id	sid	tid	token	lemma	pos
cord-279903-z0wf1wli	1	1	key	key	JJ
cord-279903-z0wf1wli	1	2	:	:	:
cord-279903-z0wf1wli	1	3	cord-279903-z0wf1wli	cord-279903-z0wf1wli	NN
cord-279903-z0wf1wli	1	4	authors	author	NNS
cord-279903-z0wf1wli	1	5	:	:	:
cord-279903-z0wf1wli	1	6	Wang	Wang	NNP
cord-279903-z0wf1wli	1	7	,	,	,
cord-279903-z0wf1wli	1	8	Leyi	Leyi	NNP
cord-279903-z0wf1wli	1	9	;	;	:
cord-279903-z0wf1wli	1	10	Zhang	Zhang	NNP
cord-279903-z0wf1wli	1	11	,	,	,
cord-279903-z0wf1wli	1	12	Yan	Yan	NNP
cord-279903-z0wf1wli	1	13	;	;	:
cord-279903-z0wf1wli	1	14	Byrum	Byrum	NNP
cord-279903-z0wf1wli	1	15	,	,	,
cord-279903-z0wf1wli	1	16	Beverly	Beverly	NNP
cord-279903-z0wf1wli	1	17	title	title	NN
cord-279903-z0wf1wli	1	18	:	:	:
cord-279903-z0wf1wli	1	19	Development	development	NN
cord-279903-z0wf1wli	1	20	and	and	CC
cord-279903-z0wf1wli	1	21	evaluation	evaluation	NN
cord-279903-z0wf1wli	1	22	of	of	IN
cord-279903-z0wf1wli	1	23	a	a	DT
cord-279903-z0wf1wli	1	24	duplex	duplex	JJ
cord-279903-z0wf1wli	1	25	real	real	JJ
cord-279903-z0wf1wli	1	26	-	-	HYPH
cord-279903-z0wf1wli	1	27	time	time	NN
cord-279903-z0wf1wli	1	28	RT	RT	NNP
cord-279903-z0wf1wli	1	29	-	-	HYPH
cord-279903-z0wf1wli	1	30	PCR	PCR	NNP
cord-279903-z0wf1wli	1	31	for	for	IN
cord-279903-z0wf1wli	1	32	detection	detection	NN
cord-279903-z0wf1wli	1	33	and	and	CC
cord-279903-z0wf1wli	1	34	differentiation	differentiation	NN
cord-279903-z0wf1wli	1	35	of	of	IN
cord-279903-z0wf1wli	1	36	virulent	virulent	JJ
cord-279903-z0wf1wli	1	37	and	and	CC
cord-279903-z0wf1wli	1	38	variant	variant	JJ
cord-279903-z0wf1wli	1	39	strains	strain	NNS
cord-279903-z0wf1wli	1	40	of	of	IN
cord-279903-z0wf1wli	1	41	porcine	porcine	JJ
cord-279903-z0wf1wli	1	42	epidemic	epidemic	NN
cord-279903-z0wf1wli	1	43	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	1	44	viruses	virus	NNS
cord-279903-z0wf1wli	1	45	from	from	IN
cord-279903-z0wf1wli	1	46	the	the	DT
cord-279903-z0wf1wli	1	47	United	United	NNP
cord-279903-z0wf1wli	1	48	States	States	NNP
cord-279903-z0wf1wli	1	49	date	date	NN
cord-279903-z0wf1wli	1	50	:	:	:
cord-279903-z0wf1wli	1	51	2014	2014	CD
cord-279903-z0wf1wli	1	52	-	-	HYPH
cord-279903-z0wf1wli	1	53	07	07	CD
cord-279903-z0wf1wli	1	54	-	-	HYPH
cord-279903-z0wf1wli	1	55	12	12	CD
cord-279903-z0wf1wli	1	56	journal	journal	NN
cord-279903-z0wf1wli	1	57	:	:	:
cord-279903-z0wf1wli	1	58	J	J	NNP
cord-279903-z0wf1wli	1	59	Virol	Virol	NNP
cord-279903-z0wf1wli	1	60	Methods	Methods	NNPS
cord-279903-z0wf1wli	1	61	DOI	DOI	NNP
cord-279903-z0wf1wli	1	62	:	:	:
cord-279903-z0wf1wli	1	63	10.1016	10.1016	CD
cord-279903-z0wf1wli	1	64	/	/	SYM
cord-279903-z0wf1wli	1	65	j.jviromet.2014.07.005	j.jviromet.2014.07.005	CD
cord-279903-z0wf1wli	1	66	sha	sha	NNP
cord-279903-z0wf1wli	1	67	:	:	:
cord-279903-z0wf1wli	1	68	a987b7d8194376a7108cd8195e0becdae7602081	a987b7d8194376a7108cd8195e0becdae7602081	NNP
cord-279903-z0wf1wli	1	69	doc_id	doc_id	CD
cord-279903-z0wf1wli	1	70	:	:	:
cord-279903-z0wf1wli	1	71	279903	279903	CD
cord-279903-z0wf1wli	1	72	cord_uid	cord_uid	NNS
cord-279903-z0wf1wli	1	73	:	:	:
cord-279903-z0wf1wli	2	1	z0wf1wli	z0wf1wli	LS
cord-279903-z0wf1wli	2	2	Porcine	porcine	JJ
cord-279903-z0wf1wli	2	3	epidemic	epidemic	NN
cord-279903-z0wf1wli	2	4	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	2	5	virus	virus	NN
cord-279903-z0wf1wli	2	6	(	(	-LRB-
cord-279903-z0wf1wli	2	7	PEDV	PEDV	NNP
cord-279903-z0wf1wli	2	8	)	)	-RRB-
cord-279903-z0wf1wli	2	9	has	have	VBZ
cord-279903-z0wf1wli	2	10	caused	cause	VBN
cord-279903-z0wf1wli	2	11	significant	significant	JJ
cord-279903-z0wf1wli	2	12	economic	economic	JJ
cord-279903-z0wf1wli	2	13	losses	loss	NNS
cord-279903-z0wf1wli	2	14	in	in	IN
cord-279903-z0wf1wli	2	15	the	the	DT
cord-279903-z0wf1wli	2	16	US	US	NNP
cord-279903-z0wf1wli	2	17	swine	swine	NN
cord-279903-z0wf1wli	2	18	industry	industry	NN
cord-279903-z0wf1wli	2	19	since	since	IN
cord-279903-z0wf1wli	2	20	May	May	NNP
cord-279903-z0wf1wli	2	21	2013	2013	CD
cord-279903-z0wf1wli	2	22	.	.	.
cord-279903-z0wf1wli	3	1	A	a	DT
cord-279903-z0wf1wli	3	2	new	new	JJ
cord-279903-z0wf1wli	3	3	variant	variant	NN
cord-279903-z0wf1wli	3	4	strain	strain	NN
cord-279903-z0wf1wli	3	5	of	of	IN
cord-279903-z0wf1wli	3	6	PEDV	PEDV	NNP
cord-279903-z0wf1wli	3	7	emerged	emerge	VBD
cord-279903-z0wf1wli	3	8	in	in	IN
cord-279903-z0wf1wli	3	9	the	the	DT
cord-279903-z0wf1wli	3	10	US	US	NNP
cord-279903-z0wf1wli	3	11	in	in	IN
cord-279903-z0wf1wli	3	12	the	the	DT
cord-279903-z0wf1wli	3	13	late	late	JJ
cord-279903-z0wf1wli	3	14	December	December	NNP
cord-279903-z0wf1wli	3	15	,	,	,
cord-279903-z0wf1wli	3	16	2013	2013	CD
cord-279903-z0wf1wli	3	17	.	.	.
cord-279903-z0wf1wli	4	1	This	this	DT
cord-279903-z0wf1wli	4	2	variant	variant	NN
cord-279903-z0wf1wli	4	3	strain	strain	NN
cord-279903-z0wf1wli	4	4	of	of	IN
cord-279903-z0wf1wli	4	5	PEDV	PEDV	NNP
cord-279903-z0wf1wli	4	6	differs	differ	VBZ
cord-279903-z0wf1wli	4	7	from	from	IN
cord-279903-z0wf1wli	4	8	the	the	DT
cord-279903-z0wf1wli	4	9	virulent	virulent	JJ
cord-279903-z0wf1wli	4	10	strain	strain	NN
cord-279903-z0wf1wli	4	11	of	of	IN
cord-279903-z0wf1wli	4	12	PEDV	PEDV	NNP
cord-279903-z0wf1wli	4	13	currently	currently	RB
cord-279903-z0wf1wli	4	14	circulating	circulate	VBG
cord-279903-z0wf1wli	4	15	in	in	IN
cord-279903-z0wf1wli	4	16	the	the	DT
cord-279903-z0wf1wli	4	17	US	US	NNP
cord-279903-z0wf1wli	4	18	in	in	IN
cord-279903-z0wf1wli	4	19	1170	1170	CD
cord-279903-z0wf1wli	4	20	nt	nt	RB
cord-279903-z0wf1wli	4	21	of	of	IN
cord-279903-z0wf1wli	4	22	the	the	DT
cord-279903-z0wf1wli	4	23	5’end	5’end	CD
cord-279903-z0wf1wli	4	24	of	of	IN
cord-279903-z0wf1wli	4	25	the	the	DT
cord-279903-z0wf1wli	4	26	S1	S1	NNP
cord-279903-z0wf1wli	4	27	domain	domain	NN
cord-279903-z0wf1wli	4	28	in	in	IN
cord-279903-z0wf1wli	4	29	the	the	DT
cord-279903-z0wf1wli	4	30	spike	spike	NN
cord-279903-z0wf1wli	4	31	gene	gene	NN
cord-279903-z0wf1wli	4	32	.	.	.
cord-279903-z0wf1wli	5	1	Importantly	importantly	RB
cord-279903-z0wf1wli	5	2	,	,	,
cord-279903-z0wf1wli	5	3	the	the	DT
cord-279903-z0wf1wli	5	4	variant	variant	JJ
cord-279903-z0wf1wli	5	5	PEDV	PEDV	NNP
cord-279903-z0wf1wli	5	6	caused	cause	VBD
cord-279903-z0wf1wli	5	7	significantly	significantly	RB
cord-279903-z0wf1wli	5	8	less	less	JJR
cord-279903-z0wf1wli	5	9	mortality	mortality	NN
cord-279903-z0wf1wli	5	10	in	in	IN
cord-279903-z0wf1wli	5	11	piglets	piglet	NNS
cord-279903-z0wf1wli	5	12	than	than	IN
cord-279903-z0wf1wli	5	13	the	the	DT
cord-279903-z0wf1wli	5	14	virulent	virulent	JJ
cord-279903-z0wf1wli	5	15	PEDV	PEDV	NNP
cord-279903-z0wf1wli	5	16	,	,	,
cord-279903-z0wf1wli	5	17	based	base	VBN
cord-279903-z0wf1wli	5	18	on	on	IN
cord-279903-z0wf1wli	5	19	clinical	clinical	JJ
cord-279903-z0wf1wli	5	20	observations	observation	NNS
cord-279903-z0wf1wli	5	21	.	.	.
cord-279903-z0wf1wli	6	1	This	this	DT
cord-279903-z0wf1wli	6	2	suggests	suggest	VBZ
cord-279903-z0wf1wli	6	3	it	-PRON-	PRP
cord-279903-z0wf1wli	6	4	may	may	MD
cord-279903-z0wf1wli	6	5	be	be	VB
cord-279903-z0wf1wli	6	6	a	a	DT
cord-279903-z0wf1wli	6	7	potential	potential	JJ
cord-279903-z0wf1wli	6	8	vaccine	vaccine	NN
cord-279903-z0wf1wli	6	9	candidate	candidate	NN
cord-279903-z0wf1wli	6	10	for	for	IN
cord-279903-z0wf1wli	6	11	PED	PED	NNP
cord-279903-z0wf1wli	6	12	.	.	.
cord-279903-z0wf1wli	7	1	Variant	Variant	NNP
cord-279903-z0wf1wli	7	2	PEDV	PEDV	NNP
cord-279903-z0wf1wli	7	3	has	have	VBZ
cord-279903-z0wf1wli	7	4	been	be	VBN
cord-279903-z0wf1wli	7	5	detected	detect	VBN
cord-279903-z0wf1wli	7	6	in	in	IN
cord-279903-z0wf1wli	7	7	samples	sample	NNS
cord-279903-z0wf1wli	7	8	from	from	IN
cord-279903-z0wf1wli	7	9	multiple	multiple	JJ
cord-279903-z0wf1wli	7	10	states	state	NNS
cord-279903-z0wf1wli	7	11	by	by	IN
cord-279903-z0wf1wli	7	12	our	-PRON-	PRP$
cord-279903-z0wf1wli	7	13	laboratory	laboratory	NN
cord-279903-z0wf1wli	7	14	as	as	RB
cord-279903-z0wf1wli	7	15	well	well	RB
cord-279903-z0wf1wli	7	16	as	as	IN
cord-279903-z0wf1wli	7	17	other	other	JJ
cord-279903-z0wf1wli	7	18	laboratories	laboratory	NNS
cord-279903-z0wf1wli	7	19	in	in	IN
cord-279903-z0wf1wli	7	20	the	the	DT
cord-279903-z0wf1wli	7	21	US	US	NNP
cord-279903-z0wf1wli	7	22	.	.	.
cord-279903-z0wf1wli	8	1	It	-PRON-	PRP
cord-279903-z0wf1wli	8	2	is	be	VBZ
cord-279903-z0wf1wli	8	3	critical	critical	JJ
cord-279903-z0wf1wli	8	4	to	to	TO
cord-279903-z0wf1wli	8	5	detect	detect	VB
cord-279903-z0wf1wli	8	6	and	and	CC
cord-279903-z0wf1wli	8	7	differentiate	differentiate	VB
cord-279903-z0wf1wli	8	8	variant	variant	JJ
cord-279903-z0wf1wli	8	9	PEDV	PEDV	NNP
cord-279903-z0wf1wli	8	10	from	from	IN
cord-279903-z0wf1wli	8	11	the	the	DT
cord-279903-z0wf1wli	8	12	virulent	virulent	JJ
cord-279903-z0wf1wli	8	13	PEDV	pedv	NN
cord-279903-z0wf1wli	8	14	during	during	IN
cord-279903-z0wf1wli	8	15	outbreaks	outbreak	NNS
cord-279903-z0wf1wli	8	16	to	to	TO
cord-279903-z0wf1wli	8	17	enhance	enhance	VB
cord-279903-z0wf1wli	8	18	control	control	NN
cord-279903-z0wf1wli	8	19	and	and	CC
cord-279903-z0wf1wli	8	20	to	to	TO
cord-279903-z0wf1wli	8	21	prevent	prevent	VB
cord-279903-z0wf1wli	8	22	PED	ped	NN
cord-279903-z0wf1wli	8	23	associated	associate	VBN
cord-279903-z0wf1wli	8	24	disease	disease	NN
cord-279903-z0wf1wli	8	25	.	.	.
cord-279903-z0wf1wli	9	1	In	in	IN
cord-279903-z0wf1wli	9	2	this	this	DT
cord-279903-z0wf1wli	9	3	study	study	NN
cord-279903-z0wf1wli	9	4	,	,	,
cord-279903-z0wf1wli	9	5	the	the	DT
cord-279903-z0wf1wli	9	6	development	development	NN
cord-279903-z0wf1wli	9	7	and	and	CC
cord-279903-z0wf1wli	9	8	validation	validation	NN
cord-279903-z0wf1wli	9	9	of	of	IN
cord-279903-z0wf1wli	9	10	a	a	DT
cord-279903-z0wf1wli	9	11	duplex	duplex	JJ
cord-279903-z0wf1wli	9	12	real	real	JJ
cord-279903-z0wf1wli	9	13	-	-	HYPH
cord-279903-z0wf1wli	9	14	time	time	NN
cord-279903-z0wf1wli	9	15	RT	RT	NNP
cord-279903-z0wf1wli	9	16	-	-	HYPH
cord-279903-z0wf1wli	9	17	PCR	PCR	NNP
cord-279903-z0wf1wli	9	18	assay	assay	NN
cord-279903-z0wf1wli	9	19	for	for	IN
cord-279903-z0wf1wli	9	20	detection	detection	NN
cord-279903-z0wf1wli	9	21	and	and	CC
cord-279903-z0wf1wli	9	22	differentiation	differentiation	NN
cord-279903-z0wf1wli	9	23	of	of	IN
cord-279903-z0wf1wli	9	24	the	the	DT
cord-279903-z0wf1wli	9	25	variant	variant	NN
cord-279903-z0wf1wli	9	26	and	and	CC
cord-279903-z0wf1wli	9	27	the	the	DT
cord-279903-z0wf1wli	9	28	virulent	virulent	JJ
cord-279903-z0wf1wli	9	29	strains	strain	NNS
cord-279903-z0wf1wli	9	30	of	of	IN
cord-279903-z0wf1wli	9	31	PEDV	PEDV	NNP
cord-279903-z0wf1wli	9	32	currently	currently	RB
cord-279903-z0wf1wli	9	33	circulating	circulate	VBG
cord-279903-z0wf1wli	9	34	in	in	IN
cord-279903-z0wf1wli	9	35	the	the	DT
cord-279903-z0wf1wli	9	36	US	US	NNP
cord-279903-z0wf1wli	9	37	was	be	VBD
cord-279903-z0wf1wli	9	38	reported	report	VBN
cord-279903-z0wf1wli	9	39	.	.	.
cord-279903-z0wf1wli	10	1	Porcine	porcine	JJ
cord-279903-z0wf1wli	10	2	epidemic	epidemic	NN
cord-279903-z0wf1wli	10	3	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	10	4	(	(	-LRB-
cord-279903-z0wf1wli	10	5	PED	ped	NN
cord-279903-z0wf1wli	10	6	)	)	-RRB-
cord-279903-z0wf1wli	10	7	virus	virus	NN
cord-279903-z0wf1wli	10	8	is	be	VBZ
cord-279903-z0wf1wli	10	9	a	a	DT
cord-279903-z0wf1wli	10	10	member	member	NN
cord-279903-z0wf1wli	10	11	of	of	IN
cord-279903-z0wf1wli	10	12	the	the	DT
cord-279903-z0wf1wli	10	13	order	order	NN
cord-279903-z0wf1wli	10	14	Nidovirales	Nidovirales	NNP
cord-279903-z0wf1wli	10	15	,	,	,
cord-279903-z0wf1wli	10	16	family	family	NN
cord-279903-z0wf1wli	10	17	Coronaviridae	Coronaviridae	NNP
cord-279903-z0wf1wli	10	18	,	,	,
cord-279903-z0wf1wli	10	19	subfamily	subfamily	NN
cord-279903-z0wf1wli	10	20	Coronavirinae	Coronavirinae	NNP
cord-279903-z0wf1wli	10	21	,	,	,
cord-279903-z0wf1wli	10	22	genus	genus	NN
cord-279903-z0wf1wli	10	23	Alphacoronavirus	Alphacoronavirus	NNP
cord-279903-z0wf1wli	10	24	.	.	.
cord-279903-z0wf1wli	11	1	PED	PED	NNP
cord-279903-z0wf1wli	11	2	is	be	VBZ
cord-279903-z0wf1wli	11	3	a	a	DT
cord-279903-z0wf1wli	11	4	highly	highly	RB
cord-279903-z0wf1wli	11	5	contagious	contagious	JJ
cord-279903-z0wf1wli	11	6	diarrheal	diarrheal	JJ
cord-279903-z0wf1wli	11	7	disease	disease	NN
cord-279903-z0wf1wli	11	8	,	,	,
cord-279903-z0wf1wli	11	9	characterized	characterize	VBN
cord-279903-z0wf1wli	11	10	by	by	IN
cord-279903-z0wf1wli	11	11	severe	severe	JJ
cord-279903-z0wf1wli	11	12	watery	watery	JJ
cord-279903-z0wf1wli	11	13	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	11	14	and	and	CC
cord-279903-z0wf1wli	11	15	high	high	JJ
cord-279903-z0wf1wli	11	16	mortality	mortality	NN
cord-279903-z0wf1wli	11	17	in	in	IN
cord-279903-z0wf1wli	11	18	piglets	piglet	NNS
cord-279903-z0wf1wli	11	19	.	.	.
cord-279903-z0wf1wli	12	1	PED	PED	NNP
cord-279903-z0wf1wli	12	2	was	be	VBD
cord-279903-z0wf1wli	12	3	originally	originally	RB
cord-279903-z0wf1wli	12	4	identified	identify	VBN
cord-279903-z0wf1wli	12	5	in	in	IN
cord-279903-z0wf1wli	12	6	England	England	NNP
cord-279903-z0wf1wli	12	7	in	in	IN
cord-279903-z0wf1wli	12	8	1971	1971	CD
cord-279903-z0wf1wli	12	9	(	(	-LRB-
cord-279903-z0wf1wli	12	10	Oldham	Oldham	NNP
cord-279903-z0wf1wli	12	11	,	,	,
cord-279903-z0wf1wli	12	12	1972	1972	CD
cord-279903-z0wf1wli	12	13	)	)	-RRB-
cord-279903-z0wf1wli	12	14	.	.	.
cord-279903-z0wf1wli	13	1	Since	since	IN
cord-279903-z0wf1wli	13	2	then	then	RB
cord-279903-z0wf1wli	13	3	,	,	,
cord-279903-z0wf1wli	13	4	it	-PRON-	PRP
cord-279903-z0wf1wli	13	5	has	have	VBZ
cord-279903-z0wf1wli	13	6	been	be	VBN
cord-279903-z0wf1wli	13	7	reported	report	VBN
cord-279903-z0wf1wli	13	8	in	in	IN
cord-279903-z0wf1wli	13	9	several	several	JJ
cord-279903-z0wf1wli	13	10	European	european	JJ
cord-279903-z0wf1wli	13	11	and	and	CC
cord-279903-z0wf1wli	13	12	Asian	asian	JJ
cord-279903-z0wf1wli	13	13	countries	country	NNS
cord-279903-z0wf1wli	13	14	including	include	VBG
cord-279903-z0wf1wli	13	15	China	China	NNP
cord-279903-z0wf1wli	13	16	and	and	CC
cord-279903-z0wf1wli	13	17	Korea	Korea	NNP
cord-279903-z0wf1wli	13	18	.	.	.
cord-279903-z0wf1wli	14	1	Since	since	IN
cord-279903-z0wf1wli	14	2	2010	2010	CD
cord-279903-z0wf1wli	14	3	,	,	,
cord-279903-z0wf1wli	14	4	a	a	DT
cord-279903-z0wf1wli	14	5	highly	highly	RB
cord-279903-z0wf1wli	14	6	virulent	virulent	JJ
cord-279903-z0wf1wli	14	7	strain	strain	NN
cord-279903-z0wf1wli	14	8	of	of	IN
cord-279903-z0wf1wli	14	9	PEDV	PEDV	NNP
cord-279903-z0wf1wli	14	10	emerged	emerge	VBD
cord-279903-z0wf1wli	14	11	in	in	IN
cord-279903-z0wf1wli	14	12	China	China	NNP
cord-279903-z0wf1wli	14	13	and	and	CC
cord-279903-z0wf1wli	14	14	caused	cause	VBD
cord-279903-z0wf1wli	14	15	significant	significant	JJ
cord-279903-z0wf1wli	14	16	loss	loss	NN
cord-279903-z0wf1wli	14	17	in	in	IN
cord-279903-z0wf1wli	14	18	the	the	DT
cord-279903-z0wf1wli	14	19	pig	pig	NN
cord-279903-z0wf1wli	14	20	industry	industry	NN
cord-279903-z0wf1wli	14	21	(	(	-LRB-
cord-279903-z0wf1wli	14	22	Sun	Sun	NNP
cord-279903-z0wf1wli	14	23	et	et	FW
cord-279903-z0wf1wli	14	24	al	al	NNP
cord-279903-z0wf1wli	14	25	.	.	NNP
cord-279903-z0wf1wli	14	26	,	,	,
cord-279903-z0wf1wli	14	27	2012	2012	CD
cord-279903-z0wf1wli	14	28	)	)	-RRB-
cord-279903-z0wf1wli	14	29	.	.	.
cord-279903-z0wf1wli	15	1	In	in	IN
cord-279903-z0wf1wli	15	2	May	May	NNP
cord-279903-z0wf1wli	15	3	2013	2013	CD
cord-279903-z0wf1wli	15	4	,	,	,
cord-279903-z0wf1wli	15	5	this	this	DT
cord-279903-z0wf1wli	15	6	virulent	virulent	JJ
cord-279903-z0wf1wli	15	7	strain	strain	NN
cord-279903-z0wf1wli	15	8	of	of	IN
cord-279903-z0wf1wli	15	9	PEDV	PEDV	NNP
cord-279903-z0wf1wli	15	10	was	be	VBD
cord-279903-z0wf1wli	15	11	recognized	recognize	VBN
cord-279903-z0wf1wli	15	12	in	in	IN
cord-279903-z0wf1wli	15	13	the	the	DT
cord-279903-z0wf1wli	15	14	United	United	NNP
cord-279903-z0wf1wli	15	15	States	States	NNP
cord-279903-z0wf1wli	15	16	(	(	-LRB-
cord-279903-z0wf1wli	15	17	US	US	NNP
cord-279903-z0wf1wli	15	18	)	)	-RRB-
cord-279903-z0wf1wli	15	19	.	.	.
cord-279903-z0wf1wli	16	1	By	by	IN
cord-279903-z0wf1wli	16	2	March	March	NNP
cord-279903-z0wf1wli	16	3	8	8	CD
cord-279903-z0wf1wli	16	4	of	of	IN
cord-279903-z0wf1wli	16	5	2014	2014	CD
cord-279903-z0wf1wli	16	6	,	,	,
cord-279903-z0wf1wli	16	7	PED	PED	NNP
cord-279903-z0wf1wli	16	8	had	have	VBD
cord-279903-z0wf1wli	16	9	been	be	VBN
cord-279903-z0wf1wli	16	10	detected	detect	VBN
cord-279903-z0wf1wli	16	11	in	in	IN
cord-279903-z0wf1wli	16	12	27	27	CD
cord-279903-z0wf1wli	16	13	US	US	NNP
cord-279903-z0wf1wli	16	14	states	state	NNS
cord-279903-z0wf1wli	16	15	and	and	CC
cord-279903-z0wf1wli	16	16	a	a	DT
cord-279903-z0wf1wli	16	17	total	total	JJ
cord-279903-z0wf1wli	16	18	4458	4458	CD
cord-279903-z0wf1wli	16	19	cases	case	NNS
cord-279903-z0wf1wli	16	20	were	be	VBD
cord-279903-z0wf1wli	16	21	confirmed	confirm	VBN
cord-279903-z0wf1wli	16	22	(	(	-LRB-
cord-279903-z0wf1wli	16	23	http://www.aasv.org/pedv/PEDv	http://www.aasv.org/pedv/PEDv	NNP
cord-279903-z0wf1wli	16	24	weekly	weekly	JJ
cord-279903-z0wf1wli	16	25	report	report	NN
cord-279903-z0wf1wli	16	26	140312.pdf	140312.pdf	CD
cord-279903-z0wf1wli	16	27	)	)	-RRB-
cord-279903-z0wf1wli	16	28	.	.	.
cord-279903-z0wf1wli	17	1	The	the	DT
cord-279903-z0wf1wli	17	2	disease	disease	NN
cord-279903-z0wf1wli	17	3	has	have	VBZ
cord-279903-z0wf1wli	17	4	caused	cause	VBN
cord-279903-z0wf1wli	17	5	severe	severe	JJ
cord-279903-z0wf1wli	17	6	economic	economic	JJ
cord-279903-z0wf1wli	17	7	losses	loss	NNS
cord-279903-z0wf1wli	17	8	to	to	IN
cord-279903-z0wf1wli	17	9	the	the	DT
cord-279903-z0wf1wli	17	10	swine	swine	NN
cord-279903-z0wf1wli	17	11	industry	industry	NN
cord-279903-z0wf1wli	17	12	in	in	IN
cord-279903-z0wf1wli	17	13	the	the	DT
cord-279903-z0wf1wli	17	14	US	US	NNP
cord-279903-z0wf1wli	17	15	.	.	.
cord-279903-z0wf1wli	18	1	Recently	recently	RB
cord-279903-z0wf1wli	18	2	the	the	DT
cord-279903-z0wf1wli	18	3	virus	virus	NN
cord-279903-z0wf1wli	18	4	was	be	VBD
cord-279903-z0wf1wli	18	5	found	find	VBN
cord-279903-z0wf1wli	18	6	in	in	IN
cord-279903-z0wf1wli	18	7	Canada	Canada	NNP
cord-279903-z0wf1wli	18	8	.	.	.
cord-279903-z0wf1wli	19	1	Studies	study	NNS
cord-279903-z0wf1wli	19	2	have	have	VBP
cord-279903-z0wf1wli	19	3	shown	show	VBN
cord-279903-z0wf1wli	19	4	that	that	IN
cord-279903-z0wf1wli	19	5	pigs	pig	NNS
cord-279903-z0wf1wli	19	6	either	either	CC
cord-279903-z0wf1wli	19	7	naturally	naturally	RB
cord-279903-z0wf1wli	19	8	or	or	CC
cord-279903-z0wf1wli	19	9	experimentally	experimentally	RB
cord-279903-z0wf1wli	19	10	infected	infect	VBN
cord-279903-z0wf1wli	19	11	with	with	IN
cord-279903-z0wf1wli	19	12	virulent	virulent	JJ
cord-279903-z0wf1wli	19	13	strain	strain	NN
cord-279903-z0wf1wli	19	14	of	of	IN
cord-279903-z0wf1wli	19	15	PEDV	PEDV	NNP
cord-279903-z0wf1wli	19	16	developed	develop	VBD
cord-279903-z0wf1wli	19	17	characteristic	characteristic	JJ
cord-279903-z0wf1wli	19	18	gross	gross	JJ
cord-279903-z0wf1wli	19	19	(	(	-LRB-
cord-279903-z0wf1wli	19	20	thin	thin	JJ
cord-279903-z0wf1wli	19	21	and	and	CC
cord-279903-z0wf1wli	19	22	dilated	dilated	JJ
cord-279903-z0wf1wli	19	23	intestinal	intestinal	JJ
cord-279903-z0wf1wli	19	24	walls	wall	NNS
cord-279903-z0wf1wli	19	25	)	)	-RRB-
cord-279903-z0wf1wli	19	26	and	and	CC
cord-279903-z0wf1wli	19	27	histologic	histologic	JJ
cord-279903-z0wf1wli	19	28	lesions	lesion	NNS
cord-279903-z0wf1wli	19	29	(	(	-LRB-
cord-279903-z0wf1wli	19	30	severe	severe	JJ
cord-279903-z0wf1wli	19	31	atrophy	atrophy	NN
cord-279903-z0wf1wli	19	32	of	of	IN
cord-279903-z0wf1wli	19	33	villi	villi	NN
cord-279903-z0wf1wli	19	34	)	)	-RRB-
cord-279903-z0wf1wli	20	1	(	(	-LRB-
cord-279903-z0wf1wli	20	2	Stevenson	Stevenson	NNP
cord-279903-z0wf1wli	20	3	et	et	NNP
cord-279903-z0wf1wli	20	4	al	al	NNP
cord-279903-z0wf1wli	20	5	.	.	NNP
cord-279903-z0wf1wli	20	6	,	,	,
cord-279903-z0wf1wli	20	7	2013	2013	CD
cord-279903-z0wf1wli	20	8	;	;	:
cord-279903-z0wf1wli	20	9	Jung	Jung	NNP
cord-279903-z0wf1wli	20	10	et	et	NNP
cord-279903-z0wf1wli	20	11	al	al	NNP
cord-279903-z0wf1wli	20	12	.	.	NNP
cord-279903-z0wf1wli	20	13	,	,	,
cord-279903-z0wf1wli	20	14	2014	2014	CD
cord-279903-z0wf1wli	20	15	)	)	-RRB-
cord-279903-z0wf1wli	20	16	.	.	.
cord-279903-z0wf1wli	21	1	Complete	complete	JJ
cord-279903-z0wf1wli	21	2	genomic	genomic	JJ
cord-279903-z0wf1wli	21	3	analysis	analysis	NN
cord-279903-z0wf1wli	21	4	of	of	IN
cord-279903-z0wf1wli	21	5	the	the	DT
cord-279903-z0wf1wli	21	6	virulent	virulent	JJ
cord-279903-z0wf1wli	21	7	PEDV	PEDV	NNP
cord-279903-z0wf1wli	21	8	strains	strain	NNS
cord-279903-z0wf1wli	21	9	from	from	IN
cord-279903-z0wf1wli	21	10	the	the	DT
cord-279903-z0wf1wli	21	11	US	US	NNP
cord-279903-z0wf1wli	21	12	showed	show	VBD
cord-279903-z0wf1wli	21	13	*	*	NFP
cord-279903-z0wf1wli	21	14	Corresponding	correspond	VBG
cord-279903-z0wf1wli	21	15	author	author	NN
cord-279903-z0wf1wli	21	16	.	.	.
cord-279903-z0wf1wli	22	1	Tel	Tel	NNP
cord-279903-z0wf1wli	22	2	.	.	.
cord-279903-z0wf1wli	23	1	:	:	:
cord-279903-z0wf1wli	23	2	+1	+1	NFP
cord-279903-z0wf1wli	24	1	6147286220	6147286220	CD
cord-279903-z0wf1wli	25	1	;	;	:
cord-279903-z0wf1wli	25	2	fax	fax	NN
cord-279903-z0wf1wli	25	3	:	:	:
cord-279903-z0wf1wli	25	4	+1	+1	NFP
cord-279903-z0wf1wli	25	5	6147286310	6147286310	CD
cord-279903-z0wf1wli	25	6	.	.	.
cord-279903-z0wf1wli	26	1	E	e	NN
cord-279903-z0wf1wli	26	2	-	-	NN
cord-279903-z0wf1wli	26	3	mail	mail	NN
cord-279903-z0wf1wli	26	4	address	address	NN
cord-279903-z0wf1wli	26	5	:	:	:
cord-279903-z0wf1wli	27	1	yzhang@agri.ohio.gov	yzhang@agri.ohio.gov	NNP
cord-279903-z0wf1wli	28	1	(	(	-LRB-
cord-279903-z0wf1wli	28	2	Y.	Y.	NNP
cord-279903-z0wf1wli	28	3	Zhang	Zhang	NNP
cord-279903-z0wf1wli	28	4	)	)	-RRB-
cord-279903-z0wf1wli	28	5	.	.	.
cord-279903-z0wf1wli	29	1	that	that	IN
cord-279903-z0wf1wli	29	2	they	-PRON-	PRP
cord-279903-z0wf1wli	29	3	cluster	cluster	VBP
cord-279903-z0wf1wli	29	4	in	in	IN
cord-279903-z0wf1wli	29	5	a	a	DT
cord-279903-z0wf1wli	29	6	single	single	JJ
cord-279903-z0wf1wli	29	7	clade	clade	NN
cord-279903-z0wf1wli	29	8	and	and	CC
cord-279903-z0wf1wli	29	9	are	be	VBP
cord-279903-z0wf1wli	29	10	closely	closely	RB
cord-279903-z0wf1wli	29	11	related	relate	VBN
cord-279903-z0wf1wli	29	12	with	with	IN
cord-279903-z0wf1wli	29	13	the	the	DT
cord-279903-z0wf1wli	29	14	AH2012	AH2012	NNP
cord-279903-z0wf1wli	29	15	strain	strain	NN
cord-279903-z0wf1wli	29	16	reported	report	VBN
cord-279903-z0wf1wli	29	17	in	in	IN
cord-279903-z0wf1wli	29	18	China	China	NNP
cord-279903-z0wf1wli	29	19	(	(	-LRB-
cord-279903-z0wf1wli	29	20	Stevenson	Stevenson	NNP
cord-279903-z0wf1wli	29	21	et	et	NNP
cord-279903-z0wf1wli	29	22	al	al	NNP
cord-279903-z0wf1wli	29	23	.	.	.
cord-279903-z0wf1wli	30	1	,	,	,
cord-279903-z0wf1wli	30	2	2013	2013	CD
cord-279903-z0wf1wli	30	3	;	;	:
cord-279903-z0wf1wli	30	4	Huang	Huang	NNP
cord-279903-z0wf1wli	30	5	et	et	NNP
cord-279903-z0wf1wli	30	6	al	al	NNP
cord-279903-z0wf1wli	30	7	.	.	NNP
cord-279903-z0wf1wli	30	8	,	,	,
cord-279903-z0wf1wli	30	9	2013	2013	CD
cord-279903-z0wf1wli	30	10	)	)	-RRB-
cord-279903-z0wf1wli	30	11	.	.	.
cord-279903-z0wf1wli	31	1	Recently	recently	RB
cord-279903-z0wf1wli	31	2	,	,	,
cord-279903-z0wf1wli	31	3	we	-PRON-	PRP
cord-279903-z0wf1wli	31	4	reported	report	VBD
cord-279903-z0wf1wli	31	5	a	a	DT
cord-279903-z0wf1wli	31	6	new	new	JJ
cord-279903-z0wf1wli	31	7	variant	variant	NN
cord-279903-z0wf1wli	31	8	PEDV	PEDV	NNP
cord-279903-z0wf1wli	31	9	detected	detect	VBD
cord-279903-z0wf1wli	31	10	in	in	IN
cord-279903-z0wf1wli	31	11	Ohio	Ohio	NNP
cord-279903-z0wf1wli	31	12	.	.	.
cord-279903-z0wf1wli	32	1	Clinical	clinical	JJ
cord-279903-z0wf1wli	32	2	observation	observation	NN
cord-279903-z0wf1wli	32	3	indicated	indicate	VBD
cord-279903-z0wf1wli	32	4	that	that	IN
cord-279903-z0wf1wli	32	5	this	this	DT
cord-279903-z0wf1wli	32	6	new	new	JJ
cord-279903-z0wf1wli	32	7	variant	variant	JJ
cord-279903-z0wf1wli	32	8	virus	virus	NN
cord-279903-z0wf1wli	32	9	(	(	-LRB-
cord-279903-z0wf1wli	32	10	OH	OH	NNP
cord-279903-z0wf1wli	32	11	851	851	CD
cord-279903-z0wf1wli	32	12	)	)	-RRB-
cord-279903-z0wf1wli	32	13	caused	cause	VBD
cord-279903-z0wf1wli	32	14	mild	mild	JJ
cord-279903-z0wf1wli	32	15	clinical	clinical	JJ
cord-279903-z0wf1wli	32	16	disease	disease	NN
cord-279903-z0wf1wli	32	17	with	with	IN
cord-279903-z0wf1wli	32	18	low	low	JJ
cord-279903-z0wf1wli	32	19	mortality	mortality	NN
cord-279903-z0wf1wli	32	20	in	in	IN
cord-279903-z0wf1wli	32	21	newborn	newborn	JJ
cord-279903-z0wf1wli	32	22	piglets	piglet	NNS
cord-279903-z0wf1wli	32	23	(	(	-LRB-
cord-279903-z0wf1wli	32	24	unpublished	unpublished	JJ
cord-279903-z0wf1wli	32	25	data	datum	NNS
cord-279903-z0wf1wli	32	26	)	)	-RRB-
cord-279903-z0wf1wli	32	27	,	,	,
cord-279903-z0wf1wli	32	28	making	make	VBG
cord-279903-z0wf1wli	32	29	it	-PRON-	PRP
cord-279903-z0wf1wli	32	30	a	a	DT
cord-279903-z0wf1wli	32	31	potential	potential	JJ
cord-279903-z0wf1wli	32	32	vaccine	vaccine	NN
cord-279903-z0wf1wli	32	33	candidate	candidate	NN
cord-279903-z0wf1wli	32	34	.	.	.
cord-279903-z0wf1wli	33	1	Strain	strain	NN
cord-279903-z0wf1wli	34	1	OH	oh	UH
cord-279903-z0wf1wli	34	2	851	851	CD
cord-279903-z0wf1wli	34	3	is	be	VBZ
cord-279903-z0wf1wli	34	4	distinct	distinct	JJ
cord-279903-z0wf1wli	34	5	from	from	IN
cord-279903-z0wf1wli	34	6	the	the	DT
cord-279903-z0wf1wli	34	7	virulent	virulent	JJ
cord-279903-z0wf1wli	34	8	strains	strain	NNS
cord-279903-z0wf1wli	34	9	of	of	IN
cord-279903-z0wf1wli	34	10	PEDV	PEDV	NNP
cord-279903-z0wf1wli	34	11	in	in	IN
cord-279903-z0wf1wli	34	12	the	the	DT
cord-279903-z0wf1wli	34	13	US	US	NNP
cord-279903-z0wf1wli	34	14	and	and	CC
cord-279903-z0wf1wli	34	15	is	be	VBZ
cord-279903-z0wf1wli	34	16	most	most	RBS
cord-279903-z0wf1wli	34	17	closely	closely	RB
cord-279903-z0wf1wli	34	18	related	relate	VBN
cord-279903-z0wf1wli	34	19	to	to	IN
cord-279903-z0wf1wli	34	20	CH	CH	NNP
cord-279903-z0wf1wli	34	21	/	/	SYM
cord-279903-z0wf1wli	34	22	HBQX/10	HBQX/10	NNP
cord-279903-z0wf1wli	34	23	reported	report	VBD
cord-279903-z0wf1wli	34	24	in	in	IN
cord-279903-z0wf1wli	34	25	central	central	JJ
cord-279903-z0wf1wli	34	26	China	China	NNP
cord-279903-z0wf1wli	34	27	(	(	-LRB-
cord-279903-z0wf1wli	34	28	Zheng	Zheng	NNP
cord-279903-z0wf1wli	34	29	et	et	NNP
cord-279903-z0wf1wli	34	30	al	al	NNP
cord-279903-z0wf1wli	34	31	.	.	NNP
cord-279903-z0wf1wli	34	32	,	,	,
cord-279903-z0wf1wli	34	33	2013	2013	CD
cord-279903-z0wf1wli	34	34	)	)	-RRB-
cord-279903-z0wf1wli	34	35	,	,	,
cord-279903-z0wf1wli	34	36	based	base	VBN
cord-279903-z0wf1wli	34	37	on	on	IN
cord-279903-z0wf1wli	34	38	the	the	DT
cord-279903-z0wf1wli	34	39	phylogenetic	phylogenetic	JJ
cord-279903-z0wf1wli	34	40	analysis	analysis	NN
cord-279903-z0wf1wli	34	41	of	of	IN
cord-279903-z0wf1wli	34	42	the	the	DT
cord-279903-z0wf1wli	34	43	full	full	JJ
cord-279903-z0wf1wli	34	44	-	-	HYPH
cord-279903-z0wf1wli	34	45	length	length	NN
cord-279903-z0wf1wli	34	46	spike	spike	NN
cord-279903-z0wf1wli	34	47	gene	gene	NN
cord-279903-z0wf1wli	34	48	.	.	.
cord-279903-z0wf1wli	35	1	Further	further	JJ
cord-279903-z0wf1wli	35	2	analysis	analysis	NN
cord-279903-z0wf1wli	35	3	showed	show	VBD
cord-279903-z0wf1wli	35	4	that	that	IN
cord-279903-z0wf1wli	35	5	the	the	DT
cord-279903-z0wf1wli	35	6	strain	strain	NN
cord-279903-z0wf1wli	35	7	OH851	oh851	NN
cord-279903-z0wf1wli	35	8	differs	differ	VBZ
cord-279903-z0wf1wli	35	9	from	from	IN
cord-279903-z0wf1wli	35	10	the	the	DT
cord-279903-z0wf1wli	35	11	virulent	virulent	JJ
cord-279903-z0wf1wli	35	12	strains	strain	NNS
cord-279903-z0wf1wli	35	13	of	of	IN
cord-279903-z0wf1wli	35	14	PEDV	PEDV	NNP
cord-279903-z0wf1wli	35	15	in	in	IN
cord-279903-z0wf1wli	35	16	the	the	DT
cord-279903-z0wf1wli	35	17	first	first	JJ
cord-279903-z0wf1wli	35	18	1170	1170	CD
cord-279903-z0wf1wli	35	19	nucleotides	nucleotide	NNS
cord-279903-z0wf1wli	35	20	(	(	-LRB-
cord-279903-z0wf1wli	35	21	nt	nt	RB
cord-279903-z0wf1wli	35	22	)	)	-RRB-
cord-279903-z0wf1wli	35	23	of	of	IN
cord-279903-z0wf1wli	35	24	spike	spike	NN
cord-279903-z0wf1wli	35	25	gene	gene	NN
cord-279903-z0wf1wli	35	26	,	,	,
cord-279903-z0wf1wli	35	27	indicating	indicate	VBG
cord-279903-z0wf1wli	35	28	that	that	IN
cord-279903-z0wf1wli	35	29	at	at	RB
cord-279903-z0wf1wli	35	30	least	least	RBS
cord-279903-z0wf1wli	35	31	two	two	CD
cord-279903-z0wf1wli	35	32	genotypes	genotype	NNS
cord-279903-z0wf1wli	35	33	of	of	IN
cord-279903-z0wf1wli	35	34	PEDV	PEDV	NNP
cord-279903-z0wf1wli	35	35	are	be	VBP
cord-279903-z0wf1wli	35	36	circulating	circulate	VBG
cord-279903-z0wf1wli	35	37	in	in	IN
cord-279903-z0wf1wli	35	38	the	the	DT
cord-279903-z0wf1wli	35	39	US	US	NNP
cord-279903-z0wf1wli	35	40	pigs	pig	NNS
cord-279903-z0wf1wli	35	41	(	(	-LRB-
cord-279903-z0wf1wli	35	42	Stevenson	Stevenson	NNP
cord-279903-z0wf1wli	35	43	et	et	NNP
cord-279903-z0wf1wli	35	44	al	al	NNP
cord-279903-z0wf1wli	35	45	.	.	NNP
cord-279903-z0wf1wli	35	46	,	,	,
cord-279903-z0wf1wli	35	47	2013	2013	CD
cord-279903-z0wf1wli	35	48	;	;	:
cord-279903-z0wf1wli	35	49	Huang	Huang	NNP
cord-279903-z0wf1wli	35	50	et	et	NNP
cord-279903-z0wf1wli	35	51	al	al	NNP
cord-279903-z0wf1wli	35	52	.	.	NNP
cord-279903-z0wf1wli	35	53	,	,	,
cord-279903-z0wf1wli	35	54	2013	2013	CD
cord-279903-z0wf1wli	35	55	;	;	:
cord-279903-z0wf1wli	35	56	Wang	Wang	NNP
cord-279903-z0wf1wli	35	57	et	et	NNP
cord-279903-z0wf1wli	35	58	al	al	NNP
cord-279903-z0wf1wli	35	59	.	.	NNP
cord-279903-z0wf1wli	35	60	,	,	,
cord-279903-z0wf1wli	35	61	2014	2014	CD
cord-279903-z0wf1wli	35	62	)	)	-RRB-
cord-279903-z0wf1wli	35	63	.	.	.
cord-279903-z0wf1wli	36	1	Since	since	IN
cord-279903-z0wf1wli	36	2	effective	effective	JJ
cord-279903-z0wf1wli	36	3	vaccines	vaccine	NNS
cord-279903-z0wf1wli	36	4	are	be	VBP
cord-279903-z0wf1wli	36	5	not	not	RB
cord-279903-z0wf1wli	36	6	currently	currently	RB
cord-279903-z0wf1wli	36	7	available	available	JJ
cord-279903-z0wf1wli	36	8	in	in	IN
cord-279903-z0wf1wli	36	9	North	North	NNP
cord-279903-z0wf1wli	36	10	America	America	NNP
cord-279903-z0wf1wli	36	11	,	,	,
cord-279903-z0wf1wli	36	12	accurate	accurate	JJ
cord-279903-z0wf1wli	36	13	diagnosis	diagnosis	NN
cord-279903-z0wf1wli	36	14	combined	combine	VBN
cord-279903-z0wf1wli	36	15	with	with	IN
cord-279903-z0wf1wli	36	16	biosecurity	biosecurity	NN
cord-279903-z0wf1wli	36	17	is	be	VBZ
cord-279903-z0wf1wli	36	18	the	the	DT
cord-279903-z0wf1wli	36	19	only	only	JJ
cord-279903-z0wf1wli	36	20	reliable	reliable	JJ
cord-279903-z0wf1wli	36	21	method	method	NN
cord-279903-z0wf1wli	36	22	for	for	IN
cord-279903-z0wf1wli	36	23	control	control	NN
cord-279903-z0wf1wli	36	24	and	and	CC
cord-279903-z0wf1wli	36	25	prevention	prevention	NN
cord-279903-z0wf1wli	36	26	of	of	IN
cord-279903-z0wf1wli	36	27	PED	PED	NNP
cord-279903-z0wf1wli	36	28	.	.	.
cord-279903-z0wf1wli	37	1	Electron	electron	NN
cord-279903-z0wf1wli	37	2	microscopy	microscopy	NN
cord-279903-z0wf1wli	37	3	was	be	VBD
cord-279903-z0wf1wli	37	4	widely	widely	RB
cord-279903-z0wf1wli	37	5	used	use	VBN
cord-279903-z0wf1wli	37	6	in	in	IN
cord-279903-z0wf1wli	37	7	the	the	DT
cord-279903-z0wf1wli	37	8	diagnosis	diagnosis	NN
cord-279903-z0wf1wli	37	9	of	of	IN
cord-279903-z0wf1wli	37	10	the	the	DT
cord-279903-z0wf1wli	37	11	initial	initial	JJ
cord-279903-z0wf1wli	37	12	outbreaks	outbreak	NNS
cord-279903-z0wf1wli	37	13	of	of	IN
cord-279903-z0wf1wli	37	14	PEDV	PEDV	NNP
cord-279903-z0wf1wli	37	15	(	(	-LRB-
cord-279903-z0wf1wli	37	16	Pospischil	Pospischil	NNP
cord-279903-z0wf1wli	37	17	et	et	NNP
cord-279903-z0wf1wli	37	18	al	al	NNP
cord-279903-z0wf1wli	37	19	.	.	NNP
cord-279903-z0wf1wli	37	20	,	,	,
cord-279903-z0wf1wli	37	21	1981	1981	CD
cord-279903-z0wf1wli	37	22	)	)	-RRB-
cord-279903-z0wf1wli	37	23	.	.	.
cord-279903-z0wf1wli	38	1	Since	since	IN
cord-279903-z0wf1wli	38	2	then	then	RB
cord-279903-z0wf1wli	38	3	,	,	,
cord-279903-z0wf1wli	38	4	several	several	JJ
cord-279903-z0wf1wli	38	5	methods	method	NNS
cord-279903-z0wf1wli	38	6	have	have	VBP
cord-279903-z0wf1wli	38	7	been	be	VBN
cord-279903-z0wf1wli	38	8	developed	develop	VBN
cord-279903-z0wf1wli	38	9	for	for	IN
cord-279903-z0wf1wli	38	10	laboratory	laboratory	NN
cord-279903-z0wf1wli	38	11	diagnosis	diagnosis	NN
cord-279903-z0wf1wli	38	12	of	of	IN
cord-279903-z0wf1wli	38	13	PEDV	PEDV	NNP
cord-279903-z0wf1wli	38	14	,	,	,
cord-279903-z0wf1wli	38	15	including	include	VBG
cord-279903-z0wf1wli	38	16	the	the	DT
cord-279903-z0wf1wli	38	17	direct	direct	JJ
cord-279903-z0wf1wli	38	18	immunofluorescence	immunofluorescence	NN
cord-279903-z0wf1wli	38	19	test	test	NN
cord-279903-z0wf1wli	38	20	for	for	IN
cord-279903-z0wf1wli	38	21	detection	detection	NN
cord-279903-z0wf1wli	38	22	of	of	IN
cord-279903-z0wf1wli	38	23	PEDV	PEDV	NNP
cord-279903-z0wf1wli	38	24	antigen	antigen	NN
cord-279903-z0wf1wli	38	25	(	(	-LRB-
cord-279903-z0wf1wli	38	26	Guscetti	Guscetti	NNP
cord-279903-z0wf1wli	38	27	et	et	NNP
cord-279903-z0wf1wli	38	28	al	al	NNP
cord-279903-z0wf1wli	38	29	.	.	NNP
cord-279903-z0wf1wli	38	30	,	,	,
cord-279903-z0wf1wli	38	31	1998	1998	CD
cord-279903-z0wf1wli	38	32	)	)	-RRB-
cord-279903-z0wf1wli	38	33	,	,	,
cord-279903-z0wf1wli	38	34	enzyme	enzyme	NN
cord-279903-z0wf1wli	38	35	-	-	HYPH
cord-279903-z0wf1wli	38	36	linked	link	VBN
cord-279903-z0wf1wli	38	37	immunosorbant	immunosorbant	JJ
cord-279903-z0wf1wli	38	38	assays	assay	NNS
cord-279903-z0wf1wli	38	39	(	(	-LRB-
cord-279903-z0wf1wli	38	40	ELISA	ELISA	NNP
cord-279903-z0wf1wli	38	41	)	)	-RRB-
cord-279903-z0wf1wli	38	42	for	for	IN
cord-279903-z0wf1wli	38	43	detection	detection	NN
cord-279903-z0wf1wli	38	44	of	of	IN
cord-279903-z0wf1wli	38	45	either	either	CC
cord-279903-z0wf1wli	38	46	PEDV	PEDV	NNP
cord-279903-z0wf1wli	38	47	antigen	antigen	NN
cord-279903-z0wf1wli	38	48	or	or	CC
cord-279903-z0wf1wli	38	49	antibodies	antibody	NNS
cord-279903-z0wf1wli	38	50	(	(	-LRB-
cord-279903-z0wf1wli	38	51	Carvajal	Carvajal	NNP
cord-279903-z0wf1wli	38	52	et	et	NNP
cord-279903-z0wf1wli	38	53	al	al	NNP
cord-279903-z0wf1wli	38	54	.	.	NNP
cord-279903-z0wf1wli	38	55	,	,	,
cord-279903-z0wf1wli	38	56	1995	1995	CD
cord-279903-z0wf1wli	38	57	)	)	-RRB-
cord-279903-z0wf1wli	38	58	,	,	,
cord-279903-z0wf1wli	38	59	and	and	CC
cord-279903-z0wf1wli	38	60	reverse	reverse	VB
cord-279903-z0wf1wli	38	61	transcription	transcription	NN
cord-279903-z0wf1wli	38	62	-	-	HYPH
cord-279903-z0wf1wli	38	63	polymerase	polymerase	NN
cord-279903-z0wf1wli	38	64	chain	chain	NN
cord-279903-z0wf1wli	38	65	reaction	reaction	NN
cord-279903-z0wf1wli	38	66	(	(	-LRB-
cord-279903-z0wf1wli	38	67	RT	RT	NNP
cord-279903-z0wf1wli	38	68	-	-	HYPH
cord-279903-z0wf1wli	38	69	PCR	PCR	NNP
cord-279903-z0wf1wli	38	70	)	)	-RRB-
cord-279903-z0wf1wli	39	1	(	(	-LRB-
cord-279903-z0wf1wli	39	2	Kwon	Kwon	NNP
cord-279903-z0wf1wli	39	3	et	et	NNP
cord-279903-z0wf1wli	39	4	al	al	NNP
cord-279903-z0wf1wli	39	5	.	.	NNP
cord-279903-z0wf1wli	39	6	,	,	,
cord-279903-z0wf1wli	39	7	1997	1997	CD
cord-279903-z0wf1wli	40	1	;	;	:
cord-279903-z0wf1wli	40	2	Ishikawa	Ishikawa	NNP
cord-279903-z0wf1wli	40	3	et	et	NNP
cord-279903-z0wf1wli	40	4	al	al	NNP
cord-279903-z0wf1wli	40	5	.	.	NNP
cord-279903-z0wf1wli	40	6	,	,	,
cord-279903-z0wf1wli	41	1	1997	1997	CD
cord-279903-z0wf1wli	41	2	years	year	NNS
cord-279903-z0wf1wli	41	3	,	,	,
cord-279903-z0wf1wli	41	4	real	real	JJ
cord-279903-z0wf1wli	41	5	-	-	HYPH
cord-279903-z0wf1wli	41	6	time	time	NN
cord-279903-z0wf1wli	41	7	RT	RT	NNP
cord-279903-z0wf1wli	41	8	-	-	HYPH
cord-279903-z0wf1wli	41	9	PCR	PCR	NNP
cord-279903-z0wf1wli	41	10	has	have	VBZ
cord-279903-z0wf1wli	41	11	increasingly	increasingly	RB
cord-279903-z0wf1wli	41	12	been	be	VBN
cord-279903-z0wf1wli	41	13	used	use	VBN
cord-279903-z0wf1wli	41	14	to	to	TO
cord-279903-z0wf1wli	41	15	detect	detect	VB
cord-279903-z0wf1wli	41	16	viral	viral	JJ
cord-279903-z0wf1wli	41	17	pathogens	pathogen	NNS
cord-279903-z0wf1wli	41	18	because	because	IN
cord-279903-z0wf1wli	41	19	of	of	IN
cord-279903-z0wf1wli	41	20	its	-PRON-	PRP$
cord-279903-z0wf1wli	41	21	advantages	advantage	NNS
cord-279903-z0wf1wli	41	22	including	include	VBG
cord-279903-z0wf1wli	41	23	high	high	JJ
cord-279903-z0wf1wli	41	24	specificity	specificity	NN
cord-279903-z0wf1wli	41	25	and	and	CC
cord-279903-z0wf1wli	41	26	sensitivity	sensitivity	NN
cord-279903-z0wf1wli	41	27	,	,	,
cord-279903-z0wf1wli	41	28	fast	fast	JJ
cord-279903-z0wf1wli	41	29	turnaround	turnaround	NN
cord-279903-z0wf1wli	41	30	,	,	,
cord-279903-z0wf1wli	41	31	and	and	CC
cord-279903-z0wf1wli	41	32	quantification	quantification	NN
cord-279903-z0wf1wli	41	33	of	of	IN
cord-279903-z0wf1wli	41	34	pathogen	pathogen	NN
cord-279903-z0wf1wli	41	35	loads	load	NNS
cord-279903-z0wf1wli	41	36	.	.	.
cord-279903-z0wf1wli	42	1	Currently	currently	RB
cord-279903-z0wf1wli	42	2	,	,	,
cord-279903-z0wf1wli	42	3	the	the	DT
cord-279903-z0wf1wli	42	4	Animal	Animal	NNP
cord-279903-z0wf1wli	42	5	Disease	Disease	NNP
cord-279903-z0wf1wli	42	6	Diagnostic	Diagnostic	NNP
cord-279903-z0wf1wli	42	7	Laboratory	Laboratory	NNP
cord-279903-z0wf1wli	42	8	in	in	IN
cord-279903-z0wf1wli	42	9	the	the	DT
cord-279903-z0wf1wli	42	10	Ohio	Ohio	NNP
cord-279903-z0wf1wli	42	11	Department	Department	NNP
cord-279903-z0wf1wli	42	12	of	of	IN
cord-279903-z0wf1wli	42	13	Agriculture	Agriculture	NNP
cord-279903-z0wf1wli	42	14	uses	use	VBZ
cord-279903-z0wf1wli	42	15	a	a	DT
cord-279903-z0wf1wli	42	16	real	real	JJ
cord-279903-z0wf1wli	42	17	-	-	HYPH
cord-279903-z0wf1wli	42	18	time	time	NN
cord-279903-z0wf1wli	42	19	RT	RT	NNP
cord-279903-z0wf1wli	42	20	-	-	HYPH
cord-279903-z0wf1wli	42	21	PCR	PCR	NNP
cord-279903-z0wf1wli	42	22	method	method	NN
cord-279903-z0wf1wli	42	23	which	which	WDT
cord-279903-z0wf1wli	42	24	targets	target	VBZ
cord-279903-z0wf1wli	42	25	the	the	DT
cord-279903-z0wf1wli	42	26	membrane	membrane	NN
cord-279903-z0wf1wli	42	27	(	(	-LRB-
cord-279903-z0wf1wli	42	28	M	M	NNP
cord-279903-z0wf1wli	42	29	)	)	-RRB-
cord-279903-z0wf1wli	42	30	gene	gene	NN
cord-279903-z0wf1wli	42	31	for	for	IN
cord-279903-z0wf1wli	42	32	detection	detection	NN
cord-279903-z0wf1wli	42	33	of	of	IN
cord-279903-z0wf1wli	42	34	PEDV	PEDV	NNP
cord-279903-z0wf1wli	42	35	.	.	.
cord-279903-z0wf1wli	43	1	However	however	RB
cord-279903-z0wf1wli	43	2	,	,	,
cord-279903-z0wf1wli	43	3	since	since	IN
cord-279903-z0wf1wli	43	4	the	the	DT
cord-279903-z0wf1wli	43	5	M	M	NNP
cord-279903-z0wf1wli	43	6	gene	gene	NN
cord-279903-z0wf1wli	43	7	is	be	VBZ
cord-279903-z0wf1wli	43	8	highly	highly	RB
cord-279903-z0wf1wli	43	9	conserved	conserve	VBN
cord-279903-z0wf1wli	43	10	between	between	IN
cord-279903-z0wf1wli	43	11	the	the	DT
cord-279903-z0wf1wli	43	12	virulent	virulent	JJ
cord-279903-z0wf1wli	43	13	and	and	CC
cord-279903-z0wf1wli	43	14	the	the	DT
cord-279903-z0wf1wli	43	15	variant	variant	JJ
cord-279903-z0wf1wli	43	16	strains	strain	NNS
cord-279903-z0wf1wli	43	17	of	of	IN
cord-279903-z0wf1wli	43	18	PEDV	PEDV	NNP
cord-279903-z0wf1wli	43	19	in	in	IN
cord-279903-z0wf1wli	43	20	the	the	DT
cord-279903-z0wf1wli	43	21	US	US	NNP
cord-279903-z0wf1wli	43	22	,	,	,
cord-279903-z0wf1wli	43	23	this	this	DT
cord-279903-z0wf1wli	43	24	real	real	JJ
cord-279903-z0wf1wli	43	25	-	-	HYPH
cord-279903-z0wf1wli	43	26	time	time	NN
cord-279903-z0wf1wli	43	27	RT	RT	NNP
cord-279903-z0wf1wli	43	28	-	-	HYPH
cord-279903-z0wf1wli	43	29	PCR	PCR	NNP
cord-279903-z0wf1wli	43	30	assay	assay	NN
cord-279903-z0wf1wli	43	31	can	can	MD
cord-279903-z0wf1wli	43	32	not	not	RB
cord-279903-z0wf1wli	43	33	differentiate	differentiate	VB
cord-279903-z0wf1wli	43	34	between	between	IN
cord-279903-z0wf1wli	43	35	the	the	DT
cord-279903-z0wf1wli	43	36	two	two	CD
cord-279903-z0wf1wli	43	37	strains	strain	NNS
cord-279903-z0wf1wli	43	38	of	of	IN
cord-279903-z0wf1wli	43	39	PEDV	PEDV	NNP
cord-279903-z0wf1wli	43	40	.	.	.
cord-279903-z0wf1wli	44	1	Therefore	therefore	RB
cord-279903-z0wf1wli	44	2	,	,	,
cord-279903-z0wf1wli	44	3	the	the	DT
cord-279903-z0wf1wli	44	4	present	present	JJ
cord-279903-z0wf1wli	44	5	study	study	NN
cord-279903-z0wf1wli	44	6	sought	seek	VBD
cord-279903-z0wf1wli	44	7	to	to	TO
cord-279903-z0wf1wli	44	8	develop	develop	VB
cord-279903-z0wf1wli	44	9	and	and	CC
cord-279903-z0wf1wli	44	10	evaluate	evaluate	VB
cord-279903-z0wf1wli	44	11	a	a	DT
cord-279903-z0wf1wli	44	12	duplex	duplex	JJ
cord-279903-z0wf1wli	44	13	real	real	JJ
cord-279903-z0wf1wli	44	14	-	-	HYPH
cord-279903-z0wf1wli	44	15	time	time	NN
cord-279903-z0wf1wli	44	16	RT	RT	NNP
cord-279903-z0wf1wli	44	17	-	-	HYPH
cord-279903-z0wf1wli	44	18	PCR	PCR	NNP
cord-279903-z0wf1wli	44	19	method	method	NN
cord-279903-z0wf1wli	44	20	to	to	IN
cord-279903-z0wf1wli	44	21	distinct	distinct	JJ
cord-279903-z0wf1wli	44	22	between	between	IN
cord-279903-z0wf1wli	44	23	the	the	DT
cord-279903-z0wf1wli	44	24	virulent	virulent	JJ
cord-279903-z0wf1wli	44	25	and	and	CC
cord-279903-z0wf1wli	44	26	the	the	DT
cord-279903-z0wf1wli	44	27	variant	variant	JJ
cord-279903-z0wf1wli	44	28	strains	strain	NNS
cord-279903-z0wf1wli	44	29	of	of	IN
cord-279903-z0wf1wli	44	30	PEDVs	pedv	NNS
cord-279903-z0wf1wli	44	31	.	.	.
cord-279903-z0wf1wli	45	1	Multiple	multiple	JJ
cord-279903-z0wf1wli	45	2	-	-	HYPH
cord-279903-z0wf1wli	45	3	sequence	sequence	NN
cord-279903-z0wf1wli	45	4	alignments	alignment	NNS
cord-279903-z0wf1wli	45	5	with	with	IN
cord-279903-z0wf1wli	45	6	the	the	DT
cord-279903-z0wf1wli	45	7	virulent	virulent	NN
cord-279903-z0wf1wli	45	8	and	and	CC
cord-279903-z0wf1wli	45	9	the	the	DT
cord-279903-z0wf1wli	45	10	variant	variant	JJ
cord-279903-z0wf1wli	45	11	strains	strain	NNS
cord-279903-z0wf1wli	45	12	of	of	IN
cord-279903-z0wf1wli	45	13	PEDV	PEDV	NNP
cord-279903-z0wf1wli	45	14	sequences	sequence	NNS
cord-279903-z0wf1wli	45	15	detected	detect	VBD
cord-279903-z0wf1wli	45	16	in	in	IN
cord-279903-z0wf1wli	45	17	the	the	DT
cord-279903-z0wf1wli	45	18	US	US	NNP
cord-279903-z0wf1wli	45	19	were	be	VBD
cord-279903-z0wf1wli	45	20	carried	carry	VBN
cord-279903-z0wf1wli	45	21	out	out	RP
cord-279903-z0wf1wli	45	22	with	with	IN
cord-279903-z0wf1wli	45	23	the	the	DT
cord-279903-z0wf1wli	45	24	Mega	Mega	NNP
cord-279903-z0wf1wli	45	25	6.05	6.05	CD
cord-279903-z0wf1wli	45	26	program	program	NN
cord-279903-z0wf1wli	45	27	.	.	.
cord-279903-z0wf1wli	46	1	Primers	primer	NNS
cord-279903-z0wf1wli	46	2	were	be	VBD
cord-279903-z0wf1wli	46	3	designed	design	VBN
cord-279903-z0wf1wli	46	4	by	by	IN
cord-279903-z0wf1wli	46	5	targeting	target	VBG
cord-279903-z0wf1wli	46	6	the	the	DT
cord-279903-z0wf1wli	46	7	conserved	conserve	VBN
cord-279903-z0wf1wli	46	8	regions	region	NNS
cord-279903-z0wf1wli	46	9	between	between	IN
cord-279903-z0wf1wli	46	10	virulent	virulent	JJ
cord-279903-z0wf1wli	46	11	and	and	CC
cord-279903-z0wf1wli	46	12	variant	variant	JJ
cord-279903-z0wf1wli	46	13	PEDV	PEDV	NNP
cord-279903-z0wf1wli	46	14	,	,	,
cord-279903-z0wf1wli	46	15	while	while	IN
cord-279903-z0wf1wli	46	16	the	the	DT
cord-279903-z0wf1wli	46	17	probes	probe	NNS
cord-279903-z0wf1wli	46	18	were	be	VBD
cord-279903-z0wf1wli	46	19	designed	design	VBN
cord-279903-z0wf1wli	46	20	by	by	IN
cord-279903-z0wf1wli	46	21	targeting	target	VBG
cord-279903-z0wf1wli	46	22	the	the	DT
cord-279903-z0wf1wli	46	23	location	location	NN
cord-279903-z0wf1wli	46	24	where	where	WRB
cord-279903-z0wf1wli	46	25	variant	variant	NN
cord-279903-z0wf1wli	46	26	PEDVs	pedv	NNS
cord-279903-z0wf1wli	46	27	have	have	VBP
cord-279903-z0wf1wli	46	28	two	two	CD
cord-279903-z0wf1wli	46	29	deletions	deletion	NNS
cord-279903-z0wf1wli	46	30	.	.	.
cord-279903-z0wf1wli	47	1	For	for	IN
cord-279903-z0wf1wli	47	2	multiplexing	multiplexe	VBG
cord-279903-z0wf1wli	47	3	,	,	,
cord-279903-z0wf1wli	47	4	the	the	DT
cord-279903-z0wf1wli	47	5	probe	probe	NN
cord-279903-z0wf1wli	47	6	for	for	IN
cord-279903-z0wf1wli	47	7	the	the	DT
cord-279903-z0wf1wli	47	8	virulent	virulent	JJ
cord-279903-z0wf1wli	47	9	PEDV	PEDV	NNP
cord-279903-z0wf1wli	47	10	was	be	VBD
cord-279903-z0wf1wli	47	11	labeled	label	VBN
cord-279903-z0wf1wli	47	12	with	with	IN
cord-279903-z0wf1wli	47	13	the	the	DT
cord-279903-z0wf1wli	47	14	5	5	CD
cord-279903-z0wf1wli	47	15	-reported	-reported	JJ
cord-279903-z0wf1wli	47	16	dye	dye	NN
cord-279903-z0wf1wli	47	17	Cy5	cy5	NN
cord-279903-z0wf1wli	47	18	and	and	CC
cord-279903-z0wf1wli	47	19	the	the	DT
cord-279903-z0wf1wli	47	20	3	3	CD
cord-279903-z0wf1wli	47	21	-quencher	-quencher	NN
cord-279903-z0wf1wli	47	22	BHQ2	BHQ2	NNP
cord-279903-z0wf1wli	47	23	,	,	,
cord-279903-z0wf1wli	47	24	and	and	CC
cord-279903-z0wf1wli	47	25	the	the	DT
cord-279903-z0wf1wli	47	26	probe	probe	NN
cord-279903-z0wf1wli	47	27	for	for	IN
cord-279903-z0wf1wli	47	28	the	the	DT
cord-279903-z0wf1wli	47	29	variant	variant	JJ
cord-279903-z0wf1wli	47	30	PEDV	PEDV	NNP
cord-279903-z0wf1wli	47	31	was	be	VBD
cord-279903-z0wf1wli	47	32	labeled	label	VBN
cord-279903-z0wf1wli	47	33	with	with	IN
cord-279903-z0wf1wli	47	34	the	the	DT
cord-279903-z0wf1wli	47	35	5	5	CD
cord-279903-z0wf1wli	47	36	-reported	-reported	JJ
cord-279903-z0wf1wli	47	37	dye	dye	NN
cord-279903-z0wf1wli	47	38	6-carboxyfluorescein	6-carboxyfluorescein	CD
cord-279903-z0wf1wli	47	39	(	(	-LRB-
cord-279903-z0wf1wli	47	40	FAM	FAM	NNP
cord-279903-z0wf1wli	47	41	)	)	-RRB-
cord-279903-z0wf1wli	47	42	and	and	CC
cord-279903-z0wf1wli	47	43	double	double	JJ
cord-279903-z0wf1wli	47	44	quencher	quencher	NN
cord-279903-z0wf1wli	47	45	of	of	IN
cord-279903-z0wf1wli	47	46	the	the	DT
cord-279903-z0wf1wli	47	47	internal	internal	JJ
cord-279903-z0wf1wli	47	48	ZEN	ZEN	NNP
cord-279903-z0wf1wli	47	49	and	and	CC
cord-279903-z0wf1wli	47	50	3'Iowa	3'iowa	CD
cord-279903-z0wf1wli	47	51	Black	Black	NNP
cord-279903-z0wf1wli	47	52	®	®	POS
cord-279903-z0wf1wli	47	53	FQ	FQ	NNP
cord-279903-z0wf1wli	47	54	(	(	-LRB-
cord-279903-z0wf1wli	47	55	3IABkFQ	3iabkfq	CD
cord-279903-z0wf1wli	47	56	)	)	-RRB-
cord-279903-z0wf1wli	47	57	.	.	.
cord-279903-z0wf1wli	48	1	The	the	DT
cord-279903-z0wf1wli	48	2	sequences	sequence	NNS
cord-279903-z0wf1wli	48	3	and	and	CC
cord-279903-z0wf1wli	48	4	amplicon	amplicon	NN
cord-279903-z0wf1wli	48	5	sizes	size	NNS
cord-279903-z0wf1wli	48	6	of	of	IN
cord-279903-z0wf1wli	48	7	the	the	DT
cord-279903-z0wf1wli	48	8	primers	primer	NNS
cord-279903-z0wf1wli	48	9	and	and	CC
cord-279903-z0wf1wli	48	10	probes	probe	NNS
cord-279903-z0wf1wli	48	11	are	be	VBP
cord-279903-z0wf1wli	48	12	listed	list	VBN
cord-279903-z0wf1wli	48	13	in	in	IN
cord-279903-z0wf1wli	48	14	Table	Table	NNP
cord-279903-z0wf1wli	48	15	1	1	CD
cord-279903-z0wf1wli	48	16	and	and	CC
cord-279903-z0wf1wli	48	17	Fig	Fig	NNP
cord-279903-z0wf1wli	48	18	.	.	.
cord-279903-z0wf1wli	49	1	1	1	LS
cord-279903-z0wf1wli	49	2	.	.	.
cord-279903-z0wf1wli	50	1	Sequences	sequence	NNS
cord-279903-z0wf1wli	50	2	of	of	IN
cord-279903-z0wf1wli	50	3	primers	primer	NNS
cord-279903-z0wf1wli	50	4	and	and	CC
cord-279903-z0wf1wli	50	5	probe	probe	VB
cord-279903-z0wf1wli	50	6	for	for	IN
cord-279903-z0wf1wli	50	7	the	the	DT
cord-279903-z0wf1wli	50	8	real	real	JJ
cord-279903-z0wf1wli	50	9	-	-	HYPH
cord-279903-z0wf1wli	50	10	time	time	NN
cord-279903-z0wf1wli	50	11	RT	RT	NNP
cord-279903-z0wf1wli	50	12	-	-	HYPH
cord-279903-z0wf1wli	50	13	PCR	PCR	NNP
cord-279903-z0wf1wli	50	14	targeting	target	VBG
cord-279903-z0wf1wli	50	15	M	M	NNP
cord-279903-z0wf1wli	50	16	gene	gene	NN
cord-279903-z0wf1wli	50	17	were	be	VBD
cord-279903-z0wf1wli	50	18	listed	list	VBN
cord-279903-z0wf1wli	50	19	in	in	IN
cord-279903-z0wf1wli	50	20	Table	Table	NNP
cord-279903-z0wf1wli	50	21	1	1	CD
cord-279903-z0wf1wli	50	22	.	.	.
cord-279903-z0wf1wli	51	1	RNA	RNA	NNP
cord-279903-z0wf1wli	51	2	was	be	VBD
cord-279903-z0wf1wli	51	3	extracted	extract	VBN
cord-279903-z0wf1wli	51	4	with	with	IN
cord-279903-z0wf1wli	51	5	the	the	DT
cord-279903-z0wf1wli	51	6	TRIzol	TRIzol	NNP
cord-279903-z0wf1wli	51	7	reagent	reagent	NN
cord-279903-z0wf1wli	51	8	(	(	-LRB-
cord-279903-z0wf1wli	51	9	Invitrogen	Invitrogen	NNP
cord-279903-z0wf1wli	51	10	,	,	,
cord-279903-z0wf1wli	51	11	Carlsbad	Carlsbad	NNP
cord-279903-z0wf1wli	51	12	,	,	,
cord-279903-z0wf1wli	51	13	CA	CA	NNP
cord-279903-z0wf1wli	51	14	,	,	,
cord-279903-z0wf1wli	51	15	USA	USA	NNP
cord-279903-z0wf1wli	51	16	)	)	-RRB-
cord-279903-z0wf1wli	51	17	.	.	.
cord-279903-z0wf1wli	52	1	Amplification	amplification	NN
cord-279903-z0wf1wli	52	2	was	be	VBD
cord-279903-z0wf1wli	52	3	performed	perform	VBN
cord-279903-z0wf1wli	52	4	with	with	IN
cord-279903-z0wf1wli	52	5	the	the	DT
cord-279903-z0wf1wli	52	6	QIAgen	QIAgen	NNP
cord-279903-z0wf1wli	52	7	One	One	NNP
cord-279903-z0wf1wli	52	8	Step	Step	NNP
cord-279903-z0wf1wli	52	9	RT	RT	NNP
cord-279903-z0wf1wli	52	10	-	-	HYPH
cord-279903-z0wf1wli	52	11	PCR	PCR	NNP
cord-279903-z0wf1wli	52	12	kit	kit	NN
cord-279903-z0wf1wli	52	13	(	(	-LRB-
cord-279903-z0wf1wli	52	14	Valencia	Valencia	NNP
cord-279903-z0wf1wli	52	15	,	,	,
cord-279903-z0wf1wli	52	16	CA	CA	NNP
cord-279903-z0wf1wli	52	17	,	,	,
cord-279903-z0wf1wli	52	18	USA	USA	NNP
cord-279903-z0wf1wli	52	19	)	)	-RRB-
cord-279903-z0wf1wli	52	20	in	in	IN
cord-279903-z0wf1wli	52	21	a	a	DT
cord-279903-z0wf1wli	52	22	SmartCycler	SmartCycler	NNP
cord-279903-z0wf1wli	52	23	II	II	NNP
cord-279903-z0wf1wli	52	24	instrument	instrument	NN
cord-279903-z0wf1wli	52	25	.	.	.
cord-279903-z0wf1wli	53	1	The	the	DT
cord-279903-z0wf1wli	53	2	amplification	amplification	NN
cord-279903-z0wf1wli	53	3	conditions	condition	NNS
cord-279903-z0wf1wli	53	4	were	be	VBD
cord-279903-z0wf1wli	53	5	50	50	CD
cord-279903-z0wf1wli	53	6	•	•	NN
cord-279903-z0wf1wli	53	7	C	c	NN
cord-279903-z0wf1wli	53	8	for	for	IN
cord-279903-z0wf1wli	53	9	30	30	CD
cord-279903-z0wf1wli	53	10	min	min	NN
cord-279903-z0wf1wli	53	11	;	;	:
cord-279903-z0wf1wli	53	12	95	95	CD
cord-279903-z0wf1wli	54	1	•	•	NNP
cord-279903-z0wf1wli	55	1	C	C	NNP
cord-279903-z0wf1wli	55	2	for	for	IN
cord-279903-z0wf1wli	55	3	15	15	CD
cord-279903-z0wf1wli	55	4	min	min	NN
cord-279903-z0wf1wli	55	5	;	;	:
cord-279903-z0wf1wli	55	6	and	and	CC
cord-279903-z0wf1wli	55	7	45	45	CD
cord-279903-z0wf1wli	55	8	cycles	cycle	NNS
cord-279903-z0wf1wli	55	9	of	of	IN
cord-279903-z0wf1wli	55	10	94	94	CD
cord-279903-z0wf1wli	55	11	•	•	NNP
cord-279903-z0wf1wli	55	12	C	C	NNP
cord-279903-z0wf1wli	55	13	,	,	,
cord-279903-z0wf1wli	55	14	10	10	CD
cord-279903-z0wf1wli	55	15	s	s	NN
cord-279903-z0wf1wli	55	16	,	,	,
cord-279903-z0wf1wli	55	17	54	54	CD
cord-279903-z0wf1wli	55	18	•	•	NNP
cord-279903-z0wf1wli	55	19	C	C	NNP
cord-279903-z0wf1wli	55	20	,	,	,
cord-279903-z0wf1wli	55	21	30	30	CD
cord-279903-z0wf1wli	55	22	s	s	NN
cord-279903-z0wf1wli	55	23	,	,	,
cord-279903-z0wf1wli	55	24	and	and	CC
cord-279903-z0wf1wli	55	25	72	72	CD
cord-279903-z0wf1wli	55	26	•	•	NN
cord-279903-z0wf1wli	55	27	C	C	NNP
cord-279903-z0wf1wli	55	28	,	,	,
cord-279903-z0wf1wli	55	29	12	12	CD
cord-279903-z0wf1wli	55	30	s.	s.	NNP
cord-279903-z0wf1wli	55	31	Primers	Primers	NNP
cord-279903-z0wf1wli	55	32	(	(	-LRB-
cord-279903-z0wf1wli	55	33	Integrated	Integrated	NNP
cord-279903-z0wf1wli	55	34	DNA	DNA	NNP
cord-279903-z0wf1wli	55	35	Technologies	Technologies	NNP
cord-279903-z0wf1wli	55	36	,	,	,
cord-279903-z0wf1wli	55	37	Coralville	Coralville	NNP
cord-279903-z0wf1wli	55	38	,	,	,
cord-279903-z0wf1wli	55	39	Iowa	Iowa	NNP
cord-279903-z0wf1wli	55	40	,	,	,
cord-279903-z0wf1wli	55	41	USA	USA	NNP
cord-279903-z0wf1wli	55	42	)	)	-RRB-
cord-279903-z0wf1wli	55	43	at	at	IN
cord-279903-z0wf1wli	55	44	240	240	CD
cord-279903-z0wf1wli	55	45	nM	nm	CD
cord-279903-z0wf1wli	55	46	and	and	CC
cord-279903-z0wf1wli	55	47	each	each	DT
cord-279903-z0wf1wli	55	48	probe	probe	NN
cord-279903-z0wf1wli	55	49	(	(	-LRB-
cord-279903-z0wf1wli	55	50	Integrated	Integrated	NNP
cord-279903-z0wf1wli	55	51	DNA	DNA	NNP
cord-279903-z0wf1wli	55	52	Technologies	Technologies	NNP
cord-279903-z0wf1wli	55	53	,	,	,
cord-279903-z0wf1wli	55	54	Coralville	Coralville	NNP
cord-279903-z0wf1wli	55	55	,	,	,
cord-279903-z0wf1wli	55	56	Iowa	Iowa	NNP
cord-279903-z0wf1wli	55	57	,	,	,
cord-279903-z0wf1wli	55	58	USA	USA	NNP
cord-279903-z0wf1wli	55	59	)	)	-RRB-
cord-279903-z0wf1wli	55	60	at	at	IN
cord-279903-z0wf1wli	55	61	240	240	CD
cord-279903-z0wf1wli	55	62	nM	nM	NNS
cord-279903-z0wf1wli	55	63	were	be	VBD
cord-279903-z0wf1wli	55	64	used	use	VBN
cord-279903-z0wf1wli	55	65	for	for	IN
cord-279903-z0wf1wli	55	66	one	one	CD
cord-279903-z0wf1wli	55	67	reaction	reaction	NN
cord-279903-z0wf1wli	55	68	.	.	.
cord-279903-z0wf1wli	56	1	The	the	DT
cord-279903-z0wf1wli	56	2	primer	primer	NN
cord-279903-z0wf1wli	56	3	set	set	NN
cord-279903-z0wf1wli	56	4	and	and	CC
cord-279903-z0wf1wli	56	5	individual	individual	JJ
cord-279903-z0wf1wli	56	6	probe	probe	NN
cord-279903-z0wf1wli	56	7	were	be	VBD
cord-279903-z0wf1wli	56	8	tested	test	VBN
cord-279903-z0wf1wli	56	9	first	first	RB
cord-279903-z0wf1wli	56	10	in	in	IN
cord-279903-z0wf1wli	56	11	a	a	DT
cord-279903-z0wf1wli	56	12	single	single	JJ
cord-279903-z0wf1wli	56	13	real	real	JJ
cord-279903-z0wf1wli	56	14	-	-	HYPH
cord-279903-z0wf1wli	56	15	time	time	NN
cord-279903-z0wf1wli	56	16	RT	RT	NNP
cord-279903-z0wf1wli	56	17	-	-	HYPH
cord-279903-z0wf1wli	56	18	PCR	PCR	NNP
cord-279903-z0wf1wli	56	19	assay	assay	NN
cord-279903-z0wf1wli	56	20	and	and	CC
cord-279903-z0wf1wli	56	21	then	then	RB
cord-279903-z0wf1wli	56	22	in	in	IN
cord-279903-z0wf1wli	56	23	a	a	DT
cord-279903-z0wf1wli	56	24	duplex	duplex	JJ
cord-279903-z0wf1wli	56	25	real	real	JJ
cord-279903-z0wf1wli	56	26	-	-	HYPH
cord-279903-z0wf1wli	56	27	time	time	NN
cord-279903-z0wf1wli	56	28	RT	RT	NNP
cord-279903-z0wf1wli	56	29	-	-	HYPH
cord-279903-z0wf1wli	56	30	PCR	PCR	NNP
cord-279903-z0wf1wli	56	31	assay	assay	NN
cord-279903-z0wf1wli	56	32	.	.	.
cord-279903-z0wf1wli	57	1	Intra	intra	JJ
cord-279903-z0wf1wli	57	2	-	-	NN
cord-279903-z0wf1wli	57	3	specificity	specificity	NN
cord-279903-z0wf1wli	57	4	of	of	IN
cord-279903-z0wf1wli	57	5	the	the	DT
cord-279903-z0wf1wli	57	6	duplex	duplex	JJ
cord-279903-z0wf1wli	57	7	RT	RT	NNP
cord-279903-z0wf1wli	57	8	-	-	HYPH
cord-279903-z0wf1wli	57	9	PCR	PCR	NNP
cord-279903-z0wf1wli	57	10	assay	assay	NN
cord-279903-z0wf1wli	57	11	was	be	VBD
cord-279903-z0wf1wli	57	12	determined	determine	VBN
cord-279903-z0wf1wli	57	13	using	use	VBG
cord-279903-z0wf1wli	57	14	single	single	JJ
cord-279903-z0wf1wli	57	15	probe	probe	NN
cord-279903-z0wf1wli	57	16	of	of	IN
cord-279903-z0wf1wli	57	17	either	either	DT
cord-279903-z0wf1wli	57	18	virulent	virulent	JJ
cord-279903-z0wf1wli	57	19	PEDV	PEDV	NNP
cord-279903-z0wf1wli	57	20	probe	probe	NN
cord-279903-z0wf1wli	57	21	for	for	IN
cord-279903-z0wf1wli	57	22	variant	variant	JJ
cord-279903-z0wf1wli	57	23	PEDV	PEDV	NNP
cord-279903-z0wf1wli	57	24	strain	strain	NN
cord-279903-z0wf1wli	57	25	or	or	CC
cord-279903-z0wf1wli	57	26	variant	variant	JJ
cord-279903-z0wf1wli	57	27	PEDV	PEDV	NNP
cord-279903-z0wf1wli	57	28	probe	probe	NN
cord-279903-z0wf1wli	57	29	for	for	IN
cord-279903-z0wf1wli	57	30	virulent	virulent	JJ
cord-279903-z0wf1wli	57	31	PEDV	PEDV	NNP
cord-279903-z0wf1wli	57	32	strain	strain	NN
cord-279903-z0wf1wli	57	33	and	and	CC
cord-279903-z0wf1wli	57	34	two	two	CD
cord-279903-z0wf1wli	57	35	probes	probe	NNS
cord-279903-z0wf1wli	57	36	for	for	IN
cord-279903-z0wf1wli	57	37	both	both	DT
cord-279903-z0wf1wli	57	38	types	type	NNS
cord-279903-z0wf1wli	57	39	of	of	IN
cord-279903-z0wf1wli	57	40	PEDVs	pedv	NNS
cord-279903-z0wf1wli	57	41	for	for	IN
cord-279903-z0wf1wli	57	42	positive	positive	JJ
cord-279903-z0wf1wli	57	43	control	control	NN
cord-279903-z0wf1wli	57	44	.	.	.
cord-279903-z0wf1wli	58	1	Inter	inter	JJ
cord-279903-z0wf1wli	58	2	-	-	NN
cord-279903-z0wf1wli	58	3	specificity	specificity	NN
cord-279903-z0wf1wli	58	4	of	of	IN
cord-279903-z0wf1wli	58	5	duplex	duplex	NN
cord-279903-z0wf1wli	58	6	RT	RT	NNP
cord-279903-z0wf1wli	58	7	-	-	HYPH
cord-279903-z0wf1wli	58	8	PCR	PCR	NNP
cord-279903-z0wf1wli	58	9	assay	assay	NN
cord-279903-z0wf1wli	58	10	was	be	VBD
cord-279903-z0wf1wli	58	11	examined	examine	VBN
cord-279903-z0wf1wli	58	12	using	use	VBG
cord-279903-z0wf1wli	58	13	various	various	JJ
cord-279903-z0wf1wli	58	14	swine	swine	NN
cord-279903-z0wf1wli	58	15	virus	virus	NN
cord-279903-z0wf1wli	58	16	strains	strain	NNS
cord-279903-z0wf1wli	58	17	available	available	JJ
cord-279903-z0wf1wli	58	18	in	in	IN
cord-279903-z0wf1wli	58	19	our	-PRON-	PRP$
cord-279903-z0wf1wli	58	20	lab	lab	NN
cord-279903-z0wf1wli	58	21	.	.	.
cord-279903-z0wf1wli	59	1	These	these	DT
cord-279903-z0wf1wli	59	2	viruses	virus	NNS
cord-279903-z0wf1wli	59	3	include	include	VBP
cord-279903-z0wf1wli	59	4	porcine	porcine	JJ
cord-279903-z0wf1wli	59	5	reproductive	reproductive	JJ
cord-279903-z0wf1wli	59	6	and	and	CC
cord-279903-z0wf1wli	59	7	respiratory	respiratory	JJ
cord-279903-z0wf1wli	59	8	syndrome	syndrome	NN
cord-279903-z0wf1wli	59	9	virus	virus	NN
cord-279903-z0wf1wli	59	10	,	,	,
cord-279903-z0wf1wli	59	11	swine	swine	NN
cord-279903-z0wf1wli	59	12	influenza	influenza	NN
cord-279903-z0wf1wli	59	13	virus	virus	NN
cord-279903-z0wf1wli	59	14	(	(	-LRB-
cord-279903-z0wf1wli	59	15	H3N2	H3N2	NNP
cord-279903-z0wf1wli	59	16	)	)	-RRB-
cord-279903-z0wf1wli	59	17	,	,	,
cord-279903-z0wf1wli	59	18	transmissible	transmissible	JJ
cord-279903-z0wf1wli	59	19	gastroenteritis	gastroenteritis	NN
cord-279903-z0wf1wli	59	20	virus	virus	NN
cord-279903-z0wf1wli	59	21	,	,	,
cord-279903-z0wf1wli	59	22	encephalomyocarditis	encephalomyocarditis	NNP
cord-279903-z0wf1wli	59	23	virus	virus	NN
cord-279903-z0wf1wli	59	24	,	,	,
cord-279903-z0wf1wli	60	1	porcine	porcine	JJ
cord-279903-z0wf1wli	60	2	coronavirus	coronavirus	NN
cord-279903-z0wf1wli	60	3	HKU15	hku15	NN
cord-279903-z0wf1wli	60	4	,	,	,
cord-279903-z0wf1wli	60	5	porcine	porcine	JJ
cord-279903-z0wf1wli	60	6	parvovirus	parvovirus	NN
cord-279903-z0wf1wli	60	7	,	,	,
cord-279903-z0wf1wli	60	8	and	and	CC
cord-279903-z0wf1wli	60	9	pseudorabies	pseudorabies	NN
cord-279903-z0wf1wli	60	10	virus	virus	NN
cord-279903-z0wf1wli	60	11	.	.	.
cord-279903-z0wf1wli	61	1	For	for	IN
cord-279903-z0wf1wli	61	2	DNA	dna	NN
cord-279903-z0wf1wli	61	3	virus	virus	NN
cord-279903-z0wf1wli	61	4	porcine	porcine	JJ
cord-279903-z0wf1wli	61	5	parvovirus	parvovirus	NN
cord-279903-z0wf1wli	61	6	and	and	CC
cord-279903-z0wf1wli	61	7	pseudorabies	pseudorabies	NN
cord-279903-z0wf1wli	61	8	virus	virus	NN
cord-279903-z0wf1wli	61	9	,	,	,
cord-279903-z0wf1wli	61	10	DNA	dna	NN
cord-279903-z0wf1wli	61	11	samples	sample	NNS
cord-279903-z0wf1wli	61	12	were	be	VBD
cord-279903-z0wf1wli	61	13	extracted	extract	VBN
cord-279903-z0wf1wli	61	14	using	use	VBG
cord-279903-z0wf1wli	61	15	DNeasy	DNeasy	NNP
cord-279903-z0wf1wli	61	16	Blood	Blood	NNP
cord-279903-z0wf1wli	61	17	&	&	CC
cord-279903-z0wf1wli	61	18	Tissue	Tissue	NNP
cord-279903-z0wf1wli	61	19	Kit	Kit	NNP
cord-279903-z0wf1wli	61	20	(	(	-LRB-
cord-279903-z0wf1wli	61	21	QIAgen	QIAgen	NNP
cord-279903-z0wf1wli	61	22	,	,	,
cord-279903-z0wf1wli	61	23	Valencia	Valencia	NNP
cord-279903-z0wf1wli	61	24	,	,	,
cord-279903-z0wf1wli	61	25	CA	CA	NNP
cord-279903-z0wf1wli	61	26	,	,	,
cord-279903-z0wf1wli	61	27	USA	USA	NNP
cord-279903-z0wf1wli	61	28	)	)	-RRB-
cord-279903-z0wf1wli	61	29	.	.	.
cord-279903-z0wf1wli	62	1	In	in	IN
cord-279903-z0wf1wli	62	2	the	the	DT
cord-279903-z0wf1wli	62	3	assay	assay	NN
cord-279903-z0wf1wli	62	4	,	,	,
cord-279903-z0wf1wli	62	5	2.5	2.5	CD
cord-279903-z0wf1wli	62	6	l	l	NNP
cord-279903-z0wf1wli	62	7	RNA	RNA	NNP
cord-279903-z0wf1wli	62	8	or	or	CC
cord-279903-z0wf1wli	62	9	DNA	dna	NN
cord-279903-z0wf1wli	62	10	samples	sample	NNS
cord-279903-z0wf1wli	62	11	were	be	VBD
cord-279903-z0wf1wli	62	12	used	use	VBN
cord-279903-z0wf1wli	62	13	,	,	,
cord-279903-z0wf1wli	62	14	2.5	2.5	CD
cord-279903-z0wf1wli	62	15	l	l	NN
cord-279903-z0wf1wli	62	16	each	each	DT
cord-279903-z0wf1wli	62	17	of	of	IN
cord-279903-z0wf1wli	62	18	virulent	virulent	JJ
cord-279903-z0wf1wli	62	19	PEDV	PEDV	NNP
cord-279903-z0wf1wli	62	20	OH1715	OH1715	NNP
cord-279903-z0wf1wli	62	21	strain	strain	NN
cord-279903-z0wf1wli	62	22	and	and	CC
cord-279903-z0wf1wli	62	23	variant	variant	NN
cord-279903-z0wf1wli	62	24	PEDV	PEDV	NNP
cord-279903-z0wf1wli	62	25	OH851	OH851	NNP
cord-279903-z0wf1wli	62	26	were	be	VBD
cord-279903-z0wf1wli	62	27	used	use	VBN
cord-279903-z0wf1wli	62	28	as	as	IN
cord-279903-z0wf1wli	62	29	positive	positive	JJ
cord-279903-z0wf1wli	62	30	control	control	NN
cord-279903-z0wf1wli	62	31	in	in	IN
cord-279903-z0wf1wli	62	32	the	the	DT
cord-279903-z0wf1wli	62	33	duplex	duplex	JJ
cord-279903-z0wf1wli	62	34	RT	RT	NNP
cord-279903-z0wf1wli	62	35	-	-	HYPH
cord-279903-z0wf1wli	62	36	PCR	PCR	NNP
cord-279903-z0wf1wli	62	37	and	and	CC
cord-279903-z0wf1wli	62	38	2.5	2.5	CD
cord-279903-z0wf1wli	62	39	l	l	NN
cord-279903-z0wf1wli	62	40	distilled	distilled	JJ
cord-279903-z0wf1wli	62	41	water	water	NN
cord-279903-z0wf1wli	62	42	was	be	VBD
cord-279903-z0wf1wli	62	43	used	use	VBN
cord-279903-z0wf1wli	62	44	as	as	IN
cord-279903-z0wf1wli	62	45	negative	negative	JJ
cord-279903-z0wf1wli	62	46	control	control	NN
cord-279903-z0wf1wli	62	47	.	.	.
cord-279903-z0wf1wli	63	1	The	the	DT
cord-279903-z0wf1wli	63	2	PCR	PCR	NNP
cord-279903-z0wf1wli	63	3	products	product	NNS
cord-279903-z0wf1wli	63	4	amplified	amplify	VBN
cord-279903-z0wf1wli	63	5	by	by	IN
cord-279903-z0wf1wli	63	6	using	use	VBG
cord-279903-z0wf1wli	63	7	RNAs	rna	NNS
cord-279903-z0wf1wli	63	8	from	from	IN
cord-279903-z0wf1wli	63	9	OH851	OH851	NNP
cord-279903-z0wf1wli	63	10	(	(	-LRB-
cord-279903-z0wf1wli	63	11	variant	variant	JJ
cord-279903-z0wf1wli	63	12	PEDV	PEDV	NNP
cord-279903-z0wf1wli	63	13	)	)	-RRB-
cord-279903-z0wf1wli	63	14	and	and	CC
cord-279903-z0wf1wli	63	15	OH1715	oh1715	NN
cord-279903-z0wf1wli	63	16	(	(	-LRB-
cord-279903-z0wf1wli	63	17	virulent	virulent	JJ
cord-279903-z0wf1wli	63	18	PEDV	PEDV	NNP
cord-279903-z0wf1wli	63	19	)	)	-RRB-
cord-279903-z0wf1wli	64	1	and	and	CC
cord-279903-z0wf1wli	64	2	the	the	DT
cord-279903-z0wf1wli	64	3	primer	primer	NN
cord-279903-z0wf1wli	64	4	set	set	VBN
cord-279903-z0wf1wli	64	5	P160-P161	P160-P161	NNP
cord-279903-z0wf1wli	64	6	covering	cover	VBG
cord-279903-z0wf1wli	64	7	the	the	DT
cord-279903-z0wf1wli	64	8	region	region	NN
cord-279903-z0wf1wli	64	9	where	where	WRB
cord-279903-z0wf1wli	64	10	contains	contain	VBZ
cord-279903-z0wf1wli	64	11	the	the	DT
cord-279903-z0wf1wli	64	12	majority	majority	NN
cord-279903-z0wf1wli	64	13	of	of	IN
cord-279903-z0wf1wli	64	14	sequence	sequence	NN
cord-279903-z0wf1wli	64	15	variations	variation	NNS
cord-279903-z0wf1wli	64	16	between	between	IN
cord-279903-z0wf1wli	64	17	the	the	DT
cord-279903-z0wf1wli	64	18	virulent	virulent	JJ
cord-279903-z0wf1wli	64	19	and	and	CC
cord-279903-z0wf1wli	64	20	variant	variant	NN
cord-279903-z0wf1wli	64	21	PEDVs	pedv	NNS
cord-279903-z0wf1wli	64	22	were	be	VBD
cord-279903-z0wf1wli	64	23	cloned	clone	VBN
cord-279903-z0wf1wli	64	24	into	into	IN
cord-279903-z0wf1wli	64	25	the	the	DT
cord-279903-z0wf1wli	64	26	pCR	pCR	NNP
cord-279903-z0wf1wli	64	27	2.1	2.1	CD
cord-279903-z0wf1wli	64	28	vector	vector	NN
cord-279903-z0wf1wli	64	29	(	(	-LRB-
cord-279903-z0wf1wli	64	30	Invitrogen	Invitrogen	NNP
cord-279903-z0wf1wli	64	31	,	,	,
cord-279903-z0wf1wli	64	32	Carlsbad	Carlsbad	NNP
cord-279903-z0wf1wli	64	33	,	,	,
cord-279903-z0wf1wli	64	34	CA	CA	NNP
cord-279903-z0wf1wli	64	35	,	,	,
cord-279903-z0wf1wli	64	36	USA	USA	NNP
cord-279903-z0wf1wli	64	37	)	)	-RRB-
cord-279903-z0wf1wli	64	38	.	.	.
cord-279903-z0wf1wli	65	1	The	the	DT
cord-279903-z0wf1wli	65	2	plasmids	plasmid	NNS
cord-279903-z0wf1wli	65	3	with	with	IN
cord-279903-z0wf1wli	65	4	the	the	DT
cord-279903-z0wf1wli	65	5	OH851	oh851	NN
cord-279903-z0wf1wli	65	6	(	(	-LRB-
cord-279903-z0wf1wli	65	7	pCR	pCR	NNP
cord-279903-z0wf1wli	65	8	2.1-OH851	2.1-oh851	CD
cord-279903-z0wf1wli	65	9	)	)	-RRB-
cord-279903-z0wf1wli	65	10	or	or	CC
cord-279903-z0wf1wli	65	11	OH1715	oh1715	VB
cord-279903-z0wf1wli	65	12	(	(	-LRB-
cord-279903-z0wf1wli	65	13	pCR	pCR	NNP
cord-279903-z0wf1wli	65	14	2.1-OH1715	2.1-oh1715	CD
cord-279903-z0wf1wli	65	15	)	)	-RRB-
cord-279903-z0wf1wli	65	16	genes	gene	NNS
cord-279903-z0wf1wli	65	17	were	be	VBD
cord-279903-z0wf1wli	65	18	confirmed	confirm	VBN
cord-279903-z0wf1wli	65	19	by	by	IN
cord-279903-z0wf1wli	65	20	sequencing	sequence	VBG
cord-279903-z0wf1wli	65	21	.	.	.
cord-279903-z0wf1wli	66	1	The	the	DT
cord-279903-z0wf1wli	66	2	detection	detection	NN
cord-279903-z0wf1wli	66	3	limit	limit	NN
cord-279903-z0wf1wli	66	4	of	of	IN
cord-279903-z0wf1wli	66	5	the	the	DT
cord-279903-z0wf1wli	66	6	real	real	JJ
cord-279903-z0wf1wli	66	7	-	-	HYPH
cord-279903-z0wf1wli	66	8	time	time	NN
cord-279903-z0wf1wli	66	9	RT	RT	NNP
cord-279903-z0wf1wli	66	10	-	-	HYPH
cord-279903-z0wf1wli	66	11	PCR	PCR	NNP
cord-279903-z0wf1wli	66	12	assay	assay	NN
cord-279903-z0wf1wli	66	13	was	be	VBD
cord-279903-z0wf1wli	66	14	determined	determine	VBN
cord-279903-z0wf1wli	66	15	through	through	IN
cord-279903-z0wf1wli	66	16	serial	serial	JJ
cord-279903-z0wf1wli	66	17	dilutions	dilution	NNS
cord-279903-z0wf1wli	66	18	of	of	IN
cord-279903-z0wf1wli	66	19	each	each	DT
cord-279903-z0wf1wli	66	20	plasmid	plasmid	NN
cord-279903-z0wf1wli	66	21	.	.	.
cord-279903-z0wf1wli	67	1	Duplicates	duplicate	NNS
cord-279903-z0wf1wli	67	2	for	for	IN
cord-279903-z0wf1wli	67	3	each	each	DT
cord-279903-z0wf1wli	67	4	dilution	dilution	NN
cord-279903-z0wf1wli	67	5	were	be	VBD
cord-279903-z0wf1wli	67	6	examined	examine	VBN
cord-279903-z0wf1wli	67	7	for	for	IN
cord-279903-z0wf1wli	67	8	separate	separate	JJ
cord-279903-z0wf1wli	67	9	and	and	CC
cord-279903-z0wf1wli	67	10	duplex	duplex	JJ
cord-279903-z0wf1wli	67	11	reactions	reaction	NNS
cord-279903-z0wf1wli	67	12	.	.	.
cord-279903-z0wf1wli	68	1	Clinical	clinical	JJ
cord-279903-z0wf1wli	68	2	fecal	fecal	JJ
cord-279903-z0wf1wli	68	3	and	and	CC
cord-279903-z0wf1wli	68	4	intestinal	intestinal	JJ
cord-279903-z0wf1wli	68	5	samples	sample	NNS
cord-279903-z0wf1wli	68	6	submitted	submit	VBN
cord-279903-z0wf1wli	68	7	to	to	IN
cord-279903-z0wf1wli	68	8	the	the	DT
cord-279903-z0wf1wli	68	9	Animal	Animal	NNP
cord-279903-z0wf1wli	68	10	Disease	Disease	NNP
cord-279903-z0wf1wli	68	11	Diagnostic	Diagnostic	NNP
cord-279903-z0wf1wli	68	12	Laboratory	Laboratory	NNP
cord-279903-z0wf1wli	68	13	in	in	IN
cord-279903-z0wf1wli	68	14	Ohio	Ohio	NNP
cord-279903-z0wf1wli	68	15	Department	Department	NNP
cord-279903-z0wf1wli	68	16	of	of	IN
cord-279903-z0wf1wli	68	17	Agriculture	Agriculture	NNP
cord-279903-z0wf1wli	68	18	were	be	VBD
cord-279903-z0wf1wli	68	19	processed	process	VBN
cord-279903-z0wf1wli	68	20	for	for	IN
cord-279903-z0wf1wli	68	21	RNA	RNA	NNP
cord-279903-z0wf1wli	68	22	extraction	extraction	NN
cord-279903-z0wf1wli	68	23	.	.	.
cord-279903-z0wf1wli	69	1	RNA	RNA	NNP
cord-279903-z0wf1wli	69	2	samples	sample	NNS
cord-279903-z0wf1wli	69	3	were	be	VBD
cord-279903-z0wf1wli	69	4	first	first	RB
cord-279903-z0wf1wli	69	5	tested	test	VBN
cord-279903-z0wf1wli	69	6	for	for	IN
cord-279903-z0wf1wli	69	7	PEDV	PEDV	NNP
cord-279903-z0wf1wli	69	8	by	by	IN
cord-279903-z0wf1wli	69	9	a	a	DT
cord-279903-z0wf1wli	69	10	real	real	JJ
cord-279903-z0wf1wli	69	11	-	-	HYPH
cord-279903-z0wf1wli	69	12	time	time	NN
cord-279903-z0wf1wli	69	13	RT	rt	NN
cord-279903-z0wf1wli	69	14	-	-	HYPH
cord-279903-z0wf1wli	69	15	PCR	PCR	NNP
cord-279903-z0wf1wli	69	16	targeting	target	VBG
cord-279903-z0wf1wli	69	17	the	the	DT
cord-279903-z0wf1wli	69	18	M	M	NNP
cord-279903-z0wf1wli	69	19	gene	gene	NN
cord-279903-z0wf1wli	69	20	.	.	.
cord-279903-z0wf1wli	70	1	If	if	IN
cord-279903-z0wf1wli	70	2	positive	positive	JJ
cord-279903-z0wf1wli	70	3	,	,	,
cord-279903-z0wf1wli	70	4	the	the	DT
cord-279903-z0wf1wli	70	5	duplex	duplex	JJ
cord-279903-z0wf1wli	70	6	real	real	JJ
cord-279903-z0wf1wli	70	7	-	-	HYPH
cord-279903-z0wf1wli	70	8	time	time	NN
cord-279903-z0wf1wli	70	9	RT	RT	NNP
cord-279903-z0wf1wli	70	10	-	-	HYPH
cord-279903-z0wf1wli	70	11	PCR	PCR	NNP
cord-279903-z0wf1wli	70	12	was	be	VBD
cord-279903-z0wf1wli	70	13	then	then	RB
cord-279903-z0wf1wli	70	14	used	use	VBN
cord-279903-z0wf1wli	70	15	to	to	TO
cord-279903-z0wf1wli	70	16	differentiate	differentiate	VB
cord-279903-z0wf1wli	70	17	the	the	DT
cord-279903-z0wf1wli	70	18	variant	variant	NN
cord-279903-z0wf1wli	70	19	and	and	CC
cord-279903-z0wf1wli	70	20	the	the	DT
cord-279903-z0wf1wli	70	21	virulent	virulent	JJ
cord-279903-z0wf1wli	70	22	strains	strain	NNS
cord-279903-z0wf1wli	70	23	of	of	IN
cord-279903-z0wf1wli	70	24	PEDV	PEDV	NNP
cord-279903-z0wf1wli	70	25	.	.	.
cord-279903-z0wf1wli	71	1	Based	base	VBN
cord-279903-z0wf1wli	71	2	on	on	IN
cord-279903-z0wf1wli	71	3	the	the	DT
cord-279903-z0wf1wli	71	4	sequence	sequence	NN
cord-279903-z0wf1wli	71	5	alignment	alignment	NN
cord-279903-z0wf1wli	71	6	and	and	CC
cord-279903-z0wf1wli	71	7	analysis	analysis	NN
cord-279903-z0wf1wli	71	8	of	of	IN
cord-279903-z0wf1wli	71	9	both	both	CC
cord-279903-z0wf1wli	71	10	virulent	virulent	JJ
cord-279903-z0wf1wli	71	11	and	and	CC
cord-279903-z0wf1wli	71	12	variant	variant	JJ
cord-279903-z0wf1wli	71	13	PEDV	PEDV	NNP
cord-279903-z0wf1wli	71	14	partial	partial	JJ
cord-279903-z0wf1wli	71	15	S1	S1	NNP
cord-279903-z0wf1wli	71	16	region	region	NN
cord-279903-z0wf1wli	71	17	,	,	,
cord-279903-z0wf1wli	71	18	in	in	IN
cord-279903-z0wf1wli	71	19	addition	addition	NN
cord-279903-z0wf1wli	71	20	to	to	IN
cord-279903-z0wf1wli	71	21	several	several	JJ
cord-279903-z0wf1wli	71	22	sequence	sequence	NN
cord-279903-z0wf1wli	71	23	variations	variation	NNS
cord-279903-z0wf1wli	71	24	,	,	,
cord-279903-z0wf1wli	71	25	there	there	EX
cord-279903-z0wf1wli	71	26	were	be	VBD
cord-279903-z0wf1wli	71	27	3	3	CD
cord-279903-z0wf1wli	71	28	deletions	deletion	NNS
cord-279903-z0wf1wli	71	29	and	and	CC
cord-279903-z0wf1wli	71	30	one	one	CD
cord-279903-z0wf1wli	71	31	insertion	insertion	NN
cord-279903-z0wf1wli	71	32	present	present	JJ
cord-279903-z0wf1wli	71	33	in	in	IN
cord-279903-z0wf1wli	71	34	the	the	DT
cord-279903-z0wf1wli	71	35	variant	variant	JJ
cord-279903-z0wf1wli	71	36	PEDV	PEDV	NNP
cord-279903-z0wf1wli	71	37	as	as	IN
cord-279903-z0wf1wli	71	38	compared	compare	VBN
cord-279903-z0wf1wli	71	39	with	with	IN
cord-279903-z0wf1wli	71	40	virulent	virulent	JJ
cord-279903-z0wf1wli	71	41	PEDV	PEDV	NNP
cord-279903-z0wf1wli	71	42	(	(	-LRB-
cord-279903-z0wf1wli	71	43	Fig	Fig	NNP
cord-279903-z0wf1wli	71	44	.	.	.
cord-279903-z0wf1wli	71	45	1	1	CD
cord-279903-z0wf1wli	71	46	)	)	-RRB-
cord-279903-z0wf1wli	71	47	.	.	.
cord-279903-z0wf1wli	72	1	The	the	DT
cord-279903-z0wf1wli	72	2	primers	primer	NNS
cord-279903-z0wf1wli	72	3	were	be	VBD
cord-279903-z0wf1wli	72	4	designed	design	VBN
cord-279903-z0wf1wli	72	5	by	by	IN
cord-279903-z0wf1wli	72	6	targeting	target	VBG
cord-279903-z0wf1wli	72	7	the	the	DT
cord-279903-z0wf1wli	72	8	conserved	conserve	VBN
cord-279903-z0wf1wli	72	9	regions	region	NNS
cord-279903-z0wf1wli	72	10	between	between	IN
cord-279903-z0wf1wli	72	11	the	the	DT
cord-279903-z0wf1wli	72	12	two	two	CD
cord-279903-z0wf1wli	72	13	viruses	virus	NNS
cord-279903-z0wf1wli	72	14	whereas	whereas	IN
cord-279903-z0wf1wli	72	15	the	the	DT
cord-279903-z0wf1wli	72	16	probes	probe	NNS
cord-279903-z0wf1wli	72	17	targeting	target	VBG
cord-279903-z0wf1wli	72	18	the	the	DT
cord-279903-z0wf1wli	72	19	region	region	NN
cord-279903-z0wf1wli	72	20	where	where	WRB
cord-279903-z0wf1wli	72	21	the	the	DT
cord-279903-z0wf1wli	72	22	first	first	JJ
cord-279903-z0wf1wli	72	23	two	two	CD
cord-279903-z0wf1wli	72	24	-	-	HYPH
cord-279903-z0wf1wli	72	25	deletion	deletion	NN
cord-279903-z0wf1wli	72	26	regions	region	NNS
cord-279903-z0wf1wli	72	27	were	be	VBD
cord-279903-z0wf1wli	72	28	located	locate	VBN
cord-279903-z0wf1wli	72	29	in	in	IN
cord-279903-z0wf1wli	72	30	the	the	DT
cord-279903-z0wf1wli	72	31	variant	variant	JJ
cord-279903-z0wf1wli	72	32	strain	strain	NN
cord-279903-z0wf1wli	72	33	of	of	IN
cord-279903-z0wf1wli	72	34	PEDV	PEDV	NNP
cord-279903-z0wf1wli	72	35	.	.	.
cord-279903-z0wf1wli	73	1	The	the	DT
cord-279903-z0wf1wli	73	2	duplex	duplex	NN
cord-279903-z0wf1wli	73	3	RT	RT	NNP
cord-279903-z0wf1wli	73	4	-	-	HYPH
cord-279903-z0wf1wli	73	5	PCR	PCR	NNP
cord-279903-z0wf1wli	73	6	assay	assay	NN
cord-279903-z0wf1wli	73	7	can	can	MD
cord-279903-z0wf1wli	73	8	detect	detect	VB
cord-279903-z0wf1wli	73	9	specifically	specifically	RB
cord-279903-z0wf1wli	73	10	the	the	DT
cord-279903-z0wf1wli	73	11	virulent	virulent	JJ
cord-279903-z0wf1wli	73	12	strain	strain	NN
cord-279903-z0wf1wli	73	13	of	of	IN
cord-279903-z0wf1wli	73	14	PEDV	PEDV	NNP
cord-279903-z0wf1wli	73	15	by	by	IN
cord-279903-z0wf1wli	73	16	the	the	DT
cord-279903-z0wf1wli	73	17	Cy5	cy5	NN
cord-279903-z0wf1wli	73	18	probe	probe	NN
cord-279903-z0wf1wli	73	19	or	or	CC
cord-279903-z0wf1wli	73	20	the	the	DT
cord-279903-z0wf1wli	73	21	variant	variant	JJ
cord-279903-z0wf1wli	73	22	strain	strain	NN
cord-279903-z0wf1wli	73	23	of	of	IN
cord-279903-z0wf1wli	73	24	PEDV	PEDV	NNP
cord-279903-z0wf1wli	73	25	by	by	IN
cord-279903-z0wf1wli	73	26	the	the	DT
cord-279903-z0wf1wli	73	27	FAM	FAM	NNP
cord-279903-z0wf1wli	73	28	probe	probe	NN
cord-279903-z0wf1wli	73	29	.	.	.
cord-279903-z0wf1wli	74	1	In	in	IN
cord-279903-z0wf1wli	74	2	contract	contract	NN
cord-279903-z0wf1wli	74	3	,	,	,
cord-279903-z0wf1wli	74	4	the	the	DT
cord-279903-z0wf1wli	74	5	duplex	duplex	JJ
cord-279903-z0wf1wli	74	6	RT	RT	NNP
cord-279903-z0wf1wli	74	7	-	-	HYPH
cord-279903-z0wf1wli	74	8	PCR	PCR	NNP
cord-279903-z0wf1wli	74	9	did	do	VBD
cord-279903-z0wf1wli	74	10	not	not	RB
cord-279903-z0wf1wli	74	11	cross	cross	VB
cord-279903-z0wf1wli	74	12	-	-	JJ
cord-279903-z0wf1wli	74	13	react	react	VB
cord-279903-z0wf1wli	74	14	with	with	IN
cord-279903-z0wf1wli	74	15	any	any	DT
cord-279903-z0wf1wli	74	16	other	other	JJ
cord-279903-z0wf1wli	74	17	pig	pig	NN
cord-279903-z0wf1wli	74	18	viruses	virus	NNS
cord-279903-z0wf1wli	74	19	used	use	VBN
cord-279903-z0wf1wli	74	20	in	in	IN
cord-279903-z0wf1wli	74	21	the	the	DT
cord-279903-z0wf1wli	74	22	study	study	NN
cord-279903-z0wf1wli	74	23	,	,	,
cord-279903-z0wf1wli	74	24	the	the	DT
cord-279903-z0wf1wli	74	25	Cy5	cy5	NN
cord-279903-z0wf1wli	74	26	probe	probe	NN
cord-279903-z0wf1wli	74	27	did	do	VBD
cord-279903-z0wf1wli	74	28	not	not	RB
cord-279903-z0wf1wli	74	29	cross	cross	VB
cord-279903-z0wf1wli	74	30	-	-	JJ
cord-279903-z0wf1wli	74	31	react	react	VB
cord-279903-z0wf1wli	74	32	with	with	IN
cord-279903-z0wf1wli	74	33	variant	variant	JJ
cord-279903-z0wf1wli	74	34	PEDV	PEDV	NNP
cord-279903-z0wf1wli	74	35	strain	strain	NN
cord-279903-z0wf1wli	74	36	,	,	,
cord-279903-z0wf1wli	74	37	and	and	CC
cord-279903-z0wf1wli	74	38	the	the	DT
cord-279903-z0wf1wli	74	39	FAM	FAM	NNP
cord-279903-z0wf1wli	74	40	probe	probe	NN
cord-279903-z0wf1wli	74	41	did	do	VBD
cord-279903-z0wf1wli	74	42	not	not	RB
cord-279903-z0wf1wli	74	43	cross	cross	VB
cord-279903-z0wf1wli	74	44	-	-	JJ
cord-279903-z0wf1wli	74	45	react	react	VB
cord-279903-z0wf1wli	74	46	with	with	IN
cord-279903-z0wf1wli	74	47	virulent	virulent	JJ
cord-279903-z0wf1wli	74	48	PEDV	PEDV	NNP
cord-279903-z0wf1wli	74	49	strain	strain	NN
cord-279903-z0wf1wli	74	50	(	(	-LRB-
cord-279903-z0wf1wli	74	51	Table	table	NN
cord-279903-z0wf1wli	74	52	2	2	CD
cord-279903-z0wf1wli	74	53	)	)	-RRB-
cord-279903-z0wf1wli	74	54	.	.	.
cord-279903-z0wf1wli	75	1	Table	table	NN
cord-279903-z0wf1wli	75	2	1	1	CD
cord-279903-z0wf1wli	75	3	Sequences	Sequences	NNPS
cord-279903-z0wf1wli	75	4	of	of	IN
cord-279903-z0wf1wli	75	5	primers	primer	NNS
cord-279903-z0wf1wli	75	6	and	and	CC
cord-279903-z0wf1wli	75	7	probes	probe	NNS
cord-279903-z0wf1wli	75	8	used	use	VBN
cord-279903-z0wf1wli	75	9	in	in	IN
cord-279903-z0wf1wli	75	10	this	this	DT
cord-279903-z0wf1wli	75	11	study	study	NN
cord-279903-z0wf1wli	75	12	.	.	.
cord-279903-z0wf1wli	76	1	Primer	primer	NN
cord-279903-z0wf1wli	76	2	/	/	SYM
cord-279903-z0wf1wli	76	3	probe	probe	NN
cord-279903-z0wf1wli	76	4	sequence	sequence	NN
cord-279903-z0wf1wli	76	5	Amplicon	amplicon	NN
cord-279903-z0wf1wli	76	6	size	size	NN
cord-279903-z0wf1wli	76	7	(	(	-LRB-
cord-279903-z0wf1wli	76	8	bp	bp	NNP
cord-279903-z0wf1wli	76	9	)	)	-RRB-
cord-279903-z0wf1wli	76	10	PEDV	PEDV	NNP
cord-279903-z0wf1wli	76	11	S1	S1	NNP
cord-279903-z0wf1wli	76	12	forward	forward	RB
cord-279903-z0wf1wli	77	1	5	5	LS
cord-279903-z0wf1wli	77	2	-AGGCGGTTCTTTTCAAAATTTAATG-3	-aggcggttcttttcaaaatttaatg-3	CD
cord-279903-z0wf1wli	77	3	PEDV	PEDV	NNP
cord-279903-z0wf1wli	77	4	S1	S1	NNP
cord-279903-z0wf1wli	77	5	reverse	reverse	NN
cord-279903-z0wf1wli	77	6	5	5	CD
cord-279903-z0wf1wli	77	7	-GAAATGCCAATCTCAAAGCC-3	-GAAATGCCAATCTCAAAGCC-3	NNP
cord-279903-z0wf1wli	77	8	191	191	CD
cord-279903-z0wf1wli	77	9	for	for	IN
cord-279903-z0wf1wli	77	10	virulent	virulent	JJ
cord-279903-z0wf1wli	77	11	PEDV	PEDV	NNP
cord-279903-z0wf1wli	78	1	Virulent	virulent	JJ
cord-279903-z0wf1wli	78	2	PEDV	PEDV	NNP
cord-279903-z0wf1wli	78	3	S1	S1	NNP
cord-279903-z0wf1wli	78	4	probe	probe	NN
cord-279903-z0wf1wli	78	5	5	5	CD
cord-279903-z0wf1wli	78	6	-/5Cy5	-/5cy5	NN
cord-279903-z0wf1wli	78	7	/	/	SYM
cord-279903-z0wf1wli	78	8	TATTGGTGAAAACCAGGGTGTCAAT/3BHQ	TATTGGTGAAAACCAGGGTGTCAAT/3BHQ	VBZ
cord-279903-z0wf1wli	78	9	2/-3	2/-3	CD
cord-279903-z0wf1wli	78	10	179	179	CD
cord-279903-z0wf1wli	78	11	for	for	IN
cord-279903-z0wf1wli	78	12	variant	variant	JJ
cord-279903-z0wf1wli	78	13	PEDV	PEDV	NNP
cord-279903-z0wf1wli	78	14	Variant	Variant	NNP
cord-279903-z0wf1wli	78	15	PEDV	PEDV	NNP
cord-279903-z0wf1wli	78	16	S1	S1	NNP
cord-279903-z0wf1wli	78	17	probe	probe	NN
cord-279903-z0wf1wli	78	18	5	5	CD
cord-279903-z0wf1wli	78	19	-	-	HYPH
cord-279903-z0wf1wli	78	20	 	 	_SP
cord-279903-z0wf1wli	79	1	The	the	DT
cord-279903-z0wf1wli	79	2	sensitivity	sensitivity	NN
cord-279903-z0wf1wli	79	3	of	of	IN
cord-279903-z0wf1wli	79	4	the	the	DT
cord-279903-z0wf1wli	79	5	duplex	duplex	JJ
cord-279903-z0wf1wli	79	6	real	real	JJ
cord-279903-z0wf1wli	79	7	-	-	HYPH
cord-279903-z0wf1wli	79	8	time	time	NN
cord-279903-z0wf1wli	79	9	RT	RT	NNP
cord-279903-z0wf1wli	79	10	-	-	HYPH
cord-279903-z0wf1wli	79	11	PCR	PCR	NNP
cord-279903-z0wf1wli	79	12	assay	assay	NN
cord-279903-z0wf1wli	79	13	was	be	VBD
cord-279903-z0wf1wli	79	14	validated	validate	VBN
cord-279903-z0wf1wli	79	15	through	through	IN
cord-279903-z0wf1wli	79	16	serial	serial	JJ
cord-279903-z0wf1wli	79	17	dilutions	dilution	NNS
cord-279903-z0wf1wli	79	18	of	of	IN
cord-279903-z0wf1wli	79	19	pCR	pCR	NNP
cord-279903-z0wf1wli	79	20	2.1-OH851	2.1-oh851	CD
cord-279903-z0wf1wli	79	21	and	and	CC
cord-279903-z0wf1wli	79	22	pCR	pCR	NNP
cord-279903-z0wf1wli	79	23	2.1-OH1715	2.1-oh1715	CD
cord-279903-z0wf1wli	79	24	constructs	construct	NNS
cord-279903-z0wf1wli	79	25	.	.	.
cord-279903-z0wf1wli	80	1	The	the	DT
cord-279903-z0wf1wli	80	2	detection	detection	NN
cord-279903-z0wf1wli	80	3	limit	limit	NN
cord-279903-z0wf1wli	80	4	was	be	VBD
cord-279903-z0wf1wli	80	5	1	1	CD
cord-279903-z0wf1wli	80	6	copy	copy	NN
cord-279903-z0wf1wli	80	7	for	for	IN
cord-279903-z0wf1wli	80	8	both	both	DT
cord-279903-z0wf1wli	80	9	variant	variant	JJ
cord-279903-z0wf1wli	80	10	and	and	CC
cord-279903-z0wf1wli	80	11	virulent	virulent	JJ
cord-279903-z0wf1wli	80	12	strains	strain	NNS
cord-279903-z0wf1wli	80	13	of	of	IN
cord-279903-z0wf1wli	80	14	PEDVs	pedv	NNS
cord-279903-z0wf1wli	80	15	.	.	.
cord-279903-z0wf1wli	81	1	Standard	standard	JJ
cord-279903-z0wf1wli	81	2	curves	curve	NNS
cord-279903-z0wf1wli	81	3	were	be	VBD
cord-279903-z0wf1wli	81	4	plotted	plot	VBN
cord-279903-z0wf1wli	81	5	using	use	VBG
cord-279903-z0wf1wli	81	6	10-fold	10-fold	JJ
cord-279903-z0wf1wli	81	7	serial	serial	JJ
cord-279903-z0wf1wli	81	8	dilutions	dilution	NNS
cord-279903-z0wf1wli	81	9	of	of	IN
cord-279903-z0wf1wli	81	10	plasmid	plasmid	NN
cord-279903-z0wf1wli	81	11	DNA	dna	NN
cord-279903-z0wf1wli	81	12	of	of	IN
cord-279903-z0wf1wli	81	13	virulent	virulent	JJ
cord-279903-z0wf1wli	81	14	and	and	CC
cord-279903-z0wf1wli	81	15	variant	variant	JJ
cord-279903-z0wf1wli	81	16	PEDV	PEDV	NNP
cord-279903-z0wf1wli	81	17	for	for	IN
cord-279903-z0wf1wli	81	18	the	the	DT
cord-279903-z0wf1wli	81	19	duplex	duplex	JJ
cord-279903-z0wf1wli	81	20	real	real	JJ
cord-279903-z0wf1wli	81	21	-	-	HYPH
cord-279903-z0wf1wli	81	22	time	time	NN
cord-279903-z0wf1wli	81	23	RT	RT	NNP
cord-279903-z0wf1wli	81	24	-	-	HYPH
cord-279903-z0wf1wli	81	25	PCR	PCR	NNP
cord-279903-z0wf1wli	81	26	.	.	.
cord-279903-z0wf1wli	82	1	As	as	IN
cord-279903-z0wf1wli	82	2	shown	show	VBN
cord-279903-z0wf1wli	82	3	in	in	IN
cord-279903-z0wf1wli	82	4	Fig	Fig	NNP
cord-279903-z0wf1wli	82	5	.	.	.
cord-279903-z0wf1wli	83	1	2	2	LS
cord-279903-z0wf1wli	83	2	,	,	,
cord-279903-z0wf1wli	83	3	there	there	EX
cord-279903-z0wf1wli	83	4	is	be	VBZ
cord-279903-z0wf1wli	83	5	a	a	DT
cord-279903-z0wf1wli	83	6	strong	strong	JJ
cord-279903-z0wf1wli	83	7	linear	linear	JJ
cord-279903-z0wf1wli	83	8	correlation	correlation	NN
cord-279903-z0wf1wli	83	9	(	(	-LRB-
cord-279903-z0wf1wli	83	10	r	r	NN
cord-279903-z0wf1wli	83	11	2	2	CD
cord-279903-z0wf1wli	83	12	>	>	XX
cord-279903-z0wf1wli	83	13	0.99	0.99	CD
cord-279903-z0wf1wli	83	14	)	)	-RRB-
cord-279903-z0wf1wli	83	15	between	between	IN
cord-279903-z0wf1wli	83	16	C	c	NN
cord-279903-z0wf1wli	83	17	t	t	NN
cord-279903-z0wf1wli	83	18	values	value	NNS
cord-279903-z0wf1wli	83	19	and	and	CC
cord-279903-z0wf1wli	83	20	the	the	DT
cord-279903-z0wf1wli	83	21	corresponding	corresponding	JJ
cord-279903-z0wf1wli	83	22	amount	amount	NN
cord-279903-z0wf1wli	83	23	of	of	IN
cord-279903-z0wf1wli	83	24	plasmid	plasmid	NN
cord-279903-z0wf1wli	83	25	copy	copy	NN
cord-279903-z0wf1wli	83	26	numbers	number	NNS
cord-279903-z0wf1wli	83	27	for	for	IN
cord-279903-z0wf1wli	83	28	both	both	CC
cord-279903-z0wf1wli	83	29	virulent	virulent	JJ
cord-279903-z0wf1wli	83	30	and	and	CC
cord-279903-z0wf1wli	83	31	variant	variant	JJ
cord-279903-z0wf1wli	83	32	PEDV	PEDV	NNP
cord-279903-z0wf1wli	83	33	.	.	.
cord-279903-z0wf1wli	84	1	The	the	DT
cord-279903-z0wf1wli	84	2	standard	standard	JJ
cord-279903-z0wf1wli	84	3	curves	curve	NNS
cord-279903-z0wf1wli	84	4	of	of	IN
cord-279903-z0wf1wli	84	5	virulent	virulent	JJ
cord-279903-z0wf1wli	84	6	and	and	CC
cord-279903-z0wf1wli	84	7	variant	variant	JJ
cord-279903-z0wf1wli	84	8	PEDV	PEDV	NNP
cord-279903-z0wf1wli	84	9	were	be	VBD
cord-279903-z0wf1wli	84	10	plotted	plot	VBN
cord-279903-z0wf1wli	84	11	with	with	IN
cord-279903-z0wf1wli	84	12	slopes	slope	NNS
cord-279903-z0wf1wli	84	13	of	of	IN
cord-279903-z0wf1wli	84	14	−3.40	−3.40	NNP
cord-279903-z0wf1wli	84	15	and	and	CC
cord-279903-z0wf1wli	84	16	−3.31	−3.31	NNP
cord-279903-z0wf1wli	84	17	,	,	,
cord-279903-z0wf1wli	84	18	respectively	respectively	RB
cord-279903-z0wf1wli	84	19	(	(	-LRB-
cord-279903-z0wf1wli	84	20	Fig	Fig	NNP
cord-279903-z0wf1wli	84	21	.	.	.
cord-279903-z0wf1wli	84	22	2A	2a	NN
cord-279903-z0wf1wli	84	23	and	and	CC
cord-279903-z0wf1wli	84	24	B	B	NNP
cord-279903-z0wf1wli	84	25	)	)	-RRB-
cord-279903-z0wf1wli	84	26	.	.	.
cord-279903-z0wf1wli	85	1	The	the	DT
cord-279903-z0wf1wli	85	2	duplex	duplex	JJ
cord-279903-z0wf1wli	85	3	real	real	JJ
cord-279903-z0wf1wli	85	4	-	-	HYPH
cord-279903-z0wf1wli	85	5	time	time	NN
cord-279903-z0wf1wli	85	6	RT	RT	NNP
cord-279903-z0wf1wli	85	7	-	-	HYPH
cord-279903-z0wf1wli	85	8	PCR	PCR	NNP
cord-279903-z0wf1wli	85	9	detected	detect	VBD
cord-279903-z0wf1wli	85	10	1	1	CD
cord-279903-z0wf1wli	85	11	genomic	genomic	JJ
cord-279903-z0wf1wli	85	12	copy	copy	NN
cord-279903-z0wf1wli	85	13	for	for	IN
cord-279903-z0wf1wli	85	14	both	both	CC
cord-279903-z0wf1wli	85	15	virulent	virulent	JJ
cord-279903-z0wf1wli	85	16	and	and	CC
cord-279903-z0wf1wli	85	17	variant	variant	JJ
cord-279903-z0wf1wli	85	18	strain	strain	NN
cord-279903-z0wf1wli	85	19	of	of	IN
cord-279903-z0wf1wli	85	20	PEDVs	pedv	NNS
cord-279903-z0wf1wli	85	21	.	.	.
cord-279903-z0wf1wli	86	1	A	a	DT
cord-279903-z0wf1wli	86	2	total	total	NN
cord-279903-z0wf1wli	86	3	of	of	IN
cord-279903-z0wf1wli	86	4	295	295	CD
cord-279903-z0wf1wli	86	5	positive	positive	JJ
cord-279903-z0wf1wli	86	6	samples	sample	NNS
cord-279903-z0wf1wli	86	7	tested	test	VBN
cord-279903-z0wf1wli	86	8	by	by	IN
cord-279903-z0wf1wli	86	9	the	the	DT
cord-279903-z0wf1wli	86	10	real	real	JJ
cord-279903-z0wf1wli	86	11	-	-	HYPH
cord-279903-z0wf1wli	86	12	time	time	NN
cord-279903-z0wf1wli	86	13	RT	rt	NN
cord-279903-z0wf1wli	86	14	-	-	HYPH
cord-279903-z0wf1wli	86	15	PCR	PCR	NNP
cord-279903-z0wf1wli	86	16	targeting	target	VBG
cord-279903-z0wf1wli	86	17	on	on	IN
cord-279903-z0wf1wli	86	18	M	M	NNP
cord-279903-z0wf1wli	86	19	gene	gene	NN
cord-279903-z0wf1wli	86	20	were	be	VBD
cord-279903-z0wf1wli	86	21	run	run	VBN
cord-279903-z0wf1wli	86	22	again	again	RB
cord-279903-z0wf1wli	86	23	by	by	IN
cord-279903-z0wf1wli	86	24	the	the	DT
cord-279903-z0wf1wli	86	25	duplex	duplex	JJ
cord-279903-z0wf1wli	86	26	real	real	JJ
cord-279903-z0wf1wli	86	27	-	-	HYPH
cord-279903-z0wf1wli	86	28	time	time	NN
cord-279903-z0wf1wli	86	29	RT	RT	NNP
cord-279903-z0wf1wli	86	30	-	-	HYPH
cord-279903-z0wf1wli	86	31	PCR	PCR	NNP
cord-279903-z0wf1wli	86	32	.	.	.
cord-279903-z0wf1wli	87	1	Forty	forty	CD
cord-279903-z0wf1wli	87	2	five	five	CD
cord-279903-z0wf1wli	87	3	samples	sample	NNS
cord-279903-z0wf1wli	87	4	tested	test	VBD
cord-279903-z0wf1wli	87	5	positive	positive	JJ
cord-279903-z0wf1wli	87	6	for	for	IN
cord-279903-z0wf1wli	87	7	the	the	DT
cord-279903-z0wf1wli	87	8	variant	variant	JJ
cord-279903-z0wf1wli	87	9	PEDV	PEDV	NNP
cord-279903-z0wf1wli	87	10	and	and	CC
cord-279903-z0wf1wli	87	11	the	the	DT
cord-279903-z0wf1wli	87	12	remaining	remain	VBG
cord-279903-z0wf1wli	87	13	250	250	CD
cord-279903-z0wf1wli	87	14	samples	sample	NNS
cord-279903-z0wf1wli	87	15	were	be	VBD
cord-279903-z0wf1wli	87	16	positive	positive	JJ
cord-279903-z0wf1wli	87	17	for	for	IN
cord-279903-z0wf1wli	87	18	the	the	DT
cord-279903-z0wf1wli	87	19	virulent	virulent	JJ
cord-279903-z0wf1wli	87	20	PEDV	PEDV	NNP
cord-279903-z0wf1wli	87	21	.	.	.
cord-279903-z0wf1wli	88	1	The	the	DT
cord-279903-z0wf1wli	88	2	results	result	NNS
cord-279903-z0wf1wli	88	3	were	be	VBD
cord-279903-z0wf1wli	88	4	confirmed	confirm	VBN
cord-279903-z0wf1wli	88	5	by	by	IN
cord-279903-z0wf1wli	88	6	sequencing	sequence	VBG
cord-279903-z0wf1wli	88	7	using	use	VBG
cord-279903-z0wf1wli	88	8	P160-P161	P160-P161	NNP
cord-279903-z0wf1wli	88	9	primer	primer	NN
cord-279903-z0wf1wli	88	10	set	set	NN
cord-279903-z0wf1wli	88	11	.	.	.
cord-279903-z0wf1wli	89	1	PEDV	PEDV	NNP
cord-279903-z0wf1wli	89	2	causes	cause	VBZ
cord-279903-z0wf1wli	89	3	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	89	4	in	in	IN
cord-279903-z0wf1wli	89	5	pigs	pig	NNS
cord-279903-z0wf1wli	89	6	and	and	CC
cord-279903-z0wf1wli	89	7	high	high	JJ
cord-279903-z0wf1wli	89	8	mortality	mortality	NN
cord-279903-z0wf1wli	89	9	in	in	IN
cord-279903-z0wf1wli	89	10	piglets	piglet	NNS
cord-279903-z0wf1wli	89	11	.	.	.
cord-279903-z0wf1wli	90	1	Since	since	IN
cord-279903-z0wf1wli	90	2	May	May	NNP
cord-279903-z0wf1wli	90	3	of	of	IN
cord-279903-z0wf1wli	90	4	2013	2013	CD
cord-279903-z0wf1wli	90	5	,	,	,
cord-279903-z0wf1wli	90	6	PEDV	PEDV	NNP
cord-279903-z0wf1wli	90	7	has	have	VBZ
cord-279903-z0wf1wli	90	8	been	be	VBN
cord-279903-z0wf1wli	90	9	identified	identify	VBN
cord-279903-z0wf1wli	90	10	in	in	IN
cord-279903-z0wf1wli	90	11	the	the	DT
cord-279903-z0wf1wli	90	12	US	US	NNP
cord-279903-z0wf1wli	90	13	resulting	result	VBG
cord-279903-z0wf1wli	90	14	in	in	IN
cord-279903-z0wf1wli	90	15	severe	severe	JJ
cord-279903-z0wf1wli	90	16	economic	economic	JJ
cord-279903-z0wf1wli	90	17	losses	loss	NNS
cord-279903-z0wf1wli	90	18	to	to	IN
cord-279903-z0wf1wli	90	19	the	the	DT
cord-279903-z0wf1wli	90	20	US	US	NNP
cord-279903-z0wf1wli	90	21	swine	swine	NN
cord-279903-z0wf1wli	90	22	industry	industry	NN
cord-279903-z0wf1wli	90	23	.	.	.
cord-279903-z0wf1wli	91	1	Data	datum	NNS
cord-279903-z0wf1wli	91	2	on	on	IN
cord-279903-z0wf1wli	91	3	PED	ped	NN
cord-279903-z0wf1wli	91	4	outbreaks	outbreak	NNS
cord-279903-z0wf1wli	91	5	have	have	VBP
cord-279903-z0wf1wli	91	6	been	be	VBN
cord-279903-z0wf1wli	91	7	collected	collect	VBN
cord-279903-z0wf1wli	91	8	and	and	CC
cord-279903-z0wf1wli	91	9	complied	comply	VBN
cord-279903-z0wf1wli	91	10	by	by	IN
cord-279903-z0wf1wli	91	11	the	the	DT
cord-279903-z0wf1wli	91	12	US	US	NNP
cord-279903-z0wf1wli	91	13	National	National	NNP
cord-279903-z0wf1wli	91	14	Animal	Animal	NNP
cord-279903-z0wf1wli	91	15	Health	Health	NNP
cord-279903-z0wf1wli	91	16	Laboratory	Laboratory	NNP
cord-279903-z0wf1wli	91	17	Network	Network	NNP
cord-279903-z0wf1wli	91	18	each	each	DT
cord-279903-z0wf1wli	91	19	week	week	NN
cord-279903-z0wf1wli	91	20	since	since	IN
cord-279903-z0wf1wli	91	21	June	June	NNP
cord-279903-z0wf1wli	91	22	17	17	CD
cord-279903-z0wf1wli	91	23	of	of	IN
cord-279903-z0wf1wli	91	24	2013	2013	CD
cord-279903-z0wf1wli	91	25	.	.	.
cord-279903-z0wf1wli	92	1	Since	since	IN
cord-279903-z0wf1wli	92	2	there	there	EX
cord-279903-z0wf1wli	92	3	is	be	VBZ
cord-279903-z0wf1wli	92	4	no	no	DT
cord-279903-z0wf1wli	92	5	PEDV	PEDV	NNP
cord-279903-z0wf1wli	92	6	vaccine	vaccine	NN
cord-279903-z0wf1wli	92	7	available	available	JJ
cord-279903-z0wf1wli	92	8	in	in	IN
cord-279903-z0wf1wli	92	9	North	North	NNP
cord-279903-z0wf1wli	92	10	America	America	NNP
cord-279903-z0wf1wli	92	11	,	,	,
cord-279903-z0wf1wli	92	12	it	-PRON-	PRP
cord-279903-z0wf1wli	92	13	is	be	VBZ
cord-279903-z0wf1wli	92	14	important	important	JJ
cord-279903-z0wf1wli	92	15	to	to	TO
cord-279903-z0wf1wli	92	16	take	take	VB
cord-279903-z0wf1wli	92	17	biosecurity	biosecurity	NN
cord-279903-z0wf1wli	92	18	strategies	strategy	NNS
cord-279903-z0wf1wli	92	19	to	to	TO
cord-279903-z0wf1wli	92	20	control	control	VB
cord-279903-z0wf1wli	92	21	PED	ped	NN
cord-279903-z0wf1wli	92	22	.	.	.
cord-279903-z0wf1wli	93	1	The	the	DT
cord-279903-z0wf1wli	93	2	findings	finding	NNS
cord-279903-z0wf1wli	93	3	of	of	IN
cord-279903-z0wf1wli	93	4	a	a	DT
cord-279903-z0wf1wli	93	5	recent	recent	JJ
cord-279903-z0wf1wli	93	6	study	study	NN
cord-279903-z0wf1wli	93	7	demonstrated	demonstrate	VBD
cord-279903-z0wf1wli	93	8	that	that	IN
cord-279903-z0wf1wli	93	9	PEDV	PEDV	NNP
cord-279903-z0wf1wli	93	10	was	be	VBD
cord-279903-z0wf1wli	93	11	found	find	VBN
cord-279903-z0wf1wli	93	12	in	in	IN
cord-279903-z0wf1wli	93	13	5.2	5.2	CD
cord-279903-z0wf1wli	93	14	%	%	NN
cord-279903-z0wf1wli	93	15	of	of	IN
cord-279903-z0wf1wli	93	16	trailers	trailer	NNS
cord-279903-z0wf1wli	93	17	used	use	VBN
cord-279903-z0wf1wli	93	18	to	to	TO
cord-279903-z0wf1wli	93	19	transport	transport	VB
cord-279903-z0wf1wli	93	20	pigs	pig	NNS
cord-279903-z0wf1wli	93	21	,	,	,
cord-279903-z0wf1wli	93	22	highlighting	highlight	VBG
cord-279903-z0wf1wli	93	23	the	the	DT
cord-279903-z0wf1wli	93	24	importance	importance	NN
cord-279903-z0wf1wli	93	25	of	of	IN
cord-279903-z0wf1wli	93	26	strict	strict	JJ
cord-279903-z0wf1wli	93	27	biosecurity	biosecurity	NN
cord-279903-z0wf1wli	93	28	(	(	-LRB-
cord-279903-z0wf1wli	93	29	Lowe	Lowe	NNP
cord-279903-z0wf1wli	93	30	et	et	NNP
cord-279903-z0wf1wli	93	31	al	al	NNP
cord-279903-z0wf1wli	93	32	.	.	NNP
cord-279903-z0wf1wli	93	33	,	,	,
cord-279903-z0wf1wli	93	34	2014	2014	CD
cord-279903-z0wf1wli	93	35	)	)	-RRB-
cord-279903-z0wf1wli	93	36	.	.	.
cord-279903-z0wf1wli	94	1	In	in	IN
cord-279903-z0wf1wli	94	2	the	the	DT
cord-279903-z0wf1wli	94	3	late	late	JJ
cord-279903-z0wf1wli	94	4	December	December	NNP
cord-279903-z0wf1wli	94	5	2013	2013	CD
cord-279903-z0wf1wli	94	6	,	,	,
cord-279903-z0wf1wli	94	7	a	a	DT
cord-279903-z0wf1wli	94	8	variant	variant	JJ
cord-279903-z0wf1wli	94	9	strain	strain	NN
cord-279903-z0wf1wli	94	10	of	of	IN
cord-279903-z0wf1wli	94	11	PEDV	PEDV	NNP
cord-279903-z0wf1wli	94	12	was	be	VBD
cord-279903-z0wf1wli	94	13	detected	detect	VBN
cord-279903-z0wf1wli	94	14	in	in	IN
cord-279903-z0wf1wli	94	15	Ohio	Ohio	NNP
cord-279903-z0wf1wli	94	16	by	by	IN
cord-279903-z0wf1wli	94	17	our	-PRON-	PRP$
cord-279903-z0wf1wli	94	18	laboratory	laboratory	NN
cord-279903-z0wf1wli	94	19	.	.	.
cord-279903-z0wf1wli	95	1	Genetic	genetic	JJ
cord-279903-z0wf1wli	95	2	analysis	analysis	NN
cord-279903-z0wf1wli	95	3	showed	show	VBD
cord-279903-z0wf1wli	95	4	that	that	IN
cord-279903-z0wf1wli	95	5	this	this	DT
cord-279903-z0wf1wli	95	6	virus	virus	NN
cord-279903-z0wf1wli	95	7	differed	differ	VBD
cord-279903-z0wf1wli	95	8	from	from	IN
cord-279903-z0wf1wli	95	9	the	the	DT
cord-279903-z0wf1wli	95	10	virulent	virulent	JJ
cord-279903-z0wf1wli	95	11	strains	strain	NNS
cord-279903-z0wf1wli	95	12	of	of	IN
cord-279903-z0wf1wli	95	13	PEDV	PEDV	NNP
cord-279903-z0wf1wli	95	14	currently	currently	RB
cord-279903-z0wf1wli	95	15	circulating	circulate	VBG
cord-279903-z0wf1wli	95	16	in	in	IN
cord-279903-z0wf1wli	95	17	the	the	DT
cord-279903-z0wf1wli	95	18	US	US	NNP
cord-279903-z0wf1wli	95	19	in	in	IN
cord-279903-z0wf1wli	95	20	the	the	DT
cord-279903-z0wf1wli	95	21	5	5	CD
cord-279903-z0wf1wli	95	22	end	end	NN
cord-279903-z0wf1wli	95	23	of	of	IN
cord-279903-z0wf1wli	95	24	the	the	DT
cord-279903-z0wf1wli	95	25	S1	s1	NN
cord-279903-z0wf1wli	95	26	domain	domain	NN
cord-279903-z0wf1wli	95	27	(	(	-LRB-
cord-279903-z0wf1wli	95	28	mainly	mainly	RB
cord-279903-z0wf1wli	95	29	located	locate	VBN
cord-279903-z0wf1wli	95	30	in	in	IN
cord-279903-z0wf1wli	95	31	the	the	DT
cord-279903-z0wf1wli	95	32	first	first	JJ
cord-279903-z0wf1wli	95	33	1170	1170	CD
cord-279903-z0wf1wli	95	34	nt	nt	RB
cord-279903-z0wf1wli	95	35	of	of	IN
cord-279903-z0wf1wli	95	36	spike	spike	NN
cord-279903-z0wf1wli	95	37	gene	gene	NN
cord-279903-z0wf1wli	95	38	)	)	-RRB-
cord-279903-z0wf1wli	95	39	,	,	,
cord-279903-z0wf1wli	95	40	thus	thus	RB
cord-279903-z0wf1wli	95	41	the	the	DT
cord-279903-z0wf1wli	95	42	real	real	JJ
cord-279903-z0wf1wli	95	43	-	-	HYPH
cord-279903-z0wf1wli	95	44	time	time	NN
cord-279903-z0wf1wli	95	45	RT	rt	NN
cord-279903-z0wf1wli	95	46	-	-	HYPH
cord-279903-z0wf1wli	95	47	PCR	PCR	NNP
cord-279903-z0wf1wli	95	48	targeting	target	VBG
cord-279903-z0wf1wli	95	49	on	on	IN
cord-279903-z0wf1wli	95	50	the	the	DT
cord-279903-z0wf1wli	95	51	M	M	NNP
cord-279903-z0wf1wli	95	52	gene	gene	NN
cord-279903-z0wf1wli	95	53	does	do	VBZ
cord-279903-z0wf1wli	95	54	not	not	RB
cord-279903-z0wf1wli	95	55	provide	provide	VB
cord-279903-z0wf1wli	95	56	differentiation	differentiation	NN
cord-279903-z0wf1wli	95	57	of	of	IN
cord-279903-z0wf1wli	95	58	the	the	DT
cord-279903-z0wf1wli	95	59	variant	variant	JJ
cord-279903-z0wf1wli	95	60	PEDV	PEDV	NNP
cord-279903-z0wf1wli	95	61	from	from	IN
cord-279903-z0wf1wli	95	62	virulent	virulent	JJ
cord-279903-z0wf1wli	95	63	strain	strain	NN
cord-279903-z0wf1wli	95	64	of	of	IN
cord-279903-z0wf1wli	95	65	PEDV	PEDV	NNP
cord-279903-z0wf1wli	95	66	.	.	.
cord-279903-z0wf1wli	96	1	Therefore	therefore	RB
cord-279903-z0wf1wli	96	2	,	,	,
cord-279903-z0wf1wli	96	3	the	the	DT
cord-279903-z0wf1wli	96	4	aim	aim	NN
cord-279903-z0wf1wli	96	5	of	of	IN
cord-279903-z0wf1wli	96	6	this	this	DT
cord-279903-z0wf1wli	96	7	study	study	NN
cord-279903-z0wf1wli	96	8	was	be	VBD
cord-279903-z0wf1wli	96	9	to	to	TO
cord-279903-z0wf1wli	96	10	develop	develop	VB
cord-279903-z0wf1wli	96	11	a	a	DT
cord-279903-z0wf1wli	96	12	duplex	duplex	JJ
cord-279903-z0wf1wli	96	13	real	real	JJ
cord-279903-z0wf1wli	96	14	-	-	HYPH
cord-279903-z0wf1wli	96	15	time	time	NN
cord-279903-z0wf1wli	96	16	RT	RT	NNP
cord-279903-z0wf1wli	96	17	-	-	HYPH
cord-279903-z0wf1wli	96	18	PCR	PCR	NNP
cord-279903-z0wf1wli	96	19	which	which	WDT
cord-279903-z0wf1wli	96	20	would	would	MD
cord-279903-z0wf1wli	96	21	detect	detect	VB
cord-279903-z0wf1wli	96	22	and	and	CC
cord-279903-z0wf1wli	96	23	differentiate	differentiate	VB
cord-279903-z0wf1wli	96	24	the	the	DT
cord-279903-z0wf1wli	96	25	virulent	virulent	JJ
cord-279903-z0wf1wli	96	26	strain	strain	NN
cord-279903-z0wf1wli	96	27	from	from	IN
cord-279903-z0wf1wli	96	28	the	the	DT
cord-279903-z0wf1wli	96	29	variant	variant	JJ
cord-279903-z0wf1wli	96	30	strain	strain	NN
cord-279903-z0wf1wli	96	31	of	of	IN
cord-279903-z0wf1wli	96	32	PEDV	PEDV	NNP
cord-279903-z0wf1wli	96	33	.	.	.
cord-279903-z0wf1wli	97	1	To	to	TO
cord-279903-z0wf1wli	97	2	optimize	optimize	VB
cord-279903-z0wf1wli	97	3	the	the	DT
cord-279903-z0wf1wli	97	4	ability	ability	NN
cord-279903-z0wf1wli	97	5	of	of	IN
cord-279903-z0wf1wli	97	6	the	the	DT
cord-279903-z0wf1wli	97	7	assay	assay	NN
cord-279903-z0wf1wli	97	8	to	to	TO
cord-279903-z0wf1wli	97	9	detect	detect	VB
cord-279903-z0wf1wli	97	10	both	both	DT
cord-279903-z0wf1wli	97	11	variant	variant	JJ
cord-279903-z0wf1wli	97	12	and	and	CC
cord-279903-z0wf1wli	97	13	virulent	virulent	JJ
cord-279903-z0wf1wli	97	14	strains	strain	NNS
cord-279903-z0wf1wli	97	15	of	of	IN
cord-279903-z0wf1wli	97	16	PEDV	PEDV	NNP
cord-279903-z0wf1wli	97	17	,	,	,
cord-279903-z0wf1wli	97	18	the	the	DT
cord-279903-z0wf1wli	97	19	two	two	CD
cord-279903-z0wf1wli	97	20	primers	primer	NNS
cord-279903-z0wf1wli	97	21	were	be	VBD
cord-279903-z0wf1wli	97	22	located	locate	VBN
cord-279903-z0wf1wli	97	23	in	in	IN
cord-279903-z0wf1wli	97	24	the	the	DT
cord-279903-z0wf1wli	97	25	conserved	conserved	JJ
cord-279903-z0wf1wli	97	26	region	region	NN
cord-279903-z0wf1wli	97	27	of	of	IN
cord-279903-z0wf1wli	97	28	S1	s1	NN
cord-279903-z0wf1wli	97	29	region	region	NN
cord-279903-z0wf1wli	97	30	.	.	.
cord-279903-z0wf1wli	98	1	To	to	TO
cord-279903-z0wf1wli	98	2	differentiate	differentiate	VB
cord-279903-z0wf1wli	98	3	specifically	specifically	RB
cord-279903-z0wf1wli	98	4	the	the	DT
cord-279903-z0wf1wli	98	5	variant	variant	JJ
cord-279903-z0wf1wli	98	6	PEDV	PEDV	NNP
cord-279903-z0wf1wli	98	7	from	from	IN
cord-279903-z0wf1wli	98	8	the	the	DT
cord-279903-z0wf1wli	98	9	virulent	virulent	JJ
cord-279903-z0wf1wli	98	10	strains	strain	NNS
cord-279903-z0wf1wli	98	11	of	of	IN
cord-279903-z0wf1wli	98	12	PEDV	PEDV	NNP
cord-279903-z0wf1wli	98	13	,	,	,
cord-279903-z0wf1wli	98	14	probes	probe	NNS
cord-279903-z0wf1wli	98	15	were	be	VBD
cord-279903-z0wf1wli	98	16	designed	design	VBN
cord-279903-z0wf1wli	98	17	by	by	IN
cord-279903-z0wf1wli	98	18	targeting	target	VBG
cord-279903-z0wf1wli	98	19	the	the	DT
cord-279903-z0wf1wli	98	20	highly	highly	RB
cord-279903-z0wf1wli	98	21	variable	variable	JJ
cord-279903-z0wf1wli	98	22	region	region	NN
cord-279903-z0wf1wli	98	23	containing	contain	VBG
cord-279903-z0wf1wli	98	24	the	the	DT
cord-279903-z0wf1wli	98	25	first	first	JJ
cord-279903-z0wf1wli	98	26	two	two	CD
cord-279903-z0wf1wli	98	27	deletions	deletion	NNS
cord-279903-z0wf1wli	98	28	present	present	JJ
cord-279903-z0wf1wli	98	29	in	in	IN
cord-279903-z0wf1wli	98	30	the	the	DT
cord-279903-z0wf1wli	98	31	variant	variant	JJ
cord-279903-z0wf1wli	98	32	PEDV	PEDV	NNP
cord-279903-z0wf1wli	99	1	(	(	-LRB-
cord-279903-z0wf1wli	99	2	Fig	Fig	NNP
cord-279903-z0wf1wli	99	3	.	.	NNP
cord-279903-z0wf1wli	99	4	1	1	CD
cord-279903-z0wf1wli	99	5	)	)	-RRB-
cord-279903-z0wf1wli	99	6	.	.	.
cord-279903-z0wf1wli	100	1	It	-PRON-	PRP
cord-279903-z0wf1wli	100	2	is	be	VBZ
cord-279903-z0wf1wli	100	3	possible	possible	JJ
cord-279903-z0wf1wli	100	4	that	that	IN
cord-279903-z0wf1wli	100	5	the	the	DT
cord-279903-z0wf1wli	100	6	third	third	JJ
cord-279903-z0wf1wli	100	7	deletion	deletion	NN
cord-279903-z0wf1wli	100	8	and	and	CC
cord-279903-z0wf1wli	100	9	insertion	insertion	NN
cord-279903-z0wf1wli	100	10	site	site	NN
cord-279903-z0wf1wli	100	11	may	may	MD
cord-279903-z0wf1wli	100	12	also	also	RB
cord-279903-z0wf1wli	100	13	be	be	VB
cord-279903-z0wf1wli	100	14	used	use	VBN
cord-279903-z0wf1wli	100	15	as	as	IN
cord-279903-z0wf1wli	100	16	a	a	DT
cord-279903-z0wf1wli	100	17	target	target	NN
cord-279903-z0wf1wli	100	18	for	for	IN
cord-279903-z0wf1wli	100	19	designing	design	VBG
cord-279903-z0wf1wli	100	20	primers	primer	NNS
cord-279903-z0wf1wli	100	21	and	and	CC
cord-279903-z0wf1wli	100	22	probes	probe	NNS
cord-279903-z0wf1wli	100	23	(	(	-LRB-
cord-279903-z0wf1wli	100	24	Fig	fig	NN
cord-279903-z0wf1wli	100	25	.	.	.
cord-279903-z0wf1wli	100	26	1	1	CD
cord-279903-z0wf1wli	100	27	)	)	-RRB-
cord-279903-z0wf1wli	100	28	.	.	.
cord-279903-z0wf1wli	101	1	The	the	DT
cord-279903-z0wf1wli	101	2	assay	assay	NN
cord-279903-z0wf1wli	101	3	is	be	VBZ
cord-279903-z0wf1wli	101	4	specific	specific	JJ
cord-279903-z0wf1wli	101	5	for	for	IN
cord-279903-z0wf1wli	101	6	PEDVs	pedv	NNS
cord-279903-z0wf1wli	101	7	,	,	,
cord-279903-z0wf1wli	101	8	since	since	IN
cord-279903-z0wf1wli	101	9	cross	cross	NN
cord-279903-z0wf1wli	101	10	-	-	NN
cord-279903-z0wf1wli	101	11	reaction	reaction	NN
cord-279903-z0wf1wli	101	12	with	with	IN
cord-279903-z0wf1wli	101	13	non	non	JJ
cord-279903-z0wf1wli	101	14	-	-	JJ
cord-279903-z0wf1wli	101	15	PED	ped	JJ
cord-279903-z0wf1wli	101	16	viral	viral	JJ
cord-279903-z0wf1wli	101	17	genomes	genome	NNS
cord-279903-z0wf1wli	101	18	used	use	VBN
cord-279903-z0wf1wli	101	19	in	in	IN
cord-279903-z0wf1wli	101	20	this	this	DT
cord-279903-z0wf1wli	101	21	study	study	NN
cord-279903-z0wf1wli	101	22	was	be	VBD
cord-279903-z0wf1wli	101	23	not	not	RB
cord-279903-z0wf1wli	101	24	detected	detect	VBN
cord-279903-z0wf1wli	101	25	.	.	.
cord-279903-z0wf1wli	102	1	In	in	IN
cord-279903-z0wf1wli	102	2	addition	addition	NN
cord-279903-z0wf1wli	102	3	,	,	,
cord-279903-z0wf1wli	102	4	the	the	DT
cord-279903-z0wf1wli	102	5	assay	assay	NN
cord-279903-z0wf1wli	102	6	is	be	VBZ
cord-279903-z0wf1wli	102	7	highly	highly	RB
cord-279903-z0wf1wli	102	8	sensitive	sensitive	JJ
cord-279903-z0wf1wli	102	9	,	,	,
cord-279903-z0wf1wli	102	10	being	be	VBG
cord-279903-z0wf1wli	102	11	able	able	JJ
cord-279903-z0wf1wli	102	12	to	to	TO
cord-279903-z0wf1wli	102	13	detect	detect	VB
cord-279903-z0wf1wli	102	14	1	1	CD
cord-279903-z0wf1wli	102	15	copy	copy	NN
cord-279903-z0wf1wli	102	16	in	in	IN
cord-279903-z0wf1wli	102	17	25	25	CD
cord-279903-z0wf1wli	102	18	l	l	NN
cord-279903-z0wf1wli	102	19	reaction	reaction	NN
cord-279903-z0wf1wli	102	20	of	of	IN
cord-279903-z0wf1wli	102	21	either	either	DT
cord-279903-z0wf1wli	102	22	variant	variant	JJ
cord-279903-z0wf1wli	102	23	or	or	CC
cord-279903-z0wf1wli	102	24	virulent	virulent	JJ
cord-279903-z0wf1wli	102	25	strains	strain	NNS
cord-279903-z0wf1wli	102	26	of	of	IN
cord-279903-z0wf1wli	102	27	PEDV	PEDV	NNP
cord-279903-z0wf1wli	102	28	.	.	.
cord-279903-z0wf1wli	103	1	The	the	DT
cord-279903-z0wf1wli	103	2	efficiency	efficiency	NN
cord-279903-z0wf1wli	103	3	of	of	IN
cord-279903-z0wf1wli	103	4	the	the	DT
cord-279903-z0wf1wli	103	5	duplex	duplex	JJ
cord-279903-z0wf1wli	103	6	real	real	JJ
cord-279903-z0wf1wli	103	7	-	-	HYPH
cord-279903-z0wf1wli	103	8	time	time	NN
cord-279903-z0wf1wli	103	9	RT	RT	NNP
cord-279903-z0wf1wli	103	10	-	-	HYPH
cord-279903-z0wf1wli	103	11	PCR	PCR	NNP
cord-279903-z0wf1wli	103	12	assay	assay	NN
cord-279903-z0wf1wli	103	13	was	be	VBD
cord-279903-z0wf1wli	103	14	determined	determine	VBN
cord-279903-z0wf1wli	103	15	by	by	IN
cord-279903-z0wf1wli	103	16	testing	test	VBG
cord-279903-z0wf1wli	103	17	clinical	clinical	JJ
cord-279903-z0wf1wli	103	18	samples	sample	NNS
cord-279903-z0wf1wli	103	19	which	which	WDT
cord-279903-z0wf1wli	103	20	were	be	VBD
cord-279903-z0wf1wli	103	21	positive	positive	JJ
cord-279903-z0wf1wli	103	22	by	by	IN
cord-279903-z0wf1wli	103	23	the	the	DT
cord-279903-z0wf1wli	103	24	real	real	JJ
cord-279903-z0wf1wli	103	25	-	-	HYPH
cord-279903-z0wf1wli	103	26	time	time	NN
cord-279903-z0wf1wli	103	27	RT	RT	NNP
cord-279903-z0wf1wli	103	28	-	-	HYPH
cord-279903-z0wf1wli	103	29	PCR	PCR	NNP
cord-279903-z0wf1wli	103	30	assay	assay	NN
cord-279903-z0wf1wli	103	31	targeting	target	VBG
cord-279903-z0wf1wli	103	32	the	the	DT
cord-279903-z0wf1wli	103	33	M	M	NNP
cord-279903-z0wf1wli	103	34	gene	gene	NN
cord-279903-z0wf1wli	103	35	.	.	.
cord-279903-z0wf1wli	104	1	Of	of	IN
cord-279903-z0wf1wli	104	2	the	the	DT
cord-279903-z0wf1wli	104	3	45	45	CD
cord-279903-z0wf1wli	104	4	clinical	clinical	JJ
cord-279903-z0wf1wli	104	5	samples	sample	NNS
cord-279903-z0wf1wli	104	6	that	that	WDT
cord-279903-z0wf1wli	104	7	tested	test	VBD
cord-279903-z0wf1wli	104	8	positive	positive	JJ
cord-279903-z0wf1wli	104	9	for	for	IN
cord-279903-z0wf1wli	104	10	the	the	DT
cord-279903-z0wf1wli	104	11	variant	variant	JJ
cord-279903-z0wf1wli	104	12	PEDV	PEDV	NNP
cord-279903-z0wf1wli	104	13	,	,	,
cord-279903-z0wf1wli	104	14	all	all	DT
cord-279903-z0wf1wli	104	15	of	of	IN
cord-279903-z0wf1wli	104	16	them	-PRON-	PRP
cord-279903-z0wf1wli	104	17	were	be	VBD
cord-279903-z0wf1wli	104	18	confirmed	confirm	VBN
cord-279903-z0wf1wli	104	19	by	by	IN
cord-279903-z0wf1wli	104	20	sequencing	sequence	VBG
cord-279903-z0wf1wli	104	21	of	of	IN
cord-279903-z0wf1wli	104	22	the	the	DT
cord-279903-z0wf1wli	104	23	spike	spike	NN
cord-279903-z0wf1wli	104	24	gene	gene	NN
cord-279903-z0wf1wli	104	25	.	.	.
cord-279903-z0wf1wli	105	1	In	in	IN
cord-279903-z0wf1wli	105	2	conclusion	conclusion	NN
cord-279903-z0wf1wli	105	3	,	,	,
cord-279903-z0wf1wli	105	4	we	-PRON-	PRP
cord-279903-z0wf1wli	105	5	have	have	VBP
cord-279903-z0wf1wli	105	6	developed	develop	VBN
cord-279903-z0wf1wli	105	7	a	a	DT
cord-279903-z0wf1wli	105	8	duplex	duplex	JJ
cord-279903-z0wf1wli	105	9	real	real	JJ
cord-279903-z0wf1wli	105	10	-	-	HYPH
cord-279903-z0wf1wli	105	11	time	time	NN
cord-279903-z0wf1wli	105	12	RT	RT	NNP
cord-279903-z0wf1wli	105	13	-	-	HYPH
cord-279903-z0wf1wli	105	14	PCR	PCR	NNP
cord-279903-z0wf1wli	105	15	assay	assay	NN
cord-279903-z0wf1wli	105	16	that	that	WDT
cord-279903-z0wf1wli	105	17	reliably	reliably	RB
cord-279903-z0wf1wli	105	18	detects	detect	VBZ
cord-279903-z0wf1wli	105	19	and	and	CC
cord-279903-z0wf1wli	105	20	differentiates	differentiate	VBZ
cord-279903-z0wf1wli	105	21	the	the	DT
cord-279903-z0wf1wli	105	22	virulent	virulent	JJ
cord-279903-z0wf1wli	105	23	strain	strain	NN
cord-279903-z0wf1wli	105	24	and	and	CC
cord-279903-z0wf1wli	105	25	variant	variant	NN
cord-279903-z0wf1wli	105	26	strain	strain	NN
cord-279903-z0wf1wli	105	27	of	of	IN
cord-279903-z0wf1wli	105	28	PEDV	PEDV	NNP
cord-279903-z0wf1wli	105	29	.	.	.
cord-279903-z0wf1wli	106	1	This	this	DT
cord-279903-z0wf1wli	106	2	assay	assay	NN
cord-279903-z0wf1wli	106	3	may	may	MD
cord-279903-z0wf1wli	106	4	be	be	VB
cord-279903-z0wf1wli	106	5	used	use	VBN
cord-279903-z0wf1wli	106	6	by	by	IN
cord-279903-z0wf1wli	106	7	veterinary	veterinary	JJ
cord-279903-z0wf1wli	106	8	diagnostic	diagnostic	JJ
cord-279903-z0wf1wli	106	9	laboratories	laboratory	NNS
cord-279903-z0wf1wli	106	10	to	to	TO
cord-279903-z0wf1wli	106	11	detect	detect	VB
cord-279903-z0wf1wli	106	12	the	the	DT
cord-279903-z0wf1wli	106	13	new	new	JJ
cord-279903-z0wf1wli	106	14	variant	variant	JJ
cord-279903-z0wf1wli	106	15	strain	strain	NN
cord-279903-z0wf1wli	106	16	and	and	CC
cord-279903-z0wf1wli	106	17	the	the	DT
cord-279903-z0wf1wli	106	18	virulent	virulent	JJ
cord-279903-z0wf1wli	106	19	strains	strain	NNS
cord-279903-z0wf1wli	106	20	of	of	IN
cord-279903-z0wf1wli	106	21	PEDV	PEDV	NNP
cord-279903-z0wf1wli	106	22	currently	currently	RB
cord-279903-z0wf1wli	106	23	circulating	circulate	VBG
cord-279903-z0wf1wli	106	24	in	in	IN
cord-279903-z0wf1wli	106	25	the	the	DT
cord-279903-z0wf1wli	106	26	US	US	NNP
cord-279903-z0wf1wli	106	27	.	.	.
cord-279903-z0wf1wli	107	1	Evaluation	evaluation	NN
cord-279903-z0wf1wli	107	2	of	of	IN
cord-279903-z0wf1wli	107	3	a	a	DT
cord-279903-z0wf1wli	107	4	blocking	block	VBG
cord-279903-z0wf1wli	107	5	ELISA	ELISA	NNP
cord-279903-z0wf1wli	107	6	using	use	VBG
cord-279903-z0wf1wli	107	7	monoclonal	monoclonal	JJ
cord-279903-z0wf1wli	107	8	antibodies	antibody	NNS
cord-279903-z0wf1wli	107	9	for	for	IN
cord-279903-z0wf1wli	107	10	the	the	DT
cord-279903-z0wf1wli	107	11	detection	detection	NN
cord-279903-z0wf1wli	107	12	of	of	IN
cord-279903-z0wf1wli	107	13	porcine	porcine	JJ
cord-279903-z0wf1wli	107	14	epidemic	epidemic	NN
cord-279903-z0wf1wli	107	15	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	107	16	virus	virus	NN
cord-279903-z0wf1wli	107	17	and	and	CC
cord-279903-z0wf1wli	107	18	its	-PRON-	PRP$
cord-279903-z0wf1wli	107	19	antibodies	antibody	NNS
cord-279903-z0wf1wli	107	20	Immuno	Immuno	NNP
cord-279903-z0wf1wli	107	21	-	-	HYPH
cord-279903-z0wf1wli	107	22	histochemical	histochemical	JJ
cord-279903-z0wf1wli	107	23	detection	detection	NN
cord-279903-z0wf1wli	107	24	of	of	IN
cord-279903-z0wf1wli	107	25	porcine	porcine	JJ
cord-279903-z0wf1wli	107	26	epidemic	epidemic	NN
cord-279903-z0wf1wli	107	27	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	107	28	virus	virus	NN
cord-279903-z0wf1wli	107	29	compared	compare	VBN
cord-279903-z0wf1wli	107	30	to	to	IN
cord-279903-z0wf1wli	107	31	other	other	JJ
cord-279903-z0wf1wli	107	32	methods	method	NNS
cord-279903-z0wf1wli	107	33	Origin	origin	NN
cord-279903-z0wf1wli	107	34	,	,	,
cord-279903-z0wf1wli	107	35	evolution	evolution	NN
cord-279903-z0wf1wli	107	36	,	,	,
cord-279903-z0wf1wli	107	37	and	and	CC
cord-279903-z0wf1wli	107	38	genotyping	genotyping	NN
cord-279903-z0wf1wli	107	39	of	of	IN
cord-279903-z0wf1wli	107	40	emergent	emergent	JJ
cord-279903-z0wf1wli	107	41	porcine	porcine	JJ
cord-279903-z0wf1wli	107	42	epidemic	epidemic	NN
cord-279903-z0wf1wli	107	43	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	107	44	virus	virus	NN
cord-279903-z0wf1wli	107	45	strains	strain	VBZ
cord-279903-z0wf1wli	107	46	in	in	IN
cord-279903-z0wf1wli	107	47	the	the	DT
cord-279903-z0wf1wli	107	48	United	United	NNP
cord-279903-z0wf1wli	107	49	States	States	NNP
cord-279903-z0wf1wli	107	50	Direct	Direct	NNP
cord-279903-z0wf1wli	107	51	and	and	CC
cord-279903-z0wf1wli	107	52	rapid	rapid	JJ
cord-279903-z0wf1wli	107	53	detection	detection	NN
cord-279903-z0wf1wli	107	54	of	of	IN
cord-279903-z0wf1wli	107	55	porcine	porcine	JJ
cord-279903-z0wf1wli	107	56	epidemic	epidemic	NN
cord-279903-z0wf1wli	107	57	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	107	58	virus	virus	NN
cord-279903-z0wf1wli	107	59	by	by	IN
cord-279903-z0wf1wli	107	60	RT	RT	NNP
cord-279903-z0wf1wli	107	61	-	-	HYPH
cord-279903-z0wf1wli	107	62	PCR	PCR	NNP
cord-279903-z0wf1wli	107	63	Pathology	Pathology	NNP
cord-279903-z0wf1wli	107	64	of	of	IN
cord-279903-z0wf1wli	107	65	US	US	NNP
cord-279903-z0wf1wli	107	66	porcine	porcine	JJ
cord-279903-z0wf1wli	107	67	epidemic	epidemic	NN
cord-279903-z0wf1wli	107	68	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	107	69	virus	virus	NN
cord-279903-z0wf1wli	107	70	strain	strain	NN
cord-279903-z0wf1wli	107	71	PC21A	PC21A	VBN
cord-279903-z0wf1wli	107	72	in	in	IN
cord-279903-z0wf1wli	107	73	gnotobiotic	gnotobiotic	JJ
cord-279903-z0wf1wli	107	74	pigs	pig	NNS
cord-279903-z0wf1wli	107	75	Rapid	rapid	JJ
cord-279903-z0wf1wli	107	76	diagnosis	diagnosis	NN
cord-279903-z0wf1wli	107	77	of	of	IN
cord-279903-z0wf1wli	107	78	porcine	porcine	JJ
cord-279903-z0wf1wli	107	79	epidemic	epidemic	NN
cord-279903-z0wf1wli	107	80	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	107	81	virus	virus	NN
cord-279903-z0wf1wli	107	82	infection	infection	NN
cord-279903-z0wf1wli	107	83	by	by	IN
cord-279903-z0wf1wli	107	84	polymerase	polymerase	NN
cord-279903-z0wf1wli	107	85	chain	chain	NN
cord-279903-z0wf1wli	107	86	reaction	reaction	NN
cord-279903-z0wf1wli	107	87	Role	role	NN
cord-279903-z0wf1wli	107	88	of	of	IN
cord-279903-z0wf1wli	107	89	transportation	transportation	NN
cord-279903-z0wf1wli	107	90	in	in	IN
cord-279903-z0wf1wli	107	91	spread	spread	NN
cord-279903-z0wf1wli	107	92	of	of	IN
cord-279903-z0wf1wli	107	93	porcine	porcine	JJ
cord-279903-z0wf1wli	107	94	epidemic	epidemic	NN
cord-279903-z0wf1wli	107	95	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	107	96	virus	virus	NN
cord-279903-z0wf1wli	107	97	infection	infection	NN
cord-279903-z0wf1wli	107	98	,	,	,
cord-279903-z0wf1wli	107	99	United	United	NNP
cord-279903-z0wf1wli	107	100	States	States	NNP
cord-279903-z0wf1wli	107	101	Letter	Letter	NNP
cord-279903-z0wf1wli	107	102	to	to	IN
cord-279903-z0wf1wli	107	103	the	the	DT
cord-279903-z0wf1wli	107	104	editor	editor	NN
cord-279903-z0wf1wli	107	105	.	.	.
cord-279903-z0wf1wli	108	1	Pig	Pig	NNP
cord-279903-z0wf1wli	108	2	Farming	Farming	NNP
cord-279903-z0wf1wli	108	3	Light	Light	NNP
cord-279903-z0wf1wli	108	4	microscopy	microscopy	NNS
cord-279903-z0wf1wli	108	5	and	and	CC
cord-279903-z0wf1wli	108	6	ultrahistology	ultrahistology	NN
cord-279903-z0wf1wli	108	7	of	of	IN
cord-279903-z0wf1wli	108	8	intestinal	intestinal	JJ
cord-279903-z0wf1wli	108	9	changes	change	NNS
cord-279903-z0wf1wli	108	10	in	in	IN
cord-279903-z0wf1wli	108	11	pigs	pig	NNS
cord-279903-z0wf1wli	108	12	infected	infect	VBN
cord-279903-z0wf1wli	108	13	with	with	IN
cord-279903-z0wf1wli	108	14	epizootic	epizootic	JJ
cord-279903-z0wf1wli	108	15	diarrhoea	diarrhoea	NN
cord-279903-z0wf1wli	108	16	virus	virus	NN
cord-279903-z0wf1wli	108	17	(	(	-LRB-
cord-279903-z0wf1wli	108	18	EDV	EDV	NNP
cord-279903-z0wf1wli	108	19	)	)	-RRB-
cord-279903-z0wf1wli	108	20	:	:	:
cord-279903-z0wf1wli	109	1	comparison	comparison	NN
cord-279903-z0wf1wli	109	2	with	with	IN
cord-279903-z0wf1wli	109	3	transmissible	transmissible	JJ
cord-279903-z0wf1wli	109	4	gastroenteritis	gastroenteritis	NN
cord-279903-z0wf1wli	109	5	(	(	-LRB-
cord-279903-z0wf1wli	109	6	TGE	TGE	NNP
cord-279903-z0wf1wli	109	7	)	)	-RRB-
cord-279903-z0wf1wli	109	8	virus	virus	NN
cord-279903-z0wf1wli	109	9	and	and	CC
cord-279903-z0wf1wli	109	10	porcine	porcine	JJ
cord-279903-z0wf1wli	109	11	rotavirus	rotavirus	NN
cord-279903-z0wf1wli	109	12	infections	infection	NNS
cord-279903-z0wf1wli	109	13	Emergence	emergence	NN
cord-279903-z0wf1wli	109	14	of	of	IN
cord-279903-z0wf1wli	109	15	porcine	porcine	JJ
cord-279903-z0wf1wli	109	16	epidemic	epidemic	NN
cord-279903-z0wf1wli	109	17	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	109	18	virus	virus	NN
cord-279903-z0wf1wli	109	19	in	in	IN
cord-279903-z0wf1wli	109	20	the	the	DT
cord-279903-z0wf1wli	109	21	United	United	NNP
cord-279903-z0wf1wli	109	22	States	States	NNP
cord-279903-z0wf1wli	109	23	:	:	:
cord-279903-z0wf1wli	109	24	clinical	clinical	JJ
cord-279903-z0wf1wli	109	25	signs	sign	NNS
cord-279903-z0wf1wli	109	26	,	,	,
cord-279903-z0wf1wli	109	27	lesions	lesion	NNS
cord-279903-z0wf1wli	109	28	,	,	,
cord-279903-z0wf1wli	109	29	and	and	CC
cord-279903-z0wf1wli	109	30	viral	viral	JJ
cord-279903-z0wf1wli	109	31	genomic	genomic	JJ
cord-279903-z0wf1wli	109	32	sequences	sequence	NNS
cord-279903-z0wf1wli	109	33	Outbreak	outbreak	NN
cord-279903-z0wf1wli	109	34	of	of	IN
cord-279903-z0wf1wli	109	35	porcine	porcine	JJ
cord-279903-z0wf1wli	109	36	epidemic	epidemic	NN
cord-279903-z0wf1wli	109	37	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	109	38	in	in	IN
cord-279903-z0wf1wli	109	39	suckling	suckle	VBG
cord-279903-z0wf1wli	109	40	piglets	piglet	NNS
cord-279903-z0wf1wli	110	1	New	new	JJ
cord-279903-z0wf1wli	110	2	variant	variant	NN
cord-279903-z0wf1wli	110	3	of	of	IN
cord-279903-z0wf1wli	110	4	porcine	porcine	JJ
cord-279903-z0wf1wli	110	5	epidemic	epidemic	NN
cord-279903-z0wf1wli	110	6	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	110	7	virus	virus	NN
cord-279903-z0wf1wli	110	8	,	,	,
cord-279903-z0wf1wli	110	9	United	United	NNP
cord-279903-z0wf1wli	110	10	States	States	NNP
cord-279903-z0wf1wli	110	11	Molecular	Molecular	NNP
cord-279903-z0wf1wli	110	12	characterization	characterization	NN
cord-279903-z0wf1wli	110	13	and	and	CC
cord-279903-z0wf1wli	110	14	phylogenetic	phylogenetic	JJ
cord-279903-z0wf1wli	110	15	analysis	analysis	NN
cord-279903-z0wf1wli	110	16	of	of	IN
cord-279903-z0wf1wli	110	17	porcine	porcine	JJ
cord-279903-z0wf1wli	110	18	epidemic	epidemic	NN
cord-279903-z0wf1wli	110	19	diarrhea	diarrhea	NN
cord-279903-z0wf1wli	110	20	virus	virus	NN
cord-279903-z0wf1wli	110	21	field	field	NN
cord-279903-z0wf1wli	110	22	strains	strain	NNS
cord-279903-z0wf1wli	110	23	in	in	IN
cord-279903-z0wf1wli	110	24	central	central	JJ
cord-279903-z0wf1wli	110	25	China	China	NNP
cord-279903-z0wf1wli	110	26	during	during	IN
cord-279903-z0wf1wli	110	27	2010	2010	CD
cord-279903-z0wf1wli	110	28	-	-	SYM
cord-279903-z0wf1wli	110	29	2012	2012	CD
cord-279903-z0wf1wli	110	30	outbreaks	outbreak	NNS