id	sid	tid	token	lemma	pos
cord-279980-49yv65gm	1	1	key	key	NN
cord-279980-49yv65gm	1	2	:	:	:
cord-279980-49yv65gm	2	1	cord-279980	cord-279980	NNP
cord-279980-49yv65gm	2	2	-	-	HYPH
cord-279980-49yv65gm	2	3	49yv65gm	49yv65gm	CD
cord-279980-49yv65gm	2	4	authors	author	NNS
cord-279980-49yv65gm	2	5	:	:	:
cord-279980-49yv65gm	2	6	WANARATANA	WANARATANA	NNP
cord-279980-49yv65gm	2	7	,	,	,
cord-279980-49yv65gm	2	8	S.	S.	NNP
cord-279980-49yv65gm	2	9	;	;	:
cord-279980-49yv65gm	2	10	PANYIM	PANYIM	NNP
cord-279980-49yv65gm	2	11	,	,	,
cord-279980-49yv65gm	2	12	S.	S.	NNP
cord-279980-49yv65gm	2	13	;	;	:
cord-279980-49yv65gm	2	14	PAKPINYO	PAKPINYO	NNP
cord-279980-49yv65gm	2	15	,	,	,
cord-279980-49yv65gm	2	16	S.	S.	NNP
cord-279980-49yv65gm	2	17	title	title	NN
cord-279980-49yv65gm	2	18	:	:	:
cord-279980-49yv65gm	3	1	The	the	DT
cord-279980-49yv65gm	3	2	potential	potential	NN
cord-279980-49yv65gm	3	3	of	of	IN
cord-279980-49yv65gm	3	4	house	house	NN
cord-279980-49yv65gm	3	5	flies	fly	VBZ
cord-279980-49yv65gm	3	6	to	to	TO
cord-279980-49yv65gm	3	7	act	act	VB
cord-279980-49yv65gm	3	8	as	as	IN
cord-279980-49yv65gm	3	9	a	a	DT
cord-279980-49yv65gm	3	10	vector	vector	NN
cord-279980-49yv65gm	3	11	of	of	IN
cord-279980-49yv65gm	3	12	avian	avian	JJ
cord-279980-49yv65gm	3	13	influenza	influenza	NN
cord-279980-49yv65gm	3	14	subtype	subtype	NN
cord-279980-49yv65gm	3	15	H5N1	H5N1	NNP
cord-279980-49yv65gm	3	16	under	under	IN
cord-279980-49yv65gm	3	17	experimental	experimental	JJ
cord-279980-49yv65gm	3	18	conditions	condition	NNS
cord-279980-49yv65gm	3	19	date	date	NN
cord-279980-49yv65gm	4	1	:	:	:
cord-279980-49yv65gm	4	2	2010	2010	CD
cord-279980-49yv65gm	4	3	-	-	SYM
cord-279980-49yv65gm	4	4	12	12	CD
cord-279980-49yv65gm	4	5	-	-	HYPH
cord-279980-49yv65gm	4	6	01	01	CD
cord-279980-49yv65gm	4	7	journal	journal	NN
cord-279980-49yv65gm	4	8	:	:	:
cord-279980-49yv65gm	5	1	Med	Med	NNP
cord-279980-49yv65gm	5	2	Vet	Vet	NNP
cord-279980-49yv65gm	5	3	Entomol	Entomol	NNP
cord-279980-49yv65gm	6	1	DOI	DOI	NNP
cord-279980-49yv65gm	6	2	:	:	:
cord-279980-49yv65gm	7	1	10.1111	10.1111	CD
cord-279980-49yv65gm	7	2	/	/	SYM
cord-279980-49yv65gm	7	3	j.1365	j.1365	XX
cord-279980-49yv65gm	7	4	-	-	HYPH
cord-279980-49yv65gm	7	5	2915.2010.00928.x	2915.2010.00928.x	CD
cord-279980-49yv65gm	7	6	sha	sha	NNP
cord-279980-49yv65gm	7	7	:	:	:
cord-279980-49yv65gm	7	8	4344fb4d3763d67b29fb70643a18d1f843528f39	4344fb4d3763d67b29fb70643a18d1f843528f39	CD
cord-279980-49yv65gm	7	9	doc_id	doc_id	CD
cord-279980-49yv65gm	7	10	:	:	:
cord-279980-49yv65gm	7	11	279980	279980	CD
cord-279980-49yv65gm	7	12	cord_uid	cord_uid	NNS
cord-279980-49yv65gm	7	13	:	:	:
cord-279980-49yv65gm	8	1	49yv65gm	49yv65gm	LS
cord-279980-49yv65gm	9	1	The	the	DT
cord-279980-49yv65gm	9	2	objective	objective	NN
cord-279980-49yv65gm	9	3	of	of	IN
cord-279980-49yv65gm	9	4	the	the	DT
cord-279980-49yv65gm	9	5	present	present	JJ
cord-279980-49yv65gm	9	6	study	study	NN
cord-279980-49yv65gm	9	7	was	be	VBD
cord-279980-49yv65gm	9	8	to	to	TO
cord-279980-49yv65gm	9	9	determine	determine	VB
cord-279980-49yv65gm	9	10	the	the	DT
cord-279980-49yv65gm	9	11	potential	potential	NN
cord-279980-49yv65gm	9	12	for	for	IN
cord-279980-49yv65gm	9	13	house	house	NN
cord-279980-49yv65gm	9	14	flies	fly	NNS
cord-279980-49yv65gm	9	15	(	(	-LRB-
cord-279980-49yv65gm	9	16	Musca	Musca	NNP
cord-279980-49yv65gm	9	17	domestica	domestica	NNP
cord-279980-49yv65gm	9	18	L.	L.	NNP
cord-279980-49yv65gm	9	19	)	)	-RRB-
cord-279980-49yv65gm	10	1	(	(	-LRB-
cord-279980-49yv65gm	10	2	Diptera	Diptera	NNP
cord-279980-49yv65gm	10	3	:	:	:
cord-279980-49yv65gm	10	4	Muscidae	Muscidae	NNP
cord-279980-49yv65gm	10	5	)	)	-RRB-
cord-279980-49yv65gm	11	1	to	to	TO
cord-279980-49yv65gm	11	2	harbour	harbour	VB
cord-279980-49yv65gm	11	3	the	the	DT
cord-279980-49yv65gm	11	4	avian	avian	JJ
cord-279980-49yv65gm	11	5	influenza	influenza	NN
cord-279980-49yv65gm	11	6	(	(	-LRB-
cord-279980-49yv65gm	11	7	AI	AI	NNP
cord-279980-49yv65gm	11	8	)	)	-RRB-
cord-279980-49yv65gm	11	9	H5N1	H5N1	NNP
cord-279980-49yv65gm	11	10	virus	virus	NN
cord-279980-49yv65gm	11	11	.	.	.
cord-279980-49yv65gm	12	1	Laboratory‐reared	laboratory‐reare	VBN
cord-279980-49yv65gm	12	2	flies	fly	NNS
cord-279980-49yv65gm	12	3	were	be	VBD
cord-279980-49yv65gm	12	4	experimentally	experimentally	RB
cord-279980-49yv65gm	12	5	fed	feed	VBN
cord-279980-49yv65gm	12	6	with	with	IN
cord-279980-49yv65gm	12	7	a	a	DT
cord-279980-49yv65gm	12	8	mixture	mixture	NN
cord-279980-49yv65gm	12	9	containing	contain	VBG
cord-279980-49yv65gm	12	10	the	the	DT
cord-279980-49yv65gm	12	11	AI	AI	NNP
cord-279980-49yv65gm	12	12	virus	virus	NN
cord-279980-49yv65gm	12	13	.	.	.
cord-279980-49yv65gm	13	1	Exposed	expose	VBN
cord-279980-49yv65gm	13	2	flies	fly	NNS
cord-279980-49yv65gm	13	3	were	be	VBD
cord-279980-49yv65gm	13	4	washed	wash	VBN
cord-279980-49yv65gm	13	5	with	with	IN
cord-279980-49yv65gm	13	6	brain	brain	NN
cord-279980-49yv65gm	13	7	–	–	:
cord-279980-49yv65gm	13	8	heart	heart	NN
cord-279980-49yv65gm	13	9	infusion	infusion	NN
cord-279980-49yv65gm	13	10	broth	broth	NN
cord-279980-49yv65gm	13	11	and	and	CC
cord-279980-49yv65gm	13	12	followed	follow	VBN
cord-279980-49yv65gm	13	13	by	by	IN
cord-279980-49yv65gm	13	14	70	70	CD
cord-279980-49yv65gm	13	15	%	%	NN
cord-279980-49yv65gm	13	16	alcohol	alcohol	NN
cord-279980-49yv65gm	13	17	before	before	IN
cord-279980-49yv65gm	13	18	preparation	preparation	NN
cord-279980-49yv65gm	13	19	of	of	IN
cord-279980-49yv65gm	13	20	whole	whole	JJ
cord-279980-49yv65gm	13	21	fly	fly	NN
cord-279980-49yv65gm	13	22	homogenate	homogenate	NNP
cord-279980-49yv65gm	13	23	.	.	.
cord-279980-49yv65gm	14	1	The	the	DT
cord-279980-49yv65gm	14	2	homogenate	homogenate	NNP
cord-279980-49yv65gm	14	3	was	be	VBD
cord-279980-49yv65gm	14	4	inoculated	inoculate	VBN
cord-279980-49yv65gm	14	5	into	into	IN
cord-279980-49yv65gm	14	6	six	six	CD
cord-279980-49yv65gm	14	7	10‐day‐old	10‐day‐old	CD
cord-279980-49yv65gm	14	8	embryonated	embryonate	VBN
cord-279980-49yv65gm	14	9	chicken	chicken	NN
cord-279980-49yv65gm	14	10	eggs	egg	NNS
cord-279980-49yv65gm	14	11	(	(	-LRB-
cord-279980-49yv65gm	14	12	ECEs	ECEs	NNP
cord-279980-49yv65gm	14	13	)	)	-RRB-
cord-279980-49yv65gm	14	14	.	.	.
cord-279980-49yv65gm	15	1	Allantoic	Allantoic	NNP
cord-279980-49yv65gm	15	2	fluids	fluid	NNS
cord-279980-49yv65gm	15	3	were	be	VBD
cord-279980-49yv65gm	15	4	collected	collect	VBN
cord-279980-49yv65gm	15	5	to	to	TO
cord-279980-49yv65gm	15	6	determine	determine	VB
cord-279980-49yv65gm	15	7	the	the	DT
cord-279980-49yv65gm	15	8	virus	virus	NN
cord-279980-49yv65gm	15	9	using	use	VBG
cord-279980-49yv65gm	15	10	the	the	DT
cord-279980-49yv65gm	15	11	haemagglutination	haemagglutination	NN
cord-279980-49yv65gm	15	12	(	(	-LRB-
cord-279980-49yv65gm	15	13	HA	HA	NNP
cord-279980-49yv65gm	15	14	)	)	-RRB-
cord-279980-49yv65gm	15	15	test	test	NN
cord-279980-49yv65gm	15	16	,	,	,
cord-279980-49yv65gm	15	17	reverse	reverse	VB
cord-279980-49yv65gm	15	18	transcription‐polymerase	transcription‐polymerase	JJ
cord-279980-49yv65gm	15	19	chain	chain	NN
cord-279980-49yv65gm	15	20	reaction	reaction	NN
cord-279980-49yv65gm	15	21	(	(	-LRB-
cord-279980-49yv65gm	15	22	RT‐PCR	RT‐PCR	NNP
cord-279980-49yv65gm	15	23	)	)	-RRB-
cord-279980-49yv65gm	15	24	or	or	CC
cord-279980-49yv65gm	15	25	quantitative	quantitative	JJ
cord-279980-49yv65gm	15	26	real‐time	real‐time	NN
cord-279980-49yv65gm	15	27	RT‐PCR	rt‐pcr	XX
cord-279980-49yv65gm	15	28	(	(	-LRB-
cord-279980-49yv65gm	15	29	RRT‐PCR	RRT‐PCR	NNP
cord-279980-49yv65gm	15	30	)	)	-RRB-
cord-279980-49yv65gm	15	31	.	.	.
cord-279980-49yv65gm	16	1	In	in	IN
cord-279980-49yv65gm	16	2	the	the	DT
cord-279980-49yv65gm	16	3	first	first	JJ
cord-279980-49yv65gm	16	4	experiment	experiment	NN
cord-279980-49yv65gm	16	5	,	,	,
cord-279980-49yv65gm	16	6	ECEs	ECEs	NNP
cord-279980-49yv65gm	16	7	that	that	WDT
cord-279980-49yv65gm	16	8	were	be	VBD
cord-279980-49yv65gm	16	9	inoculated	inoculate	VBN
cord-279980-49yv65gm	16	10	with	with	IN
cord-279980-49yv65gm	16	11	the	the	DT
cord-279980-49yv65gm	16	12	50	50	CD
cord-279980-49yv65gm	16	13	AI	AI	NNP
cord-279980-49yv65gm	16	14	virus	virus	NN
cord-279980-49yv65gm	16	15	exposed	expose	VBN
cord-279980-49yv65gm	16	16	fly	fly	NN
cord-279980-49yv65gm	16	17	homogenates	homogenate	NNS
cord-279980-49yv65gm	16	18	died	die	VBD
cord-279980-49yv65gm	16	19	within	within	IN
cord-279980-49yv65gm	16	20	48	48	CD
cord-279980-49yv65gm	16	21	h	h	NN
cord-279980-49yv65gm	16	22	and	and	CC
cord-279980-49yv65gm	16	23	HA	HA	NNP
cord-279980-49yv65gm	16	24	and	and	CC
cord-279980-49yv65gm	16	25	RT‐PCR	RT‐PCR	NNP
cord-279980-49yv65gm	16	26	were	be	VBD
cord-279980-49yv65gm	16	27	positive	positive	JJ
cord-279980-49yv65gm	16	28	for	for	IN
cord-279980-49yv65gm	16	29	AI	AI	NNP
cord-279980-49yv65gm	16	30	virus	virus	NN
cord-279980-49yv65gm	16	31	.	.	.
cord-279980-49yv65gm	17	1	In	in	IN
cord-279980-49yv65gm	17	2	the	the	DT
cord-279980-49yv65gm	17	3	second	second	JJ
cord-279980-49yv65gm	17	4	experiment	experiment	NN
cord-279980-49yv65gm	17	5	,	,	,
cord-279980-49yv65gm	17	6	ECEs	ECEs	NNP
cord-279980-49yv65gm	17	7	that	that	WDT
cord-279980-49yv65gm	17	8	were	be	VBD
cord-279980-49yv65gm	17	9	inoculated	inoculate	VBN
cord-279980-49yv65gm	17	10	with	with	IN
cord-279980-49yv65gm	17	11	only	only	RB
cord-279980-49yv65gm	17	12	one	one	CD
cord-279980-49yv65gm	17	13	fly	fly	NN
cord-279980-49yv65gm	17	14	died	die	VBD
cord-279980-49yv65gm	17	15	with	with	IN
cord-279980-49yv65gm	17	16	positive	positive	JJ
cord-279980-49yv65gm	17	17	HA	HA	NNP
cord-279980-49yv65gm	17	18	test	test	NN
cord-279980-49yv65gm	17	19	and	and	CC
cord-279980-49yv65gm	17	20	RT‐PCR	rt‐pcr	ADD
cord-279980-49yv65gm	17	21	.	.	.
cord-279980-49yv65gm	18	1	In	in	IN
cord-279980-49yv65gm	18	2	the	the	DT
cord-279980-49yv65gm	18	3	last	last	JJ
cord-279980-49yv65gm	18	4	experiment	experiment	NN
cord-279980-49yv65gm	18	5	,	,	,
cord-279980-49yv65gm	18	6	a	a	DT
cord-279980-49yv65gm	18	7	group	group	NN
cord-279980-49yv65gm	18	8	of	of	IN
cord-279980-49yv65gm	18	9	exposed	expose	VBN
cord-279980-49yv65gm	18	10	flies	fly	NNS
cord-279980-49yv65gm	18	11	was	be	VBD
cord-279980-49yv65gm	18	12	collected	collect	VBN
cord-279980-49yv65gm	18	13	at	at	IN
cord-279980-49yv65gm	18	14	0	0	CD
cord-279980-49yv65gm	18	15	,	,	,
cord-279980-49yv65gm	18	16	6	6	CD
cord-279980-49yv65gm	18	17	,	,	,
cord-279980-49yv65gm	18	18	12	12	CD
cord-279980-49yv65gm	18	19	,	,	,
cord-279980-49yv65gm	18	20	24	24	CD
cord-279980-49yv65gm	18	21	,	,	,
cord-279980-49yv65gm	18	22	36	36	CD
cord-279980-49yv65gm	18	23	,	,	,
cord-279980-49yv65gm	18	24	48	48	CD
cord-279980-49yv65gm	18	25	,	,	,
cord-279980-49yv65gm	18	26	72	72	CD
cord-279980-49yv65gm	18	27	and	and	CC
cord-279980-49yv65gm	18	28	96	96	CD
cord-279980-49yv65gm	18	29	h	h	NN
cord-279980-49yv65gm	18	30	post‐exposure	post‐exposure	NN
cord-279980-49yv65gm	18	31	.	.	.
cord-279980-49yv65gm	19	1	Fly	fly	VB
cord-279980-49yv65gm	19	2	homogenates	homogenate	NNS
cord-279980-49yv65gm	19	3	of	of	IN
cord-279980-49yv65gm	19	4	each	each	DT
cord-279980-49yv65gm	19	5	time	time	NN
cord-279980-49yv65gm	19	6	point	point	NN
cord-279980-49yv65gm	19	7	were	be	VBD
cord-279980-49yv65gm	19	8	tested	test	VBN
cord-279980-49yv65gm	19	9	by	by	IN
cord-279980-49yv65gm	19	10	virus	virus	NN
cord-279980-49yv65gm	19	11	titration	titration	NN
cord-279980-49yv65gm	19	12	in	in	IN
cord-279980-49yv65gm	19	13	ECEs	ECEs	NNP
cord-279980-49yv65gm	19	14	and	and	CC
cord-279980-49yv65gm	19	15	RRT‐PCR	RRT‐PCR	NNP
cord-279980-49yv65gm	19	16	.	.	.
cord-279980-49yv65gm	20	1	Virus	virus	NN
cord-279980-49yv65gm	20	2	titres	titre	NNS
cord-279980-49yv65gm	20	3	declined	decline	VBD
cord-279980-49yv65gm	20	4	in	in	IN
cord-279980-49yv65gm	20	5	relation	relation	NN
cord-279980-49yv65gm	20	6	to	to	IN
cord-279980-49yv65gm	20	7	exposure	exposure	NN
cord-279980-49yv65gm	20	8	time	time	NN
cord-279980-49yv65gm	20	9	.	.	.
cord-279980-49yv65gm	21	1	Furthermore	furthermore	RB
cord-279980-49yv65gm	21	2	,	,	,
cord-279980-49yv65gm	21	3	RRT‐PCR	RRT‐PCR	NNP
cord-279980-49yv65gm	21	4	results	result	NNS
cord-279980-49yv65gm	21	5	were	be	VBD
cord-279980-49yv65gm	21	6	positive	positive	JJ
cord-279980-49yv65gm	21	7	at	at	IN
cord-279980-49yv65gm	21	8	any	any	DT
cord-279980-49yv65gm	21	9	time	time	NN
cord-279980-49yv65gm	21	10	point	point	NN
cord-279980-49yv65gm	21	11	.	.	.
cord-279980-49yv65gm	22	1	The	the	DT
cord-279980-49yv65gm	22	2	present	present	JJ
cord-279980-49yv65gm	22	3	study	study	NN
cord-279980-49yv65gm	22	4	shows	show	VBZ
cord-279980-49yv65gm	22	5	that	that	IN
cord-279980-49yv65gm	22	6	the	the	DT
cord-279980-49yv65gm	22	7	flies	fly	NNS
cord-279980-49yv65gm	22	8	may	may	MD
cord-279980-49yv65gm	22	9	harbour	harbour	VB
cord-279980-49yv65gm	22	10	the	the	DT
cord-279980-49yv65gm	22	11	AI	AI	NNP
cord-279980-49yv65gm	22	12	virus	virus	NN
cord-279980-49yv65gm	22	13	and	and	CC
cord-279980-49yv65gm	22	14	could	could	MD
cord-279980-49yv65gm	22	15	act	act	VB
cord-279980-49yv65gm	22	16	as	as	IN
cord-279980-49yv65gm	22	17	a	a	DT
cord-279980-49yv65gm	22	18	mechanical	mechanical	JJ
cord-279980-49yv65gm	22	19	vector	vector	NN
cord-279980-49yv65gm	22	20	of	of	IN
cord-279980-49yv65gm	22	21	the	the	DT
cord-279980-49yv65gm	22	22	AI	AI	NNP
cord-279980-49yv65gm	22	23	virus	virus	NN
cord-279980-49yv65gm	22	24	.	.	.
cord-279980-49yv65gm	23	1	Avian	avian	JJ
cord-279980-49yv65gm	23	2	influenza	influenza	NN
cord-279980-49yv65gm	23	3	(	(	-LRB-
cord-279980-49yv65gm	23	4	AI	AI	NNP
cord-279980-49yv65gm	23	5	)	)	-RRB-
cord-279980-49yv65gm	23	6	is	be	VBZ
cord-279980-49yv65gm	23	7	a	a	DT
cord-279980-49yv65gm	23	8	highly	highly	RB
cord-279980-49yv65gm	23	9	contagious	contagious	JJ
cord-279980-49yv65gm	23	10	disease	disease	NN
cord-279980-49yv65gm	23	11	caused	cause	VBN
cord-279980-49yv65gm	23	12	by	by	IN
cord-279980-49yv65gm	23	13	the	the	DT
cord-279980-49yv65gm	23	14	type	type	NN
cord-279980-49yv65gm	23	15	A	a	DT
cord-279980-49yv65gm	23	16	influenza	influenza	NN
cord-279980-49yv65gm	23	17	virus	virus	NN
cord-279980-49yv65gm	23	18	of	of	IN
cord-279980-49yv65gm	23	19	the	the	DT
cord-279980-49yv65gm	23	20	family	family	NN
cord-279980-49yv65gm	23	21	Orthomyxoviridae	Orthomyxoviridae	NNP
cord-279980-49yv65gm	23	22	.	.	.
cord-279980-49yv65gm	24	1	Highly	highly	RB
cord-279980-49yv65gm	24	2	pathogenic	pathogenic	JJ
cord-279980-49yv65gm	24	3	avian	avian	JJ
cord-279980-49yv65gm	24	4	influenza	influenza	NN
cord-279980-49yv65gm	24	5	(	(	-LRB-
cord-279980-49yv65gm	24	6	HPAI	HPAI	NNP
cord-279980-49yv65gm	24	7	)	)	-RRB-
cord-279980-49yv65gm	24	8	viruses	virus	NNS
cord-279980-49yv65gm	24	9	,	,	,
cord-279980-49yv65gm	24	10	especially	especially	RB
cord-279980-49yv65gm	24	11	subtype	subtype	NN
cord-279980-49yv65gm	24	12	H5N1	H5N1	NNP
cord-279980-49yv65gm	24	13	,	,	,
cord-279980-49yv65gm	24	14	cause	cause	VB
cord-279980-49yv65gm	24	15	a	a	DT
cord-279980-49yv65gm	24	16	multi	multi	JJ
cord-279980-49yv65gm	24	17	-	-	JJ
cord-279980-49yv65gm	24	18	systemic	systemic	JJ
cord-279980-49yv65gm	24	19	disease	disease	NN
cord-279980-49yv65gm	24	20	associated	associate	VBN
cord-279980-49yv65gm	24	21	with	with	IN
cord-279980-49yv65gm	24	22	high	high	JJ
cord-279980-49yv65gm	24	23	morbidity	morbidity	NN
cord-279980-49yv65gm	24	24	and	and	CC
cord-279980-49yv65gm	24	25	mortality	mortality	NN
cord-279980-49yv65gm	24	26	in	in	IN
cord-279980-49yv65gm	24	27	poultry	poultry	NN
cord-279980-49yv65gm	24	28	,	,	,
cord-279980-49yv65gm	24	29	as	as	RB
cord-279980-49yv65gm	24	30	well	well	RB
cord-279980-49yv65gm	24	31	as	as	IN
cord-279980-49yv65gm	24	32	in	in	IN
cord-279980-49yv65gm	24	33	mammals	mammal	NNS
cord-279980-49yv65gm	24	34	and	and	CC
cord-279980-49yv65gm	24	35	humans	human	NNS
cord-279980-49yv65gm	24	36	(	(	-LRB-
cord-279980-49yv65gm	24	37	Mahy	Mahy	NNP
cord-279980-49yv65gm	24	38	&	&	CC
cord-279980-49yv65gm	24	39	Van	Van	NNP
cord-279980-49yv65gm	24	40	Regenmortel	Regenmortel	NNP
cord-279980-49yv65gm	24	41	,	,	,
cord-279980-49yv65gm	24	42	2008	2008	CD
cord-279980-49yv65gm	24	43	)	)	-RRB-
cord-279980-49yv65gm	24	44	.	.	.
cord-279980-49yv65gm	25	1	The	the	DT
cord-279980-49yv65gm	25	2	emergence	emergence	NN
cord-279980-49yv65gm	25	3	of	of	IN
cord-279980-49yv65gm	25	4	the	the	DT
cord-279980-49yv65gm	25	5	AI	AI	NNP
cord-279980-49yv65gm	25	6	H5N1	H5N1	NNP
cord-279980-49yv65gm	25	7	virus	virus	NN
cord-279980-49yv65gm	25	8	was	be	VBD
cord-279980-49yv65gm	25	9	first	first	RB
cord-279980-49yv65gm	25	10	reported	report	VBN
cord-279980-49yv65gm	25	11	in	in	IN
cord-279980-49yv65gm	25	12	1996	1996	CD
cord-279980-49yv65gm	25	13	in	in	IN
cord-279980-49yv65gm	25	14	mainland	mainland	NN
cord-279980-49yv65gm	25	15	China	China	NNP
cord-279980-49yv65gm	26	1	(	(	-LRB-
cord-279980-49yv65gm	26	2	Chen	Chen	NNP
cord-279980-49yv65gm	26	3	et	et	NNP
cord-279980-49yv65gm	26	4	al	al	NNP
cord-279980-49yv65gm	26	5	.	.	NNP
cord-279980-49yv65gm	26	6	,	,	,
cord-279980-49yv65gm	26	7	2004	2004	CD
cord-279980-49yv65gm	26	8	)	)	-RRB-
cord-279980-49yv65gm	26	9	and	and	CC
cord-279980-49yv65gm	26	10	later	later	RB
cord-279980-49yv65gm	26	11	spread	spread	VBD
cord-279980-49yv65gm	26	12	to	to	TO
cord-279980-49yv65gm	26	13	live	live	VB
cord-279980-49yv65gm	26	14	poultry	poultry	NN
cord-279980-49yv65gm	26	15	markets	market	NNS
cord-279980-49yv65gm	26	16	in	in	IN
cord-279980-49yv65gm	26	17	Hong	Hong	NNP
cord-279980-49yv65gm	26	18	Kong	Kong	NNP
cord-279980-49yv65gm	27	1	(	(	-LRB-
cord-279980-49yv65gm	27	2	Sims	Sims	NNP
cord-279980-49yv65gm	27	3	et	et	NNP
cord-279980-49yv65gm	27	4	al	al	NNP
cord-279980-49yv65gm	27	5	.	.	.
cord-279980-49yv65gm	28	1	,	,	,
cord-279980-49yv65gm	28	2	2005	2005	CD
cord-279980-49yv65gm	28	3	)	)	-RRB-
cord-279980-49yv65gm	28	4	.	.	.
cord-279980-49yv65gm	29	1	In	in	IN
cord-279980-49yv65gm	29	2	early	early	JJ
cord-279980-49yv65gm	29	3	2004	2004	CD
cord-279980-49yv65gm	29	4	,	,	,
cord-279980-49yv65gm	29	5	AI	AI	NNP
cord-279980-49yv65gm	29	6	H5N1	H5N1	NNP
cord-279980-49yv65gm	29	7	virus	virus	NN
cord-279980-49yv65gm	29	8	outbreaks	outbreak	NNS
cord-279980-49yv65gm	29	9	were	be	VBD
cord-279980-49yv65gm	29	10	reported	report	VBN
cord-279980-49yv65gm	29	11	in	in	IN
cord-279980-49yv65gm	29	12	several	several	JJ
cord-279980-49yv65gm	29	13	Asian	asian	JJ
cord-279980-49yv65gm	29	14	countries	country	NNS
cord-279980-49yv65gm	29	15	including	include	VBG
cord-279980-49yv65gm	29	16	Thailand	Thailand	NNP
cord-279980-49yv65gm	29	17	.	.	.
cord-279980-49yv65gm	30	1	Since	since	IN
cord-279980-49yv65gm	30	2	then	then	RB
cord-279980-49yv65gm	30	3	,	,	,
cord-279980-49yv65gm	30	4	the	the	DT
cord-279980-49yv65gm	30	5	viruses	virus	NNS
cord-279980-49yv65gm	30	6	have	have	VBP
cord-279980-49yv65gm	30	7	spread	spread	VBN
cord-279980-49yv65gm	30	8	to	to	IN
cord-279980-49yv65gm	30	9	many	many	JJ
cord-279980-49yv65gm	30	10	areas	area	NNS
cord-279980-49yv65gm	30	11	around	around	IN
cord-279980-49yv65gm	30	12	the	the	DT
cord-279980-49yv65gm	30	13	world	world	NN
cord-279980-49yv65gm	30	14	,	,	,
cord-279980-49yv65gm	30	15	causing	cause	VBG
cord-279980-49yv65gm	30	16	major	major	JJ
cord-279980-49yv65gm	30	17	economic	economic	JJ
cord-279980-49yv65gm	30	18	loss	loss	NN
cord-279980-49yv65gm	30	19	in	in	IN
cord-279980-49yv65gm	30	20	poultry	poultry	NN
cord-279980-49yv65gm	30	21	industries	industry	NNS
cord-279980-49yv65gm	30	22	(	(	-LRB-
cord-279980-49yv65gm	30	23	OIE	OIE	NNP
cord-279980-49yv65gm	30	24	,	,	,
cord-279980-49yv65gm	30	25	2008	2008	CD
cord-279980-49yv65gm	30	26	)	)	-RRB-
cord-279980-49yv65gm	30	27	.	.	.
cord-279980-49yv65gm	31	1	Moreover	moreover	RB
cord-279980-49yv65gm	31	2	,	,	,
cord-279980-49yv65gm	31	3	the	the	DT
cord-279980-49yv65gm	31	4	impact	impact	NN
cord-279980-49yv65gm	31	5	from	from	IN
cord-279980-49yv65gm	31	6	AI	AI	NNP
cord-279980-49yv65gm	31	7	H5N1	H5N1	NNP
cord-279980-49yv65gm	31	8	virus	virus	NN
cord-279980-49yv65gm	31	9	outbreaks	outbreak	NNS
cord-279980-49yv65gm	31	10	is	be	VBZ
cord-279980-49yv65gm	31	11	not	not	RB
cord-279980-49yv65gm	31	12	limited	limit	VBN
cord-279980-49yv65gm	31	13	to	to	IN
cord-279980-49yv65gm	31	14	poultry	poultry	NN
cord-279980-49yv65gm	31	15	species	specie	NNS
cord-279980-49yv65gm	31	16	as	as	IN
cord-279980-49yv65gm	31	17	the	the	DT
cord-279980-49yv65gm	31	18	virus	virus	NN
cord-279980-49yv65gm	31	19	also	also	RB
cord-279980-49yv65gm	31	20	infects	infect	VBZ
cord-279980-49yv65gm	31	21	other	other	JJ
cord-279980-49yv65gm	31	22	animals	animal	NNS
cord-279980-49yv65gm	31	23	and	and	CC
cord-279980-49yv65gm	31	24	humans	human	NNS
cord-279980-49yv65gm	31	25	.	.	.
cord-279980-49yv65gm	32	1	As	as	IN
cord-279980-49yv65gm	32	2	of	of	IN
cord-279980-49yv65gm	32	3	September	September	NNP
cord-279980-49yv65gm	32	4	2009	2009	CD
cord-279980-49yv65gm	32	5	,	,	,
cord-279980-49yv65gm	32	6	there	there	EX
cord-279980-49yv65gm	32	7	are	be	VBP
cord-279980-49yv65gm	32	8	more	more	JJR
cord-279980-49yv65gm	32	9	than	than	IN
cord-279980-49yv65gm	32	10	442	442	CD
cord-279980-49yv65gm	32	11	human	human	JJ
cord-279980-49yv65gm	32	12	cases	case	NNS
cord-279980-49yv65gm	32	13	with	with	IN
cord-279980-49yv65gm	32	14	262	262	CD
cord-279980-49yv65gm	32	15	fatal	fatal	JJ
cord-279980-49yv65gm	32	16	cases	case	NNS
cord-279980-49yv65gm	32	17	.	.	.
cord-279980-49yv65gm	33	1	This	this	DT
cord-279980-49yv65gm	33	2	leads	lead	VBZ
cord-279980-49yv65gm	33	3	to	to	IN
cord-279980-49yv65gm	33	4	a	a	DT
cord-279980-49yv65gm	33	5	serious	serious	JJ
cord-279980-49yv65gm	33	6	concern	concern	NN
cord-279980-49yv65gm	33	7	regarding	regard	VBG
cord-279980-49yv65gm	33	8	the	the	DT
cord-279980-49yv65gm	33	9	pandemic	pandemic	NN
cord-279980-49yv65gm	33	10	potential	potential	NN
cord-279980-49yv65gm	33	11	of	of	IN
cord-279980-49yv65gm	33	12	the	the	DT
cord-279980-49yv65gm	33	13	AI	AI	NNP
cord-279980-49yv65gm	33	14	H5N1	H5N1	NNP
cord-279980-49yv65gm	33	15	virus	virus	NN
cord-279980-49yv65gm	33	16	(	(	-LRB-
cord-279980-49yv65gm	33	17	WHO	who	WP
cord-279980-49yv65gm	33	18	,	,	,
cord-279980-49yv65gm	33	19	2009	2009	CD
cord-279980-49yv65gm	33	20	)	)	-RRB-
cord-279980-49yv65gm	33	21	.	.	.
cord-279980-49yv65gm	34	1	The	the	DT
cord-279980-49yv65gm	34	2	influenza	influenza	NN
cord-279980-49yv65gm	34	3	A	a	DT
cord-279980-49yv65gm	34	4	virus	virus	NN
cord-279980-49yv65gm	34	5	genome	genome	NN
cord-279980-49yv65gm	34	6	comprises	comprise	VBZ
cord-279980-49yv65gm	34	7	of	of	IN
cord-279980-49yv65gm	35	1	eight	eight	CD
cord-279980-49yv65gm	35	2	segmented	segmented	JJ
cord-279980-49yv65gm	35	3	single	single	RB
cord-279980-49yv65gm	35	4	-	-	HYPH
cord-279980-49yv65gm	35	5	stranded	strand	VBN
cord-279980-49yv65gm	35	6	negative	negative	JJ
cord-279980-49yv65gm	35	7	sense	sense	NN
cord-279980-49yv65gm	35	8	RNA	RNA	NNP
cord-279980-49yv65gm	35	9	(	(	-LRB-
cord-279980-49yv65gm	35	10	Engelhardt	Engelhardt	NNP
cord-279980-49yv65gm	35	11	&	&	CC
cord-279980-49yv65gm	35	12	Fodor	Fodor	NNP
cord-279980-49yv65gm	35	13	,	,	,
cord-279980-49yv65gm	35	14	2006	2006	CD
cord-279980-49yv65gm	35	15	)	)	-RRB-
cord-279980-49yv65gm	35	16	.	.	.
cord-279980-49yv65gm	36	1	They	-PRON-	PRP
cord-279980-49yv65gm	36	2	can	can	MD
cord-279980-49yv65gm	36	3	be	be	VB
cord-279980-49yv65gm	36	4	further	far	RBR
cord-279980-49yv65gm	36	5	sub	sub	NN
cord-279980-49yv65gm	36	6	-	-	HYPH
cord-279980-49yv65gm	36	7	typed	type	VBN
cord-279980-49yv65gm	36	8	based	base	VBN
cord-279980-49yv65gm	36	9	on	on	IN
cord-279980-49yv65gm	36	10	the	the	DT
cord-279980-49yv65gm	36	11	two	two	CD
cord-279980-49yv65gm	36	12	major	major	JJ
cord-279980-49yv65gm	36	13	antigens	antigen	NNS
cord-279980-49yv65gm	36	14	:	:	:
cord-279980-49yv65gm	36	15	haemagglutinin	haemagglutinin	NNP
cord-279980-49yv65gm	36	16	(	(	-LRB-
cord-279980-49yv65gm	36	17	HA	HA	NNP
cord-279980-49yv65gm	36	18	)	)	-RRB-
cord-279980-49yv65gm	36	19	and	and	CC
cord-279980-49yv65gm	36	20	neuraminidase	neuraminidase	NN
cord-279980-49yv65gm	36	21	(	(	-LRB-
cord-279980-49yv65gm	36	22	NA	NA	NNP
cord-279980-49yv65gm	36	23	)	)	-RRB-
cord-279980-49yv65gm	36	24	.	.	.
cord-279980-49yv65gm	37	1	To	to	IN
cord-279980-49yv65gm	37	2	date	date	NN
cord-279980-49yv65gm	37	3	,	,	,
cord-279980-49yv65gm	37	4	16	16	CD
cord-279980-49yv65gm	37	5	subtypes	subtype	NNS
cord-279980-49yv65gm	37	6	of	of	IN
cord-279980-49yv65gm	37	7	HA	HA	NNP
cord-279980-49yv65gm	37	8	(	(	-LRB-
cord-279980-49yv65gm	37	9	H1	H1	NNP
cord-279980-49yv65gm	37	10	-	-	HYPH
cord-279980-49yv65gm	37	11	16	16	CD
cord-279980-49yv65gm	37	12	)	)	-RRB-
cord-279980-49yv65gm	37	13	and	and	CC
cord-279980-49yv65gm	37	14	9	9	CD
cord-279980-49yv65gm	37	15	of	of	IN
cord-279980-49yv65gm	37	16	NA	NA	NNP
cord-279980-49yv65gm	37	17	(	(	-LRB-
cord-279980-49yv65gm	37	18	N1	N1	NNP
cord-279980-49yv65gm	37	19	-	-	HYPH
cord-279980-49yv65gm	37	20	9	9	CD
cord-279980-49yv65gm	37	21	)	)	-RRB-
cord-279980-49yv65gm	37	22	have	have	VBP
cord-279980-49yv65gm	37	23	been	be	VBN
cord-279980-49yv65gm	37	24	identified	identify	VBN
cord-279980-49yv65gm	37	25	(	(	-LRB-
cord-279980-49yv65gm	37	26	Fouchier	Fouchier	NNP
cord-279980-49yv65gm	37	27	et	et	NNP
cord-279980-49yv65gm	37	28	al	al	NNP
cord-279980-49yv65gm	37	29	.	.	NNP
cord-279980-49yv65gm	37	30	,	,	,
cord-279980-49yv65gm	37	31	2005	2005	CD
cord-279980-49yv65gm	37	32	)	)	-RRB-
cord-279980-49yv65gm	37	33	.	.	.
cord-279980-49yv65gm	38	1	In	in	IN
cord-279980-49yv65gm	38	2	general	general	JJ
cord-279980-49yv65gm	38	3	,	,	,
cord-279980-49yv65gm	38	4	viruses	virus	NNS
cord-279980-49yv65gm	38	5	of	of	IN
cord-279980-49yv65gm	38	6	all	all	DT
cord-279980-49yv65gm	38	7	HA	HA	NNP
cord-279980-49yv65gm	38	8	and	and	CC
cord-279980-49yv65gm	38	9	NA	NA	NNP
cord-279980-49yv65gm	38	10	subtypes	subtype	NNS
cord-279980-49yv65gm	38	11	are	be	VBP
cord-279980-49yv65gm	38	12	found	find	VBN
cord-279980-49yv65gm	38	13	in	in	IN
cord-279980-49yv65gm	38	14	aquatic	aquatic	JJ
cord-279980-49yv65gm	38	15	birds	bird	NNS
cord-279980-49yv65gm	38	16	.	.	.
cord-279980-49yv65gm	39	1	Among	among	IN
cord-279980-49yv65gm	39	2	the	the	DT
cord-279980-49yv65gm	39	3	16	16	CD
cord-279980-49yv65gm	39	4	HA	HA	NNP
cord-279980-49yv65gm	39	5	subtypes	subtype	NNS
cord-279980-49yv65gm	39	6	,	,	,
cord-279980-49yv65gm	39	7	only	only	RB
cord-279980-49yv65gm	39	8	H5	H5	NNP
cord-279980-49yv65gm	39	9	and	and	CC
cord-279980-49yv65gm	39	10	H7	H7	NNP
cord-279980-49yv65gm	39	11	are	be	VBP
cord-279980-49yv65gm	39	12	virulent	virulent	JJ
cord-279980-49yv65gm	39	13	in	in	IN
cord-279980-49yv65gm	39	14	poultry	poultry	NN
cord-279980-49yv65gm	39	15	(	(	-LRB-
cord-279980-49yv65gm	39	16	Alexander	Alexander	NNP
cord-279980-49yv65gm	39	17	,	,	,
cord-279980-49yv65gm	39	18	2000	2000	CD
cord-279980-49yv65gm	39	19	)	)	-RRB-
cord-279980-49yv65gm	39	20	.	.	.
cord-279980-49yv65gm	40	1	By	by	IN
cord-279980-49yv65gm	40	2	contrast	contrast	NN
cord-279980-49yv65gm	40	3	,	,	,
cord-279980-49yv65gm	40	4	only	only	RB
cord-279980-49yv65gm	40	5	three	three	CD
cord-279980-49yv65gm	40	6	HA	HA	NNP
cord-279980-49yv65gm	40	7	subtypes	subtype	NNS
cord-279980-49yv65gm	40	8	(	(	-LRB-
cord-279980-49yv65gm	40	9	H1	h1	NN
cord-279980-49yv65gm	40	10	,	,	,
cord-279980-49yv65gm	40	11	H2	H2	NNP
cord-279980-49yv65gm	40	12	and	and	CC
cord-279980-49yv65gm	40	13	H3	H3	NNP
cord-279980-49yv65gm	40	14	)	)	-RRB-
cord-279980-49yv65gm	40	15	and	and	CC
cord-279980-49yv65gm	40	16	two	two	CD
cord-279980-49yv65gm	40	17	NA	NA	NNP
cord-279980-49yv65gm	40	18	subtypes	subtype	NNS
cord-279980-49yv65gm	40	19	(	(	-LRB-
cord-279980-49yv65gm	40	20	N1	N1	NNP
cord-279980-49yv65gm	40	21	and	and	CC
cord-279980-49yv65gm	40	22	N2	N2	NNP
cord-279980-49yv65gm	40	23	)	)	-RRB-
cord-279980-49yv65gm	40	24	have	have	VBP
cord-279980-49yv65gm	40	25	commonly	commonly	RB
cord-279980-49yv65gm	40	26	been	be	VBN
cord-279980-49yv65gm	40	27	found	find	VBN
cord-279980-49yv65gm	40	28	in	in	IN
cord-279980-49yv65gm	40	29	humans	human	NNS
cord-279980-49yv65gm	40	30	.	.	.
cord-279980-49yv65gm	41	1	However	however	RB
cord-279980-49yv65gm	41	2	,	,	,
cord-279980-49yv65gm	41	3	over	over	IN
cord-279980-49yv65gm	41	4	the	the	DT
cord-279980-49yv65gm	41	5	past	past	JJ
cord-279980-49yv65gm	41	6	few	few	JJ
cord-279980-49yv65gm	41	7	years	year	NNS
cord-279980-49yv65gm	41	8	,	,	,
cord-279980-49yv65gm	41	9	several	several	JJ
cord-279980-49yv65gm	41	10	subtypes	subtype	NNS
cord-279980-49yv65gm	41	11	of	of	IN
cord-279980-49yv65gm	41	12	AI	AI	NNP
cord-279980-49yv65gm	41	13	viruses	virus	NNS
cord-279980-49yv65gm	41	14	including	include	VBG
cord-279980-49yv65gm	41	15	H5N1	H5N1	NNP
cord-279980-49yv65gm	41	16	,	,	,
cord-279980-49yv65gm	41	17	H7N7	H7N7	NNP
cord-279980-49yv65gm	41	18	,	,	,
cord-279980-49yv65gm	41	19	H7N3	H7N3	NNP
cord-279980-49yv65gm	41	20	and	and	CC
cord-279980-49yv65gm	41	21	H9N2	H9N2	NNP
cord-279980-49yv65gm	41	22	have	have	VBP
cord-279980-49yv65gm	41	23	directly	directly	RB
cord-279980-49yv65gm	41	24	crossed	cross	VBN
cord-279980-49yv65gm	41	25	the	the	DT
cord-279980-49yv65gm	41	26	species	specie	NNS
cord-279980-49yv65gm	41	27	barrier	barrier	NN
cord-279980-49yv65gm	41	28	to	to	TO
cord-279980-49yv65gm	41	29	infect	infect	VB
cord-279980-49yv65gm	41	30	humans	human	NNS
cord-279980-49yv65gm	41	31	(	(	-LRB-
cord-279980-49yv65gm	41	32	Mahy	Mahy	NNP
cord-279980-49yv65gm	41	33	&	&	CC
cord-279980-49yv65gm	41	34	Van	Van	NNP
cord-279980-49yv65gm	41	35	Regenmortel	Regenmortel	NNP
cord-279980-49yv65gm	41	36	,	,	,
cord-279980-49yv65gm	41	37	2008	2008	CD
cord-279980-49yv65gm	41	38	)	)	-RRB-
cord-279980-49yv65gm	41	39	.	.	.
cord-279980-49yv65gm	42	1	House	House	NNP
cord-279980-49yv65gm	42	2	flies	fly	VBZ
cord-279980-49yv65gm	42	3	,	,	,
cord-279980-49yv65gm	42	4	a	a	DT
cord-279980-49yv65gm	42	5	synanthropic	synanthropic	JJ
cord-279980-49yv65gm	42	6	species	specie	NNS
cord-279980-49yv65gm	42	7	,	,	,
cord-279980-49yv65gm	42	8	are	be	VBP
cord-279980-49yv65gm	42	9	commonly	commonly	RB
cord-279980-49yv65gm	42	10	found	find	VBN
cord-279980-49yv65gm	42	11	associated	associate	VBN
cord-279980-49yv65gm	42	12	with	with	IN
cord-279980-49yv65gm	42	13	humans	human	NNS
cord-279980-49yv65gm	42	14	and	and	CC
cord-279980-49yv65gm	42	15	the	the	DT
cord-279980-49yv65gm	42	16	animals	animal	NNS
cord-279980-49yv65gm	42	17	they	-PRON-	PRP
cord-279980-49yv65gm	42	18	raise	raise	VBP
cord-279980-49yv65gm	43	1	(	(	-LRB-
cord-279980-49yv65gm	43	2	Greenberg	Greenberg	NNP
cord-279980-49yv65gm	43	3	,	,	,
cord-279980-49yv65gm	43	4	1973	1973	CD
cord-279980-49yv65gm	43	5	)	)	-RRB-
cord-279980-49yv65gm	43	6	.	.	.
cord-279980-49yv65gm	44	1	Importantly	importantly	RB
cord-279980-49yv65gm	44	2	,	,	,
cord-279980-49yv65gm	44	3	house	house	NN
cord-279980-49yv65gm	44	4	flies	fly	NNS
cord-279980-49yv65gm	44	5	can	can	MD
cord-279980-49yv65gm	44	6	be	be	VB
cord-279980-49yv65gm	44	7	mechanical	mechanical	JJ
cord-279980-49yv65gm	44	8	and/or	and/or	CC
cord-279980-49yv65gm	44	9	biological	biological	JJ
cord-279980-49yv65gm	44	10	vectors	vector	NNS
cord-279980-49yv65gm	44	11	for	for	IN
cord-279980-49yv65gm	44	12	a	a	DT
cord-279980-49yv65gm	44	13	number	number	NN
cord-279980-49yv65gm	44	14	of	of	IN
cord-279980-49yv65gm	44	15	major	major	JJ
cord-279980-49yv65gm	44	16	pathogens	pathogen	NNS
cord-279980-49yv65gm	44	17	in	in	IN
cord-279980-49yv65gm	44	18	the	the	DT
cord-279980-49yv65gm	44	19	animal	animal	NN
cord-279980-49yv65gm	44	20	production	production	NN
cord-279980-49yv65gm	44	21	system	system	NN
cord-279980-49yv65gm	44	22	such	such	JJ
cord-279980-49yv65gm	44	23	as	as	IN
cord-279980-49yv65gm	44	24	Aeromonas	Aeromonas	NNP
cord-279980-49yv65gm	44	25	caviae	caviae	NN
cord-279980-49yv65gm	44	26	(	(	-LRB-
cord-279980-49yv65gm	44	27	Nayduch	Nayduch	NNP
cord-279980-49yv65gm	44	28	et	et	NNP
cord-279980-49yv65gm	44	29	al	al	NNP
cord-279980-49yv65gm	44	30	.	.	NNP
cord-279980-49yv65gm	44	31	,	,	,
cord-279980-49yv65gm	44	32	2002	2002	CD
cord-279980-49yv65gm	44	33	)	)	-RRB-
cord-279980-49yv65gm	44	34	,	,	,
cord-279980-49yv65gm	44	35	Shigella	Shigella	NNP
cord-279980-49yv65gm	44	36	spp	spp	NNS
cord-279980-49yv65gm	44	37	.	.	.
cord-279980-49yv65gm	45	1	(	(	-LRB-
cord-279980-49yv65gm	45	2	Greenberg	Greenberg	NNP
cord-279980-49yv65gm	45	3	,	,	,
cord-279980-49yv65gm	45	4	1973	1973	CD
cord-279980-49yv65gm	45	5	)	)	-RRB-
cord-279980-49yv65gm	45	6	,	,	,
cord-279980-49yv65gm	45	7	Salmonella	Salmonella	NNP
cord-279980-49yv65gm	45	8	spp	spp	NNS
cord-279980-49yv65gm	45	9	.	.	.
cord-279980-49yv65gm	46	1	(	(	-LRB-
cord-279980-49yv65gm	46	2	Holt	Holt	NNP
cord-279980-49yv65gm	46	3	et	et	NNP
cord-279980-49yv65gm	46	4	al	al	NNP
cord-279980-49yv65gm	46	5	.	.	NNP
cord-279980-49yv65gm	46	6	,	,	,
cord-279980-49yv65gm	46	7	2007	2007	CD
cord-279980-49yv65gm	46	8	)	)	-RRB-
cord-279980-49yv65gm	46	9	,	,	,
cord-279980-49yv65gm	46	10	Escherichia	Escherichia	NNP
cord-279980-49yv65gm	46	11	coli	coli	NNS
cord-279980-49yv65gm	46	12	(	(	-LRB-
cord-279980-49yv65gm	46	13	De	De	NNP
cord-279980-49yv65gm	46	14	Jesus	Jesus	NNP
cord-279980-49yv65gm	46	15	et	et	NNP
cord-279980-49yv65gm	46	16	al	al	NNP
cord-279980-49yv65gm	46	17	.	.	NNP
cord-279980-49yv65gm	46	18	,	,	,
cord-279980-49yv65gm	46	19	2004	2004	CD
cord-279980-49yv65gm	46	20	)	)	-RRB-
cord-279980-49yv65gm	46	21	,	,	,
cord-279980-49yv65gm	46	22	Vibrio	Vibrio	NNP
cord-279980-49yv65gm	46	23	cholerae	cholerae	NN
cord-279980-49yv65gm	46	24	(	(	-LRB-
cord-279980-49yv65gm	46	25	Yap	Yap	NNP
cord-279980-49yv65gm	46	26	et	et	NNP
cord-279980-49yv65gm	46	27	al	al	NNP
cord-279980-49yv65gm	46	28	.	.	NNP
cord-279980-49yv65gm	46	29	,	,	,
cord-279980-49yv65gm	46	30	2008	2008	CD
cord-279980-49yv65gm	46	31	)	)	-RRB-
cord-279980-49yv65gm	46	32	,	,	,
cord-279980-49yv65gm	46	33	Newcastle	Newcastle	NNP
cord-279980-49yv65gm	46	34	disease	disease	NN
cord-279980-49yv65gm	46	35	virus	virus	NN
cord-279980-49yv65gm	46	36	(	(	-LRB-
cord-279980-49yv65gm	46	37	NDV	NDV	NNP
cord-279980-49yv65gm	46	38	)	)	-RRB-
cord-279980-49yv65gm	47	1	(	(	-LRB-
cord-279980-49yv65gm	47	2	Watson	Watson	NNP
cord-279980-49yv65gm	47	3	et	et	NNP
cord-279980-49yv65gm	47	4	al	al	NNP
cord-279980-49yv65gm	47	5	.	.	NNP
cord-279980-49yv65gm	47	6	,	,	,
cord-279980-49yv65gm	47	7	2007	2007	CD
cord-279980-49yv65gm	47	8	)	)	-RRB-
cord-279980-49yv65gm	47	9	,	,	,
cord-279980-49yv65gm	47	10	turkey	turkey	NN
cord-279980-49yv65gm	47	11	coronavirus	coronavirus	NN
cord-279980-49yv65gm	47	12	(	(	-LRB-
cord-279980-49yv65gm	47	13	Calibeo	Calibeo	NNP
cord-279980-49yv65gm	47	14	-	-	HYPH
cord-279980-49yv65gm	47	15	Hayes	Hayes	NNP
cord-279980-49yv65gm	47	16	et	et	NNP
cord-279980-49yv65gm	47	17	al	al	NNP
cord-279980-49yv65gm	47	18	.	.	NNP
cord-279980-49yv65gm	47	19	,	,	,
cord-279980-49yv65gm	47	20	2003	2003	CD
cord-279980-49yv65gm	47	21	)	)	-RRB-
cord-279980-49yv65gm	47	22	,	,	,
cord-279980-49yv65gm	47	23	porcine	porcine	JJ
cord-279980-49yv65gm	47	24	reproductive	reproductive	JJ
cord-279980-49yv65gm	47	25	and	and	CC
cord-279980-49yv65gm	47	26	respiratory	respiratory	JJ
cord-279980-49yv65gm	47	27	syndrome	syndrome	NN
cord-279980-49yv65gm	47	28	virus	virus	NN
cord-279980-49yv65gm	48	1	(	(	-LRB-
cord-279980-49yv65gm	48	2	Otake	Otake	NNP
cord-279980-49yv65gm	48	3	et	et	NNP
cord-279980-49yv65gm	48	4	al	al	NNP
cord-279980-49yv65gm	48	5	.	.	NNP
cord-279980-49yv65gm	48	6	,	,	,
cord-279980-49yv65gm	48	7	2003	2003	CD
cord-279980-49yv65gm	48	8	)	)	-RRB-
cord-279980-49yv65gm	48	9	,	,	,
cord-279980-49yv65gm	48	10	rotavirus	rotavirus	NN
cord-279980-49yv65gm	48	11	(	(	-LRB-
cord-279980-49yv65gm	48	12	Tan	Tan	NNP
cord-279980-49yv65gm	48	13	et	et	FW
cord-279980-49yv65gm	48	14	al	al	NNP
cord-279980-49yv65gm	48	15	.	.	NNP
cord-279980-49yv65gm	48	16	,	,	,
cord-279980-49yv65gm	48	17	1997	1997	CD
cord-279980-49yv65gm	48	18	)	)	-RRB-
cord-279980-49yv65gm	48	19	,	,	,
cord-279980-49yv65gm	48	20	Microsporum	Microsporum	NNP
cord-279980-49yv65gm	48	21	canis	canis	NN
cord-279980-49yv65gm	48	22	(	(	-LRB-
cord-279980-49yv65gm	48	23	Cafarchia	Cafarchia	NNP
cord-279980-49yv65gm	48	24	et	et	NNP
cord-279980-49yv65gm	48	25	al	al	NNP
cord-279980-49yv65gm	48	26	.	.	NNP
cord-279980-49yv65gm	48	27	,	,	,
cord-279980-49yv65gm	48	28	2009	2009	CD
cord-279980-49yv65gm	48	29	)	)	-RRB-
cord-279980-49yv65gm	48	30	and	and	CC
cord-279980-49yv65gm	48	31	metazoan	metazoan	NN
cord-279980-49yv65gm	48	32	parasites	parasite	NNS
cord-279980-49yv65gm	48	33	(	(	-LRB-
cord-279980-49yv65gm	48	34	Förster	Förster	NNP
cord-279980-49yv65gm	48	35	et	et	NNP
cord-279980-49yv65gm	48	36	al	al	NNP
cord-279980-49yv65gm	48	37	.	.	NNP
cord-279980-49yv65gm	48	38	,	,	,
cord-279980-49yv65gm	48	39	2007	2007	CD
cord-279980-49yv65gm	48	40	)	)	-RRB-
cord-279980-49yv65gm	48	41	.	.	.
cord-279980-49yv65gm	49	1	House	house	NN
cord-279980-49yv65gm	49	2	flies	fly	VBZ
cord-279980-49yv65gm	49	3	transmit	transmit	VBP
cord-279980-49yv65gm	49	4	pathogens	pathogen	NNS
cord-279980-49yv65gm	49	5	via	via	IN
cord-279980-49yv65gm	49	6	mouthparts	mouthpart	NNS
cord-279980-49yv65gm	49	7	,	,	,
cord-279980-49yv65gm	49	8	vomit	vomit	NN
cord-279980-49yv65gm	49	9	droplets	droplet	NNS
cord-279980-49yv65gm	49	10	,	,	,
cord-279980-49yv65gm	49	11	faeces	faece	NNS
cord-279980-49yv65gm	49	12	and	and	CC
cord-279980-49yv65gm	49	13	their	-PRON-	PRP$
cord-279980-49yv65gm	49	14	body	body	NN
cord-279980-49yv65gm	49	15	surface	surface	NN
cord-279980-49yv65gm	49	16	(	(	-LRB-
cord-279980-49yv65gm	49	17	Greenberg	Greenberg	NNP
cord-279980-49yv65gm	49	18	,	,	,
cord-279980-49yv65gm	49	19	1973	1973	CD
cord-279980-49yv65gm	49	20	)	)	-RRB-
cord-279980-49yv65gm	49	21	.	.	.
cord-279980-49yv65gm	50	1	Their	-PRON-	PRP$
cord-279980-49yv65gm	50	2	ability	ability	NN
cord-279980-49yv65gm	50	3	to	to	TO
cord-279980-49yv65gm	50	4	disperse	disperse	VB
cord-279980-49yv65gm	50	5	contaminated	contaminated	JJ
cord-279980-49yv65gm	50	6	pathogens	pathogen	NNS
cord-279980-49yv65gm	50	7	correlates	correlate	VBZ
cord-279980-49yv65gm	50	8	with	with	IN
cord-279980-49yv65gm	50	9	the	the	DT
cord-279980-49yv65gm	50	10	flying	fly	VBG
cord-279980-49yv65gm	50	11	distance	distance	NN
cord-279980-49yv65gm	50	12	which	which	WDT
cord-279980-49yv65gm	50	13	was	be	VBD
cord-279980-49yv65gm	50	14	shown	show	VBN
cord-279980-49yv65gm	50	15	to	to	TO
cord-279980-49yv65gm	50	16	be	be	VB
cord-279980-49yv65gm	50	17	approximately	approximately	RB
cord-279980-49yv65gm	50	18	1	1	CD
cord-279980-49yv65gm	50	19	-	-	SYM
cord-279980-49yv65gm	50	20	3	3	CD
cord-279980-49yv65gm	50	21	km	km	NN
cord-279980-49yv65gm	50	22	per	per	IN
cord-279980-49yv65gm	50	23	day	day	NN
cord-279980-49yv65gm	50	24	(	(	-LRB-
cord-279980-49yv65gm	50	25	Herms	Herms	NNP
cord-279980-49yv65gm	50	26	et	et	NNP
cord-279980-49yv65gm	50	27	al	al	NNP
cord-279980-49yv65gm	50	28	.	.	NNP
cord-279980-49yv65gm	50	29	,	,	,
cord-279980-49yv65gm	50	30	1969	1969	CD
cord-279980-49yv65gm	50	31	)	)	-RRB-
cord-279980-49yv65gm	50	32	.	.	.
cord-279980-49yv65gm	51	1	Accordingly	accordingly	RB
cord-279980-49yv65gm	51	2	,	,	,
cord-279980-49yv65gm	51	3	house	house	NN
cord-279980-49yv65gm	51	4	flies	fly	NNS
cord-279980-49yv65gm	51	5	are	be	VBP
cord-279980-49yv65gm	51	6	considered	consider	VBN
cord-279980-49yv65gm	51	7	as	as	IN
cord-279980-49yv65gm	51	8	an	an	DT
cord-279980-49yv65gm	51	9	important	important	JJ
cord-279980-49yv65gm	51	10	vector	vector	NN
cord-279980-49yv65gm	51	11	for	for	IN
cord-279980-49yv65gm	51	12	spreading	spread	VBG
cord-279980-49yv65gm	51	13	disease	disease	NN
cord-279980-49yv65gm	51	14	in	in	IN
cord-279980-49yv65gm	51	15	the	the	DT
cord-279980-49yv65gm	51	16	poultry	poultry	NN
cord-279980-49yv65gm	51	17	production	production	NN
cord-279980-49yv65gm	51	18	system	system	NN
cord-279980-49yv65gm	51	19	.	.	.
cord-279980-49yv65gm	52	1	The	the	DT
cord-279980-49yv65gm	52	2	objective	objective	NN
cord-279980-49yv65gm	52	3	of	of	IN
cord-279980-49yv65gm	52	4	the	the	DT
cord-279980-49yv65gm	52	5	present	present	JJ
cord-279980-49yv65gm	52	6	study	study	NN
cord-279980-49yv65gm	52	7	was	be	VBD
cord-279980-49yv65gm	52	8	to	to	TO
cord-279980-49yv65gm	52	9	determine	determine	VB
cord-279980-49yv65gm	52	10	the	the	DT
cord-279980-49yv65gm	52	11	potential	potential	NN
cord-279980-49yv65gm	52	12	of	of	IN
cord-279980-49yv65gm	52	13	the	the	DT
cord-279980-49yv65gm	52	14	house	house	NN
cord-279980-49yv65gm	52	15	fly	fly	VB
cord-279980-49yv65gm	52	16	as	as	IN
cord-279980-49yv65gm	52	17	a	a	DT
cord-279980-49yv65gm	52	18	vector	vector	NN
cord-279980-49yv65gm	52	19	of	of	IN
cord-279980-49yv65gm	52	20	the	the	DT
cord-279980-49yv65gm	52	21	AI	AI	NNP
cord-279980-49yv65gm	52	22	H5N1	H5N1	NNP
cord-279980-49yv65gm	52	23	virus	virus	NN
cord-279980-49yv65gm	52	24	.	.	.
cord-279980-49yv65gm	53	1	The	the	DT
cord-279980-49yv65gm	53	2	highly	highly	RB
cord-279980-49yv65gm	53	3	pathogenic	pathogenic	JJ
cord-279980-49yv65gm	53	4	avian	avian	JJ
cord-279980-49yv65gm	53	5	influenza	influenza	NN
cord-279980-49yv65gm	53	6	(	(	-LRB-
cord-279980-49yv65gm	53	7	HPAI	HPAI	NNP
cord-279980-49yv65gm	53	8	)	)	-RRB-
cord-279980-49yv65gm	54	1	A	a	LS
cord-279980-49yv65gm	54	2	/	/	SYM
cord-279980-49yv65gm	54	3	Chicken/	Chicken/	NNP
cord-279980-49yv65gm	54	4	Nakorn	Nakorn	NNP
cord-279980-49yv65gm	54	5	-	-	HYPH
cord-279980-49yv65gm	54	6	Pathom	Pathom	NNP
cord-279980-49yv65gm	54	7	/	/	SYM
cord-279980-49yv65gm	54	8	Thailand	Thailand	NNP
cord-279980-49yv65gm	54	9	/	/	SYM
cord-279980-49yv65gm	54	10	CU	CU	NNP
cord-279980-49yv65gm	54	11	-	-	HYPH
cord-279980-49yv65gm	54	12	K2/04	K2/04	NNP
cord-279980-49yv65gm	54	13	(	(	-LRB-
cord-279980-49yv65gm	54	14	H5N1	H5N1	NNP
cord-279980-49yv65gm	54	15	)	)	-RRB-
cord-279980-49yv65gm	54	16	virus	virus	NN
cord-279980-49yv65gm	54	17	used	use	VBN
cord-279980-49yv65gm	54	18	in	in	IN
cord-279980-49yv65gm	54	19	the	the	DT
cord-279980-49yv65gm	54	20	present	present	JJ
cord-279980-49yv65gm	54	21	study	study	NN
cord-279980-49yv65gm	54	22	was	be	VBD
cord-279980-49yv65gm	54	23	propagated	propagate	VBN
cord-279980-49yv65gm	54	24	in	in	IN
cord-279980-49yv65gm	54	25	the	the	DT
cord-279980-49yv65gm	54	26	allantoic	allantoic	NNP
cord-279980-49yv65gm	54	27	cavity	cavity	NN
cord-279980-49yv65gm	54	28	of	of	IN
cord-279980-49yv65gm	54	29	10-dayold	10-dayold	CD
cord-279980-49yv65gm	54	30	embryonated	embryonate	VBN
cord-279980-49yv65gm	54	31	chicken	chicken	NN
cord-279980-49yv65gm	54	32	eggs	egg	NNS
cord-279980-49yv65gm	54	33	using	use	VBG
cord-279980-49yv65gm	54	34	standard	standard	JJ
cord-279980-49yv65gm	54	35	protocol	protocol	NN
cord-279980-49yv65gm	54	36	(	(	-LRB-
cord-279980-49yv65gm	54	37	OIE	OIE	NNP
cord-279980-49yv65gm	54	38	,	,	,
cord-279980-49yv65gm	54	39	2000	2000	CD
cord-279980-49yv65gm	54	40	)	)	-RRB-
cord-279980-49yv65gm	54	41	.	.	.
cord-279980-49yv65gm	55	1	Allantoic	Allantoic	NNP
cord-279980-49yv65gm	55	2	fluid	fluid	NN
cord-279980-49yv65gm	55	3	of	of	IN
cord-279980-49yv65gm	55	4	the	the	DT
cord-279980-49yv65gm	55	5	third	third	JJ
cord-279980-49yv65gm	55	6	passage	passage	NN
cord-279980-49yv65gm	55	7	of	of	IN
cord-279980-49yv65gm	55	8	viral	viral	JJ
cord-279980-49yv65gm	55	9	inoculated	inoculate	VBN
cord-279980-49yv65gm	55	10	embryonated	embryonate	VBN
cord-279980-49yv65gm	55	11	chicken	chicken	NN
cord-279980-49yv65gm	55	12	eggs	egg	NNS
cord-279980-49yv65gm	55	13	was	be	VBD
cord-279980-49yv65gm	55	14	used	use	VBN
cord-279980-49yv65gm	55	15	in	in	IN
cord-279980-49yv65gm	55	16	this	this	DT
cord-279980-49yv65gm	55	17	experiment	experiment	NN
cord-279980-49yv65gm	55	18	.	.	.
cord-279980-49yv65gm	56	1	Virus	virus	NN
cord-279980-49yv65gm	56	2	titre	titre	NN
cord-279980-49yv65gm	56	3	was	be	VBD
cord-279980-49yv65gm	56	4	determined	determine	VBN
cord-279980-49yv65gm	56	5	10	10	CD
cord-279980-49yv65gm	56	6	9.5	9.5	CD
cord-279980-49yv65gm	56	7	50	50	CD
cord-279980-49yv65gm	56	8	%	%	NN
cord-279980-49yv65gm	56	9	of	of	IN
cord-279980-49yv65gm	56	10	embryonated	embryonated	JJ
cord-279980-49yv65gm	56	11	lethal	lethal	JJ
cord-279980-49yv65gm	56	12	dose	dose	NN
cord-279980-49yv65gm	56	13	/	/	SYM
cord-279980-49yv65gm	56	14	millilitre	millilitre	NN
cord-279980-49yv65gm	56	15	(	(	-LRB-
cord-279980-49yv65gm	56	16	ELD	ELD	NNP
cord-279980-49yv65gm	56	17	50	50	CD
cord-279980-49yv65gm	56	18	/mL	/mL	.
cord-279980-49yv65gm	56	19	)	)	-RRB-
cord-279980-49yv65gm	56	20	and	and	CC
cord-279980-49yv65gm	56	21	the	the	DT
cord-279980-49yv65gm	56	22	virus	virus	NN
cord-279980-49yv65gm	56	23	was	be	VBD
cord-279980-49yv65gm	56	24	stored	store	VBN
cord-279980-49yv65gm	56	25	at	at	IN
cord-279980-49yv65gm	57	1	−80	−80	NNP
cord-279980-49yv65gm	57	2	•	•	NNP
cord-279980-49yv65gm	57	3	C	C	NNP
cord-279980-49yv65gm	57	4	until	until	IN
cord-279980-49yv65gm	57	5	used	use	VBN
cord-279980-49yv65gm	57	6	.	.	.
cord-279980-49yv65gm	58	1	House	house	NN
cord-279980-49yv65gm	58	2	flies	fly	NNS
cord-279980-49yv65gm	58	3	were	be	VBD
cord-279980-49yv65gm	58	4	obtained	obtain	VBN
cord-279980-49yv65gm	58	5	as	as	IN
cord-279980-49yv65gm	58	6	larvae	larva	NNS
cord-279980-49yv65gm	58	7	from	from	IN
cord-279980-49yv65gm	58	8	a	a	DT
cord-279980-49yv65gm	58	9	layer	layer	NN
cord-279980-49yv65gm	58	10	chicken	chicken	NN
cord-279980-49yv65gm	58	11	farm	farm	NN
cord-279980-49yv65gm	58	12	in	in	IN
cord-279980-49yv65gm	58	13	Thailand	Thailand	NNP
cord-279980-49yv65gm	58	14	(	(	-LRB-
cord-279980-49yv65gm	58	15	5.4	5.4	CD
cord-279980-49yv65gm	58	16	-	-	SYM
cord-279980-49yv65gm	58	17	20.6	20.6	CD
cord-279980-49yv65gm	58	18	•	•	NN
cord-279980-49yv65gm	58	19	N	n	CD
cord-279980-49yv65gm	58	20	and	and	CC
cord-279980-49yv65gm	58	21	97.1	97.1	CD
cord-279980-49yv65gm	58	22	-	-	SYM
cord-279980-49yv65gm	58	23	106.0	106.0	CD
cord-279980-49yv65gm	58	24	•	•	NN
cord-279980-49yv65gm	58	25	E	e	NN
cord-279980-49yv65gm	58	26	)	)	-RRB-
cord-279980-49yv65gm	58	27	.	.	.
cord-279980-49yv65gm	59	1	The	the	DT
cord-279980-49yv65gm	59	2	fly	fly	NN
cord-279980-49yv65gm	59	3	larvae	larva	NNS
cord-279980-49yv65gm	59	4	were	be	VBD
cord-279980-49yv65gm	59	5	kept	keep	VBN
cord-279980-49yv65gm	59	6	in	in	IN
cord-279980-49yv65gm	59	7	a	a	DT
cord-279980-49yv65gm	59	8	sand	sand	NN
cord-279980-49yv65gm	59	9	box	box	NN
cord-279980-49yv65gm	59	10	containing	contain	VBG
cord-279980-49yv65gm	59	11	larval	larval	JJ
cord-279980-49yv65gm	59	12	medium	medium	NN
cord-279980-49yv65gm	59	13	which	which	WDT
cord-279980-49yv65gm	59	14	comprised	comprise	VBN
cord-279980-49yv65gm	59	15	of	of	IN
cord-279980-49yv65gm	59	16	swine	swine	NN
cord-279980-49yv65gm	59	17	livers	liver	NNS
cord-279980-49yv65gm	59	18	at	at	IN
cord-279980-49yv65gm	59	19	room	room	NN
cord-279980-49yv65gm	59	20	temperature	temperature	NN
cord-279980-49yv65gm	59	21	until	until	IN
cord-279980-49yv65gm	59	22	pupation	pupation	NN
cord-279980-49yv65gm	59	23	.	.	.
cord-279980-49yv65gm	60	1	The	the	DT
cord-279980-49yv65gm	60	2	pupae	pupa	NNS
cord-279980-49yv65gm	60	3	were	be	VBD
cord-279980-49yv65gm	60	4	harvested	harvest	VBN
cord-279980-49yv65gm	60	5	and	and	CC
cord-279980-49yv65gm	60	6	stored	store	VBN
cord-279980-49yv65gm	60	7	in	in	IN
cord-279980-49yv65gm	60	8	a	a	DT
cord-279980-49yv65gm	60	9	plastic	plastic	JJ
cord-279980-49yv65gm	60	10	box	box	NN
cord-279980-49yv65gm	60	11	at	at	IN
cord-279980-49yv65gm	60	12	room	room	NN
cord-279980-49yv65gm	60	13	temperature	temperature	NN
cord-279980-49yv65gm	60	14	until	until	IN
cord-279980-49yv65gm	60	15	the	the	DT
cord-279980-49yv65gm	60	16	emergence	emergence	NN
cord-279980-49yv65gm	60	17	of	of	IN
cord-279980-49yv65gm	60	18	adults	adult	NNS
cord-279980-49yv65gm	60	19	.	.	.
cord-279980-49yv65gm	61	1	The	the	DT
cord-279980-49yv65gm	61	2	emergence	emergence	NN
cord-279980-49yv65gm	61	3	of	of	IN
cord-279980-49yv65gm	61	4	adult	adult	NN
cord-279980-49yv65gm	61	5	flies	fly	NNS
cord-279980-49yv65gm	61	6	represent	represent	VBP
cord-279980-49yv65gm	61	7	day	day	NN
cord-279980-49yv65gm	61	8	0	0	CD
cord-279980-49yv65gm	61	9	.	.	.
cord-279980-49yv65gm	62	1	Before	before	IN
cord-279980-49yv65gm	62	2	initiation	initiation	NN
cord-279980-49yv65gm	62	3	of	of	IN
cord-279980-49yv65gm	62	4	all	all	DT
cord-279980-49yv65gm	62	5	experiments	experiment	NNS
cord-279980-49yv65gm	62	6	the	the	DT
cord-279980-49yv65gm	62	7	adult	adult	NN
cord-279980-49yv65gm	62	8	stage	stage	NN
cord-279980-49yv65gm	62	9	flies	fly	NNS
cord-279980-49yv65gm	62	10	were	be	VBD
cord-279980-49yv65gm	62	11	randomly	randomly	RB
cord-279980-49yv65gm	62	12	selected	select	VBN
cord-279980-49yv65gm	62	13	and	and	CC
cord-279980-49yv65gm	62	14	confirmed	confirm	VBD
cord-279980-49yv65gm	62	15	to	to	TO
cord-279980-49yv65gm	62	16	be	be	VB
cord-279980-49yv65gm	62	17	free	free	JJ
cord-279980-49yv65gm	62	18	of	of	IN
cord-279980-49yv65gm	62	19	the	the	DT
cord-279980-49yv65gm	62	20	AI	AI	NNP
cord-279980-49yv65gm	62	21	H5N1	H5N1	NNP
cord-279980-49yv65gm	62	22	virus	virus	NN
cord-279980-49yv65gm	62	23	by	by	IN
cord-279980-49yv65gm	62	24	the	the	DT
cord-279980-49yv65gm	62	25	real	real	JJ
cord-279980-49yv65gm	62	26	-	-	HYPH
cord-279980-49yv65gm	62	27	time	time	NN
cord-279980-49yv65gm	62	28	reverse	reverse	NN
cord-279980-49yv65gm	62	29	transcription	transcription	NN
cord-279980-49yv65gm	62	30	-	-	HYPH
cord-279980-49yv65gm	62	31	polymerase	polymerase	NN
cord-279980-49yv65gm	62	32	chain	chain	NN
cord-279980-49yv65gm	62	33	reaction	reaction	NN
cord-279980-49yv65gm	62	34	(	(	-LRB-
cord-279980-49yv65gm	62	35	RRT	RRT	NNP
cord-279980-49yv65gm	62	36	-	-	HYPH
cord-279980-49yv65gm	62	37	PCR	PCR	NNP
cord-279980-49yv65gm	62	38	)	)	-RRB-
cord-279980-49yv65gm	62	39	assay	assay	NN
cord-279980-49yv65gm	62	40	using	use	VBG
cord-279980-49yv65gm	62	41	specific	specific	JJ
cord-279980-49yv65gm	62	42	primers	primer	NNS
cord-279980-49yv65gm	62	43	and	and	CC
cord-279980-49yv65gm	62	44	probes	probe	NNS
cord-279980-49yv65gm	62	45	to	to	IN
cord-279980-49yv65gm	62	46	the	the	DT
cord-279980-49yv65gm	62	47	influenza	influenza	NN
cord-279980-49yv65gm	62	48	A	a	DT
cord-279980-49yv65gm	62	49	matrix	matrix	NN
cord-279980-49yv65gm	62	50	(	(	-LRB-
cord-279980-49yv65gm	62	51	M	M	NNP
cord-279980-49yv65gm	62	52	)	)	-RRB-
cord-279980-49yv65gm	62	53	gene	gene	NN
cord-279980-49yv65gm	62	54	.	.	.
cord-279980-49yv65gm	63	1	The	the	DT
cord-279980-49yv65gm	63	2	2-day	2-day	JJ
cord-279980-49yv65gm	63	3	-	-	HYPH
cord-279980-49yv65gm	63	4	old	old	JJ
cord-279980-49yv65gm	63	5	house	house	NN
cord-279980-49yv65gm	63	6	flies	fly	NNS
cord-279980-49yv65gm	63	7	were	be	VBD
cord-279980-49yv65gm	63	8	separated	separate	VBN
cord-279980-49yv65gm	63	9	for	for	IN
cord-279980-49yv65gm	63	10	use	use	NN
cord-279980-49yv65gm	63	11	in	in	IN
cord-279980-49yv65gm	63	12	the	the	DT
cord-279980-49yv65gm	63	13	following	follow	VBG
cord-279980-49yv65gm	63	14	experiments	experiment	NNS
cord-279980-49yv65gm	63	15	.	.	.
cord-279980-49yv65gm	64	1	Three	three	CD
cord-279980-49yv65gm	64	2	experiments	experiment	NNS
cord-279980-49yv65gm	64	3	were	be	VBD
cord-279980-49yv65gm	64	4	conducted	conduct	VBN
cord-279980-49yv65gm	64	5	to	to	TO
cord-279980-49yv65gm	64	6	determine	determine	VB
cord-279980-49yv65gm	64	7	the	the	DT
cord-279980-49yv65gm	64	8	potential	potential	NN
cord-279980-49yv65gm	64	9	of	of	IN
cord-279980-49yv65gm	64	10	house	house	NN
cord-279980-49yv65gm	64	11	flies	fly	VBZ
cord-279980-49yv65gm	64	12	to	to	TO
cord-279980-49yv65gm	64	13	harbour	harbour	VB
cord-279980-49yv65gm	64	14	the	the	DT
cord-279980-49yv65gm	64	15	AI	AI	NNP
cord-279980-49yv65gm	64	16	H5N1	H5N1	NNP
cord-279980-49yv65gm	64	17	virus	virus	NN
cord-279980-49yv65gm	64	18	.	.	.
cord-279980-49yv65gm	65	1	In	in	IN
cord-279980-49yv65gm	65	2	all	all	DT
cord-279980-49yv65gm	65	3	experiments	experiment	NNS
cord-279980-49yv65gm	65	4	,	,	,
cord-279980-49yv65gm	65	5	2-day	2-day	JJ
cord-279980-49yv65gm	65	6	-	-	HYPH
cord-279980-49yv65gm	65	7	old	old	JJ
cord-279980-49yv65gm	65	8	flies	fly	NNS
cord-279980-49yv65gm	65	9	of	of	IN
cord-279980-49yv65gm	65	10	mixed	mixed	JJ
cord-279980-49yv65gm	65	11	sex	sex	NN
cord-279980-49yv65gm	65	12	were	be	VBD
cord-279980-49yv65gm	65	13	starved	starve	VBN
cord-279980-49yv65gm	65	14	for	for	IN
cord-279980-49yv65gm	65	15	12	12	CD
cord-279980-49yv65gm	65	16	h	h	NN
cord-279980-49yv65gm	65	17	before	before	IN
cord-279980-49yv65gm	65	18	use	use	NN
cord-279980-49yv65gm	65	19	.	.	.
cord-279980-49yv65gm	66	1	Experiment	experiment	NN
cord-279980-49yv65gm	66	2	1	1	CD
cord-279980-49yv65gm	66	3	.	.	.
cord-279980-49yv65gm	67	1	To	to	TO
cord-279980-49yv65gm	67	2	evaluate	evaluate	VB
cord-279980-49yv65gm	67	3	the	the	DT
cord-279980-49yv65gm	67	4	potential	potential	NN
cord-279980-49yv65gm	67	5	of	of	IN
cord-279980-49yv65gm	67	6	house	house	NN
cord-279980-49yv65gm	67	7	flies	fly	VBZ
cord-279980-49yv65gm	67	8	to	to	TO
cord-279980-49yv65gm	67	9	harbour	harbour	VB
cord-279980-49yv65gm	67	10	the	the	DT
cord-279980-49yv65gm	67	11	AI	AI	NNP
cord-279980-49yv65gm	67	12	H5N1	H5N1	NNP
cord-279980-49yv65gm	67	13	virus	virus	NN
cord-279980-49yv65gm	67	14	,	,	,
cord-279980-49yv65gm	67	15	100	100	CD
cord-279980-49yv65gm	67	16	house	house	NN
cord-279980-49yv65gm	67	17	flies	fly	NNS
cord-279980-49yv65gm	67	18	were	be	VBD
cord-279980-49yv65gm	67	19	separated	separate	VBN
cord-279980-49yv65gm	67	20	into	into	IN
cord-279980-49yv65gm	67	21	two	two	CD
cord-279980-49yv65gm	67	22	groups	group	NNS
cord-279980-49yv65gm	67	23	(	(	-LRB-
cord-279980-49yv65gm	67	24	n	n	NN
cord-279980-49yv65gm	67	25	=	=	SYM
cord-279980-49yv65gm	67	26	50	50	CD
cord-279980-49yv65gm	67	27	)	)	-RRB-
cord-279980-49yv65gm	67	28	;	;	:
cord-279980-49yv65gm	67	29	control	control	NN
cord-279980-49yv65gm	67	30	and	and	CC
cord-279980-49yv65gm	67	31	treatment	treatment	NN
cord-279980-49yv65gm	67	32	.	.	.
cord-279980-49yv65gm	68	1	The	the	DT
cord-279980-49yv65gm	68	2	treatment	treatment	NN
cord-279980-49yv65gm	68	3	group	group	NN
cord-279980-49yv65gm	68	4	was	be	VBD
cord-279980-49yv65gm	68	5	fed	feed	VBN
cord-279980-49yv65gm	68	6	with	with	IN
cord-279980-49yv65gm	68	7	a	a	DT
cord-279980-49yv65gm	68	8	virus	virus	NN
cord-279980-49yv65gm	68	9	mixture	mixture	NN
cord-279980-49yv65gm	68	10	(	(	-LRB-
cord-279980-49yv65gm	68	11	1	1	CD
cord-279980-49yv65gm	68	12	mL	ml	NN
cord-279980-49yv65gm	68	13	of	of	IN
cord-279980-49yv65gm	68	14	allantoic	allantoic	NNP
cord-279980-49yv65gm	68	15	fluid	fluid	NN
cord-279980-49yv65gm	68	16	containing	contain	VBG
cord-279980-49yv65gm	68	17	the	the	DT
cord-279980-49yv65gm	68	18	AI	AI	NNP
cord-279980-49yv65gm	68	19	H5N1	H5N1	NNP
cord-279980-49yv65gm	68	20	virus	virus	NN
cord-279980-49yv65gm	68	21	with	with	IN
cord-279980-49yv65gm	68	22	1	1	CD
cord-279980-49yv65gm	68	23	mL	ml	NN
cord-279980-49yv65gm	68	24	of	of	IN
cord-279980-49yv65gm	68	25	UHT	UHT	NNP
cord-279980-49yv65gm	68	26	(	(	-LRB-
cord-279980-49yv65gm	68	27	ultra	ultra	JJ
cord-279980-49yv65gm	68	28	high	high	JJ
cord-279980-49yv65gm	68	29	temperature	temperature	NN
cord-279980-49yv65gm	68	30	)	)	-RRB-
cord-279980-49yv65gm	68	31	processed	process	VBN
cord-279980-49yv65gm	68	32	milk	milk	NN
cord-279980-49yv65gm	68	33	mixed	mix	VBN
cord-279980-49yv65gm	68	34	with	with	IN
cord-279980-49yv65gm	68	35	10	10	CD
cord-279980-49yv65gm	68	36	%	%	NN
cord-279980-49yv65gm	68	37	sucrose	sucrose	NN
cord-279980-49yv65gm	68	38	solution	solution	NN
cord-279980-49yv65gm	68	39	)	)	-RRB-
cord-279980-49yv65gm	68	40	.	.	.
cord-279980-49yv65gm	69	1	The	the	DT
cord-279980-49yv65gm	69	2	final	final	JJ
cord-279980-49yv65gm	69	3	virus	virus	NN
cord-279980-49yv65gm	69	4	titre	titre	NN
cord-279980-49yv65gm	69	5	in	in	IN
cord-279980-49yv65gm	69	6	the	the	DT
cord-279980-49yv65gm	69	7	mixture	mixture	NN
cord-279980-49yv65gm	69	8	was	be	VBD
cord-279980-49yv65gm	69	9	1	1	CD
cord-279980-49yv65gm	69	10	×	×	CD
cord-279980-49yv65gm	69	11	10	10	CD
cord-279980-49yv65gm	69	12	9.2	9.2	CD
cord-279980-49yv65gm	69	13	ELD	ELD	NNP
cord-279980-49yv65gm	69	14	50	50	CD
cord-279980-49yv65gm	69	15	/mL.	/mL.	.
cord-279980-49yv65gm	70	1	The	the	DT
cord-279980-49yv65gm	70	2	mixture	mixture	NN
cord-279980-49yv65gm	70	3	was	be	VBD
cord-279980-49yv65gm	70	4	placed	place	VBN
cord-279980-49yv65gm	70	5	on	on	IN
cord-279980-49yv65gm	70	6	a	a	DT
cord-279980-49yv65gm	70	7	cotton	cotton	NN
cord-279980-49yv65gm	70	8	pad	pad	NN
cord-279980-49yv65gm	70	9	on	on	IN
cord-279980-49yv65gm	70	10	top	top	NN
cord-279980-49yv65gm	70	11	of	of	IN
cord-279980-49yv65gm	70	12	the	the	DT
cord-279980-49yv65gm	70	13	box	box	NN
cord-279980-49yv65gm	70	14	of	of	IN
cord-279980-49yv65gm	70	15	the	the	DT
cord-279980-49yv65gm	70	16	treatment	treatment	NN
cord-279980-49yv65gm	70	17	group	group	NN
cord-279980-49yv65gm	70	18	.	.	.
cord-279980-49yv65gm	71	1	The	the	DT
cord-279980-49yv65gm	71	2	control	control	NN
cord-279980-49yv65gm	71	3	group	group	NN
cord-279980-49yv65gm	71	4	was	be	VBD
cord-279980-49yv65gm	71	5	fed	feed	VBN
cord-279980-49yv65gm	71	6	with	with	IN
cord-279980-49yv65gm	71	7	the	the	DT
cord-279980-49yv65gm	71	8	same	same	JJ
cord-279980-49yv65gm	71	9	amount	amount	NN
cord-279980-49yv65gm	71	10	of	of	IN
cord-279980-49yv65gm	71	11	UHT	UHT	NNP
cord-279980-49yv65gm	71	12	milk	milk	NN
cord-279980-49yv65gm	71	13	mixed	mix	VBN
cord-279980-49yv65gm	71	14	with	with	IN
cord-279980-49yv65gm	71	15	10	10	CD
cord-279980-49yv65gm	71	16	%	%	NN
cord-279980-49yv65gm	71	17	sucrose	sucrose	NN
cord-279980-49yv65gm	71	18	solution	solution	NN
cord-279980-49yv65gm	71	19	without	without	IN
cord-279980-49yv65gm	71	20	the	the	DT
cord-279980-49yv65gm	71	21	virus	virus	NN
cord-279980-49yv65gm	71	22	.	.	.
cord-279980-49yv65gm	72	1	House	house	NN
cord-279980-49yv65gm	72	2	flies	fly	NNS
cord-279980-49yv65gm	72	3	were	be	VBD
cord-279980-49yv65gm	72	4	allowed	allow	VBN
cord-279980-49yv65gm	72	5	15	15	CD
cord-279980-49yv65gm	72	6	min	min	NN
cord-279980-49yv65gm	72	7	of	of	IN
cord-279980-49yv65gm	72	8	feeding	feed	VBG
cord-279980-49yv65gm	72	9	time	time	NN
cord-279980-49yv65gm	72	10	and	and	CC
cord-279980-49yv65gm	72	11	all	all	DT
cord-279980-49yv65gm	72	12	flies	fly	NNS
cord-279980-49yv65gm	72	13	were	be	VBD
cord-279980-49yv65gm	72	14	then	then	RB
cord-279980-49yv65gm	72	15	euthanized	euthanize	VBN
cord-279980-49yv65gm	72	16	with	with	IN
cord-279980-49yv65gm	72	17	dry	dry	JJ
cord-279980-49yv65gm	72	18	ice	ice	NN
cord-279980-49yv65gm	72	19	for	for	IN
cord-279980-49yv65gm	72	20	15	15	CD
cord-279980-49yv65gm	72	21	min	min	NN
cord-279980-49yv65gm	72	22	.	.	.
cord-279980-49yv65gm	73	1	Each	each	DT
cord-279980-49yv65gm	73	2	group	group	NN
cord-279980-49yv65gm	73	3	was	be	VBD
cord-279980-49yv65gm	73	4	washed	wash	VBN
cord-279980-49yv65gm	73	5	with	with	IN
cord-279980-49yv65gm	73	6	10	10	CD
cord-279980-49yv65gm	73	7	mL	ml	NN
cord-279980-49yv65gm	73	8	of	of	IN
cord-279980-49yv65gm	73	9	brain	brain	NN
cord-279980-49yv65gm	73	10	-	-	HYPH
cord-279980-49yv65gm	73	11	heart	heart	NN
cord-279980-49yv65gm	73	12	infusion	infusion	NN
cord-279980-49yv65gm	73	13	(	(	-LRB-
cord-279980-49yv65gm	73	14	BHI	BHI	NNP
cord-279980-49yv65gm	73	15	)	)	-RRB-
cord-279980-49yv65gm	73	16	broth	broth	NN
cord-279980-49yv65gm	73	17	(	(	-LRB-
cord-279980-49yv65gm	73	18	Difco	Difco	NNP
cord-279980-49yv65gm	73	19	,	,	,
cord-279980-49yv65gm	73	20	BD	BD	NNP
cord-279980-49yv65gm	73	21	Biosciences	Biosciences	NNP
cord-279980-49yv65gm	73	22	,	,	,
cord-279980-49yv65gm	73	23	Sparks	Sparks	NNP
cord-279980-49yv65gm	73	24	,	,	,
cord-279980-49yv65gm	73	25	MD	MD	NNP
cord-279980-49yv65gm	73	26	)	)	-RRB-
cord-279980-49yv65gm	73	27	by	by	IN
cord-279980-49yv65gm	73	28	vortexing	vortexe	VBG
cord-279980-49yv65gm	73	29	for	for	IN
cord-279980-49yv65gm	73	30	5	5	CD
cord-279980-49yv65gm	73	31	s.	s.	NN
cord-279980-49yv65gm	74	1	The	the	DT
cord-279980-49yv65gm	74	2	BHI	BHI	NNP
cord-279980-49yv65gm	74	3	washing	washing	NN
cord-279980-49yv65gm	74	4	fluid	fluid	NN
cord-279980-49yv65gm	74	5	(	(	-LRB-
cord-279980-49yv65gm	74	6	W1	W1	NNP
cord-279980-49yv65gm	74	7	)	)	-RRB-
cord-279980-49yv65gm	74	8	was	be	VBD
cord-279980-49yv65gm	74	9	inoculated	inoculate	VBN
cord-279980-49yv65gm	74	10	into	into	IN
cord-279980-49yv65gm	74	11	six	six	CD
cord-279980-49yv65gm	74	12	10-day	10-day	CD
cord-279980-49yv65gm	74	13	-	-	HYPH
cord-279980-49yv65gm	74	14	old	old	JJ
cord-279980-49yv65gm	74	15	embryonated	embryonate	VBN
cord-279980-49yv65gm	74	16	chicken	chicken	NN
cord-279980-49yv65gm	74	17	eggs	egg	NNS
cord-279980-49yv65gm	74	18	to	to	TO
cord-279980-49yv65gm	74	19	evaluate	evaluate	VB
cord-279980-49yv65gm	74	20	the	the	DT
cord-279980-49yv65gm	74	21	presence	presence	NN
cord-279980-49yv65gm	74	22	of	of	IN
cord-279980-49yv65gm	74	23	the	the	DT
cord-279980-49yv65gm	74	24	AI	AI	NNP
cord-279980-49yv65gm	74	25	H5N1	H5N1	NNP
cord-279980-49yv65gm	74	26	virus	virus	NN
cord-279980-49yv65gm	74	27	on	on	IN
cord-279980-49yv65gm	74	28	the	the	DT
cord-279980-49yv65gm	74	29	external	external	JJ
cord-279980-49yv65gm	74	30	surface	surface	NN
cord-279980-49yv65gm	74	31	of	of	IN
cord-279980-49yv65gm	74	32	the	the	DT
cord-279980-49yv65gm	74	33	house	house	NN
cord-279980-49yv65gm	74	34	flies	fly	VBZ
cord-279980-49yv65gm	74	35	.	.	.
cord-279980-49yv65gm	75	1	To	to	TO
cord-279980-49yv65gm	75	2	assess	assess	VB
cord-279980-49yv65gm	75	3	the	the	DT
cord-279980-49yv65gm	75	4	AI	AI	NNP
cord-279980-49yv65gm	75	5	H5N1	H5N1	NNP
cord-279980-49yv65gm	75	6	virus	virus	NN
cord-279980-49yv65gm	75	7	within	within	IN
cord-279980-49yv65gm	75	8	the	the	DT
cord-279980-49yv65gm	75	9	internal	internal	JJ
cord-279980-49yv65gm	75	10	viscera	viscera	NN
cord-279980-49yv65gm	75	11	of	of	IN
cord-279980-49yv65gm	75	12	house	house	NN
cord-279980-49yv65gm	75	13	flies	fly	NNS
cord-279980-49yv65gm	75	14	,	,	,
cord-279980-49yv65gm	75	15	the	the	DT
cord-279980-49yv65gm	75	16	previously	previously	RB
cord-279980-49yv65gm	75	17	washed	wash	VBN
cord-279980-49yv65gm	75	18	flies	fly	NNS
cord-279980-49yv65gm	75	19	were	be	VBD
cord-279980-49yv65gm	75	20	disinfected	disinfect	VBN
cord-279980-49yv65gm	75	21	by	by	IN
cord-279980-49yv65gm	75	22	immersing	immerse	VBG
cord-279980-49yv65gm	75	23	into	into	IN
cord-279980-49yv65gm	75	24	10	10	CD
cord-279980-49yv65gm	75	25	mL	ml	NN
cord-279980-49yv65gm	75	26	of	of	IN
cord-279980-49yv65gm	75	27	70	70	CD
cord-279980-49yv65gm	75	28	%	%	NN
cord-279980-49yv65gm	75	29	ethanol	ethanol	NN
cord-279980-49yv65gm	75	30	,	,	,
cord-279980-49yv65gm	75	31	vortexed	vortexe	VBN
cord-279980-49yv65gm	75	32	for	for	IN
cord-279980-49yv65gm	75	33	5	5	CD
cord-279980-49yv65gm	75	34	s	s	NNS
cord-279980-49yv65gm	75	35	and	and	CC
cord-279980-49yv65gm	75	36	rinsed	rinse	VBD
cord-279980-49yv65gm	75	37	with	with	IN
cord-279980-49yv65gm	75	38	10	10	CD
cord-279980-49yv65gm	75	39	mL	ml	NN
cord-279980-49yv65gm	75	40	of	of	IN
cord-279980-49yv65gm	75	41	BHI	BHI	NNP
cord-279980-49yv65gm	75	42	washing	washing	NN
cord-279980-49yv65gm	75	43	fluid	fluid	NN
cord-279980-49yv65gm	75	44	(	(	-LRB-
cord-279980-49yv65gm	75	45	W2	W2	NNP
cord-279980-49yv65gm	75	46	)	)	-RRB-
cord-279980-49yv65gm	75	47	.	.	.
cord-279980-49yv65gm	76	1	The	the	DT
cord-279980-49yv65gm	76	2	W2	W2	NNP
cord-279980-49yv65gm	76	3	washing	washing	NN
cord-279980-49yv65gm	76	4	fluid	fluid	NN
cord-279980-49yv65gm	76	5	was	be	VBD
cord-279980-49yv65gm	76	6	inoculated	inoculate	VBN
cord-279980-49yv65gm	76	7	into	into	IN
cord-279980-49yv65gm	76	8	six	six	CD
cord-279980-49yv65gm	76	9	10-dayold	10-dayold	CD
cord-279980-49yv65gm	76	10	embryonated	embryonate	VBN
cord-279980-49yv65gm	76	11	chicken	chicken	NN
cord-279980-49yv65gm	76	12	eggs	egg	NNS
cord-279980-49yv65gm	76	13	to	to	TO
cord-279980-49yv65gm	76	14	confirm	confirm	VB
cord-279980-49yv65gm	76	15	the	the	DT
cord-279980-49yv65gm	76	16	absence	absence	NN
cord-279980-49yv65gm	76	17	of	of	IN
cord-279980-49yv65gm	76	18	the	the	DT
cord-279980-49yv65gm	76	19	AI	AI	NNP
cord-279980-49yv65gm	76	20	H5N1	H5N1	NNP
cord-279980-49yv65gm	76	21	virus	virus	NN
cord-279980-49yv65gm	76	22	on	on	IN
cord-279980-49yv65gm	76	23	the	the	DT
cord-279980-49yv65gm	76	24	external	external	JJ
cord-279980-49yv65gm	76	25	surface	surface	NN
cord-279980-49yv65gm	76	26	of	of	IN
cord-279980-49yv65gm	76	27	house	house	NN
cord-279980-49yv65gm	76	28	flies	fly	NNS
cord-279980-49yv65gm	76	29	.	.	.
cord-279980-49yv65gm	77	1	The	the	DT
cord-279980-49yv65gm	77	2	washed	wash	VBN
cord-279980-49yv65gm	77	3	house	house	NN
cord-279980-49yv65gm	77	4	flies	fly	NNS
cord-279980-49yv65gm	77	5	were	be	VBD
cord-279980-49yv65gm	77	6	then	then	RB
cord-279980-49yv65gm	77	7	homogenized	homogenize	VBN
cord-279980-49yv65gm	77	8	with	with	IN
cord-279980-49yv65gm	77	9	900	900	CD
cord-279980-49yv65gm	77	10	μL	μL	NNS
cord-279980-49yv65gm	77	11	of	of	IN
cord-279980-49yv65gm	77	12	sterile	sterile	JJ
cord-279980-49yv65gm	77	13	BHI	BHI	NNP
cord-279980-49yv65gm	77	14	using	use	VBG
cord-279980-49yv65gm	77	15	sterile	sterile	JJ
cord-279980-49yv65gm	77	16	plastic	plastic	JJ
cord-279980-49yv65gm	77	17	pestles	pestle	NNS
cord-279980-49yv65gm	77	18	and	and	CC
cord-279980-49yv65gm	77	19	sterile	sterile	JJ
cord-279980-49yv65gm	77	20	microcentrifuge	microcentrifuge	NN
cord-279980-49yv65gm	77	21	tubes	tube	NNS
cord-279980-49yv65gm	77	22	(	(	-LRB-
cord-279980-49yv65gm	77	23	Eppendorf	Eppendorf	NNP
cord-279980-49yv65gm	77	24	South	South	NNP
cord-279980-49yv65gm	77	25	Asia	Asia	NNP
cord-279980-49yv65gm	77	26	,	,	,
cord-279980-49yv65gm	77	27	Malaysia	Malaysia	NNP
cord-279980-49yv65gm	77	28	)	)	-RRB-
cord-279980-49yv65gm	77	29	and	and	CC
cord-279980-49yv65gm	77	30	centrifuged	centrifuge	VBD
cord-279980-49yv65gm	77	31	at	at	IN
cord-279980-49yv65gm	77	32	600	600	CD
cord-279980-49yv65gm	77	33	g	g	NN
cord-279980-49yv65gm	77	34	for	for	IN
cord-279980-49yv65gm	77	35	15	15	CD
cord-279980-49yv65gm	77	36	min	min	NN
cord-279980-49yv65gm	77	37	at	at	IN
cord-279980-49yv65gm	77	38	4	4	CD
cord-279980-49yv65gm	78	1	•	•	NNP
cord-279980-49yv65gm	79	1	C.	C.	NNP
cord-279980-49yv65gm	80	1	The	the	DT
cord-279980-49yv65gm	80	2	supernatants	supernatant	NNS
cord-279980-49yv65gm	80	3	were	be	VBD
cord-279980-49yv65gm	80	4	collected	collect	VBN
cord-279980-49yv65gm	80	5	and	and	CC
cord-279980-49yv65gm	80	6	gentamicin	gentamicin	NNS
cord-279980-49yv65gm	80	7	was	be	VBD
cord-279980-49yv65gm	80	8	added	add	VBN
cord-279980-49yv65gm	80	9	to	to	IN
cord-279980-49yv65gm	80	10	a	a	DT
cord-279980-49yv65gm	80	11	final	final	JJ
cord-279980-49yv65gm	80	12	concentration	concentration	NN
cord-279980-49yv65gm	80	13	of	of	IN
cord-279980-49yv65gm	80	14	200	200	CD
cord-279980-49yv65gm	80	15	μg	μg	NN
cord-279980-49yv65gm	80	16	/	/	SYM
cord-279980-49yv65gm	80	17	mL	ml	NN
cord-279980-49yv65gm	80	18	and	and	CC
cord-279980-49yv65gm	80	19	incubated	incubate	VBD
cord-279980-49yv65gm	80	20	at	at	IN
cord-279980-49yv65gm	80	21	4	4	CD
cord-279980-49yv65gm	80	22	•	•	NN
cord-279980-49yv65gm	80	23	C	c	NN
cord-279980-49yv65gm	80	24	for	for	IN
cord-279980-49yv65gm	80	25	40	40	CD
cord-279980-49yv65gm	80	26	min	min	NN
cord-279980-49yv65gm	80	27	.	.	.
cord-279980-49yv65gm	81	1	Subsequently	subsequently	RB
cord-279980-49yv65gm	81	2	,	,	,
cord-279980-49yv65gm	81	3	virus	virus	NN
cord-279980-49yv65gm	81	4	isolation	isolation	NN
cord-279980-49yv65gm	81	5	was	be	VBD
cord-279980-49yv65gm	81	6	performed	perform	VBN
cord-279980-49yv65gm	81	7	by	by	IN
cord-279980-49yv65gm	81	8	inoculating	inoculate	VBG
cord-279980-49yv65gm	81	9	100	100	CD
cord-279980-49yv65gm	81	10	μL	μL	NNS
cord-279980-49yv65gm	81	11	of	of	IN
cord-279980-49yv65gm	81	12	the	the	DT
cord-279980-49yv65gm	81	13	supernatant	supernatant	NN
cord-279980-49yv65gm	81	14	into	into	IN
cord-279980-49yv65gm	81	15	six	six	CD
cord-279980-49yv65gm	81	16	10-day	10-day	CD
cord-279980-49yv65gm	81	17	-	-	HYPH
cord-279980-49yv65gm	81	18	old	old	JJ
cord-279980-49yv65gm	81	19	embryonated	embryonate	VBN
cord-279980-49yv65gm	81	20	chicken	chicken	NN
cord-279980-49yv65gm	81	21	eggs	egg	NNS
cord-279980-49yv65gm	81	22	.	.	.
cord-279980-49yv65gm	82	1	The	the	DT
cord-279980-49yv65gm	82	2	embryos	embryo	NNS
cord-279980-49yv65gm	82	3	were	be	VBD
cord-279980-49yv65gm	82	4	observed	observe	VBN
cord-279980-49yv65gm	82	5	twice	twice	PDT
cord-279980-49yv65gm	82	6	a	a	DT
cord-279980-49yv65gm	82	7	day	day	NN
cord-279980-49yv65gm	82	8	for	for	IN
cord-279980-49yv65gm	82	9	5	5	CD
cord-279980-49yv65gm	82	10	days	day	NNS
cord-279980-49yv65gm	82	11	post	post	NN
cord-279980-49yv65gm	82	12	-	-	NN
cord-279980-49yv65gm	82	13	inoculation	inoculation	NN
cord-279980-49yv65gm	82	14	.	.	.
cord-279980-49yv65gm	83	1	The	the	DT
cord-279980-49yv65gm	83	2	embryos	embryo	NNS
cord-279980-49yv65gm	83	3	that	that	WDT
cord-279980-49yv65gm	83	4	died	die	VBD
cord-279980-49yv65gm	83	5	within	within	IN
cord-279980-49yv65gm	83	6	24	24	CD
cord-279980-49yv65gm	83	7	h	h	NNP
cord-279980-49yv65gm	83	8	were	be	VBD
cord-279980-49yv65gm	83	9	discarded	discard	VBN
cord-279980-49yv65gm	83	10	.	.	.
cord-279980-49yv65gm	84	1	Allantoic	Allantoic	NNP
cord-279980-49yv65gm	84	2	fluid	fluid	NN
cord-279980-49yv65gm	84	3	was	be	VBD
cord-279980-49yv65gm	84	4	harvested	harvest	VBN
cord-279980-49yv65gm	84	5	from	from	IN
cord-279980-49yv65gm	84	6	eggs	egg	NNS
cord-279980-49yv65gm	84	7	and	and	CC
cord-279980-49yv65gm	84	8	AI	AI	NNP
cord-279980-49yv65gm	84	9	H5N1	H5N1	NNP
cord-279980-49yv65gm	84	10	virus	virus	NN
cord-279980-49yv65gm	84	11	identification	identification	NN
cord-279980-49yv65gm	84	12	was	be	VBD
cord-279980-49yv65gm	84	13	performed	perform	VBN
cord-279980-49yv65gm	84	14	using	use	VBG
cord-279980-49yv65gm	84	15	the	the	DT
cord-279980-49yv65gm	84	16	HA	HA	NNP
cord-279980-49yv65gm	84	17	test	test	NN
cord-279980-49yv65gm	84	18	and	and	CC
cord-279980-49yv65gm	84	19	RT	RT	NNP
cord-279980-49yv65gm	84	20	-	-	HYPH
cord-279980-49yv65gm	84	21	PCR	PCR	NNP
cord-279980-49yv65gm	84	22	assay	assay	NN
cord-279980-49yv65gm	84	23	.	.	.
cord-279980-49yv65gm	85	1	Experiment	experiment	NN
cord-279980-49yv65gm	85	2	2	2	CD
cord-279980-49yv65gm	85	3	.	.	.
cord-279980-49yv65gm	86	1	This	this	DT
cord-279980-49yv65gm	86	2	experiment	experiment	NN
cord-279980-49yv65gm	86	3	was	be	VBD
cord-279980-49yv65gm	86	4	done	do	VBN
cord-279980-49yv65gm	86	5	to	to	TO
cord-279980-49yv65gm	86	6	determine	determine	VB
cord-279980-49yv65gm	86	7	if	if	IN
cord-279980-49yv65gm	86	8	one	one	CD
cord-279980-49yv65gm	86	9	fly	fly	NN
cord-279980-49yv65gm	86	10	could	could	MD
cord-279980-49yv65gm	86	11	harbor	harbor	VB
cord-279980-49yv65gm	86	12	the	the	DT
cord-279980-49yv65gm	86	13	virus	virus	NN
cord-279980-49yv65gm	86	14	.	.	.
cord-279980-49yv65gm	87	1	Experiments	experiment	NNS
cord-279980-49yv65gm	87	2	were	be	VBD
cord-279980-49yv65gm	87	3	performed	perform	VBN
cord-279980-49yv65gm	87	4	in	in	IN
cord-279980-49yv65gm	87	5	five	five	CD
cord-279980-49yv65gm	87	6	replicates	replicate	NNS
cord-279980-49yv65gm	87	7	.	.	.
cord-279980-49yv65gm	88	1	Only	only	RB
cord-279980-49yv65gm	88	2	one	one	CD
cord-279980-49yv65gm	88	3	house	house	NN
cord-279980-49yv65gm	88	4	fly	fly	NN
cord-279980-49yv65gm	88	5	was	be	VBD
cord-279980-49yv65gm	88	6	transferred	transfer	VBN
cord-279980-49yv65gm	88	7	into	into	IN
cord-279980-49yv65gm	88	8	a	a	DT
cord-279980-49yv65gm	88	9	plastic	plastic	JJ
cord-279980-49yv65gm	88	10	box	box	NN
cord-279980-49yv65gm	88	11	and	and	CC
cord-279980-49yv65gm	88	12	exposed	expose	VBN
cord-279980-49yv65gm	88	13	to	to	IN
cord-279980-49yv65gm	88	14	the	the	DT
cord-279980-49yv65gm	88	15	mixture	mixture	NN
cord-279980-49yv65gm	88	16	containing	contain	VBG
cord-279980-49yv65gm	88	17	the	the	DT
cord-279980-49yv65gm	88	18	AI	AI	NNP
cord-279980-49yv65gm	88	19	H5N1	H5N1	NNP
cord-279980-49yv65gm	88	20	virus	virus	NN
cord-279980-49yv65gm	88	21	or	or	CC
cord-279980-49yv65gm	88	22	without	without	IN
cord-279980-49yv65gm	88	23	in	in	IN
cord-279980-49yv65gm	88	24	a	a	DT
cord-279980-49yv65gm	88	25	sterile	sterile	JJ
cord-279980-49yv65gm	88	26	cotton	cotton	NN
cord-279980-49yv65gm	88	27	pad	pad	NN
cord-279980-49yv65gm	88	28	for	for	IN
cord-279980-49yv65gm	88	29	15	15	CD
cord-279980-49yv65gm	88	30	min	min	NN
cord-279980-49yv65gm	88	31	as	as	IN
cord-279980-49yv65gm	88	32	previously	previously	RB
cord-279980-49yv65gm	88	33	described	describe	VBN
cord-279980-49yv65gm	88	34	in	in	IN
cord-279980-49yv65gm	88	35	experiment	experiment	NN
cord-279980-49yv65gm	88	36	1	1	CD
cord-279980-49yv65gm	88	37	.	.	.
cord-279980-49yv65gm	89	1	Subsequently	subsequently	RB
cord-279980-49yv65gm	89	2	,	,	,
cord-279980-49yv65gm	89	3	the	the	DT
cord-279980-49yv65gm	89	4	exposed	expose	VBN
cord-279980-49yv65gm	89	5	house	house	NN
cord-279980-49yv65gm	89	6	fly	fly	NN
cord-279980-49yv65gm	89	7	was	be	VBD
cord-279980-49yv65gm	89	8	washed	wash	VBN
cord-279980-49yv65gm	89	9	with	with	IN
cord-279980-49yv65gm	89	10	1	1	CD
cord-279980-49yv65gm	89	11	mL	ml	NN
cord-279980-49yv65gm	89	12	of	of	IN
cord-279980-49yv65gm	89	13	BHI	BHI	NNP
cord-279980-49yv65gm	89	14	as	as	IN
cord-279980-49yv65gm	89	15	W1	w1	NN
cord-279980-49yv65gm	89	16	washing	washing	NN
cord-279980-49yv65gm	89	17	fluid	fluid	NN
cord-279980-49yv65gm	89	18	.	.	.
cord-279980-49yv65gm	90	1	The	the	DT
cord-279980-49yv65gm	90	2	W1	w1	NN
cord-279980-49yv65gm	90	3	washing	washing	NN
cord-279980-49yv65gm	90	4	fluid	fluid	NN
cord-279980-49yv65gm	90	5	was	be	VBD
cord-279980-49yv65gm	90	6	titrated	titrate	VBN
cord-279980-49yv65gm	90	7	by	by	IN
cord-279980-49yv65gm	90	8	inoculation	inoculation	NN
cord-279980-49yv65gm	90	9	into	into	IN
cord-279980-49yv65gm	90	10	a	a	DT
cord-279980-49yv65gm	90	11	10-dayold	10-dayold	CD
cord-279980-49yv65gm	90	12	embryonated	embryonate	VBN
cord-279980-49yv65gm	90	13	chicken	chicken	NN
cord-279980-49yv65gm	90	14	and	and	CC
cord-279980-49yv65gm	90	15	the	the	DT
cord-279980-49yv65gm	90	16	W1	W1	NNP
cord-279980-49yv65gm	90	17	washing	washing	NN
cord-279980-49yv65gm	90	18	fluid	fluid	NN
cord-279980-49yv65gm	90	19	titre	titre	NN
cord-279980-49yv65gm	90	20	was	be	VBD
cord-279980-49yv65gm	90	21	compared	compare	VBN
cord-279980-49yv65gm	90	22	with	with	IN
cord-279980-49yv65gm	90	23	the	the	DT
cord-279980-49yv65gm	90	24	virus	virus	NN
cord-279980-49yv65gm	90	25	titre	titre	NN
cord-279980-49yv65gm	90	26	in	in	IN
cord-279980-49yv65gm	90	27	fly	fly	NN
cord-279980-49yv65gm	90	28	homogenate	homogenate	NNP
cord-279980-49yv65gm	90	29	.	.	.
cord-279980-49yv65gm	91	1	The	the	DT
cord-279980-49yv65gm	91	2	steps	step	NNS
cord-279980-49yv65gm	91	3	for	for	IN
cord-279980-49yv65gm	91	4	virus	virus	NN
cord-279980-49yv65gm	91	5	isolation	isolation	NN
cord-279980-49yv65gm	91	6	and	and	CC
cord-279980-49yv65gm	91	7	identification	identification	NN
cord-279980-49yv65gm	91	8	were	be	VBD
cord-279980-49yv65gm	91	9	performed	perform	VBN
cord-279980-49yv65gm	91	10	as	as	IN
cord-279980-49yv65gm	91	11	previously	previously	RB
cord-279980-49yv65gm	91	12	described	describe	VBN
cord-279980-49yv65gm	91	13	in	in	IN
cord-279980-49yv65gm	91	14	experiment	experiment	NN
cord-279980-49yv65gm	91	15	1	1	CD
cord-279980-49yv65gm	91	16	.	.	.
cord-279980-49yv65gm	92	1	Experiment	experiment	NN
cord-279980-49yv65gm	92	2	3	3	CD
cord-279980-49yv65gm	92	3	.	.	.
cord-279980-49yv65gm	93	1	This	this	DT
cord-279980-49yv65gm	93	2	experiment	experiment	NN
cord-279980-49yv65gm	93	3	aimed	aim	VBN
cord-279980-49yv65gm	93	4	to	to	TO
cord-279980-49yv65gm	93	5	evaluate	evaluate	VB
cord-279980-49yv65gm	93	6	the	the	DT
cord-279980-49yv65gm	93	7	correlation	correlation	NN
cord-279980-49yv65gm	93	8	between	between	IN
cord-279980-49yv65gm	93	9	the	the	DT
cord-279980-49yv65gm	93	10	time	time	NN
cord-279980-49yv65gm	93	11	period	period	NN
cord-279980-49yv65gm	93	12	after	after	IN
cord-279980-49yv65gm	93	13	exposure	exposure	NN
cord-279980-49yv65gm	93	14	and	and	CC
cord-279980-49yv65gm	93	15	AI	AI	NNP
cord-279980-49yv65gm	93	16	H5N1	H5N1	NNP
cord-279980-49yv65gm	93	17	virus	virus	NN
cord-279980-49yv65gm	93	18	viability	viability	NN
cord-279980-49yv65gm	93	19	in	in	IN
cord-279980-49yv65gm	93	20	AI	AI	NNP
cord-279980-49yv65gm	93	21	H5N1	H5N1	NNP
cord-279980-49yv65gm	93	22	exposed	expose	VBD
cord-279980-49yv65gm	93	23	house	house	NN
cord-279980-49yv65gm	93	24	flies	fly	NNS
cord-279980-49yv65gm	93	25	.	.	.
cord-279980-49yv65gm	94	1	The	the	DT
cord-279980-49yv65gm	94	2	house	house	NN
cord-279980-49yv65gm	94	3	flies	fly	NNS
cord-279980-49yv65gm	94	4	were	be	VBD
cord-279980-49yv65gm	94	5	separated	separate	VBN
cord-279980-49yv65gm	94	6	into	into	IN
cord-279980-49yv65gm	94	7	two	two	CD
cord-279980-49yv65gm	94	8	groups	group	NNS
cord-279980-49yv65gm	94	9	;	;	:
cord-279980-49yv65gm	94	10	each	each	DT
cord-279980-49yv65gm	94	11	group	group	NN
cord-279980-49yv65gm	94	12	was	be	VBD
cord-279980-49yv65gm	94	13	exposed	expose	VBN
cord-279980-49yv65gm	94	14	to	to	IN
cord-279980-49yv65gm	94	15	the	the	DT
cord-279980-49yv65gm	94	16	mixture	mixture	NN
cord-279980-49yv65gm	94	17	containing	contain	VBG
cord-279980-49yv65gm	94	18	the	the	DT
cord-279980-49yv65gm	94	19	AI	AI	NNP
cord-279980-49yv65gm	94	20	H5N1	H5N1	NNP
cord-279980-49yv65gm	94	21	virus	virus	NN
cord-279980-49yv65gm	94	22	or	or	CC
cord-279980-49yv65gm	94	23	without	without	IN
cord-279980-49yv65gm	94	24	as	as	RB
cord-279980-49yv65gm	94	25	previously	previously	RB
cord-279980-49yv65gm	94	26	described	describe	VBN
cord-279980-49yv65gm	94	27	.	.	.
cord-279980-49yv65gm	95	1	After	after	IN
cord-279980-49yv65gm	95	2	exposure	exposure	NN
cord-279980-49yv65gm	95	3	to	to	IN
cord-279980-49yv65gm	95	4	the	the	DT
cord-279980-49yv65gm	95	5	virus	virus	NN
cord-279980-49yv65gm	95	6	,	,	,
cord-279980-49yv65gm	95	7	standard	standard	JJ
cord-279980-49yv65gm	95	8	food	food	NN
cord-279980-49yv65gm	95	9	(	(	-LRB-
cord-279980-49yv65gm	95	10	UHT	UHT	NNP
cord-279980-49yv65gm	95	11	milk	milk	NN
cord-279980-49yv65gm	95	12	mixed	mix	VBN
cord-279980-49yv65gm	95	13	with	with	IN
cord-279980-49yv65gm	95	14	10	10	CD
cord-279980-49yv65gm	95	15	%	%	NN
cord-279980-49yv65gm	95	16	sucrose	sucrose	NN
cord-279980-49yv65gm	95	17	)	)	-RRB-
cord-279980-49yv65gm	95	18	was	be	VBD
cord-279980-49yv65gm	95	19	provided	provide	VBN
cord-279980-49yv65gm	95	20	for	for	IN
cord-279980-49yv65gm	95	21	all	all	DT
cord-279980-49yv65gm	95	22	groups	group	NNS
cord-279980-49yv65gm	95	23	throughout	throughout	IN
cord-279980-49yv65gm	95	24	experiment	experiment	NN
cord-279980-49yv65gm	95	25	and	and	CC
cord-279980-49yv65gm	96	1	five	five	CD
cord-279980-49yv65gm	96	2	AI	AI	NNP
cord-279980-49yv65gm	96	3	H5N1	H5N1	NNP
cord-279980-49yv65gm	96	4	exposed	expose	VBD
cord-279980-49yv65gm	96	5	house	house	NN
cord-279980-49yv65gm	96	6	flies	fly	VBZ
cord-279980-49yv65gm	96	7	from	from	IN
cord-279980-49yv65gm	96	8	each	each	DT
cord-279980-49yv65gm	96	9	group	group	NN
cord-279980-49yv65gm	96	10	were	be	VBD
cord-279980-49yv65gm	96	11	examined	examine	VBN
cord-279980-49yv65gm	96	12	for	for	IN
cord-279980-49yv65gm	96	13	the	the	DT
cord-279980-49yv65gm	96	14	presence	presence	NN
cord-279980-49yv65gm	96	15	of	of	IN
cord-279980-49yv65gm	96	16	the	the	DT
cord-279980-49yv65gm	96	17	AI	AI	NNP
cord-279980-49yv65gm	96	18	H5N1	H5N1	NNP
cord-279980-49yv65gm	96	19	virus	virus	NN
cord-279980-49yv65gm	96	20	at	at	IN
cord-279980-49yv65gm	96	21	0	0	CD
cord-279980-49yv65gm	96	22	,	,	,
cord-279980-49yv65gm	96	23	6	6	CD
cord-279980-49yv65gm	96	24	,	,	,
cord-279980-49yv65gm	96	25	12	12	CD
cord-279980-49yv65gm	96	26	,	,	,
cord-279980-49yv65gm	96	27	24	24	CD
cord-279980-49yv65gm	96	28	,	,	,
cord-279980-49yv65gm	96	29	36	36	CD
cord-279980-49yv65gm	96	30	,	,	,
cord-279980-49yv65gm	96	31	48	48	CD
cord-279980-49yv65gm	96	32	,	,	,
cord-279980-49yv65gm	96	33	72	72	CD
cord-279980-49yv65gm	96	34	and	and	CC
cord-279980-49yv65gm	96	35	96	96	CD
cord-279980-49yv65gm	96	36	h	h	NN
cord-279980-49yv65gm	96	37	postexposure	postexposure	NN
cord-279980-49yv65gm	96	38	.	.	.
cord-279980-49yv65gm	97	1	The	the	DT
cord-279980-49yv65gm	97	2	AI	AI	NNP
cord-279980-49yv65gm	97	3	H5N1-exposed	H5N1-exposed	NNP
cord-279980-49yv65gm	97	4	flies	fly	NNS
cord-279980-49yv65gm	97	5	collected	collect	VBN
cord-279980-49yv65gm	97	6	from	from	IN
cord-279980-49yv65gm	97	7	each	each	DT
cord-279980-49yv65gm	97	8	time	time	NN
cord-279980-49yv65gm	97	9	period	period	NN
cord-279980-49yv65gm	97	10	were	be	VBD
cord-279980-49yv65gm	97	11	washed	wash	VBN
cord-279980-49yv65gm	97	12	three	three	CD
cord-279980-49yv65gm	97	13	times	time	NNS
cord-279980-49yv65gm	97	14	and	and	CC
cord-279980-49yv65gm	97	15	homogenized	homogenize	VBN
cord-279980-49yv65gm	97	16	as	as	IN
cord-279980-49yv65gm	97	17	previously	previously	RB
cord-279980-49yv65gm	97	18	described	describe	VBN
cord-279980-49yv65gm	97	19	,	,	,
cord-279980-49yv65gm	97	20	to	to	TO
cord-279980-49yv65gm	97	21	determine	determine	VB
cord-279980-49yv65gm	97	22	the	the	DT
cord-279980-49yv65gm	97	23	presence	presence	NN
cord-279980-49yv65gm	97	24	of	of	IN
cord-279980-49yv65gm	97	25	AI	AI	NNP
cord-279980-49yv65gm	97	26	H5N1	H5N1	NNP
cord-279980-49yv65gm	97	27	viruses	virus	NNS
cord-279980-49yv65gm	97	28	.	.	.
cord-279980-49yv65gm	98	1	The	the	DT
cord-279980-49yv65gm	98	2	AI	AI	NNP
cord-279980-49yv65gm	98	3	H5N1	H5N1	NNP
cord-279980-49yv65gm	98	4	virus	virus	NN
cord-279980-49yv65gm	98	5	was	be	VBD
cord-279980-49yv65gm	98	6	isolated	isolate	VBN
cord-279980-49yv65gm	98	7	by	by	IN
cord-279980-49yv65gm	98	8	inoculating	inoculate	VBG
cord-279980-49yv65gm	98	9	six	six	CD
cord-279980-49yv65gm	98	10	10-dayold	10-dayold	CD
cord-279980-49yv65gm	98	11	embryonated	embryonate	VBN
cord-279980-49yv65gm	98	12	chicken	chicken	NN
cord-279980-49yv65gm	98	13	eggs	egg	NNS
cord-279980-49yv65gm	98	14	as	as	IN
cord-279980-49yv65gm	98	15	previously	previously	RB
cord-279980-49yv65gm	98	16	described	describe	VBN
cord-279980-49yv65gm	98	17	(	(	-LRB-
cord-279980-49yv65gm	98	18	OIE	OIE	NNP
cord-279980-49yv65gm	98	19	,	,	,
cord-279980-49yv65gm	98	20	2000	2000	CD
cord-279980-49yv65gm	98	21	)	)	-RRB-
cord-279980-49yv65gm	98	22	.	.	.
cord-279980-49yv65gm	99	1	Briefly	briefly	RB
cord-279980-49yv65gm	99	2	,	,	,
cord-279980-49yv65gm	99	3	100	100	CD
cord-279980-49yv65gm	99	4	μL	μL	NNS
cord-279980-49yv65gm	99	5	of	of	IN
cord-279980-49yv65gm	99	6	10-fold	10-fold	JJ
cord-279980-49yv65gm	99	7	,	,	,
cord-279980-49yv65gm	99	8	serially	serially	RB
cord-279980-49yv65gm	99	9	diluted	dilute	VBN
cord-279980-49yv65gm	99	10	supernatant	supernatant	NN
cord-279980-49yv65gm	99	11	of	of	IN
cord-279980-49yv65gm	99	12	house	house	NN
cord-279980-49yv65gm	99	13	fly	fly	NN
cord-279980-49yv65gm	99	14	homogenates	homogenate	NNS
cord-279980-49yv65gm	99	15	was	be	VBD
cord-279980-49yv65gm	99	16	inoculated	inoculate	VBN
cord-279980-49yv65gm	99	17	into	into	IN
cord-279980-49yv65gm	99	18	the	the	DT
cord-279980-49yv65gm	99	19	allantoic	allantoic	NNP
cord-279980-49yv65gm	99	20	cavity	cavity	NN
cord-279980-49yv65gm	99	21	of	of	IN
cord-279980-49yv65gm	99	22	six	six	CD
cord-279980-49yv65gm	99	23	10-day	10-day	CD
cord-279980-49yv65gm	99	24	-	-	HYPH
cord-279980-49yv65gm	99	25	old	old	JJ
cord-279980-49yv65gm	99	26	embryonated	embryonate	VBN
cord-279980-49yv65gm	99	27	chicken	chicken	NN
cord-279980-49yv65gm	99	28	eggs	egg	NNS
cord-279980-49yv65gm	99	29	.	.	.
cord-279980-49yv65gm	100	1	Embryos	embryo	NNS
cord-279980-49yv65gm	100	2	were	be	VBD
cord-279980-49yv65gm	100	3	examined	examine	VBN
cord-279980-49yv65gm	100	4	twice	twice	PDT
cord-279980-49yv65gm	100	5	a	a	DT
cord-279980-49yv65gm	100	6	day	day	NN
cord-279980-49yv65gm	100	7	for	for	IN
cord-279980-49yv65gm	100	8	5	5	CD
cord-279980-49yv65gm	100	9	days	day	NNS
cord-279980-49yv65gm	100	10	and	and	CC
cord-279980-49yv65gm	100	11	allantoic	allantoic	NNP
cord-279980-49yv65gm	100	12	fluid	fluid	NN
cord-279980-49yv65gm	100	13	was	be	VBD
cord-279980-49yv65gm	100	14	harvested	harvest	VBN
cord-279980-49yv65gm	100	15	at	at	IN
cord-279980-49yv65gm	100	16	5	5	CD
cord-279980-49yv65gm	100	17	days	day	NNS
cord-279980-49yv65gm	100	18	post	post	NN
cord-279980-49yv65gm	100	19	-	-	NN
cord-279980-49yv65gm	100	20	inoculation	inoculation	JJ
cord-279980-49yv65gm	100	21	or	or	CC
cord-279980-49yv65gm	100	22	upon	upon	IN
cord-279980-49yv65gm	100	23	embryo	embryo	NN
cord-279980-49yv65gm	100	24	death	death	NN
cord-279980-49yv65gm	100	25	.	.	.
cord-279980-49yv65gm	101	1	The	the	DT
cord-279980-49yv65gm	101	2	HA	HA	NNP
cord-279980-49yv65gm	101	3	test	test	NN
cord-279980-49yv65gm	101	4	and	and	CC
cord-279980-49yv65gm	101	5	the	the	DT
cord-279980-49yv65gm	101	6	RT	RT	NNP
cord-279980-49yv65gm	101	7	-	-	HYPH
cord-279980-49yv65gm	101	8	PCR	PCR	NNP
cord-279980-49yv65gm	101	9	assay	assay	NN
cord-279980-49yv65gm	101	10	were	be	VBD
cord-279980-49yv65gm	101	11	performed	perform	VBN
cord-279980-49yv65gm	101	12	to	to	TO
cord-279980-49yv65gm	101	13	determine	determine	VB
cord-279980-49yv65gm	101	14	the	the	DT
cord-279980-49yv65gm	101	15	presence	presence	NN
cord-279980-49yv65gm	101	16	of	of	IN
cord-279980-49yv65gm	101	17	the	the	DT
cord-279980-49yv65gm	101	18	virus	virus	NN
cord-279980-49yv65gm	101	19	.	.	.
cord-279980-49yv65gm	102	1	Virus	virus	NN
cord-279980-49yv65gm	102	2	titre	titre	NN
cord-279980-49yv65gm	102	3	was	be	VBD
cord-279980-49yv65gm	102	4	determined	determine	VBN
cord-279980-49yv65gm	102	5	according	accord	VBG
cord-279980-49yv65gm	102	6	to	to	IN
cord-279980-49yv65gm	102	7	the	the	DT
cord-279980-49yv65gm	102	8	method	method	NN
cord-279980-49yv65gm	102	9	of	of	IN
cord-279980-49yv65gm	102	10	Reed	Reed	NNP
cord-279980-49yv65gm	102	11	&	&	CC
cord-279980-49yv65gm	102	12	Muench	Muench	NNP
cord-279980-49yv65gm	102	13	(	(	-LRB-
cord-279980-49yv65gm	102	14	1938	1938	CD
cord-279980-49yv65gm	102	15	)	)	-RRB-
cord-279980-49yv65gm	102	16	.	.	.
cord-279980-49yv65gm	103	1	Allantoic	Allantoic	NNP
cord-279980-49yv65gm	103	2	fluid	fluid	NN
cord-279980-49yv65gm	103	3	was	be	VBD
cord-279980-49yv65gm	103	4	harvested	harvest	VBN
cord-279980-49yv65gm	103	5	from	from	IN
cord-279980-49yv65gm	103	6	each	each	DT
cord-279980-49yv65gm	103	7	embryonated	embryonate	VBN
cord-279980-49yv65gm	103	8	chicken	chicken	NN
cord-279980-49yv65gm	103	9	egg	egg	NN
cord-279980-49yv65gm	103	10	and	and	CC
cord-279980-49yv65gm	103	11	the	the	DT
cord-279980-49yv65gm	103	12	HA	HA	NNP
cord-279980-49yv65gm	103	13	test	test	NN
cord-279980-49yv65gm	103	14	was	be	VBD
cord-279980-49yv65gm	103	15	performed	perform	VBN
cord-279980-49yv65gm	103	16	using	use	VBG
cord-279980-49yv65gm	103	17	a	a	DT
cord-279980-49yv65gm	103	18	standard	standard	JJ
cord-279980-49yv65gm	103	19	protocol	protocol	NN
cord-279980-49yv65gm	103	20	(	(	-LRB-
cord-279980-49yv65gm	103	21	OIE	OIE	NNP
cord-279980-49yv65gm	103	22	,	,	,
cord-279980-49yv65gm	103	23	2000	2000	CD
cord-279980-49yv65gm	103	24	)	)	-RRB-
cord-279980-49yv65gm	103	25	.	.	.
cord-279980-49yv65gm	104	1	Briefly	briefly	RB
cord-279980-49yv65gm	104	2	,	,	,
cord-279980-49yv65gm	104	3	25	25	CD
cord-279980-49yv65gm	104	4	μL	μL	NNS
cord-279980-49yv65gm	104	5	of	of	IN
cord-279980-49yv65gm	104	6	phosphate	phosphate	NN
cord-279980-49yv65gm	104	7	-	-	HYPH
cord-279980-49yv65gm	104	8	buffered	buffer	VBN
cord-279980-49yv65gm	104	9	saline	saline	NN
cord-279980-49yv65gm	104	10	(	(	-LRB-
cord-279980-49yv65gm	104	11	PBS	PBS	NNP
cord-279980-49yv65gm	104	12	)	)	-RRB-
cord-279980-49yv65gm	104	13	was	be	VBD
cord-279980-49yv65gm	104	14	added	add	VBN
cord-279980-49yv65gm	104	15	into	into	IN
cord-279980-49yv65gm	104	16	a	a	DT
cord-279980-49yv65gm	104	17	96-well	96-well	CD
cord-279980-49yv65gm	104	18	,	,	,
cord-279980-49yv65gm	104	19	V	v	NN
cord-279980-49yv65gm	104	20	-	-	HYPH
cord-279980-49yv65gm	104	21	shaped	shape	VBN
cord-279980-49yv65gm	104	22	bottom	bottom	NN
cord-279980-49yv65gm	104	23	microtitre	microtitre	NNP
cord-279980-49yv65gm	104	24	plate	plate	NN
cord-279980-49yv65gm	104	25	followed	follow	VBN
cord-279980-49yv65gm	104	26	by	by	IN
cord-279980-49yv65gm	104	27	the	the	DT
cord-279980-49yv65gm	104	28	addition	addition	NN
cord-279980-49yv65gm	104	29	of	of	IN
cord-279980-49yv65gm	104	30	25	25	CD
cord-279980-49yv65gm	104	31	μL	μL	NNS
cord-279980-49yv65gm	104	32	of	of	IN
cord-279980-49yv65gm	104	33	the	the	DT
cord-279980-49yv65gm	104	34	samples	sample	NNS
cord-279980-49yv65gm	104	35	.	.	.
cord-279980-49yv65gm	105	1	The	the	DT
cord-279980-49yv65gm	105	2	solution	solution	NN
cord-279980-49yv65gm	105	3	was	be	VBD
cord-279980-49yv65gm	105	4	two	two	CD
cord-279980-49yv65gm	105	5	-	-	:
cord-279980-49yv65gm	105	6	fold	fold	VB
cord-279980-49yv65gm	105	7	serially	serially	RB
cord-279980-49yv65gm	105	8	diluted	dilute	VBN
cord-279980-49yv65gm	105	9	with	with	IN
cord-279980-49yv65gm	105	10	PBS	PBS	NNP
cord-279980-49yv65gm	105	11	.	.	.
cord-279980-49yv65gm	106	1	Twenty	twenty	CD
cord-279980-49yv65gm	106	2	-	-	HYPH
cord-279980-49yv65gm	106	3	five	five	CD
cord-279980-49yv65gm	106	4	microlitres	microlitre	NNS
cord-279980-49yv65gm	106	5	of	of	IN
cord-279980-49yv65gm	106	6	PBS	PBS	NNP
cord-279980-49yv65gm	106	7	was	be	VBD
cord-279980-49yv65gm	106	8	added	add	VBN
cord-279980-49yv65gm	106	9	into	into	IN
cord-279980-49yv65gm	106	10	all	all	DT
cord-279980-49yv65gm	106	11	wells	well	NNS
cord-279980-49yv65gm	106	12	followed	follow	VBN
cord-279980-49yv65gm	106	13	by	by	IN
cord-279980-49yv65gm	106	14	the	the	DT
cord-279980-49yv65gm	106	15	addition	addition	NN
cord-279980-49yv65gm	106	16	of	of	IN
cord-279980-49yv65gm	106	17	25	25	CD
cord-279980-49yv65gm	106	18	μL	μL	NNS
cord-279980-49yv65gm	106	19	of	of	IN
cord-279980-49yv65gm	106	20	1	1	CD
cord-279980-49yv65gm	106	21	%	%	NN
cord-279980-49yv65gm	106	22	chicken	chicken	NN
cord-279980-49yv65gm	106	23	red	red	JJ
cord-279980-49yv65gm	106	24	blood	blood	NN
cord-279980-49yv65gm	106	25	cells	cell	NNS
cord-279980-49yv65gm	106	26	(	(	-LRB-
cord-279980-49yv65gm	106	27	RBCs	rbc	NNS
cord-279980-49yv65gm	106	28	)	)	-RRB-
cord-279980-49yv65gm	106	29	in	in	IN
cord-279980-49yv65gm	106	30	PBS	PBS	NNP
cord-279980-49yv65gm	106	31	.	.	.
cord-279980-49yv65gm	107	1	The	the	DT
cord-279980-49yv65gm	107	2	microtitre	microtitre	NNP
cord-279980-49yv65gm	107	3	plate	plate	NN
cord-279980-49yv65gm	107	4	was	be	VBD
cord-279980-49yv65gm	107	5	gently	gently	RB
cord-279980-49yv65gm	107	6	tapped	tap	VBN
cord-279980-49yv65gm	107	7	and	and	CC
cord-279980-49yv65gm	107	8	RBCs	rbc	NNS
cord-279980-49yv65gm	107	9	were	be	VBD
cord-279980-49yv65gm	107	10	allowed	allow	VBN
cord-279980-49yv65gm	107	11	to	to	TO
cord-279980-49yv65gm	107	12	settle	settle	VB
cord-279980-49yv65gm	107	13	for	for	IN
cord-279980-49yv65gm	107	14	40	40	CD
cord-279980-49yv65gm	107	15	min	min	NN
cord-279980-49yv65gm	107	16	at	at	IN
cord-279980-49yv65gm	107	17	room	room	NN
cord-279980-49yv65gm	107	18	temperature	temperature	NN
cord-279980-49yv65gm	107	19	.	.	.
cord-279980-49yv65gm	108	1	The	the	DT
cord-279980-49yv65gm	108	2	AI	AI	NNP
cord-279980-49yv65gm	108	3	H5N1	H5N1	NNP
cord-279980-49yv65gm	108	4	virus	virus	NN
cord-279980-49yv65gm	108	5	was	be	VBD
cord-279980-49yv65gm	108	6	also	also	RB
cord-279980-49yv65gm	108	7	included	include	VBN
cord-279980-49yv65gm	108	8	as	as	IN
cord-279980-49yv65gm	108	9	positive	positive	JJ
cord-279980-49yv65gm	108	10	controls	control	NNS
cord-279980-49yv65gm	108	11	.	.	.
cord-279980-49yv65gm	109	1	Samples	sample	NNS
cord-279980-49yv65gm	109	2	with	with	IN
cord-279980-49yv65gm	109	3	the	the	DT
cord-279980-49yv65gm	109	4	HA	HA	NNP
cord-279980-49yv65gm	109	5	titre	titre	NN
cord-279980-49yv65gm	109	6	≥4	≥4	NNP
cord-279980-49yv65gm	109	7	were	be	VBD
cord-279980-49yv65gm	109	8	considered	consider	VBN
cord-279980-49yv65gm	109	9	positive	positive	JJ
cord-279980-49yv65gm	109	10	for	for	IN
cord-279980-49yv65gm	109	11	the	the	DT
cord-279980-49yv65gm	109	12	AI	AI	NNP
cord-279980-49yv65gm	109	13	H5N1	H5N1	NNP
cord-279980-49yv65gm	109	14	virus	virus	NN
cord-279980-49yv65gm	109	15	.	.	.
cord-279980-49yv65gm	110	1	RNA	RNA	NNP
cord-279980-49yv65gm	110	2	was	be	VBD
cord-279980-49yv65gm	110	3	extracted	extract	VBN
cord-279980-49yv65gm	110	4	from	from	IN
cord-279980-49yv65gm	110	5	the	the	DT
cord-279980-49yv65gm	110	6	supernatant	supernatant	NN
cord-279980-49yv65gm	110	7	of	of	IN
cord-279980-49yv65gm	110	8	house	house	NN
cord-279980-49yv65gm	110	9	fly	fly	VB
cord-279980-49yv65gm	110	10	homogenates	homogenate	NNS
cord-279980-49yv65gm	110	11	or	or	CC
cord-279980-49yv65gm	110	12	allantoic	allantoic	NNP
cord-279980-49yv65gm	110	13	fluid	fluid	NN
cord-279980-49yv65gm	110	14	using	use	VBG
cord-279980-49yv65gm	110	15	the	the	DT
cord-279980-49yv65gm	110	16	QIAamp	QIAamp	NNP
cord-279980-49yv65gm	110	17	Viral	Viral	NNP
cord-279980-49yv65gm	110	18	RNA	RNA	NNP
cord-279980-49yv65gm	110	19	mini	mini	NN
cord-279980-49yv65gm	110	20	kit	kit	NN
cord-279980-49yv65gm	110	21	(	(	-LRB-
cord-279980-49yv65gm	110	22	Qiagen	Qiagen	NNP
cord-279980-49yv65gm	110	23	,	,	,
cord-279980-49yv65gm	110	24	Hilden	Hilden	NNP
cord-279980-49yv65gm	110	25	,	,	,
cord-279980-49yv65gm	110	26	Germany	Germany	NNP
cord-279980-49yv65gm	110	27	)	)	-RRB-
cord-279980-49yv65gm	110	28	according	accord	VBG
cord-279980-49yv65gm	110	29	to	to	IN
cord-279980-49yv65gm	110	30	the	the	DT
cord-279980-49yv65gm	110	31	manufacturer	manufacturer	NN
cord-279980-49yv65gm	110	32	's	's	POS
cord-279980-49yv65gm	110	33	instructions	instruction	NNS
cord-279980-49yv65gm	110	34	.	.	.
cord-279980-49yv65gm	111	1	Briefly	briefly	RB
cord-279980-49yv65gm	111	2	,	,	,
cord-279980-49yv65gm	111	3	140	140	CD
cord-279980-49yv65gm	111	4	μL	μL	NNS
cord-279980-49yv65gm	111	5	of	of	IN
cord-279980-49yv65gm	111	6	sample	sample	NN
cord-279980-49yv65gm	111	7	was	be	VBD
cord-279980-49yv65gm	111	8	mixed	mix	VBN
cord-279980-49yv65gm	111	9	with	with	IN
cord-279980-49yv65gm	111	10	560	560	CD
cord-279980-49yv65gm	111	11	μL	μL	NNS
cord-279980-49yv65gm	111	12	of	of	IN
cord-279980-49yv65gm	111	13	Buffer	Buffer	NNP
cord-279980-49yv65gm	111	14	AVL	AVL	NNP
cord-279980-49yv65gm	111	15	containing	contain	VBG
cord-279980-49yv65gm	111	16	carrier	carrier	NN
cord-279980-49yv65gm	111	17	RNA	RNA	NNP
cord-279980-49yv65gm	111	18	,	,	,
cord-279980-49yv65gm	111	19	vortexed	vortexe	VBD
cord-279980-49yv65gm	111	20	for	for	IN
cord-279980-49yv65gm	111	21	15	15	CD
cord-279980-49yv65gm	111	22	s	s	NNS
cord-279980-49yv65gm	111	23	,	,	,
cord-279980-49yv65gm	111	24	and	and	CC
cord-279980-49yv65gm	111	25	incubated	incubate	VBN
cord-279980-49yv65gm	111	26	at	at	IN
cord-279980-49yv65gm	111	27	room	room	NN
cord-279980-49yv65gm	111	28	temperature	temperature	NN
cord-279980-49yv65gm	111	29	for	for	IN
cord-279980-49yv65gm	111	30	10	10	CD
cord-279980-49yv65gm	111	31	min	min	NN
cord-279980-49yv65gm	111	32	.	.	.
cord-279980-49yv65gm	112	1	Subsequently	subsequently	RB
cord-279980-49yv65gm	112	2	,	,	,
cord-279980-49yv65gm	112	3	560	560	CD
cord-279980-49yv65gm	112	4	μL	μL	NNS
cord-279980-49yv65gm	112	5	of	of	IN
cord-279980-49yv65gm	112	6	absolute	absolute	JJ
cord-279980-49yv65gm	112	7	alcohol	alcohol	NN
cord-279980-49yv65gm	112	8	was	be	VBD
cord-279980-49yv65gm	112	9	added	add	VBN
cord-279980-49yv65gm	112	10	to	to	IN
cord-279980-49yv65gm	112	11	the	the	DT
cord-279980-49yv65gm	112	12	sample	sample	NN
cord-279980-49yv65gm	112	13	.	.	.
cord-279980-49yv65gm	113	1	The	the	DT
cord-279980-49yv65gm	113	2	solution	solution	NN
cord-279980-49yv65gm	113	3	was	be	VBD
cord-279980-49yv65gm	113	4	transferred	transfer	VBN
cord-279980-49yv65gm	113	5	to	to	IN
cord-279980-49yv65gm	113	6	QIAmp	QIAmp	NNP
cord-279980-49yv65gm	113	7	Mini	Mini	NNP
cord-279980-49yv65gm	113	8	column	column	NN
cord-279980-49yv65gm	113	9	and	and	CC
cord-279980-49yv65gm	113	10	centrifuged	centrifuge	VBD
cord-279980-49yv65gm	113	11	at	at	IN
cord-279980-49yv65gm	113	12	11	11	CD
cord-279980-49yv65gm	113	13	000	000	CD
cord-279980-49yv65gm	113	14	g	g	NN
cord-279980-49yv65gm	113	15	for	for	IN
cord-279980-49yv65gm	113	16	1	1	CD
cord-279980-49yv65gm	113	17	min	min	NN
cord-279980-49yv65gm	113	18	.	.	.
cord-279980-49yv65gm	114	1	Columns	column	NNS
cord-279980-49yv65gm	114	2	were	be	VBD
cord-279980-49yv65gm	114	3	washed	wash	VBN
cord-279980-49yv65gm	114	4	twice	twice	RB
cord-279980-49yv65gm	114	5	with	with	IN
cord-279980-49yv65gm	114	6	sterile	sterile	JJ
cord-279980-49yv65gm	114	7	buffer	buffer	NN
cord-279980-49yv65gm	114	8	.	.	.
cord-279980-49yv65gm	115	1	RNA	RNA	NNP
cord-279980-49yv65gm	115	2	was	be	VBD
cord-279980-49yv65gm	115	3	eluted	elute	VBN
cord-279980-49yv65gm	115	4	with	with	IN
cord-279980-49yv65gm	115	5	50	50	CD
cord-279980-49yv65gm	115	6	μL	μL	NNS
cord-279980-49yv65gm	115	7	of	of	IN
cord-279980-49yv65gm	115	8	nuclease	nuclease	NN
cord-279980-49yv65gm	115	9	-	-	HYPH
cord-279980-49yv65gm	115	10	free	free	JJ
cord-279980-49yv65gm	115	11	water	water	NN
cord-279980-49yv65gm	115	12	.	.	.
cord-279980-49yv65gm	116	1	The	the	DT
cord-279980-49yv65gm	116	2	amount	amount	NN
cord-279980-49yv65gm	116	3	of	of	IN
cord-279980-49yv65gm	116	4	3	3	CD
cord-279980-49yv65gm	116	5	and	and	CC
cord-279980-49yv65gm	116	6	4	4	CD
cord-279980-49yv65gm	116	7	μL	μL	NNS
cord-279980-49yv65gm	116	8	of	of	IN
cord-279980-49yv65gm	116	9	the	the	DT
cord-279980-49yv65gm	116	10	RNA	RNA	NNP
cord-279980-49yv65gm	116	11	template	template	NN
cord-279980-49yv65gm	116	12	was	be	VBD
cord-279980-49yv65gm	116	13	used	use	VBN
cord-279980-49yv65gm	116	14	for	for	IN
cord-279980-49yv65gm	116	15	analysis	analysis	NN
cord-279980-49yv65gm	116	16	by	by	IN
cord-279980-49yv65gm	116	17	RT	RT	NNP
cord-279980-49yv65gm	116	18	-	-	HYPH
cord-279980-49yv65gm	116	19	PCR	PCR	NNP
cord-279980-49yv65gm	116	20	and	and	CC
cord-279980-49yv65gm	116	21	RRT	RRT	NNP
cord-279980-49yv65gm	116	22	-	-	HYPH
cord-279980-49yv65gm	116	23	PCR	PCR	NNP
cord-279980-49yv65gm	116	24	assays	assay	NNS
cord-279980-49yv65gm	116	25	,	,	,
cord-279980-49yv65gm	116	26	respectively	respectively	RB
cord-279980-49yv65gm	116	27	.	.	.
cord-279980-49yv65gm	117	1	The	the	DT
cord-279980-49yv65gm	117	2	presence	presence	NN
cord-279980-49yv65gm	117	3	of	of	IN
cord-279980-49yv65gm	117	4	the	the	DT
cord-279980-49yv65gm	117	5	HPAI	HPAI	NNP
cord-279980-49yv65gm	117	6	H5N1	H5N1	NNP
cord-279980-49yv65gm	117	7	virus	virus	NN
cord-279980-49yv65gm	117	8	in	in	IN
cord-279980-49yv65gm	117	9	the	the	DT
cord-279980-49yv65gm	117	10	allantoic	allantoic	NNP
cord-279980-49yv65gm	117	11	fluids	fluid	NNS
cord-279980-49yv65gm	117	12	was	be	VBD
cord-279980-49yv65gm	117	13	determined	determine	VBN
cord-279980-49yv65gm	117	14	using	use	VBG
cord-279980-49yv65gm	117	15	the	the	DT
cord-279980-49yv65gm	117	16	RT	RT	NNP
cord-279980-49yv65gm	117	17	-	-	HYPH
cord-279980-49yv65gm	117	18	PCR	PCR	NNP
cord-279980-49yv65gm	117	19	assay	assay	NN
cord-279980-49yv65gm	117	20	,	,	,
cord-279980-49yv65gm	117	21	as	as	IN
cord-279980-49yv65gm	117	22	previously	previously	RB
cord-279980-49yv65gm	117	23	described	describe	VBN
cord-279980-49yv65gm	117	24	(	(	-LRB-
cord-279980-49yv65gm	117	25	Payungporn	Payungporn	NNP
cord-279980-49yv65gm	117	26	et	et	FW
cord-279980-49yv65gm	117	27	al	al	NNP
cord-279980-49yv65gm	117	28	.	.	NNP
cord-279980-49yv65gm	117	29	,	,	,
cord-279980-49yv65gm	117	30	2006	2006	CD
cord-279980-49yv65gm	117	31	)	)	-RRB-
cord-279980-49yv65gm	117	32	,	,	,
cord-279980-49yv65gm	117	33	using	use	VBG
cord-279980-49yv65gm	117	34	the	the	DT
cord-279980-49yv65gm	117	35	M	M	NNP
cord-279980-49yv65gm	117	36	-	-	HYPH
cord-279980-49yv65gm	117	37	specific	specific	JJ
cord-279980-49yv65gm	117	38	primer	primer	NN
cord-279980-49yv65gm	117	39	set	set	NN
cord-279980-49yv65gm	117	40	,	,	,
cord-279980-49yv65gm	117	41	MF	MF	NNP
cord-279980-49yv65gm	117	42	5	5	CD
cord-279980-49yv65gm	117	43	-TGATCTTCTTGAAAATTTGCAG-3	-TGATCTTCTTGAAAATTTGCAG-3	NNP
cord-279980-49yv65gm	117	44	and	and	CC
cord-279980-49yv65gm	117	45	MR	MR	NNP
cord-279980-49yv65gm	117	46	5	5	CD
cord-279980-49yv65gm	117	47	-TGTTGACAAAATGACCATCG-3	-TGTTGACAAAATGACCATCG-3	NNP
cord-279980-49yv65gm	117	48	.	.	.
cord-279980-49yv65gm	118	1	RT	RT	NNP
cord-279980-49yv65gm	118	2	-	-	HYPH
cord-279980-49yv65gm	118	3	PCR	PCR	NNP
cord-279980-49yv65gm	118	4	reactions	reaction	NNS
cord-279980-49yv65gm	118	5	were	be	VBD
cord-279980-49yv65gm	118	6	performed	perform	VBN
cord-279980-49yv65gm	118	7	using	use	VBG
cord-279980-49yv65gm	118	8	the	the	DT
cord-279980-49yv65gm	118	9	AccessQuick	AccessQuick	NNP
cord-279980-49yv65gm	118	10	™	™	HYPH
cord-279980-49yv65gm	118	11	RT	RT	NNP
cord-279980-49yv65gm	118	12	-	-	HYPH
cord-279980-49yv65gm	118	13	PCR	PCR	NNP
cord-279980-49yv65gm	118	14	system	system	NN
cord-279980-49yv65gm	118	15	(	(	-LRB-
cord-279980-49yv65gm	118	16	Promega	Promega	NNP
cord-279980-49yv65gm	118	17	,	,	,
cord-279980-49yv65gm	118	18	Madison	Madison	NNP
cord-279980-49yv65gm	118	19	,	,	,
cord-279980-49yv65gm	118	20	WI	WI	NNP
cord-279980-49yv65gm	118	21	,	,	,
cord-279980-49yv65gm	118	22	USA	USA	NNP
cord-279980-49yv65gm	118	23	)	)	-RRB-
cord-279980-49yv65gm	118	24	according	accord	VBG
cord-279980-49yv65gm	118	25	to	to	IN
cord-279980-49yv65gm	118	26	the	the	DT
cord-279980-49yv65gm	118	27	manufacturer	manufacturer	NN
cord-279980-49yv65gm	118	28	's	's	POS
cord-279980-49yv65gm	118	29	protocol	protocol	NN
cord-279980-49yv65gm	118	30	.	.	.
cord-279980-49yv65gm	119	1	RT	RT	NNP
cord-279980-49yv65gm	119	2	-	-	HYPH
cord-279980-49yv65gm	119	3	PCR	PCR	NNP
cord-279980-49yv65gm	119	4	condition	condition	NN
cord-279980-49yv65gm	119	5	consisted	consist	VBD
cord-279980-49yv65gm	119	6	of	of	IN
cord-279980-49yv65gm	119	7	a	a	DT
cord-279980-49yv65gm	119	8	reverse	reverse	JJ
cord-279980-49yv65gm	119	9	transcription	transcription	NN
cord-279980-49yv65gm	119	10	step	step	NN
cord-279980-49yv65gm	119	11	for	for	IN
cord-279980-49yv65gm	119	12	15	15	CD
cord-279980-49yv65gm	119	13	min	min	NN
cord-279980-49yv65gm	119	14	at	at	IN
cord-279980-49yv65gm	119	15	48	48	CD
cord-279980-49yv65gm	119	16	•	•	NNP
cord-279980-49yv65gm	119	17	C	C	NNP
cord-279980-49yv65gm	119	18	,	,	,
cord-279980-49yv65gm	119	19	an	an	DT
cord-279980-49yv65gm	119	20	initial	initial	JJ
cord-279980-49yv65gm	119	21	denaturation	denaturation	NN
cord-279980-49yv65gm	119	22	step	step	NN
cord-279980-49yv65gm	119	23	for	for	IN
cord-279980-49yv65gm	119	24	2	2	CD
cord-279980-49yv65gm	119	25	min	min	NN
cord-279980-49yv65gm	119	26	at	at	IN
cord-279980-49yv65gm	119	27	95	95	CD
cord-279980-49yv65gm	119	28	•	•	NN
cord-279980-49yv65gm	119	29	C	c	NN
cord-279980-49yv65gm	119	30	,	,	,
cord-279980-49yv65gm	119	31	an	an	DT
cord-279980-49yv65gm	119	32	amplification	amplification	NN
cord-279980-49yv65gm	119	33	step	step	NN
cord-279980-49yv65gm	119	34	for	for	IN
cord-279980-49yv65gm	119	35	40	40	CD
cord-279980-49yv65gm	119	36	cycles	cycle	NNS
cord-279980-49yv65gm	119	37	(	(	-LRB-
cord-279980-49yv65gm	119	38	30	30	CD
cord-279980-49yv65gm	119	39	s	s	NN
cord-279980-49yv65gm	119	40	at	at	IN
cord-279980-49yv65gm	119	41	94	94	CD
cord-279980-49yv65gm	120	1	•	•	NNP
cord-279980-49yv65gm	120	2	C	C	NNP
cord-279980-49yv65gm	120	3	,	,	,
cord-279980-49yv65gm	120	4	30	30	CD
cord-279980-49yv65gm	120	5	s	s	NN
cord-279980-49yv65gm	120	6	at	at	IN
cord-279980-49yv65gm	120	7	55	55	CD
cord-279980-49yv65gm	121	1	•	•	NNP
cord-279980-49yv65gm	121	2	C	C	NNP
cord-279980-49yv65gm	121	3	and	and	CC
cord-279980-49yv65gm	121	4	30	30	CD
cord-279980-49yv65gm	121	5	s	s	NN
cord-279980-49yv65gm	121	6	at	at	IN
cord-279980-49yv65gm	121	7	72	72	CD
cord-279980-49yv65gm	121	8	•	•	NN
cord-279980-49yv65gm	121	9	C	C	NNP
cord-279980-49yv65gm	121	10	)	)	-RRB-
cord-279980-49yv65gm	121	11	and	and	CC
cord-279980-49yv65gm	121	12	a	a	DT
cord-279980-49yv65gm	121	13	final	final	JJ
cord-279980-49yv65gm	121	14	extension	extension	NN
cord-279980-49yv65gm	121	15	step	step	NN
cord-279980-49yv65gm	121	16	for	for	IN
cord-279980-49yv65gm	121	17	10	10	CD
cord-279980-49yv65gm	121	18	min	min	NN
cord-279980-49yv65gm	121	19	at	at	IN
cord-279980-49yv65gm	121	20	72	72	CD
cord-279980-49yv65gm	122	1	•	•	NNP
cord-279980-49yv65gm	122	2	C.	C.	NNP
cord-279980-49yv65gm	123	1	The	the	DT
cord-279980-49yv65gm	123	2	PCR	PCR	NNP
cord-279980-49yv65gm	123	3	product	product	NN
cord-279980-49yv65gm	123	4	was	be	VBD
cord-279980-49yv65gm	123	5	analysed	analyse	VBN
cord-279980-49yv65gm	123	6	by	by	IN
cord-279980-49yv65gm	123	7	agarose	agarose	JJ
cord-279980-49yv65gm	123	8	gel	gel	NN
cord-279980-49yv65gm	123	9	electrophoresis	electrophoresis	NN
cord-279980-49yv65gm	123	10	.	.	.
cord-279980-49yv65gm	124	1	The	the	DT
cord-279980-49yv65gm	124	2	expected	expect	VBN
cord-279980-49yv65gm	124	3	PCR	PCR	NNP
cord-279980-49yv65gm	124	4	product	product	NN
cord-279980-49yv65gm	124	5	size	size	NN
cord-279980-49yv65gm	124	6	of	of	IN
cord-279980-49yv65gm	124	7	the	the	DT
cord-279980-49yv65gm	124	8	M	M	NNP
cord-279980-49yv65gm	124	9	gene	gene	NN
cord-279980-49yv65gm	124	10	was	be	VBD
cord-279980-49yv65gm	124	11	276	276	CD
cord-279980-49yv65gm	124	12	bp	bp	NNP
cord-279980-49yv65gm	124	13	.	.	.
cord-279980-49yv65gm	125	1	The	the	DT
cord-279980-49yv65gm	125	2	allantoic	allantoic	NNP
cord-279980-49yv65gm	125	3	fluid	fluid	NN
cord-279980-49yv65gm	125	4	from	from	IN
cord-279980-49yv65gm	125	5	non	non	JJ
cord-279980-49yv65gm	125	6	-	-	JJ
cord-279980-49yv65gm	125	7	exposed	exposed	JJ
cord-279980-49yv65gm	125	8	AI	AI	NNP
cord-279980-49yv65gm	125	9	H5N1	H5N1	NNP
cord-279980-49yv65gm	125	10	house	house	NN
cord-279980-49yv65gm	125	11	flies	fly	VBZ
cord-279980-49yv65gm	125	12	inoculated	inoculate	VBD
cord-279980-49yv65gm	125	13	embryonated	embryonated	JJ
cord-279980-49yv65gm	125	14	chicken	chicken	NN
cord-279980-49yv65gm	125	15	eggs	egg	NNS
cord-279980-49yv65gm	125	16	and	and	CC
cord-279980-49yv65gm	125	17	the	the	DT
cord-279980-49yv65gm	125	18	allantoic	allantoic	NNP
cord-279980-49yv65gm	125	19	fluid	fluid	NN
cord-279980-49yv65gm	125	20	of	of	IN
cord-279980-49yv65gm	125	21	AI	AI	NNP
cord-279980-49yv65gm	125	22	H5N1	H5N1	NNP
cord-279980-49yv65gm	125	23	stock	stock	NN
cord-279980-49yv65gm	125	24	virus	virus	NN
cord-279980-49yv65gm	125	25	were	be	VBD
cord-279980-49yv65gm	125	26	used	use	VBN
cord-279980-49yv65gm	125	27	as	as	IN
cord-279980-49yv65gm	125	28	the	the	DT
cord-279980-49yv65gm	125	29	negative	negative	JJ
cord-279980-49yv65gm	125	30	and	and	CC
cord-279980-49yv65gm	125	31	positive	positive	JJ
cord-279980-49yv65gm	125	32	controls	control	NNS
cord-279980-49yv65gm	125	33	of	of	IN
cord-279980-49yv65gm	125	34	this	this	DT
cord-279980-49yv65gm	125	35	assay	assay	NN
cord-279980-49yv65gm	125	36	,	,	,
cord-279980-49yv65gm	125	37	respectively	respectively	RB
cord-279980-49yv65gm	125	38	.	.	.
cord-279980-49yv65gm	126	1	The	the	DT
cord-279980-49yv65gm	126	2	RRT	RRT	NNP
cord-279980-49yv65gm	126	3	-	-	HYPH
cord-279980-49yv65gm	126	4	PCR	pcr	NN
cord-279980-49yv65gm	126	5	assay	assay	NN
cord-279980-49yv65gm	126	6	for	for	IN
cord-279980-49yv65gm	126	7	M	M	NNP
cord-279980-49yv65gm	126	8	gene	gene	NN
cord-279980-49yv65gm	126	9	detection	detection	NN
cord-279980-49yv65gm	126	10	,	,	,
cord-279980-49yv65gm	126	11	modified	modify	VBN
cord-279980-49yv65gm	126	12	from	from	IN
cord-279980-49yv65gm	126	13	Spackman	Spackman	NNP
cord-279980-49yv65gm	126	14	et	et	NNP
cord-279980-49yv65gm	126	15	al	al	NNP
cord-279980-49yv65gm	126	16	.	.	.
cord-279980-49yv65gm	127	1	(	(	-LRB-
cord-279980-49yv65gm	127	2	2002	2002	CD
cord-279980-49yv65gm	127	3	)	)	-RRB-
cord-279980-49yv65gm	127	4	,	,	,
cord-279980-49yv65gm	127	5	was	be	VBD
cord-279980-49yv65gm	127	6	performed	perform	VBN
cord-279980-49yv65gm	127	7	using	use	VBG
cord-279980-49yv65gm	127	8	the	the	DT
cord-279980-49yv65gm	127	9	SuperScript	SuperScript	NNP
cord-279980-49yv65gm	127	10	III	III	NNP
cord-279980-49yv65gm	127	11	Platinum	Platinum	NNP
cord-279980-49yv65gm	127	12	One	one	CD
cord-279980-49yv65gm	127	13	-	-	HYPH
cord-279980-49yv65gm	127	14	step	step	NN
cord-279980-49yv65gm	127	15	RT	RT	NNP
cord-279980-49yv65gm	127	16	-	-	HYPH
cord-279980-49yv65gm	127	17	PCR	PCR	NNP
cord-279980-49yv65gm	127	18	system	system	NN
cord-279980-49yv65gm	127	19	(	(	-LRB-
cord-279980-49yv65gm	127	20	Invitrogen	Invitrogen	NNP
cord-279980-49yv65gm	127	21	,	,	,
cord-279980-49yv65gm	127	22	Carlsbad	Carlsbad	NNP
cord-279980-49yv65gm	127	23	,	,	,
cord-279980-49yv65gm	127	24	CA	CA	NNP
cord-279980-49yv65gm	127	25	,	,	,
cord-279980-49yv65gm	127	26	USA	USA	NNP
cord-279980-49yv65gm	127	27	)	)	-RRB-
cord-279980-49yv65gm	127	28	.	.	.
cord-279980-49yv65gm	128	1	The	the	DT
cord-279980-49yv65gm	128	2	forward	forward	JJ
cord-279980-49yv65gm	128	3	primer	primer	NN
cord-279980-49yv65gm	128	4	MF25	MF25	NNP
cord-279980-49yv65gm	128	5	(	(	-LRB-
cord-279980-49yv65gm	128	6	5	5	CD
cord-279980-49yv65gm	128	7	-AGATGA	-agatga	CD
cord-279980-49yv65gm	128	8	GTCTTCTAACCGAGGTCG-3	GTCTTCTAACCGAGGTCG-3	NNP
cord-279980-49yv65gm	128	9	)	)	-RRB-
cord-279980-49yv65gm	128	10	,	,	,
cord-279980-49yv65gm	128	11	reverse	reverse	VB
cord-279980-49yv65gm	128	12	primer	primer	NN
cord-279980-49yv65gm	128	13	MR124	mr124	NN
cord-279980-49yv65gm	128	14	(	(	-LRB-
cord-279980-49yv65gm	128	15	5	5	CD
cord-279980-49yv65gm	128	16	-TGCAAAAACATCTTCAAGTCTCTG-3	-TGCAAAAACATCTTCAAGTCTCTG-3	NNP
cord-279980-49yv65gm	128	17	)	)	-RRB-
cord-279980-49yv65gm	128	18	and	and	CC
cord-279980-49yv65gm	128	19	probe	probe	VB
cord-279980-49yv65gm	128	20	M64	M64	NNP
cord-279980-49yv65gm	128	21	(	(	-LRB-
cord-279980-49yv65gm	128	22	FAM	FAM	NNP
cord-279980-49yv65gm	128	23	-	-	HYPH
cord-279980-49yv65gm	128	24	TCAGGCCCCCTCAAAGCCGA	TCAGGCCCCCTCAAAGCCGA	NNP
cord-279980-49yv65gm	128	25	-	-	HYPH
cord-279980-49yv65gm	128	26	TAMRA	TAMRA	NNP
cord-279980-49yv65gm	128	27	)	)	-RRB-
cord-279980-49yv65gm	128	28	were	be	VBD
cord-279980-49yv65gm	128	29	used	use	VBN
cord-279980-49yv65gm	128	30	in	in	IN
cord-279980-49yv65gm	128	31	the	the	DT
cord-279980-49yv65gm	128	32	present	present	JJ
cord-279980-49yv65gm	128	33	study	study	NN
cord-279980-49yv65gm	128	34	(	(	-LRB-
cord-279980-49yv65gm	128	35	Spackman	Spackman	NNP
cord-279980-49yv65gm	128	36	et	et	NNP
cord-279980-49yv65gm	128	37	al	al	NNP
cord-279980-49yv65gm	128	38	.	.	NNP
cord-279980-49yv65gm	128	39	,	,	,
cord-279980-49yv65gm	128	40	2002	2002	CD
cord-279980-49yv65gm	128	41	)	)	-RRB-
cord-279980-49yv65gm	128	42	.	.	.
cord-279980-49yv65gm	129	1	Final	final	JJ
cord-279980-49yv65gm	129	2	concentrations	concentration	NNS
cord-279980-49yv65gm	129	3	of	of	IN
cord-279980-49yv65gm	129	4	primers	primer	NNS
cord-279980-49yv65gm	129	5	and	and	CC
cord-279980-49yv65gm	129	6	probe	probe	NN
cord-279980-49yv65gm	129	7	were	be	VBD
cord-279980-49yv65gm	129	8	10	10	CD
cord-279980-49yv65gm	129	9	and	and	CC
cord-279980-49yv65gm	129	10	2.5	2.5	CD
cord-279980-49yv65gm	129	11	μm	μm	NNS
cord-279980-49yv65gm	129	12	,	,	,
cord-279980-49yv65gm	129	13	respectively	respectively	RB
cord-279980-49yv65gm	129	14	.	.	.
cord-279980-49yv65gm	130	1	The	the	DT
cord-279980-49yv65gm	130	2	reaction	reaction	NN
cord-279980-49yv65gm	130	3	consisted	consist	VBD
cord-279980-49yv65gm	130	4	of	of	IN
cord-279980-49yv65gm	130	5	4	4	CD
cord-279980-49yv65gm	130	6	μL	μL	NNS
cord-279980-49yv65gm	130	7	of	of	IN
cord-279980-49yv65gm	130	8	the	the	DT
cord-279980-49yv65gm	130	9	RNA	RNA	NNP
cord-279980-49yv65gm	130	10	sample	sample	NN
cord-279980-49yv65gm	130	11	,	,	,
cord-279980-49yv65gm	130	12	7.5	7.5	CD
cord-279980-49yv65gm	130	13	μL	μl	NN
cord-279980-49yv65gm	130	14	of	of	IN
cord-279980-49yv65gm	130	15	2×	2×	CD
cord-279980-49yv65gm	130	16	Reaction	Reaction	NNP
cord-279980-49yv65gm	130	17	Mix	Mix	NNP
cord-279980-49yv65gm	130	18	,	,	,
cord-279980-49yv65gm	130	19	0.3	0.3	CD
cord-279980-49yv65gm	130	20	μL	μl	NN
cord-279980-49yv65gm	130	21	of	of	IN
cord-279980-49yv65gm	130	22	SuperScript	SuperScript	NNP
cord-279980-49yv65gm	130	23	III	III	NNP
cord-279980-49yv65gm	131	1	RT	RT	NNP
cord-279980-49yv65gm	131	2	Platinum	Platinum	NNP
cord-279980-49yv65gm	131	3	®	®	.
cord-279980-49yv65gm	131	4	Taq	Taq	NNP
cord-279980-49yv65gm	131	5	Mix	Mix	NNP
cord-279980-49yv65gm	131	6	,	,	,
cord-279980-49yv65gm	131	7	50	50	CD
cord-279980-49yv65gm	131	8	mM	mm	CD
cord-279980-49yv65gm	131	9	of	of	IN
cord-279980-49yv65gm	131	10	MgSO	MgSO	NNP
cord-279980-49yv65gm	131	11	4	4	CD
cord-279980-49yv65gm	131	12	and	and	CC
cord-279980-49yv65gm	131	13	RNase	rnase	NN
cord-279980-49yv65gm	131	14	-	-	HYPH
cord-279980-49yv65gm	131	15	free	free	JJ
cord-279980-49yv65gm	131	16	water	water	NN
cord-279980-49yv65gm	131	17	in	in	IN
cord-279980-49yv65gm	131	18	a	a	DT
cord-279980-49yv65gm	131	19	final	final	JJ
cord-279980-49yv65gm	131	20	volume	volume	NN
cord-279980-49yv65gm	131	21	of	of	IN
cord-279980-49yv65gm	131	22	17	17	CD
cord-279980-49yv65gm	131	23	μL.	μl.	JJ
cord-279980-49yv65gm	131	24	One	one	CD
cord-279980-49yv65gm	131	25	-	-	HYPH
cord-279980-49yv65gm	131	26	step	step	NN
cord-279980-49yv65gm	131	27	RRT	RRT	NNP
cord-279980-49yv65gm	131	28	-	-	HYPH
cord-279980-49yv65gm	131	29	PCR	PCR	NNP
cord-279980-49yv65gm	131	30	was	be	VBD
cord-279980-49yv65gm	131	31	performed	perform	VBN
cord-279980-49yv65gm	131	32	using	use	VBG
cord-279980-49yv65gm	131	33	Rotor	rotor	NN
cord-279980-49yv65gm	131	34	-	-	HYPH
cord-279980-49yv65gm	131	35	Gene	gene	NN
cord-279980-49yv65gm	131	36	3000	3000	CD
cord-279980-49yv65gm	131	37	(	(	-LRB-
cord-279980-49yv65gm	131	38	Corbett	Corbett	NNP
cord-279980-49yv65gm	131	39	Research	Research	NNP
cord-279980-49yv65gm	131	40	,	,	,
cord-279980-49yv65gm	131	41	New	New	NNP
cord-279980-49yv65gm	131	42	South	South	NNP
cord-279980-49yv65gm	131	43	Wales	Wales	NNP
cord-279980-49yv65gm	131	44	,	,	,
cord-279980-49yv65gm	131	45	Australia	Australia	NNP
cord-279980-49yv65gm	131	46	)	)	-RRB-
cord-279980-49yv65gm	131	47	.	.	.
cord-279980-49yv65gm	132	1	Cycling	cycling	NN
cord-279980-49yv65gm	132	2	conditions	condition	NNS
cord-279980-49yv65gm	132	3	included	include	VBD
cord-279980-49yv65gm	132	4	a	a	DT
cord-279980-49yv65gm	132	5	reverse	reverse	JJ
cord-279980-49yv65gm	132	6	transcription	transcription	NN
cord-279980-49yv65gm	132	7	step	step	NN
cord-279980-49yv65gm	132	8	at	at	IN
cord-279980-49yv65gm	132	9	50	50	CD
cord-279980-49yv65gm	132	10	•	•	NNS
cord-279980-49yv65gm	132	11	C	c	NN
cord-279980-49yv65gm	132	12	30	30	CD
cord-279980-49yv65gm	132	13	min	min	NN
cord-279980-49yv65gm	132	14	,	,	,
cord-279980-49yv65gm	132	15	initial	initial	JJ
cord-279980-49yv65gm	132	16	denaturation	denaturation	NN
cord-279980-49yv65gm	132	17	step	step	NN
cord-279980-49yv65gm	132	18	at	at	IN
cord-279980-49yv65gm	132	19	94	94	CD
cord-279980-49yv65gm	133	1	•	•	NNP
cord-279980-49yv65gm	134	1	C	C	NNP
cord-279980-49yv65gm	134	2	15	15	CD
cord-279980-49yv65gm	134	3	min	min	NN
cord-279980-49yv65gm	134	4	followed	follow	VBN
cord-279980-49yv65gm	134	5	by	by	IN
cord-279980-49yv65gm	134	6	40	40	CD
cord-279980-49yv65gm	134	7	cycles	cycle	NNS
cord-279980-49yv65gm	134	8	of	of	IN
cord-279980-49yv65gm	134	9	amplification	amplification	NN
cord-279980-49yv65gm	134	10	(	(	-LRB-
cord-279980-49yv65gm	134	11	95	95	CD
cord-279980-49yv65gm	134	12	•	•	NNS
cord-279980-49yv65gm	135	1	C	C	NNP
cord-279980-49yv65gm	135	2	for	for	IN
cord-279980-49yv65gm	135	3	10	10	CD
cord-279980-49yv65gm	135	4	s	s	NN
cord-279980-49yv65gm	136	1	,	,	,
cord-279980-49yv65gm	136	2	54	54	CD
cord-279980-49yv65gm	136	3	•	•	NN
cord-279980-49yv65gm	136	4	C	c	NN
cord-279980-49yv65gm	136	5	for	for	IN
cord-279980-49yv65gm	136	6	30	30	CD
cord-279980-49yv65gm	136	7	s	s	NN
cord-279980-49yv65gm	136	8	and	and	CC
cord-279980-49yv65gm	136	9	72	72	CD
cord-279980-49yv65gm	137	1	•	•	NNP
cord-279980-49yv65gm	138	1	C	C	NNP
cord-279980-49yv65gm	138	2	for	for	IN
cord-279980-49yv65gm	138	3	10	10	CD
cord-279980-49yv65gm	138	4	s	s	NNS
cord-279980-49yv65gm	138	5	)	)	-RRB-
cord-279980-49yv65gm	139	1	(	(	-LRB-
cord-279980-49yv65gm	139	2	Spackman	Spackman	NNP
cord-279980-49yv65gm	139	3	et	et	NNP
cord-279980-49yv65gm	139	4	al	al	NNP
cord-279980-49yv65gm	139	5	.	.	NNP
cord-279980-49yv65gm	139	6	,	,	,
cord-279980-49yv65gm	139	7	2002	2002	CD
cord-279980-49yv65gm	139	8	)	)	-RRB-
cord-279980-49yv65gm	139	9	.	.	.
cord-279980-49yv65gm	140	1	The	the	DT
cord-279980-49yv65gm	140	2	fluorescence	fluorescence	NN
cord-279980-49yv65gm	140	3	data	datum	NNS
cord-279980-49yv65gm	140	4	were	be	VBD
cord-279980-49yv65gm	140	5	collected	collect	VBN
cord-279980-49yv65gm	140	6	at	at	IN
cord-279980-49yv65gm	140	7	the	the	DT
cord-279980-49yv65gm	140	8	end	end	NN
cord-279980-49yv65gm	140	9	of	of	IN
cord-279980-49yv65gm	140	10	each	each	DT
cord-279980-49yv65gm	140	11	annealing	anneal	VBG
cord-279980-49yv65gm	140	12	step	step	NN
cord-279980-49yv65gm	140	13	and	and	CC
cord-279980-49yv65gm	140	14	the	the	DT
cord-279980-49yv65gm	140	15	data	data	NN
cord-279980-49yv65gm	140	16	analyses	analysis	NNS
cord-279980-49yv65gm	140	17	of	of	IN
cord-279980-49yv65gm	140	18	the	the	DT
cord-279980-49yv65gm	140	19	RRT	RRT	NNP
cord-279980-49yv65gm	140	20	-	-	HYPH
cord-279980-49yv65gm	140	21	PCR	PCR	NNP
cord-279980-49yv65gm	140	22	assay	assay	NN
cord-279980-49yv65gm	140	23	was	be	VBD
cord-279980-49yv65gm	140	24	performed	perform	VBN
cord-279980-49yv65gm	140	25	using	use	VBG
cord-279980-49yv65gm	140	26	the	the	DT
cord-279980-49yv65gm	140	27	Rotor	Rotor	NNP
cord-279980-49yv65gm	140	28	-	-	HYPH
cord-279980-49yv65gm	140	29	Gene	gene	NN
cord-279980-49yv65gm	140	30	analysis	analysis	NN
cord-279980-49yv65gm	140	31	software	software	NN
cord-279980-49yv65gm	140	32	,	,	,
cord-279980-49yv65gm	140	33	Version	version	NN
cord-279980-49yv65gm	140	34	6.0	6.0	CD
cord-279980-49yv65gm	140	35	(	(	-LRB-
cord-279980-49yv65gm	140	36	Corbett	Corbett	NNP
cord-279980-49yv65gm	140	37	research	research	NN
cord-279980-49yv65gm	140	38	supporting	support	VBG
cord-279980-49yv65gm	140	39	program	program	NN
cord-279980-49yv65gm	140	40	,	,	,
cord-279980-49yv65gm	140	41	Corbett	Corbett	NNP
cord-279980-49yv65gm	140	42	Research	Research	NNP
cord-279980-49yv65gm	140	43	,	,	,
cord-279980-49yv65gm	140	44	Sydney	Sydney	NNP
cord-279980-49yv65gm	140	45	,	,	,
cord-279980-49yv65gm	140	46	Australia	Australia	NNP
cord-279980-49yv65gm	140	47	)	)	-RRB-
cord-279980-49yv65gm	140	48	.	.	.
cord-279980-49yv65gm	141	1	The	the	DT
cord-279980-49yv65gm	141	2	negative	negative	JJ
cord-279980-49yv65gm	141	3	and	and	CC
cord-279980-49yv65gm	141	4	positive	positive	JJ
cord-279980-49yv65gm	141	5	controls	control	NNS
cord-279980-49yv65gm	141	6	of	of	IN
cord-279980-49yv65gm	141	7	this	this	DT
cord-279980-49yv65gm	141	8	assay	assay	NN
cord-279980-49yv65gm	141	9	were	be	VBD
cord-279980-49yv65gm	141	10	similar	similar	JJ
cord-279980-49yv65gm	141	11	to	to	IN
cord-279980-49yv65gm	141	12	the	the	DT
cord-279980-49yv65gm	141	13	RT	RT	NNP
cord-279980-49yv65gm	141	14	-	-	HYPH
cord-279980-49yv65gm	141	15	PCR	PCR	NNP
cord-279980-49yv65gm	141	16	assay	assay	NN
cord-279980-49yv65gm	141	17	.	.	.
cord-279980-49yv65gm	142	1	Student	student	NN
cord-279980-49yv65gm	142	2	's	's	POS
cord-279980-49yv65gm	142	3	paired	paired	JJ
cord-279980-49yv65gm	142	4	t	t	NN
cord-279980-49yv65gm	142	5	-	-	HYPH
cord-279980-49yv65gm	142	6	test	test	NN
cord-279980-49yv65gm	142	7	was	be	VBD
cord-279980-49yv65gm	142	8	used	use	VBN
cord-279980-49yv65gm	142	9	in	in	IN
cord-279980-49yv65gm	142	10	experiment	experiment	NN
cord-279980-49yv65gm	142	11	2	2	CD
cord-279980-49yv65gm	142	12	to	to	TO
cord-279980-49yv65gm	142	13	compare	compare	VB
cord-279980-49yv65gm	142	14	the	the	DT
cord-279980-49yv65gm	142	15	virus	virus	NN
cord-279980-49yv65gm	142	16	titre	titre	NN
cord-279980-49yv65gm	142	17	between	between	IN
cord-279980-49yv65gm	142	18	a	a	DT
cord-279980-49yv65gm	142	19	house	house	NN
cord-279980-49yv65gm	142	20	fly	fly	VB
cord-279980-49yv65gm	142	21	homogenate	homogenate	NNP
cord-279980-49yv65gm	142	22	and	and	CC
cord-279980-49yv65gm	142	23	W1	W1	NNP
cord-279980-49yv65gm	142	24	washing	washing	NN
cord-279980-49yv65gm	142	25	fluid	fluid	NN
cord-279980-49yv65gm	142	26	.	.	.
cord-279980-49yv65gm	143	1	In	in	IN
cord-279980-49yv65gm	143	2	experiment	experiment	NN
cord-279980-49yv65gm	143	3	3	3	CD
cord-279980-49yv65gm	143	4	,	,	,
cord-279980-49yv65gm	143	5	anova	anova	NNP
cord-279980-49yv65gm	143	6	with	with	IN
cord-279980-49yv65gm	143	7	a	a	DT
cord-279980-49yv65gm	143	8	Tukey	Tukey	NNP
cord-279980-49yv65gm	143	9	-	-	HYPH
cord-279980-49yv65gm	143	10	Kramer	Kramer	NNP
cord-279980-49yv65gm	143	11	multiple	multiple	JJ
cord-279980-49yv65gm	143	12	comparison	comparison	NN
cord-279980-49yv65gm	143	13	test	test	NN
cord-279980-49yv65gm	143	14	was	be	VBD
cord-279980-49yv65gm	143	15	used	use	VBN
cord-279980-49yv65gm	143	16	to	to	TO
cord-279980-49yv65gm	143	17	determine	determine	VB
cord-279980-49yv65gm	143	18	the	the	DT
cord-279980-49yv65gm	143	19	correlation	correlation	NN
cord-279980-49yv65gm	143	20	among	among	IN
cord-279980-49yv65gm	143	21	the	the	DT
cord-279980-49yv65gm	143	22	repeated	repeat	VBN
cord-279980-49yv65gm	143	23	measures	measure	NNS
cord-279980-49yv65gm	143	24	.	.	.
cord-279980-49yv65gm	144	1	A	a	DT
cord-279980-49yv65gm	144	2	P	p	NN
cord-279980-49yv65gm	144	3	-value	-value	:
cord-279980-49yv65gm	144	4	was	be	VBD
cord-279980-49yv65gm	144	5	considered	consider	VBN
cord-279980-49yv65gm	144	6	as	as	IN
cord-279980-49yv65gm	144	7	a	a	DT
cord-279980-49yv65gm	144	8	significant	significant	JJ
cord-279980-49yv65gm	144	9	difference	difference	NN
cord-279980-49yv65gm	144	10	(	(	-LRB-
cord-279980-49yv65gm	144	11	P	p	NN
cord-279980-49yv65gm	144	12	<	<	XX
cord-279980-49yv65gm	144	13	0.05	0.05	CD
cord-279980-49yv65gm	144	14	)	)	-RRB-
cord-279980-49yv65gm	144	15	for	for	IN
cord-279980-49yv65gm	144	16	all	all	DT
cord-279980-49yv65gm	144	17	tests	test	NNS
cord-279980-49yv65gm	144	18	.	.	.
cord-279980-49yv65gm	145	1	In	in	IN
cord-279980-49yv65gm	145	2	addition	addition	NN
cord-279980-49yv65gm	145	3	,	,	,
cord-279980-49yv65gm	145	4	the	the	DT
cord-279980-49yv65gm	145	5	linear	linear	JJ
cord-279980-49yv65gm	145	6	regression	regression	NN
cord-279980-49yv65gm	145	7	analysis	analysis	NN
cord-279980-49yv65gm	145	8	was	be	VBD
cord-279980-49yv65gm	145	9	used	use	VBN
cord-279980-49yv65gm	145	10	to	to	TO
cord-279980-49yv65gm	145	11	evaluate	evaluate	VB
cord-279980-49yv65gm	145	12	the	the	DT
cord-279980-49yv65gm	145	13	correlation	correlation	NN
cord-279980-49yv65gm	145	14	between	between	IN
cord-279980-49yv65gm	145	15	virus	virus	NN
cord-279980-49yv65gm	145	16	titre	titre	NN
cord-279980-49yv65gm	145	17	and	and	CC
cord-279980-49yv65gm	145	18	the	the	DT
cord-279980-49yv65gm	145	19	time	time	NN
cord-279980-49yv65gm	145	20	of	of	IN
cord-279980-49yv65gm	145	21	post	post	JJ
cord-279980-49yv65gm	145	22	-	-	JJ
cord-279980-49yv65gm	145	23	exposure	exposure	NN
cord-279980-49yv65gm	145	24	.	.	.
cord-279980-49yv65gm	146	1	Embryonated	embryonate	VBN
cord-279980-49yv65gm	146	2	chicken	chicken	NN
cord-279980-49yv65gm	146	3	eggs	egg	NNS
cord-279980-49yv65gm	146	4	inoculated	inoculate	VBN
cord-279980-49yv65gm	146	5	with	with	IN
cord-279980-49yv65gm	146	6	W1	w1	NN
cord-279980-49yv65gm	146	7	washing	washing	NN
cord-279980-49yv65gm	146	8	fluid	fluid	NN
cord-279980-49yv65gm	146	9	from	from	IN
cord-279980-49yv65gm	146	10	treatment	treatment	NN
cord-279980-49yv65gm	146	11	groups	group	NNS
cord-279980-49yv65gm	146	12	and	and	CC
cord-279980-49yv65gm	146	13	house	house	NN
cord-279980-49yv65gm	146	14	fly	fly	VB
cord-279980-49yv65gm	146	15	homogenates	homogenate	NNS
cord-279980-49yv65gm	146	16	from	from	IN
cord-279980-49yv65gm	146	17	the	the	DT
cord-279980-49yv65gm	146	18	treatment	treatment	NN
cord-279980-49yv65gm	146	19	group	group	NN
cord-279980-49yv65gm	147	1	died	die	VBD
cord-279980-49yv65gm	147	2	within	within	IN
cord-279980-49yv65gm	147	3	2	2	CD
cord-279980-49yv65gm	147	4	days	day	NNS
cord-279980-49yv65gm	147	5	post	post	NN
cord-279980-49yv65gm	147	6	-	-	NN
cord-279980-49yv65gm	147	7	inoculation	inoculation	NN
cord-279980-49yv65gm	147	8	.	.	.
cord-279980-49yv65gm	148	1	Allantoic	Allantoic	NNP
cord-279980-49yv65gm	148	2	fluid	fluid	NN
cord-279980-49yv65gm	148	3	from	from	IN
cord-279980-49yv65gm	148	4	the	the	DT
cord-279980-49yv65gm	148	5	treatment	treatment	NN
cord-279980-49yv65gm	148	6	and	and	CC
cord-279980-49yv65gm	148	7	W1	w1	NN
cord-279980-49yv65gm	148	8	washing	washing	NN
cord-279980-49yv65gm	148	9	fluid	fluid	NN
cord-279980-49yv65gm	148	10	were	be	VBD
cord-279980-49yv65gm	148	11	positive	positive	JJ
cord-279980-49yv65gm	148	12	for	for	IN
cord-279980-49yv65gm	148	13	the	the	DT
cord-279980-49yv65gm	148	14	AI	AI	NNP
cord-279980-49yv65gm	148	15	H5N1	H5N1	NNP
cord-279980-49yv65gm	148	16	virus	virus	NN
cord-279980-49yv65gm	148	17	using	use	VBG
cord-279980-49yv65gm	148	18	the	the	DT
cord-279980-49yv65gm	148	19	HA	HA	NNP
cord-279980-49yv65gm	148	20	test	test	NN
cord-279980-49yv65gm	148	21	and	and	CC
cord-279980-49yv65gm	148	22	RT	RT	NNP
cord-279980-49yv65gm	148	23	-	-	HYPH
cord-279980-49yv65gm	148	24	PCR	PCR	NNP
cord-279980-49yv65gm	148	25	assay	assay	NN
cord-279980-49yv65gm	148	26	.	.	.
cord-279980-49yv65gm	149	1	All	all	DT
cord-279980-49yv65gm	149	2	embryonated	embryonate	VBN
cord-279980-49yv65gm	149	3	chicken	chicken	NN
cord-279980-49yv65gm	149	4	eggs	egg	NNS
cord-279980-49yv65gm	149	5	inoculated	inoculate	VBN
cord-279980-49yv65gm	149	6	with	with	IN
cord-279980-49yv65gm	149	7	the	the	DT
cord-279980-49yv65gm	149	8	W2	W2	NNP
cord-279980-49yv65gm	149	9	washing	washing	NN
cord-279980-49yv65gm	149	10	fluid	fluid	NN
cord-279980-49yv65gm	149	11	(	(	-LRB-
cord-279980-49yv65gm	149	12	after	after	IN
cord-279980-49yv65gm	149	13	surface	surface	NN
cord-279980-49yv65gm	149	14	sterilization	sterilization	NN
cord-279980-49yv65gm	149	15	)	)	-RRB-
cord-279980-49yv65gm	149	16	and	and	CC
cord-279980-49yv65gm	149	17	negative	negative	JJ
cord-279980-49yv65gm	149	18	control	control	NN
cord-279980-49yv65gm	149	19	group	group	NN
cord-279980-49yv65gm	149	20	remained	remain	VBD
cord-279980-49yv65gm	149	21	healthy	healthy	JJ
cord-279980-49yv65gm	149	22	with	with	IN
cord-279980-49yv65gm	149	23	no	no	DT
cord-279980-49yv65gm	149	24	evidence	evidence	NN
cord-279980-49yv65gm	149	25	of	of	IN
cord-279980-49yv65gm	149	26	AI	AI	NNP
cord-279980-49yv65gm	149	27	H5N1	H5N1	NNP
cord-279980-49yv65gm	149	28	virus	virus	NN
cord-279980-49yv65gm	149	29	infection	infection	NN
cord-279980-49yv65gm	149	30	.	.	.
cord-279980-49yv65gm	150	1	The	the	DT
cord-279980-49yv65gm	150	2	AI	AI	NNP
cord-279980-49yv65gm	150	3	H5N1	H5N1	NNP
cord-279980-49yv65gm	150	4	virus	virus	NN
cord-279980-49yv65gm	150	5	was	be	VBD
cord-279980-49yv65gm	150	6	detected	detect	VBN
cord-279980-49yv65gm	150	7	in	in	IN
cord-279980-49yv65gm	150	8	a	a	DT
cord-279980-49yv65gm	150	9	single	single	JJ
cord-279980-49yv65gm	150	10	house	house	NN
cord-279980-49yv65gm	150	11	fly	fly	VB
cord-279980-49yv65gm	150	12	in	in	IN
cord-279980-49yv65gm	150	13	all	all	DT
cord-279980-49yv65gm	150	14	replicates	replicate	NNS
cord-279980-49yv65gm	150	15	.	.	.
cord-279980-49yv65gm	151	1	Thirty	thirty	CD
cord-279980-49yv65gm	151	2	embryonated	embryonate	VBN
cord-279980-49yv65gm	151	3	chicken	chicken	NN
cord-279980-49yv65gm	151	4	eggs	egg	NNS
cord-279980-49yv65gm	151	5	from	from	IN
cord-279980-49yv65gm	151	6	all	all	DT
cord-279980-49yv65gm	151	7	replicates	replicate	NNS
cord-279980-49yv65gm	151	8	of	of	IN
cord-279980-49yv65gm	151	9	treatment	treatment	NN
cord-279980-49yv65gm	151	10	groups	group	NNS
cord-279980-49yv65gm	151	11	died	die	VBD
cord-279980-49yv65gm	151	12	2	2	CD
cord-279980-49yv65gm	151	13	days	day	NNS
cord-279980-49yv65gm	151	14	post	post	NN
cord-279980-49yv65gm	151	15	-	-	NN
cord-279980-49yv65gm	151	16	inoculation	inoculation	NN
cord-279980-49yv65gm	151	17	.	.	.
cord-279980-49yv65gm	152	1	The	the	DT
cord-279980-49yv65gm	152	2	average	average	JJ
cord-279980-49yv65gm	152	3	virus	virus	NN
cord-279980-49yv65gm	152	4	titre	titre	NN
cord-279980-49yv65gm	152	5	of	of	IN
cord-279980-49yv65gm	152	6	the	the	DT
cord-279980-49yv65gm	152	7	house	house	NNP
cord-279980-49yv65gm	152	8	fly	fly	NN
cord-279980-49yv65gm	152	9	homogenate	homogenate	NNP
cord-279980-49yv65gm	152	10	was	be	VBD
cord-279980-49yv65gm	152	11	5.43	5.43	CD
cord-279980-49yv65gm	152	12	±	±	CD
cord-279980-49yv65gm	152	13	0.33	0.33	CD
cord-279980-49yv65gm	152	14	log	log	NN
cord-279980-49yv65gm	152	15	ELD	ELD	NNP
cord-279980-49yv65gm	152	16	50	50	CD
cord-279980-49yv65gm	152	17	/mL	/mL	NFP
cord-279980-49yv65gm	152	18	,	,	,
cord-279980-49yv65gm	152	19	which	which	WDT
cord-279980-49yv65gm	152	20	was	be	VBD
cord-279980-49yv65gm	152	21	significantly	significantly	RB
cord-279980-49yv65gm	152	22	(	(	-LRB-
cord-279980-49yv65gm	152	23	P	p	NN
cord-279980-49yv65gm	152	24	<	<	XX
cord-279980-49yv65gm	152	25	0.05	0.05	CD
cord-279980-49yv65gm	152	26	)	)	-RRB-
cord-279980-49yv65gm	152	27	higher	high	JJR
cord-279980-49yv65gm	152	28	than	than	IN
cord-279980-49yv65gm	152	29	that	that	DT
cord-279980-49yv65gm	152	30	of	of	IN
cord-279980-49yv65gm	152	31	1	1	CD
cord-279980-49yv65gm	152	32	mL	ml	NN
cord-279980-49yv65gm	152	33	of	of	IN
cord-279980-49yv65gm	152	34	W1	w1	NN
cord-279980-49yv65gm	152	35	washing	washing	NN
cord-279980-49yv65gm	152	36	fluid	fluid	NN
cord-279980-49yv65gm	152	37	(	(	-LRB-
cord-279980-49yv65gm	152	38	external	external	JJ
cord-279980-49yv65gm	152	39	surface	surface	NN
cord-279980-49yv65gm	152	40	,	,	,
cord-279980-49yv65gm	152	41	4.28	4.28	CD
cord-279980-49yv65gm	152	42	±	±	CD
cord-279980-49yv65gm	152	43	0.55	0.55	CD
cord-279980-49yv65gm	152	44	log	log	NN
cord-279980-49yv65gm	152	45	ELD	ELD	NNP
cord-279980-49yv65gm	152	46	50	50	CD
cord-279980-49yv65gm	152	47	/mL	/mL	.
cord-279980-49yv65gm	152	48	)	)	-RRB-
cord-279980-49yv65gm	152	49	.	.	.
cord-279980-49yv65gm	153	1	The	the	DT
cord-279980-49yv65gm	153	2	virus	virus	NN
cord-279980-49yv65gm	153	3	titres	titre	NNS
cord-279980-49yv65gm	153	4	between	between	IN
cord-279980-49yv65gm	153	5	a	a	DT
cord-279980-49yv65gm	153	6	house	house	NN
cord-279980-49yv65gm	153	7	fly	fly	NN
cord-279980-49yv65gm	153	8	homogenate	homogenate	NNP
cord-279980-49yv65gm	153	9	and	and	CC
cord-279980-49yv65gm	153	10	W1	W1	NNP
cord-279980-49yv65gm	153	11	at	at	IN
cord-279980-49yv65gm	153	12	different	different	JJ
cord-279980-49yv65gm	153	13	times	time	NNS
cord-279980-49yv65gm	153	14	decreased	decrease	VBD
cord-279980-49yv65gm	153	15	after	after	IN
cord-279980-49yv65gm	153	16	48	48	CD
cord-279980-49yv65gm	153	17	and	and	CC
cord-279980-49yv65gm	153	18	24	24	CD
cord-279980-49yv65gm	153	19	h	h	NN
cord-279980-49yv65gm	153	20	,	,	,
cord-279980-49yv65gm	153	21	respectively	respectively	RB
cord-279980-49yv65gm	153	22	(	(	-LRB-
cord-279980-49yv65gm	153	23	Table	table	NN
cord-279980-49yv65gm	153	24	1	1	CD
cord-279980-49yv65gm	153	25	)	)	-RRB-
cord-279980-49yv65gm	153	26	.	.	.
cord-279980-49yv65gm	154	1	The	the	DT
cord-279980-49yv65gm	154	2	HA	HA	NNP
cord-279980-49yv65gm	154	3	test	test	NN
cord-279980-49yv65gm	154	4	and	and	CC
cord-279980-49yv65gm	154	5	RT	RT	NNP
cord-279980-49yv65gm	154	6	-	-	HYPH
cord-279980-49yv65gm	154	7	PCR	PCR	NNP
cord-279980-49yv65gm	154	8	results	result	NNS
cord-279980-49yv65gm	154	9	were	be	VBD
cord-279980-49yv65gm	154	10	also	also	RB
cord-279980-49yv65gm	154	11	positive	positive	JJ
cord-279980-49yv65gm	154	12	in	in	IN
cord-279980-49yv65gm	154	13	all	all	DT
cord-279980-49yv65gm	154	14	groups	group	NNS
cord-279980-49yv65gm	154	15	and	and	CC
cord-279980-49yv65gm	154	16	in	in	IN
cord-279980-49yv65gm	154	17	all	all	DT
cord-279980-49yv65gm	154	18	replicates	replicate	NNS
cord-279980-49yv65gm	154	19	.	.	.
cord-279980-49yv65gm	155	1	In	in	IN
cord-279980-49yv65gm	155	2	the	the	DT
cord-279980-49yv65gm	155	3	negative	negative	JJ
cord-279980-49yv65gm	155	4	control	control	NN
cord-279980-49yv65gm	155	5	group	group	NN
cord-279980-49yv65gm	155	6	,	,	,
cord-279980-49yv65gm	155	7	all	all	DT
cord-279980-49yv65gm	155	8	embryonated	embryonate	VBN
cord-279980-49yv65gm	155	9	chicken	chicken	NN
cord-279980-49yv65gm	155	10	eggs	egg	NNS
cord-279980-49yv65gm	155	11	were	be	VBD
cord-279980-49yv65gm	155	12	alive	alive	JJ
cord-279980-49yv65gm	155	13	and	and	CC
cord-279980-49yv65gm	155	14	the	the	DT
cord-279980-49yv65gm	155	15	RT	RT	NNP
cord-279980-49yv65gm	155	16	-	-	HYPH
cord-279980-49yv65gm	155	17	PCR	PCR	NNP
cord-279980-49yv65gm	155	18	results	result	NNS
cord-279980-49yv65gm	155	19	were	be	VBD
cord-279980-49yv65gm	155	20	negative	negative	JJ
cord-279980-49yv65gm	155	21	.	.	.
cord-279980-49yv65gm	156	1	The	the	DT
cord-279980-49yv65gm	156	2	results	result	NNS
cord-279980-49yv65gm	156	3	of	of	IN
cord-279980-49yv65gm	156	4	the	the	DT
cord-279980-49yv65gm	156	5	virus	virus	NN
cord-279980-49yv65gm	156	6	isolation	isolation	NN
cord-279980-49yv65gm	156	7	revealed	reveal	VBD
cord-279980-49yv65gm	156	8	that	that	IN
cord-279980-49yv65gm	156	9	the	the	DT
cord-279980-49yv65gm	156	10	H5N1	H5N1	NNP
cord-279980-49yv65gm	156	11	virus	virus	NN
cord-279980-49yv65gm	156	12	could	could	MD
cord-279980-49yv65gm	156	13	survive	survive	VB
cord-279980-49yv65gm	156	14	in	in	IN
cord-279980-49yv65gm	156	15	house	house	NN
cord-279980-49yv65gm	156	16	flies	fly	NNS
cord-279980-49yv65gm	156	17	and	and	CC
cord-279980-49yv65gm	156	18	remained	remain	VBD
cord-279980-49yv65gm	156	19	infective	infective	JJ
cord-279980-49yv65gm	156	20	up	up	IN
cord-279980-49yv65gm	156	21	to	to	TO
cord-279980-49yv65gm	156	22	72	72	CD
cord-279980-49yv65gm	156	23	h	h	NN
cord-279980-49yv65gm	156	24	post	post	NN
cord-279980-49yv65gm	156	25	-	-	NN
cord-279980-49yv65gm	156	26	exposure	exposure	JJ
cord-279980-49yv65gm	156	27	(	(	-LRB-
cord-279980-49yv65gm	156	28	Fig	fig	NN
cord-279980-49yv65gm	156	29	.	.	.
cord-279980-49yv65gm	156	30	1	1	CD
cord-279980-49yv65gm	156	31	)	)	-RRB-
cord-279980-49yv65gm	156	32	.	.	.
cord-279980-49yv65gm	157	1	Whereas	whereas	IN
cord-279980-49yv65gm	157	2	,	,	,
cord-279980-49yv65gm	157	3	the	the	DT
cord-279980-49yv65gm	157	4	results	result	NNS
cord-279980-49yv65gm	157	5	of	of	IN
cord-279980-49yv65gm	157	6	the	the	DT
cord-279980-49yv65gm	157	7	RRT	RRT	NNP
cord-279980-49yv65gm	157	8	-	-	HYPH
cord-279980-49yv65gm	157	9	PCR	PCR	NNP
cord-279980-49yv65gm	157	10	assay	assay	NN
cord-279980-49yv65gm	157	11	were	be	VBD
cord-279980-49yv65gm	157	12	positive	positive	JJ
cord-279980-49yv65gm	157	13	up	up	IN
cord-279980-49yv65gm	157	14	to	to	IN
cord-279980-49yv65gm	157	15	96	96	CD
cord-279980-49yv65gm	157	16	h	h	NN
cord-279980-49yv65gm	157	17	post	post	NN
cord-279980-49yv65gm	157	18	-	-	NN
cord-279980-49yv65gm	157	19	exposure	exposure	JJ
cord-279980-49yv65gm	157	20	(	(	-LRB-
cord-279980-49yv65gm	157	21	Table	table	NN
cord-279980-49yv65gm	157	22	2	2	CD
cord-279980-49yv65gm	157	23	)	)	-RRB-
cord-279980-49yv65gm	157	24	,	,	,
cord-279980-49yv65gm	157	25	indicating	indicate	VBG
cord-279980-49yv65gm	157	26	that	that	IN
cord-279980-49yv65gm	157	27	all	all	DT
cord-279980-49yv65gm	157	28	house	house	NN
cord-279980-49yv65gm	157	29	flies	fly	NNS
cord-279980-49yv65gm	157	30	carried	carry	VBD
cord-279980-49yv65gm	157	31	the	the	DT
cord-279980-49yv65gm	157	32	AI	AI	NNP
cord-279980-49yv65gm	157	33	H5N1	H5N1	NNP
cord-279980-49yv65gm	157	34	virus	virus	NN
cord-279980-49yv65gm	157	35	but	but	CC
cord-279980-49yv65gm	157	36	Table	table	NN
cord-279980-49yv65gm	157	37	1	1	CD
cord-279980-49yv65gm	157	38	.	.	.
cord-279980-49yv65gm	158	1	Avian	avian	JJ
cord-279980-49yv65gm	158	2	influenza	influenza	NN
cord-279980-49yv65gm	158	3	(	(	-LRB-
cord-279980-49yv65gm	158	4	AI	ai	NN
cord-279980-49yv65gm	158	5	)	)	-RRB-
cord-279980-49yv65gm	159	1	H5N1	H5N1	NNP
cord-279980-49yv65gm	159	2	virus	virus	NN
cord-279980-49yv65gm	159	3	titre	titre	NN
cord-279980-49yv65gm	159	4	between	between	IN
cord-279980-49yv65gm	159	5	house	house	NNP
cord-279980-49yv65gm	159	6	fly	fly	VB
cord-279980-49yv65gm	159	7	homogenates	homogenate	NNS
cord-279980-49yv65gm	159	8	and	and	CC
cord-279980-49yv65gm	159	9	W1	w1	NN
cord-279980-49yv65gm	159	10	of	of	IN
cord-279980-49yv65gm	159	11	the	the	DT
cord-279980-49yv65gm	159	12	AI	AI	NNP
cord-279980-49yv65gm	159	13	H5N1	H5N1	NNP
cord-279980-49yv65gm	159	14	virus	virus	NN
cord-279980-49yv65gm	159	15	exposed	expose	VBD
cord-279980-49yv65gm	159	16	house	house	NN
cord-279980-49yv65gm	159	17	flies	fly	VBZ
cord-279980-49yv65gm	159	18	at	at	IN
cord-279980-49yv65gm	159	19	different	different	JJ
cord-279980-49yv65gm	159	20	times	time	NNS
cord-279980-49yv65gm	159	21	of	of	IN
cord-279980-49yv65gm	159	22	post	post	JJ
cord-279980-49yv65gm	159	23	-	-	JJ
cord-279980-49yv65gm	159	24	exposure	exposure	NN
cord-279980-49yv65gm	159	25	in	in	IN
cord-279980-49yv65gm	159	26	embryonated	embryonate	VBN
cord-279980-49yv65gm	159	27	chicken	chicken	NN
cord-279980-49yv65gm	159	28	eggs	egg	NNS
cord-279980-49yv65gm	159	29	.	.	.
cord-279980-49yv65gm	160	1	The	the	DT
cord-279980-49yv65gm	160	2	different	different	JJ
cord-279980-49yv65gm	160	3	superscript	superscript	NN
cord-279980-49yv65gm	160	4	letters	letter	NNS
cord-279980-49yv65gm	160	5	in	in	IN
cord-279980-49yv65gm	160	6	the	the	DT
cord-279980-49yv65gm	160	7	same	same	JJ
cord-279980-49yv65gm	160	8	column	column	NN
cord-279980-49yv65gm	160	9	means	mean	VBZ
cord-279980-49yv65gm	160	10	significant	significant	JJ
cord-279980-49yv65gm	160	11	difference	difference	NN
cord-279980-49yv65gm	160	12	(	(	-LRB-
cord-279980-49yv65gm	160	13	P	p	NN
cord-279980-49yv65gm	160	14	<	<	XX
cord-279980-49yv65gm	160	15	0.05	0.05	CD
cord-279980-49yv65gm	160	16	)	)	-RRB-
cord-279980-49yv65gm	160	17	.	.	.
cord-279980-49yv65gm	161	1	the	the	DT
cord-279980-49yv65gm	161	2	virus	virus	NN
cord-279980-49yv65gm	161	3	could	could	MD
cord-279980-49yv65gm	161	4	not	not	RB
cord-279980-49yv65gm	161	5	replicate	replicate	VB
cord-279980-49yv65gm	161	6	in	in	IN
cord-279980-49yv65gm	161	7	the	the	DT
cord-279980-49yv65gm	161	8	house	house	NN
cord-279980-49yv65gm	161	9	flies	fly	VBZ
cord-279980-49yv65gm	161	10	and	and	CC
cord-279980-49yv65gm	161	11	the	the	DT
cord-279980-49yv65gm	161	12	results	result	NNS
cord-279980-49yv65gm	161	13	from	from	IN
cord-279980-49yv65gm	161	14	three	three	CD
cord-279980-49yv65gm	161	15	replicates	replicate	NNS
cord-279980-49yv65gm	161	16	were	be	VBD
cord-279980-49yv65gm	161	17	not	not	RB
cord-279980-49yv65gm	161	18	statistically	statistically	RB
cord-279980-49yv65gm	161	19	significantly	significantly	RB
cord-279980-49yv65gm	161	20	different	different	JJ
cord-279980-49yv65gm	161	21	(	(	-LRB-
cord-279980-49yv65gm	161	22	P	p	NN
cord-279980-49yv65gm	161	23	>	>	XX
cord-279980-49yv65gm	161	24	0.05	0.05	CD
cord-279980-49yv65gm	161	25	)	)	-RRB-
cord-279980-49yv65gm	161	26	.	.	.
cord-279980-49yv65gm	162	1	The	the	DT
cord-279980-49yv65gm	162	2	AI	AI	NNP
cord-279980-49yv65gm	162	3	H5N1	H5N1	NNP
cord-279980-49yv65gm	162	4	virus	virus	NN
cord-279980-49yv65gm	162	5	was	be	VBD
cord-279980-49yv65gm	162	6	not	not	RB
cord-279980-49yv65gm	162	7	detected	detect	VBN
cord-279980-49yv65gm	162	8	from	from	IN
cord-279980-49yv65gm	162	9	the	the	DT
cord-279980-49yv65gm	162	10	sham	sham	NN
cord-279980-49yv65gm	162	11	-	-	HYPH
cord-279980-49yv65gm	162	12	inoculated	inoculate	VBN
cord-279980-49yv65gm	162	13	negative	negative	JJ
cord-279980-49yv65gm	162	14	control	control	NN
cord-279980-49yv65gm	162	15	group	group	NN
cord-279980-49yv65gm	162	16	by	by	IN
cord-279980-49yv65gm	162	17	both	both	DT
cord-279980-49yv65gm	162	18	virus	virus	NN
cord-279980-49yv65gm	162	19	titration	titration	NN
cord-279980-49yv65gm	162	20	and	and	CC
cord-279980-49yv65gm	162	21	RRT	RRT	NNP
cord-279980-49yv65gm	162	22	-	-	HYPH
cord-279980-49yv65gm	162	23	PCR	PCR	NNP
cord-279980-49yv65gm	162	24	assay	assay	NN
cord-279980-49yv65gm	162	25	.	.	.
cord-279980-49yv65gm	163	1	The	the	DT
cord-279980-49yv65gm	163	2	highly	highly	RB
cord-279980-49yv65gm	163	3	pathogenic	pathogenic	JJ
cord-279980-49yv65gm	163	4	avian	avian	JJ
cord-279980-49yv65gm	163	5	influenza	influenza	NN
cord-279980-49yv65gm	163	6	virus	virus	NN
cord-279980-49yv65gm	163	7	subtype	subtype	NN
cord-279980-49yv65gm	163	8	H5N1	H5N1	NNP
cord-279980-49yv65gm	163	9	causes	cause	VBZ
cord-279980-49yv65gm	163	10	serious	serious	JJ
cord-279980-49yv65gm	163	11	problems	problem	NNS
cord-279980-49yv65gm	163	12	not	not	RB
cord-279980-49yv65gm	163	13	only	only	RB
cord-279980-49yv65gm	163	14	in	in	IN
cord-279980-49yv65gm	163	15	poultry	poultry	NN
cord-279980-49yv65gm	163	16	industries	industry	NNS
cord-279980-49yv65gm	163	17	but	but	CC
cord-279980-49yv65gm	163	18	also	also	RB
cord-279980-49yv65gm	163	19	poses	pose	VBZ
cord-279980-49yv65gm	163	20	a	a	DT
cord-279980-49yv65gm	163	21	threat	threat	NN
cord-279980-49yv65gm	163	22	to	to	IN
cord-279980-49yv65gm	163	23	human	human	JJ
cord-279980-49yv65gm	163	24	health	health	NN
cord-279980-49yv65gm	163	25	.	.	.
cord-279980-49yv65gm	164	1	Generally	generally	RB
cord-279980-49yv65gm	164	2	,	,	,
cord-279980-49yv65gm	164	3	the	the	DT
cord-279980-49yv65gm	164	4	poultry	poultry	NN
cord-279980-49yv65gm	164	5	production	production	NN
cord-279980-49yv65gm	164	6	system	system	NN
cord-279980-49yv65gm	164	7	in	in	IN
cord-279980-49yv65gm	164	8	Thailand	Thailand	NNP
cord-279980-49yv65gm	164	9	can	can	MD
cord-279980-49yv65gm	164	10	be	be	VB
cord-279980-49yv65gm	164	11	divided	divide	VBN
cord-279980-49yv65gm	164	12	into	into	IN
cord-279980-49yv65gm	164	13	four	four	CD
cord-279980-49yv65gm	164	14	sectors	sector	NNS
cord-279980-49yv65gm	164	15	namely	namely	RB
cord-279980-49yv65gm	164	16	,	,	,
cord-279980-49yv65gm	164	17	the	the	DT
cord-279980-49yv65gm	164	18	industrial	industrial	JJ
cord-279980-49yv65gm	164	19	integrated	integrate	VBN
cord-279980-49yv65gm	164	20	system	system	NN
cord-279980-49yv65gm	164	21	,	,	,
cord-279980-49yv65gm	164	22	the	the	DT
cord-279980-49yv65gm	164	23	semi	semi	JJ
cord-279980-49yv65gm	164	24	-	-	JJ
cord-279980-49yv65gm	164	25	vertical	vertical	JJ
cord-279980-49yv65gm	164	26	integrated	integrate	VBN
cord-279980-49yv65gm	164	27	system	system	NN
cord-279980-49yv65gm	164	28	,	,	,
cord-279980-49yv65gm	164	29	extensive	extensive	JJ
cord-279980-49yv65gm	164	30	farming	farming	NN
cord-279980-49yv65gm	164	31	and	and	CC
cord-279980-49yv65gm	164	32	backyard	backyard	NN
cord-279980-49yv65gm	164	33	.	.	.
cord-279980-49yv65gm	165	1	In	in	IN
cord-279980-49yv65gm	165	2	extensive	extensive	JJ
cord-279980-49yv65gm	165	3	farming	farming	NN
cord-279980-49yv65gm	165	4	(	(	-LRB-
cord-279980-49yv65gm	165	5	e.g.	e.g.	RB
cord-279980-49yv65gm	165	6	layer	layer	NN
cord-279980-49yv65gm	165	7	hens	hen	NNS
cord-279980-49yv65gm	165	8	,	,	,
cord-279980-49yv65gm	165	9	broilers	broiler	NNS
cord-279980-49yv65gm	165	10	,	,	,
cord-279980-49yv65gm	165	11	ducks	duck	NNS
cord-279980-49yv65gm	165	12	and	and	CC
cord-279980-49yv65gm	165	13	free	free	RB
cord-279980-49yv65gm	165	14	-	-	HYPH
cord-279980-49yv65gm	165	15	grazing	graze	VBG
cord-279980-49yv65gm	165	16	ducks	duck	NNS
cord-279980-49yv65gm	165	17	)	)	-RRB-
cord-279980-49yv65gm	165	18	and	and	CC
cord-279980-49yv65gm	165	19	backyards	backyard	NNS
cord-279980-49yv65gm	165	20	(	(	-LRB-
cord-279980-49yv65gm	165	21	e.g.	e.g.	IN
cord-279980-49yv65gm	165	22	chickens	chicken	NNS
cord-279980-49yv65gm	165	23	,	,	,
cord-279980-49yv65gm	165	24	ducks	duck	NNS
cord-279980-49yv65gm	165	25	and	and	CC
cord-279980-49yv65gm	165	26	fighting	fight	VBG
cord-279980-49yv65gm	165	27	cocks	cock	NNS
cord-279980-49yv65gm	165	28	)	)	-RRB-
cord-279980-49yv65gm	165	29	they	-PRON-	PRP
cord-279980-49yv65gm	165	30	live	live	VBP
cord-279980-49yv65gm	165	31	in	in	IN
cord-279980-49yv65gm	165	32	close	close	JJ
cord-279980-49yv65gm	165	33	proximity	proximity	NN
cord-279980-49yv65gm	165	34	with	with	IN
cord-279980-49yv65gm	165	35	their	-PRON-	PRP$
cord-279980-49yv65gm	165	36	owners	owner	NNS
cord-279980-49yv65gm	165	37	and	and	CC
cord-279980-49yv65gm	165	38	are	be	VBP
cord-279980-49yv65gm	165	39	freely	freely	RB
cord-279980-49yv65gm	165	40	in	in	IN
cord-279980-49yv65gm	165	41	contact	contact	NN
cord-279980-49yv65gm	165	42	with	with	IN
cord-279980-49yv65gm	165	43	the	the	DT
cord-279980-49yv65gm	165	44	other	other	JJ
cord-279980-49yv65gm	165	45	animals	animal	NNS
cord-279980-49yv65gm	166	1	(	(	-LRB-
cord-279980-49yv65gm	166	2	Tiensin	Tiensin	NNP
cord-279980-49yv65gm	166	3	et	et	NNP
cord-279980-49yv65gm	166	4	al	al	NNP
cord-279980-49yv65gm	166	5	.	.	NNP
cord-279980-49yv65gm	166	6	,	,	,
cord-279980-49yv65gm	166	7	2007	2007	CD
cord-279980-49yv65gm	166	8	)	)	-RRB-
cord-279980-49yv65gm	166	9	.	.	.
cord-279980-49yv65gm	167	1	Then	then	RB
cord-279980-49yv65gm	167	2	,	,	,
cord-279980-49yv65gm	167	3	the	the	DT
cord-279980-49yv65gm	167	4	manure	manure	NN
cord-279980-49yv65gm	167	5	of	of	IN
cord-279980-49yv65gm	167	6	this	this	DT
cord-279980-49yv65gm	167	7	poultry	poultry	NN
cord-279980-49yv65gm	167	8	unit	unit	NN
cord-279980-49yv65gm	167	9	was	be	VBD
cord-279980-49yv65gm	167	10	a	a	DT
cord-279980-49yv65gm	167	11	perfect	perfect	JJ
cord-279980-49yv65gm	167	12	breeding	breeding	NN
cord-279980-49yv65gm	167	13	place	place	NN
cord-279980-49yv65gm	167	14	for	for	IN
cord-279980-49yv65gm	167	15	house	house	NN
cord-279980-49yv65gm	167	16	flies	fly	NNS
cord-279980-49yv65gm	167	17	.	.	.
cord-279980-49yv65gm	168	1	Moreover	moreover	RB
cord-279980-49yv65gm	168	2	,	,	,
cord-279980-49yv65gm	168	3	Thailand	Thailand	NNP
cord-279980-49yv65gm	168	4	's	's	POS
cord-279980-49yv65gm	168	5	climate	climate	NN
cord-279980-49yv65gm	168	6	is	be	VBZ
cord-279980-49yv65gm	168	7	appropriate	appropriate	JJ
cord-279980-49yv65gm	168	8	for	for	IN
cord-279980-49yv65gm	168	9	the	the	DT
cord-279980-49yv65gm	168	10	development	development	NN
cord-279980-49yv65gm	168	11	of	of	IN
cord-279980-49yv65gm	168	12	house	house	NN
cord-279980-49yv65gm	168	13	flies	fly	NNS
cord-279980-49yv65gm	168	14	.	.	.
cord-279980-49yv65gm	169	1	Previous	previous	JJ
cord-279980-49yv65gm	169	2	studies	study	NNS
cord-279980-49yv65gm	169	3	showed	show	VBD
cord-279980-49yv65gm	169	4	that	that	IN
cord-279980-49yv65gm	169	5	house	house	NN
cord-279980-49yv65gm	169	6	flies	fly	NNS
cord-279980-49yv65gm	169	7	could	could	MD
cord-279980-49yv65gm	169	8	act	act	VB
cord-279980-49yv65gm	169	9	as	as	IN
cord-279980-49yv65gm	169	10	a	a	DT
cord-279980-49yv65gm	169	11	vector	vector	NN
cord-279980-49yv65gm	169	12	for	for	IN
cord-279980-49yv65gm	169	13	transmitting	transmit	VBG
cord-279980-49yv65gm	169	14	disease	disease	NN
cord-279980-49yv65gm	169	15	to	to	IN
cord-279980-49yv65gm	169	16	poultry	poultry	NN
cord-279980-49yv65gm	169	17	farms	farm	NNS
cord-279980-49yv65gm	169	18	and	and	CC
cord-279980-49yv65gm	169	19	flies	fly	NNS
cord-279980-49yv65gm	169	20	readily	readily	RB
cord-279980-49yv65gm	169	21	move	move	VB
cord-279980-49yv65gm	169	22	between	between	IN
cord-279980-49yv65gm	169	23	poultry	poultry	NN
cord-279980-49yv65gm	169	24	buildings	building	NNS
cord-279980-49yv65gm	169	25	(	(	-LRB-
cord-279980-49yv65gm	169	26	Lysyk	Lysyk	NNP
cord-279980-49yv65gm	169	27	&	&	CC
cord-279980-49yv65gm	169	28	Axtell	Axtell	NNP
cord-279980-49yv65gm	169	29	,	,	,
cord-279980-49yv65gm	169	30	1986	1986	CD
cord-279980-49yv65gm	169	31	)	)	-RRB-
cord-279980-49yv65gm	169	32	.	.	.
cord-279980-49yv65gm	170	1	Therefore	therefore	RB
cord-279980-49yv65gm	170	2	,	,	,
cord-279980-49yv65gm	170	3	the	the	DT
cord-279980-49yv65gm	170	4	potential	potential	NN
cord-279980-49yv65gm	170	5	of	of	IN
cord-279980-49yv65gm	170	6	house	house	NN
cord-279980-49yv65gm	170	7	flies	fly	VBZ
cord-279980-49yv65gm	170	8	to	to	TO
cord-279980-49yv65gm	170	9	act	act	VB
cord-279980-49yv65gm	170	10	as	as	IN
cord-279980-49yv65gm	170	11	a	a	DT
cord-279980-49yv65gm	170	12	vector	vector	NN
cord-279980-49yv65gm	170	13	for	for	IN
cord-279980-49yv65gm	170	14	the	the	DT
cord-279980-49yv65gm	170	15	AI	AI	NNP
cord-279980-49yv65gm	170	16	H5N1	H5N1	NNP
cord-279980-49yv65gm	170	17	virus	virus	NN
cord-279980-49yv65gm	170	18	was	be	VBD
cord-279980-49yv65gm	170	19	determined	determine	VBN
cord-279980-49yv65gm	170	20	in	in	IN
cord-279980-49yv65gm	170	21	the	the	DT
cord-279980-49yv65gm	170	22	present	present	JJ
cord-279980-49yv65gm	170	23	study	study	NN
cord-279980-49yv65gm	170	24	.	.	.
cord-279980-49yv65gm	171	1	Here	here	RB
cord-279980-49yv65gm	171	2	we	-PRON-	PRP
cord-279980-49yv65gm	171	3	demonstrated	demonstrate	VBD
cord-279980-49yv65gm	171	4	that	that	IN
cord-279980-49yv65gm	171	5	house	house	NN
cord-279980-49yv65gm	171	6	flies	fly	VBZ
cord-279980-49yv65gm	171	7	that	that	WDT
cord-279980-49yv65gm	171	8	consumed	consume	VBD
cord-279980-49yv65gm	171	9	food	food	NN
cord-279980-49yv65gm	171	10	contaminated	contaminate	VBN
cord-279980-49yv65gm	171	11	with	with	IN
cord-279980-49yv65gm	171	12	AI	AI	NNP
cord-279980-49yv65gm	171	13	H5N1	H5N1	NNP
cord-279980-49yv65gm	171	14	could	could	MD
cord-279980-49yv65gm	171	15	carry	carry	VB
cord-279980-49yv65gm	171	16	the	the	DT
cord-279980-49yv65gm	171	17	virus	virus	NN
cord-279980-49yv65gm	171	18	within	within	IN
cord-279980-49yv65gm	171	19	their	-PRON-	PRP$
cord-279980-49yv65gm	171	20	bodies	body	NNS
cord-279980-49yv65gm	171	21	for	for	IN
cord-279980-49yv65gm	171	22	a	a	DT
cord-279980-49yv65gm	171	23	long	long	JJ
cord-279980-49yv65gm	171	24	period	period	NN
cord-279980-49yv65gm	171	25	of	of	IN
cord-279980-49yv65gm	171	26	time	time	NN
cord-279980-49yv65gm	171	27	at	at	RB
cord-279980-49yv65gm	171	28	least	least	JJS
cord-279980-49yv65gm	171	29	72	72	CD
cord-279980-49yv65gm	171	30	h	h	NN
cord-279980-49yv65gm	171	31	post	post	NN
cord-279980-49yv65gm	171	32	-	-	NN
cord-279980-49yv65gm	171	33	exposure	exposure	NN
cord-279980-49yv65gm	171	34	.	.	.
cord-279980-49yv65gm	172	1	The	the	DT
cord-279980-49yv65gm	172	2	virus	virus	NN
cord-279980-49yv65gm	172	3	was	be	VBD
cord-279980-49yv65gm	172	4	detected	detect	VBN
cord-279980-49yv65gm	172	5	both	both	CC
cord-279980-49yv65gm	172	6	in	in	IN
cord-279980-49yv65gm	172	7	the	the	DT
cord-279980-49yv65gm	172	8	homogenates	homogenate	NNS
cord-279980-49yv65gm	172	9	of	of	IN
cord-279980-49yv65gm	172	10	whole	whole	JJ
cord-279980-49yv65gm	172	11	flies	fly	NNS
cord-279980-49yv65gm	172	12	and	and	CC
cord-279980-49yv65gm	172	13	the	the	DT
cord-279980-49yv65gm	172	14	external	external	JJ
cord-279980-49yv65gm	172	15	surfaces	surface	NNS
cord-279980-49yv65gm	172	16	of	of	IN
cord-279980-49yv65gm	172	17	flies	fly	NNS
cord-279980-49yv65gm	172	18	at	at	IN
cord-279980-49yv65gm	172	19	high	high	JJ
cord-279980-49yv65gm	172	20	levels	level	NNS
cord-279980-49yv65gm	172	21	.	.	.
cord-279980-49yv65gm	173	1	Moreover	moreover	RB
cord-279980-49yv65gm	173	2	,	,	,
cord-279980-49yv65gm	173	3	virus	virus	NN
cord-279980-49yv65gm	173	4	titres	titre	NNS
cord-279980-49yv65gm	173	5	of	of	IN
cord-279980-49yv65gm	173	6	a	a	DT
cord-279980-49yv65gm	173	7	whole	whole	JJ
cord-279980-49yv65gm	173	8	fly	fly	NN
cord-279980-49yv65gm	173	9	homogenate	homogenate	NNP
cord-279980-49yv65gm	173	10	compared	compare	VBN
cord-279980-49yv65gm	173	11	with	with	IN
cord-279980-49yv65gm	173	12	that	that	DT
cord-279980-49yv65gm	173	13	of	of	IN
cord-279980-49yv65gm	173	14	washing	wash	VBG
cord-279980-49yv65gm	173	15	fluid	fluid	NN
cord-279980-49yv65gm	173	16	revealed	reveal	VBD
cord-279980-49yv65gm	173	17	that	that	IN
cord-279980-49yv65gm	173	18	the	the	DT
cord-279980-49yv65gm	173	19	viruses	virus	NNS
cord-279980-49yv65gm	173	20	could	could	MD
cord-279980-49yv65gm	173	21	be	be	VB
cord-279980-49yv65gm	173	22	detected	detect	VBN
cord-279980-49yv65gm	173	23	in	in	IN
cord-279980-49yv65gm	173	24	homogenates	homogenate	NNS
cord-279980-49yv65gm	173	25	of	of	IN
cord-279980-49yv65gm	173	26	whole	whole	JJ
cord-279980-49yv65gm	173	27	flies	fly	NNS
cord-279980-49yv65gm	173	28	for	for	IN
cord-279980-49yv65gm	173	29	up	up	IN
cord-279980-49yv65gm	173	30	to	to	TO
cord-279980-49yv65gm	173	31	96	96	CD
cord-279980-49yv65gm	173	32	h	h	NN
cord-279980-49yv65gm	173	33	post	post	NN
cord-279980-49yv65gm	173	34	-	-	NN
cord-279980-49yv65gm	173	35	exposure	exposure	NN
cord-279980-49yv65gm	173	36	,	,	,
cord-279980-49yv65gm	173	37	whereas	whereas	IN
cord-279980-49yv65gm	173	38	these	these	DT
cord-279980-49yv65gm	173	39	viruses	virus	NNS
cord-279980-49yv65gm	173	40	could	could	MD
cord-279980-49yv65gm	173	41	be	be	VB
cord-279980-49yv65gm	173	42	detected	detect	VBN
cord-279980-49yv65gm	173	43	in	in	IN
cord-279980-49yv65gm	173	44	external	external	JJ
cord-279980-49yv65gm	173	45	surfaces	surface	NNS
cord-279980-49yv65gm	173	46	of	of	IN
cord-279980-49yv65gm	173	47	house	house	NN
cord-279980-49yv65gm	173	48	flies	fly	VBZ
cord-279980-49yv65gm	173	49	for	for	IN
cord-279980-49yv65gm	173	50	only	only	RB
cord-279980-49yv65gm	173	51	up	up	IN
cord-279980-49yv65gm	173	52	to	to	TO
cord-279980-49yv65gm	173	53	24	24	CD
cord-279980-49yv65gm	173	54	h	h	NN
cord-279980-49yv65gm	173	55	postexposure	postexposure	NN
cord-279980-49yv65gm	173	56	(	(	-LRB-
cord-279980-49yv65gm	173	57	Table	table	NN
cord-279980-49yv65gm	173	58	1	1	CD
cord-279980-49yv65gm	173	59	)	)	-RRB-
cord-279980-49yv65gm	173	60	.	.	.
cord-279980-49yv65gm	174	1	The	the	DT
cord-279980-49yv65gm	174	2	capacity	capacity	NN
cord-279980-49yv65gm	174	3	of	of	IN
cord-279980-49yv65gm	174	4	a	a	DT
cord-279980-49yv65gm	174	5	house	house	NN
cord-279980-49yv65gm	174	6	fly	fly	NN
cord-279980-49yv65gm	174	7	to	to	TO
cord-279980-49yv65gm	174	8	carry	carry	VB
cord-279980-49yv65gm	174	9	the	the	DT
cord-279980-49yv65gm	174	10	AI	AI	NNP
cord-279980-49yv65gm	174	11	H5N1	H5N1	NNP
cord-279980-49yv65gm	174	12	virus	virus	NN
cord-279980-49yv65gm	174	13	via	via	IN
cord-279980-49yv65gm	174	14	whole	whole	JJ
cord-279980-49yv65gm	174	15	fly	fly	NN
cord-279980-49yv65gm	174	16	homogenate	homogenate	NNP
cord-279980-49yv65gm	174	17	was	be	VBD
cord-279980-49yv65gm	174	18	significantly	significantly	RB
cord-279980-49yv65gm	174	19	higher	high	JJR
cord-279980-49yv65gm	174	20	than	than	IN
cord-279980-49yv65gm	174	21	that	that	DT
cord-279980-49yv65gm	174	22	of	of	IN
cord-279980-49yv65gm	174	23	the	the	DT
cord-279980-49yv65gm	174	24	external	external	JJ
cord-279980-49yv65gm	174	25	surface	surface	NN
cord-279980-49yv65gm	174	26	(	(	-LRB-
cord-279980-49yv65gm	174	27	P	p	NN
cord-279980-49yv65gm	174	28	<	<	XX
cord-279980-49yv65gm	174	29	0.05	0.05	CD
cord-279980-49yv65gm	174	30	)	)	-RRB-
cord-279980-49yv65gm	174	31	.	.	.
cord-279980-49yv65gm	175	1	Our	-PRON-	PRP$
cord-279980-49yv65gm	175	2	finding	finding	NN
cord-279980-49yv65gm	175	3	is	be	VBZ
cord-279980-49yv65gm	175	4	consistent	consistent	JJ
cord-279980-49yv65gm	175	5	with	with	IN
cord-279980-49yv65gm	175	6	Otake	Otake	NNP
cord-279980-49yv65gm	175	7	et	et	NNP
cord-279980-49yv65gm	175	8	al	al	NNP
cord-279980-49yv65gm	175	9	.	.	.
cord-279980-49yv65gm	176	1	(	(	-LRB-
cord-279980-49yv65gm	176	2	2003	2003	CD
cord-279980-49yv65gm	176	3	)	)	-RRB-
cord-279980-49yv65gm	176	4	that	that	WDT
cord-279980-49yv65gm	176	5	found	find	VBD
cord-279980-49yv65gm	176	6	viable	viable	JJ
cord-279980-49yv65gm	176	7	porcine	porcine	JJ
cord-279980-49yv65gm	176	8	reproductive	reproductive	JJ
cord-279980-49yv65gm	176	9	and	and	CC
cord-279980-49yv65gm	176	10	respiratory	respiratory	JJ
cord-279980-49yv65gm	176	11	syndrome	syndrome	NN
cord-279980-49yv65gm	176	12	virus	virus	NN
cord-279980-49yv65gm	176	13	(	(	-LRB-
cord-279980-49yv65gm	176	14	PRRSV	PRRSV	NNP
cord-279980-49yv65gm	176	15	)	)	-RRB-
cord-279980-49yv65gm	176	16	in	in	IN
cord-279980-49yv65gm	176	17	the	the	DT
cord-279980-49yv65gm	176	18	internal	internal	JJ
cord-279980-49yv65gm	176	19	organs	organ	NNS
cord-279980-49yv65gm	176	20	of	of	IN
cord-279980-49yv65gm	176	21	house	house	NN
cord-279980-49yv65gm	176	22	flies	fly	VBZ
cord-279980-49yv65gm	176	23	higher	high	JJR
cord-279980-49yv65gm	176	24	than	than	IN
cord-279980-49yv65gm	176	25	the	the	DT
cord-279980-49yv65gm	176	26	external	external	JJ
cord-279980-49yv65gm	176	27	surface	surface	NN
cord-279980-49yv65gm	176	28	.	.	.
cord-279980-49yv65gm	177	1	A	a	DT
cord-279980-49yv65gm	177	2	separate	separate	JJ
cord-279980-49yv65gm	177	3	study	study	NN
cord-279980-49yv65gm	177	4	detected	detect	VBD
cord-279980-49yv65gm	177	5	higher	high	JJR
cord-279980-49yv65gm	177	6	levels	level	NNS
cord-279980-49yv65gm	177	7	of	of	IN
cord-279980-49yv65gm	177	8	Exotic	exotic	JJ
cord-279980-49yv65gm	177	9	Newcastle	Newcastle	NNP
cord-279980-49yv65gm	177	10	disease	disease	NN
cord-279980-49yv65gm	177	11	virus	virus	NN
cord-279980-49yv65gm	177	12	(	(	-LRB-
cord-279980-49yv65gm	177	13	ENDV	ENDV	NNP
cord-279980-49yv65gm	177	14	)	)	-RRB-
cord-279980-49yv65gm	177	15	from	from	IN
cord-279980-49yv65gm	177	16	the	the	DT
cord-279980-49yv65gm	177	17	whole	whole	JJ
cord-279980-49yv65gm	177	18	house	house	NN
cord-279980-49yv65gm	177	19	fly	fly	VB
cord-279980-49yv65gm	177	20	homogenate	homogenate	NNP
cord-279980-49yv65gm	177	21	than	than	IN
cord-279980-49yv65gm	177	22	the	the	DT
cord-279980-49yv65gm	177	23	level	level	NN
cord-279980-49yv65gm	177	24	of	of	IN
cord-279980-49yv65gm	177	25	virus	virus	NN
cord-279980-49yv65gm	177	26	from	from	IN
cord-279980-49yv65gm	177	27	the	the	DT
cord-279980-49yv65gm	177	28	body	body	NN
cord-279980-49yv65gm	177	29	surface	surface	NN
cord-279980-49yv65gm	177	30	(	(	-LRB-
cord-279980-49yv65gm	177	31	Chakrabarti	Chakrabarti	NNP
cord-279980-49yv65gm	177	32	et	et	NNP
cord-279980-49yv65gm	177	33	al	al	NNP
cord-279980-49yv65gm	177	34	.	.	NNP
cord-279980-49yv65gm	177	35	,	,	,
cord-279980-49yv65gm	177	36	2008	2008	CD
cord-279980-49yv65gm	177	37	)	)	-RRB-
cord-279980-49yv65gm	177	38	.	.	.
cord-279980-49yv65gm	178	1	In	in	IN
cord-279980-49yv65gm	178	2	general	general	JJ
cord-279980-49yv65gm	178	3	,	,	,
cord-279980-49yv65gm	178	4	the	the	DT
cord-279980-49yv65gm	178	5	avian	avian	JJ
cord-279980-49yv65gm	178	6	influenza	influenza	NN
cord-279980-49yv65gm	178	7	virus	virus	NN
cord-279980-49yv65gm	178	8	can	can	MD
cord-279980-49yv65gm	178	9	survive	survive	VB
cord-279980-49yv65gm	178	10	in	in	IN
cord-279980-49yv65gm	178	11	an	an	DT
cord-279980-49yv65gm	178	12	environment	environment	NN
cord-279980-49yv65gm	178	13	for	for	IN
cord-279980-49yv65gm	178	14	a	a	DT
cord-279980-49yv65gm	178	15	period	period	NN
cord-279980-49yv65gm	178	16	of	of	IN
cord-279980-49yv65gm	178	17	time	time	NN
cord-279980-49yv65gm	178	18	(	(	-LRB-
cord-279980-49yv65gm	178	19	Swayne	Swayne	NNP
cord-279980-49yv65gm	178	20	&	&	CC
cord-279980-49yv65gm	178	21	Halvorson	Halvorson	NNP
cord-279980-49yv65gm	178	22	,	,	,
cord-279980-49yv65gm	178	23	2003	2003	CD
cord-279980-49yv65gm	178	24	)	)	-RRB-
cord-279980-49yv65gm	178	25	.	.	.
cord-279980-49yv65gm	179	1	Optimum	optimum	JJ
cord-279980-49yv65gm	179	2	humidity	humidity	NN
cord-279980-49yv65gm	179	3	,	,	,
cord-279980-49yv65gm	179	4	temperature	temperature	NN
cord-279980-49yv65gm	179	5	and	and	CC
cord-279980-49yv65gm	179	6	organic	organic	JJ
cord-279980-49yv65gm	179	7	materials	material	NNS
cord-279980-49yv65gm	179	8	including	include	VBG
cord-279980-49yv65gm	179	9	nasal	nasal	NN
cord-279980-49yv65gm	179	10	discharge	discharge	NN
cord-279980-49yv65gm	179	11	and	and	CC
cord-279980-49yv65gm	179	12	faeces	faece	NNS
cord-279980-49yv65gm	179	13	can	can	MD
cord-279980-49yv65gm	179	14	prolong	prolong	VB
cord-279980-49yv65gm	179	15	the	the	DT
cord-279980-49yv65gm	179	16	survival	survival	NN
cord-279980-49yv65gm	179	17	time	time	NN
cord-279980-49yv65gm	179	18	of	of	IN
cord-279980-49yv65gm	179	19	many	many	JJ
cord-279980-49yv65gm	179	20	viruses	virus	NNS
cord-279980-49yv65gm	179	21	(	(	-LRB-
cord-279980-49yv65gm	179	22	Pantin	Pantin	NNP
cord-279980-49yv65gm	179	23	-	-	HYPH
cord-279980-49yv65gm	179	24	Jackwood	Jackwood	NNP
cord-279980-49yv65gm	179	25	&	&	CC
cord-279980-49yv65gm	179	26	Swayne	Swayne	NNP
cord-279980-49yv65gm	179	27	,	,	,
cord-279980-49yv65gm	179	28	2009	2009	CD
cord-279980-49yv65gm	179	29	)	)	-RRB-
cord-279980-49yv65gm	179	30	.	.	.
cord-279980-49yv65gm	180	1	The	the	DT
cord-279980-49yv65gm	180	2	AI	AI	NNP
cord-279980-49yv65gm	180	3	H5N2	H5N2	NNP
cord-279980-49yv65gm	180	4	virus	virus	NN
cord-279980-49yv65gm	180	5	can	can	MD
cord-279980-49yv65gm	180	6	survive	survive	VB
cord-279980-49yv65gm	180	7	in	in	IN
cord-279980-49yv65gm	180	8	faeces	faece	NNS
cord-279980-49yv65gm	180	9	at	at	IN
cord-279980-49yv65gm	180	10	4	4	CD
cord-279980-49yv65gm	180	11	•	•	NN
cord-279980-49yv65gm	180	12	C	c	NN
cord-279980-49yv65gm	180	13	for	for	IN
cord-279980-49yv65gm	180	14	30	30	CD
cord-279980-49yv65gm	180	15	-	-	SYM
cord-279980-49yv65gm	180	16	35	35	CD
cord-279980-49yv65gm	180	17	days	day	NNS
cord-279980-49yv65gm	180	18	and	and	CC
cord-279980-49yv65gm	180	19	at	at	IN
cord-279980-49yv65gm	180	20	20	20	CD
cord-279980-49yv65gm	181	1	•	•	NNP
cord-279980-49yv65gm	181	2	C	C	NNP
cord-279980-49yv65gm	181	3	for	for	IN
cord-279980-49yv65gm	181	4	7	7	CD
cord-279980-49yv65gm	181	5	days	day	NNS
cord-279980-49yv65gm	181	6	(	(	-LRB-
cord-279980-49yv65gm	181	7	Swayne	Swayne	NNP
cord-279980-49yv65gm	181	8	&	&	CC
cord-279980-49yv65gm	181	9	Halvorson	Halvorson	NNP
cord-279980-49yv65gm	181	10	,	,	,
cord-279980-49yv65gm	181	11	2003	2003	CD
cord-279980-49yv65gm	181	12	)	)	-RRB-
cord-279980-49yv65gm	181	13	.	.	.
cord-279980-49yv65gm	182	1	In	in	IN
cord-279980-49yv65gm	182	2	contrast	contrast	NN
cord-279980-49yv65gm	182	3	,	,	,
cord-279980-49yv65gm	182	4	the	the	DT
cord-279980-49yv65gm	182	5	AI	AI	NNP
cord-279980-49yv65gm	182	6	H5N1	H5N1	NNP
cord-279980-49yv65gm	182	7	virus	virus	NN
cord-279980-49yv65gm	182	8	can	can	MD
cord-279980-49yv65gm	182	9	survive	survive	VB
cord-279980-49yv65gm	182	10	at	at	IN
cord-279980-49yv65gm	182	11	25	25	CD
cord-279980-49yv65gm	182	12	•	•	NNS
cord-279980-49yv65gm	182	13	C	C	NNP
cord-279980-49yv65gm	182	14	for	for	IN
cord-279980-49yv65gm	182	15	24	24	CD
cord-279980-49yv65gm	182	16	h	h	NN
cord-279980-49yv65gm	182	17	,	,	,
cord-279980-49yv65gm	182	18	and	and	CC
cord-279980-49yv65gm	182	19	at	at	IN
cord-279980-49yv65gm	182	20	40	40	CD
cord-279980-49yv65gm	182	21	•	•	NN
cord-279980-49yv65gm	182	22	C	C	NNP
cord-279980-49yv65gm	182	23	for	for	IN
cord-279980-49yv65gm	182	24	15	15	CD
cord-279980-49yv65gm	182	25	min	min	NN
cord-279980-49yv65gm	183	1	(	(	-LRB-
cord-279980-49yv65gm	183	2	Chumpolbanchorn	Chumpolbanchorn	NNP
cord-279980-49yv65gm	183	3	et	et	NNP
cord-279980-49yv65gm	183	4	al	al	NNP
cord-279980-49yv65gm	183	5	.	.	NNP
cord-279980-49yv65gm	183	6	,	,	,
cord-279980-49yv65gm	183	7	2006	2006	CD
cord-279980-49yv65gm	183	8	)	)	-RRB-
cord-279980-49yv65gm	183	9	.	.	.
cord-279980-49yv65gm	184	1	Jeong	Jeong	NNP
cord-279980-49yv65gm	184	2	et	et	NNP
cord-279980-49yv65gm	184	3	al	al	NNP
cord-279980-49yv65gm	184	4	.	.	.
cord-279980-49yv65gm	185	1	(	(	-LRB-
cord-279980-49yv65gm	185	2	2009	2009	CD
cord-279980-49yv65gm	185	3	)	)	-RRB-
cord-279980-49yv65gm	185	4	found	find	VBD
cord-279980-49yv65gm	185	5	that	that	IN
cord-279980-49yv65gm	185	6	experimental	experimental	JJ
cord-279980-49yv65gm	185	7	chickens	chicken	NNS
cord-279980-49yv65gm	185	8	inoculated	inoculate	VBN
cord-279980-49yv65gm	185	9	with	with	IN
cord-279980-49yv65gm	185	10	10	10	CD
cord-279980-49yv65gm	185	11	6.5	6.5	CD
cord-279980-49yv65gm	185	12	EID	EID	NNP
cord-279980-49yv65gm	185	13	50	50	CD
cord-279980-49yv65gm	185	14	of	of	IN
cord-279980-49yv65gm	185	15	A	a	NN
cord-279980-49yv65gm	186	1	/Chicken	/Chicken	NNP
cord-279980-49yv65gm	186	2	/Korea	/Korea	.
cord-279980-49yv65gm	187	1	/	/	NFP
cord-279980-49yv65gm	188	1	IS/06	IS/06	NNP
cord-279980-49yv65gm	188	2	(	(	-LRB-
cord-279980-49yv65gm	188	3	H5N1	H5N1	NNP
cord-279980-49yv65gm	188	4	)	)	-RRB-
cord-279980-49yv65gm	188	5	can	can	MD
cord-279980-49yv65gm	188	6	shed	shed	VB
cord-279980-49yv65gm	188	7	a	a	DT
cord-279980-49yv65gm	188	8	virus	virus	NN
cord-279980-49yv65gm	188	9	from	from	IN
cord-279980-49yv65gm	188	10	oropharyngeal	oropharyngeal	NN
cord-279980-49yv65gm	188	11	and	and	CC
cord-279980-49yv65gm	188	12	cloaca	cloaca	NN
cord-279980-49yv65gm	188	13	for	for	IN
cord-279980-49yv65gm	188	14	3	3	CD
cord-279980-49yv65gm	188	15	days	day	NNS
cord-279980-49yv65gm	188	16	at	at	IN
cord-279980-49yv65gm	188	17	virus	virus	NN
cord-279980-49yv65gm	188	18	titres	titre	NNS
cord-279980-49yv65gm	188	19	of	of	IN
cord-279980-49yv65gm	188	20	10	10	CD
cord-279980-49yv65gm	188	21	4.6	4.6	CD
cord-279980-49yv65gm	188	22	and	and	CC
cord-279980-49yv65gm	188	23	10	10	CD
cord-279980-49yv65gm	188	24	2.4	2.4	CD
cord-279980-49yv65gm	188	25	TCID	TCID	NNP
cord-279980-49yv65gm	188	26	50	50	CD
cord-279980-49yv65gm	188	27	/mL	/mL	NFP
cord-279980-49yv65gm	188	28	,	,	,
cord-279980-49yv65gm	188	29	respectively	respectively	RB
cord-279980-49yv65gm	188	30	.	.	.
cord-279980-49yv65gm	189	1	Other	other	JJ
cord-279980-49yv65gm	189	2	poultry	poultry	NN
cord-279980-49yv65gm	189	3	species	specie	NNS
cord-279980-49yv65gm	189	4	infected	infect	VBN
cord-279980-49yv65gm	189	5	with	with	IN
cord-279980-49yv65gm	189	6	H5N1	H5N1	NNP
cord-279980-49yv65gm	189	7	including	include	VBG
cord-279980-49yv65gm	189	8	ducks	duck	NNS
cord-279980-49yv65gm	189	9	and	and	CC
cord-279980-49yv65gm	189	10	quails	quail	NNS
cord-279980-49yv65gm	189	11	can	can	MD
cord-279980-49yv65gm	189	12	shed	shed	VB
cord-279980-49yv65gm	189	13	virus	virus	NN
cord-279980-49yv65gm	189	14	up	up	IN
cord-279980-49yv65gm	189	15	to	to	IN
cord-279980-49yv65gm	189	16	4	4	CD
cord-279980-49yv65gm	189	17	and	and	CC
cord-279980-49yv65gm	189	18	6	6	CD
cord-279980-49yv65gm	189	19	days	day	NNS
cord-279980-49yv65gm	189	20	,	,	,
cord-279980-49yv65gm	189	21	respectively	respectively	RB
cord-279980-49yv65gm	189	22	at	at	IN
cord-279980-49yv65gm	189	23	titres	titre	NNS
cord-279980-49yv65gm	189	24	of	of	IN
cord-279980-49yv65gm	189	25	oropharyngeal	oropharyngeal	JJ
cord-279980-49yv65gm	189	26	swabs	swab	NNS
cord-279980-49yv65gm	189	27	is	be	VBZ
cord-279980-49yv65gm	189	28	10	10	CD
cord-279980-49yv65gm	189	29	3.2	3.2	CD
cord-279980-49yv65gm	189	30	and	and	CC
cord-279980-49yv65gm	189	31	10	10	CD
cord-279980-49yv65gm	189	32	6.0	6.0	CD
cord-279980-49yv65gm	189	33	TCID	TCID	NNP
cord-279980-49yv65gm	189	34	50	50	CD
cord-279980-49yv65gm	189	35	/mL	/mL	NFP
cord-279980-49yv65gm	189	36	,	,	,
cord-279980-49yv65gm	189	37	respectively	respectively	RB
cord-279980-49yv65gm	189	38	.	.	.
cord-279980-49yv65gm	190	1	Pantin	Pantin	NNP
cord-279980-49yv65gm	190	2	-	-	HYPH
cord-279980-49yv65gm	190	3	Jackwood	Jackwood	NNP
cord-279980-49yv65gm	190	4	&	&	CC
cord-279980-49yv65gm	190	5	Swayne	Swayne	NNP
cord-279980-49yv65gm	190	6	(	(	-LRB-
cord-279980-49yv65gm	190	7	2009	2009	CD
cord-279980-49yv65gm	190	8	)	)	-RRB-
cord-279980-49yv65gm	190	9	demonstrated	demonstrate	VBD
cord-279980-49yv65gm	190	10	that	that	IN
cord-279980-49yv65gm	190	11	Pekin	Pekin	NNP
cord-279980-49yv65gm	190	12	ducks	duck	NNS
cord-279980-49yv65gm	190	13	intranasally	intranasally	RB
cord-279980-49yv65gm	190	14	inoculated	inoculate	VBN
cord-279980-49yv65gm	190	15	with	with	IN
cord-279980-49yv65gm	190	16	the	the	DT
cord-279980-49yv65gm	190	17	AI	AI	NNP
cord-279980-49yv65gm	190	18	H5N1	H5N1	NNP
cord-279980-49yv65gm	190	19	virus	virus	NN
cord-279980-49yv65gm	190	20	could	could	MD
cord-279980-49yv65gm	190	21	shed	shed	VB
cord-279980-49yv65gm	190	22	virus	virus	NN
cord-279980-49yv65gm	190	23	from	from	IN
cord-279980-49yv65gm	190	24	oral	oral	JJ
cord-279980-49yv65gm	190	25	and	and	CC
cord-279980-49yv65gm	190	26	cloaca	cloaca	NN
cord-279980-49yv65gm	190	27	at	at	IN
cord-279980-49yv65gm	190	28	titres	titre	NNS
cord-279980-49yv65gm	190	29	of	of	IN
cord-279980-49yv65gm	190	30	10	10	CD
cord-279980-49yv65gm	190	31	6.5	6.5	CD
cord-279980-49yv65gm	190	32	and	and	CC
cord-279980-49yv65gm	190	33	10	10	CD
cord-279980-49yv65gm	190	34	3.3	3.3	CD
cord-279980-49yv65gm	190	35	EID	EID	NNP
cord-279980-49yv65gm	190	36	50	50	CD
cord-279980-49yv65gm	190	37	,	,	,
cord-279980-49yv65gm	190	38	respectively	respectively	RB
cord-279980-49yv65gm	190	39	.	.	.
cord-279980-49yv65gm	191	1	Interestingly	interestingly	RB
cord-279980-49yv65gm	191	2	,	,	,
cord-279980-49yv65gm	191	3	the	the	DT
cord-279980-49yv65gm	191	4	results	result	NNS
cord-279980-49yv65gm	191	5	of	of	IN
cord-279980-49yv65gm	191	6	the	the	DT
cord-279980-49yv65gm	191	7	present	present	JJ
cord-279980-49yv65gm	191	8	study	study	NN
cord-279980-49yv65gm	191	9	showed	show	VBD
cord-279980-49yv65gm	191	10	that	that	IN
cord-279980-49yv65gm	191	11	an	an	DT
cord-279980-49yv65gm	191	12	individual	individual	JJ
cord-279980-49yv65gm	191	13	house	house	NN
cord-279980-49yv65gm	191	14	fly	fly	VB
cord-279980-49yv65gm	191	15	can	can	MD
cord-279980-49yv65gm	191	16	uptake	uptake	VB
cord-279980-49yv65gm	191	17	the	the	DT
cord-279980-49yv65gm	191	18	virus	virus	NN
cord-279980-49yv65gm	191	19	in	in	IN
cord-279980-49yv65gm	191	20	approximately	approximately	RB
cord-279980-49yv65gm	191	21	10	10	CD
cord-279980-49yv65gm	191	22	5.43	5.43	CD
cord-279980-49yv65gm	191	23	ELD	ELD	NNP
cord-279980-49yv65gm	191	24	50	50	CD
cord-279980-49yv65gm	191	25	/mL	/mL	NNS
cord-279980-49yv65gm	191	26	out	out	IN
cord-279980-49yv65gm	191	27	of	of	IN
cord-279980-49yv65gm	191	28	1	1	CD
cord-279980-49yv65gm	191	29	×	×	CD
cord-279980-49yv65gm	191	30	10	10	CD
cord-279980-49yv65gm	191	31	9.2	9.2	CD
cord-279980-49yv65gm	191	32	ELD	ELD	NNP
cord-279980-49yv65gm	191	33	50	50	CD
cord-279980-49yv65gm	191	34	/mL	/mL	:
cord-279980-49yv65gm	191	35	of	of	IN
cord-279980-49yv65gm	191	36	infectious	infectious	JJ
cord-279980-49yv65gm	191	37	mixture	mixture	NN
cord-279980-49yv65gm	191	38	or	or	CC
cord-279980-49yv65gm	191	39	approximately	approximately	RB
cord-279980-49yv65gm	191	40	0.02	0.02	CD
cord-279980-49yv65gm	191	41	%	%	NN
cord-279980-49yv65gm	191	42	of	of	IN
cord-279980-49yv65gm	191	43	the	the	DT
cord-279980-49yv65gm	191	44	total	total	JJ
cord-279980-49yv65gm	191	45	virus	virus	NN
cord-279980-49yv65gm	191	46	when	when	WRB
cord-279980-49yv65gm	191	47	it	-PRON-	PRP
cord-279980-49yv65gm	191	48	was	be	VBD
cord-279980-49yv65gm	191	49	kept	keep	VBN
cord-279980-49yv65gm	191	50	at	at	IN
cord-279980-49yv65gm	191	51	room	room	NN
cord-279980-49yv65gm	191	52	temperature	temperature	NN
cord-279980-49yv65gm	191	53	.	.	.
cord-279980-49yv65gm	192	1	Thus	thus	RB
cord-279980-49yv65gm	192	2	,	,	,
cord-279980-49yv65gm	192	3	our	-PRON-	PRP$
cord-279980-49yv65gm	192	4	data	datum	NNS
cord-279980-49yv65gm	192	5	suggest	suggest	VBP
cord-279980-49yv65gm	192	6	that	that	IN
cord-279980-49yv65gm	192	7	house	house	NN
cord-279980-49yv65gm	192	8	flies	fly	NNS
cord-279980-49yv65gm	192	9	can	can	MD
cord-279980-49yv65gm	192	10	carry	carry	VB
cord-279980-49yv65gm	192	11	a	a	DT
cord-279980-49yv65gm	192	12	similar	similar	JJ
cord-279980-49yv65gm	192	13	amount	amount	NN
cord-279980-49yv65gm	192	14	of	of	IN
cord-279980-49yv65gm	192	15	the	the	DT
cord-279980-49yv65gm	192	16	AI	AI	NNP
cord-279980-49yv65gm	192	17	H5N1	H5N1	NNP
cord-279980-49yv65gm	192	18	virus	virus	NN
cord-279980-49yv65gm	192	19	to	to	IN
cord-279980-49yv65gm	192	20	the	the	DT
cord-279980-49yv65gm	192	21	amount	amount	NN
cord-279980-49yv65gm	192	22	of	of	IN
cord-279980-49yv65gm	192	23	virus	virus	NN
cord-279980-49yv65gm	192	24	shed	shed	VBN
cord-279980-49yv65gm	192	25	from	from	IN
cord-279980-49yv65gm	192	26	H5N1	H5N1	NNP
cord-279980-49yv65gm	192	27	experimentally	experimentally	RB
cord-279980-49yv65gm	192	28	infected	infect	VBD
cord-279980-49yv65gm	192	29	avian	avian	JJ
cord-279980-49yv65gm	192	30	species	specie	NNS
cord-279980-49yv65gm	192	31	such	such	JJ
cord-279980-49yv65gm	192	32	as	as	IN
cord-279980-49yv65gm	192	33	chickens	chicken	NNS
cord-279980-49yv65gm	192	34	,	,	,
cord-279980-49yv65gm	192	35	quails	quail	NNS
cord-279980-49yv65gm	192	36	and	and	CC
cord-279980-49yv65gm	192	37	ducks	duck	NNS
cord-279980-49yv65gm	192	38	.	.	.
cord-279980-49yv65gm	193	1	However	however	RB
cord-279980-49yv65gm	193	2	,	,	,
cord-279980-49yv65gm	193	3	transmission	transmission	NN
cord-279980-49yv65gm	193	4	studies	study	NNS
cord-279980-49yv65gm	193	5	should	should	MD
cord-279980-49yv65gm	193	6	be	be	VB
cord-279980-49yv65gm	193	7	performed	perform	VBN
cord-279980-49yv65gm	193	8	.	.	.
cord-279980-49yv65gm	194	1	In	in	IN
cord-279980-49yv65gm	194	2	addition	addition	NN
cord-279980-49yv65gm	194	3	,	,	,
cord-279980-49yv65gm	194	4	an	an	DT
cord-279980-49yv65gm	194	5	individual	individual	JJ
cord-279980-49yv65gm	194	6	house	house	NN
cord-279980-49yv65gm	194	7	fly	fly	VB
cord-279980-49yv65gm	194	8	can	can	MD
cord-279980-49yv65gm	194	9	fly	fly	VB
cord-279980-49yv65gm	194	10	up	up	IN
cord-279980-49yv65gm	194	11	to	to	TO
cord-279980-49yv65gm	194	12	11.8	11.8	CD
cord-279980-49yv65gm	194	13	km	km	NNS
cord-279980-49yv65gm	194	14	within	within	IN
cord-279980-49yv65gm	194	15	24	24	CD
cord-279980-49yv65gm	194	16	h	h	NN
cord-279980-49yv65gm	194	17	(	(	-LRB-
cord-279980-49yv65gm	194	18	Greenberg	Greenberg	NNP
cord-279980-49yv65gm	194	19	,	,	,
cord-279980-49yv65gm	194	20	1973	1973	CD
cord-279980-49yv65gm	194	21	)	)	-RRB-
cord-279980-49yv65gm	194	22	.	.	.
cord-279980-49yv65gm	195	1	Therefore	therefore	RB
cord-279980-49yv65gm	195	2	,	,	,
cord-279980-49yv65gm	195	3	house	house	NN
cord-279980-49yv65gm	195	4	flies	fly	NNS
cord-279980-49yv65gm	195	5	may	may	MD
cord-279980-49yv65gm	195	6	serve	serve	VB
cord-279980-49yv65gm	195	7	as	as	IN
cord-279980-49yv65gm	195	8	potential	potential	JJ
cord-279980-49yv65gm	195	9	mechanical	mechanical	JJ
cord-279980-49yv65gm	195	10	vectors	vector	NNS
cord-279980-49yv65gm	195	11	which	which	WDT
cord-279980-49yv65gm	195	12	spread	spread	VBD
cord-279980-49yv65gm	195	13	the	the	DT
cord-279980-49yv65gm	195	14	AI	AI	NNP
cord-279980-49yv65gm	195	15	H5N1	H5N1	NNP
cord-279980-49yv65gm	195	16	virus	virus	NN
cord-279980-49yv65gm	195	17	to	to	IN
cord-279980-49yv65gm	195	18	poultry	poultry	NN
cord-279980-49yv65gm	195	19	farms	farm	NNS
cord-279980-49yv65gm	195	20	in	in	IN
cord-279980-49yv65gm	195	21	the	the	DT
cord-279980-49yv65gm	195	22	nearby	nearby	JJ
cord-279980-49yv65gm	195	23	area	area	NN
cord-279980-49yv65gm	195	24	similar	similar	JJ
cord-279980-49yv65gm	195	25	to	to	TO
cord-279980-49yv65gm	195	26	blow	blow	VB
cord-279980-49yv65gm	195	27	flies	fly	NNS
cord-279980-49yv65gm	195	28	(	(	-LRB-
cord-279980-49yv65gm	195	29	Calliphora	Calliphora	NNP
cord-279980-49yv65gm	195	30	nigribarbis	nigribarbis	NNP
cord-279980-49yv65gm	195	31	)	)	-RRB-
cord-279980-49yv65gm	195	32	that	that	WDT
cord-279980-49yv65gm	195	33	was	be	VBD
cord-279980-49yv65gm	195	34	shown	show	VBN
cord-279980-49yv65gm	195	35	to	to	TO
cord-279980-49yv65gm	195	36	be	be	VB
cord-279980-49yv65gm	195	37	mechanical	mechanical	JJ
cord-279980-49yv65gm	195	38	vectors	vector	NNS
cord-279980-49yv65gm	195	39	for	for	IN
cord-279980-49yv65gm	195	40	AIV	AIV	NNP
cord-279980-49yv65gm	195	41	in	in	IN
cord-279980-49yv65gm	195	42	Japan	Japan	NNP
cord-279980-49yv65gm	196	1	(	(	-LRB-
cord-279980-49yv65gm	196	2	Sawabe	Sawabe	NNP
cord-279980-49yv65gm	196	3	et	et	NNP
cord-279980-49yv65gm	196	4	al	al	NNP
cord-279980-49yv65gm	196	5	.	.	NNP
cord-279980-49yv65gm	196	6	,	,	,
cord-279980-49yv65gm	196	7	2009	2009	CD
cord-279980-49yv65gm	196	8	)	)	-RRB-
cord-279980-49yv65gm	196	9	.	.	.
cord-279980-49yv65gm	197	1	The	the	DT
cord-279980-49yv65gm	197	2	results	result	NNS
cord-279980-49yv65gm	197	3	of	of	IN
cord-279980-49yv65gm	197	4	experiment	experiment	NN
cord-279980-49yv65gm	197	5	3	3	CD
cord-279980-49yv65gm	197	6	revealed	reveal	VBD
cord-279980-49yv65gm	197	7	that	that	IN
cord-279980-49yv65gm	197	8	the	the	DT
cord-279980-49yv65gm	197	9	AI	AI	NNP
cord-279980-49yv65gm	197	10	H5N1	H5N1	NNP
cord-279980-49yv65gm	197	11	virus	virus	NN
cord-279980-49yv65gm	197	12	could	could	MD
cord-279980-49yv65gm	197	13	be	be	VB
cord-279980-49yv65gm	197	14	detected	detect	VBN
cord-279980-49yv65gm	197	15	within	within	IN
cord-279980-49yv65gm	197	16	the	the	DT
cord-279980-49yv65gm	197	17	fed	fed	NNP
cord-279980-49yv65gm	197	18	house	house	NN
cord-279980-49yv65gm	197	19	flies	fly	VBZ
cord-279980-49yv65gm	197	20	for	for	IN
cord-279980-49yv65gm	197	21	up	up	IN
cord-279980-49yv65gm	197	22	to	to	TO
cord-279980-49yv65gm	197	23	72	72	CD
cord-279980-49yv65gm	197	24	h	h	NN
cord-279980-49yv65gm	197	25	postexposure	postexposure	NN
cord-279980-49yv65gm	197	26	.	.	.
cord-279980-49yv65gm	198	1	Otake	Otake	NNP
cord-279980-49yv65gm	198	2	et	et	NNP
cord-279980-49yv65gm	198	3	al	al	NNP
cord-279980-49yv65gm	198	4	.	.	.
cord-279980-49yv65gm	199	1	(	(	-LRB-
cord-279980-49yv65gm	199	2	2003	2003	CD
cord-279980-49yv65gm	199	3	)	)	-RRB-
cord-279980-49yv65gm	199	4	showed	show	VBD
cord-279980-49yv65gm	199	5	that	that	IN
cord-279980-49yv65gm	199	6	the	the	DT
cord-279980-49yv65gm	199	7	PRRSV	PRRSV	NNP
cord-279980-49yv65gm	199	8	could	could	MD
cord-279980-49yv65gm	199	9	survive	survive	VB
cord-279980-49yv65gm	199	10	within	within	IN
cord-279980-49yv65gm	199	11	the	the	DT
cord-279980-49yv65gm	199	12	intestinal	intestinal	JJ
cord-279980-49yv65gm	199	13	viscera	viscera	NN
cord-279980-49yv65gm	199	14	of	of	IN
cord-279980-49yv65gm	199	15	house	house	NN
cord-279980-49yv65gm	199	16	flies	fly	VBZ
cord-279980-49yv65gm	199	17	for	for	IN
cord-279980-49yv65gm	199	18	up	up	IN
cord-279980-49yv65gm	199	19	to	to	TO
cord-279980-49yv65gm	199	20	12	12	CD
cord-279980-49yv65gm	199	21	h	h	NN
cord-279980-49yv65gm	199	22	post	post	NN
cord-279980-49yv65gm	199	23	-	-	NN
cord-279980-49yv65gm	199	24	exposure	exposure	NN
cord-279980-49yv65gm	199	25	.	.	.
cord-279980-49yv65gm	200	1	Moreover	moreover	RB
cord-279980-49yv65gm	200	2	,	,	,
cord-279980-49yv65gm	200	3	Watson	Watson	NNP
cord-279980-49yv65gm	200	4	et	et	NNP
cord-279980-49yv65gm	200	5	al	al	NNP
cord-279980-49yv65gm	200	6	.	.	.
cord-279980-49yv65gm	201	1	(	(	-LRB-
cord-279980-49yv65gm	201	2	2007	2007	CD
cord-279980-49yv65gm	201	3	)	)	-RRB-
cord-279980-49yv65gm	201	4	found	find	VBD
cord-279980-49yv65gm	201	5	that	that	IN
cord-279980-49yv65gm	201	6	the	the	DT
cord-279980-49yv65gm	201	7	NDV	NDV	NNP
cord-279980-49yv65gm	201	8	remained	remain	VBD
cord-279980-49yv65gm	201	9	viable	viable	JJ
cord-279980-49yv65gm	201	10	in	in	IN
cord-279980-49yv65gm	201	11	the	the	DT
cord-279980-49yv65gm	201	12	crop	crop	NN
cord-279980-49yv65gm	201	13	and	and	CC
cord-279980-49yv65gm	201	14	gut	gut	NN
cord-279980-49yv65gm	201	15	tissues	tissue	NNS
cord-279980-49yv65gm	201	16	of	of	IN
cord-279980-49yv65gm	201	17	the	the	DT
cord-279980-49yv65gm	201	18	house	house	NN
cord-279980-49yv65gm	201	19	flies	fly	VBZ
cord-279980-49yv65gm	201	20	for	for	IN
cord-279980-49yv65gm	201	21	up	up	IN
cord-279980-49yv65gm	201	22	to	to	TO
cord-279980-49yv65gm	201	23	96	96	CD
cord-279980-49yv65gm	201	24	h	h	NN
cord-279980-49yv65gm	201	25	post	post	NN
cord-279980-49yv65gm	201	26	-	-	NN
cord-279980-49yv65gm	201	27	exposure	exposure	NN
cord-279980-49yv65gm	201	28	.	.	.
cord-279980-49yv65gm	202	1	It	-PRON-	PRP
cord-279980-49yv65gm	202	2	should	should	MD
cord-279980-49yv65gm	202	3	be	be	VB
cord-279980-49yv65gm	202	4	noted	note	VBN
cord-279980-49yv65gm	202	5	that	that	IN
cord-279980-49yv65gm	202	6	different	different	JJ
cord-279980-49yv65gm	202	7	results	result	NNS
cord-279980-49yv65gm	202	8	of	of	IN
cord-279980-49yv65gm	202	9	viable	viable	JJ
cord-279980-49yv65gm	202	10	virus	virus	NN
cord-279980-49yv65gm	202	11	remaining	remain	VBG
cord-279980-49yv65gm	202	12	in	in	IN
cord-279980-49yv65gm	202	13	the	the	DT
cord-279980-49yv65gm	202	14	digestive	digestive	JJ
cord-279980-49yv65gm	202	15	tract	tract	NN
cord-279980-49yv65gm	202	16	depend	depend	VBP
cord-279980-49yv65gm	202	17	on	on	IN
cord-279980-49yv65gm	202	18	the	the	DT
cord-279980-49yv65gm	202	19	dimension	dimension	NN
cord-279980-49yv65gm	202	20	of	of	IN
cord-279980-49yv65gm	202	21	anatomy	anatomy	NN
cord-279980-49yv65gm	202	22	,	,	,
cord-279980-49yv65gm	202	23	the	the	DT
cord-279980-49yv65gm	202	24	type	type	NN
cord-279980-49yv65gm	202	25	of	of	IN
cord-279980-49yv65gm	202	26	virus	virus	NN
cord-279980-49yv65gm	202	27	and	and	CC
cord-279980-49yv65gm	202	28	the	the	DT
cord-279980-49yv65gm	202	29	route	route	NN
cord-279980-49yv65gm	202	30	of	of	IN
cord-279980-49yv65gm	202	31	transmission	transmission	NN
cord-279980-49yv65gm	203	1	(	(	-LRB-
cord-279980-49yv65gm	203	2	Förster	Förster	NNP
cord-279980-49yv65gm	203	3	et	et	NNP
cord-279980-49yv65gm	203	4	al	al	NNP
cord-279980-49yv65gm	203	5	.	.	NNP
cord-279980-49yv65gm	203	6	,	,	,
cord-279980-49yv65gm	203	7	2007	2007	CD
cord-279980-49yv65gm	203	8	)	)	-RRB-
cord-279980-49yv65gm	203	9	.	.	.
cord-279980-49yv65gm	204	1	However	however	RB
cord-279980-49yv65gm	204	2	,	,	,
cord-279980-49yv65gm	204	3	the	the	DT
cord-279980-49yv65gm	204	4	real	real	JJ
cord-279980-49yv65gm	204	5	-	-	HYPH
cord-279980-49yv65gm	204	6	time	time	NN
cord-279980-49yv65gm	204	7	RT	RT	NNP
cord-279980-49yv65gm	204	8	-	-	HYPH
cord-279980-49yv65gm	204	9	PCR	PCR	NNP
cord-279980-49yv65gm	204	10	results	result	NNS
cord-279980-49yv65gm	204	11	showed	show	VBD
cord-279980-49yv65gm	204	12	that	that	IN
cord-279980-49yv65gm	204	13	the	the	DT
cord-279980-49yv65gm	204	14	viral	viral	JJ
cord-279980-49yv65gm	204	15	RNA	RNA	NNP
cord-279980-49yv65gm	204	16	can	can	MD
cord-279980-49yv65gm	204	17	be	be	VB
cord-279980-49yv65gm	204	18	found	find	VBN
cord-279980-49yv65gm	204	19	in	in	IN
cord-279980-49yv65gm	204	20	all	all	DT
cord-279980-49yv65gm	204	21	time	time	NN
cord-279980-49yv65gm	204	22	points	point	NNS
cord-279980-49yv65gm	204	23	of	of	IN
cord-279980-49yv65gm	204	24	this	this	DT
cord-279980-49yv65gm	204	25	experiment	experiment	NN
cord-279980-49yv65gm	204	26	.	.	.
cord-279980-49yv65gm	205	1	In	in	IN
cord-279980-49yv65gm	205	2	addition	addition	NN
cord-279980-49yv65gm	205	3	,	,	,
cord-279980-49yv65gm	205	4	the	the	DT
cord-279980-49yv65gm	205	5	virus	virus	NN
cord-279980-49yv65gm	205	6	infection	infection	NN
cord-279980-49yv65gm	205	7	titre	titre	NN
cord-279980-49yv65gm	205	8	continuously	continuously	RB
cord-279980-49yv65gm	205	9	decreased	decrease	VBD
cord-279980-49yv65gm	205	10	according	accord	VBG
cord-279980-49yv65gm	205	11	to	to	IN
cord-279980-49yv65gm	205	12	the	the	DT
cord-279980-49yv65gm	205	13	increasing	increase	VBG
cord-279980-49yv65gm	205	14	exposure	exposure	NN
cord-279980-49yv65gm	205	15	time	time	NN
cord-279980-49yv65gm	205	16	.	.	.
cord-279980-49yv65gm	206	1	This	this	DT
cord-279980-49yv65gm	206	2	study	study	NN
cord-279980-49yv65gm	206	3	found	find	VBD
cord-279980-49yv65gm	206	4	that	that	IN
cord-279980-49yv65gm	206	5	the	the	DT
cord-279980-49yv65gm	206	6	AI	AI	NNP
cord-279980-49yv65gm	206	7	H5N1	H5N1	NNP
cord-279980-49yv65gm	206	8	virus	virus	NN
cord-279980-49yv65gm	206	9	could	could	MD
cord-279980-49yv65gm	206	10	not	not	RB
cord-279980-49yv65gm	206	11	replicate	replicate	VB
cord-279980-49yv65gm	206	12	within	within	IN
cord-279980-49yv65gm	206	13	the	the	DT
cord-279980-49yv65gm	206	14	house	house	NN
cord-279980-49yv65gm	206	15	flies	fly	VBZ
cord-279980-49yv65gm	206	16	,	,	,
cord-279980-49yv65gm	206	17	a	a	DT
cord-279980-49yv65gm	206	18	mechanical	mechanical	JJ
cord-279980-49yv65gm	206	19	vector	vector	NN
cord-279980-49yv65gm	206	20	rather	rather	RB
cord-279980-49yv65gm	206	21	than	than	IN
cord-279980-49yv65gm	206	22	a	a	DT
cord-279980-49yv65gm	206	23	biological	biological	JJ
cord-279980-49yv65gm	206	24	vector	vector	NN
cord-279980-49yv65gm	206	25	.	.	.
cord-279980-49yv65gm	207	1	In	in	IN
cord-279980-49yv65gm	207	2	conclusion	conclusion	NN
cord-279980-49yv65gm	207	3	,	,	,
cord-279980-49yv65gm	207	4	the	the	DT
cord-279980-49yv65gm	207	5	present	present	JJ
cord-279980-49yv65gm	207	6	study	study	NN
cord-279980-49yv65gm	207	7	demonstrated	demonstrate	VBD
cord-279980-49yv65gm	207	8	that	that	IN
cord-279980-49yv65gm	207	9	the	the	DT
cord-279980-49yv65gm	207	10	house	house	NN
cord-279980-49yv65gm	207	11	flies	fly	NNS
cord-279980-49yv65gm	207	12	could	could	MD
cord-279980-49yv65gm	207	13	carry	carry	VB
cord-279980-49yv65gm	207	14	the	the	DT
cord-279980-49yv65gm	207	15	H5N1	H5N1	NNP
cord-279980-49yv65gm	207	16	virus	virus	NN
cord-279980-49yv65gm	207	17	,	,	,
cord-279980-49yv65gm	207	18	which	which	WDT
cord-279980-49yv65gm	207	19	remained	remain	VBD
cord-279980-49yv65gm	207	20	infective	infective	JJ
cord-279980-49yv65gm	207	21	for	for	IN
cord-279980-49yv65gm	207	22	at	at	RB
cord-279980-49yv65gm	207	23	least	least	RBS
cord-279980-49yv65gm	207	24	72	72	CD
cord-279980-49yv65gm	207	25	h.	h.	NN
cord-279980-49yv65gm	208	1	The	the	DT
cord-279980-49yv65gm	208	2	results	result	NNS
cord-279980-49yv65gm	208	3	from	from	IN
cord-279980-49yv65gm	208	4	the	the	DT
cord-279980-49yv65gm	208	5	present	present	JJ
cord-279980-49yv65gm	208	6	study	study	NN
cord-279980-49yv65gm	208	7	indicated	indicate	VBD
cord-279980-49yv65gm	208	8	that	that	IN
cord-279980-49yv65gm	208	9	house	house	NN
cord-279980-49yv65gm	208	10	flies	fly	NNS
cord-279980-49yv65gm	208	11	may	may	MD
cord-279980-49yv65gm	208	12	act	act	VB
cord-279980-49yv65gm	208	13	as	as	IN
cord-279980-49yv65gm	208	14	a	a	DT
cord-279980-49yv65gm	208	15	potential	potential	JJ
cord-279980-49yv65gm	208	16	mechanical	mechanical	JJ
cord-279980-49yv65gm	208	17	vector	vector	NN
cord-279980-49yv65gm	208	18	for	for	IN
cord-279980-49yv65gm	208	19	spreading	spread	VBG
cord-279980-49yv65gm	208	20	the	the	DT
cord-279980-49yv65gm	208	21	AI	AI	NNP
cord-279980-49yv65gm	208	22	H5N1	H5N1	NNP
cord-279980-49yv65gm	208	23	virus	virus	NN
cord-279980-49yv65gm	208	24	.	.	.
cord-279980-49yv65gm	209	1	As	as	IN
cord-279980-49yv65gm	209	2	a	a	DT
cord-279980-49yv65gm	209	3	consequence	consequence	NN
cord-279980-49yv65gm	209	4	,	,	,
cord-279980-49yv65gm	209	5	improving	improve	VBG
cord-279980-49yv65gm	209	6	biosecurity	biosecurity	NN
cord-279980-49yv65gm	209	7	including	include	VBG
cord-279980-49yv65gm	209	8	fly	fly	VB
cord-279980-49yv65gm	209	9	management	management	NN
cord-279980-49yv65gm	209	10	control	control	NN
cord-279980-49yv65gm	209	11	should	should	MD
cord-279980-49yv65gm	209	12	also	also	RB
cord-279980-49yv65gm	209	13	be	be	VB
cord-279980-49yv65gm	209	14	considered	consider	VBN
cord-279980-49yv65gm	209	15	for	for	IN
cord-279980-49yv65gm	209	16	the	the	DT
cord-279980-49yv65gm	209	17	effective	effective	JJ
cord-279980-49yv65gm	209	18	control	control	NN
cord-279980-49yv65gm	209	19	of	of	IN
cord-279980-49yv65gm	209	20	the	the	DT
cord-279980-49yv65gm	209	21	AI	AI	NNP
cord-279980-49yv65gm	209	22	H5N1	H5N1	NNP
cord-279980-49yv65gm	209	23	virus	virus	NN
cord-279980-49yv65gm	209	24	in	in	IN
cord-279980-49yv65gm	209	25	epidemic	epidemic	NN
cord-279980-49yv65gm	209	26	areas	area	NNS
cord-279980-49yv65gm	209	27	.	.	.
cord-279980-49yv65gm	210	1	However	however	RB
cord-279980-49yv65gm	210	2	,	,	,
cord-279980-49yv65gm	210	3	the	the	DT
cord-279980-49yv65gm	210	4	actual	actual	JJ
cord-279980-49yv65gm	210	5	ability	ability	NN
cord-279980-49yv65gm	210	6	of	of	IN
cord-279980-49yv65gm	210	7	infected	infected	JJ
cord-279980-49yv65gm	210	8	house	house	NN
cord-279980-49yv65gm	210	9	flies	fly	VBZ
cord-279980-49yv65gm	210	10	in	in	IN
cord-279980-49yv65gm	210	11	disseminating	disseminate	VBG
cord-279980-49yv65gm	210	12	the	the	DT
cord-279980-49yv65gm	210	13	AI	AI	NNP
cord-279980-49yv65gm	210	14	H5N1	H5N1	NNP
cord-279980-49yv65gm	210	15	virus	virus	NN
cord-279980-49yv65gm	210	16	to	to	IN
cord-279980-49yv65gm	210	17	the	the	DT
cord-279980-49yv65gm	210	18	chicken	chicken	NN
cord-279980-49yv65gm	210	19	has	have	VBZ
cord-279980-49yv65gm	210	20	not	not	RB
cord-279980-49yv65gm	210	21	been	be	VBN
cord-279980-49yv65gm	210	22	determined	determine	VBN
cord-279980-49yv65gm	210	23	in	in	IN
cord-279980-49yv65gm	210	24	this	this	DT
cord-279980-49yv65gm	210	25	study	study	NN
cord-279980-49yv65gm	210	26	.	.	.
cord-279980-49yv65gm	211	1	Therefore	therefore	RB
cord-279980-49yv65gm	211	2	,	,	,
cord-279980-49yv65gm	211	3	we	-PRON-	PRP
cord-279980-49yv65gm	211	4	suggest	suggest	VBP
cord-279980-49yv65gm	211	5	that	that	IN
cord-279980-49yv65gm	211	6	the	the	DT
cord-279980-49yv65gm	211	7	experimental	experimental	JJ
cord-279980-49yv65gm	211	8	infection	infection	NN
cord-279980-49yv65gm	211	9	with	with	IN
cord-279980-49yv65gm	211	10	AI	AI	NNP
cord-279980-49yv65gm	211	11	H5N1	H5N1	NNP
cord-279980-49yv65gm	211	12	virus	virus	NN
cord-279980-49yv65gm	211	13	exposed	expose	VBD
cord-279980-49yv65gm	211	14	house	house	NN
cord-279980-49yv65gm	211	15	flies	fly	NNS
cord-279980-49yv65gm	211	16	in	in	IN
cord-279980-49yv65gm	211	17	chickens	chicken	NNS
cord-279980-49yv65gm	211	18	should	should	MD
cord-279980-49yv65gm	211	19	be	be	VB
cord-279980-49yv65gm	211	20	further	further	RB
cord-279980-49yv65gm	211	21	performed	perform	VBN
cord-279980-49yv65gm	211	22	.	.	.
cord-279980-49yv65gm	212	1	A	a	DT
cord-279980-49yv65gm	212	2	review	review	NN
cord-279980-49yv65gm	212	3	of	of	IN
cord-279980-49yv65gm	212	4	avian	avian	JJ
cord-279980-49yv65gm	212	5	influenza	influenza	NN
cord-279980-49yv65gm	212	6	in	in	IN
cord-279980-49yv65gm	212	7	different	different	JJ
cord-279980-49yv65gm	212	8	bird	bird	NN
cord-279980-49yv65gm	212	9	species	specie	NNS
cord-279980-49yv65gm	212	10	Competence	competence	NN
cord-279980-49yv65gm	212	11	of	of	IN
cord-279980-49yv65gm	212	12	the	the	DT
cord-279980-49yv65gm	212	13	housefly	housefly	NN
cord-279980-49yv65gm	212	14	,	,	,
cord-279980-49yv65gm	212	15	Musca	Musca	NNP
cord-279980-49yv65gm	212	16	domestica	domestica	NN
cord-279980-49yv65gm	212	17	,	,	,
cord-279980-49yv65gm	212	18	as	as	IN
cord-279980-49yv65gm	212	19	a	a	DT
cord-279980-49yv65gm	212	20	vector	vector	NN
cord-279980-49yv65gm	212	21	of	of	IN
cord-279980-49yv65gm	212	22	Microsporum	Microsporum	NNP
cord-279980-49yv65gm	212	23	canis	canis	NN
cord-279980-49yv65gm	212	24	under	under	IN
cord-279980-49yv65gm	212	25	experimental	experimental	JJ
cord-279980-49yv65gm	212	26	conditions	condition	NNS
cord-279980-49yv65gm	212	27	Mechanical	mechanical	JJ
cord-279980-49yv65gm	212	28	transmission	transmission	NN
cord-279980-49yv65gm	212	29	of	of	IN
cord-279980-49yv65gm	212	30	turkey	turkey	NN
cord-279980-49yv65gm	212	31	coronavirus	coronavirus	NN
cord-279980-49yv65gm	212	32	by	by	IN
cord-279980-49yv65gm	212	33	domestic	domestic	JJ
cord-279980-49yv65gm	212	34	houseflies	housefly	NNS
cord-279980-49yv65gm	212	35	(	(	-LRB-
cord-279980-49yv65gm	212	36	Musca	Musca	NNP
cord-279980-49yv65gm	212	37	domestica	domestica	NNP
cord-279980-49yv65gm	212	38	Linnaeaus	Linnaeaus	NNP
cord-279980-49yv65gm	212	39	)	)	-RRB-
cord-279980-49yv65gm	212	40	Persistence	Persistence	NNP
cord-279980-49yv65gm	212	41	of	of	IN
cord-279980-49yv65gm	212	42	exotic	exotic	JJ
cord-279980-49yv65gm	212	43	newcastle	newcastle	NNP
cord-279980-49yv65gm	212	44	disease	disease	NNP
cord-279980-49yv65gm	212	45	virus	virus	NN
cord-279980-49yv65gm	212	46	(	(	-LRB-
cord-279980-49yv65gm	212	47	ENDV	ENDV	NNP
cord-279980-49yv65gm	212	48	)	)	-RRB-
cord-279980-49yv65gm	212	49	in	in	IN
cord-279980-49yv65gm	212	50	laboratory	laboratory	NN
cord-279980-49yv65gm	212	51	infected	infect	VBN
cord-279980-49yv65gm	212	52	Musca	Musca	NNP
cord-279980-49yv65gm	212	53	domestica	domestica	NN
cord-279980-49yv65gm	212	54	and	and	CC
cord-279980-49yv65gm	212	55	Fannia	Fannia	NNP
cord-279980-49yv65gm	212	56	canicularis	canicularis	NNP
cord-279980-49yv65gm	213	1	The	the	DT
cord-279980-49yv65gm	213	2	evolution	evolution	NN
cord-279980-49yv65gm	213	3	of	of	IN
cord-279980-49yv65gm	213	4	H5N1	H5N1	NNP
cord-279980-49yv65gm	213	5	influenza	influenza	NN
cord-279980-49yv65gm	213	6	viruses	virus	NNS
cord-279980-49yv65gm	213	7	in	in	IN
cord-279980-49yv65gm	213	8	ducks	duck	NNS
cord-279980-49yv65gm	213	9	in	in	IN
cord-279980-49yv65gm	213	10	southern	southern	JJ
cord-279980-49yv65gm	213	11	China	China	NNP
cord-279980-49yv65gm	213	12	.	.	.
cord-279980-49yv65gm	214	1	Proceeding	proceed	VBG
cord-279980-49yv65gm	214	2	of	of	IN
cord-279980-49yv65gm	214	3	the	the	DT
cord-279980-49yv65gm	214	4	National	National	NNP
cord-279980-49yv65gm	214	5	Academy	Academy	NNP
cord-279980-49yv65gm	214	6	of	of	IN
cord-279980-49yv65gm	214	7	Sciences	Sciences	NNPS
cord-279980-49yv65gm	214	8	of	of	IN
cord-279980-49yv65gm	214	9	the	the	DT
cord-279980-49yv65gm	214	10	United	United	NNP
cord-279980-49yv65gm	214	11	States	States	NNP
cord-279980-49yv65gm	214	12	America	America	NNP
cord-279980-49yv65gm	215	1	The	the	DT
cord-279980-49yv65gm	215	2	effect	effect	NN
cord-279980-49yv65gm	215	3	of	of	IN
cord-279980-49yv65gm	215	4	temperature	temperature	NN
cord-279980-49yv65gm	215	5	and	and	CC
cord-279980-49yv65gm	215	6	UV	uv	NN
cord-279980-49yv65gm	215	7	light	light	NN
cord-279980-49yv65gm	215	8	on	on	IN
cord-279980-49yv65gm	215	9	infectivity	infectivity	NN
cord-279980-49yv65gm	215	10	of	of	IN
cord-279980-49yv65gm	215	11	avian	avian	JJ
cord-279980-49yv65gm	215	12	influenza	influenza	NN
cord-279980-49yv65gm	215	13	virus	virus	NN
cord-279980-49yv65gm	215	14	(	(	-LRB-
cord-279980-49yv65gm	215	15	H5N1	H5N1	NNP
cord-279980-49yv65gm	215	16	,	,	,
cord-279980-49yv65gm	215	17	Thai	Thai	NNP
cord-279980-49yv65gm	215	18	field	field	NN
cord-279980-49yv65gm	215	19	strain	strain	NN
cord-279980-49yv65gm	215	20	)	)	-RRB-
cord-279980-49yv65gm	215	21	in	in	IN
cord-279980-49yv65gm	215	22	chicken	chicken	NN
cord-279980-49yv65gm	215	23	fecal	fecal	JJ
cord-279980-49yv65gm	215	24	manure	manure	NN
cord-279980-49yv65gm	215	25	Quantitative	quantitative	JJ
cord-279980-49yv65gm	215	26	contamination	contamination	NN
cord-279980-49yv65gm	215	27	and	and	CC
cord-279980-49yv65gm	215	28	transfer	transfer	NN
cord-279980-49yv65gm	215	29	of	of	IN
cord-279980-49yv65gm	215	30	Escherichia	Escherichia	NNP
cord-279980-49yv65gm	215	31	coli	coli	NNS
cord-279980-49yv65gm	215	32	from	from	IN
cord-279980-49yv65gm	215	33	foods	food	NNS
cord-279980-49yv65gm	215	34	by	by	IN
cord-279980-49yv65gm	215	35	houseflies	housefly	NNS
cord-279980-49yv65gm	215	36	,	,	,
cord-279980-49yv65gm	215	37	Musca	Musca	NNP
cord-279980-49yv65gm	215	38	domestica	domestica	NN
cord-279980-49yv65gm	215	39	L.	L.	NNP
cord-279980-49yv65gm	216	1	(	(	-LRB-
cord-279980-49yv65gm	216	2	Diptera	Diptera	NNP
cord-279980-49yv65gm	216	3	:	:	:
cord-279980-49yv65gm	216	4	Muscidae	Muscidae	NNP
cord-279980-49yv65gm	216	5	)	)	-RRB-
cord-279980-49yv65gm	216	6	Functional	Functional	NNP
cord-279980-49yv65gm	216	7	association	association	NN
cord-279980-49yv65gm	216	8	between	between	IN
cord-279980-49yv65gm	216	9	viral	viral	JJ
cord-279980-49yv65gm	216	10	and	and	CC
cord-279980-49yv65gm	216	11	cellular	cellular	JJ
cord-279980-49yv65gm	216	12	transcription	transcription	NN
cord-279980-49yv65gm	216	13	during	during	IN
cord-279980-49yv65gm	216	14	influenza	influenza	NN
cord-279980-49yv65gm	216	15	virus	virus	NN
cord-279980-49yv65gm	216	16	infection	infection	NN
cord-279980-49yv65gm	216	17	Pilot	Pilot	NNP
cord-279980-49yv65gm	216	18	study	study	NN
cord-279980-49yv65gm	216	19	on	on	IN
cord-279980-49yv65gm	216	20	synanthropic	synanthropic	NNP
cord-279980-49yv65gm	216	21	flies	fly	NNS
cord-279980-49yv65gm	216	22	(	(	-LRB-
cord-279980-49yv65gm	216	23	e.g.	e.g.	IN
cord-279980-49yv65gm	216	24	Musca	Musca	NNP
cord-279980-49yv65gm	216	25	,	,	,
cord-279980-49yv65gm	216	26	Sarcophaga	Sarcophaga	NNP
cord-279980-49yv65gm	216	27	,	,	,
cord-279980-49yv65gm	216	28	Calliphora	Calliphora	NNP
cord-279980-49yv65gm	216	29	,	,	,
cord-279980-49yv65gm	216	30	Fannia	Fannia	NNP
cord-279980-49yv65gm	216	31	,	,	,
cord-279980-49yv65gm	216	32	Lucilia	Lucilia	NNP
cord-279980-49yv65gm	216	33	,	,	,
cord-279980-49yv65gm	216	34	Stomoxys	Stomoxys	NNP
cord-279980-49yv65gm	216	35	)	)	-RRB-
cord-279980-49yv65gm	216	36	as	as	IN
cord-279980-49yv65gm	216	37	vectors	vector	NNS
cord-279980-49yv65gm	216	38	of	of	IN
cord-279980-49yv65gm	216	39	pathogenic	pathogenic	JJ
cord-279980-49yv65gm	216	40	microorganisms	microorganism	NNS
cord-279980-49yv65gm	216	41	Characterization	characterization	NN
cord-279980-49yv65gm	216	42	of	of	IN
cord-279980-49yv65gm	216	43	a	a	DT
cord-279980-49yv65gm	216	44	novel	novel	JJ
cord-279980-49yv65gm	216	45	influenza	influenza	NN
cord-279980-49yv65gm	216	46	A	a	DT
cord-279980-49yv65gm	216	47	virus	virus	NN
cord-279980-49yv65gm	216	48	hemagglutinin	hemagglutinin	NN
cord-279980-49yv65gm	216	49	subtype	subtype	NN
cord-279980-49yv65gm	216	50	(	(	-LRB-
cord-279980-49yv65gm	216	51	H16	H16	NNP
cord-279980-49yv65gm	216	52	)	)	-RRB-
cord-279980-49yv65gm	216	53	obtained	obtain	VBN
cord-279980-49yv65gm	216	54	from	from	IN
cord-279980-49yv65gm	216	55	black	black	JJ
cord-279980-49yv65gm	216	56	-	-	HYPH
cord-279980-49yv65gm	216	57	headed	head	VBN
cord-279980-49yv65gm	216	58	gulls	gull	NNS
cord-279980-49yv65gm	216	59	Flies	Flies	NNPS
cord-279980-49yv65gm	216	60	and	and	CC
cord-279980-49yv65gm	216	61	Disease	Disease	NNP
cord-279980-49yv65gm	217	1	The	the	DT
cord-279980-49yv65gm	217	2	House	House	NNP
cord-279980-49yv65gm	217	3	Fly	Fly	NNP
cord-279980-49yv65gm	217	4	and	and	CC
cord-279980-49yv65gm	217	5	its	-PRON-	PRP$
cord-279980-49yv65gm	217	6	Relatives	relative	NNS
cord-279980-49yv65gm	217	7	,	,	,
cord-279980-49yv65gm	217	8	Herms	Herms	NNPS
cord-279980-49yv65gm	217	9	's	's	POS
cord-279980-49yv65gm	217	10	Medical	medical	JJ
cord-279980-49yv65gm	217	11	Entomology	Entomology	NNP
cord-279980-49yv65gm	217	12	Isolation	Isolation	NNP
cord-279980-49yv65gm	217	13	of	of	IN
cord-279980-49yv65gm	217	14	Salmonella	Salmonella	NNP
cord-279980-49yv65gm	217	15	enterica	enterica	NNP
cord-279980-49yv65gm	217	16	serovar	serovar	NNP
cord-279980-49yv65gm	217	17	Enteritidis	Enteritidis	NNP
cord-279980-49yv65gm	217	18	from	from	IN
cord-279980-49yv65gm	217	19	houseflies	housefly	NNS
cord-279980-49yv65gm	217	20	(	(	-LRB-
cord-279980-49yv65gm	217	21	Musca	Musca	NNP
cord-279980-49yv65gm	217	22	domestica	domestica	NN
cord-279980-49yv65gm	217	23	)	)	-RRB-
cord-279980-49yv65gm	217	24	found	find	VBN
cord-279980-49yv65gm	217	25	in	in	IN
cord-279980-49yv65gm	217	26	rooms	room	NNS
cord-279980-49yv65gm	217	27	containing	contain	VBG
cord-279980-49yv65gm	217	28	Salmonella	Salmonella	NNP
cord-279980-49yv65gm	217	29	serovar	serovar	NNP
cord-279980-49yv65gm	217	30	Enteritidis	Enteritidis	NNP
cord-279980-49yv65gm	217	31	-	-	HYPH
cord-279980-49yv65gm	217	32	challenged	challenge	VBN
cord-279980-49yv65gm	217	33	hens	hen	NNS
cord-279980-49yv65gm	217	34	Experimental	experimental	JJ
cord-279980-49yv65gm	217	35	infection	infection	NN
cord-279980-49yv65gm	217	36	of	of	IN
cord-279980-49yv65gm	217	37	chickens	chicken	NNS
cord-279980-49yv65gm	217	38	,	,	,
cord-279980-49yv65gm	217	39	ducks	duck	NNS
cord-279980-49yv65gm	217	40	and	and	CC
cord-279980-49yv65gm	217	41	quails	quail	NNS
cord-279980-49yv65gm	217	42	with	with	IN
cord-279980-49yv65gm	217	43	the	the	DT
cord-279980-49yv65gm	217	44	highly	highly	RB
cord-279980-49yv65gm	217	45	pathogenic	pathogenic	JJ
cord-279980-49yv65gm	217	46	H5N1	H5N1	NNP
cord-279980-49yv65gm	217	47	avian	avian	JJ
cord-279980-49yv65gm	217	48	influenza	influenza	NN
cord-279980-49yv65gm	217	49	virus	virus	NN
cord-279980-49yv65gm	217	50	Movement	movement	NN
cord-279980-49yv65gm	217	51	and	and	CC
cord-279980-49yv65gm	217	52	distribution	distribution	NN
cord-279980-49yv65gm	217	53	of	of	IN
cord-279980-49yv65gm	217	54	house	house	NN
cord-279980-49yv65gm	217	55	flies	fly	NNS
cord-279980-49yv65gm	218	1	(	(	-LRB-
cord-279980-49yv65gm	218	2	Diptera	Diptera	NNP
cord-279980-49yv65gm	218	3	:	:	:
cord-279980-49yv65gm	218	4	Muscidae	Muscidae	NNP
cord-279980-49yv65gm	218	5	)	)	-RRB-
cord-279980-49yv65gm	218	6	between	between	IN
cord-279980-49yv65gm	218	7	habitats	habitat	NNS
cord-279980-49yv65gm	218	8	in	in	IN
cord-279980-49yv65gm	218	9	two	two	CD
cord-279980-49yv65gm	218	10	livestock	livestock	NN
cord-279980-49yv65gm	218	11	farms	farm	NNS
cord-279980-49yv65gm	219	1	Vector	vector	NN
cord-279980-49yv65gm	219	2	potential	potential	NN
cord-279980-49yv65gm	219	3	of	of	IN
cord-279980-49yv65gm	219	4	houseflies	housefly	NNS
cord-279980-49yv65gm	219	5	for	for	IN
cord-279980-49yv65gm	219	6	the	the	DT
cord-279980-49yv65gm	219	7	bacterium	bacterium	NN
cord-279980-49yv65gm	219	8	Aeromonas	Aeromonas	NNP
cord-279980-49yv65gm	219	9	caviae	caviae	NNP
cord-279980-49yv65gm	220	1	Influenza	Influenza	NNP
cord-279980-49yv65gm	220	2	,	,	,
cord-279980-49yv65gm	220	3	Manual	Manual	NNP
cord-279980-49yv65gm	220	4	of	of	IN
cord-279980-49yv65gm	220	5	Standards	Standards	NNPS
cord-279980-49yv65gm	220	6	for	for	IN
cord-279980-49yv65gm	220	7	Diagnostic	Diagnostic	NNP
cord-279980-49yv65gm	220	8	Tests	Tests	NNPS
cord-279980-49yv65gm	220	9	and	and	CC
cord-279980-49yv65gm	221	1	Vaccines	Vaccines	NNP
cord-279980-49yv65gm	221	2	Office	Office	NNP
cord-279980-49yv65gm	221	3	International	International	NNP
cord-279980-49yv65gm	221	4	des	des	FW
cord-279980-49yv65gm	221	5	Epizooties	Epizooties	NNP
cord-279980-49yv65gm	221	6	(	(	-LRB-
cord-279980-49yv65gm	221	7	OIE	OIE	NNP
cord-279980-49yv65gm	221	8	)	)	-RRB-
cord-279980-49yv65gm	221	9	(	(	-LRB-
cord-279980-49yv65gm	221	10	2008	2008	CD
cord-279980-49yv65gm	221	11	)	)	-RRB-
cord-279980-49yv65gm	222	1	Update	update	VB
cord-279980-49yv65gm	222	2	on	on	IN
cord-279980-49yv65gm	222	3	Highly	highly	RB
cord-279980-49yv65gm	222	4	Pathogenic	pathogenic	JJ
cord-279980-49yv65gm	222	5	Avian	avian	JJ
cord-279980-49yv65gm	222	6	Influenza	Influenza	NNP
cord-279980-49yv65gm	222	7	in	in	IN
cord-279980-49yv65gm	222	8	Animals	animal	NNS
cord-279980-49yv65gm	222	9	(	(	-LRB-
cord-279980-49yv65gm	222	10	type	type	NN
cord-279980-49yv65gm	222	11	H5	H5	NNP
cord-279980-49yv65gm	222	12	and	and	CC
cord-279980-49yv65gm	222	13	H7	H7	NNP
cord-279980-49yv65gm	222	14	Survival	Survival	NNP
cord-279980-49yv65gm	222	15	of	of	IN
cord-279980-49yv65gm	222	16	porcine	porcine	JJ
cord-279980-49yv65gm	222	17	reproductive	reproductive	JJ
cord-279980-49yv65gm	222	18	and	and	CC
cord-279980-49yv65gm	222	19	respiratory	respiratory	JJ
cord-279980-49yv65gm	222	20	syndrome	syndrome	NN
cord-279980-49yv65gm	222	21	virus	virus	NN
cord-279980-49yv65gm	222	22	in	in	IN
cord-279980-49yv65gm	222	23	houseflies	housefly	NNS
cord-279980-49yv65gm	222	24	Pathogenesis	Pathogenesis	NNP
cord-279980-49yv65gm	222	25	and	and	CC
cord-279980-49yv65gm	222	26	pathobiology	pathobiology	NN
cord-279980-49yv65gm	222	27	of	of	IN
cord-279980-49yv65gm	222	28	avian	avian	JJ
cord-279980-49yv65gm	222	29	influenza	influenza	NN
cord-279980-49yv65gm	222	30	virus	virus	NN
cord-279980-49yv65gm	222	31	infection	infection	NN
cord-279980-49yv65gm	222	32	in	in	IN
cord-279980-49yv65gm	222	33	birds	bird	NNS
cord-279980-49yv65gm	223	1	Single	single	JJ
cord-279980-49yv65gm	223	2	step	step	NN
cord-279980-49yv65gm	223	3	multiplex	multiplex	NN
cord-279980-49yv65gm	223	4	real	real	JJ
cord-279980-49yv65gm	223	5	-	-	HYPH
cord-279980-49yv65gm	223	6	time	time	NN
cord-279980-49yv65gm	223	7	RT	rt	NN
cord-279980-49yv65gm	223	8	-	-	HYPH
cord-279980-49yv65gm	223	9	PCR	PCR	NNP
cord-279980-49yv65gm	223	10	for	for	IN
cord-279980-49yv65gm	223	11	H5N1	H5N1	NNP
cord-279980-49yv65gm	224	1	influenza	influenza	NN
cord-279980-49yv65gm	224	2	A	a	DT
cord-279980-49yv65gm	224	3	virus	virus	NN
cord-279980-49yv65gm	224	4	detection	detection	NN
cord-279980-49yv65gm	225	1	A	a	DT
cord-279980-49yv65gm	225	2	simple	simple	JJ
cord-279980-49yv65gm	225	3	method	method	NN
cord-279980-49yv65gm	225	4	of	of	IN
cord-279980-49yv65gm	225	5	estimating	estimate	VBG
cord-279980-49yv65gm	225	6	fifty	fifty	CD
cord-279980-49yv65gm	225	7	percent	percent	NN
cord-279980-49yv65gm	225	8	endpoints	endpoint	NNS
cord-279980-49yv65gm	225	9	Survival	Survival	NNP
cord-279980-49yv65gm	225	10	of	of	IN
cord-279980-49yv65gm	225	11	avian	avian	JJ
cord-279980-49yv65gm	225	12	H5N1	H5N1	NNP
cord-279980-49yv65gm	225	13	influenza	influenza	NN
cord-279980-49yv65gm	225	14	A	a	DT
cord-279980-49yv65gm	225	15	viruses	virus	NNS
cord-279980-49yv65gm	225	16	in	in	IN
cord-279980-49yv65gm	225	17	Calliphora	Calliphora	NNP
cord-279980-49yv65gm	225	18	nigribarbis	nigribarbis	NNP
cord-279980-49yv65gm	226	1	(	(	-LRB-
cord-279980-49yv65gm	226	2	Diptera	Diptera	NNS
cord-279980-49yv65gm	226	3	:	:	:
cord-279980-49yv65gm	226	4	Calliphoridae	Calliphoridae	NNP
cord-279980-49yv65gm	226	5	)	)	-RRB-
cord-279980-49yv65gm	226	6	Origin	origin	NN
cord-279980-49yv65gm	226	7	and	and	CC
cord-279980-49yv65gm	226	8	evolution	evolution	NN
cord-279980-49yv65gm	226	9	of	of	IN
cord-279980-49yv65gm	226	10	highly	highly	RB
cord-279980-49yv65gm	226	11	pathogenic	pathogenic	JJ
cord-279980-49yv65gm	226	12	H5N1	H5N1	NNP
cord-279980-49yv65gm	226	13	avian	avian	JJ
cord-279980-49yv65gm	226	14	influenza	influenza	NN
cord-279980-49yv65gm	226	15	in	in	IN
cord-279980-49yv65gm	226	16	Asia	Asia	NNP
cord-279980-49yv65gm	226	17	Development	Development	NNP
cord-279980-49yv65gm	226	18	of	of	IN
cord-279980-49yv65gm	226	19	a	a	DT
cord-279980-49yv65gm	226	20	real	real	JJ
cord-279980-49yv65gm	226	21	-	-	HYPH
cord-279980-49yv65gm	226	22	time	time	NN
cord-279980-49yv65gm	226	23	reverse	reverse	NN
cord-279980-49yv65gm	226	24	transcriptase	transcriptase	NN
cord-279980-49yv65gm	226	25	PCR	pcr	NN
cord-279980-49yv65gm	226	26	assay	assay	NN
cord-279980-49yv65gm	226	27	for	for	IN
cord-279980-49yv65gm	226	28	type	type	NN
cord-279980-49yv65gm	226	29	A	a	DT
cord-279980-49yv65gm	226	30	influenza	influenza	NN
cord-279980-49yv65gm	226	31	virus	virus	NN
cord-279980-49yv65gm	226	32	and	and	CC
cord-279980-49yv65gm	226	33	the	the	DT
cord-279980-49yv65gm	226	34	avian	avian	JJ
cord-279980-49yv65gm	226	35	H5	H5	NNP
cord-279980-49yv65gm	226	36	and	and	CC
cord-279980-49yv65gm	226	37	H7	H7	NNP
cord-279980-49yv65gm	226	38	hemagglutinin	hemagglutinin	NN
cord-279980-49yv65gm	226	39	subtypes	subtype	NNS
cord-279980-49yv65gm	227	1	Influenza	Influenza	NNP
cord-279980-49yv65gm	227	2	,	,	,
cord-279980-49yv65gm	227	3	Diseases	Diseases	NNPS
cord-279980-49yv65gm	227	4	of	of	IN
cord-279980-49yv65gm	227	5	Poultry	Poultry	NNP
cord-279980-49yv65gm	227	6	Mechanical	Mechanical	NNP
cord-279980-49yv65gm	227	7	transport	transport	NN
cord-279980-49yv65gm	227	8	of	of	IN
cord-279980-49yv65gm	227	9	rotavirus	rotavirus	NN
cord-279980-49yv65gm	227	10	by	by	IN
cord-279980-49yv65gm	227	11	the	the	DT
cord-279980-49yv65gm	227	12	legs	leg	NNS
cord-279980-49yv65gm	227	13	and	and	CC
cord-279980-49yv65gm	227	14	wings	wing	NNS
cord-279980-49yv65gm	227	15	of	of	IN
cord-279980-49yv65gm	227	16	Musca	Musca	NNP
cord-279980-49yv65gm	227	17	domestica	domestica	NN
cord-279980-49yv65gm	227	18	(	(	-LRB-
cord-279980-49yv65gm	227	19	Diptera	Diptera	NNP
cord-279980-49yv65gm	227	20	:	:	:
cord-279980-49yv65gm	227	21	Muscidae	Muscidae	NNP
cord-279980-49yv65gm	227	22	)	)	-RRB-
cord-279980-49yv65gm	227	23	Transmission	transmission	NN
cord-279980-49yv65gm	227	24	of	of	IN
cord-279980-49yv65gm	227	25	the	the	DT
cord-279980-49yv65gm	227	26	highly	highly	RB
cord-279980-49yv65gm	227	27	pathogenic	pathogenic	JJ
cord-279980-49yv65gm	227	28	avian	avian	JJ
cord-279980-49yv65gm	227	29	influenza	influenza	NN
cord-279980-49yv65gm	227	30	A	a	DT
cord-279980-49yv65gm	227	31	virus	virus	NN
cord-279980-49yv65gm	227	32	(	(	-LRB-
cord-279980-49yv65gm	227	33	H5N1	H5N1	NNP
cord-279980-49yv65gm	227	34	)	)	-RRB-
cord-279980-49yv65gm	227	35	in	in	IN
cord-279980-49yv65gm	227	36	Thailand	Thailand	NNP
cord-279980-49yv65gm	227	37	Experimental	experimental	JJ
cord-279980-49yv65gm	227	38	evaluation	evaluation	NN
cord-279980-49yv65gm	227	39	of	of	IN
cord-279980-49yv65gm	227	40	Musca	Musca	NNP
cord-279980-49yv65gm	227	41	domestica	domestica	NN
cord-279980-49yv65gm	227	42	(	(	-LRB-
cord-279980-49yv65gm	227	43	Diptera	Diptera	NNP
cord-279980-49yv65gm	227	44	:	:	:
cord-279980-49yv65gm	227	45	Muscidae	Muscidae	NNP
cord-279980-49yv65gm	227	46	)	)	-RRB-
cord-279980-49yv65gm	227	47	as	as	IN
cord-279980-49yv65gm	227	48	a	a	DT
cord-279980-49yv65gm	227	49	vector	vector	NN
cord-279980-49yv65gm	227	50	of	of	IN
cord-279980-49yv65gm	227	51	Newcastle	Newcastle	NNP
cord-279980-49yv65gm	227	52	disease	disease	NN
cord-279980-49yv65gm	227	53	virus	virus	NN
cord-279980-49yv65gm	227	54	Cumulative	Cumulative	NNP
cord-279980-49yv65gm	227	55	Number	Number	NNP
cord-279980-49yv65gm	227	56	of	of	IN
cord-279980-49yv65gm	227	57	Confirmed	confirm	VBN
cord-279980-49yv65gm	227	58	Human	Human	NNP
cord-279980-49yv65gm	227	59	Cases	Cases	NNPS
cord-279980-49yv65gm	227	60	of	of	IN
cord-279980-49yv65gm	227	61	Avian	avian	JJ
cord-279980-49yv65gm	227	62	Influenza	Influenza	NNP
cord-279980-49yv65gm	227	63	A/(H5N1	A/(H5N1	NNP
cord-279980-49yv65gm	227	64	)	)	-RRB-
cord-279980-49yv65gm	228	1	Reported	report	VBN
cord-279980-49yv65gm	228	2	to	to	IN
cord-279980-49yv65gm	228	3	WHO	who	WP
cord-279980-49yv65gm	228	4	)	)	-RRB-
cord-279980-49yv65gm	229	1	Wings	wing	NNS
cord-279980-49yv65gm	229	2	of	of	IN
cord-279980-49yv65gm	229	3	the	the	DT
cord-279980-49yv65gm	229	4	common	common	JJ
cord-279980-49yv65gm	229	5	house	house	NNP
cord-279980-49yv65gm	229	6	fly	fly	NN
cord-279980-49yv65gm	229	7	(	(	-LRB-
cord-279980-49yv65gm	229	8	Musca	Musca	NNP
cord-279980-49yv65gm	229	9	domestica	domestica	NNP
cord-279980-49yv65gm	229	10	L.	L.	NNP
cord-279980-49yv65gm	229	11	)	)	-RRB-
cord-279980-49yv65gm	229	12	:	:	:
cord-279980-49yv65gm	229	13	importance	importance	NN
cord-279980-49yv65gm	229	14	in	in	IN
cord-279980-49yv65gm	229	15	mechanical	mechanical	JJ
cord-279980-49yv65gm	229	16	transmission	transmission	NN
cord-279980-49yv65gm	229	17	of	of	IN
cord-279980-49yv65gm	229	18	Vibrio	Vibrio	NNP
cord-279980-49yv65gm	229	19	cholerae	cholerae	NN
cord-279980-49yv65gm	230	1	The	the	DT
cord-279980-49yv65gm	230	2	authors	author	NNS
cord-279980-49yv65gm	230	3	are	be	VBP
cord-279980-49yv65gm	230	4	grateful	grateful	JJ
cord-279980-49yv65gm	230	5	to	to	IN
cord-279980-49yv65gm	230	6	Dr	Dr	NNP
cord-279980-49yv65gm	230	7	Nareerat	Nareerat	NNP
cord-279980-49yv65gm	230	8	Viseshakul	Viseshakul	NNP
cord-279980-49yv65gm	230	9	,	,	,
cord-279980-49yv65gm	230	10	Dr	Dr	NNP
cord-279980-49yv65gm	230	11	Jiroj	Jiroj	NNP
cord-279980-49yv65gm	230	12	Sasipreeyajan	Sasipreeyajan	NNP
cord-279980-49yv65gm	230	13	,	,	,
cord-279980-49yv65gm	230	14	Dr	Dr	NNP
cord-279980-49yv65gm	230	15	Padet	Padet	NNP
cord-279980-49yv65gm	230	16	Tammaruk	Tammaruk	NNP
cord-279980-49yv65gm	230	17	,	,	,
cord-279980-49yv65gm	230	18	the	the	DT
cord-279980-49yv65gm	230	19	Virology	Virology	NNP
cord-279980-49yv65gm	230	20	Unit	Unit	NNP
cord-279980-49yv65gm	230	21	,	,	,
cord-279980-49yv65gm	230	22	the	the	DT
cord-279980-49yv65gm	230	23	Veterinary	Veterinary	NNP
cord-279980-49yv65gm	230	24	Diagnostic	Diagnostic	NNP
cord-279980-49yv65gm	230	25	Laboratory	Laboratory	NNP
cord-279980-49yv65gm	230	26	,	,	,
cord-279980-49yv65gm	230	27	Faculty	Faculty	NNP
cord-279980-49yv65gm	230	28	of	of	IN
cord-279980-49yv65gm	230	29	Veterinary	Veterinary	NNP
cord-279980-49yv65gm	230	30	Science	Science	NNP
cord-279980-49yv65gm	230	31	,	,	,
cord-279980-49yv65gm	230	32	Chulalongkorn	Chulalongkorn	NNP
cord-279980-49yv65gm	230	33	University	University	NNP
cord-279980-49yv65gm	230	34	for	for	IN
cord-279980-49yv65gm	230	35	the	the	DT
cord-279980-49yv65gm	230	36	laboratory	laboratory	NN
cord-279980-49yv65gm	230	37	and	and	CC
cord-279980-49yv65gm	230	38	technical	technical	JJ
cord-279980-49yv65gm	230	39	assistance	assistance	NN
cord-279980-49yv65gm	230	40	.	.	.
cord-279980-49yv65gm	231	1	This	this	DT
cord-279980-49yv65gm	231	2	research	research	NN
cord-279980-49yv65gm	231	3	was	be	VBD
cord-279980-49yv65gm	231	4	supported	support	VBN
cord-279980-49yv65gm	231	5	by	by	IN
cord-279980-49yv65gm	231	6	a	a	DT
cord-279980-49yv65gm	231	7	grant	grant	NN
cord-279980-49yv65gm	231	8	from	from	IN
cord-279980-49yv65gm	231	9	the	the	DT
cord-279980-49yv65gm	231	10	program	program	NN
cord-279980-49yv65gm	231	11	Strategic	Strategic	NNP
cord-279980-49yv65gm	231	12	Scholarships	Scholarships	NNPS
cord-279980-49yv65gm	231	13	for	for	IN
cord-279980-49yv65gm	231	14	Frontier	Frontier	NNP
cord-279980-49yv65gm	231	15	Research	Research	NNP
cord-279980-49yv65gm	231	16	Network	Network	NNP
cord-279980-49yv65gm	231	17	for	for	IN
cord-279980-49yv65gm	231	18	the	the	DT
cord-279980-49yv65gm	231	19	Joint	Joint	NNP
cord-279980-49yv65gm	231	20	PhD	phd	NN
cord-279980-49yv65gm	231	21	Program	Program	NNP
cord-279980-49yv65gm	231	22	Thai	Thai	NNP
cord-279980-49yv65gm	231	23	Doctoral	Doctoral	NNP
cord-279980-49yv65gm	231	24	degree	degree	NN
cord-279980-49yv65gm	231	25	from	from	IN
cord-279980-49yv65gm	231	26	the	the	DT
cord-279980-49yv65gm	231	27	Office	Office	NNP
cord-279980-49yv65gm	231	28	of	of	IN
cord-279980-49yv65gm	231	29	the	the	DT
cord-279980-49yv65gm	231	30	Higher	Higher	NNP
cord-279980-49yv65gm	231	31	Education	Education	NNP
cord-279980-49yv65gm	231	32	Commission	Commission	NNP
cord-279980-49yv65gm	231	33	,	,	,
cord-279980-49yv65gm	231	34	Thailand	Thailand	NNP
cord-279980-49yv65gm	231	35	and	and	CC
cord-279980-49yv65gm	231	36	the	the	DT
cord-279980-49yv65gm	231	37	90	90	CD
cord-279980-49yv65gm	231	38	th	th	XX
cord-279980-49yv65gm	231	39	anniversary	anniversary	NN
cord-279980-49yv65gm	231	40	of	of	IN
cord-279980-49yv65gm	231	41	the	the	DT
cord-279980-49yv65gm	231	42	Chulalongkorn	Chulalongkorn	NNP
cord-279980-49yv65gm	231	43	University	University	NNP
cord-279980-49yv65gm	231	44	Fund	Fund	NNP
cord-279980-49yv65gm	231	45	(	(	-LRB-
cord-279980-49yv65gm	231	46	Ratchadaphiseksomphot	Ratchadaphiseksomphot	NNP
cord-279980-49yv65gm	231	47	Endowment	Endowment	NNP
cord-279980-49yv65gm	231	48	Fund	Fund	NNP
cord-279980-49yv65gm	231	49	)	)	-RRB-
cord-279980-49yv65gm	231	50	.	.	.
cord-279980-49yv65gm	232	1	Potential	potential	NN
cord-279980-49yv65gm	232	2	of	of	IN
cord-279980-49yv65gm	232	3	house	house	NN
cord-279980-49yv65gm	232	4	flies	fly	NNS
cord-279980-49yv65gm	232	5	as	as	IN
cord-279980-49yv65gm	232	6	a	a	DT
cord-279980-49yv65gm	232	7	vector	vector	NN
cord-279980-49yv65gm	232	8	of	of	IN
cord-279980-49yv65gm	232	9	AI	AI	NNP
cord-279980-49yv65gm	232	10	H5N1	H5N1	NNP
cord-279980-49yv65gm	232	11	63	63	CD