cord-000010-prsvv6l9	2008	Copy number variations (CNVs) in the human genome are conventionally detected using high-throughput scanning technologies, such as comparative genomic hybridization and high-density single nucleotide polymorphism (SNP) microarrays, or relatively low-throughput techniques, such as quantitative polymerase chain reaction (PCR). We have developed a new technology to study copy numbers using a platform known as the digital array, a nanofluidic biochip capable of accurately quantitating genes of interest in DNA samples. Other existing technologies, such as quantitative polymerase chain reaction (PCR), are limited because of their inability to reliably distinguish less than a twofold difference in copy number of a particular gene in DNA samples (11) (12) (13) . In this study we demonstrate the use of a unique integrated nanofluidic system, the digital array, in the study of CNVs. The digital array (14, 15) is able to accurately quantitate DNA samples based on the fact that single DNA molecules are randomly distributed in more than 9000 reaction chambers and then PCR amplified.
cord-000014-e0ou9zjb	2008	
cord-000080-7s5b3lpn	2009	
cord-000083-3p81yr4n	2009	
cord-000113-d0eur1hq	2009	The advent of molecular biology and new technological initiatives that combine advances in biology with other disciplines will support the development of techniques capable of high throughput testing with a low turnaround time for rabies diagnosis. The advent of molecular biology and new technological initiatives that combine advances in biology with other disciplines will support the development of techniques capable of high throughput testing with a low turnaround time for rabies diagnosis. Another method for the detection of rabies virus antigen from postmortem samples is a recently developed rapid immunodiagwww.plosntds.org nostic test (RIDT) based on the principles of immunochromatography [13] . Development of RT-LAMP assays for use in diagnosis and surveillance is challenged by the considerable sequence variation observed within the rabies virus genome [44] that can frustrate specific primer design. Currently, high-throughput rabies virus molecular detection methods augment standard diagnostic tests or are in the process of development and refinement for use alone.
cord-000180-howix091	2010	By taking advantage of the entry-defective phenotype of glycoprotein-deficient HSV-1 virus particles, the results presented here show that binding of virions to cellular receptors on the plasma membrane is sufficient to stimulate a change in cellular gene expression. As induction of the NF-kB reporter construct occurred within one hour of inoculation with DgH virions and peaked at around two-and-a-half hours post-inoculation, then the transcripts previHFFs were stimulated with 1000 particles/cell of DgB, DgD or DgH HSV-1 for six hours and a cDNA microarray corresponding to targets of 19 signalling pathways was used to detect changes in cellular gene expression when compared to mock-infected. Real-time PCR confirmed that changes in transcription associated with the NF-kB, JAK/STAT, JAK/Src and PI3K pathways were modulated as a result of virion binding, all of which required gD on the envelope surface To demonstrate that signalling occurred at physiologically relevant multiplicities of infection, HFFs were inoculated with either 1000, 100, 10 or 1 particles per cell of entry-defective HSV-1.
cord-000235-782iew86	2010	The multiple species and high degree of genetic diversity seen among the human bocaviruses found in feces relative to the highly homogeneous HBoV1 suggest that this world-wide distributed respiratory pathogen may have recently evolved from an enteric bocavirus, perhaps after acquiring an expanded tropism favoring the respiratory track. Most PCR-positive stool samples contained HBoV2B (76 of 101), making this genotype the most commonly detected enteric human bocavirus (Table 1) . Based on the phylogenetic clustering observed for a large number of partial VP1 sequences ( Figure 1 ) and the distances among full genomes (Table 2) , we propose for future classification that HBoV strains showing 18% protein and 110% nucleotide difference in the complete VP1 gene should be considered different species, whereas those showing 11.5% protein and 15% nucleotide difference should be considered different genotypes.
cord-000265-llilwq1u	2010	
cord-000322-8ctsa9sd	2011	Subsequently, T4 and MS2 ICs were evaluated in routine real-time PCR or RT-PCR virological diagnostic tests, using a series of 8,950 clinical samples (representing 36 distinct specimen types) sent to our laboratory for the detection of a variety of DNA and RNA viruses. It represents a valuable strategy for enhancing the quality of routine molecular diagnosis in laboratories that use in-house designed diagnostic systems, which can conveniently be associated to the use of specific synthetic ECs. The high rate of inhibitors observed in a variety of specimen types should stimulate the elaboration of improved technical protocols for the extraction and amplification of nucleic acids. Monitoring rt-PCR and rt-RT-PCR assays and validation of the results rely on the use of relevant external or internal controls (ECs or ICs) [1, 2] and commercial kits including such control systems are being increasingly improved for the molecular diagnosis of a number of pathogens such as HIV, hepatitis viruses, influenza viruses etc..
cord-000483-zgapjjjw	2011	We conducted a preliminary comparison of the relative sensitivity of a cross-section of published human rhinovirus (HRV)–specific PCR primer pairs, varying the oligonucleotides and annealing temperature. We conducted a preliminary comparison of the relative sensitivity of a cross-section of published HRV-specifi c PCR primer pairs (most of which were fi rst published before HRV-C was reported), independent of most variables described above, by testing a panel of 57 clinical specimen nucleic acid extracts from combined nose and throat swabs from preschool children with colds and infl uenza-like illnesses in Melbourne, Australia. Five primer pairs, including real-time PCR (rtPCR) pair 5, did not amplify the HEVs, a positive feature for HRV-specifi c studies. We next selected 4 frequently published primer pairs (1, 5, 7, and 8) to examine 44 picornavirus-positive specimens (39 HRVs, 3 HEVs, and 2 untypeable picornaviruses) from nonhospitalized children with acute asthma exacerbation (6) .
cord-000664-085v7n6k	2012	The PLEX-ID/Flu assay has been recently developed to enable the detection and typing of influenza viruses based on the RT-PCR/electrospray ionization mass spectrometry technology. Taken together, and although our results need to be confirmed by further prospective studies, the PLEX-ID/Flu assay detected positively and gave a typing result for 93% of all NPS detected positively by real-time RT-PCR, thus suggesting a potential role for influenza virus surveillance among other techniques. The typing performance of the PLEX-ID/Flu assay versus the Sanger-based sequencing method was then compared for all influenza specimens with low viral loads (C T values 30; 19 influenza A and 18 influenza B-positive NPS; Table 2 ). Based on a selection of positive NPS collected in Switzerland during the 2010-2011 influenza season, this study suggests that the PLEX-ID/Flu assay is a convenient platform for the detection, typing, and subtyping (lineage characterization for influenza B) of circulating influenza viruses.
cord-000715-zl1s82yi	2012	These samples were selected from among archived stool samples previously tested for enterovirus and MS2 after extraction by QIAamp Viral RNA Mini Kit. A sufficient number of samples with high, intermediate, and low levels of inhibitors were chosen for re-analysis to enable comparison between extraction procedures at each of these levels of inhibition. Analysis of variance ( Fig. 3 , part 2), indicated that there was no significant difference (paired t-test, P.0.05) between the inhibition of rRT-PCR of the MS2 external control and the added enterovirus (P.0.05) for protocols A, C, and D. Stool suspensions (N = 185) prepared for routine analysis of clinical stool samples sent to the Central Virology Laboratory (CVL) at Chaim Sheba Medical Center in Israel were used to evaluate the efficiency of four different RNA extraction systems in excluding inhibitors of rRT-PCR.
cord-000718-7whai7nr	2012	Method: We analyzed consecutive gastric cancer cases in terms of AMACR immunohistochemical expression and clinical/pathological characteristics and followed patients'' postoperative history. Results: Histological, immunohistochemical and molecular examination revealed non-neoplastic lymphadenopathy with atypical paracortical T-cell hyperplasia with immunoblastic reaction in the former and burnt-out histiocytic pattern in the latter, both falling into a broad spectrum of reactive lymph node changes associated with Still''s disease. Method: We have thus collected, from our two Institutions a large number (45 cases) of cancers showing the histological definition of adenosquamous carcinomas according to the WHO criteria and performed gene analysis for k-RAS (codons 12, 13) and EGFR (codons 18, 19 and 21) mutations. Objective: We previously identified amplified fibroblast growth factor 1 (FGFR1) as a therapeutic target for small molecule inhibitor (SMI) therapy in squamous cell lung cancer (L-SCC), resulting in currently running clinical trials treating patients with stage III disease.
cord-000736-6f8vyziv	2012	FINDINGS: We developed a real-time PCR array capable of simultaneously detecting eight human viral pathogens: human immunodeficiency virus types 1 and 2 (HIV-1 and -2), hepatitis B virus (HBV), hepatitis C virus (HCV), human T-cell leukemia virus-1 and -2 (HTLV-1 and -2), vaccinia virus (VACV) and West Nile virus (WNV). The analytical sensitivity of each primer set was determined in the single virus testing using FDA/CBER panels (kindly provided by Dr. Stephen Kerby, FDA/CBER) consisting of various amounts of the viruses (0-1,000 genome copies/ml) spiked into the ''''normal'''' human plasma. The results of sensitivity testing of the real-time PCR array primer sets specific for HIV-1, HIV-2, HBV, HCV, and WNV the with FDA/CBER analytical plasma panels. Tm and C(t) values obtained with primer sets specific for HIV-1, HCV, or HBV in testing of 17 human clinical samples in the format of PCR array targeting eight different viruses.
cord-000750-l9ozvlae	2012	We have previously reported impressive heart activity including high-splicing efficiency and dystrophin restoration following a single administration of an arginine-rich cell-penetrating peptide (CPPs) conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO): Pip5e-PMO. We have previously reported impressive heart activity including high-splicing efficiency and dystrophin restoration following a single administration of an arginine-rich cell-penetrating peptide (CPPs) conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO): Pip5e-PMO. These changes affect the levels of exon skipping and dystrophin restoration in multiple muscle groups, including the heart, following a single, low dose intravenous injection of the corresponding Pip6-PMO conjugates. Therefore, considering the results overall, mdx mice treated with each of the four 5-aa core Pip6-PMOs (Pip6a-, Pip6b-, Pip6e-, and Pip6f-PMO) appear to demonstrate improved dystrophin production and exon skipping in TA, quadriceps, and heart muscles compared with the previous lead candidate, Pip5e-PMO.
cord-000830-jiy4cp4n	2012	The use of amplification techniques such as polymerase chain reaction, real-time polymerase chain reaction or nucleic acid sequence-based amplification for virus detection, genotyping and quantification have some advantages like high sensitivity and reproducibility, as well as a broad dynamic range. The use of amplification techniques such as polymerase chain reaction (PCR), real-time PCR or nucleic acid sequence-based amplification (NASBA) [3] for virus detection, genotyping and quantification have some advantages like high sensitivity and reproducibility, as well as a broad dynamic range [4, 5] . NASBA assays could identify active infection by detecting viral messenger RNA (mRNA) but the most widely used tests in clinical virus diagnosis are quantitative real-time PCR techniques [8] . Some real-time PCR assays such as LightCycler parvovirus B19 quantitative assay (Roche Diagnostics, Indianapolis, IN) and ABI TaqMan (Applied Biosystems) have been developed for detecting B19 nucleic acids in association with infection during pregnancy or assessing the prevalence of the virus DNA in blood products [62, 63] .
cord-000979-cav9n18w	2013	title: Rapid Identification of Novel Immunodominant Proteins and Characterization of a Specific Linear Epitope of Campylobacter jejuni The innovative approach presented herein of generating cDNAs of prokaryotes in combination with a microarray platform rendering time-consuming purification steps obsolete has helped to illuminate novel immunodominant proteins of C.jejuni. Additionally, the structure and antigenicity of the proteins and epitopes were modelled to analyze the suitability of the identified sequences for future applications like diagnostic tools or vaccine development. For a summary of the predicted characteristics, see S9: Transmembrane and antigenic potential of three potential epitope sites for cj0920c.Further, specificity control assays revealed that these signals do not drop significantly when using antibodies to Salmonella enterica indicative of nonspecific binding to occur, see S10: Specific vs. jejuni and were able to determine the important residue involved in antibody binding as well as modelling the epitope''s accessibility within the full-length protein.
cord-000988-79fp75u3	2013	
cord-001134-8ljgxnhf	2013	title: Comparison of viremia of type II porcine reproductive and respiratory syndrome virus in naturally infected pigs by zip nucleic acid probe-based real-time PCR In this study, we developed a sensitive and specific zip nucleic acid probe-based real-time PCR assay to evaluate the viremia of natural PRRSV-infected pigs in Taiwan. CONCLUSIONS: ZNA probe-based real-time PCR can be a useful tool to diagnose symptomatic and asymptomatic PRRSV-infected pigs. ZNA probe-based real-time PCR amplification and the limit of detection Tenfold serial plasmid dilutions (10 1 to 10 6 copies/μl) were tested and used to construct the standard curve by plotting the logarithm of the plasmid copy number against the measured quantification cycles (Cq) values. However, this is first study to report the viral load using serum samples in asymptomatic PRRSV-infected pigs using ZNA probebased real-time PCR. Development of a onestep real-time quantitative PCR assay based on primer-probe energy transfer for the detection of porcine reproductive and respiratory syndrome virus
cord-001371-wf0vonkn	2014	
cord-001435-ebl8yc92	2014	
cord-001455-n7quwr4s	2014	title: Activation of Innate Immune-Response Genes in Little Brown Bats (Myotis lucifugus) Infected with the Fungus Pseudogymnoascus destructans Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. We used samples collected during the experiment to address the question: Can hibernating bats respond to infection by activating genes responsible for innate immune and stress responses? We determined levels of transcripts for several immune and stress response genes (Table 1) in lungs from infected and control bats.
cord-001521-l36f1gp7	2011	The IC 50 values determined in functional NI assays provide valuable information for detection of resistant viruses, but should not be used to draw direct correlations with drug concentrations needed to inhibit virus replication in the infected human host, as clinical data to support such inferences are inadequate. • Standardized reagents and protocols • Choice of detection technology • Simple instrumentation requirements • High sensitivity for use with low virus concentrations • Compatibility with batch-mode processing and largescale assay throughput • Broad specificity of influenza detection • Flexibility in assay format • Additional NA assay applications -cell-based viral assays, screening for new NIs, detection of NA from other organisms Functional neuraminidase inhibition assays enable detection of any resistance mutation and are extremely important in conjunction with sequence-based screening assays for global monitoring of virus isolates for NI resistance mutations, including known and new mutations. Such new assays need to include methods to measure local antibodies and virus-specific lymphocytes, especially in the case of live attenuated influenza vaccines, because of their potential to induce such broad-based immune responses.
cord-001655-uqw74ra0	2015	The sets of viral genotypes ranged from that which would be expected for a straightforward co-infection by 2 virus strains in snake #45, to more complex combinations such as that in snake #33, which contained the sequences of 1 S and 10 distinct L segments. We applied homogenates from samples to cultures of boa constrictor-derived JK cells and monitored levels of virus RNA by qRT-PCR using genotype-discriminating primers. Thus, sequences of multiple viral genotypes Recombinant genome segments with unusual organizations. Virus populations replicate as stable ensembles in culture: (A) Liver homogenate from snake #38 was applied to cultures of JK cells and replication was monitored by measuring supernatant viral RNA levels using qRT-PCR and genotype-specific primers. Although we detected many instances of snake tissues containing multiple viral genotypes, our results do not prove that individual cells in these animals were multiply infected.
cord-001762-dtvzwin8	2015	
cord-001787-lj1nd922	2014	title: Enhancing production of ergosterol in Pichia pastoris GS115 by over-expression of 3-hydroxy-3-methylglutaryl CoA reductase from Glycyrrhiza uralensis pastoris strains containing different copy numbers of the GuHMGR gene were obtained and the content of ergosterol was analyzed by HPLC. In this study, we investigated how copy number variation (CNV) of the GuHMGR gene affects the formation of ergosterol. pastoris strains containing different copy numbers of the GuHMGR gene were induced to express the gene; P. pastoris strains was 1.07-2.51 times higher than in the negative control but with increase in the copy number of GuHMGR gene; the content of ergosterol showed an increasing-decreasingincreasing pattern. pastoris strain containing 44 copies of the GuHMGR gene. In this study, the dependence of the content of ergosterol on the copy number of the GuHMGR gene suggests that an increase in the latter could lead to an increase in the production of GA in G.
cord-001843-ceatyj3o	2015	PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. The duplex UNDP-PCR assay is suitable for simultaneous detection of RNA and DNA viruses in early viral infection, providing an effective approach for diagnosis of swine diseases. The duplex UNDP-PCR assay developed in this study provided a useful tool for simultaneous detection of RNA (TGEV) and DNA viruses (PCV2) without the need for viral nucleic acid extraction, purification and reverse transcription.
cord-001858-nmi39n6h	2015	title: Reference gene selection for normalization of RT-qPCR gene expression data from Actinidia deliciosa leaves infected with Pseudomonas syringae pv. Primer sequence (5′-3′) BestKeeper and the deltaCt method) were used to evaluate the stability of expression of selected RGs. The analyses were performed for three comparison groups considering both low-and high-dose bacterial inocula in the leaves and their combined dataset. In kiwifruit leaves with a high dose of bacterial inoculum, BestKeeper revealed that only the expression of TUB overcame the stability threshold; CYP and GAPDH were considered to be the most stable genes, with SD values of 0.50 and 0.61, respectively (Table 3 ). The expression of three genes encoding the reactive oxygen species (ROS) scavenging enzymes ascorbate peroxidase (APX), superoxide dismutase (SOD) and catalase (CAT), induced during the systemic infection of kiwifruit leaves with PSA, were chosen to further validate the reliability of the selected RGs for the normalization of RT-qPCR data.
cord-001891-5op0yss9	2015	
cord-001932-sklwt76a	2013	
cord-002178-ggtxuulg	2015	A portable, miniaturized POC NAAT with performance comparable to conventional PCR (polymerase-chain reaction)-based tests in clinical laboratories can be realized with a disposable, palm-sized, plastic microfluidic chip in which: (1) nucleic acids (NAs) are extracted from relatively large (~mL) volume sample lysates using an embedded porous silica glass fiber or cellulose binding phase ("membrane") to capture sample NAs in a flow-through, filtration mode; (2) NAs captured on the membrane are isothermally (~65 °C) amplified; (3) amplicon production is monitored by real-time fluorescence detection, such as with a smartphone CCD camera serving as a low-cost detector; and (4) paraffin-encapsulated, lyophilized reagents for temperature-activated release are pre-stored in the chip.
cord-002376-970934vm	2016	The quantitative reverse transcription polymerase chain reaction (RT-qPCR) assay is nowadays considered as the gold standard method for detection and quantification of enteric RNA viruses such as hepatitis A virus (HAV), hepatitis E virus (HEV) or human noroviruses (NoV) (Mattison et al., 2009; Blaise-Boisseau et al., 2010; Di Pasquale et al., 2010; Vasickova et al., 2012; Hennechart-Collette et al., 2014) . The present article is a followup study of a previously published theoretical concept (Mikel et al., 2015) and describes a method of preparation of MS2 PLP carrying a specific control sequence and their use as a PCV in RT-qPCR detection and quantification of enteric RNA viruses in swab, liver tissue, serum, feces, and vegetable samples. MS2 PLP were added in the amount of 5 × 10 6 particles to the different types of matrices (swabs, liver tissue, serum, feces, and leafy green vegetables) to reveal their ability to serve as PCV in the RT-qPCR detection of enteric RNA viruses.
cord-002399-z3in6bi2	2016	
cord-002560-pue5q5wp	2017	Recently, due to the advent of molecular enrichment protocols, high throughput sequencing and new metagenomic analytical methods we are now able to explore, identify and characterise viruses from different biological and environmental samples with a greater capacity [2, [5] [6] [7] [8] [9] [10] [11] In studies of human faeces, the virome has been shown to include viruses that infect eukaryotic organisms and viruses that infect prokaryotes (bacteriophages) [2, 5, [12] [13] [14] [15] [16] [17] [18] . Another eukaryotic viral family found in one healthy dog sample was Parvoviridae, genetic analysis of the 3 contigs/singletons showed a coverage of approximately 3.5% of the complete genome of canine parvovirus reference sequence (NC_001539), or 9.3% of the polyprotetin Ns1-Ns2. Nucleic acids from a single faecal sample from a dog with acute diarrhoea (DD1), which had 18 contigs/singletons of canine astrovirus (after tBLASTx analysis) was used to determine the complete genome sequence.
cord-002757-upwe0cpj	2017	The first section addresses general considerations, the second section profiles specific infections organized according to mechanism of transmission, and the third section focuses on unique phenotypes and unique susceptibilities in patients with PIDDs. This review does not address most parasitic diseases. In developing countries where polio is still endemic and oral polio vaccine is essential for eradicating the disease, it is of utmost importance that all PIDD patients and family members should not receive live oral polio (OPV) because of the reported prolonged excretion of the virus for months and even years [24] . As for host factors, although severe and fatal cases have been described in healthy immunocompetent hosts [129, 130] , there is evidence to suggest that children under the age of 10 [130] and immunocompromised hosts either secondary to hematologic malignancies, immunosuppressant treatment for organ transplantation, or HIV infection are at a greater risk to develop more severe disease with higher case fatality rates [131, 132] .
cord-002795-i1qcanti	2017	
cord-002852-m4l2l2r1	2012	authors: Munyua, Peninah M.; Githinji, Jane W.; Waiboci, Lilian W.; Njagi, Leonard M.; Arunga, Geoffrey; Mwasi, Lydia; Murithi Mbabu, R.; Macharia, Joseph M.; Breiman, Robert F.; Kariuki Njenga, M.; Katz, Mark A. Background Surveillance for influenza viruses within live bird markets (LBMs) has been recognized as an effective tool for detecting circulating avian influenza viruses (AIVs). Efforts should be made to promote practices that could limit the maintenance and transmission of AIVs in LBMs. Influenza A viruses are zoonotic pathogens that infect a variety of domestic poultry such as chickens, turkeys, ducks, and geese. 2, 4, 5 Surveillance for influenza viruses within live bird markets (LBMs) has been recognized as an effective tool for detecting circulating influenza subtypes in the poultry population. 7, 8 Influenza viruses have also been detected in various environmental specimens collected in contaminated areas in LBMs including drinking water troughs, and surfaces in the delivery, holding and slaughter areas in markets.
cord-003047-3ejfxj6r	2018	title: Comparison data of a two-target real-time PCR assay with and without an internal control in detecting Salmonella enterica from cattle lymph nodes Data was generated by the duplex qPCR assay on 138 enriched cattle lymph node samples without the internal control, and compared with data on the same samples tested by the triplex qPCR assay that has Similar threshold cycle (Ct) data were generated with and without the use of the 18S rRNA gene as internal control. Real-time PCR (qPCR) test data on 138 culture-enriched cattle lymph node samples for Salmonella enterica detections is shown in Table 1 . One Table 1 Real-time PCR threshold cycle (Ct) data on 138 Salmonella-positive cattle lymph node samples with and without the 18S rRNA internal control. A multiplex real-time PCR assay, based on invA and pagC genes, for the detection and quantification of Salmonella enterica from cattle lymph nodes
cord-003505-qr6ukfti	2019	In this work, we have developed a novel colorimetric molecular assay that integrates nucleic acid analysis by dynamic chemistry (ChemNAT) with reverse dot-blot hybridization in an array format for a rapid and easy discrimination of Leishmania major and Trypanosoma cruzi. Once the abasic PNA probes hybridize with target sequences, the SMART-C-Biotin dynamic incorporation takes place, enabling the unequivocal identification of the parasite present in the amplicon sample, because of the unique colorimetric pattern that each Trypanosomatid amplicon generates. DNA amplicon products were denatured and then together with the dynamic chemistry reaction reagents added directly into the internal column of the Spin-Tube that supports the nylon membrane for the color-development assay (Fig. 4) . 20 ng of human gDNA were used as PCR template for its amplification with the set of primers described in our study and neither colorimetric signals nor bands were detected using the Spin-Tube and capillary electrophoresis analysis respectively (Fig. 5 , column 2: 2A and 2B), hence probing the specificity when human gDNA is present.
cord-003850-in7he5o4	2019	Therefore, the aim of the current study was to develop a sensitive, multitarget, and high-throughput method that can detect various agents responsible for STIs. METHODS: We developed and tested a 23-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) assay (sexually transmitted infection-mass spectrometry, STI-MS) that simultaneously targets 11 different agents, including 8 most common clinical pathogens related to STIs (HSV-1, HSV-2, Neisseria gonorrhoeae, Chlamydia trachomatis, Treponema pallidum, Trichomonas vaginalis, Mycoplasma genitalium, and Haemophilus ducreyi) and 3 controversial microorganisms as pathogens (Mycoplasma hominis, Ureaplasma urealyticum, and Ureaplasma parvum). 3 In this study, the MassARRAY System (Agena Bioscience, Inc., San Diego, CA, USA), a detection platform combining endpoint multiplex-PCR with matrixassisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), was utilized to develop a sexually transmitted infection assay (STI-MS) that can simultaneously detect and identify common clinical pathogens implicated in STIs, including herpes simplex virus types 1 and 2 (HSV-1 and HSV-2), Neisseria gonorrhoeae, Chlamydia trachomatis, Treponema pallidum, Trichomonas vaginalis, Mycoplasma genitalium, and Haemophilus ducreyi.
cord-004003-rlgzgyzn	2019	Thus, to amplify the size-variable DNA library uniformly, we introduced a linear amplification strategy with RPA and successfully improved the uniformity. Also, the average percentages of bases in the uniform range (uniformity value between 0.5 and 1.5) about the triplet experiment was improved from 56.3 and 49.2% by two-primer RPA to 73.6 and 75.7% by linear RPA for the small and large DNA libraries, respectively (Figures 2b and S5) . Taken together, the data show that RPA uniformly amplifies DNA libraries of the same size and has different amplification preferences than PCR. However, during the experiment, an accelerated small-sized DNA amplification by two-primer RPA reaction caused lower uniformity compared to PCR. It was noted that during the analysis, different amplification preferences were found between the PCR and RPA amplified oligo library sequencing data. Taken together, we show that single-primer linear RPA can be one of the alternative methods to PCR for DNA library amplification.
cord-004133-32w6g7qk	2019	Studies were included if they involved direct amplification and detection of genetic material from one of six representative sample types: blood, dried blood spot, serum and plasma, saliva and sputum, swabs, urine, and stool. However, it is important to note that the sensitivity does not necessarily suffer in much more concentrated samples-in Liu et al.''s highly robust two-step amplification process with direct hairpin assembly and HCR-based detection of SNP DNA sequences in 50% (v/v) serum, they achieved a very low LOD of 100 pg [119] . However, it is important to note that the sensitivity does not necessarily suffer in much more concentrated samples-in Liu et al.''s highly robust two-step amplification process with direct hairpin assembly and HCR-based detection of SNP DNA sequences in 50% (v/v) serum, they achieved a very low LOD of 100 pg [119] .
cord-004356-r83g3n0m	2019	
cord-004675-n8mlxe7p	2019	However, the mean infusion rate per site was similar between patients aged <18 years ( XMEN disease (X-linked Immunodeficency with Magnesium defect, Epstein-Barr virus infection and Neoplasia) is a primary immune deficiency caused by mutations in MAGT1 and characterized by chronic infection with Epstein-Barr virus (EBV), EBV-driven lymphoma, CD4 T-cell lymphopenia, and dysgammaglobulinemia. We present the case of a 1-year old Hispanic infant with a pathogenic variant in MAGT1 gene that clinically manifested with early Pneumocystis jirovecii and cytomegalovirus (CMV) interstitial pneumonia, and EBV chronic infection with good response to intravenous immunoglobulins supplementation without hematopoietic stem cell transplantation or gene therapy. Chief, Laboratory of Clinical Immunology and Microbiology, IDGS, DIR, NIAID, NIH, Bethesda, MD, USA Hypomorphic Recombination Activating Gene 1 (RAG1) mutations result in residual T-and B-cell development in both humans and mice and have been found in patients presenting with delayed-onset combined immune deficiency with granulomas and/or autoimmunity (CID-G/AI).
cord-004717-41ui4lqc	2011	
cord-004808-6w9n03fy	1995	
cord-004810-g0y7ied0	2003	The S1 glycoprotein gene of IBV isolates were amplified by reverse transcriptase – polymerase chain reaction (RT-PCR) and analyzed by restriction fragment length polymorphism (RFLP) analysis. And these IBV isolates showed different patterns from each other and non-Korean IBV isolates in reverse transcriptase-polymerase chain reaction-restriction fragment length polymorphism (RT-PCR-RFLP) analysis [29] . Amplified S1 genes were first classified by RFLP analysis and then the representative strains were cloned, sequenced and compared to other non-Korean published IBV sequences. Phylogenetic trees were constructed from the nucleotide and deduced amino acid sequences of the S1 glycoprotein genes of Korean IBV isolates and non-Korean IBV strains (Fig. 3) . Korean IBV K281-01 and K210-02 isolates formed distinct clusters that were related to non-Korean IBV Ark99, Ark DPI, Gray and JMK strains although K281-01 and K210-02 isolates were classified into the Arkansas type by PCR-RFLP analysis.
cord-004840-4rbrzv5o	2013	
cord-004879-pgyzluwp	1994	
cord-005048-9fs1ienf	2006	
cord-005147-mvoq9vln	2017	Using whole-exome sequencing and trio-based de novo analysis, we identified a novel heterozygous de novo frameshift variant in the leukemia inhibitory factor receptor (LIFR) gene causing instability of the mRNA in a patient presenting with bilateral CAKUT and requiring kidney transplantation at one year of age. Loss of cdkl5 associated with deficient mammalian target of rapamycin (mTOR) signaling in mice and human cells We and other groups have shown that mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene cause a severe neurodevelopmental disorder with clinical features including intellectual disability, early-onset intractable seizures and autism, that are closely related to those present in Rett syndrome (RTT) patients. Functional characterization of novel GNB1 mutations as a rare cause of global developmental delay Over the past years, prioritization strategies that combined the molecular predictors of sequence variants from exomes and genomes of patients with rare Mendelian disorders with computer-readable phenotype information became a highly effective method for detecting disease-causing mutations.
cord-005309-147erliy	1995	The authors describe an efficient method for generating large deletions (>200 nts) of precise length using the PCR-based method of gene splicing by overlap extension (1). Gene splicing by overlap extension or gene SOEing (1) is a powerful PCR-based technique for generating recombinant DNA molecules. A cloned 2231 nt subgenomic defective-interfering RNA of the bovine coronavirus in the pGEM3Zf(-) vector (Promega), containing an in-frame reporter sequence and called pDrepl (4) ( Fig. 1 ) was used for large deletion mutagenesis. GT3'', the "universal" primer for pGEM vectors, and primer B, 5''CTTACCAGGAGTAAAAGA CATTGTGACCTATGGGTGGGCC3'', which anneals to bases 192-213 and 502-519 in the genome-sense (plus) strand of pDrepl and forms the deletion, were used in the first round of PCR. Oligonucleotidedirected mutagenesis: A simple method using two oligonucleotide primers and a single-stranded DNA template
cord-005453-4057qib7	2019	To compare the safety and efficacy of prophylactic DLI for prevention of relapse after allogeneic peripheral blood stem cell transplantation from haploidentical donors (HID-SCT) and matched-sibling donors (MSD-SCT) in patients with very high-risk acute myeloid leukemia (AML), we performed a retrospective, observational cohort study enrolled in 21 HID-SCT and 13 MSD-SCT recipients. The aim of this study is to identify the prognostic impact of pre-transplant TIM3 levels on early and late transplant related complications as well as post-transplant relapse and survival Methods: A total of 177 hematopoietic stem cell transplantation (HSCT) recipients with an initial diagnosis of acute leukemia [median age: 36(16-66) years; male/ female: 111/66] were included in the study.
cord-005460-ezrn8cva	2017	Still the optimal combination of immunosuppressive agents with PTCy should be elucidated for different types of SCTs. We report the 2-year update of the prospective NCT02294552 single-center trial that evaluated risk-adapted graft-versushost disease (GVHD) prophylaxis with PTCy in related, unrelated and haploidentical SCTs. 200 adult patients (median age 32 y.o., range: 18-62) with hematologic malignancies, including AML (47.5%), ALL (26.5%), CML (10.5%), MDS (4%), and lymphomas (11.5%), were enrolled in the study. Long-term follow-up from the prospective randomized phase III multicenter trial comparing a standard GvHD prophylaxis with cyclosporine A and methotrexate with or without additional pretransplant ATLG (Grafalon, previously ATG-FRESENIUS S) (given 20 mg/kg/day, days − 3 to − 1) in unrelated donor hematopoietic cell transplantation after myeloablative conditioning resulted in a significant reduction of acute and chronic GvHD without compromising relapse rate and survival [1, 2, 3] .
cord-005687-gj6q0ft0	2017	
cord-005752-tur57xd9	2012	Since the near global eradication of poliomyelitis, Guillain-Barré syndrome (GBS) has become the most common cause of acute neuromuscular paralysis. Recent Campylobacter jejuni infection is discovered in 30 % of GBS patients (Poropatich et al. In this case report, we describe a 36-year-old male Finnish patient with GBS, who had a parechovirus infection preceding the neurological illness. Picornavirus PCR was positive from a stool sample taken on the day following hospitalization. Our patient had a mild clinical parechovirus infection preceding GBS. jejuni infection preceding GBS include serological evidence of C. jejuni IgG antibody titer≥1:2,000 by ELISA test) and a definite history of diarrhea within the previous 3 weeks of GBS onset (Kuwabara et al. It remains unproven whether HPeV had any causative role in triggering autoimmunity in our patient, but no other acute or recent microbial infections were detected. Epidemiology and clinical associations of human parechovirus respiratory infections
cord-005865-7lohh5ty	2007	
cord-006230-xta38e7j	2012	Here, we will present our analysis of Ca 2+ signaling following stimulation of the FcεRI receptor and application of secretagogues that are supposed to affect Ca 2+ -dependent mast cell activation such as adenosine, endothelin-1, substance P and compound 48/80 in BMMCs and PMCs derived from mouse lines with inactivation of TRPC1, TRPC3, TRPC4, TRPC5 or TRPC6 since specific antagonists are still lacking for these TRP channels. These data indicate that increased PP2A activity is associated with modified gene expression in TG hearts possibly affecting stress response and regulation of cell signalling. As demonstrated by qPCR and Western blot experiments, mesangial cells showed a marked time-and dose-dependent upregulation of CSE mRNA and protein levels after treatment with platelet-derived growth factor (PDGF-BB). The transcription factor cAMP response element (CRE)-binding protein (CREB) plays a critical role in regulating gene expression in response to activation of the cAMPdependent signaling pathway, which is implicated in the pathophysiology of heart failure.
cord-006450-si5168pb	2012	The variables associated with positive viral tests on univariate analysis were immunosuppression [human immunodeficiency virus (HIV), corticosteroids >10 mg/day for ≥3 weeks, or other immunosuppressive therapy], ground-glass attenuations on computed tomography (CT) scanning, late-onset ventilator-associated pneumonia (VAP), and durations of (i) hospital stay, (ii) intensive care unit (ICU) stay, and (iii) mechanical ventilation before BAL (p < 0.01 for each comparison). The variables significantly associated with positive viral tests on univariate analysis were immunosuppression (i.e., HIV infection, corticosteroids >10 mg/day for ≥3 weeks, and/or other immunosuppressive therapy), ground-glass attenuations on chest CT scans, late-onset ventilator-associated pneumonia (VAP), and durations of (i) hospital stay, (ii) ICU stay, and (iii) mechanical ventilation before BAL was performed (p<0.01 for each comparison). This advocates for the systematic use of PCR techniques for viral tests in BALF, in accordance with previous studies [27, 28] , in the situations where viruses may reasonably be suspected (i.e., acute lower tract respiratory disease in immunocompromised patients and/or patients with unexplained bilateral ground-glass attenuations on CT scan).
cord-006860-a3b8hyyr	1996	Dept of Pediatrics, University Hospitals Kiel and Mtinster, Germany Resistance to activated protein C (APCR), in the majority of cases associated with the Arg 506 Gin point mutation in the factor V gene is present in more than 50 % of patients < 60 years of age with unexplained thrombophilia. The regular APC resistance test is not applicable to plasma from Orally anticoagulated (OAC) or heparinized patients due to decreased levels of vitamin K-dependent clotting factors and to thrombin inhibition by antithrombin, respectively. On admission an extensive coagulation screen yielded the following results (n/normal, t/elevated, I/reduced, +/positive, -/negative): PT t, aPTT t, Tr n, factor II, V, VIII n, factor VII, IX, XI, XII /,, fibrinogan t, ATIII n, protein C, S *, activated protein C sensitivity ratio 1.92 ($), FV-Leidenmutation PCR -, fibrinolytic system n, TAT t, Ft÷2 t, lupus anticoagulant +, heparin induced platelet antibodies +; no diagnosis of a specific autoimmuna disorder could be made.
cord-006960-9pho3hk6	2013	In this work, we have utilized electro-actuation based DMF technology, integrated with suitably tailored resistive micro-heaters and temperature sensors, to achieve chip based real-time, quantitative PCR (qRT-PCR). Performance of the integrated DMF device was analyzed in real-time chip based qRT-PCR detection of in-vitro synthesized influenza A and C virus RNAs during 30-35 PCR cycles. Among the contact temperature control methods, the micro-fabricated resistive heaters/RTDs have smaller power requirement, faster thermal response and higher heating ramp rates and are therefore preferred for the proposed qRT-PCR micro-device. Mixing of the influenza C RNA sample and the off-chip prepared PCR reagents, followed by the RT reaction and thermal cycling over Micro-electrode 1, is shown in Figure 7 . This article demonstrates the design and micro-fabrication of integrated droplet microfluidic device, with nano-textured superhydrophobic top surface, that is capable of electro-handling of PCR samples/reagents, facilitating chip based mixing/sample preparation and chip based qRT-PCR amplification and detection of influenza viruses.
cord-007047-7ty9mxa9	2006	Problems with currently available molecular assays include a lack of knowledge about the extent of microbial nucleic acid in "normal" hosts, concentration of agent material in small volume samples, lack of microbiologist expertise, lack of adequate reimbursement, and difficulty with validation based on conventional methods. Infectious diseases clinicians have relied on these expert workers, and Reliable molecular diagnostic tests are not readily available for many infectious agents Commercial tests should only be used for validated specimen types Transportation problems, low concentrations of infectious agent, primer binding site genetic changes, final assay volume, inhibition, contamination, nonspecific amplification, and operator error lead to false-negative and false-positive amplification results Genomic bacterial sequencing is subject to error because of sequence homology among different bacteria, database problems, and mutations A number of nucleic acid hybridization and amplification methods are now in use, including direct probe hybridization (AdvanDx FISH for Staphylococcus aureus [AdvanDx] and GenProbe for group A streptococci [GenProbe]), hybrid capture (Digene for human papillomavirus; Digene), PCR, branched-chain DNA (bDNA; Bayer Diagnostics), and transcription-mediated amplification (Probe-Tec for Chlamydia and N.
cord-007066-zn10rnrm	2006	RNA can enter the oral cavity through various routes, including saliva secretions from the 3 major salivary glands (the parotid, submandibular, and sublingual glands) and minor glands, gingival crevice fluid (GCF), and desquamated oral epithelial cells. It is therefore possible that the RPS9 PCR products in panels B and C of Fig. 1 are produced from both RPS9 and RPS9P2 mRNAs. Previous expression-based microarray analysis showed that 185 different transcripts were consistently detected in the supernatants of 10 healthy human saliva samples (6 ) . Although individual variations exist, we detected ␤-actin mRNA in all 3 major salivary glands, GCF, and desquamated oral epithelial cells ( Fig. 2A) , suggesting that RNA enters the oral cavity from different sites. In addition to the saliva samples, we also measured RNA-macromolecule associations in serum and found that ϳ8% and Ͻ1% of ␤-actin mRNA could be detected in serum filtered through 0.45 and 0.22 m pores, respectively (see Fig. 1c in the online Data Supplement).
cord-007068-vcfs41eb	2019	We sought to determine whether an automated electronic medical record best practice alert (BPA) based on procalcitonin and respiratory polymerase chain reaction (PCR) results could help reduce inappropriate antibiotic use in patients with likely viral respiratory illness. In the study group, a BPA alerted providers of the diagnostic results suggesting viral infection and prompted them to reassess the need for antibiotics. CONCLUSIONS: The automated antimicrobial stewardship BPA effectively reduced antibiotic use and discharge prescribing rates when diagnostics suggested viral respiratory tract infection, without a higher rate for reinitiation of antibiotics after discontinuation. The aim of our study was to determine if antibiotic use could be reduced by deploying an automated antimicrobial stewardship provider alert that prompted antibiotic de-escalation if 3 criteria were met: PCT <0.25 ng/mL, virus detected on respiratory PCR, and active use of systemic antibiotics.
cord-007234-hcpa8ej5	2007	
cord-007427-iqwojhq2	2019	Based on sequencing data, LASV-specific assay was developed using synthetic MS2-phage-based armored RNA particles, RNA from Lassa virus strain Josiah, and further, evaluated in field conditions using samples from patients and Mastomys natalensis rodents. Viral RNAs were examined for Lassa immediately after extraction by the staff of the Virology Laboratory of Hemorrhagic Fevers Research Project of Gamal Abdel Nasser University of Conakry, Guinea and were then used to assess diagnostic sensitivity and specificity. In addition, LOD was assessed using a series of 10-fold dilutions of ARPs. For this purpose, eight LASV sequences of a maximal number of mismatches in the targeting region of L gene were selected (including a sequence of the strain Josiah, which was also used for the generation of the positive controls) and generated for the production of ARPs as described above (Table 2 ) .
cord-007564-ljqrxjvv	2006	Trentetrois examens directs et 46 Ces données montrent que l''examen direct et la culture de l''expectoration dès lors qu''ils sont correctement effectués chez un patient sans antibiothérapie sont fréquemment positifs au cours des PAC à pneumocoque les plus graves, c''est-à-dire bactériémiques. Ces données ne doivent pas toutefois faire perdre de vue, comme le souligne Pesola [37] que dans plus de 10 % des cas, les PAC ont une étiologie plurimicrobienne et qu''il n''est peut être pas raisonnable de focaliser l''antibiothérapie uniquement sur le pneumocoque en cas de test positif. À partir d''échantillons provenant du tractus respiratoire inférieur (expectoration, voire prélèvements endoscopiques) ou supérieur (prélèvement nasopharyngé), un certain nombre de techniques ont été mises au point pour le diagnostic des infections liées à des germes tels que Chlamydia pneumoniae, Mycoplasma pneumoniae ou Legionella spp.
cord-007874-oq8gpl91	2011	
cord-007890-bie1veti	2002	Effects of Interferon alpha plus ribavirine therapy on frequencies of HCV, HIV and CMV specific CD4-T-cell responses in peripheral blood of HIV/HCV coinfected patients after 6 months of treatment SoA9.5 Methods: Two groups of patients with chronic HCV infection were studied: 26 HIV coinfected progressors with antiretroviral therapy and 13 HIV-negative controls. In order to assess the local temporal trend of antibiotic sensitivity of the most common urinary tract bacterial pathogen, all urine-cultured Escherichia coli isolates were reviewed as to susceptibility profile, and specimen source (community-versus hospital-acquired infection). Methods: A total of 87 penicillin resistant clinical strains isolated from patients at Hacettepe Children''s Hospital, Ankara, Turkey between 1999 and 2001 were tested for their in vitro susceptibility to various antibiotics that are commonly used in the treatment of respiratory tract infections.
cord-008678-zi3aunqz	2020	
cord-008777-i2reanan	2005	Mollerup Department of Chemical Engineering, Building 229, DTU, 2800 Lyngby, Denmark A variety of factors that govern the properties of proteins are utilized in the development of chromatographic processes for the recovery of biological products including the binding and release of protons, the non-covalent association with non-polar groups (often hydrophobic interactions), the association of small ions (ion exchange) and the highly specific antigen-antibody interaction (affinity interactions). Such fermenters will be needed in order to meet the increasing pressure on costs for low price commodity type products such as single cell protein or food and technical grade enzymes, and to meet the demands of the new wave of white biotech, in which bio-produced chemicals must be made at prices competitive with those of the traditional chemical industry. The presentation will focus on use of the sensitive sandwich hybridization technology for the quantitative analysis of process relevant marker genes in different kind of microbial cell cultures with a focus on the production of recombinant proteins.
cord-009376-a35a92gh	2002	Applications of Q-PCR within biotechnology are discussed with particular emphasis on the following areas of biosafety and genetic stability testing: (a) determination of the biodistribution of gene therapy vectors in animals; (b) quantification of the residual DNA in final product therapeutics; (c) detection of viral and bacterial nucleic acid in contaminated cell banks and final products; (d) quantification of the level of virus removal in process validation viral clearance studies; (e) specific detection of retroviral RT activity in vaccines with high sensitivity; and (f) transgene copy number determination for monitoring genetic stability during production. We are developing Q-PCR assays for these repeat regions for rodent and primate residual DNA to obtain sensitivity in the fg range, however, one advantage of using a gene such as ␤-actin is gene stability, as this target should not undergo copy number changes within a stable cell line.
cord-009664-kb9fnbgy	2014	
cord-010027-r0tl01kq	2015	Further profiling of other T cell populations may help to further understand this expression which may act as a biomarker or provide a therapeutic target Biomarkers that are able to distinguish stage II and III colon cancer patients at high risk of developing disease recurrence, who may benefit from adjuvant chemotherapy, are still lacking. *AM supported by the NIHR and the Academy of Medical Sciences ABSTRACTS S·17 Assessment of HER2 Status on Needle Core Biopsy of Breast Cancer: Impact of Histopathological Concordance P M Pigera; AHS Lee; IO Ellis; EA Rakha; Z Hodi Nottingham City Hospital, Nottingham, UK One of the key recommendations introduced in the ASCO/CAP update guideline recommendation on HER2 testing is the novel concept of "histopathological concordance." It is proposed that certain tumour morphological features such as histologic type and grade should trigger repeating a molecular test in cases of "discordance".
cord-010092-uftc8inx	2019	Prospective testing of blood donations in endemic areas of the U.S. revealed 0.38% of donors were positive for Babesia DNA or antibodies (Moritz, NEJM, 2016) Aims: -To report results of ongoing Babesia clinical trial -To explain significance of Babesia as a TT infection Methods: In cobas â Babesia for use on the cobas â 6800/8800 Systems, is a qualitative polymerase chain reaction nucleic acid amplification test, developed to detect in whole blood (WB) donor samples the 4 Babesia species that cause human disease: B. In sensitivity analyses, there were two discrepant results for HIV testing, three for HCV, and five for anti-HBc. Summary/Conclusions: Elecsys â infectious disease parameters on the cobas e 801 analyser demonstrate high specificity/sensitivity for screening first-time blood donor samples, with similar clinical performance to other commercially available assays.
cord-010119-t1x9gknd	2017	Conclusion: The wide distribution in the concentration of bioactive lipids among 405 stored RBC units suggests that lipid degradation is highly donor-Background/Case Studies: To ensure availability of biological products to hospitals, blood banks have developed and validated multiple storage conditions for each of their products to maximize shelf life and quality. 1 The Department of Blood Transfusion, The PLA General Hospital, 2 The Department of Blood Transfusion, Air Force General Hospital, PLA Background/Case Studies: Recently, multi researches have reported that longer term-stored red blood cells(RBCs) units were associated with increased risks of clinically adverse events, especially in critically ill patients. Weak D types 1, 2 and 3 express all the major RhD epitopes and these patients can be managed as RhD-positive, which may lead to a reduction in unnecessary Rh immunoglobulin (RhIG) administration and conservation of RhD-negative RBCs. Study Design/Method: RHD genotyping was performed on all patient samples with weaker than expected or discrepant RhD typing results, utilizing a commercially available genotyping kit manufactured by Immucor (RHD BeadChip).
cord-010235-hu6o1ggc	1997	(3) provided the first clear demonstration of the causal relationship between a virus (Norwalk virus [NV] ) and gastroenteritis by using immune electron microscopy (IEM) to detect the presence of viral particles in the stools of individuals from an epidemic outbreak of gastroenteritis. This article describes the structure and genome organization of the human caliciviruses that cause gastroenteritis, the clinical and epidemiologic features of these viruses, and new methods for the laboratory diagnosis of infection with these viruses. The inability to cultivate the HuCVs and establish neutralization assays has prevented the definition of specific serotypes; however, at least five different serotypes are thought to exist based on early human cross-challenge studies and comparisons of the IEM and enzyme-linked immunosorbent assay (ELISA) reactivities of several prototype virus strains.
cord-010608-eaa2znom	2020	
cord-011073-uiabpbxd	2019	
cord-011322-olvqgs85	2020	The objective of this study was to compare the prevalence of human rotavirus group A common G and P genotypes in human Egyptian stool specimens and raw sewage samples to determine the most common genotypes for future vaccine development. Also, previous studies reported that rotavirus group A was the most frequent RNA enteric viruses in Egyptian clinical specimens and aquatic environment and was the most resistant one to sewage and water treatment processes (El-Senousy et al. The present study was conducted to estimate the burden of rotavirus gastroenteritis as well as to compare the prevalence of rotavirus common G and P genotypes among children ≤ 5 years of age visiting Abo El-Reech hospital (from Oct. 2015 to Sep. 2017 ) and in raw sewage samples collected from WWTPs in Greater Cairo during winter and autumn months in the same period to determine the most common G and P genotypes for future vaccine development.
cord-011436-ud35mf5l	2020	
cord-011966-7k2cxy8a	2020	Phylogenetic analysis based on the partial nucleotide sequences of RdRp, F, and HN proteins suggested that the viruses belonged to the proposed genus Shaanvirus. The Hendra and Nipah viruses are emerging bat-borne infectious agents that are highly pathogenic paramyxoviruses, which have caused outbreaks of respiratory and neurological diseases in humans and domesticated mammals [13, 14] . In 2016, 121 bat fecal samples were collected and four positive samples were identified based on RT-semi-nested PCR using consensus primers targeting the RdRp region. Based on the partial RdRp, F, and HN nucleotide sequences, the Korean bat paramyxoviruses belonged to the proposed genus shaanvirus. The phylogenetic analysis based on partial RdRp nucleotide sequences indicated that Korean bat paramyxoviruses belonged to the unclassified proposed genera Shaanvirus (Figure 2 ). In addition, the phylogenetic analysis based on the partial nucleotide sequences of RdRp, F, and HN proteins suggested that the viruses belonged to the proposed genus Shaanvirus.
cord-012085-ubdzhkfq	2011	
cord-012430-3uvhoca9	2008	
cord-012461-v8d91fdo	2020	
cord-013416-ooq1q5gy	2020	
cord-013589-3l8kar3k	2020	A homozygous missense variant leading to drastic decrease of PDE2A enzymatic activity was reported in one patient with childhood-onset choreodystonia preceded by paroxysmal dyskinesia and associated with cognitive impairment and interictal EEG abnormalities. The phenotype of the two oldest patients, aged 9 and 26, was characterized by childhood-onset refractory paroxysmal dyskinesia initially misdiagnosed as epilepsy due to interictal EEG abnormalities. Together with previously reported case, our three patients confirm that biallelic PDE2A variants are a cause of childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. reported a missense homozygous variant in PDE2A in a patient with cognitive impairment, interictal EEG abnormalities, and childhoodonset chorea [8] . indicate that biallelic variants in PDE2A leading to loss of function are involved in heterogeneous phenotypes characterized by early-onset paroxysmal hyperkinetic movement disorders associated with cognitive impairment and possibly epilepsy.
cord-014462-11ggaqf1	2011	
cord-014516-r59usk02	2015	
cord-014527-nvzfpntu	2015	A negative outcome was associated with higher fecal S100A12 concentrations in CE dogs, but the response to different forms of treatment and fecal S100A12 has not been reported, and this information will be important to further evaluate the utility of fecal S100A12 as a biomarker for gastrointestinal disease. Statistical analysis was performed using non-parametric 2-or multiple-group comparisons, the likelihood ratio to evaluate the association between groups of dogs and response to treatment, and a receiver operating characteristic curve to calculate sensitivity and specificity at the optimum cut-off concentration. The objectives of this study were to describe pulmonary transit time and myocardial perfusion normalized to heart rate (nPTT and nMP, respectively), evaluated by means of contrast echocardiography, in dogs with stable stage C ACVIM myxomatous mitral valve disease (MMVD), and to assess short-term effects of pimobendan on these parameters.
cord-014794-yppi30a0	2003	These parts were in a high percentage associated with fibrosis and lymphocyte rich areas and showed a higher mitotic activity than usual PTCs. Discussion The differences in the occurrence of TCV and TCmorphology between the presented series and previously reported cases might result from until now not clearly defined tall cell morphology as well as from similarities to PTCs, such as the oxyphilic variant, which is extremely rare in our series, and maybe also from often described squamous changes within PTCs. Due to these data it is not clear which tumor parts have relevance for prognosis and which tumors should be treated more aggressively than others. The aims of this study were to characterize the group of patients with BSOT and evaluate the significance of various molecular markers expression versus serous papillary ovarian carcinomas (SPOC) Material and methods We analyzed a total of 102 cases including: 64 cystadenoma, 10 borderline and 28 cystadenocarcinoma.
cord-014942-4hk0veck	2010	The objective of this study was to evaluate the potential role of fomites in human parainfluenza virus 1 (HPIV1) transmission by assessing the occurrence of HPIV1 on surfaces in an adult setting (office). Data revealed a statistically significant difference between the percentage of HPIV1 positive fomites in office cubicles and conference rooms (Chi-square P < 0.011, Fisher''s Exact P = 0.054). A study conducted at the San Francisco University Medical Center during the 2002 influenza season found HPIV1 in healthy adults with respiratory infections after using polymerase chain reaction (PCR) for diagnosis (Louie et al. The offices sampled in Arizona indicated a greater variation in the total percentage of HPIV1 positive surfaces per building (Fig. 3) . Potential role of hands in the spread of respiratory viral infections: Studies with human Parainfluenza virus 3 and Rhinovirus 14
cord-014965-efmozngq	2001	
cord-014976-546zaoxn	2006	In order to evaluate if malignant and non malignant hematological diseases quantitatively and qualitatively affect BM derived MSCs, bone marrow from children with acute lymphoblastic leukemia (ALL diagnosis n=9, different phases of treatment n=29, end of therapy n=10), idiopathic thrombocytopenic purpura (n=16), autoimmune neutropenia (n=12) and control patients (solid tumors without BM involvement, n=30) was harvested and the mononuclear cell (MNC) fraction isolated. Case: In our hospital a total of 3 patients with relapsed Hodgkin''s disease underwent reduced-intensity conditioning (RIC) allogeneic stem cell transplantation (allo-SCT) from an HLA-identical sibling. We report a case of a young male patient of 19 years old with aggressive MS who was treated with a high-dose immunosuppressive regimen (HDIS) using myeloablation followed by autologous blood stem cell transplantation (ASCT) that has induced a dramatic and long-lasting remission of the disease.
cord-015147-h0o0yqv8	2014	
cord-015324-y44sfr0c	2007	In order to further validate this approach, we performed a prospective randomized open-label multicenter trial in 41 low-risk pediatric renal transplant recipients (12 f, 29 m; mean age 10.1 yrs; range, 3.4 to 17.8) on CsA (target trough level 100-200 ng/ml), MMF (1200 mg/m 2 per day) and methylprednisolone (3) (4) mg/m 2 per day), who were randomly assigned >1 year posttransplant to continue steroids or to withdraw over a period of 3 months. We evaluated MMF in 15 children with LN, 11 F/4 M, mean age: 12.4±3.9 yrs, proteinuria >3 g/day, decreased C3 and increased anti-dsDNA serum levels, normal renal function. Patients and methods: 91 children and adolescents (60 male, 31 female, mean age at transplantation 9.7±5.2 years) with stable renal function and observation period exceeding 6 months were included.
cord-015348-qt0worsl	2010	
cord-015372-76xvzvdg	1996	
cord-015394-uj7fe5y6	2008	Studies involving immunohistochemical analysis of normal ovaries have shown that granulosa cells express significantly higher levels of the activator protein-1 (AP-1) transcription factor, cFos compared to theca cells, where cFos expression is virtually absent. Following acute hypoxia (0.5% O2) for one to six hours, RhoA mRNA, total protein and activation (RhoA-GTP) levels were analysed, using semi-quantitative PCRs and western blot, and compared to normoxic non-pregnant human uterine smooth muscle control cells. Since there is an urgent need for non-invasive methods for determination of fetal (F) and placental (P) function, this study was designed to evaluate the genes differently and commonly expressed in P tissue and leukocytes in maternal (M) and F circulation.Material and Methods. The current study: 1) localized IL-6 mRNA levels in preeclamptic versus normal decidual sections; 2) evaluated mechanisms regulating IL-6 synthesis by targeting intracellular signaling pathways with specific inhibitors; 3) identified potential IL-6 targets by immunolocalizing the IL-6 receptor (IL-6R) to specific cell types in placental bed biopsies.
cord-015683-a9a82of4	2016	Molecular diagnostics such as Western blot , ELISA , PCR , DNA, and protein microarrays are 7 revolutionizing the clinical practice of infectious diseases. Molecular diagnostics such as Western blot , ELISA , PCR , DNA, and protein microarrays are 7 revolutionizing the clinical practice of infectious diseases. Binding of another antigen-specifi c antibody linked with enzyme results in color formation upon addition of the substrate 9.2 Diagnosis of Bacterial, Viral, and Parasitic Diseases peptide may react in some assays but not in others as some regions of a peptide may be more immunogenic than others. Because of the specifi city, homogeneity, and unlimited availability of the MAbs, vast amount of work has been carried out on the production/development The immuno-diagnoses of protozoan and parasitic diseases have signifi cantly been improved by MAb technology because the tests involving MAb as diagnostic reagents overcome the limitations of polyclonal antibodies. The sensitivity and specifi city of a PCR assay is dependent on target genes, primer sequences, PCR techniques, DNA extraction procedures, and PCR product detection methods.
cord-015763-5lx179pa	2014	Keywords Severe community acquired pneumonia · Microbial diagnosis La pneumonie communautaire grave (PCG) est la première cause de sepsis sévère et de choc septique rencontrée aux urgences [1] . Ainsi, puisque les pathogènes responsables et l''antibiothérapie à instaurer sont connus, l''utilité de réaliser des prélèvements microbiologiques systématiques chez tous les patients admis aux urgences pour une pneumonie communautaire peut se discuter. Toutefois, cette relation entre la gravité de l''infection et la fréquence de positivité de l''hémoculture lorsqu''elle est appréciée non plus par le lieu d''admission du patient mais par un élément objectif tel que le Pneumonia Severity Index (PSI, score de Fine) ou le CURB-65 apparaît plus difficile à établir, tant les études sur le sujet rapportent des résultats discordants. Ces données ne doivent pas toutefois faire perdre de vue que les pneumonies ayant une étiologie pluri microbienne dans plus de 10 % des cas il n''est peutêtre pas raisonnable de focaliser l''antibiothérapie uniquement sur le pneumocoque en cas de test positif.
cord-015941-4fz79wzf	2018	Through the application of molecular biology, biological and biochemical analyses have been revolutionized, and nucleic acid, gene-based techniques have been developed to screen blood and plasma donations for evidence of very recent and earlier viral infections that might otherwise be missed by conventional serologic testing. Because NAT detects a virus''s genetic material instead of waiting for the body''s response, the formation of antibodies, as with many current tests, it offers the opportunity to reduce the window period during which an infecting agent is undetectable by traditional tests [21] , thus further improving blood safety. One reason for this is that currently available blood screening technologies detect core antibodies or surface antigens, which appear up to 8 weeks after infection. The anti-HBc test developed in 1987 detects an antibody to the hepatitis B virus that is produced during and after infection. Detection of HIV-1 and HCV infections among antibody-negative blood donors by nucleic acid-amplification testing
cord-016000-le22pknc	2019	Porcine circovirus (PCV) infections associated with post-weaning multisystemic wasting syndrome (PMWS) are characterized by weight loss, respiratory distress, jaundice, etc. Later on in 1991, a novel PCV associated with a sporadic disease called as post-weaning multisystemic wasting syndrome (PMWS), characterized by weight loss, respiratory distress, jaundice, etc., was reported from Saskatchewan, Canada (Harding 1996; Clark 1997) . Genetic characterization of type 2 porcine circovirus (PCV-2) from pigs with postweaning multisystemic wasting syndrome in different geographic regions of North America and development of a differential PCR-restriction fragment length polymorphism assay to detect and differentiate between infections with PCV-1 and PCV-2 Mycoplasma hyopneumoniae bacterins and porcine circovirus type 2 (PCV2) infection: induction of postweaning multisystemic wasting syndrome (PMWS) in the gnotobiotic swine model of PCV2-associated disease Porcine circovirus type 2 (PCV2) distribution and replication in tissues and immune cells in early infected pigs
cord-016020-awanrm9u	2007	In addition, despite the well-recognized association of viral infections with upper and lower respiratory tract infections, the current diagnostic virology procedures do not provide an answer rapidly enough to with parainfluenza virus type 4, human coronaviruses, rhinoviruses, and some enteroviruses would not ordinarily be identified without RNA detection methods. Published diagnostic methods for detection of respiratory pathogen DNA or RNA directly from clinical specimens utilize target amplification procedures such as polymerase chain reaction (PCR) or nucleic acid sequence-based amplification (NASBA).Although direct detection methods based on nucleic acid hybridization would be theoretically possible, the amount of target nucleic acid in specimens may be minimal and such methods would lack sensitivity compared to amplification methods, unless the organism was propagated before analysis. Thus, the molecular amplification procedures reported for direct detection of respiratory pathogens in clinical samples include PCR (e.g., Reference 19 and Figure 41 assays have utilized bacterial ribosomal RNA (rRNA; e.g., Reference 22 ).
cord-016073-uhei3bvr	2012	
cord-016144-280kwlev	2018	
cord-016179-4i1n9j4x	2015	
cord-016417-3cwwmyv9	2006	In this chapter, we focus on the newest advancements in reverse transcription polymerase chain reaction (rt-pcr) technology, the real-time PCR or quantitative PCR, using small amounts of RNA to determine expression levels.We discuss the technique in general and describe two different approaches. Traditional methods to quantify mRNA expression levels are Northern blotting, in situ hybridization, ribonuclease protection, cDNA arrays, and reverse transcription polymerase chain reaction (rt-pcr). PCR amplification of your target DNA will increase the number of probes that hybridize with the complementary template. Accumulation of the released reporter molecules during the amplification cycles results in an increasing fluorescent signal and is correlated to the amount of the target DNA present. When the probe binds to the target sequence this will result in a separation of the reporter and quencher molecule and the fluorescent signal can be monitored. Amplification in a real-time PCR will increase the target DNA and therefore also the observed fluorescent signal.
cord-016499-5iqpl23p	2014	
cord-016640-pvlg3nkp	2012	
cord-016796-g4kqqpy1	2019	
cord-016882-c9ts2g7w	2017	
cord-017072-qwe1ne3q	2018	Multiplex respiratory panels have the potential to improve patient management and lower overall healthcare costs by improving use of influenza antivirals, reducing inappropriate use of antibiotics and antivirals, reducing use of healthcare resource (e.g., additional laboratory or imaging procedures), informing appropriate infection control practices, and reducing length of hospital, emergency department, and intensive care unit (ICU) stay. In another study evaluating adult patients with a positive influenza result on a multiplex respiratory panel, Rappo [21] reported a significantly lower odds ratio for hospital admission (p = 0.046), a reduced length of stay (p = 0.040), reductions in antimicrobial duration (p = 0.032), and a reduction in the number of chest radiographs (p = 0.005). As with the individual molecular assays and the MALDI-TOF identification, numerous studies have shown that use of multiplex molecular blood culture panels dramatically reduces the time to organism identification [29] [30] [31] [32] which drives more appropriate pathogen-directed therapy. A retrospective study of the impact of rapid diagnostic testing on time to pathogen identification and antibiotic use for children with positive blood cultures
cord-017199-dn413uud	2016	Aan zwangeren met een positieve kweekuitslag of aan vrouwen van wie nog geen uitslag bekend is, moeten intrapartum profylactisch antibiotica intraveneus worden toegediend, bij voorkeur 2 miljoen IE penicilline G, of anders 2 g amoxicilline/ampicilline, zo mogelijk te geven minstens vier uur voor de te verwachten partus en daarna à 4 uur de helft tot de baby geboren is. Dit kan via seksueel contact, maar vaak blijkt de bron van infectie een kind uit het gezin te zijn dat door contact met andere geïnfecteerde kinderen besmet is geraakt. Onafhankelijke risicofactoren voor hiv-overdracht zijn: primo-infectie tijdens zwangerschap of lactatie, vroeggeboorte, andere geslachtsziekten wanneer die leiden tot ulceratie van de genitaliën, vitamine-A-deficiëntie, langer dan vier uur gebroken vliezen, invasieve diagnostiek bij het kind voor de geboorte en een vaginale geboorte. Bij gezonde zwangeren is de D-dimeer plasmaspiegel rondom de bevalling en vier weken post partum dermate verhoogd dat deze bepaling tijdens zwangerschap en kraambed niet kan worden gebruikt voor het vaststellen van een tromboembolisch proces.
cord-017331-ru7mvfc0	2017	The chapter includes history, etiology, susceptible hosts, transmission, pathogenesis, clinical symptoms, lesion, diagnosis, zoonosis, Treatment and control strategy of Tuberculosis, Salmonellosis, Chlamydiosis, Campylobacteriosis, Lyme disease, other bacterial infection, Newcastle disease, Avian Influenza infection, West Nile Virus infection, Usutu virus infection, Avian Borna Virus infection, Beak and feather disease, other viral infection, Toxoplasmosis, Giardiasis, Cryptosporidiosis, other parasitic infection, Cryptococcosis, Aspergillosis, Other fungal infections. Clinical samples include faeces or cloacal swabs, blood/serum of live birds and affected tissues, such as liver, spleen, heart, intestine/caeca, lung, esophagus/crop, brain and kidney in 10% buffered formalin. Non-specific clinical symptoms such as neurological signs (head between legs), depression, ruffled feathers, and standing at the bottom of the cage are observed in pet birds with AIV infection (Fig. 2.13) . The virus is detected in brain, heart, liver, kidney, lungs, and intestinal tissues of laboratory mice and naturally infected birds.
cord-017363-dmb42kna	2015	Transmissible gastroenteritis (TGE) is a highly contagious disease of pigs caused by the TGE virus (TGEV). Rapid detection of the virus in the affected pigs'' feces is critical for controlling the disease outbreaks. The real-time RT-PCR assay described in this chapter can quickly detect the presence of TGEV in fecal samples with high sensitivity and specificity. The assay, along with the RNA extraction method described here, can be established in any molecular diagnostic laboratory for detection of TGEV in pig fecal samples [ 6 -8 ] . It is recommended that the nucleic acid extraction, preparation of master mix, and real-time PCR amplifi cation are performed in three physically separated areas. In our experience, RNA extracted from pig fecal samples using the following method is suitable for TGEV detection using the real-time RT-PCR assay. A real-time TaqMan ® RT-PCR assay with an internal amplifi cation control for rapid detection of transmissible gastroenteritis virus in swine fecal samples
cord-017543-60q9iecq	2008	Sections cover microscale sample preparation methods; immunomagnetic separations and immunoassays; proteomics; polymerase chain reaction (PCR), quantitative PCR (qPCR) and other nucleic acid amplification methods; DNA microarrays, microelectrophoresis, and finally integrated Lab-on-a-Chip systems. The intent of JBAIDS Block III, Next Generation Diagnostics (NGD), is to establish a new system incorporating the capabilities of Block I and Block II capabilities (Table 10 .1) and adding immunoassay capabilities and the ability to identify up to 50 agents including toxins in 15 minutes using automated, miniaturized sample preparation integrated with analysis for nucleic acids and proteins, in a hand held or smaller format. They will need to be completely automated or simple to use; incorporate advanced technologies including sample preparation starting from primary samples (aerosols, blood, etc.), molecular detection, automation, microfluidics, and bioinformatics; reduce reagent consumption and space requirements; and provide cost and performance advantages compared to present systems.
cord-017600-4e7mw041	2008	
cord-017767-zj1h5ixf	2012	Although general practice of pathology is largely oriented toward diagnosis of neoplastic diseases, pathologists have been increasingly called upon to make diagnoses from tissue samples collected by cytology, biopsy, and autopsy procedures in response to the challenge of emerging infections [1] [2] [3] [4] . Immunolocalization of antigens by IHC provides histomorphologic correlation between the infectious pathogen and host tissue responses, which is not only crucial for diagnosis but also important to study the pathogenesis of those emerging infections [ 19, 21, 39, 40 ] . PCR ampli fi cation undoubtedly is the most sensitive method available to detect microbial organisms in tissue specimens and has become a common practice in many pathology laboratories. These differential 16S rRNA gene PCR assays provide more speci fi c information regarding the bacteria identity and are very useful for detecting bacterial pathogens in tissue samples in conjunction with histopathologic evaluation, special stains, and IHC.
cord-017867-8cn4c6cu	2017	In addition, the OIE Terrestrial Manual also provides recommendations for PCR analyses, which can be applied in combination either with or after culture as an ancillary test or-more often-direct as the primary test to examine bovine samples-i.e., preputial material, uterine or vaginal secretions, or abomasal content of aborted fetuses. In bovine tritrichomonosis cultivation became an important diagnostic tool, because parasite numbers in bovine samples-e.g., preputial smegma or cervico-vaginal mucus-are usually too low to be detected by direct microscopy and a multiplication of parasites after a few days of cultivation increases the chance to find infected bulls. Sensitivity and specificity of culture and PCR of smegma samples of bulls experimentally infected with Tritrichomonas foetus Evaluation of a PCR test for the diagnosis of Tritrichomonas foetus infection in bulls: effects of sample collection method, storage and transport medium on the test Comparison of sampling and culture methods for the diagnosis of Tritrichomonas foetus infection in bulls
cord-017894-8iahlshj	2015	
cord-017948-fqhl1qb4	2012	Currently, nucleic acid testing techniques have been developed to screen blood and plasma products for evidence of very recent viral infections that could be missed by conventional serologic tests. Through the application of molecular biology, biological and biochemical analyses have been revolutionized, and nucleic acid, gene-based techniques have been developed to screen blood and plasma donations for evidence of very recent and earlier viral infections that might otherwise be missed by conventional serologic testing. Because NAT detects a virus''s genetic material instead of waiting for the body''s response, the formation of antibodies, as with many current tests, it offers the opportunity to reduce the window period during which an infecting agent is undetectable by traditional tests [ 19 ] , thus further improving blood safety. Detection of HIV-1 and HCV infections among antibody-negative blood donors by nucleic acid-ampli fi cation testing
cord-017959-g0nf1iwm	2014	
cord-017984-w19kd6yp	2015	
cord-018721-othar2uv	2012	Zusammenfassend kann aufgrund der zur Verfügung stehenden Daten die Gabe von Dexamethason bei erwachsenen Patienten mit Verdacht auf eine bakterielle Meningitis (d. Für Entwicklungsländer mit eingeschränkter medizinischer Versorgung und einem hohen Anteil HIV-positiver Patienten konnte keine Wirksamkeit für Dexamethason bei der bakteriellen Meningitis nachgewiesen werden [32] , [33] , [34] . HIV-positive Patienten mit intrakraniellen Tuberkulomen können im Rahmen des "immune reconstitution syndrome" (IRIS) eine durchaus dramatische klinisch neurologische Verschlechterung erfahren, mit Zunahme der neurologi-z Diagnostik Die Untersuchung des Liquor cerebrospinalis ist für die Diagnose einer chronischen Meningitis unverzichtbar, der Liquor ist typischerweise klar, bei deutlich erhöhtem Eiweiß auch xanthochrom wirkend. Da bei der Pathogenese dieser Enzephalitis auch Autoimmunmechanismen eine wichtige Rolle spielen, scheint unter einer kombinierten Th erapie mit Aciclovir und Dexamethason die Rate von Patienten mit schlechtem Outcome geringer zu sein als unter alleiniger Th erapie mit Aciclovir [158] .
cord-018848-6kemhsyu	2011	
cord-018865-melttpiq	2012	In order to illuminate the antigenicity of porcine transmissible gastroenteritis virus (TGEV) spike protein B and C antigen sites, the truncated spike gene including B and C antigen sites of Chinese isolate TH-98 was expressed respectively in E.coli, baculovirus and pichia pastoris expression systems. Dot-ELISA assays based on these three recombinant proteins were developed to detect TGEV antibodies and could avoid antibody cross-reaction from PRCV theoretically. The recombinant B and C antigen sites protein expressed into the yeast culture supernatant was identified on the bases of its molecular weight. When the amount of spotting is 50ng, the recombinant B and C antigen sites protein expressed into the yeast culture supernatant show the positive reaction in contrast with the GS115 cells transformed with pPIC9K plasmids (Fig. 2. Antigenic variation among transmissible gastroenteritis virus (TGEV) and porcine respiratory coronavirus strains detected with monoclonal antibodies to the S protein of TGEV
cord-018944-du42ho11	2018	[6, 7] as follows: (1) extraction should be simple and rapid and should show high sensitivity and specificity; (2) it is preferred that there be no requirements for specialized equipment or special knowledge and skills; (3) the final nucleic acid should be pure and easy to modify for various amplification techniques; (4) the reagents and their product should be harmless; and (5) the process of preparation should resist contamination with other specimens. Although the phenolchloroform method is relatively easy compared with the CsCl/EtBr gradient and is very useful for the extraction of nucleic acids, it also is problematic for the clinical microbiology laboratory because phenol has important limitations due to its being toxic, caustic, and flammable [5, 15, 16] . In recent years, it has become possible to extract viral nucleic acid from clinical specimens having cellular components, and there have been trials of these commercially available kits to detect various clinically important viruses [30] [31] [32] .
cord-019490-m1cuuehi	2015	
cord-020568-c5425959	2007	The avian flu outbreak in several Asian countries killing approximately 50 million chickens has revealed the need for establishing rapid molecular diagnostics for mass screening of the Biological threat agents may be difficult to detect and identify quickly and reliable both from a civilian (public health) and a military point of view. Real-time PCR is the most commonly used nucleic acid-based method for specific and sensitive identification of biological threat agents. Internal controls may consist of either a plasmid or a DNA fragment in which the amplified DNA sequence is Several real-time PCR assays have been outlined for a number of biological threat agents, and commercial kits containing the specific reagents are available. An essential part of bioterrorism preparedness and response includes the design of efficient and reliable systems for detection and identification of biological threat agents. Classical microbiology, immunoassays, and nucleic acid-based methods, including molecular forensics, are laboratory approaches for detecting, identifying, and verifying various biological threat agents.
cord-020954-mt8mm7y4	2018	
cord-021052-qydc404w	2015	Las té cnicas de Romanovsky fueron introducidas en 1891 con un uso principal en la identificació n de pará sitos en hematología.El avance en este caso se centró en que los microorganismos podían verse en su contexto tisular. Gracias a ello, en 1950 se realizaron las primeras observaciones de un virus al microscopio electró nico mediante sombreado de los viriones, pero fue en 1960 cuando se difundió el uso del microscopio electró nico en virología 20 para enfermedades que hasta ese momento se diagnosticaban con cultivo, a veces no concluyente. Un magnífico ejemplo lo representaron los anticuerpos contra el herpesvirus humano 8 (HHV8) y contra el virus del carcinoma de cé lulas de Merkel. De otro, el virus tambié n fue detectado en tejido no tumoral de pacientes tanto con carcinoma de cé lulas de Merkel como sin é l 51 .
cord-021402-wq770ik9	2009	The most common laboratory methodologies used to identify an infectious agent include visualization of the organism via cytology/biopsy, isolation of the agent in microbiological culture, immunodiagnostics/serology, and nucleic acid technology. Fluorescent antibody and immunoblot assays are performed in commercial laboratories, whereas numerous patient-side rapid ELISA and latex agglutination kits are available for antigen detection. Until the introduction of nucleic acid amplification by the PCR, detection of an organism''s DNA or RNA often was impossible because of the small amount of antigen present in a sample. In the ELISA and IFA antibody assays, a specific antigen from the infectious agent in question is fixed to a solid surface (microtiter plate or glass slide, respectively) and the patient''s serum is added. The SVN assay evaluates the ability of antibodies in a patient''s serum to prevent the infection of culture cells or embryonated eggs with a known specific virus.
cord-021596-5s8lksxp	2018	Hepatic hemosiderosois is seen frequently in several pinniped species including young northern elephant and harbor seals, Hawaiian monk seals, northern fur seals, and CSLs. Mild chronic cholecystitis and portal hepatitis are common findings in wild pinnipeds secondary to trematode infection and trematode-associated pigment accumulation can occur. is most commonly reported in free-ranging pinnipeds including CSLs, harbor, and northern elephant seals along the Pacific coast of North America (Colegrove et al., 2005b; Gulland et al., 1996b) . pinnipedii has not been reported for any phocid species; however, the potential host range is broad and transmission from infected fur seals and sea lions has been described for zoo species, domestic cattle, and humans (Cousins et al., 2003; Kiers et al., 2008; Loeffler et al., 2014; Moser et al., 2008; Thompson et al., 1993; Thorel et al., 1998) . Harbor seals are the most commonly reported species to develop severe fatal disease with infection, and in California subadults and adults are primarily affected (Barbosa et al., 2015; Miller, 2008) .
cord-021772-5v4gor2v	2019	45, 46 In a recent study of 106 canine CSF samples without pleocytosis (TNCC <5/μL) but containing at least 500 RBCs/μL, the mean percentage of neutrophils (45.2% versus 5.7%), percentage of samples with eosinophils present (36.8% versus 6.8%), and mean protein concentration (40 mg/dL versus 26 mg/dL) were found to be significantly increased in the samples with blood contamination when compared with controls. 4 A study of cats with CNS cryptococcosis showed organisms in 9 of 11 of the CSF samples, and a majority of cases (9 of 10) had neutrophilic pleocytosis and increased protein concentration (8 of 10). A case series of five cats showed CSF ranging from normal to marked neutrophilic pleocytosis with moderately elevated protein concentration and variable correlation to clinical outcome. 85 A study of eight dogs with natural infection (confirmed by CNS tissue-PCR and histopathology) showed lymphocytic pleocytosis in all samples and normal protein concentrations.
cord-022034-o27mh4wz	2009	They include presence of disease outbreaks of the same illness in noncontiguous areas, disease outbreaks with zoonotic impact, different attack rates in different environments (indoor versus outdoor), presence of large epidemics in small populations, increased number of unexplained deaths, unusually high severity of a disease for a particular pathogen, unusual clinical manifestations owing to route of transmission for a given pathogen, presence of a disease (vector-borne or not) in an area not endemic for that particular disease, multiple epidemics with different diseases in the same population, a case of a disease by an uncommon agent (smallpox, viral hemorrhagic fevers, inhalational anthrax), unusual strains of microorganisms when compared to conventional strains circulating in the same affected areas, and genetically homogenous organisms isolated from different locations.
cord-022053-idft1p6d	2017	Organisms commonly identified this way include spirochetes, mycobacteria, DNA viruses, Aspergillus, Candida, and Toxoplasma, although special reference laboratories (e.g., The Infectious Disease Pathology Branch at the Centers for Disease Control and Prevention) have a wide range of antibodies for common to exotic pathogens for tissue confirmation. These include highly sensitive probes for use in direct specimens, to alternative amplification methods, rapid assays of single targets, and multiplexed systems that allow for the detection of many organisms in one assay. Application of RNA-ISH to Aspergillus and Candida in FFPE showed less sensitivity than real-time PCR with sequencing (gold standard), although some FISH-positive, PCRnegative cases with obvious fungal elements were seen, suggesting refinements of this technique may be valuable for rapid identification of these common organisms, especially if mucormycosis is in the differential. Comparative evaluation of the Bruker Biotyper and Vitek MS matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry systems for identification of yeasts of medical importance
cord-022084-hap7flng	2009	
cord-022310-yc6xtw0s	2011	47 Because of these findings, it is currently recommended to combine serologic test results with those of blood culture or PCR assay results when evaluating clinically ill cats for bartonellosis. Because serologic test results do not accurately correlate with presence of bacteremia and individual culture or PCR assay results can be falsely negative, there is no indication for testing healthy cats for Bartonella spp. T. gondii-specific IgM is detectable in serum by ELISA in approximately 80% of subclinically ill cats 2 to 4 weeks after experimental induction of toxoplasmosis; these titers generally are negative less than 16 weeks after infection. The author, however, has demonstrated IgG antibody titers greater than 1 : 16,384 in subclinically ill cats 5 years after experimental induction In chronic disease or asymptomatic carriers, demonstration of organisms is unreliable, and a tentative diagnosis is based on clinical signs and a positive titer. gondii-specific antibodies can also be detected in the serum, CSF, and aqueous humor of healthy, infected animals, one cannot assay results in clinically ill dogs, E.
cord-022501-9wnmdvg5	2015	Methods: Using published data on (1) the prevalence of MRSA and other bacterial pathogens causing cSSSI in the US, (2) the in-vitro susceptibility rates of commonly used regimens in cSSSI in the US in relation to the most pervasive pathogens identified above, and (3) estimated costs of failure of initial, empiric treatment from a recent study of a large US multi-hospital database, we developed a model to predict the expected clinical and economic impact of increasing prevalence of MRSA. Small outbreaks of VEB-1 ESBL producing Acinetobacter baumannii in Belgian nursing homes and hospitals through cross-border transfer of patients from northern France Methods: From 01/04 to 03/05, all Belgian acute hospitals were invited to report cases of nosocomial infections/colonisations due to MDR Ab isolates presenting a resistance profile similar to the French epidemic strain (resistance to all agents except carbapenems and colistin) and to send such isolates to the reference laboratory for phenotypic confirmation and for genotypic characterization (PCR of VEB-1 and class 1 Integron, PFGE typing).
cord-022888-dnsdg04n	2009	Methods: Phospho-specific Western blot analyses were performed to verify the functionality of the different IFN-g pathway components, intra-and extracellular flow cytometry experiments were employed to determine the expression of antigen processing components and HLA class I cell surface antigens, quantitative real time-PCR experiments to confirm the absence of JAK2 and presence of pathway relevant molecules as well as, genomic PCR and chromosome typing technique to prove the deletion of JAK2. In order to accomplish these objectives we induced priming or tolerance of ovalbumin (OVA 323-339 peptide)-specific T cells from DO11.10 TCR transgenic mice in vitro or, following adoptive transfer of near physiologically relevant numbers of such cells into recipients, in vivo and correlated functional outcome (via proliferation and cytokine readout assays or antibody production) with E3 ubiquitin-protein ligases expression and the ubiquitination status of the TCR signalling machinery.
cord-022889-lv6fy6e6	2019	This report suggests that some plant ncRNAs (e.g miRNAs and siRNAs) show higher stability as compared to other ncRNAs due to peculiar chemical characteristics (2''‐O‐methylation at 3'' end).However, ingested or administered ncRNA must overcome many extracellular and cellular barriers to reach the intended target tissue or functional location in sufficient amount to exert any biological effect. Finally, the publications reporting the outcome of two EFSA procurements aiming respectively at investigating and summarising the state of knowledge on the mode-of-action of dsRNA and miRNA pathways, the potential for non-target gene regulation by dsRNA-derived siRNAs or miRNAs, the determination of siRNA pools in plant tissues and the importance of individual siRNAs for silencing 6 ; and reviewing relevant scientific information on RNA interference that could serve as baseline information for the environmental risk assessment of RNAi-based GM plants ) 7 were also used.
cord-022940-atbjwpo5	2016	We have studied the effect of inhibition of IRE1 (inositol requiring enzyme 1), which is a central mediator of endoplasmic reticulum stress and controls cell proliferation and tumor growth, on hypoxic regulation of the expression of different proliferation related genes in U87 glioma cells. Transient inhibition of Akt and mTOR protein kinase activation in tumor cells followed by reactivation of signaling pathway did not result in a time-dependent difference on EGFR, HER2 and HER3 expression levels. In our study we aimed to determine cytotoxic effect of RES in K562 human CML cell line and to evaluate the expressions of miRNAs that are associated with genetics of leukemia after treatment with RES; to investigate target genes of miRNAs which show significant expression alterations and molecular mechanisms of RES treatment.
cord-023017-k6edtg58	2006	14/55 (25%) patients in AC who did not discontinue by week 24 received ribavirin dose reduction in comparison to 31/108 ( The clinical outcome in response to combination therapy for treatment of chronic hepatitis C virus (HCV) infection appears to be different for Caucasian versus African American patients. Over the period of combination therapy, most patients in which serum virus titers were reduced to non detectable levels had significant increases in T cell responses to HCV proteins. CHRONIC Background: Recent large prospective trials demonstrated that the combination therapy of interferon (1FN)-alphalribavirin significantly increased the ratio of a sustained virological response in patients with chronic hepatitis C in comparison with IFN monotherapy, especially in patients with high HCV-RNA titer and genotype lb. Results: Patients with chronic HCV infection showed higher MxA gene expression levels than healthy controls, indicating that hepatitis C virus induces IFN production.
cord-023026-2r84ndzv	2013	Thus, this work provides the basis to identify molecular pathways regulated by distinct niche/environmental signals and involved in the heterogeneity of adult OPCs. Multiple sclerosis (MS) is a chronic inflammatory and neurodegenerative demyelinating disease of the central nervous system (CNS) characterized by inflammation, which leads to formation of demyelinating areas due to loss of oligodendrocytes, astrogliosis and, finally, axonal degeneration. Taken together, these results demonstrate the important role of miR-200b in modulating the MAPK pathway via c-Jun which in turn affects different aspects of the inflammatory process accompanying microglia activation including cytokine response, NO production, phagocytosis and neuronal cell death. For this purpose, coronal cryostat free-floating sections from the brain of both adult transgenic mice and their corresponding wild-type (Wt) littermates, were processed for the study of astrocytes using GFAP immunohistochemistry and microglia using antibodies against Iba1 and several markers commonly related to the activated phenotype of these microglial cells, such as CD16/32 (Fc receptor), F4/80, CD11b, CD206, CD150 and MHC-II.
cord-023095-4dannjjm	2011	The purpose of this study was to determine the short-term effects of ivabradine on heart rate (HR), blood pressure, left ventricular (LV) systolic and diastolic function, left atrial (LA) performance, and clinical tolerance in healthy cats after repeated oral doses. The goal of this study was to investigate the relationship between heart rate and ECG time intervals to body mass in apparently healthy horses and ponies and to calculate normal ranges for different weight groups. This study aimed to investigate the prevalence of hypercoagulability in PLN dogs based on thromboelastography (TEG), and to determine whether hypercoagulability in these patients could be predicted by clinical assessments that identify systemic hypertension (systolic blood pressure 4 160 mmHg), hypoalbuminemia (serum albumin o 2.7 mg/dl), antithrombin activity (o 70%), and degree of proteinuria (urine protein:creatinine ratio [UPC] !
cord-023134-y665agnh	2012	Doppler echocardiographic indices of diastolic function of the right ventricle are good prognostic markers during left ventricular (LV) failure secondary to ischemic and dilated cardiomyopathy.The aims of the present study were: to assess LV and RV diastolic function by conventional Doppler and pulsed-wave tissue Doppler imaging (PW-TDI) in dogs with mitral valve disease (MVD), with or without pulmonary hypertension (PH); to test if echocardiographic parameters of LV and RV diastolic dysfunction correlate to the Doppler-estimated pulmonary artery systolic pressure (PASP).114 dogs were prospectively evaluated, including 86 dogs with MVD. The aims of the present study were to assess whether diabetic cats have pathological evidence of islet inflammation or pancreatitis and to define islet lesions in comparison to a well-matched control population.Formalin-fixed, paraffin-embedded pancreatic samples were collected from post-mortem examination performed on diabetic and control cats died due to any disease at the Clinic for Small Animal Internal Medicine, University of Zurich (Switzerland) between 1997 and 2009.
cord-023211-kt5gt26t	2007	Previous studies performed using fluorescence halide efflux measurements and short-circuit current voltage clamp have shown that treatment with PPARγ (peroxisome proliferator activated receptor gamma) agonists, such as pioglitazone and FLL (FMOC-L-leucine), resulted in an increased biosynthesis and trafficking of ∆F508-CFTR to the cell surface. Physiology, School of Medical Sciences, University of Bristol, Bristol, United Kingdom Recent progress in the development of small molecule correctors and potentiators capable of restoring CFTR function have increased the need for pre-clinical test models including cultured airway epithelial cells from human CF patients as well as CF mouse models. Clinical studies have linked increased sputum and peripheral blood neutrophil MPO activity with increased airflow obstruction in cystic fibrosis (CF) patients of the same age, gender, airway bacterial flora, and CFTR genotype. Because patients expressing low levels of normal CFTR mRNA (5-20%) have mild disease symptoms, these studies demonstrate that the incorporation of the ciliated cell-specific FOXJ1 promoter into gene therapy vectors may be useful for treatment of CF.
cord-023288-sqr33y72	2008	
cord-023303-fxus38mp	2008	
cord-023308-af5nihyi	2008	Results Data indicate splice variant expression in dendritic cells from asthmatic patients is influenced by asthma severity. Methods Randomized controlled trials (RCTs) of GORD treatment in adults or children that reported asthma health outcomes and had symptomatic GORD were included and assessed in accordance with the standard Cochrane systematic review process. Results 11 male (44%) and 14 female (56%) patients with moderate to severe persistent asthma (mean age 44 years, SD = 11) participated. Methods A comprehensive range of intracellular T-cell and monocyte proand anti-inflammatory cytokines/chemokines was investigated in peripheral blood from 5 OSA patients and 5 aged-matched control subjects (with no evidence of sleep problems) using multiparameter flow cytometry. Methods Following completion of a 12-month exercise study, which included a supervised program (Intervention, n = 18) and control group (Control, n = 17), COPD subjects [mean age (SD): 66 (8); mean FEV1 (% predicted) = 56% (19)] were asked to complete a questionnaire.
cord-023331-jrvmgnu3	2008	
cord-023346-8sqbqjm1	2005	• enhancement of automation/computerisation; • process control to provide an ''error-free pathway''; • (national) surveillance and trend analysis of results, preferably based on national working standards; • significantly increased sensitivity, especially from development of antigen/antibody ''combi'' assays (e.g. for HIV, and recently, for HCV); • awareness of HBsAg vaccine-escape mutants and design of assays to cope with this; • extension of range of agents and markers tested for (varies in different countries); • increasing range of assays available for testing donors with a relevant history of exposure to malaria or Chagas'' disease infection (for retrieval of otherwise wasted blood); • European Union''s in vitro diagnostics directive: this has caused some problems and reduced flexibility.
cord-023354-f2ciho6o	2005	• enhancement of automation/computerisation; • process control to provide an ''error-free pathway''; • (national) surveillance and trend analysis of results, preferably based on national working standards; • significantly increased sensitivity, especially from development of antigen/antibody ''combi'' assays (e.g. for HIV, and recently, for HCV); • awareness of HBsAg vaccine-escape mutants and design of assays to cope with this; • extension of range of agents and markers tested for (varies in different countries); • increasing range of assays available for testing donors with a relevant history of exposure to malaria or Chagas'' disease infection (for retrieval of otherwise wasted blood); • European Union''s in vitro diagnostics directive: this has caused some problems and reduced flexibility.
cord-023364-ut56gczm	2005	• enhancement of automation/computerisation; • process control to provide an ''error-free pathway''; • (national) surveillance and trend analysis of results, preferably based on national working standards; • significantly increased sensitivity, especially from development of antigen/antibody ''combi'' assays (e.g. for HIV, and recently, for HCV); • awareness of HBsAg vaccine-escape mutants and design of assays to cope with this; • extension of range of agents and markers tested for (varies in different countries); • increasing range of assays available for testing donors with a relevant history of exposure to malaria or Chagas'' disease infection (for retrieval of otherwise wasted blood); • European Union''s in vitro diagnostics directive: this has caused some problems and reduced flexibility.
cord-023592-w96h4rir	2015	
cord-023698-wvk200j0	2014	Because the organism has been difficult to grow and because of the lack of a commercially available other diagnostic assay, most original associations with respiratory diseases have been use of serology with the microimmunofluorescence (MIF) test. 38, 39 For an example of the complexity of this issue, consider that two multicenter pneumonia treatment studies in children showed that although 7% to 13% of the patients in the study had positive culture results and 7% to 18% met the serologic criteria with the MIF test for acute infection, they were not the same patients. pneumoniae infection is that the MIF method used to detect serum antibodies is not standardized; recent studies have shown substantial interlaboratory variation in the performance of these tests. Multicenter comparison trial of DNA extraction methods and PCR assays for detection of Chlamydia pneumoniae in endarterectomy specimens Multicenter comparison trial of DNA extraction methods and PCR assays for detection of Chlamydia pneumoniae in endarterectomy specimens
cord-023830-w218ogsk	2008	The inadequacy of phenotypic-based diagnostic assays is illustrated graphically by the ''''gold standard'''' public health laboratory-testing algorithm that was in place for positive identification of Bacillus anthracis from environmental samples during the October 2001 anthrax outbreak (Fig. 16.1a) . Genomic differences between microbes offer an alternative to culturing for detection and identification of pathogens by providing species-specific DNA targets that can be accurately resolved by molecular methodology. Polymerase chain reaction (PCR)-based amplification of highly conserved ribosomal RNA (rRNA) genes, intergenic sequences, and specific toxin genes is currently the most reliable approach for identification of bacterial, fungal and many viral pathogenic agents. Most importantly, these genetic probing systems offer rapid turn around time (1-6 h) and are suitable for high throughput, automated multiplex operations critical for use in clinical diagnostic laboratories. Rapid diagnostic assays in the genomic biology era: detection and identification of infectious disease and biological weapon agents
cord-024080-eh3ztsv5	2020	Recent data from infections in special contexts such as cruise liners (9) and in close contacts of COVID-19 patients (10) have demonstrated that SARS-CoV-2-specific RT-PCR may be positive in the early phase of the disease, and that viral shedding in the asymptomatic phase and in the early prodromal phase can be considerable. (19) This false negativity phenomenon may be due to several factors, including a low viral load below the detection limit of the assay, low sample volume or cellular mass during acquisition, sampling location (upper versus lower respiratory tract), sample degradation during transport or storage, sample processing methodology and the timing of sampling in relation to the stage of the disease (RT-PCR positivity may progressively increase during the course of the disease). In patients with more severe diseases, including those with lower respiratory tract infection, but also in individuals with mild disease, high viral loads can be detected often for several days after the resolution of symptoms.
cord-025232-5itrsfmk	2020	The strategy of using a clinically approved and replication-defective HAdV-5 vector provides a novel approach to develop universal adenovirus vaccine candidates against all the other types of adenoviruses causing ARDs and perhaps other adenovirus-associated diseases. In this study, the commercially-available and gene therapy use approved replication-defective HAdV-5 vector was used to construct a recombinant attenuated human adenovirus type 3 vaccine (Ginn et al. The complete hexon gene of HAdV-3 GZ01 was cloned into the AdEasy TM Adenoviral Vector, and this type-specific antigen was expressed when the recombinant adenovirus vaccine was inoculated into mice. The recombinant vaccine is expected to be used in the prevention of ARD outbreaks caused by HAdV-3 infections, and to serve as a model using adenovirus vectors for the construction of other vaccines against additional important serotypes of adenoviral respiratory pathogens. Mice were either inoculated with HAdV-3 wild-type strain GZ01 or immunized with the rAd3H recombinant vaccine by either the intranasal route or intramuscular route, respectively, to assess the antibody titer.
cord-025634-31n5fvex	2020	title: The prevalence of occult HBV infection in immunized children with HBsAg-positive parents: a hospital-based analysis BACKGROUND AND OBJECT: The risk of occult HBV infection (OBI) in children whose mothers are HBV carriers has received more widespread attention, but there were few reports to focus on the children with HBsAg-positive parents. In this study, we aimed at exploring the prevalence of OBI in hepatitis B-vaccinated children with HBV-positive mothers and/or fathers, trying to identify the risk factors of OBI. Forty-six [14.10% (95% CI 10.3-17.9%)] HBsAg-negative children were detected HBV DNA positive by nested PCR, which were confirmed through sequencing analysis. To our acknowledgement, this is the first study to explore the prevalence of OBI among hepatitis B vaccinated children with HBsAg-positive parents lived in HBV highly endemic areas. There is an equal potential risk of occult HBV infection in children with the HBsAg-positive father and mother.
cord-027498-cfzfgzqi	2020	Currently, the standard for diagnosis of Severe Acute Respiratory Syndrome-Coronavirus-2 (SARSinfection is a positive result based on a polymerase chain reaction (PCR) test from nasopharyngeal swab samples. Although her clinical symptoms and radiological findings resolved within a few days, PCR results from nasopharyngeal swab samples remained positive for 50 days after the onset. We specifically hypothesized that old age could be a risk for prolonged duration of positive PCR results from nasopharyngeal swab samples. In our analysis, older age is significantly associated with prolonged duration of positive PCR tests from nasopharyngeal swab samples, irrespective of the disease severity and the used of medication ( Figure 1 ). In summary, we demonstrated that old age is significantly associated with prolonged duration of positive PCR results from nasopharyngeal swab samples; this is the case regardless of disease severity.
cord-029183-3aotgq6m	2020	We evaluated the relevance of a new syndromic rapid multiplex PCR test (rm-PCR) on respiratory samples to guide empirical antimicrobial therapy in adult patients with community-acquired pneumonia (CAP), hospital-acquired pneumonia (HAP), and ventilator-acquired pneumonia (VAP). CONCLUSIONS: Use of a syndromic rm-PCR test has the potential to reduce unnecessary antimicrobial exposure and increase the appropriateness of empirical antibiotic therapy in adult patients with pneumonia. Therefore, in pneumonia patients, international guidelines state that an attempt should be made to obtain respiratory samples and recommend to start early empirical treatment while awaiting for the results of culture and antimicrobial susceptibility testing (AST) [3] . The BioFire® FilmArray® Pneumonia Panel (bioMerieux S.A., Marcy-l''Etoile, France) is a novel assay able to simultaneously identify 27 of the most common pathogens involved in lower respiratory tract infections (semi-quantitative results for 11 Gram-negative and 4 Gram-positive bacteria, qualitative results for 3 atypical bacteria and 9 viruses) as well as 7 antibiotic resistance genes (Fig. 1) .
cord-029710-ythz9ax0	2020	PURPOSE: To compare prediction of disease outcome, severity, and patient triage in COVID-19 pneumonia with whole lung radiomics, radiologists'' interpretation, and clinical variables. CONCLUSION: Radiomics from non-contrast chest CT were superior to radiologists'' assessment of extent and type of pulmonary opacities in predicting COVID-19 pneumonia outcome, disease severity, and patient triage. We compared prediction of disease outcome, severity, and patient triage in COVID-19 pneumonia with whole lung radiomics, radiologists'' interpretation, and clinical variables. Although prior studies have reported on the ability of visual severity score of COVID-19 pneumonia on chest CT [16, 18, 20] , we found that such qualitative assessment was not as useful as radiomics in predicting ICU admission or patient outcome (recovery versus death). Another limitation of our study pertains to the fact that some patients may have been admitted to the hospital based on severity of symptoms, other comorbidities (such as immunodeficiencies) or positive CT findings rather than an extensive lung changes related to COVID-19 pneumonia.
cord-029775-mntcor5d	2020	For the initial reactivity test, double-stranded DNA fragments (gBlocks® Gene Fragments) including the sequence targeted by the PCR primers (approximately 1700 bp each) of the human sapovirus genotypes GI.1 (GenBank accession number X86560), GI.2 (AB614356), GI.3 (AB623037), GI.4 (AJ606693), GI.5 (DQ366345), GI.6 (AJ606694), GI.7 (AB522390), GII.1 (AJ249939), GII.2 (AY237420), GII.3 (AB630068), GII.4 (AB522397), GII.5 (LC190463), GII.6 (AY646855), GII.7 (AB630067), GII.8 (KX894315), GIV.1 (DQ058829), GV.1 (DQ366344), and GV.2 (AB775659) were synthesized (Integrated DNA Technologies, Coralville, IA), and 1.0 × 10 4 copies of these fragments were used. The target regions of HuSaV-F1, -F2, and -F3 recently designed as forward primers in a broadly reactive real-time PCR for human sapoviruses [11] are similar to those of SV-F13 and SV-F14 (Fig. 2) , and the sapovirus-specific sequence of M13R-HuSaV5498R (5′-CCCCANCCNGCVHACAT-3′) ( [11] are shown in parentheses. The assay including two primers (M13F-HuSaV-5159F and M13R-HuSaV-5498R) generated similar-sized PCR products (approximately 380 bp) for all of the sapovirus genotypes tested (Fig. 1A, right panel, and Fig. 1B) .
cord-030026-4jew57ce	2020	
cord-030028-s6sxi8uj	2020	
cord-030191-tekgcthp	2020	
cord-031565-mos619wp	2009	
cord-031907-ilhr3iu5	2020	L.M., and the National Institutes of Health (R35GM119623) to T.R.G. The addition of a size exclusion chromatography step to various urinary extracellular vesicle concentrating methods reveals differences in the small RNA profile Introduction: Urinary extracellular vesicles (EVs) and their RNA cargo are a novel source of biomarkers for various diseases, however non-vesicular RNA (e.g. associated with proteins) is also present within urine. We then evaluated efficiency of heart targeting for eAAV9 or eAAV6 and standard AAV9 or AAV6 encoding for EGFP, mCherry or firefly luciferase in different human cell lines in vitro, in black mouse and in passive immunity nude mouse model in vivo using flow cytometry, confocal microscopy, Langendorff perfusion system and Methods: HLHS patients (n = 3) after Glenn procedure and swine (n = 3) after PAB were given RV injections of allogeneic/xenogeneic MSCs. Donor-specific, HLA-I+, exosomes were isolated from plasma.
cord-032134-mvj7i1er	2013	Bei Durchführung des Tests wird nach Verzicht auf ballaststoffreiche Kost für 3 Tage sowie nach einer Nüchternperiode von je nach Alter 8-12 Stunden und nach Mundspülung mit Wasser oder desinfizierender Lösung (morgens nicht Zähneputzen wegen Kohlenhydraten in der Zahnpasta) der Basalwert durch Gewinn von 1-2 Atemproben vor der Gabe der Testsubstanz ermittelt. Andererseits hat der EHEC-Ausbruch im Mai / Juni 2011 in Norddeutschland in eigenen vergleichenden Studien gezeigt, dass die Amplifikation von Zielsequenzen der Shiga-Toxin kodierenden Gene mittels PCR direkt im Stuhl das mit Abstand sensitivste und schnellste Verfahren zum frühen Nachweis oder Ausschluss einer EHEC-Infektion ist (Bialek et al., unveröffentlichtes Manuskript; Robert Koch Institut 2011b) . Nur bei der Amöbenruhr, verursacht durch Entamoeba histolytica, finden sich temperatursensible Trophozoiten im blutig-schleimigen Stuhl, die nur bei noch "warmer" Stuhlprobe mikroskopisch nachweisbar und identifizierbar sind, so dass eine Probe entweder direkt im Labor entnommen werden sollte oder diese warm zu transportieren ist.
cord-034689-se1hdn61	2020	CONCLUSION: The presence of patchy and/or confluent, bandlike ground glass opacity or consolidation in a peripheral and mid-to-lower lung zone distribution on a chest radiograph obtained in the setting of pandemic COVID-19 is highly suggestive of SARS-CoV-2 infection and should be used in conjunction with clinical judgement to make a diagnosis. The characteristic COVID-19 pattern ( Fig. 2-4) was defined in accordance with the prevailingly accepted chest imaging findings of COVID-19 in recent literature [2, 12, 20, 24, 25, [27] [28] [29] including the presence of bilateral "patchy" or "confluent, bandlike" ground glass opacity or consolidation in a peripheral and mid-to-lower lung zone distribution. The presence of bilateral "patchy" and/or "confluent, bandlike" ground glass opacity or consolidation in a peripheral and mid-to-lower lung zone distribution on a chest radiograph obtained in the setting of pandemic COVID-19 is highly suggestive of SARS-CoV-2 infection and should be used in conjunction with clinical judgement to make a diagnosis, especially when rapid and reliable serologic testing is lacking.
cord-034746-uxhpufnv	2020	We therefore analyzed standard markers of glomerular proteinuria (e.g. immunoglobulin G [IgG]), urinary nephrin excretion (podocyte injury) and serum levels of the soluble urokinase plasminogen activator receptor (suPAR), a proposed pathomechanically involved molecule in INS, in PUUV-infected patients. On admission, patients suffering from hantavirus infection showed significantly increased urinary nephrin, IgG, α1-MG and serum suPAR levels compared to healthy controls (Fig. 3A ). Though, urinary biomarker levels decreased in both groups over time, patients with severe PCR showed significantly higher levels of nephrin, IgG, ACR and PCR during the first 48 h after admission ( Table 2 ). Our data show a strong association between urinary nephrin levels and the extent of (non-selective) glomerular proteinuria, suggesting that hantavirus infection causes a pronounced podocyte damage and subsequent impairment of the GFB. To date, one other study showed significantly elevated blood suPAR levels and their association with hantavirus disease severity but did not include nephrinuria and the extent of proteinuria in their analysis 19 .
cord-035280-z0bbz19b	2020	
cord-048359-lz37rh82	2007	Subsequently, melting curve analysis, on conventional or nano-technology real-time PCR platforms, detects the samples that contain mutations in a high-throughput and closed-tube manner. Following denaturation and re-annealing of PCR products that leads to formation of cross-hybridized sequences at the positions of mutations ( Figure 1A ) the sample is exposed to Surveyor TM endonuclease that recognizes base pair mismatches or small loops with high specificity (28) and generates a break on both DNA strands 3 0 to the mismatch. Finally, because the amplified mutated sequences contain defined primers at their ends, direct sequencing of enzymatically selected PCR products is readily possible following the real-time melting step, enabling sequencing of low-level mutations identified by Surveyor TM . Here we enabled Surveyor TM , an endonuclease that recognizes selectively mismatches formed by mutations and small deletions following ''cross-hybridized sequence'' formation, to generate mutation-specific DNA fragments that are amplified and screened via differential melting curve analysis.
cord-048470-33mqfj2t	2001	Previous studies have reported the clinical usefulness of reverse transcription-polymerase chain reaction (RT-PCR) detection of thyroglobulin (TG) mRNA in the peripheral blood of patients with differentiated thyroid carcinoma. To evaluate this usefulness, we measured TG mRNA in the peripheral blood of patients diagnosed with thyroid carcinoma after total thyroidectomy by real-time quantitative RT-PCR using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as an internal control. Recent reports have demonstrated that the reverse transcription-polymerase chain reaction (RT-PCR) can be used to detect circulating cancer cells in the peripheral blood of patients with malignancies such as prostate cancer (Ghossein et al, 1995) and neuroblastoma (Mattano et al, 1992) . As such, we measured TG mRNA in the peripheral blood of patients after total thyroidectomy and determined the expression levels of TG mRNA by real time-quantitative RT-PCR using GAPDH mRNA as an internal control.
cord-102411-0mo1198e	2020	
cord-102511-7zgd45fl	2020	Here, we present the Donut PCR platform that features high multiplexing, rapid turnaround times, single nucleotide discrimination, and precise quantitation of DNA targets in a portable, affordable, and battery-powered instrument using closed consumables that minimize contamination. Here, we present the Donut PCR platform for DNA detection that combines scalable and massive multiplexing, rapid turnaround times, single nucleotide discrimination, and precise quantitation in a portable, affordable, and batterypowered instrument using closed consumables that minimize contamination risks ( Table 1 ). By engineering a donut-shaped reaction chamber in the PCR chip, we remove most of the dead volume, and are able to achieve similar PCR specificity on human genomic DNA as the commercial Bio-Rad CFX96 instrument (Fig. 2a) . The Donut PCR platform presented here achieves rapid, sensitive, and quantitative detection of many DNA targets from a single sample using a closed, portable, and affordable instrument.
cord-103163-0rreoh4o	2020	We determined the titers and RNA segment profiles of reovirus (rsT1L and rsT3D I ) and rotavirus (rsSA11) laboratory strains that had been rescued by reverse genetics then serially passaged ten times, each in triplicate lineages, in cultured cells. The two reoviruses accumulated non-canonical RNAs that retain 5′ and 3′ termini and feature one or more large internal deletions, while the rotavirus rarely accumulated such DVGs. Analyses of next-generation RNA-sequencing data sets from purified rsT1L reovirus RNA revealed many junctions, with hot spots for recombination in specific viral gene segments. Taken together, lin1 RNA profiles suggest non-canonical RNA species that differ in length but have identical termini to the parental segments accumulate variably during reovirus and rotavirus serial passage in cultured cells.
cord-103417-2uinislh	2020	
cord-103563-7a3wdduq	2020	Unlike other silicon-based technologies, TriSilix can be produced at wafer-scale in a standard laboratory; we have developed a series of methodologies based on metal-assisted chemical (wet) etching, electroplating, thermal bonding and laser-cutting to enable a cleanroom-free low-cost fabrication that does not require processing in an advanced semiconductor foundry. To create an ultra-low-cost device, the architecture proposed exploits the intrinsic properties of silicon and integrates three modes of operation in a single chip: i) electrical (Joule) heater, ii) temperature sensor (i.e. thermistor) with a negative temperature coefficient that can provide the precise temperature of the sample solution during reaction and iii) electrochemical sensor for detecting target NA. Using TriSilix, the sample solution can be maintained at a single, specific temperature (needed for isothermal amplification of NA such as Recombinase Polymerase Amplification (RPA) or cycled between different temperatures (with a precision of ±1.3°C) for Polymerase Chain Reaction (PCR) while the exact concentration of amplicons is measured quantitatively and in real-time electrochemically.
cord-103735-nil1vv6h	2020	
cord-103787-qhftb6d7	2005	Scalable transcriptional analysis routine (STAR) represents a novel integration of reverse transcriptase-polymerase chain reaction and capillary electrophoresis that allows detection of dozens of gene transcripts in a multiplexed format using amplicon size as an identifier for each target. Scalable transcriptional analysis routine (STAR) represents a novel integration of reverse transcriptase-polymerase chain reaction and capillary electrophoresis that allows detection of dozens of gene transcripts in a multiplexed format using amplicon size as an identifier for each target. We have developed STAR (scalable transcription analysis routine), a gene expression analysis platform that represents an innovative integration of real-time multiplex PCR and capillary electrophoresis (CE), allowing the simultaneous quantitative measurement of multiple targets in a single sample with high sensitivity. In a typical STAR experiment (diagrammatically shown in Figure 1A ), a PCR reaction is set up in a single tube containing the analyte, common PCR reagents (eg, DNA polymerase, dNTPs), and, for each target to be amplified, gene-specific primers where at least one of each pair is labeled with a fluorophore.
cord-140318-xtx8hl14	2020	Methods: We implemented RT-dPCR based COVID-19 group testing on commercially available system and assay (Naica System from Stilla Technologies) and investigated the sensitivity of the method in real life conditions of a university hospital in Paris, France, in May 2020. The results for SARS-CoV-2 detection by RT-dPCR in groups of 8 samples, detailed in Tables 1 and 2 , are in concordance with the reference individual RT-PCR testing for 52 groups (corresponding for 416 samples), out of which 32 were RT-PCR negative groups and 20 groups contained at least one RT-PCR+ sample. In this work, we assessed the sensitivity and specificity of group testing combined with digital PCR for SARS-CoV-2 detection.
cord-158252-l43ztxsl	2020	We found that compared to COVIDneg at the time of clinical presentation and diagnostic testing, COVIDpos patients tended to have higher plasma fibrinogen levels and similarly low platelet counts, with approximately 25% of patients in both cohorts showing outright thrombocytopenia. To this end, we instituted a holistic data science platform across an academic health care system that enables machine intelligence to augment the curation of phenotypes and outcomes from 15.2 million EHR clinical notes and associated 3 million lab tests from 1,192 COVID-19positive (COVIDpos) and 47,344 confirmed COVID-19-negative (COVIDneg) patients over a retrospectively defined 2-month observation period straddling the date of the PCR test (see Methods). Conversely, platelet counts were lower in the COVIDpos cohort at the time of clinical presentation but tended to increase over the subsequent 10 days to levels significantly higher than those in COVIDneg patients (Cohen''s D = 0.361, BH-adjusted Mann-Whitney p-value = 0.008, Table 2, Figure 2B ).
cord-245161-xbw72k4m	2020	
cord-252198-gs52k4lq	2010	We conclude that the theoretical risks arising from manufacturing seasonal influenza vaccine using MDCK-33016PF cells are reduced to levels that are effectively zero by the multiple, orthogonal processes used during production. In order to quantitatively assess potential risks represented by adventitious viruses, data were collected about growth properties of various relevant viruses in MDCK-33016PF cells, about the virus inactivating and virus clearance of the vaccine manufacturing process, and about the detection limits of applied PCR methods to detect adventitious viruses. Combining all data on the virus growth in MDCK-33016PF cells, on the inactivation or process removal of various model viruses, and with consideration of applicable detection limits for virus exclusion tests, a process-specific risk assessment was made using quantitative data relative to infectious doses. First a rigorous analysis of the MDCK-33016PF cells was undertaken to exclude the presence of infectious oncogenic viruses or infectious oncogenic viral genomes; secondly the manufacturing process was shown to be capable of inactivating potential virus contaminants at very high levels.
cord-252268-o63ep08b	2014	As this equation relies on consistency between samples in the RNA quantity assayed, and the optimum reaction efficiency, as well as minimal fluctuation in the expression of housekeeping genes (endogenous controls) (Peters et al., 2007; Mane et al., 2008; Bruder et al., 2010) , these parameters were optimized using RNA extracted from cultured ferret lymph node cells stimulated with mitogens or with influenza virus. To test the ability of ferret leukocytes to produce mRNA cytokines and chemokines, lymph node cells from naïve ferrets were cultured with various mitogens known to activate T and B lymphocyte and macrophage/monocyte responses (Fig. 5) and with live or heat inactivated influenza virus (Fig. 6 ) and the cytokine and chemokine expression profiles were determined (summarized in (ConA) or Phytohaemagglutinin (PHA), which act by cross linking T cell receptors via sugars on the surface of human T lymphocytes (Chilson and Kelly-Chilson, 1989) , induced similar cytokine profiles, increasing expression of IL2, IL4, IL6, IL10, IL17, Granzyme A, TNF␣ and IFN␥, most with high fold changes, consistent with effective stimulation of T lymphocytes (Fig. 5) .
cord-252347-vnn4135b	2007	METHODS AND FINDINGS: To directly type HRVs in nasal secretions of infants with frequent respiratory illnesses, we developed a sensitive molecular typing assay based on phylogenetic comparisons of a 260-bp variable sequence in the 5'' noncoding region with homologous sequences of the 101 known serotypes. The degenerate primers EV292 and EV222 for PCR amplification of NIm-1A region were not sensitive enough for direct detection of small amount of HRV in original clinical samples (data not shown), and high titer infected cell lysates of cultured isolates were needed to produce enough PCR product for cloning and sequencing. This new assay had 3 key components: sensitive pan-HRV primers and semi-nested PCR to amplify P1-P2 region from cDNA prepared from original clinical specimens, a sequence database of 260-bp P1-P2 region of 5''NCR of all 101 HRV serotypes to serve as standard references for HRV identification, and phylogenetic tree reconstruction of the new P1-P2 sequences and the 101 homologous reference sequences.
cord-252604-1u14i4v1	2006	To test the possibility that sera may contain Vesivirus genomes, as suggested by the clinical evidence of viremia in cases of Vesivirus illness, including humans [Smith et al., 1998a] , three complementary methods targeting three Vesivirus genomic regions were utilized to detect Vesivirus RNA in serum ( Fig. 1 ): dot blot for the ORF1 3C protease region, reverse transcriptionpolymerase chain reaction (RT-PCR) for the 3 0 terminal region of ORF1 encoding a portion of the viral RNA polymerase or for a portion of the viral capsid protein, and nucleotide sequencing of RT-PCR amplicons.
cord-252694-36ijqwge	2020	Der Referenzstandard für die Diagnose von COVID-19 ist eine positive "reverse transcription polymerase chain reaction" (RT-PCR) eines Nasen-/ Rachenabstriches oder einer Probe tiefen Bronchialsekrets [4] . Mehrere medizinische und radiologische Fachgesellschaften haben Empfehlungen für die Anwendung der verschiedenen Bildgebungsmodalitäten bei Patienten mit Verdacht auf oder bereits nachgewiesener SARS-CoV-2 publiziert [5] [6] [7] [8] [9] [10] . Sollten sich COVID-19-typische Lungenveränderungen als Zufallsbefund bei respiratorisch asymptomatischen Patienten zeigen, ist eine Bestätigung der Diagnose mittels RT-PCR notwendig [7, 8] . Im Thoraxröntgen untypisch für COVID-19 sind Kavitationen und Pleuraergüsse, die hinweisend auf Komplikationen oder andere Diagnosen wie beispielswei-se eine kardiale Dekompensation sein können [19] . Besteht jedoch eine hohe klinische Vortestwahrscheinlichkeit für COVID-19, beispielsweise bei typischen klinischen Symptomen und bekanntem Kontakt zu einer SARS-CoV2-positiven Person oder einer hohen Erkrankungsprävalenz in der Bevölkerung, sind diese jedoch als wahrscheinlich für das Vorliegen einer COVID-19-Pneumonie zu werten.
cord-252838-av7ducrk	2010	
cord-253502-v2hh3w3r	2004	authors: Leung, C.W.; Chiu, W.K. title: Clinical picture, diagnosis, treatment and outcome of severe acute respiratory syndrome (SARS) in children [5] [6] [7] [8] [9] [10] [11] Superspreading events including a major hospital outbreak, in-flight transmission on board commercial PAEDIATRIC RESPIRATORY REVIEWS (2004) Summary Children are susceptible to infection by SARS-associated coronavirus (SARS-CoV) but the clinical picture of SARS is milder than in adults.
cord-253826-63dgq551	2017	
cord-254064-qxgpehuy	2020	In spite of several observational studies and a few randomized controlled trials, the effect of hydroxychloroquine on patients with COVID 19 infection remains unclear. Conclusions Our meta-analysis does not suggest improvement in clinical progression, mortality, or viral clearance by RT PCR among patients with COVID 19 infection who are treated with hydroxychloroquine. Hence, we performed a systematic review and meta-analysis of available controlled studies to evaluate the safety and efficacy of hydroxychloroquine in the treatment of COVID-19 infection. Studies were considered eligible if they included patients who received hydroxychloroquine alone or in combination with other specific treatment modalities for COVID-19 infection and were compared with a control group. Data on at least one of the following outcomes had to be available for inclusion in the meta-analysis: (i) mortality, (ii) clinical progress, (iii) results of the reverse transcription-polymerase chain reaction (RT-PCR) test after the commencement of treatment, (iv) changes on computed tomography (CT) imaging of the chest, and (iv) adverse clinical events.
cord-254101-613aftc1	2012	In this study, we generated by fusion PCR a vector to express high levels of chimeric secretory IgD (csIgD) specifically in the liver. Hyperimmunoglobulinemia D syndrome (HIDS), also called receptor-associated periodic syndrome or etiocholanolone fever, is characterized by high serum levels of immunoglobulin D (IgD) and recurrent febrile attacks, and may also include arthritis, lymphadenopathy, hepatosplenomegaly, and skin rash [1-3]. The resulting plasmids, designated en-pAlb-csIgD-H and en-pAlb-cKappa, were under control of the mouse Alb regulatory sequences to direct gene expression specifically in the liver. This indicates that the inflammation in the transgenic mice is caused by increased sIgD rather than by Mvk mutation. Skin ulcers in transgenic mice with high expression of sIgD may be caused by excessive immune activation. An albumin enhancer located 10-kb upstream functions along with its promoter to direct efficient, liver-specific expression in transgenic mice High level expression of a functional human/mouse chimeric anti-CD20 monoclonal antibody in milk of transgenic mice
cord-254115-hwy962a4	2017	xMAP multiplex assays are currently available in various nucleic acid and immunoassay formats, enabling simultaneous detection and typing of pathogenic viruses, bacteria, parasites and fungi and also antigen or antibody interception. High-throughput multiplex detection techniques are designed for the rapid, sensitive and specific testing of large numbers of analytes (nucleic acid assays, immunoassays, enzyme assays, or receptor-ligands) in a single biological sample. Although PCR allows multiplex amplification of several targets in a single run xMAP as a methodology represents a significant step forward, and was designed with the aim of creating a high-throughput bioassay platform, enabling rapid, cost-effective, and simultaneous analysis of multiple analytes within a single biological sample. In direct DNA hybridization (DDH), allele-specific primer extension (ASPE), single base chain extension (SBCE), and Oligonucleotide ligation assay (OLA) all the target DNA sequences are amplified in multiplex PCR prior to hybridization to microspheres.
cord-254250-l0v602x9	2020	title: A Novel RNA Virus, Macrobrachium rosenbergii Golda Virus (MrGV), Linked to Mass Mortalities of the Larval Giant Freshwater Prawn in Bangladesh De novo virus assembly revealed a 29 kb single-stranded positive-sense RNA virus with similarities in key protein motif sequences to yellow head virus (YHV), an RNA virus that causes mass mortalities in marine shrimp aquaculture, and other viruses in the Nidovirales order. rnaSPAdes assembly of combined libraries produced 38,826 contigs; 23 contigs, of average length 4560 bp, had similarity in protein sequence to YHV or gill-associated virus (GAV), but when the trimmed reads were aligned against the YHV genome (accession number GCA_003972805.1), no alignment was seen. rosenbergii were negative: MrNV and XSV, the causative agents of white tail disease [9, 10] ; MrTV, a virus associated with mass larval mortalities in China [15] , Spiroplasma eriocheiris [8] , and WSSV-shown to be able to infect M.
cord-254265-8i86c8kt	2008	
cord-254450-ienq3aex	2013	
cord-254506-cxdklz4u	2020	The aim of this study was to describe the impact on clinical practice of sequential preoperative screening for COVID-19-infection in deciding whether to proceed or postpone surgery. Sequential preoperative screening for COVID-19-infection: two-time medical history (telematic and face-to-face), PCR and chest CT, 48 hours before of surgical intervention. Conclusion preoperative screening for COVID-19-infection using medical history and PCR helped the surgeon to decide whether to go ahead or postpone surgery in oncological patients. Three preoperative screening tests have been proposed: a detailed history, a COVID-19 PCR determination and a chest radiological imaging (CT or Xray), despite not having any control studies available [6] [7] [8] [9] [10] [11] [12] . Therefore, our working hypothesis is that sequential preoperative screening: clinical (detailed history), PCR and radiology (chest CT) of COVID-19 infection and pneumonia will identify symptomatic and asymptomatic infected patients.
cord-254825-c5d0wul9	2020	
cord-255013-njpuc475	2014	
cord-255019-iie8wxb4	2010	title: Acute lower respiratory tract infections by human metapneumovirus in children in Southwest China: A 2‐year study Specimens were collected over a 2‐year period from children hospitalized with acute lower respiratory tract infections (ALRTI) and analyzed for the presence of hMPV using real‐time RT‐PCR assays. 2, 3 Human metapneumovirus (hMPV) was first isolated in 2001 from nasopharyngeal aspirates (NPAs) obtained from children with acute lower respiratory tract infections (ALRTI) in the Netherlands. The validated assay was then used to detect the presence of hMPV in NPAs from pediatric patients presenting at a large teaching children''s hospital located in southwest China over a period of 2 years. NPAs from pediatric patients presenting with ALRTI in the daytime were collected at the Respiratory Ward, Children''s Hospital of Chongqing Medical University, on three fixed days each week over a 2-year period from April 2006 to March 2008.
cord-255026-fdp6mies	2007	The experiences of an OIE-Collaborating Centre and of two EU project consortia are summarised on the diagnostic application of gel-based PCR, general PCR systems, phylogeny, molecular epidemiology, real-time PCR (TaqMan, Molecular Beacons, Primer-Probe Energy Transfer), amplification without thermocycling (Invader), multiplex PCR, nucleic acid extraction and pipetting robotics, automation and quality control, including internal controls.
cord-255043-uxdsjr39	2020	
cord-255096-27dfbhsl	2016	
cord-255384-tljyx6ua	2014	
cord-255465-sc1yzzsn	2006	
cord-255495-xnoppq3y	2020	
cord-255545-nycdhdsd	1999	In theory, sense-specific measurement of viral RNAs may be achieved by reverse transcription polymerase chain reaction (RT-PCR) assays which utilize primers of defined polarity during the RT step. Key RT-PCR parameters which were optimized include the design of tagged primers, DNase treatment of in vitro transcribed RNA standards, specification of temperature differences between RT and PCR annealing steps, and use of competitive RNA templates for quantitative assays. In fact, several studies have demonstrated that RT-PCR assays based on specific RNA template recognition by RT primers of defined polarity will not reliably distinguish between viral RNAs of positive or negative sense. Despite the findings above, many published research reports are based on conventional RT-PCR assays, relying on the polarity of primers added to the RT step in putative sense-specific measurements of viral RNAs; rarely are control reactions performed to rigorously show that this method is in fact sense-specific.
cord-255711-8lojw5cz	2019	
cord-255871-dau9tz6u	2015	BACKGROUND: It is crucial to understand the current status of clinical laboratory practices for the largest outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) infections in the Republic of Korea to be well prepared for future emerging infectious diseases. The number of MERS-CoV rRT-PCR tests performed was collected from 32 medical institutions and five referral medical laboratories. A total of 27,009 MERS-CoV rRT-PCR tests were performed at 32 medical institutions (N = 11,502) and five referral medical laboratories (N = 15,507) (Table 1 and Fig. 1 ). The proportion of medical institutions was significantly underestimated because one tertiary care hospital submitted responses for the survey but not the specimen list, and the numbers of MERS-CoV rRT-PCR tests and positive specimens at this institution would have been predominant in the reporting medical institutions. Table 2 shows the current status of clinical laboratories in medical institutions with respect to their response to the outbreak of MERS-CoV infections.
cord-255975-ymw9avlm	2011	The direct analysis of whole pathogenic microbial cells with matrix‐assisted laser desorption/ionization MS without sample separation reveals specific biomarkers for taxonomy, and has the advantages of simplicity, rapidity, and high‐throughput measurements. Matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) allows the fast and accurate identification and subtyping of bacterial species (Seng et al., 2009; Stevenson, Drake, & Murray, 2010) , fungi (Marinach-Patrice et al., 2009 , 2010 Santos et al., 2010) , and viruses Franco et al., 2010) . Direct bacterial profiling with MALDI-TOFMS is based mainly on a comparison of specific mass spectra of the proteins, peptides, and other cellular components that are obtained from microbial cells. The development of a matrix-assisted laser desorption/ionization mass spectrometry-based method for the protein fingerprinting and identification of Aeromonas species using whole cells On-probe sample pretreatment for direct analysis of lipids in gram-positive bacterial cells by matrix-assisted laser desorption ionization mass spectrometry Universal sample preparation method for characterization of bacteria by matrix-assisted laser desorption ionization-time of flight mass spectrometry
cord-255983-3dq99xz9	2012	The quantitative assay was compared to a commercial conventional multiplex PCR method (Seeplex TM RV detection kit, Seegene, Inc., Seoul, Korea) (Kim et al., 2009; Roh et al., 2008) respiratory samples from a study (Do et al., 2011) on acute respiratory infection in children at the Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam. All samples were analyzed in parallel by the commercial multiplex Seeplex TM RV detection kit (Seegene, Inc., Seoul, Korea) according to the manufacturer''s instructions, to determine the presence of 12 respiratory viruses: human RSV subgroups A and B (RSV A, RSV B); influenza virus A (InfV A); influenza virus B (InfV B); human coronaviruses (229E, OC43), human metapneumovirus (hMPV), parainfluenza virus 1, 2 and 3 (PIV1, 2, 3), human rhinovirus (hRV A) and adenovirus (AdV) (Kim et al., 2009; Roh et al., 2008) and by the newly developed RSV LNA real-time RT-PCR.
cord-256130-zhlvvuj4	2018	Here, we evaluated quantification of torque teno virus (TTV) and Epstein-Barr virus (EBV) as biomarkers for defining the net state of immunosuppression in lung-transplanted patients. The aim of the present study was to evaluate levels of TTV and EBV in relation to the frequency of infectious events and acute rejections over time in a prospective manner in a single-center cohort of lung-transplanted patients. The total nucleic acid content was isolated from serum or whole blood samples and analyzed for TTV-, EBV-, and CMV-DNA load by real-time PCR. Comparison of TTV-and EBV-DNA levels in lung transplant recipients who received either Tacrolimus-or Cyclosporinebased therapy revealed that Cyclosporine-treated patients had significantly lower TTV-DNA levels in serum at month 6 post-LTx and onwards, compared with the Tacrolimustreated patients (Figure 1 ). However, we found no association between either TTV-or EBV-DNA load and infectious events or acute rejections, which suggests a limited clinical applicability as biomarkers predicting short-term outcomes related to the net state of immunosuppression.
cord-256146-d599uera	2003	
cord-256244-f5zsy56p	2019	Mycoplasma pneumonia was tested for using the loop-mediated isothermal amplification method (Eiken Chemical, Tokyo, Japan) 15 when physicians in charge considered it as a potential etiologic pathogen based on patient age and symptoms regardless of the patient''s eligibility for this study. We encountered an outbreak of EV-D68 in the autumn of 2015 (September-October), in which the number of patients with respiratory symptoms who required treatment for wheezing increased dramatically compared with previous years. 19, 29, 30 In the present study, EV-D68 infection with a history of asthma was not associated with either severity (defined as ICU admission, magnesium sulfate use, or ventilation support) nor prolonged hospitalization. In contrast to previous research, asthma history was not associated with the risk of developing severe respiratory infections in the present study. Two cases of acute severe flaccid myelitis associated with enterovirus D68 infection in children
cord-256338-ovj63ith	2020	title: SARS-CoV-2 RT-PCR profile in 298 Indian COVID-19 patients : a retrospective observational study Currently as per the revised government of India guidelines asymptomatic or mildly symptomatic patients can be discharged 10 days after symptom onset and the strategy of repeat RT-PCR testing has been done away with. Cases with laboratory confirmed diagnosis of COVID-19, made by positive SARS-CoV-2 RT-PCR on nasopharyngeal samples, were enrolled regardless of symptomatology. The mean duration from 1st and last positive RT-PCR assays between symptomatic and asymptomatic patients were 13·01±4·63 and 13·93±5·42 days respectively; and the difference was not statistically significant with p value <0·05 (p=0·39). This study was conducted in the initial part of pandemic in India, which, to the best of our knowledge provides the largest data on SARS-CoV-2 RNA detection in naso-pharyngeal and oro-pharyngeal samples in symptomatic or asymptomatic COVID-19 cases. Profile of RT-PCR for SARS-CoV-2: a preliminary study from 56 COVID-19 patients
cord-256355-muskjaw3	2002	
cord-256456-rg366bk2	2010	Contrary to group 1, group 2 agents like Torque Teno virus (TTV) or RD114, a replication-competent feline γ-retrovirus, have only recently been recognised and their role as contaminants needs further investigation. Since 2007, 12 batches of live Aujeszky''s disease vaccines have been tested for Pestivirus by reverse transcriptase-polymerase chain reaction (RT-PCR), in the framework of the Official Control Authority Batch Release (OCABR). In addition, 27 poultry vaccines, from eight different manufacturers, used in Hungary between 1996 and 2009 were randomly selected and examined by PCR for the presence of chicken anaemia virus (CAV) and egg drop syndrome virus (EDSV). Contrary to the wellknown Group 1 agents, Group 2 contains new potential contaminants, such as TTV and/or RD114 virus, recently found to be present in vaccines. Swine Torque Teno virus detection in pig commercial vaccines, enzymes for laboratory use and human drugs containing components of porcine origin
cord-256608-ajzk86rq	2019	
cord-256702-lwxt4587	2020	title: A case of SARS-CoV-2 carrier for 32 days with several times false negative nucleic acid tests After the onset of clinical symptoms, chest CT results showed patchy ground-glass opacity (GGO) in her lungs, but it took a total of nine nucleic acid tests to confirm the diagnosis, among which the first eight RT-PCR results were negative or single-target positive. Although the nucleic acid test was negative or single-target positive, the low number of white blood cells and lymphocytes in laboratory tests, and GGO in the lungs by CT examination indicated SARS-CoV-2 infection. https://doi.org/10.1101/2020.03.31.20045401 doi: medRxiv preprint pathogenic nucleic acid genomes from samples of asymptomatic and occult infected patients is also conducive to studying the virus mutations in the pathogenic genes providing a basis for subsequent virus tracing and epidemiological investigations. We report the epidemiological history and clinical information of a patient with negative (or single-target positive) SARS-CoV-2 infection with multiple RT-PCR tests.
cord-256931-wj0esjwi	2015	The etiology of community-acquired pneumonia (CAP) is determined in less than half of the patients based on cultures of sputum and blood plus testing urine for the antigens of Streptococcus pneumoniae and Legionella pneumophila. A common core diagnostic test bundle was applied to all patients in the study: i.e., 2 blood cultures; sputum culture and sensitivity; serum PCT level; and urine antigen testing for L. If a respiratory virus was detected and the serum PCT was above 0.5 ng/mL and/or a bacterial pathogen was found in the sputum culture, the patient was assumed to have a dual infection with the identified virus and bacteria. If a respiratory virus was detected, an associated bacterial infection was deemed present if a bacterial pathogen was identified by culture or PCR or urine antigens or if the serum PCT concentration was N0.5 ng/mL.
cord-256982-t6urqus7	2020	The sensitivity in serum samples, collected at a median of 24 days after onset of symptoms, detected by the Anti-SARS-CoV-2-ELISA IgG (Euroimmun), EDI™ Novel Coronavirus COVID-19 IgG ELISA (Epitope Diagnostics), Liaison(®) SARS-CoV-2 S1/S2 IgG (Diasorin), SARS-CoV-2 IgG on the Architect™ i2000 (Abbott), and Elecsys(®) Anti-SARS-CoV-2 (IgM/IgA/IgG) on the cobas™ e801 (Roche) was 84.3%, 78.4%, 74.5%, 86.3%, and 88.2%, respectively. Our results show significant individual differences of the IgG response against SARS-CoV-2, additionally confirmed in three patients with follow-up serum samples and seven asymptomatic but PCR-positive contact persons. In conclusion, our study shows that commercially available immunoassays detect SARS-CoV-2-IgG or total antibodies in outpatients with a satisfying sensitivity, but lower than that reported for hospitalized patients. A comparison of five commercial immunoassays in serum samples taken at least ten days after onset of symptoms from 51 PCR-confirmed COVID-19 outpatients revealed an overall sensitivity of the assays from 74.5% to 88.2%.
cord-257217-f9sdt7ax	2014	
cord-257284-dash9udv	2010	The detection limit was 10(1) and 1.20 × 10(1) DNA copies per 10 μl(−1) of template for standard DNA and a CHV-1-positive kidney sample, respectively: about 1-log higher than a gel-based PCR assay targeting the thymidine kinase gene. Unlike other CHV-1-specific diagnostic methods, this quantitative assay permits simultaneous detection and quantitation of CHV-1 DNA in a wide range of canine tissues and body fluids, thus providing a useful tool for confirmation of a clinical diagnosis, for the study of viral pathogenesis and for evaluation of the efficacy of vaccines and antiviral drugs. To evaluate the detection limits of the real-time PCR assay, 10fold dilutions of the plasmid DNA, ranging from 10 9 to 10 0 copies, were made in a CHV-1-negative kidney homogenate and tested subsequently. The development and validation of a real-time PCR assay for detection and absolute quantitation of CHV-1 DNA in tissue samples and body fluids of dogs are described.
cord-257316-dmc8wjyl	2007	
cord-257398-fmkfo5ju	2020	In the present study, we collected clinical data from 652 suspected COVID-19 patients and 206 non-COVID-19 patients to investigate the diagnostic value of SARS-CoV-2 IgM/IgG antibody test kits with colloidal gold immunoassays and nucleic acid RT-PCR test kits. As recently reported, a rapid IgM/IgG October 6, 2020 Volume 8 Issue 19 combined antibody test was used for the diagnosis of SARS-CoV-2 infection, showing 88.66% sensitivity and 90.63% specificity [15] . Of the 415 suspected COVID-19 patients who were negative for the SARS-CoV-2 nucleic acid tests, 366 patients were positive for the SARS-CoV-2specific IgM and/or IgG antibody tests with a positive detection rate of 88.2%. Of the 415 suspected COVID-19 patients who were negative for the SARS-CoV-2 nucleic acid tests, 366 patients were positive for the SARS-CoV-2specific IgM and/or IgG antibody tests with a positive detection rate of 88.2%.
cord-257456-15bm9psj	2020	
cord-257521-1amcsgmj	2001	All 7 patients had a significant increase in antibody titers between serum samples collected during the acute and convalescent phases of the illness. Only 1 of the 7 patients from whom these samples were obtained was still positive by PCR at the first control visit 1 week later, but a signal was detected only with the NS-1 primer pair. A у8-fold increase between acute-and convalescent-phase serum samples was found in all 7 individuals with PCR-positive results (table 2). All 7 individuals with PCR-positive results had a у8-fold increase in antibody titers between serum samples collected during the acute and convalescent phases of the illness. In addition, 1 study participant with PCR-negative results also had a significant increase in antibody titer (patient 160; table 2). NPAs obtained from the 7 patients with RT-PCR-positive results at the first control visit 1 week after study entry also were tested.
cord-257600-0plhquk9	2020	Differences in health-care systems, in the incidence and prevalence of SARS-CoV-2 infection by geographic regions, and patient access to intensive support care -including MVand treatment with antivirals or anti-IL6/IL1 agents may ultimately influence outcomes in patients with lung cancer affected by COVID-19. We aimed to describe the clinical characteristics of lung cancer patients with COVID-19 attended in a tertiary hospital in Madrid, one of the most hit regions by coronavirus in the world so far, and analyze factors associated with worse outcome, including type of treatment receiving at the time of COVID-19 diagnosis. We performed SARS-CoV-2 RT-PCR to every suspicious case and included all lung cancer patients attended at our hospital (emergency room, hospitalization, ambulatory office, day care area). Data from Wuhan, in China, showed that active cancer treatment received in the 14 days before SARS-CoV-2 infection had an increase on the risk of severe outcomes of COVID-19 (HR 4.079, 95%CI, 1.086-15.322; p = 0.037) (9) .
cord-257661-iwwzli0w	2006	
cord-258008-t78svobg	2010	Two molecular assays were compared with real-time RT-PCR and viral culture for simultaneous detection of common viruses from respiratory samples: a multiplex ligation-dependant probe amplification (MLPA) and a dual priming oligonucleotide system (DPO). A panel of 168 culture-positive and negative samples was tested by the molecular assays for the presence of influenza A and B virus, respiratory syncytial virus, human metapneumovirus, rhinovirus, coronaviruses, parainfluenza viruses and adenovirus. Both molecular assays are comparable with real-time RT-PCR, more sensitive than viral culture and can detect dual infections easily. In this study, two commercial molecular assays, both designed for simultaneous detection of the most common viruses from a variety of respiratory samples, were compared with real-time RT-PCR and viral culture: a multiplex ligation-dependant probe amplification (MLPA) and a dual priming oligonucleotide system (DPO). Defined as true positives were samples that yielded positive viral detections by more than one method (culture, DPO, MLPA or real-time RT-PCR).
cord-258021-xhx74vr6	2016	This review focuses principally on the diagnosis of Legionella, Mycoplasma, and influenza infections, but also covers recent publications on the cutting edge of diagnostic tools likely to transform the field of infectious diseases over the coming decade. 28 Recently, there has been interest in antigen detection assays for the diagnosis of M pneumoniae because these offer the potential for point-of-care testing, but so far these have yet to enter the clinical mainstream. 73 A single study from Taiwan indicates that PCR-electrospray ionization mass spectrometry has promise for the detection of multiple viruses in the setting of respiratory tract infection but this was done retrospectively rather than in real time. Comparison of the performance of direct fluorescent antibody staining, a point-of-care rapid antigen test and virus isolation with that of RT-PCR for the detection of novel 2009 influenza A (H1N1) virus in respiratory specimens
cord-258057-ti0rpt0q	2020	
cord-258250-zueo1xfa	2020	title: Comparison of Automated SARS-CoV-2 Antigen Test for COVID-19 Infection with Quantitative RT-PCR using 313 Nasopharyngeal Swabs Including from 7 Serially Followed Patients In summary, the LUMIPULSE antigen test can rapidly identify SARS-CoV-2-infected individuals with moderate to high viral loads and may be helpful for monitoring viral clearance in hospitalized patients. To date, 11 million individuals have been infected with SARS-CoV-2 and 0.52 million patients have died from coronavirus disease 2019 (COVID-19) [2] . We compared the quantitative RT-PCR (RT-qPCR) results for viral load with the CLEIA results for antigen level following testing of 313 nasopharyngeal swabs. We used 100 µL of the supernatant per sample of thawed viral transport media from each nasopharyngeal swab to measure the antigen level with the LUMIPULSE SARS-CoV-2 Ag kit (Fujirebio) on the LUMIPULSE G600II automated immunoassay analyzer (Fujirebio) based on the CLEIA method. We next examined the relationship between the SARS-CoV-2 viral loads (as determined by RT-qPCR) and the antigen levels (Fig 2) .
cord-258438-6exkwp52	2015	
cord-258724-1qhen1bj	2020	METHODS: We evaluated these characteristics and established their association with clinical severity in a prospective observational cohort study of 100 patients with PCR-confirmed SARS-CoV-2 infection (mean age 46 years, 56% male, 38% with comorbidities). In this multi-pronged study, we describe the serologic evolution, inflammatory response and pattern of viral shedding and viability in patients with virologically confirmed COVID-19 in Singapore, and analyse the contributions these make to severe infections. Serum collected during the acute and convalescent phases of infection were tested for SARS-CoV-2 receptor binding domain specific IgM and IgG using capture ELISA (details in Supplementary Appendix). The central role of the immune response to SARS-CoV-2 in COVID-19 was evident from the strong correlation between disease severity and levels of IgG/IgM and inflammatory immune mediators in our cohort. Temporal profiles of viral load in posterior oropharyngeal saliva samples and serum antibody responses during infection by SARS-CoV-2: an observational cohort study
cord-258768-bjjfkfgg	2010	Two hundred fifty samples were collected in total, Fig. 2 Phylogenetic tree based on partial S gene nucleotide sequences of CCoVs described in this study and reference strains. As a result of RNA recombination, insertions, deletions and a high susceptibility to frequent mutation, coronaviruses can mutate rapidly, leading to new genotypes (CCoV-I), biotypes (pantropic CCoV) and host variants (canine respiratory coronavirus), all of which may present possible difficulties regarding successful vaccination of dogs. As a result of this study, it can be concluded that although it appears that the viral evolution of CPV type 2 is not yet a significant problem for the canine population in Ireland, vaccine efficacy may need to be re-evaluated by the animal healthcare industry, as it is a possibility that the new CPV-2c strain will eventually emerge into the population as a result of importing dogs from other parts of the world.
cord-258819-4boe6t1v	2020	title: The Limited Sensitivity of Chest Computed Tomography Relative to Reverse Transcription Polymerase Chain Reaction for Severe Acute Respiratory Syndrome Coronavirus-2 Infection: A Systematic Review on COVID-19 Diagnostics OBJECTIVES: Several studies suggest the sensitivity of chest computed tomography (CT) is far greater than that of reverse transcription polymerase chain reaction (RT-PCR) in diagnosing COVID-19 patients, and therefore, CT should be included as a primary diagnostic tool. The quality assessment tool QUADAS-2 was used to stratify studies according to their risk of bias, and exclusion criteria included not providing the information deemed relevant for such a stratification, such as not indicating if the patients were symptomatic or asymptomatic, or identifying the source of the specimen for the reference standard, RT-PCR (eg, nasal, oropharyngeal, etc). A recent study by Li and colleagues 18 tested a cohort of patients assumed to have SARS-CoV-2 infection owing to CT findings consistent with a viral pneumonia and reported an RT-PCR sensitivity of 27.5% (n = 610).
cord-259004-plst2wno	2004	
cord-259324-g8kv4pvq	2011	In this study, we assessed the feasibility of producing a protective antigen for the PEDV spike protein 1 using duckweed, Lemna minor. Transgene integration and expression of the PEDV spike protein 1 gene were confirmed by genomic PCR and RT-PCR and western blot analysis of transgenic Lemna, respectively. In this study, we report the stable transformation and expression of a protective antigen for PEDV in Lemna minor with potential for use as an effective complement to the diets of animals. Fronds were then blotted onto sterile filter paper, and co-cultivated with Agrobacterium tumefaciens strain EHA105 harboring the PEDV spike protein 1 gene fused to a c-myc tag for 72 h on antibiotic-free ½MS1BA medium. PCR products of the expected size (330 bp) corresponding to primers designed on the internal PEDV spike protein 1 gene were detected from kanamycin-resistant Lemna, whereas no DNA band corresponding to the target gene was detected in untransformed wild-type Lemna.
cord-259422-5ex12eun	2003	title: A prospective, community-based study on virologic assessment among elderly people with and without symptoms of acute respiratory infection METHODS: In a 1-year community-based study, we prospectively investigated the possible virologic cause of acute respiratory infections in 107 symptomatic case episodes and 91 symptom-free control periods. Therefore, in this prospective, community-based study, we investigated the presence of known respiratory viruses in elderly persons both with and without symptoms of an acute upper respiratory tract infection. Second, we compared the clinical characteristics of the persons suffering from an acute respiratory infection, during episodes with positive and negative virologic laboratory diagnosis. Cases who reported their symptoms after 3 days to the study nurse were excluded for virologic assessment to overcome false negative test results. Preliminary results of a Dutch study being performed in persons consulting their general practitioner for signs and symptoms of an acute respiratory infection, showed a positive virologic assessment in 19% of the controls [16] .
cord-259458-o2yts5pq	2011	This study assessed the sensitivity of a simple method for transporting respiratory samples from a remote setting for viral PCR compared with frozen specimens. To inform the design of surveillance and intervention studies addressing respiratory infections in remote communities, we compared the sensitivity of a simple, cost-efficient method for transporting respiratory samples from a remote setting for viral real-time PCR with transport using frozen specimens. Given the sensitivity and specificity of real-time PCR diagnosis, we considered a specimen from either nostril positive for any virus to represent a true-positive, similar to previous studies (Lambert et al. Determining the aetiology and burden of viral respiratory infections in remote communities has to date been limited by the inability to store and transport clinical specimens requiring freezing ⁄ refrigeration to urban laboratories. We propose that this method, combining standard clinic refrigeration and weekly surface mailing of specimens combined with real-time PCR, can be used for viral respiratory research in remote locations.
cord-259590-ot933axv	2011	In this article, the current knowledge of human coronavirus HCoV-NL63, with special reference to the clinical features, prevalence and seasonal incidence, and coinfection with other respiratory viruses, will be discussed. In this article, the current knowledge of human coronavirus HCoV-NL63, with special reference to the clinical features, prevalence and seasonal incidence, and coinfection with other respiratory viruses, will be discussed. A recent comprehen sive 2year populationbased study, using data from different countries, on children under 3 years of age with lower respiratory tract infec tion (LRTI) shows that HCoVNL63 infections peak in winter months. Another study reports that HCoVNL63, when compared with other respiratory viruses, is the virus secondmost com monly associated with young children (median age 13 months) hospitalized with croup [17] . A novel pancoronavirus RTPCR assay: frequent detection of human coronavirus NL63 in children hospitalized with respiratory tract infections in Belgium
cord-259717-e8ljkv2y	2014	Viromes from Northern Territory children contained more viral families per sample than viromes from Melbourne, which could be attributed largely to an increased number of sequences from the families Adenoviridae and Picornaviridae (genus enterovirus). Viromes from Northern Territory children contained more viral families per sample than viromes from Melbourne, which could be attributed largely to an increased number of sequences from the families Adenoviridae and Picornaviridae (genus enterovirus). Because previous metagenomic studies demonstrated significant virus diversity in patients with diarrhea (Finkbeiner et al., 2008) we focused this study on comparing the eukaryotic virus populations in stools of children with diarrhea collected from two different locations, Melbourne, Australia and the Northern Territory, Australia. In order to independently confirm the sequencing results, we used PCR to define the prevalence of the most frequently detected viruses for which pan-family or pan-genus primers could be used including: adenovirus, astrovirus, enterovirus, norovirus, and rotavirus.
cord-259747-sl9q63oc	2020	BACKGROUND: Post-mortem studies can provide important information for understanding new diseases and small autopsy case series have already reported different findings in COVID-19 patients. IHC revealed positive cells with a heterogeneous distribution in the lungs of 11 of the 17 (65%) patients; RT-PCR yielded a wide distribution of SARS-CoV-2 in different tissues, with 8 patients showing viral presence in all tested organs (i.e., lung, heart, spleen, liver, colon, kidney, and brain). In this post-mortem study, we included the first 17 adult patients (> 18 years) who died in our hospital (either in a COVID-19 unit or an intensive care unit) from March 13, 2020, with confirmed SARS-CoV-2 infection (i.e., positive RT-PCR assay on nasopharyngeal swab and/or bronchoalveolar lavage specimen). This post-mortem study showed several histopathological abnormalities in COVID-19 non-survivors; however, none of the findings was specific for direct viral injury, even though SARS-CoV-2 was detected in all examined organs using RT-PCR.
cord-259823-ia1g5dt4	2017	British, American, and Polish guidelines state that, in children hospitalized due to pneumonia, microbiological examinations should include blood cultures, the detection of the presence of viruses with the use of PCR (Polymerase Chain Reaction) or immunofluorescence in material collected from the nasopharynx (smear or upper respiratory aspirate), the assessment of antibodies against Mycoplasma and Chlamydophila in classes IgM and IgG, and the comparison of antibody levels in the acute phase of the disease and during convalescence [4] [5] [6] . achieved positive results of multiplex real-time PCR tests detecting only viral factors in 76% of cases in a group of children below the age of six with symptoms of respiratory tract infection and the dominant pathogen was RSV [12] .
cord-259886-j0bpp7iw	2020	SPT oligonucleotides contain probe binding and virus-irrelevant regions as templates for detecting SARS-CoV-2 genes (RdRP, E, and N SARS-CoV-2) by real-time RT-PCR was performed in a concentration-dependent manner. Therefore, this approach may be integrated into the molecular diagnosis of COVID-19 and provides a general method for preparing positive controls for diagnosing emerging RNA virus infections. Therefore, a new preparation design that provides contamination-free positive controls for COVID-19 real-time RT-PCR testing is urgently needed. Here, we present a new approach for producing synthetic positive controls using synthetic positive template (SPT) oligonucleotides that contain probe binding and virusirrelevant regions as templates for detecting SARS-CoV-2 genes by real-time RT-PCR. We performed multiplex real-time RT-PCR using an SPT (positive control) as a template in a concentration-dependent manner, to determine the limit of detection (LOD) for individual SARS-CoV-2 genes. In previous studies, the Uni-Control method for preparing real-time RT-PCR positive controls has been developed as a generic approach for diagnosing viral infections [22] .
cord-259988-3s7b5ovi	2005	A mammalian orthoreovirus (MRV) strain was isolated from a pup with fatal diarrhea, which had a concurrent infection by canine parvovirus type 2. Assignment of the isolated virus to MRV-3 was confirmed by type-specific RT-PCR assays, targeting the S1 gene, and by subsequent sequence analysis of the PCR product. A total of 110 fecal samples, 56 nasal and 31 ocular swabs from dogs with diarrhea or nasal/ocular discharge were tested by a nested-PCR assay specific for reoviruses, and no sample was found to contain MRV RNA, a finding that is apparently in contrast with the seroprevalence (25.77%) observed in dogs. In the present study, the isolation and molecular characterization of a MRV-3 strain from a dog with diarrhea are reported. By the type-specific RT-PCR assays the isolate was recognized as MRV-3 (Fig. 5) , and therefore designated T3/ canine/Italy/Decaro/2004 (T3D/04), according to the conventional system used to identify MRV strains.
cord-260168-rb7j94dh	2007	Negative controls also included an unrelated antisense probe against the fragment of the polymerase gene (R1AB) of the severe acute respiratory syndrome-associated coronavirus (SARS-CoV), 20 as well as H5N1 in-situ hybridisation probes to tissues (including lung and tracheal) obtained from seven adults who died from infectious lung diseases other than H5N1 infl uenza (four, SARS; one, purulent bronchitis; two, pneumonia), one adult who died from a non-infectious disease (gastric ulcer), one pregnant woman who died from an amniotic embolism, and one aborted fetus. Presence of viral sequences and antigens in the CNS is consistent with the recent isolation of H5N1 virus from cerebrospinal fl uid of a boy who died from encephalitis 6 with neurological symptoms commonly seen in patients with H5N1 infl uenza (Gao Zh, unpublished), including the two cases in this study.
cord-260231-vayxg23a	2007	Summary Aims We undertook this study to define the incidence of toxigenic Clostridium difficile in our hospital and to characterise the isolates. Detection of tcdA and tcdB genes was carried out for A2B+ strains by polymerase chain reaction (PCR).The minimum inhibitory concentrations (MICs) of metronidazole, vancomycin and clindamycin for all isolates were tested using the Etest. All unformed stool from SGH inpatients sent to the Department of Pathology from 1 October 2002 to 28 February 2003 was tested for the presence of TcdA and TcdB using the Premier Toxin A and B enzyme immunoassay (EIA) kit (Meridian Diagnostics, USA) following the manufacturer''s instructions. Combining the numbers of toxigenic strains and culture negative/direct toxin positive specimens, the incidence of CDAD was 3.2 cases per 1000 admissions or discharges and 53.8 cases per 100 000 patient days. Clindamycin resistant strains of Clostridium difficile isolated from cases of C.
cord-260250-t48y27wg	2004	A TaqMan(®) fluorogenic reverse transcriptase-polymerase chain reaction (RT-PCR) assay was developed for the detection and quantitation of canine coronavirus (CCoV) RNA in the faeces of naturally or experimentally infected dogs. The CCoV fluorogenic RT-PCR assay, which targeted the ORF5 (M gene), was more sensitive than a conventional RT-PCR assay targeting the same gene, showing a detection limit of 10 copies of CCoV standard RNA, and was linear from 10 to 10(8) copies, allowing quantitation of samples with a wide range of CCoV RNA loads. As shown in Table 2 , the detec-tion limit of the TaqMan RT-PCR was 1-2 log higher than that of conventional RT-PCR, ranging around 10 1 copies/l and 10 −1.50 TCID 50 /50 l for standard RNA and CCoV strain, respectively, with a detection rate of 100% for each positive dilution. The results of the conventional amplification and real-time analysis carried out on the faecal samples of the CCoV experimentally infected dog are summarized in Fig. 3 .
cord-260404-leifaqda	2006	In this retrospective study, we used polymerase chain reaction (PCR) assays to determine the prevalence rates of Mycoplasma haemofelis, ''Candidatus M haemominutum'', A phagocytophilum, Ehrlichia species, and Bartonella species DNA in the blood of cats with anemia and a control group of healthy cats. The purpose of this study was to determine whether there were differences in prevalence rates of M haemofelis, ''Candidatus M haemominutum'', A phagocytophilum, Ehrlichia species, and Bartonella species DNA in the blood of healthy cats and retrovirus-negative cats with anemia that did not have an apparent non-infectious (ie, blood loss, chronic disease) cause for their anemia. In this study, we reviewed the laboratory submission forms and medical records to attempt to eliminate cats with known causes of anemia including neoplasia, FeLV, FIV, suspected FIP, blood loss, chronic renal failure, bone marrow disease, other chronic diseases (eg, neoplasia), endocrinopathies, and previous cytologic evidence of hemoplasmosis to allow for selection of cases that were likely to have anemia from previously unrecognized infectious diseases or primary immune-mediated anemia.
cord-260431-eksl7pp8	2014	In the present study, we used molecular methods, virus isolation, TEM examination and an animal challenge experiment to diagnose the cause of death of the South China tiger, and for the first time, we confirmed the infection with FHV-1 in the captive tiger population in China. The phylogenetic tree based on the TK gene sequences showed that the isolate investigated in this study, was closely related to the ten isolates of FHV-1 ( Figure 2 ), a result consistent with the alignment analysis. By PCR/RT-PCR, the only virus detected in the trachea homogenates was FHV-1, which was confirmed afterwards by virus isolation, the TEM examination of cell cultures showing CPE, and a challenge experiment in cats. In this study, the authors described the first occurrence of feline herpesvirus type 1 (FHV-1) in a South China tiger in China.
cord-260457-m1jbpo5l	2007	We investigated the presence of human bocavirus by quantitative polymerase chain reaction of nasopharyngeal aspirate specimens and selected serum samples obtained from 259 children (median age, 1.6 years) who had been hospitalized for acute expiratory wheezing. Human bocavirus DNA was frequently detected in serum specimens obtained from patients with acute wheezing, suggesting systemic infection. Results suggest a model for bocavirus infection in which high viral loads are potentially associated with respiratory symptoms and low viral loads indicate asymptomatic shedding. Of the 293 children who were randomized, 259 children (median age, 1.6 years; range, 3 months to 15 years) who had sufficient sample material available for complete virus diagnostic evaluation (nasopharyngeal aspirate specimens were used for PCR [for 16 viruses], virus culture [for 9 viruses], and antigen detection [for 7 viruses]; acute-and convalescent-phase serum samples were used for serologic testing [for 7 viruses]) were included in the present study.
cord-260481-twk5kvd3	2020	More precisely, assuming knowledge about the overall incidence rate, we calculate explicit error bounds on the number of false positives which scale favourably with pool size and sample multiplicity. then in any multipooling strategy with pool size n and multiplicity k, the probability of a positive test being a false positive does not exceed fp . Table 1 : Probability of a positive result being a false positive and the compression k/n compared to individual testing for pool size n = 31, incidence ρ ≤ 0.01 and different multiplicities k. If we choose k = 4 and accept fp = 1.2% as the k fp k/n 3 0.17 0.049 4 0.012 0.066 5 0.0007 0.082 Table 2 : Probability of a positive result being a false positive and the compression k/n compared to individual testing for pool size n = 31, incidence ρ ≤ 0.01 and different multiplicities k.
cord-260647-7bjhobg7	2016	A nanofluidic real-time PCR system was used to develop novel high-throughput methods for qualitative molecular detection (RT-qPCR array) and quantification of human pathogenic viruses by digital RT-PCR (RT-dPCR). The aim of this study was to develop real time RT-PCR assays for detection of a total of 19 human enteric viruses (including 3 genogroupes of norovirus and 4 coronaviruses) and two control process viruses (mengovirus and murine norovirus) generally used for monitoring the recovery of viral foodstuff extraction methods. The sensitivity of conventional qPCR assays targeting 21 viral genomes was compared to the quantitative digital RT-PCR array and to the qualitative nanofluidic real-time PCR array performed on Fluidigm''s BioMark System. Similarly, by testing genomes from viruses in stools and RNA from virus production in cells, the limit of detection (LOD) as determined by RT-dPCR was respectively 1.5 to 3.4 log 10 and 1.6 to 2.1 log 10 lower than the expected copy numbers calculated via the standard curve by RT-qPCR.
cord-260690-h5pjv2dw	2004	A total of 333 additional respiratory specimens, including 20 from asymptomatic laboratory staff was used to validate the PCR assays for influenza A virus (H1 and H3 subtypes), influenza B virus, RSV, parainfluenza viruses (at least one of types 1-3), picornaviruses (a mixture of enteroviruses and rhinoviruses), and adenoviruses (each of different serotype) (Table III) . The process included the design and evaluation of primers; optimization of nucleic acid extraction conditions; establishment of optimum PCR amplification conditions; evaluation of applicable specimen types; determination of assay sensitivity compared to conventional assays; specificity testing using clinical material likely to be negative (including asymptomatic staff volunteers); or material previously shown to be positive for respiratory viruses by conventional assays or by sequencing of an amplified product where no other confirmatory method was available.
cord-260700-u12aa739	2010	title: Recurrent and persistent respiratory tract viral infections in patients with primary hypogammaglobulinemia OBJECTIVE: We conducted a prospective 12-month follow-up study of respiratory tract infections in 12 adult patients with primary hypogammaglobulinemia. METHODS: Nasal swab samples and induced sputum samples were taken at the onset of acute respiratory tract infection and every 3 months thereafter. CONCLUSIONS: Despite adequate immunoglobulin replacement therapy, patients with primary hypogammaglobulinemia have increased susceptibility to respiratory tract viral infections. Using modern diagnostic techniques, we wanted to study the occurrence of respiratory tract infections, especially viral infections, in patients with primary hypogammaglobulinemia who were receiving regular immunoglobulin replacement therapy. If the spouse of the patient had acute symptoms of respiratory tract infection, she or he took nasal swabs at home according to the instructions of the research nurse and sent the vials by post. First, despite adequate immunoglobulin replacement therapy, most patients with primary hypogammaglobulinemia had increased susceptibility to respiratory tract viral infections.
cord-260728-4w23kwzu	2016	Real-time reverse transcriptase (rRT) PCR for influenza was performed on combined nasal and throat specimens followed by viral culture, antigenic analysis, antiviral susceptibility testing and full genome sequencing for phylogenetic analysis. Between May 2010 and December 2012, we collected specimens and surveillance data for influenza and other viral respiratory pathogens from a subset of outpatients presenting with influenza-like-illness (ILI) at four sentinel sites-located in five health centers and hospitals in Battambang, Oddar Meanchey, Pailin and Banteay Meanchey provinces in Cambodia (Fig 1) . A subset of 164 culture-negative specimens (collected between May 2010 and April 2012), where we found a higher proportion (5.6%) of non-polio enteroviruses in children less than 5 years old as compared with previous studies (1%) in Cambodia [2] , were tested for enterovirus and rhinovirus by two separate nested RT-PCR methods adapted from Coiras et al., 2004 and Singh et al., 2002 [29,30] , one for simultaneous detection of pan-enteroviruses and rhinoviruses, and the other specific for enterovirus 71 (EV71).
cord-260791-2gmrsm8q	2020	
cord-260866-bzdd4f5h	2020	Paper-based devices would be certainly one of the best measurement solutions for the rapid and onsite detection of COVID-19 in sewage waters and humans as well [2, 16] and also the use of other biomarkers of exposure [1] . Detection of SARS-CoV-2 in sewage has been employed as a complementary method to clinical test .It is an early warning indicator of virus spreading in communities, covering both symptomatic and asymptomatic cases. Hopefully at certain moment applications to detect SARS-CoV-2 and other viruses in wastewater will be developed based on these LOC/POCT systems that will enable simple, fast and sensitive virus detection. PCR platforms like RT-qPCR are still the most widely used methods for SARS-Cov-2 detection in waste waters. Sewage sensors, such as paper-based and smartphones for SARS-CoV2 detection at the population level have as well a clear potential for early warning of COVID-19 pandemic.
cord-261089-aul4ifso	2016	The aim of this study is to develop a rapid, sensitive and specific duplex real-time RT-PCR assay for the simultaneous detection of TMEV and RTV, and provide a useful tool for the routine health monitoring of these two viruses in laboratory rodents and for the screening of contaminated biological materials. In addition, twenty cecum content and spleen samples collected from eight specific pathogen free (SPF) mouse strains (BALB/c, C57BL/6, DBA, FVB, 129, ICR, KM and NIH) and two rat strains (SD and Wistar) were used to evaluate specificity of the duplex real-time RT-PCR assay, these animals were reared under barrier colonies and were confirmed as serology negative for TMEV and RTV by a commercial ELISA kit (XpressBio, Maryland, USA). The specificity of the duplex real-time RT-PCR assay was determined by evaluation of RNA extracted from positive cultures of the following rodent viral pathogens: TMEV, RTV, MHV, Reo-3, RCV, Sendai, PVM, MNV and LCMV, and from twenty cecum content and spleen samples of ten SPF rodent strains.
cord-261128-j55v4clu	2013	
cord-261134-zarq507s	2004	PCR assays that can identify the presence of variola virus (VARV) sequences in an unknown DNA sample were developed using principles established for the amplification refractory mutation system (ARMS). When a variola virus specific primer was used with a consensus primer in an ARMS assay with different Orthopoxvirus genomes, a PCR product was only amplified from variola virus DNA. Incorporating a second consensus primer into the assay produced a multiplex PCR that provided Orthopoxvirus generic and variola-specific products with variola virus DNA. The variola virus specific primers did not produce amplicons with either assay format when tested with 50 other Orthopoxvirus DNA samples. These multiplex assays employ three primers; two consensus primers generate an amplicon diagnostic of an Old World Orthopoxvirus and the third primer simultaneously binds to a variola-specific polymorphism and initiates extension of a shorter PCR product to detect the presence of variola virus.
cord-261160-g92zhv19	2003	title: Lymphoid tissue tropism of porcine reproductive and respiratory syndrome virus replication during persistent infection of pigs originally exposed to virus in utero Even though PRRSV-specific antibody appears as early as 5 days post-infection and is followed by serum neutralizing activity and cell-mediated immunity Molitor, 1997, 1999; Rowland et al., 1999 Rowland et al., , 2001 persistently infected pigs can continue to shed virus. The purpose of this study was to further understand persistent infection in congenitally infected pigs by characterizing the course of clinical disease, sites of virus replication and the capacity to transmit virus in a group of pigs exposed to PRRSV in utero. Analysis of virus and antibody in blood and/or umbilical cords from the 28 live neonates showed that at least 20 or 74% were virus isolation (VI) or RT-PCR positive for PRRSV at the time of farrowing indicating that in utero infection was successful.
cord-261237-0hbijukt	2017	title: Development of a recombinase polymerase amplification combined with lateral-flow dipstick assay for detection of bovine ephemeral fever virus In this study, we described the development of lateral-flow dipstick isothermal recombinase polymerase amplification (LFD-RPA) assays for detection of BEFV. In this study, we aimed to develop the lateral flow dipsticks recombinase polymerase amplification (LFD-RPA) assays for rapid detection of BEFV. The results of those assays showed that a total of 83 clinical specimens were tested positive by conventional RT-PCR, while the similar performance that 96 specimens were detected positive by BEFV RPA nucleic acid amplification assays on LFD within 5 min, and 95 specimens were positive with the C t values below 35 using the real-time qPCR assay. As the applications of LFD-RPA, conventional RT-PCR and real time qPCR methods for detection BEFV genomes from clinical samples (Table 2) , the results clearly indicated the potential benefits of the developed assay over PCR-based methods.
cord-261279-6mef38eo	2020	RESULTS: Using RNA extracted from cells infected by SARS coronavirus as a positive control, these assays were shown to have a dynamic range of at least seven orders of magnitude (2x10(−4)-2000 TCID(50)/reaction). In this study, we report the development of RT-PCR assays to detect this novel virus in human clinical specimens. Two monoplex real-time RT-PCR assays targeting the ORF1b and N gene regions of 2019-nCoV were designed based on the first publicly available sequence in Genbank (Accession number: MN908947). Viral RNA from cells infected by SARS coronavirus or DNA plasmids containing the target sequences were positive in the assays as expected. In addition, the N gene RT-PCR assay was found to be more sensitive in detecting 2019-nCoV RNA in the studied clinical samples.
cord-261329-k1p7fo0e	2010	A rapid diagnostic method based on the melting curve SYBR Green I real-time PCR analysis was developed to detect and differentiate Newcastle disease virus (NDV) strains. The results obtained in this study demonstrate the possible applications for melting curve real-time PCR analysis in laboratory practice for the diagnosis and differentiation of avirulent and virulent strains of Newcastle disease virus. (2005) described a SYBR Green I real-time PCR melting curve analysis assay for differentiation, although the differences in the Tm values between the three genotypes were not very significant and could cause false characterization of the virus. Using the SYBR Green I real-time PCR melting peak analysis, it was possible to detect and differentiate virulent and avirulent strains of Newcastle disease virus. In this study, a method for the rapid detection and differentiation of Newcastle disease virus by SYBR Green I melting-curve analysis was described.
cord-261419-8dcqnifn	2009	
cord-261442-r4vgt0h3	2014	
cord-261735-03hvi4el	2011	A one-step real time quantitative RT-PCR (qRT-PCR) assay was developed to detect all published Dugbe virus (DUGV) genomes of the Nairovirus genus. Frequently detected in tick-borne virus surveys in Africa (Guilherme et al., 1996) , DUGV is a tri-segmented single-stranded negative RNA enveloped virus and is considered endemic in arid regions (Burt et al., 1996) . The aim of this study was to develop a sensitive, specific and rapid one-step quantitative real time RT-PCR assay (qRT-PCR) to detect DUGV in infected cell supernatants, ticks or serum samples. The specificity was evaluated by using RNA extracted from supernatants from CCHFV, Hazara virus, Coronavirus and Influenza A virus infected cells. Among the 498 captured ticks, one Dugbe virus RNA was detected in one tick using the qRT-PCR assay (0.2%). In conclusion, a sensitive and specific qRT-PCR assay was developed to detect and quantify DUGV RNAs in infected cell supernatants, extracts from ticks and potentially sera.
cord-261823-pgluidj8	2020	In this study, we have developed and evaluated a novel one-step single-tube nested quantitative real-time PCR (OSN-qRT-PCR) assay for the highly sensitive detection of SARS-CoV-2 targeting the ORF1ab and N genes. 7−10 In this study, we developed and evaluated an OSN-qRT-PCR assay for the highly sensitive detection of SARS-CoV-2, targeting the ORF1ab and N genes on the basis of a commercial qRT-PCR kit for SARS-CoV-2 (Sansure, Hunan, China). Compared to this qRT-PCR kit, the OSN-qRT-PCR assay revealed higher sensitivity and specificity, showing better suitability to clinical applications for the detection of SARS-CoV-2 in patients with low viral load. Compared to this qRT-PCR kit, the OSN-qRT-PCR assay revealed higher sensitivity and specificity, showing better suitability to clinical applications for the detection of SARS-CoV-2 in patients with low viral load. Collectively, the OSN-qRT-PCR assay has advantages of high sensitivity and easy applicability for the detection of SARS-CoV-2 in clinical samples.
cord-261867-6n0g3bz5	2011	Infection rates, based on serologic studies, are high enough to explain entry of CHV into multidog environments, either as an active infection or as the result of reactivation of latent virus in environments associated with natural, or pharmacologically induced immunosuppression. In fetal and neonatal dogs with primary CHV infection, severe intraocular lesions are frequently present concurrent with systemic viral disease. The results of this study showed that topical ocular prednisolone at the concentration and treatment regimen used did not result in detectable reactivation of CHV latency, based on a combination of recrudescent clinical signs, confocal microscopy findings, ocular infectious virus shedding, real-time PCR findings, and serologic response. Primary and recurrent CHV infection in mature dogs is associated with mucosal viral shedding that it detectable by PCR assay or virus isolation. Experimental recurrent ocular CHV infection induced by systemic corticosteroid administration to dogs recovered from primary ocular infection again resulted in viral shedding.
cord-262328-q7mt0xve	2020	
cord-262467-epqqd8n8	2020	The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is responsible for the COVID-19 disease as originally shown in Wuhan, China, as early as documented from 1 December 2019 (ref. A recent prospective study failed to find antiviral activity or clinical benefit of this combination for the treatment of our hospitalized patients with severe COVID-19 (ref. More recently, a randomized, controlled study conducted in Wuhan, China also failed to identify beneficial effect of LPV/r beyond standard therapy in hospitalized patients with severe Covid-19 (ref. Clinical trials also showed that in patients with severe H1N1 influenza A, in the 2009 pandemic, therapy with convalescent plasma from patients who recovered, especially within 5 days of symptom onset, resulted in a lower viral load and lower mortality 66, 67 . The duration from onset of symptoms to viral clearance is significantly longer in severe and critical ill SARS-CoV-2infected patients compared with that in the mild cases 48 .
cord-262485-sx2q5ol4	2020	The method employs real time quantitative reverse transcription polymerase chain reaction (RT-qPCR) of RNA extracted from nasopharyngeal (NP) swab samples, to measure amplification of a short segment of a viral gene in the course of a PCR reaction following reverse transcription of viral RNA. We developed and tested a RT-nPCR protocol comprising a multiplex primary RT-PCR for amplification of four SARS-CoV-2 amplicons and a control human RPP30 amplicon followed by a secondary nested PCR for individual amplicons 4 and visualization by agarose gel electrophoresis. Based on the experimentally measured false negative rate by RT-nPCR tests from this study we estimated that as many as 50% of positive samples may escape detection in single pass testing by RT-qPCR in an actual testing scenario. To detect the presence of SARS-CoV-2 in RNA isolated from NP swabs we performed a multiplex one-step RT-PCR on RNA from positive and negative samples using pooled primers for the four viral amplicons together with human RPP30 control.
cord-262592-0rdiosxd	2016	
cord-262599-19aj551d	2013	
cord-262730-1dxeg8ci	2020	
cord-262826-2usqmujy	2010	For this population, there has not been a comprehensive comparison of current modalities for detection of respiratory viruses (i.e., direct fluorescent antibody testing [DFA], culture, multiplex nucleic acid amplification, and rapid antigen assays), and test performance is likely to differ because adults are known to shed fewer virus particles than children during RTI (Hall et al., 1976) . Although many studies have examined the utility of the various methods used for diagnosis of respiratory virus infections, to our knowledge, none have systematically and concurrently examined the performance characteristics of DFA, culture, rapid antigen testing, and PCR on an older adult population (Barenfanger et al., 2000; Falsey et al., 1996 Falsey et al., , 1995 Lam et al., 2007; Templeton et al., 2004) . The data in this study indicate that multiplexed RT-PCR is highly sensitive in detecting respiratory viruses in older adults compared to DFA, culture, and rapid antigen testing.
cord-263118-6sf41rsj	2008	STUDY DESIGN: Binax NOW, cytospin-enhanced direct immunofluoroescence (DFA), and influenza A and B multiplex TaqMan RT-PCR were performed on 237 clinical samples. RESULTS: Binax NOW detected 70 (53.0%), cytospin-DFA detected 127 (96.2%), and TaqMan RT-PCR detected 132 (100%) influenza-positive samples. CONCLUSIONS: The accuracy of real-time RT-PCR should greatly improve the diagnosis of influenza in hospitals using simple rapid flu tests, but may have a more modest impact in hospitals with expertise in cytospin-DFA. In our hospital, cytospin-enhanced direct immunofluorescence (DFA) is performed on respiratory samples when Virology is open, and a rapid influenza test, Binax NOW, is used in the Core Laboratory when Virology is closed (Landry and Ferguson, 2000; Landry et al., 2004) . During the study period, reflex cultures were performed on 683 DFA-negative samples, but only three influenza A positives were detected.
cord-263134-0p4zy5t2	2014	This review describes the landscape of molecular isothermal diagnostic techniques for infectious diseases, their characteristics, current state of development, and available products, with a focus on new directions towards point-of-care applications. Advances in microfluidics and miniaturization of signal detectors have allowed the integration of molecular diagnostics into microscale lab-on-achip devices that perform all necessary PCR steps automatically, from sample intake to cell lysis, DNA extraction, purification and amplification. This review describes the state-ofthe-art and new directions in the development of isothermal amplification technologies for diagnosis of infectious diseases with particular focus on those susceptible to be integrated in inexpensive molecular POC tests. • Loop-mediated isothermal amplification, smart amplification process & signal mediated amplification of RNA technology, helicasedependent amplification, strand displacement amplification, recombinase polymerase amplification and nicking and extension amplification reaction are isothermal techniques with mid/high tolerance to inhibitory compounds that allow the use of raw samples without any pretreatment step, which may be an interesting feature for PCR-based point-of-care (POC) testing.
cord-263142-o8qbqxhx	2018	
cord-263279-afdmegq0	2020	Of the first assays that were available for validations were the CDC COVID-19 RT-PCR panel assay (IDT, Coralville, IA) as well as the RealStar® SARS-CoV-2 RT-PCR (Altona Diagnostics, Hamburg, Germany), and both were initially validated for clinical use at the Johns Hopkins Hospital Medical Microbiology laboratory. To compare the analytical performance of the three assays, positive and negative SARS-CoV-2 clinical specimens (using the RealStar® SARS-CoV-2 as the reference method as this assay was the first to be offered in house for clinical diagnosis) were tested by the CDC COVID-19 RT-PCR and/ or the ePlex® SARS-CoV-2 assays. Comparing the performance of the CDC COVID-19 RT-PCR to the RealStar® SARS-CoV-2 included testing 20 positive and 48 negative clinical NP specimens. In this study, we compared the analytical performance of three different molecular assays for the detection of SARS-CoV-2; the RealStar® SARS-CoV-2 RT-PCR, ePlex® SARS-CoV-2, and the CDC COVID-19 RT-PCR tests.
cord-263302-z5uhrta5	2000	Transfection of the reporter RNA into MHV-infected cells resulted in synthesis of a CAT-specific subgenomic mRNA detected by reverse transcription-polymerase chain reaction (RT-PCR). Further sequencing on cDNA clones derived from JHM2c mRNAs by reserve transcription-polymerase chain reaction (RT-PCR) has shown that the leader-body joining sites in subgenomic mRNA2-1 are more heterogeneous . When it was placed in front of the chloramphenicol acetyl-transferase (CAT) gene in the defective-interfering (DI) RNA-CAT reporter plasmid, the IG5-1, which is devoid of any known IRES sequence, can direct the synthesis of a subgenomic CAT-containing mRNA and expression of the CAT activity, thus confirming that the IG5-1 serves as a promoter for transcription of a subgenomic mRNA. To identify the minimal sequence required for subgenomic mRNA transcription, three deletions within the 140-nt sequence were made by PCR, and the deletion fragments were cloned into the DI RNA-CAT reporter vector in place of the wild-type, full-length (140-nt) se, and MHV-1 (F), respectively.
cord-263389-m6x9gxwe	2017	
cord-263417-jgu8kc5k	2017	We utilized one-step multiplex reverse transcription-PCR (RT-PCR) and Luminex xMAP technology to develop a respiratory multiplex liquid-chip assay (rMLA) for simultaneous detection of 6 common respiratory viruses, including influenza virus type A (FluA) and type B (FluB), para-influenza virus type 3 (PIV-3), respiratory syncytial virus (RSV), human metapneumovirus (MPV) and a threatening virus to China, Middle East Respiratory Syndrome coronavirus (MERS-CoV). In this study, one-step multiplex reverse transcription-PCR(RT-PCR) and Luminex xMAP technology were utilized to develop a respiratory multiplex LiquiChip assay (rMLA) for the detection of 6 common respiratory viruses in Jiaxing, including influenza virus type A (FluA) and B (FluB), parainfluenza virus type 3 (PIV-3), respiratory syncytial virus (RSV) and human metapneumovirus (MPV), as well as a potentially threatening virus, MERS-CoV [29] . The analytical sensitivities of the Luminex-based rMLA and multiplex real-time RT-PCR assay developed in this study were assessed by testing in duplicate 10-fold serial dilutions of positive standards ranging from 10 6 to 10 1 copies/μl of viral RNA transcripts for each target.
cord-263426-l32gyiky	2014	In clinically normal cats, prevalence rates of FCV and FHV were about 50.00%, but FIV and FeLV rates (42.00% and 65.00% respectively) were higher compared to other studies. Feline herpesvirus1 (FHV-1), a double-stranded DNA virus, member of the Varicellovirus, genus of the subfamily Alphaherpesvirinae combine with, feline calicivirus (FCV) that is a single-stranded positive-sense RNA virus, in the family Caliciviridae, genus Vesivirus are considered as the main agents involved in upper respiratory tract diseases (URTD) in cats. 1 However, it is important to determine the prevalence of FHV-1 and FCV and evaluation of their clinical signs, especially in relation with FIV and FeLV, to identify agents involved in URTD in Iran. For better understanding the role of FIV and FeLV viruses in induction of FCV and FHV infections, the prevalence rates of these infections were investigated in healthy and diseased cats. Association between clinical signs in cats with URTD and infection with FIV, FeLV, FCV, FHV-1.
cord-263538-0wozg085	2020	
cord-263567-6uacorpp	2009	Lors du dernier examen, après deux mois de traitement, la PCR sur sang est négative, et seule une légère protéinurie persiste. La période d''incubation peut être extrêmement variable avant l''apparition de la maladie (trois à 12 mois à quatre à 15 ans, selon les auteurs) [1, [5] [6] [7] [8] ; dans une étude portant sur 390 chiens en Espagne, deux pics d''âges sont notés : trois et sept ans, et plus. En effet, une étude montre qu''en dépit d''une thérapeutique combinée (antimoniate de méglumine et allopurinol pendant un mois) en relais longue durée avec de l''allopurinol, les chiens cliniquement améliorés restent PCR positifs dans les tissus (moelle ou noeuds lymphatiques) [26] [27] [28] . Ainsi, il peut être intéressant d''arrêter l''antimoniate de méglumine dès que les signes cliniques ont disparu et que la PCR sur sang est négative, afin de diminuer les effets secondaires (surtout hépatiques et rénaux), liés à l''utilisation de cette molécule [29] , et de réduire le coût du traitement.
cord-263570-6notzm6s	2007	The load and distribution of CPV-2 mRNA in samples from infected dogs were estimated in comparison with the load of virus DNA, as evaluated by real-time PCR. The analytic specificity of spliced CPV-2 mRNA detection by real-time RT-PCR was assessed by testing RNA and DNA preparations of other canine pathogens, including canine coronavirus types I and II (CCoVI, CCoVII) (Decaro et al., 2005d) , canine distemper virus (CDV) (Elia et al., 2006) , canine adenovirus (CAdV) (Decaro et al., 2006a) , reoviruses (Decaro et al., 2005b) and rotaviruses . To compare the amount of viral DNA in the tissue samples and in the infected cell cultures, a real-time PCR assay was used as described previously (Decaro et al., 2005c) . The newly developed real-time RT-PCR assay was applied to determine the viral mRNA loads in different tissues of CPV-2 naturally infected dogs. A real-time PCR assay for rapid detection and quantitation of canine parvovirus type 2 DNA in the feces of dogs
cord-263735-sos2ovng	2020	Furthermore, several studies reported that CT had high sensitivity for COVID-19 [7, 9, 10] , but a recent study including 121 cases found 56% of patients had a normal CT finding in the early stage of infection [11] . Furthermore, there are 10 studies reported the diagnostic sensitivity of the initial PCR assay [7, 10, 11, 18, 22, 29, 32, [34] [35] [36] , while 5 of them mentioned the rate of missed diagnosis after the second tests [10, 22, 29, 32, 35] . For these 25 studies, the diagnostic sensitivity and specificity of CT for COVID-19 ranged from 69% to 100% and from 0% to 96%, with pooled estimates of 93% (95% CI, 89-96%) and 44% (95% CI, 27-62%) (Figure 4 ), respectively. For the 10 studies with repeated PCR assay, the pooled sensitivity of the initial RT-PCR test in diagnosis of COVID-19 was 76% (95% CI: 59-89%; I 2 =96%).
cord-263763-a8wgvgz2	2020	Here, we present our approach to a 54-year-old male patient who had coronary artery bypass (CABG) surgery diagnosed as high probability coronavirus disease 2019 (COVID-19) in early postoperative period. We aimed to present our approach to high probability COVID-19 pneumonia which developed on early postoperative period in our patient after coronary artery bypass grafting (CABG) operation, which was not reported in the literature before. After consultations applied by chest physicians and infectious disease departments of our hospital, COVID-19 was evaluated as a high probability due to the laboratory tests, radiological findings, and clinical course. Having considered our patient as high risk, without waiting for the RT-PCR result, we started the specific treatment for COVID-19 immediately, by evaluating clinical, laboratory, and radiology findings. Correlation of chest CT and RT-PCR testing in coronavirus disease 2019 (COVID-19) in China: a report of 1024 cases
cord-263976-b9shffb3	2014	One sequence independent method, Virus Discovery based on cDNA Amplified Fragment Length Polymorphism (VIDISCA) is capable of identifying viruses that would have remained unidentified in standard diagnostics or cell cultures. Therefore, a simplified VIDISCA protocol was developed, which lacks the last amplification round, and evaluated using viruses that were cultured from stool samples of acute flaccid paralysis children, and which had remained unrecognized on both cell culture and enterovirus specific real-time PCR. On the other hand, genetic analysis in ORF2 gene (capsid protein) showed that PAK-NIH-VS908 shared 99.7% nucleotide and 100% amino acid similarities with HAstV type 3 isolate IDH2211 (AB54844), a finding which matches with the results from VIDISCA and we conclude that the astrovirus is a recombinant, with a recombination site between ORF1a and ORF2.
cord-264071-hg0qslyx	2019	Principal coordinate analysis revealed three different microbiota profiles: microbiota A, dominated by the genus Dolosigranulum (44.3%); Microbiota B, mostly represented by Streptococcus (36.9%) and Staphylococcus (21.3%) and a high diversity of anaerobic genera including Veillonella, Prevotella and Porphyromonas; and Microbiota C, mainly containing Haemophilus (52.1%) and Moraxella (31.4%). To test this hypothesis, the objective of the present study was to characterize the nasopharyngeal microbiota profiles in two groups of children: (i) children with invasive pneumococcal disease (IPD), considered as a case group whose nasopharyngeal microbiota was suffering an important disturbance; and (ii) a matched control group of healthy children representative of a healthy nasopharyngeal niche. Sequence files and metadata for all samples used in this study are stored in the MG-RAST server to be publicly available by accessing the project Invasive Pneumococcal Disease (IPD) in children is associated with a highly diverse nasopharyngeal microbiota: a case-control study, ID mgp80930.
cord-264107-6doie8pj	2020	
cord-264261-98h1bmb2	2020	It is recommended to use real-time RT-PCR for RNA viruses in order (i) to perform a rapid and accurate diagnostic, (ii) to guide patient care and management and (iii) to guide epidemiological strategies. IMPLICATIONS: Real-time RT-PCR remains the reference method for diagnosis of SARS-CoV-2 infection. On the other hand, notwithstanding its varying sensitivity according to the time of infection, serology represents a valid asset (i) to try to solve possible discrepancies between a highly suggestive clinical and radiological presentation and negative RT-PCR, (ii) to solve discrepancies between different PCR assays, and (iii) for epidemiological purposes. Improved molecular diagnosis of COVID-19 by the novel, highly sensitive 316 and specific COVID-19-RdRp/Hel real-time reverse transcription-polymerase chain 317 reaction assay validated in vitro and with clinical specimens Antibody responses to SARS-CoV-2 in patients of 373 novel coronavirus disease 2019 SARS-CoV-2 viral load in 413 upper respiratory specimens of infected patients
cord-264392-he1vekrt	2008	This study confirmed the classification of NarPV as a member of the subfamily Paramyxovirinae and established the close genome organization and sequence relationship between the two rodent paramyxoviruses isolated almost a decade apart and from two locations separated by more than 15,000 km. This was then followed by PCR to fill in the ''''gaps'''' using specific primers designed from NarPV Nariva virus genome 201 sequences obtained from the cDNA subtraction or degenerate primers designed using highly conserved consensus sequences of known paramyxoviruses in the subfamily Paramyxovirinae. Overall comparison of deduced sizes and amino acid sequences of all proteins indicated that NarPV is most closely related to MosPV (Table 1) genome is significantly larger (16,650 nt) than that of NarPV due to the longer untranslated regions (UTRs) located at the 3 0 end of most genes ( Fig. 1b and Table 1 ).
cord-264716-igl25jhg	2013	
cord-264880-0tmd9knh	2016	We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. To avoid thermal cycling, different isothermal amplification methods have been developed that rapidly amplify nucleic acids to detectable levels at a single temperature [42, 43] , such as loop-mediated amplification (LAMP) [44] , rolling circle amplification (RCA) [45] , helicasedependent amplification (HDA) [46] , nucleic acid sequence-based amplification (NASBA) [47] , recombinase polymerase amplification (RPA) [48] , transcription-mediated amplification (TMA) [49] , multiple displacement amplification (MDA) [50] , and strand-displacement amplification (SDA) [51] . Finally, we sealed the PWA chip in a homemade copper chamber filled with oil and successfully performed real-time dRPA on an isothermal incubation setup for the absolute quantification of serial dilutions of a Listeria monocytogenes gDNA stock solution.
cord-264944-7xj27r98	1993	The method was compared to existing extraction techniques by studying the quality of the templates for reverse-transcriptase polymerase chain reaction amplification (RT-PCR), using virus-infected and mock-infected paraffin-embedded cell pellets as a model. The method was compared to existing extraction techniques by studying the quality of the templates for rcvcrsetranscriptase polymerase chain reaction amplification (RT-PCR), using virusinfected and mock-infected paraffin-embedded cell pellets as a model. In the work reported here we used paraffin-embedded torovirus-infected cell pellets to compare the effect of different fixatives and RNA extraction methods on RT-PCR amplification of tissue extracts.
cord-265221-qtkwciym	2020	It is essential to understand the limitations of both antibody and real time polymerase chain reaction (RT-PCR) tests in interpreting SARS-CoV-2 data in relation to semen and testicular tissues analyses without appropriate controls. raising equal concerns for embryo and fetal development (Colaco et al., 2020) .In males, ACE2 receptor sites have been reported in testicular tissue which then have the capability to harbour SARS-CoV-2 virus and eventual shedding into the semen and hence its implication in sexual transmission, early pregnancy or early in utero embryonic development. Studies analysing SARS-CoV-2 in seminal fluid or testicular biopsies have so far lacked appropriate controls and patients suffered from predominantly mild infections and tested several weeks after the infection, thereby increasing the complexity of result interpretation. Also no SARS-CoV-2 was detected in expressed prostatic secretion (EPS) of 18 confirmed Covid-19 infected patients and 5 strongly suspected cases but absent semen analyses.
cord-265237-sxh2nqre	2009	
cord-265258-2rmtsyns	2017	The real-time RT-PCR assays seem to be effective tools for IBV-type identification and although S1 coding region is prone to mutations, methods aimed in this gene detection has been recently developed and used for GI-1 (Mass, Connecticut), GI-9 (Arkansas), GI-11 (SAI), G1-16 (ASAII) and GIV-1 (DE072/GA98) lineages (Acevedo et al. Here, we describe the development of a TaqMan probe-based real-time RT-PCR for the detection of GII-1 (D1466-like) IBV lineage. Moreover, the assay developed in the present study showed to be highly specific as no fluorescent signals were detected with other tested IBV lineages or chicken RNA viral pathogens. In conclusion, the TaqMan probe-based real-time RT-PCR assay described here is a time-saving, specific, sensitive and reliable method of detection of GII-1 lineage (D1466-like) of IBV which could successfully replace standard nested RT-PCR. Development and evaluation of a real-time Taqman RT-PCR assay for the detection of infectious bronchitis virus from infected chickens
cord-265268-5xu9hj2n	2016	title: Evaluation of Glass Wool Filters and Hollow-Fiber Ultrafiltration Concentration Methods for qPCR Detection of Human Adenoviruses and Polyomaviruses in River Water Here, we compared the recovery efficiencies of human adenoviruses (HAdVs) and human polyomaviruses (HPyVs) from 10-L river water samples seeded with raw human wastewater (100 and 10 mL) using hollow-fiber ultrafiltration (HFUF) and glass wool filter (GWF) methods. Little has been documented on the recovery efficiencies of HFUF and GWF methods for concentrating HAdVs and HPyVs markers from environmental water samples seeded with raw human wastewater. HFUF method recovered significantly higher concentration of HAdVs (P = 0.004; P = 0.003) and HPyVs (P = 0.01; P = 0.009) compared to GWF method for river water samples seeded with 100 and 10 mL of human wastewater, respectively.
cord-265634-7n4cvgs4	2002	
cord-265978-i0fu8e0p	2011	In this report, a real-time RT-PCR system using SYBR Green I and melt curve analysis was developed for detection and quantification of BCoV in clinical samples. The reaction conditions were first optimized by testing variable concentrations of BCoV and internal control QPCR primer sets; MgCl 2 concentrations; template volumes and primer annealing Following amplification, a melt curve analysis was performed to verify the specificity of the amplified products by their specific melting temperatures (Tm). In order to determine the optimal conditions for developing a robust SYBR Green I based real-time qPCR assay that detects BCoV and internal control RNA simultaneously, different variables of the reaction were assessed. The competence of the developed real-time RT-PCR assay, for accurate detection of BCoV in clinical samples, was evaluated by analysis of 103 swab samples (68 fecal and 35 nasal) in comparison to the gel-based RT-PCR assay ( Table 4 ).
cord-266025-bkm486jd	2012	
cord-266036-qhlo99l7	2020	OBJECTIVES: To assess the methodologies used in the estimation of diagnostic accuracy of SARS-CoV-2 real-time reverse transcription polymerase chain reaction (rRT-PCR) and other nucleic acid amplification tests (NAATs) and to evaluate the quality and reliability of the studies employing those methods. After its emergence in December 2019, the virus now known as SARS-CoV-2 was identified and sequenced in early January 2020, 1 allowing for the rapid development of diagnostic testing based on the detection of viral nucleic acid (i.e., real-time reverse transcription polymerase chain reaction [rRT-PCR]). Articles were included if they met the following criteria on screening: 1) Peer-reviewed publication, 2) Study evaluated diagnostic test accuracy of NAAT, 3) Diagnostic test performed on ≥10 patients, 4) Diagnostic/Clinical sensitivity, specificity, other correlative statistics, or test positive rate were either identified by name or were included in the publication as a numerical value and we could reproduce the calculations.
cord-266150-wox7pnkr	2020	Once these forms were signed, a copy was emailed to participants for their records and they were directed to a secure survey that i) asked basic demographic questions, ii) requested information on any previous RT-PCR test for SARS-CoV-2 and potential contact with any Covid-19 positive cases, and iii) asked about symptoms experienced since the outbreak (date and duration in days of each symptom). Among students, antibody positive children were younger, had a higher PCR positivity rate (in those who underwent PCR testing during the outbreak), and were more likely to self-report contact with one or more confirmed cases, as compared to seronegative children ( Table 2 ). Overall, PCR testing and contact history was significantly higher in staff compared to students, which in addition to the higher antibody positivity observed in this study, support the more significant role of adults within the outbreak, in proportion to the overall population.
cord-266156-xmf4emln	2020	Our goal was to examine the clinical sensitivity of two most common SARS‐CoV‐2 diagnostic test modalities, polymerase chain reaction (PCR) and serology, over the disease course to provide insight into their clinical interpretation in patients presenting to the hospital. The goal of this study is to examine the clinical sensitivity and provide insights into the interpretation of the two most common SARS-CoV-2 diagnostic test modalities: polymerase chain reaction (PCR) and serology. Serologic analysis of IgM, IgA and IgG status was performed in a subset of the above SARS-CoV-2 PCR-positive patients for which we had excess material in the MGH core laboratories for clinical validation studies. To assess the sensitivity of our serology assay over time, we tested for IgM, IgG, and IgA antibodies against the RBD of SARS-CoV-2 spike protein in 157 SARS-CoV-2 PCR-positive patients using an in-house ELISA (Table 1) .
cord-266175-4jyltfus	2020	
cord-266466-5sgfx7oq	2020	Here, we report the case of a 16-month-old female infant from Lebanon who presented with fever and severe diarrhea and tested positive for COVID-19. Her RT-PCR test was negative after five days of treatment, suggesting that children can clear the virus faster than adults. Most severe illness occurs in older adults but comparison with the pediatric population can be challenging as documented cases in infants and children have been scarce [3, 4] . On day 5, the RT-PCR test of the infant was negative, and the patient''s symptoms had resolved. Uniquely, our patient presented with fever and diarrhea; cough and other respiratory symptoms were not reported. Similarly, previous research in children indicates that the RT-PCR test becomes negative within 12 days (range: 6-22) after the presentation of symptoms [6] . This is the first case reported from the Middle East on an infant presenting with fever and diarrhea that tested positive for COVID-19.
cord-266499-g1lajsp8	2015	
cord-266523-qd5asgg8	2020	
cord-266670-jxgywvwx	2007	The standard method of detection of viral pathogens in environmental samples uses assays in mammalian cell culture. The standard method of detection of viral pathogens in environmental samples uses assays in mammalian cell culture. When realtime PCR quantitative results for adenoviruses in environmental samples were compared with conventional cell culture results, it was concluded that the real-time PCR method demonstrated higher quantities of adenoviruses in comparison with conventional techniques. Detection of astroviruses, enteroviruses, and adenovirus types 40 and 41 in surface waters collected and evaluated by the information collection rule and an integrated cell culture-nested PCR procedure Application of Real-Time PCR and Tissue Culture Assay for Adenovirus Detection in Two Southern California Urban Rivers Rapid and quantitative detection of human adenovirus DNA by real-time PCR Use of cell culture-PCR assay based on combination of A549 and BGMK cell lines and molecular identification as a tool to monitor infectious adenoviruses and enteroviruses in river water
cord-267671-ys43n672	2015	Clinical Signs MCMV causes subclinical infection in adult immunocompetent mice, but experimental inoculation of neonates can cause lethal disease due to multisystemic necrosis and inflammation. Diagnosis Because infected mice do not manifest signs or lesions and the virus is very difficult to propagate in cell culture, detection and diagnosis rely on serology and molecular methods. Differential Diagnosis Reovirus infection must be differentiated from other diarrheal diseases of infant mice, including those caused by mouse coronaviruses, EDIM virus, Salmonella spp., or Clostridium piliforme. Epizootiology EDIM virus appears to be infectious only for mice and occurs episodically in mouse colonies, and infection is probably widespread geographically (Livingston and Riley, 2003; Pritchett-Corning LABORATORY ANIMAL MEDICINE et al., 2009) . Sentinel mouse surveillance, using soiled bedding, is an effective strategy for detecting MNV (Manuel et al., 2008) Differential Diagnosis The mild change in fecal consistency associated with MNV in adult mice may mimic rotavirus, coronavirus, Helicobacter spp., Citrobacter rodentium, or other enteric diseases.
cord-267928-dflkggjt	2009	
cord-268094-ubz0q7e9	2018	title: Investigation into diseases in free-ranging ring-necked pheasants (Phasianus colchicus) in northwestern Germany during population decline with special reference to infectious pathogens In the present study, carcasses of 258 deceased free-ranging pheasants of different age groups, predominantly adult pheasants, collected over a period of 4 years in the states of Lower Saxony, North Rhine–Westphalia and Schleswig-Holstein, were examined pathomorphologically, parasitologically, virologically and bacteriologically, with a focus set on infectious pathogens. In China, antibodies against infectious bursal disease virus (IBDV) were detected in 14 out of 40 samples of free-ranging pheasants (Gu et al. The aim of the present study was to elucidate pathogens in free-ranging pheasants during the current population decline in Northwestern Germany using pathomorphological, virological, microbiological and parasitological investigations. Non-purulent mostly perivascularly accentuated inflammations with different cellular compositions and gradual variable infiltrations of lymphocytes, plasma cells and macrophages were detected in 68 birds (68.7% of affected pheasants) (Fig. 2) .
cord-268233-ibxufjrv	2020	
cord-268251-mcg1v24t	2014	
cord-268455-btuzihsy	2020	The aim of this study was to evaluate surgical treatment of gynecological cancer patients during the COVID-19 outbreak in our center. During this period, the hospital was divided into two separate areas, independent of each other, assisting COVID-19 cases and at the same time allocating resources to surgical care, follow-up, or ongoing treatments of patients with cancer. Our study showed that we were able to safely manage 126 gynecological cancer surgeries in the COVID free zone during the pandemic, avoiding delays or cancellations. The number of low complexity surgeries with short hospital stays included in the study may have influenced the risk of postoperative contagion, and the fact that the PCR test before surgery was not performed in half of the patients due to low availability could have reduced the diagnosis of the infection. This study, conducted in a partial COVID-19 free hospital, showed that with adequate preventive and protective measures, cancer surgery was possible and did not significantly compromise patients or healthcare workers.
cord-268468-036i1082	2020	In this review, the importance of biosensors including electrochemical, surface enhanced Raman scattering, field-effect transistor and surface plasmon resonance biosensors in the detection of SARS-CoV-2 has been underscored. In this outbreak, three different types of diagnosis tests are being used including (i) chest CT scan along with clinical indications, (ii) RNA detection using RT-PCR assay and (iii) lateral flow assays, full automatic chemiluminescence method, enzyme-linked immunosorbent assay (ELISA) for the determination of antibodies [5] . In this review, we have summarized the biosensor based technologies which are able to detect SARS-CoV-2 effectively. The peptide monolayer was successfully coated on SPR biosensor and further functionalized with virus nucleocapsid protein which was finally able to detect SARS-CoV-2 antibodies at nanomolar level. The sensing aptitude of the biosensor was evaluated employing antigen protein, self-cultured virus, and nasopharyngeal swab samples taken from people infected with COVID-19 pneumonia.
cord-268567-2xoubkxb	2020	In this study, we are evaluating the work up, management and outcome of 241 adults with encephalitis based on the majority of current guidelines recommendations in literature [11] [12] [13] [14] . As summarized in (Supplemental Digital Content Table 1 ), all guidelines of encephalitis management have major parts in evaluating and managing patients with encephalitis; exposure evaluation, appropriate utilization of diagnostic and neurodiagnostic studies, and proportion and timing of empirical antibiotic and antiviral therapy [11] [12] [13] [14] [15] . The Infectious Disease Society of America (IDSA), British, Australian, International consortium, and French guidelines recommend that clinicians evaluate for potential exposures and risk factors and to perform appropriate utilization of diagnostic studies in patients with suspected encephalitis. Also, most of the guidelines recommends to repeat CSF HSV PCR in 3-7 days in undiagnosed cases of encephalitis in which patients have clinical features or neuroimaging findings of HSV encephalitis [11] [12] [13] [14] .
cord-268721-n6dsc4ig	2020	. Summary of lab tests significantly different between COVID pos and propensity score-matched COVID neg cohorts during at least one clinical time window. Conversely, platelet counts were lower in the COVID pos cohort at the time of clinical presentation but tended to increase over the subsequent 10 days to levels significantly higher than those in COVID neg patients (Cohen''s D = 0.229, BH-adjusted Mann-Whitney p-value = 3.6e-3, Table 2, Figure 3B ). This approach offers the advantage of increased granularity at the cost of sample size per time point, but we did identify similar lab tests as altered in COVID pos patients using each approach including the fibrinogen decline and platelet increase in the COVID pos cohort after diagnosis ( Figure 4 ). Our study focusing on COVID-19 patients with longitudinal lab data suggests that COVID-19 is indeed associated with modulation of coagulation related parameters such as platelet counts, fibrinogen levels, and clotting time ( Figure 2) .
cord-268817-wx96wwpg	2020	Here, we present an ultrasensitive and high-throughput automated liquid biopsy assay based on the Hamilton Microlab ADAP STAR automated liquid-handling platform, which was developed and validated for the qualitative detection of total antibodies against spike protein 1 (S1) of SARS-CoV-2 that uses as little as 4 µL of serum. 6 In this study, we report the development and validation of a highly sensitive and specific SARS-CoV-2 total antibody assay on a Hamilton MicroLab STAR liquid-handling platform (Fig. 1) , based on the ADAP STAR assay-ready workstation. The successful implementation of the automated high-throughput ADAP SARS-CoV-2 total antibody assay solution as described herein can help meet the surge in demand for COVID-19 infection testing. To evaluate the assay''s sensitivity, 57 serum specimens from COVID-19 patients were subjected to the ADAP SARS-CoV-2 total antibody analysis.
cord-268977-hcg2rrhl	2012	METHODOLOGY/PRINCIPAL FINDINGS: From March 1, 2007, to February 28, 2010, among a surveillance population of 21,420 persons >5 years old in rural western Kenya, we collected blood for culture and malaria smears, nasopharyngeal and oropharyngeal swabs for quantitative real-time PCR for ten viruses and three atypical bacteria, and urine for pneumococcal antigen testing on outpatients and inpatients meeting a ARI case definition (cough or difficulty breathing or chest pain and temperature >38.0°C or oxygen saturation <90% or hospitalization). CONCLUSIONS/SIGNFICANCE: Vaccination against influenza and pneumococcus (by potential herd immunity from childhood vaccination or of HIV-infected adults) might prevent much of the substantial ARI incidence among persons >5 years old in similar rural African settings. Compared with other regions, the mortality rate among older children and adults remains several-fold higher in sub-Saharan Africa, where acute respiratory infections (ARI) are a leading cause of this high mortality, as well as associated morbidity [1] .
cord-269194-b1wlr3t7	2015	Complementing serologic testing by detecting infections within the pre-seroconversion window period and infections with immunovariant viruses, real-time PCR provides a highly valuable tool for screening, diagnosing, or monitoring diseases, as well as evaluating medical and therapeutic decision points that allows for more timely predictions of therapeutic failures than traditional methods and, lastly, assessing cure rates following targeted therapies. Beyond this, quantitative real-time PCR facilitates advancements in the quality of diagnostics by driving consensus management guidelines following standardisation to improve patient outcomes, pushing for disease eradication with assays offering progressively lower limits of detection, and rapidly meeting medical needs in cases of emerging epidemic crises involving new pathogens that may result in significant health threats. With the development and administration of newer drugs that target specific biological processes of HIV, routine and clinical monitoring of viral loads using a real-time quantitative PCR assay continues to be critical to predict treatment failure and early emergence of drug resistance mutations, within a timeframe that would increase subsequent treatment success.
cord-269407-6i66zf0e	2017	
cord-269627-mx1mjdqc	2009	
cord-269726-z0frgm7s	2020	Criteria for patients'' selection were diagnosis of SARS-CoV-2 infection [5] ; the subsequent meeting of criteria for hospital discharge (improvement of symptoms and two negative swabs collected at least 24 h apart) [4] ; and a positive respiratory sample collected after discharge. Following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) Statement protocol [8] , a systematic review has been performed concerning the patients with a diagnosis of COVID-19 that, after clinical and virological recovery, presented a new positive respiratory sample (swab, sputum, saliva, tracheal aspirate, or BAL). The patient was discharged in good clinical conditions with indication to repeat quarantine and swab tests that came negative for SARS-CoV-2 (Allplex™ 2019-nCoV Assay) on April 27 and 28 (Fig. 1b) .
cord-269839-jxqs51o5	2017	
cord-269948-zfbu9646	2011	
cord-270526-o4hsr4pm	2007	
cord-270579-rf933a0y	2006	title: Detection of respiratory pathogens by real-time PCR in children with clinical suspicion of pertussis The use of a multiplex respiratory real-time PCR in patients clinically suspected of pertussis increases the number of pathogens detected. Pathogens were detected by PCR in 31 out of 38 (82%) cases and 10 out of 21 (48%) cases in Group I and Group II, respectively. PCR can also give falsenegative results and fewer diagnoses in those patients with pertussis could be due to the quality of the sample. Other pathogens were detected in 31 out of 38 patients with clinical diagnosis of pertussis. Other pathogens that cause a pertussis-like disease have previously been described using serological assays and Cherry et al. pertussis and other pathogens causing pertussis-like symptoms and use of this form of diagnosis might help in treatment and improve management of patients. Evaluation of real-time PCR for detection of and discrimination between Bordetella pertussis, Bordetella parapertussis, and Bordetella holmesii for clinical diagnosis
cord-270929-utn21ce1	2006	Using consensus PCR assays for the genus Coronavirus, followed by additional genomic sequencing and phylogenetic analyses, we provide the first molecular evidence that the virus associated with ECE in ferrets is a new coronavirus, tentatively designated as "ferret enteric coronavirus" (FECV). Table 1 shows the sequence identities between the N protein of FECV-MSU1 and those of porcine transmissible gastroenteritis virus (TGEV), canine coronavirus (CCV), feline coronavirus (FCoV), porcine epidemic diarrhea virus (PEDV), human coronavirus (HCoV) 229E, bovine coronavirus (BCV), mouse hepatitis virus (MHV), HCoV OC43, SARS virus, avian infectious bronchitis virus (IBV), and turkey coronavirus (TCoV). As with the analysis of the N protein sequence, phylogenetic analyses based upon these three other regions of the genome gave similar results, further supporting the classification of FECV as a member of group 1 coronaviruses with highest similarities to CCV, FCoV, and TGEV and more distantly related to PEDV and HcoV 229E.
cord-270964-kxze0470	2004	On day 22 of illness, generalized tonic-clonic convulsion developed in a 32-year-old woman with severe acute respiratory syndrome (SARS). In our patient, the occurrence of generalized convulsion with a positive RT-PCR for SARS-CoV in the CSF suggests possible infection of the central nervous system by SARS-CoV. The findings from our patient are not compatible with multiple sclerosis, and the PCR result suggests that the central nervous system (CNS) is affected by SARS-CoV. The possibility also remains that infection of the CNS never occurred, as suggested by the lack of focal neurologic deficit, normal CSF pressure, cell count, and biochemistry. Besides involvement of the lungs and possibly the CNS, no good alternative explanation exists for acute renal failure in this patient. Renal failure could possibly be caused by SARS-CoV involving the kidneys. Additionally, our patient had diarrhea from day 3 to day 20, with positive RT-PCR for SARS-CoV in stool specimens, suggesting involvement of the gastrointestinal tract as well.
cord-271130-6s79q1c1	2017	title: Putative progressive and abortive feline leukemia virus infection outcomes in captive jaguarundis (Puma yagouaroundi) Thus, the aim of this study was to perform additional serological and molecular tests and monitor the population of jaguarundis at FPZSP for FeLV infection and development of FeLV-related diseases for 5 years (2003) (2004) (2005) (2006) (2007) . Two captive-born male jaguarundis, the geriatric #1 and the mature adult #4, presented serological and molecular FeLV test results similar to the progressive FeLV infection outcome in domestic cats [25] . Moreover, consistent with findings in domestic cats with a progressive FeLV infection, no antibodies to FeLV antigens were detected in jaguarundis #1 and #4. Two captive-born jaguarundis, #2 and #22, presented test results similar to those reported for domestic cats with abortive FeLV infection and seroconversion as the only marker of FeLV exposure [28] .
cord-271339-wt5o9sgm	2020	The real-time reverse transcriptase polymerase chain was one of the most quickly established methods in the novel viral pandemic and was considered as the gold standard for the detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To ensure the whole process of the COVID-19 diagnostic testing took place without a problem, we simultaneously added primers and a probe of human RNase P gene (RP gene) as an internal control in the same well with the RdRp gene assay according to the protocol from the U.S. CDC [6] (Figure 3 ). In the present report, we demonstrated our experience of relying on a protocol template from the Taiwan CDC to establish an optimized COVID-19 molecular diagnostic test within our routine services in a public health emergency.
cord-271341-fszljnax	2020	title: COVID-19 Carrier or Pneumonia: Positive Real-Time Reverse-Transcriptase Polymerase Chain Reaction but Negative or Positive Chest CT Results Dear Editor, We have read the articles published in the Korean Journal of Radiology with great interest concerning the real-time reverse-transcriptase polymerase chain reaction (rRT-PCR) amplification of the viral deoxyribonucleic acid (DNA) and chest computed tomography (CT) results for screening or detection of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection (1, 2) . Based on the aforementioned situation, patients with positive rRT-PCR but negative chest CT results should be classified as SARS-CoV-2 carriers. To the Editor, Thank you for your comments on our online article focusing on the false-negative results of real-time reversetranscriptase polymerase chain reaction (rRT-PCR) and the possible complementary approaches for screening coronavirus disease 2019 (COVID-19). With the rapid and extensive spread of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), patients with positive rRT-PCR but negative chest CT results emerged.
cord-271421-4dk7mkut	2017	
cord-271427-af71cum9	2020	
cord-271504-t3y1w9ef	2020	A confirmed case should have at least one of the following criteria: (i) a positive result for 2019-nCoV nucleic acid, using real-time PCR tests from respiratory or blood samples; (ii) a high homogeneity between viral gene sequencing from respiratory or blood samples and known 2019-nCoV; and (iii) serum samples positive for IgM or IgG to 2019-nCoV, or seroconversion in IgG, or a fourfold or more significant increase in IgG antibody titer to 2019-nCoV in the recovery phase than in the acute phase [25] . Using blood samples taken from alleged COVID-19 patients, the researchers detected antibodies targeting the spike protein that prevented the virus from killing cells in laboratory tests. showed a promising in vitro inhibitory effect of this serine protease inhibitor in SARS-CoV and 2019-nCoV on human lung cells, showing potential as a viable option for COVID-19 treatment [113] . Given that antiviral drugs have previously demonstrated reasonable inhibition of coronaviruses and therapeutic efficacy against coronavirus outbreaks, umifenovir, chloroquine, hydroxychloroquine, lopinavir-ritonavir, and ribavirin have been recommended in the latest guidelines for diagnosis and treatment of COVID-19, updated on 17 February 2020 [189] .
cord-271669-dkg6229j	2019	Because these conventional methods have low sensitivity for detecting rhinovirus and enterovirus, which are the most common causes of community-acquired respiratory viral infection (RVI), RVI was identified only in 6-22% of immune compromised children with respiratory symptoms in the past. 7, 10, 19, 23, [25] [26] [27] Even in rhinovirus infection, which causes milder respiratory illnesses compared to those of RSV, parainfluenza virus and influenza virus, mortality was significantly higher in patients with LRIs than that in those with URIs. 26 Therefore, the early detection of patients at risk of progression to LRIs and early application of proper management for LRIs are necessary to improve the outcome of RVI in immune compromised patients. Considering the confirmed RVI diagnosis in half of the immune compromised children and adolescents with respiratory symptoms in this study, the introduction of multiplex PCR tests for RV detection in this population should be encouraged, especially for patients complaining of rhinorrhea or sputum prominent over a cough.
cord-271915-nvilxnzl	2004	
cord-271919-pbs95hy0	2004	
cord-271920-1dzkgt6w	2020	3 As waves of COVID-19 patients present to ED''s in coming months with symptoms or potential exposures, understanding the diagnostic accuracy and reliability of history, physical exam, routine labs, advanced imaging, and an evolving array of COVID-19 diagnostics will be essential knowledge to inform the timing of testing, optimal specimen and test selection, shared decision-making, and ultimately derivation of clinical instruments to guide disposition, follow-up, and shared The search strategy used a combination of standardized terms and key words, including but not limited to (Covid-19 OR Novel Coronavirus OR SARS-COV-2) AND (diagnosis OR polymerase chain reaction OR serology OR CRISPR-CAS OR sensitivity/specificity) (Appendix). 40,42 It is known, however, that false negatives are frequent, so current recommendations advise incorporating patient''s exposure risk, clinical signs and symptoms, routine lab and imaging findings, serology, and (when available) CT results into real-time determination of COVID-19 status.
cord-272104-i79b79un	2020	
cord-272696-1jg46veg	2020	We collected nasopharyngeal swab and sputum samples from the boy 15 days after the last close contact and tested these specimens for SARS-CoV-2 by using RT-PCRs targeting the open reading frame lab (ORF1ab) and nucleoprotein gene regions (4) . The boy we report had close contact with confirmed COVID-19 case-patients on several occasions before he showed an equivocal RT-PCR result for respiratory specimens and subsequently positive results for stool specimens. We report an asymptomatic child who was positive for a coronavirus by reverse transcription PCR in a stool specimen 17 days after the last virus exposure. We report an asymptomatic child who was positive for a coronavirus by reverse transcription PCR in a stool specimen 17 days after the last virus exposure. Timeline for detection of novel coronavirus by RT-PCR in stool specimen from asymptomatic child, China
cord-272955-kkkrkgg1	2009	title: Molecular characterization of adenoviral infections in Cuba: report of an unusual association of species D adenoviruses with different clinical syndromes The objectives of this study were to identify and characterize members of different adenovirus species at the molecular level and to describe the correlation between viruses and clinical syndromes during a period of 4 years. Four isolates from clinical materials obtained from patients with encephalitis, acute flaccid paralysis and meningoencephalitis were identified as belonging to the species Human adenovirus D. In the present report, the nested PCR method used was able to detect different HAdVs in clinical samples and supernatant culture with a sensitive internal control system to assure the quality of reaction conditions in each individual tube. Human adenovirus DNA was detected in the supernatant of a cell culture infected with viruses obtained from fecal specimens taken from a patient with acute flaccid paralysis (AFP), as well as in two cases of meningoencephalitis.
cord-273179-bpnak9ov	2017	METHODS: We used real-time TaqMan-based PCR to detect MWPyV in the feces (n = 174) of children with diarrhea, nasopharyngeal aspirates (n = 887) from children with respiratory infections, and sera (n = 200) from healthy adults, and analyzed its clinical characteristics statistically. Therefore, in this study, we used realtime qPCR and DNA sequencing to investigate the presence of MWPyV in fecal samples from 174 children with diarrhea, nasopharyngeal aspirate (NPA) samples from 887 children with acute respiratory tract infections (ARIs), and sera from 200 healthy adults in China. In brief, the analysis of 1261 clinical samples only detected MWPyV in respiratory and fecal specimens from children, suggesting that the establishment of the primary infection occurs at an early age, and that the gastrointestinal and respiratory tracts are sites of viral persistence.
cord-273343-als886fe	2013	A cytopathic virus was isolated using Madin-Darby bovine kidney (MDBK) cells from lung tissue of alpaca that died of a severe respiratory infection. To identify the virus, the infected cell culture supernatant was enriched for virus particles and a generic, PCR-based method was used to amplify potential viral sequences. The new alpaca virus sequence was most similar to recently designated Enterovirus species F, previously bovine enterovirus (BEVs), viruses that are globally prevalent in cattle, although they appear not to cause significant disease. Analysis of the full polyprotein and the individual capsid, 2A protease, 3C protease, and polymerase proteins of the alpaca-infecting virus relative to sequences of other representative enteroviruses from bovine EV-E (BEV-A serotypes 1-4) and EV-F (BEV-B serotypes 1-4), and sequences from three unclassified EV-F viruses [16] , two from bovine sources (AY724744 and AY724745) [20] , and one from a capped langur (JX538037) [21] , possum, porcine (PEV), and human (HEV) hosts.
cord-273608-dxx3p1x5	2013	Total nucleic acids were extracted using the EZ1 system (Qiagen, Germany) and 17 respiratory viruses and genotypes including influenza A virus (FluA), FluB, parainfluenza virus 1 (PIV1), PIV2, PIV3, PIV4, respiratory syncytial virus (RSV), human metapneumovirus (hMPV), rhinoviruses (RhV), enteroviruses (EnV), human bocaviruses (hBoV), adenoviruses (AdV), four coronaviruses (229E, OC43, NL63 and HKU1), and FluA 2009 pandemic H1N1(H1N1-p) were detected and identified by the ResPlex II kit. In this study, we evaluated the ResPlex II V2.0 kit (Qiagen, Germany), which uses a target enriched multiplexing RT-PCR amplification coupled with a suspension array detection, for detection and identification of a panel of respiratory specimens in pediatric inpatients with LRTIs. Clinical accuracy of the ResPlex II assay was validated on a panel of prospectively collected consecutive nasopharyngeal swab (NPS) specimens in comparison to viral culture and a monoplex real-time TaqMan RT-PCR.
cord-273829-t5cuop5c	2020	Therefore, the COVID-19 pandemic control and filiation evaluation with the rRT-PCR test may produce false negative results. Patient with positive Covid-19 IgM Rapid Test performed on May 19, 2020, was subjected to the rRT-PCR test, repeated twice on the 19th of May which also resulted in positive. The nucleic acid test functions as the gold standard method for confirming the SARS-COV-2 infection; however, some recent studies have detected false negative results of real-time reverse transcriptase polymerase chain reaction (rRT-PCR) [4] . Similar to our case, there are case reports of reverse transcription-polymerase chain reaction (RT-PCR) test initially false negative and later positive in the literature [11] . Therefore, it can be argued that COVID-19 pandemic control and filiation evaluation with the rRT-PCR test may produce false negative results. A case report of COVID-19 with false negative RT-PCR test: necessity of chest CT
cord-273840-jjm7y07m	2006	The clinical presentation of these 6 patients was as follows: 3 were admitted to the hospital for acute enteric disease resulting in severe dehydration associated with upper respiratory symptoms; 1 had fever, otitis, and febrile seizure; 1 had a sample obtained to investigate failure to thrive; and 1 had a sample obtained for exploration of X-linked agammaglobulinemia and hyperleucocytosis. Our results suggest that HCoV-HKU1 could be associated with respiratory and enteric diseases, and its detection can be related to a persistent asymptomatic infection in patients with poor underlying conditions. For 2 patients with results positive for detection of HCoV-HKU1 in respiratory specimens, stool samples obtained at the same time were available and have been tested. To eliminate cell culture contamination, the N gene HCoV-HKU1 RT-PCR was performed directly on the respiratory specimens obtained from the 6 patients. Patient 6, who tested positive for HCoV-HKU1, had an influenza C virus detected in the same clinical specimen.
cord-273846-l0elcfe8	2005	title: Effects of cold storage on detection of avian infectious bronchitis virus in chicken carcasses and local antibodies in tracheal washes In order to test the survivability of infectious bronchitis virus (IBV) in dead chicken carcasses during 24 h of cold storage, 7 week-old specific-pathogen-free chickens were infected with virulent IBV Massachusetts strain M41, and were killed humanely 10 days later. Trachea, lung, kidney and rectum were collected for virus isolation by tracheal organ culture (TOC) or embryonated chicken eggs (ECE), and detection by nested reverse-transcriptase polymerase chain reaction (RT-PCR). Diagnosis of infectious bronchitis virus (IBV) is confirmed by isolation of the virus using either chicken embryonated eggs (ECE) or tracheal organ culture (TOC) and detection by reverse-transcriptase polymerase chain reaction (RT-PCR) (Cavanagh and Naqi, 2003; Gelb and Jackwood, 1998) . The use of chicken tracheal organ cultures for the isolation and assay of avian infectious bronchitis virus
cord-273859-tr4s5i7h	2020	En las formas clínicas menos graves, la detección de ARN viral es máxima durante las dos primeras semanas desde el inicio de los síntomas(4), y a partir de los 7-10 días se produce respuesta inmunológica de IgM y después de IgG (5) . El CDC propone como una pauta segura la determinación de 2 rRT-PCR negativas consecutivas para valorar la necesidad de aislamiento de los pacientes con COVID-19 (8). A estos pacientes se les hicieron 2 determinaciones de rRT-PCR de Coronavirus a partir de 21 días del inicio de síntomas, separadas por 24 h, para comprobar si persistía eliminación del virus. La detección del ARN viral mediante técnicas de rRT-PCR parece ser una forma adecuada de determinar la necesidad de aislamiento de los pacientes con SARS-CoV-2(8, 12). Seguimiento de negativización de rRT-PCR a coronavirus en 10 pacientes críticos con SARS-CoV-2 bajo ventilación mecánica. Seguimiento de negativización de rRT-PCR a coronavirus en 10 pacientes críticos con SARS-CoV-2 bajo ventilación mecánica.
cord-274127-12x5cc8i	2014	Paired specimens of nasopharyngeal swabs and sputum were obtained from 154 subjects, and RNA was extracted and tested for 16 different respiratory viruses using the Anyplex II RV16 Detection kit (Seegene, Seoul, Korea). The detection rates of respiratory viruses from sputum samples were significantly higher than those from nasopharyngeal swabs in adults using real‐time multiplex RT‐PCR. The aim of this study was to compare the detection rates of respiratory viruses in paired nasopharyngeal swabs and sputum samples from adult patients with respiratory symptoms using multiplex real-time RT-PCR. The present study found that the overall detection rate from sputum samples in adults was significantly higher than from nasopharyngeal swabs using multiplex real-time RT-PCR. In conclusion, the detection rates of respiratory viruses from sputum samples are significantly higher than those from nasopharyngeal swabs in adults using multiple real-time RT-PCR.
cord-274128-kgtr77e7	2020	Given the vast adaptability of microfluidics to any kind of single or multi-cellular assay [63] , the ability to combine it with various light microscopy techniques [64] , image processing [65] , optical or acoustic traps [53] , generation of chemical gradients [66] , and even cell culture [4, [67] [68] [69] [70] [71] [72] [73] [74] [75] [76] [77] [78] [79] [80] [81] [82] [83] , any cellular or subcellular target seems to be possible for future on-chip diagnostics. If the sample is in the continuous phase, we can separate the target cells either using deterministic lateral displacement (DLD), ratchets, dean-flow, di-electrophoresis, surface acoustic waves (SAW), optical and acoustic tweezers or by using optical density/refractive index.
cord-274184-hm516x6p	2020	From the abovementioned reasons we must deduce that: -in high SARS-CoV-2 incidence areas where PCR assays are not extensively performed, Covid-19 cannot be ruled out by simple clinical examination or epidemiological link; -the greatest amount of efforts and precautions are required to minimize the spread of the disease and to preserve medical staff from infection. In our current situation, which is characterized by high incidence of Covid-19 and relative scarcity of surveillance assays in asymptomatic subjects, for the abovementioned reasons we recommend different modalities of individual protection based on a strict clinical and epidemiological stratification of patients with potential SARS-CoV-2 infection undergoing endoscopic examination. In this setting, regardless of the classification of patients (high/low-risk, , in order to prevent the medical staff from becoming infected, we suggest high-performance personal protection equipment, i.e. a N95 or FFP2/FFP3 respirator, a hairnet, a double pair of gloves, a disposable waterproof surgical gown, a face shield (which we prefer because it allows to protect, and then spare, respirators) or goggles, and work safety clogs (Table 1) .
cord-274289-8g9tuyrc	2014	The study assessed the stability of nucleic acids stored on FTA cards at a temperature range representing the extremes of environmental heat (13 • to 46 • C) and cold specimen handling conditions (−7 • to −27 • C), and a timeframe from specimen collection to laboratory processing consistent with the expected extremes of diagnostic sample shipping (7-14 days). Bovine Coronavirus was the most prevalent virus detected by realtime PCR during this phase of the study, with 60% animals testing Table 2 Kappa values (95% CI) and percentage agreement for specimens collected into viral transport media compared to specimens collected onto FTA Cards. Bovine Respiratory Syncytial virus was detected using both the specimens in viral transport media and those on FTA Cards for 100% agreement; however the realtime PCR positive test result was for only one animal (Tables 1 and 2) .
cord-274438-tgslabi2	2017	title: Performance of the Alere i RSV assay for point-of-care detection of respiratory syncytial virus in children False negative Alere i RSV test results mostly occurred in samples with low viral load (mean CT value 31.1; CI(95) 29.6 – 32.6). Mann-Whitney-U-test was applied to compare C T values in samples with true positive versus false negative Alere i RSV result. In comparison to the RT-PCR reference standard, the Alere i RSV test result was true positive in 213 and true negative in 278 samples, respectively. The Alere i RSV performed well in the point-of-care setting, and sensitive test results were obtained across all pediatric age groups within 13 min. Evaluation of Alere i RSV for rapid detection of respiratory syncytial virus in children hospitalized with acute respiratory tract infection Host and viral factors affecting clinical performance of a rapid diagnostic test for respiratory Syncytial virus in hospitalized children
cord-274567-xd37wxxf	2002	title: Application of a Real-Time Polymerase Chain Reaction with Internal Positive Control for Detection and Quantification of Enterovirus in Cerebrospinal Fluid A quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) method based on TaqMan technology was developed to determine the presence and amount of enterovirus RNA. Amplification of the internal positive control was effective in all but two specimens, confirming the absence of PCR inhibitors and allowing the results of amplification to be validated. Detection of EVs by amplification of viral RNA from CSF using reverse transcriptase-polymerase chain reaction (RT-PCR) assay has already been reported [4, 5, 6 ]. The fluorogenic RT-PCR was applied to detection of EVs in the CSF of 104 patients presenting with signs of meningitis. Amplicor enterovirus polymerase chain reaction in patients with aseptic meningitis: a sensitive test limited by amplification inhibitors Comparison of use of cerebrospinal fluid, serum, and throat swab specimens in diagnosis of enteroviral acute neurological infection by a rapid RNA detection PCR assay
cord-274568-flqc3jjd	2020	Many studies have reported high sensitivities of CT scans and suggested that they can be used in the diagnosis of COVID-19 alongside reverse transcriptase PCR. In this report, we will discuss the clinical relevance of each test and the current Centers for Disease Control and Prevention and American College of Radiology recommendations regarding the use of imaging in the diagnosis of COVID-19. Sensitivity of CT scans • Many studies have reported high sensitivity of CT scans and suggested its valuable use in aiding the diagnosis of novel coronavirus disease 2019 (COVID-19) alongside reverse transcriptase PCR. • Centers for Disease Control & Prevention and the American College of Radiology recommend against the use of CT as well as CXR for diagnosis and that reverse transcriptase PCR is the reference test for diagnosing of COVID-19. Discusses the importance of background chest computed tomography (CT) being used for diagnosis of novel coronavirus disease 2019 (COVID-19) alongside reverse transcriptase PCR.
cord-274644-gr1eaj6k	2019	
cord-274656-dngumjns	2011	To investigate the relationship between NMO and viruses that have special affinity for the central nervous system, we performed a nested polymerase chain reaction (PCR) to detect mumps virus or enterovirus RNA in cerebrospinal fluid samples from 13 patients with MS, 8 with NMO and 20 with other neurological diseases (ONDs). The aim of this study was to investigate using nested polymerase chain reaction (PCR) the relationship between NMO and the two causative agents of polio-like disease, mumps virus [9] and enteroviruses, which have specific affinity for the central nervous system. PCR tests for detection of the mumps virus and the enterovirus genomes CSF samples were tested for the presence of the mumps virus and enterovirus genomes by a nested PCR method (PCR-FMU), as described elsewhere [13, 14] , blindly with respect to clinical information and the results of NMO-IgG or anti-aquaporin-4 antibody assays.
cord-274676-wtizb7hk	2016	Cryptosporidium prevalence was assessed by PCR and ELISA, and molecular characterization was performed by targeting the 18S rRNA, heat-shock protein 70 (hsp70), and glycoprotein 60 (gp60) genes. Previous studies using different methods found variable prevalence rates of Cryptosporidium in cattle: 49.4% (39/79) in Hungary using IFA (Plutzer and Karanis, 2007) , 11.9% (68/571) in the United States using PCR (Fayer et al., 2006) , 75.0% (60/80) in Japan using PCR (Karanis et al., 2010) , 20.0% (15/60) in New Zealand using IFA (Shrestha et al., 2014) , 5.1% (150/2945) in China using PCR (Zhang et al., 2015) , 21.5-22.5% in Ireland using direct fluorescence antibody testing (Mirhashemi et al., 2016) , and 10.2% (49/480) in Egypt using microscopy with staining (Ibrahim et al., 2016) . In addition, the PCR and ELISA results showed the same statistically significant differences with respect to the higher prevalence in the central region and lower prevalence in the case of hemorrhagic diarrhea. In addition, a higher prevalence at the farm level than the individual level was observed, regardless of the PCR or ELISA results, indicating a wide distribution of Cryptosporidium in calves in Korea.
cord-274707-mxh38hwd	2020	The virus is now widespread and causing the current pandemic of COVID-19, a highly pathogenic viral pneumonia, commonly presented with fever and cough, which frequently lead to lower respiratory tract disease with poor clinical outcomes associated with older age and underlying health conditions. Most rapid tests use colloidal gold particles in a technique known as immunochromatography, also called lateral flow immunoassay, a type of sandwich assay that relies on a pair of antibodies used to recognize two independent epitopes of a protein, and therefore it can achieve high specificity (Zhou et al., 2012) . One of the first rapid tests (lateral flow immunoassay) for SARS-CoV-2 IgG and IgM immune responses was developed by professor''s Feng Ye group at the National Clinical Research Centre for Respiratory Disease in Guangzhou, China. Development and Clinical Application of A Rapid IgM-IgG Combined Antibody Test for SARS-CoV-2 Infection Diagnosis
cord-274805-b3mqkfhh	2004	We analyzed 3′ end triplets of PCR primer sequences obtained from refereed journal articles, to test those recommendations and to make empirical recommendations for primer design. The frequencies of the 64 possible 3′end triplets among 2137 PCR primers from the VirOligo database were not uniformly distributed. The analysis results revealed preferred and disfavored 3 0 end triplets in successful primer sequences, and led to recommendations for primer design based on experience rather than theory. Since the primer sequence data set contained 134 BHV-1, 237 BVDV and 121 FMV primers, these viruses were used to test whether genome compositions determined the 3 0 end triplet frequencies. Low GCC contents in the 3 0 end triplets of PCR primers were not frequently reported in the VirOligo database. We suggest that primer design software incorporate scores based on empirical frequencies of 3 0 end triplets, such as those reported here, into the evaluation of oligonucleotides as primers.
cord-274828-67yeag50	2000	In this study we determine surface expression and transcript levels of CD13 within mononuclear cells originating from 40 AML patients with median blast percent of 90% and four healthy controls. Mononuclear cells of bone marrow aspirations from 40 AML patients and four healthy controls were analysed by competitive RT-PCR, and content of CD13 and GAPDH transcripts were determined. For the 32 AML patients and the four healthy controls having intermediate to high values of normalised CD13 transcripts levels there was a linear correlation between normalised CD13 transcript levels and cell surface expression of CD13 (r = 0.59, P B 0.001, n = 36). Such differences of up to 200-fold variation in normalised transcript levels were found only for AML patients having less than 15% surface expression of CD13 antigen. The diversity of normalised CD13 transcript levels found for patients with less than 15% CD13 antigen on the surface of their mononuclear cells was not caused by limitations of the competitive RT-PCR method.
cord-274892-a6fscyjf	2008	
cord-274954-06c3ymc3	2009	
cord-275232-0sg0hv9w	2006	
cord-275275-wy8d6cw3	2013	During the period April 2011 to April 2012, 689 stool samples from as many patients hospitalized at the Fondazione IRCCS Policlinico San Matteo of Pavia exhibiting gastrointestinal syndromes were examined for the presence of rotavirus, norovirus, astrovirus, adenovirus, rhinovirus, enterovirus, parechovirus, bocavirus, coronavirus, sapovirus, cosavirus, and aichi virus using polymerase chain reaction assays. Viral pathogens causing acute gastroenteritis include Rotavirus (RV), members of the Caliciviridae family such as Norovirus (NoV) and Sapovirus (SaV), Adenovirus (HAdV) and Astrovirus (HAstV) (Eckardt and Baumgart, 2011) . Overall, 689 stool samples stored in the period April 2011 to April 2012 from as many patients (356 pediatrics and 333 adults) with gastrointestinal syndromes hospitalized at the Fondazione IRCCS Policlinico San Matteo of Pavia (a teaching and university hospital with 50,000 admissions, 2,500,000 outpatients visits, and 94,000 emergency consultations per year) were systematically examined for the presence of gastroenteric viruses.
cord-275413-e2rhioty	2010	
cord-275519-98qxf6xo	2007	
cord-275787-5s442sy2	2016	title: Generation and Characterization of Eptesicus fuscus (Big brown bat) kidney cell lines immortalized using the Myotis polyomavirus large T-antigen Here we describe a method to establish and immortalize big brown bat (Eptesicus fuscus) kidney (Efk3) cells using the Myotis polyomavirus T-antigen. Cell clones expressed interferon beta in response to poly(I:C) stimulation and supported the replication of four different viruses, namely, vesicular stomatitis virus (VSV), porcine epidemic diarrhea coronavirus (PED-CoV), Middle-East respiratory syndrome coronavirus (MERS-CoV) and herpes simplex virus (HSV). The parental cell line and clones were capable of expressing IFN beta and supported the replication of viruses such as vesicular stomatitis virus (VSV; family Rhabdoviridae, genus Vesiculovirus), herpes simplex virus (HSV; family Herpesviridae, subfamily Alphaherpesvirinae, genus Herpesvirus), PED-CoV and MERS-CoV. Bat kidney cells were immortalized by using ViaFect (Promega, USA) to transfect cells with either 2.5 g of pcDNA3 (Invitrogen, USA) empty vector or plasmids expressing either SV40 large T-antigen (SV40Tag) or Myotis polyomavirus large T-antigen (MyPVTag).
cord-276271-3nz3169p	2009	
cord-276368-c9e93h0u	2010	
cord-276542-lxwls664	2020	
cord-276718-3lujp0oy	2014	
cord-276739-84vf5bts	2011	Using SHRT-PCR, 86 strains of influenza viruses isolated by the Tokyo Metropolitan Institute of Public Health were tested; the results showed 100% sensitivity and specificity for each influenza A and B virus, and swine-origin influenza virus. This method offers high sensitivity and selectivity, but generally requires approximately 2 h per run; therefore, qRT-PCR is not appropriate for rapid virus detection or subtyping in outbreaks of fast-spreading and/or highly pathogenic viruses at public health centers, hospitals, airports, and other public transportation hubs. The commercial reaction mixture was from the qRT-PCR kit, RNA-Direct TM SYBR ® Green Real-time PCR Master Mix (Toyobo, Osaka, Japan; http://www.toyobo.co.jp/e/). The SHRT-PCR system detects the highly conserved sequence of the corresponding viral genome, and the newly designed primer sets targeted for typing MP segments do not exhibit any cross reactions among other influenza viruses (Table 5 ).
cord-276978-xl4u7n6r	2007	
cord-277025-gmy51dx4	2020	
cord-277057-ww41t4k2	2012	title: Comparison of fast-track diagnostics respiratory pathogens multiplex real-time RT-PCR assay with in-house singleplex assays for comprehensive detection of human respiratory viruses() Individual FTDRP assays for adenovirus, respiratory syncytial virus and rhinovirus showed the lowest comparative sensitivities with in-house assays, with most discrepancies occurring with specimens containing low virus loads and failed to detect some rhinovirus strains, even when abundant. This study reports the results of a comparison of the FTDRP multiplex assay with a panel of validated in-house singleplex real-time RT-PCR assays developed at the Centers for Disease Control and Prevention (CDC). These included 26 laboratory reference virus strains and field isolates and 265 geographically (U.S., Central and South America and Africa) and compositionally diverse specimens [nasopharyngeal and oropharyngeal swabs (223), nasal washes and aspirates (21), sputum (1), lung autopsy tissue (1) and unidentified (19)] collected from children and adults with acute respiratory illnesses (ARIs) acquired between 2008 and 2011 and previously testing positive for respiratory viruses by the in-house singleplex assays.
cord-277125-s11obc7w	2020	This study employed an electrostatic air sampler to capture aerosolized test viruses (human coronavirus 229E (HCoV-229E), influenza A virus subtype H1N1 (A/H1N1), and influenza A virus subtype H3N2 (A/H3N2)) in a continuously flowing liquid (aerosol-to-hydrosol (ATH) enrichment) and a concanavalin A (ConA)-coated magnetic particles (CMPs)-installed fluidic channel for simultaneous hydrosol-to-hydrosol (HTH) enrichment. Even though a liquid sample obtained via the ATH collection of virus particles of very low concentration in air is "non-detectable" in real-time qRT-PCR analysis, we demonstrate that subsequent HTH enrichment can cause a "non-detectable" sample to become "detectable." Human coronavirus 229E (HCoV-229E), Influenza A virus subtype H1N1 (A/H1N1), and Influenza A virus subtype H3N2 (A/H3N2) J o u r n a l P r e -p r o o f 6 were used as test viruses.
cord-277265-p8pns7r9	2019	However, utilizing the principles of ELISA and PCR, several serological and molecular technologies have been developed to achieve higher sensitivity, rapid, and point-of-care (POC) detection such as lateral flow assays, biosensors, loop-mediated isothermal amplification, recombinase polymerase amplification, and molecular platforms for field-level detection of animal pathogens. Since then, biotechnological applications have been making significant contributions in the development of novel powerful diagnostic assays for the efficient diagnosis and control of animal infectious diseases. Presently, molecular detection-based methods such as polymerase chain reaction (PCR) or its variants, and serological methods such as enzyme-linked immunosorbent assay (ELISA), are being used worldwide for the accurate diagnosis of many animal diseases. Although, yet not been adopted for animal disease diagnosis, but novel platforms such as smartphonebased diagnosis (which expands nucleic acid-based detection assays toward POCD) like RT-LAMP and fluorescent lateral flow immunoassay (already developed for Zika virus and Dengue virus) provide exciting opportunities for veterinary diagnostics in the near future (Rong et al., 2019) .
cord-277276-j2qzhvzi	2014	
cord-277357-lpurk7pe	2020	title: Portable and accurate diagnostics for COVID-19: Combined use of the miniPCR thermocycler and a well-plate reader for SARS-CoV-2 virus detection Here, we demonstrate the use of the miniPCR, a commercial compact and portable PCR device recently available on the market, in combination with a commercial well-plate reader as a diagnostic system for detecting genetic material of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the causal agent of COVID-19. Combined use of the miniPCR thermocycler and a well-plate reader for SARS-CoV-2 virus detection containing the amplification products of each one of three experiments, where the three different sets of primers (namely N1, N2, and N3) were used to amplify the same range of concentrations of template. Combined use of the miniPCR thermocycler and a well-plate reader for SARS-CoV-2 virus detection others), we observe differences in the performance of each primer pair.
cord-277359-za2hh71g	2020	, and we would like to discuss a role of low-dose CT in discharge decision based on our recent experience regarding the positive conversion of COVID-19 after two consecutive negative RT-PCR results. In order to discharge patients from the hospital, most guidelines include no fever for more than 3 days, improvement of symptoms, and two consecutive negative real-time polymerase chain reaction (RT-PCR) test results [2] . The patient therefore met the criteria for hospital discharge (absence of fever or symptoms and two negative RT-PCR results) established by the Korea Centers for Disease J o u r n a l P r e -p r o o f Control and Prevention [5] ; however, follow-up LDCT prior to discharge revealed newly developed multifocal GGOs in the lower lobes, which led to cancelation of discharge. With continued treatment, the patient was discharged after two consecutive negative RT-PCR results and near complete resolution of her previous pneumonia without new lesions on LDCT (Figure 1) .
cord-277659-afysef1e	2020	Objectives: To assess the performance (sensitivity and specificity) of the Abbott Architect SARS-CoV-2 IgG antibody assay across three clinical settings. Methods: Antibody testing was performed on three clinical cohorts of COVID-19 disease: hospitalised patients with PCR confirmation, hospitalized patients with a clinical diagnosis but negative PCR, and symptomatic healthcare workers (HCWs). To assess the performance (sensitivity and specificity) of the Abbott Architect SARS-CoV-2 IgG antibody assay across three clinical settings. Antibody testing was performed on three clinical cohorts of COVID-19 disease: hospitalised patients with PCR confirmation, hospitalized patients with a clinical diagnosis but negative PCR, and symptomatic healthcare workers (HCW''s). In this paper, we report the kinetics and performance of this assay in three populations: confirmed (PCR +ve) and suspected COVID-19 patients, confirmed (PCR +ve) healthcare workers, and pre-pandemic controls with respiratory infection. The sensitivity of the Abbott SARS-CoV-2 IgG assay was estimated with 95% Confidence Intervals at different time points post symptom onset (DISCOVER patients) or first PCR positive result (healthcare workers).
cord-277804-ujabzic4	2016	title: Comparison between dot-immunoblotting assay and clinical sign determination method for quantifying avian infectious bronchitis virus vaccine by titration in embryonated eggs In this study, we used a dot-immunoblotting assay (DIA) to measure the titers of IBV vaccines that originated from different pathogenic strains or attenuation methods in embryonated eggs, and we compared this assay to the currently used method, clinical sign evaluation. The aim of this study was to evaluate and compare the sensitivity and specificity of the DIA to the clinical sign determination method for detecting IBV in inoculated embryonated eggs during titration of IBV vaccines. Propagation of the inoculated virus was determined using real-time RT-PCR, DIA, and the EE index method, and the 50% egg infectious dose (EID 50 ) of the five vaccines was calculated based on the method of Reed and Muench (1938) .
cord-277838-931sco95	2003	Sequence analysis of four positive samples showed the presence of a coronavirus with high similarity to both bovine and human coronavirus (strain OC43) in their polymerase and spike genes, whereas there was a low similarity to comparable genes in the enteric canine coronavirus. This investigation sought to detect coronaviruses associated with CIRD in a large kenneled dog population with a history of endemic respiratory disease, using virus culture and PCR techniques as well as serology on paired serum samples. Of the group of dogs which developed respiratory disease, 17 were positive for antibodies to CRCV on the day of entry into the kennel and 64 were negative. Furthermore, serological analysis revealed that dogs with antibodies to CRCV on the day of entry into the kennel developed respiratory disease less frequently than dogs RT-PCR results from tracheal and lung samples of 119 dogs with different respiratory signs (none to severe) using a nested PCR directed against the coronavirus spike gene.
cord-277909-rn1dow26	2006	In comparison to traditional gel-based PCR assays, real time PCR offers increased sensitivity and specificity in a rapid format (turn around time from sample receipt to result <5 h). Most of the published real time probe based PCR assays for viral diagnosis utilise either molecular beacons or dual labelled probes although more recent publications tend to favour the use of dual labelled probes. In real time PCR, the signal is detected early in the amplification process, and therefore the end-point variation seen in gel-based assays does not affect the result. Despite this we still perform an initial optimisation of both primer and probe concentrations to ensure we are running our real time PCR assays at their most sensitive and efficient. Some manufacturers are now producing real time reaction mixes specifically designed for use with multiplex assays, and provide guidelines on the optimal primer and probe concentrations to use.
cord-277988-dhzln0n3	2010	
cord-278176-o9glkhyv	2004	The SARS-CoV cDNA preparations derived from viral RNA extract and the cloned recombinant plasmid both exhibit the identical amplification characteristics, i.e. amplification efficacy using the same PCR formulation developed in this study. The 3′-NCR based SARS-CoV assay demonstrated 100% diagnostic specificity testing samples of patients with acute respiratory disease from a non-SARS epidemic region. It was demonstrated that the RT-PCR assay with 91% amplification efficiency could be used for consistent detect ion of the SARS-CoV viral RNA extracted from samples containing as little as 0.005 pfu per reaction with an anticipated C T value of 40 cycles (data not shown). It was demonstrated in this study that the cloned pHCV1 plasmid could be used to replace viral cDNA as a stable and rational SARS-CoV copy number standard for the SARS-CoV RT-PCR assay. Detection of SARS coronavirus in patients with severe acute respiratory syndrome by conventional and real-time quantitative reverse transcription-PCR assays
cord-278635-vwdxr1bl	2020	In the present study we compared the clinical outcome, mortality and transmission in chickens and turkeys infected with the same infectious doses of H7N7 low pathogenic avian influenza virus containing different levels of defective gene segments (95/95(DVG-high) and 95/95(DVG-low)). Virions containing highly deleted forms of genome segments (defective viral genes-DVGs) are able to replicate only in the presence and at the expense of fully infectious virus, hence the term "defective interfering particles" (DIPs) [4] . To evaluate the effect of DIPs on the course of infection with low pathogenic avian influenza virus (LPAIV), a comparison of pathogenicity of two virus stocks of H7N7 LPAIV with different levels of defective genomes was performed in turkeys and chickens. Infected birds received the same infectious dose of the virus but with different amount of DVGs. The semiquantitative analysis of defective particles was done by a combination of RT-PCR, real time RT-PCR and whole genome sequencing and indicated significantly higher amount of truncated gene segments in 95/95(DVG-high).
cord-278833-wlhmcdcn	2015	FINDINGS: The hot start effect was investigated in a one-step real-time RT-PCR assay for the detection of Middle East respiratory syndrome coronavirus (MERS-CoV). CONCLUSIONS: The study demonstrates the potential of aptamer-dependent hot start RT for the improvement of diagnostic real-time RT-PCR assays. In the present study, the aptamer was analyzed in a one-step real-time RT-PCR assay for the detection of Middle East respiratory syndrome coronavirus (MERS-CoV) to investigate the potential of a hot start RT for improved real-time RT-PCR performance. The one-step real-time RT-PCR was performed in a 25-μL reaction mix containing 10 μL of RNA template, 1x PCR reaction buffer (altona Diagnostics GmbH), 2.4 mM MgCl 2 (Sigma-Aldrich), 240 μg/μL BSA (Roche), 1 U of Platinum® Taq DNA Polymerase high fidelity (Invitrogen), 156 U of SuperScript® III Reverse Transcriptase (Invitrogen). The analytic sensitivity was determined by analyzing a half-logarithmic serial dilution Table 1 Hit rate of 25 μM aptamer and without aptamer in real-time RT-PCR MERS-CoV assay.
cord-279101-c763gzq2	2020	title: Identification and characterization of a novel L-type lectin (MjLTL2) from kuruma shrimp (Marsupenaeus japonicus) MjLTL2 was upregulated following challenge of shrimp with Vibrio anguillarum and white spot syndrome virus (WSSV). A novel L-type lectin is required for the multiplication of white spot syndrome virus (WSSV) in red swamp crayfish Procambarus clakii [12] . anguillarum-challenged shrimps were also analyzed, and results indicated that MjLTL2 expression is upregulated 24-48 h after WSSV injection in hemocytes and the hepatopancreas ( Fig. 4B and C) ; by comparison, MjLTL2 is upregulated 6-24 h after V. Shrimps were injected with WSSV after MjLTL2 silencing, followed by total RNA extraction from hemocytes at 36 and 48 hpi. Our results revealed lower VP19, VP24, VP26, and VP28 mRNA expression in the hemocytes of MjLTL2 knockdown shrimps than in the control. The results of this study revealed that expression of MjLTL2 was upregulated from 24 to 48 hpi in hemocytes and hepatopancreas after WSSV injection.
cord-279223-qvih5qas	2020	Another mother exhibited infection 6 weeks pre-delivery, confirmed by nasopharyngeal swab testing with positive RT-PCR, and positive antibody detection (IgM and IgG). Two additional mothers exhibited infection confirmed by positive RT-PCR testing at 28and 31-days pre-delivery but did not present detectable antibody reaction at the time of delivery. Thus, although the mother was considered cleared at 6 weeks after the onset of infection, which was confirmed by negative nasopharyngeal and stool SARS-CoV-2 RT-PCR tests after delivery, we tested stool and pharynx swab samples from asymptomatic baby-girl D. Two additional babies and their mothers were tested at birth because the mothers had symptomatic infection, documented with positive SARS-CoV-2 RT-PCR results, at 28 and 31 days before delivery, respectively. Despite the first newborn was asymptomatic and the screening performed as part of routine systematic testing, SARS-CoV-2 RNA detection through early nasopharyngeal sampling and the persistent detection of virus in stool strongly suggest possible vertical maternofetal infection.
cord-279229-2226jnfl	2005	In this paper, we review a novel method of DNA amplification known as loop-mediated isothermal amplification (LAMP) of a target nucleic acid. Screening for KHV has become very important as trade of fancy carp is an easy route for geographical spread of the virus and a rapid and efficient system like LAMP is very Figure 2 Loop-mediated isothermal amplification reaction amplifying the haemolysin gene from Edwardsiella tarda isolates. Rapid detection of a fish iridovirus using loop-mediated isothermal amplification (LAMP) Rapid diagnosis of Tetracapsuloides bryosalmonae, the causative agent of proliferative kidney disease (PKD) in salmonid fish by a novel DNA amplification method, loop-mediated isothermal amplification (LAMP) Rapid diagnosis of herpes simplex virus infection by a loop-mediated isothermal amplification method A loop mediated isothermal amplification (LAMP) method for detection of infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss) Rapid diagnosis of human herpesvirus 6 infection by a novel DNA amplification method, loop-mediated isothermal amplification
cord-279496-3be5tlnw	2018	
cord-279551-py2awuav	2015	title: Clinical and molecular investigation of a canine distemper outbreak and vector-borne infections in a group of rescue dogs imported from Hungary to Switzerland In the present study, we describe a distemper outbreak in 15 rescue dogs that were imported from Hungary to Switzerland by an animal welfare organisation. Canine distemper virus (CDV) is one of the most important viral pathogens in domestic dogs and causes high morbidity and mortality worldwide, particularly in unvaccinated dogs or dogs with incomplete vaccination [1] . The study provides data on vaccination, medical history, clinical examinations and diagnostic imaging of the dogs and CDV testing, testing for canine parvovirus (CPV) and vector-borne infections. The vaccine-specific real-time reverse transcription (RT)quantitative (q)PCR was negative for all ten dogs that were tested, which supports the finding of infection with a wild-type CDV strain.
cord-279563-4lu1n0s7	2020	
cord-279576-wt4crton	2020	Several methods based on real time reverse transcription polymerase chain reaction (RT-qPCR) for the detection of SARS-CoV-2 genomic RNA have been developed. The aim of the study was to set up an alternative molecular protocol to detect SARS-CoV-2 from clinical samples, without the need of TaqMan probes or post-PCR steps (i.e. gel electrophoresis), which can be implemented in case of difficulties to get specific reagents or kits because of the current pandemic situation. In order to select an appropriate amount of control vector to use in the comparison between the two real time qPCR methods, we prepared plasmids dilutions (107, 106, 105 and 104 copies/μL) and assayed them following both protocols: the probe-based One Step RT-qPCR developed by the University of Hong Kong Poon et al. The amplification data for the SYBR Green-based qPCR protocol showed that the ORF1b-nsp14 region was correctly amplified for all SARS-CoV-2 positive samples (1 to 7) (Fig. 3) .
cord-279577-iwqr2d0r	2008	title: Descriptive epidemiology of fatal respiratory outbreaks and detection of a human‐related metapneumovirus in wild chimpanzees (Pan troglodytes) at Mahale Mountains National Park, Western Tanzania Here, we provide the descriptive epidemiology on respiratory outbreaks that were observed in 2003, 2005 and 2006 in the M-Group at MMNP, and present our findings that the probable causative agent responsible for the fatal 2006 illness is a human-related paramyxovirus. Also, shown is 2006 plus presumed cases, where nine additional chimpanzees, although not observed with clinical signs, have not been seen since the time of the outbreak as follows: one on May 25 (day -8), six on June 5 (day 3), one on June 6 (day 4) and one on June 28 (day 26); they are presumed dead possibly in association with the respiratory illness [Hanamura et al., 2008] . Clinical signs of respiratory illness were observed in all age groups of the M-Group chimpanzees consistent with those reported in humans infected with hMPV.
cord-279644-g9cr9m96	2011	To determine the prevalence of MCPyV in 305 respiratory samples from immunocompetent and immunocompromised patients and evaluate their contribution to respiratory diseases, specimens were screened for MCPyV using single, multiplex, or real‐time PCR; co‐infection with other viruses was examined. The aim of this study was to determine the prevalence of MCPyV in respiratory specimens collected from immunocompetent and immunocompromised patients and evaluate the possible of contribution of the virus in respiratory disease alone, or in combination with other respiratory viruses. MCPyV DNA was found in 3.27% of nasopharyngeal aspirate samples obtained from patients with respiratory tract disease as determined by both PCR assays (LT and VP1). Although samples tested in this study were only collected during the autumn and winter months, there was no Sequence data from positive specimens showed that the MCPyV found in respiratory specimens was similar to the sequence of viruses identified within Merkel cell carcinomas by Feng et al.
cord-279980-49yv65gm	2010	The objective of the present study was to determine the potential for house flies (Musca domestica L.) (Diptera: Muscidae) to harbour the avian influenza (AI) H5N1 virus. Before initiation of all experiments the adult stage flies were randomly selected and confirmed to be free of the AI H5N1 virus by the real-time reverse transcription-polymerase chain reaction (RRT-PCR) assay using specific primers and probes to the influenza A matrix (M) gene. The BHI washing fluid (W1) was inoculated into six 10-day-old embryonated chicken eggs to evaluate the presence of the AI H5N1 virus on the external surface of the house flies. The W2 washing fluid was inoculated into six 10-dayold embryonated chicken eggs to confirm the absence of the AI H5N1 virus on the external surface of house flies. Avian influenza (AI) H5N1 virus titre between house fly homogenates and W1 of the AI H5N1 virus exposed house flies at different times of post-exposure in embryonated chicken eggs.
cord-280442-jtvez46y	2019	To evaluate this novel detection method, PCR assays (including conventional RT-PCR, qRT-PCR and nRT-PCR) and reverse-transcription LAMP (RT-LAMP) monitored by electrophoresis were also conducted and the specificity and sensitivity of the assays were compared with those of the mRT-LAMP-LFD assay. A total of 13 IBV strains, 7 NDV strains, and the PCR and LAMP target sequences of 6 NDV and 1 turkey coronavirus strains (TCoV) synthesized by Sangon Biotech (Shanghai, China) Co, as well as 6 other avian virus strains, were used for the determination of the specificities of RT-PCR and RT-LAMP assays. Statistical significance difference studies showed that the mean detection rates of mRT-LAMP-LFD were significantly higher than that of conventional RT-PCR assays when detecting IBV or NDV alone (P < 0.05). The mean IBV and NDV detection rates of different samples, detected by mRT-LAMP-LFD, were both 95%, and were significantly higher than those detected by conventional RT-PCR and qRT-PCR (P < 0.05, Figure 6B) .
cord-280846-bbv6f5gf	2010	To determine whether a pan-viral microarray assay was capable of identifying novel 2009 H1N1 in the absence of a priori sequence information, we used the Virochip to comprehensively screen for viruses in 29 nasopharyngeal swab samples from individuals with influenza-like illness. To further characterize the metagenomics of 2009 H1N1 infection in humans, we labeled the 17 influenza samples positive for 2009 H1N1 by Virochip with distinct molecular barcodes and analyzed them by paired-end deep sequencing on three lanes of an Illumina Genome Analyzer IIx. After trimming reads to remove barcodes and exclude low-complexity or primer sequences, 11,427,212 high-quality 60-bp sequence reads were subjected to an iterative BLASTN analysis pipeline (Fig. 1B) . After stratifying by originating location and corresponding method of sample processing (pre-DNase and/or post-DNase treatment), the percentage of total reads aligning to influenza was linearly correlated with calculated viral titers by realtime quantitative RT-PCR for sites in the United States (California) and Canada but not in Mexico (Fig. 5A ).
cord-280865-shwxhak9	2018	title: Clinical evaluation of a panel of multiplex quantitative real-time reverse transcription polymerase chain reaction assays for the detection of 16 respiratory viruses associated with community-acquired pneumonia We developed a panel of multiplex quantitative real-time reverse transcription polymerase chain reaction (mqRT-PCR) assay consisting of seven internally controlled qRT-PCR assays to detect 16 different respiratory viruses. Given that the laboratories from all of the provincial and most municipal CDC laboratories in China have access to conventional real-time PCR instrumentation, in this study, we aimed to develop a multiplex quantitative real-time RT-PCR (mqRT-PCR) consisting of a panel of seven internally controlled qRT-PCR assays to detect 16 different respiratory viruses: human coronavirus (CoV) 229E, CoV NL63, CoV OC43, CoVHKU1, parainfluenza virus (PIV)1, PIV2, PIV3, PIV4, influenza virus (IV) types A and B, human respiratory syncytial virus (RSV) types A and B, human rhinovirus (HRV), human metapneumovirus (HMPV), human adenovirus (ADV), and human bocavirus (HBoV).
cord-281162-2pu7x5rj	2019	The aim of this study was to use conventional and molecular detection methods to assess the epidemiology of respiratory viral infections in children less than five years of age that were hospitalized with ALRTIs. Methods: The cross-sectional study was designed to investigate the occurrence of respiratory viruses including respiratory syncytisl virus (RSV), human metapneumovirus (HMPV), influenza virus A and B (IFV-A and B), parainfluenzavirus 1, 2, 3 and 4 (PIV 1, 2, 3 and 4), human rhinoviruses (HRV), human enterovirus (HEV), human coronaviruses (HCoV) 229E and OC43, human bocavirus (HBoV) and human adenovirus (HAdV) in hospitalized children with ALRTIs, at Hospital Serdang, Malaysia, from June 16 to December 21, 2009.
cord-281174-3c1vue0y	2003	
cord-281529-2rec51xg	2013	We tested for the presence of MERS-CoV in dromedary camels from a farm in Qatar linked to two human cases of the infection in October, 2013. 13 Both MERS-CoV spike protein binding antibodies and virus neutralising antibodies were reported in dromedary camels from diff erent regions, including Oman and Egypt, but no virus shedding could be detected and, therefore, the signifi cance of these observations remained an issue of debate. The camel MERS-CoV clustered with viral sequences obtained from the two human cases related to the farm and with a sequence from Hafr-Al-Batin as the next closest relative (fi gure 1). However, virological testing was unable to detect MERS-CoV viral sequences in camels, probably because only faecal and serum samples were analysed. Our report describes the fi rst detection of MERS-CoV in dromedary camels on a farm in Qatar that had been linked to human cases of the disease.
cord-281653-zogtpm7a	2011	A multiplex real-time PCR assay for the detection of Mycoplasma pneumoniae (MP181), Chlamydia (Chlamydophila) pneumoniae (CP-Arg), Legionella spp. This procedure may allow for a practical and efficient means to test respiratory clinical specimens for atypical pneumonia agents in health care settings and facilitate an appropriate public health response to outbreaks. Specific real-time PCR assays have been developed to provide a more rapid and reliable method for detecting respiratory pathogens in clinical specimens (Apfalter et al., 2003; Hayden et al., 2001; Mitchell et al., 2009; Winchell et al., 2008) . The current study reports the development and evaluation of a multiplex real-time PCR assay for simultaneous detection of 3 atypical bacterial pneumonia-causing organisms in clinical specimens. The sensitivity observed when testing clinical specimens with the multiplex assay was found to be significantly greater in 2 agent-specific assays (CP-Arg and Pan-Leg) and the RNase P. Development of a multiplex real-time quantitative PCR assay to detect Chlamydia pneumoniae, Legionella pneumophila and Mycoplasma pneumoniae in respiratory tract secretions
cord-281844-c0uhcatg	2014	Abstract Objective To review the available literature on the association between acute viral respiratory tract infection and the onset of asthma exacerbations, identifying the most prevalent viruses, detection methods, as well as preventive and therapeutic aspects. Studies using reverse transcriptase polymerase chain reaction (RT-PCR) as the detection technique, isolated or combined with traditional methods, observed positivity for respiratory viruses in up to 92.2% of episodes of acute asthma exacerbation in children. Several authors have performed studies aiming to detect viruses in respiratory secretions of exacerbated asthma patients, showing a prevalence of viral identification that varies with several factors, such as patient age, time of the year, method of sample collection, and method of viral detection. The use of viral detection techniques with high sensitivity and specificity has increased the identification of some respiratory viruses in children with asthma exacerbation.
cord-281871-3j64de2i	2020	In patients with lymphocytic myocarditis and heart failure (HF) with severe left ventricular dysfunction or lifethreatening ventricular arrhythmias who do not respond to conventional treatments in the short term (i.e. 7-10 days), EMB may guide more advanced medical therapy, including immunosuppression and immunomodulation 1 state, "Immunosuppression should be started only after ruling out active infection on EMB by PCR," and, "Immunosuppression may be considered, on an individual basis, in infection-negative lymphocytic myocarditis refractory to standard therapy in patients with no contraindications to Accepted Article immunosuppression." 4 Accordingly, the latest version of the Cochrane bank analysis 5 reports, "Corticosteroids may have a role in treating myocarditis without viral evidence." The same recommendations have been reaffirmed in recent reviews 1, 6, 7 , where different international experts highlight the need for ruling out viral presence in EMB via PCR analysis before starting immunosuppression or immunomodulation in clinically suspected acute myocarditis patients presenting life-threatening scenarios.
cord-281887-b511bjdy	2020	DISCUSSION: The rational use of resources to reduce the risk of surgical cancer patients being operated on during the incubation period of a corona virus infection is important in this context. CONCLUSIONS: We present a protocol, focused on the patients'' outcomes, for safe and rational use of resources to reduce the risk of surgical cancer patients being operated on during the virus incubation period, in the context of areas with limited resources. Our objective was to present the Brazilian Society of Surgical Oncology (BSSO) protocol for rational use of resources and for reducing the risk of surgical cancer patients being operated on during the coronavirus incubation period, in the context of areas with limited resources, and focused on patient outcomes. In light of all the previous considerations, Table 3 presents our suggested protocol for the rational use of resources to reduce the risk of surgical cancer patients from being operated on during the COVID-19 incubation period, in the context of areas with limited resources.
cord-282155-6jp9yx47	2018	
cord-282278-q7jp224a	2015	
cord-282321-svoshzz8	2016	The RT-SIBA method includes a reverse transcriptase enzyme that allows one-step reverse transcription of RNA to complementary DNA (cDNA) and simultaneous amplification and detection of the cDNA by SIBA under isothermal reaction conditions. The RT-SIBA method includes a reverse transcriptase enzyme that allows a one-step reverse transcription of RNA to cDNA and simultaneous amplification and detection of the cDNA with SIBA under isothermal reaction conditions. The use of an Influenza A assay IO with no seeding region resulted in reactions with the longest detection time, suggesting that the seeding region is of vital importance for efficient amplification of the target DNA. The recombinasemediated target duplex separation and polymerase-mediated extension are the basis for exponential amplification conclusion, IOs for both influenza A and B assays used in the following experiments were designed to contain seeding regions consisting of a polyC sequence of 10 and 14 nucleotides in length, respectively.
cord-282449-7mxp3sdy	2020	
cord-282968-kjvvoveq	2019	
cord-283309-ovx5fzsg	2019	Six subgenomic mRNAs containing the leader-body junction sites, including a bicistronic mRNA encoding the accessory NS7a and NS7b genes, were experimentally identified in SeACoV-infected cells. Anti-Ac (Nsp3) staining also resulted in detection of perinuclear foci at four time points, indicating localization to the viral replication-transcription complexes (Fig. 1C) , which was similar to the pattern of Nsp3 antibody observed in SARS-CoV-infected Vero cells (Prentice et al., 2004) . DMVs are membrane structures where viral genomic RNA is recognized by the host cell machinery and translated into non-structural proteins (ORF1ab), assembling into viral replication-transcription complexes (Gosert et al., 2002) , whereas LVCVs are large circular organelles that are thought to originate from Golgi compartments expanding to accommodate numerous precursor virions Positions of forward (LF) and reverse primers (S1-R, sgORF3-R, sgE-R, sgM-R, sgN-R and NS7a-R/NS7-R) used for PCR amplification of distinct subgenomic mRNAs (sgRNAs) are indicated by arrows under the genome.
cord-283409-ynwgdz52	2020	INTERVENTIONS: We assessed daily symptom screening with polymerase chain reaction (PCR) testing of screen-positives, universal PCR testing every 2 weeks, hospital-based COVID-19 care, alternate care sites [ACSs] for mild/moderate COVID-19, and temporary housing, each compared to no intervention. CONCLUSIONS & RELEVANCE: In this modeling study of simulated adults living in homeless shelters, daily symptom screening and ACSs were associated with fewer COVID-19 infections and decreased costs compared with no intervention. In addition, we provide details on the Clinical and Economic Analysis of COVID-19 interventions (CEACOV) model and management strategies for people experiencing sheltered homelessness. The effective magnitude of the transmission rate, however, changes over time as social interventions alter the daily average number of contacts between susceptible and infected individuals as well as the infectivity per contact. PCR-positive individuals with mild/moderate illness remain in temporary housing and are transferred to the hospital if they progress to severe or critical disease
cord-283641-2u16otbf	2015	
cord-283786-d65njv7b	2020	
cord-284037-nj5jo1ev	2020	
cord-284262-lddmo1sv	2013	We identified a canine circovirus in the liver of a dog that had necrotizing vasculitis and granulomatous lymphadenitis, both of which are described in PCV2-infected pigs (4) . A fourth sample cohort consisted of tissue samples from 21 necropsy cases of dogs whose clinical signs or microscopic lesions matched the sentinel animal (i.e., hemorrhagic diarrhea, vasculitis, and/or granulomatous disease); these samples were selected from the tissue archives of Anatomic Pathology at the UC Davis Veterinary Medical Teaching Hospital. To establish tissue distribution and investigate whether DogCV contributes to canine disease, we developed and validated an ISH oligomeric probe and examined the sentinel dog and dogs from 21 suspected, retrospective cases that included >2 of these 3 signs: vasculitis, hemorrhage, or granulomatous disease. We characterized the genome of multiple DogCV strains, determined DogCV prevalence in dog fecal and plasma samples and tissue distribution in infected animals, and detected paracrystalline arrays in inclusion bodies in macrophages.
cord-284275-bqo203pf	2012	
cord-284313-rg3krh7d	2007	Abstract Background:This study examined the contribution of airway inflammation to the delayed lung function recovery that occurs in some people following virus-induced asthma exacerbations. In contrast, during exacerbation, subjects with persistent airway obstruction showed no differences in inflammatory cell counts compared to stable subjects with asthma, nor did cell counts change postexacerbation. Table 3 indicates that during the exacerbation the CCQ was elevated in both the airwayrecovery and the persistent-airway-obstruction groups; then, at 4 to 6 weeks postexacerbation, a similar improvement in virus symptoms was seen in both groups (percentage change in CCQ) [Fig 1] . The poor lung function (percent predicted FEV 1 ) observed during the acute episode significantly improved in the airway-recovery group, with values returning to levels of stable asthma patients postexacerbation. 11 Conversely, patients in the persistent-airway-obstruction group showed a lower airway inflammatory profile during exacerbations similar to those with stable asthma (Fig 2) , and this did not change significantly postexacerbation (Table 4 ).
cord-284366-snajbvr9	2020	[3] [4] [5] The diagnosis of COVID-19 considers clinical symptoms, GGO lesions in chest CT or Xray images, and positive RT-PCR test results for the presence of SARS-CoV-2 RNA in patient samples. For example, the guidelines of the National Health Commission of China state that patients must meet the following 4 benchmarks before they can be discharged: (i) be afebrile for at least 3 consecutive days, (ii) have significantly improved respiratory function, (iii) produce two negative SARS-CoV-2 RT-PCR test results at least 24 hours apart, and (iv) have significant improvement in lung GGO lesions determined by chest CT or X-ray imaging. In Table 1 , we summarize the information about patients who tested positive for SARS-CoV-2 RNA in post-discharge, follow-up examinations in China as described in the 12 published reports. Our analysis indicates that many of the discharged patients tested positive for SARS-CoV-2 RNA when feces or anal swabs were employed, even though they tested negative at the same time when nasopharyngeal or oropharyngeal or sputum samples were examined.
cord-284367-cy61pjcb	2013	In this study, we describe the detection of novel paramyxoviruses from the Eidolon helvum species of fruit bats. Semi-nested RT-PCR detected a total of 25 (8%) positive samples for paramyxoviruses which were then directly sequenced and analyzed using phylogenetic analysis. Our study identified novel Henipavirus-related and unrelated viruses using RT-PCR in fruit bats from Kansaka National Park and indicated the presence of similar Bat paramyxoviruses originating from wide geographic areas, suggesting the ability of bats to harbor and transmit viruses. This has been as a result of the high detection rate of previously unknown viral sequences in bats coupled with the emergence of pathogens, such as Hendra, Nipah, Severe acute respiratory syndrome (SARS)-Corona, Ebola and Marburg viruses, all of which are highly virulent and pose a great zoonotic risk [2, 3, 8, 9, 17] . The samples from Zambia formed clusters with the Henipavirus-related viruses and with the unclassified Bat paramyxoviruses (Fig. 1) .
cord-284372-v95fzp8n	2004	title: A touchdown nucleic acid amplification protocol as an alternative to culture backup for immunofluorescence in the routine diagnosis of acute viral respiratory tract infections To overcome this problem we developed a diagnostic molecular strip which combined a generic nested touchdown protocol with in-house primer master-mixes that could recognise 12 common respiratory viruses. CONCLUSIONS: The touchdown protocol with pre-dispensed primer master-mixes was suitable for replacing virus culture for the diagnosis of respiratory viruses which were negative by immunofluorescence. To test the feasibility of its routine use we needed to clinically validate its performance in a routine setting on specimens tested in parallel with our standard immunofluorescence protocol for the diagnosis of acute virus respiratory infections. In conclusion the use of the touchdown protocol with pre-dispensed and quality checked primer master-mixes was suitable for replacing virus culture for the diagnosis of respiratory viruses for immunofluorescence negative specimens.
cord-284376-plwyjhl8	2020	All specimens tested negative by direct examination for PJ, whereas 27 were positive by real-time PCR (BAL, n = 18; sputa, n = 7, and TA, n = 2); Following stringent clinical, microbiological and imaging criteria ( Table 1 ) , PJP was deemed to be the most probable diagnosis in 12 episodes occurring in unique patients. In contrast, corticosteroid use within the month before sampling was not different between The probability of Pneumocystis jirovecii (PJ) pneumonia (PJP) for each patient was retrospectively evaluated by an expert committee including infectious diseases and microbiology specialists at both centers, on the basis of (i) documented PJ presence in respiratory specimens by microscopy; (ii) compatibility of clinical signs and symptoms (at least 2 of the following: subtle onset of progressive dyspnea, pyrexia, nonproductive cough, hypoxaemia and chest pain), (iii) compatible (suggestive) radiological findings (chest radiograph and/or high-resolution computed tomographic scan detection of interstitial opacities and/or diffuse infiltration infiltrates); (iv) complete resolution of symptoms after a full course of anti-PJP treatment; (v) absence of alternative diagnosis.
cord-284423-fzz8g3rq	2018	This study aimed to establish a liquid bead array based on Luminex xMAP technology that was able to simultaneously detect multiple insect-borne pathogens. CONCLUSIONS: This optimized liquid array detection system was high-throughput and highly specific and sensitive in screening of the insect-borne pathogens. To date, multiple molecular detection methods have been established to detect insect-borne pathogens, including reverse transcriptase-polymerase chain reaction (PCR) [8] , real-time PCR [9] , a liquid bead array [10] and a microwell membrane array [11] . In this study, we established a method that was able to simultaneously detect multiple insect-borne pathogens rapidly and effectively, including bluetongue virus (BTV), epizootic hemorrhagic disease virus of deer (EHDV), Q-fever pathogen Coxiella burnetii (CB), African swine fever virus (ASFV), West Nile fever virus (WNV), Borrelia burgdorferi (BB), vesicular stomatitis virus (VSV), Rift Valley fever virus (RVFV), Ebola virus (EBV) and Schmallenberg virus (SBV). This study established a multiplexed PCR-coupled liquid array to simultaneously detect 10 types of insect-borne pathogens.
cord-284608-ba7wq52t	2019	title: Alpha, Beta, gamma human PapillomaViruses (HPV) detection with a different sets of primers in oropharyngeal swabs, anal and cervical samples BACKGROUND: Recent studies have shown a 13-fold increase of oropharyngeal cancer in the presence of HPV, while α-HPV detection seems to be rare in oral cavity in comparison to anal or cervical district, many novel β and γ types have been isolated in this anatomical site suggesting a wide tropism range. METHODS: We analysed the presence of HPV DNA in oropharyngeal (n = 124), anal (n = 186), cervical specimens (n = 43) from HIV positive and negative patients using FAP59/64 and MY09/11 primers. In this study, we analyzed the presence of HPV DNA in oral, anal, and cervical specimens collected from HIV positive and HIV negative individuals, living in the same geographic area (regione Lazio) by using MY09/11 [20, 21] FAP59/64 primers [22] .
cord-284625-to6w5hm2	2020	Given the concept of the early diagnosis and treatment of SARS-CoV-2, this article mainly focused on the 25 initial laboratory-confirmed patients in the Luoyang area, discussing their imaging features and clinical characteristics. From January 10 to February 8, 2020, 25 patients with laboratory-confirmed SARS-CoV-2 infection in the area of Luoyang, Henan Province, China, were enrolled in the study. In addition, COVID-19 patients were not found to have combined a On the admission day, the unenhanced CT scan shows diffuse bilateral multiple patchy GGO (white arrow), and the partial boundary is clear while some have unclear boundaries, which are especially significant in the lower lobes of both lungs; strip consolidative opacities (black arrow) are in the focal area. A woman who is the wife of the patient 3 and mother of patient 22 had two negative PCR results, but the lesions in her lung had the same progression, and the blood test also confirmed the SARS-CoV-2 infection.
cord-284644-9k2oox64	2017	Optimized RT-LAMP assays were applied on clinical samples from patients having influenza like illness and results were compared with conventional one-step RT-PCR and real-time RT-PCR. CONCLUSIONS: RT-LAMP assay is rapid, sensitive, specific and cost effective method for detection of influenza A viruses than conventional one-step RT-PCR and it can serve as a good alternate for diagnosis and surveillance studies during influenza outbreaks in resource-limited setups of developing countries. The objectives of the current study were to (1) optimize RT-LAMP assay for detection of influenza A viruses and their subtypes (H1N1, H3N2 and pdm09/H1N1); (2) determine sensitivity and specificity of RT-LAMP assay; (3) clinical evaluation of RT-LAMP assay and conventional one-step RT-PCR in comparison to WHO recommended rRT-PCR taken as standard. Development and evaluation of reverse transcription loop-mediated isothermal amplification assay for rapid and real-time detection of the swine-origin influenza A H1N1 virus
cord-284777-z7bd3a91	2018	Three reverse transcription recombinase polymerase amplification assays with lateral flow dipsticks (RT-RPA-LFD) were developed for identification of the matrix and hemagglutinin (HA) genes to detect influenza A virus and distinguish subtypes H1 and H3. More recently, nucleic acid amplification tests (NAATs), such as reverse transcription polymerase chain reaction (RT-PCR) [12] [13] [14] [15] , real-time RT-PCR [16, 17] , and reverse transcription loop-mediated isothermal amplification (RT-LAMP) [18, 19] , have been used for rapid and sensitive diagnosis or subtyping of IAVs. Nevertheless, these methods require expensive equipment and/or skilled technicians, making them inappropriate for use in developing countries. In order to comprehensively evaluate the performance of RT-RPA-LFD, 28 positive throat swab specimens by matrix real-time RT-PCR were tested by RIDTs (Rapid influenza A virus antigen test kits, Guangzhou Wondfo Biotechnology Co., Ltd, China).
cord-285203-ilxd0ih9	2020	
cord-285323-473d7zvg	2013	
cord-285527-1mceq6v0	2020	
cord-285587-rggfg60a	2015	title: Detection of viral acute lower respiratory tract infection in hospitalized infants using real-time PCR Detection of viral acute lower respiratory tract infection in hospitalized infants using real-time PCR Introduction Viral pathogens account for a large proportion of community acquired pneumonia cases. 6, 7 The present study aims at investigating the epidemiology of viral infection using multiplex real time PCR, and exploring the clinical spectrum of the affected children in relation to viral type, during the winter season in hospitalized children with viral pneumonia. 19 Although RSV is well recognized as the main agent associated with severe ALRTIs, recent data indicate that other viruses may play a significant role in these clinical outcomes, RV seems to be of particular interest, as the most prevalent virus in respiratory illnesses even in the first years of life, being associated with severe acute bronchiolitis. Viral etiology of hospitalized acute lower respiratory infections in children under 5 years of age -a systematic review and metaanalysis
cord-286065-x0g67pnb	2016	We describe the analytical characteristics of the IRIDICA BAC BSI Assay and compare its pre-clinical performance to current standard-of-care methods in a collection of prospectively collected blood specimens from patients with symptoms of sepsis. During the clinical sample study, performed following the sterility and personal protective equipment recommendations of the manufacturer, 61 negative controls were tested and yielded no Other reportable organisms excluding potential contaminants (n = 550) 0 0 0 207 A These 11 culture-negative, IRIDICA BAC BSI Assay-positive detections were supported by later organism-specific ID data which identified the same species as agents of infection (as noted on the subjects'' charts). The broad-spectrum nature of the IRIDICA BAC BSI Assay primers, paired with a signal analysis method capable of sensitive and specific detection and identification of one or more species signatures in samples with high background levels of human DNA, make it uniquely suited as a molecular test for bacterial and Candida DNA in blood samples.
cord-286096-h275nner	2012	Methods Between April 2008 and April 2009, 408 adult patients (aged between 20 and 94 years) with community‐acquired pneumonia were tested for the presence of respiratory pathogens using bacterial cultures, real‐time PCR for viruses and bacteria, urinary antigen testing for Legionella and Pneumococci and serology for the presence of viral and bacterial pathogens. All samples were tested using real-time PCR for the presence of respiratory viruses and bacteria including adenovirus (AdV), human bocavirus (hBoV), KI-and WU polyomaviruses (KIPyV and WUPyV), human metapneumovirus (hMPV), human rhinovirus (HRV), human coronaviruses (HCoV) (OC43, NL63, HKU and 229E), parainfluenza viruses (PIV), 1-4 influenza viruses A and B (InfA, InfB), respiratory syncytial virus (RSV), Legionella pneumophila, Mycoplasma pneumoniae, Chlamydophila psittaci, Chlamydophila pneumoniae, Coxiella burnetii and Streptococcus pneumoniae. This study revealed the viral and bacterial aetiology in 263 (64AE5%) of 408 patients with community-acquired pneumonia.
cord-286343-s8n1ldol	2020	
cord-286360-wrrqb387	1999	A diagnostic test for canine coronavirus (CCV) infection based on a nested polymerase chain reaction (n-PCR) assay was developed and tested using the following coronavirus strains: CCV (USDA strain), CCV (45/93, field strain), feline infectious peritonitis virus (FIPV, field strain), trasmissible gastroenteritis virus (TGEV, Purdue strain), bovine coronavirus (BCV, 9WBL-77 strain), infectious bronchitis virus (IBV, M-41 strain) and fecal samples of dogs with CCV enteritis. The test described in the present study was able to amplify both CCV and TGEV strains and also gave positive results on fecal samples from CCV infected dogs. Recently a nested polymerase chain reaction (n-PCR) assay was developed for detection of feline infectious peritonitis virus (FIPV), a coronavirus closely related to CCV, in clinical specimens (Gamble et al., 1997) . PCR carried out with CCV1 and CCV2 primers specific for the target sequence 337 -746 of M gene revealed high sensitivity; tests performed on corresponding viral dilutions, which also were inoculated into cell cultures, gave positive results to the 10 − 4 dilution (approximately 10 -50 TCID 50 of virus).
cord-286443-t0asknzu	2013	
cord-286451-ujo72w06	2012	
cord-286555-rz88g3ze	2020	The most widely used molecular method approved by the World Health Organization (WHO) and the Centers for Disease Control and Prevention (CDC) to detect SARS-CoV-2 is the real-time reverse transcription polymerase chain reaction (qRT-PCR) [4] . The protocol for the COVID-19 PCR Diatheva Detection Kit used with Fast Gene Probe One Step Mix uses 5 µL of mix 1 mixed with 0.625 µL of mix 2, 9.375 µL of primer/probe mix, and 5 µL of RNA template, with a total volume of 20 µL. An initial interlaboratory validation was performed by the Molecular Pathology Laboratory from the University Emergency Hospital Bucharest, using the PowerCheck 2019-nCoV Real-Time PCR Kit. This study was conducted as part of a surveillance program for COVID-19 implemented by the Romanian government. To determine the analytical sensitivity of the COVID-19 commercial assays used in Romanian hospitals (PowerCheck Kogene 2019-nCoV, COVID-19 PCR Diatheva Detection Kit, and 2019-nCoV CDC EUA), we first evaluated their limit of detection (LOD) by performing 10-fold serial dilutions of the controls provided by the kits.
cord-287054-zmxpuynv	2020	
cord-287104-4k8pqbc0	2019	title: Development of Rapid and Specific Detection for the Human Aichivirus A Using the Loop-Mediated Isothermal Amplification from Water Samples In this study, developed a LAMP method to achieve a rapid, specific and highly sensitive detection of AiV-A. A newly developed method was more rapid (approximately 2–8 h), specific and equivalent detection of AiV-A than with the conventional PCRs. In addition, confirm system of positive LAMP reaction was developed by using the restriction enzyme Aci I and Hae III. A method for detecting AiV-A specific genes by using reverse transcription nested polymerase chain reaction (RT-PCR) assay, have been reported [15] [16] [17] . In this study, developed a rapid, specific and highly sensitive detection of AiV-A by using a LAMP assay. In this study, developed a LAMP assay that could rapid, specific, and sensitive detection of AiV-A from water samples.
cord-287228-0qm939ve	2020	
cord-287447-5lzzobl3	2004	Abstract We report on chloroquine, a 4-amino-quinoline, as an effective inhibitor of the replication of the severe acute respiratory syndrome coronavirus (SARS-CoV) in vitro. Glycyrrhizin (an active component of liquorice roots), niclosamide (an antihelminthic drug), nelfinavir (a human immunodeficiency deficiency virus (HIV) protease inhibitor), and SNAP (a nitric oxide donor) were reported to have an antiviral effect against SARS-CoV [12] [13] [14] [15] . In this study we report the in vitro antiviral activity of chloroquine against SARS-CoV Frankfurt 1 strain infection. The IC 50 of chloroquine inhibition of SARS-CoV replication in Vero E6 cells, 8.8 lM, is below (1000-fold) the plasma concentrations of chloroquine that are reached in human plasma, following treatment with chloroquine (for acute malaria) at a dose of 25 mg/kg over three days [27] . Our results show that chloroquine inhibits the replication of SARS-CoV in Vero E6 cells.
cord-287466-ag5y781z	2016	As evidenced by the presence of genomic-length and sgmRNA-length replicativeintermediate double-stranded (ds)RNAs in shrimp cells infected with gill-associated virus (GAV) (Cowley et al., 2002a) , the type species okavirus (Cowley et al., 2012) , it is speculated that transcription termination of the antisense RNAs might occur at precise positions, resulting in common 3′-termini, and that these then act directly as promoters for transcription initiation of the genomic and sgmRNAs. In all other nidoviruses, however, and for the longest of the sgmRNAs transcribed by toroviruses, the (−) and (+) strand sgmRNAs are transcribed using a far more complex discontinuous process involving the splicing of a common "anti-leader" sequence derived from the genome 5′-terminus to each (−) strand sgmRNA that then acts as a universal promoter for transcribing each (+) strand sgmRNA (Pasternak et al., 2006; Sawicki et al., 2007; Smits et al., 2005; van Vliet et al., 2002) . Nidoviruses of aquatic species include the rod-shaped okaviruses GAV and yellow head virus (YHV) that primarily infect Penaeid shrimp (Longyant et al., 2005; Flegel, 2012; Flegel et al., 1997a; Cowley et al., 2000a Cowley et al., , 2002a Cowley and Walker, 2002; Sittidilokratna et al., 2008) and a morphologically similar virus with a ~22 kb ssRNA genome detected in diseased Chinese mitten crabs (Zhang and Bonami, 2007) .
cord-287843-snra23sy	2012	In this study, a Taq-Man 1 -based real-time polymerase chain reaction (PCR) method that targets the HCoV-HKU1 open reading frame (ORF) 1a and ORF 1b genes with high sensitivity and specificity was developed and evaluated. Fifty HCoV-HKU1-positive cases were detected (2.5%) out of 1,985 clinical specimens using real-time PCR assays targeting ORF 1a and ORF 1b. To circumvent these limitations, a quantitative real-time PCR was developed and targeted a study group of 1,985 throat swab specimens collected from patients with an acute respiratory illness from January 2007 to May 2008. The aim of the real-time PCR assays developed in this study was to detect both of the HCoV-HKU1 ORF 1a and ORF 1b genes. One limitation of this study was that because clinical specimens were chosen from negative cases of acute respiratory illness in the ARI-Net laboratory surveillance system [Chun et al., 2009] , dual or multiple infections of HCoV-HKU1 with other respiratory viruses could not be detected.
cord-287931-cxqzac4a	2013	RESULTS: Using multiple probes designed to specifically detect a microbial genus or species, EOPM can correctly identify known pathogens at the species or genus level in blinded testing. To facilitate the application of EOPM in multiple surveillance sites for infectious diseases, we designed software with a user-friendly interface, which is supported by a statistical analysis method based on a comprehensive microbial sequence identification database. Analysis of the enrichment results at the genus level revealed Cardiovirus as the number one match, showing significant enrichment ( The microarray raw data of other symptom-causing pathogens, such as streptococcus and mycoplasma, identified by EOPM in peripheral blood in infectious patients, were also submitted to the GEO database. These microarray platforms use long oligonucleotide probes (60-70-mer) and random PCR amplification, and have successfully identified unexpected pathogens in infectious disease outbreaks, even discovering novel viruses with homology to known species [8, 11] .
cord-288253-wqrhiq08	2015	Because the major pathological changes of the porcine coronaviruses (e.g., TGEV and PEDV) involves enteric diseases, we measured porcine APN expression in the small intestine by RT-PCR, immunoblotting, and IHC. An immunohistochemical analysis, with both anti-Flag and anti-porcine APN antibodies, clearly confirmed porcine APN expression in the brush borders of the absorptive cells in the small intestines of the mouse model (Fig. 4C) . For these purposes, many transgenic mouse models have been developed to study viral pathogenesis, immune responses, and vaccines (Darling et Both wild type and porcine APN transgenic mice were infected with PEDV (5X TCID5010 6 ) orally on day 0. Although significant clinical illness was not observed when the transgenic mice were infected with PEDV, their susceptibility to the virus was confirmed by the detection of viral RNA in various organs with RT-PCR and viral proteins in the small intestines with IHC.
cord-288306-0chcsqe7	2020	The wellestablished diagnostic methods of CSF such as virus isolation, fluorescent antibody test (FAT), antigen capture antibody enzyme-linked immunosorbent assay (ELISA), reverse-transcription polymerase chain reaction (RT-PCR), virus neutralization test (VNT), and antibody ELISA (Table 1) have been widely used and well described in the OIE Terrestrial Manual [17] . The well-established diagnostic methods of CSF such as virus isolation, fluorescent antibody test (FAT), antigen capture antibody enzyme-linked immunosorbent assay (ELISA), reverse-transcription polymerase chain reaction (RT-PCR), virus neutralization test (VNT), and antibody ELISA (Table 1 ) have been widely used and well described in the OIE Terrestrial Manual [17] . Evaluation of a multiplex real-time RT-PCR for quantitative and differential detection of wild-type viruses and C-strain vaccine of Classical swine fever virus The double-antigen ELISA concept for early detection of E rns -specific classical swine fever virus antibodies and application as an accompanying test for differentiation of infected from marker vaccinated animals
cord-288327-r20zowty	2005	Biotin‐labeled PCR products obtained with two multiplex reverse transcription (RT)‐polymerase chain reaction (PCR) assays described previously, which allow for the detection of fourteen different groups of respiratory viruses, were hybridized to the oligonucleotide array. Biotin-labeled PCR products obtained with two multiplex reverse transcription (RT)-polymerase chain reaction (PCR) assays described previously, which allow for the detection of fourteen different groups of respiratory viruses, were hybridized to the oligonucleotide array. To evaluate the validity of this method for routine diagnosis was performed a comparative analysis using reference strains from a wide range of respiratory viruses, viral isolates and clinical specimens that have been analyzed by both nested PCR and RLB assays. In conclusion, a RT-PCR-RLB method has been developed for simultaneous detection and typing of a wide range of respiratory viruses, based on the hybridization of biotinylated PCR products, obtained with two multiplex RT-PCR assays described previously, to an array of oligonucleotides that are immobilized and orientated on a nylon membrane.
cord-288556-o8i6j3b2	2020	We characterized from fecal samples the genome of a novel chapparvovirus we named fechavirus that was shed by 8/17 affected cats and identified three different feline bocaviruses shed by 9/17 cats. Epidemiological investigation of disease signs, time of onset, and transfers of affected cats between three facilities support a possible role for this new chapparvovirus in a highly contagious feline diarrhea and vomiting disease. Here, we analyzed a multi-facility outbreak of vomiting and diarrhea in cats using the following approaches: a commercial feline diarrhea panel of PCR tests for known enteric pathogens; viral metagenomics; and follow-up PCRs. Multiple mammalian viruses of varied origins were detected. DNA was extracted from each individual fecal sample (and one pool of 3, cat#973-975) shown in Table 3 plus 4 vomit samples using the QIAamp MinElute Virus Spin Kit (Qiagen, Hilden, Germany), and PCR assays were used for the detection of different viral nucleic acids in each sample.
cord-288692-v471648u	2005	title: Use of Dual TaqMan Probes to Increase the Sensitivity of 1-Step Quantitative Reverse Transcription-PCR: Application to the Detection of SARS Coronavirus We designed a 1-step real-time quantitative RT-PCR assay for SARS-CoV with the use of 2 TaqMan probes, instead of 1 probe, hybridizing to the same PCR product to further improve the sensitivity. In conclusion, we report the use of dual TaqMan probes for quantification purposes and apply it to the detection of Clinical Chemistry 51, No. 10, 2005 SARS-CoV with a detection limit of 1 copy RNA per reaction. Detection of SARS coronavirus in patients with severe acute respiratory syndrome by conventional and real-time quantitative reverse transcription-PCR assays Quantitation of severe acute respiratory syndrome coronavirus genome by real-time polymerase chain reaction assay using minor groove binder DNA probe technology Sensitive and quantitative detection of severe acute respiratory syndrome coronavirus infection by real-time nested-polymerase chain reaction
cord-288701-nx9fg4yn	2015	The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. To overcome these limitations, we have developed a multiplex real-time RT-PCR assay for simultaneous detection of the different species of bovine pestiviruses, including the emerging HoBi-like group, allowing a rapid, sensitive and specific diagnosis of pestivirus infection and characterisation of the viral species.
cord-288962-jgtoehcr	2000	To define the role of enteroviruses and human rhinoviruses as etiological agents in childhood bronchiolitis, clinical aspirates from 84 infants admitted to hospital with symptoms of obstructive bronchiolitis were tested by picornavirus RT‐PCR assay, adenovirus PCR assay and classical immunofluorescence antigen detection of common respiratory viral agents. In summary, combination of molecular and classical detection assays of common viruses can be used to demonstrate enterovirus and human rhinovirus respiratory infection in childhood bronchiolitis, and provides an improved approach to obtain new insights into concomitant viral respiratory tract infection in infants. To investigate the role of enteroviruses and human rhinoviruses as etiological agent in bronchiolitis, 84 nasopharyngeal aspirates were tested by picornavirus RT-PCR assay, classical immunofluorescence antigens detection of respiratory syncytial viruses, influenza viruses, parainfluenza viruses, coronaviruses, and adenovirus PCR assay.
cord-289017-vwye3pk9	2012	CONCLUSIONS/SIGNIFICANCE: Influenza viruses were the most commonly detected viral organisms among patients with acute febrile respiratory illnesses presenting at two hospitals in Maracay, Venezuela. Recent prospective studies, which utilized more sensitive methods for detecting respiratory viruses such as multiplex polymerase chain reaction (PCR), have similarly demonstrated that the highest rates of viral respiratory infection occur among children and the frequency of infection tends to decrease with age due to increasing acquired immunity [8] . On the other hand, the percentage of influenza viruses (not including pH1N1) detected in our study during a similar period of time, but in different years accounted for the significant differences found in both studies: a) the collection, preservation and further processing of respiratory samples, and b) the type of cells and IFA reagents used for virus isolation and identification. In contrast, a prospective study of ILI among Brazilian adults, which utilized viral isolation and RT-PCR testing on respiratory samples, detected rhinoviruses in 19.6% of patients [14] .
cord-289050-9w7ks01n	2008	5, 6 The aim of the present study was to report the case of a pediatric, immunocompetent patient who presented with severe acute respiratory distress syndrome (ARDS), for whom there was a fatal outcome, and in whom hMPV was the only etiologic agent found even on post-mortem necropsy. Human metapneumovirus could be more severe in patients with underlying medical conditions such as chronic lung disease caused by prematurity, cardiac disease, and immunodefi ciency. The accumulation of cases, however, and comprehensive microbiological analysis including (RT-) PCR for other respiratory viruses are needed to confi rm that infection with hMPV alone can result in such severe lung disease. We believe that the present case should warn us about the occasional role of hMPV as an agent of severe lung infection in children without a predisposing condition. Human metapneumovirus detection in patients with severe acute respiratory syndrome
cord-289114-ifnk41oq	2020	The SARS-CoV-2 infected patients with the cardiovascular problem have a higher fatality rate as compared to general COVID-19 patients. The ACE-2 has been suggested as a medicine for the treatment of diabetes because it reduces inflammation .Therefore, the diabetes and COVID-19 patients treated with ACE-2 have higher risk of infection (Zachary, 2020) . Although, the specific drug for SARS-CoV-2 is not discovered till date, the medical observers are attempting with different antiviral drugs for the treatment of COVID-19 infection . All rights reserved patients demonstrated that the combination of a new antiviral drug remdesivir and chloroquine slowed down the growth of SARS-CoV-2 (Abdul et al., 2017) . Convalescent plasma therapy has been observed as a better alternative for the treatment of severely infected COVID-19 patients. A research report suggested that plasma treatment is more effective at the initial stage (within 14 days of symptoms) of COVID-19 infection.
cord-289200-6yhz1a23	2020	Two authors independently and systematically searched these databases using the following MeSH terms: "pregnancy," "infant, newborn," "COVID-19," and "severe acute respiratory syndrome coronavirus 2." We also performed a manual search in Google Scholar and the websites of key journals in the related field. Indeed, breastfeeding may not be safe until COVID-19 is ruled out or until both mother and neonate clear As there is no evidence to support the possibility of intrauterine vertical transmission, the timing of delivery should not be based solely on the condition that a pregnant patient is infected but should be individualized in each case; that is, obstetricians may consider maternal and fetal wellbeing, gestational age, and other concomitant conditions to determine the time of delivery. The currently available evidence does not support the possibility of intrauterine vertical transmission of SARS-CoV-2 infection during the third trimester of pregnancy.
cord-289216-g4kqi560	2020	title: Analysis of external quality assessment samples revealed crucial performance differences between commercial RT-PCR assays for SARS-CoV-2 detection when taking extraction methods and real-time-PCR instruments into account The aim of this study was to compare the performance of the overall analytical matrix including the extraction kit (BD MAX, Promega, Qiagen), the PCR instrument (Agilent Mx3005P, BD MAX, Qiagen Rotor-Gene, Roche Cobas z 480) and the RT-PCR assay (Altona Diagnostics, CerTest Biotec, R-Biopharm AG) using predefined samples from proficiency testing organizers. In this study, two diagnostic laboratories of a tertiary care hospital equipped with different PCR systems validated the available kits on the respective systems for SARS-CoV-2 testing. In order to evaluate the performance of analytical components used for SARS-CoV-2 diagnostic we compared three commercially available RT-PCR kits, six extraction kits and four PCR cyclers in all possible combinations using predefined EQA samples.
cord-289612-4x5t4c5u	2020	Laboratory-confirmed SARS-CoV-2 infection requires the detection of viral nucleic acid in respiratory tract samples by the use of real-time reverse-transcription polymerase chain reaction (rRT-PCR) assay. In the course of this phase, upper respiratory specimens were tested by RT-PCR for viral RNA and the majority of the patients showed positive results for SARS-CoV-2. These results contrast with another German smaller study by Wolfel et al., conducted on 9 COVID-19 patients, with no discernible difference in viral loads or detection rates when comparing nasal and throat swabs [38] . found that 66.67% of laboratory-confirmed COVID-19 patients were tested positive for SARS-CoV-2 RNA in stool specimens. enrolled a total of 173 confirmed cases of COVID-19 by the use of rRT-PCR on samples from the respiratory track reported that the seroconversion sequentially appeared for the total antibody (Ab), IgM and then IgG, with a median time of 11, 12 and 14 days, respectively. Correlation of chest CT and RT-PCR testing in coronavirus disease 2019 (COVID-19) in China: a report of 1014 cases
cord-289676-tjy7f9rk	2009	
cord-289735-iw3uq2z9	2019	BACKGROUND: It is unclear whether multiple respiratory viral infections are associated with more severe bronchiolitis requiring pediatric intensive care unit (PICU) admission. Other viruses frequently found in children with bronchiolitis include rhinovirus, Background: It is unclear whether multiple respiratory viral infections are associated with more severe bronchiolitis requiring pediatric intensive care unit (PICU) admission. To address these issues, we conducted a case-control study and performed a multivariable regression analysis to determine the association between severe bronchiolitis resulting in PICU admission and the number of viral co-infections among previously healthy infants hospitalized for acute bronchiolitis, while accounting for confounders. As controls, the same number of neonates (<28 days; n = 20) and infants (n = 135) were randomly selected among the 890 patients (age 1 year) with bronchiolitis admitted to the general pediatric unit, and for whom PCR was performed during the same study period, using a random sampling method.
cord-289744-suiqh3gv	2018	The aim of our multicentre study was to assess detection of enterovirus by PCR in blood specimens of newborn babies, infants, and children with fever without source, sepsis-like disease, or suspected meningitis. Evidence before this study We searched PubMed up to Feb 7, 2018, for papers reporting paediatric enterovirus diseases and enterovirus PCR testing or molecular detection of viruses in cerebrospinal fluid (CSF) or blood specimens of patients with aseptic meningitis, sepsis and sepsis-like disease, or fever without source. Our study of 360 patients with laboratory findings of enterovirus infection is, as far as we are aware, the largest prospective, multicentre, observational study to assess PCR testing for enterovirus in both blood and CSF samples from newborn babies (aged ≤28 days) and infants (aged >28 days to ≤2 years) with fever without source, sepsis-like disease, or suspected meningitis, and children (aged >2 years to ≤16 years) with suspected meningitis.
cord-289745-qtorq2qq	2005	We sought to determine whether novel human coronaviruses (HCoVs) are circulating in New Haven, Connecticut, and, if so, whether they are associated with respiratory tract disease in infants and young children. To determine whether novel HCoVs are circulating and, if so, whether they are responsible for respiratory tract disease in children, we developed a strategy to screen for previously unknown HCoVs. Our initial assumption was that all CoVs must have conserved functions and that these conserved functions are reflected in the genome. These specimens, which were obtained from both ambulatory and hospitalized patients, were screened for presence of human metapneumovirus (hMPV) by use of an RT-PCR-based approach described elsewhere [12, 13] and were submitted to the Clinical Virology Laboratory, Yale-New Haven Hospital, for diagnostic testing. The novel HCoV identified in New Haven and The Netherlands was associated with both upper and lower respiratory tract disease in infants and young children.
cord-290456-cgrn5c36	2020	[16] e aim of this study is to present the current situation from a developing country perspective in dealing with emergency endoscopic endonasal skull base surgeries at the time of the COVID-19 pandemic in terms of preoperative patients'' screening, surgical techniques, and intraoperative PPE utilization. e survey consisted of 12 questions designed to explore three domains; patients'' information (age, clinical manifestations [neurological and COVID-19 related], diagnosis, preoperative COVID-19 screening, and COVID-19 symptoms during the first 3 weeks postsurgery), surgical team information (age, chronic medical conditions, and COVID-19 symptoms during the first 3 weeks postsurgery), and operative information (PPE utilization and basal craniectomy). ere was only one surgeon who developed a high-grade fever, malaise, and bony aches in the first 3 days after surgery who had undergone two nasopharyngeal swabs with RT-PCR testing 1 week apart and both came back negative representing 2.1% of the surgical team members [ Figure 2c ].
cord-290513-ygqin14x	2020	title: Reporting radiographers'' interpretation and use of the British Society of Thoracic Imaging''s coding system when reporting COVID-19 chest x-rays Methodology Retrospective review of CXR reports by radiographers for suspected COVID-19 patients attending the Emergency Department (ED) of a hospital in the UK. The criteria for inclusion were; adult patients attending the ED with the diagnostic question querying COVID-19, with a BSTI code in the report and an initial RT-PCR swab result. The fact that the reporting team and Radiologist arbiter reached agreement that the 18 false negative reports with code CVCX0 all had normal appearances, despite returning a positive RT-PCR result, corroborates findings from previous work suggesting that there may be no radiographic features in early or mild disease 7,10,21 . Correlation of Chest CT and RT-PCR Testing in Coronavirus Disease 2019 (COVID-19) in China: A Report of 1014 Cases
cord-290540-r0d6oaez	1999	Special attention is given to the genetic dynamics of the viruses as these now allow us to begin to understand the origin of the different phenotypes, in particular the genesis of virulence during persistent infection. The conclusion from these experiments is that feline coronaviruses may persist in the lower intestinal tract where the virus continues to replicate at low levels. Conceivably, the persisting virus confers to its host resistance against superinfection by the closely related feline coronaviruses, which were infecting the other cats. The idea was that''feline enteric coronaviruses'' are indeed restricted in tropism, while''FIP viruses'' would cross the epithelium, infect macrophages and go systemically. The result of all these studies is that generally there is no protection when an antibody response to the spike protein is induced there is rather an enhancement of the infection, with an''early death'' phenomenon. Detection of feline coronavirus RNA in feces, tissues and body fluids of naturally infected cats by reverse transcriptase PCR
cord-290867-akurajpf	2011	
cord-290976-dhwlr2ui	2013	
cord-291026-99cit4ig	2015	In this study, we describe validation of a new probe‐based insulated isothermal reverse transcriptase PCR (iiRT‐PCR) assay for rapid detection of classical swine fever virus (CSFV) on a compact, user‐friendly device (POCKIT (™) Nucleic Acid Analyzer) that does not need data interpretation by the user. Archived viral nucleic acid from 18 laboratory-amplified non-CSF viruses including eight other pestiviruses (BVDV 1-Hastings, Singer and NY1 strains; BVDV 2-Ames 125c, 890, 24515 strains; BDV-Coos Bay; HoBi atypical pestivirus), African swine fever virus-Lisbon, swine vesicular disease virus-ITL 19/92, porcine respiratory and reproductive syndrome virus-YNL, swine influenza virus (H3N2), porcine circovirus 1 (PCV1, derived from infectious clone based on GenBank accession no. The iiRT-PCR assay accurately detected all CSFV RNA samples which represented all three genotypes, and eight of 11 subgenotypes that were available for testing and gave negative results for three BVDV type 1 strains, three BVDV type 2 strains, BDV, HoBi atypical pestivirus, ASFV and nine other viruses that affect livestock.
cord-291029-oldket3n	2005	The QIAamp MinElute Virus kit (Qiagen Inc., Valencia, CA) was compared to the two existing methods currently used in our laboratory, IsoQuick (Orca Research Inc., Bothell, WA) for DNA extraction and RNAzol B (Leedo Laboratories Inc., Houston, TX) for RNA extraction, of viral nucleic acids. In this study, we have chosen both nasopharyngeal swab (NPS) and cerebrospinal fluid (CSF) specimens submitted for influenza A virus, enterovirus and herpesvirus testing to validate the MinElute nucleic acid extraction system. Nucleic acid recovery rates between the MinElute and RNAzol B were further determined by quantitating HIV-1 or CMV viral loads in extracted RNA or DNA specimens using a real-time TaqMan PCR. The MinElute kits possessed an equivalent sensitivity in nucleic acid recovery and detection, in comparison to the IsoQuick and RNAzol B, for both DNA and RNA extraction.
cord-291281-ygrh8ces	2020	In contrast to other PCR examinations, or laboratory medical analyses, currently SARS-CoV-2 diagnostic information about the device or the detection limit / sensitivity is not usually provided by the laboratory. Using a protocol without purification of viral RNA, i.e. the Munich Extraction Protocol (MEP) [2] , we could show that the type of transport medium had little influence on the detection sensitivity of SARS-CoV-2 in the PCR (Table 1) . By using this system, the sensitivity could be increased by at least one more dilution step compared to the use of commercial purification methods in PCR (Table 3) . . https://doi.org/10.1101/2020.06.11.20127241 doi: medRxiv preprint Table 1 Comparison of different types of transport media for their influence on the detectability of SARS-CoV-2. . https://doi.org/10.1101/2020.06.11.20127241 doi: medRxiv preprint Table 2 Comparison of different purification systems for their influence on the detectability of SARS-CoV-2 (Cp = crossing point).
cord-291360-z19ri377	2020	Of 509 HCWs with initial negative SARS-CoV-2 assays, nine had symptom progression and positive re-tests, yielding an estimated negative predictive value of 98.2% (95% CI: 96.8–99.0%) for the exclusion of clinically relevant COVID-19. CONCLUSIONS: Symptom and temperature reports are useful screening tools for predicting SARS-CoV-2 assay results in HCWs. Anosmia/ageusia, fever, and myalgia were the strongest independent predictors of positive assays. Therefore, we investigated the presenting symptoms most predictive of positive/negative SARS-CoV-2 RT-PCR results among HCWs. Since March 9, 2020, the occupational health service of a Massachusetts community healthcare system has implemented a staff "hotline" system to maintain a viable/healthy workforce and operational continuity during the pandemic. The clinical COVID-19 attack rate during the study period was calculated as: (the number of initial positive SARS-CoV-2 assays + the number of false negatives) divided by the system''s estimated total HCW population (n = 4600).
cord-291486-5h96msv1	2007	
cord-291729-4l4v9jxd	2020	
cord-291749-revhbd0q	2019	
cord-291860-dw1sfzqx	2019	Herein, were studied the performance of an in-house mNGS protocol for routine diagnostics of viral respiratory infections with potential for automated pan-pathogen detection. Herein, were studied the performance of an in-house mNGS protocol for routine diagnostics of viral respiratory infections with potential for automated pan-pathogen detection. Clinical sensitivity was analyzed using the optimized procedure, which in short consisted of total nucleic acid extraction, including internal controls (1:100 dilution); the adapted New England Biolabs Next library preparation protocol, including fragmentation with zinc, for combined RNA and DNA detection (see Library Preparation); and sequencing of 10 million reads (Illumina NextSeq 500). The Centrifuge default settings, with NCBI''s nucleotide database and assignment of sequence reads to a maximum of five labels per sequence, resulted in various spurious classifications ( Figure 4) [eg, Lassa virus ( Figure 5 ), evidently highly unlikely to be present in patient samples from the Netherlands with respiratory complaints].
cord-291916-5yqc3zcx	2020	
cord-291954-wormplcu	2020	A novel betacoronavirus, the seventh member of coronaviruses, which is shown to infect humans and lately named as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) causes an ongoing outbreak of respiratory illness that began in December 2019 in China called coronavirus disease 2019 . On admission, a nasopharyngeal and throat swabs for SARS-CoV-2 reverse transcription-polymerase chain reaction (RT-PCR) revealed a positive result, other laboratory findings included white blood cell count (WBC) 2480 cells/mm 3 , lymphocyte (L) 18%, neutrophil (N) 78%, and C-reactive protein (CRP) 62.7 mg/L. Although acute hypoxemic respiratory failure from COVID-19 in elderly and KT recipients in our cohort seemed to be prominent, early investigation in high-risk populations, prompt initiation of potential therapy, and intensive supportive care are important to prevent adverse consequences and mortality. Case report of COVID-19 in a kidney transplant recipient: Does immunosuppression alter the clinical presentation?
cord-291958-g4jlg9pw	2014	Our study aim was to investigate the molecular epidemiology of human CoV strains circulating in Arkansas, their genetic variability and their association with reported influenza-like symptoms. Samples were pre-screened, using a quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) multiprobe for coronavirus, and subjected to confirmatory pancoronavirus and/or strain-specific reverse transcriptase (RT)-PCR followed by sequence analysis. RNAs positive for CoV by qRT-PCR were analyzed by one-step RT-PCR, using degenerate primers for the ORF1b [20] and specific primers (Table 1) for the spike and nucleocapsid genes of human alphacoronavirus (NL63 and 229E) and betacoronavirus (OC43 and HKU1). Among the 3 feline-like samples (based on ORF1b phylogenetic analysis), two were amplified and sequenced using primers to the S region, one was shown to share the highest identity with the OC43 strain (95.9% identity) and another shared the highest identity to feline CoV (83.8% identity) ( Figure 2 ).
cord-291961-usl8z6ep	2015	METHODS: The VP1 gene of HPyV6 was detected with an established TaqMan real-time PCR from nasopharyngeal aspirate specimens collected from hospitalized children with respiratory tract infections. All 15 HPyV6-positive patients were diagnosed with lower respiratory tract infections, and their viral loads ranged from 1.38 to 182.42 copies/μl nasopharyngeal aspirate specimen. CONCLUSIONS: The prevalence of HPyV6 was 1.7 % in nasopharyngeal aspirate specimens from hospitalized children with respiratory tract infections, as analyzed by real-time PCR. Previous studies have indicated that a number of HPyVs are associated with human diseases, such as progressive multifocal leukoencephalopathy (JCPyV), hemorrhagic cystitis (BKPyV), Merkel cell carcinoma (MCPyV), and trichodysplasia spinulosa (TSPyV) [3, 7, 9, [17] [18] [19] . Because initial infections with most HPyVs occur in infancy, the prevalence of HPyV6 in NPAs from children was detected with real-time PCR. The detection rate for HPyV6 by real-time PCR assay was 1.7 % in 887 NPA samples collected from hospitalized children with RTI.
cord-292031-weiwksh6	2015	Quantitative microbial risk assessment (QMRA) is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. Molecular techniques, such as nucleic acid amplification procedures, offer sensitive and analytical tools for detecting a variety of pathogens, including new emerging strains, present the possibility of automation, and real-time analysis to provide information for microbial risk assessment purposes [33] . Limitations of DNA based methods such as PCR include the inability to discriminate between viable from non-viable cells that both contain DNA, the low concentration of several pathogens in water such as Cryptosporidium, Giardia and viruses, and the lack of data to indicate the real infectious risk to a population. Oligonucleotide microarrays are a powerful genomic technology that is widely utilized to monitor gene expression under different cell growth conditions, detecting specific mutations in DNA sequences and characterizing microorganisms in environmental samples [76] .
cord-292172-aqsc9fbl	2020	Hence this paper documented the application of species specific polymerase chain reaction-restriction fragment length polymorphism (SP-PCR-RFLP) assay targeting a short-fragments (69 bp) of mitochondrial cytochrome b (cytb) gene to screen feline meat in commercial meat products using lab-on-a-chip. Thus, total 378 samples of two types (chicken and beef) with three commercial meat products (frankfurter, nuggets and meatball) of total six (6) different brands purchased from total six (6) supermarket located at Kedah, Penang and Kuala Lumpur of Malaysia (Fig. 4) were negative for feline meat detection using feline SP-PCR based on lab-on-a-chip (Table 4 ). Henceforward, the amazing stability and established sensitivity of this assay initiates its J o u r n a l P r e -p r o o f application for the screening of larger quantity of samples of three major commercial meat products (frankfurters, nuggets and meatballs) of total six brands from different supermarket chains across Malaysia (three-states) for feline species detection.
cord-292281-fui9all6	2007	Clinical Significance: This study showed the efficacy of a high‐cell‐passage canine coronavirus vaccine in preventing infection of dogs by virulent virus and, specifically, its ability to induce sterilising immunity. Faecal samples collected from the vaccinated and control dogs were tested by virus isolation and PCR assays. After challenge with field strain 144/ 01, the vaccinated dogs did not develop clinical signs, and virus isolation and PCR did not detect viral shedding. In a recent study, it was found that the inactivated vaccine had poor efficacy in reducing faecal shedding of CCoV following infection with a field strain of the virus (Pratelli and others 2003b) . After challenge at 14 dpsv, protection from CCoV infection was complete because no viral shedding was observed by either virus isolation or PCR tests. The present study has shown the efficacy of a high-cell-passage CCoV vaccine in preventing infection of dogs by virulent virus and, specifically, its ability to induce sterilising immunity.
cord-292312-cwrqorn1	2020	Conclusion: Despite high levels of COVID-19 in Pernambuco, continued exposure through the provision of essential services from the mainland, and lack of direction from national authorities, FNA was able to implement a series of prevention measures unique in Brazil that contained the epidemic on the island. These included imposing a lockdown, promoting physical distancing and providing emergency assistance to the neediest families; enhancing testing for Sars-Cov-2, including monitoring of arriving travelers, restricting access to the island and the initiation of the cohort study described here to estimate the incidence and prevalence of Covid-19. First we reviewed data extracted from the following sources: 1) demographic and socioeconomic data from the Brazilian Institute of Geography and Statistics 8 ; 2) state and district decrees and 4 ordinances; 3) number of cases and deaths from COVID-19 reported by the Pernambuco State Health Department; 4) flights and passengers from the National Aviation Agency 5 ; and 5) information provided by local authorities and residents.
cord-292347-d7xq7x5g	2020	375 While RT-PCR-based viral RNA detection has been widely 376 used in diagnosis of COVID-19, it cannot be used to monitor 377 the progress of the disease stages and cannot be applied to 378 broad identification of past infection and immunity. 46,47 410 The determination of SARS-CoV-2 exposure relies largely 411 on the detection of either IgM or IgG antibodies that are 412 specific for various viral antigens including, but not exclusively, 413 the spike glycoprotein (S1 and S2 subunits, receptor-binding 414 domain) and nucleocapsid protein. While RT-PCR has been 571 the dominant technique for detection of viral RNA, other 572 nucleic acid assays including isothermal amplification assays, 573 hybridization microarray assays, amplicon-based metagenomics 574 sequencing, and the cutting-edge CRISPR-related technologies 575 are also under development or have resulted in approved 576 tests.
cord-292364-jhiimglg	2020	
cord-292575-vsswxwdi	2020	It is in this context that this chapter aims to discuss the various scientific advances, particularly molecular, in terms of diagnosis of these diseases; the new discoveries in the role of nanotechnologies and nanobiosensors; and also the implication of biomarkers, especially microRNAs (miRNAs), since it was reported that a single miRNA has the ultimate capacity to target multiple genes simultaneously. The availability of nucleic acidÀbased technology, such as real-time PCR, along with conventional staining and culture methods and immunoassays, can provide laboratories of many sizes with a comprehensive and responsible approach for the detection of both commonly encountered and emerging or reemerging pathogens. As is the case for SARS, agents of bioterrorism, and the other pathogens, rapid diagnostic methods, such as real-time PCR, and microarray will likely play a major role in the early and sensitive detection of emerging and reemerging infectious diseases encountered in the future.
cord-292742-mio4przi	2020	KEYWORDS One Health, Panthera leo, Panthera tigris, SARS-CoV-2, in situ hybridization, lion, rRT-PCR, tiger, virus isolation, whole-genome sequencing, zoo, zoonotic infection C oronaviruses are a recognized cause of disease in humans and animals (1) . Subsequent to confirmation of SARS-CoV-2 infection in the animals, an epidemiologic investigation of zoo staff identified 10 zoo keepers and two managers who provided care for and had close (Յ1.8-m) but not direct contact with the tigers or lions between 16 March 2020 (the date on which the zoo was closed to the public due to the pandemic) and 27 March to 3 April 2020 (timeline of disease onset in the animals). Nine complete SARS-CoV-2 genome sequences (from four tigers, three lions, and two keepers) and eight full-length S gene sequences (from seven symptomatic animals and one asymptomatic animal) were generated directly from respiratory and/or fecal samples (Data Sets 3 and 4).
cord-292772-xdic7rcy	2019	Bordetella bronchiseptica, Mycoplasma spp., and Pneumocystis carinii were identified by polymerase chain reaction testing, and Klebsiella pneumonia was cultured from the bronchoalveolar lavage fluid. canis in a suspected immunocompromised Cavalier King Charles Spaniel with concurrent pulmonary and urinary tract infections involving four different pathogens, and highlights the importance of the use of polymerase chain reaction testing to detect canine Pneumocystis spp. 1 In the veterinary literature, there are many published cases of confirmed canine pneumocystosis-most of which described cases of young to middle-age dogs with suspected immunodeficiency, with the Miniature Dachshund, and the Cavalier King Charles Spaniel (CKCS) breeds most commonly reported. This case report, in the authors'' opinion, highlights four points about the diagnosis and clinical presentation of dogs with Pneumocystis spp. Second, the detection of the fungal pathogen was achieved through PCR testing of a BAL sample which was negative with microscopic visualization for Pneumocystis spp.
cord-292828-29jbf9ik	2014	title: Nasal swab samples and real-time polymerase chain reaction assays in community-based, longitudinal studies of respiratory viruses: the importance of sample integrity and quality control We therefore investigated the impact of sample collection quality and the presence of visible mould in samples upon respiratory virus detection by real-time polymerase chain reaction (PCR) assays. Quality control measures, including monitoring human DNA loads using ERV3 as a marker for epithelial cell components in samples should be undertaken to optimize the validity of real-time PCR results for respiratory virus investigations in community-based studies. Importantly, when using highly sensitive polymerase chain reaction (PCR) assays the detection rates for respiratory viruses are similar in both anterior nasal swab specimens and samples collected by the more traditional method of nasopharyngeal aspiration [18, 19] . The ORChID project is an ongoing comprehensive community-based study using PCR assays to detect respiratory viruses in anterior nasal swab specimens taken weekly by parents from their infants throughout the first 2-years of life.
cord-292831-oihcay6w	2013	
cord-292928-a4bn30ul	2015	This review also provides the information on the concentration levels of various airborne microorganisms in different indoor environments, their associated health effects as well as various bioaerosol control mechanisms worked upon till now. A recently developed electrostatic precipitator had no charging unit in the inlet while the physical collection efficiency strongly depended on the precipitation voltage which eventually depended on the charge present on the airborne microbes naturally due to aerosolization (Kunkel, 1950; Flagan, 2001 ) thereby making collection possible by differentiating between the positively and negatively charged microorganisms by adding a signature to the bioaerosol particle sampled (Lee et al., 2004a; ; Lee et al., 2004b) . Whole genome sequencing has also been applied to study the airborne microbial community in various indoor and outdoor environments of NYC after collecting air samples using a Wet Cyclone Portable Air Sampler at the flow rate of 450 L/min (Yooseph et al., 2013) .
cord-292958-k5d5fo3i	2017	
cord-293234-ouykx6g5	2012	title: Effectiveness of the 2010–2011 seasonal influenza vaccine in preventing confirmed influenza hospitalizations in adults: A case–case comparison, case-control study INTRODUCTION: We estimated influenza vaccine effectiveness (IVE) to prevent laboratory-confirmed influenza-related hospitalizations in patients 18 years old or older during the 2010–2011 influenza season. Using a prospective case-case comparison approach, we have estimated seasonal influenza vaccine effectiveness (IVE) to prevent laboratory confirmed influenza-related hospitalizations in adults. When restricting the comparison, between cases and controls, by the presence of high-risk conditions, the differences that remained significant were age, 23-valent pneumococcal vaccination, and having been vaccinated with the previous or current season influenza vaccines (Table 2) . When restricted to those 60 years old or older, age and influenza vaccination with the previous or current seasonal influenza vaccine remained as significant differences between cases and controls ( Table 2 ).
cord-293421-0ksn0fc7	1997	Summary The polymerase chain reaction (PCR) is a nucleic acid-based technique that enables the rapid and sensitive detection of specific micro-organisms. Althougla PCR has some shortcomings, such as the problems caused by contaminants and inhibitors or the lack of suitable sequences for designing specific primers, the outstanding research effort focused on tiffs technique, together with the remarkable development of molecular biology have minimized the deficiencies and allowed its increased general use as a diagnostic tool. Sensitive studies using reference strains of BVDV fi-om persistently infected carriers have shown that reverse transo-iption (RT)-PCR has greater sensitivity than other tests, including enzyme-linked immunosorbent assay (ELISA) (Horner el aL, 1995) ; unfortunately, cost currently makes this technique unsuitahle for large-scale testing but it should be valuahle as a coniirmatm T test in cases where ELISA resuhs are in the ''suspicious range'' or where the viral titre is low, such as in batches of foetal bovine serum. Comparison of polymerase chain reaction and virus isolation for detection of epizootic hemorrhagic disease in clinical samples from naturally infected deer
cord-293590-0xn6mqh6	2010	FINDINGS: The expression stability of five commonly used housekeeping genes [beta-actin (ACTB), elongation factor 1-alpha (EF1A), ubiquitin (UBQ), glyceraldehyd-3-phosphate dehydrogenase (GAPDH) and tubulin alpha (TUBA)] were monitored in salmonid cell lines CHSE-214 and RTS11 after infection with two of the most fastidious fish pathogens, the facultative bacterium Piscirickettsia salmonis and the aquabirnavirus IPNV (Infectious Pancreatic Necrosis Virus). CONCLUSION: Based on the data presented here with the cell culture models CHSE-214 and RTS11, we suggest the initial choice of UBQ, ACTB and EF1A as reference genes in qRT-PCR assays for studying the effect of P. Prior validation of the selected reference gene candidates (ACTB, EF1A, GAPDH, UBQ and TUBA), general expression levels based on mean qPCR threshold cycle (Ct) values in control CHSE-214 and RTS11 cells were determined, since extremely high or low expression levels might preclude their usefulness as internal controls ( Figure 3) .
cord-293629-1cno01un	2016	En este artículo se pretende hacer una revisión de las diversas técnicas de biología molecular aplicadas al diagnóstico de las infecciones respiratorias, centrándose fundamentalmente en la neumonía, y analizar el impacto que pueden tener en el manejo del paciente con infección respiratoria aguda. En este artículo se pretende hacer una revisión de las diversas técnicas de biología molecular aplicadas al diagnóstico de las infecciones respiratorias, centrándose fundamentalmente en la neumonía, y analizar el impacto que pueden tener en el manejo del paciente con infección respiratoria aguda. En los últimos años se han realizado estudios sobre el impacto de las técnicas moleculares en el manejo y pronóstico de pacientes con infecciones respiratorias, así como de coste-efectividad de su implantación en los laboratorios de microbiología clínica. Aplicación de los métodos moleculares al diagnóstico y el estudio epidemiológico de las infecciones respiratorias causadas por virus
cord-293849-p3j2keyo	2012	Eighty-four respiratory viruses identified by laboratory-developed real-time reverse transcription–PCR assays (LDA) or by viral cultures were mixed and tested by FilmArray to assess its performance. The cost of each reagent pouch was approximately 6-fold higher than the cost per sample of the reagents needed to perform the laboratory-developed multiplexed real-time RT-PCR assays for detection of 12 respiratory viruses. The sensitivity of the FilmArray Respiratory Panel assay was comparable to our LDA for detection of 12 respiratory viruses in clinical samples and in dilutions of positive control mixes. In the analysis of 34 positive mixed clinical specimens, the FilmArray had results similar to those in another study comparing FilmArray with real-time PCR assays, identifying 90% of the 80 viruses detected by our LDA (Pierce et al., 2012) . In other situations, use of multiplexed Table 4 Results of laboratory-developed real-time RT-PCR assays and FilmArray Respiratory Panel assay for dilutions of the influenza positive mix control.
cord-293966-5c466xvz	2019	Quickly after the identification of Middle East respiratory syndrome-CoV (MERS-CoV), both in vitro ligation and BAC-based reverse genetic technologies were engineered for MERS-CoV to study its basic biological properties, develop live-attenuated vaccines, and test antiviral drugs. Here, I will describe how lambda red recombination can be used with the MERS-CoV BAC to quickly and efficiently introduce virtually any type of genetic modification (point mutations, insertions, deletions) into the MERS-CoV genome and recover recombinant virus. In the method described here, this recognition site is engineered on a plasmid (pEP-KanS) just outside of the positive selection marker, and its cleavage with the I-SceI enzyme allows for the removal of the positive selection marker by intramolecular Red recombination utilizing sequence duplication introduced in the original PCR primers. Using 1 μL of the BAC DNA, use the external primers located 100-200 bp outside the region of homology you previously designed to test for the insertion of Kan r -I-SceI by PCR.
cord-294138-h7sfd1wa	2020	Both countries were involved in the United States Agency for International Development''s (USAID) Emerging Pandemic Threats PREDICT program, and surveillance of bats in wildlife markets in rural areas in Laos using family-level PCR assays revealed the presence of CoV RNA in 41 animals [5] . Considering the significant interactions of wildlife and especially rodents with humans in Laos, we were interested in investigating the presence of CoVs in these animals, which can be primary or intermediate hosts for CoVs with zoonotic potential. Since there are abundant contact opportunities for wildlife pathogens and humans in Laos, and considering that coronavirus-zoonotic events can involve intermediate hosts, as in the cases of SARS and MERS, we focused our screening on non-bat species potentially capable of playing that role. It is worth noting that we targeted rodents most likely to be in contact with humans and transmit virus and found fewer CoV-RNA-positive animals than in other studies of rodents in the region or elsewhere.
cord-294155-94skyx5f	2007	HBoV was detected in respiratory samples by PCR, but its aetiologic role in the pathogenesis of acute respiratory infectious diseases is still unclear. CONCLUSIONS: Detection of HboV, as the only microbial agent, in samples from children with wheezing and acute respiratory diseases supports the assumption that this emerging virus could have an aetiologic role in the pathogenesis of respiratory diseases. A new parvovirus, the human bocavirus (HBoV), has recently been discovered by the application of random PCR/cloning technique on respiratory samples (Allender et al., 2005) . In this report, we describe a case of pneumonia and severe wheezing associated with HBoV DNA in the pharyngeal swab sample from a child. The detection of HBoV in the nasopharyngeal swab in a child with a clinical picture of pneumonia supports the assumption that this virus has a causative role in respiratory diseases. Human bocavirus DNA detected by quantitative real-time PCR in two children hospitalized for lower respiratory tract infection
cord-294335-qnu19ru5	2020	We assessed symptoms reported by household contacts on the collection date of their first RT-PCRpositive NP specimen (Figure 1 , Subset A), and categorized symptoms as constitutional (fever, chills, myalgia, or fatigue), upper respiratory (runny nose, nasal congestion, or sore throat), lower respiratory (cough, difficulty breathing, shortness of breath, wheezing, or chest pain), neurologic (headache, loss of taste, or loss of smell), and gastrointestinal (nausea/vomiting, diarrhea, or abdominal pain). We identified and prospectively followed household contacts who were asymptomatic at the time they initially tested positive for SARS-CoV-2 by PCR ( Figure 1 , Subset B) to see if they developed symptoms during the study period. The symptom profiles and demographic characteristics of our cohort of SARS-CoV-2 RT-PCR positive household contacts differ from those described in inpatient populations [3] [4] [5] 12] .
cord-294454-uzfsv2df	2005	
cord-294546-0otd1heg	2019	CONCLUSION: Comprehensive molecular testing of NPS increases the number of pathogens detected compared with routine methods, but results are poorly predictive of the presence of pneumonia. showed in a randomized controlled trial (107 individuals with lower respiratory tract infections, mean age 65 years) that PCR for viruses and atypical bacteria in nasopharyngeal and oropharyngeal swabs (NPS) allowed the identification of additional pathogens but did not reduce antibiotic use or costs [7] . Individuals admitted to hospital for suspected pneumonia had NPS collected at inclusion for the detection of multiple bacterial and viral pathogens using multiplex PCR (comprehensive molecular testing), in addition to routine testing. Demographic data, co-morbidities, vital signs, clinical findings, severity scores, results of standard laboratory tests, blood, sputum and urine cultures, urinary antigen detection, PCR for respiratory viruses on NPS, and antimicrobial therapy administered were recorded prospectively.
cord-294798-ji3p0l4j	2018	
cord-294947-g4ntyddb	2016	title: Establishment of a nanoparticle-assisted RT-PCR assay to distinguish field strains and attenuated strains of porcine epidemic diarrhea virus In this study, a nanoparticle-assisted polymerase chain reaction (nanoparticle-assisted RT-PCR) assay targeting the ORF3 of PEDV was developed to distinguish PEDV field strains from attenuated strains by using a specific pair of primers. The nanoparticle-assisted RT-PCR assay we describe here can be used to distinguish field strains from vaccine strains of PEDV, and it shows promise for reducing economic loss due to PEDV infection. The results showed that the nanoparticle-assisted RT-PCR assay could distinguish PEDV field strains from the attenuated strain in samples from infected pigs. The present study demonstrated that an effective nanoparticle-assisted RT-PCR assay targeting the ORF3 gene of PEDV was able to distinguish field strains from attenuated vaccine strains. Development of a nanoparticle-assisted PCR assay for detection of porcine epidemic diarrhea virus
cord-295296-jtjx1vgd	2020	title: ''In-silico primer designing and PCR for detection of novel coronavirus-19 Novel corona virus (2019-nCoV or COVID-19) pandemic has been considered as a major public health emergency in the world of this century. Novel corona virus (2019-nCoV or COVID-19) pandemic has been considered as a major public health emergency in the world of this century. qRT-PCR primer and probe were designed within conserved region from whole genome, RNA dependent RNA polymerase (RdRP) and envelope to detect SARS-CoV2 from COVID-19 virus isolated from Wuhan, China (Gene bank No: NC_045512, MT072668.1and MT111896.1 respectively). All these sets of primers of COVID-19 were highly specific and any of the primer set either syber green based or Taqman probe based may be useful for commercial one step RT-PCR based kit development for the molecular diagnosis of COVID-19 viruses. The assay based on one step qRT-PCR detection will be sensitive, rapid and specific to detect COVID-19 viruses in mouth swab, nasal swab, 
cord-295401-3p6q92x4	2003	title: Quantitation of respiratory syncytial virus RNA in nasal aspirates of children by real-time RT-PCR assay RSV and GAPDH were quantified in nasal aspirates from 75 children hospitalised for acute respiratory tract disease: 31 (41.3%) were positive according to the immunofluorescence assay (IFA), 34 (45.3%) were culture-positive and 42 (56%) were positive according to our real-time RT-PCR method. RNA and DNA extracted from cell cultures infected with different respiratory viruses were screened by the real-time RT-PCR for RSV to assess the specificity of this assay. Of the 42 samples found to be positive by the real-time RT-PCR assay for RSV, six could not be quantitated as the number of RSV RNA copies contained was below the detection limit of the technique; two of these six samples were also culturepositive. The sensitivity of the real-time RT-PCR assay for RSV on clinical samples was 56%, which is significantly higher than the sensitivity of conventional techniques for the detection of RSV in nasal aspirates.
cord-295445-f4p00yaw	2018	Previous studies conducted in wastewater treatment plants have shown that ozone disinfection might be highly efficient in inactivating bacteria and bacteriophages after conventional sewage treatments (Kim et al., 1999; Tyrrell et al., 1995) , but knowledge regarding its effect for reducing human enteric viruses is relatively scarce. The four concentrated water samples (incoming sewage, conventionally treated, ozone treated, and outlet water) from each of the three weeks were also analyzed by qPCR for 14 common enteric viruses (adenovirus, astrovirus, hepatitis A virus, hepatitis E virus, norovirus GI, norovirus GII, norovirus GIV, parechovirus, sapovirus, aichivirus, mengovirus, torovirus, enterovirus, and rotavirus). However, in this study some viruses that were undetectable in the ozone-treated samples reoccurred in the outlet water, including parvovirus, norovirus GII, human feces pecovirus, parvovirus-like virus, gokushovirus, and HAdV-F41, although the amounts were significantly lower compared with raw sewage.
cord-296109-kco85lqn	2020	Furthermore, vulnerable populations such as those served by Boston Medical Center (BMC), the largest safety net hospital in New England, represent a high-risk group across multiple dimensions, including a higher prevalence of pre-existing conditions and substance use disorders, lower health maintenance, unstable housing, and a propensity for rapid community spread, highlighting the urgent need for expedient and reliable in-house testing. In the United States, significant delays in the rapid development and distribution of diagnostic testing for SARS-CoV-2 infection have prevented adequate COVID-19 patient care and public health management of the pandemic (Sharfstein et al., 2020) , impacting the timely mapping of the dynamics of viral spread in the general population, and more topically, the conservation of personal protective equipment. Subsequently, we implemented a quantitative, real-time reverse transcriptase polymerase chain reaction (qRT-PCR)-based assay to detect viral SARS-CoV-2 RNA from nasopharyngeal swabs, based on guidelines from the Centers for Disease Control and Prevention (CDC) and the FDA for use with in-house testing of BMC patient samples ( Figure 1 ) (CDC, 2020; Wang et al., 2020a).
cord-296197-ohfhnpma	2008	
cord-296309-i1mpov7k	2017	
cord-296364-7rp60d2m	2005	
cord-296392-2u9mz6d3	2020	title: Investigation of compatibility of severe acute respiratory syndrome coronavirus 2 reverse transcriptase-PCR kits containing different gene targets during coronavirus disease 2019 pandemic This value being higher than 0.73 coefficient obtained through comparison of RdRps of the two kits only, showed that inclusion of a secondary biomarker by Diagnovital improved the correlation of different kits. In this study, we investigated the compatibility between the two different SARS-CoV-2 PCR kits produced in Turkey during the COVID-19 pandemic. Nevertheless, the strong correlation of the two kit results suggested that two different RNA targeting gene assays were appropriate as suggested by WHO in the diagnosis of COVID-19 disease [20] . showed that similar results were found; the PCR kit with two different genes of the SARS-CoV-2 had a higher yield than the other two kits performing one gene analysis [21] .
cord-296593-ox6x53vj	2020	We investigated the relation between PCR examination rate among population and the success of containment of COVID-19. We investigated the relation between PCR examination rate among population and the success of containment of COVID-19. Close inspection of individual countries suggested that the social distancing is the largest factor to achieve containment, and the contribution of broad PCR tests is smaller. Close inspection of individual countries suggested that the social distancing is the largest factor to achieve containment, and the contribution of broad PCR tests is smaller. . https://doi.org/10.1101/2020.05.13.20100982 doi: medRxiv preprint Coronavirus disease 2019 (COVID-19) pandemic is now a worldwide peril and its control is an emergent issue. Trajectory analysis of new coronavirus COVID-19 cases and deaths by country No reuse allowed without permission.(which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
cord-296736-jsm6o5pq	2009	title: An Economical Tandem Multiplex Real-Time PCR Technique for the Detection of a Comprehensive Range of Respiratory Pathogens The aim of this study was to modify real-time PCR assays to facilitate the rapid screening of respiratory samples for a comprehensive range of viral and bacterial pathogens. This tandem multiplex real-time PCR assay, in combination with the semi-nested picornavirus and human metapneumovirus PCR assays, tests for 35 respiratory agents from a sample volume of 180µL compared to 720 µL required for the individual assays. Further work is planned to incorporate the picornavirus and human metapneumovirus assays into the tandem multiplex real-time PCR assay, but so far we have been unable to design or use published real-time PCR primers and probes that detect all types of these viruses with the same sensitivity as our nested assays. A tandem multiplex real-time assay is presented which detects a comprehensive range of respiratory pathogens from a specimen sample of 180µL. Multiplex real-time PCR assay for detection of Influenza and human respiratory syncytial viruses
cord-296819-gztmidn2	2013	title: Diagnosis of West Nile Virus Human Infections: Overview and Proposal of Diagnostic Protocols Considering the Results of External Quality Assessment Studies This paper reviews the presently available methods to achieve the laboratory diagnosis of West Nile virus infections in humans, discussing the most prominent advantages and disadvantages of each in light of the results obtained during four different External Quality Assessment studies carried out by the European Network for ''Imported'' Viral Diseases (ENIVD). For the routine detection of WNV RNA using molecular techniques there are two distinct diagnostic settings: the first involves blood and organ donation screening from subjects living in an area where WNV circulation is known to be occurring, and the second involves the identification of viral genomes in serum, plasma and CSF samples from patients presenting with a clinical picture typical of WNV infection [21] .
cord-296979-8r851j4t	2017	Eighteen healthy donors were randomly divided into six groups, and their sperm samples were used to fertilize zona-free hamster oocytes in vitro and assess the effects of the silencing of five target genes (CSH2, EIF4G2, PCBD2, PSG4 and TTN) and a control gene (ESRRG) on transcription of HBV s and x genes by real-time quantitative (q)RT-PCR. Eighteen healthy donors were randomly divided into six groups, and their sperm sample were used to fertilize zona-free hamster oocytes in vitro and assess the effects of the silencing of five target genes (CSH2, EIF4G2, PCBD2, PSG4 and TTN) and a control gene (ESRRG) on transcription of HBV S and X genes in two-cell embryos using real time qRT-PCR and 2 − CT method.
cord-297160-tqw9vx2b	2013	
cord-297396-r1p7xn3a	2020	OBJECTIVES: To develop:(1) two validated risk prediction models for COVID-19 positivity using readily available parameters in a general hospital setting; (2) nomograms and probabilities to allow clinical utilisation.  Developed two simple-to use nomograms for identifying COVID-19 positive patients  Probabilities are provided to allow healthcare leaders to decide suitable cut-offs  Variables are age, white cell count, chest x-ray appearances and contact history  Model variables are easily available in the general hospital setting. To develop: (1) two validated risk prediction models for COVID-19 positivity using readily available parameters in a general hospital setting; (2) nomograms and probabilities to allow clinical utilisation. Thus, a COVID-19 prediction model based on clinical, laboratory and radiological findings which presents the sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) would allow public healthcare systems to decide a suitable strategy on prioritizing tests when such RT-PCR availability is constrained.
cord-297432-2edncbgn	2020	A man in his fifties treated with chemoimmunotherapy for chronic lymphocytic leukemia experienced a 9-week course of COVID-19 with high fever and severe viral pneumonia. Recently, preliminary results of the Adaptive COVID-19 Treatment Trial (ACTT), a multicenter randomized controlled trial of remdesivir versus placebo for treatment of coronavirus disease 2019 (COVID-19) in hospitalized patients, demonstrated that remdesivir reduced time to recovery, in particular for those not yet having experienced respiratory failure with need for assisted ventilation [1] . We here report the clinical course and findings in an immunocompromised patient with remission of COVID-19 during treatment with remdesivir but relapse soon after discontinuation. We present a case of severe COVID-19 in a patient with B-and T-lymphocyte impairment secondary to CLL treated with chemoimmunotherapy 3 months prior to the SARS-CoV-2 infection. The course and findings in this clinical case suggest that remdesivir has a rapid onset of action and can suppress, but may not eradicate, SARS-CoV-2 in immunocompromised patients.
cord-297646-49l6k5h2	2017	title: Prevalence of intestinal parasites in companion dogs with diarrhea in Beijing, China, and genetic characteristics of Giardia and Cryptosporidium species In this study, we performed a survey of intestinal parasites in fecal specimens (n = 485) collected from outpatient pet dogs with diarrhea in Beijing, China, for the entire year of 2015 by microscopic examination (all parasites) and SSU rRNA-based nested PCR detection (Giardia and Cryptosporidium). Smears were examined microscopically for the presence of common parasites by observing eggs of helminthes (e.g., Toxocara canis [canine ascariasis] and Trichuris vulpis [canine whipworm]) and oocysts or trophozoites of protozoa (e.g., coccidia, Giardia duodenalis and trichomonads Tritrichomonas foetus/Pentatrichomonas hominis). We collected a total of 485 fecal specimens in year 2015 from outpatient dogs with diarrhea, in which 124 specimens were parasite-positive by wet mount microscopic examination and/ or PCR detection (i.e., an overall positive rate at 25.6%, n = 124) ( Table 1 , Fig. 1a ).
cord-298002-jvnwivrg	2020	CASE PRESENTATIONS: We present two cases of confirmed COVID-19 patients and characterize their initial symptoms, chest CT results, medication, and laboratory test results in detail (including RT-PCR, IgM/ IgG, cytokine and blood cell counts). CONCLUSION: Both of patients with confirmed COVID-19 pneumonia failed to produce either IgM or IgG even 40 to 50 days after their symptoms onset. During the outbreak of coronavirus 2019 (COVID-19) [1] [2] [3] , a small proportion of confirmed COVID-19 patients fail to produce IgM or IgG antibodies against SARS-CoV-2 even 40 days or longer periods of time after onset of their initial symptoms. From January 30 to March 15, 310 of COVID-19 patients who were positive for SARS-CoV-2 real time reverse-transcription PCR (RT-PCR) testing and received IgM and IgG detection at Wuhan Union Hospital (Wuhan, China) were enrolled. In this study, two patients with confirmed COVID-19 failed to produce either IgM or IgG even 40 to 50 days after their symptoms onset.
cord-298049-gabjdkx9	2017	OBJECTIVES: To investigate the detection rates of bovine coronavirus (BCoV) in feces of healthy and diarrheic calves and to describe the usefulness of a pancoronavirus reverse transcriptase (RT) PCR (PanCoV‐RT‐PCR) assay to identify BCoV in samples of diarrheic calves. The objectives of this study were to investigate the detection rates of BCoV in feces of healthy and diarrheic dairy calves and to describe the usefulness of a PanCoV-RT-PCR assay to identify BCoV in nasal and fecal samples of a group of calves from a dairy farm suffering an outbreak of diarrhea. The results of this study demonstrated a positive association between BCoV and diarrhea in dairy calves as detection rates of this agent were higher in diarrheic calves than in farm-, season-, aged-matched nondiarrheic calves.
cord-298051-ej8qxkce	2016	Cell lines can be infected with patient samples to allow viral replication within the cells; observable cytopathic effects can help to identify the identity of the virus. Infected cells can also be used for immunofluorescence assays, which use fluorescently labeled virus-specific antibodies to identify viruses in fixed cells or tissues. In the process of PCR, DNA (including any viral DNA present) is isolated from the clinical specimen, generally blood cells or tissue, and added to a tube containing primers, DNA polymerase, and nucleotides ( Fig. 7.14) . The diagnostic techniques described in this chapter identify the presence of a virus in a sample, or even the amount of viral nucleic acid, but these assays cannot determine the amount of virus present that is capable of productively infecting cells. Fluorescently labeled antibodies bind to viral antigens present in infected cells.
cord-298076-rujylmib	2010	
cord-298401-4szmu1dh	2017	
cord-298462-xpx3orvs	2007	A quantitative PCR method was established to quantify human bocavirus (HBoV) genomic copies in clinical specimens from children with lower respiratory tract infections (LRTI) in China. Recently, a reliable quantitative PCR (Q-PCR) method has been developed to detect HBoV genomic copies in clinical samples, and this has demonstrated a presence of HBoV DNA in children with pneumonia-like symptoms in Thailand [14] . In this study, we used a Q-PCR with the amplicon targeted to the NS coding region of HBoV to detect the presence of HBoV DNA in children with respiratory tract infection in China. All 7 positive samples were either sputum or aspirated sputum, indicating a significant presence of HBoV DNA in lower respiratory tract. HBoV (Human bocavirus); LTRI (Lower respiratory tract infection); Q-PCR (Quantitative polymerase chain reaction). Detection of human bocavirus in Japanese children with lower respiratory tract infections
cord-298600-cnolne6k	2020	Our aim was to determine the diagnostic accuracy in terms of sensitivity and specificity of CT chest in diagnosing and confirming COVID-19 infection in patients presenting with acute surgical and medical pathologies. Patients admitted for acute surgical emergencies were treated according to RCS guidelines and subjected to RT-PCR test and/or CT scan of the thorax. Patients admitted for acute surgical emergencies were treated according to RCS guidelines and subjected to RT-PCR test and/or CT scan of the thorax. CT imaging was found to have a high false positive rate making it an unreliable tool for a definitive diagnosis in the presence of concomitant respiratory pathologies, but with a strong negative predictive value at 82.4% makes it a useful tool for the exclusion of COVID-19 infection and can be helpful in surgical decision making for asymptomatic patients (Table 1 ).In our study, more than 70% of all acute surgical presentations which are normally treated surgically were treated conservatively with good outcome.
cord-298697-v1qdizwx	2020	One of the most common applications of MinION is for nanopore-based DNA barcoding in situ for species identification and discovery, yet the existing sample capability is limited (n ≤ 10). We also tested the performance of the newly released R10.3 nanopore flow cell for DNA barcoding, and showed that the barcodes generated were ~99.9% accurate when compared to Illumina references. For the field sequencing phase, an additional 31 samples were collected and subjected to QE-based DNA extraction on the BentoLab. While we did not run the gel check in situ to save time, a postliminary amplification check on agarose back at the laboratory revealed 20 observable gel bands. For the field sequencing phase, an additional 31 samples were collected and subjected to QE-based DNA extraction on the BentoLab. While we did not run the gel check in situ to save time, a postliminary amplification check on agarose back at the laboratory revealed 20 observable gel bands.
cord-298805-ntpm68cg	2018	Therefore, in order to overcome the limitations, many researchers have focused on the development of new immunological and molecular based rapid assays that could enable early diagnosis of infection and accurate identification of fungal pathogens causing superficial and invasive infection. Therefore, in order to overcome the limitations, many researchers have focused on the development of new immunological and molecular based rapid assays that could enable early diagnosis of infection and accurate identification of fungal pathogens causing superficial and invasive infection. As for the use of GM in diagnosis of invasive aspergilosis, recently published data suggest that detection of this Aspergillus Ag in blood and parallel PCR diagnostics provide very high sensitivity of 99% with specificity of 64% which influence 100% negative predictive value in high risk patients and enable the consideration of no-existing invasive aspergillosis in these patients and no need for antifungal therapy.
cord-298991-5qae0ege	2020	SARS-CoV-2 may use ocular structure as an additional transmission route, as demonstrated by the COVID-19 patients'' conjunctival secretion and tears positivity to reverse transcriptase-PCR SARS-CoV-2-RNA assay. This systematic review will firstly attempt to analyse the current knowledge on SARS-CoV-2 colonization of ocular and periocular tissues and secretions (i.e., cornea, conjunctiva, lacrimal sac, and tears), in order elucidate if conjunctival transmission occurs, and secondarily aims to propose a potential diagnostic tool in the evaluation of suspected, infected patients. Due to the scant evidence, both original articles, editorials, letters, and reviews providing evidence (i.e., prevalence, anecdotal report) about SARS-CoV-2 colonization of ocular and periocular tissues and secretions were all included in the study. This systematic review analysed 252 SARS-CoV-2infected patients globally who underwent conjunctival swab, and demonstrates the prevalence of ocular conjunctivitis complicating the course of COVID-19 to be as high as 32% (12 patients out 38) , differently as what Lu et al.
cord-298998-n5rhhzc9	2017	Using an early passage of the human CMV isolate Toledo, we first applied transformation-associated recombination (TAR) to clone 16 overlapping fragments covering the entire Toledo genome in Saccharomyces cerevisiae. Since next-generation sequence analysis revealed that the low-passage-number isolate represented a mixture of parental and fibroblast-adapted genomes, we selectively modified individual DNA fragments of fibroblast-adapted Toledo (Toledo-F) and again used TAR assembly to recreate parental Toledo (Toledo-P). IMPORTANCE The genomes of large DNA viruses, such as human cytomegalovirus (HCMV), are difficult to manipulate using current genetic tools, and at this time, it is not possible to obtain, molecular clones of CMV without extensive tissue culture. IMPORTANCE The genomes of large DNA viruses, such as human cytomegalovirus (HCMV), are difficult to manipulate using current genetic tools, and at this time, it is not possible to obtain, molecular clones of CMV without extensive tissue culture.
cord-299537-lbx1plqx	2010	METHODS: A 2-year surveillance program of children presenting with acute respiratory infections (ARIs) was carried out to characterize the viral etiology and to assess whether using gene amplification and sequencing could be a reliable approach to monitor virus introduction and spread in a population subgroup. RESULTS: Using multiplex RT-PCR, 15 different respiratory viruses were detected within the 486 nasopharyngeal positive samples collected among 817 children aged <9-year old who presented with ARI during October 2006 to September 2008. CONCLUSIONS: This study supports the usefulness of multiplex RT-PCR for virus detection and co-infection, and for implementation of a molecular monitoring system for endemic and epidemic viral respiratory infections. In the present 2-year study, we used a five-tube mRT-PCR assay we implemented in the Pasteur Institute network in the Asian region (http://www.pasteur-international.org/ip/easysite/ pasteur-international/activites-scientifiques/projets/tous-lesprojets/sisea), which covered 17 common respiratory viruses, 10 to identify viruses in nasopharyngeal specimens in 817 children with Table 1 Criteria of patient enrollment.
cord-299585-fkg8d6ym	2019	title: Development of a triplex real-time RT-PCR assay for detection and differentiation of three US genotypes of porcine hemagglutinating encephalomyelitis virus In the present study, we report the development of a triplex real-time RT-PCR assay for detection and differentiation of three PHEV genotypes, 1, 2, and 3. The triplex real-time RT-PCR provides a rapid and sensitive method to detect and differentiate all three US genotypes of PHEV from clinical samples. Porcine hemagglutinating encephalomyelitis virus (PHEV) is one of six known porcine coronaviruses (CoVs) causing diseases in pigs (Gong et al., 2017; Wang and Zhang, 2016) . The triplex rRT-PCR developed in the present study will fulfill this purpose and can be used to monitor PHEV of different genetic genotypes and differentiate between them. The detection limit of the triplex rRT-PCR assay was determined by testing 10-fold serially diluted positive PHEV RNAs (15SW1362 and 15SW25049) and plasmid DNAs (pCR 2.1-15SW1582-N, pCR 2.1-15SW1362-NS2, and pCR 2.1-15SW25049-NS2) in duplicate.
cord-299672-dq1y1gkc	2010	Conclusions Respiratory viral infections are commonly found in children with asthma exacerbation, with HRV being the most important pathogen in our patients. Our primary outcome was the difference in detection rate for any respiratory pathogen between children with asthma with acute exacerbation and controls (ie, stable asthma). Secondary outcomes consisted of differences in the clinical severity of asthma exacerbation, lung function parameters, and fractional exhaled nitric oxide concentration (FeNO) in relation to patients with different respiratory pathogens. HRV infection was associated with asthma exacerbation in the children, which is consistent with FeNO was the only parameter that differed between patients with and without HRV, being signifi cantly lower in the former group ( P 5 .018). Identifi cation of viral and atypical bacterial pathogens in children hospitalized with acute respiratory infections in Hong Kong by multiplex PCR assays
cord-299737-r34d0rx7	2020	The standard molecular diagnostic test is a multistep process involving viral RNA extraction and real-time quantitative reverse transcriptase PCR (qRT-PCR). We have developed a simplified qRT-PCR assay that removes the need for an RNA extraction process and can be run on a real-time thermal cycler. The standard molecular diagnostic test for this virus is a multistep process involving viral RNA extraction and real-time quantitative reverse transcriptase PCR (qRT-PCR). Using the same primers and probes, we have now developed a qRT-PCR that can be run on a real-time thermal cycler without the need for an RNA extraction process. Direct addition of samples to the qRT-PCR without extraction with a diagnostic sensitivity of 98.0%, specificity of 100% and accuracy of 98.8% compared to the method on the Panther Fusion. Many laboratories use real-time thermal cyclers, so this method can be used to increase national screening capacity without the need for other specialized equipment or RNA extraction reagents.
cord-299943-wzkh04dv	2020	
cord-299944-1e44usl6	2014	The major difference is that it begins with a consensus sequence containing degenerate bases and selects primers with fewer than 3 or 4 degenerate bases, so that in the end a majority of strains are amplified, 2 Advances in Bioinformatics Table 1 : Summary of average lengths, number of sequences, and percentage of conserved bases in a multiple sequence alignment (with MUSCLE [5] ), and number of tiled primers required for the short and long amplicon settings. The method here differs in that it takes the full multiple sequence alignment as input rather than a consensus, and it seeks to automatically design a minimal, degenerate set of multiplex compatible primers to amplify all the strains for a given region in a single reaction. The run tiled primers process can be summarized as follows: split a multiple sequence alignment into overlapping regions, and for each region design a degenerate multiplex set of primers that in combination amplify that region in all strains with as few primers as possible.
cord-300243-5q67tnx4	2017	The aim of the study was to identify the prevalence of common enteropathogens and the antibiotic sensitivity pattern in puppies reported with HGE. Fecal polymerase chain reaction (PCR) assay was employed to screen and compare the enteropathogens in puppies with hemorrhagic diarrhea and healthy control. The potential enteropathogenic bacteria associated with bacterial gastroenteritis in dogs include Clostridium difficile, Clostridium perfringens, Escherichia coli, Campylobacter jejuni, and Salmonella sp. Fecal samples collected from all the puppies during the study period were screened by polymerase chain reaction (PCR) for the common enteropathogens, including the bacteria, their toxins and viruses. The cpa (alpha toxin) and cpe (enterotoxin) genes corresponding to the Clostridium perfringens were tested to show amplification with a molecular length of 400 and 233 bp [14] . difficile toxin B, enteric CCoV and Rotavirus were found negative in 62 puppies with hemorrhagic diarrhea screened samples.
cord-300285-su2fueox	2020	title: Persistently positive severe acute respiratory syndrome coronavirus 2 (SARS‐COV2) nasopharyngeal PCR in a kidney transplant recipient Severe acute respiratory syndrome coronavirus 2 (SARS-COV2 ) infection is usually diagnosed by a positive PCR test in respiratory samples. While the respiratory PCR may remain positive for 2-3 weeks in the general population there have been occasional reports of persistent and recurrent positive SARS-COV2 PCR beyond 4 weeks despite clinical resolution 1-6 . This is particularly relevant in transplant recipients who carry a significant mortality and morbidity associated with SARS COV2 infection. 8 Here, we would like to share our experience of a Follow-up NP SARS COV2 PCR, however, remained intermittently positive for 57 days after the first positive test (Table 1) . Quantifying the prevalence of SARS-CoV-2 long-term shedding among non-hospitalized COVID-19 patients Case report: viral shedding for 60 days in a woman with COVID-19
cord-300313-w8njg569	2020	To mitigate SARS-CoV-2 transmission risks from international travellers, many countries currently use a combination of up to 14 days of self-quarantine on arrival and testing for active infection. Due to differences in COVID-19 prevalence and estimated travel volume in July 2020, the expected numbers of infectious entries per week in a no-intervention scenario (apart from self-reporting of symptoms and syndromic screening at departure) from the USA are approximately double that of the EU (up to 28 and up to 12, respectively). While the acceptable number of infected travellers entering the community will depend on the local context of SARS-CoV-2 transmission we find that for travellers arriving from low prevalence destinations the absolute risk of seeding new outbreaks is likely low and hence either testing and/or quarantine-based strategies may do little to further reduce such risk, particularly when many infectious arrivals are asymptomatic cases.
cord-300316-r54ksiy3	2016	authors: Moesker, F.M.; van Kampen, J.J.A.; Aron, G.; Schutten, M.; van de Vijver, D.A.M.C.; Koopmans, M.P.G.; Osterhaus, A.D.M.E.; Fraaij, P.L.A. title: Diagnostic performance of influenza viruses and RSV rapid antigen detection tests in children in tertiary care OBJECTIVES: Comparing diagnostic performances of BinaxNow Influenza AB(®) (BNI) and BinaxNow RSV(®) (BNR), to those of real-time reverse transcriptase PCR (RT-PCR), virus isolation and direct immunofluorescence (D-IF) in paediatric patients. Comparing diagnostic performances of two RADTs, BinaxNow Influenza AB ® (BNI) and BinaxNow RSV ® (BNR), with those of RT-PCR in samples of paediatric patients attending our tertiary care centre with ARTIs for a period of almost eight consecutive years. The main outcomes of this study were the sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) of the BNI and BNR rapid test results compared to RT-PCR during the total study period and during viral season (October 1st through March 31st).
cord-300338-duhyb754	2020	We therefore aimed to explore whether recent BCG vaccine coverage is associated with COVID-19 morbidity and/or mortality rates, using linear regression models to explore associations between the two continuous random variables adjusted for a variety of potential confounders, such as median age and body mass index (BMI) in individual countries through this ecological study. As a result, ''≥60 years of age'' (p < 0.001) and ''BCG vaccine coverage'' (p = 0.002) remained significant factors associated with COVID-19 mortality, even after adjustment for morbidity and PCR-tests. As a result, ''≥60 years of age'' (p < 0.001) and ''BCG vaccine coverage'' (p = 0.002) remained significant factors associated with COVID-19 mortality, even after adjustment for morbidity and PCR-tests.
cord-300399-21xozruq	2020	This review paper examines current molecular diagnostic tools (Fig. 1) , such as amplification-based (including CRISPR-Cas based), antibody and antigen tests, and sequencing, utilized for the detection of SARS-CoV-2. In addition, we also discuss sample preparation aspects that are relevant to wider utilization and point-of-care (POC) deployment of COVID-19 diagnostic tests (PCR, isothermal amplification, and sequencing-including library preparation). RT-PCR broadly involves four steps-lysis of SARS-CoV-2 in the sample, purification of the viral RNA, reverse transcription to complementary DNA (cDNA), and amplification of specific regions of the cDNA, and finally, optical detection of the amplified cDNA. The assay can detect the virus from respiratory swab samples with sensitivity comparable to that of the US Centers for Disease Control and Prevention (CDC) SARS-CoV-2 real-time RT-PCR assay in 30-40 min. Evaluation of novel antigen-based rapid detection test for the diagnosis of SARS-CoV-2 in respiratory samples
cord-300508-po2zolo8	2020	With the need to develop an approach to manage orthopaedic surgeries, we aimed to evaluate the most current data on all the surgical cases in our department including the results of the reverse-transcriptase polymerase chain reaction (RT-PCR) assay for infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). We also examined the results of PT-PCR for SARS-CoV-2, which was principally performed for all the surgical candidates in our department beginning May 13, and investigated their laboratory test results before surgery, their clinical signs and symptoms, which were reported to be related with COVID-19. evaluated 66 orthopaedic healthcare workers exposed to one patient who became positive for SARS-CoV-2 infection one week after admission, and reported that the RT-PCR assays were negative for all 66 healthcare workers, although 14 (21%) manifested clinical signs/symptoms suggestive of COVID-19, including cough (6.1%), sore throat (4.5%), nasal congestion (4.5%), dyspnoea (3.0%), fever (1.5%), headache, and myalgias (1.5%) [19] .
cord-300685-bcjnujlj	2003	The detection of live virus (4 ) and the detection of high copy numbers of viral sequence from NPA samples in the current study clearly support that the concept that cough and sneeze droplets from SARS patients are a major route of spread of this infectious agent. Interestingly, two of four available stool samples from the SARS patients in this study were positive in the assay (data not shown). RNA samples from this study were subjected to nested reverse transcription-PCR (4 ), and no evidence of metapneumovirus infection was detected in any of the patients in this study (data not shown), suggesting that the novel coronavirus is the key player in the pathogenesis of SARS. The PCR products from all 23 positive cases in this study had the same melting point, strongly suggesting that there was no viral sequence variation in the target region of samples collected at the two Hong Kong hospitals during the 1-month period of patient accrual.
cord-300999-20c17smt	2020	title: Exploration of turn-positive RT-PCR results and factors related to treatment outcome in COVID-19: A retrospective cohort study In the recurrent group, white blood cell, Neutrophils, prothrombin time, activated partial thromboplastin time, CD3, CD4, CD8, ratio of CD4/CD8, IgG and C4 complement were of significant difference among the baseline, negative and turn-positive time points. Due to a lack of specific antiviral treatments and vaccines, identifying and isolating as many potential patients as possible, especially for those with earlyonset of symptoms, is of great importance for the prevention and control of COVID-19 [2] , Real-time reverse-transcriptase polymerase-chain-reaction (RT-PCR) assay is a nucleic acid detection-based approach to detect severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which confer an advantage to rapid detection and specificity [3, 4] . As such, we attempt to review the details of 116 COVID-19 patients in Renmin Hospitals of Wuhan University and thus, perform cause analysis of RT-PCR turn-positive and the effective screening factors related to treatment outcome in COVID-19.
cord-301066-62qe4fb0	2005	In 2001 and 2002, we performed prospective clinical and virological studies of children (age, р18 years) with acute respiratory tract infection who were admitted to Queen Mary Hospital (Hong Kong, China). We studied a systematic sample of children (age, р18 years) with acute respiratory infection admitted to Queen Mary Hospital during the period from August 2001 to March 2002. One child with HCoV-NL63 upper respiratory tract infection had positive results of only the consensus primer PCR, so no viral load could be measured. We documented that human coronavirus infection was a significant cause of hospitalization for children aged р18 years, accounting for 4.4% of all admissions for acute respiratory infections. A previous study showed that 8.2% of children aged !18 months who were admitted to a Chicago, Illinois, hospital with lower respiratory tract diseases had serological evidence of HCoV-229E or HCoV-OC43 infection [13] .
cord-301102-jbjysyqm	2009	title: Quantification of mRNA encoding cytokines and chemokines and assessment of ciliary function in canine tracheal epithelium during infection with canine respiratory coronavirus (CRCoV) This study aimed to quantify pro-inflammatory cytokine mRNAs following infection of canine air-interface tracheal cultures with CRCoV. This study aimed to quantify pro-inflammatory cytokine mRNAs following infection of canine air-interface tracheal cultures with CRCoV. The quantification of canine IL-6, IL-8 and TNF-a mRNA copies in CRCoV-inoculated cultures was presented as the logarithm of the fold change relative to control-inoculated cultures in the same dog at the same time point. In response to LPS, mRNA levels of TNF-a, IL-6 and IL-8 in cultures, were significantly increased from 24 h post-inoculation, relative to controls, indicating that the assay was sensitive enough to detect changes in cytokine mRNAs within this system. IHC revealed coronavirus antigen positive intra-cytoplasmic staining of ciliated epithelial and goblet cells within canine tracheas of both CRCoV-inoculated cultures and from naturally infected cases of CIRD.
cord-301167-101lnq4f	2007	Methods: We developed a novel PCR assay, the microarray-in-a-tube system, which integrates multiple PCR processes and DNA microarrays for multiple virus detection. A 5 × 5 oligonucleotide microarray for detecting 4 respiratory tract viruses (severe acute respiratory syndrome–associated coronavirus, influenza A virus, influenza B virus, and enterovirus) with inner controls was arranged on the inner surface of a specially designed Eppendorf cap with a flat, optically transparent window. We aimed to develop a microarray-in-a-tube that integrates RT-PCR and a DNA microarray for detecting and distinguishing 4 viruses causing human acute respiratory tract infection, SARS coronavirus, influenza A and B viruses, and enterovirus. The system (Fig. 1 ) has 3 parts, which include an optically transparent plastic cap with an oligonucleotide microarray on the inner surface, a black inner vessel that contains hybridization solution, and the body of the Eppendorf tube.
cord-301254-093yih5n	2010	OBJECTIVES: The aim of the present study was to evaluate the diagnostic performance and clinical use of a novel multiplex PCR method in adults with community-acquired respiratory viral infection, and the impact of duration of symptoms on detection rates. CONCLUSIONS: Duration of symptoms significantly affects the detection rate of respiratory pathogens by multiplex real-time PCR in nasopharyngeal swab samples from adult patients with respiratory infections. The aim of the present study was to evaluate the diagnostic performance and clinical use of a novel multiplex PCR method in adults with community-acquired respiratory viral infection, and the impact of duration of symptoms on detection rates. All patients still positive for the same agent on follow-up had a higher Ct-value (corresponding to a lower Table 2 Follow-up (10 ± 2 days after initial visit) test result from analysis with real-time PCR of nasopharyngeal/throat swab specimens.
cord-301430-gzou8b9k	2004	In addition, earlier investigations demonstrated that contamination of the BLV antigen-producing cell culture systems by bovine viral diarrhea virus (BVDV) may give rise to misinterpretation of serological test results after BVDV vaccination of cattle. Investigations of a panel of well-characterised sera by agar gel immunodiffusion (AGID) and capture ELISA (cELISA) tests using antigen prepared from this new cell line in comparison with antigen of the well-known cell line FLK/BLV yielded comparable results. Standard and field sera were investigated in parallel with a commercially available test kit (Riemser Rinderleukose Test Kit, RTAM/Germany) in order to compare sensitivity and specificity of the antigens from the cell lines PO714 and FLK/BLV. Comparative investigations of sera from cattle infected with BLV of different provirus subtypes with antigen from both cell lines using the gp51 cELISA.
cord-301695-zl7cjs1k	2019	Though NGS had a longer turnaround time (24 hours), it worked well with different sample types (lung tissue, brain tissue and serum from deceased cases and plasma from a severe case) and was more sensitive than nanopore sequencing. The data generated by the Ion Torrent platform were aligned with the genomic database of Histoplasma, and specific reads were found in the serum and mixed brain and lung tissue from the deceased patients and in the plasma from the severe case ( Figure 5 ) [16] . In this case, NGS also identified specific fragments of Histoplasma in all tested samples (lung, brain and blood serum) from the deceased patients, which consolidated the identification of Histoplasma as the causative pathogen, indicating higher detection sensitivity by NGS than nanopore sequencing. We conclude that Histoplasma was the causative pathogen of this disease cluster based on epidemiologic, clinical, pathological and nucleic acid evidence.
cord-301720-majpfxqn	2017	
cord-301823-fbeb1nw1	2020	Here we describe our experience in establishing a COVID-19 diagnostics laboratory in an academic containment level 2 (CL2) research facility (UK) in which we validated and established a real-time PCR workflow to detect SARS-CoV2 in nose and throat swabs from HCWs. We developed an assay and workflow over eight working days (set-up to validation to screening) that can produce a quantitative diagnostic result ~4 hours after swabbing. Establishing and validating the workflow in our setting Establishing a workflow for SARS-Cov2 qRT-PCR Upon the decision to rapidly establish the qRT-PCR assay we identified several challenges, and these included: a) establishment and validation of a method suitable for diagnostic reporting, b) safe extraction of nucleic acid from a highly transmissible virus, c) accessing reagents required for performing extractions and amplifications, d) establishing a "clean" diagnostic workflow to minimise the risk of contamination, and e) creating a system in which HCWs could be swabbed and the data reported confidentially within a specified timeframe.
cord-302024-zz7mt6be	2004	
cord-302189-3xab3yxc	2007	Thereby, NASBA turned out to be the most sensitive method with a total number of 80 RSV positive samples out of a cohort of 251 nasopharyngeal washings from patients suffering from clinical symptoms, followed by the inhouse RT-PCR (62/251) and ELISA (52/251). Despite an increasing number of newly detected respiratory pathogen the human Respiratory syncytial virus (RSV) remains the single most prevalent etiologic agent in pediatric viral respiratory tract infection [1, 2, 3] . In relation to the positive test results obtained with the NucliSENSH EasyQ NASBA, the relative sensitivity of the RT-PCR was 77,5% compared to 65% obtained with the NOWH RSV ELISA. The results showed that from the three tested methods for molecular diagnosis of RSV the NucliSENSH EasyQ NASBA (bioMerieux, Nürtingen, Germany) detected the most RSV positive samples in a cohort of 251 nasopharyngeal samples of pediatric patients hospitalized with respiratory disease.
cord-302207-ljpfgih2	2019	title: Molecular characterization of Giardia intestinalis and Cryptosporidium parvum from calves with diarrhoea in Austria and evaluation of point-of-care tests Validation of two immunochromatographic point-of-care tests resulted in a sensitivity of 29.2% and 77.6%; a specificity of 98.4% and 91.1% for the detection of Giardia intestinalis and Cryptosporidium parvum, respectively. It was hypothesized that diarrhoeic calves from Austria harbour Giardia and Cryptosporidium genotypes/subtypes which have the potential to cause human infection, and that immunochromatographic point-of-care tests are valid methods for the detection of these parasites in calf faeces. This is in sharp contrast to a previous study on the possible causes of diarrhoea in calves from Austria which only detected 4.4-6.1% Giardia-and 11.7-25.6% Cryptosporidium-positive samples by sugar-flotation [19, 37] . In Southern Germany 101/110 Giardia intestinalis-positive faecal samples from calves were positive for genotype assemblage E, eight for A and one had a mixed infection with A and E [13] .
cord-302296-7ge92p69	2007	The selected clones were sequences showing similarity to the following genes: fatty acid binding protein (FABP, clone ID GH4A-F142), putative transmembrane 4 superfamily member protein (TM4, clone ID GH4A-F103), polypeptide N-acetylgalactosaminyltransferase (ppGaNTase, clone ID GH4A-F107), Aminopeptidase M (Alanyl aminopeptidase)(CD13)/Aminopeptidase N (APN, clone ID GH4A-F77), transcobalamin I precursor (TCI, clone ID GH4A-F84), Sec61-alpha (SEC61, clone ID GH4A-F137), F-box protein 44 (F-BOX, clone ID GH4A-F138), glutathione peroxidase (GPx, clone ID GH4A-F127), peroxiredoxin 4 (Prx4, clone ID GH4A-F167), cytochrome P450 3A40 (CYP3A40, clone ID GH4A-F166), ras-related nuclear protein (Ran, clone ID GH4A-F53), and 14-3-3B2 protein (14-3-3, clone ID GH4A-F159). Mean normalized calibrated ratios from real-time PCR of 12 clones, selected based on their similarity to genes involved in processes such as protein-and lipid metabolism, growth and antioxidant functions, showed that expression of 4 out of the 12 clones tested were significantly up regulated (P b 0.05) in intestine from cod fed SBM compared to intestines from cod fed FM.
cord-302459-grs2x26l	2018	In this study we profiled 372 cancer-associated miRNAs in plasma collected before (~60% patients) and after/during commencement of treatment (~40% patients), from age-matched prostate cancer patients and healthy controls, and observed elevated levels of 4 miRNAs miR-4289, miR-326, miR-152-3p and miR-98-5p, which were validated in an independent cohort. Analysis of published miRNA transcriptomic data from clinical samples in the TCGA dataset demonstrated low expression of miR-152-3p in tumour compared to adjacent non-malignant tissues (p = 0.001) (Wilcoxon test, p ≤ 0.05) (Fig. 4) Figure S3) . Similarly, other groups have assessed the diagnostic performance of plasma or serum miRNAs in patients with localised or metastatic prostate cancer, BPH and healthy controls, and in most instances the specificity and sensitivity of the miRNA biomarkers have outperformed the accuracy of the PSA test 23, 28, 29 .
cord-302486-z36hcvrx	2006	Viral and prion contamination of cell cultures and "feeder" cells, which is a common risk in all biotechnological products derived from the cell lines, is the most challenging and potentially serious outcome to address, due to the difficulty involved in virus and prion detection and the potential to cause serious disease in recipients of these cell products. The use of bovine fetal serum in stem cell cultures requires an urgent need for a risk assessment for Transmissible Spongiform Encephalopathies (TSEs) by means of a sensitive and specific test in all products derived from ruminants (U.S. Food and Drugs Administration, 1999; Directive 2004/C 24/ 03). This panel of tests should necessarily include reverse transcriptase detection as a general test for retroviruses, electron microscopy that can detect different kinds of viral particles and characterize many unknown isolates present in cell cultures and molecular techniques like PCR (conventional or real-time) and RT-PCR tests to include all the viruses that we know pose a risk to the product.
cord-302503-7s9f8wje	2020	In October 2010, a severe PED outbreak caused by a highly virulent PEDV variant emerged in southern China with high mortality ranging from 70 to 100%; the result was devastating damage to the pig farm industry and tremendous economic losses, and later, the PEDV variant spreads to other countries, e.g., USA, Canada, and Mexico ( For the early and rapid detection of PEDV, different types of PCR methods have been developed. A TaqMan probe-based real-time PCR to differentiate porcine epidemic diarrhea virus virulent strains from attenuated vaccine strains Development and evaluation of a duplex real-time RT-PCR for detection and differentiation of virulent and variant strains of porcine epidemic diarrhea viruses from the United States Development of a TaqMan-based real-time RT-PCR assay for the detection of SADS-CoV associated with severe diarrhea disease in pigs
cord-302713-h3aoag4y	2011	title: Clinical and Microbiological Evaluation of Travel‐Associated Respiratory Tract Infections in Travelers Returning From Countries Affected by Pandemic A(H1N1) 2009 Influenza BACKGROUND: Although acute respiratory tract infections (RTI) have been recognized as a significant cause of illness in returning travelers, few studies have specifically evaluated the etiologies of RTI in this population. Patients were included if they presented with signs suggestive of RTI that had occurred during travel or <7 days after their return from countries endemic for influenza virus A(H1N1) 2009. At the virology laboratory, the first step of the diagnostic evaluation was to identify influenza A(H1N1) 2009 virus infection by means of real-time reverse transcription-PCR (RT-PCR), as previously described 11 to assess whether or not the patient should remain isolated. In a study performed at San Francisco University Medical Center during the influenza season, a viral agent was identified (through shell vial assay and PCR) in 103 (39%) of the patients with RTI.
cord-302819-oj33i2ma	2014	On the SDPP sample that was tested, the following N gene rRT-PCR results were observed: C t of 35.84 for PBS supernatant after 10 000 g, C t of 36.74 for the PBS pellet after 10 000 g, C t of 38.83 for the PBS + Nonidet P-40 Comparison of S protein gene sequences obtained from bioassay piglets versus those of field cases. No significant difference was observed in the kinetics of N gene rRT-PCR positivity in animals that were inoculated with the three SDPP samples that were tested, suggesting that each contained infectious virus. Negative contrast staining electron microscopy of fecal samples collected at 4 dpi from the SDPP-inoculated piglets and the positive control group piglets showed the presence of virus-like particles consistent with coronavirus virions. Similar virus-like particles were also found in the content of the small intestine of a SDPP-inoculated piglet at 7 dpi and a positive control group contact piglet at 5 days post-contact.
cord-302829-1o1jo8uk	2008	
cord-302871-x3mjov5l	2016	This study presents the pathological, immunohistochemical, and molecular findings associated with the extra-intestinal detection of canine kobuvirus (CaKV) in a 5-month-old Chihuahua puppy, that had a clinical history of bloody-tinged feces. There are few descriptions of coinfection due to CaKV and other viral agents: a recent study identified CaKV in association with a several agents including canine herpesvirus type 1 (CaHV-1), canine distemper virus (CDV), canine parvovirus (CPV), and canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2) in diarrheic and non-diarrheic dogs from Korea [19] . Furthermore, widespread viral dissemination was demonstrated in multiple tissues as CaKV nucleic acids were detected in the liver, lung, brain, and tonsils of this Fig. 2 Phylogenetic analysis of a partial nucleotide sequence (nt 201) of the RdRp gene (a) and partial region of the VP1 protein (nt 303) of canine kobuvirus (CaKV) (b).
cord-303289-qoukiqr7	2017	We carried out RT‐PCR on 306 nasal and 315 rectal swabs and tested 243 sera for antibodies to detect coronavirus infections in apparently healthy horses in Saudi Arabia and Oman. RNA extracts were tested for evidence of conserved coronavirus nucleic acid genetic sequences using previously reported RT-PCR assays (Chu et al., 2014) , RTqPCR assay for MERS-CoV upE gene (Corman et al., 2012) , RTqPCR assay for ECoV (Miszczak et al., 2014) , and a RTqPCR assay for HKU23 reported below. T A B L E 5 Cross-neutralization titres (denoted as reciprocal titres) for Middle East respiratory coronavirus (MERS-CoV), bovine coronavirus (BCoV) and equine coronavirus (ECoV) in hyperimmune or naturally infected sera known to be positive for different coronaviruses NR460pig antiserum to porcine respiratory coronavirus 1,200 a <20 <20 <20 <20 Similarly, a BCoV immune serum from an experimentally infected gnotobiotic calf showed detectable, but 16-fold reduced antibody titre with ECoV but no cross-reaction with MERS-CoV.
cord-303588-bwllypvq	2020	MATERIALS AND METHODS: In this study, qRT-PCR was conducted on a partial fragment S1 gene followed by a high resolution melting curve analysis (qRT-PCR/HRM) on 23 IBV-positive samples in Jordan. Although the third cluster contained the highest number of samples, it displayed no similarity to any of the reference vaccine strains, and, after comparing them with the sequencing results, we found that the samples in the third cluster were similar to the variant II-like (IS-1494-06) IBV field strain. CONCLUSION: Our developed qRT-PCR/HRM curve analysis was able to detect and rapidly identify novel and vaccine-related IBV strains as confirmed by S1 gene nucleotide sequences, making it a rapid and cost-effective tool. High-resolution melting (HRM) curve analysis is a newly established PCR-based technique that has been used to differentiate related strains of the same animal or avian virus [16] [17] [18] [19] . Those 22 samples, along with the five IBV vaccine reference strains, were subjected to qRT-PCR targeting the S1 gene followed with HRM curve analysis.
cord-303665-l57e54hu	2020	Under these circumstances, the passive, but effective, method of sewage or wastewater monitoring can be used to trace and track the presence of SARS-CoV-2, through their genetic material RNA, and screen entire community. Since wastewater contains viruses that are repelled by everyone, regardless of their health, monitoring for viruses in wastewater and environmental waters that receive effluent from wastewater treatment plants (WWTPs) can determine the true prevalence and molecular epidemiology of gastroenteritis viruses and the risks to human health (Guan et al., 2020; Huang et al., 2020; Wang et al., 2020a) in a given geographical area rather than clinical research (Prevost et al., 2015; Kazama et al., 2017) . Therefore, the safety of drinking water and wastewater depends on the appropriate selection of the disinfectant dose and contact time in the treated environment, which are very important analytical techniques and methods that can detect viruses. Understanding how the virus breaks down in the aquatic environment is also critical to assessing risks to human health at present; the stability of the SARS-CoV-2 genome in wastewater is unclear.
cord-303697-oj05bstn	2018	
cord-303818-z3js3mr4	2015	title: Development and Evaluation of a SYBR Green–Based Real-Time Multiplex RT-PCR Assay for Simultaneous Detection and Serotyping of Dengue and Chikungunya Viruses In the present study, we aimed to develop and evaluate a SYBR Green Iebased multiplex real-time RT-PCR assay to detect, differentiate, and quantify DENV and CHIKV and simultaneously to serotype DENV based on Tm analysis of the PCR amplicon. A set of 22 serum samples from CHIKV-infected patients and 30 from uninfected individuals were collected at the National University Hospital, Singapore, with informed consent, to evaluate the clinical sensitivity and specificity of the real-time RT-PCR assay. To our knowledge, this is the first SYBR Green Iebased real-time RT-PCR assay reported that is able to detect, quantify, differentiate, and serotype DENV and CHIKV simultaneously. Establishment of one-step SYBR green-based real time-PCR assay for rapid detection and quantification of chikungunya virus infection Development of group-and serotype-specific one-step SYBR green I-based real-time reverse transcription-PCR assay for dengue virus
cord-303978-z3888e3g	2015	
cord-303986-9g24xg9x	2020	
cord-304044-i1ikf96b	2007	Here, we described specific silencing of five white spot syndrome virus (WSSV) genes in Litopenaeus vannamei in vivo with sequence-specific siRNAs. These genes included DNA polymerase (dnapol), ribonucleotide reductase small subunit (rr2), thymidine kinase and thymidylate kinase (tk-tmk), vp24 and vp28. control for interference action of siRNAs. Delivery of the selected sequence-specific siRNAs resulted in increase of survival rate of shrimp infected by WSSV, as compared to the virus injected controls (Fig. 1) . To examine if treatment of specific and mutant siRNAs resulted in a reduced expression level of the selected WSSV genes in shrimp in vivo, semiquantitative and highly sensitive RT-PCR analyses were used to compare the relative silencing effects. The results showed that sequence-specific siRNAs significantly inhibited replication of WSSV relative to that of positive controls and the mutant siRNA injected group at 24 h during experiment (Fig. 3) . Our data strongly indicated that sequence-specific siRNAs significantly inhibited expression of target genes and viral replication to protect shrimp from WSSV.
cord-304058-i8cywew0	2009	title: Reverse genetic characterization of the natural genomic deletion in SARS-Coronavirus strain Frankfurt-1 open reading frame 7b reveals an attenuating function of the 7b protein in-vitro and in-vivo To study the role of ORF 7b in the context of virus replication, we cloned a full genome cDNA copy of Frankfurt-1 in a bacterial artificial chromosome downstream of a T7 RNA polymerase promoter. In the context of viral host switching, it is interesting that several SARS-CoV proteins encoded on subgenomic (sg) RNAs seem to be dispensable for virus replication in cultured cells of primate or rodent origin, as well as in rodent models [17] [18] [19] . Both BACs were sequenced, confirming presence of all marker mutations and absence of any further mutations (refer to Influence on apoptosis and type I interferon induction by overexpression of ORF 7a, ORF 7b, and ORF 7b with the Frankfurt-1-specific deletion Interferon beta promoter-specific reporter gene expression (y-axis), shown as the factor of induction as compared to the mock-transfected, non-superinfected control (see below).
cord-304457-8g36h1bz	2020	
cord-304610-6o3hydg6	2020	
cord-304656-v0fyb161	2020	
cord-304720-0lgup7yj	2014	The industry significance, etiology, epidemiology, pathogenesis, clinical signs, postmortem and histpathologic lesions, diagnostic testing, and generic treatment, control, and prevention are described. Important history to understand from caretakers includes: age of pigs affected, duration of clinical signs, morbidity rate, mortality rate, treatments administered, response to treatments, and any other important information regarding previous diagnoses or disease in the affected group of animals. Records include but are not limited to: where the animals originated from; number in the herd; age; daily mortality; number treated; name of treatment, route of delivery and dose; feed and water usage; high-low temperatures; and vaccinations received or administered. Postweaning infections result in a high morbidity but low mortality; most significant economic losses at this time are caused by reduced average daily gain, market weights, and overall system efficiency. Postweaning infections result in a high morbidity but low mortality; most significant economic losses at this time are caused by reduced average daily gain, market weights, and overall system efficiency.
cord-304913-qb9zeazk	2009	RESULTS: A subtractive bean cDNA library composed of 10,581 unisequences was constructed and enriched in sequences regulated by either bean rust race 41, a virulent strain, or race 49, an avirulent strain on cultivar Early Gallatin carrying the resistance gene Ur-4. Plant gene expression was similar for both race 41 and 49 during the first 48 hours of the infection process but varied significantly at the later time points (72–96 hours after inoculation) mainly due to the presence of the Avr4 gene in the race 49 leading to a hypersensitive response in the bean plants. The stability of the expression level of the 3 remaining genes, TC127, cons6 and cons7 was evaluated by qRT-PCR on cDNAs from bean uninfected or infected with bean rust race 41 or 49 at 6, 12, 24, 48, 72, and 96 hours after inoculation (HAI).
cord-305008-8gl9d79i	2020	
cord-305025-pqye1ebh	2020	The rapid outbreak of coronavirus disease 2019 (COVID-19) around the world is a tragic and shocking event that demonstrates the unpreparedness of humans to develop quick diagnostic platforms for novel infectious diseases. In conclusion, it can be deduced that as rapid COVID-19 detection infection can play a vital role in disease control and treatment, this review may be of great help for controlling the COVID-19 outbreak by providing some necessary information for the development of portable, accurate, selectable and simple nanobiosensors. Detection of severe acute respiratory syndrome (SARS) coronavirus nucleocapsid 637 protein in human serum using a localized surface plasmon coupled fluorescence fiber-optic 638 RNA as a control for multiplex real-time reverse transcription-PCR detection of influenza 790 virus and severe acute respiratory syndrome coronavirus Development and evaluation of a novel loop-mediated isothermal amplification 829 method for rapid detection of severe acute respiratory syndrome coronavirus Rapid COVID-19 detection causative virus (SARS-CoV-2) in human 933 nasopharyngeal swab specimens using field-effect transistor-based biosensor
cord-305059-8z54lw2d	2021	If any one of the following pathogenic or serological tests is positive, the patient is confirmed as COVID-19: (1) positive RT-PCR results for SARS-CoV-2 nucleic acid; (2) viral gene sequencing highly homologous to the known SARS-CoV-2; or (3) serum samples positive for SARS-CoV-2-specific IgM and IgG antibodies. The fifth edition of the program was specially designed for Hubei to establish the diagnostic criteria of "clinical diagnosis cases," which include clinical compliance with the characteristics of viral pneumonia, such as corresponding clinical symptoms and imaging CT findings, especially the multiple lobes exudative ground-glass shadow and intermittent consolidation, normal or decreased total count of white blood cells in laboratory examination, and reduced lymphocyte count. The methods are: (1) real-time fluorescence RT-PCR detection of SARS-CoV-2 nucleic acid positive and (2) viral gene sequencing, highly homologous with the known novel coronavirus.
cord-305336-wxiazglk	2014	In the present study, we showed that a plant-pathogenic RNA virus, tobacco ringspot virus (TRSV), could replicate and produce virions in honeybees, Apis mellifera, resulting in infections that were found throughout the entire body. While intracellular life cycle, species-level genetic variation, and pathogenesis of the virus in honeybee hosts remain to be determined, the increasing prevalence of TRSV in conjunction with other bee viruses from spring toward winter in infected colonies was associated with gradual decline of host populations and winter colony collapse, suggesting the negative impact of the virus on colony survival. Conventional RT-PCR was performed on RNA samples extracted from adult bees, Varroa mites, different tissues, and bee bread collected from the same colony for the presence and distribution of TRSV.
cord-305399-98sqovwb	2019	A simple and accurate reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay was developed and evaluated for the detection of porcine pegivirus (PPgV). The results indicated that RT-LAMP assay developed in this study could be a highly specific, sensitive, and cost-effective alternative for a rapid detection of PPgV in field settings. The final volume of 25 μl reaction mixtures for RT-LAMP was prepared, which contained 1 μl of Bst DNA polymerase (NEB, USA) (8000 U/ml), 2.5 μl of 10 × Isothermal Amplification Buffer, 5 μl of Betaine (5 M), 1 μl of MgSO 4 (100 mM), 5 μl of dNTP (2.5 mM), 2 μl of each inner primers FIP and BIP (10 μmol), 0.25 μl of each outer primers F3 and B3 (10 μmol), 0.25 μl of each loop primers LF and LB (10 μmol), 1.25 μl of AMV reverse transcriptase (TaKaRa, China) (40 U/μl), 2 μl of RNA template, and the sterile distilled water was set as a negative control template.
cord-305462-2wz1f6k6	2004	OBJECTIVES: The purpose of the present study was to apply reverse transcription-PCR (RT-PCR) assays to clinical specimens collected from patients with acute respiratory illness and chronic obstructive pulmonary disease (COPD). METHODS: One hundred and ninety-four samples from two different study cohorts were analysed using RT-PCR assays for picornaviruses, coronaviruses 229E and OC43, influenza A and B viruses, respiratory syncytial virus, parainfluenza types 1–3 viruses, and human metapneumovirus and a PCR assay for adenoviruses. 11 The number of respiratory viral infections identified in asthmatic patients with acute exacerbations of disease increase significantly when RT-PCR assays are used in addition to other diagnostic methods. 3 In order to extend our understanding of the prevalence of respiratory viral infection in acute respiratory illnesses in patients with COPD, we used RT-PCR assays to evaluate samples from the previous two prospective studies for evidence of respiratory virus infection.
cord-305473-w30hsr4m	2017	
cord-305475-lhi0hcki	2012	We studied 878 stool specimens from children with acute gastroenteritis and 112 controls (43 children with unspecified fever, 33 with respiratory tract infection and 36 healthy children) for known HBoVs. The same specimens were previously studied for rotaviruses, noroviruses, sapoviruses, adenoviruses, coronaviruses and aichivirus. As in the case of the respiratory tract, simultaneous presence of HBoV1 with other, previously established gastroenteritis viruses is common in faecal specimens (10, 12, 13) , and no clear connection between HBoV1 and AGE of children has been established (11, 13, 14) . We did a thorough work-up of most of the established gastroenteritis viruses including rotaviruses, noroviruses, sapoviruses, enteric adenoviruses, coronaviruses and aichivirus (astroviruses or bacterial pathogens were not studied) and found co-infections in 81.2% of all bocavirus-positive AGE cases. Human bocavirus in children hospitalized for acute gastroenteritis: a case-control study
cord-305657-ayqxesiv	2020	Out of concern over the use of CT and associated radiation doses to patients with suspected or known COVID-19 infection, the International Atomic Energy Agency (IAEA) organized a survey and a webinar to discuss CT practice and protocol optimization for COVID-19 pneumonia on April 9, 2020. When these assays have limited availability, diagnostic imaging (chest radiographs or CT) can be used in patients with at least moderate to severe clinical features supportive of COVID-19 pneumonia. Although there are no specific publications or guidance on this matter, in pregnant patients with suspected complications or worsening respiratory status, a chest CT may be indicated and, when necessary, performed with single-phase, non-contrast, lowdose CT protocol. Most national and international organizations recommend against routine use of diagnostic imaging for the diagnosis of COVID-19 pneumonia unless there is a lack of availability or access to RT-PCR or immunoassays in patients with moderate to severe disease, worsening respiratory status, or a suspicion of cardiopulmonary complications.
cord-305694-qzf425lw	2018	CONCLUSIONS: The results obtained in this study suggest the implementation of antimicrobial susceptibility surveillance programs to assess the prevalence of metronidazole resistance in dogs; molecular studies to elucidate C. difficile in canine enteric disease is still unclear due to the presence of toxigenic strains or their toxins in asymptomatic animals and the failure to reproduce CDI in healthy dogs with and without antibiotic treatment [9, 10] . difficile, molecular characterisation of the strains obtained (i.e. tpi housekeeping and toxin genes detection by PCR, identification of non-toxigenic strains, and PCR-ribotyping) and antimicrobial susceptibility testing was performed as described elsewhere [21] . Since the ribotypes found in dogs are also commonly found in humans, it is possible Fig. 2 Metronidazole susceptibility test of Clostridium difficile D24 strain after 48 h of incubation. Antibiotic resistance patterns and PCR-ribotyping of Clostridium difficile strains isolated from swine and dogs in Italy
cord-305872-66vij492	2013	To test this concept, artificial positive controls (APCs) for use in PCR were synthesized to contain primer sequences targeting four viruses (Barley yellow dwarf virus, Soilborne wheat mosaic virus, Triticum mosaic virus and Wheat streak mosaic virus) pathogenic to wheat and, as internal control, the plant mitochondrial nad5 gene. Plasmid construct-based synthetic controls harboring a custom and de novo designed insert can enhance technologies such as polymerase chain reaction (PCR) to improve biosafety, speed of processing and overall detection without compromising sensitivity and specificity. The Plot ΔG or energy dot plot contains the Table 1 Primers used for designing the APC synthetic inserts, performing PCR of the targets within APCs, and RT-PCR of in vivo reference positive controls a . PCR products from APCs may differ in size from those generated by traditionally-used positive controls (Fig. 2) due to the discrepancy in the lengths between the annealing sites of the target sequences in vivo and the arrangement of primer sequences in the APC template (Table 1) .
cord-306135-pt4jsr6d	2016	Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR) and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. This thermos thermal cycler (TTC) uses a very simple design that performs PCR amplification based on the "archaic" method of hand-transferring reaction tubes through a series of water baths, minimizing the temperature ramping time needed for PCR tubes to reach thermal equilibrium (Fig 1) . The TTC RT-PCR was performed using protocols similar to the HIV test, with PCR tubes transferred between three thermoses (reverse transcription, denaturation, and annealing/extension) and an optional room-temperature water bath. The gel photo in Fig 3 shows that the TTC can produce multiplexed amplicons with the correct sizes and that the yield is similar to a three-step reaction performed in the commercial cycler with same number of PCR cycles.
cord-306175-p5rtp31m	2006	
cord-306278-c4q4la5c	2016	To evaluate the predominant human adenovirus (HAdV) species and types associated with pediatric respiratory infections, nasopharyngeal swabs were collected from otherwise healthy children attending an emergency room in Milan, Italy, due to a respiratory tract infection from January 1 to February 28 of two subsequent years, 2013 and 2014. To evaluate the circulation of the different HAdV types and the possible relationship between viral load, viral genetic characteristics, and the severity of infection, nasopharyngeal swabs were collected from otherwise healthy children consecutively attending the Emergency Room of the Fondazione IRCCS Ca'' Granda Ospedale Maggiore Policlinico, University of Milan, Italy, due to a respiratory tract infection. However, further studies are needed to identify the potential pathogenetic role of the different species and types of HAdV and the importance of viral load in the severity of infection.
cord-306396-wci56l0c	2014	BACKGROUND: We evaluated the analytical and clinical performances of the SD BIOLINE Rota/Adeno Rapid kit (SD Rota/Adeno Rapid; Standard Diagnostics, Inc., Korea), an immunochromatographic assay (ICA), for the simultaneous detection of rotaviruses and adenoviruses in human stool samples. METHODS: We tested 400 clinical stool samples from patients with acute gastroenteritis and compared the ICA results with the results obtained by using ELISA, enzyme-linked fluorescent assays (ELFA), PCR, and multiplex reverse transcription-PCR (mRT-PCR). In this study, we evaluated the analytical and clinical performance of this ICA for the detection of rotaviruses and adenoviruses and compared the results with those of other tests, including ELISA, enzyme-linked fluorescent assays (ELFA), real-time PCR, and multiplex reverse transcription-PCR (mRT-PCR) assays. The SD Rota/Adeno Rapid test is a one-step lateral flow ICA that simultaneously detects group A rotavirus and adenovirus in stool samples.
cord-306502-jkqg1qal	2014	
cord-306605-mnafslqw	2008	Objective To investigate the role of fetal viral infection in the development of a range of adverse pregnancy outcomes (APOs), including pregnancy‐induced hypertensive disorders (PIHD), antepartum haemorrhage (APH), birthweight <10th percentile (small for gestational age, SGA) and preterm birth (PTB). Main outcome measure Odds ratios and 95% CIs for specific APOs. Results For both term and PTBs, the risk of developing PIHD was increased in the presence of DNA from Herpes PCR group B viruses (OR 3.57, 95% CI 1.10–11.70), CMV (OR 3.89, 95% CI 1.67–9.06), any herpesvirus (OR 5.70, 95% CI 1.85–17.57) and any virus (OR 5.17, 95% CI 1.68–15.94). 2, 3 It has been postulated that fetal viral infection in utero may increase the risk of adverse pregnancy outcomes (APOs), such as pregnancy-induced hypertensive disorders (PIHD), birthweight <10th percentile (small for gestational age, SGA) and preterm birth (PTB). This study investigated the role of fetal exposure to viral infection (detected through the presence of viral nucleic acids in newborn screening cards) in APOs, including SGA, PIHD, antepartum haemorrhage (APH) and PTB.
cord-306656-cbtf2y2f	2018	
cord-306682-01q775up	2004	In this study we examined whether polymorphisms could be detected in the HCoV-229E binding domain of APN in a Caucasian population of 100 unrelated, healthy individuals, assuming that these mutations could be of importance in HCoV-229E attachment to human cells. A total of 100 healthy unrelated Belgian individuals were screened for polymorphisms in the human aminopeptidase N domain that is essential for its HCoV-229E receptor activity. All individuals were heterozygous for these polymorphisms, which have no apparent functional consequence, as they are located in a non-coding intron region of the APN gene. In our search for polymorphisms in the APN domain that is essential for its HCoV-229E receptor function, we identified seven polymorphisms, of which four were located in the non-coding intron 3. Three polymorphisms in APN exon 4 (C956T, G978T and G987A) in association with an intron 3 variation (C389T), were identified at a relatively high allele frequency (8.5%) in our Belgian population.
cord-306780-9xelf8oh	2016	However, comparatively few wildlife epidemiological studies use quantitative PCR (qPCR) for pathogen detection, even fewer employ an internal control, to ensure confidence in negative results, and PCR''s ability to multiplex and therefore detect several targets in a single reaction is underutilised. Tests on infected squirrel tissue demonstrate that simple swab samples (particularly from distal antebrachial skin) are sufficient to detect and identify the relative quantity of SQPV DNA in both squirrel species, while rectal swabs and blood cell pellets can be used to reliably indicate SADV infection. As grey squirrels appear asymptomatic, lower infection loads are recorded, and thus it is essential to use the more sensitive qPCR assays when screening for SQPV presence as part of a wildlife disease management programme for red squirrels.
cord-306829-88nihy7q	2010	Infection with FCoV can result in a diverse range of signs from clinically inapparent infections to a highly fatal disease called feline infectious peritonitis (FIP). The currently available serological tests have low specificity and sensitivity for detection of active infection and cross-react with FCoV strains of low pathogenicity, the feline enteric coronaviruses (FECV). Therefore, a quantitative real-time RT-PCR assay that could determine the amount of viral mRNA in blood may be able to better differentiate FCoV-positive healthy cats from FIP cases. Detection of feline coronaviruses by culture and reverse transcriptase-polymerase chain reaction of blood samples from healthy cats and cats with clinical feline infectious peritonitis Protein electrophoresis on effusions from cats as a diagnostic test for feline infectious peritonitis Detection of feline coronavirus RNA in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase PCR Detection of feline coronavirus RNA in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase PCR
cord-307068-360qs3ov	2007	A new method was developed for detection of human papillomavirus (HPV) by loop‐mediated isothermal amplification (LAMP), which was compared with the polymerase chain reaction (PCR), and real‐time PCR for specificity and sensitivity. In order to evaluate the reliability of HPV type‐specific LAMP detecting HPV DNA from clinical samples, tissue specimens were obtained from 27 patients with external genital polypoid lesions. In this study, a LAMP-based HPV typespecific DNA amplification method was developed and were compared its specificity and sensitivity with PCR and real-time PCR. Type-specific real-time PCR was used to measure the quantity of the DNAs of HPV-6, -11, -16, and -18 in each sample. The sensitivity of HPV-6, -11, -16, and -18 type-specific LAMP determined by turbidity assay were 1,000 copies/tube (Fig. 3) . The sensitivity of amplification of LAMP for detection of viral DNA was nearly the same as that of real-time PCR.
cord-307070-tqxvu3pu	2020	However, improvement was observed in the clinical condition of the patients who were managed as per COVID-19 protocol based upon the clinical signs and symptoms after correlating with diagnostic chest imaging studies. The infectious disease team advised testing with COVID-19 serology (immunoglobulin (Ig) M and IgG antibodies through lateral flow assay), the results of which were positive, indicating recent infection. The infectious disease team was consulted and based upon his clinical presentation and previous investigations, the patient was maintained on the local management protocol for COVID-19 infection. Moreover, biomarkers such as CRP, ferritin, lymphocyte counts, lactate dehydrogenase, and N-terminal pro b-type natriuretic peptide, along with radiological findings in CXR or features such as unilateral or bilateral pneumonia, ground-glass opacities, or consolidations in a chest CT scan, can suggest COVID-19 infection even in such patients where RT-PCR alone is negative [4] .
cord-307261-0a3iztns	2012	title: Comparison of two broadly multiplexed PCR systems for viral detection in clinical respiratory tract specimens from immunocompromised children Samples were de-identified and assayed in parallel using two different, broadly multiplexed PCR systems: ResPlex™ II Panel v2.0 (ResPlex), Qiagen, Hilden, Germany and FilmArray(®) Respiratory Panel (FilmArray), Idaho Technology Inc., Salt Lake City, UT. Two broadly multiplexed PCR systems were compared to each other and to a panel of laboratory developed tests for the detection of respiratory viral pathogens in clinical respiratory tract specimens from pediatric immunocompromised children. FilmArray detected viral targets: adenovirus, bocavirus, coronavirus 229E, HKU1, NL63, OC43, enterovirus, hMPV, human rhinovirus, influenza virus types A and B, parainfluenza viruses 1, 2, 3 and 4, and RSV. The current study, to our knowledge, is the first reported that compares the FilmArray with the ResPlex II v2.0 for the direct detection of viral agents in clinical respiratory tract specimens from immunocompromised children.
cord-307338-4nta9b6w	2010	Fifteen of these specimens (six swabs and nine tissues) were shown to be Avian influenza viruses, with highly pathogenic (HP) H5 and H7 isolates indicated positive for H1N1v by non-RRT PCR approaches (Table 3) , i.e. amplification of RNA extracted from the clinical specimen by conventional RT PCR using primers that had been designed specifically for the HA gene of current H1N1v isolates, available at: http://www.who.int/csr/resources/publications/swineflu/GenomePrimers_20090512.pdf Amplicons were electrophoresed in 2% agarose and stained with RedSafeÔ (iNtRON Biotechnology, Kyungki-Do, Korea) for visualisation, excised and purified from agarose using the QIAquick Ò Gel Extraction Kit (Qiagen, Crawley, UK). These test results with archived tissue specimens obtained from the field reinforced the observation that the ''''perfect match'''' M gene RRT PCR is the most sensitive for detecting contemporary European and UK SIVs. All 31 archived UK tissue samples from SIV-positive pigs were negative by the ''''H1-118'''' RRT PCR assay (Table 2) .
cord-307602-2cmgu7rf	2007	BACKGROUND: Human rhinoviruses (HRVs) are some of the earliest identified and most commonly detected viruses associated with acute respiratory tract infections (ARTIs) and yet the molecular epidemiology and genomic variation of individual serotypes remains undefined. RESULTS: Phylogenetic studies of complete coding sequences defined HRV-QPM as a novel member the genus Rhinovirus residing within the previously described HRV-A2 sub-lineage. CONCLUSIONS: We present the molecular characterisation and preliminary clinical impact of a newly identified HRV along with sequences representing additional new HRVs. Acute respiratory tract infections (ARTIs) are a leading cause of human morbidity worldwide and are most frequently viral in origin. We further investigated one of these putative viruses and herein present the complete polyprotein coding sequence of a novel HRV, HRV-QPM, which was first detected in an infant with bronchiolitis.
cord-307702-n74wvika	2020	METHODS: We performed a retrospective assessment of laboratory test order and specimen container utilization at a single, urban tertiary care medical center. We performed a retrospective assessment of laboratory test order and specimen container utilization at a single, urban tertiary care medical center. Total testing volumes were calculated during the first and last two-weeks of the observation period and used as reference points to examine the absolute and relative differences in test order volume between the pre-pandemic and COVID-19 surge periods. Total testing volumes were calculated during the first and last two-weeks of the observation period and used as reference points to examine the absolute and relative differences in test order volume between the pre-pandemic and COVID-19 surge periods. While volume increases were seen for laboratory tests related to COVID-19 diagnostics and management, including some with limited evidence to support their use, overall testing volumes decreased substantially.
cord-307758-a4sgt66g	2004	Community studies have shown that ∼30% of patients with acute respiratory tract symptoms have no identifiable infective aetiology. The purpose of this study was to determine the infective aetiology in patients who presented to primary care doctors with acute respiratory symptoms. Data collection was through interview using structured questionnaire, physical examination, throat swabs for bacterial culture and nasal swabs for virus identification by immunofluorescence (IF) and polymerase chain reaction (PCR). The main objective of our study was therefore to determine the aetiological cause in patients who presented with acute respiratory symptoms in nine primary care clinics in Singapore, using bacterial culture, IF and PCR. To our knowledge, this is the first practice-based study on the aetiological diagnosis of a large group of patients presenting with URTI in primary care clinics in Asia, using IF and PCR as identification methods.
cord-307768-xx46w6dc	2017	
cord-307874-0obomty2	2020	Evidence-based guidelines for precise interpretation of microbiologic tests results are lacking; however, approaches that have been practically useful for the management of bovine respiratory disease outbreaks are presented. However, naturally resistant to fluoroquinolones 71 Escherichia coli, Gallibacterium anatis, Enterobacter hormaechei, staphylococci, streptococci, fungi Secondary Single reports on cattle-specific strains isolated in pure culture in an outbreak of pneumonia in calves 52, [72] [73] [74] Multiple other bacterial species can be detected in the bovine respiratory tract. 10, 35, 54 However, with current knowledge on the interpretation of DNS results at the individual or group level, samples of the lower respiratory tract are likely a better option to evaluate potential involvement of opportunistic pathogens. In the example where the pathogen is causing the disease in 100% of affected calves, the risk of not finding an infected animal after sampling n cases is (1-Se)n , where Se is the test sensitivity.
cord-308315-g6udfu2a	2010	Recently, a coronavirus strain (179/07-11) was isolated from water buffalo (Bubalus bubalis) and the virus which displayed a strict genetic and biological relatedness with bovine coronavirus (BCoV) was referred to as bubaline coronavirus (BuCoV). There are multiple genetic and antigenic evidences that several subgroup 2a CoVs, such as HCoV-OC43, HECoV-4408, PHEV and CRCoV, have arisen as consequence of trans-species infections caused by BCoV (Zhang et al., 1994; Vijgen et al., 2005 Vijgen et al., , 2006 Erles et al., Veterinary Microbiology 145 (2010) [245] [246] [247] [248] [249] [250] [251] Recently, a coronavirus strain (179/07-11) was isolated from water buffalo (Bubalus bubalis) and the virus which displayed a strict genetic and biological relatedness with bovine coronavirus (BCoV) was referred to as bubaline coronavirus (BuCoV). Recently, another bovine-like CoV, which was referred to as bubaline coronavirus (BuCoV), was isolated from water buffalo (Bubalus bubalis) calves with fatal gastroenteritis in Italy (Decaro et al., 2008d) .
cord-308344-ao9z00t7	2017	title: Novel Porcine Epidemic Diarrhea Virus (PEDV) Variants with Large Deletions in the Spike (S) Gene Coexist with PEDV Strains Possessing an Intact S Gene in Domestic Pigs in Japan: A New Disease Situation Among 17 PEDV samples isolated from individual pigs, all of them contained at least two distinct genotypes with large genomic deletions, and 94.1% of them were found to consist of strains with an intact S gene. In this study, variants with large deletions in the S gene were found in eight primary and nine recurrent outbreaks from 16 pig farms, and they mostly (94.1%) coexisted with PEDV strains with an intact S gene. Cell culture isolation and sequence analysis of genetically diverse US porcine epidemic diarrhea virus strains including a novel strain with a large deletion in the spike gene New porcine epidemic diarrhoea virus variant with a large deletion in the spike gene identified in domestic pigs
cord-308422-ueyaw8pd	2007	Here, we report the results of a systematic investigation of the complex relationships between viral amplification efficiency, hybridization signal output, target-probe annealing specificity, and reproducibility of pathogen detection using a custom designed microarray platform. The array was designed to detect up to 35 RNA viruses using 40-mer probes tiled at an average 8-base resolution across the full length of each genome (53,555 probes; Figure S1 and Table S1 in Additional data file 1). We next hypothesized that amplification efficiency scoring could be used to select an optimal tag sequence (that is, for the RT-PCR primers) for achieving uniformly high AES Table 1 Binning of probes into specific pathogen signature probe sets across viral genomes, thus globally maximizing PCR efficiency (see supplemental methods in Additional data file 1 and [25] ).
cord-308655-zntwwqod	2012	title: Comparison of three multiplex PCR assays for the detection of respiratory viral infections: evaluation of xTAG respiratory virus panel fast assay, RespiFinder 19 assay and RespiFinder SMART 22 assay METHODS: The analytical sensitivity of three multiplex PCR assays, RespiFinder-19, RespiFinder-SMART-22 and xTAG-Respiratory-Virus-Panel-Fast-Assay (RVP), were compared to monoplex real-time PCR with quantified standardized control material. RESULTS: To compare the analytical sensitivity of the multiplex assays, samples were inoculated with 13 different quantified viruses in the range of 10(1) to 10(5) copies/ml. This study presents the first comparison of the analytical sensitivity of three novel multiplex PCR methods, the RespiFinder-19 assay, RespiFinder-SMART(Single tube Multiplex Amplification in Real-Time)-22 assay (both PathoFinder, Maastricht, Netherlands) and the xTAG Respiratory Virus Panel Fast Assay (Abbott Molecular, Wiesbaden, Germany), with quantified virus control material. Previous studies with clinical samples showed that the sensitivity and specificity of the RVP assay was 78.8% and 99.6%, respectively, compared to real-time PCR-methods, that are currently declared as the gold standard [21] .
cord-308867-mrtf8l4f	2015	
cord-308945-i2agpvhk	2020	METHODS: A total of 967 subjects were tested for IgG antibodies reactive to SARS-CoV-2, including 172 suspected cases of SARS-CoV-2, 656 plasma samples from healthy donors, 49 sera from patients with rheumatic disease, and 90 specimens from individuals positive for polymerase chain reaction (PCR)–based respiratory viral panel. Long et al 8 have described a variable antiviral IgM and IgG immune response to SARS-CoV-2 infection in a Chinese population in which seroconversion in a group of 285 patients from 3 hospitals showed IgG positivity for all cases beyond 17 to 19 days. The goals of this study were to ascertain key performance metrics of analytical specificity and cross-reactivity for a SARS-CoV-2 IgG serologic assay, perform a detailed cross-sectional and serial assessment of IgG and IgM antibody responses in suspected COVID-19 patients, and determine their relation to disease severity. SARS-CoV-2 IgG antibody results agreed with the PCR-negative samples for 96 of 97 (99%) of cases, including 55 instances of patients with new or acute-on-chronic symptoms suspicious for COVID-19 and with known time of onset.
cord-308979-qhlvd2mt	2005	
cord-309083-ew9cwiw0	2018	In this review, authors summarized six major cyprinid viral diseases, including koi herpesvirus disease (KHVD), spring viraemia of carp (SVC), grass carp hemorrhagic disease (GCHD), koi sleepy disease (KSD), carp pox disease (CPD) and herpesviral haematopoietic necrosis (HPHN). Challenge experiment reveals that the oral recombinant subunit vaccine can protect 50%-60% grass carp from infection and generate immunity against GCRV [199] . Oral vaccination is an effective way to induce mucosal immunity [215] and this strategy has shown a successful induction of the antiviral responses against viral diseases in different fish species [165] . Gene expression analysis of common carp (Cyprinus carpio L.) lines during cyprinid herpesvirus 3 infection yields insights into differential immune responses Recombinant lactobacillus expressing G protein of spring viremia of carp virus (SVCV) combined with ORF81 protein of koi herpesvirus (KHV): a promising way to induce protective immunity against SVCV and KHV infection in cyprinid fish via oral vaccination
cord-309107-2xzam3x9	2019	title: Feline coronavirus with and without spike gene mutations detected by real-time RT-PCRs in cats with feline infectious peritonitis This study investigated the presence of FCoV with and without S gene mutations in cats with FIP using two different real-time RT-PCRs on different samples obtained under clinical conditions. METHODS: Fine-needle aspirates (FNAs) and incisional biopsies (IBs) of popliteal and mesenteric lymph nodes, liver, spleen, omentum and kidneys (each n = 20), EDTA blood (n = 13), buffy coat smears (n = 13), serum (n = 11), effusion (n = 14), cerebrospinal fluid (n = 16), aqueous humour (n = 20) and peritoneal lavage (n = 6) were obtained from 20 cats with FIP diagnosed by immunohistochemistry. This study investigated the presence of FCoV with and without S gene mutations in different tissue and body fluid samples from cats with IHC-confirmed FIP via realtime RT-PCR.
cord-309540-4pk5tq5w	2020	Recent advances in CRISPR-based diagnostics suggest that DETECTR, a combination of isothermal reverse transcriptase loop mediated amplification (RT-LAMP) and subsequent Cas12 bystander nuclease activation by amplicon targeting ribonucleoprotein complexes, could be a faster and cheaper alternative to qRT-PCR without sacrificing sensitivity/specificity. Isothermal reverse transcriptase loop mediated isothermal amplification (RT-LAMP) in combination with Cas12 detection does not need expensive specialised equipment, is highly sensitive and specific, has a short TAT and is easy to implement and therefore could be used as an alternative for qRT-PCR (5, 6) . Since DETECTR depends on both signal amplification by RT-LAMP and reporter degradation after Cas12-dependent amplicon recognition, the assay produces a binary readout and is potentially more sensitive and specific compared to qRT-PCR (5, 6) . In this manuscript we describe the development of an in-house SARS-CoV-2 DETECTR assay, compare its performance with routine diagnostic qRT-PCR on almost 400 patient samples of three Dutch hospitals, thereby providing a first field test of this novel Cas12-mediated SARS-CoV-2 detection tool.
cord-309565-8syjr6k8	2018	
cord-309644-cujlpm4i	2020	
cord-309763-8eywr57j	2005	
cord-310064-p8u424ch	2020	
cord-310095-1pxki8y8	2019	
cord-310096-a242g5kg	2020	Methods We conducted a mass-screening study to compare the utility of nucleic acid amplification, such as reverse transcriptase polymerase chain reaction (RT-PCR) testing, using NPS and saliva samples from each individual in two cohorts of asymptomatic persons: the contact tracing cohort and the airport quarantine cohort. We conducted a mass-screening study to compare the utility of nucleic acid amplification, such as reverse transcriptase polymerase chain reaction (RT-PCR) testing, using NPS and saliva samples from each individual in two cohorts of asymptomatic persons: the contact tracing cohort and the airport quarantine cohort. Currently, the diagnosis of COVID-19 is made by the detection of the nucleic acids of SARS-CoV-2 typically by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) testing of specimens collected by nasopharyngeal swabs (NPS) [5, 6] . We conducted a mass-screening study to determine and compare the sensitivity and specificity of nucleic acid amplification using paired samples (self-collected saliva and NPS) for the detection of SARS-CoV-2 in two cohorts of asymptomatic individuals.
cord-310140-h7uwl0pb	2005	
cord-310501-ro55cqxw	2012	title: Detection of porcine circovirus genotypes 2a and 2b in aborted foetuses from infected swine herds in the State of São Paulo, Brazil FINDINGS: Samples of 168 aborted foetuses or mummified foetuses from five farrow-to-finish swine farms known to be infected with PCV2 and located in the State of São Paulo were tested for PCV2 by polymerase chain reaction (PCR). CONCLUSIONS: The findings indicate that the frequency of PCV2 infections in aborted porcine foetuses from the State of São Paulo is rather low (10.7%) and that co-infection with other pathogens is common and may be involved in PCV2 associated reproductive failure. Given the distribution of the virus in swine populations worldwide and the impact of PCV2 associated reproductive failure on swine herd economy, the aim of this study was to identify genotypes of PCV2 involved in reproductive failure in State of São Paulo, Brazil and to investigate the level of co-infections of foetuses with other pathogens.
cord-310748-ao29zx1u	1991	Our results showed that within a 1-kb region of the peplomer gene, RNA recombination occurred at almost every potential crossover site. To study RNA recombination in the absence of selection pressure, we developed a polymer-ase chain reaction (PCR) assay using two primers specific for the potential recombinant viruses which have a crossover site between the two primers. Only recombinant RNAs which had a crossover between the two primers and contained A59-specific sequences on the 5''-side and JHM-DL-specific sequences on the 3''-side could be detected by this PCR approach. DNA sequence analysis of 35 cloned PCR products showed that the crossover sites were almost randomly distributed throughout the nearly 1-kb region of the peplomer gene studied ( Fig. 2A) . Analysis of 53 recombinant clones revealed that, similar to the intracellular recombinants, the crossover sites in the viral recombinant RNAs were almost randomly distributed over the 1 -kb region of the peplomer gene (Fig. 2B) .
cord-310771-tnwfp1je	2005	A method was developed for qualitative and quantitative detection of the seminal cell-associated PRRSV RNA in relation to endogenous and exogenous reference RNAs. As endogenous control for one-step real-time reverse transcription (RT)-PCR UBE2D2 mRNA was selected. Particularly for the analysis of persistent infections associated with low copy numbers of PRRSV RNA, UBE2D2 mRNA is an ideal control due to its low expression in seminal cells and its detection in all samples analysed (n = 36). For the development of one-step real-time RT-PCR for four endogenous reference RNAs (HPRT, UBE2D2, PPIA, and HMBS) appropriate target regions were selected and the assay conditions were optimised for amplification efficiency. One-step real-time RT-PCR assays for PRRSV-1 and -2 RNA allowed quantitation with optimal efficiency (Fig. 1a ; standard curves for two additional viremic pigs infected with PRRSV-1 (data not shown)) as achieved for endogenous and Fig. 1 .
cord-310946-rjwyirld	2020	
cord-311204-fc12f845	2016	Canine parvovirus type 2 (CPV-2) can cause acute haemorrhagic enteritis in dogs and myocarditis in puppies. Some faecal samples were negative for the CPV-2 antigen based on a colloidal gold test strip but were positive based on PCR, and a viral strain was isolated from one such sample. Identification of CPV-2 with cell culture and IPMA Feline kidney cell line F81 was obtained from the American Type Culture Collection, USA and was used to isolate viruses from clinical samples and to observe cytopathic effects associated with viral replication. Cloning the full-length genomic sequence of CPV-2 DNA and RNA were extracted from the homogenized samples (faeces from infected dogs) with the TIANamp Virus DNA/RNA Kit (Beijing TIANGEN Biotech Company, Beijing, China) according to the manufacturer''s protocol. One viral strain was isolated from the faeces of dogs that tested negative in the colloidal gold test strip but positive with PCR.
cord-311410-lgqup9ug	2006	In this study we present the design and validation of a single tube RT-PCR assay using a pair of consensus primers for the detection of mosquito-borne flaviviruses. For specificity studies, several viral samples were used, including clinical samples found to contain CMV and EBV DNA by PCR testing, as described (Johnson et al., 2000) ; a clinical isolate of influenza virus from the 2004-2005 season, typed as H3 by sequencing of the hemagglutinin gene; echovirus 11 from the laboratory collection at the Hospital for Sick Children; hepatitis C virus RNA was obtained by in vitro transcription of the infectious clone pCV-H77C (Yanagi et al., 1997) (the clone was kindly provided by Dr. J. Coupled with sequencing, it could detect with great sensitivity and identify several mosquito-borne flaviviruses including WNV, Kunjin, SLE, YFV and dengue fever viruses.
cord-311439-y9jwu38r	2007	We describe an outbreak of acute respiratory infection due to adenovirus type 3 that occurred in one county of Jiangsu Province, China, during the period from April 18 th to July 4 th 2004. Pharyngeal swab specimens from children and adolescent patients who were diagnosed with acute upper respiratory tract infections at Township A health care hospital during the outbreak from April through July 2005 were cultured for adenovirus. An infection caused by adenovirus type 3 was verified by entire gene sequence testing to 10 Nested PCR amplification products of positive specimens (from nine patients) in the laboratory of the National CDC of China. Eighteen paired patient serums(acute and convalescent) were used to test neutralization titer with the isolate adenovirus type 3 viral strain simultaneously. This investigation demonstrated that acute respiratory infection caused by adenovirus type 3 caused the outbreak that occurred in over seventy schools in ten townships in 2004.
cord-311506-fb8c3ix0	2020	
cord-311639-zij2wbzs	2012	This study was performed to evaluate the analytical and clinical performance of a newly developed rapid ICG test (SD Bioline Norovirus test) for detecting human norovirus genogroups GI and GII in stool specimens. In samples with negative ICG and positive real-time PCR results, 200 L of fecal suspension was mixed with 200 L diluent (1:1 dilution) instead of 1 mL diluent, and the test was repeated. In this study, therefore, in the case of samples with negative ICG and positive real-time PCR results, 200 L of fecal suspension was mixed with 200 L diluent instead of 1 mL diluent (total dilution titer was 1:10-1:20 dilution, which is similar to that of the original procedure of this assay using stool), and the test was repeated. Evaluation of rapid immunochromatography test for the detection of norovirus infection: comparison with ELISA and real time quantitative reverse transcription PCR assays
cord-311748-yr2ep7uf	2013	In recent years, polymerase chain reaction (PCR)-based methods in particular, have become the gold standard for virus detection in food due to their high sensitivity, specifi city and potential to detect even a single virus particle (Bosch et al. In recent years, qRT-PCR has been widely used in food virology as the most promising nucleic acid detection method, since it offers several advantages over conventional RT-PCR, including high sensitivity, the possibility of simultaneous amplifi cation, detection and quantifi cation of the target nucleic acids in a single step, and with minimum risk of carry-over contamination through the use of a closed system (Mackay et al. The challenges associated with the detection of foodborne viruses, such as PCR inhibitors and low virus concentrations in foods, affect the effi ciency of realtime assay adversely, therefore, for process control (PC) an internal amplifi cation control (IAC), which is extracted and amplifi ed with the target sequence, is crucial in the evaluation of PCR and to prevent false negatives (Di Pasquale et al.
cord-311801-m2otfdjw	2020	The purpose of this study was to investigate the feasibility of serological total antibody tests combined with RT-PCR for detection of SARS-CoV-2. Serum samples and throat swabs were collected from 375 patients for total antibody testing against SARS-CoV-2 and RT-PCR analysis, respectively. This study supported the advantage of the combined method for detection of SARS-CoV-2 with a high degree of sensitivity and specificity, as a useful tool for accurate diagnosis and timely treatment of suspected patients, epidemiological investigation, as well as monitoring ongoing outbreaks of infections with SARS-CoV-2. In this study, we presented the results of two diagnostic methods: serum total antibody assays against SARS-CoV-2 by CMIA and the RT-PCR for detection of viral RNA. In addition, the combination of the results of the total antibody test and RT-PCR was discussed for detection of SARS-CoV-2 infections. Sensitivity, specificity for detection of SARS-CoV-2 by RT-PCR, and the total antibody test method as well as the combined methods were analysed.
cord-311982-wkg56xeq	2007	Comparisons of the enteric (jejunum) and non-enteric (liver) derived viral RNA sequences revealed 100% nucleotide identity, a finding that questions the well accepted ''internal mutation theory'' of FIPV pathogenicity. Comparisons of the enteric (jejunum) and non-enteric (liver) derived viral RNA sequences revealed 100% nucleotide identity, a finding that questions the well accepted ''internal mutation theory'' of FIPV pathogenicity. Furthermore, the structural and accessory gene regions of viral RNA isolated from the liver of the same cat (FCoV C1Li) were sequenced and the data derived from the enteric (jejunum) and non-enteric (liver) sources were compared. Sequence data previously generated for the laboratory strain FCoV, FIPV 79-1146, were used to design primers for conventional reverse transcriptase polymerase chain reaction (RT-PCR) amplification of short lengths (100e500 bases) of the field strain RNA. Analysis of the accessory gene 7 region of the FCoV C1Je genome identifies two ORFs, which have translation products sharing high amino acid identity with proteins 7a and 7b of FIPV 79-1146.
cord-312024-qdgqif5j	2010	The increasing availability of new rapid and sensitive molecular diagnostics such as polymerase chain reaction testing, should provide more accurate and timely diagnoses of viral respiratory infections in older adults in the near future. This article summarizes what is known about the diagnosis of viral respiratory diseases in elderly adults, with the hope of increasing understanding of the utility and limitations of the currently available diagnostic tests for viral respiratory pathogens, such as culture, rapid antigen testing, polymerase chain reaction (PCR) testing, and serologic analysis. Compared with previous studies that have used viral culture for diagnosis, studies using PCR have more accurately detected the presence of viruses (including influenza virus, RSV, hMPV, parainfluenza virus, rhinoviruses, and coronaviruses) in the lower respiratory tract illness in older adults [5, 13, 31, 36, 40, 42] .
cord-312139-g1hczx54	2020	Based on the primers provided by research institutes from different countries, especially primers from China, detailed analysis of non-specificity of primer sequences had been conducted, and interference of human mRNA targeted by the primer was discussed deeply for RT-PCR detection of COVID-19 infections. https://doi.org/10.1101/2020.04.07.20056804 doi: medRxiv preprint 8 Although many patients tested one or more negative before receiving positive results for SARS-CoV-2 virus in China, it was difficult to understand the extent to which this abnormal phenomenon occurs. To eliminate the host interference in RT-PCR detection of COVID-19 infections, specific amplification of the intended target of SARS-Cov-2 sequence required that primers matched as little as possible to any human RNA transcript. Hence it was not difficult to draw a conclusion that non-specificity of the primer designed for SARS-CoV-2 virus might be an important factor resulting in so many false-negative diagnoses for COVID-19 infections in China.
cord-312161-egwo19oc	2011	Microbial water quality monitoring has undergone tremendous transition in recent years, with novel molecular tools beginning to offer rapid, high-throughput, sensitive and specific detection of a wide spectrum of microbial pathogens that challenge traditional culture-based techniques. High-density microarrays, quantitative real-time PCR (qPCR) and pyrosequencing which are considered to be breakthrough technologies borne out of the ''molecular revolution'' are at present emerging rapidly as tools of pathogen detection and discovery. The limitations in detecting and identifying pathogens directly from environmental water samples by culture or microscopy can now be addressed by integrating concentration techniques with molecular tools to provide sensitive, specific and quantitative data on any pathogens of interest. Pyrosequencing technology is revolutionizing the study of microbial ecology as well as direct metagenomic detection Detection of pathogens in water Aw and Rose 425 High levels of several classes of resistance genes in bacterial communities exposed to antibiotic were identified.
cord-312197-d5d8amk7	2010	Health facility infections are also a major problem in lowincome countries, but the more pressing issues are the high proportion of home deliveries in unclean environments predisposing to sepsis and ensuring that all neonates have access to effective interventions from health care providers in the first days of life 2 . Randomised controlled trials (RCTs) of maternal protein-calorie and multiple micronutrient and supplementation have demonstrated significant improvements in rates of prematurity and birth weight and variable impact on mortality; but no studies have examined their impact on rates of neonatal sepsis [20, 21] . New studies from Malawi and Nepal indicate that maternal antisepsis interventions such as vaginal chlorhexidine during labour may have a significant impact on rates of neonatal mortality and sepsis in developing countries [33] . Intrapartum antibiotic prophylaxis has been highly effective in reducing both early-onset neonatal bacterial and maternal sepsis in developed countries [35] .
cord-312206-0pkbbb99	2019	
cord-312222-aw5849rc	2020	METHODS: This prospective service improvement project piloted an RT-LAMP method on nasal and pharyngeal swabs on 21 residents of a high dependency care home, with two index COVID-19 cases, and compared it to multiplex tandem reverse transcription polymerase chain reaction (RT-PCR). We recorded vital signs of patients to correlate clinical and laboratory information and calculated the sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) of a single swab using RT-LAMP compared with the current standard, RT-PCR, as per Standards for Reporting Diagnostic Accuracy Studies (STARD) guidelines. Since then, a number [13] of other groups have published high-quality studies demonstrating that RT-LAMP has the potential to replace RT-PCR as a means for detecting SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2) within RNA extracted from nose -throat swabs and endotracheal secretions/bronchoalveolar lavage fluid [5, 14, 15] .
cord-312223-qgwzgazd	2013	RESULTS: Screening of NanoTrap particles indicated that one particle, NT53, was the most efficient at RVFV capture as demonstrated by both qRT-PCR and plaque assays. RVFV that was inactivated through either detergent or heat treatment was still found bound to NT53, indicating the ability to use NanoTrap particles for viral capture prior to transport to a BSL-2 environment. Our study demonstrates that NanoTrap particles are capable of capturing whole virus, and can be assayed with both qRT-PCR and plaque assays. A) Seven different types of NanoTrap particles were incubated with viral supernatants containing RVFV (1E+7 pfu/ml) for 30 minutes at room temperature and washed 4 times with water. In order to determine if the amplification observed in the qRT-PCR assay was due to the NanoTrap particle capturing intact viral particles or association of viral RNA (presumably due to lysed virus) with the particles, plaque assays were performed.
cord-312240-0k8y86pf	2017	Nasopharyngeal/oropharyngeal (NP/OP) swabs from 70 children <5 years with CAP of unknown etiology and 90 asymptomatic controls were tested by next-generation sequencing (RNA-seq) and pan viral group (PVG) PCR for 19 viral families. We first assessed the ability of RNA-seq and PVG PCR to detect known respiratory pathogens using specimens from children with CAP (n = 63) and asymptomatic control (n = 52) subjects in whom viral or atypical bacterial pathogens had been detected using the EPIC study protocol. We validated RNA-seq and PVG PCR methods to detect known respiratory pathogens by testing specimens using both methods from children with CAP (n = 63) and asymptomatic control subjects (n = 52) in whom viral or atypical bacterial pathogens had been detected using the EPIC study protocol. Using RNA-seq and PVG PCR, we identified additional viruses from upper respiratory tract specimens in >30% children hospitalized with clinical and radiographic pneumonia but in whom no pathogen was identified despite extensive testing by culture, molecular, and serologic methods.
cord-312456-6lxc2rj2	2016	title: Comparison of electron microscopy, ELISA, real time RT-PCR and insulated isothermal RT-PCR for the detection of Rotavirus group A (RVA) in feces of different animal species The aim of this investigation was to evaluate a commercially available RT-iiPCR assay for RVA detection in feces from different animal species. Therefore, the aim of our investigation was to evaluate a recently available insulated isothermal RT-PCR (RT-iiPCR) reagent set (POCKIT TM Rotavirus A Reagent Set, GeneReach USA, Lexington, MA, USA) with use of a portable PCR machine, which could potentially be used for point-of-need detection for RVA in the feces of different animal species. Additionally, the sensitivity of the rotavirus RT-iiPCR reagent set was evaluated by comparison with the commercially available rtRT-PCR assay using 10-fold serial dilutions of nucleic acid extracted from a positive bovine clinical sample. There was a significant difference in the number of positive samples detected with the in-house rtRT-PCR assay versus the other two molecular tests.
cord-312477-2y88gzji	2020	
cord-312996-qzu8pkyt	2020	Testing limitations, including reagent shortages, remain a bottleneck in the battle to curtail COVID-19 spread in even the wealthiest countries [1, 2] The development of new matrix assisted laser desorption time of flight mass spectrometry (MALDI-ToF MS) diagnostics for SARS-CoV-2 detection is driven by the need for greater diagnostic capacity and alternative applications to complement standard PCR and antibody based diagnostics. Consequently studies where swab samples have been split for simultaneous analysis by RT PCR detection systems of SARS-CoV-2 RNA and by MALDI-ToF mass spectrometry for viral proteins, are compromised [4] . virus grown in vitro and mass spectra of gargle/saliva spiked with culture media from cells infected with SARS-CoV-2: S proteolytic fragments S1 and S2 were seen in all preparations and S2b only in serum free samples. These confirmed PCR-negative gargle samples were analysed by MALDI-ToF mass spectrometry 40 times; the measured peak intensities of which acted as comparative controls to the viral spiked saliva/gargle.
cord-313000-as507p4t	2007	
cord-313004-gdnaiodj	2020	
cord-313107-6cfenpxm	2020	In this context, a pooled sample testing strategy was evaluated in the setting of emerging disease outbreak in 3 central Indian districts to assess if the cost of the test and turn-around time could be reduced without compromising its diagnostic characteristics and thus lead to early containment of the outbreak. At the reported point prevalence of 4.8% in this study, the negative predictive value of qRT-PCR on pooled samples was around 96% suggesting that the adoption of this strategy as an effective screening tool for COVID-19 needs to be carefully evaluated. We hypothesized that testing of pooled respiratory samples, collected from potentially infected individuals, could lead to faster laboratory confirmation and quicker containment of the emerging infection in these districts and, thus, undertook this study to evaluate the diagnostic concordance between the strategies of pooled vs.
cord-313375-rs3jjiuj	2010	Study design: A real-time RT-PCR assay targeting the matrix gene of influenza A viruses was developed and validated using in vitro transcribed RNA derived from influenza A/H1N1v, A/H1N1 and A/H3N2 virus as well as plaque-quantified influenza A/H1N1v, A/H1N1 and A/H3N2 virus samples. Study design: A real-time RT-PCR assay targeting the matrix gene of influenza A viruses was developed and validated using in vitro transcribed RNA derived from influenza A/H1N1v, A/H1N1 and A/H3N2 virus as well as plaque-quantified influenza A/H1N1v, A/H1N1 and A/H3N2 virus samples. After validation of the in-house version the commercial RealStar kit was used to assess the clinical performance and specificity on a panel of influenza viruses including A/H1N1v, A/H1N1, swine A/H1N1, A/H3N2, avian A/H5N1 as well as patient specimens. After validation of the in-house version the commercial RealStar kit was used to assess the clinical performance and specificity on a panel of influenza viruses including A/H1N1v, A/H1N1, swine A/H1N1, A/H3N2, avian A/H5N1 as well as patient specimens.
cord-313439-cadyykks	2019	Studies evaluating sensitivity and specificity of the detection of serum antibodies in comparison to either histopathology, a combination of diagnostic tests or clinical suspicion of feline infectious peritonitis (FIP). Recent studies evaluated the use of a quantitative RT-PCR (RT-qPCR) to detect FCoV RNA in FNA samples of the mesenteric lymph nodes and other abnormal tissues of clinical cases [119, 140] and hypothesized that this technique would be a useful tool to diagnose FIP for veterinary practitioners, especially in cats without effusion. Sensitivity and specificity from different studies evaluating the detection of feline coronavirus (FCoV) spike (S) gene mutations in tissue samples. RT-nPCR and subsequent S gene sequencing of serum and plasma samples from cats with FIP (diagnosed by histopathology ± IHC or by positive immunofluorescence in effusion) and control cats (diagnosed with another disease either ante or post mortem) revealed a sensitivity of only 7%, which confirms the very low virus load in blood.
cord-313506-6bb4q7nv	2013	We previously showed that transchromosomic (Tc) cattle carrying a human artificial chromosome (HAC) comprising the entire unrearranged human immunoglobulin heavy-chain (hIGH) and kappa-chain (hIGK) germline loci (named as κHAC) are capable of producing functional hpAbs when both of the bovine immunoglobulin mu heavy-chains, bIGHM and bIGHML1, are homozygously inactivated (double knockouts or DKO). Therefore, in an effort to improve B cell development and hIgG production in Tc cattle, we sought to enhance pre-BCR function by engineering a new HAC into which, in addition to the hIGH, hIGK and hIGL chromosome loci that carry the entire human immunoglobulin gene repertoire, the human VpreB (hVPREB1) and λ5 (hIGLL1) genomic loci from human chromosome 22 (hChr22) was incorporated, and part of CH and TM domains, CH2-TM, of hIGHM gene, was replaced by the corresponding bovine gene sequence (bovinization of the CH2-TM domains of hIGHM). doi: 10.1371/journal.pone.0078119.g002 DT40 colonies were screened with genomic PCR (data not shown) for the correctly modified hChr2, and clone K53 was identified and selected for the final HAC construction ( Figure 5 ).
cord-313676-6rebpe57	2018	The most common enteric viruses affecting commercial flocks in Brazil include Fowl Adenovirus of group I (FAdV-I), Chicken Parvovirus (ChPV), Chicken Astrovirus (CAstV), Avian Nephritis Virus (ANV), Infectious Bronchitis Virus (IBV), Avian Reovirus (AReo), and Avian Rotavirus (ARtV). The main enteric viruses reported to cause enteric diseases are found in single and multiple infections and include the Fowl Adenovirus of group I (FAdV-I); Chicken Parvovirus (ChPV); two viruses from the Astroviridae family: Chicken Astrovirus (CAstV) and Avian Nephritis Virus (ANV); two viruses from the Reoviridae family: Avian Reovirus (AReo) and Avian Rotavirus (ARtV); and a member of the Coronaviridae family, Infectious Bronchitis Virus (IBV) [4, [6] [7] [8] [9] . The association of enteric virus with the age of broilers, breeders, and layers (Tables 4 and 5) showed that molecular diagnosis of these viruses can be performed at different stages of production, which can be useful in the control of vertical infections.
cord-313749-f2ct57em	2007	
cord-313994-l15qa9tr	2015	
cord-314051-dr27bsvt	2020	If viral carriage is not detected by testing, patients may proceed with elective surgery whereby signs and symptoms of coronavirus disease (COVID-19) may arise in the postoperative period, leading to adverse outcomes. 3 While screening with RT-PCR may detect some presymptomatic preoperative patients, the window of diagnostic utility is small, and careful interpretation of negative and positive test results must be considered prior to altering the course of therapy. A positive RT-PCR result identifies a group of patients who may be infected with SARS-CoV-2 and should have elective surgeries delayed. Si la présence virale n''est pas dépistée par un test, les patients peuvent aller de l''avant avec leur chirurgie non urgente, à la suite de laquelle les signes et symptômes d''une atteinte au coronavirus (COVID-19) pourraient survenir en période postopératoire, entraînant des devenirs défavorables.
cord-314069-8dxzf2ip	2016	authors: Dongliu, Yuan; Guoliang, Yang; Haocheng, Xu; Shuaijia, Qing; Li, Bing; Yanglei, Jia This study reports an outbreak of acute febrile respiratory illness caused by human adenovirus B [P14H11F14] in a military training center in China between May and June 2014. A HAdV-B [P14H11F14] virus was confirmed as the etiological pathogen of this acute outbreak of febrile respiratory illness based on clinical manifestations, epidemiological characteristics, specific molecular detection results, phylogenetic analysis, and serological assays. In conclusion, the regional CDC officials concluded that a type-55-like human adenovirus B human/CHN/SD77001/ 2014/[P14H11F14] virus was the etiological pathogen responsible for this acute FRI outbreak based on the clinical manifestations in the patients, the epidemiological characteristics of the outbreak, the HAdV-DNA-specific PCR results, isolation of the virus, sequencing and alignment of the PCR amplicons, homology and phylogenetic analyses based on the complete E1A, penton base, hexon, and fiber gene sequences, and serological assays specific for HAdV IgA/IgG.
cord-314201-6njwigco	2008	Tanaka [3] published the first universal primer pair specific for mosquito borne flaviviruses in 1993; the YF1 and YF3 primers targeted the NS5/3''UTR of the genome and were based upon the six flavivirus sequences available at the time. In 2005 Gaunt and Gould designed a universal nested PCR, using six primers targeting the E gene, capable of amplifying cDNA from 60 flavivirus strains. In the present study, we identified conserved sites and developed a universal, non-nested primer pair that amplifies cDNA from each of the major subgroups of flaviviruses, and also TABV, under standard reaction conditions. Since the amplified products represent 8% of the genome, this is sufficient sequence to determine the species of the virus and thus potentially to identify unrecognised flaviviruses. Rapid subgroup identification of the flaviviruses using degenerate primer E-gene RT-PCR and site specific restriction enzyme analysis
cord-314386-cxq9v218	2004	We developed a set of three real-time reverse transcription–polymerase chain reaction (PCR) assays that amplify three different regions of the SARS-associated coronavirus (SARS-CoV), can be run in parallel or in a single tube, and can detect <10 genome equivalents of SARS-CoV. To improve the ability to detect SARS-CoV safely and reduce the risk of eliciting false-negative results caused by genome sequence variations, we established three individual real-time RT-PCR assays. Target sequences were chosen by using the following criteria: 1) the regions are distributed over the whole genome, including the nonstructural polyprotein 1a and 1ab genes and the spike glycoprotein gene (Table 1) ; 2) the regions are highly conserved among the 89, 90, and 100 respective sequences available in public sequence databases; 3) the regions are suitable for the design of a real-time RT-PCR assay; and 4) the designed primers, 5′-nuclease probes, and amplicons displayed no considerable homology to other viruses, including human CoV OC43 and 229E in BLAST searches (available from http://www.ncbi.nlm.nih.gov/BLAST/).
cord-314404-tkhupnko	2020	
cord-314937-jrxu65bl	2020	The secondary attack rate of SARS-CoV-2 from index cases to household contacts reflects the natural spread of infection in immunologically naive populations with limited preventive measures to control transmission. Here, we estimated the secondary household attack rate of SARS-CoV-2 and identified the determinants of household transmission by measuring SARS-CoV-2-specific antibodies in household members of RT-PCR confirmed cases during the first month of the COVID-19 pandemic in Norway. Our study was specifically designed to assess household attack rates as measured by seropositivity in household members 6-8 weeks after onset of symptoms in the index case, with low prevalence of SARS-CoV-2 virus in the community. We calculated attack rates based on SARS-CoV-2-specific antibodies in household members, whereas the majority of previous studies have ascertained transmission based on RT-PCR, with estimates of 7·6% to 38% (11) (12) (13) (14) (15) (16) (17) (18) (19) (20) .
cord-314986-uhpe69k0	2020	title: A model based on CT radiomic features for predicting RT-PCR becoming negative in coronavirus disease 2019 (COVID-19) patients Our purpose is to assess a model based on chest computed tomography (CT) radiomic features and clinical characteristics to predict RT-PCR negativity during clinical treatment. METHODS: From February 10 to March 10, 2020, 203 mild COVID-19 patients in Fangcang Shelter Hospital were retrospectively included (training: n = 141; testing: n = 62), and clinical characteristics were collected. We collected the clinical data and chest CT features of mild COVID-19 patients in Fangcang Shelter Hospital in Wuhan, Hubei, aiming to establish a predictive model for RT-PCR becoming negative during the recovery period. We analyzed chest CT images after the abnormal clinical symptoms disappeared, and proposed a combination model of radiomic features and clinical data to predict RT-PCR negativity.
cord-315037-lmur80te	2020	
cord-315094-pzixgqcy	2004	
cord-315167-ph15z424	2014	
cord-315476-7rdiesav	2002	In this study, 11 isolates from 10 patients with respiratory disease from Quebec, Canada, were tested by a reverse-transcriptase polymerase chain reaction based on the fusion protein gene. In this study, 11 isolates from 10 patients with respiratory disease from Quebec, Canada, were tested by a reverse-transcriptase polymerase chain reaction based on the fusion protein gene. In the present article, we describe polymerase chain reaction (PCR) and sequencing studies done on 11 isolates from respiratory specimens from 10 Canadian patients with acute respiratory tract illness. Published nucleocapsid (N) and fusion (F) gene sequences of HMPV and avian pneumovirus were used to develop primers for detection and sequencing of HMPV at the Respiratory Virus Section (Centers for Disease Control and Prevention, Atlanta). We detected virus in isolates from children with acute respiratory tract infection, as described in the first report of HMPV [1] .
cord-315541-tirod4t6	2018	This paper reports the development and validation of a real-time PCR targeted to ORF1 and based on a TaqMan probe for the detection of porcine circovirus type 2 DNA in swine samples. The real-time PCR method described in this paper was performed with DNA from this strain, and an amplification curve with Ct 19.9 was obtained, confirming that such mutation in the probe annealing sequence had no effect in the reaction. The test performed with a plasmid containing the fragment to be amplified in the qPCR, with known The DNA samples used for the determination of the intra-and inter-assay variabilities for medium Ct values was not the same due to the lack of available DNA Fig. 2 Amplification curves obtained in the real-time PCR reaction performed for the determination of the limit of detection.
cord-315598-qwh72inx	2020	De otorgarse un Consentimiento Informado amplio, éste debería ser única y exclusivamente para los procesos asociados con COVID-19".(71) AMCI ® Se recomienda considerar la transición del cuidado intensivo al cuidado paliativo en todo paciente con sospecha o diagnóstico de COVID-19 sin mejoría a pesar de las intervenciones óptimas, con empeoramiento progresivo de su pronóstico vital y ante un evidente deterioro; aplicando medidas generales en control de síntomas ( Manejo de secreciones -Tratamiento del dolor -Tratamiento de la disnea -Sedación paliativa), así como apoyo espiritual, siempre acompañando al paciente y nunca abandonarlo en el final de la vida. En cuanto hace referencia a la situación actual de pandemia por SARS-CoV-2 y compromiso pulmonar; Wu y cols, en Marzo de 2.020 realizaron un estudio retrospectivo de 201 pacientes con COVID-19 en China; para aquellos pacientes que desarrollaron SDRA, el tratamiento con metilprednisolona estuvo asociado con una disminución del riesgo de muerte (23/50 [46%] con esteroides vs 21/34 [62%] sin esteroides; HR, 0.38 [IC 95%, 0.20-0.72]), con las limitaciones de los estudios retrospectivo, de un solo centro, con un limitado número de pacientes (400).
cord-315780-uhi66unn	1997	Abstract An RT-PCR method was developed that amplified genetic material from the 5′ end of the S protein gene of both transmissible gastroenteritis virus (TGEV) and porcine respiratory coronavirus (PRCV), but discriminated between the two by the size of the product generated. Detection of TGEV in clinical specimens was possible using a spin column method to extract RNA and sensitivity was compared to virus isolation and antigen detection ELISA. There are also reports of the use of DNA probes and of RT-PCR as detectors of TGEV RNA (Bae et al., 1991; Vaughn et al., 1996; Wesley et al., 1991; Jackwood et al., 1995) but the methods were not shown to be suitable for the direct detection of virus in clinical samples. Differentiation of transmissible gastroenteritis virus from porcine respiratory coronavirus and other antigenically related coronaviruses by using cDNA probes specific for the 5'' region of the S glycoprotein gene
cord-315949-7id5mitl	2013	8, 9 The purpose of this study was to describe during a limited period of time the viral etiology of acute lower respiratory infections (ALRI) in patients hospitalized in two Lao hospitals by using a set of five multiplex RT-PCR/PCR targeting 18 common respiratory viruses. In this study, we report for the first time in Lao PDR the viral etiologies in patients hospitalized for ALRIs. We identified 186 respiratory viruses in 162 (55%) patients of all ages using 5 multiplex PCR/RT-PCR. Human respiratory syncytial virus is frequently defined as the predominant virus associated with hospitalizations for ALRI in children aged ≤5 years. Respiratory virus coinfections being frequent, 5, 19, 44 it demonstrates the usefulness of the multiplex RT-PCR approach, which allows the detection of the most important viruses in only few reactions while multiple infections are often undetected in viral culture or by direct immunofluorescence.
cord-316173-ocdlh310	2018	title: One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus and canine kobuvirus To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10(2.1) TCID(50) for CDV, 10(1.9) TCID(50) for CPV and 10(3) copies for CaKoV. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs. The viral DNA/RNA of fecal samples collected from dogs with clinical symptoms of diarrhea were extracted and tested in parallel with both the one-step multiplex PCR/RT-PCR and the commercial Rapid CDV/CPV Ag Test Kit (Bionote, Gyeonggi, Republic of Korea) for CDV or CPV, according to the manufacturer''s instruction, and a traditional simplex RT-PCR for CaKoV, as described previously with minor modification [4] . Detection of canine distemper virus in dogs by real-time RT-PCR
cord-316250-w0nl88jz	2013	title: Selection of reference genes for quantitative real-time PCR analysis in chicken embryo fibroblasts infected with avian leukosis virus subgroup J The objective of our study was to identify suitable reference genes for mRNA expression analysis in chicken embryonic fibroblasts (CEF) after infection with avian leukosis virus subgroup J (ALV-J). CONCLUSIONS: The RPL30 and SDHA were deemed suitable for use as reference genes for real-time PCR analysis of mRNA gene expression during ALV-J infection, whereas commonly used ACTB and GAPDH are unsuitable to be reference genes. This highlights the necessity of reference gene selection during real-time PCR analysis for virus-infected cells. Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses Selection of reference genes for quantitative real-time PCR analysis in chicken embryo fibroblasts infected with avian leukosis virus subgroup J.
cord-316295-x636ux34	2012	Abstract This paper summarizes results obtained by multiplex PCR screening of human clinical samples for respiratory viruses and corresponding data obtained after passaging of virus-positive samples in MDCK 33016PF cells. Using lower inoculum dilutions than those normally applied for preparations containing influenza virus (total dilution of the original sample of ∼104), the positive results for the different viruses turned negative already after 2 or 3 passages in MDCK 33016PF cells. In a similar way, samples with positive and questionable multiplex PCR results only for viruses other than influenza virus were also cultivated for 2 or 3 passages in MDCK 33016PF cells. Considering the selection of specimens, the high percentage of influenza-positive results is not surprising, but a significant number of samples (66/370 or 17.8%) also tested positive for other viruses, such as adenovirus, bocavirus, coronavirus, enterovirus, metapneumovirus (HMPV), parainfluenza virus (PIV), rhinovirus, and respiratory syncytial virus (RSV).
cord-316309-8xe7cg8q	2008	We build on our previous paper [14] describing in further detail the AES algorithm that identifies genomics sequences that can be successfully amplified by random primers, facilitating the design of appropriate microarray probes for detection of the pathogen. In our paper, we reported an observation that experiments using random priming amplification often resulted in incomplete hybridization of the pathogen genome marked by interspersed genomic regions not detected by tiling probes on the microarray (Figure 1. Since our pathogen detection chip contains tiling 40-mer probes of both RSV and HMPV, the number and distribution of the probes with high signal intensities would give a good indication of the amount of PCR products generated across the target genome by a tagged-random primer. We expect that a tagged-random primer with desirable amplification efficiency that generates sufficient PCR products uniformly across the whole target genome would result in high signal intensity probes distributed evenly across the whole genome.
cord-316343-u1uup5da	2018	Total RNA was extracted from the hearts, livers, spleens, lungs, kidneys, brains, and intestines of six bats infected with bat coronaviruses HKU9 or GCCDC1 using the High Pure Viral RNA Kit. Partial RdRp representing HKU9 or GCCDC1 were cloned into the pGEM-T-easy Vector (Promega, Madison, WI, USA) and used as a positive control for quantitative analysis. By RT-PCR detection targeting partial RdRP, 46 (8.29%) samples were positive for HKU9 and 13 (2.34%) were positive for GCCDC1 or closely related viruses (Table 1) . A phylogenetic tree was conducted based on the alignment of partial RdRp sequences along with previously reported HKU9, GCCDC1, and related stains, as well as representative strains of other betacoronaviruses. In this study, we identified all bat species positive for coronavirus by sequencing the Cytb gene and found that HKU9 and GCCDC1 were from two different genera, Rousettus and Eonycteris, respectively.
cord-316376-76beuk0c	2020	
cord-316500-vik30moa	2020	
cord-316537-f5rto51t	2016	The clinical significance of a serologic test, both for IgM and IgG, should be defined by studies of patients with a documented infection and for whom detailed information concerning the time lapses between onset of disease and the collection of the serum specimens are known. Comparison of real-time polymerase chain reaction and serological tests for the confirmation of Mycoplasma pneumoniae infection in children with clinical diagnosis of atypical pneumonia Evaluation of five real-time PCR assays for detection of Mycoplasma pneumoniae Sensitive detection of Mycoplasma pneumoniae in human respiratory tract samples by optimized real-time PCR approach Diagnostic sensitivity of a rapid antigen test for the detection of Mycoplasma pneumoniae: comparison with real-time PCR Development of a multiplex real-time PCR assay for detection of Mycoplasma pneumoniae, Chlamydia pneumoniae and mutations associated with macrolide resistance in Mycoplasma pneumoniae from respiratory clinical specimens Real-time PCR detection of Mycoplasma pneumoniae in respiratory specimens Evaluation of a new real-time PCR assay for detection of Mycoplasma pneumoniae in clinical specimens
cord-316719-uej7d5zf	2015	
cord-316932-fia1w9jt	2005	PCR tests in which a primary "touchdown" PCR was followed by secondary reactions using PV or HRV specific primers were able to differentiate HRVs of 48 serotypes from EVs. PVnRT‐PCR and HRVnRT‐PCR were then used to test nasal and throat swabs from adult subjects with naturally acquired respiratory virus infections. 2"PCRs using a primer of sequence A together with primers complementary to either B (HRVnRT-PCR) or C (PVnRT-PCR) are then used to differentiate between HRVs and other PVs. We have applied this test directly to nasal and throat swabs from controls and from individuals with naturally acquired colds and compared the rate of PV detection by PVnRT-PCR and by cell culture. This study has shown that PVnRT-PCR is a t least five times more sensitive than cell culture for the detection of PVs in nasal and throat swabs.
cord-317000-bfc51e0m	2020	
cord-317042-dll3qt4g	2020	
cord-317049-q3bvmkf7	2020	To fill the knowledge gap in this area, we sought to describe our experience with resuming endoscopy using a two-step approach (patient screening followed by COVID-19 testing) in order to provide needed data for other practices weighing the risks and benefits of resuming endoscopic procedures. On April 13, 2020 our endoscopy unit began mandatory COVID-19 polymerase chain reaction (PCR) testing by nasopharyngeal swab for all patients prior to any endoscopic procedure. On arrival to the endoscopy unit, patients were again screened by nursing staff using the same pre-procedure questionnaire and body temperature checks. Even with a negative result, endoscopy staff used full barrier PPE and ensured compliance with hygiene and social distancing practices in pre-and post-procedure areas to minimize risks to patients and staff. Although preprocedure PCR testing for COVID-19 may help to assuage concerns of the endoscopy unit staff, this needs to be balanced against the substantial false negative rate even with the best available tests.
cord-317129-wa1j2f6b	2003	This highly efficient and safe strategy for obtaining SARS gene fragments is useful for the development of PCR assays, as well as for the preparation of reliable positive controls for PCR testing kits. This single-step sequential primer extension was expected to yield mainly final templates with no intermediate products. As shown in Figure 1 , DNA fragments in lengths of 182 and 204 bp were obtained from primers of set A and set B, respectively, by the single-step sequential primer extension where each reaction contained four partially overlapping a The expected products were extended from reverse primers (AR or BR) to the first forward primers. De novo synthesis of the PCR template complimentary to a viral genome provides a tool for the rapid development of early diagnostic assays for any new pathogen as soon as its sequence is known.
cord-317244-4su5on6s	2014	
cord-317948-svgguadm	2020	
cord-318013-5om35tu8	2020	(1-4) The authors of these reports or correspondence highlighted the added value of serological testing, which, if captured within the correct timeframe after disease onset, can detect both active and past infections.(1) By providing estimates of who is and is not immune to SARS-CoV-2, serological data can be used to estimate epidemiological variables, such as the attack rate or case-fatality rate, which are necessary to assess how much community transmission has occurred and its burden.(5) They can also be used to strategically deploy immune health-care workers to reduce exposure of the virus to susceptible individuals or to assess the effect of non-pharmaceutical interventions at the population level and inform policy changes to release such measures. After two weeks, all tests demonstrate a sensitivity of 100%, as reported by other groups, (8, 10) except when the cut-off provided by the manufacturer were used for IgG detection (i.e. one of our 15 patients was never considered as positive).
cord-318120-vfznyyz6	2015	
cord-318341-0827d8to	2020	The aim of the present study is to check the in vitro and in silico anti-dengue activity of Cyamopsis tetragonoloba supercritical extract in cell lines. The antiviral assay was performed on C6/36 cell lines with 100 copies of dengue-2 virus and maximum non-toxic dose (31.25 µg/ml) of supercritical extract and their effect was detected by real-time RT-PCR. tetragonoloba extracts) as well as experimental well (cell with 100 copies of the dengue-2 virus treated by MNTD of C. The percentages of cell viability of supercritical plants extract concentrations and anti-dengue data was analyzed by Microsoft Excel 2007 with the help of Tukey''s test (each treatment mean value different from each other and compared to control). tetragonoloba show highly significant anti-viral activity against the dengue-2 virus quantitatively with the help of a real-time PCR assay. tetragonoloba extract was found 31.25 lg/ml effective against the DENV-2 virus on C6/36 cells.
cord-318392-r9bbomvk	2017	The genomes of two Coronavirus HKU15 strains detected in the nasopharyngeal samples of two different pigs were sequenced following our previous publications 26, 27 with modifications. Divergence times for the Coronavirus HKU15 strains were calculated based on the complete genome sequence data, utilizing the Bayesian Markov chain Monte Carlo method using BEAST 1.8.0 33 with the substitution model GTR (general time-reversible model)+G (gammadistributed rate variation)+I (estimated proportion of invariable sites), a strict molecular clock, and a constant coalescent. In one (S579N) of the two Coronavirus HKU15 genomes that we sequenced in this study, variant sites were observed at four positions; two of them were due to nucleotide substitutions, and the other two were results of indels at mononucleotide polymeric regions (189th and 376th bases).
cord-318614-518giv0m	2019	
cord-318991-tw7wgpsi	2020	In accordance with guidance from the Chief Medical Officer''s office and the Royal College of Radiologists, the British Society of Thoracic Imaging (BSTI) recognises that based on the available evidence computed tomography (CT) currently has no upfront role in the diagnostic work-up of 2019 novel coronavirus (COVID-19) infection (https://www. 2 As such, in the minority of patients with high clinical suspicion but negative initial RT-PCR, the presence of typical CT appearances, such as peripheral ground-glass opacity, could be used to rapidly diagnose COVID-19 infection, until such time as multiple negative testing is sufficient to exclude or change the diagnosis. Therefore, we regard the role of CT in COVID-19 confirmed cases following RT-PCR results to be the same as in any other viral infection, in that it could be used to: (1) find co-existing or underlying diagnoses; (2) help diagnose complications, or investigate a clinically discordant picture (e.g., CRP decline, but increasing hypoxia); and (3) add value in patients with pre-existing lung diseases.
cord-319253-8bssrn9o	2018	
cord-319324-zdpbrprg	2015	
cord-319392-zg7gkf0j	2011	title: Development of a combined canine distemper virus specific RT-PCR protocol for the differentiation of infected and vaccinated animals (DIVA) and genetic characterization of the hemagglutinin gene of seven Chinese strains demonstrated in dogs A combined reverse-transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of the canine distemper virus (CDV). The phylogenetic analysis of the hemagglutinin gene of the local wild-type CDV strains revealed that the seven local isolates all belonged to the Asia-1 lineage, and were clustered closely with one another at the same location. The CDV cDNA products were further simultaneously amplified by a combined two-step RT-PCR assay using two primer sets to distinguish the vaccine and field strains. A multiplex reverse transcriptionnested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus
cord-319460-n4ezxnjc	2016	During summer 2014, animals on two farms displaying mild clinical signs were detected as positive for PEDV by PCR (Boniotti et al., 2016) , and at the beginning of 2015 a new severe epidemic wave occurred (Efsa Ahaw Panel, 2014) . We conducted a longitudinal study by sampling the feces and blood of piglet groups from each farm at fixed intervals during a 2-5 months period, and then we determined PEDV shedding and the antibody presence. The highest fecal PEDV RNA shedding titer was observed in 3-6 day-old piglets with mean values (among shedding animals) of 5.9, 5.6, 5.6, and 6.2 log 10 copies/mL on F1, F2, F3, and F4, respectively ( Figure 1B; Supplementary Table 3 ). Determining the viral loads and shedding rates of PEDV in real field situations during outbreaks is important in evaluating the virulence of a strain and in predicting the susceptibility of infected animals, at different ages and in the various farm units, within a herd.
cord-319685-dw0qsl4s	2014	Recent evidence suggests that a mutation in the spike protein gene of feline coronavirus (FCoV), which results in an amino acid change from methionine to leucine at position 1058, may be associated with feline infectious peritonitis (FIP). Tissue and faecal samples collected post mortem from cats diagnosed with or without FIP were subjected to RNA extraction and quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) to detect FCoV RNA. Data evaluating FCoV relative copy numbers in tissue and faecal samples from cats with and without FIP were analysed using a multilevel modelling approach (MLwiN v2.27) [25] , to account for the repeated measures within cats, and a non-parametric Mann-Whitney U test. Moreover, the majority (77%) of FCoV RNA sequences in faecal samples from cats with FIP had a methionine codon at position 1058 in the FCoV S protein gene, suggesting that these animals were shedding an enteric form of the virus.
cord-319845-oob2ktnz	2011	Therefore, in order to test whether active viral replication of human bocavirus is associated with respiratory diseases and to understand the clinical impact of this virus in patients with these diseases, we performed a 3-year retrospective hospital-based study of HBoV in outpatients and inpatients with symptoms of Acute Respiratory Infections (ARI) in Brazil. This article reports a cross-sectional study of HBoV in ARI patients from Ribeirão Preto, Brazil, in which the shedding of VP1 mRNA in respiratory secretions was used as surrogate marker for active HBoV replication, to look for correlations with viral load, and presence of particular clinical manifestations and simultaneous detection of other respiratory viruses. The results of this cross-sectional study of HBoV in ARI patients from Ribeirão Preto, Brazil, indicate that shedding of VP1 mRNA in respiratory secretions, as a marker of HBoV replication, correlates positively with high viral load, presence of diarrhea, and lack of co-infection by other respiratory viruses.
cord-319921-uxtydu60	2009	METHODOLOGY/ PRINCIPAL FINDINGS: We systematically analyzed the prevalence and importance of seven viral, one protozoan (Cytauxzoon felis), and several bacterial (e.g., hemotropic mycoplasma) infections in 77 of approximately 200 remaining free-ranging Iberian lynxes of the Doñana and Sierra Morena areas, in Southern Spain, between 2003 and 2007. Furthermore, the presence of feline leukemia virus (FeLV) provirus was recently reported in six samples originating from both the Doñ ana and Sierra Morena areas in southern Spain between 1994 and 2003 [29] . Thus, in the present study, we report on the prevalence of the aforementioned pathogens and we describe a dramatic FeLV epidemic, which most likely led to the death of 6 Iberian lynxes within a 6-months period in 2007, its possible origin, and its relationship to other infectious agents. However, endogenous FeLV sequences related to those of domestic cats are apparently not present in Iberian lynxes: only 5 of the 77 lynxes tested displayed weak signals by quantitative realtime PCR, which is not compatible with presence of enFeLV sequences.
cord-319970-1gu0a6cb	2015	title: Development and Laboratory Evaluation of a Real-Time PCR Assay for Detecting Viruses and Bacteria of Relevance for Community-Acquired Pneumonia Diagnostic accuracy of the qPCR assay varied between 60% positive agreement with standard tests for Streptococcus pneumoniae and 100% for Mycoplasma pneumoniae, Moraxella catarrhalis, and Staphylococcus aureus. To verify that the method could detect viruses in sputum, sputum specimens each with a volume of 350 mL were spiked with100 mL from a NpA specimen positive for either RSV or influenza A before nucleic acid extraction and qPCR assay analysis were performed as described in the sections DNA and RNA Extraction and Primers Probes and qPCR Conditions, respectively. In the evaluation of the assay performance for detection of virus in sputum, we found that sputum specimens spiked with influenza A-or RSV-containing NpA specimens were positive at 25.9 AE 0.6 (n Z 5) and 27.7 AE 1.1 (n Z 5) cycles, respectively.
cord-320002-25ivll3q	2015	BACKGROUND: Childhood community acquired pneumonia (CAP) is a significant problem in developing countries, and confirmation of microbial etiology is important for individual, as well as public health. The Pneumonia Research for Child Health (PERCH) project [15] is a 7-site case-control study to identify the cause of pneumonia among children in developing countries. Currently, there is no study from India reporting etiology of CAP in a large cohort of children, using multiple biological samples, and various sensitive as well as specific microbiologic methods. We initiated the Community Acquired Pneumonia Etiology Study (CAPES) to address this knowledge gap by determining the microbiologic etiology of CAP in a cohort of Indian children using multiple biological specimens (blood, nasopharyngeal aspirates, bronchoalveolar lavage) and the relationship between etiology and pneumonia severity. Lower respiratory infections among hospitalized children in New Caledonia: a pilot study for the Pneumonia Etiology Research for Child Health project
cord-320085-n9i54wzh	2020	We evaluated the performance of a molecular assay for the detection of SARS-CoV-2 on a high-throughput platform, the cobas 6800, using the ''open channel'' for integration of a laboratory-developed assay. We evaluated the performance of a molecular assay for the detection of SARS-CoV-2 on a high-throughput platform, the cobas 6800, using the ''open channel'' for integration of a laboratory-developed assay. The ability to quickly confirm or clear suspected cases is crucial during global outbreak scenarios, especially when clinical manifestations are difficult to distinguish from other respiratory infections such as influenza, molecular diagnostics is key for detection of the emerging virus. In this study, we demonstrated good analytical performance of an adapted SARS-CoV-2 assay on swab samples with an LoD of 689.3 copies/mL (e.g. 275.72 copies/process) at 95% detection probability, which is roughly in line with results published by Corman et al.
cord-320547-law20pmw	2016	The detection rates of respiratory viruses by Luminex xTAG® RVP fast assay, real time RT‐PCR (rtRT‐PCR) (Sacace®), and immunofluorescence assay (IFA) in adult CAP were performed in nasopharyngeal swabs (NPS) and aspirates (NPA) from 179 hospitalized adults. The aim of this study was to compare the respiratory viruses detection by Luminex xTAG 1 RVP, rtRT-PCR, and IFA in adults presenting with CAP, in secretions obtained by two nasopharyngeal secretion samples, swabs, and aspirates. Although detection rate for each virus by rtRT-PCR and by Luminex 1 were similar in NPS (P > 0.2), 10 viruses were additionally positive by rtRT-PCR (eight RV, one AdV, and one PIV) and 15 by xTAG 1 RVP Fast (eleven RV-EV, two Flu A,one hMPV, and one PIV-4) ( Table SII) , totalizing 24 patients with discordant viral detection. In the adult CAP cases herein studied the overall respiratory viruses detection rate, by both the new Luminex xTAG 1 RVP Fast and the rtRT-PCR technique was similar (51.9% vs.
cord-320617-ucm7wx8b	2018	Here, we typed Enterovirus A-D (EV) from central nervous system (CNS) and respiratory infections in Viet Nam. METHODS: Data and specimens from prospective observational clinical studies conducted between 1997 and 2010 were used. In Viet Nam, since 2005, various serotypes of EV A, most commonly enterovirus A71 (EV-A71), coxsackievirus A16 (CV-A16), CV-A10, and CV-A6 have been associated with outbreaks of HFMD [12, 13] and EVs have also been frequently detected in aetiological studies of CNS and respiratory infections [14] [15] [16] [17] [18] . Here we report the clinical associations and serotyping results of EVs that were previously detected in our studies of CNS and respiratory infections in southern and central Viet Nam between 1997 and 2010. Our study illustrates the circulation of diverse enterovirus serotypes belonging to four species (A-D), and their association with respiratory and CNS infections in Viet Nam. These data are important for patient management, laboratory diagnostics and future outbreak response.
cord-320769-qcpua9ck	2008	These results suggest that the BToV infections are sporadic in diarrheic calves in South Korea, and the Korean BToV strains are more closely related to the Japanese and Dutch BToVs than to the American and Italian BToVs. Toroviruses within the family Coronaviridae are spherical, oval, elongated, or kidney-shaped enveloped viruses that possess a positive-sense single-stranded, polyadenylated RNA genome of approximately 25-30 kb in length (Cornelissen et al., 1997; Horzinek, 1999; Snijder and Horzinek, 1993) . Based on the partial sequence of the BToV M gene, the Korean BToVs were more closely related to the Japanese and Dutch BToVs than to the American and Italian BToVs. To our knowledge, this is the first report of the detection of BToV shedding and its genetic diversity in diarrheic calves in South Korea.
cord-320787-dwyyjq6o	2020	Italy is among the world''s worst-affected countries in the COVID-19 pandemic, but so far there are no studies assessing the presence of SARS-CoV-2 in Italian wastewaters. To this aim, twelve influent sewage samples, collected between February and April 2020 from Wastewater Treatment Plants in Milan and Rome, were tested adapting, for concentration, the standard WHO procedure for Poliovirus surveillance. SARS-CoV-2 RNA detection was accomplished in volumes of 250 mL of wastewaters collected in areas of high (Milan) and low (Rome) epidemic circulation, according to clinical data. Herein we report the results of the screening for SARS-CoV-2 presence in sewage samples collected between the end of February and the beginning of April 2020 from WWTPs in Milan (Northern Italy) and Rome (Central Italy). In the absence of a standardized method for SARS-CoV-2 detection in environmental samples, RNAs were tested for the presence of SARS-CoV-2 using three different nested RT-PCR assays and one real-time qPCR assay (Table 1 and Figure 1 b) a newly designed primer set specific for SARS-CoV-2.
cord-320854-ybah03kr	2017	Suppression of PmRab11 using dsRNA-PmRab11 either before or after YHV-challenge resulted in significant inhibition of YHV levels in the hemocytes and viral release in the supernatant in both mRNA and protein levels. Protein analysis revealed that an envelope glycoprotein gp64 of YHV cannot be detected in the hemocytes and supernatant of the PmRab11 knockdown group from 24 to 72 h post-YHV challenge. The low signals of PmRab11 protein and YHV glycoprotein 64 (gp64) can be observed inside the hemocytes of PmRab11 knockdown shrimp at 24 h post-infection (Fig. 8B) . In contrast, high signals of PmRab11 and gp64 can be detected in shrimp that was injected with dsRNA-GFP and NaCl followed by YHV challenge at this time point. Similar results of the delay in shrimp mortalities can be demonstrated for the knockdown effects of other Rab proteins including PmRab7 and PmRab5 during YHV infection [11, 12] .
cord-320938-f526k9q1	2012	In order to determine whether a Flu PCR amplicon could be transfected into cells and be amplified by the influenza polymerase complex, a PCR product was produced encoding the GFP reporter gene in negative orientation flanked by the influenza segment 7 untranslated regions (UTRs) and further flanked by the human pol1 promoter and the mouse t1 termination signal, pol1EGFPt1 (Fig. 1A, Fig. S1A , Table S1 ). doi:10.1371/journal.pone.0046378.g001 Efficient influenza virus rescue using Flu PCR amplicons in either ''''1+7'''' or ''''2+6'''' modes The pol1HA pdm t1 or pol1HA D072 t1 HA PCR amplicons (Table 1) were co-transfected into co-cultured 293T/MDCK cells in a ''''1+7'''' mode along with 7 RG plasmids encoding the corresponding additional gene segments from the influenza A/Puerto Rico/ 8/1934 (H1N1) strain (PR8).
cord-321074-7jfy8cn6	2020	Quantitative Chest CT analysis was performed with a dedicated software that provides total lung volume, healthy parenchyma, GGOs, consolidations and fibrotic alterations, expressed both in liters and percentage. Lung quantification in liters showed significant differences between COVID-19 and non-COVID-19 patients for GGOs (0.55 ± 0.26L vs 0.43 ± 0.23L, p = 0.0005) and fibrotic alterations (0.05 ± 0.03 L vs 0.04 ± 0.03 L, p < 0.0001). A recent consensus statement from the Fleischner Society pointed out as imaging is indicated for medical triage of suspected COVID-19 patients presenting moderate-severe clinical features and a high pre-test probability of disease [13] . According to the hospital internal protocol, at the time of admission suspected COVID-19 patients presenting moderate-severe clinical features and a high pre-test probability of disease (fever defined as > 37.5 °C and respiratory symptoms or direct contact with a confirmed COVID-19 patient) underwent nasopharyngeal and oropharyngeal swabs for SARS-CoV-2.
cord-321076-kont2sff	2020	title: Cohort PCR Testing: A Strategic Method for Rapid SARS-CoV-2 Screening The world is currently facing an unprecedented outbreak of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which causes viral pneumonias and the coronavirus disease 2019 (COVID-19) in humans. 2, 3 Various diagnostic methods have been utilized in the detection of SARS-CoV-2, among which real time reverse transcription polymerase chain reaction (RT-PCR) assay is the most established and commonly utilized test method. Last, any cohort PCR reaction tubes that are positive for SARS-CoV-2 will be followed up by running RT-PCR on each of the individual RNA samples to identify the infected individual(s). Cohort PCR is applicable for rapid screening of family/living units in the community who are likely to be negative for SARS-CoV-2. If cohort PCR is used to test a family or living unit where one member has confirmed SARS-CoV-2 infection, then there would be a very high likelihood that the pool would be positive (increasing probability with pool size).
cord-321181-bqdsfgdc	2020	Faltaban datos sobre el numero de casos no testados en España.Para estimar rápidamente el número de casos durante la pandemia de COVID-19, la Fundación Io , lanzó, el 19 de marzo, una herramienta web llamada "Covid-19 Trends", a nivel nacional, a través de las redes sociales. La página web de la Fundación iO muestra el cuestionario (https://covid19.fundacionio.com/epidemiologicalquestionnaire.aspx), así como el enlace a los datos en formatos CVS para ser utilizados por las autoridades de salud u otros grupos como universidades o institutos de investigación, de manera gratuita y a tiempo real. El cuestionario "Covid-19 Trends" estimó más de 6.000 casos compatibles con la definición clínica del Ministerio de Sanidad, Consumo y Bienestar Social en Euskadi durante el mes anterior al primer diagnóstico de COVID-19 mediante RT-PCR; esto indica que este tipo de herramienta podría ser útil como sistema de vigilancia temprana.
cord-321284-0y69n1ea	2016	title: The use of multiplex PCR for the diagnosis of viral severe acute respiratory infection in children: a high rate of co-detection during the winter season This study confirms the high rate of detection of viral nucleic acids by multiplex PCR among hospitalized children admitted with SARI, as well as the high rate of co-detection of multiple viruses. Forty healthy age-matched asymptomatic children with no history of a recent respiratory tract infection during the previous 2 weeks, who were not admitted to the hospital, and who do not have any chronic underlying illness were included as a control group. This study confirms the high rate of detection of viral nucleic acids by multiplex PCR) among hospitalized children admitted with severe acute respiratory infection, as well as the high rate of detection of multiple viruses.
cord-321361-6bkrt49b	2020	key: cord-321361-6bkrt49b title: Reply to Suri et al.: COVID-19 Real-Time RT-PCR: Does Positivity on Follow-up RT-PCR Always Imply Infectivity? cord_uid: 6bkrt49b We read with keen interest the results of the SUMMIT (Study to Understand Mortality and Morbidity in COPD) randomized controlled trial of fluticasone furoate/vilanterol in patients with moderate chronic obstructive pulmonary disease (COPD) with a history of cardiovascular disease or at increased cardiovascular risk (1) . The trial evaluated both the value of aortic pulse wave velocity (aPWV) to predict all-cause mortality (ACM) in this population and Time kinetics of viral clearance and resolution of symptoms in novel coronavirus infection Novel Coronavirus Outbreak Research Team. Epidemiologic features and clinical course of patients infected with SARS-CoV-2 in Singapore Transmission of 2019-nCoV infection from an asymptomatic contact in Germany Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study
cord-321432-qi2knswx	2010	METHODS: We designed a pan-Microbial Detection Array (MDA) to detect all known viruses (including phages), bacteria and plasmids and developed a novel statistical analysis method to identify mixtures of organisms from complex samples hybridized to the array. We also present a novel statistical algorithm for analysis of detection/discovery arrays, which combines a predictive model of probe hybridization with a greedy likelihood maximization procedure to identify the combination of targets in a complex sample that best explains the observed probe intensity pattern. We developed a novel statistical method for detection array analysis, by modeling the likelihood of the observed probe intensities as a function of the combination of targets present in the sample, and performing greedy maximization to find a locally optimal set of targets; the details of the algorithm are shown in Methods.
cord-321443-89o13sox	2020	AIM: To clarify the status of personal protective equipment (PPE) and coronavirus disease 2019 (COVID‐19) tests for pregnant women, we conducted an urgent survey. Our study also determined that around 65.0% of facilities for doctors and 73.5% of facilities for midwives used PPE beyond the "standard gown or apron, surgical mask, goggles or face shield" during labor of asymptomatic women. 3 In order to clarify the status of PPE usage during labor and delivery and COVID-19 tests for pregnant women, we conducted an urgent survey in Japan. Status of PPE use beyond "standard gown or apron, surgical mask, goggle or face shield" during labor of women without symptoms of COVID-19 Pregnant women were tested for COVID-19 not only in perinatal medical centers and university hospitals, but also other facilities, at a rate of 9-17% (Table S2) . Appropriate guidelines for PPE usage by medical providers and COVID-19 testing for pregnant women before delivery are necessary in Japan.
cord-321514-knyw023l	2017	The objectives were to evaluate the microbiological agents linked with hypoxemia in hospitalized children with pneumonia from developing countries, to identify predictors of hypoxemia, and to characterize factors associated with in-hospital mortality. The objectives of the present study are to assess the microbiological agents linked to hypoxemia in hospitalized children with pneumonia in developing countries, to identify clinical and para-clinical predictors of hypoxemia and to pinpoint factors associated with death within 2 weeks after admission. The present study selectively comprised sites with better quality data on oxygen saturation (SO 2 ) at admission, mortality among pneumonia cases, and documented recording of patient follow-up during hospitalization. One of the objectives of this study was to assess microbiological agents and other predictors of hypoxemia and death in under 5-year-old hospitalized children with pneumonia from developing countries.
cord-321739-dnuu6jok	2015	
cord-321855-7b1c2xdh	2020	title: Silent disease and loss of taste and smell are common manifestations of SARS-COV-2 infection in a quarantine facility: Saudi Arabia PRIMARY AND SECONDARY MEASURES: The clinical presentation, prevalence of asymptomatic carriers among SARS-COV-2 positive quarantined subjects, and the difference between virus clearance among symptomatic and asymptomatic individuals. The persistent positive PCR beyond 14 days observed in the mild symptomatic residents despite being symptoms free, warrant further studies to determine its implications on disease spread and control. have examined 24 asymptomatic infected individuals with a history of close contact with SARS-COV-2 confirmed cases and found that only 20% of them developed symptoms. Our findings are in light with a recent study that reported a 59% prevalence of loss of taste and smell in a cohort of COVID-19 patients [15] . Sudden onset of loss of smell and taste were prevalent in our study and were key symptoms of mild disease.
cord-322184-kgv9f58a	2020	Conclusions: In conclusion, our study suggests that even if viral shedding is sustained in asymptomatic or mildly symptomatic patients with later phase of COVID-19, it can be expected that the transmission risk of the virus is low. In this study, we attempted to confirm the presence of viable virus by performing RT-PCR assay and culture using salivary and nasopharyngeal swabs of asymptomatic or mildly symptomatic COVID-19 patients who had been diagnosed with the disease and admitted to a CTC at least two weeks previously. Therefore, based on the evidence that the virus is rarely detected in respiratory specimens after 10 days following the onset of symptoms, especially in mild or asymptomatic cases of SARS-CoV-2 infection, even if viral shedding is sustained in the later phase of COVID-19, it can be expected that the transmission risk of the virus is low.
cord-322234-1zyy536y	2009	To evaluate the applicability of the test as a diagnostic tool in the screening of field specimens from swine, 64 field isolates of North American swine, 5 equine and 48 avian influenza viruses collected during diagnostic investigations were analyzed retrospectively as well as samples collected during an experimental in vivo infection with two novel H1N1 isolates, A/California/04/2009 (H1N1)v virus and A/Mexico/4108/2009 (H1N1)v. Swine and equine influenza virus isolates and the clinical samples from pigs infected experimentally with 2009 (H1N1)v were subjected to the USDA-validated qRT-PCR procedure for the general detection of type A influenza virus RNA (matrix screening assay), following procedures described previously (Spackman and Suarez, 2008) . All endemic North American swine influenza virus isolates were negative for (H1N1) 2009 specific matrix gene RNA using the present qRT-PCR assay, whereas the (H1N1) 2009 strains used as positive control were positive.
cord-322389-rd93y7hu	2011	
cord-322391-tumpiid5	1999	According to the virus, a viral isolation technique, immunofluorescence assays (IFA) or both were used for the detection of rhinovirus, enterovirus, respiratory syncytial (RS) virus, adenovirus, coronavirus 229E, influenza and parainfluenza virus. Results: Using IFA and viral isolation techniques, viruses were detected in 33.3% of cases, and by PCR techniques, nucleic acid sequences of virus, Chlamydia pneumoniae and Mycoplasma pneumoniae were obtained in 71.9% of cases. We also previously reported that molecular techniques were more sensitive than IFA and viral isolation for the detection of RS virus, rhinovirus, adenovirus and parainfluenza virus in nasal specimens collected from infants with bronchiolitis (Freymuth et al., 1997) , and the present study further confirmed that observation. Respiratory viruses, Chlamydia pneumoniae and Mycoplasma pneumoniae alone or associated, were detected in 81.8% of asthmatic exacerbations, with rhinovirus and RS virus being the most frequent isolated agents.
cord-322448-s04e6po9	2016	
cord-322524-bq9ok8h1	2018	Studies conducted in the 1980s and 1990s first identified RSV as a cause of acute respiratory illness in a variety of adult populations, including older adults, working-age adults, hospitalized patients, and residents of long-term care facilities [5] [6] [7] [8] [9] . A 6-season study of adults ≥50 years old with predominantly outpatient acute respiratory illness found that RSV was the third most common viral pathogen (after influenza and human rhinovirus) [19] . The objective of this study was to describe the clinical characteristics, severity, clinical outcomes, and long-term incidence of medically attended RSV illness in a community cohort of adults ≥60 years of age from the 2004-2005 through 2015-2016 influenza seasons. Seasonal incidence of medically attended respiratory syncytial virus infection in a community cohort of adults ≥50 years old
cord-322566-ye27nqj2	2017	title: Stable Internal Reference Genes for Normalizing Real-Time Quantitative PCR in Baphicacanthus cusia under Hormonal Stimuli and UV Irradiation, and in Different Plant Organs cusia in this study, and the expression stability was assessed across 60 samples representing different tissues and organs under various conditions, including ultraviolet (UV) irradiation, hormonal stimuli (jasmonic acid methyl ester and abscisic acid), and in different plant organs. However, it is necessary to select suitable reference genes as internal controls under different experimental conditions for accurate RT-qPCR evaluation because of the variability in initial material, RNA integrity, RT-PCR efficiency, and RT-qPCR efficiency (Derveaux et al., 2010) . cusia was evaluated by RNA-Seq (unpublished data) in this study to identify potential reference genes suitable for transcript normalization in experiments under UV irradiation and hormonal stimuli (MeJA and ABA), and also in different plant organs.
cord-322573-1fw1ehzd	2007	
cord-322657-q4aeood2	2004	We studied the viral etiology of acute expiratory wheezing (bronchiolitis, acute asthma) in 293 hospitalized children in a 2-year prospective study in Finland. To prevent and treat acute expiratory wheezing illnesses in children, efforts should be focused on RSV, enterovirus, and rhinovirus infections. The purpose of the study was to investigate the role of 11 respiratory viruses in children hospitalized for acute expiratory wheezing. The supernatants of cell cultures exhibiting a cytopathogenic effect were further studied by antigen detection for adenovirus; influenza A and B viruses; parainfluenza virus types 1, 2, and 3; and RSV or by reverse transcription (RT)-PCR for enterovirus-es and rhinovirus. First, respiratory virus infection was detected in up to 90% of hospitalized children with acute expiratory wheezing. In conclusion, this study showed that acute expiratory wheezing necessitating hospitalization was most often associated with RSV, enterovirus, and rhinovirus infections.
cord-322778-a411t2wg	2020	
cord-322937-lakdi3x8	2010	title: A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. In this study, a duplex TaqMan real-time RT-PCR assay was improved by adjusting the concentrations of primers and probes in the WHO protocols. The protocol of real-time RT-PCR for influenza A (H1N1) recommended by WHO used a concentration of 1000 nM each of novel SW H1 primers and 250 nM of SW H1 probe [18] . Design of multiplexed detection assays for identification of avian influenza a virus subtypes pathogenic to humans by SmartCycler real-time reverse transcription-PCR A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus Virology Journal 2010
cord-322987-zv58s79r	2020	In addition, our study provides further evidence for considering patients'' socioeconomic status as an important risk factor for COVIDKeywords: COVID-19; computed tomography; RT-PCR; polymerase chain reaction; socioeconomic; correlation; diagnosis In this study, we aimed to evaluate the correlation between the number of daily positive chest CT scans and number of daily PCR-confirmed cases and COVID-19-related deaths in Tehran during a three-month period. Figure 2 shows the trend of total patients who underwent chest CT due to high clinical suspicion and also the trend of cases with positive CT scan in each specific hospital during this three-month period. The results of our study, along with the findings of previous reports, provide evidence for policymakers and healthcare leaders to consider low-dose chest CT as a safe, rapid and reliable diagnostic tool to for the detection of COVID-19, particularly in high-prevalent regions with constraint of resources such as insufficient SARS-CoV-2 molecular test kits.
cord-323029-7hqp8xuq	2020	For aptamer selection against rIgG [6] and IgE [7] , homogenous processes were used and the separation of bound and unbound nucleic Several different SELEX methods have been used to generate immunoglobulin aptamers including homogeneous, heterogeneous, bead-based SELEX processes, CE-SELEX (capillary electrophoresis-SELEX), µFFE-SELEX (micro-free flow electrophoresis-SELEX) and fully integrated selection processes selection of aptamers with proper binding properties. Molecular Light Switch Complex 100-800 100 [128] Fluorescence enhancement using a DNA aptamer 92-37,000 57 [130] Amplification through allostery-triggered enzymatic recycling amplification NA 5 [131] Fluorescent oligonucleotide probe based on G-quadruplex scaffold for signal-on ultrasensitive protein assay 4.72-7560 0.095 [132] Fluorescence anisotropy 1000-60,000 350 [133] Fluorescence anisotropy assay NA 20 [134] Fluorescence protection assay 100-50,000 100 [136] Aptamer-barcode-based assay based on instantaneous derivatization chemiluminescence coupled to magnetic beads 4.88-20,000 4.6 [137] Competitive fluorescence quenching assay 350-35,000 170 [138] Rapid fluorescence detection of immunoglobulin E using an aptamer switch based on a binding-induced pyrene excimer NA 1600 [139] 6.1.
cord-323397-5yop6clu	2020	
cord-323473-e2pgjynr	2009	
cord-323700-5awng7h1	2018	The aim of the study here presented was to establish differences in viral detection and species sampled from different sinonasal sites, in an effort to validate and standardise viral collection techniques, and facilitate further investigation of the sinonasal virome. All DNA extracts first underwent an endogenous retrovirus 3 (ERV3) assay (present as two copies per human diploid cell) in order to confirm respiratory sample collection quality. Nasal swab samples and real-time polymerase chain reaction assays in community-based, longitudinal studies of respiratory viruses: the importance of sample integrity and quality control High rates of detection of respiratory viruses in the nasal washes and mucosae of patients with chronic rhinosinusitis Detection of herpesviruses 1-6 and community-acquired respiratory viruses in patients with chronic rhinosinusitis with nasal polyposis Real-time RT-PCR detection of 12 respiratory viral infections in four triplex reactions Real-time quantitative PCR assays for detection and monitoring of pathogenic human viruses in immunosuppressed pediatric patients
cord-323963-whv88ggl	2006	Among RNA templates, hepatitis C virus (HCV) represents an excellent example to challenge the potential of LRP technology due to its extensive secondary structures and its difficulty to be readily cultured in vitro. Thus, our LRP protocol could be applied for the amplification of other difficult RNA templates and may facilitate RNA virus research such as linked viral mutations and reverse genetics. In some experiments, we mixed a RT enzyme with Pfu DNA polymerase (Stratagene), a similar strategy as used in long PCR, to improve full-length cDNA synthesis [8] . A representative neighbor-joining (NJ) tree constructed based on HCV E1 domain of 20 clones derived from 9.1 kb LRP product, which was amplified using mixed serum from samples LIV19 and LIV23. A refined long RT-PCR technique to amplify complete viral RNA genome sequences from clinical samples: Application to a novel hepatitis C virus variant of genotype 6
cord-323973-wszo9s3d	2020	
cord-323987-gh1m05gi	2018	RIDTs with digital readout systems showed many similarities to conventional assays like small sample volume (less than 150 µL) and short analysis time (around 15 min) but exhibited much better sensitivities, even one order of magnitude lower limits of detection (LODs). Among methods mentioned, general diagnostic tests for influenza base on virus culture (conventional and shellvial), detection of viral nucleic acid (PCR) or antigens (by neuraminidase enzymatic activity, fluorescent antibody or enzyme/optical immunoassay) and serologic tests. Main trends for influenza virus detection are: (I) modifications of traditional ''gold star'' methods like PCR, RIDTs, ELISA what results in analysis time shortening, costs lowering, LOD and limit of quantification (LOQ) improvement, (II) conjugating of traditional methods and creating new platforms, micro-biochips and others, (III) introducing known solutions to new ones, like smartphone-based analysis control with results data insertion into Google Maps, (IV) reuse of the functions of known devices, like glucometer, smartphone cameras, (V) the most common used detection methods: spectral/optical, electrical, (VI) and entirely new approaches.
cord-324012-q2ilk6gs	2019	METHODS: A panel of 59 virus isolates, including H7N9, avian influenza viruses of subtype H1 to H13, swine and human influenza viruses, Newcastle disease virus, and infectious bursal disease virus, were tested by H7 and N9 iiRT‐PCR reagents, using probes and primers specific to H7 or N9, in comparison with laboratory‐based real‐time RT‐PCR assays to determine analytical sensitivity and specificity. Fifty oropharyngeal samples from experimentally infected chicken and ducks with H7N9 and 50 non‐infected control swabs were tested by the H7 iiRT‐PCR to determine diagnostic sensitivity and specificity. The H7 and N9 iiRT-PCR reagents yielded comparable levels of analytical sensitivity and specificity with real-time RT-PCR for the detection of H7N9 virus. Reverse transcription-insulated isothermal PCR (RT-iiRT-PCR) assay for rapid and sensitive detection of foot-and-mouth disease virus A rapid field-deployable reverse transcription-insulated isothermal polymerase chain reaction assay for sensitive and specific detection of bluetongue virus Rapid detection of equine influenza virus H3N8 subtype by insulated isothermal RT-PCR (iiRT-PCR) assay using the POCKIT nucleic acid analyzer
cord-324094-23kzr8rq	2008	We have developed two real-time assays ie., SYBR green I based real time reverse transcription polymerase chain reaction (RT-PCR) and RT-loop-mediated isothermal amplification (LAMP) assay for rapid detection as well as typing of some of the emerging viruses of biomedical importance viz. We have developed two real-time assays ie., SYBR green I based real time reverse transcription polymerase chain reaction (RT-PCR) and RT-loop-mediated isothermal amplifi cation (LAMP) assay for rapid detection as well as typing of some of the emerging viruses of biomedical importance viz. A one-step single tube real-time accelerated reverse transcription loop mediated isothermal amplifi cation (RT-LAMP) assays for rapid detection of some of the recently emerged human viral pathogens viz. Rapid detection and differentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplifi cation assay Development and evaluation of reverse transcription Loop mediated isothermal amplifi cation assay for rapid and Real-time detection of Japanese encephalitis virus
cord-324213-3uqlimov	2009	
cord-324321-y96x8x3h	2003	Furthermore, treatment of cells with chloroquine, which blocks the acidification of endosomes, significantly inhibited the repression of the BNip3 promoter activity induced by the acidic pH-dependent MHV mutant OBLV60, which enters cells via endocytosis, indicating that the down-regulation of BNip3 expression is mediated by fusion between viral envelope and cell membranes during entry. To establish further the specificity of the down-regulation of BNip3 gene expression, we used vesicular stomatitis virus (VSV) in a parallel experiment, because VSV is also an enveloped RNA virus whose infection has a broad host cell range and is mediated by the interaction between the envelope G protein and cell membranes (Riedel et al., 1984) . By extrapolating the data from the mutant virus, we can envision that fusion between viral envelope and plasma/endosomal membranes during wild-type MHV infection is involved in the down-regulation of BNip3 gene expression.
cord-324531-lpoelp91	2020	title: A Recurrent Mutation at Position 26340 of SARS-CoV-2 Is Associated with Failure of the E Gene Quantitative Reverse Transcription-PCR Utilized in a Commercial Dual-Target Diagnostic Assay At the current time, a number of quantitative real-time PCR (qRT-PCR) assays have been developed to identify SARS-CoV-2, targeting multiple positions in the viral genome. Here, we report the identification of a C-to-U transition at position 26340 of the SARS-CoV-2 genome that is associated with failure of the cobas SARS-CoV-2 E gene qRT-PCR in eight patients. The cobas system (Roche) implements a dual-target assay to detect SARS-CoV-2, with qRT-PCRs targeting both the ORF1ab region and the E gene (see Fig. S1 in the supplemental material). We speculated that these samples carried a common variant that interfered with the E gene qRT-PCR and carried out whole-genome sequencing of the viruses using the Artic Network protocol (17) .
cord-324944-ixh3ykrc	2018	This review gives an overview of diagnostic technologies featuring a platform based approach: (i) assay (nucleic acid amplification technologies are examined); (ii) cartridge (microfluidic technologies are presented); (iii) instrument (various detection technologies are discussed); and at the end proposes a way that such technologies can be interfaced with electronic clinical decision-making algorithms towards a broad and complete diagnostic ecosystem. In studies that have recorded the clinical presentation of patients (and not only their laboratory results), the causes of fever in outpatients could be classified into four main syndromes: 1) acute respiratory infections (ARI, of any type); 2) diarrhea (gastroenteritis); 3) fever with another clear focus (e.g. meningitis or skin infection); and 4) non-specific fevers [13] (each diagnostic platform described in Section 5 focuses on at least one of the aforementioned cases).
cord-325014-n7mnhk2v	2020	As the time window for a positive RT-PCR result is short, serological testing, which provides information about whether a person has been exposed to SARS-CoV-2, may be useful for epidemiological purposes to detect the overall burden of previous infection in a given community. The aim of this study was to determine the prevalence of current and past SARS-CoV-2 infections among police employees, a high-risk population due to their professional duties, during the COVID-19 epidemic. Neither sex (p =0.155) nor other variables listed in Figure 2 were significantly associated with the IgG results ( Figure 2 A logistic regression model predicting a positive anti-SARS-CoV-2 IgM+IgA index was developed (Cox and Snell R Square at 0.015 andNagelkerke R Square at 0.033). After including all variables listed in Figures 1 and 2 along with the number of registered cases and deaths due to COVID-19 (per 10,000 inhabitants), only 4 variables showed a correlation with a positive anti-SARS-CoV-2 IgM+IgA index.
cord-325068-j1lfq60o	2003	The results of inoculation tests performed with HUH7 cells were also positive, revealing corona-like particles that were subsequently identified as coronavirus 229E by RT-PCR performed on both culture supernatant and BAL fluid specimens. However, respiratory symptoms only appeared after completion of antiviral treatment and improvement of skin eruptions, and both viral culture and PCR for VZV performed on BAL fluid specimens were negative. The prevalence of coronavirus pulmonary infections among immunocompromised patients is unknown, and it is probably largely underestimated in the absence of the routine performance of sensitive cell culture, RT-PCR, or electron microscopy on BAL fluid specimens. Thus, only 1 case of coronavirus-associated pneumonia was previously described in an immunocompromised patient following autologous bone marrow transplantation, with the diagnosis based on the presence of viral particles in BAL fluid specimens [22] .
cord-325101-9qslo6qh	2014	Although many pathogens have been individually detected with real-time polymerase chain reaction (PCR), a comprehensive panel of agents that cause diarrhea in privately owned dogs has not yet been established. Therefore, the aim of this study was to investigate pathogenic co-infections in populations of diarrheic and control owned dogs using a real-time PCR analysis of a panel of diarrhea-causing agents. The most prevalent agent involved in co-infections was canine parvovirus type 2 (CPV-2), and 21/36 (58.3%) of the diarrheic samples positive for CPV-2 were associated with others agents, most commonly with Clostridium perfringens alpha toxin (CPA), Cryptosporidium spp., and Giardia spp. The detection of individual pathogens in the panel with real-time PCR (Table 3) showed that CPA was the most prevalent pathogen in the fecal samples, infecting 40/104 (38.5%) diarrheic dogs and 6/43 (14.0%) control dogs, and the difference between the groups was highly statistically significant (P = 0.006).
cord-325113-sou8xyld	2020	The use of unprocessed swap samples is enabled by employing a heat-stable RNAand DNA-dependent DNA polymerase, which performs the double task of stringent reverse transcription of RNA at elevated temperatures as well as PCR amplification of a SARS-CoV-2 specific target gene. A RNA-and DNA-reading heat-stable polymerase reverse transcribes and amplifies viral RNA Evidence of an acute SARS-CoV-2 infection depends on the detection of viral RNA species in patient samples, which necessitates reverse transcription of RNA followed by PCR amplification of the resulting DNA. To evaluate the potential of the high-temperature RT-PCR protocol using Volvano3G for the detection of viral RNAs in patient material, we assessed the presence of SARS-CoV-2 in RNA isolated from a small cohort of COVID-19 suspected cases. Interestingly, for most positive samples detected by the high-temperature RT-PCR with Volcano3G, the cq-values were lower compared to the standard RT-PCR (Fig 3C and 3D) , indicating that the detection of SARS-CoV-2 from unprocessed patient material is not limited by the sensitivity of this direct approach.
cord-325124-0hxan9rw	2020	However, it has been reported that only 47-59% of the positive cases were identified by some RT-PCR methods, probably due to low viral load, timing of sampling, degradation of virus RNA in the sampling process, or possible mutations spanning the primer binding sites. With the goal of improving sensitivity and accommodating various application settings, we developed a multiplex-PCR-based method comprised of 343 pairs of specific primers, and demonstrated its efficiency to detect SARS-CoV-2 at low copy numbers. We further amplified the entire SARS-CoV-2 genome from 8 to half a million viral copies purified from 13 COVID-19 positive specimens, and detected mutations through next generation sequencing. Finally, we developed a multiplex-PCR-based metagenomic method in parallel, that required modest sequencing depth for uncovering SARS-CoV-2 mutational diversity and potentially novel or emerging isolates. To overcome this constraint, we developed a multiplex-PCR-based metagenomic method that achieved >96% coverage of the S and N genes of SARS-CoV-2 in the contest of human gDNA, while only required ~0.6M of total reads per library.
cord-325137-6c6er06a	2016	Our data demonstrate that this approach provides full-length genomic sequence information not only from high-titer virion preparations but it can also recover specific viral sequence from samples with limited starting material in the background of cellular RNA, and it can be used to identify pathogens from unknown samples. NGS data from this SOP can provide complete genome coverage from viral stocks and can also detect virus-specific reads from limited starting material. Thus, in some instances, large cDNAs, double-stranded DNAs (dsDNAs), or clones containing at least two-thirds of the genome may also be regulated as SAs. Positive-sense RNA viruses span multiple virus families, and the infectious nature of these genomic RNAs coupled with SA/biosafety/biosecurity concerns inhibit rapid removal from BSL-3/4 containment (7) or transport and handling of RNA samples that are known to contain viral genomes from outbreak settings.
cord-325349-57n1878d	2020	
cord-325529-pid58g2r	2020	METHODS: We tested the efficiency and sensitivity of pooling strategies for RNA extraction and RT-PCR detection of SARS-CoV-2. Implementing the 8-sample Dorfman pooling to test 26,576 samples from asymptomatic individuals, we identified 31 (0.12%) SARS-CoV-2 positive samples, achieving a 7.3-fold increase in throughput. Some key constrains are (1) a limit on the number of stages due to the importance of delivering a test result quickly, exemplified by the urgent clinical context of COVID-19 diagnosis; (2) a limit on the ability to dilute samples and still safely identify a single positive sample in a pool; and (3) favorability of simple algorithms which may minimize human error in a laboratory setting. Specifically, we have demonstrated that pooling lysates from 5 or 8 nasopharyngeal swab samples retains sufficient sensitivity of viral RNA detection, allowing identification of SARS-CoV-2-positive individuals, while increasing throughput 5-fold to 7.5-fold.
cord-325611-tu1bn4hu	2019	We systematically collected samples from a prospective cohort of pediatric patients with respiratory infections, that returned negative results by validated molecular RT–PCR assays, and studied them with a target-independent, high-throughput sequencing-based approach. In this report, we performed a systematic study of respiratory specimens collected from a carefully characterized and highly representative, prospective cohort of pediatric cases suffering unexplained ARI, and we compared the rate of detection of pathogens by utilizing validated molecular assays, and a comprehensive sequence-independent, high-throughput sequencing-based analysis. In order to assess for the clinical relevance of the viral identifications made by HTS in the specimens collected from the unexplained cases of respiratory infections, a second cohort of age-matched healthy individuals from the same epidemiologic environment was also studied with the same methodology. Respiratory viral pathogens identified by target-agnostic HTS analysis and confirmed by contig-specific molecular assays in the respiratory specimens from the cases of respiratory infection and from the control group.
cord-325736-gs9d8y55	2000	title: Persistence of Viruses in Upper Respiratory Tract of Children with Asthma Conclusions: The persistent presence of viruses in the upper respiratory tract of asthmatic children shows a possible connection between viral infections and asthma. 4 In this study nasopharyngeal swabs were taken from asthmatic children whose asthma was well controlled, and when they were at least 3 weeks free of any respiratory infections. The samples were examined for the presence of adenovirus DNA and rhinovirus and coronavirus RNA. Five microlitres of c-DNA product were subsequently amplified in 50µl PCR reaction mixture consisting of 10 reaction buffer, 25 mM MgCl 2 , 20 mM dNTP, 5 U/l of DNA Taq polymerase (all reagents provided by Perkin Elmer, New Jersey, USA) and 50 µM of each specific primer for rhinoviruses and coronaviruses (TIB MOLBIOL, Berlin, Germany) (Table I) . found that upper respiratory tract viruses were associated with over 80% of asthma exacerbations in children.
cord-325969-9zhmmvdg	2017	In the first cohort of 159 patients whose nasopharyngeal aspirates (NPAs) tested positive for respiratory viruses during routine testing, the viral load was measured using quantitative reverse transcription PCR. Although NPAs have high viral loads and remain the specimen of choice for most patients with respiratory virus infections, supplementary molecular testing of saliva can improve the clinical management of these patients. The first part of the study consisted of patients whose NPA samples tested positive for respiratory viruses by DFA or the influenza A virus M gene by real-time RT-PCR during routine respiratory virus testing in our clinical microbiology laboratory ( Figure 1 ). In the first part of this study, saliva had a higher viral load than NPA in 17.0% of the patients who tested positive for respiratory viruses by DFA or influenza A virus by RT-PCR in their NPA samples.
cord-326017-qw4qynqv	2020	
cord-326122-5m1727m1	2014	The Pediatric Infectious Disease Society (PIDS) and the Infectious Diseases Society of America (IDSA) recommend in their guideline ''Community-Acquired Pneumonia (CAP) in Infants and Children'' the use of sensitive and specific tests for the rapid diagnosis of influenza virus and other respiratory viruses in the evaluation of children older than three months of age with CAP [19] . In another recent retrospective study of 177 children with ARI in a general hospital, antibiotic management was not influenced after detecting a viral respiratory pathogen, although the authors state that routine testing of common respiratory pathogens could lead to a better understanding of their role in disease in children with respiratory symptoms [38] . Multiple versus single virus respiratory infections: viral load and clinical disease severity in hospitalized children
cord-326130-wm3l1849	2020	To account for individuals presenting with symptoms that mimic COVID-19 disease that would prompt testing or positive diagnosis in the absence of testing, an estimate of .0957 was used based on the prevalence of college students who develop influenza-like illness in November (the earliest month with data available for the first semester) [22] . To the best of our knowledge, this is the first study that used a formal decision tree analysis to evaluate the true positives and negatives and the number of RT-PCR tests needed for a comprehensive range of COVID-19 testing strategies for repopulating a university campus. Based on the analysis of TTP, there is no value of willingness to trade off RT-PCR tests for true positive students detected for which Strategy 3 (universal, single RT-PCR testing) was preferred. In summary, strategies that include RT-PCR testing will identify more COVID-19 cases than symptom-based screening, but all approaches will fail to detect a proportion of infected students.
cord-326497-458mnekj	2020	
cord-326596-8ux1q9xw	2018	
cord-327024-1k5jucae	2018	18 reported the detection of avian nephritis virus infection in Croatian goose flocks and provided evidence that this AstV was associated with stunting and prehatching mortality of goose embryos. To determine the potential genetic mutation(s) that might occur during the goose embryo passage, the initial virus genome was sequenced using the total RNA extracted from the clinical case tissue homogenate. When the samples were tested by RT-PCR for virus shedding evaluation, the AAstV specific RNA was sequentially detected from the cloacal swabs of infected goslings from 2 to 12 dpi (Fig. 6 ). To evaluate the potential adaptive mutation (s) of the virus that might occur during the process of goose embryo passage, we sequenced the complete genome of initial virus using the total RNA extracted from the clinical case tissue homogenate of kidney, spleen, and liver using the method described above.
cord-327069-vjlisnui	2017	To build capacity at the sites, and in alignment with the priorities of the Bill & Melinda Gates Foundation, all PERCH testing was done locally, with the exception of quality assurance testing and a select subset of specialized assays, which were performed at the study reference laboratory (Canterbury Health Laboratories, Christchurch, New Zealand), which also served as the study specimen and isolate biorepository. Induced sputum, pleural fluid, and lung aspirate specimens were collected in saline in universal containers and either refrigerated at 2°C-8°C for a maximum of 24 hours, or frozen at -80°C prior to nucleic acid extraction. Organism identification was done according to standard microbiological methods that were documented in SOPs and clarified at each site at the outset; antimicrobial susceptibility testing followed the Clinical and Laboratory Standards Institute (CLSI) guidelines [15] .
cord-327105-7dsgs2sd	2020	title: Distinct changes in the real-time PCR detectability of certain SARS-CoV-2 target sequences [1] highlighted notable aspects of the PCR-based diagnosis of SARS-CoV-2 infection, namely that the PCR-based detectability of certain loci might differ significantly and change over time. In our practice we also observed that the SARS-CoV-2 PCR positivity in the oropharyngeal swabs of patients might persist for weeks [2] , however, the characteristics of positivity (including the target sequences detected) may change in a predictable manner. Our results might indicate that the detectability of the viral Orf1a-related RdRp sequence might fade more rapidly during convalescence, only later followed by the N gene. This phenomenon might affect the interpretation of the results, as detecting a lone N gene might suggest a later presentation within the course of the disease. Dynamic change process of target genes by RT-PCR testing of SARS-Cov-2 during the course of a Coronavirus Disease 2019 patient Profile of RT-PCR for SARS-CoV-2: a preliminary study from 56 COVID-19 patients
cord-327259-7o7fs4yb	2020	We aim to evaluate pooling tests in experimental procedures, as well as perform in silico statistical modeling analysis validated with specimen samples obtained from a mass testing program of Industry Federation of the State of Rio de Janeiro (Brazil). This data was validated with the results obtained in our mass testing program: statistical modeling predicted a cost saving of 48.0%, which in practice, was 51.5%, already considering the expenditures with pool sampling that were analyzed individually. To assess the advantages of the pooling approach, we used previous qRT-PCR results obtained in the diagnostic analyses performed with industrial workers of Rio de Janeiro state as a base to calculate the prevalence rates (%) of positive cases and to build the statistical modeling methodology. Our study adopted the statistical modeling approach and validated the data with pooling biological samples for COVID-19 diagnostic, confirming that the pool size must be selected according to the prevalence rate of positive cases in the population (Figure 2) .
cord-327344-8gi1wb76	2009	This article describes the development and optimization of a reverse transcription (RT) real-time PCR assay for quantification of HRV RNA in clinical samples. Clinical specimens originated from the Virology Unit of the Fig. 1 Standard curve (from 10 2 to 10 5 copies/reaction) and dynamic range (from 10 7 to 10 1 copies/reaction) of the real-time RT-PCR developed in this study Azienda Ospedaliero-Universitaria San Giovanni Battista, Turin, and included 110 bronchoalveolar lavages (BAL) obtained from 84 patients (M/F, 57/27; mean age, 57.8 years; range, . The performance of the RT real-time PCR developed in this study was examined over different concentrations of HRV RNA and it was found to be very sensitive with a minimum cut-off for detection of 10 0 copy/reaction and was linear up to 10 1 copies. In conclusion, the RT real-time PCR assay developed in this study could represent a useful tool for diagnosing HRV infections, quantifying the viral load and could be applicable for routine diagnostic workup of upper as well as lower respiratory tract diseases.
cord-327620-fwhhsnmq	2003	
cord-327675-uo839gvc	2019	(2011) showed that infective H5N1 virus could be detected at least 72 h PE from house flies while viral RNA was still found by real-time reverse-transcription polymerase chain reaction (RRT-PCR) 96 h PE. The aim of this study was to investigate the acquisition of H9N2 AIV by the house fly under laboratory conditions and to determine virus persistence in external surface and within house fly using quantitative reverse-transcription PCR. The potential of house fly, Musca Domestica (L.) in the mechanical transmission of influenza A subtype H1N1 virus under laboratory conditions Persistence of low-pathogenic avian influenza H5N7 and H7N1 subtypes in house flies (Diptera: Muscidae) Detection and isolation of highly pathogenic H5N1 avian influenza A viruses from blow flies collected in the vicinity of an infected poultry farm in Kyoto Avian influenza virus H5N1 remained exist in gastrointestinal tracts of house flies 24 hours post-infection
cord-327682-i3uim0zi	1999	It has been shown in a number of studies that virtually all the enterovirus serotypes and most of the HRV isolates can be detected using these primer sequences (Hyypiä et , 1989; Horsnell et al., 1995; Pulli et al., 1995; Arola et al., 1996; Huttunen et al., 1996; Pitkäranta et al., 1997; Hyypiä et al., 1998; Oberste et al., 1998) The authors became convinced of the usefulness of this technique during a recent outbreak of aseptic meningitis in Finland. Partial sequence analysis of virtually all enterovirus serotypes has shown that they belong to these four clusters (Pulli et al., 1995; Huttunen et al., 1996) and that the VP4/VP2 region sequence can be used for molecular typing of clinical isolates (Arola et al., 1996) . In hepatitis A virus infections, the molecular epidemiology has been investigated by many reseach groups and an extensive analysis of partial sequences from different geographic locations has been used to establish a useful database for further studies (Robertson et al., 1992) .
cord-327894-b0bsseui	2020	En respuesta a la COVID-19, el gobierno español inicialmente instó a limitar el contacto social como medida general, sin embargo, otros países, además, implementaron pruebas generalizadas para la infección por SARS-COV-2 desde el principio de la pandemia. Son test sencillos de hacer, pero deben ser interpretados con prudencia, en relación con el curso de la infección, sobre todo por la tasa de falsos negativos en la detección de IgM ya que la respuesta de IgM en un enfermo COVID-19 puede tardar en aparecer desde varios días a dos semanas 21 Algunos estudios han mostrado que durante los primeros 7 días desde el inicio de síntomas, menos de un 40% de pacientes presentan anticuerpos IgM detectables.
cord-328206-iylw1bvw	2012	In this study, applying novel AllGlo fluorescent probes, we established a quadruplex quantitative PCR method to simultaneously detect and differentiate HPV 6, 11, 16 and 18 in a single tube. So AllGlo quadruplex quantitative PCR has the advantages of relatively high throughput, good reproducibility, high sensitivity, high specificity, it is easy for designing the probes and primers of multiplex qPCR and can increase the detection throughput. Two aliquots were used for the detection of HPV6-11 and HPV16-18 mixed types by TaqMan uniplex probe fluorescence quantitative PCR (Guangzhou Da''an Diagnostic Co., Ltd., China). Single-tube AllGlo probe quadruplex fluorescence qPCR could simultaneously type HPV 6, 11, 16, and 18 and quantitatively detect the viral load of each HPV at the same time. Single-tube AllGlo probe quadruplex fluorescence qPCR could simultaneously type HPV 6, 11, 16, and 18 and quantitatively detect the viral load of each HPV at the same time.
cord-328373-cubp1cc1	2020	In the current study the use of a novel digital PCR assay to detect SARS-CoV-2 in both clinical patient-derived samples and environmentally derived samples was investigated, with the ultimate aim of reducing the rate of false negative results. Thirty-two patient samples including nasopharyngeal swabs, throat swabs, oropharyngeal swabs, phlegm, plasma/blood, and eye conjunctiva were collected at multiple timepoints during the disease course, and tested for the presence of SARS-CoV-2 via RT-PCR. SARS-CoV-2 nucleic acid sequences were detected in all clinical patient samples (respiratory tract samples including nasopharyngeal and oropharyngeal swabs). To prevent false-negative SARS-CoV-2 nucleic acid-based test results, and develop a new sensitive detection assay, we evaluated the performance of real-time RT-PCR and digital PCR for detecting SARS-CoV-2 nucleic acid in clinical patient-derived samples and environmentally derived samples. Strikingly, digital PCR detected SARS-CoV-2 nucleic acids in several samples that had previously tested negative via real-time RT-PCR, including 3 patient-derived samples and 5 environmentally derived samples.
cord-328409-px92ff89	2020	After the first PCR turned in negative another PCR-analysis for SARS-CoV-2 of a deep oral swab-sample was performed since the clinical, laboratory and radiological findings were typical for COVID-19. After the first PCR turned in negative another PCR-analysis for SARS-CoV-2 of a deep oral swab-sample was performed since the clinical, laboratory and radiological findings were typical for COVID-19. After a third attempt for a PCR-analysis of a deep oral swab-sample was negative, analysis of a sputum was performed which finally confirmed the diagnosis of COVID-19 associated pneumonia. After a third attempt for a PCR-analysis of a deep oral swab-sample was negative, analysis of a sputum was performed which finally confirmed the diagnosis of COVID-19 associated pneumonia. Als Diagnostik der Wahl zur schnellen Identifikation von COVID-19-Fällen hat sich dabei die PCR-Analyse auf SARS-CoV-2 aus tiefen nasopharyngealen oder oropharyngealen Abstrichen etabliert [3] .
cord-328460-thx9zh11	2012	
cord-328526-es8t6t0j	2010	Since its discovery, avian bornavirus (ABV) has been successfully cultured from the brains of psittacines diagnosed with PDD, providing a source of antigen for serologic assays and nucleic acid for molecular assays. Subsequently the authors have isolated ABV by culture in duck embryo fibroblasts using material from the brains of 5 additional birds with necropsy-confirmed PDD (Fig. 2) . Lierz and colleagues 34 have also shown that apparently healthy birds within an aviary where clinical cases were occurring were also shedding ABV as detected by fecal swabs. Diagnostic tests such as Western blots or fecal PCR can identify many, but not all ABV-infected birds, and should be employed to control the spread of this disease. Advances in understanding of proventricular dilation disease (PDD): detection of virus and viral nucleic acid in infected birds Unususal and severe lesions of proventricular dilatation disease in Cockatiels (Nymphicus hollandicus) as healthy carriers of avian bornavirus and subsequently infected with a virulent strain of the same ABV genotype.
cord-328534-66c2tg5r	2013	
cord-328633-c31xsyeo	2012	
cord-328795-rs1sd42z	2016	The incidence of HRV infection in children during the first 2 years of life was noted to be 0.7-2 infections per year in older studies using cell culture for viral detection (Brownlee and Turner, 2008) . Although symptoms associated with ''the common cold'' syndrome are often attributed to HRV disease, the clinical findings of rhinovirus infections are indistinguishable from those of other viral pathogens. Currently, there are no antiviral drugs approved for clinical use in HRV infections although a few agents have been advanced to clinical trials and shown modest results in decreasing either symptom severity or viral activity. Conversely, monoclonal antibody blockade of the ICAM-1 receptor, the site of cellular attachment for the majority of HRV-A and HRV-B serotypes, has also been studied and demonstrated a reduction in the severity of symptoms and viral shedding but failed to prevent infection in the rhinovirus challenge model (Greenberg, 2003) .
cord-328961-waxtb759	2002	Comparative sequence analysis of the PCR products of the M gene and fragments of the pol1a and pol1b genes of canine coronavirus (CCoV) have demonstrated that two separate clusters of CCoV are present in dogs. The sequence analysis of the PCR products of the M and S genes carried out on the faecal samples from the two pups confirmed that the FCoV-like CCoV had caused the disease (personal observations). On the basis of these preliminary results, a PCR assay was developed to detect and identify the FCoV-like CCoV strains from faecal samples of infected dogs. In a previous study, similar nucleotide substitutions in the binding site of the internal primer CCoV3 used for the n-PCR were demonstrated in the sequence analysis of the PCR products from five faecal samples of pups with diarrhoea.
cord-329052-jan20ljs	2020	BACKGROUND: Current guidelines for returning health care workers (HCW) to service after a positive SARS-CoV-2 RT-PCR test and ceasing of transmission precautions for patients is based on two general strategies. Alternatively, due to the limited availability of testing, many sites employ a symptom-based strategy that recommends excluding HCW from the workforce and keeping patients on contact precautions until a fixed period of time has elapsed from symptom recovery. The underlying assumption of the symptom-based strategy is that waiting for a fixed period of time is a surrogate for negative RT-PCR testing, which itself is a surrogate for the absence of shedding infectious virus. STUDY DESIGN: We performed an observational analysis of 150 patients and HCW that transitioned from RT-PCR SARS-CoV-2 positive to negative over the course of 2 months at a US academic medical center. We performed an observational analysis of 150 patients and HCW that transitioned from RT-PCR SARS-CoV-2 positive to negative over the course of 2 months at a US academic medical center.
cord-329069-ejdunj41	2020	
cord-329148-zs18ez5q	2017	
cord-329162-6w8qcv1c	2018	The existing approaches for the design of oligonucleotides for targeted enrichment are usually involved in the development of primers for the PCR-based detection of particular viral species or genera, but not for families or higher taxonomic orders. We have subsequently designed a genus-specific oligonucleotide panel for targeted enrichment of viral nucleic acids in biological material and demonstrated the possibility of its application for virus detection in bird samples. We have applied this approach to design genus-specific primer pairs for targeted enrichment of cDNA from zoonotic RNA viruses and have evaluated it using several samples from birds. The control samples cDNA was obtained by reverse transcription reaction performed on 5 L of the extracted RNA using the Reverta-L RT kit (AmpliSens; total volume of the reaction mixture is 20 L); after that 5 L of the reaction mixture containing cDNAs was further used for evaluation of the ability of the primer pair to amplify the targeted region of viruses, both in single and in multiplex PCR format.
cord-329395-4k8js9v2	2020	Polymerase chain reaction (PCR)-based assays are the gold standard for detecting viral RNA in patient samples and are used extensively in clinical settings. To enable the application of PCR in resource-poor or non-specialist laboratories, we have developed and evaluated a nested PCR method for SARS-CoV-2 RNA using simple agarose gel electrophoresis for product detection. Using clinical samples tested by conventional qPCR methods and RNA transcripts of defined RNA copy number, the nested PCR based on the RdRP gene demonstrated high sensitivity and specificity for SARS-CoV-2 RNA detection in clinical samples, but showed variable and transcript length-dependent sensitivity for RNA transcripts. The sensitivity of the nested PCR and two RT-qPCR methods was compared by measuring the 118 50% endpoints (50EP) of detection for serial dilutions of the four transcripts described above 119 (Table 1, Figure 2 ). Protocol: Real-time RT-PCR assays for the detection of SARS-CoV-2
cord-329517-3yn80r9h	2009	title: Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Ten-fold dilutions of the pVP3 plasmid DNA were tested by the established FQ-PCR assay to evaluate the sensitivity of the system, and the detection limit was found to be 2.8 × 10 1 copies/reaction. Viral load quantification using the established FQ-PCR demonstrated that the GPV DNA copy number of each sample could be calculated using the cycle threshold (Ct) value determined from the standard curve. In conclusion, the established real-time PCR assay was rapid, sensitive, and specific for the detection and quantification of GPV DNA.
cord-329564-tmi1u224	2020	title: COVID-19 in 2 Persons with Mild Upper Respiratory Tract Symptoms on a Cruise Ship, Japan We created an illustration showing the floors where the eventual COVID-19 case-patients worked or shopped, along with dates of symptom onset, potential incubation periods, symptom durations, confirmed times of positive diagnosis, and times of discharge ( Figure 1, panel A) . By February 28, a total of 705 COVID-19 cases were confirmed among 4,061 passengers and crew tested; 392 cases were asymptomatic, 36 persons were admitted to intensive care units, and 6 patients died (2) . Because of the lower threshold for testing persons on board, the cruise ship created an opportunity to observe mild COVID-19 cases and monitor patient symptoms. We describe 2 cases of coronavirus disease in patients with mild upper respiratory symptoms. We describe 2 cases of coronavirus disease in patients with mild upper respiratory symptoms. Clinical courses of 2 case-patients with coronavirus disease (COVID-19) admitted from a cruise ship docked in Japan, 2020.
cord-329643-hhk900c1	2020	Here we demonstrate the long-term stability of nasopharyngeal swab specimens for SARS-CoV-2 molecular testing across three assays recently approved by the U.S. FDA under Emergency Use Authorization. This study demonstrates that nasopharyngeal swab specimens can be stored under refrigeration or even ambient conditions for 21 days without clinically impacting the results of the real-time RT-PCR testing. determined that short delays (up to 4 days) in processing influenza nasal and throat swabs did not significantly affect the ability to detect viral particles by real-time RT-PCR.(5) More recently the stability of SARS-CoV-2 detection in different types of storage media over a 14-day period was evaluated. This study utilized three different automated real-time reverse-transcriptase polymerase chain reaction (RT-PCR) in vitro diagnostic platforms (Luminex ARIES, Panther Fusion, and Abbott m2000) currently in use for clinical testing of SARS-CoV-2 at the Department of Pathology, Division of Virology, Montefiore Medical Center, Bronx, NY.
cord-330079-pdaowkop	2012	
cord-330594-uq2h8rmv	2008	
cord-330602-g0xaonxv	2013	Japanese traditional surveillance is based on definitive diagnosis and is enforced by the infection control laws in Japan for the early detection of agents of bioterrorism and outbreaks of emerging infectious diseases. The purpose of the present study was to evaluate whether the PCR method triggered by the results of the prescription surveillance system can rapidly and accurately identify causative pathogens of local outbreaks of infection. Between October 4 and 28, 2011, 50 patients were included in the present study who either presented at a single clinic with a chief complaint of respiratory symptoms or fever or were suspected of having respiratory tract infections after being identified through the syndromic prescription surveillance system. Here, we examined a combination of syndromic surveillance and PCR testing and showed the potential to identify pathogens during the early stage of an outbreak of respiratory infections.
cord-330800-s91zfzfi	2020	
cord-331413-fejho1of	2007	title: Rapid optimization of antimicrobial chemotherapy given to pediatric patients with community-acquired pneumonia using PCR techniques with serology and standard culture Abstract Children (n =117; mean age 2.4 ± 2.9 years) were diagnosed as having community-acquired pneumonia (CAP) using clinical symptoms, chest X-rays, and hematological data. The causative pathogen was determined using real-time polymerase chain reaction (PCR) (6 bacteria), multiple reverse transcription-PCR (MPCR; 11 viruses), bacterial culture, and serology. [7] [8] [9] In Japan, antimicrobial chemotherapy for patients with CAP is begun empirically based on (1) chest X-rays, (2) clinical fi ndings including respiratory status, (3) age, and (4) laboratory tests such as white blood cell count (WBC) and C-reactive protein concentration (CRP). The bacteria suspected to be the causative pathogens was determined by standard culture and real-time PCR for six pathogens: Streptococcus pneumoniae, Haemophilus infl uenzae, Mycoplasma pneumoniae, Chlamydophila pneumoniae, Streptococcus pyogenes, and Legionella pneumophila (Table 3) In the patients suspected of having an infection caused by S.
cord-331455-dfnn9mrf	2020	title: The utility of chest computed tomography (CT) and RT-PCR screening of asymptomatic patients for SARS-CoV-2 prior to semiurgent or urgent hospital procedures Here, we describe our experience and the results of implementing this safety project of screening and testing patients for SARS-CoV-2 (COVID-19) prior to semiurgent or urgent hospital procedures using both CT chest imaging and RT-PCR testing. If the phone-screening questionnaire was entirely negative, the patient would undergo a SARS-CoV-2 nasopharyngeal swab PCR 48 hours prior to the elective hospital procedure as well as CT imaging of the chest the day before the procedure. 17 Among asymptomatic patients on the Diamond Princess cruise ship who tested positive for SARS-CoV-2 by RT-PCR, CTs scan were negative for pulmonary opacities in 46% of cases, 18 although the prevalence of disease was relatively high in this cohort (~26%).
cord-331475-mmcu18c8	2018	title: Selection and validation of suitable reference genes for qPCR gene expression analysis in goats and sheep under Peste des petits ruminants virus (PPRV), lineage IV infection In this study, we evaluated the expression stability of ten most commonly used reference genes (GAPDH, ACTB, HSP90, HMBS, 18S rRNA, B2M, POLR2A, HPRT1, ACAC, YWHAZ) in fourteen different Peste des petits ruminants virus (PPRV) infected tissues of goats and sheep. GAPDH (Glyceraldehyde-3-phosphate dehydrogenase), 18S rRNA (18S ribosomal RNA), B2M (β 2 microglobulin), HSP 90 (heat shock protein 90), ACAC-alpha (Acetyl coenzyme carboxylase alpha), HMBS (Hydroxymethylbilane synthase), YWHAZ (Tyrosine 3-monooxygenase activation protein zeta polypeptide), POLR2A (Polymerase 32 II (DNA directed) polypeptide A), ACTB (beta actin) and HPRT1 (Hypoxanthin Phosphoribosyl transferase 1) in fourteen different tissues obtained from healthy and PPRV infected goats and sheep to identify the best possible reference gene(s) for qRT-PCR normalization.
cord-331496-5xak7z6b	2020	We anticipate it will be a useful tool in screening for exposure to SARS-CoV-2; however, the use of the CoV2T and other serologic assays in the clinical management of patients with COVID-19 is unknown and must be evaluated in future studies. In this study, we describe validation of one of the first assays to receive EUA on an automated platform, the Vitros Anti-SARS-CoV-2 Total (CoV2T; Ortho Clinical Diagnostics) antibody assay, for screening of previous exposure to SARS-CoV-2 in our patient population. Seroconversion in our patient population was assessed by correlation of chart review of 55 patients known to be positive for SARS-CoV-2 by RT-PCR and known date of symptom onset with sample reactivity by the CoV2T assay. Specimens from 14 patients with acute infections, previously tested to be negative for SARS-CoV-2 by RT-PCR but positive for another respiratory viral infection by molecular analysis, were nonreactive by the CoV2T assay.
cord-331557-8axi74nn	2004	
cord-331558-6rqd3fmj	2020	Although the conjunctiva is directly exposed to extraocular pathogens, and the mucosa of the ocular surface and upper respiratory tract are connected by the nasolacrimal duct and share the same entry receptors for some respiratory viruses, the eye is rarely involved in human CoV infection, conjunctivitis is quite rare in patients with 2019-nCoV infection, and the CoV RNA positive rate by RT-PCR test in tears and conjunctival secretions from patients with 2019-nCoV and SARS-CoV infection is also extremely low. Considering that close doctor-patient contact is quite common in ophthalmic practice and is apt to transmit human CoVs via droplets and fomites, strict hand hygiene and proper personal protection are highly recommended for health care workers to avoid hospital-related viral transmission during ophthalmic practice. Considering that close doctor-patient contact is quite common in ophthalmic practice and is apt to transmit human CoVs via droplets and fomites, strict hand hygiene and proper personal protection are highly recommended for health care workers to avoid hospital-related viral transmission during ophthalmic practice.
cord-331616-arnuoufn	2004	The authors compare MAP testing with PCR-based detection methods, focusing on differences in animal use, laboratory requirements, sample size, and limits of detection. Until recently, the mouse antibody production (MAP) test was the primary method of screening for viruses of murine origin 6 ( Table 1) , but the application of modern molecular biology methods to this purpose presents certain advantages. Because PCR amplifies only DNA molecules, one detects viruses with RNA samples from the animals and test them for virus-specific antibodies using the enzymelinked immunosorbent (ELISA), indirect fluorescent antibody (IFA), or hemagglutination inhibition (HAI) assays. To prevent false-positive results due to contamination with PCR templates, reagent preparation, sample processing, and PCR amplification/product detection should all take place in separate laboratories. Comparison of the sensitivity of in vivo antibody production tests with in vitro PCR-based methods to detect infectious contamination of biological materials
cord-331740-yjt3q9ph	2011	This real-time RT-PCR test was used to examine a panel of field samples and its performance compared to virus isolation in embryonated fowls'' eggs. Design and calibration of IBV real-time RT-PCR To confirm that the modified test was suitable for detecting contemporary UK field strains of IBV, a panel of laboratory isolates of IBV representing the major genotypes currently circulating in the UK was tested . The validity of the result obtained for 38 of the 173 real-time RT-PCR positive, virus isolation negative samples could be confirmed by sequencing of the amplicon generated by the diagnostic RT-PCR. Infectious bronchitis virus RNA has been detected in tracheal swab samples by other real-time RT-PCRs for at least 21 days post-vaccination (Callison et al., 2006) and has been isolated from faecal samples in some infected birds as long as 227 days post-infection Gough, 1977, 1978) , making it essential to be able to differentiate between vaccine and field strains for diagnostic purposes.
cord-331932-oujdl459	2015	The user‐friendly assay detected and differentiated between four viruses [porcine reproductive and respiratory syndrome virus (PRRSV), influenza A virus, porcine circovirus type 2, porcine respiratory corona virus], four bacteria (Mycoplasma hyopneumoniae, Pasteurella multocida, Salmonella enterica serovar Choleraesuis, Streptococcus suis), and further differentiated between type 1 and type 2 PRRSV as well as toxigenic and non‐toxigenic P. Here, a microarray assay with associated multiplex RT-PCRs for detection and differentiation of four viruses and four bacteria involved in PRDC using a novel user-friendly electronic microarray in which capture probe printing, hybridization, washing and reporting are fully integrated and automated is described. Similarly, representative whole-genome sequences, as well as full and partial sequences of homologous genes from related and unrelated non-targets such as TGEV, porcine circovirus type 1 (PCV1), as well as other Salmonella enterica serovars, and Mycoplasma species were downloaded for in silico analysis of probe specificity. The analytical specificity of the viral and bacterial multiplex PCR assays was assessed by amplifying panels of 14 non-target viruses and 21 bacteria, respectively (Table 3) .
cord-332024-jk983q4p	2005	We describe a diagnostic system for rapid, sensitive, multiplex discrimination of microbial gene sequences and report its application for detecting 22 respiratory pathogens in clinical samples. We describe a diagnostic system for rapid, sensitive, multiplex discrimination of microbial gene sequences and report its application for detecting 22 respiratory pathogens in clinical samples. To address the need for sensitive multiplex assays in diagnostic molecular microbiology, we created a polymerase chain reaction (PCR) platform in which microbial gene targets are coded by a library of 64 distinct Masscode tags (Qiagen Masscode technology, Qiagen, Hilden, Germany). Multiplex primer sets were designed to identify up to 22 respiratory pathogens in a single Mass Tag PCR reaction; sensitivity was established by using synthetic DNA and RNA standards as well as titered viral stocks; the utility of Mass Tag PCR was determined in blinded analysis of previously diagnosed clinical specimens.
cord-332042-bqtflk7r	2019	Influenza A and B viruses are identified and characterized using real-time reverse-transcriptase polymerase chain reaction (RT-PCR), and multiplex testing has been performed on a subset of patients to identify other respiratory virus aetiologies. The CIRN SOS Network comprises 15 to 45 acute care (depending on the year) hospitals across Canada, and influenza testing is performed using real-time reverse-transcriptase polymerase chain reaction (RT-PCR) methods derived from the World Health Organization (WHO) [12] [13] [14] . While WHO-based real-time RT-PCRs methods are often viewed as the reference standard for influenza virus detection, diagnostic laboratories and surveillance studies often test for other viral aetiologies of respiratory illness [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] . This study''s strengths include prospectively collected specimens from a defined patient population (adults hospitalized with acute respiratory illness), comparison of results against reference methods for influenza A and B detection, and analyses performed on influenza viruses characterized by subtyping or lineage determination.
cord-332053-df44guu7	2015	The Effect of Viral Infection on Exhaled Nitric Oxide in Children with Acute Asthma Exacerbations Jonathan Malka, MD a,b , Ronina Covar, MD c,d , Anna Faino, MS e , Jennifer Fish, CPNP f , Paige Pickering, BS g , Preveen Ramamoorthy, MD g , Melanie Gleason, PAC b,h , and Joseph D. All patients who presented to the Urgent Care Clinic at National Jewish Health for an acute asthma exacerbation and who had undergone spirometry and FENO measurements within the last 6 months when clinically stable (visit 1) were approached to participate in the study (Figure 1 ). We found FENO levels to be the highest in children with acute asthma exacerbations that were not associated with viral infections [PCR(À)]. B, Change in exhaled nitric oxide levels from baseline, during an exacerbation, and following a course of prednisone in adjusted models.
cord-332333-vw5ogccq	2020	
cord-332510-x3znuwc0	2020	
cord-332522-adul9nzf	2004	In this study, 12 sets of nested primers covering the SARS-CoV genome have been screened and showed sufficient sensitivity to detect SARS-CoV in RNA isolated from virus cultured in Vero 6 cells. To optimize further the reaction condition of those nested primers sets, seven sets of nested primers have been chosen to compare their reverse transcribed efficiency with specific and random primers, which is useful to combine RT with the first round of PCR into a one-step RT-PCR. Through investigations on a test panel of whole blood obtained from 30 SARS patients and 9 control persons, the specificity and sensitivity of the Taqman RT-nested PCR system was found to be 100 and 83%, respectively, which suggests that the method is a promising one to diagnose SARS in early stages. To compare the sensitivities of these 12 sets of nested primers, serial 10-fold di-lution genome cDNA of BJ01 that reverse transcribed with random primer was used as the template to carry out the nested PCR.
cord-332539-v1bfm57x	2020	
cord-333216-fdwmsnz9	2020	Data posted in the COVID 19 tracking website for RT-PCR (PCR) results and hospital admissions are used to estimate the prevalence of the SARS-CoV-2 pandemic in the United States (1). A higher recovered population mitigates the current positive value attainable by limiting the infectivity rate Re. This approach provides an alternate source of information on the pandemic''s full time course since the serological testing only views a narrow time slice of its history due to the transient nature of the antibody response and its graduated expression dependency on the severity of the disease. This paper relies on the integration of % PCR positive test results over time, cycle-corrected for the length of disease, and coupled with hospital admissions to control for PCR testing sample bias, to estimate the kinetics and prevalence over the time course of the pandemic in the United States. Figure 4A shows the time course comparison of the SARS-CoV-2 United States infected population obtained from PCR tests and NHA.
cord-333261-knj2rrut	2011	To facilitate the collections of HRV sequences over a number of years, a virology experiment was designed in which students test nasal lavage samples to look for HRV infection. The extensive data available on HRV genomes enables many bioinformatics opportunities for students, including alignment of genome sequences to look for mutations at the RNA level and differences among protein sequences. Students can examine differences in the HRV serotypes over several years of data regarding a university population to identify HRV mutations that have occurred and their severity in causing symptoms in the host. In this inquiry-based laboratory project, students use a variety of techniques, including RNA isolation, cDNA synthesis, qPCR, and agarose gel electrophoresis to look for the presence of HRV in nasal lavage samples from human subjects. By analyzing surveys in which subjects indicate severity of their symptoms, stress factors, and average hours of rest per night, students can identify possible contributors to HRV infection.
cord-333413-8buawes0	2020	Being a typical ground-breeding bird of the agricultural landscape in Germany, the pheasant has experienced a strong and persistent population decline with a hitherto unexplained cause. In the present study, 62 free-ranging pheasant chicks were caught within a two-year period in three federal states of Germany; Lower Saxony, North Rhine-Westphalia and Schleswig-Holstein. Pheasant chick deaths may often have been triggered by poor nutritional status, probably in association with inflammatory changes in various tissues and organs as well as bacterial and parasitic pathogens. In 2014 and 2015, the Institute for Terrestrial and Aquatic Wildlife Research (ITAW), University of Veterinary Medicine Hannover, Foundation, Hannover and the Wildlife Research Institute, State Office for Nature, Environment and Consumer Protection of North Rhine-Westphalia caught free-living Ring-necked Pheasant chicks from Lower Saxony (Cuxhaven, Grafschaft Bentheim, Emsland, Osnabrück, Vechta), North Rhine-Westphalia (Coesfeld, Warendorf) and Schleswig-Holstein (Dithmarschen) to assess the health state by means of pathological, microbiological, virological, parasitological and toxicological investigations.
cord-333453-v3gap8kj	2020	The novel coronavirus officially named severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) by the International Committee on Taxonomy of Virus generated a pandemic, which erupted in Hubei, Wuhan, China and quickly spread throughout the world, [1, 2] has been putting medical workers all over the world in difficulty because of the high number of cases combined with the lack of information about the disease. The clinic where the patient was born discharged her and the mother on April 6, 2020 both being negative for SARS-CoV-2 (RT-PCR test). On April 15, after 3 days of observing cough, lethargy, loss of appetite, jaundice, and constant fever, the mother presented in emergency room with the newborn, both being tested positive for SARS-CoV-2. [10] We believe it is important in the current epidemiologic context to mention that all 3 patients were discharged from the clinic where they were born with SARS-CoV-2 negative tests (RT-PCR), which were taken in conformity with our national protocol regarding COVID-19.
cord-333524-a6p6ma8r	2020	19 The current most common diagnostic method used to identify SARS-CoV-2 infection is a molecular technique for detecting viral RNA through nucleic acid amplification, RT-PCR. Nucleic acid amplification tests (NAATs) are the most common diagnostic tests used to detect pathogens, and many of the current SARS-CoV-2 detection techniques are primarily based on NAATs. 21 NAATs involve nucleic acid amplification, a process that initiates with a small quantity of starting nucleic acids and uses primers that target specific, short nucleic acid sequences in conjunction with enzymes to amplify or increase the quantity of starting nucleic acids. 34 This test incorporates a nested nucleic acid amplification technique showing higher sensitivity of detection than LAMP alone and conventional RT-PCR for minimally processed SARS-CoV-2 samples. 55 The technique first uses RT-LAMP for reverse transcription and isothermal amplification of viral RNA, and then employs the Cas12a enzyme to identify sequences of SARS-CoV-2, allowing cleavage of a reporter molecule ( Figure 5 ).
cord-333805-xmqs2ax7	2020	BACKGROUND: We systematically reviewed available evidence for reports of neurological signs and symptoms in Coronavirus disease (COVID)‐19 patients to identify cases with severe acute respiratory syndrome coronavirus‐2 (SARS‐CoV‐2) infection or immune‐mediated reaction in the nervous system. This study therefore aimed to identify clinical cases of confirmed nervous system invasion or postinfectious neurological disease in the available COVID-19 literature on the basis of a systematic review. A systematic review was carried out to study all cases reporting nervous system involvement in patients with proven SARS-CoV2 infection. There were just 2 cases with positive SARS-CoV-2 PCR in CSF among 27 patients with potential neurologic symptoms and proven COVID-19. In this regard, we see a clear need for the use of precise case definitions and focused diagnostic work-up to distinguish nonspecific complications of severe disease and focused reporting of neurological involvement in association with SARS-CoV-2 infection.
cord-334090-66d8c75g	2016	Thus, the spread of viral respiratory diseases has become the most commonly reported condition in commercial broiler flocks in Iraq; however, there have been no studies on the detection and genotyping of these viruses using molecular techniques and sequencing. Phylogenetic analysis of the 32 strains (Fig. 2) revealed that Iraqi IBV strains could be classified into four genetic groups or genotypes: group I, variant 2 IS/1494-like viruses, including 15 field isolates (46.87 %); group II, 793/Blike viruses, including 13 field strains (40.62 %); group III, QX-like viruses, including three field strains (9.37); and caused by bacteria and mycoplasmas have already been detected on broiler farms located in the central and southern parts of Iraq. Our result were in line with those of Mahmood et al., who conducted the first study of identification and genotyping of IBV isolates and indicated that the 4/91-like virus is circulating on vaccinated broiler farms of the Kurdistan region of Iraq [21] .
cord-334688-0i1pu8wc	2020	Material and methods Retrospective cohort study of patients with COVID-19 admitted from 26th February 2020, who had been discharged or died up to 29th April 2020. Conclusions The presence of cardiopathy, levels of LDH ≥ 345 IU/L and age ≥ 65 years, are associated with a higher risk of death during hospital stay for COVID-19. In this study, we describe the first cases of COVID-19 in patients hospitalized in a general hospital and analyze the characteristics upon admission associated with in-hospital death. Our model shows that a medical history of cardiopathy, LDH levels ≥345 IU/L upon admission, and age ≥65 years are associated with greater in-hospital mortality due to COVID-19. Predictors of Mortality for Patients with COVID-19 Pneumonia Caused by SARS-CoV-2: A Prospective Cohort Study Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study.
cord-335085-7pxkhgbq	2009	Material and methods ‐ Spinal fluids from 37 patients with AMON and 15 surgical control patients with protrusion of the intervertebral disk were assayed with a nested multiplex polymerase chain reaction with primers specific for human coronaviruses strain (HCV) 229E and OC43. To investigate the possibility of an infection with human coronaviruses (HCV) in early MS and as a possible cause of AMON we have analyzed cerebrospinal fluid (CSF) from patients with AMON using reverse transcriptase reaction and the polymerase chain reaction (RT-PCR) applying primers specific for HCV. CSF from 4 patients and 1 control ( Table 2) were positive on nested RT-PCR using the HCV-229E primers and all samples were negative with the HCV-OC43 primers. HCV-229E RNA was found in the CSF by RT-PCR in 4 of 37 patients with AMON and in 1 of 15 controls.
cord-335323-p7cv79ig	2020	The authors have proposed an algorithm for management of CMF trauma during the COVID-19 pandemic to ensure that urgent and emergent CMF injuries are addressed appropriately while optimizing the safety of surgeons and other healthcare providers. So far there has been a significant mortality of otolaryngologists and ophthalmologists in the Wuhan region, thought to be related to exposure to aerosolized virus from the nasal and oral airway mucosa from high risk procedures such as CMF trauma and sinus operations and in some patients despite the use of N95 masks. 19, 20 Given that the majority of CMF trauma procedures involve violation of the mucosa of the oral cavity and sinuses, these patients place the surgeons and the remainder of the operating room staff at high risk of exposure during the COVID-19 pandemic.
cord-335359-4rcj75tc	2020	We report here the use of a diagnostic assay that utilizes a universal extraction method, broad spectrum PCR amplification and analysis via electrospray ionization mass spectrometry (PCR/ESI-MS) to detect and identify more than 200 pathogenic fungi directly from bronchoalveolar lavage (BAL) specimens in less than 8 hours. For the clinical performance, the PCR/ESI-MS method was applied to prospectively collected BAL specimens obtained from patients suspected of, or at high risk for, pulmonary fungal infections. All BAL samples were processed at the Johns Hopkins Hospital Microbiology Laboratory for the detection and identification of fungal pathogens using all standard of care reference tests including direct microscopic examination by calcofluor white staining, fungal culture, galactomannan (positive cutoff value: GMI 0.5), and direct fluorescent antibody (DFA) microscopic examination that is the only method used for the detection of Pneumocystis jirovecii.
cord-335393-4buooi2d	2019	title: Comparative transcriptome analysis reveals the role of p53 signalling pathway during red‐spotted grouper nervous necrosis virus infection in Lateolabrax japonicus brain cells To better comprehend the molecular immune mechanism of sea perch (Lateolabrax japonicus) against NNV infection, the comparative transcriptome analysis of red‐spotted grouper nervous necrosis virus (RGNNV)‐infected or mock‐infected L. Based on the analysis of differentially expressed genes (DEGs), we found that p53 signalling pathway might be involved in the immune response against RGNNV, and experimentally revealed the role of L. Of these genes, many well-known immune-related genes were strongly inhibited after RGNNV infecComparative transcriptome analysis showed that 79 DEGs involved in p53 signalling pathway were regulated in RGNNV-infected LJB cells compared to control cells (Supporting Information Figure S1 ). Several studies indicated that p53 functioned as a key player in innate antiviral immunity by both enforcing the type I IFN response and inducing apoptosis in virus-infected cells (Rivas, Aaronson, & Munoz-Fontela, 2010) .
cord-335459-tq4fwigw	2020	title: Early chest CT features of patients with 2019 novel coronavirus (COVID-19) pneumonia: relationship to diagnosis and prognosis METHODS: The clinical manifestations, laboratory parameters, and CT imaging findings were analyzed in 34 COVID-19 patients, confirmed by RT-PCR from January 20 to February 4 in Hainan Province. a-c Axial unenhanced chest CT revealed multiple confluent and patchy ground-glass and consolidative pulmonary opacities in the subpleural area bilaterally upon hospital admission on January 29, 2020. The CT images on admission showed bilateral, multiple lobular and subsegmental areas of GGO with subsegmental areas of consolidation, indicating the disease was severe Fig. 3 A 50-year-old woman with a history of exposure presented with cough and white phlegm for 4 days, accompanied by headache, muscle aches, and no fever.
cord-335784-v7nbck0n	2020	Pooling multiple swab samples prior to RNA extraction and RT-PCR analysis was proposed as a strategy to reduce costs and increase throughput of SARS-CoV-2 tests. Key open questions concern reduced sensitivity due to sample dilution; the rate of false positives; the actual efficiency (number of tests saved by pooling) and the impact of infection rate in the population on assay performance. Major diagnostic challenges have emerged, mainly, the need for high throughput SARS-CoV-2 RT-PCR tests, aimed to detect not only symptomatic but also asymptomatic infectious viral carriers and to screen special or at-risk populations (such as health care personnel or nursing home tenants), in order to contain viral spread and guide control measures. To our knowledge, this is the most extensive analysis, addressing key considerations of efficiency, sensitivity and feasibility in the actual reality of routine, large-scale implementation of sample pooling for SARS-CoV-2 detection.
cord-336453-cbq0ui4p	2020	PURPOSE: To reveal that a computed tomography surveillance program (CT-surveillance) could demonstrate the epidemiologic features of COVID-19 infection and simultaneously investigate the type and frequency of CT findings using clinical CT data. Using an online questionnaire, we asked Japanese board-certified radiologists to register their patients'' information including patient age and sex, the CT examination date, the results of PCR test for COVID-19 infection, CT findings, and the postal code of the medical institution that performed the CT. We conducted the present study to reveal that CT-surveillance could demonstrate the epidemiologic features of COVID-19 infection as well as simultaneously investigate the type and frequency of characteristic imaging findings on CT by using clinical CT data. CT findings in CT surveillance might distinguish the group that is considered Fig. 2 The epidemic curve of the diurnal patient number in the CT surveillance (a) shows a distribution similar to that of the PCR surveillance (b).
cord-336636-xgfw21hk	2020	
cord-336639-jaue41mv	2004	
cord-336671-vfq5ft08	2020	Unexplained pneumonia (UP) caused by a novel coronavirus SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) emerged in China in late December 2019 and has infected more than 9000 cases by 31 January 2020. A combinative approach of real-time RT–PCR, CRISPR-based assay and metagenomic next-generation sequencing (mNGS) were used to diagnose this unexplained pneumonia patient. The reasons behind this outbreak are numerous, the highly infectious nature of SARS-CoV-2, limited pathogen detection method for unexplained pneumonia, the high population density of the Hubei Province and across China, etc. On 20 January, Shanghai reported the first imported case of SARS-CoV-2 infection, and through this case, we seek a combinative approach of selected techniques to improve pathogen identification of unexplained pneumonia in the future. We then performed real-time RT-PCR, CRISPR-based assay and metagenomic next-generation sequencing (mNGS) on her respiratory sample and finally diagnosed her with COVID-19.
cord-336975-28mtmw2z	2011	PCR-based studies have suggested the important role of respiratory picornaviruses (rhinovirus and enterovirus) as a leading cause of lower respiratory tract infections in children [5] , in particular wheezing illnesses such as bronchiolitis [6, 7] , wheezy bronchitis [8] and asthma exacerbations [9] , but also pneumonia [2] . In addition, PCR has allowed for the detection of new respiratory viruses, such as hMPV [10] , which has been implicated in upper and lower respiratory tract infections in children [11] [12] [13] . A significant proportion of asymptomatic children test positive by PCR to respiratory viruses [14] [15] [16] , and picornavirus RNA can be detected by PCR up to 5 weeks after an acute infection [17] . In order to determine the value of DFA in conducting epidemiological studies on respiratory viruses now that assays for respiratory picornaviruses and hMPV are available, we retrospectively analysed the results of 12 years of DFA screening of viral pathogens in hospitalized children with respiratory disease.
cord-337003-7ygcfzii	2017	METHODS: We conducted a case-control study, including 79 mild flu and 125 flu-negative individuals attending primary care centers of three provinces of Iran (i.e, Markazi, Semnan, and Zanjan). Lack of significant association between C allele homozygous and mild flu, observed in this study, might be the result of small sample size in this group. Therefore, we performed this study to identify the association between mild flu and IFITM3 rs12252-C polymorphism, BMI, diabetes and hypercholesterolemia. In this study, we investigated the association between mild flu and IFITM3 rs12252 variant, BMI, diabetes, and hypercholesterolemia in an Iranian population. To control for the effect of residual population admixture on our results, we adjusted genetic association between IFITM3-SNP rs12252 and susceptibility to mild flu for participants'' residence area. To the best of our knowledge, this is the first study evaluating the association between IFITM3 rs12252 polymorphism, diabetes, hypercholesterolemia and BMI with susceptibility to mild flu in an Iranian sample.
cord-337096-ulc7mnwb	2020	
cord-337198-4sors3bg	2020	In this study, we evidence that the anti-SARS-CoV2 activity of a clinically achievable hydroxychloroquine concentration is maximized only when administered before and after the infection of Vero E6 and Caco-2 cells. In this study, we tested HCQ against a SARS-CoV-2 Italian clinical isolate, by using different protocols of drug administration corresponding to its possible prophylactic, therapeutic, and prophylactic/therapeutic use in patients. A clinical isolate hCoV-19/Italy/UniSR1/2020 (GISAID accession ID: EPI_ISL_413489) was isolated and propagated in Vero E6 cells, and viral titer was determined by 50% tissue culture infective dose (TCID 50 ) and plaque assay for confirming the obtained titer. HCQ EC 50 against SARS-CoV-2 was obtained by both CPE and RT-PCR analysis on results from full-time experimental setting on Vero E6 cells. Different concentrations of HCQ were tested on Vero E6 to determine the effective concentration of the drug against SARS-CoV-2 in vitro infection (Figure 1) .
cord-337206-jo29nx9b	2010	
cord-337396-g69bb60d	2020	
cord-337406-25285u24	2015	
cord-337636-3yc0ribg	2020	
cord-337701-56tmg38b	2020	In the present study, we evaluated the sensitivity, specificity, amplification efficiency, and linear detection ranges of three qRT-PCR assays, including the assays developed by our group (IPBCAMS), and the assays recommended by WHO and China CDC (CCDC). No effect of the 152 co-existed other viral nucleic acids on the LOD and the linear detection range was 153 observed, although higher Ct values were generated than those of RNA transcript 154 alone as template in all of the three qRT-PCR assays. Although most of the evaluated 232 assays exhibited good sensitivity, specificity, reproducibility and wide linear detection 233 range, performance test with clinical specimens from suspected COVID-19 patients 234 suggested that the N gene assay in IPBCAMS assays and CCDC assays, and the ORF 235 1b gene assays in IPBCAMS assays were the preferred qRT-PCR assays for accurate 236 detection of SARS-CoV-2.
cord-338205-sy91rnse	2020	With limited understanding of COVID-19, it is difficult to exclude SARS-CoV-2 infection based on a single negative PCR result, especially when testing was used for upper respiratory tract specimens. The study found that SARS-CoV-2 could be detected in all primer-probe sets applied in the qRT-PCR tests, but significant discrepancy was observed in the detection limit and the ability to identify negatives and positives with a lower viral load. Compared with the qRT-PCR kit, nested RT-PCR analysis showed higher sensitivity and specificity, indicating that it is more suitable for clinical application to detect SARS-CoV-2 in cases with low viral load. In cases where RT-PCR assays are negative and there is a strong epidemiological link to SARS-CoV-2 infection, paired serum samples (in the acute and convalescent-phase) could support diagnosis once validated serology tests are available with the initial samples collected in the first week of COVID-19 and the second collected after 2-4 weeks [28] .
cord-338582-o976nab9	2010	Genome sequencing has allowed efficient, sensitive, and specific diagnostic assays to be developed based on the detection of nucleic acids. PCR uses the highly specific molecular recognition ability of Watson-Crick base pairing to provide the selectivity needed for a nucleic acid probe to bind to a targeted DNA sequence and allow for its exponential amplification. It has been used to develop rapid diagnostic tests for several pathogenic viruses with singlestranded RNA genomes, including influenza A, 13 footand-mouth disease virus, 14 and severe acute respiratory syndrome (SARS)-associated coronavirus. DNA microarrays also permit relatively rapid interrogation of a clinical sample against thousands of genetic targets, allowing for simultaneous detection and discrimination among hundreds of pathogenic agents of veterinary interest. Unlike PCR technology where the target agent must be known to use specific test primers, microarrays can allow for the rapid diagnosis of multiple pathogenic agents in disease outbreaks and epidemics of unknown etiology.
cord-338607-22f04uqe	1991	title: Genomic relationship between turkey and bovine enteric coronaviruses identified by hybridization with BCV or TCV specific cDNA probes Genomic relationships between turkey and bovine coronavirus (TCV and BCV), which are currently placed in distinct antigenic groups, were demonstrated by hybridization using specific cDNA probes. BCV-specific recombinant plasmids p 52, p 27, and p 247, which served previously for the optimization of hybridization conditions for BCV-RNA detection [33] , and probes pN 17 and pN 9, holding respectively the BCV N and M gene ( Fig. 1) , were used in the detection of several coronaviruses in order to establish the presence of potential genomic homologies. Clinical diagnosis of TCV was assayed with a pool of six 32p-labelled BCV specific recombinant plasmids (pBCV-pool), holding non-overlapping eDNA sequences, in order to amplify the detection signal. Detection signals were absent when testing spotted supernatant fluids of non-infected HRT-18 cells (Fig. 2) and when probing identical blots with 32p-labelled pUC-DNA (not shown), confirming the specificity of the hybridization signals obtained.
cord-338641-s006a7m0	2006	
cord-338899-qt17jhg0	2008	Emergence or reemergence of severe arboviral hemorrhagic fevers caused by mosquitoborne viruses, such as dengue virus and Chikungunya (CHIK) virus, have been frequently reported in the Indian subcontinent in the past few years. We report clinical observations and laboratory investigations involving virus isolation methods and molecular assays performed for 296 clinically suspected cases of CHIK fever. Of particular interest was the applicability of a novel method of gene amplificatio called real-time loop-mediated isothermal amplifica tion (RT-LAMP) as a rapid, sensitive, and specifi real-time method to detect and quantify CHIK virus in the acute phase of the infection. All 132 patients who had clinically suspected CHIK virus but whose RT-PCR and RT-LAMP results were negative presented 17 days after the onset of fever; this may be the reason for the negative test results. The RT-LAMP allows rapid, realtime detection of CHIK virus in acute-phase serum samples, without requiring sophisticated equipment, and has potential usefulness for clinical diagnosis and surveillance of CHIK virus in developing countries.
cord-338942-q4neat3x	2019	Isothermal deoxyribonucleic acid amplification methods, such as loop-mediated isothermal amplification (LAMP), exhibit characteristics ideal for point-of-care (POC) applications, since their instrumentation is simpler in comparison with the standard method of polymerase chain reaction. Nucleic acids amplification methods are primarily required to be performed, as the original number of either DNA or ribonucleic acid (RNA) copies in the clinical sample is insufficient for their direct detection. A microfluidic disk-based LAMP chip, integrating sample preparation and detection, was developed [44] (Fig. 2B ). Loop-mediated isothermal amplification integrated on microfluidic chips for point-of-care quantitative detection of pathogens An integrated rotary microfluidic system with DNA extraction, loop-mediated isothermal amplification, and lateral flow strip based detection for point-ofcare pathogen diagnostics An integrated microfluidic loop-mediated-isothermal-amplification system for rapid sample pre-treatment and detection of viruses Development and application of a loop-mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples
cord-339278-9luefzyo	2020	Between March, 30th and April, 3rd 2020 we retrospectively collected the following data from the medical files of patients: demographic characteristics (age, sex), interval between illness onset and consultation, functional symptoms (measured fever > 38 °C, myalgia and/ or arthralgia, headache, cough, dyspnea, dysgeusia, anosmia, rhinorrhea, nausea, vomiting, diarrhea, and abdominal pain), clinical signs (crackling sounds heard on pulmonary auscultation) and result of RT-PCR SARS-CoV-2 nasopharyngeal sample. During the study period, 217 samples (nasopharyngeal swabs) were collected in our consultation: 95 patients (44%) had a positive SARS-CoV-2 RT-PCR confirming the infection by COVID-19 and 122 patients (56%) had a negative SARS-CoV-2 RT-PCR. Outpatients presenting with dysgeusia and/or anosmia may be considered as patients infected with COVID-19, until microbiological confirmation has been obtained (as they have a high pre-test probability to be positive for SARS CoV-2 RT-PCR).
cord-339419-b6tr2zyx	2006	Recent progresses in the miniaturization of various biological processing steps for the sample preparation, DNA amplification (polymerase chain reaction), and product detection are delineated in detail. The organization of the following contents is based upon the three basic DNA processing modules of sample preparation, target amplification, and product detection. Thermal lysis can be easily adapted to microfabricated amplification systems as the initial high-temperature step (∼95 • C) employed to denature the double-stranded (ds) DNA template is powerful enough to open up the cell membranes [10, 12, 19] . The sensing protocol basically involves the immobilization of an oligonucleotide onto a transducer surface, and upon the hybridization of complementary target sequence, the binding event is detected by optical, microgravimetric (mass-sensitive), or electrochemical methods. To further increase the sensitivity of the gold nanoparticle-based assay, a signal amplification step Pictorial representation of the working principle of the molecular beacon-type capture probe labeled with ferrocene group for the reagentless sequence-specific DNA detection.
cord-339456-82iks0xf	2015	title: Methods for Preparation of MS2 Phage-Like Particles and Their Utilization as Process Control Viruses in RT-PCR and qRT-PCR Detection of RNA Viruses From Food Matrices and Clinical Specimens The technology for production of MS2 phage-like particles is theoretically well established, uses the knowledge gained from the study of the familiar bacteriophage MS2 and utilizes many different approaches for the construction of the various process control viruses. Also MS2 phage-like particles have been used as the process control virus for the detection of pathogenic RNA viruses in clinical samples. prepared MS2 phage-like particles, also called armored RNA (aRNA), that carried the consensus RNA sequence from human immunodeficiency virus type 1 (HIV-1) packaged in the capsid which can serve as quantitative standard in detection of HIV-1 (Pasloske et al. MS2 phage-like particles carrying the plant-specific ribulose-1,5-bisphosphate carboxyl small subunit (rbcs) gene fragment were used as the process control virus in qRT-PCR detection of severe acute respiratory syndrome coronavirus (SARS-CoV) .
cord-339656-u0cpklsv	2010	Methods Ocular fluids from 139 patients suspected of infectious uveitis, but negative for herpes simplex virus, varicella-zoster virus, cytomegalovirus, and Toxoplasma gondii by polymerase chain reaction and/or antibody analysis in intraocular fluids, were assessed for the presence of 18 viruses and 3 bacteria by real-time polymerase chain reaction (PCR). The remainders of ocular fluid samples from patients with PCR-and/or GWC-confirmed infectious uveitis (ocular toxoplasmosis, n ϭ 13; HSV anterior uveitis, n ϭ 10; rubella virus-associated Fuchs heterochromic uveitis syndrome (FHUS), n ϭ 14) and from patients with cataract in the absence of intraocular inflammation (n ϭ 11) served as controls. • NUCLEIC ACID ISOLATION AND REAL-TIME PCR: The ocular fluid samples were analyzed for the presence of adenovirus, EBV, HHV6, Mycoplasma pneumoniae, Chlamydia pneumoniae, and Chlamydia trachomatis DNA and of coronaviruses 229E, OC43, and NL63, enteroviruses, human metapneumovirus, influenza A and B virus, parainfluenza virus 1 to 4, HPeV, respiratory syncytial virus A and B, and rubella virus RNA.
cord-339804-hktedla3	2011	
cord-339973-kj56zi59	2018	Although baseline metagenomic maps created from these studies are said to be useful for mitigating bioterrorism and infectious disease outbreaks, most of them focus largely on mapping surface-borne bacterial DNA 17 and neglect to address the threat of weaponized or global catastrophic biological risk-level (GCBR-level) agents, both of which would likely be aerosolized or respiratory-borne RNA viruses 19 . Bioaerosol sampling in the field provides a noninvasive way to monitor and characterize the community of aerosolized respiratory viruses that regularly infect the public, as well as potentially detect or discover novel pathogens with pandemic potential, such as the influenza A(H7N9) virus. Although the air pump flow rate and sample collection times used in our study have been demonstrated to efficiently capture aerosolized influenza virus and RSV RNA [33] [34] [35] , it is possible that these parameters are not optimal for capturing the other respiratory virus DNA/RNA targeted in our study.
cord-339976-tg2jkss7	2004	title: Detection and Monitoring of SARS Coronavirus in the Plasma and Peripheral Blood Lymphocytes of Patients with Severe Acute Respiratory Syndrome Reliable and sensitive determination of the SARS CoV load would aid in the early identification of infected individuals, provide guidance for treatment (especially the use of steroid hormones and antiviral agents), and aid in monitoring of a patient''s clinical course and outcome. The method could detect the CoV load during the SARS course, as demonstrated in Fig. 1B , representative data from the 44 patients tested. High frequency of point mutations clustered within the adenosine triphosphatebinding region of BCR/ABL in patients with chronic myeloid leukemia or Ph-positive acute lymphoblastic leukemia who develop imatinib (STI571) resistance Serial analysis of the plasma concentration of SARS coronavirus RNA in pediatric patients with severe acute respiratory syndrome Quantitative analysis and prognostic implication of SARS coronavirus RNA in the plasma and serum of patients with severe acute respiratory syndrome
cord-339995-0pbknb32	2020	We report a case of 34-year-old man who was diagnosed as negative for COVID-19 based on the four sequential RT-PCR tests of his pharyngeal swab. It is difficult to distinguish COVID-19 pneumonia from other viral pneumonia on CT findings alone; however, we emphasize the utility of chest CT to detect early change of COVID-19 in cases which RT-PCR tests show negative results. d Follow-up CT 7 days after admission (d1, axial image; d2, ray-summation image; d3, pseudo color MIP; d4, coronal image) shows multifocal bilateral ground-glass opacities and improvement of mixed groundglass opacities and consolidation in left upper lobe. Correlation of chest CT and RT-PCR testing in coronavirus disease 2019 (COVID-19) in China: a report of 1014 cases
cord-340021-pj6fywwc	2020	
cord-340046-kgbvld0y	2011	BACKGROUND: Exhaled breath condensate (EBC) sampling has been considered an inventive and novel method for the isolation of respiratory viruses. RESULTS: Viral screening resulted in the detection of 4 different viruses in EBC and/or nasal swabs: Rhinovirus, Human Respiratory Syncytial Virus B, Influenza A and Influenza B. This observation has created a growing interest in the use of EBC as a new sampling method for the screening of respiratory viruses infecting the upper airways. The aim of this study was to investigate whether the EBC collection method was suited for the efficient condensation of aerosolised virus particles during normal breathing and to explore the isolation of respiratory viruses in the condensate. In this study, 102 EBCs were collected from otherwise healthy volunteers showing respiratory or flu-like symptoms (defined in Table 1 ), using a commercially available condenser (RTube™, Respiratory Research Inc., Charlottesville, Virginia, USA). Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract.
cord-340317-gwqy6u9x	2020	
cord-340336-u59l0taa	2020	 -Of all 356 samples tested, triplexing demonstrated 99.2% (n=353/356) assay agreement Abstract: Background -The novel respiratory virus SARS-CoV-2, responsible for over 380,000 COVID-19 related deaths, has caused significant strain on healthcare infrastructure and clinical laboratories globally. Methods -Nasopharyngeal swabs submitted to UW Virology for SARS-CoV-2 clinical testing were extracted, amplified by our laboratory developed test (LDT) -a CDC-based quantitative reverse transcriptase PCR reaction -and analyzed for agreement between the multiplexed assay. Methods -Nasopharyngeal swabs submitted to UW Virology for SARS-CoV-2 clinical testing were extracted, amplified by our laboratory developed test (LDT) -a CDC-based quantitative reverse transcriptase PCR reaction -and analyzed for agreement between the multiplexed assay. To increase throughput of SARS-CoV-2 testing in clinical laboratories, we designed a multiplexed real-time quantitative reverse transcription PCR (qRT-PCR) assay utilizing primers and probe sets from the CDC combined with an internal extraction control.
cord-340481-i3qrxnpr	2008	En comparación con las técnicas de diagnóstico clásicas, como son el cultivo de virus en líneas celulares (CC) o la detección de antígenos mediante ensayos de inmunofluorescencia (IF) u otros métodos, la reacción en cadena de la polimerasa (PCR), en sus múltiples variantes, ha permitido incre-mentar de manera considerable el número de muestras respiratorias en las que se detecta la presencia de alguno de los virus asociados con IRA. La elevada sensibilidad de los ensayos de PCR también comporta algunos inconvenientes para el diagnóstico etiológico de la IRA, como son la detección de virus que se encuentran colonizando la mucosa respiratoria de personas asintomáticas o la detección, a consecuencia de excreción prolongada, del virus en secreciones de pacientes que ya se han recuperado de una infección.
cord-340627-xyvzgkxl	2020	title: Performance of an extended triage questionnaire to detect suspected cases of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) infection in obstetric patients: Experience from two large teaching hospitals in Lombardy, Northern Italy Initially, a targeted SARS-CoV-2 screening approach triggered by a positive questionnaire and based on RT-PCR testing of nasopharyngeal swabs was used in women with hospital admission after accessing the Emergency Department. On April 8 th , we changed our policy and started testing all women for SARS-CoV-2 infection independent of the type of hospital admission and the questionnaire result, in agreement with a disposition of the Lombardy Region Health Care Authority. Our study investigated the accuracy of a comprehensive questionnaire thoroughly assessing obstetric patients upon hospital admission to identify cases suspected for SARS-CoV-2 infection. Our data show that thorough assessment of obstetric patients upon hospital admission by means of an exhaustive questionnaire is feasible and effective in discriminating women at low risk of SARS-CoV-2 infection in the context of both a targeted and a universal screening
cord-340710-dmow5p7k	2020	
cord-340788-p02v46xu	2020	With regard to the accuracy of the test, the most commonly used test for detecting SARS-CoV-2 is a nasopharyngeal swab that uses a reverse transcriptase-polymerase chain reaction (RT-PCR) to identify viral RNA. One non-peer reviewed publication reports that, based on 87 Chinese patients who were ultimately diagnosed with COVID-19, pharyngeal RT-PCR tests have a sensitivity and specificity of 78.2% and 98.8%, respectively. Along the same lines, Winichakoon et al published a letter to the editor in which they described a case of a COVID-19 patient who had a nasopharygeal/oropharyngeal RT-PCR swab that was negative for COVID-19, but RT-PCR of BAL fluid was positive. 12 Next, in a case series described by Xie et al, five patients from the Hunan province of China had ground-glass opacities on chest computed tomography (CT) that were suggestive of COVID-19, but initial pharyngeal RT-PCR tests were negative.
cord-340883-zf8jbhdl	2007	title: Using patient-collected clinical samples and sera to detect and quantify the severe acute respiratory syndrome coronavirus (SARS-CoV) Reverse transcriptase polymerase chain reaction (RT-PCR) was used to detect and quantify SARS-CoV in 934 sera and self-collected throat washes and fecal samples from 271 patients with laboratory-confirmed SARS managed at a single institution. The highest SARS-CoV RT-PCR rates (70.4–86.3%) and viral loads (log(10 )4.5–6.1) were seen in fecal samples collected 2–4 weeks after the onset of clinical illness. The aim of this study was to detect and quantify SARS-CoV using RT-PCR in sera and throat washes and stools self-collected by 271 patients with laboratory confirmed SARS managed at a single institution. The use of patient self-collected throat washings may reduce risks to healthcare workers, although lower respiratory tract samples such as sputum, NPAs or bronchoalveolar lavage fluid are likely to have higher viral loads and offer increased likelihood of SARS-CoV detection by RT-PCR.
cord-341141-bgrgzfoo	2017	In this study, we described the development of a lateral flow dipstrip (LFD) of isothermal recombinase polymerase amplification (RPA) method for rapid detection of IBRV. The assay performance on acute-phase high fever clinical samples collected from cattle with no vaccine against IBRV, which were suspected to be infected with IBRV, was validated by detecting 24 fecal, 36 blood, 38 nasal swab and 8 tissue specimens, and compared with SYBR Green I based real-time PCR. The initial agarose gel result showed that Primer set 4-2F/4-2R/ 4-2LF yielded specific amplification efficiency for the RPA assay, and produced the expected size of the product was 250 base-pairs (Fig. 1a) , while the primers/probe targeting glycoprotein gB of the IBRV genome in this study could not be used to amplify effectively in the initial screen (data not show).
cord-341434-2xrdv92m	2015	Etiology Pasteurella multocida is a Gram-negative nonmotile coccobacillus that causes pasteurellosis, also known as ''snuffles'', the primary respiratory disease affecting domestic rabbits (Deeb and DiGiacomo, 2000; Guo et al., 2012) . Research Complications Pasteurellosis can cause considerable economic losses (El Tayeb et al., 2004; Ferreira et al., 2012; Stahel et al., 2009 ) and has the potential to affect different types of research studies using rabbits due to the multisystemic nature of the disease, and the possibility of high morbidity and mortality. piliforme is a pleomorphic, Gramnegative, spore-forming, motile, obligate intracellular rod-shaped bacterium that causes Tyzzer''s disease and infects various animals including mice, nonhuman primates, gerbils, rats, rabbits, and others (Allen et al., 1965; Ganaway et al., 1971; Pritt et al., 2010) . Research Complications EPEC infection can cause high morbidity and mortality in laboratory rabbit colonies and can affect studies involving intestinal physiology in rabbits.
cord-342277-v6310fjh	2011	
cord-342344-jjnf4yje	2020	Diagnostic assays for the presence of SARS-CoV-2 currently use real-time reverse transcriptase PCR (RT-qPCR) to yield a binary (positive or negative) result based on an amplification cycle threshold (Ct) value 9-12 . Current PCR-based assays can detect the presence of very short SARS-CoV-2 RNA sequences but do not distinguish whether these sequences are derived from longer molecules present in the sample at the time of collection. To address these issues, we explored using droplet digital PCR (ddPCR) 19, 20 to more precisely quantify SARS-CoV-2 RNA in biological samples and evaluate the extent to which positive results reflect larger, intact viral nucleic acids. The results yielded definitive evidence of linkage: although only 822 of the 12,220 droplets (6.7%) were positive for either N1 or N2, 75% of the droplets that were positive for N2 (HEX) were also positive for N1 (FAM) (Fig. 2a, Table 1 ); we estimate (using a formula we previously described 21 , which accounts for chance co-encapsulation) that 71% of the detected RNA sequences were physically linked.
cord-342380-lihz7h1k	2020	BACKGROUND AND STUDY AIMS: Frontlines healthcare workers (HCWs) during the coronavirus disease 2019 (COVID-19) pandemic are at increased risk of infection by SARS-CoV-2, but there are limited data on the prevalence of COVID-19 among HCWs in Egypt. SUBJECTS AND METHODS: Seventy-four HCWs at the gastroenterological service of Al-Manial University Hospital, the main hospital of the largest tertiary university hospitals complex in Egypt (Kasr Al-Ainy Faculty of Medicine, Cairo University) were tested using real-time reverse transcription–polymerase chain reaction (RT-PCR) on nasopharyngeal samples, and rapid serological IgM/IgG tests (RST). This work has been conducted to determine the extent of infection by realtime reverse transcription polymerase chain reaction (RT-PCR) and rapid serological test (RST) for SARS-CoV-2 among frontline HCWs providing gastrointestinal services. Previous studies in developed countries reported variable infection rates in HCWs. In a study on 957 employees in a German university hospital, 52 of them (5.4%) tested positive for SARS-CoV-2 by PCR [13] .
cord-342383-ckswlo9o	2020	Furthermore, age, race/ethnicity, and blood group stratified analyses reveal significantly lower SARS-CoV-2 rate among black individuals who have taken the PCV13 vaccine, with relative risk of 0.45 at the 5 year time horizon (n: 653, 95% CI: (0.32, 0.64), p-value: 6.9e-05). Given this study population, we assess the rates of SARS-CoV-2 infection among individuals who did and did not receive one of 18 vaccines in the past 1, 2, and 5 years relative to the date of PCR testing. In Figure 6 , we present the results from the tipping point analysis on the statistically significant associations between vaccination and reduced rates of SARS-CoV-2 infection in the overall study population. For example, for the polio vaccine at the 1 year time horizon, an unobserved confounder with a relative risk of 2.78 which is prevalent in 17.8% of the vaccinated cohort and 0% of the unvaccinated cohort could explain the differences in SARS-CoV-2 infection rates that we observe in the data.
cord-342476-0rupk21u	2019	The sensitivity, specificity and predictive values of mNGS were calculated based on 24 PCR positive and 1120 PCR negative target results of 88 samples and the normalized read counts (Table 5 ). The following markers were tested for potential associations with clinical severity of exacerbation (exacerbation severity, self-reported exacerbation severity), length of exacerbation and a decrease/increase in FEV 1 (control visit compared to baseline): mNGS pathogen positive versus negative exacerbation (qPCR targets), the number of normalized reads (log, cutoff of �5normalized reads) for the different target viruses (species level). The Shannon diversity scores for bacteriophages (normalized reads, cut-off of �5normalized reads) were comparable for COPD exacerbations of viral aetiology in PCR positive versus negative patients (Fig 5) . In this study, the respiratory virome in patients with COPD exacerbations was analysed with both mNGS and qPCR, and combined with clinical data.
cord-342568-3sj235rm	2017	In this study a new method for plant virus diagnosis is described using the Luminex xTAG technology to test for tospoviruses in general and for the four species TSWV, WSMoV, INSV and CaCV. Infected, dried plant material of 12 tospoviral isolates from eight different species was obtained from the DSMZ including single isolates of alstroemeria necrotic streak virus (ANSV), CaCV, GRSV, IYSV, TCSV and WSMoV as well as three isolates each of INSV and TSWV. The generic tospovirus primers Tospo_GENs/as (without tags) allowed the detection of all eight tospoviruses and of all three isolates of INSV and TSWV tested in RT-PCR experiments. A molecular assay for the detection of tospoviruses in general and for viruses from the four species belonging to this genus (TSWV, INSV, CaCV and WSMoV), using the Luminex xTAG technology, was successfully developed.
cord-342783-85b4lwh3	2020	
cord-342785-55r01n0x	2008	
cord-343377-6muareue	2016	Objective The aim of our study was to evaluate the occurrence of viral infections in infants with suspected late-onset bacterial sepsis in a neonatal intensive care unit. Methods In a prospective study, infants with suspected late-onset bacterial sepsis underwent viral testing alongside routine blood culture sampling. Bennett et al performed a surveillance study of viral respiratory infections in two NICUs. All infants of a gestational age < 33 weeks were tested twice a week using multiplex RT-PCR ELISA. Detection of respiratory viral infections in neonates treated for suspicion of nosocomial bacterial sepsis: a feasibility study Viral respiratory tract infections in the neonatal intensive care unit: the VIRIoN-I study Unrecognized viral respiratory tract infections in premature infants during their birth hospitalization: a prospective surveillance study in two neonatal intensive care units Viral respiratory tract infections in the Neonatal Intensive Care Unit
cord-343441-z849jvq5	2013	In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The analytic sensitivity of the duplex TaqMan rRT-PCR assay was compared with the WHO TaqMan assay and a commercial single H7N9 rRT-PCR kit (bioPerfectus technologies, Taizhou, China) with a 10-fold dilution series of a nasopharyngeal aspirate (NPA) from a patient infected with the H7N9 virus (approximately 4.8 × 10 6 copies of the viral genome/mL). To determine the actual detection limit (number of copies per reaction) of the duplex TaqMan rRT-PCR assay, in vitro RNA transcripts of HA and NA genes from the H7N9 virus were prepared with T7 RNA polymerase (TaKaRa Biotechnology Co. Ltd., Dalian, China) according to the manufacturer''s instructions using influenza A/Nanjing/1/2013 (H7N9) RNA as a template.
cord-343784-zgvxl4h3	2014	Several studies have demonstrated the advantages of multiplex PCR assays such as xTAG RVP, RVP fast (Luminex Molecular Diagnostics, Toronto, ON, Canada), Resplex II (Qiagen, Mississauga, ON, Canada), FilmArray® Respiratory panel (Idaho Technology Inc., Salt Lake City, UT, USA), and Seeplex RV assays (Seegene, Seoul, Korea), which are used routinely for the detection of respiratory viral infection (Bibby et al., 2011; Couturier et al., 2013; Gharabaghi et al., 2011; Kim et al., 2013; Zhang et al., 2012) . In the previous study evaluating Seeplex RV12 detection kit (Seegene, Rockville, MD, USA), viral culture, RV12, and real-time PCR detected 8, 6, and 11 of 11 influenza B-positive specimens, respectively (Bruijnesteijn van Coppenraet et al., 2010) . Simultaneous detection of influenza A, B, and C viruses, respiratory syncytial virus, and adenoviruses in clinical samples by multiplex reverse transcription nested-PCR assay Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens
cord-343860-2j7nbryv	2012	The identification of the respiratory viruses that are responsible for influenza-like illness has been reported in many countries, and the percentage of positive swabs for at least one virus ranges from 32% to 65% [Bellei et al., 2008; Laguna-Torres et al., 2009; Ren et al., 2009; Buecher et al., 2010; Renois et al., 2010; Razanajatovo et al., 2011] . Although it is possible that some EVs remained undetected, five samples were tested positive for EVs (1.7% of tested patients), which is consistent with previous studies in patients with acute respiratory infection or influenza-like illness [Bellei et al., 2008; Laguna-Torres et al., 2009; Ren et al., 2009] . Several studies have reported the results from respiratory virus testing using respiratory samples that were obtained from patients with influenza-like illness or acute respiratory infection throughout the world and during different times.
cord-344745-sgkq1l93	2013	title: Molecular characterization of infectious bronchitis viruses isolated from broiler and layer chicken farms in Egypt during 2012 The aim of this study aimed to survey the Egyptian chicken field for infectious bronchitis virus and study the genomic differentiation between isolated field samples seeking the new variant strain emerged in the Egyptian field. For virus isolation, the supernatants of IBV-positive selected 13 samples determined by RT-PCR were inoculated into five specific pathogen free embryonated chicken eggs (KoumOshiem SPF chicken farm, Fayoum, Egypt) 10-day-old for each sample. The genetic analysis of 100 amino acids sequence from position 263-362 of SP1 gene for the selected 13 Egyptian viruses was done and the hypervariable region of SP1 gene showed multiple mutations as shown in Table 4 in comparison with variant-2 strain. S1 gene sequence analysis of a nephro-pathogenic strain of avian infectious bronchitis virus in Egypt
cord-344749-omzhhr0k	2020	Cell culture-based virus isolation has been accepted as a "gold standard" in the detection and identification of viruses and is the technique by which all other test methods have been compared [35] . A novel method for dengue virus detection and antibody screening using a graphene-polymer based electrochemical biosensor Chitosan-carbon nanofiber modified single-use graphite electrodes developed for electrochemical detection of DNA hybridization related to hepatitis B virus A sensitive electrochemical biosensor for specific DNA sequence detection based on flower-like VS2, graphene and Au nanoparticles signal amplification Electrochemical DNA biosensor based on a tetrahedral nanostructure probe for the detection of avian influenza A (H7N9) virus Electrochemical DNA biosensor based on gold nanorods for detecting hepatitis B virus Electrochemical-DNA biosensor development based on a modified carbon electrode with gold nanoparticles for influenza a (H1N1) detection: effect of spacer Magnetic nanoparticle-based immunosensor for electrochemical detection of hepatitis B surface antigen
cord-344751-i4qnrtjq	2020	Clinical specificity for Covid-19 of some N protein-based immuno-assays was suboptimal, as positive results were observed in control patients with recent common human coronavirus, influenza B and adenovirus infections. To evaluate the specificity of the immuno-assays, we used a set of serum samples from control patients with recent respiratory viral or atypical bacterial infections. To this end, we tested for cross-reactivity with sera of patients with other respiratory viral or atypical bacterial infections, including common coronavirus infections, since these may present with clinical and radiological findings similar to Covid-19. Our study focused on the clinical sensitivity and specificity of four commercial immuno-assays for anti-SARS-COV-2 IgG in the subset of patients presenting with negative RT-PCR and suspect CT findings. In summary, we found good clinical sensitivity of anti-SARS-Cov-2 IgG immunoassays for Covid-19 in the subset of patients with negative RT-PCR 14 days after onset of symptoms.
cord-344770-aoi42xq4	2014	
cord-344782-ond1ziu5	2018	Nucleic acid sequencing of the virus isolate has identified the entire genome and indicates that this is a novel nidovirus that has a low level of nucleotide similarity to recognised nidoviruses. Following the detection of the novel virus, in November 2015 (about 6 months after the cessation of the outbreak) an intensive survey of the parts of the river where affected turtles had been detected [2] was undertaken by groups of biologists and ecologists and samples collected from a wide range of aquatic species and some terrestrial animals (n = 360) to establish the size of the remaining population and whether any other animals were carrying this virus. BRV, as a novel nidovirus, was isolated from tissues of diseased animals, very high levels of viral RNA were detected in tissues with marked pathological changes and in situ hybridisation assays demonstrated the presence of specific viral RNA in lesions in kidneys and eye tissue-two of the main affected organs.
cord-344889-1y4ieamp	2006	OBJECTIVES: We aimed to characterise and quantify the incidence of common infectious agents in acute exacerbations of chronic obstructive pulmonary disease (COPD) requiring ventilation, with a focus on respiratory viruses. Abstract Objectives: We aimed to characterise and quantify the incidence of common infectious agents in acute exacerbations of chronic obstructive pulmonary disease (COPD) requiring ventilation, with a focus on respiratory viruses. Of these, influenza types A and B (Inf A, B), parainfluenza types 1, 2 and 3 (Para 1, 2, 3), rhinovirus (RV), adenovirus (AV), respiratory syncytial virus (RSV), coronavirus (CoV) [11, 12] and, less commonly, human metapneumovirus (hMPV) [13] , and enterovirus (EV) [14, 15] have been shown to play significant roles in airway infections. A probable virus pathogen was found in 46 cases (43%) and a probable bacterial aetiology was found in 25 cases (23%) in this study of ventilated COPD exacerbation patients.
cord-345211-4ivqlsgt	2016	Guidelines for the management of community-acquired pneumonia in children are even more restrictive, again recommending that tests should mainly be used on patients with severe disease, with a focus on blood cultures and detection of respiratory viruses [11, 12] . While not exactly new (polymerase chain reaction (PCR) assays for respiratory pathogens have been around for over 20 years), the widespread adoption of nucleic acid detection tests (NATs) by diagnostic laboratories has been relatively slow. The NATs that are most widely used in diagnostic laboratories are those that detect potential pneumonia pathogens that are not part of the normal flora, namely respiratory viruses and selected non-colonizing bacteria. Quantitative multiplex PCR has been used to determine the etiology of community-acquired pneumonia in adults using cutoffs developed for interpretation of culture results from lower respiratory tract specimens [85, 86] .
cord-345312-i7soyabu	2019	OBJECTIVE: To determine whether rapid polymerase chain reaction (PCR) testing for influenza and respiratory syncytial viruses (RSV) in emergency departments (EDs) is associated with better patient and laboratory outcomes than standard multiplex PCR testing. Rapid PCR tests were expected to facilitate timely and appropriate initiation of treatment, improve outbreak prevention and infection control measures, and expedite the assessment of patients in EDs. In this study, we analysed routinely collected data to determine whether rapid PCR testing for influenza and RSV infections in EDs is associated with improved patient and laboratory outcomes. Other studies have also reported that hospital admission numbers were significantly lower when rapid influenza virus testing was used in EDs. An analysis of outcomes for more than 300 adults at a tertiary care centre in New York found that early diagnosis of respiratory infections was associated with significantly fewer hospitalisations of influenza-positive patients.
cord-345338-pf4tsh3v	2020	
cord-345475-ttrcmtu4	2011	Given the increasing interest in the functional genomics of Eucalyptus and the need for validated reference genes for a broader set of species and experimental conditions, we sought to identify the most stably expressed genes in a set of 21,432 genes assayed by microarray developed to compare stem vascular (xylem) and leaf tissues of E. According to the NormFinder analysis of gene expression in leaves, xylem tissues and among species, the stability values of the 15 genes studied were <0.138, with error bars no greater than 0.044 ( Fig. 3C ; Table 3 ). When we analyzed the gene expression in all tissues/organs and species, the stability value was in the range between 0.017 and 0.106, proving again that all genes elected are good references for RT-qPCR studies in Eucalyptus. By RT-qPCR, the expression stability of eight of the 50 best candidate genes selected by SAM and SDMA was addressed in different organs (leaves and flowers) and vascular tissues (xylem) derived from six species of Eucalyptus.
cord-345518-athy5yg7	2000	
cord-345820-0n1pea70	2007	
cord-346054-k84rcpav	2018	Here, we develop a chip containing 130 different micro-arrayed RV proteins and peptides and demonstrate in a cohort of 120 pre-school children, most of whom had been hospitalized due to acute wheeze, that it is possible to determine the culprit RV species with a minute blood sample by serology. The analysis of IgG reactivity to structural and non-structural proteins and to recombinant fragments and synthetic peptides spanning VP1, VP2, and VP3 from RV89 is shown in Supplementary Fig. 2a for all 120 children and in Supplementary Fig. 2b for those children (n = 41) who had shown increases of RV89-specific antibody responses in follow-up serum samples taken after recovery. Based on our previous observations that antibody increases specific for the N-terminal portion of VP1 can be detected in serum samples obtained from subjects after RV infection 36 , the PreDicta chip was equipped with a VP1 peptide set which should allow detecting species-specific immune responses at high resolution ( Fig. 1 ).
cord-346096-aml84iv1	2018	
cord-346104-18x8u2oe	2019	
cord-346138-ip42zcld	2020	
cord-346308-9h2fk9qt	2020	The study of hospital wastewater (HWW) microbiology is important to understand the pollution load, growth of particular pathogenic microbes, shift and drift in microbial community, development and spread of antibiotic resistance in microbes, and subsequent change in treatment efficiencies. Within past years, pieces of evidence have shown mobilization of these resistance genes from the environment into pathogenic bacteria causing health risks to humans and animals and also, demonstrating a link between environmental and clinical resistance [123] . The HWW has been reported to have two overexpressed β-lactam-resistance genes (bla GES and bla OXA ) as compared with the water collected from other aquatic bodies, which could be correlated with antibiotic usage over the time in hospitals and discharge of the residues of antibiotics in the wastewater [176] . Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: a review
cord-346325-grt67p73	2020	Design, Setting, and Participants Nationwide population-based cohort of all 228.677 consecutive Danish individuals tested (positive or negative) for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA from the identification of the first COVID-19 case on February 27th, 2020 until April 30th, 2020. In this population-based study of a Danish COVID-19 cohort capturing all individuals with a positive PCR test for SARS-CoV-2 in Denmark, we provide nationwide data on clinical characteristics and predictors of hospitalization and death for all SARS-CoV-2 PCR-positive cases identified from February 27 th , 2020 to April 30 th , 2020. In this nationwide cohort of SARS-CoV-2 PCR positive cases and test-negative individuals from the general population in Denmark, we found that older age (e.g., >70 years), male sex, and number of comorbidities were risk factors for hospitalization and death. In this first nationwide population-based study, increasing age, sex, and number and type of comorbidities were closely associated with hospitalization requirement and death in SARS-CoV-2 PCR positive cases.
cord-346436-p61mpc6t	2007	Over 2000 primer sequences from successful PCR experiments used with varieties of templates and conditions were analyzed for finding frequencies of the 3′-end triplets. This chapter discusses a trend in 3′-end triplet frequencies in primers used in successful PCR experiments and proposes requirements for the 3′-end of a primer. From the VirOligo database, 2137 PCR primer sequences were retrieved for detailed analysis of the 3 -end triplets of successful PCR primers (8; see Note 1). The analysis of the 3 -end triplets of primers (8; see Fig. 5 and Table 1) showed all 64 types were used in successful PCR experiments from the VirOligo database. 3. When primers are obtained by a primer design program, the user needs to note that some primer search settings such as 3 -end "GC clamp" interfere with the 3 -end triplet selection.
cord-346467-a0r4xh1c	2017	title: Mycoplasma detection by triplex real-time PCR in bronchoalveolar lavage fluid from bovine respiratory disease complex cases BACKGROUND: In this study we evaluated the RespoCheck Mycoplasma triplex real-time PCR for the detection in bronchoalveolar lavage fluid (BALF) of Mycoplasma (M.) dispar, M. RESULTS: The analytical sensitivity of the RespoCheck triplex real-time PCR was, as determined by spiking experiments of the Mycoplasma strains in Phosphate Buffered Saline, 300 colony forming units (cfu)/mL for M. To enable testing of testing for BRD associated pathogens in a routine setting, real-time PCRs for detection of viral, bacterial and mycoplasma pathogens in bronchoalveolar lavage fluid (BALF) of calves have been set up by the Central Veterinary Institute (Lelystad, The Netherlands) under the name RespoCheck. In this study we used the highly conserved 16S rRNA sequence to set up the RespoCheck Mycoplasma triplex real-time PCR assay for the specific detection of M.
cord-346574-u28y1ttw	2012	At present, various laboratory methods are available for the detection and surveillance of PHE-CoV, including virus isolation [1] , hemagglutination/hemagglutination inhibition (HA/HI) tests [13] , immunohistochemistry (IHC) assays [10] , and molecular tools such as nestedpolymerase chain reaction (nested PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR) that enable detection of specific CoV RNA sequences from infected tissues [14, 15] . (1) (2) (3) In this study, an immunochromatographic strip with high sensitivity and specificity was developed for the detection of PHE-CoV, combining monoclonal antibody (MAb) and colloidal gold immunochromatography (GICA), and the resulting product is suitable for the surveillance of PHE-CoV. Thus, a lot of brain tissue samples were collected from deceased piglets with suspected PHE-CoV infection, and using RT-PCR and ELISA as reference test, the relative specificity and sensitivity of the immunochromatographic strip were determined to be 100% and 97.78%, respectively.
cord-346859-r1v6ir8u	2020	BACKGROUND: Tests for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) viral ribonucleic acid (RNA) using reverse transcription polymerase chain reaction (RT-PCR) are pivotal to detecting current coronavirus disease (COVID-19) and duration of detectable virus indicating potential for infectivity. METHODS: We conducted an individual participant data (IPD) systematic review of longitudinal studies of RT-PCR test results in symptomatic SARS-CoV-2. Because testing is pivotal to management and containment of COVID-19, we performed an individual participant data (IPD) systematic review of emerging evidence about test accuracy by anatomical sampling site to inform optimal sampling strategies for SARS-CoV-2. Previous studies have established that in COVID-19 infection, viral loads typically peak just before symptoms and at symptom onset [4] and estimated false negative test results over time since exposure from upper respiratory tract samples [2] . • Participants included will be biased to over-represent people with detectable virus in respiratory tract sampling sites and at times frequently used for testing (post symptom onset or at admission to hospital).
cord-346958-9eeqlkoq	2020	In the subgroup of RT-PCR-positive and CT-positive patients, ground-glass opacities (GGO) were present in 58/58 (100%), multilobe and posterior involvement were both present in 54/58 (93%), bilateral pneumonia in 53/58 (91%), and subsegmental vessel enlargement (> 3 mm) in 52/58 (89%) of study participants. As reported by Ai (5) , in a cohort of 1014 patients in Wuhan China, the sensitivity, specificity and accuracy of chest CT in the detection of COVID-19 pneumonia were 97%, 25% and 68% respectively using RT-PCR results as reference standard. The aim of this study was to investigate chest CT features of patients with COVID-19 in Rome, Italy, and to compare the diagnostic performance of chest CT with RT-PCR. To understand the CT features of patients with COVID-19 pneumonia, a sub-analysis was performed considering only study participants with positive RT-PCR testing and chest CT findings.
cord-346989-604gho1u	2013	RESULTS: We demonstrate that overlapping read pairs (ORP) -generated by combining short fragment sequencing libraries and longer sequencing reads -significantly reduce sequencing error rates and improve rare variant detection accuracy. We demonstrate the novel use of mismatch rates in the overlapping read pairs (ORP) to provide an unbiased assessment of the sequencer-derived quality scores when selecting a read filtering threshold, as well as to estimate position-dependent sequencing errors without relying on a clonal control. ORPs reduce error rates and provide benchmarks for quality scores For all five samples, 3 natural viral and 2 plasmid controls, Illumina paired-end sequencing was carried out using relatively short sequencing fragment libraries combined with relatively long reads (112 bp) to generate overlapping read pairs (ORP).
cord-347443-0evqo01m	2013	Seasonality has been reported for many viruses, including influenza virus, respiratory syncytial virus (RSV), and the recently described human metapneumovirus (hMPV). Major causes of bronchiolitis and lower respiratory tract illnesses in children include respiratory syncytial virus (RSV), parainfluenza viruses, influenza virus, and human metapneumovirus (hMPV). The organism/viruses detected by the FilmArray included adenovirus, influenza A virus (FluA), influenza B virus (FluB), parainfluenza virus 1 (Para 1), parainfluenza virus 2 (Para 2), parainfluenza virus 3 (Para 3), parainfluenza virus 4 (Para 4), respiratory syncytial virus (RSV), coronavirus 229E (CoronaV 229E), CoronaV NL63, CoronaV HKU1, CoronaV OC43, human metapneumovirus (hMPV), Bordetella pertussis, Chlamydophila pneumoniae and Mycoplasma pneumoniae. In our study, 939 specimens were analyzed over the course of a year using a respiratory pathogen multiplex PCR that yielded a positivity rate of 65 % with multiple analytes detected in 12 % of specimens, especially in children. RSV and hMPV PCR-positive cases were statistically much more likely than Rhino/Entero PCR-positive infections to initially present with pneumonia or bronchiolitis in our study.
cord-347462-yz67t10x	2004	title: A Comparative Study of Clinical Features and Outcomes in Young and Older Adults with Severe Acute Respiratory Syndrome Objectives: To determine the clinical presentation, findings, and outcomes of older adults (> 60) with severe acute respiratory syndrome (SARS) and compare these with a control group of younger patients (≤60). A retrospective study was undertaken in the department of medicine and geriatrics of the hospital to evaluate the clinical course of young and elderly SARS patients. Single or paired serum samples were tested for SARS-CoV antibody in 96% (50/52) of young and 76% (19/25) of older patients. Because the proportion of patients with positive RT-PCR in stool samples was similar in two groups, fewer older patients with diarrhea probably represents a generalized paucity of symptoms rather than a different site of involvement by SARS-CoV. In the current study, similar proportions of young and older patients with SARS had RT-PCR performed, and comparable positivity rates were achieved.
cord-348209-rkkhv4mw	2020	title: Clinical evaluation of a SARS-CoV-2 RT-PCR assay on a fully automated system for rapid on-demand testing in the hospital setting In this study we evaluated a SARS-CoV-2 LDT for the NeuMoDx 96 system, a fully automated (sample to result) RT-PCR platform offering random-access capabilities and good clinical performance for SARS-CoV-2 testing. In this study we evaluated a SARS-CoV-2 LDT for the NeuMoDx 96 30 system, a fully automated device performing extraction and real-time PCR. Due to its random-access workflow concept and rapid time-to-39 result of about 80 minutes, the device is very well suited for providing fast-tracked SARS-CoV-2 40 diagnostics for urgent clinical samples in the hospital setting. For the assay presented in this study, we used a fully automated random-access platform for molecular 56 diagnostics, handling everything from extraction, amplification, signal detection to reporting of results 57 (10). Evaluation of a quantitative RT-PCR assay for 180 the detection of the emerging coronavirus SARS-CoV-2 using a high throughput system
cord-348522-r7ev9br6	2012	
cord-348914-6wzqitun	2020	key: cord-348914-6wzqitun authors: Ahouach, B.; Harant, S.; Ullmer, A.; Martres, P.; Bégon, E.; Blum, L.; Tess, O.; Bachmeyer, C. cord_uid: 6wzqitun A previously healthy 57‐year‐old woman presented with fever (39 °C) lasting for 4 days, and dry cough and rash appeared 2 days before. Diffuse fixed erythematous blanching maculopapular lesions were present, asymptomatic over the limbs and trunk, with burning sensation over the palms (a, b). Thorax computed tomography scan was typical of COVID‐19; nasopharyngeal swab polymerase chain reaction (PCR) confirmed SARS‐CoV‐2. maculopapular lesions were present, asymptomatic over the limbs and trunk, with burning sensation over the palms (a, b). Thorax computed tomography scan was typical of COVID-19; nasopharyngeal swab polymerase chain reaction (PCR) confirmed SARS-CoV-2. PCR on whole-skin biopsy specimen was negative for SARS-CoV-2. Fever and rash resolved within 9 days, dry cough within 2 weeks. Urticarial and chilblain-like lesions have been reported in patients with COVID-19, but other phenotypes could be observed.
cord-348975-plne3xlz	2020	
cord-349070-bqv03u2e	2004	title: Sensitive and Quantitative Detection of Severe Acute Respiratory Syndrome Coronavirus Infection by Real-Time Nested Polymerase Chain Reaction In most of the cases, we and others have found that the single-step real time RT-PCR methods (as suggested by the World Health Organization [WHO] ; available at http://www.who.int/csr/sars/diagnostic tests/en/) could specifically detect SARS-CoV but were unable to proficiently detect !10 copies of virus per test, suggesting that the conventional RT-PCR assay may actually yield falsenegative results. In contrast, the second-round amplification by nested real-time PCR proficiently generated a signal of SARS-CoV DNA without apparent background, compared with no detectable signal for the negative control samples ( figure 1A ). After 25 cycles of first-round amplification and 25 cycles of nested PCR amplification, our assay could detect a theoretical single copy of extracted viral RNA (figure 1A), suggesting its superior sensitivity for detection of SARS-CoV.
cord-349562-ivu632j2	2010	The purpose of this study was to compare the sampling efficacy of rayon swabs and nylon flocked swabs, and of oropharyngeal and nasopharyngeal specimens for the detection of respiratory viruses in elderly patients. Regardless of the sampling site, a calculated 4.8 times higher viral load (95% confidence interval [CI] 1.3–17, p = 0.017) was obtained using the nylon flocked swabs as compared to the rayon swabs. Samples for the diagnosis of a respiratory viral infection can be obtained by swabbing the oropharynx, the nasal cavity, the nasopharynx or alternatively, by nasopharyngeal aspiration (NPA) or nasopharyngeal washings (NPW). The aim of this study was to compare the respective efficacies of rayon swabs and nylon flocked swabs in providing material for direct respiratory virus detection by real-time PCR in adults above 60 years of age. Using monoplex (RSV and human metapneumovirus) or multiplex (influenza A/B, adenovirus/internal control and parainfluenza virus 1-4) PCR methods, the specimens were examined for, in total, nine different respiratory viruses (Table 2) .
cord-349745-zlhu1jit	2020	The need for timely establishment of diagnostic assays arose when Germany was confronted with the first travel-associated outbreak of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in Europe. We found that the SARS-CoV E gene screening assay with the QuantiTect Virus +Rox Vial kit showed moderate to high amounts of unspecific signals in late cycles in 61% (451/743) of the tested patient samples and also of negative extraction and non-template controls (Table, Figure 2 ), which complicated the evaluation of the qPCR result. The Public Health Microbiology Laboratory in Bavaria was confronted with SARS-CoV-2-related events very early: once the assays and control materials arrived and the PCR assays were performed for the first time, a large contact investigation around the first German COVID-19 patient (data not shown) was immediately started, with so far more than 700 samples.
cord-349775-zwslhjju	2011	The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR) assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs) would have an impact on antibiotic prescription rate in primary care clinical settings. Acute respiratory tract infections (ARTIs) represent a major global health burden [1] , and viruses cause a large proportion of ARTIs. Distinguishing bacterial ARTIs that require antibiotic treatment from viral ARTIs not needing an antibiotic prescription can be difficult on clinical grounds alone and causes unnecessary use of antibiotics, with the highest rates occurring in the primary care setting [2, 3] . The present study was designed to evaluate whether access to a multiplex RT-PCR method targeting thirteen viruses would have an impact on antibiotic prescription rates for ARTI in a primary care setting.
cord-349782-djzxkus2	2020	
cord-349838-p6vfzbla	2020	Realizing the challenges as a result of this pandemic affecting the daily practice of the HCT centers, and the recognition of the variability in practice worldwide, the Worldwide Network for Blood &amp; Marrow Transplantation (WBMT) and the Center for International Blood and Marrow Transplant Research&nbsp;(CIBMTR) Health Services and International Studies Committee have jointly produced an expert opinion statement as a general guide to deal with certain aspects of HCT including diagnostics for SARS-CoV-2 in HCT patients, pre-and-post-HCT management, donor issues, medical tourism and facilities management. While acknowledging all aforementioned challenges and taking into account current recommendations or guidelines issued by the American Society for Transplantation and Cellular Therapy (ASTCT) and the European Society for Blood and Marrow Transplantation (EBMT) (which are WBMT members), herein, we aim at providing a consensus among the authors from WBMT and CIBMTR''s HSIS committee and other HCT experts who represent multiple continents and allude to the current worldwide threat to HCT patient from the COVID-19 pandemic (7, 8) .
cord-350016-yxf7ykva	2020	
cord-350172-w3yoxhsg	2020	
cord-350211-vuxs5wtt	2020	
cord-350296-6bq0tps2	2008	
cord-350398-w75flrwv	2012	Coupling biothreat cluster-specific PCR to electrospray ionization mass spectrometry simultaneously provides the breadth of coverage, discrimination of near neighbors, and an extremely low false positive rate due to the requirement that an amplicon with a precise base composition of a biothreat agent be detected by mass spectrometry. In addition to detecting the threat organisms, the biothreat assay described here also detects virulence factors associated with three of the agents: Bacillus anthracis (pXO1 and pXO2), Yersinia pestis (pla and caf), and Vibrio cholera (ctx1). PCR primers were designed to conserved regions within the selected target genes such that the targeted threat agent was clearly identified and differentiated from its near-neighbor species ( Table 1) . In the biothreat assay, the Francisella biocluster is identified by two genus-specific primer pairs targeting the asd (BCT2328) and galE (BCT2332) genes ( Table 1) .
cord-350593-bvmg7f15	2012	CONCLUSIONS: MID (50) for inspired H1N1 aerosols in CD‐1 mice is between 12 and 40 TCID (50); proportionality to dose of weight loss and viral populations makes the CD‐1 mouse a useful model for measuring infectivity by inhalation. Although a few publications have documented the transmissibility of influenza A through inhalation routes (Tellier 2006 (Tellier , 2009 , few studies to date have utilized a mouse model to investigate susceptibility to and pathogenicity of measured aerosol exposures. Table 2 Results of three assays [PCR, direct fluorescent antibody assay (DFA) and CPE] from the homogenates of CD-1 murine lung tissue exposed to an aerosol generated from 1Á58 9 10 6 TCID 50 ml À1 At the 3-min exposure time, no mice were positive for influenza virus as determined by Ct value.
cord-350807-qdq96723	2020	Samples were tested by PCR for the presence of herpesviruses (HSV-1/-2; VZV; CMV; HHV6; EBV), adenoviruses, bocaviruses, entero-/rhinoviruses (HRV), parechoviruses, coronaviruses, influenza viruses (IV), parainfluenza viruses as well as for pneumoviruses (HMPV and RSV), and atypical bacteria (Mycoplasma pneumoniae, M.p.; Chlamydia pneumoniae, C.p.). Furthermore, particularly transplant patients are at risk for reactivation of diverse herpesviruses (herpes simplex virus-1/-2, HSV-1/-2; varicella zoster virus, VZV; cytomegalovirus, CMV; human herpesvirus 6, HHV-6; Epstein-Barr virus, EBV) [12, 15, [17] [18] [19] [20] . In this monocentric study, genome equivalents of viruses and M.p. were frequently detected in immunocompromised (66.7%) and immunocompetent (69.2%) patients with respiratory symptoms (Table 1) . Same authors indicated a mean age of 1.8 years Table 2 Detection of multiple pathogens in the respiratory tract of the overall study population (a) as well as of immunocompromised (b) and immunocompetent (c) patients.
cord-350890-ajxvjkmq	2013	This research reports the design, analysis, integration, and test of a prototype of a real-time convective polymerase chain reaction (RT-cPCR) machine that uses a color charged coupled device (CCD) for detecting the emission of fluorescence intensity from an RT-cPCR mix in a microliter volume glass capillary. The measured results from the image-processing scheme indicate that the RT-cPCR prototype with a CCD-based fluorometer can achieve similar DNA quantification reproducibility compared to commercial machines, even when the initial DNA concentration in the test PCR mix is reduced to 10 copies/μL To assess the performance of the prototype, a single DNA template, HBV 122 base pairs, with known concentrations and a single labeling dye, SYBR Green I, was used in the PCR mixes undergoing the same thermal cycling in both the prototype and commercial RT-PCR machines for comparing their measured and predicted fluorescence intensities emitted from the glass capillaries.
cord-351038-k2m6woow	2020	Currently the nucleic acid based polymerase chain reaction is used as the reliable diagnostic platform and antigen/antibody detection immunoassays are playing the role of screening tests for early detection and prognosis in COVID-19 treatment. The limitation of rRT-PCR to detect COVID-19 past infection and the progress of the disease, increases the importance of serological assays. Currently COVID-19 antigen LFIA test is under development which will offer more sensitive and specific result for COVID-19 diagnosis and will detect the viral antigen in 3 days of infection [22] . have developed an enzyme linked immunosorbent assay for the detection of COVID-19 IgM and IgG antibody from serum sample. The complexity, cost effectiveness and limitations of nucleic acid based diagnostic tools, impetus the innovative development of well standardized, high sensitive, specific and low cost serological assays for COVID-19 diagnosis. Evaluation of enzyme-linked immunoassay and colloidal gold-immunochromatographic assay kit for detection of novel coronavirus (SARS-Cov-2) causing an outbreak of pneumonia (COVID-19).
cord-351100-llyl97ry	2020	We aimed to evaluate the time length of negativization from the onset of symptoms in healthcare workers (HCWs) with COVID-19, and to evaluate significant variations in cycle threshold (CT) values and gene positivity (E, RdRP, and N genes) among positive individuals who returned to work. We collected cycle threshold values of the first SARS-CoV-2-positive nasopharyngeal swabs (T0) for all 182 HCWs and CT values at one week before the two negative RT-PCR tests (T1) for the 58 subjects who healed by 30 April 2020 (Figure 2 ). In the present study, we analyzed 2443 nasopharyngeal swabs from 1683 HCWs by molecular laboratory testing for suspected SARS-CoV-2 infection in a large university hospital in Milan, showing 10.8% positive HCWs. Overall, the majority of HCWs with COVID-19 were physicians, and the main reported symptoms were fever, cough, and headache.
cord-351125-asrezu1f	2018	Although multiplex real-time PCR was positive for Cyclospora cayetanensis, the final diagnosis was Cystoisospora ohioensis infection, confirmed by phylogenetic analysis of 18S rRNA. ohioensis was identified in a Korean dog, using microscopy of diarrheal stools and confirmed using phylogenetic analysis of 18S ribosomal RNA (rRNA). Blood chemistry and hematology profile were analyzed using the Fuji DRI-CHEM NX500 automated clinical chemistry analyzer (Fuji, Tokyo, Japan) and veterinary hematology analyzer PE-Identification of Cystoisospora ohioensis in a Diarrheal Dog in Korea 6800 VET (Prokan, Shenzhen, China), respectively. Immunochromatographic assay, multiplex real-time polymerase chain reaction (PCR), and reverse transcription PCR (RT-PCR) were performed at POBANILAB using POBGEN canine enteric pathogen detection kits ( In order to confirm coccidian organisms in fecal samples, sequence analysis was performed as described previously [7] . Based on multiplex real-time PCR and fecal smear analyses, trimethoprim-sulfamethoxazole and metronidazole were initially administered to the puppy for treatment of the condition tentatively diagnosed as canine cyclosporiasis.
cord-351492-8jv7ip67	2020	Methods: A literature search was performed on the 1st of October 2020 to identify studies reporting diagnostic accuracy statistics of the FebriDx POC test versus real time reverse transcriptase polymerase chain reaction (RT-PCR) testing for SARS-CoV-2. Conclusions: Based on a large sample of patients from two studies during the first wave of the SARS-CoV-2 pandemic, the FebriDx POC test had reasonable diagnostic accuracy in a hospital setting with high COVID-19 prevalence, out of influenza season. In this systematic review and pooled analysis of IPD, we found that the FebriDx LFD had a pooled sensitivity of 0.920 (95% CI: 0.875-0.950) and specificity of 0.862 (0.819-0.896) for COVID-19 across two studies performed within acute hospitals in the UK when compared to RT-PCR on nose and throat swabs during the first wave of the SARS-CoV-2 pandemic.
cord-351643-8ce807ub	2010	It should be noted that all of the PCR-positive viral segments fall into the sister group of pandemic H1N1 (see online Supplemental Fig. 2) , which demonstrates the feasibility of using these real-time RT-PCR assays to detect genes from contemporary TR (PB2, PB1, PA, HA, NP, and NS) and EA (NA and M) swine viruses (2 ) . In contrast, melting-curve signals of the HA gene derived from the TR-H1 swine viruses were found to be different from that of the pandemic H1N1/ 2009 virus (Fig. 1B The sequence similarity and diversity of influenza viruses were the major hurdles for the primer design of this study. By use of the 8 established real-time PCR assays we tested RNA from 2 randomly selected samples of the original swine swab specimens that contained the pandemic H1N1/2009 virus. It should be noted that none of these assays can detect viral genes derived from seasonal human influenza viruses.
cord-351854-5s03f0pp	2020	title: Pooled RNA extraction and PCR assay for efficient SARS-CoV-2 detection We have implemented the method in a routine clinical diagnosis setting, and already tested 2,168 individuals for SARS-CoV-2 using 311 RNA extraction and RT-PCR kits. Three such limitations might be: (1) a limit on the number of stages due to the importance of delivering a test result quickly, exemplified by the urgent clinical context of COVID-19 diagnosis; (2) a limit on the ability to dilute samples and still safely identify a single positive sample in a pool; (3) favorability of simple algorithms which may minimize human error in a laboratory setting. . https://doi.org/10.1101/2020.04.17.20069062 doi: medRxiv preprint probability of a sample to be positive by p (prevalence of detectable COVID-19 patients in the relevant population) and the pool size by n. This allows for reliable and efficient screening of large asymptomatic populations for the presence of SARS-CoV-2 infection, even when RNA extraction and RT-PCR reagents are in short supply.
cord-351864-zozrj7w5	2020	
cord-352554-hsbyznex	2020	On 6th February 2020, Emergency Use Authorization (EUA) for COVID-19 testing was implemented in Korea, permitting rapid expansion of capacity in clinical and public health laboratories [5] . To evaluate the performance of the RNA extraction step, 31 and 35 samples were prepared using the Real-Prep-in-use and the new Real-Prep system, respectively, and all 66 eluates were submitted to the same run of rRT-PCR. As the experience of the Middle East Respiratory Syndrome outbreak of 2015 in Korea, an epidemic of emerging infectious diseases necessitates clinical laboratories to conduct new tests at a large scale in a short period of time with kits and equipment that have not been thoroughly validated [10] . Analytical and clinical validation of six commercial Middle East Respiratory Syndrome coronavirus RNA detection kits based on real-time reverse-transcription PCR Comparative evaluation of three homogenization methods for isolating Middle East Respiratory Syndrome coronavirus nucleic acids from sputum samples for real-time reverse transcription PCR
cord-352562-qfb478sf	2020	In the section devoted to the specific laboratory diagnosis of COVID-19, the most used RT-PCR protocols were described and some studies on the serological diagnosis with IgA, IgM and IgG detection were detailed, including the use of rapid immunochromatographic assays and discussing the ideal period after the onset of symptoms to perform each type of test. They identified 191 cases in hospitalized patients younger than 21 years of age, reported by hospitals in the New York State with the diagnosis of Kawasaki disease, toxic shock syndrome, myocarditis, and suspected multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C). The laboratory diagnosis of COVID-19 are based on the detection of viral RNA by real time amplifications (RT-PCR) 40 or the detection of antibodies (immunoglobulins) anti-SARS-CoV-2 from the classes IgM, IgA and IgG, produced by the host''s immune system. Severe acute respiratory syndrome Coronavirus 2 (SARS-CoV-2) infection in children and adolescents: a systematic review
cord-352640-fycwhyfv	2020	Our study is a short retrospective analysis of the demographic and clinical profiles of subjects presenting with a mild flu-like illness to our hospital who were tested for COVID-19. We present a short retrospective analysis of the demographic and clinical profiles of subjects presenting with a mild flu-like illness to our hospital who were tested for COVID-19. A retrospective analysis of data from subjects who presented to our hospital with mild flu-like illness between the months of March and May 2020 was conducted to understand the disease profile. Data were available for 3,026 subjects who presented to our hospital with either mild flu-like symptoms or with suspected exposure to a confirmed case of COVID-19 during the early phases of the pandemic. In this retrospective analysis, we report that among subjects presenting to the hospital with a mild flu-like illness, those who tested positive for COVID-19 were significantly older and more likely to be men.
cord-352720-z1cvjc2y	2020	While initial evidence suggests that pregnant women were not at increased risk for COVID-19, neither developed a more severe disease compared to non-pregnant adults [3, 4] , recent reports suggest increased rates of preterm birth [5] , pneumonia and intensive care unit admission [6] , and maternal mortality [6, 7] . The main objective of this study was to assess point-prevalence of SARS CoV-2 infection in unselected obstetrical population at the time of delivery and to describe the presentation and clinical evolution of confirmed cases. women were screened for COVID-19 clinical symptoms including fever, cough and shortness of breath by trained personnel, and RT-PCR for SARS CoV-2 (Allplex TM 2019-nCoV Assay [17] ) was performed by nasopharyngeal swab, unless a prior test with no more than 48 hours to admission was reported.
cord-352814-fcl2g5wr	2011	
cord-352831-ydlix2o7	2020	
cord-352872-y1qh5nig	2020	In France, chest CT in combination with reverse transcriptase-polymerase chain reaction (RT-PCR) testing was effective as a diagnostic tool to assess coronavirus disease 2019 (COVID19) pneumonia in symptomatic patients. The final discharge diagnosis based on a multiparametric item including clinical findings, RT-PCR testing, chest CT imaging, risk level of exposure, local estimated prevalence and biological data, was used as reference standard. The survey included the following parameters: clinical patient data (age, sex), results of initial chest CT and initial and/or repeat RT-PCR tests, time intervals between chest CT and RT-PCR, and final discharge summary according to the hospital discharge report. The final discharge diagnosis was based on multiparametric items, risk level of exposure, local estimated prevalence, symptoms (fever, cough, fatigue, dyspnea, anosmia), evolution during hospitalization for inpatient, Diagnostic accuracy, including sensitivity, specificity, PPV, negative predictive value, and accuracy of chest CT imaging, were calculated using final report as the reference standard.
cord-352894-88c46evj	2010	Methods: Stray dog samples were evaluated by histopathology, polymerase chain reaction (PCR), and immunohistochemistry (IHC) to investigate the status of the CAV‐2 infection on the stray dogs in Korea. Common infectious causes of respiratory disease in dogs include canine distemper virus (CDV) and canine adenovirus type 2 (CAV-2). 3 Pulmonary CAV-2 lesions are consistent with those of bronchointerstitial pneumonia, including the presence of necrosis and large basophilic intranuclear inclusion bodies (IN/IBs) in bronchiolar and alveolar epithelial cells as well as pulmonary macrophages. 5,6 Therefore, pneumonic lung tissues were examined for CAV-2 antigen by immunochemistry and CAV-2 genes by polymerase chain reaction (PCR) in the present study. 5 CAV-2 specific IC/IBs were identified in only three cases in the present study; however, seven cases were IHC positive for CAV-2 antigen detection. These results suggested that CAV-2 particles may fail to create detectable inclusions in some cases although viral antigens were present in the lung tissues.
cord-353190-7qcoxl81	2012	This chapter covers infections of mice with the following viruses: herpesviruses, mousepox virus, murine adenoviruses, polyomaviruses, parvoviruses, lactate dehydrogenase-elevating virus, lymphocytic choriomeningitis virus, mammalian orthoreovirus serotype 3, murine hepatitis virus, murine norovirus, murine pneumonia virus, murine rotavirus, Sendai virus, and Theiler''s murine encephalomyelitis virus. These results are very difficult to summarize because the outcome of experimental infection in laboratory mice depends on various factors such as mouse strain and age, virus strain and passage history [26] , virus dose and route of inoculation [24] . Experimental infection of laboratory mice with MHV-68 is a frequently used model system for the study of human gammaherpesvirus pathogenesis, e.g. of Kaposi''s sarcoma-associated herpesvirus or Epstein-Barr virus (EBV) [62, 63] which are members of the same subfamily. Early descriptions of naturally occurring disease may have been complicated by concurrent infections such as MHV (murine hepatitis virus) or murine rotavirus A (MuRV-A)/epizootic diarrhoea of infant mice (EDIM) virus that contributed to the severity of the lesions especially in liver, pancreas, CNS and intestine.
cord-353241-ityhcak7	2020	Considerable effort has been invested in the development of portable, user-friendly, and cost-effective systems for point-of-care (POC) diagnostics, which could also create an Internet of Things (IoT) for healthcare via a global network. Connecting the easy to use and cost-effective POC devices providing the DENV diagnoses via a mobile network would create an Internet of Things (IoT) [15] for healthcare [16, 17] , an essential tool to tackle any infectious disease outbreak. Prior to testing on an IoT PCR device, we verified the master mix performance and its values of critical threshold (C T ) and the melting temperature (T M ) using a commercial real-time PCR system (Supplementary Section A) beginning with a hot start at 95°C for 30 s followed by 40 cycles of PCR amplification consisting of DNA denaturation at 95°C for 8 s, primer annealing at 60°C for 30 s, and DNA sequence elongation at 72°C for 10 s, then followed by melting curve analysis (MCA) from 72°C to 95°C.
cord-353246-q9qpec7t	2017	The objective of this study was to compare the performance of the RP panel with those of laboratory-developed real-time PCR assays, using a variety of previously collected clinical respiratory specimens. In the current study, the performance of the syndromic RP panel was compared to those of laboratory-developed real-time PCR assays, using clinical specimens previously submitted for diagnosis of respiratory pathogens. The 323 positive clinical specimens contained a total of 464 respiratory pathogens as detected by laboratory-developed real-time PCR assays (Table 1) . Owing to the lack of clinical specimens containing MERS-CoV, dilutions of two different culture isolates were tested in this study, of which dilutions with C T values of Ͻ30 as shown by the laboratory-developed real-time PCR assay could be detected consistently. In conclusion, this study shows excellent performance of the GenMark ePlex RP panel in comparison to laboratory-developed real-time PCR assays for the detection of respiratory pathogens from multiple types of clinical specimens and EQA samples.
cord-353253-kk2q71vg	2020	Soon after the pandemic was recognized by epidemiologists, a group of biologists comprising the ARTIC Network, has devised a multiplexed polymerase chain reaction (PCR) protocol and primer set for targeted whole-genome amplification of SARS-CoV-2. In our experience, the low to zero depth for those two amplicons was the most frequent bottleneck for using the ARTIC primer set V1 to sequence all targeted genomic regions from samples with middle to low viral load (Ct > 27). The results indicated that preventing primer dimerformation is an effective measure to improve coverage bias in the ARTIC Network''s SARS-CoV-2 genome sequencing protocol, and may be applicable to other PrimalSeq methods in general. The formation of primer-dimers is a major cause of coverage bias in the ARTIC Network''s multiplex PCR protocol for SARS-CoV-2 genome sequencing. A proposal of an alternative primer for the ARTIC Network''s multiplex PCR to improve coverage of SARS-CoV-2 genome sequencing (manuscript version 1)
cord-353353-njvalb44	2016	Analysis of 13 complete genome sequences showed that "Rosavirus B" and "Rosavirus C" represent two potentially novel picornavirus species infecting different rodents. Rosavirus C isolated from 3T3 cells causes multisystemic diseases in a mouse model, with high viral loads and positive viral antigen expression in organs of infected mice after oral or intracerebral inoculation. Rosavirus C isolated from cell culture causes multisystemic diseases in a mouse model, with histopathological changes and positive viral antigen expression in lungs and liver of infected mice. A total of 13 complete genomes from samples of four different wild rodent species (chestnut spiny rat, Coxing''s white-bellied rat, roof rat and Indochinese forest rat) positive for "Rosavirus C" and one street rodent species (Norway rat) positive for "Rosavirus B" were sequenced directly from the positive respiratory or alimentary samples and characterized. Infected cell lines and tissues from challenged mice that were tested positive for rosavirus C RASM14A by RT-PCR were subject to viral load studies and immunohistochemical staining for viral VP1 protein as described previously [28, 69] .
cord-353499-os328w9o	2020	Here we present a machine learning model incorporating patient demographic features (age, sex, race) with 27 routine laboratory tests to predict an individual''s SARS-CoV-2 infection status. Overall, this model employing routine laboratory test results offers opportunities for early and rapid identification of high-risk SARS-COV-2 infected patients before their RT-PCR results are available. In this study, we hypothesized that the results of routine laboratory tests performed within a short time frame as the RT-PCR testing, in conjunction with a limited number of previously identified predictive demographic factors (age, gender, race) (16), can predict SARS-CoV-2 infection status. selected to construct the input feature vectors of the prediction model based on the following criteria: 1) a result available for at least 30% of the patients two days before a specific SARS-CoV-2 RT-PCR test, and 2) showing a significant difference (p-value, pvalue after Bonferroni correction, p-value after demographics adjustment all less than 0.05) between patients with positive and negative RT-PCR results.
cord-353573-y9jro9gt	2017	BACKGROUND: Both respiratory syncytial virus (RSV) and human metapneumovirus (hMPV) are important viral pathogens causing respiratory tract infection (RTI) in the pediatric population. RESULTS: Our one-step triplex qRT-PCR assay showed 100% sensitivity and specificity in testing RSV and hMPV in 86 known virus culture supernatants, with excellent linearity (R(2) > 0.99) and reliable reproducibility (CV lower than 1.04%). The aim of this study is to design and assess the diagnostic performance of clinical specimens for the simultaneous identification of RSV and hMPV by using one-step triplex qRT-PCR assay with TaqMan probes. Our one-step triplex qRT-PCR results showed that the viral load of the RSV or hMPV-positive samples from clinical specimens varied over a wide range, presenting threshold between Ct 21 and 44 (21 and 44 cycles). In this study, we established a rapid and internally controlled triplex qRT-PCR assay that can identify RSV and hMPV virus in one reaction mixtures.
cord-353810-mf753ae9	2019	This report also describes a successful application of capture-based purification as a direct RNA sequencing strategy that addresses certain limitations of current strategies in sequencing RNA viral genomes. Based on the mapping rates to human and DENV1 reference genomes for pre and post-capture groups, shown in Table 2 , purification factor was calculated to be 272-fold. The minimum coverage required for variant calling was, as described above, benchmarked to that of Illumina reads so that the effectiveness of our capture-based purification method could be more accurately evaluated based on the higher error read rates of direct RNA sequencing technology. Indeed, after comparison of the postcapture and concentrated post-capture sequencing runs (Table 2) , the 2.5-fold increase in the percentage of reads mapping to DENV1 suggests that scaling our method greatly improved the signal-to-noise ratio of this particular downstream RNA assay.
cord-353957-0pjg25kn	2017	
cord-354035-i3sl2r0k	2016	Sensitive, culture-independent molecular assays (polymerase chain reaction and high-throughput sequencing) reveal that in addition to common viruses that cause acute, symptomatic infections the virome also includes viruses that do not cause clinical symptoms, have unknown pathogenic effect, or cause symptoms but are not among the most common viral respiratory tract pathogens. However, as characterization of the respiratory tract virome using molecular methods is a relatively new area of exploration, these studies can be useful in order to determine if viruses beyond the common, known respiratory pathogens are detected. In a study of 71 patients, viruses were assessed in nasal swabs using a panel of targeted PCR assays for common respiratory pathogens. Another study tested 89 nasopharyngeal swabs from adults with upper respiratory tract infections using reverse transcription (RT)-PCR assays for a series of common viruses, including human rhinoviruses, coronaviruses, influenza viruses and others, and by RNA sequencing.
cord-354103-4dldgqzf	2020	While epidemiologists and infectious disease physicians are at the forefront in the fight against COVID-19, this pandemic is also a "stress test" to evaluate the capacity and resilience of our surgical community in dealing with the challenges imposed to our health system and society. On the same day, the United States Surgeon General echoed the recommendation from the American College of Surgeons and urged hospitals and healthcare systems to consider suspending elective surgical procedures during the outbreak of COVID-19. This pandemic started with identification of novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) as the causative agent from a cluster of pneumonias in the Hubei providence of China in December 2019. On March 25, 2000, American College of Surgeons released the guidelines for emergency general surgery in COVID-19 positive patients or those at high clinical suspicion for COVID infection. Correlation of Chest CT and RT-PCR Testing in Coronavirus Disease 2019 (COVID-19) in China: A Report of 1014 Cases
cord-354308-ol8twpay	2020	
cord-354683-l07w3lc7	2020	
cord-354725-lqio7l8k	2020	
cord-354733-qxivrhj8	2020	Whole genome sequencing confirmed the virus genotype in patients with prolonged 28 viral RNA shedding and droplet digital PCR (ddPCR) was used to assess the rate of false 29 negative standard of care PCR results. Whole genome sequencing confirmed the virus genotype in patients with prolonged 28 viral RNA shedding and droplet digital PCR (ddPCR) was used to assess the rate of false 29 negative standard of care PCR results. Prolonged viral RNA shedding was associated with recovery of infectious 31 virus in specimens collected up to 20 days after the first positive result in patients who were 32 symptomatic at the time of specimen collection. Infection control personnel and physicians managing COVID-19 patients and patients under 43 investigation (PUI) continue to face several diagnostic dilemmas related to a lack of 44 understanding of the clinical sensitivities of SARS-CoV-2 molecular diagnostics and the 45 correlation between viral RNA detection and shedding of infectious virus.
cord-354773-u86bdmvf	2020	To improve the diagnostic accuracy of nucleic acid detection of SARS-Cov-2 in low viral load samples using droplet digital PCR, we compared the dynamic range and the limit of detection (LoD) with a 95% repeatable probability between ddPCR and RT-PCR in laboratory, and tested the clinical samples from 77 patients by both ddPCR and RT-PCR for head to head comparison. Throat swab samples of each patient were firstly collected for official approved RT-PCR diagnosis in hospitals and blinding laboratory RT-PCR and ddPCR tests simultaneously with the same primers/probe sets approved by Chinese CDC. As shown in Figure 3 , throat swab samples of each suspected outpatient were firstly collected for laboratory RT-PCR, ddPCR tests and official approved RT-PCR diagnosis in hospitals simultaneously with the same primers/probe sets approved by Chinese CDC (Table 1) . In this study, two throat swab samples of each supposed convalescent were collected for laboratory RT-PCR, ddPCR and official approved RT-PCR tests simultaneously with the same primers/probe sets (Table 2) .
cord-354943-wxhbwcfr	2020	
cord-355014-los6q1k4	2020	Although the real-time RT-PCR detection of the virus nucleic acid is the current golden diagnostic standard, it has high false negative rate when only apply single test. Although the real-time RT-PCR detection of the virus nucleic acid is the current golden diagnostic standard, it has high false negative rate when only apply single test. Nucleic acid RT-PCR test is the diagnosis basis of confirming COVID-19, but the first-time test has relatively high false negative rate. When first RT-PCR test show negative result, the chest CT scan, contact history, age and lymphocyte count of the suspected patient should be used combinedly to assess the possibility of SARS-CoV-2 infection. When first RT-PCR test show negative result, the chest CT scan, contact history, age and lymphocyte count of the suspected patient should be used combinedly to assess the possibility of SARS-CoV-2 infection.
cord-355102-jcyq8qve	2020	PURPOSE: This work describes a machine learning model derived from hemogram exam data performed in symptomatic patients and how they can be used to predict qRT-PCR test results. METHODS: Hemogram exams data from 510 symptomatic patients (73 positives and 437 negatives) were used to model and predict qRT-PCR results through Naïve-Bayes algorithms. In order to evaluate the adequacy and generalization power of the proposed model, as well as its tolerance to handle samples containing missing data (i.e., at least one variable with no informed values), an additional set of 92 samples (10 positives for COVID-19 and 82 negatives) was obtained from the patient database. When no clinical or medical data is available, or when decisions regarding resource management involving multiple symptomatic patients are necessary, the model can be used in multiple individuals simultaneously, aiming to identify those with higher probabilities of presenting positive qRT-PCR results.
cord-355489-tkvfneje	2010	Yet, the phylogenetic relationships between strains isolated along the covered period of time suggests that viral strains detected in some years, although belonging to the same genotype V, have different recent origins corresponding to multiple re-introduction events of viral strains that were circulating in neighbor countries. Due to the importance of DENV in public health, the particular goals of this research were to reconstruct the phylogenetic history of DENV-1 and to date the phylogenetic tree using isolation time as calibration points to establish date of introduction of virus and rate evolution patterns of virus in Colombia. Previously reported genotypes were represented in the tree and placed most of the Colombian isolates nesting in the genotype V clade (America, Africa) and were closely related to Argentina, Brazil and Paraguay virus strains.
cord-355874-nz6eqcdb	2016	title: A GeXP-Based Assay for Simultaneous Detection of Multiple Viruses in Hospitalized Children with Community Acquired Pneumonia In this study, we used the GeXP-based assay for simultaneous detection of 20 types/subtypes of viruses in 1699 nasopharyngeal specimens collected from hospitalized children with CAP. To evaluate the sensitivity of the GeXP assay, nucleic acid from all 20 target viruses and the internal control pcDNA3.1 (+) DNA were mixed to make the template pool. In the present study, we applied multiplex RT-PCR together with automated capillary electrophoresis, namely the GeXP-based assay, to detect virus in 1699 nasopharyngeal specimens from hospitalized children with CAP. We showed that the GeXP-based assay had high sensitivity and specificity for simultaneous detection of multiple viruses, and about 65% of cases tested were positive for virus. The development of a GeXP-based multiplex reverse transcription-PCR assay for simultaneous detection of sixteen human respiratory virus types/ subtypes
cord-355988-4eldkteb	2007	Here we describe a powerful new approach for infectious disease surveillance that is based on polymerase chain reaction (PCR) to amplify nucleic acid targets from large groupings of organisms, electrospray ionization mass spectrometry (ESI‐MS) for accurate mass measurements of the PCR products, and base composition signature analysis to identify organisms in a sample. Most of the new technologies being developed for detection of infectious agents incorporate a version of quantitative polymerase chain reaction (PCR), based upon the use of highly specific primers and probes and designed to selectively identify specific pathogenic organisms. The process uses electrospray ionization mass spectrometry (ESI-MS) and base composition analysis of PCR amplification products from highly conserved genomic regions to identify and determine the relative quantity of pathogenic bacteria, FIGURE 1. Importantly, the base composition data for some of the isolates represented new measurements from regions that have not been sequenced, showing the potential of this strategy to identify previously unknown or newly emerging viruses.
cord-356007-6b0w36l9	2018	OBJECTIVE: To investigate a Middle East respiratory syndrome coronavirus (MERS-CoV) outbreak event involving multiple healthcare facilities in Riyadh, Saudi Arabia; to characterize transmission; and to explore infection control implications. Of these 10 available HCP, 9 reported prolonged, close contact with an unrecognized patient case before implementation of MERS-CoV IPC measures and with limited PPE use ( Table 3 ). Among the 10 interviewed HCP cases, the time from first positive MERS-CoV result to serum collection was 55-61 days, and 1 was seropositive: a 32-year-old female who had reported headache, muscle aches, and productive cough. Among them, 9 HCP (33%) tested rRT-PCR positive for MERS-CoV; 5 reported contact with index patient B before At hospital B, 34 of 50 MERS-CoV rRT-PCR-negative HCP contacts of cases (68%) were interviewed and provided serum. One was seropositive, a physician who had close, prolonged contact with index B after isolation and while wearing recommended PPE; however, he had previously tested rRT-PCR positive for MERS-CoV in 2013.
cord-356370-jjl1hbeb	2020	In response to the outbreak, several state authorities and commercial companies have developed diagnostic assays to test individuals for the SARS-CoV-2 infection. In the US, clinical laboratories are required to perform ''bridging studies'' on FDA approved SARS-CoV-2 diagnostic assays to implement testing under the EUA regulation. Although, the reverse transcription-polymerase chain reaction (RT-PCR) based assays for the detection of SARS-CoV-2 nucleic acid regions might be the most practical approach at present, qualitative assays are far from providing insights into the evolution of the virus and the varied immune response in different populations. In addition, the RT-PCR based assays provide a unique opportunity to implement pooling sample strategy for wide-scale population screening for SARS-CoV-2. Several studies, including from our laboratory (under review) have demonstrated that pooling sample strategy is a practical and feasible method for screening populations for SARS-CoV-2 [2] . Laboratories should therefore prime for serologic testing by validating assays using RT-PCR confirmed COVID-19 samples.