) .

ODCase activity resulting from the translation of the A high degree of accuracy in tRNA aminoacylation has been considered crucial for preserving fidelity in protein URA3 gene was examined in the presence of a pyrimidine analog, 5-fluoroorotic acid (5FOA), an inhibitor in synthesis. It has been established that aminoacyl-tRNA synthetase is able to discriminate precisely its cognate pyrimidine biosynthesis. Incorporation of 5FOA with ODCase results in the formation of 5-fluorouridylate, amino acid from other structurally related amino acids at the adenylation reaction step, and its cognate tRNAs from which is harmful to cell propagation (Boeke et al., 1984) . Thus, URA3-defective strains grow normally on a medium non-cognate ones (reviewed in Parker, 1989; Kurland, 1992) . The misacylation error in this process has been containing 5FOA, whereas cells possessing the active URA3 gene are unable to grow on this medium. Cells estimated to range between 10 -4 and 10 -5 (Lin et al., 1984; Okamoto et al., 1984) . Discrimination of cognate harboring the respective plasmids were cultivated in the presence of 5FOA in addition to uracil. tRNA from non-cognate tRNAs is mediated by positive and negative identity determinants localized on the tRNA As shown in the bottom row of Figure 5B , cells harboring pCSU-CTG exhibited similar growth on the molecule (Yarus, 1988; Normanly and Abelson, 1989) . The only exception reported so far is that tRNA Gln is agar plate to those with pCSU-TCT and pUTH18, although the transformants with pCSU-CTC and pCCU were unable aminoacylated with glutamate in Gram-positive bacteria and in some organelles (Lapointe et al., 1986 ; Schön to grow. These results indicate that the CTG codon at position 45 was mainly translated as serine in C. maltosa, et al., 1988) . However, this differs from misaminoacylation in that this process is indispensable to compensate for the so as to produce the inactive ODCase. However, when the liquid medium was supplied with 5FOA, a slight lack of glutamyl-tRNA synthetase in these organisms. In general, high fidelity in the aminoacylation process is reduction in the growth rate was observed in the case of pCSU-CTG, compared with pCSU-TCT ( Figure 5C ), considered to be indispensable for translating genes into functionally active proteins with a high degree of accuracy. while very slow growth was observed in the case of pCSU-CTC used as a control. In order to detect a low

The discovery of a polysemous codon in a Candida species contradicts the established notion of aminoacyl-level of ODCase activity arising from a slight incorporation of leucine at the CUG codon in the 45th position, we ation with high fidelity. We have shown that a single tRNA is acceptable to two different amino acids, and adjusted the ratio of 5FOA and uracil as shown in Materials and methods. This growth rate reduction clearly suggests that it can therefore transfer two different amino acids corresponding to a particular codon. The expression that the slow growth observed in the SD medium was due to low expression of active ODCase. Thus it is concluded experiment using the ODCase-encoding URA3 gene containing codon CUG at the site essential for its activity that the CUG codon is partially translated as leucine in C.maltosa cells.

(see also Sugiyama et al., 1995) suggested that leucine could be incorporated into the gene product corresponding on experiments using an artificial mutation, and it does not reflect experimental observation in an extant living to codon CUG in C.maltosa, as judged from the complementation tests with the URA3 mutation. Although the organism.

On the basis of peptide sequences, several research amount of leucine incorporated per CUG codon was not quantitatively determined, it is clear that the incorporation groups have reported that codon CUG corresponds only to serine in C.maltosa (Sugiyama et al., 1995) and was mediated by the leucyl-tRNA Ser CAG. We thus concluded that codon CUG was simultaneously assigned to C.albicans (Santos and Tuite, 1995a; White et al., 1995) . No leucine-inserted peptide was detected in these studies. serine and leucine in the normal translation process in C.maltosa. A quantitative analysis of the amino acids However, we consider that any peptide with a leucine which was inserted for the codon CUG might have been attached to the tRNA indicated that 3% of tRNA Ser CAG is leucylated in C.zeylanoides cells. Such a high level of missed during purification or was undetectable in the peptide sequencing, because the amount of leucine-inserted leucylation is far beyond conventional misacylation, whose rate is estimated to be less than 10 -4 . Unless a proofreading peptide (~3%) would have been too low to be positively identified in sequencing experiments. mechanism exists on the ribosome, incorporation of leucine at CUG codon sites may reflect the relative ratio of

We have shown that tRNA Ser CAG in Candida species is a chimera of tRNA Ser CAG and tRNALeuCAG in so far tRNA Ser CAG leucylation, which is two orders of magnitude higher than that of conventional mistranslation.

as it is the substrate for both SerRS and LeuRS. The K m value for LeuRS is 5.0 µM, which is only one order of To date, artificial manipulations of molecules participating in the translation process, such as the overproduction magnitude larger than that for SerRS (0.22 µM). In an in vitro aminoacylation experiment Ͼ30% of tRNA Ser CAG of aminoacyl-tRNA synthetase (Swanson et al., 1988) , mutations of tRNAs etc. and/or control of growth condi-subjected to the reaction could be converted to leucyl-tRNA Ser CAG using an increased amount of LeuRS and a tions, such as deprivation of amino acids in the medium (Edelmann and Gallant, 1977; O'Farrell, 1978; Parker and longer incubation time (data not shown). We observed that while the presence of SerRS and non-radioactive Precup, 1986), have been found to increase the error rate in translation (reviewed in Parker, 1989) . However, our serine reduced leucylation, complete loss of leucylation could not be achieved (data not shown), indicating that the observation is based on experiments using wild-type cells grown in a rich medium suitable for high viability. In affinity of LeuRS toward tRNA Ser CAG is relatively high. In proliferating cells of C.zeylanoides, the leucyl-these respects, the polysemous codon is a phenomenon completely different from these artificial translational tRNA Ser CAG in the cells was estimated to be 3% of the seryl-tRNA Ser CAG, which is much lower than that errors. It is known that many examples exist for alternative decoding of universal codons-initiation codons other obtained in the in vitro experiments. We consider that such a reduction in leucylation is due to the competition than AUG (Gold, 1988; Kozak, 1983) , leaky stop codons caused by nonsense suppresser or native tRNAs (Murgola, for the tRNA Ser CAG between SerRS and LeuRS in the cells. Despite this competition, the distinct detection of 1985), the UGA codon used for incorporation of selenocysteine (Leinfelder et al., 1988) and so on. However, leucylated tRNA Ser CAG in vivo supports the existence of an ambiguous aminoacylation reaction toward the single because of strong dependence on the context effects or possible secondary structures of mRNAs, these recoding tRNA Ser CAG species. The polysemous codon results from the coexistence of events are those which are programed in the mRNAs (Gesteland et al., 1992) . We have sequenced several genes tRNA identity determinants for serine and leucine in a single tRNA molecule. Construction of tRNA Ser CAG in Candida genomes, but we could not find any secondary structure around the codon CUG in these genes. Con-variants by the microsurgery method led to the finding that a single methyl moiety of m 1 G at position 37 sidering that the polysemous codon is mediated by a single tRNA, it is unlikely that a polysemous codon occurs under is involved in the leucylation process. In contrast, the tRNA Ser CAG of C.cylindracea, which has A at the same the influences of the neighboring regions in mRNAs. Alternative decoding of a polysemous codon CUG is position, is deprived of such leucine-accepting activity. Himeno and his co-workers noted that three nucleotides possible, assuming that LeuRS is overexpressed under a certain physiological condition. Depending on the of leucine tRNAs were strongly recognized by S.cerevisiae LeuRS using unmodified variants transcribed by T7 RNA increased amount of the LeuRS in cells, incorporation of leucine corresponding to codon CUG may occur fre-polymerase (Soma et al., 1996) . Although the discriminator base, A73, is the strongest recognition site among them, quently, which causes the production of polypeptides with new functions. This possibility should be examined in A35 and G37 in the anticodon loop also play roles as determinants in tRNA. They were able to compare the further experiments.

The idea of a polysemous codon also differs from the activities of variants mutated at position 37 with A or G using the variants with A at the discriminator position 'near-cognate' concept proposed by Schultz and Yarus (1994) . They claimed that ambiguous decoding may occur which effectively elevates leucylation activity. In our work, we utilized serine tRNA with a modified nucleoside as a consequence of an irregular codon-anticodon interaction induced by the 27-43 base pair at the anticodon and with G at the discriminator position as a substrate for LeuRS, because the T7 transcript of tRNA Ser CAG showed stem of the tRNA, resulting in a genetic code change transition state. The polysemous codon found in our study no activity for leucylation. Our experiments using microsurgery methods indicated that m 1 G is of great importance is caused by the tRNA aminoacylation process of tRNA with codon-anticodon interaction proceeding precisely in in leucylation, despite the fact that the presence of G at the discriminator position is unsuitable for the recognition the conventional manner . Furthermore, since the hypothesis of Schultz and Yarus is based of LeuRS. Some modified nucleotides in tRNA are known to be involved in recoginition of some synthetases (Muramatsu et al., 1988) . Pütz et al. (1994) showed that m 1 G at position 37 of yeast tRNA Asp is one of the negative determinants for arginyl-tRNA synthetase.

We have also demonstrated that the nucleotide at position 33, where only tRNA Ser CAG uniquely possesses G, modulates the leucine-accepting activity. G33 may prevent tRNA Ser CAG from excessive leucylation, which S.cerevisiae cells, but that the viability of the cells decreased substantially. This finding suggests the polysemous state may be tolerated only when the ambiguous recognizes its cognate leucine tRNA from the 3Ј-side of the anticodon loop, which is afforded by the uridine-turn translation is under a strict constraint. We consider that G33 functions as a negative modulator in the leucylation structure due to U33 ( Figure 6A ). The methyl moiety of m 1 G37 is directly recognized by LeuRS. In the case of tRNA Ser CAG, thereby controlling the relative seryl-to leucyl-tRNA Ser CAG ratio.

of C.zeylanoides, the anticodon loop distorted by G33 decreases the affinity toward LeuRS, judging from the Several lines of experiment have suggested that U33 is involved in the tRNA function on ribosomes, such as in observation that G33 increased the K m value for leucylation approximately 4-to 5-fold in comparison with that with rigid codon-anticodon interaction, proper GTP hydrolysis of the ternary complex and the efficient translation of prymidine bases at the position ( Figure 6B ). In C.cylindracea, m 1 G is replaced by A, which means that the tRNA termination codons (Bare et al., 1983; Dix et al., 1986) . Indeed, the replacement of G33 by U in C.cylindracea has lost the two major determinants for LeuRS, m 1 G and the discriminator base ( Figure 6C ). Consequently, LeuRS tRNA Ser CAG increased the efficiency of in vitro translation by 2-to 3-fold (data not shown). The negative effect of is unable to recognize tRNA Ser CAG at all, and G33 concomitantly loses its function as a modulator. LeuRS G33 on translation may indicate involvement in some mechanism for decoding the polysemous codon. This is, of course, unable to recognize other serine isoacceptor tRNAs corresponding to universal codons, because they possibility needs to be clarified by further study. Nevertheless, we have shown here that one of the roles of G33 is have modified A at position 37. How did this interaction between LeuRS and the suppression of leucylation, and we consider that the nucleotide at position 33 is not directly involved in tRNA Ser CAG evolve? Candida species utilizing CUG as serine can be classified into two distinct groups: group 1 recognition by LeuRS. On the basis of our observation that no leucylation was detectable in the C.cylindracea contains the species that have tRNA Ser CAG with leucylation activity, and includes C.zeylanoides, C.maltosa and tRNA Ser CAG variants in which G33 was replaced by a pyrimidine base (c-G33U and c-G33C), we speculate that others (see Figure 6B ); group 2, which is represented solely by C.cylindracea, contains species that have tRNA Ser CAG G33 influences the location and/or conformation of m 1 G37, accompanied by the alteration of the anticodon loop without leucylation activity ( Figure 6C ). A plausible evolutionary process is that group 1 would have arisen structure, decreasing the affinity of LeuRS toward tRNA Ser CAG.

prior to group 2 after the genetic code change, which is speculated on the basis of the following observations. It has been generally considered that reconstructed tRNA does not lose its activity during the several reaction First, the homology between tRNA Ser CAGs in group 1 and its isoacceptor tRNAs for codon UCG is higher than steps needed in the microsurgery method, such as cleavage of the tRNA strand and ligation of tRNA fragments that between the tRNA Ser CAG from C.cylindracea and its isoacceptor . Second, C.cylindracea (Ohyama et al., 1985) . However, a slight reduction of leucylation activity was observed in the control variant, (group 2) possesses high copy numbers of the tRNA Ser CAG genes (~20 copies) on the diploid genome (Suzuki z-G33G, compared with that of the native tRNA ( Figure  3A , right-hand graph), which turned out to result from et al., 1994) , while low copy numbers (two or four copies) are observed for group 1 tRNA Ser CAG genes (Santos the partial deacetylation of 4-acetyl cytidine (ac4C) due to acid treatment of the 5Ј-half fragment (see Materials et al., 1993; Sugiyama et al., 1995; T.Suzuki, personal observations) . Third, the codon CUG is utilized as a major and methods). Nevertheless, it is reasonable to deduce the effect of base replacement on the aminoacylation activity serine codon on several genes in C.cylindracea, such as lipase (Kawaguchi et al., 1989) and chitin synthase by comparing the activities of these reconstructed tRNAs, because the same 5Ј-half fragments were used for all the (unpublished results) , while CUG appears infrequently on the genomes of other species belonging to group 1 (Lloyd manipulated tRNA molecules of C.zeylanoides.

A plausible mechanism by which LeuRS could recog-and Sharp, 1992; Sugiyama et al., 1995; T.Suzuki, personal observations) . During the course of the change in the nize cognate leucine and serine tRNAs specific for codon CUG is illustrated in Figure 6 . LeuRS contacts and genetic code, the genome should pass through a state group 2 (Ohama et al., 1993) . Fourth, the phylogenetic dextrose) and minimal medium SD [0.67% yeast nitrogen base without tree of these species and relatives constructed by using amino acids (Difco) and 2% dextrose] supplied with 24 mg/ml uracil were used for the cultivation of yeast cells.

several genes also supports this evolutionary pathway SD-plates with or without uracil were prepared by adding agar at a (manuscript in preparation (Boeke et al., 1984) .

for codon UCG Pesole et al., 1995) . Thus, the nucleotide at position 37 seems likely to have

In order to introduce mutation at the 45th codon in the reading frame mutated in the direction modified A→m 1 G- Alternative splicing generates a multiple protein pUTH18 containing an autonomously replicating sequence of C.maltosa (Takagi et al., 1986) and C-HIS5 (Hikiji et al., 1989) were used as sequence from a single gene at the mRNA level. In when the codon appears infrequently, as observed in group was mutated from CTG to CTC, and pCCU (Sugiyama et al., 1995) synthesis caused by a polysemous codon. We speculate instruction manual. The electrified cells were spread on a SD-plate that such ambiguity could have given rise to proteins containing uracil and incubated at 30°C.

with multiple amino acid sequences in non-house-keeping genes, which may have conferred multifunctionality on

In vitro aminoacylation assay Seryl-or leucyl-tRNA synthetases were partially purified from C.zeylan-the proteins. Since the C.cylindracea strain was developed oides cells as described previously , both of the industrially for the production of lipase, such multifunc- Large-scale purification of tRNA Ser CAGs from C.zeylanoides and C.cylindracea mmol) and leucine (11.5 MBq/mmol) were from Amersham. 5-fluoroorotic acid monohydrate (5FOA) was from PCR inc. 3Ј-Biotinylated Candida cylindracea cells (3.1 kg) were treated with phenol, from which 150 000 A 260 units of unfractionated tRNA were extracted. Eighty DNA probes were synthesized by Sci. Media, Japan. Synthetic RNA oligomers and a chimeric oligonucleotide composed of DNA and 2Ј-O-thousand A 260 units of tRNA mixture were obtained by DEAE-cellulose chromatography with stepwise elution, which was then applied onto a methyl RNA were synthesized by Genset Co. Ltd. Most of the enzymes used for the microsurgery were from Takara Shuzo (Tokyo, Japan).

DEAE-Sephadex A-50 column (6ϫ100 cm). Elution was performed with a linear gradient of NaCl from 0.375 to 0.525 M in a buffer Other chemicals were obtained from Wako Chemical Industries.

consisting of 20 mM Tris-HCl (pH 7.5) and 8 mM MgCl 2 . The fraction as CZE-37 (5ЈGmCmCmCmAmAmUmGmGmAmAmdCdCdTdG-CmAmUmCmCmAmUm3Ј), possessing a cleavage site between posi-rich in tRNA Ser was applied onto a RPC-5 column (1ϫ80 cm) and eluted with a linear gradient of NaCl from 0.4 to 1 M NaCl in a buffer tions 37 and 38 of C.zeylanoides tRNA Ser CAG. Two hundred micrograms of purified tRNA Ser CAG from C.zeylanoides was incubated at 65°C for consisting of 10 mM Tris-HCl (pH 7.5) and 10 mM Mg(OAc) 2 . As a result of these chromatographies, 300 A 260 units of purified tRNA Ser CAG 10 min with 14.4 nmol CZE-37 in a buffer consisting of 40 mM Tris-HCl (pH 7.7), 0.5 mM NaCl, 0.1 mM DTT, 0.0003% BSA and 0.4% were finally obtained.

One hundred and fifty thousand A 260 units of tRNA from C.zeylanoides glycerol (500 µl), and then annealed at room temperature. Magnesium chloride was added to the mixture up to a final concentration of 4 mM cells (3.7 kg) were fractionated on DEAE-Sepharose fast-flow column (3.5ϫ130 cm) with a linear gradient of NaCl from 0.25 to 0.4 M in a and the reaction was carried out at 30°C for 2 h by the addition of 600 units of RNase H (Takara Shuzo). About 60 µg of the cleaved 3Ј-half buffer consisting of 20 mM Tris-HCl (pH 7.5) and 8 mM MgCl 2 . About 300 A 260 units of C.zeylanoides tRNA Ser CAG were finally obtained by fragment was obtained by purification using 10% PAGE containing 7 M urea. Either of two synthetic oligo-RNAs, pCAGAp or pCAGGp, was further column chromatography with Sepharose 4B in a reverse gradient of ammonium sulfate from 1.7 to 0 M with a buffer consisting of ligated with the same 5Ј-half fragment digested by RNase T1 as the variants mutated at position 33 under the conditions described above. 10 mM NaOAc (pH 4.5), 10 mM MgCl 2 , 6 mM β-mercaptoethanol and 1 mM EDTA.

The ligated and dephosphorylated 5Ј-half fragments were annealed and ligated with the 3Ј-half fragment digested by RNase H. About 50 µg of each of the two variants from C.zeylanoides mutated at position 37-Construction of tRNA variants with mutation at position 33 The microsurgery procedures were basically carried out according to the m 1 G37A and m 1 G37G-was obtained by the phosphorylation of the 5Јend and purification by 12% PAGE containing 7 M urea. literature (Ohyama et al., 1985 (Ohyama et al., , 1986 . Limited digestion of 4 mg purified tRNA Ser CAG from C.zeylanoides with RNase T1 was performed at 0°C for 30 min in a reaction mixture containing 50 mM Tris-HCl (pH 7.5), Identification of amino acids attached to tRNA Ser CAGs in 100 mM MgCl 2 , 0.5 mg/ml of the tRNA and 25 000 units/ml RNase the cells T1 (Sigma). After phenol extraction, the resulting fragments were treated Identification of aminoacyl-tRNA Ser CAG from Candida cells was carried with 0.1 N HCl at 0°C for 12 h in order to cleave the 2Ј, 3Ј cyclic out by a new method developed recently by us (Suzuki et al., 1996) . phosphate of the 3Ј-end of the fragments formed in the limited digestion,

The experimental conditions were the same as those reported. To and then the 5Ј-and 3Ј-half fragments were separated by 10% PAGE fish out the aminoacyl-tRNAs, we designed two 3Ј-biotinylated DNA containing 7 M urea (10ϫ10 cm). Four hundred and thirty micrograms probes: 5ЈAGCAAGCTCAATGGATTCTGCGTCC3Ј for C.cylindracea of the 5Ј-half and 520 µg of the 3Ј-half fragments were recovered from tRNA Ser CAG and 5ЈGAAGCCCAATGGAACCTGCATCC3Ј for the gel. The purified 5Ј-half fragment was dephosphorylated with C.zeylanoides tRNA Ser CAG. These probes were immobilized with strepbacterial alkaline phosphatase (Takara Shuzo), and G33 at the 3Ј-end of tavidin agarose (Gibco BRL) as reported previously (Wakita et al., 1994) . the 5Ј-half fragment was removed by oxidation with sodium periodate as described in the literature (Keith and Gilham, 1974) . After dephos-

Uridine-33 in yeast tRNA not essential for amber suppression. Nature, 305, enzyme. The reconstituted tRNAs were purified by 12% PAGE containing 7 M urea (0.5ϫ20ϫ40 cm)

A positive selection for mutated at G33 from C.zeylanoides tRNA Ser CAG were finally obtained

these were denoted as z-G33U, z-G33C, z-G33A and z-G33G, respectmutants lacking orotidine-5Ј-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance

Transfer RNA variants mutated at position 33 from C.cylindracea tRNA Ser CAG were constructed. Limited digestion of 10 mg purified Crain

Effect of replacing uridine 33 in yeast tRNA Phe on the reaction with fragments was annealed with the phosphorylated 3Ј-half fragment and ligated at the anticodon loop. Then the 3Ј-end of each variant was ribosomes

PhyM: an RNase activity specific for U and A repaired with T4 polynucleotide kinase and the CCA enzyme as described above

tRNA Ser CAG mutated at position 33 was obtained; these were denoted as c-G33U

Alternative readings of the genetic code. Cell, 74, Construction of tRNA variants

To obtain the mutation of m 1 G37 of C.zeylanoides tRNA Ser CAG

Recoding: selected the restrictive digestion technique with RNase H using a chimera oligonucleotide splint composed of DNA and 2Ј-O-methyl RNA as reprogrammed genetic decoding

We designed a splint oligonucleotide according to the literature (Hayase et al., 1990) which was designated coli

Errors and alternatives in reading the universal genetic formylmethionine tRNA influences the site-directed cleavage of code

Mistranslation during phenylalanine Biochemistry

Evolutionary vector system for Candida maltosa using a gene isolated from origin of nonuniversal CUGSer codon in some Candida species as its genome that complements the his5 mutation of Saccharomyces inferred from a molecular phylogeny

A single methyl Ikemura,T. (1982) Correlation between the abundance of yeast transfer group prevents the mischarging of a tRNA

Structural domains of transfer RNA

yeast URA3 gene: expression in Escherichia coli

in vivo as serine and not leucine in Candida albicans

Comparison of initiation of protein synthesis in serine-CUG decoding in Candida albicans. 16th International tRNA procaryotes, eucaryotes, and organelles

Translational accuracy and the fitness of bacteria

A single glutamyl-tRNA tRNA with a 5Ј-CAG-3Ј (leucine) anticodon

Aminoacyl tRNA synthetases: General scheme of and efficiently misacylates Escherichia coli tRNA Gln 1 in vitro. structure-function relationships in the polypeptides and recognition of

Gene for novel tRNA species that accepts L-serine and cooperational RNA code for amino acids and possible relationship to translationally inserts selenocysteine. Nature, 331, 723-725. genetic code

Protein tRNA (anticodon CAG) in the pathogen Candida albicans: in vivo biosynthesis in organelles requires misaminoacylation of tRNA. evidence for non-standard decoding of CUG codons

Fast kinetic study of yeast understanding transfer RNA identity

Transfer RNA mutation and the between tyrosine and phenylalanine. Biochemistry, 23, 4109-4116. malleability of the genetic code

) the extent and nature of divergence between Candida albicans and The role of anticodon bases and the discriminator nucleotide in Saccharomyces cerevisiae

Rules that govern tRNA identity in protein synthetases

anticodon loop is a major identity determinant of Saccharomyces Miyazawa

Discrimination against

Changing misacylated tRNA by chloroplast elongation factor Tu. Eur. J. the identity of a transfer RNA

In vivo evidence for non-universal usage of the codon CUG O'Farrell,P.H. (1978) The suppression of defective translation by ppGpp in Candida maltosa

Characterization of serine and leucine tRNAs in an asporogenic yeast Nakase,T. (1993) Non-universal decoding of the leucine codon CUG Candida cylindracea and evolutionary implications of genes for in several Candida species

A new method for identifying (his5, ade1, ura3) as a useful host for the genetic engineering of the amino acid attached to a particular RNA in the cell

Accuracy of in vivo aminoacylation requires proper Deletion of the conserved sequence Gm-G and its effects on balance of tRNA and aminoacyl-tRNA synthetase. Science, 242, aminoacylation and conformation

tRNA Tyr variants with enzymatically altered D-loop sequence. II. Construction of a host-vector system in Candida maltosa by using an Relationship between the tertiary structure and tyrosine acceptance. ARS site isolated from its genome

Batchwise purification of proofreading mechanism: steady-state analysis testing internal specific tRNAs by a solid-phase DNA probe

leucine codon CUG in various Candida species and their putative

Recent evidence for evolution of the genetic code

Higher-order structure of bovine mitochondrial tRNAPhe lacking the 'conserved' GG and TΨCG sequences as inferred by enzymatic and chemical probing

Enzymatic and NMR analysis of oligoribonucleotides synthesized with 2Ј-tertbutyldimethylsilyl protected cyanoethylphosphoramidite monomers

The 'universal' leucine codon CTG in the secreted aspartyl proteinase 1 (SAP1) gene of Candida albicans encodes a serine in vivo

tRNA identity: A hair of the dogma that bit us

Serine tRNA complementary to the nonuniversal serine codon CUG in Candida cylindracea: evolutionary implications

A deviation from the universal genetic code in Candida maltosa and consequences for heterologous expression of cytochromes P450 52A4 and 52A5 in Saccharomyces cerevisiae

Acknowledgements phorylation of the 3Ј-end of this fragment, the truncated 5Ј-half fragment was ligated with each of four synthetic tetramers-pUCAGp, pCCAGp,The authors are grateful to Drs M.Takagi and R.Ohtomo of the Depart-pACAGp or pGCAGp-with T4 RNA ligase (Takara Shuzo) at 10°C

their experimental results to us before publication and for useful for 10 min and annealed at room temperature. The ligation was performed suggestions, and Drs N.Nishikawa and T.Yokogawa of Gifu University in 300 µl of a reaction mixture consisting of 58 mM Tris-HCl (pH 7.5), and S.Asakawa of Keio University for their technical advice. This work 17.5 mM MgCl 2 , 3.5 mM DTT, 10 µg/ml BSA, 50 µM ATP, 50 µg was supported by Grant-in Aid for Scientific Research on Priority Areas annealed tRNA and 200 units T4 RNA ligase. The 5Ј-end of the from Ministry of Education, Science, Sports, and Culture, Japan and by ligated tRNA was phosphorylated and the 3Ј-end was dephosphorylated a JSPS Fellowship for Japanese Junior Scientists to T.Suzuki. simultaneously with T4 polynucleotide kinase (Toyobo) at pH 6.9, and then the 3Ј-end was repaired at 37°C for 1 h with CCA enzyme partially purified from C.zeylanoides in 400 µl of a reaction mixture consisting