id sid tid token lemma pos cord-005309-147erliy 1 1 key key NN cord-005309-147erliy 1 2 : : : cord-005309-147erliy 2 1 cord-005309 cord-005309 VB cord-005309-147erliy 2 2 - - HYPH cord-005309-147erliy 2 3 147erliy 147erliy JJ cord-005309-147erliy 2 4 authors author NNS cord-005309-147erliy 2 5 : : : cord-005309-147erliy 2 6 Senanayake Senanayake NNP cord-005309-147erliy 2 7 , , , cord-005309-147erliy 2 8 Savithra Savithra NNP cord-005309-147erliy 2 9 D. D. NNP cord-005309-147erliy 2 10 ; ; : cord-005309-147erliy 2 11 Brian Brian NNP cord-005309-147erliy 2 12 , , , cord-005309-147erliy 2 13 David David NNP cord-005309-147erliy 2 14 A. A. NNP cord-005309-147erliy 3 1 title title NN cord-005309-147erliy 3 2 : : : cord-005309-147erliy 4 1 Precise precise JJ cord-005309-147erliy 4 2 large large JJ cord-005309-147erliy 4 3 deletions deletion NNS cord-005309-147erliy 4 4 by by IN cord-005309-147erliy 4 5 the the DT cord-005309-147erliy 4 6 PCR PCR NNP cord-005309-147erliy 4 7 - - HYPH cord-005309-147erliy 4 8 based base VBN cord-005309-147erliy 4 9 overlap overlap NN cord-005309-147erliy 4 10 extension extension NN cord-005309-147erliy 4 11 method method NN cord-005309-147erliy 4 12 date date NN cord-005309-147erliy 4 13 : : : cord-005309-147erliy 4 14 1995 1995 CD cord-005309-147erliy 4 15 journal journal NN cord-005309-147erliy 4 16 : : : cord-005309-147erliy 5 1 Mol Mol NNP cord-005309-147erliy 5 2 Biotechnol Biotechnol NNP cord-005309-147erliy 5 3 DOI doi NN cord-005309-147erliy 5 4 : : : cord-005309-147erliy 6 1 10.1007 10.1007 CD cord-005309-147erliy 6 2 / / SYM cord-005309-147erliy 6 3 bf02907467 bf02907467 VBN cord-005309-147erliy 6 4 sha sha NNP cord-005309-147erliy 6 5 : : : cord-005309-147erliy 6 6 e3c78c86ca2843975e37a2f5c36fb0665ae94f7b e3c78c86ca2843975e37a2f5c36fb0665ae94f7b NNP cord-005309-147erliy 6 7 doc_id doc_id CD cord-005309-147erliy 6 8 : : : cord-005309-147erliy 6 9 5309 5309 CD cord-005309-147erliy 6 10 cord_uid cord_uid NNS cord-005309-147erliy 6 11 : : : cord-005309-147erliy 7 1 147erliy 147erliy JJ cord-005309-147erliy 8 1 The the DT cord-005309-147erliy 8 2 authors author NNS cord-005309-147erliy 8 3 describe describe VBP cord-005309-147erliy 8 4 an an DT cord-005309-147erliy 8 5 efficient efficient JJ cord-005309-147erliy 8 6 method method NN cord-005309-147erliy 8 7 for for IN cord-005309-147erliy 8 8 generating generate VBG cord-005309-147erliy 8 9 large large JJ cord-005309-147erliy 8 10 deletions deletion NNS cord-005309-147erliy 8 11 ( ( -LRB- cord-005309-147erliy 8 12 > > NFP cord-005309-147erliy 8 13 200 200 CD cord-005309-147erliy 8 14 nts nts NNPS cord-005309-147erliy 8 15 ) ) -RRB- cord-005309-147erliy 8 16 of of IN cord-005309-147erliy 8 17 precise precise JJ cord-005309-147erliy 8 18 length length NN cord-005309-147erliy 8 19 using use VBG cord-005309-147erliy 8 20 the the DT cord-005309-147erliy 8 21 PCR PCR NNP cord-005309-147erliy 8 22 - - HYPH cord-005309-147erliy 8 23 based base VBN cord-005309-147erliy 8 24 method method NN cord-005309-147erliy 8 25 of of IN cord-005309-147erliy 8 26 gene gene NN cord-005309-147erliy 8 27 splicing splicing NN cord-005309-147erliy 8 28 by by IN cord-005309-147erliy 8 29 overlap overlap NN cord-005309-147erliy 8 30 extension extension NN cord-005309-147erliy 8 31 ( ( -LRB- cord-005309-147erliy 8 32 1 1 CD cord-005309-147erliy 8 33 ) ) -RRB- cord-005309-147erliy 8 34 . . . cord-005309-147erliy 9 1 This this DT cord-005309-147erliy 9 2 method method NN cord-005309-147erliy 9 3 is be VBZ cord-005309-147erliy 9 4 technically technically RB cord-005309-147erliy 9 5 simple simple JJ cord-005309-147erliy 9 6 and and CC cord-005309-147erliy 9 7 less less JJR cord-005309-147erliy 9 8 time time NN cord-005309-147erliy 9 9 consuming consume VBG cord-005309-147erliy 9 10 than than IN cord-005309-147erliy 9 11 conventional conventional JJ cord-005309-147erliy 9 12 loop loop NN cord-005309-147erliy 9 13 - - HYPH cord-005309-147erliy 9 14 out out RP cord-005309-147erliy 9 15 mutagenesis mutagenesis NN cord-005309-147erliy 9 16 techniques technique NNS cord-005309-147erliy 9 17 requiring require VBG cord-005309-147erliy 9 18 preparation preparation NN cord-005309-147erliy 9 19 of of IN cord-005309-147erliy 9 20 a a DT cord-005309-147erliy 9 21 single single RB cord-005309-147erliy 9 22 - - HYPH cord-005309-147erliy 9 23 stranded strand VBN cord-005309-147erliy 9 24 DNA dna NN cord-005309-147erliy 9 25 template template NN cord-005309-147erliy 9 26 . . . cord-005309-147erliy 10 1 Gene gene NN cord-005309-147erliy 10 2 splicing splicing NN cord-005309-147erliy 10 3 by by IN cord-005309-147erliy 10 4 overlap overlap NN cord-005309-147erliy 10 5 extension extension NN cord-005309-147erliy 10 6 or or CC cord-005309-147erliy 10 7 gene gene NN cord-005309-147erliy 10 8 SOEing SOEing NNP cord-005309-147erliy 10 9 ( ( -LRB- cord-005309-147erliy 10 10 1 1 CD cord-005309-147erliy 10 11 ) ) -RRB- cord-005309-147erliy 10 12 is be VBZ cord-005309-147erliy 10 13 a a DT cord-005309-147erliy 10 14 powerful powerful JJ cord-005309-147erliy 10 15 PCR pcr NN cord-005309-147erliy 10 16 - - HYPH cord-005309-147erliy 10 17 based base VBN cord-005309-147erliy 10 18 technique technique NN cord-005309-147erliy 10 19 for for IN cord-005309-147erliy 10 20 generating generate VBG cord-005309-147erliy 10 21 recombinant recombinant JJ cord-005309-147erliy 10 22 DNA dna NN cord-005309-147erliy 10 23 molecules molecule NNS cord-005309-147erliy 10 24 . . . cord-005309-147erliy 11 1 One one CD cord-005309-147erliy 11 2 major major JJ cord-005309-147erliy 11 3 advantage advantage NN cord-005309-147erliy 11 4 of of IN cord-005309-147erliy 11 5 the the DT cord-005309-147erliy 11 6 technique technique NN cord-005309-147erliy 11 7 is be VBZ cord-005309-147erliy 11 8 that that IN cord-005309-147erliy 11 9 there there EX cord-005309-147erliy 11 10 is be VBZ cord-005309-147erliy 11 11 no no DT cord-005309-147erliy 11 12 need need NN cord-005309-147erliy 11 13 to to TO cord-005309-147erliy 11 14 rely rely VB cord-005309-147erliy 11 15 on on IN cord-005309-147erliy 11 16 restriction restriction NN cord-005309-147erliy 11 17 endonuclease endonuclease NN cord-005309-147erliy 11 18 sites site NNS cord-005309-147erliy 11 19 for for IN cord-005309-147erliy 11 20 generating generate VBG cord-005309-147erliy 11 21 recombinants recombinant NNS cord-005309-147erliy 11 22 . . . cord-005309-147erliy 12 1 Here here RB cord-005309-147erliy 12 2 , , , cord-005309-147erliy 12 3 we -PRON- PRP cord-005309-147erliy 12 4 describe describe VBP cord-005309-147erliy 12 5 how how WRB cord-005309-147erliy 12 6 the the DT cord-005309-147erliy 12 7 gene gene NN cord-005309-147erliy 12 8 splicing splicing NN cord-005309-147erliy 12 9 by by IN cord-005309-147erliy 12 10 overlap overlap NN cord-005309-147erliy 12 11 extension extension NN cord-005309-147erliy 12 12 technique technique NN cord-005309-147erliy 12 13 can can MD cord-005309-147erliy 12 14 be be VB cord-005309-147erliy 12 15 adapted adapt VBN cord-005309-147erliy 12 16 to to TO cord-005309-147erliy 12 17 create create VB cord-005309-147erliy 12 18 large large JJ cord-005309-147erliy 12 19 deletions deletion NNS cord-005309-147erliy 12 20 . . . cord-005309-147erliy 13 1 Unlike unlike IN cord-005309-147erliy 13 2 conventional conventional JJ cord-005309-147erliy 13 3 loop loop NN cord-005309-147erliy 13 4 - - HYPH cord-005309-147erliy 13 5 out out RP cord-005309-147erliy 13 6 mutagenesis mutagenesis NN cord-005309-147erliy 13 7 techniques technique NNS cord-005309-147erliy 13 8 that that WDT cord-005309-147erliy 13 9 require require VBP cord-005309-147erliy 13 10 preparation preparation NN cord-005309-147erliy 13 11 of of IN cord-005309-147erliy 13 12 ssDNA ssdna JJ cord-005309-147erliy 13 13 template template NN cord-005309-147erliy 13 14 ( ( -LRB- cord-005309-147erliy 13 15 2 2 CD cord-005309-147erliy 13 16 , , , cord-005309-147erliy 13 17 3 3 CD cord-005309-147erliy 13 18 ) ) -RRB- cord-005309-147erliy 13 19 , , , cord-005309-147erliy 13 20 this this DT cord-005309-147erliy 13 21 method method NN cord-005309-147erliy 13 22 utilizes utilize VBZ cord-005309-147erliy 13 23 cloned clone VBN cord-005309-147erliy 13 24 ds ds NNP cord-005309-147erliy 13 25 DNA DNA NNP cord-005309-147erliy 13 26 as as IN cord-005309-147erliy 13 27 the the DT cord-005309-147erliy 13 28 starting starting NN cord-005309-147erliy 13 29 material material NN cord-005309-147erliy 13 30 . . . cord-005309-147erliy 14 1 To to TO cord-005309-147erliy 14 2 produce produce VB cord-005309-147erliy 14 3 recombinant recombinant JJ cord-005309-147erliy 14 4 molecules molecule NNS cord-005309-147erliy 14 5 , , , cord-005309-147erliy 14 6 four four CD cord-005309-147erliy 14 7 oligonucleotide oligonucleotide JJ cord-005309-147erliy 14 8 primers primer NNS cord-005309-147erliy 14 9 are be VBP cord-005309-147erliy 14 10 used use VBN cord-005309-147erliy 14 11 to to TO cord-005309-147erliy 14 12 perform perform VB cord-005309-147erliy 14 13 three three CD cord-005309-147erliy 14 14 rounds round NNS cord-005309-147erliy 14 15 of of IN cord-005309-147erliy 14 16 PCR PCR NNP cord-005309-147erliy 14 17 . . . cord-005309-147erliy 15 1 In in IN cord-005309-147erliy 15 2 the the DT cord-005309-147erliy 15 3 first first JJ cord-005309-147erliy 15 4 round round NN cord-005309-147erliy 15 5 the the DT cord-005309-147erliy 15 6 deleted delete VBN cord-005309-147erliy 15 7 fragment fragment NN cord-005309-147erliy 15 8 is be VBZ cord-005309-147erliy 15 9 generated generate VBN cord-005309-147erliy 15 10 and and CC cord-005309-147erliy 15 11 amplified amplify VBN cord-005309-147erliy 15 12 , , , cord-005309-147erliy 15 13 in in IN cord-005309-147erliy 15 14 the the DT cord-005309-147erliy 15 15 second second JJ cord-005309-147erliy 15 16 round round NN cord-005309-147erliy 15 17 the the DT cord-005309-147erliy 15 18 overlapping overlapping JJ cord-005309-147erliy 15 19 fragment fragment NN cord-005309-147erliy 15 20 is be VBZ cord-005309-147erliy 15 21 amplified amplify VBN cord-005309-147erliy 15 22 , , , cord-005309-147erliy 15 23 and and CC cord-005309-147erliy 15 24 in in IN cord-005309-147erliy 15 25 the the DT cord-005309-147erliy 15 26 third third JJ cord-005309-147erliy 15 27 round round NN cord-005309-147erliy 15 28 the the DT cord-005309-147erliy 15 29 recombinant recombinant JJ cord-005309-147erliy 15 30 molecule molecule NN cord-005309-147erliy 15 31 is be VBZ cord-005309-147erliy 15 32 generated generate VBN cord-005309-147erliy 15 33 and and CC cord-005309-147erliy 15 34 amplified amplify VBN cord-005309-147erliy 15 35 . . . cord-005309-147erliy 16 1 We -PRON- PRP cord-005309-147erliy 16 2 illustrate illustrate VBP cord-005309-147erliy 16 3 the the DT cord-005309-147erliy 16 4 procedure procedure NN cord-005309-147erliy 16 5 by by IN cord-005309-147erliy 16 6 creating create VBG cord-005309-147erliy 16 7 a a DT cord-005309-147erliy 16 8 288 288 CD cord-005309-147erliy 16 9 nt nt NN cord-005309-147erliy 16 10 deletion deletion NN cord-005309-147erliy 16 11 within within IN cord-005309-147erliy 16 12 the the DT cord-005309-147erliy 16 13 open open JJ cord-005309-147erliy 16 14 reading reading NN cord-005309-147erliy 16 15 frame frame NN cord-005309-147erliy 16 16 of of IN cord-005309-147erliy 16 17 a a DT cord-005309-147erliy 16 18 cloned clone VBN cord-005309-147erliy 16 19 defectiveinterfering defectiveinterfere VBG cord-005309-147erliy 16 20 RNA RNA NNP cord-005309-147erliy 16 21 of of IN cord-005309-147erliy 16 22 the the DT cord-005309-147erliy 16 23 bovine bovine JJ cord-005309-147erliy 16 24 coronavirus coronavirus NN cord-005309-147erliy 16 25 . . . cord-005309-147erliy 16 26 _SP cord-005309-147erliy 17 1 A a DT cord-005309-147erliy 17 2 cloned clone VBN cord-005309-147erliy 17 3 2231 2231 CD cord-005309-147erliy 17 4 nt nt RB cord-005309-147erliy 17 5 subgenomic subgenomic NNP cord-005309-147erliy 17 6 defective defective NNP cord-005309-147erliy 17 7 - - HYPH cord-005309-147erliy 17 8 interfering interfere VBG cord-005309-147erliy 17 9 RNA RNA NNP cord-005309-147erliy 17 10 of of IN cord-005309-147erliy 17 11 the the DT cord-005309-147erliy 17 12 bovine bovine JJ cord-005309-147erliy 17 13 coronavirus coronavirus NN cord-005309-147erliy 17 14 in in IN cord-005309-147erliy 17 15 the the DT cord-005309-147erliy 17 16 pGEM3Zf(- pgem3zf(- JJ cord-005309-147erliy 17 17 ) ) -RRB- cord-005309-147erliy 17 18 vector vector NN cord-005309-147erliy 17 19 ( ( -LRB- cord-005309-147erliy 17 20 Promega Promega NNP cord-005309-147erliy 17 21 ) ) -RRB- cord-005309-147erliy 17 22 , , . cord-005309-147erliy 18 1 containing contain VBG cord-005309-147erliy 18 2 an an DT cord-005309-147erliy 18 3 in in IN cord-005309-147erliy 18 4 - - HYPH cord-005309-147erliy 18 5 frame frame NN cord-005309-147erliy 18 6 reporter reporter NN cord-005309-147erliy 18 7 sequence sequence NN cord-005309-147erliy 18 8 and and CC cord-005309-147erliy 18 9 called call VBN cord-005309-147erliy 18 10 pDrepl pDrepl NNP cord-005309-147erliy 18 11 ( ( -LRB- cord-005309-147erliy 18 12 4 4 LS cord-005309-147erliy 18 13 ) ) -RRB- cord-005309-147erliy 18 14 ( ( -LRB- cord-005309-147erliy 18 15 Fig Fig NNP cord-005309-147erliy 18 16 . . NNP cord-005309-147erliy 18 17 1 1 CD cord-005309-147erliy 18 18 ) ) -RRB- cord-005309-147erliy 18 19 was be VBD cord-005309-147erliy 18 20 used use VBN cord-005309-147erliy 18 21 for for IN cord-005309-147erliy 18 22 large large JJ cord-005309-147erliy 18 23 deletion deletion NN cord-005309-147erliy 18 24 mutagenesis mutagenesis NN cord-005309-147erliy 18 25 . . . cord-005309-147erliy 19 1 The the DT cord-005309-147erliy 19 2 cloned clone VBN cord-005309-147erliy 19 3 sequence sequence NN cord-005309-147erliy 19 4 contains contain VBZ cord-005309-147erliy 19 5 a a DT cord-005309-147erliy 19 6 5 5 CD cord-005309-147erliy 19 7 ' ' POS cord-005309-147erliy 19 8 untranslated untranslated JJ cord-005309-147erliy 19 9 region region NN cord-005309-147erliy 19 10 of of IN cord-005309-147erliy 19 11 210 210 CD cord-005309-147erliy 19 12 nt nt RB cord-005309-147erliy 19 13 , , , cord-005309-147erliy 19 14 an an DT cord-005309-147erliy 19 15 open open JJ cord-005309-147erliy 19 16 reading reading NN cord-005309-147erliy 19 17 frame frame NN cord-005309-147erliy 19 18 of of IN cord-005309-147erliy 19 19 1662 1662 CD cord-005309-147erliy 19 20 nt nt RB cord-005309-147erliy 19 21 comprised comprise VBN cord-005309-147erliy 19 22 of of IN cord-005309-147erliy 19 23 an an DT cord-005309-147erliy 19 24 in in IN cord-005309-147erliy 19 25 - - HYPH cord-005309-147erliy 19 26 frame frame NN cord-005309-147erliy 19 27 fusion fusion NN cord-005309-147erliy 19 28 of of IN cord-005309-147erliy 19 29 two two CD cord-005309-147erliy 19 30 natural natural JJ cord-005309-147erliy 19 31 ORFs ORFs NNP cord-005309-147erliy 19 32 , , , cord-005309-147erliy 19 33 ORF1 ORF1 NNP cord-005309-147erliy 19 34 , , , cord-005309-147erliy 19 35 and and CC cord-005309-147erliy 19 36 ORF2 ORF2 NNP cord-005309-147erliy 20 1 ( ( -LRB- cord-005309-147erliy 20 2 ORF2 ORF2 NNP cord-005309-147erliy 20 3 contains contain VBZ cord-005309-147erliy 20 4 the the DT cord-005309-147erliy 20 5 30 30 CD cord-005309-147erliy 20 6 nt nt NN cord-005309-147erliy 20 7 in in IN cord-005309-147erliy 20 8 - - HYPH cord-005309-147erliy 20 9 frame frame NN cord-005309-147erliy 20 10 reporter reporter NN cord-005309-147erliy 20 11 sequence sequence NN cord-005309-147erliy 20 12 ) ) -RRB- cord-005309-147erliy 20 13 , , , cord-005309-147erliy 20 14 and and CC cord-005309-147erliy 20 15 a a DT cord-005309-147erliy 20 16 3 3 CD cord-005309-147erliy 20 17 ' ' POS cord-005309-147erliy 20 18 untranslated untranslated JJ cord-005309-147erliy 20 19 region region NN cord-005309-147erliy 20 20 of of IN cord-005309-147erliy 20 21 359 359 CD cord-005309-147erliy 20 22 nt nt RB cord-005309-147erliy 20 23 that that WDT cord-005309-147erliy 20 24 includes include VBZ cord-005309-147erliy 20 25 a a DT cord-005309-147erliy 20 26 poly poly NN cord-005309-147erliy 20 27 ( ( -LRB- cord-005309-147erliy 20 28 A a NN cord-005309-147erliy 20 29 ) ) -RRB- cord-005309-147erliy 20 30 tail tail NN cord-005309-147erliy 20 31 of of IN cord-005309-147erliy 20 32 68 68 CD cord-005309-147erliy 20 33 nt nt RB cord-005309-147erliy 20 34 . . . cord-005309-147erliy 21 1 For for IN cord-005309-147erliy 21 2 the the DT cord-005309-147erliy 21 3 deletion deletion NN cord-005309-147erliy 21 4 reaction reaction NN cord-005309-147erliy 21 5 in in IN cord-005309-147erliy 21 6 the the DT cord-005309-147erliy 21 7 5 5 CD cord-005309-147erliy 21 8 ' ' POS cord-005309-147erliy 21 9 terminal terminal NN cord-005309-147erliy 21 10 fragment fragment NN cord-005309-147erliy 21 11 , , , cord-005309-147erliy 21 12 primer primer VB cord-005309-147erliy 21 13 A a DT cord-005309-147erliy 21 14 , , , cord-005309-147erliy 21 15 5'GTTGTAAAACGACGGCCA 5'gttgtaaaacgacggcca CD cord-005309-147erliy 21 16 * * NFP cord-005309-147erliy 21 17 Author author NN cord-005309-147erliy 21 18 to to TO cord-005309-147erliy 21 19 whom whom WP cord-005309-147erliy 21 20 all all DT cord-005309-147erliy 21 21 correspondence correspondence NN cord-005309-147erliy 21 22 and and CC cord-005309-147erliy 21 23 reprint reprint NN cord-005309-147erliy 21 24 requests request NNS cord-005309-147erliy 21 25 should should MD cord-005309-147erliy 21 26 be be VB cord-005309-147erliy 21 27 addressed address VBN cord-005309-147erliy 21 28 . . . cord-005309-147erliy 22 1 Department Department NNP cord-005309-147erliy 22 2 of of IN cord-005309-147erliy 22 3 Microbiology Microbiology NNP cord-005309-147erliy 22 4 , , , cord-005309-147erliy 22 5 The the DT cord-005309-147erliy 22 6 University University NNP cord-005309-147erliy 22 7 of of IN cord-005309-147erliy 22 8 Tennessee Tennessee NNP cord-005309-147erliy 22 9 , , , cord-005309-147erliy 22 10 Knoxville Knoxville NNP cord-005309-147erliy 22 11 , , , cord-005309-147erliy 22 12 TN TN NNP cord-005309-147erliy 22 13 37996 37996 CD cord-005309-147erliy 22 14 - - HYPH cord-005309-147erliy 22 15 0845 0845 CD cord-005309-147erliy 22 16 . . . cord-005309-147erliy 23 1 In in IN cord-005309-147erliy 23 2 step step NN cord-005309-147erliy 23 3 II II NNP cord-005309-147erliy 23 4 , , , cord-005309-147erliy 23 5 the the DT cord-005309-147erliy 23 6 3 3 CD cord-005309-147erliy 23 7 ' ' POS cord-005309-147erliy 23 8 terminal terminal NN cord-005309-147erliy 23 9 1069 1069 CD cord-005309-147erliy 23 10 nt nt RB cord-005309-147erliy 23 11 fragment fragment NN cord-005309-147erliy 23 12 is be VBZ cord-005309-147erliy 23 13 amplified amplify VBN cord-005309-147erliy 23 14 . . . cord-005309-147erliy 24 1 In in IN cord-005309-147erliy 24 2 step step NN cord-005309-147erliy 24 3 III III NNP cord-005309-147erliy 24 4 , , , cord-005309-147erliy 24 5 the the DT cord-005309-147erliy 24 6 full full JJ cord-005309-147erliy 24 7 - - HYPH cord-005309-147erliy 24 8 length length NN cord-005309-147erliy 24 9 1319 1319 CD cord-005309-147erliy 24 10 nt nt RB cord-005309-147erliy 24 11 fragment fragment NN cord-005309-147erliy 24 12 is be VBZ cord-005309-147erliy 24 13 amplified amplify VBN cord-005309-147erliy 24 14 . . . cord-005309-147erliy 25 1 The the DT cord-005309-147erliy 25 2 846 846 CD cord-005309-147erliy 25 3 nt nt RB cord-005309-147erliy 25 4 BgllI BgllI NNP cord-005309-147erliy 25 5 fragment fragment NN cord-005309-147erliy 25 6 from from IN cord-005309-147erliy 25 7 the the DT cord-005309-147erliy 25 8 product product NN cord-005309-147erliy 25 9 in in IN cord-005309-147erliy 25 10 step step NN cord-005309-147erliy 25 11 III III NNP cord-005309-147erliy 25 12 is be VBZ cord-005309-147erliy 25 13 used use VBN cord-005309-147erliy 25 14 to to TO cord-005309-147erliy 25 15 replace replace VB cord-005309-147erliy 25 16 the the DT cord-005309-147erliy 25 17 1043 1043 CD cord-005309-147erliy 25 18 nt nt RB cord-005309-147erliy 25 19 BgllI BgllI NNP cord-005309-147erliy 25 20 fragment fragment NN cord-005309-147erliy 25 21 of of IN cord-005309-147erliy 25 22 pDrepl pDrepl NNP cord-005309-147erliy 25 23 , , , cord-005309-147erliy 25 24 to to TO cord-005309-147erliy 25 25 form form VB cord-005309-147erliy 25 26 the the DT cord-005309-147erliy 25 27 resultant resultant JJ cord-005309-147erliy 25 28 mutant mutant NN cord-005309-147erliy 25 29 . . . cord-005309-147erliy 26 1 GT3 GT3 NNP cord-005309-147erliy 26 2 ' ' POS cord-005309-147erliy 26 3 , , , cord-005309-147erliy 26 4 the the DT cord-005309-147erliy 26 5 " " `` cord-005309-147erliy 26 6 universal universal JJ cord-005309-147erliy 26 7 " " '' cord-005309-147erliy 26 8 primer primer NN cord-005309-147erliy 26 9 for for IN cord-005309-147erliy 26 10 pGEM pgem JJ cord-005309-147erliy 26 11 vectors vector NNS cord-005309-147erliy 26 12 , , , cord-005309-147erliy 26 13 and and CC cord-005309-147erliy 26 14 primer primer NN cord-005309-147erliy 26 15 B B NNP cord-005309-147erliy 26 16 , , , cord-005309-147erliy 26 17 5'CTTACCAGGAGTAAAAGA 5'cttaccaggagtaaaaga CD cord-005309-147erliy 26 18 CATTGTGACCTATGGGTGGGCC3 CATTGTGACCTATGGGTGGGCC3 NNP cord-005309-147erliy 26 19 ' ' '' cord-005309-147erliy 26 20 , , , cord-005309-147erliy 26 21 which which WDT cord-005309-147erliy 26 22 anneals anneal VBZ cord-005309-147erliy 26 23 to to IN cord-005309-147erliy 26 24 bases basis NNS cord-005309-147erliy 26 25 192 192 CD cord-005309-147erliy 26 26 - - SYM cord-005309-147erliy 26 27 213 213 CD cord-005309-147erliy 26 28 and and CC cord-005309-147erliy 26 29 502 502 CD cord-005309-147erliy 26 30 - - SYM cord-005309-147erliy 26 31 519 519 CD cord-005309-147erliy 26 32 in in IN cord-005309-147erliy 26 33 the the DT cord-005309-147erliy 26 34 genome genome NN cord-005309-147erliy 26 35 - - HYPH cord-005309-147erliy 26 36 sense sense NN cord-005309-147erliy 26 37 ( ( -LRB- cord-005309-147erliy 26 38 plus plus CC cord-005309-147erliy 26 39 ) ) -RRB- cord-005309-147erliy 26 40 strand strand NN cord-005309-147erliy 26 41 of of IN cord-005309-147erliy 26 42 pDrepl pDrepl NNP cord-005309-147erliy 26 43 and and CC cord-005309-147erliy 26 44 forms form VBZ cord-005309-147erliy 26 45 the the DT cord-005309-147erliy 26 46 deletion deletion NN cord-005309-147erliy 26 47 , , , cord-005309-147erliy 26 48 were be VBD cord-005309-147erliy 26 49 used use VBN cord-005309-147erliy 26 50 in in IN cord-005309-147erliy 26 51 the the DT cord-005309-147erliy 26 52 first first JJ cord-005309-147erliy 26 53 round round NN cord-005309-147erliy 26 54 of of IN cord-005309-147erliy 26 55 PCR PCR NNP cord-005309-147erliy 26 56 . . . cord-005309-147erliy 27 1 For for IN cord-005309-147erliy 27 2 this this DT cord-005309-147erliy 27 3 , , , cord-005309-147erliy 27 4 10 10 CD cord-005309-147erliy 27 5 ng ng NN cord-005309-147erliy 27 6 of of IN cord-005309-147erliy 27 7 pDrepl pDrepl NNP cord-005309-147erliy 27 8 DNA DNA NNP cord-005309-147erliy 27 9 were be VBD cord-005309-147erliy 27 10 used use VBN cord-005309-147erliy 27 11 in in IN cord-005309-147erliy 27 12 a a DT cord-005309-147erliy 27 13 20l.tL 20l.tl CD cord-005309-147erliy 27 14 PCR pcr NN cord-005309-147erliy 27 15 mixture mixture NN cord-005309-147erliy 27 16 containing contain VBG cord-005309-147erliy 27 17 1 1 CD cord-005309-147erliy 27 18 l.tL l.tL NNP cord-005309-147erliy 27 19 10X 10X JJR cord-005309-147erliy 27 20 PCR PCR NNP cord-005309-147erliy 27 21 buffer buffer NN cord-005309-147erliy 27 22 , , , cord-005309-147erliy 27 23 3 3 CD cord-005309-147erliy 27 24 ~tL ~tl NN cord-005309-147erliy 27 25 of of IN cord-005309-147erliy 27 26 dNTP dNTP NNP cord-005309-147erliy 27 27 mix mix NN cord-005309-147erliy 27 28 , , , cord-005309-147erliy 27 29 20 20 CD cord-005309-147erliy 27 30 pmols pmol NNS cord-005309-147erliy 27 31 each each DT cord-005309-147erliy 27 32 of of IN cord-005309-147erliy 27 33 primer primer NN cord-005309-147erliy 27 34 A a NN cord-005309-147erliy 27 35 and and CC cord-005309-147erliy 27 36 B b NN cord-005309-147erliy 27 37 , , , cord-005309-147erliy 27 38 1 1 CD cord-005309-147erliy 27 39 U u NN cord-005309-147erliy 27 40 Taq taq NN cord-005309-147erliy 27 41 DNA dna NN cord-005309-147erliy 27 42 polymerase polymerase NN cord-005309-147erliy 27 43 , , , cord-005309-147erliy 27 44 and and CC cord-005309-147erliy 27 45 the the DT cord-005309-147erliy 27 46 mixture mixture NN cord-005309-147erliy 27 47 was be VBD cord-005309-147erliy 27 48 overlaid overlay VBN cord-005309-147erliy 27 49 with with IN cord-005309-147erliy 27 50 1 1 CD cord-005309-147erliy 27 51 drop drop NN cord-005309-147erliy 27 52 of of IN cord-005309-147erliy 27 53 mineral mineral NN cord-005309-147erliy 27 54 oil oil NN cord-005309-147erliy 27 55 and and CC cord-005309-147erliy 27 56 subjected subject VBN cord-005309-147erliy 27 57 to to IN cord-005309-147erliy 27 58 30 30 CD cord-005309-147erliy 27 59 thermal thermal JJ cord-005309-147erliy 27 60 cycles cycle NNS cord-005309-147erliy 27 61 : : : cord-005309-147erliy 27 62 10 10 CD cord-005309-147erliy 27 63 cycles cycle NNS cord-005309-147erliy 27 64 at at IN cord-005309-147erliy 27 65 94~ 94~ CD cord-005309-147erliy 27 66 for for IN cord-005309-147erliy 27 67 1 1 CD cord-005309-147erliy 27 68 min min NN cord-005309-147erliy 27 69 , , , cord-005309-147erliy 27 70 55~ 55~ CD cord-005309-147erliy 27 71 for for IN cord-005309-147erliy 27 72 6 6 CD cord-005309-147erliy 27 73 min min NN cord-005309-147erliy 27 74 , , , cord-005309-147erliy 27 75 72~ 72~ CD cord-005309-147erliy 27 76 for for IN cord-005309-147erliy 27 77 2 2 CD cord-005309-147erliy 27 78 min min NN cord-005309-147erliy 27 79 followed follow VBN cord-005309-147erliy 27 80 by by IN cord-005309-147erliy 27 81 20 20 CD cord-005309-147erliy 27 82 cycles cycle NNS cord-005309-147erliy 27 83 at at IN cord-005309-147erliy 27 84 94~ 94~ CD cord-005309-147erliy 27 85 for for IN cord-005309-147erliy 27 86 1 1 CD cord-005309-147erliy 27 87 min min NN cord-005309-147erliy 27 88 , , , cord-005309-147erliy 27 89 55~ 55~ CD cord-005309-147erliy 27 90 for for IN cord-005309-147erliy 27 91 3 3 CD cord-005309-147erliy 27 92 min min NN cord-005309-147erliy 27 93 , , , cord-005309-147erliy 27 94 and and CC cord-005309-147erliy 27 95 72~ 72~ CD cord-005309-147erliy 27 96 for for IN cord-005309-147erliy 27 97 1 1 CD cord-005309-147erliy 27 98 min min NN cord-005309-147erliy 27 99 . . . cord-005309-147erliy 28 1 To to TO cord-005309-147erliy 28 2 create create VB cord-005309-147erliy 28 3 the the DT cord-005309-147erliy 28 4 3 3 CD cord-005309-147erliy 28 5 ' ' POS cord-005309-147erliy 28 6 terminal terminal JJ cord-005309-147erliy 28 7 fragment fragment NN cord-005309-147erliy 28 8 , , , cord-005309-147erliy 28 9 primer primer NN cord-005309-147erliy 28 10 C C NNP cord-005309-147erliy 28 11 , , , cord-005309-147erliy 28 12 5'ATGTCTTTTACTCCTGGTAAG3 5'atgtcttttactcctggtaag3 CD cord-005309-147erliy 28 13 ' ' '' cord-005309-147erliy 28 14 , , , cord-005309-147erliy 28 15 which which WDT cord-005309-147erliy 28 16 is be VBZ cord-005309-147erliy 28 17 complementary complementary JJ cord-005309-147erliy 28 18 to to IN cord-005309-147erliy 28 19 the the DT cord-005309-147erliy 28 20 5 5 CD cord-005309-147erliy 28 21 ' ' POS cord-005309-147erliy 28 22 21 21 CD cord-005309-147erliy 28 23 bases basis NNS cord-005309-147erliy 28 24 of of IN cord-005309-147erliy 28 25 primer primer NN cord-005309-147erliy 28 26 B b NN cord-005309-147erliy 28 27 , , , cord-005309-147erliy 28 28 and and CC cord-005309-147erliy 28 29 primer primer NN cord-005309-147erliy 28 30 D D NNP cord-005309-147erliy 28 31 , , , cord-005309-147erliy 28 32 5'CCTTCTGGGGCTCGTCAAGAT 5'ccttctggggctcgtcaagat CD cord-005309-147erliy 28 33 TCCCA3 tccca3 NN cord-005309-147erliy 28 34 ' ' '' cord-005309-147erliy 28 35 , , , cord-005309-147erliy 28 36 which which WDT cord-005309-147erliy 28 37 is be VBZ cord-005309-147erliy 28 38 complementary complementary JJ cord-005309-147erliy 28 39 to to IN cord-005309-147erliy 28 40 bases basis NNS cord-005309-147erliy 28 41 1542 1542 CD cord-005309-147erliy 28 42 - - SYM cord-005309-147erliy 28 43 1567 1567 CD cord-005309-147erliy 28 44 ofpDrepl ofpdrepl NN cord-005309-147erliy 28 45 , , , cord-005309-147erliy 28 46 genome genome NN cord-005309-147erliy 28 47 - - HYPH cord-005309-147erliy 28 48 sense sense NN cord-005309-147erliy 28 49 , , , cord-005309-147erliy 28 50 was be VBD cord-005309-147erliy 28 51 used use VBN cord-005309-147erliy 28 52 in in IN cord-005309-147erliy 28 53 a a DT cord-005309-147erliy 28 54 PCR pcr NN cord-005309-147erliy 28 55 with with IN cord-005309-147erliy 28 56 pDrepl pDrepl NNP cord-005309-147erliy 28 57 template template NN cord-005309-147erliy 28 58 under under IN cord-005309-147erliy 28 59 the the DT cord-005309-147erliy 28 60 reaction reaction NN cord-005309-147erliy 28 61 conditions condition NNS cord-005309-147erliy 28 62 described describe VBN cord-005309-147erliy 28 63 above above IN cord-005309-147erliy 28 64 except except IN cord-005309-147erliy 28 65 that that IN cord-005309-147erliy 28 66 it -PRON- PRP cord-005309-147erliy 28 67 was be VBD cord-005309-147erliy 28 68 subjected subject VBN cord-005309-147erliy 28 69 to to IN cord-005309-147erliy 28 70 25 25 CD cord-005309-147erliy 28 71 thermal thermal JJ cord-005309-147erliy 28 72 cycles cycle NNS cord-005309-147erliy 28 73 : : : cord-005309-147erliy 28 74 94~ 94~ CD cord-005309-147erliy 28 75 for for IN cord-005309-147erliy 28 76 1 1 CD cord-005309-147erliy 28 77 min min NN cord-005309-147erliy 28 78 , , , cord-005309-147erliy 28 79 50~ 50~ CD cord-005309-147erliy 28 80 for for IN cord-005309-147erliy 28 81 1 1 CD cord-005309-147erliy 28 82 min min NN cord-005309-147erliy 28 83 , , , cord-005309-147erliy 28 84 and and CC cord-005309-147erliy 28 85 72~ 72~ CD cord-005309-147erliy 28 86 for for IN cord-005309-147erliy 28 87 2 2 CD cord-005309-147erliy 28 88 min min NN cord-005309-147erliy 28 89 . . . cord-005309-147erliy 29 1 The the DT cord-005309-147erliy 29 2 amplified amplified JJ cord-005309-147erliy 29 3 products product NNS cord-005309-147erliy 29 4 of of IN cord-005309-147erliy 29 5 the the DT cord-005309-147erliy 29 6 first first JJ cord-005309-147erliy 29 7 and and CC cord-005309-147erliy 29 8 second second JJ cord-005309-147erliy 29 9 reactions reaction NNS cord-005309-147erliy 29 10 were be VBD cord-005309-147erliy 29 11 electrophoretically electrophoretically RB cord-005309-147erliy 29 12 resolved resolve VBN cord-005309-147erliy 29 13 on on IN cord-005309-147erliy 29 14 a a DT cord-005309-147erliy 29 15 1 1 CD cord-005309-147erliy 29 16 % % NN cord-005309-147erliy 29 17 agarose agarose NN cord-005309-147erliy 29 18 gel gel NN cord-005309-147erliy 29 19 and and CC cord-005309-147erliy 29 20 obtained obtain VBN cord-005309-147erliy 29 21 by by IN cord-005309-147erliy 29 22 gel gel NN cord-005309-147erliy 29 23 puncture puncture NN cord-005309-147erliy 29 24 with with IN cord-005309-147erliy 29 25 a a DT cord-005309-147erliy 29 26 micropipet micropipet JJ cord-005309-147erliy 29 27 tip tip NN cord-005309-147erliy 29 28 for for IN cord-005309-147erliy 29 29 a a DT cord-005309-147erliy 29 30 third third JJ cord-005309-147erliy 29 31 round round NN cord-005309-147erliy 29 32 of of IN cord-005309-147erliy 29 33 PCR PCR NNP cord-005309-147erliy 29 34 using use VBG cord-005309-147erliy 29 35 primers primer NNS cord-005309-147erliy 29 36 A A NNP cord-005309-147erliy 29 37 and and CC cord-005309-147erliy 29 38 D. D. NNP cord-005309-147erliy 29 39 Amplification Amplification NNP cord-005309-147erliy 29 40 was be VBD cord-005309-147erliy 29 41 done do VBN cord-005309-147erliy 29 42 in in IN cord-005309-147erliy 29 43 an an DT cord-005309-147erliy 29 44 80-~tL 80-~tl CD cord-005309-147erliy 30 1 PCR PCR NNP cord-005309-147erliy 30 2 mixture mixture NN cord-005309-147erliy 30 3 by by IN cord-005309-147erliy 30 4 25 25 CD cord-005309-147erliy 30 5 cycles cycle NNS cord-005309-147erliy 30 6 of of IN cord-005309-147erliy 30 7 94~ 94~ CD cord-005309-147erliy 30 8 for for IN cord-005309-147erliy 30 9 1 1 CD cord-005309-147erliy 30 10 min min NN cord-005309-147erliy 30 11 , , , cord-005309-147erliy 30 12 50~ 50~ CD cord-005309-147erliy 30 13 for for IN cord-005309-147erliy 30 14 2 2 CD cord-005309-147erliy 30 15 min min NN cord-005309-147erliy 30 16 , , , cord-005309-147erliy 30 17 and and CC cord-005309-147erliy 30 18 72~ 72~ CD cord-005309-147erliy 30 19 for for IN cord-005309-147erliy 30 20 3 3 CD cord-005309-147erliy 30 21 min min NN cord-005309-147erliy 30 22 . . . cord-005309-147erliy 31 1 The the DT cord-005309-147erliy 31 2 melting melting NN cord-005309-147erliy 31 3 temperature temperature NN cord-005309-147erliy 31 4 ( ( -LRB- cord-005309-147erliy 31 5 T0 T0 NNP cord-005309-147erliy 31 6 ) ) -RRB- cord-005309-147erliy 31 7 was be VBD cord-005309-147erliy 31 8 determined determine VBN cord-005309-147erliy 31 9 to to TO cord-005309-147erliy 31 10 be be VB cord-005309-147erliy 31 11 above above IN cord-005309-147erliy 31 12 55~ 55~ CD cord-005309-147erliy 31 13 for for IN cord-005309-147erliy 31 14 all all DT cord-005309-147erliy 31 15 primers primer NNS cord-005309-147erliy 31 16 according accord VBG cord-005309-147erliy 31 17 to to IN cord-005309-147erliy 31 18 the the DT cord-005309-147erliy 31 19 formula formula NN cord-005309-147erliy 31 20 T t NN cord-005309-147erliy 31 21 0 0 CD cord-005309-147erliy 31 22 = = NFP cord-005309-147erliy 32 1 4(C 4(c LS cord-005309-147erliy 32 2 + + SYM cord-005309-147erliy 32 3 G g NN cord-005309-147erliy 32 4 ) ) -RRB- cord-005309-147erliy 32 5 + + . cord-005309-147erliy 33 1 2(A 2(A NNP cord-005309-147erliy 33 2 + + CC cord-005309-147erliy 33 3 T T NNP cord-005309-147erliy 33 4 ) ) -RRB- cord-005309-147erliy 33 5 . . . cord-005309-147erliy 34 1 The the DT cord-005309-147erliy 34 2 phenol phenol NN cord-005309-147erliy 34 3 - - HYPH cord-005309-147erliy 34 4 chloroform chloroform NN cord-005309-147erliy 34 5 extracted extract VBN cord-005309-147erliy 34 6 and and CC cord-005309-147erliy 34 7 ethanol ethanol NN cord-005309-147erliy 34 8 precipitated precipitate VBN cord-005309-147erliy 34 9 recombinant recombinant JJ cord-005309-147erliy 35 1 1319 1319 CD cord-005309-147erliy 35 2 nt nt RB cord-005309-147erliy 35 3 DNA DNA NNP cord-005309-147erliy 35 4 fragment fragment NN cord-005309-147erliy 35 5 from from IN cord-005309-147erliy 35 6 the the DT cord-005309-147erliy 35 7 third third JJ cord-005309-147erliy 35 8 PCR PCR NNP cord-005309-147erliy 35 9 was be VBD cord-005309-147erliy 35 10 cut cut VBN cord-005309-147erliy 35 11 with with IN cord-005309-147erliy 35 12 BgllI BgllI NNP cord-005309-147erliy 35 13 and and CC cord-005309-147erliy 35 14 the the DT cord-005309-147erliy 35 15 resulting result VBG cord-005309-147erliy 35 16 846 846 CD cord-005309-147erliy 35 17 nt nt RB cord-005309-147erliy 35 18 fragment fragment NN cord-005309-147erliy 35 19 , , , cord-005309-147erliy 35 20 resolved resolve VBN cord-005309-147erliy 35 21 by by IN cord-005309-147erliy 35 22 agarose agarose JJ cord-005309-147erliy 35 23 gel gel NN cord-005309-147erliy 35 24 electrophoresis electrophoresis NN cord-005309-147erliy 35 25 an an DT cord-005309-147erliy 35 26 electroeluted electroeluted NN cord-005309-147erliy 35 27 , , , cord-005309-147erliy 35 28 was be VBD cord-005309-147erliy 35 29 ligated ligate VBN cord-005309-147erliy 35 30 into into IN cord-005309-147erliy 35 31 the the DT cord-005309-147erliy 35 32 BgllI BgllI NNP cord-005309-147erliy 35 33 - - HYPH cord-005309-147erliy 35 34 cut cut VBN cord-005309-147erliy 35 35 sites site NNS cord-005309-147erliy 35 36 of of IN cord-005309-147erliy 35 37 pDrepl pDrepl NNP cord-005309-147erliy 35 38 from from IN cord-005309-147erliy 35 39 which which WDT cord-005309-147erliy 35 40 the the DT cord-005309-147erliy 35 41 homologous homologous JJ cord-005309-147erliy 35 42 1043 1043 CD cord-005309-147erliy 35 43 nt nt RB cord-005309-147erliy 35 44 BgllI BgllI NNP cord-005309-147erliy 35 45 fragment fragment NN cord-005309-147erliy 35 46 had have VBD cord-005309-147erliy 35 47 been be VBN cord-005309-147erliy 35 48 removed remove VBN cord-005309-147erliy 35 49 , , , cord-005309-147erliy 35 50 and and CC cord-005309-147erliy 35 51 JM109 jm109 NN cord-005309-147erliy 35 52 cells cell NNS cord-005309-147erliy 35 53 were be VBD cord-005309-147erliy 35 54 transformed transform VBN cord-005309-147erliy 35 55 . . . cord-005309-147erliy 36 1 The the DT cord-005309-147erliy 36 2 resulting result VBG cord-005309-147erliy 36 3 clone clone NN cord-005309-147erliy 36 4 was be VBD cord-005309-147erliy 36 5 confirmed confirm VBN cord-005309-147erliy 36 6 by by IN cord-005309-147erliy 36 7 sequencing sequence VBG cord-005309-147erliy 36 8 . . . cord-005309-147erliy 36 9 _SP cord-005309-147erliy 37 1 Gene gene NN cord-005309-147erliy 37 2 splicing splicing NN cord-005309-147erliy 37 3 by by IN cord-005309-147erliy 37 4 overlap overlap NN cord-005309-147erliy 37 5 extension extension NN cord-005309-147erliy 38 1 : : : cord-005309-147erliy 38 2 Tailor Tailor NNP cord-005309-147erliy 38 3 made make VBD cord-005309-147erliy 38 4 genes gene NNS cord-005309-147erliy 38 5 using use VBG cord-005309-147erliy 38 6 the the DT cord-005309-147erliy 38 7 polymerase polymerase NN cord-005309-147erliy 38 8 chain chain NN cord-005309-147erliy 38 9 reaction reaction NN cord-005309-147erliy 38 10 Rapid Rapid NNP cord-005309-147erliy 38 11 and and CC cord-005309-147erliy 38 12 efficient efficient JJ cord-005309-147erliy 38 13 site site NN cord-005309-147erliy 38 14 - - HYPH cord-005309-147erliy 38 15 specific specific JJ cord-005309-147erliy 38 16 mutagenesis mutagenesis NN cord-005309-147erliy 38 17 without without IN cord-005309-147erliy 38 18 phenotypic phenotypic NN cord-005309-147erliy 38 19 selection selection NN cord-005309-147erliy 38 20 Oligonucleotidedirected Oligonucleotidedirected NNP cord-005309-147erliy 38 21 mutagenesis mutagenesis NN cord-005309-147erliy 38 22 : : : cord-005309-147erliy 38 23 A a DT cord-005309-147erliy 38 24 simple simple JJ cord-005309-147erliy 38 25 method method NN cord-005309-147erliy 38 26 using use VBG cord-005309-147erliy 38 27 two two CD cord-005309-147erliy 38 28 oligonucleotide oligonucleotide JJ cord-005309-147erliy 38 29 primers primer NNS cord-005309-147erliy 38 30 and and CC cord-005309-147erliy 38 31 a a DT cord-005309-147erliy 38 32 single single RB cord-005309-147erliy 38 33 - - HYPH cord-005309-147erliy 38 34 stranded strand VBN cord-005309-147erliy 38 35 DNA dna NN cord-005309-147erliy 38 36 template template NN cord-005309-147erliy 38 37 Role role NN cord-005309-147erliy 38 38 of of IN cord-005309-147erliy 38 39 subgenomic subgenomic JJ cord-005309-147erliy 38 40 minus minus JJ cord-005309-147erliy 38 41 - - HYPH cord-005309-147erliy 38 42 strand strand NN cord-005309-147erliy 38 43 RNA RNA NNP cord-005309-147erliy 38 44 in in IN cord-005309-147erliy 38 45 coronavirus coronavirus NN cord-005309-147erliy 38 46 replication replication NN cord-005309-147erliy 39 1 This this DT cord-005309-147erliy 39 2 work work NN cord-005309-147erliy 39 3 was be VBD cord-005309-147erliy 39 4 supported support VBN cord-005309-147erliy 39 5 primarily primarily RB cord-005309-147erliy 39 6 by by IN cord-005309-147erliy 39 7 Public Public NNP cord-005309-147erliy 39 8 Health Health NNP cord-005309-147erliy 39 9 Service Service NNP cord-005309-147erliy 39 10 grant grant NN cord-005309-147erliy 39 11 AI AI NNP cord-005309-147erliy 39 12 14367 14367 CD cord-005309-147erliy 39 13 from from IN cord-005309-147erliy 39 14 the the DT cord-005309-147erliy 39 15 National National NNP cord-005309-147erliy 39 16 Institute Institute NNP cord-005309-147erliy 39 17 of of IN cord-005309-147erliy 39 18 Allergy Allergy NNP cord-005309-147erliy 39 19 and and CC cord-005309-147erliy 39 20 Infectious Infectious NNP cord-005309-147erliy 39 21 Diseases Diseases NNPS cord-005309-147erliy 39 22 and and CC cord-005309-147erliy 39 23 in in IN cord-005309-147erliy 39 24 part part NN cord-005309-147erliy 39 25 by by IN cord-005309-147erliy 39 26 funds fund NNS cord-005309-147erliy 39 27 from from IN cord-005309-147erliy 39 28 the the DT cord-005309-147erliy 39 29 University University NNP cord-005309-147erliy 39 30 of of IN cord-005309-147erliy 39 31 Tennessee Tennessee NNP cord-005309-147erliy 39 32 College College NNP cord-005309-147erliy 39 33 of of IN cord-005309-147erliy 39 34 Veterinary Veterinary NNP cord-005309-147erliy 39 35 Medicine Medicine NNP cord-005309-147erliy 39 36 Center Center NNP cord-005309-147erliy 39 37 of of IN cord-005309-147erliy 39 38 Excellence Excellence NNP cord-005309-147erliy 39 39 Program Program NNP cord-005309-147erliy 39 40 for for IN cord-005309-147erliy 39 41 Livestock Livestock NNP cord-005309-147erliy 39 42 Diseases Diseases NNPS cord-005309-147erliy 39 43 and and CC cord-005309-147erliy 39 44 Human Human NNP cord-005309-147erliy 39 45 Health Health NNP cord-005309-147erliy 39 46 . . .