id	author	title	date	pages	extension	mime	words	sentences	flesch	summary	cache	txt
cord-005309-147erliy	Senanayake, Savithra D.	Precise large deletions by the PCR-based overlap extension method	1995		.txt	text/plain	859	44	59	The authors describe an efficient method for generating large deletions (>200 nts) of precise length using the PCR-based method of gene splicing by overlap extension (1). Gene splicing by overlap extension or gene SOEing (1) is a powerful PCR-based technique for generating recombinant DNA molecules. A cloned 2231 nt subgenomic defective-interfering RNA of the bovine coronavirus in the pGEM3Zf(-) vector (Promega), containing an in-frame reporter sequence and called pDrepl (4) ( Fig. 1 ) was used for large deletion mutagenesis. GT3', the "universal" primer for pGEM vectors, and primer B, 5'CTTACCAGGAGTAAAAGA CATTGTGACCTATGGGTGGGCC3', which anneals to bases 192-213 and 502-519 in the genome-sense (plus) strand of pDrepl and forms the deletion, were used in the first round of PCR. Oligonucleotidedirected mutagenesis: A simple method using two oligonucleotide primers and a single-stranded DNA template	./cache/cord-005309-147erliy.txt	./txt/cord-005309-147erliy.txt