id	sid	tid	token	lemma	pos
cord-252671-uf96jgig	1	1	key	key	JJ
cord-252671-uf96jgig	2	1	:	:	:
cord-252671-uf96jgig	2	2	cord-252671-uf96jgig	cord-252671-uf96jgig	JJ
cord-252671-uf96jgig	2	3	authors	author	NNS
cord-252671-uf96jgig	2	4	:	:	:
cord-252671-uf96jgig	2	5	Wang	Wang	NNP
cord-252671-uf96jgig	2	6	,	,	,
cord-252671-uf96jgig	2	7	Yi	Yi	NNP
cord-252671-uf96jgig	2	8	;	;	:
cord-252671-uf96jgig	2	9	Liu	Liu	NNP
cord-252671-uf96jgig	2	10	,	,	,
cord-252671-uf96jgig	3	1	Li	Li	NNP
cord-252671-uf96jgig	3	2	title	title	NN
cord-252671-uf96jgig	3	3	:	:	:
cord-252671-uf96jgig	3	4	The	the	DT
cord-252671-uf96jgig	3	5	Membrane	Membrane	NNP
cord-252671-uf96jgig	3	6	Protein	Protein	NNP
cord-252671-uf96jgig	3	7	of	of	IN
cord-252671-uf96jgig	3	8	Severe	severe	JJ
cord-252671-uf96jgig	3	9	Acute	acute	JJ
cord-252671-uf96jgig	3	10	Respiratory	Respiratory	NNP
cord-252671-uf96jgig	3	11	Syndrome	Syndrome	NNP
cord-252671-uf96jgig	3	12	Coronavirus	Coronavirus	NNP
cord-252671-uf96jgig	3	13	Functions	Functions	NNPS
cord-252671-uf96jgig	3	14	as	as	IN
cord-252671-uf96jgig	3	15	a	a	DT
cord-252671-uf96jgig	3	16	Novel	Novel	NNP
cord-252671-uf96jgig	3	17	Cytosolic	Cytosolic	NNP
cord-252671-uf96jgig	3	18	Pathogen	Pathogen	NNP
cord-252671-uf96jgig	3	19	-	-	HYPH
cord-252671-uf96jgig	3	20	Associated	Associated	NNP
cord-252671-uf96jgig	3	21	Molecular	Molecular	NNP
cord-252671-uf96jgig	3	22	Pattern	Pattern	NNP
cord-252671-uf96jgig	4	1	To	to	TO
cord-252671-uf96jgig	4	2	Promote	promote	VB
cord-252671-uf96jgig	4	3	Beta	Beta	NNP
cord-252671-uf96jgig	4	4	Interferon	Interferon	NNP
cord-252671-uf96jgig	4	5	Induction	Induction	NNP
cord-252671-uf96jgig	4	6	via	via	IN
cord-252671-uf96jgig	4	7	a	a	DT
cord-252671-uf96jgig	4	8	Toll	toll	NN
cord-252671-uf96jgig	4	9	-	-	HYPH
cord-252671-uf96jgig	4	10	Like	like	JJ
cord-252671-uf96jgig	4	11	-	-	HYPH
cord-252671-uf96jgig	4	12	Receptor	receptor	NN
cord-252671-uf96jgig	4	13	-	-	HYPH
cord-252671-uf96jgig	4	14	Related	relate	VBN
cord-252671-uf96jgig	4	15	TRAF3-Independent	TRAF3-Independent	NNP
cord-252671-uf96jgig	4	16	Mechanism	Mechanism	NNP
cord-252671-uf96jgig	4	17	date	date	NN
cord-252671-uf96jgig	4	18	:	:	:
cord-252671-uf96jgig	4	19	2016	2016	CD
cord-252671-uf96jgig	4	20	-	-	HYPH
cord-252671-uf96jgig	4	21	02	02	CD
cord-252671-uf96jgig	4	22	-	-	HYPH
cord-252671-uf96jgig	4	23	09	09	CD
cord-252671-uf96jgig	4	24	journal	journal	NN
cord-252671-uf96jgig	4	25	:	:	:
cord-252671-uf96jgig	5	1	mBio	mbio	NN
cord-252671-uf96jgig	5	2	DOI	DOI	NNP
cord-252671-uf96jgig	5	3	:	:	:
cord-252671-uf96jgig	5	4	10.1128	10.1128	CD
cord-252671-uf96jgig	5	5	/	/	SYM
cord-252671-uf96jgig	5	6	mbio.01872	mbio.01872	NNP
cord-252671-uf96jgig	5	7	-	-	HYPH
cord-252671-uf96jgig	5	8	15	15	CD
cord-252671-uf96jgig	5	9	sha	sha	NNP
cord-252671-uf96jgig	5	10	:	:	:
cord-252671-uf96jgig	6	1	358d351a51c6f7f9ddb86ea3fb468c7fdc601e3d	358d351a51c6f7f9ddb86ea3fb468c7fdc601e3d	CD
cord-252671-uf96jgig	6	2	doc_id	doc_id	CD
cord-252671-uf96jgig	6	3	:	:	:
cord-252671-uf96jgig	6	4	252671	252671	CD
cord-252671-uf96jgig	6	5	cord_uid	cord_uid	NNS
cord-252671-uf96jgig	6	6	:	:	:
cord-252671-uf96jgig	7	1	uf96jgig	uf96jgig	NNP
cord-252671-uf96jgig	7	2	Most	Most	JJS
cord-252671-uf96jgig	7	3	of	of	IN
cord-252671-uf96jgig	7	4	the	the	DT
cord-252671-uf96jgig	7	5	intracellular	intracellular	JJ
cord-252671-uf96jgig	7	6	pattern	pattern	NN
cord-252671-uf96jgig	7	7	recognition	recognition	NN
cord-252671-uf96jgig	7	8	receptors	receptor	NNS
cord-252671-uf96jgig	7	9	(	(	-LRB-
cord-252671-uf96jgig	7	10	PRRs	PRRs	NNP
cord-252671-uf96jgig	7	11	)	)	-RRB-
cord-252671-uf96jgig	7	12	reside	reside	VBP
cord-252671-uf96jgig	7	13	in	in	IN
cord-252671-uf96jgig	7	14	either	either	CC
cord-252671-uf96jgig	7	15	the	the	DT
cord-252671-uf96jgig	7	16	endolysosome	endolysosome	NN
cord-252671-uf96jgig	7	17	or	or	CC
cord-252671-uf96jgig	7	18	the	the	DT
cord-252671-uf96jgig	7	19	cytoplasm	cytoplasm	NN
cord-252671-uf96jgig	7	20	to	to	IN
cord-252671-uf96jgig	7	21	sense	sense	NN
cord-252671-uf96jgig	7	22	pathogen	pathogen	NN
cord-252671-uf96jgig	7	23	-	-	HYPH
cord-252671-uf96jgig	7	24	derived	derive	VBN
cord-252671-uf96jgig	7	25	RNAs	rna	NNS
cord-252671-uf96jgig	7	26	,	,	,
cord-252671-uf96jgig	7	27	DNAs	dna	NNS
cord-252671-uf96jgig	7	28	,	,	,
cord-252671-uf96jgig	7	29	or	or	CC
cord-252671-uf96jgig	7	30	synthetic	synthetic	JJ
cord-252671-uf96jgig	7	31	analogs	analog	NNS
cord-252671-uf96jgig	7	32	of	of	IN
cord-252671-uf96jgig	7	33	double	double	RB
cord-252671-uf96jgig	7	34	-	-	HYPH
cord-252671-uf96jgig	7	35	stranded	strand	VBN
cord-252671-uf96jgig	7	36	RNA	RNA	NNP
cord-252671-uf96jgig	7	37	(	(	-LRB-
cord-252671-uf96jgig	7	38	dsRNA	dsrna	NN
cord-252671-uf96jgig	7	39	)	)	-RRB-
cord-252671-uf96jgig	7	40	,	,	,
cord-252671-uf96jgig	7	41	such	such	JJ
cord-252671-uf96jgig	7	42	as	as	IN
cord-252671-uf96jgig	7	43	poly(I	poly(I	NNP
cord-252671-uf96jgig	7	44	:	:	:
cord-252671-uf96jgig	7	45	C	C	NNP
cord-252671-uf96jgig	7	46	)	)	-RRB-
cord-252671-uf96jgig	7	47	.	.	.
cord-252671-uf96jgig	8	1	However	however	RB
cord-252671-uf96jgig	8	2	,	,	,
cord-252671-uf96jgig	8	3	it	-PRON-	PRP
cord-252671-uf96jgig	8	4	remains	remain	VBZ
cord-252671-uf96jgig	8	5	elusive	elusive	JJ
cord-252671-uf96jgig	8	6	whether	whether	IN
cord-252671-uf96jgig	8	7	or	or	CC
cord-252671-uf96jgig	8	8	not	not	RB
cord-252671-uf96jgig	8	9	a	a	DT
cord-252671-uf96jgig	8	10	pathogen	pathogen	NN
cord-252671-uf96jgig	8	11	-	-	HYPH
cord-252671-uf96jgig	8	12	derived	derive	VBN
cord-252671-uf96jgig	8	13	protein	protein	NN
cord-252671-uf96jgig	8	14	can	can	MD
cord-252671-uf96jgig	8	15	function	function	VB
cord-252671-uf96jgig	8	16	as	as	IN
cord-252671-uf96jgig	8	17	a	a	DT
cord-252671-uf96jgig	8	18	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	8	19	pathogen	pathogen	NN
cord-252671-uf96jgig	8	20	-	-	HYPH
cord-252671-uf96jgig	8	21	associated	associate	VBN
cord-252671-uf96jgig	8	22	molecular	molecular	JJ
cord-252671-uf96jgig	8	23	pattern	pattern	NN
cord-252671-uf96jgig	8	24	(	(	-LRB-
cord-252671-uf96jgig	8	25	PAMP	PAMP	NNP
cord-252671-uf96jgig	8	26	)	)	-RRB-
cord-252671-uf96jgig	8	27	.	.	.
cord-252671-uf96jgig	9	1	In	in	IN
cord-252671-uf96jgig	9	2	this	this	DT
cord-252671-uf96jgig	9	3	study	study	NN
cord-252671-uf96jgig	9	4	,	,	,
cord-252671-uf96jgig	9	5	we	-PRON-	PRP
cord-252671-uf96jgig	9	6	demonstrate	demonstrate	VBP
cord-252671-uf96jgig	9	7	that	that	IN
cord-252671-uf96jgig	9	8	delivering	deliver	VBG
cord-252671-uf96jgig	9	9	the	the	DT
cord-252671-uf96jgig	9	10	membrane	membrane	NN
cord-252671-uf96jgig	9	11	gene	gene	NN
cord-252671-uf96jgig	9	12	of	of	IN
cord-252671-uf96jgig	9	13	severe	severe	JJ
cord-252671-uf96jgig	9	14	acute	acute	JJ
cord-252671-uf96jgig	9	15	respiratory	respiratory	JJ
cord-252671-uf96jgig	9	16	syndrome	syndrome	NN
cord-252671-uf96jgig	9	17	coronavirus	coronavirus	NN
cord-252671-uf96jgig	9	18	(	(	-LRB-
cord-252671-uf96jgig	9	19	SARS	SARS	NNP
cord-252671-uf96jgig	9	20	-	-	HYPH
cord-252671-uf96jgig	9	21	CoV	CoV	NNP
cord-252671-uf96jgig	9	22	)	)	-RRB-
cord-252671-uf96jgig	9	23	into	into	IN
cord-252671-uf96jgig	9	24	HEK293	HEK293	NNP
cord-252671-uf96jgig	9	25	T	T	NNP
cord-252671-uf96jgig	9	26	,	,	,
cord-252671-uf96jgig	9	27	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	9	28	,	,	,
cord-252671-uf96jgig	9	29	and	and	CC
cord-252671-uf96jgig	9	30	immobilized	immobilize	VBN
cord-252671-uf96jgig	9	31	murine	murine	JJ
cord-252671-uf96jgig	9	32	bone	bone	NN
cord-252671-uf96jgig	9	33	marrow	marrow	NN
cord-252671-uf96jgig	9	34	-	-	HYPH
cord-252671-uf96jgig	9	35	derived	derive	VBN
cord-252671-uf96jgig	9	36	macrophage	macrophage	NN
cord-252671-uf96jgig	9	37	(	(	-LRB-
cord-252671-uf96jgig	9	38	J2-Mφ	J2-Mφ	NNP
cord-252671-uf96jgig	9	39	)	)	-RRB-
cord-252671-uf96jgig	9	40	cells	cell	NNS
cord-252671-uf96jgig	9	41	significantly	significantly	RB
cord-252671-uf96jgig	9	42	upregulates	upregulate	VBZ
cord-252671-uf96jgig	9	43	beta	beta	NN
cord-252671-uf96jgig	9	44	interferon	interferon	NN
cord-252671-uf96jgig	9	45	(	(	-LRB-
cord-252671-uf96jgig	9	46	IFN	IFN	NNP
cord-252671-uf96jgig	9	47	-	-	HYPH
cord-252671-uf96jgig	9	48	β	β	NNP
cord-252671-uf96jgig	9	49	)	)	-RRB-
cord-252671-uf96jgig	9	50	production	production	NN
cord-252671-uf96jgig	9	51	.	.	.
cord-252671-uf96jgig	10	1	Both	both	DT
cord-252671-uf96jgig	10	2	NF	nf	NN
cord-252671-uf96jgig	10	3	-	-	HYPH
cord-252671-uf96jgig	10	4	κB	κB	NNP
cord-252671-uf96jgig	10	5	and	and	CC
cord-252671-uf96jgig	10	6	TBK1-IRF3	TBK1-IRF3	NNP
cord-252671-uf96jgig	10	7	signaling	signal	VBG
cord-252671-uf96jgig	10	8	cascades	cascade	NNS
cord-252671-uf96jgig	10	9	are	be	VBP
cord-252671-uf96jgig	10	10	activated	activate	VBN
cord-252671-uf96jgig	10	11	by	by	IN
cord-252671-uf96jgig	10	12	M	M	NNP
cord-252671-uf96jgig	10	13	gene	gene	NN
cord-252671-uf96jgig	10	14	products	product	NNS
cord-252671-uf96jgig	10	15	.	.	.
cord-252671-uf96jgig	11	1	M	M	NNP
cord-252671-uf96jgig	11	2	protein	protein	NN
cord-252671-uf96jgig	11	3	rather	rather	RB
cord-252671-uf96jgig	11	4	than	than	IN
cord-252671-uf96jgig	11	5	M	M	NNP
cord-252671-uf96jgig	11	6	mRNA	mRNA	NNP
cord-252671-uf96jgig	11	7	is	be	VBZ
cord-252671-uf96jgig	11	8	responsible	responsible	JJ
cord-252671-uf96jgig	11	9	for	for	IN
cord-252671-uf96jgig	11	10	M	M	NNP
cord-252671-uf96jgig	11	11	-	-	HYPH
cord-252671-uf96jgig	11	12	mediated	mediate	VBN
cord-252671-uf96jgig	11	13	IFN	IFN	NNP
cord-252671-uf96jgig	11	14	-	-	HYPH
cord-252671-uf96jgig	11	15	β	β	NN
cord-252671-uf96jgig	11	16	induction	induction	NN
cord-252671-uf96jgig	11	17	that	that	WDT
cord-252671-uf96jgig	11	18	is	be	VBZ
cord-252671-uf96jgig	11	19	preferentially	preferentially	RB
cord-252671-uf96jgig	11	20	associated	associate	VBN
cord-252671-uf96jgig	11	21	with	with	IN
cord-252671-uf96jgig	11	22	the	the	DT
cord-252671-uf96jgig	11	23	activation	activation	NN
cord-252671-uf96jgig	11	24	of	of	IN
cord-252671-uf96jgig	11	25	the	the	DT
cord-252671-uf96jgig	11	26	Toll	Toll	NNP
cord-252671-uf96jgig	11	27	-	-	HYPH
cord-252671-uf96jgig	11	28	like	like	JJ
cord-252671-uf96jgig	11	29	receptor	receptor	NN
cord-252671-uf96jgig	11	30	(	(	-LRB-
cord-252671-uf96jgig	11	31	TLR	TLR	NNP
cord-252671-uf96jgig	11	32	)	)	-RRB-
cord-252671-uf96jgig	11	33	adaptor	adaptor	NN
cord-252671-uf96jgig	11	34	proteins	protein	NNS
cord-252671-uf96jgig	11	35	MyD88	MyD88	NNS
cord-252671-uf96jgig	11	36	,	,	,
cord-252671-uf96jgig	11	37	TIRAP	TIRAP	NNP
cord-252671-uf96jgig	11	38	,	,	,
cord-252671-uf96jgig	11	39	and	and	CC
cord-252671-uf96jgig	11	40	TICAM2	ticam2	NN
cord-252671-uf96jgig	12	1	but	but	CC
cord-252671-uf96jgig	12	2	not	not	RB
cord-252671-uf96jgig	12	3	the	the	DT
cord-252671-uf96jgig	12	4	RIG	rig	NN
cord-252671-uf96jgig	12	5	-	-	:
cord-252671-uf96jgig	12	6	I	i	NN
cord-252671-uf96jgig	12	7	signaling	signal	VBG
cord-252671-uf96jgig	12	8	cascade	cascade	NN
cord-252671-uf96jgig	12	9	.	.	.
cord-252671-uf96jgig	13	1	Blocking	block	VBG
cord-252671-uf96jgig	13	2	the	the	DT
cord-252671-uf96jgig	13	3	secretion	secretion	NN
cord-252671-uf96jgig	13	4	of	of	IN
cord-252671-uf96jgig	13	5	M	M	NNP
cord-252671-uf96jgig	13	6	protein	protein	NN
cord-252671-uf96jgig	13	7	by	by	IN
cord-252671-uf96jgig	13	8	brefeldin	brefeldin	NNP
cord-252671-uf96jgig	13	9	A	A	NNP
cord-252671-uf96jgig	13	10	(	(	-LRB-
cord-252671-uf96jgig	13	11	BFA	BFA	NNP
cord-252671-uf96jgig	13	12	)	)	-RRB-
cord-252671-uf96jgig	13	13	failed	fail	VBD
cord-252671-uf96jgig	13	14	to	to	TO
cord-252671-uf96jgig	13	15	reverse	reverse	VB
cord-252671-uf96jgig	13	16	the	the	DT
cord-252671-uf96jgig	13	17	M	M	NNP
cord-252671-uf96jgig	13	18	-	-	HYPH
cord-252671-uf96jgig	13	19	mediated	mediate	VBN
cord-252671-uf96jgig	13	20	IFN	IFN	NNP
cord-252671-uf96jgig	13	21	-	-	HYPH
cord-252671-uf96jgig	13	22	β	β	NN
cord-252671-uf96jgig	13	23	induction	induction	NN
cord-252671-uf96jgig	13	24	.	.	.
cord-252671-uf96jgig	14	1	The	the	DT
cord-252671-uf96jgig	14	2	antagonist	antagonist	NN
cord-252671-uf96jgig	14	3	of	of	IN
cord-252671-uf96jgig	14	4	both	both	DT
cord-252671-uf96jgig	14	5	TLR2	TLR2	NNP
cord-252671-uf96jgig	14	6	and	and	CC
cord-252671-uf96jgig	14	7	TLR4	TLR4	NNP
cord-252671-uf96jgig	14	8	did	do	VBD
cord-252671-uf96jgig	14	9	not	not	RB
cord-252671-uf96jgig	14	10	impede	impede	VB
cord-252671-uf96jgig	14	11	M	M	NNP
cord-252671-uf96jgig	14	12	-	-	HYPH
cord-252671-uf96jgig	14	13	mediated	mediate	VBN
cord-252671-uf96jgig	14	14	IFN	IFN	NNP
cord-252671-uf96jgig	14	15	-	-	HYPH
cord-252671-uf96jgig	14	16	β	β	NN
cord-252671-uf96jgig	14	17	induction	induction	NN
cord-252671-uf96jgig	14	18	,	,	,
cord-252671-uf96jgig	14	19	indicating	indicate	VBG
cord-252671-uf96jgig	14	20	that	that	IN
cord-252671-uf96jgig	14	21	the	the	DT
cord-252671-uf96jgig	14	22	driving	drive	VBG
cord-252671-uf96jgig	14	23	force	force	NN
cord-252671-uf96jgig	14	24	for	for	IN
cord-252671-uf96jgig	14	25	the	the	DT
cord-252671-uf96jgig	14	26	activation	activation	NN
cord-252671-uf96jgig	14	27	of	of	IN
cord-252671-uf96jgig	14	28	IFN	IFN	NNP
cord-252671-uf96jgig	14	29	-	-	HYPH
cord-252671-uf96jgig	14	30	β	β	NNP
cord-252671-uf96jgig	14	31	production	production	NN
cord-252671-uf96jgig	14	32	was	be	VBD
cord-252671-uf96jgig	14	33	generated	generate	VBN
cord-252671-uf96jgig	14	34	from	from	IN
cord-252671-uf96jgig	14	35	inside	inside	IN
cord-252671-uf96jgig	14	36	the	the	DT
cord-252671-uf96jgig	14	37	cells	cell	NNS
cord-252671-uf96jgig	14	38	.	.	.
cord-252671-uf96jgig	15	1	Inhibition	inhibition	NN
cord-252671-uf96jgig	15	2	of	of	IN
cord-252671-uf96jgig	15	3	TRAF3	traf3	NN
cord-252671-uf96jgig	15	4	expression	expression	NN
cord-252671-uf96jgig	15	5	by	by	IN
cord-252671-uf96jgig	15	6	specific	specific	JJ
cord-252671-uf96jgig	15	7	small	small	JJ
cord-252671-uf96jgig	15	8	interfering	interfere	VBG
cord-252671-uf96jgig	15	9	RNA	RNA	NNP
cord-252671-uf96jgig	15	10	(	(	-LRB-
cord-252671-uf96jgig	15	11	siRNA	siRNA	NNP
cord-252671-uf96jgig	15	12	)	)	-RRB-
cord-252671-uf96jgig	15	13	did	do	VBD
cord-252671-uf96jgig	15	14	not	not	RB
cord-252671-uf96jgig	15	15	prevent	prevent	VB
cord-252671-uf96jgig	15	16	M	M	NNP
cord-252671-uf96jgig	15	17	-	-	HYPH
cord-252671-uf96jgig	15	18	mediated	mediate	VBN
cord-252671-uf96jgig	15	19	IFN	IFN	NNP
cord-252671-uf96jgig	15	20	-	-	HYPH
cord-252671-uf96jgig	15	21	β	β	NN
cord-252671-uf96jgig	15	22	induction	induction	NN
cord-252671-uf96jgig	15	23	.	.	.
cord-252671-uf96jgig	16	1	SARS	SARS	NNP
cord-252671-uf96jgig	16	2	-	-	HYPH
cord-252671-uf96jgig	16	3	CoV	CoV	NNP
cord-252671-uf96jgig	16	4	pseudovirus	pseudovirus	NNP
cord-252671-uf96jgig	16	5	could	could	MD
cord-252671-uf96jgig	16	6	induce	induce	VB
cord-252671-uf96jgig	16	7	IFN	IFN	NNP
cord-252671-uf96jgig	16	8	-	-	HYPH
cord-252671-uf96jgig	16	9	β	β	NN
cord-252671-uf96jgig	16	10	production	production	NN
cord-252671-uf96jgig	16	11	in	in	IN
cord-252671-uf96jgig	16	12	an	an	DT
cord-252671-uf96jgig	16	13	M	M	NNP
cord-252671-uf96jgig	16	14	rather	rather	RB
cord-252671-uf96jgig	16	15	than	than	IN
cord-252671-uf96jgig	16	16	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	16	17	)	)	-RRB-
cord-252671-uf96jgig	16	18	dependent	dependent	JJ
cord-252671-uf96jgig	16	19	manner	manner	NN
cord-252671-uf96jgig	16	20	,	,	,
cord-252671-uf96jgig	16	21	since	since	IN
cord-252671-uf96jgig	16	22	the	the	DT
cord-252671-uf96jgig	16	23	valine	valine	NN
cord-252671-uf96jgig	16	24	-	-	HYPH
cord-252671-uf96jgig	16	25	to	to	IN
cord-252671-uf96jgig	16	26	-	-	HYPH
cord-252671-uf96jgig	16	27	alanine	alanine	NN
cord-252671-uf96jgig	16	28	alteration	alteration	NN
cord-252671-uf96jgig	16	29	at	at	IN
cord-252671-uf96jgig	16	30	residue	residue	NN
cord-252671-uf96jgig	16	31	68	68	CD
cord-252671-uf96jgig	16	32	in	in	IN
cord-252671-uf96jgig	16	33	M	M	NNP
cord-252671-uf96jgig	16	34	protein	protein	NN
cord-252671-uf96jgig	16	35	markedly	markedly	RB
cord-252671-uf96jgig	16	36	inhibited	inhibit	VBD
cord-252671-uf96jgig	16	37	IFN	IFN	NNP
cord-252671-uf96jgig	16	38	-	-	HYPH
cord-252671-uf96jgig	16	39	β	β	NN
cord-252671-uf96jgig	16	40	production	production	NN
cord-252671-uf96jgig	16	41	.	.	.
cord-252671-uf96jgig	17	1	Overall	overall	RB
cord-252671-uf96jgig	17	2	,	,	,
cord-252671-uf96jgig	17	3	our	-PRON-	PRP$
cord-252671-uf96jgig	17	4	study	study	NN
cord-252671-uf96jgig	17	5	indicates	indicate	VBZ
cord-252671-uf96jgig	17	6	for	for	IN
cord-252671-uf96jgig	17	7	the	the	DT
cord-252671-uf96jgig	17	8	first	first	JJ
cord-252671-uf96jgig	17	9	time	time	NN
cord-252671-uf96jgig	17	10	that	that	IN
cord-252671-uf96jgig	17	11	a	a	DT
cord-252671-uf96jgig	17	12	pathogen	pathogen	NN
cord-252671-uf96jgig	17	13	-	-	HYPH
cord-252671-uf96jgig	17	14	derived	derive	VBN
cord-252671-uf96jgig	17	15	protein	protein	NN
cord-252671-uf96jgig	17	16	is	be	VBZ
cord-252671-uf96jgig	17	17	able	able	JJ
cord-252671-uf96jgig	17	18	to	to	TO
cord-252671-uf96jgig	17	19	function	function	VB
cord-252671-uf96jgig	17	20	as	as	IN
cord-252671-uf96jgig	17	21	a	a	DT
cord-252671-uf96jgig	17	22	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	17	23	PAMP	PAMP	NNP
cord-252671-uf96jgig	17	24	to	to	TO
cord-252671-uf96jgig	17	25	stimulate	stimulate	VB
cord-252671-uf96jgig	17	26	type	type	NN
cord-252671-uf96jgig	18	1	I	-PRON-	PRP
cord-252671-uf96jgig	19	1	interferon	interferon	NN
cord-252671-uf96jgig	19	2	production	production	NN
cord-252671-uf96jgig	19	3	by	by	IN
cord-252671-uf96jgig	19	4	activating	activate	VBG
cord-252671-uf96jgig	19	5	a	a	DT
cord-252671-uf96jgig	19	6	noncanonical	noncanonical	JJ
cord-252671-uf96jgig	19	7	TLR	TLR	NNP
cord-252671-uf96jgig	19	8	signaling	signal	VBG
cord-252671-uf96jgig	19	9	cascade	cascade	NN
cord-252671-uf96jgig	19	10	in	in	IN
cord-252671-uf96jgig	19	11	a	a	DT
cord-252671-uf96jgig	19	12	TRAF3-independent	TRAF3-independent	NNP
cord-252671-uf96jgig	19	13	manner	manner	NN
cord-252671-uf96jgig	19	14	.	.	.
cord-252671-uf96jgig	20	1	In	in	IN
cord-252671-uf96jgig	20	2	addition	addition	NN
cord-252671-uf96jgig	20	3	to	to	IN
cord-252671-uf96jgig	20	4	the	the	DT
cord-252671-uf96jgig	20	5	TLR	TLR	NNP
cord-252671-uf96jgig	20	6	,	,	,
cord-252671-uf96jgig	20	7	which	which	WDT
cord-252671-uf96jgig	20	8	can	can	MD
cord-252671-uf96jgig	20	9	be	be	VB
cord-252671-uf96jgig	20	10	defined	define	VBN
cord-252671-uf96jgig	20	11	as	as	IN
cord-252671-uf96jgig	20	12	a	a	DT
cord-252671-uf96jgig	20	13	membraneassociated	membraneassociate	VBN
cord-252671-uf96jgig	20	14	PRR	PRR	NNP
cord-252671-uf96jgig	20	15	,	,	,
cord-252671-uf96jgig	20	16	another	another	DT
cord-252671-uf96jgig	20	17	set	set	NN
cord-252671-uf96jgig	20	18	of	of	IN
cord-252671-uf96jgig	20	19	PRRs	prr	NNS
cord-252671-uf96jgig	20	20	is	be	VBZ
cord-252671-uf96jgig	20	21	localized	localize	VBN
cord-252671-uf96jgig	20	22	at	at	IN
cord-252671-uf96jgig	20	23	the	the	DT
cord-252671-uf96jgig	20	24	cytoplasm	cytoplasm	NN
cord-252671-uf96jgig	20	25	and	and	CC
cord-252671-uf96jgig	20	26	mainly	mainly	RB
cord-252671-uf96jgig	20	27	includes	include	VBZ
cord-252671-uf96jgig	20	28	RIG	rig	NN
cord-252671-uf96jgig	20	29	-	-	HYPH
cord-252671-uf96jgig	20	30	like	like	JJ
cord-252671-uf96jgig	20	31	receptors	receptor	NNS
cord-252671-uf96jgig	20	32	(	(	-LRB-
cord-252671-uf96jgig	20	33	RLRs	rlr	NNS
cord-252671-uf96jgig	20	34	)	)	-RRB-
cord-252671-uf96jgig	20	35	and	and	CC
cord-252671-uf96jgig	20	36	NOD	nod	JJ
cord-252671-uf96jgig	20	37	-	-	HYPH
cord-252671-uf96jgig	20	38	like	like	JJ
cord-252671-uf96jgig	20	39	receptors	receptor	NNS
cord-252671-uf96jgig	20	40	(	(	-LRB-
cord-252671-uf96jgig	20	41	NLRs	nlr	NNS
cord-252671-uf96jgig	20	42	)	)	-RRB-
cord-252671-uf96jgig	20	43	to	to	TO
cord-252671-uf96jgig	20	44	sense	sense	VB
cord-252671-uf96jgig	20	45	viral	viral	JJ
cord-252671-uf96jgig	20	46	dsRNAs	dsRNAs	NNPS
cord-252671-uf96jgig	20	47	and	and	CC
cord-252671-uf96jgig	20	48	bacterial	bacterial	JJ
cord-252671-uf96jgig	20	49	cell	cell	NN
cord-252671-uf96jgig	20	50	wall	wall	NN
cord-252671-uf96jgig	20	51	components	component	NNS
cord-252671-uf96jgig	20	52	,	,	,
cord-252671-uf96jgig	20	53	respectively	respectively	RB
cord-252671-uf96jgig	20	54	(	(	-LRB-
cord-252671-uf96jgig	20	55	2	2	CD
cord-252671-uf96jgig	20	56	,	,	,
cord-252671-uf96jgig	20	57	7	7	CD
cord-252671-uf96jgig	20	58	)	)	-RRB-
cord-252671-uf96jgig	20	59	.	.	.
cord-252671-uf96jgig	21	1	The	the	DT
cord-252671-uf96jgig	21	2	RLRs	rlr	NNS
cord-252671-uf96jgig	21	3	consist	consist	VBP
cord-252671-uf96jgig	21	4	of	of	IN
cord-252671-uf96jgig	21	5	at	at	RB
cord-252671-uf96jgig	21	6	least	least	RBS
cord-252671-uf96jgig	21	7	three	three	CD
cord-252671-uf96jgig	21	8	members	member	NNS
cord-252671-uf96jgig	21	9	,	,	,
cord-252671-uf96jgig	21	10	including	include	VBG
cord-252671-uf96jgig	21	11	RIG	rig	NN
cord-252671-uf96jgig	21	12	-	-	:
cord-252671-uf96jgig	21	13	I	I	NNP
cord-252671-uf96jgig	21	14	,	,	,
cord-252671-uf96jgig	21	15	MDA5	MDA5	NNP
cord-252671-uf96jgig	21	16	,	,	,
cord-252671-uf96jgig	21	17	and	and	CC
cord-252671-uf96jgig	21	18	LGP2	LGP2	NNP
cord-252671-uf96jgig	21	19	.	.	.
cord-252671-uf96jgig	22	1	RIG	rig	NN
cord-252671-uf96jgig	22	2	-	-	:
cord-252671-uf96jgig	22	3	I	-PRON-	PRP
cord-252671-uf96jgig	22	4	recognizes	recognize	VBZ
cord-252671-uf96jgig	22	5	5=-triphosphate	5=-triphosphate	JJ
cord-252671-uf96jgig	22	6	RNA	RNA	NNP
cord-252671-uf96jgig	22	7	and	and	CC
cord-252671-uf96jgig	22	8	short	short	JJ
cord-252671-uf96jgig	22	9	dsRNA	dsrna	NN
cord-252671-uf96jgig	22	10	(	(	-LRB-
cord-252671-uf96jgig	22	11	4	4	CD
cord-252671-uf96jgig	22	12	,	,	,
cord-252671-uf96jgig	22	13	8)	8)	NNP
cord-252671-uf96jgig	22	14	,	,	,
cord-252671-uf96jgig	22	15	while	while	IN
cord-252671-uf96jgig	22	16	MDA5	MDA5	NNP
cord-252671-uf96jgig	22	17	senses	sense	VBZ
cord-252671-uf96jgig	22	18	long	long	JJ
cord-252671-uf96jgig	22	19	dsRNA	dsrna	NN
cord-252671-uf96jgig	22	20	(	(	-LRB-
cord-252671-uf96jgig	22	21	9	9	CD
cord-252671-uf96jgig	22	22	)	)	-RRB-
cord-252671-uf96jgig	22	23	.	.	.
cord-252671-uf96jgig	23	1	An	an	DT
cord-252671-uf96jgig	23	2	adaptor	adaptor	NN
cord-252671-uf96jgig	23	3	protein	protein	NN
cord-252671-uf96jgig	23	4	,	,	,
cord-252671-uf96jgig	23	5	MAVS	MAVS	NNP
cord-252671-uf96jgig	23	6	,	,	,
cord-252671-uf96jgig	23	7	is	be	VBZ
cord-252671-uf96jgig	23	8	required	require	VBN
cord-252671-uf96jgig	23	9	for	for	IN
cord-252671-uf96jgig	23	10	the	the	DT
cord-252671-uf96jgig	23	11	activation	activation	NN
cord-252671-uf96jgig	23	12	of	of	IN
cord-252671-uf96jgig	23	13	the	the	DT
cord-252671-uf96jgig	23	14	RIG	rig	NN
cord-252671-uf96jgig	23	15	-	-	HYPH
cord-252671-uf96jgig	23	16	I	I	NNP
cord-252671-uf96jgig	23	17	/	/	SYM
cord-252671-uf96jgig	23	18	MDA5	MDA5	NNP
cord-252671-uf96jgig	23	19	signaling	signal	VBG
cord-252671-uf96jgig	23	20	pathway	pathway	NN
cord-252671-uf96jgig	23	21	.	.	.
cord-252671-uf96jgig	24	1	The	the	DT
cord-252671-uf96jgig	24	2	association	association	NN
cord-252671-uf96jgig	24	3	of	of	IN
cord-252671-uf96jgig	24	4	viral	viral	JJ
cord-252671-uf96jgig	24	5	nucleic	nucleic	JJ
cord-252671-uf96jgig	24	6	acids	acid	NNS
cord-252671-uf96jgig	24	7	with	with	IN
cord-252671-uf96jgig	24	8	MAVS	MAVS	NNPS
cord-252671-uf96jgig	24	9	promotes	promote	VBZ
cord-252671-uf96jgig	24	10	the	the	DT
cord-252671-uf96jgig	24	11	aggregation	aggregation	NN
cord-252671-uf96jgig	24	12	of	of	IN
cord-252671-uf96jgig	24	13	MAVS	MAVS	NNPS
cord-252671-uf96jgig	24	14	on	on	IN
cord-252671-uf96jgig	24	15	the	the	DT
cord-252671-uf96jgig	24	16	mitochondrial	mitochondrial	JJ
cord-252671-uf96jgig	24	17	membrane	membrane	NN
cord-252671-uf96jgig	24	18	(	(	-LRB-
cord-252671-uf96jgig	24	19	10	10	CD
cord-252671-uf96jgig	24	20	)	)	-RRB-
cord-252671-uf96jgig	24	21	.	.	.
cord-252671-uf96jgig	25	1	The	the	DT
cord-252671-uf96jgig	25	2	"	"	``
cord-252671-uf96jgig	25	3	ligation	ligation	NN
cord-252671-uf96jgig	25	4	"	"	''
cord-252671-uf96jgig	25	5	of	of	IN
cord-252671-uf96jgig	25	6	TRAF3	traf3	NN
cord-252671-uf96jgig	25	7	with	with	IN
cord-252671-uf96jgig	25	8	the	the	DT
cord-252671-uf96jgig	25	9	aggregated	aggregated	JJ
cord-252671-uf96jgig	25	10	MAVS	MAVS	NNPS
cord-252671-uf96jgig	25	11	may	may	MD
cord-252671-uf96jgig	25	12	promote	promote	VB
cord-252671-uf96jgig	25	13	the	the	DT
cord-252671-uf96jgig	25	14	phosphorylation	phosphorylation	NN
cord-252671-uf96jgig	25	15	of	of	IN
cord-252671-uf96jgig	25	16	IRF3	IRF3	NNP
cord-252671-uf96jgig	25	17	that	that	WDT
cord-252671-uf96jgig	25	18	is	be	VBZ
cord-252671-uf96jgig	25	19	required	require	VBN
cord-252671-uf96jgig	25	20	for	for	IN
cord-252671-uf96jgig	25	21	IFN-	IFN-	NNP
cord-252671-uf96jgig	25	22	␤	␤	CD
cord-252671-uf96jgig	25	23	production	production	NN
cord-252671-uf96jgig	25	24	(	(	-LRB-
cord-252671-uf96jgig	25	25	11	11	CD
cord-252671-uf96jgig	25	26	)	)	-RRB-
cord-252671-uf96jgig	25	27	.	.	.
cord-252671-uf96jgig	26	1	A	a	DT
cord-252671-uf96jgig	26	2	recent	recent	JJ
cord-252671-uf96jgig	26	3	study	study	NN
cord-252671-uf96jgig	26	4	also	also	RB
cord-252671-uf96jgig	26	5	shows	show	VBZ
cord-252671-uf96jgig	26	6	that	that	IN
cord-252671-uf96jgig	26	7	an	an	DT
cord-252671-uf96jgig	26	8	endoplasmic	endoplasmic	NN
cord-252671-uf96jgig	26	9	reticulum	reticulum	NN
cord-252671-uf96jgig	26	10	(	(	-LRB-
cord-252671-uf96jgig	26	11	ER)-derived	er)-derived	CD
cord-252671-uf96jgig	26	12	adaptor	adaptor	NN
cord-252671-uf96jgig	26	13	protein	protein	NN
cord-252671-uf96jgig	26	14	,	,	,
cord-252671-uf96jgig	26	15	STING	sting	NN
cord-252671-uf96jgig	26	16	,	,	,
cord-252671-uf96jgig	26	17	could	could	MD
cord-252671-uf96jgig	26	18	also	also	RB
cord-252671-uf96jgig	26	19	function	function	VB
cord-252671-uf96jgig	26	20	downstream	downstream	RB
cord-252671-uf96jgig	26	21	of	of	IN
cord-252671-uf96jgig	26	22	MAVS	MAVS	NNPS
cord-252671-uf96jgig	26	23	to	to	TO
cord-252671-uf96jgig	26	24	promote	promote	VB
cord-252671-uf96jgig	26	25	IRF3	IRF3	NNP
cord-252671-uf96jgig	26	26	phosphorylation	phosphorylation	NN
cord-252671-uf96jgig	26	27	and	and	CC
cord-252671-uf96jgig	26	28	the	the	DT
cord-252671-uf96jgig	26	29	subsequent	subsequent	JJ
cord-252671-uf96jgig	26	30	IFN-	IFN-	NNP
cord-252671-uf96jgig	26	31	␤	␤	CD
cord-252671-uf96jgig	26	32	response	response	NN
cord-252671-uf96jgig	26	33	(	(	-LRB-
cord-252671-uf96jgig	26	34	12	12	CD
cord-252671-uf96jgig	26	35	)	)	-RRB-
cord-252671-uf96jgig	26	36	.	.	.
cord-252671-uf96jgig	27	1	Pathogen	pathogen	NN
cord-252671-uf96jgig	27	2	-	-	HYPH
cord-252671-uf96jgig	27	3	derived	derive	VBN
cord-252671-uf96jgig	27	4	proteins	protein	NNS
cord-252671-uf96jgig	27	5	such	such	JJ
cord-252671-uf96jgig	27	6	as	as	IN
cord-252671-uf96jgig	27	7	virus	virus	NN
cord-252671-uf96jgig	27	8	-	-	HYPH
cord-252671-uf96jgig	27	9	encoded	encode	VBN
cord-252671-uf96jgig	27	10	proteins	protein	NNS
cord-252671-uf96jgig	27	11	are	be	VBP
cord-252671-uf96jgig	27	12	frequently	frequently	RB
cord-252671-uf96jgig	27	13	documented	document	VBN
cord-252671-uf96jgig	27	14	as	as	IN
cord-252671-uf96jgig	27	15	negative	negative	JJ
cord-252671-uf96jgig	27	16	regulators	regulator	NNS
cord-252671-uf96jgig	27	17	in	in	IN
cord-252671-uf96jgig	27	18	subverting	subvert	VBG
cord-252671-uf96jgig	27	19	type	type	NN
cord-252671-uf96jgig	27	20	I	-PRON-	PRP
cord-252671-uf96jgig	27	21	interferon	interferon	NN
cord-252671-uf96jgig	27	22	(	(	-LRB-
cord-252671-uf96jgig	27	23	IFN	IFN	NNP
cord-252671-uf96jgig	27	24	-	-	HYPH
cord-252671-uf96jgig	27	25	I	I	NNP
cord-252671-uf96jgig	27	26	)	)	-RRB-
cord-252671-uf96jgig	27	27	induction	induction	NN
cord-252671-uf96jgig	27	28	by	by	IN
cord-252671-uf96jgig	27	29	interfering	interfere	VBG
cord-252671-uf96jgig	27	30	with	with	IN
cord-252671-uf96jgig	27	31	a	a	DT
cord-252671-uf96jgig	27	32	certain	certain	JJ
cord-252671-uf96jgig	27	33	key	key	NN
cord-252671-uf96jgig	27	34	component(s	component(s	NNP
cord-252671-uf96jgig	27	35	)	)	-RRB-
cord-252671-uf96jgig	27	36	of	of	IN
cord-252671-uf96jgig	27	37	IFN	IFN	NNP
cord-252671-uf96jgig	27	38	-	-	HYPH
cord-252671-uf96jgig	27	39	I	-PRON-	PRP
cord-252671-uf96jgig	27	40	activation	activation	NN
cord-252671-uf96jgig	27	41	signaling	signal	VBG
cord-252671-uf96jgig	27	42	cascades	cascade	NNS
cord-252671-uf96jgig	27	43	.	.	.
cord-252671-uf96jgig	28	1	Viral	viral	JJ
cord-252671-uf96jgig	28	2	evolution	evolution	NN
cord-252671-uf96jgig	28	3	may	may	MD
cord-252671-uf96jgig	28	4	develop	develop	VB
cord-252671-uf96jgig	28	5	a	a	DT
cord-252671-uf96jgig	28	6	unique	unique	JJ
cord-252671-uf96jgig	28	7	strategy	strategy	NN
cord-252671-uf96jgig	28	8	to	to	TO
cord-252671-uf96jgig	28	9	inhibit	inhibit	VB
cord-252671-uf96jgig	28	10	host	host	NN
cord-252671-uf96jgig	28	11	innate	innate	JJ
cord-252671-uf96jgig	28	12	immunity	immunity	NN
cord-252671-uf96jgig	28	13	by	by	IN
cord-252671-uf96jgig	28	14	generating	generate	VBG
cord-252671-uf96jgig	28	15	virus	virus	NN
cord-252671-uf96jgig	28	16	-	-	HYPH
cord-252671-uf96jgig	28	17	derived	derive	VBN
cord-252671-uf96jgig	28	18	antagonists	antagonist	NNS
cord-252671-uf96jgig	28	19	to	to	IN
cord-252671-uf96jgig	28	20	some	some	DT
cord-252671-uf96jgig	28	21	key	key	JJ
cord-252671-uf96jgig	28	22	signaling	signal	VBG
cord-252671-uf96jgig	28	23	molecules	molecule	NNS
cord-252671-uf96jgig	28	24	.	.	.
cord-252671-uf96jgig	29	1	The	the	DT
cord-252671-uf96jgig	29	2	vaccinia	vaccinia	NN
cord-252671-uf96jgig	29	3	virus	virus	NN
cord-252671-uf96jgig	29	4	encodes	encode	VBZ
cord-252671-uf96jgig	29	5	two	two	CD
cord-252671-uf96jgig	29	6	Toll	toll	NN
cord-252671-uf96jgig	29	7	/	/	SYM
cord-252671-uf96jgig	29	8	interleukin-1	interleukin-1	NN
cord-252671-uf96jgig	29	9	(	(	-LRB-
cord-252671-uf96jgig	29	10	IL-1	IL-1	NNP
cord-252671-uf96jgig	29	11	)	)	-RRB-
cord-252671-uf96jgig	30	1	receptor	receptor	NN
cord-252671-uf96jgig	30	2	(	(	-LRB-
cord-252671-uf96jgig	30	3	TIR	TIR	NNP
cord-252671-uf96jgig	30	4	)	)	-RRB-
cord-252671-uf96jgig	30	5	domains	domain	NNS
cord-252671-uf96jgig	30	6	containing	contain	VBG
cord-252671-uf96jgig	30	7	proteins	protein	NNS
cord-252671-uf96jgig	30	8	A46R	A46R	NNPS
cord-252671-uf96jgig	30	9	and	and	CC
cord-252671-uf96jgig	30	10	A52R	A52R	NNP
cord-252671-uf96jgig	30	11	,	,	,
cord-252671-uf96jgig	30	12	which	which	WDT
cord-252671-uf96jgig	30	13	can	can	MD
cord-252671-uf96jgig	30	14	negatively	negatively	RB
cord-252671-uf96jgig	30	15	regulate	regulate	VB
cord-252671-uf96jgig	30	16	TLR	TLR	NNP
cord-252671-uf96jgig	30	17	signaling	signal	VBG
cord-252671-uf96jgig	30	18	by	by	IN
cord-252671-uf96jgig	30	19	two	two	CD
cord-252671-uf96jgig	30	20	distinct	distinct	JJ
cord-252671-uf96jgig	30	21	mechanisms	mechanism	NNS
cord-252671-uf96jgig	30	22	(	(	-LRB-
cord-252671-uf96jgig	30	23	13	13	CD
cord-252671-uf96jgig	30	24	)	)	-RRB-
cord-252671-uf96jgig	30	25	.	.	.
cord-252671-uf96jgig	31	1	The	the	DT
cord-252671-uf96jgig	31	2	vaccinia	vaccinia	NN
cord-252671-uf96jgig	31	3	virus	virus	NN
cord-252671-uf96jgig	31	4	A46R	A46R	NNPS
cord-252671-uf96jgig	31	5	inhibits	inhibit	VBZ
cord-252671-uf96jgig	31	6	TLR	TLR	NNP
cord-252671-uf96jgig	31	7	signaling	signal	VBG
cord-252671-uf96jgig	31	8	by	by	IN
cord-252671-uf96jgig	31	9	physically	physically	RB
cord-252671-uf96jgig	31	10	interacting	interact	VBG
cord-252671-uf96jgig	31	11	with	with	IN
cord-252671-uf96jgig	31	12	the	the	DT
cord-252671-uf96jgig	31	13	BB	bb	NN
cord-252671-uf96jgig	31	14	loop	loop	NN
cord-252671-uf96jgig	31	15	of	of	IN
cord-252671-uf96jgig	31	16	TIR	TIR	NNP
cord-252671-uf96jgig	31	17	containing	contain	VBG
cord-252671-uf96jgig	31	18	adaptor	adaptor	NN
cord-252671-uf96jgig	31	19	proteins	protein	NNS
cord-252671-uf96jgig	31	20	such	such	JJ
cord-252671-uf96jgig	31	21	as	as	IN
cord-252671-uf96jgig	31	22	MyD88	myd88	JJ
cord-252671-uf96jgig	31	23	adaptor	adaptor	NN
cord-252671-uf96jgig	31	24	-	-	HYPH
cord-252671-uf96jgig	31	25	like	like	JJ
cord-252671-uf96jgig	31	26	(	(	-LRB-
cord-252671-uf96jgig	31	27	MAL	MAL	NNP
cord-252671-uf96jgig	31	28	)	)	-RRB-
cord-252671-uf96jgig	31	29	and	and	CC
cord-252671-uf96jgig	31	30	TRIF	TRIF	NNP
cord-252671-uf96jgig	31	31	-	-	HYPH
cord-252671-uf96jgig	31	32	related	relate	VBN
cord-252671-uf96jgig	31	33	adaptor	adaptor	NN
cord-252671-uf96jgig	31	34	molecule	molecule	NN
cord-252671-uf96jgig	31	35	(	(	-LRB-
cord-252671-uf96jgig	31	36	TRAM	tram	NN
cord-252671-uf96jgig	31	37	)	)	-RRB-
cord-252671-uf96jgig	31	38	to	to	TO
cord-252671-uf96jgig	31	39	disrupt	disrupt	VB
cord-252671-uf96jgig	31	40	receptor	receptor	NN
cord-252671-uf96jgig	31	41	-	-	HYPH
cord-252671-uf96jgig	31	42	adaptor	adaptor	NN
cord-252671-uf96jgig	31	43	(	(	-LRB-
cord-252671-uf96jgig	31	44	e.g.	e.g.	RB
cord-252671-uf96jgig	31	45	,	,	,
cord-252671-uf96jgig	31	46	TLR4-MAL	TLR4-MAL	NNP
cord-252671-uf96jgig	31	47	and	and	CC
cord-252671-uf96jgig	31	48	TLR4-TRAM	tlr4-tram	CD
cord-252671-uf96jgig	31	49	)	)	-RRB-
cord-252671-uf96jgig	31	50	interactions	interaction	NNS
cord-252671-uf96jgig	31	51	(	(	-LRB-
cord-252671-uf96jgig	31	52	14	14	CD
cord-252671-uf96jgig	31	53	,	,	,
cord-252671-uf96jgig	31	54	15	15	CD
cord-252671-uf96jgig	31	55	)	)	-RRB-
cord-252671-uf96jgig	31	56	.	.	.
cord-252671-uf96jgig	32	1	Differently	differently	RB
cord-252671-uf96jgig	32	2	,	,	,
cord-252671-uf96jgig	32	3	the	the	DT
cord-252671-uf96jgig	32	4	A52R	A52R	NNP
cord-252671-uf96jgig	32	5	protein	protein	NN
cord-252671-uf96jgig	32	6	may	may	MD
cord-252671-uf96jgig	32	7	function	function	VB
cord-252671-uf96jgig	32	8	as	as	IN
cord-252671-uf96jgig	32	9	a	a	DT
cord-252671-uf96jgig	32	10	dominant	dominant	JJ
cord-252671-uf96jgig	32	11	negative	negative	JJ
cord-252671-uf96jgig	32	12	MyD88	MyD88	NNS
cord-252671-uf96jgig	32	13	to	to	TO
cord-252671-uf96jgig	32	14	directly	directly	RB
cord-252671-uf96jgig	32	15	interact	interact	VB
cord-252671-uf96jgig	32	16	with	with	IN
cord-252671-uf96jgig	32	17	TRAF6	TRAF6	NNP
cord-252671-uf96jgig	33	1	and	and	CC
cord-252671-uf96jgig	33	2	IRAK2	IRAK2	NNP
cord-252671-uf96jgig	33	3	(	(	-LRB-
cord-252671-uf96jgig	33	4	16	16	CD
cord-252671-uf96jgig	33	5	,	,	,
cord-252671-uf96jgig	33	6	17	17	CD
cord-252671-uf96jgig	33	7	)	)	-RRB-
cord-252671-uf96jgig	33	8	.	.	.
cord-252671-uf96jgig	34	1	On	on	IN
cord-252671-uf96jgig	34	2	the	the	DT
cord-252671-uf96jgig	34	3	other	other	JJ
cord-252671-uf96jgig	34	4	hand	hand	NN
cord-252671-uf96jgig	34	5	,	,	,
cord-252671-uf96jgig	34	6	the	the	DT
cord-252671-uf96jgig	34	7	vaccinia	vaccinia	NN
cord-252671-uf96jgig	34	8	virus	virus	NN
cord-252671-uf96jgig	34	9	N1L	N1L	NNP
cord-252671-uf96jgig	34	10	protein	protein	NN
cord-252671-uf96jgig	34	11	,	,	,
cord-252671-uf96jgig	34	12	another	another	DT
cord-252671-uf96jgig	34	13	protein	protein	NN
cord-252671-uf96jgig	34	14	homologous	homologous	JJ
cord-252671-uf96jgig	34	15	to	to	IN
cord-252671-uf96jgig	34	16	A52R	A52R	NNP
cord-252671-uf96jgig	34	17	,	,	,
cord-252671-uf96jgig	34	18	employs	employ	VBZ
cord-252671-uf96jgig	34	19	a	a	DT
cord-252671-uf96jgig	34	20	different	different	JJ
cord-252671-uf96jgig	34	21	anti	anti	AFX
cord-252671-uf96jgig	34	22	-	-	JJ
cord-252671-uf96jgig	34	23	IFN	IFN	NNP
cord-252671-uf96jgig	34	24	-	-	HYPH
cord-252671-uf96jgig	34	25	I	-PRON-	PRP
cord-252671-uf96jgig	34	26	strategy	strategy	NN
cord-252671-uf96jgig	34	27	by	by	IN
cord-252671-uf96jgig	34	28	targeting	target	VBG
cord-252671-uf96jgig	34	29	both	both	CC
cord-252671-uf96jgig	34	30	the	the	DT
cord-252671-uf96jgig	34	31	TBK1	TBK1	NNP
cord-252671-uf96jgig	34	32	/	/	SYM
cord-252671-uf96jgig	34	33	IB	IB	NNP
cord-252671-uf96jgig	34	34	kinase	kinase	NNP
cord-252671-uf96jgig	34	35	(	(	-LRB-
cord-252671-uf96jgig	34	36	IKK	IKK	NNP
cord-252671-uf96jgig	34	37	)	)	-RRB-
cord-252671-uf96jgig	34	38	and	and	CC
cord-252671-uf96jgig	34	39	IKK	IKK	NNP
cord-252671-uf96jgig	35	1	␣	␣	NNP
cord-252671-uf96jgig	35	2	/IKK	/IKK	.
cord-252671-uf96jgig	35	3	␤	␤	NNP
cord-252671-uf96jgig	35	4	complexes	complex	NNS
cord-252671-uf96jgig	35	5	to	to	TO
cord-252671-uf96jgig	35	6	inhibit	inhibit	VB
cord-252671-uf96jgig	35	7	IRF3	IRF3	NNP
cord-252671-uf96jgig	35	8	and	and	CC
cord-252671-uf96jgig	35	9	NF	nf	NN
cord-252671-uf96jgig	35	10	-	-	HYPH
cord-252671-uf96jgig	35	11	B	b	NN
cord-252671-uf96jgig	35	12	signaling	signaling	NN
cord-252671-uf96jgig	35	13	,	,	,
cord-252671-uf96jgig	35	14	respectively	respectively	RB
cord-252671-uf96jgig	35	15	(	(	-LRB-
cord-252671-uf96jgig	35	16	18	18	CD
cord-252671-uf96jgig	35	17	)	)	-RRB-
cord-252671-uf96jgig	35	18	.	.	.
cord-252671-uf96jgig	36	1	Alternatively	alternatively	RB
cord-252671-uf96jgig	36	2	,	,	,
cord-252671-uf96jgig	36	3	virus	virus	NN
cord-252671-uf96jgig	36	4	may	may	MD
cord-252671-uf96jgig	36	5	invade	invade	VB
cord-252671-uf96jgig	36	6	the	the	DT
cord-252671-uf96jgig	36	7	cells	cell	NNS
cord-252671-uf96jgig	36	8	to	to	TO
cord-252671-uf96jgig	36	9	target	target	VB
cord-252671-uf96jgig	36	10	the	the	DT
cord-252671-uf96jgig	36	11	retinoic	retinoic	JJ
cord-252671-uf96jgig	36	12	acid	acid	NN
cord-252671-uf96jgig	36	13	-	-	HYPH
cord-252671-uf96jgig	36	14	inducible	inducible	JJ
cord-252671-uf96jgig	36	15	gene	gene	NN
cord-252671-uf96jgig	36	16	I	i	NN
cord-252671-uf96jgig	36	17	(	(	-LRB-
cord-252671-uf96jgig	36	18	RIG	RIG	NNP
cord-252671-uf96jgig	36	19	-	-	HYPH
cord-252671-uf96jgig	36	20	I)-like	I)-like	NNP
cord-252671-uf96jgig	36	21	receptor	receptor	NN
cord-252671-uf96jgig	36	22	signaling	signal	VBG
cord-252671-uf96jgig	36	23	pathways	pathway	NNS
cord-252671-uf96jgig	36	24	for	for	IN
cord-252671-uf96jgig	36	25	the	the	DT
cord-252671-uf96jgig	36	26	prevention	prevention	NN
cord-252671-uf96jgig	36	27	of	of	IN
cord-252671-uf96jgig	37	1	IFN	IFN	NNP
cord-252671-uf96jgig	37	2	-	-	HYPH
cord-252671-uf96jgig	37	3	I	-PRON-	PRP
cord-252671-uf96jgig	37	4	induction	induction	NN
cord-252671-uf96jgig	37	5	.	.	.
cord-252671-uf96jgig	38	1	For	for	IN
cord-252671-uf96jgig	38	2	example	example	NN
cord-252671-uf96jgig	38	3	,	,	,
cord-252671-uf96jgig	38	4	the	the	DT
cord-252671-uf96jgig	38	5	influenza	influenza	NN
cord-252671-uf96jgig	38	6	virus	virus	NN
cord-252671-uf96jgig	38	7	nonstructural	nonstructural	JJ
cord-252671-uf96jgig	38	8	protein	protein	NN
cord-252671-uf96jgig	38	9	NS1	NS1	NNS
cord-252671-uf96jgig	38	10	can	can	MD
cord-252671-uf96jgig	38	11	sequester	sequester	VB
cord-252671-uf96jgig	38	12	either	either	CC
cord-252671-uf96jgig	38	13	the	the	DT
cord-252671-uf96jgig	38	14	dsRNA	dsrna	NN
cord-252671-uf96jgig	38	15	or	or	CC
cord-252671-uf96jgig	38	16	5	5	CD
cord-252671-uf96jgig	38	17	=	=	SYM
cord-252671-uf96jgig	38	18	triphosphate	triphosphate	NN
cord-252671-uf96jgig	38	19	RNA	RNA	NNP
cord-252671-uf96jgig	38	20	products	product	NNS
cord-252671-uf96jgig	38	21	of	of	IN
cord-252671-uf96jgig	38	22	viral	viral	JJ
cord-252671-uf96jgig	38	23	infection	infection	NN
cord-252671-uf96jgig	38	24	which	which	WDT
cord-252671-uf96jgig	38	25	can	can	MD
cord-252671-uf96jgig	38	26	be	be	VB
cord-252671-uf96jgig	38	27	sensed	sense	VBN
cord-252671-uf96jgig	38	28	by	by	IN
cord-252671-uf96jgig	38	29	or	or	CC
cord-252671-uf96jgig	38	30	directly	directly	RB
cord-252671-uf96jgig	38	31	bound	bind	VBN
cord-252671-uf96jgig	38	32	to	to	IN
cord-252671-uf96jgig	38	33	the	the	DT
cord-252671-uf96jgig	38	34	RNA	RNA	NNP
cord-252671-uf96jgig	38	35	helicase	helicase	NN
cord-252671-uf96jgig	38	36	sensor	sensor	NN
cord-252671-uf96jgig	38	37	RIG	rig	NN
cord-252671-uf96jgig	38	38	-	-	:
cord-252671-uf96jgig	38	39	I	-PRON-	PRP
cord-252671-uf96jgig	38	40	to	to	TO
cord-252671-uf96jgig	38	41	inhibit	inhibit	VB
cord-252671-uf96jgig	38	42	RIG	rig	NN
cord-252671-uf96jgig	38	43	-	-	HYPH
cord-252671-uf96jgig	38	44	I	i	NN
cord-252671-uf96jgig	38	45	-	-	HYPH
cord-252671-uf96jgig	38	46	mediated	mediate	VBN
cord-252671-uf96jgig	38	47	IFN-	IFN-	NNP
cord-252671-uf96jgig	38	48	␤	␤	CD
cord-252671-uf96jgig	38	49	production	production	NN
cord-252671-uf96jgig	38	50	(	(	-LRB-
cord-252671-uf96jgig	38	51	8	8	CD
cord-252671-uf96jgig	38	52	,	,	,
cord-252671-uf96jgig	38	53	19	19	CD
cord-252671-uf96jgig	38	54	,	,	,
cord-252671-uf96jgig	38	55	20	20	CD
cord-252671-uf96jgig	38	56	)	)	-RRB-
cord-252671-uf96jgig	38	57	.	.	.
cord-252671-uf96jgig	39	1	The	the	DT
cord-252671-uf96jgig	39	2	paramyxovirus	paramyxovirus	NN
cord-252671-uf96jgig	39	3	V	v	NN
cord-252671-uf96jgig	39	4	protein	protein	NN
cord-252671-uf96jgig	39	5	inhibits	inhibit	VBZ
cord-252671-uf96jgig	39	6	IFN-	IFN-	NNP
cord-252671-uf96jgig	39	7	␤	␤	``
cord-252671-uf96jgig	39	8	induction	induction	NN
cord-252671-uf96jgig	39	9	through	through	IN
cord-252671-uf96jgig	39	10	the	the	DT
cord-252671-uf96jgig	39	11	blockage	blockage	NN
cord-252671-uf96jgig	39	12	of	of	IN
cord-252671-uf96jgig	39	13	MDA5	MDA5	NNP
cord-252671-uf96jgig	39	14	,	,	,
cord-252671-uf96jgig	39	15	another	another	DT
cord-252671-uf96jgig	39	16	RIG	rig	NN
cord-252671-uf96jgig	39	17	-	-	HYPH
cord-252671-uf96jgig	39	18	I	i	NN
cord-252671-uf96jgig	39	19	-	-	HYPH
cord-252671-uf96jgig	39	20	homologous	homologous	JJ
cord-252671-uf96jgig	39	21	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	39	22	dsRNA	dsrna	NN
cord-252671-uf96jgig	39	23	sensor	sensor	NN
cord-252671-uf96jgig	39	24	(	(	-LRB-
cord-252671-uf96jgig	39	25	21	21	CD
cord-252671-uf96jgig	39	26	)	)	-RRB-
cord-252671-uf96jgig	39	27	.	.	.
cord-252671-uf96jgig	40	1	A	a	DT
cord-252671-uf96jgig	40	2	recent	recent	JJ
cord-252671-uf96jgig	40	3	study	study	NN
cord-252671-uf96jgig	40	4	revealed	reveal	VBD
cord-252671-uf96jgig	40	5	that	that	IN
cord-252671-uf96jgig	40	6	the	the	DT
cord-252671-uf96jgig	40	7	transcriptional	transcriptional	JJ
cord-252671-uf96jgig	40	8	factor	factor	NN
cord-252671-uf96jgig	40	9	IRF3	IRF3	NNP
cord-252671-uf96jgig	40	10	might	may	MD
cord-252671-uf96jgig	40	11	be	be	VB
cord-252671-uf96jgig	40	12	alternatively	alternatively	RB
cord-252671-uf96jgig	40	13	targeted	target	VBN
cord-252671-uf96jgig	40	14	and	and	CC
cord-252671-uf96jgig	40	15	inhibited	inhibit	VBN
cord-252671-uf96jgig	40	16	by	by	IN
cord-252671-uf96jgig	40	17	the	the	DT
cord-252671-uf96jgig	40	18	paramyxovirus	paramyxovirus	NN
cord-252671-uf96jgig	40	19	V	V	NNP
cord-252671-uf96jgig	40	20	protein	protein	NN
cord-252671-uf96jgig	40	21	to	to	TO
cord-252671-uf96jgig	40	22	impede	impede	VB
cord-252671-uf96jgig	40	23	IFN-	IFN-	NNP
cord-252671-uf96jgig	40	24	␤	␤	CD
cord-252671-uf96jgig	40	25	gene	gene	NN
cord-252671-uf96jgig	40	26	transcription	transcription	NN
cord-252671-uf96jgig	40	27	(	(	-LRB-
cord-252671-uf96jgig	40	28	22	22	CD
cord-252671-uf96jgig	40	29	)	)	-RRB-
cord-252671-uf96jgig	40	30	.	.	.
cord-252671-uf96jgig	41	1	It	-PRON-	PRP
cord-252671-uf96jgig	41	2	has	have	VBZ
cord-252671-uf96jgig	41	3	been	be	VBN
cord-252671-uf96jgig	41	4	demonstrated	demonstrate	VBN
cord-252671-uf96jgig	41	5	in	in	IN
cord-252671-uf96jgig	41	6	some	some	DT
cord-252671-uf96jgig	41	7	cases	case	NNS
cord-252671-uf96jgig	41	8	that	that	WDT
cord-252671-uf96jgig	41	9	viral	viral	JJ
cord-252671-uf96jgig	41	10	proteins	protein	NNS
cord-252671-uf96jgig	41	11	may	may	MD
cord-252671-uf96jgig	41	12	function	function	VB
cord-252671-uf96jgig	41	13	as	as	IN
cord-252671-uf96jgig	41	14	extracellular	extracellular	JJ
cord-252671-uf96jgig	41	15	PAMPs	pamp	NNS
cord-252671-uf96jgig	41	16	to	to	TO
cord-252671-uf96jgig	41	17	activate	activate	VB
cord-252671-uf96jgig	41	18	the	the	DT
cord-252671-uf96jgig	41	19	IFN	IFN	NNP
cord-252671-uf96jgig	41	20	-	-	HYPH
cord-252671-uf96jgig	41	21	I	-PRON-	PRP
cord-252671-uf96jgig	41	22	immune	immune	VBP
cord-252671-uf96jgig	41	23	response	response	NN
cord-252671-uf96jgig	41	24	,	,	,
cord-252671-uf96jgig	41	25	most	most	RBS
cord-252671-uf96jgig	41	26	often	often	RB
cord-252671-uf96jgig	41	27	through	through	IN
cord-252671-uf96jgig	41	28	TLR	TLR	NNP
cord-252671-uf96jgig	41	29	(	(	-LRB-
cord-252671-uf96jgig	41	30	such	such	JJ
cord-252671-uf96jgig	41	31	as	as	IN
cord-252671-uf96jgig	41	32	TLR2	TLR2	NNP
cord-252671-uf96jgig	41	33	and	and	CC
cord-252671-uf96jgig	41	34	TLR4	TLR4	NNP
cord-252671-uf96jgig	41	35	)	)	-RRB-
cord-252671-uf96jgig	41	36	signaling	signal	VBG
cord-252671-uf96jgig	41	37	pathways	pathway	NNS
cord-252671-uf96jgig	41	38	(	(	-LRB-
cord-252671-uf96jgig	41	39	23	23	CD
cord-252671-uf96jgig	41	40	)	)	-RRB-
cord-252671-uf96jgig	41	41	(	(	-LRB-
cord-252671-uf96jgig	41	42	24	24	CD
cord-252671-uf96jgig	41	43	)	)	-RRB-
cord-252671-uf96jgig	41	44	(	(	-LRB-
cord-252671-uf96jgig	41	45	25	25	CD
cord-252671-uf96jgig	41	46	)	)	-RRB-
cord-252671-uf96jgig	41	47	.	.	.
cord-252671-uf96jgig	42	1	However	however	RB
cord-252671-uf96jgig	42	2	,	,	,
cord-252671-uf96jgig	42	3	evidence	evidence	NN
cord-252671-uf96jgig	42	4	is	be	VBZ
cord-252671-uf96jgig	42	5	lacking	lack	VBG
cord-252671-uf96jgig	42	6	in	in	IN
cord-252671-uf96jgig	42	7	regard	regard	NN
cord-252671-uf96jgig	42	8	to	to	IN
cord-252671-uf96jgig	42	9	whether	whether	IN
cord-252671-uf96jgig	42	10	or	or	CC
cord-252671-uf96jgig	42	11	not	not	RB
cord-252671-uf96jgig	42	12	a	a	DT
cord-252671-uf96jgig	42	13	virus	virus	NN
cord-252671-uf96jgig	42	14	-	-	HYPH
cord-252671-uf96jgig	42	15	derived	derive	VBN
cord-252671-uf96jgig	42	16	protein	protein	NN
cord-252671-uf96jgig	42	17	can	can	MD
cord-252671-uf96jgig	42	18	function	function	VB
cord-252671-uf96jgig	42	19	as	as	IN
cord-252671-uf96jgig	42	20	a	a	DT
cord-252671-uf96jgig	42	21	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	42	22	PAMP	pamp	NN
cord-252671-uf96jgig	42	23	.	.	.
cord-252671-uf96jgig	43	1	Our	-PRON-	PRP$
cord-252671-uf96jgig	43	2	initial	initial	JJ
cord-252671-uf96jgig	43	3	study	study	NN
cord-252671-uf96jgig	43	4	indicates	indicate	VBZ
cord-252671-uf96jgig	43	5	that	that	IN
cord-252671-uf96jgig	43	6	delivering	deliver	VBG
cord-252671-uf96jgig	43	7	the	the	DT
cord-252671-uf96jgig	43	8	membrane	membrane	NN
cord-252671-uf96jgig	43	9	gene	gene	NN
cord-252671-uf96jgig	43	10	into	into	IN
cord-252671-uf96jgig	43	11	HEK293	HEK293	NNP
cord-252671-uf96jgig	43	12	cells	cell	NNS
cord-252671-uf96jgig	43	13	markedly	markedly	RB
cord-252671-uf96jgig	43	14	induces	induce	VBZ
cord-252671-uf96jgig	43	15	type	type	NN
cord-252671-uf96jgig	43	16	I	-PRON-	PRP
cord-252671-uf96jgig	43	17	interferon	interferon	NN
cord-252671-uf96jgig	43	18	(	(	-LRB-
cord-252671-uf96jgig	43	19	IFN	IFN	NNP
cord-252671-uf96jgig	43	20	-	-	HYPH
cord-252671-uf96jgig	43	21	I	I	NNP
cord-252671-uf96jgig	43	22	)	)	-RRB-
cord-252671-uf96jgig	43	23	production	production	NN
cord-252671-uf96jgig	43	24	(	(	-LRB-
cord-252671-uf96jgig	43	25	26	26	CD
cord-252671-uf96jgig	43	26	)	)	-RRB-
cord-252671-uf96jgig	43	27	.	.	.
cord-252671-uf96jgig	44	1	To	to	IN
cord-252671-uf96jgig	44	2	our	-PRON-	PRP$
cord-252671-uf96jgig	44	3	knowledge	knowledge	NN
cord-252671-uf96jgig	44	4	,	,	,
cord-252671-uf96jgig	44	5	there	there	EX
cord-252671-uf96jgig	44	6	are	be	VBP
cord-252671-uf96jgig	44	7	limited	limited	JJ
cord-252671-uf96jgig	44	8	reports	report	NNS
cord-252671-uf96jgig	44	9	regarding	regard	VBG
cord-252671-uf96jgig	44	10	the	the	DT
cord-252671-uf96jgig	44	11	induction	induction	NN
cord-252671-uf96jgig	44	12	of	of	IN
cord-252671-uf96jgig	44	13	IFN-	IFN-	NNP
cord-252671-uf96jgig	44	14	␤	␤	DT
cord-252671-uf96jgig	44	15	expression	expression	NN
cord-252671-uf96jgig	44	16	directly	directly	RB
cord-252671-uf96jgig	44	17	by	by	IN
cord-252671-uf96jgig	44	18	viral	viral	JJ
cord-252671-uf96jgig	44	19	structural	structural	JJ
cord-252671-uf96jgig	44	20	genes	gene	NNS
cord-252671-uf96jgig	44	21	.	.	.
cord-252671-uf96jgig	45	1	Therefore	therefore	RB
cord-252671-uf96jgig	45	2	,	,	,
cord-252671-uf96jgig	45	3	it	-PRON-	PRP
cord-252671-uf96jgig	45	4	is	be	VBZ
cord-252671-uf96jgig	45	5	intriguing	intriguing	JJ
cord-252671-uf96jgig	45	6	to	to	TO
cord-252671-uf96jgig	45	7	know	know	VB
cord-252671-uf96jgig	45	8	which	which	WDT
cord-252671-uf96jgig	45	9	mechanism	mechanism	NN
cord-252671-uf96jgig	45	10	is	be	VBZ
cord-252671-uf96jgig	45	11	responsible	responsible	JJ
cord-252671-uf96jgig	45	12	for	for	IN
cord-252671-uf96jgig	45	13	the	the	DT
cord-252671-uf96jgig	45	14	severe	severe	JJ
cord-252671-uf96jgig	45	15	acute	acute	JJ
cord-252671-uf96jgig	45	16	respiratory	respiratory	JJ
cord-252671-uf96jgig	45	17	syndrome	syndrome	NN
cord-252671-uf96jgig	45	18	coronavirus	coronavirus	NN
cord-252671-uf96jgig	45	19	(	(	-LRB-
cord-252671-uf96jgig	45	20	SARS	SARS	NNP
cord-252671-uf96jgig	45	21	-	-	HYPH
cord-252671-uf96jgig	45	22	CoV	CoV	NNP
cord-252671-uf96jgig	45	23	)	)	-RRB-
cord-252671-uf96jgig	46	1	M	M	NNP
cord-252671-uf96jgig	47	1	gene	gene	NN
cord-252671-uf96jgig	47	2	-	-	HYPH
cord-252671-uf96jgig	47	3	mediated	mediate	VBN
cord-252671-uf96jgig	47	4	IFN-	IFN-	NNP
cord-252671-uf96jgig	47	5	␤	␤	CD
cord-252671-uf96jgig	47	6	response	response	NN
cord-252671-uf96jgig	47	7	.	.	.
cord-252671-uf96jgig	48	1	In	in	IN
cord-252671-uf96jgig	48	2	this	this	DT
cord-252671-uf96jgig	48	3	study	study	NN
cord-252671-uf96jgig	48	4	,	,	,
cord-252671-uf96jgig	48	5	we	-PRON-	PRP
cord-252671-uf96jgig	48	6	demonstrate	demonstrate	VBP
cord-252671-uf96jgig	48	7	that	that	IN
cord-252671-uf96jgig	48	8	SARS	SARS	NNP
cord-252671-uf96jgig	48	9	-	-	HYPH
cord-252671-uf96jgig	48	10	CoV	CoV	NNP
cord-252671-uf96jgig	48	11	M	M	NNP
cord-252671-uf96jgig	48	12	protein	protein	NN
cord-252671-uf96jgig	48	13	,	,	,
cord-252671-uf96jgig	48	14	rather	rather	RB
cord-252671-uf96jgig	48	15	than	than	IN
cord-252671-uf96jgig	48	16	its	-PRON-	PRP$
cord-252671-uf96jgig	48	17	mRNA	mrna	NN
cord-252671-uf96jgig	48	18	,	,	,
cord-252671-uf96jgig	48	19	activates	activate	VBZ
cord-252671-uf96jgig	48	20	IFN-	IFN-	NNP
cord-252671-uf96jgig	48	21	␤	␤	NNP
cord-252671-uf96jgig	48	22	and	and	CC
cord-252671-uf96jgig	48	23	NF	nf	NN
cord-252671-uf96jgig	48	24	-	-	HYPH
cord-252671-uf96jgig	48	25	B	b	NN
cord-252671-uf96jgig	48	26	responses	response	NNS
cord-252671-uf96jgig	48	27	through	through	IN
cord-252671-uf96jgig	48	28	TLR	TLR	NNP
cord-252671-uf96jgig	48	29	-	-	HYPH
cord-252671-uf96jgig	48	30	related	relate	VBN
cord-252671-uf96jgig	48	31	TRAF3-independent	TRAF3-independent	NNP
cord-252671-uf96jgig	48	32	signaling	signaling	NN
cord-252671-uf96jgig	48	33	cascades	cascade	NNS
cord-252671-uf96jgig	48	34	.	.	.
cord-252671-uf96jgig	49	1	The	the	DT
cord-252671-uf96jgig	49	2	driving	drive	VBG
cord-252671-uf96jgig	49	3	force	force	NN
cord-252671-uf96jgig	49	4	for	for	IN
cord-252671-uf96jgig	49	5	M	M	NNP
cord-252671-uf96jgig	49	6	-	-	HYPH
cord-252671-uf96jgig	49	7	mediated	mediate	VBN
cord-252671-uf96jgig	49	8	IFN-	IFN-	NNP
cord-252671-uf96jgig	49	9	␤	␤	CD
cord-252671-uf96jgig	49	10	induction	induction	NN
cord-252671-uf96jgig	49	11	was	be	VBD
cord-252671-uf96jgig	49	12	most	most	RBS
cord-252671-uf96jgig	49	13	likely	likely	RB
cord-252671-uf96jgig	49	14	generated	generate	VBN
cord-252671-uf96jgig	49	15	from	from	IN
cord-252671-uf96jgig	49	16	the	the	DT
cord-252671-uf96jgig	49	17	inside	inside	NN
cord-252671-uf96jgig	49	18	of	of	IN
cord-252671-uf96jgig	49	19	the	the	DT
cord-252671-uf96jgig	49	20	cells	cell	NNS
cord-252671-uf96jgig	49	21	.	.	.
cord-252671-uf96jgig	50	1	Using	use	VBG
cord-252671-uf96jgig	50	2	SARS	SARS	NNP
cord-252671-uf96jgig	50	3	-	-	HYPH
cord-252671-uf96jgig	50	4	CoV	CoV	NNP
cord-252671-uf96jgig	50	5	pseudovirus	pseudovirus	NNP
cord-252671-uf96jgig	50	6	as	as	IN
cord-252671-uf96jgig	50	7	an	an	DT
cord-252671-uf96jgig	50	8	infectious	infectious	JJ
cord-252671-uf96jgig	50	9	agent	agent	NN
cord-252671-uf96jgig	50	10	,	,	,
cord-252671-uf96jgig	50	11	we	-PRON-	PRP
cord-252671-uf96jgig	50	12	further	further	RB
cord-252671-uf96jgig	50	13	show	show	VBP
cord-252671-uf96jgig	50	14	that	that	IN
cord-252671-uf96jgig	50	15	single	single	JJ
cord-252671-uf96jgig	50	16	point	point	NN
cord-252671-uf96jgig	50	17	mutation	mutation	NN
cord-252671-uf96jgig	50	18	at	at	IN
cord-252671-uf96jgig	50	19	the	the	DT
cord-252671-uf96jgig	50	20	valine	valine	NN
cord-252671-uf96jgig	50	21	68	68	CD
cord-252671-uf96jgig	50	22	residue	residue	NN
cord-252671-uf96jgig	50	23	of	of	IN
cord-252671-uf96jgig	50	24	M	M	NNP
cord-252671-uf96jgig	50	25	protein	protein	NN
cord-252671-uf96jgig	50	26	markedly	markedly	RB
cord-252671-uf96jgig	50	27	inhibits	inhibit	VBZ
cord-252671-uf96jgig	50	28	virus	virus	NN
cord-252671-uf96jgig	50	29	-	-	HYPH
cord-252671-uf96jgig	50	30	induced	induce	VBN
cord-252671-uf96jgig	50	31	IFN-	IFN-	NNP
cord-252671-uf96jgig	50	32	␤	␤	CD
cord-252671-uf96jgig	50	33	production	production	NN
cord-252671-uf96jgig	50	34	.	.	.
cord-252671-uf96jgig	51	1	Overall	overall	RB
cord-252671-uf96jgig	51	2	,	,	,
cord-252671-uf96jgig	51	3	SARS	SARS	NNP
cord-252671-uf96jgig	51	4	-	-	HYPH
cord-252671-uf96jgig	51	5	CoV	CoV	NNP
cord-252671-uf96jgig	51	6	M	M	NNP
cord-252671-uf96jgig	51	7	protein	protein	NN
cord-252671-uf96jgig	51	8	may	may	MD
cord-252671-uf96jgig	51	9	stand	stand	VB
cord-252671-uf96jgig	51	10	out	out	RP
cord-252671-uf96jgig	51	11	as	as	IN
cord-252671-uf96jgig	51	12	a	a	DT
cord-252671-uf96jgig	51	13	novel	novel	JJ
cord-252671-uf96jgig	51	14	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	51	15	PAMP	pamp	NN
cord-252671-uf96jgig	51	16	in	in	IN
cord-252671-uf96jgig	51	17	mediating	mediate	VBG
cord-252671-uf96jgig	51	18	the	the	DT
cord-252671-uf96jgig	51	19	IFN-	IFN-	NNP
cord-252671-uf96jgig	51	20	␤	␤	``
cord-252671-uf96jgig	51	21	immune	immune	JJ
cord-252671-uf96jgig	51	22	response	response	NN
cord-252671-uf96jgig	51	23	.	.	.
cord-252671-uf96jgig	52	1	The	the	DT
cord-252671-uf96jgig	52	2	SARS	SARS	NNP
cord-252671-uf96jgig	52	3	-	-	HYPH
cord-252671-uf96jgig	52	4	CoV	CoV	NNP
cord-252671-uf96jgig	52	5	M	M	NNP
cord-252671-uf96jgig	52	6	gene	gene	NN
cord-252671-uf96jgig	52	7	stimulates	stimulate	VBZ
cord-252671-uf96jgig	52	8	beta	beta	NN
cord-252671-uf96jgig	52	9	interferon	interferon	NN
cord-252671-uf96jgig	52	10	gene	gene	NN
cord-252671-uf96jgig	52	11	expression	expression	NN
cord-252671-uf96jgig	52	12	in	in	IN
cord-252671-uf96jgig	52	13	the	the	DT
cord-252671-uf96jgig	52	14	human	human	JJ
cord-252671-uf96jgig	52	15	embryonic	embryonic	JJ
cord-252671-uf96jgig	52	16	kidney	kidney	NN
cord-252671-uf96jgig	52	17	293	293	CD
cord-252671-uf96jgig	52	18	T	T	NNP
cord-252671-uf96jgig	52	19	cell	cell	NN
cord-252671-uf96jgig	52	20	line	line	NN
cord-252671-uf96jgig	52	21	.	.	.
cord-252671-uf96jgig	53	1	The	the	DT
cord-252671-uf96jgig	53	2	overexpression	overexpression	NN
cord-252671-uf96jgig	53	3	of	of	IN
cord-252671-uf96jgig	53	4	the	the	DT
cord-252671-uf96jgig	53	5	SARS	SARS	NNP
cord-252671-uf96jgig	53	6	-	-	HYPH
cord-252671-uf96jgig	53	7	CoV	CoV	NNP
cord-252671-uf96jgig	53	8	M	M	NNP
cord-252671-uf96jgig	53	9	gene	gene	NN
cord-252671-uf96jgig	53	10	has	have	VBZ
cord-252671-uf96jgig	53	11	been	be	VBN
cord-252671-uf96jgig	53	12	shown	show	VBN
cord-252671-uf96jgig	53	13	to	to	TO
cord-252671-uf96jgig	53	14	upregulate	upregulate	VB
cord-252671-uf96jgig	53	15	the	the	DT
cord-252671-uf96jgig	53	16	transcriptional	transcriptional	JJ
cord-252671-uf96jgig	53	17	level	level	NN
cord-252671-uf96jgig	53	18	of	of	IN
cord-252671-uf96jgig	53	19	IFN-	IFN-	NNP
cord-252671-uf96jgig	53	20	␤	␤	.
cord-252671-uf96jgig	53	21	(	(	-LRB-
cord-252671-uf96jgig	53	22	26	26	CD
cord-252671-uf96jgig	53	23	)	)	-RRB-
cord-252671-uf96jgig	53	24	.	.	.
cord-252671-uf96jgig	54	1	To	to	TO
cord-252671-uf96jgig	54	2	further	further	RB
cord-252671-uf96jgig	54	3	confirm	confirm	VB
cord-252671-uf96jgig	54	4	the	the	DT
cord-252671-uf96jgig	54	5	result	result	NN
cord-252671-uf96jgig	54	6	,	,	,
cord-252671-uf96jgig	54	7	using	use	VBG
cord-252671-uf96jgig	54	8	either	either	CC
cord-252671-uf96jgig	54	9	enhanced	enhance	VBN
cord-252671-uf96jgig	54	10	green	green	JJ
cord-252671-uf96jgig	54	11	fluorescent	fluorescent	NN
cord-252671-uf96jgig	54	12	protein	protein	NN
cord-252671-uf96jgig	54	13	(	(	-LRB-
cord-252671-uf96jgig	54	14	EGFP	EGFP	NNP
cord-252671-uf96jgig	54	15	)	)	-RRB-
cord-252671-uf96jgig	54	16	or	or	CC
cord-252671-uf96jgig	54	17	poly(I	poly(I	NNP
cord-252671-uf96jgig	54	18	:	:	:
cord-252671-uf96jgig	54	19	C	C	NNP
cord-252671-uf96jgig	54	20	)	)	-RRB-
cord-252671-uf96jgig	54	21	as	as	IN
cord-252671-uf96jgig	54	22	a	a	DT
cord-252671-uf96jgig	54	23	negative	negative	JJ
cord-252671-uf96jgig	54	24	or	or	CC
cord-252671-uf96jgig	54	25	positive	positive	JJ
cord-252671-uf96jgig	54	26	control	control	NN
cord-252671-uf96jgig	54	27	,	,	,
cord-252671-uf96jgig	54	28	respectively	respectively	RB
cord-252671-uf96jgig	54	29	,	,	,
cord-252671-uf96jgig	54	30	we	-PRON-	PRP
cord-252671-uf96jgig	54	31	demonstrated	demonstrate	VBD
cord-252671-uf96jgig	54	32	that	that	IN
cord-252671-uf96jgig	54	33	M	M	NNP
cord-252671-uf96jgig	54	34	gene	gene	NN
cord-252671-uf96jgig	54	35	products	product	NNS
cord-252671-uf96jgig	54	36	specifically	specifically	RB
cord-252671-uf96jgig	54	37	promoted	promote	VBD
cord-252671-uf96jgig	54	38	IFN-	IFN-	NNP
cord-252671-uf96jgig	54	39	␤	␤	CD
cord-252671-uf96jgig	54	40	production	production	NN
cord-252671-uf96jgig	54	41	,	,	,
cord-252671-uf96jgig	54	42	since	since	IN
cord-252671-uf96jgig	54	43	cotransfection	cotransfection	NN
cord-252671-uf96jgig	54	44	with	with	IN
cord-252671-uf96jgig	54	45	M	M	NNP
cord-252671-uf96jgig	54	46	small	small	JJ
cord-252671-uf96jgig	54	47	interfering	interfere	VBG
cord-252671-uf96jgig	54	48	RNA	RNA	NNP
cord-252671-uf96jgig	54	49	(	(	-LRB-
cord-252671-uf96jgig	54	50	siRNA	siRNA	NNP
cord-252671-uf96jgig	54	51	)	)	-RRB-
cord-252671-uf96jgig	54	52	completely	completely	RB
cord-252671-uf96jgig	54	53	abolished	abolish	VBD
cord-252671-uf96jgig	54	54	M	M	NNP
cord-252671-uf96jgig	54	55	-	-	HYPH
cord-252671-uf96jgig	54	56	mediated	mediate	VBN
cord-252671-uf96jgig	54	57	IFN-	IFN-	NNP
cord-252671-uf96jgig	54	58	␤	␤	CD
cord-252671-uf96jgig	54	59	induction	induction	NN
cord-252671-uf96jgig	54	60	at	at	IN
cord-252671-uf96jgig	54	61	both	both	CC
cord-252671-uf96jgig	54	62	protein	protein	NN
cord-252671-uf96jgig	54	63	(	(	-LRB-
cord-252671-uf96jgig	54	64	Fig	Fig	NNP
cord-252671-uf96jgig	54	65	.	.	.
cord-252671-uf96jgig	54	66	1A	1a	NN
cord-252671-uf96jgig	54	67	,	,	,
cord-252671-uf96jgig	54	68	comparing	compare	VBG
cord-252671-uf96jgig	54	69	lanes	lane	NNS
cord-252671-uf96jgig	54	70	3	3	CD
cord-252671-uf96jgig	54	71	and	and	CC
cord-252671-uf96jgig	54	72	4	4	CD
cord-252671-uf96jgig	54	73	)	)	-RRB-
cord-252671-uf96jgig	55	1	and	and	CC
cord-252671-uf96jgig	55	2	mRNA	mRNA	NNP
cord-252671-uf96jgig	55	3	(	(	-LRB-
cord-252671-uf96jgig	55	4	Fig	Fig	NNP
cord-252671-uf96jgig	55	5	.	.	.
cord-252671-uf96jgig	55	6	1B	1b	LS
cord-252671-uf96jgig	55	7	)	)	-RRB-
cord-252671-uf96jgig	55	8	levels	level	NNS
cord-252671-uf96jgig	55	9	.	.	.
cord-252671-uf96jgig	56	1	Moreover	moreover	RB
cord-252671-uf96jgig	56	2	,	,	,
cord-252671-uf96jgig	56	3	after	after	IN
cord-252671-uf96jgig	56	4	a	a	DT
cord-252671-uf96jgig	56	5	48-h	48-h	CD
cord-252671-uf96jgig	56	6	transfection	transfection	NN
cord-252671-uf96jgig	56	7	,	,	,
cord-252671-uf96jgig	56	8	cell	cell	NN
cord-252671-uf96jgig	56	9	supernatants	supernatant	NNS
cord-252671-uf96jgig	56	10	were	be	VBD
cord-252671-uf96jgig	56	11	collected	collect	VBN
cord-252671-uf96jgig	56	12	and	and	CC
cord-252671-uf96jgig	56	13	assayed	assay	VBN
cord-252671-uf96jgig	56	14	for	for	IN
cord-252671-uf96jgig	56	15	the	the	DT
cord-252671-uf96jgig	56	16	presence	presence	NN
cord-252671-uf96jgig	56	17	of	of	IN
cord-252671-uf96jgig	56	18	IFN-	IFN-	NNP
cord-252671-uf96jgig	56	19	␤	␤	VBN
cord-252671-uf96jgig	56	20	by	by	IN
cord-252671-uf96jgig	56	21	enzyme	enzyme	NN
cord-252671-uf96jgig	56	22	-	-	HYPH
cord-252671-uf96jgig	56	23	linked	link	VBN
cord-252671-uf96jgig	56	24	immunosorbent	immunosorbent	JJ
cord-252671-uf96jgig	56	25	assay	assay	NN
cord-252671-uf96jgig	56	26	(	(	-LRB-
cord-252671-uf96jgig	56	27	ELISA	ELISA	NNP
cord-252671-uf96jgig	56	28	)	)	-RRB-
cord-252671-uf96jgig	56	29	.	.	.
cord-252671-uf96jgig	57	1	Figure	figure	NN
cord-252671-uf96jgig	57	2	1C	1c	NN
cord-252671-uf96jgig	57	3	clearly	clearly	RB
cord-252671-uf96jgig	57	4	demonstrated	demonstrate	VBD
cord-252671-uf96jgig	57	5	that	that	IN
cord-252671-uf96jgig	57	6	delivering	deliver	VBG
cord-252671-uf96jgig	57	7	pCMV	pcmv	NN
cord-252671-uf96jgig	57	8	-	-	HYPH
cord-252671-uf96jgig	57	9	Myc	Myc	NNP
cord-252671-uf96jgig	57	10	-	-	HYPH
cord-252671-uf96jgig	57	11	M	M	NNP
cord-252671-uf96jgig	57	12	into	into	IN
cord-252671-uf96jgig	57	13	HEK293	HEK293	NNP
cord-252671-uf96jgig	57	14	T	T	NNP
cord-252671-uf96jgig	57	15	cells	cell	NNS
cord-252671-uf96jgig	57	16	specifically	specifically	RB
cord-252671-uf96jgig	57	17	and	and	CC
cord-252671-uf96jgig	57	18	significantly	significantly	RB
cord-252671-uf96jgig	57	19	promoted	promote	VBD
cord-252671-uf96jgig	57	20	the	the	DT
cord-252671-uf96jgig	57	21	secretion	secretion	NN
cord-252671-uf96jgig	57	22	of	of	IN
cord-252671-uf96jgig	57	23	IFN-	IFN-	NNP
cord-252671-uf96jgig	57	24	␤	␤	NNP
cord-252671-uf96jgig	57	25	into	into	IN
cord-252671-uf96jgig	57	26	cell	cell	NN
cord-252671-uf96jgig	57	27	culture	culture	NN
cord-252671-uf96jgig	57	28	medium	medium	NN
cord-252671-uf96jgig	57	29	.	.	.
cord-252671-uf96jgig	58	1	In	in	IN
cord-252671-uf96jgig	58	2	addition	addition	NN
cord-252671-uf96jgig	58	3	,	,	,
cord-252671-uf96jgig	58	4	the	the	DT
cord-252671-uf96jgig	58	5	promoter	promoter	NN
cord-252671-uf96jgig	58	6	sequence	sequence	NN
cord-252671-uf96jgig	58	7	of	of	IN
cord-252671-uf96jgig	58	8	IFN-	IFN-	NNP
cord-252671-uf96jgig	58	9	␤	␤	NNP
cord-252671-uf96jgig	58	10	was	be	VBD
cord-252671-uf96jgig	58	11	placed	place	VBN
cord-252671-uf96jgig	58	12	upstream	upstream	RB
cord-252671-uf96jgig	58	13	of	of	IN
cord-252671-uf96jgig	58	14	the	the	DT
cord-252671-uf96jgig	58	15	firefly	firefly	NN
cord-252671-uf96jgig	58	16	luciferase	luciferase	NN
cord-252671-uf96jgig	58	17	reporter	reporter	NN
cord-252671-uf96jgig	58	18	to	to	TO
cord-252671-uf96jgig	58	19	generate	generate	VB
cord-252671-uf96jgig	58	20	the	the	DT
cord-252671-uf96jgig	58	21	pGL3-IFN-	pgl3-ifn-	NN
cord-252671-uf96jgig	58	22	␤	␤	TO
cord-252671-uf96jgig	58	23	-Luc	-luc	VB
cord-252671-uf96jgig	58	24	construct	construct	VB
cord-252671-uf96jgig	58	25	.	.	.
cord-252671-uf96jgig	59	1	To	to	TO
cord-252671-uf96jgig	59	2	test	test	VB
cord-252671-uf96jgig	59	3	the	the	DT
cord-252671-uf96jgig	59	4	specificity	specificity	NN
cord-252671-uf96jgig	59	5	of	of	IN
cord-252671-uf96jgig	59	6	M	M	NNP
cord-252671-uf96jgig	59	7	-	-	HYPH
cord-252671-uf96jgig	59	8	mediated	mediate	VBN
cord-252671-uf96jgig	59	9	IFN-	IFN-	NNP
cord-252671-uf96jgig	59	10	␤	␤	CD
cord-252671-uf96jgig	59	11	induction	induction	NN
cord-252671-uf96jgig	59	12	,	,	,
cord-252671-uf96jgig	59	13	other	other	JJ
cord-252671-uf96jgig	59	14	viral	viral	JJ
cord-252671-uf96jgig	59	15	envelope	envelope	NN
cord-252671-uf96jgig	59	16	-	-	HYPH
cord-252671-uf96jgig	59	17	associated	associate	VBN
cord-252671-uf96jgig	59	18	genes	gene	NNS
cord-252671-uf96jgig	59	19	such	such	JJ
cord-252671-uf96jgig	59	20	as	as	IN
cord-252671-uf96jgig	59	21	the	the	DT
cord-252671-uf96jgig	59	22	spike	spike	NN
cord-252671-uf96jgig	59	23	(	(	-LRB-
cord-252671-uf96jgig	59	24	S	s	NN
cord-252671-uf96jgig	59	25	)	)	-RRB-
cord-252671-uf96jgig	59	26	and	and	CC
cord-252671-uf96jgig	59	27	envelope	envelope	NN
cord-252671-uf96jgig	59	28	(	(	-LRB-
cord-252671-uf96jgig	59	29	E	e	NN
cord-252671-uf96jgig	59	30	)	)	-RRB-
cord-252671-uf96jgig	59	31	protein	protein	NN
cord-252671-uf96jgig	59	32	genes	gene	NNS
cord-252671-uf96jgig	59	33	as	as	RB
cord-252671-uf96jgig	59	34	well	well	RB
cord-252671-uf96jgig	59	35	as	as	IN
cord-252671-uf96jgig	59	36	the	the	DT
cord-252671-uf96jgig	59	37	M	M	NNP
cord-252671-uf96jgig	59	38	mutant	mutant	NN
cord-252671-uf96jgig	59	39	[	[	-LRB-
cord-252671-uf96jgig	59	40	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	59	41	)	)	-RRB-
cord-252671-uf96jgig	59	42	]	]	-RRB-
cord-252671-uf96jgig	59	43	from	from	IN
cord-252671-uf96jgig	59	44	the	the	DT
cord-252671-uf96jgig	59	45	GZ50	GZ50	NNP
cord-252671-uf96jgig	59	46	isolate	isolate	VB
cord-252671-uf96jgig	59	47	were	be	VBD
cord-252671-uf96jgig	59	48	also	also	RB
cord-252671-uf96jgig	59	49	included	include	VBN
cord-252671-uf96jgig	59	50	(	(	-LRB-
cord-252671-uf96jgig	59	51	27	27	CD
cord-252671-uf96jgig	59	52	)	)	-RRB-
cord-252671-uf96jgig	59	53	.	.	.
cord-252671-uf96jgig	60	1	The	the	DT
cord-252671-uf96jgig	60	2	result	result	NN
cord-252671-uf96jgig	60	3	of	of	IN
cord-252671-uf96jgig	60	4	a	a	DT
cord-252671-uf96jgig	60	5	dual	dual	JJ
cord-252671-uf96jgig	60	6	-	-	HYPH
cord-252671-uf96jgig	60	7	luciferase	luciferase	NN
cord-252671-uf96jgig	60	8	assay	assay	NN
cord-252671-uf96jgig	60	9	using	use	VBG
cord-252671-uf96jgig	60	10	the	the	DT
cord-252671-uf96jgig	60	11	Renilla	Renilla	NNP
cord-252671-uf96jgig	60	12	luciferase	luciferase	NN
cord-252671-uf96jgig	60	13	gene	gene	NN
cord-252671-uf96jgig	60	14	as	as	IN
cord-252671-uf96jgig	60	15	a	a	DT
cord-252671-uf96jgig	60	16	transfection	transfection	NN
cord-252671-uf96jgig	60	17	control	control	NN
cord-252671-uf96jgig	60	18	demonstrated	demonstrate	VBD
cord-252671-uf96jgig	60	19	that	that	IN
cord-252671-uf96jgig	60	20	the	the	DT
cord-252671-uf96jgig	60	21	SARS	SARS	NNP
cord-252671-uf96jgig	60	22	-	-	HYPH
cord-252671-uf96jgig	60	23	CoV	CoV	NNP
cord-252671-uf96jgig	60	24	M	M	NNP
cord-252671-uf96jgig	60	25	gene	gene	NN
cord-252671-uf96jgig	60	26	rather	rather	RB
cord-252671-uf96jgig	60	27	than	than	IN
cord-252671-uf96jgig	60	28	the	the	DT
cord-252671-uf96jgig	60	29	S	S	NNP
cord-252671-uf96jgig	60	30	and	and	CC
cord-252671-uf96jgig	60	31	E	e	NN
cord-252671-uf96jgig	60	32	genes	gene	NNS
cord-252671-uf96jgig	60	33	markedly	markedly	RB
cord-252671-uf96jgig	60	34	increased	increase	VBD
cord-252671-uf96jgig	60	35	IFN-	IFN-	NNP
cord-252671-uf96jgig	60	36	␤	␤	CD
cord-252671-uf96jgig	60	37	promoter	promoter	NN
cord-252671-uf96jgig	60	38	activity	activity	NN
cord-252671-uf96jgig	61	1	(	(	-LRB-
cord-252671-uf96jgig	61	2	Fig	Fig	NNP
cord-252671-uf96jgig	61	3	.	.	.
cord-252671-uf96jgig	61	4	1D	1d	CD
cord-252671-uf96jgig	61	5	)	)	-RRB-
cord-252671-uf96jgig	61	6	,	,	,
cord-252671-uf96jgig	61	7	whereas	whereas	IN
cord-252671-uf96jgig	61	8	the	the	DT
cord-252671-uf96jgig	61	9	valineto	valineto	NN
cord-252671-uf96jgig	61	10	-	-	HYPH
cord-252671-uf96jgig	61	11	alanine	alanine	NN
cord-252671-uf96jgig	61	12	alteration	alteration	NN
cord-252671-uf96jgig	61	13	at	at	IN
cord-252671-uf96jgig	61	14	residue	residue	NN
cord-252671-uf96jgig	61	15	68	68	CD
cord-252671-uf96jgig	61	16	of	of	IN
cord-252671-uf96jgig	61	17	M	M	NNP
cord-252671-uf96jgig	61	18	protein	protein	NN
cord-252671-uf96jgig	61	19	completely	completely	RB
cord-252671-uf96jgig	61	20	abolished	abolish	VBD
cord-252671-uf96jgig	61	21	this	this	DT
cord-252671-uf96jgig	61	22	induction	induction	NN
cord-252671-uf96jgig	61	23	,	,	,
cord-252671-uf96jgig	61	24	indicating	indicate	VBG
cord-252671-uf96jgig	61	25	that	that	IN
cord-252671-uf96jgig	61	26	the	the	DT
cord-252671-uf96jgig	61	27	specificity	specificity	NN
cord-252671-uf96jgig	61	28	of	of	IN
cord-252671-uf96jgig	61	29	M	M	NNP
cord-252671-uf96jgig	61	30	gene	gene	NN
cord-252671-uf96jgig	61	31	products	product	NNS
cord-252671-uf96jgig	61	32	played	play	VBD
cord-252671-uf96jgig	61	33	a	a	DT
cord-252671-uf96jgig	61	34	role	role	NN
cord-252671-uf96jgig	61	35	in	in	IN
cord-252671-uf96jgig	61	36	this	this	DT
cord-252671-uf96jgig	61	37	process	process	NN
cord-252671-uf96jgig	61	38	.	.	.
cord-252671-uf96jgig	62	1	Consistent	consistent	JJ
cord-252671-uf96jgig	62	2	with	with	IN
cord-252671-uf96jgig	62	3	these	these	DT
cord-252671-uf96jgig	62	4	results	result	NNS
cord-252671-uf96jgig	62	5	,	,	,
cord-252671-uf96jgig	62	6	Western	western	JJ
cord-252671-uf96jgig	62	7	blotting	blotting	NN
cord-252671-uf96jgig	62	8	and	and	CC
cord-252671-uf96jgig	62	9	ELISA	ELISA	NNP
cord-252671-uf96jgig	62	10	further	further	RB
cord-252671-uf96jgig	62	11	validated	validate	VBD
cord-252671-uf96jgig	62	12	the	the	DT
cord-252671-uf96jgig	62	13	above	above	JJ
cord-252671-uf96jgig	62	14	observation	observation	NN
cord-252671-uf96jgig	62	15	(	(	-LRB-
cord-252671-uf96jgig	62	16	Fig	Fig	NNP
cord-252671-uf96jgig	62	17	.	.	.
cord-252671-uf96jgig	62	18	1E	1E	NNP
cord-252671-uf96jgig	62	19	and	and	CC
cord-252671-uf96jgig	62	20	F	F	NNP
cord-252671-uf96jgig	62	21	)	)	-RRB-
cord-252671-uf96jgig	62	22	.	.	.
cord-252671-uf96jgig	63	1	To	to	TO
cord-252671-uf96jgig	63	2	detect	detect	VB
cord-252671-uf96jgig	63	3	if	if	IN
cord-252671-uf96jgig	63	4	the	the	DT
cord-252671-uf96jgig	63	5	SARS	SARS	NNP
cord-252671-uf96jgig	63	6	-	-	HYPH
cord-252671-uf96jgig	63	7	CoV	CoV	NNP
cord-252671-uf96jgig	63	8	M	M	NNP
cord-252671-uf96jgig	63	9	gene	gene	NN
cord-252671-uf96jgig	63	10	has	have	VBZ
cord-252671-uf96jgig	63	11	a	a	DT
cord-252671-uf96jgig	63	12	direct	direct	JJ
cord-252671-uf96jgig	63	13	effect	effect	NN
cord-252671-uf96jgig	63	14	on	on	IN
cord-252671-uf96jgig	63	15	NF	nf	NN
cord-252671-uf96jgig	63	16	-	-	HYPH
cord-252671-uf96jgig	63	17	B	b	NN
cord-252671-uf96jgig	63	18	activation	activation	NN
cord-252671-uf96jgig	63	19	,	,	,
cord-252671-uf96jgig	63	20	pCMV	pcmv	NN
cord-252671-uf96jgig	63	21	-	-	HYPH
cord-252671-uf96jgig	63	22	Myc	Myc	NNP
cord-252671-uf96jgig	63	23	-	-	HYPH
cord-252671-uf96jgig	63	24	M	M	NNP
cord-252671-uf96jgig	63	25	was	be	VBD
cord-252671-uf96jgig	63	26	cotransfected	cotransfecte	VBN
cord-252671-uf96jgig	63	27	with	with	IN
cord-252671-uf96jgig	63	28	pNFB	pnfb	JJ
cord-252671-uf96jgig	63	29	-	-	HYPH
cord-252671-uf96jgig	63	30	luc	luc	NNP
cord-252671-uf96jgig	63	31	,	,	,
cord-252671-uf96jgig	63	32	which	which	WDT
cord-252671-uf96jgig	63	33	contained	contain	VBD
cord-252671-uf96jgig	63	34	five	five	CD
cord-252671-uf96jgig	63	35	copies	copy	NNS
cord-252671-uf96jgig	63	36	of	of	IN
cord-252671-uf96jgig	63	37	NF	nf	NN
cord-252671-uf96jgig	63	38	-	-	HYPH
cord-252671-uf96jgig	63	39	B	b	NN
cord-252671-uf96jgig	63	40	recognition	recognition	NN
cord-252671-uf96jgig	63	41	sites	site	NNS
cord-252671-uf96jgig	63	42	,	,	,
cord-252671-uf96jgig	63	43	into	into	IN
cord-252671-uf96jgig	63	44	HEK293	HEK293	NNP
cord-252671-uf96jgig	63	45	T	T	NNP
cord-252671-uf96jgig	63	46	cells	cell	NNS
cord-252671-uf96jgig	63	47	.	.	.
cord-252671-uf96jgig	64	1	The	the	DT
cord-252671-uf96jgig	64	2	results	result	NNS
cord-252671-uf96jgig	64	3	of	of	IN
cord-252671-uf96jgig	64	4	the	the	DT
cord-252671-uf96jgig	64	5	dualluciferase	dualluciferase	NNP
cord-252671-uf96jgig	64	6	assay	assay	NN
cord-252671-uf96jgig	64	7	revealed	reveal	VBD
cord-252671-uf96jgig	64	8	that	that	IN
cord-252671-uf96jgig	64	9	the	the	DT
cord-252671-uf96jgig	64	10	SARS	SARS	NNP
cord-252671-uf96jgig	64	11	-	-	HYPH
cord-252671-uf96jgig	64	12	CoV	CoV	NNP
cord-252671-uf96jgig	64	13	M	M	NNP
cord-252671-uf96jgig	64	14	gene	gene	NN
cord-252671-uf96jgig	64	15	specifically	specifically	RB
cord-252671-uf96jgig	64	16	and	and	CC
cord-252671-uf96jgig	64	17	dramatically	dramatically	RB
cord-252671-uf96jgig	64	18	upregulated	upregulate	VBN
cord-252671-uf96jgig	64	19	NF	nf	NN
cord-252671-uf96jgig	64	20	-	-	HYPH
cord-252671-uf96jgig	64	21	B	b	NN
cord-252671-uf96jgig	64	22	activity	activity	NN
cord-252671-uf96jgig	64	23	compared	compare	VBN
cord-252671-uf96jgig	64	24	with	with	IN
cord-252671-uf96jgig	64	25	the	the	DT
cord-252671-uf96jgig	64	26	controls	control	NNS
cord-252671-uf96jgig	64	27	(	(	-LRB-
cord-252671-uf96jgig	64	28	Fig	Fig	NNP
cord-252671-uf96jgig	64	29	.	.	.
cord-252671-uf96jgig	64	30	1	1	CD
cord-252671-uf96jgig	64	31	G	g	NN
cord-252671-uf96jgig	64	32	)	)	-RRB-
cord-252671-uf96jgig	64	33	.	.	.
cord-252671-uf96jgig	65	1	Moreover	moreover	RB
cord-252671-uf96jgig	65	2	,	,	,
cord-252671-uf96jgig	65	3	M	M	NNP
cord-252671-uf96jgig	65	4	could	could	MD
cord-252671-uf96jgig	65	5	mediate	mediate	VB
cord-252671-uf96jgig	65	6	IFN-	IFN-	NNP
cord-252671-uf96jgig	65	7	␤	␤	CD
cord-252671-uf96jgig	65	8	induction	induction	NN
cord-252671-uf96jgig	65	9	in	in	IN
cord-252671-uf96jgig	65	10	both	both	CC
cord-252671-uf96jgig	65	11	dose	dose	NN
cord-252671-uf96jgig	65	12	-	-	HYPH
cord-252671-uf96jgig	65	13	and	and	CC
cord-252671-uf96jgig	65	14	time	time	NN
cord-252671-uf96jgig	65	15	-	-	HYPH
cord-252671-uf96jgig	65	16	dependent	dependent	JJ
cord-252671-uf96jgig	65	17	manner	manner	NN
cord-252671-uf96jgig	66	1	(	(	-LRB-
cord-252671-uf96jgig	66	2	Fig	Fig	NNP
cord-252671-uf96jgig	66	3	.	.	.
cord-252671-uf96jgig	66	4	1H	1h	CD
cord-252671-uf96jgig	66	5	and	and	CC
cord-252671-uf96jgig	66	6	I	i	NN
cord-252671-uf96jgig	66	7	)	)	-RRB-
cord-252671-uf96jgig	66	8	.	.	.
cord-252671-uf96jgig	67	1	Overall	overall	RB
cord-252671-uf96jgig	67	2	,	,	,
cord-252671-uf96jgig	67	3	the	the	DT
cord-252671-uf96jgig	67	4	data	datum	NNS
cord-252671-uf96jgig	67	5	strongly	strongly	RB
cord-252671-uf96jgig	67	6	indicated	indicate	VBD
cord-252671-uf96jgig	67	7	that	that	IN
cord-252671-uf96jgig	67	8	the	the	DT
cord-252671-uf96jgig	67	9	SARS	SARS	NNP
cord-252671-uf96jgig	67	10	-	-	HYPH
cord-252671-uf96jgig	67	11	CoV	CoV	NNP
cord-252671-uf96jgig	67	12	M	M	NNP
cord-252671-uf96jgig	67	13	gene	gene	NN
cord-252671-uf96jgig	67	14	product	product	NN
cord-252671-uf96jgig	67	15	was	be	VBD
cord-252671-uf96jgig	67	16	sufficient	sufficient	JJ
cord-252671-uf96jgig	67	17	to	to	TO
cord-252671-uf96jgig	67	18	promote	promote	VB
cord-252671-uf96jgig	67	19	IFN-	IFN-	NNP
cord-252671-uf96jgig	67	20	␤	␤	CD
cord-252671-uf96jgig	67	21	gene	gene	NN
cord-252671-uf96jgig	67	22	expression	expression	NN
cord-252671-uf96jgig	67	23	.	.	.
cord-252671-uf96jgig	68	1	The	the	DT
cord-252671-uf96jgig	68	2	SARS	SARS	NNP
cord-252671-uf96jgig	68	3	-	-	HYPH
cord-252671-uf96jgig	68	4	CoV	CoV	NNP
cord-252671-uf96jgig	68	5	M	M	NNP
cord-252671-uf96jgig	68	6	gene	gene	NN
cord-252671-uf96jgig	68	7	product	product	NN
cord-252671-uf96jgig	68	8	activates	activate	VBZ
cord-252671-uf96jgig	68	9	the	the	DT
cord-252671-uf96jgig	68	10	IFN-	IFN-	NNP
cord-252671-uf96jgig	68	11	␤	␤	``
cord-252671-uf96jgig	68	12	signaling	signal	VBG
cord-252671-uf96jgig	68	13	pathway	pathway	NN
cord-252671-uf96jgig	68	14	at	at	IN
cord-252671-uf96jgig	68	15	or	or	CC
cord-252671-uf96jgig	68	16	upstream	upstream	RB
cord-252671-uf96jgig	68	17	of	of	IN
cord-252671-uf96jgig	68	18	TBK1	TBK1	NNP
cord-252671-uf96jgig	68	19	.	.	.
cord-252671-uf96jgig	69	1	To	to	TO
cord-252671-uf96jgig	69	2	further	further	RB
cord-252671-uf96jgig	69	3	confirm	confirm	VB
cord-252671-uf96jgig	69	4	the	the	DT
cord-252671-uf96jgig	69	5	above	above	JJ
cord-252671-uf96jgig	69	6	results	result	NNS
cord-252671-uf96jgig	69	7	,	,	,
cord-252671-uf96jgig	69	8	increased	increase	VBN
cord-252671-uf96jgig	69	9	doses	dose	NNS
cord-252671-uf96jgig	69	10	of	of	IN
cord-252671-uf96jgig	69	11	the	the	DT
cord-252671-uf96jgig	69	12	pCMV	pcmv	NN
cord-252671-uf96jgig	69	13	-	-	HYPH
cord-252671-uf96jgig	69	14	Myc	Myc	NNP
cord-252671-uf96jgig	69	15	-	-	HYPH
cord-252671-uf96jgig	69	16	M	M	NNP
cord-252671-uf96jgig	69	17	gene	gene	NN
cord-252671-uf96jgig	69	18	were	be	VBD
cord-252671-uf96jgig	69	19	transiently	transiently	RB
cord-252671-uf96jgig	69	20	transfected	transfecte	VBN
cord-252671-uf96jgig	69	21	into	into	IN
cord-252671-uf96jgig	69	22	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	69	23	cells	cell	NNS
cord-252671-uf96jgig	69	24	.	.	.
cord-252671-uf96jgig	70	1	The	the	DT
cord-252671-uf96jgig	70	2	cell	cell	NN
cord-252671-uf96jgig	70	3	lysates	lysate	NNS
cord-252671-uf96jgig	70	4	prepared	prepare	VBN
cord-252671-uf96jgig	70	5	from	from	IN
cord-252671-uf96jgig	70	6	the	the	DT
cord-252671-uf96jgig	70	7	transfection	transfection	NN
cord-252671-uf96jgig	70	8	were	be	VBD
cord-252671-uf96jgig	70	9	examined	examine	VBN
cord-252671-uf96jgig	70	10	for	for	IN
cord-252671-uf96jgig	70	11	the	the	DT
cord-252671-uf96jgig	70	12	activation	activation	NN
cord-252671-uf96jgig	70	13	of	of	IN
cord-252671-uf96jgig	70	14	the	the	DT
cord-252671-uf96jgig	70	15	downstream	downstream	JJ
cord-252671-uf96jgig	70	16	modulator	modulator	NN
cord-252671-uf96jgig	70	17	and/or	and/or	CC
cord-252671-uf96jgig	70	18	effector	effector	NN
cord-252671-uf96jgig	70	19	molecules	molecule	NNS
cord-252671-uf96jgig	70	20	,	,	,
cord-252671-uf96jgig	70	21	such	such	JJ
cord-252671-uf96jgig	70	22	as	as	IN
cord-252671-uf96jgig	70	23	TBK1	TBK1	NNP
cord-252671-uf96jgig	70	24	,	,	,
cord-252671-uf96jgig	70	25	IRF3	IRF3	NNP
cord-252671-uf96jgig	70	26	,	,	,
cord-252671-uf96jgig	70	27	and	and	CC
cord-252671-uf96jgig	70	28	NF	NF	NNP
cord-252671-uf96jgig	70	29	-	-	HYPH
cord-252671-uf96jgig	70	30	B.	B.	NNP
cord-252671-uf96jgig	70	31	Figure	Figure	NNP
cord-252671-uf96jgig	70	32	2A	2a	CD
cord-252671-uf96jgig	70	33	clearly	clearly	RB
cord-252671-uf96jgig	70	34	demonstrates	demonstrate	VBZ
cord-252671-uf96jgig	70	35	that	that	IN
cord-252671-uf96jgig	70	36	SARS	SARS	NNP
cord-252671-uf96jgig	70	37	-	-	HYPH
cord-252671-uf96jgig	70	38	CoV	CoV	NNP
cord-252671-uf96jgig	70	39	M	M	NNP
cord-252671-uf96jgig	70	40	gene	gene	NN
cord-252671-uf96jgig	70	41	products	product	NNS
cord-252671-uf96jgig	70	42	not	not	RB
cord-252671-uf96jgig	70	43	only	only	RB
cord-252671-uf96jgig	70	44	enhanced	enhance	VBD
cord-252671-uf96jgig	70	45	the	the	DT
cord-252671-uf96jgig	70	46	phosphorylation	phosphorylation	NN
cord-252671-uf96jgig	70	47	level	level	NN
cord-252671-uf96jgig	70	48	of	of	IN
cord-252671-uf96jgig	70	49	TBK1	TBK1	NNP
cord-252671-uf96jgig	70	50	but	but	CC
cord-252671-uf96jgig	70	51	also	also	RB
cord-252671-uf96jgig	70	52	promoted	promote	VBD
cord-252671-uf96jgig	70	53	the	the	DT
cord-252671-uf96jgig	70	54	activation	activation	NN
cord-252671-uf96jgig	70	55	of	of	IN
cord-252671-uf96jgig	70	56	both	both	DT
cord-252671-uf96jgig	70	57	NF	nf	NN
cord-252671-uf96jgig	70	58	-	-	HYPH
cord-252671-uf96jgig	70	59	B	b	NN
cord-252671-uf96jgig	70	60	p65	p65	NN
cord-252671-uf96jgig	70	61	and	and	CC
cord-252671-uf96jgig	70	62	IRF3	IRF3	NNP
cord-252671-uf96jgig	70	63	,	,	,
cord-252671-uf96jgig	70	64	indicating	indicate	VBG
cord-252671-uf96jgig	70	65	that	that	IN
cord-252671-uf96jgig	70	66	M	M	NNP
cord-252671-uf96jgig	70	67	gene	gene	NN
cord-252671-uf96jgig	70	68	products	product	NNS
cord-252671-uf96jgig	70	69	may	may	MD
cord-252671-uf96jgig	70	70	stimulate	stimulate	VB
cord-252671-uf96jgig	70	71	IFN-	IFN-	NNP
cord-252671-uf96jgig	70	72	␤	␤	CD
cord-252671-uf96jgig	70	73	activation	activation	NN
cord-252671-uf96jgig	70	74	by	by	IN
cord-252671-uf96jgig	70	75	promoting	promote	VBG
cord-252671-uf96jgig	70	76	its	-PRON-	PRP$
cord-252671-uf96jgig	70	77	enhanceosome	enhanceosome	NN
cord-252671-uf96jgig	70	78	activity	activity	NN
cord-252671-uf96jgig	70	79	.	.	.
cord-252671-uf96jgig	71	1	To	to	TO
cord-252671-uf96jgig	71	2	further	further	RB
cord-252671-uf96jgig	71	3	define	define	VB
cord-252671-uf96jgig	71	4	the	the	DT
cord-252671-uf96jgig	71	5	activation	activation	NN
cord-252671-uf96jgig	71	6	level	level	NN
cord-252671-uf96jgig	71	7	of	of	IN
cord-252671-uf96jgig	71	8	M	M	NNP
cord-252671-uf96jgig	71	9	-	-	HYPH
cord-252671-uf96jgig	71	10	mediated	mediate	VBN
cord-252671-uf96jgig	71	11	IFN-	IFN-	NNP
cord-252671-uf96jgig	71	12	␤	␤	CD
cord-252671-uf96jgig	71	13	induction	induction	NN
cord-252671-uf96jgig	71	14	,	,	,
cord-252671-uf96jgig	71	15	specific	specific	JJ
cord-252671-uf96jgig	71	16	siR	siR	NNP
cord-252671-uf96jgig	71	17	-	-	HYPH
cord-252671-uf96jgig	71	18	NAs	NAs	NNPS
cord-252671-uf96jgig	71	19	that	that	WDT
cord-252671-uf96jgig	71	20	selectively	selectively	RB
cord-252671-uf96jgig	71	21	targeted	target	VBD
cord-252671-uf96jgig	71	22	either	either	CC
cord-252671-uf96jgig	71	23	TBK1	TBK1	NNP
cord-252671-uf96jgig	72	1	(	(	-LRB-
cord-252671-uf96jgig	72	2	Fig	Fig	NNP
cord-252671-uf96jgig	72	3	.	.	.
cord-252671-uf96jgig	72	4	2B	2B	NNP
cord-252671-uf96jgig	72	5	and	and	CC
cord-252671-uf96jgig	72	6	C	C	NNP
cord-252671-uf96jgig	72	7	)	)	-RRB-
cord-252671-uf96jgig	72	8	or	or	CC
cord-252671-uf96jgig	72	9	IRF3	IRF3	NNP
cord-252671-uf96jgig	73	1	(	(	-LRB-
cord-252671-uf96jgig	73	2	Fig	Fig	NNP
cord-252671-uf96jgig	73	3	.	.	.
cord-252671-uf96jgig	73	4	2E	2E	NNP
cord-252671-uf96jgig	73	5	and	and	CC
cord-252671-uf96jgig	73	6	F	F	NNP
cord-252671-uf96jgig	73	7	)	)	-RRB-
cord-252671-uf96jgig	73	8	mRNAs	mRNAs	NNP
cord-252671-uf96jgig	73	9	were	be	VBD
cord-252671-uf96jgig	73	10	generated	generate	VBN
cord-252671-uf96jgig	73	11	.	.	.
cord-252671-uf96jgig	74	1	Individually	individually	RB
cord-252671-uf96jgig	74	2	diminishing	diminish	VBG
cord-252671-uf96jgig	74	3	either	either	CC
cord-252671-uf96jgig	74	4	TBK1	TBK1	NNP
cord-252671-uf96jgig	74	5	or	or	CC
cord-252671-uf96jgig	74	6	IRF3	IRF3	NNP
cord-252671-uf96jgig	74	7	mRNA	mRNA	NNP
cord-252671-uf96jgig	74	8	expression	expression	NN
cord-252671-uf96jgig	74	9	by	by	IN
cord-252671-uf96jgig	75	1	siTBK1	siTBK1	NNP
cord-252671-uf96jgig	75	2	or	or	CC
cord-252671-uf96jgig	75	3	siIRF3	siIRF3	NNP
cord-252671-uf96jgig	75	4	sig	sig	VB
cord-252671-uf96jgig	75	5	-	-	HYPH
cord-252671-uf96jgig	75	6	nificantly	nificantly	RB
cord-252671-uf96jgig	75	7	reversed	reverse	VBN
cord-252671-uf96jgig	75	8	M	M	NNP
cord-252671-uf96jgig	75	9	-	-	HYPH
cord-252671-uf96jgig	75	10	mediated	mediate	VBN
cord-252671-uf96jgig	75	11	IFN-	IFN-	NNP
cord-252671-uf96jgig	75	12	␤	␤	``
cord-252671-uf96jgig	75	13	induction	induction	NN
cord-252671-uf96jgig	75	14	(	(	-LRB-
cord-252671-uf96jgig	75	15	Fig	fig	NN
cord-252671-uf96jgig	75	16	.	.	.
cord-252671-uf96jgig	76	1	2D	2D	NNP
cord-252671-uf96jgig	76	2	and	and	CC
cord-252671-uf96jgig	76	3	G	G	NNP
cord-252671-uf96jgig	76	4	,	,	,
cord-252671-uf96jgig	76	5	respectively	respectively	RB
cord-252671-uf96jgig	76	6	)	)	-RRB-
cord-252671-uf96jgig	76	7	,	,	,
cord-252671-uf96jgig	76	8	indicating	indicate	VBG
cord-252671-uf96jgig	76	9	that	that	IN
cord-252671-uf96jgig	76	10	M	M	NNP
cord-252671-uf96jgig	76	11	-	-	HYPH
cord-252671-uf96jgig	76	12	mediated	mediate	VBN
cord-252671-uf96jgig	76	13	IFN-	IFN-	NNP
cord-252671-uf96jgig	76	14	␤	␤	``
cord-252671-uf96jgig	76	15	induction	induction	NN
cord-252671-uf96jgig	76	16	functions	function	NNS
cord-252671-uf96jgig	76	17	at	at	IN
cord-252671-uf96jgig	76	18	a	a	DT
cord-252671-uf96jgig	76	19	level	level	NN
cord-252671-uf96jgig	76	20	at	at	IN
cord-252671-uf96jgig	76	21	or	or	CC
cord-252671-uf96jgig	76	22	above	above	IN
cord-252671-uf96jgig	76	23	the	the	DT
cord-252671-uf96jgig	76	24	signaling	signaling	NN
cord-252671-uf96jgig	76	25	molecule	molecule	NN
cord-252671-uf96jgig	76	26	TBK1	TBK1	NNP
cord-252671-uf96jgig	76	27	.	.	.
cord-252671-uf96jgig	77	1	The	the	DT
cord-252671-uf96jgig	77	2	SARS	SARS	NNP
cord-252671-uf96jgig	77	3	-	-	HYPH
cord-252671-uf96jgig	77	4	CoV	CoV	NNP
cord-252671-uf96jgig	77	5	M	M	NNP
cord-252671-uf96jgig	77	6	gene	gene	NN
cord-252671-uf96jgig	77	7	product	product	NN
cord-252671-uf96jgig	77	8	preferentially	preferentially	RB
cord-252671-uf96jgig	77	9	activates	activate	VBZ
cord-252671-uf96jgig	77	10	IFN-	IFN-	NNP
cord-252671-uf96jgig	77	11	␤	␤	CD
cord-252671-uf96jgig	77	12	production	production	NN
cord-252671-uf96jgig	77	13	through	through	IN
cord-252671-uf96jgig	77	14	Toll	toll	NN
cord-252671-uf96jgig	77	15	-	-	HYPH
cord-252671-uf96jgig	77	16	like	like	JJ
cord-252671-uf96jgig	77	17	-	-	HYPH
cord-252671-uf96jgig	77	18	receptor	receptor	NN
cord-252671-uf96jgig	77	19	-	-	HYPH
cord-252671-uf96jgig	77	20	related	relate	VBN
cord-252671-uf96jgig	77	21	signaling	signal	VBG
cord-252671-uf96jgig	77	22	pathways	pathway	NNS
cord-252671-uf96jgig	77	23	in	in	IN
cord-252671-uf96jgig	77	24	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	77	25	cells	cell	NNS
cord-252671-uf96jgig	77	26	.	.	.
cord-252671-uf96jgig	78	1	RLR	RLR	NNP
cord-252671-uf96jgig	78	2	and	and	CC
cord-252671-uf96jgig	78	3	TLR	TLR	NNP
cord-252671-uf96jgig	78	4	are	be	VBP
cord-252671-uf96jgig	78	5	two	two	CD
cord-252671-uf96jgig	78	6	main	main	JJ
cord-252671-uf96jgig	78	7	PRRs	prr	NNS
cord-252671-uf96jgig	78	8	HEK293	HEK293	NNP
cord-252671-uf96jgig	78	9	T	t	NN
cord-252671-uf96jgig	78	10	cells	cell	NNS
cord-252671-uf96jgig	78	11	.	.	.
cord-252671-uf96jgig	79	1	After	after	IN
cord-252671-uf96jgig	79	2	0	0	CD
cord-252671-uf96jgig	79	3	,	,	,
cord-252671-uf96jgig	79	4	6	6	CD
cord-252671-uf96jgig	79	5	,	,	,
cord-252671-uf96jgig	79	6	12	12	CD
cord-252671-uf96jgig	79	7	,	,	,
cord-252671-uf96jgig	79	8	and	and	CC
cord-252671-uf96jgig	79	9	24	24	CD
cord-252671-uf96jgig	79	10	h	h	NN
cord-252671-uf96jgig	79	11	of	of	IN
cord-252671-uf96jgig	79	12	transfection	transfection	NN
cord-252671-uf96jgig	79	13	,	,	,
cord-252671-uf96jgig	79	14	dual	dual	JJ
cord-252671-uf96jgig	79	15	-	-	HYPH
cord-252671-uf96jgig	79	16	luciferase	luciferase	NN
cord-252671-uf96jgig	79	17	assays	assay	NNS
cord-252671-uf96jgig	79	18	were	be	VBD
cord-252671-uf96jgig	79	19	performed	perform	VBN
cord-252671-uf96jgig	79	20	to	to	TO
cord-252671-uf96jgig	79	21	detect	detect	VB
cord-252671-uf96jgig	79	22	IFN-	IFN-	NNP
cord-252671-uf96jgig	79	23	␤	␤	DT
cord-252671-uf96jgig	79	24	expression	expression	NN
cord-252671-uf96jgig	79	25	.	.	.
cord-252671-uf96jgig	80	1	Each	each	DT
cord-252671-uf96jgig	80	2	value	value	NN
cord-252671-uf96jgig	80	3	represents	represent	VBZ
cord-252671-uf96jgig	80	4	the	the	DT
cord-252671-uf96jgig	80	5	mean	mean	JJ
cord-252671-uf96jgig	80	6	Ϯ	Ϯ	NNP
cord-252671-uf96jgig	80	7	standard	standard	JJ
cord-252671-uf96jgig	80	8	deviation	deviation	NN
cord-252671-uf96jgig	80	9	from	from	IN
cord-252671-uf96jgig	80	10	three	three	CD
cord-252671-uf96jgig	80	11	independent	independent	JJ
cord-252671-uf96jgig	80	12	tests	test	NNS
cord-252671-uf96jgig	80	13	.	.	.
cord-252671-uf96jgig	81	1	*	*	NFP
cord-252671-uf96jgig	81	2	,	,	,
cord-252671-uf96jgig	81	3	P	p	NN
cord-252671-uf96jgig	81	4	Յ	յ	CD
cord-252671-uf96jgig	81	5	0.05	0.05	CD
cord-252671-uf96jgig	81	6	;	;	.
cord-252671-uf96jgig	82	1	*	*	NFP
cord-252671-uf96jgig	82	2	*	*	NFP
cord-252671-uf96jgig	82	3	,	,	,
cord-252671-uf96jgig	82	4	P	p	NN
cord-252671-uf96jgig	82	5	Յ	յ	CD
cord-252671-uf96jgig	82	6	0.01	0.01	CD
cord-252671-uf96jgig	82	7	.	.	.
cord-252671-uf96jgig	83	1	In	in	IN
cord-252671-uf96jgig	83	2	all	all	DT
cord-252671-uf96jgig	83	3	data	datum	NNS
cord-252671-uf96jgig	83	4	presented	present	VBN
cord-252671-uf96jgig	83	5	above	above	RB
cord-252671-uf96jgig	83	6	,	,	,
cord-252671-uf96jgig	83	7	the	the	DT
cord-252671-uf96jgig	83	8	relative	relative	JJ
cord-252671-uf96jgig	83	9	luciferase	luciferase	NN
cord-252671-uf96jgig	83	10	activity	activity	NN
cord-252671-uf96jgig	83	11	was	be	VBD
cord-252671-uf96jgig	83	12	determined	determine	VBN
cord-252671-uf96jgig	83	13	as	as	IN
cord-252671-uf96jgig	83	14	firefly	firefly	NN
cord-252671-uf96jgig	83	15	luciferase	luciferase	NN
cord-252671-uf96jgig	83	16	activity	activity	NN
cord-252671-uf96jgig	83	17	divided	divide	VBN
cord-252671-uf96jgig	83	18	by	by	IN
cord-252671-uf96jgig	83	19	Renilla	Renilla	NNP
cord-252671-uf96jgig	83	20	luciferase	luciferase	NN
cord-252671-uf96jgig	83	21	activity	activity	NN
cord-252671-uf96jgig	83	22	.	.	.
cord-252671-uf96jgig	84	1	The	the	DT
cord-252671-uf96jgig	84	2	effect	effect	NN
cord-252671-uf96jgig	84	3	of	of	IN
cord-252671-uf96jgig	84	4	TBK1	TBK1	NNP
cord-252671-uf96jgig	84	5	siRNA	siRNA	NNP
cord-252671-uf96jgig	84	6	(	(	-LRB-
cord-252671-uf96jgig	84	7	siTBK1	siTBK1	NNP
cord-252671-uf96jgig	84	8	)	)	-RRB-
cord-252671-uf96jgig	84	9	on	on	IN
cord-252671-uf96jgig	84	10	the	the	DT
cord-252671-uf96jgig	84	11	expression	expression	NN
cord-252671-uf96jgig	84	12	of	of	IN
cord-252671-uf96jgig	84	13	endogenous	endogenous	JJ
cord-252671-uf96jgig	84	14	TBK1	TBK1	NNP
cord-252671-uf96jgig	84	15	by	by	IN
cord-252671-uf96jgig	84	16	semiquantitative	semiquantitative	NNP
cord-252671-uf96jgig	84	17	RT	RT	NNP
cord-252671-uf96jgig	84	18	-	-	HYPH
cord-252671-uf96jgig	84	19	PCR	PCR	NNP
cord-252671-uf96jgig	84	20	.	.	.
cord-252671-uf96jgig	85	1	The	the	DT
cord-252671-uf96jgig	85	2	increased	increase	VBN
cord-252671-uf96jgig	85	3	doses	dose	NNS
cord-252671-uf96jgig	85	4	of	of	IN
cord-252671-uf96jgig	85	5	pBS	pBS	NNP
cord-252671-uf96jgig	85	6	/	/	SYM
cord-252671-uf96jgig	85	7	U6-siTBK1	U6-siTBK1	NNP
cord-252671-uf96jgig	85	8	plasmid	plasmid	NN
cord-252671-uf96jgig	85	9	DNAs	dna	NNS
cord-252671-uf96jgig	85	10	(	(	-LRB-
cord-252671-uf96jgig	85	11	0	0	CD
cord-252671-uf96jgig	85	12	,	,	,
cord-252671-uf96jgig	85	13	0.5	0.5	CD
cord-252671-uf96jgig	85	14	,	,	,
cord-252671-uf96jgig	85	15	and	and	CC
cord-252671-uf96jgig	85	16	2	2	CD
cord-252671-uf96jgig	85	17	g	g	NN
cord-252671-uf96jgig	85	18	)	)	-RRB-
cord-252671-uf96jgig	85	19	were	be	VBD
cord-252671-uf96jgig	85	20	transiently	transiently	RB
cord-252671-uf96jgig	85	21	transfected	transfecte	VBN
cord-252671-uf96jgig	85	22	into	into	IN
cord-252671-uf96jgig	85	23	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	85	24	cells	cell	NNS
cord-252671-uf96jgig	85	25	.	.	.
cord-252671-uf96jgig	86	1	Total	total	JJ
cord-252671-uf96jgig	86	2	RNAs	rna	NNS
cord-252671-uf96jgig	86	3	or	or	CC
cord-252671-uf96jgig	86	4	whole	whole	JJ
cord-252671-uf96jgig	86	5	-	-	HYPH
cord-252671-uf96jgig	86	6	cell	cell	NN
cord-252671-uf96jgig	86	7	lysates	lysate	NNS
cord-252671-uf96jgig	86	8	were	be	VBD
cord-252671-uf96jgig	86	9	isolated	isolate	VBN
cord-252671-uf96jgig	86	10	or	or	CC
cord-252671-uf96jgig	86	11	harvested	harvest	VBN
cord-252671-uf96jgig	86	12	at	at	IN
cord-252671-uf96jgig	86	13	48	48	CD
cord-252671-uf96jgig	86	14	h	h	NN
cord-252671-uf96jgig	86	15	posttransfection	posttransfection	NN
cord-252671-uf96jgig	86	16	.	.	.
cord-252671-uf96jgig	87	1	One	one	CD
cord-252671-uf96jgig	87	2	-	-	HYPH
cord-252671-uf96jgig	87	3	step	step	NN
cord-252671-uf96jgig	87	4	RT	RT	NNP
cord-252671-uf96jgig	87	5	-	-	HYPH
cord-252671-uf96jgig	87	6	PCR	PCR	NNP
cord-252671-uf96jgig	87	7	(	(	-LRB-
cord-252671-uf96jgig	87	8	RT	RT	NNP
cord-252671-uf96jgig	87	9	)	)	-RRB-
cord-252671-uf96jgig	87	10	was	be	VBD
cord-252671-uf96jgig	87	11	conducted	conduct	VBN
cord-252671-uf96jgig	87	12	to	to	TO
cord-252671-uf96jgig	87	13	detect	detect	VB
cord-252671-uf96jgig	87	14	the	the	DT
cord-252671-uf96jgig	87	15	TBK1	TBK1	NNP
cord-252671-uf96jgig	87	16	mRNA	mRNA	NNP
cord-252671-uf96jgig	87	17	expression	expression	NN
cord-252671-uf96jgig	87	18	with	with	IN
cord-252671-uf96jgig	87	19	specific	specific	JJ
cord-252671-uf96jgig	87	20	primers	primer	NNS
cord-252671-uf96jgig	87	21	(	(	-LRB-
cord-252671-uf96jgig	87	22	upper	upper	JJ
cord-252671-uf96jgig	87	23	panel	panel	NN
cord-252671-uf96jgig	87	24	)	)	-RRB-
cord-252671-uf96jgig	87	25	,	,	,
cord-252671-uf96jgig	87	26	while	while	IN
cord-252671-uf96jgig	87	27	Western	western	JJ
cord-252671-uf96jgig	87	28	blotting	blotting	NN
cord-252671-uf96jgig	87	29	(	(	-LRB-
cord-252671-uf96jgig	87	30	WB	WB	NNP
cord-252671-uf96jgig	87	31	)	)	-RRB-
cord-252671-uf96jgig	87	32	was	be	VBD
cord-252671-uf96jgig	87	33	performed	perform	VBN
cord-252671-uf96jgig	87	34	to	to	TO
cord-252671-uf96jgig	87	35	detect	detect	VB
cord-252671-uf96jgig	87	36	TBK1	TBK1	NNP
cord-252671-uf96jgig	87	37	protein	protein	NN
cord-252671-uf96jgig	87	38	expression	expression	NN
cord-252671-uf96jgig	87	39	using	use	VBG
cord-252671-uf96jgig	87	40	specific	specific	JJ
cord-252671-uf96jgig	87	41	anti	anti	JJ
cord-252671-uf96jgig	87	42	-	-	JJ
cord-252671-uf96jgig	87	43	TBK1	tbk1	JJ
cord-252671-uf96jgig	87	44	antibody	antibody	NN
cord-252671-uf96jgig	87	45	(	(	-LRB-
cord-252671-uf96jgig	87	46	lower	low	JJR
cord-252671-uf96jgig	87	47	panel	panel	NN
cord-252671-uf96jgig	87	48	)	)	-RRB-
cord-252671-uf96jgig	87	49	.	.	.
cord-252671-uf96jgig	88	1	The	the	DT
cord-252671-uf96jgig	88	2	expression	expression	NN
cord-252671-uf96jgig	88	3	of	of	IN
cord-252671-uf96jgig	88	4	␤	␤	NNP
cord-252671-uf96jgig	88	5	-actin	-actin	NNP
cord-252671-uf96jgig	88	6	served	serve	VBD
cord-252671-uf96jgig	88	7	as	as	IN
cord-252671-uf96jgig	88	8	a	a	DT
cord-252671-uf96jgig	88	9	loading	loading	NN
cord-252671-uf96jgig	88	10	control	control	NN
cord-252671-uf96jgig	88	11	.	.	.
cord-252671-uf96jgig	89	1	The	the	DT
cord-252671-uf96jgig	89	2	relative	relative	JJ
cord-252671-uf96jgig	89	3	band	band	NN
cord-252671-uf96jgig	89	4	intensity	intensity	NN
cord-252671-uf96jgig	89	5	was	be	VBD
cord-252671-uf96jgig	89	6	quantitated	quantitate	VBN
cord-252671-uf96jgig	89	7	with	with	IN
cord-252671-uf96jgig	89	8	the	the	DT
cord-252671-uf96jgig	89	9	Image	Image	NNP
cord-252671-uf96jgig	89	10	J	J	NNP
cord-252671-uf96jgig	89	11	program	program	NN
cord-252671-uf96jgig	89	12	in	in	IN
cord-252671-uf96jgig	89	13	comparison	comparison	NN
cord-252671-uf96jgig	89	14	with	with	IN
cord-252671-uf96jgig	89	15	the	the	DT
cord-252671-uf96jgig	89	16	␤	␤	NNP
cord-252671-uf96jgig	89	17	-actin	-actin	NNP
cord-252671-uf96jgig	89	18	control	control	NN
cord-252671-uf96jgig	89	19	.	.	.
cord-252671-uf96jgig	90	1	The	the	DT
cord-252671-uf96jgig	90	2	result	result	NN
cord-252671-uf96jgig	90	3	is	be	VBZ
cord-252671-uf96jgig	90	4	representative	representative	NN
cord-252671-uf96jgig	90	5	of	of	IN
cord-252671-uf96jgig	90	6	at	at	RB
cord-252671-uf96jgig	90	7	least	least	JJS
cord-252671-uf96jgig	90	8	2	2	CD
cord-252671-uf96jgig	90	9	identical	identical	JJ
cord-252671-uf96jgig	90	10	experiments	experiment	NNS
cord-252671-uf96jgig	90	11	.	.	.
cord-252671-uf96jgig	91	1	(	(	-LRB-
cord-252671-uf96jgig	91	2	C	C	NNP
cord-252671-uf96jgig	91	3	)	)	-RRB-
cord-252671-uf96jgig	91	4	Effect	Effect	NNP
cord-252671-uf96jgig	91	5	of	of	IN
cord-252671-uf96jgig	91	6	siTBK1	siTBK1	NNP
cord-252671-uf96jgig	91	7	on	on	IN
cord-252671-uf96jgig	91	8	the	the	DT
cord-252671-uf96jgig	91	9	expression	expression	NN
cord-252671-uf96jgig	91	10	of	of	IN
cord-252671-uf96jgig	91	11	TBK1	TBK1	NNP
cord-252671-uf96jgig	91	12	mRNAs	mRNAs	NNPS
cord-252671-uf96jgig	91	13	by	by	IN
cord-252671-uf96jgig	91	14	real	real	JJ
cord-252671-uf96jgig	91	15	-	-	HYPH
cord-252671-uf96jgig	91	16	time	time	NN
cord-252671-uf96jgig	91	17	qRT	qRT	NNP
cord-252671-uf96jgig	91	18	-	-	HYPH
cord-252671-uf96jgig	91	19	PCR	PCR	NNP
cord-252671-uf96jgig	91	20	analysis	analysis	NN
cord-252671-uf96jgig	91	21	.	.	.
cord-252671-uf96jgig	92	1	Total	total	JJ
cord-252671-uf96jgig	92	2	RNAs	rna	NNS
cord-252671-uf96jgig	92	3	isolated	isolate	VBN
cord-252671-uf96jgig	92	4	in	in	IN
cord-252671-uf96jgig	92	5	panel	panel	NN
cord-252671-uf96jgig	92	6	B	B	NNP
cord-252671-uf96jgig	92	7	were	be	VBD
cord-252671-uf96jgig	92	8	subjected	subject	VBN
cord-252671-uf96jgig	92	9	to	to	IN
cord-252671-uf96jgig	92	10	qRT	qRT	NNP
cord-252671-uf96jgig	92	11	-	-	HYPH
cord-252671-uf96jgig	92	12	PCR	PCR	NNP
cord-252671-uf96jgig	92	13	analysis	analysis	NN
cord-252671-uf96jgig	92	14	using	use	VBG
cord-252671-uf96jgig	92	15	specific	specific	JJ
cord-252671-uf96jgig	92	16	TBK1	TBK1	NNP
cord-252671-uf96jgig	92	17	primers	primer	NNS
cord-252671-uf96jgig	92	18	.	.	.
cord-252671-uf96jgig	93	1	Each	each	DT
cord-252671-uf96jgig	93	2	value	value	NN
cord-252671-uf96jgig	93	3	represents	represent	VBZ
cord-252671-uf96jgig	93	4	the	the	DT
cord-252671-uf96jgig	93	5	mean	mean	JJ
cord-252671-uf96jgig	93	6	Ϯ	Ϯ	NNP
cord-252671-uf96jgig	93	7	standard	standard	JJ
cord-252671-uf96jgig	93	8	deviation	deviation	NN
cord-252671-uf96jgig	93	9	from	from	IN
cord-252671-uf96jgig	93	10	three	three	CD
cord-252671-uf96jgig	93	11	reactions	reaction	NNS
cord-252671-uf96jgig	93	12	.	.	.
cord-252671-uf96jgig	94	1	The	the	DT
cord-252671-uf96jgig	94	2	result	result	NN
cord-252671-uf96jgig	94	3	is	be	VBZ
cord-252671-uf96jgig	94	4	representative	representative	NN
cord-252671-uf96jgig	94	5	of	of	IN
cord-252671-uf96jgig	94	6	at	at	RB
cord-252671-uf96jgig	94	7	least	least	JJS
cord-252671-uf96jgig	94	8	2	2	CD
cord-252671-uf96jgig	94	9	identical	identical	JJ
cord-252671-uf96jgig	94	10	experiments	experiment	NNS
cord-252671-uf96jgig	94	11	.	.	.
cord-252671-uf96jgig	95	1	(	(	-LRB-
cord-252671-uf96jgig	95	2	D	D	NNP
cord-252671-uf96jgig	95	3	)	)	-RRB-
cord-252671-uf96jgig	95	4	Effect	Effect	NNP
cord-252671-uf96jgig	95	5	of	of	IN
cord-252671-uf96jgig	95	6	siTBK1	siTBK1	NNP
cord-252671-uf96jgig	95	7	on	on	IN
cord-252671-uf96jgig	95	8	M	M	NNP
cord-252671-uf96jgig	95	9	-	-	HYPH
cord-252671-uf96jgig	95	10	mediated	mediate	VBN
cord-252671-uf96jgig	95	11	IFN-	IFN-	NNP
cord-252671-uf96jgig	95	12	␤	␤	CD
cord-252671-uf96jgig	95	13	induction	induction	NN
cord-252671-uf96jgig	95	14	.	.	.
cord-252671-uf96jgig	96	1	Plasmid	Plasmid	NNP
cord-252671-uf96jgig	96	2	pGL3-IFN-	pGL3-IFN-	NNP
cord-252671-uf96jgig	96	3	␤	␤	CD
cord-252671-uf96jgig	96	4	-luc	-luc	CD
cord-252671-uf96jgig	96	5	reporter	reporter	NN
cord-252671-uf96jgig	96	6	was	be	VBD
cord-252671-uf96jgig	96	7	cotransfected	cotransfecte	VBN
cord-252671-uf96jgig	96	8	with	with	IN
cord-252671-uf96jgig	96	9	2	2	CD
cord-252671-uf96jgig	96	10	g	g	NN
cord-252671-uf96jgig	96	11	of	of	IN
cord-252671-uf96jgig	96	12	pCMV	pcmv	NN
cord-252671-uf96jgig	96	13	-	-	HYPH
cord-252671-uf96jgig	96	14	Myc	Myc	NNP
cord-252671-uf96jgig	96	15	-	-	HYPH
cord-252671-uf96jgig	96	16	M	M	NNP
cord-252671-uf96jgig	96	17	or	or	CC
cord-252671-uf96jgig	96	18	2	2	CD
cord-252671-uf96jgig	96	19	g	g	NN
cord-252671-uf96jgig	96	20	of	of	IN
cord-252671-uf96jgig	96	21	pCMV	pcmv	NN
cord-252671-uf96jgig	96	22	-	-	HYPH
cord-252671-uf96jgig	96	23	Myc	Myc	NNP
cord-252671-uf96jgig	96	24	-	-	HYPH
cord-252671-uf96jgig	96	25	M	M	NNP
cord-252671-uf96jgig	96	26	plus	plus	CC
cord-252671-uf96jgig	96	27	increased	increase	VBN
cord-252671-uf96jgig	96	28	doses	dose	NNS
cord-252671-uf96jgig	96	29	of	of	IN
cord-252671-uf96jgig	96	30	siTBK1	siTBK1	NNP
cord-252671-uf96jgig	96	31	(	(	-LRB-
cord-252671-uf96jgig	96	32	0	0	NFP
cord-252671-uf96jgig	96	33	,	,	,
cord-252671-uf96jgig	96	34	0.5	0.5	CD
cord-252671-uf96jgig	96	35	,	,	,
cord-252671-uf96jgig	96	36	and	and	CC
cord-252671-uf96jgig	96	37	2	2	CD
cord-252671-uf96jgig	96	38	g	g	NN
cord-252671-uf96jgig	96	39	)	)	-RRB-
cord-252671-uf96jgig	96	40	into	into	IN
cord-252671-uf96jgig	96	41	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	96	42	cells	cell	NNS
cord-252671-uf96jgig	96	43	grown	grow	VBN
cord-252671-uf96jgig	96	44	on	on	IN
cord-252671-uf96jgig	96	45	a	a	DT
cord-252671-uf96jgig	96	46	12-well	12-well	CD
cord-252671-uf96jgig	96	47	plate	plate	NN
cord-252671-uf96jgig	96	48	.	.	.
cord-252671-uf96jgig	97	1	At	at	IN
cord-252671-uf96jgig	97	2	48	48	CD
cord-252671-uf96jgig	97	3	h	h	NN
cord-252671-uf96jgig	97	4	posttransfection	posttransfection	NN
cord-252671-uf96jgig	97	5	,	,	,
cord-252671-uf96jgig	97	6	the	the	DT
cord-252671-uf96jgig	97	7	dual	dual	JJ
cord-252671-uf96jgig	97	8	-	-	HYPH
cord-252671-uf96jgig	97	9	luciferase	luciferase	NN
cord-252671-uf96jgig	97	10	assay	assay	NN
cord-252671-uf96jgig	97	11	was	be	VBD
cord-252671-uf96jgig	97	12	conducted	conduct	VBN
cord-252671-uf96jgig	97	13	to	to	TO
cord-252671-uf96jgig	97	14	assay	assay	VB
cord-252671-uf96jgig	97	15	fold	fold	VB
cord-252671-uf96jgig	97	16	induction	induction	NN
cord-252671-uf96jgig	97	17	of	of	IN
cord-252671-uf96jgig	97	18	M	M	NNP
cord-252671-uf96jgig	97	19	-	-	HYPH
cord-252671-uf96jgig	97	20	mediated	mediate	VBN
cord-252671-uf96jgig	97	21	IFN-	IFN-	NNP
cord-252671-uf96jgig	97	22	␤	␤	DT
cord-252671-uf96jgig	97	23	expression	expression	NN
cord-252671-uf96jgig	97	24	.	.	.
cord-252671-uf96jgig	98	1	Each	each	DT
cord-252671-uf96jgig	98	2	value	value	NN
cord-252671-uf96jgig	98	3	represents	represent	VBZ
cord-252671-uf96jgig	98	4	the	the	DT
cord-252671-uf96jgig	98	5	mean	mean	JJ
cord-252671-uf96jgig	98	6	Ϯ	Ϯ	NNP
cord-252671-uf96jgig	98	7	standard	standard	JJ
cord-252671-uf96jgig	98	8	deviation	deviation	NN
cord-252671-uf96jgig	98	9	from	from	IN
cord-252671-uf96jgig	98	10	three	three	CD
cord-252671-uf96jgig	98	11	independent	independent	JJ
cord-252671-uf96jgig	98	12	tests	test	NNS
cord-252671-uf96jgig	98	13	.	.	.
cord-252671-uf96jgig	99	1	(	(	-LRB-
cord-252671-uf96jgig	99	2	E	e	NN
cord-252671-uf96jgig	99	3	)	)	-RRB-
cord-252671-uf96jgig	99	4	Effect	Effect	NNP
cord-252671-uf96jgig	99	5	of	of	IN
cord-252671-uf96jgig	99	6	IRF3	IRF3	NNP
cord-252671-uf96jgig	99	7	siRNA	siRNA	NNP
cord-252671-uf96jgig	99	8	(	(	-LRB-
cord-252671-uf96jgig	99	9	siIRF3	siirf3	NN
cord-252671-uf96jgig	99	10	)	)	-RRB-
cord-252671-uf96jgig	100	1	on	on	IN
cord-252671-uf96jgig	100	2	expression	expression	NN
cord-252671-uf96jgig	100	3	of	of	IN
cord-252671-uf96jgig	100	4	endogenous	endogenous	JJ
cord-252671-uf96jgig	100	5	IFR3	IFR3	NNP
cord-252671-uf96jgig	100	6	by	by	IN
cord-252671-uf96jgig	100	7	semiquantitative	semiquantitative	JJ
cord-252671-uf96jgig	100	8	RT	RT	NNP
cord-252671-uf96jgig	100	9	-	-	HYPH
cord-252671-uf96jgig	100	10	PCR	PCR	NNP
cord-252671-uf96jgig	100	11	.	.	.
cord-252671-uf96jgig	101	1	The	the	DT
cord-252671-uf96jgig	101	2	increased	increase	VBN
cord-252671-uf96jgig	101	3	doses	dose	NNS
cord-252671-uf96jgig	101	4	of	of	IN
cord-252671-uf96jgig	101	5	pBS	pBS	NNP
cord-252671-uf96jgig	101	6	/	/	SYM
cord-252671-uf96jgig	101	7	U6-siIRF3	U6-siIRF3	NNP
cord-252671-uf96jgig	101	8	plasmid	plasmid	NN
cord-252671-uf96jgig	101	9	DNAs	dna	NNS
cord-252671-uf96jgig	101	10	(	(	-LRB-
cord-252671-uf96jgig	101	11	0	0	CD
cord-252671-uf96jgig	101	12	,	,	,
cord-252671-uf96jgig	101	13	0.5	0.5	CD
cord-252671-uf96jgig	101	14	,	,	,
cord-252671-uf96jgig	101	15	and	and	CC
cord-252671-uf96jgig	101	16	2	2	CD
cord-252671-uf96jgig	101	17	g	g	NN
cord-252671-uf96jgig	101	18	)	)	-RRB-
cord-252671-uf96jgig	101	19	were	be	VBD
cord-252671-uf96jgig	101	20	transiently	transiently	RB
cord-252671-uf96jgig	101	21	transfected	transfecte	VBN
cord-252671-uf96jgig	101	22	into	into	IN
cord-252671-uf96jgig	101	23	HEK293	HEK293	NNP
cord-252671-uf96jgig	101	24	T	T	NNP
cord-252671-uf96jgig	101	25	cells	cell	NNS
cord-252671-uf96jgig	101	26	.	.	.
cord-252671-uf96jgig	102	1	Total	total	JJ
cord-252671-uf96jgig	102	2	RNAs	rna	NNS
cord-252671-uf96jgig	102	3	or	or	CC
cord-252671-uf96jgig	102	4	whole	whole	JJ
cord-252671-uf96jgig	102	5	-	-	HYPH
cord-252671-uf96jgig	102	6	cell	cell	NN
cord-252671-uf96jgig	102	7	lysates	lysate	NNS
cord-252671-uf96jgig	102	8	were	be	VBD
cord-252671-uf96jgig	102	9	isolated	isolate	VBN
cord-252671-uf96jgig	102	10	or	or	CC
cord-252671-uf96jgig	102	11	harvested	harvest	VBN
cord-252671-uf96jgig	102	12	at	at	IN
cord-252671-uf96jgig	102	13	48	48	CD
cord-252671-uf96jgig	102	14	h	h	NN
cord-252671-uf96jgig	102	15	posttransfection	posttransfection	NN
cord-252671-uf96jgig	102	16	.	.	.
cord-252671-uf96jgig	103	1	One	one	CD
cord-252671-uf96jgig	103	2	-	-	HYPH
cord-252671-uf96jgig	103	3	step	step	NN
cord-252671-uf96jgig	103	4	RT	RT	NNP
cord-252671-uf96jgig	103	5	-	-	HYPH
cord-252671-uf96jgig	103	6	PCR	PCR	NNP
cord-252671-uf96jgig	103	7	was	be	VBD
cord-252671-uf96jgig	103	8	conducted	conduct	VBN
cord-252671-uf96jgig	103	9	to	to	TO
cord-252671-uf96jgig	103	10	detect	detect	VB
cord-252671-uf96jgig	103	11	IRF3	IRF3	NNP
cord-252671-uf96jgig	103	12	expression	expression	NN
cord-252671-uf96jgig	103	13	with	with	IN
cord-252671-uf96jgig	103	14	specific	specific	JJ
cord-252671-uf96jgig	103	15	primers	primer	NNS
cord-252671-uf96jgig	103	16	(	(	-LRB-
cord-252671-uf96jgig	103	17	upper	upper	JJ
cord-252671-uf96jgig	103	18	panel	panel	NN
cord-252671-uf96jgig	103	19	)	)	-RRB-
cord-252671-uf96jgig	103	20	,	,	,
cord-252671-uf96jgig	103	21	while	while	IN
cord-252671-uf96jgig	103	22	Western	western	JJ
cord-252671-uf96jgig	103	23	blotting	blotting	NN
cord-252671-uf96jgig	103	24	was	be	VBD
cord-252671-uf96jgig	103	25	performed	perform	VBN
cord-252671-uf96jgig	103	26	to	to	TO
cord-252671-uf96jgig	103	27	detect	detect	VB
cord-252671-uf96jgig	103	28	IRF3	IRF3	NNP
cord-252671-uf96jgig	103	29	protein	protein	NN
cord-252671-uf96jgig	103	30	expression	expression	NN
cord-252671-uf96jgig	103	31	(	(	-LRB-
cord-252671-uf96jgig	103	32	lower	low	JJR
cord-252671-uf96jgig	103	33	panel	panel	NN
cord-252671-uf96jgig	103	34	)	)	-RRB-
cord-252671-uf96jgig	103	35	.	.	.
cord-252671-uf96jgig	104	1	The	the	DT
cord-252671-uf96jgig	104	2	expression	expression	NN
cord-252671-uf96jgig	104	3	of	of	IN
cord-252671-uf96jgig	104	4	␤	␤	NNP
cord-252671-uf96jgig	104	5	-actin	-actin	NNP
cord-252671-uf96jgig	104	6	served	serve	VBD
cord-252671-uf96jgig	104	7	as	as	IN
cord-252671-uf96jgig	104	8	a	a	DT
cord-252671-uf96jgig	104	9	loading	loading	NN
cord-252671-uf96jgig	104	10	control	control	NN
cord-252671-uf96jgig	104	11	.	.	.
cord-252671-uf96jgig	105	1	The	the	DT
cord-252671-uf96jgig	105	2	result	result	NN
cord-252671-uf96jgig	105	3	is	be	VBZ
cord-252671-uf96jgig	105	4	representative	representative	NN
cord-252671-uf96jgig	105	5	of	of	IN
cord-252671-uf96jgig	105	6	at	at	RB
cord-252671-uf96jgig	105	7	least	least	JJS
cord-252671-uf96jgig	105	8	2	2	CD
cord-252671-uf96jgig	105	9	identical	identical	JJ
cord-252671-uf96jgig	105	10	experiments	experiment	NNS
cord-252671-uf96jgig	105	11	.	.	.
cord-252671-uf96jgig	106	1	(	(	-LRB-
cord-252671-uf96jgig	106	2	F	F	NNP
cord-252671-uf96jgig	106	3	)	)	-RRB-
cord-252671-uf96jgig	106	4	Effect	Effect	NNP
cord-252671-uf96jgig	106	5	of	of	IN
cord-252671-uf96jgig	106	6	siIRF3	siirf3	NN
cord-252671-uf96jgig	106	7	on	on	IN
cord-252671-uf96jgig	106	8	M	M	NNP
cord-252671-uf96jgig	106	9	-	-	HYPH
cord-252671-uf96jgig	106	10	mediated	mediate	VBN
cord-252671-uf96jgig	107	1	IFN-	IFN-	NNP
cord-252671-uf96jgig	107	2	␤	␤	DT
cord-252671-uf96jgig	107	3	mRNA	mrna	NN
cord-252671-uf96jgig	107	4	expression	expression	NN
cord-252671-uf96jgig	107	5	by	by	IN
cord-252671-uf96jgig	107	6	real	real	JJ
cord-252671-uf96jgig	107	7	-	-	HYPH
cord-252671-uf96jgig	107	8	time	time	NN
cord-252671-uf96jgig	107	9	qRT	qRT	NNP
cord-252671-uf96jgig	107	10	-	-	HYPH
cord-252671-uf96jgig	107	11	PCR	PCR	NNP
cord-252671-uf96jgig	107	12	analysis	analysis	NN
cord-252671-uf96jgig	107	13	.	.	.
cord-252671-uf96jgig	108	1	Real	real	JJ
cord-252671-uf96jgig	108	2	-	-	HYPH
cord-252671-uf96jgig	108	3	time	time	NN
cord-252671-uf96jgig	108	4	qRT	qRT	NNP
cord-252671-uf96jgig	108	5	-	-	HYPH
cord-252671-uf96jgig	108	6	PCR	PCR	NNP
cord-252671-uf96jgig	108	7	was	be	VBD
cord-252671-uf96jgig	108	8	performed	perform	VBN
cord-252671-uf96jgig	108	9	to	to	TO
cord-252671-uf96jgig	108	10	detect	detect	VB
cord-252671-uf96jgig	108	11	the	the	DT
cord-252671-uf96jgig	108	12	IRF3	IRF3	NNP
cord-252671-uf96jgig	108	13	mRNA	mrna	NN
cord-252671-uf96jgig	108	14	(	(	-LRB-
cord-252671-uf96jgig	108	15	isolated	isolate	VBN
cord-252671-uf96jgig	108	16	in	in	IN
cord-252671-uf96jgig	108	17	panel	panel	NN
cord-252671-uf96jgig	108	18	E	e	NN
cord-252671-uf96jgig	108	19	)	)	-RRB-
cord-252671-uf96jgig	108	20	expression	expression	NN
cord-252671-uf96jgig	108	21	.	.	.
cord-252671-uf96jgig	109	1	Each	each	DT
cord-252671-uf96jgig	109	2	value	value	NN
cord-252671-uf96jgig	109	3	represents	represent	VBZ
cord-252671-uf96jgig	109	4	the	the	DT
cord-252671-uf96jgig	109	5	mean	mean	JJ
cord-252671-uf96jgig	109	6	Ϯ	Ϯ	NNP
cord-252671-uf96jgig	109	7	standard	standard	JJ
cord-252671-uf96jgig	109	8	deviation	deviation	NN
cord-252671-uf96jgig	109	9	from	from	IN
cord-252671-uf96jgig	109	10	three	three	CD
cord-252671-uf96jgig	109	11	reactions	reaction	NNS
cord-252671-uf96jgig	109	12	.	.	.
cord-252671-uf96jgig	110	1	The	the	DT
cord-252671-uf96jgig	110	2	result	result	NN
cord-252671-uf96jgig	110	3	is	be	VBZ
cord-252671-uf96jgig	110	4	representative	representative	NN
cord-252671-uf96jgig	110	5	of	of	IN
cord-252671-uf96jgig	110	6	at	at	RB
cord-252671-uf96jgig	110	7	least	least	JJS
cord-252671-uf96jgig	110	8	2	2	CD
cord-252671-uf96jgig	110	9	identical	identical	JJ
cord-252671-uf96jgig	110	10	experiments	experiment	NNS
cord-252671-uf96jgig	110	11	.	.	.
cord-252671-uf96jgig	111	1	(	(	-LRB-
cord-252671-uf96jgig	111	2	G	G	NNP
cord-252671-uf96jgig	111	3	)	)	-RRB-
cord-252671-uf96jgig	111	4	Effect	effect	NN
cord-252671-uf96jgig	111	5	of	of	IN
cord-252671-uf96jgig	111	6	siIRF3	siirf3	NN
cord-252671-uf96jgig	111	7	on	on	IN
cord-252671-uf96jgig	111	8	M	M	NNP
cord-252671-uf96jgig	111	9	-	-	HYPH
cord-252671-uf96jgig	111	10	mediated	mediate	VBN
cord-252671-uf96jgig	111	11	IFN-	IFN-	NNP
cord-252671-uf96jgig	111	12	␤	␤	CD
cord-252671-uf96jgig	111	13	induction	induction	NN
cord-252671-uf96jgig	111	14	by	by	IN
cord-252671-uf96jgig	111	15	luciferase	luciferase	NN
cord-252671-uf96jgig	111	16	assay	assay	NN
cord-252671-uf96jgig	111	17	.	.	.
cord-252671-uf96jgig	112	1	Plasmid	Plasmid	NNP
cord-252671-uf96jgig	112	2	pGL3-IFN-	pGL3-IFN-	NNP
cord-252671-uf96jgig	112	3	␤	␤	CD
cord-252671-uf96jgig	112	4	-luc	-luc	CD
cord-252671-uf96jgig	112	5	reporter	reporter	NN
cord-252671-uf96jgig	112	6	was	be	VBD
cord-252671-uf96jgig	112	7	cotransfected	cotransfecte	VBN
cord-252671-uf96jgig	112	8	with	with	IN
cord-252671-uf96jgig	112	9	2	2	CD
cord-252671-uf96jgig	112	10	g	g	NN
cord-252671-uf96jgig	112	11	of	of	IN
cord-252671-uf96jgig	112	12	pCMV	pcmv	NN
cord-252671-uf96jgig	112	13	-	-	HYPH
cord-252671-uf96jgig	112	14	Myc	Myc	NNP
cord-252671-uf96jgig	112	15	-	-	HYPH
cord-252671-uf96jgig	112	16	M	M	NNP
cord-252671-uf96jgig	112	17	or	or	CC
cord-252671-uf96jgig	112	18	2	2	CD
cord-252671-uf96jgig	112	19	g	g	NN
cord-252671-uf96jgig	112	20	of	of	IN
cord-252671-uf96jgig	112	21	pCMV	pcmv	NN
cord-252671-uf96jgig	112	22	-	-	HYPH
cord-252671-uf96jgig	112	23	Myc	Myc	NNP
cord-252671-uf96jgig	112	24	-	-	HYPH
cord-252671-uf96jgig	112	25	M	M	NNP
cord-252671-uf96jgig	112	26	plus	plus	CC
cord-252671-uf96jgig	112	27	increased	increase	VBN
cord-252671-uf96jgig	112	28	doses	dose	NNS
cord-252671-uf96jgig	112	29	of	of	IN
cord-252671-uf96jgig	112	30	siIRF3	siIRF3	NNS
cord-252671-uf96jgig	112	31	(	(	-LRB-
cord-252671-uf96jgig	112	32	0	0	NFP
cord-252671-uf96jgig	112	33	,	,	,
cord-252671-uf96jgig	112	34	0.5	0.5	CD
cord-252671-uf96jgig	112	35	,	,	,
cord-252671-uf96jgig	112	36	and	and	CC
cord-252671-uf96jgig	112	37	2	2	CD
cord-252671-uf96jgig	112	38	g	g	NN
cord-252671-uf96jgig	112	39	)	)	-RRB-
cord-252671-uf96jgig	112	40	into	into	IN
cord-252671-uf96jgig	112	41	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	112	42	cells	cell	NNS
cord-252671-uf96jgig	112	43	grown	grow	VBN
cord-252671-uf96jgig	112	44	on	on	IN
cord-252671-uf96jgig	112	45	a	a	DT
cord-252671-uf96jgig	112	46	12-well	12-well	CD
cord-252671-uf96jgig	112	47	plate	plate	NN
cord-252671-uf96jgig	112	48	.	.	.
cord-252671-uf96jgig	113	1	At	at	IN
cord-252671-uf96jgig	113	2	48	48	CD
cord-252671-uf96jgig	113	3	h	h	NN
cord-252671-uf96jgig	113	4	posttransfection	posttransfection	NN
cord-252671-uf96jgig	113	5	,	,	,
cord-252671-uf96jgig	113	6	the	the	DT
cord-252671-uf96jgig	113	7	dual	dual	JJ
cord-252671-uf96jgig	113	8	-	-	HYPH
cord-252671-uf96jgig	113	9	luciferase	luciferase	NN
cord-252671-uf96jgig	113	10	assay	assay	NN
cord-252671-uf96jgig	113	11	was	be	VBD
cord-252671-uf96jgig	113	12	conducted	conduct	VBN
cord-252671-uf96jgig	113	13	to	to	TO
cord-252671-uf96jgig	113	14	assay	assay	VB
cord-252671-uf96jgig	113	15	fold	fold	VB
cord-252671-uf96jgig	113	16	induction	induction	NN
cord-252671-uf96jgig	113	17	of	of	IN
cord-252671-uf96jgig	113	18	M	M	NNP
cord-252671-uf96jgig	113	19	-	-	HYPH
cord-252671-uf96jgig	113	20	mediated	mediate	VBN
cord-252671-uf96jgig	113	21	IFN-	IFN-	NNP
cord-252671-uf96jgig	113	22	␤	␤	DT
cord-252671-uf96jgig	113	23	expression	expression	NN
cord-252671-uf96jgig	113	24	.	.	.
cord-252671-uf96jgig	114	1	Each	each	DT
cord-252671-uf96jgig	114	2	value	value	NN
cord-252671-uf96jgig	114	3	represents	represent	VBZ
cord-252671-uf96jgig	114	4	the	the	DT
cord-252671-uf96jgig	114	5	mean	mean	JJ
cord-252671-uf96jgig	114	6	Ϯ	Ϯ	NNP
cord-252671-uf96jgig	114	7	standard	standard	JJ
cord-252671-uf96jgig	114	8	deviation	deviation	NN
cord-252671-uf96jgig	114	9	from	from	IN
cord-252671-uf96jgig	114	10	three	three	CD
cord-252671-uf96jgig	114	11	independent	independent	JJ
cord-252671-uf96jgig	114	12	tests	test	NNS
cord-252671-uf96jgig	114	13	.	.	.
cord-252671-uf96jgig	115	1	recognizing	recognize	VBG
cord-252671-uf96jgig	115	2	the	the	DT
cord-252671-uf96jgig	115	3	majority	majority	NN
cord-252671-uf96jgig	115	4	of	of	IN
cord-252671-uf96jgig	115	5	extracellular	extracellular	JJ
cord-252671-uf96jgig	115	6	and	and	CC
cord-252671-uf96jgig	115	7	intracellular	intracellular	JJ
cord-252671-uf96jgig	115	8	PAMPs	pamp	NNS
cord-252671-uf96jgig	115	9	.	.	.
cord-252671-uf96jgig	116	1	Upon	upon	IN
cord-252671-uf96jgig	116	2	the	the	DT
cord-252671-uf96jgig	116	3	ligation	ligation	NN
cord-252671-uf96jgig	116	4	of	of	IN
cord-252671-uf96jgig	116	5	a	a	DT
cord-252671-uf96jgig	116	6	PRR	PRR	NNP
cord-252671-uf96jgig	116	7	with	with	IN
cord-252671-uf96jgig	116	8	its	-PRON-	PRP$
cord-252671-uf96jgig	116	9	specific	specific	JJ
cord-252671-uf96jgig	116	10	PAMP	PAMP	NNP
cord-252671-uf96jgig	116	11	,	,	,
cord-252671-uf96jgig	116	12	both	both	DT
cord-252671-uf96jgig	116	13	RLR	RLR	NNP
cord-252671-uf96jgig	116	14	and	and	CC
cord-252671-uf96jgig	116	15	TLR	TLR	NNP
cord-252671-uf96jgig	116	16	pathways	pathway	NNS
cord-252671-uf96jgig	116	17	transmit	transmit	VBP
cord-252671-uf96jgig	116	18	the	the	DT
cord-252671-uf96jgig	116	19	signal	signal	NN
cord-252671-uf96jgig	116	20	to	to	IN
cord-252671-uf96jgig	116	21	a	a	DT
cord-252671-uf96jgig	116	22	common	common	JJ
cord-252671-uf96jgig	116	23	class	class	NN
cord-252671-uf96jgig	116	24	of	of	IN
cord-252671-uf96jgig	116	25	adaptors	adaptor	NNS
cord-252671-uf96jgig	116	26	called	call	VBN
cord-252671-uf96jgig	116	27	tumor	tumor	NN
cord-252671-uf96jgig	116	28	necrosis	necrosis	NN
cord-252671-uf96jgig	116	29	factor	factor	NN
cord-252671-uf96jgig	116	30	(	(	-LRB-
cord-252671-uf96jgig	116	31	TNF	TNF	NNP
cord-252671-uf96jgig	116	32	)	)	-RRB-
cord-252671-uf96jgig	116	33	receptor	receptor	NN
cord-252671-uf96jgig	116	34	-	-	HYPH
cord-252671-uf96jgig	116	35	associated	associate	VBN
cord-252671-uf96jgig	116	36	factors	factor	NNS
cord-252671-uf96jgig	116	37	(	(	-LRB-
cord-252671-uf96jgig	116	38	TRAFs	TRAFs	NNP
cord-252671-uf96jgig	116	39	)	)	-RRB-
cord-252671-uf96jgig	116	40	including	include	VBG
cord-252671-uf96jgig	116	41	TRAF2	TRAF2	NNP
cord-252671-uf96jgig	116	42	/	/	SYM
cord-252671-uf96jgig	116	43	TRAF5	traf5	XX
cord-252671-uf96jgig	116	44	,	,	,
cord-252671-uf96jgig	116	45	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	116	46	,	,	,
cord-252671-uf96jgig	116	47	and	and	CC
cord-252671-uf96jgig	116	48	TRAF6	TRAF6	NNP
cord-252671-uf96jgig	116	49	(	(	-LRB-
cord-252671-uf96jgig	116	50	28	28	CD
cord-252671-uf96jgig	116	51	,	,	,
cord-252671-uf96jgig	116	52	29	29	CD
cord-252671-uf96jgig	116	53	)	)	-RRB-
cord-252671-uf96jgig	116	54	.	.	.
cord-252671-uf96jgig	117	1	To	to	TO
cord-252671-uf96jgig	117	2	test	test	VB
cord-252671-uf96jgig	117	3	the	the	DT
cord-252671-uf96jgig	117	4	effect	effect	NN
cord-252671-uf96jgig	117	5	of	of	IN
cord-252671-uf96jgig	117	6	M	M	NNP
cord-252671-uf96jgig	117	7	on	on	IN
cord-252671-uf96jgig	117	8	RLR	RLR	NNP
cord-252671-uf96jgig	117	9	and	and	CC
cord-252671-uf96jgig	117	10	TLR	TLR	NNP
cord-252671-uf96jgig	117	11	signaling	signal	VBG
cord-252671-uf96jgig	117	12	as	as	RB
cord-252671-uf96jgig	117	13	well	well	RB
cord-252671-uf96jgig	117	14	as	as	IN
cord-252671-uf96jgig	117	15	TRAF	TRAF	NNP
cord-252671-uf96jgig	117	16	expression	expression	NN
cord-252671-uf96jgig	117	17	,	,	,
cord-252671-uf96jgig	117	18	an	an	DT
cord-252671-uf96jgig	117	19	increased	increase	VBN
cord-252671-uf96jgig	117	20	dose	dose	NN
cord-252671-uf96jgig	117	21	of	of	IN
cord-252671-uf96jgig	117	22	pCMV	pcmv	NN
cord-252671-uf96jgig	117	23	-	-	HYPH
cord-252671-uf96jgig	117	24	Myc	Myc	NNP
cord-252671-uf96jgig	117	25	-	-	HYPH
cord-252671-uf96jgig	117	26	M	M	NNP
cord-252671-uf96jgig	117	27	constructs	construct	NNS
cord-252671-uf96jgig	117	28	was	be	VBD
cord-252671-uf96jgig	117	29	first	first	RB
cord-252671-uf96jgig	117	30	transiently	transiently	RB
cord-252671-uf96jgig	117	31	transfected	transfecte	VBN
cord-252671-uf96jgig	117	32	into	into	IN
cord-252671-uf96jgig	117	33	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	117	34	cells	cell	NNS
cord-252671-uf96jgig	117	35	.	.	.
cord-252671-uf96jgig	118	1	The	the	DT
cord-252671-uf96jgig	118	2	results	result	NNS
cord-252671-uf96jgig	118	3	in	in	IN
cord-252671-uf96jgig	118	4	Fig	Fig	NNP
cord-252671-uf96jgig	118	5	.	.	.
cord-252671-uf96jgig	119	1	3A	3A	NNP
cord-252671-uf96jgig	119	2	demonstrate	demonstrate	VBP
cord-252671-uf96jgig	119	3	that	that	IN
cord-252671-uf96jgig	119	4	the	the	DT
cord-252671-uf96jgig	119	5	increased	increase	VBN
cord-252671-uf96jgig	119	6	delivery	delivery	NN
cord-252671-uf96jgig	119	7	of	of	IN
cord-252671-uf96jgig	119	8	pCMV	pcmv	NN
cord-252671-uf96jgig	119	9	-	-	HYPH
cord-252671-uf96jgig	119	10	Myc	Myc	NNP
cord-252671-uf96jgig	119	11	-	-	HYPH
cord-252671-uf96jgig	119	12	M	M	NNP
cord-252671-uf96jgig	119	13	into	into	IN
cord-252671-uf96jgig	119	14	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	119	15	cells	cell	VBZ
cord-252671-uf96jgig	119	16	markedly	markedly	RB
cord-252671-uf96jgig	119	17	enhanced	enhance	VBN
cord-252671-uf96jgig	119	18	TRAF6	TRAF6	''
cord-252671-uf96jgig	120	1	but	but	CC
cord-252671-uf96jgig	120	2	not	not	RB
cord-252671-uf96jgig	120	3	TRAF2	TRAF2	NNP
cord-252671-uf96jgig	120	4	and	and	CC
cord-252671-uf96jgig	120	5	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	120	6	expression	expression	NN
cord-252671-uf96jgig	120	7	,	,	,
cord-252671-uf96jgig	120	8	indicating	indicate	VBG
cord-252671-uf96jgig	120	9	that	that	IN
cord-252671-uf96jgig	120	10	TRAF6-mediated	TRAF6-mediated	NNP
cord-252671-uf96jgig	120	11	signaling	signal	VBG
cord-252671-uf96jgig	120	12	transduction	transduction	NN
cord-252671-uf96jgig	120	13	might	may	MD
cord-252671-uf96jgig	120	14	contribute	contribute	VB
cord-252671-uf96jgig	120	15	to	to	IN
cord-252671-uf96jgig	120	16	the	the	DT
cord-252671-uf96jgig	120	17	upregulation	upregulation	NN
cord-252671-uf96jgig	120	18	of	of	IN
cord-252671-uf96jgig	120	19	IFN-	IFN-	NNP
cord-252671-uf96jgig	120	20	␤	␤	CD
cord-252671-uf96jgig	120	21	production	production	NN
cord-252671-uf96jgig	120	22	.	.	.
cord-252671-uf96jgig	121	1	To	to	TO
cord-252671-uf96jgig	121	2	further	further	JJ
cord-252671-uf96jgig	121	3	address	address	VB
cord-252671-uf96jgig	121	4	how	how	WRB
cord-252671-uf96jgig	121	5	TRAF	TRAF	NNP
cord-252671-uf96jgig	121	6	expression	expression	NN
cord-252671-uf96jgig	121	7	is	be	VBZ
cord-252671-uf96jgig	121	8	associated	associate	VBN
cord-252671-uf96jgig	121	9	with	with	IN
cord-252671-uf96jgig	121	10	RLR	RLR	NNP
cord-252671-uf96jgig	121	11	and/or	and/or	CC
cord-252671-uf96jgig	121	12	TLR	TLR	NNP
cord-252671-uf96jgig	121	13	signaling	signal	VBG
cord-252671-uf96jgig	121	14	pathways	pathway	NNS
cord-252671-uf96jgig	121	15	,	,	,
cord-252671-uf96jgig	121	16	the	the	DT
cord-252671-uf96jgig	121	17	M	M	NNP
cord-252671-uf96jgig	121	18	genetransfected	genetransfecte	VBD
cord-252671-uf96jgig	121	19	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	121	20	cells	cell	NNS
cord-252671-uf96jgig	121	21	were	be	VBD
cord-252671-uf96jgig	121	22	also	also	RB
cord-252671-uf96jgig	121	23	assayed	assay	VBN
cord-252671-uf96jgig	121	24	for	for	IN
cord-252671-uf96jgig	121	25	the	the	DT
cord-252671-uf96jgig	121	26	expression	expression	NN
cord-252671-uf96jgig	121	27	of	of	IN
cord-252671-uf96jgig	121	28	upstream	upstream	JJ
cord-252671-uf96jgig	121	29	sensors	sensor	NNS
cord-252671-uf96jgig	121	30	and/or	and/or	CC
cord-252671-uf96jgig	121	31	signaling	signal	VBG
cord-252671-uf96jgig	121	32	molecules	molecule	NNS
cord-252671-uf96jgig	121	33	of	of	IN
cord-252671-uf96jgig	121	34	TRAFs	traf	NNS
cord-252671-uf96jgig	121	35	.	.	.
cord-252671-uf96jgig	122	1	Figure	figure	NN
cord-252671-uf96jgig	122	2	3B	3b	NN
cord-252671-uf96jgig	122	3	demonstrates	demonstrate	VBZ
cord-252671-uf96jgig	122	4	that	that	IN
cord-252671-uf96jgig	122	5	no	no	DT
cord-252671-uf96jgig	122	6	significant	significant	JJ
cord-252671-uf96jgig	122	7	alteration	alteration	NN
cord-252671-uf96jgig	122	8	was	be	VBD
cord-252671-uf96jgig	122	9	observed	observe	VBN
cord-252671-uf96jgig	122	10	in	in	IN
cord-252671-uf96jgig	122	11	the	the	DT
cord-252671-uf96jgig	122	12	expression	expression	NN
cord-252671-uf96jgig	122	13	of	of	IN
cord-252671-uf96jgig	122	14	RIG	rig	NN
cord-252671-uf96jgig	122	15	-	-	:
cord-252671-uf96jgig	122	16	I	I	NNP
cord-252671-uf96jgig	122	17	,	,	,
cord-252671-uf96jgig	122	18	MDA5	MDA5	NNP
cord-252671-uf96jgig	122	19	,	,	,
cord-252671-uf96jgig	122	20	and	and	CC
cord-252671-uf96jgig	122	21	MAVS	MAVS	NNPS
cord-252671-uf96jgig	122	22	after	after	IN
cord-252671-uf96jgig	122	23	exogenously	exogenously	RB
cord-252671-uf96jgig	122	24	delivering	deliver	VBG
cord-252671-uf96jgig	122	25	M	M	NNP
cord-252671-uf96jgig	122	26	genes	gene	NNS
cord-252671-uf96jgig	122	27	into	into	IN
cord-252671-uf96jgig	122	28	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	122	29	cells	cell	NNS
cord-252671-uf96jgig	122	30	,	,	,
cord-252671-uf96jgig	122	31	indicating	indicate	VBG
cord-252671-uf96jgig	122	32	that	that	IN
cord-252671-uf96jgig	122	33	the	the	DT
cord-252671-uf96jgig	122	34	RLR	RLR	NNP
cord-252671-uf96jgig	122	35	signaling	signal	VBG
cord-252671-uf96jgig	122	36	pathway	pathway	NN
cord-252671-uf96jgig	122	37	might	may	MD
cord-252671-uf96jgig	122	38	not	not	RB
cord-252671-uf96jgig	122	39	be	be	VB
cord-252671-uf96jgig	122	40	targeted	target	VBN
cord-252671-uf96jgig	122	41	by	by	IN
cord-252671-uf96jgig	122	42	M	M	NNP
cord-252671-uf96jgig	122	43	gene	gene	NN
cord-252671-uf96jgig	122	44	products	product	NNS
cord-252671-uf96jgig	122	45	.	.	.
cord-252671-uf96jgig	123	1	In	in	IN
cord-252671-uf96jgig	123	2	contrast	contrast	NN
cord-252671-uf96jgig	123	3	,	,	,
cord-252671-uf96jgig	123	4	three	three	CD
cord-252671-uf96jgig	123	5	adaptor	adaptor	NN
cord-252671-uf96jgig	123	6	proteins	protein	NNS
cord-252671-uf96jgig	123	7	(	(	-LRB-
cord-252671-uf96jgig	123	8	MyD88	MyD88	NNS
cord-252671-uf96jgig	123	9	,	,	,
cord-252671-uf96jgig	123	10	TRAM	tram	NN
cord-252671-uf96jgig	123	11	/	/	SYM
cord-252671-uf96jgig	123	12	TICAM2	ticam2	NN
cord-252671-uf96jgig	123	13	,	,	,
cord-252671-uf96jgig	123	14	and	and	CC
cord-252671-uf96jgig	123	15	TIRAP	TIRAP	NNP
cord-252671-uf96jgig	123	16	)	)	-RRB-
cord-252671-uf96jgig	123	17	associated	associate	VBD
cord-252671-uf96jgig	123	18	with	with	IN
cord-252671-uf96jgig	123	19	TLRs	tlr	NNS
cord-252671-uf96jgig	123	20	were	be	VBD
cord-252671-uf96jgig	123	21	all	all	DT
cord-252671-uf96jgig	123	22	upregulated	upregulate	VBN
cord-252671-uf96jgig	124	1	(	(	-LRB-
cord-252671-uf96jgig	124	2	Fig	Fig	NNP
cord-252671-uf96jgig	124	3	.	.	.
cord-252671-uf96jgig	124	4	3C	3C	NNP
cord-252671-uf96jgig	124	5	)	)	-RRB-
cord-252671-uf96jgig	124	6	,	,	,
cord-252671-uf96jgig	124	7	while	while	IN
cord-252671-uf96jgig	124	8	the	the	DT
cord-252671-uf96jgig	124	9	adaptor	adaptor	NN
cord-252671-uf96jgig	124	10	protein	protein	NN
cord-252671-uf96jgig	124	11	TRIF	TRIF	NNP
cord-252671-uf96jgig	124	12	failed	fail	VBD
cord-252671-uf96jgig	124	13	to	to	TO
cord-252671-uf96jgig	124	14	be	be	VB
cord-252671-uf96jgig	124	15	upregulated	upregulate	VBN
cord-252671-uf96jgig	124	16	in	in	IN
cord-252671-uf96jgig	124	17	responding	respond	VBG
cord-252671-uf96jgig	124	18	to	to	IN
cord-252671-uf96jgig	124	19	M	M	NNP
cord-252671-uf96jgig	124	20	gene	gene	NN
cord-252671-uf96jgig	124	21	overexpression	overexpression	NN
cord-252671-uf96jgig	124	22	(	(	-LRB-
cord-252671-uf96jgig	124	23	Fig	Fig	NNP
cord-252671-uf96jgig	124	24	.	.	.
cord-252671-uf96jgig	124	25	3D	3D	NNP
cord-252671-uf96jgig	124	26	)	)	-RRB-
cord-252671-uf96jgig	124	27	.	.	.
cord-252671-uf96jgig	125	1	Overall	overall	RB
cord-252671-uf96jgig	125	2	,	,	,
cord-252671-uf96jgig	125	3	the	the	DT
cord-252671-uf96jgig	125	4	results	result	NNS
cord-252671-uf96jgig	125	5	indicate	indicate	VBP
cord-252671-uf96jgig	125	6	that	that	IN
cord-252671-uf96jgig	125	7	TLR	TLR	NNP
cord-252671-uf96jgig	125	8	signaling	signal	VBG
cord-252671-uf96jgig	125	9	pathways	pathway	NNS
cord-252671-uf96jgig	125	10	are	be	VBP
cord-252671-uf96jgig	125	11	mainly	mainly	RB
cord-252671-uf96jgig	125	12	targeted	target	VBN
cord-252671-uf96jgig	125	13	by	by	IN
cord-252671-uf96jgig	125	14	the	the	DT
cord-252671-uf96jgig	125	15	SARS	SARS	NNP
cord-252671-uf96jgig	125	16	-	-	HYPH
cord-252671-uf96jgig	125	17	CoV	CoV	NNP
cord-252671-uf96jgig	125	18	M	M	NNP
cord-252671-uf96jgig	125	19	gene	gene	NN
cord-252671-uf96jgig	125	20	product	product	NN
cord-252671-uf96jgig	125	21	for	for	IN
cord-252671-uf96jgig	125	22	the	the	DT
cord-252671-uf96jgig	125	23	induction	induction	NN
cord-252671-uf96jgig	125	24	of	of	IN
cord-252671-uf96jgig	125	25	IFN-	IFN-	NNP
cord-252671-uf96jgig	125	26	␤	␤	DT
cord-252671-uf96jgig	125	27	expression	expression	NN
cord-252671-uf96jgig	125	28	.	.	.
cord-252671-uf96jgig	126	1	The	the	DT
cord-252671-uf96jgig	126	2	SARS	SARS	NNP
cord-252671-uf96jgig	126	3	-	-	HYPH
cord-252671-uf96jgig	126	4	CoV	CoV	NNP
cord-252671-uf96jgig	126	5	M	M	NNP
cord-252671-uf96jgig	126	6	gene	gene	NN
cord-252671-uf96jgig	126	7	product	product	NN
cord-252671-uf96jgig	126	8	promotes	promote	VBZ
cord-252671-uf96jgig	126	9	IFN-	IFN-	NNP
cord-252671-uf96jgig	126	10	␤	␤	CD
cord-252671-uf96jgig	126	11	production	production	NN
cord-252671-uf96jgig	126	12	through	through	IN
cord-252671-uf96jgig	126	13	Toll	toll	NN
cord-252671-uf96jgig	126	14	-	-	HYPH
cord-252671-uf96jgig	126	15	like	like	JJ
cord-252671-uf96jgig	126	16	-	-	HYPH
cord-252671-uf96jgig	126	17	receptor	receptor	NN
cord-252671-uf96jgig	126	18	-	-	HYPH
cord-252671-uf96jgig	126	19	related	relate	VBN
cord-252671-uf96jgig	126	20	signaling	signal	VBG
cord-252671-uf96jgig	126	21	pathways	pathway	NNS
cord-252671-uf96jgig	126	22	in	in	IN
cord-252671-uf96jgig	126	23	immortalized	immortalize	VBN
cord-252671-uf96jgig	126	24	murine	murine	JJ
cord-252671-uf96jgig	126	25	bone	bone	NN
cord-252671-uf96jgig	126	26	marrow	marrow	NN
cord-252671-uf96jgig	126	27	-	-	HYPH
cord-252671-uf96jgig	126	28	derived	derive	VBN
cord-252671-uf96jgig	126	29	macrophage	macrophage	NN
cord-252671-uf96jgig	126	30	cells	cell	NNS
cord-252671-uf96jgig	126	31	.	.	.
cord-252671-uf96jgig	127	1	To	to	TO
cord-252671-uf96jgig	127	2	further	further	RB
cord-252671-uf96jgig	127	3	confirm	confirm	VB
cord-252671-uf96jgig	127	4	the	the	DT
cord-252671-uf96jgig	127	5	above	above	JJ
cord-252671-uf96jgig	127	6	results	result	NNS
cord-252671-uf96jgig	127	7	,	,	,
cord-252671-uf96jgig	127	8	the	the	DT
cord-252671-uf96jgig	127	9	pCMV	pcmv	NN
cord-252671-uf96jgig	127	10	-	-	HYPH
cord-252671-uf96jgig	127	11	Myc	Myc	NNP
cord-252671-uf96jgig	127	12	-	-	HYPH
cord-252671-uf96jgig	127	13	M	M	NNP
cord-252671-uf96jgig	127	14	construct	construct	NN
cord-252671-uf96jgig	127	15	was	be	VBD
cord-252671-uf96jgig	127	16	also	also	RB
cord-252671-uf96jgig	127	17	transiently	transiently	RB
cord-252671-uf96jgig	127	18	transfected	transfecte	VBN
cord-252671-uf96jgig	127	19	into	into	IN
cord-252671-uf96jgig	127	20	J2-M	J2-M	NNP
cord-252671-uf96jgig	127	21	cells	cell	NNS
cord-252671-uf96jgig	127	22	,	,	,
cord-252671-uf96jgig	127	23	an	an	DT
cord-252671-uf96jgig	127	24	immortalized	immortalize	VBN
cord-252671-uf96jgig	127	25	murine	murine	JJ
cord-252671-uf96jgig	127	26	bone	bone	NN
cord-252671-uf96jgig	127	27	marrow	marrow	NN
cord-252671-uf96jgig	127	28	-	-	HYPH
cord-252671-uf96jgig	127	29	derived	derive	VBN
cord-252671-uf96jgig	127	30	macrophage	macrophage	NN
cord-252671-uf96jgig	127	31	cell	cell	NN
cord-252671-uf96jgig	127	32	line	line	NN
cord-252671-uf96jgig	127	33	established	establish	VBN
cord-252671-uf96jgig	127	34	with	with	IN
cord-252671-uf96jgig	127	35	J2	J2	NNP
cord-252671-uf96jgig	127	36	virus	virus	NN
cord-252671-uf96jgig	127	37	(	(	-LRB-
cord-252671-uf96jgig	127	38	30	30	CD
cord-252671-uf96jgig	127	39	,	,	,
cord-252671-uf96jgig	127	40	31	31	CD
cord-252671-uf96jgig	127	41	)	)	-RRB-
cord-252671-uf96jgig	127	42	.	.	.
cord-252671-uf96jgig	128	1	The	the	DT
cord-252671-uf96jgig	128	2	delivery	delivery	NN
cord-252671-uf96jgig	128	3	of	of	IN
cord-252671-uf96jgig	128	4	the	the	DT
cord-252671-uf96jgig	128	5	M	M	NNP
cord-252671-uf96jgig	128	6	gene	gene	NN
cord-252671-uf96jgig	128	7	product	product	NN
cord-252671-uf96jgig	128	8	is	be	VBZ
cord-252671-uf96jgig	128	9	effec	effec	NN
cord-252671-uf96jgig	128	10	-	-	HYPH
cord-252671-uf96jgig	128	11	tive	tive	JJ
cord-252671-uf96jgig	128	12	in	in	IN
cord-252671-uf96jgig	128	13	stimulating	stimulate	VBG
cord-252671-uf96jgig	128	14	the	the	DT
cord-252671-uf96jgig	128	15	activation	activation	NN
cord-252671-uf96jgig	128	16	of	of	IN
cord-252671-uf96jgig	128	17	both	both	CC
cord-252671-uf96jgig	128	18	IFN-	IFN-	NNP
cord-252671-uf96jgig	128	19	␤	␤	NNP
cord-252671-uf96jgig	128	20	and	and	CC
cord-252671-uf96jgig	128	21	NF	nf	NN
cord-252671-uf96jgig	128	22	-	-	HYPH
cord-252671-uf96jgig	128	23	B	b	NN
cord-252671-uf96jgig	128	24	in	in	IN
cord-252671-uf96jgig	128	25	murine	murine	JJ
cord-252671-uf96jgig	128	26	J2-M	J2-M	NNP
cord-252671-uf96jgig	128	27	cells	cell	NNS
cord-252671-uf96jgig	128	28	(	(	-LRB-
cord-252671-uf96jgig	128	29	Fig	fig	NN
cord-252671-uf96jgig	128	30	.	.	.
cord-252671-uf96jgig	128	31	4A	4a	CD
cord-252671-uf96jgig	128	32	,	,	,
cord-252671-uf96jgig	128	33	B	b	NN
cord-252671-uf96jgig	128	34	,	,	,
cord-252671-uf96jgig	128	35	and	and	CC
cord-252671-uf96jgig	128	36	C	C	NNP
cord-252671-uf96jgig	128	37	)	)	-RRB-
cord-252671-uf96jgig	128	38	.	.	.
cord-252671-uf96jgig	129	1	Figure	figure	NN
cord-252671-uf96jgig	129	2	4D	4d	CD
cord-252671-uf96jgig	129	3	demonstrates	demonstrate	VBZ
cord-252671-uf96jgig	129	4	that	that	IN
cord-252671-uf96jgig	129	5	increased	increase	VBN
cord-252671-uf96jgig	129	6	delivery	delivery	NN
cord-252671-uf96jgig	129	7	of	of	IN
cord-252671-uf96jgig	129	8	M	M	NNP
cord-252671-uf96jgig	129	9	gene	gene	NN
cord-252671-uf96jgig	129	10	product	product	NN
cord-252671-uf96jgig	129	11	into	into	IN
cord-252671-uf96jgig	129	12	J2-M	J2-M	NNP
cord-252671-uf96jgig	129	13	cells	cell	NNS
cord-252671-uf96jgig	129	14	indeed	indeed	RB
cord-252671-uf96jgig	129	15	promotes	promote	VBZ
cord-252671-uf96jgig	129	16	IFN-	IFN-	NNP
cord-252671-uf96jgig	129	17	␤	␤	CD
cord-252671-uf96jgig	129	18	induction	induction	NN
cord-252671-uf96jgig	129	19	through	through	IN
cord-252671-uf96jgig	129	20	the	the	DT
cord-252671-uf96jgig	129	21	phosphorylation	phosphorylation	NN
cord-252671-uf96jgig	129	22	of	of	IN
cord-252671-uf96jgig	129	23	IRF3	IRF3	NNP
cord-252671-uf96jgig	129	24	,	,	,
cord-252671-uf96jgig	129	25	NF	nf	NN
cord-252671-uf96jgig	129	26	-	-	HYPH
cord-252671-uf96jgig	129	27	B	b	NN
cord-252671-uf96jgig	129	28	p65	p65	NN
cord-252671-uf96jgig	129	29	,	,	,
cord-252671-uf96jgig	129	30	and	and	CC
cord-252671-uf96jgig	129	31	TBK1	TBK1	NNP
cord-252671-uf96jgig	129	32	.	.	.
cord-252671-uf96jgig	130	1	In	in	IN
cord-252671-uf96jgig	130	2	accord	accord	NN
cord-252671-uf96jgig	130	3	with	with	IN
cord-252671-uf96jgig	130	4	the	the	DT
cord-252671-uf96jgig	130	5	results	result	NNS
cord-252671-uf96jgig	130	6	in	in	IN
cord-252671-uf96jgig	130	7	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	130	8	cells	cell	NNS
cord-252671-uf96jgig	130	9	,	,	,
cord-252671-uf96jgig	130	10	the	the	DT
cord-252671-uf96jgig	130	11	increased	increase	VBN
cord-252671-uf96jgig	130	12	delivery	delivery	NN
cord-252671-uf96jgig	130	13	of	of	IN
cord-252671-uf96jgig	130	14	pCMV	pcmv	NN
cord-252671-uf96jgig	130	15	-	-	HYPH
cord-252671-uf96jgig	130	16	Myc	Myc	NNP
cord-252671-uf96jgig	130	17	-	-	HYPH
cord-252671-uf96jgig	130	18	M	M	NNP
cord-252671-uf96jgig	130	19	into	into	IN
cord-252671-uf96jgig	130	20	J2-M	J2-M	NNP
cord-252671-uf96jgig	130	21	cells	cell	NNS
cord-252671-uf96jgig	130	22	markedly	markedly	RB
cord-252671-uf96jgig	130	23	enhanced	enhance	VBN
cord-252671-uf96jgig	130	24	TRAF6	TRAF6	''
cord-252671-uf96jgig	131	1	but	but	CC
cord-252671-uf96jgig	131	2	not	not	RB
cord-252671-uf96jgig	131	3	TRAF2	traf2	VB
cord-252671-uf96jgig	131	4	and	and	CC
cord-252671-uf96jgig	132	1	TRAF3	traf3	NN
cord-252671-uf96jgig	132	2	expression	expression	NN
cord-252671-uf96jgig	132	3	(	(	-LRB-
cord-252671-uf96jgig	132	4	Fig	Fig	NNP
cord-252671-uf96jgig	132	5	.	.	.
cord-252671-uf96jgig	132	6	4E	4E	NNP
cord-252671-uf96jgig	132	7	)	)	-RRB-
cord-252671-uf96jgig	132	8	.	.	.
cord-252671-uf96jgig	133	1	Moreover	moreover	RB
cord-252671-uf96jgig	133	2	,	,	,
cord-252671-uf96jgig	133	3	the	the	DT
cord-252671-uf96jgig	133	4	M	M	NNP
cord-252671-uf96jgig	133	5	gene	gene	NN
cord-252671-uf96jgig	133	6	product	product	NN
cord-252671-uf96jgig	133	7	did	do	VBD
cord-252671-uf96jgig	133	8	not	not	RB
cord-252671-uf96jgig	133	9	significantly	significantly	RB
cord-252671-uf96jgig	133	10	increase	increase	VB
cord-252671-uf96jgig	133	11	the	the	DT
cord-252671-uf96jgig	133	12	protein	protein	NN
cord-252671-uf96jgig	133	13	levels	level	NNS
cord-252671-uf96jgig	133	14	of	of	IN
cord-252671-uf96jgig	133	15	RIG	rig	NN
cord-252671-uf96jgig	133	16	-	-	:
cord-252671-uf96jgig	133	17	I	I	NNP
cord-252671-uf96jgig	133	18	,	,	,
cord-252671-uf96jgig	133	19	MAVS	MAVS	NNP
cord-252671-uf96jgig	133	20	,	,	,
cord-252671-uf96jgig	133	21	STING	sting	VB
cord-252671-uf96jgig	133	22	,	,	,
cord-252671-uf96jgig	133	23	and	and	CC
cord-252671-uf96jgig	133	24	MDA5	MDA5	NNP
cord-252671-uf96jgig	133	25	(	(	-LRB-
cord-252671-uf96jgig	133	26	Fig	Fig	NNP
cord-252671-uf96jgig	133	27	.	.	.
cord-252671-uf96jgig	133	28	4F	4F	NNP
cord-252671-uf96jgig	133	29	)	)	-RRB-
cord-252671-uf96jgig	133	30	,	,	,
cord-252671-uf96jgig	133	31	indicating	indicate	VBG
cord-252671-uf96jgig	133	32	that	that	IN
cord-252671-uf96jgig	133	33	the	the	DT
cord-252671-uf96jgig	133	34	RIG	rig	NN
cord-252671-uf96jgig	133	35	-	-	:
cord-252671-uf96jgig	133	36	I	-PRON-	PRP
cord-252671-uf96jgig	133	37	signaling	signal	VBG
cord-252671-uf96jgig	133	38	pathway	pathway	NN
cord-252671-uf96jgig	133	39	might	may	MD
cord-252671-uf96jgig	133	40	not	not	RB
cord-252671-uf96jgig	133	41	be	be	VB
cord-252671-uf96jgig	133	42	activated	activate	VBN
cord-252671-uf96jgig	133	43	in	in	IN
cord-252671-uf96jgig	133	44	responding	respond	VBG
cord-252671-uf96jgig	133	45	to	to	IN
cord-252671-uf96jgig	133	46	exogenous	exogenous	JJ
cord-252671-uf96jgig	133	47	delivery	delivery	NN
cord-252671-uf96jgig	133	48	of	of	IN
cord-252671-uf96jgig	133	49	the	the	DT
cord-252671-uf96jgig	133	50	M	M	NNP
cord-252671-uf96jgig	133	51	gene	gene	NN
cord-252671-uf96jgig	133	52	product	product	NN
cord-252671-uf96jgig	133	53	into	into	IN
cord-252671-uf96jgig	133	54	J2-M	J2-M	NNP
cord-252671-uf96jgig	133	55	cells	cell	NNS
cord-252671-uf96jgig	133	56	.	.	.
cord-252671-uf96jgig	134	1	In	in	IN
cord-252671-uf96jgig	134	2	contrast	contrast	NN
cord-252671-uf96jgig	134	3	,	,	,
cord-252671-uf96jgig	134	4	the	the	DT
cord-252671-uf96jgig	134	5	increased	increase	VBN
cord-252671-uf96jgig	134	6	delivery	delivery	NN
cord-252671-uf96jgig	134	7	of	of	IN
cord-252671-uf96jgig	134	8	the	the	DT
cord-252671-uf96jgig	134	9	M	M	NNP
cord-252671-uf96jgig	134	10	gene	gene	NN
cord-252671-uf96jgig	134	11	into	into	IN
cord-252671-uf96jgig	134	12	J2-M	J2-M	NNP
cord-252671-uf96jgig	134	13	cells	cell	NNS
cord-252671-uf96jgig	134	14	markedly	markedly	RB
cord-252671-uf96jgig	134	15	enhanced	enhance	VBN
cord-252671-uf96jgig	134	16	MyD88	MyD88	NNS
cord-252671-uf96jgig	134	17	and	and	CC
cord-252671-uf96jgig	134	18	TRAM/	TRAM/	NNP
cord-252671-uf96jgig	134	19	TICAM2	TICAM2	NNP
cord-252671-uf96jgig	135	1	but	but	CC
cord-252671-uf96jgig	135	2	not	not	RB
cord-252671-uf96jgig	135	3	TRIF	TRIF	NNP
cord-252671-uf96jgig	135	4	expression	expression	NN
cord-252671-uf96jgig	136	1	(	(	-LRB-
cord-252671-uf96jgig	136	2	Fig	Fig	NNP
cord-252671-uf96jgig	136	3	.	.	.
cord-252671-uf96jgig	136	4	4	4	CD
cord-252671-uf96jgig	136	5	G	G	NNP
cord-252671-uf96jgig	136	6	)	)	-RRB-
cord-252671-uf96jgig	136	7	,	,	,
cord-252671-uf96jgig	136	8	indicating	indicate	VBG
cord-252671-uf96jgig	136	9	that	that	IN
cord-252671-uf96jgig	136	10	TLRrelated	tlrrelate	VBN
cord-252671-uf96jgig	136	11	signaling	signal	VBG
cord-252671-uf96jgig	136	12	pathways	pathway	NNS
cord-252671-uf96jgig	136	13	might	may	MD
cord-252671-uf96jgig	136	14	be	be	VB
cord-252671-uf96jgig	136	15	mainly	mainly	RB
cord-252671-uf96jgig	136	16	associated	associate	VBN
cord-252671-uf96jgig	136	17	with	with	IN
cord-252671-uf96jgig	136	18	M	M	NNP
cord-252671-uf96jgig	136	19	-	-	HYPH
cord-252671-uf96jgig	136	20	mediated	mediate	VBN
cord-252671-uf96jgig	136	21	IFN-	IFN-	NNP
cord-252671-uf96jgig	136	22	␤	␤	CD
cord-252671-uf96jgig	136	23	induction	induction	NN
cord-252671-uf96jgig	136	24	.	.	.
cord-252671-uf96jgig	137	1	Overall	overall	RB
cord-252671-uf96jgig	137	2	,	,	,
cord-252671-uf96jgig	137	3	our	-PRON-	PRP$
cord-252671-uf96jgig	137	4	data	datum	NNS
cord-252671-uf96jgig	137	5	in	in	IN
cord-252671-uf96jgig	137	6	both	both	DT
cord-252671-uf96jgig	137	7	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	137	8	and	and	CC
cord-252671-uf96jgig	137	9	J2-M	J2-M	NNP
cord-252671-uf96jgig	137	10	cells	cell	NNS
cord-252671-uf96jgig	137	11	strongly	strongly	RB
cord-252671-uf96jgig	137	12	indicate	indicate	VBP
cord-252671-uf96jgig	137	13	that	that	IN
cord-252671-uf96jgig	137	14	M	M	NNP
cord-252671-uf96jgig	137	15	-	-	HYPH
cord-252671-uf96jgig	137	16	mediated	mediate	VBN
cord-252671-uf96jgig	137	17	induction	induction	NN
cord-252671-uf96jgig	137	18	of	of	IN
cord-252671-uf96jgig	137	19	IFN-	IFN-	NNP
cord-252671-uf96jgig	137	20	␤	␤	DT
cord-252671-uf96jgig	137	21	expression	expression	NN
cord-252671-uf96jgig	137	22	is	be	VBZ
cord-252671-uf96jgig	137	23	likely	likely	RB
cord-252671-uf96jgig	137	24	associated	associate	VBN
cord-252671-uf96jgig	137	25	with	with	IN
cord-252671-uf96jgig	137	26	the	the	DT
cord-252671-uf96jgig	137	27	activation	activation	NN
cord-252671-uf96jgig	137	28	of	of	IN
cord-252671-uf96jgig	137	29	TLR	TLR	NNP
cord-252671-uf96jgig	137	30	-	-	HYPH
cord-252671-uf96jgig	137	31	related	relate	VBN
cord-252671-uf96jgig	137	32	signaling	signal	VBG
cord-252671-uf96jgig	137	33	pathways	pathway	NNS
cord-252671-uf96jgig	137	34	.	.	.
cord-252671-uf96jgig	138	1	The	the	DT
cord-252671-uf96jgig	138	2	SARS	SARS	NNP
cord-252671-uf96jgig	138	3	-	-	HYPH
cord-252671-uf96jgig	138	4	CoV	CoV	NNP
cord-252671-uf96jgig	138	5	M	M	NNP
cord-252671-uf96jgig	138	6	gene	gene	NN
cord-252671-uf96jgig	138	7	product	product	NN
cord-252671-uf96jgig	138	8	functions	function	NNS
cord-252671-uf96jgig	138	9	at	at	IN
cord-252671-uf96jgig	138	10	the	the	DT
cord-252671-uf96jgig	138	11	protein	protein	NN
cord-252671-uf96jgig	138	12	level	level	NN
cord-252671-uf96jgig	138	13	to	to	TO
cord-252671-uf96jgig	138	14	induce	induce	VB
cord-252671-uf96jgig	138	15	IFN-	IFN-	NNP
cord-252671-uf96jgig	138	16	␤	␤	CD
cord-252671-uf96jgig	138	17	production	production	NN
cord-252671-uf96jgig	138	18	.	.	.
cord-252671-uf96jgig	139	1	The	the	DT
cord-252671-uf96jgig	139	2	next	next	JJ
cord-252671-uf96jgig	139	3	question	question	NN
cord-252671-uf96jgig	139	4	that	that	IN
cord-252671-uf96jgig	139	5	we	-PRON-	PRP
cord-252671-uf96jgig	139	6	tried	try	VBD
cord-252671-uf96jgig	139	7	to	to	TO
cord-252671-uf96jgig	139	8	ask	ask	VB
cord-252671-uf96jgig	139	9	was	be	VBD
cord-252671-uf96jgig	139	10	at	at	IN
cord-252671-uf96jgig	139	11	which	which	WDT
cord-252671-uf96jgig	139	12	level	level	NN
cord-252671-uf96jgig	139	13	(	(	-LRB-
cord-252671-uf96jgig	139	14	mRNA	mrna	NN
cord-252671-uf96jgig	139	15	or	or	CC
cord-252671-uf96jgig	139	16	protein	protein	NN
cord-252671-uf96jgig	139	17	)	)	-RRB-
cord-252671-uf96jgig	140	1	the	the	DT
cord-252671-uf96jgig	140	2	M	M	NNP
cord-252671-uf96jgig	140	3	-	-	HYPH
cord-252671-uf96jgig	140	4	mediated	mediate	VBN
cord-252671-uf96jgig	140	5	IFN-	IFN-	NNP
cord-252671-uf96jgig	140	6	␤	␤	CD
cord-252671-uf96jgig	140	7	induction	induction	NN
cord-252671-uf96jgig	140	8	occurred	occur	VBD
cord-252671-uf96jgig	140	9	.	.	.
cord-252671-uf96jgig	141	1	To	to	TO
cord-252671-uf96jgig	141	2	address	address	VB
cord-252671-uf96jgig	141	3	this	this	DT
cord-252671-uf96jgig	141	4	issue	issue	NN
cord-252671-uf96jgig	141	5	directly	directly	RB
cord-252671-uf96jgig	141	6	,	,	,
cord-252671-uf96jgig	141	7	we	-PRON-	PRP
cord-252671-uf96jgig	141	8	created	create	VBD
cord-252671-uf96jgig	141	9	an	an	DT
cord-252671-uf96jgig	141	10	M	M	NNP
cord-252671-uf96jgig	141	11	-	-	HYPH
cord-252671-uf96jgig	141	12	stop	stop	NN
cord-252671-uf96jgig	141	13	construct	construct	NN
cord-252671-uf96jgig	141	14	by	by	IN
cord-252671-uf96jgig	141	15	replacing	replace	VBG
cord-252671-uf96jgig	141	16	the	the	DT
cord-252671-uf96jgig	141	17	start	start	NN
cord-252671-uf96jgig	141	18	codon	codon	NN
cord-252671-uf96jgig	141	19	AUG	AUG	NNP
cord-252671-uf96jgig	141	20	with	with	IN
cord-252671-uf96jgig	141	21	three	three	CD
cord-252671-uf96jgig	141	22	in	in	IN
cord-252671-uf96jgig	141	23	-	-	HYPH
cord-252671-uf96jgig	141	24	frame	frame	NN
cord-252671-uf96jgig	141	25	tandem	tandem	NN
cord-252671-uf96jgig	141	26	stop	stop	NN
cord-252671-uf96jgig	141	27	codons	codon	NNS
cord-252671-uf96jgig	141	28	at	at	IN
cord-252671-uf96jgig	141	29	the	the	DT
cord-252671-uf96jgig	141	30	5=	5=	CD
cord-252671-uf96jgig	141	31	end	end	NN
cord-252671-uf96jgig	141	32	of	of	IN
cord-252671-uf96jgig	141	33	the	the	DT
cord-252671-uf96jgig	141	34	M	M	NNP
cord-252671-uf96jgig	141	35	gene	gene	NN
cord-252671-uf96jgig	141	36	(	(	-LRB-
cord-252671-uf96jgig	141	37	Fig	Fig	NNP
cord-252671-uf96jgig	141	38	.	.	.
cord-252671-uf96jgig	141	39	5A	5a	CD
cord-252671-uf96jgig	141	40	)	)	-RRB-
cord-252671-uf96jgig	141	41	.	.	.
cord-252671-uf96jgig	142	1	This	this	DT
cord-252671-uf96jgig	142	2	expression	expression	NN
cord-252671-uf96jgig	142	3	construct	construct	VBP
cord-252671-uf96jgig	142	4	can	can	MD
cord-252671-uf96jgig	142	5	generate	generate	VB
cord-252671-uf96jgig	142	6	only	only	RB
cord-252671-uf96jgig	142	7	mRNA	mrna	NN
cord-252671-uf96jgig	142	8	and	and	CC
cord-252671-uf96jgig	142	9	no	no	DT
cord-252671-uf96jgig	142	10	protein	protein	NN
cord-252671-uf96jgig	142	11	due	due	IN
cord-252671-uf96jgig	142	12	to	to	IN
cord-252671-uf96jgig	142	13	the	the	DT
cord-252671-uf96jgig	142	14	translation	translation	NN
cord-252671-uf96jgig	142	15	failure	failure	NN
cord-252671-uf96jgig	142	16	of	of	IN
cord-252671-uf96jgig	142	17	the	the	DT
cord-252671-uf96jgig	142	18	mRNA	mRNA	NNP
cord-252671-uf96jgig	142	19	substrates	substrate	NNS
cord-252671-uf96jgig	142	20	.	.	.
cord-252671-uf96jgig	143	1	Western	western	JJ
cord-252671-uf96jgig	143	2	blot	blot	NN
cord-252671-uf96jgig	143	3	analysis	analysis	NN
cord-252671-uf96jgig	143	4	shows	show	VBZ
cord-252671-uf96jgig	143	5	that	that	IN
cord-252671-uf96jgig	143	6	the	the	DT
cord-252671-uf96jgig	143	7	M	M	NNP
cord-252671-uf96jgig	143	8	protein	protein	NN
cord-252671-uf96jgig	143	9	synthesis	synthesis	NN
cord-252671-uf96jgig	143	10	was	be	VBD
cord-252671-uf96jgig	143	11	completely	completely	RB
cord-252671-uf96jgig	143	12	blocked	block	VBN
cord-252671-uf96jgig	143	13	in	in	IN
cord-252671-uf96jgig	143	14	the	the	DT
cord-252671-uf96jgig	143	15	M	M	NNP
cord-252671-uf96jgig	143	16	-	-	HYPH
cord-252671-uf96jgig	143	17	stop	stop	VB
cord-252671-uf96jgig	143	18	construct	construct	NN
cord-252671-uf96jgig	143	19	but	but	CC
cord-252671-uf96jgig	143	20	not	not	RB
cord-252671-uf96jgig	143	21	the	the	DT
cord-252671-uf96jgig	143	22	wild	wild	JJ
cord-252671-uf96jgig	143	23	-	-	HYPH
cord-252671-uf96jgig	143	24	type	type	NN
cord-252671-uf96jgig	143	25	M	M	NNP
cord-252671-uf96jgig	143	26	construct	construct	NN
cord-252671-uf96jgig	143	27	(	(	-LRB-
cord-252671-uf96jgig	143	28	Fig	Fig	NNP
cord-252671-uf96jgig	143	29	.	.	.
cord-252671-uf96jgig	143	30	5B	5b	CD
cord-252671-uf96jgig	143	31	)	)	-RRB-
cord-252671-uf96jgig	143	32	.	.	.
cord-252671-uf96jgig	144	1	Real	real	JJ
cord-252671-uf96jgig	144	2	-	-	HYPH
cord-252671-uf96jgig	144	3	time	time	NN
cord-252671-uf96jgig	144	4	quantitative	quantitative	JJ
cord-252671-uf96jgig	144	5	reverse	reverse	NN
cord-252671-uf96jgig	144	6	transcription	transcription	NN
cord-252671-uf96jgig	144	7	PCR	pcr	NN
cord-252671-uf96jgig	145	1	(	(	-LRB-
cord-252671-uf96jgig	145	2	qRT	qRT	NNP
cord-252671-uf96jgig	145	3	-	-	HYPH
cord-252671-uf96jgig	145	4	PCR	PCR	NNP
cord-252671-uf96jgig	145	5	)	)	-RRB-
cord-252671-uf96jgig	145	6	analysis	analysis	NN
cord-252671-uf96jgig	145	7	shows	show	VBZ
cord-252671-uf96jgig	145	8	that	that	IN
cord-252671-uf96jgig	145	9	the	the	DT
cord-252671-uf96jgig	145	10	M	M	NNP
cord-252671-uf96jgig	145	11	-	-	HYPH
cord-252671-uf96jgig	145	12	stop	stop	NNP
cord-252671-uf96jgig	145	13	construct	construct	NN
cord-252671-uf96jgig	145	14	did	do	VBD
cord-252671-uf96jgig	145	15	not	not	RB
cord-252671-uf96jgig	145	16	induce	induce	VB
cord-252671-uf96jgig	145	17	IFN-	IFN-	NNP
cord-252671-uf96jgig	145	18	␤	␤	CD
cord-252671-uf96jgig	145	19	production	production	NN
cord-252671-uf96jgig	145	20	in	in	IN
cord-252671-uf96jgig	145	21	HEK293	HEK293	NNP
cord-252671-uf96jgig	145	22	T	T	NNP
cord-252671-uf96jgig	145	23	cells	cell	NNS
cord-252671-uf96jgig	145	24	,	,	,
cord-252671-uf96jgig	145	25	indicating	indicate	VBG
cord-252671-uf96jgig	145	26	that	that	IN
cord-252671-uf96jgig	145	27	M	M	NNP
cord-252671-uf96jgig	145	28	-	-	HYPH
cord-252671-uf96jgig	145	29	mediated	mediate	VBN
cord-252671-uf96jgig	145	30	IFN-	IFN-	NNP
cord-252671-uf96jgig	145	31	␤	␤	CD
cord-252671-uf96jgig	145	32	production	production	NN
cord-252671-uf96jgig	145	33	is	be	VBZ
cord-252671-uf96jgig	145	34	dependent	dependent	JJ
cord-252671-uf96jgig	145	35	on	on	IN
cord-252671-uf96jgig	145	36	M	M	NNP
cord-252671-uf96jgig	145	37	protein	protein	NN
cord-252671-uf96jgig	145	38	rather	rather	RB
cord-252671-uf96jgig	145	39	than	than	IN
cord-252671-uf96jgig	145	40	M	M	NNP
cord-252671-uf96jgig	145	41	mRNA	mRNA	NNP
cord-252671-uf96jgig	145	42	(	(	-LRB-
cord-252671-uf96jgig	145	43	Fig	Fig	NNP
cord-252671-uf96jgig	145	44	.	.	.
cord-252671-uf96jgig	145	45	5C	5c	CD
cord-252671-uf96jgig	145	46	)	)	-RRB-
cord-252671-uf96jgig	145	47	.	.	.
cord-252671-uf96jgig	146	1	To	to	TO
cord-252671-uf96jgig	146	2	directly	directly	RB
cord-252671-uf96jgig	146	3	compare	compare	VB
cord-252671-uf96jgig	146	4	M	M	NNP
cord-252671-uf96jgig	146	5	-	-	:
cord-252671-uf96jgig	146	6	and	and	CC
cord-252671-uf96jgig	146	7	M	M	NNP
cord-252671-uf96jgig	146	8	-	-	HYPH
cord-252671-uf96jgig	146	9	stop	stop	VB
cord-252671-uf96jgig	146	10	-	-	HYPH
cord-252671-uf96jgig	146	11	induced	induce	VBN
cord-252671-uf96jgig	146	12	IFN-	IFN-	NNP
cord-252671-uf96jgig	146	13	␤	␤	CD
cord-252671-uf96jgig	146	14	production	production	NN
cord-252671-uf96jgig	146	15	levels	level	NNS
cord-252671-uf96jgig	146	16	,	,	,
cord-252671-uf96jgig	146	17	the	the	DT
cord-252671-uf96jgig	146	18	increased	increase	VBN
cord-252671-uf96jgig	146	19	doses	dose	NNS
cord-252671-uf96jgig	146	20	of	of	IN
cord-252671-uf96jgig	146	21	either	either	DT
cord-252671-uf96jgig	146	22	M	M	NNP
cord-252671-uf96jgig	146	23	or	or	CC
cord-252671-uf96jgig	146	24	M	M	NNP
cord-252671-uf96jgig	146	25	-	-	HYPH
cord-252671-uf96jgig	146	26	stop	stop	NN
cord-252671-uf96jgig	146	27	constructs	construct	NNS
cord-252671-uf96jgig	146	28	were	be	VBD
cord-252671-uf96jgig	146	29	cotransfected	cotransfecte	VBN
cord-252671-uf96jgig	146	30	with	with	IN
cord-252671-uf96jgig	146	31	IFN-	IFN-	NNP
cord-252671-uf96jgig	146	32	␤	␤	``
cord-252671-uf96jgig	146	33	luciferase	luciferase	NN
cord-252671-uf96jgig	146	34	reporter	reporter	NN
cord-252671-uf96jgig	146	35	into	into	IN
cord-252671-uf96jgig	146	36	HEK293	HEK293	NNP
cord-252671-uf96jgig	146	37	T	T	NNP
cord-252671-uf96jgig	146	38	cells	cell	NNS
cord-252671-uf96jgig	146	39	.	.	.
cord-252671-uf96jgig	147	1	Figure	figure	NN
cord-252671-uf96jgig	147	2	5D	5d	CD
cord-252671-uf96jgig	147	3	clearly	clearly	RB
cord-252671-uf96jgig	147	4	demonstrates	demonstrate	VBZ
cord-252671-uf96jgig	147	5	that	that	IN
cord-252671-uf96jgig	147	6	M	M	NNP
cord-252671-uf96jgig	147	7	-	-	HYPH
cord-252671-uf96jgig	147	8	stop	stop	NNP
cord-252671-uf96jgig	147	9	does	do	VBZ
cord-252671-uf96jgig	147	10	not	not	RB
cord-252671-uf96jgig	147	11	induce	induce	VB
cord-252671-uf96jgig	147	12	IFN-	IFN-	NNP
cord-252671-uf96jgig	147	13	␤	␤	CD
cord-252671-uf96jgig	147	14	production	production	NN
cord-252671-uf96jgig	147	15	,	,	,
cord-252671-uf96jgig	147	16	indicating	indicate	VBG
cord-252671-uf96jgig	147	17	that	that	IN
cord-252671-uf96jgig	147	18	protein	protein	NN
cord-252671-uf96jgig	147	19	translation	translation	NN
cord-252671-uf96jgig	147	20	is	be	VBZ
cord-252671-uf96jgig	147	21	necessary	necessary	JJ
cord-252671-uf96jgig	147	22	for	for	IN
cord-252671-uf96jgig	147	23	M	M	NNP
cord-252671-uf96jgig	147	24	-	-	HYPH
cord-252671-uf96jgig	147	25	induced	induce	VBN
cord-252671-uf96jgig	147	26	IFN-	IFN-	NNP
cord-252671-uf96jgig	147	27	␤	␤	CD
cord-252671-uf96jgig	147	28	production	production	NN
cord-252671-uf96jgig	147	29	.	.	.
cord-252671-uf96jgig	148	1	To	to	TO
cord-252671-uf96jgig	148	2	confirm	confirm	VB
cord-252671-uf96jgig	148	3	this	this	DT
cord-252671-uf96jgig	148	4	result	result	NN
cord-252671-uf96jgig	148	5	further	further	RB
cord-252671-uf96jgig	148	6	,	,	,
cord-252671-uf96jgig	148	7	the	the	DT
cord-252671-uf96jgig	148	8	chemical	chemical	JJ
cord-252671-uf96jgig	148	9	inhibitor	inhibitor	NN
cord-252671-uf96jgig	148	10	cycloheximide	cycloheximide	NN
cord-252671-uf96jgig	148	11	(	(	-LRB-
cord-252671-uf96jgig	148	12	CHX	CHX	NNP
cord-252671-uf96jgig	148	13	)	)	-RRB-
cord-252671-uf96jgig	148	14	was	be	VBD
cord-252671-uf96jgig	148	15	used	use	VBN
cord-252671-uf96jgig	148	16	to	to	TO
cord-252671-uf96jgig	148	17	block	block	VB
cord-252671-uf96jgig	148	18	the	the	DT
cord-252671-uf96jgig	148	19	protein	protein	NN
cord-252671-uf96jgig	148	20	biosynthesis	biosynthesis	NN
cord-252671-uf96jgig	148	21	in	in	IN
cord-252671-uf96jgig	148	22	transfected	transfecte	VBN
cord-252671-uf96jgig	148	23	HEK293	HEK293	NNP
cord-252671-uf96jgig	148	24	T	t	NN
cord-252671-uf96jgig	148	25	cells	cell	NNS
cord-252671-uf96jgig	148	26	.	.	.
cord-252671-uf96jgig	149	1	Figure	figure	NN
cord-252671-uf96jgig	149	2	5E	5e	NN
cord-252671-uf96jgig	149	3	shows	show	VBZ
cord-252671-uf96jgig	149	4	that	that	IN
cord-252671-uf96jgig	149	5	addition	addition	NN
cord-252671-uf96jgig	149	6	of	of	IN
cord-252671-uf96jgig	149	7	CHX	CHX	NNP
cord-252671-uf96jgig	149	8	significantly	significantly	RB
cord-252671-uf96jgig	149	9	inhibited	inhibit	VBD
cord-252671-uf96jgig	149	10	and	and	CC
cord-252671-uf96jgig	149	11	completely	completely	RB
cord-252671-uf96jgig	149	12	blocked	block	VBN
cord-252671-uf96jgig	149	13	M	M	NNP
cord-252671-uf96jgig	149	14	protein	protein	NN
cord-252671-uf96jgig	149	15	synthesis	synthesis	NN
cord-252671-uf96jgig	149	16	at	at	IN
cord-252671-uf96jgig	149	17	5	5	CD
cord-252671-uf96jgig	149	18	g	g	NN
cord-252671-uf96jgig	149	19	/	/	SYM
cord-252671-uf96jgig	149	20	ml	ml	NN
cord-252671-uf96jgig	149	21	and	and	CC
cord-252671-uf96jgig	149	22	above	above	IN
cord-252671-uf96jgig	149	23	20	20	CD
cord-252671-uf96jgig	149	24	g/	g/	NNS
cord-252671-uf96jgig	149	25	ml	ml	NNS
cord-252671-uf96jgig	149	26	,	,	,
cord-252671-uf96jgig	149	27	respectively	respectively	RB
cord-252671-uf96jgig	149	28	,	,	,
cord-252671-uf96jgig	149	29	which	which	WDT
cord-252671-uf96jgig	149	30	are	be	VBP
cord-252671-uf96jgig	149	31	directly	directly	RB
cord-252671-uf96jgig	149	32	correlated	correlate	VBN
cord-252671-uf96jgig	149	33	with	with	IN
cord-252671-uf96jgig	149	34	the	the	DT
cord-252671-uf96jgig	149	35	marked	marked	JJ
cord-252671-uf96jgig	149	36	reduction	reduction	NN
cord-252671-uf96jgig	149	37	and	and	CC
cord-252671-uf96jgig	149	38	complete	complete	JJ
cord-252671-uf96jgig	149	39	inhibition	inhibition	NN
cord-252671-uf96jgig	149	40	in	in	IN
cord-252671-uf96jgig	149	41	IFN-	IFN-	NNP
cord-252671-uf96jgig	149	42	␤	␤	DT
cord-252671-uf96jgig	149	43	expression	expression	NN
cord-252671-uf96jgig	149	44	,	,	,
cord-252671-uf96jgig	149	45	indicating	indicate	VBG
cord-252671-uf96jgig	149	46	that	that	IN
cord-252671-uf96jgig	149	47	M	M	NNP
cord-252671-uf96jgig	149	48	protein	protein	NN
cord-252671-uf96jgig	149	49	may	may	MD
cord-252671-uf96jgig	149	50	function	function	VB
cord-252671-uf96jgig	149	51	as	as	IN
cord-252671-uf96jgig	149	52	a	a	DT
cord-252671-uf96jgig	149	53	PAMP	PAMP	NNP
cord-252671-uf96jgig	149	54	to	to	TO
cord-252671-uf96jgig	149	55	induce	induce	VB
cord-252671-uf96jgig	149	56	IFN-	IFN-	NNP
cord-252671-uf96jgig	149	57	␤	␤	CD
cord-252671-uf96jgig	149	58	production	production	NN
cord-252671-uf96jgig	149	59	.	.	.
cord-252671-uf96jgig	150	1	If	if	IN
cord-252671-uf96jgig	150	2	M	M	NNP
cord-252671-uf96jgig	150	3	protein	protein	NN
cord-252671-uf96jgig	150	4	indeed	indeed	RB
cord-252671-uf96jgig	150	5	functions	function	VBZ
cord-252671-uf96jgig	150	6	as	as	IN
cord-252671-uf96jgig	150	7	a	a	DT
cord-252671-uf96jgig	150	8	PAMP	PAMP	NNP
cord-252671-uf96jgig	150	9	,	,	,
cord-252671-uf96jgig	150	10	blocking	block	VBG
cord-252671-uf96jgig	150	11	M	M	NNP
cord-252671-uf96jgig	150	12	protein	protein	NN
cord-252671-uf96jgig	150	13	synthesis	synthesis	NN
cord-252671-uf96jgig	150	14	should	should	MD
cord-252671-uf96jgig	150	15	prevent	prevent	VB
cord-252671-uf96jgig	150	16	the	the	DT
cord-252671-uf96jgig	150	17	M	M	NNP
cord-252671-uf96jgig	150	18	-	-	HYPH
cord-252671-uf96jgig	150	19	mediated	mediate	VBN
cord-252671-uf96jgig	150	20	activation	activation	NN
cord-252671-uf96jgig	150	21	of	of	IN
cord-252671-uf96jgig	150	22	the	the	DT
cord-252671-uf96jgig	150	23	IFN-	IFN-	NNP
cord-252671-uf96jgig	150	24	␤	␤	DT
cord-252671-uf96jgig	150	25	signaling	signal	VBG
cord-252671-uf96jgig	150	26	pathway	pathway	NN
cord-252671-uf96jgig	150	27	.	.	.
cord-252671-uf96jgig	151	1	Figure	figure	NN
cord-252671-uf96jgig	151	2	5F	5f	NN
cord-252671-uf96jgig	151	3	clearly	clearly	RB
cord-252671-uf96jgig	151	4	shows	show	VBZ
cord-252671-uf96jgig	151	5	that	that	IN
cord-252671-uf96jgig	151	6	M	M	NNP
cord-252671-uf96jgig	151	7	-	-	HYPH
cord-252671-uf96jgig	151	8	stop	stop	NNP
cord-252671-uf96jgig	151	9	reverses	reverse	VBZ
cord-252671-uf96jgig	151	10	the	the	DT
cord-252671-uf96jgig	151	11	M	M	NNP
cord-252671-uf96jgig	151	12	-	-	HYPH
cord-252671-uf96jgig	151	13	mediated	mediate	VBN
cord-252671-uf96jgig	151	14	upregulation	upregulation	NN
cord-252671-uf96jgig	151	15	of	of	IN
cord-252671-uf96jgig	151	16	the	the	DT
cord-252671-uf96jgig	151	17	adaptor	adaptor	NN
cord-252671-uf96jgig	151	18	proteins	protein	NNS
cord-252671-uf96jgig	151	19	MyD88	MyD88	NNS
cord-252671-uf96jgig	151	20	and	and	CC
cord-252671-uf96jgig	151	21	TICAM2	TICAM2	NNP
cord-252671-uf96jgig	151	22	/	/	SYM
cord-252671-uf96jgig	151	23	TRAM	TRAM	NNP
cord-252671-uf96jgig	151	24	in	in	IN
cord-252671-uf96jgig	151	25	the	the	DT
cord-252671-uf96jgig	151	26	initiating	initiating	NN
cord-252671-uf96jgig	151	27	phase	phase	NN
cord-252671-uf96jgig	151	28	of	of	IN
cord-252671-uf96jgig	151	29	TLR	TLR	NNP
cord-252671-uf96jgig	151	30	signaling	signal	VBG
cord-252671-uf96jgig	151	31	pathways	pathway	NNS
cord-252671-uf96jgig	151	32	.	.	.
cord-252671-uf96jgig	152	1	Moreover	moreover	RB
cord-252671-uf96jgig	152	2	,	,	,
cord-252671-uf96jgig	152	3	M	M	NNP
cord-252671-uf96jgig	152	4	-	-	HYPH
cord-252671-uf96jgig	152	5	stop	stop	NNP
cord-252671-uf96jgig	152	6	prevents	prevent	VBZ
cord-252671-uf96jgig	152	7	the	the	DT
cord-252671-uf96jgig	152	8	activation	activation	NN
cord-252671-uf96jgig	152	9	of	of	IN
cord-252671-uf96jgig	152	10	the	the	DT
cord-252671-uf96jgig	152	11	downstream	downstream	JJ
cord-252671-uf96jgig	152	12	modulator	modulator	NN
cord-252671-uf96jgig	152	13	and	and	CC
cord-252671-uf96jgig	152	14	key	key	JJ
cord-252671-uf96jgig	152	15	effectors	effector	NNS
cord-252671-uf96jgig	152	16	of	of	IN
cord-252671-uf96jgig	152	17	the	the	DT
cord-252671-uf96jgig	152	18	IFN-	IFN-	NNP
cord-252671-uf96jgig	152	19	␤	␤	DT
cord-252671-uf96jgig	152	20	signaling	signal	VBG
cord-252671-uf96jgig	152	21	pathway	pathway	NN
cord-252671-uf96jgig	152	22	,	,	,
cord-252671-uf96jgig	152	23	such	such	JJ
cord-252671-uf96jgig	152	24	as	as	IN
cord-252671-uf96jgig	152	25	TBK1	TBK1	NNP
cord-252671-uf96jgig	152	26	,	,	,
cord-252671-uf96jgig	152	27	IRF3	IRF3	NNP
cord-252671-uf96jgig	152	28	,	,	,
cord-252671-uf96jgig	152	29	and	and	CC
cord-252671-uf96jgig	152	30	NF	nf	NN
cord-252671-uf96jgig	152	31	-	-	HYPH
cord-252671-uf96jgig	152	32	B	b	NN
cord-252671-uf96jgig	152	33	p65	p65	NN
cord-252671-uf96jgig	152	34	,	,	,
cord-252671-uf96jgig	152	35	in	in	IN
cord-252671-uf96jgig	152	36	a	a	DT
cord-252671-uf96jgig	152	37	dose	dose	NN
cord-252671-uf96jgig	152	38	-	-	HYPH
cord-252671-uf96jgig	152	39	dependent	dependent	JJ
cord-252671-uf96jgig	152	40	manner	manner	NN
cord-252671-uf96jgig	152	41	(	(	-LRB-
cord-252671-uf96jgig	152	42	Fig	Fig	NNP
cord-252671-uf96jgig	152	43	.	.	.
cord-252671-uf96jgig	152	44	5F	5F	NNP
cord-252671-uf96jgig	152	45	)	)	-RRB-
cord-252671-uf96jgig	152	46	.	.	.
cord-252671-uf96jgig	153	1	Thus	thus	RB
cord-252671-uf96jgig	153	2	,	,	,
cord-252671-uf96jgig	153	3	blocking	block	VBG
cord-252671-uf96jgig	153	4	M	M	NNP
cord-252671-uf96jgig	153	5	protein	protein	NN
cord-252671-uf96jgig	153	6	translation	translation	NN
cord-252671-uf96jgig	153	7	could	could	MD
cord-252671-uf96jgig	153	8	prevent	prevent	VB
cord-252671-uf96jgig	153	9	M	M	NNP
cord-252671-uf96jgig	153	10	-	-	HYPH
cord-252671-uf96jgig	153	11	mediated	mediate	VBN
cord-252671-uf96jgig	153	12	IFN-	IFN-	NNP
cord-252671-uf96jgig	153	13	␤	␤	CD
cord-252671-uf96jgig	153	14	induction	induction	NN
cord-252671-uf96jgig	153	15	by	by	IN
cord-252671-uf96jgig	153	16	inactivating	inactivate	VBG
cord-252671-uf96jgig	153	17	the	the	DT
cord-252671-uf96jgig	153	18	TLRrelated	tlrrelate	VBN
cord-252671-uf96jgig	153	19	signaling	signal	VBG
cord-252671-uf96jgig	153	20	pathway	pathway	NN
cord-252671-uf96jgig	153	21	.	.	.
cord-252671-uf96jgig	154	1	SARS	SARS	NNP
cord-252671-uf96jgig	154	2	-	-	HYPH
cord-252671-uf96jgig	154	3	CoV	CoV	NNP
cord-252671-uf96jgig	154	4	M	M	NNP
cord-252671-uf96jgig	154	5	protein	protein	NN
cord-252671-uf96jgig	154	6	may	may	MD
cord-252671-uf96jgig	154	7	function	function	VB
cord-252671-uf96jgig	154	8	as	as	IN
cord-252671-uf96jgig	154	9	a	a	DT
cord-252671-uf96jgig	154	10	novel	novel	NN
cord-252671-uf96jgig	154	11	intracellular	intracellular	JJ
cord-252671-uf96jgig	154	12	PAMP	PAMP	NNP
cord-252671-uf96jgig	154	13	to	to	TO
cord-252671-uf96jgig	154	14	induce	induce	VB
cord-252671-uf96jgig	154	15	IFN-	IFN-	NNP
cord-252671-uf96jgig	154	16	␤	␤	CD
cord-252671-uf96jgig	154	17	production	production	NN
cord-252671-uf96jgig	154	18	.	.	.
cord-252671-uf96jgig	155	1	One	one	CD
cord-252671-uf96jgig	155	2	critical	critical	JJ
cord-252671-uf96jgig	155	3	question	question	NN
cord-252671-uf96jgig	155	4	remaining	remain	VBG
cord-252671-uf96jgig	155	5	to	to	TO
cord-252671-uf96jgig	155	6	be	be	VB
cord-252671-uf96jgig	155	7	answered	answer	VBN
cord-252671-uf96jgig	155	8	is	be	VBZ
cord-252671-uf96jgig	155	9	whether	whether	IN
cord-252671-uf96jgig	155	10	the	the	DT
cord-252671-uf96jgig	155	11	driving	drive	VBG
cord-252671-uf96jgig	155	12	force	force	NN
cord-252671-uf96jgig	155	13	for	for	IN
cord-252671-uf96jgig	155	14	M	M	NNP
cord-252671-uf96jgig	155	15	protein	protein	NN
cord-252671-uf96jgig	155	16	-	-	HYPH
cord-252671-uf96jgig	155	17	mediated	mediate	VBN
cord-252671-uf96jgig	155	18	IFN-	IFN-	NNP
cord-252671-uf96jgig	155	19	␤	␤	CD
cord-252671-uf96jgig	155	20	induction	induction	NN
cord-252671-uf96jgig	155	21	is	be	VBZ
cord-252671-uf96jgig	155	22	generated	generate	VBN
cord-252671-uf96jgig	155	23	intracellularly	intracellularly	RB
cord-252671-uf96jgig	155	24	or	or	CC
cord-252671-uf96jgig	155	25	extracellularly	extracellularly	RB
cord-252671-uf96jgig	155	26	.	.	.
cord-252671-uf96jgig	156	1	To	to	TO
cord-252671-uf96jgig	156	2	answer	answer	VB
cord-252671-uf96jgig	156	3	this	this	DT
cord-252671-uf96jgig	156	4	question	question	NN
cord-252671-uf96jgig	156	5	directly	directly	RB
cord-252671-uf96jgig	156	6	,	,	,
cord-252671-uf96jgig	156	7	the	the	DT
cord-252671-uf96jgig	156	8	TRAP	trap	NN
cord-252671-uf96jgig	156	9	␥	␥	NNP
cord-252671-uf96jgig	156	10	gene	gene	NN
cord-252671-uf96jgig	156	11	,	,	,
cord-252671-uf96jgig	156	12	an	an	DT
cord-252671-uf96jgig	156	13	endoplasmic	endoplasmic	NN
cord-252671-uf96jgig	156	14	reticulum	reticulum	NN
cord-252671-uf96jgig	156	15	(	(	-LRB-
cord-252671-uf96jgig	156	16	ER)-associated	er)-associated	CD
cord-252671-uf96jgig	156	17	gene	gene	NN
cord-252671-uf96jgig	156	18	,	,	,
cord-252671-uf96jgig	156	19	was	be	VBD
cord-252671-uf96jgig	156	20	cotransfected	cotransfecte	VBN
cord-252671-uf96jgig	156	21	with	with	IN
cord-252671-uf96jgig	156	22	M	M	NNP
cord-252671-uf96jgig	156	23	into	into	IN
cord-252671-uf96jgig	156	24	HeLa	HeLa	NNP
cord-252671-uf96jgig	156	25	cells	cell	NNS
cord-252671-uf96jgig	156	26	.	.	.
cord-252671-uf96jgig	157	1	Brefeldin	Brefeldin	NNP
cord-252671-uf96jgig	157	2	A	A	NNP
cord-252671-uf96jgig	157	3	(	(	-LRB-
cord-252671-uf96jgig	157	4	BFA	BFA	NNP
cord-252671-uf96jgig	157	5	)	)	-RRB-
cord-252671-uf96jgig	157	6	was	be	VBD
cord-252671-uf96jgig	157	7	employed	employ	VBN
cord-252671-uf96jgig	157	8	in	in	IN
cord-252671-uf96jgig	157	9	the	the	DT
cord-252671-uf96jgig	157	10	assay	assay	NN
cord-252671-uf96jgig	157	11	system	system	NN
cord-252671-uf96jgig	157	12	to	to	TO
cord-252671-uf96jgig	157	13	block	block	VB
cord-252671-uf96jgig	157	14	M	M	NNP
cord-252671-uf96jgig	157	15	protein	protein	NN
cord-252671-uf96jgig	157	16	transport	transport	NN
cord-252671-uf96jgig	157	17	from	from	IN
cord-252671-uf96jgig	157	18	the	the	DT
cord-252671-uf96jgig	157	19	rough	rough	JJ
cord-252671-uf96jgig	157	20	endoplasmic	endoplasmic	NN
cord-252671-uf96jgig	157	21	reticulum	reticulum	NN
cord-252671-uf96jgig	157	22	to	to	IN
cord-252671-uf96jgig	157	23	the	the	DT
cord-252671-uf96jgig	157	24	cell	cell	NN
cord-252671-uf96jgig	157	25	surface	surface	NN
cord-252671-uf96jgig	157	26	.	.	.
cord-252671-uf96jgig	158	1	Indeed	indeed	RB
cord-252671-uf96jgig	158	2	,	,	,
cord-252671-uf96jgig	158	3	the	the	DT
cord-252671-uf96jgig	158	4	addition	addition	NN
cord-252671-uf96jgig	158	5	of	of	IN
cord-252671-uf96jgig	158	6	BFA	BFA	NNP
cord-252671-uf96jgig	158	7	effectively	effectively	RB
cord-252671-uf96jgig	158	8	increased	increase	VBD
cord-252671-uf96jgig	158	9	the	the	DT
cord-252671-uf96jgig	158	10	retention	retention	NN
cord-252671-uf96jgig	158	11	of	of	IN
cord-252671-uf96jgig	158	12	M	M	NNP
cord-252671-uf96jgig	158	13	proteins	protein	NNS
cord-252671-uf96jgig	158	14	in	in	IN
cord-252671-uf96jgig	158	15	the	the	DT
cord-252671-uf96jgig	158	16	ER	ER	NNP
cord-252671-uf96jgig	158	17	compartment	compartment	NN
cord-252671-uf96jgig	158	18	(	(	-LRB-
cord-252671-uf96jgig	158	19	Fig	Fig	NNP
cord-252671-uf96jgig	158	20	.	.	.
cord-252671-uf96jgig	158	21	6A	6a	CD
cord-252671-uf96jgig	158	22	)	)	-RRB-
cord-252671-uf96jgig	158	23	.	.	.
cord-252671-uf96jgig	159	1	Figure	figure	NN
cord-252671-uf96jgig	159	2	6B	6b	NN
cord-252671-uf96jgig	159	3	shows	show	VBZ
cord-252671-uf96jgig	159	4	that	that	IN
cord-252671-uf96jgig	159	5	addition	addition	NN
cord-252671-uf96jgig	159	6	of	of	IN
cord-252671-uf96jgig	159	7	BFA	BFA	NNP
cord-252671-uf96jgig	159	8	also	also	RB
cord-252671-uf96jgig	159	9	effectively	effectively	RB
cord-252671-uf96jgig	159	10	inhibited	inhibit	VBD
cord-252671-uf96jgig	159	11	the	the	DT
cord-252671-uf96jgig	159	12	secretion	secretion	NN
cord-252671-uf96jgig	159	13	of	of	IN
cord-252671-uf96jgig	159	14	IFN-	IFN-	NNP
cord-252671-uf96jgig	159	15	␤	␤	''
cord-252671-uf96jgig	159	16	into	into	IN
cord-252671-uf96jgig	159	17	the	the	DT
cord-252671-uf96jgig	159	18	cell	cell	NN
cord-252671-uf96jgig	159	19	culture	culture	NN
cord-252671-uf96jgig	159	20	medium	medium	NN
cord-252671-uf96jgig	159	21	(	(	-LRB-
cord-252671-uf96jgig	159	22	right	right	JJ
cord-252671-uf96jgig	159	23	panel	panel	NN
cord-252671-uf96jgig	159	24	)	)	-RRB-
cord-252671-uf96jgig	159	25	but	but	CC
cord-252671-uf96jgig	159	26	did	do	VBD
cord-252671-uf96jgig	159	27	not	not	RB
cord-252671-uf96jgig	159	28	inhibit	inhibit	VB
cord-252671-uf96jgig	159	29	M	M	NNP
cord-252671-uf96jgig	159	30	-	-	HYPH
cord-252671-uf96jgig	159	31	mediated	mediate	VBN
cord-252671-uf96jgig	159	32	IFN-	IFN-	NNP
cord-252671-uf96jgig	159	33	␤	␤	CD
cord-252671-uf96jgig	159	34	induction	induction	NN
cord-252671-uf96jgig	159	35	at	at	IN
cord-252671-uf96jgig	159	36	either	either	CC
cord-252671-uf96jgig	159	37	the	the	DT
cord-252671-uf96jgig	159	38	mRNA	mRNA	NNP
cord-252671-uf96jgig	159	39	level	level	NN
cord-252671-uf96jgig	159	40	or	or	CC
cord-252671-uf96jgig	159	41	the	the	DT
cord-252671-uf96jgig	159	42	protein	protein	NN
cord-252671-uf96jgig	159	43	level	level	NN
cord-252671-uf96jgig	159	44	(	(	-LRB-
cord-252671-uf96jgig	159	45	left	left	JJ
cord-252671-uf96jgig	159	46	panel	panel	NN
cord-252671-uf96jgig	159	47	)	)	-RRB-
cord-252671-uf96jgig	159	48	,	,	,
cord-252671-uf96jgig	159	49	indicating	indicate	VBG
cord-252671-uf96jgig	159	50	that	that	IN
cord-252671-uf96jgig	159	51	the	the	DT
cord-252671-uf96jgig	159	52	driving	drive	VBG
cord-252671-uf96jgig	159	53	force	force	NN
cord-252671-uf96jgig	159	54	for	for	IN
cord-252671-uf96jgig	159	55	M	M	NNP
cord-252671-uf96jgig	159	56	-	-	HYPH
cord-252671-uf96jgig	159	57	mediated	mediate	VBN
cord-252671-uf96jgig	159	58	IFN-	IFN-	NNP
cord-252671-uf96jgig	159	59	␤	␤	CD
cord-252671-uf96jgig	159	60	induction	induction	NN
cord-252671-uf96jgig	159	61	was	be	VBD
cord-252671-uf96jgig	159	62	indeed	indeed	RB
cord-252671-uf96jgig	159	63	derived	derive	VBN
cord-252671-uf96jgig	159	64	from	from	IN
cord-252671-uf96jgig	159	65	intracellular	intracellular	JJ
cord-252671-uf96jgig	159	66	stimulation	stimulation	NN
cord-252671-uf96jgig	159	67	by	by	IN
cord-252671-uf96jgig	159	68	M	M	NNP
cord-252671-uf96jgig	159	69	proteins	protein	NNS
cord-252671-uf96jgig	159	70	.	.	.
cord-252671-uf96jgig	160	1	Reports	report	NNS
cord-252671-uf96jgig	160	2	indicate	indicate	VBP
cord-252671-uf96jgig	160	3	that	that	IN
cord-252671-uf96jgig	160	4	SARS	SARS	NNP
cord-252671-uf96jgig	160	5	-	-	HYPH
cord-252671-uf96jgig	160	6	CoV	CoV	NNP
cord-252671-uf96jgig	160	7	M	M	NNP
cord-252671-uf96jgig	160	8	protein	protein	NN
cord-252671-uf96jgig	160	9	alone	alone	RB
cord-252671-uf96jgig	160	10	can	can	MD
cord-252671-uf96jgig	160	11	form	form	VB
cord-252671-uf96jgig	160	12	virus	virus	NN
cord-252671-uf96jgig	160	13	-	-	HYPH
cord-252671-uf96jgig	160	14	like	like	JJ
cord-252671-uf96jgig	160	15	particles	particle	NNS
cord-252671-uf96jgig	160	16	(	(	-LRB-
cord-252671-uf96jgig	160	17	VLPs	vlp	NNS
cord-252671-uf96jgig	160	18	)	)	-RRB-
cord-252671-uf96jgig	160	19	that	that	WDT
cord-252671-uf96jgig	160	20	can	can	MD
cord-252671-uf96jgig	160	21	be	be	VB
cord-252671-uf96jgig	160	22	secreted	secrete	VBN
cord-252671-uf96jgig	160	23	extracellularly	extracellularly	RB
cord-252671-uf96jgig	160	24	.	.	.
cord-252671-uf96jgig	161	1	Therefore	therefore	RB
cord-252671-uf96jgig	161	2	,	,	,
cord-252671-uf96jgig	161	3	the	the	DT
cord-252671-uf96jgig	161	4	secreted	secrete	VBN
cord-252671-uf96jgig	161	5	M	M	NNP
cord-252671-uf96jgig	161	6	protein	protein	NN
cord-252671-uf96jgig	161	7	might	may	MD
cord-252671-uf96jgig	161	8	be	be	VB
cord-252671-uf96jgig	161	9	sensed	sense	VBN
cord-252671-uf96jgig	161	10	by	by	IN
cord-252671-uf96jgig	161	11	its	-PRON-	PRP$
cord-252671-uf96jgig	161	12	own	own	JJ
cord-252671-uf96jgig	161	13	or	or	CC
cord-252671-uf96jgig	161	14	other	other	JJ
cord-252671-uf96jgig	161	15	cell	cell	NN
cord-252671-uf96jgig	161	16	PRRs	prr	NNS
cord-252671-uf96jgig	161	17	on	on	IN
cord-252671-uf96jgig	161	18	the	the	DT
cord-252671-uf96jgig	161	19	cell	cell	NN
cord-252671-uf96jgig	161	20	surface	surface	NN
cord-252671-uf96jgig	161	21	to	to	TO
cord-252671-uf96jgig	161	22	activate	activate	VB
cord-252671-uf96jgig	161	23	IFN	IFN	NNP
cord-252671-uf96jgig	161	24	-	-	HYPH
cord-252671-uf96jgig	161	25	I	-PRON-	PRP
cord-252671-uf96jgig	161	26	responses	response	NNS
cord-252671-uf96jgig	161	27	.	.	.
cord-252671-uf96jgig	162	1	To	to	TO
cord-252671-uf96jgig	162	2	rule	rule	VB
cord-252671-uf96jgig	162	3	out	out	RP
cord-252671-uf96jgig	162	4	this	this	DT
cord-252671-uf96jgig	162	5	possibility	possibility	NN
cord-252671-uf96jgig	162	6	,	,	,
cord-252671-uf96jgig	162	7	OxPAPC	OxPAPC	NNP
cord-252671-uf96jgig	162	8	(	(	-LRB-
cord-252671-uf96jgig	162	9	a	a	DT
cord-252671-uf96jgig	162	10	TLR2	TLR2	NNP
cord-252671-uf96jgig	162	11	and	and	CC
cord-252671-uf96jgig	162	12	TLR4	TLR4	NNP
cord-252671-uf96jgig	162	13	inhibitor	inhibitor	NN
cord-252671-uf96jgig	162	14	)	)	-RRB-
cord-252671-uf96jgig	162	15	was	be	VBD
cord-252671-uf96jgig	162	16	used	use	VBN
cord-252671-uf96jgig	162	17	to	to	TO
cord-252671-uf96jgig	162	18	block	block	VB
cord-252671-uf96jgig	162	19	the	the	DT
cord-252671-uf96jgig	162	20	function	function	NN
cord-252671-uf96jgig	162	21	of	of	IN
cord-252671-uf96jgig	162	22	the	the	DT
cord-252671-uf96jgig	162	23	accessory	accessory	NN
cord-252671-uf96jgig	162	24	proteins	protein	NNS
cord-252671-uf96jgig	162	25	CD14	CD14	NNP
cord-252671-uf96jgig	162	26	,	,	,
cord-252671-uf96jgig	162	27	LBP	LBP	NNP
cord-252671-uf96jgig	162	28	,	,	,
cord-252671-uf96jgig	162	29	and	and	CC
cord-252671-uf96jgig	162	30	MD2	MD2	NNP
cord-252671-uf96jgig	162	31	that	that	WDT
cord-252671-uf96jgig	162	32	are	be	VBP
cord-252671-uf96jgig	162	33	required	require	VBN
cord-252671-uf96jgig	162	34	for	for	IN
cord-252671-uf96jgig	162	35	TLR2	TLR2	NNP
cord-252671-uf96jgig	162	36	and	and	CC
cord-252671-uf96jgig	162	37	TLR4	TLR4	NNP
cord-252671-uf96jgig	162	38	signaling	signal	VBG
cord-252671-uf96jgig	162	39	(	(	-LRB-
cord-252671-uf96jgig	162	40	32	32	CD
cord-252671-uf96jgig	162	41	)	)	-RRB-
cord-252671-uf96jgig	162	42	.	.	.
cord-252671-uf96jgig	163	1	Figure	figure	NN
cord-252671-uf96jgig	163	2	6C	6c	NN
cord-252671-uf96jgig	163	3	shows	show	VBZ
cord-252671-uf96jgig	163	4	that	that	IN
cord-252671-uf96jgig	163	5	addition	addition	NN
cord-252671-uf96jgig	163	6	of	of	IN
cord-252671-uf96jgig	163	7	OxPAPC	OxPAPC	NNP
cord-252671-uf96jgig	163	8	could	could	MD
cord-252671-uf96jgig	163	9	effectively	effectively	RB
cord-252671-uf96jgig	163	10	inhibit	inhibit	VB
cord-252671-uf96jgig	163	11	lipopolysaccharide	lipopolysaccharide	NN
cord-252671-uf96jgig	163	12	(	(	-LRB-
cord-252671-uf96jgig	164	1	LPS)-mediated	lps)-mediated	JJ
cord-252671-uf96jgig	164	2	IFN-	IFN-	NNP
cord-252671-uf96jgig	164	3	␤	␤	CD
cord-252671-uf96jgig	164	4	production	production	NN
cord-252671-uf96jgig	164	5	(	(	-LRB-
cord-252671-uf96jgig	164	6	right	right	JJ
cord-252671-uf96jgig	164	7	panel	panel	NN
cord-252671-uf96jgig	164	8	)	)	-RRB-
cord-252671-uf96jgig	165	1	but	but	CC
cord-252671-uf96jgig	165	2	did	do	VBD
cord-252671-uf96jgig	165	3	not	not	RB
cord-252671-uf96jgig	165	4	reverse	reverse	VB
cord-252671-uf96jgig	165	5	the	the	DT
cord-252671-uf96jgig	165	6	M	M	NNP
cord-252671-uf96jgig	165	7	-	-	HYPH
cord-252671-uf96jgig	165	8	mediated	mediate	VBN
cord-252671-uf96jgig	165	9	IFN-	IFN-	NNP
cord-252671-uf96jgig	165	10	␤	␤	CD
cord-252671-uf96jgig	165	11	induction	induction	NN
cord-252671-uf96jgig	165	12	(	(	-LRB-
cord-252671-uf96jgig	165	13	left	left	JJ
cord-252671-uf96jgig	165	14	panel	panel	NN
cord-252671-uf96jgig	165	15	)	)	-RRB-
cord-252671-uf96jgig	165	16	,	,	,
cord-252671-uf96jgig	165	17	indicating	indicate	VBG
cord-252671-uf96jgig	165	18	that	that	IN
cord-252671-uf96jgig	165	19	the	the	DT
cord-252671-uf96jgig	165	20	extracellular	extracellular	JJ
cord-252671-uf96jgig	165	21	stimulation	stimulation	NN
cord-252671-uf96jgig	165	22	by	by	IN
cord-252671-uf96jgig	165	23	M	M	NNP
cord-252671-uf96jgig	165	24	pro-	pro-	NN
cord-252671-uf96jgig	166	1	SARS	SARS	NNP
cord-252671-uf96jgig	166	2	-	-	HYPH
cord-252671-uf96jgig	166	3	CoV	CoV	NNP
cord-252671-uf96jgig	166	4	M	M	NNP
cord-252671-uf96jgig	166	5	protein	protein	NN
cord-252671-uf96jgig	166	6	promotes	promote	VBZ
cord-252671-uf96jgig	166	7	IFN-	IFN-	NNP
cord-252671-uf96jgig	166	8	␤	␤	CD
cord-252671-uf96jgig	166	9	induction	induction	NN
cord-252671-uf96jgig	166	10	independently	independently	RB
cord-252671-uf96jgig	166	11	of	of	IN
cord-252671-uf96jgig	166	12	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	166	13	.	.	.
cord-252671-uf96jgig	167	1	It	-PRON-	PRP
cord-252671-uf96jgig	167	2	has	have	VBZ
cord-252671-uf96jgig	167	3	been	be	VBN
cord-252671-uf96jgig	167	4	well	well	RB
cord-252671-uf96jgig	167	5	known	know	VBN
cord-252671-uf96jgig	167	6	that	that	IN
cord-252671-uf96jgig	167	7	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	167	8	plays	play	VBZ
cord-252671-uf96jgig	167	9	a	a	DT
cord-252671-uf96jgig	167	10	critical	critical	JJ
cord-252671-uf96jgig	167	11	role	role	NN
cord-252671-uf96jgig	167	12	in	in	IN
cord-252671-uf96jgig	167	13	TLR	TLR	NNP
cord-252671-uf96jgig	167	14	-	-	HYPH
cord-252671-uf96jgig	167	15	mediated	mediate	VBN
cord-252671-uf96jgig	167	16	IFN-	IFN-	NNP
cord-252671-uf96jgig	167	17	␤	␤	CD
cord-252671-uf96jgig	167	18	induction	induction	NN
cord-252671-uf96jgig	167	19	,	,	,
cord-252671-uf96jgig	167	20	especially	especially	RB
cord-252671-uf96jgig	167	21	through	through	IN
cord-252671-uf96jgig	167	22	TLR3	TLR3	NNP
cord-252671-uf96jgig	167	23	and	and	CC
cord-252671-uf96jgig	167	24	TLR4	TLR4	NNP
cord-252671-uf96jgig	167	25	pathways	pathway	NNS
cord-252671-uf96jgig	167	26	(	(	-LRB-
cord-252671-uf96jgig	167	27	27	27	CD
cord-252671-uf96jgig	167	28	,	,	,
cord-252671-uf96jgig	167	29	29	29	CD
cord-252671-uf96jgig	167	30	,	,	,
cord-252671-uf96jgig	167	31	33	33	CD
cord-252671-uf96jgig	167	32	)	)	-RRB-
cord-252671-uf96jgig	167	33	.	.	.
cord-252671-uf96jgig	168	1	Since	since	IN
cord-252671-uf96jgig	168	2	M	M	NNP
cord-252671-uf96jgig	168	3	protein	protein	NN
cord-252671-uf96jgig	168	4	could	could	MD
cord-252671-uf96jgig	168	5	activate	activate	VB
cord-252671-uf96jgig	168	6	the	the	DT
cord-252671-uf96jgig	168	7	TLR	TLR	NNP
cord-252671-uf96jgig	168	8	pathway	pathway	NN
cord-252671-uf96jgig	168	9	from	from	IN
cord-252671-uf96jgig	168	10	inside	inside	IN
cord-252671-uf96jgig	168	11	the	the	DT
cord-252671-uf96jgig	168	12	cells	cell	NNS
cord-252671-uf96jgig	168	13	,	,	,
cord-252671-uf96jgig	168	14	it	-PRON-	PRP
cord-252671-uf96jgig	168	15	remained	remain	VBD
cord-252671-uf96jgig	168	16	unclear	unclear	JJ
cord-252671-uf96jgig	168	17	whether	whether	IN
cord-252671-uf96jgig	168	18	or	or	CC
cord-252671-uf96jgig	168	19	not	not	RB
cord-252671-uf96jgig	168	20	this	this	DT
cord-252671-uf96jgig	168	21	activation	activation	NN
cord-252671-uf96jgig	168	22	is	be	VBZ
cord-252671-uf96jgig	168	23	in	in	IN
cord-252671-uf96jgig	168	24	a	a	DT
cord-252671-uf96jgig	168	25	TRAF3-dependent	traf3-dependent	CD
cord-252671-uf96jgig	168	26	or	or	CC
cord-252671-uf96jgig	168	27	-independent	-independent	JJ
cord-252671-uf96jgig	168	28	manner	manner	NN
cord-252671-uf96jgig	168	29	.	.	.
cord-252671-uf96jgig	169	1	To	to	TO
cord-252671-uf96jgig	169	2	address	address	VB
cord-252671-uf96jgig	169	3	this	this	DT
cord-252671-uf96jgig	169	4	issue	issue	NN
cord-252671-uf96jgig	169	5	directly	directly	RB
cord-252671-uf96jgig	169	6	,	,	,
cord-252671-uf96jgig	169	7	a	a	DT
cord-252671-uf96jgig	169	8	specific	specific	JJ
cord-252671-uf96jgig	169	9	siRNA	sirna	NN
cord-252671-uf96jgig	169	10	against	against	IN
cord-252671-uf96jgig	169	11	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	169	12	was	be	VBD
cord-252671-uf96jgig	169	13	successfully	successfully	RB
cord-252671-uf96jgig	169	14	constructed	construct	VBN
cord-252671-uf96jgig	170	1	(	(	-LRB-
cord-252671-uf96jgig	170	2	Fig	Fig	NNP
cord-252671-uf96jgig	170	3	.	.	.
cord-252671-uf96jgig	170	4	7A	7a	NN
cord-252671-uf96jgig	170	5	)	)	-RRB-
cord-252671-uf96jgig	170	6	.	.	.
cord-252671-uf96jgig	171	1	A	a	DT
cord-252671-uf96jgig	171	2	dual	dual	JJ
cord-252671-uf96jgig	171	3	-	-	HYPH
cord-252671-uf96jgig	171	4	luciferase	luciferase	NN
cord-252671-uf96jgig	171	5	assay	assay	NN
cord-252671-uf96jgig	171	6	was	be	VBD
cord-252671-uf96jgig	171	7	conducted	conduct	VBN
cord-252671-uf96jgig	171	8	to	to	TO
cord-252671-uf96jgig	171	9	assay	assay	VB
cord-252671-uf96jgig	171	10	the	the	DT
cord-252671-uf96jgig	171	11	effect	effect	NN
cord-252671-uf96jgig	171	12	of	of	IN
cord-252671-uf96jgig	171	13	siTRAF3	siTRAF3	NNP
cord-252671-uf96jgig	171	14	on	on	IN
cord-252671-uf96jgig	171	15	M	M	NNP
cord-252671-uf96jgig	171	16	-	-	HYPH
cord-252671-uf96jgig	171	17	mediated	mediate	VBN
cord-252671-uf96jgig	171	18	IFN-	IFN-	NNP
cord-252671-uf96jgig	171	19	␤	␤	CD
cord-252671-uf96jgig	171	20	induction	induction	NN
cord-252671-uf96jgig	171	21	in	in	IN
cord-252671-uf96jgig	171	22	HEK293	HEK293	NNP
cord-252671-uf96jgig	171	23	T	T	NNP
cord-252671-uf96jgig	171	24	cells	cell	NNS
cord-252671-uf96jgig	171	25	.	.	.
cord-252671-uf96jgig	172	1	Figure	figure	NN
cord-252671-uf96jgig	172	2	7B	7b	NN
cord-252671-uf96jgig	172	3	clearly	clearly	RB
cord-252671-uf96jgig	172	4	shows	show	VBZ
cord-252671-uf96jgig	172	5	that	that	IN
cord-252671-uf96jgig	172	6	the	the	DT
cord-252671-uf96jgig	172	7	increased	increase	VBN
cord-252671-uf96jgig	172	8	delivery	delivery	NN
cord-252671-uf96jgig	172	9	of	of	IN
cord-252671-uf96jgig	172	10	siTRAF3	siTRAF3	NNP
cord-252671-uf96jgig	172	11	did	do	VBD
cord-252671-uf96jgig	172	12	not	not	RB
cord-252671-uf96jgig	172	13	reverse	reverse	VB
cord-252671-uf96jgig	172	14	the	the	DT
cord-252671-uf96jgig	172	15	M	M	NNP
cord-252671-uf96jgig	172	16	-	-	HYPH
cord-252671-uf96jgig	172	17	mediated	mediate	VBN
cord-252671-uf96jgig	172	18	IFN-	IFN-	NNP
cord-252671-uf96jgig	172	19	␤	␤	CD
cord-252671-uf96jgig	172	20	induction	induction	NN
cord-252671-uf96jgig	172	21	,	,	,
cord-252671-uf96jgig	172	22	indicating	indicate	VBG
cord-252671-uf96jgig	172	23	that	that	IN
cord-252671-uf96jgig	172	24	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	172	25	might	may	MD
cord-252671-uf96jgig	172	26	not	not	RB
cord-252671-uf96jgig	172	27	be	be	VB
cord-252671-uf96jgig	172	28	essential	essential	JJ
cord-252671-uf96jgig	172	29	for	for	IN
cord-252671-uf96jgig	172	30	this	this	DT
cord-252671-uf96jgig	172	31	activation	activation	NN
cord-252671-uf96jgig	172	32	.	.	.
cord-252671-uf96jgig	173	1	To	to	TO
cord-252671-uf96jgig	173	2	further	further	RB
cord-252671-uf96jgig	173	3	confirm	confirm	VB
cord-252671-uf96jgig	173	4	the	the	DT
cord-252671-uf96jgig	173	5	above	above	JJ
cord-252671-uf96jgig	173	6	result	result	NN
cord-252671-uf96jgig	173	7	,	,	,
cord-252671-uf96jgig	173	8	Western	western	JJ
cord-252671-uf96jgig	173	9	blot	blot	NN
cord-252671-uf96jgig	173	10	analysis	analysis	NN
cord-252671-uf96jgig	173	11	was	be	VBD
cord-252671-uf96jgig	173	12	performed	perform	VBN
cord-252671-uf96jgig	173	13	to	to	TO
cord-252671-uf96jgig	173	14	detect	detect	VB
cord-252671-uf96jgig	173	15	IFN-	IFN-	NNP
cord-252671-uf96jgig	173	16	␤	␤	DT
cord-252671-uf96jgig	173	17	expression	expression	NN
cord-252671-uf96jgig	173	18	in	in	IN
cord-252671-uf96jgig	173	19	responding	respond	VBG
cord-252671-uf96jgig	173	20	to	to	IN
cord-252671-uf96jgig	173	21	the	the	DT
cord-252671-uf96jgig	173	22	increased	increase	VBN
cord-252671-uf96jgig	173	23	delivery	delivery	NN
cord-252671-uf96jgig	173	24	of	of	IN
cord-252671-uf96jgig	173	25	siTRAF3	siTRAF3	NNP
cord-252671-uf96jgig	173	26	into	into	IN
cord-252671-uf96jgig	173	27	HEK293	HEK293	NNP
cord-252671-uf96jgig	173	28	T	T	NNP
cord-252671-uf96jgig	173	29	cells	cell	NNS
cord-252671-uf96jgig	173	30	.	.	.
cord-252671-uf96jgig	174	1	The	the	DT
cord-252671-uf96jgig	174	2	increased	increase	VBN
cord-252671-uf96jgig	174	3	delivery	delivery	NN
cord-252671-uf96jgig	174	4	of	of	IN
cord-252671-uf96jgig	174	5	siTRAF3	siTRAF3	NNP
cord-252671-uf96jgig	174	6	into	into	IN
cord-252671-uf96jgig	174	7	HEK293	HEK293	NNP
cord-252671-uf96jgig	174	8	T	T	NNP
cord-252671-uf96jgig	174	9	Co	co	NN
cord-252671-uf96jgig	174	10	-	-	HYPH
cord-252671-uf96jgig	174	11	IP	IP	NNP
cord-252671-uf96jgig	174	12	was	be	VBD
cord-252671-uf96jgig	174	13	conducted	conduct	VBN
cord-252671-uf96jgig	174	14	as	as	IN
cord-252671-uf96jgig	174	15	shown	show	VBN
cord-252671-uf96jgig	174	16	in	in	IN
cord-252671-uf96jgig	174	17	the	the	DT
cord-252671-uf96jgig	174	18	left	left	JJ
cord-252671-uf96jgig	174	19	panel	panel	NN
cord-252671-uf96jgig	174	20	.	.	.
cord-252671-uf96jgig	175	1	About	about	RB
cord-252671-uf96jgig	175	2	10	10	CD
cord-252671-uf96jgig	175	3	%	%	NN
cord-252671-uf96jgig	175	4	input	input	NN
cord-252671-uf96jgig	175	5	from	from	IN
cord-252671-uf96jgig	175	6	each	each	DT
cord-252671-uf96jgig	175	7	lysate	lysate	NN
cord-252671-uf96jgig	175	8	preparation	preparation	NN
cord-252671-uf96jgig	175	9	was	be	VBD
cord-252671-uf96jgig	175	10	subjected	subject	VBN
cord-252671-uf96jgig	175	11	to	to	IN
cord-252671-uf96jgig	175	12	Western	western	JJ
cord-252671-uf96jgig	175	13	blot	blot	NN
cord-252671-uf96jgig	175	14	analysis	analysis	NN
cord-252671-uf96jgig	175	15	using	use	VBG
cord-252671-uf96jgig	175	16	anti	anti	JJ
cord-252671-uf96jgig	175	17	-	-	NNP
cord-252671-uf96jgig	175	18	HA	HA	NNP
cord-252671-uf96jgig	175	19	,	,	,
cord-252671-uf96jgig	175	20	anti	anti	JJ
cord-252671-uf96jgig	175	21	-	-	JJ
cord-252671-uf96jgig	175	22	Flag	flag	JJ
cord-252671-uf96jgig	175	23	,	,	,
cord-252671-uf96jgig	175	24	and	and	CC
cord-252671-uf96jgig	175	25	anti	anti	JJ
cord-252671-uf96jgig	175	26	-	-	JJ
cord-252671-uf96jgig	175	27	Myc	myc	JJ
cord-252671-uf96jgig	175	28	antibodies	antibody	NNS
cord-252671-uf96jgig	175	29	as	as	IN
cord-252671-uf96jgig	175	30	probes	probe	NNS
cord-252671-uf96jgig	175	31	.	.	.
cord-252671-uf96jgig	176	1	The	the	DT
cord-252671-uf96jgig	176	2	rest	rest	NN
cord-252671-uf96jgig	176	3	of	of	IN
cord-252671-uf96jgig	176	4	the	the	DT
cord-252671-uf96jgig	176	5	lysate	lysate	NN
cord-252671-uf96jgig	176	6	was	be	VBD
cord-252671-uf96jgig	176	7	first	first	RB
cord-252671-uf96jgig	176	8	immunoprecipitated	immunoprecipitate	VBN
cord-252671-uf96jgig	176	9	with	with	IN
cord-252671-uf96jgig	176	10	anti	anti	JJ
cord-252671-uf96jgig	176	11	-	-	JJ
cord-252671-uf96jgig	176	12	Flag	flag	JJ
cord-252671-uf96jgig	176	13	antibody	antibody	NN
cord-252671-uf96jgig	176	14	conjugated	conjugate	VBN
cord-252671-uf96jgig	176	15	with	with	IN
cord-252671-uf96jgig	176	16	an	an	DT
cord-252671-uf96jgig	176	17	affinity	affinity	NN
cord-252671-uf96jgig	176	18	gel	gel	NN
cord-252671-uf96jgig	176	19	.	.	.
cord-252671-uf96jgig	177	1	Then	then	RB
cord-252671-uf96jgig	177	2	,	,	,
cord-252671-uf96jgig	177	3	the	the	DT
cord-252671-uf96jgig	177	4	reaction	reaction	NN
cord-252671-uf96jgig	177	5	products	product	NNS
cord-252671-uf96jgig	177	6	were	be	VBD
cord-252671-uf96jgig	177	7	probed	probe	VBN
cord-252671-uf96jgig	177	8	with	with	IN
cord-252671-uf96jgig	177	9	anti	anti	JJ
cord-252671-uf96jgig	177	10	-	-	JJ
cord-252671-uf96jgig	177	11	HA	HA	NNP
cord-252671-uf96jgig	177	12	and	and	CC
cord-252671-uf96jgig	177	13	anti	anti	JJ
cord-252671-uf96jgig	177	14	-	-	JJ
cord-252671-uf96jgig	177	15	Myc	myc	JJ
cord-252671-uf96jgig	177	16	antibodies	antibody	NNS
cord-252671-uf96jgig	177	17	.	.	.
cord-252671-uf96jgig	178	1	A	a	DT
cord-252671-uf96jgig	178	2	reverse	reverse	JJ
cord-252671-uf96jgig	178	3	co	co	JJ
cord-252671-uf96jgig	178	4	-	-	JJ
cord-252671-uf96jgig	178	5	IP	ip	JJ
cord-252671-uf96jgig	178	6	experiment	experiment	NN
cord-252671-uf96jgig	178	7	was	be	VBD
cord-252671-uf96jgig	178	8	also	also	RB
cord-252671-uf96jgig	178	9	conducted	conduct	VBN
cord-252671-uf96jgig	178	10	as	as	IN
cord-252671-uf96jgig	178	11	shown	show	VBN
cord-252671-uf96jgig	178	12	in	in	IN
cord-252671-uf96jgig	178	13	the	the	DT
cord-252671-uf96jgig	178	14	right	right	JJ
cord-252671-uf96jgig	178	15	panel	panel	NN
cord-252671-uf96jgig	178	16	.	.	.
cord-252671-uf96jgig	179	1	The	the	DT
cord-252671-uf96jgig	179	2	lysates	lysate	NNS
cord-252671-uf96jgig	179	3	were	be	VBD
cord-252671-uf96jgig	179	4	first	first	RB
cord-252671-uf96jgig	179	5	immunoprecipitated	immunoprecipitate	VBN
cord-252671-uf96jgig	179	6	with	with	IN
cord-252671-uf96jgig	179	7	anti	anti	JJ
cord-252671-uf96jgig	179	8	-	-	JJ
cord-252671-uf96jgig	179	9	Myc	myc	JJ
cord-252671-uf96jgig	179	10	antibody	antibody	NN
cord-252671-uf96jgig	179	11	.	.	.
cord-252671-uf96jgig	180	1	Then	then	RB
cord-252671-uf96jgig	180	2	,	,	,
cord-252671-uf96jgig	180	3	the	the	DT
cord-252671-uf96jgig	180	4	reaction	reaction	NN
cord-252671-uf96jgig	180	5	products	product	NNS
cord-252671-uf96jgig	180	6	were	be	VBD
cord-252671-uf96jgig	180	7	individually	individually	RB
cord-252671-uf96jgig	180	8	probed	probe	VBN
cord-252671-uf96jgig	180	9	with	with	IN
cord-252671-uf96jgig	180	10	anti	anti	JJ
cord-252671-uf96jgig	180	11	-	-	JJ
cord-252671-uf96jgig	180	12	Myc	myc	JJ
cord-252671-uf96jgig	180	13	,	,	,
cord-252671-uf96jgig	180	14	anti	anti	JJ
cord-252671-uf96jgig	180	15	-	-	JJ
cord-252671-uf96jgig	180	16	Flag	flag	JJ
cord-252671-uf96jgig	180	17	,	,	,
cord-252671-uf96jgig	180	18	and	and	CC
cord-252671-uf96jgig	180	19	anti	anti	JJ
cord-252671-uf96jgig	180	20	-	-	JJ
cord-252671-uf96jgig	180	21	HA	HA	NNP
cord-252671-uf96jgig	180	22	antibodies	antibody	NNS
cord-252671-uf96jgig	180	23	and	and	CC
cord-252671-uf96jgig	180	24	subsequently	subsequently	RB
cord-252671-uf96jgig	180	25	subjected	subject	VBN
cord-252671-uf96jgig	180	26	to	to	IN
cord-252671-uf96jgig	180	27	Western	western	JJ
cord-252671-uf96jgig	180	28	blotting	blotting	NN
cord-252671-uf96jgig	180	29	.	.	.
cord-252671-uf96jgig	181	1	The	the	DT
cord-252671-uf96jgig	181	2	result	result	NN
cord-252671-uf96jgig	181	3	is	be	VBZ
cord-252671-uf96jgig	181	4	representative	representative	NN
cord-252671-uf96jgig	181	5	of	of	IN
cord-252671-uf96jgig	181	6	at	at	RB
cord-252671-uf96jgig	181	7	least	least	JJS
cord-252671-uf96jgig	181	8	2	2	CD
cord-252671-uf96jgig	181	9	identical	identical	JJ
cord-252671-uf96jgig	181	10	experiments	experiment	NNS
cord-252671-uf96jgig	181	11	.	.	.
cord-252671-uf96jgig	182	1	IB	IB	NNP
cord-252671-uf96jgig	182	2	,	,	,
cord-252671-uf96jgig	182	3	immunoblotting	immunoblotting	NN
cord-252671-uf96jgig	182	4	;	;	:
cord-252671-uf96jgig	182	5	ns	ns	UH
cord-252671-uf96jgig	182	6	,	,	,
cord-252671-uf96jgig	182	7	nonspecific	nonspecific	JJ
cord-252671-uf96jgig	182	8	.	.	.
cord-252671-uf96jgig	183	1	(	(	-LRB-
cord-252671-uf96jgig	183	2	H	h	NN
cord-252671-uf96jgig	183	3	)	)	-RRB-
cord-252671-uf96jgig	184	1	The	the	DT
cord-252671-uf96jgig	184	2	M	M	NNP
cord-252671-uf96jgig	184	3	gene	gene	NN
cord-252671-uf96jgig	184	4	product	product	NN
cord-252671-uf96jgig	184	5	does	do	VBZ
cord-252671-uf96jgig	184	6	not	not	RB
cord-252671-uf96jgig	184	7	suppress	suppress	VB
cord-252671-uf96jgig	185	1	poly(I	poly(I	NNS
cord-252671-uf96jgig	185	2	:	:	:
cord-252671-uf96jgig	185	3	C)-mediated	C)-mediated	NNP
cord-252671-uf96jgig	185	4	IFN-	IFN-	NNP
cord-252671-uf96jgig	185	5	␤	␤	DT
cord-252671-uf96jgig	185	6	induction	induction	NN
cord-252671-uf96jgig	185	7	.	.	.
cord-252671-uf96jgig	186	1	About	about	RB
cord-252671-uf96jgig	186	2	2	2	CD
cord-252671-uf96jgig	186	3	g	g	NN
cord-252671-uf96jgig	186	4	/	/	SYM
cord-252671-uf96jgig	186	5	ml	ml	NN
cord-252671-uf96jgig	186	6	of	of	IN
cord-252671-uf96jgig	186	7	poly(I	poly(I	NNP
cord-252671-uf96jgig	186	8	:	:	:
cord-252671-uf96jgig	186	9	C	C	NNP
cord-252671-uf96jgig	186	10	)	)	-RRB-
cord-252671-uf96jgig	186	11	was	be	VBD
cord-252671-uf96jgig	186	12	cotransfected	cotransfecte	VBN
cord-252671-uf96jgig	186	13	with	with	IN
cord-252671-uf96jgig	186	14	2	2	CD
cord-252671-uf96jgig	186	15	g	g	NN
cord-252671-uf96jgig	186	16	of	of	IN
cord-252671-uf96jgig	186	17	either	either	DT
cord-252671-uf96jgig	186	18	M	M	NNP
cord-252671-uf96jgig	186	19	or	or	CC
cord-252671-uf96jgig	186	20	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	186	21	)	)	-RRB-
cord-252671-uf96jgig	186	22	plasmid	plasmid	NN
cord-252671-uf96jgig	186	23	along	along	IN
cord-252671-uf96jgig	186	24	with	with	IN
cord-252671-uf96jgig	186	25	pGL3-IFN-	pgl3-ifn-	NN
cord-252671-uf96jgig	186	26	␤	␤	NNP
cord-252671-uf96jgig	186	27	luciferase	luciferase	NN
cord-252671-uf96jgig	186	28	reporter	reporter	NN
cord-252671-uf96jgig	186	29	(	(	-LRB-
cord-252671-uf96jgig	186	30	100	100	CD
cord-252671-uf96jgig	186	31	ng	ng	NNP
cord-252671-uf96jgig	186	32	)	)	-RRB-
cord-252671-uf96jgig	186	33	plus	plus	CC
cord-252671-uf96jgig	186	34	pRL	pRL	NNP
cord-252671-uf96jgig	186	35	-	-	HYPH
cord-252671-uf96jgig	186	36	TK	TK	NNP
cord-252671-uf96jgig	186	37	(	(	-LRB-
cord-252671-uf96jgig	186	38	10	10	CD
cord-252671-uf96jgig	186	39	ng	ng	NN
cord-252671-uf96jgig	186	40	)	)	-RRB-
cord-252671-uf96jgig	186	41	into	into	IN
cord-252671-uf96jgig	186	42	HEK293	HEK293	NNP
cord-252671-uf96jgig	186	43	T	T	NNP
cord-252671-uf96jgig	186	44	cells	cell	NNS
cord-252671-uf96jgig	186	45	.	.	.
cord-252671-uf96jgig	187	1	After	after	IN
cord-252671-uf96jgig	187	2	48	48	CD
cord-252671-uf96jgig	187	3	h	h	NN
cord-252671-uf96jgig	187	4	of	of	IN
cord-252671-uf96jgig	187	5	transfection	transfection	NN
cord-252671-uf96jgig	187	6	,	,	,
cord-252671-uf96jgig	187	7	dual	dual	JJ
cord-252671-uf96jgig	187	8	-	-	HYPH
cord-252671-uf96jgig	187	9	luciferase	luciferase	NN
cord-252671-uf96jgig	187	10	assays	assay	NNS
cord-252671-uf96jgig	187	11	were	be	VBD
cord-252671-uf96jgig	187	12	performed	perform	VBN
cord-252671-uf96jgig	187	13	to	to	TO
cord-252671-uf96jgig	187	14	detect	detect	VB
cord-252671-uf96jgig	187	15	IFN-	IFN-	NNP
cord-252671-uf96jgig	187	16	␤	␤	DT
cord-252671-uf96jgig	187	17	expression	expression	NN
cord-252671-uf96jgig	187	18	(	(	-LRB-
cord-252671-uf96jgig	187	19	left	left	JJ
cord-252671-uf96jgig	187	20	panel	panel	NN
cord-252671-uf96jgig	187	21	)	)	-RRB-
cord-252671-uf96jgig	187	22	.	.	.
cord-252671-uf96jgig	188	1	Each	each	DT
cord-252671-uf96jgig	188	2	value	value	NN
cord-252671-uf96jgig	188	3	represents	represent	VBZ
cord-252671-uf96jgig	188	4	the	the	DT
cord-252671-uf96jgig	188	5	mean	mean	JJ
cord-252671-uf96jgig	188	6	Ϯ	Ϯ	NNP
cord-252671-uf96jgig	188	7	standard	standard	JJ
cord-252671-uf96jgig	188	8	deviation	deviation	NN
cord-252671-uf96jgig	188	9	from	from	IN
cord-252671-uf96jgig	188	10	three	three	CD
cord-252671-uf96jgig	188	11	independent	independent	JJ
cord-252671-uf96jgig	188	12	tests	test	NNS
cord-252671-uf96jgig	188	13	.	.	.
cord-252671-uf96jgig	189	1	The	the	DT
cord-252671-uf96jgig	189	2	statistical	statistical	JJ
cord-252671-uf96jgig	189	3	difference	difference	NN
cord-252671-uf96jgig	189	4	was	be	VBD
cord-252671-uf96jgig	189	5	considered	consider	VBN
cord-252671-uf96jgig	189	6	to	to	TO
cord-252671-uf96jgig	189	7	be	be	VB
cord-252671-uf96jgig	189	8	significant	significant	JJ
cord-252671-uf96jgig	189	9	at	at	IN
cord-252671-uf96jgig	189	10	a	a	DT
cord-252671-uf96jgig	189	11	P	p	NN
cord-252671-uf96jgig	189	12	value	value	NN
cord-252671-uf96jgig	189	13	of	of	IN
cord-252671-uf96jgig	189	14	Յ0.05	Յ0.05	NNP
cord-252671-uf96jgig	189	15	.	.	.
cord-252671-uf96jgig	190	1	The	the	DT
cord-252671-uf96jgig	190	2	IFN-	IFN-	NNP
cord-252671-uf96jgig	190	3	␤	␤	DT
cord-252671-uf96jgig	190	4	expression	expression	NN
cord-252671-uf96jgig	190	5	was	be	VBD
cord-252671-uf96jgig	190	6	also	also	RB
cord-252671-uf96jgig	190	7	subjected	subject	VBN
cord-252671-uf96jgig	190	8	to	to	IN
cord-252671-uf96jgig	190	9	Western	western	JJ
cord-252671-uf96jgig	190	10	blotting	blotting	NN
cord-252671-uf96jgig	190	11	(	(	-LRB-
cord-252671-uf96jgig	190	12	right	right	JJ
cord-252671-uf96jgig	190	13	panel	panel	NN
cord-252671-uf96jgig	190	14	)	)	-RRB-
cord-252671-uf96jgig	190	15	.	.	.
cord-252671-uf96jgig	191	1	The	the	DT
cord-252671-uf96jgig	191	2	relative	relative	JJ
cord-252671-uf96jgig	191	3	band	band	NN
cord-252671-uf96jgig	191	4	intensity	intensity	NN
cord-252671-uf96jgig	191	5	was	be	VBD
cord-252671-uf96jgig	191	6	quantitated	quantitate	VBN
cord-252671-uf96jgig	191	7	with	with	IN
cord-252671-uf96jgig	191	8	the	the	DT
cord-252671-uf96jgig	191	9	Image	Image	NNP
cord-252671-uf96jgig	191	10	J	J	NNP
cord-252671-uf96jgig	191	11	program	program	NN
cord-252671-uf96jgig	191	12	in	in	IN
cord-252671-uf96jgig	191	13	comparison	comparison	NN
cord-252671-uf96jgig	191	14	with	with	IN
cord-252671-uf96jgig	191	15	the	the	DT
cord-252671-uf96jgig	191	16	␤	␤	.
cord-252671-uf96jgig	192	1	-actin	-actin	NNP
cord-252671-uf96jgig	192	2	control	control	NN
cord-252671-uf96jgig	192	3	.	.	.
cord-252671-uf96jgig	193	1	cells	cell	NNS
cord-252671-uf96jgig	193	2	failed	fail	VBD
cord-252671-uf96jgig	193	3	to	to	TO
cord-252671-uf96jgig	193	4	inactivate	inactivate	VB
cord-252671-uf96jgig	193	5	the	the	DT
cord-252671-uf96jgig	193	6	activation	activation	NN
cord-252671-uf96jgig	193	7	of	of	IN
cord-252671-uf96jgig	193	8	IRF3	IRF3	NNP
cord-252671-uf96jgig	193	9	and	and	CC
cord-252671-uf96jgig	193	10	NF	NF	NNP
cord-252671-uf96jgig	193	11	-	-	HYPH
cord-252671-uf96jgig	193	12	B	b	NN
cord-252671-uf96jgig	193	13	p65	p65	NN
cord-252671-uf96jgig	193	14	and	and	CC
cord-252671-uf96jgig	193	15	did	do	VBD
cord-252671-uf96jgig	193	16	not	not	RB
cord-252671-uf96jgig	193	17	affect	affect	VB
cord-252671-uf96jgig	193	18	the	the	DT
cord-252671-uf96jgig	193	19	M	M	NNP
cord-252671-uf96jgig	193	20	-	-	HYPH
cord-252671-uf96jgig	193	21	mediated	mediate	VBN
cord-252671-uf96jgig	193	22	IFN-	IFN-	NNP
cord-252671-uf96jgig	193	23	␤	␤	``
cord-252671-uf96jgig	193	24	induction	induction	NN
cord-252671-uf96jgig	193	25	(	(	-LRB-
cord-252671-uf96jgig	193	26	Fig	Fig	NNP
cord-252671-uf96jgig	193	27	.	.	.
cord-252671-uf96jgig	193	28	7C	7C	NNP
cord-252671-uf96jgig	193	29	)	)	-RRB-
cord-252671-uf96jgig	193	30	,	,	,
cord-252671-uf96jgig	193	31	while	while	IN
cord-252671-uf96jgig	193	32	a	a	DT
cord-252671-uf96jgig	193	33	result	result	NN
cord-252671-uf96jgig	193	34	was	be	VBD
cord-252671-uf96jgig	193	35	obtained	obtain	VBN
cord-252671-uf96jgig	193	36	consistent	consistent	JJ
cord-252671-uf96jgig	193	37	with	with	IN
cord-252671-uf96jgig	193	38	the	the	DT
cord-252671-uf96jgig	193	39	increased	increase	VBN
cord-252671-uf96jgig	193	40	delivery	delivery	NN
cord-252671-uf96jgig	193	41	of	of	IN
cord-252671-uf96jgig	193	42	si	si	NN
cord-252671-uf96jgig	193	43	-	-	HYPH
cord-252671-uf96jgig	193	44	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	193	45	into	into	IN
cord-252671-uf96jgig	193	46	J2-M	J2-M	NNP
cord-252671-uf96jgig	193	47	cells	cell	NNS
cord-252671-uf96jgig	193	48	(	(	-LRB-
cord-252671-uf96jgig	193	49	Fig	Fig	NNP
cord-252671-uf96jgig	193	50	.	.	.
cord-252671-uf96jgig	193	51	7D	7D	NNP
cord-252671-uf96jgig	193	52	)	)	-RRB-
cord-252671-uf96jgig	193	53	.	.	.
cord-252671-uf96jgig	194	1	In	in	IN
cord-252671-uf96jgig	194	2	addition	addition	NN
cord-252671-uf96jgig	194	3	,	,	,
cord-252671-uf96jgig	194	4	a	a	DT
cord-252671-uf96jgig	194	5	stable	stable	JJ
cord-252671-uf96jgig	194	6	HEK293	HEK293	NNP
cord-252671-uf96jgig	194	7	cell	cell	NN
cord-252671-uf96jgig	194	8	line	line	NN
cord-252671-uf96jgig	194	9	with	with	IN
cord-252671-uf96jgig	194	10	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	194	11	knocked	knock	VBN
cord-252671-uf96jgig	194	12	down	down	RP
cord-252671-uf96jgig	194	13	by	by	IN
cord-252671-uf96jgig	194	14	siTRAF3	siTRAF3	NNP
cord-252671-uf96jgig	194	15	was	be	VBD
cord-252671-uf96jgig	194	16	also	also	RB
cord-252671-uf96jgig	194	17	established	establish	VBN
cord-252671-uf96jgig	194	18	(	(	-LRB-
cord-252671-uf96jgig	194	19	Fig	Fig	NNP
cord-252671-uf96jgig	194	20	.	.	.
cord-252671-uf96jgig	194	21	7E	7E	NNP
cord-252671-uf96jgig	194	22	)	)	-RRB-
cord-252671-uf96jgig	194	23	.	.	.
cord-252671-uf96jgig	195	1	A	a	DT
cord-252671-uf96jgig	195	2	dose	dose	NN
cord-252671-uf96jgig	195	3	-	-	HYPH
cord-252671-uf96jgig	195	4	dependent	dependent	JJ
cord-252671-uf96jgig	195	5	increase	increase	NN
cord-252671-uf96jgig	195	6	in	in	IN
cord-252671-uf96jgig	195	7	IFN-	IFN-	NNP
cord-252671-uf96jgig	195	8	␤	␤	CD
cord-252671-uf96jgig	195	9	production	production	NN
cord-252671-uf96jgig	195	10	was	be	VBD
cord-252671-uf96jgig	195	11	observed	observe	VBN
cord-252671-uf96jgig	195	12	with	with	IN
cord-252671-uf96jgig	195	13	the	the	DT
cord-252671-uf96jgig	195	14	increased	increase	VBN
cord-252671-uf96jgig	195	15	delivery	delivery	NN
cord-252671-uf96jgig	195	16	of	of	IN
cord-252671-uf96jgig	195	17	M	M	NNP
cord-252671-uf96jgig	195	18	gene	gene	NN
cord-252671-uf96jgig	195	19	into	into	IN
cord-252671-uf96jgig	195	20	293	293	CD
cord-252671-uf96jgig	195	21	si	si	NN
cord-252671-uf96jgig	195	22	-	-	HYPH
cord-252671-uf96jgig	195	23	TRAF3	traf3	NN
cord-252671-uf96jgig	195	24	stable	stable	JJ
cord-252671-uf96jgig	195	25	cells	cell	NNS
cord-252671-uf96jgig	195	26	(	(	-LRB-
cord-252671-uf96jgig	195	27	Fig	fig	NN
cord-252671-uf96jgig	195	28	.	.	.
cord-252671-uf96jgig	195	29	7F	7f	CD
cord-252671-uf96jgig	195	30	)	)	-RRB-
cord-252671-uf96jgig	195	31	.	.	.
cord-252671-uf96jgig	196	1	Thus	thus	RB
cord-252671-uf96jgig	196	2	,	,	,
cord-252671-uf96jgig	196	3	the	the	DT
cord-252671-uf96jgig	196	4	above	above	JJ
cord-252671-uf96jgig	196	5	data	datum	NNS
cord-252671-uf96jgig	196	6	strongly	strongly	RB
cord-252671-uf96jgig	196	7	indicate	indicate	VBP
cord-252671-uf96jgig	196	8	that	that	IN
cord-252671-uf96jgig	196	9	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	196	10	is	be	VBZ
cord-252671-uf96jgig	196	11	not	not	RB
cord-252671-uf96jgig	196	12	required	require	VBN
cord-252671-uf96jgig	196	13	for	for	IN
cord-252671-uf96jgig	196	14	M	M	NNP
cord-252671-uf96jgig	196	15	-	-	HYPH
cord-252671-uf96jgig	196	16	mediated	mediate	VBN
cord-252671-uf96jgig	196	17	IFN-	IFN-	NNP
cord-252671-uf96jgig	196	18	␤	␤	CD
cord-252671-uf96jgig	196	19	induction	induction	NN
cord-252671-uf96jgig	196	20	.	.	.
cord-252671-uf96jgig	197	1	SARS	SARS	NNP
cord-252671-uf96jgig	197	2	-	-	HYPH
cord-252671-uf96jgig	197	3	CoV	CoV	NNP
cord-252671-uf96jgig	197	4	M	M	NNP
cord-252671-uf96jgig	197	5	protein	protein	NN
cord-252671-uf96jgig	197	6	has	have	VBZ
cord-252671-uf96jgig	197	7	been	be	VBN
cord-252671-uf96jgig	197	8	shown	show	VBN
cord-252671-uf96jgig	197	9	to	to	TO
cord-252671-uf96jgig	197	10	destabilize	destabilize	VB
cord-252671-uf96jgig	197	11	the	the	DT
cord-252671-uf96jgig	197	12	functional	functional	JJ
cord-252671-uf96jgig	197	13	TRAF3-TBK1	TRAF3-TBK1	NNP
cord-252671-uf96jgig	197	14	complex	complex	JJ
cord-252671-uf96jgig	197	15	formation	formation	NN
cord-252671-uf96jgig	197	16	(	(	-LRB-
cord-252671-uf96jgig	197	17	34	34	CD
cord-252671-uf96jgig	197	18	)	)	-RRB-
cord-252671-uf96jgig	197	19	.	.	.
cord-252671-uf96jgig	198	1	However	however	RB
cord-252671-uf96jgig	198	2	,	,	,
cord-252671-uf96jgig	198	3	it	-PRON-	PRP
cord-252671-uf96jgig	198	4	remains	remain	VBZ
cord-252671-uf96jgig	198	5	unknown	unknown	JJ
cord-252671-uf96jgig	198	6	whether	whether	IN
cord-252671-uf96jgig	198	7	or	or	CC
cord-252671-uf96jgig	198	8	not	not	RB
cord-252671-uf96jgig	198	9	M	M	NNP
cord-252671-uf96jgig	198	10	protein	protein	NN
cord-252671-uf96jgig	198	11	is	be	VBZ
cord-252671-uf96jgig	198	12	able	able	JJ
cord-252671-uf96jgig	198	13	to	to	TO
cord-252671-uf96jgig	198	14	associate	associate	VB
cord-252671-uf96jgig	198	15	with	with	IN
cord-252671-uf96jgig	198	16	the	the	DT
cord-252671-uf96jgig	198	17	key	key	JJ
cord-252671-uf96jgig	198	18	components	component	NNS
cord-252671-uf96jgig	198	19	of	of	IN
cord-252671-uf96jgig	198	20	this	this	DT
cord-252671-uf96jgig	198	21	complex	complex	NN
cord-252671-uf96jgig	198	22	.	.	.
cord-252671-uf96jgig	199	1	To	to	TO
cord-252671-uf96jgig	199	2	clarify	clarify	VB
cord-252671-uf96jgig	199	3	this	this	DT
cord-252671-uf96jgig	199	4	issue	issue	NN
cord-252671-uf96jgig	199	5	directly	directly	RB
cord-252671-uf96jgig	199	6	,	,	,
cord-252671-uf96jgig	199	7	a	a	DT
cord-252671-uf96jgig	199	8	coimmunoprecipitation	coimmunoprecipitation	NN
cord-252671-uf96jgig	199	9	(	(	-LRB-
cord-252671-uf96jgig	199	10	co	co	NN
cord-252671-uf96jgig	199	11	-	-	JJ
cord-252671-uf96jgig	199	12	IP	ip	NN
cord-252671-uf96jgig	199	13	)	)	-RRB-
cord-252671-uf96jgig	199	14	experiment	experiment	NN
cord-252671-uf96jgig	199	15	was	be	VBD
cord-252671-uf96jgig	199	16	conducted	conduct	VBN
cord-252671-uf96jgig	199	17	.	.	.
cord-252671-uf96jgig	200	1	Plasmid	Plasmid	NNP
cord-252671-uf96jgig	200	2	TBK1-Flag	TBK1-Flag	NNP
cord-252671-uf96jgig	200	3	,	,	,
cord-252671-uf96jgig	200	4	TRAF3-HA	traf3-ha	CD
cord-252671-uf96jgig	200	5	,	,	,
cord-252671-uf96jgig	200	6	and	and	CC
cord-252671-uf96jgig	200	7	Myc	Myc	NNP
cord-252671-uf96jgig	200	8	-	-	HYPH
cord-252671-uf96jgig	200	9	M	M	NNP
cord-252671-uf96jgig	200	10	DNAs	dna	NNS
cord-252671-uf96jgig	200	11	were	be	VBD
cord-252671-uf96jgig	200	12	transiently	transiently	RB
cord-252671-uf96jgig	200	13	cotransfected	cotransfecte	VBN
cord-252671-uf96jgig	200	14	into	into	IN
cord-252671-uf96jgig	200	15	HEK293	HEK293	NNP
cord-252671-uf96jgig	200	16	T	T	NNP
cord-252671-uf96jgig	200	17	cells	cell	NNS
cord-252671-uf96jgig	200	18	.	.	.
cord-252671-uf96jgig	201	1	The	the	DT
cord-252671-uf96jgig	201	2	cell	cell	NN
cord-252671-uf96jgig	201	3	lysates	lysate	NNS
cord-252671-uf96jgig	201	4	were	be	VBD
cord-252671-uf96jgig	201	5	first	first	RB
cord-252671-uf96jgig	201	6	immunoprecipitated	immunoprecipitate	VBN
cord-252671-uf96jgig	201	7	with	with	IN
cord-252671-uf96jgig	201	8	anti	anti	JJ
cord-252671-uf96jgig	201	9	-	-	JJ
cord-252671-uf96jgig	201	10	Flag	flag	JJ
cord-252671-uf96jgig	201	11	antibody	antibody	NN
cord-252671-uf96jgig	201	12	conjugated	conjugate	VBN
cord-252671-uf96jgig	201	13	with	with	IN
cord-252671-uf96jgig	201	14	an	an	DT
cord-252671-uf96jgig	201	15	affinity	affinity	NN
cord-252671-uf96jgig	201	16	gel	gel	NN
cord-252671-uf96jgig	201	17	and	and	CC
cord-252671-uf96jgig	201	18	then	then	RB
cord-252671-uf96jgig	201	19	subsequently	subsequently	RB
cord-252671-uf96jgig	201	20	probed	probe	VBD
cord-252671-uf96jgig	201	21	with	with	IN
cord-252671-uf96jgig	201	22	antihemagglutinin	antihemagglutinin	NNP
cord-252671-uf96jgig	201	23	(	(	-LRB-
cord-252671-uf96jgig	201	24	anti	anti	JJ
cord-252671-uf96jgig	201	25	-	-	NNP
cord-252671-uf96jgig	201	26	HA	HA	NNP
cord-252671-uf96jgig	201	27	)	)	-RRB-
cord-252671-uf96jgig	201	28	and	and	CC
cord-252671-uf96jgig	201	29	anti	anti	JJ
cord-252671-uf96jgig	201	30	-	-	JJ
cord-252671-uf96jgig	201	31	Myc	myc	JJ
cord-252671-uf96jgig	201	32	antibodies	antibody	NNS
cord-252671-uf96jgig	201	33	.	.	.
cord-252671-uf96jgig	202	1	The	the	DT
cord-252671-uf96jgig	202	2	left	left	JJ
cord-252671-uf96jgig	202	3	panel	panel	NN
cord-252671-uf96jgig	202	4	of	of	IN
cord-252671-uf96jgig	202	5	Fig	Fig	NNP
cord-252671-uf96jgig	202	6	.	.	.
cord-252671-uf96jgig	203	1	7	7	CD
cord-252671-uf96jgig	203	2	G	g	NN
cord-252671-uf96jgig	203	3	indicates	indicate	VBZ
cord-252671-uf96jgig	203	4	that	that	IN
cord-252671-uf96jgig	203	5	M	M	NNP
cord-252671-uf96jgig	203	6	protein	protein	NN
cord-252671-uf96jgig	203	7	was	be	VBD
cord-252671-uf96jgig	203	8	able	able	JJ
cord-252671-uf96jgig	203	9	to	to	TO
cord-252671-uf96jgig	203	10	disrupt	disrupt	VB
cord-252671-uf96jgig	203	11	the	the	DT
cord-252671-uf96jgig	203	12	physical	physical	JJ
cord-252671-uf96jgig	203	13	interaction	interaction	NN
cord-252671-uf96jgig	203	14	between	between	IN
cord-252671-uf96jgig	203	15	TBK1	TBK1	NNP
cord-252671-uf96jgig	203	16	and	and	CC
cord-252671-uf96jgig	203	17	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	203	18	,	,	,
cord-252671-uf96jgig	203	19	but	but	CC
cord-252671-uf96jgig	203	20	M	M	NNP
cord-252671-uf96jgig	203	21	protein	protein	NN
cord-252671-uf96jgig	203	22	itself	-PRON-	PRP
cord-252671-uf96jgig	203	23	could	could	MD
cord-252671-uf96jgig	203	24	not	not	RB
cord-252671-uf96jgig	203	25	form	form	VB
cord-252671-uf96jgig	203	26	a	a	DT
cord-252671-uf96jgig	203	27	complex	complex	NN
cord-252671-uf96jgig	203	28	with	with	IN
cord-252671-uf96jgig	203	29	TBK1	TBK1	NNP
cord-252671-uf96jgig	203	30	.	.	.
cord-252671-uf96jgig	204	1	In	in	IN
cord-252671-uf96jgig	204	2	the	the	DT
cord-252671-uf96jgig	204	3	reverse	reverse	JJ
cord-252671-uf96jgig	204	4	immunoprecipitation	immunoprecipitation	NN
cord-252671-uf96jgig	204	5	(	(	-LRB-
cord-252671-uf96jgig	204	6	IP	ip	NN
cord-252671-uf96jgig	204	7	)	)	-RRB-
cord-252671-uf96jgig	204	8	experiment	experiment	NN
cord-252671-uf96jgig	204	9	as	as	IN
cord-252671-uf96jgig	204	10	shown	show	VBN
cord-252671-uf96jgig	204	11	in	in	IN
cord-252671-uf96jgig	204	12	the	the	DT
cord-252671-uf96jgig	204	13	right	right	JJ
cord-252671-uf96jgig	204	14	panel	panel	NN
cord-252671-uf96jgig	204	15	of	of	IN
cord-252671-uf96jgig	204	16	Fig	Fig	NNP
cord-252671-uf96jgig	204	17	.	.	.
cord-252671-uf96jgig	205	1	7	7	CD
cord-252671-uf96jgig	205	2	G	g	NN
cord-252671-uf96jgig	205	3	,	,	,
cord-252671-uf96jgig	205	4	M	M	NNP
cord-252671-uf96jgig	205	5	protein	protein	NN
cord-252671-uf96jgig	205	6	was	be	VBD
cord-252671-uf96jgig	205	7	unable	unable	JJ
cord-252671-uf96jgig	205	8	to	to	TO
cord-252671-uf96jgig	205	9	interact	interact	VB
cord-252671-uf96jgig	205	10	with	with	IN
cord-252671-uf96jgig	205	11	both	both	CC
cord-252671-uf96jgig	205	12	TBK1	TBK1	NNP
cord-252671-uf96jgig	205	13	and	and	CC
cord-252671-uf96jgig	205	14	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	205	15	directly	directly	RB
cord-252671-uf96jgig	205	16	,	,	,
cord-252671-uf96jgig	205	17	indicating	indicate	VBG
cord-252671-uf96jgig	205	18	that	that	IN
cord-252671-uf96jgig	205	19	M	M	NNP
cord-252671-uf96jgig	205	20	protein	protein	NN
cord-252671-uf96jgig	205	21	may	may	MD
cord-252671-uf96jgig	205	22	modulate	modulate	VB
cord-252671-uf96jgig	205	23	the	the	DT
cord-252671-uf96jgig	205	24	TBK1-TRAF3	tbk1-traf3	NN
cord-252671-uf96jgig	205	25	complex	complex	JJ
cord-252671-uf96jgig	205	26	formation	formation	NN
cord-252671-uf96jgig	205	27	indirectly	indirectly	RB
cord-252671-uf96jgig	205	28	.	.	.
cord-252671-uf96jgig	206	1	Interestingly	interestingly	RB
cord-252671-uf96jgig	206	2	,	,	,
cord-252671-uf96jgig	206	3	in	in	IN
cord-252671-uf96jgig	206	4	contrast	contrast	NN
cord-252671-uf96jgig	206	5	to	to	IN
cord-252671-uf96jgig	206	6	the	the	DT
cord-252671-uf96jgig	206	7	inhibitory	inhibitory	JJ
cord-252671-uf96jgig	206	8	effect	effect	NN
cord-252671-uf96jgig	206	9	of	of	IN
cord-252671-uf96jgig	206	10	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	206	11	)	)	-RRB-
cord-252671-uf96jgig	206	12	on	on	IN
cord-252671-uf96jgig	206	13	poly(I	poly(I	NNS
cord-252671-uf96jgig	206	14	:	:	:
cord-252671-uf96jgig	206	15	C)-mediated	C)-mediated	NNP
cord-252671-uf96jgig	206	16	IFN-	IFN-	NNP
cord-252671-uf96jgig	206	17	␤	␤	CD
cord-252671-uf96jgig	206	18	induction	induction	NN
cord-252671-uf96jgig	206	19	,	,	,
cord-252671-uf96jgig	206	20	the	the	DT
cord-252671-uf96jgig	206	21	M	M	NNP
cord-252671-uf96jgig	206	22	gene	gene	NN
cord-252671-uf96jgig	206	23	product	product	NN
cord-252671-uf96jgig	206	24	did	do	VBD
cord-252671-uf96jgig	206	25	not	not	RB
cord-252671-uf96jgig	206	26	affect	affect	VB
cord-252671-uf96jgig	206	27	the	the	DT
cord-252671-uf96jgig	206	28	IFN-	IFN-	NNP
cord-252671-uf96jgig	206	29	␤	␤	CD
cord-252671-uf96jgig	206	30	induction	induction	NN
cord-252671-uf96jgig	206	31	stimulated	stimulate	VBN
cord-252671-uf96jgig	206	32	by	by	IN
cord-252671-uf96jgig	206	33	poly(I	poly(I	NNS
cord-252671-uf96jgig	206	34	:	:	:
cord-252671-uf96jgig	206	35	C	C	NNP
cord-252671-uf96jgig	206	36	)	)	-RRB-
cord-252671-uf96jgig	207	1	(	(	-LRB-
cord-252671-uf96jgig	207	2	Fig	Fig	NNP
cord-252671-uf96jgig	207	3	.	.	.
cord-252671-uf96jgig	207	4	7H	7H	NNP
cord-252671-uf96jgig	207	5	)	)	-RRB-
cord-252671-uf96jgig	207	6	,	,	,
cord-252671-uf96jgig	207	7	indicating	indicate	VBG
cord-252671-uf96jgig	207	8	that	that	IN
cord-252671-uf96jgig	207	9	M	M	NNP
cord-252671-uf96jgig	207	10	has	have	VBZ
cord-252671-uf96jgig	207	11	no	no	DT
cord-252671-uf96jgig	207	12	effect	effect	NN
cord-252671-uf96jgig	207	13	on	on	IN
cord-252671-uf96jgig	207	14	poly(I	poly(I	NNP
cord-252671-uf96jgig	207	15	:	:	:
cord-252671-uf96jgig	208	1	C)induced	C)induced	NNP
cord-252671-uf96jgig	209	1	IFN-	IFN-	NNP
cord-252671-uf96jgig	209	2	␤	␤	DT
cord-252671-uf96jgig	209	3	production	production	NN
cord-252671-uf96jgig	209	4	while	while	IN
cord-252671-uf96jgig	209	5	retaining	retain	VBG
cord-252671-uf96jgig	209	6	the	the	DT
cord-252671-uf96jgig	209	7	ability	ability	NN
cord-252671-uf96jgig	209	8	to	to	TO
cord-252671-uf96jgig	209	9	destabilize	destabilize	VB
cord-252671-uf96jgig	209	10	the	the	DT
cord-252671-uf96jgig	209	11	complex	complex	JJ
cord-252671-uf96jgig	209	12	formation	formation	NN
cord-252671-uf96jgig	209	13	.	.	.
cord-252671-uf96jgig	210	1	One	one	CD
cord-252671-uf96jgig	210	2	critical	critical	JJ
cord-252671-uf96jgig	210	3	question	question	NN
cord-252671-uf96jgig	210	4	remaining	remain	VBG
cord-252671-uf96jgig	210	5	to	to	TO
cord-252671-uf96jgig	210	6	be	be	VB
cord-252671-uf96jgig	210	7	answered	answer	VBN
cord-252671-uf96jgig	210	8	is	be	VBZ
cord-252671-uf96jgig	210	9	whether	whether	IN
cord-252671-uf96jgig	210	10	or	or	CC
cord-252671-uf96jgig	210	11	not	not	RB
cord-252671-uf96jgig	210	12	M	M	NNP
cord-252671-uf96jgig	210	13	-	-	HYPH
cord-252671-uf96jgig	210	14	mediated	mediate	VBN
cord-252671-uf96jgig	210	15	IFN-	IFN-	NNP
cord-252671-uf96jgig	210	16	␤	␤	CD
cord-252671-uf96jgig	210	17	induction	induction	NN
cord-252671-uf96jgig	210	18	could	could	MD
cord-252671-uf96jgig	210	19	occur	occur	VB
cord-252671-uf96jgig	210	20	in	in	IN
cord-252671-uf96jgig	210	21	real	real	JJ
cord-252671-uf96jgig	210	22	virus	virus	NN
cord-252671-uf96jgig	210	23	infection	infection	NN
cord-252671-uf96jgig	210	24	.	.	.
cord-252671-uf96jgig	211	1	It	-PRON-	PRP
cord-252671-uf96jgig	211	2	has	have	VBZ
cord-252671-uf96jgig	211	3	been	be	VBN
cord-252671-uf96jgig	211	4	shown	show	VBN
cord-252671-uf96jgig	211	5	that	that	IN
cord-252671-uf96jgig	211	6	codelivering	codelivere	VBG
cord-252671-uf96jgig	211	7	the	the	DT
cord-252671-uf96jgig	211	8	M	M	NNP
cord-252671-uf96jgig	211	9	,	,	,
cord-252671-uf96jgig	211	10	N	N	NNP
cord-252671-uf96jgig	211	11	,	,	,
cord-252671-uf96jgig	211	12	and	and	CC
cord-252671-uf96jgig	211	13	S	S	NNP
cord-252671-uf96jgig	211	14	genes	gene	NNS
cord-252671-uf96jgig	211	15	of	of	IN
cord-252671-uf96jgig	211	16	SARS	SARS	NNP
cord-252671-uf96jgig	211	17	-	-	HYPH
cord-252671-uf96jgig	211	18	CoV	CoV	NNP
cord-252671-uf96jgig	211	19	into	into	IN
cord-252671-uf96jgig	211	20	HEK293	HEK293	NNP
cord-252671-uf96jgig	211	21	cells	cell	NNS
cord-252671-uf96jgig	211	22	readily	readily	RB
cord-252671-uf96jgig	211	23	produced	produce	VBD
cord-252671-uf96jgig	211	24	SARS	SARS	NNP
cord-252671-uf96jgig	211	25	-	-	HYPH
cord-252671-uf96jgig	211	26	CoV	CoV	NNP
cord-252671-uf96jgig	211	27	pseudovirus	pseudovirus	NNP
cord-252671-uf96jgig	211	28	with	with	IN
cord-252671-uf96jgig	211	29	the	the	DT
cord-252671-uf96jgig	211	30	corona	corona	NN
cord-252671-uf96jgig	211	31	-	-	HYPH
cord-252671-uf96jgig	211	32	like	like	JJ
cord-252671-uf96jgig	211	33	halo	halo	NN
cord-252671-uf96jgig	211	34	(	(	-LRB-
cord-252671-uf96jgig	211	35	35	35	CD
cord-252671-uf96jgig	211	36	)	)	-RRB-
cord-252671-uf96jgig	211	37	.	.	.
cord-252671-uf96jgig	212	1	Earlier	early	JJR
cord-252671-uf96jgig	212	2	results	result	NNS
cord-252671-uf96jgig	212	3	demonstrate	demonstrate	VBP
cord-252671-uf96jgig	212	4	that	that	IN
cord-252671-uf96jgig	212	5	valine	valine	NN
cord-252671-uf96jgig	212	6	-	-	HYPH
cord-252671-uf96jgig	212	7	toalanine	toalanine	NN
cord-252671-uf96jgig	212	8	mutation	mutation	NN
cord-252671-uf96jgig	212	9	at	at	IN
cord-252671-uf96jgig	212	10	residue	residue	NN
cord-252671-uf96jgig	212	11	68	68	CD
cord-252671-uf96jgig	212	12	[	[	-LRB-
cord-252671-uf96jgig	212	13	abbreviated	abbreviate	VBN
cord-252671-uf96jgig	212	14	as	as	IN
cord-252671-uf96jgig	212	15	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	212	16	)	)	-RRB-
cord-252671-uf96jgig	212	17	]	]	-RRB-
cord-252671-uf96jgig	212	18	inhibited	inhibit	VBN
cord-252671-uf96jgig	212	19	IFN-	IFN-	NNP
cord-252671-uf96jgig	212	20	␤	␤	CD
cord-252671-uf96jgig	212	21	induction	induction	NN
cord-252671-uf96jgig	212	22	(	(	-LRB-
cord-252671-uf96jgig	212	23	34	34	CD
cord-252671-uf96jgig	212	24	)	)	-RRB-
cord-252671-uf96jgig	212	25	.	.	.
cord-252671-uf96jgig	213	1	We	-PRON-	PRP
cord-252671-uf96jgig	213	2	employed	employ	VBD
cord-252671-uf96jgig	213	3	a	a	DT
cord-252671-uf96jgig	213	4	SARS	SARS	NNP
cord-252671-uf96jgig	213	5	-	-	HYPH
cord-252671-uf96jgig	213	6	CoV	CoV	NNP
cord-252671-uf96jgig	213	7	pseudovirus	pseudovirus	NNP
cord-252671-uf96jgig	213	8	system	system	NN
cord-252671-uf96jgig	213	9	to	to	TO
cord-252671-uf96jgig	213	10	mimic	mimic	VB
cord-252671-uf96jgig	213	11	the	the	DT
cord-252671-uf96jgig	213	12	real	real	JJ
cord-252671-uf96jgig	213	13	SARS	SARS	NNP
cord-252671-uf96jgig	213	14	-	-	HYPH
cord-252671-uf96jgig	213	15	CoV	CoV	NNP
cord-252671-uf96jgig	213	16	infection	infection	NN
cord-252671-uf96jgig	213	17	.	.	.
cord-252671-uf96jgig	214	1	Cell	cell	NN
cord-252671-uf96jgig	214	2	lysate	lysate	NN
cord-252671-uf96jgig	214	3	supernatants	supernatant	NNS
cord-252671-uf96jgig	214	4	isolated	isolate	VBN
cord-252671-uf96jgig	214	5	from	from	IN
cord-252671-uf96jgig	214	6	either	either	DT
cord-252671-uf96jgig	214	7	M	M	NNP
cord-252671-uf96jgig	214	8	,	,	,
cord-252671-uf96jgig	214	9	N	N	NNP
cord-252671-uf96jgig	214	10	,	,	,
cord-252671-uf96jgig	214	11	and	and	CC
cord-252671-uf96jgig	214	12	S	S	NNP
cord-252671-uf96jgig	214	13	cotransfection	cotransfection	NN
cord-252671-uf96jgig	214	14	or	or	CC
cord-252671-uf96jgig	214	15	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	214	16	)	)	-RRB-
cord-252671-uf96jgig	214	17	,	,	,
cord-252671-uf96jgig	214	18	N	n	CD
cord-252671-uf96jgig	214	19	,	,	,
cord-252671-uf96jgig	214	20	and	and	CC
cord-252671-uf96jgig	214	21	S	S	NNP
cord-252671-uf96jgig	214	22	cotransfection	cotransfection	NN
cord-252671-uf96jgig	214	23	were	be	VBD
cord-252671-uf96jgig	214	24	first	first	RB
cord-252671-uf96jgig	214	25	incubated	incubate	VBN
cord-252671-uf96jgig	214	26	with	with	IN
cord-252671-uf96jgig	214	27	293-ACE2	293-ace2	CD
cord-252671-uf96jgig	214	28	stable	stable	JJ
cord-252671-uf96jgig	214	29	cells	cell	NNS
cord-252671-uf96jgig	214	30	(	(	-LRB-
cord-252671-uf96jgig	214	31	Fig	Fig	NNP
cord-252671-uf96jgig	214	32	.	.	.
cord-252671-uf96jgig	214	33	8A	8a	NN
cord-252671-uf96jgig	214	34	)	)	-RRB-
cord-252671-uf96jgig	214	35	for	for	IN
cord-252671-uf96jgig	214	36	4	4	CD
cord-252671-uf96jgig	214	37	h.	h.	NN
cord-252671-uf96jgig	215	1	Then	then	RB
cord-252671-uf96jgig	215	2	,	,	,
cord-252671-uf96jgig	215	3	the	the	DT
cord-252671-uf96jgig	215	4	cell	cell	NN
cord-252671-uf96jgig	215	5	culture	culture	NN
cord-252671-uf96jgig	215	6	medium	medium	NN
cord-252671-uf96jgig	215	7	was	be	VBD
cord-252671-uf96jgig	215	8	replaced	replace	VBN
cord-252671-uf96jgig	215	9	with	with	IN
cord-252671-uf96jgig	215	10	fresh	fresh	JJ
cord-252671-uf96jgig	215	11	medium	medium	NN
cord-252671-uf96jgig	215	12	and	and	CC
cord-252671-uf96jgig	215	13	further	further	RB
cord-252671-uf96jgig	215	14	incubated	incubate	VBN
cord-252671-uf96jgig	215	15	at	at	IN
cord-252671-uf96jgig	215	16	37	37	CD
cord-252671-uf96jgig	215	17	°	°	NN
cord-252671-uf96jgig	215	18	C	c	NN
cord-252671-uf96jgig	215	19	for	for	IN
cord-252671-uf96jgig	215	20	another	another	DT
cord-252671-uf96jgig	215	21	24	24	CD
cord-252671-uf96jgig	215	22	h	h	NN
cord-252671-uf96jgig	215	23	before	before	IN
cord-252671-uf96jgig	215	24	harvesting	harvest	VBG
cord-252671-uf96jgig	215	25	.	.	.
cord-252671-uf96jgig	216	1	The	the	DT
cord-252671-uf96jgig	216	2	SARS	SARS	NNP
cord-252671-uf96jgig	216	3	-	-	HYPH
cord-252671-uf96jgig	216	4	CoV	CoV	NNP
cord-252671-uf96jgig	216	5	pseudovirus	pseudovirus	NNP
cord-252671-uf96jgig	216	6	VLP(S	VLP(S	NNP
cord-252671-uf96jgig	216	7	-	-	HYPH
cord-252671-uf96jgig	216	8	M	M	NNP
cord-252671-uf96jgig	216	9	-	-	HYPH
cord-252671-uf96jgig	216	10	N	N	NNP
cord-252671-uf96jgig	216	11	)	)	-RRB-
cord-252671-uf96jgig	216	12	markedly	markedly	RB
cord-252671-uf96jgig	216	13	upregulated	upregulate	VBN
cord-252671-uf96jgig	216	14	IFN-	IFN-	NNP
cord-252671-uf96jgig	216	15	␤	␤	DT
cord-252671-uf96jgig	216	16	expression	expression	NN
cord-252671-uf96jgig	216	17	at	at	IN
cord-252671-uf96jgig	216	18	both	both	CC
cord-252671-uf96jgig	216	19	RNA	RNA	NNP
cord-252671-uf96jgig	216	20	and	and	CC
cord-252671-uf96jgig	216	21	protein	protein	NN
cord-252671-uf96jgig	216	22	levels	level	NNS
cord-252671-uf96jgig	216	23	(	(	-LRB-
cord-252671-uf96jgig	216	24	Fig	Fig	NNP
cord-252671-uf96jgig	216	25	.	.	.
cord-252671-uf96jgig	216	26	8B	8B	NNP
cord-252671-uf96jgig	216	27	)	)	-RRB-
cord-252671-uf96jgig	216	28	,	,	,
cord-252671-uf96jgig	216	29	whereas	whereas	IN
cord-252671-uf96jgig	216	30	the	the	DT
cord-252671-uf96jgig	216	31	point	point	NN
cord-252671-uf96jgig	216	32	mutation	mutation	NN
cord-252671-uf96jgig	216	33	at	at	IN
cord-252671-uf96jgig	216	34	the	the	DT
cord-252671-uf96jgig	216	35	valine	valine	NN
cord-252671-uf96jgig	216	36	68	68	CD
cord-252671-uf96jgig	216	37	residue	residue	NN
cord-252671-uf96jgig	216	38	of	of	IN
cord-252671-uf96jgig	216	39	M	M	NNP
cord-252671-uf96jgig	216	40	protein	protein	NN
cord-252671-uf96jgig	216	41	completely	completely	RB
cord-252671-uf96jgig	216	42	diminished	diminish	VBD
cord-252671-uf96jgig	216	43	SARS	SARS	NNP
cord-252671-uf96jgig	216	44	-	-	HYPH
cord-252671-uf96jgig	216	45	CoV	CoV	NNP
cord-252671-uf96jgig	216	46	pseudovirus	pseudovirus	NNP
cord-252671-uf96jgig	216	47	-	-	HYPH
cord-252671-uf96jgig	216	48	mediated	mediate	VBN
cord-252671-uf96jgig	216	49	IFN-	IFN-	NNP
cord-252671-uf96jgig	216	50	␤	␤	CD
cord-252671-uf96jgig	216	51	induction	induction	NN
cord-252671-uf96jgig	216	52	,	,	,
cord-252671-uf96jgig	216	53	strongly	strongly	RB
cord-252671-uf96jgig	216	54	indicating	indicate	VBG
cord-252671-uf96jgig	216	55	that	that	IN
cord-252671-uf96jgig	216	56	the	the	DT
cord-252671-uf96jgig	216	57	M	M	NNP
cord-252671-uf96jgig	216	58	protein	protein	NN
cord-252671-uf96jgig	216	59	residing	reside	VBG
cord-252671-uf96jgig	216	60	on	on	IN
cord-252671-uf96jgig	216	61	SARS	SARS	NNP
cord-252671-uf96jgig	216	62	-	-	HYPH
cord-252671-uf96jgig	216	63	CoV	CoV	NNP
cord-252671-uf96jgig	216	64	virion	virion	NN
cord-252671-uf96jgig	216	65	could	could	MD
cord-252671-uf96jgig	216	66	specifically	specifically	RB
cord-252671-uf96jgig	216	67	induce	induce	VB
cord-252671-uf96jgig	216	68	IFN-	IFN-	NNP
cord-252671-uf96jgig	216	69	␤	␤	CD
cord-252671-uf96jgig	216	70	production	production	NN
cord-252671-uf96jgig	216	71	upon	upon	IN
cord-252671-uf96jgig	216	72	infecting	infect	VBG
cord-252671-uf96jgig	216	73	the	the	DT
cord-252671-uf96jgig	216	74	targeted	target	VBN
cord-252671-uf96jgig	216	75	cells	cell	NNS
cord-252671-uf96jgig	216	76	.	.	.
cord-252671-uf96jgig	217	1	Taken	take	VBN
cord-252671-uf96jgig	217	2	together	together	RB
cord-252671-uf96jgig	217	3	,	,	,
cord-252671-uf96jgig	217	4	our	-PRON-	PRP$
cord-252671-uf96jgig	217	5	data	datum	NNS
cord-252671-uf96jgig	217	6	indicate	indicate	VBP
cord-252671-uf96jgig	217	7	for	for	IN
cord-252671-uf96jgig	217	8	the	the	DT
cord-252671-uf96jgig	217	9	first	first	JJ
cord-252671-uf96jgig	217	10	time	time	NN
cord-252671-uf96jgig	217	11	that	that	WDT
cord-252671-uf96jgig	217	12	SARS	SARS	NNP
cord-252671-uf96jgig	217	13	-	-	HYPH
cord-252671-uf96jgig	217	14	CoV	CoV	NNP
cord-252671-uf96jgig	217	15	M	M	NNP
cord-252671-uf96jgig	217	16	protein	protein	NN
cord-252671-uf96jgig	217	17	may	may	MD
cord-252671-uf96jgig	217	18	function	function	VB
cord-252671-uf96jgig	217	19	as	as	IN
cord-252671-uf96jgig	217	20	a	a	DT
cord-252671-uf96jgig	217	21	novel	novel	JJ
cord-252671-uf96jgig	217	22	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	217	23	PAMP	PAMP	NNP
cord-252671-uf96jgig	217	24	to	to	TO
cord-252671-uf96jgig	217	25	activate	activate	VB
cord-252671-uf96jgig	217	26	IFN-	IFN-	NNP
cord-252671-uf96jgig	217	27	␤	␤	CD
cord-252671-uf96jgig	217	28	induction	induction	NN
cord-252671-uf96jgig	217	29	through	through	IN
cord-252671-uf96jgig	217	30	an	an	DT
cord-252671-uf96jgig	217	31	intracellular	intracellular	JJ
cord-252671-uf96jgig	217	32	TLR	tlr	NN
cord-252671-uf96jgig	217	33	-	-	HYPH
cord-252671-uf96jgig	217	34	related	relate	VBN
cord-252671-uf96jgig	217	35	signaling	signal	VBG
cord-252671-uf96jgig	217	36	pathway	pathway	NN
cord-252671-uf96jgig	217	37	in	in	IN
cord-252671-uf96jgig	217	38	a	a	DT
cord-252671-uf96jgig	217	39	TRAF3-independent	TRAF3-independent	NNP
cord-252671-uf96jgig	217	40	manner	manner	NN
cord-252671-uf96jgig	217	41	.	.	.
cord-252671-uf96jgig	218	1	Pathogen	pathogen	NN
cord-252671-uf96jgig	218	2	-	-	HYPH
cord-252671-uf96jgig	218	3	associated	associate	VBN
cord-252671-uf96jgig	218	4	molecular	molecular	JJ
cord-252671-uf96jgig	218	5	patterns	pattern	NNS
cord-252671-uf96jgig	218	6	(	(	-LRB-
cord-252671-uf96jgig	218	7	PAMPs	pamp	NNS
cord-252671-uf96jgig	218	8	)	)	-RRB-
cord-252671-uf96jgig	218	9	are	be	VBP
cord-252671-uf96jgig	218	10	pathogenborne	pathogenborne	JJ
cord-252671-uf96jgig	218	11	components	component	NNS
cord-252671-uf96jgig	218	12	that	that	WDT
cord-252671-uf96jgig	218	13	can	can	MD
cord-252671-uf96jgig	218	14	be	be	VB
cord-252671-uf96jgig	218	15	sensed	sense	VBN
cord-252671-uf96jgig	218	16	by	by	IN
cord-252671-uf96jgig	218	17	either	either	DT
cord-252671-uf96jgig	218	18	transmembrane	transmembrane	NN
cord-252671-uf96jgig	218	19	,	,	,
cord-252671-uf96jgig	218	20	endolysosomal	endolysosomal	JJ
cord-252671-uf96jgig	218	21	,	,	,
cord-252671-uf96jgig	218	22	or	or	CC
cord-252671-uf96jgig	218	23	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	218	24	sensors	sensor	NNS
cord-252671-uf96jgig	218	25	known	know	VBN
cord-252671-uf96jgig	218	26	as	as	IN
cord-252671-uf96jgig	218	27	pattern	pattern	NN
cord-252671-uf96jgig	218	28	recognition	recognition	NN
cord-252671-uf96jgig	218	29	receptors	receptor	NNS
cord-252671-uf96jgig	218	30	(	(	-LRB-
cord-252671-uf96jgig	218	31	PRRs	PRRs	NNP
cord-252671-uf96jgig	218	32	)	)	-RRB-
cord-252671-uf96jgig	218	33	(	(	-LRB-
cord-252671-uf96jgig	218	34	36	36	CD
cord-252671-uf96jgig	218	35	)	)	-RRB-
cord-252671-uf96jgig	218	36	.	.	.
cord-252671-uf96jgig	219	1	In	in	IN
cord-252671-uf96jgig	219	2	this	this	DT
cord-252671-uf96jgig	219	3	study	study	NN
cord-252671-uf96jgig	219	4	,	,	,
cord-252671-uf96jgig	219	5	we	-PRON-	PRP
cord-252671-uf96jgig	219	6	demonstrate	demonstrate	VBP
cord-252671-uf96jgig	219	7	that	that	IN
cord-252671-uf96jgig	219	8	the	the	DT
cord-252671-uf96jgig	219	9	membrane	membrane	NN
cord-252671-uf96jgig	219	10	protein	protein	NN
cord-252671-uf96jgig	219	11	of	of	IN
cord-252671-uf96jgig	219	12	SARS	SARS	NNP
cord-252671-uf96jgig	219	13	-	-	HYPH
cord-252671-uf96jgig	219	14	CoV	CoV	NNP
cord-252671-uf96jgig	219	15	significantly	significantly	RB
cord-252671-uf96jgig	219	16	upregulates	upregulate	VBZ
cord-252671-uf96jgig	219	17	IFN-	IFN-	NNP
cord-252671-uf96jgig	219	18	␤	␤	CD
cord-252671-uf96jgig	219	19	production	production	NN
cord-252671-uf96jgig	219	20	by	by	IN
cord-252671-uf96jgig	219	21	activating	activate	VBG
cord-252671-uf96jgig	219	22	both	both	DT
cord-252671-uf96jgig	219	23	NF	nf	NN
cord-252671-uf96jgig	219	24	-	-	HYPH
cord-252671-uf96jgig	219	25	B	B	NNP
cord-252671-uf96jgig	219	26	and	and	CC
cord-252671-uf96jgig	219	27	TBK1-IRF3	TBK1-IRF3	NNP
cord-252671-uf96jgig	219	28	signaling	signal	VBG
cord-252671-uf96jgig	219	29	cascades	cascade	NNS
cord-252671-uf96jgig	219	30	.	.	.
cord-252671-uf96jgig	220	1	Our	-PRON-	PRP$
cord-252671-uf96jgig	220	2	data	datum	NNS
cord-252671-uf96jgig	220	3	show	show	VBP
cord-252671-uf96jgig	220	4	that	that	IN
cord-252671-uf96jgig	220	5	M	M	NNP
cord-252671-uf96jgig	220	6	-	-	HYPH
cord-252671-uf96jgig	220	7	mediated	mediate	VBN
cord-252671-uf96jgig	220	8	IFN-	IFN-	NNP
cord-252671-uf96jgig	220	9	␤	␤	CD
cord-252671-uf96jgig	220	10	production	production	NN
cord-252671-uf96jgig	220	11	is	be	VBZ
cord-252671-uf96jgig	220	12	induced	induce	VBN
cord-252671-uf96jgig	220	13	by	by	IN
cord-252671-uf96jgig	220	14	M	M	NNP
cord-252671-uf96jgig	220	15	protein	protein	NN
cord-252671-uf96jgig	220	16	rather	rather	RB
cord-252671-uf96jgig	220	17	than	than	IN
cord-252671-uf96jgig	220	18	M	M	NNP
cord-252671-uf96jgig	220	19	mRNA	mRNA	NNP
cord-252671-uf96jgig	220	20	,	,	,
cord-252671-uf96jgig	220	21	indicating	indicate	VBG
cord-252671-uf96jgig	220	22	that	that	IN
cord-252671-uf96jgig	220	23	pathogen	pathogen	NN
cord-252671-uf96jgig	220	24	-	-	HYPH
cord-252671-uf96jgig	220	25	derived	derive	VBN
cord-252671-uf96jgig	220	26	protein	protein	NN
cord-252671-uf96jgig	220	27	might	may	MD
cord-252671-uf96jgig	220	28	be	be	VB
cord-252671-uf96jgig	220	29	able	able	JJ
cord-252671-uf96jgig	220	30	to	to	TO
cord-252671-uf96jgig	220	31	serve	serve	VB
cord-252671-uf96jgig	220	32	as	as	IN
cord-252671-uf96jgig	220	33	a	a	DT
cord-252671-uf96jgig	220	34	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	220	35	PAMP	pamp	NN
cord-252671-uf96jgig	220	36	.	.	.
cord-252671-uf96jgig	221	1	In	in	IN
cord-252671-uf96jgig	221	2	addition	addition	NN
cord-252671-uf96jgig	221	3	,	,	,
cord-252671-uf96jgig	221	4	a	a	DT
cord-252671-uf96jgig	221	5	mechanism	mechanism	NN
cord-252671-uf96jgig	221	6	study	study	NN
cord-252671-uf96jgig	221	7	indicates	indicate	VBZ
cord-252671-uf96jgig	221	8	that	that	IN
cord-252671-uf96jgig	221	9	M	M	NNP
cord-252671-uf96jgig	221	10	proteinmediated	proteinmediate	VBD
cord-252671-uf96jgig	221	11	IFN-	IFN-	NNP
cord-252671-uf96jgig	221	12	␤	␤	CD
cord-252671-uf96jgig	221	13	induction	induction	NN
cord-252671-uf96jgig	221	14	may	may	MD
cord-252671-uf96jgig	221	15	be	be	VB
cord-252671-uf96jgig	221	16	mainly	mainly	RB
cord-252671-uf96jgig	221	17	due	due	JJ
cord-252671-uf96jgig	221	18	to	to	IN
cord-252671-uf96jgig	221	19	the	the	DT
cord-252671-uf96jgig	221	20	selective	selective	JJ
cord-252671-uf96jgig	221	21	activation	activation	NN
cord-252671-uf96jgig	221	22	of	of	IN
cord-252671-uf96jgig	221	23	TLR	tlr	NN
cord-252671-uf96jgig	221	24	-	-	HYPH
cord-252671-uf96jgig	221	25	related	relate	VBN
cord-252671-uf96jgig	221	26	signaling	signal	VBG
cord-252671-uf96jgig	221	27	pathways	pathway	NNS
cord-252671-uf96jgig	221	28	rather	rather	RB
cord-252671-uf96jgig	221	29	than	than	IN
cord-252671-uf96jgig	221	30	the	the	DT
cord-252671-uf96jgig	221	31	RLR	RLR	NNP
cord-252671-uf96jgig	221	32	signaling	signal	VBG
cord-252671-uf96jgig	221	33	pathway	pathway	NN
cord-252671-uf96jgig	221	34	in	in	IN
cord-252671-uf96jgig	221	35	a	a	DT
cord-252671-uf96jgig	221	36	TRAF3-independent	TRAF3-independent	NNP
cord-252671-uf96jgig	221	37	manner	manner	NN
cord-252671-uf96jgig	221	38	.	.	.
cord-252671-uf96jgig	222	1	Overall	overall	RB
cord-252671-uf96jgig	222	2	,	,	,
cord-252671-uf96jgig	222	3	the	the	DT
cord-252671-uf96jgig	222	4	current	current	JJ
cord-252671-uf96jgig	222	5	study	study	NN
cord-252671-uf96jgig	222	6	indicates	indicate	VBZ
cord-252671-uf96jgig	222	7	for	for	IN
cord-252671-uf96jgig	222	8	the	the	DT
cord-252671-uf96jgig	222	9	first	first	JJ
cord-252671-uf96jgig	222	10	time	time	NN
cord-252671-uf96jgig	222	11	that	that	DT
cord-252671-uf96jgig	222	12	pathogen	pathogen	NN
cord-252671-uf96jgig	222	13	-	-	HYPH
cord-252671-uf96jgig	222	14	derived	derive	VBN
cord-252671-uf96jgig	222	15	protein	protein	NN
cord-252671-uf96jgig	222	16	may	may	MD
cord-252671-uf96jgig	222	17	function	function	VB
cord-252671-uf96jgig	222	18	as	as	IN
cord-252671-uf96jgig	222	19	a	a	DT
cord-252671-uf96jgig	222	20	novel	novel	JJ
cord-252671-uf96jgig	222	21	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	222	22	PAMP	PAMP	NNP
cord-252671-uf96jgig	222	23	to	to	TO
cord-252671-uf96jgig	222	24	initiate	initiate	VB
cord-252671-uf96jgig	222	25	a	a	DT
cord-252671-uf96jgig	222	26	TLRrelated	tlrrelate	VBN
cord-252671-uf96jgig	222	27	TRAF3-independent	TRAF3-independent	NNP
cord-252671-uf96jgig	222	28	signaling	signal	VBG
cord-252671-uf96jgig	222	29	pathway	pathway	NN
cord-252671-uf96jgig	222	30	that	that	WDT
cord-252671-uf96jgig	222	31	subsequently	subsequently	RB
cord-252671-uf96jgig	222	32	promotes	promote	VBZ
cord-252671-uf96jgig	222	33	type	type	NN
cord-252671-uf96jgig	223	1	I	-PRON-	PRP
cord-252671-uf96jgig	224	1	interferon	interferon	NNP
cord-252671-uf96jgig	224	2	(	(	-LRB-
cord-252671-uf96jgig	224	3	IFN	IFN	NNP
cord-252671-uf96jgig	224	4	-	-	HYPH
cord-252671-uf96jgig	224	5	I	I	NNP
cord-252671-uf96jgig	224	6	)	)	-RRB-
cord-252671-uf96jgig	224	7	production	production	NN
cord-252671-uf96jgig	224	8	.	.	.
cord-252671-uf96jgig	225	1	The	the	DT
cord-252671-uf96jgig	225	2	membrane	membrane	NN
cord-252671-uf96jgig	225	3	-	-	HYPH
cord-252671-uf96jgig	225	4	associated	associate	VBN
cord-252671-uf96jgig	225	5	PRRs	prr	NNS
cord-252671-uf96jgig	225	6	,	,	,
cord-252671-uf96jgig	225	7	such	such	JJ
cord-252671-uf96jgig	225	8	as	as	IN
cord-252671-uf96jgig	225	9	TLR2	TLR2	NNP
cord-252671-uf96jgig	225	10	and	and	CC
cord-252671-uf96jgig	225	11	TLR4	TLR4	NNP
cord-252671-uf96jgig	225	12	,	,	,
cord-252671-uf96jgig	225	13	can	can	MD
cord-252671-uf96jgig	225	14	sense	sense	VB
cord-252671-uf96jgig	225	15	not	not	RB
cord-252671-uf96jgig	225	16	only	only	RB
cord-252671-uf96jgig	225	17	bacterial	bacterial	JJ
cord-252671-uf96jgig	225	18	components	component	NNS
cord-252671-uf96jgig	225	19	but	but	CC
cord-252671-uf96jgig	225	20	also	also	RB
cord-252671-uf96jgig	225	21	viral	viral	JJ
cord-252671-uf96jgig	225	22	coat	coat	NN
cord-252671-uf96jgig	225	23	proteins	protein	NNS
cord-252671-uf96jgig	225	24	(	(	-LRB-
cord-252671-uf96jgig	225	25	37	37	CD
cord-252671-uf96jgig	225	26	)	)	-RRB-
cord-252671-uf96jgig	225	27	.	.	.
cord-252671-uf96jgig	226	1	Kurt	Kurt	NNP
cord-252671-uf96jgig	226	2	-	-	HYPH
cord-252671-uf96jgig	226	3	Jones	Jones	NNP
cord-252671-uf96jgig	226	4	and	and	CC
cord-252671-uf96jgig	226	5	colleagues	colleague	NNS
cord-252671-uf96jgig	226	6	first	first	RB
cord-252671-uf96jgig	226	7	demonstrated	demonstrate	VBD
cord-252671-uf96jgig	226	8	that	that	IN
cord-252671-uf96jgig	226	9	the	the	DT
cord-252671-uf96jgig	226	10	innate	innate	JJ
cord-252671-uf96jgig	226	11	immune	immune	JJ
cord-252671-uf96jgig	226	12	response	response	NN
cord-252671-uf96jgig	226	13	to	to	IN
cord-252671-uf96jgig	226	14	the	the	DT
cord-252671-uf96jgig	226	15	fusion	fusion	NN
cord-252671-uf96jgig	226	16	(	(	-LRB-
cord-252671-uf96jgig	226	17	F	F	NNP
cord-252671-uf96jgig	226	18	)	)	-RRB-
cord-252671-uf96jgig	226	19	protein	protein	NN
cord-252671-uf96jgig	226	20	of	of	IN
cord-252671-uf96jgig	226	21	respiratory	respiratory	JJ
cord-252671-uf96jgig	226	22	syncytial	syncytial	JJ
cord-252671-uf96jgig	226	23	virus	virus	NN
cord-252671-uf96jgig	226	24	(	(	-LRB-
cord-252671-uf96jgig	226	25	RSV	RSV	NNP
cord-252671-uf96jgig	226	26	)	)	-RRB-
cord-252671-uf96jgig	226	27	is	be	VBZ
cord-252671-uf96jgig	226	28	mediated	mediate	VBN
cord-252671-uf96jgig	226	29	by	by	IN
cord-252671-uf96jgig	226	30	TLR4	TLR4	NNP
cord-252671-uf96jgig	226	31	plus	plus	CC
cord-252671-uf96jgig	226	32	its	-PRON-	PRP$
cord-252671-uf96jgig	226	33	cofactor	cofactor	NN
cord-252671-uf96jgig	226	34	CD14	CD14	NNP
cord-252671-uf96jgig	226	35	on	on	IN
cord-252671-uf96jgig	226	36	the	the	DT
cord-252671-uf96jgig	226	37	plasma	plasma	NN
cord-252671-uf96jgig	226	38	membrane	membrane	NN
cord-252671-uf96jgig	226	39	,	,	,
cord-252671-uf96jgig	226	40	indicating	indicate	VBG
cord-252671-uf96jgig	226	41	that	that	IN
cord-252671-uf96jgig	226	42	nonbacterial	nonbacterial	JJ
cord-252671-uf96jgig	226	43	components	component	NNS
cord-252671-uf96jgig	226	44	can	can	MD
cord-252671-uf96jgig	226	45	serve	serve	VB
cord-252671-uf96jgig	226	46	as	as	IN
cord-252671-uf96jgig	226	47	extracellular	extracellular	JJ
cord-252671-uf96jgig	226	48	PAMPs	pamp	NNS
cord-252671-uf96jgig	226	49	(	(	-LRB-
cord-252671-uf96jgig	226	50	24	24	CD
cord-252671-uf96jgig	226	51	)	)	-RRB-
cord-252671-uf96jgig	226	52	.	.	.
cord-252671-uf96jgig	227	1	Although	although	IN
cord-252671-uf96jgig	227	2	some	some	DT
cord-252671-uf96jgig	227	3	viral	viral	JJ
cord-252671-uf96jgig	227	4	structural	structural	JJ
cord-252671-uf96jgig	227	5	proteins	protein	NNS
cord-252671-uf96jgig	227	6	,	,	,
cord-252671-uf96jgig	227	7	such	such	JJ
cord-252671-uf96jgig	227	8	as	as	IN
cord-252671-uf96jgig	227	9	the	the	DT
cord-252671-uf96jgig	227	10	nucleocapsid	nucleocapsid	NN
cord-252671-uf96jgig	227	11	(	(	-LRB-
cord-252671-uf96jgig	227	12	N	N	NNP
cord-252671-uf96jgig	227	13	)	)	-RRB-
cord-252671-uf96jgig	227	14	from	from	IN
cord-252671-uf96jgig	227	15	measles	measles	NNP
cord-252671-uf96jgig	227	16	virus	virus	NN
cord-252671-uf96jgig	227	17	(	(	-LRB-
cord-252671-uf96jgig	227	18	38	38	CD
cord-252671-uf96jgig	227	19	)	)	-RRB-
cord-252671-uf96jgig	227	20	and	and	CC
cord-252671-uf96jgig	227	21	viral	viral	JJ
cord-252671-uf96jgig	227	22	ribonucleoprotein	ribonucleoprotein	NN
cord-252671-uf96jgig	227	23	from	from	IN
cord-252671-uf96jgig	227	24	vesicular	vesicular	JJ
cord-252671-uf96jgig	227	25	stomatitis	stomatitis	NN
cord-252671-uf96jgig	227	26	virus	virus	NN
cord-252671-uf96jgig	227	27	(	(	-LRB-
cord-252671-uf96jgig	227	28	39	39	CD
cord-252671-uf96jgig	227	29	)	)	-RRB-
cord-252671-uf96jgig	227	30	,	,	,
cord-252671-uf96jgig	227	31	can	can	MD
cord-252671-uf96jgig	227	32	activate	activate	VB
cord-252671-uf96jgig	227	33	IRF3	IRF3	NNP
cord-252671-uf96jgig	227	34	and	and	CC
cord-252671-uf96jgig	227	35	TBK1	TBK1	NNP
cord-252671-uf96jgig	227	36	/	/	SYM
cord-252671-uf96jgig	227	37	IKK	IKK	NNP
cord-252671-uf96jgig	227	38	␦	␦	NNP
cord-252671-uf96jgig	227	39	,	,	,
cord-252671-uf96jgig	227	40	respectively	respectively	RB
cord-252671-uf96jgig	227	41	,	,	,
cord-252671-uf96jgig	227	42	it	-PRON-	PRP
cord-252671-uf96jgig	227	43	remains	remain	VBZ
cord-252671-uf96jgig	227	44	to	to	TO
cord-252671-uf96jgig	227	45	be	be	VB
cord-252671-uf96jgig	227	46	determined	determine	VBN
cord-252671-uf96jgig	227	47	how	how	WRB
cord-252671-uf96jgig	227	48	these	these	DT
cord-252671-uf96jgig	227	49	viral	viral	JJ
cord-252671-uf96jgig	227	50	products	product	NNS
cord-252671-uf96jgig	227	51	can	can	MD
cord-252671-uf96jgig	227	52	function	function	VB
cord-252671-uf96jgig	227	53	as	as	IN
cord-252671-uf96jgig	227	54	PAMPs	pamp	NNS
cord-252671-uf96jgig	227	55	and	and	CC
cord-252671-uf96jgig	227	56	where	where	WRB
cord-252671-uf96jgig	227	57	the	the	DT
cord-252671-uf96jgig	227	58	driving	drive	VBG
cord-252671-uf96jgig	227	59	forces	force	NNS
cord-252671-uf96jgig	227	60	for	for	IN
cord-252671-uf96jgig	227	61	their	-PRON-	PRP$
cord-252671-uf96jgig	227	62	activation	activation	NN
cord-252671-uf96jgig	227	63	come	come	VBN
cord-252671-uf96jgig	227	64	from	from	IN
cord-252671-uf96jgig	227	65	.	.	.
cord-252671-uf96jgig	228	1	It	-PRON-	PRP
cord-252671-uf96jgig	228	2	has	have	VBZ
cord-252671-uf96jgig	228	3	been	be	VBN
cord-252671-uf96jgig	228	4	shown	show	VBN
cord-252671-uf96jgig	228	5	that	that	IN
cord-252671-uf96jgig	228	6	the	the	DT
cord-252671-uf96jgig	228	7	SARS	SARS	NNP
cord-252671-uf96jgig	228	8	-	-	HYPH
cord-252671-uf96jgig	228	9	CoV	CoV	NNP
cord-252671-uf96jgig	228	10	M	M	NNP
cord-252671-uf96jgig	228	11	protein	protein	NN
cord-252671-uf96jgig	228	12	alone	alone	RB
cord-252671-uf96jgig	228	13	not	not	RB
cord-252671-uf96jgig	228	14	only	only	RB
cord-252671-uf96jgig	228	15	can	can	MD
cord-252671-uf96jgig	228	16	form	form	VB
cord-252671-uf96jgig	228	17	virus	virus	NN
cord-252671-uf96jgig	228	18	-	-	HYPH
cord-252671-uf96jgig	228	19	like	like	JJ
cord-252671-uf96jgig	228	20	particles	particle	NNS
cord-252671-uf96jgig	228	21	(	(	-LRB-
cord-252671-uf96jgig	228	22	VLPs	vlp	NNS
cord-252671-uf96jgig	228	23	)	)	-RRB-
cord-252671-uf96jgig	228	24	in	in	IN
cord-252671-uf96jgig	228	25	a	a	DT
cord-252671-uf96jgig	228	26	viral	viral	JJ
cord-252671-uf96jgig	228	27	RNA	rna	NN
cord-252671-uf96jgig	228	28	-	-	HYPH
cord-252671-uf96jgig	228	29	independent	independent	JJ
cord-252671-uf96jgig	228	30	manner	manner	NN
cord-252671-uf96jgig	228	31	(	(	-LRB-
cord-252671-uf96jgig	228	32	40	40	CD
cord-252671-uf96jgig	228	33	)	)	-RRB-
cord-252671-uf96jgig	228	34	but	but	CC
cord-252671-uf96jgig	228	35	also	also	RB
cord-252671-uf96jgig	228	36	can	can	MD
cord-252671-uf96jgig	228	37	induce	induce	VB
cord-252671-uf96jgig	228	38	cell	cell	NN
cord-252671-uf96jgig	228	39	apoptosis	apoptosis	NN
cord-252671-uf96jgig	228	40	by	by	IN
cord-252671-uf96jgig	228	41	inhibiting	inhibit	VBG
cord-252671-uf96jgig	228	42	some	some	DT
cord-252671-uf96jgig	228	43	key	key	JJ
cord-252671-uf96jgig	228	44	survival	survival	NN
cord-252671-uf96jgig	228	45	signal	signal	NN
cord-252671-uf96jgig	228	46	pathways	pathway	NNS
cord-252671-uf96jgig	228	47	,	,	,
cord-252671-uf96jgig	228	48	such	such	JJ
cord-252671-uf96jgig	228	49	as	as	IN
cord-252671-uf96jgig	228	50	the	the	DT
cord-252671-uf96jgig	228	51	Akt	Akt	NNP
cord-252671-uf96jgig	228	52	signaling	signal	VBG
cord-252671-uf96jgig	228	53	pathway	pathway	NN
cord-252671-uf96jgig	228	54	(	(	-LRB-
cord-252671-uf96jgig	228	55	41	41	CD
cord-252671-uf96jgig	228	56	)	)	-RRB-
cord-252671-uf96jgig	228	57	.	.	.
cord-252671-uf96jgig	229	1	Thus	thus	RB
cord-252671-uf96jgig	229	2	,	,	,
cord-252671-uf96jgig	229	3	the	the	DT
cord-252671-uf96jgig	229	4	M	M	NNP
cord-252671-uf96jgig	229	5	proteins	protein	NNS
cord-252671-uf96jgig	229	6	derived	derive	VBN
cord-252671-uf96jgig	229	7	from	from	IN
cord-252671-uf96jgig	229	8	these	these	DT
cord-252671-uf96jgig	229	9	infected	infect	VBN
cord-252671-uf96jgig	229	10	and	and	CC
cord-252671-uf96jgig	229	11	apoptotic	apoptotic	JJ
cord-252671-uf96jgig	229	12	cells	cell	NNS
cord-252671-uf96jgig	229	13	might	may	MD
cord-252671-uf96jgig	229	14	be	be	VB
cord-252671-uf96jgig	229	15	eventually	eventually	RB
cord-252671-uf96jgig	229	16	secreted	secrete	VBN
cord-252671-uf96jgig	229	17	and	and	CC
cord-252671-uf96jgig	229	18	released	release	VBN
cord-252671-uf96jgig	229	19	into	into	IN
cord-252671-uf96jgig	229	20	the	the	DT
cord-252671-uf96jgig	229	21	extracellular	extracellular	JJ
cord-252671-uf96jgig	229	22	compartments	compartment	NNS
cord-252671-uf96jgig	229	23	where	where	WRB
cord-252671-uf96jgig	229	24	the	the	DT
cord-252671-uf96jgig	229	25	TLRs	TLRs	NNPS
cord-252671-uf96jgig	229	26	(	(	-LRB-
cord-252671-uf96jgig	229	27	such	such	JJ
cord-252671-uf96jgig	229	28	as	as	IN
cord-252671-uf96jgig	229	29	TLR2	TLR2	NNP
cord-252671-uf96jgig	229	30	and	and	CC
cord-252671-uf96jgig	229	31	TLR4	TLR4	NNP
cord-252671-uf96jgig	229	32	)	)	-RRB-
cord-252671-uf96jgig	229	33	on	on	IN
cord-252671-uf96jgig	229	34	the	the	DT
cord-252671-uf96jgig	229	35	cell	cell	NN
cord-252671-uf96jgig	229	36	surface	surface	NN
cord-252671-uf96jgig	229	37	can	can	MD
cord-252671-uf96jgig	229	38	be	be	VB
cord-252671-uf96jgig	229	39	potentially	potentially	RB
cord-252671-uf96jgig	229	40	recognized	recognize	VBN
cord-252671-uf96jgig	229	41	and	and	CC
cord-252671-uf96jgig	229	42	subsequently	subsequently	RB
cord-252671-uf96jgig	229	43	activated	activate	VBN
cord-252671-uf96jgig	229	44	by	by	IN
cord-252671-uf96jgig	229	45	these	these	DT
cord-252671-uf96jgig	229	46	extracellular	extracellular	JJ
cord-252671-uf96jgig	229	47	PAMPs	pamp	NNS
cord-252671-uf96jgig	229	48	for	for	IN
cord-252671-uf96jgig	229	49	the	the	DT
cord-252671-uf96jgig	229	50	induction	induction	NN
cord-252671-uf96jgig	229	51	of	of	IN
cord-252671-uf96jgig	229	52	the	the	DT
cord-252671-uf96jgig	229	53	IFN	IFN	NNP
cord-252671-uf96jgig	229	54	-	-	HYPH
cord-252671-uf96jgig	229	55	I	-PRON-	PRP
cord-252671-uf96jgig	229	56	response	response	NN
cord-252671-uf96jgig	229	57	.	.	.
cord-252671-uf96jgig	230	1	To	to	TO
cord-252671-uf96jgig	230	2	clarify	clarify	VB
cord-252671-uf96jgig	230	3	this	this	DT
cord-252671-uf96jgig	230	4	possibility	possibility	NN
cord-252671-uf96jgig	230	5	,	,	,
cord-252671-uf96jgig	230	6	we	-PRON-	PRP
cord-252671-uf96jgig	230	7	employed	employ	VBD
cord-252671-uf96jgig	230	8	several	several	JJ
cord-252671-uf96jgig	230	9	approaches	approach	NNS
cord-252671-uf96jgig	230	10	to	to	TO
cord-252671-uf96jgig	230	11	test	test	VB
cord-252671-uf96jgig	230	12	whether	whether	IN
cord-252671-uf96jgig	230	13	the	the	DT
cord-252671-uf96jgig	230	14	driving	drive	VBG
cord-252671-uf96jgig	230	15	force	force	NN
cord-252671-uf96jgig	230	16	for	for	IN
cord-252671-uf96jgig	230	17	M	M	NNP
cord-252671-uf96jgig	230	18	proteinmediated	proteinmediate	VBD
cord-252671-uf96jgig	231	1	IFN-	IFN-	NNP
cord-252671-uf96jgig	231	2	␤	␤	DT
cord-252671-uf96jgig	231	3	production	production	NN
cord-252671-uf96jgig	231	4	is	be	VBZ
cord-252671-uf96jgig	231	5	generated	generate	VBN
cord-252671-uf96jgig	231	6	from	from	IN
cord-252671-uf96jgig	231	7	inside	inside	IN
cord-252671-uf96jgig	231	8	or	or	CC
cord-252671-uf96jgig	231	9	outside	outside	IN
cord-252671-uf96jgig	231	10	the	the	DT
cord-252671-uf96jgig	231	11	cells	cell	NNS
cord-252671-uf96jgig	231	12	.	.	.
cord-252671-uf96jgig	232	1	We	-PRON-	PRP
cord-252671-uf96jgig	232	2	used	use	VBD
cord-252671-uf96jgig	232	3	two	two	CD
cord-252671-uf96jgig	232	4	types	type	NNS
cord-252671-uf96jgig	232	5	of	of	IN
cord-252671-uf96jgig	232	6	inhibitors	inhibitor	NNS
cord-252671-uf96jgig	232	7	,	,	,
cord-252671-uf96jgig	232	8	BFA	BFA	NNP
cord-252671-uf96jgig	232	9	and	and	CC
cord-252671-uf96jgig	232	10	OxPAPC	OxPAPC	NNP
cord-252671-uf96jgig	232	11	,	,	,
cord-252671-uf96jgig	232	12	to	to	TO
cord-252671-uf96jgig	232	13	block	block	VB
cord-252671-uf96jgig	232	14	either	either	CC
cord-252671-uf96jgig	232	15	the	the	DT
cord-252671-uf96jgig	232	16	intracellular	intracellular	JJ
cord-252671-uf96jgig	232	17	transport	transport	NN
cord-252671-uf96jgig	232	18	of	of	IN
cord-252671-uf96jgig	232	19	M	M	NNP
cord-252671-uf96jgig	232	20	protein	protein	NN
cord-252671-uf96jgig	232	21	or	or	CC
cord-252671-uf96jgig	232	22	the	the	DT
cord-252671-uf96jgig	232	23	extracellular	extracellular	JJ
cord-252671-uf96jgig	232	24	binding	binding	NN
cord-252671-uf96jgig	232	25	of	of	IN
cord-252671-uf96jgig	232	26	M	M	NNP
cord-252671-uf96jgig	232	27	protein	protein	NN
cord-252671-uf96jgig	232	28	on	on	IN
cord-252671-uf96jgig	232	29	TLR2	TLR2	NNP
cord-252671-uf96jgig	232	30	and	and	CC
cord-252671-uf96jgig	232	31	TLR4	TLR4	NNP
cord-252671-uf96jgig	232	32	,	,	,
cord-252671-uf96jgig	232	33	respectively	respectively	RB
cord-252671-uf96jgig	232	34	.	.	.
cord-252671-uf96jgig	233	1	Our	-PRON-	PRP$
cord-252671-uf96jgig	233	2	results	result	NNS
cord-252671-uf96jgig	233	3	reveal	reveal	VBP
cord-252671-uf96jgig	233	4	that	that	IN
cord-252671-uf96jgig	233	5	M	M	NNP
cord-252671-uf96jgig	233	6	-	-	HYPH
cord-252671-uf96jgig	233	7	mediated	mediate	VBN
cord-252671-uf96jgig	233	8	IFN-	IFN-	NNP
cord-252671-uf96jgig	233	9	␤	␤	CD
cord-252671-uf96jgig	233	10	induction	induction	NN
cord-252671-uf96jgig	233	11	is	be	VBZ
cord-252671-uf96jgig	233	12	independent	independent	JJ
cord-252671-uf96jgig	233	13	of	of	IN
cord-252671-uf96jgig	233	14	M	M	NNP
cord-252671-uf96jgig	233	15	protein	protein	NN
cord-252671-uf96jgig	233	16	secretion	secretion	NN
cord-252671-uf96jgig	233	17	as	as	RB
cord-252671-uf96jgig	233	18	well	well	RB
cord-252671-uf96jgig	233	19	as	as	IN
cord-252671-uf96jgig	233	20	the	the	DT
cord-252671-uf96jgig	233	21	extracellular	extracellular	JJ
cord-252671-uf96jgig	233	22	stimulation	stimulation	NN
cord-252671-uf96jgig	233	23	of	of	IN
cord-252671-uf96jgig	234	1	TLR2	TLR2	NNP
cord-252671-uf96jgig	234	2	/	/	SYM
cord-252671-uf96jgig	234	3	TLR4	TLR4	NNP
cord-252671-uf96jgig	234	4	signaling	signaling	NN
cord-252671-uf96jgig	234	5	,	,	,
cord-252671-uf96jgig	234	6	indicating	indicate	VBG
cord-252671-uf96jgig	234	7	that	that	IN
cord-252671-uf96jgig	234	8	the	the	DT
cord-252671-uf96jgig	234	9	driving	drive	VBG
cord-252671-uf96jgig	234	10	force	force	NN
cord-252671-uf96jgig	234	11	for	for	IN
cord-252671-uf96jgig	234	12	the	the	DT
cord-252671-uf96jgig	234	13	M	M	NNP
cord-252671-uf96jgig	234	14	-	-	HYPH
cord-252671-uf96jgig	234	15	mediated	mediate	VBN
cord-252671-uf96jgig	234	16	IFN-	IFN-	NNP
cord-252671-uf96jgig	234	17	␤	␤	CD
cord-252671-uf96jgig	234	18	induction	induction	NN
cord-252671-uf96jgig	234	19	is	be	VBZ
cord-252671-uf96jgig	234	20	likely	likely	RB
cord-252671-uf96jgig	234	21	generated	generate	VBN
cord-252671-uf96jgig	234	22	from	from	IN
cord-252671-uf96jgig	234	23	inside	inside	IN
cord-252671-uf96jgig	234	24	the	the	DT
cord-252671-uf96jgig	234	25	cells	cell	NNS
cord-252671-uf96jgig	234	26	.	.	.
cord-252671-uf96jgig	235	1	Our	-PRON-	PRP$
cord-252671-uf96jgig	235	2	results	result	NNS
cord-252671-uf96jgig	235	3	may	may	MD
cord-252671-uf96jgig	235	4	contradict	contradict	VB
cord-252671-uf96jgig	235	5	some	some	DT
cord-252671-uf96jgig	235	6	previous	previous	JJ
cord-252671-uf96jgig	235	7	reports	report	NNS
cord-252671-uf96jgig	235	8	related	relate	VBN
cord-252671-uf96jgig	235	9	to	to	IN
cord-252671-uf96jgig	235	10	M	M	NNP
cord-252671-uf96jgig	235	11	-	-	HYPH
cord-252671-uf96jgig	235	12	mediated	mediate	VBN
cord-252671-uf96jgig	235	13	IFN	IFN	NNP
cord-252671-uf96jgig	235	14	-	-	HYPH
cord-252671-uf96jgig	235	15	I	-PRON-	PRP
cord-252671-uf96jgig	235	16	response	response	NN
cord-252671-uf96jgig	235	17	.	.	.
cord-252671-uf96jgig	236	1	Siu	Siu	NNP
cord-252671-uf96jgig	236	2	et	et	NNP
cord-252671-uf96jgig	236	3	al	al	NNP
cord-252671-uf96jgig	236	4	.	.	NNP
cord-252671-uf96jgig	236	5	demonstrated	demonstrate	VBD
cord-252671-uf96jgig	236	6	that	that	IN
cord-252671-uf96jgig	236	7	the	the	DT
cord-252671-uf96jgig	236	8	M	M	NNP
cord-252671-uf96jgig	236	9	protein	protein	NN
cord-252671-uf96jgig	236	10	of	of	IN
cord-252671-uf96jgig	236	11	SARS	SARS	NNP
cord-252671-uf96jgig	236	12	-	-	HYPH
cord-252671-uf96jgig	236	13	CoV	CoV	NNP
cord-252671-uf96jgig	236	14	negatively	negatively	RB
cord-252671-uf96jgig	236	15	regulated	regulate	VBD
cord-252671-uf96jgig	236	16	the	the	DT
cord-252671-uf96jgig	236	17	dsRNA	dsrna	NN
cord-252671-uf96jgig	236	18	-	-	HYPH
cord-252671-uf96jgig	236	19	induced	induce	VBN
cord-252671-uf96jgig	236	20	and	and	CC
cord-252671-uf96jgig	236	21	signaling	signal	VBG
cord-252671-uf96jgig	236	22	molecule	molecule	NN
cord-252671-uf96jgig	236	23	-	-	HYPH
cord-252671-uf96jgig	236	24	induced	induce	VBN
cord-252671-uf96jgig	236	25	IFN	IFN	NNP
cord-252671-uf96jgig	236	26	-	-	HYPH
cord-252671-uf96jgig	236	27	I	-PRON-	PRP
cord-252671-uf96jgig	236	28	production	production	NN
cord-252671-uf96jgig	236	29	.	.	.
cord-252671-uf96jgig	237	1	They	-PRON-	PRP
cord-252671-uf96jgig	237	2	also	also	RB
cord-252671-uf96jgig	237	3	showed	show	VBD
cord-252671-uf96jgig	237	4	that	that	IN
cord-252671-uf96jgig	237	5	M	M	NNP
cord-252671-uf96jgig	237	6	protein	protein	NN
cord-252671-uf96jgig	237	7	alone	alone	RB
cord-252671-uf96jgig	237	8	was	be	VBD
cord-252671-uf96jgig	237	9	unable	unable	JJ
cord-252671-uf96jgig	237	10	to	to	TO
cord-252671-uf96jgig	237	11	activate	activate	VB
cord-252671-uf96jgig	237	12	the	the	DT
cord-252671-uf96jgig	237	13	IFN	IFN	NNP
cord-252671-uf96jgig	237	14	-	-	HYPH
cord-252671-uf96jgig	237	15	I	i	NN
cord-252671-uf96jgig	237	16	promoter	promoter	NN
cord-252671-uf96jgig	237	17	activity	activity	NN
cord-252671-uf96jgig	237	18	(	(	-LRB-
cord-252671-uf96jgig	237	19	34	34	CD
cord-252671-uf96jgig	237	20	)	)	-RRB-
cord-252671-uf96jgig	237	21	.	.	.
cord-252671-uf96jgig	238	1	One	one	CD
cord-252671-uf96jgig	238	2	study	study	NN
cord-252671-uf96jgig	238	3	even	even	RB
cord-252671-uf96jgig	238	4	showed	show	VBD
cord-252671-uf96jgig	238	5	that	that	IN
cord-252671-uf96jgig	238	6	M	M	NNP
cord-252671-uf96jgig	238	7	protein	protein	NN
cord-252671-uf96jgig	238	8	negatively	negatively	RB
cord-252671-uf96jgig	238	9	regulates	regulate	VBZ
cord-252671-uf96jgig	238	10	the	the	DT
cord-252671-uf96jgig	238	11	NF	nf	NN
cord-252671-uf96jgig	238	12	-	-	HYPH
cord-252671-uf96jgig	238	13	B	b	NN
cord-252671-uf96jgig	238	14	signaling	signal	VBG
cord-252671-uf96jgig	238	15	pathway	pathway	NN
cord-252671-uf96jgig	238	16	(	(	-LRB-
cord-252671-uf96jgig	238	17	42	42	CD
cord-252671-uf96jgig	238	18	)	)	-RRB-
cord-252671-uf96jgig	238	19	.	.	.
cord-252671-uf96jgig	239	1	A	a	DT
cord-252671-uf96jgig	239	2	possible	possible	JJ
cord-252671-uf96jgig	239	3	explanation	explanation	NN
cord-252671-uf96jgig	239	4	for	for	IN
cord-252671-uf96jgig	239	5	these	these	DT
cord-252671-uf96jgig	239	6	discrepancies	discrepancy	NNS
cord-252671-uf96jgig	239	7	might	may	MD
cord-252671-uf96jgig	239	8	be	be	VB
cord-252671-uf96jgig	239	9	related	relate	VBN
cord-252671-uf96jgig	239	10	to	to	IN
cord-252671-uf96jgig	239	11	the	the	DT
cord-252671-uf96jgig	239	12	M	M	NNP
cord-252671-uf96jgig	239	13	gene	gene	NN
cord-252671-uf96jgig	239	14	itself	-PRON-	PRP
cord-252671-uf96jgig	239	15	.	.	.
cord-252671-uf96jgig	240	1	Early	early	JJ
cord-252671-uf96jgig	240	2	study	study	NN
cord-252671-uf96jgig	240	3	has	have	VBZ
cord-252671-uf96jgig	240	4	shown	show	VBN
cord-252671-uf96jgig	240	5	that	that	IN
cord-252671-uf96jgig	240	6	M	M	NNP
cord-252671-uf96jgig	240	7	protein	protein	NN
cord-252671-uf96jgig	240	8	possesses	possess	VBZ
cord-252671-uf96jgig	240	9	a	a	DT
cord-252671-uf96jgig	240	10	higher	high	JJR
cord-252671-uf96jgig	240	11	substitution	substitution	NN
cord-252671-uf96jgig	240	12	rate	rate	NN
cord-252671-uf96jgig	240	13	than	than	IN
cord-252671-uf96jgig	240	14	other	other	JJ
cord-252671-uf96jgig	240	15	structural	structural	JJ
cord-252671-uf96jgig	240	16	proteins	protein	NNS
cord-252671-uf96jgig	240	17	in	in	IN
cord-252671-uf96jgig	240	18	SARS	SARS	NNP
cord-252671-uf96jgig	240	19	-	-	HYPH
cord-252671-uf96jgig	240	20	CoV	CoV	NNP
cord-252671-uf96jgig	240	21	,	,	,
cord-252671-uf96jgig	240	22	and	and	CC
cord-252671-uf96jgig	240	23	the	the	DT
cord-252671-uf96jgig	240	24	outcome	outcome	NN
cord-252671-uf96jgig	240	25	of	of	IN
cord-252671-uf96jgig	240	26	these	these	DT
cord-252671-uf96jgig	240	27	substitutions	substitution	NNS
cord-252671-uf96jgig	240	28	alters	alter	VBZ
cord-252671-uf96jgig	240	29	the	the	DT
cord-252671-uf96jgig	240	30	biochemical	biochemical	JJ
cord-252671-uf96jgig	240	31	and	and	CC
cord-252671-uf96jgig	240	32	immunological	immunological	JJ
cord-252671-uf96jgig	240	33	properties	property	NNS
cord-252671-uf96jgig	240	34	of	of	IN
cord-252671-uf96jgig	240	35	M	M	NNP
cord-252671-uf96jgig	240	36	proteins	protein	NNS
cord-252671-uf96jgig	240	37	(	(	-LRB-
cord-252671-uf96jgig	240	38	43	43	CD
cord-252671-uf96jgig	240	39	,	,	,
cord-252671-uf96jgig	240	40	44	44	CD
cord-252671-uf96jgig	240	41	)	)	-RRB-
cord-252671-uf96jgig	240	42	.	.	.
cord-252671-uf96jgig	241	1	One	one	CD
cord-252671-uf96jgig	241	2	amino	amino	NN
cord-252671-uf96jgig	241	3	acid	acid	NN
cord-252671-uf96jgig	241	4	alteration	alteration	NN
cord-252671-uf96jgig	241	5	from	from	IN
cord-252671-uf96jgig	241	6	valine	valine	NN
cord-252671-uf96jgig	241	7	to	to	IN
cord-252671-uf96jgig	241	8	alanine	alanine	NN
cord-252671-uf96jgig	241	9	at	at	IN
cord-252671-uf96jgig	241	10	residue	residue	NN
cord-252671-uf96jgig	241	11	68	68	CD
cord-252671-uf96jgig	241	12	is	be	VBZ
cord-252671-uf96jgig	241	13	indeed	indeed	RB
cord-252671-uf96jgig	241	14	found	find	VBN
cord-252671-uf96jgig	241	15	in	in	IN
cord-252671-uf96jgig	241	16	the	the	DT
cord-252671-uf96jgig	241	17	M	M	NNP
cord-252671-uf96jgig	241	18	protein	protein	NN
cord-252671-uf96jgig	241	19	from	from	IN
cord-252671-uf96jgig	241	20	the	the	DT
cord-252671-uf96jgig	241	21	GZ50	GZ50	NNP
cord-252671-uf96jgig	241	22	isolate	isolate	VB
cord-252671-uf96jgig	241	23	studied	study	VBN
cord-252671-uf96jgig	241	24	by	by	IN
cord-252671-uf96jgig	241	25	Siu	Siu	NNP
cord-252671-uf96jgig	241	26	et	et	NNP
cord-252671-uf96jgig	241	27	al	al	NNP
cord-252671-uf96jgig	241	28	.	.	.
cord-252671-uf96jgig	242	1	compared	compare	VBN
cord-252671-uf96jgig	242	2	with	with	IN
cord-252671-uf96jgig	242	3	the	the	DT
cord-252671-uf96jgig	242	4	isolate	isolate	NN
cord-252671-uf96jgig	242	5	used	use	VBN
cord-252671-uf96jgig	242	6	in	in	IN
cord-252671-uf96jgig	242	7	the	the	DT
cord-252671-uf96jgig	242	8	current	current	JJ
cord-252671-uf96jgig	242	9	study	study	NN
cord-252671-uf96jgig	242	10	.	.	.
cord-252671-uf96jgig	243	1	Our	-PRON-	PRP$
cord-252671-uf96jgig	243	2	functional	functional	JJ
cord-252671-uf96jgig	243	3	analysis	analysis	NN
cord-252671-uf96jgig	243	4	provides	provide	VBZ
cord-252671-uf96jgig	243	5	strong	strong	JJ
cord-252671-uf96jgig	243	6	evidence	evidence	NN
cord-252671-uf96jgig	243	7	to	to	TO
cord-252671-uf96jgig	243	8	demonstrate	demonstrate	VB
cord-252671-uf96jgig	243	9	that	that	IN
cord-252671-uf96jgig	243	10	the	the	DT
cord-252671-uf96jgig	243	11	valine	valine	NN
cord-252671-uf96jgig	243	12	-	-	HYPH
cord-252671-uf96jgig	243	13	toalanine	toalanine	NN
cord-252671-uf96jgig	243	14	change	change	NN
cord-252671-uf96jgig	243	15	at	at	IN
cord-252671-uf96jgig	243	16	residue	residue	NN
cord-252671-uf96jgig	243	17	68	68	CD
cord-252671-uf96jgig	243	18	of	of	IN
cord-252671-uf96jgig	243	19	M	M	NNP
cord-252671-uf96jgig	243	20	protein	protein	NN
cord-252671-uf96jgig	243	21	is	be	VBZ
cord-252671-uf96jgig	243	22	sufficient	sufficient	JJ
cord-252671-uf96jgig	243	23	to	to	TO
cord-252671-uf96jgig	243	24	abolish	abolish	VB
cord-252671-uf96jgig	243	25	M	M	NNP
cord-252671-uf96jgig	243	26	-	-	HYPH
cord-252671-uf96jgig	243	27	mediated	mediate	VBN
cord-252671-uf96jgig	243	28	IFN-	IFN-	NNP
cord-252671-uf96jgig	243	29	␤	␤	CD
cord-252671-uf96jgig	243	30	induction	induction	NN
cord-252671-uf96jgig	243	31	at	at	IN
cord-252671-uf96jgig	243	32	both	both	CC
cord-252671-uf96jgig	243	33	the	the	DT
cord-252671-uf96jgig	243	34	transient	transient	JJ
cord-252671-uf96jgig	243	35	-	-	HYPH
cord-252671-uf96jgig	243	36	transfection	transfection	NN
cord-252671-uf96jgig	243	37	level	level	NN
cord-252671-uf96jgig	243	38	and	and	CC
cord-252671-uf96jgig	243	39	the	the	DT
cord-252671-uf96jgig	243	40	viral	viral	JJ
cord-252671-uf96jgig	243	41	infection	infection	NN
cord-252671-uf96jgig	243	42	level	level	NN
cord-252671-uf96jgig	243	43	(	(	-LRB-
cord-252671-uf96jgig	243	44	Fig	Fig	NNP
cord-252671-uf96jgig	243	45	.	.	.
cord-252671-uf96jgig	243	46	1D	1D	NNP
cord-252671-uf96jgig	243	47	and	and	CC
cord-252671-uf96jgig	243	48	E	E	NNP
cord-252671-uf96jgig	243	49	and	and	CC
cord-252671-uf96jgig	243	50	8B	8b	NN
cord-252671-uf96jgig	243	51	and	and	CC
cord-252671-uf96jgig	243	52	C	C	NNP
cord-252671-uf96jgig	243	53	)	)	-RRB-
cord-252671-uf96jgig	243	54	.	.	.
cord-252671-uf96jgig	244	1	Therefore	therefore	RB
cord-252671-uf96jgig	244	2	,	,	,
cord-252671-uf96jgig	244	3	this	this	DT
cord-252671-uf96jgig	244	4	amino	amino	NN
cord-252671-uf96jgig	244	5	acid	acid	NN
cord-252671-uf96jgig	244	6	substitution	substitution	NN
cord-252671-uf96jgig	244	7	in	in	IN
cord-252671-uf96jgig	244	8	M	M	NNP
cord-252671-uf96jgig	244	9	proteins	protein	NNS
cord-252671-uf96jgig	244	10	indeed	indeed	RB
cord-252671-uf96jgig	244	11	affects	affect	VBZ
cord-252671-uf96jgig	244	12	the	the	DT
cord-252671-uf96jgig	244	13	interaction	interaction	NN
cord-252671-uf96jgig	244	14	between	between	IN
cord-252671-uf96jgig	244	15	M	M	NNP
cord-252671-uf96jgig	244	16	protein	protein	NN
cord-252671-uf96jgig	244	17	and	and	CC
cord-252671-uf96jgig	244	18	the	the	DT
cord-252671-uf96jgig	244	19	PRR	PRR	NNP
cord-252671-uf96jgig	244	20	for	for	IN
cord-252671-uf96jgig	244	21	the	the	DT
cord-252671-uf96jgig	244	22	subsequent	subsequent	JJ
cord-252671-uf96jgig	245	1	IFN	IFN	NNP
cord-252671-uf96jgig	245	2	-	-	HYPH
cord-252671-uf96jgig	245	3	I	-PRON-	PRP
cord-252671-uf96jgig	245	4	induction	induction	NN
cord-252671-uf96jgig	245	5	.	.	.
cord-252671-uf96jgig	246	1	It	-PRON-	PRP
cord-252671-uf96jgig	246	2	still	still	RB
cord-252671-uf96jgig	246	3	remains	remain	VBZ
cord-252671-uf96jgig	246	4	elusive	elusive	JJ
cord-252671-uf96jgig	246	5	which	which	WDT
cord-252671-uf96jgig	246	6	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	246	7	PRR	PRR	NNP
cord-252671-uf96jgig	246	8	is	be	VBZ
cord-252671-uf96jgig	246	9	responsible	responsible	JJ
cord-252671-uf96jgig	246	10	for	for	IN
cord-252671-uf96jgig	246	11	M	M	NNP
cord-252671-uf96jgig	246	12	-	-	HYPH
cord-252671-uf96jgig	246	13	mediated	mediate	VBN
cord-252671-uf96jgig	246	14	IFN-	IFN-	NNP
cord-252671-uf96jgig	246	15	␤	␤	CD
cord-252671-uf96jgig	246	16	induction	induction	NN
cord-252671-uf96jgig	246	17	.	.	.
cord-252671-uf96jgig	247	1	The	the	DT
cord-252671-uf96jgig	247	2	M	M	NNP
cord-252671-uf96jgig	247	3	protein	protein	NN
cord-252671-uf96jgig	247	4	might	may	MD
cord-252671-uf96jgig	247	5	be	be	VB
cord-252671-uf96jgig	247	6	a	a	DT
cord-252671-uf96jgig	247	7	multifaceted	multifaceted	JJ
cord-252671-uf96jgig	247	8	molecule	molecule	NN
cord-252671-uf96jgig	247	9	that	that	WDT
cord-252671-uf96jgig	247	10	physically	physically	RB
cord-252671-uf96jgig	247	11	interacts	interact	VBZ
cord-252671-uf96jgig	247	12	with	with	IN
cord-252671-uf96jgig	247	13	diverse	diverse	JJ
cord-252671-uf96jgig	247	14	intracellular	intracellular	JJ
cord-252671-uf96jgig	247	15	sensors	sensor	NNS
cord-252671-uf96jgig	247	16	and	and	CC
cord-252671-uf96jgig	247	17	signaling	signal	VBG
cord-252671-uf96jgig	247	18	factors	factor	NNS
cord-252671-uf96jgig	247	19	(	(	-LRB-
cord-252671-uf96jgig	247	20	34	34	CD
cord-252671-uf96jgig	247	21	,	,	,
cord-252671-uf96jgig	247	22	42	42	CD
cord-252671-uf96jgig	247	23	)	)	-RRB-
cord-252671-uf96jgig	247	24	.	.	.
cord-252671-uf96jgig	248	1	Our	-PRON-	PRP$
cord-252671-uf96jgig	248	2	data	datum	NNS
cord-252671-uf96jgig	248	3	indicate	indicate	VBP
cord-252671-uf96jgig	248	4	that	that	IN
cord-252671-uf96jgig	248	5	the	the	DT
cord-252671-uf96jgig	248	6	TLR	TLR	NNP
cord-252671-uf96jgig	248	7	-	-	HYPH
cord-252671-uf96jgig	248	8	related	relate	VBN
cord-252671-uf96jgig	248	9	signaling	signal	VBG
cord-252671-uf96jgig	248	10	pathway	pathway	NN
cord-252671-uf96jgig	248	11	rather	rather	RB
cord-252671-uf96jgig	248	12	than	than	IN
cord-252671-uf96jgig	248	13	the	the	DT
cord-252671-uf96jgig	248	14	RIG	rig	NN
cord-252671-uf96jgig	248	15	-	-	:
cord-252671-uf96jgig	248	16	I	i	NN
cord-252671-uf96jgig	248	17	signaling	signal	VBG
cord-252671-uf96jgig	248	18	cascade	cascade	NN
cord-252671-uf96jgig	248	19	is	be	VBZ
cord-252671-uf96jgig	248	20	responsible	responsible	JJ
cord-252671-uf96jgig	248	21	for	for	IN
cord-252671-uf96jgig	248	22	M	M	NNP
cord-252671-uf96jgig	248	23	-	-	HYPH
cord-252671-uf96jgig	248	24	mediated	mediate	VBN
cord-252671-uf96jgig	248	25	IFN-	IFN-	NNP
cord-252671-uf96jgig	248	26	␤	␤	CD
cord-252671-uf96jgig	248	27	induction	induction	NN
cord-252671-uf96jgig	248	28	.	.	.
cord-252671-uf96jgig	249	1	Interestingly	interestingly	RB
cord-252671-uf96jgig	249	2	,	,	,
cord-252671-uf96jgig	249	3	we	-PRON-	PRP
cord-252671-uf96jgig	249	4	observed	observe	VBD
cord-252671-uf96jgig	249	5	consistent	consistent	JJ
cord-252671-uf96jgig	249	6	TRAF3	traf3	NN
cord-252671-uf96jgig	249	7	reductions	reduction	NNS
cord-252671-uf96jgig	249	8	in	in	IN
cord-252671-uf96jgig	249	9	both	both	DT
cord-252671-uf96jgig	249	10	HEK293	HEK293	NNP
cord-252671-uf96jgig	249	11	T	T	NNP
cord-252671-uf96jgig	249	12	and	and	CC
cord-252671-uf96jgig	249	13	J2-M	J2-M	NNP
cord-252671-uf96jgig	249	14	cells	cell	NNS
cord-252671-uf96jgig	249	15	as	as	IN
cord-252671-uf96jgig	249	16	tested	test	VBN
cord-252671-uf96jgig	249	17	by	by	IN
cord-252671-uf96jgig	249	18	the	the	DT
cord-252671-uf96jgig	249	19	transiently	transiently	RB
cord-252671-uf96jgig	249	20	intracellular	intracellular	JJ
cord-252671-uf96jgig	249	21	overexpression	overexpression	NN
cord-252671-uf96jgig	249	22	of	of	IN
cord-252671-uf96jgig	249	23	the	the	DT
cord-252671-uf96jgig	249	24	M	M	NNP
cord-252671-uf96jgig	249	25	gene	gene	NN
cord-252671-uf96jgig	249	26	.	.	.
cord-252671-uf96jgig	250	1	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	250	2	is	be	VBZ
cord-252671-uf96jgig	250	3	one	one	CD
cord-252671-uf96jgig	250	4	of	of	IN
cord-252671-uf96jgig	250	5	the	the	DT
cord-252671-uf96jgig	250	6	key	key	JJ
cord-252671-uf96jgig	250	7	signaling	signal	VBG
cord-252671-uf96jgig	250	8	molecules	molecule	NNS
cord-252671-uf96jgig	250	9	specifically	specifically	RB
cord-252671-uf96jgig	250	10	responsible	responsible	JJ
cord-252671-uf96jgig	250	11	for	for	IN
cord-252671-uf96jgig	250	12	IFN	IFN	NNP
cord-252671-uf96jgig	250	13	-	-	HYPH
cord-252671-uf96jgig	250	14	I	I	NNP
cord-252671-uf96jgig	250	15	induction	induction	NN
cord-252671-uf96jgig	250	16	(	(	-LRB-
cord-252671-uf96jgig	250	17	28	28	CD
cord-252671-uf96jgig	250	18	)	)	-RRB-
cord-252671-uf96jgig	250	19	.	.	.
cord-252671-uf96jgig	251	1	Data	datum	NNS
cord-252671-uf96jgig	251	2	from	from	IN
cord-252671-uf96jgig	251	3	the	the	DT
cord-252671-uf96jgig	251	4	work	work	NN
cord-252671-uf96jgig	251	5	of	of	IN
cord-252671-uf96jgig	251	6	Siu	Siu	NNP
cord-252671-uf96jgig	251	7	and	and	CC
cord-252671-uf96jgig	251	8	colleagues	colleague	NNS
cord-252671-uf96jgig	251	9	have	have	VBP
cord-252671-uf96jgig	251	10	shown	show	VBN
cord-252671-uf96jgig	251	11	that	that	IN
cord-252671-uf96jgig	251	12	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	251	13	)	)	-RRB-
cord-252671-uf96jgig	251	14	excludes	exclude	VBZ
cord-252671-uf96jgig	251	15	the	the	DT
cord-252671-uf96jgig	251	16	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	251	17	inclusion	inclusion	NN
cord-252671-uf96jgig	251	18	in	in	IN
cord-252671-uf96jgig	251	19	the	the	DT
cord-252671-uf96jgig	251	20	TRAF3.TANK.TBK1	TRAF3.TANK.TBK1	NNP
cord-252671-uf96jgig	251	21	/	/	SYM
cord-252671-uf96jgig	251	22	IKK	IKK	NNP
cord-252671-uf96jgig	251	23	complex	complex	NN
cord-252671-uf96jgig	251	24	(	(	-LRB-
cord-252671-uf96jgig	251	25	39	39	CD
cord-252671-uf96jgig	251	26	)	)	-RRB-
cord-252671-uf96jgig	251	27	.	.	.
cord-252671-uf96jgig	252	1	Although	although	IN
cord-252671-uf96jgig	252	2	M(V68A)-mediated	M(V68A)-mediated	NNP
cord-252671-uf96jgig	252	3	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	252	4	exclusion	exclusion	NN
cord-252671-uf96jgig	252	5	inhibits	inhibit	VBZ
cord-252671-uf96jgig	252	6	IFN-	IFN-	NNP
cord-252671-uf96jgig	252	7	␤	␤	CD
cord-252671-uf96jgig	252	8	induction	induction	NN
cord-252671-uf96jgig	252	9	,	,	,
cord-252671-uf96jgig	252	10	our	-PRON-	PRP$
cord-252671-uf96jgig	252	11	study	study	NN
cord-252671-uf96jgig	252	12	showed	show	VBD
cord-252671-uf96jgig	252	13	that	that	IN
cord-252671-uf96jgig	252	14	M	M	NNP
cord-252671-uf96jgig	252	15	-	-	HYPH
cord-252671-uf96jgig	252	16	mediated	mediate	VBN
cord-252671-uf96jgig	252	17	TRAF3	traf3	NN
cord-252671-uf96jgig	252	18	exclusion	exclusion	NN
cord-252671-uf96jgig	252	19	is	be	VBZ
cord-252671-uf96jgig	252	20	independent	independent	JJ
cord-252671-uf96jgig	252	21	of	of	IN
cord-252671-uf96jgig	252	22	ligand	ligand	NN
cord-252671-uf96jgig	252	23	stimulation	stimulation	NN
cord-252671-uf96jgig	252	24	and	and	CC
cord-252671-uf96jgig	252	25	the	the	DT
cord-252671-uf96jgig	252	26	disassociated	disassociate	VBN
cord-252671-uf96jgig	252	27	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	252	28	and	and	CC
cord-252671-uf96jgig	252	29	TBK1	TBK1	NNP
cord-252671-uf96jgig	252	30	could	could	MD
cord-252671-uf96jgig	252	31	not	not	RB
cord-252671-uf96jgig	252	32	complex	complex	VB
cord-252671-uf96jgig	252	33	with	with	IN
cord-252671-uf96jgig	252	34	M	M	NNP
cord-252671-uf96jgig	252	35	protein	protein	NN
cord-252671-uf96jgig	252	36	,	,	,
cord-252671-uf96jgig	252	37	indicating	indicate	VBG
cord-252671-uf96jgig	252	38	that	that	IN
cord-252671-uf96jgig	252	39	M	M	NNP
cord-252671-uf96jgig	252	40	protein	protein	NN
cord-252671-uf96jgig	252	41	might	may	MD
cord-252671-uf96jgig	252	42	modulate	modulate	VB
cord-252671-uf96jgig	252	43	the	the	DT
cord-252671-uf96jgig	252	44	functions	function	NNS
cord-252671-uf96jgig	252	45	of	of	IN
cord-252671-uf96jgig	252	46	TBK1	TBK1	NNP
cord-252671-uf96jgig	252	47	complex	complex	NN
cord-252671-uf96jgig	252	48	indirectly	indirectly	RB
cord-252671-uf96jgig	252	49	.	.	.
cord-252671-uf96jgig	253	1	Interestingly	interestingly	RB
cord-252671-uf96jgig	253	2	,	,	,
cord-252671-uf96jgig	253	3	we	-PRON-	PRP
cord-252671-uf96jgig	253	4	demonstrated	demonstrate	VBD
cord-252671-uf96jgig	253	5	that	that	IN
cord-252671-uf96jgig	253	6	M	M	NNP
cord-252671-uf96jgig	253	7	-	-	HYPH
cord-252671-uf96jgig	253	8	mediated	mediate	VBN
cord-252671-uf96jgig	253	9	IFN-	IFN-	NNP
cord-252671-uf96jgig	253	10	␤	␤	CD
cord-252671-uf96jgig	253	11	induction	induction	NN
cord-252671-uf96jgig	253	12	was	be	VBD
cord-252671-uf96jgig	253	13	associated	associate	VBN
cord-252671-uf96jgig	253	14	with	with	IN
cord-252671-uf96jgig	253	15	the	the	DT
cord-252671-uf96jgig	253	16	upregulation	upregulation	NN
cord-252671-uf96jgig	253	17	of	of	IN
cord-252671-uf96jgig	253	18	the	the	DT
cord-252671-uf96jgig	253	19	adaptor	adaptor	NN
cord-252671-uf96jgig	253	20	proteins	protein	NNS
cord-252671-uf96jgig	253	21	MyD88	MyD88	NNS
cord-252671-uf96jgig	253	22	,	,	,
cord-252671-uf96jgig	253	23	TIRAP	TIRAP	NNP
cord-252671-uf96jgig	253	24	,	,	,
cord-252671-uf96jgig	253	25	and	and	CC
cord-252671-uf96jgig	253	26	TICAM2	ticam2	NN
cord-252671-uf96jgig	254	1	but	but	CC
cord-252671-uf96jgig	254	2	not	not	RB
cord-252671-uf96jgig	254	3	TRIF	TRIF	NNP
cord-252671-uf96jgig	254	4	,	,	,
cord-252671-uf96jgig	254	5	which	which	WDT
cord-252671-uf96jgig	254	6	are	be	VBP
cord-252671-uf96jgig	254	7	all	all	DT
cord-252671-uf96jgig	254	8	involved	involve	VBN
cord-252671-uf96jgig	254	9	in	in	IN
cord-252671-uf96jgig	254	10	the	the	DT
cord-252671-uf96jgig	254	11	initiating	initiating	NN
cord-252671-uf96jgig	254	12	phase	phase	NN
cord-252671-uf96jgig	254	13	of	of	IN
cord-252671-uf96jgig	254	14	TLR	TLR	NNP
cord-252671-uf96jgig	254	15	signaling	signal	VBG
cord-252671-uf96jgig	254	16	pathways	pathway	NNS
cord-252671-uf96jgig	254	17	.	.	.
cord-252671-uf96jgig	255	1	TRIF	TRIF	NNP
cord-252671-uf96jgig	255	2	is	be	VBZ
cord-252671-uf96jgig	255	3	required	require	VBN
cord-252671-uf96jgig	255	4	for	for	IN
cord-252671-uf96jgig	255	5	both	both	DT
cord-252671-uf96jgig	255	6	TLR3-and	TLR3-and	NNP
cord-252671-uf96jgig	255	7	TLR4mediated	TLR4mediated	NNP
cord-252671-uf96jgig	255	8	IFN-	IFN-	NNP
cord-252671-uf96jgig	255	9	␤	␤	CD
cord-252671-uf96jgig	255	10	induction	induction	NN
cord-252671-uf96jgig	255	11	.	.	.
cord-252671-uf96jgig	256	1	In	in	IN
cord-252671-uf96jgig	256	2	the	the	DT
cord-252671-uf96jgig	256	3	activation	activation	NN
cord-252671-uf96jgig	256	4	of	of	IN
cord-252671-uf96jgig	256	5	TLR3	TLR3	NNP
cord-252671-uf96jgig	256	6	,	,	,
cord-252671-uf96jgig	256	7	TRIF	TRIF	NNP
cord-252671-uf96jgig	256	8	is	be	VBZ
cord-252671-uf96jgig	256	9	directly	directly	RB
cord-252671-uf96jgig	256	10	recruited	recruit	VBN
cord-252671-uf96jgig	256	11	to	to	IN
cord-252671-uf96jgig	256	12	the	the	DT
cord-252671-uf96jgig	256	13	TIR	TIR	NNP
cord-252671-uf96jgig	256	14	domain	domain	NN
cord-252671-uf96jgig	256	15	of	of	IN
cord-252671-uf96jgig	256	16	dimerized	dimerize	VBN
cord-252671-uf96jgig	256	17	TLR3	TLR3	NNP
cord-252671-uf96jgig	256	18	,	,	,
cord-252671-uf96jgig	256	19	while	while	IN
cord-252671-uf96jgig	256	20	in	in	IN
cord-252671-uf96jgig	256	21	the	the	DT
cord-252671-uf96jgig	256	22	activation	activation	NN
cord-252671-uf96jgig	256	23	of	of	IN
cord-252671-uf96jgig	256	24	TLR4	TLR4	NNP
cord-252671-uf96jgig	256	25	,	,	,
cord-252671-uf96jgig	256	26	TRIF	TRIF	NNP
cord-252671-uf96jgig	256	27	is	be	VBZ
cord-252671-uf96jgig	256	28	recruited	recruit	VBN
cord-252671-uf96jgig	256	29	to	to	IN
cord-252671-uf96jgig	256	30	dimerized	dimerize	VBN
cord-252671-uf96jgig	256	31	TLR4	TLR4	NNP
cord-252671-uf96jgig	256	32	indirectly	indirectly	RB
cord-252671-uf96jgig	256	33	through	through	IN
cord-252671-uf96jgig	256	34	another	another	DT
cord-252671-uf96jgig	256	35	TIR	TIR	NNP
cord-252671-uf96jgig	256	36	-	-	HYPH
cord-252671-uf96jgig	256	37	containing	contain	VBG
cord-252671-uf96jgig	256	38	adaptor	adaptor	NN
cord-252671-uf96jgig	256	39	protein	protein	NN
cord-252671-uf96jgig	256	40	,	,	,
cord-252671-uf96jgig	256	41	TICAM2	ticam2	FW
cord-252671-uf96jgig	256	42	(	(	-LRB-
cord-252671-uf96jgig	256	43	also	also	RB
cord-252671-uf96jgig	256	44	called	call	VBN
cord-252671-uf96jgig	256	45	TRAM	TRAM	NNP
cord-252671-uf96jgig	256	46	)	)	-RRB-
cord-252671-uf96jgig	256	47	.	.	.
cord-252671-uf96jgig	257	1	If	if	IN
cord-252671-uf96jgig	257	2	TRIF	TRIF	NNP
cord-252671-uf96jgig	257	3	is	be	VBZ
cord-252671-uf96jgig	257	4	not	not	RB
cord-252671-uf96jgig	257	5	required	require	VBN
cord-252671-uf96jgig	257	6	for	for	IN
cord-252671-uf96jgig	257	7	M	M	NNP
cord-252671-uf96jgig	257	8	-	-	HYPH
cord-252671-uf96jgig	257	9	mediated	mediate	VBN
cord-252671-uf96jgig	257	10	IFN-	IFN-	NNP
cord-252671-uf96jgig	257	11	␤	␤	CD
cord-252671-uf96jgig	257	12	induction	induction	NN
cord-252671-uf96jgig	257	13	,	,	,
cord-252671-uf96jgig	257	14	M	M	NNP
cord-252671-uf96jgig	257	15	-	-	HYPH
cord-252671-uf96jgig	257	16	mediated	mediate	VBN
cord-252671-uf96jgig	257	17	IFN-	IFN-	NNP
cord-252671-uf96jgig	257	18	␤	␤	CD
cord-252671-uf96jgig	257	19	induction	induction	NN
cord-252671-uf96jgig	257	20	might	may	MD
cord-252671-uf96jgig	257	21	be	be	VB
cord-252671-uf96jgig	257	22	activated	activate	VBN
cord-252671-uf96jgig	257	23	via	via	IN
cord-252671-uf96jgig	257	24	a	a	DT
cord-252671-uf96jgig	257	25	noncanonical	noncanonical	JJ
cord-252671-uf96jgig	257	26	TLR4-related	TLR4-related	NNP
cord-252671-uf96jgig	257	27	signaling	signal	VBG
cord-252671-uf96jgig	257	28	cascade	cascade	NN
cord-252671-uf96jgig	257	29	independently	independently	RB
cord-252671-uf96jgig	257	30	of	of	IN
cord-252671-uf96jgig	257	31	TRIF	TRIF	NNP
cord-252671-uf96jgig	257	32	and	and	CC
cord-252671-uf96jgig	257	33	TRAF3	TRAF3	NNP
cord-252671-uf96jgig	257	34	.	.	.
cord-252671-uf96jgig	258	1	In	in	IN
cord-252671-uf96jgig	258	2	summary	summary	NN
cord-252671-uf96jgig	258	3	,	,	,
cord-252671-uf96jgig	258	4	the	the	DT
cord-252671-uf96jgig	258	5	current	current	JJ
cord-252671-uf96jgig	258	6	study	study	NN
cord-252671-uf96jgig	258	7	demonstrates	demonstrate	VBZ
cord-252671-uf96jgig	258	8	for	for	IN
cord-252671-uf96jgig	258	9	the	the	DT
cord-252671-uf96jgig	258	10	first	first	JJ
cord-252671-uf96jgig	258	11	time	time	NN
cord-252671-uf96jgig	258	12	that	that	WDT
cord-252671-uf96jgig	258	13	the	the	DT
cord-252671-uf96jgig	258	14	M	M	NNP
cord-252671-uf96jgig	258	15	protein	protein	NN
cord-252671-uf96jgig	258	16	of	of	IN
cord-252671-uf96jgig	258	17	SARS	SARS	NNP
cord-252671-uf96jgig	258	18	-	-	HYPH
cord-252671-uf96jgig	258	19	CoV	CoV	NNP
cord-252671-uf96jgig	258	20	is	be	VBZ
cord-252671-uf96jgig	258	21	able	able	JJ
cord-252671-uf96jgig	258	22	to	to	TO
cord-252671-uf96jgig	258	23	function	function	VB
cord-252671-uf96jgig	258	24	as	as	IN
cord-252671-uf96jgig	258	25	a	a	DT
cord-252671-uf96jgig	258	26	cytosolic	cytosolic	JJ
cord-252671-uf96jgig	258	27	PAMP	pamp	NN
cord-252671-uf96jgig	258	28	to	to	TO
cord-252671-uf96jgig	258	29	promote	promote	VB
cord-252671-uf96jgig	258	30	IFN-	IFN-	NNP
cord-252671-uf96jgig	258	31	␤	␤	CD
cord-252671-uf96jgig	258	32	production	production	NN
cord-252671-uf96jgig	258	33	by	by	IN
cord-252671-uf96jgig	258	34	activating	activate	VBG
cord-252671-uf96jgig	258	35	a	a	DT
cord-252671-uf96jgig	258	36	TLR	TLR	NNP
cord-252671-uf96jgig	258	37	-	-	HYPH
cord-252671-uf96jgig	258	38	related	relate	VBN
cord-252671-uf96jgig	258	39	TRAF3-independent	TRAF3-independent	NNP
cord-252671-uf96jgig	258	40	pathway	pathway	NN
cord-252671-uf96jgig	258	41	.	.	.
cord-252671-uf96jgig	259	1	The	the	DT
cord-252671-uf96jgig	259	2	driving	drive	VBG
cord-252671-uf96jgig	259	3	force	force	NN
cord-252671-uf96jgig	259	4	for	for	IN
cord-252671-uf96jgig	259	5	M	M	NNP
cord-252671-uf96jgig	259	6	-	-	HYPH
cord-252671-uf96jgig	259	7	mediated	mediate	VBN
cord-252671-uf96jgig	259	8	IFN-	IFN-	NNP
cord-252671-uf96jgig	259	9	␤	␤	CD
cord-252671-uf96jgig	259	10	induction	induction	NN
cord-252671-uf96jgig	259	11	is	be	VBZ
cord-252671-uf96jgig	259	12	likely	likely	RB
cord-252671-uf96jgig	259	13	generated	generate	VBN
cord-252671-uf96jgig	259	14	from	from	IN
cord-252671-uf96jgig	259	15	inside	inside	IN
cord-252671-uf96jgig	259	16	the	the	DT
cord-252671-uf96jgig	259	17	cells	cell	NNS
cord-252671-uf96jgig	259	18	rather	rather	RB
cord-252671-uf96jgig	259	19	than	than	IN
cord-252671-uf96jgig	259	20	the	the	DT
cord-252671-uf96jgig	259	21	extracellular	extracellular	JJ
cord-252671-uf96jgig	259	22	binding	binding	NN
cord-252671-uf96jgig	259	23	of	of	IN
cord-252671-uf96jgig	259	24	M	M	NNP
cord-252671-uf96jgig	259	25	proteins	protein	NNS
cord-252671-uf96jgig	259	26	with	with	IN
cord-252671-uf96jgig	259	27	the	the	DT
cord-252671-uf96jgig	259	28	defined	define	VBN
cord-252671-uf96jgig	259	29	cell	cell	NN
cord-252671-uf96jgig	259	30	surface	surface	NN
cord-252671-uf96jgig	259	31	PRRs	prr	NNS
cord-252671-uf96jgig	259	32	,	,	,
cord-252671-uf96jgig	259	33	such	such	JJ
cord-252671-uf96jgig	259	34	as	as	IN
cord-252671-uf96jgig	259	35	TLR4	TLR4	NNP
cord-252671-uf96jgig	259	36	.	.	.
cord-252671-uf96jgig	260	1	Plasmid	plasmid	NN
cord-252671-uf96jgig	260	2	construction	construction	NN
cord-252671-uf96jgig	260	3	.	.	.
cord-252671-uf96jgig	261	1	Plasmids	plasmid	NNS
cord-252671-uf96jgig	261	2	pCMV	pcmv	NN
cord-252671-uf96jgig	261	3	-	-	HYPH
cord-252671-uf96jgig	261	4	Myc	Myc	NNP
cord-252671-uf96jgig	261	5	-	-	HYPH
cord-252671-uf96jgig	261	6	M	M	NNP
cord-252671-uf96jgig	261	7	and	and	CC
cord-252671-uf96jgig	261	8	pBS	pBS	NNP
cord-252671-uf96jgig	261	9	-	-	:
cord-252671-uf96jgig	261	10	U6-siM1	u6-sim1	CD
cord-252671-uf96jgig	261	11	were	be	VBD
cord-252671-uf96jgig	261	12	constructed	construct	VBN
cord-252671-uf96jgig	261	13	previously	previously	RB
cord-252671-uf96jgig	261	14	(	(	-LRB-
cord-252671-uf96jgig	261	15	26	26	CD
cord-252671-uf96jgig	261	16	)	)	-RRB-
cord-252671-uf96jgig	261	17	.	.	.
cord-252671-uf96jgig	262	1	Plasmids	plasmid	NNS
cord-252671-uf96jgig	262	2	pCMV	pcmv	NN
cord-252671-uf96jgig	262	3	-	-	HYPH
cord-252671-uf96jgig	262	4	Myc	Myc	NNP
cord-252671-uf96jgig	262	5	-	-	HYPH
cord-252671-uf96jgig	262	6	S	s	NN
cord-252671-uf96jgig	262	7	and	and	CC
cord-252671-uf96jgig	262	8	pCMV	pcmv	NN
cord-252671-uf96jgig	262	9	-	-	HYPH
cord-252671-uf96jgig	262	10	Myc	myc	NN
cord-252671-uf96jgig	262	11	-	-	HYPH
cord-252671-uf96jgig	262	12	E	E	NNP
cord-252671-uf96jgig	262	13	were	be	VBD
cord-252671-uf96jgig	262	14	constructed	construct	VBN
cord-252671-uf96jgig	262	15	by	by	IN
cord-252671-uf96jgig	262	16	inserting	insert	VBG
cord-252671-uf96jgig	262	17	S	s	NN
cord-252671-uf96jgig	262	18	and	and	CC
cord-252671-uf96jgig	262	19	E	E	NNP
cord-252671-uf96jgig	262	20	into	into	IN
cord-252671-uf96jgig	262	21	the	the	DT
cord-252671-uf96jgig	262	22	EcoRI	ecori	NN
cord-252671-uf96jgig	262	23	and	and	CC
cord-252671-uf96jgig	262	24	KpnI	KpnI	NNP
cord-252671-uf96jgig	262	25	sites	site	NNS
cord-252671-uf96jgig	262	26	of	of	IN
cord-252671-uf96jgig	262	27	pCMV	pcmv	NN
cord-252671-uf96jgig	262	28	-	-	HYPH
cord-252671-uf96jgig	262	29	Myc	Myc	NNP
cord-252671-uf96jgig	262	30	.	.	.
cord-252671-uf96jgig	263	1	The	the	DT
cord-252671-uf96jgig	263	2	mutant	mutant	NN
cord-252671-uf96jgig	263	3	of	of	IN
cord-252671-uf96jgig	263	4	pCMV	pcmv	NN
cord-252671-uf96jgig	263	5	-	-	HYPH
cord-252671-uf96jgig	263	6	Myc	Myc	NNP
cord-252671-uf96jgig	263	7	-	-	HYPH
cord-252671-uf96jgig	263	8	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	263	9	)	)	-RRB-
cord-252671-uf96jgig	263	10	was	be	VBD
cord-252671-uf96jgig	263	11	generated	generate	VBN
cord-252671-uf96jgig	263	12	by	by	IN
cord-252671-uf96jgig	263	13	using	use	VBG
cord-252671-uf96jgig	263	14	the	the	DT
cord-252671-uf96jgig	263	15	site	site	NN
cord-252671-uf96jgig	263	16	-	-	HYPH
cord-252671-uf96jgig	263	17	directed	direct	VBN
cord-252671-uf96jgig	263	18	mutagenesis	mutagenesis	NN
cord-252671-uf96jgig	263	19	kit	kit	NN
cord-252671-uf96jgig	263	20	(	(	-LRB-
cord-252671-uf96jgig	263	21	TaKaRa	takara	XX
cord-252671-uf96jgig	263	22	,	,	,
cord-252671-uf96jgig	263	23	Dalian	Dalian	NNP
cord-252671-uf96jgig	263	24	,	,	,
cord-252671-uf96jgig	263	25	China	China	NNP
cord-252671-uf96jgig	263	26	)	)	-RRB-
cord-252671-uf96jgig	263	27	.	.	.
cord-252671-uf96jgig	264	1	One	one	CD
cord-252671-uf96jgig	264	2	copy	copy	NN
cord-252671-uf96jgig	264	3	of	of	IN
cord-252671-uf96jgig	264	4	the	the	DT
cord-252671-uf96jgig	264	5	IFN-	IFN-	NNP
cord-252671-uf96jgig	264	6	␤	␤	NNP
cord-252671-uf96jgig	264	7	promoter	promoter	NN
cord-252671-uf96jgig	264	8	sequence	sequence	NN
cord-252671-uf96jgig	264	9	(	(	-LRB-
cord-252671-uf96jgig	264	10	5=-CTAAAATGTAAATGACATA	5=-ctaaaatgtaaatgacata	CD
cord-252671-uf96jgig	264	11	GGAAAACTGAAAGGGAGAAGTGAAAGTGGGAAATTCCTCTGAAT	GGAAAACTGAAAGGGAGAAGTGAAAGTGGGAAATTCCTCTGAAT	NNP
cord-252671-uf96jgig	264	12	AGAGAGAGGACCATCTCATATAAATAGGCCATACCCATGGAGAA	AGAGAGAGGACCATCTCATATAAATAGGCCATACCCATGGAGAA	NNP
cord-252671-uf96jgig	265	1	AGGACATTCTAACTGCAACCTTTCGA-3=	aggacattctaactgcaacctttcga-3=	LS
cord-252671-uf96jgig	265	2	)	)	-RRB-
cord-252671-uf96jgig	266	1	was	be	VBD
cord-252671-uf96jgig	266	2	PCR	PCR	NNP
cord-252671-uf96jgig	266	3	amplified	amplify	VBN
cord-252671-uf96jgig	266	4	and	and	CC
cord-252671-uf96jgig	266	5	subcloned	subclone	VBN
cord-252671-uf96jgig	266	6	into	into	IN
cord-252671-uf96jgig	266	7	the	the	DT
cord-252671-uf96jgig	266	8	KpnI	KpnI	NNP
cord-252671-uf96jgig	266	9	and	and	CC
cord-252671-uf96jgig	266	10	XhoI	XhoI	NNP
cord-252671-uf96jgig	266	11	sites	site	NNS
cord-252671-uf96jgig	266	12	of	of	IN
cord-252671-uf96jgig	266	13	the	the	DT
cord-252671-uf96jgig	266	14	luciferase	luciferase	NN
cord-252671-uf96jgig	266	15	reporter	reporter	NN
cord-252671-uf96jgig	266	16	pGL3basic	pgl3basic	NN
cord-252671-uf96jgig	266	17	(	(	-LRB-
cord-252671-uf96jgig	266	18	Promega	Promega	NNP
cord-252671-uf96jgig	266	19	,	,	,
cord-252671-uf96jgig	266	20	Madison	Madison	NNP
cord-252671-uf96jgig	266	21	,	,	,
cord-252671-uf96jgig	266	22	WI	WI	NNP
cord-252671-uf96jgig	266	23	,	,	,
cord-252671-uf96jgig	266	24	USA	USA	NNP
cord-252671-uf96jgig	266	25	)	)	-RRB-
cord-252671-uf96jgig	266	26	to	to	TO
cord-252671-uf96jgig	266	27	generate	generate	VB
cord-252671-uf96jgig	266	28	the	the	DT
cord-252671-uf96jgig	266	29	pGL3-IFN-	pgl3-ifn-	NN
cord-252671-uf96jgig	266	30	␤	␤	CD
cord-252671-uf96jgig	266	31	-luc	-luc	PRP
cord-252671-uf96jgig	266	32	construct	construct	VB
cord-252671-uf96jgig	266	33	.	.	.
cord-252671-uf96jgig	267	1	All	all	DT
cord-252671-uf96jgig	267	2	primers	primer	NNS
cord-252671-uf96jgig	267	3	were	be	VBD
cord-252671-uf96jgig	267	4	synthesized	synthesize	VBN
cord-252671-uf96jgig	267	5	by	by	IN
cord-252671-uf96jgig	267	6	Sangon	Sangon	NNP
cord-252671-uf96jgig	267	7	(	(	-LRB-
cord-252671-uf96jgig	267	8	Shanghai	Shanghai	NNP
cord-252671-uf96jgig	267	9	,	,	,
cord-252671-uf96jgig	267	10	China	China	NNP
cord-252671-uf96jgig	267	11	)	)	-RRB-
cord-252671-uf96jgig	267	12	.	.	.
cord-252671-uf96jgig	268	1	For	for	IN
cord-252671-uf96jgig	268	2	the	the	DT
cord-252671-uf96jgig	268	3	construction	construction	NN
cord-252671-uf96jgig	268	4	of	of	IN
cord-252671-uf96jgig	268	5	pBS	pBS	NNP
cord-252671-uf96jgig	268	6	/	/	SYM
cord-252671-uf96jgig	268	7	U6	U6	NNP
cord-252671-uf96jgig	268	8	siTBK1	siTBK1	NNP
cord-252671-uf96jgig	268	9	,	,	,
cord-252671-uf96jgig	268	10	the	the	DT
cord-252671-uf96jgig	268	11	sense	sense	NN
cord-252671-uf96jgig	268	12	strand	strand	NN
cord-252671-uf96jgig	268	13	5=	5=	CD
cord-252671-uf96jgig	268	14	TCGAGTTGCG	TCGAGTTGCG	NNP
cord-252671-uf96jgig	268	15	AAGCCGGAAGTGTCCTAAGCTTAGGACACTTCCGGCTTCGCAAT	AAGCCGGAAGTGTCCTAAGCTTAGGACACTTCCGGCTTCGCAAT	NNP
cord-252671-uf96jgig	269	1	TTTTG	TTTTG	NNP
cord-252671-uf96jgig	269	2	3=	3=	CD
cord-252671-uf96jgig	269	3	and	and	CC
cord-252671-uf96jgig	269	4	antisense	antisense	NN
cord-252671-uf96jgig	269	5	strand	strand	NN
cord-252671-uf96jgig	269	6	5=	5=	CD
cord-252671-uf96jgig	269	7	ACGCTTCGGCCTTCACAGGATTC	ACGCTTCGGCCTTCACAGGATTC	NNS
cord-252671-uf96jgig	269	8	GAATCCTGTGAAGGCCGAAGCGTTAAAAACTTAA	GAATCCTGTGAAGGCCGAAGCGTTAAAAACTTAA	NNP
cord-252671-uf96jgig	270	1	3=	3=	CD
cord-252671-uf96jgig	270	2	were	be	VBD
cord-252671-uf96jgig	270	3	annealed	anneal	VBN
cord-252671-uf96jgig	270	4	and	and	CC
cord-252671-uf96jgig	270	5	then	then	RB
cord-252671-uf96jgig	270	6	subcloned	subclone	VBN
cord-252671-uf96jgig	270	7	into	into	IN
cord-252671-uf96jgig	270	8	the	the	DT
cord-252671-uf96jgig	270	9	EcoRI	ecori	NN
cord-252671-uf96jgig	270	10	and	and	CC
cord-252671-uf96jgig	270	11	XhoI	XhoI	NNP
cord-252671-uf96jgig	270	12	sites	site	NNS
cord-252671-uf96jgig	270	13	of	of	IN
cord-252671-uf96jgig	270	14	pBS	pBS	NNP
cord-252671-uf96jgig	270	15	/	/	SYM
cord-252671-uf96jgig	270	16	U6	U6	NNP
cord-252671-uf96jgig	270	17	.	.	.
cord-252671-uf96jgig	271	1	For	for	IN
cord-252671-uf96jgig	271	2	the	the	DT
cord-252671-uf96jgig	271	3	construction	construction	NN
cord-252671-uf96jgig	271	4	of	of	IN
cord-252671-uf96jgig	271	5	pBS	pBS	NNP
cord-252671-uf96jgig	271	6	/	/	SYM
cord-252671-uf96jgig	271	7	U6	U6	NNP
cord-252671-uf96jgig	271	8	siIRF3	siIRF3	NNP
cord-252671-uf96jgig	271	9	,	,	,
cord-252671-uf96jgig	271	10	the	the	DT
cord-252671-uf96jgig	271	11	sense	sense	NN
cord-252671-uf96jgig	271	12	strand	strand	NN
cord-252671-uf96jgig	271	13	5=	5=	CD
cord-252671-uf96jgig	271	14	TCGAGCATCGGCT	TCGAGCATCGGCT	NNP
cord-252671-uf96jgig	272	1	TTTGGGTCTGTTAAAGCTTTAACAGACCCAAAAGCCGATGTTTT	TTTGGGTCTGTTAAAGCTTTAACAGACCCAAAAGCCGATGTTTT	NNP
cord-252671-uf96jgig	272	2	TG	TG	NNP
cord-252671-uf96jgig	273	1	3=	3=	CD
cord-252671-uf96jgig	273	2	and	and	CC
cord-252671-uf96jgig	273	3	antisense	antisense	NN
cord-252671-uf96jgig	273	4	strand	strand	NN
cord-252671-uf96jgig	274	1	5=	5=	CD
cord-252671-uf96jgig	274	2	CGTAGCCGAAAACCCAGACAATTTCG	CGTAGCCGAAAACCCAGACAATTTCG	NNP
cord-252671-uf96jgig	274	3	AAATTGTCTGGGTTTTCGGCTACAAAAACTTAA	AAATTGTCTGGGTTTTCGGCTACAAAAACTTAA	NNP
cord-252671-uf96jgig	274	4	3=	3=	CD
cord-252671-uf96jgig	274	5	were	be	VBD
cord-252671-uf96jgig	274	6	annealed	anneal	VBN
cord-252671-uf96jgig	274	7	and	and	CC
cord-252671-uf96jgig	274	8	then	then	RB
cord-252671-uf96jgig	274	9	subcloned	subclone	VBN
cord-252671-uf96jgig	274	10	into	into	IN
cord-252671-uf96jgig	274	11	the	the	DT
cord-252671-uf96jgig	274	12	EcoRI	ecori	NN
cord-252671-uf96jgig	274	13	and	and	CC
cord-252671-uf96jgig	274	14	XhoI	XhoI	NNP
cord-252671-uf96jgig	274	15	sites	site	NNS
cord-252671-uf96jgig	274	16	of	of	IN
cord-252671-uf96jgig	274	17	pBS	pBS	NNP
cord-252671-uf96jgig	274	18	/	/	SYM
cord-252671-uf96jgig	274	19	U6	U6	NNP
cord-252671-uf96jgig	274	20	.	.	.
cord-252671-uf96jgig	275	1	For	for	IN
cord-252671-uf96jgig	275	2	construction	construction	NN
cord-252671-uf96jgig	275	3	of	of	IN
cord-252671-uf96jgig	275	4	pSilencer	pSilencer	NNP
cord-252671-uf96jgig	275	5	-	-	HYPH
cord-252671-uf96jgig	275	6	siTRAF3	siTRAF3	NNP
cord-252671-uf96jgig	275	7	,	,	,
cord-252671-uf96jgig	275	8	the	the	DT
cord-252671-uf96jgig	275	9	single	single	JJ
cord-252671-uf96jgig	275	10	-	-	HYPH
cord-252671-uf96jgig	275	11	strand	strand	NN
cord-252671-uf96jgig	275	12	oligonucleotides	oligonucleotide	NNS
cord-252671-uf96jgig	275	13	5=	5=	CD
cord-252671-uf96jgig	275	14	GATCCGCGAGAACTCCTCTTTCCCTCGAGGGAAAGAGG	gatccgcgagaactcctctttccctcgagggaaagagg	JJ
cord-252671-uf96jgig	275	15	AGTTCTCGCAGA	AGTTCTCGCAGA	NNS
cord-252671-uf96jgig	276	1	3=	3=	CD
cord-252671-uf96jgig	276	2	and	and	CC
cord-252671-uf96jgig	276	3	5=	5=	CD
cord-252671-uf96jgig	276	4	AGCTTCTGCGAGAACTCCTCTTTCCC	AGCTTCTGCGAGAACTCCTCTTTCCC	NNP
cord-252671-uf96jgig	276	5	TCGAGGGAAAGAGGAGTTCTCGCG	TCGAGGGAAAGAGGAGTTCTCGCG	NNP
cord-252671-uf96jgig	277	1	3=	3=	CD
cord-252671-uf96jgig	277	2	were	be	VBD
cord-252671-uf96jgig	277	3	annealed	anneal	VBN
cord-252671-uf96jgig	277	4	to	to	TO
cord-252671-uf96jgig	277	5	double	double	JJ
cord-252671-uf96jgig	277	6	strands	strand	NNS
cord-252671-uf96jgig	277	7	before	before	IN
cord-252671-uf96jgig	277	8	being	be	VBG
cord-252671-uf96jgig	277	9	subcloned	subclone	VBN
cord-252671-uf96jgig	277	10	into	into	IN
cord-252671-uf96jgig	277	11	the	the	DT
cord-252671-uf96jgig	277	12	HindIII	HindIII	NNS
cord-252671-uf96jgig	277	13	and	and	CC
cord-252671-uf96jgig	277	14	BamHI	bamhi	NN
cord-252671-uf96jgig	277	15	sites	site	NNS
cord-252671-uf96jgig	277	16	of	of	IN
cord-252671-uf96jgig	277	17	pSilencer	pSilencer	NNP
cord-252671-uf96jgig	277	18	4.1-CMV	4.1-cmv	CD
cord-252671-uf96jgig	277	19	neo	neo	NNP
cord-252671-uf96jgig	277	20	to	to	TO
cord-252671-uf96jgig	277	21	form	form	VB
cord-252671-uf96jgig	277	22	the	the	DT
cord-252671-uf96jgig	277	23	pSilencer	pSilencer	NNP
cord-252671-uf96jgig	277	24	-	-	HYPH
cord-252671-uf96jgig	277	25	siTRAF3	siTRAF3	NNP
cord-252671-uf96jgig	277	26	construct	construct	VB
cord-252671-uf96jgig	277	27	.	.	.
cord-252671-uf96jgig	278	1	Transient	transient	JJ
cord-252671-uf96jgig	278	2	transfection	transfection	NN
cord-252671-uf96jgig	278	3	.	.	.
cord-252671-uf96jgig	279	1	Cells	cell	NNS
cord-252671-uf96jgig	279	2	(	(	-LRB-
cord-252671-uf96jgig	279	3	HEK293ET	HEK293ET	NNP
cord-252671-uf96jgig	279	4	,	,	,
cord-252671-uf96jgig	279	5	HEK293	HEK293	NNP
cord-252671-uf96jgig	279	6	T	T	NNP
cord-252671-uf96jgig	279	7	,	,	,
cord-252671-uf96jgig	279	8	and	and	CC
cord-252671-uf96jgig	279	9	J2-M	J2-M	NNP
cord-252671-uf96jgig	279	10	)	)	-RRB-
cord-252671-uf96jgig	279	11	were	be	VBD
cord-252671-uf96jgig	279	12	transiently	transiently	RB
cord-252671-uf96jgig	279	13	transfected	transfecte	VBN
cord-252671-uf96jgig	279	14	with	with	IN
cord-252671-uf96jgig	279	15	the	the	DT
cord-252671-uf96jgig	279	16	plasmid	plasmid	NN
cord-252671-uf96jgig	279	17	DNAs	dna	NNS
cord-252671-uf96jgig	279	18	(	(	-LRB-
cord-252671-uf96jgig	279	19	pCMV	pcmv	NN
cord-252671-uf96jgig	279	20	-	-	HYPH
cord-252671-uf96jgig	279	21	Myc	Myc	NNP
cord-252671-uf96jgig	279	22	-	-	HYPH
cord-252671-uf96jgig	279	23	M	M	NNP
cord-252671-uf96jgig	279	24	,	,	,
cord-252671-uf96jgig	279	25	pCMV	pcmv	NN
cord-252671-uf96jgig	279	26	-	-	HYPH
cord-252671-uf96jgig	279	27	Myc	Myc	NNP
cord-252671-uf96jgig	279	28	,	,	,
cord-252671-uf96jgig	279	29	pGL3-IFN-	pGL3-IFN-	NNP
cord-252671-uf96jgig	279	30	␤	␤	CD
cord-252671-uf96jgig	279	31	-luc	-luc	CD
cord-252671-uf96jgig	279	32	,	,	,
cord-252671-uf96jgig	279	33	or	or	CC
cord-252671-uf96jgig	279	34	pNF	pNF	NNP
cord-252671-uf96jgig	279	35	-	-	HYPH
cord-252671-uf96jgig	279	36	B	B	NNP
cord-252671-uf96jgig	279	37	-	-	HYPH
cord-252671-uf96jgig	279	38	luc	luc	NNP
cord-252671-uf96jgig	279	39	)	)	-RRB-
cord-252671-uf96jgig	279	40	using	use	VBG
cord-252671-uf96jgig	279	41	VigoFect	VigoFect	NNP
cord-252671-uf96jgig	279	42	(	(	-LRB-
cord-252671-uf96jgig	279	43	Vigorous	Vigorous	NNP
cord-252671-uf96jgig	279	44	Biotechnology	Biotechnology	NNP
cord-252671-uf96jgig	279	45	,	,	,
cord-252671-uf96jgig	279	46	Beijing	Beijing	NNP
cord-252671-uf96jgig	279	47	,	,	,
cord-252671-uf96jgig	279	48	China	China	NNP
cord-252671-uf96jgig	279	49	)	)	-RRB-
cord-252671-uf96jgig	279	50	according	accord	VBG
cord-252671-uf96jgig	279	51	to	to	IN
cord-252671-uf96jgig	279	52	the	the	DT
cord-252671-uf96jgig	279	53	manufacturer	manufacturer	NN
cord-252671-uf96jgig	279	54	's	's	POS
cord-252671-uf96jgig	279	55	instructions	instruction	NNS
cord-252671-uf96jgig	279	56	.	.	.
cord-252671-uf96jgig	280	1	For	for	IN
cord-252671-uf96jgig	280	2	example	example	NN
cord-252671-uf96jgig	280	3	,	,	,
cord-252671-uf96jgig	280	4	about	about	RB
cord-252671-uf96jgig	280	5	5	5	CD
cord-252671-uf96jgig	280	6	g	g	NN
cord-252671-uf96jgig	280	7	plasmid	plasmid	NN
cord-252671-uf96jgig	280	8	DNAs	dna	NNS
cord-252671-uf96jgig	280	9	was	be	VBD
cord-252671-uf96jgig	280	10	first	first	RB
cord-252671-uf96jgig	280	11	added	add	VBN
cord-252671-uf96jgig	280	12	to	to	IN
cord-252671-uf96jgig	280	13	100	100	CD
cord-252671-uf96jgig	280	14	l	l	NN
cord-252671-uf96jgig	280	15	of	of	IN
cord-252671-uf96jgig	280	16	0.9	0.9	CD
cord-252671-uf96jgig	280	17	%	%	NN
cord-252671-uf96jgig	280	18	NaCl	nacl	NN
cord-252671-uf96jgig	280	19	.	.	.
cord-252671-uf96jgig	281	1	Then	then	RB
cord-252671-uf96jgig	281	2	,	,	,
cord-252671-uf96jgig	281	3	2.5	2.5	CD
cord-252671-uf96jgig	281	4	l	l	NN
cord-252671-uf96jgig	281	5	VigoFect	VigoFect	NNP
cord-252671-uf96jgig	281	6	was	be	VBD
cord-252671-uf96jgig	281	7	resuspended	resuspend	VBN
cord-252671-uf96jgig	281	8	into	into	IN
cord-252671-uf96jgig	281	9	another	another	DT
cord-252671-uf96jgig	281	10	100	100	CD
cord-252671-uf96jgig	281	11	l	l	NN
cord-252671-uf96jgig	281	12	of	of	IN
cord-252671-uf96jgig	281	13	0.9	0.9	CD
cord-252671-uf96jgig	281	14	%	%	NN
cord-252671-uf96jgig	281	15	NaCl	nacl	NN
cord-252671-uf96jgig	281	16	solution	solution	NN
cord-252671-uf96jgig	281	17	.	.	.
cord-252671-uf96jgig	282	1	Then	then	RB
cord-252671-uf96jgig	282	2	,	,	,
cord-252671-uf96jgig	282	3	the	the	DT
cord-252671-uf96jgig	282	4	DNA	dna	NN
cord-252671-uf96jgig	282	5	-	-	HYPH
cord-252671-uf96jgig	282	6	NaCl	nacl	NN
cord-252671-uf96jgig	282	7	mixture	mixture	NN
cord-252671-uf96jgig	282	8	was	be	VBD
cord-252671-uf96jgig	282	9	added	add	VBN
cord-252671-uf96jgig	282	10	to	to	IN
cord-252671-uf96jgig	282	11	the	the	DT
cord-252671-uf96jgig	282	12	VigoFect	VigoFect	NNP
cord-252671-uf96jgig	282	13	-	-	HYPH
cord-252671-uf96jgig	282	14	NaCl	NaCl	NNP
cord-252671-uf96jgig	282	15	mixture	mixture	NN
cord-252671-uf96jgig	282	16	drop	drop	NN
cord-252671-uf96jgig	282	17	by	by	IN
cord-252671-uf96jgig	282	18	drop	drop	NN
cord-252671-uf96jgig	282	19	with	with	IN
cord-252671-uf96jgig	282	20	gentle	gentle	JJ
cord-252671-uf96jgig	282	21	vortexing	vortexing	NN
cord-252671-uf96jgig	282	22	.	.	.
cord-252671-uf96jgig	283	1	After	after	IN
cord-252671-uf96jgig	283	2	a	a	DT
cord-252671-uf96jgig	283	3	15min	15min	JJ
cord-252671-uf96jgig	283	4	incubation	incubation	NN
cord-252671-uf96jgig	283	5	at	at	IN
cord-252671-uf96jgig	283	6	room	room	NN
cord-252671-uf96jgig	283	7	temperature	temperature	NN
cord-252671-uf96jgig	283	8	,	,	,
cord-252671-uf96jgig	283	9	the	the	DT
cord-252671-uf96jgig	283	10	reaction	reaction	NN
cord-252671-uf96jgig	283	11	product	product	NN
cord-252671-uf96jgig	283	12	was	be	VBD
cord-252671-uf96jgig	283	13	evenly	evenly	RB
cord-252671-uf96jgig	283	14	distributed	distribute	VBN
cord-252671-uf96jgig	283	15	onto	onto	IN
cord-252671-uf96jgig	283	16	the	the	DT
cord-252671-uf96jgig	283	17	cell	cell	NN
cord-252671-uf96jgig	283	18	culture	culture	NN
cord-252671-uf96jgig	283	19	surface	surface	NN
cord-252671-uf96jgig	283	20	of	of	IN
cord-252671-uf96jgig	283	21	either	either	DT
cord-252671-uf96jgig	283	22	6-well	6-well	CD
cord-252671-uf96jgig	283	23	plates	plate	NNS
cord-252671-uf96jgig	283	24	or	or	CC
cord-252671-uf96jgig	283	25	35-mm	35-mm	CD
cord-252671-uf96jgig	283	26	2	2	CD
cord-252671-uf96jgig	283	27	dishes	dish	NNS
cord-252671-uf96jgig	283	28	and	and	CC
cord-252671-uf96jgig	283	29	then	then	RB
cord-252671-uf96jgig	283	30	continuously	continuously	RB
cord-252671-uf96jgig	283	31	incubated	incubate	VBD
cord-252671-uf96jgig	283	32	for	for	IN
cord-252671-uf96jgig	283	33	48	48	CD
cord-252671-uf96jgig	283	34	h	h	NN
cord-252671-uf96jgig	283	35	before	before	IN
cord-252671-uf96jgig	283	36	harvesting	harvesting	NN
cord-252671-uf96jgig	283	37	.	.	.
cord-252671-uf96jgig	284	1	Construction	construction	NN
cord-252671-uf96jgig	284	2	of	of	IN
cord-252671-uf96jgig	284	3	the	the	DT
cord-252671-uf96jgig	284	4	293	293	CD
cord-252671-uf96jgig	284	5	siTRAF3	sitraf3	CD
cord-252671-uf96jgig	284	6	stable	stable	JJ
cord-252671-uf96jgig	284	7	cells	cell	NNS
cord-252671-uf96jgig	284	8	.	.	.
cord-252671-uf96jgig	285	1	Plasmid	Plasmid	NNP
cord-252671-uf96jgig	285	2	pSilencer	pSilencer	NNP
cord-252671-uf96jgig	285	3	-	-	HYPH
cord-252671-uf96jgig	285	4	siTRAF3	siTRAF3	NNP
cord-252671-uf96jgig	285	5	DNAs	dna	NNS
cord-252671-uf96jgig	285	6	(	(	-LRB-
cord-252671-uf96jgig	285	7	5	5	CD
cord-252671-uf96jgig	285	8	g	g	NN
cord-252671-uf96jgig	285	9	)	)	-RRB-
cord-252671-uf96jgig	285	10	were	be	VBD
cord-252671-uf96jgig	285	11	transfected	transfecte	VBN
cord-252671-uf96jgig	285	12	into	into	IN
cord-252671-uf96jgig	285	13	HEK293	HEK293	NNP
cord-252671-uf96jgig	285	14	cells	cell	NNS
cord-252671-uf96jgig	285	15	.	.	.
cord-252671-uf96jgig	286	1	After	after	IN
cord-252671-uf96jgig	286	2	a	a	DT
cord-252671-uf96jgig	286	3	24-h	24-h	JJ
cord-252671-uf96jgig	286	4	transfection	transfection	NN
cord-252671-uf96jgig	286	5	,	,	,
cord-252671-uf96jgig	286	6	the	the	DT
cord-252671-uf96jgig	286	7	cell	cell	NN
cord-252671-uf96jgig	286	8	culture	culture	NN
cord-252671-uf96jgig	286	9	medium	medium	NN
cord-252671-uf96jgig	286	10	was	be	VBD
cord-252671-uf96jgig	286	11	replaced	replace	VBN
cord-252671-uf96jgig	286	12	with	with	IN
cord-252671-uf96jgig	286	13	fresh	fresh	JJ
cord-252671-uf96jgig	286	14	medium	medium	NN
cord-252671-uf96jgig	286	15	containing	contain	VBG
cord-252671-uf96jgig	286	16	1,200	1,200	CD
cord-252671-uf96jgig	286	17	g	g	NN
cord-252671-uf96jgig	286	18	/	/	SYM
cord-252671-uf96jgig	286	19	ml	ml	NNP
cord-252671-uf96jgig	286	20	G418	G418	NNP
cord-252671-uf96jgig	286	21	.	.	.
cord-252671-uf96jgig	287	1	After	after	IN
cord-252671-uf96jgig	287	2	2	2	CD
cord-252671-uf96jgig	287	3	weeks	week	NNS
cord-252671-uf96jgig	287	4	of	of	IN
cord-252671-uf96jgig	287	5	culture	culture	NN
cord-252671-uf96jgig	287	6	,	,	,
cord-252671-uf96jgig	287	7	cell	cell	NN
cord-252671-uf96jgig	287	8	colonies	colony	NNS
cord-252671-uf96jgig	287	9	were	be	VBD
cord-252671-uf96jgig	287	10	picked	pick	VBN
cord-252671-uf96jgig	287	11	up	up	RP
cord-252671-uf96jgig	287	12	and	and	CC
cord-252671-uf96jgig	287	13	expanded	expand	VBD
cord-252671-uf96jgig	287	14	in	in	IN
cord-252671-uf96jgig	287	15	a	a	DT
cord-252671-uf96jgig	287	16	24-well	24-well	CD
cord-252671-uf96jgig	287	17	tissue	tissue	NN
cord-252671-uf96jgig	287	18	culture	culture	NN
cord-252671-uf96jgig	287	19	plate	plate	NN
cord-252671-uf96jgig	287	20	.	.	.
cord-252671-uf96jgig	288	1	Finally	finally	RB
cord-252671-uf96jgig	288	2	,	,	,
cord-252671-uf96jgig	288	3	Western	western	JJ
cord-252671-uf96jgig	288	4	blot	blot	NN
cord-252671-uf96jgig	288	5	analysis	analysis	NN
cord-252671-uf96jgig	288	6	was	be	VBD
cord-252671-uf96jgig	288	7	performed	perform	VBN
cord-252671-uf96jgig	288	8	to	to	TO
cord-252671-uf96jgig	288	9	detect	detect	VB
cord-252671-uf96jgig	288	10	TRAF3	traf3	NN
cord-252671-uf96jgig	288	11	expression	expression	NN
cord-252671-uf96jgig	288	12	.	.	.
cord-252671-uf96jgig	289	1	Reverse	reverse	JJ
cord-252671-uf96jgig	289	2	transcription	transcription	NN
cord-252671-uf96jgig	289	3	-	-	HYPH
cord-252671-uf96jgig	289	4	PCR	PCR	NNP
cord-252671-uf96jgig	289	5	(	(	-LRB-
cord-252671-uf96jgig	289	6	RT	RT	NNP
cord-252671-uf96jgig	289	7	-	-	HYPH
cord-252671-uf96jgig	289	8	PCR	PCR	NNP
cord-252671-uf96jgig	289	9	)	)	-RRB-
cord-252671-uf96jgig	289	10	and	and	CC
cord-252671-uf96jgig	289	11	qRT	qRT	NNP
cord-252671-uf96jgig	289	12	-	-	HYPH
cord-252671-uf96jgig	289	13	PCR	PCR	NNP
cord-252671-uf96jgig	289	14	.	.	.
cord-252671-uf96jgig	290	1	Total	total	JJ
cord-252671-uf96jgig	290	2	RNAs	rna	NNS
cord-252671-uf96jgig	290	3	were	be	VBD
cord-252671-uf96jgig	290	4	extracted	extract	VBN
cord-252671-uf96jgig	290	5	from	from	IN
cord-252671-uf96jgig	290	6	the	the	DT
cord-252671-uf96jgig	290	7	cultured	cultured	JJ
cord-252671-uf96jgig	290	8	cells	cell	NNS
cord-252671-uf96jgig	290	9	with	with	IN
cord-252671-uf96jgig	290	10	TRIzol	TRIzol	NNP
cord-252671-uf96jgig	290	11	(	(	-LRB-
cord-252671-uf96jgig	290	12	Invitrogen	Invitrogen	NNP
cord-252671-uf96jgig	290	13	,	,	,
cord-252671-uf96jgig	290	14	Carlsbad	Carlsbad	NNP
cord-252671-uf96jgig	290	15	,	,	,
cord-252671-uf96jgig	290	16	CA	CA	NNP
cord-252671-uf96jgig	290	17	,	,	,
cord-252671-uf96jgig	290	18	USA	USA	NNP
cord-252671-uf96jgig	290	19	)	)	-RRB-
cord-252671-uf96jgig	290	20	.	.	.
cord-252671-uf96jgig	291	1	The	the	DT
cord-252671-uf96jgig	291	2	purified	purify	VBN
cord-252671-uf96jgig	291	3	total	total	JJ
cord-252671-uf96jgig	291	4	RNAs	rna	NNS
cord-252671-uf96jgig	291	5	were	be	VBD
cord-252671-uf96jgig	291	6	treated	treat	VBN
cord-252671-uf96jgig	291	7	with	with	IN
cord-252671-uf96jgig	291	8	DNase	DNase	NNP
cord-252671-uf96jgig	292	1	I	-PRON-	PRP
cord-252671-uf96jgig	292	2	(	(	-LRB-
cord-252671-uf96jgig	292	3	Qiagen	Qiagen	NNP
cord-252671-uf96jgig	292	4	,	,	,
cord-252671-uf96jgig	292	5	Düsseldorf	Düsseldorf	NNP
cord-252671-uf96jgig	292	6	,	,	,
cord-252671-uf96jgig	292	7	Germany	Germany	NNP
cord-252671-uf96jgig	292	8	)	)	-RRB-
cord-252671-uf96jgig	292	9	.	.	.
cord-252671-uf96jgig	293	1	All	all	DT
cord-252671-uf96jgig	293	2	primers	primer	NNS
cord-252671-uf96jgig	293	3	used	use	VBN
cord-252671-uf96jgig	293	4	in	in	IN
cord-252671-uf96jgig	293	5	the	the	DT
cord-252671-uf96jgig	293	6	RT	RT	NNP
cord-252671-uf96jgig	293	7	-	-	HYPH
cord-252671-uf96jgig	293	8	PCRs	pcr	NNS
cord-252671-uf96jgig	293	9	are	be	VBP
cord-252671-uf96jgig	293	10	listed	list	VBN
cord-252671-uf96jgig	293	11	in	in	IN
cord-252671-uf96jgig	293	12	Table	Table	NNP
cord-252671-uf96jgig	293	13	1	1	CD
cord-252671-uf96jgig	293	14	.	.	.
cord-252671-uf96jgig	294	1	The	the	DT
cord-252671-uf96jgig	294	2	RT	RT	NNP
cord-252671-uf96jgig	294	3	-	-	HYPH
cord-252671-uf96jgig	294	4	PCR	PCR	NNP
cord-252671-uf96jgig	294	5	was	be	VBD
cord-252671-uf96jgig	294	6	carried	carry	VBN
cord-252671-uf96jgig	294	7	out	out	RP
cord-252671-uf96jgig	294	8	with	with	IN
cord-252671-uf96jgig	294	9	the	the	DT
cord-252671-uf96jgig	294	10	PrimeScript	PrimeScript	NNP
cord-252671-uf96jgig	294	11	one	one	CD
cord-252671-uf96jgig	294	12	-	-	HYPH
cord-252671-uf96jgig	294	13	step	step	NN
cord-252671-uf96jgig	294	14	RT	RT	NNP
cord-252671-uf96jgig	294	15	-	-	HYPH
cord-252671-uf96jgig	294	16	PCR	PCR	NNP
cord-252671-uf96jgig	294	17	kit	kit	NN
cord-252671-uf96jgig	294	18	(	(	-LRB-
cord-252671-uf96jgig	294	19	TaKaRa	TaKaRa	NNP
cord-252671-uf96jgig	294	20	Biotechnology	Biotechnology	NNP
cord-252671-uf96jgig	294	21	,	,	,
cord-252671-uf96jgig	294	22	Dalian	Dalian	NNP
cord-252671-uf96jgig	294	23	,	,	,
cord-252671-uf96jgig	294	24	China	China	NNP
cord-252671-uf96jgig	294	25	)	)	-RRB-
cord-252671-uf96jgig	294	26	according	accord	VBG
cord-252671-uf96jgig	294	27	to	to	IN
cord-252671-uf96jgig	294	28	the	the	DT
cord-252671-uf96jgig	294	29	manufacturer	manufacturer	NN
cord-252671-uf96jgig	294	30	's	's	POS
cord-252671-uf96jgig	294	31	instructions	instruction	NNS
cord-252671-uf96jgig	294	32	.	.	.
cord-252671-uf96jgig	295	1	The	the	DT
cord-252671-uf96jgig	295	2	RT	RT	NNP
cord-252671-uf96jgig	295	3	-	-	HYPH
cord-252671-uf96jgig	295	4	PCR	PCR	NNP
cord-252671-uf96jgig	295	5	was	be	VBD
cord-252671-uf96jgig	295	6	carried	carry	VBN
cord-252671-uf96jgig	295	7	out	out	RP
cord-252671-uf96jgig	295	8	in	in	IN
cord-252671-uf96jgig	295	9	a	a	DT
cord-252671-uf96jgig	295	10	DNA	DNA	NNP
cord-252671-uf96jgig	295	11	Thermal	Thermal	NNP
cord-252671-uf96jgig	295	12	Cycler	cycler	NN
cord-252671-uf96jgig	295	13	(	(	-LRB-
cord-252671-uf96jgig	295	14	Applied	Applied	NNP
cord-252671-uf96jgig	295	15	Biosystems	Biosystems	NNP
cord-252671-uf96jgig	295	16	,	,	,
cord-252671-uf96jgig	295	17	Carlsbad	Carlsbad	NNP
cord-252671-uf96jgig	295	18	,	,	,
cord-252671-uf96jgig	295	19	CA	CA	NNP
cord-252671-uf96jgig	295	20	)	)	-RRB-
cord-252671-uf96jgig	295	21	under	under	IN
cord-252671-uf96jgig	295	22	the	the	DT
cord-252671-uf96jgig	295	23	following	follow	VBG
cord-252671-uf96jgig	295	24	conditions	condition	NNS
cord-252671-uf96jgig	295	25	:	:	:
cord-252671-uf96jgig	295	26	50	50	CD
cord-252671-uf96jgig	295	27	°	°	NN
cord-252671-uf96jgig	295	28	C	c	NN
cord-252671-uf96jgig	295	29	for	for	IN
cord-252671-uf96jgig	295	30	35	35	CD
cord-252671-uf96jgig	295	31	min	min	NNS
cord-252671-uf96jgig	295	32	for	for	IN
cord-252671-uf96jgig	295	33	reverse	reverse	JJ
cord-252671-uf96jgig	295	34	transcription	transcription	NN
cord-252671-uf96jgig	295	35	and	and	CC
cord-252671-uf96jgig	295	36	94	94	CD
cord-252671-uf96jgig	295	37	°	°	NN
cord-252671-uf96jgig	295	38	C	c	NN
cord-252671-uf96jgig	295	39	for	for	IN
cord-252671-uf96jgig	295	40	5	5	CD
cord-252671-uf96jgig	295	41	min	min	NN
cord-252671-uf96jgig	295	42	for	for	IN
cord-252671-uf96jgig	295	43	denaturation	denaturation	NN
cord-252671-uf96jgig	295	44	.	.	.
cord-252671-uf96jgig	296	1	The	the	DT
cord-252671-uf96jgig	296	2	PCR	PCR	NNP
cord-252671-uf96jgig	296	3	conditions	condition	NNS
cord-252671-uf96jgig	296	4	were	be	VBD
cord-252671-uf96jgig	296	5	94	94	CD
cord-252671-uf96jgig	296	6	°	°	NN
cord-252671-uf96jgig	296	7	C	c	NN
cord-252671-uf96jgig	296	8	for	for	IN
cord-252671-uf96jgig	296	9	30	30	CD
cord-252671-uf96jgig	296	10	s	s	NN
cord-252671-uf96jgig	296	11	,	,	,
cord-252671-uf96jgig	296	12	50	50	CD
cord-252671-uf96jgig	296	13	°	°	NN
cord-252671-uf96jgig	296	14	C	c	NN
cord-252671-uf96jgig	296	15	for	for	IN
cord-252671-uf96jgig	296	16	30	30	CD
cord-252671-uf96jgig	296	17	s	s	NN
cord-252671-uf96jgig	296	18	,	,	,
cord-252671-uf96jgig	296	19	and	and	CC
cord-252671-uf96jgig	296	20	72	72	CD
cord-252671-uf96jgig	296	21	°	°	NN
cord-252671-uf96jgig	296	22	C	c	NN
cord-252671-uf96jgig	296	23	for	for	IN
cord-252671-uf96jgig	296	24	50	50	CD
cord-252671-uf96jgig	296	25	s	s	NNS
cord-252671-uf96jgig	296	26	,	,	,
cord-252671-uf96jgig	296	27	repeated	repeat	VBN
cord-252671-uf96jgig	296	28	for	for	IN
cord-252671-uf96jgig	296	29	20	20	CD
cord-252671-uf96jgig	296	30	to	to	TO
cord-252671-uf96jgig	296	31	30	30	CD
cord-252671-uf96jgig	296	32	cycles	cycle	NNS
cord-252671-uf96jgig	296	33	;	;	:
cord-252671-uf96jgig	296	34	the	the	DT
cord-252671-uf96jgig	296	35	reaction	reaction	NN
cord-252671-uf96jgig	296	36	was	be	VBD
cord-252671-uf96jgig	296	37	extended	extend	VBN
cord-252671-uf96jgig	296	38	at	at	IN
cord-252671-uf96jgig	296	39	72	72	CD
cord-252671-uf96jgig	296	40	°	°	NN
cord-252671-uf96jgig	296	41	C	c	NN
cord-252671-uf96jgig	296	42	for	for	IN
cord-252671-uf96jgig	296	43	10	10	CD
cord-252671-uf96jgig	296	44	min	min	NNS
cord-252671-uf96jgig	296	45	before	before	IN
cord-252671-uf96jgig	296	46	the	the	DT
cord-252671-uf96jgig	296	47	reaction	reaction	NN
cord-252671-uf96jgig	296	48	product	product	NN
cord-252671-uf96jgig	296	49	was	be	VBD
cord-252671-uf96jgig	296	50	stored	store	VBN
cord-252671-uf96jgig	296	51	at	at	IN
cord-252671-uf96jgig	296	52	4	4	CD
cord-252671-uf96jgig	296	53	°	°	NN
cord-252671-uf96jgig	296	54	C	c	NN
cord-252671-uf96jgig	296	55	.	.	.
cord-252671-uf96jgig	297	1	One	one	CD
cord-252671-uf96jgig	297	2	-	-	HYPH
cord-252671-uf96jgig	297	3	step	step	NN
cord-252671-uf96jgig	297	4	real	real	JJ
cord-252671-uf96jgig	297	5	-	-	HYPH
cord-252671-uf96jgig	297	6	time	time	NN
cord-252671-uf96jgig	297	7	quantitative	quantitative	JJ
cord-252671-uf96jgig	297	8	RT	RT	NNP
cord-252671-uf96jgig	297	9	-	-	HYPH
cord-252671-uf96jgig	297	10	PCR	PCR	NNP
cord-252671-uf96jgig	297	11	(	(	-LRB-
cord-252671-uf96jgig	297	12	qRT	qRT	NNP
cord-252671-uf96jgig	297	13	-	-	HYPH
cord-252671-uf96jgig	297	14	PCR	PCR	NNP
cord-252671-uf96jgig	297	15	)	)	-RRB-
cord-252671-uf96jgig	297	16	(	(	-LRB-
cord-252671-uf96jgig	297	17	TaKaRa	TaKaRa	NNP
cord-252671-uf96jgig	297	18	Biotechnology	Biotechnology	NNP
cord-252671-uf96jgig	297	19	,	,	,
cord-252671-uf96jgig	297	20	Dalian	Dalian	NNP
cord-252671-uf96jgig	297	21	,	,	,
cord-252671-uf96jgig	297	22	China	China	NNP
cord-252671-uf96jgig	297	23	)	)	-RRB-
cord-252671-uf96jgig	297	24	was	be	VBD
cord-252671-uf96jgig	297	25	also	also	RB
cord-252671-uf96jgig	297	26	performed	perform	VBN
cord-252671-uf96jgig	297	27	to	to	TO
cord-252671-uf96jgig	297	28	monitor	monitor	VB
cord-252671-uf96jgig	297	29	the	the	DT
cord-252671-uf96jgig	297	30	targeted	target	VBN
cord-252671-uf96jgig	297	31	gene	gene	NN
cord-252671-uf96jgig	297	32	expression	expression	NN
cord-252671-uf96jgig	297	33	.	.	.
cord-252671-uf96jgig	298	1	The	the	DT
cord-252671-uf96jgig	298	2	primers	primer	NNS
cord-252671-uf96jgig	298	3	used	use	VBN
cord-252671-uf96jgig	298	4	in	in	IN
cord-252671-uf96jgig	298	5	qRT	qRT	NNP
cord-252671-uf96jgig	298	6	-	-	HYPH
cord-252671-uf96jgig	298	7	PCR	PCR	NNP
cord-252671-uf96jgig	298	8	were	be	VBD
cord-252671-uf96jgig	298	9	also	also	RB
cord-252671-uf96jgig	298	10	listed	list	VBN
cord-252671-uf96jgig	298	11	in	in	IN
cord-252671-uf96jgig	298	12	Table	Table	NNP
cord-252671-uf96jgig	298	13	1	1	CD
cord-252671-uf96jgig	298	14	.	.	.
cord-252671-uf96jgig	299	1	Real	real	JJ
cord-252671-uf96jgig	299	2	-	-	HYPH
cord-252671-uf96jgig	299	3	time	time	NN
cord-252671-uf96jgig	299	4	qRT	qRT	NNP
cord-252671-uf96jgig	299	5	-	-	HYPH
cord-252671-uf96jgig	299	6	PCR	PCR	NNP
cord-252671-uf96jgig	299	7	was	be	VBD
cord-252671-uf96jgig	299	8	carried	carry	VBN
cord-252671-uf96jgig	299	9	out	out	RP
cord-252671-uf96jgig	299	10	with	with	IN
cord-252671-uf96jgig	299	11	the	the	DT
cord-252671-uf96jgig	299	12	CFX	cfx	JJ
cord-252671-uf96jgig	299	13	real	real	JJ
cord-252671-uf96jgig	299	14	-	-	HYPH
cord-252671-uf96jgig	299	15	time	time	NN
cord-252671-uf96jgig	299	16	PCR	PCR	NNP
cord-252671-uf96jgig	299	17	detection	detection	NN
cord-252671-uf96jgig	299	18	system	system	NN
cord-252671-uf96jgig	299	19	(	(	-LRB-
cord-252671-uf96jgig	299	20	Bio	Bio	NNP
cord-252671-uf96jgig	299	21	-	-	HYPH
cord-252671-uf96jgig	299	22	Rad	Rad	NNP
cord-252671-uf96jgig	299	23	Laboratories	Laboratories	NNP
cord-252671-uf96jgig	299	24	,	,	,
cord-252671-uf96jgig	299	25	Hercules	Hercules	NNP
cord-252671-uf96jgig	299	26	,	,	,
cord-252671-uf96jgig	299	27	CA	CA	NNP
cord-252671-uf96jgig	299	28	,	,	,
cord-252671-uf96jgig	299	29	USA	USA	NNP
cord-252671-uf96jgig	299	30	)	)	-RRB-
cord-252671-uf96jgig	299	31	under	under	IN
cord-252671-uf96jgig	299	32	the	the	DT
cord-252671-uf96jgig	299	33	following	follow	VBG
cord-252671-uf96jgig	299	34	conditions	condition	NNS
cord-252671-uf96jgig	299	35	:	:	:
cord-252671-uf96jgig	299	36	42	42	CD
cord-252671-uf96jgig	299	37	°	°	NN
cord-252671-uf96jgig	299	38	C	c	NN
cord-252671-uf96jgig	299	39	for	for	IN
cord-252671-uf96jgig	299	40	5	5	CD
cord-252671-uf96jgig	299	41	min	min	NN
cord-252671-uf96jgig	299	42	and	and	CC
cord-252671-uf96jgig	299	43	95	95	CD
cord-252671-uf96jgig	299	44	°	°	NN
cord-252671-uf96jgig	299	45	C	c	NN
cord-252671-uf96jgig	299	46	for	for	IN
cord-252671-uf96jgig	299	47	10	10	CD
cord-252671-uf96jgig	299	48	s	s	NNS
cord-252671-uf96jgig	299	49	,	,	,
cord-252671-uf96jgig	299	50	and	and	CC
cord-252671-uf96jgig	299	51	then	then	RB
cord-252671-uf96jgig	299	52	95	95	CD
cord-252671-uf96jgig	299	53	°	°	NN
cord-252671-uf96jgig	299	54	C	c	NN
cord-252671-uf96jgig	299	55	for	for	IN
cord-252671-uf96jgig	299	56	5	5	CD
cord-252671-uf96jgig	299	57	s	s	NNPS
cord-252671-uf96jgig	299	58	and	and	CC
cord-252671-uf96jgig	299	59	60	60	CD
cord-252671-uf96jgig	299	60	°	°	NN
cord-252671-uf96jgig	299	61	C	c	NN
cord-252671-uf96jgig	299	62	for	for	IN
cord-252671-uf96jgig	299	63	10	10	CD
cord-252671-uf96jgig	299	64	s	s	NNS
cord-252671-uf96jgig	299	65	,	,	,
cord-252671-uf96jgig	299	66	repeated	repeat	VBN
cord-252671-uf96jgig	299	67	for	for	IN
cord-252671-uf96jgig	299	68	40	40	CD
cord-252671-uf96jgig	299	69	cycles	cycle	NNS
cord-252671-uf96jgig	299	70	.	.	.
cord-252671-uf96jgig	300	1	The	the	DT
cord-252671-uf96jgig	300	2	dissociation	dissociation	NN
cord-252671-uf96jgig	300	3	of	of	IN
cord-252671-uf96jgig	300	4	the	the	DT
cord-252671-uf96jgig	300	5	reaction	reaction	NN
cord-252671-uf96jgig	300	6	products	product	NNS
cord-252671-uf96jgig	300	7	was	be	VBD
cord-252671-uf96jgig	300	8	conducted	conduct	VBN
cord-252671-uf96jgig	300	9	from	from	IN
cord-252671-uf96jgig	300	10	55	55	CD
cord-252671-uf96jgig	300	11	°	°	NN
cord-252671-uf96jgig	300	12	C	c	NN
cord-252671-uf96jgig	300	13	to	to	IN
cord-252671-uf96jgig	300	14	95	95	CD
cord-252671-uf96jgig	300	15	°	°	NN
cord-252671-uf96jgig	300	16	C	c	NN
cord-252671-uf96jgig	300	17	as	as	IN
cord-252671-uf96jgig	300	18	the	the	DT
cord-252671-uf96jgig	300	19	temperature	temperature	NN
cord-252671-uf96jgig	300	20	rose	rise	VBD
cord-252671-uf96jgig	300	21	at	at	IN
cord-252671-uf96jgig	300	22	0.2	0.2	CD
cord-252671-uf96jgig	300	23	°	°	NN
cord-252671-uf96jgig	300	24	C	c	NN
cord-252671-uf96jgig	300	25	per	per	IN
cord-252671-uf96jgig	300	26	10	10	CD
cord-252671-uf96jgig	300	27	s.	s.	NN
cord-252671-uf96jgig	300	28	 	 	_SP
cord-252671-uf96jgig	300	29	Viral	viral	JJ
cord-252671-uf96jgig	300	30	evasion	evasion	NN
cord-252671-uf96jgig	300	31	and	and	CC
cord-252671-uf96jgig	300	32	subversion	subversion	NN
cord-252671-uf96jgig	300	33	of	of	IN
cord-252671-uf96jgig	300	34	pattern	pattern	NN
cord-252671-uf96jgig	300	35	-	-	HYPH
cord-252671-uf96jgig	300	36	recognition	recognition	NN
cord-252671-uf96jgig	300	37	receptor	receptor	NN
cord-252671-uf96jgig	300	38	signalling	signal	VBG
cord-252671-uf96jgig	300	39	Induction	induction	NN
cord-252671-uf96jgig	300	40	and	and	CC
cord-252671-uf96jgig	300	41	function	function	NN
cord-252671-uf96jgig	300	42	of	of	IN
cord-252671-uf96jgig	300	43	IFNbeta	ifnbeta	NN
cord-252671-uf96jgig	300	44	during	during	IN
cord-252671-uf96jgig	300	45	viral	viral	JJ
cord-252671-uf96jgig	300	46	and	and	CC
cord-252671-uf96jgig	300	47	bacterial	bacterial	JJ
cord-252671-uf96jgig	300	48	infection	infection	NN
cord-252671-uf96jgig	300	49	Innate	innate	JJ
cord-252671-uf96jgig	300	50	immunity	immunity	NN
cord-252671-uf96jgig	300	51	to	to	IN
cord-252671-uf96jgig	300	52	virus	virus	NN
cord-252671-uf96jgig	300	53	infection	infection	NN
cord-252671-uf96jgig	300	54	Role	role	NN
cord-252671-uf96jgig	300	55	of	of	IN
cord-252671-uf96jgig	300	56	adaptor	adaptor	NN
cord-252671-uf96jgig	300	57	TRIF	TRIF	NNP
cord-252671-uf96jgig	300	58	in	in	IN
cord-252671-uf96jgig	300	59	the	the	DT
cord-252671-uf96jgig	300	60	MyD88-independent	MyD88-independent	NNP
cord-252671-uf96jgig	300	61	Toll	Toll	NNP
cord-252671-uf96jgig	300	62	-	-	HYPH
cord-252671-uf96jgig	300	63	like	like	JJ
cord-252671-uf96jgig	300	64	receptor	receptor	NN
cord-252671-uf96jgig	300	65	signaling	signal	VBG
cord-252671-uf96jgig	300	66	pathway	pathway	NN
cord-252671-uf96jgig	300	67	Innate	innate	VBP
cord-252671-uf96jgig	300	68	antiviral	antiviral	JJ
cord-252671-uf96jgig	300	69	responses	response	NNS
cord-252671-uf96jgig	300	70	by	by	IN
cord-252671-uf96jgig	300	71	means	mean	NNS
cord-252671-uf96jgig	300	72	of	of	IN
cord-252671-uf96jgig	300	73	TLR7-mediated	tlr7-mediated	JJ
cord-252671-uf96jgig	300	74	recognition	recognition	NN
cord-252671-uf96jgig	300	75	of	of	IN
cord-252671-uf96jgig	300	76	singlestranded	singlestranded	NNP
cord-252671-uf96jgig	300	77	RNA	RNA	NNP
cord-252671-uf96jgig	300	78	TLR9	TLR9	NNP
cord-252671-uf96jgig	300	79	signals	signal	NNS
cord-252671-uf96jgig	300	80	after	after	IN
cord-252671-uf96jgig	300	81	translocating	translocate	VBG
cord-252671-uf96jgig	300	82	from	from	IN
cord-252671-uf96jgig	300	83	the	the	DT
cord-252671-uf96jgig	300	84	ER	ER	NNP
cord-252671-uf96jgig	300	85	to	to	IN
cord-252671-uf96jgig	300	86	CpG	CpG	NNP
cord-252671-uf96jgig	300	87	DNA	DNA	NNP
cord-252671-uf96jgig	300	88	in	in	IN
cord-252671-uf96jgig	300	89	the	the	DT
cord-252671-uf96jgig	300	90	lysosome	lysosome	NN
cord-252671-uf96jgig	301	1	The	the	DT
cord-252671-uf96jgig	301	2	interferon	interferon	NN
cord-252671-uf96jgig	301	3	inducing	induce	VBG
cord-252671-uf96jgig	301	4	pathways	pathway	NNS
cord-252671-uf96jgig	301	5	and	and	CC
cord-252671-uf96jgig	301	6	the	the	DT
cord-252671-uf96jgig	301	7	hepatitis	hepatitis	NN
cord-252671-uf96jgig	301	8	C	C	NNP
cord-252671-uf96jgig	301	9	virus	virus	NN
cord-252671-uf96jgig	301	10	5=-Triphosphate	5=-triphosphate	CD
cord-252671-uf96jgig	301	11	RNA	RNA	NNP
cord-252671-uf96jgig	301	12	is	be	VBZ
cord-252671-uf96jgig	301	13	the	the	DT
cord-252671-uf96jgig	301	14	ligand	ligand	NN
cord-252671-uf96jgig	301	15	for	for	IN
cord-252671-uf96jgig	301	16	RIG	rig	NN
cord-252671-uf96jgig	301	17	-	-	:
cord-252671-uf96jgig	301	18	I	i	NN
cord-252671-uf96jgig	301	19	Differential	differential	JJ
cord-252671-uf96jgig	301	20	roles	role	NNS
cord-252671-uf96jgig	301	21	of	of	IN
cord-252671-uf96jgig	301	22	MDA5	MDA5	NNP
cord-252671-uf96jgig	301	23	and	and	CC
cord-252671-uf96jgig	301	24	RIG	rig	NN
cord-252671-uf96jgig	302	1	-I	-i	DT
cord-252671-uf96jgig	302	2	helicases	helicase	NNS
cord-252671-uf96jgig	302	3	in	in	IN
cord-252671-uf96jgig	302	4	the	the	DT
cord-252671-uf96jgig	302	5	recognition	recognition	NN
cord-252671-uf96jgig	302	6	of	of	IN
cord-252671-uf96jgig	302	7	RNA	RNA	NNP
cord-252671-uf96jgig	302	8	viruses	virus	NNS
cord-252671-uf96jgig	302	9	MAVS	mavs	RB
cord-252671-uf96jgig	302	10	forms	form	VBZ
cord-252671-uf96jgig	302	11	functional	functional	JJ
cord-252671-uf96jgig	302	12	prion	prion	NN
cord-252671-uf96jgig	302	13	-	-	HYPH
cord-252671-uf96jgig	302	14	like	like	JJ
cord-252671-uf96jgig	302	15	aggregates	aggregate	NNS
cord-252671-uf96jgig	302	16	to	to	TO
cord-252671-uf96jgig	302	17	activate	activate	VB
cord-252671-uf96jgig	302	18	and	and	CC
cord-252671-uf96jgig	302	19	propagate	propagate	VB
cord-252671-uf96jgig	302	20	antiviral	antiviral	JJ
cord-252671-uf96jgig	302	21	innate	innate	JJ
cord-252671-uf96jgig	302	22	immune	immune	JJ
cord-252671-uf96jgig	302	23	response	response	NN
cord-252671-uf96jgig	302	24	Regulation	regulation	NN
cord-252671-uf96jgig	302	25	of	of	IN
cord-252671-uf96jgig	302	26	antiviral	antiviral	JJ
cord-252671-uf96jgig	302	27	responses	response	NNS
cord-252671-uf96jgig	302	28	by	by	IN
cord-252671-uf96jgig	302	29	a	a	DT
cord-252671-uf96jgig	302	30	direct	direct	JJ
cord-252671-uf96jgig	302	31	and	and	CC
cord-252671-uf96jgig	302	32	specific	specific	JJ
cord-252671-uf96jgig	302	33	interaction	interaction	NN
cord-252671-uf96jgig	302	34	between	between	IN
cord-252671-uf96jgig	302	35	TRAF3	traf3	NN
cord-252671-uf96jgig	302	36	and	and	CC
cord-252671-uf96jgig	302	37	Cardif	Cardif	NNP
cord-252671-uf96jgig	303	1	The	the	DT
cord-252671-uf96jgig	303	2	adaptor	adaptor	NN
cord-252671-uf96jgig	303	3	protein	protein	NN
cord-252671-uf96jgig	303	4	MITA	MITA	NNP
cord-252671-uf96jgig	303	5	links	link	VBZ
cord-252671-uf96jgig	303	6	virus	virus	NN
cord-252671-uf96jgig	303	7	-	-	HYPH
cord-252671-uf96jgig	303	8	sensing	sense	VBG
cord-252671-uf96jgig	303	9	receptors	receptor	NNS
cord-252671-uf96jgig	303	10	to	to	IN
cord-252671-uf96jgig	303	11	IRF3	IRF3	NNP
cord-252671-uf96jgig	303	12	transcription	transcription	NN
cord-252671-uf96jgig	303	13	factor	factor	NN
cord-252671-uf96jgig	303	14	activation	activation	NN
cord-252671-uf96jgig	303	15	Vaccinia	Vaccinia	NNP
cord-252671-uf96jgig	303	16	virus	virus	NN
cord-252671-uf96jgig	304	1	protein	protein	NNP
cord-252671-uf96jgig	304	2	A46R	A46R	NNPS
cord-252671-uf96jgig	304	3	targets	target	VBZ
cord-252671-uf96jgig	304	4	multiple	multiple	JJ
cord-252671-uf96jgig	304	5	toll	toll	NN
cord-252671-uf96jgig	304	6	-	-	HYPH
cord-252671-uf96jgig	304	7	like	like	IN
cord-252671-uf96jgig	304	8	-	-	HYPH
cord-252671-uf96jgig	304	9	interleukin-1	interleukin-1	NN
cord-252671-uf96jgig	304	10	receptor	receptor	NN
cord-252671-uf96jgig	304	11	adaptors	adaptor	NNS
cord-252671-uf96jgig	304	12	and	and	CC
cord-252671-uf96jgig	304	13	contributes	contribute	VBZ
cord-252671-uf96jgig	304	14	to	to	IN
cord-252671-uf96jgig	304	15	virulence	virulence	NN
cord-252671-uf96jgig	304	16	Poxviral	Poxviral	NNP
cord-252671-uf96jgig	304	17	protein	protein	NN
cord-252671-uf96jgig	305	1	A46	A46	NNP
cord-252671-uf96jgig	305	2	antagonizes	antagonize	VBZ
cord-252671-uf96jgig	305	3	Toll	toll	NN
cord-252671-uf96jgig	305	4	-	-	HYPH
cord-252671-uf96jgig	305	5	like	like	JJ
cord-252671-uf96jgig	305	6	receptor	receptor	NN
cord-252671-uf96jgig	305	7	4	4	CD
cord-252671-uf96jgig	305	8	signaling	signal	VBG
cord-252671-uf96jgig	305	9	by	by	IN
cord-252671-uf96jgig	305	10	targeting	target	VBG
cord-252671-uf96jgig	305	11	BB	bb	NN
cord-252671-uf96jgig	305	12	loop	loop	NN
cord-252671-uf96jgig	305	13	motifs	motif	NNS
cord-252671-uf96jgig	305	14	in	in	IN
cord-252671-uf96jgig	305	15	toll	toll	NN
cord-252671-uf96jgig	305	16	-	-	HYPH
cord-252671-uf96jgig	305	17	IL-1	IL-1	NNP
cord-252671-uf96jgig	305	18	receptor	receptor	NN
cord-252671-uf96jgig	305	19	adaptor	adaptor	NN
cord-252671-uf96jgig	305	20	proteins	protein	NNS
cord-252671-uf96jgig	305	21	to	to	TO
cord-252671-uf96jgig	305	22	disrupt	disrupt	VB
cord-252671-uf96jgig	305	23	receptor	receptor	NN
cord-252671-uf96jgig	305	24	:	:	:
cord-252671-uf96jgig	305	25	adaptor	adaptor	NN
cord-252671-uf96jgig	305	26	interactions	interaction	NNS
cord-252671-uf96jgig	305	27	Viral	viral	JJ
cord-252671-uf96jgig	305	28	inhibitory	inhibitory	JJ
cord-252671-uf96jgig	305	29	peptide	peptide	NN
cord-252671-uf96jgig	305	30	of	of	IN
cord-252671-uf96jgig	305	31	TLR4	TLR4	NNP
cord-252671-uf96jgig	305	32	,	,	,
cord-252671-uf96jgig	305	33	a	a	DT
cord-252671-uf96jgig	305	34	peptide	peptide	NN
cord-252671-uf96jgig	305	35	derived	derive	VBN
cord-252671-uf96jgig	305	36	from	from	IN
cord-252671-uf96jgig	305	37	vaccinia	vaccinia	NN
cord-252671-uf96jgig	305	38	protein	protein	NN
cord-252671-uf96jgig	305	39	A46	A46	NNP
cord-252671-uf96jgig	305	40	,	,	,
cord-252671-uf96jgig	305	41	specifically	specifically	RB
cord-252671-uf96jgig	305	42	inhibits	inhibit	VBZ
cord-252671-uf96jgig	305	43	TLR4	TLR4	NNP
cord-252671-uf96jgig	305	44	by	by	IN
cord-252671-uf96jgig	305	45	directly	directly	RB
cord-252671-uf96jgig	305	46	targeting	target	VBG
cord-252671-uf96jgig	305	47	MyD88	myd88	JJ
cord-252671-uf96jgig	305	48	adaptor	adaptor	NN
cord-252671-uf96jgig	305	49	-	-	HYPH
cord-252671-uf96jgig	305	50	like	like	JJ
cord-252671-uf96jgig	305	51	and	and	CC
cord-252671-uf96jgig	305	52	TRIF	trif	NN
cord-252671-uf96jgig	305	53	-	-	HYPH
cord-252671-uf96jgig	305	54	related	relate	VBN
cord-252671-uf96jgig	305	55	adaptor	adaptor	NN
cord-252671-uf96jgig	305	56	molecule	molecule	NN
cord-252671-uf96jgig	306	1	The	the	DT
cord-252671-uf96jgig	306	2	poxvirus	poxvirus	NNP
cord-252671-uf96jgig	306	3	protein	protein	NN
cord-252671-uf96jgig	306	4	A52R	A52R	NNP
cord-252671-uf96jgig	306	5	targets	target	NNS
cord-252671-uf96jgig	307	1	Toll	toll	NN
cord-252671-uf96jgig	307	2	-	-	HYPH
cord-252671-uf96jgig	307	3	like	like	JJ
cord-252671-uf96jgig	307	4	receptor	receptor	NN
cord-252671-uf96jgig	307	5	signaling	signal	VBG
cord-252671-uf96jgig	307	6	complexes	complex	NNS
cord-252671-uf96jgig	307	7	to	to	TO
cord-252671-uf96jgig	307	8	suppress	suppress	VB
cord-252671-uf96jgig	307	9	host	host	NN
cord-252671-uf96jgig	307	10	defense	defense	NN
cord-252671-uf96jgig	307	11	A46R	A46R	NNS
cord-252671-uf96jgig	307	12	and	and	CC
cord-252671-uf96jgig	307	13	A52R	a52r	NN
cord-252671-uf96jgig	307	14	from	from	IN
cord-252671-uf96jgig	307	15	vaccinia	vaccinia	NN
cord-252671-uf96jgig	307	16	virus	virus	NN
cord-252671-uf96jgig	307	17	are	be	VBP
cord-252671-uf96jgig	307	18	antagonists	antagonist	NNS
cord-252671-uf96jgig	307	19	of	of	IN
cord-252671-uf96jgig	307	20	host	host	NN
cord-252671-uf96jgig	307	21	IL-1	IL-1	NNP
cord-252671-uf96jgig	307	22	and	and	CC
cord-252671-uf96jgig	307	23	Toll	Toll	NNP
cord-252671-uf96jgig	307	24	-	-	HYPH
cord-252671-uf96jgig	307	25	like	like	JJ
cord-252671-uf96jgig	307	26	receptor	receptor	NN
cord-252671-uf96jgig	307	27	signaling	signal	VBG
cord-252671-uf96jgig	307	28	Poxvirus	Poxvirus	NNP
cord-252671-uf96jgig	307	29	protein	protein	NN
cord-252671-uf96jgig	307	30	N1L	n1l	NN
cord-252671-uf96jgig	307	31	targets	target	VBZ
cord-252671-uf96jgig	307	32	the	the	DT
cord-252671-uf96jgig	307	33	I	I	NNP
cord-252671-uf96jgig	307	34	-	-	HYPH
cord-252671-uf96jgig	307	35	kappaB	kappaB	NNP
cord-252671-uf96jgig	307	36	kinase	kinase	NN
cord-252671-uf96jgig	307	37	complex	complex	NN
cord-252671-uf96jgig	307	38	,	,	,
cord-252671-uf96jgig	307	39	inhibits	inhibit	VBZ
cord-252671-uf96jgig	307	40	signaling	signal	VBG
cord-252671-uf96jgig	307	41	to	to	IN
cord-252671-uf96jgig	307	42	NF	NF	NNP
cord-252671-uf96jgig	307	43	-	-	HYPH
cord-252671-uf96jgig	307	44	kappaB	kappaB	NNP
cord-252671-uf96jgig	307	45	by	by	IN
cord-252671-uf96jgig	307	46	the	the	DT
cord-252671-uf96jgig	307	47	tumor	tumor	NN
cord-252671-uf96jgig	307	48	necrosis	necrosis	NN
cord-252671-uf96jgig	307	49	factor	factor	NN
cord-252671-uf96jgig	307	50	superfamily	superfamily	NN
cord-252671-uf96jgig	307	51	of	of	IN
cord-252671-uf96jgig	307	52	receptors	receptor	NNS
cord-252671-uf96jgig	307	53	,	,	,
cord-252671-uf96jgig	307	54	and	and	CC
cord-252671-uf96jgig	307	55	inhibits	inhibit	VBZ
cord-252671-uf96jgig	307	56	NF	nf	NN
cord-252671-uf96jgig	307	57	-	-	HYPH
cord-252671-uf96jgig	307	58	kappaB	kappaB	NNP
cord-252671-uf96jgig	307	59	and	and	CC
cord-252671-uf96jgig	307	60	IRF3	IRF3	NNP
cord-252671-uf96jgig	307	61	signaling	signal	VBG
cord-252671-uf96jgig	307	62	by	by	IN
cord-252671-uf96jgig	307	63	Toll	toll	NN
cord-252671-uf96jgig	307	64	-	-	HYPH
cord-252671-uf96jgig	307	65	like	like	JJ
cord-252671-uf96jgig	307	66	receptors	receptor	NNS
cord-252671-uf96jgig	307	67	Inhibition	inhibition	NN
cord-252671-uf96jgig	307	68	of	of	IN
cord-252671-uf96jgig	307	69	retinoic	retinoic	JJ
cord-252671-uf96jgig	307	70	acid	acid	NN
cord-252671-uf96jgig	307	71	-	-	HYPH
cord-252671-uf96jgig	307	72	inducible	inducible	JJ
cord-252671-uf96jgig	307	73	gene	gene	NN
cord-252671-uf96jgig	307	74	I	i	NN
cord-252671-uf96jgig	307	75	-	-	HYPH
cord-252671-uf96jgig	307	76	mediated	mediate	VBN
cord-252671-uf96jgig	307	77	induction	induction	NN
cord-252671-uf96jgig	307	78	of	of	IN
cord-252671-uf96jgig	307	79	beta	beta	NN
cord-252671-uf96jgig	307	80	interferon	interferon	NN
cord-252671-uf96jgig	307	81	by	by	IN
cord-252671-uf96jgig	307	82	the	the	DT
cord-252671-uf96jgig	307	83	NS1	ns1	NN
cord-252671-uf96jgig	307	84	protein	protein	NN
cord-252671-uf96jgig	307	85	of	of	IN
cord-252671-uf96jgig	307	86	influenza	influenza	NN
cord-252671-uf96jgig	307	87	A	a	DT
cord-252671-uf96jgig	307	88	virus	virus	NN
cord-252671-uf96jgig	307	89	Influenza	influenza	NN
cord-252671-uf96jgig	307	90	C	C	NNP
cord-252671-uf96jgig	307	91	virus	virus	NN
cord-252671-uf96jgig	307	92	NS1	ns1	NN
cord-252671-uf96jgig	307	93	protein	protein	NN
cord-252671-uf96jgig	308	1	counteracts	counteract	VBZ
cord-252671-uf96jgig	308	2	RIG	rig	NN
cord-252671-uf96jgig	308	3	-	-	HYPH
cord-252671-uf96jgig	308	4	I	i	NN
cord-252671-uf96jgig	308	5	-	-	HYPH
cord-252671-uf96jgig	308	6	mediated	mediate	VBN
cord-252671-uf96jgig	308	7	IFN	IFN	NNP
cord-252671-uf96jgig	308	8	signalling	signal	VBG
cord-252671-uf96jgig	308	9	The	the	DT
cord-252671-uf96jgig	308	10	V	v	NN
cord-252671-uf96jgig	308	11	proteins	protein	NNS
cord-252671-uf96jgig	308	12	of	of	IN
cord-252671-uf96jgig	308	13	paramyxoviruses	paramyxovirus	NNS
cord-252671-uf96jgig	308	14	bind	bind	VBP
cord-252671-uf96jgig	308	15	the	the	DT
cord-252671-uf96jgig	308	16	IFNinducible	IFNinducible	NNP
cord-252671-uf96jgig	308	17	RNA	RNA	NNP
cord-252671-uf96jgig	308	18	helicase	helicase	NN
cord-252671-uf96jgig	308	19	,	,	,
cord-252671-uf96jgig	308	20	mda-5	mda-5	NNP
cord-252671-uf96jgig	308	21	,	,	,
cord-252671-uf96jgig	308	22	and	and	CC
cord-252671-uf96jgig	308	23	inhibit	inhibit	VB
cord-252671-uf96jgig	308	24	its	-PRON-	PRP$
cord-252671-uf96jgig	308	25	activation	activation	NN
cord-252671-uf96jgig	308	26	of	of	IN
cord-252671-uf96jgig	308	27	the	the	DT
cord-252671-uf96jgig	308	28	IFN	IFN	NNP
cord-252671-uf96jgig	308	29	-	-	HYPH
cord-252671-uf96jgig	308	30	beta	beta	NN
cord-252671-uf96jgig	308	31	promoter	promoter	NN
cord-252671-uf96jgig	308	32	Inhibition	inhibition	NN
cord-252671-uf96jgig	308	33	of	of	IN
cord-252671-uf96jgig	308	34	interferon	interferon	NN
cord-252671-uf96jgig	308	35	regulatory	regulatory	JJ
cord-252671-uf96jgig	308	36	factor	factor	NN
cord-252671-uf96jgig	308	37	3	3	CD
cord-252671-uf96jgig	308	38	activation	activation	NN
cord-252671-uf96jgig	308	39	by	by	IN
cord-252671-uf96jgig	308	40	paramyxovirus	paramyxovirus	NNP
cord-252671-uf96jgig	308	41	V	V	NNP
cord-252671-uf96jgig	308	42	protein	protein	NN
cord-252671-uf96jgig	308	43	Murine	murine	JJ
cord-252671-uf96jgig	308	44	retroviruses	retrovirus	NNS
cord-252671-uf96jgig	308	45	activate	activate	VBP
cord-252671-uf96jgig	308	46	B	b	NN
cord-252671-uf96jgig	308	47	cells	cell	NNS
cord-252671-uf96jgig	308	48	via	via	IN
cord-252671-uf96jgig	308	49	interaction	interaction	NN
cord-252671-uf96jgig	308	50	with	with	IN
cord-252671-uf96jgig	308	51	Toll	Toll	NNP
cord-252671-uf96jgig	308	52	-	-	HYPH
cord-252671-uf96jgig	308	53	like	like	JJ
cord-252671-uf96jgig	308	54	receptor	receptor	NN
cord-252671-uf96jgig	308	55	4	4	CD
cord-252671-uf96jgig	308	56	Pattern	pattern	NN
cord-252671-uf96jgig	308	57	recognition	recognition	NN
cord-252671-uf96jgig	308	58	receptors	receptor	NNS
cord-252671-uf96jgig	308	59	TLR4	TLR4	NNP
cord-252671-uf96jgig	308	60	and	and	CC
cord-252671-uf96jgig	308	61	CD14	CD14	NNP
cord-252671-uf96jgig	309	1	mediate	mediate	VB
cord-252671-uf96jgig	309	2	response	response	NN
cord-252671-uf96jgig	309	3	to	to	IN
cord-252671-uf96jgig	309	4	respiratory	respiratory	JJ
cord-252671-uf96jgig	309	5	syncytial	syncytial	JJ
cord-252671-uf96jgig	309	6	virus	virus	NN
cord-252671-uf96jgig	309	7	Reading	read	VBG
cord-252671-uf96jgig	309	8	the	the	DT
cord-252671-uf96jgig	309	9	viral	viral	JJ
cord-252671-uf96jgig	309	10	signature	signature	NN
cord-252671-uf96jgig	309	11	by	by	IN
cord-252671-uf96jgig	309	12	Toll	toll	NN
cord-252671-uf96jgig	309	13	-	-	HYPH
cord-252671-uf96jgig	309	14	like	like	JJ
cord-252671-uf96jgig	309	15	receptors	receptor	NNS
cord-252671-uf96jgig	309	16	and	and	CC
cord-252671-uf96jgig	309	17	other	other	JJ
cord-252671-uf96jgig	309	18	pattern	pattern	NN
cord-252671-uf96jgig	309	19	recognition	recognition	NN
cord-252671-uf96jgig	309	20	receptors	receptor	NNS
cord-252671-uf96jgig	310	1	Small	small	JJ
cord-252671-uf96jgig	310	2	interfering	interfere	VBG
cord-252671-uf96jgig	310	3	RNA	RNA	NNP
cord-252671-uf96jgig	310	4	effectively	effectively	RB
cord-252671-uf96jgig	310	5	inhibits	inhibit	VBZ
cord-252671-uf96jgig	310	6	the	the	DT
cord-252671-uf96jgig	310	7	expression	expression	NN
cord-252671-uf96jgig	310	8	of	of	IN
cord-252671-uf96jgig	310	9	SARS	SARS	NNP
cord-252671-uf96jgig	310	10	coronavirus	coronavirus	NN
cord-252671-uf96jgig	310	11	membrane	membrane	NN
cord-252671-uf96jgig	310	12	gene	gene	NN
cord-252671-uf96jgig	310	13	at	at	IN
cord-252671-uf96jgig	310	14	two	two	CD
cord-252671-uf96jgig	310	15	novel	novel	NN
cord-252671-uf96jgig	310	16	targeting	targeting	NN
cord-252671-uf96jgig	310	17	sites	site	NNS
cord-252671-uf96jgig	311	1	The	the	DT
cord-252671-uf96jgig	311	2	family	family	NN
cord-252671-uf96jgig	311	3	of	of	IN
cord-252671-uf96jgig	311	4	five	five	CD
cord-252671-uf96jgig	311	5	:	:	:
cord-252671-uf96jgig	311	6	TIR	tir	NN
cord-252671-uf96jgig	311	7	-	-	HYPH
cord-252671-uf96jgig	311	8	domain	domain	NN
cord-252671-uf96jgig	311	9	-	-	HYPH
cord-252671-uf96jgig	311	10	containing	contain	VBG
cord-252671-uf96jgig	311	11	adaptors	adaptor	NNS
cord-252671-uf96jgig	311	12	in	in	IN
cord-252671-uf96jgig	311	13	Toll	Toll	NNP
cord-252671-uf96jgig	311	14	-	-	HYPH
cord-252671-uf96jgig	311	15	like	like	JJ
cord-252671-uf96jgig	311	16	receptor	receptor	NN
cord-252671-uf96jgig	311	17	signalling	signal	VBG
cord-252671-uf96jgig	311	18	TRAF	TRAF	NNP
cord-252671-uf96jgig	311	19	molecules	molecule	NNS
cord-252671-uf96jgig	311	20	in	in	IN
cord-252671-uf96jgig	311	21	cell	cell	NN
cord-252671-uf96jgig	311	22	signaling	signaling	NN
cord-252671-uf96jgig	311	23	and	and	CC
cord-252671-uf96jgig	311	24	in	in	IN
cord-252671-uf96jgig	311	25	human	human	JJ
cord-252671-uf96jgig	311	26	diseases	disease	NNS
cord-252671-uf96jgig	311	27	Expanding	expand	VBG
cord-252671-uf96jgig	311	28	TRAF	TRAF	NNP
cord-252671-uf96jgig	311	29	function	function	NN
cord-252671-uf96jgig	311	30	:	:	:
cord-252671-uf96jgig	311	31	TRAF3	traf3	NN
cord-252671-uf96jgig	311	32	as	as	IN
cord-252671-uf96jgig	311	33	a	a	DT
cord-252671-uf96jgig	311	34	tri	tri	JJ
cord-252671-uf96jgig	311	35	-	-	JJ
cord-252671-uf96jgig	311	36	faced	faced	JJ
cord-252671-uf96jgig	311	37	immune	immune	JJ
cord-252671-uf96jgig	311	38	regulator	regulator	NN
cord-252671-uf96jgig	311	39	Tumoricidal	Tumoricidal	NNP
cord-252671-uf96jgig	311	40	alveolar	alveolar	JJ
cord-252671-uf96jgig	311	41	macrophage	macrophage	NN
cord-252671-uf96jgig	311	42	and	and	CC
cord-252671-uf96jgig	311	43	tumor	tumor	NN
cord-252671-uf96jgig	311	44	infiltrating	infiltrate	VBG
cord-252671-uf96jgig	311	45	macrophage	macrophage	NN
cord-252671-uf96jgig	311	46	cell	cell	NN
cord-252671-uf96jgig	311	47	lines	line	NNS
cord-252671-uf96jgig	311	48	Interaction	Interaction	NNP
cord-252671-uf96jgig	311	49	between	between	IN
cord-252671-uf96jgig	311	50	Raf	Raf	NNP
cord-252671-uf96jgig	311	51	and	and	CC
cord-252671-uf96jgig	311	52	Myc	Myc	NNP
cord-252671-uf96jgig	311	53	oncogenes	oncogene	NNS
cord-252671-uf96jgig	311	54	in	in	IN
cord-252671-uf96jgig	311	55	transformation	transformation	NN
cord-252671-uf96jgig	311	56	in	in	IN
cord-252671-uf96jgig	311	57	vivo	vivo	NN
cord-252671-uf96jgig	311	58	and	and	CC
cord-252671-uf96jgig	311	59	in	in	IN
cord-252671-uf96jgig	311	60	vitro	vitro	FW
cord-252671-uf96jgig	311	61	Oxidized	oxidize	VBN
cord-252671-uf96jgig	311	62	phospholipid	phospholipid	NN
cord-252671-uf96jgig	311	63	inhibition	inhibition	NN
cord-252671-uf96jgig	311	64	of	of	IN
cord-252671-uf96jgig	311	65	Toll	Toll	NNP
cord-252671-uf96jgig	311	66	-	-	HYPH
cord-252671-uf96jgig	311	67	like	like	JJ
cord-252671-uf96jgig	311	68	receptor	receptor	NN
cord-252671-uf96jgig	311	69	(	(	-LRB-
cord-252671-uf96jgig	311	70	TLR	TLR	NNP
cord-252671-uf96jgig	311	71	)	)	-RRB-
cord-252671-uf96jgig	312	1	signaling	signal	VBG
cord-252671-uf96jgig	312	2	is	be	VBZ
cord-252671-uf96jgig	312	3	restricted	restrict	VBN
cord-252671-uf96jgig	312	4	to	to	IN
cord-252671-uf96jgig	312	5	TLR2	TLR2	NNP
cord-252671-uf96jgig	312	6	and	and	CC
cord-252671-uf96jgig	312	7	TLR4	TLR4	NNP
cord-252671-uf96jgig	312	8	:	:	:
cord-252671-uf96jgig	312	9	roles	role	NNS
cord-252671-uf96jgig	312	10	for	for	IN
cord-252671-uf96jgig	312	11	CD14	CD14	NNP
cord-252671-uf96jgig	312	12	,	,	,
cord-252671-uf96jgig	312	13	LPS	LPS	NNP
cord-252671-uf96jgig	312	14	-	-	HYPH
cord-252671-uf96jgig	312	15	binding	bind	VBG
cord-252671-uf96jgig	312	16	protein	protein	NN
cord-252671-uf96jgig	312	17	,	,	,
cord-252671-uf96jgig	312	18	and	and	CC
cord-252671-uf96jgig	312	19	MD2	MD2	NNP
cord-252671-uf96jgig	313	1	as	as	IN
cord-252671-uf96jgig	313	2	targets	target	NNS
cord-252671-uf96jgig	313	3	for	for	IN
cord-252671-uf96jgig	313	4	specificity	specificity	NN
cord-252671-uf96jgig	313	5	of	of	IN
cord-252671-uf96jgig	313	6	inhibition	inhibition	NN
cord-252671-uf96jgig	313	7	Assembly	assembly	NN
cord-252671-uf96jgig	313	8	and	and	CC
cord-252671-uf96jgig	313	9	localization	localization	NN
cord-252671-uf96jgig	313	10	of	of	IN
cord-252671-uf96jgig	313	11	Toll	Toll	NNP
cord-252671-uf96jgig	313	12	-	-	HYPH
cord-252671-uf96jgig	313	13	like	like	JJ
cord-252671-uf96jgig	313	14	receptor	receptor	NN
cord-252671-uf96jgig	313	15	signalling	signal	VBG
cord-252671-uf96jgig	313	16	complexes	complex	NNS
cord-252671-uf96jgig	314	1	Severe	severe	JJ
cord-252671-uf96jgig	314	2	acute	acute	JJ
cord-252671-uf96jgig	314	3	respiratory	respiratory	JJ
cord-252671-uf96jgig	314	4	syndrome	syndrome	NN
cord-252671-uf96jgig	314	5	coronavirus	coronavirus	NN
cord-252671-uf96jgig	314	6	M	M	NNP
cord-252671-uf96jgig	314	7	protein	protein	NN
cord-252671-uf96jgig	314	8	inhibits	inhibit	VBZ
cord-252671-uf96jgig	314	9	type	type	NN
cord-252671-uf96jgig	315	1	I	-PRON-	PRP
cord-252671-uf96jgig	316	1	interferon	interferon	NN
cord-252671-uf96jgig	316	2	production	production	NN
cord-252671-uf96jgig	316	3	by	by	IN
cord-252671-uf96jgig	316	4	impeding	impede	VBG
cord-252671-uf96jgig	316	5	the	the	DT
cord-252671-uf96jgig	316	6	formation	formation	NN
cord-252671-uf96jgig	316	7	of	of	IN
cord-252671-uf96jgig	316	8	TRAF3.TANK.TBK1	TRAF3.TANK.TBK1	NNP
cord-252671-uf96jgig	316	9	/	/	SYM
cord-252671-uf96jgig	316	10	IKKepsilon	IKKepsilon	NNP
cord-252671-uf96jgig	316	11	complex	complex	JJ
cord-252671-uf96jgig	316	12	Generation	generation	NN
cord-252671-uf96jgig	316	13	of	of	IN
cord-252671-uf96jgig	316	14	synthetic	synthetic	JJ
cord-252671-uf96jgig	316	15	severe	severe	JJ
cord-252671-uf96jgig	316	16	acute	acute	JJ
cord-252671-uf96jgig	316	17	respiratory	respiratory	JJ
cord-252671-uf96jgig	316	18	syndrome	syndrome	NN
cord-252671-uf96jgig	316	19	coronavirus	coronavirus	NN
cord-252671-uf96jgig	316	20	pseudoparticles	pseudoparticle	NNS
cord-252671-uf96jgig	316	21	:	:	:
cord-252671-uf96jgig	316	22	implications	implication	NNS
cord-252671-uf96jgig	316	23	for	for	IN
cord-252671-uf96jgig	316	24	assembly	assembly	NN
cord-252671-uf96jgig	316	25	and	and	CC
cord-252671-uf96jgig	316	26	vaccine	vaccine	NN
cord-252671-uf96jgig	316	27	production	production	NN
cord-252671-uf96jgig	316	28	Pattern	Pattern	NNP
cord-252671-uf96jgig	316	29	recognition	recognition	NN
cord-252671-uf96jgig	316	30	receptors	receptor	NNS
cord-252671-uf96jgig	316	31	and	and	CC
cord-252671-uf96jgig	316	32	inflammation	inflammation	NN
cord-252671-uf96jgig	316	33	Pathogen	Pathogen	NNP
cord-252671-uf96jgig	316	34	recognition	recognition	NN
cord-252671-uf96jgig	316	35	by	by	IN
cord-252671-uf96jgig	316	36	the	the	DT
cord-252671-uf96jgig	316	37	innate	innate	JJ
cord-252671-uf96jgig	316	38	immune	immune	JJ
cord-252671-uf96jgig	316	39	system	system	NN
cord-252671-uf96jgig	316	40	Recognition	Recognition	NNP
cord-252671-uf96jgig	316	41	of	of	IN
cord-252671-uf96jgig	316	42	the	the	DT
cord-252671-uf96jgig	316	43	measles	measles	NNP
cord-252671-uf96jgig	316	44	virus	virus	NN
cord-252671-uf96jgig	316	45	nucleocapsid	nucleocapsid	NN
cord-252671-uf96jgig	316	46	as	as	IN
cord-252671-uf96jgig	316	47	a	a	DT
cord-252671-uf96jgig	316	48	mechanism	mechanism	NN
cord-252671-uf96jgig	316	49	of	of	IN
cord-252671-uf96jgig	316	50	IRF-3	IRF-3	NNP
cord-252671-uf96jgig	316	51	activation	activation	NN
cord-252671-uf96jgig	316	52	Activation	Activation	NNP
cord-252671-uf96jgig	316	53	of	of	IN
cord-252671-uf96jgig	316	54	TBK1	TBK1	NNP
cord-252671-uf96jgig	316	55	and	and	CC
cord-252671-uf96jgig	316	56	IKKvarepsilon	IKKvarepsilon	NNP
cord-252671-uf96jgig	316	57	kinases	kinase	NNS
cord-252671-uf96jgig	316	58	by	by	IN
cord-252671-uf96jgig	316	59	vesicular	vesicular	JJ
cord-252671-uf96jgig	316	60	stomatitis	stomatitis	NN
cord-252671-uf96jgig	316	61	virus	virus	NN
cord-252671-uf96jgig	316	62	infection	infection	NN
cord-252671-uf96jgig	316	63	and	and	CC
cord-252671-uf96jgig	316	64	the	the	DT
cord-252671-uf96jgig	316	65	role	role	NN
cord-252671-uf96jgig	316	66	of	of	IN
cord-252671-uf96jgig	316	67	viral	viral	JJ
cord-252671-uf96jgig	316	68	ribonucleoprotein	ribonucleoprotein	NN
cord-252671-uf96jgig	316	69	in	in	IN
cord-252671-uf96jgig	316	70	the	the	DT
cord-252671-uf96jgig	316	71	development	development	NN
cord-252671-uf96jgig	316	72	of	of	IN
cord-252671-uf96jgig	316	73	interferon	interferon	NN
cord-252671-uf96jgig	316	74	antiviral	antiviral	JJ
cord-252671-uf96jgig	316	75	immunity	immunity	NN
cord-252671-uf96jgig	316	76	Self	Self	NNP
cord-252671-uf96jgig	316	77	-	-	HYPH
cord-252671-uf96jgig	316	78	assembly	assembly	NN
cord-252671-uf96jgig	316	79	of	of	IN
cord-252671-uf96jgig	316	80	severe	severe	JJ
cord-252671-uf96jgig	316	81	acute	acute	JJ
cord-252671-uf96jgig	316	82	respiratory	respiratory	JJ
cord-252671-uf96jgig	316	83	syndrome	syndrome	NN
cord-252671-uf96jgig	316	84	coronavirus	coronavirus	NN
cord-252671-uf96jgig	316	85	membrane	membrane	NN
cord-252671-uf96jgig	316	86	protein	protein	NN
cord-252671-uf96jgig	317	1	The	the	DT
cord-252671-uf96jgig	317	2	SARS	SARS	NNP
cord-252671-uf96jgig	317	3	-	-	HYPH
cord-252671-uf96jgig	317	4	coronavirus	coronavirus	NN
cord-252671-uf96jgig	317	5	membrane	membrane	NN
cord-252671-uf96jgig	317	6	protein	protein	NN
cord-252671-uf96jgig	317	7	induces	induce	VBZ
cord-252671-uf96jgig	317	8	apoptosis	apoptosis	NN
cord-252671-uf96jgig	317	9	through	through	IN
cord-252671-uf96jgig	317	10	modulating	modulate	VBG
cord-252671-uf96jgig	317	11	the	the	DT
cord-252671-uf96jgig	317	12	Akt	Akt	NNP
cord-252671-uf96jgig	317	13	survival	survival	NN
cord-252671-uf96jgig	317	14	pathway	pathway	NN
cord-252671-uf96jgig	318	1	The	the	DT
cord-252671-uf96jgig	318	2	membrane	membrane	NN
cord-252671-uf96jgig	318	3	protein	protein	NN
cord-252671-uf96jgig	318	4	of	of	IN
cord-252671-uf96jgig	318	5	SARS	SARS	NNP
cord-252671-uf96jgig	318	6	-	-	HYPH
cord-252671-uf96jgig	318	7	CoV	CoV	NNP
cord-252671-uf96jgig	318	8	suppresses	suppress	VBZ
cord-252671-uf96jgig	318	9	NF	NF	NNP
cord-252671-uf96jgig	318	10	-	-	HYPH
cord-252671-uf96jgig	318	11	kappaB	kappaB	NNP
cord-252671-uf96jgig	318	12	activation	activation	NN
cord-252671-uf96jgig	319	1	The	the	DT
cord-252671-uf96jgig	319	2	M	M	NNP
cord-252671-uf96jgig	319	3	protein	protein	NN
cord-252671-uf96jgig	319	4	of	of	IN
cord-252671-uf96jgig	319	5	SARS	SARS	NNP
cord-252671-uf96jgig	319	6	-	-	HYPH
cord-252671-uf96jgig	319	7	CoV	CoV	NNP
cord-252671-uf96jgig	319	8	:	:	:
cord-252671-uf96jgig	319	9	basic	basic	JJ
cord-252671-uf96jgig	319	10	structural	structural	JJ
cord-252671-uf96jgig	319	11	and	and	CC
cord-252671-uf96jgig	319	12	immunological	immunological	JJ
cord-252671-uf96jgig	319	13	properties	property	NNS
cord-252671-uf96jgig	319	14	Persistent	persistent	JJ
cord-252671-uf96jgig	319	15	replication	replication	NN
cord-252671-uf96jgig	319	16	of	of	IN
cord-252671-uf96jgig	319	17	severe	severe	JJ
cord-252671-uf96jgig	319	18	acute	acute	JJ
cord-252671-uf96jgig	319	19	respiratory	respiratory	JJ
cord-252671-uf96jgig	319	20	syndrome	syndrome	NN
cord-252671-uf96jgig	319	21	coronavirus	coronavirus	NN
cord-252671-uf96jgig	319	22	in	in	IN
cord-252671-uf96jgig	319	23	human	human	JJ
cord-252671-uf96jgig	319	24	tubular	tubular	JJ
cord-252671-uf96jgig	319	25	kidney	kidney	NN
cord-252671-uf96jgig	319	26	cells	cell	NNS
cord-252671-uf96jgig	319	27	selects	select	VBZ
cord-252671-uf96jgig	319	28	for	for	IN
cord-252671-uf96jgig	319	29	adaptive	adaptive	JJ
cord-252671-uf96jgig	319	30	mutations	mutation	NNS
cord-252671-uf96jgig	319	31	in	in	IN
cord-252671-uf96jgig	319	32	the	the	DT
cord-252671-uf96jgig	319	33	membrane	membrane	NN
cord-252671-uf96jgig	319	34	protein	protein	NN
cord-252671-uf96jgig	320	1	The	the	DT
cord-252671-uf96jgig	320	2	orphan	orphan	NN
cord-252671-uf96jgig	320	3	nuclear	nuclear	JJ
cord-252671-uf96jgig	320	4	receptor	receptor	NN
cord-252671-uf96jgig	321	1	TR3	TR3	NNP
cord-252671-uf96jgig	321	2	/	/	SYM
cord-252671-uf96jgig	321	3	Nur77	Nur77	NNP
cord-252671-uf96jgig	321	4	regulates	regulate	VBZ
cord-252671-uf96jgig	321	5	ER	ER	NNP
cord-252671-uf96jgig	321	6	stress	stress	NN
cord-252671-uf96jgig	321	7	and	and	CC
cord-252671-uf96jgig	321	8	induces	induce	VBZ
cord-252671-uf96jgig	321	9	apoptosis	apoptosis	NN
cord-252671-uf96jgig	321	10	via	via	IN
cord-252671-uf96jgig	321	11	interaction	interaction	NN
cord-252671-uf96jgig	321	12	with	with	IN
cord-252671-uf96jgig	321	13	TRAP	trap	NN
cord-252671-uf96jgig	322	1	␥	␥	XX
cord-252671-uf96jgig	323	1	We	-PRON-	PRP
cord-252671-uf96jgig	323	2	thank	thank	VBP
cord-252671-uf96jgig	323	3	Genhong	Genhong	NNP
cord-252671-uf96jgig	323	4	Cheng	Cheng	NNP
cord-252671-uf96jgig	323	5	and	and	CC
cord-252671-uf96jgig	323	6	Hang	Hang	NNP
cord-252671-uf96jgig	323	7	-	-	HYPH
cord-252671-uf96jgig	323	8	Zi	Zi	NNP
cord-252671-uf96jgig	323	9	Chen	Chen	NNP
cord-252671-uf96jgig	323	10	for	for	IN
cord-252671-uf96jgig	323	11	providing	provide	VBG
cord-252671-uf96jgig	323	12	the	the	DT
cord-252671-uf96jgig	323	13	J2-M	j2-m	NN
cord-252671-uf96jgig	323	14	cells	cell	NNS
cord-252671-uf96jgig	323	15	and	and	CC
cord-252671-uf96jgig	323	16	TRAP	trap	NN
cord-252671-uf96jgig	323	17	␥	␥	XX
cord-252671-uf96jgig	323	18	,	,	,
cord-252671-uf96jgig	323	19	respectively	respectively	RB
cord-252671-uf96jgig	323	20	.	.	.
cord-252671-uf96jgig	323	21	 	 	_SP
cord-252671-uf96jgig	324	1	Western	western	JJ
cord-252671-uf96jgig	324	2	blot	blot	NN
cord-252671-uf96jgig	324	3	analysis	analysis	NN
cord-252671-uf96jgig	324	4	.	.	.
cord-252671-uf96jgig	325	1	The	the	DT
cord-252671-uf96jgig	325	2	transfected	transfecte	VBN
cord-252671-uf96jgig	325	3	cells	cell	NNS
cord-252671-uf96jgig	325	4	were	be	VBD
cord-252671-uf96jgig	325	5	lysed	lyse	VBN
cord-252671-uf96jgig	325	6	with	with	IN
cord-252671-uf96jgig	325	7	a	a	DT
cord-252671-uf96jgig	325	8	lysis	lysis	NN
cord-252671-uf96jgig	325	9	buffer	buffer	NN
cord-252671-uf96jgig	325	10	containing	contain	VBG
cord-252671-uf96jgig	325	11	1	1	CD
cord-252671-uf96jgig	325	12	%	%	NN
cord-252671-uf96jgig	325	13	NP-40	NP-40	NNP
cord-252671-uf96jgig	325	14	,	,	,
cord-252671-uf96jgig	325	15	50	50	CD
cord-252671-uf96jgig	325	16	mM	mm	CD
cord-252671-uf96jgig	325	17	Tris	Tris	NNP
cord-252671-uf96jgig	325	18	-	-	HYPH
cord-252671-uf96jgig	325	19	HCl	HCl	NNP
cord-252671-uf96jgig	325	20	(	(	-LRB-
cord-252671-uf96jgig	325	21	pH	pH	NNP
cord-252671-uf96jgig	325	22	7.5	7.5	CD
cord-252671-uf96jgig	325	23	)	)	-RRB-
cord-252671-uf96jgig	325	24	,	,	,
cord-252671-uf96jgig	325	25	120	120	CD
cord-252671-uf96jgig	325	26	mM	mm	CD
cord-252671-uf96jgig	325	27	NaCl	nacl	NN
cord-252671-uf96jgig	325	28	,	,	,
cord-252671-uf96jgig	326	1	200	200	CD
cord-252671-uf96jgig	326	2	M	m	NN
cord-252671-uf96jgig	326	3	NaVO	NaVO	NNP
cord-252671-uf96jgig	326	4	4	4	CD
cord-252671-uf96jgig	326	5	,	,	,
cord-252671-uf96jgig	326	6	1	1	CD
cord-252671-uf96jgig	326	7	g	g	NN
cord-252671-uf96jgig	326	8	/	/	SYM
cord-252671-uf96jgig	326	9	ml	ml	NN
cord-252671-uf96jgig	326	10	leupeptin	leupeptin	NNP
cord-252671-uf96jgig	326	11	,	,	,
cord-252671-uf96jgig	326	12	1	1	CD
cord-252671-uf96jgig	326	13	g	g	NN
cord-252671-uf96jgig	326	14	/	/	SYM
cord-252671-uf96jgig	326	15	ml	ml	NNP
cord-252671-uf96jgig	326	16	aprotinin	aprotinin	NNP
cord-252671-uf96jgig	326	17	,	,	,
cord-252671-uf96jgig	326	18	and	and	CC
cord-252671-uf96jgig	326	19	1	1	CD
cord-252671-uf96jgig	326	20	M	m	NN
cord-252671-uf96jgig	326	21	phenylmethylsulfonyl	phenylmethylsulfonyl	NN
cord-252671-uf96jgig	326	22	fluoride	fluoride	NN
cord-252671-uf96jgig	326	23	(	(	-LRB-
cord-252671-uf96jgig	326	24	PMSF	PMSF	NNP
cord-252671-uf96jgig	326	25	)	)	-RRB-
cord-252671-uf96jgig	326	26	.	.	.
cord-252671-uf96jgig	327	1	About	about	RB
cord-252671-uf96jgig	327	2	15	15	CD
cord-252671-uf96jgig	327	3	g	g	NN
cord-252671-uf96jgig	327	4	of	of	IN
cord-252671-uf96jgig	327	5	cell	cell	NN
cord-252671-uf96jgig	327	6	lysate	lysate	NN
cord-252671-uf96jgig	327	7	for	for	IN
cord-252671-uf96jgig	327	8	each	each	DT
cord-252671-uf96jgig	327	9	sample	sample	NN
cord-252671-uf96jgig	327	10	was	be	VBD
cord-252671-uf96jgig	327	11	resolved	resolve	VBN
cord-252671-uf96jgig	327	12	by	by	IN
cord-252671-uf96jgig	327	13	12	12	CD
cord-252671-uf96jgig	327	14	%	%	NN
cord-252671-uf96jgig	327	15	SDS	sds	NN
cord-252671-uf96jgig	327	16	-	-	HYPH
cord-252671-uf96jgig	327	17	PAGE	PAGE	NNP
cord-252671-uf96jgig	327	18	.	.	.
cord-252671-uf96jgig	328	1	After	after	IN
cord-252671-uf96jgig	328	2	separation	separation	NN
cord-252671-uf96jgig	328	3	,	,	,
cord-252671-uf96jgig	328	4	the	the	DT
cord-252671-uf96jgig	328	5	reaction	reaction	NN
cord-252671-uf96jgig	328	6	products	product	NNS
cord-252671-uf96jgig	328	7	were	be	VBD
cord-252671-uf96jgig	328	8	transferred	transfer	VBN
cord-252671-uf96jgig	328	9	onto	onto	IN
cord-252671-uf96jgig	328	10	a	a	DT
cord-252671-uf96jgig	328	11	Hybond	Hybond	NNP
cord-252671-uf96jgig	328	12	nitrocellulose	nitrocellulose	NN
cord-252671-uf96jgig	328	13	membrane	membrane	NN
cord-252671-uf96jgig	328	14	(	(	-LRB-
cord-252671-uf96jgig	328	15	Pharmacia	Pharmacia	NNP
cord-252671-uf96jgig	328	16	,	,	,
cord-252671-uf96jgig	328	17	St.	St.	NNP
cord-252671-uf96jgig	328	18	Louis	Louis	NNP
cord-252671-uf96jgig	328	19	,	,	,
cord-252671-uf96jgig	328	20	MO	MO	NNP
cord-252671-uf96jgig	328	21	,	,	,
cord-252671-uf96jgig	328	22	USA	USA	NNP
cord-252671-uf96jgig	328	23	)	)	-RRB-
cord-252671-uf96jgig	328	24	.	.	.
cord-252671-uf96jgig	329	1	The	the	DT
cord-252671-uf96jgig	329	2	transferred	transfer	VBN
cord-252671-uf96jgig	329	3	membrane	membrane	NN
cord-252671-uf96jgig	329	4	was	be	VBD
cord-252671-uf96jgig	329	5	first	first	RB
cord-252671-uf96jgig	329	6	probed	probe	VBN
cord-252671-uf96jgig	329	7	with	with	IN
cord-252671-uf96jgig	329	8	a	a	DT
cord-252671-uf96jgig	329	9	primary	primary	JJ
cord-252671-uf96jgig	329	10	antibody	antibody	NN
cord-252671-uf96jgig	329	11	.	.	.
cord-252671-uf96jgig	330	1	Then	then	RB
cord-252671-uf96jgig	330	2	,	,	,
cord-252671-uf96jgig	330	3	a	a	DT
cord-252671-uf96jgig	330	4	secondary	secondary	JJ
cord-252671-uf96jgig	330	5	antibody	antibody	NN
cord-252671-uf96jgig	330	6	labeled	label	VBN
cord-252671-uf96jgig	330	7	with	with	IN
cord-252671-uf96jgig	330	8	horseradish	horseradish	NN
cord-252671-uf96jgig	330	9	peroxidase	peroxidase	NN
cord-252671-uf96jgig	330	10	was	be	VBD
cord-252671-uf96jgig	330	11	added	add	VBN
cord-252671-uf96jgig	330	12	to	to	IN
cord-252671-uf96jgig	330	13	the	the	DT
cord-252671-uf96jgig	330	14	reaction	reaction	NN
cord-252671-uf96jgig	330	15	product	product	NN
cord-252671-uf96jgig	330	16	and	and	CC
cord-252671-uf96jgig	330	17	was	be	VBD
cord-252671-uf96jgig	330	18	finally	finally	RB
cord-252671-uf96jgig	330	19	visualized	visualize	VBN
cord-252671-uf96jgig	330	20	with	with	IN
cord-252671-uf96jgig	330	21	an	an	DT
cord-252671-uf96jgig	330	22	enhanced	enhanced	JJ
cord-252671-uf96jgig	330	23	chemiluminescence	chemiluminescence	NN
cord-252671-uf96jgig	330	24	(	(	-LRB-
cord-252671-uf96jgig	330	25	ECL	ECL	NNP
cord-252671-uf96jgig	330	26	)	)	-RRB-
cord-252671-uf96jgig	330	27	kit	kit	NN
cord-252671-uf96jgig	330	28	(	(	-LRB-
cord-252671-uf96jgig	330	29	Santa	Santa	NNP
cord-252671-uf96jgig	330	30	Cruz	Cruz	NNP
cord-252671-uf96jgig	330	31	Biotechnology	Biotechnology	NNP
cord-252671-uf96jgig	330	32	,	,	,
cord-252671-uf96jgig	330	33	Santa	Santa	NNP
cord-252671-uf96jgig	330	34	Cruz	Cruz	NNP
cord-252671-uf96jgig	330	35	,	,	,
cord-252671-uf96jgig	330	36	CA	CA	NNP
cord-252671-uf96jgig	330	37	,	,	,
cord-252671-uf96jgig	330	38	USA).Dual	usa).dual	JJ
cord-252671-uf96jgig	330	39	-	-	HYPH
cord-252671-uf96jgig	330	40	luciferase	luciferase	NN
cord-252671-uf96jgig	330	41	assay	assay	NN
cord-252671-uf96jgig	330	42	.	.	.
cord-252671-uf96jgig	331	1	The	the	DT
cord-252671-uf96jgig	331	2	dual	dual	JJ
cord-252671-uf96jgig	331	3	-	-	HYPH
cord-252671-uf96jgig	331	4	luciferase	luciferase	NN
cord-252671-uf96jgig	331	5	kit	kit	NN
cord-252671-uf96jgig	331	6	was	be	VBD
cord-252671-uf96jgig	331	7	purchased	purchase	VBN
cord-252671-uf96jgig	331	8	from	from	IN
cord-252671-uf96jgig	331	9	Promega	Promega	NNP
cord-252671-uf96jgig	331	10	(	(	-LRB-
cord-252671-uf96jgig	331	11	Promega	Promega	NNP
cord-252671-uf96jgig	331	12	Corporation	Corporation	NNP
cord-252671-uf96jgig	331	13	,	,	,
cord-252671-uf96jgig	331	14	USA	USA	NNP
cord-252671-uf96jgig	331	15	)	)	-RRB-
cord-252671-uf96jgig	331	16	.	.	.
cord-252671-uf96jgig	332	1	Cells	cell	NNS
cord-252671-uf96jgig	332	2	were	be	VBD
cord-252671-uf96jgig	332	3	transfected	transfecte	VBN
cord-252671-uf96jgig	332	4	with	with	IN
cord-252671-uf96jgig	332	5	pGL3-IFN-	pgl3-ifn-	NN
cord-252671-uf96jgig	332	6	␤	␤	CD
cord-252671-uf96jgig	332	7	-luc	-luc	-RRB-
cord-252671-uf96jgig	332	8	or	or	CC
cord-252671-uf96jgig	332	9	pNF	pNF	NNP
cord-252671-uf96jgig	332	10	-	-	HYPH
cord-252671-uf96jgig	332	11	B	B	NNP
cord-252671-uf96jgig	332	12	-	-	HYPH
cord-252671-uf96jgig	332	13	luc	luc	NNP
cord-252671-uf96jgig	332	14	plus	plus	CC
cord-252671-uf96jgig	332	15	pRL	pRL	NNP
cord-252671-uf96jgig	332	16	-	-	HYPH
cord-252671-uf96jgig	332	17	TK	TK	NNP
cord-252671-uf96jgig	332	18	at	at	IN
cord-252671-uf96jgig	332	19	the	the	DT
cord-252671-uf96jgig	332	20	ratio	ratio	NN
cord-252671-uf96jgig	332	21	of	of	IN
cord-252671-uf96jgig	332	22	100:1	100:1	CD
cord-252671-uf96jgig	332	23	or	or	CC
cord-252671-uf96jgig	332	24	10:1	10:1	CD
cord-252671-uf96jgig	332	25	as	as	IN
cord-252671-uf96jgig	332	26	suggested	suggest	VBN
cord-252671-uf96jgig	332	27	by	by	IN
cord-252671-uf96jgig	332	28	the	the	DT
cord-252671-uf96jgig	332	29	manual	manual	NN
cord-252671-uf96jgig	332	30	.	.	.
cord-252671-uf96jgig	333	1	The	the	DT
cord-252671-uf96jgig	333	2	detection	detection	NN
cord-252671-uf96jgig	333	3	was	be	VBD
cord-252671-uf96jgig	333	4	done	do	VBN
cord-252671-uf96jgig	333	5	by	by	IN
cord-252671-uf96jgig	333	6	following	follow	VBG
cord-252671-uf96jgig	333	7	the	the	DT
cord-252671-uf96jgig	333	8	assay	assay	NN
cord-252671-uf96jgig	333	9	protocol	protocol	NN
cord-252671-uf96jgig	333	10	in	in	IN
cord-252671-uf96jgig	333	11	the	the	DT
cord-252671-uf96jgig	333	12	kit	kit	NN
cord-252671-uf96jgig	333	13	.	.	.
cord-252671-uf96jgig	334	1	The	the	DT
cord-252671-uf96jgig	334	2	firefly	firefly	NN
cord-252671-uf96jgig	334	3	and	and	CC
cord-252671-uf96jgig	334	4	Renilla	Renilla	NNP
cord-252671-uf96jgig	334	5	luciferase	luciferase	NN
cord-252671-uf96jgig	334	6	activities	activity	NNS
cord-252671-uf96jgig	334	7	were	be	VBD
cord-252671-uf96jgig	334	8	read	read	VBN
cord-252671-uf96jgig	334	9	with	with	IN
cord-252671-uf96jgig	334	10	a	a	DT
cord-252671-uf96jgig	334	11	Modulus	Modulus	NNP
cord-252671-uf96jgig	334	12	microplate	microplate	NN
cord-252671-uf96jgig	334	13	multimode	multimode	JJ
cord-252671-uf96jgig	334	14	reader	reader	NN
cord-252671-uf96jgig	334	15	(	(	-LRB-
cord-252671-uf96jgig	334	16	Turner	Turner	NNP
cord-252671-uf96jgig	334	17	Biosystems	Biosystems	NNP
cord-252671-uf96jgig	334	18	,	,	,
cord-252671-uf96jgig	334	19	Sunnyvale	Sunnyvale	NNP
cord-252671-uf96jgig	334	20	,	,	,
cord-252671-uf96jgig	334	21	CA	CA	NNP
cord-252671-uf96jgig	334	22	,	,	,
cord-252671-uf96jgig	334	23	USA).Coimmunoprecipitation	usa).coimmunoprecipitation	JJ
cord-252671-uf96jgig	334	24	(	(	-LRB-
cord-252671-uf96jgig	334	25	co	co	NN
cord-252671-uf96jgig	334	26	-	-	JJ
cord-252671-uf96jgig	334	27	IP	ip	NN
cord-252671-uf96jgig	334	28	)	)	-RRB-
cord-252671-uf96jgig	334	29	assay	assay	NN
cord-252671-uf96jgig	334	30	.	.	.
cord-252671-uf96jgig	335	1	The	the	DT
cord-252671-uf96jgig	335	2	transfected	transfecte	VBN
cord-252671-uf96jgig	335	3	cells	cell	NNS
cord-252671-uf96jgig	335	4	were	be	VBD
cord-252671-uf96jgig	335	5	lysed	lyse	VBN
cord-252671-uf96jgig	335	6	with	with	IN
cord-252671-uf96jgig	335	7	a	a	DT
cord-252671-uf96jgig	335	8	lysis	lysis	NN
cord-252671-uf96jgig	335	9	buffer	buffer	NN
cord-252671-uf96jgig	335	10	containing	contain	VBG
cord-252671-uf96jgig	335	11	50	50	CD
cord-252671-uf96jgig	335	12	mM	mm	CD
cord-252671-uf96jgig	335	13	Tris	Tris	NNP
cord-252671-uf96jgig	335	14	-	-	HYPH
cord-252671-uf96jgig	335	15	HCl	HCl	NNP
cord-252671-uf96jgig	335	16	(	(	-LRB-
cord-252671-uf96jgig	335	17	pH	pH	NNP
cord-252671-uf96jgig	335	18	7.4	7.4	CD
cord-252671-uf96jgig	335	19	)	)	-RRB-
cord-252671-uf96jgig	335	20	,	,	,
cord-252671-uf96jgig	335	21	150	150	CD
cord-252671-uf96jgig	335	22	mM	mm	CD
cord-252671-uf96jgig	335	23	NaCl	nacl	NN
cord-252671-uf96jgig	335	24	,	,	,
cord-252671-uf96jgig	335	25	1	1	CD
cord-252671-uf96jgig	335	26	mM	mm	CD
cord-252671-uf96jgig	335	27	EDTA	edta	NN
cord-252671-uf96jgig	335	28	,	,	,
cord-252671-uf96jgig	335	29	0.2	0.2	CD
cord-252671-uf96jgig	335	30	%	%	NN
cord-252671-uf96jgig	335	31	Triton	Triton	NNP
cord-252671-uf96jgig	335	32	,	,	,
cord-252671-uf96jgig	336	1	1	1	CD
cord-252671-uf96jgig	336	2	g	g	NN
cord-252671-uf96jgig	336	3	/	/	SYM
cord-252671-uf96jgig	336	4	ml	ml	NN
cord-252671-uf96jgig	336	5	leupeptin	leupeptin	NNP
cord-252671-uf96jgig	336	6	,	,	,
cord-252671-uf96jgig	336	7	1	1	CD
cord-252671-uf96jgig	336	8	g	g	NN
cord-252671-uf96jgig	336	9	/	/	SYM
cord-252671-uf96jgig	336	10	ml	ml	NNP
cord-252671-uf96jgig	336	11	aprotinin	aprotinin	NNP
cord-252671-uf96jgig	336	12	,	,	,
cord-252671-uf96jgig	336	13	and	and	CC
cord-252671-uf96jgig	336	14	1	1	CD
cord-252671-uf96jgig	336	15	mM	mm	CD
cord-252671-uf96jgig	336	16	PMSF	PMSF	NNP
cord-252671-uf96jgig	336	17	.	.	.
cord-252671-uf96jgig	337	1	About	about	RB
cord-252671-uf96jgig	337	2	10	10	CD
cord-252671-uf96jgig	337	3	%	%	NN
cord-252671-uf96jgig	337	4	of	of	IN
cord-252671-uf96jgig	337	5	the	the	DT
cord-252671-uf96jgig	337	6	lysate	lysate	NN
cord-252671-uf96jgig	337	7	was	be	VBD
cord-252671-uf96jgig	337	8	subjected	subject	VBN
cord-252671-uf96jgig	337	9	to	to	IN
cord-252671-uf96jgig	337	10	input	input	NN
cord-252671-uf96jgig	337	11	analysis	analysis	NN
cord-252671-uf96jgig	337	12	.	.	.
cord-252671-uf96jgig	338	1	Flag	flag	NN
cord-252671-uf96jgig	338	2	affinity	affinity	NN
cord-252671-uf96jgig	338	3	gel	gel	NN
cord-252671-uf96jgig	338	4	(	(	-LRB-
cord-252671-uf96jgig	338	5	Sigma	Sigma	NNP
cord-252671-uf96jgig	338	6	,	,	,
cord-252671-uf96jgig	338	7	USA	USA	NNP
cord-252671-uf96jgig	338	8	)	)	-RRB-
cord-252671-uf96jgig	338	9	or	or	CC
cord-252671-uf96jgig	338	10	anti	anti	JJ
cord-252671-uf96jgig	338	11	-	-	JJ
cord-252671-uf96jgig	338	12	Myc	myc	JJ
cord-252671-uf96jgig	338	13	and	and	CC
cord-252671-uf96jgig	338	14	protein	protein	NN
cord-252671-uf96jgig	338	15	G	g	NN
cord-252671-uf96jgig	338	16	plus	plus	CC
cord-252671-uf96jgig	338	17	agarose	agarose	VBN
cord-252671-uf96jgig	338	18	(	(	-LRB-
cord-252671-uf96jgig	338	19	Santa	Santa	NNP
cord-252671-uf96jgig	338	20	Cruz	Cruz	NNP
cord-252671-uf96jgig	338	21	Biotechnology	Biotechnology	NNP
cord-252671-uf96jgig	338	22	,	,	,
cord-252671-uf96jgig	338	23	Santa	Santa	NNP
cord-252671-uf96jgig	338	24	Cruz	Cruz	NNP
cord-252671-uf96jgig	338	25	,	,	,
cord-252671-uf96jgig	338	26	CA	CA	NNP
cord-252671-uf96jgig	338	27	,	,	,
cord-252671-uf96jgig	338	28	USA	USA	NNP
cord-252671-uf96jgig	338	29	)	)	-RRB-
cord-252671-uf96jgig	338	30	were	be	VBD
cord-252671-uf96jgig	338	31	added	add	VBN
cord-252671-uf96jgig	338	32	to	to	IN
cord-252671-uf96jgig	338	33	the	the	DT
cord-252671-uf96jgig	338	34	rest	rest	NN
cord-252671-uf96jgig	338	35	of	of	IN
cord-252671-uf96jgig	338	36	the	the	DT
cord-252671-uf96jgig	338	37	lysate	lysate	NN
cord-252671-uf96jgig	338	38	(	(	-LRB-
cord-252671-uf96jgig	338	39	90	90	CD
cord-252671-uf96jgig	338	40	%	%	NN
cord-252671-uf96jgig	338	41	)	)	-RRB-
cord-252671-uf96jgig	338	42	and	and	CC
cord-252671-uf96jgig	338	43	rotated	rotate	VBN
cord-252671-uf96jgig	338	44	overnight	overnight	RB
cord-252671-uf96jgig	338	45	at	at	IN
cord-252671-uf96jgig	338	46	4	4	CD
cord-252671-uf96jgig	338	47	°	°	NN
cord-252671-uf96jgig	338	48	C	c	NN
cord-252671-uf96jgig	338	49	.	.	.
cord-252671-uf96jgig	339	1	The	the	DT
cord-252671-uf96jgig	339	2	reaction	reaction	NN
cord-252671-uf96jgig	339	3	products	product	NNS
cord-252671-uf96jgig	339	4	were	be	VBD
cord-252671-uf96jgig	339	5	washed	wash	VBN
cord-252671-uf96jgig	339	6	5	5	CD
cord-252671-uf96jgig	339	7	times	time	NNS
cord-252671-uf96jgig	339	8	with	with	IN
cord-252671-uf96jgig	339	9	a	a	DT
cord-252671-uf96jgig	339	10	wash	wash	NN
cord-252671-uf96jgig	339	11	buffer	buffer	NN
cord-252671-uf96jgig	339	12	and	and	CC
cord-252671-uf96jgig	339	13	then	then	RB
cord-252671-uf96jgig	339	14	centrifuged	centrifuge	VBN
cord-252671-uf96jgig	339	15	at	at	IN
cord-252671-uf96jgig	339	16	5,000	5,000	CD
cord-252671-uf96jgig	339	17	rpm	rpm	NN
cord-252671-uf96jgig	339	18	for	for	IN
cord-252671-uf96jgig	339	19	1	1	CD
cord-252671-uf96jgig	339	20	min	min	NN
cord-252671-uf96jgig	339	21	.	.	.
cord-252671-uf96jgig	340	1	The	the	DT
cord-252671-uf96jgig	340	2	IP	ip	NN
cord-252671-uf96jgig	340	3	products	product	NNS
cord-252671-uf96jgig	340	4	were	be	VBD
cord-252671-uf96jgig	340	5	resuspended	resuspend	VBN
cord-252671-uf96jgig	340	6	in	in	IN
cord-252671-uf96jgig	340	7	the	the	DT
cord-252671-uf96jgig	340	8	loading	loading	NN
cord-252671-uf96jgig	340	9	buffer	buffer	NN
cord-252671-uf96jgig	340	10	and	and	CC
cord-252671-uf96jgig	340	11	subjected	subject	VBN
cord-252671-uf96jgig	340	12	to	to	IN
cord-252671-uf96jgig	340	13	Western	western	JJ
cord-252671-uf96jgig	340	14	blot	blot	NN
cord-252671-uf96jgig	340	15	analysis	analysis	NN
cord-252671-uf96jgig	340	16	.	.	.
cord-252671-uf96jgig	341	1	ELISA	ELISA	NNP
cord-252671-uf96jgig	341	2	.	.	.
cord-252671-uf96jgig	342	1	Cell	cell	NN
cord-252671-uf96jgig	342	2	culture	culture	NN
cord-252671-uf96jgig	342	3	supernatants	supernatant	NNS
cord-252671-uf96jgig	342	4	were	be	VBD
cord-252671-uf96jgig	342	5	harvested	harvest	VBN
cord-252671-uf96jgig	342	6	48	48	CD
cord-252671-uf96jgig	342	7	h	h	NN
cord-252671-uf96jgig	342	8	after	after	IN
cord-252671-uf96jgig	342	9	transfection	transfection	NN
cord-252671-uf96jgig	342	10	.	.	.
cord-252671-uf96jgig	343	1	The	the	DT
cord-252671-uf96jgig	343	2	human	human	NN
cord-252671-uf96jgig	343	3	IFN-	IFN-	NNP
cord-252671-uf96jgig	343	4	␤	␤	NNP
cord-252671-uf96jgig	343	5	ELISA	ELISA	NNP
cord-252671-uf96jgig	343	6	kit	kit	NN
cord-252671-uf96jgig	343	7	was	be	VBD
cord-252671-uf96jgig	343	8	purchased	purchase	VBN
cord-252671-uf96jgig	343	9	from	from	IN
cord-252671-uf96jgig	343	10	Bluegene	Bluegene	NNP
cord-252671-uf96jgig	343	11	(	(	-LRB-
cord-252671-uf96jgig	343	12	Shanghai	Shanghai	NNP
cord-252671-uf96jgig	343	13	,	,	,
cord-252671-uf96jgig	343	14	China	China	NNP
cord-252671-uf96jgig	343	15	)	)	-RRB-
cord-252671-uf96jgig	343	16	.	.	.
cord-252671-uf96jgig	344	1	The	the	DT
cord-252671-uf96jgig	344	2	reaction	reaction	NN
cord-252671-uf96jgig	344	3	was	be	VBD
cord-252671-uf96jgig	344	4	carried	carry	VBN
cord-252671-uf96jgig	344	5	out	out	RP
cord-252671-uf96jgig	344	6	by	by	IN
cord-252671-uf96jgig	344	7	following	follow	VBG
cord-252671-uf96jgig	344	8	the	the	DT
cord-252671-uf96jgig	344	9	manufacturer	manufacturer	NN
cord-252671-uf96jgig	344	10	's	's	POS
cord-252671-uf96jgig	344	11	instructions	instruction	NNS
cord-252671-uf96jgig	344	12	.	.	.
cord-252671-uf96jgig	345	1	The	the	DT
cord-252671-uf96jgig	345	2	reaction	reaction	NN
cord-252671-uf96jgig	345	3	products	product	NNS
cord-252671-uf96jgig	345	4	were	be	VBD
cord-252671-uf96jgig	345	5	detected	detect	VBN
cord-252671-uf96jgig	345	6	with	with	IN
cord-252671-uf96jgig	345	7	Synogen	Synogen	NNP
cord-252671-uf96jgig	345	8	4	4	CD
cord-252671-uf96jgig	345	9	(	(	-LRB-
cord-252671-uf96jgig	345	10	BioTek	BioTek	NNP
cord-252671-uf96jgig	345	11	,	,	,
cord-252671-uf96jgig	345	12	Seattle	Seattle	NNP
cord-252671-uf96jgig	345	13	,	,	,
cord-252671-uf96jgig	345	14	WA	WA	NNP
cord-252671-uf96jgig	345	15	,	,	,
cord-252671-uf96jgig	345	16	USA	USA	NNP
cord-252671-uf96jgig	345	17	)	)	-RRB-
cord-252671-uf96jgig	345	18	under	under	IN
cord-252671-uf96jgig	345	19	450	450	CD
cord-252671-uf96jgig	345	20	nm	nm	NN
cord-252671-uf96jgig	345	21	.	.	.
cord-252671-uf96jgig	346	1	Generation	generation	NN
cord-252671-uf96jgig	346	2	of	of	IN
cord-252671-uf96jgig	346	3	SARS	SARS	NNP
cord-252671-uf96jgig	346	4	-	-	HYPH
cord-252671-uf96jgig	346	5	CoV	CoV	NNP
cord-252671-uf96jgig	346	6	pseudovirus	pseudovirus	NNP
cord-252671-uf96jgig	346	7	and	and	CC
cord-252671-uf96jgig	346	8	assay	assay	NN
cord-252671-uf96jgig	346	9	of	of	IN
cord-252671-uf96jgig	347	1	virus	virus	NN
cord-252671-uf96jgig	347	2	-	-	HYPH
cord-252671-uf96jgig	347	3	induced	induce	VBN
cord-252671-uf96jgig	347	4	IFN-	IFN-	NNP
cord-252671-uf96jgig	347	5	␤	␤	CD
cord-252671-uf96jgig	347	6	production	production	NN
cord-252671-uf96jgig	347	7	.	.	.
cord-252671-uf96jgig	348	1	The	the	DT
cord-252671-uf96jgig	348	2	generation	generation	NN
cord-252671-uf96jgig	348	3	of	of	IN
cord-252671-uf96jgig	348	4	SARS	SARS	NNP
cord-252671-uf96jgig	348	5	-	-	HYPH
cord-252671-uf96jgig	348	6	CoV	CoV	NNP
cord-252671-uf96jgig	348	7	pseudovirus	pseudovirus	NNP
cord-252671-uf96jgig	348	8	followed	follow	VBD
cord-252671-uf96jgig	348	9	the	the	DT
cord-252671-uf96jgig	348	10	procedure	procedure	NN
cord-252671-uf96jgig	348	11	described	describe	VBN
cord-252671-uf96jgig	348	12	by	by	IN
cord-252671-uf96jgig	348	13	Huang	Huang	NNP
cord-252671-uf96jgig	348	14	et	et	NNP
cord-252671-uf96jgig	348	15	al	al	NNP
cord-252671-uf96jgig	348	16	.	.	.
cord-252671-uf96jgig	349	1	(	(	-LRB-
cord-252671-uf96jgig	349	2	35	35	CD
cord-252671-uf96jgig	349	3	)	)	-RRB-
cord-252671-uf96jgig	349	4	.	.	.
cord-252671-uf96jgig	350	1	Briefly	briefly	RB
cord-252671-uf96jgig	350	2	,	,	,
cord-252671-uf96jgig	350	3	HEK293	HEK293	NNP
cord-252671-uf96jgig	350	4	cells	cell	NNS
cord-252671-uf96jgig	350	5	were	be	VBD
cord-252671-uf96jgig	350	6	cotransfected	cotransfecte	VBN
cord-252671-uf96jgig	350	7	with	with	IN
cord-252671-uf96jgig	350	8	either	either	CC
cord-252671-uf96jgig	350	9	the	the	DT
cord-252671-uf96jgig	350	10	S	S	NNP
cord-252671-uf96jgig	350	11	,	,	,
cord-252671-uf96jgig	350	12	M	M	NNP
cord-252671-uf96jgig	350	13	,	,	,
cord-252671-uf96jgig	350	14	and	and	CC
cord-252671-uf96jgig	350	15	N	n	CD
cord-252671-uf96jgig	350	16	genes	gene	NNS
cord-252671-uf96jgig	350	17	or	or	CC
cord-252671-uf96jgig	350	18	the	the	DT
cord-252671-uf96jgig	350	19	S	S	NNP
cord-252671-uf96jgig	350	20	,	,	,
cord-252671-uf96jgig	350	21	M	M	NNP
cord-252671-uf96jgig	350	22	mutant	mutant	NN
cord-252671-uf96jgig	350	23	M(V68A	M(V68A	NNP
cord-252671-uf96jgig	350	24	)	)	-RRB-
cord-252671-uf96jgig	350	25	,	,	,
cord-252671-uf96jgig	350	26	and	and	CC
cord-252671-uf96jgig	350	27	N	N	NNP
cord-252671-uf96jgig	350	28	of	of	IN
cord-252671-uf96jgig	350	29	SARS	SARS	NNP
cord-252671-uf96jgig	350	30	-	-	HYPH
cord-252671-uf96jgig	350	31	CoV.	CoV.	NNP
cord-252671-uf96jgig	350	32	After	after	IN
cord-252671-uf96jgig	350	33	48	48	CD
cord-252671-uf96jgig	350	34	h	h	NN
cord-252671-uf96jgig	350	35	of	of	IN
cord-252671-uf96jgig	350	36	transfection	transfection	NN
cord-252671-uf96jgig	350	37	,	,	,
cord-252671-uf96jgig	350	38	the	the	DT
cord-252671-uf96jgig	350	39	culture	culture	NN
cord-252671-uf96jgig	350	40	medium	medium	NN
cord-252671-uf96jgig	350	41	and	and	CC
cord-252671-uf96jgig	350	42	the	the	DT
cord-252671-uf96jgig	350	43	transfected	transfecte	VBN
cord-252671-uf96jgig	350	44	cells	cell	NNS
cord-252671-uf96jgig	350	45	were	be	VBD
cord-252671-uf96jgig	350	46	collected	collect	VBN
cord-252671-uf96jgig	350	47	and	and	CC
cord-252671-uf96jgig	350	48	subjected	subject	VBN
cord-252671-uf96jgig	350	49	to	to	IN
cord-252671-uf96jgig	350	50	freezing	freeze	VBG
cord-252671-uf96jgig	350	51	and	and	CC
cord-252671-uf96jgig	350	52	thawing	thaw	VBG
cord-252671-uf96jgig	350	53	cycles	cycle	NNS
cord-252671-uf96jgig	350	54	at	at	RB
cord-252671-uf96jgig	350	55	least	least	JJS
cord-252671-uf96jgig	350	56	four	four	CD
cord-252671-uf96jgig	350	57	times	time	NNS
cord-252671-uf96jgig	350	58	.	.	.
cord-252671-uf96jgig	351	1	The	the	DT
cord-252671-uf96jgig	351	2	reaction	reaction	NN
cord-252671-uf96jgig	351	3	products	product	NNS
cord-252671-uf96jgig	351	4	were	be	VBD
cord-252671-uf96jgig	351	5	centrifuged	centrifuge	VBN
cord-252671-uf96jgig	351	6	at	at	IN
cord-252671-uf96jgig	351	7	12,000	12,000	CD
cord-252671-uf96jgig	351	8	rpm	rpm	NN
cord-252671-uf96jgig	351	9	for	for	IN
cord-252671-uf96jgig	351	10	10	10	CD
cord-252671-uf96jgig	351	11	min	min	NN
cord-252671-uf96jgig	351	12	.	.	.
cord-252671-uf96jgig	352	1	The	the	DT
cord-252671-uf96jgig	352	2	supernatant	supernatant	JJ
cord-252671-uf96jgig	352	3	containing	contain	VBG
cord-252671-uf96jgig	352	4	VLPs	vlp	NNS
cord-252671-uf96jgig	352	5	was	be	VBD
cord-252671-uf96jgig	352	6	then	then	RB
cord-252671-uf96jgig	352	7	applied	apply	VBN
cord-252671-uf96jgig	352	8	to	to	IN
cord-252671-uf96jgig	352	9	HEK293-ACE2	hek293-ace2	NN
cord-252671-uf96jgig	352	10	stable	stable	JJ
cord-252671-uf96jgig	352	11	cells	cell	NNS
cord-252671-uf96jgig	352	12	and	and	CC
cord-252671-uf96jgig	352	13	incubated	incubate	VBN
cord-252671-uf96jgig	352	14	for	for	IN
cord-252671-uf96jgig	352	15	4	4	CD
cord-252671-uf96jgig	352	16	h.	h.	NN
cord-252671-uf96jgig	353	1	Then	then	RB
cord-252671-uf96jgig	353	2	,	,	,
cord-252671-uf96jgig	353	3	the	the	DT
cord-252671-uf96jgig	353	4	cell	cell	NN
cord-252671-uf96jgig	353	5	culture	culture	NN
cord-252671-uf96jgig	353	6	medium	medium	NN
cord-252671-uf96jgig	353	7	was	be	VBD
cord-252671-uf96jgig	353	8	replaced	replace	VBN
cord-252671-uf96jgig	353	9	with	with	IN
cord-252671-uf96jgig	353	10	fresh	fresh	JJ
cord-252671-uf96jgig	353	11	medium	medium	NN
cord-252671-uf96jgig	353	12	.	.	.
cord-252671-uf96jgig	354	1	After	after	IN
cord-252671-uf96jgig	354	2	24	24	CD
cord-252671-uf96jgig	354	3	h	h	NN
cord-252671-uf96jgig	354	4	,	,	,
cord-252671-uf96jgig	354	5	the	the	DT
cord-252671-uf96jgig	354	6	infected	infected	JJ
cord-252671-uf96jgig	354	7	cells	cell	NNS
cord-252671-uf96jgig	354	8	were	be	VBD
cord-252671-uf96jgig	354	9	subjected	subject	VBN
cord-252671-uf96jgig	354	10	to	to	IN
cord-252671-uf96jgig	354	11	total	total	VB
cord-252671-uf96jgig	354	12	RNA	RNA	NNP
cord-252671-uf96jgig	354	13	isolation	isolation	NN
cord-252671-uf96jgig	354	14	and	and	CC
cord-252671-uf96jgig	354	15	preparation	preparation	NN
cord-252671-uf96jgig	354	16	of	of	IN
cord-252671-uf96jgig	354	17	whole	whole	JJ
cord-252671-uf96jgig	354	18	-	-	HYPH
cord-252671-uf96jgig	354	19	cell	cell	NN
cord-252671-uf96jgig	354	20	lysates	lysate	NNS
cord-252671-uf96jgig	354	21	as	as	IN
cord-252671-uf96jgig	354	22	described	describe	VBN
cord-252671-uf96jgig	354	23	elsewhere	elsewhere	RB
cord-252671-uf96jgig	354	24	.	.	.
cord-252671-uf96jgig	355	1	SARS	SARS	NNP
cord-252671-uf96jgig	355	2	-	-	HYPH
cord-252671-uf96jgig	355	3	CoV	CoV	NNP
cord-252671-uf96jgig	355	4	-	-	HYPH
cord-252671-uf96jgig	355	5	mediated	mediate	VBN
cord-252671-uf96jgig	355	6	IFN-	IFN-	NNP
cord-252671-uf96jgig	355	7	␤	␤	DT
cord-252671-uf96jgig	355	8	expression	expression	NN
cord-252671-uf96jgig	355	9	was	be	VBD
cord-252671-uf96jgig	355	10	monitored	monitor	VBN
cord-252671-uf96jgig	355	11	by	by	IN
cord-252671-uf96jgig	355	12	standard	standard	JJ
cord-252671-uf96jgig	355	13	Western	western	JJ
cord-252671-uf96jgig	355	14	blotting	blotting	NN
cord-252671-uf96jgig	355	15	,	,	,
cord-252671-uf96jgig	355	16	RT	RT	NNP
cord-252671-uf96jgig	355	17	-	-	HYPH
cord-252671-uf96jgig	355	18	PCR	PCR	NNP
cord-252671-uf96jgig	355	19	,	,	,
cord-252671-uf96jgig	355	20	and	and	CC
cord-252671-uf96jgig	355	21	qRT	qRT	NNP
cord-252671-uf96jgig	355	22	-	-	HYPH
cord-252671-uf96jgig	355	23	PCR.Immunostaining	PCR.Immunostaining	NNP
cord-252671-uf96jgig	355	24	assay	assay	NN
cord-252671-uf96jgig	355	25	.	.	.
cord-252671-uf96jgig	356	1	HeLa	HeLa	NNP
cord-252671-uf96jgig	356	2	cells	cell	NNS
cord-252671-uf96jgig	356	3	were	be	VBD
cord-252671-uf96jgig	356	4	transiently	transiently	RB
cord-252671-uf96jgig	356	5	transfected	transfecte	VBN
cord-252671-uf96jgig	356	6	with	with	IN
cord-252671-uf96jgig	356	7	Myc	Myc	NNP
cord-252671-uf96jgig	356	8	-	-	HYPH
cord-252671-uf96jgig	356	9	M	M	NNP
cord-252671-uf96jgig	356	10	and	and	CC
cord-252671-uf96jgig	356	11	Flag	Flag	NNP
cord-252671-uf96jgig	356	12	-	-	HYPH
cord-252671-uf96jgig	356	13	TRAP	trap	NN
cord-252671-uf96jgig	356	14	␥	␥	ADD
cord-252671-uf96jgig	356	15	(	(	-LRB-
cord-252671-uf96jgig	356	16	45	45	CD
cord-252671-uf96jgig	356	17	)	)	-RRB-
cord-252671-uf96jgig	356	18	.	.	.
cord-252671-uf96jgig	357	1	After	after	IN
cord-252671-uf96jgig	357	2	24	24	CD
cord-252671-uf96jgig	357	3	h	h	NN
cord-252671-uf96jgig	357	4	of	of	IN
cord-252671-uf96jgig	357	5	transfection	transfection	NN
cord-252671-uf96jgig	357	6	,	,	,
cord-252671-uf96jgig	357	7	the	the	DT
cord-252671-uf96jgig	357	8	cells	cell	NNS
cord-252671-uf96jgig	357	9	were	be	VBD
cord-252671-uf96jgig	357	10	fixed	fix	VBN
cord-252671-uf96jgig	357	11	with	with	IN
cord-252671-uf96jgig	357	12	4	4	CD
cord-252671-uf96jgig	357	13	%	%	NN
cord-252671-uf96jgig	357	14	formaldehyde	formaldehyde	NN
cord-252671-uf96jgig	357	15	for	for	IN
cord-252671-uf96jgig	357	16	20	20	CD
cord-252671-uf96jgig	357	17	min	min	NN
cord-252671-uf96jgig	357	18	on	on	IN
cord-252671-uf96jgig	357	19	ice	ice	NN
cord-252671-uf96jgig	357	20	and	and	CC
cord-252671-uf96jgig	357	21	then	then	RB
cord-252671-uf96jgig	357	22	incubated	incubate	VBD
cord-252671-uf96jgig	357	23	in	in	IN
cord-252671-uf96jgig	357	24	1ϫ	1ϫ	CD
cord-252671-uf96jgig	357	25	phosphate	phosphate	NN
cord-252671-uf96jgig	357	26	-	-	HYPH
cord-252671-uf96jgig	357	27	buffered	buffer	VBN
cord-252671-uf96jgig	357	28	saline	saline	NN
cord-252671-uf96jgig	357	29	(	(	-LRB-
cord-252671-uf96jgig	357	30	PBS	PBS	NNP
cord-252671-uf96jgig	357	31	)	)	-RRB-
cord-252671-uf96jgig	357	32	containing	contain	VBG
cord-252671-uf96jgig	357	33	10	10	CD
cord-252671-uf96jgig	357	34	%	%	NN
cord-252671-uf96jgig	357	35	bovine	bovine	JJ
cord-252671-uf96jgig	357	36	serum	serum	NN
cord-252671-uf96jgig	357	37	albumin	albumin	NN
cord-252671-uf96jgig	357	38	(	(	-LRB-
cord-252671-uf96jgig	357	39	BSA	BSA	NNP
cord-252671-uf96jgig	357	40	)	)	-RRB-
cord-252671-uf96jgig	357	41	for	for	IN
cord-252671-uf96jgig	357	42	1	1	CD
cord-252671-uf96jgig	357	43	h.	h.	NN
cord-252671-uf96jgig	358	1	The	the	DT
cord-252671-uf96jgig	358	2	cells	cell	NNS
cord-252671-uf96jgig	358	3	were	be	VBD
cord-252671-uf96jgig	358	4	first	first	RB
cord-252671-uf96jgig	358	5	incubated	incubate	VBN
cord-252671-uf96jgig	358	6	with	with	IN
cord-252671-uf96jgig	358	7	primary	primary	JJ
cord-252671-uf96jgig	358	8	antibody	antibody	NN
cord-252671-uf96jgig	358	9	rabbit	rabbit	NN
cord-252671-uf96jgig	358	10	anti	anti	NNP
cord-252671-uf96jgig	358	11	-	-	NNP
cord-252671-uf96jgig	358	12	Flag	flag	JJ
cord-252671-uf96jgig	358	13	or	or	CC
cord-252671-uf96jgig	358	14	mouse	mouse	NN
cord-252671-uf96jgig	358	15	anti	anti	JJ
cord-252671-uf96jgig	358	16	-	-	NNP
cord-252671-uf96jgig	358	17	Myc	Myc	NNP
cord-252671-uf96jgig	358	18	for	for	IN
cord-252671-uf96jgig	358	19	1	1	CD
cord-252671-uf96jgig	358	20	h.	h.	NN
cord-252671-uf96jgig	359	1	Then	then	RB
cord-252671-uf96jgig	359	2	,	,	,
cord-252671-uf96jgig	359	3	the	the	DT
cord-252671-uf96jgig	359	4	secondary	secondary	JJ
cord-252671-uf96jgig	359	5	antibody	antibody	NN
cord-252671-uf96jgig	359	6	fluorescein	fluorescein	NN
cord-252671-uf96jgig	359	7	isothiocyanate	isothiocyanate	NN
cord-252671-uf96jgig	359	8	(	(	-LRB-
cord-252671-uf96jgig	359	9	FITC)-labeled	fitc)-labele	VBN
cord-252671-uf96jgig	359	10	goat	goat	NN
cord-252671-uf96jgig	359	11	anti	anti	JJ
cord-252671-uf96jgig	359	12	-	-	JJ
cord-252671-uf96jgig	359	13	mouse	mouse	NN
cord-252671-uf96jgig	359	14	or	or	CC
cord-252671-uf96jgig	359	15	tetramethyl	tetramethyl	NN
cord-252671-uf96jgig	359	16	rhodamine	rhodamine	NN
cord-252671-uf96jgig	359	17	isocyanate	isocyanate	NN
cord-252671-uf96jgig	359	18	(	(	-LRB-
cord-252671-uf96jgig	359	19	TRITC)-labeled	tritc)-labele	VBN
cord-252671-uf96jgig	359	20	goat	goat	NN
cord-252671-uf96jgig	359	21	anti	anti	JJ
cord-252671-uf96jgig	359	22	-	-	JJ
cord-252671-uf96jgig	359	23	rabbit	rabbit	JJ
cord-252671-uf96jgig	359	24	antibody	antibody	NN
cord-252671-uf96jgig	359	25	was	be	VBD
cord-252671-uf96jgig	359	26	added	add	VBN
cord-252671-uf96jgig	359	27	,	,	,
cord-252671-uf96jgig	359	28	and	and	CC
cord-252671-uf96jgig	359	29	the	the	DT
cord-252671-uf96jgig	359	30	mixture	mixture	NN
cord-252671-uf96jgig	359	31	was	be	VBD
cord-252671-uf96jgig	359	32	incubated	incubate	VBN
cord-252671-uf96jgig	359	33	for	for	IN
cord-252671-uf96jgig	360	1	another	another	DT
cord-252671-uf96jgig	360	2	1	1	CD
cord-252671-uf96jgig	360	3	h.	h.	NN
cord-252671-uf96jgig	360	4	Finally	finally	RB
cord-252671-uf96jgig	360	5	,	,	,
cord-252671-uf96jgig	360	6	the	the	DT
cord-252671-uf96jgig	360	7	cells	cell	NNS
cord-252671-uf96jgig	360	8	were	be	VBD
cord-252671-uf96jgig	360	9	incubated	incubate	VBN
cord-252671-uf96jgig	360	10	with	with	IN
cord-252671-uf96jgig	360	11	4=,6-diamidino-2-phenylindole	4=,6-diamidino-2-phenylindole	CD
cord-252671-uf96jgig	360	12	(	(	-LRB-
cord-252671-uf96jgig	360	13	DAPI	DAPI	NNP
cord-252671-uf96jgig	360	14	)	)	-RRB-
cord-252671-uf96jgig	360	15	and	and	CC
cord-252671-uf96jgig	360	16	sealed	seal	VBN
cord-252671-uf96jgig	360	17	with	with	IN
cord-252671-uf96jgig	360	18	glycerol	glycerol	NN
cord-252671-uf96jgig	360	19	.	.	.
cord-252671-uf96jgig	361	1	The	the	DT
cord-252671-uf96jgig	361	2	results	result	NNS
cord-252671-uf96jgig	361	3	were	be	VBD
cord-252671-uf96jgig	361	4	observed	observe	VBN
cord-252671-uf96jgig	361	5	under	under	IN
cord-252671-uf96jgig	361	6	an	an	DT
cord-252671-uf96jgig	361	7	Olympus	Olympus	NNP
cord-252671-uf96jgig	361	8	FV1000	fv1000	NN
cord-252671-uf96jgig	361	9	confocal	confocal	JJ
cord-252671-uf96jgig	361	10	microscope	microscope	NN
cord-252671-uf96jgig	361	11	.	.	.
cord-252671-uf96jgig	362	1	Statistical	statistical	JJ
cord-252671-uf96jgig	362	2	analysis	analysis	NN
cord-252671-uf96jgig	362	3	.	.	.
cord-252671-uf96jgig	363	1	All	all	DT
cord-252671-uf96jgig	363	2	values	value	NNS
cord-252671-uf96jgig	363	3	were	be	VBD
cord-252671-uf96jgig	363	4	calculated	calculate	VBN
cord-252671-uf96jgig	363	5	as	as	IN
cord-252671-uf96jgig	363	6	means	mean	VBZ
cord-252671-uf96jgig	363	7	Ϯ	Ϯ	NNP
cord-252671-uf96jgig	363	8	standard	standard	JJ
cord-252671-uf96jgig	363	9	deviations	deviation	NNS
cord-252671-uf96jgig	363	10	(	(	-LRB-
cord-252671-uf96jgig	363	11	SDs	SDs	NNP
cord-252671-uf96jgig	363	12	)	)	-RRB-
cord-252671-uf96jgig	363	13	from	from	IN
cord-252671-uf96jgig	363	14	three	three	CD
cord-252671-uf96jgig	363	15	independent	independent	JJ
cord-252671-uf96jgig	363	16	experiments	experiment	NNS
cord-252671-uf96jgig	363	17	.	.	.
cord-252671-uf96jgig	364	1	The	the	DT
cord-252671-uf96jgig	364	2	statistical	statistical	JJ
cord-252671-uf96jgig	364	3	difference	difference	NN
cord-252671-uf96jgig	364	4	between	between	IN
cord-252671-uf96jgig	364	5	the	the	DT
cord-252671-uf96jgig	364	6	assayed	assay	VBN
cord-252671-uf96jgig	364	7	group	group	NN
cord-252671-uf96jgig	364	8	and	and	CC
cord-252671-uf96jgig	364	9	the	the	DT
cord-252671-uf96jgig	364	10	standard	standard	JJ
cord-252671-uf96jgig	364	11	group	group	NN
cord-252671-uf96jgig	364	12	was	be	VBD
cord-252671-uf96jgig	364	13	subjected	subject	VBN
cord-252671-uf96jgig	364	14	to	to	IN
cord-252671-uf96jgig	364	15	Student	Student	NNP
cord-252671-uf96jgig	364	16	's	's	POS
cord-252671-uf96jgig	364	17	t	t	NN
cord-252671-uf96jgig	364	18	test	test	NN
cord-252671-uf96jgig	364	19	.	.	.
cord-252671-uf96jgig	365	1	The	the	DT
cord-252671-uf96jgig	365	2	calculated	calculated	JJ
cord-252671-uf96jgig	365	3	difference	difference	NN
cord-252671-uf96jgig	365	4	was	be	VBD
cord-252671-uf96jgig	365	5	considered	consider	VBN
cord-252671-uf96jgig	365	6	significant	significant	JJ
cord-252671-uf96jgig	365	7	at	at	IN
cord-252671-uf96jgig	365	8	the	the	DT
cord-252671-uf96jgig	365	9	P	p	NN
cord-252671-uf96jgig	365	10	value	value	NN
cord-252671-uf96jgig	365	11	of	of	IN
cord-252671-uf96jgig	365	12	Ͻ0.05	Ͻ0.05	NNP
cord-252671-uf96jgig	365	13	.	.	.