key: cord-272596-yxvg8357
authors: WU, Jian Jun; JIN, Yu; LIN, Na; XIE, Zhi Ping; YU, Jie Mei; LI, Jin Song; CAO, Chang Qing; YUAN, Xin Hui; SONG, Jin Rong; ZHANG, Jing; ZHAO, Yang; GAO, Xiao Qian; DUAN, Zhao Jun
title: Detection of Human Bocavirus in Children with Acute Respiratory Tract Infections in Lanzhou and Nanjing, China
date: 2014-11-30
journal: Biomedical and Environmental Sciences
DOI: 10.3967/bes2014.110
sha: 
doc_id: 272596
cord_uid: yxvg8357

Abstract Objective The aim of this study was to explore the prevalent characteristics of HBoV1 and its co-infection. Methods PCR was used to detect HBoV1-DNA (HBoV1) and other viruses. A multivariate logistic regression model was used to explore possibility of co-detected for related viruses. Results The positivity rates in Nanjing and Lanzhou were 9.38% (74/789) and 11.62% (161/1386), respectively (P<0.05). The HBoV1 positive group was younger than negative group (P<0.05). Seasonal differences were noted, with a higher frequency of infection in December and July. HBoV1-positive children [72.34% (169/235)] were co-infected with other respiratory viruses. Multifactorial analysis showed no correlations between HBoV1 and the clinical classification, region, gender, age, or treatment as an outpatient or in a hospital. Correlations were identified between HBoV1 infections with ADV (OR=1.53, 95% CI 1.03-2.28), RSV (OR=0.71, 95% CI 0.52-0.98), and IFVA (OR=1.77, 95% CI 1.00-3.13). Conclusions Presence of HBoV1 in nasopharyngeal aspirates did not correlate with region or gender, although the prevalence of HBoV1 was higher in younger children. There were no correlations between HBoV1 and other variables, except for the season and ADV, RSV, or IFVA infections.

INTRODUCTION espiratory infections are often the result of combined bacterial and viral infections [1] , and severe acute respiratory infections are the leading cause of mortality among children WORLDWIDE [2] . The traditional viruses known to cause respiratory tract infections include adenovirus (ADV), influenza virus (IFV) A and B, human rhinoviruses (HRV), and respiratory syncytial virus (RSV). New viruses have been discovered in recent years, including human metapneumovirus (hMPV) [3] , the coronaviruses HCoV-NL63 [4] , and HCoV-HKU1 [5] [6] , as well as human bocavirus (HBoV) which was the first virus identified by molecular virus screening in 2005 [7] . More than two-thirds of childhood pneumonia cases are associated with viral infections [8] [9] . Reports of HBoV in respiratory tract infections have increased rapidly in numerous countries and regions throughout the world [10] [11] [12] [13] [14] [15] [16] [17] , with HBoVs detected in 1.5%-19% of respiratory tract secretions and 0.8%-9.1% of fecal samples [12] [13] . Thus, increasing evidence suggests that HBoV1 is an important cause of respiratory tract infections [10] [11] [12] 14] . HBoV2 [18] , HBoV3 [19] , and HBoV4 [20] were isolated recently in stool samples from patients with diarrhea. All four HBoV genotypes can be detected in stool of patients with acute gastroenteritis, while HBoV1 and HBoV2 were reported in respiratory tract samples [12] . However, pathogen testing of respiratory infected patient sputum found the presence of other viruses and bacteria in addition to HBoV1. Thus, it remains to be clarified whether high-rates of HBoV co-infection in the respiratory tract lead to disease, or represents only a concomitant viral infection. There is also a lack of large-scale HBoV studies determining whether there are ethnic and regional differences in HBoV detection rates, since the incidence and clinical presentation of HBoV vary widely. Furthermore, the epidemiological characteristics of HBoV1 and its relationships with other viruses need to be elucidated.

From November 2007 to July 2011, nasopharyngeal aspirates (NPAs) were obtained from 2175 children <173 months of age with acute respiratory tract infection. All cases of children with acute respiratory tract infections were included in our study, data were collected using a standardized questionnaire, diagnostic criteria based on Practical Pediatrics (Seventh Edition), including: acute upper respiratory tract infections (including acute laryngitis, herpes angina, acute tonsillitis), acute bronchitis (including asthmatic bronchitis), pneumonia (including bronchiolitis), and acute exacerbation of bronchial asthma. Inclusion criteria: (1) patients with the 'acute respiratory infection' diagnostic criteria characteristics from inpatient or outpatient, (2) patients or legal guardian signed an informed consent form, (3) age of patients were <15 years, (4) the course of disease of patients were within 48 h. Exclusion criteria: (1) the patients did not meet the diagnostic criteria, (2) Although within 48 h, the patients had received anti-viral or anti-inflammatory drug treatment, (3) patients associated with cardiovascular, liver, kidney, hematopoietic system, or other serious diseases, (4) the sample of patients could not be completely collected. Of these samples, 1386 were from the First Hospital of Lanzhou University (Lanzhou, China) and 789 were from Nanjing Children's Hospital, Medical School of Nanjing University (Nanjing, China). Acute respiratory tract infections were classified according to WHO definitions [21] ; children with symptoms of acute upper respiratory tract infection (URTI) and acute lower respiratory tract infection (LRTI) were diagnosed in the presence of characteristic manifestations of rhinitis, pharyngitis, tracheitis, bronchitis, pneumonia, and severe pneumonia. The clinical diagnostic classification (I-IV) was based on previous studies [22] . It was assessed at the time of enrollment and categorized as follows. I grade: very mild (upper respiratory tract symptoms/signs only); II grade: Mild (lower respiratory tract symptoms/signs +/2 upper respiratory tract symptoms/signs but not needing hospital admission); III grade: moderate (lower respiratory tract symptoms/signs +/2 upper respiratory tract symptoms/signs, needing hospital admission but with oxygen saturations in air >93% on pulse oximetry); IV grade: severe (lower respiratory tract symptoms/signs +/2 upper respiratory tract symptoms/signs, needing hospital admission and oxygen with saturations in air <93%). Informed consent was obtained from the parents of all children who provided specimens and the study protocol was approved by the Ethics Committee of each hospital. Demographic and clinical data were recorded from all patients and specimens were stored at -80 °C for further analysis. Viral RNA and DNA were extracted from the NPAs by using a QIAamp® Viral RNA Mini Kit (Qiagen, Hilden, Germany), which extracts viral RNA and DNA simultaneously according to the manufacturer's instructions.

The nested PCR assay with primers (forward1 5'-A GGTAAAACAAATATTGCAAA GGCCAT AGTC-3' and reverse1 5'-TGGGAGTTCTCTCCGTCCGTAT C-3', forward2 5'-AGGGTTTG T CTTTAACGATTGC AGAC AAC-3', and reverse2 5'-TATACACAGAGT CGTCAGCAC TATGAG-3') was performed using Ex-Taq DNA polymerase (TaKaRa, Beijing, China) to amplify a 455-bp fragment targeting a portion of the NS1 genes, as reported previously [23] . The amplicons from a second-round of PCR were analyzed by 1.5% agarose gel electrophoresis and sequenced with the Big-Dye Terminator Cycle sequencing kit and the automated ABI Prism 310 Genetic Analyzer (Qiagen, Beijing, China). Sequences were edited using the DNA Star software package. BLAST (www.ncbi. nlm.nih.gov) was used to confirm gene identities in the National Center for Biotechnology Information (NCBI) databases.

All samples were tested for 11 pathogens using standard reverse transcription PCR. These pathogens included IFVA, IFVB, HMPV, RSV, HRV, PIV types 1-3, HCoV-NL63, and HKU1 [7, [24] [25] [26] . A different PCR method was used to detect ADV [27] .

All sample data were done using EpiData Analysis. Categorical data and the median ages of children in different groups were compared using the Chi-square (χ 2 ) test and Mann-Whitney test, respectively. Binary logistic regression analysis and independent variables were defined by region (Lanzhou=1, Nanjing=2), gender (Male=1, Female=2), age (months), season (1-12), disease classification (I-IV), and inpatient/outpatient (inpatient=1, outpatient=2). The 11 other respiratory viruses were also defined as independent variables (positive=1, negative=0). HBoV1 infection (positive=1, negative=0) was the dependent variable in multivariate analysis. Eigenvalues and condition indices were used to assess multi-colinearity in the regression models. All tests were two-tailed and P≤0.05 was considered statistically significant. All analyses were performed using SPSS version 13.0.

The 2175 children with acute respiratory infections in this study were aged 9 d to 173 months (The median age was 26 months). The majority of patients (74.11%) were aged >24 months. The ratio of males to females was 2.0:1.0 and that of inpatients to outpatients was 6.35:1. The case ratio of Lanzhou to Nanjing was 1.76:1.0. Respiratory tract infection disease classifications at grade III-IV accounted for 66.73% of cases.

HBoV1-DNA was detected by nested PCR in 235 specimens, an overall frequency of 10.80%. HBoV1 positive rates were 11.62% (161/1386) in Lanzhou and 9.38% (74/789) in Nanjing (χ 2 =2.61, P>0.05). The ratio of males to females with HBoV1-DNA was 1.83:1 but the HBoV1 positive rate did not differ based on gender or region ( Table 1 ). The positivity rates were 6.97% (53/760) for the <6 months old group, 14.55% (112/770) for the 7-24 months old group, 12.30% (53/431) for the 25-60 months old group, 13.64% (9/66) for the 61-72 months old group, 5.41% (8/148) for the >72 months old group (Figure 1 ). HBoV1-DNA was detected in every month, but detection peaked in December (13.75%), followed by 13.16% in July, 12.70% in February, 12.50% in April, and 11.29% in May (Figure 2 ). The seasonal distribution of HBoV1-DNA differed significantly (χ 2 =19.97, P<0.05) in the positive and negative groups. While our study used highly sensitive and low error probability nested PCR to screen HBoV1, HBoV1 detection rates varies widely. Since our techniques result in highly precise and sensitive detection of HBoV1 infection, environmental or socio-economic factors may potentiate different patient risk factors. Previous studies had shown that the peak of HBoV1 infection is in the summer [12, 14] or spring [37, 39] . In our study however, the peak seasons of HBoV1 infection occurred in February, April, July, and December during the 48 months collecting period. Thus, the seasonal frequency of HBoV1 infection should be further investigated as it appears to be more common in the colder seasons [37] . Regardless, the seasonal peaks of HBoV1 infection have differed among counties and climate regions.

Previous studies have determined that HBoV1 has a high co-infection rate with other respiratory viruses [12] [13] , but Its pathogenic role was still debatable due to high frequency of co-infection. HBoV1 may exist in the respiratory tracts as a bystander without causality to a patient's current symptoms [13] . Additionally, HBoV1 may have an important role in acute respiratory infections among children [43] . In patients with respiratory complaints, HBoV1 can be found alone or, more often, in combination with other viruses known to cause respiratory complaints [44] . HBoV1 may be a factitive with other respiratory viruses for the observed symptions, suggested by the findings that symptomatic children had higher HBoV1 viral load than asymptomatic children [41] . In our study, 72.34% of HBoV1-positive patients had co-infection with 10 different respiratory viruses, which is similar to previous reports [12] [13] [14] [46] [47] [48] . HBoV1 co-infection has been reported with RSV [8] [9] 14, [45] [46] [47] [48] , IFVA [12, 14] , and ADV [8] [9] in children and adults with respiratory tract infections, and also with HMPV infections in children with community-acquired pneumonia [49] . Thus, the reasons underlying the high co-infection rate of HBoV1 need further study and leads to questions regarding HBoV1 pathogenicity [12] . Recent studies based on epidemiological evidence show that HBoV1 was likely to be a major contributor to acute respiratory tract disease, particularly in infants and chlidren [13] . HBoV1 co-infections with other viruses have been associated with greater disease burden (i.e., more hospitalizations and loss of school days) in children with respiratory tract infection than in those with HBoV infection alone. Many factors might have an impact on HBoV1 infection and a larger study seemed to corroborate a synergistic relationship between HBoV1 and the pathogenesis of respiratory syndromes such as influenza-like illnesses, bronchiolitis, and pneumonia [47] . However, our regression model showed that HBoV1-positivity was highly correlated with season, RSV, ADV, and IFVA (P<0.05).

HBoV1 belongs to the parvoviridae family with viral head-to-tail genome sequences that use typical rolling circle replication [50] [51] . HBoV1 may be triggered by helper viruses, although it had been hypothesized that picornaviruses may be a factor that promotes clinical illnesses [52] . Our analysis suggested a possible synergistic effect between HBoV1 and ADV and IFVA (OR>1). The results should be confirmed by further clinical and experimental data. Nevertheless, given that the OR value for RSV infection in multivariate analysis was <1, it was estimated that related to the wide distribution of RSV. Unfortunately, the analysis results did not show a link between age and HBoV1, which may be due to the fact that infants and young children were the primary participants in our study. This connection requires further investigation before any interactions can be confirmed.

Deficiencies still existed in our manuscript because some patients or legal guardians did not agree to take part in our study. As such, some cases were missed, so potential sample selection bias were not absolutely avoided. However, our large sample size likely weakened any potential sample bias. Samples of cases that were excluded were not collected in this study, so the frequency of infection in exclusive samples of cases needs to be revealed by more studies. In addition, distribution of HBoV1 positive infections in children without respiratory tract infections remains crucial to be explored for revealing relationships between HBoV1 in the health and the diseased.

In summary, we examined HBoV1 in children with respiratory infections but require further information to elucidate its pathogenic role. Our understanding of this virus would be greatly enhanced by large-scale molecular epidemiological studies of pathogens in different regions.

None of the authors has a conflict of interest.

ZD and YJ designed the study. CC, XY, JS, JZ, YZ, and XG collected the samples. JW, JL, ZX, and XG performed the PCR tests. JW and NL analyzed the data. JW, JY, and NL wrote and finalized the manuscript. All authors read and approved the final manuscript.

Epidemic Intelligence Service investigations of respiratory illness

RNA viruses in young Nepalese children hospitalized with severe pneumonia

A newly discovered human pneumovirus isolated from young children with respiratory tract disease

A previously undescribed coronavirus associated with respiratory disease in humans

Clinical and molecular epidemiological features of coronavirus HKU1-associated community-acquired pneumonia

Characterization and complete genome sequence of a novel coronavirus, coronavirus HKU1, from patients with pneumonia

Cloning of a human parvovirus by molecular screening of respiratory tract samples

The role of respiratory viral infections among children hospitalized for community-acquired pneumonia in a developing country

Etiology of community-acquired pneumonia in hospitalized children based on WHO clinical guidelines

Detection of human bocavirus in children with upper respiratory tract infection by polymerase chain reaction

Detection of bocavirus in children suffering from acute respiratory tract infections in Saudi Arabia

Surveillance and genome analysis of human bocavirus in patients with respiratory infection in Guangzhou, China

Human bocavirus-the first 5 years

Detection of human bocavirus from children and adults with acute respiratory tract illness in Guangzhou, southern China

Detection of HBoV DNA in idiopathic lung fibrosis

Primary and secondary human bocavirus 1 infections in a family

Life-threatening respiratory tract disease with human bocavirus-1 infection in a 4-year-old child

A newly identified bocavirus species in human stool

A novel bocavirus associated with acute gastroenteritis in Australian children

Human bocaviruses are highly diverse, dispersed, recombination prone, and prevalent in enteric infections

Integrated management of childhood illness handbook

Viral and atypical bacterial detection in acute respiratory infection in children under five years

Human bocavirus in children hospitalized for acute gastroenteritis: a case-control study

Development of three multiplex RT-PCR assays for the detection of 12 respiratory RNA viruses

Human coronavirus NL63 infection in Canada

Detection of the new human coronavirus HKU1: a report of 6 cases

Detection of adenovirus in clinical specimens by polymerase chain reaction and liquid-phase hybridization quantitated by time-resolved fluorometry

Correlation between bocavirus infection and humoral response, and co-infection with other respiratory viruses in children with acute respiratory infection

Frequent and prolonged shedding of bocavirus in young children attending daycare

Human bocavirus species 2 and 3 in Brazil

Phylogenetic and recombination analysis of human bocavirus 2

High incidence of human bocavirus infection in children in Spain

Seroepidemiology of human bocaviruses 1-4

Co-circulation of genetically distinct human metapneumovirus and human bocavirus strains in young children with respiratory tract infections in Italy

Human bocavirus in Jordan: prevalence and clinical symptoms in hospitalised paediatric patients and molecular virus characterisation

Human Bocavirus infection

Human bocavirus: a novel parvovirus epidemiologically associated with pneumonia requiring hospitalization in Thailand

Clinical relevance of human bocavirus with acute respiratory tract infection and diarrhea in children: a prospective case-control study

Frequent detection of bocavirus DNA in German children with respiratory tract infections

The association of newly identified respiratory viruses with lower respiratory tract infections in Korean children

High human bocavirus viral load is associated with disease severity in children under five years of age

Human bocavirus infection in children with acute respiratory tract infection in India

Human bocavirus in children with acute respiratory infections in Vietnam

Human bocavirus, a newly discovered parvovirus of the respiratory tract

Complete genome sequence of a novel reassortant H11N2 avian influenza virus isolated from a live poultry market in eastern China

Distinct regulation of host responses by ERK and JNK MAP kinases in swine macrophages infected with pandemic (H1N1) 2009 influenza virus

Human bocavirus in Italian patients with respiratory diseases

Rapid detection of respiratory tract viral infections and coinfections in patients with influenza-like illnesses by use of reverse transcription-PCR DNA microarray systems

Viruses and bacteria in sputum samples of children with community-acquired pneumonia

Detection of head-to-tail DNA sequences of human bocavirus in clinical samples

Human bocavirus infection in young children with acute respiratory tract infection in Lanzhou

Does human bocavirus infection depend on helper viruses? A challenging case report