id	sid	tid	token	lemma	pos
cord-014462-11ggaqf1	1	1	key	key	JJ
cord-014462-11ggaqf1	1	2	:	:	:
cord-014462-11ggaqf1	1	3	cord-014462	cord-014462	NNP
cord-014462-11ggaqf1	1	4	-	-	HYPH
cord-014462-11ggaqf1	1	5	11ggaqf1	11ggaqf1	CD
cord-014462-11ggaqf1	1	6	authors	author	NNS
cord-014462-11ggaqf1	1	7	:	:	:
cord-014462-11ggaqf1	2	1	nan	nan	NNP
cord-014462-11ggaqf1	2	2	title	title	NN
cord-014462-11ggaqf1	2	3	:	:	:
cord-014462-11ggaqf1	2	4	Abstracts	abstract	NNS
cord-014462-11ggaqf1	2	5	of	of	IN
cord-014462-11ggaqf1	2	6	the	the	DT
cord-014462-11ggaqf1	2	7	Papers	Papers	NNPS
cord-014462-11ggaqf1	2	8	Presented	present	VBN
cord-014462-11ggaqf1	2	9	in	in	IN
cord-014462-11ggaqf1	2	10	the	the	DT
cord-014462-11ggaqf1	2	11	XIX	XIX	NNP
cord-014462-11ggaqf1	2	12	National	National	NNP
cord-014462-11ggaqf1	2	13	Conference	Conference	NNP
cord-014462-11ggaqf1	2	14	of	of	IN
cord-014462-11ggaqf1	2	15	Indian	Indian	NNP
cord-014462-11ggaqf1	2	16	Virological	Virological	NNP
cord-014462-11ggaqf1	2	17	Society	Society	NNP
cord-014462-11ggaqf1	2	18	,	,	,
cord-014462-11ggaqf1	3	1	“	"	``
cord-014462-11ggaqf1	3	2	Recent	Recent	NNP
cord-014462-11ggaqf1	3	3	Trends	Trends	NNPS
cord-014462-11ggaqf1	3	4	in	in	IN
cord-014462-11ggaqf1	3	5	Viral	Viral	NNP
cord-014462-11ggaqf1	3	6	Disease	Disease	NNP
cord-014462-11ggaqf1	3	7	Problems	Problems	NNPS
cord-014462-11ggaqf1	3	8	and	and	CC
cord-014462-11ggaqf1	3	9	Management	Management	NNP
cord-014462-11ggaqf1	3	10	”	"	''
cord-014462-11ggaqf1	3	11	,	,	,
cord-014462-11ggaqf1	3	12	on	on	IN
cord-014462-11ggaqf1	3	13	18–20	18–20	CD
cord-014462-11ggaqf1	3	14	March	March	NNP
cord-014462-11ggaqf1	3	15	,	,	,
cord-014462-11ggaqf1	3	16	2010	2010	CD
cord-014462-11ggaqf1	3	17	,	,	,
cord-014462-11ggaqf1	3	18	at	at	IN
cord-014462-11ggaqf1	3	19	S.V.	S.V.	NNP
cord-014462-11ggaqf1	3	20	University	University	NNP
cord-014462-11ggaqf1	3	21	,	,	,
cord-014462-11ggaqf1	3	22	Tirupati	Tirupati	NNP
cord-014462-11ggaqf1	3	23	,	,	,
cord-014462-11ggaqf1	4	1	Andhra	Andhra	NNP
cord-014462-11ggaqf1	4	2	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	4	3	date	date	NN
cord-014462-11ggaqf1	5	1	:	:	:
cord-014462-11ggaqf1	5	2	2011	2011	CD
cord-014462-11ggaqf1	5	3	-	-	HYPH
cord-014462-11ggaqf1	5	4	04	04	CD
cord-014462-11ggaqf1	5	5	-	-	SYM
cord-014462-11ggaqf1	5	6	21	21	CD
cord-014462-11ggaqf1	5	7	journal	journal	NN
cord-014462-11ggaqf1	5	8	:	:	:
cord-014462-11ggaqf1	6	1	Indian	Indian	NNP
cord-014462-11ggaqf1	6	2	J	J	NNP
cord-014462-11ggaqf1	6	3	Virol	Virol	NNP
cord-014462-11ggaqf1	6	4	DOI	DOI	NNP
cord-014462-11ggaqf1	6	5	:	:	:
cord-014462-11ggaqf1	7	1	10.1007	10.1007	CD
cord-014462-11ggaqf1	7	2	/	/	SYM
cord-014462-11ggaqf1	7	3	s13337	s13337	NN
cord-014462-11ggaqf1	7	4	-	-	HYPH
cord-014462-11ggaqf1	7	5	011	011	CD
cord-014462-11ggaqf1	7	6	-	-	HYPH
cord-014462-11ggaqf1	7	7	0027	0027	CD
cord-014462-11ggaqf1	7	8	-	-	HYPH
cord-014462-11ggaqf1	7	9	2	2	CD
cord-014462-11ggaqf1	7	10	sha	sha	NN
cord-014462-11ggaqf1	7	11	:	:	:
cord-014462-11ggaqf1	7	12	ed57af4ce362b8b0a9a96db0ce9259e18167d521	ed57af4ce362b8b0a9a96db0ce9259e18167d521	NNP
cord-014462-11ggaqf1	7	13	doc_id	doc_id	CD
cord-014462-11ggaqf1	7	14	:	:	:
cord-014462-11ggaqf1	7	15	14462	14462	CD
cord-014462-11ggaqf1	7	16	cord_uid	cord_uid	NNS
cord-014462-11ggaqf1	7	17	:	:	:
cord-014462-11ggaqf1	8	1	11ggaqf1	11ggaqf1	LS
cord-014462-11ggaqf1	9	1	nan	nan	NNP
cord-014462-11ggaqf1	9	2	patients	patient	NNS
cord-014462-11ggaqf1	9	3	showed	show	VBD
cord-014462-11ggaqf1	9	4	rashes	rash	NNS
cord-014462-11ggaqf1	9	5	on	on	IN
cord-014462-11ggaqf1	9	6	face	face	NN
cord-014462-11ggaqf1	9	7	,	,	,
cord-014462-11ggaqf1	9	8	hand	hand	NN
cord-014462-11ggaqf1	9	9	and	and	CC
cord-014462-11ggaqf1	9	10	foot	foot	NN
cord-014462-11ggaqf1	9	11	.	.	.
cord-014462-11ggaqf1	10	1	EV	ev	NN
cord-014462-11ggaqf1	10	2	detection	detection	NN
cord-014462-11ggaqf1	10	3	carried	carry	VBD
cord-014462-11ggaqf1	10	4	out	out	RP
cord-014462-11ggaqf1	10	5	in	in	IN
cord-014462-11ggaqf1	10	6	vesicular	vesicular	JJ
cord-014462-11ggaqf1	10	7	fluid	fluid	NN
cord-014462-11ggaqf1	10	8	,	,	,
cord-014462-11ggaqf1	10	9	stool	stool	NN
cord-014462-11ggaqf1	10	10	,	,	,
cord-014462-11ggaqf1	10	11	serum	serum	NN
cord-014462-11ggaqf1	10	12	and	and	CC
cord-014462-11ggaqf1	10	13	throat	throat	NN
cord-014462-11ggaqf1	10	14	swab	swab	NN
cord-014462-11ggaqf1	10	15	specimens	specimen	NNS
cord-014462-11ggaqf1	10	16	by	by	IN
cord-014462-11ggaqf1	10	17	RT	RT	NNP
cord-014462-11ggaqf1	10	18	-	-	HYPH
cord-014462-11ggaqf1	10	19	PCR	PCR	NNP
cord-014462-11ggaqf1	10	20	of	of	IN
cord-014462-11ggaqf1	10	21	5	5	CD
cord-014462-11ggaqf1	10	22	0	0	CD
cord-014462-11ggaqf1	10	23	NCR	NCR	NNP
cord-014462-11ggaqf1	10	24	gene	gene	NN
cord-014462-11ggaqf1	10	25	.	.	.
cord-014462-11ggaqf1	11	1	Serotyping	Serotyping	NNP
cord-014462-11ggaqf1	11	2	was	be	VBD
cord-014462-11ggaqf1	11	3	carried	carry	VBN
cord-014462-11ggaqf1	11	4	out	out	RP
cord-014462-11ggaqf1	11	5	by	by	IN
cord-014462-11ggaqf1	11	6	using	use	VBG
cord-014462-11ggaqf1	11	7	RT	RT	NNP
cord-014462-11ggaqf1	11	8	-	-	HYPH
cord-014462-11ggaqf1	11	9	PCR	PCR	NNP
cord-014462-11ggaqf1	11	10	of	of	IN
cord-014462-11ggaqf1	11	11	viral	viral	JJ
cord-014462-11ggaqf1	11	12	protein	protein	NN
cord-014462-11ggaqf1	11	13	of	of	IN
cord-014462-11ggaqf1	11	14	VP1/2A	VP1/2A	NNP
cord-014462-11ggaqf1	11	15	junction	junction	NN
cord-014462-11ggaqf1	11	16	region	region	NN
cord-014462-11ggaqf1	11	17	followed	follow	VBN
cord-014462-11ggaqf1	11	18	by	by	IN
cord-014462-11ggaqf1	11	19	sequencing	sequence	VBG
cord-014462-11ggaqf1	11	20	and	and	CC
cord-014462-11ggaqf1	11	21	phylogenetic	phylogenetic	NN
cord-014462-11ggaqf1	11	22	analysis	analysis	NN
cord-014462-11ggaqf1	11	23	using	use	VBG
cord-014462-11ggaqf1	11	24	neighbor	neighbor	NN
cord-014462-11ggaqf1	11	25	-	-	HYPH
cord-014462-11ggaqf1	11	26	joining	join	VBG
cord-014462-11ggaqf1	11	27	-	-	HYPH
cord-014462-11ggaqf1	11	28	algorithm	algorithm	NN
cord-014462-11ggaqf1	11	29	and	and	CC
cord-014462-11ggaqf1	11	30	Kimura-2	Kimura-2	NNP
cord-014462-11ggaqf1	11	31	parameter	parameter	NN
cord-014462-11ggaqf1	11	32	model	model	NN
cord-014462-11ggaqf1	11	33	of	of	IN
cord-014462-11ggaqf1	11	34	MEGA-4	MEGA-4	NNS
cord-014462-11ggaqf1	11	35	software	software	NN
cord-014462-11ggaqf1	11	36	.	.	.
cord-014462-11ggaqf1	12	1	Overall	overall	JJ
cord-014462-11ggaqf1	12	2	EV	EV	NNP
cord-014462-11ggaqf1	12	3	positivity	positivity	NN
cord-014462-11ggaqf1	12	4	detected	detect	VBD
cord-014462-11ggaqf1	12	5	in	in	IN
cord-014462-11ggaqf1	12	6	HFMD	HFMD	NNP
cord-014462-11ggaqf1	12	7	patients	patient	NNS
cord-014462-11ggaqf1	12	8	from	from	IN
cord-014462-11ggaqf1	12	9	Kerala	Kerala	NNP
cord-014462-11ggaqf1	12	10	,	,	,
cord-014462-11ggaqf1	12	11	Tamil	Tamil	NNP
cord-014462-11ggaqf1	12	12	Nadu	Nadu	NNP
cord-014462-11ggaqf1	12	13	,	,	,
cord-014462-11ggaqf1	12	14	West	West	NNP
cord-014462-11ggaqf1	12	15	Bengal	Bengal	NNP
cord-014462-11ggaqf1	12	16	and	and	CC
cord-014462-11ggaqf1	12	17	Orissa	Orissa	NNP
cord-014462-11ggaqf1	12	18	states	state	NNS
cord-014462-11ggaqf1	12	19	was	be	VBD
cord-014462-11ggaqf1	12	20	found	find	VBN
cord-014462-11ggaqf1	12	21	to	to	TO
cord-014462-11ggaqf1	12	22	be	be	VB
cord-014462-11ggaqf1	12	23	51.6	51.6	CD
cord-014462-11ggaqf1	12	24	%	%	NN
cord-014462-11ggaqf1	12	25	,	,	,
cord-014462-11ggaqf1	12	26	66.6	66.6	CD
cord-014462-11ggaqf1	12	27	%	%	NN
cord-014462-11ggaqf1	12	28	,	,	,
cord-014462-11ggaqf1	12	29	62.5	62.5	CD
cord-014462-11ggaqf1	12	30	%	%	NN
cord-014462-11ggaqf1	12	31	and	and	CC
cord-014462-11ggaqf1	12	32	71.4	71.4	CD
cord-014462-11ggaqf1	12	33	%	%	NN
cord-014462-11ggaqf1	12	34	respectively	respectively	RB
cord-014462-11ggaqf1	12	35	.	.	.
cord-014462-11ggaqf1	13	1	Typing	type	VBG
cord-014462-11ggaqf1	13	2	of	of	IN
cord-014462-11ggaqf1	13	3	VP1	vp1	NN
cord-014462-11ggaqf1	13	4	gene	gene	NN
cord-014462-11ggaqf1	13	5	sequences	sequence	NNS
cord-014462-11ggaqf1	13	6	indicated	indicate	VBD
cord-014462-11ggaqf1	13	7	presence	presence	NN
cord-014462-11ggaqf1	13	8	of	of	IN
cord-014462-11ggaqf1	13	9	CA-6	CA-6	NNP
cord-014462-11ggaqf1	13	10	,	,	,
cord-014462-11ggaqf1	13	11	EV-71	EV-71	NNP
cord-014462-11ggaqf1	13	12	,	,	,
cord-014462-11ggaqf1	13	13	Echo-9	Echo-9	NNP
cord-014462-11ggaqf1	13	14	strains	strain	NNS
cord-014462-11ggaqf1	13	15	in	in	IN
cord-014462-11ggaqf1	13	16	Kerala	Kerala	NNP
cord-014462-11ggaqf1	13	17	and	and	CC
cord-014462-11ggaqf1	13	18	CA-16	CA-16	NNP
cord-014462-11ggaqf1	13	19	in	in	IN
cord-014462-11ggaqf1	13	20	West	West	NNP
cord-014462-11ggaqf1	13	21	Bengal	Bengal	NNP
cord-014462-11ggaqf1	13	22	,	,	,
cord-014462-11ggaqf1	13	23	Orissa	Orissa	NNP
cord-014462-11ggaqf1	13	24	and	and	CC
cord-014462-11ggaqf1	13	25	Tamil	Tamil	NNP
cord-014462-11ggaqf1	13	26	Nadu	Nadu	NNP
cord-014462-11ggaqf1	13	27	.	.	.
cord-014462-11ggaqf1	14	1	Phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	14	2	analysis	analysis	NN
cord-014462-11ggaqf1	14	3	indicated	indicate	VBD
cord-014462-11ggaqf1	14	4	CA-6	CA-6	NNP
cord-014462-11ggaqf1	14	5	,	,	,
cord-014462-11ggaqf1	14	6	EV-71	EV-71	NNP
cord-014462-11ggaqf1	14	7	,	,	,
cord-014462-11ggaqf1	14	8	Echo-9	Echo-9	NNP
cord-014462-11ggaqf1	14	9	strains	strain	NNS
cord-014462-11ggaqf1	14	10	showed	show	VBD
cord-014462-11ggaqf1	14	11	94.8	94.8	CD
cord-014462-11ggaqf1	14	12	-	-	HYPH
cord-014462-11ggaqf1	14	13	95.7	95.7	CD
cord-014462-11ggaqf1	14	14	%	%	NN
cord-014462-11ggaqf1	14	15	and	and	CC
cord-014462-11ggaqf1	14	16	95	95	CD
cord-014462-11ggaqf1	14	17	-	-	HYPH
cord-014462-11ggaqf1	14	18	94.4	94.4	CD
cord-014462-11ggaqf1	14	19	%	%	NN
cord-014462-11ggaqf1	14	20	homology	homology	NN
cord-014462-11ggaqf1	14	21	with	with	IN
cord-014462-11ggaqf1	14	22	Japanese	japanese	JJ
cord-014462-11ggaqf1	14	23	,	,	,
cord-014462-11ggaqf1	14	24	Australian	australian	JJ
cord-014462-11ggaqf1	14	25	and	and	CC
cord-014462-11ggaqf1	14	26	French	french	JJ
cord-014462-11ggaqf1	14	27	strains	strain	NNS
cord-014462-11ggaqf1	14	28	.	.	.
cord-014462-11ggaqf1	15	1	However	however	RB
cord-014462-11ggaqf1	15	2	,	,	,
cord-014462-11ggaqf1	15	3	CA-16	CA-16	NNP
cord-014462-11ggaqf1	15	4	strains	strain	NNS
cord-014462-11ggaqf1	15	5	were	be	VBD
cord-014462-11ggaqf1	15	6	closer	close	JJR
cord-014462-11ggaqf1	15	7	to	to	IN
cord-014462-11ggaqf1	15	8	Malaysian	malaysian	JJ
cord-014462-11ggaqf1	15	9	strains	strain	NNS
cord-014462-11ggaqf1	15	10	with	with	IN
cord-014462-11ggaqf1	15	11	91.2	91.2	CD
cord-014462-11ggaqf1	15	12	-	-	HYPH
cord-014462-11ggaqf1	15	13	95.6	95.6	CD
cord-014462-11ggaqf1	15	14	%	%	NN
cord-014462-11ggaqf1	15	15	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	15	16	homology	homology	NN
cord-014462-11ggaqf1	15	17	.	.	.
cord-014462-11ggaqf1	16	1	The	the	DT
cord-014462-11ggaqf1	16	2	present	present	JJ
cord-014462-11ggaqf1	16	3	study	study	NN
cord-014462-11ggaqf1	16	4	documents	document	VBZ
cord-014462-11ggaqf1	16	5	the	the	DT
cord-014462-11ggaqf1	16	6	association	association	NN
cord-014462-11ggaqf1	16	7	of	of	IN
cord-014462-11ggaqf1	16	8	multiple	multiple	JJ
cord-014462-11ggaqf1	16	9	types	type	NNS
cord-014462-11ggaqf1	16	10	of	of	IN
cord-014462-11ggaqf1	16	11	EV	ev	NN
cord-014462-11ggaqf1	16	12	's	's	POS
cord-014462-11ggaqf1	16	13	i.e.	i.e.	FW
cord-014462-11ggaqf1	16	14	,	,	,
cord-014462-11ggaqf1	16	15	CA-6	CA-6	NNP
cord-014462-11ggaqf1	16	16	,	,	,
cord-014462-11ggaqf1	16	17	EV-71	EV-71	NNP
cord-014462-11ggaqf1	16	18	,	,	,
cord-014462-11ggaqf1	16	19	Echo-9	Echo-9	NNP
cord-014462-11ggaqf1	16	20	and	and	CC
cord-014462-11ggaqf1	16	21	CA-16	CA-16	NNP
cord-014462-11ggaqf1	16	22	strains	strain	NNS
cord-014462-11ggaqf1	16	23	contributing	contribute	VBG
cord-014462-11ggaqf1	16	24	as	as	IN
cord-014462-11ggaqf1	16	25	prime	prime	JJ
cord-014462-11ggaqf1	16	26	viral	viral	JJ
cord-014462-11ggaqf1	16	27	pathogens	pathogen	NNS
cord-014462-11ggaqf1	16	28	in	in	IN
cord-014462-11ggaqf1	16	29	HFMD	HFMD	NNP
cord-014462-11ggaqf1	16	30	epidemics	epidemic	NNS
cord-014462-11ggaqf1	16	31	in	in	IN
cord-014462-11ggaqf1	16	32	the	the	DT
cord-014462-11ggaqf1	16	33	reported	report	VBN
cord-014462-11ggaqf1	16	34	regions	region	NNS
cord-014462-11ggaqf1	16	35	with	with	IN
cord-014462-11ggaqf1	16	36	new	new	JJ
cord-014462-11ggaqf1	16	37	emergence	emergence	NN
cord-014462-11ggaqf1	16	38	of	of	IN
cord-014462-11ggaqf1	16	39	CA-6	CA-6	NNP
cord-014462-11ggaqf1	16	40	circulating	circulate	VBG
cord-014462-11ggaqf1	16	41	strain	strain	NN
cord-014462-11ggaqf1	16	42	in	in	IN
cord-014462-11ggaqf1	16	43	Kerala	Kerala	NNP
cord-014462-11ggaqf1	16	44	,	,	,
cord-014462-11ggaqf1	16	45	India	India	NNP
cord-014462-11ggaqf1	16	46	.	.	.
cord-014462-11ggaqf1	17	1	Tasgaon	Tasgaon	NNP
cord-014462-11ggaqf1	17	2	September	September	NNP
cord-014462-11ggaqf1	17	3	2010	2010	CD
cord-014462-11ggaqf1	17	4	.	.	.
cord-014462-11ggaqf1	18	1	Sera	Sera	NNP
cord-014462-11ggaqf1	18	2	were	be	VBD
cord-014462-11ggaqf1	18	3	collected	collect	VBN
cord-014462-11ggaqf1	18	4	from	from	IN
cord-014462-11ggaqf1	18	5	162	162	CD
cord-014462-11ggaqf1	18	6	suspected	suspect	VBN
cord-014462-11ggaqf1	18	7	hepatitis	hepatitis	NN
cord-014462-11ggaqf1	18	8	cases	case	NNS
cord-014462-11ggaqf1	18	9	and	and	CC
cord-014462-11ggaqf1	18	10	there	there	EX
cord-014462-11ggaqf1	18	11	contacts	contact	NNS
cord-014462-11ggaqf1	18	12	and	and	CC
cord-014462-11ggaqf1	18	13	tested	test	VBN
cord-014462-11ggaqf1	18	14	for	for	IN
cord-014462-11ggaqf1	18	15	anti	anti	JJ
cord-014462-11ggaqf1	18	16	HEV	HEV	NNP
cord-014462-11ggaqf1	18	17	IgM	IgM	NNP
cord-014462-11ggaqf1	18	18	/	/	SYM
cord-014462-11ggaqf1	18	19	IgG	IgG	NNP
cord-014462-11ggaqf1	18	20	antibodies	antibodies	NNP
cord-014462-11ggaqf1	18	21	(	(	-LRB-
cord-014462-11ggaqf1	18	22	ELISA	ELISA	NNP
cord-014462-11ggaqf1	18	23	)	)	-RRB-
cord-014462-11ggaqf1	18	24	and	and	CC
cord-014462-11ggaqf1	18	25	liver	liver	NN
cord-014462-11ggaqf1	18	26	enzymes	enzyme	NNS
cord-014462-11ggaqf1	18	27	like	like	IN
cord-014462-11ggaqf1	18	28	Alanine	Alanine	NNP
cord-014462-11ggaqf1	18	29	Aminotransferase	Aminotransferase	NNP
cord-014462-11ggaqf1	18	30	(	(	-LRB-
cord-014462-11ggaqf1	18	31	ALT	ALT	NNP
cord-014462-11ggaqf1	18	32	)	)	-RRB-
cord-014462-11ggaqf1	18	33	.	.	.
cord-014462-11ggaqf1	19	1	Anti	Anti	NNP
cord-014462-11ggaqf1	19	2	HEV	HEV	NNP
cord-014462-11ggaqf1	19	3	IgM	IgM	NNP
cord-014462-11ggaqf1	19	4	antibodies	antibody	NNS
cord-014462-11ggaqf1	19	5	were	be	VBD
cord-014462-11ggaqf1	19	6	detected	detect	VBN
cord-014462-11ggaqf1	19	7	in	in	IN
cord-014462-11ggaqf1	19	8	45.7	45.7	CD
cord-014462-11ggaqf1	19	9	%	%	NN
cord-014462-11ggaqf1	19	10	(	(	-LRB-
cord-014462-11ggaqf1	19	11	74/162	74/162	CD
cord-014462-11ggaqf1	19	12	)	)	-RRB-
cord-014462-11ggaqf1	19	13	of	of	IN
cord-014462-11ggaqf1	19	14	the	the	DT
cord-014462-11ggaqf1	19	15	suspected	suspect	VBN
cord-014462-11ggaqf1	19	16	cases	case	NNS
cord-014462-11ggaqf1	19	17	.	.	.
cord-014462-11ggaqf1	20	1	The	the	DT
cord-014462-11ggaqf1	20	2	overall	overall	JJ
cord-014462-11ggaqf1	20	3	attack	attack	NN
cord-014462-11ggaqf1	20	4	rate	rate	NN
cord-014462-11ggaqf1	20	5	was	be	VBD
cord-014462-11ggaqf1	20	6	0.7	0.7	CD
cord-014462-11ggaqf1	20	7	%	%	NN
cord-014462-11ggaqf1	20	8	.	.	.
cord-014462-11ggaqf1	21	1	Male	male	JJ
cord-014462-11ggaqf1	21	2	to	to	IN
cord-014462-11ggaqf1	21	3	female	female	JJ
cord-014462-11ggaqf1	21	4	ratio	ratio	NN
cord-014462-11ggaqf1	21	5	was	be	VBD
cord-014462-11ggaqf1	21	6	2:1	2:1	CD
cord-014462-11ggaqf1	21	7	.	.	.
cord-014462-11ggaqf1	22	1	Majority	majority	NN
cord-014462-11ggaqf1	22	2	(	(	-LRB-
cord-014462-11ggaqf1	22	3	60.4	60.4	CD
cord-014462-11ggaqf1	22	4	%	%	NN
cord-014462-11ggaqf1	22	5	)	)	-RRB-
cord-014462-11ggaqf1	22	6	of	of	IN
cord-014462-11ggaqf1	22	7	the	the	DT
cord-014462-11ggaqf1	22	8	cases	case	NNS
cord-014462-11ggaqf1	22	9	were	be	VBD
cord-014462-11ggaqf1	22	10	in	in	IN
cord-014462-11ggaqf1	22	11	the	the	DT
cord-014462-11ggaqf1	22	12	age	age	NN
cord-014462-11ggaqf1	22	13	group	group	NN
cord-014462-11ggaqf1	22	14	20	20	CD
cord-014462-11ggaqf1	22	15	-	-	SYM
cord-014462-11ggaqf1	22	16	40	40	CD
cord-014462-11ggaqf1	22	17	years	year	NNS
cord-014462-11ggaqf1	22	18	and	and	CC
cord-014462-11ggaqf1	22	19	recovered	recover	VBD
cord-014462-11ggaqf1	22	20	without	without	IN
cord-014462-11ggaqf1	22	21	any	any	DT
cord-014462-11ggaqf1	22	22	clinical	clinical	JJ
cord-014462-11ggaqf1	22	23	complications	complication	NNS
cord-014462-11ggaqf1	22	24	.	.	.
cord-014462-11ggaqf1	23	1	Weekly	weekly	JJ
cord-014462-11ggaqf1	23	2	distribution	distribution	NN
cord-014462-11ggaqf1	23	3	of	of	IN
cord-014462-11ggaqf1	23	4	cases	case	NNS
cord-014462-11ggaqf1	23	5	showed	show	VBD
cord-014462-11ggaqf1	23	6	that	that	IN
cord-014462-11ggaqf1	23	7	the	the	DT
cord-014462-11ggaqf1	23	8	majority	majority	NN
cord-014462-11ggaqf1	23	9	(	(	-LRB-
cord-014462-11ggaqf1	23	10	79.4	79.4	CD
cord-014462-11ggaqf1	23	11	%	%	NN
cord-014462-11ggaqf1	23	12	,	,	,
cord-014462-11ggaqf1	23	13	116/146	116/146	CD
cord-014462-11ggaqf1	23	14	)	)	-RRB-
cord-014462-11ggaqf1	23	15	cases	case	NNS
cord-014462-11ggaqf1	23	16	occurred	occur	VBD
cord-014462-11ggaqf1	23	17	between	between	IN
cord-014462-11ggaqf1	23	18	2nd	2nd	JJ
cord-014462-11ggaqf1	23	19	and	and	CC
cord-014462-11ggaqf1	23	20	3rd	3rd	JJ
cord-014462-11ggaqf1	23	21	week	week	NN
cord-014462-11ggaqf1	23	22	of	of	IN
cord-014462-11ggaqf1	23	23	June	June	NNP
cord-014462-11ggaqf1	23	24	.	.	.
cord-014462-11ggaqf1	24	1	Dark	dark	JJ
cord-014462-11ggaqf1	24	2	urine	urine	NN
cord-014462-11ggaqf1	24	3	(	(	-LRB-
cord-014462-11ggaqf1	24	4	97.5	97.5	CD
cord-014462-11ggaqf1	24	5	%	%	NN
cord-014462-11ggaqf1	24	6	)	)	-RRB-
cord-014462-11ggaqf1	24	7	,	,	,
cord-014462-11ggaqf1	24	8	jaundice	jaundice	NN
cord-014462-11ggaqf1	24	9	(	(	-LRB-
cord-014462-11ggaqf1	24	10	93.5	93.5	CD
cord-014462-11ggaqf1	24	11	%	%	NN
cord-014462-11ggaqf1	24	12	)	)	-RRB-
cord-014462-11ggaqf1	24	13	,	,	,
cord-014462-11ggaqf1	24	14	fatigue	fatigue	NN
cord-014462-11ggaqf1	24	15	(	(	-LRB-
cord-014462-11ggaqf1	24	16	35.9	35.9	CD
cord-014462-11ggaqf1	24	17	%	%	NN
cord-014462-11ggaqf1	24	18	)	)	-RRB-
cord-014462-11ggaqf1	24	19	,	,	,
cord-014462-11ggaqf1	24	20	abdominal	abdominal	JJ
cord-014462-11ggaqf1	24	21	pain	pain	NN
cord-014462-11ggaqf1	24	22	(	(	-LRB-
cord-014462-11ggaqf1	24	23	32.6	32.6	CD
cord-014462-11ggaqf1	24	24	%	%	NN
cord-014462-11ggaqf1	24	25	)	)	-RRB-
cord-014462-11ggaqf1	24	26	,	,	,
cord-014462-11ggaqf1	24	27	anorexia	anorexia	NN
cord-014462-11ggaqf1	24	28	(	(	-LRB-
cord-014462-11ggaqf1	24	29	29.4	29.4	CD
cord-014462-11ggaqf1	24	30	%	%	NN
cord-014462-11ggaqf1	24	31	)	)	-RRB-
cord-014462-11ggaqf1	24	32	,	,	,
cord-014462-11ggaqf1	24	33	vomiting	vomit	VBG
cord-014462-11ggaqf1	24	34	(	(	-LRB-
cord-014462-11ggaqf1	24	35	26.5	26.5	CD
cord-014462-11ggaqf1	24	36	%	%	NN
cord-014462-11ggaqf1	24	37	)	)	-RRB-
cord-014462-11ggaqf1	24	38	,	,	,
cord-014462-11ggaqf1	24	39	fever	fever	NN
cord-014462-11ggaqf1	24	40	(	(	-LRB-
cord-014462-11ggaqf1	24	41	22.8	22.8	CD
cord-014462-11ggaqf1	24	42	%	%	NN
cord-014462-11ggaqf1	24	43	)	)	-RRB-
cord-014462-11ggaqf1	24	44	,	,	,
cord-014462-11ggaqf1	24	45	giddiness	giddiness	NN
cord-014462-11ggaqf1	24	46	(	(	-LRB-
cord-014462-11ggaqf1	24	47	14.3	14.3	CD
cord-014462-11ggaqf1	24	48	%	%	NN
cord-014462-11ggaqf1	24	49	)	)	-RRB-
cord-014462-11ggaqf1	24	50	,	,	,
cord-014462-11ggaqf1	24	51	diarrhoea	diarrhoea	NN
cord-014462-11ggaqf1	24	52	(	(	-LRB-
cord-014462-11ggaqf1	24	53	12.6	12.6	CD
cord-014462-11ggaqf1	24	54	%	%	NN
cord-014462-11ggaqf1	24	55	)	)	-RRB-
cord-014462-11ggaqf1	24	56	and	and	CC
cord-014462-11ggaqf1	24	57	arthalgia	arthalgia	NNP
cord-014462-11ggaqf1	24	58	(	(	-LRB-
cord-014462-11ggaqf1	24	59	3.7	3.7	CD
cord-014462-11ggaqf1	24	60	%	%	NN
cord-014462-11ggaqf1	24	61	)	)	-RRB-
cord-014462-11ggaqf1	24	62	were	be	VBD
cord-014462-11ggaqf1	24	63	the	the	DT
cord-014462-11ggaqf1	24	64	prominent	prominent	JJ
cord-014462-11ggaqf1	24	65	symptoms	symptom	NNS
cord-014462-11ggaqf1	24	66	.	.	.
cord-014462-11ggaqf1	25	1	Sera	Sera	NNP
cord-014462-11ggaqf1	25	2	collected	collect	VBD
cord-014462-11ggaqf1	25	3	from	from	IN
cord-014462-11ggaqf1	25	4	73	73	CD
cord-014462-11ggaqf1	25	5	antenatal	antenatal	JJ
cord-014462-11ggaqf1	25	6	cases	case	NNS
cord-014462-11ggaqf1	25	7	(	(	-LRB-
cord-014462-11ggaqf1	25	8	ANCs	ANCs	NNP
cord-014462-11ggaqf1	25	9	)	)	-RRB-
cord-014462-11ggaqf1	26	1	showed	show	VBD
cord-014462-11ggaqf1	26	2	anti	anti	NNP
cord-014462-11ggaqf1	26	3	HEV	HEV	NNP
cord-014462-11ggaqf1	26	4	IgM	IgM	NNP
cord-014462-11ggaqf1	26	5	antibody	antibody	NN
cord-014462-11ggaqf1	26	6	in	in	IN
cord-014462-11ggaqf1	26	7	3	3	CD
cord-014462-11ggaqf1	26	8	.	.	.
cord-014462-11ggaqf1	27	1	Affected	affected	JJ
cord-014462-11ggaqf1	27	2	pregnant	pregnant	JJ
cord-014462-11ggaqf1	27	3	women	woman	NNS
cord-014462-11ggaqf1	27	4	had	have	VBD
cord-014462-11ggaqf1	27	5	a	a	DT
cord-014462-11ggaqf1	27	6	normal	normal	JJ
cord-014462-11ggaqf1	27	7	outcome	outcome	NN
cord-014462-11ggaqf1	27	8	.	.	.
cord-014462-11ggaqf1	28	1	A	a	DT
cord-014462-11ggaqf1	28	2	death	death	NN
cord-014462-11ggaqf1	28	3	of	of	IN
cord-014462-11ggaqf1	28	4	32	32	CD
cord-014462-11ggaqf1	28	5	year	year	NN
cord-014462-11ggaqf1	28	6	,	,	,
cord-014462-11ggaqf1	28	7	male	male	JJ
cord-014462-11ggaqf1	28	8	hepatitis	hepatitis	NN
cord-014462-11ggaqf1	28	9	E	e	NN
cord-014462-11ggaqf1	28	10	case	case	NN
cord-014462-11ggaqf1	28	11	was	be	VBD
cord-014462-11ggaqf1	28	12	reported	report	VBN
cord-014462-11ggaqf1	28	13	during	during	IN
cord-014462-11ggaqf1	28	14	the	the	DT
cord-014462-11ggaqf1	28	15	outbreak	outbreak	NN
cord-014462-11ggaqf1	28	16	period	period	NN
cord-014462-11ggaqf1	28	17	that	that	WDT
cord-014462-11ggaqf1	28	18	had	have	VBD
cord-014462-11ggaqf1	28	19	cirrhosis	cirrhosi	NNS
cord-014462-11ggaqf1	28	20	of	of	IN
cord-014462-11ggaqf1	28	21	liver	liver	NN
cord-014462-11ggaqf1	28	22	with	with	IN
cord-014462-11ggaqf1	28	23	oesophageal	oesophageal	JJ
cord-014462-11ggaqf1	28	24	varices	varix	NNS
cord-014462-11ggaqf1	28	25	.	.	.
cord-014462-11ggaqf1	29	1	Sanitary	sanitary	JJ
cord-014462-11ggaqf1	29	2	survey	survey	NN
cord-014462-11ggaqf1	29	3	revealed	reveal	VBD
cord-014462-11ggaqf1	29	4	that	that	IN
cord-014462-11ggaqf1	29	5	water	water	NN
cord-014462-11ggaqf1	29	6	pipelines	pipeline	NNS
cord-014462-11ggaqf1	29	7	were	be	VBD
cord-014462-11ggaqf1	29	8	laid	lay	VBN
cord-014462-11ggaqf1	29	9	down	down	RP
cord-014462-11ggaqf1	29	10	in	in	IN
cord-014462-11ggaqf1	29	11	close	close	JJ
cord-014462-11ggaqf1	29	12	proximity	proximity	NN
cord-014462-11ggaqf1	29	13	of	of	IN
cord-014462-11ggaqf1	29	14	sewerage	sewerage	NN
cord-014462-11ggaqf1	29	15	system	system	NN
cord-014462-11ggaqf1	29	16	,	,	,
cord-014462-11ggaqf1	29	17	and	and	CC
cord-014462-11ggaqf1	29	18	water	water	NN
cord-014462-11ggaqf1	29	19	posts	post	NNS
cord-014462-11ggaqf1	29	20	were	be	VBD
cord-014462-11ggaqf1	29	21	without	without	IN
cord-014462-11ggaqf1	29	22	tap	tap	NN
cord-014462-11ggaqf1	29	23	.	.	.
cord-014462-11ggaqf1	30	1	These	these	DT
cord-014462-11ggaqf1	30	2	are	be	VBP
cord-014462-11ggaqf1	30	3	the	the	DT
cord-014462-11ggaqf1	30	4	likely	likely	JJ
cord-014462-11ggaqf1	30	5	sources	source	NNS
cord-014462-11ggaqf1	30	6	of	of	IN
cord-014462-11ggaqf1	30	7	faecal	faecal	JJ
cord-014462-11ggaqf1	30	8	contamination	contamination	NN
cord-014462-11ggaqf1	30	9	of	of	IN
cord-014462-11ggaqf1	30	10	water	water	NN
cord-014462-11ggaqf1	30	11	supplies	supply	NNS
cord-014462-11ggaqf1	30	12	.	.	.
cord-014462-11ggaqf1	31	1	Among	among	IN
cord-014462-11ggaqf1	31	2	17	17	CD
cord-014462-11ggaqf1	31	3	water	water	NN
cord-014462-11ggaqf1	31	4	samples	sample	NNS
cord-014462-11ggaqf1	31	5	collected	collect	VBN
cord-014462-11ggaqf1	31	6	from	from	IN
cord-014462-11ggaqf1	31	7	various	various	JJ
cord-014462-11ggaqf1	31	8	places	place	NNS
cord-014462-11ggaqf1	31	9	,	,	,
cord-014462-11ggaqf1	31	10	5	5	CD
cord-014462-11ggaqf1	31	11	were	be	VBD
cord-014462-11ggaqf1	31	12	found	find	VBN
cord-014462-11ggaqf1	31	13	to	to	TO
cord-014462-11ggaqf1	31	14	be	be	VB
cord-014462-11ggaqf1	31	15	unfit	unfit	JJ
cord-014462-11ggaqf1	31	16	for	for	IN
cord-014462-11ggaqf1	31	17	drinking	drink	VBG
cord-014462-11ggaqf1	31	18	based	base	VBN
cord-014462-11ggaqf1	31	19	on	on	IN
cord-014462-11ggaqf1	31	20	the	the	DT
cord-014462-11ggaqf1	31	21	routine	routine	JJ
cord-014462-11ggaqf1	31	22	bacteriological	bacteriological	JJ
cord-014462-11ggaqf1	31	23	tests	test	NNS
cord-014462-11ggaqf1	31	24	conducted	conduct	VBN
cord-014462-11ggaqf1	31	25	at	at	IN
cord-014462-11ggaqf1	31	26	State	State	NNP
cord-014462-11ggaqf1	31	27	Public	Public	NNP
cord-014462-11ggaqf1	31	28	Health	Health	NNP
cord-014462-11ggaqf1	31	29	Laboratory	Laboratory	NNP
cord-014462-11ggaqf1	31	30	,	,	,
cord-014462-11ggaqf1	31	31	Pune	Pune	NNP
cord-014462-11ggaqf1	31	32	.	.	.
cord-014462-11ggaqf1	32	1	No	no	DT
cord-014462-11ggaqf1	32	2	case	case	NN
cord-014462-11ggaqf1	32	3	occurred	occur	VBD
cord-014462-11ggaqf1	32	4	after	after	IN
cord-014462-11ggaqf1	32	5	the	the	DT
cord-014462-11ggaqf1	32	6	pipelines	pipeline	NNS
cord-014462-11ggaqf1	32	7	were	be	VBD
cord-014462-11ggaqf1	32	8	repaired	repair	VBN
cord-014462-11ggaqf1	32	9	.	.	.
cord-014462-11ggaqf1	33	1	This	this	DT
cord-014462-11ggaqf1	33	2	typical	typical	JJ
cord-014462-11ggaqf1	33	3	outbreak	outbreak	NN
cord-014462-11ggaqf1	33	4	of	of	IN
cord-014462-11ggaqf1	33	5	hepatitis	hepatitis	NN
cord-014462-11ggaqf1	33	6	E	E	NNP
cord-014462-11ggaqf1	33	7	re	re	NN
cord-014462-11ggaqf1	33	8	-	-	NN
cord-014462-11ggaqf1	33	9	emphasizes	emphasize	VBZ
cord-014462-11ggaqf1	33	10	need	need	NN
cord-014462-11ggaqf1	33	11	for	for	IN
cord-014462-11ggaqf1	33	12	proper	proper	JJ
cord-014462-11ggaqf1	33	13	water	water	NN
cord-014462-11ggaqf1	33	14	supply	supply	NN
cord-014462-11ggaqf1	33	15	/	/	SYM
cord-014462-11ggaqf1	33	16	sewage	sewage	NN
cord-014462-11ggaqf1	33	17	disposal	disposal	NN
cord-014462-11ggaqf1	33	18	pipelines	pipeline	NNS
cord-014462-11ggaqf1	33	19	and	and	CC
cord-014462-11ggaqf1	33	20	adequate	adequate	JJ
cord-014462-11ggaqf1	33	21	maintenance	maintenance	NN
cord-014462-11ggaqf1	33	22	measures	measure	NNS
cord-014462-11ggaqf1	33	23	.	.	.
cord-014462-11ggaqf1	34	1	Jayanthi	Jayanthi	NNP
cord-014462-11ggaqf1	34	2	Shastri	Shastri	NNP
cord-014462-11ggaqf1	34	3	,	,	,
cord-014462-11ggaqf1	34	4	Nilima	Nilima	NNP
cord-014462-11ggaqf1	34	5	Vaidya	Vaidya	NNP
cord-014462-11ggaqf1	34	6	,	,	,
cord-014462-11ggaqf1	34	7	Sandhya	Sandhya	NNP
cord-014462-11ggaqf1	34	8	Sawant	Sawant	NNP
cord-014462-11ggaqf1	34	9	,	,	,
cord-014462-11ggaqf1	34	10	Umesh	Umesh	NNP
cord-014462-11ggaqf1	34	11	Aigal	Aigal	NNP
cord-014462-11ggaqf1	34	12	Department	Department	NNP
cord-014462-11ggaqf1	34	13	of	of	IN
cord-014462-11ggaqf1	34	14	Molecular	Molecular	NNP
cord-014462-11ggaqf1	34	15	Biology	Biology	NNP
cord-014462-11ggaqf1	34	16	,	,	,
cord-014462-11ggaqf1	34	17	Kasturba	Kasturba	NNP
cord-014462-11ggaqf1	34	18	Hospital	Hospital	NNP
cord-014462-11ggaqf1	34	19	for	for	IN
cord-014462-11ggaqf1	34	20	Infectious	Infectious	NNP
cord-014462-11ggaqf1	34	21	Diseases	Diseases	NNPS
cord-014462-11ggaqf1	34	22	,	,	,
cord-014462-11ggaqf1	34	23	Mumbai	Mumbai	NNP
cord-014462-11ggaqf1	34	24	,	,	,
cord-014462-11ggaqf1	34	25	India	India	NNP
cord-014462-11ggaqf1	34	26	Dengue	Dengue	NNP
cord-014462-11ggaqf1	34	27	and	and	CC
cord-014462-11ggaqf1	34	28	Dengue	Dengue	NNP
cord-014462-11ggaqf1	34	29	haemorrhagic	haemorrhagic	JJ
cord-014462-11ggaqf1	34	30	fever	fever	NN
cord-014462-11ggaqf1	34	31	are	be	VBP
cord-014462-11ggaqf1	34	32	amongst	amongst	IN
cord-014462-11ggaqf1	34	33	the	the	DT
cord-014462-11ggaqf1	34	34	most	most	RBS
cord-014462-11ggaqf1	34	35	important	important	JJ
cord-014462-11ggaqf1	34	36	challenges	challenge	NNS
cord-014462-11ggaqf1	34	37	in	in	IN
cord-014462-11ggaqf1	34	38	tropical	tropical	JJ
cord-014462-11ggaqf1	34	39	diseases	disease	NNS
cord-014462-11ggaqf1	34	40	due	due	IN
cord-014462-11ggaqf1	34	41	to	to	IN
cord-014462-11ggaqf1	34	42	their	-PRON-	PRP$
cord-014462-11ggaqf1	34	43	expanding	expand	VBG
cord-014462-11ggaqf1	34	44	geographic	geographic	JJ
cord-014462-11ggaqf1	34	45	distribution	distribution	NN
cord-014462-11ggaqf1	34	46	,	,	,
cord-014462-11ggaqf1	34	47	increasing	increase	VBG
cord-014462-11ggaqf1	34	48	outbreak	outbreak	NN
cord-014462-11ggaqf1	34	49	frequency	frequency	NN
cord-014462-11ggaqf1	34	50	,	,	,
cord-014462-11ggaqf1	34	51	hyperendemicity	hyperendemicity	NN
cord-014462-11ggaqf1	34	52	and	and	CC
cord-014462-11ggaqf1	34	53	evolution	evolution	NN
cord-014462-11ggaqf1	34	54	of	of	IN
cord-014462-11ggaqf1	34	55	virulence	virulence	NN
cord-014462-11ggaqf1	34	56	.	.	.
cord-014462-11ggaqf1	35	1	The	the	DT
cord-014462-11ggaqf1	35	2	gobal	gobal	JJ
cord-014462-11ggaqf1	35	3	prevalence	prevalence	NN
cord-014462-11ggaqf1	35	4	of	of	IN
cord-014462-11ggaqf1	35	5	dengue	dengue	NN
cord-014462-11ggaqf1	35	6	has	have	VBZ
cord-014462-11ggaqf1	35	7	grown	grow	VBN
cord-014462-11ggaqf1	35	8	dramatically	dramatically	RB
cord-014462-11ggaqf1	35	9	in	in	IN
cord-014462-11ggaqf1	35	10	recent	recent	JJ
cord-014462-11ggaqf1	35	11	decades	decade	NNS
cord-014462-11ggaqf1	35	12	.	.	.
cord-014462-11ggaqf1	36	1	WHO	who	WP
cord-014462-11ggaqf1	36	2	estimates	estimate	VBZ
cord-014462-11ggaqf1	36	3	50	50	CD
cord-014462-11ggaqf1	36	4	-	-	SYM
cord-014462-11ggaqf1	36	5	100	100	CD
cord-014462-11ggaqf1	36	6	million	million	CD
cord-014462-11ggaqf1	36	7	cases	case	NNS
cord-014462-11ggaqf1	36	8	of	of	IN
cord-014462-11ggaqf1	36	9	dengue	dengue	NN
cord-014462-11ggaqf1	36	10	virus	virus	NN
cord-014462-11ggaqf1	36	11	infections	infection	NNS
cord-014462-11ggaqf1	36	12	worldwide	worldwide	RB
cord-014462-11ggaqf1	36	13	every	every	DT
cord-014462-11ggaqf1	36	14	year	year	NN
cord-014462-11ggaqf1	36	15	resulting	result	VBG
cord-014462-11ggaqf1	36	16	in	in	IN
cord-014462-11ggaqf1	36	17	250,000	250,000	CD
cord-014462-11ggaqf1	36	18	to	to	TO
cord-014462-11ggaqf1	36	19	500,000	500,000	CD
cord-014462-11ggaqf1	36	20	cases	case	NNS
cord-014462-11ggaqf1	36	21	of	of	IN
cord-014462-11ggaqf1	36	22	DHF	DHF	NNP
cord-014462-11ggaqf1	36	23	and	and	CC
cord-014462-11ggaqf1	36	24	24,000	24,000	CD
cord-014462-11ggaqf1	36	25	deaths	death	NNS
cord-014462-11ggaqf1	36	26	each	each	DT
cord-014462-11ggaqf1	36	27	year	year	NN
cord-014462-11ggaqf1	36	28	.	.	.
cord-014462-11ggaqf1	37	1	Public	public	JJ
cord-014462-11ggaqf1	37	2	health	health	NN
cord-014462-11ggaqf1	37	3	laboratories	laboratory	NNS
cord-014462-11ggaqf1	37	4	require	require	VBP
cord-014462-11ggaqf1	37	5	rapid	rapid	JJ
cord-014462-11ggaqf1	37	6	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	37	7	of	of	IN
cord-014462-11ggaqf1	37	8	dengue	dengue	NN
cord-014462-11ggaqf1	37	9	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	37	10	for	for	IN
cord-014462-11ggaqf1	37	11	application	application	NN
cord-014462-11ggaqf1	37	12	of	of	IN
cord-014462-11ggaqf1	37	13	measures	measure	NNS
cord-014462-11ggaqf1	37	14	such	such	JJ
cord-014462-11ggaqf1	37	15	as	as	IN
cord-014462-11ggaqf1	37	16	vector	vector	NN
cord-014462-11ggaqf1	37	17	control	control	NN
cord-014462-11ggaqf1	37	18	.	.	.
cord-014462-11ggaqf1	38	1	Laboratory	laboratory	NN
cord-014462-11ggaqf1	38	2	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	38	3	of	of	IN
cord-014462-11ggaqf1	38	4	dengue	dengue	NN
cord-014462-11ggaqf1	38	5	virus	virus	NN
cord-014462-11ggaqf1	38	6	infection	infection	NN
cord-014462-11ggaqf1	38	7	can	can	MD
cord-014462-11ggaqf1	38	8	be	be	VB
cord-014462-11ggaqf1	38	9	made	make	VBN
cord-014462-11ggaqf1	38	10	by	by	IN
cord-014462-11ggaqf1	38	11	the	the	DT
cord-014462-11ggaqf1	38	12	detection	detection	NN
cord-014462-11ggaqf1	38	13	of	of	IN
cord-014462-11ggaqf1	38	14	specific	specific	JJ
cord-014462-11ggaqf1	38	15	virus	virus	NN
cord-014462-11ggaqf1	38	16	,	,	,
cord-014462-11ggaqf1	38	17	viral	viral	JJ
cord-014462-11ggaqf1	38	18	antigen	antigen	NN
cord-014462-11ggaqf1	38	19	,	,	,
cord-014462-11ggaqf1	38	20	genomic	genomic	JJ
cord-014462-11ggaqf1	38	21	sequence	sequence	NN
cord-014462-11ggaqf1	38	22	and/or	and/or	CC
cord-014462-11ggaqf1	38	23	antibodies	antibody	NNS
cord-014462-11ggaqf1	38	24	.	.	.
cord-014462-11ggaqf1	39	1	Currently	currently	RB
cord-014462-11ggaqf1	39	2	3	3	CD
cord-014462-11ggaqf1	39	3	basic	basic	JJ
cord-014462-11ggaqf1	39	4	methods	method	NNS
cord-014462-11ggaqf1	39	5	used	use	VBN
cord-014462-11ggaqf1	39	6	by	by	IN
cord-014462-11ggaqf1	39	7	laboratories	laboratory	NNS
cord-014462-11ggaqf1	39	8	for	for	IN
cord-014462-11ggaqf1	39	9	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	39	10	of	of	IN
cord-014462-11ggaqf1	39	11	dengue	dengue	NN
cord-014462-11ggaqf1	39	12	virus	virus	NN
cord-014462-11ggaqf1	39	13	infection	infection	NN
cord-014462-11ggaqf1	39	14	are	be	VBP
cord-014462-11ggaqf1	39	15	virus	virus	NN
cord-014462-11ggaqf1	39	16	isolation	isolation	NN
cord-014462-11ggaqf1	39	17	and	and	CC
cord-014462-11ggaqf1	39	18	characterisation	characterisation	NN
cord-014462-11ggaqf1	39	19	,	,	,
cord-014462-11ggaqf1	39	20	detection	detection	NN
cord-014462-11ggaqf1	39	21	of	of	IN
cord-014462-11ggaqf1	39	22	genomic	genomic	JJ
cord-014462-11ggaqf1	39	23	sequence	sequence	NN
cord-014462-11ggaqf1	39	24	by	by	IN
cord-014462-11ggaqf1	39	25	nucleic	nucleic	JJ
cord-014462-11ggaqf1	39	26	acid	acid	NN
cord-014462-11ggaqf1	39	27	amplification	amplification	NN
cord-014462-11ggaqf1	39	28	technology	technology	NN
cord-014462-11ggaqf1	39	29	assay	assay	NN
cord-014462-11ggaqf1	39	30	and	and	CC
cord-014462-11ggaqf1	39	31	detection	detection	NN
cord-014462-11ggaqf1	39	32	of	of	IN
cord-014462-11ggaqf1	39	33	dengue	dengue	NN
cord-014462-11ggaqf1	39	34	virus	virus	NN
cord-014462-11ggaqf1	39	35	specific	specific	JJ
cord-014462-11ggaqf1	39	36	antibodies	antibody	NNS
cord-014462-11ggaqf1	39	37	/	/	SYM
cord-014462-11ggaqf1	39	38	antigen	antigen	NN
cord-014462-11ggaqf1	39	39	.	.	.
cord-014462-11ggaqf1	40	1	Molecular	molecular	JJ
cord-014462-11ggaqf1	40	2	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	40	3	based	base	VBN
cord-014462-11ggaqf1	40	4	on	on	IN
cord-014462-11ggaqf1	40	5	reverse	reverse	JJ
cord-014462-11ggaqf1	40	6	transcription	transcription	NN
cord-014462-11ggaqf1	40	7	(	(	-LRB-
cord-014462-11ggaqf1	40	8	RT)-PCR	RT)-PCR	NNP
cord-014462-11ggaqf1	40	9	s.a	s.a	NNP
cord-014462-11ggaqf1	40	10	.	.	.
cord-014462-11ggaqf1	41	1	one	one	CD
cord-014462-11ggaqf1	41	2	step	step	NN
cord-014462-11ggaqf1	41	3	or	or	CC
cord-014462-11ggaqf1	41	4	nested	nest	VBN
cord-014462-11ggaqf1	41	5	PCR	PCR	NNP
cord-014462-11ggaqf1	41	6	,	,	,
cord-014462-11ggaqf1	41	7	nucleic	nucleic	JJ
cord-014462-11ggaqf1	41	8	acid	acid	NN
cord-014462-11ggaqf1	41	9	sequence	sequence	NN
cord-014462-11ggaqf1	41	10	based	base	VBN
cord-014462-11ggaqf1	41	11	amplification	amplification	NN
cord-014462-11ggaqf1	41	12	(	(	-LRB-
cord-014462-11ggaqf1	41	13	NASBA	NASBA	NNP
cord-014462-11ggaqf1	41	14	)	)	-RRB-
cord-014462-11ggaqf1	41	15	,	,	,
cord-014462-11ggaqf1	41	16	or	or	CC
cord-014462-11ggaqf1	41	17	real	real	JJ
cord-014462-11ggaqf1	41	18	time	time	NN
cord-014462-11ggaqf1	41	19	RT	RT	NNP
cord-014462-11ggaqf1	41	20	-	-	HYPH
cord-014462-11ggaqf1	41	21	PCR	PCR	NNP
cord-014462-11ggaqf1	41	22	,	,	,
cord-014462-11ggaqf1	41	23	has	have	VBZ
cord-014462-11ggaqf1	41	24	gradually	gradually	RB
cord-014462-11ggaqf1	41	25	replaced	replace	VBN
cord-014462-11ggaqf1	41	26	the	the	DT
cord-014462-11ggaqf1	41	27	virus	virus	NN
cord-014462-11ggaqf1	41	28	isolation	isolation	NN
cord-014462-11ggaqf1	41	29	method	method	NN
cord-014462-11ggaqf1	41	30	as	as	IN
cord-014462-11ggaqf1	41	31	the	the	DT
cord-014462-11ggaqf1	41	32	new	new	JJ
cord-014462-11ggaqf1	41	33	standard	standard	NN
cord-014462-11ggaqf1	41	34	for	for	IN
cord-014462-11ggaqf1	41	35	the	the	DT
cord-014462-11ggaqf1	41	36	detection	detection	NN
cord-014462-11ggaqf1	41	37	of	of	IN
cord-014462-11ggaqf1	41	38	dengue	dengue	NN
cord-014462-11ggaqf1	41	39	virus	virus	NN
cord-014462-11ggaqf1	41	40	in	in	IN
cord-014462-11ggaqf1	41	41	acute	acute	JJ
cord-014462-11ggaqf1	41	42	phase	phase	NN
cord-014462-11ggaqf1	41	43	serum	serum	NN
cord-014462-11ggaqf1	41	44	samples	sample	NNS
cord-014462-11ggaqf1	41	45	.	.	.
cord-014462-11ggaqf1	42	1	Several	several	JJ
cord-014462-11ggaqf1	42	2	PCR	PCR	NNP
cord-014462-11ggaqf1	42	3	protocols	protocol	NNS
cord-014462-11ggaqf1	42	4	for	for	IN
cord-014462-11ggaqf1	42	5	detection	detection	NN
cord-014462-11ggaqf1	42	6	have	have	VBP
cord-014462-11ggaqf1	42	7	been	be	VBN
cord-014462-11ggaqf1	42	8	described	describe	VBN
cord-014462-11ggaqf1	42	9	that	that	WDT
cord-014462-11ggaqf1	42	10	vary	vary	VBP
cord-014462-11ggaqf1	42	11	in	in	IN
cord-014462-11ggaqf1	42	12	the	the	DT
cord-014462-11ggaqf1	42	13	extraction	extraction	NN
cord-014462-11ggaqf1	42	14	method	method	NN
cord-014462-11ggaqf1	42	15	,	,	,
cord-014462-11ggaqf1	42	16	genomic	genomic	JJ
cord-014462-11ggaqf1	42	17	location	location	NN
cord-014462-11ggaqf1	42	18	of	of	IN
cord-014462-11ggaqf1	42	19	primers	primer	NNS
cord-014462-11ggaqf1	42	20	,	,	,
cord-014462-11ggaqf1	42	21	specificity	specificity	NN
cord-014462-11ggaqf1	42	22	,	,	,
cord-014462-11ggaqf1	42	23	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	42	24	and	and	CC
cord-014462-11ggaqf1	42	25	the	the	DT
cord-014462-11ggaqf1	42	26	methods	method	NNS
cord-014462-11ggaqf1	42	27	to	to	TO
cord-014462-11ggaqf1	42	28	determine	determine	VB
cord-014462-11ggaqf1	42	29	the	the	DT
cord-014462-11ggaqf1	42	30	products	product	NNS
cord-014462-11ggaqf1	42	31	and	and	CC
cord-014462-11ggaqf1	42	32	the	the	DT
cord-014462-11ggaqf1	42	33	serotype	serotype	NN
cord-014462-11ggaqf1	42	34	.	.	.
cord-014462-11ggaqf1	43	1	PCR	PCR	NNP
cord-014462-11ggaqf1	43	2	-	-	HYPH
cord-014462-11ggaqf1	43	3	based	base	VBN
cord-014462-11ggaqf1	43	4	dengue	dengue	NN
cord-014462-11ggaqf1	43	5	tests	test	NNS
cord-014462-11ggaqf1	43	6	,	,	,
cord-014462-11ggaqf1	43	7	due	due	IN
cord-014462-11ggaqf1	43	8	to	to	IN
cord-014462-11ggaqf1	43	9	the	the	DT
cord-014462-11ggaqf1	43	10	specificity	specificity	NN
cord-014462-11ggaqf1	43	11	of	of	IN
cord-014462-11ggaqf1	43	12	amplification	amplification	NN
cord-014462-11ggaqf1	43	13	,	,	,
cord-014462-11ggaqf1	43	14	enable	enable	VB
cord-014462-11ggaqf1	43	15	a	a	DT
cord-014462-11ggaqf1	43	16	definitive	definitive	JJ
cord-014462-11ggaqf1	43	17	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	43	18	and	and	CC
cord-014462-11ggaqf1	43	19	serotyping	serotyping	NN
cord-014462-11ggaqf1	43	20	of	of	IN
cord-014462-11ggaqf1	43	21	the	the	DT
cord-014462-11ggaqf1	43	22	virus	virus	NN
cord-014462-11ggaqf1	43	23	.	.	.
cord-014462-11ggaqf1	44	1	In	in	IN
cord-014462-11ggaqf1	44	2	addition	addition	NN
cord-014462-11ggaqf1	44	3	DNA	dna	NN
cord-014462-11ggaqf1	44	4	sequencing	sequencing	NN
cord-014462-11ggaqf1	44	5	of	of	IN
cord-014462-11ggaqf1	44	6	the	the	DT
cord-014462-11ggaqf1	44	7	amplification	amplification	NN
cord-014462-11ggaqf1	44	8	product	product	NN
cord-014462-11ggaqf1	44	9	enables	enable	VBZ
cord-014462-11ggaqf1	44	10	the	the	DT
cord-014462-11ggaqf1	44	11	virus	virus	NN
cord-014462-11ggaqf1	44	12	to	to	TO
cord-014462-11ggaqf1	44	13	be	be	VB
cord-014462-11ggaqf1	44	14	genotyped	genotype	VBN
cord-014462-11ggaqf1	44	15	,	,	,
cord-014462-11ggaqf1	44	16	providing	provide	VBG
cord-014462-11ggaqf1	44	17	important	important	JJ
cord-014462-11ggaqf1	44	18	information	information	NN
cord-014462-11ggaqf1	44	19	on	on	IN
cord-014462-11ggaqf1	44	20	the	the	DT
cord-014462-11ggaqf1	44	21	sources	source	NNS
cord-014462-11ggaqf1	44	22	of	of	IN
cord-014462-11ggaqf1	44	23	infection	infection	NN
cord-014462-11ggaqf1	44	24	.	.	.
cord-014462-11ggaqf1	45	1	More	more	RBR
cord-014462-11ggaqf1	45	2	recently	recently	RB
cord-014462-11ggaqf1	45	3	tests	test	NNS
cord-014462-11ggaqf1	45	4	have	have	VBP
cord-014462-11ggaqf1	45	5	incorporated	incorporate	VBN
cord-014462-11ggaqf1	45	6	flurogenic	flurogenic	NNP
cord-014462-11ggaqf1	45	7	probe	probe	NN
cord-014462-11ggaqf1	45	8	,	,	,
cord-014462-11ggaqf1	45	9	so	so	RB
cord-014462-11ggaqf1	45	10	called	call	VBN
cord-014462-11ggaqf1	45	11	Taq	Taq	NNP
cord-014462-11ggaqf1	45	12	Man	Man	NNP
cord-014462-11ggaqf1	45	13	technology	technology	NN
cord-014462-11ggaqf1	45	14	for	for	IN
cord-014462-11ggaqf1	45	15	the	the	DT
cord-014462-11ggaqf1	45	16	specific	specific	JJ
cord-014462-11ggaqf1	45	17	Real	real	JJ
cord-014462-11ggaqf1	45	18	Time	Time	NNP
cord-014462-11ggaqf1	45	19	detection	detection	NN
cord-014462-11ggaqf1	45	20	of	of	IN
cord-014462-11ggaqf1	45	21	dengue	dengue	NN
cord-014462-11ggaqf1	45	22	1	1	CD
cord-014462-11ggaqf1	45	23	-	-	SYM
cord-014462-11ggaqf1	45	24	4	4	CD
cord-014462-11ggaqf1	45	25	amplicons	amplicon	NNS
cord-014462-11ggaqf1	45	26	.	.	.
cord-014462-11ggaqf1	46	1	Product	product	NN
cord-014462-11ggaqf1	46	2	is	be	VBZ
cord-014462-11ggaqf1	46	3	detected	detect	VBN
cord-014462-11ggaqf1	46	4	by	by	IN
cord-014462-11ggaqf1	46	5	a	a	DT
cord-014462-11ggaqf1	46	6	specific	specific	JJ
cord-014462-11ggaqf1	46	7	oligodeoxy	oligodeoxy	NN
cord-014462-11ggaqf1	46	8	nucleotide	nucleotide	NN
cord-014462-11ggaqf1	46	9	probe	probe	NN
cord-014462-11ggaqf1	46	10	that	that	WDT
cord-014462-11ggaqf1	46	11	is	be	VBZ
cord-014462-11ggaqf1	46	12	labelled	label	VBN
cord-014462-11ggaqf1	46	13	with	with	IN
cord-014462-11ggaqf1	46	14	6	6	CD
cord-014462-11ggaqf1	46	15	carboxy	carboxy	JJ
cord-014462-11ggaqf1	46	16	-	-	HYPH
cord-014462-11ggaqf1	46	17	fluorescein	fluorescein	NN
cord-014462-11ggaqf1	46	18	(	(	-LRB-
cord-014462-11ggaqf1	46	19	FAM	FAM	NNP
cord-014462-11ggaqf1	46	20	)	)	-RRB-
cord-014462-11ggaqf1	46	21	.	.	.
cord-014462-11ggaqf1	47	1	This	this	DT
cord-014462-11ggaqf1	47	2	technology	technology	NN
cord-014462-11ggaqf1	47	3	offers	offer	VBZ
cord-014462-11ggaqf1	47	4	the	the	DT
cord-014462-11ggaqf1	47	5	advantage	advantage	NN
cord-014462-11ggaqf1	47	6	of	of	IN
cord-014462-11ggaqf1	47	7	being	be	VBG
cord-014462-11ggaqf1	47	8	both	both	CC
cord-014462-11ggaqf1	47	9	rapid	rapid	JJ
cord-014462-11ggaqf1	47	10	and	and	CC
cord-014462-11ggaqf1	47	11	potentially	potentially	RB
cord-014462-11ggaqf1	47	12	quantitative	quantitative	JJ
cord-014462-11ggaqf1	47	13	.	.	.
cord-014462-11ggaqf1	48	1	Second	second	RB
cord-014462-11ggaqf1	48	2	,	,	,
cord-014462-11ggaqf1	48	3	the	the	DT
cord-014462-11ggaqf1	48	4	detection	detection	NN
cord-014462-11ggaqf1	48	5	of	of	IN
cord-014462-11ggaqf1	48	6	product	product	NN
cord-014462-11ggaqf1	48	7	by	by	IN
cord-014462-11ggaqf1	48	8	hybridisation	hybridisation	NN
cord-014462-11ggaqf1	48	9	of	of	IN
cord-014462-11ggaqf1	48	10	flurochrome	flurochrome	NN
cord-014462-11ggaqf1	48	11	labelled	label	VBN
cord-014462-11ggaqf1	48	12	probes	probe	NNS
cord-014462-11ggaqf1	48	13	increases	increase	VBZ
cord-014462-11ggaqf1	48	14	specificity	specificity	NN
cord-014462-11ggaqf1	48	15	.	.	.
cord-014462-11ggaqf1	49	1	Third	third	RB
cord-014462-11ggaqf1	49	2	,	,	,
cord-014462-11ggaqf1	49	3	as	as	IN
cord-014462-11ggaqf1	49	4	the	the	DT
cord-014462-11ggaqf1	49	5	product	product	NN
cord-014462-11ggaqf1	49	6	is	be	VBZ
cord-014462-11ggaqf1	49	7	detected	detect	VBN
cord-014462-11ggaqf1	49	8	without	without	IN
cord-014462-11ggaqf1	49	9	the	the	DT
cord-014462-11ggaqf1	49	10	need	need	NN
cord-014462-11ggaqf1	49	11	to	to	TO
cord-014462-11ggaqf1	49	12	open	open	VB
cord-014462-11ggaqf1	49	13	the	the	DT
cord-014462-11ggaqf1	49	14	reaction	reaction	NN
cord-014462-11ggaqf1	49	15	tube	tube	NN
cord-014462-11ggaqf1	49	16	,	,	,
cord-014462-11ggaqf1	49	17	the	the	DT
cord-014462-11ggaqf1	49	18	risk	risk	NN
cord-014462-11ggaqf1	49	19	of	of	IN
cord-014462-11ggaqf1	49	20	contamination	contamination	NN
cord-014462-11ggaqf1	49	21	by	by	IN
cord-014462-11ggaqf1	49	22	product	product	NN
cord-014462-11ggaqf1	49	23	carry	carry	NN
cord-014462-11ggaqf1	49	24	over	over	RP
cord-014462-11ggaqf1	49	25	is	be	VBZ
cord-014462-11ggaqf1	49	26	minimised	minimise	VBN
cord-014462-11ggaqf1	49	27	.	.	.
cord-014462-11ggaqf1	50	1	The	the	DT
cord-014462-11ggaqf1	50	2	advantages	advantage	NNS
cord-014462-11ggaqf1	50	3	of	of	IN
cord-014462-11ggaqf1	50	4	speed	speed	NN
cord-014462-11ggaqf1	50	5	,	,	,
cord-014462-11ggaqf1	50	6	contamination	contamination	NN
cord-014462-11ggaqf1	50	7	minimisation	minimisation	NN
cord-014462-11ggaqf1	50	8	and	and	CC
cord-014462-11ggaqf1	50	9	reduced	reduce	VBN
cord-014462-11ggaqf1	50	10	turn	turn	NN
cord-014462-11ggaqf1	50	11	around	around	IN
cord-014462-11ggaqf1	50	12	time	time	NN
cord-014462-11ggaqf1	50	13	justify	justify	VB
cord-014462-11ggaqf1	50	14	application	application	NN
cord-014462-11ggaqf1	50	15	of	of	IN
cord-014462-11ggaqf1	50	16	this	this	DT
cord-014462-11ggaqf1	50	17	assay	assay	NN
cord-014462-11ggaqf1	50	18	over	over	IN
cord-014462-11ggaqf1	50	19	the	the	DT
cord-014462-11ggaqf1	50	20	currently	currently	RB
cord-014462-11ggaqf1	50	21	used	use	VBN
cord-014462-11ggaqf1	50	22	nested	nest	VBN
cord-014462-11ggaqf1	50	23	PCR	PCR	NNP
cord-014462-11ggaqf1	50	24	assay	assay	NN
cord-014462-11ggaqf1	50	25	.	.	.
cord-014462-11ggaqf1	51	1	During	during	IN
cord-014462-11ggaqf1	51	2	the	the	DT
cord-014462-11ggaqf1	51	3	period	period	NN
cord-014462-11ggaqf1	51	4	January	January	NNP
cord-014462-11ggaqf1	51	5	2007	2007	CD
cord-014462-11ggaqf1	51	6	to	to	IN
cord-014462-11ggaqf1	51	7	October	October	NNP
cord-014462-11ggaqf1	51	8	2009	2009	CD
cord-014462-11ggaqf1	51	9	,	,	,
cord-014462-11ggaqf1	51	10	Molecular	Molecular	NNP
cord-014462-11ggaqf1	51	11	laboratory	laboratory	NN
cord-014462-11ggaqf1	51	12	received	receive	VBD
cord-014462-11ggaqf1	51	13	900	900	CD
cord-014462-11ggaqf1	51	14	samples	sample	NNS
cord-014462-11ggaqf1	51	15	from	from	IN
cord-014462-11ggaqf1	51	16	patients	patient	NNS
cord-014462-11ggaqf1	51	17	presenting	present	VBG
cord-014462-11ggaqf1	51	18	with	with	IN
cord-014462-11ggaqf1	51	19	acute	acute	JJ
cord-014462-11ggaqf1	51	20	onset	onset	NN
cord-014462-11ggaqf1	51	21	fever	fever	NN
cord-014462-11ggaqf1	51	22	for	for	IN
cord-014462-11ggaqf1	51	23	Dengue	dengue	NN
cord-014462-11ggaqf1	51	24	.6	.6	CD
cord-014462-11ggaqf1	51	25	%	%	NN
cord-014462-11ggaqf1	51	26	)	)	-RRB-
cord-014462-11ggaqf1	52	1	samples	sample	NNS
cord-014462-11ggaqf1	52	2	were	be	VBD
cord-014462-11ggaqf1	52	3	tested	test	VBN
cord-014462-11ggaqf1	52	4	positive	positive	JJ
cord-014462-11ggaqf1	52	5	by	by	IN
cord-014462-11ggaqf1	52	6	this	this	DT
cord-014462-11ggaqf1	52	7	method	method	NN
cord-014462-11ggaqf1	52	8	.	.	.
cord-014462-11ggaqf1	53	1	The	the	DT
cord-014462-11ggaqf1	53	2	disease	disease	NN
cord-014462-11ggaqf1	53	3	peaks	peak	VBZ
cord-014462-11ggaqf1	53	4	in	in	IN
cord-014462-11ggaqf1	53	5	the	the	DT
cord-014462-11ggaqf1	53	6	monsoon	monsoon	NN
cord-014462-11ggaqf1	53	7	season	season	NN
cord-014462-11ggaqf1	53	8	with	with	IN
cord-014462-11ggaqf1	53	9	a	a	DT
cord-014462-11ggaqf1	53	10	percentage	percentage	NN
cord-014462-11ggaqf1	53	11	of	of	IN
cord-014462-11ggaqf1	53	12	17.5	17.5	CD
cord-014462-11ggaqf1	53	13	%	%	NN
cord-014462-11ggaqf1	53	14	.	.	.
cord-014462-11ggaqf1	54	1	Rapid	rapid	JJ
cord-014462-11ggaqf1	54	2	tests	test	NNS
cord-014462-11ggaqf1	54	3	,	,	,
cord-014462-11ggaqf1	54	4	IgM	IgM	NNP
cord-014462-11ggaqf1	54	5	and	and	CC
cord-014462-11ggaqf1	54	6	IgG	IgG	NNP
cord-014462-11ggaqf1	54	7	capture	capture	VB
cord-014462-11ggaqf1	54	8	ELISA	ELISA	NNP
cord-014462-11ggaqf1	54	9	are	be	VBP
cord-014462-11ggaqf1	54	10	popularly	popularly	RB
cord-014462-11ggaqf1	54	11	used	use	VBN
cord-014462-11ggaqf1	54	12	tests	test	NNS
cord-014462-11ggaqf1	54	13	for	for	IN
cord-014462-11ggaqf1	54	14	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	54	15	of	of	IN
cord-014462-11ggaqf1	54	16	dengue	dengue	NN
cord-014462-11ggaqf1	54	17	infection	infection	NN
cord-014462-11ggaqf1	54	18	.	.	.
cord-014462-11ggaqf1	55	1	Its	-PRON-	PRP$
cord-014462-11ggaqf1	55	2	utility	utility	NN
cord-014462-11ggaqf1	55	3	is	be	VBZ
cord-014462-11ggaqf1	55	4	limited	limit	VBN
cord-014462-11ggaqf1	55	5	for	for	IN
cord-014462-11ggaqf1	55	6	diagnosing	diagnose	VBG
cord-014462-11ggaqf1	55	7	dengue	dengue	NN
cord-014462-11ggaqf1	55	8	in	in	IN
cord-014462-11ggaqf1	55	9	convalescecce	convalescecce	NNS
cord-014462-11ggaqf1	55	10	(	(	-LRB-
cord-014462-11ggaqf1	55	11	8	8	CD
cord-014462-11ggaqf1	55	12	-	-	SYM
cord-014462-11ggaqf1	55	13	14	14	CD
cord-014462-11ggaqf1	55	14	days	day	NNS
cord-014462-11ggaqf1	55	15	)	)	-RRB-
cord-014462-11ggaqf1	55	16	.	.	.
cord-014462-11ggaqf1	56	1	Specificity	specificity	NN
cord-014462-11ggaqf1	56	2	is	be	VBZ
cord-014462-11ggaqf1	56	3	also	also	RB
cord-014462-11ggaqf1	56	4	compromised	compromise	VBN
cord-014462-11ggaqf1	56	5	due	due	IN
cord-014462-11ggaqf1	56	6	to	to	IN
cord-014462-11ggaqf1	56	7	infections	infection	NNS
cord-014462-11ggaqf1	56	8	with	with	IN
cord-014462-11ggaqf1	56	9	flaviviruses	flavivirus	NNS
cord-014462-11ggaqf1	56	10	:	:	:
cord-014462-11ggaqf1	56	11	Japanese	japanese	JJ
cord-014462-11ggaqf1	56	12	encephalitis	encephalitis	NN
cord-014462-11ggaqf1	56	13	and	and	CC
cord-014462-11ggaqf1	56	14	Chikungunya	chikungunya	NN
cord-014462-11ggaqf1	56	15	.	.	.
cord-014462-11ggaqf1	57	1	Dengue	dengue	NN
cord-014462-11ggaqf1	57	2	NS1	NS1	NNPS
cord-014462-11ggaqf1	57	3	Ag	Ag	NNP
cord-014462-11ggaqf1	57	4	ELISA	ELISA	NNP
cord-014462-11ggaqf1	57	5	with	with	IN
cord-014462-11ggaqf1	57	6	its	-PRON-	PRP$
cord-014462-11ggaqf1	57	7	cost	cost	NN
cord-014462-11ggaqf1	57	8	effectiveness	effectiveness	NN
cord-014462-11ggaqf1	57	9	,	,	,
cord-014462-11ggaqf1	57	10	specificity	specificity	NN
cord-014462-11ggaqf1	57	11	and	and	CC
cord-014462-11ggaqf1	57	12	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	57	13	should	should	MD
cord-014462-11ggaqf1	57	14	be	be	VB
cord-014462-11ggaqf1	57	15	considered	consider	VBN
cord-014462-11ggaqf1	57	16	as	as	IN
cord-014462-11ggaqf1	57	17	the	the	DT
cord-014462-11ggaqf1	57	18	test	test	NN
cord-014462-11ggaqf1	57	19	of	of	IN
cord-014462-11ggaqf1	57	20	choice	choice	NN
cord-014462-11ggaqf1	57	21	for	for	IN
cord-014462-11ggaqf1	57	22	diagnosing	diagnose	VBG
cord-014462-11ggaqf1	57	23	Dengue	Dengue	NNP
cord-014462-11ggaqf1	57	24	in	in	IN
cord-014462-11ggaqf1	57	25	the	the	DT
cord-014462-11ggaqf1	57	26	acute	acute	JJ
cord-014462-11ggaqf1	57	27	phase	phase	NN
cord-014462-11ggaqf1	57	28	of	of	IN
cord-014462-11ggaqf1	57	29	illness	illness	NN
cord-014462-11ggaqf1	57	30	in	in	IN
cord-014462-11ggaqf1	57	31	the	the	DT
cord-014462-11ggaqf1	57	32	developing	develop	VBG
cord-014462-11ggaqf1	57	33	countries	country	NNS
cord-014462-11ggaqf1	57	34	.	.	.
cord-014462-11ggaqf1	58	1	Molecular	molecular	JJ
cord-014462-11ggaqf1	58	2	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	58	3	enables	enable	VBZ
cord-014462-11ggaqf1	58	4	confirmatory	confirmatory	JJ
cord-014462-11ggaqf1	58	5	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	58	6	of	of	IN
cord-014462-11ggaqf1	58	7	Dengue	dengue	NN
cord-014462-11ggaqf1	58	8	in	in	IN
cord-014462-11ggaqf1	58	9	the	the	DT
cord-014462-11ggaqf1	58	10	acute	acute	JJ
cord-014462-11ggaqf1	58	11	phase	phase	NN
cord-014462-11ggaqf1	58	12	of	of	IN
cord-014462-11ggaqf1	58	13	the	the	DT
cord-014462-11ggaqf1	58	14	illness	illness	NN
cord-014462-11ggaqf1	58	15	and	and	CC
cord-014462-11ggaqf1	58	16	is	be	VBZ
cord-014462-11ggaqf1	58	17	suitable	suitable	JJ
cord-014462-11ggaqf1	58	18	for	for	IN
cord-014462-11ggaqf1	58	19	further	further	JJ
cord-014462-11ggaqf1	58	20	typing	typing	NN
cord-014462-11ggaqf1	58	21	methods	method	NNS
cord-014462-11ggaqf1	58	22	.	.	.
cord-014462-11ggaqf1	59	1	Assistant	Assistant	NNP
cord-014462-11ggaqf1	59	2	General	General	NNP
cord-014462-11ggaqf1	59	3	Manager	Manager	NNP
cord-014462-11ggaqf1	59	4	and	and	CC
cord-014462-11ggaqf1	59	5	R&D	R&D	NNP
cord-014462-11ggaqf1	59	6	Coordinator	Coordinator	NNP
cord-014462-11ggaqf1	59	7	,	,	,
cord-014462-11ggaqf1	59	8	Division	Division	NNP
cord-014462-11ggaqf1	59	9	of	of	IN
cord-014462-11ggaqf1	59	10	Quality	Quality	NNP
cord-014462-11ggaqf1	59	11	Control	Control	NNP
cord-014462-11ggaqf1	59	12	and	and	CC
cord-014462-11ggaqf1	59	13	R&D	R&D	NNP
cord-014462-11ggaqf1	59	14	,	,	,
cord-014462-11ggaqf1	59	15	Bharat	Bharat	NNP
cord-014462-11ggaqf1	59	16	Immunologicals	Immunologicals	NNP
cord-014462-11ggaqf1	59	17	and	and	CC
cord-014462-11ggaqf1	59	18	Biologicals	Biologicals	NNP
cord-014462-11ggaqf1	59	19	Corporation	Corporation	NNP
cord-014462-11ggaqf1	59	20	Ltd.	Ltd.	NNP
cord-014462-11ggaqf1	59	21	,	,	,
cord-014462-11ggaqf1	59	22	Village	Village	NNP
cord-014462-11ggaqf1	59	23	Chola	Chola	NNP
cord-014462-11ggaqf1	59	24	,	,	,
cord-014462-11ggaqf1	59	25	Bulandshahr	Bulandshahr	NNP
cord-014462-11ggaqf1	59	26	,	,	,
cord-014462-11ggaqf1	59	27	UP	UP	NNP
cord-014462-11ggaqf1	59	28	Vaccine	vaccine	NN
cord-014462-11ggaqf1	59	29	development	development	NN
cord-014462-11ggaqf1	59	30	in	in	IN
cord-014462-11ggaqf1	59	31	India	India	NNP
cord-014462-11ggaqf1	59	32	,	,	,
cord-014462-11ggaqf1	59	33	though	though	IN
cord-014462-11ggaqf1	59	34	slow	slow	JJ
cord-014462-11ggaqf1	59	35	to	to	TO
cord-014462-11ggaqf1	59	36	start	start	VB
cord-014462-11ggaqf1	59	37	,	,	,
cord-014462-11ggaqf1	59	38	has	have	VBZ
cord-014462-11ggaqf1	59	39	progressed	progress	VBN
cord-014462-11ggaqf1	59	40	by	by	IN
cord-014462-11ggaqf1	59	41	leaps	leap	NNS
cord-014462-11ggaqf1	59	42	and	and	CC
cord-014462-11ggaqf1	59	43	bounds	bound	NNS
cord-014462-11ggaqf1	59	44	in	in	IN
cord-014462-11ggaqf1	59	45	the	the	DT
cord-014462-11ggaqf1	59	46	past	past	JJ
cord-014462-11ggaqf1	59	47	60	60	CD
cord-014462-11ggaqf1	59	48	years	year	NNS
cord-014462-11ggaqf1	59	49	.	.	.
cord-014462-11ggaqf1	60	1	It	-PRON-	PRP
cord-014462-11ggaqf1	60	2	was	be	VBD
cord-014462-11ggaqf1	60	3	dependent	dependent	JJ
cord-014462-11ggaqf1	60	4	on	on	IN
cord-014462-11ggaqf1	60	5	imported	import	VBN
cord-014462-11ggaqf1	60	6	vaccines	vaccine	NNS
cord-014462-11ggaqf1	60	7	but	but	CC
cord-014462-11ggaqf1	60	8	now	now	RB
cord-014462-11ggaqf1	60	9	it	-PRON-	PRP
cord-014462-11ggaqf1	60	10	is	be	VBZ
cord-014462-11ggaqf1	60	11	not	not	RB
cord-014462-11ggaqf1	60	12	only	only	RB
cord-014462-11ggaqf1	60	13	self	self	NN
cord-014462-11ggaqf1	60	14	-	-	HYPH
cord-014462-11ggaqf1	60	15	sufficient	sufficient	JJ
cord-014462-11ggaqf1	60	16	in	in	IN
cord-014462-11ggaqf1	60	17	the	the	DT
cord-014462-11ggaqf1	60	18	production	production	NN
cord-014462-11ggaqf1	60	19	of	of	IN
cord-014462-11ggaqf1	60	20	vaccines	vaccine	NNS
cord-014462-11ggaqf1	60	21	conforming	conform	VBG
cord-014462-11ggaqf1	60	22	to	to	IN
cord-014462-11ggaqf1	60	23	international	international	JJ
cord-014462-11ggaqf1	60	24	standards	standard	NNS
cord-014462-11ggaqf1	60	25	with	with	IN
cord-014462-11ggaqf1	60	26	major	major	JJ
cord-014462-11ggaqf1	60	27	supplier	supplier	NN
cord-014462-11ggaqf1	60	28	of	of	IN
cord-014462-11ggaqf1	60	29	the	the	DT
cord-014462-11ggaqf1	60	30	same	same	JJ
cord-014462-11ggaqf1	60	31	to	to	IN
cord-014462-11ggaqf1	60	32	UNICEF	UNICEF	NNP
cord-014462-11ggaqf1	60	33	.	.	.
cord-014462-11ggaqf1	61	1	The	the	DT
cord-014462-11ggaqf1	61	2	role	role	NN
cord-014462-11ggaqf1	61	3	of	of	IN
cord-014462-11ggaqf1	61	4	Drug	Drug	NNP
cord-014462-11ggaqf1	61	5	authorities	authority	NNS
cord-014462-11ggaqf1	61	6	is	be	VBZ
cord-014462-11ggaqf1	61	7	to	to	TO
cord-014462-11ggaqf1	61	8	enhance	enhance	VB
cord-014462-11ggaqf1	61	9	the	the	DT
cord-014462-11ggaqf1	61	10	public	public	JJ
cord-014462-11ggaqf1	61	11	health	health	NN
cord-014462-11ggaqf1	61	12	by	by	IN
cord-014462-11ggaqf1	61	13	assuring	assure	VBG
cord-014462-11ggaqf1	61	14	the	the	DT
cord-014462-11ggaqf1	61	15	availability	availability	NN
cord-014462-11ggaqf1	61	16	of	of	IN
cord-014462-11ggaqf1	61	17	safe	safe	JJ
cord-014462-11ggaqf1	61	18	and	and	CC
cord-014462-11ggaqf1	61	19	effective	effective	JJ
cord-014462-11ggaqf1	61	20	A2	A2	NNP
cord-014462-11ggaqf1	61	21	Indian	Indian	NNP
cord-014462-11ggaqf1	61	22	J.	J.	NNP
cord-014462-11ggaqf1	61	23	Virol	Virol	NNP
cord-014462-11ggaqf1	61	24	.	.	.
cord-014462-11ggaqf1	62	1	(	(	-LRB-
cord-014462-11ggaqf1	62	2	September	September	NNP
cord-014462-11ggaqf1	62	3	2010	2010	CD
cord-014462-11ggaqf1	62	4	)	)	-RRB-
cord-014462-11ggaqf1	63	1	21(Suppl	21(Suppl	NNP
cord-014462-11ggaqf1	63	2	.	.	.
cord-014462-11ggaqf1	64	1	1):A1-A58	1):a1-a58	LS
cord-014462-11ggaqf1	64	2	vaccines	vaccine	NNS
cord-014462-11ggaqf1	64	3	,	,	,
cord-014462-11ggaqf1	64	4	allergenic	allergenic	JJ
cord-014462-11ggaqf1	64	5	extracts	extract	NNS
cord-014462-11ggaqf1	64	6	,	,	,
cord-014462-11ggaqf1	64	7	and	and	CC
cord-014462-11ggaqf1	64	8	other	other	JJ
cord-014462-11ggaqf1	64	9	related	related	JJ
cord-014462-11ggaqf1	64	10	products	product	NNS
cord-014462-11ggaqf1	64	11	.	.	.
cord-014462-11ggaqf1	65	1	Vaccine	vaccine	NN
cord-014462-11ggaqf1	65	2	development	development	NN
cord-014462-11ggaqf1	65	3	is	be	VBZ
cord-014462-11ggaqf1	65	4	tightly	tightly	RB
cord-014462-11ggaqf1	65	5	regulated	regulate	VBN
cord-014462-11ggaqf1	65	6	by	by	IN
cord-014462-11ggaqf1	65	7	a	a	DT
cord-014462-11ggaqf1	65	8	hierarchy	hierarchy	NN
cord-014462-11ggaqf1	65	9	of	of	IN
cord-014462-11ggaqf1	65	10	regulatory	regulatory	JJ
cord-014462-11ggaqf1	65	11	bodies	body	NNS
cord-014462-11ggaqf1	65	12	.	.	.
cord-014462-11ggaqf1	66	1	Guidelines	guideline	NNS
cord-014462-11ggaqf1	66	2	provided	provide	VBN
cord-014462-11ggaqf1	66	3	by	by	IN
cord-014462-11ggaqf1	66	4	the	the	DT
cord-014462-11ggaqf1	66	5	Indian	Indian	NNP
cord-014462-11ggaqf1	66	6	Council	Council	NNP
cord-014462-11ggaqf1	66	7	of	of	IN
cord-014462-11ggaqf1	66	8	Medical	Medical	NNP
cord-014462-11ggaqf1	66	9	Research	Research	NNP
cord-014462-11ggaqf1	66	10	(	(	-LRB-
cord-014462-11ggaqf1	66	11	ICMR	ICMR	NNP
cord-014462-11ggaqf1	66	12	)	)	-RRB-
cord-014462-11ggaqf1	66	13	set	set	VBD
cord-014462-11ggaqf1	66	14	the	the	DT
cord-014462-11ggaqf1	66	15	rules	rule	NNS
cord-014462-11ggaqf1	66	16	of	of	IN
cord-014462-11ggaqf1	66	17	conduct	conduct	NN
cord-014462-11ggaqf1	66	18	for	for	IN
cord-014462-11ggaqf1	66	19	clinical	clinical	JJ
cord-014462-11ggaqf1	66	20	trials	trial	NNS
cord-014462-11ggaqf1	66	21	from	from	IN
cord-014462-11ggaqf1	66	22	Phase	phase	NN
cord-014462-11ggaqf1	66	23	I	-PRON-	PRP
cord-014462-11ggaqf1	66	24	to	to	IN
cord-014462-11ggaqf1	66	25	IV	IV	NNP
cord-014462-11ggaqf1	66	26	studies	study	NNS
cord-014462-11ggaqf1	66	27	as	as	RB
cord-014462-11ggaqf1	66	28	well	well	RB
cord-014462-11ggaqf1	66	29	as	as	IN
cord-014462-11ggaqf1	66	30	studies	study	NNS
cord-014462-11ggaqf1	66	31	on	on	IN
cord-014462-11ggaqf1	66	32	combination	combination	NN
cord-014462-11ggaqf1	66	33	vaccines	vaccine	NNS
cord-014462-11ggaqf1	66	34	.	.	.
cord-014462-11ggaqf1	67	1	These	these	DT
cord-014462-11ggaqf1	67	2	guidelines	guideline	NNS
cord-014462-11ggaqf1	67	3	address	address	VBP
cord-014462-11ggaqf1	67	4	ethical	ethical	JJ
cord-014462-11ggaqf1	67	5	issues	issue	NNS
cord-014462-11ggaqf1	67	6	that	that	WDT
cord-014462-11ggaqf1	67	7	arise	arise	VBP
cord-014462-11ggaqf1	67	8	during	during	IN
cord-014462-11ggaqf1	67	9	a	a	DT
cord-014462-11ggaqf1	67	10	vaccine	vaccine	NN
cord-014462-11ggaqf1	67	11	study	study	NN
cord-014462-11ggaqf1	67	12	.	.	.
cord-014462-11ggaqf1	68	1	A	a	DT
cord-014462-11ggaqf1	68	2	network	network	NN
cord-014462-11ggaqf1	68	3	of	of	IN
cord-014462-11ggaqf1	68	4	Adverse	Adverse	NNP
cord-014462-11ggaqf1	68	5	Drug	Drug	NNP
cord-014462-11ggaqf1	68	6	Reaction	Reaction	NNP
cord-014462-11ggaqf1	68	7	(	(	-LRB-
cord-014462-11ggaqf1	68	8	ADR	ADR	NNP
cord-014462-11ggaqf1	68	9	)	)	-RRB-
cord-014462-11ggaqf1	68	10	monitoring	monitoring	NN
cord-014462-11ggaqf1	68	11	centers	center	NNS
cord-014462-11ggaqf1	68	12	along	along	IN
cord-014462-11ggaqf1	68	13	with	with	IN
cord-014462-11ggaqf1	68	14	the	the	DT
cord-014462-11ggaqf1	68	15	Adverse	adverse	JJ
cord-014462-11ggaqf1	68	16	Events	event	NNS
cord-014462-11ggaqf1	69	1	Following	follow	VBG
cord-014462-11ggaqf1	70	1	Immunization	immunization	NN
cord-014462-11ggaqf1	70	2	(	(	-LRB-
cord-014462-11ggaqf1	70	3	AEFI	AEFI	NNP
cord-014462-11ggaqf1	70	4	)	)	-RRB-
cord-014462-11ggaqf1	70	5	monitoring	monitoring	NN
cord-014462-11ggaqf1	70	6	program	program	NN
cord-014462-11ggaqf1	70	7	provide	provide	VBP
cord-014462-11ggaqf1	70	8	the	the	DT
cord-014462-11ggaqf1	70	9	machinery	machinery	NN
cord-014462-11ggaqf1	70	10	for	for	IN
cord-014462-11ggaqf1	70	11	vaccine	vaccine	NN
cord-014462-11ggaqf1	70	12	pharmacovigilance	pharmacovigilance	NN
cord-014462-11ggaqf1	70	13	.	.	.
cord-014462-11ggaqf1	71	1	Genetic	genetic	JJ
cord-014462-11ggaqf1	71	2	modifications	modification	NNS
cord-014462-11ggaqf1	71	3	have	have	VBP
cord-014462-11ggaqf1	71	4	been	be	VBN
cord-014462-11ggaqf1	71	5	developed	develop	VBN
cord-014462-11ggaqf1	71	6	to	to	TO
cord-014462-11ggaqf1	71	7	develop	develop	VB
cord-014462-11ggaqf1	71	8	effective	effective	JJ
cord-014462-11ggaqf1	71	9	and	and	CC
cord-014462-11ggaqf1	71	10	cheaper	cheap	JJR
cord-014462-11ggaqf1	71	11	vaccines	vaccine	NNS
cord-014462-11ggaqf1	71	12	by	by	IN
cord-014462-11ggaqf1	71	13	the	the	DT
cord-014462-11ggaqf1	71	14	use	use	NN
cord-014462-11ggaqf1	71	15	of	of	IN
cord-014462-11ggaqf1	71	16	recombinant	recombinant	JJ
cord-014462-11ggaqf1	71	17	technology	technology	NN
cord-014462-11ggaqf1	71	18	.	.	.
cord-014462-11ggaqf1	72	1	To	to	TO
cord-014462-11ggaqf1	72	2	ensure	ensure	VB
cord-014462-11ggaqf1	72	3	safety	safety	NN
cord-014462-11ggaqf1	72	4	of	of	IN
cord-014462-11ggaqf1	72	5	consumers	consumer	NNS
cord-014462-11ggaqf1	72	6	,	,	,
cord-014462-11ggaqf1	72	7	producers	producer	NNS
cord-014462-11ggaqf1	72	8	,	,	,
cord-014462-11ggaqf1	72	9	experimental	experimental	JJ
cord-014462-11ggaqf1	72	10	animals	animal	NNS
cord-014462-11ggaqf1	72	11	and	and	CC
cord-014462-11ggaqf1	72	12	environment	environment	NN
cord-014462-11ggaqf1	72	13	,	,	,
cord-014462-11ggaqf1	72	14	Governments	government	NNS
cord-014462-11ggaqf1	72	15	all	all	RB
cord-014462-11ggaqf1	72	16	over	over	IN
cord-014462-11ggaqf1	72	17	the	the	DT
cord-014462-11ggaqf1	72	18	world	world	NN
cord-014462-11ggaqf1	72	19	are	be	VBP
cord-014462-11ggaqf1	72	20	following	follow	VBG
cord-014462-11ggaqf1	72	21	regulatory	regulatory	JJ
cord-014462-11ggaqf1	72	22	mechanisms	mechanism	NNS
cord-014462-11ggaqf1	72	23	and	and	CC
cord-014462-11ggaqf1	72	24	guidelines	guideline	NNS
cord-014462-11ggaqf1	72	25	for	for	IN
cord-014462-11ggaqf1	72	26	genetically	genetically	RB
cord-014462-11ggaqf1	72	27	modified	modify	VBN
cord-014462-11ggaqf1	72	28	products	product	NNS
cord-014462-11ggaqf1	72	29	.	.	.
cord-014462-11ggaqf1	73	1	As	as	IN
cord-014462-11ggaqf1	73	2	with	with	IN
cord-014462-11ggaqf1	73	3	other	other	JJ
cord-014462-11ggaqf1	73	4	industrializing	industrialize	VBG
cord-014462-11ggaqf1	73	5	countries	country	NNS
cord-014462-11ggaqf1	73	6	undergoing	undergo	VBG
cord-014462-11ggaqf1	73	7	rapid	rapid	JJ
cord-014462-11ggaqf1	73	8	shifts	shift	NNS
cord-014462-11ggaqf1	73	9	,	,	,
cord-014462-11ggaqf1	73	10	India	India	NNP
cord-014462-11ggaqf1	73	11	clearly	clearly	RB
cord-014462-11ggaqf1	73	12	recognizes	recognize	VBZ
cord-014462-11ggaqf1	73	13	the	the	DT
cord-014462-11ggaqf1	73	14	need	need	NN
cord-014462-11ggaqf1	73	15	to	to	TO
cord-014462-11ggaqf1	73	16	restructure	restructure	VB
cord-014462-11ggaqf1	73	17	its	-PRON-	PRP$
cord-014462-11ggaqf1	73	18	regulatory	regulatory	JJ
cord-014462-11ggaqf1	73	19	system	system	NN
cord-014462-11ggaqf1	73	20	so	so	IN
cord-014462-11ggaqf1	73	21	that	that	IN
cord-014462-11ggaqf1	73	22	its	-PRON-	PRP$
cord-014462-11ggaqf1	73	23	biopharmaceutical	biopharmaceutical	JJ
cord-014462-11ggaqf1	73	24	industry	industry	NN
cord-014462-11ggaqf1	73	25	can	can	MD
cord-014462-11ggaqf1	73	26	compete	compete	VB
cord-014462-11ggaqf1	73	27	in	in	IN
cord-014462-11ggaqf1	73	28	international	international	JJ
cord-014462-11ggaqf1	73	29	markets	market	NNS
cord-014462-11ggaqf1	73	30	.	.	.
cord-014462-11ggaqf1	74	1	Genetic	Genetic	NNP
cord-014462-11ggaqf1	74	2	Engineering	Engineering	NNP
cord-014462-11ggaqf1	74	3	Approval	Approval	NNP
cord-014462-11ggaqf1	74	4	Council	Council	NNP
cord-014462-11ggaqf1	74	5	(	(	-LRB-
cord-014462-11ggaqf1	74	6	GEAC	GEAC	NNP
cord-014462-11ggaqf1	74	7	)	)	-RRB-
cord-014462-11ggaqf1	74	8	,	,	,
cord-014462-11ggaqf1	74	9	Recombinant	Recombinant	NNP
cord-014462-11ggaqf1	74	10	DNA	DNA	NNP
cord-014462-11ggaqf1	74	11	Advisory	Advisory	NNP
cord-014462-11ggaqf1	74	12	Committee	Committee	NNP
cord-014462-11ggaqf1	74	13	(	(	-LRB-
cord-014462-11ggaqf1	74	14	RDAC	RDAC	NNP
cord-014462-11ggaqf1	74	15	)	)	-RRB-
cord-014462-11ggaqf1	74	16	,	,	,
cord-014462-11ggaqf1	74	17	Review	Review	NNP
cord-014462-11ggaqf1	74	18	Committee	Committee	NNP
cord-014462-11ggaqf1	74	19	on	on	IN
cord-014462-11ggaqf1	74	20	Genetic	Genetic	NNP
cord-014462-11ggaqf1	74	21	Manipulation	Manipulation	NNP
cord-014462-11ggaqf1	74	22	(	(	-LRB-
cord-014462-11ggaqf1	74	23	RCGM	RCGM	NNP
cord-014462-11ggaqf1	74	24	)	)	-RRB-
cord-014462-11ggaqf1	74	25	,	,	,
cord-014462-11ggaqf1	74	26	Institutional	Institutional	NNP
cord-014462-11ggaqf1	74	27	Biosafety	Biosafety	NNP
cord-014462-11ggaqf1	74	28	Committees	Committees	NNPS
cord-014462-11ggaqf1	74	29	(	(	-LRB-
cord-014462-11ggaqf1	74	30	IBSC	IBSC	NNP
cord-014462-11ggaqf1	74	31	)	)	-RRB-
cord-014462-11ggaqf1	74	32	are	be	VBP
cord-014462-11ggaqf1	74	33	responsible	responsible	JJ
cord-014462-11ggaqf1	74	34	for	for	IN
cord-014462-11ggaqf1	74	35	development	development	NN
cord-014462-11ggaqf1	74	36	,	,	,
cord-014462-11ggaqf1	74	37	commitment	commitment	NN
cord-014462-11ggaqf1	74	38	for	for	IN
cord-014462-11ggaqf1	74	39	parameters	parameter	NNS
cord-014462-11ggaqf1	74	40	and	and	CC
cord-014462-11ggaqf1	74	41	commercialization	commercialization	NN
cord-014462-11ggaqf1	74	42	of	of	IN
cord-014462-11ggaqf1	74	43	recombinant	recombinant	JJ
cord-014462-11ggaqf1	74	44	vaccines	vaccine	NNS
cord-014462-11ggaqf1	74	45	.	.	.
cord-014462-11ggaqf1	75	1	To	to	TO
cord-014462-11ggaqf1	75	2	centralize	centralize	VB
cord-014462-11ggaqf1	75	3	and	and	CC
cord-014462-11ggaqf1	75	4	coordinate	coordinate	VB
cord-014462-11ggaqf1	75	5	the	the	DT
cord-014462-11ggaqf1	75	6	whole	whole	JJ
cord-014462-11ggaqf1	75	7	system	system	NN
cord-014462-11ggaqf1	75	8	,	,	,
cord-014462-11ggaqf1	75	9	Government	Government	NNP
cord-014462-11ggaqf1	75	10	has	have	VBZ
cord-014462-11ggaqf1	75	11	taken	take	VBN
cord-014462-11ggaqf1	75	12	to	to	TO
cord-014462-11ggaqf1	75	13	form	form	VB
cord-014462-11ggaqf1	75	14	two	two	CD
cord-014462-11ggaqf1	75	15	agencies	agency	NNS
cord-014462-11ggaqf1	75	16	to	to	TO
cord-014462-11ggaqf1	75	17	regulate	regulate	VB
cord-014462-11ggaqf1	75	18	the	the	DT
cord-014462-11ggaqf1	75	19	regulation	regulation	NN
cord-014462-11ggaqf1	75	20	laws	law	NNS
cord-014462-11ggaqf1	75	21	to	to	TO
cord-014462-11ggaqf1	75	22	develop	develop	VB
cord-014462-11ggaqf1	75	23	recombinant	recombinant	JJ
cord-014462-11ggaqf1	75	24	pharmaceuticals	pharmaceutical	NNS
cord-014462-11ggaqf1	75	25	products	product	NNS
cord-014462-11ggaqf1	75	26	including	include	VBG
cord-014462-11ggaqf1	75	27	vaccines	vaccine	NNS
cord-014462-11ggaqf1	75	28	.	.	.
cord-014462-11ggaqf1	76	1	The	the	DT
cord-014462-11ggaqf1	76	2	first	first	JJ
cord-014462-11ggaqf1	76	3	is	be	VBZ
cord-014462-11ggaqf1	76	4	the	the	DT
cord-014462-11ggaqf1	76	5	creation	creation	NN
cord-014462-11ggaqf1	76	6	of	of	IN
cord-014462-11ggaqf1	76	7	the	the	DT
cord-014462-11ggaqf1	76	8	National	National	NNP
cord-014462-11ggaqf1	76	9	Biotechnology	Biotechnology	NNP
cord-014462-11ggaqf1	76	10	Regulatory	Regulatory	NNP
cord-014462-11ggaqf1	76	11	Authority	Authority	NNP
cord-014462-11ggaqf1	76	12	(	(	-LRB-
cord-014462-11ggaqf1	76	13	NBRA	NBRA	NNP
cord-014462-11ggaqf1	76	14	)	)	-RRB-
cord-014462-11ggaqf1	76	15	,	,	,
cord-014462-11ggaqf1	76	16	under	under	IN
cord-014462-11ggaqf1	76	17	the	the	DT
cord-014462-11ggaqf1	76	18	Department	Department	NNP
cord-014462-11ggaqf1	76	19	of	of	IN
cord-014462-11ggaqf1	76	20	Biotechnology	Biotechnology	NNP
cord-014462-11ggaqf1	76	21	(	(	-LRB-
cord-014462-11ggaqf1	76	22	DBT	DBT	NNP
cord-014462-11ggaqf1	76	23	)	)	-RRB-
cord-014462-11ggaqf1	76	24	,	,	,
cord-014462-11ggaqf1	76	25	as	as	IN
cord-014462-11ggaqf1	76	26	part	part	NN
cord-014462-11ggaqf1	76	27	of	of	IN
cord-014462-11ggaqf1	76	28	India	India	NNP
cord-014462-11ggaqf1	76	29	's	's	POS
cord-014462-11ggaqf1	76	30	long	long	JJ
cord-014462-11ggaqf1	76	31	-	-	HYPH
cord-014462-11ggaqf1	76	32	term	term	NN
cord-014462-11ggaqf1	76	33	biotech	biotech	JJ
cord-014462-11ggaqf1	76	34	sector	sector	NN
cord-014462-11ggaqf1	76	35	development	development	NN
cord-014462-11ggaqf1	76	36	strategy	strategy	NN
cord-014462-11ggaqf1	76	37	.	.	.
cord-014462-11ggaqf1	77	1	The	the	DT
cord-014462-11ggaqf1	77	2	second	second	JJ
cord-014462-11ggaqf1	77	3	major	major	JJ
cord-014462-11ggaqf1	77	4	initiative	initiative	NN
cord-014462-11ggaqf1	77	5	will	will	MD
cord-014462-11ggaqf1	77	6	affect	affect	VB
cord-014462-11ggaqf1	77	7	the	the	DT
cord-014462-11ggaqf1	77	8	entire	entire	JJ
cord-014462-11ggaqf1	77	9	Indian	indian	JJ
cord-014462-11ggaqf1	77	10	pharmaceutical	pharmaceutical	NN
cord-014462-11ggaqf1	77	11	industry	industry	NN
cord-014462-11ggaqf1	77	12	.	.	.
cord-014462-11ggaqf1	78	1	This	this	DT
cord-014462-11ggaqf1	78	2	is	be	VBZ
cord-014462-11ggaqf1	78	3	the	the	DT
cord-014462-11ggaqf1	78	4	replacement	replacement	NN
cord-014462-11ggaqf1	78	5	of	of	IN
cord-014462-11ggaqf1	78	6	most	most	JJS
cord-014462-11ggaqf1	78	7	state	state	NN
cord-014462-11ggaqf1	78	8	,	,	,
cord-014462-11ggaqf1	78	9	district	district	NN
cord-014462-11ggaqf1	78	10	,	,	,
cord-014462-11ggaqf1	78	11	and	and	CC
cord-014462-11ggaqf1	78	12	central	central	JJ
cord-014462-11ggaqf1	78	13	drug	drug	NN
cord-014462-11ggaqf1	78	14	regulatory	regulatory	JJ
cord-014462-11ggaqf1	78	15	agencies	agency	NNS
cord-014462-11ggaqf1	78	16	with	with	IN
cord-014462-11ggaqf1	78	17	a	a	DT
cord-014462-11ggaqf1	78	18	single	single	JJ
cord-014462-11ggaqf1	78	19	,	,	,
cord-014462-11ggaqf1	78	20	central	central	JJ
cord-014462-11ggaqf1	78	21	,	,	,
cord-014462-11ggaqf1	78	22	FDA	FDA	NNP
cord-014462-11ggaqf1	78	23	-	-	HYPH
cord-014462-11ggaqf1	78	24	style	style	NN
cord-014462-11ggaqf1	78	25	agency	agency	NN
cord-014462-11ggaqf1	78	26	,	,	,
cord-014462-11ggaqf1	78	27	the	the	DT
cord-014462-11ggaqf1	78	28	Central	Central	NNP
cord-014462-11ggaqf1	78	29	Drug	Drug	NNP
cord-014462-11ggaqf1	78	30	Authority	Authority	NNP
cord-014462-11ggaqf1	78	31	(	(	-LRB-
cord-014462-11ggaqf1	78	32	CDA	CDA	NNP
cord-014462-11ggaqf1	78	33	)	)	-RRB-
cord-014462-11ggaqf1	78	34	.	.	.
cord-014462-11ggaqf1	79	1	The	the	DT
cord-014462-11ggaqf1	79	2	CDA	CDA	NNP
cord-014462-11ggaqf1	79	3	is	be	VBZ
cord-014462-11ggaqf1	79	4	expected	expect	VBN
cord-014462-11ggaqf1	79	5	to	to	TO
cord-014462-11ggaqf1	79	6	have	have	VB
cord-014462-11ggaqf1	79	7	separate	separate	JJ
cord-014462-11ggaqf1	79	8	,	,	,
cord-014462-11ggaqf1	79	9	semi	semi	JJ
cord-014462-11ggaqf1	79	10	-	-	JJ
cord-014462-11ggaqf1	79	11	autonomous	autonomous	JJ
cord-014462-11ggaqf1	79	12	departments	department	NNS
cord-014462-11ggaqf1	79	13	for	for	IN
cord-014462-11ggaqf1	79	14	regulation	regulation	NN
cord-014462-11ggaqf1	79	15	,	,	,
cord-014462-11ggaqf1	79	16	enforcement	enforcement	NN
cord-014462-11ggaqf1	79	17	,	,	,
cord-014462-11ggaqf1	79	18	legal	legal	JJ
cord-014462-11ggaqf1	79	19	,	,	,
cord-014462-11ggaqf1	79	20	and	and	CC
cord-014462-11ggaqf1	79	21	consumer	consumer	NN
cord-014462-11ggaqf1	79	22	affairs	affair	NNS
cord-014462-11ggaqf1	79	23	;	;	:
cord-014462-11ggaqf1	79	24	biotechnology	biotechnology	NN
cord-014462-11ggaqf1	79	25	products	product	NNS
cord-014462-11ggaqf1	79	26	;	;	:
cord-014462-11ggaqf1	79	27	pharmacovigilance	pharmacovigilance	NN
cord-014462-11ggaqf1	79	28	and	and	CC
cord-014462-11ggaqf1	79	29	drugs	drug	NNS
cord-014462-11ggaqf1	79	30	safety	safety	NN
cord-014462-11ggaqf1	79	31	;	;	:
cord-014462-11ggaqf1	79	32	medical	medical	JJ
cord-014462-11ggaqf1	79	33	devices	device	NNS
cord-014462-11ggaqf1	79	34	and	and	CC
cord-014462-11ggaqf1	79	35	diagnostics	diagnostic	NNS
cord-014462-11ggaqf1	79	36	;	;	:
cord-014462-11ggaqf1	79	37	imports	import	NNS
cord-014462-11ggaqf1	79	38	;	;	:
cord-014462-11ggaqf1	79	39	quality	quality	NN
cord-014462-11ggaqf1	79	40	control	control	NN
cord-014462-11ggaqf1	79	41	;	;	:
cord-014462-11ggaqf1	79	42	and	and	CC
cord-014462-11ggaqf1	79	43	traditional	traditional	JJ
cord-014462-11ggaqf1	79	44	Indian	indian	JJ
cord-014462-11ggaqf1	79	45	medicines	medicine	NNS
cord-014462-11ggaqf1	79	46	.	.	.
cord-014462-11ggaqf1	80	1	It	-PRON-	PRP
cord-014462-11ggaqf1	80	2	will	will	MD
cord-014462-11ggaqf1	80	3	set	set	VB
cord-014462-11ggaqf1	80	4	up	up	RP
cord-014462-11ggaqf1	80	5	offices	office	NNS
cord-014462-11ggaqf1	80	6	throughout	throughout	IN
cord-014462-11ggaqf1	80	7	India	India	NNP
cord-014462-11ggaqf1	80	8	and	and	CC
cord-014462-11ggaqf1	80	9	will	will	MD
cord-014462-11ggaqf1	80	10	be	be	VB
cord-014462-11ggaqf1	80	11	paid	pay	VBN
cord-014462-11ggaqf1	80	12	for	for	IN
cord-014462-11ggaqf1	80	13	inspection	inspection	NN
cord-014462-11ggaqf1	80	14	,	,	,
cord-014462-11ggaqf1	80	15	registration	registration	NN
cord-014462-11ggaqf1	80	16	,	,	,
cord-014462-11ggaqf1	80	17	and	and	CC
cord-014462-11ggaqf1	80	18	license	license	NN
cord-014462-11ggaqf1	80	19	fees	fee	NNS
cord-014462-11ggaqf1	80	20	.	.	.
cord-014462-11ggaqf1	81	1	Its	-PRON-	PRP$
cord-014462-11ggaqf1	81	2	enforcement	enforcement	NN
cord-014462-11ggaqf1	81	3	powers	power	NNS
cord-014462-11ggaqf1	81	4	will	will	MD
cord-014462-11ggaqf1	81	5	be	be	VB
cord-014462-11ggaqf1	81	6	strengthened	strengthen	VBN
cord-014462-11ggaqf1	81	7	by	by	IN
cord-014462-11ggaqf1	81	8	a	a	DT
cord-014462-11ggaqf1	81	9	new	new	JJ
cord-014462-11ggaqf1	81	10	law	law	NN
cord-014462-11ggaqf1	81	11	increasing	increase	VBG
cord-014462-11ggaqf1	81	12	the	the	DT
cord-014462-11ggaqf1	81	13	criminal	criminal	JJ
cord-014462-11ggaqf1	81	14	penalties	penalty	NNS
cord-014462-11ggaqf1	81	15	for	for	IN
cord-014462-11ggaqf1	81	16	illegal	illegal	JJ
cord-014462-11ggaqf1	81	17	clinical	clinical	JJ
cord-014462-11ggaqf1	81	18	trials	trial	NNS
cord-014462-11ggaqf1	81	19	.	.	.
cord-014462-11ggaqf1	82	1	In	in	IN
cord-014462-11ggaqf1	82	2	the	the	DT
cord-014462-11ggaqf1	82	3	manufacturing	manufacturing	NN
cord-014462-11ggaqf1	82	4	area	area	NN
cord-014462-11ggaqf1	82	5	,	,	,
cord-014462-11ggaqf1	82	6	though	though	RB
cord-014462-11ggaqf1	82	7	,	,	,
cord-014462-11ggaqf1	82	8	the	the	DT
cord-014462-11ggaqf1	82	9	country	country	NN
cord-014462-11ggaqf1	82	10	has	have	VBZ
cord-014462-11ggaqf1	82	11	been	be	VBN
cord-014462-11ggaqf1	82	12	tightening	tighten	VBG
cord-014462-11ggaqf1	82	13	the	the	DT
cord-014462-11ggaqf1	82	14	rules	rule	NNS
cord-014462-11ggaqf1	82	15	and	and	CC
cord-014462-11ggaqf1	82	16	enforcement	enforcement	NN
cord-014462-11ggaqf1	82	17	.	.	.
cord-014462-11ggaqf1	83	1	An	an	DT
cord-014462-11ggaqf1	83	2	amendment	amendment	NN
cord-014462-11ggaqf1	83	3	to	to	IN
cord-014462-11ggaqf1	83	4	the	the	DT
cord-014462-11ggaqf1	83	5	regulations	regulation	NNS
cord-014462-11ggaqf1	83	6	,	,	,
cord-014462-11ggaqf1	83	7	'	'	''
cord-014462-11ggaqf1	83	8	'	'	``
cord-014462-11ggaqf1	83	9	Schedule	Schedule	NNP
cord-014462-11ggaqf1	83	10	M	M	NNP
cord-014462-11ggaqf1	83	11	'	'	''
cord-014462-11ggaqf1	83	12	'	'	''
cord-014462-11ggaqf1	83	13	of	of	IN
cord-014462-11ggaqf1	83	14	the	the	DT
cord-014462-11ggaqf1	83	15	Drug	Drug	NNP
cord-014462-11ggaqf1	83	16	and	and	CC
cord-014462-11ggaqf1	83	17	Cosmetics	Cosmetics	NNPS
cord-014462-11ggaqf1	83	18	Act	Act	NNP
cord-014462-11ggaqf1	83	19	,	,	,
cord-014462-11ggaqf1	83	20	now	now	RB
cord-014462-11ggaqf1	83	21	specifies	specify	VBZ
cord-014462-11ggaqf1	83	22	the	the	DT
cord-014462-11ggaqf1	83	23	Good	Good	NNP
cord-014462-11ggaqf1	83	24	Manufacturing	Manufacturing	NNP
cord-014462-11ggaqf1	83	25	Practice	Practice	NNP
cord-014462-11ggaqf1	83	26	(	(	-LRB-
cord-014462-11ggaqf1	83	27	GMP	GMP	NNP
cord-014462-11ggaqf1	83	28	)	)	-RRB-
cord-014462-11ggaqf1	83	29	requirements	requirement	NNS
cord-014462-11ggaqf1	83	30	for	for	IN
cord-014462-11ggaqf1	83	31	factory	factory	NN
cord-014462-11ggaqf1	83	32	premises	premise	NNS
cord-014462-11ggaqf1	83	33	and	and	CC
cord-014462-11ggaqf1	83	34	materials	material	NNS
cord-014462-11ggaqf1	83	35	.	.	.
cord-014462-11ggaqf1	84	1	These	these	DT
cord-014462-11ggaqf1	84	2	requirements	requirement	NNS
cord-014462-11ggaqf1	84	3	were	be	VBD
cord-014462-11ggaqf1	84	4	modeled	model	VBN
cord-014462-11ggaqf1	84	5	after	after	IN
cord-014462-11ggaqf1	84	6	US	US	NNP
cord-014462-11ggaqf1	84	7	FDA	FDA	NNP
cord-014462-11ggaqf1	84	8	regulations	regulation	NNS
cord-014462-11ggaqf1	84	9	,	,	,
cord-014462-11ggaqf1	84	10	to	to	TO
cord-014462-11ggaqf1	84	11	improve	improve	VB
cord-014462-11ggaqf1	84	12	regulatory	regulatory	JJ
cord-014462-11ggaqf1	84	13	coordination	coordination	NN
cord-014462-11ggaqf1	84	14	between	between	IN
cord-014462-11ggaqf1	84	15	Indian	Indian	NNP
cord-014462-11ggaqf1	84	16	and	and	CC
cord-014462-11ggaqf1	84	17	US	US	NNP
cord-014462-11ggaqf1	84	18	regulators	regulator	NNS
cord-014462-11ggaqf1	84	19	.	.	.
cord-014462-11ggaqf1	85	1	India	India	NNP
cord-014462-11ggaqf1	85	2	has	have	VBZ
cord-014462-11ggaqf1	85	3	realized	realize	VBN
cord-014462-11ggaqf1	85	4	the	the	DT
cord-014462-11ggaqf1	85	5	importance	importance	NN
cord-014462-11ggaqf1	85	6	of	of	IN
cord-014462-11ggaqf1	85	7	regulations	regulation	NNS
cord-014462-11ggaqf1	85	8	in	in	IN
cord-014462-11ggaqf1	85	9	pharmaceutical	pharmaceutical	NN
cord-014462-11ggaqf1	85	10	specially	specially	RB
cord-014462-11ggaqf1	85	11	in	in	IN
cord-014462-11ggaqf1	85	12	vaccine	vaccine	NN
cord-014462-11ggaqf1	85	13	field	field	NN
cord-014462-11ggaqf1	85	14	but	but	CC
cord-014462-11ggaqf1	85	15	it	-PRON-	PRP
cord-014462-11ggaqf1	85	16	will	will	MD
cord-014462-11ggaqf1	85	17	take	take	VB
cord-014462-11ggaqf1	85	18	several	several	JJ
cord-014462-11ggaqf1	85	19	years	year	NNS
cord-014462-11ggaqf1	85	20	to	to	IN
cord-014462-11ggaqf1	85	21	implementation	implementation	NN
cord-014462-11ggaqf1	85	22	of	of	IN
cord-014462-11ggaqf1	85	23	these	these	DT
cord-014462-11ggaqf1	85	24	.	.	.
cord-014462-11ggaqf1	86	1	India	India	NNP
cord-014462-11ggaqf1	86	2	has	have	VBZ
cord-014462-11ggaqf1	86	3	coordinated	coordinate	VBN
cord-014462-11ggaqf1	86	4	some	some	DT
cord-014462-11ggaqf1	86	5	of	of	IN
cord-014462-11ggaqf1	86	6	its	-PRON-	PRP$
cord-014462-11ggaqf1	86	7	regulatory	regulatory	JJ
cord-014462-11ggaqf1	86	8	functions	function	NNS
cord-014462-11ggaqf1	86	9	with	with	IN
cord-014462-11ggaqf1	86	10	Western	western	JJ
cord-014462-11ggaqf1	86	11	organizations	organization	NNS
cord-014462-11ggaqf1	86	12	.	.	.
cord-014462-11ggaqf1	87	1	The	the	DT
cord-014462-11ggaqf1	87	2	US	US	NNP
cord-014462-11ggaqf1	87	3	Pharmacopoeia	Pharmacopoeia	NNP
cord-014462-11ggaqf1	87	4	established	establish	VBD
cord-014462-11ggaqf1	87	5	an	an	DT
cord-014462-11ggaqf1	87	6	office	office	NN
cord-014462-11ggaqf1	87	7	in	in	IN
cord-014462-11ggaqf1	87	8	Hyderabad	Hyderabad	NNP
cord-014462-11ggaqf1	87	9	in	in	IN
cord-014462-11ggaqf1	87	10	2007	2007	CD
cord-014462-11ggaqf1	87	11	.	.	.
cord-014462-11ggaqf1	88	1	A	a	DT
cord-014462-11ggaqf1	88	2	representative	representative	NN
cord-014462-11ggaqf1	88	3	of	of	IN
cord-014462-11ggaqf1	88	4	the	the	DT
cord-014462-11ggaqf1	88	5	Indian	indian	JJ
cord-014462-11ggaqf1	88	6	pharmaceutical	pharmaceutical	NN
cord-014462-11ggaqf1	88	7	lobby	lobby	NN
cord-014462-11ggaqf1	88	8	also	also	RB
cord-014462-11ggaqf1	88	9	recently	recently	RB
cord-014462-11ggaqf1	88	10	has	have	VBZ
cord-014462-11ggaqf1	88	11	expressed	express	VBN
cord-014462-11ggaqf1	88	12	openness	openness	NN
cord-014462-11ggaqf1	88	13	to	to	IN
cord-014462-11ggaqf1	88	14	an	an	DT
cord-014462-11ggaqf1	88	15	expansion	expansion	NN
cord-014462-11ggaqf1	88	16	of	of	IN
cord-014462-11ggaqf1	88	17	the	the	DT
cord-014462-11ggaqf1	88	18	FDA	FDA	NNP
cord-014462-11ggaqf1	88	19	's	's	POS
cord-014462-11ggaqf1	88	20	oversight	oversight	NN
cord-014462-11ggaqf1	88	21	of	of	IN
cord-014462-11ggaqf1	88	22	Indian	indian	JJ
cord-014462-11ggaqf1	88	23	manufacturing	manufacturing	NN
cord-014462-11ggaqf1	88	24	.	.	.
cord-014462-11ggaqf1	89	1	As	as	IN
cord-014462-11ggaqf1	89	2	India	India	NNP
cord-014462-11ggaqf1	89	3	expands	expand	VBZ
cord-014462-11ggaqf1	89	4	its	-PRON-	PRP$
cord-014462-11ggaqf1	89	5	global	global	JJ
cord-014462-11ggaqf1	89	6	drug	drug	NN
cord-014462-11ggaqf1	89	7	and	and	CC
cord-014462-11ggaqf1	89	8	biologicals	biological	NNS
cord-014462-11ggaqf1	89	9	production	production	NN
cord-014462-11ggaqf1	89	10	,	,	,
cord-014462-11ggaqf1	89	11	US	US	NNP
cord-014462-11ggaqf1	89	12	and	and	CC
cord-014462-11ggaqf1	89	13	Europe	Europe	NNP
cord-014462-11ggaqf1	89	14	,	,	,
cord-014462-11ggaqf1	89	15	as	as	IN
cord-014462-11ggaqf1	89	16	the	the	DT
cord-014462-11ggaqf1	89	17	world	world	NN
cord-014462-11ggaqf1	89	18	's	's	POS
cord-014462-11ggaqf1	89	19	largest	large	JJS
cord-014462-11ggaqf1	89	20	drug	drug	NN
cord-014462-11ggaqf1	89	21	importers	importer	NNS
cord-014462-11ggaqf1	89	22	,	,	,
cord-014462-11ggaqf1	89	23	will	will	MD
cord-014462-11ggaqf1	89	24	likely	likely	RB
cord-014462-11ggaqf1	89	25	expand	expand	VB
cord-014462-11ggaqf1	89	26	their	-PRON-	PRP$
cord-014462-11ggaqf1	89	27	regulatory	regulatory	JJ
cord-014462-11ggaqf1	89	28	support	support	NN
cord-014462-11ggaqf1	89	29	in	in	IN
cord-014462-11ggaqf1	89	30	the	the	DT
cord-014462-11ggaqf1	89	31	development	development	NN
cord-014462-11ggaqf1	89	32	of	of	IN
cord-014462-11ggaqf1	89	33	the	the	DT
cord-014462-11ggaqf1	89	34	country	country	NN
cord-014462-11ggaqf1	89	35	's	's	POS
cord-014462-11ggaqf1	89	36	regulatory	regulatory	JJ
cord-014462-11ggaqf1	89	37	systems	system	NNS
cord-014462-11ggaqf1	89	38	.	.	.
cord-014462-11ggaqf1	90	1	Rapid	rapid	JJ
cord-014462-11ggaqf1	90	2	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	90	3	of	of	IN
cord-014462-11ggaqf1	90	4	Japanese	japanese	JJ
cord-014462-11ggaqf1	90	5	encephalitis	encephalitis	RB
cord-014462-11ggaqf1	90	6	virus	virus	NN
cord-014462-11ggaqf1	90	7	(	(	-LRB-
cord-014462-11ggaqf1	90	8	JEV	JEV	NNP
cord-014462-11ggaqf1	90	9	)	)	-RRB-
cord-014462-11ggaqf1	90	10	infections	infection	NNS
cord-014462-11ggaqf1	90	11	is	be	VBZ
cord-014462-11ggaqf1	90	12	important	important	JJ
cord-014462-11ggaqf1	90	13	for	for	IN
cord-014462-11ggaqf1	90	14	timely	timely	JJ
cord-014462-11ggaqf1	90	15	clinical	clinical	JJ
cord-014462-11ggaqf1	90	16	management	management	NN
cord-014462-11ggaqf1	90	17	and	and	CC
cord-014462-11ggaqf1	90	18	epidemiological	epidemiological	JJ
cord-014462-11ggaqf1	90	19	control	control	NN
cord-014462-11ggaqf1	90	20	in	in	IN
cord-014462-11ggaqf1	90	21	areas	area	NNS
cord-014462-11ggaqf1	90	22	where	where	WRB
cord-014462-11ggaqf1	90	23	multiple	multiple	JJ
cord-014462-11ggaqf1	90	24	flaviviruses	flavivirus	NNS
cord-014462-11ggaqf1	90	25	are	be	VBP
cord-014462-11ggaqf1	90	26	endemic	endemic	JJ
cord-014462-11ggaqf1	90	27	.	.	.
cord-014462-11ggaqf1	91	1	However	however	RB
cord-014462-11ggaqf1	91	2	,	,	,
cord-014462-11ggaqf1	91	3	the	the	DT
cord-014462-11ggaqf1	91	4	speed	speed	NN
cord-014462-11ggaqf1	91	5	and	and	CC
cord-014462-11ggaqf1	91	6	accuracy	accuracy	NN
cord-014462-11ggaqf1	91	7	of	of	IN
cord-014462-11ggaqf1	91	8	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	91	9	must	must	MD
cord-014462-11ggaqf1	91	10	be	be	VB
cord-014462-11ggaqf1	91	11	balanced	balance	VBN
cord-014462-11ggaqf1	91	12	against	against	IN
cord-014462-11ggaqf1	91	13	test	test	NN
cord-014462-11ggaqf1	91	14	cost	cost	NN
cord-014462-11ggaqf1	91	15	and	and	CC
cord-014462-11ggaqf1	91	16	availability	availability	NN
cord-014462-11ggaqf1	91	17	,	,	,
cord-014462-11ggaqf1	91	18	especially	especially	RB
cord-014462-11ggaqf1	91	19	in	in	IN
cord-014462-11ggaqf1	91	20	developing	develop	VBG
cord-014462-11ggaqf1	91	21	countries	country	NNS
cord-014462-11ggaqf1	91	22	.	.	.
cord-014462-11ggaqf1	92	1	An	an	DT
cord-014462-11ggaqf1	92	2	antigen	antigen	NN
cord-014462-11ggaqf1	92	3	capture	capture	NN
cord-014462-11ggaqf1	92	4	enzyme	enzyme	NN
cord-014462-11ggaqf1	92	5	-	-	HYPH
cord-014462-11ggaqf1	92	6	linked	link	VBN
cord-014462-11ggaqf1	92	7	immunosorbent	immunosorbent	JJ
cord-014462-11ggaqf1	92	8	assay	assay	NN
cord-014462-11ggaqf1	92	9	(	(	-LRB-
cord-014462-11ggaqf1	92	10	ELISA	ELISA	NNP
cord-014462-11ggaqf1	92	11	)	)	-RRB-
cord-014462-11ggaqf1	92	12	for	for	IN
cord-014462-11ggaqf1	92	13	detection	detection	NN
cord-014462-11ggaqf1	92	14	of	of	IN
cord-014462-11ggaqf1	92	15	circulating	circulate	VBG
cord-014462-11ggaqf1	92	16	JEV	JEV	NNP
cord-014462-11ggaqf1	92	17	specific	specific	JJ
cord-014462-11ggaqf1	92	18	nonstructural	nonstructural	JJ
cord-014462-11ggaqf1	92	19	protein	protein	NN
cord-014462-11ggaqf1	92	20	1	1	CD
cord-014462-11ggaqf1	92	21	(	(	-LRB-
cord-014462-11ggaqf1	92	22	NS1	ns1	NN
cord-014462-11ggaqf1	92	23	)	)	-RRB-
cord-014462-11ggaqf1	92	24	was	be	VBD
cord-014462-11ggaqf1	92	25	developed	develop	VBN
cord-014462-11ggaqf1	92	26	by	by	IN
cord-014462-11ggaqf1	92	27	using	use	VBG
cord-014462-11ggaqf1	92	28	monoclonal	monoclonal	JJ
cord-014462-11ggaqf1	92	29	antibodies	antibody	NNS
cord-014462-11ggaqf1	92	30	(	(	-LRB-
cord-014462-11ggaqf1	92	31	MAbs	MAbs	NNP
cord-014462-11ggaqf1	92	32	)	)	-RRB-
cord-014462-11ggaqf1	92	33	specific	specific	JJ
cord-014462-11ggaqf1	92	34	to	to	IN
cord-014462-11ggaqf1	92	35	recombinant	recombinant	JJ
cord-014462-11ggaqf1	92	36	(	(	-LRB-
cord-014462-11ggaqf1	92	37	NS1	ns1	NN
cord-014462-11ggaqf1	92	38	)	)	-RRB-
cord-014462-11ggaqf1	92	39	.	.	.
cord-014462-11ggaqf1	93	1	The	the	DT
cord-014462-11ggaqf1	93	2	applicability	applicability	NN
cord-014462-11ggaqf1	93	3	of	of	IN
cord-014462-11ggaqf1	93	4	this	this	DT
cord-014462-11ggaqf1	93	5	JEV	JEV	NNP
cord-014462-11ggaqf1	93	6	NS1	NS1	NNS
cord-014462-11ggaqf1	93	7	antigen	antigen	NN
cord-014462-11ggaqf1	93	8	capture	capture	NN
cord-014462-11ggaqf1	93	9	ELISA	ELISA	NNP
cord-014462-11ggaqf1	93	10	for	for	IN
cord-014462-11ggaqf1	93	11	early	early	JJ
cord-014462-11ggaqf1	93	12	clinical	clinical	JJ
cord-014462-11ggaqf1	93	13	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	93	14	was	be	VBD
cord-014462-11ggaqf1	93	15	evaluated	evaluate	VBN
cord-014462-11ggaqf1	93	16	with	with	IN
cord-014462-11ggaqf1	93	17	200	200	CD
cord-014462-11ggaqf1	93	18	acute	acute	JJ
cord-014462-11ggaqf1	93	19	phase	phase	NN
cord-014462-11ggaqf1	93	20	serum/	serum/	CD
cord-014462-11ggaqf1	93	21	cerebrospinal	cerebrospinal	NN
cord-014462-11ggaqf1	93	22	fluid	fluid	NN
cord-014462-11ggaqf1	94	1	(	(	-LRB-
cord-014462-11ggaqf1	94	2	CSF	CSF	NNP
cord-014462-11ggaqf1	94	3	)	)	-RRB-
cord-014462-11ggaqf1	94	4	specimens	specimen	NNS
cord-014462-11ggaqf1	94	5	collected	collect	VBN
cord-014462-11ggaqf1	94	6	from	from	IN
cord-014462-11ggaqf1	94	7	different	different	JJ
cord-014462-11ggaqf1	94	8	epidemics	epidemic	NNS
cord-014462-11ggaqf1	94	9	during	during	IN
cord-014462-11ggaqf1	94	10	[	[	-LRB-
cord-014462-11ggaqf1	94	11	2007	2007	CD
cord-014462-11ggaqf1	94	12	]	]	-RRB-
cord-014462-11ggaqf1	95	1	[	[	-LRB-
cord-014462-11ggaqf1	95	2	2008	2008	CD
cord-014462-11ggaqf1	95	3	]	]	-RRB-
cord-014462-11ggaqf1	95	4	[	[	-LRB-
cord-014462-11ggaqf1	95	5	2009	2009	CD
cord-014462-11ggaqf1	95	6	]	]	-RRB-
cord-014462-11ggaqf1	95	7	.	.	.
cord-014462-11ggaqf1	96	1	JEV	JEV	NNP
cord-014462-11ggaqf1	96	2	NS1	NS1	NNP
cord-014462-11ggaqf1	96	3	antigen	antigen	NNP
cord-014462-11ggaqf1	96	4	was	be	VBD
cord-014462-11ggaqf1	96	5	detected	detect	VBN
cord-014462-11ggaqf1	96	6	in	in	IN
cord-014462-11ggaqf1	96	7	circulation	circulation	NN
cord-014462-11ggaqf1	96	8	from	from	IN
cord-014462-11ggaqf1	96	9	day	day	NN
cord-014462-11ggaqf1	96	10	1	1	CD
cord-014462-11ggaqf1	96	11	to	to	IN
cord-014462-11ggaqf1	96	12	18	18	CD
cord-014462-11ggaqf1	96	13	.	.	.
cord-014462-11ggaqf1	97	1	The	the	DT
cord-014462-11ggaqf1	97	2	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	97	3	and	and	CC
cord-014462-11ggaqf1	97	4	specificity	specificity	NN
cord-014462-11ggaqf1	97	5	of	of	IN
cord-014462-11ggaqf1	97	6	JEV	JEV	NNP
cord-014462-11ggaqf1	97	7	NS1	ns1	CD
cord-014462-11ggaqf1	97	8	detection	detection	NN
cord-014462-11ggaqf1	97	9	in	in	IN
cord-014462-11ggaqf1	97	10	serum	serum	NN
cord-014462-11ggaqf1	97	11	/	/	SYM
cord-014462-11ggaqf1	97	12	CSF	csf	NN
cord-014462-11ggaqf1	97	13	specimens	specimen	NNS
cord-014462-11ggaqf1	97	14	with	with	IN
cord-014462-11ggaqf1	97	15	reference	reference	NN
cord-014462-11ggaqf1	97	16	to	to	TO
cord-014462-11ggaqf1	97	17	reverse	reverse	VB
cord-014462-11ggaqf1	97	18	transcriptase	transcriptase	NN
cord-014462-11ggaqf1	97	19	PCR	PCR	NNP
cord-014462-11ggaqf1	97	20	was	be	VBD
cord-014462-11ggaqf1	97	21	82	82	CD
cord-014462-11ggaqf1	97	22	%	%	NN
cord-014462-11ggaqf1	97	23	,	,	,
cord-014462-11ggaqf1	97	24	and	and	CC
cord-014462-11ggaqf1	97	25	98.9	98.9	CD
cord-014462-11ggaqf1	97	26	%	%	NN
cord-014462-11ggaqf1	97	27	respectively	respectively	RB
cord-014462-11ggaqf1	97	28	.	.	.
cord-014462-11ggaqf1	98	1	No	no	DT
cord-014462-11ggaqf1	98	2	crossreactions	crossreaction	NNS
cord-014462-11ggaqf1	98	3	with	with	IN
cord-014462-11ggaqf1	98	4	any	any	DT
cord-014462-11ggaqf1	98	5	of	of	IN
cord-014462-11ggaqf1	98	6	the	the	DT
cord-014462-11ggaqf1	98	7	other	other	JJ
cord-014462-11ggaqf1	98	8	closely	closely	RB
cord-014462-11ggaqf1	98	9	related	related	JJ
cord-014462-11ggaqf1	98	10	members	member	NNS
cord-014462-11ggaqf1	98	11	of	of	IN
cord-014462-11ggaqf1	98	12	the	the	DT
cord-014462-11ggaqf1	98	13	genus	genus	NN
cord-014462-11ggaqf1	98	14	Flaviviruses	Flaviviruses	NNP
cord-014462-11ggaqf1	98	15	(	(	-LRB-
cord-014462-11ggaqf1	98	16	Dengue	Dengue	NNP
cord-014462-11ggaqf1	98	17	,	,	,
cord-014462-11ggaqf1	98	18	Westnile	Westnile	NNP
cord-014462-11ggaqf1	98	19	,	,	,
cord-014462-11ggaqf1	98	20	Yellow	yellow	JJ
cord-014462-11ggaqf1	98	21	fever	fever	NN
cord-014462-11ggaqf1	98	22	and	and	CC
cord-014462-11ggaqf1	98	23	Saint	Saint	NNP
cord-014462-11ggaqf1	98	24	Louis	Louis	NNP
cord-014462-11ggaqf1	98	25	encephalitis	encephalitis	RB
cord-014462-11ggaqf1	98	26	(	(	-LRB-
cord-014462-11ggaqf1	98	27	SLE	SLE	NNP
cord-014462-11ggaqf1	98	28	)	)	-RRB-
cord-014462-11ggaqf1	98	29	viruses	virus	NNS
cord-014462-11ggaqf1	98	30	)	)	-RRB-
cord-014462-11ggaqf1	98	31	were	be	VBD
cord-014462-11ggaqf1	98	32	observed	observe	VBN
cord-014462-11ggaqf1	98	33	when	when	WRB
cord-014462-11ggaqf1	98	34	tested	test	VBN
cord-014462-11ggaqf1	98	35	with	with	IN
cord-014462-11ggaqf1	98	36	either	either	DT
cord-014462-11ggaqf1	98	37	clinical	clinical	JJ
cord-014462-11ggaqf1	98	38	specimens	specimen	NNS
cord-014462-11ggaqf1	98	39	or	or	CC
cord-014462-11ggaqf1	98	40	virus	virus	NN
cord-014462-11ggaqf1	98	41	cultures	culture	NNS
cord-014462-11ggaqf1	98	42	.	.	.
cord-014462-11ggaqf1	99	1	These	these	DT
cord-014462-11ggaqf1	99	2	findings	finding	NNS
cord-014462-11ggaqf1	99	3	suggested	suggest	VBD
cord-014462-11ggaqf1	99	4	that	that	IN
cord-014462-11ggaqf1	99	5	the	the	DT
cord-014462-11ggaqf1	99	6	reported	report	VBN
cord-014462-11ggaqf1	99	7	JEV	JEV	NNP
cord-014462-11ggaqf1	99	8	specific	specific	JJ
cord-014462-11ggaqf1	99	9	MAb	MAb	NNS
cord-014462-11ggaqf1	99	10	-	-	HYPH
cord-014462-11ggaqf1	99	11	based	base	VBN
cord-014462-11ggaqf1	99	12	NS1	ns1	NN
cord-014462-11ggaqf1	99	13	antigen	antigen	NN
cord-014462-11ggaqf1	99	14	capture	capture	NN
cord-014462-11ggaqf1	99	15	ELISA	ELISA	NNP
cord-014462-11ggaqf1	99	16	will	will	MD
cord-014462-11ggaqf1	99	17	be	be	VB
cord-014462-11ggaqf1	99	18	a	a	DT
cord-014462-11ggaqf1	99	19	rapid	rapid	JJ
cord-014462-11ggaqf1	99	20	and	and	CC
cord-014462-11ggaqf1	99	21	reliable	reliable	JJ
cord-014462-11ggaqf1	99	22	tool	tool	NN
cord-014462-11ggaqf1	99	23	for	for	IN
cord-014462-11ggaqf1	99	24	early	early	JJ
cord-014462-11ggaqf1	99	25	confirmatory	confirmatory	JJ
cord-014462-11ggaqf1	99	26	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	99	27	as	as	RB
cord-014462-11ggaqf1	99	28	well	well	RB
cord-014462-11ggaqf1	99	29	as	as	IN
cord-014462-11ggaqf1	99	30	surveillance	surveillance	NN
cord-014462-11ggaqf1	99	31	of	of	IN
cord-014462-11ggaqf1	99	32	JE	JE	NNP
cord-014462-11ggaqf1	99	33	infections	infection	NNS
cord-014462-11ggaqf1	99	34	in	in	IN
cord-014462-11ggaqf1	99	35	developing	develop	VBG
cord-014462-11ggaqf1	99	36	countries	country	NNS
cord-014462-11ggaqf1	99	37	.	.	.
cord-014462-11ggaqf1	100	1	Manmohan	Manmohan	NNP
cord-014462-11ggaqf1	100	2	Parida	Parida	NNP
cord-014462-11ggaqf1	101	1	The	the	DT
cord-014462-11ggaqf1	101	2	recent	recent	JJ
cord-014462-11ggaqf1	101	3	emergence	emergence	NN
cord-014462-11ggaqf1	101	4	of	of	IN
cord-014462-11ggaqf1	101	5	a	a	DT
cord-014462-11ggaqf1	101	6	novel	novel	JJ
cord-014462-11ggaqf1	101	7	human	human	NN
cord-014462-11ggaqf1	101	8	influenza	influenza	NN
cord-014462-11ggaqf1	101	9	A	a	DT
cord-014462-11ggaqf1	101	10	virus	virus	NN
cord-014462-11ggaqf1	101	11	(	(	-LRB-
cord-014462-11ggaqf1	101	12	H1N1	H1N1	NNP
cord-014462-11ggaqf1	101	13	)	)	-RRB-
cord-014462-11ggaqf1	101	14	poses	pose	VBZ
cord-014462-11ggaqf1	101	15	a	a	DT
cord-014462-11ggaqf1	101	16	serious	serious	JJ
cord-014462-11ggaqf1	101	17	global	global	JJ
cord-014462-11ggaqf1	101	18	health	health	NN
cord-014462-11ggaqf1	101	19	threat	threat	NN
cord-014462-11ggaqf1	101	20	.	.	.
cord-014462-11ggaqf1	102	1	The	the	DT
cord-014462-11ggaqf1	102	2	H1N1	H1N1	NNP
cord-014462-11ggaqf1	102	3	virus	virus	NN
cord-014462-11ggaqf1	102	4	has	have	VBZ
cord-014462-11ggaqf1	102	5	caused	cause	VBN
cord-014462-11ggaqf1	102	6	a	a	DT
cord-014462-11ggaqf1	102	7	considerable	considerable	JJ
cord-014462-11ggaqf1	102	8	number	number	NN
cord-014462-11ggaqf1	102	9	of	of	IN
cord-014462-11ggaqf1	102	10	deaths	death	NNS
cord-014462-11ggaqf1	102	11	within	within	IN
cord-014462-11ggaqf1	102	12	a	a	DT
cord-014462-11ggaqf1	102	13	short	short	JJ
cord-014462-11ggaqf1	102	14	duration	duration	NN
cord-014462-11ggaqf1	102	15	since	since	IN
cord-014462-11ggaqf1	102	16	its	-PRON-	PRP$
cord-014462-11ggaqf1	102	17	emergence	emergence	NN
cord-014462-11ggaqf1	102	18	.	.	.
cord-014462-11ggaqf1	103	1	A	a	DT
cord-014462-11ggaqf1	103	2	two	two	CD
cord-014462-11ggaqf1	103	3	-	-	HYPH
cord-014462-11ggaqf1	103	4	step	step	NN
cord-014462-11ggaqf1	103	5	single	single	JJ
cord-014462-11ggaqf1	103	6	tube	tube	NN
cord-014462-11ggaqf1	103	7	accelerated	accelerate	VBD
cord-014462-11ggaqf1	103	8	rapid	rapid	JJ
cord-014462-11ggaqf1	103	9	real	real	JJ
cord-014462-11ggaqf1	103	10	-	-	HYPH
cord-014462-11ggaqf1	103	11	time	time	NN
cord-014462-11ggaqf1	103	12	and	and	CC
cord-014462-11ggaqf1	103	13	quantitative	quantitative	JJ
cord-014462-11ggaqf1	103	14	Swine	Swine	NNP
cord-014462-11ggaqf1	103	15	flu	flu	NN
cord-014462-11ggaqf1	103	16	virus	virus	NN
cord-014462-11ggaqf1	103	17	specific	specific	JJ
cord-014462-11ggaqf1	103	18	H1	H1	NNP
cord-014462-11ggaqf1	103	19	RTLAMP	RTLAMP	NNP
cord-014462-11ggaqf1	103	20	assay	assay	NN
cord-014462-11ggaqf1	103	21	is	be	VBZ
cord-014462-11ggaqf1	103	22	reported	report	VBN
cord-014462-11ggaqf1	103	23	by	by	IN
cord-014462-11ggaqf1	103	24	targeting	target	VBG
cord-014462-11ggaqf1	103	25	the	the	DT
cord-014462-11ggaqf1	103	26	H1	H1	NNP
cord-014462-11ggaqf1	103	27	gene	gene	NN
cord-014462-11ggaqf1	103	28	of	of	IN
cord-014462-11ggaqf1	103	29	the	the	DT
cord-014462-11ggaqf1	103	30	novel	novel	JJ
cord-014462-11ggaqf1	103	31	H1N1	H1N1	NNP
cord-014462-11ggaqf1	103	32	hybrid	hybrid	NN
cord-014462-11ggaqf1	103	33	virus	virus	NN
cord-014462-11ggaqf1	103	34	.	.	.
cord-014462-11ggaqf1	104	1	The	the	DT
cord-014462-11ggaqf1	104	2	feasibility	feasibility	NN
cord-014462-11ggaqf1	104	3	of	of	IN
cord-014462-11ggaqf1	104	4	Swine	Swine	NNP
cord-014462-11ggaqf1	104	5	flu	flu	NN
cord-014462-11ggaqf1	104	6	H1	h1	NN
cord-014462-11ggaqf1	104	7	RTLAMP	RTLAMP	NNP
cord-014462-11ggaqf1	104	8	for	for	IN
cord-014462-11ggaqf1	104	9	clinical	clinical	JJ
cord-014462-11ggaqf1	104	10	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	104	11	was	be	VBD
cord-014462-11ggaqf1	104	12	validated	validate	VBN
cord-014462-11ggaqf1	104	13	with	with	IN
cord-014462-11ggaqf1	104	14	a	a	DT
cord-014462-11ggaqf1	104	15	panel	panel	NN
cord-014462-11ggaqf1	104	16	of	of	IN
cord-014462-11ggaqf1	104	17	239	239	CD
cord-014462-11ggaqf1	104	18	suspected	suspect	VBN
cord-014462-11ggaqf1	104	19	throat	throat	NN
cord-014462-11ggaqf1	104	20	wash	wash	NN
cord-014462-11ggaqf1	104	21	samples	sample	NNS
cord-014462-11ggaqf1	104	22	comprising	comprise	VBG
cord-014462-11ggaqf1	104	23	116	116	CD
cord-014462-11ggaqf1	104	24	confirmed	confirm	VBD
cord-014462-11ggaqf1	104	25	positive	positive	JJ
cord-014462-11ggaqf1	104	26	and	and	CC
cord-014462-11ggaqf1	104	27	123	123	CD
cord-014462-11ggaqf1	104	28	confirmed	confirm	VBD
cord-014462-11ggaqf1	104	29	negative	negative	JJ
cord-014462-11ggaqf1	104	30	cases	case	NNS
cord-014462-11ggaqf1	104	31	of	of	IN
cord-014462-11ggaqf1	104	32	ongoing	ongoing	JJ
cord-014462-11ggaqf1	104	33	epidemic	epidemic	NN
cord-014462-11ggaqf1	104	34	.	.	.
cord-014462-11ggaqf1	105	1	The	the	DT
cord-014462-11ggaqf1	105	2	comparative	comparative	JJ
cord-014462-11ggaqf1	105	3	evaluation	evaluation	NN
cord-014462-11ggaqf1	105	4	of	of	IN
cord-014462-11ggaqf1	105	5	H1	h1	NN
cord-014462-11ggaqf1	105	6	specific	specific	JJ
cord-014462-11ggaqf1	105	7	RTLAMP	RTLAMP	NNP
cord-014462-11ggaqf1	105	8	assay	assay	NN
cord-014462-11ggaqf1	105	9	with	with	IN
cord-014462-11ggaqf1	105	10	real	real	JJ
cord-014462-11ggaqf1	105	11	-	-	HYPH
cord-014462-11ggaqf1	105	12	time	time	NN
cord-014462-11ggaqf1	105	13	RT	RT	NNP
cord-014462-11ggaqf1	105	14	-	-	HYPH
cord-014462-11ggaqf1	105	15	PCR	PCR	NNP
cord-014462-11ggaqf1	105	16	demonstrated	demonstrate	VBD
cord-014462-11ggaqf1	105	17	exceptionally	exceptionally	RB
cord-014462-11ggaqf1	105	18	higher	high	JJR
cord-014462-11ggaqf1	105	19	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	105	20	by	by	IN
cord-014462-11ggaqf1	105	21	picking	pick	VBG
cord-014462-11ggaqf1	105	22	up	up	RP
cord-014462-11ggaqf1	105	23	all	all	PDT
cord-014462-11ggaqf1	105	24	the	the	DT
cord-014462-11ggaqf1	105	25	116	116	CD
cord-014462-11ggaqf1	105	26	H1N1	H1N1	NNP
cord-014462-11ggaqf1	105	27	positive	positive	JJ
cord-014462-11ggaqf1	105	28	and	and	CC
cord-014462-11ggaqf1	105	29	36	36	CD
cord-014462-11ggaqf1	105	30	additional	additional	JJ
cord-014462-11ggaqf1	105	31	positive	positive	JJ
cord-014462-11ggaqf1	105	32	cases	case	NNS
cord-014462-11ggaqf1	105	33	amongst	amongst	IN
cord-014462-11ggaqf1	105	34	the	the	DT
cord-014462-11ggaqf1	105	35	negatives	negative	NNS
cord-014462-11ggaqf1	105	36	that	that	WDT
cord-014462-11ggaqf1	105	37	were	be	VBD
cord-014462-11ggaqf1	105	38	sequence	sequence	NN
cord-014462-11ggaqf1	105	39	confirmed	confirm	VBN
cord-014462-11ggaqf1	105	40	as	as	IN
cord-014462-11ggaqf1	105	41	H1N1	H1N1	NNP
cord-014462-11ggaqf1	105	42	.	.	.
cord-014462-11ggaqf1	106	1	None	none	NN
cord-014462-11ggaqf1	106	2	of	of	IN
cord-014462-11ggaqf1	106	3	the	the	DT
cord-014462-11ggaqf1	106	4	Real	Real	NNP
cord-014462-11ggaqf1	106	5	-	-	HYPH
cord-014462-11ggaqf1	106	6	Time	time	NN
cord-014462-11ggaqf1	106	7	RTPCR	RTPCR	NNP
cord-014462-11ggaqf1	106	8	positive	positive	JJ
cord-014462-11ggaqf1	106	9	samples	sample	NNS
cord-014462-11ggaqf1	106	10	were	be	VBD
cord-014462-11ggaqf1	106	11	missed	miss	VBN
cord-014462-11ggaqf1	106	12	by	by	IN
cord-014462-11ggaqf1	106	13	RTLAMP	RTLAMP	NNP
cord-014462-11ggaqf1	106	14	system	system	NN
cord-014462-11ggaqf1	106	15	.	.	.
cord-014462-11ggaqf1	107	1	The	the	DT
cord-014462-11ggaqf1	107	2	comparative	comparative	JJ
cord-014462-11ggaqf1	107	3	study	study	NN
cord-014462-11ggaqf1	107	4	revealed	reveal	VBD
cord-014462-11ggaqf1	107	5	that	that	IN
cord-014462-11ggaqf1	107	6	RTLAMP	RTLAMP	NNP
cord-014462-11ggaqf1	107	7	was	be	VBD
cord-014462-11ggaqf1	107	8	100-fold	100-fold	CD
cord-014462-11ggaqf1	107	9	more	more	RBR
cord-014462-11ggaqf1	107	10	sensitive	sensitive	JJ
cord-014462-11ggaqf1	107	11	than	than	IN
cord-014462-11ggaqf1	107	12	RTPCR	RTPCR	NNP
cord-014462-11ggaqf1	107	13	with	with	IN
cord-014462-11ggaqf1	107	14	a	a	DT
cord-014462-11ggaqf1	107	15	detection	detection	NN
cord-014462-11ggaqf1	107	16	limit	limit	NN
cord-014462-11ggaqf1	107	17	of	of	IN
cord-014462-11ggaqf1	107	18	1	1	CD
cord-014462-11ggaqf1	107	19	copy	copy	NN
cord-014462-11ggaqf1	107	20	number	number	NN
cord-014462-11ggaqf1	107	21	.	.	.
cord-014462-11ggaqf1	108	1	These	these	DT
cord-014462-11ggaqf1	108	2	findings	finding	NNS
cord-014462-11ggaqf1	108	3	suggested	suggest	VBD
cord-014462-11ggaqf1	108	4	that	that	IN
cord-014462-11ggaqf1	108	5	RTLAMP	RTLAMP	NNP
cord-014462-11ggaqf1	108	6	assay	assay	NN
cord-014462-11ggaqf1	108	7	is	be	VBZ
cord-014462-11ggaqf1	108	8	a	a	DT
cord-014462-11ggaqf1	108	9	valuable	valuable	JJ
cord-014462-11ggaqf1	108	10	tool	tool	NN
cord-014462-11ggaqf1	108	11	for	for	IN
cord-014462-11ggaqf1	108	12	rapid	rapid	JJ
cord-014462-11ggaqf1	108	13	,	,	,
cord-014462-11ggaqf1	108	14	real	real	JJ
cord-014462-11ggaqf1	108	15	-	-	HYPH
cord-014462-11ggaqf1	108	16	time	time	NN
cord-014462-11ggaqf1	108	17	detection	detection	NN
cord-014462-11ggaqf1	108	18	as	as	RB
cord-014462-11ggaqf1	108	19	well	well	RB
cord-014462-11ggaqf1	108	20	as	as	IN
cord-014462-11ggaqf1	108	21	quantification	quantification	NN
cord-014462-11ggaqf1	108	22	of	of	IN
cord-014462-11ggaqf1	108	23	H1N1	H1N1	NNP
cord-014462-11ggaqf1	108	24	virus	virus	NN
cord-014462-11ggaqf1	108	25	in	in	IN
cord-014462-11ggaqf1	108	26	acute	acute	JJ
cord-014462-11ggaqf1	108	27	phase	phase	NN
cord-014462-11ggaqf1	108	28	throat	throat	NN
cord-014462-11ggaqf1	108	29	swab	swab	NN
cord-014462-11ggaqf1	108	30	samples	sample	NNS
cord-014462-11ggaqf1	108	31	without	without	IN
cord-014462-11ggaqf1	108	32	requiring	require	VBG
cord-014462-11ggaqf1	108	33	any	any	DT
cord-014462-11ggaqf1	108	34	sophisticated	sophisticated	JJ
cord-014462-11ggaqf1	108	35	equipments	equipment	NNS
cord-014462-11ggaqf1	108	36	.	.	.
cord-014462-11ggaqf1	109	1	because	because	IN
cord-014462-11ggaqf1	109	2	of	of	IN
cord-014462-11ggaqf1	109	3	its	-PRON-	PRP$
cord-014462-11ggaqf1	109	4	recurrent	recurrent	JJ
cord-014462-11ggaqf1	109	5	nature	nature	NN
cord-014462-11ggaqf1	109	6	.	.	.
cord-014462-11ggaqf1	110	1	Despite	despite	IN
cord-014462-11ggaqf1	110	2	considerable	considerable	JJ
cord-014462-11ggaqf1	110	3	progress	progress	NN
cord-014462-11ggaqf1	110	4	in	in	IN
cord-014462-11ggaqf1	110	5	understanding	understanding	NN
cord-014462-11ggaqf1	110	6	of	of	IN
cord-014462-11ggaqf1	110	7	the	the	DT
cord-014462-11ggaqf1	110	8	virus	virus	NN
cord-014462-11ggaqf1	110	9	at	at	IN
cord-014462-11ggaqf1	110	10	cellular	cellular	JJ
cord-014462-11ggaqf1	110	11	and	and	CC
cord-014462-11ggaqf1	110	12	molecular	molecular	JJ
cord-014462-11ggaqf1	110	13	levels	level	NNS
cord-014462-11ggaqf1	110	14	,	,	,
cord-014462-11ggaqf1	110	15	the	the	DT
cord-014462-11ggaqf1	110	16	proper	proper	JJ
cord-014462-11ggaqf1	110	17	management	management	NN
cord-014462-11ggaqf1	110	18	of	of	IN
cord-014462-11ggaqf1	110	19	the	the	DT
cord-014462-11ggaqf1	110	20	disease	disease	NN
cord-014462-11ggaqf1	110	21	in	in	IN
cord-014462-11ggaqf1	110	22	its	-PRON-	PRP$
cord-014462-11ggaqf1	110	23	different	different	JJ
cord-014462-11ggaqf1	110	24	stages	stage	NNS
cord-014462-11ggaqf1	110	25	is	be	VBZ
cord-014462-11ggaqf1	110	26	still	still	RB
cord-014462-11ggaqf1	110	27	a	a	DT
cord-014462-11ggaqf1	110	28	dilemma	dilemma	NN
cord-014462-11ggaqf1	110	29	particularly	particularly	RB
cord-014462-11ggaqf1	110	30	whether	whether	IN
cord-014462-11ggaqf1	110	31	to	to	TO
cord-014462-11ggaqf1	110	32	use	use	VB
cord-014462-11ggaqf1	110	33	antiviral	antiviral	JJ
cord-014462-11ggaqf1	110	34	or	or	CC
cord-014462-11ggaqf1	110	35	steroids	steroid	NNS
cord-014462-11ggaqf1	110	36	or	or	CC
cord-014462-11ggaqf1	110	37	both	both	DT
cord-014462-11ggaqf1	110	38	.	.	.
cord-014462-11ggaqf1	111	1	The	the	DT
cord-014462-11ggaqf1	111	2	risk	risk	NN
cord-014462-11ggaqf1	111	3	of	of	IN
cord-014462-11ggaqf1	111	4	using	use	VBG
cord-014462-11ggaqf1	111	5	steroids	steroid	NNS
cord-014462-11ggaqf1	111	6	with	with	IN
cord-014462-11ggaqf1	111	7	its	-PRON-	PRP$
cord-014462-11ggaqf1	111	8	attendant	attendant	JJ
cord-014462-11ggaqf1	111	9	complications	complication	NNS
cord-014462-11ggaqf1	111	10	has	have	VBZ
cord-014462-11ggaqf1	111	11	to	to	TO
cord-014462-11ggaqf1	111	12	be	be	VB
cord-014462-11ggaqf1	111	13	weighed	weigh	VBN
cord-014462-11ggaqf1	111	14	against	against	IN
cord-014462-11ggaqf1	111	15	the	the	DT
cord-014462-11ggaqf1	111	16	risk	risk	NN
cord-014462-11ggaqf1	111	17	of	of	IN
cord-014462-11ggaqf1	111	18	progression	progression	NN
cord-014462-11ggaqf1	111	19	of	of	IN
cord-014462-11ggaqf1	111	20	the	the	DT
cord-014462-11ggaqf1	111	21	disease	disease	NN
cord-014462-11ggaqf1	111	22	if	if	IN
cord-014462-11ggaqf1	111	23	avoiding	avoid	VBG
cord-014462-11ggaqf1	111	24	the	the	DT
cord-014462-11ggaqf1	111	25	use	use	NN
cord-014462-11ggaqf1	111	26	of	of	IN
cord-014462-11ggaqf1	111	27	steroids	steroid	NNS
cord-014462-11ggaqf1	111	28	.	.	.
cord-014462-11ggaqf1	112	1	This	this	DT
cord-014462-11ggaqf1	112	2	dilemma	dilemma	NN
cord-014462-11ggaqf1	112	3	can	can	MD
cord-014462-11ggaqf1	112	4	be	be	VB
cord-014462-11ggaqf1	112	5	reduced	reduce	VBN
cord-014462-11ggaqf1	112	6	to	to	IN
cord-014462-11ggaqf1	112	7	a	a	DT
cord-014462-11ggaqf1	112	8	considerable	considerable	JJ
cord-014462-11ggaqf1	112	9	extent	extent	NN
cord-014462-11ggaqf1	112	10	if	if	IN
cord-014462-11ggaqf1	112	11	basic	basic	JJ
cord-014462-11ggaqf1	112	12	principles	principle	NNS
cord-014462-11ggaqf1	112	13	of	of	IN
cord-014462-11ggaqf1	112	14	virology	virology	NN
cord-014462-11ggaqf1	112	15	and	and	CC
cord-014462-11ggaqf1	112	16	pathogenesis	pathogenesis	NN
cord-014462-11ggaqf1	112	17	are	be	VBP
cord-014462-11ggaqf1	112	18	kept	keep	VBN
cord-014462-11ggaqf1	112	19	in	in	IN
cord-014462-11ggaqf1	112	20	mind	mind	NN
cord-014462-11ggaqf1	112	21	.	.	.
cord-014462-11ggaqf1	113	1	This	this	DT
cord-014462-11ggaqf1	113	2	article	article	NN
cord-014462-11ggaqf1	113	3	reviews	review	VBZ
cord-014462-11ggaqf1	113	4	current	current	JJ
cord-014462-11ggaqf1	113	5	concepts	concept	NNS
cord-014462-11ggaqf1	113	6	of	of	IN
cord-014462-11ggaqf1	113	7	virological	virological	JJ
cord-014462-11ggaqf1	113	8	and	and	CC
cord-014462-11ggaqf1	113	9	clinical	clinical	JJ
cord-014462-11ggaqf1	113	10	aspects	aspect	NNS
cord-014462-11ggaqf1	113	11	of	of	IN
cord-014462-11ggaqf1	113	12	HSV	HSV	NNP
cord-014462-11ggaqf1	113	13	keratitis	keratitis	NN
cord-014462-11ggaqf1	113	14	to	to	TO
cord-014462-11ggaqf1	113	15	enable	enable	VB
cord-014462-11ggaqf1	113	16	a	a	DT
cord-014462-11ggaqf1	113	17	broad	broad	JJ
cord-014462-11ggaqf1	113	18	understanding	understanding	NN
cord-014462-11ggaqf1	113	19	of	of	IN
cord-014462-11ggaqf1	113	20	the	the	DT
cord-014462-11ggaqf1	113	21	disease	disease	NN
cord-014462-11ggaqf1	113	22	process	process	NN
cord-014462-11ggaqf1	113	23	.	.	.
cord-014462-11ggaqf1	114	1	It	-PRON-	PRP
cord-014462-11ggaqf1	114	2	is	be	VBZ
cord-014462-11ggaqf1	114	3	recognized	recognize	VBN
cord-014462-11ggaqf1	114	4	several	several	JJ
cord-014462-11ggaqf1	114	5	influential	influential	JJ
cord-014462-11ggaqf1	114	6	host	host	NN
cord-014462-11ggaqf1	114	7	factors	factor	NNS
cord-014462-11ggaqf1	114	8	including	include	VBG
cord-014462-11ggaqf1	114	9	the	the	DT
cord-014462-11ggaqf1	114	10	fact	fact	NN
cord-014462-11ggaqf1	114	11	that	that	IN
cord-014462-11ggaqf1	114	12	HSK	HSK	NNP
cord-014462-11ggaqf1	114	13	is	be	VBZ
cord-014462-11ggaqf1	114	14	more	more	RBR
cord-014462-11ggaqf1	114	15	common	common	JJ
cord-014462-11ggaqf1	114	16	in	in	IN
cord-014462-11ggaqf1	114	17	men	man	NNS
cord-014462-11ggaqf1	114	18	than	than	IN
cord-014462-11ggaqf1	114	19	women	woman	NNS
cord-014462-11ggaqf1	114	20	.	.	.
cord-014462-11ggaqf1	115	1	It	-PRON-	PRP
cord-014462-11ggaqf1	115	2	is	be	VBZ
cord-014462-11ggaqf1	115	3	observed	observe	VBN
cord-014462-11ggaqf1	115	4	that	that	IN
cord-014462-11ggaqf1	115	5	the	the	DT
cord-014462-11ggaqf1	115	6	ability	ability	NN
cord-014462-11ggaqf1	115	7	of	of	IN
cord-014462-11ggaqf1	115	8	HSV	HSV	NNP
cord-014462-11ggaqf1	115	9	to	to	TO
cord-014462-11ggaqf1	115	10	establish	establish	VB
cord-014462-11ggaqf1	115	11	latent	latent	JJ
cord-014462-11ggaqf1	115	12	infection	infection	NN
cord-014462-11ggaqf1	115	13	in	in	IN
cord-014462-11ggaqf1	115	14	sensory	sensory	JJ
cord-014462-11ggaqf1	115	15	neurons	neuron	NNS
cord-014462-11ggaqf1	115	16	and	and	CC
cord-014462-11ggaqf1	115	17	possibly	possibly	RB
cord-014462-11ggaqf1	115	18	cornea	cornea	NN
cord-014462-11ggaqf1	115	19	,	,	,
cord-014462-11ggaqf1	115	20	but	but	CC
cord-014462-11ggaqf1	115	21	have	have	VBP
cord-014462-11ggaqf1	115	22	as	as	RB
cord-014462-11ggaqf1	115	23	yet	yet	RB
cord-014462-11ggaqf1	115	24	been	be	VBN
cord-014462-11ggaqf1	115	25	unable	unable	JJ
cord-014462-11ggaqf1	115	26	to	to	TO
cord-014462-11ggaqf1	115	27	use	use	VB
cord-014462-11ggaqf1	115	28	this	this	DT
cord-014462-11ggaqf1	115	29	knowledge	knowledge	NN
cord-014462-11ggaqf1	115	30	to	to	TO
cord-014462-11ggaqf1	115	31	prevent	prevent	VB
cord-014462-11ggaqf1	115	32	the	the	DT
cord-014462-11ggaqf1	115	33	disease	disease	NN
cord-014462-11ggaqf1	115	34	limitations	limitation	NNS
cord-014462-11ggaqf1	115	35	.	.	.
cord-014462-11ggaqf1	116	1	Acknowledging	acknowledge	VBG
cord-014462-11ggaqf1	116	2	limitations	limitation	NNS
cord-014462-11ggaqf1	116	3	may	may	MD
cord-014462-11ggaqf1	116	4	further	further	RB
cord-014462-11ggaqf1	116	5	stimulate	stimulate	VB
cord-014462-11ggaqf1	116	6	application	application	NN
cord-014462-11ggaqf1	116	7	of	of	IN
cord-014462-11ggaqf1	116	8	laboratory	laboratory	NN
cord-014462-11ggaqf1	116	9	knowledge	knowledge	NN
cord-014462-11ggaqf1	116	10	in	in	IN
cord-014462-11ggaqf1	116	11	coping	cope	VBG
cord-014462-11ggaqf1	116	12	with	with	IN
cord-014462-11ggaqf1	116	13	HSK	HSK	NNP
cord-014462-11ggaqf1	116	14	which	which	WDT
cord-014462-11ggaqf1	116	15	constitutes	constitute	VBZ
cord-014462-11ggaqf1	116	16	to	to	TO
cord-014462-11ggaqf1	116	17	present	present	VB
cord-014462-11ggaqf1	116	18	major	major	JJ
cord-014462-11ggaqf1	116	19	challenge	challenge	NN
cord-014462-11ggaqf1	116	20	in	in	IN
cord-014462-11ggaqf1	116	21	terms	term	NNS
cord-014462-11ggaqf1	116	22	of	of	IN
cord-014462-11ggaqf1	116	23	management	management	NN
cord-014462-11ggaqf1	116	24	.	.	.
cord-014462-11ggaqf1	117	1	MVO-10	MVO-10	NNP
cord-014462-11ggaqf1	117	2	Study	Study	NNP
cord-014462-11ggaqf1	117	3	on	on	IN
cord-014462-11ggaqf1	117	4	Effect	Effect	NNP
cord-014462-11ggaqf1	117	5	of	of	IN
cord-014462-11ggaqf1	117	6	Human	Human	NNP
cord-014462-11ggaqf1	117	7	bHsp90	bHsp90	.
cord-014462-11ggaqf1	117	8	in	in	IN
cord-014462-11ggaqf1	117	9	Immunity	Immunity	NNP
cord-014462-11ggaqf1	117	10	of	of	IN
cord-014462-11ggaqf1	117	11	HCV	HCV	NNP
cord-014462-11ggaqf1	117	12	Core	Core	NNP
cord-014462-11ggaqf1	117	13	Protein	Protein	NNP
cord-014462-11ggaqf1	117	14	and	and	CC
cord-014462-11ggaqf1	117	15	HBV	HBV	NNP
cord-014462-11ggaqf1	118	1	HbsAg	HbsAg	NNP
cord-014462-11ggaqf1	119	1	There	there	EX
cord-014462-11ggaqf1	119	2	are	be	VBP
cord-014462-11ggaqf1	119	3	more	more	JJR
cord-014462-11ggaqf1	119	4	than	than	IN
cord-014462-11ggaqf1	119	5	500	500	CD
cord-014462-11ggaqf1	119	6	million	million	CD
cord-014462-11ggaqf1	119	7	individuals	individual	NNS
cord-014462-11ggaqf1	119	8	with	with	IN
cord-014462-11ggaqf1	119	9	hepatitis	hepatitis	NNP
cord-014462-11ggaqf1	119	10	B	B	NNP
cord-014462-11ggaqf1	119	11	and	and	CC
cord-014462-11ggaqf1	119	12	C	C	NNP
cord-014462-11ggaqf1	119	13	in	in	IN
cord-014462-11ggaqf1	119	14	the	the	DT
cord-014462-11ggaqf1	119	15	world	world	NN
cord-014462-11ggaqf1	119	16	.	.	.
cord-014462-11ggaqf1	120	1	In	in	IN
cord-014462-11ggaqf1	120	2	spite	spite	NN
cord-014462-11ggaqf1	120	3	of	of	IN
cord-014462-11ggaqf1	120	4	vaccination	vaccination	NN
cord-014462-11ggaqf1	120	5	in	in	IN
cord-014462-11ggaqf1	120	6	the	the	DT
cord-014462-11ggaqf1	120	7	different	different	JJ
cord-014462-11ggaqf1	120	8	areas	area	NNS
cord-014462-11ggaqf1	120	9	there	there	EX
cord-014462-11ggaqf1	120	10	are	be	VBP
cord-014462-11ggaqf1	120	11	several	several	JJ
cord-014462-11ggaqf1	120	12	reports	report	NNS
cord-014462-11ggaqf1	120	13	about	about	IN
cord-014462-11ggaqf1	120	14	patients	patient	NNS
cord-014462-11ggaqf1	120	15	who	who	WP
cord-014462-11ggaqf1	120	16	got	get	VBD
cord-014462-11ggaqf1	120	17	vaccine	vaccine	NN
cord-014462-11ggaqf1	120	18	before	before	RB
cord-014462-11ggaqf1	120	19	.	.	.
cord-014462-11ggaqf1	121	1	Also	also	RB
cord-014462-11ggaqf1	121	2	there	there	EX
cord-014462-11ggaqf1	121	3	is	be	VBZ
cord-014462-11ggaqf1	121	4	not	not	RB
cord-014462-11ggaqf1	121	5	efficient	efficient	JJ
cord-014462-11ggaqf1	121	6	vaccine	vaccine	NN
cord-014462-11ggaqf1	121	7	against	against	IN
cord-014462-11ggaqf1	121	8	of	of	IN
cord-014462-11ggaqf1	121	9	hepatitis	hepatitis	NNP
cord-014462-11ggaqf1	121	10	C	C	NNP
cord-014462-11ggaqf1	121	11	and	and	CC
cord-014462-11ggaqf1	121	12	one	one	CD
cord-014462-11ggaqf1	121	13	of	of	IN
cord-014462-11ggaqf1	121	14	the	the	DT
cord-014462-11ggaqf1	121	15	important	important	JJ
cord-014462-11ggaqf1	121	16	problems	problem	NNS
cord-014462-11ggaqf1	121	17	in	in	IN
cord-014462-11ggaqf1	121	18	vaccine	vaccine	NN
cord-014462-11ggaqf1	121	19	project	project	NN
cord-014462-11ggaqf1	122	1	is	be	VBZ
cord-014462-11ggaqf1	122	2	development	development	NN
cord-014462-11ggaqf1	122	3	of	of	IN
cord-014462-11ggaqf1	122	4	effective	effective	JJ
cord-014462-11ggaqf1	122	5	and	and	CC
cord-014462-11ggaqf1	122	6	suitable	suitable	JJ
cord-014462-11ggaqf1	122	7	adjuvant	adjuvant	NN
cord-014462-11ggaqf1	122	8	in	in	IN
cord-014462-11ggaqf1	122	9	human	human	JJ
cord-014462-11ggaqf1	122	10	vaccines	vaccine	NNS
cord-014462-11ggaqf1	122	11	.	.	.
cord-014462-11ggaqf1	123	1	At	at	IN
cord-014462-11ggaqf1	123	2	present	present	JJ
cord-014462-11ggaqf1	123	3	research	research	NN
cord-014462-11ggaqf1	123	4	we	-PRON-	PRP
cord-014462-11ggaqf1	123	5	applied	apply	VBD
cord-014462-11ggaqf1	123	6	human	human	NN
cord-014462-11ggaqf1	123	7	bHsp90	bhsp90	CC
cord-014462-11ggaqf1	123	8	protein	protein	NN
cord-014462-11ggaqf1	123	9	as	as	IN
cord-014462-11ggaqf1	123	10	adjuvant	adjuvant	NN
cord-014462-11ggaqf1	123	11	and	and	CC
cord-014462-11ggaqf1	123	12	chaperon	chaperon	NN
cord-014462-11ggaqf1	123	13	.	.	.
cord-014462-11ggaqf1	124	1	This	this	DT
cord-014462-11ggaqf1	124	2	protein	protein	NN
cord-014462-11ggaqf1	124	3	injected	inject	VBD
cord-014462-11ggaqf1	124	4	to	to	IN
cord-014462-11ggaqf1	124	5	BalbC	BalbC	NNP
cord-014462-11ggaqf1	124	6	mice	mouse	NNS
cord-014462-11ggaqf1	124	7	as	as	IN
cord-014462-11ggaqf1	124	8	adjuvant	adjuvant	JJ
cord-014462-11ggaqf1	124	9	together	together	RB
cord-014462-11ggaqf1	124	10	with	with	IN
cord-014462-11ggaqf1	124	11	recombinant	recombinant	JJ
cord-014462-11ggaqf1	124	12	proteins	protein	NNS
cord-014462-11ggaqf1	124	13	of	of	IN
cord-014462-11ggaqf1	124	14	HCV	HCV	NNP
cord-014462-11ggaqf1	124	15	core	core	NN
cord-014462-11ggaqf1	124	16	and	and	CC
cord-014462-11ggaqf1	124	17	HBV	HBV	NNP
cord-014462-11ggaqf1	124	18	HbsAg	HbsAg	NNP
cord-014462-11ggaqf1	124	19	.	.	.
cord-014462-11ggaqf1	125	1	Then	then	RB
cord-014462-11ggaqf1	125	2	humoral	humoral	JJ
cord-014462-11ggaqf1	125	3	and	and	CC
cord-014462-11ggaqf1	125	4	Cellular	cellular	JJ
cord-014462-11ggaqf1	125	5	immune	immune	JJ
cord-014462-11ggaqf1	125	6	systems	system	NNS
cord-014462-11ggaqf1	125	7	of	of	IN
cord-014462-11ggaqf1	125	8	the	the	DT
cord-014462-11ggaqf1	125	9	mice	mouse	NNS
cord-014462-11ggaqf1	125	10	were	be	VBD
cord-014462-11ggaqf1	125	11	studied	study	VBN
cord-014462-11ggaqf1	125	12	.	.	.
cord-014462-11ggaqf1	126	1	Core	core	VB
cord-014462-11ggaqf1	126	2	and	and	CC
cord-014462-11ggaqf1	126	3	HbsAg	HbsAg	NNP
cord-014462-11ggaqf1	126	4	genes	gene	NNS
cord-014462-11ggaqf1	126	5	were	be	VBD
cord-014462-11ggaqf1	126	6	cloned	clone	VBN
cord-014462-11ggaqf1	126	7	into	into	IN
cord-014462-11ggaqf1	126	8	pETDuet-1	petduet-1	CD
cord-014462-11ggaqf1	126	9	vector	vector	NN
cord-014462-11ggaqf1	126	10	and	and	CC
cord-014462-11ggaqf1	126	11	thermal	thermal	JJ
cord-014462-11ggaqf1	126	12	vector	vector	NN
cord-014462-11ggaqf1	126	13	of	of	IN
cord-014462-11ggaqf1	126	14	pGP1	pGP1	NNP
cord-014462-11ggaqf1	126	15	-	-	HYPH
cord-014462-11ggaqf1	126	16	2	2	CD
cord-014462-11ggaqf1	126	17	was	be	VBD
cord-014462-11ggaqf1	126	18	used	use	VBN
cord-014462-11ggaqf1	126	19	for	for	IN
cord-014462-11ggaqf1	126	20	human	human	JJ
cord-014462-11ggaqf1	126	21	heat	heat	NN
cord-014462-11ggaqf1	126	22	shock	shock	NN
cord-014462-11ggaqf1	126	23	protein	protein	NN
cord-014462-11ggaqf1	126	24	90	90	CD
cord-014462-11ggaqf1	126	25	expressions	expression	NNS
cord-014462-11ggaqf1	126	26	.	.	.
cord-014462-11ggaqf1	127	1	The	the	DT
cord-014462-11ggaqf1	127	2	different	different	JJ
cord-014462-11ggaqf1	127	3	combination	combination	NN
cord-014462-11ggaqf1	127	4	of	of	IN
cord-014462-11ggaqf1	127	5	these	these	DT
cord-014462-11ggaqf1	127	6	three	three	CD
cord-014462-11ggaqf1	127	7	proteins	protein	NNS
cord-014462-11ggaqf1	127	8	was	be	VBD
cord-014462-11ggaqf1	127	9	injected	inject	VBN
cord-014462-11ggaqf1	127	10	to	to	IN
cord-014462-11ggaqf1	127	11	mice	mouse	NNS
cord-014462-11ggaqf1	127	12	and	and	CC
cord-014462-11ggaqf1	127	13	we	-PRON-	PRP
cord-014462-11ggaqf1	127	14	evaluated	evaluate	VBD
cord-014462-11ggaqf1	127	15	the	the	DT
cord-014462-11ggaqf1	127	16	total	total	JJ
cord-014462-11ggaqf1	127	17	IgG	igg	NN
cord-014462-11ggaqf1	127	18	and	and	CC
cord-014462-11ggaqf1	127	19	IgG2a	IgG2a	NNP
cord-014462-11ggaqf1	127	20	of	of	IN
cord-014462-11ggaqf1	127	21	mice	mouse	NNS
cord-014462-11ggaqf1	127	22	serums	serum	NNS
cord-014462-11ggaqf1	127	23	after	after	IN
cord-014462-11ggaqf1	127	24	a	a	DT
cord-014462-11ggaqf1	127	25	week	week	NN
cord-014462-11ggaqf1	127	26	.	.	.
cord-014462-11ggaqf1	128	1	Two	two	CD
cord-014462-11ggaqf1	128	2	weeks	week	NNS
cord-014462-11ggaqf1	128	3	after	after	IN
cord-014462-11ggaqf1	128	4	booster	booster	NN
cord-014462-11ggaqf1	128	5	injection	injection	NN
cord-014462-11ggaqf1	128	6	,	,	,
cord-014462-11ggaqf1	128	7	we	-PRON-	PRP
cord-014462-11ggaqf1	128	8	studied	study	VBD
cord-014462-11ggaqf1	128	9	the	the	DT
cord-014462-11ggaqf1	128	10	proliferation	proliferation	NN
cord-014462-11ggaqf1	128	11	and	and	CC
cord-014462-11ggaqf1	128	12	cytokine	cytokine	JJ
cord-014462-11ggaqf1	128	13	secretion	secretion	NN
cord-014462-11ggaqf1	128	14	of	of	IN
cord-014462-11ggaqf1	128	15	spleen	spleen	NNS
cord-014462-11ggaqf1	128	16	,	,	,
cord-014462-11ggaqf1	128	17	inguinal	inguinal	JJ
cord-014462-11ggaqf1	128	18	and	and	CC
cord-014462-11ggaqf1	128	19	popliteal	popliteal	JJ
cord-014462-11ggaqf1	128	20	lymph	lymph	NN
cord-014462-11ggaqf1	128	21	nodes	node	NNS
cord-014462-11ggaqf1	128	22	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	128	23	in	in	IN
cord-014462-11ggaqf1	128	24	vitro	vitro	FW
cord-014462-11ggaqf1	128	25	and	and	CC
cord-014462-11ggaqf1	128	26	ex	ex	FW
cord-014462-11ggaqf1	128	27	vivo	vivo	NN
cord-014462-11ggaqf1	128	28	conditions	condition	NNS
cord-014462-11ggaqf1	128	29	.	.	.
cord-014462-11ggaqf1	129	1	So	so	RB
cord-014462-11ggaqf1	129	2	the	the	DT
cord-014462-11ggaqf1	129	3	Core	Core	NNP
cord-014462-11ggaqf1	129	4	/	/	SYM
cord-014462-11ggaqf1	129	5	HbsAg	HbsAg	NNP
cord-014462-11ggaqf1	129	6	+	+	CC
cord-014462-11ggaqf1	129	7	hsp	hsp	NNP
cord-014462-11ggaqf1	129	8	and	and	CC
cord-014462-11ggaqf1	129	9	Core	Core	NNP
cord-014462-11ggaqf1	129	10	+	+	SYM
cord-014462-11ggaqf1	129	11	HbsAg	HbsAg	NNP
cord-014462-11ggaqf1	129	12	+	+	CC
cord-014462-11ggaqf1	129	13	hsp	hsp	NNP
cord-014462-11ggaqf1	129	14	complexes	complex	NNS
cord-014462-11ggaqf1	129	15	induced	induce	VBD
cord-014462-11ggaqf1	129	16	total	total	JJ
cord-014462-11ggaqf1	129	17	IgG	igg	NN
cord-014462-11ggaqf1	129	18	and	and	CC
cord-014462-11ggaqf1	129	19	IgG2a	IgG2a	NNP
cord-014462-11ggaqf1	129	20	secretion	secretion	NN
cord-014462-11ggaqf1	129	21	.	.	.
cord-014462-11ggaqf1	130	1	The	the	DT
cord-014462-11ggaqf1	130	2	spleen	spleen	NN
cord-014462-11ggaqf1	130	3	lymphocytes	lymphocyte	VBZ
cord-014462-11ggaqf1	130	4	proliferation	proliferation	NN
cord-014462-11ggaqf1	130	5	were	be	VBD
cord-014462-11ggaqf1	130	6	increased	increase	VBN
cord-014462-11ggaqf1	130	7	equal	equal	JJ
cord-014462-11ggaqf1	130	8	to	to	IN
cord-014462-11ggaqf1	130	9	serum	serum	NN
cord-014462-11ggaqf1	130	10	IgG2a	igg2a	JJ
cord-014462-11ggaqf1	130	11	level	level	NN
cord-014462-11ggaqf1	130	12	that	that	WDT
cord-014462-11ggaqf1	130	13	was	be	VBD
cord-014462-11ggaqf1	130	14	constant	constant	JJ
cord-014462-11ggaqf1	130	15	in	in	IN
cord-014462-11ggaqf1	130	16	second	second	JJ
cord-014462-11ggaqf1	130	17	time	time	NN
cord-014462-11ggaqf1	130	18	bleeding	bleed	VBG
cord-014462-11ggaqf1	130	19	with	with	IN
cord-014462-11ggaqf1	130	20	significant	significant	JJ
cord-014462-11ggaqf1	130	21	different	different	JJ
cord-014462-11ggaqf1	130	22	to	to	IN
cord-014462-11ggaqf1	130	23	complexes	complex	NNS
cord-014462-11ggaqf1	130	24	with	with	IN
cord-014462-11ggaqf1	130	25	freund	freund	NNP
cord-014462-11ggaqf1	130	26	's	's	POS
cord-014462-11ggaqf1	130	27	adjuvant	adjuvant	NN
cord-014462-11ggaqf1	130	28	.	.	.
cord-014462-11ggaqf1	131	1	At	at	IN
cord-014462-11ggaqf1	131	2	first	first	JJ
cord-014462-11ggaqf1	131	3	IL-4	IL-4	NNP
cord-014462-11ggaqf1	131	4	and	and	CC
cord-014462-11ggaqf1	131	5	IL-5	IL-5	NNP
cord-014462-11ggaqf1	131	6	cytokines	cytokine	NNS
cord-014462-11ggaqf1	131	7	were	be	VBD
cord-014462-11ggaqf1	131	8	increased	increase	VBN
cord-014462-11ggaqf1	131	9	and	and	CC
cord-014462-11ggaqf1	131	10	then	then	RB
cord-014462-11ggaqf1	131	11	decrease	decrease	NN
cord-014462-11ggaqf1	131	12	of	of	IN
cord-014462-11ggaqf1	131	13	IL-4	IL-4	NNP
cord-014462-11ggaqf1	131	14	meaned	mean	VBD
cord-014462-11ggaqf1	131	15	no	no	DT
cord-014462-11ggaqf1	131	16	hypersensitivity	hypersensitivity	NN
cord-014462-11ggaqf1	131	17	.	.	.
cord-014462-11ggaqf1	132	1	The	the	DT
cord-014462-11ggaqf1	132	2	chaperon	chaperon	NN
cord-014462-11ggaqf1	132	3	effect	effect	NN
cord-014462-11ggaqf1	132	4	of	of	IN
cord-014462-11ggaqf1	132	5	Hsp90	Hsp90	NNP
cord-014462-11ggaqf1	132	6	on	on	IN
cord-014462-11ggaqf1	132	7	structure	structure	NN
cord-014462-11ggaqf1	132	8	of	of	IN
cord-014462-11ggaqf1	132	9	core	core	NN
cord-014462-11ggaqf1	132	10	and	and	CC
cord-014462-11ggaqf1	132	11	HbsAg	HbsAg	NNP
cord-014462-11ggaqf1	132	12	proteins	protein	NNS
cord-014462-11ggaqf1	132	13	was	be	VBD
cord-014462-11ggaqf1	132	14	studied	study	VBN
cord-014462-11ggaqf1	132	15	by	by	IN
cord-014462-11ggaqf1	132	16	CD	CD	NNP
cord-014462-11ggaqf1	132	17	and	and	CC
cord-014462-11ggaqf1	132	18	flourometer	flourometer	NN
cord-014462-11ggaqf1	132	19	.	.	.
cord-014462-11ggaqf1	133	1	It	-PRON-	PRP
cord-014462-11ggaqf1	133	2	could	could	MD
cord-014462-11ggaqf1	133	3	fold	fold	VB
cord-014462-11ggaqf1	133	4	the	the	DT
cord-014462-11ggaqf1	133	5	proteins	protein	NNS
cord-014462-11ggaqf1	133	6	after	after	IN
cord-014462-11ggaqf1	133	7	heating	heating	NN
cord-014462-11ggaqf1	133	8	and	and	CC
cord-014462-11ggaqf1	133	9	unfolding	unfolding	NN
cord-014462-11ggaqf1	133	10	.	.	.
cord-014462-11ggaqf1	134	1	Hepatitis	Hepatitis	NNP
cord-014462-11ggaqf1	134	2	B	B	NNP
cord-014462-11ggaqf1	134	3	virus	virus	NN
cord-014462-11ggaqf1	134	4	(	(	-LRB-
cord-014462-11ggaqf1	134	5	HBV	HBV	NNP
cord-014462-11ggaqf1	134	6	)	)	-RRB-
cord-014462-11ggaqf1	134	7	infection	infection	NN
cord-014462-11ggaqf1	134	8	is	be	VBZ
cord-014462-11ggaqf1	134	9	vaccine	vaccine	NN
cord-014462-11ggaqf1	134	10	preventable	preventable	JJ
cord-014462-11ggaqf1	134	11	global	global	JJ
cord-014462-11ggaqf1	134	12	public	public	JJ
cord-014462-11ggaqf1	134	13	health	health	NN
cord-014462-11ggaqf1	134	14	problem	problem	NN
cord-014462-11ggaqf1	134	15	.	.	.
cord-014462-11ggaqf1	135	1	All	all	DT
cord-014462-11ggaqf1	135	2	commercially	commercially	RB
cord-014462-11ggaqf1	135	3	available	available	JJ
cord-014462-11ggaqf1	135	4	vaccines	vaccine	NNS
cord-014462-11ggaqf1	135	5	contain	contain	VBP
cord-014462-11ggaqf1	135	6	one	one	CD
cord-014462-11ggaqf1	135	7	or	or	CC
cord-014462-11ggaqf1	135	8	more	more	JJR
cord-014462-11ggaqf1	135	9	of	of	IN
cord-014462-11ggaqf1	135	10	the	the	DT
cord-014462-11ggaqf1	135	11	recombinant	recombinant	JJ
cord-014462-11ggaqf1	135	12	Hepatitis	Hepatitis	NNP
cord-014462-11ggaqf1	135	13	B	B	NNP
cord-014462-11ggaqf1	135	14	envelope	envelope	NN
cord-014462-11ggaqf1	135	15	protein	protein	NN
cord-014462-11ggaqf1	135	16	or	or	CC
cord-014462-11ggaqf1	135	17	surface	surface	NN
cord-014462-11ggaqf1	135	18	antigen	antigen	NN
cord-014462-11ggaqf1	135	19	(	(	-LRB-
cord-014462-11ggaqf1	135	20	HBsAg	hbsag	ADD
cord-014462-11ggaqf1	135	21	)	)	-RRB-
cord-014462-11ggaqf1	135	22	.	.	.
cord-014462-11ggaqf1	136	1	Measurement	measurement	NN
cord-014462-11ggaqf1	136	2	of	of	IN
cord-014462-11ggaqf1	136	3	antigen	antigen	NN
cord-014462-11ggaqf1	136	4	responsible	responsible	JJ
cord-014462-11ggaqf1	136	5	for	for	IN
cord-014462-11ggaqf1	136	6	immunogenicity	immunogenicity	NN
cord-014462-11ggaqf1	136	7	of	of	IN
cord-014462-11ggaqf1	136	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	136	9	is	be	VBZ
cord-014462-11ggaqf1	136	10	central	central	JJ
cord-014462-11ggaqf1	136	11	to	to	IN
cord-014462-11ggaqf1	136	12	quality	quality	NN
cord-014462-11ggaqf1	136	13	assessment	assessment	NN
cord-014462-11ggaqf1	136	14	.	.	.
cord-014462-11ggaqf1	137	1	The	the	DT
cord-014462-11ggaqf1	137	2	problems	problem	NNS
cord-014462-11ggaqf1	137	3	associated	associate	VBN
cord-014462-11ggaqf1	137	4	with	with	IN
cord-014462-11ggaqf1	137	5	the	the	DT
cord-014462-11ggaqf1	137	6	use	use	NN
cord-014462-11ggaqf1	137	7	of	of	IN
cord-014462-11ggaqf1	137	8	a	a	DT
cord-014462-11ggaqf1	137	9	polyclonal	polyclonal	JJ
cord-014462-11ggaqf1	137	10	antibody	antibody	NN
cord-014462-11ggaqf1	137	11	in	in	IN
cord-014462-11ggaqf1	137	12	an	an	DT
cord-014462-11ggaqf1	137	13	assay	assay	NN
cord-014462-11ggaqf1	137	14	with	with	IN
cord-014462-11ggaqf1	137	15	regard	regard	NN
cord-014462-11ggaqf1	137	16	to	to	IN
cord-014462-11ggaqf1	137	17	its	-PRON-	PRP$
cord-014462-11ggaqf1	137	18	poorly	poorly	RB
cord-014462-11ggaqf1	137	19	defined	define	VBN
cord-014462-11ggaqf1	137	20	nature	nature	NN
cord-014462-11ggaqf1	137	21	and	and	CC
cord-014462-11ggaqf1	137	22	batch	batch	NN
cord-014462-11ggaqf1	137	23	-	-	HYPH
cord-014462-11ggaqf1	137	24	to	to	IN
cord-014462-11ggaqf1	137	25	-	-	HYPH
cord-014462-11ggaqf1	137	26	batch	batch	NN
cord-014462-11ggaqf1	137	27	variation	variation	NN
cord-014462-11ggaqf1	137	28	has	have	VBZ
cord-014462-11ggaqf1	137	29	been	be	VBN
cord-014462-11ggaqf1	137	30	mitigated	mitigate	VBN
cord-014462-11ggaqf1	137	31	by	by	IN
cord-014462-11ggaqf1	137	32	the	the	DT
cord-014462-11ggaqf1	137	33	use	use	NN
cord-014462-11ggaqf1	137	34	of	of	IN
cord-014462-11ggaqf1	137	35	MAbs	MAbs	NNP
cord-014462-11ggaqf1	137	36	as	as	IN
cord-014462-11ggaqf1	137	37	described	describe	VBN
cord-014462-11ggaqf1	137	38	in	in	IN
cord-014462-11ggaqf1	137	39	this	this	DT
cord-014462-11ggaqf1	137	40	paper	paper	NN
cord-014462-11ggaqf1	137	41	.	.	.
cord-014462-11ggaqf1	138	1	The	the	DT
cord-014462-11ggaqf1	138	2	initial	initial	JJ
cord-014462-11ggaqf1	138	3	capture	capture	NN
cord-014462-11ggaqf1	138	4	of	of	IN
cord-014462-11ggaqf1	138	5	HBsAg	hbsag	ADD
cord-014462-11ggaqf1	138	6	by	by	IN
cord-014462-11ggaqf1	138	7	the	the	DT
cord-014462-11ggaqf1	138	8	MAb	MAb	NNS
cord-014462-11ggaqf1	138	9	could	could	MD
cord-014462-11ggaqf1	138	10	orientate	orientate	VB
cord-014462-11ggaqf1	138	11	it	-PRON-	PRP
cord-014462-11ggaqf1	138	12	such	such	JJ
cord-014462-11ggaqf1	138	13	that	that	IN
cord-014462-11ggaqf1	138	14	the	the	DT
cord-014462-11ggaqf1	138	15	same	same	JJ
cord-014462-11ggaqf1	138	16	antibody	antibody	NN
cord-014462-11ggaqf1	138	17	could	could	MD
cord-014462-11ggaqf1	138	18	bind	bind	VB
cord-014462-11ggaqf1	138	19	to	to	IN
cord-014462-11ggaqf1	138	20	it	-PRON-	PRP
cord-014462-11ggaqf1	138	21	as	as	IN
cord-014462-11ggaqf1	138	22	a	a	DT
cord-014462-11ggaqf1	138	23	detection	detection	NN
cord-014462-11ggaqf1	138	24	antibody	antibody	NN
cord-014462-11ggaqf1	138	25	after	after	IN
cord-014462-11ggaqf1	138	26	labeling	label	VBG
cord-014462-11ggaqf1	138	27	with	with	IN
cord-014462-11ggaqf1	138	28	out	out	IN
cord-014462-11ggaqf1	138	29	steric	steric	JJ
cord-014462-11ggaqf1	138	30	hindrance	hindrance	NN
cord-014462-11ggaqf1	138	31	.	.	.
cord-014462-11ggaqf1	139	1	The	the	DT
cord-014462-11ggaqf1	139	2	development	development	NN
cord-014462-11ggaqf1	139	3	of	of	IN
cord-014462-11ggaqf1	139	4	an	an	DT
cord-014462-11ggaqf1	139	5	immuno	immuno	JJ
cord-014462-11ggaqf1	139	6	-	-	JJ
cord-014462-11ggaqf1	139	7	capture	capture	JJ
cord-014462-11ggaqf1	139	8	ELISA	ELISA	NNP
cord-014462-11ggaqf1	139	9	(	(	-LRB-
cord-014462-11ggaqf1	139	10	IC	IC	NNP
cord-014462-11ggaqf1	139	11	-	-	HYPH
cord-014462-11ggaqf1	139	12	ELISA	ELISA	NNP
cord-014462-11ggaqf1	139	13	)	)	-RRB-
cord-014462-11ggaqf1	139	14	to	to	TO
cord-014462-11ggaqf1	139	15	measure	measure	VB
cord-014462-11ggaqf1	139	16	the	the	DT
cord-014462-11ggaqf1	139	17	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	139	18	content	content	NN
cord-014462-11ggaqf1	139	19	using	use	VBG
cord-014462-11ggaqf1	139	20	a	a	DT
cord-014462-11ggaqf1	139	21	monoclonal	monoclonal	JJ
cord-014462-11ggaqf1	139	22	antibody	antibody	NN
cord-014462-11ggaqf1	139	23	(	(	-LRB-
cord-014462-11ggaqf1	139	24	MAb	MAb	NNS
cord-014462-11ggaqf1	139	25	)	)	-RRB-
cord-014462-11ggaqf1	139	26	specific	specific	JJ
cord-014462-11ggaqf1	139	27	to	to	IN
cord-014462-11ggaqf1	139	28	determinant	determinant	NN
cord-014462-11ggaqf1	139	29	'	'	''
cord-014462-11ggaqf1	139	30	'	'	''
cord-014462-11ggaqf1	139	31	a	a	DT
cord-014462-11ggaqf1	139	32	'	'	''
cord-014462-11ggaqf1	139	33	'	'	''
cord-014462-11ggaqf1	139	34	of	of	IN
cord-014462-11ggaqf1	139	35	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	139	36	in	in	IN
cord-014462-11ggaqf1	139	37	the	the	DT
cord-014462-11ggaqf1	139	38	experimental	experimental	JJ
cord-014462-11ggaqf1	139	39	vaccine	vaccine	NN
cord-014462-11ggaqf1	139	40	formulations	formulation	NNS
cord-014462-11ggaqf1	139	41	is	be	VBZ
cord-014462-11ggaqf1	139	42	being	be	VBG
cord-014462-11ggaqf1	139	43	discussed	discuss	VBN
cord-014462-11ggaqf1	139	44	.	.	.
cord-014462-11ggaqf1	140	1	Murine	Murine	NNP
cord-014462-11ggaqf1	140	2	MAbs	MAbs	NNP
cord-014462-11ggaqf1	140	3	developed	develop	VBD
cord-014462-11ggaqf1	140	4	against	against	IN
cord-014462-11ggaqf1	140	5	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	140	6	,	,	,
cord-014462-11ggaqf1	140	7	subtype	subtype	NN
cord-014462-11ggaqf1	140	8	adw2	adw2	NNP
cord-014462-11ggaqf1	140	9	were	be	VBD
cord-014462-11ggaqf1	140	10	found	find	VBN
cord-014462-11ggaqf1	140	11	to	to	TO
cord-014462-11ggaqf1	140	12	cross	cross	VB
cord-014462-11ggaqf1	140	13	-	-	VB
cord-014462-11ggaqf1	140	14	react	react	VB
cord-014462-11ggaqf1	140	15	with	with	IN
cord-014462-11ggaqf1	140	16	the	the	DT
cord-014462-11ggaqf1	140	17	other	other	JJ
cord-014462-11ggaqf1	140	18	subtypes	subtype	NNS
cord-014462-11ggaqf1	140	19	viz	viz	JJ
cord-014462-11ggaqf1	140	20	.	.	.
cord-014462-11ggaqf1	141	1	ad	ad	NNP
cord-014462-11ggaqf1	141	2	and	and	CC
cord-014462-11ggaqf1	141	3	ay	ay	UH
cord-014462-11ggaqf1	141	4	too	too	RB
cord-014462-11ggaqf1	141	5	.	.	.
cord-014462-11ggaqf1	142	1	The	the	DT
cord-014462-11ggaqf1	142	2	MAbs	MAbs	NNP
cord-014462-11ggaqf1	142	3	have	have	VBP
cord-014462-11ggaqf1	142	4	been	be	VBN
cord-014462-11ggaqf1	142	5	characterized	characterize	VBN
cord-014462-11ggaqf1	142	6	following	follow	VBG
cord-014462-11ggaqf1	142	7	which	which	WDT
cord-014462-11ggaqf1	142	8	,	,	,
cord-014462-11ggaqf1	142	9	one	one	CD
cord-014462-11ggaqf1	142	10	MAb	MAb	NNS
cord-014462-11ggaqf1	142	11	HBs06	hbs06	PRP
cord-014462-11ggaqf1	142	12	was	be	VBD
cord-014462-11ggaqf1	142	13	chosen	choose	VBN
cord-014462-11ggaqf1	142	14	for	for	IN
cord-014462-11ggaqf1	142	15	developing	develop	VBG
cord-014462-11ggaqf1	142	16	IC	IC	NNP
cord-014462-11ggaqf1	142	17	-	-	HYPH
cord-014462-11ggaqf1	142	18	ELISA	ELISA	NNP
cord-014462-11ggaqf1	142	19	format	format	NN
cord-014462-11ggaqf1	142	20	for	for	IN
cord-014462-11ggaqf1	142	21	the	the	DT
cord-014462-11ggaqf1	142	22	quantification	quantification	NN
cord-014462-11ggaqf1	142	23	of	of	IN
cord-014462-11ggaqf1	142	24	the	the	DT
cord-014462-11ggaqf1	142	25	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	142	26	in	in	IN
cord-014462-11ggaqf1	142	27	the	the	DT
cord-014462-11ggaqf1	142	28	final	final	JJ
cord-014462-11ggaqf1	142	29	Algel	Algel	NNP
cord-014462-11ggaqf1	142	30	adsorbed	adsorb	VBD
cord-014462-11ggaqf1	142	31	vaccines	vaccine	NNS
cord-014462-11ggaqf1	142	32	.	.	.
cord-014462-11ggaqf1	143	1	The	the	DT
cord-014462-11ggaqf1	143	2	unadsorbed	unadsorbed	JJ
cord-014462-11ggaqf1	143	3	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	143	4	was	be	VBD
cord-014462-11ggaqf1	143	5	used	use	VBN
cord-014462-11ggaqf1	143	6	to	to	TO
cord-014462-11ggaqf1	143	7	establish	establish	VB
cord-014462-11ggaqf1	143	8	the	the	DT
cord-014462-11ggaqf1	143	9	standard	standard	JJ
cord-014462-11ggaqf1	143	10	curve	curve	NN
cord-014462-11ggaqf1	143	11	of	of	IN
cord-014462-11ggaqf1	143	12	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	143	13	/	/	SYM
cord-014462-11ggaqf1	143	14	a	a	NN
cord-014462-11ggaqf1	143	15	.	.	.
cord-014462-11ggaqf1	144	1	The	the	DT
cord-014462-11ggaqf1	144	2	ELISA	ELISA	NNP
cord-014462-11ggaqf1	144	3	had	have	VBD
cord-014462-11ggaqf1	144	4	a	a	DT
cord-014462-11ggaqf1	144	5	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	144	6	of	of	IN
cord-014462-11ggaqf1	144	7	10	10	CD
cord-014462-11ggaqf1	144	8	ng	ng	NN
cord-014462-11ggaqf1	144	9	/	/	SYM
cord-014462-11ggaqf1	144	10	ml	ml	NN
cord-014462-11ggaqf1	144	11	of	of	IN
cord-014462-11ggaqf1	144	12	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	144	13	.	.	.
cord-014462-11ggaqf1	145	1	The	the	DT
cord-014462-11ggaqf1	145	2	recovery	recovery	NN
cord-014462-11ggaqf1	145	3	rate	rate	NN
cord-014462-11ggaqf1	145	4	of	of	IN
cord-014462-11ggaqf1	145	5	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	145	6	/	/	SYM
cord-014462-11ggaqf1	145	7	a	a	DT
cord-014462-11ggaqf1	145	8	was	be	VBD
cord-014462-11ggaqf1	145	9	found	find	VBN
cord-014462-11ggaqf1	145	10	to	to	TO
cord-014462-11ggaqf1	145	11	be	be	VB
cord-014462-11ggaqf1	145	12	around	around	IN
cord-014462-11ggaqf1	145	13	70	70	CD
cord-014462-11ggaqf1	145	14	%	%	NN
cord-014462-11ggaqf1	145	15	in	in	IN
cord-014462-11ggaqf1	145	16	the	the	DT
cord-014462-11ggaqf1	145	17	vaccines	vaccine	NNS
cord-014462-11ggaqf1	145	18	treated	treat	VBN
cord-014462-11ggaqf1	145	19	to	to	TO
cord-014462-11ggaqf1	145	20	desorb	desorb	VB
cord-014462-11ggaqf1	145	21	the	the	DT
cord-014462-11ggaqf1	145	22	antigen	antigen	NN
cord-014462-11ggaqf1	145	23	from	from	IN
cord-014462-11ggaqf1	145	24	Algel	Algel	NNP
cord-014462-11ggaqf1	145	25	.	.	.
cord-014462-11ggaqf1	146	1	Twenty	twenty	CD
cord-014462-11ggaqf1	146	2	seven	seven	CD
cord-014462-11ggaqf1	146	3	experimental	experimental	JJ
cord-014462-11ggaqf1	146	4	batches	batch	NNS
cord-014462-11ggaqf1	146	5	of	of	IN
cord-014462-11ggaqf1	146	6	monovalent	monovalent	NN
cord-014462-11ggaqf1	147	1	Hepatitis	hepatitis	NN
cord-014462-11ggaqf1	147	2	B	b	NN
cord-014462-11ggaqf1	147	3	vaccines	vaccine	NNS
cord-014462-11ggaqf1	147	4	were	be	VBD
cord-014462-11ggaqf1	147	5	analyzed	analyze	VBN
cord-014462-11ggaqf1	147	6	for	for	IN
cord-014462-11ggaqf1	147	7	the	the	DT
cord-014462-11ggaqf1	147	8	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	147	9	content	content	NN
cord-014462-11ggaqf1	147	10	,	,	,
cord-014462-11ggaqf1	147	11	both	both	DT
cord-014462-11ggaqf1	147	12	by	by	IN
cord-014462-11ggaqf1	147	13	IC	IC	NNP
cord-014462-11ggaqf1	147	14	-	-	HYPH
cord-014462-11ggaqf1	147	15	ELISA	ELISA	NNP
cord-014462-11ggaqf1	147	16	and	and	CC
cord-014462-11ggaqf1	147	17	a	a	DT
cord-014462-11ggaqf1	147	18	commercial	commercial	JJ
cord-014462-11ggaqf1	147	19	kit	kit	NN
cord-014462-11ggaqf1	147	20	(	(	-LRB-
cord-014462-11ggaqf1	147	21	AxSym	AxSym	NNP
cord-014462-11ggaqf1	147	22	kit	kit	NN
cord-014462-11ggaqf1	147	23	,	,	,
cord-014462-11ggaqf1	147	24	Abbott	Abbott	NNP
cord-014462-11ggaqf1	147	25	Laboratories	Laboratories	NNP
cord-014462-11ggaqf1	147	26	,	,	,
cord-014462-11ggaqf1	147	27	USA	USA	NNP
cord-014462-11ggaqf1	147	28	)	)	-RRB-
cord-014462-11ggaqf1	147	29	.	.	.
cord-014462-11ggaqf1	148	1	The	the	DT
cord-014462-11ggaqf1	148	2	statistical	statistical	JJ
cord-014462-11ggaqf1	148	3	analysis	analysis	NN
cord-014462-11ggaqf1	148	4	of	of	IN
cord-014462-11ggaqf1	148	5	IC	IC	NNP
cord-014462-11ggaqf1	148	6	-	-	HYPH
cord-014462-11ggaqf1	148	7	ELISA	ELISA	NNP
cord-014462-11ggaqf1	148	8	results	result	NNS
cord-014462-11ggaqf1	148	9	indicated	indicate	VBD
cord-014462-11ggaqf1	148	10	that	that	IN
cord-014462-11ggaqf1	148	11	an	an	DT
cord-014462-11ggaqf1	148	12	experimental	experimental	JJ
cord-014462-11ggaqf1	148	13	equation	equation	NN
cord-014462-11ggaqf1	148	14	f(x	f(x	NNP
cord-014462-11ggaqf1	148	15	)	)	-RRB-
cord-014462-11ggaqf1	148	16	=	=	SYM
cord-014462-11ggaqf1	148	17	0.0062(x	0.0062(x	CD
cord-014462-11ggaqf1	148	18	)	)	-RRB-
cord-014462-11ggaqf1	148	19	+	+	SYM
cord-014462-11ggaqf1	148	20	0.184	0.184	CD
cord-014462-11ggaqf1	148	21	,	,	,
cord-014462-11ggaqf1	148	22	could	could	MD
cord-014462-11ggaqf1	148	23	precisely	precisely	RB
cord-014462-11ggaqf1	148	24	estimate	estimate	VB
cord-014462-11ggaqf1	148	25	the	the	DT
cord-014462-11ggaqf1	148	26	amount	amount	NN
cord-014462-11ggaqf1	148	27	of	of	IN
cord-014462-11ggaqf1	148	28	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	148	29	in	in	IN
cord-014462-11ggaqf1	148	30	the	the	DT
cord-014462-11ggaqf1	148	31	adsorbed	adsorb	VBN
cord-014462-11ggaqf1	148	32	vaccines	vaccine	NNS
cord-014462-11ggaqf1	148	33	.	.	.
cord-014462-11ggaqf1	149	1	The	the	DT
cord-014462-11ggaqf1	149	2	amounts	amount	NNS
cord-014462-11ggaqf1	149	3	of	of	IN
cord-014462-11ggaqf1	149	4	HBsAg	hbsag	ADD
cord-014462-11ggaqf1	149	5	recovered	recover	VBN
cord-014462-11ggaqf1	149	6	from	from	IN
cord-014462-11ggaqf1	149	7	the	the	DT
cord-014462-11ggaqf1	149	8	adsorbed	adsorb	VBN
cord-014462-11ggaqf1	149	9	vaccines	vaccine	NNS
cord-014462-11ggaqf1	149	10	as	as	IN
cord-014462-11ggaqf1	149	11	estimated	estimate	VBN
cord-014462-11ggaqf1	149	12	by	by	IN
cord-014462-11ggaqf1	149	13	the	the	DT
cord-014462-11ggaqf1	149	14	IC	IC	NNP
cord-014462-11ggaqf1	149	15	-	-	HYPH
cord-014462-11ggaqf1	149	16	ELISA	ELISA	NNP
cord-014462-11ggaqf1	149	17	format	format	NN
cord-014462-11ggaqf1	149	18	had	have	VBD
cord-014462-11ggaqf1	149	19	a	a	DT
cord-014462-11ggaqf1	149	20	good	good	JJ
cord-014462-11ggaqf1	149	21	correlation	correlation	NN
cord-014462-11ggaqf1	149	22	with	with	IN
cord-014462-11ggaqf1	149	23	the	the	DT
cord-014462-11ggaqf1	149	24	estimates	estimate	NNS
cord-014462-11ggaqf1	149	25	derived	derive	VBN
cord-014462-11ggaqf1	149	26	from	from	IN
cord-014462-11ggaqf1	149	27	a	a	DT
cord-014462-11ggaqf1	149	28	commercial	commercial	JJ
cord-014462-11ggaqf1	149	29	kit	kit	NN
cord-014462-11ggaqf1	149	30	,	,	,
cord-014462-11ggaqf1	149	31	which	which	WDT
cord-014462-11ggaqf1	149	32	is	be	VBZ
cord-014462-11ggaqf1	149	33	being	be	VBG
cord-014462-11ggaqf1	149	34	used	use	VBN
cord-014462-11ggaqf1	149	35	by	by	IN
cord-014462-11ggaqf1	149	36	several	several	JJ
cord-014462-11ggaqf1	149	37	vaccine	vaccine	NN
cord-014462-11ggaqf1	149	38	manufacturers	manufacturer	NNS
cord-014462-11ggaqf1	149	39	in	in	IN
cord-014462-11ggaqf1	149	40	India	India	NNP
cord-014462-11ggaqf1	149	41	for	for	IN
cord-014462-11ggaqf1	149	42	the	the	DT
cord-014462-11ggaqf1	149	43	quality	quality	NN
cord-014462-11ggaqf1	149	44	control	control	NN
cord-014462-11ggaqf1	149	45	of	of	IN
cord-014462-11ggaqf1	149	46	vaccine	vaccine	NN
cord-014462-11ggaqf1	149	47	antigen	antigen	NN
cord-014462-11ggaqf1	149	48	.	.	.
cord-014462-11ggaqf1	150	1	The	the	DT
cord-014462-11ggaqf1	150	2	varying	vary	VBG
cord-014462-11ggaqf1	150	3	amounts	amount	NNS
cord-014462-11ggaqf1	150	4	of	of	IN
cord-014462-11ggaqf1	150	5	vaccine	vaccine	NN
cord-014462-11ggaqf1	150	6	antigens	antigen	NNS
cord-014462-11ggaqf1	150	7	that	that	WDT
cord-014462-11ggaqf1	150	8	could	could	MD
cord-014462-11ggaqf1	150	9	be	be	VB
cord-014462-11ggaqf1	150	10	recovered	recover	VBN
cord-014462-11ggaqf1	150	11	seemed	seem	VBD
cord-014462-11ggaqf1	150	12	to	to	TO
cord-014462-11ggaqf1	150	13	depend	depend	VB
cord-014462-11ggaqf1	150	14	on	on	IN
cord-014462-11ggaqf1	150	15	the	the	DT
cord-014462-11ggaqf1	150	16	quality	quality	NN
cord-014462-11ggaqf1	150	17	of	of	IN
cord-014462-11ggaqf1	150	18	the	the	DT
cord-014462-11ggaqf1	150	19	HBsAg	hbsag	XX
cord-014462-11ggaqf1	150	20	and	and	CC
cord-014462-11ggaqf1	150	21	the	the	DT
cord-014462-11ggaqf1	150	22	methods	method	NNS
cord-014462-11ggaqf1	150	23	of	of	IN
cord-014462-11ggaqf1	150	24	HBsAg	HBsAg	NNP
cord-014462-11ggaqf1	150	25	adsorption	adsorption	NN
cord-014462-11ggaqf1	150	26	to	to	IN
cord-014462-11ggaqf1	150	27	the	the	DT
cord-014462-11ggaqf1	150	28	alum	alum	NN
cord-014462-11ggaqf1	150	29	gel	gel	NN
cord-014462-11ggaqf1	150	30	during	during	IN
cord-014462-11ggaqf1	150	31	vaccine	vaccine	NN
cord-014462-11ggaqf1	150	32	manufacture	manufacture	NN
cord-014462-11ggaqf1	150	33	.	.	.
cord-014462-11ggaqf1	151	1	epidemiology	epidemiology	NN
cord-014462-11ggaqf1	151	2	of	of	IN
cord-014462-11ggaqf1	151	3	the	the	DT
cord-014462-11ggaqf1	151	4	spread	spread	NN
cord-014462-11ggaqf1	151	5	of	of	IN
cord-014462-11ggaqf1	151	6	H1N1	H1N1	NNP
cord-014462-11ggaqf1	151	7	virus	virus	NN
cord-014462-11ggaqf1	151	8	.	.	.
cord-014462-11ggaqf1	152	1	Children	child	NNS
cord-014462-11ggaqf1	152	2	of	of	IN
cord-014462-11ggaqf1	152	3	school	school	NN
cord-014462-11ggaqf1	152	4	going	go	VBG
cord-014462-11ggaqf1	152	5	age	age	NN
cord-014462-11ggaqf1	152	6	have	have	VBP
cord-014462-11ggaqf1	152	7	become	become	VBN
cord-014462-11ggaqf1	152	8	victim	victim	NN
cord-014462-11ggaqf1	152	9	of	of	IN
cord-014462-11ggaqf1	152	10	this	this	DT
cord-014462-11ggaqf1	152	11	deadly	deadly	JJ
cord-014462-11ggaqf1	152	12	virus	virus	NN
cord-014462-11ggaqf1	152	13	as	as	IN
cord-014462-11ggaqf1	152	14	evident	evident	JJ
cord-014462-11ggaqf1	152	15	from	from	IN
cord-014462-11ggaqf1	152	16	the	the	DT
cord-014462-11ggaqf1	152	17	reporting	report	VBG
cord-014462-11ggaqf1	152	18	data	datum	NNS
cord-014462-11ggaqf1	152	19	generated	generate	VBN
cord-014462-11ggaqf1	152	20	in	in	IN
cord-014462-11ggaqf1	152	21	the	the	DT
cord-014462-11ggaqf1	152	22	past	past	JJ
cord-014462-11ggaqf1	152	23	few	few	JJ
cord-014462-11ggaqf1	152	24	weeks	week	NNS
cord-014462-11ggaqf1	152	25	.	.	.
cord-014462-11ggaqf1	153	1	The	the	DT
cord-014462-11ggaqf1	153	2	mortality	mortality	NN
cord-014462-11ggaqf1	153	3	rate	rate	NN
cord-014462-11ggaqf1	153	4	has	have	VBZ
cord-014462-11ggaqf1	153	5	also	also	RB
cord-014462-11ggaqf1	153	6	been	be	VBN
cord-014462-11ggaqf1	153	7	slightly	slightly	RB
cord-014462-11ggaqf1	153	8	increased	increase	VBN
cord-014462-11ggaqf1	153	9	.	.	.
cord-014462-11ggaqf1	154	1	The	the	DT
cord-014462-11ggaqf1	154	2	disease	disease	NN
cord-014462-11ggaqf1	154	3	spread	spread	VBD
cord-014462-11ggaqf1	154	4	in	in	IN
cord-014462-11ggaqf1	154	5	wave	wave	NN
cord-014462-11ggaqf1	154	6	pattern	pattern	NN
cord-014462-11ggaqf1	154	7	and	and	CC
cord-014462-11ggaqf1	154	8	presently	presently	RB
cord-014462-11ggaqf1	154	9	the	the	DT
cord-014462-11ggaqf1	154	10	world	world	NN
cord-014462-11ggaqf1	154	11	is	be	VBZ
cord-014462-11ggaqf1	154	12	passing	pass	VBG
cord-014462-11ggaqf1	154	13	through	through	IN
cord-014462-11ggaqf1	154	14	the	the	DT
cord-014462-11ggaqf1	154	15	second	second	JJ
cord-014462-11ggaqf1	154	16	wave	wave	NN
cord-014462-11ggaqf1	154	17	of	of	IN
cord-014462-11ggaqf1	154	18	pandemic	pandemic	NN
cord-014462-11ggaqf1	154	19	with	with	IN
cord-014462-11ggaqf1	154	20	more	more	JJR
cord-014462-11ggaqf1	154	21	severity	severity	NN
cord-014462-11ggaqf1	154	22	in	in	IN
cord-014462-11ggaqf1	154	23	young	young	JJ
cord-014462-11ggaqf1	154	24	and	and	CC
cord-014462-11ggaqf1	154	25	otherwise	otherwise	RB
cord-014462-11ggaqf1	154	26	health	health	NN
cord-014462-11ggaqf1	154	27	people	people	NNS
cord-014462-11ggaqf1	154	28	with	with	IN
cord-014462-11ggaqf1	154	29	a	a	DT
cord-014462-11ggaqf1	154	30	predilection	predilection	NN
cord-014462-11ggaqf1	154	31	for	for	IN
cord-014462-11ggaqf1	154	32	lungs	lung	NNS
cord-014462-11ggaqf1	154	33	leading	lead	VBG
cord-014462-11ggaqf1	154	34	to	to	IN
cord-014462-11ggaqf1	154	35	viral	viral	JJ
cord-014462-11ggaqf1	154	36	pneumonia	pneumonia	NN
cord-014462-11ggaqf1	154	37	and	and	CC
cord-014462-11ggaqf1	154	38	respiratory	respiratory	JJ
cord-014462-11ggaqf1	154	39	failure	failure	NN
cord-014462-11ggaqf1	154	40	.	.	.
cord-014462-11ggaqf1	155	1	Now	now	RB
cord-014462-11ggaqf1	155	2	the	the	DT
cord-014462-11ggaqf1	155	3	pandemic	pandemic	NN
cord-014462-11ggaqf1	155	4	gained	gain	VBD
cord-014462-11ggaqf1	155	5	hold	hold	NN
cord-014462-11ggaqf1	155	6	in	in	IN
cord-014462-11ggaqf1	155	7	the	the	DT
cord-014462-11ggaqf1	155	8	developing	develop	VBG
cord-014462-11ggaqf1	155	9	world	world	NN
cord-014462-11ggaqf1	155	10	affecting	affect	VBG
cord-014462-11ggaqf1	155	11	more	more	RBR
cord-014462-11ggaqf1	155	12	severely	severely	RB
cord-014462-11ggaqf1	155	13	as	as	IN
cord-014462-11ggaqf1	155	14	millions	million	NNS
cord-014462-11ggaqf1	155	15	of	of	IN
cord-014462-11ggaqf1	155	16	people	people	NNS
cord-014462-11ggaqf1	155	17	live	live	VBP
cord-014462-11ggaqf1	155	18	under	under	IN
cord-014462-11ggaqf1	155	19	deprived	deprived	JJ
cord-014462-11ggaqf1	155	20	conditions	condition	NNS
cord-014462-11ggaqf1	155	21	having	have	VBG
cord-014462-11ggaqf1	155	22	multiple	multiple	JJ
cord-014462-11ggaqf1	155	23	health	health	NN
cord-014462-11ggaqf1	155	24	problems	problem	NNS
cord-014462-11ggaqf1	155	25	,	,	,
cord-014462-11ggaqf1	155	26	with	with	IN
cord-014462-11ggaqf1	155	27	little	little	JJ
cord-014462-11ggaqf1	155	28	access	access	NN
cord-014462-11ggaqf1	155	29	to	to	IN
cord-014462-11ggaqf1	155	30	basic	basic	JJ
cord-014462-11ggaqf1	155	31	health	health	NN
cord-014462-11ggaqf1	155	32	care	care	NN
cord-014462-11ggaqf1	155	33	.	.	.
cord-014462-11ggaqf1	156	1	Current	current	JJ
cord-014462-11ggaqf1	156	2	data	datum	NNS
cord-014462-11ggaqf1	156	3	about	about	IN
cord-014462-11ggaqf1	156	4	the	the	DT
cord-014462-11ggaqf1	156	5	pandemic	pandemic	NN
cord-014462-11ggaqf1	156	6	from	from	IN
cord-014462-11ggaqf1	156	7	developed	develop	VBN
cord-014462-11ggaqf1	156	8	counties	county	NNS
cord-014462-11ggaqf1	156	9	need	need	VBP
cord-014462-11ggaqf1	156	10	to	to	TO
cord-014462-11ggaqf1	156	11	be	be	VB
cord-014462-11ggaqf1	156	12	very	very	RB
cord-014462-11ggaqf1	156	13	closely	closely	RB
cord-014462-11ggaqf1	156	14	watched	watch	VBN
cord-014462-11ggaqf1	156	15	in	in	IN
cord-014462-11ggaqf1	156	16	relation	relation	NN
cord-014462-11ggaqf1	156	17	to	to	TO
cord-014462-11ggaqf1	156	18	Shift	shift	VB
cord-014462-11ggaqf1	156	19	in	in	IN
cord-014462-11ggaqf1	156	20	virus	virus	NN
cord-014462-11ggaqf1	156	21	sub	sub	NN
cord-014462-11ggaqf1	156	22	type	type	NN
cord-014462-11ggaqf1	156	23	,	,	,
cord-014462-11ggaqf1	156	24	Shift	Shift	NNP
cord-014462-11ggaqf1	156	25	of	of	IN
cord-014462-11ggaqf1	156	26	the	the	DT
cord-014462-11ggaqf1	156	27	highest	high	JJS
cord-014462-11ggaqf1	156	28	death	death	NN
cord-014462-11ggaqf1	156	29	rate	rate	NN
cord-014462-11ggaqf1	156	30	to	to	IN
cord-014462-11ggaqf1	156	31	younger	young	JJR
cord-014462-11ggaqf1	156	32	populations	population	NNS
cord-014462-11ggaqf1	156	33	,	,	,
cord-014462-11ggaqf1	156	34	Successive	successive	JJ
cord-014462-11ggaqf1	156	35	pandemic	pandemic	NN
cord-014462-11ggaqf1	156	36	waves	wave	NNS
cord-014462-11ggaqf1	156	37	,	,	,
cord-014462-11ggaqf1	156	38	Higher	high	JJR
cord-014462-11ggaqf1	156	39	transmissibility	transmissibility	NN
cord-014462-11ggaqf1	156	40	than	than	IN
cord-014462-11ggaqf1	156	41	seasonal	seasonal	JJ
cord-014462-11ggaqf1	156	42	Influenza	Influenza	NNP
cord-014462-11ggaqf1	156	43	,	,	,
cord-014462-11ggaqf1	156	44	and	and	CC
cord-014462-11ggaqf1	156	45	Demographic	demographic	JJ
cord-014462-11ggaqf1	156	46	differences	difference	NNS
cord-014462-11ggaqf1	156	47	etc	etc	FW
cord-014462-11ggaqf1	156	48	.	.	.
cord-014462-11ggaqf1	157	1	Presently	presently	RB
cord-014462-11ggaqf1	157	2	the	the	DT
cord-014462-11ggaqf1	157	3	world	world	NN
cord-014462-11ggaqf1	157	4	appears	appear	VBZ
cord-014462-11ggaqf1	157	5	to	to	TO
cord-014462-11ggaqf1	157	6	be	be	VB
cord-014462-11ggaqf1	157	7	better	well	RBR
cord-014462-11ggaqf1	157	8	prepared	prepare	VBN
cord-014462-11ggaqf1	157	9	.	.	.
cord-014462-11ggaqf1	158	1	Vaccine	vaccine	NN
cord-014462-11ggaqf1	158	2	is	be	VBZ
cord-014462-11ggaqf1	158	3	available	available	JJ
cord-014462-11ggaqf1	158	4	in	in	IN
cord-014462-11ggaqf1	158	5	market	market	NN
cord-014462-11ggaqf1	158	6	in	in	IN
cord-014462-11ggaqf1	158	7	many	many	JJ
cord-014462-11ggaqf1	158	8	countries	country	NNS
cord-014462-11ggaqf1	158	9	.	.	.
cord-014462-11ggaqf1	159	1	Even	even	RB
cord-014462-11ggaqf1	159	2	vaccine	vaccine	NN
cord-014462-11ggaqf1	159	3	trials	trial	NNS
cord-014462-11ggaqf1	159	4	are	be	VBP
cord-014462-11ggaqf1	159	5	actively	actively	RB
cord-014462-11ggaqf1	159	6	going	go	VBG
cord-014462-11ggaqf1	159	7	on	on	RP
cord-014462-11ggaqf1	159	8	in	in	IN
cord-014462-11ggaqf1	159	9	Indian	indian	JJ
cord-014462-11ggaqf1	159	10	population	population	NN
cord-014462-11ggaqf1	159	11	.	.	.
cord-014462-11ggaqf1	160	1	Effective	effective	JJ
cord-014462-11ggaqf1	160	2	antivirals	antiviral	NNS
cord-014462-11ggaqf1	160	3	are	be	VBP
cord-014462-11ggaqf1	160	4	available	available	JJ
cord-014462-11ggaqf1	160	5	.	.	.
cord-014462-11ggaqf1	161	1	Although	although	IN
cord-014462-11ggaqf1	161	2	till	till	IN
cord-014462-11ggaqf1	161	3	now	now	RB
cord-014462-11ggaqf1	161	4	H1N1	H1N1	NNP
cord-014462-11ggaqf1	161	5	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	161	6	centers	center	NNS
cord-014462-11ggaqf1	161	7	worked	work	VBD
cord-014462-11ggaqf1	161	8	with	with	IN
cord-014462-11ggaqf1	161	9	CDC	CDC	NNP
cord-014462-11ggaqf1	161	10	/	/	SYM
cord-014462-11ggaqf1	161	11	WHO	who	WP
cord-014462-11ggaqf1	161	12	recommended	recommend	VBD
cord-014462-11ggaqf1	161	13	H1N1	H1N1	NNP
cord-014462-11ggaqf1	161	14	specific	specific	JJ
cord-014462-11ggaqf1	161	15	primer	primer	NN
cord-014462-11ggaqf1	161	16	,	,	,
cord-014462-11ggaqf1	161	17	probes	probe	NNS
cord-014462-11ggaqf1	161	18	with	with	IN
cord-014462-11ggaqf1	161	19	Taqman	Taqman	NNP
cord-014462-11ggaqf1	161	20	chemistry	chemistry	NN
cord-014462-11ggaqf1	161	21	by	by	IN
cord-014462-11ggaqf1	161	22	Real	Real	NNP
cord-014462-11ggaqf1	161	23	Time	Time	NNP
cord-014462-11ggaqf1	161	24	PCR	PCR	NNP
cord-014462-11ggaqf1	161	25	,	,	,
cord-014462-11ggaqf1	161	26	efforts	effort	NNS
cord-014462-11ggaqf1	161	27	on	on	IN
cord-014462-11ggaqf1	161	28	the	the	DT
cord-014462-11ggaqf1	161	29	development	development	NN
cord-014462-11ggaqf1	161	30	of	of	IN
cord-014462-11ggaqf1	161	31	indigenous	indigenous	JJ
cord-014462-11ggaqf1	161	32	diagnostics	diagnostic	NNS
cord-014462-11ggaqf1	161	33	,	,	,
cord-014462-11ggaqf1	161	34	Vaccines	vaccine	NNS
cord-014462-11ggaqf1	161	35	and	and	CC
cord-014462-11ggaqf1	161	36	chemoprophylaxis	chemoprophylaxis	NNP
cord-014462-11ggaqf1	161	37	is	be	VBZ
cord-014462-11ggaqf1	161	38	going	go	VBG
cord-014462-11ggaqf1	161	39	on	on	RP
cord-014462-11ggaqf1	161	40	to	to	TO
cord-014462-11ggaqf1	161	41	have	have	VB
cord-014462-11ggaqf1	161	42	a	a	DT
cord-014462-11ggaqf1	161	43	better	well	JJR
cord-014462-11ggaqf1	161	44	combat	combat	NN
cord-014462-11ggaqf1	161	45	against	against	IN
cord-014462-11ggaqf1	161	46	this	this	DT
cord-014462-11ggaqf1	161	47	highly	highly	RB
cord-014462-11ggaqf1	161	48	infectious	infectious	JJ
cord-014462-11ggaqf1	161	49	virus	virus	NN
cord-014462-11ggaqf1	161	50	.	.	.
cord-014462-11ggaqf1	162	1	were	be	VBD
cord-014462-11ggaqf1	162	2	positive	positive	JJ
cord-014462-11ggaqf1	162	3	for	for	IN
cord-014462-11ggaqf1	162	4	rotavirus	rotavirus	JJ
cord-014462-11ggaqf1	162	5	infection	infection	NN
cord-014462-11ggaqf1	162	6	by	by	IN
cord-014462-11ggaqf1	162	7	either	either	CC
cord-014462-11ggaqf1	162	8	PAGE	PAGE	NNP
cord-014462-11ggaqf1	162	9	or	or	CC
cord-014462-11ggaqf1	162	10	ELISA	ELISA	NNP
cord-014462-11ggaqf1	162	11	methods	method	NNS
cord-014462-11ggaqf1	162	12	.	.	.
cord-014462-11ggaqf1	163	1	The	the	DT
cord-014462-11ggaqf1	163	2	available	available	JJ
cord-014462-11ggaqf1	163	3	data	data	NN
cord-014462-11ggaqf1	163	4	highlights	highlight	VBZ
cord-014462-11ggaqf1	163	5	the	the	DT
cord-014462-11ggaqf1	163	6	importance	importance	NN
cord-014462-11ggaqf1	163	7	of	of	IN
cord-014462-11ggaqf1	163	8	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	163	9	as	as	IN
cord-014462-11ggaqf1	163	10	a	a	DT
cord-014462-11ggaqf1	163	11	cause	cause	NN
cord-014462-11ggaqf1	163	12	of	of	IN
cord-014462-11ggaqf1	163	13	diarrhea	diarrhea	NN
cord-014462-11ggaqf1	163	14	in	in	IN
cord-014462-11ggaqf1	163	15	children	child	NNS
cord-014462-11ggaqf1	163	16	,	,	,
cord-014462-11ggaqf1	163	17	which	which	WDT
cord-014462-11ggaqf1	163	18	is	be	VBZ
cord-014462-11ggaqf1	163	19	severe	severe	JJ
cord-014462-11ggaqf1	163	20	enough	enough	RB
cord-014462-11ggaqf1	163	21	to	to	TO
cord-014462-11ggaqf1	163	22	deserve	deserve	VB
cord-014462-11ggaqf1	163	23	specialized	specialized	JJ
cord-014462-11ggaqf1	163	24	care	care	NN
cord-014462-11ggaqf1	163	25	.	.	.
cord-014462-11ggaqf1	164	1	The	the	DT
cord-014462-11ggaqf1	164	2	observed	observed	JJ
cord-014462-11ggaqf1	164	3	proportion	proportion	NN
cord-014462-11ggaqf1	164	4	of	of	IN
cord-014462-11ggaqf1	164	5	25.5	25.5	CD
cord-014462-11ggaqf1	164	6	%	%	NN
cord-014462-11ggaqf1	164	7	of	of	IN
cord-014462-11ggaqf1	164	8	all	all	DT
cord-014462-11ggaqf1	164	9	diarrhea	diarrhea	NN
cord-014462-11ggaqf1	164	10	cases	case	NNS
cord-014462-11ggaqf1	164	11	being	be	VBG
cord-014462-11ggaqf1	164	12	associated	associate	VBN
cord-014462-11ggaqf1	164	13	with	with	IN
cord-014462-11ggaqf1	164	14	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	164	15	falls	fall	VBZ
cord-014462-11ggaqf1	164	16	within	within	IN
cord-014462-11ggaqf1	164	17	the	the	DT
cord-014462-11ggaqf1	164	18	range	range	NN
cord-014462-11ggaqf1	164	19	of	of	IN
cord-014462-11ggaqf1	164	20	values	value	NNS
cord-014462-11ggaqf1	164	21	reported	report	VBN
cord-014462-11ggaqf1	164	22	by	by	IN
cord-014462-11ggaqf1	164	23	other	other	JJ
cord-014462-11ggaqf1	164	24	workers	worker	NNS
cord-014462-11ggaqf1	164	25	.	.	.
cord-014462-11ggaqf1	165	1	The	the	DT
cord-014462-11ggaqf1	165	2	reported	reported	JJ
cord-014462-11ggaqf1	165	3	positivity	positivity	NN
cord-014462-11ggaqf1	165	4	varies	vary	VBZ
cord-014462-11ggaqf1	165	5	from	from	IN
cord-014462-11ggaqf1	165	6	10.5	10.5	CD
cord-014462-11ggaqf1	165	7	to	to	IN
cord-014462-11ggaqf1	165	8	70.7	70.7	CD
cord-014462-11ggaqf1	165	9	%	%	NN
cord-014462-11ggaqf1	165	10	.	.	.
cord-014462-11ggaqf1	166	1	In	in	IN
cord-014462-11ggaqf1	166	2	our	-PRON-	PRP$
cord-014462-11ggaqf1	166	3	study	study	NN
cord-014462-11ggaqf1	166	4	a	a	DT
cord-014462-11ggaqf1	166	5	complete	complete	JJ
cord-014462-11ggaqf1	166	6	concordance	concordance	NN
cord-014462-11ggaqf1	166	7	of	of	IN
cord-014462-11ggaqf1	166	8	ELISA	ELISA	NNP
cord-014462-11ggaqf1	166	9	and	and	CC
cord-014462-11ggaqf1	166	10	PAGE	page	NN
cord-014462-11ggaqf1	166	11	results	result	NNS
cord-014462-11ggaqf1	166	12	were	be	VBD
cord-014462-11ggaqf1	166	13	observed	observe	VBN
cord-014462-11ggaqf1	166	14	in	in	IN
cord-014462-11ggaqf1	166	15	194	194	CD
cord-014462-11ggaqf1	166	16	(	(	-LRB-
cord-014462-11ggaqf1	166	17	97	97	CD
cord-014462-11ggaqf1	166	18	%	%	NN
cord-014462-11ggaqf1	166	19	)	)	-RRB-
cord-014462-11ggaqf1	166	20	of	of	IN
cord-014462-11ggaqf1	166	21	the	the	DT
cord-014462-11ggaqf1	166	22	200	200	CD
cord-014462-11ggaqf1	166	23	tested	test	VBN
cord-014462-11ggaqf1	166	24	specimens	specimen	NNS
cord-014462-11ggaqf1	166	25	.	.	.
cord-014462-11ggaqf1	167	1	This	this	DT
cord-014462-11ggaqf1	167	2	finding	finding	NN
cord-014462-11ggaqf1	167	3	closely	closely	RB
cord-014462-11ggaqf1	167	4	correlates	correlate	VBZ
cord-014462-11ggaqf1	167	5	with	with	IN
cord-014462-11ggaqf1	167	6	the	the	DT
cord-014462-11ggaqf1	167	7	findings	finding	NNS
cord-014462-11ggaqf1	167	8	of	of	IN
cord-014462-11ggaqf1	167	9	other	other	JJ
cord-014462-11ggaqf1	167	10	authors	author	NNS
cord-014462-11ggaqf1	167	11	who	who	WP
cord-014462-11ggaqf1	167	12	found	find	VBD
cord-014462-11ggaqf1	167	13	a	a	DT
cord-014462-11ggaqf1	167	14	96.7	96.7	CD
cord-014462-11ggaqf1	167	15	-	-	HYPH
cord-014462-11ggaqf1	167	16	97.14	97.14	CD
cord-014462-11ggaqf1	167	17	%	%	NN
cord-014462-11ggaqf1	167	18	concordance	concordance	NN
cord-014462-11ggaqf1	167	19	results	result	NNS
cord-014462-11ggaqf1	167	20	between	between	IN
cord-014462-11ggaqf1	167	21	ELISA	ELISA	NNP
cord-014462-11ggaqf1	167	22	and	and	CC
cord-014462-11ggaqf1	167	23	PAGE	page	NN
cord-014462-11ggaqf1	167	24	methods	method	NNS
cord-014462-11ggaqf1	167	25	.	.	.
cord-014462-11ggaqf1	168	1	Some	some	DT
cord-014462-11ggaqf1	168	2	authors	author	NNS
cord-014462-11ggaqf1	168	3	found	find	VBD
cord-014462-11ggaqf1	168	4	RNA	RNA	NNP
cord-014462-11ggaqf1	168	5	-	-	HYPH
cord-014462-11ggaqf1	168	6	PAGE	page	NN
cord-014462-11ggaqf1	168	7	method	method	NN
cord-014462-11ggaqf1	168	8	that	that	WDT
cord-014462-11ggaqf1	168	9	is	be	VBZ
cord-014462-11ggaqf1	168	10	as	as	RB
cord-014462-11ggaqf1	168	11	sensitive	sensitive	JJ
cord-014462-11ggaqf1	168	12	and	and	CC
cord-014462-11ggaqf1	168	13	rapid	rapid	JJ
cord-014462-11ggaqf1	168	14	as	as	IN
cord-014462-11ggaqf1	168	15	ELISA	ELISA	NNP
cord-014462-11ggaqf1	168	16	for	for	IN
cord-014462-11ggaqf1	168	17	detecting	detect	VBG
cord-014462-11ggaqf1	168	18	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	168	19	In	in	IN
cord-014462-11ggaqf1	168	20	stool	stool	NN
cord-014462-11ggaqf1	168	21	samples	sample	NNS
cord-014462-11ggaqf1	168	22	of	of	IN
cord-014462-11ggaqf1	168	23	cases	case	NNS
cord-014462-11ggaqf1	168	24	of	of	IN
cord-014462-11ggaqf1	168	25	diarrhea	diarrhea	NN
cord-014462-11ggaqf1	168	26	and	and	CC
cord-014462-11ggaqf1	168	27	some	some	DT
cord-014462-11ggaqf1	168	28	others	other	NNS
cord-014462-11ggaqf1	169	1	proposed	propose	VBN
cord-014462-11ggaqf1	169	2	ELISA	ELISA	NNP
cord-014462-11ggaqf1	169	3	is	be	VBZ
cord-014462-11ggaqf1	169	4	more	more	RBR
cord-014462-11ggaqf1	169	5	sensitive	sensitive	JJ
cord-014462-11ggaqf1	169	6	than	than	IN
cord-014462-11ggaqf1	169	7	PAGE	page	NN
cord-014462-11ggaqf1	169	8	method	method	NN
cord-014462-11ggaqf1	169	9	fond	fond	JJ
cord-014462-11ggaqf1	169	10	to	to	TO
cord-014462-11ggaqf1	169	11	be	be	VB
cord-014462-11ggaqf1	169	12	100	100	CD
cord-014462-11ggaqf1	169	13	%	%	NN
cord-014462-11ggaqf1	169	14	specific	specific	JJ
cord-014462-11ggaqf1	169	15	.	.	.
cord-014462-11ggaqf1	170	1	The	the	DT
cord-014462-11ggaqf1	170	2	remaining	remain	VBG
cord-014462-11ggaqf1	170	3	6	6	CD
cord-014462-11ggaqf1	170	4	(	(	-LRB-
cord-014462-11ggaqf1	170	5	3	3	CD
cord-014462-11ggaqf1	170	6	%	%	NN
cord-014462-11ggaqf1	170	7	)	)	-RRB-
cord-014462-11ggaqf1	170	8	samples	sample	NNS
cord-014462-11ggaqf1	170	9	showed	show	VBD
cord-014462-11ggaqf1	170	10	conflicting	conflict	VBG
cord-014462-11ggaqf1	170	11	results	result	NNS
cord-014462-11ggaqf1	170	12	.	.	.
cord-014462-11ggaqf1	171	1	In	in	IN
cord-014462-11ggaqf1	171	2	a	a	DT
cord-014462-11ggaqf1	171	3	lone	lone	JJ
cord-014462-11ggaqf1	171	4	sample	sample	NN
cord-014462-11ggaqf1	171	5	in	in	IN
cord-014462-11ggaqf1	171	6	which	which	WDT
cord-014462-11ggaqf1	171	7	the	the	DT
cord-014462-11ggaqf1	171	8	OD	OD	NNP
cord-014462-11ggaqf1	171	9	value	value	NN
cord-014462-11ggaqf1	171	10	of	of	IN
cord-014462-11ggaqf1	171	11	ELISA	ELISA	NNP
cord-014462-11ggaqf1	171	12	test	test	NN
cord-014462-11ggaqf1	171	13	was	be	VBD
cord-014462-11ggaqf1	171	14	0.195	0.195	CD
cord-014462-11ggaqf1	171	15	,	,	,
cord-014462-11ggaqf1	171	16	this	this	DT
cord-014462-11ggaqf1	171	17	value	value	NN
cord-014462-11ggaqf1	171	18	was	be	VBD
cord-014462-11ggaqf1	171	19	almost	almost	RB
cord-014462-11ggaqf1	171	20	at	at	IN
cord-014462-11ggaqf1	171	21	the	the	DT
cord-014462-11ggaqf1	171	22	cutoff	cutoff	NN
cord-014462-11ggaqf1	171	23	level	level	NN
cord-014462-11ggaqf1	171	24	,	,	,
cord-014462-11ggaqf1	171	25	the	the	DT
cord-014462-11ggaqf1	171	26	possibility	possibility	NN
cord-014462-11ggaqf1	171	27	of	of	IN
cord-014462-11ggaqf1	171	28	this	this	DT
cord-014462-11ggaqf1	171	29	sample	sample	NN
cord-014462-11ggaqf1	171	30	being	be	VBG
cord-014462-11ggaqf1	171	31	positive	positive	JJ
cord-014462-11ggaqf1	171	32	by	by	IN
cord-014462-11ggaqf1	171	33	ELISA	ELISA	NNP
cord-014462-11ggaqf1	171	34	test	test	NN
cord-014462-11ggaqf1	171	35	is	be	VBZ
cord-014462-11ggaqf1	171	36	doubtful	doubtful	JJ
cord-014462-11ggaqf1	171	37	.	.	.
cord-014462-11ggaqf1	172	1	Negative	negative	JJ
cord-014462-11ggaqf1	172	2	result	result	NN
cord-014462-11ggaqf1	172	3	of	of	IN
cord-014462-11ggaqf1	172	4	the	the	DT
cord-014462-11ggaqf1	172	5	same	same	JJ
cord-014462-11ggaqf1	172	6	sample	sample	NN
cord-014462-11ggaqf1	172	7	in	in	IN
cord-014462-11ggaqf1	172	8	PAGE	page	NN
cord-014462-11ggaqf1	172	9	method	method	NN
cord-014462-11ggaqf1	172	10	is	be	VBZ
cord-014462-11ggaqf1	172	11	difficult	difficult	JJ
cord-014462-11ggaqf1	172	12	to	to	TO
cord-014462-11ggaqf1	172	13	explain	explain	VB
cord-014462-11ggaqf1	172	14	,	,	,
cord-014462-11ggaqf1	172	15	the	the	DT
cord-014462-11ggaqf1	172	16	possibility	possibility	NN
cord-014462-11ggaqf1	172	17	of	of	IN
cord-014462-11ggaqf1	172	18	presence	presence	NN
cord-014462-11ggaqf1	172	19	of	of	IN
cord-014462-11ggaqf1	172	20	lot	lot	NN
cord-014462-11ggaqf1	172	21	of	of	IN
cord-014462-11ggaqf1	172	22	empty	empty	JJ
cord-014462-11ggaqf1	172	23	virus	virus	NN
cord-014462-11ggaqf1	172	24	particles	particle	NNS
cord-014462-11ggaqf1	172	25	or	or	CC
cord-014462-11ggaqf1	172	26	due	due	JJ
cord-014462-11ggaqf1	172	27	to	to	IN
cord-014462-11ggaqf1	172	28	low	low	JJ
cord-014462-11ggaqf1	172	29	concentration	concentration	NN
cord-014462-11ggaqf1	172	30	of	of	IN
cord-014462-11ggaqf1	172	31	viral	viral	JJ
cord-014462-11ggaqf1	172	32	RNA	RNA	NNP
cord-014462-11ggaqf1	172	33	in	in	IN
cord-014462-11ggaqf1	172	34	the	the	DT
cord-014462-11ggaqf1	172	35	fecal	fecal	JJ
cord-014462-11ggaqf1	172	36	specimen	specimen	NN
cord-014462-11ggaqf1	172	37	and	and	CC
cord-014462-11ggaqf1	172	38	insufficient	insufficient	JJ
cord-014462-11ggaqf1	172	39	extraction	extraction	NN
cord-014462-11ggaqf1	172	40	of	of	IN
cord-014462-11ggaqf1	172	41	viral	viral	JJ
cord-014462-11ggaqf1	172	42	RNA	RNA	NNP
cord-014462-11ggaqf1	172	43	could	could	MD
cord-014462-11ggaqf1	172	44	be	be	VB
cord-014462-11ggaqf1	172	45	possible	possible	JJ
cord-014462-11ggaqf1	172	46	.	.	.
cord-014462-11ggaqf1	173	1	On	on	IN
cord-014462-11ggaqf1	173	2	the	the	DT
cord-014462-11ggaqf1	173	3	other	other	JJ
cord-014462-11ggaqf1	173	4	hand	hand	NN
cord-014462-11ggaqf1	173	5	,	,	,
cord-014462-11ggaqf1	173	6	5	5	CD
cord-014462-11ggaqf1	173	7	of	of	IN
cord-014462-11ggaqf1	173	8	the	the	DT
cord-014462-11ggaqf1	173	9	samples	sample	NNS
cord-014462-11ggaqf1	173	10	which	which	WDT
cord-014462-11ggaqf1	173	11	gave	give	VBD
cord-014462-11ggaqf1	173	12	positive	positive	JJ
cord-014462-11ggaqf1	173	13	results	result	NNS
cord-014462-11ggaqf1	173	14	by	by	IN
cord-014462-11ggaqf1	173	15	PAGE	page	NN
cord-014462-11ggaqf1	173	16	method	method	NN
cord-014462-11ggaqf1	173	17	were	be	VBD
cord-014462-11ggaqf1	173	18	negative	negative	JJ
cord-014462-11ggaqf1	173	19	by	by	IN
cord-014462-11ggaqf1	173	20	ELISA	ELISA	NNP
cord-014462-11ggaqf1	173	21	test	test	NN
cord-014462-11ggaqf1	173	22	.	.	.
cord-014462-11ggaqf1	174	1	These	these	DT
cord-014462-11ggaqf1	174	2	5	5	CD
cord-014462-11ggaqf1	174	3	samples	sample	NNS
cord-014462-11ggaqf1	174	4	had	have	VBD
cord-014462-11ggaqf1	174	5	a	a	DT
cord-014462-11ggaqf1	174	6	typical	typical	JJ
cord-014462-11ggaqf1	174	7	4	4	CD
cord-014462-11ggaqf1	174	8	-	-	SYM
cord-014462-11ggaqf1	174	9	2	2	CD
cord-014462-11ggaqf1	174	10	-	-	HYPH
cord-014462-11ggaqf1	174	11	3	3	CD
cord-014462-11ggaqf1	174	12	-	-	SYM
cord-014462-11ggaqf1	174	13	2	2	CD
cord-014462-11ggaqf1	174	14	RNA	RNA	NNP
cord-014462-11ggaqf1	174	15	pattern	pattern	NN
cord-014462-11ggaqf1	174	16	.	.	.
cord-014462-11ggaqf1	175	1	The	the	DT
cord-014462-11ggaqf1	175	2	reason	reason	NN
cord-014462-11ggaqf1	175	3	for	for	IN
cord-014462-11ggaqf1	175	4	their	-PRON-	PRP$
cord-014462-11ggaqf1	175	5	being	be	VBG
cord-014462-11ggaqf1	175	6	ELISA	ELISA	NNP
cord-014462-11ggaqf1	175	7	negative	negative	JJ
cord-014462-11ggaqf1	175	8	thus	thus	RB
cord-014462-11ggaqf1	175	9	remains	remain	VBZ
cord-014462-11ggaqf1	175	10	unexplained	unexplained	JJ
cord-014462-11ggaqf1	175	11	,	,	,
cord-014462-11ggaqf1	175	12	however	however	RB
cord-014462-11ggaqf1	175	13	blocking	block	VBG
cord-014462-11ggaqf1	175	14	factors	factor	NNS
cord-014462-11ggaqf1	175	15	or	or	CC
cord-014462-11ggaqf1	175	16	the	the	DT
cord-014462-11ggaqf1	175	17	presence	presence	NN
cord-014462-11ggaqf1	175	18	of	of	IN
cord-014462-11ggaqf1	175	19	inhibitory	inhibitory	JJ
cord-014462-11ggaqf1	175	20	substance	substance	NN
cord-014462-11ggaqf1	175	21	in	in	IN
cord-014462-11ggaqf1	175	22	stools	stool	NNS
cord-014462-11ggaqf1	175	23	might	may	MD
cord-014462-11ggaqf1	175	24	have	have	VB
cord-014462-11ggaqf1	175	25	been	be	VBN
cord-014462-11ggaqf1	175	26	responsible	responsible	JJ
cord-014462-11ggaqf1	175	27	.	.	.
cord-014462-11ggaqf1	176	1	The	the	DT
cord-014462-11ggaqf1	176	2	samples	sample	NNS
cord-014462-11ggaqf1	176	3	containing	contain	VBG
cord-014462-11ggaqf1	176	4	predominantly	predominantly	RB
cord-014462-11ggaqf1	176	5	complete	complete	JJ
cord-014462-11ggaqf1	176	6	particles	particle	NNS
cord-014462-11ggaqf1	176	7	can	can	MD
cord-014462-11ggaqf1	176	8	also	also	RB
cord-014462-11ggaqf1	176	9	give	give	VB
cord-014462-11ggaqf1	176	10	false	false	JJ
cord-014462-11ggaqf1	176	11	negative	negative	JJ
cord-014462-11ggaqf1	176	12	results	result	NNS
cord-014462-11ggaqf1	176	13	.	.	.
cord-014462-11ggaqf1	177	1	Since	since	IN
cord-014462-11ggaqf1	177	2	,	,	,
cord-014462-11ggaqf1	177	3	the	the	DT
cord-014462-11ggaqf1	177	4	group	group	NN
cord-014462-11ggaqf1	177	5	antigen	antigen	NN
cord-014462-11ggaqf1	177	6	is	be	VBZ
cord-014462-11ggaqf1	177	7	not	not	RB
cord-014462-11ggaqf1	177	8	exposed	expose	VBN
cord-014462-11ggaqf1	177	9	.	.	.
cord-014462-11ggaqf1	178	1	Earlier	early	JJR
cord-014462-11ggaqf1	178	2	studies	study	NNS
cord-014462-11ggaqf1	178	3	have	have	VBP
cord-014462-11ggaqf1	178	4	also	also	RB
cord-014462-11ggaqf1	178	5	reported	report	VBN
cord-014462-11ggaqf1	178	6	PAGE	page	NN
cord-014462-11ggaqf1	178	7	to	to	TO
cord-014462-11ggaqf1	178	8	be	be	VB
cord-014462-11ggaqf1	178	9	the	the	DT
cord-014462-11ggaqf1	178	10	most	most	RBS
cord-014462-11ggaqf1	178	11	sensitive	sensitive	JJ
cord-014462-11ggaqf1	178	12	technique	technique	NN
cord-014462-11ggaqf1	178	13	although	although	IN
cord-014462-11ggaqf1	178	14	some	some	DT
cord-014462-11ggaqf1	178	15	are	be	VBP
cord-014462-11ggaqf1	178	16	of	of	IN
cord-014462-11ggaqf1	178	17	view	view	NN
cord-014462-11ggaqf1	178	18	that	that	IN
cord-014462-11ggaqf1	178	19	it	-PRON-	PRP
cord-014462-11ggaqf1	178	20	is	be	VBZ
cord-014462-11ggaqf1	178	21	laborious	laborious	JJ
cord-014462-11ggaqf1	178	22	procedure	procedure	NN
cord-014462-11ggaqf1	178	23	.	.	.
cord-014462-11ggaqf1	179	1	How	how	WRB
cord-014462-11ggaqf1	179	2	ever	ever	RB
cord-014462-11ggaqf1	179	3	,	,	,
cord-014462-11ggaqf1	179	4	the	the	DT
cord-014462-11ggaqf1	179	5	PAGE	page	NN
cord-014462-11ggaqf1	179	6	system	system	NN
cord-014462-11ggaqf1	179	7	used	use	VBN
cord-014462-11ggaqf1	179	8	in	in	IN
cord-014462-11ggaqf1	179	9	this	this	DT
cord-014462-11ggaqf1	179	10	study	study	NN
cord-014462-11ggaqf1	179	11	was	be	VBD
cord-014462-11ggaqf1	179	12	very	very	RB
cord-014462-11ggaqf1	179	13	simple	simple	JJ
cord-014462-11ggaqf1	179	14	to	to	TO
cord-014462-11ggaqf1	179	15	perform	perform	VB
cord-014462-11ggaqf1	179	16	and	and	CC
cord-014462-11ggaqf1	179	17	the	the	DT
cord-014462-11ggaqf1	179	18	results	result	NNS
cord-014462-11ggaqf1	179	19	were	be	VBD
cord-014462-11ggaqf1	179	20	available	available	JJ
cord-014462-11ggaqf1	179	21	on	on	IN
cord-014462-11ggaqf1	179	22	the	the	DT
cord-014462-11ggaqf1	179	23	same	same	JJ
cord-014462-11ggaqf1	179	24	day	day	NN
cord-014462-11ggaqf1	179	25	.	.	.
cord-014462-11ggaqf1	180	1	The	the	DT
cord-014462-11ggaqf1	180	2	main	main	JJ
cord-014462-11ggaqf1	180	3	requirement	requirement	NN
cord-014462-11ggaqf1	180	4	was	be	VBD
cord-014462-11ggaqf1	180	5	of	of	IN
cord-014462-11ggaqf1	180	6	trained	train	VBN
cord-014462-11ggaqf1	180	7	personnel	personnel	NNS
cord-014462-11ggaqf1	180	8	and	and	CC
cord-014462-11ggaqf1	180	9	proper	proper	JJ
cord-014462-11ggaqf1	180	10	standardization	standardization	NN
cord-014462-11ggaqf1	180	11	of	of	IN
cord-014462-11ggaqf1	180	12	the	the	DT
cord-014462-11ggaqf1	180	13	technique	technique	NN
cord-014462-11ggaqf1	180	14	.	.	.
cord-014462-11ggaqf1	181	1	Most	Most	JJS
cord-014462-11ggaqf1	181	2	reports	report	VBZ
cord-014462-11ggaqf1	181	3	states	state	VBZ
cord-014462-11ggaqf1	181	4	that	that	IN
cord-014462-11ggaqf1	181	5	the	the	DT
cord-014462-11ggaqf1	181	6	greatest	great	JJS
cord-014462-11ggaqf1	181	7	advantage	advantage	NN
cord-014462-11ggaqf1	181	8	of	of	IN
cord-014462-11ggaqf1	181	9	PAGE	page	NN
cord-014462-11ggaqf1	181	10	and	and	CC
cord-014462-11ggaqf1	181	11	silver	silver	NN
cord-014462-11ggaqf1	181	12	stain	stain	NN
cord-014462-11ggaqf1	181	13	method	method	NN
cord-014462-11ggaqf1	181	14	are	be	VBP
cord-014462-11ggaqf1	181	15	its	-PRON-	PRP$
cord-014462-11ggaqf1	181	16	lack	lack	NN
cord-014462-11ggaqf1	181	17	of	of	IN
cord-014462-11ggaqf1	181	18	ambiguity	ambiguity	NN
cord-014462-11ggaqf1	181	19	and	and	CC
cord-014462-11ggaqf1	181	20	the	the	DT
cord-014462-11ggaqf1	181	21	fact	fact	NN
cord-014462-11ggaqf1	181	22	that	that	IN
cord-014462-11ggaqf1	181	23	it	-PRON-	PRP
cord-014462-11ggaqf1	181	24	provides	provide	VBZ
cord-014462-11ggaqf1	181	25	information	information	NN
cord-014462-11ggaqf1	181	26	about	about	IN
cord-014462-11ggaqf1	181	27	viral	viral	JJ
cord-014462-11ggaqf1	181	28	electropherotypes	electropherotype	NNS
cord-014462-11ggaqf1	181	29	.	.	.
cord-014462-11ggaqf1	182	1	The	the	DT
cord-014462-11ggaqf1	182	2	modified	modify	VBN
cord-014462-11ggaqf1	182	3	PAGE	page	NN
cord-014462-11ggaqf1	182	4	system	system	NN
cord-014462-11ggaqf1	182	5	was	be	VBD
cord-014462-11ggaqf1	182	6	thus	thus	RB
cord-014462-11ggaqf1	182	7	found	find	VBN
cord-014462-11ggaqf1	182	8	to	to	TO
cord-014462-11ggaqf1	182	9	be	be	VB
cord-014462-11ggaqf1	182	10	reliable	reliable	JJ
cord-014462-11ggaqf1	182	11	,	,	,
cord-014462-11ggaqf1	182	12	simple	simple	JJ
cord-014462-11ggaqf1	182	13	and	and	CC
cord-014462-11ggaqf1	182	14	rapid	rapid	JJ
cord-014462-11ggaqf1	182	15	,	,	,
cord-014462-11ggaqf1	182	16	no	no	DT
cord-014462-11ggaqf1	182	17	expensive	expensive	JJ
cord-014462-11ggaqf1	182	18	reagents	reagent	NNS
cord-014462-11ggaqf1	182	19	were	be	VBD
cord-014462-11ggaqf1	182	20	required	require	VBN
cord-014462-11ggaqf1	182	21	.	.	.
cord-014462-11ggaqf1	183	1	Locally	locally	RB
cord-014462-11ggaqf1	183	2	available	available	JJ
cord-014462-11ggaqf1	183	3	reagents	reagent	NNS
cord-014462-11ggaqf1	183	4	from	from	IN
cord-014462-11ggaqf1	183	5	HI	HI	NNP
cord-014462-11ggaqf1	183	6	media	medium	NNS
cord-014462-11ggaqf1	183	7	were	be	VBD
cord-014462-11ggaqf1	183	8	used	use	VBN
cord-014462-11ggaqf1	183	9	.	.	.
cord-014462-11ggaqf1	184	1	The	the	DT
cord-014462-11ggaqf1	184	2	cost	cost	NN
cord-014462-11ggaqf1	184	3	of	of	IN
cord-014462-11ggaqf1	184	4	the	the	DT
cord-014462-11ggaqf1	184	5	chemical	chemical	NN
cord-014462-11ggaqf1	184	6	for	for	IN
cord-014462-11ggaqf1	184	7	PAGE	page	NN
cord-014462-11ggaqf1	184	8	per	per	IN
cord-014462-11ggaqf1	184	9	specimen	specimen	NN
cord-014462-11ggaqf1	184	10	was	be	VBD
cord-014462-11ggaqf1	184	11	Rs	r	NNS
cord-014462-11ggaqf1	184	12	.	.	.
cord-014462-11ggaqf1	185	1	24	24	CD
cord-014462-11ggaqf1	185	2	approximately	approximately	RB
cord-014462-11ggaqf1	185	3	as	as	IN
cord-014462-11ggaqf1	185	4	compared	compare	VBN
cord-014462-11ggaqf1	185	5	to	to	IN
cord-014462-11ggaqf1	185	6	Rs	r	NNS
cord-014462-11ggaqf1	185	7	.	.	.
cord-014462-11ggaqf1	186	1	110	110	CD
cord-014462-11ggaqf1	186	2	per	per	IN
cord-014462-11ggaqf1	186	3	test	test	NN
cord-014462-11ggaqf1	186	4	by	by	IN
cord-014462-11ggaqf1	186	5	confirmatory	confirmatory	JJ
cord-014462-11ggaqf1	186	6	ELISA	ELISA	NNP
cord-014462-11ggaqf1	186	7	.	.	.
cord-014462-11ggaqf1	187	1	A	a	DT
cord-014462-11ggaqf1	187	2	locally	locally	RB
cord-014462-11ggaqf1	187	3	produced	produce	VBN
cord-014462-11ggaqf1	187	4	slab	slab	NN
cord-014462-11ggaqf1	187	5	gel	gel	NN
cord-014462-11ggaqf1	187	6	electrophoresis	electrophoresis	NN
cord-014462-11ggaqf1	187	7	system	system	NN
cord-014462-11ggaqf1	187	8	with	with	IN
cord-014462-11ggaqf1	187	9	power	power	NN
cord-014462-11ggaqf1	187	10	pack	pack	NN
cord-014462-11ggaqf1	187	11	was	be	VBD
cord-014462-11ggaqf1	187	12	the	the	DT
cord-014462-11ggaqf1	187	13	only	only	JJ
cord-014462-11ggaqf1	187	14	equipment	equipment	NN
cord-014462-11ggaqf1	187	15	required	require	VBN
cord-014462-11ggaqf1	187	16	.	.	.
cord-014462-11ggaqf1	188	1	This	this	DT
cord-014462-11ggaqf1	188	2	method	method	NN
cord-014462-11ggaqf1	188	3	could	could	MD
cord-014462-11ggaqf1	188	4	be	be	VB
cord-014462-11ggaqf1	188	5	used	use	VBN
cord-014462-11ggaqf1	188	6	for	for	IN
cord-014462-11ggaqf1	188	7	the	the	DT
cord-014462-11ggaqf1	188	8	routine	routine	JJ
cord-014462-11ggaqf1	188	9	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	188	10	of	of	IN
cord-014462-11ggaqf1	188	11	rotavirus	rotavirus	JJ
cord-014462-11ggaqf1	188	12	infection	infection	NN
cord-014462-11ggaqf1	188	13	in	in	IN
cord-014462-11ggaqf1	188	14	the	the	DT
cord-014462-11ggaqf1	188	15	laboratory	laboratory	NN
cord-014462-11ggaqf1	188	16	.	.	.
cord-014462-11ggaqf1	189	1	vaccine	vaccine	NN
cord-014462-11ggaqf1	189	2	,	,	,
cord-014462-11ggaqf1	189	3	rapid	rapid	JJ
cord-014462-11ggaqf1	189	4	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	189	5	plays	play	VBZ
cord-014462-11ggaqf1	189	6	an	an	DT
cord-014462-11ggaqf1	189	7	important	important	JJ
cord-014462-11ggaqf1	189	8	role	role	NN
cord-014462-11ggaqf1	189	9	in	in	IN
cord-014462-11ggaqf1	189	10	early	early	JJ
cord-014462-11ggaqf1	189	11	management	management	NN
cord-014462-11ggaqf1	189	12	of	of	IN
cord-014462-11ggaqf1	189	13	patients	patient	NNS
cord-014462-11ggaqf1	189	14	.	.	.
cord-014462-11ggaqf1	190	1	In	in	IN
cord-014462-11ggaqf1	190	2	this	this	DT
cord-014462-11ggaqf1	190	3	study	study	NN
cord-014462-11ggaqf1	190	4	a	a	DT
cord-014462-11ggaqf1	190	5	QC	QC	NNP
cord-014462-11ggaqf1	190	6	-	-	HYPH
cord-014462-11ggaqf1	190	7	RT	RT	NNP
cord-014462-11ggaqf1	190	8	-	-	HYPH
cord-014462-11ggaqf1	190	9	PCR	PCR	NNP
cord-014462-11ggaqf1	190	10	assay	assay	NN
cord-014462-11ggaqf1	190	11	was	be	VBD
cord-014462-11ggaqf1	190	12	developed	develop	VBN
cord-014462-11ggaqf1	190	13	to	to	TO
cord-014462-11ggaqf1	190	14	quantify	quantify	VB
cord-014462-11ggaqf1	190	15	Chikungunya	Chikungunya	NNP
cord-014462-11ggaqf1	190	16	virus	virus	NN
cord-014462-11ggaqf1	190	17	RNA	RNA	NNP
cord-014462-11ggaqf1	190	18	by	by	IN
cord-014462-11ggaqf1	190	19	targeting	target	VBG
cord-014462-11ggaqf1	190	20	the	the	DT
cord-014462-11ggaqf1	190	21	conserved	conserve	VBN
cord-014462-11ggaqf1	190	22	region	region	NN
cord-014462-11ggaqf1	190	23	of	of	IN
cord-014462-11ggaqf1	190	24	E1	E1	NNP
cord-014462-11ggaqf1	190	25	gene	gene	NN
cord-014462-11ggaqf1	190	26	.	.	.
cord-014462-11ggaqf1	191	1	A	a	DT
cord-014462-11ggaqf1	191	2	competitor	competitor	NN
cord-014462-11ggaqf1	191	3	molecule	molecule	NN
cord-014462-11ggaqf1	191	4	containing	contain	VBG
cord-014462-11ggaqf1	191	5	an	an	DT
cord-014462-11ggaqf1	191	6	internal	internal	JJ
cord-014462-11ggaqf1	191	7	insertion	insertion	NN
cord-014462-11ggaqf1	191	8	was	be	VBD
cord-014462-11ggaqf1	191	9	generated	generate	VBN
cord-014462-11ggaqf1	191	10	,	,	,
cord-014462-11ggaqf1	191	11	that	that	WDT
cord-014462-11ggaqf1	191	12	provided	provide	VBD
cord-014462-11ggaqf1	191	13	a	a	DT
cord-014462-11ggaqf1	191	14	stringent	stringent	JJ
cord-014462-11ggaqf1	191	15	control	control	NN
cord-014462-11ggaqf1	191	16	of	of	IN
cord-014462-11ggaqf1	191	17	the	the	DT
cord-014462-11ggaqf1	191	18	quantification	quantification	NN
cord-014462-11ggaqf1	191	19	process	process	NN
cord-014462-11ggaqf1	191	20	.	.	.
cord-014462-11ggaqf1	192	1	The	the	DT
cord-014462-11ggaqf1	192	2	introduction	introduction	NN
cord-014462-11ggaqf1	192	3	of	of	IN
cord-014462-11ggaqf1	192	4	10-fold	10-fold	CD
cord-014462-11ggaqf1	192	5	serially	serially	RB
cord-014462-11ggaqf1	192	6	diluted	dilute	VBN
cord-014462-11ggaqf1	192	7	competitor	competitor	NN
cord-014462-11ggaqf1	192	8	in	in	IN
cord-014462-11ggaqf1	192	9	each	each	DT
cord-014462-11ggaqf1	192	10	reaction	reaction	NN
cord-014462-11ggaqf1	192	11	was	be	VBD
cord-014462-11ggaqf1	192	12	further	further	RB
cord-014462-11ggaqf1	192	13	used	use	VBN
cord-014462-11ggaqf1	192	14	to	to	TO
cord-014462-11ggaqf1	192	15	determine	determine	VB
cord-014462-11ggaqf1	192	16	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	192	17	.	.	.
cord-014462-11ggaqf1	193	1	The	the	DT
cord-014462-11ggaqf1	193	2	applicability	applicability	NN
cord-014462-11ggaqf1	193	3	of	of	IN
cord-014462-11ggaqf1	193	4	this	this	DT
cord-014462-11ggaqf1	193	5	assay	assay	NN
cord-014462-11ggaqf1	193	6	for	for	IN
cord-014462-11ggaqf1	193	7	quantification	quantification	NN
cord-014462-11ggaqf1	193	8	of	of	IN
cord-014462-11ggaqf1	193	9	Chikungunya	Chikungunya	NNP
cord-014462-11ggaqf1	193	10	virus	virus	NN
cord-014462-11ggaqf1	193	11	RNA	RNA	NNP
cord-014462-11ggaqf1	193	12	was	be	VBD
cord-014462-11ggaqf1	193	13	evaluated	evaluate	VBN
cord-014462-11ggaqf1	193	14	with	with	IN
cord-014462-11ggaqf1	193	15	human	human	JJ
cord-014462-11ggaqf1	193	16	clinical	clinical	JJ
cord-014462-11ggaqf1	193	17	samples	sample	NNS
cord-014462-11ggaqf1	193	18	and	and	CC
cord-014462-11ggaqf1	193	19	the	the	DT
cord-014462-11ggaqf1	193	20	results	result	NNS
cord-014462-11ggaqf1	193	21	were	be	VBD
cord-014462-11ggaqf1	193	22	compared	compare	VBN
cord-014462-11ggaqf1	193	23	with	with	IN
cord-014462-11ggaqf1	193	24	Real	real	JJ
cord-014462-11ggaqf1	193	25	-	-	HYPH
cord-014462-11ggaqf1	193	26	time	time	NN
cord-014462-11ggaqf1	193	27	quantitative	quantitative	JJ
cord-014462-11ggaqf1	193	28	RT	RT	NNP
cord-014462-11ggaqf1	193	29	-	-	HYPH
cord-014462-11ggaqf1	193	30	PCR	PCR	NNP
cord-014462-11ggaqf1	193	31	.	.	.
cord-014462-11ggaqf1	194	1	The	the	DT
cord-014462-11ggaqf1	194	2	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	194	3	of	of	IN
cord-014462-11ggaqf1	194	4	this	this	DT
cord-014462-11ggaqf1	194	5	assay	assay	NN
cord-014462-11ggaqf1	194	6	was	be	VBD
cord-014462-11ggaqf1	194	7	estimated	estimate	VBN
cord-014462-11ggaqf1	194	8	to	to	TO
cord-014462-11ggaqf1	194	9	be	be	VB
cord-014462-11ggaqf1	194	10	100	100	CD
cord-014462-11ggaqf1	194	11	RNA	RNA	NNP
cord-014462-11ggaqf1	194	12	copies	copy	NNS
cord-014462-11ggaqf1	194	13	per	per	IN
cord-014462-11ggaqf1	194	14	reaction	reaction	NN
cord-014462-11ggaqf1	194	15	with	with	IN
cord-014462-11ggaqf1	194	16	a	a	DT
cord-014462-11ggaqf1	194	17	dynamic	dynamic	JJ
cord-014462-11ggaqf1	194	18	detection	detection	NN
cord-014462-11ggaqf1	194	19	range	range	NN
cord-014462-11ggaqf1	194	20	of	of	IN
cord-014462-11ggaqf1	194	21	10	10	CD
cord-014462-11ggaqf1	194	22	2	2	CD
cord-014462-11ggaqf1	194	23	to	to	TO
cord-014462-11ggaqf1	194	24	10	10	CD
cord-014462-11ggaqf1	194	25	10	10	CD
cord-014462-11ggaqf1	194	26	copies	copy	NNS
cord-014462-11ggaqf1	194	27	.	.	.
cord-014462-11ggaqf1	195	1	Specificity	specificity	NN
cord-014462-11ggaqf1	195	2	was	be	VBD
cord-014462-11ggaqf1	195	3	confirmed	confirm	VBN
cord-014462-11ggaqf1	195	4	using	use	VBG
cord-014462-11ggaqf1	195	5	closely	closely	RB
cord-014462-11ggaqf1	195	6	related	related	JJ
cord-014462-11ggaqf1	195	7	alpha	alpha	NN
cord-014462-11ggaqf1	195	8	and	and	CC
cord-014462-11ggaqf1	195	9	flaviviruses	flavivirus	NNS
cord-014462-11ggaqf1	195	10	.	.	.
cord-014462-11ggaqf1	196	1	The	the	DT
cord-014462-11ggaqf1	196	2	comparison	comparison	NN
cord-014462-11ggaqf1	196	3	of	of	IN
cord-014462-11ggaqf1	196	4	QC	QC	NNP
cord-014462-11ggaqf1	196	5	-	-	HYPH
cord-014462-11ggaqf1	196	6	RT	RT	NNP
cord-014462-11ggaqf1	196	7	-	-	HYPH
cord-014462-11ggaqf1	196	8	PCR	PCR	NNP
cord-014462-11ggaqf1	196	9	result	result	NN
cord-014462-11ggaqf1	196	10	with	with	IN
cord-014462-11ggaqf1	196	11	real	real	JJ
cord-014462-11ggaqf1	196	12	-	-	HYPH
cord-014462-11ggaqf1	196	13	time	time	NN
cord-014462-11ggaqf1	196	14	RT	RT	NNP
cord-014462-11ggaqf1	196	15	-	-	HYPH
cord-014462-11ggaqf1	196	16	PCR	PCR	NNP
cord-014462-11ggaqf1	196	17	revealed	reveal	VBD
cord-014462-11ggaqf1	196	18	100	100	CD
cord-014462-11ggaqf1	196	19	%	%	NN
cord-014462-11ggaqf1	196	20	concordance	concordance	NN
cord-014462-11ggaqf1	196	21	.	.	.
cord-014462-11ggaqf1	197	1	These	these	DT
cord-014462-11ggaqf1	197	2	findings	finding	NNS
cord-014462-11ggaqf1	197	3	demonstrated	demonstrate	VBD
cord-014462-11ggaqf1	197	4	that	that	IN
cord-014462-11ggaqf1	197	5	the	the	DT
cord-014462-11ggaqf1	197	6	reported	reported	JJ
cord-014462-11ggaqf1	197	7	assay	assay	NN
cord-014462-11ggaqf1	197	8	is	be	VBZ
cord-014462-11ggaqf1	197	9	convenient	convenient	JJ
cord-014462-11ggaqf1	197	10	,	,	,
cord-014462-11ggaqf1	197	11	sensitive	sensitive	JJ
cord-014462-11ggaqf1	197	12	and	and	CC
cord-014462-11ggaqf1	197	13	accurate	accurate	JJ
cord-014462-11ggaqf1	197	14	method	method	NN
cord-014462-11ggaqf1	197	15	and	and	CC
cord-014462-11ggaqf1	197	16	has	have	VBZ
cord-014462-11ggaqf1	197	17	the	the	DT
cord-014462-11ggaqf1	197	18	potential	potential	JJ
cord-014462-11ggaqf1	197	19	usefulness	usefulness	NN
cord-014462-11ggaqf1	197	20	for	for	IN
cord-014462-11ggaqf1	197	21	clinical	clinical	JJ
cord-014462-11ggaqf1	197	22	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	197	23	due	due	IN
cord-014462-11ggaqf1	197	24	to	to	IN
cord-014462-11ggaqf1	197	25	simultaneous	simultaneous	JJ
cord-014462-11ggaqf1	197	26	detection	detection	NN
cord-014462-11ggaqf1	197	27	and	and	CC
cord-014462-11ggaqf1	197	28	quantification	quantification	NN
cord-014462-11ggaqf1	197	29	of	of	IN
cord-014462-11ggaqf1	197	30	Chikungunya	Chikungunya	NNP
cord-014462-11ggaqf1	197	31	virus	virus	NN
cord-014462-11ggaqf1	197	32	in	in	IN
cord-014462-11ggaqf1	197	33	acute	acute	JJ
cord-014462-11ggaqf1	197	34	-	-	HYPH
cord-014462-11ggaqf1	197	35	phase	phase	NN
cord-014462-11ggaqf1	197	36	serum	serum	NN
cord-014462-11ggaqf1	197	37	samples	sample	NNS
cord-014462-11ggaqf1	197	38	.	.	.
cord-014462-11ggaqf1	198	1	In	in	IN
cord-014462-11ggaqf1	198	2	India	India	NNP
cord-014462-11ggaqf1	198	3	,	,	,
cord-014462-11ggaqf1	198	4	measles	measles	NN
cord-014462-11ggaqf1	198	5	vaccine	vaccine	NN
cord-014462-11ggaqf1	198	6	was	be	VBD
cord-014462-11ggaqf1	198	7	introduced	introduce	VBN
cord-014462-11ggaqf1	198	8	as	as	IN
cord-014462-11ggaqf1	198	9	part	part	NN
cord-014462-11ggaqf1	198	10	of	of	IN
cord-014462-11ggaqf1	198	11	expanded	expand	VBN
cord-014462-11ggaqf1	198	12	programme	programme	NN
cord-014462-11ggaqf1	198	13	of	of	IN
cord-014462-11ggaqf1	198	14	immunization	immunization	NN
cord-014462-11ggaqf1	198	15	in	in	IN
cord-014462-11ggaqf1	198	16	1985	1985	CD
cord-014462-11ggaqf1	198	17	.	.	.
cord-014462-11ggaqf1	199	1	Measles	measles	NN
cord-014462-11ggaqf1	199	2	,	,	,
cord-014462-11ggaqf1	199	3	mumps	mumps	NN
cord-014462-11ggaqf1	199	4	and	and	CC
cord-014462-11ggaqf1	199	5	rubella	rubella	NN
cord-014462-11ggaqf1	199	6	(	(	-LRB-
cord-014462-11ggaqf1	199	7	MMR	MMR	NNP
cord-014462-11ggaqf1	199	8	)	)	-RRB-
cord-014462-11ggaqf1	199	9	vaccine	vaccine	NN
cord-014462-11ggaqf1	199	10	is	be	VBZ
cord-014462-11ggaqf1	199	11	still	still	RB
cord-014462-11ggaqf1	199	12	not	not	RB
cord-014462-11ggaqf1	199	13	part	part	NN
cord-014462-11ggaqf1	199	14	of	of	IN
cord-014462-11ggaqf1	199	15	the	the	DT
cord-014462-11ggaqf1	199	16	national	national	JJ
cord-014462-11ggaqf1	199	17	immunization	immunization	NN
cord-014462-11ggaqf1	199	18	schedule	schedule	NN
cord-014462-11ggaqf1	199	19	of	of	IN
cord-014462-11ggaqf1	199	20	India	India	NNP
cord-014462-11ggaqf1	199	21	.	.	.
cord-014462-11ggaqf1	200	1	The	the	DT
cord-014462-11ggaqf1	200	2	Indian	indian	JJ
cord-014462-11ggaqf1	200	3	association	association	NN
cord-014462-11ggaqf1	200	4	of	of	IN
cord-014462-11ggaqf1	200	5	paediatrics	paediatrics	NNP
cord-014462-11ggaqf1	200	6	(	(	-LRB-
cord-014462-11ggaqf1	200	7	IAP	IAP	NNP
cord-014462-11ggaqf1	200	8	)	)	-RRB-
cord-014462-11ggaqf1	200	9	recommends	recommend	VBZ
cord-014462-11ggaqf1	200	10	measles	measles	JJ
cord-014462-11ggaqf1	200	11	vaccine	vaccine	NN
cord-014462-11ggaqf1	200	12	at	at	IN
cord-014462-11ggaqf1	200	13	9	9	CD
cord-014462-11ggaqf1	200	14	months	month	NNS
cord-014462-11ggaqf1	200	15	of	of	IN
cord-014462-11ggaqf1	200	16	age	age	NN
cord-014462-11ggaqf1	200	17	and	and	CC
cord-014462-11ggaqf1	200	18	MMR	MMR	NNP
cord-014462-11ggaqf1	200	19	vaccine	vaccine	NN
cord-014462-11ggaqf1	200	20	at	at	IN
cord-014462-11ggaqf1	200	21	15	15	CD
cord-014462-11ggaqf1	200	22	-	-	SYM
cord-014462-11ggaqf1	200	23	18	18	CD
cord-014462-11ggaqf1	200	24	months	month	NNS
cord-014462-11ggaqf1	200	25	.	.	.
cord-014462-11ggaqf1	201	1	However	however	RB
cord-014462-11ggaqf1	201	2	,	,	,
cord-014462-11ggaqf1	201	3	in	in	IN
cord-014462-11ggaqf1	201	4	a	a	DT
cord-014462-11ggaqf1	201	5	recent	recent	JJ
cord-014462-11ggaqf1	201	6	policy	policy	NN
cord-014462-11ggaqf1	201	7	update	update	NN
cord-014462-11ggaqf1	201	8	,	,	,
cord-014462-11ggaqf1	201	9	IAP	IAP	NNP
cord-014462-11ggaqf1	201	10	committee	committee	NN
cord-014462-11ggaqf1	201	11	on	on	IN
cord-014462-11ggaqf1	201	12	immunisation	immunisation	NN
cord-014462-11ggaqf1	201	13	opined	opine	VBD
cord-014462-11ggaqf1	201	14	that	that	IN
cord-014462-11ggaqf1	201	15	there	there	EX
cord-014462-11ggaqf1	201	16	is	be	VBZ
cord-014462-11ggaqf1	201	17	a	a	DT
cord-014462-11ggaqf1	201	18	need	need	NN
cord-014462-11ggaqf1	201	19	for	for	IN
cord-014462-11ggaqf1	201	20	a	a	DT
cord-014462-11ggaqf1	201	21	second	second	JJ
cord-014462-11ggaqf1	201	22	dose	dose	NN
cord-014462-11ggaqf1	201	23	of	of	IN
cord-014462-11ggaqf1	201	24	MMR	MMR	NNP
cord-014462-11ggaqf1	201	25	vaccine	vaccine	NN
cord-014462-11ggaqf1	201	26	for	for	IN
cord-014462-11ggaqf1	201	27	providing	provide	VBG
cord-014462-11ggaqf1	201	28	adequate	adequate	JJ
cord-014462-11ggaqf1	201	29	immunity	immunity	NN
cord-014462-11ggaqf1	201	30	against	against	IN
cord-014462-11ggaqf1	201	31	MMR	MMR	NNP
cord-014462-11ggaqf1	201	32	.	.	.
cord-014462-11ggaqf1	202	1	The	the	DT
cord-014462-11ggaqf1	202	2	aim	aim	NN
cord-014462-11ggaqf1	202	3	of	of	IN
cord-014462-11ggaqf1	202	4	the	the	DT
cord-014462-11ggaqf1	202	5	present	present	JJ
cord-014462-11ggaqf1	202	6	study	study	NN
cord-014462-11ggaqf1	202	7	was	be	VBD
cord-014462-11ggaqf1	202	8	to	to	TO
cord-014462-11ggaqf1	202	9	assess	assess	VB
cord-014462-11ggaqf1	202	10	the	the	DT
cord-014462-11ggaqf1	202	11	extent	extent	NN
cord-014462-11ggaqf1	202	12	of	of	IN
cord-014462-11ggaqf1	202	13	sero	sero	NN
cord-014462-11ggaqf1	202	14	-	-	HYPH
cord-014462-11ggaqf1	202	15	protection	protection	NN
cord-014462-11ggaqf1	202	16	against	against	IN
cord-014462-11ggaqf1	202	17	MMR	MMR	NNP
cord-014462-11ggaqf1	202	18	at	at	IN
cord-014462-11ggaqf1	202	19	4	4	CD
cord-014462-11ggaqf1	202	20	-	-	SYM
cord-014462-11ggaqf1	202	21	6	6	CD
cord-014462-11ggaqf1	202	22	years	year	NNS
cord-014462-11ggaqf1	202	23	of	of	IN
cord-014462-11ggaqf1	202	24	age	age	NN
cord-014462-11ggaqf1	202	25	in	in	IN
cord-014462-11ggaqf1	202	26	children	child	NNS
cord-014462-11ggaqf1	202	27	who	who	WP
cord-014462-11ggaqf1	202	28	have	have	VBP
cord-014462-11ggaqf1	202	29	received	receive	VBN
cord-014462-11ggaqf1	202	30	one	one	CD
cord-014462-11ggaqf1	202	31	dose	dose	NN
cord-014462-11ggaqf1	202	32	of	of	IN
cord-014462-11ggaqf1	202	33	MMR	MMR	NNP
cord-014462-11ggaqf1	202	34	between	between	IN
cord-014462-11ggaqf1	202	35	12	12	CD
cord-014462-11ggaqf1	202	36	and	and	CC
cord-014462-11ggaqf1	202	37	24	24	CD
cord-014462-11ggaqf1	202	38	months	month	NNS
cord-014462-11ggaqf1	202	39	of	of	IN
cord-014462-11ggaqf1	202	40	age	age	NN
cord-014462-11ggaqf1	202	41	.	.	.
cord-014462-11ggaqf1	203	1	An	an	DT
cord-014462-11ggaqf1	203	2	attempt	attempt	NN
cord-014462-11ggaqf1	203	3	has	have	VBZ
cord-014462-11ggaqf1	203	4	also	also	RB
cord-014462-11ggaqf1	203	5	been	be	VBN
cord-014462-11ggaqf1	203	6	made	make	VBN
cord-014462-11ggaqf1	203	7	to	to	TO
cord-014462-11ggaqf1	203	8	assess	assess	VB
cord-014462-11ggaqf1	203	9	the	the	DT
cord-014462-11ggaqf1	203	10	sero	sero	NN
cord-014462-11ggaqf1	203	11	-	-	HYPH
cord-014462-11ggaqf1	203	12	response	response	NN
cord-014462-11ggaqf1	203	13	to	to	IN
cord-014462-11ggaqf1	203	14	the	the	DT
cord-014462-11ggaqf1	203	15	second	second	JJ
cord-014462-11ggaqf1	203	16	dose	dose	NN
cord-014462-11ggaqf1	203	17	of	of	IN
cord-014462-11ggaqf1	203	18	MMR	MMR	NNP
cord-014462-11ggaqf1	203	19	vaccine	vaccine	NN
cord-014462-11ggaqf1	203	20	in	in	IN
cord-014462-11ggaqf1	203	21	4	4	CD
cord-014462-11ggaqf1	203	22	-	-	SYM
cord-014462-11ggaqf1	203	23	6	6	CD
cord-014462-11ggaqf1	203	24	years	year	NNS
cord-014462-11ggaqf1	203	25	old	old	JJ
cord-014462-11ggaqf1	203	26	children	child	NNS
cord-014462-11ggaqf1	203	27	.	.	.
cord-014462-11ggaqf1	204	1	A	a	DT
cord-014462-11ggaqf1	204	2	total	total	NN
cord-014462-11ggaqf1	204	3	of	of	IN
cord-014462-11ggaqf1	204	4	106	106	CD
cord-014462-11ggaqf1	204	5	consecutive	consecutive	JJ
cord-014462-11ggaqf1	204	6	children	child	NNS
cord-014462-11ggaqf1	204	7	between	between	IN
cord-014462-11ggaqf1	204	8	the	the	DT
cord-014462-11ggaqf1	204	9	ages	age	NNS
cord-014462-11ggaqf1	204	10	of	of	IN
cord-014462-11ggaqf1	204	11	4	4	CD
cord-014462-11ggaqf1	204	12	-	-	SYM
cord-014462-11ggaqf1	204	13	6	6	CD
cord-014462-11ggaqf1	204	14	years	year	NNS
cord-014462-11ggaqf1	204	15	who	who	WP
cord-014462-11ggaqf1	204	16	had	have	VBD
cord-014462-11ggaqf1	204	17	received	receive	VBN
cord-014462-11ggaqf1	204	18	MMR	MMR	NNP
cord-014462-11ggaqf1	204	19	vaccine	vaccine	NN
cord-014462-11ggaqf1	204	20	between	between	IN
cord-014462-11ggaqf1	204	21	12	12	CD
cord-014462-11ggaqf1	204	22	and	and	CC
cord-014462-11ggaqf1	204	23	24	24	CD
cord-014462-11ggaqf1	204	24	months	month	NNS
cord-014462-11ggaqf1	204	25	of	of	IN
cord-014462-11ggaqf1	204	26	age	age	NN
cord-014462-11ggaqf1	204	27	and	and	CC
cord-014462-11ggaqf1	204	28	attending	attend	VBG
cord-014462-11ggaqf1	204	29	the	the	DT
cord-014462-11ggaqf1	204	30	immunization	immunization	NN
cord-014462-11ggaqf1	204	31	clinic	clinic	NN
cord-014462-11ggaqf1	204	32	of	of	IN
cord-014462-11ggaqf1	204	33	GTB	GTB	NNP
cord-014462-11ggaqf1	204	34	hospital	hospital	NN
cord-014462-11ggaqf1	204	35	,	,	,
cord-014462-11ggaqf1	204	36	Delhi	Delhi	NNP
cord-014462-11ggaqf1	204	37	were	be	VBD
cord-014462-11ggaqf1	204	38	enrolled	enrol	VBN
cord-014462-11ggaqf1	204	39	.	.	.
cord-014462-11ggaqf1	205	1	The	the	DT
cord-014462-11ggaqf1	205	2	vaccination	vaccination	NN
cord-014462-11ggaqf1	205	3	status	status	NN
cord-014462-11ggaqf1	205	4	,	,	,
cord-014462-11ggaqf1	205	5	anthropometry	anthropometry	NN
cord-014462-11ggaqf1	205	6	and	and	CC
cord-014462-11ggaqf1	205	7	physical	physical	JJ
cord-014462-11ggaqf1	205	8	examination	examination	NN
cord-014462-11ggaqf1	205	9	findings	finding	NNS
cord-014462-11ggaqf1	205	10	were	be	VBD
cord-014462-11ggaqf1	205	11	recorded	record	VBN
cord-014462-11ggaqf1	205	12	.	.	.
cord-014462-11ggaqf1	206	1	Three	three	CD
cord-014462-11ggaqf1	206	2	ml	ml	NNS
cord-014462-11ggaqf1	206	3	of	of	IN
cord-014462-11ggaqf1	206	4	venous	venous	JJ
cord-014462-11ggaqf1	206	5	sample	sample	NN
cord-014462-11ggaqf1	206	6	was	be	VBD
cord-014462-11ggaqf1	206	7	again	again	RB
cord-014462-11ggaqf1	206	8	withdrawn	withdraw	VBN
cord-014462-11ggaqf1	206	9	for	for	IN
cord-014462-11ggaqf1	206	10	estimation	estimation	NN
cord-014462-11ggaqf1	206	11	of	of	IN
cord-014462-11ggaqf1	206	12	post	post	JJ
cord-014462-11ggaqf1	206	13	vaccination	vaccination	NN
cord-014462-11ggaqf1	206	14	antibody	antibody	NN
cord-014462-11ggaqf1	206	15	titre	titre	NNP
cord-014462-11ggaqf1	206	16	.	.	.
cord-014462-11ggaqf1	207	1	It	-PRON-	PRP
cord-014462-11ggaqf1	207	2	was	be	VBD
cord-014462-11ggaqf1	207	3	observed	observe	VBN
cord-014462-11ggaqf1	207	4	that	that	IN
cord-014462-11ggaqf1	207	5	20.39	20.39	CD
cord-014462-11ggaqf1	207	6	%	%	NN
cord-014462-11ggaqf1	207	7	,	,	,
cord-014462-11ggaqf1	207	8	87.38	87.38	CD
cord-014462-11ggaqf1	207	9	%	%	NN
cord-014462-11ggaqf1	207	10	and	and	CC
cord-014462-11ggaqf1	207	11	75.73	75.73	CD
cord-014462-11ggaqf1	207	12	%	%	NN
cord-014462-11ggaqf1	207	13	children	child	NNS
cord-014462-11ggaqf1	207	14	were	be	VBD
cord-014462-11ggaqf1	207	15	seroprotected	seroprotecte	VBN
cord-014462-11ggaqf1	207	16	for	for	IN
cord-014462-11ggaqf1	207	17	MMR	MMR	NNP
cord-014462-11ggaqf1	207	18	respectively	respectively	RB
cord-014462-11ggaqf1	207	19	after	after	IN
cord-014462-11ggaqf1	207	20	2.5	2.5	CD
cord-014462-11ggaqf1	207	21	-	-	SYM
cord-014462-11ggaqf1	207	22	4.5	4.5	CD
cord-014462-11ggaqf1	207	23	year	year	NN
cord-014462-11ggaqf1	207	24	of	of	IN
cord-014462-11ggaqf1	207	25	receiving	receive	VBG
cord-014462-11ggaqf1	207	26	first	first	JJ
cord-014462-11ggaqf1	207	27	dose	dose	NN
cord-014462-11ggaqf1	207	28	of	of	IN
cord-014462-11ggaqf1	207	29	MMR	MMR	NNP
cord-014462-11ggaqf1	207	30	vaccine	vaccine	NN
cord-014462-11ggaqf1	207	31	.	.	.
cord-014462-11ggaqf1	208	1	Seroprotection	Seroprotection	NNP
cord-014462-11ggaqf1	208	2	rose	rise	VBD
cord-014462-11ggaqf1	208	3	to	to	IN
cord-014462-11ggaqf1	208	4	72.62	72.62	CD
cord-014462-11ggaqf1	208	5	%	%	NN
cord-014462-11ggaqf1	208	6	,	,	,
cord-014462-11ggaqf1	208	7	100	100	CD
cord-014462-11ggaqf1	208	8	%	%	NN
cord-014462-11ggaqf1	208	9	and	and	CC
cord-014462-11ggaqf1	208	10	100	100	CD
cord-014462-11ggaqf1	208	11	%	%	NN
cord-014462-11ggaqf1	208	12	for	for	IN
cord-014462-11ggaqf1	208	13	MMR	MMR	NNP
cord-014462-11ggaqf1	208	14	respectively	respectively	RB
cord-014462-11ggaqf1	208	15	after	after	IN
cord-014462-11ggaqf1	208	16	4	4	CD
cord-014462-11ggaqf1	208	17	-	-	SYM
cord-014462-11ggaqf1	208	18	6	6	CD
cord-014462-11ggaqf1	208	19	weeks	week	NNS
cord-014462-11ggaqf1	208	20	of	of	IN
cord-014462-11ggaqf1	208	21	receiving	receive	VBG
cord-014462-11ggaqf1	208	22	second	second	JJ
cord-014462-11ggaqf1	208	23	dose	dose	NN
cord-014462-11ggaqf1	208	24	of	of	IN
cord-014462-11ggaqf1	208	25	MMR	MMR	NNP
cord-014462-11ggaqf1	208	26	vaccine	vaccine	NN
cord-014462-11ggaqf1	208	27	.	.	.
cord-014462-11ggaqf1	209	1	Geometric	geometric	JJ
cord-014462-11ggaqf1	209	2	mean	mean	JJ
cord-014462-11ggaqf1	209	3	concentration	concentration	NN
cord-014462-11ggaqf1	209	4	of	of	IN
cord-014462-11ggaqf1	209	5	antibody	antibody	NN
cord-014462-11ggaqf1	209	6	also	also	RB
cord-014462-11ggaqf1	209	7	rose	rise	VBD
cord-014462-11ggaqf1	209	8	significantly	significantly	RB
cord-014462-11ggaqf1	209	9	in	in	IN
cord-014462-11ggaqf1	209	10	all	all	DT
cord-014462-11ggaqf1	209	11	three	three	CD
cord-014462-11ggaqf1	209	12	diseases	disease	NNS
cord-014462-11ggaqf1	209	13	.	.	.
cord-014462-11ggaqf1	210	1	In	in	IN
cord-014462-11ggaqf1	210	2	view	view	NN
cord-014462-11ggaqf1	210	3	of	of	IN
cord-014462-11ggaqf1	210	4	low	low	JJ
cord-014462-11ggaqf1	210	5	seroprevalence	seroprevalence	NN
cord-014462-11ggaqf1	210	6	of	of	IN
cord-014462-11ggaqf1	210	7	MMR	MMR	NNP
cord-014462-11ggaqf1	210	8	and	and	CC
cord-014462-11ggaqf1	210	9	hence	hence	RB
cord-014462-11ggaqf1	210	10	high	high	JJ
cord-014462-11ggaqf1	210	11	susceptibility	susceptibility	NN
cord-014462-11ggaqf1	210	12	to	to	IN
cord-014462-11ggaqf1	210	13	infection	infection	NN
cord-014462-11ggaqf1	210	14	at	at	IN
cord-014462-11ggaqf1	210	15	4	4	CD
cord-014462-11ggaqf1	210	16	-	-	SYM
cord-014462-11ggaqf1	210	17	6	6	CD
cord-014462-11ggaqf1	210	18	years	year	NNS
cord-014462-11ggaqf1	210	19	of	of	IN
cord-014462-11ggaqf1	210	20	age	age	NN
cord-014462-11ggaqf1	210	21	,	,	,
cord-014462-11ggaqf1	210	22	who	who	WP
cord-014462-11ggaqf1	210	23	have	have	VBP
cord-014462-11ggaqf1	210	24	already	already	RB
cord-014462-11ggaqf1	210	25	received	receive	VBN
cord-014462-11ggaqf1	210	26	MMR	MMR	NNP
cord-014462-11ggaqf1	210	27	vaccine	vaccine	NN
cord-014462-11ggaqf1	210	28	,	,	,
cord-014462-11ggaqf1	210	29	there	there	EX
cord-014462-11ggaqf1	210	30	is	be	VBZ
cord-014462-11ggaqf1	210	31	need	need	NN
cord-014462-11ggaqf1	210	32	to	to	TO
cord-014462-11ggaqf1	210	33	boost	boost	VB
cord-014462-11ggaqf1	210	34	the	the	DT
cord-014462-11ggaqf1	210	35	immune	immune	JJ
cord-014462-11ggaqf1	210	36	responses	response	NNS
cord-014462-11ggaqf1	210	37	against	against	IN
cord-014462-11ggaqf1	210	38	these	these	DT
cord-014462-11ggaqf1	210	39	three	three	CD
cord-014462-11ggaqf1	210	40	diseases	disease	NNS
cord-014462-11ggaqf1	210	41	by	by	IN
cord-014462-11ggaqf1	210	42	giving	give	VBG
cord-014462-11ggaqf1	210	43	a	a	DT
cord-014462-11ggaqf1	210	44	second	second	JJ
cord-014462-11ggaqf1	210	45	dose	dose	NN
cord-014462-11ggaqf1	210	46	of	of	IN
cord-014462-11ggaqf1	210	47	MMR	MMR	NNP
cord-014462-11ggaqf1	210	48	vaccine	vaccine	NN
cord-014462-11ggaqf1	210	49	.	.	.
cord-014462-11ggaqf1	211	1	Baseline	baseline	JJ
cord-014462-11ggaqf1	211	2	information	information	NN
cord-014462-11ggaqf1	211	3	on	on	IN
cord-014462-11ggaqf1	211	4	the	the	DT
cord-014462-11ggaqf1	211	5	epidemiology	epidemiology	NN
cord-014462-11ggaqf1	211	6	of	of	IN
cord-014462-11ggaqf1	211	7	viral	viral	JJ
cord-014462-11ggaqf1	211	8	agents	agent	NNS
cord-014462-11ggaqf1	211	9	causing	cause	VBG
cord-014462-11ggaqf1	211	10	STIs	sti	NNS
cord-014462-11ggaqf1	211	11	and	and	CC
cord-014462-11ggaqf1	211	12	types	type	NNS
cord-014462-11ggaqf1	211	13	of	of	IN
cord-014462-11ggaqf1	211	14	risk	risk	NN
cord-014462-11ggaqf1	211	15	behaviour	behaviour	NN
cord-014462-11ggaqf1	211	16	of	of	IN
cord-014462-11ggaqf1	211	17	affected	affected	JJ
cord-014462-11ggaqf1	211	18	persons	person	NNS
cord-014462-11ggaqf1	211	19	are	be	VBP
cord-014462-11ggaqf1	211	20	essential	essential	JJ
cord-014462-11ggaqf1	211	21	for	for	IN
cord-014462-11ggaqf1	211	22	any	any	DT
cord-014462-11ggaqf1	211	23	meaningful	meaningful	JJ
cord-014462-11ggaqf1	211	24	targeted	target	VBN
cord-014462-11ggaqf1	211	25	intervention	intervention	NN
cord-014462-11ggaqf1	211	26	.	.	.
cord-014462-11ggaqf1	212	1	The	the	DT
cord-014462-11ggaqf1	212	2	present	present	JJ
cord-014462-11ggaqf1	212	3	study	study	NN
cord-014462-11ggaqf1	212	4	documents	document	VBZ
cord-014462-11ggaqf1	212	5	the	the	DT
cord-014462-11ggaqf1	212	6	pattern	pattern	NN
cord-014462-11ggaqf1	212	7	of	of	IN
cord-014462-11ggaqf1	212	8	viral	viral	JJ
cord-014462-11ggaqf1	212	9	STIs	sti	NNS
cord-014462-11ggaqf1	212	10	in	in	IN
cord-014462-11ggaqf1	212	11	patients	patient	NNS
cord-014462-11ggaqf1	212	12	attending	attend	VBG
cord-014462-11ggaqf1	212	13	a	a	DT
cord-014462-11ggaqf1	212	14	tertiary	tertiary	JJ
cord-014462-11ggaqf1	212	15	care	care	NN
cord-014462-11ggaqf1	212	16	hospital	hospital	NN
cord-014462-11ggaqf1	212	17	,	,	,
cord-014462-11ggaqf1	212	18	correlating	correlate	VBG
cord-014462-11ggaqf1	212	19	the	the	DT
cord-014462-11ggaqf1	212	20	syndromic	syndromic	JJ
cord-014462-11ggaqf1	212	21	approach	approach	NN
cord-014462-11ggaqf1	212	22	and	and	CC
cord-014462-11ggaqf1	212	23	the	the	DT
cord-014462-11ggaqf1	212	24	laboratory	laboratory	NN
cord-014462-11ggaqf1	212	25	investigations	investigation	NNS
cord-014462-11ggaqf1	212	26	to	to	TO
cord-014462-11ggaqf1	212	27	determine	determine	VB
cord-014462-11ggaqf1	212	28	the	the	DT
cord-014462-11ggaqf1	212	29	aetiology	aetiology	NN
cord-014462-11ggaqf1	212	30	.	.	.
cord-014462-11ggaqf1	213	1	Three	three	CD
cord-014462-11ggaqf1	213	2	hundred	hundred	CD
cord-014462-11ggaqf1	213	3	consecutive	consecutive	JJ
cord-014462-11ggaqf1	213	4	patients	patient	NNS
cord-014462-11ggaqf1	213	5	attending	attend	VBG
cord-014462-11ggaqf1	213	6	the	the	DT
cord-014462-11ggaqf1	213	7	STI	STI	NNP
cord-014462-11ggaqf1	213	8	clinic	clinic	NN
cord-014462-11ggaqf1	213	9	were	be	VBD
cord-014462-11ggaqf1	213	10	diagnosed	diagnose	VBN
cord-014462-11ggaqf1	213	11	and	and	CC
cord-014462-11ggaqf1	213	12	categorized	categorize	VBN
cord-014462-11ggaqf1	213	13	according	accord	VBG
cord-014462-11ggaqf1	213	14	to	to	IN
cord-014462-11ggaqf1	213	15	the	the	DT
cord-014462-11ggaqf1	213	16	syndromic	syndromic	JJ
cord-014462-11ggaqf1	213	17	approach	approach	NN
cord-014462-11ggaqf1	213	18	of	of	IN
cord-014462-11ggaqf1	213	19	the	the	DT
cord-014462-11ggaqf1	213	20	WHO	WHO	NNP
cord-014462-11ggaqf1	213	21	along	along	IN
cord-014462-11ggaqf1	213	22	with	with	IN
cord-014462-11ggaqf1	213	23	detailed	detailed	JJ
cord-014462-11ggaqf1	213	24	history	history	NN
cord-014462-11ggaqf1	213	25	and	and	CC
cord-014462-11ggaqf1	213	26	demographic	demographic	JJ
cord-014462-11ggaqf1	213	27	data	datum	NNS
cord-014462-11ggaqf1	213	28	.	.	.
cord-014462-11ggaqf1	214	1	Majority	majority	NN
cord-014462-11ggaqf1	214	2	of	of	IN
cord-014462-11ggaqf1	214	3	the	the	DT
cord-014462-11ggaqf1	214	4	patients	patient	NNS
cord-014462-11ggaqf1	214	5	were	be	VBD
cord-014462-11ggaqf1	214	6	men	man	NNS
cord-014462-11ggaqf1	214	7	(	(	-LRB-
cord-014462-11ggaqf1	214	8	53.12	53.12	CD
cord-014462-11ggaqf1	214	9	%	%	NN
cord-014462-11ggaqf1	214	10	)	)	-RRB-
cord-014462-11ggaqf1	214	11	with	with	IN
cord-014462-11ggaqf1	214	12	a	a	DT
cord-014462-11ggaqf1	214	13	mean	mean	JJ
cord-014462-11ggaqf1	214	14	age	age	NN
cord-014462-11ggaqf1	214	15	of	of	IN
cord-014462-11ggaqf1	214	16	24	24	CD
cord-014462-11ggaqf1	214	17	years	year	NNS
cord-014462-11ggaqf1	214	18	.	.	.
cord-014462-11ggaqf1	215	1	Men	man	NNS
cord-014462-11ggaqf1	215	2	received	receive	VBD
cord-014462-11ggaqf1	215	3	education	education	NN
cord-014462-11ggaqf1	215	4	up	up	IN
cord-014462-11ggaqf1	215	5	to	to	IN
cord-014462-11ggaqf1	215	6	middle	middle	JJ
cord-014462-11ggaqf1	215	7	school	school	NN
cord-014462-11ggaqf1	215	8	.	.	.
cord-014462-11ggaqf1	216	1	Half	half	NN
cord-014462-11ggaqf1	216	2	of	of	IN
cord-014462-11ggaqf1	216	3	the	the	DT
cord-014462-11ggaqf1	216	4	female	female	JJ
cord-014462-11ggaqf1	216	5	subjects	subject	NNS
cord-014462-11ggaqf1	216	6	were	be	VBD
cord-014462-11ggaqf1	216	7	illiterate	illiterate	JJ
cord-014462-11ggaqf1	216	8	.	.	.
cord-014462-11ggaqf1	217	1	Sixty	sixty	CD
cord-014462-11ggaqf1	217	2	percent	percent	NN
cord-014462-11ggaqf1	217	3	of	of	IN
cord-014462-11ggaqf1	217	4	the	the	DT
cord-014462-11ggaqf1	217	5	patients	patient	NNS
cord-014462-11ggaqf1	217	6	were	be	VBD
cord-014462-11ggaqf1	217	7	married	married	JJ
cord-014462-11ggaqf1	217	8	and	and	CC
cord-014462-11ggaqf1	217	9	among	among	IN
cord-014462-11ggaqf1	217	10	these	these	DT
cord-014462-11ggaqf1	217	11	,	,	,
cord-014462-11ggaqf1	217	12	19	19	CD
cord-014462-11ggaqf1	217	13	%	%	NN
cord-014462-11ggaqf1	217	14	were	be	VBD
cord-014462-11ggaqf1	217	15	regular	regular	JJ
cord-014462-11ggaqf1	217	16	condom	condom	NN
cord-014462-11ggaqf1	217	17	users	user	NNS
cord-014462-11ggaqf1	217	18	.	.	.
cord-014462-11ggaqf1	218	1	First	first	JJ
cord-014462-11ggaqf1	218	2	sexual	sexual	JJ
cord-014462-11ggaqf1	218	3	contact	contact	NN
cord-014462-11ggaqf1	218	4	at	at	IN
cord-014462-11ggaqf1	218	5	or	or	CC
cord-014462-11ggaqf1	218	6	before	before	IN
cord-014462-11ggaqf1	218	7	18	18	CD
cord-014462-11ggaqf1	218	8	years	year	NNS
cord-014462-11ggaqf1	218	9	of	of	IN
cord-014462-11ggaqf1	218	10	age	age	NN
cord-014462-11ggaqf1	218	11	was	be	VBD
cord-014462-11ggaqf1	218	12	more	more	JJR
cord-014462-11ggaqf1	218	13	in	in	IN
cord-014462-11ggaqf1	218	14	men	man	NNS
cord-014462-11ggaqf1	218	15	(	(	-LRB-
cord-014462-11ggaqf1	218	16	31	31	CD
cord-014462-11ggaqf1	218	17	%	%	NN
cord-014462-11ggaqf1	218	18	vs.	vs.	IN
cord-014462-11ggaqf1	218	19	22	22	CD
cord-014462-11ggaqf1	218	20	.22	.22	CD
cord-014462-11ggaqf1	218	21	%	%	NN
cord-014462-11ggaqf1	218	22	in	in	IN
cord-014462-11ggaqf1	218	23	women	woman	NNS
cord-014462-11ggaqf1	218	24	)	)	-RRB-
cord-014462-11ggaqf1	218	25	.	.	.
cord-014462-11ggaqf1	219	1	Promiscuity	promiscuity	NN
cord-014462-11ggaqf1	219	2	was	be	VBD
cord-014462-11ggaqf1	219	3	more	more	JJR
cord-014462-11ggaqf1	219	4	among	among	IN
cord-014462-11ggaqf1	219	5	male	male	JJ
cord-014462-11ggaqf1	219	6	patients	patient	NNS
cord-014462-11ggaqf1	219	7	who	who	WP
cord-014462-11ggaqf1	219	8	had	have	VBD
cord-014462-11ggaqf1	219	9	contact	contact	NN
cord-014462-11ggaqf1	219	10	with	with	IN
cord-014462-11ggaqf1	219	11	CSW	CSW	NNP
cord-014462-11ggaqf1	219	12	.	.	.
cord-014462-11ggaqf1	220	1	Genital	Genital	NNP
cord-014462-11ggaqf1	220	2	Herpes	Herpes	NNP
cord-014462-11ggaqf1	220	3	was	be	VBD
cord-014462-11ggaqf1	220	4	the	the	DT
cord-014462-11ggaqf1	220	5	commonest	common	JJS
cord-014462-11ggaqf1	220	6	viral	viral	JJ
cord-014462-11ggaqf1	220	7	STI	STI	NNP
cord-014462-11ggaqf1	220	8	(	(	-LRB-
cord-014462-11ggaqf1	220	9	86/300	86/300	CD
cord-014462-11ggaqf1	220	10	)	)	-RRB-
cord-014462-11ggaqf1	220	11	followed	follow	VBN
cord-014462-11ggaqf1	220	12	by	by	IN
cord-014462-11ggaqf1	220	13	genital	genital	JJ
cord-014462-11ggaqf1	220	14	wart	wart	NN
cord-014462-11ggaqf1	220	15	(	(	-LRB-
cord-014462-11ggaqf1	220	16	60/300	60/300	CD
cord-014462-11ggaqf1	220	17	)	)	-RRB-
cord-014462-11ggaqf1	220	18	.	.	.
cord-014462-11ggaqf1	221	1	Concomitant	concomitant	JJ
cord-014462-11ggaqf1	221	2	infection	infection	NN
cord-014462-11ggaqf1	221	3	with	with	IN
cord-014462-11ggaqf1	221	4	more	more	JJR
cord-014462-11ggaqf1	221	5	than	than	IN
cord-014462-11ggaqf1	221	6	one	one	CD
cord-014462-11ggaqf1	221	7	virus	virus	NN
cord-014462-11ggaqf1	221	8	was	be	VBD
cord-014462-11ggaqf1	221	9	seen	see	VBN
cord-014462-11ggaqf1	221	10	in	in	IN
cord-014462-11ggaqf1	221	11	35	35	CD
cord-014462-11ggaqf1	221	12	%	%	NN
cord-014462-11ggaqf1	221	13	of	of	IN
cord-014462-11ggaqf1	221	14	patients	patient	NNS
cord-014462-11ggaqf1	221	15	.	.	.
cord-014462-11ggaqf1	222	1	HIV	HIV	NNP
cord-014462-11ggaqf1	222	2	was	be	VBD
cord-014462-11ggaqf1	222	3	prevalent	prevalent	JJ
cord-014462-11ggaqf1	222	4	in	in	IN
cord-014462-11ggaqf1	222	5	10.3	10.3	CD
cord-014462-11ggaqf1	222	6	%	%	NN
cord-014462-11ggaqf1	222	7	of	of	IN
cord-014462-11ggaqf1	222	8	STI	STI	NNP
cord-014462-11ggaqf1	222	9	patients	patient	NNS
cord-014462-11ggaqf1	222	10	.	.	.
cord-014462-11ggaqf1	223	1	Hepatitis	Hepatitis	NNP
cord-014462-11ggaqf1	223	2	B	B	NNP
cord-014462-11ggaqf1	223	3	,	,	,
cord-014462-11ggaqf1	223	4	Hepatitis	Hepatitis	NNP
cord-014462-11ggaqf1	223	5	C	C	NNP
cord-014462-11ggaqf1	223	6	,	,	,
cord-014462-11ggaqf1	223	7	Herpes	Herpes	NNP
cord-014462-11ggaqf1	223	8	simplex	simplex	NN
cord-014462-11ggaqf1	223	9	type	type	NN
cord-014462-11ggaqf1	223	10	1	1	CD
cord-014462-11ggaqf1	223	11	and	and	CC
cord-014462-11ggaqf1	223	12	Molluscum	Molluscum	NNP
cord-014462-11ggaqf1	223	13	contagiosum	contagiosum	NN
cord-014462-11ggaqf1	223	14	were	be	VBD
cord-014462-11ggaqf1	223	15	the	the	DT
cord-014462-11ggaqf1	223	16	other	other	JJ
cord-014462-11ggaqf1	223	17	viral	viral	JJ
cord-014462-11ggaqf1	223	18	agents	agent	NNS
cord-014462-11ggaqf1	223	19	seen	see	VBN
cord-014462-11ggaqf1	223	20	in	in	IN
cord-014462-11ggaqf1	223	21	STI	STI	NNP
cord-014462-11ggaqf1	223	22	clinic	clinic	NN
cord-014462-11ggaqf1	223	23	attendees	attendee	NNS
cord-014462-11ggaqf1	223	24	at	at	IN
cord-014462-11ggaqf1	223	25	our	-PRON-	PRP$
cord-014462-11ggaqf1	223	26	centre	centre	NN
cord-014462-11ggaqf1	223	27	.	.	.
cord-014462-11ggaqf1	224	1	This	this	DT
cord-014462-11ggaqf1	224	2	disease	disease	NN
cord-014462-11ggaqf1	224	3	currently	currently	RB
cord-014462-11ggaqf1	224	4	Prevalent	prevalent	JJ
cord-014462-11ggaqf1	224	5	in	in	IN
cord-014462-11ggaqf1	224	6	more	more	JJR
cord-014462-11ggaqf1	224	7	than	than	IN
cord-014462-11ggaqf1	224	8	100	100	CD
cord-014462-11ggaqf1	224	9	countries	country	NNS
cord-014462-11ggaqf1	224	10	world	world	NN
cord-014462-11ggaqf1	224	11	wide	wide	RB
cord-014462-11ggaqf1	224	12	and	and	CC
cord-014462-11ggaqf1	224	13	annually	annually	RB
cord-014462-11ggaqf1	224	14	50	50	CD
cord-014462-11ggaqf1	224	15	-	-	SYM
cord-014462-11ggaqf1	224	16	100	100	CD
cord-014462-11ggaqf1	224	17	million	million	CD
cord-014462-11ggaqf1	224	18	people	people	NNS
cord-014462-11ggaqf1	224	19	are	be	VBP
cord-014462-11ggaqf1	224	20	infected	infect	VBN
cord-014462-11ggaqf1	224	21	with	with	IN
cord-014462-11ggaqf1	224	22	Dengue	Dengue	NNP
cord-014462-11ggaqf1	224	23	virus	virus	NN
cord-014462-11ggaqf1	224	24	among	among	IN
cord-014462-11ggaqf1	224	25	which	which	WDT
cord-014462-11ggaqf1	224	26	2.5	2.5	CD
cord-014462-11ggaqf1	224	27	-	-	SYM
cord-014462-11ggaqf1	224	28	5	5	CD
cord-014462-11ggaqf1	224	29	lakhs	lakh	NNS
cord-014462-11ggaqf1	224	30	cases	case	NNS
cord-014462-11ggaqf1	224	31	were	be	VBD
cord-014462-11ggaqf1	224	32	Dengue	Dengue	NNP
cord-014462-11ggaqf1	224	33	Hemorrhagic	hemorrhagic	JJ
cord-014462-11ggaqf1	224	34	Fever	fever	NN
cord-014462-11ggaqf1	224	35	(	(	-LRB-
cord-014462-11ggaqf1	224	36	DHF	DHF	NNP
cord-014462-11ggaqf1	224	37	)	)	-RRB-
cord-014462-11ggaqf1	224	38	and	and	CC
cord-014462-11ggaqf1	224	39	Dengue	Dengue	NNP
cord-014462-11ggaqf1	224	40	Shock	Shock	NNP
cord-014462-11ggaqf1	224	41	Syndrome	Syndrome	NNP
cord-014462-11ggaqf1	224	42	(	(	-LRB-
cord-014462-11ggaqf1	224	43	DSS	DSS	NNP
cord-014462-11ggaqf1	224	44	)	)	-RRB-
cord-014462-11ggaqf1	224	45	which	which	WDT
cord-014462-11ggaqf1	224	46	are	be	VBP
cord-014462-11ggaqf1	224	47	serious	serious	JJ
cord-014462-11ggaqf1	224	48	forms	form	NNS
cord-014462-11ggaqf1	224	49	of	of	IN
cord-014462-11ggaqf1	224	50	Dengue	dengue	NN
cord-014462-11ggaqf1	224	51	virus	virus	NN
cord-014462-11ggaqf1	224	52	infection	infection	NN
cord-014462-11ggaqf1	224	53	and	and	CC
cord-014462-11ggaqf1	224	54	due	due	IN
cord-014462-11ggaqf1	224	55	to	to	IN
cord-014462-11ggaqf1	224	56	this	this	DT
cord-014462-11ggaqf1	224	57	condition	condition	NN
cord-014462-11ggaqf1	224	58	25,000	25,000	CD
cord-014462-11ggaqf1	224	59	deaths	death	NNS
cord-014462-11ggaqf1	224	60	might	may	MD
cord-014462-11ggaqf1	224	61	occur	occur	VB
cord-014462-11ggaqf1	224	62	annually	annually	RB
cord-014462-11ggaqf1	224	63	World	World	NNP
cord-014462-11ggaqf1	224	64	Wide	wide	JJ
cord-014462-11ggaqf1	224	65	and	and	CC
cord-014462-11ggaqf1	224	66	approximately	approximately	RB
cord-014462-11ggaqf1	224	67	3	3	CD
cord-014462-11ggaqf1	224	68	million	million	CD
cord-014462-11ggaqf1	224	69	children	child	NNS
cord-014462-11ggaqf1	224	70	were	be	VBD
cord-014462-11ggaqf1	224	71	hospitalized	hospitalize	VBN
cord-014462-11ggaqf1	224	72	for	for	IN
cord-014462-11ggaqf1	224	73	the	the	DT
cord-014462-11ggaqf1	224	74	fast	fast	JJ
cord-014462-11ggaqf1	224	75	3	3	CD
cord-014462-11ggaqf1	224	76	decades	decade	NNS
cord-014462-11ggaqf1	224	77	.	.	.
cord-014462-11ggaqf1	225	1	This	this	DT
cord-014462-11ggaqf1	225	2	disease	disease	NN
cord-014462-11ggaqf1	225	3	is	be	VBZ
cord-014462-11ggaqf1	225	4	characterized	characterize	VBN
cord-014462-11ggaqf1	225	5	by	by	IN
cord-014462-11ggaqf1	225	6	sudden	sudden	JJ
cord-014462-11ggaqf1	225	7	onset	onset	NN
cord-014462-11ggaqf1	225	8	of	of	IN
cord-014462-11ggaqf1	225	9	high	high	JJ
cord-014462-11ggaqf1	225	10	fever	fever	NN
cord-014462-11ggaqf1	225	11	with	with	IN
cord-014462-11ggaqf1	225	12	sever	sever	NN
cord-014462-11ggaqf1	225	13	headache	headache	NN
cord-014462-11ggaqf1	225	14	,	,	,
cord-014462-11ggaqf1	225	15	pain	pain	NN
cord-014462-11ggaqf1	225	16	in	in	IN
cord-014462-11ggaqf1	225	17	the	the	DT
cord-014462-11ggaqf1	225	18	back	back	NN
cord-014462-11ggaqf1	225	19	and	and	CC
cord-014462-11ggaqf1	225	20	limbs	limb	NNS
cord-014462-11ggaqf1	225	21	,	,	,
cord-014462-11ggaqf1	225	22	lymphadenopathy	lymphadenopathy	NNP
cord-014462-11ggaqf1	225	23	macuolo	macuolo	NN
cord-014462-11ggaqf1	225	24	-	-	HYPH
cord-014462-11ggaqf1	225	25	papulur	papulur	NN
cord-014462-11ggaqf1	225	26	rash	rash	NN
cord-014462-11ggaqf1	225	27	over	over	IN
cord-014462-11ggaqf1	225	28	the	the	DT
cord-014462-11ggaqf1	225	29	skin	skin	NN
cord-014462-11ggaqf1	225	30	and	and	CC
cord-014462-11ggaqf1	225	31	retro	retro	JJ
cord-014462-11ggaqf1	225	32	-	-	HYPH
cord-014462-11ggaqf1	225	33	bulbar	bulbar	NN
cord-014462-11ggaqf1	225	34	pain	pain	NN
cord-014462-11ggaqf1	225	35	.	.	.
cord-014462-11ggaqf1	226	1	Early	early	JJ
cord-014462-11ggaqf1	226	2	Diagnosis	diagnosis	NN
cord-014462-11ggaqf1	226	3	can	can	MD
cord-014462-11ggaqf1	226	4	be	be	VB
cord-014462-11ggaqf1	226	5	established	establish	VBN
cord-014462-11ggaqf1	226	6	with	with	IN
cord-014462-11ggaqf1	226	7	simple	simple	JJ
cord-014462-11ggaqf1	226	8	and	and	CC
cord-014462-11ggaqf1	226	9	rapid	rapid	JJ
cord-014462-11ggaqf1	226	10	lgG/1gM	lgG/1gM	NNP
cord-014462-11ggaqf1	226	11	antibodies	antibody	NNS
cord-014462-11ggaqf1	226	12	detection	detection	NN
cord-014462-11ggaqf1	226	13	in	in	IN
cord-014462-11ggaqf1	226	14	the	the	DT
cord-014462-11ggaqf1	226	15	blood	blood	NN
cord-014462-11ggaqf1	226	16	samples	sample	NNS
cord-014462-11ggaqf1	226	17	of	of	IN
cord-014462-11ggaqf1	226	18	the	the	DT
cord-014462-11ggaqf1	226	19	patients	patient	NNS
cord-014462-11ggaqf1	226	20	based	base	VBN
cord-014462-11ggaqf1	226	21	on	on	IN
cord-014462-11ggaqf1	226	22	the	the	DT
cord-014462-11ggaqf1	226	23	Bi	bi	JJ
cord-014462-11ggaqf1	226	24	-	-	HYPH
cord-014462-11ggaqf1	226	25	directional	directional	JJ
cord-014462-11ggaqf1	226	26	immunoassay	immunoassay	NN
cord-014462-11ggaqf1	226	27	system	system	NN
cord-014462-11ggaqf1	226	28	for	for	IN
cord-014462-11ggaqf1	226	29	its	-PRON-	PRP$
cord-014462-11ggaqf1	226	30	management	management	NN
cord-014462-11ggaqf1	226	31	and	and	CC
cord-014462-11ggaqf1	226	32	control	control	NN
cord-014462-11ggaqf1	226	33	to	to	TO
cord-014462-11ggaqf1	226	34	reduce	reduce	VB
cord-014462-11ggaqf1	226	35	morbidity	morbidity	NN
cord-014462-11ggaqf1	226	36	and	and	CC
cord-014462-11ggaqf1	226	37	mortality	mortality	NN
cord-014462-11ggaqf1	226	38	.	.	.
cord-014462-11ggaqf1	227	1	Details	detail	NNS
cord-014462-11ggaqf1	227	2	will	will	MD
cord-014462-11ggaqf1	227	3	be	be	VB
cord-014462-11ggaqf1	227	4	presented	present	VBN
cord-014462-11ggaqf1	227	5	.	.	.
cord-014462-11ggaqf1	228	1	Myocarditis	myocarditis	NN
cord-014462-11ggaqf1	228	2	and	and	CC
cord-014462-11ggaqf1	228	3	dilated	dilated	JJ
cord-014462-11ggaqf1	228	4	cardiomyopathy	cardiomyopathy	NN
cord-014462-11ggaqf1	228	5	(	(	-LRB-
cord-014462-11ggaqf1	228	6	DCM	DCM	NNP
cord-014462-11ggaqf1	228	7	)	)	-RRB-
cord-014462-11ggaqf1	228	8	are	be	VBP
cord-014462-11ggaqf1	228	9	common	common	JJ
cord-014462-11ggaqf1	228	10	causes	cause	NNS
cord-014462-11ggaqf1	228	11	of	of	IN
cord-014462-11ggaqf1	228	12	morbidity	morbidity	NN
cord-014462-11ggaqf1	228	13	and	and	CC
cord-014462-11ggaqf1	228	14	mortality	mortality	NN
cord-014462-11ggaqf1	228	15	both	both	DT
cord-014462-11ggaqf1	228	16	in	in	IN
cord-014462-11ggaqf1	228	17	children	child	NNS
cord-014462-11ggaqf1	228	18	and	and	CC
cord-014462-11ggaqf1	228	19	adults	adult	NNS
cord-014462-11ggaqf1	228	20	.	.	.
cord-014462-11ggaqf1	229	1	The	the	DT
cord-014462-11ggaqf1	229	2	most	most	RBS
cord-014462-11ggaqf1	229	3	common	common	JJ
cord-014462-11ggaqf1	229	4	viruses	virus	NNS
cord-014462-11ggaqf1	229	5	involved	involve	VBN
cord-014462-11ggaqf1	229	6	in	in	IN
cord-014462-11ggaqf1	229	7	myocarditis	myocarditis	NN
cord-014462-11ggaqf1	229	8	are	be	VBP
cord-014462-11ggaqf1	229	9	coxsackievirus	coxsackievirus	NNP
cord-014462-11ggaqf1	229	10	B	b	NN
cord-014462-11ggaqf1	229	11	or	or	CC
cord-014462-11ggaqf1	229	12	adenovirus	adenovirus	NN
cord-014462-11ggaqf1	229	13	.	.	.
cord-014462-11ggaqf1	230	1	Recently	recently	RB
cord-014462-11ggaqf1	230	2	,	,	,
cord-014462-11ggaqf1	230	3	the	the	DT
cord-014462-11ggaqf1	230	4	coxsackievirus	coxsackievirus	NNP
cord-014462-11ggaqf1	230	5	and	and	CC
cord-014462-11ggaqf1	230	6	adenovirus	adenovirus	NN
cord-014462-11ggaqf1	230	7	receptor	receptor	NN
cord-014462-11ggaqf1	230	8	(	(	-LRB-
cord-014462-11ggaqf1	230	9	CAR	car	NN
cord-014462-11ggaqf1	230	10	)	)	-RRB-
cord-014462-11ggaqf1	230	11	,	,	,
cord-014462-11ggaqf1	230	12	a	a	DT
cord-014462-11ggaqf1	230	13	common	common	JJ
cord-014462-11ggaqf1	230	14	receptor	receptor	NN
cord-014462-11ggaqf1	230	15	for	for	IN
cord-014462-11ggaqf1	230	16	coxsackieviruses	coxsackievirus	NNS
cord-014462-11ggaqf1	230	17	B3	B3	NNP
cord-014462-11ggaqf1	230	18	,	,	,
cord-014462-11ggaqf1	230	19	B4	B4	NNP
cord-014462-11ggaqf1	230	20	and	and	CC
cord-014462-11ggaqf1	230	21	adenoviruses	adenovirus	NNS
cord-014462-11ggaqf1	230	22	2	2	CD
cord-014462-11ggaqf1	230	23	,	,	,
cord-014462-11ggaqf1	230	24	5	5	CD
cord-014462-11ggaqf1	230	25	has	have	VBZ
cord-014462-11ggaqf1	230	26	been	be	VBN
cord-014462-11ggaqf1	230	27	identified	identify	VBN
cord-014462-11ggaqf1	230	28	.	.	.
cord-014462-11ggaqf1	231	1	Increased	increase	VBN
cord-014462-11ggaqf1	231	2	expression	expression	NN
cord-014462-11ggaqf1	231	3	of	of	IN
cord-014462-11ggaqf1	231	4	CAR	car	NN
cord-014462-11ggaqf1	231	5	has	have	VBZ
cord-014462-11ggaqf1	231	6	been	be	VBN
cord-014462-11ggaqf1	231	7	reported	report	VBN
cord-014462-11ggaqf1	231	8	in	in	IN
cord-014462-11ggaqf1	231	9	patients	patient	NNS
cord-014462-11ggaqf1	231	10	with	with	IN
cord-014462-11ggaqf1	231	11	DCM	DCM	NNP
cord-014462-11ggaqf1	231	12	suggesting	suggest	VBG
cord-014462-11ggaqf1	231	13	utilization	utilization	NN
cord-014462-11ggaqf1	231	14	of	of	IN
cord-014462-11ggaqf1	231	15	CAR	car	NN
cord-014462-11ggaqf1	231	16	by	by	IN
cord-014462-11ggaqf1	231	17	these	these	DT
cord-014462-11ggaqf1	231	18	viruses	virus	NNS
cord-014462-11ggaqf1	231	19	for	for	IN
cord-014462-11ggaqf1	231	20	cell	cell	NN
cord-014462-11ggaqf1	231	21	entry	entry	NN
cord-014462-11ggaqf1	231	22	.	.	.
cord-014462-11ggaqf1	232	1	The	the	DT
cord-014462-11ggaqf1	232	2	present	present	JJ
cord-014462-11ggaqf1	232	3	study	study	NN
cord-014462-11ggaqf1	232	4	was	be	VBD
cord-014462-11ggaqf1	232	5	designed	design	VBN
cord-014462-11ggaqf1	232	6	to	to	TO
cord-014462-11ggaqf1	232	7	study	study	VB
cord-014462-11ggaqf1	232	8	the	the	DT
cord-014462-11ggaqf1	232	9	expression	expression	NN
cord-014462-11ggaqf1	232	10	of	of	IN
cord-014462-11ggaqf1	232	11	CAR	car	NN
cord-014462-11ggaqf1	232	12	in	in	IN
cord-014462-11ggaqf1	232	13	myocardial	myocardial	JJ
cord-014462-11ggaqf1	232	14	tissue	tissue	NN
cord-014462-11ggaqf1	232	15	of	of	IN
cord-014462-11ggaqf1	232	16	patients	patient	NNS
cord-014462-11ggaqf1	232	17	with	with	IN
cord-014462-11ggaqf1	232	18	DCM	DCM	NNP
cord-014462-11ggaqf1	232	19	.	.	.
cord-014462-11ggaqf1	233	1	Formalin	Formalin	NNP
cord-014462-11ggaqf1	233	2	fixed	fix	VBN
cord-014462-11ggaqf1	234	1	myocardial	myocardial	JJ
cord-014462-11ggaqf1	234	2	tissues	tissue	NNS
cord-014462-11ggaqf1	234	3	were	be	VBD
cord-014462-11ggaqf1	234	4	obtained	obtain	VBN
cord-014462-11ggaqf1	234	5	from	from	IN
cord-014462-11ggaqf1	234	6	autopsy	autopsy	JJ
cord-014462-11ggaqf1	234	7	cases	case	NNS
cord-014462-11ggaqf1	234	8	.	.	.
cord-014462-11ggaqf1	235	1	A	a	DT
cord-014462-11ggaqf1	235	2	total	total	NN
cord-014462-11ggaqf1	235	3	of	of	IN
cord-014462-11ggaqf1	235	4	26	26	CD
cord-014462-11ggaqf1	235	5	cases	case	NNS
cord-014462-11ggaqf1	235	6	of	of	IN
cord-014462-11ggaqf1	235	7	DCM	DCM	NNP
cord-014462-11ggaqf1	235	8	and	and	CC
cord-014462-11ggaqf1	235	9	20	20	CD
cord-014462-11ggaqf1	235	10	cases	case	NNS
cord-014462-11ggaqf1	235	11	of	of	IN
cord-014462-11ggaqf1	235	12	controls	control	NNS
cord-014462-11ggaqf1	235	13	which	which	WDT
cord-014462-11ggaqf1	235	14	included	include	VBD
cord-014462-11ggaqf1	235	15	non	non	JJ
cord-014462-11ggaqf1	235	16	-	-	JJ
cord-014462-11ggaqf1	235	17	cardiac	cardiac	JJ
cord-014462-11ggaqf1	235	18	(	(	-LRB-
cord-014462-11ggaqf1	235	19	Group	Group	NNP
cord-014462-11ggaqf1	235	20	-	-	HYPH
cord-014462-11ggaqf1	235	21	A	A	NNP
cord-014462-11ggaqf1	235	22	)	)	-RRB-
cord-014462-11ggaqf1	235	23	and	and	CC
cord-014462-11ggaqf1	235	24	cardiac	cardiac	JJ
cord-014462-11ggaqf1	235	25	disease	disease	NN
cord-014462-11ggaqf1	235	26	other	other	JJ
cord-014462-11ggaqf1	235	27	than	than	IN
cord-014462-11ggaqf1	235	28	DCM	DCM	NNP
cord-014462-11ggaqf1	235	29	(	(	-LRB-
cord-014462-11ggaqf1	235	30	Group	Group	NNP
cord-014462-11ggaqf1	235	31	-	-	HYPH
cord-014462-11ggaqf1	235	32	B	B	NNP
cord-014462-11ggaqf1	235	33	)	)	-RRB-
cord-014462-11ggaqf1	235	34	were	be	VBD
cord-014462-11ggaqf1	235	35	included	include	VBN
cord-014462-11ggaqf1	235	36	in	in	IN
cord-014462-11ggaqf1	235	37	the	the	DT
cord-014462-11ggaqf1	235	38	study	study	NN
cord-014462-11ggaqf1	235	39	.	.	.
cord-014462-11ggaqf1	236	1	Expression	expression	NN
cord-014462-11ggaqf1	236	2	of	of	IN
cord-014462-11ggaqf1	236	3	CAR	car	NN
cord-014462-11ggaqf1	236	4	was	be	VBD
cord-014462-11ggaqf1	236	5	studied	study	VBN
cord-014462-11ggaqf1	236	6	by	by	IN
cord-014462-11ggaqf1	236	7	immunohistochemical	immunohistochemical	JJ
cord-014462-11ggaqf1	236	8	staining	staining	NN
cord-014462-11ggaqf1	236	9	of	of	IN
cord-014462-11ggaqf1	236	10	myocardial	myocardial	JJ
cord-014462-11ggaqf1	236	11	tissue	tissue	NN
cord-014462-11ggaqf1	236	12	using	use	VBG
cord-014462-11ggaqf1	236	13	CAR	car	NN
cord-014462-11ggaqf1	236	14	specific	specific	JJ
cord-014462-11ggaqf1	236	15	rabbit	rabbit	NN
cord-014462-11ggaqf1	236	16	polyclonal	polyclonal	JJ
cord-014462-11ggaqf1	236	17	antibody	antibody	NN
cord-014462-11ggaqf1	236	18	and	and	CC
cord-014462-11ggaqf1	236	19	biotin	biotin	NN
cord-014462-11ggaqf1	236	20	conjugated	conjugate	VBD
cord-014462-11ggaqf1	236	21	secondary	secondary	JJ
cord-014462-11ggaqf1	236	22	antibody	antibody	NN
cord-014462-11ggaqf1	236	23	.	.	.
cord-014462-11ggaqf1	237	1	The	the	DT
cord-014462-11ggaqf1	237	2	tissue	tissue	NN
cord-014462-11ggaqf1	237	3	sections	section	NNS
cord-014462-11ggaqf1	237	4	were	be	VBD
cord-014462-11ggaqf1	237	5	considered	consider	VBN
cord-014462-11ggaqf1	237	6	positive	positive	JJ
cord-014462-11ggaqf1	237	7	when[25	when[25	CD
cord-014462-11ggaqf1	237	8	%	%	NN
cord-014462-11ggaqf1	237	9	of	of	IN
cord-014462-11ggaqf1	237	10	the	the	DT
cord-014462-11ggaqf1	237	11	cell	cell	NN
cord-014462-11ggaqf1	237	12	showed	show	VBD
cord-014462-11ggaqf1	237	13	brown	brown	JJ
cord-014462-11ggaqf1	237	14	color	color	NN
cord-014462-11ggaqf1	237	15	staining	staining	NN
cord-014462-11ggaqf1	237	16	by	by	IN
cord-014462-11ggaqf1	237	17	immunohistochemistry	immunohistochemistry	NN
cord-014462-11ggaqf1	237	18	(	(	-LRB-
cord-014462-11ggaqf1	237	19	IHC	IHC	NNP
cord-014462-11ggaqf1	237	20	)	)	-RRB-
cord-014462-11ggaqf1	237	21	.	.	.
cord-014462-11ggaqf1	238	1	The	the	DT
cord-014462-11ggaqf1	238	2	CAR	car	NN
cord-014462-11ggaqf1	238	3	positivity	positivity	NN
cord-014462-11ggaqf1	238	4	in	in	IN
cord-014462-11ggaqf1	238	5	DCM	DCM	NNP
cord-014462-11ggaqf1	238	6	cases	case	NNS
cord-014462-11ggaqf1	238	7	was	be	VBD
cord-014462-11ggaqf1	238	8	found	find	VBN
cord-014462-11ggaqf1	238	9	to	to	TO
cord-014462-11ggaqf1	238	10	be	be	VB
cord-014462-11ggaqf1	238	11	96	96	CD
cord-014462-11ggaqf1	238	12	%	%	NN
cord-014462-11ggaqf1	238	13	(	(	-LRB-
cord-014462-11ggaqf1	238	14	25/	25/	CD
cord-014462-11ggaqf1	238	15	26	26	CD
cord-014462-11ggaqf1	238	16	)	)	-RRB-
cord-014462-11ggaqf1	238	17	as	as	IN
cord-014462-11ggaqf1	238	18	compared	compare	VBN
cord-014462-11ggaqf1	238	19	to	to	IN
cord-014462-11ggaqf1	238	20	30	30	CD
cord-014462-11ggaqf1	238	21	%	%	NN
cord-014462-11ggaqf1	238	22	in	in	IN
cord-014462-11ggaqf1	238	23	control	control	NN
cord-014462-11ggaqf1	238	24	group	group	NN
cord-014462-11ggaqf1	238	25	A	A	NNP
cord-014462-11ggaqf1	238	26	and	and	CC
cord-014462-11ggaqf1	238	27	40	40	CD
cord-014462-11ggaqf1	238	28	%	%	NN
cord-014462-11ggaqf1	238	29	in	in	IN
cord-014462-11ggaqf1	238	30	control	control	NN
cord-014462-11ggaqf1	238	31	group	group	NN
cord-014462-11ggaqf1	238	32	B	B	NNP
cord-014462-11ggaqf1	238	33	respectively	respectively	RB
cord-014462-11ggaqf1	238	34	.	.	.
cord-014462-11ggaqf1	239	1	The	the	DT
cord-014462-11ggaqf1	239	2	CAR	car	NN
cord-014462-11ggaqf1	239	3	positivity	positivity	NN
cord-014462-11ggaqf1	239	4	was	be	VBD
cord-014462-11ggaqf1	239	5	significantly	significantly	RB
cord-014462-11ggaqf1	239	6	higher	high	JJR
cord-014462-11ggaqf1	239	7	in	in	IN
cord-014462-11ggaqf1	239	8	the	the	DT
cord-014462-11ggaqf1	239	9	test	test	NN
cord-014462-11ggaqf1	239	10	group	group	NN
cord-014462-11ggaqf1	239	11	as	as	IN
cord-014462-11ggaqf1	239	12	compared	compare	VBN
cord-014462-11ggaqf1	239	13	to	to	IN
cord-014462-11ggaqf1	239	14	both	both	CC
cord-014462-11ggaqf1	239	15	the	the	DT
cord-014462-11ggaqf1	239	16	control	control	NN
cord-014462-11ggaqf1	239	17	groups	group	NNS
cord-014462-11ggaqf1	239	18	.	.	.
cord-014462-11ggaqf1	240	1	Further	further	JJ
cord-014462-11ggaqf1	240	2	CAR	car	NN
cord-014462-11ggaqf1	240	3	positivity	positivity	NN
cord-014462-11ggaqf1	240	4	in	in	IN
cord-014462-11ggaqf1	240	5	all	all	PDT
cord-014462-11ggaqf1	240	6	the	the	DT
cord-014462-11ggaqf1	240	7	cellular	cellular	JJ
cord-014462-11ggaqf1	240	8	types	type	NNS
cord-014462-11ggaqf1	240	9	(	(	-LRB-
cord-014462-11ggaqf1	240	10	myocytes	myocyte	NNS
cord-014462-11ggaqf1	240	11	,	,	,
cord-014462-11ggaqf1	240	12	endothelial	endothelial	JJ
cord-014462-11ggaqf1	240	13	cells	cell	NNS
cord-014462-11ggaqf1	240	14	and	and	CC
cord-014462-11ggaqf1	240	15	interstitial	interstitial	JJ
cord-014462-11ggaqf1	240	16	cells	cell	NNS
cord-014462-11ggaqf1	240	17	)	)	-RRB-
cord-014462-11ggaqf1	240	18	was	be	VBD
cord-014462-11ggaqf1	240	19	found	find	VBN
cord-014462-11ggaqf1	240	20	significantly	significantly	RB
cord-014462-11ggaqf1	240	21	higher	high	JJR
cord-014462-11ggaqf1	240	22	in	in	IN
cord-014462-11ggaqf1	240	23	test	test	NN
cord-014462-11ggaqf1	240	24	group	group	NN
cord-014462-11ggaqf1	240	25	as	as	IN
cord-014462-11ggaqf1	240	26	compared	compare	VBN
cord-014462-11ggaqf1	240	27	to	to	IN
cord-014462-11ggaqf1	240	28	both	both	CC
cord-014462-11ggaqf1	240	29	the	the	DT
cord-014462-11ggaqf1	240	30	control	control	NN
cord-014462-11ggaqf1	240	31	groups	group	NNS
cord-014462-11ggaqf1	240	32	.	.	.
cord-014462-11ggaqf1	241	1	The	the	DT
cord-014462-11ggaqf1	241	2	expression	expression	NN
cord-014462-11ggaqf1	241	3	of	of	IN
cord-014462-11ggaqf1	241	4	CAR	car	NN
cord-014462-11ggaqf1	241	5	was	be	VBD
cord-014462-11ggaqf1	241	6	significantly	significantly	RB
cord-014462-11ggaqf1	241	7	higher	high	JJR
cord-014462-11ggaqf1	241	8	in	in	IN
cord-014462-11ggaqf1	241	9	myocytes	myocyte	NNS
cord-014462-11ggaqf1	241	10	as	as	IN
cord-014462-11ggaqf1	241	11	compared	compare	VBN
cord-014462-11ggaqf1	241	12	to	to	IN
cord-014462-11ggaqf1	241	13	both	both	CC
cord-014462-11ggaqf1	241	14	endothelial	endothelial	JJ
cord-014462-11ggaqf1	241	15	and	and	CC
cord-014462-11ggaqf1	241	16	interstitial	interstitial	JJ
cord-014462-11ggaqf1	241	17	cells	cell	NNS
cord-014462-11ggaqf1	241	18	in	in	IN
cord-014462-11ggaqf1	241	19	all	all	PDT
cord-014462-11ggaqf1	241	20	the	the	DT
cord-014462-11ggaqf1	241	21	groups	group	NNS
cord-014462-11ggaqf1	241	22	.	.	.
cord-014462-11ggaqf1	242	1	However	however	RB
cord-014462-11ggaqf1	242	2	,	,	,
cord-014462-11ggaqf1	242	3	no	no	DT
cord-014462-11ggaqf1	242	4	significant	significant	JJ
cord-014462-11ggaqf1	242	5	difference	difference	NN
cord-014462-11ggaqf1	242	6	was	be	VBD
cord-014462-11ggaqf1	242	7	observed	observe	VBN
cord-014462-11ggaqf1	242	8	in	in	IN
cord-014462-11ggaqf1	242	9	CAR	car	NN
cord-014462-11ggaqf1	242	10	positivity	positivity	NN
cord-014462-11ggaqf1	242	11	between	between	IN
cord-014462-11ggaqf1	242	12	endothelial	endothelial	JJ
cord-014462-11ggaqf1	242	13	and	and	CC
cord-014462-11ggaqf1	242	14	interstitial	interstitial	JJ
cord-014462-11ggaqf1	242	15	cells	cell	NNS
cord-014462-11ggaqf1	242	16	.	.	.
cord-014462-11ggaqf1	243	1	The	the	DT
cord-014462-11ggaqf1	243	2	present	present	JJ
cord-014462-11ggaqf1	243	3	study	study	NN
cord-014462-11ggaqf1	243	4	highlights	highlight	VBZ
cord-014462-11ggaqf1	243	5	the	the	DT
cord-014462-11ggaqf1	243	6	increased	increase	VBN
cord-014462-11ggaqf1	243	7	expression	expression	NN
cord-014462-11ggaqf1	243	8	of	of	IN
cord-014462-11ggaqf1	243	9	CAR	car	NN
cord-014462-11ggaqf1	243	10	in	in	IN
cord-014462-11ggaqf1	243	11	DCM	DCM	NNP
cord-014462-11ggaqf1	243	12	cases	case	NNS
cord-014462-11ggaqf1	243	13	with	with	IN
cord-014462-11ggaqf1	243	14	further	further	JJ
cord-014462-11ggaqf1	243	15	significance	significance	NN
cord-014462-11ggaqf1	243	16	of	of	IN
cord-014462-11ggaqf1	243	17	CAR	car	NN
cord-014462-11ggaqf1	243	18	expression	expression	NN
cord-014462-11ggaqf1	243	19	in	in	IN
cord-014462-11ggaqf1	243	20	myocytes	myocyte	NNS
cord-014462-11ggaqf1	243	21	and	and	CC
cord-014462-11ggaqf1	243	22	endothelial	endothelial	JJ
cord-014462-11ggaqf1	243	23	cells	cell	NNS
cord-014462-11ggaqf1	243	24	.	.	.
cord-014462-11ggaqf1	244	1	This	this	DT
cord-014462-11ggaqf1	244	2	may	may	MD
cord-014462-11ggaqf1	244	3	help	help	VB
cord-014462-11ggaqf1	244	4	further	far	RBR
cord-014462-11ggaqf1	244	5	in	in	IN
cord-014462-11ggaqf1	244	6	understanding	understand	VBG
cord-014462-11ggaqf1	244	7	the	the	DT
cord-014462-11ggaqf1	244	8	tropism	tropism	NN
cord-014462-11ggaqf1	244	9	of	of	IN
cord-014462-11ggaqf1	244	10	viruses	virus	NNS
cord-014462-11ggaqf1	244	11	or	or	CC
cord-014462-11ggaqf1	244	12	cellular	cellular	JJ
cord-014462-11ggaqf1	244	13	susceptibility	susceptibility	NN
cord-014462-11ggaqf1	244	14	,	,	,
cord-014462-11ggaqf1	244	15	which	which	WDT
cord-014462-11ggaqf1	244	16	in	in	IN
cord-014462-11ggaqf1	244	17	turn	turn	NN
cord-014462-11ggaqf1	244	18	will	will	MD
cord-014462-11ggaqf1	244	19	help	help	VB
cord-014462-11ggaqf1	244	20	in	in	IN
cord-014462-11ggaqf1	244	21	appropriate	appropriate	JJ
cord-014462-11ggaqf1	244	22	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	244	23	and	and	CC
cord-014462-11ggaqf1	244	24	therapeutic	therapeutic	JJ
cord-014462-11ggaqf1	244	25	approach	approach	NN
cord-014462-11ggaqf1	244	26	in	in	IN
cord-014462-11ggaqf1	244	27	management	management	NN
cord-014462-11ggaqf1	244	28	of	of	IN
cord-014462-11ggaqf1	244	29	viral	viral	JJ
cord-014462-11ggaqf1	244	30	myocarditis	myocarditis	NN
cord-014462-11ggaqf1	244	31	and	and	CC
cord-014462-11ggaqf1	244	32	DCM	DCM	NNP
cord-014462-11ggaqf1	244	33	cases	case	NNS
cord-014462-11ggaqf1	244	34	.	.	.
cord-014462-11ggaqf1	245	1	Food	Food	NNP
cord-014462-11ggaqf1	245	2	Security	Security	NNP
cord-014462-11ggaqf1	245	3	and	and	CC
cord-014462-11ggaqf1	245	4	Safety	Safety	NNP
cord-014462-11ggaqf1	245	5	vary	vary	VBP
cord-014462-11ggaqf1	245	6	widely	widely	RB
cord-014462-11ggaqf1	245	7	around	around	IN
cord-014462-11ggaqf1	245	8	the	the	DT
cord-014462-11ggaqf1	245	9	world	world	NN
cord-014462-11ggaqf1	245	10	,	,	,
cord-014462-11ggaqf1	245	11	and	and	CC
cord-014462-11ggaqf1	245	12	reaching	reach	VBG
cord-014462-11ggaqf1	245	13	these	these	DT
cord-014462-11ggaqf1	245	14	goals	goal	NNS
cord-014462-11ggaqf1	245	15	is	be	VBZ
cord-014462-11ggaqf1	245	16	one	one	CD
cord-014462-11ggaqf1	245	17	of	of	IN
cord-014462-11ggaqf1	245	18	the	the	DT
cord-014462-11ggaqf1	245	19	major	major	JJ
cord-014462-11ggaqf1	245	20	challenges	challenge	NNS
cord-014462-11ggaqf1	245	21	,	,	,
cord-014462-11ggaqf1	245	22	raising	raise	VBG
cord-014462-11ggaqf1	245	23	public	public	JJ
cord-014462-11ggaqf1	245	24	concern	concern	NN
cord-014462-11ggaqf1	245	25	for	for	IN
cord-014462-11ggaqf1	245	26	the	the	DT
cord-014462-11ggaqf1	245	27	wellbeing	wellbeing	NN
cord-014462-11ggaqf1	245	28	of	of	IN
cord-014462-11ggaqf1	245	29	mankind	mankind	NN
cord-014462-11ggaqf1	245	30	,	,	,
cord-014462-11ggaqf1	245	31	in	in	IN
cord-014462-11ggaqf1	245	32	particular	particular	JJ
cord-014462-11ggaqf1	245	33	.	.	.
cord-014462-11ggaqf1	246	1	Industrialized	industrialize	VBN
cord-014462-11ggaqf1	246	2	production	production	NN
cord-014462-11ggaqf1	246	3	and	and	CC
cord-014462-11ggaqf1	246	4	processing	processing	NN
cord-014462-11ggaqf1	246	5	as	as	RB
cord-014462-11ggaqf1	246	6	well	well	RB
cord-014462-11ggaqf1	246	7	as	as	IN
cord-014462-11ggaqf1	246	8	improper	improper	JJ
cord-014462-11ggaqf1	246	9	environmental	environmental	JJ
cord-014462-11ggaqf1	246	10	protection	protection	NN
cord-014462-11ggaqf1	246	11	have	have	VBP
cord-014462-11ggaqf1	246	12	clearly	clearly	RB
cord-014462-11ggaqf1	246	13	shown	show	VBN
cord-014462-11ggaqf1	246	14	severe	severe	JJ
cord-014462-11ggaqf1	246	15	limitations	limitation	NNS
cord-014462-11ggaqf1	246	16	such	such	JJ
cord-014462-11ggaqf1	246	17	as	as	IN
cord-014462-11ggaqf1	246	18	worldwide	worldwide	JJ
cord-014462-11ggaqf1	246	19	contamination	contamination	NN
cord-014462-11ggaqf1	246	20	of	of	IN
cord-014462-11ggaqf1	246	21	the	the	DT
cord-014462-11ggaqf1	246	22	food	food	NN
cord-014462-11ggaqf1	246	23	chain	chain	NN
cord-014462-11ggaqf1	246	24	and	and	CC
cord-014462-11ggaqf1	246	25	water	water	NN
cord-014462-11ggaqf1	246	26	.	.	.
cord-014462-11ggaqf1	247	1	Contaminated	contaminated	JJ
cord-014462-11ggaqf1	247	2	water	water	NN
cord-014462-11ggaqf1	247	3	and	and	CC
cord-014462-11ggaqf1	247	4	food	food	NN
cord-014462-11ggaqf1	247	5	during	during	IN
cord-014462-11ggaqf1	247	6	the	the	DT
cord-014462-11ggaqf1	247	7	processes	process	NNS
cord-014462-11ggaqf1	247	8	of	of	IN
cord-014462-11ggaqf1	247	9	production	production	NN
cord-014462-11ggaqf1	247	10	,	,	,
cord-014462-11ggaqf1	247	11	processing	processing	NN
cord-014462-11ggaqf1	247	12	and	and	CC
cord-014462-11ggaqf1	247	13	handling	handling	NN
cord-014462-11ggaqf1	247	14	are	be	VBP
cord-014462-11ggaqf1	247	15	essentially	essentially	RB
cord-014462-11ggaqf1	247	16	responsible	responsible	JJ
cord-014462-11ggaqf1	247	17	for	for	IN
cord-014462-11ggaqf1	247	18	food	food	NN
cord-014462-11ggaqf1	247	19	and	and	CC
cord-014462-11ggaqf1	247	20	water	water	NN
cord-014462-11ggaqf1	248	1	borne	bear	VBN
cord-014462-11ggaqf1	248	2	viral	viral	JJ
cord-014462-11ggaqf1	248	3	infections	infection	NNS
cord-014462-11ggaqf1	248	4	/	/	SYM
cord-014462-11ggaqf1	248	5	diseases	disease	NNS
cord-014462-11ggaqf1	248	6	.	.	.
cord-014462-11ggaqf1	249	1	The	the	DT
cord-014462-11ggaqf1	249	2	cases	case	NNS
cord-014462-11ggaqf1	249	3	of	of	IN
cord-014462-11ggaqf1	249	4	viral	viral	JJ
cord-014462-11ggaqf1	249	5	food	food	NN
cord-014462-11ggaqf1	249	6	borne	bear	VBN
cord-014462-11ggaqf1	249	7	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	249	8	are	be	VBP
cord-014462-11ggaqf1	249	9	on	on	IN
cord-014462-11ggaqf1	249	10	the	the	DT
cord-014462-11ggaqf1	249	11	rise	rise	NN
cord-014462-11ggaqf1	249	12	,	,	,
cord-014462-11ggaqf1	249	13	creating	create	VBG
cord-014462-11ggaqf1	249	14	a	a	DT
cord-014462-11ggaqf1	249	15	threat	threat	NN
cord-014462-11ggaqf1	249	16	to	to	IN
cord-014462-11ggaqf1	249	17	human	human	JJ
cord-014462-11ggaqf1	249	18	health	health	NN
cord-014462-11ggaqf1	249	19	.	.	.
cord-014462-11ggaqf1	250	1	Recent	recent	JJ
cord-014462-11ggaqf1	250	2	researches	research	NNS
cord-014462-11ggaqf1	250	3	indicate	indicate	VBP
cord-014462-11ggaqf1	250	4	that	that	IN
cord-014462-11ggaqf1	250	5	epidemiological	epidemiological	JJ
cord-014462-11ggaqf1	250	6	studies	study	NNS
cord-014462-11ggaqf1	250	7	are	be	VBP
cord-014462-11ggaqf1	250	8	meager	meager	JJ
cord-014462-11ggaqf1	250	9	to	to	TO
cord-014462-11ggaqf1	250	10	focus	focus	VB
cord-014462-11ggaqf1	250	11	the	the	DT
cord-014462-11ggaqf1	250	12	frequently	frequently	RB
cord-014462-11ggaqf1	250	13	contaminated	contaminate	VBN
cord-014462-11ggaqf1	250	14	foods	food	NNS
cord-014462-11ggaqf1	250	15	and	and	CC
cord-014462-11ggaqf1	250	16	food	food	NN
cord-014462-11ggaqf1	250	17	borne	bear	VBN
cord-014462-11ggaqf1	250	18	viral	viral	JJ
cord-014462-11ggaqf1	250	19	diseases	disease	NNS
cord-014462-11ggaqf1	250	20	.	.	.
cord-014462-11ggaqf1	251	1	Current	current	JJ
cord-014462-11ggaqf1	251	2	paper	paper	NN
cord-014462-11ggaqf1	251	3	projects	project	VBZ
cord-014462-11ggaqf1	251	4	the	the	DT
cord-014462-11ggaqf1	251	5	etiology	etiology	NN
cord-014462-11ggaqf1	251	6	of	of	IN
cord-014462-11ggaqf1	251	7	select	select	JJ
cord-014462-11ggaqf1	251	8	food	food	NN
cord-014462-11ggaqf1	251	9	borne	bear	VBD
cord-014462-11ggaqf1	251	10	viral	viral	JJ
cord-014462-11ggaqf1	251	11	diseases	disease	NNS
cord-014462-11ggaqf1	251	12	,	,	,
cord-014462-11ggaqf1	251	13	probable	probable	JJ
cord-014462-11ggaqf1	251	14	reasons	reason	NNS
cord-014462-11ggaqf1	251	15	for	for	IN
cord-014462-11ggaqf1	251	16	non	non	JJ
cord-014462-11ggaqf1	251	17	availability	availability	NN
cord-014462-11ggaqf1	251	18	of	of	IN
cord-014462-11ggaqf1	251	19	appropriate	appropriate	JJ
cord-014462-11ggaqf1	251	20	methods	method	NNS
cord-014462-11ggaqf1	251	21	to	to	TO
cord-014462-11ggaqf1	251	22	detect	detect	VB
cord-014462-11ggaqf1	251	23	the	the	DT
cord-014462-11ggaqf1	251	24	viruses	virus	NNS
cord-014462-11ggaqf1	251	25	responsible	responsible	JJ
cord-014462-11ggaqf1	251	26	for	for	IN
cord-014462-11ggaqf1	251	27	the	the	DT
cord-014462-11ggaqf1	251	28	diseases	disease	NNS
cord-014462-11ggaqf1	251	29	,	,	,
cord-014462-11ggaqf1	251	30	routes	route	NNS
cord-014462-11ggaqf1	251	31	of	of	IN
cord-014462-11ggaqf1	251	32	water	water	NN
cord-014462-11ggaqf1	251	33	and	and	CC
cord-014462-11ggaqf1	251	34	food	food	NN
cord-014462-11ggaqf1	251	35	borne	bear	VBN
cord-014462-11ggaqf1	251	36	transmission	transmission	NN
cord-014462-11ggaqf1	251	37	of	of	IN
cord-014462-11ggaqf1	251	38	enteric	enteric	JJ
cord-014462-11ggaqf1	251	39	viral	viral	JJ
cord-014462-11ggaqf1	251	40	infections	infection	NNS
cord-014462-11ggaqf1	251	41	,	,	,
cord-014462-11ggaqf1	251	42	currently	currently	RB
cord-014462-11ggaqf1	251	43	available	available	JJ
cord-014462-11ggaqf1	251	44	methods	method	NNS
cord-014462-11ggaqf1	251	45	of	of	IN
cord-014462-11ggaqf1	251	46	detection	detection	NN
cord-014462-11ggaqf1	251	47	of	of	IN
cord-014462-11ggaqf1	251	48	select	select	JJ
cord-014462-11ggaqf1	251	49	viruses	virus	NNS
cord-014462-11ggaqf1	251	50	and	and	CC
cord-014462-11ggaqf1	251	51	bio	bio	NN
cord-014462-11ggaqf1	251	52	safety	safety	NN
cord-014462-11ggaqf1	251	53	measures	measure	NNS
cord-014462-11ggaqf1	251	54	to	to	TO
cord-014462-11ggaqf1	251	55	prevent	prevent	VB
cord-014462-11ggaqf1	251	56	food	food	NN
cord-014462-11ggaqf1	251	57	borne	bear	VBN
cord-014462-11ggaqf1	251	58	viral	viral	JJ
cord-014462-11ggaqf1	251	59	infections	infection	NNS
cord-014462-11ggaqf1	251	60	.	.	.
cord-014462-11ggaqf1	252	1	Dietary	dietary	JJ
cord-014462-11ggaqf1	252	2	/	/	SYM
cord-014462-11ggaqf1	252	3	Nutritional	Nutritional	NNP
cord-014462-11ggaqf1	252	4	Management	Management	NNP
cord-014462-11ggaqf1	252	5	in	in	IN
cord-014462-11ggaqf1	252	6	food	food	NN
cord-014462-11ggaqf1	252	7	borne	bear	VBD
cord-014462-11ggaqf1	252	8	viral	viral	JJ
cord-014462-11ggaqf1	252	9	diseases	disease	NNS
cord-014462-11ggaqf1	252	10	is	be	VBZ
cord-014462-11ggaqf1	252	11	crucial	crucial	JJ
cord-014462-11ggaqf1	252	12	to	to	TO
cord-014462-11ggaqf1	252	13	control	control	VB
cord-014462-11ggaqf1	252	14	weakness	weakness	NN
cord-014462-11ggaqf1	252	15	and	and	CC
cord-014462-11ggaqf1	252	16	gastro	gastro	JJ
cord-014462-11ggaqf1	252	17	enteric	enteric	JJ
cord-014462-11ggaqf1	252	18	intolerance	intolerance	NN
cord-014462-11ggaqf1	252	19	due	due	IN
cord-014462-11ggaqf1	252	20	to	to	IN
cord-014462-11ggaqf1	252	21	disease	disease	NN
cord-014462-11ggaqf1	252	22	condition	condition	NN
cord-014462-11ggaqf1	252	23	and	and	CC
cord-014462-11ggaqf1	252	24	antibiotic	antibiotic	JJ
cord-014462-11ggaqf1	252	25	therapy	therapy	NN
cord-014462-11ggaqf1	252	26	.	.	.
cord-014462-11ggaqf1	253	1	It	-PRON-	PRP
cord-014462-11ggaqf1	253	2	will	will	MD
cord-014462-11ggaqf1	253	3	principally	principally	RB
cord-014462-11ggaqf1	253	4	improve	improve	VB
cord-014462-11ggaqf1	253	5	food	food	NN
cord-014462-11ggaqf1	253	6	intake	intake	NN
cord-014462-11ggaqf1	253	7	,	,	,
cord-014462-11ggaqf1	253	8	resulting	result	VBG
cord-014462-11ggaqf1	253	9	in	in	IN
cord-014462-11ggaqf1	253	10	better	well	JJR
cord-014462-11ggaqf1	253	11	nutritional	nutritional	JJ
cord-014462-11ggaqf1	253	12	status	status	NN
cord-014462-11ggaqf1	253	13	leading	lead	VBG
cord-014462-11ggaqf1	253	14	to	to	IN
cord-014462-11ggaqf1	253	15	optimum	optimum	JJ
cord-014462-11ggaqf1	253	16	immune	immune	JJ
cord-014462-11ggaqf1	253	17	response	response	NN
cord-014462-11ggaqf1	253	18	.	.	.
cord-014462-11ggaqf1	254	1	Food	food	NN
cord-014462-11ggaqf1	254	2	borne	bear	VBN
cord-014462-11ggaqf1	254	3	viruses	virus	NNS
cord-014462-11ggaqf1	254	4	are	be	VBP
cord-014462-11ggaqf1	254	5	mainly	mainly	RB
cord-014462-11ggaqf1	254	6	belong	belong	VBN
cord-014462-11ggaqf1	254	7	to	to	IN
cord-014462-11ggaqf1	254	8	rotaviruses	rotaviruses	NNP
cord-014462-11ggaqf1	254	9	,	,	,
cord-014462-11ggaqf1	254	10	enteropathogenic	enteropathogenic	NNP
cord-014462-11ggaqf1	254	11	viruses	virus	NNS
cord-014462-11ggaqf1	254	12	,	,	,
cord-014462-11ggaqf1	254	13	astroviruses	astroviruse	NNS
cord-014462-11ggaqf1	254	14	,	,	,
cord-014462-11ggaqf1	254	15	adenoviruses	adenovirus	NNS
cord-014462-11ggaqf1	254	16	and	and	CC
cord-014462-11ggaqf1	254	17	caliciviruses	caliciviruse	NNS
cord-014462-11ggaqf1	254	18	,	,	,
cord-014462-11ggaqf1	254	19	causes	cause	VBZ
cord-014462-11ggaqf1	254	20	acute	acute	JJ
cord-014462-11ggaqf1	254	21	gastroenteritis	gastroenteritis	NN
cord-014462-11ggaqf1	254	22	(	(	-LRB-
cord-014462-11ggaqf1	254	23	AG	AG	NNP
cord-014462-11ggaqf1	254	24	)	)	-RRB-
cord-014462-11ggaqf1	254	25	which	which	WDT
cord-014462-11ggaqf1	254	26	is	be	VBZ
cord-014462-11ggaqf1	254	27	an	an	DT
cord-014462-11ggaqf1	254	28	important	important	JJ
cord-014462-11ggaqf1	254	29	health	health	NN
cord-014462-11ggaqf1	254	30	problem	problem	NN
cord-014462-11ggaqf1	254	31	.	.	.
cord-014462-11ggaqf1	255	1	The	the	DT
cord-014462-11ggaqf1	255	2	frequency	frequency	NN
cord-014462-11ggaqf1	255	3	of	of	IN
cord-014462-11ggaqf1	255	4	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	255	5	as	as	IN
cord-014462-11ggaqf1	255	6	a	a	DT
cord-014462-11ggaqf1	255	7	cause	cause	NN
cord-014462-11ggaqf1	255	8	of	of	IN
cord-014462-11ggaqf1	255	9	sporadic	sporadic	JJ
cord-014462-11ggaqf1	255	10	cases	case	NNS
cord-014462-11ggaqf1	255	11	of	of	IN
cord-014462-11ggaqf1	255	12	AG	AG	NNP
cord-014462-11ggaqf1	255	13	ranges	range	VBZ
cord-014462-11ggaqf1	255	14	between	between	IN
cord-014462-11ggaqf1	255	15	17.3	17.3	CD
cord-014462-11ggaqf1	255	16	%	%	NN
cord-014462-11ggaqf1	255	17	and	and	CC
cord-014462-11ggaqf1	255	18	37.4	37.4	CD
cord-014462-11ggaqf1	255	19	%	%	NN
cord-014462-11ggaqf1	255	20	.	.	.
cord-014462-11ggaqf1	256	1	Astroviruses	Astroviruses	NNP
cord-014462-11ggaqf1	256	2	cause	cause	VBP
cord-014462-11ggaqf1	256	3	AG	AG	NNP
cord-014462-11ggaqf1	256	4	,	,	,
cord-014462-11ggaqf1	256	5	with	with	IN
cord-014462-11ggaqf1	256	6	a	a	DT
cord-014462-11ggaqf1	256	7	frequency	frequency	NN
cord-014462-11ggaqf1	256	8	ranging	range	VBG
cord-014462-11ggaqf1	256	9	between	between	IN
cord-014462-11ggaqf1	256	10	2	2	CD
cord-014462-11ggaqf1	256	11	and	and	CC
cord-014462-11ggaqf1	256	12	26	26	CD
cord-014462-11ggaqf1	256	13	%	%	NN
cord-014462-11ggaqf1	256	14	:	:	:
cord-014462-11ggaqf1	256	15	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	256	16	have	have	VBP
cord-014462-11ggaqf1	256	17	been	be	VBN
cord-014462-11ggaqf1	256	18	described	describe	VBN
cord-014462-11ggaqf1	256	19	in	in	IN
cord-014462-11ggaqf1	256	20	schools	school	NNS
cord-014462-11ggaqf1	256	21	and	and	CC
cord-014462-11ggaqf1	256	22	kindergartens	kindergarten	NNS
cord-014462-11ggaqf1	256	23	,	,	,
cord-014462-11ggaqf1	256	24	but	but	CC
cord-014462-11ggaqf1	256	25	also	also	RB
cord-014462-11ggaqf1	256	26	in	in	IN
cord-014462-11ggaqf1	256	27	adults	adult	NNS
cord-014462-11ggaqf1	256	28	and	and	CC
cord-014462-11ggaqf1	256	29	the	the	DT
cord-014462-11ggaqf1	256	30	elderly	elderly	JJ
cord-014462-11ggaqf1	256	31	.	.	.
cord-014462-11ggaqf1	257	1	The	the	DT
cord-014462-11ggaqf1	257	2	frequency	frequency	NN
cord-014462-11ggaqf1	257	3	of	of	IN
cord-014462-11ggaqf1	257	4	identification	identification	NN
cord-014462-11ggaqf1	257	5	of	of	IN
cord-014462-11ggaqf1	257	6	adenoviruses	adenovirus	NNS
cord-014462-11ggaqf1	257	7	40	40	CD
cord-014462-11ggaqf1	257	8	and	and	CC
cord-014462-11ggaqf1	257	9	41	41	CD
cord-014462-11ggaqf1	257	10	as	as	IN
cord-014462-11ggaqf1	257	11	causes	cause	NNS
cord-014462-11ggaqf1	257	12	of	of	IN
cord-014462-11ggaqf1	257	13	sporadic	sporadic	JJ
cord-014462-11ggaqf1	257	14	AG	AG	NNP
cord-014462-11ggaqf1	257	15	in	in	IN
cord-014462-11ggaqf1	257	16	non	non	JJ
cord-014462-11ggaqf1	257	17	-	-	JJ
cord-014462-11ggaqf1	257	18	immuno	immuno	JJ
cord-014462-11ggaqf1	257	19	suppressed	suppress	VBN
cord-014462-11ggaqf1	257	20	children	child	NNS
cord-014462-11ggaqf1	257	21	ranges	range	VBZ
cord-014462-11ggaqf1	257	22	between	between	IN
cord-014462-11ggaqf1	257	23	0.7	0.7	CD
cord-014462-11ggaqf1	257	24	%	%	NN
cord-014462-11ggaqf1	257	25	and	and	CC
cord-014462-11ggaqf1	257	26	31.5	31.5	CD
cord-014462-11ggaqf1	257	27	%	%	NN
cord-014462-11ggaqf1	257	28	,	,	,
cord-014462-11ggaqf1	257	29	although	although	IN
cord-014462-11ggaqf1	257	30	there	there	EX
cord-014462-11ggaqf1	257	31	is	be	VBZ
cord-014462-11ggaqf1	257	32	probably	probably	RB
cord-014462-11ggaqf1	257	33	underreporting	underreporte	VBG
cord-014462-11ggaqf1	257	34	because	because	IN
cord-014462-11ggaqf1	257	35	the	the	DT
cord-014462-11ggaqf1	257	36	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	257	37	of	of	IN
cord-014462-11ggaqf1	257	38	conventional	conventional	JJ
cord-014462-11ggaqf1	257	39	techniques	technique	NNS
cord-014462-11ggaqf1	257	40	is	be	VBZ
cord-014462-11ggaqf1	257	41	low	low	JJ
cord-014462-11ggaqf1	257	42	.	.	.
cord-014462-11ggaqf1	258	1	Caliciviruses	caliciviruse	NNS
cord-014462-11ggaqf1	258	2	are	be	VBP
cord-014462-11ggaqf1	258	3	separated	separate	VBN
cord-014462-11ggaqf1	258	4	phylogenetically	phylogenetically	RB
cord-014462-11ggaqf1	258	5	into	into	IN
cord-014462-11ggaqf1	258	6	two	two	CD
cord-014462-11ggaqf1	258	7	genera	genus	NNS
cord-014462-11ggaqf1	258	8	:	:	:
cord-014462-11ggaqf1	258	9	Norovirus	norovirus	NN
cord-014462-11ggaqf1	258	10	and	and	CC
cord-014462-11ggaqf1	258	11	Sapovirus	Sapovirus	NNP
cord-014462-11ggaqf1	258	12	.	.	.
cord-014462-11ggaqf1	259	1	Norovirus	norovirus	NN
cord-014462-11ggaqf1	259	2	is	be	VBZ
cord-014462-11ggaqf1	259	3	frequently	frequently	RB
cord-014462-11ggaqf1	259	4	associated	associate	VBN
cord-014462-11ggaqf1	259	5	with	with	IN
cord-014462-11ggaqf1	259	6	food	food	NN
cord-014462-11ggaqf1	259	7	-	-	HYPH
cord-014462-11ggaqf1	259	8	and	and	CC
cord-014462-11ggaqf1	259	9	water	water	NN
cord-014462-11ggaqf1	259	10	-	-	HYPH
cord-014462-11ggaqf1	259	11	borne	bear	VBN
cord-014462-11ggaqf1	259	12	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	259	13	of	of	IN
cord-014462-11ggaqf1	259	14	AG	AG	NNP
cord-014462-11ggaqf1	259	15	.	.	.
cord-014462-11ggaqf1	260	1	It	-PRON-	PRP
cord-014462-11ggaqf1	260	2	is	be	VBZ
cord-014462-11ggaqf1	260	3	estimated	estimate	VBN
cord-014462-11ggaqf1	260	4	that	that	IN
cord-014462-11ggaqf1	260	5	40	40	CD
cord-014462-11ggaqf1	260	6	%	%	NN
cord-014462-11ggaqf1	260	7	of	of	IN
cord-014462-11ggaqf1	260	8	cases	case	NNS
cord-014462-11ggaqf1	260	9	of	of	IN
cord-014462-11ggaqf1	260	10	AG	AG	NNP
cord-014462-11ggaqf1	260	11	due	due	IN
cord-014462-11ggaqf1	260	12	to	to	IN
cord-014462-11ggaqf1	260	13	norovirus	norovirus	NN
cord-014462-11ggaqf1	260	14	are	be	VBP
cord-014462-11ggaqf1	260	15	food	food	NN
cord-014462-11ggaqf1	260	16	borne	bear	VBN
cord-014462-11ggaqf1	260	17	.	.	.
cord-014462-11ggaqf1	261	1	In	in	IN
cord-014462-11ggaqf1	261	2	Sweden	Sweden	NNP
cord-014462-11ggaqf1	261	3	and	and	CC
cord-014462-11ggaqf1	261	4	some	some	DT
cord-014462-11ggaqf1	261	5	regions	region	NNS
cord-014462-11ggaqf1	261	6	of	of	IN
cord-014462-11ggaqf1	261	7	the	the	DT
cord-014462-11ggaqf1	261	8	United	United	NNP
cord-014462-11ggaqf1	261	9	States	States	NNP
cord-014462-11ggaqf1	261	10	,	,	,
cord-014462-11ggaqf1	261	11	norovirus	norovirus	NN
cord-014462-11ggaqf1	261	12	is	be	VBZ
cord-014462-11ggaqf1	261	13	the	the	DT
cord-014462-11ggaqf1	261	14	first	first	JJ
cord-014462-11ggaqf1	261	15	cause	cause	NN
cord-014462-11ggaqf1	261	16	of	of	IN
cord-014462-11ggaqf1	261	17	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	261	18	of	of	IN
cord-014462-11ggaqf1	261	19	food	food	NN
cord-014462-11ggaqf1	261	20	borne	bear	VBN
cord-014462-11ggaqf1	261	21	diseases	disease	NNS
cord-014462-11ggaqf1	261	22	.	.	.
cord-014462-11ggaqf1	262	1	Sapovirus	Sapovirus	NNP
cord-014462-11ggaqf1	262	2	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	262	3	due	due	JJ
cord-014462-11ggaqf1	262	4	to	to	IN
cord-014462-11ggaqf1	262	5	person	person	NN
cord-014462-11ggaqf1	262	6	-	-	HYPH
cord-014462-11ggaqf1	262	7	to	to	IN
cord-014462-11ggaqf1	262	8	-	-	HYPH
cord-014462-11ggaqf1	262	9	person	person	NN
cord-014462-11ggaqf1	262	10	and	and	CC
cord-014462-11ggaqf1	262	11	food	food	NN
cord-014462-11ggaqf1	262	12	borne	bear	VBN
cord-014462-11ggaqf1	262	13	transmission	transmission	NN
cord-014462-11ggaqf1	262	14	affecting	affect	VBG
cord-014462-11ggaqf1	262	15	both	both	CC
cord-014462-11ggaqf1	262	16	children	child	NNS
cord-014462-11ggaqf1	262	17	and	and	CC
cord-014462-11ggaqf1	262	18	adults	adult	NNS
cord-014462-11ggaqf1	262	19	have	have	VBP
cord-014462-11ggaqf1	262	20	recently	recently	RB
cord-014462-11ggaqf1	262	21	been	be	VBN
cord-014462-11ggaqf1	262	22	reported	report	VBN
cord-014462-11ggaqf1	262	23	in	in	IN
cord-014462-11ggaqf1	262	24	countries	country	NNS
cord-014462-11ggaqf1	262	25	such	such	JJ
cord-014462-11ggaqf1	262	26	as	as	IN
cord-014462-11ggaqf1	262	27	Canada	Canada	NNP
cord-014462-11ggaqf1	262	28	and	and	CC
cord-014462-11ggaqf1	262	29	Japan	Japan	NNP
cord-014462-11ggaqf1	262	30	.	.	.
cord-014462-11ggaqf1	263	1	It	-PRON-	PRP
cord-014462-11ggaqf1	263	2	has	have	VBZ
cord-014462-11ggaqf1	263	3	been	be	VBN
cord-014462-11ggaqf1	263	4	predicted	predict	VBN
cord-014462-11ggaqf1	263	5	that	that	IN
cord-014462-11ggaqf1	263	6	the	the	DT
cord-014462-11ggaqf1	263	7	importance	importance	NN
cord-014462-11ggaqf1	263	8	of	of	IN
cord-014462-11ggaqf1	263	9	diarrhoeal	diarrhoeal	NN
cord-014462-11ggaqf1	263	10	disease	disease	NN
cord-014462-11ggaqf1	263	11	,	,	,
cord-014462-11ggaqf1	263	12	mainly	mainly	RB
cord-014462-11ggaqf1	263	13	due	due	JJ
cord-014462-11ggaqf1	263	14	to	to	IN
cord-014462-11ggaqf1	263	15	contaminated	contaminate	VBN
cord-014462-11ggaqf1	263	16	food	food	NN
cord-014462-11ggaqf1	263	17	and	and	CC
cord-014462-11ggaqf1	263	18	water	water	NN
cord-014462-11ggaqf1	263	19	,	,	,
cord-014462-11ggaqf1	263	20	as	as	IN
cord-014462-11ggaqf1	263	21	a	a	DT
cord-014462-11ggaqf1	263	22	cause	cause	NN
cord-014462-11ggaqf1	263	23	of	of	IN
cord-014462-11ggaqf1	263	24	death	death	NN
cord-014462-11ggaqf1	263	25	will	will	MD
cord-014462-11ggaqf1	263	26	decline	decline	VB
cord-014462-11ggaqf1	263	27	worldwide	worldwide	RB
cord-014462-11ggaqf1	263	28	.	.	.
cord-014462-11ggaqf1	264	1	Evidence	evidence	NN
cord-014462-11ggaqf1	264	2	for	for	IN
cord-014462-11ggaqf1	264	3	such	such	PDT
cord-014462-11ggaqf1	264	4	a	a	DT
cord-014462-11ggaqf1	264	5	downward	downward	JJ
cord-014462-11ggaqf1	264	6	trend	trend	NN
cord-014462-11ggaqf1	264	7	is	be	VBZ
cord-014462-11ggaqf1	264	8	limited	limit	VBN
cord-014462-11ggaqf1	264	9	.	.	.
cord-014462-11ggaqf1	265	1	This	this	DT
cord-014462-11ggaqf1	265	2	prediction	prediction	NN
cord-014462-11ggaqf1	265	3	presumes	presume	VBZ
cord-014462-11ggaqf1	265	4	that	that	IN
cord-014462-11ggaqf1	265	5	improvements	improvement	NNS
cord-014462-11ggaqf1	265	6	in	in	IN
cord-014462-11ggaqf1	265	7	the	the	DT
cord-014462-11ggaqf1	265	8	production	production	NN
cord-014462-11ggaqf1	265	9	and	and	CC
cord-014462-11ggaqf1	265	10	retail	retail	NN
cord-014462-11ggaqf1	265	11	of	of	IN
cord-014462-11ggaqf1	265	12	microbiologically	microbiologically	RB
cord-014462-11ggaqf1	265	13	safe	safe	JJ
cord-014462-11ggaqf1	265	14	food	food	NN
cord-014462-11ggaqf1	265	15	will	will	MD
cord-014462-11ggaqf1	265	16	be	be	VB
cord-014462-11ggaqf1	265	17	sustained	sustain	VBN
cord-014462-11ggaqf1	265	18	in	in	IN
cord-014462-11ggaqf1	265	19	the	the	DT
cord-014462-11ggaqf1	265	20	developed	develop	VBN
cord-014462-11ggaqf1	265	21	world	world	NN
cord-014462-11ggaqf1	265	22	and	and	CC
cord-014462-11ggaqf1	265	23	,	,	,
cord-014462-11ggaqf1	265	24	moreover	moreover	RB
cord-014462-11ggaqf1	265	25	,	,	,
cord-014462-11ggaqf1	265	26	will	will	MD
cord-014462-11ggaqf1	265	27	be	be	VB
cord-014462-11ggaqf1	265	28	rolled	roll	VBN
cord-014462-11ggaqf1	265	29	out	out	RP
cord-014462-11ggaqf1	265	30	to	to	IN
cord-014462-11ggaqf1	265	31	those	those	DT
cord-014462-11ggaqf1	265	32	countries	country	NNS
cord-014462-11ggaqf1	265	33	of	of	IN
cord-014462-11ggaqf1	265	34	the	the	DT
cord-014462-11ggaqf1	265	35	developing	develop	VBG
cord-014462-11ggaqf1	265	36	world	world	NN
cord-014462-11ggaqf1	265	37	increasingly	increasingly	RB
cord-014462-11ggaqf1	265	38	producing	produce	VBG
cord-014462-11ggaqf1	265	39	food	food	NN
cord-014462-11ggaqf1	265	40	for	for	IN
cord-014462-11ggaqf1	265	41	a	a	DT
cord-014462-11ggaqf1	265	42	global	global	JJ
cord-014462-11ggaqf1	265	43	market	market	NN
cord-014462-11ggaqf1	265	44	.	.	.
cord-014462-11ggaqf1	266	1	Sustaining	sustain	VBG
cord-014462-11ggaqf1	266	2	food	food	NN
cord-014462-11ggaqf1	266	3	safety	safety	NN
cord-014462-11ggaqf1	266	4	standards	standard	NNS
cord-014462-11ggaqf1	266	5	will	will	MD
cord-014462-11ggaqf1	266	6	depend	depend	VB
cord-014462-11ggaqf1	266	7	on	on	IN
cord-014462-11ggaqf1	266	8	constant	constant	JJ
cord-014462-11ggaqf1	266	9	vigilance	vigilance	NN
cord-014462-11ggaqf1	266	10	maintained	maintain	VBN
cord-014462-11ggaqf1	266	11	by	by	IN
cord-014462-11ggaqf1	266	12	monitoring	monitoring	NN
cord-014462-11ggaqf1	266	13	and	and	CC
cord-014462-11ggaqf1	266	14	surveillance	surveillance	NN
cord-014462-11ggaqf1	266	15	but	but	CC
cord-014462-11ggaqf1	266	16	,	,	,
cord-014462-11ggaqf1	266	17	with	with	IN
cord-014462-11ggaqf1	266	18	the	the	DT
cord-014462-11ggaqf1	266	19	rising	rise	VBG
cord-014462-11ggaqf1	266	20	importance	importance	NN
cord-014462-11ggaqf1	266	21	of	of	IN
cord-014462-11ggaqf1	266	22	other	other	JJ
cord-014462-11ggaqf1	266	23	food	food	NN
cord-014462-11ggaqf1	266	24	-	-	HYPH
cord-014462-11ggaqf1	266	25	related	relate	VBN
cord-014462-11ggaqf1	266	26	issues	issue	NNS
cord-014462-11ggaqf1	266	27	,	,	,
cord-014462-11ggaqf1	266	28	such	such	JJ
cord-014462-11ggaqf1	266	29	as	as	IN
cord-014462-11ggaqf1	266	30	food	food	NN
cord-014462-11ggaqf1	266	31	security	security	NN
cord-014462-11ggaqf1	266	32	,	,	,
cord-014462-11ggaqf1	266	33	obesity	obesity	NN
cord-014462-11ggaqf1	266	34	and	and	CC
cord-014462-11ggaqf1	266	35	climate	climate	NN
cord-014462-11ggaqf1	266	36	change	change	NN
cord-014462-11ggaqf1	266	37	,	,	,
cord-014462-11ggaqf1	266	38	competition	competition	NN
cord-014462-11ggaqf1	266	39	for	for	IN
cord-014462-11ggaqf1	266	40	resources	resource	NNS
cord-014462-11ggaqf1	266	41	in	in	IN
cord-014462-11ggaqf1	266	42	the	the	DT
cord-014462-11ggaqf1	266	43	future	future	NN
cord-014462-11ggaqf1	266	44	to	to	TO
cord-014462-11ggaqf1	266	45	enable	enable	VB
cord-014462-11ggaqf1	266	46	this	this	DT
cord-014462-11ggaqf1	266	47	may	may	MD
cord-014462-11ggaqf1	266	48	be	be	VB
cord-014462-11ggaqf1	266	49	fierce	fierce	JJ
cord-014462-11ggaqf1	266	50	.	.	.
cord-014462-11ggaqf1	267	1	In	in	IN
cord-014462-11ggaqf1	267	2	addition	addition	NN
cord-014462-11ggaqf1	267	3	the	the	DT
cord-014462-11ggaqf1	267	4	pathogen	pathogen	NN
cord-014462-11ggaqf1	267	5	populations	population	NNS
cord-014462-11ggaqf1	267	6	relevant	relevant	JJ
cord-014462-11ggaqf1	267	7	to	to	IN
cord-014462-11ggaqf1	267	8	food	food	NN
cord-014462-11ggaqf1	267	9	safety	safety	NN
cord-014462-11ggaqf1	267	10	are	be	VBP
cord-014462-11ggaqf1	267	11	not	not	RB
cord-014462-11ggaqf1	267	12	static	static	JJ
cord-014462-11ggaqf1	267	13	.	.	.
cord-014462-11ggaqf1	268	1	Food	food	NN
cord-014462-11ggaqf1	268	2	is	be	VBZ
cord-014462-11ggaqf1	268	3	an	an	DT
cord-014462-11ggaqf1	268	4	excellent	excellent	JJ
cord-014462-11ggaqf1	268	5	vehicle	vehicle	NN
cord-014462-11ggaqf1	268	6	by	by	IN
cord-014462-11ggaqf1	268	7	which	which	WDT
cord-014462-11ggaqf1	268	8	many	many	JJ
cord-014462-11ggaqf1	268	9	pathogens	pathogen	NNS
cord-014462-11ggaqf1	268	10	(	(	-LRB-
cord-014462-11ggaqf1	268	11	bacteria	bacteria	NNS
cord-014462-11ggaqf1	268	12	,	,	,
cord-014462-11ggaqf1	268	13	viruses	virus	NNS
cord-014462-11ggaqf1	268	14	/	/	SYM
cord-014462-11ggaqf1	268	15	prions	prion	NNS
cord-014462-11ggaqf1	268	16	and	and	CC
cord-014462-11ggaqf1	268	17	parasites	parasite	NNS
cord-014462-11ggaqf1	268	18	)	)	-RRB-
cord-014462-11ggaqf1	268	19	can	can	MD
cord-014462-11ggaqf1	268	20	reach	reach	VB
cord-014462-11ggaqf1	268	21	an	an	DT
cord-014462-11ggaqf1	268	22	appropriate	appropriate	JJ
cord-014462-11ggaqf1	268	23	colonization	colonization	NN
cord-014462-11ggaqf1	268	24	site	site	NN
cord-014462-11ggaqf1	268	25	in	in	IN
cord-014462-11ggaqf1	268	26	a	a	DT
cord-014462-11ggaqf1	268	27	new	new	JJ
cord-014462-11ggaqf1	268	28	host	host	NN
cord-014462-11ggaqf1	268	29	.	.	.
cord-014462-11ggaqf1	269	1	Although	although	IN
cord-014462-11ggaqf1	269	2	food	food	NN
cord-014462-11ggaqf1	269	3	production	production	NN
cord-014462-11ggaqf1	269	4	practices	practice	NNS
cord-014462-11ggaqf1	269	5	change	change	VBP
cord-014462-11ggaqf1	269	6	,	,	,
cord-014462-11ggaqf1	269	7	the	the	DT
cord-014462-11ggaqf1	269	8	well	well	RB
cord-014462-11ggaqf1	269	9	-	-	HYPH
cord-014462-11ggaqf1	269	10	recognized	recognize	VBN
cord-014462-11ggaqf1	269	11	food	food	NN
cord-014462-11ggaqf1	269	12	-	-	HYPH
cord-014462-11ggaqf1	269	13	borne	bear	VBN
cord-014462-11ggaqf1	269	14	pathogens	pathogen	NNS
cord-014462-11ggaqf1	269	15	,	,	,
cord-014462-11ggaqf1	269	16	such	such	JJ
cord-014462-11ggaqf1	269	17	as	as	IN
cord-014462-11ggaqf1	269	18	Salmonella	Salmonella	NNP
cord-014462-11ggaqf1	269	19	spp	spp	NNP
cord-014462-11ggaqf1	269	20	.	.	.
cord-014462-11ggaqf1	270	1	and	and	CC
cord-014462-11ggaqf1	270	2	Escherichia	Escherichia	NNP
cord-014462-11ggaqf1	270	3	coli	coli	NNS
cord-014462-11ggaqf1	270	4	,	,	,
cord-014462-11ggaqf1	270	5	seem	seem	VBP
cord-014462-11ggaqf1	270	6	able	able	JJ
cord-014462-11ggaqf1	270	7	to	to	TO
cord-014462-11ggaqf1	270	8	evolve	evolve	VB
cord-014462-11ggaqf1	270	9	to	to	TO
cord-014462-11ggaqf1	270	10	exploit	exploit	VB
cord-014462-11ggaqf1	270	11	novel	novel	JJ
cord-014462-11ggaqf1	270	12	opportunities	opportunity	NNS
cord-014462-11ggaqf1	270	13	,	,	,
cord-014462-11ggaqf1	270	14	for	for	IN
cord-014462-11ggaqf1	270	15	example	example	NN
cord-014462-11ggaqf1	270	16	fresh	fresh	JJ
cord-014462-11ggaqf1	270	17	produce	produce	NN
cord-014462-11ggaqf1	270	18	and	and	CC
cord-014462-11ggaqf1	270	19	even	even	RB
cord-014462-11ggaqf1	270	20	generate	generate	VB
cord-014462-11ggaqf1	270	21	new	new	JJ
cord-014462-11ggaqf1	270	22	public	public	JJ
cord-014462-11ggaqf1	270	23	health	health	NN
cord-014462-11ggaqf1	270	24	challenges	challenge	NNS
cord-014462-11ggaqf1	270	25	,	,	,
cord-014462-11ggaqf1	270	26	for	for	IN
cord-014462-11ggaqf1	270	27	example	example	NN
cord-014462-11ggaqf1	270	28	antimicrobial	antimicrobial	JJ
cord-014462-11ggaqf1	270	29	resistance	resistance	NN
cord-014462-11ggaqf1	270	30	.	.	.
cord-014462-11ggaqf1	271	1	In	in	IN
cord-014462-11ggaqf1	271	2	addition	addition	NN
cord-014462-11ggaqf1	271	3	,	,	,
cord-014462-11ggaqf1	271	4	previously	previously	RB
cord-014462-11ggaqf1	271	5	unknown	unknown	JJ
cord-014462-11ggaqf1	271	6	food	food	NN
cord-014462-11ggaqf1	271	7	-	-	HYPH
cord-014462-11ggaqf1	271	8	borne	bear	VBN
cord-014462-11ggaqf1	271	9	pathogens	pathogen	NNS
cord-014462-11ggaqf1	271	10	,	,	,
cord-014462-11ggaqf1	271	11	many	many	JJ
cord-014462-11ggaqf1	271	12	of	of	IN
cord-014462-11ggaqf1	271	13	which	which	WDT
cord-014462-11ggaqf1	271	14	are	be	VBP
cord-014462-11ggaqf1	271	15	zoonotic	zoonotic	JJ
cord-014462-11ggaqf1	271	16	,	,	,
cord-014462-11ggaqf1	271	17	are	be	VBP
cord-014462-11ggaqf1	271	18	constantly	constantly	RB
cord-014462-11ggaqf1	271	19	emerging	emerge	VBG
cord-014462-11ggaqf1	271	20	.	.	.
cord-014462-11ggaqf1	272	1	Awareness	awareness	NN
cord-014462-11ggaqf1	272	2	and	and	CC
cord-014462-11ggaqf1	272	3	surveillance	surveillance	NN
cord-014462-11ggaqf1	272	4	of	of	IN
cord-014462-11ggaqf1	272	5	viral	viral	JJ
cord-014462-11ggaqf1	272	6	food	food	NN
cord-014462-11ggaqf1	272	7	-	-	HYPH
cord-014462-11ggaqf1	272	8	borne	bear	VBN
cord-014462-11ggaqf1	272	9	pathogens	pathogen	NNS
cord-014462-11ggaqf1	272	10	is	be	VBZ
cord-014462-11ggaqf1	272	11	generally	generally	RB
cord-014462-11ggaqf1	272	12	poor	poor	JJ
cord-014462-11ggaqf1	272	13	but	but	CC
cord-014462-11ggaqf1	272	14	emphasis	emphasis	NN
cord-014462-11ggaqf1	272	15	is	be	VBZ
cord-014462-11ggaqf1	272	16	placed	place	VBN
cord-014462-11ggaqf1	272	17	on	on	IN
cord-014462-11ggaqf1	272	18	Norovirus	Norovirus	NNP
cord-014462-11ggaqf1	272	19	,	,	,
cord-014462-11ggaqf1	272	20	Hepatitis	Hepatitis	NNP
cord-014462-11ggaqf1	272	21	A	A	NNP
cord-014462-11ggaqf1	272	22	,	,	,
cord-014462-11ggaqf1	272	23	rotaviruses	rotavirus	NNS
cord-014462-11ggaqf1	272	24	and	and	CC
cord-014462-11ggaqf1	272	25	newly	newly	RB
cord-014462-11ggaqf1	272	26	emerging	emerge	VBG
cord-014462-11ggaqf1	272	27	viruses	virus	NNS
cord-014462-11ggaqf1	272	28	such	such	JJ
cord-014462-11ggaqf1	272	29	as	as	IN
cord-014462-11ggaqf1	272	30	SARS	SARS	NNP
cord-014462-11ggaqf1	272	31	.	.	.
cord-014462-11ggaqf1	273	1	It	-PRON-	PRP
cord-014462-11ggaqf1	273	2	is	be	VBZ
cord-014462-11ggaqf1	273	3	clear	clear	JJ
cord-014462-11ggaqf1	273	4	that	that	IN
cord-014462-11ggaqf1	273	5	one	one	CD
cord-014462-11ggaqf1	273	6	overall	overall	JJ
cord-014462-11ggaqf1	273	7	challenge	challenge	NN
cord-014462-11ggaqf1	273	8	is	be	VBZ
cord-014462-11ggaqf1	273	9	the	the	DT
cord-014462-11ggaqf1	273	10	generation	generation	NN
cord-014462-11ggaqf1	273	11	and	and	CC
cord-014462-11ggaqf1	273	12	maintenance	maintenance	NN
cord-014462-11ggaqf1	273	13	of	of	IN
cord-014462-11ggaqf1	273	14	constructive	constructive	JJ
cord-014462-11ggaqf1	273	15	dialogue	dialogue	NN
cord-014462-11ggaqf1	273	16	and	and	CC
cord-014462-11ggaqf1	273	17	collaboration	collaboration	NN
cord-014462-11ggaqf1	273	18	between	between	IN
cord-014462-11ggaqf1	273	19	public	public	JJ
cord-014462-11ggaqf1	273	20	health	health	NN
cord-014462-11ggaqf1	273	21	,	,	,
cord-014462-11ggaqf1	273	22	veterinary	veterinary	NN
cord-014462-11ggaqf1	273	23	and	and	CC
cord-014462-11ggaqf1	273	24	food	food	NN
cord-014462-11ggaqf1	273	25	safety	safety	NN
cord-014462-11ggaqf1	273	26	experts	expert	NNS
cord-014462-11ggaqf1	273	27	,	,	,
cord-014462-11ggaqf1	273	28	bringing	bring	VBG
cord-014462-11ggaqf1	273	29	together	together	RB
cord-014462-11ggaqf1	273	30	multidisciplinary	multidisciplinary	JJ
cord-014462-11ggaqf1	273	31	skills	skill	NNS
cord-014462-11ggaqf1	273	32	and	and	CC
cord-014462-11ggaqf1	273	33	multi	multi	JJ
cord-014462-11ggaqf1	273	34	-	-	JJ
cord-014462-11ggaqf1	273	35	pathogen	pathogen	NN
cord-014462-11ggaqf1	273	36	expertise	expertise	NN
cord-014462-11ggaqf1	273	37	.	.	.
cord-014462-11ggaqf1	274	1	Such	such	JJ
cord-014462-11ggaqf1	274	2	collaboration	collaboration	NN
cord-014462-11ggaqf1	274	3	is	be	VBZ
cord-014462-11ggaqf1	274	4	essential	essential	JJ
cord-014462-11ggaqf1	274	5	to	to	TO
cord-014462-11ggaqf1	274	6	monitor	monitor	VB
cord-014462-11ggaqf1	274	7	changing	change	VBG
cord-014462-11ggaqf1	274	8	trends	trend	NNS
cord-014462-11ggaqf1	274	9	in	in	IN
cord-014462-11ggaqf1	274	10	the	the	DT
cord-014462-11ggaqf1	274	11	well	well	RB
cord-014462-11ggaqf1	274	12	-	-	HYPH
cord-014462-11ggaqf1	274	13	recognized	recognize	VBN
cord-014462-11ggaqf1	274	14	diseases	disease	NNS
cord-014462-11ggaqf1	274	15	and	and	CC
cord-014462-11ggaqf1	274	16	detect	detect	VB
cord-014462-11ggaqf1	274	17	emerging	emerge	VBG
cord-014462-11ggaqf1	274	18	pathogens	pathogen	NNS
cord-014462-11ggaqf1	274	19	.	.	.
cord-014462-11ggaqf1	275	1	It	-PRON-	PRP
cord-014462-11ggaqf1	275	2	is	be	VBZ
cord-014462-11ggaqf1	275	3	also	also	RB
cord-014462-11ggaqf1	275	4	necessary	necessary	JJ
cord-014462-11ggaqf1	275	5	to	to	TO
cord-014462-11ggaqf1	275	6	understand	understand	VB
cord-014462-11ggaqf1	275	7	the	the	DT
cord-014462-11ggaqf1	275	8	multiple	multiple	JJ
cord-014462-11ggaqf1	275	9	interactions	interaction	NNS
cord-014462-11ggaqf1	275	10	between	between	IN
cord-014462-11ggaqf1	275	11	these	these	DT
cord-014462-11ggaqf1	275	12	pathogens	pathogen	NNS
cord-014462-11ggaqf1	275	13	and	and	CC
cord-014462-11ggaqf1	275	14	their	-PRON-	PRP$
cord-014462-11ggaqf1	275	15	environments	environment	NNS
cord-014462-11ggaqf1	275	16	during	during	IN
cord-014462-11ggaqf1	275	17	transmission	transmission	NN
cord-014462-11ggaqf1	275	18	along	along	IN
cord-014462-11ggaqf1	275	19	the	the	DT
cord-014462-11ggaqf1	275	20	food	food	NN
cord-014462-11ggaqf1	275	21	chain	chain	NN
cord-014462-11ggaqf1	275	22	in	in	IN
cord-014462-11ggaqf1	275	23	order	order	NN
cord-014462-11ggaqf1	275	24	to	to	TO
cord-014462-11ggaqf1	275	25	develop	develop	VB
cord-014462-11ggaqf1	275	26	effective	effective	JJ
cord-014462-11ggaqf1	275	27	prevention	prevention	NN
cord-014462-11ggaqf1	275	28	and	and	CC
cord-014462-11ggaqf1	275	29	control	control	NN
cord-014462-11ggaqf1	275	30	strategies	strategy	NNS
cord-014462-11ggaqf1	275	31	.	.	.
cord-014462-11ggaqf1	276	1	To	to	TO
cord-014462-11ggaqf1	276	2	analyse	analyse	VB
cord-014462-11ggaqf1	276	3	the	the	DT
cord-014462-11ggaqf1	276	4	effectiveness	effectiveness	NN
cord-014462-11ggaqf1	276	5	of	of	IN
cord-014462-11ggaqf1	276	6	these	these	DT
cord-014462-11ggaqf1	276	7	siRNAs	siRNAs	NNP
cord-014462-11ggaqf1	276	8	targeting	target	VBG
cord-014462-11ggaqf1	276	9	rabies	rabies	NN
cord-014462-11ggaqf1	276	10	virus	virus	NN
cord-014462-11ggaqf1	276	11	L	L	NNP
cord-014462-11ggaqf1	276	12	gene	gene	NN
cord-014462-11ggaqf1	276	13	,	,	,
cord-014462-11ggaqf1	276	14	the	the	DT
cord-014462-11ggaqf1	276	15	BHK-21	BHK-21	NNP
cord-014462-11ggaqf1	276	16	cells	cell	NNS
cord-014462-11ggaqf1	276	17	expressing	express	VBG
cord-014462-11ggaqf1	276	18	siRNAs	siRNAs	NNP
cord-014462-11ggaqf1	276	19	in	in	IN
cord-014462-11ggaqf1	276	20	shRNA	shrna	NN
cord-014462-11ggaqf1	276	21	form	form	NN
cord-014462-11ggaqf1	276	22	were	be	VBD
cord-014462-11ggaqf1	276	23	produced	produce	VBN
cord-014462-11ggaqf1	276	24	by	by	IN
cord-014462-11ggaqf1	276	25	transduction	transduction	NN
cord-014462-11ggaqf1	276	26	of	of	IN
cord-014462-11ggaqf1	276	27	cells	cell	NNS
cord-014462-11ggaqf1	276	28	with	with	IN
cord-014462-11ggaqf1	276	29	rAdV	rAdV	NNP
cord-014462-11ggaqf1	276	30	-	-	HYPH
cord-014462-11ggaqf1	276	31	L.	l.	NN
cord-014462-11ggaqf1	277	1	The	the	DT
cord-014462-11ggaqf1	277	2	transduced	transduce	VBN
cord-014462-11ggaqf1	277	3	BHK-21	BHK-21	NNP
cord-014462-11ggaqf1	277	4	cells	cell	NNS
cord-014462-11ggaqf1	277	5	expressing	express	VBG
cord-014462-11ggaqf1	277	6	siRNA	siRNA	NNP
cord-014462-11ggaqf1	277	7	were	be	VBD
cord-014462-11ggaqf1	277	8	infected	infect	VBN
cord-014462-11ggaqf1	277	9	with	with	IN
cord-014462-11ggaqf1	277	10	rabies	rabie	NNS
cord-014462-11ggaqf1	277	11	virus	virus	NN
cord-014462-11ggaqf1	277	12	PV-11	PV-11	NNP
cord-014462-11ggaqf1	277	13	strain	strain	NN
cord-014462-11ggaqf1	277	14	.	.	.
cord-014462-11ggaqf1	278	1	There	there	EX
cord-014462-11ggaqf1	278	2	was	be	VBD
cord-014462-11ggaqf1	278	3	reduction	reduction	NN
cord-014462-11ggaqf1	278	4	in	in	IN
cord-014462-11ggaqf1	278	5	rabies	rabies	NN
cord-014462-11ggaqf1	278	6	virus	virus	NN
cord-014462-11ggaqf1	278	7	multiplication	multiplication	NN
cord-014462-11ggaqf1	278	8	as	as	IN
cord-014462-11ggaqf1	278	9	analysed	analyse	VBN
cord-014462-11ggaqf1	278	10	by	by	IN
cord-014462-11ggaqf1	278	11	reduction	reduction	NN
cord-014462-11ggaqf1	278	12	in	in	IN
cord-014462-11ggaqf1	278	13	fluorescent	fluorescent	JJ
cord-014462-11ggaqf1	278	14	foci	foci	NN
cord-014462-11ggaqf1	278	15	forming	form	VBG
cord-014462-11ggaqf1	278	16	unit	unit	NN
cord-014462-11ggaqf1	278	17	(	(	-LRB-
cord-014462-11ggaqf1	278	18	ffu	ffu	NNP
cord-014462-11ggaqf1	278	19	)	)	-RRB-
cord-014462-11ggaqf1	278	20	count	count	NN
cord-014462-11ggaqf1	278	21	by	by	IN
cord-014462-11ggaqf1	278	22	51.85	51.85	CD
cord-014462-11ggaqf1	278	23	%	%	NN
cord-014462-11ggaqf1	278	24	(	(	-LRB-
cord-014462-11ggaqf1	278	25	70	70	CD
cord-014462-11ggaqf1	278	26	ffu	ffu	NN
cord-014462-11ggaqf1	278	27	in	in	IN
cord-014462-11ggaqf1	278	28	BHK-21	BHK-21	NNP
cord-014462-11ggaqf1	278	29	cells	cell	NNS
cord-014462-11ggaqf1	278	30	expressing	express	VBG
cord-014462-11ggaqf1	278	31	siRNA	siRNA	NNP
cord-014462-11ggaqf1	278	32	-	-	HYPH
cord-014462-11ggaqf1	278	33	L	L	NNP
cord-014462-11ggaqf1	278	34	compared	compare	VBN
cord-014462-11ggaqf1	278	35	to	to	IN
cord-014462-11ggaqf1	278	36	135	135	CD
cord-014462-11ggaqf1	278	37	ffu	ffu	NN
cord-014462-11ggaqf1	278	38	in	in	IN
cord-014462-11ggaqf1	278	39	BHK-21	BHK-21	NNP
cord-014462-11ggaqf1	278	40	cells	cell	NNS
cord-014462-11ggaqf1	278	41	expressing	express	VBG
cord-014462-11ggaqf1	278	42	negative	negative	JJ
cord-014462-11ggaqf1	278	43	siRNA	siRNA	NNP
cord-014462-11ggaqf1	278	44	)	)	-RRB-
cord-014462-11ggaqf1	278	45	.	.	.
cord-014462-11ggaqf1	279	1	The	the	DT
cord-014462-11ggaqf1	279	2	expression	expression	NN
cord-014462-11ggaqf1	279	3	of	of	IN
cord-014462-11ggaqf1	279	4	L	L	NNP
cord-014462-11ggaqf1	279	5	gene	gene	NN
cord-014462-11ggaqf1	279	6	mRNA	mRNA	NNP
cord-014462-11ggaqf1	279	7	was	be	VBD
cord-014462-11ggaqf1	279	8	reduced	reduce	VBN
cord-014462-11ggaqf1	279	9	by	by	IN
cord-014462-11ggaqf1	279	10	16.11fold	16.11fold	CD
cord-014462-11ggaqf1	279	11	in	in	IN
cord-014462-11ggaqf1	279	12	rabies	rabies	NN
cord-014462-11ggaqf1	279	13	virus	virus	NN
cord-014462-11ggaqf1	279	14	infected	infect	VBN
cord-014462-11ggaqf1	279	15	rAdV	rAdV	NNP
cord-014462-11ggaqf1	279	16	-	-	HYPH
cord-014462-11ggaqf1	279	17	L	l	NN
cord-014462-11ggaqf1	279	18	transduced	transduce	VBD
cord-014462-11ggaqf1	279	19	cells	cell	NNS
cord-014462-11ggaqf1	279	20	compared	compare	VBN
cord-014462-11ggaqf1	279	21	to	to	IN
cord-014462-11ggaqf1	279	22	rAdV	radv	NN
cord-014462-11ggaqf1	279	23	-	-	HYPH
cord-014462-11ggaqf1	279	24	Neg	neg	NN
cord-014462-11ggaqf1	279	25	transduced	transduce	VBN
cord-014462-11ggaqf1	279	26	cells	cell	NNS
cord-014462-11ggaqf1	279	27	(	(	-LRB-
cord-014462-11ggaqf1	279	28	Negative	negative	JJ
cord-014462-11ggaqf1	279	29	control	control	NN
cord-014462-11ggaqf1	279	30	)	)	-RRB-
cord-014462-11ggaqf1	279	31	as	as	IN
cord-014462-11ggaqf1	279	32	detected	detect	VBN
cord-014462-11ggaqf1	279	33	using	use	VBG
cord-014462-11ggaqf1	279	34	real	real	JJ
cord-014462-11ggaqf1	279	35	-	-	HYPH
cord-014462-11ggaqf1	279	36	time	time	NN
cord-014462-11ggaqf1	279	37	PCR	PCR	NNP
cord-014462-11ggaqf1	279	38	.	.	.
cord-014462-11ggaqf1	280	1	After	after	IN
cord-014462-11ggaqf1	280	2	analyzing	analyze	VBG
cord-014462-11ggaqf1	280	3	the	the	DT
cord-014462-11ggaqf1	280	4	effectiveness	effectiveness	NN
cord-014462-11ggaqf1	280	5	of	of	IN
cord-014462-11ggaqf1	280	6	rAdV	radv	NN
cord-014462-11ggaqf1	280	7	-	-	HYPH
cord-014462-11ggaqf1	280	8	L	l	NN
cord-014462-11ggaqf1	280	9	in	in	IN
cord-014462-11ggaqf1	280	10	vitro	vitro	FW
cord-014462-11ggaqf1	280	11	,	,	,
cord-014462-11ggaqf1	280	12	its	-PRON-	PRP$
cord-014462-11ggaqf1	280	13	effectiveness	effectiveness	NN
cord-014462-11ggaqf1	280	14	was	be	VBD
cord-014462-11ggaqf1	280	15	also	also	RB
cord-014462-11ggaqf1	280	16	evaluated	evaluate	VBN
cord-014462-11ggaqf1	280	17	in	in	IN
cord-014462-11ggaqf1	280	18	vivo	vivo	NN
cord-014462-11ggaqf1	280	19	in	in	IN
cord-014462-11ggaqf1	280	20	mice	mouse	NNS
cord-014462-11ggaqf1	280	21	after	after	IN
cord-014462-11ggaqf1	280	22	virulent	virulent	JJ
cord-014462-11ggaqf1	280	23	rabies	rabies	NN
cord-014462-11ggaqf1	280	24	challenge	challenge	NN
cord-014462-11ggaqf1	280	25	.	.	.
cord-014462-11ggaqf1	281	1	The	the	DT
cord-014462-11ggaqf1	281	2	mice	mouse	NNS
cord-014462-11ggaqf1	281	3	were	be	VBD
cord-014462-11ggaqf1	281	4	inoculated	inoculate	VBN
cord-014462-11ggaqf1	281	5	with	with	IN
cord-014462-11ggaqf1	281	6	10	10	CD
cord-014462-11ggaqf1	281	7	7	7	CD
cord-014462-11ggaqf1	281	8	plaque	plaque	NN
cord-014462-11ggaqf1	281	9	forming	form	VBG
cord-014462-11ggaqf1	281	10	units	unit	NNS
cord-014462-11ggaqf1	281	11	(	(	-LRB-
cord-014462-11ggaqf1	281	12	PFU	pfu	NN
cord-014462-11ggaqf1	281	13	)	)	-RRB-
cord-014462-11ggaqf1	281	14	of	of	IN
cord-014462-11ggaqf1	281	15	rAdV	rAdV	NNP
cord-014462-11ggaqf1	281	16	-	-	HYPH
cord-014462-11ggaqf1	281	17	L	l	NN
cord-014462-11ggaqf1	281	18	in	in	IN
cord-014462-11ggaqf1	281	19	masseter	masseter	NN
cord-014462-11ggaqf1	281	20	muscle	muscle	NN
cord-014462-11ggaqf1	281	21	(	(	-LRB-
cord-014462-11ggaqf1	281	22	i	i	NN
cord-014462-11ggaqf1	281	23	/	/	SYM
cord-014462-11ggaqf1	281	24	m	m	NNP
cord-014462-11ggaqf1	281	25	route	route	NN
cord-014462-11ggaqf1	281	26	)	)	-RRB-
cord-014462-11ggaqf1	281	27	and	and	CC
cord-014462-11ggaqf1	281	28	challenged	challenge	VBD
cord-014462-11ggaqf1	281	29	with	with	IN
cord-014462-11ggaqf1	281	30	15	15	CD
cord-014462-11ggaqf1	281	31	LD	LD	NNP
cord-014462-11ggaqf1	281	32	50	50	CD
cord-014462-11ggaqf1	281	33	rabies	rabie	NNS
cord-014462-11ggaqf1	281	34	virus	virus	NN
cord-014462-11ggaqf1	281	35	challenge	challenge	NN
cord-014462-11ggaqf1	281	36	virus	virus	NN
cord-014462-11ggaqf1	281	37	standard	standard	NN
cord-014462-11ggaqf1	281	38	(	(	-LRB-
cord-014462-11ggaqf1	281	39	CVS	CVS	NNP
cord-014462-11ggaqf1	281	40	)	)	-RRB-
cord-014462-11ggaqf1	281	41	strain	strain	NN
cord-014462-11ggaqf1	281	42	.	.	.
cord-014462-11ggaqf1	282	1	The	the	DT
cord-014462-11ggaqf1	282	2	results	result	NNS
cord-014462-11ggaqf1	282	3	indicated	indicate	VBD
cord-014462-11ggaqf1	282	4	50	50	CD
cord-014462-11ggaqf1	282	5	%	%	NN
cord-014462-11ggaqf1	282	6	protection	protection	NN
cord-014462-11ggaqf1	282	7	with	with	IN
cord-014462-11ggaqf1	282	8	improved	improved	JJ
cord-014462-11ggaqf1	282	9	median	median	JJ
cord-014462-11ggaqf1	282	10	survival	survival	NN
cord-014462-11ggaqf1	282	11	from	from	IN
cord-014462-11ggaqf1	282	12	7	7	CD
cord-014462-11ggaqf1	282	13	to	to	TO
cord-014462-11ggaqf1	282	14	11	11	CD
cord-014462-11ggaqf1	282	15	days	day	NNS
cord-014462-11ggaqf1	282	16	compared	compare	VBN
cord-014462-11ggaqf1	282	17	with	with	IN
cord-014462-11ggaqf1	282	18	group	group	NN
cord-014462-11ggaqf1	282	19	of	of	IN
cord-014462-11ggaqf1	282	20	mice	mouse	NNS
cord-014462-11ggaqf1	282	21	treated	treat	VBN
cord-014462-11ggaqf1	282	22	with	with	IN
cord-014462-11ggaqf1	282	23	rAdV	radv	NN
cord-014462-11ggaqf1	282	24	-	-	HYPH
cord-014462-11ggaqf1	282	25	Neg	neg	NN
cord-014462-11ggaqf1	282	26	.	.	.
cord-014462-11ggaqf1	283	1	The	the	DT
cord-014462-11ggaqf1	283	2	results	result	NNS
cord-014462-11ggaqf1	283	3	of	of	IN
cord-014462-11ggaqf1	283	4	this	this	DT
cord-014462-11ggaqf1	283	5	study	study	NN
cord-014462-11ggaqf1	283	6	indicated	indicate	VBD
cord-014462-11ggaqf1	283	7	that	that	IN
cord-014462-11ggaqf1	283	8	siRNAs	siRNAs	NNP
cord-014462-11ggaqf1	283	9	targeting	target	VBG
cord-014462-11ggaqf1	283	10	rabies	rabies	NN
cord-014462-11ggaqf1	283	11	virus	virus	NN
cord-014462-11ggaqf1	283	12	polymerase	polymerase	NN
cord-014462-11ggaqf1	283	13	(	(	-LRB-
cord-014462-11ggaqf1	283	14	L	L	NNP
cord-014462-11ggaqf1	283	15	)	)	-RRB-
cord-014462-11ggaqf1	283	16	gene	gene	NN
cord-014462-11ggaqf1	283	17	delivered	deliver	VBN
cord-014462-11ggaqf1	283	18	through	through	IN
cord-014462-11ggaqf1	283	19	adenoviral	adenoviral	JJ
cord-014462-11ggaqf1	283	20	vector	vector	NN
cord-014462-11ggaqf1	283	21	inhibited	inhibit	VBN
cord-014462-11ggaqf1	283	22	rabies	rabies	NN
cord-014462-11ggaqf1	283	23	virus	virus	NN
cord-014462-11ggaqf1	283	24	multiplication	multiplication	NN
cord-014462-11ggaqf1	283	25	in	in	IN
cord-014462-11ggaqf1	283	26	vitro	vitro	FW
cord-014462-11ggaqf1	283	27	and	and	CC
cord-014462-11ggaqf1	283	28	in	in	IN
cord-014462-11ggaqf1	283	29	vivo	vivo	NNP
cord-014462-11ggaqf1	283	30	.	.	.
cord-014462-11ggaqf1	284	1	and	and	CC
cord-014462-11ggaqf1	284	2	4	4	CD
cord-014462-11ggaqf1	284	3	were	be	VBD
cord-014462-11ggaqf1	284	4	successfully	successfully	RB
cord-014462-11ggaqf1	284	5	produced	produce	VBN
cord-014462-11ggaqf1	284	6	and	and	CC
cord-014462-11ggaqf1	284	7	purified	purify	VBN
cord-014462-11ggaqf1	284	8	from	from	IN
cord-014462-11ggaqf1	284	9	the	the	DT
cord-014462-11ggaqf1	284	10	infected	infected	JJ
cord-014462-11ggaqf1	284	11	Spodoptera	Spodoptera	NNP
cord-014462-11ggaqf1	284	12	frugiperda	frugiperda	NN
cord-014462-11ggaqf1	284	13	(	(	-LRB-
cord-014462-11ggaqf1	284	14	Sf-9	Sf-9	NNP
cord-014462-11ggaqf1	284	15	)	)	-RRB-
cord-014462-11ggaqf1	284	16	cells	cell	NNS
cord-014462-11ggaqf1	284	17	using	use	VBG
cord-014462-11ggaqf1	284	18	these	these	DT
cord-014462-11ggaqf1	284	19	recombinant	recombinant	JJ
cord-014462-11ggaqf1	284	20	baculovirus	baculovirus	NN
cord-014462-11ggaqf1	284	21	.	.	.
cord-014462-11ggaqf1	285	1	The	the	DT
cord-014462-11ggaqf1	285	2	morphology	morphology	NN
cord-014462-11ggaqf1	285	3	of	of	IN
cord-014462-11ggaqf1	285	4	the	the	DT
cord-014462-11ggaqf1	285	5	VLPs	vlp	NNS
cord-014462-11ggaqf1	285	6	was	be	VBD
cord-014462-11ggaqf1	285	7	validated	validate	VBN
cord-014462-11ggaqf1	285	8	by	by	IN
cord-014462-11ggaqf1	285	9	electron	electron	NN
cord-014462-11ggaqf1	285	10	microscopy	microscopy	NN
cord-014462-11ggaqf1	285	11	in	in	IN
cord-014462-11ggaqf1	285	12	comparison	comparison	NN
cord-014462-11ggaqf1	285	13	to	to	IN
cord-014462-11ggaqf1	285	14	the	the	DT
cord-014462-11ggaqf1	285	15	authentic	authentic	JJ
cord-014462-11ggaqf1	285	16	BT	BT	NNP
cord-014462-11ggaqf1	285	17	virions	virion	NNS
cord-014462-11ggaqf1	285	18	.	.	.
cord-014462-11ggaqf1	286	1	The	the	DT
cord-014462-11ggaqf1	286	2	VLPs	vlp	NNS
cord-014462-11ggaqf1	286	3	produced	produce	VBN
cord-014462-11ggaqf1	286	4	here	here	RB
cord-014462-11ggaqf1	286	5	were	be	VBD
cord-014462-11ggaqf1	286	6	stable	stable	JJ
cord-014462-11ggaqf1	286	7	and	and	CC
cord-014462-11ggaqf1	286	8	were	be	VBD
cord-014462-11ggaqf1	286	9	highly	highly	RB
cord-014462-11ggaqf1	286	10	immunogenic	immunogenic	JJ
cord-014462-11ggaqf1	286	11	with	with	IN
cord-014462-11ggaqf1	286	12	intact	intact	JJ
cord-014462-11ggaqf1	286	13	outer	outer	JJ
cord-014462-11ggaqf1	286	14	layer	layer	NN
cord-014462-11ggaqf1	286	15	which	which	WDT
cord-014462-11ggaqf1	286	16	is	be	VBZ
cord-014462-11ggaqf1	286	17	rapidly	rapidly	RB
cord-014462-11ggaqf1	286	18	lost	lose	VBN
cord-014462-11ggaqf1	286	19	during	during	IN
cord-014462-11ggaqf1	286	20	normal	normal	JJ
cord-014462-11ggaqf1	286	21	infection	infection	NN
cord-014462-11ggaqf1	286	22	of	of	IN
cord-014462-11ggaqf1	286	23	BTV	BTV	NNP
cord-014462-11ggaqf1	286	24	.	.	.
cord-014462-11ggaqf1	287	1	These	these	DT
cord-014462-11ggaqf1	287	2	BTV	BTV	NNP
cord-014462-11ggaqf1	287	3	-	-	HYPH
cord-014462-11ggaqf1	287	4	VLPs	vlp	NNS
cord-014462-11ggaqf1	287	5	elicited	elicit	VBD
cord-014462-11ggaqf1	287	6	long	long	RB
cord-014462-11ggaqf1	287	7	lasting	last	VBG
cord-014462-11ggaqf1	287	8	protective	protective	JJ
cord-014462-11ggaqf1	287	9	immunity	immunity	NN
cord-014462-11ggaqf1	287	10	in	in	IN
cord-014462-11ggaqf1	287	11	vaccinated	vaccinated	JJ
cord-014462-11ggaqf1	287	12	sheep	sheep	NN
cord-014462-11ggaqf1	287	13	against	against	IN
cord-014462-11ggaqf1	287	14	virulent	virulent	JJ
cord-014462-11ggaqf1	287	15	virus	virus	NN
cord-014462-11ggaqf1	287	16	challenge	challenge	NN
cord-014462-11ggaqf1	287	17	.	.	.
cord-014462-11ggaqf1	288	1	With	with	IN
cord-014462-11ggaqf1	288	2	the	the	DT
cord-014462-11ggaqf1	288	3	use	use	NN
cord-014462-11ggaqf1	288	4	of	of	IN
cord-014462-11ggaqf1	288	5	BTV	BTV	NNP
cord-014462-11ggaqf1	288	6	-	-	HYPH
cord-014462-11ggaqf1	288	7	VLPs	VLPs	NNP
cord-014462-11ggaqf1	288	8	it	-PRON-	PRP
cord-014462-11ggaqf1	288	9	was	be	VBD
cord-014462-11ggaqf1	288	10	also	also	RB
cord-014462-11ggaqf1	288	11	possible	possible	JJ
cord-014462-11ggaqf1	288	12	to	to	TO
cord-014462-11ggaqf1	288	13	differentiate	differentiate	VB
cord-014462-11ggaqf1	288	14	the	the	DT
cord-014462-11ggaqf1	288	15	infected	infect	VBN
cord-014462-11ggaqf1	288	16	and	and	CC
cord-014462-11ggaqf1	288	17	vaccinated	vaccinate	VBN
cord-014462-11ggaqf1	288	18	animals	animal	NNS
cord-014462-11ggaqf1	288	19	(	(	-LRB-
cord-014462-11ggaqf1	288	20	DIVA	diva	NN
cord-014462-11ggaqf1	288	21	)	)	-RRB-
cord-014462-11ggaqf1	288	22	.	.	.
cord-014462-11ggaqf1	289	1	VLP	VLP	NNP
cord-014462-11ggaqf1	289	2	-	-	HYPH
cord-014462-11ggaqf1	289	3	based	base	VBN
cord-014462-11ggaqf1	289	4	BTV	BTV	NNP
cord-014462-11ggaqf1	289	5	vaccine	vaccine	NN
cord-014462-11ggaqf1	289	6	has	have	VBZ
cord-014462-11ggaqf1	289	7	potential	potential	JJ
cord-014462-11ggaqf1	289	8	advantages	advantage	NNS
cord-014462-11ggaqf1	289	9	with	with	IN
cord-014462-11ggaqf1	289	10	regard	regard	NN
cord-014462-11ggaqf1	289	11	to	to	IN
cord-014462-11ggaqf1	289	12	controlling	control	VBG
cord-014462-11ggaqf1	289	13	the	the	DT
cord-014462-11ggaqf1	289	14	spread	spread	NN
cord-014462-11ggaqf1	289	15	of	of	IN
cord-014462-11ggaqf1	289	16	BTV	BTV	NNP
cord-014462-11ggaqf1	289	17	with	with	IN
cord-014462-11ggaqf1	289	18	multiple	multiple	JJ
cord-014462-11ggaqf1	289	19	serotypes	serotype	NNS
cord-014462-11ggaqf1	289	20	.	.	.
cord-014462-11ggaqf1	290	1	It	-PRON-	PRP
cord-014462-11ggaqf1	290	2	is	be	VBZ
cord-014462-11ggaqf1	290	3	possible	possible	JJ
cord-014462-11ggaqf1	290	4	to	to	TO
cord-014462-11ggaqf1	290	5	produce	produce	VB
cord-014462-11ggaqf1	290	6	milligram	milligram	NN
cord-014462-11ggaqf1	290	7	quantities	quantity	NNS
cord-014462-11ggaqf1	290	8	of	of	IN
cord-014462-11ggaqf1	290	9	correctly	correctly	RB
cord-014462-11ggaqf1	290	10	folded	fold	VBN
cord-014462-11ggaqf1	290	11	and	and	CC
cord-014462-11ggaqf1	290	12	processed	process	VBN
cord-014462-11ggaqf1	290	13	protein	protein	NN
cord-014462-11ggaqf1	290	14	complexes	complex	NNS
cord-014462-11ggaqf1	290	15	using	use	VBG
cord-014462-11ggaqf1	290	16	this	this	DT
cord-014462-11ggaqf1	290	17	Baculovirus	Baculovirus	NNP
cord-014462-11ggaqf1	290	18	expression	expression	NN
cord-014462-11ggaqf1	290	19	system	system	NN
cord-014462-11ggaqf1	290	20	and	and	CC
cord-014462-11ggaqf1	290	21	hence	hence	RB
cord-014462-11ggaqf1	290	22	it	-PRON-	PRP
cord-014462-11ggaqf1	290	23	is	be	VBZ
cord-014462-11ggaqf1	290	24	a	a	DT
cord-014462-11ggaqf1	290	25	more	more	RBR
cord-014462-11ggaqf1	290	26	promising	promising	JJ
cord-014462-11ggaqf1	290	27	system	system	NN
cord-014462-11ggaqf1	290	28	for	for	IN
cord-014462-11ggaqf1	290	29	producing	produce	VBG
cord-014462-11ggaqf1	290	30	new	new	JJ
cord-014462-11ggaqf1	290	31	generation	generation	NN
cord-014462-11ggaqf1	290	32	vaccines	vaccine	NNS
cord-014462-11ggaqf1	290	33	like	like	IN
cord-014462-11ggaqf1	290	34	VLP	VLP	NNP
cord-014462-11ggaqf1	290	35	subunit	subunit	NN
cord-014462-11ggaqf1	290	36	vaccine	vaccine	NN
cord-014462-11ggaqf1	290	37	against	against	IN
cord-014462-11ggaqf1	290	38	any	any	DT
cord-014462-11ggaqf1	290	39	viral	viral	JJ
cord-014462-11ggaqf1	290	40	diseases	disease	NNS
cord-014462-11ggaqf1	290	41	in	in	IN
cord-014462-11ggaqf1	290	42	large	large	JJ
cord-014462-11ggaqf1	290	43	scale	scale	NN
cord-014462-11ggaqf1	290	44	.	.	.
cord-014462-11ggaqf1	291	1	Peste	Peste	NNP
cord-014462-11ggaqf1	291	2	des	des	FW
cord-014462-11ggaqf1	291	3	petits	petit	NNS
cord-014462-11ggaqf1	291	4	ruminants	ruminant	NNS
cord-014462-11ggaqf1	291	5	(	(	-LRB-
cord-014462-11ggaqf1	291	6	PPR	PPR	NNP
cord-014462-11ggaqf1	291	7	)	)	-RRB-
cord-014462-11ggaqf1	291	8	,	,	,
cord-014462-11ggaqf1	291	9	goatpox	goatpox	NNP
cord-014462-11ggaqf1	291	10	and	and	CC
cord-014462-11ggaqf1	291	11	ORF	ORF	NNP
cord-014462-11ggaqf1	291	12	are	be	VBP
cord-014462-11ggaqf1	291	13	OIE	OIE	NNP
cord-014462-11ggaqf1	291	14	notifiable	notifiable	JJ
cord-014462-11ggaqf1	291	15	diseases	disease	NNS
cord-014462-11ggaqf1	291	16	of	of	IN
cord-014462-11ggaqf1	291	17	small	small	JJ
cord-014462-11ggaqf1	291	18	ruminants	ruminant	NNS
cord-014462-11ggaqf1	291	19	especially	especially	RB
cord-014462-11ggaqf1	291	20	goat	goat	NN
cord-014462-11ggaqf1	291	21	and	and	CC
cord-014462-11ggaqf1	291	22	sheep	sheep	NNS
cord-014462-11ggaqf1	291	23	.	.	.
cord-014462-11ggaqf1	292	1	These	these	DT
cord-014462-11ggaqf1	292	2	diseases	disease	NNS
cord-014462-11ggaqf1	292	3	are	be	VBP
cord-014462-11ggaqf1	292	4	economically	economically	RB
cord-014462-11ggaqf1	292	5	important	important	JJ
cord-014462-11ggaqf1	292	6	,	,	,
cord-014462-11ggaqf1	292	7	in	in	IN
cord-014462-11ggaqf1	292	8	enzootic	enzootic	JJ
cord-014462-11ggaqf1	292	9	countries	country	NNS
cord-014462-11ggaqf1	292	10	like	like	IN
cord-014462-11ggaqf1	292	11	India	India	NNP
cord-014462-11ggaqf1	292	12	and	and	CC
cord-014462-11ggaqf1	292	13	cause	cause	VB
cord-014462-11ggaqf1	292	14	significant	significant	JJ
cord-014462-11ggaqf1	292	15	loss	loss	NN
cord-014462-11ggaqf1	292	16	and	and	CC
cord-014462-11ggaqf1	292	17	are	be	VBP
cord-014462-11ggaqf1	292	18	major	major	JJ
cord-014462-11ggaqf1	292	19	constraints	constraint	NNS
cord-014462-11ggaqf1	292	20	in	in	IN
cord-014462-11ggaqf1	292	21	the	the	DT
cord-014462-11ggaqf1	292	22	productivity	productivity	NN
cord-014462-11ggaqf1	292	23	.	.	.
cord-014462-11ggaqf1	293	1	Considering	consider	VBG
cord-014462-11ggaqf1	293	2	the	the	DT
cord-014462-11ggaqf1	293	3	geographical	geographical	JJ
cord-014462-11ggaqf1	293	4	distribution	distribution	NN
cord-014462-11ggaqf1	293	5	of	of	IN
cord-014462-11ggaqf1	293	6	PPR	ppr	NN
cord-014462-11ggaqf1	293	7	,	,	,
cord-014462-11ggaqf1	293	8	goat	goat	NNP
cord-014462-11ggaqf1	293	9	pox	pox	NN
cord-014462-11ggaqf1	293	10	and	and	CC
cord-014462-11ggaqf1	293	11	ORF	ORF	NNP
cord-014462-11ggaqf1	293	12	infections	infection	NNS
cord-014462-11ggaqf1	293	13	and	and	CC
cord-014462-11ggaqf1	293	14	prevalence	prevalence	NN
cord-014462-11ggaqf1	293	15	of	of	IN
cord-014462-11ggaqf1	293	16	mixed	mixed	JJ
cord-014462-11ggaqf1	293	17	infection	infection	NN
cord-014462-11ggaqf1	293	18	,	,	,
cord-014462-11ggaqf1	293	19	in	in	IN
cord-014462-11ggaqf1	293	20	the	the	DT
cord-014462-11ggaqf1	293	21	present	present	JJ
cord-014462-11ggaqf1	293	22	study	study	NN
cord-014462-11ggaqf1	293	23	,	,	,
cord-014462-11ggaqf1	293	24	safety	safety	NN
cord-014462-11ggaqf1	293	25	and	and	CC
cord-014462-11ggaqf1	293	26	potency	potency	NN
cord-014462-11ggaqf1	293	27	of	of	IN
cord-014462-11ggaqf1	293	28	the	the	DT
cord-014462-11ggaqf1	293	29	experimental	experimental	JJ
cord-014462-11ggaqf1	293	30	triple	triple	JJ
cord-014462-11ggaqf1	293	31	vaccine	vaccine	NN
cord-014462-11ggaqf1	293	32	comprising	comprise	VBG
cord-014462-11ggaqf1	293	33	attenuated	attenuated	JJ
cord-014462-11ggaqf1	293	34	strains	strain	NNS
cord-014462-11ggaqf1	293	35	of	of	IN
cord-014462-11ggaqf1	293	36	thermostable	thermostable	JJ
cord-014462-11ggaqf1	293	37	-	-	HYPH
cord-014462-11ggaqf1	293	38	PPR	ppr	NN
cord-014462-11ggaqf1	293	39	virus	virus	NN
cord-014462-11ggaqf1	293	40	(	(	-LRB-
cord-014462-11ggaqf1	293	41	PPRV	PPRV	NNP
cord-014462-11ggaqf1	293	42	Jhansi	Jhansi	NNP
cord-014462-11ggaqf1	293	43	,	,	,
cord-014462-11ggaqf1	293	44	P-50	P-50	NNP
cord-014462-11ggaqf1	293	45	)	)	-RRB-
cord-014462-11ggaqf1	294	1	grown	grow	VBN
cord-014462-11ggaqf1	294	2	at	at	IN
cord-014462-11ggaqf1	294	3	40	40	CD
cord-014462-11ggaqf1	294	4	°	°	NN
cord-014462-11ggaqf1	294	5	C	c	NN
cord-014462-11ggaqf1	294	6	,	,	,
cord-014462-11ggaqf1	294	7	high	high	JJ
cord-014462-11ggaqf1	294	8	passaged	passage	VBN
cord-014462-11ggaqf1	294	9	goat	goat	NN
cord-014462-11ggaqf1	294	10	poxvirus	poxvirus	NNP
cord-014462-11ggaqf1	294	11	(	(	-LRB-
cord-014462-11ggaqf1	294	12	GTPV	GTPV	NNP
cord-014462-11ggaqf1	294	13	Uttarkashi	Uttarkashi	NNP
cord-014462-11ggaqf1	294	14	,	,	,
cord-014462-11ggaqf1	294	15	P100	P100	NNP
cord-014462-11ggaqf1	294	16	)	)	-RRB-
cord-014462-11ggaqf1	294	17	and	and	CC
cord-014462-11ggaqf1	294	18	attenuated	attenuate	VBD
cord-014462-11ggaqf1	294	19	ORF	ORF	NNP
cord-014462-11ggaqf1	294	20	virus	virus	NN
cord-014462-11ggaqf1	294	21	(	(	-LRB-
cord-014462-11ggaqf1	295	1	ORFV	ORFV	NNP
cord-014462-11ggaqf1	295	2	Mukteswar	Mukteswar	NNP
cord-014462-11ggaqf1	295	3	,	,	,
cord-014462-11ggaqf1	295	4	P51	P51	NNP
cord-014462-11ggaqf1	295	5	)	)	-RRB-
cord-014462-11ggaqf1	295	6	was	be	VBD
cord-014462-11ggaqf1	295	7	evaluated	evaluate	VBN
cord-014462-11ggaqf1	295	8	in	in	IN
cord-014462-11ggaqf1	295	9	sub	sub	JJ
cord-014462-11ggaqf1	295	10	-	-	JJ
cord-014462-11ggaqf1	295	11	Himalayan	himalayan	JJ
cord-014462-11ggaqf1	295	12	local	local	JJ
cord-014462-11ggaqf1	295	13	hill	hill	NN
cord-014462-11ggaqf1	295	14	goats	goat	NNS
cord-014462-11ggaqf1	295	15	.	.	.
cord-014462-11ggaqf1	296	1	Goats	goat	NNS
cord-014462-11ggaqf1	296	2	simultaneously	simultaneously	RB
cord-014462-11ggaqf1	296	3	immunized	immunize	VBD
cord-014462-11ggaqf1	296	4	with	with	IN
cord-014462-11ggaqf1	296	5	1	1	CD
cord-014462-11ggaqf1	296	6	ml	ml	NNS
cord-014462-11ggaqf1	296	7	of	of	IN
cord-014462-11ggaqf1	296	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	296	9	consisting	consist	VBG
cord-014462-11ggaqf1	296	10	of	of	IN
cord-014462-11ggaqf1	296	11	either	either	DT
cord-014462-11ggaqf1	296	12	10	10	CD
cord-014462-11ggaqf1	296	13	3	3	CD
cord-014462-11ggaqf1	296	14	TCID	TCID	NNP
cord-014462-11ggaqf1	296	15	50	50	CD
cord-014462-11ggaqf1	296	16	or	or	CC
cord-014462-11ggaqf1	296	17	10	10	CD
cord-014462-11ggaqf1	296	18	5	5	CD
cord-014462-11ggaqf1	296	19	TCID	TCID	NNP
cord-014462-11ggaqf1	296	20	50	50	CD
cord-014462-11ggaqf1	296	21	of	of	IN
cord-014462-11ggaqf1	296	22	each	each	DT
cord-014462-11ggaqf1	296	23	of	of	IN
cord-014462-11ggaqf1	296	24	PPRV	PPRV	NNP
cord-014462-11ggaqf1	296	25	,	,	,
cord-014462-11ggaqf1	296	26	GTPV	GTPV	NNP
cord-014462-11ggaqf1	296	27	and	and	CC
cord-014462-11ggaqf1	296	28	ORFV	ORFV	NNP
cord-014462-11ggaqf1	296	29	were	be	VBD
cord-014462-11ggaqf1	296	30	monitored	monitor	VBN
cord-014462-11ggaqf1	296	31	for	for	IN
cord-014462-11ggaqf1	296	32	clinical	clinical	JJ
cord-014462-11ggaqf1	296	33	and	and	CC
cord-014462-11ggaqf1	296	34	serological	serological	JJ
cord-014462-11ggaqf1	296	35	responses	response	NNS
cord-014462-11ggaqf1	296	36	for	for	IN
cord-014462-11ggaqf1	296	37	a	a	DT
cord-014462-11ggaqf1	296	38	period	period	NN
cord-014462-11ggaqf1	296	39	of	of	IN
cord-014462-11ggaqf1	296	40	3	3	CD
cord-014462-11ggaqf1	296	41	-	-	SYM
cord-014462-11ggaqf1	296	42	4	4	CD
cord-014462-11ggaqf1	296	43	weeks	week	NNS
cord-014462-11ggaqf1	296	44	post	post	NN
cord-014462-11ggaqf1	296	45	-	-	NN
cord-014462-11ggaqf1	296	46	immunization	immunization	JJ
cord-014462-11ggaqf1	296	47	(	(	-LRB-
cord-014462-11ggaqf1	296	48	pi	pi	NNP
cord-014462-11ggaqf1	296	49	)	)	-RRB-
cord-014462-11ggaqf1	296	50	and	and	CC
cord-014462-11ggaqf1	296	51	post	post	NN
cord-014462-11ggaqf1	296	52	challenge	challenge	NN
cord-014462-11ggaqf1	296	53	(	(	-LRB-
cord-014462-11ggaqf1	296	54	pc	pc	NNP
cord-014462-11ggaqf1	296	55	)	)	-RRB-
cord-014462-11ggaqf1	296	56	.	.	.
cord-014462-11ggaqf1	297	1	Specific	specific	JJ
cord-014462-11ggaqf1	297	2	immune	immune	JJ
cord-014462-11ggaqf1	297	3	responses	response	NNS
cord-014462-11ggaqf1	297	4	i.e.	i.e.	FW
cord-014462-11ggaqf1	297	5	,	,	,
cord-014462-11ggaqf1	297	6	antibodies	antibody	NNS
cord-014462-11ggaqf1	297	7	directed	direct	VBN
cord-014462-11ggaqf1	297	8	to	to	IN
cord-014462-11ggaqf1	297	9	PPRV	PPRV	NNP
cord-014462-11ggaqf1	297	10	,	,	,
cord-014462-11ggaqf1	297	11	GTPV	GTPV	NNP
cord-014462-11ggaqf1	297	12	and	and	CC
cord-014462-11ggaqf1	297	13	ORFV	ORFV	NNP
cord-014462-11ggaqf1	297	14	could	could	MD
cord-014462-11ggaqf1	297	15	be	be	VB
cord-014462-11ggaqf1	297	16	demonstrated	demonstrate	VBN
cord-014462-11ggaqf1	297	17	by	by	IN
cord-014462-11ggaqf1	297	18	PPR	PPR	NNP
cord-014462-11ggaqf1	297	19	competitive	competitive	JJ
cord-014462-11ggaqf1	297	20	ELISA	ELISA	NNP
cord-014462-11ggaqf1	297	21	kit	kit	NN
cord-014462-11ggaqf1	297	22	and	and	CC
cord-014462-11ggaqf1	297	23	capripox	capripox	VB
cord-014462-11ggaqf1	297	24	indirect	indirect	JJ
cord-014462-11ggaqf1	297	25	ELISA	ELISA	NNP
cord-014462-11ggaqf1	297	26	,	,	,
cord-014462-11ggaqf1	297	27	SNT	SNT	NNP
cord-014462-11ggaqf1	297	28	,	,	,
cord-014462-11ggaqf1	297	29	respectively	respectively	RB
cord-014462-11ggaqf1	297	30	following	follow	VBG
cord-014462-11ggaqf1	297	31	immunization	immunization	NN
cord-014462-11ggaqf1	297	32	.	.	.
cord-014462-11ggaqf1	298	1	All	all	PDT
cord-014462-11ggaqf1	298	2	the	the	DT
cord-014462-11ggaqf1	298	3	immunized	immunize	VBN
cord-014462-11ggaqf1	298	4	animals	animal	NNS
cord-014462-11ggaqf1	298	5	resisted	resist	VBD
cord-014462-11ggaqf1	298	6	infections	infection	NNS
cord-014462-11ggaqf1	298	7	when	when	WRB
cord-014462-11ggaqf1	298	8	challenged	challenge	VBN
cord-014462-11ggaqf1	298	9	with	with	IN
cord-014462-11ggaqf1	298	10	virulent	virulent	JJ
cord-014462-11ggaqf1	298	11	strains	strain	NNS
cord-014462-11ggaqf1	298	12	of	of	IN
cord-014462-11ggaqf1	298	13	either	either	CC
cord-014462-11ggaqf1	298	14	GTPV	GTPV	NNP
cord-014462-11ggaqf1	298	15	or	or	CC
cord-014462-11ggaqf1	298	16	PPRV	PPRV	NNP
cord-014462-11ggaqf1	298	17	or	or	CC
cord-014462-11ggaqf1	298	18	ORFV	ORFV	NNP
cord-014462-11ggaqf1	298	19	on	on	IN
cord-014462-11ggaqf1	298	20	day	day	NN
cord-014462-11ggaqf1	298	21	28	28	CD
cord-014462-11ggaqf1	298	22	dpi	dpi	NN
cord-014462-11ggaqf1	298	23	,	,	,
cord-014462-11ggaqf1	298	24	while	while	IN
cord-014462-11ggaqf1	298	25	in	in	IN
cord-014462-11ggaqf1	298	26	contact	contact	NN
cord-014462-11ggaqf1	298	27	control	control	NN
cord-014462-11ggaqf1	298	28	animals	animal	NNS
cord-014462-11ggaqf1	298	29	developed	develop	VBD
cord-014462-11ggaqf1	298	30	characteristic	characteristic	JJ
cord-014462-11ggaqf1	298	31	signs	sign	NNS
cord-014462-11ggaqf1	298	32	of	of	IN
cord-014462-11ggaqf1	298	33	respective	respective	JJ
cord-014462-11ggaqf1	298	34	disease	disease	NN
cord-014462-11ggaqf1	298	35	.	.	.
cord-014462-11ggaqf1	299	1	Further	further	RB
cord-014462-11ggaqf1	299	2	,	,	,
cord-014462-11ggaqf1	299	3	PPR	PPR	NNP
cord-014462-11ggaqf1	299	4	viral	viral	JJ
cord-014462-11ggaqf1	299	5	antigen	antigen	NN
cord-014462-11ggaqf1	299	6	could	could	MD
cord-014462-11ggaqf1	299	7	be	be	VB
cord-014462-11ggaqf1	299	8	detected	detect	VBN
cord-014462-11ggaqf1	299	9	by	by	IN
cord-014462-11ggaqf1	299	10	using	use	VBG
cord-014462-11ggaqf1	299	11	PPR	PPR	NNP
cord-014462-11ggaqf1	299	12	sandwich	sandwich	NN
cord-014462-11ggaqf1	299	13	ELISA	ELISA	NNP
cord-014462-11ggaqf1	299	14	kit	kit	NN
cord-014462-11ggaqf1	299	15	in	in	IN
cord-014462-11ggaqf1	299	16	the	the	DT
cord-014462-11ggaqf1	299	17	excretions	excretion	NNS
cord-014462-11ggaqf1	299	18	(	(	-LRB-
cord-014462-11ggaqf1	299	19	nasal	nasal	NN
cord-014462-11ggaqf1	299	20	,	,	,
cord-014462-11ggaqf1	299	21	ocular	ocular	JJ
cord-014462-11ggaqf1	299	22	and	and	CC
cord-014462-11ggaqf1	299	23	oral	oral	JJ
cord-014462-11ggaqf1	299	24	swab	swab	NN
cord-014462-11ggaqf1	299	25	materials	material	NNS
cord-014462-11ggaqf1	299	26	)	)	-RRB-
cord-014462-11ggaqf1	299	27	of	of	IN
cord-014462-11ggaqf1	299	28	unvaccinated	unvaccinated	JJ
cord-014462-11ggaqf1	299	29	control	control	NN
cord-014462-11ggaqf1	299	30	animals	animal	NNS
cord-014462-11ggaqf1	299	31	after	after	IN
cord-014462-11ggaqf1	299	32	challenge	challenge	NN
cord-014462-11ggaqf1	299	33	but	but	CC
cord-014462-11ggaqf1	299	34	not	not	RB
cord-014462-11ggaqf1	299	35	from	from	IN
cord-014462-11ggaqf1	299	36	any	any	DT
cord-014462-11ggaqf1	299	37	of	of	IN
cord-014462-11ggaqf1	299	38	the	the	DT
cord-014462-11ggaqf1	299	39	immunized	immunize	VBN
cord-014462-11ggaqf1	299	40	goats	goat	NNS
cord-014462-11ggaqf1	299	41	.	.	.
cord-014462-11ggaqf1	300	1	Triple	triple	JJ
cord-014462-11ggaqf1	300	2	vaccine	vaccine	NN
cord-014462-11ggaqf1	300	3	was	be	VBD
cord-014462-11ggaqf1	300	4	found	find	VBN
cord-014462-11ggaqf1	300	5	safe	safe	JJ
cord-014462-11ggaqf1	300	6	at	at	IN
cord-014462-11ggaqf1	300	7	dose	dose	NN
cord-014462-11ggaqf1	300	8	as	as	RB
cord-014462-11ggaqf1	300	9	higher	high	JJR
cord-014462-11ggaqf1	300	10	as	as	IN
cord-014462-11ggaqf1	300	11	10	10	CD
cord-014462-11ggaqf1	300	12	5	5	CD
cord-014462-11ggaqf1	300	13	TCID	TCID	NNP
cord-014462-11ggaqf1	300	14	50	50	CD
cord-014462-11ggaqf1	300	15	and	and	CC
cord-014462-11ggaqf1	300	16	induced	induce	VBN
cord-014462-11ggaqf1	300	17	protective	protective	JJ
cord-014462-11ggaqf1	300	18	immune	immune	JJ
cord-014462-11ggaqf1	300	19	response	response	NN
cord-014462-11ggaqf1	300	20	even	even	RB
cord-014462-11ggaqf1	300	21	at	at	IN
cord-014462-11ggaqf1	300	22	lower	low	JJR
cord-014462-11ggaqf1	300	23	dose	dose	NN
cord-014462-11ggaqf1	300	24	(	(	-LRB-
cord-014462-11ggaqf1	300	25	10	10	CD
cord-014462-11ggaqf1	300	26	2	2	CD
cord-014462-11ggaqf1	300	27	TCID	TCID	NNP
cord-014462-11ggaqf1	300	28	50	50	CD
cord-014462-11ggaqf1	300	29	)	)	-RRB-
cord-014462-11ggaqf1	300	30	in	in	IN
cord-014462-11ggaqf1	300	31	goats	goat	NNS
cord-014462-11ggaqf1	300	32	,	,	,
cord-014462-11ggaqf1	300	33	which	which	WDT
cord-014462-11ggaqf1	300	34	was	be	VBD
cord-014462-11ggaqf1	300	35	evident	evident	JJ
cord-014462-11ggaqf1	300	36	from	from	IN
cord-014462-11ggaqf1	300	37	sero	sero	NN
cord-014462-11ggaqf1	300	38	-	-	HYPH
cord-014462-11ggaqf1	300	39	conversion	conversion	NN
cord-014462-11ggaqf1	300	40	as	as	RB
cord-014462-11ggaqf1	300	41	well	well	RB
cord-014462-11ggaqf1	300	42	as	as	IN
cord-014462-11ggaqf1	300	43	challenge	challenge	NN
cord-014462-11ggaqf1	300	44	studies	study	NNS
cord-014462-11ggaqf1	300	45	.	.	.
cord-014462-11ggaqf1	301	1	The	the	DT
cord-014462-11ggaqf1	301	2	study	study	NN
cord-014462-11ggaqf1	301	3	indicated	indicate	VBD
cord-014462-11ggaqf1	301	4	that	that	IN
cord-014462-11ggaqf1	301	5	these	these	DT
cord-014462-11ggaqf1	301	6	viruses	virus	NNS
cord-014462-11ggaqf1	301	7	are	be	VBP
cord-014462-11ggaqf1	301	8	compatible	compatible	JJ
cord-014462-11ggaqf1	301	9	and	and	CC
cord-014462-11ggaqf1	301	10	did	do	VBD
cord-014462-11ggaqf1	301	11	not	not	RB
cord-014462-11ggaqf1	301	12	interfere	interfere	VB
cord-014462-11ggaqf1	301	13	with	with	IN
cord-014462-11ggaqf1	301	14	each	each	DT
cord-014462-11ggaqf1	301	15	other	other	JJ
cord-014462-11ggaqf1	301	16	in	in	IN
cord-014462-11ggaqf1	301	17	eliciting	elicit	VBG
cord-014462-11ggaqf1	301	18	immune	immune	JJ
cord-014462-11ggaqf1	301	19	response	response	NN
cord-014462-11ggaqf1	301	20	,	,	,
cord-014462-11ggaqf1	301	21	paving	pave	VBG
cord-014462-11ggaqf1	301	22	the	the	DT
cord-014462-11ggaqf1	301	23	feasibility	feasibility	NN
cord-014462-11ggaqf1	301	24	of	of	IN
cord-014462-11ggaqf1	301	25	use	use	NN
cord-014462-11ggaqf1	301	26	of	of	IN
cord-014462-11ggaqf1	301	27	this	this	DT
cord-014462-11ggaqf1	301	28	triple	triple	JJ
cord-014462-11ggaqf1	301	29	vaccine	vaccine	NN
cord-014462-11ggaqf1	301	30	in	in	IN
cord-014462-11ggaqf1	301	31	combating	combat	VBG
cord-014462-11ggaqf1	301	32	these	these	DT
cord-014462-11ggaqf1	301	33	infections	infection	NNS
cord-014462-11ggaqf1	301	34	simultaneously	simultaneously	RB
cord-014462-11ggaqf1	301	35	.	.	.
cord-014462-11ggaqf1	302	1	Toll	toll	NN
cord-014462-11ggaqf1	302	2	like	like	IN
cord-014462-11ggaqf1	302	3	receptors	receptor	NNS
cord-014462-11ggaqf1	302	4	(	(	-LRB-
cord-014462-11ggaqf1	302	5	TLRs	TLRs	NNP
cord-014462-11ggaqf1	302	6	)	)	-RRB-
cord-014462-11ggaqf1	302	7	,	,	,
cord-014462-11ggaqf1	302	8	primary	primary	JJ
cord-014462-11ggaqf1	302	9	sensors	sensor	NNS
cord-014462-11ggaqf1	302	10	of	of	IN
cord-014462-11ggaqf1	302	11	microbial	microbial	JJ
cord-014462-11ggaqf1	302	12	origin	origin	NN
cord-014462-11ggaqf1	302	13	,	,	,
cord-014462-11ggaqf1	302	14	plays	play	VBZ
cord-014462-11ggaqf1	302	15	a	a	DT
cord-014462-11ggaqf1	302	16	crucial	crucial	JJ
cord-014462-11ggaqf1	302	17	role	role	NN
cord-014462-11ggaqf1	302	18	in	in	IN
cord-014462-11ggaqf1	302	19	the	the	DT
cord-014462-11ggaqf1	302	20	innate	innate	JJ
cord-014462-11ggaqf1	302	21	immunity	immunity	NN
cord-014462-11ggaqf1	302	22	.	.	.
cord-014462-11ggaqf1	303	1	Till	till	IN
cord-014462-11ggaqf1	303	2	now	now	RB
cord-014462-11ggaqf1	303	3	13	13	CD
cord-014462-11ggaqf1	303	4	mammalian	mammalian	JJ
cord-014462-11ggaqf1	303	5	TLRs	tlr	NNS
cord-014462-11ggaqf1	303	6	have	have	VBP
cord-014462-11ggaqf1	303	7	been	be	VBN
cord-014462-11ggaqf1	303	8	identified	identify	VBN
cord-014462-11ggaqf1	303	9	,	,	,
cord-014462-11ggaqf1	303	10	while	while	IN
cord-014462-11ggaqf1	303	11	there	there	EX
cord-014462-11ggaqf1	303	12	is	be	VBZ
cord-014462-11ggaqf1	303	13	no	no	DT
cord-014462-11ggaqf1	303	14	information	information	NN
cord-014462-11ggaqf1	303	15	available	available	JJ
cord-014462-11ggaqf1	303	16	on	on	IN
cord-014462-11ggaqf1	303	17	TLRs	tlr	NNS
cord-014462-11ggaqf1	303	18	of	of	IN
cord-014462-11ggaqf1	303	19	Yak	Yak	NNP
cord-014462-11ggaqf1	303	20	.	.	.
cord-014462-11ggaqf1	304	1	This	this	DT
cord-014462-11ggaqf1	304	2	study	study	NN
cord-014462-11ggaqf1	304	3	is	be	VBZ
cord-014462-11ggaqf1	304	4	part	part	NN
cord-014462-11ggaqf1	304	5	of	of	IN
cord-014462-11ggaqf1	304	6	World	World	NNP
cord-014462-11ggaqf1	304	7	Bank	Bank	NNP
cord-014462-11ggaqf1	304	8	Funded	Funded	NNP
cord-014462-11ggaqf1	304	9	-	-	HYPH
cord-014462-11ggaqf1	304	10	ICAR	ICAR	NNP
cord-014462-11ggaqf1	304	11	project	project	NN
cord-014462-11ggaqf1	304	12	.	.	.
cord-014462-11ggaqf1	305	1	Yak	Yak	NNP
cord-014462-11ggaqf1	305	2	,	,	,
cord-014462-11ggaqf1	305	3	named	name	VBN
cord-014462-11ggaqf1	305	4	Bos	Bos	NNP
cord-014462-11ggaqf1	305	5	grunniens	grunniens	NNP
cord-014462-11ggaqf1	305	6	for	for	IN
cord-014462-11ggaqf1	305	7	its	-PRON-	PRP$
cord-014462-11ggaqf1	305	8	distinctive	distinctive	JJ
cord-014462-11ggaqf1	305	9	vocalization	vocalization	NN
cord-014462-11ggaqf1	305	10	and	and	CC
cord-014462-11ggaqf1	305	11	relationship	relationship	NN
cord-014462-11ggaqf1	305	12	with	with	IN
cord-014462-11ggaqf1	305	13	cattle	cattle	NNS
cord-014462-11ggaqf1	305	14	,	,	,
cord-014462-11ggaqf1	305	15	is	be	VBZ
cord-014462-11ggaqf1	305	16	natural	natural	JJ
cord-014462-11ggaqf1	305	17	habitant	habitant	NN
cord-014462-11ggaqf1	305	18	of	of	IN
cord-014462-11ggaqf1	305	19	extremely	extremely	RB
cord-014462-11ggaqf1	305	20	cold	cold	JJ
cord-014462-11ggaqf1	305	21	environment	environment	NN
cord-014462-11ggaqf1	305	22	.	.	.
cord-014462-11ggaqf1	306	1	When	when	WRB
cord-014462-11ggaqf1	306	2	these	these	DT
cord-014462-11ggaqf1	306	3	animals	animal	NNS
cord-014462-11ggaqf1	306	4	comes	come	VBZ
cord-014462-11ggaqf1	306	5	to	to	IN
cord-014462-11ggaqf1	306	6	a	a	DT
cord-014462-11ggaqf1	306	7	lower	low	JJR
cord-014462-11ggaqf1	306	8	altitude	altitude	NN
cord-014462-11ggaqf1	306	9	grazing	graze	VBG
cord-014462-11ggaqf1	306	10	land	land	NN
cord-014462-11ggaqf1	306	11	,	,	,
cord-014462-11ggaqf1	306	12	adjacent	adjacent	JJ
cord-014462-11ggaqf1	306	13	to	to	IN
cord-014462-11ggaqf1	306	14	villages	village	NNS
cord-014462-11ggaqf1	306	15	,	,	,
cord-014462-11ggaqf1	306	16	become	become	VBP
cord-014462-11ggaqf1	306	17	susceptible	susceptible	JJ
cord-014462-11ggaqf1	306	18	to	to	IN
cord-014462-11ggaqf1	306	19	the	the	DT
cord-014462-11ggaqf1	306	20	diseases	disease	NNS
cord-014462-11ggaqf1	306	21	of	of	IN
cord-014462-11ggaqf1	306	22	cattle	cattle	NNS
cord-014462-11ggaqf1	306	23	,	,	,
cord-014462-11ggaqf1	306	24	buffalo	buffalo	NNP
cord-014462-11ggaqf1	306	25	etc	etc	FW
cord-014462-11ggaqf1	306	26	.	.	.
cord-014462-11ggaqf1	307	1	Thus	thus	RB
cord-014462-11ggaqf1	307	2	,	,	,
cord-014462-11ggaqf1	307	3	present	present	JJ
cord-014462-11ggaqf1	307	4	study	study	NN
cord-014462-11ggaqf1	307	5	was	be	VBD
cord-014462-11ggaqf1	307	6	undertaken	undertake	VBN
cord-014462-11ggaqf1	307	7	to	to	TO
cord-014462-11ggaqf1	307	8	with	with	IN
cord-014462-11ggaqf1	307	9	genetic	genetic	JJ
cord-014462-11ggaqf1	307	10	characterization	characterization	NN
cord-014462-11ggaqf1	307	11	and	and	CC
cord-014462-11ggaqf1	307	12	evolutionary	evolutionary	JJ
cord-014462-11ggaqf1	307	13	lineage	lineage	NN
cord-014462-11ggaqf1	307	14	analysis	analysis	NN
cord-014462-11ggaqf1	307	15	of	of	IN
cord-014462-11ggaqf1	307	16	Yak	Yak	NNP
cord-014462-11ggaqf1	307	17	TLRs	TLRs	NNP
cord-014462-11ggaqf1	307	18	.	.	.
cord-014462-11ggaqf1	308	1	We	-PRON-	PRP
cord-014462-11ggaqf1	308	2	worked	work	VBD
cord-014462-11ggaqf1	308	3	on	on	IN
cord-014462-11ggaqf1	308	4	TLR7	TLR7	NNP
cord-014462-11ggaqf1	308	5	gene	gene	NN
cord-014462-11ggaqf1	308	6	,	,	,
cord-014462-11ggaqf1	308	7	which	which	WDT
cord-014462-11ggaqf1	308	8	plays	play	VBZ
cord-014462-11ggaqf1	308	9	an	an	DT
cord-014462-11ggaqf1	308	10	important	important	JJ
cord-014462-11ggaqf1	308	11	role	role	NN
cord-014462-11ggaqf1	308	12	in	in	IN
cord-014462-11ggaqf1	308	13	recognition	recognition	NN
cord-014462-11ggaqf1	308	14	of	of	IN
cord-014462-11ggaqf1	308	15	ssRNA	ssrna	NN
cord-014462-11ggaqf1	308	16	viruses	virus	NNS
cord-014462-11ggaqf1	308	17	.	.	.
cord-014462-11ggaqf1	309	1	Total	Total	NNP
cord-014462-11ggaqf1	309	2	RNA	RNA	NNP
cord-014462-11ggaqf1	309	3	was	be	VBD
cord-014462-11ggaqf1	309	4	extracted	extract	VBN
cord-014462-11ggaqf1	309	5	from	from	IN
cord-014462-11ggaqf1	309	6	mitogen	mitogen	NNP
cord-014462-11ggaqf1	309	7	stimulated	stimulate	VBN
cord-014462-11ggaqf1	309	8	PBMCs	pbmc	NNS
cord-014462-11ggaqf1	309	9	of	of	IN
cord-014462-11ggaqf1	309	10	Yak	Yak	NNP
cord-014462-11ggaqf1	309	11	.	.	.
cord-014462-11ggaqf1	310	1	The	the	DT
cord-014462-11ggaqf1	310	2	RT	RT	NNP
cord-014462-11ggaqf1	310	3	-	-	HYPH
cord-014462-11ggaqf1	310	4	PCR	PCR	NNP
cord-014462-11ggaqf1	310	5	conditions	condition	NNS
cord-014462-11ggaqf1	310	6	were	be	VBD
cord-014462-11ggaqf1	310	7	standardized	standardize	VBN
cord-014462-11ggaqf1	310	8	for	for	IN
cord-014462-11ggaqf1	310	9	full	full	JJ
cord-014462-11ggaqf1	310	10	length	length	NN
cord-014462-11ggaqf1	310	11	amplification	amplification	NN
cord-014462-11ggaqf1	310	12	of	of	IN
cord-014462-11ggaqf1	310	13	TLR	TLR	NNP
cord-014462-11ggaqf1	310	14	gene	gene	NN
cord-014462-11ggaqf1	310	15	7	7	CD
cord-014462-11ggaqf1	310	16	using	use	VBG
cord-014462-11ggaqf1	310	17	specific	specific	JJ
cord-014462-11ggaqf1	310	18	self	self	NN
cord-014462-11ggaqf1	310	19	designed	design	VBN
cord-014462-11ggaqf1	310	20	primers	primer	NNS
cord-014462-11ggaqf1	310	21	.	.	.
cord-014462-11ggaqf1	311	1	The	the	DT
cord-014462-11ggaqf1	311	2	expected	expected	JJ
cord-014462-11ggaqf1	311	3	amplicon	amplicon	NN
cord-014462-11ggaqf1	311	4	of	of	IN
cord-014462-11ggaqf1	311	5	3559bps	3559bp	NNS
cord-014462-11ggaqf1	311	6	was	be	VBD
cord-014462-11ggaqf1	311	7	obtained	obtain	VBN
cord-014462-11ggaqf1	311	8	.	.	.
cord-014462-11ggaqf1	312	1	It	-PRON-	PRP
cord-014462-11ggaqf1	312	2	was	be	VBD
cord-014462-11ggaqf1	312	3	cloned	clone	VBN
cord-014462-11ggaqf1	312	4	in	in	IN
cord-014462-11ggaqf1	312	5	pGEMT	pGEMT	NNP
cord-014462-11ggaqf1	312	6	-	-	HYPH
cord-014462-11ggaqf1	312	7	Easy	easy	JJ
cord-014462-11ggaqf1	312	8	vector	vector	NN
cord-014462-11ggaqf1	312	9	followed	follow	VBN
cord-014462-11ggaqf1	312	10	by	by	IN
cord-014462-11ggaqf1	312	11	transformation	transformation	NN
cord-014462-11ggaqf1	312	12	in	in	IN
cord-014462-11ggaqf1	312	13	E.	E.	NNP
cord-014462-11ggaqf1	312	14	coli	coli	VBZ
cord-014462-11ggaqf1	312	15	Top10	Top10	NNP
cord-014462-11ggaqf1	312	16	strain	strain	NN
cord-014462-11ggaqf1	312	17	.	.	.
cord-014462-11ggaqf1	313	1	The	the	DT
cord-014462-11ggaqf1	313	2	recombinant	recombinant	JJ
cord-014462-11ggaqf1	313	3	clones	clone	NNS
cord-014462-11ggaqf1	313	4	were	be	VBD
cord-014462-11ggaqf1	313	5	screened	screen	VBN
cord-014462-11ggaqf1	313	6	,	,	,
cord-014462-11ggaqf1	313	7	picked	pick	VBN
cord-014462-11ggaqf1	313	8	up	up	RP
cord-014462-11ggaqf1	313	9	for	for	IN
cord-014462-11ggaqf1	313	10	plasmid	plasmid	NN
cord-014462-11ggaqf1	313	11	isolation	isolation	NN
cord-014462-11ggaqf1	313	12	and	and	CC
cord-014462-11ggaqf1	313	13	release	release	NN
cord-014462-11ggaqf1	313	14	of	of	IN
cord-014462-11ggaqf1	313	15	TLR7	TLR7	NNP
cord-014462-11ggaqf1	313	16	was	be	VBD
cord-014462-11ggaqf1	313	17	confirmed	confirm	VBN
cord-014462-11ggaqf1	313	18	by	by	IN
cord-014462-11ggaqf1	313	19	restriction	restriction	NN
cord-014462-11ggaqf1	313	20	digestion	digestion	NN
cord-014462-11ggaqf1	313	21	.	.	.
cord-014462-11ggaqf1	314	1	The	the	DT
cord-014462-11ggaqf1	314	2	cloned	clone	VBN
cord-014462-11ggaqf1	314	3	TLR7	TLR7	NNP
cord-014462-11ggaqf1	314	4	product	product	NN
cord-014462-11ggaqf1	314	5	was	be	VBD
cord-014462-11ggaqf1	314	6	sequenced	sequence	VBN
cord-014462-11ggaqf1	314	7	and	and	CC
cord-014462-11ggaqf1	314	8	analyzed	analyze	VBN
cord-014462-11ggaqf1	314	9	for	for	IN
cord-014462-11ggaqf1	314	10	the	the	DT
cord-014462-11ggaqf1	314	11	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	314	12	and	and	CC
cord-014462-11ggaqf1	314	13	deduced	deduce	VBN
cord-014462-11ggaqf1	314	14	amino	amino	NN
cord-014462-11ggaqf1	314	15	acid	acid	NN
cord-014462-11ggaqf1	314	16	sequences	sequence	NNS
cord-014462-11ggaqf1	314	17	,	,	,
cord-014462-11ggaqf1	314	18	and	and	CC
cord-014462-11ggaqf1	314	19	3D	3D	NNP
cord-014462-11ggaqf1	314	20	structure	structure	NN
cord-014462-11ggaqf1	314	21	analysis	analysis	NN
cord-014462-11ggaqf1	314	22	.	.	.
cord-014462-11ggaqf1	315	1	The	the	DT
cord-014462-11ggaqf1	315	2	results	result	NNS
cord-014462-11ggaqf1	315	3	revealed	reveal	VBD
cord-014462-11ggaqf1	315	4	that	that	IN
cord-014462-11ggaqf1	315	5	Yak	Yak	NNP
cord-014462-11ggaqf1	315	6	shows	show	VBZ
cord-014462-11ggaqf1	315	7	more	more	JJR
cord-014462-11ggaqf1	315	8	than	than	IN
cord-014462-11ggaqf1	315	9	98	98	CD
cord-014462-11ggaqf1	315	10	%	%	NN
cord-014462-11ggaqf1	315	11	sequence	sequence	NN
cord-014462-11ggaqf1	315	12	homology	homology	NN
cord-014462-11ggaqf1	315	13	with	with	IN
cord-014462-11ggaqf1	315	14	other	other	JJ
cord-014462-11ggaqf1	315	15	Bos	Bos	NNP
cord-014462-11ggaqf1	315	16	indicus	indicus	NN
cord-014462-11ggaqf1	315	17	breeds	breed	VBZ
cord-014462-11ggaqf1	315	18	and	and	CC
cord-014462-11ggaqf1	315	19	Bos	Bos	NNP
cord-014462-11ggaqf1	315	20	taurus	taurus	NNP
cord-014462-11ggaqf1	315	21	breeds	breed	NNS
cord-014462-11ggaqf1	315	22	.	.	.
cord-014462-11ggaqf1	316	1	However	however	RB
cord-014462-11ggaqf1	316	2	,	,	,
cord-014462-11ggaqf1	316	3	identity	identity	NN
cord-014462-11ggaqf1	316	4	was	be	VBD
cord-014462-11ggaqf1	316	5	less	less	JJR
cord-014462-11ggaqf1	316	6	than	than	IN
cord-014462-11ggaqf1	316	7	88	88	CD
cord-014462-11ggaqf1	316	8	%	%	NN
cord-014462-11ggaqf1	316	9	with	with	IN
cord-014462-11ggaqf1	316	10	other	other	JJ
cord-014462-11ggaqf1	316	11	animal	animal	NN
cord-014462-11ggaqf1	316	12	species	specie	NNS
cord-014462-11ggaqf1	316	13	(	(	-LRB-
cord-014462-11ggaqf1	316	14	equine	equine	NN
cord-014462-11ggaqf1	316	15	,	,	,
cord-014462-11ggaqf1	316	16	murine	murine	JJ
cord-014462-11ggaqf1	316	17	,	,	,
cord-014462-11ggaqf1	316	18	feline	feline	JJ
cord-014462-11ggaqf1	316	19	,	,	,
cord-014462-11ggaqf1	316	20	canine	canine	JJ
cord-014462-11ggaqf1	316	21	etc	etc	NN
cord-014462-11ggaqf1	316	22	.	.	.
cord-014462-11ggaqf1	316	23	)	)	-RRB-
cord-014462-11ggaqf1	316	24	.	.	.
cord-014462-11ggaqf1	317	1	The	the	DT
cord-014462-11ggaqf1	317	2	evolutionary	evolutionary	JJ
cord-014462-11ggaqf1	317	3	lineage	lineage	NN
cord-014462-11ggaqf1	317	4	findings	finding	NNS
cord-014462-11ggaqf1	317	5	cluster	cluster	NN
cord-014462-11ggaqf1	317	6	Yak	Yak	NNP
cord-014462-11ggaqf1	317	7	more	more	RBR
cord-014462-11ggaqf1	317	8	closely	closely	RB
cord-014462-11ggaqf1	317	9	with	with	IN
cord-014462-11ggaqf1	317	10	bovine	bovine	JJ
cord-014462-11ggaqf1	317	11	species	specie	NNS
cord-014462-11ggaqf1	317	12	.	.	.
cord-014462-11ggaqf1	318	1	Point	point	NN
cord-014462-11ggaqf1	318	2	mutations	mutation	NNS
cord-014462-11ggaqf1	318	3	revealed	reveal	VBD
cord-014462-11ggaqf1	318	4	changes	change	NNS
cord-014462-11ggaqf1	318	5	at	at	IN
cord-014462-11ggaqf1	318	6	25	25	CD
cord-014462-11ggaqf1	318	7	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	318	8	positions	position	NNS
cord-014462-11ggaqf1	318	9	with	with	IN
cord-014462-11ggaqf1	318	10	corresponding	correspond	VBG
cord-014462-11ggaqf1	318	11	amino	amino	NN
cord-014462-11ggaqf1	318	12	acid	acid	NN
cord-014462-11ggaqf1	318	13	change	change	NN
cord-014462-11ggaqf1	318	14	at	at	IN
cord-014462-11ggaqf1	318	15	15	15	CD
cord-014462-11ggaqf1	318	16	positions	position	NNS
cord-014462-11ggaqf1	318	17	.	.	.
cord-014462-11ggaqf1	319	1	SMART	smart	JJ
cord-014462-11ggaqf1	319	2	analysis	analysis	NN
cord-014462-11ggaqf1	319	3	of	of	IN
cord-014462-11ggaqf1	319	4	Yak	Yak	NNP
cord-014462-11ggaqf1	319	5	protein	protein	NN
cord-014462-11ggaqf1	319	6	domain	domain	NN
cord-014462-11ggaqf1	319	7	architecture	architecture	NN
cord-014462-11ggaqf1	319	8	revealed	reveal	VBD
cord-014462-11ggaqf1	319	9	Toll	Toll	NNP
cord-014462-11ggaqf1	319	10	-	-	HYPH
cord-014462-11ggaqf1	319	11	Interleukin	Interleukin	NNP
cord-014462-11ggaqf1	319	12	I	-PRON-	PRP
cord-014462-11ggaqf1	319	13	receptor	receptor	NN
cord-014462-11ggaqf1	319	14	(	(	-LRB-
cord-014462-11ggaqf1	319	15	TIR	TIR	NNP
cord-014462-11ggaqf1	319	16	)	)	-RRB-
cord-014462-11ggaqf1	319	17	,	,	,
cord-014462-11ggaqf1	319	18	Leucine	leucine	JJ
cord-014462-11ggaqf1	319	19	rich	rich	JJ
cord-014462-11ggaqf1	319	20	repeats	repeat	NNS
cord-014462-11ggaqf1	319	21	(	(	-LRB-
cord-014462-11ggaqf1	319	22	LRR	LRR	NNP
cord-014462-11ggaqf1	319	23	)	)	-RRB-
cord-014462-11ggaqf1	319	24	and	and	CC
cord-014462-11ggaqf1	319	25	signal	signal	NN
cord-014462-11ggaqf1	319	26	peptide	peptide	NN
cord-014462-11ggaqf1	319	27	region	region	NN
cord-014462-11ggaqf1	319	28	.	.	.
cord-014462-11ggaqf1	320	1	The	the	DT
cord-014462-11ggaqf1	320	2	variations	variation	NNS
cord-014462-11ggaqf1	320	3	in	in	IN
cord-014462-11ggaqf1	320	4	Yak	Yak	NNP
cord-014462-11ggaqf1	320	5	mainly	mainly	RB
cord-014462-11ggaqf1	320	6	lie	lie	VBP
cord-014462-11ggaqf1	320	7	in	in	IN
cord-014462-11ggaqf1	320	8	the	the	DT
cord-014462-11ggaqf1	320	9	LRR	LRR	NNP
cord-014462-11ggaqf1	320	10	region	region	NN
cord-014462-11ggaqf1	320	11	.	.	.
cord-014462-11ggaqf1	321	1	Homology	homology	NN
cord-014462-11ggaqf1	321	2	modeling	model	VBG
cord-014462-11ggaqf1	321	3	revealed	reveal	VBD
cord-014462-11ggaqf1	321	4	horse	horse	NN
cord-014462-11ggaqf1	321	5	shoe	shoe	NN
cord-014462-11ggaqf1	321	6	shaped	shape	VBN
cord-014462-11ggaqf1	321	7	structure	structure	NN
cord-014462-11ggaqf1	321	8	with	with	IN
cord-014462-11ggaqf1	321	9	5	5	CD
cord-014462-11ggaqf1	321	10	alpha	alpha	NN
cord-014462-11ggaqf1	321	11	helix	helix	NN
cord-014462-11ggaqf1	321	12	.	.	.
cord-014462-11ggaqf1	322	1	The	the	DT
cord-014462-11ggaqf1	322	2	additional	additional	JJ
cord-014462-11ggaqf1	322	3	alpha	alpha	NN
cord-014462-11ggaqf1	322	4	helix	helix	NN
cord-014462-11ggaqf1	322	5	present	present	NN
cord-014462-11ggaqf1	322	6	in	in	IN
cord-014462-11ggaqf1	322	7	Bos	Bos	NNP
cord-014462-11ggaqf1	322	8	indicus	indicus	NN
cord-014462-11ggaqf1	322	9	was	be	VBD
cord-014462-11ggaqf1	322	10	not	not	RB
cord-014462-11ggaqf1	322	11	detected	detect	VBN
cord-014462-11ggaqf1	322	12	in	in	IN
cord-014462-11ggaqf1	322	13	Yak	Yak	NNP
cord-014462-11ggaqf1	322	14	.	.	.
cord-014462-11ggaqf1	323	1	The	the	DT
cord-014462-11ggaqf1	323	2	present	present	JJ
cord-014462-11ggaqf1	323	3	study	study	NN
cord-014462-11ggaqf1	323	4	shows	show	VBZ
cord-014462-11ggaqf1	323	5	existence	existence	NN
cord-014462-11ggaqf1	323	6	of	of	IN
cord-014462-11ggaqf1	323	7	genetic	genetic	JJ
cord-014462-11ggaqf1	323	8	variability	variability	NN
cord-014462-11ggaqf1	323	9	in	in	IN
cord-014462-11ggaqf1	323	10	TLR7	TLR7	NNP
cord-014462-11ggaqf1	323	11	gene	gene	NN
cord-014462-11ggaqf1	323	12	of	of	IN
cord-014462-11ggaqf1	323	13	Yak	Yak	NNP
cord-014462-11ggaqf1	323	14	,	,	,
cord-014462-11ggaqf1	323	15	in	in	IN
cord-014462-11ggaqf1	323	16	particular	particular	JJ
cord-014462-11ggaqf1	323	17	the	the	DT
cord-014462-11ggaqf1	323	18	LRR	LRR	NNP
cord-014462-11ggaqf1	323	19	region	region	NN
cord-014462-11ggaqf1	323	20	,	,	,
cord-014462-11ggaqf1	323	21	which	which	WDT
cord-014462-11ggaqf1	323	22	plays	play	VBZ
cord-014462-11ggaqf1	323	23	an	an	DT
cord-014462-11ggaqf1	323	24	important	important	JJ
cord-014462-11ggaqf1	323	25	role	role	NN
cord-014462-11ggaqf1	323	26	in	in	IN
cord-014462-11ggaqf1	323	27	the	the	DT
cord-014462-11ggaqf1	323	28	pathogen	pathogen	NN
cord-014462-11ggaqf1	323	29	recognition	recognition	NN
cord-014462-11ggaqf1	323	30	and	and	CC
cord-014462-11ggaqf1	323	31	the	the	DT
cord-014462-11ggaqf1	323	32	evolutionary	evolutionary	JJ
cord-014462-11ggaqf1	323	33	lineage	lineage	NN
cord-014462-11ggaqf1	323	34	analyses	analysis	NNS
cord-014462-11ggaqf1	323	35	shows	show	VBZ
cord-014462-11ggaqf1	323	36	its	-PRON-	PRP$
cord-014462-11ggaqf1	323	37	closeness	closeness	NN
cord-014462-11ggaqf1	323	38	with	with	IN
cord-014462-11ggaqf1	323	39	other	other	JJ
cord-014462-11ggaqf1	323	40	bovine	bovine	JJ
cord-014462-11ggaqf1	323	41	species	specie	NNS
cord-014462-11ggaqf1	323	42	.	.	.
cord-014462-11ggaqf1	324	1	A.P.	A.P.	NNP
cord-014462-11ggaqf1	324	2	Aquaculture	Aquaculture	NNP
cord-014462-11ggaqf1	324	3	and	and	CC
cord-014462-11ggaqf1	324	4	Fisheries	Fisheries	NNP
cord-014462-11ggaqf1	324	5	,	,	,
cord-014462-11ggaqf1	324	6	Tirupati	Tirupati	NNP
cord-014462-11ggaqf1	325	1	In	in	IN
cord-014462-11ggaqf1	325	2	this	this	DT
cord-014462-11ggaqf1	325	3	new	new	JJ
cord-014462-11ggaqf1	325	4	millennium	millennium	NN
cord-014462-11ggaqf1	325	5	,	,	,
cord-014462-11ggaqf1	325	6	aquatic	aquatic	JJ
cord-014462-11ggaqf1	325	7	animal	animal	NN
cord-014462-11ggaqf1	325	8	health	health	NN
cord-014462-11ggaqf1	325	9	management	management	NN
cord-014462-11ggaqf1	325	10	strategies	strategy	NNS
cord-014462-11ggaqf1	325	11	in	in	IN
cord-014462-11ggaqf1	325	12	Asia	Asia	NNP
cord-014462-11ggaqf1	325	13	expanded	expand	VBD
cord-014462-11ggaqf1	325	14	and	and	CC
cord-014462-11ggaqf1	325	15	adjusted	adjust	VBN
cord-014462-11ggaqf1	325	16	to	to	IN
cord-014462-11ggaqf1	325	17	the	the	DT
cord-014462-11ggaqf1	325	18	current	current	JJ
cord-014462-11ggaqf1	325	19	disease	disease	NN
cord-014462-11ggaqf1	325	20	problems	problem	NNS
cord-014462-11ggaqf1	325	21	faced	face	VBN
cord-014462-11ggaqf1	325	22	by	by	IN
cord-014462-11ggaqf1	325	23	the	the	DT
cord-014462-11ggaqf1	325	24	aquaculture	aquaculture	NN
cord-014462-11ggaqf1	325	25	sector	sector	NN
cord-014462-11ggaqf1	325	26	.	.	.
cord-014462-11ggaqf1	326	1	This	this	DT
cord-014462-11ggaqf1	326	2	presentation	presentation	NN
cord-014462-11ggaqf1	326	3	will	will	MD
cord-014462-11ggaqf1	326	4	briefly	briefly	RB
cord-014462-11ggaqf1	326	5	discuss	discuss	VB
cord-014462-11ggaqf1	326	6	some	some	DT
cord-014462-11ggaqf1	326	7	of	of	IN
cord-014462-11ggaqf1	326	8	the	the	DT
cord-014462-11ggaqf1	326	9	most	most	RBS
cord-014462-11ggaqf1	326	10	serious	serious	JJ
cord-014462-11ggaqf1	326	11	trans	trans	JJ
cord-014462-11ggaqf1	326	12	-	-	JJ
cord-014462-11ggaqf1	326	13	boundary	boundary	JJ
cord-014462-11ggaqf1	326	14	pathogens	pathogen	NNS
cord-014462-11ggaqf1	326	15	affecting	affect	VBG
cord-014462-11ggaqf1	326	16	Asian	asian	JJ
cord-014462-11ggaqf1	326	17	aquaculture	aquaculture	NN
cord-014462-11ggaqf1	326	18	including	include	VBG
cord-014462-11ggaqf1	326	19	a	a	DT
cord-014462-11ggaqf1	326	20	newly	newly	RB
cord-014462-11ggaqf1	326	21	emerging	emerge	VBG
cord-014462-11ggaqf1	326	22	disease	disease	NN
cord-014462-11ggaqf1	326	23	and	and	CC
cord-014462-11ggaqf1	326	24	highlight	highlight	VB
cord-014462-11ggaqf1	326	25	recent	recent	JJ
cord-014462-11ggaqf1	326	26	regional	regional	JJ
cord-014462-11ggaqf1	326	27	and	and	CC
cord-014462-11ggaqf1	326	28	national	national	JJ
cord-014462-11ggaqf1	326	29	efforts	effort	NNS
cord-014462-11ggaqf1	326	30	on	on	IN
cord-014462-11ggaqf1	326	31	responsible	responsible	JJ
cord-014462-11ggaqf1	326	32	health	health	NN
cord-014462-11ggaqf1	326	33	management	management	NN
cord-014462-11ggaqf1	326	34	for	for	IN
cord-014462-11ggaqf1	326	35	mitigating	mitigate	VBG
cord-014462-11ggaqf1	326	36	the	the	DT
cord-014462-11ggaqf1	326	37	risks	risk	NNS
cord-014462-11ggaqf1	326	38	associated	associate	VBN
cord-014462-11ggaqf1	326	39	with	with	IN
cord-014462-11ggaqf1	326	40	aquatic	aquatic	JJ
cord-014462-11ggaqf1	326	41	animal	animal	NN
cord-014462-11ggaqf1	326	42	movement	movement	NN
cord-014462-11ggaqf1	326	43	.	.	.
cord-014462-11ggaqf1	327	1	A	a	DT
cord-014462-11ggaqf1	327	2	regional	regional	JJ
cord-014462-11ggaqf1	327	3	approach	approach	NN
cord-014462-11ggaqf1	327	4	is	be	VBZ
cord-014462-11ggaqf1	327	5	fundamental	fundamental	JJ
cord-014462-11ggaqf1	327	6	since	since	IN
cord-014462-11ggaqf1	327	7	many	many	JJ
cord-014462-11ggaqf1	327	8	countries	country	NNS
cord-014462-11ggaqf1	327	9	share	share	VBP
cord-014462-11ggaqf1	327	10	common	common	JJ
cord-014462-11ggaqf1	327	11	social	social	JJ
cord-014462-11ggaqf1	327	12	,	,	,
cord-014462-11ggaqf1	327	13	economic	economic	JJ
cord-014462-11ggaqf1	327	14	,	,	,
cord-014462-11ggaqf1	327	15	industrial	industrial	JJ
cord-014462-11ggaqf1	327	16	,	,	,
cord-014462-11ggaqf1	327	17	environmental	environmental	JJ
cord-014462-11ggaqf1	327	18	,	,	,
cord-014462-11ggaqf1	327	19	biological	biological	JJ
cord-014462-11ggaqf1	327	20	and	and	CC
cord-014462-11ggaqf1	327	21	geographical	geographical	JJ
cord-014462-11ggaqf1	327	22	characteristics	characteristic	NNS
cord-014462-11ggaqf1	327	23	.	.	.
cord-014462-11ggaqf1	328	1	Capacity	capacity	NN
cord-014462-11ggaqf1	328	2	and	and	CC
cord-014462-11ggaqf1	328	3	awareness	awareness	NN
cord-014462-11ggaqf1	328	4	building	build	VBG
cord-014462-11ggaqf1	328	5	on	on	IN
cord-014462-11ggaqf1	328	6	aquatic	aquatic	JJ
cord-014462-11ggaqf1	328	7	animal	animal	NN
cord-014462-11ggaqf1	328	8	epidemiology	epidemiology	NN
cord-014462-11ggaqf1	328	9	,	,	,
cord-014462-11ggaqf1	328	10	science	science	NN
cord-014462-11ggaqf1	328	11	-	-	HYPH
cord-014462-11ggaqf1	328	12	based	base	VBN
cord-014462-11ggaqf1	328	13	risk	risk	NN
cord-014462-11ggaqf1	328	14	analysis	analysis	NN
cord-014462-11ggaqf1	328	15	for	for	IN
cord-014462-11ggaqf1	328	16	aquatic	aquatic	JJ
cord-014462-11ggaqf1	328	17	animal	animal	NN
cord-014462-11ggaqf1	328	18	transfers	transfer	NNS
cord-014462-11ggaqf1	328	19	,	,	,
cord-014462-11ggaqf1	328	20	surveillance	surveillance	NN
cord-014462-11ggaqf1	328	21	and	and	CC
cord-014462-11ggaqf1	328	22	disease	disease	NN
cord-014462-11ggaqf1	328	23	reporting	reporting	NN
cord-014462-11ggaqf1	328	24	,	,	,
cord-014462-11ggaqf1	328	25	disease	disease	NN
cord-014462-11ggaqf1	328	26	zoning	zoning	NN
cord-014462-11ggaqf1	328	27	and	and	CC
cord-014462-11ggaqf1	328	28	establishment	establishment	NN
cord-014462-11ggaqf1	328	29	of	of	IN
cord-014462-11ggaqf1	328	30	aquatic	aquatic	JJ
cord-014462-11ggaqf1	328	31	animal	animal	NN
cord-014462-11ggaqf1	328	32	health	health	NN
cord-014462-11ggaqf1	328	33	information	information	NN
cord-014462-11ggaqf1	328	34	systems	system	NNS
cord-014462-11ggaqf1	328	35	to	to	TO
cord-014462-11ggaqf1	328	36	support	support	VB
cord-014462-11ggaqf1	328	37	development	development	NN
cord-014462-11ggaqf1	328	38	of	of	IN
cord-014462-11ggaqf1	328	39	national	national	JJ
cord-014462-11ggaqf1	328	40	disease	disease	NN
cord-014462-11ggaqf1	328	41	control	control	NN
cord-014462-11ggaqf1	328	42	programs	program	NNS
cord-014462-11ggaqf1	328	43	and	and	CC
cord-014462-11ggaqf1	328	44	emergency	emergency	NN
cord-014462-11ggaqf1	328	45	response	response	NN
cord-014462-11ggaqf1	328	46	to	to	IN
cord-014462-11ggaqf1	328	47	disease	disease	NN
cord-014462-11ggaqf1	328	48	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	328	49	are	be	VBP
cord-014462-11ggaqf1	328	50	needed	need	VBN
cord-014462-11ggaqf1	328	51	.	.	.
cord-014462-11ggaqf1	329	1	Molecular	molecular	JJ
cord-014462-11ggaqf1	329	2	diagnostics	diagnostic	NNS
cord-014462-11ggaqf1	329	3	with	with	IN
cord-014462-11ggaqf1	329	4	emphasis	emphasis	NN
cord-014462-11ggaqf1	329	5	towards	towards	IN
cord-014462-11ggaqf1	329	6	standardization	standardization	NN
cord-014462-11ggaqf1	329	7	and	and	CC
cord-014462-11ggaqf1	329	8	harmonization	harmonization	NN
cord-014462-11ggaqf1	329	9	,	,	,
cord-014462-11ggaqf1	329	10	inter	inter	JJ
cord-014462-11ggaqf1	329	11	-	-	JJ
cord-014462-11ggaqf1	329	12	calibration	calibration	JJ
cord-014462-11ggaqf1	329	13	exercises	exercise	NNS
cord-014462-11ggaqf1	329	14	and	and	CC
cord-014462-11ggaqf1	329	15	quality	quality	NN
cord-014462-11ggaqf1	329	16	assurance	assurance	NN
cord-014462-11ggaqf1	329	17	in	in	IN
cord-014462-11ggaqf1	329	18	laboratories	laboratory	NNS
cord-014462-11ggaqf1	329	19	,	,	,
cord-014462-11ggaqf1	329	20	accreditation	accreditation	NN
cord-014462-11ggaqf1	329	21	program	program	NN
cord-014462-11ggaqf1	329	22	and	and	CC
cord-014462-11ggaqf1	329	23	utilization	utilization	NN
cord-014462-11ggaqf1	329	24	of	of	IN
cord-014462-11ggaqf1	329	25	regional	regional	JJ
cord-014462-11ggaqf1	329	26	resource	resource	NN
cord-014462-11ggaqf1	329	27	centres	centre	NNS
cord-014462-11ggaqf1	329	28	on	on	IN
cord-014462-11ggaqf1	329	29	aquatic	aquatic	JJ
cord-014462-11ggaqf1	329	30	animal	animal	NN
cord-014462-11ggaqf1	329	31	health	health	NN
cord-014462-11ggaqf1	329	32	will	will	MD
cord-014462-11ggaqf1	329	33	also	also	RB
cord-014462-11ggaqf1	329	34	be	be	VB
cord-014462-11ggaqf1	329	35	needed	need	VBN
cord-014462-11ggaqf1	329	36	.	.	.
cord-014462-11ggaqf1	330	1	Whilst	whilst	IN
cord-014462-11ggaqf1	330	2	most	most	JJS
cord-014462-11ggaqf1	330	3	of	of	IN
cord-014462-11ggaqf1	330	4	these	these	DT
cord-014462-11ggaqf1	330	5	strategies	strategy	NNS
cord-014462-11ggaqf1	330	6	are	be	VBP
cord-014462-11ggaqf1	330	7	directed	direct	VBN
cord-014462-11ggaqf1	330	8	in	in	IN
cord-014462-11ggaqf1	330	9	support	support	NN
cord-014462-11ggaqf1	330	10	of	of	IN
cord-014462-11ggaqf1	330	11	government	government	NN
cord-014462-11ggaqf1	330	12	policies	policy	NNS
cord-014462-11ggaqf1	330	13	,	,	,
cord-014462-11ggaqf1	330	14	implementation	implementation	NN
cord-014462-11ggaqf1	330	15	will	will	MD
cord-014462-11ggaqf1	330	16	require	require	VB
cord-014462-11ggaqf1	330	17	pro	pro	JJ
cord-014462-11ggaqf1	330	18	-	-	JJ
cord-014462-11ggaqf1	330	19	active	active	JJ
cord-014462-11ggaqf1	330	20	involvement	involvement	NN
cord-014462-11ggaqf1	330	21	,	,	,
cord-014462-11ggaqf1	330	22	effective	effective	JJ
cord-014462-11ggaqf1	330	23	cooperation	cooperation	NN
cord-014462-11ggaqf1	330	24	and	and	CC
cord-014462-11ggaqf1	330	25	strategic	strategic	JJ
cord-014462-11ggaqf1	330	26	networking	networking	NN
cord-014462-11ggaqf1	330	27	between	between	IN
cord-014462-11ggaqf1	330	28	governments	government	NNS
cord-014462-11ggaqf1	330	29	,	,	,
cord-014462-11ggaqf1	330	30	farmers	farmer	NNS
cord-014462-11ggaqf1	330	31	,	,	,
cord-014462-11ggaqf1	330	32	researchers	researcher	NNS
cord-014462-11ggaqf1	330	33	,	,	,
cord-014462-11ggaqf1	330	34	scientists	scientist	NNS
cord-014462-11ggaqf1	330	35	,	,	,
cord-014462-11ggaqf1	330	36	development	development	NN
cord-014462-11ggaqf1	330	37	and	and	CC
cord-014462-11ggaqf1	330	38	aid	aid	NN
cord-014462-11ggaqf1	330	39	agencies	agency	NNS
cord-014462-11ggaqf1	330	40	,	,	,
cord-014462-11ggaqf1	330	41	and	and	CC
cord-014462-11ggaqf1	330	42	relevant	relevant	JJ
cord-014462-11ggaqf1	330	43	private	private	JJ
cord-014462-11ggaqf1	330	44	sector	sector	NN
cord-014462-11ggaqf1	330	45	stakeholders	stakeholder	NNS
cord-014462-11ggaqf1	330	46	at	at	IN
cord-014462-11ggaqf1	330	47	all	all	DT
cord-014462-11ggaqf1	330	48	levels	level	NNS
cord-014462-11ggaqf1	330	49	.	.	.
cord-014462-11ggaqf1	331	1	Their	-PRON-	PRP$
cord-014462-11ggaqf1	331	2	contributions	contribution	NNS
cord-014462-11ggaqf1	331	3	are	be	VBP
cord-014462-11ggaqf1	331	4	essential	essential	JJ
cord-014462-11ggaqf1	331	5	to	to	IN
cord-014462-11ggaqf1	331	6	the	the	DT
cord-014462-11ggaqf1	331	7	health	health	NN
cord-014462-11ggaqf1	331	8	management	management	NN
cord-014462-11ggaqf1	331	9	process	process	NN
cord-014462-11ggaqf1	331	10	.	.	.
cord-014462-11ggaqf1	332	1	Generally	generally	RB
cord-014462-11ggaqf1	332	2	,	,	,
cord-014462-11ggaqf1	332	3	aquaculture	aquaculture	NN
cord-014462-11ggaqf1	332	4	plays	play	VBZ
cord-014462-11ggaqf1	332	5	an	an	DT
cord-014462-11ggaqf1	332	6	important	important	JJ
cord-014462-11ggaqf1	332	7	role	role	NN
cord-014462-11ggaqf1	332	8	in	in	IN
cord-014462-11ggaqf1	332	9	economy	economy	NN
cord-014462-11ggaqf1	332	10	as	as	IN
cord-014462-11ggaqf1	332	11	harvests	harvest	NNS
cord-014462-11ggaqf1	332	12	from	from	IN
cord-014462-11ggaqf1	332	13	natural	natural	JJ
cord-014462-11ggaqf1	332	14	waters	water	NNS
cord-014462-11ggaqf1	332	15	have	have	VBP
cord-014462-11ggaqf1	332	16	declined	decline	VBN
cord-014462-11ggaqf1	332	17	or	or	CC
cord-014462-11ggaqf1	332	18	,	,	,
cord-014462-11ggaqf1	332	19	at	at	IN
cord-014462-11ggaqf1	332	20	best	good	JJS
cord-014462-11ggaqf1	332	21	,	,	,
cord-014462-11ggaqf1	332	22	remained	remain	VBD
cord-014462-11ggaqf1	332	23	static	static	JJ
cord-014462-11ggaqf1	332	24	in	in	IN
cord-014462-11ggaqf1	332	25	most	most	JJS
cord-014462-11ggaqf1	332	26	countries	country	NNS
cord-014462-11ggaqf1	332	27	.	.	.
cord-014462-11ggaqf1	333	1	Fish	fish	NN
cord-014462-11ggaqf1	333	2	and	and	CC
cord-014462-11ggaqf1	333	3	shrimp	shrimp	NN
cord-014462-11ggaqf1	333	4	,	,	,
cord-014462-11ggaqf1	333	5	the	the	DT
cord-014462-11ggaqf1	333	6	main	main	JJ
cord-014462-11ggaqf1	333	7	aquaculture	aquaculture	NN
cord-014462-11ggaqf1	333	8	product	product	NN
cord-014462-11ggaqf1	333	9	sources	source	NNS
cord-014462-11ggaqf1	333	10	,	,	,
cord-014462-11ggaqf1	333	11	have	have	VBP
cord-014462-11ggaqf1	333	12	gained	gain	VBN
cord-014462-11ggaqf1	333	13	the	the	DT
cord-014462-11ggaqf1	333	14	most	most	JJS
cord-014462-11ggaqf1	333	15	attention	attention	NN
cord-014462-11ggaqf1	333	16	.	.	.
cord-014462-11ggaqf1	334	1	Many	many	JJ
cord-014462-11ggaqf1	334	2	factors	factor	NNS
cord-014462-11ggaqf1	334	3	can	can	MD
cord-014462-11ggaqf1	334	4	cause	cause	VB
cord-014462-11ggaqf1	334	5	losses	loss	NNS
cord-014462-11ggaqf1	334	6	in	in	IN
cord-014462-11ggaqf1	334	7	yields	yield	NNS
cord-014462-11ggaqf1	334	8	of	of	IN
cord-014462-11ggaqf1	334	9	fish	fish	NN
cord-014462-11ggaqf1	334	10	products	product	NNS
cord-014462-11ggaqf1	334	11	and	and	CC
cord-014462-11ggaqf1	334	12	infectious	infectious	JJ
cord-014462-11ggaqf1	334	13	disease	disease	NN
cord-014462-11ggaqf1	334	14	in	in	IN
cord-014462-11ggaqf1	334	15	fish	fish	NN
cord-014462-11ggaqf1	334	16	and	and	CC
cord-014462-11ggaqf1	334	17	shrimp	shrimp	NN
cord-014462-11ggaqf1	334	18	is	be	VBZ
cord-014462-11ggaqf1	334	19	the	the	DT
cord-014462-11ggaqf1	334	20	biggest	big	JJS
cord-014462-11ggaqf1	334	21	threat	threat	NN
cord-014462-11ggaqf1	334	22	to	to	IN
cord-014462-11ggaqf1	334	23	the	the	DT
cord-014462-11ggaqf1	334	24	fishery	fishery	NN
cord-014462-11ggaqf1	334	25	industry	industry	NN
cord-014462-11ggaqf1	334	26	.	.	.
cord-014462-11ggaqf1	335	1	Shrimp	shrimp	NN
cord-014462-11ggaqf1	335	2	and	and	CC
cord-014462-11ggaqf1	335	3	fish	fish	NN
cord-014462-11ggaqf1	335	4	aquaculture	aquaculture	NN
cord-014462-11ggaqf1	335	5	has	have	VBZ
cord-014462-11ggaqf1	335	6	grown	grow	VBN
cord-014462-11ggaqf1	335	7	rapidly	rapidly	RB
cord-014462-11ggaqf1	335	8	over	over	IN
cord-014462-11ggaqf1	335	9	several	several	JJ
cord-014462-11ggaqf1	335	10	decades	decade	NNS
cord-014462-11ggaqf1	335	11	to	to	TO
cord-014462-11ggaqf1	335	12	become	become	VB
cord-014462-11ggaqf1	335	13	a	a	DT
cord-014462-11ggaqf1	335	14	major	major	JJ
cord-014462-11ggaqf1	335	15	global	global	JJ
cord-014462-11ggaqf1	335	16	industry	industry	NN
cord-014462-11ggaqf1	335	17	that	that	WDT
cord-014462-11ggaqf1	335	18	serves	serve	VBZ
cord-014462-11ggaqf1	335	19	the	the	DT
cord-014462-11ggaqf1	335	20	increasing	increase	VBG
cord-014462-11ggaqf1	335	21	consumer	consumer	NN
cord-014462-11ggaqf1	335	22	demand	demand	NN
cord-014462-11ggaqf1	335	23	for	for	IN
cord-014462-11ggaqf1	335	24	seafood	seafood	NN
cord-014462-11ggaqf1	335	25	and	and	CC
cord-014462-11ggaqf1	335	26	has	have	VBZ
cord-014462-11ggaqf1	335	27	contributed	contribute	VBN
cord-014462-11ggaqf1	335	28	significantly	significantly	RB
cord-014462-11ggaqf1	335	29	to	to	IN
cord-014462-11ggaqf1	335	30	socio	socio	JJ
cord-014462-11ggaqf1	335	31	-	-	HYPH
cord-014462-11ggaqf1	335	32	economic	economic	JJ
cord-014462-11ggaqf1	335	33	development	development	NN
cord-014462-11ggaqf1	335	34	in	in	IN
cord-014462-11ggaqf1	335	35	many	many	JJ
cord-014462-11ggaqf1	335	36	poor	poor	JJ
cord-014462-11ggaqf1	335	37	coastal	coastal	JJ
cord-014462-11ggaqf1	335	38	communities	community	NNS
cord-014462-11ggaqf1	335	39	.	.	.
cord-014462-11ggaqf1	336	1	However	however	RB
cord-014462-11ggaqf1	336	2	,	,	,
cord-014462-11ggaqf1	336	3	the	the	DT
cord-014462-11ggaqf1	336	4	ecological	ecological	JJ
cord-014462-11ggaqf1	336	5	disturbances	disturbance	NNS
cord-014462-11ggaqf1	336	6	and	and	CC
cord-014462-11ggaqf1	336	7	changes	change	NNS
cord-014462-11ggaqf1	336	8	in	in	IN
cord-014462-11ggaqf1	336	9	patterns	pattern	NNS
cord-014462-11ggaqf1	336	10	of	of	IN
cord-014462-11ggaqf1	336	11	trade	trade	NN
cord-014462-11ggaqf1	336	12	associated	associate	VBN
cord-014462-11ggaqf1	336	13	with	with	IN
cord-014462-11ggaqf1	336	14	the	the	DT
cord-014462-11ggaqf1	336	15	development	development	NN
cord-014462-11ggaqf1	336	16	of	of	IN
cord-014462-11ggaqf1	336	17	shrimp	shrimp	NN
cord-014462-11ggaqf1	336	18	and	and	CC
cord-014462-11ggaqf1	336	19	fish	fish	NN
cord-014462-11ggaqf1	336	20	farming	farming	NN
cord-014462-11ggaqf1	336	21	have	have	VBP
cord-014462-11ggaqf1	336	22	presented	present	VBN
cord-014462-11ggaqf1	336	23	many	many	JJ
cord-014462-11ggaqf1	336	24	of	of	IN
cord-014462-11ggaqf1	336	25	the	the	DT
cord-014462-11ggaqf1	336	26	pre	pre	JJ
cord-014462-11ggaqf1	336	27	-	-	NNS
cord-014462-11ggaqf1	336	28	conditions	condition	NNS
cord-014462-11ggaqf1	336	29	for	for	IN
cord-014462-11ggaqf1	336	30	the	the	DT
cord-014462-11ggaqf1	336	31	emergence	emergence	NN
cord-014462-11ggaqf1	336	32	and	and	CC
cord-014462-11ggaqf1	336	33	spread	spread	NN
cord-014462-11ggaqf1	336	34	of	of	IN
cord-014462-11ggaqf1	336	35	disease	disease	NN
cord-014462-11ggaqf1	336	36	.	.	.
cord-014462-11ggaqf1	337	1	Shrimp	shrimp	NN
cord-014462-11ggaqf1	337	2	and	and	CC
cord-014462-11ggaqf1	337	3	fish	fish	NN
cord-014462-11ggaqf1	337	4	are	be	VBP
cord-014462-11ggaqf1	337	5	displaced	displace	VBN
cord-014462-11ggaqf1	337	6	from	from	IN
cord-014462-11ggaqf1	337	7	their	-PRON-	PRP$
cord-014462-11ggaqf1	337	8	natural	natural	JJ
cord-014462-11ggaqf1	337	9	environments	environment	NNS
cord-014462-11ggaqf1	337	10	,	,	,
cord-014462-11ggaqf1	337	11	provided	provide	VBN
cord-014462-11ggaqf1	337	12	artificial	artificial	JJ
cord-014462-11ggaqf1	337	13	or	or	CC
cord-014462-11ggaqf1	337	14	alternative	alternative	JJ
cord-014462-11ggaqf1	337	15	feeds	feed	NNS
cord-014462-11ggaqf1	337	16	,	,	,
cord-014462-11ggaqf1	337	17	stocked	stock	VBN
cord-014462-11ggaqf1	337	18	in	in	IN
cord-014462-11ggaqf1	337	19	high	high	JJ
cord-014462-11ggaqf1	337	20	density	density	NN
cord-014462-11ggaqf1	337	21	,	,	,
cord-014462-11ggaqf1	337	22	exposed	expose	VBN
cord-014462-11ggaqf1	337	23	to	to	IN
cord-014462-11ggaqf1	337	24	stress	stress	VB
cord-014462-11ggaqf1	337	25	through	through	IN
cord-014462-11ggaqf1	337	26	changes	change	NNS
cord-014462-11ggaqf1	337	27	in	in	IN
cord-014462-11ggaqf1	337	28	water	water	NN
cord-014462-11ggaqf1	337	29	quality	quality	NN
cord-014462-11ggaqf1	337	30	and	and	CC
cord-014462-11ggaqf1	337	31	are	be	VBP
cord-014462-11ggaqf1	337	32	transported	transport	VBN
cord-014462-11ggaqf1	337	33	nationally	nationally	RB
cord-014462-11ggaqf1	337	34	and	and	CC
cord-014462-11ggaqf1	337	35	internationally	internationally	RB
cord-014462-11ggaqf1	337	36	,	,	,
cord-014462-11ggaqf1	337	37	either	either	CC
cord-014462-11ggaqf1	337	38	live	live	VBP
cord-014462-11ggaqf1	337	39	or	or	CC
cord-014462-11ggaqf1	337	40	as	as	IN
cord-014462-11ggaqf1	337	41	frozen	frozen	JJ
cord-014462-11ggaqf1	337	42	product	product	NN
cord-014462-11ggaqf1	337	43	.	.	.
cord-014462-11ggaqf1	338	1	These	these	DT
cord-014462-11ggaqf1	338	2	practices	practice	NNS
cord-014462-11ggaqf1	338	3	have	have	VBP
cord-014462-11ggaqf1	338	4	provided	provide	VBN
cord-014462-11ggaqf1	338	5	opportunities	opportunity	NNS
cord-014462-11ggaqf1	338	6	for	for	IN
cord-014462-11ggaqf1	338	7	increased	increase	VBN
cord-014462-11ggaqf1	338	8	pathogenicity	pathogenicity	NN
cord-014462-11ggaqf1	338	9	of	of	IN
cord-014462-11ggaqf1	338	10	existing	exist	VBG
cord-014462-11ggaqf1	338	11	infections	infection	NNS
cord-014462-11ggaqf1	338	12	,	,	,
cord-014462-11ggaqf1	338	13	exposure	exposure	NN
cord-014462-11ggaqf1	338	14	to	to	IN
cord-014462-11ggaqf1	338	15	new	new	JJ
cord-014462-11ggaqf1	338	16	pathogens	pathogen	NNS
cord-014462-11ggaqf1	338	17	,	,	,
cord-014462-11ggaqf1	338	18	and	and	CC
cord-014462-11ggaqf1	338	19	the	the	DT
cord-014462-11ggaqf1	338	20	rapid	rapid	JJ
cord-014462-11ggaqf1	338	21	transmission	transmission	NN
cord-014462-11ggaqf1	338	22	and	and	CC
cord-014462-11ggaqf1	338	23	trans	trans	NNP
cord-014462-11ggaqf1	338	24	boundary	boundary	NNP
cord-014462-11ggaqf1	338	25	spread	spread	NN
cord-014462-11ggaqf1	338	26	of	of	IN
cord-014462-11ggaqf1	338	27	disease	disease	NN
cord-014462-11ggaqf1	338	28	.	.	.
cord-014462-11ggaqf1	339	1	Not	not	RB
cord-014462-11ggaqf1	339	2	surprisingly	surprisingly	RB
cord-014462-11ggaqf1	339	3	,	,	,
cord-014462-11ggaqf1	339	4	a	a	DT
cord-014462-11ggaqf1	339	5	succession	succession	NN
cord-014462-11ggaqf1	339	6	of	of	IN
cord-014462-11ggaqf1	339	7	new	new	JJ
cord-014462-11ggaqf1	339	8	viral	viral	JJ
cord-014462-11ggaqf1	339	9	diseases	disease	NNS
cord-014462-11ggaqf1	339	10	has	have	VBZ
cord-014462-11ggaqf1	339	11	devastated	devastate	VBN
cord-014462-11ggaqf1	339	12	the	the	DT
cord-014462-11ggaqf1	339	13	production	production	NN
cord-014462-11ggaqf1	339	14	and	and	CC
cord-014462-11ggaqf1	339	15	livelihoods	livelihood	NNS
cord-014462-11ggaqf1	339	16	of	of	IN
cord-014462-11ggaqf1	339	17	farmers	farmer	NNS
cord-014462-11ggaqf1	339	18	and	and	CC
cord-014462-11ggaqf1	339	19	their	-PRON-	PRP$
cord-014462-11ggaqf1	339	20	sustaining	sustain	VBG
cord-014462-11ggaqf1	339	21	communities	community	NNS
cord-014462-11ggaqf1	339	22	.	.	.
cord-014462-11ggaqf1	340	1	This	this	DT
cord-014462-11ggaqf1	340	2	review	review	NN
cord-014462-11ggaqf1	340	3	examines	examine	VBZ
cord-014462-11ggaqf1	340	4	the	the	DT
cord-014462-11ggaqf1	340	5	major	major	JJ
cord-014462-11ggaqf1	340	6	viral	viral	JJ
cord-014462-11ggaqf1	340	7	pathogens	pathogen	NNS
cord-014462-11ggaqf1	340	8	of	of	IN
cord-014462-11ggaqf1	340	9	farmed	farm	VBN
cord-014462-11ggaqf1	340	10	shrimp	shrimp	NN
cord-014462-11ggaqf1	340	11	and	and	CC
cord-014462-11ggaqf1	340	12	fish	fish	NN
cord-014462-11ggaqf1	340	13	,	,	,
cord-014462-11ggaqf1	340	14	the	the	DT
cord-014462-11ggaqf1	340	15	likely	likely	JJ
cord-014462-11ggaqf1	340	16	reasons	reason	NNS
cord-014462-11ggaqf1	340	17	for	for	IN
cord-014462-11ggaqf1	340	18	their	-PRON-	PRP$
cord-014462-11ggaqf1	340	19	emergence	emergence	NN
cord-014462-11ggaqf1	340	20	and	and	CC
cord-014462-11ggaqf1	340	21	spread	spread	NN
cord-014462-11ggaqf1	340	22	,	,	,
cord-014462-11ggaqf1	340	23	and	and	CC
cord-014462-11ggaqf1	340	24	the	the	DT
cord-014462-11ggaqf1	340	25	consequences	consequence	NNS
cord-014462-11ggaqf1	340	26	for	for	IN
cord-014462-11ggaqf1	340	27	the	the	DT
cord-014462-11ggaqf1	340	28	structure	structure	NN
cord-014462-11ggaqf1	340	29	and	and	CC
cord-014462-11ggaqf1	340	30	operation	operation	NN
cord-014462-11ggaqf1	340	31	of	of	IN
cord-014462-11ggaqf1	340	32	the	the	DT
cord-014462-11ggaqf1	340	33	shrimp	shrimp	NN
cord-014462-11ggaqf1	340	34	farming	farming	NN
cord-014462-11ggaqf1	340	35	industry	industry	NN
cord-014462-11ggaqf1	340	36	.	.	.
cord-014462-11ggaqf1	341	1	In	in	IN
cord-014462-11ggaqf1	341	2	addition	addition	NN
cord-014462-11ggaqf1	341	3	,	,	,
cord-014462-11ggaqf1	341	4	this	this	DT
cord-014462-11ggaqf1	341	5	review	review	NN
cord-014462-11ggaqf1	341	6	discusses	discuss	VBZ
cord-014462-11ggaqf1	341	7	the	the	DT
cord-014462-11ggaqf1	341	8	health	health	NN
cord-014462-11ggaqf1	341	9	management	management	NN
cord-014462-11ggaqf1	341	10	strategies	strategy	NNS
cord-014462-11ggaqf1	341	11	that	that	WDT
cord-014462-11ggaqf1	341	12	have	have	VBP
cord-014462-11ggaqf1	341	13	been	be	VBN
cord-014462-11ggaqf1	341	14	introduced	introduce	VBN
cord-014462-11ggaqf1	341	15	to	to	TO
cord-014462-11ggaqf1	341	16	combat	combat	VB
cord-014462-11ggaqf1	341	17	the	the	DT
cord-014462-11ggaqf1	341	18	major	major	JJ
cord-014462-11ggaqf1	341	19	pathogens	pathogen	NNS
cord-014462-11ggaqf1	341	20	and	and	CC
cord-014462-11ggaqf1	341	21	the	the	DT
cord-014462-11ggaqf1	341	22	reasons	reason	NNS
cord-014462-11ggaqf1	341	23	that	that	WDT
cord-014462-11ggaqf1	341	24	disease	disease	NN
cord-014462-11ggaqf1	341	25	continues	continue	VBZ
cord-014462-11ggaqf1	341	26	to	to	TO
cord-014462-11ggaqf1	341	27	have	have	VB
cord-014462-11ggaqf1	341	28	an	an	DT
cord-014462-11ggaqf1	341	29	impact	impact	NN
cord-014462-11ggaqf1	341	30	,	,	,
cord-014462-11ggaqf1	341	31	particularly	particularly	RB
cord-014462-11ggaqf1	341	32	on	on	IN
cord-014462-11ggaqf1	341	33	poor	poor	JJ
cord-014462-11ggaqf1	341	34	,	,	,
cord-014462-11ggaqf1	341	35	smallholder	smallholder	NN
cord-014462-11ggaqf1	341	36	farmers	farmer	NNS
cord-014462-11ggaqf1	341	37	in	in	IN
cord-014462-11ggaqf1	341	38	Asia	Asia	NNP
cord-014462-11ggaqf1	341	39	.	.	.
cord-014462-11ggaqf1	342	1	BTV	BTV	NNP
cord-014462-11ggaqf1	342	2	isolates	isolate	VBZ
cord-014462-11ggaqf1	342	3	from	from	IN
cord-014462-11ggaqf1	342	4	the	the	DT
cord-014462-11ggaqf1	342	5	same	same	JJ
cord-014462-11ggaqf1	342	6	geographic	geographic	JJ
cord-014462-11ggaqf1	342	7	region	region	NN
cord-014462-11ggaqf1	342	8	have	have	VBP
cord-014462-11ggaqf1	342	9	been	be	VBN
cord-014462-11ggaqf1	342	10	termed	term	VBN
cord-014462-11ggaqf1	342	11	as	as	IN
cord-014462-11ggaqf1	342	12	'	'	``
cord-014462-11ggaqf1	342	13	topotypes	topotypes	NNP
cord-014462-11ggaqf1	342	14	'	'	POS
cord-014462-11ggaqf1	342	15	and	and	CC
cord-014462-11ggaqf1	342	16	initial	initial	JJ
cord-014462-11ggaqf1	342	17	observation	observation	NN
cord-014462-11ggaqf1	342	18	on	on	IN
cord-014462-11ggaqf1	342	19	segment	segment	NN
cord-014462-11ggaqf1	342	20	3	3	CD
cord-014462-11ggaqf1	342	21	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	342	22	sequences	sequence	NNS
cord-014462-11ggaqf1	342	23	identified	identify	VBD
cord-014462-11ggaqf1	342	24	a	a	DT
cord-014462-11ggaqf1	342	25	correlation	correlation	NN
cord-014462-11ggaqf1	342	26	between	between	IN
cord-014462-11ggaqf1	342	27	topotypes	topotype	NNS
cord-014462-11ggaqf1	342	28	and	and	CC
cord-014462-11ggaqf1	342	29	genetic	genetic	JJ
cord-014462-11ggaqf1	342	30	information	information	NN
cord-014462-11ggaqf1	342	31	.	.	.
cord-014462-11ggaqf1	343	1	Later	later	RB
cord-014462-11ggaqf1	343	2	topotyping	topotyping	NNP
cord-014462-11ggaqf1	343	3	was	be	VBD
cord-014462-11ggaqf1	343	4	proposed	propose	VBN
cord-014462-11ggaqf1	343	5	based	base	VBN
cord-014462-11ggaqf1	343	6	on	on	IN
cord-014462-11ggaqf1	343	7	segment	segment	NN
cord-014462-11ggaqf1	343	8	10	10	CD
cord-014462-11ggaqf1	343	9	,	,	,
cord-014462-11ggaqf1	343	10	on	on	IN
cord-014462-11ggaqf1	343	11	the	the	DT
cord-014462-11ggaqf1	343	12	premise	premise	NN
cord-014462-11ggaqf1	343	13	that	that	IN
cord-014462-11ggaqf1	343	14	the	the	DT
cord-014462-11ggaqf1	343	15	encoding	encoding	NN
cord-014462-11ggaqf1	343	16	protein	protein	NN
cord-014462-11ggaqf1	343	17	NS3	ns3	RB
cord-014462-11ggaqf1	343	18	,	,	,
cord-014462-11ggaqf1	343	19	which	which	WDT
cord-014462-11ggaqf1	343	20	is	be	VBZ
cord-014462-11ggaqf1	343	21	involved	involve	VBN
cord-014462-11ggaqf1	343	22	in	in	IN
cord-014462-11ggaqf1	343	23	virus	virus	NN
cord-014462-11ggaqf1	343	24	egress	egress	NN
cord-014462-11ggaqf1	343	25	from	from	IN
cord-014462-11ggaqf1	343	26	insect	insect	NN
cord-014462-11ggaqf1	343	27	cells	cell	NNS
cord-014462-11ggaqf1	343	28	,	,	,
cord-014462-11ggaqf1	343	29	would	would	MD
cord-014462-11ggaqf1	343	30	lead	lead	VB
cord-014462-11ggaqf1	343	31	to	to	IN
cord-014462-11ggaqf1	343	32	evolutionary	evolutionary	JJ
cord-014462-11ggaqf1	343	33	fitness	fitness	NN
cord-014462-11ggaqf1	343	34	in	in	IN
cord-014462-11ggaqf1	343	35	parallel	parallel	NN
cord-014462-11ggaqf1	343	36	with	with	IN
cord-014462-11ggaqf1	343	37	the	the	DT
cord-014462-11ggaqf1	343	38	geographic	geographic	JJ
cord-014462-11ggaqf1	343	39	distribution	distribution	NN
cord-014462-11ggaqf1	343	40	of	of	IN
cord-014462-11ggaqf1	343	41	the	the	DT
cord-014462-11ggaqf1	343	42	different	different	JJ
cord-014462-11ggaqf1	343	43	Culicoides	Culicoides	NNP
cord-014462-11ggaqf1	343	44	species	specie	NNS
cord-014462-11ggaqf1	343	45	.	.	.
cord-014462-11ggaqf1	344	1	Further	further	JJ
cord-014462-11ggaqf1	344	2	studies	study	NNS
cord-014462-11ggaqf1	344	3	attempted	attempt	VBD
cord-014462-11ggaqf1	344	4	to	to	TO
cord-014462-11ggaqf1	344	5	extend	extend	VB
cord-014462-11ggaqf1	344	6	this	this	DT
cord-014462-11ggaqf1	344	7	to	to	IN
cord-014462-11ggaqf1	344	8	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	344	9	sequence	sequence	NN
cord-014462-11ggaqf1	344	10	homology	homology	NN
cord-014462-11ggaqf1	344	11	in	in	IN
cord-014462-11ggaqf1	344	12	segments	segment	NNS
cord-014462-11ggaqf1	344	13	7	7	CD
cord-014462-11ggaqf1	344	14	and	and	CC
cord-014462-11ggaqf1	344	15	10	10	CD
cord-014462-11ggaqf1	344	16	,	,	,
cord-014462-11ggaqf1	344	17	but	but	CC
cord-014462-11ggaqf1	344	18	failed	fail	VBD
cord-014462-11ggaqf1	344	19	to	to	TO
cord-014462-11ggaqf1	344	20	identify	identify	VB
cord-014462-11ggaqf1	344	21	clear	clear	JJ
cord-014462-11ggaqf1	344	22	cut	cut	JJ
cord-014462-11ggaqf1	344	23	correlations	correlation	NNS
cord-014462-11ggaqf1	344	24	or	or	CC
cord-014462-11ggaqf1	344	25	any	any	DT
cord-014462-11ggaqf1	344	26	evidence	evidence	NN
cord-014462-11ggaqf1	344	27	for	for	IN
cord-014462-11ggaqf1	344	28	positive	positive	JJ
cord-014462-11ggaqf1	344	29	selection	selection	NN
cord-014462-11ggaqf1	344	30	.	.	.
cord-014462-11ggaqf1	345	1	For	for	IN
cord-014462-11ggaqf1	345	2	example	example	NN
cord-014462-11ggaqf1	345	3	,	,	,
cord-014462-11ggaqf1	345	4	South	south	JJ
cord-014462-11ggaqf1	345	5	African	african	JJ
cord-014462-11ggaqf1	345	6	isolates	isolate	NNS
cord-014462-11ggaqf1	345	7	were	be	VBD
cord-014462-11ggaqf1	345	8	found	find	VBN
cord-014462-11ggaqf1	345	9	not	not	RB
cord-014462-11ggaqf1	345	10	to	to	TO
cord-014462-11ggaqf1	345	11	cluster	cluster	VB
cord-014462-11ggaqf1	345	12	into	into	IN
cord-014462-11ggaqf1	345	13	separate	separate	JJ
cord-014462-11ggaqf1	345	14	African	african	JJ
cord-014462-11ggaqf1	345	15	lineage	lineage	NN
cord-014462-11ggaqf1	345	16	.	.	.
cord-014462-11ggaqf1	346	1	In	in	IN
cord-014462-11ggaqf1	346	2	this	this	DT
cord-014462-11ggaqf1	346	3	study	study	NN
cord-014462-11ggaqf1	346	4	,	,	,
cord-014462-11ggaqf1	346	5	we	-PRON-	PRP
cord-014462-11ggaqf1	346	6	carried	carry	VBD
cord-014462-11ggaqf1	346	7	out	out	RP
cord-014462-11ggaqf1	346	8	a	a	DT
cord-014462-11ggaqf1	346	9	more	more	RBR
cord-014462-11ggaqf1	346	10	extensive	extensive	JJ
cord-014462-11ggaqf1	346	11	analysis	analysis	NN
cord-014462-11ggaqf1	346	12	of	of	IN
cord-014462-11ggaqf1	346	13	segment	segment	NN
cord-014462-11ggaqf1	346	14	10	10	CD
cord-014462-11ggaqf1	346	15	sequences	sequence	NNS
cord-014462-11ggaqf1	346	16	.	.	.
cord-014462-11ggaqf1	347	1	Our	-PRON-	PRP$
cord-014462-11ggaqf1	347	2	analysis	analysis	NN
cord-014462-11ggaqf1	347	3	showed	show	VBD
cord-014462-11ggaqf1	347	4	no	no	DT
cord-014462-11ggaqf1	347	5	segregation	segregation	NN
cord-014462-11ggaqf1	347	6	of	of	IN
cord-014462-11ggaqf1	347	7	isolates	isolate	NNS
cord-014462-11ggaqf1	347	8	into	into	IN
cord-014462-11ggaqf1	347	9	topographically	topographically	RB
cord-014462-11ggaqf1	347	10	distinct	distinct	JJ
cord-014462-11ggaqf1	347	11	groups	group	NNS
cord-014462-11ggaqf1	347	12	.	.	.
cord-014462-11ggaqf1	348	1	Instead	instead	RB
cord-014462-11ggaqf1	348	2	we	-PRON-	PRP
cord-014462-11ggaqf1	348	3	observed	observe	VBD
cord-014462-11ggaqf1	348	4	topological	topological	JJ
cord-014462-11ggaqf1	348	5	clustering	clustering	NN
cord-014462-11ggaqf1	348	6	of	of	IN
cord-014462-11ggaqf1	348	7	the	the	DT
cord-014462-11ggaqf1	348	8	clades	clade	NNS
cord-014462-11ggaqf1	348	9	,	,	,
cord-014462-11ggaqf1	348	10	and	and	CC
cord-014462-11ggaqf1	348	11	we	-PRON-	PRP
cord-014462-11ggaqf1	348	12	attribute	attribute	VBP
cord-014462-11ggaqf1	348	13	this	this	DT
cord-014462-11ggaqf1	348	14	to	to	IN
cord-014462-11ggaqf1	348	15	genetic	genetic	JJ
cord-014462-11ggaqf1	348	16	bottleneck	bottleneck	NN
cord-014462-11ggaqf1	348	17	resulting	result	VBG
cord-014462-11ggaqf1	348	18	in	in	IN
cord-014462-11ggaqf1	348	19	genetic	genetic	JJ
cord-014462-11ggaqf1	348	20	drift	drift	NN
cord-014462-11ggaqf1	348	21	and	and	CC
cord-014462-11ggaqf1	348	22	founder	founder	NN
cord-014462-11ggaqf1	348	23	effect	effect	NN
cord-014462-11ggaqf1	348	24	leading	lead	VBG
cord-014462-11ggaqf1	348	25	to	to	IN
cord-014462-11ggaqf1	348	26	homogenous	homogenous	JJ
cord-014462-11ggaqf1	348	27	gene	gene	NN
cord-014462-11ggaqf1	348	28	pool	pool	NN
cord-014462-11ggaqf1	348	29	in	in	IN
cord-014462-11ggaqf1	348	30	a	a	DT
cord-014462-11ggaqf1	348	31	geographical	geographical	JJ
cord-014462-11ggaqf1	348	32	area	area	NN
cord-014462-11ggaqf1	348	33	.	.	.
cord-014462-11ggaqf1	349	1	We	-PRON-	PRP
cord-014462-11ggaqf1	349	2	hypothesize	hypothesize	VBP
cord-014462-11ggaqf1	349	3	that	that	IN
cord-014462-11ggaqf1	349	4	when	when	WRB
cord-014462-11ggaqf1	349	5	a	a	DT
cord-014462-11ggaqf1	349	6	new	new	JJ
cord-014462-11ggaqf1	349	7	virus	virus	NN
cord-014462-11ggaqf1	349	8	enters	enter	VBZ
cord-014462-11ggaqf1	349	9	a	a	DT
cord-014462-11ggaqf1	349	10	geographical	geographical	JJ
cord-014462-11ggaqf1	349	11	area	area	NN
cord-014462-11ggaqf1	349	12	where	where	WRB
cord-014462-11ggaqf1	349	13	local	local	JJ
cord-014462-11ggaqf1	349	14	BTV	BTV	NNP
cord-014462-11ggaqf1	349	15	strains	strain	NNS
cord-014462-11ggaqf1	349	16	are	be	VBP
cord-014462-11ggaqf1	349	17	already	already	RB
cord-014462-11ggaqf1	349	18	circulating	circulate	VBG
cord-014462-11ggaqf1	349	19	,	,	,
cord-014462-11ggaqf1	349	20	the	the	DT
cord-014462-11ggaqf1	349	21	new	new	JJ
cord-014462-11ggaqf1	349	22	genes	gene	NNS
cord-014462-11ggaqf1	349	23	/	/	SYM
cord-014462-11ggaqf1	349	24	segments	segment	NNS
cord-014462-11ggaqf1	349	25	would	would	MD
cord-014462-11ggaqf1	349	26	enter	enter	VB
cord-014462-11ggaqf1	349	27	into	into	IN
cord-014462-11ggaqf1	349	28	a	a	DT
cord-014462-11ggaqf1	349	29	bigger	big	JJR
cord-014462-11ggaqf1	349	30	gene	gene	NN
cord-014462-11ggaqf1	349	31	pool	pool	NN
cord-014462-11ggaqf1	349	32	.	.	.
cord-014462-11ggaqf1	350	1	Consequently	consequently	RB
cord-014462-11ggaqf1	350	2	,	,	,
cord-014462-11ggaqf1	350	3	the	the	DT
cord-014462-11ggaqf1	350	4	newer	new	JJR
cord-014462-11ggaqf1	350	5	incursions	incursion	NNS
cord-014462-11ggaqf1	350	6	into	into	IN
cord-014462-11ggaqf1	350	7	a	a	DT
cord-014462-11ggaqf1	350	8	heavily	heavily	RB
cord-014462-11ggaqf1	350	9	endemic	endemic	JJ
cord-014462-11ggaqf1	350	10	area	area	NN
cord-014462-11ggaqf1	350	11	tend	tend	VBP
cord-014462-11ggaqf1	350	12	to	to	TO
cord-014462-11ggaqf1	350	13	get	get	VB
cord-014462-11ggaqf1	350	14	diluted	dilute	VBN
cord-014462-11ggaqf1	350	15	and	and	CC
cord-014462-11ggaqf1	350	16	disappear	disappear	VB
cord-014462-11ggaqf1	350	17	from	from	IN
cord-014462-11ggaqf1	350	18	the	the	DT
cord-014462-11ggaqf1	350	19	population	population	NN
cord-014462-11ggaqf1	350	20	because	because	IN
cord-014462-11ggaqf1	350	21	the	the	DT
cord-014462-11ggaqf1	350	22	rate	rate	NN
cord-014462-11ggaqf1	350	23	of	of	IN
cord-014462-11ggaqf1	350	24	drift	drift	NN
cord-014462-11ggaqf1	350	25	is	be	VBZ
cord-014462-11ggaqf1	350	26	inversely	inversely	RB
cord-014462-11ggaqf1	350	27	proportional	proportional	JJ
cord-014462-11ggaqf1	350	28	to	to	IN
cord-014462-11ggaqf1	350	29	the	the	DT
cord-014462-11ggaqf1	350	30	population	population	NN
cord-014462-11ggaqf1	350	31	size	size	NN
cord-014462-11ggaqf1	350	32	,	,	,
cord-014462-11ggaqf1	350	33	unless	unless	IN
cord-014462-11ggaqf1	350	34	they	-PRON-	PRP
cord-014462-11ggaqf1	350	35	are	be	VBP
cord-014462-11ggaqf1	350	36	positively	positively	RB
cord-014462-11ggaqf1	350	37	selected	select	VBN
cord-014462-11ggaqf1	350	38	.	.	.
cord-014462-11ggaqf1	351	1	Use	use	NN
cord-014462-11ggaqf1	351	2	of	of	IN
cord-014462-11ggaqf1	351	3	live	live	JJ
cord-014462-11ggaqf1	351	4	attenuated	attenuated	JJ
cord-014462-11ggaqf1	351	5	vaccine	vaccine	NN
cord-014462-11ggaqf1	351	6	in	in	IN
cord-014462-11ggaqf1	351	7	Israel	Israel	NNP
cord-014462-11ggaqf1	351	8	,	,	,
cord-014462-11ggaqf1	351	9	Europe	Europe	NNP
cord-014462-11ggaqf1	351	10	,	,	,
cord-014462-11ggaqf1	351	11	South	South	NNP
cord-014462-11ggaqf1	351	12	Africa	Africa	NNP
cord-014462-11ggaqf1	351	13	and	and	CC
cord-014462-11ggaqf1	351	14	USA	USA	NNP
cord-014462-11ggaqf1	351	15	also	also	RB
cord-014462-11ggaqf1	351	16	led	lead	VBD
cord-014462-11ggaqf1	351	17	to	to	IN
cord-014462-11ggaqf1	351	18	more	more	RBR
cord-014462-11ggaqf1	351	19	homogenous	homogenous	JJ
cord-014462-11ggaqf1	351	20	population	population	NN
cord-014462-11ggaqf1	351	21	similar	similar	JJ
cord-014462-11ggaqf1	351	22	to	to	IN
cord-014462-11ggaqf1	351	23	the	the	DT
cord-014462-11ggaqf1	351	24	vaccine	vaccine	NN
cord-014462-11ggaqf1	351	25	strains	strain	NNS
cord-014462-11ggaqf1	351	26	due	due	JJ
cord-014462-11ggaqf1	351	27	to	to	IN
cord-014462-11ggaqf1	351	28	continuous	continuous	JJ
cord-014462-11ggaqf1	351	29	infusion	infusion	NN
cord-014462-11ggaqf1	351	30	of	of	IN
cord-014462-11ggaqf1	351	31	the	the	DT
cord-014462-11ggaqf1	351	32	vaccine	vaccine	NN
cord-014462-11ggaqf1	351	33	type	type	NN
cord-014462-11ggaqf1	351	34	genes	gene	NNS
cord-014462-11ggaqf1	351	35	into	into	IN
cord-014462-11ggaqf1	351	36	the	the	DT
cord-014462-11ggaqf1	351	37	gene	gene	NN
cord-014462-11ggaqf1	351	38	pool	pool	NN
cord-014462-11ggaqf1	351	39	.	.	.
cord-014462-11ggaqf1	352	1	We	-PRON-	PRP
cord-014462-11ggaqf1	352	2	conclude	conclude	VBP
cord-014462-11ggaqf1	352	3	that	that	IN
cord-014462-11ggaqf1	352	4	restriction	restriction	NN
cord-014462-11ggaqf1	352	5	of	of	IN
cord-014462-11ggaqf1	352	6	specific	specific	JJ
cord-014462-11ggaqf1	352	7	strains	strain	NNS
cord-014462-11ggaqf1	352	8	to	to	IN
cord-014462-11ggaqf1	352	9	certain	certain	JJ
cord-014462-11ggaqf1	352	10	geographical	geographical	JJ
cord-014462-11ggaqf1	352	11	areas	area	NNS
cord-014462-11ggaqf1	352	12	could	could	MD
cord-014462-11ggaqf1	352	13	generate	generate	VB
cord-014462-11ggaqf1	352	14	uniquely	uniquely	RB
cord-014462-11ggaqf1	352	15	imprinted	imprint	VBN
cord-014462-11ggaqf1	352	16	genotypes	genotype	NNS
cord-014462-11ggaqf1	352	17	which	which	WDT
cord-014462-11ggaqf1	352	18	would	would	MD
cord-014462-11ggaqf1	352	19	not	not	RB
cord-014462-11ggaqf1	352	20	only	only	RB
cord-014462-11ggaqf1	352	21	indicate	indicate	VB
cord-014462-11ggaqf1	352	22	origin	origin	NN
cord-014462-11ggaqf1	352	23	but	but	CC
cord-014462-11ggaqf1	352	24	also	also	RB
cord-014462-11ggaqf1	352	25	predict	predict	VBP
cord-014462-11ggaqf1	352	26	movement	movement	NN
cord-014462-11ggaqf1	352	27	of	of	IN
cord-014462-11ggaqf1	352	28	viral	viral	JJ
cord-014462-11ggaqf1	352	29	strains	strain	NNS
cord-014462-11ggaqf1	352	30	to	to	IN
cord-014462-11ggaqf1	352	31	new	new	JJ
cord-014462-11ggaqf1	352	32	areas	area	NNS
cord-014462-11ggaqf1	352	33	.	.	.
cord-014462-11ggaqf1	353	1	VVO-10	VVO-10	NNP
cord-014462-11ggaqf1	354	1	Viral	viral	JJ
cord-014462-11ggaqf1	354	2	Diseases	disease	NNS
cord-014462-11ggaqf1	354	3	of	of	IN
cord-014462-11ggaqf1	354	4	Zoonotic	Zoonotic	NNP
cord-014462-11ggaqf1	354	5	Importance	importance	NN
cord-014462-11ggaqf1	354	6	:	:	:
cord-014462-11ggaqf1	355	1	Indian	Indian	NNP
cord-014462-11ggaqf1	355	2	Context	Context	NNP
cord-014462-11ggaqf1	355	3	K.	K.	NNP
cord-014462-11ggaqf1	355	4	Prabhudas	Prabhudas	NNP
cord-014462-11ggaqf1	355	5	PD	PD	NNP
cord-014462-11ggaqf1	355	6	-	-	HYPH
cord-014462-11ggaqf1	355	7	ADMAS	ADMAS	NNP
cord-014462-11ggaqf1	355	8	,	,	,
cord-014462-11ggaqf1	355	9	IVRI	IVRI	NNP
cord-014462-11ggaqf1	355	10	,	,	,
cord-014462-11ggaqf1	355	11	Campus	Campus	NNP
cord-014462-11ggaqf1	355	12	,	,	,
cord-014462-11ggaqf1	356	1	Hebbal	Hebbal	NNP
cord-014462-11ggaqf1	356	2	,	,	,
cord-014462-11ggaqf1	356	3	Bangalore	Bangalore	NNP
cord-014462-11ggaqf1	356	4	24	24	CD
cord-014462-11ggaqf1	356	5	Zoonoses	Zoonoses	NNP
cord-014462-11ggaqf1	356	6	are	be	VBP
cord-014462-11ggaqf1	356	7	generally	generally	RB
cord-014462-11ggaqf1	356	8	defined	define	VBN
cord-014462-11ggaqf1	356	9	as	as	IN
cord-014462-11ggaqf1	356	10	animal	animal	NN
cord-014462-11ggaqf1	356	11	diseases	disease	NNS
cord-014462-11ggaqf1	356	12	that	that	WDT
cord-014462-11ggaqf1	356	13	are	be	VBP
cord-014462-11ggaqf1	356	14	transmissible	transmissible	JJ
cord-014462-11ggaqf1	356	15	to	to	IN
cord-014462-11ggaqf1	356	16	humans	human	NNS
cord-014462-11ggaqf1	356	17	.	.	.
cord-014462-11ggaqf1	357	1	They	-PRON-	PRP
cord-014462-11ggaqf1	357	2	continue	continue	VBP
cord-014462-11ggaqf1	357	3	to	to	TO
cord-014462-11ggaqf1	357	4	represent	represent	VB
cord-014462-11ggaqf1	357	5	an	an	DT
cord-014462-11ggaqf1	357	6	important	important	JJ
cord-014462-11ggaqf1	357	7	health	health	NN
cord-014462-11ggaqf1	357	8	hazard	hazard	NN
cord-014462-11ggaqf1	357	9	in	in	IN
cord-014462-11ggaqf1	357	10	most	most	JJS
cord-014462-11ggaqf1	357	11	parts	part	NNS
cord-014462-11ggaqf1	357	12	of	of	IN
cord-014462-11ggaqf1	357	13	the	the	DT
cord-014462-11ggaqf1	357	14	world	world	NN
cord-014462-11ggaqf1	357	15	,	,	,
cord-014462-11ggaqf1	357	16	where	where	WRB
cord-014462-11ggaqf1	357	17	they	-PRON-	PRP
cord-014462-11ggaqf1	357	18	cause	cause	VBP
cord-014462-11ggaqf1	357	19	considerable	considerable	JJ
cord-014462-11ggaqf1	357	20	expenditure	expenditure	NN
cord-014462-11ggaqf1	357	21	and	and	CC
cord-014462-11ggaqf1	357	22	losses	loss	NNS
cord-014462-11ggaqf1	357	23	for	for	IN
cord-014462-11ggaqf1	357	24	the	the	DT
cord-014462-11ggaqf1	357	25	health	health	NN
cord-014462-11ggaqf1	357	26	and	and	CC
cord-014462-11ggaqf1	357	27	agricultural	agricultural	JJ
cord-014462-11ggaqf1	357	28	sectors	sector	NNS
cord-014462-11ggaqf1	357	29	.	.	.
cord-014462-11ggaqf1	358	1	The	the	DT
cord-014462-11ggaqf1	358	2	emergence	emergence	NN
cord-014462-11ggaqf1	358	3	of	of	IN
cord-014462-11ggaqf1	358	4	these	these	DT
cord-014462-11ggaqf1	358	5	zoonotic	zoonotic	JJ
cord-014462-11ggaqf1	358	6	diseases	disease	NNS
cord-014462-11ggaqf1	358	7	are	be	VBP
cord-014462-11ggaqf1	358	8	very	very	RB
cord-014462-11ggaqf1	358	9	distinct	distinct	JJ
cord-014462-11ggaqf1	358	10	,	,	,
cord-014462-11ggaqf1	358	11	hence	hence	RB
cord-014462-11ggaqf1	358	12	their	-PRON-	PRP$
cord-014462-11ggaqf1	358	13	prevention	prevention	NN
cord-014462-11ggaqf1	358	14	and	and	CC
cord-014462-11ggaqf1	358	15	control	control	NN
cord-014462-11ggaqf1	358	16	will	will	MD
cord-014462-11ggaqf1	358	17	require	require	VB
cord-014462-11ggaqf1	358	18	unique	unique	JJ
cord-014462-11ggaqf1	358	19	strategies	strategy	NNS
cord-014462-11ggaqf1	358	20	,	,	,
cord-014462-11ggaqf1	358	21	apart	apart	RB
cord-014462-11ggaqf1	358	22	from	from	IN
cord-014462-11ggaqf1	358	23	traditional	traditional	JJ
cord-014462-11ggaqf1	358	24	approaches	approach	NNS
cord-014462-11ggaqf1	358	25	.	.	.
cord-014462-11ggaqf1	359	1	Such	such	JJ
cord-014462-11ggaqf1	359	2	strategies	strategy	NNS
cord-014462-11ggaqf1	359	3	require	require	VBP
cord-014462-11ggaqf1	359	4	rebuilding	rebuild	VBG
cord-014462-11ggaqf1	359	5	a	a	DT
cord-014462-11ggaqf1	359	6	cadre	cadre	NN
cord-014462-11ggaqf1	359	7	of	of	IN
cord-014462-11ggaqf1	359	8	trained	train	VBN
cord-014462-11ggaqf1	359	9	professionals	professional	NNS
cord-014462-11ggaqf1	359	10	of	of	IN
cord-014462-11ggaqf1	359	11	several	several	JJ
cord-014462-11ggaqf1	359	12	medical	medical	JJ
cord-014462-11ggaqf1	359	13	and	and	CC
cord-014462-11ggaqf1	359	14	biologic	biologic	JJ
cord-014462-11ggaqf1	359	15	sciences	science	NNS
cord-014462-11ggaqf1	359	16	.	.	.
cord-014462-11ggaqf1	360	1	The	the	DT
cord-014462-11ggaqf1	360	2	article	article	NN
cord-014462-11ggaqf1	360	3	discusses	discuss	VBZ
cord-014462-11ggaqf1	360	4	virus	virus	NN
cord-014462-11ggaqf1	360	5	infections	infection	NNS
cord-014462-11ggaqf1	360	6	that	that	WDT
cord-014462-11ggaqf1	360	7	have	have	VBP
cord-014462-11ggaqf1	360	8	significant	significant	JJ
cord-014462-11ggaqf1	360	9	zoonotic	zoonotic	JJ
cord-014462-11ggaqf1	360	10	implications	implication	NNS
cord-014462-11ggaqf1	360	11	for	for	IN
cord-014462-11ggaqf1	360	12	India	India	NNP
cord-014462-11ggaqf1	360	13	.	.	.
cord-014462-11ggaqf1	361	1	Buffalopox	Buffalopox	NNP
cord-014462-11ggaqf1	361	2	is	be	VBZ
cord-014462-11ggaqf1	361	3	a	a	DT
cord-014462-11ggaqf1	361	4	contagious	contagious	JJ
cord-014462-11ggaqf1	361	5	viral	viral	JJ
cord-014462-11ggaqf1	361	6	disease	disease	NN
cord-014462-11ggaqf1	361	7	affecting	affect	VBG
cord-014462-11ggaqf1	361	8	milch	milch	JJ
cord-014462-11ggaqf1	361	9	buffaloes	buffalo	NNS
cord-014462-11ggaqf1	361	10	and	and	CC
cord-014462-11ggaqf1	361	11	rarely	rarely	RB
cord-014462-11ggaqf1	361	12	,	,	,
cord-014462-11ggaqf1	361	13	cows	cow	NNS
cord-014462-11ggaqf1	361	14	,	,	,
cord-014462-11ggaqf1	361	15	with	with	IN
cord-014462-11ggaqf1	361	16	a	a	DT
cord-014462-11ggaqf1	361	17	morbidity	morbidity	NN
cord-014462-11ggaqf1	361	18	rate	rate	NN
cord-014462-11ggaqf1	361	19	up	up	IN
cord-014462-11ggaqf1	361	20	to	to	TO
cord-014462-11ggaqf1	361	21	80	80	CD
cord-014462-11ggaqf1	361	22	%	%	NN
cord-014462-11ggaqf1	361	23	in	in	IN
cord-014462-11ggaqf1	361	24	the	the	DT
cord-014462-11ggaqf1	361	25	affected	affected	JJ
cord-014462-11ggaqf1	361	26	herd	herd	NN
cord-014462-11ggaqf1	361	27	.	.	.
cord-014462-11ggaqf1	362	1	Although	although	IN
cord-014462-11ggaqf1	362	2	the	the	DT
cord-014462-11ggaqf1	362	3	disease	disease	NN
cord-014462-11ggaqf1	362	4	is	be	VBZ
cord-014462-11ggaqf1	362	5	not	not	RB
cord-014462-11ggaqf1	362	6	responsible	responsible	JJ
cord-014462-11ggaqf1	362	7	for	for	IN
cord-014462-11ggaqf1	362	8	high	high	JJ
cord-014462-11ggaqf1	362	9	mortality	mortality	NN
cord-014462-11ggaqf1	362	10	,	,	,
cord-014462-11ggaqf1	362	11	it	-PRON-	PRP
cord-014462-11ggaqf1	362	12	adversely	adversely	RB
cord-014462-11ggaqf1	362	13	affects	affect	VBZ
cord-014462-11ggaqf1	362	14	the	the	DT
cord-014462-11ggaqf1	362	15	productivity	productivity	NN
cord-014462-11ggaqf1	362	16	of	of	IN
cord-014462-11ggaqf1	362	17	the	the	DT
cord-014462-11ggaqf1	362	18	animals	animal	NNS
cord-014462-11ggaqf1	362	19	,	,	,
cord-014462-11ggaqf1	362	20	resulting	result	VBG
cord-014462-11ggaqf1	362	21	in	in	IN
cord-014462-11ggaqf1	362	22	large	large	JJ
cord-014462-11ggaqf1	362	23	economic	economic	JJ
cord-014462-11ggaqf1	362	24	losses	loss	NNS
cord-014462-11ggaqf1	362	25	.	.	.
cord-014462-11ggaqf1	363	1	Furthermore	furthermore	RB
cord-014462-11ggaqf1	363	2	,	,	,
cord-014462-11ggaqf1	363	3	the	the	DT
cord-014462-11ggaqf1	363	4	disease	disease	NN
cord-014462-11ggaqf1	363	5	has	have	VBZ
cord-014462-11ggaqf1	363	6	zoonotic	zoonotic	JJ
cord-014462-11ggaqf1	363	7	implications	implication	NNS
cord-014462-11ggaqf1	363	8	,	,	,
cord-014462-11ggaqf1	363	9	as	as	IN
cord-014462-11ggaqf1	363	10	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	363	11	are	be	VBP
cord-014462-11ggaqf1	363	12	frequently	frequently	RB
cord-014462-11ggaqf1	363	13	associated	associate	VBN
cord-014462-11ggaqf1	363	14	with	with	IN
cord-014462-11ggaqf1	363	15	human	human	JJ
cord-014462-11ggaqf1	363	16	infections	infection	NNS
cord-014462-11ggaqf1	363	17	,	,	,
cord-014462-11ggaqf1	363	18	particularly	particularly	RB
cord-014462-11ggaqf1	363	19	in	in	IN
cord-014462-11ggaqf1	363	20	the	the	DT
cord-014462-11ggaqf1	363	21	milkers	milker	NNS
cord-014462-11ggaqf1	363	22	.	.	.
cord-014462-11ggaqf1	364	1	The	the	DT
cord-014462-11ggaqf1	364	2	causative	causative	JJ
cord-014462-11ggaqf1	364	3	agent	agent	NN
cord-014462-11ggaqf1	364	4	,	,	,
cord-014462-11ggaqf1	364	5	buffalopox	buffalopox	NNP
cord-014462-11ggaqf1	364	6	virus	virus	NN
cord-014462-11ggaqf1	364	7	(	(	-LRB-
cord-014462-11ggaqf1	364	8	BPXV	BPXV	NNP
cord-014462-11ggaqf1	364	9	)	)	-RRB-
cord-014462-11ggaqf1	364	10	,	,	,
cord-014462-11ggaqf1	364	11	is	be	VBZ
cord-014462-11ggaqf1	364	12	closely	closely	RB
cord-014462-11ggaqf1	364	13	related	relate	VBN
cord-014462-11ggaqf1	364	14	to	to	IN
cord-014462-11ggaqf1	364	15	vaccinia	vaccinia	NN
cord-014462-11ggaqf1	364	16	virus	virus	NN
cord-014462-11ggaqf1	364	17	.	.	.
cord-014462-11ggaqf1	365	1	The	the	DT
cord-014462-11ggaqf1	365	2	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	365	3	of	of	IN
cord-014462-11ggaqf1	365	4	febrile	febrile	JJ
cord-014462-11ggaqf1	365	5	rash	rash	JJ
cord-014462-11ggaqf1	365	6	illness	illness	NN
cord-014462-11ggaqf1	365	7	among	among	IN
cord-014462-11ggaqf1	365	8	humans	human	NNS
cord-014462-11ggaqf1	365	9	and	and	CC
cord-014462-11ggaqf1	365	10	buffaloes	buffalo	NNS
cord-014462-11ggaqf1	365	11	were	be	VBD
cord-014462-11ggaqf1	365	12	investigated	investigate	VBN
cord-014462-11ggaqf1	365	13	in	in	IN
cord-014462-11ggaqf1	365	14	the	the	DT
cord-014462-11ggaqf1	365	15	villages	village	NNS
cord-014462-11ggaqf1	365	16	of	of	IN
cord-014462-11ggaqf1	365	17	districts	district	NNS
cord-014462-11ggaqf1	365	18	Solapur	Solapur	NNP
cord-014462-11ggaqf1	365	19	and	and	CC
cord-014462-11ggaqf1	365	20	Kolhapur	Kolhapur	NNP
cord-014462-11ggaqf1	365	21	of	of	IN
cord-014462-11ggaqf1	365	22	Western	Western	NNP
cord-014462-11ggaqf1	365	23	Maharashtra	Maharashtra	NNP
cord-014462-11ggaqf1	365	24	.	.	.
cord-014462-11ggaqf1	366	1	Clinico	clinico	NN
cord-014462-11ggaqf1	366	2	-	-	HYPH
cord-014462-11ggaqf1	366	3	epidemiological	epidemiological	JJ
cord-014462-11ggaqf1	366	4	investigations	investigation	NNS
cord-014462-11ggaqf1	366	5	of	of	IN
cord-014462-11ggaqf1	366	6	humans	human	NNS
cord-014462-11ggaqf1	366	7	and	and	CC
cord-014462-11ggaqf1	366	8	buffaloes	buffalo	NNS
cord-014462-11ggaqf1	366	9	were	be	VBD
cord-014462-11ggaqf1	366	10	carried	carry	VBN
cord-014462-11ggaqf1	366	11	out	out	RP
cord-014462-11ggaqf1	366	12	and	and	CC
cord-014462-11ggaqf1	366	13	representative	representative	JJ
cord-014462-11ggaqf1	366	14	clinical	clinical	JJ
cord-014462-11ggaqf1	366	15	samples	sample	NNS
cord-014462-11ggaqf1	366	16	were	be	VBD
cord-014462-11ggaqf1	366	17	collected	collect	VBN
cord-014462-11ggaqf1	366	18	respectively	respectively	RB
cord-014462-11ggaqf1	366	19	.	.	.
cord-014462-11ggaqf1	367	1	The	the	DT
cord-014462-11ggaqf1	367	2	samples	sample	NNS
cord-014462-11ggaqf1	367	3	include	include	VBP
cord-014462-11ggaqf1	367	4	vesicular	vesicular	JJ
cord-014462-11ggaqf1	367	5	fluid	fluid	NN
cord-014462-11ggaqf1	367	6	,	,	,
cord-014462-11ggaqf1	367	7	scab	scab	NN
cord-014462-11ggaqf1	367	8	,	,	,
cord-014462-11ggaqf1	367	9	and	and	CC
cord-014462-11ggaqf1	367	10	blood	blood	NN
cord-014462-11ggaqf1	367	11	.	.	.
cord-014462-11ggaqf1	368	1	Laboratory	laboratory	NN
cord-014462-11ggaqf1	368	2	investigations	investigation	NNS
cord-014462-11ggaqf1	368	3	for	for	IN
cord-014462-11ggaqf1	368	4	Buffalo	Buffalo	NNP
cord-014462-11ggaqf1	368	5	-	-	HYPH
cord-014462-11ggaqf1	368	6	Pox	Pox	NNP
cord-014462-11ggaqf1	368	7	virus	virus	NN
cord-014462-11ggaqf1	368	8	(	(	-LRB-
cord-014462-11ggaqf1	368	9	BPXV	BPXV	NNP
cord-014462-11ggaqf1	368	10	)	)	-RRB-
cord-014462-11ggaqf1	368	11	was	be	VBD
cord-014462-11ggaqf1	368	12	done	do	VBN
cord-014462-11ggaqf1	368	13	by	by	IN
cord-014462-11ggaqf1	368	14	PCR	PCR	NNP
cord-014462-11ggaqf1	368	15	on	on	IN
cord-014462-11ggaqf1	368	16	blood	blood	NN
cord-014462-11ggaqf1	368	17	samples	sample	NNS
cord-014462-11ggaqf1	368	18	,	,	,
cord-014462-11ggaqf1	368	19	scabs	scab	NNS
cord-014462-11ggaqf1	368	20	and	and	CC
cord-014462-11ggaqf1	368	21	vesicular	vesicular	JJ
cord-014462-11ggaqf1	368	22	fluid	fluid	NN
cord-014462-11ggaqf1	368	23	.	.	.
cord-014462-11ggaqf1	369	1	In	in	IN
cord-014462-11ggaqf1	369	2	vitro	vitro	FW
cord-014462-11ggaqf1	369	3	virus	virus	NN
cord-014462-11ggaqf1	369	4	isolation	isolation	NN
cord-014462-11ggaqf1	369	5	attempts	attempt	NNS
cord-014462-11ggaqf1	369	6	were	be	VBD
cord-014462-11ggaqf1	369	7	carried	carry	VBN
cord-014462-11ggaqf1	369	8	out	out	RP
cord-014462-11ggaqf1	369	9	by	by	IN
cord-014462-11ggaqf1	369	10	using	use	VBG
cord-014462-11ggaqf1	369	11	Vero	Vero	NNP
cord-014462-11ggaqf1	369	12	E-6	E-6	NNP
cord-014462-11ggaqf1	369	13	cells	cell	NNS
cord-014462-11ggaqf1	369	14	.	.	.
cord-014462-11ggaqf1	370	1	Negative	negative	JJ
cord-014462-11ggaqf1	370	2	staining	stain	VBG
cord-014462-11ggaqf1	370	3	electron	electron	NN
cord-014462-11ggaqf1	370	4	microscopy	microscopy	NN
cord-014462-11ggaqf1	370	5	was	be	VBD
cord-014462-11ggaqf1	370	6	also	also	RB
cord-014462-11ggaqf1	370	7	employed	employ	VBN
cord-014462-11ggaqf1	370	8	for	for	IN
cord-014462-11ggaqf1	370	9	detection	detection	NN
cord-014462-11ggaqf1	370	10	of	of	IN
cord-014462-11ggaqf1	370	11	virus	virus	NN
cord-014462-11ggaqf1	370	12	particles	particle	NNS
cord-014462-11ggaqf1	370	13	.	.	.
cord-014462-11ggaqf1	371	1	A	a	DT
cord-014462-11ggaqf1	371	2	total	total	NN
cord-014462-11ggaqf1	371	3	of	of	IN
cord-014462-11ggaqf1	371	4	166	166	CD
cord-014462-11ggaqf1	371	5	human	human	JJ
cord-014462-11ggaqf1	371	6	cases	case	NNS
cord-014462-11ggaqf1	371	7	with	with	IN
cord-014462-11ggaqf1	371	8	pox	pox	NN
cord-014462-11ggaqf1	371	9	lesions	lesion	NNS
cord-014462-11ggaqf1	371	10	on	on	IN
cord-014462-11ggaqf1	371	11	hand	hand	NN
cord-014462-11ggaqf1	371	12	and	and	CC
cord-014462-11ggaqf1	371	13	other	other	JJ
cord-014462-11ggaqf1	371	14	body	body	NN
cord-014462-11ggaqf1	371	15	parts	part	NNS
cord-014462-11ggaqf1	371	16	from	from	IN
cord-014462-11ggaqf1	371	17	village	village	NN
cord-014462-11ggaqf1	371	18	Kasegaon	Kasegaon	NNP
cord-014462-11ggaqf1	371	19	,	,	,
cord-014462-11ggaqf1	371	20	District	District	NNP
cord-014462-11ggaqf1	371	21	-	-	HYPH
cord-014462-11ggaqf1	371	22	Solapur	Solapur	NNP
cord-014462-11ggaqf1	371	23	and	and	CC
cord-014462-11ggaqf1	371	24	185	185	CD
cord-014462-11ggaqf1	371	25	cases	case	NNS
cord-014462-11ggaqf1	371	26	from	from	IN
cord-014462-11ggaqf1	371	27	20	20	CD
cord-014462-11ggaqf1	371	28	different	different	JJ
cord-014462-11ggaqf1	371	29	villages	village	NNS
cord-014462-11ggaqf1	371	30	of	of	IN
cord-014462-11ggaqf1	371	31	Kolhapur	Kolhapur	NNP
cord-014462-11ggaqf1	371	32	district	district	NN
cord-014462-11ggaqf1	371	33	were	be	VBD
cord-014462-11ggaqf1	371	34	reported	report	VBN
cord-014462-11ggaqf1	371	35	.	.	.
cord-014462-11ggaqf1	372	1	Besides	besides	IN
cord-014462-11ggaqf1	372	2	pox	pox	NN
cord-014462-11ggaqf1	372	3	lesions	lesion	NNS
cord-014462-11ggaqf1	372	4	patients	patient	NNS
cord-014462-11ggaqf1	372	5	were	be	VBD
cord-014462-11ggaqf1	372	6	having	have	VBG
cord-014462-11ggaqf1	372	7	fever	fever	NN
cord-014462-11ggaqf1	372	8	,	,	,
cord-014462-11ggaqf1	372	9	malaise	malaise	NN
cord-014462-11ggaqf1	372	10	,	,	,
cord-014462-11ggaqf1	372	11	pain	pain	NN
cord-014462-11ggaqf1	372	12	at	at	IN
cord-014462-11ggaqf1	372	13	site	site	NN
cord-014462-11ggaqf1	372	14	of	of	IN
cord-014462-11ggaqf1	372	15	lesion	lesion	NN
cord-014462-11ggaqf1	372	16	and	and	CC
cord-014462-11ggaqf1	372	17	axillary	axillary	JJ
cord-014462-11ggaqf1	372	18	and	and	CC
cord-014462-11ggaqf1	372	19	inguinal	inguinal	JJ
cord-014462-11ggaqf1	372	20	lymphadenopathy	lymphadenopathy	NN
cord-014462-11ggaqf1	372	21	.	.	.
cord-014462-11ggaqf1	373	1	In	in	IN
cord-014462-11ggaqf1	373	2	Kasegaon	Kasegaon	NNP
cord-014462-11ggaqf1	373	3	village	village	NN
cord-014462-11ggaqf1	373	4	,	,	,
cord-014462-11ggaqf1	373	5	attack	attack	NN
cord-014462-11ggaqf1	373	6	rate	rate	NN
cord-014462-11ggaqf1	373	7	in	in	IN
cord-014462-11ggaqf1	373	8	human	human	JJ
cord-014462-11ggaqf1	373	9	cases	case	NNS
cord-014462-11ggaqf1	373	10	was	be	VBD
cord-014462-11ggaqf1	373	11	6.6	6.6	CD
cord-014462-11ggaqf1	373	12	%	%	NN
cord-014462-11ggaqf1	373	13	and	and	CC
cord-014462-11ggaqf1	373	14	in	in	IN
cord-014462-11ggaqf1	373	15	buffaloes	buffalo	NNS
cord-014462-11ggaqf1	373	16	41.9	41.9	CD
cord-014462-11ggaqf1	373	17	%	%	NN
cord-014462-11ggaqf1	373	18	(	(	-LRB-
cord-014462-11ggaqf1	373	19	231/551	231/551	CD
cord-014462-11ggaqf1	373	20	)	)	-RRB-
cord-014462-11ggaqf1	373	21	.	.	.
cord-014462-11ggaqf1	374	1	Whereas	whereas	IN
cord-014462-11ggaqf1	374	2	in	in	IN
cord-014462-11ggaqf1	374	3	Kolhapur	Kolhapur	NNP
cord-014462-11ggaqf1	374	4	area	area	NN
cord-014462-11ggaqf1	374	5	attack	attack	NN
cord-014462-11ggaqf1	374	6	rate	rate	NN
cord-014462-11ggaqf1	374	7	in	in	IN
cord-014462-11ggaqf1	374	8	buffaloes	buffalo	NNS
cord-014462-11ggaqf1	374	9	was	be	VBD
cord-014462-11ggaqf1	374	10	11.75	11.75	CD
cord-014462-11ggaqf1	374	11	%	%	NN
cord-014462-11ggaqf1	374	12	(	(	-LRB-
cord-014462-11ggaqf1	374	13	2633/22398	2633/22398	CD
cord-014462-11ggaqf1	374	14	)	)	-RRB-
cord-014462-11ggaqf1	374	15	.	.	.
cord-014462-11ggaqf1	375	1	BPXV	BPXV	NNP
cord-014462-11ggaqf1	375	2	was	be	VBD
cord-014462-11ggaqf1	375	3	confirmed	confirm	VBN
cord-014462-11ggaqf1	375	4	in	in	IN
cord-014462-11ggaqf1	375	5	blood	blood	NN
cord-014462-11ggaqf1	375	6	,	,	,
cord-014462-11ggaqf1	375	7	vesicular	vesicular	JJ
cord-014462-11ggaqf1	375	8	fluid	fluid	NN
cord-014462-11ggaqf1	375	9	and	and	CC
cord-014462-11ggaqf1	375	10	scab	scab	NN
cord-014462-11ggaqf1	375	11	specimens	specimen	NNS
cord-014462-11ggaqf1	375	12	from	from	IN
cord-014462-11ggaqf1	375	13	human	human	JJ
cord-014462-11ggaqf1	375	14	cases	case	NNS
cord-014462-11ggaqf1	375	15	and	and	CC
cord-014462-11ggaqf1	375	16	scab	scab	NN
cord-014462-11ggaqf1	375	17	specimen	specimen	NN
cord-014462-11ggaqf1	375	18	from	from	IN
cord-014462-11ggaqf1	375	19	buffalo	buffalo	NNP
cord-014462-11ggaqf1	375	20	by	by	IN
cord-014462-11ggaqf1	375	21	polymerase	polymerase	NN
cord-014462-11ggaqf1	375	22	chain	chain	NN
cord-014462-11ggaqf1	375	23	reaction	reaction	NN
cord-014462-11ggaqf1	375	24	(	(	-LRB-
cord-014462-11ggaqf1	375	25	PCR	PCR	NNP
cord-014462-11ggaqf1	375	26	)	)	-RRB-
cord-014462-11ggaqf1	375	27	method	method	NN
cord-014462-11ggaqf1	375	28	.	.	.
cord-014462-11ggaqf1	376	1	The	the	DT
cord-014462-11ggaqf1	376	2	BPXV	BPXV	NNP
cord-014462-11ggaqf1	376	3	was	be	VBD
cord-014462-11ggaqf1	376	4	also	also	RB
cord-014462-11ggaqf1	376	5	isolated	isolate	VBN
cord-014462-11ggaqf1	376	6	from	from	IN
cord-014462-11ggaqf1	376	7	3	3	CD
cord-014462-11ggaqf1	376	8	different	different	JJ
cord-014462-11ggaqf1	376	9	clinical	clinical	JJ
cord-014462-11ggaqf1	376	10	specimens	specimen	NNS
cord-014462-11ggaqf1	376	11	and	and	CC
cord-014462-11ggaqf1	376	12	further	further	RB
cord-014462-11ggaqf1	376	13	identified	identify	VBN
cord-014462-11ggaqf1	376	14	by	by	IN
cord-014462-11ggaqf1	376	15	PCR	PCR	NNP
cord-014462-11ggaqf1	376	16	and	and	CC
cord-014462-11ggaqf1	376	17	electron	electron	NN
cord-014462-11ggaqf1	376	18	microscopy	microscopy	NN
cord-014462-11ggaqf1	376	19	.	.	.
cord-014462-11ggaqf1	377	1	Clinical	clinical	JJ
cord-014462-11ggaqf1	377	2	manifestation	manifestation	NN
cord-014462-11ggaqf1	377	3	of	of	IN
cord-014462-11ggaqf1	377	4	the	the	DT
cord-014462-11ggaqf1	377	5	disease	disease	NN
cord-014462-11ggaqf1	377	6	in	in	IN
cord-014462-11ggaqf1	377	7	buffaloes	buffalo	NNS
cord-014462-11ggaqf1	377	8	from	from	IN
cord-014462-11ggaqf1	377	9	Solapur	Solapur	NNP
cord-014462-11ggaqf1	377	10	district	district	NN
cord-014462-11ggaqf1	377	11	was	be	VBD
cord-014462-11ggaqf1	377	12	as	as	IN
cord-014462-11ggaqf1	377	13	reported	report	VBN
cord-014462-11ggaqf1	377	14	earlier	early	RBR
cord-014462-11ggaqf1	377	15	like	like	IN
cord-014462-11ggaqf1	377	16	common	common	JJ
cord-014462-11ggaqf1	377	17	pox	pox	NN
cord-014462-11ggaqf1	377	18	lesions	lesion	NNS
cord-014462-11ggaqf1	377	19	on	on	IN
cord-014462-11ggaqf1	377	20	teats	teat	NNS
cord-014462-11ggaqf1	377	21	and	and	CC
cord-014462-11ggaqf1	377	22	udders	udder	NNS
cord-014462-11ggaqf1	377	23	whereas	whereas	IN
cord-014462-11ggaqf1	377	24	the	the	DT
cord-014462-11ggaqf1	377	25	buffaloes	buffalo	NNS
cord-014462-11ggaqf1	377	26	from	from	IN
cord-014462-11ggaqf1	377	27	Kolhapur	Kolhapur	NNP
cord-014462-11ggaqf1	377	28	district	district	NN
cord-014462-11ggaqf1	377	29	had	have	VBD
cord-014462-11ggaqf1	377	30	lesions	lesion	NNS
cord-014462-11ggaqf1	377	31	on	on	IN
cord-014462-11ggaqf1	377	32	hairless	hairless	JJ
cord-014462-11ggaqf1	377	33	parts	part	NNS
cord-014462-11ggaqf1	377	34	of	of	IN
cord-014462-11ggaqf1	377	35	ears	ear	NNS
cord-014462-11ggaqf1	377	36	and	and	CC
cord-014462-11ggaqf1	377	37	on	on	IN
cord-014462-11ggaqf1	377	38	the	the	DT
cord-014462-11ggaqf1	377	39	eyelids	eyelid	NNS
cord-014462-11ggaqf1	377	40	with	with	IN
cord-014462-11ggaqf1	377	41	purulent	purulent	JJ
cord-014462-11ggaqf1	377	42	discharge	discharge	NN
cord-014462-11ggaqf1	377	43	.	.	.
cord-014462-11ggaqf1	378	1	BPXV	BPXV	NNP
cord-014462-11ggaqf1	378	2	from	from	IN
cord-014462-11ggaqf1	378	3	human	human	JJ
cord-014462-11ggaqf1	378	4	and	and	CC
cord-014462-11ggaqf1	378	5	buffalo	buffalo	NNP
cord-014462-11ggaqf1	378	6	cases	case	NNS
cord-014462-11ggaqf1	378	7	showed	show	VBD
cord-014462-11ggaqf1	378	8	similarity	similarity	NN
cord-014462-11ggaqf1	378	9	.	.	.
cord-014462-11ggaqf1	379	1	Vaccines	vaccine	NNS
cord-014462-11ggaqf1	379	2	have	have	VBP
cord-014462-11ggaqf1	379	3	been	be	VBN
cord-014462-11ggaqf1	379	4	made	make	VBN
cord-014462-11ggaqf1	379	5	against	against	IN
cord-014462-11ggaqf1	379	6	several	several	JJ
cord-014462-11ggaqf1	379	7	diseases	disease	NNS
cord-014462-11ggaqf1	379	8	and	and	CC
cord-014462-11ggaqf1	379	9	used	use	VBN
cord-014462-11ggaqf1	379	10	for	for	IN
cord-014462-11ggaqf1	379	11	controlling	control	VBG
cord-014462-11ggaqf1	379	12	the	the	DT
cord-014462-11ggaqf1	379	13	afflictions	affliction	NNS
cord-014462-11ggaqf1	379	14	.	.	.
cord-014462-11ggaqf1	380	1	However	however	RB
cord-014462-11ggaqf1	380	2	a	a	DT
cord-014462-11ggaqf1	380	3	few	few	JJ
cord-014462-11ggaqf1	380	4	of	of	IN
cord-014462-11ggaqf1	380	5	them	-PRON-	PRP
cord-014462-11ggaqf1	380	6	were	be	VBD
cord-014462-11ggaqf1	380	7	not	not	RB
cord-014462-11ggaqf1	380	8	effective	effective	JJ
cord-014462-11ggaqf1	380	9	for	for	IN
cord-014462-11ggaqf1	380	10	successfully	successfully	RB
cord-014462-11ggaqf1	380	11	controlling	control	VBG
cord-014462-11ggaqf1	380	12	the	the	DT
cord-014462-11ggaqf1	380	13	disease	disease	NN
cord-014462-11ggaqf1	380	14	.	.	.
cord-014462-11ggaqf1	381	1	The	the	DT
cord-014462-11ggaqf1	381	2	reasons	reason	NNS
cord-014462-11ggaqf1	381	3	for	for	IN
cord-014462-11ggaqf1	381	4	the	the	DT
cord-014462-11ggaqf1	381	5	failure	failure	NN
cord-014462-11ggaqf1	381	6	are	be	VBP
cord-014462-11ggaqf1	381	7	many	many	JJ
cord-014462-11ggaqf1	381	8	,	,	,
cord-014462-11ggaqf1	381	9	the	the	DT
cord-014462-11ggaqf1	381	10	major	major	JJ
cord-014462-11ggaqf1	381	11	being	being	NN
cord-014462-11ggaqf1	381	12	,	,	,
cord-014462-11ggaqf1	381	13	either	either	CC
cord-014462-11ggaqf1	381	14	the	the	DT
cord-014462-11ggaqf1	381	15	pathogen	pathogen	NN
cord-014462-11ggaqf1	381	16	is	be	VBZ
cord-014462-11ggaqf1	381	17	not	not	RB
cord-014462-11ggaqf1	381	18	completely	completely	RB
cord-014462-11ggaqf1	381	19	cleared	clear	VBN
cord-014462-11ggaqf1	381	20	from	from	IN
cord-014462-11ggaqf1	381	21	the	the	DT
cord-014462-11ggaqf1	381	22	vaccinated	vaccinate	VBN
cord-014462-11ggaqf1	381	23	animal	animal	NN
cord-014462-11ggaqf1	381	24	or	or	CC
cord-014462-11ggaqf1	381	25	it	-PRON-	PRP
cord-014462-11ggaqf1	381	26	reemerges	reemerge	VBZ
cord-014462-11ggaqf1	381	27	after	after	IN
cord-014462-11ggaqf1	381	28	changing	change	VBG
cord-014462-11ggaqf1	381	29	its	-PRON-	PRP$
cord-014462-11ggaqf1	381	30	antigenic	antigenic	JJ
cord-014462-11ggaqf1	381	31	structure	structure	NN
cord-014462-11ggaqf1	381	32	,	,	,
cord-014462-11ggaqf1	381	33	thus	thus	RB
cord-014462-11ggaqf1	381	34	making	make	VBG
cord-014462-11ggaqf1	381	35	the	the	DT
cord-014462-11ggaqf1	381	36	vaccination	vaccination	NN
cord-014462-11ggaqf1	381	37	programme	programme	NN
cord-014462-11ggaqf1	381	38	less	less	RBR
cord-014462-11ggaqf1	381	39	effective	effective	JJ
cord-014462-11ggaqf1	381	40	.	.	.
cord-014462-11ggaqf1	382	1	In	in	IN
cord-014462-11ggaqf1	382	2	addition	addition	NN
cord-014462-11ggaqf1	382	3	to	to	IN
cord-014462-11ggaqf1	382	4	this	this	DT
cord-014462-11ggaqf1	382	5	,	,	,
cord-014462-11ggaqf1	382	6	emergences	emergence	NNS
cord-014462-11ggaqf1	382	7	of	of	IN
cord-014462-11ggaqf1	382	8	newer	new	JJR
cord-014462-11ggaqf1	382	9	diseases	disease	NNS
cord-014462-11ggaqf1	382	10	such	such	JJ
cord-014462-11ggaqf1	382	11	as	as	IN
cord-014462-11ggaqf1	382	12	HIV	HIV	NNP
cord-014462-11ggaqf1	383	1	the	the	DT
cord-014462-11ggaqf1	383	2	development	development	NN
cord-014462-11ggaqf1	383	3	of	of	IN
cord-014462-11ggaqf1	383	4	suitable	suitable	JJ
cord-014462-11ggaqf1	383	5	vaccines	vaccine	NNS
cord-014462-11ggaqf1	383	6	have	have	VBP
cord-014462-11ggaqf1	383	7	become	become	VBN
cord-014462-11ggaqf1	383	8	a	a	DT
cord-014462-11ggaqf1	383	9	challenging	challenging	JJ
cord-014462-11ggaqf1	383	10	task	task	NN
cord-014462-11ggaqf1	383	11	.	.	.
cord-014462-11ggaqf1	384	1	This	this	DT
cord-014462-11ggaqf1	384	2	is	be	VBZ
cord-014462-11ggaqf1	384	3	especially	especially	RB
cord-014462-11ggaqf1	384	4	true	true	JJ
cord-014462-11ggaqf1	384	5	in	in	IN
cord-014462-11ggaqf1	384	6	the	the	DT
cord-014462-11ggaqf1	384	7	case	case	NN
cord-014462-11ggaqf1	384	8	of	of	IN
cord-014462-11ggaqf1	384	9	viral	viral	JJ
cord-014462-11ggaqf1	384	10	diseases	disease	NNS
cord-014462-11ggaqf1	384	11	.	.	.
cord-014462-11ggaqf1	385	1	These	these	DT
cord-014462-11ggaqf1	385	2	challenges	challenge	NNS
cord-014462-11ggaqf1	385	3	have	have	VBP
cord-014462-11ggaqf1	385	4	warned	warn	VBN
cord-014462-11ggaqf1	385	5	the	the	DT
cord-014462-11ggaqf1	385	6	researchers	researcher	NNS
cord-014462-11ggaqf1	385	7	'	'	POS
cord-014462-11ggaqf1	385	8	'	'	''
cord-014462-11ggaqf1	385	9	that	that	IN
cord-014462-11ggaqf1	385	10	protection	protection	NN
cord-014462-11ggaqf1	385	11	by	by	IN
cord-014462-11ggaqf1	385	12	vaccination	vaccination	NN
cord-014462-11ggaqf1	385	13	is	be	VBZ
cord-014462-11ggaqf1	385	14	not	not	RB
cord-014462-11ggaqf1	385	15	that	that	RB
cord-014462-11ggaqf1	385	16	simple	simple	JJ
cord-014462-11ggaqf1	385	17	and	and	CC
cord-014462-11ggaqf1	385	18	strait	strait	JJ
cord-014462-11ggaqf1	385	19	forward	forward	RB
cord-014462-11ggaqf1	385	20	approach	approach	NN
cord-014462-11ggaqf1	385	21	'	'	''
cord-014462-11ggaqf1	385	22	'	'	''
cord-014462-11ggaqf1	385	23	,	,	,
cord-014462-11ggaqf1	385	24	and	and	CC
cord-014462-11ggaqf1	385	25	lot	lot	NN
cord-014462-11ggaqf1	385	26	need	need	VBP
cord-014462-11ggaqf1	385	27	to	to	TO
cord-014462-11ggaqf1	385	28	be	be	VB
cord-014462-11ggaqf1	385	29	understood	understand	VBN
cord-014462-11ggaqf1	385	30	in	in	IN
cord-014462-11ggaqf1	385	31	terms	term	NNS
cord-014462-11ggaqf1	385	32	of	of	IN
cord-014462-11ggaqf1	385	33	host	host	NN
cord-014462-11ggaqf1	385	34	virus	virus	NN
cord-014462-11ggaqf1	385	35	interaction	interaction	NN
cord-014462-11ggaqf1	385	36	and	and	CC
cord-014462-11ggaqf1	385	37	role	role	NN
cord-014462-11ggaqf1	385	38	of	of	IN
cord-014462-11ggaqf1	385	39	environment	environment	NN
cord-014462-11ggaqf1	385	40	in	in	IN
cord-014462-11ggaqf1	385	41	perpetuating	perpetuate	VBG
cord-014462-11ggaqf1	385	42	the	the	DT
cord-014462-11ggaqf1	385	43	disease	disease	NN
cord-014462-11ggaqf1	385	44	.	.	.
cord-014462-11ggaqf1	386	1	So	so	IN
cord-014462-11ggaqf1	386	2	the	the	DT
cord-014462-11ggaqf1	386	3	immediate	immediate	JJ
cord-014462-11ggaqf1	386	4	step	step	NN
cord-014462-11ggaqf1	386	5	that	that	WDT
cord-014462-11ggaqf1	386	6	was	be	VBD
cord-014462-11ggaqf1	386	7	considered	consider	VBN
cord-014462-11ggaqf1	386	8	was	be	VBD
cord-014462-11ggaqf1	386	9	the	the	DT
cord-014462-11ggaqf1	386	10	environmental	environmental	JJ
cord-014462-11ggaqf1	386	11	safety	safety	NN
cord-014462-11ggaqf1	386	12	by	by	IN
cord-014462-11ggaqf1	386	13	way	way	NN
cord-014462-11ggaqf1	386	14	using	use	VBG
cord-014462-11ggaqf1	386	15	non	non	JJ
cord-014462-11ggaqf1	386	16	infectious	infectious	JJ
cord-014462-11ggaqf1	386	17	materials	material	NNS
cord-014462-11ggaqf1	386	18	as	as	IN
cord-014462-11ggaqf1	386	19	vaccines	vaccine	NNS
cord-014462-11ggaqf1	386	20	.	.	.
cord-014462-11ggaqf1	387	1	With	with	IN
cord-014462-11ggaqf1	387	2	the	the	DT
cord-014462-11ggaqf1	387	3	understanding	understanding	NN
cord-014462-11ggaqf1	387	4	that	that	WDT
cord-014462-11ggaqf1	387	5	has	have	VBZ
cord-014462-11ggaqf1	387	6	been	be	VBN
cord-014462-11ggaqf1	387	7	developed	develop	VBN
cord-014462-11ggaqf1	387	8	in	in	IN
cord-014462-11ggaqf1	387	9	molecular	molecular	JJ
cord-014462-11ggaqf1	387	10	immunology	immunology	NN
cord-014462-11ggaqf1	387	11	and	and	CC
cord-014462-11ggaqf1	387	12	molecular	molecular	JJ
cord-014462-11ggaqf1	387	13	biology	biology	NN
cord-014462-11ggaqf1	387	14	and	and	CC
cord-014462-11ggaqf1	387	15	with	with	IN
cord-014462-11ggaqf1	387	16	the	the	DT
cord-014462-11ggaqf1	387	17	availability	availability	NN
cord-014462-11ggaqf1	387	18	of	of	IN
cord-014462-11ggaqf1	387	19	molecular	molecular	JJ
cord-014462-11ggaqf1	387	20	tools	tool	NNS
cord-014462-11ggaqf1	387	21	that	that	WDT
cord-014462-11ggaqf1	387	22	have	have	VBP
cord-014462-11ggaqf1	387	23	been	be	VBN
cord-014462-11ggaqf1	387	24	developed	develop	VBN
cord-014462-11ggaqf1	387	25	through	through	IN
cord-014462-11ggaqf1	387	26	recombinant	recombinant	JJ
cord-014462-11ggaqf1	387	27	DNA	dna	NN
cord-014462-11ggaqf1	387	28	technology	technology	NN
cord-014462-11ggaqf1	387	29	the	the	DT
cord-014462-11ggaqf1	387	30	field	field	NN
cord-014462-11ggaqf1	387	31	of	of	IN
cord-014462-11ggaqf1	387	32	vaccinology	vaccinology	NN
cord-014462-11ggaqf1	387	33	has	have	VBZ
cord-014462-11ggaqf1	387	34	changed	change	VBN
cord-014462-11ggaqf1	387	35	dramatically	dramatically	RB
cord-014462-11ggaqf1	387	36	to	to	TO
cord-014462-11ggaqf1	387	37	emerge	emerge	VB
cord-014462-11ggaqf1	387	38	as	as	IN
cord-014462-11ggaqf1	387	39	modern	modern	JJ
cord-014462-11ggaqf1	387	40	vaccinology	vaccinology	NN
cord-014462-11ggaqf1	387	41	.	.	.
cord-014462-11ggaqf1	388	1	This	this	DT
cord-014462-11ggaqf1	388	2	presentation	presentation	NN
cord-014462-11ggaqf1	388	3	deals	deal	VBZ
cord-014462-11ggaqf1	388	4	with	with	IN
cord-014462-11ggaqf1	388	5	the	the	DT
cord-014462-11ggaqf1	388	6	modern	modern	JJ
cord-014462-11ggaqf1	388	7	approaches	approach	NNS
cord-014462-11ggaqf1	388	8	that	that	WDT
cord-014462-11ggaqf1	388	9	are	be	VBP
cord-014462-11ggaqf1	388	10	being	be	VBG
cord-014462-11ggaqf1	388	11	used	use	VBN
cord-014462-11ggaqf1	388	12	to	to	TO
cord-014462-11ggaqf1	388	13	produce	produce	VB
cord-014462-11ggaqf1	388	14	effective	effective	JJ
cord-014462-11ggaqf1	388	15	vaccines	vaccine	NNS
cord-014462-11ggaqf1	388	16	in	in	IN
cord-014462-11ggaqf1	388	17	the	the	DT
cord-014462-11ggaqf1	388	18	case	case	NN
cord-014462-11ggaqf1	388	19	of	of	IN
cord-014462-11ggaqf1	388	20	foot	foot	NN
cord-014462-11ggaqf1	388	21	and	and	CC
cord-014462-11ggaqf1	388	22	mouth	mouth	NN
cord-014462-11ggaqf1	388	23	disease	disease	NN
cord-014462-11ggaqf1	388	24	of	of	IN
cord-014462-11ggaqf1	388	25	cloven	cloven	NN
cord-014462-11ggaqf1	388	26	footed	footed	JJ
cord-014462-11ggaqf1	388	27	animals	animal	NNS
cord-014462-11ggaqf1	388	28	.	.	.
cord-014462-11ggaqf1	389	1	The	the	DT
cord-014462-11ggaqf1	389	2	similar	similar	JJ
cord-014462-11ggaqf1	389	3	approach	approach	NN
cord-014462-11ggaqf1	389	4	may	may	MD
cord-014462-11ggaqf1	389	5	be	be	VB
cord-014462-11ggaqf1	389	6	worked	work	VBN
cord-014462-11ggaqf1	389	7	out	out	RP
cord-014462-11ggaqf1	389	8	for	for	IN
cord-014462-11ggaqf1	389	9	other	other	JJ
cord-014462-11ggaqf1	389	10	viral	viral	JJ
cord-014462-11ggaqf1	389	11	diseases	disease	NNS
cord-014462-11ggaqf1	389	12	also	also	RB
cord-014462-11ggaqf1	389	13	.	.	.
cord-014462-11ggaqf1	390	1	Despite	despite	IN
cord-014462-11ggaqf1	390	2	the	the	DT
cord-014462-11ggaqf1	390	3	availability	availability	NN
cord-014462-11ggaqf1	390	4	of	of	IN
cord-014462-11ggaqf1	390	5	an	an	DT
cord-014462-11ggaqf1	390	6	inactivated	inactivated	JJ
cord-014462-11ggaqf1	390	7	vaccine	vaccine	NN
cord-014462-11ggaqf1	390	8	that	that	WDT
cord-014462-11ggaqf1	390	9	is	be	VBZ
cord-014462-11ggaqf1	390	10	noted	note	VBN
cord-014462-11ggaqf1	390	11	to	to	TO
cord-014462-11ggaqf1	390	12	provide	provide	VB
cord-014462-11ggaqf1	390	13	solid	solid	JJ
cord-014462-11ggaqf1	390	14	immunity	immunity	NN
cord-014462-11ggaqf1	390	15	against	against	IN
cord-014462-11ggaqf1	390	16	the	the	DT
cord-014462-11ggaqf1	390	17	disease	disease	NN
cord-014462-11ggaqf1	390	18	over	over	IN
cord-014462-11ggaqf1	390	19	a	a	DT
cord-014462-11ggaqf1	390	20	short	short	JJ
cord-014462-11ggaqf1	390	21	period	period	NN
cord-014462-11ggaqf1	390	22	of	of	IN
cord-014462-11ggaqf1	390	23	time	time	NN
cord-014462-11ggaqf1	390	24	,	,	,
cord-014462-11ggaqf1	390	25	the	the	DT
cord-014462-11ggaqf1	390	26	search	search	NN
cord-014462-11ggaqf1	390	27	for	for	IN
cord-014462-11ggaqf1	390	28	an	an	DT
cord-014462-11ggaqf1	390	29	ideal	ideal	JJ
cord-014462-11ggaqf1	390	30	vaccine	vaccine	NN
cord-014462-11ggaqf1	390	31	,	,	,
cord-014462-11ggaqf1	390	32	the	the	DT
cord-014462-11ggaqf1	390	33	criteria	criterion	NNS
cord-014462-11ggaqf1	390	34	for	for	IN
cord-014462-11ggaqf1	390	35	which	which	WDT
cord-014462-11ggaqf1	390	36	are	be	VBP
cord-014462-11ggaqf1	390	37	;	;	:
cord-014462-11ggaqf1	390	38	safety	safety	NN
cord-014462-11ggaqf1	390	39	of	of	IN
cord-014462-11ggaqf1	390	40	the	the	DT
cord-014462-11ggaqf1	390	41	vaccine	vaccine	NN
cord-014462-11ggaqf1	390	42	for	for	IN
cord-014462-11ggaqf1	390	43	environment	environment	NN
cord-014462-11ggaqf1	390	44	,	,	,
cord-014462-11ggaqf1	390	45	easy	easy	JJ
cord-014462-11ggaqf1	390	46	in	in	IN
cord-014462-11ggaqf1	390	47	its	-PRON-	PRP$
cord-014462-11ggaqf1	390	48	preparation	preparation	NN
cord-014462-11ggaqf1	390	49	,	,	,
cord-014462-11ggaqf1	390	50	does	do	VBZ
cord-014462-11ggaqf1	390	51	not	not	RB
cord-014462-11ggaqf1	390	52	require	require	VB
cord-014462-11ggaqf1	390	53	a	a	DT
cord-014462-11ggaqf1	390	54	cold	cold	JJ
cord-014462-11ggaqf1	390	55	chain	chain	NN
cord-014462-11ggaqf1	390	56	for	for	IN
cord-014462-11ggaqf1	390	57	its	-PRON-	PRP$
cord-014462-11ggaqf1	390	58	storage	storage	NN
cord-014462-11ggaqf1	390	59	,	,	,
cord-014462-11ggaqf1	390	60	provides	provide	VBZ
cord-014462-11ggaqf1	390	61	longer	long	RBR
cord-014462-11ggaqf1	390	62	lasting	last	VBG
cord-014462-11ggaqf1	390	63	immunity	immunity	NN
cord-014462-11ggaqf1	390	64	,	,	,
cord-014462-11ggaqf1	390	65	economically	economically	RB
cord-014462-11ggaqf1	390	66	viable	viable	JJ
cord-014462-11ggaqf1	390	67	and	and	CC
cord-014462-11ggaqf1	390	68	may	may	MD
cord-014462-11ggaqf1	390	69	be	be	VB
cord-014462-11ggaqf1	390	70	able	able	JJ
cord-014462-11ggaqf1	390	71	to	to	TO
cord-014462-11ggaqf1	390	72	clear	clear	VB
cord-014462-11ggaqf1	390	73	the	the	DT
cord-014462-11ggaqf1	390	74	virus	virus	NN
cord-014462-11ggaqf1	390	75	in	in	IN
cord-014462-11ggaqf1	390	76	case	case	NN
cord-014462-11ggaqf1	390	77	of	of	IN
cord-014462-11ggaqf1	390	78	persistent	persistent	JJ
cord-014462-11ggaqf1	390	79	infection	infection	NN
cord-014462-11ggaqf1	390	80	is	be	VBZ
cord-014462-11ggaqf1	390	81	on	on	IN
cord-014462-11ggaqf1	390	82	.	.	.
cord-014462-11ggaqf1	391	1	The	the	DT
cord-014462-11ggaqf1	391	2	advent	advent	NN
cord-014462-11ggaqf1	391	3	of	of	IN
cord-014462-11ggaqf1	391	4	recombinant	recombinant	JJ
cord-014462-11ggaqf1	391	5	DNA	dna	NN
cord-014462-11ggaqf1	391	6	technology	technology	NN
cord-014462-11ggaqf1	391	7	together	together	RB
cord-014462-11ggaqf1	391	8	with	with	IN
cord-014462-11ggaqf1	391	9	the	the	DT
cord-014462-11ggaqf1	391	10	information	information	NN
cord-014462-11ggaqf1	391	11	available	available	JJ
cord-014462-11ggaqf1	391	12	on	on	IN
cord-014462-11ggaqf1	391	13	the	the	DT
cord-014462-11ggaqf1	391	14	molecular	molecular	JJ
cord-014462-11ggaqf1	391	15	biology	biology	NN
cord-014462-11ggaqf1	391	16	of	of	IN
cord-014462-11ggaqf1	391	17	viruses	virus	NNS
cord-014462-11ggaqf1	391	18	has	have	VBZ
cord-014462-11ggaqf1	391	19	enabled	enable	VBN
cord-014462-11ggaqf1	391	20	to	to	TO
cord-014462-11ggaqf1	391	21	design	design	VB
cord-014462-11ggaqf1	391	22	the	the	DT
cord-014462-11ggaqf1	391	23	development	development	NN
cord-014462-11ggaqf1	391	24	of	of	IN
cord-014462-11ggaqf1	391	25	newer	new	JJR
cord-014462-11ggaqf1	391	26	vaccines	vaccine	NNS
cord-014462-11ggaqf1	391	27	that	that	WDT
cord-014462-11ggaqf1	391	28	can	can	MD
cord-014462-11ggaqf1	391	29	induce	induce	VB
cord-014462-11ggaqf1	391	30	strong	strong	JJ
cord-014462-11ggaqf1	391	31	cellular	cellular	JJ
cord-014462-11ggaqf1	391	32	and	and	CC
cord-014462-11ggaqf1	391	33	humoral	humoral	JJ
cord-014462-11ggaqf1	391	34	responses	response	NNS
cord-014462-11ggaqf1	391	35	.	.	.
cord-014462-11ggaqf1	392	1	The	the	DT
cord-014462-11ggaqf1	392	2	underlying	underlying	JJ
cord-014462-11ggaqf1	392	3	principal	principal	NN
cord-014462-11ggaqf1	392	4	in	in	IN
cord-014462-11ggaqf1	392	5	the	the	DT
cord-014462-11ggaqf1	392	6	present	present	JJ
cord-014462-11ggaqf1	392	7	vaccine	vaccine	NN
cord-014462-11ggaqf1	392	8	development	development	NN
cord-014462-11ggaqf1	392	9	strategy	strategy	NN
cord-014462-11ggaqf1	392	10	world	world	NN
cord-014462-11ggaqf1	392	11	over	over	IN
cord-014462-11ggaqf1	392	12	is	be	VBZ
cord-014462-11ggaqf1	392	13	the	the	DT
cord-014462-11ggaqf1	392	14	virus	virus	NN
cord-014462-11ggaqf1	392	15	antigen	antigen	NN
cord-014462-11ggaqf1	392	16	gene	gene	NN
cord-014462-11ggaqf1	392	17	has	have	VBZ
cord-014462-11ggaqf1	392	18	to	to	TO
cord-014462-11ggaqf1	392	19	be	be	VB
cord-014462-11ggaqf1	392	20	expressed	express	VBN
cord-014462-11ggaqf1	392	21	in	in	IN
cord-014462-11ggaqf1	392	22	the	the	DT
cord-014462-11ggaqf1	392	23	tissue	tissue	NN
cord-014462-11ggaqf1	392	24	and	and	CC
cord-014462-11ggaqf1	392	25	the	the	DT
cord-014462-11ggaqf1	392	26	vaccine	vaccine	NN
cord-014462-11ggaqf1	392	27	backbone	backbone	NN
cord-014462-11ggaqf1	392	28	has	have	VBZ
cord-014462-11ggaqf1	392	29	to	to	TO
cord-014462-11ggaqf1	392	30	trigger	trigger	VB
cord-014462-11ggaqf1	392	31	the	the	DT
cord-014462-11ggaqf1	392	32	immune	immune	JJ
cord-014462-11ggaqf1	392	33	system	system	NN
cord-014462-11ggaqf1	392	34	for	for	IN
cord-014462-11ggaqf1	392	35	eliciting	elicit	VBG
cord-014462-11ggaqf1	392	36	desired	desire	VBN
cord-014462-11ggaqf1	392	37	immune	immune	JJ
cord-014462-11ggaqf1	392	38	response	response	NN
cord-014462-11ggaqf1	392	39	.	.	.
cord-014462-11ggaqf1	393	1	Bangalore	Bangalore	NNP
cord-014462-11ggaqf1	393	2	Campus	Campus	NNP
cord-014462-11ggaqf1	393	3	of	of	IN
cord-014462-11ggaqf1	393	4	IVRI	IVRI	NNP
cord-014462-11ggaqf1	393	5	has	have	VBZ
cord-014462-11ggaqf1	393	6	been	be	VBN
cord-014462-11ggaqf1	393	7	vigorously	vigorously	RB
cord-014462-11ggaqf1	393	8	pursuing	pursue	VBG
cord-014462-11ggaqf1	393	9	research	research	NN
cord-014462-11ggaqf1	393	10	to	to	TO
cord-014462-11ggaqf1	393	11	develop	develop	VB
cord-014462-11ggaqf1	393	12	ideal	ideal	JJ
cord-014462-11ggaqf1	393	13	vaccines	vaccine	NNS
cord-014462-11ggaqf1	393	14	for	for	IN
cord-014462-11ggaqf1	393	15	foot	foot	NN
cord-014462-11ggaqf1	393	16	and	and	CC
cord-014462-11ggaqf1	393	17	mouth	mouth	NN
cord-014462-11ggaqf1	393	18	disease	disease	NN
cord-014462-11ggaqf1	393	19	keeping	keep	VBG
cord-014462-11ggaqf1	393	20	above	above	IN
cord-014462-11ggaqf1	393	21	principal	principal	NN
cord-014462-11ggaqf1	393	22	in	in	IN
cord-014462-11ggaqf1	393	23	mind	mind	NN
cord-014462-11ggaqf1	393	24	to	to	TO
cord-014462-11ggaqf1	393	25	achieve	achieve	VB
cord-014462-11ggaqf1	393	26	the	the	DT
cord-014462-11ggaqf1	393	27	previously	previously	RB
cord-014462-11ggaqf1	393	28	mentioned	mention	VBN
cord-014462-11ggaqf1	393	29	criteria	criterion	NNS
cord-014462-11ggaqf1	393	30	.	.	.
cord-014462-11ggaqf1	394	1	The	the	DT
cord-014462-11ggaqf1	394	2	approaches	approach	NNS
cord-014462-11ggaqf1	394	3	selected	select	VBN
cord-014462-11ggaqf1	394	4	are	be	VBP
cord-014462-11ggaqf1	394	5	to	to	TO
cord-014462-11ggaqf1	394	6	see	see	VB
cord-014462-11ggaqf1	394	7	that	that	IN
cord-014462-11ggaqf1	394	8	the	the	DT
cord-014462-11ggaqf1	394	9	virus	virus	NN
cord-014462-11ggaqf1	394	10	antigen	antigen	NNP
cord-014462-11ggaqf1	394	11	/	/	SYM
cord-014462-11ggaqf1	394	12	s	s	NNS
cord-014462-11ggaqf1	394	13	replicate	replicate	VBP
cord-014462-11ggaqf1	394	14	transiently	transiently	RB
cord-014462-11ggaqf1	394	15	in	in	IN
cord-014462-11ggaqf1	394	16	the	the	DT
cord-014462-11ggaqf1	394	17	host	host	NN
cord-014462-11ggaqf1	394	18	.	.	.
cord-014462-11ggaqf1	395	1	The	the	DT
cord-014462-11ggaqf1	395	2	self	self	NN
cord-014462-11ggaqf1	395	3	replicating	replicate	VBG
cord-014462-11ggaqf1	395	4	vaccines	vaccine	NNS
cord-014462-11ggaqf1	395	5	that	that	WDT
cord-014462-11ggaqf1	395	6	have	have	VBP
cord-014462-11ggaqf1	395	7	been	be	VBN
cord-014462-11ggaqf1	395	8	developed	develop	VBN
cord-014462-11ggaqf1	395	9	are	be	VBP
cord-014462-11ggaqf1	395	10	pox	pox	NN
cord-014462-11ggaqf1	395	11	virus	virus	NN
cord-014462-11ggaqf1	395	12	vectored	vectore	VBN
cord-014462-11ggaqf1	395	13	vaccines	vaccine	NNS
cord-014462-11ggaqf1	395	14	,	,	,
cord-014462-11ggaqf1	395	15	alpha	alpha	NN
cord-014462-11ggaqf1	395	16	virus	virus	NN
cord-014462-11ggaqf1	395	17	replicase	replicase	NN
cord-014462-11ggaqf1	395	18	based	base	VBD
cord-014462-11ggaqf1	395	19	vaccines	vaccine	NNS
cord-014462-11ggaqf1	395	20	and	and	CC
cord-014462-11ggaqf1	395	21	FMDV	FMDV	NNP
cord-014462-11ggaqf1	395	22	vectored	vectore	VBD
cord-014462-11ggaqf1	395	23	vaccines	vaccine	NNS
cord-014462-11ggaqf1	395	24	.	.	.
cord-014462-11ggaqf1	396	1	The	the	DT
cord-014462-11ggaqf1	396	2	approach	approach	NN
cord-014462-11ggaqf1	396	3	and	and	CC
cord-014462-11ggaqf1	396	4	the	the	DT
cord-014462-11ggaqf1	396	5	result	result	NN
cord-014462-11ggaqf1	396	6	obtained	obtain	VBN
cord-014462-11ggaqf1	396	7	so	so	RB
cord-014462-11ggaqf1	396	8	far	far	RB
cord-014462-11ggaqf1	396	9	will	will	MD
cord-014462-11ggaqf1	396	10	be	be	VB
cord-014462-11ggaqf1	396	11	discussed	discuss	VBN
cord-014462-11ggaqf1	396	12	.	.	.
cord-014462-11ggaqf1	397	1	Silkworm	silkworm	NN
cord-014462-11ggaqf1	397	2	,	,	,
cord-014462-11ggaqf1	397	3	Bombyx	Bombyx	NNP
cord-014462-11ggaqf1	397	4	mori	mori	NNP
cord-014462-11ggaqf1	397	5	is	be	VBZ
cord-014462-11ggaqf1	397	6	affected	affect	VBN
cord-014462-11ggaqf1	397	7	with	with	IN
cord-014462-11ggaqf1	397	8	various	various	JJ
cord-014462-11ggaqf1	397	9	diseases	disease	NNS
cord-014462-11ggaqf1	397	10	caused	cause	VBN
cord-014462-11ggaqf1	397	11	by	by	IN
cord-014462-11ggaqf1	397	12	viruses	virus	NNS
cord-014462-11ggaqf1	397	13	viz	viz	JJ
cord-014462-11ggaqf1	397	14	.	.	.
cord-014462-11ggaqf1	398	1	,	,	,
cord-014462-11ggaqf1	398	2	nuclearpolyhedrosis	nuclearpolyhedrosis	NNP
cord-014462-11ggaqf1	398	3	(	(	-LRB-
cord-014462-11ggaqf1	398	4	BmNPV	BmNPV	NNP
cord-014462-11ggaqf1	398	5	)	)	-RRB-
cord-014462-11ggaqf1	398	6	,	,	,
cord-014462-11ggaqf1	398	7	densosnucleosis	densosnucleosis	NNP
cord-014462-11ggaqf1	398	8	(	(	-LRB-
cord-014462-11ggaqf1	398	9	BmDNV	BmDNV	NNP
cord-014462-11ggaqf1	398	10	)	)	-RRB-
cord-014462-11ggaqf1	398	11	and	and	CC
cord-014462-11ggaqf1	398	12	infectious	infectious	JJ
cord-014462-11ggaqf1	398	13	flacherie	flacherie	NN
cord-014462-11ggaqf1	398	14	(	(	-LRB-
cord-014462-11ggaqf1	398	15	BmIFV	BmIFV	NNP
cord-014462-11ggaqf1	398	16	)	)	-RRB-
cord-014462-11ggaqf1	398	17	.	.	.
cord-014462-11ggaqf1	399	1	Silkworm	silkworm	NN
cord-014462-11ggaqf1	399	2	viral	viral	JJ
cord-014462-11ggaqf1	399	3	diseases	disease	NNS
cord-014462-11ggaqf1	399	4	form	form	VBP
cord-014462-11ggaqf1	399	5	major	major	JJ
cord-014462-11ggaqf1	399	6	constraints	constraint	NNS
cord-014462-11ggaqf1	399	7	for	for	IN
cord-014462-11ggaqf1	399	8	the	the	DT
cord-014462-11ggaqf1	399	9	silk	silk	NN
cord-014462-11ggaqf1	399	10	cocoon	cocoon	NN
cord-014462-11ggaqf1	399	11	production	production	NN
cord-014462-11ggaqf1	399	12	in	in	IN
cord-014462-11ggaqf1	399	13	all	all	PDT
cord-014462-11ggaqf1	399	14	the	the	DT
cord-014462-11ggaqf1	399	15	sericultural	sericultural	JJ
cord-014462-11ggaqf1	399	16	countries	country	NNS
cord-014462-11ggaqf1	399	17	.	.	.
cord-014462-11ggaqf1	400	1	The	the	DT
cord-014462-11ggaqf1	400	2	losses	loss	NNS
cord-014462-11ggaqf1	400	3	due	due	JJ
cord-014462-11ggaqf1	400	4	to	to	IN
cord-014462-11ggaqf1	400	5	silkworm	silkworm	NN
cord-014462-11ggaqf1	400	6	diseases	disease	NNS
cord-014462-11ggaqf1	400	7	is	be	VBZ
cord-014462-11ggaqf1	400	8	estimated	estimate	VBN
cord-014462-11ggaqf1	400	9	about	about	IN
cord-014462-11ggaqf1	400	10	20	20	CD
cord-014462-11ggaqf1	400	11	-	-	SYM
cord-014462-11ggaqf1	400	12	40	40	CD
cord-014462-11ggaqf1	400	13	%	%	NN
cord-014462-11ggaqf1	400	14	and	and	CC
cord-014462-11ggaqf1	400	15	among	among	IN
cord-014462-11ggaqf1	400	16	them	-PRON-	PRP
cord-014462-11ggaqf1	400	17	viral	viral	JJ
cord-014462-11ggaqf1	400	18	diseases	disease	NNS
cord-014462-11ggaqf1	400	19	are	be	VBP
cord-014462-11ggaqf1	400	20	most	most	RBS
cord-014462-11ggaqf1	400	21	common	common	JJ
cord-014462-11ggaqf1	400	22	.	.	.
cord-014462-11ggaqf1	401	1	In	in	IN
cord-014462-11ggaqf1	401	2	sericulture	sericulture	NN
cord-014462-11ggaqf1	401	3	,	,	,
cord-014462-11ggaqf1	401	4	prophylactic	prophylactic	JJ
cord-014462-11ggaqf1	401	5	measures	measure	NNS
cord-014462-11ggaqf1	401	6	play	play	VBP
cord-014462-11ggaqf1	401	7	a	a	DT
cord-014462-11ggaqf1	401	8	vital	vital	JJ
cord-014462-11ggaqf1	401	9	role	role	NN
cord-014462-11ggaqf1	401	10	in	in	IN
cord-014462-11ggaqf1	401	11	the	the	DT
cord-014462-11ggaqf1	401	12	management	management	NN
cord-014462-11ggaqf1	401	13	of	of	IN
cord-014462-11ggaqf1	401	14	silkworm	silkworm	NN
cord-014462-11ggaqf1	401	15	diseases	disease	NNS
cord-014462-11ggaqf1	401	16	.	.	.
cord-014462-11ggaqf1	402	1	These	these	DT
cord-014462-11ggaqf1	402	2	include	include	VBP
cord-014462-11ggaqf1	402	3	disinfection	disinfection	NN
cord-014462-11ggaqf1	402	4	of	of	IN
cord-014462-11ggaqf1	402	5	silkworm	silkworm	NN
cord-014462-11ggaqf1	402	6	rearing	rear	VBG
cord-014462-11ggaqf1	402	7	house	house	NN
cord-014462-11ggaqf1	402	8	and	and	CC
cord-014462-11ggaqf1	402	9	appliances	appliance	NNS
cord-014462-11ggaqf1	402	10	,	,	,
cord-014462-11ggaqf1	402	11	rearing	rearing	NN
cord-014462-11ggaqf1	402	12	area	area	NN
cord-014462-11ggaqf1	402	13	,	,	,
cord-014462-11ggaqf1	402	14	rearing	rear	VBG
cord-014462-11ggaqf1	402	15	surroundings	surrounding	NNS
cord-014462-11ggaqf1	402	16	,	,	,
cord-014462-11ggaqf1	402	17	silkworm	silkworm	NN
cord-014462-11ggaqf1	402	18	egg	egg	NN
cord-014462-11ggaqf1	402	19	and	and	CC
cord-014462-11ggaqf1	402	20	body	body	NN
cord-014462-11ggaqf1	402	21	,	,	,
cord-014462-11ggaqf1	402	22	and	and	CC
cord-014462-11ggaqf1	402	23	rearing	rear	VBG
cord-014462-11ggaqf1	402	24	bed	bed	NN
cord-014462-11ggaqf1	402	25	disinfection	disinfection	NN
cord-014462-11ggaqf1	402	26	associated	associate	VBN
cord-014462-11ggaqf1	402	27	with	with	IN
cord-014462-11ggaqf1	402	28	maintenance	maintenance	NN
cord-014462-11ggaqf1	402	29	of	of	IN
cord-014462-11ggaqf1	402	30	general	general	JJ
cord-014462-11ggaqf1	402	31	hygiene	hygiene	NN
cord-014462-11ggaqf1	402	32	and	and	CC
cord-014462-11ggaqf1	402	33	personnel	personnel	NNS
cord-014462-11ggaqf1	402	34	hygiene	hygiene	NN
cord-014462-11ggaqf1	402	35	.	.	.
cord-014462-11ggaqf1	403	1	All	all	PDT
cord-014462-11ggaqf1	403	2	these	these	DT
cord-014462-11ggaqf1	403	3	activities	activity	NNS
cord-014462-11ggaqf1	403	4	are	be	VBP
cord-014462-11ggaqf1	403	5	generally	generally	RB
cord-014462-11ggaqf1	403	6	carried	carry	VBN
cord-014462-11ggaqf1	403	7	out	out	RP
cord-014462-11ggaqf1	403	8	as	as	IN
cord-014462-11ggaqf1	403	9	rituals	ritual	NNS
cord-014462-11ggaqf1	403	10	by	by	IN
cord-014462-11ggaqf1	403	11	using	use	VBG
cord-014462-11ggaqf1	403	12	general	general	JJ
cord-014462-11ggaqf1	403	13	disinfectants	disinfectant	NNS
cord-014462-11ggaqf1	403	14	often	often	RB
cord-014462-11ggaqf1	403	15	with	with	IN
cord-014462-11ggaqf1	403	16	partial	partial	JJ
cord-014462-11ggaqf1	403	17	success	success	NN
cord-014462-11ggaqf1	403	18	.	.	.
cord-014462-11ggaqf1	404	1	Recent	recent	JJ
cord-014462-11ggaqf1	404	2	trends	trend	NNS
cord-014462-11ggaqf1	404	3	in	in	IN
cord-014462-11ggaqf1	404	4	complete	complete	JJ
cord-014462-11ggaqf1	404	5	management	management	NN
cord-014462-11ggaqf1	404	6	of	of	IN
cord-014462-11ggaqf1	404	7	silkworm	silkworm	NN
cord-014462-11ggaqf1	404	8	diseases	disease	NNS
cord-014462-11ggaqf1	404	9	include	include	VBP
cord-014462-11ggaqf1	404	10	development	development	NN
cord-014462-11ggaqf1	404	11	of	of	IN
cord-014462-11ggaqf1	404	12	silkworm	silkworm	NN
cord-014462-11ggaqf1	404	13	hybrids	hybrid	NNS
cord-014462-11ggaqf1	404	14	evolved	evolve	VBN
cord-014462-11ggaqf1	404	15	from	from	IN
cord-014462-11ggaqf1	404	16	disease	disease	NN
cord-014462-11ggaqf1	404	17	resistant	resistant	JJ
cord-014462-11ggaqf1	404	18	/	/	SYM
cord-014462-11ggaqf1	404	19	tolerant	tolerant	JJ
cord-014462-11ggaqf1	404	20	breeds	breed	NNS
cord-014462-11ggaqf1	404	21	,	,	,
cord-014462-11ggaqf1	404	22	effective	effective	JJ
cord-014462-11ggaqf1	404	23	eco	eco	NN
cord-014462-11ggaqf1	404	24	-	-	:
cord-014462-11ggaqf1	404	25	and	and	CC
cord-014462-11ggaqf1	404	26	user	user	NN
cord-014462-11ggaqf1	404	27	-	-	HYPH
cord-014462-11ggaqf1	404	28	friendly	friendly	JJ
cord-014462-11ggaqf1	404	29	disinfectants	disinfectant	NNS
cord-014462-11ggaqf1	404	30	,	,	,
cord-014462-11ggaqf1	404	31	anti	anti	JJ
cord-014462-11ggaqf1	404	32	-	-	JJ
cord-014462-11ggaqf1	404	33	microbial	microbial	JJ
cord-014462-11ggaqf1	404	34	feed	feed	NN
cord-014462-11ggaqf1	404	35	-	-	HYPH
cord-014462-11ggaqf1	404	36	supplements	supplement	NNS
cord-014462-11ggaqf1	404	37	and	and	CC
cord-014462-11ggaqf1	404	38	use	use	NN
cord-014462-11ggaqf1	404	39	of	of	IN
cord-014462-11ggaqf1	404	40	transgenic	transgenic	JJ
cord-014462-11ggaqf1	404	41	silkworms	silkworm	NNS
cord-014462-11ggaqf1	404	42	.	.	.
cord-014462-11ggaqf1	405	1	Biotechnological	biotechnological	JJ
cord-014462-11ggaqf1	405	2	breakthrough	breakthrough	NN
cord-014462-11ggaqf1	405	3	in	in	IN
cord-014462-11ggaqf1	405	4	this	this	DT
cord-014462-11ggaqf1	405	5	regard	regard	NN
cord-014462-11ggaqf1	405	6	is	be	VBZ
cord-014462-11ggaqf1	405	7	through	through	IN
cord-014462-11ggaqf1	405	8	RNA	RNA	NNP
cord-014462-11ggaqf1	405	9	interference	interference	NN
cord-014462-11ggaqf1	405	10	(	(	-LRB-
cord-014462-11ggaqf1	405	11	RNAi	RNAi	NNP
cord-014462-11ggaqf1	405	12	)	)	-RRB-
cord-014462-11ggaqf1	405	13	approach	approach	NN
cord-014462-11ggaqf1	405	14	involving	involve	VBG
cord-014462-11ggaqf1	405	15	dsRNA	dsRNA	VBG
cord-014462-11ggaqf1	405	16	mediated	mediate	VBN
cord-014462-11ggaqf1	405	17	nuclear	nuclear	JJ
cord-014462-11ggaqf1	405	18	polyhedrosis	polyhedrosis	NN
cord-014462-11ggaqf1	405	19	management	management	NN
cord-014462-11ggaqf1	405	20	and	and	CC
cord-014462-11ggaqf1	405	21	this	this	DT
cord-014462-11ggaqf1	405	22	is	be	VBZ
cord-014462-11ggaqf1	405	23	presently	presently	RB
cord-014462-11ggaqf1	405	24	pursued	pursue	VBN
cord-014462-11ggaqf1	405	25	by	by	IN
cord-014462-11ggaqf1	405	26	APSSRDI	APSSRDI	NNP
cord-014462-11ggaqf1	405	27	,	,	,
cord-014462-11ggaqf1	405	28	HIndupur	HIndupur	NNP
cord-014462-11ggaqf1	405	29	in	in	IN
cord-014462-11ggaqf1	405	30	collaboration	collaboration	NN
cord-014462-11ggaqf1	405	31	with	with	IN
cord-014462-11ggaqf1	405	32	Centre	Centre	NNP
cord-014462-11ggaqf1	405	33	for	for	IN
cord-014462-11ggaqf1	405	34	DNA	DNA	NNP
cord-014462-11ggaqf1	405	35	Fingerprinting	Fingerprinting	NNP
cord-014462-11ggaqf1	405	36	and	and	CC
cord-014462-11ggaqf1	405	37	Diagnostics	Diagnostics	NNPS
cord-014462-11ggaqf1	405	38	(	(	-LRB-
cord-014462-11ggaqf1	405	39	CDFD	CDFD	NNP
cord-014462-11ggaqf1	405	40	)	)	-RRB-
cord-014462-11ggaqf1	405	41	,	,	,
cord-014462-11ggaqf1	405	42	Hyderabad	Hyderabad	NNP
cord-014462-11ggaqf1	405	43	.	.	.
cord-014462-11ggaqf1	406	1	Nadu	Nadu	NNP
cord-014462-11ggaqf1	406	2	and	and	CC
cord-014462-11ggaqf1	406	3	Karnataka	Karnataka	NNP
cord-014462-11ggaqf1	406	4	.	.	.
cord-014462-11ggaqf1	407	1	The	the	DT
cord-014462-11ggaqf1	407	2	disease	disease	NN
cord-014462-11ggaqf1	407	3	appears	appear	VBZ
cord-014462-11ggaqf1	407	4	to	to	TO
cord-014462-11ggaqf1	407	5	be	be	VB
cord-014462-11ggaqf1	407	6	more	more	RBR
cord-014462-11ggaqf1	407	7	severe	severe	JJ
cord-014462-11ggaqf1	407	8	in	in	IN
cord-014462-11ggaqf1	407	9	rural	rural	JJ
cord-014462-11ggaqf1	407	10	flocks	flock	NNS
cord-014462-11ggaqf1	407	11	than	than	IN
cord-014462-11ggaqf1	407	12	organized	organize	VBN
cord-014462-11ggaqf1	407	13	farms	farm	NNS
cord-014462-11ggaqf1	407	14	.	.	.
cord-014462-11ggaqf1	408	1	Our	-PRON-	PRP$
cord-014462-11ggaqf1	408	2	investigations	investigation	NNS
cord-014462-11ggaqf1	408	3	revealed	reveal	VBD
cord-014462-11ggaqf1	408	4	the	the	DT
cord-014462-11ggaqf1	408	5	Morbidity	morbidity	NN
cord-014462-11ggaqf1	408	6	,	,	,
cord-014462-11ggaqf1	408	7	mortality	mortality	NN
cord-014462-11ggaqf1	408	8	and	and	CC
cord-014462-11ggaqf1	408	9	case	case	NN
cord-014462-11ggaqf1	408	10	fatality	fatality	NN
cord-014462-11ggaqf1	408	11	rates	rate	NNS
cord-014462-11ggaqf1	408	12	among	among	IN
cord-014462-11ggaqf1	408	13	rural	rural	JJ
cord-014462-11ggaqf1	408	14	and	and	CC
cord-014462-11ggaqf1	408	15	organised	organised	JJ
cord-014462-11ggaqf1	408	16	farms	farm	NNS
cord-014462-11ggaqf1	408	17	as	as	IN
cord-014462-11ggaqf1	408	18	9.34	9.34	CD
cord-014462-11ggaqf1	408	19	%	%	NN
cord-014462-11ggaqf1	408	20	,	,	,
cord-014462-11ggaqf1	408	21	2.69	2.69	CD
cord-014462-11ggaqf1	408	22	%	%	NN
cord-014462-11ggaqf1	408	23	,	,	,
cord-014462-11ggaqf1	408	24	28.84	28.84	CD
cord-014462-11ggaqf1	408	25	%	%	NN
cord-014462-11ggaqf1	408	26	and	and	CC
cord-014462-11ggaqf1	408	27	6.22	6.22	CD
cord-014462-11ggaqf1	408	28	%	%	NN
cord-014462-11ggaqf1	408	29	,	,	,
cord-014462-11ggaqf1	408	30	0.47	0.47	CD
cord-014462-11ggaqf1	408	31	%	%	NN
cord-014462-11ggaqf1	408	32	,	,	,
cord-014462-11ggaqf1	408	33	7.63	7.63	CD
cord-014462-11ggaqf1	408	34	%	%	NN
cord-014462-11ggaqf1	408	35	respectively	respectively	RB
cord-014462-11ggaqf1	408	36	.	.	.
cord-014462-11ggaqf1	409	1	Higher	high	JJR
cord-014462-11ggaqf1	409	2	morbidity	morbidity	NN
cord-014462-11ggaqf1	409	3	and	and	CC
cord-014462-11ggaqf1	409	4	mortality	mortality	NN
cord-014462-11ggaqf1	409	5	in	in	IN
cord-014462-11ggaqf1	409	6	rural	rural	JJ
cord-014462-11ggaqf1	409	7	areas	area	NNS
cord-014462-11ggaqf1	409	8	may	may	MD
cord-014462-11ggaqf1	409	9	be	be	VB
cord-014462-11ggaqf1	409	10	due	due	JJ
cord-014462-11ggaqf1	409	11	to	to	IN
cord-014462-11ggaqf1	409	12	stress	stress	NN
cord-014462-11ggaqf1	409	13	factors	factor	NNS
cord-014462-11ggaqf1	409	14	like	like	IN
cord-014462-11ggaqf1	409	15	poor	poor	JJ
cord-014462-11ggaqf1	409	16	nutrition	nutrition	NN
cord-014462-11ggaqf1	409	17	,	,	,
cord-014462-11ggaqf1	409	18	parasitic	parasitic	JJ
cord-014462-11ggaqf1	409	19	burden	burden	NN
cord-014462-11ggaqf1	409	20	,	,	,
cord-014462-11ggaqf1	409	21	fatigue	fatigue	NN
cord-014462-11ggaqf1	409	22	due	due	IN
cord-014462-11ggaqf1	409	23	to	to	IN
cord-014462-11ggaqf1	409	24	long	long	JJ
cord-014462-11ggaqf1	409	25	walks	walk	NNS
cord-014462-11ggaqf1	409	26	and	and	CC
cord-014462-11ggaqf1	409	27	non	non	JJ
cord-014462-11ggaqf1	409	28	availability	availability	NN
cord-014462-11ggaqf1	409	29	of	of	IN
cord-014462-11ggaqf1	409	30	veterinary	veterinary	JJ
cord-014462-11ggaqf1	409	31	aid	aid	NN
cord-014462-11ggaqf1	409	32	.	.	.
cord-014462-11ggaqf1	410	1	Kulkarni	Kulkarni	NNP
cord-014462-11ggaqf1	410	2	et	et	NNP
cord-014462-11ggaqf1	410	3	al	al	NNP
cord-014462-11ggaqf1	410	4	.	.	.
cord-014462-11ggaqf1	410	5	1992	1992	CD
cord-014462-11ggaqf1	410	6	also	also	RB
cord-014462-11ggaqf1	410	7	reported	report	VBD
cord-014462-11ggaqf1	410	8	the	the	DT
cord-014462-11ggaqf1	410	9	severe	severe	JJ
cord-014462-11ggaqf1	410	10	BT	BT	NNP
cord-014462-11ggaqf1	410	11	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	410	12	in	in	IN
cord-014462-11ggaqf1	410	13	rural	rural	JJ
cord-014462-11ggaqf1	410	14	areas	area	NNS
cord-014462-11ggaqf1	410	15	of	of	IN
cord-014462-11ggaqf1	410	16	Maharashtra	Maharashtra	NNP
cord-014462-11ggaqf1	410	17	with	with	IN
cord-014462-11ggaqf1	410	18	overall	overall	JJ
cord-014462-11ggaqf1	410	19	morbidity	morbidity	NN
cord-014462-11ggaqf1	410	20	,	,	,
cord-014462-11ggaqf1	410	21	mortality	mortality	NN
cord-014462-11ggaqf1	410	22	and	and	CC
cord-014462-11ggaqf1	410	23	case	case	NN
cord-014462-11ggaqf1	410	24	fatality	fatality	NN
cord-014462-11ggaqf1	410	25	of	of	IN
cord-014462-11ggaqf1	410	26	32	32	CD
cord-014462-11ggaqf1	410	27	%	%	NN
cord-014462-11ggaqf1	410	28	,	,	,
cord-014462-11ggaqf1	410	29	8	8	CD
cord-014462-11ggaqf1	410	30	%	%	NN
cord-014462-11ggaqf1	410	31	and	and	CC
cord-014462-11ggaqf1	410	32	25	25	CD
cord-014462-11ggaqf1	410	33	%	%	NN
cord-014462-11ggaqf1	410	34	respectively	respectively	RB
cord-014462-11ggaqf1	410	35	.	.	.
cord-014462-11ggaqf1	411	1	All	all	PDT
cord-014462-11ggaqf1	411	2	the	the	DT
cord-014462-11ggaqf1	411	3	south	south	JJ
cord-014462-11ggaqf1	411	4	Indian	indian	JJ
cord-014462-11ggaqf1	411	5	sheep	sheep	NN
cord-014462-11ggaqf1	411	6	breeds	breed	NNS
cord-014462-11ggaqf1	411	7	were	be	VBD
cord-014462-11ggaqf1	411	8	found	find	VBN
cord-014462-11ggaqf1	411	9	to	to	TO
cord-014462-11ggaqf1	411	10	be	be	VB
cord-014462-11ggaqf1	411	11	susceptible	susceptible	JJ
cord-014462-11ggaqf1	411	12	and	and	CC
cord-014462-11ggaqf1	411	13	clinical	clinical	JJ
cord-014462-11ggaqf1	411	14	farm	farm	NN
cord-014462-11ggaqf1	411	15	of	of	IN
cord-014462-11ggaqf1	411	16	the	the	DT
cord-014462-11ggaqf1	411	17	disease	disease	NN
cord-014462-11ggaqf1	411	18	is	be	VBZ
cord-014462-11ggaqf1	411	19	evident	evident	JJ
cord-014462-11ggaqf1	411	20	in	in	IN
cord-014462-11ggaqf1	411	21	all	all	DT
cord-014462-11ggaqf1	411	22	of	of	IN
cord-014462-11ggaqf1	411	23	them	-PRON-	PRP
cord-014462-11ggaqf1	411	24	though	though	IN
cord-014462-11ggaqf1	411	25	Saravanabava	Saravanabava	NNP
cord-014462-11ggaqf1	411	26	(	(	-LRB-
cord-014462-11ggaqf1	411	27	1992	1992	CD
cord-014462-11ggaqf1	411	28	)	)	-RRB-
cord-014462-11ggaqf1	411	29	reported	report	VBD
cord-014462-11ggaqf1	411	30	variations	variation	NNS
cord-014462-11ggaqf1	411	31	in	in	IN
cord-014462-11ggaqf1	411	32	susceptibility	susceptibility	NN
cord-014462-11ggaqf1	411	33	among	among	IN
cord-014462-11ggaqf1	411	34	the	the	DT
cord-014462-11ggaqf1	411	35	indigenous	indigenous	JJ
cord-014462-11ggaqf1	411	36	sheep	sheep	NNS
cord-014462-11ggaqf1	411	37	.	.	.
cord-014462-11ggaqf1	412	1	Trichy	Trichy	NNP
cord-014462-11ggaqf1	412	2	black	black	JJ
cord-014462-11ggaqf1	412	3	and	and	CC
cord-014462-11ggaqf1	412	4	Ramnad	ramnad	JJ
cord-014462-11ggaqf1	412	5	white	white	JJ
cord-014462-11ggaqf1	412	6	sheep	sheep	NNS
cord-014462-11ggaqf1	412	7	were	be	VBD
cord-014462-11ggaqf1	412	8	found	find	VBN
cord-014462-11ggaqf1	412	9	to	to	TO
cord-014462-11ggaqf1	412	10	be	be	VB
cord-014462-11ggaqf1	412	11	more	more	RBR
cord-014462-11ggaqf1	412	12	susceptible	susceptible	JJ
cord-014462-11ggaqf1	412	13	than	than	IN
cord-014462-11ggaqf1	412	14	the	the	DT
cord-014462-11ggaqf1	412	15	Vambur	Vambur	NNP
cord-014462-11ggaqf1	412	16	and	and	CC
cord-014462-11ggaqf1	412	17	Mecheri	Mecheri	NNP
cord-014462-11ggaqf1	412	18	sheep	sheep	NNS
cord-014462-11ggaqf1	412	19	of	of	IN
cord-014462-11ggaqf1	412	20	Tamil	Tamil	NNP
cord-014462-11ggaqf1	412	21	Nadu	Nadu	NNP
cord-014462-11ggaqf1	412	22	.	.	.
cord-014462-11ggaqf1	413	1	Prevalence	prevalence	NN
cord-014462-11ggaqf1	413	2	of	of	IN
cord-014462-11ggaqf1	413	3	bluetongue	bluetongue	NN
cord-014462-11ggaqf1	413	4	in	in	IN
cord-014462-11ggaqf1	413	5	sheep	sheep	NN
cord-014462-11ggaqf1	413	6	,	,	,
cord-014462-11ggaqf1	413	7	goat	goat	NN
cord-014462-11ggaqf1	413	8	and	and	CC
cord-014462-11ggaqf1	413	9	cattle	cattle	NNS
cord-014462-11ggaqf1	413	10	appears	appear	VBZ
cord-014462-11ggaqf1	413	11	to	to	TO
cord-014462-11ggaqf1	413	12	be	be	VB
cord-014462-11ggaqf1	413	13	high	high	JJ
cord-014462-11ggaqf1	413	14	in	in	IN
cord-014462-11ggaqf1	413	15	the	the	DT
cord-014462-11ggaqf1	413	16	region	region	NN
cord-014462-11ggaqf1	413	17	.	.	.
cord-014462-11ggaqf1	414	1	Serological	serological	JJ
cord-014462-11ggaqf1	414	2	surveys	survey	NNS
cord-014462-11ggaqf1	414	3	conducted	conduct	VBN
cord-014462-11ggaqf1	414	4	in	in	IN
cord-014462-11ggaqf1	414	5	Andhra	Andhra	NNP
cord-014462-11ggaqf1	414	6	pradesh	pradesh	NNP
cord-014462-11ggaqf1	414	7	during	during	IN
cord-014462-11ggaqf1	414	8	1991	1991	CD
cord-014462-11ggaqf1	414	9	revealed	reveal	VBD
cord-014462-11ggaqf1	414	10	the	the	DT
cord-014462-11ggaqf1	414	11	prevalence	prevalence	NN
cord-014462-11ggaqf1	414	12	of	of	IN
cord-014462-11ggaqf1	414	13	BTV	BTV	NNP
cord-014462-11ggaqf1	414	14	antibodies	antibody	NNS
cord-014462-11ggaqf1	414	15	in	in	IN
cord-014462-11ggaqf1	414	16	sheep	sheep	NN
cord-014462-11ggaqf1	414	17	(	(	-LRB-
cord-014462-11ggaqf1	414	18	47.5	47.5	CD
cord-014462-11ggaqf1	414	19	%	%	NN
cord-014462-11ggaqf1	414	20	)	)	-RRB-
cord-014462-11ggaqf1	414	21	goats	goat	NNS
cord-014462-11ggaqf1	414	22	(	(	-LRB-
cord-014462-11ggaqf1	414	23	43.56	43.56	CD
cord-014462-11ggaqf1	414	24	%	%	NN
cord-014462-11ggaqf1	414	25	)	)	-RRB-
cord-014462-11ggaqf1	414	26	cattle	cattle	NNS
cord-014462-11ggaqf1	414	27	(	(	-LRB-
cord-014462-11ggaqf1	414	28	33	33	CD
cord-014462-11ggaqf1	414	29	%	%	NN
cord-014462-11ggaqf1	414	30	)	)	-RRB-
cord-014462-11ggaqf1	414	31	and	and	CC
cord-014462-11ggaqf1	414	32	buffaloe	buffaloe	NNP
cord-014462-11ggaqf1	414	33	(	(	-LRB-
cord-014462-11ggaqf1	414	34	20	20	CD
cord-014462-11ggaqf1	414	35	%	%	NN
cord-014462-11ggaqf1	414	36	)	)	-RRB-
cord-014462-11ggaqf1	414	37	.	.	.
cord-014462-11ggaqf1	415	1	Similar	similar	JJ
cord-014462-11ggaqf1	415	2	high	high	JJ
cord-014462-11ggaqf1	415	3	prevalence	prevalence	NN
cord-014462-11ggaqf1	415	4	of	of	IN
cord-014462-11ggaqf1	415	5	BTV	BTV	NNP
cord-014462-11ggaqf1	415	6	antibodies	antibody	NNS
cord-014462-11ggaqf1	415	7	in	in	IN
cord-014462-11ggaqf1	415	8	sheep	sheep	NNS
cord-014462-11ggaqf1	415	9	and	and	CC
cord-014462-11ggaqf1	415	10	goats	goat	NNS
cord-014462-11ggaqf1	415	11	were	be	VBD
cord-014462-11ggaqf1	415	12	also	also	RB
cord-014462-11ggaqf1	415	13	reported	report	VBN
cord-014462-11ggaqf1	415	14	from	from	IN
cord-014462-11ggaqf1	415	15	the	the	DT
cord-014462-11ggaqf1	415	16	other	other	JJ
cord-014462-11ggaqf1	415	17	states	state	NNS
cord-014462-11ggaqf1	415	18	in	in	IN
cord-014462-11ggaqf1	415	19	the	the	DT
cord-014462-11ggaqf1	415	20	region	region	NN
cord-014462-11ggaqf1	415	21	.	.	.
cord-014462-11ggaqf1	416	1	Clinical	clinical	JJ
cord-014462-11ggaqf1	416	2	disease	disease	NN
cord-014462-11ggaqf1	416	3	has	have	VBZ
cord-014462-11ggaqf1	416	4	not	not	RB
cord-014462-11ggaqf1	416	5	been	be	VBN
cord-014462-11ggaqf1	416	6	recorded	record	VBN
cord-014462-11ggaqf1	416	7	in	in	IN
cord-014462-11ggaqf1	416	8	kerala	kerala	NNP
cord-014462-11ggaqf1	416	9	though	though	IN
cord-014462-11ggaqf1	416	10	BTV	BTV	NNP
cord-014462-11ggaqf1	416	11	antibodies	antibody	NNS
cord-014462-11ggaqf1	416	12	were	be	VBD
cord-014462-11ggaqf1	416	13	recorded	record	VBN
cord-014462-11ggaqf1	416	14	in	in	IN
cord-014462-11ggaqf1	416	15	sheep	sheep	NN
cord-014462-11ggaqf1	416	16	(	(	-LRB-
cord-014462-11ggaqf1	416	17	13.76	13.76	CD
cord-014462-11ggaqf1	416	18	%	%	NN
cord-014462-11ggaqf1	416	19	)	)	-RRB-
cord-014462-11ggaqf1	416	20	and	and	CC
cord-014462-11ggaqf1	416	21	goats	goat	NNS
cord-014462-11ggaqf1	416	22	(	(	-LRB-
cord-014462-11ggaqf1	416	23	7.10	7.10	CD
cord-014462-11ggaqf1	416	24	%	%	NN
cord-014462-11ggaqf1	416	25	)	)	-RRB-
cord-014462-11ggaqf1	416	26	(	(	-LRB-
cord-014462-11ggaqf1	416	27	Ravi	Ravi	NNP
cord-014462-11ggaqf1	416	28	Sankar	Sankar	NNP
cord-014462-11ggaqf1	416	29	2003	2003	CD
cord-014462-11ggaqf1	416	30	)	)	-RRB-
cord-014462-11ggaqf1	416	31	.	.	.
cord-014462-11ggaqf1	417	1	Culicoides	culicoide	NNS
cord-014462-11ggaqf1	417	2	are	be	VBP
cord-014462-11ggaqf1	417	3	the	the	DT
cord-014462-11ggaqf1	417	4	known	know	VBN
cord-014462-11ggaqf1	417	5	biological	biological	JJ
cord-014462-11ggaqf1	417	6	vectors	vector	NNS
cord-014462-11ggaqf1	417	7	of	of	IN
cord-014462-11ggaqf1	417	8	BTV	BTV	NNP
cord-014462-11ggaqf1	417	9	.	.	.
cord-014462-11ggaqf1	418	1	All	all	PDT
cord-014462-11ggaqf1	418	2	the	the	DT
cord-014462-11ggaqf1	418	3	culicoides	culicoide	NNS
cord-014462-11ggaqf1	418	4	species	specie	NNS
cord-014462-11ggaqf1	418	5	are	be	VBP
cord-014462-11ggaqf1	418	6	not	not	RB
cord-014462-11ggaqf1	418	7	capable	capable	JJ
cord-014462-11ggaqf1	418	8	of	of	IN
cord-014462-11ggaqf1	418	9	transmitting	transmit	VBG
cord-014462-11ggaqf1	418	10	the	the	DT
cord-014462-11ggaqf1	418	11	BTV	BTV	NNP
cord-014462-11ggaqf1	418	12	.	.	.
cord-014462-11ggaqf1	419	1	The	the	DT
cord-014462-11ggaqf1	419	2	occurrence	occurrence	NN
cord-014462-11ggaqf1	419	3	of	of	IN
cord-014462-11ggaqf1	419	4	the	the	DT
cord-014462-11ggaqf1	419	5	disease	disease	NN
cord-014462-11ggaqf1	419	6	is	be	VBZ
cord-014462-11ggaqf1	419	7	related	relate	VBN
cord-014462-11ggaqf1	419	8	to	to	IN
cord-014462-11ggaqf1	419	9	the	the	DT
cord-014462-11ggaqf1	419	10	presence	presence	NN
cord-014462-11ggaqf1	419	11	of	of	IN
cord-014462-11ggaqf1	419	12	the	the	DT
cord-014462-11ggaqf1	419	13	competent	competent	JJ
cord-014462-11ggaqf1	419	14	vectors	vector	NNS
cord-014462-11ggaqf1	419	15	in	in	IN
cord-014462-11ggaqf1	419	16	the	the	DT
cord-014462-11ggaqf1	419	17	area	area	NN
cord-014462-11ggaqf1	419	18	.	.	.
cord-014462-11ggaqf1	420	1	Jain	Jain	NNP
cord-014462-11ggaqf1	420	2	et	et	NNP
cord-014462-11ggaqf1	420	3	al	al	NNP
cord-014462-11ggaqf1	420	4	.	.	.
cord-014462-11ggaqf1	421	1	(	(	-LRB-
cord-014462-11ggaqf1	421	2	1988	1988	CD
cord-014462-11ggaqf1	421	3	)	)	-RRB-
cord-014462-11ggaqf1	421	4	established	establish	VBD
cord-014462-11ggaqf1	421	5	the	the	DT
cord-014462-11ggaqf1	421	6	involvement	involvement	NN
cord-014462-11ggaqf1	421	7	of	of	IN
cord-014462-11ggaqf1	421	8	the	the	DT
cord-014462-11ggaqf1	421	9	culicoides	culicoide	NNS
cord-014462-11ggaqf1	421	10	in	in	IN
cord-014462-11ggaqf1	421	11	transmitting	transmit	VBG
cord-014462-11ggaqf1	421	12	the	the	DT
cord-014462-11ggaqf1	421	13	BTV	BTV	NNP
cord-014462-11ggaqf1	421	14	by	by	IN
cord-014462-11ggaqf1	421	15	isolating	isolate	VBG
cord-014462-11ggaqf1	421	16	the	the	DT
cord-014462-11ggaqf1	421	17	virus	virus	NN
cord-014462-11ggaqf1	421	18	from	from	IN
cord-014462-11ggaqf1	421	19	culicoides	culicoide	NNS
cord-014462-11ggaqf1	421	20	at	at	IN
cord-014462-11ggaqf1	421	21	Haryana	Haryana	NNP
cord-014462-11ggaqf1	421	22	,	,	,
cord-014462-11ggaqf1	421	23	the	the	DT
cord-014462-11ggaqf1	421	24	North	north	JJ
cord-014462-11ggaqf1	421	25	Indian	indian	JJ
cord-014462-11ggaqf1	421	26	state	state	NN
cord-014462-11ggaqf1	421	27	.	.	.
cord-014462-11ggaqf1	422	1	C.	C.	NNP
cord-014462-11ggaqf1	422	2	imicola	imicola	NNP
cord-014462-11ggaqf1	422	3	and	and	CC
cord-014462-11ggaqf1	422	4	C.	C.	NNP
cord-014462-11ggaqf1	422	5	oxystoma	oxystoma	NNP
cord-014462-11ggaqf1	422	6	were	be	VBD
cord-014462-11ggaqf1	422	7	found	find	VBN
cord-014462-11ggaqf1	422	8	to	to	TO
cord-014462-11ggaqf1	422	9	be	be	VB
cord-014462-11ggaqf1	422	10	prevalent	prevalent	JJ
cord-014462-11ggaqf1	422	11	in	in	IN
cord-014462-11ggaqf1	422	12	Andhra	Andhra	NNP
cord-014462-11ggaqf1	422	13	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	422	14	and	and	CC
cord-014462-11ggaqf1	422	15	Tamil	Tamil	NNP
cord-014462-11ggaqf1	422	16	Nadu	Nadu	NNP
cord-014462-11ggaqf1	422	17	.	.	.
cord-014462-11ggaqf1	423	1	Narladakar	Narladakar	NNP
cord-014462-11ggaqf1	423	2	et	et	IN
cord-014462-11ggaqf1	423	3	al.(1993	al.(1993	NN
cord-014462-11ggaqf1	423	4	)	)	-RRB-
cord-014462-11ggaqf1	423	5	reported	report	VBD
cord-014462-11ggaqf1	423	6	the	the	DT
cord-014462-11ggaqf1	423	7	presence	presence	NN
cord-014462-11ggaqf1	423	8	of	of	IN
cord-014462-11ggaqf1	423	9	C.	C.	NNP
cord-014462-11ggaqf1	423	10	schultzei	schultzei	NNP
cord-014462-11ggaqf1	423	11	,	,	,
cord-014462-11ggaqf1	423	12	C.	C.	NNP
cord-014462-11ggaqf1	423	13	perigrinus	perigrinus	NNP
cord-014462-11ggaqf1	423	14	and	and	CC
cord-014462-11ggaqf1	423	15	C.	C.	NNP
cord-014462-11ggaqf1	423	16	octoni	octoni	RB
cord-014462-11ggaqf1	423	17	in	in	IN
cord-014462-11ggaqf1	423	18	Marathwada	Marathwada	NNP
cord-014462-11ggaqf1	423	19	region	region	NN
cord-014462-11ggaqf1	423	20	of	of	IN
cord-014462-11ggaqf1	423	21	Maharastra	Maharastra	NNP
cord-014462-11ggaqf1	423	22	.	.	.
cord-014462-11ggaqf1	424	1	Culicoid	Culicoid	NNP
cord-014462-11ggaqf1	424	2	vectors	vector	NNS
cord-014462-11ggaqf1	424	3	are	be	VBP
cord-014462-11ggaqf1	424	4	significantly	significantly	RB
cord-014462-11ggaqf1	424	5	affected	affect	VBN
cord-014462-11ggaqf1	424	6	by	by	IN
cord-014462-11ggaqf1	424	7	the	the	DT
cord-014462-11ggaqf1	424	8	climate	climate	NN
cord-014462-11ggaqf1	424	9	and	and	CC
cord-014462-11ggaqf1	424	10	annual	annual	JJ
cord-014462-11ggaqf1	424	11	variations	variation	NNS
cord-014462-11ggaqf1	424	12	in	in	IN
cord-014462-11ggaqf1	424	13	the	the	DT
cord-014462-11ggaqf1	424	14	climate	climate	NN
cord-014462-11ggaqf1	424	15	reflects	reflect	VBZ
cord-014462-11ggaqf1	424	16	the	the	DT
cord-014462-11ggaqf1	424	17	outcome	outcome	NN
cord-014462-11ggaqf1	424	18	of	of	IN
cord-014462-11ggaqf1	424	19	the	the	DT
cord-014462-11ggaqf1	424	20	disease	disease	NN
cord-014462-11ggaqf1	424	21	.	.	.
cord-014462-11ggaqf1	425	1	The	the	DT
cord-014462-11ggaqf1	425	2	monsoon	monsoon	NN
cord-014462-11ggaqf1	425	3	season	season	NN
cord-014462-11ggaqf1	425	4	(	(	-LRB-
cord-014462-11ggaqf1	425	5	June	June	NNP
cord-014462-11ggaqf1	425	6	to	to	IN
cord-014462-11ggaqf1	425	7	Dec	Dec	NNP
cord-014462-11ggaqf1	425	8	)	)	-RRB-
cord-014462-11ggaqf1	425	9	with	with	IN
cord-014462-11ggaqf1	425	10	the	the	DT
cord-014462-11ggaqf1	425	11	temperature	temperature	NN
cord-014462-11ggaqf1	425	12	ranging	range	VBG
cord-014462-11ggaqf1	425	13	from	from	IN
cord-014462-11ggaqf1	425	14	21.2	21.2	CD
cord-014462-11ggaqf1	425	15	to	to	IN
cord-014462-11ggaqf1	425	16	35.6	35.6	CD
cord-014462-11ggaqf1	425	17	°	°	NN
cord-014462-11ggaqf1	425	18	C	C	NNP
cord-014462-11ggaqf1	425	19	appears	appear	VBZ
cord-014462-11ggaqf1	425	20	to	to	TO
cord-014462-11ggaqf1	425	21	be	be	VB
cord-014462-11ggaqf1	425	22	favourable	favourable	JJ
cord-014462-11ggaqf1	425	23	period	period	NN
cord-014462-11ggaqf1	425	24	for	for	IN
cord-014462-11ggaqf1	425	25	the	the	DT
cord-014462-11ggaqf1	425	26	multiplication	multiplication	NN
cord-014462-11ggaqf1	425	27	of	of	IN
cord-014462-11ggaqf1	425	28	culicoides	culicoide	NNS
cord-014462-11ggaqf1	425	29	.	.	.
cord-014462-11ggaqf1	426	1	The	the	DT
cord-014462-11ggaqf1	426	2	maximum	maximum	JJ
cord-014462-11ggaqf1	426	3	No	no	NN
cord-014462-11ggaqf1	426	4	of	of	IN
cord-014462-11ggaqf1	426	5	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	426	6	were	be	VBD
cord-014462-11ggaqf1	426	7	recorded	record	VBN
cord-014462-11ggaqf1	426	8	during	during	IN
cord-014462-11ggaqf1	426	9	the	the	DT
cord-014462-11ggaqf1	426	10	North	North	NNP
cord-014462-11ggaqf1	426	11	East	East	NNP
cord-014462-11ggaqf1	426	12	monsoon	monsoon	NN
cord-014462-11ggaqf1	426	13	period	period	NN
cord-014462-11ggaqf1	426	14	(	(	-LRB-
cord-014462-11ggaqf1	426	15	Oct	Oct	NNP
cord-014462-11ggaqf1	426	16	-	-	HYPH
cord-014462-11ggaqf1	426	17	Dec	Dec	NNP
cord-014462-11ggaqf1	426	18	)	)	-RRB-
cord-014462-11ggaqf1	426	19	followed	follow	VBD
cord-014462-11ggaqf1	426	20	by	by	IN
cord-014462-11ggaqf1	426	21	South	South	NNP
cord-014462-11ggaqf1	426	22	West	West	NNP
cord-014462-11ggaqf1	426	23	monsoon	monsoon	NN
cord-014462-11ggaqf1	426	24	period	period	NN
cord-014462-11ggaqf1	426	25	(	(	-LRB-
cord-014462-11ggaqf1	426	26	June	June	NNP
cord-014462-11ggaqf1	426	27	to	to	IN
cord-014462-11ggaqf1	426	28	Sep	Sep	NNP
cord-014462-11ggaqf1	426	29	)	)	-RRB-
cord-014462-11ggaqf1	426	30	in	in	IN
cord-014462-11ggaqf1	426	31	the	the	DT
cord-014462-11ggaqf1	426	32	region	region	NN
cord-014462-11ggaqf1	426	33	.	.	.
cord-014462-11ggaqf1	427	1	However	however	RB
cord-014462-11ggaqf1	427	2	,	,	,
cord-014462-11ggaqf1	427	3	details	detail	NNS
cord-014462-11ggaqf1	427	4	on	on	IN
cord-014462-11ggaqf1	427	5	the	the	DT
cord-014462-11ggaqf1	427	6	distribution	distribution	NN
cord-014462-11ggaqf1	427	7	of	of	IN
cord-014462-11ggaqf1	427	8	the	the	DT
cord-014462-11ggaqf1	427	9	competent	competent	JJ
cord-014462-11ggaqf1	427	10	vectors	vector	NNS
cord-014462-11ggaqf1	427	11	,	,	,
cord-014462-11ggaqf1	427	12	feeding	feed	VBG
cord-014462-11ggaqf1	427	13	habits	habit	NNS
cord-014462-11ggaqf1	427	14	and	and	CC
cord-014462-11ggaqf1	427	15	their	-PRON-	PRP$
cord-014462-11ggaqf1	427	16	dynamics	dynamic	NNS
cord-014462-11ggaqf1	427	17	in	in	IN
cord-014462-11ggaqf1	427	18	the	the	DT
cord-014462-11ggaqf1	427	19	region	region	NN
cord-014462-11ggaqf1	427	20	is	be	VBZ
cord-014462-11ggaqf1	427	21	lacking	lack	VBG
cord-014462-11ggaqf1	427	22	Multiple	multiple	JJ
cord-014462-11ggaqf1	427	23	BTV	BTV	NNP
cord-014462-11ggaqf1	427	24	serotypes	serotype	NNS
cord-014462-11ggaqf1	427	25	were	be	VBD
cord-014462-11ggaqf1	427	26	found	find	VBN
cord-014462-11ggaqf1	427	27	to	to	TO
cord-014462-11ggaqf1	427	28	be	be	VB
cord-014462-11ggaqf1	427	29	circulating	circulate	VBG
cord-014462-11ggaqf1	427	30	in	in	IN
cord-014462-11ggaqf1	427	31	the	the	DT
cord-014462-11ggaqf1	427	32	region	region	NN
cord-014462-11ggaqf1	427	33	.	.	.
cord-014462-11ggaqf1	428	1	(	(	-LRB-
cord-014462-11ggaqf1	428	2	Kulkarni	Kulkarni	NNP
cord-014462-11ggaqf1	428	3	and	and	CC
cord-014462-11ggaqf1	428	4	Kulkarni	Kulkarni	NNP
cord-014462-11ggaqf1	428	5	1984	1984	CD
cord-014462-11ggaqf1	428	6	;	;	:
cord-014462-11ggaqf1	428	7	Janakiraman	Janakiraman	NNP
cord-014462-11ggaqf1	428	8	etal	etal	NNP
cord-014462-11ggaqf1	428	9	.	.	.
cord-014462-11ggaqf1	428	10	1991	1991	CD
cord-014462-11ggaqf1	428	11	;	;	:
cord-014462-11ggaqf1	428	12	Mehrotra	Mehrotra	NNP
cord-014462-11ggaqf1	428	13	et	et	NNP
cord-014462-11ggaqf1	428	14	al	al	NNP
cord-014462-11ggaqf1	428	15	.	.	.
cord-014462-11ggaqf1	428	16	1996	1996	CD
cord-014462-11ggaqf1	428	17	)	)	-RRB-
cord-014462-11ggaqf1	429	1	A	a	DT
cord-014462-11ggaqf1	429	2	total	total	NN
cord-014462-11ggaqf1	429	3	of	of	IN
cord-014462-11ggaqf1	429	4	10	10	CD
cord-014462-11ggaqf1	429	5	serotypes	serotype	NNS
cord-014462-11ggaqf1	429	6	viz	viz	NN
cord-014462-11ggaqf1	429	7	.	.	.
cord-014462-11ggaqf1	430	1	1	1	LS
cord-014462-11ggaqf1	430	2	-	-	SYM
cord-014462-11ggaqf1	430	3	4	4	CD
cord-014462-11ggaqf1	430	4	,	,	,
cord-014462-11ggaqf1	430	5	8	8	CD
cord-014462-11ggaqf1	430	6	,	,	,
cord-014462-11ggaqf1	430	7	9	9	CD
cord-014462-11ggaqf1	430	8	,	,	,
cord-014462-11ggaqf1	430	9	15	15	CD
cord-014462-11ggaqf1	430	10	,	,	,
cord-014462-11ggaqf1	430	11	16	16	CD
cord-014462-11ggaqf1	430	12	,	,	,
cord-014462-11ggaqf1	430	13	18	18	CD
cord-014462-11ggaqf1	430	14	and	and	CC
cord-014462-11ggaqf1	430	15	23	23	CD
cord-014462-11ggaqf1	430	16	were	be	VBD
cord-014462-11ggaqf1	430	17	identified	identify	VBN
cord-014462-11ggaqf1	430	18	based	base	VBN
cord-014462-11ggaqf1	430	19	on	on	IN
cord-014462-11ggaqf1	430	20	the	the	DT
cord-014462-11ggaqf1	430	21	virus	virus	NN
cord-014462-11ggaqf1	430	22	isolations	isolation	NNS
cord-014462-11ggaqf1	430	23	.	.	.
cord-014462-11ggaqf1	431	1	Sreenivasulu	Sreenivasulu	NNP
cord-014462-11ggaqf1	431	2	et	et	FW
cord-014462-11ggaqf1	431	3	al	al	NNP
cord-014462-11ggaqf1	431	4	.	.	.
cord-014462-11ggaqf1	432	1	1999	1999	CD
cord-014462-11ggaqf1	432	2	isolated	isolate	VBD
cord-014462-11ggaqf1	432	3	BTV	BTV	NNP
cord-014462-11ggaqf1	432	4	serotype	serotype	NN
cord-014462-11ggaqf1	432	5	2	2	CD
cord-014462-11ggaqf1	432	6	from	from	IN
cord-014462-11ggaqf1	432	7	an	an	DT
cord-014462-11ggaqf1	432	8	outbreak	outbreak	NN
cord-014462-11ggaqf1	432	9	of	of	IN
cord-014462-11ggaqf1	432	10	BT	BT	NNP
cord-014462-11ggaqf1	432	11	in	in	IN
cord-014462-11ggaqf1	432	12	native	native	JJ
cord-014462-11ggaqf1	432	13	sheep	sheep	NN
cord-014462-11ggaqf1	432	14	of	of	IN
cord-014462-11ggaqf1	432	15	Andhra	Andhra	NNP
cord-014462-11ggaqf1	432	16	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	432	17	.	.	.
cord-014462-11ggaqf1	433	1	BTV	BTV	NNP
cord-014462-11ggaqf1	433	2	serotype	serotype	NNP
cord-014462-11ggaqf1	433	3	9	9	CD
cord-014462-11ggaqf1	433	4	,	,	,
cord-014462-11ggaqf1	433	5	15	15	CD
cord-014462-11ggaqf1	433	6	and	and	CC
cord-014462-11ggaqf1	433	7	21	21	CD
cord-014462-11ggaqf1	433	8	were	be	VBD
cord-014462-11ggaqf1	433	9	also	also	RB
cord-014462-11ggaqf1	433	10	isolated	isolate	VBN
cord-014462-11ggaqf1	433	11	from	from	IN
cord-014462-11ggaqf1	433	12	the	the	DT
cord-014462-11ggaqf1	433	13	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	433	14	occurred	occur	VBD
cord-014462-11ggaqf1	433	15	in	in	IN
cord-014462-11ggaqf1	433	16	Andhra	Andhra	NNP
cord-014462-11ggaqf1	433	17	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	433	18	.	.	.
cord-014462-11ggaqf1	434	1	Some	some	DT
cord-014462-11ggaqf1	434	2	of	of	IN
cord-014462-11ggaqf1	434	3	the	the	DT
cord-014462-11ggaqf1	434	4	isolates	isolate	NNS
cord-014462-11ggaqf1	434	5	need	need	VBP
cord-014462-11ggaqf1	434	6	to	to	TO
cord-014462-11ggaqf1	434	7	be	be	VB
cord-014462-11ggaqf1	434	8	serotyped	serotyped	JJ
cord-014462-11ggaqf1	434	9	.	.	.
cord-014462-11ggaqf1	435	1	Deshmukh	Deshmukh	NNP
cord-014462-11ggaqf1	435	2	and	and	CC
cord-014462-11ggaqf1	435	3	Gujar	Gujar	NNP
cord-014462-11ggaqf1	435	4	(	(	-LRB-
cord-014462-11ggaqf1	435	5	1999	1999	CD
cord-014462-11ggaqf1	435	6	)	)	-RRB-
cord-014462-11ggaqf1	435	7	isolated	isolate	VBD
cord-014462-11ggaqf1	435	8	BTV	BTV	NNP
cord-014462-11ggaqf1	435	9	type	type	NN
cord-014462-11ggaqf1	435	10	1	1	CD
cord-014462-11ggaqf1	435	11	from	from	IN
cord-014462-11ggaqf1	435	12	Maharashtra	Maharashtra	NNP
cord-014462-11ggaqf1	435	13	.	.	.
cord-014462-11ggaqf1	436	1	Following	follow	VBG
cord-014462-11ggaqf1	436	2	is	be	VBZ
cord-014462-11ggaqf1	436	3	the	the	DT
cord-014462-11ggaqf1	436	4	summary	summary	NN
cord-014462-11ggaqf1	436	5	of	of	IN
cord-014462-11ggaqf1	436	6	the	the	DT
cord-014462-11ggaqf1	436	7	distribution	distribution	NN
cord-014462-11ggaqf1	436	8	of	of	IN
cord-014462-11ggaqf1	436	9	BTV	BTV	NNP
cord-014462-11ggaqf1	436	10	serotypes	serotype	NNS
cord-014462-11ggaqf1	436	11	in	in	IN
cord-014462-11ggaqf1	436	12	this	this	DT
cord-014462-11ggaqf1	436	13	region	region	NN
cord-014462-11ggaqf1	436	14	.	.	.
cord-014462-11ggaqf1	437	1	Clinical	clinical	JJ
cord-014462-11ggaqf1	437	2	picture	picture	NN
cord-014462-11ggaqf1	437	3	of	of	IN
cord-014462-11ggaqf1	437	4	BT	BT	NNP
cord-014462-11ggaqf1	437	5	in	in	IN
cord-014462-11ggaqf1	437	6	native	native	JJ
cord-014462-11ggaqf1	437	7	sheep	sheep	NN
cord-014462-11ggaqf1	437	8	appears	appear	VBZ
cord-014462-11ggaqf1	437	9	to	to	TO
cord-014462-11ggaqf1	437	10	be	be	VB
cord-014462-11ggaqf1	437	11	slightly	slightly	RB
cord-014462-11ggaqf1	437	12	different	different	JJ
cord-014462-11ggaqf1	437	13	,	,	,
cord-014462-11ggaqf1	437	14	the	the	DT
cord-014462-11ggaqf1	437	15	major	major	JJ
cord-014462-11ggaqf1	437	16	difference	difference	NN
cord-014462-11ggaqf1	437	17	being	be	VBG
cord-014462-11ggaqf1	437	18	that	that	IN
cord-014462-11ggaqf1	437	19	swelling	swelling	NN
cord-014462-11ggaqf1	437	20	of	of	IN
cord-014462-11ggaqf1	437	21	lips	lip	NNS
cord-014462-11ggaqf1	437	22	and	and	CC
cord-014462-11ggaqf1	437	23	face	face	NN
cord-014462-11ggaqf1	437	24	was	be	VBD
cord-014462-11ggaqf1	437	25	less	less	RBR
cord-014462-11ggaqf1	437	26	conspicuous	conspicuous	JJ
cord-014462-11ggaqf1	437	27	.	.	.
cord-014462-11ggaqf1	438	1	Mucocutaneous	Mucocutaneous	NNP
cord-014462-11ggaqf1	438	2	borders	border	NNS
cord-014462-11ggaqf1	438	3	appeared	appear	VBD
cord-014462-11ggaqf1	438	4	to	to	TO
cord-014462-11ggaqf1	438	5	be	be	VB
cord-014462-11ggaqf1	438	6	very	very	RB
cord-014462-11ggaqf1	438	7	sensitive	sensitive	JJ
cord-014462-11ggaqf1	438	8	to	to	TO
cord-014462-11ggaqf1	438	9	touch	touch	VB
cord-014462-11ggaqf1	438	10	and	and	CC
cord-014462-11ggaqf1	438	11	bleed	bleed	VB
cord-014462-11ggaqf1	438	12	easily	easily	RB
cord-014462-11ggaqf1	438	13	upon	upon	IN
cord-014462-11ggaqf1	438	14	handling	handle	VBG
cord-014462-11ggaqf1	438	15	.	.	.
cord-014462-11ggaqf1	439	1	The	the	DT
cord-014462-11ggaqf1	439	2	classical	classical	JJ
cord-014462-11ggaqf1	439	3	signs	sign	NNS
cord-014462-11ggaqf1	439	4	of	of	IN
cord-014462-11ggaqf1	439	5	cyanosis	cyanosis	NN
cord-014462-11ggaqf1	439	6	of	of	IN
cord-014462-11ggaqf1	439	7	tongue	tongue	NN
cord-014462-11ggaqf1	439	8	and	and	CC
cord-014462-11ggaqf1	439	9	reddening	reddening	NN
cord-014462-11ggaqf1	439	10	of	of	IN
cord-014462-11ggaqf1	439	11	coronary	coronary	JJ
cord-014462-11ggaqf1	439	12	band	band	NN
cord-014462-11ggaqf1	439	13	are	be	VBP
cord-014462-11ggaqf1	439	14	not	not	RB
cord-014462-11ggaqf1	439	15	the	the	DT
cord-014462-11ggaqf1	439	16	common	common	JJ
cord-014462-11ggaqf1	439	17	features	feature	NNS
cord-014462-11ggaqf1	439	18	of	of	IN
cord-014462-11ggaqf1	439	19	the	the	DT
cord-014462-11ggaqf1	439	20	disease	disease	NN
cord-014462-11ggaqf1	439	21	in	in	IN
cord-014462-11ggaqf1	439	22	native	native	JJ
cord-014462-11ggaqf1	439	23	sheep	sheep	NN
cord-014462-11ggaqf1	439	24	.	.	.
cord-014462-11ggaqf1	440	1	The	the	DT
cord-014462-11ggaqf1	440	2	disease	disease	NN
cord-014462-11ggaqf1	440	3	was	be	VBD
cord-014462-11ggaqf1	440	4	also	also	RB
cord-014462-11ggaqf1	440	5	confirmed	confirm	VBN
cord-014462-11ggaqf1	440	6	by	by	IN
cord-014462-11ggaqf1	440	7	the	the	DT
cord-014462-11ggaqf1	440	8	virus	virus	NN
cord-014462-11ggaqf1	440	9	isolation	isolation	NN
cord-014462-11ggaqf1	440	10	and	and	CC
cord-014462-11ggaqf1	440	11	identification	identification	NN
cord-014462-11ggaqf1	440	12	.	.	.
cord-014462-11ggaqf1	441	1	Clinical	clinical	JJ
cord-014462-11ggaqf1	441	2	disease	disease	NN
cord-014462-11ggaqf1	441	3	has	have	VBZ
cord-014462-11ggaqf1	441	4	not	not	RB
cord-014462-11ggaqf1	441	5	been	be	VBN
cord-014462-11ggaqf1	441	6	reported	report	VBN
cord-014462-11ggaqf1	441	7	in	in	IN
cord-014462-11ggaqf1	441	8	cattle	cattle	NNS
cord-014462-11ggaqf1	441	9	,	,	,
cord-014462-11ggaqf1	441	10	buffaloes	buffalo	NNS
cord-014462-11ggaqf1	441	11	and	and	CC
cord-014462-11ggaqf1	441	12	goats	goat	NNS
cord-014462-11ggaqf1	441	13	in	in	IN
cord-014462-11ggaqf1	441	14	spite	spite	NN
cord-014462-11ggaqf1	441	15	of	of	IN
cord-014462-11ggaqf1	441	16	high	high	JJ
cord-014462-11ggaqf1	441	17	seroprevalence	seroprevalence	NN
cord-014462-11ggaqf1	441	18	.	.	.
cord-014462-11ggaqf1	442	1	In	in	IN
cord-014462-11ggaqf1	442	2	conclusion	conclusion	NN
cord-014462-11ggaqf1	442	3	BT	BT	NNP
cord-014462-11ggaqf1	442	4	is	be	VBZ
cord-014462-11ggaqf1	442	5	established	establish	VBN
cord-014462-11ggaqf1	442	6	in	in	IN
cord-014462-11ggaqf1	442	7	native	native	JJ
cord-014462-11ggaqf1	442	8	sheep	sheep	NNS
cord-014462-11ggaqf1	442	9	and	and	CC
cord-014462-11ggaqf1	442	10	causes	cause	VBZ
cord-014462-11ggaqf1	442	11	severe	severe	JJ
cord-014462-11ggaqf1	442	12	economic	economic	JJ
cord-014462-11ggaqf1	442	13	losses	loss	NNS
cord-014462-11ggaqf1	442	14	to	to	IN
cord-014462-11ggaqf1	442	15	the	the	DT
cord-014462-11ggaqf1	442	16	farmers	farmer	NNS
cord-014462-11ggaqf1	442	17	.	.	.
cord-014462-11ggaqf1	443	1	The	the	DT
cord-014462-11ggaqf1	443	2	disease	disease	NN
cord-014462-11ggaqf1	443	3	is	be	VBZ
cord-014462-11ggaqf1	443	4	concentrated	concentrate	VBN
cord-014462-11ggaqf1	443	5	in	in	IN
cord-014462-11ggaqf1	443	6	the	the	DT
cord-014462-11ggaqf1	443	7	southern	southern	JJ
cord-014462-11ggaqf1	443	8	peninsula	peninsula	NN
cord-014462-11ggaqf1	443	9	of	of	IN
cord-014462-11ggaqf1	443	10	the	the	DT
cord-014462-11ggaqf1	443	11	country	country	NN
cord-014462-11ggaqf1	443	12	.	.	.
cord-014462-11ggaqf1	444	1	The	the	DT
cord-014462-11ggaqf1	444	2	disease	disease	NN
cord-014462-11ggaqf1	444	3	is	be	VBZ
cord-014462-11ggaqf1	444	4	seasonal	seasonal	JJ
cord-014462-11ggaqf1	444	5	and	and	CC
cord-014462-11ggaqf1	444	6	is	be	VBZ
cord-014462-11ggaqf1	444	7	associated	associate	VBN
cord-014462-11ggaqf1	444	8	with	with	IN
cord-014462-11ggaqf1	444	9	the	the	DT
cord-014462-11ggaqf1	444	10	rain	rain	NN
cord-014462-11ggaqf1	444	11	fall	fall	NN
cord-014462-11ggaqf1	444	12	.	.	.
cord-014462-11ggaqf1	445	1	Multiple	multiple	JJ
cord-014462-11ggaqf1	445	2	serotypes	serotype	NNS
cord-014462-11ggaqf1	445	3	appear	appear	VBP
cord-014462-11ggaqf1	445	4	to	to	TO
cord-014462-11ggaqf1	445	5	be	be	VB
cord-014462-11ggaqf1	445	6	circulating	circulate	VBG
cord-014462-11ggaqf1	445	7	in	in	IN
cord-014462-11ggaqf1	445	8	this	this	DT
cord-014462-11ggaqf1	445	9	region	region	NN
cord-014462-11ggaqf1	445	10	.	.	.
cord-014462-11ggaqf1	446	1	The	the	DT
cord-014462-11ggaqf1	446	2	BTV	BTV	NNP
cord-014462-11ggaqf1	446	3	serotypes	serotype	NNS
cord-014462-11ggaqf1	446	4	were	be	VBD
cord-014462-11ggaqf1	446	5	of	of	IN
cord-014462-11ggaqf1	446	6	virulent	virulent	JJ
cord-014462-11ggaqf1	446	7	in	in	IN
cord-014462-11ggaqf1	446	8	nature	nature	NN
cord-014462-11ggaqf1	446	9	as	as	IN
cord-014462-11ggaqf1	446	10	evident	evident	JJ
cord-014462-11ggaqf1	446	11	by	by	IN
cord-014462-11ggaqf1	446	12	severe	severe	JJ
cord-014462-11ggaqf1	446	13	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	446	14	.	.	.
cord-014462-11ggaqf1	447	1	S.	S.	NNP
cord-014462-11ggaqf1	447	2	Janardana	Janardana	NNP
cord-014462-11ggaqf1	447	3	Reddy	Reddy	NNP
cord-014462-11ggaqf1	447	4	*	*	NFP
cord-014462-11ggaqf1	447	5	,	,	,
cord-014462-11ggaqf1	447	6	D.	D.	NNP
cord-014462-11ggaqf1	447	7	C.	C.	NNP
cord-014462-11ggaqf1	447	8	Reddy	Reddy	NNP
cord-014462-11ggaqf1	447	9	Department	Department	NNP
cord-014462-11ggaqf1	447	10	of	of	IN
cord-014462-11ggaqf1	447	11	Fishery	Fishery	NNP
cord-014462-11ggaqf1	447	12	Science	Science	NNP
cord-014462-11ggaqf1	447	13	and	and	CC
cord-014462-11ggaqf1	447	14	Aquaculture	Aquaculture	NNP
cord-014462-11ggaqf1	447	15	,	,	,
cord-014462-11ggaqf1	447	16	Sri	Sri	NNP
cord-014462-11ggaqf1	447	17	Venkateswara	Venkateswara	NNP
cord-014462-11ggaqf1	447	18	University	University	NNP
cord-014462-11ggaqf1	447	19	,	,	,
cord-014462-11ggaqf1	447	20	Tirupati	Tirupati	NNP
cord-014462-11ggaqf1	447	21	517	517	CD
cord-014462-11ggaqf1	447	22	502	502	CD
cord-014462-11ggaqf1	448	1	In	in	IN
cord-014462-11ggaqf1	448	2	less	less	JJR
cord-014462-11ggaqf1	448	3	than	than	IN
cord-014462-11ggaqf1	448	4	Three	three	CD
cord-014462-11ggaqf1	448	5	decades	decade	NNS
cord-014462-11ggaqf1	448	6	,	,	,
cord-014462-11ggaqf1	448	7	the	the	DT
cord-014462-11ggaqf1	448	8	Penaeid	Penaeid	NNP
cord-014462-11ggaqf1	448	9	shrimp	shrimp	NN
cord-014462-11ggaqf1	448	10	culture	culture	NN
cord-014462-11ggaqf1	448	11	industries	industry	NNS
cord-014462-11ggaqf1	448	12	of	of	IN
cord-014462-11ggaqf1	448	13	the	the	DT
cord-014462-11ggaqf1	448	14	world	world	NN
cord-014462-11ggaqf1	448	15	developed	develop	VBN
cord-014462-11ggaqf1	448	16	from	from	IN
cord-014462-11ggaqf1	448	17	their	-PRON-	PRP$
cord-014462-11ggaqf1	448	18	experimental	experimental	JJ
cord-014462-11ggaqf1	448	19	beginnings	beginning	NNS
cord-014462-11ggaqf1	448	20	into	into	IN
cord-014462-11ggaqf1	448	21	major	major	JJ
cord-014462-11ggaqf1	448	22	industries	industry	NNS
cord-014462-11ggaqf1	448	23	providing	provide	VBG
cord-014462-11ggaqf1	448	24	hundreds	hundred	NNS
cord-014462-11ggaqf1	448	25	of	of	IN
cord-014462-11ggaqf1	448	26	thousands	thousand	NNS
cord-014462-11ggaqf1	448	27	of	of	IN
cord-014462-11ggaqf1	448	28	jobs	job	NNS
cord-014462-11ggaqf1	448	29	,	,	,
cord-014462-11ggaqf1	448	30	billions	billion	NNS
cord-014462-11ggaqf1	448	31	of	of	IN
cord-014462-11ggaqf1	448	32	U.S.	U.S.	NNP
cord-014462-11ggaqf1	448	33	dollars	dollar	NNS
cord-014462-11ggaqf1	448	34	in	in	IN
cord-014462-11ggaqf1	448	35	revenue	revenue	NN
cord-014462-11ggaqf1	448	36	,	,	,
cord-014462-11ggaqf1	448	37	and	and	CC
cord-014462-11ggaqf1	448	38	augmentation	augmentation	NN
cord-014462-11ggaqf1	448	39	of	of	IN
cord-014462-11ggaqf1	448	40	the	the	DT
cord-014462-11ggaqf1	448	41	world	world	NN
cord-014462-11ggaqf1	448	42	's	's	POS
cord-014462-11ggaqf1	448	43	food	food	NN
cord-014462-11ggaqf1	448	44	supply	supply	NN
cord-014462-11ggaqf1	448	45	with	with	IN
cord-014462-11ggaqf1	448	46	a	a	DT
cord-014462-11ggaqf1	448	47	high	high	JJ
cord-014462-11ggaqf1	448	48	value	value	NN
cord-014462-11ggaqf1	448	49	crop	crop	NN
cord-014462-11ggaqf1	448	50	.	.	.
cord-014462-11ggaqf1	449	1	Concomitant	concomitant	JJ
cord-014462-11ggaqf1	449	2	with	with	IN
cord-014462-11ggaqf1	449	3	the	the	DT
cord-014462-11ggaqf1	449	4	growth	growth	NN
cord-014462-11ggaqf1	449	5	of	of	IN
cord-014462-11ggaqf1	449	6	the	the	DT
cord-014462-11ggaqf1	449	7	shrimp	shrimp	NN
cord-014462-11ggaqf1	449	8	culture	culture	NN
cord-014462-11ggaqf1	449	9	industry	industry	NN
cord-014462-11ggaqf1	449	10	has	have	VBZ
cord-014462-11ggaqf1	449	11	been	be	VBN
cord-014462-11ggaqf1	449	12	the	the	DT
cord-014462-11ggaqf1	449	13	recognition	recognition	NN
cord-014462-11ggaqf1	449	14	of	of	IN
cord-014462-11ggaqf1	449	15	the	the	DT
cord-014462-11ggaqf1	449	16	ever	ever	RB
cord-014462-11ggaqf1	449	17	increasing	increase	VBG
cord-014462-11ggaqf1	449	18	importance	importance	NN
cord-014462-11ggaqf1	449	19	of	of	IN
cord-014462-11ggaqf1	449	20	disease	disease	NN
cord-014462-11ggaqf1	449	21	,	,	,
cord-014462-11ggaqf1	449	22	especially	especially	RB
cord-014462-11ggaqf1	449	23	those	those	DT
cord-014462-11ggaqf1	449	24	caused	cause	VBN
cord-014462-11ggaqf1	449	25	by	by	IN
cord-014462-11ggaqf1	449	26	infectious	infectious	JJ
cord-014462-11ggaqf1	449	27	agents	agent	NNS
cord-014462-11ggaqf1	449	28	.	.	.
cord-014462-11ggaqf1	450	1	In	in	IN
cord-014462-11ggaqf1	450	2	India	India	NNP
cord-014462-11ggaqf1	450	3	viral	viral	JJ
cord-014462-11ggaqf1	450	4	diseases	disease	NNS
cord-014462-11ggaqf1	450	5	have	have	VBP
cord-014462-11ggaqf1	450	6	become	become	VBN
cord-014462-11ggaqf1	450	7	an	an	DT
cord-014462-11ggaqf1	450	8	important	important	JJ
cord-014462-11ggaqf1	450	9	limiting	limit	VBG
cord-014462-11ggaqf1	450	10	factor	factor	NN
cord-014462-11ggaqf1	450	11	for	for	IN
cord-014462-11ggaqf1	450	12	growth	growth	NN
cord-014462-11ggaqf1	450	13	of	of	IN
cord-014462-11ggaqf1	450	14	shrimp	shrimp	NN
cord-014462-11ggaqf1	450	15	aquaculture	aquaculture	NN
cord-014462-11ggaqf1	450	16	industry	industry	NN
cord-014462-11ggaqf1	450	17	.	.	.
cord-014462-11ggaqf1	451	1	Although	although	IN
cord-014462-11ggaqf1	451	2	more	more	JJR
cord-014462-11ggaqf1	451	3	than	than	IN
cord-014462-11ggaqf1	451	4	30	30	CD
cord-014462-11ggaqf1	451	5	different	different	JJ
cord-014462-11ggaqf1	451	6	viral	viral	JJ
cord-014462-11ggaqf1	451	7	pathogens	pathogen	NNS
cord-014462-11ggaqf1	451	8	have	have	VBP
cord-014462-11ggaqf1	451	9	been	be	VBN
cord-014462-11ggaqf1	451	10	identified	identify	VBN
cord-014462-11ggaqf1	451	11	in	in	IN
cord-014462-11ggaqf1	451	12	different	different	JJ
cord-014462-11ggaqf1	451	13	species	specie	NNS
cord-014462-11ggaqf1	451	14	of	of	IN
cord-014462-11ggaqf1	451	15	shrimp	shrimp	NN
cord-014462-11ggaqf1	451	16	world	world	NN
cord-014462-11ggaqf1	451	17	wide	wide	JJ
cord-014462-11ggaqf1	451	18	,	,	,
cord-014462-11ggaqf1	451	19	only	only	RB
cord-014462-11ggaqf1	451	20	a	a	DT
cord-014462-11ggaqf1	451	21	few	few	JJ
cord-014462-11ggaqf1	451	22	viruses	virus	NNS
cord-014462-11ggaqf1	451	23	have	have	VBP
cord-014462-11ggaqf1	451	24	identified	identify	VBN
cord-014462-11ggaqf1	451	25	which	which	WDT
cord-014462-11ggaqf1	451	26	are	be	VBP
cord-014462-11ggaqf1	451	27	causing	cause	VBG
cord-014462-11ggaqf1	451	28	disease	disease	NN
cord-014462-11ggaqf1	451	29	problems	problem	NNS
cord-014462-11ggaqf1	451	30	in	in	IN
cord-014462-11ggaqf1	451	31	cultured	cultured	JJ
cord-014462-11ggaqf1	451	32	Tiger	Tiger	NNP
cord-014462-11ggaqf1	451	33	shrimps	shrimp	NNS
cord-014462-11ggaqf1	451	34	in	in	IN
cord-014462-11ggaqf1	451	35	India	India	NNP
cord-014462-11ggaqf1	451	36	,	,	,
cord-014462-11ggaqf1	451	37	East	East	NNP
cord-014462-11ggaqf1	451	38	Coast	Coast	NNP
cord-014462-11ggaqf1	451	39	of	of	IN
cord-014462-11ggaqf1	451	40	Andhra	Andhra	NNP
cord-014462-11ggaqf1	451	41	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	451	42	,	,	,
cord-014462-11ggaqf1	451	43	in	in	IN
cord-014462-11ggaqf1	451	44	particular	particular	JJ
cord-014462-11ggaqf1	451	45	.	.	.
cord-014462-11ggaqf1	452	1	Diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	452	2	methods	method	NNS
cord-014462-11ggaqf1	452	3	for	for	IN
cord-014462-11ggaqf1	452	4	these	these	DT
cord-014462-11ggaqf1	452	5	pathogens	pathogen	NNS
cord-014462-11ggaqf1	452	6	include	include	VBP
cord-014462-11ggaqf1	452	7	the	the	DT
cord-014462-11ggaqf1	452	8	traditional	traditional	JJ
cord-014462-11ggaqf1	452	9	methods	method	NNS
cord-014462-11ggaqf1	452	10	of	of	IN
cord-014462-11ggaqf1	452	11	morphological	morphological	JJ
cord-014462-11ggaqf1	452	12	pathology	pathology	NN
cord-014462-11ggaqf1	452	13	(	(	-LRB-
cord-014462-11ggaqf1	452	14	direct	direct	JJ
cord-014462-11ggaqf1	452	15	light	light	JJ
cord-014462-11ggaqf1	452	16	microscopy	microscopy	NN
cord-014462-11ggaqf1	452	17	,	,	,
cord-014462-11ggaqf1	452	18	histopathology	histopathology	NN
cord-014462-11ggaqf1	452	19	,	,	,
cord-014462-11ggaqf1	452	20	and	and	CC
cord-014462-11ggaqf1	452	21	Transmission	Transmission	NNP
cord-014462-11ggaqf1	452	22	Electron	Electron	NNP
cord-014462-11ggaqf1	452	23	Microscopy	Microscopy	NNP
cord-014462-11ggaqf1	452	24	)	)	-RRB-
cord-014462-11ggaqf1	452	25	,	,	,
cord-014462-11ggaqf1	452	26	enhancement	enhancement	NN
cord-014462-11ggaqf1	452	27	and	and	CC
cord-014462-11ggaqf1	452	28	bioassay	bioassay	NN
cord-014462-11ggaqf1	452	29	methods	method	NNS
cord-014462-11ggaqf1	452	30	,	,	,
cord-014462-11ggaqf1	452	31	traditional	traditional	JJ
cord-014462-11ggaqf1	452	32	microbiology	microbiology	NN
cord-014462-11ggaqf1	452	33	,	,	,
cord-014462-11ggaqf1	452	34	and	and	CC
cord-014462-11ggaqf1	452	35	the	the	DT
cord-014462-11ggaqf1	452	36	application	application	NN
cord-014462-11ggaqf1	452	37	of	of	IN
cord-014462-11ggaqf1	452	38	serological	serological	JJ
cord-014462-11ggaqf1	452	39	methods	method	NNS
cord-014462-11ggaqf1	452	40	.	.	.
cord-014462-11ggaqf1	453	1	While	while	IN
cord-014462-11ggaqf1	453	2	tissue	tissue	NN
cord-014462-11ggaqf1	453	3	culture	culture	NN
cord-014462-11ggaqf1	453	4	is	be	VBZ
cord-014462-11ggaqf1	453	5	considered	consider	VBN
cord-014462-11ggaqf1	453	6	to	to	TO
cord-014462-11ggaqf1	453	7	be	be	VB
cord-014462-11ggaqf1	453	8	a	a	DT
cord-014462-11ggaqf1	453	9	standard	standard	JJ
cord-014462-11ggaqf1	453	10	tool	tool	NN
cord-014462-11ggaqf1	453	11	in	in	IN
cord-014462-11ggaqf1	453	12	medical	medical	JJ
cord-014462-11ggaqf1	453	13	and	and	CC
cord-014462-11ggaqf1	453	14	veterinary	veterinary	JJ
cord-014462-11ggaqf1	453	15	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	453	16	labs	lab	NNS
cord-014462-11ggaqf1	453	17	,	,	,
cord-014462-11ggaqf1	453	18	it	-PRON-	PRP
cord-014462-11ggaqf1	453	19	has	have	VBZ
cord-014462-11ggaqf1	453	20	never	never	RB
cord-014462-11ggaqf1	453	21	been	be	VBN
cord-014462-11ggaqf1	453	22	developed	develop	VBN
cord-014462-11ggaqf1	453	23	as	as	IN
cord-014462-11ggaqf1	453	24	a	a	DT
cord-014462-11ggaqf1	453	25	useable	useable	JJ
cord-014462-11ggaqf1	453	26	,	,	,
cord-014462-11ggaqf1	453	27	routine	routine	JJ
cord-014462-11ggaqf1	453	28	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	453	29	tool	tool	NN
cord-014462-11ggaqf1	453	30	for	for	IN
cord-014462-11ggaqf1	453	31	shrimp	shrimp	NN
cord-014462-11ggaqf1	453	32	pathogens	pathogen	NNS
cord-014462-11ggaqf1	453	33	.	.	.
cord-014462-11ggaqf1	454	1	The	the	DT
cord-014462-11ggaqf1	454	2	need	need	NN
cord-014462-11ggaqf1	454	3	for	for	IN
cord-014462-11ggaqf1	454	4	rapid	rapid	JJ
cord-014462-11ggaqf1	454	5	,	,	,
cord-014462-11ggaqf1	454	6	sensitive	sensitive	JJ
cord-014462-11ggaqf1	454	7	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	454	8	methods	method	NNS
cord-014462-11ggaqf1	454	9	led	lead	VBD
cord-014462-11ggaqf1	454	10	to	to	IN
cord-014462-11ggaqf1	454	11	the	the	DT
cord-014462-11ggaqf1	454	12	application	application	NN
cord-014462-11ggaqf1	454	13	of	of	IN
cord-014462-11ggaqf1	454	14	modern	modern	JJ
cord-014462-11ggaqf1	454	15	biotechnology	biotechnology	NN
cord-014462-11ggaqf1	454	16	to	to	IN
cord-014462-11ggaqf1	454	17	Penaeid	Penaeid	NNP
cord-014462-11ggaqf1	454	18	shrimp	shrimp	NN
cord-014462-11ggaqf1	454	19	disease	disease	NN
cord-014462-11ggaqf1	454	20	.	.	.
cord-014462-11ggaqf1	455	1	The	the	DT
cord-014462-11ggaqf1	455	2	industry	industry	NN
cord-014462-11ggaqf1	455	3	now	now	RB
cord-014462-11ggaqf1	455	4	has	have	VBZ
cord-014462-11ggaqf1	455	5	modern	modern	JJ
cord-014462-11ggaqf1	455	6	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	455	7	genomic	genomic	JJ
cord-014462-11ggaqf1	455	8	probes	probe	NNS
cord-014462-11ggaqf1	455	9	with	with	IN
cord-014462-11ggaqf1	455	10	nonradioactive	nonradioactive	JJ
cord-014462-11ggaqf1	455	11	labels	label	NNS
cord-014462-11ggaqf1	455	12	for	for	IN
cord-014462-11ggaqf1	455	13	viral	viral	JJ
cord-014462-11ggaqf1	455	14	pathogens	pathogen	NNS
cord-014462-11ggaqf1	455	15	like	like	IN
cord-014462-11ggaqf1	455	16	Infectious	infectious	JJ
cord-014462-11ggaqf1	455	17	hypodermal	hypodermal	JJ
cord-014462-11ggaqf1	455	18	and	and	CC
cord-014462-11ggaqf1	455	19	hematopoietic	hematopoietic	JJ
cord-014462-11ggaqf1	455	20	Necrosis	necrosis	NN
cord-014462-11ggaqf1	455	21	(	(	-LRB-
cord-014462-11ggaqf1	455	22	IHHNV	IHHNV	NNP
cord-014462-11ggaqf1	455	23	)	)	-RRB-
cord-014462-11ggaqf1	455	24	,	,	,
cord-014462-11ggaqf1	455	25	Hepatopancreatic	Hepatopancreatic	NNP
cord-014462-11ggaqf1	455	26	Virus	Virus	NNP
cord-014462-11ggaqf1	455	27	(	(	-LRB-
cord-014462-11ggaqf1	455	28	HPV	HPV	NNP
cord-014462-11ggaqf1	455	29	)	)	-RRB-
cord-014462-11ggaqf1	455	30	,	,	,
cord-014462-11ggaqf1	455	31	Taura	Taura	NNP
cord-014462-11ggaqf1	455	32	Syndrome	Syndrome	NNP
cord-014462-11ggaqf1	455	33	Virus	Virus	NNP
cord-014462-11ggaqf1	455	34	(	(	-LRB-
cord-014462-11ggaqf1	455	35	TSV	TSV	NNP
cord-014462-11ggaqf1	455	36	)	)	-RRB-
cord-014462-11ggaqf1	455	37	,	,	,
cord-014462-11ggaqf1	455	38	White	White	NNP
cord-014462-11ggaqf1	455	39	Spot	Spot	NNP
cord-014462-11ggaqf1	455	40	Syndrome	Syndrome	NNP
cord-014462-11ggaqf1	455	41	Virus	Virus	NNP
cord-014462-11ggaqf1	455	42	(	(	-LRB-
cord-014462-11ggaqf1	455	43	WSSV	WSSV	NNP
cord-014462-11ggaqf1	455	44	)	)	-RRB-
cord-014462-11ggaqf1	455	45	,	,	,
cord-014462-11ggaqf1	455	46	Monodon	Monodon	NNP
cord-014462-11ggaqf1	455	47	Baculo	Baculo	NNP
cord-014462-11ggaqf1	455	48	Virus	Virus	NNP
cord-014462-11ggaqf1	455	49	(	(	-LRB-
cord-014462-11ggaqf1	455	50	MBV	MBV	NNP
cord-014462-11ggaqf1	455	51	)	)	-RRB-
cord-014462-11ggaqf1	455	52	,	,	,
cord-014462-11ggaqf1	455	53	and	and	CC
cord-014462-11ggaqf1	455	54	BP	BP	NNP
cord-014462-11ggaqf1	455	55	.	.	.
cord-014462-11ggaqf1	456	1	Highly	highly	RB
cord-014462-11ggaqf1	456	2	sensitive	sensitive	JJ
cord-014462-11ggaqf1	456	3	detection	detection	NN
cord-014462-11ggaqf1	456	4	methods	method	NNS
cord-014462-11ggaqf1	456	5	for	for	IN
cord-014462-11ggaqf1	456	6	some	some	DT
cord-014462-11ggaqf1	456	7	pathogens	pathogen	NNS
cord-014462-11ggaqf1	456	8	that	that	WDT
cord-014462-11ggaqf1	456	9	employ	employ	VBP
cord-014462-11ggaqf1	456	10	DNA	dna	NN
cord-014462-11ggaqf1	456	11	amplification	amplification	NN
cord-014462-11ggaqf1	456	12	methods	method	NNS
cord-014462-11ggaqf1	456	13	based	base	VBN
cord-014462-11ggaqf1	456	14	on	on	IN
cord-014462-11ggaqf1	456	15	the	the	DT
cord-014462-11ggaqf1	456	16	polymerase	polymerase	NN
cord-014462-11ggaqf1	456	17	chain	chain	NN
cord-014462-11ggaqf1	456	18	reaction	reaction	NN
cord-014462-11ggaqf1	456	19	(	(	-LRB-
cord-014462-11ggaqf1	456	20	PCR	PCR	NNP
cord-014462-11ggaqf1	456	21	)	)	-RRB-
cord-014462-11ggaqf1	456	22	now	now	RB
cord-014462-11ggaqf1	456	23	exist	exist	VBP
cord-014462-11ggaqf1	456	24	,	,	,
cord-014462-11ggaqf1	456	25	and	and	CC
cord-014462-11ggaqf1	456	26	more	more	JJR
cord-014462-11ggaqf1	456	27	PCR	PCR	NNP
cord-014462-11ggaqf1	456	28	methods	method	NNS
cord-014462-11ggaqf1	456	29	are	be	VBP
cord-014462-11ggaqf1	456	30	being	be	VBG
cord-014462-11ggaqf1	456	31	developed	develop	VBN
cord-014462-11ggaqf1	456	32	for	for	IN
cord-014462-11ggaqf1	456	33	additional	additional	JJ
cord-014462-11ggaqf1	456	34	agents	agent	NNS
cord-014462-11ggaqf1	456	35	.	.	.
cord-014462-11ggaqf1	457	1	These	these	DT
cord-014462-11ggaqf1	457	2	advanced	advanced	JJ
cord-014462-11ggaqf1	457	3	molecular	molecular	JJ
cord-014462-11ggaqf1	457	4	methods	method	NNS
cord-014462-11ggaqf1	457	5	promise	promise	VBP
cord-014462-11ggaqf1	457	6	to	to	TO
cord-014462-11ggaqf1	457	7	provide	provide	VB
cord-014462-11ggaqf1	457	8	badly	badly	RB
cord-014462-11ggaqf1	457	9	needed	need	VBN
cord-014462-11ggaqf1	457	10	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	457	11	and	and	CC
cord-014462-11ggaqf1	457	12	research	research	NN
cord-014462-11ggaqf1	457	13	tools	tool	NNS
cord-014462-11ggaqf1	457	14	to	to	IN
cord-014462-11ggaqf1	457	15	an	an	DT
cord-014462-11ggaqf1	457	16	industry	industry	NN
cord-014462-11ggaqf1	457	17	reeling	reel	VBG
cord-014462-11ggaqf1	457	18	from	from	IN
cord-014462-11ggaqf1	457	19	catastrophic	catastrophic	JJ
cord-014462-11ggaqf1	457	20	epizootics	epizootic	NNS
cord-014462-11ggaqf1	457	21	and	and	CC
cord-014462-11ggaqf1	457	22	which	which	WDT
cord-014462-11ggaqf1	457	23	must	must	MD
cord-014462-11ggaqf1	457	24	become	become	VB
cord-014462-11ggaqf1	457	25	poised	poised	JJ
cord-014462-11ggaqf1	457	26	to	to	TO
cord-014462-11ggaqf1	457	27	go	go	VB
cord-014462-11ggaqf1	457	28	on	on	RP
cord-014462-11ggaqf1	457	29	with	with	IN
cord-014462-11ggaqf1	457	30	the	the	DT
cord-014462-11ggaqf1	457	31	next	next	JJ
cord-014462-11ggaqf1	457	32	phase	phase	NN
cord-014462-11ggaqf1	457	33	of	of	IN
cord-014462-11ggaqf1	457	34	its	-PRON-	PRP$
cord-014462-11ggaqf1	457	35	development	development	NN
cord-014462-11ggaqf1	457	36	as	as	IN
cord-014462-11ggaqf1	457	37	an	an	DT
cord-014462-11ggaqf1	457	38	industry	industry	NN
cord-014462-11ggaqf1	457	39	that	that	WDT
cord-014462-11ggaqf1	457	40	must	must	MD
cord-014462-11ggaqf1	457	41	be	be	VB
cord-014462-11ggaqf1	457	42	better	well	RBR
cord-014462-11ggaqf1	457	43	able	able	JJ
cord-014462-11ggaqf1	457	44	to	to	TO
cord-014462-11ggaqf1	457	45	understand	understand	VB
cord-014462-11ggaqf1	457	46	and	and	CC
cord-014462-11ggaqf1	457	47	manage	manage	VB
cord-014462-11ggaqf1	457	48	disease	disease	NN
cord-014462-11ggaqf1	457	49	.	.	.
cord-014462-11ggaqf1	458	1	Within	within	IN
cord-014462-11ggaqf1	458	2	this	this	DT
cord-014462-11ggaqf1	458	3	field	field	NN
cord-014462-11ggaqf1	458	4	,	,	,
cord-014462-11ggaqf1	458	5	shrimp	shrimp	NN
cord-014462-11ggaqf1	458	6	immunology	immunology	NN
cord-014462-11ggaqf1	458	7	is	be	VBZ
cord-014462-11ggaqf1	458	8	a	a	DT
cord-014462-11ggaqf1	458	9	key	key	JJ
cord-014462-11ggaqf1	458	10	element	element	NN
cord-014462-11ggaqf1	458	11	in	in	IN
cord-014462-11ggaqf1	458	12	establishing	establish	VBG
cord-014462-11ggaqf1	458	13	strategies	strategy	NNS
cord-014462-11ggaqf1	458	14	for	for	IN
cord-014462-11ggaqf1	458	15	the	the	DT
cord-014462-11ggaqf1	458	16	control	control	NN
cord-014462-11ggaqf1	458	17	of	of	IN
cord-014462-11ggaqf1	458	18	diseases	disease	NNS
cord-014462-11ggaqf1	458	19	in	in	IN
cord-014462-11ggaqf1	458	20	shrimp	shrimp	NN
cord-014462-11ggaqf1	458	21	aquaculture	aquaculture	NN
cord-014462-11ggaqf1	458	22	.	.	.
cord-014462-11ggaqf1	459	1	Research	research	NN
cord-014462-11ggaqf1	459	2	needs	need	VBZ
cord-014462-11ggaqf1	459	3	to	to	TO
cord-014462-11ggaqf1	459	4	be	be	VB
cord-014462-11ggaqf1	459	5	directed	direct	VBN
cord-014462-11ggaqf1	459	6	towards	towards	IN
cord-014462-11ggaqf1	459	7	the	the	DT
cord-014462-11ggaqf1	459	8	development	development	NN
cord-014462-11ggaqf1	459	9	of	of	IN
cord-014462-11ggaqf1	459	10	assays	assay	NNS
cord-014462-11ggaqf1	459	11	to	to	TO
cord-014462-11ggaqf1	459	12	evaluate	evaluate	VB
cord-014462-11ggaqf1	459	13	and	and	CC
cord-014462-11ggaqf1	459	14	monitor	monitor	VB
cord-014462-11ggaqf1	459	15	the	the	DT
cord-014462-11ggaqf1	459	16	immune	immune	JJ
cord-014462-11ggaqf1	459	17	state	state	NN
cord-014462-11ggaqf1	459	18	of	of	IN
cord-014462-11ggaqf1	459	19	shrimp	shrimp	NN
cord-014462-11ggaqf1	459	20	.	.	.
cord-014462-11ggaqf1	460	1	The	the	DT
cord-014462-11ggaqf1	460	2	establishment	establishment	NN
cord-014462-11ggaqf1	460	3	of	of	IN
cord-014462-11ggaqf1	460	4	regular	regular	JJ
cord-014462-11ggaqf1	460	5	immune	immune	JJ
cord-014462-11ggaqf1	460	6	checkups	checkup	NNS
cord-014462-11ggaqf1	460	7	will	will	MD
cord-014462-11ggaqf1	460	8	permit	permit	VB
cord-014462-11ggaqf1	460	9	the	the	DT
cord-014462-11ggaqf1	460	10	detection	detection	NN
cord-014462-11ggaqf1	460	11	of	of	IN
cord-014462-11ggaqf1	460	12	shrimp	shrimp	NN
cord-014462-11ggaqf1	460	13	immunodeficiencies	immunodeficiency	NNS
cord-014462-11ggaqf1	460	14	but	but	CC
cord-014462-11ggaqf1	460	15	also	also	RB
cord-014462-11ggaqf1	460	16	to	to	TO
cord-014462-11ggaqf1	460	17	help	help	VB
cord-014462-11ggaqf1	460	18	monitor	monitor	VB
cord-014462-11ggaqf1	460	19	and	and	CC
cord-014462-11ggaqf1	460	20	improve	improve	VB
cord-014462-11ggaqf1	460	21	environment	environment	NN
cord-014462-11ggaqf1	460	22	quality	quality	NN
cord-014462-11ggaqf1	460	23	.	.	.
cord-014462-11ggaqf1	461	1	For	for	IN
cord-014462-11ggaqf1	461	2	this	this	DT
cord-014462-11ggaqf1	461	3	,	,	,
cord-014462-11ggaqf1	461	4	immune	immune	JJ
cord-014462-11ggaqf1	461	5	effectors	effector	NNS
cord-014462-11ggaqf1	461	6	must	must	MD
cord-014462-11ggaqf1	461	7	be	be	VB
cord-014462-11ggaqf1	461	8	first	first	RB
cord-014462-11ggaqf1	461	9	identified	identify	VBN
cord-014462-11ggaqf1	461	10	and	and	CC
cord-014462-11ggaqf1	461	11	characterised	characterise	VBN
cord-014462-11ggaqf1	461	12	.	.	.
cord-014462-11ggaqf1	462	1	In	in	IN
cord-014462-11ggaqf1	462	2	the	the	DT
cord-014462-11ggaqf1	462	3	end	end	NN
cord-014462-11ggaqf1	462	4	,	,	,
cord-014462-11ggaqf1	462	5	however	however	RB
cord-014462-11ggaqf1	462	6	,	,	,
cord-014462-11ggaqf1	462	7	the	the	DT
cord-014462-11ggaqf1	462	8	assumption	assumption	NN
cord-014462-11ggaqf1	462	9	may	may	MD
cord-014462-11ggaqf1	462	10	be	be	VB
cord-014462-11ggaqf1	462	11	made	make	VBN
cord-014462-11ggaqf1	462	12	that	that	IN
cord-014462-11ggaqf1	462	13	the	the	DT
cord-014462-11ggaqf1	462	14	sustainability	sustainability	NN
cord-014462-11ggaqf1	462	15	of	of	IN
cord-014462-11ggaqf1	462	16	aquaculture	aquaculture	NN
cord-014462-11ggaqf1	462	17	will	will	MD
cord-014462-11ggaqf1	462	18	depend	depend	VB
cord-014462-11ggaqf1	462	19	on	on	IN
cord-014462-11ggaqf1	462	20	the	the	DT
cord-014462-11ggaqf1	462	21	selection	selection	NN
cord-014462-11ggaqf1	462	22	of	of	IN
cord-014462-11ggaqf1	462	23	disease	disease	NN
cord-014462-11ggaqf1	462	24	-	-	HYPH
cord-014462-11ggaqf1	462	25	resistant	resistant	JJ
cord-014462-11ggaqf1	462	26	shrimp	shrimp	NN
cord-014462-11ggaqf1	462	27	,	,	,
cord-014462-11ggaqf1	462	28	i.e.	i.e.	FW
cord-014462-11ggaqf1	462	29	to	to	TO
cord-014462-11ggaqf1	462	30	develop	develop	VB
cord-014462-11ggaqf1	462	31	research	research	NN
cord-014462-11ggaqf1	462	32	in	in	IN
cord-014462-11ggaqf1	462	33	immunology	immunology	NN
cord-014462-11ggaqf1	462	34	and	and	CC
cord-014462-11ggaqf1	462	35	genetics	genetic	NNS
cord-014462-11ggaqf1	462	36	at	at	IN
cord-014462-11ggaqf1	462	37	the	the	DT
cord-014462-11ggaqf1	462	38	same	same	JJ
cord-014462-11ggaqf1	462	39	time	time	NN
cord-014462-11ggaqf1	462	40	.	.	.
cord-014462-11ggaqf1	463	1	The	the	DT
cord-014462-11ggaqf1	463	2	development	development	NN
cord-014462-11ggaqf1	463	3	of	of	IN
cord-014462-11ggaqf1	463	4	strategies	strategy	NNS
cord-014462-11ggaqf1	463	5	for	for	IN
cord-014462-11ggaqf1	463	6	prophylaxis	prophylaxis	NN
cord-014462-11ggaqf1	463	7	and	and	CC
cord-014462-11ggaqf1	463	8	control	control	NN
cord-014462-11ggaqf1	463	9	of	of	IN
cord-014462-11ggaqf1	463	10	shrimp	shrimp	NN
cord-014462-11ggaqf1	463	11	diseases	disease	NNS
cord-014462-11ggaqf1	463	12	could	could	MD
cord-014462-11ggaqf1	463	13	be	be	VB
cord-014462-11ggaqf1	463	14	aided	aid	VBN
cord-014462-11ggaqf1	463	15	by	by	IN
cord-014462-11ggaqf1	463	16	the	the	DT
cord-014462-11ggaqf1	463	17	establishment	establishment	NN
cord-014462-11ggaqf1	463	18	of	of	IN
cord-014462-11ggaqf1	463	19	a	a	DT
cord-014462-11ggaqf1	463	20	collaborative	collaborative	JJ
cord-014462-11ggaqf1	463	21	network	network	NN
cord-014462-11ggaqf1	463	22	to	to	TO
cord-014462-11ggaqf1	463	23	contribute	contribute	VB
cord-014462-11ggaqf1	463	24	to	to	IN
cord-014462-11ggaqf1	463	25	progress	progress	NN
cord-014462-11ggaqf1	463	26	in	in	IN
cord-014462-11ggaqf1	463	27	basic	basic	JJ
cord-014462-11ggaqf1	463	28	knowledge	knowledge	NN
cord-014462-11ggaqf1	463	29	of	of	IN
cord-014462-11ggaqf1	463	30	penaeid	penaeid	NN
cord-014462-11ggaqf1	463	31	immunity	immunity	NN
cord-014462-11ggaqf1	463	32	.	.	.
cord-014462-11ggaqf1	464	1	However	however	RB
cord-014462-11ggaqf1	464	2	,	,	,
cord-014462-11ggaqf1	464	3	to	to	TO
cord-014462-11ggaqf1	464	4	improve	improve	VB
cord-014462-11ggaqf1	464	5	efficiency	efficiency	NN
cord-014462-11ggaqf1	464	6	,	,	,
cord-014462-11ggaqf1	464	7	it	-PRON-	PRP
cord-014462-11ggaqf1	464	8	appears	appear	VBZ
cord-014462-11ggaqf1	464	9	essential	essential	JJ
cord-014462-11ggaqf1	464	10	also	also	RB
cord-014462-11ggaqf1	464	11	to	to	TO
cord-014462-11ggaqf1	464	12	open	open	VB
cord-014462-11ggaqf1	464	13	this	this	DT
cord-014462-11ggaqf1	464	14	network	network	NN
cord-014462-11ggaqf1	464	15	to	to	IN
cord-014462-11ggaqf1	464	16	complementary	complementary	JJ
cord-014462-11ggaqf1	464	17	research	research	NN
cord-014462-11ggaqf1	464	18	areas	area	NNS
cord-014462-11ggaqf1	464	19	related	relate	VBN
cord-014462-11ggaqf1	464	20	to	to	IN
cord-014462-11ggaqf1	464	21	shrimp	shrimp	NN
cord-014462-11ggaqf1	464	22	pathology	pathology	NN
cord-014462-11ggaqf1	464	23	,	,	,
cord-014462-11ggaqf1	464	24	physiology	physiology	NN
cord-014462-11ggaqf1	464	25	,	,	,
cord-014462-11ggaqf1	464	26	genetics	genetics	NN
cord-014462-11ggaqf1	464	27	and	and	CC
cord-014462-11ggaqf1	464	28	environment	environment	NN
cord-014462-11ggaqf1	464	29	.	.	.
cord-014462-11ggaqf1	465	1	Bluetongue	bluetongue	NN
cord-014462-11ggaqf1	465	2	is	be	VBZ
cord-014462-11ggaqf1	465	3	an	an	DT
cord-014462-11ggaqf1	465	4	important	important	JJ
cord-014462-11ggaqf1	465	5	viral	viral	JJ
cord-014462-11ggaqf1	465	6	disease	disease	NN
cord-014462-11ggaqf1	465	7	of	of	IN
cord-014462-11ggaqf1	465	8	sheep	sheep	NN
cord-014462-11ggaqf1	465	9	causing	cause	VBG
cord-014462-11ggaqf1	465	10	severe	severe	JJ
cord-014462-11ggaqf1	465	11	economic	economic	JJ
cord-014462-11ggaqf1	465	12	losses	loss	NNS
cord-014462-11ggaqf1	465	13	to	to	IN
cord-014462-11ggaqf1	465	14	the	the	DT
cord-014462-11ggaqf1	465	15	farmers	farmer	NNS
cord-014462-11ggaqf1	465	16	.	.	.
cord-014462-11ggaqf1	466	1	Lack	lack	NN
cord-014462-11ggaqf1	466	2	of	of	IN
cord-014462-11ggaqf1	466	3	effective	effective	JJ
cord-014462-11ggaqf1	466	4	vaccine	vaccine	NN
cord-014462-11ggaqf1	466	5	is	be	VBZ
cord-014462-11ggaqf1	466	6	the	the	DT
cord-014462-11ggaqf1	466	7	major	major	JJ
cord-014462-11ggaqf1	466	8	impediments	impediment	NNS
cord-014462-11ggaqf1	466	9	in	in	IN
cord-014462-11ggaqf1	466	10	controlling	control	VBG
cord-014462-11ggaqf1	466	11	the	the	DT
cord-014462-11ggaqf1	466	12	disease	disease	NN
cord-014462-11ggaqf1	466	13	.	.	.
cord-014462-11ggaqf1	467	1	Multiple	multiple	JJ
cord-014462-11ggaqf1	467	2	serotypes	serotype	NNS
cord-014462-11ggaqf1	467	3	were	be	VBD
cord-014462-11ggaqf1	467	4	found	find	VBN
cord-014462-11ggaqf1	467	5	to	to	TO
cord-014462-11ggaqf1	467	6	be	be	VB
cord-014462-11ggaqf1	467	7	circulating	circulate	VBG
cord-014462-11ggaqf1	467	8	in	in	IN
cord-014462-11ggaqf1	467	9	the	the	DT
cord-014462-11ggaqf1	467	10	state	state	NN
cord-014462-11ggaqf1	467	11	.	.	.
cord-014462-11ggaqf1	468	1	Attempts	attempt	NNS
cord-014462-11ggaqf1	468	2	are	be	VBP
cord-014462-11ggaqf1	468	3	being	be	VBG
cord-014462-11ggaqf1	468	4	made	make	VBN
cord-014462-11ggaqf1	468	5	to	to	TO
cord-014462-11ggaqf1	468	6	develop	develop	VB
cord-014462-11ggaqf1	468	7	the	the	DT
cord-014462-11ggaqf1	468	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	468	9	employing	employ	VBG
cord-014462-11ggaqf1	468	10	the	the	DT
cord-014462-11ggaqf1	468	11	available	available	JJ
cord-014462-11ggaqf1	468	12	serotypes	serotype	NNS
cord-014462-11ggaqf1	468	13	to	to	TO
cord-014462-11ggaqf1	468	14	control	control	VB
cord-014462-11ggaqf1	468	15	the	the	DT
cord-014462-11ggaqf1	468	16	disease	disease	NN
cord-014462-11ggaqf1	468	17	.	.	.
cord-014462-11ggaqf1	469	1	Hence	hence	RB
cord-014462-11ggaqf1	469	2	,	,	,
cord-014462-11ggaqf1	469	3	it	-PRON-	PRP
cord-014462-11ggaqf1	469	4	is	be	VBZ
cord-014462-11ggaqf1	469	5	essential	essential	JJ
cord-014462-11ggaqf1	469	6	to	to	TO
cord-014462-11ggaqf1	469	7	identify	identify	VB
cord-014462-11ggaqf1	469	8	the	the	DT
cord-014462-11ggaqf1	469	9	antigenic	antigenic	JJ
cord-014462-11ggaqf1	469	10	relationship	relationship	NN
cord-014462-11ggaqf1	469	11	among	among	IN
cord-014462-11ggaqf1	469	12	the	the	DT
cord-014462-11ggaqf1	469	13	serotypes	serotype	NNS
cord-014462-11ggaqf1	469	14	to	to	TO
cord-014462-11ggaqf1	469	15	identify	identify	VB
cord-014462-11ggaqf1	469	16	the	the	DT
cord-014462-11ggaqf1	469	17	candidate	candidate	NN
cord-014462-11ggaqf1	469	18	vaccine	vaccine	NN
cord-014462-11ggaqf1	469	19	strains	strain	NNS
cord-014462-11ggaqf1	469	20	to	to	TO
cord-014462-11ggaqf1	469	21	be	be	VB
cord-014462-11ggaqf1	469	22	incorporated	incorporate	VBN
cord-014462-11ggaqf1	469	23	in	in	IN
cord-014462-11ggaqf1	469	24	the	the	DT
cord-014462-11ggaqf1	469	25	preparation	preparation	NN
cord-014462-11ggaqf1	469	26	of	of	IN
cord-014462-11ggaqf1	469	27	vaccine	vaccine	NN
cord-014462-11ggaqf1	469	28	.	.	.
cord-014462-11ggaqf1	470	1	Reciprocal	reciprocal	JJ
cord-014462-11ggaqf1	470	2	cross	cross	NN
cord-014462-11ggaqf1	470	3	neutralization	neutralization	NN
cord-014462-11ggaqf1	470	4	test	test	NN
cord-014462-11ggaqf1	470	5	was	be	VBD
cord-014462-11ggaqf1	470	6	employed	employ	VBN
cord-014462-11ggaqf1	470	7	to	to	TO
cord-014462-11ggaqf1	470	8	find	find	VB
cord-014462-11ggaqf1	470	9	out	out	RP
cord-014462-11ggaqf1	470	10	the	the	DT
cord-014462-11ggaqf1	470	11	R%	r%	NN
cord-014462-11ggaqf1	470	12	values	value	NNS
cord-014462-11ggaqf1	470	13	between	between	IN
cord-014462-11ggaqf1	470	14	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	470	15	,	,	,
cord-014462-11ggaqf1	470	16	-9	-9	ADD
cord-014462-11ggaqf1	470	17	and	and	CC
cord-014462-11ggaqf1	470	18	-15	-15	CD
cord-014462-11ggaqf1	470	19	which	which	WDT
cord-014462-11ggaqf1	470	20	indicated	indicate	VBD
cord-014462-11ggaqf1	470	21	the	the	DT
cord-014462-11ggaqf1	470	22	extent	extent	NN
cord-014462-11ggaqf1	470	23	of	of	IN
cord-014462-11ggaqf1	470	24	antigenic	antigenic	JJ
cord-014462-11ggaqf1	470	25	relationship	relationship	NN
cord-014462-11ggaqf1	470	26	between	between	IN
cord-014462-11ggaqf1	470	27	the	the	DT
cord-014462-11ggaqf1	470	28	serotypes	serotype	NNS
cord-014462-11ggaqf1	470	29	.	.	.
cord-014462-11ggaqf1	471	1	R%	r%	NN
cord-014462-11ggaqf1	471	2	value	value	NN
cord-014462-11ggaqf1	471	3	between	between	IN
cord-014462-11ggaqf1	471	4	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	471	5	and	and	CC
cord-014462-11ggaqf1	471	6	BTV-9	BTV-9	NNP
cord-014462-11ggaqf1	471	7	was	be	VBD
cord-014462-11ggaqf1	471	8	recorded	record	VBN
cord-014462-11ggaqf1	471	9	as	as	IN
cord-014462-11ggaqf1	471	10	2.8	2.8	CD
cord-014462-11ggaqf1	471	11	R%	r%	NN
cord-014462-11ggaqf1	471	12	value	value	NN
cord-014462-11ggaqf1	471	13	of	of	IN
cord-014462-11ggaqf1	471	14	3.53	3.53	CD
cord-014462-11ggaqf1	471	15	and	and	CC
cord-014462-11ggaqf1	471	16	2.8	2.8	CD
cord-014462-11ggaqf1	471	17	were	be	VBD
cord-014462-11ggaqf1	471	18	observed	observe	VBN
cord-014462-11ggaqf1	471	19	between	between	IN
cord-014462-11ggaqf1	471	20	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	471	21	and	and	CC
cord-014462-11ggaqf1	471	22	-15	-15	CD
cord-014462-11ggaqf1	471	23	and	and	CC
cord-014462-11ggaqf1	471	24	BTV-9	btv-9	JJ
cord-014462-11ggaqf1	471	25	and	and	CC
cord-014462-11ggaqf1	471	26	-15	-15	RB
cord-014462-11ggaqf1	471	27	respectively	respectively	RB
cord-014462-11ggaqf1	471	28	.	.	.
cord-014462-11ggaqf1	472	1	The	the	DT
cord-014462-11ggaqf1	472	2	R%	r%	NN
cord-014462-11ggaqf1	472	3	values	value	NNS
cord-014462-11ggaqf1	472	4	recorded	record	VBN
cord-014462-11ggaqf1	472	5	in	in	IN
cord-014462-11ggaqf1	472	6	the	the	DT
cord-014462-11ggaqf1	472	7	present	present	JJ
cord-014462-11ggaqf1	472	8	study	study	NN
cord-014462-11ggaqf1	472	9	revealed	reveal	VBD
cord-014462-11ggaqf1	472	10	a	a	DT
cord-014462-11ggaqf1	472	11	weak	weak	JJ
cord-014462-11ggaqf1	472	12	antigenic	antigenic	JJ
cord-014462-11ggaqf1	472	13	relationship	relationship	NN
cord-014462-11ggaqf1	472	14	between	between	IN
cord-014462-11ggaqf1	472	15	the	the	DT
cord-014462-11ggaqf1	472	16	BTV	BTV	NNP
cord-014462-11ggaqf1	472	17	serotypes	serotype	NNS
cord-014462-11ggaqf1	472	18	.	.	.
cord-014462-11ggaqf1	473	1	The	the	DT
cord-014462-11ggaqf1	473	2	extent	extent	NN
cord-014462-11ggaqf1	473	3	of	of	IN
cord-014462-11ggaqf1	473	4	antigenic	antigenic	JJ
cord-014462-11ggaqf1	473	5	relationship	relationship	NN
cord-014462-11ggaqf1	473	6	between	between	IN
cord-014462-11ggaqf1	473	7	the	the	DT
cord-014462-11ggaqf1	473	8	BTV	BTV	NNP
cord-014462-11ggaqf1	473	9	serotypes	serotype	NNS
cord-014462-11ggaqf1	473	10	was	be	VBD
cord-014462-11ggaqf1	473	11	also	also	RB
cord-014462-11ggaqf1	473	12	determined	determine	VBN
cord-014462-11ggaqf1	473	13	by	by	IN
cord-014462-11ggaqf1	473	14	multiple	multiple	JJ
cord-014462-11ggaqf1	473	15	sequence	sequence	NN
cord-014462-11ggaqf1	473	16	alignment	alignment	NN
cord-014462-11ggaqf1	473	17	of	of	IN
cord-014462-11ggaqf1	473	18	the	the	DT
cord-014462-11ggaqf1	473	19	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	473	20	and	and	CC
cord-014462-11ggaqf1	473	21	amino	amino	NN
cord-014462-11ggaqf1	473	22	acid	acid	NN
cord-014462-11ggaqf1	473	23	sequences	sequence	NNS
cord-014462-11ggaqf1	473	24	of	of	IN
cord-014462-11ggaqf1	473	25	the	the	DT
cord-014462-11ggaqf1	473	26	reference	reference	NN
cord-014462-11ggaqf1	473	27	BTV	BTV	NNP
cord-014462-11ggaqf1	473	28	serotypes	serotypes	NN
cord-014462-11ggaqf1	473	29	2	2	CD
cord-014462-11ggaqf1	473	30	,	,	,
cord-014462-11ggaqf1	473	31	9	9	CD
cord-014462-11ggaqf1	473	32	and	and	CC
cord-014462-11ggaqf1	473	33	15	15	CD
cord-014462-11ggaqf1	473	34	.	.	.
cord-014462-11ggaqf1	474	1	The	the	DT
cord-014462-11ggaqf1	474	2	sequence	sequence	NN
cord-014462-11ggaqf1	474	3	analysis	analysis	NN
cord-014462-11ggaqf1	474	4	of	of	IN
cord-014462-11ggaqf1	474	5	the	the	DT
cord-014462-11ggaqf1	474	6	VP2	VP2	NNP
cord-014462-11ggaqf1	474	7	gene	gene	NN
cord-014462-11ggaqf1	474	8	revealed	reveal	VBD
cord-014462-11ggaqf1	474	9	a	a	DT
cord-014462-11ggaqf1	474	10	homology	homology	NN
cord-014462-11ggaqf1	474	11	of	of	IN
cord-014462-11ggaqf1	474	12	47	47	CD
cord-014462-11ggaqf1	474	13	-	-	SYM
cord-014462-11ggaqf1	474	14	53	53	CD
cord-014462-11ggaqf1	474	15	%	%	NN
cord-014462-11ggaqf1	474	16	and	and	CC
cord-014462-11ggaqf1	474	17	29	29	CD
cord-014462-11ggaqf1	474	18	-	-	SYM
cord-014462-11ggaqf1	474	19	41	41	CD
cord-014462-11ggaqf1	474	20	%	%	NN
cord-014462-11ggaqf1	474	21	at	at	IN
cord-014462-11ggaqf1	474	22	the	the	DT
cord-014462-11ggaqf1	474	23	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	474	24	and	and	CC
cord-014462-11ggaqf1	474	25	amino	amino	NN
cord-014462-11ggaqf1	474	26	acid	acid	NN
cord-014462-11ggaqf1	474	27	levels	level	NNS
cord-014462-11ggaqf1	474	28	respectively	respectively	RB
cord-014462-11ggaqf1	474	29	.	.	.
cord-014462-11ggaqf1	475	1	R%	r%	NN
cord-014462-11ggaqf1	475	2	values	value	NNS
cord-014462-11ggaqf1	475	3	obtained	obtain	VBD
cord-014462-11ggaqf1	475	4	using	use	VBG
cord-014462-11ggaqf1	475	5	reciprocal	reciprocal	JJ
cord-014462-11ggaqf1	475	6	cross	cross	JJ
cord-014462-11ggaqf1	475	7	neutralization	neutralization	NN
cord-014462-11ggaqf1	475	8	test	test	NN
cord-014462-11ggaqf1	475	9	with	with	IN
cord-014462-11ggaqf1	475	10	the	the	DT
cord-014462-11ggaqf1	475	11	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	475	12	,	,	,
cord-014462-11ggaqf1	475	13	9	9	CD
cord-014462-11ggaqf1	475	14	and	and	CC
cord-014462-11ggaqf1	475	15	15	15	CD
cord-014462-11ggaqf1	475	16	serotypes	serotype	NNS
cord-014462-11ggaqf1	475	17	isolated	isolate	VBN
cord-014462-11ggaqf1	475	18	in	in	IN
cord-014462-11ggaqf1	475	19	native	native	JJ
cord-014462-11ggaqf1	475	20	sheep	sheep	NN
cord-014462-11ggaqf1	475	21	of	of	IN
cord-014462-11ggaqf1	475	22	Andhra	Andhra	NNP
cord-014462-11ggaqf1	475	23	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	475	24	and	and	CC
cord-014462-11ggaqf1	475	25	the	the	DT
cord-014462-11ggaqf1	475	26	genomic	genomic	JJ
cord-014462-11ggaqf1	475	27	analysis	analysis	NN
cord-014462-11ggaqf1	475	28	of	of	IN
cord-014462-11ggaqf1	475	29	the	the	DT
cord-014462-11ggaqf1	475	30	reference	reference	NN
cord-014462-11ggaqf1	475	31	serotypes	serotype	NNS
cord-014462-11ggaqf1	475	32	of	of	IN
cord-014462-11ggaqf1	475	33	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	475	34	,	,	,
cord-014462-11ggaqf1	475	35	9	9	CD
cord-014462-11ggaqf1	475	36	and	and	CC
cord-014462-11ggaqf1	475	37	15	15	CD
cord-014462-11ggaqf1	475	38	revealed	reveal	VBD
cord-014462-11ggaqf1	475	39	very	very	RB
cord-014462-11ggaqf1	475	40	weak	weak	JJ
cord-014462-11ggaqf1	475	41	antigenic	antigenic	JJ
cord-014462-11ggaqf1	475	42	relationship	relationship	NN
cord-014462-11ggaqf1	475	43	and	and	CC
cord-014462-11ggaqf1	475	44	were	be	VBD
cord-014462-11ggaqf1	475	45	highly	highly	RB
cord-014462-11ggaqf1	475	46	divergent	divergent	JJ
cord-014462-11ggaqf1	475	47	.	.	.
cord-014462-11ggaqf1	476	1	Diseases	disease	NNS
cord-014462-11ggaqf1	476	2	especially	especially	RB
cord-014462-11ggaqf1	476	3	those	those	DT
cord-014462-11ggaqf1	476	4	by	by	IN
cord-014462-11ggaqf1	476	5	viral	viral	JJ
cord-014462-11ggaqf1	476	6	pathogens	pathogen	NNS
cord-014462-11ggaqf1	476	7	cause	cause	VBP
cord-014462-11ggaqf1	476	8	greater	great	JJR
cord-014462-11ggaqf1	476	9	economic	economic	JJ
cord-014462-11ggaqf1	476	10	losses	loss	NNS
cord-014462-11ggaqf1	476	11	in	in	IN
cord-014462-11ggaqf1	476	12	most	most	JJS
cord-014462-11ggaqf1	476	13	horticultural	horticultural	JJ
cord-014462-11ggaqf1	476	14	crop	crop	NN
cord-014462-11ggaqf1	476	15	species	specie	NNS
cord-014462-11ggaqf1	476	16	throughout	throughout	IN
cord-014462-11ggaqf1	476	17	the	the	DT
cord-014462-11ggaqf1	476	18	world	world	NN
cord-014462-11ggaqf1	476	19	as	as	IN
cord-014462-11ggaqf1	476	20	compared	compare	VBN
cord-014462-11ggaqf1	476	21	to	to	IN
cord-014462-11ggaqf1	476	22	agricultural	agricultural	JJ
cord-014462-11ggaqf1	476	23	crops	crop	NNS
cord-014462-11ggaqf1	476	24	.	.	.
cord-014462-11ggaqf1	477	1	Non	non	JJ
cord-014462-11ggaqf1	477	2	-	-	JJ
cord-014462-11ggaqf1	477	3	genetic	genetic	JJ
cord-014462-11ggaqf1	477	4	methods	method	NNS
cord-014462-11ggaqf1	477	5	of	of	IN
cord-014462-11ggaqf1	477	6	management	management	NN
cord-014462-11ggaqf1	477	7	of	of	IN
cord-014462-11ggaqf1	477	8	these	these	DT
cord-014462-11ggaqf1	477	9	diseases	disease	NNS
cord-014462-11ggaqf1	477	10	include	include	VBP
cord-014462-11ggaqf1	477	11	quarantine	quarantine	NN
cord-014462-11ggaqf1	477	12	measures	measure	NNS
cord-014462-11ggaqf1	477	13	,	,	,
cord-014462-11ggaqf1	477	14	eradication	eradication	NN
cord-014462-11ggaqf1	477	15	of	of	IN
cord-014462-11ggaqf1	477	16	infected	infected	JJ
cord-014462-11ggaqf1	477	17	plants	plant	NNS
cord-014462-11ggaqf1	477	18	and	and	CC
cord-014462-11ggaqf1	477	19	weed	weed	NN
cord-014462-11ggaqf1	477	20	hosts	host	NNS
cord-014462-11ggaqf1	477	21	,	,	,
cord-014462-11ggaqf1	477	22	crop	crop	NN
cord-014462-11ggaqf1	477	23	rotation	rotation	NN
cord-014462-11ggaqf1	477	24	,	,	,
cord-014462-11ggaqf1	477	25	use	use	NN
cord-014462-11ggaqf1	477	26	of	of	IN
cord-014462-11ggaqf1	477	27	certified	certify	VBN
cord-014462-11ggaqf1	477	28	virus	virus	NN
cord-014462-11ggaqf1	477	29	-	-	HYPH
cord-014462-11ggaqf1	477	30	free	free	JJ
cord-014462-11ggaqf1	477	31	seed	seed	NN
cord-014462-11ggaqf1	477	32	or	or	CC
cord-014462-11ggaqf1	477	33	planting	planting	NN
cord-014462-11ggaqf1	477	34	stock	stock	NN
cord-014462-11ggaqf1	477	35	and	and	CC
cord-014462-11ggaqf1	477	36	use	use	NN
cord-014462-11ggaqf1	477	37	of	of	IN
cord-014462-11ggaqf1	477	38	pesticides	pesticide	NNS
cord-014462-11ggaqf1	477	39	to	to	TO
cord-014462-11ggaqf1	477	40	control	control	VB
cord-014462-11ggaqf1	477	41	insect	insect	NN
cord-014462-11ggaqf1	477	42	vector	vector	NN
cord-014462-11ggaqf1	477	43	populations	population	NNS
cord-014462-11ggaqf1	477	44	implicated	implicate	VBN
cord-014462-11ggaqf1	477	45	in	in	IN
cord-014462-11ggaqf1	477	46	transmission	transmission	NN
cord-014462-11ggaqf1	477	47	of	of	IN
cord-014462-11ggaqf1	477	48	viruses	virus	NNS
cord-014462-11ggaqf1	477	49	.	.	.
cord-014462-11ggaqf1	478	1	However	however	RB
cord-014462-11ggaqf1	478	2	,	,	,
cord-014462-11ggaqf1	478	3	none	none	NN
cord-014462-11ggaqf1	478	4	of	of	IN
cord-014462-11ggaqf1	478	5	these	these	DT
cord-014462-11ggaqf1	478	6	measures	measure	NNS
cord-014462-11ggaqf1	478	7	is	be	VBZ
cord-014462-11ggaqf1	478	8	likely	likely	JJ
cord-014462-11ggaqf1	478	9	to	to	TO
cord-014462-11ggaqf1	478	10	provide	provide	VB
cord-014462-11ggaqf1	478	11	an	an	DT
cord-014462-11ggaqf1	478	12	enduring	enduring	JJ
cord-014462-11ggaqf1	478	13	solution	solution	NN
cord-014462-11ggaqf1	478	14	against	against	IN
cord-014462-11ggaqf1	478	15	these	these	DT
cord-014462-11ggaqf1	478	16	diseases	disease	NNS
cord-014462-11ggaqf1	478	17	especially	especially	RB
cord-014462-11ggaqf1	478	18	those	those	DT
cord-014462-11ggaqf1	478	19	caused	cause	VBN
cord-014462-11ggaqf1	478	20	by	by	IN
cord-014462-11ggaqf1	478	21	viruses	virus	NNS
cord-014462-11ggaqf1	478	22	due	due	JJ
cord-014462-11ggaqf1	478	23	sometimes	sometimes	RB
cord-014462-11ggaqf1	478	24	to	to	IN
cord-014462-11ggaqf1	478	25	the	the	DT
cord-014462-11ggaqf1	478	26	huge	huge	JJ
cord-014462-11ggaqf1	478	27	expenditure	expenditure	NN
cord-014462-11ggaqf1	478	28	involved	involve	VBN
cord-014462-11ggaqf1	478	29	,	,	,
cord-014462-11ggaqf1	478	30	but	but	CC
cord-014462-11ggaqf1	478	31	mostly	mostly	RB
cord-014462-11ggaqf1	478	32	to	to	IN
cord-014462-11ggaqf1	478	33	the	the	DT
cord-014462-11ggaqf1	478	34	questionable	questionable	JJ
cord-014462-11ggaqf1	478	35	effectiveness	effectiveness	NN
cord-014462-11ggaqf1	478	36	and	and	CC
cord-014462-11ggaqf1	478	37	reliability	reliability	NN
cord-014462-11ggaqf1	478	38	of	of	IN
cord-014462-11ggaqf1	478	39	those	those	DT
cord-014462-11ggaqf1	478	40	methods	method	NNS
cord-014462-11ggaqf1	478	41	.	.	.
cord-014462-11ggaqf1	479	1	As	as	IN
cord-014462-11ggaqf1	479	2	key	key	JJ
cord-014462-11ggaqf1	479	3	control	control	NN
cord-014462-11ggaqf1	479	4	pesticides	pesticide	NNS
cord-014462-11ggaqf1	479	5	are	be	VBP
cord-014462-11ggaqf1	479	6	getting	get	VBG
cord-014462-11ggaqf1	479	7	increasingly	increasingly	RB
cord-014462-11ggaqf1	479	8	abandoned	abandon	VBN
cord-014462-11ggaqf1	479	9	,	,	,
cord-014462-11ggaqf1	479	10	development	development	NN
cord-014462-11ggaqf1	479	11	of	of	IN
cord-014462-11ggaqf1	479	12	alternative	alternative	JJ
cord-014462-11ggaqf1	479	13	methods	method	NNS
cord-014462-11ggaqf1	479	14	to	to	TO
cord-014462-11ggaqf1	479	15	control	control	VB
cord-014462-11ggaqf1	479	16	diseases	disease	NNS
cord-014462-11ggaqf1	479	17	has	have	VBZ
cord-014462-11ggaqf1	479	18	been	be	VBN
cord-014462-11ggaqf1	479	19	a	a	DT
cord-014462-11ggaqf1	479	20	felt	feel	VBN
cord-014462-11ggaqf1	479	21	-	-	HYPH
cord-014462-11ggaqf1	479	22	need	need	NN
cord-014462-11ggaqf1	479	23	in	in	IN
cord-014462-11ggaqf1	479	24	the	the	DT
cord-014462-11ggaqf1	479	25	recent	recent	JJ
cord-014462-11ggaqf1	479	26	past	past	NN
cord-014462-11ggaqf1	479	27	.	.	.
cord-014462-11ggaqf1	480	1	Though	though	IN
cord-014462-11ggaqf1	480	2	breeding	breed	VBG
cord-014462-11ggaqf1	480	3	for	for	IN
cord-014462-11ggaqf1	480	4	disease	disease	NN
cord-014462-11ggaqf1	480	5	resistance	resistance	NN
cord-014462-11ggaqf1	480	6	generally	generally	RB
cord-014462-11ggaqf1	480	7	provides	provide	VBZ
cord-014462-11ggaqf1	480	8	a	a	DT
cord-014462-11ggaqf1	480	9	reliable	reliable	JJ
cord-014462-11ggaqf1	480	10	security	security	NN
cord-014462-11ggaqf1	480	11	in	in	IN
cord-014462-11ggaqf1	480	12	a	a	DT
cord-014462-11ggaqf1	480	13	long	long	JJ
cord-014462-11ggaqf1	480	14	run	run	NN
cord-014462-11ggaqf1	480	15	,	,	,
cord-014462-11ggaqf1	480	16	introgression	introgression	NN
cord-014462-11ggaqf1	480	17	of	of	IN
cord-014462-11ggaqf1	480	18	host	host	NN
cord-014462-11ggaqf1	480	19	plant	plant	NN
cord-014462-11ggaqf1	480	20	resistance	resistance	NN
cord-014462-11ggaqf1	480	21	did	do	VBD
cord-014462-11ggaqf1	480	22	not	not	RB
cord-014462-11ggaqf1	480	23	materialise	materialise	VB
cord-014462-11ggaqf1	480	24	in	in	IN
cord-014462-11ggaqf1	480	25	most	most	RBS
cord-014462-11ggaqf1	480	26	important	important	JJ
cord-014462-11ggaqf1	480	27	crops	crop	NNS
cord-014462-11ggaqf1	480	28	.	.	.
cord-014462-11ggaqf1	481	1	Non	non	JJ
cord-014462-11ggaqf1	481	2	-	-	NN
cord-014462-11ggaqf1	481	3	availability	availability	NN
cord-014462-11ggaqf1	481	4	of	of	IN
cord-014462-11ggaqf1	481	5	an	an	DT
cord-014462-11ggaqf1	481	6	appropriate	appropriate	JJ
cord-014462-11ggaqf1	481	7	source	source	NN
cord-014462-11ggaqf1	481	8	of	of	IN
cord-014462-11ggaqf1	481	9	resistance	resistance	NN
cord-014462-11ggaqf1	481	10	in	in	IN
cord-014462-11ggaqf1	481	11	inter	inter	JJ
cord-014462-11ggaqf1	481	12	-	-	JJ
cord-014462-11ggaqf1	481	13	fertile	fertile	JJ
cord-014462-11ggaqf1	481	14	relatives	relative	NNS
cord-014462-11ggaqf1	481	15	,	,	,
cord-014462-11ggaqf1	481	16	linkage	linkage	NN
cord-014462-11ggaqf1	481	17	to	to	IN
cord-014462-11ggaqf1	481	18	undesirable	undesirable	JJ
cord-014462-11ggaqf1	481	19	traits	trait	NNS
cord-014462-11ggaqf1	481	20	,	,	,
cord-014462-11ggaqf1	481	21	or	or	CC
cord-014462-11ggaqf1	481	22	often	often	RB
cord-014462-11ggaqf1	481	23	times	time	NNS
cord-014462-11ggaqf1	481	24	polygenic	polygenic	JJ
cord-014462-11ggaqf1	481	25	nature	nature	NN
cord-014462-11ggaqf1	481	26	of	of	IN
cord-014462-11ggaqf1	481	27	such	such	JJ
cord-014462-11ggaqf1	481	28	sources	source	NNS
cord-014462-11ggaqf1	481	29	of	of	IN
cord-014462-11ggaqf1	481	30	resistance	resistance	NN
cord-014462-11ggaqf1	481	31	are	be	VBP
cord-014462-11ggaqf1	481	32	the	the	DT
cord-014462-11ggaqf1	481	33	stumbling	stumble	VBG
cord-014462-11ggaqf1	481	34	blocks	block	NNS
cord-014462-11ggaqf1	481	35	in	in	IN
cord-014462-11ggaqf1	481	36	breeding	breed	VBG
cord-014462-11ggaqf1	481	37	programs	program	NNS
cord-014462-11ggaqf1	481	38	.	.	.
cord-014462-11ggaqf1	482	1	The	the	DT
cord-014462-11ggaqf1	482	2	limitations	limitation	NNS
cord-014462-11ggaqf1	482	3	of	of	IN
cord-014462-11ggaqf1	482	4	conventional	conventional	JJ
cord-014462-11ggaqf1	482	5	breeding	breeding	NN
cord-014462-11ggaqf1	482	6	and	and	CC
cord-014462-11ggaqf1	482	7	routine	routine	JJ
cord-014462-11ggaqf1	482	8	cultural	cultural	JJ
cord-014462-11ggaqf1	482	9	practices	practice	NNS
cord-014462-11ggaqf1	482	10	prompted	prompt	VBD
cord-014462-11ggaqf1	482	11	the	the	DT
cord-014462-11ggaqf1	482	12	need	need	NN
cord-014462-11ggaqf1	482	13	for	for	IN
cord-014462-11ggaqf1	482	14	the	the	DT
cord-014462-11ggaqf1	482	15	development	development	NN
cord-014462-11ggaqf1	482	16	of	of	IN
cord-014462-11ggaqf1	482	17	other	other	JJ
cord-014462-11ggaqf1	482	18	approaches	approach	NNS
cord-014462-11ggaqf1	482	19	of	of	IN
cord-014462-11ggaqf1	482	20	virus	virus	NN
cord-014462-11ggaqf1	482	21	control	control	NN
cord-014462-11ggaqf1	482	22	that	that	WDT
cord-014462-11ggaqf1	482	23	could	could	MD
cord-014462-11ggaqf1	482	24	be	be	VB
cord-014462-11ggaqf1	482	25	fully	fully	RB
cord-014462-11ggaqf1	482	26	incorporated	incorporate	VBN
cord-014462-11ggaqf1	482	27	into	into	IN
cord-014462-11ggaqf1	482	28	traditional	traditional	JJ
cord-014462-11ggaqf1	482	29	methods	method	NNS
cord-014462-11ggaqf1	482	30	.	.	.
cord-014462-11ggaqf1	483	1	In	in	IN
cord-014462-11ggaqf1	483	2	this	this	DT
cord-014462-11ggaqf1	483	3	perspective	perspective	NN
cord-014462-11ggaqf1	483	4	,	,	,
cord-014462-11ggaqf1	483	5	the	the	DT
cord-014462-11ggaqf1	483	6	concept	concept	NN
cord-014462-11ggaqf1	483	7	of	of	IN
cord-014462-11ggaqf1	483	8	pathogen	pathogen	NN
cord-014462-11ggaqf1	483	9	-	-	HYPH
cord-014462-11ggaqf1	483	10	derived	derive	VBN
cord-014462-11ggaqf1	483	11	resistance	resistance	NN
cord-014462-11ggaqf1	483	12	offers	offer	VBZ
cord-014462-11ggaqf1	483	13	an	an	DT
cord-014462-11ggaqf1	483	14	attractive	attractive	JJ
cord-014462-11ggaqf1	483	15	strategy	strategy	NN
cord-014462-11ggaqf1	483	16	to	to	TO
cord-014462-11ggaqf1	483	17	evolve	evolve	VB
cord-014462-11ggaqf1	483	18	newer	new	JJR
cord-014462-11ggaqf1	483	19	methods	method	NNS
cord-014462-11ggaqf1	483	20	of	of	IN
cord-014462-11ggaqf1	483	21	virus	virus	NN
cord-014462-11ggaqf1	483	22	management	management	NN
cord-014462-11ggaqf1	483	23	,	,	,
cord-014462-11ggaqf1	483	24	by	by	IN
cord-014462-11ggaqf1	483	25	transforming	transform	VBG
cord-014462-11ggaqf1	483	26	crop	crop	NN
cord-014462-11ggaqf1	483	27	plants	plant	NNS
cord-014462-11ggaqf1	483	28	with	with	IN
cord-014462-11ggaqf1	483	29	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	483	30	sequences	sequence	NNS
cord-014462-11ggaqf1	483	31	derived	derive	VBN
cord-014462-11ggaqf1	483	32	from	from	IN
cord-014462-11ggaqf1	483	33	the	the	DT
cord-014462-11ggaqf1	483	34	pathogen	pathogen	NN
cord-014462-11ggaqf1	483	35	's	's	POS
cord-014462-11ggaqf1	483	36	genome	genome	NN
cord-014462-11ggaqf1	483	37	.	.	.
cord-014462-11ggaqf1	484	1	An	an	DT
cord-014462-11ggaqf1	484	2	increasing	increase	VBG
cord-014462-11ggaqf1	484	3	number	number	NN
cord-014462-11ggaqf1	484	4	of	of	IN
cord-014462-11ggaqf1	484	5	molecular	molecular	JJ
cord-014462-11ggaqf1	484	6	characterisation	characterisation	NN
cord-014462-11ggaqf1	484	7	of	of	IN
cord-014462-11ggaqf1	484	8	plant	plant	NN
cord-014462-11ggaqf1	484	9	virus	virus	NN
cord-014462-11ggaqf1	484	10	genomes	genome	NNS
cord-014462-11ggaqf1	484	11	and	and	CC
cord-014462-11ggaqf1	484	12	the	the	DT
cord-014462-11ggaqf1	484	13	stable	stable	JJ
cord-014462-11ggaqf1	484	14	transformation	transformation	NN
cord-014462-11ggaqf1	484	15	of	of	IN
cord-014462-11ggaqf1	484	16	a	a	DT
cord-014462-11ggaqf1	484	17	number	number	NN
cord-014462-11ggaqf1	484	18	of	of	IN
cord-014462-11ggaqf1	484	19	horticultural	horticultural	JJ
cord-014462-11ggaqf1	484	20	crop	crop	NN
cord-014462-11ggaqf1	484	21	species	specie	NNS
cord-014462-11ggaqf1	484	22	have	have	VBP
cord-014462-11ggaqf1	484	23	in	in	IN
cord-014462-11ggaqf1	484	24	fact	fact	NN
cord-014462-11ggaqf1	484	25	opened	open	VBN
cord-014462-11ggaqf1	484	26	an	an	DT
cord-014462-11ggaqf1	484	27	avenue	avenue	NN
cord-014462-11ggaqf1	484	28	for	for	IN
cord-014462-11ggaqf1	484	29	molecular	molecular	JJ
cord-014462-11ggaqf1	484	30	breeding	breed	VBG
cord-014462-11ggaqf1	484	31	against	against	IN
cord-014462-11ggaqf1	484	32	virus	virus	NN
cord-014462-11ggaqf1	484	33	pathogens	pathogen	NNS
cord-014462-11ggaqf1	484	34	.	.	.
cord-014462-11ggaqf1	485	1	Successful	successful	JJ
cord-014462-11ggaqf1	485	2	field	field	NN
cord-014462-11ggaqf1	485	3	-	-	HYPH
cord-014462-11ggaqf1	485	4	testing	testing	NN
cord-014462-11ggaqf1	485	5	of	of	IN
cord-014462-11ggaqf1	485	6	genetically	genetically	RB
cord-014462-11ggaqf1	485	7	modified	modify	VBN
cord-014462-11ggaqf1	485	8	crop	crop	NN
cord-014462-11ggaqf1	485	9	cultivars	cultivar	NNS
cord-014462-11ggaqf1	485	10	renders	render	VBZ
cord-014462-11ggaqf1	485	11	proof	proof	NN
cord-014462-11ggaqf1	485	12	of	of	IN
cord-014462-11ggaqf1	485	13	their	-PRON-	PRP$
cord-014462-11ggaqf1	485	14	supremacy	supremacy	NN
cord-014462-11ggaqf1	485	15	over	over	IN
cord-014462-11ggaqf1	485	16	existing	exist	VBG
cord-014462-11ggaqf1	485	17	cultivars	cultivar	NNS
cord-014462-11ggaqf1	485	18	.	.	.
cord-014462-11ggaqf1	486	1	It	-PRON-	PRP
cord-014462-11ggaqf1	486	2	also	also	RB
cord-014462-11ggaqf1	486	3	contributes	contribute	VBZ
cord-014462-11ggaqf1	486	4	to	to	TO
cord-014462-11ggaqf1	486	5	demonstrate	demonstrate	VB
cord-014462-11ggaqf1	486	6	their	-PRON-	PRP$
cord-014462-11ggaqf1	486	7	capability	capability	NN
cord-014462-11ggaqf1	486	8	with	with	IN
cord-014462-11ggaqf1	486	9	regard	regard	NN
cord-014462-11ggaqf1	486	10	to	to	IN
cord-014462-11ggaqf1	486	11	environmental	environmental	JJ
cord-014462-11ggaqf1	486	12	safety	safety	NN
cord-014462-11ggaqf1	486	13	with	with	IN
cord-014462-11ggaqf1	486	14	a	a	DT
cord-014462-11ggaqf1	486	15	view	view	NN
cord-014462-11ggaqf1	486	16	to	to	IN
cord-014462-11ggaqf1	486	17	winning	win	VBG
cord-014462-11ggaqf1	486	18	over	over	IN
cord-014462-11ggaqf1	486	19	public	public	JJ
cord-014462-11ggaqf1	486	20	concern	concern	NN
cord-014462-11ggaqf1	486	21	and	and	CC
cord-014462-11ggaqf1	486	22	scepticism	scepticism	NN
cord-014462-11ggaqf1	486	23	.	.	.
cord-014462-11ggaqf1	487	1	In	in	IN
cord-014462-11ggaqf1	487	2	general	general	JJ
cord-014462-11ggaqf1	487	3	,	,	,
cord-014462-11ggaqf1	487	4	the	the	DT
cord-014462-11ggaqf1	487	5	eventual	eventual	JJ
cord-014462-11ggaqf1	487	6	commercialisation	commercialisation	NN
cord-014462-11ggaqf1	487	7	transgenic	transgenic	NN
cord-014462-11ggaqf1	487	8	lines	line	NNS
cord-014462-11ggaqf1	487	9	expressing	express	VBG
cord-014462-11ggaqf1	487	10	virus	virus	NN
cord-014462-11ggaqf1	487	11	resistance	resistance	NN
cord-014462-11ggaqf1	487	12	will	will	MD
cord-014462-11ggaqf1	487	13	rely	rely	VB
cord-014462-11ggaqf1	487	14	upon	upon	IN
cord-014462-11ggaqf1	487	15	a	a	DT
cord-014462-11ggaqf1	487	16	host	host	NN
cord-014462-11ggaqf1	487	17	of	of	IN
cord-014462-11ggaqf1	487	18	factors	factor	NNS
cord-014462-11ggaqf1	487	19	including	include	VBG
cord-014462-11ggaqf1	487	20	their	-PRON-	PRP$
cord-014462-11ggaqf1	487	21	field	field	NN
cord-014462-11ggaqf1	487	22	performance	performance	NN
cord-014462-11ggaqf1	487	23	,	,	,
cord-014462-11ggaqf1	487	24	genetic	genetic	JJ
cord-014462-11ggaqf1	487	25	stability	stability	NN
cord-014462-11ggaqf1	487	26	,	,	,
cord-014462-11ggaqf1	487	27	public	public	JJ
cord-014462-11ggaqf1	487	28	acceptance	acceptance	NN
cord-014462-11ggaqf1	487	29	and	and	CC
cord-014462-11ggaqf1	487	30	the	the	DT
cord-014462-11ggaqf1	487	31	resolution	resolution	NN
cord-014462-11ggaqf1	487	32	of	of	IN
cord-014462-11ggaqf1	487	33	environmental	environmental	JJ
cord-014462-11ggaqf1	487	34	concerns	concern	NNS
cord-014462-11ggaqf1	487	35	and	and	CC
cord-014462-11ggaqf1	487	36	patent	patent	NN
cord-014462-11ggaqf1	487	37	related	relate	VBN
cord-014462-11ggaqf1	487	38	issues	issue	NNS
cord-014462-11ggaqf1	487	39	.	.	.
cord-014462-11ggaqf1	488	1	As	as	IN
cord-014462-11ggaqf1	488	2	such	such	JJ
cord-014462-11ggaqf1	488	3	,	,	,
cord-014462-11ggaqf1	488	4	elaborate	elaborate	JJ
cord-014462-11ggaqf1	488	5	field	field	NN
cord-014462-11ggaqf1	488	6	trials	trial	NNS
cord-014462-11ggaqf1	488	7	and	and	CC
cord-014462-11ggaqf1	488	8	allied	ally	VBN
cord-014462-11ggaqf1	488	9	studies	study	NNS
cord-014462-11ggaqf1	488	10	are	be	VBP
cord-014462-11ggaqf1	488	11	now	now	RB
cord-014462-11ggaqf1	488	12	required	require	VBN
cord-014462-11ggaqf1	488	13	to	to	TO
cord-014462-11ggaqf1	488	14	adapt	adapt	VB
cord-014462-11ggaqf1	488	15	genetically	genetically	RB
cord-014462-11ggaqf1	488	16	engineered	engineer	VBN
cord-014462-11ggaqf1	488	17	horticultural	horticultural	JJ
cord-014462-11ggaqf1	488	18	crops	crop	NNS
cord-014462-11ggaqf1	488	19	expressing	express	VBG
cord-014462-11ggaqf1	488	20	virus	virus	NN
cord-014462-11ggaqf1	488	21	resistance	resistance	NN
cord-014462-11ggaqf1	488	22	for	for	IN
cord-014462-11ggaqf1	488	23	their	-PRON-	PRP$
cord-014462-11ggaqf1	488	24	implementation	implementation	NN
cord-014462-11ggaqf1	488	25	into	into	IN
cord-014462-11ggaqf1	488	26	practical	practical	JJ
cord-014462-11ggaqf1	488	27	agriculture	agriculture	NN
cord-014462-11ggaqf1	488	28	.	.	.
cord-014462-11ggaqf1	489	1	A	a	DT
cord-014462-11ggaqf1	489	2	few	few	JJ
cord-014462-11ggaqf1	489	3	examples	example	NNS
cord-014462-11ggaqf1	489	4	from	from	IN
cord-014462-11ggaqf1	489	5	current	current	JJ
cord-014462-11ggaqf1	489	6	research	research	NN
cord-014462-11ggaqf1	489	7	at	at	IN
cord-014462-11ggaqf1	489	8	TNAU	TNAU	NNP
cord-014462-11ggaqf1	489	9	,	,	,
cord-014462-11ggaqf1	489	10	in	in	IN
cord-014462-11ggaqf1	489	11	India	India	NNP
cord-014462-11ggaqf1	489	12	or	or	CC
cord-014462-11ggaqf1	489	13	elsewhere	elsewhere	RB
cord-014462-11ggaqf1	489	14	will	will	MD
cord-014462-11ggaqf1	489	15	be	be	VB
cord-014462-11ggaqf1	489	16	discussed	discuss	VBN
cord-014462-11ggaqf1	489	17	in	in	IN
cord-014462-11ggaqf1	489	18	this	this	DT
cord-014462-11ggaqf1	489	19	presentation	presentation	NN
cord-014462-11ggaqf1	489	20	.	.	.
cord-014462-11ggaqf1	490	1	Virology	Virology	NNP
cord-014462-11ggaqf1	490	2	Unit	Unit	NNP
cord-014462-11ggaqf1	490	3	,	,	,
cord-014462-11ggaqf1	490	4	Division	Division	NNP
cord-014462-11ggaqf1	490	5	of	of	IN
cord-014462-11ggaqf1	490	6	Plant	Plant	NNP
cord-014462-11ggaqf1	490	7	Pathology	Pathology	NNP
cord-014462-11ggaqf1	490	8	,	,	,
cord-014462-11ggaqf1	490	9	IARI	IARI	NNP
cord-014462-11ggaqf1	490	10	,	,	,
cord-014462-11ggaqf1	490	11	New	New	NNP
cord-014462-11ggaqf1	490	12	Delhi	Delhi	NNP
cord-014462-11ggaqf1	490	13	12	12	CD
cord-014462-11ggaqf1	491	1	In	in	IN
cord-014462-11ggaqf1	491	2	recent	recent	JJ
cord-014462-11ggaqf1	491	3	times	time	NNS
cord-014462-11ggaqf1	491	4	there	there	EX
cord-014462-11ggaqf1	491	5	has	have	VBZ
cord-014462-11ggaqf1	491	6	been	be	VBN
cord-014462-11ggaqf1	491	7	greater	great	JJR
cord-014462-11ggaqf1	491	8	emphasis	emphasis	NN
cord-014462-11ggaqf1	491	9	on	on	IN
cord-014462-11ggaqf1	491	10	vegetatively	vegetatively	RB
cord-014462-11ggaqf1	491	11	propagated	propagate	VBN
cord-014462-11ggaqf1	491	12	crops	crop	NNS
cord-014462-11ggaqf1	491	13	in	in	IN
cord-014462-11ggaqf1	491	14	India	India	NNP
cord-014462-11ggaqf1	491	15	to	to	TO
cord-014462-11ggaqf1	491	16	help	help	VB
cord-014462-11ggaqf1	491	17	diversify	diversify	VB
cord-014462-11ggaqf1	491	18	the	the	DT
cord-014462-11ggaqf1	491	19	Indian	indian	JJ
cord-014462-11ggaqf1	491	20	agriculture	agriculture	NN
cord-014462-11ggaqf1	491	21	.	.	.
cord-014462-11ggaqf1	492	1	Fruit	fruit	NN
cord-014462-11ggaqf1	492	2	,	,	,
cord-014462-11ggaqf1	492	3	flower	flower	NN
cord-014462-11ggaqf1	492	4	,	,	,
cord-014462-11ggaqf1	492	5	spice	spice	NN
cord-014462-11ggaqf1	492	6	and	and	CC
cord-014462-11ggaqf1	492	7	plantation	plantation	NN
cord-014462-11ggaqf1	492	8	crops	crop	NNS
cord-014462-11ggaqf1	492	9	are	be	VBP
cord-014462-11ggaqf1	492	10	important	important	JJ
cord-014462-11ggaqf1	492	11	vegetatively	vegetatively	RB
cord-014462-11ggaqf1	492	12	propagated	propagate	VBN
cord-014462-11ggaqf1	492	13	horticultural	horticultural	JJ
cord-014462-11ggaqf1	492	14	crops	crop	NNS
cord-014462-11ggaqf1	492	15	,	,	,
cord-014462-11ggaqf1	492	16	which	which	WDT
cord-014462-11ggaqf1	492	17	have	have	VBP
cord-014462-11ggaqf1	492	18	become	become	VBN
cord-014462-11ggaqf1	492	19	a	a	DT
cord-014462-11ggaqf1	492	20	driving	drive	VBG
cord-014462-11ggaqf1	492	21	force	force	NN
cord-014462-11ggaqf1	492	22	for	for	IN
cord-014462-11ggaqf1	492	23	economic	economic	JJ
cord-014462-11ggaqf1	492	24	development	development	NN
cord-014462-11ggaqf1	492	25	in	in	IN
cord-014462-11ggaqf1	492	26	several	several	JJ
cord-014462-11ggaqf1	492	27	parts	part	NNS
cord-014462-11ggaqf1	492	28	of	of	IN
cord-014462-11ggaqf1	492	29	India	India	NNP
cord-014462-11ggaqf1	492	30	.	.	.
cord-014462-11ggaqf1	493	1	However	however	RB
cord-014462-11ggaqf1	493	2	,	,	,
cord-014462-11ggaqf1	493	3	most	most	JJS
cord-014462-11ggaqf1	493	4	of	of	IN
cord-014462-11ggaqf1	493	5	the	the	DT
cord-014462-11ggaqf1	493	6	vegetatively	vegetatively	RB
cord-014462-11ggaqf1	493	7	propagated	propagate	VBN
cord-014462-11ggaqf1	493	8	crops	crop	NNS
cord-014462-11ggaqf1	493	9	are	be	VBP
cord-014462-11ggaqf1	493	10	threatened	threaten	VBN
cord-014462-11ggaqf1	493	11	by	by	IN
cord-014462-11ggaqf1	493	12	biotic	biotic	JJ
cord-014462-11ggaqf1	493	13	stress	stress	NN
cord-014462-11ggaqf1	493	14	caused	cause	VBN
cord-014462-11ggaqf1	493	15	by	by	IN
cord-014462-11ggaqf1	493	16	plant	plant	NN
cord-014462-11ggaqf1	493	17	pathogens	pathogen	NNS
cord-014462-11ggaqf1	493	18	in	in	IN
cord-014462-11ggaqf1	493	19	general	general	JJ
cord-014462-11ggaqf1	493	20	and	and	CC
cord-014462-11ggaqf1	493	21	plant	plant	NN
cord-014462-11ggaqf1	493	22	viruses	virus	NNS
cord-014462-11ggaqf1	493	23	in	in	IN
cord-014462-11ggaqf1	493	24	particular	particular	JJ
cord-014462-11ggaqf1	493	25	.	.	.
cord-014462-11ggaqf1	494	1	Plant	plant	NN
cord-014462-11ggaqf1	494	2	viruses	virus	NNS
cord-014462-11ggaqf1	494	3	produce	produce	VBP
cord-014462-11ggaqf1	494	4	specific	specific	JJ
cord-014462-11ggaqf1	494	5	and	and	CC
cord-014462-11ggaqf1	494	6	non	non	JJ
cord-014462-11ggaqf1	494	7	specific	specific	JJ
cord-014462-11ggaqf1	494	8	symptoms	symptom	NNS
cord-014462-11ggaqf1	494	9	and	and	CC
cord-014462-11ggaqf1	494	10	in	in	IN
cord-014462-11ggaqf1	494	11	some	some	DT
cord-014462-11ggaqf1	494	12	cases	case	NNS
cord-014462-11ggaqf1	494	13	no	no	DT
cord-014462-11ggaqf1	494	14	symptoms	symptom	NNS
cord-014462-11ggaqf1	494	15	are	be	VBP
cord-014462-11ggaqf1	494	16	produced	produce	VBN
cord-014462-11ggaqf1	494	17	.	.	.
cord-014462-11ggaqf1	495	1	Correct	correct	JJ
cord-014462-11ggaqf1	495	2	identification	identification	NN
cord-014462-11ggaqf1	495	3	and	and	CC
cord-014462-11ggaqf1	495	4	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	495	5	of	of	IN
cord-014462-11ggaqf1	495	6	viral	viral	JJ
cord-014462-11ggaqf1	495	7	diseases	disease	NNS
cord-014462-11ggaqf1	495	8	is	be	VBZ
cord-014462-11ggaqf1	495	9	first	first	JJ
cord-014462-11ggaqf1	495	10	step	step	NN
cord-014462-11ggaqf1	495	11	in	in	IN
cord-014462-11ggaqf1	495	12	the	the	DT
cord-014462-11ggaqf1	495	13	management	management	NN
cord-014462-11ggaqf1	495	14	of	of	IN
cord-014462-11ggaqf1	495	15	any	any	DT
cord-014462-11ggaqf1	495	16	disease	disease	NN
cord-014462-11ggaqf1	495	17	including	include	VBG
cord-014462-11ggaqf1	495	18	viral	viral	JJ
cord-014462-11ggaqf1	495	19	diseases	disease	NNS
cord-014462-11ggaqf1	495	20	.	.	.
cord-014462-11ggaqf1	496	1	There	there	EX
cord-014462-11ggaqf1	496	2	have	have	VBP
cord-014462-11ggaqf1	496	3	been	be	VBN
cord-014462-11ggaqf1	496	4	two	two	CD
cord-014462-11ggaqf1	496	5	major	major	JJ
cord-014462-11ggaqf1	496	6	breakthroughs	breakthrough	NNS
cord-014462-11ggaqf1	496	7	in	in	IN
cord-014462-11ggaqf1	496	8	virus	virus	NN
cord-014462-11ggaqf1	496	9	diagnostics	diagnostic	NNS
cord-014462-11ggaqf1	496	10	during	during	IN
cord-014462-11ggaqf1	496	11	last	last	JJ
cord-014462-11ggaqf1	496	12	four	four	CD
cord-014462-11ggaqf1	496	13	decades	decade	NNS
cord-014462-11ggaqf1	496	14	.	.	.
cord-014462-11ggaqf1	497	1	The	the	DT
cord-014462-11ggaqf1	497	2	first	first	JJ
cord-014462-11ggaqf1	497	3	one	one	NN
cord-014462-11ggaqf1	497	4	was	be	VBD
cord-014462-11ggaqf1	497	5	serological	serological	JJ
cord-014462-11ggaqf1	497	6	assay	assay	NN
cord-014462-11ggaqf1	497	7	using	use	VBG
cord-014462-11ggaqf1	497	8	monoclonal	monoclonal	JJ
cord-014462-11ggaqf1	497	9	or	or	CC
cord-014462-11ggaqf1	497	10	polyclonal	polyclonal	JJ
cord-014462-11ggaqf1	497	11	antibodies	antibody	NNS
cord-014462-11ggaqf1	497	12	in	in	IN
cord-014462-11ggaqf1	497	13	enzyme	enzyme	NN
cord-014462-11ggaqf1	497	14	linked	link	VBN
cord-014462-11ggaqf1	497	15	immunosorbent	immunosorbent	JJ
cord-014462-11ggaqf1	497	16	assay	assay	NN
cord-014462-11ggaqf1	497	17	(	(	-LRB-
cord-014462-11ggaqf1	497	18	ELISA	ELISA	NNP
cord-014462-11ggaqf1	497	19	)	)	-RRB-
cord-014462-11ggaqf1	497	20	and	and	CC
cord-014462-11ggaqf1	497	21	the	the	DT
cord-014462-11ggaqf1	497	22	other	other	JJ
cord-014462-11ggaqf1	497	23	one	one	NN
cord-014462-11ggaqf1	497	24	was	be	VBD
cord-014462-11ggaqf1	497	25	the	the	DT
cord-014462-11ggaqf1	497	26	use	use	NN
cord-014462-11ggaqf1	497	27	of	of	IN
cord-014462-11ggaqf1	497	28	in	in	FW
cord-014462-11ggaqf1	497	29	vitro	vitro	FW
cord-014462-11ggaqf1	497	30	amplification	amplification	NN
cord-014462-11ggaqf1	497	31	of	of	IN
cord-014462-11ggaqf1	497	32	DNA	dna	NN
cord-014462-11ggaqf1	497	33	in	in	IN
cord-014462-11ggaqf1	497	34	polymerase	polymerase	NN
cord-014462-11ggaqf1	497	35	chain	chain	NN
cord-014462-11ggaqf1	497	36	reaction	reaction	NN
cord-014462-11ggaqf1	497	37	(	(	-LRB-
cord-014462-11ggaqf1	497	38	PCR	PCR	NNP
cord-014462-11ggaqf1	497	39	)	)	-RRB-
cord-014462-11ggaqf1	497	40	.	.	.
cord-014462-11ggaqf1	498	1	A	a	DT
cord-014462-11ggaqf1	498	2	significant	significant	JJ
cord-014462-11ggaqf1	498	3	development	development	NN
cord-014462-11ggaqf1	498	4	in	in	IN
cord-014462-11ggaqf1	498	5	serological	serological	JJ
cord-014462-11ggaqf1	498	6	assays	assay	NNS
cord-014462-11ggaqf1	498	7	has	have	VBZ
cord-014462-11ggaqf1	498	8	been	be	VBN
cord-014462-11ggaqf1	498	9	its	-PRON-	PRP$
cord-014462-11ggaqf1	498	10	simplification	simplification	NN
cord-014462-11ggaqf1	498	11	in	in	IN
cord-014462-11ggaqf1	498	12	form	form	NN
cord-014462-11ggaqf1	498	13	of	of	IN
cord-014462-11ggaqf1	498	14	user	user	NN
cord-014462-11ggaqf1	498	15	's	's	POS
cord-014462-11ggaqf1	498	16	friendly	friendly	JJ
cord-014462-11ggaqf1	498	17	quick	quick	JJ
cord-014462-11ggaqf1	498	18	strip	strip	NN
cord-014462-11ggaqf1	498	19	/	/	SYM
cord-014462-11ggaqf1	498	20	dip	dip	NN
cord-014462-11ggaqf1	498	21	stick	stick	NN
cord-014462-11ggaqf1	498	22	method	method	NN
cord-014462-11ggaqf1	498	23	.	.	.
cord-014462-11ggaqf1	499	1	The	the	DT
cord-014462-11ggaqf1	499	2	one	one	CD
cord-014462-11ggaqf1	499	3	-	-	HYPH
cord-014462-11ggaqf1	499	4	step	step	NN
cord-014462-11ggaqf1	499	5	lateral	lateral	JJ
cord-014462-11ggaqf1	499	6	-	-	HYPH
cord-014462-11ggaqf1	499	7	flow	flow	NN
cord-014462-11ggaqf1	499	8	(	(	-LRB-
cord-014462-11ggaqf1	499	9	LF	lf	NN
cord-014462-11ggaqf1	499	10	)	)	-RRB-
cord-014462-11ggaqf1	499	11	tests	test	NNS
cord-014462-11ggaqf1	499	12	have	have	VBP
cord-014462-11ggaqf1	499	13	been	be	VBN
cord-014462-11ggaqf1	499	14	developed	develop	VBN
cord-014462-11ggaqf1	499	15	for	for	IN
cord-014462-11ggaqf1	499	16	the	the	DT
cord-014462-11ggaqf1	499	17	on	on	IN
cord-014462-11ggaqf1	499	18	-	-	HYPH
cord-014462-11ggaqf1	499	19	site	site	NN
cord-014462-11ggaqf1	499	20	detection	detection	NN
cord-014462-11ggaqf1	499	21	and	and	CC
cord-014462-11ggaqf1	499	22	identification	identification	NN
cord-014462-11ggaqf1	499	23	of	of	IN
cord-014462-11ggaqf1	499	24	several	several	JJ
cord-014462-11ggaqf1	499	25	plant	plant	NN
cord-014462-11ggaqf1	499	26	viruses	virus	NNS
cord-014462-11ggaqf1	499	27	.	.	.
cord-014462-11ggaqf1	500	1	Rapid	rapid	JJ
cord-014462-11ggaqf1	500	2	advancement	advancement	NN
cord-014462-11ggaqf1	500	3	in	in	IN
cord-014462-11ggaqf1	500	4	virus	virus	NN
cord-014462-11ggaqf1	500	5	genome	genome	NN
cord-014462-11ggaqf1	500	6	characterization	characterization	NN
cord-014462-11ggaqf1	500	7	has	have	VBZ
cord-014462-11ggaqf1	500	8	led	lead	VBN
cord-014462-11ggaqf1	500	9	to	to	IN
cord-014462-11ggaqf1	500	10	the	the	DT
cord-014462-11ggaqf1	500	11	development	development	NN
cord-014462-11ggaqf1	500	12	of	of	IN
cord-014462-11ggaqf1	500	13	novel	novel	JJ
cord-014462-11ggaqf1	500	14	approaches	approach	NNS
cord-014462-11ggaqf1	500	15	of	of	IN
cord-014462-11ggaqf1	500	16	nucleic	nucleic	JJ
cord-014462-11ggaqf1	500	17	acid	acid	NN
cord-014462-11ggaqf1	500	18	based	base	VBN
cord-014462-11ggaqf1	500	19	diagnostics	diagnostic	NNS
cord-014462-11ggaqf1	500	20	which	which	WDT
cord-014462-11ggaqf1	500	21	include	include	VBP
cord-014462-11ggaqf1	500	22	conventional	conventional	JJ
cord-014462-11ggaqf1	500	23	PCR	PCR	NNP
cord-014462-11ggaqf1	500	24	,	,	,
cord-014462-11ggaqf1	500	25	real	real	JJ
cord-014462-11ggaqf1	500	26	time	time	NN
cord-014462-11ggaqf1	500	27	PCR	PCR	NNP
cord-014462-11ggaqf1	500	28	,	,	,
cord-014462-11ggaqf1	500	29	multiplex	multiplex	NN
cord-014462-11ggaqf1	500	30	PCR	PCR	NNP
cord-014462-11ggaqf1	500	31	,	,	,
cord-014462-11ggaqf1	500	32	micro	micro	JJ
cord-014462-11ggaqf1	500	33	/	/	SYM
cord-014462-11ggaqf1	500	34	macro	macro	JJ
cord-014462-11ggaqf1	500	35	arrays	array	NNS
cord-014462-11ggaqf1	500	36	and	and	CC
cord-014462-11ggaqf1	500	37	biochips	biochip	NNS
cord-014462-11ggaqf1	500	38	.	.	.
cord-014462-11ggaqf1	501	1	PCR	PCR	NNP
cord-014462-11ggaqf1	501	2	protocols	protocol	NNS
cord-014462-11ggaqf1	501	3	already	already	RB
cord-014462-11ggaqf1	501	4	exist	exist	VBP
cord-014462-11ggaqf1	501	5	for	for	IN
cord-014462-11ggaqf1	501	6	many	many	JJ
cord-014462-11ggaqf1	501	7	plant	plant	NN
cord-014462-11ggaqf1	501	8	viruses	virus	NNS
cord-014462-11ggaqf1	501	9	of	of	IN
cord-014462-11ggaqf1	501	10	citrus	citrus	NN
cord-014462-11ggaqf1	501	11	,	,	,
cord-014462-11ggaqf1	501	12	banana	banana	NN
cord-014462-11ggaqf1	501	13	,	,	,
cord-014462-11ggaqf1	501	14	apple	apple	NN
cord-014462-11ggaqf1	501	15	,	,	,
cord-014462-11ggaqf1	501	16	papaya	papaya	NN
cord-014462-11ggaqf1	501	17	,	,	,
cord-014462-11ggaqf1	501	18	vegetables	vegetable	NNS
cord-014462-11ggaqf1	501	19	,	,	,
cord-014462-11ggaqf1	501	20	ornamental	ornamental	JJ
cord-014462-11ggaqf1	501	21	and	and	CC
cord-014462-11ggaqf1	501	22	spice	spice	NN
cord-014462-11ggaqf1	501	23	crops	crop	NNS
cord-014462-11ggaqf1	501	24	.	.	.
cord-014462-11ggaqf1	502	1	A	a	DT
cord-014462-11ggaqf1	502	2	further	further	JJ
cord-014462-11ggaqf1	502	3	advancement	advancement	NN
cord-014462-11ggaqf1	502	4	has	have	VBZ
cord-014462-11ggaqf1	502	5	led	lead	VBN
cord-014462-11ggaqf1	502	6	to	to	IN
cord-014462-11ggaqf1	502	7	development	development	NN
cord-014462-11ggaqf1	502	8	of	of	IN
cord-014462-11ggaqf1	502	9	realtime	realtime	NNP
cord-014462-11ggaqf1	502	10	PCR	PCR	NNP
cord-014462-11ggaqf1	502	11	assay	assay	NN
cord-014462-11ggaqf1	502	12	which	which	WDT
cord-014462-11ggaqf1	502	13	is	be	VBZ
cord-014462-11ggaqf1	502	14	relatively	relatively	RB
cord-014462-11ggaqf1	502	15	easy	easy	JJ
cord-014462-11ggaqf1	502	16	but	but	CC
cord-014462-11ggaqf1	502	17	requires	require	VBZ
cord-014462-11ggaqf1	502	18	training	training	NN
cord-014462-11ggaqf1	502	19	for	for	IN
cord-014462-11ggaqf1	502	20	diagnosticians	diagnostician	NNS
cord-014462-11ggaqf1	502	21	.	.	.
cord-014462-11ggaqf1	503	1	In	in	IN
cord-014462-11ggaqf1	503	2	real	real	JJ
cord-014462-11ggaqf1	503	3	-	-	HYPH
cord-014462-11ggaqf1	503	4	time	time	NN
cord-014462-11ggaqf1	503	5	PCR	PCR	NNP
cord-014462-11ggaqf1	503	6	assays	assay	NNS
cord-014462-11ggaqf1	503	7	,	,	,
cord-014462-11ggaqf1	503	8	results	result	NNS
cord-014462-11ggaqf1	503	9	can	can	MD
cord-014462-11ggaqf1	503	10	be	be	VB
cord-014462-11ggaqf1	503	11	available	available	JJ
cord-014462-11ggaqf1	503	12	within	within	IN
cord-014462-11ggaqf1	503	13	20	20	CD
cord-014462-11ggaqf1	503	14	min	min	NN
cord-014462-11ggaqf1	503	15	.	.	.
cord-014462-11ggaqf1	504	1	The	the	DT
cord-014462-11ggaqf1	504	2	nucleic	nucleic	JJ
cord-014462-11ggaqf1	504	3	acid	acid	NN
cord-014462-11ggaqf1	504	4	template	template	NN
cord-014462-11ggaqf1	504	5	preparation	preparation	NN
cord-014462-11ggaqf1	504	6	in	in	IN
cord-014462-11ggaqf1	504	7	PCR	PCR	NNP
cord-014462-11ggaqf1	504	8	has	have	VBZ
cord-014462-11ggaqf1	504	9	been	be	VBN
cord-014462-11ggaqf1	504	10	simplified	simplify	VBN
cord-014462-11ggaqf1	504	11	.	.	.
cord-014462-11ggaqf1	505	1	Membrane	membrane	NN
cord-014462-11ggaqf1	505	2	based	base	VBN
cord-014462-11ggaqf1	505	3	DNA	dna	NN
cord-014462-11ggaqf1	505	4	template	template	NN
cord-014462-11ggaqf1	505	5	protocol	protocol	NN
cord-014462-11ggaqf1	505	6	and	and	CC
cord-014462-11ggaqf1	505	7	co	co	NN
cord-014462-11ggaqf1	505	8	-	-	NN
cord-014462-11ggaqf1	505	9	isolation	isolation	NN
cord-014462-11ggaqf1	505	10	of	of	IN
cord-014462-11ggaqf1	505	11	nucleic	nucleic	JJ
cord-014462-11ggaqf1	505	12	acid	acid	NN
cord-014462-11ggaqf1	505	13	template	template	NN
cord-014462-11ggaqf1	505	14	preparation	preparation	NN
cord-014462-11ggaqf1	505	15	are	be	VBP
cord-014462-11ggaqf1	505	16	novel	novel	JJ
cord-014462-11ggaqf1	505	17	approaches	approach	NNS
cord-014462-11ggaqf1	505	18	in	in	IN
cord-014462-11ggaqf1	505	19	PCR	PCR	NNP
cord-014462-11ggaqf1	505	20	detection	detection	NN
cord-014462-11ggaqf1	505	21	of	of	IN
cord-014462-11ggaqf1	505	22	virus	virus	NN
cord-014462-11ggaqf1	505	23	and	and	CC
cord-014462-11ggaqf1	505	24	virus	virus	NN
cord-014462-11ggaqf1	505	25	like	like	IN
cord-014462-11ggaqf1	505	26	pathogens	pathogen	NNS
cord-014462-11ggaqf1	505	27	.	.	.
cord-014462-11ggaqf1	506	1	Since	since	IN
cord-014462-11ggaqf1	506	2	many	many	JJ
cord-014462-11ggaqf1	506	3	of	of	IN
cord-014462-11ggaqf1	506	4	the	the	DT
cord-014462-11ggaqf1	506	5	horticultural	horticultural	JJ
cord-014462-11ggaqf1	506	6	crops	crop	NNS
cord-014462-11ggaqf1	506	7	are	be	VBP
cord-014462-11ggaqf1	506	8	often	often	RB
cord-014462-11ggaqf1	506	9	infected	infect	VBN
cord-014462-11ggaqf1	506	10	by	by	IN
cord-014462-11ggaqf1	506	11	more	more	JJR
cord-014462-11ggaqf1	506	12	than	than	IN
cord-014462-11ggaqf1	506	13	one	one	CD
cord-014462-11ggaqf1	506	14	virus	virus	NN
cord-014462-11ggaqf1	506	15	,	,	,
cord-014462-11ggaqf1	506	16	their	-PRON-	PRP$
cord-014462-11ggaqf1	506	17	individual	individual	JJ
cord-014462-11ggaqf1	506	18	detection	detection	NN
cord-014462-11ggaqf1	506	19	by	by	IN
cord-014462-11ggaqf1	506	20	PCR	PCR	NNP
cord-014462-11ggaqf1	506	21	is	be	VBZ
cord-014462-11ggaqf1	506	22	not	not	RB
cord-014462-11ggaqf1	506	23	only	only	RB
cord-014462-11ggaqf1	506	24	expensive	expensive	JJ
cord-014462-11ggaqf1	506	25	but	but	CC
cord-014462-11ggaqf1	506	26	also	also	RB
cord-014462-11ggaqf1	506	27	time	time	NN
cord-014462-11ggaqf1	506	28	consuming	consume	VBG
cord-014462-11ggaqf1	506	29	.	.	.
cord-014462-11ggaqf1	507	1	Therefore	therefore	RB
cord-014462-11ggaqf1	507	2	,	,	,
cord-014462-11ggaqf1	507	3	multiplex	multiplex	NN
cord-014462-11ggaqf1	507	4	PCR	PCR	NNP
cord-014462-11ggaqf1	507	5	has	have	VBZ
cord-014462-11ggaqf1	507	6	been	be	VBN
cord-014462-11ggaqf1	507	7	developed	develop	VBN
cord-014462-11ggaqf1	507	8	where	where	WRB
cord-014462-11ggaqf1	507	9	in	in	IN
cord-014462-11ggaqf1	507	10	genome	genome	NN
cord-014462-11ggaqf1	507	11	of	of	IN
cord-014462-11ggaqf1	507	12	more	more	JJR
cord-014462-11ggaqf1	507	13	than	than	IN
cord-014462-11ggaqf1	507	14	one	one	CD
cord-014462-11ggaqf1	507	15	virus	virus	NN
cord-014462-11ggaqf1	507	16	could	could	MD
cord-014462-11ggaqf1	507	17	be	be	VB
cord-014462-11ggaqf1	507	18	amplified	amplify	VBN
cord-014462-11ggaqf1	507	19	and	and	CC
cord-014462-11ggaqf1	507	20	detected	detect	VBN
cord-014462-11ggaqf1	507	21	in	in	IN
cord-014462-11ggaqf1	507	22	the	the	DT
cord-014462-11ggaqf1	507	23	same	same	JJ
cord-014462-11ggaqf1	507	24	reaction	reaction	NN
cord-014462-11ggaqf1	507	25	mixture	mixture	NN
cord-014462-11ggaqf1	507	26	.	.	.
cord-014462-11ggaqf1	508	1	Development	development	NN
cord-014462-11ggaqf1	508	2	of	of	IN
cord-014462-11ggaqf1	508	3	nucleic	nucleic	JJ
cord-014462-11ggaqf1	508	4	acid	acid	NN
cord-014462-11ggaqf1	508	5	based	base	VBN
cord-014462-11ggaqf1	508	6	chip	chip	NN
cord-014462-11ggaqf1	508	7	is	be	VBZ
cord-014462-11ggaqf1	508	8	now	now	RB
cord-014462-11ggaqf1	508	9	one	one	CD
cord-014462-11ggaqf1	508	10	of	of	IN
cord-014462-11ggaqf1	508	11	the	the	DT
cord-014462-11ggaqf1	508	12	fastest	fast	JJS
cord-014462-11ggaqf1	508	13	and	and	CC
cord-014462-11ggaqf1	508	14	recent	recent	JJ
cord-014462-11ggaqf1	508	15	growing	grow	VBG
cord-014462-11ggaqf1	508	16	areas	area	NNS
cord-014462-11ggaqf1	508	17	in	in	IN
cord-014462-11ggaqf1	508	18	the	the	DT
cord-014462-11ggaqf1	508	19	field	field	NN
cord-014462-11ggaqf1	508	20	of	of	IN
cord-014462-11ggaqf1	508	21	pathogen	pathogen	NN
cord-014462-11ggaqf1	508	22	detection	detection	NN
cord-014462-11ggaqf1	508	23	.	.	.
cord-014462-11ggaqf1	509	1	These	these	DT
cord-014462-11ggaqf1	509	2	nucleic	nucleic	JJ
cord-014462-11ggaqf1	509	3	acid	acid	NN
cord-014462-11ggaqf1	509	4	based	base	VBN
cord-014462-11ggaqf1	509	5	chips	chip	NNS
cord-014462-11ggaqf1	509	6	have	have	VBP
cord-014462-11ggaqf1	509	7	been	be	VBN
cord-014462-11ggaqf1	509	8	named	name	VBN
cord-014462-11ggaqf1	509	9	as	as	IN
cord-014462-11ggaqf1	509	10	DNA	DNA	NNP
cord-014462-11ggaqf1	509	11	/	/	SYM
cord-014462-11ggaqf1	509	12	RNA	RNA	NNP
cord-014462-11ggaqf1	509	13	chips	chip	NNS
cord-014462-11ggaqf1	509	14	,	,	,
cord-014462-11ggaqf1	509	15	Biochips	Biochips	NNP
cord-014462-11ggaqf1	509	16	,	,	,
cord-014462-11ggaqf1	509	17	Genechips	Genechips	NNP
cord-014462-11ggaqf1	509	18	,	,	,
cord-014462-11ggaqf1	509	19	Biosensors	biosensor	NNS
cord-014462-11ggaqf1	509	20	or	or	CC
cord-014462-11ggaqf1	509	21	DNA	dna	NN
cord-014462-11ggaqf1	509	22	arrays	array	NNS
cord-014462-11ggaqf1	509	23	.	.	.
cord-014462-11ggaqf1	510	1	When	when	WRB
cord-014462-11ggaqf1	510	2	it	-PRON-	PRP
cord-014462-11ggaqf1	510	3	comes	come	VBZ
cord-014462-11ggaqf1	510	4	to	to	IN
cord-014462-11ggaqf1	510	5	applications	application	NNS
cord-014462-11ggaqf1	510	6	of	of	IN
cord-014462-11ggaqf1	510	7	microarray	microarray	NN
cord-014462-11ggaqf1	510	8	technology	technology	NN
cord-014462-11ggaqf1	510	9	for	for	IN
cord-014462-11ggaqf1	510	10	plant	plant	NN
cord-014462-11ggaqf1	510	11	viruses	virus	NNS
cord-014462-11ggaqf1	510	12	,	,	,
cord-014462-11ggaqf1	510	13	it	-PRON-	PRP
cord-014462-11ggaqf1	510	14	is	be	VBZ
cord-014462-11ggaqf1	510	15	not	not	RB
cord-014462-11ggaqf1	510	16	too	too	RB
cord-014462-11ggaqf1	510	17	difficult	difficult	JJ
cord-014462-11ggaqf1	510	18	to	to	TO
cord-014462-11ggaqf1	510	19	see	see	VB
cord-014462-11ggaqf1	510	20	the	the	DT
cord-014462-11ggaqf1	510	21	value	value	NN
cord-014462-11ggaqf1	510	22	of	of	IN
cord-014462-11ggaqf1	510	23	a	a	DT
cord-014462-11ggaqf1	510	24	method	method	NN
cord-014462-11ggaqf1	510	25	that	that	WDT
cord-014462-11ggaqf1	510	26	could	could	MD
cord-014462-11ggaqf1	510	27	potentially	potentially	RB
cord-014462-11ggaqf1	510	28	detect	detect	VB
cord-014462-11ggaqf1	510	29	a	a	DT
cord-014462-11ggaqf1	510	30	whole	whole	JJ
cord-014462-11ggaqf1	510	31	range	range	NN
cord-014462-11ggaqf1	510	32	of	of	IN
cord-014462-11ggaqf1	510	33	viruses	virus	NNS
cord-014462-11ggaqf1	510	34	using	use	VBG
cord-014462-11ggaqf1	510	35	a	a	DT
cord-014462-11ggaqf1	510	36	single	single	JJ
cord-014462-11ggaqf1	510	37	test	test	NN
cord-014462-11ggaqf1	510	38	.	.	.
cord-014462-11ggaqf1	511	1	However	however	RB
cord-014462-11ggaqf1	511	2	,	,	,
cord-014462-11ggaqf1	511	3	microarrays	microarray	NNS
cord-014462-11ggaqf1	511	4	are	be	VBP
cord-014462-11ggaqf1	511	5	unlikely	unlikely	JJ
cord-014462-11ggaqf1	511	6	to	to	TO
cord-014462-11ggaqf1	511	7	become	become	VB
cord-014462-11ggaqf1	511	8	the	the	DT
cord-014462-11ggaqf1	511	9	only	only	JJ
cord-014462-11ggaqf1	511	10	method	method	NN
cord-014462-11ggaqf1	511	11	in	in	IN
cord-014462-11ggaqf1	511	12	use	use	NN
cord-014462-11ggaqf1	511	13	in	in	IN
cord-014462-11ggaqf1	511	14	a	a	DT
cord-014462-11ggaqf1	511	15	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	511	16	laboratory	laboratory	NN
cord-014462-11ggaqf1	511	17	.	.	.
cord-014462-11ggaqf1	512	1	processing	processing	NN
cord-014462-11ggaqf1	512	2	of	of	IN
cord-014462-11ggaqf1	512	3	germplasm	germplasm	NN
cord-014462-11ggaqf1	512	4	including	include	VBG
cord-014462-11ggaqf1	512	5	transgenic	transgenic	JJ
cord-014462-11ggaqf1	512	6	planting	planting	NN
cord-014462-11ggaqf1	512	7	material	material	NN
cord-014462-11ggaqf1	512	8	imported	import	VBN
cord-014462-11ggaqf1	512	9	for	for	IN
cord-014462-11ggaqf1	512	10	research	research	NN
cord-014462-11ggaqf1	512	11	purposes	purpose	NNS
cord-014462-11ggaqf1	512	12	into	into	IN
cord-014462-11ggaqf1	512	13	the	the	DT
cord-014462-11ggaqf1	512	14	country	country	NN
cord-014462-11ggaqf1	512	15	.	.	.
cord-014462-11ggaqf1	513	1	During	during	IN
cord-014462-11ggaqf1	513	2	the	the	DT
cord-014462-11ggaqf1	513	3	last	last	JJ
cord-014462-11ggaqf1	513	4	two	two	CD
cord-014462-11ggaqf1	513	5	decades	decade	NNS
cord-014462-11ggaqf1	513	6	,	,	,
cord-014462-11ggaqf1	513	7	a	a	DT
cord-014462-11ggaqf1	513	8	total	total	NN
cord-014462-11ggaqf1	513	9	of	of	IN
cord-014462-11ggaqf1	513	10	49,923	49,923	CD
cord-014462-11ggaqf1	513	11	samples	sample	NNS
cord-014462-11ggaqf1	513	12	of	of	IN
cord-014462-11ggaqf1	513	13	wheat	wheat	NN
cord-014462-11ggaqf1	513	14	including	include	VBG
cord-014462-11ggaqf1	513	15	transgenics	transgenic	NNS
cord-014462-11ggaqf1	513	16	were	be	VBD
cord-014462-11ggaqf1	513	17	imported	import	VBN
cord-014462-11ggaqf1	513	18	from	from	IN
cord-014462-11ggaqf1	513	19	CIMMYT	CIMMYT	NNP
cord-014462-11ggaqf1	513	20	(	(	-LRB-
cord-014462-11ggaqf1	513	21	Mexico	Mexico	NNP
cord-014462-11ggaqf1	513	22	)	)	-RRB-
cord-014462-11ggaqf1	513	23	,	,	,
cord-014462-11ggaqf1	513	24	ICARDA	ICARDA	NNP
cord-014462-11ggaqf1	513	25	(	(	-LRB-
cord-014462-11ggaqf1	513	26	Syria	Syria	NNP
cord-014462-11ggaqf1	513	27	)	)	-RRB-
cord-014462-11ggaqf1	513	28	and	and	CC
cord-014462-11ggaqf1	513	29	many	many	JJ
cord-014462-11ggaqf1	513	30	other	other	JJ
cord-014462-11ggaqf1	513	31	countries	country	NNS
cord-014462-11ggaqf1	513	32	.	.	.
cord-014462-11ggaqf1	514	1	These	these	DT
cord-014462-11ggaqf1	514	2	were	be	VBD
cord-014462-11ggaqf1	514	3	grown	grow	VBN
cord-014462-11ggaqf1	514	4	in	in	IN
cord-014462-11ggaqf1	514	5	post	post	JJ
cord-014462-11ggaqf1	514	6	-	-	JJ
cord-014462-11ggaqf1	514	7	entry	entry	JJ
cord-014462-11ggaqf1	514	8	quarantine	quarantine	NN
cord-014462-11ggaqf1	514	9	nursery	nursery	NN
cord-014462-11ggaqf1	514	10	each	each	DT
cord-014462-11ggaqf1	514	11	year	year	NN
cord-014462-11ggaqf1	514	12	at	at	IN
cord-014462-11ggaqf1	514	13	NBPGR	NBPGR	NNP
cord-014462-11ggaqf1	514	14	,	,	,
cord-014462-11ggaqf1	514	15	New	New	NNP
cord-014462-11ggaqf1	514	16	Delhi	Delhi	NNP
cord-014462-11ggaqf1	514	17	and	and	CC
cord-014462-11ggaqf1	514	18	the	the	DT
cord-014462-11ggaqf1	514	19	transgenic	transgenic	JJ
cord-014462-11ggaqf1	514	20	samples	sample	NNS
cord-014462-11ggaqf1	514	21	were	be	VBD
cord-014462-11ggaqf1	514	22	grown	grow	VBN
cord-014462-11ggaqf1	514	23	in	in	IN
cord-014462-11ggaqf1	514	24	National	National	NNP
cord-014462-11ggaqf1	514	25	Containment	Containment	NNP
cord-014462-11ggaqf1	514	26	Facility	Facility	NNP
cord-014462-11ggaqf1	514	27	of	of	IN
cord-014462-11ggaqf1	514	28	level-4	level-4	NNP
cord-014462-11ggaqf1	514	29	(	(	-LRB-
cord-014462-11ggaqf1	514	30	CL-4	CL-4	NNP
cord-014462-11ggaqf1	514	31	)	)	-RRB-
cord-014462-11ggaqf1	514	32	since	since	IN
cord-014462-11ggaqf1	514	33	its	-PRON-	PRP$
cord-014462-11ggaqf1	514	34	inception	inception	NN
cord-014462-11ggaqf1	514	35	to	to	TO
cord-014462-11ggaqf1	514	36	ensure	ensure	VB
cord-014462-11ggaqf1	514	37	that	that	IN
cord-014462-11ggaqf1	514	38	no	no	DT
cord-014462-11ggaqf1	514	39	viable	viable	JJ
cord-014462-11ggaqf1	514	40	biological	biological	JJ
cord-014462-11ggaqf1	514	41	material	material	NN
cord-014462-11ggaqf1	514	42	/	/	SYM
cord-014462-11ggaqf1	514	43	pollen	pollen	NN
cord-014462-11ggaqf1	514	44	/	/	SYM
cord-014462-11ggaqf1	514	45	pathogen	pathogen	NN
cord-014462-11ggaqf1	514	46	enters	enter	VBZ
cord-014462-11ggaqf1	514	47	or	or	CC
cord-014462-11ggaqf1	514	48	leaves	leave	VBZ
cord-014462-11ggaqf1	514	49	the	the	DT
cord-014462-11ggaqf1	514	50	facility	facility	NN
cord-014462-11ggaqf1	514	51	during	during	IN
cord-014462-11ggaqf1	514	52	quarantine	quarantine	NN
cord-014462-11ggaqf1	514	53	processing	processing	NN
cord-014462-11ggaqf1	514	54	of	of	IN
cord-014462-11ggaqf1	514	55	transgenics	transgenic	NNS
cord-014462-11ggaqf1	514	56	.	.	.
cord-014462-11ggaqf1	515	1	In	in	IN
cord-014462-11ggaqf1	515	2	addition	addition	NN
cord-014462-11ggaqf1	515	3	,	,	,
cord-014462-11ggaqf1	515	4	post	post	JJ
cord-014462-11ggaqf1	515	5	-	-	JJ
cord-014462-11ggaqf1	515	6	entry	entry	JJ
cord-014462-11ggaqf1	515	7	quarantine	quarantine	NN
cord-014462-11ggaqf1	515	8	inspections	inspection	NNS
cord-014462-11ggaqf1	515	9	of	of	IN
cord-014462-11ggaqf1	515	10	the	the	DT
cord-014462-11ggaqf1	515	11	transgenic	transgenic	JJ
cord-014462-11ggaqf1	515	12	wheat	wheat	NN
cord-014462-11ggaqf1	515	13	grown	grow	VBN
cord-014462-11ggaqf1	515	14	by	by	IN
cord-014462-11ggaqf1	515	15	indenters	indenter	NNS
cord-014462-11ggaqf1	515	16	are	be	VBP
cord-014462-11ggaqf1	515	17	also	also	RB
cord-014462-11ggaqf1	515	18	undertaken	undertake	VBN
cord-014462-11ggaqf1	515	19	by	by	IN
cord-014462-11ggaqf1	515	20	NBPGR	NBPGR	NNP
cord-014462-11ggaqf1	515	21	quarantine	quarantine	NN
cord-014462-11ggaqf1	515	22	scientists	scientist	NNS
cord-014462-11ggaqf1	515	23	.	.	.
cord-014462-11ggaqf1	516	1	Virus	virus	NN
cord-014462-11ggaqf1	516	2	-	-	HYPH
cord-014462-11ggaqf1	516	3	Induced	induce	VBN
cord-014462-11ggaqf1	516	4	Gene	gene	NN
cord-014462-11ggaqf1	516	5	Silencing	silencing	NN
cord-014462-11ggaqf1	516	6	(	(	-LRB-
cord-014462-11ggaqf1	516	7	VIGS	VIGS	NNP
cord-014462-11ggaqf1	516	8	)	)	-RRB-
cord-014462-11ggaqf1	516	9	is	be	VBZ
cord-014462-11ggaqf1	516	10	a	a	DT
cord-014462-11ggaqf1	516	11	technique	technique	NN
cord-014462-11ggaqf1	516	12	in	in	IN
cord-014462-11ggaqf1	516	13	which	which	WDT
cord-014462-11ggaqf1	516	14	viral	viral	JJ
cord-014462-11ggaqf1	516	15	genomes	genome	NNS
cord-014462-11ggaqf1	516	16	are	be	VBP
cord-014462-11ggaqf1	516	17	used	use	VBN
cord-014462-11ggaqf1	516	18	,	,	,
cord-014462-11ggaqf1	516	19	usually	usually	RB
cord-014462-11ggaqf1	516	20	after	after	IN
cord-014462-11ggaqf1	516	21	appropriate	appropriate	JJ
cord-014462-11ggaqf1	516	22	modifications	modification	NNS
cord-014462-11ggaqf1	516	23	,	,	,
cord-014462-11ggaqf1	516	24	for	for	IN
cord-014462-11ggaqf1	516	25	transient	transient	JJ
cord-014462-11ggaqf1	516	26	gene	gene	NN
cord-014462-11ggaqf1	516	27	silencing	silencing	NN
cord-014462-11ggaqf1	516	28	in	in	IN
cord-014462-11ggaqf1	516	29	plants	plant	NNS
cord-014462-11ggaqf1	516	30	.	.	.
cord-014462-11ggaqf1	517	1	The	the	DT
cord-014462-11ggaqf1	517	2	mechanism	mechanism	NN
cord-014462-11ggaqf1	517	3	behind	behind	IN
cord-014462-11ggaqf1	517	4	VIGS	VIGS	NNP
cord-014462-11ggaqf1	517	5	is	be	VBZ
cord-014462-11ggaqf1	517	6	the	the	DT
cord-014462-11ggaqf1	517	7	phenomenon	phenomenon	NN
cord-014462-11ggaqf1	517	8	called	call	VBN
cord-014462-11ggaqf1	517	9	RNA	RNA	NNP
cord-014462-11ggaqf1	517	10	-	-	HYPH
cord-014462-11ggaqf1	517	11	interference	interference	NN
cord-014462-11ggaqf1	517	12	(	(	-LRB-
cord-014462-11ggaqf1	517	13	RNAi	RNAi	NNP
cord-014462-11ggaqf1	517	14	)	)	-RRB-
cord-014462-11ggaqf1	517	15	,	,	,
cord-014462-11ggaqf1	517	16	which	which	WDT
cord-014462-11ggaqf1	517	17	is	be	VBZ
cord-014462-11ggaqf1	517	18	widespread	widespread	JJ
cord-014462-11ggaqf1	517	19	in	in	IN
cord-014462-11ggaqf1	517	20	many	many	JJ
cord-014462-11ggaqf1	517	21	organisms	organism	NNS
cord-014462-11ggaqf1	517	22	and	and	CC
cord-014462-11ggaqf1	517	23	is	be	VBZ
cord-014462-11ggaqf1	517	24	believed	believe	VBN
cord-014462-11ggaqf1	517	25	to	to	TO
cord-014462-11ggaqf1	517	26	be	be	VB
cord-014462-11ggaqf1	517	27	form	form	NN
cord-014462-11ggaqf1	517	28	of	of	IN
cord-014462-11ggaqf1	517	29	inherent	inherent	JJ
cord-014462-11ggaqf1	517	30	defence	defence	NN
cord-014462-11ggaqf1	517	31	system	system	NN
cord-014462-11ggaqf1	517	32	against	against	IN
cord-014462-11ggaqf1	517	33	intracellular	intracellular	JJ
cord-014462-11ggaqf1	517	34	pathogens	pathogen	NNS
cord-014462-11ggaqf1	517	35	,	,	,
cord-014462-11ggaqf1	517	36	such	such	JJ
cord-014462-11ggaqf1	517	37	as	as	IN
cord-014462-11ggaqf1	517	38	viruses	virus	NNS
cord-014462-11ggaqf1	517	39	and	and	CC
cord-014462-11ggaqf1	517	40	transposons	transposon	NNS
cord-014462-11ggaqf1	517	41	.	.	.
cord-014462-11ggaqf1	518	1	Double	double	JJ
cord-014462-11ggaqf1	518	2	-	-	HYPH
cord-014462-11ggaqf1	518	3	stranded	strand	VBN
cord-014462-11ggaqf1	518	4	RNA	RNA	NNP
cord-014462-11ggaqf1	518	5	or	or	CC
cord-014462-11ggaqf1	518	6	RNA	RNA	NNP
cord-014462-11ggaqf1	518	7	containing	contain	VBG
cord-014462-11ggaqf1	518	8	strong	strong	JJ
cord-014462-11ggaqf1	518	9	secondary	secondary	JJ
cord-014462-11ggaqf1	518	10	structures	structure	NNS
cord-014462-11ggaqf1	518	11	,	,	,
cord-014462-11ggaqf1	518	12	commonly	commonly	RB
cord-014462-11ggaqf1	518	13	produced	produce	VBN
cord-014462-11ggaqf1	518	14	during	during	IN
cord-014462-11ggaqf1	518	15	viral	viral	JJ
cord-014462-11ggaqf1	518	16	infections	infection	NNS
cord-014462-11ggaqf1	518	17	,	,	,
cord-014462-11ggaqf1	518	18	are	be	VBP
cord-014462-11ggaqf1	518	19	believed	believe	VBN
cord-014462-11ggaqf1	518	20	to	to	TO
cord-014462-11ggaqf1	518	21	cause	cause	VB
cord-014462-11ggaqf1	518	22	triggering	trigger	VBG
cord-014462-11ggaqf1	518	23	of	of	IN
cord-014462-11ggaqf1	518	24	RNAi	RNAi	NNS
cord-014462-11ggaqf1	518	25	,	,	,
cord-014462-11ggaqf1	518	26	which	which	WDT
cord-014462-11ggaqf1	518	27	employs	employ	VBZ
cord-014462-11ggaqf1	518	28	a	a	DT
cord-014462-11ggaqf1	518	29	battery	battery	NN
cord-014462-11ggaqf1	518	30	of	of	IN
cord-014462-11ggaqf1	518	31	proteins	protein	NNS
cord-014462-11ggaqf1	518	32	and	and	CC
cord-014462-11ggaqf1	518	33	nucleoprotein	nucleoprotein	NNP
cord-014462-11ggaqf1	518	34	complexes	complex	NNS
cord-014462-11ggaqf1	518	35	to	to	TO
cord-014462-11ggaqf1	518	36	identify	identify	VB
cord-014462-11ggaqf1	518	37	and	and	CC
cord-014462-11ggaqf1	518	38	degrade	degrade	VB
cord-014462-11ggaqf1	518	39	specific	specific	JJ
cord-014462-11ggaqf1	518	40	viral	viral	JJ
cord-014462-11ggaqf1	518	41	transcripts	transcript	NNS
cord-014462-11ggaqf1	518	42	.	.	.
cord-014462-11ggaqf1	519	1	In	in	IN
cord-014462-11ggaqf1	519	2	VIGS	VIGS	NNP
cord-014462-11ggaqf1	519	3	,	,	,
cord-014462-11ggaqf1	519	4	viral	viral	JJ
cord-014462-11ggaqf1	519	5	genomes	genome	NNS
cord-014462-11ggaqf1	519	6	not	not	RB
cord-014462-11ggaqf1	519	7	causing	cause	VBG
cord-014462-11ggaqf1	519	8	severe	severe	JJ
cord-014462-11ggaqf1	519	9	symptoms	symptom	NNS
cord-014462-11ggaqf1	519	10	,	,	,
cord-014462-11ggaqf1	519	11	but	but	CC
cord-014462-11ggaqf1	519	12	which	which	WDT
cord-014462-11ggaqf1	519	13	can	can	MD
cord-014462-11ggaqf1	519	14	accumulate	accumulate	VB
cord-014462-11ggaqf1	519	15	and	and	CC
cord-014462-11ggaqf1	519	16	spread	spread	VB
cord-014462-11ggaqf1	519	17	efficiently	efficiently	RB
cord-014462-11ggaqf1	519	18	in	in	IN
cord-014462-11ggaqf1	519	19	the	the	DT
cord-014462-11ggaqf1	519	20	host	host	NN
cord-014462-11ggaqf1	519	21	plant	plant	NN
cord-014462-11ggaqf1	519	22	are	be	VBP
cord-014462-11ggaqf1	519	23	used	use	VBN
cord-014462-11ggaqf1	519	24	as	as	IN
cord-014462-11ggaqf1	519	25	vectors	vector	NNS
cord-014462-11ggaqf1	519	26	in	in	IN
cord-014462-11ggaqf1	519	27	which	which	WDT
cord-014462-11ggaqf1	519	28	a	a	DT
cord-014462-11ggaqf1	519	29	host	host	NN
cord-014462-11ggaqf1	519	30	gene	gene	NN
cord-014462-11ggaqf1	519	31	is	be	VBZ
cord-014462-11ggaqf1	519	32	cloned	clone	VBN
cord-014462-11ggaqf1	519	33	and	and	CC
cord-014462-11ggaqf1	519	34	introduced	introduce	VBN
cord-014462-11ggaqf1	519	35	into	into	IN
cord-014462-11ggaqf1	519	36	the	the	DT
cord-014462-11ggaqf1	519	37	plant	plant	NN
cord-014462-11ggaqf1	519	38	.	.	.
cord-014462-11ggaqf1	520	1	Upon	upon	IN
cord-014462-11ggaqf1	520	2	replication	replication	NN
cord-014462-11ggaqf1	520	3	,	,	,
cord-014462-11ggaqf1	520	4	the	the	DT
cord-014462-11ggaqf1	520	5	viral	viral	JJ
cord-014462-11ggaqf1	520	6	vector	vector	NN
cord-014462-11ggaqf1	520	7	triggers	trigger	VBZ
cord-014462-11ggaqf1	520	8	RNAi	RNAi	NNP
cord-014462-11ggaqf1	520	9	response	response	NN
cord-014462-11ggaqf1	520	10	in	in	IN
cord-014462-11ggaqf1	520	11	the	the	DT
cord-014462-11ggaqf1	520	12	host	host	NN
cord-014462-11ggaqf1	520	13	plant	plant	NN
cord-014462-11ggaqf1	520	14	,	,	,
cord-014462-11ggaqf1	520	15	which	which	WDT
cord-014462-11ggaqf1	520	16	also	also	RB
cord-014462-11ggaqf1	520	17	targets	target	VBZ
cord-014462-11ggaqf1	520	18	the	the	DT
cord-014462-11ggaqf1	520	19	host	host	NN
cord-014462-11ggaqf1	520	20	gene	gene	NN
cord-014462-11ggaqf1	520	21	,	,	,
cord-014462-11ggaqf1	520	22	leading	lead	VBG
cord-014462-11ggaqf1	520	23	to	to	IN
cord-014462-11ggaqf1	520	24	its	-PRON-	PRP$
cord-014462-11ggaqf1	520	25	silencing	silencing	NN
cord-014462-11ggaqf1	520	26	and	and	CC
cord-014462-11ggaqf1	520	27	subsequently	subsequently	RB
cord-014462-11ggaqf1	520	28	,	,	,
cord-014462-11ggaqf1	520	29	the	the	DT
cord-014462-11ggaqf1	520	30	silenced	silence	VBN
cord-014462-11ggaqf1	520	31	phenotype	phenotype	NN
cord-014462-11ggaqf1	520	32	revealing	reveal	VBG
cord-014462-11ggaqf1	520	33	gene	gene	NN
cord-014462-11ggaqf1	520	34	function	function	NN
cord-014462-11ggaqf1	520	35	in	in	IN
cord-014462-11ggaqf1	520	36	vivo	vivo	NNP
cord-014462-11ggaqf1	520	37	.	.	.
cord-014462-11ggaqf1	521	1	VIGS	VIGS	NNP
cord-014462-11ggaqf1	521	2	has	have	VBZ
cord-014462-11ggaqf1	521	3	been	be	VBN
cord-014462-11ggaqf1	521	4	used	use	VBN
cord-014462-11ggaqf1	521	5	extensively	extensively	RB
cord-014462-11ggaqf1	521	6	to	to	TO
cord-014462-11ggaqf1	521	7	study	study	VB
cord-014462-11ggaqf1	521	8	gene	gene	NN
cord-014462-11ggaqf1	521	9	functions	function	NNS
cord-014462-11ggaqf1	521	10	in	in	IN
cord-014462-11ggaqf1	521	11	dicot	dicot	NN
cord-014462-11ggaqf1	521	12	plants	plant	NNS
cord-014462-11ggaqf1	521	13	,	,	,
cord-014462-11ggaqf1	521	14	such	such	JJ
cord-014462-11ggaqf1	521	15	as	as	IN
cord-014462-11ggaqf1	521	16	tobacco	tobacco	NN
cord-014462-11ggaqf1	521	17	,	,	,
cord-014462-11ggaqf1	521	18	tomato	tomato	NN
cord-014462-11ggaqf1	521	19	,	,	,
cord-014462-11ggaqf1	521	20	pea	pea	NN
cord-014462-11ggaqf1	521	21	,	,	,
cord-014462-11ggaqf1	521	22	soybean	soybean	NN
cord-014462-11ggaqf1	521	23	,	,	,
cord-014462-11ggaqf1	521	24	etc	etc	FW
cord-014462-11ggaqf1	521	25	.	.	.
cord-014462-11ggaqf1	522	1	,	,	,
cord-014462-11ggaqf1	522	2	using	use	VBG
cord-014462-11ggaqf1	522	3	vectors	vector	NNS
cord-014462-11ggaqf1	522	4	derived	derive	VBN
cord-014462-11ggaqf1	522	5	from	from	IN
cord-014462-11ggaqf1	522	6	Reference	reference	NN
cord-014462-11ggaqf1	522	7	genes	gene	NNS
cord-014462-11ggaqf1	522	8	are	be	VBP
cord-014462-11ggaqf1	522	9	commonly	commonly	RB
cord-014462-11ggaqf1	522	10	used	use	VBN
cord-014462-11ggaqf1	522	11	as	as	IN
cord-014462-11ggaqf1	522	12	an	an	DT
cord-014462-11ggaqf1	522	13	/	/	SYM
cord-014462-11ggaqf1	522	14	the	the	DT
cord-014462-11ggaqf1	522	15	endogenous	endogenous	JJ
cord-014462-11ggaqf1	522	16	normalisation	normalisation	NN
cord-014462-11ggaqf1	522	17	measure	measure	NN
cord-014462-11ggaqf1	522	18	for	for	IN
cord-014462-11ggaqf1	522	19	the	the	DT
cord-014462-11ggaqf1	522	20	relative	relative	JJ
cord-014462-11ggaqf1	522	21	quantification	quantification	NN
cord-014462-11ggaqf1	522	22	of	of	IN
cord-014462-11ggaqf1	522	23	target	target	NN
cord-014462-11ggaqf1	522	24	genes	gene	NNS
cord-014462-11ggaqf1	522	25	.	.	.
cord-014462-11ggaqf1	523	1	The	the	DT
cord-014462-11ggaqf1	523	2	expression	expression	NN
cord-014462-11ggaqf1	523	3	(	(	-LRB-
cord-014462-11ggaqf1	523	4	characteristics	characteristic	NNS
cord-014462-11ggaqf1	523	5	)	)	-RRB-
cord-014462-11ggaqf1	523	6	of	of	IN
cord-014462-11ggaqf1	523	7	seven	seven	CD
cord-014462-11ggaqf1	523	8	potential	potential	JJ
cord-014462-11ggaqf1	523	9	reference	reference	NN
cord-014462-11ggaqf1	523	10	genes	gene	NNS
cord-014462-11ggaqf1	523	11	was	be	VBD
cord-014462-11ggaqf1	523	12	evaluated	evaluate	VBN
cord-014462-11ggaqf1	523	13	in	in	IN
cord-014462-11ggaqf1	523	14	tissues	tissue	NNS
cord-014462-11ggaqf1	523	15	of	of	IN
cord-014462-11ggaqf1	523	16	180	180	CD
cord-014462-11ggaqf1	523	17	healthy	healthy	JJ
cord-014462-11ggaqf1	523	18	,	,	,
cord-014462-11ggaqf1	523	19	physiologically	physiologically	RB
cord-014462-11ggaqf1	523	20	stressed	stressed	JJ
cord-014462-11ggaqf1	523	21	and	and	CC
cord-014462-11ggaqf1	523	22	Barley	Barley	NNP
cord-014462-11ggaqf1	523	23	yellow	yellow	JJ
cord-014462-11ggaqf1	523	24	dwarf	dwarf	NN
cord-014462-11ggaqf1	523	25	virus	virus	NN
cord-014462-11ggaqf1	523	26	(	(	-LRB-
cord-014462-11ggaqf1	523	27	BYDV	BYDV	NNP
cord-014462-11ggaqf1	523	28	)	)	-RRB-
cord-014462-11ggaqf1	523	29	infected	infect	VBN
cord-014462-11ggaqf1	523	30	cereal	cereal	NN
cord-014462-11ggaqf1	523	31	plants	plant	NNS
cord-014462-11ggaqf1	523	32	.	.	.
cord-014462-11ggaqf1	524	1	These	these	DT
cord-014462-11ggaqf1	524	2	genes	gene	NNS
cord-014462-11ggaqf1	524	3	were	be	VBD
cord-014462-11ggaqf1	524	4	tested	test	VBN
cord-014462-11ggaqf1	524	5	by	by	IN
cord-014462-11ggaqf1	524	6	RT	RT	NNP
cord-014462-11ggaqf1	524	7	-	-	HYPH
cord-014462-11ggaqf1	524	8	qPCR	qPCR	NNP
cord-014462-11ggaqf1	524	9	and	and	CC
cord-014462-11ggaqf1	524	10	ranked	rank	VBD
cord-014462-11ggaqf1	524	11	according	accord	VBG
cord-014462-11ggaqf1	524	12	to	to	IN
cord-014462-11ggaqf1	524	13	the	the	DT
cord-014462-11ggaqf1	524	14	stability	stability	NN
cord-014462-11ggaqf1	524	15	of	of	IN
cord-014462-11ggaqf1	524	16	their	-PRON-	PRP$
cord-014462-11ggaqf1	524	17	expression	expression	NN
cord-014462-11ggaqf1	524	18	(	(	-LRB-
cord-014462-11ggaqf1	524	19	characteristics	characteristic	NNS
cord-014462-11ggaqf1	524	20	)	)	-RRB-
cord-014462-11ggaqf1	524	21	using	use	VBG
cord-014462-11ggaqf1	524	22	three	three	CD
cord-014462-11ggaqf1	524	23	different	different	JJ
cord-014462-11ggaqf1	524	24	methods	method	NNS
cord-014462-11ggaqf1	524	25	(	(	-LRB-
cord-014462-11ggaqf1	524	26	Two	two	CD
cord-014462-11ggaqf1	524	27	-	-	HYPH
cord-014462-11ggaqf1	524	28	way	way	NN
cord-014462-11ggaqf1	524	29	ANOVA	anova	NN
cord-014462-11ggaqf1	524	30	,	,	,
cord-014462-11ggaqf1	524	31	GeNorm	genorm	NN
cord-014462-11ggaqf1	524	32	and	and	CC
cord-014462-11ggaqf1	524	33	NormFinder	NormFinder	NNP
cord-014462-11ggaqf1	524	34	tools	tool	NNS
cord-014462-11ggaqf1	524	35	)	)	-RRB-
cord-014462-11ggaqf1	524	36	.	.	.
cord-014462-11ggaqf1	525	1	In	in	IN
cord-014462-11ggaqf1	525	2	most	most	JJS
cord-014462-11ggaqf1	525	3	cases	case	NNS
cord-014462-11ggaqf1	525	4	,	,	,
cord-014462-11ggaqf1	525	5	the	the	DT
cord-014462-11ggaqf1	525	6	expression	expression	NN
cord-014462-11ggaqf1	525	7	(	(	-LRB-
cord-014462-11ggaqf1	525	8	characteristics	characteristic	NNS
cord-014462-11ggaqf1	525	9	)	)	-RRB-
cord-014462-11ggaqf1	525	10	of	of	IN
cord-014462-11ggaqf1	525	11	all	all	DT
cord-014462-11ggaqf1	525	12	genes	gene	NNS
cord-014462-11ggaqf1	525	13	did	do	VBD
cord-014462-11ggaqf1	525	14	not	not	RB
cord-014462-11ggaqf1	525	15	depend	depend	VB
cord-014462-11ggaqf1	525	16	on	on	IN
cord-014462-11ggaqf1	525	17	the	the	DT
cord-014462-11ggaqf1	525	18	abiotic	abiotic	JJ
cord-014462-11ggaqf1	525	19	stress	stress	NN
cord-014462-11ggaqf1	525	20	conditions	condition	NNS
cord-014462-11ggaqf1	525	21	or	or	CC
cord-014462-11ggaqf1	525	22	on	on	IN
cord-014462-11ggaqf1	525	23	the	the	DT
cord-014462-11ggaqf1	525	24	virus	virus	NN
cord-014462-11ggaqf1	525	25	infections	infection	NNS
cord-014462-11ggaqf1	525	26	.	.	.
cord-014462-11ggaqf1	526	1	All	all	PDT
cord-014462-11ggaqf1	526	2	the	the	DT
cord-014462-11ggaqf1	526	3	genes	gene	NNS
cord-014462-11ggaqf1	526	4	showed	show	VBD
cord-014462-11ggaqf1	526	5	significant	significant	JJ
cord-014462-11ggaqf1	526	6	differences	difference	NNS
cord-014462-11ggaqf1	526	7	in	in	IN
cord-014462-11ggaqf1	526	8	expression	expression	NN
cord-014462-11ggaqf1	526	9	(	(	-LRB-
cord-014462-11ggaqf1	526	10	characteristics	characteristic	NNS
cord-014462-11ggaqf1	526	11	)	)	-RRB-
cord-014462-11ggaqf1	526	12	among	among	IN
cord-014462-11ggaqf1	526	13	plant	plant	NN
cord-014462-11ggaqf1	526	14	species	specie	NNS
cord-014462-11ggaqf1	526	15	.	.	.
cord-014462-11ggaqf1	527	1	Glyceraldehyde-3-phosphate	glyceraldehyde-3-phosphate	JJ
cord-014462-11ggaqf1	527	2	dehydrogenase	dehydrogenase	NN
cord-014462-11ggaqf1	527	3	(	(	-LRB-
cord-014462-11ggaqf1	527	4	GAPDH	GAPDH	NNP
cord-014462-11ggaqf1	527	5	)	)	-RRB-
cord-014462-11ggaqf1	527	6	,	,	,
cord-014462-11ggaqf1	527	7	Beta	beta	NN
cord-014462-11ggaqf1	527	8	-	-	HYPH
cord-014462-11ggaqf1	527	9	tubulin	tubulin	JJ
cord-014462-11ggaqf1	527	10	(	(	-LRB-
cord-014462-11ggaqf1	527	11	TUBB	TUBB	NNP
cord-014462-11ggaqf1	527	12	)	)	-RRB-
cord-014462-11ggaqf1	527	13	and	and	CC
cord-014462-11ggaqf1	527	14	18S	18S	NNP
cord-014462-11ggaqf1	527	15	ribosomal	ribosomal	NNP
cord-014462-11ggaqf1	527	16	RNA	RNA	NNP
cord-014462-11ggaqf1	527	17	(	(	-LRB-
cord-014462-11ggaqf1	527	18	18S	18S	NNP
cord-014462-11ggaqf1	527	19	rRNA	rRNA	NNP
cord-014462-11ggaqf1	527	20	)	)	-RRB-
cord-014462-11ggaqf1	527	21	always	always	RB
cord-014462-11ggaqf1	527	22	ranked	rank	VBD
cord-014462-11ggaqf1	527	23	as	as	IN
cord-014462-11ggaqf1	527	24	the	the	DT
cord-014462-11ggaqf1	527	25	three	three	CD
cord-014462-11ggaqf1	527	26	most	most	RBS
cord-014462-11ggaqf1	527	27	stable	stable	JJ
cord-014462-11ggaqf1	527	28	genes	gene	NNS
cord-014462-11ggaqf1	527	29	.	.	.
cord-014462-11ggaqf1	528	1	On	on	IN
cord-014462-11ggaqf1	528	2	the	the	DT
cord-014462-11ggaqf1	528	3	other	other	JJ
cord-014462-11ggaqf1	528	4	hand	hand	NN
cord-014462-11ggaqf1	528	5	,	,	,
cord-014462-11ggaqf1	528	6	Elongation	Elongation	NNP
cord-014462-11ggaqf1	528	7	factor-1	factor-1	NNP
cord-014462-11ggaqf1	528	8	alpha	alpha	NN
cord-014462-11ggaqf1	528	9	(	(	-LRB-
cord-014462-11ggaqf1	528	10	EF1A	EF1A	NNP
cord-014462-11ggaqf1	528	11	)	)	-RRB-
cord-014462-11ggaqf1	528	12	,	,	,
cord-014462-11ggaqf1	528	13	Eukaryotic	eukaryotic	JJ
cord-014462-11ggaqf1	528	14	initiation	initiation	NN
cord-014462-11ggaqf1	528	15	factor	factor	NN
cord-014462-11ggaqf1	528	16	4a	4a	CD
cord-014462-11ggaqf1	528	17	(	(	-LRB-
cord-014462-11ggaqf1	528	18	EIF4A	EIF4A	NNS
cord-014462-11ggaqf1	528	19	)	)	-RRB-
cord-014462-11ggaqf1	528	20	,	,	,
cord-014462-11ggaqf1	528	21	and	and	CC
cord-014462-11ggaqf1	528	22	28S	28S	NNP
cord-014462-11ggaqf1	528	23	ribosomal	ribosomal	NNP
cord-014462-11ggaqf1	528	24	RNA	RNA	NNP
cord-014462-11ggaqf1	528	25	(	(	-LRB-
cord-014462-11ggaqf1	528	26	28S	28S	NNP
cord-014462-11ggaqf1	528	27	rRNA	rRNA	NNP
cord-014462-11ggaqf1	528	28	)	)	-RRB-
cord-014462-11ggaqf1	528	29	for	for	IN
cord-014462-11ggaqf1	528	30	barley	barley	NN
cord-014462-11ggaqf1	528	31	and	and	CC
cord-014462-11ggaqf1	528	32	oat	oat	NN
cord-014462-11ggaqf1	528	33	samples	sample	NNS
cord-014462-11ggaqf1	528	34	;	;	:
cord-014462-11ggaqf1	528	35	and	and	CC
cord-014462-11ggaqf1	528	36	Beta	beta	NN
cord-014462-11ggaqf1	528	37	-	-	HYPH
cord-014462-11ggaqf1	528	38	tubulin	tubulin	JJ
cord-014462-11ggaqf1	528	39	(	(	-LRB-
cord-014462-11ggaqf1	528	40	TUBB	TUBB	NNP
cord-014462-11ggaqf1	528	41	)	)	-RRB-
cord-014462-11ggaqf1	528	42	for	for	IN
cord-014462-11ggaqf1	528	43	wheat	wheat	NN
cord-014462-11ggaqf1	528	44	samples	sample	NNS
cord-014462-11ggaqf1	528	45	were	be	VBD
cord-014462-11ggaqf1	528	46	consistently	consistently	RB
cord-014462-11ggaqf1	528	47	ranked	rank	VBN
cord-014462-11ggaqf1	528	48	as	as	IN
cord-014462-11ggaqf1	528	49	the	the	DT
cord-014462-11ggaqf1	528	50	less	less	RBR
cord-014462-11ggaqf1	528	51	reliable	reliable	JJ
cord-014462-11ggaqf1	528	52	controls	control	NNS
cord-014462-11ggaqf1	528	53	.	.	.
cord-014462-11ggaqf1	529	1	The	the	DT
cord-014462-11ggaqf1	529	2	BYDV	BYDV	NNP
cord-014462-11ggaqf1	529	3	titre	titre	NN
cord-014462-11ggaqf1	529	4	was	be	VBD
cord-014462-11ggaqf1	529	5	determined	determine	VBN
cord-014462-11ggaqf1	529	6	in	in	IN
cord-014462-11ggaqf1	529	7	two	two	CD
cord-014462-11ggaqf1	529	8	oat	oat	NN
cord-014462-11ggaqf1	529	9	varieties	variety	NNS
cord-014462-11ggaqf1	529	10	by	by	IN
cord-014462-11ggaqf1	529	11	RT	RT	NNP
cord-014462-11ggaqf1	529	12	-	-	HYPH
cord-014462-11ggaqf1	529	13	qPCR	qPCR	NNP
cord-014462-11ggaqf1	529	14	by	by	IN
cord-014462-11ggaqf1	529	15	three	three	CD
cord-014462-11ggaqf1	529	16	different	different	JJ
cord-014462-11ggaqf1	529	17	quantification	quantification	NN
cord-014462-11ggaqf1	529	18	approaches	approach	NNS
cord-014462-11ggaqf1	529	19	.	.	.
cord-014462-11ggaqf1	530	1	Statistically	statistically	RB
cord-014462-11ggaqf1	530	2	,	,	,
cord-014462-11ggaqf1	530	3	there	there	EX
cord-014462-11ggaqf1	530	4	were	be	VBD
cord-014462-11ggaqf1	530	5	no	no	DT
cord-014462-11ggaqf1	530	6	significant	significant	JJ
cord-014462-11ggaqf1	530	7	differences	difference	NNS
cord-014462-11ggaqf1	530	8	between	between	IN
cord-014462-11ggaqf1	530	9	the	the	DT
cord-014462-11ggaqf1	530	10	absolute	absolute	JJ
cord-014462-11ggaqf1	530	11	and	and	CC
cord-014462-11ggaqf1	530	12	the	the	DT
cord-014462-11ggaqf1	530	13	relative	relative	JJ
cord-014462-11ggaqf1	530	14	quantification	quantification	NN
cord-014462-11ggaqf1	530	15	,	,	,
cord-014462-11ggaqf1	530	16	or	or	CC
cord-014462-11ggaqf1	530	17	between	between	IN
cord-014462-11ggaqf1	530	18	quantification	quantification	NN
cord-014462-11ggaqf1	530	19	using	use	VBG
cord-014462-11ggaqf1	530	20	GAPDH	GAPDH	NNP
cord-014462-11ggaqf1	530	21	+	+	SYM
cord-014462-11ggaqf1	530	22	TUBB	TUBB	NNP
cord-014462-11ggaqf1	530	23	+	+	CC
cord-014462-11ggaqf1	530	24	TUBA	TUBA	NNP
cord-014462-11ggaqf1	530	25	+18S	+18S	NNP
cord-014462-11ggaqf1	530	26	rRNA	rRNA	NNP
cord-014462-11ggaqf1	530	27	and	and	CC
cord-014462-11ggaqf1	530	28	EF1A	EF1A	NNS
cord-014462-11ggaqf1	530	29	+	+	CC
cord-014462-11ggaqf1	531	1	EIF4A	EIF4A	NNS
cord-014462-11ggaqf1	531	2	+	+	CC
cord-014462-11ggaqf1	532	1	28S	28S	NNP
cord-014462-11ggaqf1	532	2	rRNA	rRNA	NNP
cord-014462-11ggaqf1	532	3	.	.	.
cord-014462-11ggaqf1	533	1	The	the	DT
cord-014462-11ggaqf1	533	2	geometric	geometric	JJ
cord-014462-11ggaqf1	533	3	average	average	NN
cord-014462-11ggaqf1	533	4	of	of	IN
cord-014462-11ggaqf1	533	5	GAPDH	GAPDH	NNP
cord-014462-11ggaqf1	533	6	,	,	,
cord-014462-11ggaqf1	533	7	18S	18S	NNP
cord-014462-11ggaqf1	533	8	rRNA	rrna	NN
cord-014462-11ggaqf1	533	9	,	,	,
cord-014462-11ggaqf1	533	10	TUBA	TUBA	NNP
cord-014462-11ggaqf1	533	11	and	and	CC
cord-014462-11ggaqf1	533	12	TUBB	TUBB	NNP
cord-014462-11ggaqf1	533	13	is	be	VBZ
cord-014462-11ggaqf1	533	14	suitable	suitable	JJ
cord-014462-11ggaqf1	533	15	for	for	IN
cord-014462-11ggaqf1	533	16	normalisation	normalisation	NN
cord-014462-11ggaqf1	533	17	of	of	IN
cord-014462-11ggaqf1	533	18	BYDV	BYDV	NNP
cord-014462-11ggaqf1	533	19	quantification	quantification	NN
cord-014462-11ggaqf1	533	20	in	in	IN
cord-014462-11ggaqf1	533	21	barley	barley	NN
cord-014462-11ggaqf1	533	22	and	and	CC
cord-014462-11ggaqf1	533	23	oat	oat	NN
cord-014462-11ggaqf1	533	24	tissues	tissue	NNS
cord-014462-11ggaqf1	533	25	.	.	.
cord-014462-11ggaqf1	534	1	For	for	IN
cord-014462-11ggaqf1	534	2	wheat	wheat	NN
cord-014462-11ggaqf1	534	3	samples	sample	NNS
cord-014462-11ggaqf1	534	4	,	,	,
cord-014462-11ggaqf1	534	5	a	a	DT
cord-014462-11ggaqf1	534	6	combination	combination	NN
cord-014462-11ggaqf1	534	7	of	of	IN
cord-014462-11ggaqf1	534	8	GAPDH	GAPDH	NNP
cord-014462-11ggaqf1	534	9	,	,	,
cord-014462-11ggaqf1	534	10	18S	18S	NNP
cord-014462-11ggaqf1	534	11	rRNA	rRNA	NNP
cord-014462-11ggaqf1	534	12	,	,	,
cord-014462-11ggaqf1	534	13	TUBB	TUBB	NNP
cord-014462-11ggaqf1	534	14	,	,	,
cord-014462-11ggaqf1	534	15	EIF4A	EIF4A	NNS
cord-014462-11ggaqf1	534	16	and	and	CC
cord-014462-11ggaqf1	534	17	E1FA	E1FA	NNP
cord-014462-11ggaqf1	534	18	is	be	VBZ
cord-014462-11ggaqf1	534	19	recommended	recommend	VBN
cord-014462-11ggaqf1	534	20	.	.	.
cord-014462-11ggaqf1	535	1	Department	Department	NNP
cord-014462-11ggaqf1	535	2	of	of	IN
cord-014462-11ggaqf1	535	3	Microbiology	Microbiology	NNP
cord-014462-11ggaqf1	535	4	,	,	,
cord-014462-11ggaqf1	535	5	Yogi	Yogi	NNP
cord-014462-11ggaqf1	535	6	Vemana	Vemana	NNP
cord-014462-11ggaqf1	535	7	University	University	NNP
cord-014462-11ggaqf1	535	8	,	,	,
cord-014462-11ggaqf1	535	9	Vemanapuram	Vemanapuram	NNP
cord-014462-11ggaqf1	535	10	,	,	,
cord-014462-11ggaqf1	535	11	Kadapa	Kadapa	NNP
cord-014462-11ggaqf1	535	12	516	516	CD
cord-014462-11ggaqf1	535	13	003	003	CD
cord-014462-11ggaqf1	536	1	Large	large	JJ
cord-014462-11ggaqf1	536	2	scale	scale	NN
cord-014462-11ggaqf1	536	3	production	production	NN
cord-014462-11ggaqf1	536	4	and	and	CC
cord-014462-11ggaqf1	536	5	import	import	NN
cord-014462-11ggaqf1	536	6	of	of	IN
cord-014462-11ggaqf1	536	7	propagative	propagative	JJ
cord-014462-11ggaqf1	536	8	material	material	NN
cord-014462-11ggaqf1	536	9	poses	pose	VBZ
cord-014462-11ggaqf1	536	10	potential	potential	JJ
cord-014462-11ggaqf1	536	11	risk	risk	NN
cord-014462-11ggaqf1	536	12	of	of	IN
cord-014462-11ggaqf1	536	13	introducing	introduce	VBG
cord-014462-11ggaqf1	536	14	several	several	JJ
cord-014462-11ggaqf1	536	15	destructive	destructive	JJ
cord-014462-11ggaqf1	536	16	pathogens	pathogen	NNS
cord-014462-11ggaqf1	536	17	particularly	particularly	RB
cord-014462-11ggaqf1	536	18	viruses	virus	NNS
cord-014462-11ggaqf1	536	19	and	and	CC
cord-014462-11ggaqf1	536	20	Mycoplasma	Mycoplasma	NNS
cord-014462-11ggaqf1	536	21	like	like	IN
cord-014462-11ggaqf1	536	22	organisms	organism	NNS
cord-014462-11ggaqf1	536	23	in	in	IN
cord-014462-11ggaqf1	536	24	our	-PRON-	PRP$
cord-014462-11ggaqf1	536	25	country	country	NN
cord-014462-11ggaqf1	536	26	.	.	.
cord-014462-11ggaqf1	537	1	This	this	DT
cord-014462-11ggaqf1	537	2	demands	demand	VBZ
cord-014462-11ggaqf1	537	3	adequate	adequate	JJ
cord-014462-11ggaqf1	537	4	quarantine	quarantine	NN
cord-014462-11ggaqf1	537	5	safe	safe	JJ
cord-014462-11ggaqf1	537	6	guards	guard	NNS
cord-014462-11ggaqf1	537	7	such	such	JJ
cord-014462-11ggaqf1	537	8	as	as	IN
cord-014462-11ggaqf1	537	9	growing	grow	VBG
cord-014462-11ggaqf1	537	10	them	-PRON-	PRP
cord-014462-11ggaqf1	537	11	under	under	IN
cord-014462-11ggaqf1	537	12	approved	approve	VBN
cord-014462-11ggaqf1	537	13	post	post	JJ
cord-014462-11ggaqf1	537	14	entry	entry	NN
cord-014462-11ggaqf1	537	15	quarantine	quarantine	NN
cord-014462-11ggaqf1	537	16	facility	facility	NN
cord-014462-11ggaqf1	537	17	for	for	IN
cord-014462-11ggaqf1	537	18	specific	specific	JJ
cord-014462-11ggaqf1	537	19	period	period	NN
cord-014462-11ggaqf1	537	20	so	so	IN
cord-014462-11ggaqf1	537	21	as	as	IN
cord-014462-11ggaqf1	537	22	to	to	TO
cord-014462-11ggaqf1	537	23	facilitate	facilitate	VB
cord-014462-11ggaqf1	537	24	virus	virus	NN
cord-014462-11ggaqf1	537	25	detection	detection	NN
cord-014462-11ggaqf1	537	26	,	,	,
cord-014462-11ggaqf1	537	27	thereby	thereby	RB
cord-014462-11ggaqf1	537	28	curtailing	curtail	VBG
cord-014462-11ggaqf1	537	29	risk	risk	NN
cord-014462-11ggaqf1	537	30	.	.	.
cord-014462-11ggaqf1	538	1	When	when	WRB
cord-014462-11ggaqf1	538	2	such	such	JJ
cord-014462-11ggaqf1	538	3	facilities	facility	NNS
cord-014462-11ggaqf1	538	4	are	be	VBP
cord-014462-11ggaqf1	538	5	coupled	couple	VBN
cord-014462-11ggaqf1	538	6	with	with	IN
cord-014462-11ggaqf1	538	7	propagation	propagation	NN
cord-014462-11ggaqf1	538	8	by	by	IN
cord-014462-11ggaqf1	538	9	tissue	tissue	NN
cord-014462-11ggaqf1	538	10	culture	culture	NN
cord-014462-11ggaqf1	538	11	will	will	MD
cord-014462-11ggaqf1	538	12	ensure	ensure	VB
cord-014462-11ggaqf1	538	13	virus	virus	NN
cord-014462-11ggaqf1	538	14	free	free	JJ
cord-014462-11ggaqf1	538	15	propagative	propagative	JJ
cord-014462-11ggaqf1	538	16	plant	plant	NN
cord-014462-11ggaqf1	538	17	material	material	NN
cord-014462-11ggaqf1	538	18	.	.	.
cord-014462-11ggaqf1	539	1	The	the	DT
cord-014462-11ggaqf1	539	2	requirement	requirement	NN
cord-014462-11ggaqf1	539	3	of	of	IN
cord-014462-11ggaqf1	539	4	nationwide	nationwide	JJ
cord-014462-11ggaqf1	539	5	network	network	NN
cord-014462-11ggaqf1	539	6	of	of	IN
cord-014462-11ggaqf1	539	7	post	post	NNP
cord-014462-11ggaqf1	539	8	entry	entry	NN
cord-014462-11ggaqf1	539	9	quarantine	quarantine	NN
cord-014462-11ggaqf1	539	10	facility	facility	NN
cord-014462-11ggaqf1	539	11	working	work	VBG
cord-014462-11ggaqf1	539	12	in	in	IN
cord-014462-11ggaqf1	539	13	close	close	JJ
cord-014462-11ggaqf1	539	14	collaboration	collaboration	NN
cord-014462-11ggaqf1	539	15	with	with	IN
cord-014462-11ggaqf1	539	16	crop	crop	NN
cord-014462-11ggaqf1	539	17	institutions	institution	NNS
cord-014462-11ggaqf1	539	18	are	be	VBP
cord-014462-11ggaqf1	539	19	very	very	RB
cord-014462-11ggaqf1	539	20	much	much	RB
cord-014462-11ggaqf1	539	21	emphasized	emphasize	VBN
cord-014462-11ggaqf1	539	22	for	for	IN
cord-014462-11ggaqf1	539	23	considering	consider	VBG
cord-014462-11ggaqf1	539	24	import	import	NN
cord-014462-11ggaqf1	539	25	of	of	IN
cord-014462-11ggaqf1	539	26	high	high	JJ
cord-014462-11ggaqf1	539	27	risk	risk	NN
cord-014462-11ggaqf1	539	28	plant	plant	NN
cord-014462-11ggaqf1	539	29	genera	genus	NNS
cord-014462-11ggaqf1	539	30	for	for	IN
cord-014462-11ggaqf1	539	31	agriculture	agriculture	NN
cord-014462-11ggaqf1	539	32	development	development	NN
cord-014462-11ggaqf1	539	33	.	.	.
cord-014462-11ggaqf1	540	1	Present	present	JJ
cord-014462-11ggaqf1	540	2	paper	paper	NN
cord-014462-11ggaqf1	540	3	discusses	discuss	VBZ
cord-014462-11ggaqf1	540	4	about	about	IN
cord-014462-11ggaqf1	540	5	virus	virus	NN
cord-014462-11ggaqf1	540	6	disease	disease	NN
cord-014462-11ggaqf1	540	7	of	of	IN
cord-014462-11ggaqf1	540	8	quarantine	quarantine	NN
cord-014462-11ggaqf1	540	9	importance	importance	NN
cord-014462-11ggaqf1	540	10	affecting	affect	VBG
cord-014462-11ggaqf1	540	11	ornamental	ornamental	JJ
cord-014462-11ggaqf1	540	12	and	and	CC
cord-014462-11ggaqf1	540	13	fruit	fruit	NN
cord-014462-11ggaqf1	540	14	plants	plant	NNS
cord-014462-11ggaqf1	540	15	such	such	JJ
cord-014462-11ggaqf1	540	16	as	as	IN
cord-014462-11ggaqf1	540	17	Chrysanthimum	Chrysanthimum	NNP
cord-014462-11ggaqf1	540	18	,	,	,
cord-014462-11ggaqf1	540	19	Dahlia	Dahlia	NNP
cord-014462-11ggaqf1	540	20	,	,	,
cord-014462-11ggaqf1	540	21	Dianthus	Dianthus	NNP
cord-014462-11ggaqf1	540	22	,	,	,
cord-014462-11ggaqf1	540	23	Rosabengalensis	Rosabengalensis	NNP
cord-014462-11ggaqf1	540	24	,	,	,
cord-014462-11ggaqf1	540	25	Cattleya	Cattleya	NNP
cord-014462-11ggaqf1	540	26	,	,	,
cord-014462-11ggaqf1	540	27	Cymbidium	Cymbidium	NNP
cord-014462-11ggaqf1	540	28	,	,	,
cord-014462-11ggaqf1	540	29	Dendrobium	Dendrobium	NNP
cord-014462-11ggaqf1	540	30	,	,	,
cord-014462-11ggaqf1	540	31	Lilium	Lilium	NNP
cord-014462-11ggaqf1	540	32	,	,	,
cord-014462-11ggaqf1	540	33	Citrus	Citrus	NNP
cord-014462-11ggaqf1	540	34	,	,	,
cord-014462-11ggaqf1	540	35	Vitis	Vitis	NNP
cord-014462-11ggaqf1	540	36	etc	etc	FW
cord-014462-11ggaqf1	540	37	.	.	.
cord-014462-11ggaqf1	541	1	The	the	DT
cord-014462-11ggaqf1	541	2	paper	paper	NN
cord-014462-11ggaqf1	541	3	also	also	RB
cord-014462-11ggaqf1	541	4	discusses	discuss	VBZ
cord-014462-11ggaqf1	541	5	on	on	IN
cord-014462-11ggaqf1	541	6	immunodiagnostic	immunodiagnostic	JJ
cord-014462-11ggaqf1	541	7	methods	method	NNS
cord-014462-11ggaqf1	541	8	of	of	IN
cord-014462-11ggaqf1	541	9	detection	detection	NN
cord-014462-11ggaqf1	541	10	and	and	CC
cord-014462-11ggaqf1	541	11	methods	method	NNS
cord-014462-11ggaqf1	541	12	of	of	IN
cord-014462-11ggaqf1	541	13	obtaining	obtain	VBG
cord-014462-11ggaqf1	541	14	virus	virus	NN
cord-014462-11ggaqf1	541	15	free	free	JJ
cord-014462-11ggaqf1	541	16	propagative	propagative	JJ
cord-014462-11ggaqf1	541	17	material	material	NN
cord-014462-11ggaqf1	541	18	.	.	.
cord-014462-11ggaqf1	542	1	Rice	Rice	NNP
cord-014462-11ggaqf1	542	2	tungro	tungro	NNS
cord-014462-11ggaqf1	542	3	occurs	occur	VBZ
cord-014462-11ggaqf1	542	4	as	as	IN
cord-014462-11ggaqf1	542	5	epidemics	epidemic	NNS
cord-014462-11ggaqf1	542	6	in	in	IN
cord-014462-11ggaqf1	542	7	regular	regular	JJ
cord-014462-11ggaqf1	542	8	cycles	cycle	NNS
cord-014462-11ggaqf1	542	9	and	and	CC
cord-014462-11ggaqf1	542	10	has	have	VBZ
cord-014462-11ggaqf1	542	11	been	be	VBN
cord-014462-11ggaqf1	542	12	reported	report	VBN
cord-014462-11ggaqf1	542	13	in	in	IN
cord-014462-11ggaqf1	542	14	the	the	DT
cord-014462-11ggaqf1	542	15	last	last	JJ
cord-014462-11ggaqf1	542	16	50	50	CD
cord-014462-11ggaqf1	542	17	years	year	NNS
cord-014462-11ggaqf1	542	18	from	from	IN
cord-014462-11ggaqf1	542	19	all	all	PDT
cord-014462-11ggaqf1	542	20	the	the	DT
cord-014462-11ggaqf1	542	21	major	major	JJ
cord-014462-11ggaqf1	542	22	rice	rice	NN
cord-014462-11ggaqf1	542	23	growing	grow	VBG
cord-014462-11ggaqf1	542	24	regions	region	NNS
cord-014462-11ggaqf1	542	25	of	of	IN
cord-014462-11ggaqf1	542	26	India	India	NNP
cord-014462-11ggaqf1	542	27	,	,	,
cord-014462-11ggaqf1	542	28	especially	especially	RB
cord-014462-11ggaqf1	542	29	prevalent	prevalent	JJ
cord-014462-11ggaqf1	542	30	in	in	IN
cord-014462-11ggaqf1	542	31	the	the	DT
cord-014462-11ggaqf1	542	32	southern	southern	JJ
cord-014462-11ggaqf1	542	33	and	and	CC
cord-014462-11ggaqf1	542	34	eastern	eastern	JJ
cord-014462-11ggaqf1	542	35	states	state	NNS
cord-014462-11ggaqf1	542	36	.	.	.
cord-014462-11ggaqf1	543	1	Development	development	NN
cord-014462-11ggaqf1	543	2	of	of	IN
cord-014462-11ggaqf1	543	3	the	the	DT
cord-014462-11ggaqf1	543	4	durable	durable	JJ
cord-014462-11ggaqf1	543	5	resistant	resistant	JJ
cord-014462-11ggaqf1	543	6	varieties	variety	NNS
cord-014462-11ggaqf1	543	7	to	to	IN
cord-014462-11ggaqf1	543	8	tungro	tungro	NNP
cord-014462-11ggaqf1	543	9	is	be	VBZ
cord-014462-11ggaqf1	543	10	crucial	crucial	JJ
cord-014462-11ggaqf1	543	11	for	for	IN
cord-014462-11ggaqf1	543	12	the	the	DT
cord-014462-11ggaqf1	543	13	management	management	NN
cord-014462-11ggaqf1	543	14	of	of	IN
cord-014462-11ggaqf1	543	15	the	the	DT
cord-014462-11ggaqf1	543	16	disease	disease	NN
cord-014462-11ggaqf1	543	17	.	.	.
cord-014462-11ggaqf1	544	1	Molecular	molecular	JJ
cord-014462-11ggaqf1	544	2	breeding	breeding	NN
cord-014462-11ggaqf1	544	3	,	,	,
cord-014462-11ggaqf1	544	4	involving	involve	VBG
cord-014462-11ggaqf1	544	5	the	the	DT
cord-014462-11ggaqf1	544	6	use	use	NN
cord-014462-11ggaqf1	544	7	of	of	IN
cord-014462-11ggaqf1	544	8	DNA	dna	NN
cord-014462-11ggaqf1	544	9	markers	marker	NNS
cord-014462-11ggaqf1	544	10	linked	link	VBN
cord-014462-11ggaqf1	544	11	to	to	IN
cord-014462-11ggaqf1	544	12	the	the	DT
cord-014462-11ggaqf1	544	13	resistant	resistant	JJ
cord-014462-11ggaqf1	544	14	gene(s	gene(s	NNP
cord-014462-11ggaqf1	544	15	)	)	-RRB-
cord-014462-11ggaqf1	544	16	for	for	IN
cord-014462-11ggaqf1	544	17	selection	selection	NN
cord-014462-11ggaqf1	544	18	,	,	,
cord-014462-11ggaqf1	544	19	can	can	MD
cord-014462-11ggaqf1	544	20	overcome	overcome	VB
cord-014462-11ggaqf1	544	21	the	the	DT
cord-014462-11ggaqf1	544	22	difficulties	difficulty	NNS
cord-014462-11ggaqf1	544	23	encountered	encounter	VBN
cord-014462-11ggaqf1	544	24	in	in	IN
cord-014462-11ggaqf1	544	25	conventional	conventional	JJ
cord-014462-11ggaqf1	544	26	resistant	resistant	JJ
cord-014462-11ggaqf1	544	27	breeding	breeding	NN
cord-014462-11ggaqf1	544	28	programs	program	NNS
cord-014462-11ggaqf1	544	29	.	.	.
cord-014462-11ggaqf1	545	1	For	for	IN
cord-014462-11ggaqf1	545	2	successful	successful	JJ
cord-014462-11ggaqf1	545	3	marker	marker	NN
cord-014462-11ggaqf1	545	4	-	-	HYPH
cord-014462-11ggaqf1	545	5	assisted	assist	VBN
cord-014462-11ggaqf1	545	6	selection	selection	NN
cord-014462-11ggaqf1	545	7	(	(	-LRB-
cord-014462-11ggaqf1	545	8	MAS	MAS	NNP
cord-014462-11ggaqf1	545	9	)	)	-RRB-
cord-014462-11ggaqf1	545	10	,	,	,
cord-014462-11ggaqf1	545	11	the	the	DT
cord-014462-11ggaqf1	545	12	identification	identification	NN
cord-014462-11ggaqf1	545	13	of	of	IN
cord-014462-11ggaqf1	545	14	closely	closely	RB
cord-014462-11ggaqf1	545	15	linked	link	VBN
cord-014462-11ggaqf1	545	16	markers	marker	NNS
cord-014462-11ggaqf1	545	17	through	through	IN
cord-014462-11ggaqf1	545	18	the	the	DT
cord-014462-11ggaqf1	545	19	process	process	NN
cord-014462-11ggaqf1	545	20	of	of	IN
cord-014462-11ggaqf1	545	21	gene	gene	NN
cord-014462-11ggaqf1	545	22	tagging	tagging	NN
cord-014462-11ggaqf1	545	23	and	and	CC
cord-014462-11ggaqf1	545	24	mapping	mapping	NN
cord-014462-11ggaqf1	545	25	is	be	VBZ
cord-014462-11ggaqf1	545	26	a	a	DT
cord-014462-11ggaqf1	545	27	prerequisite	prerequisite	NN
cord-014462-11ggaqf1	545	28	.	.	.
cord-014462-11ggaqf1	546	1	Attempts	attempt	NNS
cord-014462-11ggaqf1	546	2	have	have	VBP
cord-014462-11ggaqf1	546	3	been	be	VBN
cord-014462-11ggaqf1	546	4	initiated	initiate	VBN
cord-014462-11ggaqf1	546	5	for	for	IN
cord-014462-11ggaqf1	546	6	identification	identification	NN
cord-014462-11ggaqf1	546	7	of	of	IN
cord-014462-11ggaqf1	546	8	tungro	tungro	JJ
cord-014462-11ggaqf1	546	9	resistance	resistance	NN
cord-014462-11ggaqf1	546	10	genes	gene	NNS
cord-014462-11ggaqf1	546	11	through	through	IN
cord-014462-11ggaqf1	546	12	molecular	molecular	JJ
cord-014462-11ggaqf1	546	13	mapping	mapping	NN
cord-014462-11ggaqf1	546	14	and	and	CC
cord-014462-11ggaqf1	546	15	their	-PRON-	PRP$
cord-014462-11ggaqf1	546	16	introgression	introgression	NN
cord-014462-11ggaqf1	546	17	into	into	IN
cord-014462-11ggaqf1	546	18	the	the	DT
cord-014462-11ggaqf1	546	19	target	target	NN
cord-014462-11ggaqf1	546	20	varieties	variety	NNS
cord-014462-11ggaqf1	546	21	using	use	VBG
cord-014462-11ggaqf1	546	22	marker	marker	NN
cord-014462-11ggaqf1	546	23	-	-	HYPH
cord-014462-11ggaqf1	546	24	assisted	assist	VBN
cord-014462-11ggaqf1	546	25	selection	selection	NN
cord-014462-11ggaqf1	546	26	at	at	IN
cord-014462-11ggaqf1	546	27	DRR	DRR	NNP
cord-014462-11ggaqf1	546	28	,	,	,
cord-014462-11ggaqf1	546	29	Hyderabad	Hyderabad	NNP
cord-014462-11ggaqf1	546	30	.	.	.
cord-014462-11ggaqf1	547	1	The	the	DT
cord-014462-11ggaqf1	547	2	inheritance	inheritance	NN
cord-014462-11ggaqf1	547	3	of	of	IN
cord-014462-11ggaqf1	547	4	resistance	resistance	NN
cord-014462-11ggaqf1	547	5	to	to	IN
cord-014462-11ggaqf1	547	6	rice	rice	NN
cord-014462-11ggaqf1	547	7	tungro	tungro	NNP
cord-014462-11ggaqf1	547	8	virus	virus	NN
cord-014462-11ggaqf1	547	9	disease	disease	NN
cord-014462-11ggaqf1	547	10	was	be	VBD
cord-014462-11ggaqf1	547	11	studied	study	VBN
cord-014462-11ggaqf1	547	12	in	in	IN
cord-014462-11ggaqf1	547	13	seven	seven	CD
cord-014462-11ggaqf1	547	14	resistant	resistant	JJ
cord-014462-11ggaqf1	547	15	rice	rice	NN
cord-014462-11ggaqf1	547	16	cultivars	cultivar	NNS
cord-014462-11ggaqf1	547	17	with	with	IN
cord-014462-11ggaqf1	547	18	field	field	NN
cord-014462-11ggaqf1	547	19	evaluation	evaluation	NN
cord-014462-11ggaqf1	547	20	at	at	IN
cord-014462-11ggaqf1	547	21	hot	hot	JJ
cord-014462-11ggaqf1	547	22	spot	spot	NN
cord-014462-11ggaqf1	547	23	locations	location	NNS
cord-014462-11ggaqf1	547	24	.	.	.
cord-014462-11ggaqf1	548	1	The	the	DT
cord-014462-11ggaqf1	548	2	microsatellite	microsatellite	JJ
cord-014462-11ggaqf1	548	3	markers	marker	NNS
cord-014462-11ggaqf1	548	4	linked	link	VBN
cord-014462-11ggaqf1	548	5	to	to	IN
cord-014462-11ggaqf1	548	6	rice	rice	NN
cord-014462-11ggaqf1	548	7	tungro	tungro	NNP
cord-014462-11ggaqf1	548	8	resistance	resistance	NN
cord-014462-11ggaqf1	548	9	in	in	IN
cord-014462-11ggaqf1	548	10	Utri	Utri	NNP
cord-014462-11ggaqf1	548	11	Merah	Merah	NNP
cord-014462-11ggaqf1	548	12	was	be	VBD
cord-014462-11ggaqf1	548	13	studied	study	VBN
cord-014462-11ggaqf1	548	14	and	and	CC
cord-014462-11ggaqf1	548	15	found	find	VBD
cord-014462-11ggaqf1	548	16	that	that	IN
cord-014462-11ggaqf1	548	17	resistance	resistance	NN
cord-014462-11ggaqf1	548	18	genes	gene	NNS
cord-014462-11ggaqf1	548	19	were	be	VBD
cord-014462-11ggaqf1	548	20	linked	link	VBN
cord-014462-11ggaqf1	548	21	to	to	IN
cord-014462-11ggaqf1	548	22	RM	RM	NNP
cord-014462-11ggaqf1	548	23	336	336	CD
cord-014462-11ggaqf1	548	24	on	on	IN
cord-014462-11ggaqf1	548	25	chromosome	chromosome	NN
cord-014462-11ggaqf1	548	26	7	7	CD
cord-014462-11ggaqf1	548	27	.	.	.
cord-014462-11ggaqf1	549	1	Through	through	IN
cord-014462-11ggaqf1	549	2	molecular	molecular	JJ
cord-014462-11ggaqf1	549	3	mapping	mapping	NN
cord-014462-11ggaqf1	549	4	two	two	CD
cord-014462-11ggaqf1	549	5	QTL	QTL	NNP
cord-014462-11ggaqf1	549	6	were	be	VBD
cord-014462-11ggaqf1	549	7	identified	identify	VBN
cord-014462-11ggaqf1	549	8	controlling	control	VBG
cord-014462-11ggaqf1	549	9	RTV	RTV	NNP
cord-014462-11ggaqf1	549	10	resistance	resistance	NN
cord-014462-11ggaqf1	549	11	on	on	IN
cord-014462-11ggaqf1	549	12	chromosomes	chromosome	NNS
cord-014462-11ggaqf1	549	13	7	7	CD
cord-014462-11ggaqf1	549	14	and	and	CC
cord-014462-11ggaqf1	549	15	2	2	CD
cord-014462-11ggaqf1	549	16	in	in	IN
cord-014462-11ggaqf1	549	17	'	'	``
cord-014462-11ggaqf1	549	18	Utri	Utri	NNP
cord-014462-11ggaqf1	549	19	Rajapan	Rajapan	NNP
cord-014462-11ggaqf1	549	20	'	'	POS
cord-014462-11ggaqf1	549	21	explaining	explain	VBG
cord-014462-11ggaqf1	549	22	40.8	40.8	CD
cord-014462-11ggaqf1	549	23	%	%	NN
cord-014462-11ggaqf1	549	24	and	and	CC
cord-014462-11ggaqf1	549	25	21.6	21.6	CD
cord-014462-11ggaqf1	549	26	%	%	NN
cord-014462-11ggaqf1	549	27	of	of	IN
cord-014462-11ggaqf1	549	28	the	the	DT
cord-014462-11ggaqf1	549	29	phenotypic	phenotypic	JJ
cord-014462-11ggaqf1	549	30	variance	variance	NN
cord-014462-11ggaqf1	549	31	.	.	.
cord-014462-11ggaqf1	550	1	In	in	IN
cord-014462-11ggaqf1	550	2	variety	variety	NN
cord-014462-11ggaqf1	550	3	'	'	``
cord-014462-11ggaqf1	550	4	Vikramarya	Vikramarya	NNP
cord-014462-11ggaqf1	550	5	'	'	''
cord-014462-11ggaqf1	550	6	,	,	,
cord-014462-11ggaqf1	550	7	another	another	DT
cord-014462-11ggaqf1	550	8	two	two	CD
cord-014462-11ggaqf1	550	9	QTL	QTL	NNP
cord-014462-11ggaqf1	550	10	for	for	IN
cord-014462-11ggaqf1	550	11	RTV	RTV	NNP
cord-014462-11ggaqf1	550	12	resistance	resistance	NN
cord-014462-11ggaqf1	550	13	were	be	VBD
cord-014462-11ggaqf1	550	14	detected	detect	VBN
cord-014462-11ggaqf1	550	15	on	on	IN
cord-014462-11ggaqf1	550	16	chromosomes	chromosome	NNS
cord-014462-11ggaqf1	550	17	7	7	CD
cord-014462-11ggaqf1	550	18	and	and	CC
cord-014462-11ggaqf1	550	19	1	1	CD
cord-014462-11ggaqf1	550	20	explaining	explain	VBG
cord-014462-11ggaqf1	550	21	18.7	18.7	CD
cord-014462-11ggaqf1	550	22	%	%	NN
cord-014462-11ggaqf1	550	23	and	and	CC
cord-014462-11ggaqf1	550	24	16.4	16.4	CD
cord-014462-11ggaqf1	550	25	%	%	NN
cord-014462-11ggaqf1	550	26	of	of	IN
cord-014462-11ggaqf1	550	27	the	the	DT
cord-014462-11ggaqf1	550	28	phenotypic	phenotypic	JJ
cord-014462-11ggaqf1	550	29	variance	variance	NN
cord-014462-11ggaqf1	550	30	.	.	.
cord-014462-11ggaqf1	551	1	The	the	DT
cord-014462-11ggaqf1	551	2	closely	closely	RB
cord-014462-11ggaqf1	551	3	linked	link	VBN
cord-014462-11ggaqf1	551	4	markers	marker	NNS
cord-014462-11ggaqf1	551	5	identified	identify	VBN
cord-014462-11ggaqf1	551	6	in	in	IN
cord-014462-11ggaqf1	551	7	this	this	DT
cord-014462-11ggaqf1	551	8	study	study	NN
cord-014462-11ggaqf1	551	9	flanking	flank	VBG
cord-014462-11ggaqf1	551	10	the	the	DT
cord-014462-11ggaqf1	551	11	gene	gene	NN
cord-014462-11ggaqf1	551	12	of	of	IN
cord-014462-11ggaqf1	551	13	interest	interest	NN
cord-014462-11ggaqf1	551	14	through	through	IN
cord-014462-11ggaqf1	551	15	mapping	mapping	NN
cord-014462-11ggaqf1	551	16	will	will	MD
cord-014462-11ggaqf1	551	17	improve	improve	VB
cord-014462-11ggaqf1	551	18	the	the	DT
cord-014462-11ggaqf1	551	19	efficiency	efficiency	NN
cord-014462-11ggaqf1	551	20	and	and	CC
cord-014462-11ggaqf1	551	21	precision	precision	NN
cord-014462-11ggaqf1	551	22	of	of	IN
cord-014462-11ggaqf1	551	23	introgression	introgression	NN
cord-014462-11ggaqf1	551	24	programs	program	NNS
cord-014462-11ggaqf1	551	25	in	in	IN
cord-014462-11ggaqf1	551	26	marker	marker	NN
cord-014462-11ggaqf1	551	27	assisted	assist	VBN
cord-014462-11ggaqf1	551	28	breeding	breeding	NN
cord-014462-11ggaqf1	551	29	for	for	IN
cord-014462-11ggaqf1	551	30	RTV	RTV	NNP
cord-014462-11ggaqf1	551	31	resistance	resistance	NN
cord-014462-11ggaqf1	551	32	.	.	.
cord-014462-11ggaqf1	552	1	Functional	functional	JJ
cord-014462-11ggaqf1	552	2	characterization	characterization	NN
cord-014462-11ggaqf1	552	3	of	of	IN
cord-014462-11ggaqf1	552	4	these	these	DT
cord-014462-11ggaqf1	552	5	QTL	QTL	NNP
cord-014462-11ggaqf1	552	6	for	for	IN
cord-014462-11ggaqf1	552	7	RTV	RTV	NNP
cord-014462-11ggaqf1	552	8	resistance	resistance	NN
cord-014462-11ggaqf1	552	9	is	be	VBZ
cord-014462-11ggaqf1	552	10	under	under	IN
cord-014462-11ggaqf1	552	11	progress	progress	NN
cord-014462-11ggaqf1	552	12	.	.	.
cord-014462-11ggaqf1	553	1	There	there	EX
cord-014462-11ggaqf1	553	2	is	be	VBZ
cord-014462-11ggaqf1	553	3	only	only	RB
cord-014462-11ggaqf1	553	4	a	a	DT
cord-014462-11ggaqf1	553	5	limited	limited	JJ
cord-014462-11ggaqf1	553	6	pool	pool	NN
cord-014462-11ggaqf1	553	7	of	of	IN
cord-014462-11ggaqf1	553	8	natural	natural	JJ
cord-014462-11ggaqf1	553	9	virus	virus	NN
cord-014462-11ggaqf1	553	10	resistance	resistance	NN
cord-014462-11ggaqf1	553	11	in	in	IN
cord-014462-11ggaqf1	553	12	Cassava	Cassava	NNP
cord-014462-11ggaqf1	553	13	against	against	IN
cord-014462-11ggaqf1	553	14	cassava	cassava	NN
cord-014462-11ggaqf1	553	15	mosaic	mosaic	NN
cord-014462-11ggaqf1	553	16	geminiviruses	geminiviruse	NNS
cord-014462-11ggaqf1	553	17	and	and	CC
cord-014462-11ggaqf1	553	18	cassava	cassava	NN
cord-014462-11ggaqf1	553	19	brown	brown	JJ
cord-014462-11ggaqf1	553	20	streak	streak	NN
cord-014462-11ggaqf1	554	1	Ipomovirus	Ipomovirus	NNP
cord-014462-11ggaqf1	555	1	hence	hence	RB
cord-014462-11ggaqf1	555	2	the	the	DT
cord-014462-11ggaqf1	555	3	development	development	NN
cord-014462-11ggaqf1	555	4	of	of	IN
cord-014462-11ggaqf1	555	5	transgenic	transgenic	JJ
cord-014462-11ggaqf1	555	6	resistance	resistance	NN
cord-014462-11ggaqf1	555	7	in	in	IN
cord-014462-11ggaqf1	555	8	this	this	DT
cord-014462-11ggaqf1	555	9	significant	significant	JJ
cord-014462-11ggaqf1	555	10	crop	crop	NN
cord-014462-11ggaqf1	555	11	might	may	MD
cord-014462-11ggaqf1	555	12	present	present	VB
cord-014462-11ggaqf1	555	13	an	an	DT
cord-014462-11ggaqf1	555	14	option	option	NN
cord-014462-11ggaqf1	555	15	.	.	.
cord-014462-11ggaqf1	556	1	RNA	RNA	NNP
cord-014462-11ggaqf1	556	2	mediated	mediate	VBN
cord-014462-11ggaqf1	556	3	resistance	resistance	NN
cord-014462-11ggaqf1	556	4	through	through	IN
cord-014462-11ggaqf1	556	5	the	the	DT
cord-014462-11ggaqf1	556	6	expression	expression	NN
cord-014462-11ggaqf1	556	7	of	of	IN
cord-014462-11ggaqf1	556	8	inverted	inverted	JJ
cord-014462-11ggaqf1	556	9	-	-	HYPH
cord-014462-11ggaqf1	556	10	repeat	repeat	NN
cord-014462-11ggaqf1	556	11	dsRNA	dsrna	NN
cord-014462-11ggaqf1	556	12	sequences	sequence	NNS
cord-014462-11ggaqf1	556	13	derived	derive	VBN
cord-014462-11ggaqf1	556	14	from	from	IN
cord-014462-11ggaqf1	556	15	the	the	DT
cord-014462-11ggaqf1	556	16	virus	virus	NN
cord-014462-11ggaqf1	556	17	genome	genome	NN
cord-014462-11ggaqf1	556	18	and	and	CC
cord-014462-11ggaqf1	556	19	the	the	DT
cord-014462-11ggaqf1	556	20	modification	modification	NN
cord-014462-11ggaqf1	556	21	of	of	IN
cord-014462-11ggaqf1	556	22	plant	plant	NN
cord-014462-11ggaqf1	556	23	microRNA	microRNA	NNP
cord-014462-11ggaqf1	556	24	to	to	TO
cord-014462-11ggaqf1	556	25	produce	produce	VB
cord-014462-11ggaqf1	556	26	antiviral	antiviral	JJ
cord-014462-11ggaqf1	556	27	artificial	artificial	JJ
cord-014462-11ggaqf1	556	28	microRNA	microRNA	NNP
cord-014462-11ggaqf1	557	1	are	be	VBP
cord-014462-11ggaqf1	557	2	strategies	strategy	NNS
cord-014462-11ggaqf1	557	3	that	that	WDT
cord-014462-11ggaqf1	557	4	have	have	VBP
cord-014462-11ggaqf1	557	5	recently	recently	RB
cord-014462-11ggaqf1	557	6	been	be	VBN
cord-014462-11ggaqf1	557	7	proven	prove	VBN
cord-014462-11ggaqf1	557	8	very	very	RB
cord-014462-11ggaqf1	557	9	effective	effective	JJ
cord-014462-11ggaqf1	557	10	for	for	IN
cord-014462-11ggaqf1	557	11	induction	induction	NN
cord-014462-11ggaqf1	557	12	of	of	IN
cord-014462-11ggaqf1	557	13	virus	virus	NN
cord-014462-11ggaqf1	557	14	resistance	resistance	NN
cord-014462-11ggaqf1	557	15	(	(	-LRB-
cord-014462-11ggaqf1	557	16	immunity	immunity	NN
cord-014462-11ggaqf1	557	17	)	)	-RRB-
cord-014462-11ggaqf1	557	18	against	against	IN
cord-014462-11ggaqf1	557	19	a	a	DT
cord-014462-11ggaqf1	557	20	number	number	NN
cord-014462-11ggaqf1	557	21	of	of	IN
cord-014462-11ggaqf1	557	22	RNA	RNA	NNP
cord-014462-11ggaqf1	557	23	viruses	virus	NNS
cord-014462-11ggaqf1	557	24	.	.	.
cord-014462-11ggaqf1	558	1	Results	result	NNS
cord-014462-11ggaqf1	558	2	from	from	IN
cord-014462-11ggaqf1	558	3	RNA	RNA	NNP
cord-014462-11ggaqf1	558	4	interference	interference	NN
cord-014462-11ggaqf1	558	5	strategies	strategy	NNS
cord-014462-11ggaqf1	558	6	against	against	IN
cord-014462-11ggaqf1	558	7	geminiviruses	geminiviruse	NNS
cord-014462-11ggaqf1	558	8	never	never	RB
cord-014462-11ggaqf1	558	9	resulted	result	VBD
cord-014462-11ggaqf1	558	10	in	in	IN
cord-014462-11ggaqf1	558	11	immunity	immunity	NN
cord-014462-11ggaqf1	558	12	of	of	IN
cord-014462-11ggaqf1	558	13	transgenes	transgene	NNS
cord-014462-11ggaqf1	558	14	.	.	.
cord-014462-11ggaqf1	559	1	However	however	RB
cord-014462-11ggaqf1	559	2	,	,	,
cord-014462-11ggaqf1	559	3	it	-PRON-	PRP
cord-014462-11ggaqf1	559	4	suggest	suggest	VBP
cord-014462-11ggaqf1	559	5	that	that	IN
cord-014462-11ggaqf1	559	6	viral	viral	JJ
cord-014462-11ggaqf1	559	7	mRNA	mrna	NN
cord-014462-11ggaqf1	559	8	are	be	VBP
cord-014462-11ggaqf1	559	9	targets	target	NNS
cord-014462-11ggaqf1	559	10	of	of	IN
cord-014462-11ggaqf1	559	11	RNA	RNA	NNP
cord-014462-11ggaqf1	559	12	silencing	silencing	NN
cord-014462-11ggaqf1	559	13	and	and	CC
cord-014462-11ggaqf1	559	14	that	that	IN
cord-014462-11ggaqf1	559	15	the	the	DT
cord-014462-11ggaqf1	559	16	success	success	NN
cord-014462-11ggaqf1	559	17	of	of	IN
cord-014462-11ggaqf1	559	18	the	the	DT
cord-014462-11ggaqf1	559	19	strategy	strategy	NN
cord-014462-11ggaqf1	559	20	depends	depend	VBZ
cord-014462-11ggaqf1	559	21	on	on	IN
cord-014462-11ggaqf1	559	22	the	the	DT
cord-014462-11ggaqf1	559	23	relevance	relevance	NN
cord-014462-11ggaqf1	559	24	of	of	IN
cord-014462-11ggaqf1	559	25	the	the	DT
cord-014462-11ggaqf1	559	26	target	target	NN
cord-014462-11ggaqf1	559	27	gene	gene	NN
cord-014462-11ggaqf1	559	28	in	in	IN
cord-014462-11ggaqf1	559	29	the	the	DT
cord-014462-11ggaqf1	559	30	systemic	systemic	JJ
cord-014462-11ggaqf1	559	31	spread	spread	NN
cord-014462-11ggaqf1	559	32	of	of	IN
cord-014462-11ggaqf1	559	33	the	the	DT
cord-014462-11ggaqf1	559	34	virus	virus	NN
cord-014462-11ggaqf1	559	35	.	.	.
cord-014462-11ggaqf1	560	1	We	-PRON-	PRP
cord-014462-11ggaqf1	560	2	have	have	VBP
cord-014462-11ggaqf1	560	3	generated	generate	VBN
cord-014462-11ggaqf1	560	4	a	a	DT
cord-014462-11ggaqf1	560	5	number	number	NN
cord-014462-11ggaqf1	560	6	of	of	IN
cord-014462-11ggaqf1	560	7	RNA	RNA	NNP
cord-014462-11ggaqf1	560	8	silencing	silencing	NN
cord-014462-11ggaqf1	560	9	constructs	construct	NNS
cord-014462-11ggaqf1	560	10	to	to	TO
cord-014462-11ggaqf1	560	11	induce	induce	VB
cord-014462-11ggaqf1	560	12	resistance	resistance	NN
cord-014462-11ggaqf1	560	13	against	against	IN
cord-014462-11ggaqf1	560	14	CBSV	CBSV	NNP
cord-014462-11ggaqf1	560	15	and	and	CC
cord-014462-11ggaqf1	560	16	the	the	DT
cord-014462-11ggaqf1	560	17	Indian	indian	JJ
cord-014462-11ggaqf1	560	18	cassava	cassava	NN
cord-014462-11ggaqf1	560	19	mosaic	mosaic	NN
cord-014462-11ggaqf1	560	20	viruses	virus	NNS
cord-014462-11ggaqf1	560	21	ICMV	ICMV	NNP
cord-014462-11ggaqf1	560	22	and	and	CC
cord-014462-11ggaqf1	560	23	SLCMV	SLCMV	NNP
cord-014462-11ggaqf1	560	24	.	.	.
cord-014462-11ggaqf1	561	1	Due	due	IN
cord-014462-11ggaqf1	561	2	to	to	IN
cord-014462-11ggaqf1	561	3	the	the	DT
cord-014462-11ggaqf1	561	4	serious	serious	JJ
cord-014462-11ggaqf1	561	5	problems	problem	NNS
cord-014462-11ggaqf1	561	6	inherent	inherent	JJ
cord-014462-11ggaqf1	561	7	with	with	IN
cord-014462-11ggaqf1	561	8	transformation	transformation	NN
cord-014462-11ggaqf1	561	9	of	of	IN
cord-014462-11ggaqf1	561	10	cassava	cassava	NN
cord-014462-11ggaqf1	561	11	and	and	CC
cord-014462-11ggaqf1	561	12	subsequent	subsequent	JJ
cord-014462-11ggaqf1	561	13	resistance	resistance	NN
cord-014462-11ggaqf1	561	14	screening	screening	NN
cord-014462-11ggaqf1	561	15	,	,	,
cord-014462-11ggaqf1	561	16	these	these	DT
cord-014462-11ggaqf1	561	17	constructs	construct	NNS
cord-014462-11ggaqf1	561	18	were	be	VBD
cord-014462-11ggaqf1	561	19	tested	test	VBN
cord-014462-11ggaqf1	561	20	for	for	IN
cord-014462-11ggaqf1	561	21	efficiency	efficiency	NN
cord-014462-11ggaqf1	561	22	either	either	CC
cord-014462-11ggaqf1	561	23	by	by	IN
cord-014462-11ggaqf1	561	24	transient	transient	JJ
cord-014462-11ggaqf1	561	25	-	-	:
cord-014462-11ggaqf1	561	26	or	or	CC
cord-014462-11ggaqf1	561	27	by	by	IN
cord-014462-11ggaqf1	561	28	transgenic	transgenic	JJ
cord-014462-11ggaqf1	561	29	expression	expression	NN
cord-014462-11ggaqf1	561	30	in	in	IN
cord-014462-11ggaqf1	561	31	N.	N.	NNP
cord-014462-11ggaqf1	561	32	benthamiana	benthamiana	NNP
cord-014462-11ggaqf1	561	33	.	.	.
cord-014462-11ggaqf1	562	1	Complete	complete	JJ
cord-014462-11ggaqf1	562	2	immunity	immunity	NN
cord-014462-11ggaqf1	562	3	was	be	VBD
cord-014462-11ggaqf1	562	4	reached	reach	VBN
cord-014462-11ggaqf1	562	5	in	in	IN
cord-014462-11ggaqf1	562	6	transgenic	transgenic	JJ
cord-014462-11ggaqf1	562	7	N.	n.	NN
cord-014462-11ggaqf1	562	8	benthamiana	benthamiana	NNP
cord-014462-11ggaqf1	562	9	against	against	IN
cord-014462-11ggaqf1	562	10	CBSV	CBSV	NNP
cord-014462-11ggaqf1	562	11	using	use	VBG
cord-014462-11ggaqf1	562	12	inverted	inverted	JJ
cord-014462-11ggaqf1	562	13	repeat	repeat	NN
cord-014462-11ggaqf1	562	14	or	or	CC
cord-014462-11ggaqf1	562	15	amiRNA	amirna	NN
cord-014462-11ggaqf1	562	16	constructs	construct	NNS
cord-014462-11ggaqf1	562	17	.	.	.
cord-014462-11ggaqf1	563	1	Using	use	VBG
cord-014462-11ggaqf1	563	2	different	different	JJ
cord-014462-11ggaqf1	563	3	species	specie	NNS
cord-014462-11ggaqf1	563	4	of	of	IN
cord-014462-11ggaqf1	563	5	CBSV	CBSV	NNP
cord-014462-11ggaqf1	563	6	for	for	IN
cord-014462-11ggaqf1	563	7	resistance	resistance	NN
cord-014462-11ggaqf1	563	8	screening	screening	NN
cord-014462-11ggaqf1	563	9	,	,	,
cord-014462-11ggaqf1	563	10	immunity	immunity	NN
cord-014462-11ggaqf1	563	11	was	be	VBD
cord-014462-11ggaqf1	563	12	broken	break	VBN
cord-014462-11ggaqf1	563	13	,	,	,
cord-014462-11ggaqf1	563	14	to	to	TO
cord-014462-11ggaqf1	563	15	show	show	VB
cord-014462-11ggaqf1	563	16	the	the	DT
cord-014462-11ggaqf1	563	17	minimum	minimum	JJ
cord-014462-11ggaqf1	563	18	context	context	NN
cord-014462-11ggaqf1	563	19	for	for	IN
cord-014462-11ggaqf1	563	20	broad	broad	JJ
cord-014462-11ggaqf1	563	21	spectrum	spectrum	NN
cord-014462-11ggaqf1	563	22	resistance	resistance	NN
cord-014462-11ggaqf1	563	23	.	.	.
cord-014462-11ggaqf1	564	1	Similarly	similarly	RB
cord-014462-11ggaqf1	564	2	,	,	,
cord-014462-11ggaqf1	564	3	highly	highly	RB
cord-014462-11ggaqf1	564	4	specific	specific	JJ
cord-014462-11ggaqf1	564	5	resistance	resistance	NN
cord-014462-11ggaqf1	564	6	was	be	VBD
cord-014462-11ggaqf1	564	7	reached	reach	VBN
cord-014462-11ggaqf1	564	8	in	in	IN
cord-014462-11ggaqf1	564	9	expression	expression	NN
cord-014462-11ggaqf1	564	10	of	of	IN
cord-014462-11ggaqf1	564	11	amiRNA	amiRNA	NNP
cord-014462-11ggaqf1	564	12	.	.	.
cord-014462-11ggaqf1	565	1	In	in	IN
cord-014462-11ggaqf1	565	2	contrast	contrast	NN
cord-014462-11ggaqf1	565	3	,	,	,
cord-014462-11ggaqf1	565	4	virus	virus	NN
cord-014462-11ggaqf1	565	5	resistance	resistance	NN
cord-014462-11ggaqf1	565	6	against	against	IN
cord-014462-11ggaqf1	565	7	ICMV/	ICMV/	NNP
cord-014462-11ggaqf1	565	8	SLCMV	SLCMV	NNP
cord-014462-11ggaqf1	565	9	using	use	VBG
cord-014462-11ggaqf1	565	10	single	single	JJ
cord-014462-11ggaqf1	565	11	amiRNA	amirna	NN
cord-014462-11ggaqf1	565	12	constructs	construct	NNS
cord-014462-11ggaqf1	565	13	was	be	VBD
cord-014462-11ggaqf1	565	14	not	not	RB
cord-014462-11ggaqf1	565	15	successful	successful	JJ
cord-014462-11ggaqf1	565	16	.	.	.
cord-014462-11ggaqf1	566	1	Results	result	NNS
cord-014462-11ggaqf1	566	2	from	from	IN
cord-014462-11ggaqf1	566	3	the	the	DT
cord-014462-11ggaqf1	566	4	experiments	experiment	NNS
cord-014462-11ggaqf1	566	5	to	to	TO
cord-014462-11ggaqf1	566	6	generate	generate	VB
cord-014462-11ggaqf1	566	7	virus	virus	NN
cord-014462-11ggaqf1	566	8	resistance	resistance	NN
cord-014462-11ggaqf1	566	9	against	against	IN
cord-014462-11ggaqf1	566	10	CBSV	CBSV	NNP
cord-014462-11ggaqf1	566	11	and	and	CC
cord-014462-11ggaqf1	566	12	ICMV	ICMV	NNP
cord-014462-11ggaqf1	566	13	/	/	SYM
cord-014462-11ggaqf1	566	14	SLCMV	SLCMV	NNP
cord-014462-11ggaqf1	566	15	will	will	MD
cord-014462-11ggaqf1	566	16	be	be	VB
cord-014462-11ggaqf1	566	17	shown	show	VBN
cord-014462-11ggaqf1	566	18	;	;	:
cord-014462-11ggaqf1	566	19	methods	method	NNS
cord-014462-11ggaqf1	566	20	to	to	TO
cord-014462-11ggaqf1	566	21	evaluate	evaluate	VB
cord-014462-11ggaqf1	566	22	efficiency	efficiency	NN
cord-014462-11ggaqf1	566	23	of	of	IN
cord-014462-11ggaqf1	566	24	RNAi	RNAi	NNP
cord-014462-11ggaqf1	566	25	gene	gene	NN
cord-014462-11ggaqf1	566	26	constructs	construct	NNS
cord-014462-11ggaqf1	566	27	by	by	IN
cord-014462-11ggaqf1	566	28	transient	transient	JJ
cord-014462-11ggaqf1	566	29	gene	gene	NN
cord-014462-11ggaqf1	566	30	expression	expression	NN
cord-014462-11ggaqf1	566	31	in	in	IN
cord-014462-11ggaqf1	566	32	N.	N.	NNP
cord-014462-11ggaqf1	566	33	benthamiana	benthamiana	NNP
cord-014462-11ggaqf1	566	34	and	and	CC
cord-014462-11ggaqf1	566	35	strategies	strategy	NNS
cord-014462-11ggaqf1	566	36	to	to	TO
cord-014462-11ggaqf1	566	37	develop	develop	VB
cord-014462-11ggaqf1	566	38	efficient	efficient	JJ
cord-014462-11ggaqf1	566	39	resistance	resistance	NN
cord-014462-11ggaqf1	566	40	against	against	IN
cord-014462-11ggaqf1	566	41	RNA	RNA	NNP
cord-014462-11ggaqf1	566	42	and	and	CC
cord-014462-11ggaqf1	566	43	DNA	dna	NN
cord-014462-11ggaqf1	566	44	viruses	virus	NNS
cord-014462-11ggaqf1	566	45	in	in	IN
cord-014462-11ggaqf1	566	46	cassava	cassava	NN
cord-014462-11ggaqf1	566	47	will	will	MD
cord-014462-11ggaqf1	566	48	be	be	VB
cord-014462-11ggaqf1	566	49	discussed	discuss	VBN
cord-014462-11ggaqf1	566	50	.	.	.
cord-014462-11ggaqf1	567	1	Bitter	bitter	JJ
cord-014462-11ggaqf1	567	2	gourd	gourd	NN
cord-014462-11ggaqf1	567	3	(	(	-LRB-
cord-014462-11ggaqf1	567	4	Momordica	Momordica	NNP
cord-014462-11ggaqf1	567	5	charantia	charantia	NN
cord-014462-11ggaqf1	567	6	L.	L.	NNP
cord-014462-11ggaqf1	567	7	)	)	-RRB-
cord-014462-11ggaqf1	567	8	which	which	WDT
cord-014462-11ggaqf1	567	9	is	be	VBZ
cord-014462-11ggaqf1	567	10	also	also	RB
cord-014462-11ggaqf1	567	11	called	call	VBN
cord-014462-11ggaqf1	567	12	bitter	bitter	JJ
cord-014462-11ggaqf1	567	13	melon	melon	NN
cord-014462-11ggaqf1	567	14	,	,	,
cord-014462-11ggaqf1	567	15	balsam	balsam	NN
cord-014462-11ggaqf1	567	16	apple	apple	NNP
cord-014462-11ggaqf1	567	17	and	and	CC
cord-014462-11ggaqf1	567	18	balsam	balsam	NN
cord-014462-11ggaqf1	567	19	pear	pear	NN
cord-014462-11ggaqf1	567	20	belongs	belong	VBZ
cord-014462-11ggaqf1	567	21	to	to	IN
cord-014462-11ggaqf1	567	22	family	family	NN
cord-014462-11ggaqf1	567	23	cucurbitaceae	cucurbitaceae	NNP
cord-014462-11ggaqf1	567	24	.	.	.
cord-014462-11ggaqf1	568	1	It	-PRON-	PRP
cord-014462-11ggaqf1	568	2	is	be	VBZ
cord-014462-11ggaqf1	568	3	an	an	DT
cord-014462-11ggaqf1	568	4	important	important	JJ
cord-014462-11ggaqf1	568	5	traditional	traditional	JJ
cord-014462-11ggaqf1	568	6	vegetable	vegetable	NN
cord-014462-11ggaqf1	568	7	of	of	IN
cord-014462-11ggaqf1	568	8	nutritive	nutritive	JJ
cord-014462-11ggaqf1	568	9	and	and	CC
cord-014462-11ggaqf1	568	10	medicinal	medicinal	JJ
cord-014462-11ggaqf1	568	11	value	value	NN
cord-014462-11ggaqf1	568	12	that	that	WDT
cord-014462-11ggaqf1	568	13	is	be	VBZ
cord-014462-11ggaqf1	568	14	cultivated	cultivate	VBN
cord-014462-11ggaqf1	568	15	in	in	IN
cord-014462-11ggaqf1	568	16	tropical	tropical	JJ
cord-014462-11ggaqf1	568	17	and	and	CC
cord-014462-11ggaqf1	568	18	sub	sub	JJ
cord-014462-11ggaqf1	568	19	-	-	JJ
cord-014462-11ggaqf1	568	20	tropical	tropical	JJ
cord-014462-11ggaqf1	568	21	Asia	Asia	NNP
cord-014462-11ggaqf1	568	22	,	,	,
cord-014462-11ggaqf1	568	23	but	but	CC
cord-014462-11ggaqf1	568	24	is	be	VBZ
cord-014462-11ggaqf1	568	25	considered	consider	VBN
cord-014462-11ggaqf1	568	26	as	as	IN
cord-014462-11ggaqf1	568	27	a	a	DT
cord-014462-11ggaqf1	568	28	weed	weed	NN
cord-014462-11ggaqf1	568	29	host	host	NN
cord-014462-11ggaqf1	568	30	reservoir	reservoir	NN
cord-014462-11ggaqf1	568	31	for	for	IN
cord-014462-11ggaqf1	568	32	viruses	virus	NNS
cord-014462-11ggaqf1	568	33	in	in	IN
cord-014462-11ggaqf1	568	34	Jamaica	Jamaica	NNP
cord-014462-11ggaqf1	568	35	.	.	.
cord-014462-11ggaqf1	569	1	Viral	viral	JJ
cord-014462-11ggaqf1	569	2	disease	disease	NN
cord-014462-11ggaqf1	569	3	-	-	HYPH
cord-014462-11ggaqf1	569	4	like	like	JJ
cord-014462-11ggaqf1	569	5	symptoms	symptom	NNS
cord-014462-11ggaqf1	569	6	were	be	VBD
cord-014462-11ggaqf1	569	7	observed	observe	VBN
cord-014462-11ggaqf1	569	8	occurring	occur	VBG
cord-014462-11ggaqf1	569	9	naturally	naturally	RB
cord-014462-11ggaqf1	569	10	on	on	IN
cord-014462-11ggaqf1	569	11	the	the	DT
cord-014462-11ggaqf1	569	12	crops	crop	NNS
cord-014462-11ggaqf1	569	13	of	of	IN
cord-014462-11ggaqf1	569	14	bitter	bitter	JJ
cord-014462-11ggaqf1	569	15	gourd	gourd	NN
cord-014462-11ggaqf1	569	16	grown	grow	VBN
cord-014462-11ggaqf1	569	17	in	in	IN
cord-014462-11ggaqf1	569	18	the	the	DT
cord-014462-11ggaqf1	569	19	fields	field	NNS
cord-014462-11ggaqf1	569	20	of	of	IN
cord-014462-11ggaqf1	569	21	Northern	Northern	NNP
cord-014462-11ggaqf1	569	22	India	India	NNP
cord-014462-11ggaqf1	569	23	during	during	IN
cord-014462-11ggaqf1	569	24	2007	2007	CD
cord-014462-11ggaqf1	569	25	-	-	SYM
cord-014462-11ggaqf1	569	26	2009	2009	CD
cord-014462-11ggaqf1	569	27	.	.	.
cord-014462-11ggaqf1	570	1	An	an	DT
cord-014462-11ggaqf1	570	2	incidence	incidence	NN
cord-014462-11ggaqf1	570	3	of	of	IN
cord-014462-11ggaqf1	570	4	78.5	78.5	CD
cord-014462-11ggaqf1	570	5	%	%	NN
cord-014462-11ggaqf1	570	6	of	of	IN
cord-014462-11ggaqf1	570	7	diseased	diseased	JJ
cord-014462-11ggaqf1	570	8	plants	plant	NNS
cord-014462-11ggaqf1	570	9	was	be	VBD
cord-014462-11ggaqf1	570	10	recorded	record	VBN
cord-014462-11ggaqf1	570	11	which	which	WDT
cord-014462-11ggaqf1	570	12	showed	show	VBD
cord-014462-11ggaqf1	570	13	chlorotic	chlorotic	JJ
cord-014462-11ggaqf1	570	14	spots	spot	NNS
cord-014462-11ggaqf1	570	15	and	and	CC
cord-014462-11ggaqf1	570	16	mosaic	mosaic	NN
cord-014462-11ggaqf1	570	17	ranging	range	VBG
cord-014462-11ggaqf1	570	18	from	from	IN
cord-014462-11ggaqf1	570	19	mild	mild	JJ
cord-014462-11ggaqf1	570	20	mottling	mottling	NN
cord-014462-11ggaqf1	570	21	to	to	IN
cord-014462-11ggaqf1	570	22	green	green	JJ
cord-014462-11ggaqf1	570	23	blisters	blister	NNS
cord-014462-11ggaqf1	570	24	along	along	IN
cord-014462-11ggaqf1	570	25	with	with	IN
cord-014462-11ggaqf1	570	26	leaf	leaf	NN
cord-014462-11ggaqf1	570	27	smalling	smalling	NNP
cord-014462-11ggaqf1	570	28	,	,	,
cord-014462-11ggaqf1	570	29	leaf	leaf	NN
cord-014462-11ggaqf1	570	30	and	and	CC
cord-014462-11ggaqf1	570	31	fruit	fruit	NN
cord-014462-11ggaqf1	570	32	deformations	deformation	NNS
cord-014462-11ggaqf1	570	33	,	,	,
cord-014462-11ggaqf1	570	34	bud	bud	NN
cord-014462-11ggaqf1	570	35	necrosis	necrosis	NN
cord-014462-11ggaqf1	570	36	and	and	CC
cord-014462-11ggaqf1	570	37	stunted	stunted	JJ
cord-014462-11ggaqf1	570	38	growth	growth	NN
cord-014462-11ggaqf1	570	39	whereas	whereas	IN
cord-014462-11ggaqf1	570	40	20.2	20.2	CD
cord-014462-11ggaqf1	570	41	%	%	NN
cord-014462-11ggaqf1	570	42	plants	plant	NNS
cord-014462-11ggaqf1	570	43	exhibited	exhibit	VBD
cord-014462-11ggaqf1	570	44	leaf	leaf	NN
cord-014462-11ggaqf1	570	45	curling	curling	NN
cord-014462-11ggaqf1	570	46	alone	alone	RB
cord-014462-11ggaqf1	570	47	or	or	CC
cord-014462-11ggaqf1	570	48	in	in	IN
cord-014462-11ggaqf1	570	49	combination	combination	NN
cord-014462-11ggaqf1	570	50	with	with	IN
cord-014462-11ggaqf1	570	51	mosaic	mosaic	JJ
cord-014462-11ggaqf1	570	52	-	-	HYPH
cord-014462-11ggaqf1	570	53	type	type	NN
cord-014462-11ggaqf1	570	54	disease	disease	NN
cord-014462-11ggaqf1	570	55	.	.	.
cord-014462-11ggaqf1	571	1	A	a	DT
cord-014462-11ggaqf1	571	2	reduction	reduction	NN
cord-014462-11ggaqf1	571	3	of	of	IN
cord-014462-11ggaqf1	571	4	34.5	34.5	CD
cord-014462-11ggaqf1	571	5	%	%	NN
cord-014462-11ggaqf1	571	6	in	in	IN
cord-014462-11ggaqf1	571	7	fruit	fruit	NN
cord-014462-11ggaqf1	571	8	yield	yield	NN
cord-014462-11ggaqf1	571	9	was	be	VBD
cord-014462-11ggaqf1	571	10	recorded	record	VBN
cord-014462-11ggaqf1	571	11	in	in	IN
cord-014462-11ggaqf1	571	12	mosaic	mosaic	JJ
cord-014462-11ggaqf1	571	13	-	-	HYPH
cord-014462-11ggaqf1	571	14	like	like	JJ
cord-014462-11ggaqf1	571	15	disease	disease	NN
cord-014462-11ggaqf1	571	16	which	which	WDT
cord-014462-11ggaqf1	571	17	could	could	MD
cord-014462-11ggaqf1	571	18	be	be	VB
cord-014462-11ggaqf1	571	19	attributed	attribute	VBN
cord-014462-11ggaqf1	571	20	to	to	IN
cord-014462-11ggaqf1	571	21	lesser	less	JJR
cord-014462-11ggaqf1	571	22	fruit	fruit	NN
cord-014462-11ggaqf1	571	23	setting	set	VBG
cord-014462-11ggaqf1	571	24	due	due	IN
cord-014462-11ggaqf1	571	25	to	to	IN
cord-014462-11ggaqf1	571	26	bud	bud	NN
cord-014462-11ggaqf1	571	27	necrosis	necrosis	NN
cord-014462-11ggaqf1	571	28	,	,	,
cord-014462-11ggaqf1	571	29	smaller	small	JJR
cord-014462-11ggaqf1	571	30	fruit	fruit	NN
cord-014462-11ggaqf1	571	31	size	size	NN
cord-014462-11ggaqf1	571	32	and	and	CC
cord-014462-11ggaqf1	571	33	stunted	stunted	JJ
cord-014462-11ggaqf1	571	34	plant	plant	NN
cord-014462-11ggaqf1	571	35	growth	growth	NN
cord-014462-11ggaqf1	571	36	.	.	.
cord-014462-11ggaqf1	572	1	Such	such	JJ
cord-014462-11ggaqf1	572	2	plants	plant	NNS
cord-014462-11ggaqf1	572	3	produced	produce	VBD
cord-014462-11ggaqf1	572	4	deformed	deform	VBN
cord-014462-11ggaqf1	572	5	,	,	,
cord-014462-11ggaqf1	572	6	notched	notch	VBN
cord-014462-11ggaqf1	572	7	,	,	,
cord-014462-11ggaqf1	572	8	irregularly	irregularly	RB
cord-014462-11ggaqf1	572	9	shaped	shape	VBN
cord-014462-11ggaqf1	572	10	fruits	fruit	NNS
cord-014462-11ggaqf1	572	11	wherein	wherein	WRB
cord-014462-11ggaqf1	572	12	pre	pre	JJ
cord-014462-11ggaqf1	572	13	-	-	JJ
cord-014462-11ggaqf1	572	14	mature	mature	JJ
cord-014462-11ggaqf1	572	15	yellowing	yellowing	NN
cord-014462-11ggaqf1	572	16	and	and	CC
cord-014462-11ggaqf1	572	17	necrosis	necrosis	NN
cord-014462-11ggaqf1	572	18	on	on	IN
cord-014462-11ggaqf1	572	19	the	the	DT
cord-014462-11ggaqf1	572	20	anterior	anterior	JJ
cord-014462-11ggaqf1	572	21	and	and	CC
cord-014462-11ggaqf1	572	22	posteriors	posterior	NNS
cord-014462-11ggaqf1	572	23	ends	end	VBZ
cord-014462-11ggaqf1	572	24	made	make	VBD
cord-014462-11ggaqf1	572	25	22.4	22.4	CD
cord-014462-11ggaqf1	572	26	%	%	NN
cord-014462-11ggaqf1	572	27	fruits	fruit	NNS
cord-014462-11ggaqf1	572	28	unfit	unfit	JJ
cord-014462-11ggaqf1	572	29	for	for	IN
cord-014462-11ggaqf1	572	30	marketability	marketability	NN
cord-014462-11ggaqf1	572	31	.	.	.
cord-014462-11ggaqf1	573	1	The	the	DT
cord-014462-11ggaqf1	573	2	dwindling	dwindle	VBG
cord-014462-11ggaqf1	573	3	yield	yield	NN
cord-014462-11ggaqf1	573	4	and	and	CC
cord-014462-11ggaqf1	573	5	production	production	NN
cord-014462-11ggaqf1	573	6	of	of	IN
cord-014462-11ggaqf1	573	7	unmarketable	unmarketable	JJ
cord-014462-11ggaqf1	573	8	fruits	fruit	NNS
cord-014462-11ggaqf1	573	9	posed	pose	VBD
cord-014462-11ggaqf1	573	10	a	a	DT
cord-014462-11ggaqf1	573	11	major	major	JJ
cord-014462-11ggaqf1	573	12	constraint	constraint	NN
cord-014462-11ggaqf1	573	13	for	for	IN
cord-014462-11ggaqf1	573	14	profitable	profitable	JJ
cord-014462-11ggaqf1	573	15	cultivation	cultivation	NN
cord-014462-11ggaqf1	573	16	of	of	IN
cord-014462-11ggaqf1	573	17	this	this	DT
cord-014462-11ggaqf1	573	18	economically	economically	RB
cord-014462-11ggaqf1	573	19	important	important	JJ
cord-014462-11ggaqf1	573	20	crop	crop	NN
cord-014462-11ggaqf1	573	21	,	,	,
cord-014462-11ggaqf1	573	22	thus	thus	RB
cord-014462-11ggaqf1	573	23	warranting	warrant	VBG
cord-014462-11ggaqf1	573	24	for	for	IN
cord-014462-11ggaqf1	573	25	studies	study	NNS
cord-014462-11ggaqf1	573	26	on	on	IN
cord-014462-11ggaqf1	573	27	etiology	etiology	NN
cord-014462-11ggaqf1	573	28	and	and	CC
cord-014462-11ggaqf1	573	29	management	management	NN
cord-014462-11ggaqf1	573	30	of	of	IN
cord-014462-11ggaqf1	573	31	these	these	DT
cord-014462-11ggaqf1	573	32	diseases	disease	NNS
cord-014462-11ggaqf1	573	33	.	.	.
cord-014462-11ggaqf1	574	1	The	the	DT
cord-014462-11ggaqf1	574	2	mosaic	mosaic	JJ
cord-014462-11ggaqf1	574	3	-	-	HYPH
cord-014462-11ggaqf1	574	4	like	like	JJ
cord-014462-11ggaqf1	574	5	disease	disease	NN
cord-014462-11ggaqf1	574	6	was	be	VBD
cord-014462-11ggaqf1	574	7	transmitted	transmit	VBN
cord-014462-11ggaqf1	574	8	to	to	IN
cord-014462-11ggaqf1	574	9	healthy	healthy	JJ
cord-014462-11ggaqf1	574	10	seedlings	seedling	NNS
cord-014462-11ggaqf1	574	11	of	of	IN
cord-014462-11ggaqf1	574	12	bitter	bitter	JJ
cord-014462-11ggaqf1	574	13	gourd	gourd	NN
cord-014462-11ggaqf1	574	14	at	at	IN
cord-014462-11ggaqf1	574	15	2-leaves	2-leaves	CD
cord-014462-11ggaqf1	574	16	stage	stage	NN
cord-014462-11ggaqf1	574	17	by	by	IN
cord-014462-11ggaqf1	574	18	sap	sap	NN
cord-014462-11ggaqf1	574	19	inoculation	inoculation	NN
cord-014462-11ggaqf1	574	20	as	as	RB
cord-014462-11ggaqf1	574	21	well	well	RB
cord-014462-11ggaqf1	574	22	as	as	IN
cord-014462-11ggaqf1	574	23	by	by	IN
cord-014462-11ggaqf1	574	24	aphid	aphid	NNP
cord-014462-11ggaqf1	574	25	viz	viz	NN
cord-014462-11ggaqf1	574	26	.	.	.
cord-014462-11ggaqf1	575	1	,	,	,
cord-014462-11ggaqf1	575	2	Myzus	Myzus	NNP
cord-014462-11ggaqf1	575	3	persicae	persicae	NN
cord-014462-11ggaqf1	575	4	Sulz	Sulz	NNP
cord-014462-11ggaqf1	575	5	.	.	.
cord-014462-11ggaqf1	576	1	and	and	CC
cord-014462-11ggaqf1	576	2	Aphis	Aphis	NNP
cord-014462-11ggaqf1	576	3	gossypii	gossypii	NNP
cord-014462-11ggaqf1	576	4	Glov	Glov	NNP
cord-014462-11ggaqf1	576	5	.	.	.
cord-014462-11ggaqf1	577	1	initially	initially	RB
cord-014462-11ggaqf1	577	2	studies	study	NNS
cord-014462-11ggaqf1	577	3	were	be	VBD
cord-014462-11ggaqf1	577	4	carried	carry	VBN
cord-014462-11ggaqf1	577	5	out	out	RP
cord-014462-11ggaqf1	577	6	to	to	TO
cord-014462-11ggaqf1	577	7	optimize	optimize	VB
cord-014462-11ggaqf1	577	8	protocols	protocol	NNS
cord-014462-11ggaqf1	577	9	for	for	IN
cord-014462-11ggaqf1	577	10	efficient	efficient	JJ
cord-014462-11ggaqf1	577	11	plant	plant	NN
cord-014462-11ggaqf1	577	12	regeneration	regeneration	NN
cord-014462-11ggaqf1	577	13	and	and	CC
cord-014462-11ggaqf1	577	14	Agrobacterium	agrobacterium	NN
cord-014462-11ggaqf1	577	15	-	-	HYPH
cord-014462-11ggaqf1	577	16	mediated	mediate	VBN
cord-014462-11ggaqf1	577	17	transformation	transformation	NN
cord-014462-11ggaqf1	577	18	for	for	IN
cord-014462-11ggaqf1	577	19	Nagpur	Nagpur	NNP
cord-014462-11ggaqf1	577	20	sweet	sweet	JJ
cord-014462-11ggaqf1	577	21	orange	orange	NN
cord-014462-11ggaqf1	577	22	,	,	,
cord-014462-11ggaqf1	577	23	which	which	WDT
cord-014462-11ggaqf1	577	24	is	be	VBZ
cord-014462-11ggaqf1	577	25	a	a	DT
cord-014462-11ggaqf1	577	26	popular	popular	JJ
cord-014462-11ggaqf1	577	27	and	and	CC
cord-014462-11ggaqf1	577	28	elite	elite	JJ
cord-014462-11ggaqf1	577	29	citrus	citrus	NN
cord-014462-11ggaqf1	577	30	cultivar	cultivar	NN
cord-014462-11ggaqf1	577	31	in	in	IN
cord-014462-11ggaqf1	577	32	India	India	NNP
cord-014462-11ggaqf1	577	33	.	.	.
cord-014462-11ggaqf1	578	1	Organogenesis	organogenesis	NN
cord-014462-11ggaqf1	578	2	was	be	VBD
cord-014462-11ggaqf1	578	3	induced	induce	VBN
cord-014462-11ggaqf1	578	4	in	in	IN
cord-014462-11ggaqf1	578	5	etiolated	etiolated	JJ
cord-014462-11ggaqf1	578	6	epicotyl	epicotyl	NNP
cord-014462-11ggaqf1	578	7	explants	explant	NNS
cord-014462-11ggaqf1	578	8	of	of	IN
cord-014462-11ggaqf1	578	9	one	one	CD
cord-014462-11ggaqf1	578	10	-	-	HYPH
cord-014462-11ggaqf1	578	11	month	month	NN
cord-014462-11ggaqf1	578	12	-	-	HYPH
cord-014462-11ggaqf1	578	13	old	old	JJ
cord-014462-11ggaqf1	578	14	axenically	axenically	RB
cord-014462-11ggaqf1	578	15	raised	raise	VBD
cord-014462-11ggaqf1	578	16	polyembryonic	polyembryonic	NNP
cord-014462-11ggaqf1	578	17	seedlings	seedling	NNS
cord-014462-11ggaqf1	578	18	by	by	IN
cord-014462-11ggaqf1	578	19	culturing	culture	VBG
cord-014462-11ggaqf1	578	20	them	-PRON-	PRP
cord-014462-11ggaqf1	578	21	in	in	IN
cord-014462-11ggaqf1	578	22	MT	MT	NNP
cord-014462-11ggaqf1	578	23	medium	medium	NN
cord-014462-11ggaqf1	578	24	supplemented	supplement	VBN
cord-014462-11ggaqf1	578	25	with	with	IN
cord-014462-11ggaqf1	578	26	30	30	CD
cord-014462-11ggaqf1	578	27	g	g	NN
cord-014462-11ggaqf1	578	28	/	/	SYM
cord-014462-11ggaqf1	578	29	l	l	NN
cord-014462-11ggaqf1	578	30	sucrose	sucrose	NN
cord-014462-11ggaqf1	578	31	with	with	IN
cord-014462-11ggaqf1	578	32	varying	vary	VBG
cord-014462-11ggaqf1	578	33	concentrations	concentration	NNS
cord-014462-11ggaqf1	578	34	of	of	IN
cord-014462-11ggaqf1	578	35	plant	plant	NN
cord-014462-11ggaqf1	578	36	hormones	hormone	NNS
cord-014462-11ggaqf1	578	37	.	.	.
cord-014462-11ggaqf1	579	1	It	-PRON-	PRP
cord-014462-11ggaqf1	579	2	was	be	VBD
cord-014462-11ggaqf1	579	3	found	find	VBN
cord-014462-11ggaqf1	579	4	that	that	IN
cord-014462-11ggaqf1	579	5	BAP	BAP	NNP
cord-014462-11ggaqf1	579	6	at	at	IN
cord-014462-11ggaqf1	579	7	1	1	CD
cord-014462-11ggaqf1	579	8	mg	mg	NNP
cord-014462-11ggaqf1	579	9	/	/	SYM
cord-014462-11ggaqf1	579	10	l	l	NN
cord-014462-11ggaqf1	579	11	without	without	IN
cord-014462-11ggaqf1	579	12	auxin	auxin	NN
cord-014462-11ggaqf1	579	13	was	be	VBD
cord-014462-11ggaqf1	579	14	best	good	JJS
cord-014462-11ggaqf1	579	15	for	for	IN
cord-014462-11ggaqf1	579	16	efficient	efficient	JJ
cord-014462-11ggaqf1	579	17	shoot	shoot	NN
cord-014462-11ggaqf1	579	18	regeneration	regeneration	NN
cord-014462-11ggaqf1	579	19	in	in	IN
cord-014462-11ggaqf1	579	20	Citrus	Citrus	NNP
cord-014462-11ggaqf1	579	21	using	use	VBG
cord-014462-11ggaqf1	579	22	epicotyl	epicotyl	NNP
cord-014462-11ggaqf1	579	23	explants	explant	NNS
cord-014462-11ggaqf1	579	24	.	.	.
cord-014462-11ggaqf1	580	1	A	a	DT
cord-014462-11ggaqf1	580	2	100	100	CD
cord-014462-11ggaqf1	580	3	%	%	NN
cord-014462-11ggaqf1	580	4	regeneration	regeneration	NN
cord-014462-11ggaqf1	580	5	frequency	frequency	NN
cord-014462-11ggaqf1	580	6	was	be	VBD
cord-014462-11ggaqf1	580	7	obtained	obtain	VBN
cord-014462-11ggaqf1	580	8	and	and	CC
cord-014462-11ggaqf1	580	9	multiple	multiple	JJ
cord-014462-11ggaqf1	580	10	shoot	shoot	NN
cord-014462-11ggaqf1	580	11	formation	formation	NN
cord-014462-11ggaqf1	580	12	was	be	VBD
cord-014462-11ggaqf1	580	13	obtained	obtain	VBN
cord-014462-11ggaqf1	580	14	from	from	IN
cord-014462-11ggaqf1	580	15	both	both	CC
cord-014462-11ggaqf1	580	16	the	the	DT
cord-014462-11ggaqf1	580	17	cut	cut	NN
cord-014462-11ggaqf1	580	18	ends	end	NNS
cord-014462-11ggaqf1	580	19	of	of	IN
cord-014462-11ggaqf1	580	20	all	all	PDT
cord-014462-11ggaqf1	580	21	the	the	DT
cord-014462-11ggaqf1	580	22	explants	explant	NNS
cord-014462-11ggaqf1	580	23	.	.	.
cord-014462-11ggaqf1	581	1	An	an	DT
cord-014462-11ggaqf1	581	2	average	average	NN
cord-014462-11ggaqf1	581	3	of	of	IN
cord-014462-11ggaqf1	581	4	8.24	8.24	CD
cord-014462-11ggaqf1	581	5	well	well	RB
cord-014462-11ggaqf1	581	6	-	-	HYPH
cord-014462-11ggaqf1	581	7	differentiated	differentiate	VBN
cord-014462-11ggaqf1	581	8	shoots	shoot	NNS
cord-014462-11ggaqf1	581	9	per	per	IN
cord-014462-11ggaqf1	581	10	explant	explant	NN
cord-014462-11ggaqf1	581	11	were	be	VBD
cord-014462-11ggaqf1	581	12	obtained	obtain	VBN
cord-014462-11ggaqf1	581	13	,	,	,
cord-014462-11ggaqf1	581	14	all	all	DT
cord-014462-11ggaqf1	581	15	of	of	IN
cord-014462-11ggaqf1	581	16	which	which	WDT
cord-014462-11ggaqf1	581	17	rooted	root	VBN
cord-014462-11ggaqf1	581	18	normally	normally	RB
cord-014462-11ggaqf1	581	19	under	under	IN
cord-014462-11ggaqf1	581	20	the	the	DT
cord-014462-11ggaqf1	581	21	influence	influence	NN
cord-014462-11ggaqf1	581	22	of	of	IN
cord-014462-11ggaqf1	581	23	1	1	CD
cord-014462-11ggaqf1	581	24	mg	mg	NNP
cord-014462-11ggaqf1	581	25	/	/	SYM
cord-014462-11ggaqf1	581	26	l	l	NNP
cord-014462-11ggaqf1	581	27	IBA	IBA	NNP
cord-014462-11ggaqf1	581	28	.	.	.
cord-014462-11ggaqf1	582	1	This	this	DT
cord-014462-11ggaqf1	582	2	improved	improve	VBD
cord-014462-11ggaqf1	582	3	regeneration	regeneration	NN
cord-014462-11ggaqf1	582	4	protocol	protocol	NN
cord-014462-11ggaqf1	582	5	was	be	VBD
cord-014462-11ggaqf1	582	6	utilized	utilize	VBN
cord-014462-11ggaqf1	582	7	in	in	IN
cord-014462-11ggaqf1	582	8	standardizing	standardize	VBG
cord-014462-11ggaqf1	582	9	Agrobacterium	agrobacterium	NN
cord-014462-11ggaqf1	582	10	-	-	HYPH
cord-014462-11ggaqf1	582	11	mediated	mediate	VBN
cord-014462-11ggaqf1	582	12	transformation	transformation	NN
cord-014462-11ggaqf1	582	13	of	of	IN
cord-014462-11ggaqf1	582	14	citrus	citrus	NN
cord-014462-11ggaqf1	582	15	using	use	VBG
cord-014462-11ggaqf1	582	16	A.	a.	NN
cord-014462-11ggaqf1	582	17	tumefaciens	tumefaciens	NNP
cord-014462-11ggaqf1	582	18	strain	strain	NN
cord-014462-11ggaqf1	582	19	EHA	EHA	NNP
cord-014462-11ggaqf1	582	20	105	105	CD
cord-014462-11ggaqf1	582	21	,	,	,
cord-014462-11ggaqf1	582	22	containing	contain	VBG
cord-014462-11ggaqf1	582	23	binary	binary	JJ
cord-014462-11ggaqf1	582	24	plasmid	plasmid	NN
cord-014462-11ggaqf1	582	25	pCAMBIA	pcambia	RB
cord-014462-11ggaqf1	582	26	2301	2301	CD
cord-014462-11ggaqf1	582	27	that	that	WDT
cord-014462-11ggaqf1	582	28	harbors	harbor	VBZ
cord-014462-11ggaqf1	582	29	GUS	GUS	NNP
cord-014462-11ggaqf1	582	30	reporter	reporter	NN
cord-014462-11ggaqf1	582	31	gene	gene	NN
cord-014462-11ggaqf1	582	32	and	and	CC
cord-014462-11ggaqf1	582	33	NPT	NPT	NNP
cord-014462-11ggaqf1	582	34	-	-	HYPH
cord-014462-11ggaqf1	582	35	II	II	NNP
cord-014462-11ggaqf1	582	36	plant	plant	NN
cord-014462-11ggaqf1	582	37	selection	selection	NN
cord-014462-11ggaqf1	582	38	marker	marker	NN
cord-014462-11ggaqf1	582	39	gene	gene	NN
cord-014462-11ggaqf1	582	40	.	.	.
cord-014462-11ggaqf1	583	1	One	one	CD
cord-014462-11ggaqf1	583	2	-	-	HYPH
cord-014462-11ggaqf1	583	3	month	month	NN
cord-014462-11ggaqf1	583	4	-	-	HYPH
cord-014462-11ggaqf1	583	5	old	old	JJ
cord-014462-11ggaqf1	583	6	epicotyl	epicotyl	NNP
cord-014462-11ggaqf1	583	7	explants	explant	NNS
cord-014462-11ggaqf1	583	8	infected	infect	VBN
cord-014462-11ggaqf1	583	9	with	with	IN
cord-014462-11ggaqf1	583	10	over	over	IN
cord-014462-11ggaqf1	583	11	-	-	HYPH
cord-014462-11ggaqf1	583	12	night	night	NN
cord-014462-11ggaqf1	583	13	grown	grow	VBN
cord-014462-11ggaqf1	583	14	Agrobacterium	Agrobacterium	NNP
cord-014462-11ggaqf1	583	15	(	(	-LRB-
cord-014462-11ggaqf1	583	16	A	a	NN
cord-014462-11ggaqf1	583	17	600	600	CD
cord-014462-11ggaqf1	583	18	0.6	0.6	CD
cord-014462-11ggaqf1	583	19	-	-	HYPH
cord-014462-11ggaqf1	583	20	0.8	0.8	CD
cord-014462-11ggaqf1	583	21	)	)	-RRB-
cord-014462-11ggaqf1	583	22	for	for	IN
cord-014462-11ggaqf1	583	23	15	15	CD
cord-014462-11ggaqf1	583	24	min	min	NN
cord-014462-11ggaqf1	583	25	and	and	CC
cord-014462-11ggaqf1	583	26	co	co	JJ
cord-014462-11ggaqf1	583	27	-	-	JJ
cord-014462-11ggaqf1	583	28	cultured	cultured	JJ
cord-014462-11ggaqf1	583	29	for	for	IN
cord-014462-11ggaqf1	583	30	3	3	CD
cord-014462-11ggaqf1	583	31	days	day	NNS
cord-014462-11ggaqf1	583	32	were	be	VBD
cord-014462-11ggaqf1	583	33	found	find	VBN
cord-014462-11ggaqf1	583	34	to	to	TO
cord-014462-11ggaqf1	583	35	be	be	VB
cord-014462-11ggaqf1	583	36	optimum	optimum	JJ
cord-014462-11ggaqf1	583	37	for	for	IN
cord-014462-11ggaqf1	583	38	transformation	transformation	NN
cord-014462-11ggaqf1	583	39	as	as	IN
cord-014462-11ggaqf1	583	40	assessed	assess	VBN
cord-014462-11ggaqf1	583	41	on	on	IN
cord-014462-11ggaqf1	583	42	the	the	DT
cord-014462-11ggaqf1	583	43	basis	basis	NN
cord-014462-11ggaqf1	583	44	of	of	IN
cord-014462-11ggaqf1	583	45	PCR	PCR	NNP
cord-014462-11ggaqf1	583	46	analysis	analysis	NN
cord-014462-11ggaqf1	583	47	and	and	CC
cord-014462-11ggaqf1	583	48	GUS	GUS	NNP
cord-014462-11ggaqf1	583	49	activity	activity	NN
cord-014462-11ggaqf1	583	50	displayed	display	VBN
cord-014462-11ggaqf1	583	51	by	by	IN
cord-014462-11ggaqf1	583	52	the	the	DT
cord-014462-11ggaqf1	583	53	stem	stem	NN
cord-014462-11ggaqf1	583	54	and	and	CC
cord-014462-11ggaqf1	583	55	leaf	leaf	NN
cord-014462-11ggaqf1	583	56	sections	section	NNS
cord-014462-11ggaqf1	583	57	of	of	IN
cord-014462-11ggaqf1	583	58	putative	putative	JJ
cord-014462-11ggaqf1	583	59	transgenics	transgenic	NNS
cord-014462-11ggaqf1	583	60	.	.	.
cord-014462-11ggaqf1	584	1	Overall	overall	JJ
cord-014462-11ggaqf1	584	2	transformation	transformation	NN
cord-014462-11ggaqf1	584	3	frequency	frequency	NN
cord-014462-11ggaqf1	584	4	ranged	range	VBD
cord-014462-11ggaqf1	584	5	from	from	IN
cord-014462-11ggaqf1	584	6	38	38	CD
cord-014462-11ggaqf1	584	7	to	to	TO
cord-014462-11ggaqf1	584	8	48	48	CD
cord-014462-11ggaqf1	584	9	%	%	NN
cord-014462-11ggaqf1	584	10	.	.	.
cord-014462-11ggaqf1	585	1	Current	current	JJ
cord-014462-11ggaqf1	585	2	study	study	NN
cord-014462-11ggaqf1	585	3	focuses	focus	VBZ
cord-014462-11ggaqf1	585	4	on	on	IN
cord-014462-11ggaqf1	585	5	the	the	DT
cord-014462-11ggaqf1	585	6	generation	generation	NN
cord-014462-11ggaqf1	585	7	of	of	IN
cord-014462-11ggaqf1	585	8	citrus	citrus	NN
cord-014462-11ggaqf1	585	9	transgenics	transgenic	NNS
cord-014462-11ggaqf1	585	10	for	for	IN
cord-014462-11ggaqf1	585	11	CTV	CTV	NNP
cord-014462-11ggaqf1	585	12	resistance	resistance	NN
cord-014462-11ggaqf1	585	13	using	use	VBG
cord-014462-11ggaqf1	585	14	A.	a.	NN
cord-014462-11ggaqf1	585	15	tumefaciens	tumefaciens	NNP
cord-014462-11ggaqf1	585	16	strain	strain	NN
cord-014462-11ggaqf1	585	17	EHA	EHA	NNP
cord-014462-11ggaqf1	585	18	105	105	CD
cord-014462-11ggaqf1	585	19	containing	contain	VBG
cord-014462-11ggaqf1	585	20	binary	binary	JJ
cord-014462-11ggaqf1	585	21	plasmid	plasmid	NN
cord-014462-11ggaqf1	585	22	pBinAR	pBinAR	NNP
cord-014462-11ggaqf1	585	23	harboring	harbor	VBG
cord-014462-11ggaqf1	585	24	portion	portion	NN
cord-014462-11ggaqf1	585	25	of	of	IN
cord-014462-11ggaqf1	585	26	coat	coat	NN
cord-014462-11ggaqf1	585	27	protein	protein	NN
cord-014462-11ggaqf1	585	28	gene	gene	NN
cord-014462-11ggaqf1	585	29	of	of	IN
cord-014462-11ggaqf1	585	30	CTV	CTV	NNP
cord-014462-11ggaqf1	585	31	and	and	CC
cord-014462-11ggaqf1	585	32	NPT	NPT	NNP
cord-014462-11ggaqf1	585	33	-	-	HYPH
cord-014462-11ggaqf1	585	34	II	II	NNP
cord-014462-11ggaqf1	585	35	gene	gene	NN
cord-014462-11ggaqf1	585	36	employing	employ	VBG
cord-014462-11ggaqf1	585	37	the	the	DT
cord-014462-11ggaqf1	585	38	standardized	standardized	JJ
cord-014462-11ggaqf1	585	39	protocols	protocol	NNS
cord-014462-11ggaqf1	585	40	.	.	.
cord-014462-11ggaqf1	586	1	Several	several	JJ
cord-014462-11ggaqf1	586	2	putative	putative	JJ
cord-014462-11ggaqf1	586	3	transgenic	transgenic	JJ
cord-014462-11ggaqf1	586	4	shoots	shoot	NNS
cord-014462-11ggaqf1	586	5	were	be	VBD
cord-014462-11ggaqf1	586	6	recovered	recover	VBN
cord-014462-11ggaqf1	586	7	on	on	IN
cord-014462-11ggaqf1	586	8	selection	selection	NN
cord-014462-11ggaqf1	586	9	medium	medium	NN
cord-014462-11ggaqf1	586	10	and	and	CC
cord-014462-11ggaqf1	586	11	they	-PRON-	PRP
cord-014462-11ggaqf1	586	12	are	be	VBP
cord-014462-11ggaqf1	586	13	being	be	VBG
cord-014462-11ggaqf1	586	14	utilized	utilize	VBN
cord-014462-11ggaqf1	586	15	for	for	IN
cord-014462-11ggaqf1	586	16	molecular	molecular	JJ
cord-014462-11ggaqf1	586	17	analyses	analysis	NNS
cord-014462-11ggaqf1	586	18	and	and	CC
cord-014462-11ggaqf1	586	19	resistance	resistance	NN
cord-014462-11ggaqf1	586	20	against	against	IN
cord-014462-11ggaqf1	586	21	CTV	CTV	NNP
cord-014462-11ggaqf1	586	22	.	.	.
cord-014462-11ggaqf1	587	1	Work	work	NN
cord-014462-11ggaqf1	587	2	is	be	VBZ
cord-014462-11ggaqf1	587	3	also	also	RB
cord-014462-11ggaqf1	587	4	in	in	IN
cord-014462-11ggaqf1	587	5	progress	progress	NN
cord-014462-11ggaqf1	587	6	on	on	IN
cord-014462-11ggaqf1	587	7	the	the	DT
cord-014462-11ggaqf1	587	8	generation	generation	NN
cord-014462-11ggaqf1	587	9	of	of	IN
cord-014462-11ggaqf1	587	10	Citrus	Citrus	NNP
cord-014462-11ggaqf1	587	11	transformants	transformant	NNS
cord-014462-11ggaqf1	587	12	using	use	VBG
cord-014462-11ggaqf1	587	13	RNAi	RNAi	NNS
cord-014462-11ggaqf1	587	14	construct	construct	VBP
cord-014462-11ggaqf1	587	15	harboring	harbor	VBG
cord-014462-11ggaqf1	587	16	CTV	CTV	NNP
cord-014462-11ggaqf1	587	17	CP	CP	NNP
cord-014462-11ggaqf1	587	18	and	and	CC
cord-014462-11ggaqf1	587	19	p23	p23	NN
cord-014462-11ggaqf1	587	20	genes	gene	NNS
cord-014462-11ggaqf1	587	21	,	,	,
cord-014462-11ggaqf1	587	22	singly	singly	RB
cord-014462-11ggaqf1	587	23	and	and	CC
cord-014462-11ggaqf1	587	24	in	in	IN
cord-014462-11ggaqf1	587	25	conjunction	conjunction	NN
cord-014462-11ggaqf1	587	26	.	.	.
cord-014462-11ggaqf1	588	1	Our	-PRON-	PRP$
cord-014462-11ggaqf1	588	2	lab	lab	NN
cord-014462-11ggaqf1	588	3	was	be	VBD
cord-014462-11ggaqf1	588	4	also	also	RB
cord-014462-11ggaqf1	588	5	involved	involve	VBN
cord-014462-11ggaqf1	588	6	in	in	IN
cord-014462-11ggaqf1	588	7	developing	develop	VBG
cord-014462-11ggaqf1	588	8	rice	rice	NN
cord-014462-11ggaqf1	588	9	transgenics	transgenic	NNS
cord-014462-11ggaqf1	588	10	for	for	IN
cord-014462-11ggaqf1	588	11	resistance	resistance	NN
cord-014462-11ggaqf1	588	12	against	against	IN
cord-014462-11ggaqf1	588	13	Rice	Rice	NNP
cord-014462-11ggaqf1	588	14	tungro	tungro	NNP
cord-014462-11ggaqf1	588	15	disease	disease	NN
cord-014462-11ggaqf1	588	16	,	,	,
cord-014462-11ggaqf1	588	17	which	which	WDT
cord-014462-11ggaqf1	588	18	is	be	VBZ
cord-014462-11ggaqf1	588	19	one	one	CD
cord-014462-11ggaqf1	588	20	of	of	IN
cord-014462-11ggaqf1	588	21	the	the	DT
cord-014462-11ggaqf1	588	22	most	most	RBS
cord-014462-11ggaqf1	588	23	important	important	JJ
cord-014462-11ggaqf1	588	24	and	and	CC
cord-014462-11ggaqf1	588	25	widespread	widespread	JJ
cord-014462-11ggaqf1	588	26	virus	virus	NN
cord-014462-11ggaqf1	588	27	diseases	disease	NNS
cord-014462-11ggaqf1	588	28	of	of	IN
cord-014462-11ggaqf1	588	29	rice	rice	NN
cord-014462-11ggaqf1	588	30	in	in	IN
cord-014462-11ggaqf1	588	31	South	South	NNP
cord-014462-11ggaqf1	588	32	and	and	CC
cord-014462-11ggaqf1	588	33	Southeast	Southeast	NNP
cord-014462-11ggaqf1	588	34	Asia	Asia	NNP
cord-014462-11ggaqf1	588	35	,	,	,
cord-014462-11ggaqf1	588	36	causing	cause	VBG
cord-014462-11ggaqf1	588	37	an	an	DT
cord-014462-11ggaqf1	588	38	annual	annual	JJ
cord-014462-11ggaqf1	588	39	estimated	estimate	VBN
cord-014462-11ggaqf1	588	40	loss	loss	NN
cord-014462-11ggaqf1	588	41	in	in	IN
cord-014462-11ggaqf1	588	42	crop	crop	NN
cord-014462-11ggaqf1	588	43	yield	yield	NN
cord-014462-11ggaqf1	588	44	of	of	IN
cord-014462-11ggaqf1	588	45	Economic	economic	JJ
cord-014462-11ggaqf1	588	46	losses	loss	NNS
cord-014462-11ggaqf1	588	47	worth	worth	JJ
cord-014462-11ggaqf1	588	48	millions	million	NNS
cord-014462-11ggaqf1	588	49	of	of	IN
cord-014462-11ggaqf1	588	50	rupees	rupee	NNS
cord-014462-11ggaqf1	588	51	are	be	VBP
cord-014462-11ggaqf1	588	52	caused	cause	VBN
cord-014462-11ggaqf1	588	53	due	due	IN
cord-014462-11ggaqf1	588	54	to	to	IN
cord-014462-11ggaqf1	588	55	these	these	DT
cord-014462-11ggaqf1	588	56	diseases	disease	NNS
cord-014462-11ggaqf1	588	57	annually	annually	RB
cord-014462-11ggaqf1	588	58	.	.	.
cord-014462-11ggaqf1	589	1	Virus	virus	NN
cord-014462-11ggaqf1	589	2	diseases	disease	NNS
cord-014462-11ggaqf1	589	3	are	be	VBP
cord-014462-11ggaqf1	589	4	frequently	frequently	RB
cord-014462-11ggaqf1	589	5	less	less	RBR
cord-014462-11ggaqf1	589	6	conspicuous	conspicuous	JJ
cord-014462-11ggaqf1	589	7	than	than	IN
cord-014462-11ggaqf1	589	8	those	those	DT
cord-014462-11ggaqf1	589	9	caused	cause	VBN
cord-014462-11ggaqf1	589	10	by	by	IN
cord-014462-11ggaqf1	589	11	other	other	JJ
cord-014462-11ggaqf1	589	12	plant	plant	NN
cord-014462-11ggaqf1	589	13	pathogens	pathogen	NNS
cord-014462-11ggaqf1	589	14	and	and	CC
cord-014462-11ggaqf1	589	15	last	last	JJ
cord-014462-11ggaqf1	589	16	for	for	IN
cord-014462-11ggaqf1	589	17	much	much	RB
cord-014462-11ggaqf1	589	18	longer	long	JJR
cord-014462-11ggaqf1	589	19	.	.	.
cord-014462-11ggaqf1	590	1	This	this	DT
cord-014462-11ggaqf1	590	2	is	be	VBZ
cord-014462-11ggaqf1	590	3	especially	especially	RB
cord-014462-11ggaqf1	590	4	true	true	JJ
cord-014462-11ggaqf1	590	5	for	for	IN
cord-014462-11ggaqf1	590	6	perennial	perennial	JJ
cord-014462-11ggaqf1	590	7	crops	crop	NNS
cord-014462-11ggaqf1	590	8	and	and	CC
cord-014462-11ggaqf1	590	9	those	those	DT
cord-014462-11ggaqf1	590	10	that	that	WDT
cord-014462-11ggaqf1	590	11	are	be	VBP
cord-014462-11ggaqf1	590	12	vegetatively	vegetatively	RB
cord-014462-11ggaqf1	590	13	propagated	propagate	VBN
cord-014462-11ggaqf1	590	14	.	.	.
cord-014462-11ggaqf1	591	1	One	one	CD
cord-014462-11ggaqf1	591	2	further	further	JJ
cord-014462-11ggaqf1	591	3	problem	problem	NN
cord-014462-11ggaqf1	591	4	with	with	IN
cord-014462-11ggaqf1	591	5	attending	attend	VBG
cord-014462-11ggaqf1	591	6	to	to	TO
cord-014462-11ggaqf1	591	7	assess	assess	VB
cord-014462-11ggaqf1	591	8	losses	loss	NNS
cord-014462-11ggaqf1	591	9	due	due	JJ
cord-014462-11ggaqf1	591	10	to	to	IN
cord-014462-11ggaqf1	591	11	various	various	JJ
cord-014462-11ggaqf1	591	12	diseases	disease	NNS
cord-014462-11ggaqf1	591	13	on	on	IN
cord-014462-11ggaqf1	591	14	a	a	DT
cord-014462-11ggaqf1	591	15	global	global	JJ
cord-014462-11ggaqf1	591	16	basis	basis	NN
cord-014462-11ggaqf1	591	17	is	be	VBZ
cord-014462-11ggaqf1	591	18	that	that	IN
cord-014462-11ggaqf1	591	19	what	what	WP
cord-014462-11ggaqf1	591	20	most	most	JJS
cord-014462-11ggaqf1	591	21	of	of	IN
cord-014462-11ggaqf1	591	22	the	the	DT
cord-014462-11ggaqf1	591	23	data	datum	NNS
cord-014462-11ggaqf1	591	24	are	be	VBP
cord-014462-11ggaqf1	591	25	from	from	IN
cord-014462-11ggaqf1	591	26	small	small	JJ
cord-014462-11ggaqf1	591	27	comparative	comparative	JJ
cord-014462-11ggaqf1	591	28	trials	trial	NNS
cord-014462-11ggaqf1	591	29	rather	rather	RB
cord-014462-11ggaqf1	591	30	than	than	IN
cord-014462-11ggaqf1	591	31	wide	wide	JJ
cord-014462-11ggaqf1	591	32	scale	scale	VB
cord-014462-11ggaqf1	591	33	comprehensive	comprehensive	JJ
cord-014462-11ggaqf1	591	34	surveys	survey	NNS
cord-014462-11ggaqf1	591	35	,	,	,
cord-014462-11ggaqf1	591	36	even	even	RB
cord-014462-11ggaqf1	591	37	the	the	DT
cord-014462-11ggaqf1	591	38	small	small	JJ
cord-014462-11ggaqf1	591	39	trials	trial	NNS
cord-014462-11ggaqf1	591	40	do	do	VBP
cord-014462-11ggaqf1	591	41	not	not	RB
cord-014462-11ggaqf1	591	42	necessarily	necessarily	RB
cord-014462-11ggaqf1	591	43	give	give	VB
cord-014462-11ggaqf1	591	44	data	datum	NNS
cord-014462-11ggaqf1	591	45	that	that	WDT
cord-014462-11ggaqf1	591	46	can	can	MD
cord-014462-11ggaqf1	591	47	be	be	VB
cord-014462-11ggaqf1	591	48	used	use	VBN
cord-014462-11ggaqf1	591	49	for	for	IN
cord-014462-11ggaqf1	591	50	more	more	JJR
cord-014462-11ggaqf1	591	51	global	global	JJ
cord-014462-11ggaqf1	591	52	estimates	estimate	NNS
cord-014462-11ggaqf1	591	53	of	of	IN
cord-014462-11ggaqf1	591	54	losses	loss	NNS
cord-014462-11ggaqf1	591	55	.	.	.
cord-014462-11ggaqf1	592	1	This	this	DT
cord-014462-11ggaqf1	592	2	is	be	VBZ
cord-014462-11ggaqf1	592	3	for	for	IN
cord-014462-11ggaqf1	592	4	several	several	JJ
cord-014462-11ggaqf1	592	5	reasons	reason	NNS
cord-014462-11ggaqf1	592	6	,	,	,
cord-014462-11ggaqf1	592	7	including	include	VBG
cord-014462-11ggaqf1	592	8	:	:	:
cord-014462-11ggaqf1	592	9	(	(	-LRB-
cord-014462-11ggaqf1	592	10	1	1	LS
cord-014462-11ggaqf1	592	11	)	)	-RRB-
cord-014462-11ggaqf1	592	12	variation	variation	NN
cord-014462-11ggaqf1	592	13	in	in	IN
cord-014462-11ggaqf1	592	14	losses	loss	NNS
cord-014462-11ggaqf1	592	15	by	by	IN
cord-014462-11ggaqf1	592	16	a	a	DT
cord-014462-11ggaqf1	592	17	particular	particular	JJ
cord-014462-11ggaqf1	592	18	crop	crop	NN
cord-014462-11ggaqf1	592	19	from	from	IN
cord-014462-11ggaqf1	592	20	year	year	NN
cord-014462-11ggaqf1	592	21	to	to	IN
cord-014462-11ggaqf1	592	22	year	year	NN
cord-014462-11ggaqf1	592	23	;	;	,
cord-014462-11ggaqf1	592	24	(	(	-LRB-
cord-014462-11ggaqf1	592	25	2	2	LS
cord-014462-11ggaqf1	592	26	)	)	-RRB-
cord-014462-11ggaqf1	592	27	variation	variation	NN
cord-014462-11ggaqf1	592	28	from	from	IN
cord-014462-11ggaqf1	592	29	region	region	NN
cord-014462-11ggaqf1	592	30	to	to	IN
cord-014462-11ggaqf1	592	31	region	region	NN
cord-014462-11ggaqf1	592	32	and	and	CC
cord-014462-11ggaqf1	592	33	climatic	climatic	JJ
cord-014462-11ggaqf1	592	34	zone	zone	NN
cord-014462-11ggaqf1	592	35	to	to	IN
cord-014462-11ggaqf1	592	36	climatic	climatic	JJ
cord-014462-11ggaqf1	592	37	zone	zone	NN
cord-014462-11ggaqf1	592	38	:	:	:
cord-014462-11ggaqf1	592	39	(	(	-LRB-
cord-014462-11ggaqf1	592	40	3	3	LS
cord-014462-11ggaqf1	592	41	)	)	-RRB-
cord-014462-11ggaqf1	592	42	differences	difference	NNS
cord-014462-11ggaqf1	592	43	in	in	IN
cord-014462-11ggaqf1	592	44	loss	loss	NN
cord-014462-11ggaqf1	592	45	assessment	assessment	NN
cord-014462-11ggaqf1	592	46	methodologies	methodology	NNS
cord-014462-11ggaqf1	592	47	;	;	,
cord-014462-11ggaqf1	592	48	(	(	-LRB-
cord-014462-11ggaqf1	592	49	4	4	LS
cord-014462-11ggaqf1	592	50	)	)	-RRB-
cord-014462-11ggaqf1	592	51	identification	identification	NN
cord-014462-11ggaqf1	592	52	of	of	IN
cord-014462-11ggaqf1	592	53	the	the	DT
cord-014462-11ggaqf1	592	54	viral	viral	JJ
cord-014462-11ggaqf1	592	55	etiology	etiology	NN
cord-014462-11ggaqf1	592	56	of	of	IN
cord-014462-11ggaqf1	592	57	the	the	DT
cord-014462-11ggaqf1	592	58	disease	disease	NN
cord-014462-11ggaqf1	592	59	;	;	:
cord-014462-11ggaqf1	592	60	5	5	CD
cord-014462-11ggaqf1	592	61	variation	variation	NN
cord-014462-11ggaqf1	592	62	in	in	IN
cord-014462-11ggaqf1	592	63	the	the	DT
cord-014462-11ggaqf1	592	64	definition	definition	NN
cord-014462-11ggaqf1	592	65	of	of	IN
cord-014462-11ggaqf1	592	66	the	the	DT
cord-014462-11ggaqf1	592	67	term	term	NN
cord-014462-11ggaqf1	592	68	'	'	``
cord-014462-11ggaqf1	592	69	losses	loss	NNS
cord-014462-11ggaqf1	592	70	'	'	''
cord-014462-11ggaqf1	592	71	and	and	CC
cord-014462-11ggaqf1	592	72	(	(	-LRB-
cord-014462-11ggaqf1	592	73	6	6	CD
cord-014462-11ggaqf1	592	74	)	)	-RRB-
cord-014462-11ggaqf1	593	1	Chilli	Chilli	NNP
cord-014462-11ggaqf1	593	2	is	be	VBZ
cord-014462-11ggaqf1	593	3	the	the	DT
cord-014462-11ggaqf1	593	4	major	major	JJ
cord-014462-11ggaqf1	593	5	vegetable	vegetable	NN
cord-014462-11ggaqf1	593	6	and	and	CC
cord-014462-11ggaqf1	593	7	spice	spice	NN
cord-014462-11ggaqf1	593	8	crop	crop	NN
cord-014462-11ggaqf1	593	9	grown	grow	VBN
cord-014462-11ggaqf1	593	10	in	in	IN
cord-014462-11ggaqf1	593	11	Thar	Thar	NNP
cord-014462-11ggaqf1	593	12	Desert	Desert	NNP
cord-014462-11ggaqf1	593	13	areas	area	NNS
cord-014462-11ggaqf1	593	14	of	of	IN
cord-014462-11ggaqf1	593	15	Rajasthan	Rajasthan	NNP
cord-014462-11ggaqf1	593	16	.	.	.
cord-014462-11ggaqf1	594	1	Leaf	leaf	NN
cord-014462-11ggaqf1	594	2	curl	curl	NN
cord-014462-11ggaqf1	594	3	disease	disease	NN
cord-014462-11ggaqf1	594	4	(	(	-LRB-
cord-014462-11ggaqf1	594	5	ChLCD	ChLCD	NNP
cord-014462-11ggaqf1	594	6	)	)	-RRB-
cord-014462-11ggaqf1	594	7	is	be	VBZ
cord-014462-11ggaqf1	594	8	one	one	CD
cord-014462-11ggaqf1	594	9	of	of	IN
cord-014462-11ggaqf1	594	10	the	the	DT
cord-014462-11ggaqf1	594	11	major	major	JJ
cord-014462-11ggaqf1	594	12	constrains	constrain	NNS
cord-014462-11ggaqf1	594	13	in	in	IN
cord-014462-11ggaqf1	594	14	chilli	chilli	NN
cord-014462-11ggaqf1	594	15	cultivation	cultivation	NN
cord-014462-11ggaqf1	594	16	faced	face	VBN
cord-014462-11ggaqf1	594	17	by	by	IN
cord-014462-11ggaqf1	594	18	farmers	farmer	NNS
cord-014462-11ggaqf1	594	19	and	and	CC
cord-014462-11ggaqf1	594	20	cause	cause	VB
cord-014462-11ggaqf1	594	21	yield	yield	NN
cord-014462-11ggaqf1	594	22	loss	loss	NN
cord-014462-11ggaqf1	594	23	up	up	IN
cord-014462-11ggaqf1	594	24	to	to	TO
cord-014462-11ggaqf1	594	25	100	100	CD
cord-014462-11ggaqf1	594	26	%	%	NN
cord-014462-11ggaqf1	594	27	.	.	.
cord-014462-11ggaqf1	595	1	A	a	DT
cord-014462-11ggaqf1	595	2	survey	survey	NN
cord-014462-11ggaqf1	595	3	was	be	VBD
cord-014462-11ggaqf1	595	4	conducted	conduct	VBN
cord-014462-11ggaqf1	595	5	in	in	IN
cord-014462-11ggaqf1	595	6	major	major	JJ
cord-014462-11ggaqf1	595	7	chilli	chilli	NN
cord-014462-11ggaqf1	595	8	growing	grow	VBG
cord-014462-11ggaqf1	595	9	areas	area	NNS
cord-014462-11ggaqf1	595	10	of	of	IN
cord-014462-11ggaqf1	595	11	Thar	Thar	NNP
cord-014462-11ggaqf1	595	12	Desert	Desert	NNP
cord-014462-11ggaqf1	595	13	;	;	:
cord-014462-11ggaqf1	595	14	Bikaner	Bikaner	NNP
cord-014462-11ggaqf1	595	15	,	,	,
cord-014462-11ggaqf1	595	16	Nagur	Nagur	NNP
cord-014462-11ggaqf1	595	17	,	,	,
cord-014462-11ggaqf1	595	18	Jodhpur	Jodhpur	NNP
cord-014462-11ggaqf1	595	19	and	and	CC
cord-014462-11ggaqf1	595	20	Jalore	Jalore	NNP
cord-014462-11ggaqf1	595	21	districts	district	NNS
cord-014462-11ggaqf1	595	22	of	of	IN
cord-014462-11ggaqf1	595	23	Rajasthan	Rajasthan	NNP
cord-014462-11ggaqf1	595	24	during	during	IN
cord-014462-11ggaqf1	595	25	November	November	NNP
cord-014462-11ggaqf1	595	26	,	,	,
cord-014462-11ggaqf1	595	27	2009	2009	CD
cord-014462-11ggaqf1	595	28	to	to	TO
cord-014462-11ggaqf1	595	29	understand	understand	VB
cord-014462-11ggaqf1	595	30	the	the	DT
cord-014462-11ggaqf1	595	31	present	present	JJ
cord-014462-11ggaqf1	595	32	status	status	NN
cord-014462-11ggaqf1	595	33	of	of	IN
cord-014462-11ggaqf1	595	34	leaf	leaf	NN
cord-014462-11ggaqf1	595	35	curl	curl	NN
cord-014462-11ggaqf1	595	36	disease	disease	NN
cord-014462-11ggaqf1	595	37	in	in	IN
cord-014462-11ggaqf1	595	38	Chilli	Chilli	NNP
cord-014462-11ggaqf1	595	39	.	.	.
cord-014462-11ggaqf1	596	1	Among	among	IN
cord-014462-11ggaqf1	596	2	the	the	DT
cord-014462-11ggaqf1	596	3	four	four	CD
cord-014462-11ggaqf1	596	4	district	district	NN
cord-014462-11ggaqf1	596	5	surveyed	survey	VBN
cord-014462-11ggaqf1	596	6	for	for	IN
cord-014462-11ggaqf1	596	7	ChLCD	ChLCD	NNP
cord-014462-11ggaqf1	596	8	,	,	,
cord-014462-11ggaqf1	596	9	the	the	DT
cord-014462-11ggaqf1	596	10	disease	disease	NN
cord-014462-11ggaqf1	596	11	incidence	incidence	NN
cord-014462-11ggaqf1	596	12	was	be	VBD
cord-014462-11ggaqf1	596	13	recorded	record	VBN
cord-014462-11ggaqf1	596	14	maximum	maximum	NN
cord-014462-11ggaqf1	596	15	(	(	-LRB-
cord-014462-11ggaqf1	596	16	up	up	IN
cord-014462-11ggaqf1	596	17	to	to	TO
cord-014462-11ggaqf1	596	18	98	98	CD
cord-014462-11ggaqf1	596	19	%	%	NN
cord-014462-11ggaqf1	596	20	)	)	-RRB-
cord-014462-11ggaqf1	596	21	in	in	IN
cord-014462-11ggaqf1	596	22	Jodhpur	Jodhpur	NNP
cord-014462-11ggaqf1	596	23	district	district	NN
cord-014462-11ggaqf1	596	24	followed	follow	VBN
cord-014462-11ggaqf1	596	25	by	by	IN
cord-014462-11ggaqf1	596	26	Jolore	Jolore	NNP
cord-014462-11ggaqf1	596	27	district	district	NN
cord-014462-11ggaqf1	596	28	(	(	-LRB-
cord-014462-11ggaqf1	596	29	up	up	IN
cord-014462-11ggaqf1	596	30	to	to	TO
cord-014462-11ggaqf1	596	31	88	88	CD
cord-014462-11ggaqf1	596	32	%	%	NN
cord-014462-11ggaqf1	596	33	)	)	-RRB-
cord-014462-11ggaqf1	596	34	.	.	.
cord-014462-11ggaqf1	597	1	No	no	DT
cord-014462-11ggaqf1	597	2	relation	relation	NN
cord-014462-11ggaqf1	597	3	was	be	VBD
cord-014462-11ggaqf1	597	4	found	find	VBN
cord-014462-11ggaqf1	597	5	between	between	IN
cord-014462-11ggaqf1	597	6	the	the	DT
cord-014462-11ggaqf1	597	7	disease	disease	NN
cord-014462-11ggaqf1	597	8	incidence	incidence	NN
cord-014462-11ggaqf1	597	9	and	and	CC
cord-014462-11ggaqf1	597	10	varieties	variety	NNS
cord-014462-11ggaqf1	597	11	.	.	.
cord-014462-11ggaqf1	598	1	The	the	DT
cord-014462-11ggaqf1	598	2	major	major	JJ
cord-014462-11ggaqf1	598	3	varieties	variety	NNS
cord-014462-11ggaqf1	598	4	grown	grow	VBN
cord-014462-11ggaqf1	598	5	in	in	IN
cord-014462-11ggaqf1	598	6	these	these	DT
cord-014462-11ggaqf1	598	7	area	area	NN
cord-014462-11ggaqf1	598	8	are	be	VBP
cord-014462-11ggaqf1	598	9	;	;	:
cord-014462-11ggaqf1	598	10	Mehsana	Mehsana	NNP
cord-014462-11ggaqf1	598	11	,	,	,
cord-014462-11ggaqf1	598	12	RCH	RCH	NNP
cord-014462-11ggaqf1	598	13	(	(	-LRB-
cord-014462-11ggaqf1	598	14	Mandoria	Mandoria	NNP
cord-014462-11ggaqf1	598	15	)	)	-RRB-
cord-014462-11ggaqf1	598	16	,	,	,
cord-014462-11ggaqf1	598	17	Haripur	Haripur	NNP
cord-014462-11ggaqf1	598	18	Raipur	Raipur	NNP
cord-014462-11ggaqf1	598	19	,	,	,
cord-014462-11ggaqf1	598	20	Mathania	Mathania	NNP
cord-014462-11ggaqf1	598	21	and	and	CC
cord-014462-11ggaqf1	598	22	local	local	JJ
cord-014462-11ggaqf1	598	23	cultivars	cultivar	NNS
cord-014462-11ggaqf1	598	24	.	.	.
cord-014462-11ggaqf1	599	1	The	the	DT
cord-014462-11ggaqf1	599	2	number	number	NN
cord-014462-11ggaqf1	599	3	of	of	IN
cord-014462-11ggaqf1	599	4	whitefly	whitefly	NN
cord-014462-11ggaqf1	599	5	was	be	VBD
cord-014462-11ggaqf1	599	6	also	also	RB
cord-014462-11ggaqf1	599	7	counted	count	VBN
cord-014462-11ggaqf1	599	8	in	in	IN
cord-014462-11ggaqf1	599	9	top	top	JJ
cord-014462-11ggaqf1	599	10	,	,	,
cord-014462-11ggaqf1	599	11	middle	middle	JJ
cord-014462-11ggaqf1	599	12	and	and	CC
cord-014462-11ggaqf1	599	13	bottom	bottom	JJ
cord-014462-11ggaqf1	599	14	leaf	leaf	NN
cord-014462-11ggaqf1	599	15	of	of	IN
cord-014462-11ggaqf1	599	16	chilli	chilli	NN
cord-014462-11ggaqf1	599	17	grown	grow	VBN
cord-014462-11ggaqf1	599	18	in	in	IN
cord-014462-11ggaqf1	599	19	these	these	DT
cord-014462-11ggaqf1	599	20	areas	area	NNS
cord-014462-11ggaqf1	599	21	.	.	.
cord-014462-11ggaqf1	600	1	The	the	DT
cord-014462-11ggaqf1	600	2	average	average	JJ
cord-014462-11ggaqf1	600	3	number	number	NN
cord-014462-11ggaqf1	600	4	of	of	IN
cord-014462-11ggaqf1	600	5	whitefly	whitefly	NN
cord-014462-11ggaqf1	600	6	per	per	IN
cord-014462-11ggaqf1	600	7	plant	plant	NN
cord-014462-11ggaqf1	600	8	ranged	range	VBD
cord-014462-11ggaqf1	600	9	from	from	IN
cord-014462-11ggaqf1	600	10	0.0	0.0	CD
cord-014462-11ggaqf1	600	11	to	to	IN
cord-014462-11ggaqf1	600	12	4.0	4.0	CD
cord-014462-11ggaqf1	600	13	.	.	.
cord-014462-11ggaqf1	601	1	More	More	JJR
cord-014462-11ggaqf1	601	2	number	number	NN
cord-014462-11ggaqf1	601	3	of	of	IN
cord-014462-11ggaqf1	601	4	whitefly	whitefly	NN
cord-014462-11ggaqf1	601	5	(	(	-LRB-
cord-014462-11ggaqf1	601	6	4.0	4.0	CD
cord-014462-11ggaqf1	601	7	)	)	-RRB-
cord-014462-11ggaqf1	601	8	was	be	VBD
cord-014462-11ggaqf1	601	9	recorded	record	VBN
cord-014462-11ggaqf1	601	10	in	in	IN
cord-014462-11ggaqf1	601	11	Jodhpur	Jodhpur	NNP
cord-014462-11ggaqf1	601	12	district	district	NN
cord-014462-11ggaqf1	601	13	and	and	CC
cord-014462-11ggaqf1	601	14	lowest	low	JJS
cord-014462-11ggaqf1	601	15	(	(	-LRB-
cord-014462-11ggaqf1	601	16	1.8	1.8	CD
cord-014462-11ggaqf1	601	17	)	)	-RRB-
cord-014462-11ggaqf1	601	18	in	in	IN
cord-014462-11ggaqf1	601	19	Jalore	Jalore	NNP
cord-014462-11ggaqf1	601	20	district	district	NN
cord-014462-11ggaqf1	601	21	.	.	.
cord-014462-11ggaqf1	602	1	Total	total	JJ
cord-014462-11ggaqf1	602	2	DNA	DNA	NNP
cord-014462-11ggaqf1	602	3	was	be	VBD
cord-014462-11ggaqf1	602	4	extracted	extract	VBN
cord-014462-11ggaqf1	602	5	from	from	IN
cord-014462-11ggaqf1	603	1	three	three	CD
cord-014462-11ggaqf1	603	2	leaf	leaf	NN
cord-014462-11ggaqf1	603	3	curl	curl	NN
cord-014462-11ggaqf1	603	4	infected	infect	VBN
cord-014462-11ggaqf1	603	5	samples	sample	NNS
cord-014462-11ggaqf1	603	6	from	from	IN
cord-014462-11ggaqf1	603	7	each	each	DT
cord-014462-11ggaqf1	603	8	district	district	NN
cord-014462-11ggaqf1	603	9	and	and	CC
cord-014462-11ggaqf1	603	10	tested	test	VBN
cord-014462-11ggaqf1	603	11	for	for	IN
cord-014462-11ggaqf1	603	12	the	the	DT
cord-014462-11ggaqf1	603	13	presence	presence	NN
cord-014462-11ggaqf1	603	14	of	of	IN
cord-014462-11ggaqf1	603	15	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	603	16	using	use	VBG
cord-014462-11ggaqf1	603	17	coat	coat	NN
cord-014462-11ggaqf1	603	18	protein	protein	NN
cord-014462-11ggaqf1	603	19	(	(	-LRB-
cord-014462-11ggaqf1	603	20	CP	CP	NNP
cord-014462-11ggaqf1	603	21	)	)	-RRB-
cord-014462-11ggaqf1	603	22	and	and	CC
cord-014462-11ggaqf1	603	23	DNA	dna	NN
cord-014462-11ggaqf1	603	24	-	-	HYPH
cord-014462-11ggaqf1	603	25	b	b	NN
cord-014462-11ggaqf1	603	26	specific	specific	JJ
cord-014462-11ggaqf1	603	27	primers	primer	NNS
cord-014462-11ggaqf1	603	28	.	.	.
cord-014462-11ggaqf1	604	1	All	all	PDT
cord-014462-11ggaqf1	604	2	the	the	DT
cord-014462-11ggaqf1	604	3	samples	sample	NNS
cord-014462-11ggaqf1	604	4	were	be	VBD
cord-014462-11ggaqf1	604	5	positive	positive	JJ
cord-014462-11ggaqf1	604	6	for	for	IN
cord-014462-11ggaqf1	604	7	CP	cp	NN
cord-014462-11ggaqf1	604	8	and	and	CC
cord-014462-11ggaqf1	604	9	DNA	dna	NN
cord-014462-11ggaqf1	604	10	-	-	HYPH
cord-014462-11ggaqf1	604	11	b	b	NN
cord-014462-11ggaqf1	604	12	amplifications	amplification	NNS
cord-014462-11ggaqf1	604	13	by	by	IN
cord-014462-11ggaqf1	604	14	PCR	PCR	NNP
cord-014462-11ggaqf1	604	15	.	.	.
cord-014462-11ggaqf1	605	1	The	the	DT
cord-014462-11ggaqf1	605	2	cloning	cloning	NN
cord-014462-11ggaqf1	605	3	and	and	CC
cord-014462-11ggaqf1	605	4	sequencing	sequencing	NN
cord-014462-11ggaqf1	605	5	of	of	IN
cord-014462-11ggaqf1	605	6	selected	select	VBN
cord-014462-11ggaqf1	605	7	CP	cp	NN
cord-014462-11ggaqf1	605	8	gene	gene	NN
cord-014462-11ggaqf1	605	9	and	and	CC
cord-014462-11ggaqf1	605	10	DNA	dna	NN
cord-014462-11ggaqf1	605	11	-	-	HYPH
cord-014462-11ggaqf1	605	12	b	b	NN
cord-014462-11ggaqf1	605	13	fragments	fragment	NNS
cord-014462-11ggaqf1	605	14	are	be	VBP
cord-014462-11ggaqf1	605	15	in	in	IN
cord-014462-11ggaqf1	605	16	progress	progress	NN
cord-014462-11ggaqf1	605	17	.	.	.
cord-014462-11ggaqf1	606	1	The	the	DT
cord-014462-11ggaqf1	606	2	preliminary	preliminary	JJ
cord-014462-11ggaqf1	606	3	investigations	investigation	NNS
cord-014462-11ggaqf1	606	4	shows	show	VBZ
cord-014462-11ggaqf1	606	5	that	that	IN
cord-014462-11ggaqf1	606	6	the	the	DT
cord-014462-11ggaqf1	606	7	leaf	leaf	NN
cord-014462-11ggaqf1	606	8	curl	curl	NN
cord-014462-11ggaqf1	606	9	disease	disease	NN
cord-014462-11ggaqf1	606	10	of	of	IN
cord-014462-11ggaqf1	606	11	chilli	chilli	NN
cord-014462-11ggaqf1	606	12	is	be	VBZ
cord-014462-11ggaqf1	606	13	widespread	widespread	JJ
cord-014462-11ggaqf1	606	14	in	in	IN
cord-014462-11ggaqf1	606	15	the	the	DT
cord-014462-11ggaqf1	606	16	arid	arid	JJ
cord-014462-11ggaqf1	606	17	region	region	NN
cord-014462-11ggaqf1	606	18	of	of	IN
cord-014462-11ggaqf1	606	19	Rajasthan	Rajasthan	NNP
cord-014462-11ggaqf1	606	20	and	and	CC
cord-014462-11ggaqf1	606	21	may	may	MD
cord-014462-11ggaqf1	606	22	be	be	VB
cord-014462-11ggaqf1	606	23	caused	cause	VBN
cord-014462-11ggaqf1	606	24	by	by	IN
cord-014462-11ggaqf1	606	25	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	606	26	associated	associate	VBN
cord-014462-11ggaqf1	606	27	with	with	IN
cord-014462-11ggaqf1	606	28	satellite	satellite	NN
cord-014462-11ggaqf1	606	29	DNA	dna	NN
cord-014462-11ggaqf1	606	30	-	-	HYPH
cord-014462-11ggaqf1	606	31	b	b	NN
cord-014462-11ggaqf1	606	32	.	.	.
cord-014462-11ggaqf1	607	1	Bittergourd	Bittergourd	NNP
cord-014462-11ggaqf1	607	2	(	(	-LRB-
cord-014462-11ggaqf1	607	3	Momordica	Momordica	NNP
cord-014462-11ggaqf1	607	4	charantia	charantia	NN
cord-014462-11ggaqf1	607	5	)	)	-RRB-
cord-014462-11ggaqf1	607	6	is	be	VBZ
cord-014462-11ggaqf1	607	7	an	an	DT
cord-014462-11ggaqf1	607	8	important	important	JJ
cord-014462-11ggaqf1	607	9	vegetable	vegetable	NN
cord-014462-11ggaqf1	607	10	crop	crop	NN
cord-014462-11ggaqf1	607	11	of	of	IN
cord-014462-11ggaqf1	607	12	Kerala	Kerala	NNP
cord-014462-11ggaqf1	607	13	.	.	.
cord-014462-11ggaqf1	608	1	The	the	DT
cord-014462-11ggaqf1	608	2	crop	crop	NN
cord-014462-11ggaqf1	608	3	is	be	VBZ
cord-014462-11ggaqf1	608	4	affected	affect	VBN
cord-014462-11ggaqf1	608	5	by	by	IN
cord-014462-11ggaqf1	608	6	several	several	JJ
cord-014462-11ggaqf1	608	7	diseases	disease	NNS
cord-014462-11ggaqf1	608	8	of	of	IN
cord-014462-11ggaqf1	608	9	which	which	WDT
cord-014462-11ggaqf1	608	10	Mosaic	Mosaic	NNP
cord-014462-11ggaqf1	608	11	is	be	VBZ
cord-014462-11ggaqf1	608	12	a	a	DT
cord-014462-11ggaqf1	608	13	prominent	prominent	JJ
cord-014462-11ggaqf1	608	14	one	one	CD
cord-014462-11ggaqf1	608	15	.	.	.
cord-014462-11ggaqf1	609	1	A	a	DT
cord-014462-11ggaqf1	609	2	field	field	NN
cord-014462-11ggaqf1	609	3	experiment	experiment	NN
cord-014462-11ggaqf1	609	4	was	be	VBD
cord-014462-11ggaqf1	609	5	conducted	conduct	VBN
cord-014462-11ggaqf1	609	6	to	to	TO
cord-014462-11ggaqf1	609	7	evaluate	evaluate	VB
cord-014462-11ggaqf1	609	8	the	the	DT
cord-014462-11ggaqf1	609	9	efficacy	efficacy	NN
cord-014462-11ggaqf1	609	10	of	of	IN
cord-014462-11ggaqf1	609	11	potentised	potentised	JJ
cord-014462-11ggaqf1	609	12	resistance	resistance	NN
cord-014462-11ggaqf1	609	13	inducing	induce	VBG
cord-014462-11ggaqf1	609	14	substances	substance	NNS
cord-014462-11ggaqf1	609	15	(	(	-LRB-
cord-014462-11ggaqf1	609	16	RIS	RIS	NNP
cord-014462-11ggaqf1	609	17	)	)	-RRB-
cord-014462-11ggaqf1	609	18	viz	viz	NN
cord-014462-11ggaqf1	609	19	.	.	.
cord-014462-11ggaqf1	610	1	,	,	,
cord-014462-11ggaqf1	610	2	mosaic	mosaic	NNP
cord-014462-11ggaqf1	610	3	affected	affect	VBN
cord-014462-11ggaqf1	610	4	bittergourd	bittergourd	NNP
cord-014462-11ggaqf1	610	5	plant	plant	NN
cord-014462-11ggaqf1	610	6	tissue	tissue	NN
cord-014462-11ggaqf1	610	7	,	,	,
cord-014462-11ggaqf1	610	8	ash	ash	NN
cord-014462-11ggaqf1	610	9	of	of	IN
cord-014462-11ggaqf1	610	10	mosaic	mosaic	JJ
cord-014462-11ggaqf1	610	11	affected	affect	VBN
cord-014462-11ggaqf1	610	12	bittergourd	bittergourd	NNP
cord-014462-11ggaqf1	610	13	plant	plant	NN
cord-014462-11ggaqf1	610	14	tissue	tissue	NN
cord-014462-11ggaqf1	610	15	,	,	,
cord-014462-11ggaqf1	610	16	plumbago	plumbago	JJ
cord-014462-11ggaqf1	610	17	and	and	CC
cord-014462-11ggaqf1	610	18	salicylic	salicylic	JJ
cord-014462-11ggaqf1	610	19	acid	acid	NN
cord-014462-11ggaqf1	610	20	for	for	IN
cord-014462-11ggaqf1	610	21	control	control	NN
cord-014462-11ggaqf1	610	22	of	of	IN
cord-014462-11ggaqf1	610	23	bittergourd	bittergourd	NNP
cord-014462-11ggaqf1	610	24	mosaic	mosaic	NNP
cord-014462-11ggaqf1	610	25	in	in	IN
cord-014462-11ggaqf1	610	26	March	March	NNP
cord-014462-11ggaqf1	610	27	2008	2008	CD
cord-014462-11ggaqf1	610	28	.	.	.
cord-014462-11ggaqf1	611	1	RIS	RIS	NNP
cord-014462-11ggaqf1	611	2	were	be	VBD
cord-014462-11ggaqf1	611	3	applied	apply	VBN
cord-014462-11ggaqf1	611	4	as	as	IN
cord-014462-11ggaqf1	611	5	drench	drench	NN
cord-014462-11ggaqf1	611	6	and	and	CC
cord-014462-11ggaqf1	611	7	foliar	foliar	NN
cord-014462-11ggaqf1	611	8	spray	spray	NN
cord-014462-11ggaqf1	611	9	at	at	IN
cord-014462-11ggaqf1	611	10	three	three	CD
cord-014462-11ggaqf1	611	11	potency	potency	NN
cord-014462-11ggaqf1	611	12	levels	level	NNS
cord-014462-11ggaqf1	611	13	twice	twice	RB
cord-014462-11ggaqf1	611	14	,	,	,
cord-014462-11ggaqf1	611	15	before	before	IN
cord-014462-11ggaqf1	611	16	flowering	flower	VBG
cord-014462-11ggaqf1	611	17	of	of	IN
cord-014462-11ggaqf1	611	18	the	the	DT
cord-014462-11ggaqf1	611	19	crop	crop	NN
cord-014462-11ggaqf1	611	20	.	.	.
cord-014462-11ggaqf1	612	1	The	the	DT
cord-014462-11ggaqf1	612	2	experimental	experimental	JJ
cord-014462-11ggaqf1	612	3	crop	crop	NN
cord-014462-11ggaqf1	612	4	was	be	VBD
cord-014462-11ggaqf1	612	5	grown	grow	VBN
cord-014462-11ggaqf1	612	6	as	as	IN
cord-014462-11ggaqf1	612	7	per	per	IN
cord-014462-11ggaqf1	612	8	the	the	DT
cord-014462-11ggaqf1	612	9	package	package	NN
cord-014462-11ggaqf1	612	10	of	of	IN
cord-014462-11ggaqf1	612	11	practice	practice	NN
cord-014462-11ggaqf1	612	12	recommendations	recommendation	NNS
cord-014462-11ggaqf1	612	13	in	in	IN
cord-014462-11ggaqf1	612	14	split	split	NN
cord-014462-11ggaqf1	612	15	plot	plot	NN
cord-014462-11ggaqf1	612	16	design	design	NN
cord-014462-11ggaqf1	612	17	with	with	IN
cord-014462-11ggaqf1	612	18	five	five	CD
cord-014462-11ggaqf1	612	19	replications	replication	NNS
cord-014462-11ggaqf1	612	20	per	per	IN
cord-014462-11ggaqf1	612	21	treatment	treatment	NN
cord-014462-11ggaqf1	612	22	.	.	.
cord-014462-11ggaqf1	613	1	The	the	DT
cord-014462-11ggaqf1	613	2	disease	disease	NN
cord-014462-11ggaqf1	613	3	incidence	incidence	NN
cord-014462-11ggaqf1	613	4	,	,	,
cord-014462-11ggaqf1	613	5	disease	disease	NN
cord-014462-11ggaqf1	613	6	severity	severity	NN
cord-014462-11ggaqf1	613	7	and	and	CC
cord-014462-11ggaqf1	613	8	yield	yield	NN
cord-014462-11ggaqf1	613	9	of	of	IN
cord-014462-11ggaqf1	613	10	the	the	DT
cord-014462-11ggaqf1	613	11	crop	crop	NN
cord-014462-11ggaqf1	613	12	were	be	VBD
cord-014462-11ggaqf1	613	13	recorded	record	VBN
cord-014462-11ggaqf1	613	14	.	.	.
cord-014462-11ggaqf1	614	1	The	the	DT
cord-014462-11ggaqf1	614	2	result	result	NN
cord-014462-11ggaqf1	614	3	of	of	IN
cord-014462-11ggaqf1	614	4	the	the	DT
cord-014462-11ggaqf1	614	5	experiment	experiment	NN
cord-014462-11ggaqf1	614	6	shows	show	VBZ
cord-014462-11ggaqf1	614	7	that	that	IN
cord-014462-11ggaqf1	614	8	spraying	spraying	NN
cord-014462-11ggaqf1	614	9	was	be	VBD
cord-014462-11ggaqf1	614	10	more	more	RBR
cord-014462-11ggaqf1	614	11	effective	effective	JJ
cord-014462-11ggaqf1	614	12	than	than	IN
cord-014462-11ggaqf1	614	13	drenching	drench	VBG
cord-014462-11ggaqf1	614	14	of	of	IN
cord-014462-11ggaqf1	614	15	treatments	treatment	NNS
cord-014462-11ggaqf1	614	16	for	for	IN
cord-014462-11ggaqf1	614	17	reducing	reduce	VBG
cord-014462-11ggaqf1	614	18	mosaic	mosaic	JJ
cord-014462-11ggaqf1	614	19	incidence	incidence	NN
cord-014462-11ggaqf1	614	20	and	and	CC
cord-014462-11ggaqf1	614	21	severity	severity	NN
cord-014462-11ggaqf1	614	22	.	.	.
cord-014462-11ggaqf1	615	1	Among	among	IN
cord-014462-11ggaqf1	615	2	treatments	treatment	NNS
cord-014462-11ggaqf1	615	3	,	,	,
cord-014462-11ggaqf1	615	4	infected	infected	JJ
cord-014462-11ggaqf1	615	5	plant	plant	NN
cord-014462-11ggaqf1	615	6	extract	extract	NN
cord-014462-11ggaqf1	615	7	at	at	IN
cord-014462-11ggaqf1	615	8	19	19	CD
cord-014462-11ggaqf1	615	9	potency	potency	NN
cord-014462-11ggaqf1	615	10	was	be	VBD
cord-014462-11ggaqf1	615	11	the	the	DT
cord-014462-11ggaqf1	615	12	most	most	RBS
cord-014462-11ggaqf1	615	13	effective	effective	JJ
cord-014462-11ggaqf1	615	14	one	one	NN
cord-014462-11ggaqf1	615	15	for	for	IN
cord-014462-11ggaqf1	615	16	reducing	reduce	VBG
cord-014462-11ggaqf1	615	17	mosaic	mosaic	JJ
cord-014462-11ggaqf1	615	18	incidence	incidence	NN
cord-014462-11ggaqf1	615	19	and	and	CC
cord-014462-11ggaqf1	615	20	it	-PRON-	PRP
cord-014462-11ggaqf1	615	21	showed	show	VBD
cord-014462-11ggaqf1	615	22	the	the	DT
cord-014462-11ggaqf1	615	23	maximum	maximum	JJ
cord-014462-11ggaqf1	615	24	incubation	incubation	NN
cord-014462-11ggaqf1	615	25	period	period	NN
cord-014462-11ggaqf1	615	26	and	and	CC
cord-014462-11ggaqf1	615	27	minimum	minimum	JJ
cord-014462-11ggaqf1	615	28	disease	disease	NN
cord-014462-11ggaqf1	615	29	severity	severity	NN
cord-014462-11ggaqf1	615	30	.	.	.
cord-014462-11ggaqf1	616	1	The	the	DT
cord-014462-11ggaqf1	616	2	spray	spray	NN
cord-014462-11ggaqf1	616	3	application	application	NN
cord-014462-11ggaqf1	616	4	of	of	IN
cord-014462-11ggaqf1	616	5	treatments	treatment	NNS
cord-014462-11ggaqf1	616	6	produced	produce	VBN
cord-014462-11ggaqf1	616	7	significantly	significantly	RB
cord-014462-11ggaqf1	616	8	higher	high	JJR
cord-014462-11ggaqf1	616	9	yield	yield	NN
cord-014462-11ggaqf1	616	10	than	than	IN
cord-014462-11ggaqf1	616	11	drenching	drench	VBG
cord-014462-11ggaqf1	616	12	.	.	.
cord-014462-11ggaqf1	617	1	Among	among	IN
cord-014462-11ggaqf1	617	2	the	the	DT
cord-014462-11ggaqf1	617	3	treatments	treatment	NNS
cord-014462-11ggaqf1	617	4	,	,	,
cord-014462-11ggaqf1	617	5	ash	ash	NN
cord-014462-11ggaqf1	617	6	of	of	IN
cord-014462-11ggaqf1	617	7	infected	infected	JJ
cord-014462-11ggaqf1	617	8	plant	plant	NN
cord-014462-11ggaqf1	617	9	at	at	IN
cord-014462-11ggaqf1	617	10	19	19	CD
cord-014462-11ggaqf1	617	11	and	and	CC
cord-014462-11ggaqf1	617	12	309	309	CD
cord-014462-11ggaqf1	617	13	potency	potency	NN
cord-014462-11ggaqf1	617	14	and	and	CC
cord-014462-11ggaqf1	617	15	infected	infected	JJ
cord-014462-11ggaqf1	617	16	plant	plant	NN
cord-014462-11ggaqf1	617	17	extract	extract	NN
cord-014462-11ggaqf1	617	18	at	at	IN
cord-014462-11ggaqf1	617	19	69	69	CD
cord-014462-11ggaqf1	617	20	potency	potency	NN
cord-014462-11ggaqf1	617	21	were	be	VBD
cord-014462-11ggaqf1	617	22	on	on	IN
cord-014462-11ggaqf1	617	23	par	par	NN
cord-014462-11ggaqf1	617	24	and	and	CC
cord-014462-11ggaqf1	617	25	produced	produce	VBD
cord-014462-11ggaqf1	617	26	comparatively	comparatively	RB
cord-014462-11ggaqf1	617	27	higher	high	JJR
cord-014462-11ggaqf1	617	28	yield	yield	NN
cord-014462-11ggaqf1	617	29	.	.	.
cord-014462-11ggaqf1	618	1	Elephant	elephant	NN
cord-014462-11ggaqf1	618	2	foot	foot	NN
cord-014462-11ggaqf1	618	3	yam	yam	NN
cord-014462-11ggaqf1	618	4	(	(	-LRB-
cord-014462-11ggaqf1	618	5	Amoprhophallus	Amoprhophallus	NNP
cord-014462-11ggaqf1	618	6	paeoniifolius	paeoniifolius	NN
cord-014462-11ggaqf1	618	7	)	)	-RRB-
cord-014462-11ggaqf1	618	8	,	,	,
cord-014462-11ggaqf1	618	9	colocasia	colocasia	NNP
cord-014462-11ggaqf1	618	10	(	(	-LRB-
cord-014462-11ggaqf1	618	11	Colocasia	Colocasia	NNP
cord-014462-11ggaqf1	618	12	esculenta	esculenta	NN
cord-014462-11ggaqf1	618	13	)	)	-RRB-
cord-014462-11ggaqf1	618	14	and	and	CC
cord-014462-11ggaqf1	618	15	tannia	tannia	NNP
cord-014462-11ggaqf1	618	16	(	(	-LRB-
cord-014462-11ggaqf1	618	17	Xanthosoma	Xanthosoma	NNP
cord-014462-11ggaqf1	618	18	sagittifolium	sagittifolium	NNP
cord-014462-11ggaqf1	618	19	)	)	-RRB-
cord-014462-11ggaqf1	618	20	are	be	VBP
cord-014462-11ggaqf1	618	21	the	the	DT
cord-014462-11ggaqf1	618	22	major	major	JJ
cord-014462-11ggaqf1	618	23	edible	edible	JJ
cord-014462-11ggaqf1	618	24	aroids	aroid	NNS
cord-014462-11ggaqf1	618	25	cultivated	cultivate	VBN
cord-014462-11ggaqf1	618	26	in	in	IN
cord-014462-11ggaqf1	618	27	India	India	NNP
cord-014462-11ggaqf1	618	28	.	.	.
cord-014462-11ggaqf1	619	1	The	the	DT
cord-014462-11ggaqf1	619	2	elephant	elephant	NN
cord-014462-11ggaqf1	619	3	foot	foot	NN
cord-014462-11ggaqf1	619	4	yam	yam	NN
cord-014462-11ggaqf1	619	5	cultivation	cultivation	NN
cord-014462-11ggaqf1	619	6	is	be	VBZ
cord-014462-11ggaqf1	619	7	gaining	gain	VBG
cord-014462-11ggaqf1	619	8	importance	importance	NN
cord-014462-11ggaqf1	619	9	due	due	IN
cord-014462-11ggaqf1	619	10	to	to	IN
cord-014462-11ggaqf1	619	11	its	-PRON-	PRP$
cord-014462-11ggaqf1	619	12	high	high	JJ
cord-014462-11ggaqf1	619	13	production	production	NN
cord-014462-11ggaqf1	619	14	potential	potential	NN
cord-014462-11ggaqf1	619	15	,	,	,
cord-014462-11ggaqf1	619	16	nutritional	nutritional	JJ
cord-014462-11ggaqf1	619	17	and	and	CC
cord-014462-11ggaqf1	619	18	medicinal	medicinal	JJ
cord-014462-11ggaqf1	619	19	values	value	NNS
cord-014462-11ggaqf1	619	20	and	and	CC
cord-014462-11ggaqf1	619	21	good	good	JJ
cord-014462-11ggaqf1	619	22	economic	economic	JJ
cord-014462-11ggaqf1	619	23	returns	return	NNS
cord-014462-11ggaqf1	619	24	.	.	.
cord-014462-11ggaqf1	620	1	All	all	PDT
cord-014462-11ggaqf1	620	2	these	these	DT
cord-014462-11ggaqf1	620	3	aroids	aroid	NNS
cord-014462-11ggaqf1	620	4	are	be	VBP
cord-014462-11ggaqf1	620	5	vegetatively	vegetatively	RB
cord-014462-11ggaqf1	620	6	propagated	propagate	VBN
cord-014462-11ggaqf1	620	7	and	and	CC
cord-014462-11ggaqf1	620	8	viral	viral	JJ
cord-014462-11ggaqf1	620	9	diseases	disease	NNS
cord-014462-11ggaqf1	620	10	are	be	VBP
cord-014462-11ggaqf1	620	11	spreading	spread	VBG
cord-014462-11ggaqf1	620	12	through	through	IN
cord-014462-11ggaqf1	620	13	planting	planting	NN
cord-014462-11ggaqf1	620	14	materials	material	NNS
cord-014462-11ggaqf1	620	15	.	.	.
cord-014462-11ggaqf1	621	1	CTCRI	CTCRI	NNP
cord-014462-11ggaqf1	621	2	has	have	VBZ
cord-014462-11ggaqf1	621	3	the	the	DT
cord-014462-11ggaqf1	621	4	mandate	mandate	NN
cord-014462-11ggaqf1	621	5	of	of	IN
cord-014462-11ggaqf1	621	6	producing	produce	VBG
cord-014462-11ggaqf1	621	7	healthy	healthy	JJ
cord-014462-11ggaqf1	621	8	planting	planting	NN
cord-014462-11ggaqf1	621	9	materials	material	NNS
cord-014462-11ggaqf1	621	10	of	of	IN
cord-014462-11ggaqf1	621	11	these	these	DT
cord-014462-11ggaqf1	621	12	edible	edible	JJ
cord-014462-11ggaqf1	621	13	aroids	aroid	NNS
cord-014462-11ggaqf1	621	14	.	.	.
cord-014462-11ggaqf1	622	1	Accurate	accurate	JJ
cord-014462-11ggaqf1	622	2	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	622	3	and	and	CC
cord-014462-11ggaqf1	622	4	identification	identification	NN
cord-014462-11ggaqf1	622	5	of	of	IN
cord-014462-11ggaqf1	622	6	the	the	DT
cord-014462-11ggaqf1	622	7	virus	virus	NN
cord-014462-11ggaqf1	622	8	is	be	VBZ
cord-014462-11ggaqf1	622	9	essential	essential	JJ
cord-014462-11ggaqf1	622	10	for	for	IN
cord-014462-11ggaqf1	622	11	production	production	NN
cord-014462-11ggaqf1	622	12	of	of	IN
cord-014462-11ggaqf1	622	13	healthy	healthy	JJ
cord-014462-11ggaqf1	622	14	planting	planting	NN
cord-014462-11ggaqf1	622	15	material	material	NN
cord-014462-11ggaqf1	622	16	and	and	CC
cord-014462-11ggaqf1	622	17	effective	effective	JJ
cord-014462-11ggaqf1	622	18	management	management	NN
cord-014462-11ggaqf1	622	19	of	of	IN
cord-014462-11ggaqf1	622	20	the	the	DT
cord-014462-11ggaqf1	622	21	disease	disease	NN
cord-014462-11ggaqf1	622	22	.	.	.
cord-014462-11ggaqf1	623	1	Though	though	IN
cord-014462-11ggaqf1	623	2	occurrences	occurrence	NNS
cord-014462-11ggaqf1	623	3	of	of	IN
cord-014462-11ggaqf1	623	4	viral	viral	JJ
cord-014462-11ggaqf1	623	5	diseases	disease	NNS
cord-014462-11ggaqf1	623	6	on	on	IN
cord-014462-11ggaqf1	623	7	edible	edible	JJ
cord-014462-11ggaqf1	623	8	aroids	aroid	NNS
cord-014462-11ggaqf1	623	9	in	in	IN
cord-014462-11ggaqf1	623	10	India	India	NNP
cord-014462-11ggaqf1	623	11	were	be	VBD
cord-014462-11ggaqf1	623	12	known	know	VBN
cord-014462-11ggaqf1	623	13	in	in	IN
cord-014462-11ggaqf1	623	14	1960s	1960	NNS
cord-014462-11ggaqf1	623	15	,	,	,
cord-014462-11ggaqf1	623	16	not	not	RB
cord-014462-11ggaqf1	623	17	much	much	JJ
cord-014462-11ggaqf1	623	18	attention	attention	NN
cord-014462-11ggaqf1	623	19	was	be	VBD
cord-014462-11ggaqf1	623	20	given	give	VBN
cord-014462-11ggaqf1	623	21	for	for	IN
cord-014462-11ggaqf1	623	22	detection	detection	NN
cord-014462-11ggaqf1	623	23	and	and	CC
cord-014462-11ggaqf1	623	24	identification	identification	NN
cord-014462-11ggaqf1	623	25	of	of	IN
cord-014462-11ggaqf1	623	26	the	the	DT
cord-014462-11ggaqf1	623	27	virus	virus	NN
cord-014462-11ggaqf1	623	28	involved	involve	VBN
cord-014462-11ggaqf1	623	29	.	.	.
cord-014462-11ggaqf1	624	1	In	in	IN
cord-014462-11ggaqf1	624	2	case	case	NN
cord-014462-11ggaqf1	624	3	of	of	IN
cord-014462-11ggaqf1	624	4	elephant	elephant	NN
cord-014462-11ggaqf1	624	5	foot	foot	NN
cord-014462-11ggaqf1	624	6	yam	yam	NNP
cord-014462-11ggaqf1	624	7	5	5	CD
cord-014462-11ggaqf1	624	8	-	-	SYM
cord-014462-11ggaqf1	624	9	30	30	CD
cord-014462-11ggaqf1	624	10	%	%	NN
cord-014462-11ggaqf1	624	11	mosaic	mosaic	JJ
cord-014462-11ggaqf1	624	12	incidence	incidence	NN
cord-014462-11ggaqf1	624	13	was	be	VBD
cord-014462-11ggaqf1	624	14	observed	observe	VBN
cord-014462-11ggaqf1	624	15	with	with	IN
cord-014462-11ggaqf1	624	16	varying	vary	VBG
cord-014462-11ggaqf1	624	17	symptoms	symptom	NNS
cord-014462-11ggaqf1	624	18	of	of	IN
cord-014462-11ggaqf1	624	19	mosaic	mosaic	NN
cord-014462-11ggaqf1	624	20	,	,	,
cord-014462-11ggaqf1	624	21	puckering	pucker	VBG
cord-014462-11ggaqf1	624	22	,	,	,
cord-014462-11ggaqf1	624	23	filiformy	filiformy	JJ
cord-014462-11ggaqf1	624	24	etc	etc	FW
cord-014462-11ggaqf1	624	25	.	.	.
cord-014462-11ggaqf1	625	1	In	in	IN
cord-014462-11ggaqf1	625	2	colocasia	colocasia	NNP
cord-014462-11ggaqf1	625	3	and	and	CC
cord-014462-11ggaqf1	625	4	tannia	tannia	NNP
cord-014462-11ggaqf1	625	5	,	,	,
cord-014462-11ggaqf1	625	6	5	5	CD
cord-014462-11ggaqf1	625	7	-	-	SYM
cord-014462-11ggaqf1	625	8	10	10	CD
cord-014462-11ggaqf1	625	9	%	%	NN
cord-014462-11ggaqf1	625	10	incidence	incidence	NN
cord-014462-11ggaqf1	625	11	was	be	VBD
cord-014462-11ggaqf1	625	12	noticed	notice	VBN
cord-014462-11ggaqf1	625	13	.	.	.
cord-014462-11ggaqf1	626	1	RT	RT	NNP
cord-014462-11ggaqf1	626	2	-	-	HYPH
cord-014462-11ggaqf1	626	3	PCR	PCR	NNP
cord-014462-11ggaqf1	626	4	amplification	amplification	NN
cord-014462-11ggaqf1	626	5	with	with	IN
cord-014462-11ggaqf1	626	6	potyvirus	potyvirus	NNP
cord-014462-11ggaqf1	626	7	group	group	NN
cord-014462-11ggaqf1	626	8	specific	specific	JJ
cord-014462-11ggaqf1	626	9	primers	primer	NNS
cord-014462-11ggaqf1	626	10	and	and	CC
cord-014462-11ggaqf1	626	11	subsequent	subsequent	JJ
cord-014462-11ggaqf1	626	12	cloning	cloning	NN
cord-014462-11ggaqf1	626	13	and	and	CC
cord-014462-11ggaqf1	626	14	sequencing	sequencing	NN
cord-014462-11ggaqf1	626	15	of	of	IN
cord-014462-11ggaqf1	626	16	the	the	DT
cord-014462-11ggaqf1	626	17	amplified	amplify	VBN
cord-014462-11ggaqf1	626	18	product	product	NN
cord-014462-11ggaqf1	626	19	has	have	VBZ
cord-014462-11ggaqf1	626	20	confirmed	confirm	VBN
cord-014462-11ggaqf1	626	21	the	the	DT
cord-014462-11ggaqf1	626	22	association	association	NN
cord-014462-11ggaqf1	626	23	of	of	IN
cord-014462-11ggaqf1	626	24	Dasheen	Dasheen	NNP
cord-014462-11ggaqf1	626	25	mosaic	mosaic	JJ
cord-014462-11ggaqf1	626	26	virus	virus	NN
cord-014462-11ggaqf1	626	27	(	(	-LRB-
cord-014462-11ggaqf1	626	28	DsMV	DsMV	NNP
cord-014462-11ggaqf1	626	29	)	)	-RRB-
cord-014462-11ggaqf1	626	30	with	with	IN
cord-014462-11ggaqf1	626	31	all	all	PDT
cord-014462-11ggaqf1	626	32	the	the	DT
cord-014462-11ggaqf1	626	33	three	three	CD
cord-014462-11ggaqf1	626	34	edible	edible	JJ
cord-014462-11ggaqf1	626	35	aroids	aroid	NNS
cord-014462-11ggaqf1	626	36	cultivated	cultivate	VBN
cord-014462-11ggaqf1	626	37	in	in	IN
cord-014462-11ggaqf1	626	38	India	India	NNP
cord-014462-11ggaqf1	626	39	.	.	.
cord-014462-11ggaqf1	627	1	The	the	DT
cord-014462-11ggaqf1	627	2	complete	complete	JJ
cord-014462-11ggaqf1	627	3	full	full	JJ
cord-014462-11ggaqf1	627	4	length	length	NN
cord-014462-11ggaqf1	627	5	coat	coat	NN
cord-014462-11ggaqf1	627	6	protein	protein	NN
cord-014462-11ggaqf1	627	7	gene	gene	NN
cord-014462-11ggaqf1	627	8	of	of	IN
cord-014462-11ggaqf1	627	9	DsMV	DsMV	NNP
cord-014462-11ggaqf1	627	10	infecting	infect	VBG
cord-014462-11ggaqf1	627	11	elephant	elephant	NN
cord-014462-11ggaqf1	627	12	foot	foot	NN
cord-014462-11ggaqf1	627	13	yam	yam	NNP
cord-014462-11ggaqf1	627	14	was	be	VBD
cord-014462-11ggaqf1	627	15	cloned	clone	VBN
cord-014462-11ggaqf1	627	16	in	in	IN
cord-014462-11ggaqf1	627	17	pGEM	pgem	JJ
cord-014462-11ggaqf1	627	18	-	-	HYPH
cord-014462-11ggaqf1	627	19	T	t	NN
cord-014462-11ggaqf1	627	20	vector	vector	NN
cord-014462-11ggaqf1	627	21	and	and	CC
cord-014462-11ggaqf1	627	22	sequenced	sequence	VBN
cord-014462-11ggaqf1	627	23	.	.	.
cord-014462-11ggaqf1	628	1	Further	further	JJ
cord-014462-11ggaqf1	628	2	sequence	sequence	NN
cord-014462-11ggaqf1	628	3	analysis	analysis	NN
cord-014462-11ggaqf1	628	4	revealed	reveal	VBD
cord-014462-11ggaqf1	628	5	that	that	IN
cord-014462-11ggaqf1	628	6	the	the	DT
cord-014462-11ggaqf1	628	7	CP	CP	NNP
cord-014462-11ggaqf1	628	8	of	of	IN
cord-014462-11ggaqf1	628	9	DsMV	DsMV	NNP
cord-014462-11ggaqf1	628	10	consisted	consist	VBD
cord-014462-11ggaqf1	628	11	of	of	IN
cord-014462-11ggaqf1	628	12	942	942	CD
cord-014462-11ggaqf1	628	13	nucleotides	nucleotide	NNS
cord-014462-11ggaqf1	628	14	and	and	CC
cord-014462-11ggaqf1	628	15	the	the	DT
cord-014462-11ggaqf1	628	16	3	3	CD
cord-014462-11ggaqf1	628	17	0	0	CD
cord-014462-11ggaqf1	628	18	UTR	UTR	NNP
cord-014462-11ggaqf1	628	19	comprised	comprise	VBN
cord-014462-11ggaqf1	628	20	of	of	IN
cord-014462-11ggaqf1	628	21	260	260	CD
cord-014462-11ggaqf1	628	22	nucleotides	nucleotide	NNS
cord-014462-11ggaqf1	628	23	.	.	.
cord-014462-11ggaqf1	629	1	BLAST	blast	NN
cord-014462-11ggaqf1	629	2	and	and	CC
cord-014462-11ggaqf1	629	3	phylogenetic	phylogenetic	NN
cord-014462-11ggaqf1	629	4	analysis	analysis	NN
cord-014462-11ggaqf1	629	5	showed	show	VBD
cord-014462-11ggaqf1	629	6	highest	high	JJS
cord-014462-11ggaqf1	629	7	similarity	similarity	NN
cord-014462-11ggaqf1	629	8	of	of	IN
cord-014462-11ggaqf1	629	9	89	89	CD
cord-014462-11ggaqf1	629	10	%	%	NN
cord-014462-11ggaqf1	629	11	with	with	IN
cord-014462-11ggaqf1	629	12	that	that	DT
cord-014462-11ggaqf1	629	13	of	of	IN
cord-014462-11ggaqf1	629	14	DsMV	DsMV	NNP
cord-014462-11ggaqf1	629	15	isolate	isolate	VBP
cord-014462-11ggaqf1	629	16	AF048981	AF048981	NNP
cord-014462-11ggaqf1	629	17	,	,	,
cord-014462-11ggaqf1	629	18	reported	report	VBN
cord-014462-11ggaqf1	629	19	from	from	IN
cord-014462-11ggaqf1	629	20	USA	USA	NNP
cord-014462-11ggaqf1	629	21	.	.	.
cord-014462-11ggaqf1	630	1	The	the	DT
cord-014462-11ggaqf1	630	2	deduced	deduce	VBN
cord-014462-11ggaqf1	630	3	amino	amino	NN
cord-014462-11ggaqf1	630	4	acid	acid	NN
cord-014462-11ggaqf1	630	5	sequence	sequence	NN
cord-014462-11ggaqf1	630	6	of	of	IN
cord-014462-11ggaqf1	630	7	CP	CP	NNP
cord-014462-11ggaqf1	630	8	had	have	VBD
cord-014462-11ggaqf1	630	9	92.0	92.0	CD
cord-014462-11ggaqf1	630	10	-	-	HYPH
cord-014462-11ggaqf1	630	11	98.0	98.0	CD
cord-014462-11ggaqf1	630	12	%	%	NN
cord-014462-11ggaqf1	630	13	identity	identity	NN
cord-014462-11ggaqf1	630	14	with	with	IN
cord-014462-11ggaqf1	630	15	other	other	JJ
cord-014462-11ggaqf1	630	16	DsMV	DsMV	NNP
cord-014462-11ggaqf1	630	17	isolates	isolate	NNS
cord-014462-11ggaqf1	630	18	.	.	.
cord-014462-11ggaqf1	631	1	BLAST	blast	NN
cord-014462-11ggaqf1	631	2	analysis	analysis	NN
cord-014462-11ggaqf1	631	3	of	of	IN
cord-014462-11ggaqf1	631	4	the	the	DT
cord-014462-11ggaqf1	631	5	partial	partial	JJ
cord-014462-11ggaqf1	631	6	CP	cp	NN
cord-014462-11ggaqf1	631	7	gene	gene	NN
cord-014462-11ggaqf1	631	8	sequences	sequence	NNS
cord-014462-11ggaqf1	631	9	of	of	IN
cord-014462-11ggaqf1	631	10	colocasia	colocasia	NNP
cord-014462-11ggaqf1	631	11	and	and	CC
cord-014462-11ggaqf1	631	12	tannia	tannia	NNP
cord-014462-11ggaqf1	631	13	also	also	RB
cord-014462-11ggaqf1	631	14	confirmed	confirm	VBD
cord-014462-11ggaqf1	631	15	that	that	IN
cord-014462-11ggaqf1	631	16	the	the	DT
cord-014462-11ggaqf1	631	17	virus	virus	NN
cord-014462-11ggaqf1	631	18	involved	involve	VBN
cord-014462-11ggaqf1	631	19	is	be	VBZ
cord-014462-11ggaqf1	631	20	DsMV	DsMV	NNP
cord-014462-11ggaqf1	631	21	.	.	.
cord-014462-11ggaqf1	632	1	RT	RT	NNP
cord-014462-11ggaqf1	632	2	-	-	HYPH
cord-014462-11ggaqf1	632	3	PCR	PCR	NNP
cord-014462-11ggaqf1	632	4	analysis	analysis	NN
cord-014462-11ggaqf1	632	5	of	of	IN
cord-014462-11ggaqf1	632	6	large	large	JJ
cord-014462-11ggaqf1	632	7	number	number	NN
cord-014462-11ggaqf1	632	8	of	of	IN
cord-014462-11ggaqf1	632	9	samples	sample	NNS
cord-014462-11ggaqf1	632	10	from	from	IN
cord-014462-11ggaqf1	632	11	all	all	PDT
cord-014462-11ggaqf1	632	12	the	the	DT
cord-014462-11ggaqf1	632	13	three	three	CD
cord-014462-11ggaqf1	632	14	crops	crop	NNS
cord-014462-11ggaqf1	632	15	confirmed	confirm	VBD
cord-014462-11ggaqf1	632	16	that	that	IN
cord-014462-11ggaqf1	632	17	the	the	DT
cord-014462-11ggaqf1	632	18	potyvirus	potyvirus	NNP
cord-014462-11ggaqf1	632	19	group	group	NN
cord-014462-11ggaqf1	632	20	specific	specific	JJ
cord-014462-11ggaqf1	632	21	primers	primer	NNS
cord-014462-11ggaqf1	632	22	(	(	-LRB-
cord-014462-11ggaqf1	632	23	MJ1	MJ1	NNP
cord-014462-11ggaqf1	632	24	and	and	CC
cord-014462-11ggaqf1	632	25	MJ2	MJ2	NNP
cord-014462-11ggaqf1	632	26	)	)	-RRB-
cord-014462-11ggaqf1	632	27	are	be	VBP
cord-014462-11ggaqf1	632	28	good	good	JJ
cord-014462-11ggaqf1	632	29	for	for	IN
cord-014462-11ggaqf1	632	30	rapid	rapid	JJ
cord-014462-11ggaqf1	632	31	detection	detection	NN
cord-014462-11ggaqf1	632	32	of	of	IN
cord-014462-11ggaqf1	632	33	DsMV	DsMV	NNP
cord-014462-11ggaqf1	632	34	in	in	IN
cord-014462-11ggaqf1	632	35	these	these	DT
cord-014462-11ggaqf1	632	36	crops	crop	NNS
cord-014462-11ggaqf1	632	37	.	.	.
cord-014462-11ggaqf1	633	1	DsMV	DsMV	NNP
cord-014462-11ggaqf1	633	2	specific	specific	JJ
cord-014462-11ggaqf1	633	3	biotinylated	biotinylate	VBN
cord-014462-11ggaqf1	633	4	cDNA	cDNA	NNP
cord-014462-11ggaqf1	633	5	and	and	CC
cord-014462-11ggaqf1	633	6	digoxigenin	digoxigenin	NNP
cord-014462-11ggaqf1	633	7	labelled	label	VBN
cord-014462-11ggaqf1	633	8	cRNA	cRNA	NNS
cord-014462-11ggaqf1	633	9	probes	probe	NNS
cord-014462-11ggaqf1	633	10	were	be	VBD
cord-014462-11ggaqf1	633	11	also	also	RB
cord-014462-11ggaqf1	633	12	prepared	prepare	VBN
cord-014462-11ggaqf1	633	13	and	and	CC
cord-014462-11ggaqf1	633	14	DsMV	DsMV	NNP
cord-014462-11ggaqf1	633	15	in	in	IN
cord-014462-11ggaqf1	633	16	elephant	elephant	NN
cord-014462-11ggaqf1	633	17	foot	foot	NN
cord-014462-11ggaqf1	633	18	yam	yam	NN
cord-014462-11ggaqf1	633	19	was	be	VBD
cord-014462-11ggaqf1	633	20	detected	detect	VBN
cord-014462-11ggaqf1	633	21	through	through	IN
cord-014462-11ggaqf1	633	22	nucleic	nucleic	JJ
cord-014462-11ggaqf1	633	23	acid	acid	NN
cord-014462-11ggaqf1	633	24	spot	spot	NN
cord-014462-11ggaqf1	633	25	hybridization	hybridization	NN
cord-014462-11ggaqf1	633	26	.	.	.
cord-014462-11ggaqf1	634	1	Yellow	yellow	JJ
cord-014462-11ggaqf1	634	2	leaf	leaf	NN
cord-014462-11ggaqf1	634	3	disease	disease	NN
cord-014462-11ggaqf1	634	4	(	(	-LRB-
cord-014462-11ggaqf1	634	5	YLD	YLD	NNP
cord-014462-11ggaqf1	634	6	)	)	-RRB-
cord-014462-11ggaqf1	634	7	caused	cause	VBN
cord-014462-11ggaqf1	634	8	by	by	IN
cord-014462-11ggaqf1	634	9	Sugarcane	sugarcane	NN
cord-014462-11ggaqf1	634	10	yellow	yellow	JJ
cord-014462-11ggaqf1	634	11	leaf	leaf	NN
cord-014462-11ggaqf1	634	12	virus	virus	NN
cord-014462-11ggaqf1	634	13	(	(	-LRB-
cord-014462-11ggaqf1	634	14	SCYLV	SCYLV	NNP
cord-014462-11ggaqf1	634	15	)	)	-RRB-
cord-014462-11ggaqf1	634	16	is	be	VBZ
cord-014462-11ggaqf1	634	17	a	a	DT
cord-014462-11ggaqf1	634	18	recently	recently	RB
cord-014462-11ggaqf1	634	19	recorded	record	VBN
cord-014462-11ggaqf1	634	20	disease	disease	NN
cord-014462-11ggaqf1	634	21	in	in	IN
cord-014462-11ggaqf1	634	22	India	India	NNP
cord-014462-11ggaqf1	634	23	and	and	CC
cord-014462-11ggaqf1	634	24	is	be	VBZ
cord-014462-11ggaqf1	634	25	found	find	VBN
cord-014462-11ggaqf1	634	26	wide	wide	JJ
cord-014462-11ggaqf1	634	27	spread	spread	VBN
cord-014462-11ggaqf1	634	28	throughout	throughout	IN
cord-014462-11ggaqf1	634	29	country	country	NN
cord-014462-11ggaqf1	634	30	.	.	.
cord-014462-11ggaqf1	635	1	In	in	IN
cord-014462-11ggaqf1	635	2	popular	popular	JJ
cord-014462-11ggaqf1	635	3	varieties	variety	NNS
cord-014462-11ggaqf1	635	4	,	,	,
cord-014462-11ggaqf1	635	5	the	the	DT
cord-014462-11ggaqf1	635	6	disease	disease	NN
cord-014462-11ggaqf1	635	7	incidence	incidence	NN
cord-014462-11ggaqf1	635	8	varied	varied	JJ
cord-014462-11ggaqf1	635	9	from	from	IN
cord-014462-11ggaqf1	635	10	0	0	CD
cord-014462-11ggaqf1	635	11	to	to	IN
cord-014462-11ggaqf1	635	12	75.0	75.0	CD
cord-014462-11ggaqf1	635	13	%	%	NN
cord-014462-11ggaqf1	635	14	and	and	CC
cord-014462-11ggaqf1	635	15	attained	attain	VBD
cord-014462-11ggaqf1	635	16	epidemic	epidemic	NN
cord-014462-11ggaqf1	635	17	levels	level	NNS
cord-014462-11ggaqf1	635	18	under	under	IN
cord-014462-11ggaqf1	635	19	field	field	NN
cord-014462-11ggaqf1	635	20	conditions	condition	NNS
cord-014462-11ggaqf1	635	21	.	.	.
cord-014462-11ggaqf1	636	1	Detailed	detailed	JJ
cord-014462-11ggaqf1	636	2	studies	study	NNS
cord-014462-11ggaqf1	636	3	on	on	IN
cord-014462-11ggaqf1	636	4	the	the	DT
cord-014462-11ggaqf1	636	5	impact	impact	NN
cord-014462-11ggaqf1	636	6	of	of	IN
cord-014462-11ggaqf1	636	7	YLD	YLD	NNP
cord-014462-11ggaqf1	636	8	on	on	IN
cord-014462-11ggaqf1	636	9	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	636	10	revealed	reveal	VBD
cord-014462-11ggaqf1	636	11	that	that	IN
cord-014462-11ggaqf1	636	12	the	the	DT
cord-014462-11ggaqf1	636	13	virus	virus	NN
cord-014462-11ggaqf1	636	14	infection	infection	NN
cord-014462-11ggaqf1	636	15	significantly	significantly	RB
cord-014462-11ggaqf1	636	16	reduces	reduce	VBZ
cord-014462-11ggaqf1	636	17	various	various	JJ
cord-014462-11ggaqf1	636	18	cane	cane	NN
cord-014462-11ggaqf1	636	19	growth	growth	NN
cord-014462-11ggaqf1	636	20	parameters	parameter	NNS
cord-014462-11ggaqf1	636	21	,	,	,
cord-014462-11ggaqf1	636	22	cane	cane	NN
cord-014462-11ggaqf1	636	23	yield	yield	NN
cord-014462-11ggaqf1	636	24	and	and	CC
cord-014462-11ggaqf1	636	25	juice	juice	NN
cord-014462-11ggaqf1	636	26	quality	quality	NN
cord-014462-11ggaqf1	636	27	.	.	.
cord-014462-11ggaqf1	637	1	Sequence	sequence	NN
cord-014462-11ggaqf1	637	2	comparisons	comparison	NNS
cord-014462-11ggaqf1	637	3	of	of	IN
cord-014462-11ggaqf1	637	4	the	the	DT
cord-014462-11ggaqf1	637	5	coat	coat	NN
cord-014462-11ggaqf1	637	6	protein	protein	NN
cord-014462-11ggaqf1	637	7	(	(	-LRB-
cord-014462-11ggaqf1	637	8	CP	CP	NNP
cord-014462-11ggaqf1	637	9	)	)	-RRB-
cord-014462-11ggaqf1	637	10	and	and	CC
cord-014462-11ggaqf1	637	11	movement	movement	NN
cord-014462-11ggaqf1	637	12	protein	protein	NN
cord-014462-11ggaqf1	637	13	(	(	-LRB-
cord-014462-11ggaqf1	637	14	MP	MP	NNP
cord-014462-11ggaqf1	637	15	)	)	-RRB-
cord-014462-11ggaqf1	637	16	of	of	IN
cord-014462-11ggaqf1	637	17	22	22	CD
cord-014462-11ggaqf1	637	18	SCYLV	SCYLV	NNS
cord-014462-11ggaqf1	637	19	isolates	isolate	NNS
cord-014462-11ggaqf1	637	20	from	from	IN
cord-014462-11ggaqf1	637	21	India	India	NNP
cord-014462-11ggaqf1	637	22	and	and	CC
cord-014462-11ggaqf1	637	23	database	database	NN
cord-014462-11ggaqf1	637	24	sequences	sequence	NNS
cord-014462-11ggaqf1	637	25	showed	show	VBD
cord-014462-11ggaqf1	637	26	a	a	DT
cord-014462-11ggaqf1	637	27	significant	significant	JJ
cord-014462-11ggaqf1	637	28	variation	variation	NN
cord-014462-11ggaqf1	637	29	between	between	IN
cord-014462-11ggaqf1	637	30	Indian	indian	JJ
cord-014462-11ggaqf1	637	31	isolates	isolate	NNS
cord-014462-11ggaqf1	637	32	and	and	CC
cord-014462-11ggaqf1	637	33	the	the	DT
cord-014462-11ggaqf1	637	34	database	database	NN
cord-014462-11ggaqf1	637	35	sequences	sequence	NNS
cord-014462-11ggaqf1	637	36	both	both	CC
cord-014462-11ggaqf1	637	37	at	at	IN
cord-014462-11ggaqf1	637	38	nt	nt	RB
cord-014462-11ggaqf1	637	39	and	and	CC
cord-014462-11ggaqf1	637	40	aa	aa	NNP
cord-014462-11ggaqf1	637	41	level	level	NN
cord-014462-11ggaqf1	637	42	in	in	IN
cord-014462-11ggaqf1	637	43	the	the	DT
cord-014462-11ggaqf1	637	44	CP	CP	NNP
cord-014462-11ggaqf1	637	45	/	/	SYM
cord-014462-11ggaqf1	637	46	MP	MP	NNP
cord-014462-11ggaqf1	637	47	coding	coding	NN
cord-014462-11ggaqf1	637	48	regions	region	NNS
cord-014462-11ggaqf1	637	49	.	.	.
cord-014462-11ggaqf1	638	1	The	the	DT
cord-014462-11ggaqf1	638	2	significant	significant	JJ
cord-014462-11ggaqf1	638	3	variation	variation	NN
cord-014462-11ggaqf1	638	4	in	in	IN
cord-014462-11ggaqf1	638	5	our	-PRON-	PRP$
cord-014462-11ggaqf1	638	6	isolates	isolate	NNS
cord-014462-11ggaqf1	638	7	with	with	IN
cord-014462-11ggaqf1	638	8	the	the	DT
cord-014462-11ggaqf1	638	9	database	database	NN
cord-014462-11ggaqf1	638	10	isolates	isolate	NNS
cord-014462-11ggaqf1	638	11	,	,	,
cord-014462-11ggaqf1	638	12	even	even	RB
cord-014462-11ggaqf1	638	13	in	in	IN
cord-014462-11ggaqf1	638	14	the	the	DT
cord-014462-11ggaqf1	638	15	least	least	JJS
cord-014462-11ggaqf1	638	16	variable	variable	JJ
cord-014462-11ggaqf1	638	17	region	region	NN
cord-014462-11ggaqf1	638	18	of	of	IN
cord-014462-11ggaqf1	638	19	the	the	DT
cord-014462-11ggaqf1	638	20	SCYLV	SCYLV	NNP
cord-014462-11ggaqf1	638	21	genome	genome	NN
cord-014462-11ggaqf1	638	22	showed	show	VBD
cord-014462-11ggaqf1	638	23	that	that	IN
cord-014462-11ggaqf1	638	24	the	the	DT
cord-014462-11ggaqf1	638	25	population	population	NN
cord-014462-11ggaqf1	638	26	existing	exist	VBG
cord-014462-11ggaqf1	638	27	in	in	IN
cord-014462-11ggaqf1	638	28	India	India	NNP
cord-014462-11ggaqf1	638	29	is	be	VBZ
cord-014462-11ggaqf1	638	30	different	different	JJ
cord-014462-11ggaqf1	638	31	from	from	IN
cord-014462-11ggaqf1	638	32	rest	rest	NN
cord-014462-11ggaqf1	638	33	of	of	IN
cord-014462-11ggaqf1	638	34	the	the	DT
cord-014462-11ggaqf1	638	35	world	world	NN
cord-014462-11ggaqf1	638	36	.	.	.
cord-014462-11ggaqf1	639	1	Further	further	RB
cord-014462-11ggaqf1	639	2	,	,	,
cord-014462-11ggaqf1	639	3	comparison	comparison	NN
cord-014462-11ggaqf1	639	4	of	of	IN
cord-014462-11ggaqf1	639	5	partial	partial	JJ
cord-014462-11ggaqf1	639	6	sequences	sequence	NNS
cord-014462-11ggaqf1	639	7	encoding	encode	VBG
cord-014462-11ggaqf1	639	8	for	for	IN
cord-014462-11ggaqf1	639	9	ORF	ORF	NNP
cord-014462-11ggaqf1	639	10	1	1	CD
cord-014462-11ggaqf1	639	11	and	and	CC
cord-014462-11ggaqf1	639	12	2	2	CD
cord-014462-11ggaqf1	639	13	revealed	reveal	VBD
cord-014462-11ggaqf1	639	14	that	that	IN
cord-014462-11ggaqf1	639	15	YLD	YLD	NNP
cord-014462-11ggaqf1	639	16	in	in	IN
cord-014462-11ggaqf1	639	17	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	639	18	in	in	IN
cord-014462-11ggaqf1	639	19	India	India	NNP
cord-014462-11ggaqf1	639	20	is	be	VBZ
cord-014462-11ggaqf1	639	21	caused	cause	VBN
cord-014462-11ggaqf1	639	22	at	at	IN
cord-014462-11ggaqf1	639	23	least	least	JJS
cord-014462-11ggaqf1	639	24	by	by	IN
cord-014462-11ggaqf1	639	25	three	three	CD
cord-014462-11ggaqf1	639	26	genotypes	genotype	NNS
cord-014462-11ggaqf1	639	27	viz	viz	JJ
cord-014462-11ggaqf1	639	28	.	.	.
cord-014462-11ggaqf1	640	1	,	,	,
cord-014462-11ggaqf1	640	2	CUB	CUB	NNP
cord-014462-11ggaqf1	640	3	,	,	,
cord-014462-11ggaqf1	640	4	IND	IND	NNP
cord-014462-11ggaqf1	640	5	and	and	CC
cord-014462-11ggaqf1	640	6	BRA	BRA	NNP
cord-014462-11ggaqf1	640	7	-	-	HYPH
cord-014462-11ggaqf1	640	8	PER	per	NN
cord-014462-11ggaqf1	640	9	,	,	,
cord-014462-11ggaqf1	640	10	of	of	IN
cord-014462-11ggaqf1	640	11	which	which	WDT
cord-014462-11ggaqf1	640	12	a	a	DT
cord-014462-11ggaqf1	640	13	majority	majority	NN
cord-014462-11ggaqf1	640	14	of	of	IN
cord-014462-11ggaqf1	640	15	the	the	DT
cord-014462-11ggaqf1	640	16	samples	sample	NNS
cord-014462-11ggaqf1	640	17	were	be	VBD
cord-014462-11ggaqf1	640	18	found	find	VBN
cord-014462-11ggaqf1	640	19	infected	infect	VBN
cord-014462-11ggaqf1	640	20	with	with	IN
cord-014462-11ggaqf1	640	21	Cuban	cuban	JJ
cord-014462-11ggaqf1	640	22	genotype	genotype	NN
cord-014462-11ggaqf1	640	23	(	(	-LRB-
cord-014462-11ggaqf1	640	24	CUB	CUB	NNP
cord-014462-11ggaqf1	640	25	)	)	-RRB-
cord-014462-11ggaqf1	640	26	.	.	.
cord-014462-11ggaqf1	641	1	The	the	DT
cord-014462-11ggaqf1	641	2	genotype	genotype	NN
cord-014462-11ggaqf1	641	3	IND	IND	NNP
cord-014462-11ggaqf1	641	4	was	be	VBD
cord-014462-11ggaqf1	641	5	identified	identify	VBN
cord-014462-11ggaqf1	641	6	as	as	IN
cord-014462-11ggaqf1	641	7	a	a	DT
cord-014462-11ggaqf1	641	8	new	new	JJ
cord-014462-11ggaqf1	641	9	genotype	genotype	NN
cord-014462-11ggaqf1	641	10	and	and	CC
cord-014462-11ggaqf1	641	11	this	this	DT
cord-014462-11ggaqf1	641	12	was	be	VBD
cord-014462-11ggaqf1	641	13	found	find	VBN
cord-014462-11ggaqf1	641	14	to	to	TO
cord-014462-11ggaqf1	641	15	have	have	VB
cord-014462-11ggaqf1	641	16	significant	significant	JJ
cord-014462-11ggaqf1	641	17	variation	variation	NN
cord-014462-11ggaqf1	641	18	with	with	IN
cord-014462-11ggaqf1	641	19	the	the	DT
cord-014462-11ggaqf1	641	20	reported	report	VBN
cord-014462-11ggaqf1	641	21	genotypes	genotype	NNS
cord-014462-11ggaqf1	641	22	.	.	.
cord-014462-11ggaqf1	642	1	We	-PRON-	PRP
cord-014462-11ggaqf1	642	2	have	have	VBP
cord-014462-11ggaqf1	642	3	identified	identify	VBN
cord-014462-11ggaqf1	642	4	specific	specific	JJ
cord-014462-11ggaqf1	642	5	primers	primer	NNS
cord-014462-11ggaqf1	642	6	from	from	IN
cord-014462-11ggaqf1	642	7	CP	cp	NN
cord-014462-11ggaqf1	642	8	region	region	NN
cord-014462-11ggaqf1	642	9	of	of	IN
cord-014462-11ggaqf1	642	10	the	the	DT
cord-014462-11ggaqf1	642	11	virus	virus	NN
cord-014462-11ggaqf1	642	12	and	and	CC
cord-014462-11ggaqf1	642	13	optimized	optimize	VBN
cord-014462-11ggaqf1	642	14	RT	RT	NNP
cord-014462-11ggaqf1	642	15	-	-	HYPH
cord-014462-11ggaqf1	642	16	PCR	PCR	NNP
cord-014462-11ggaqf1	642	17	conditions	condition	NNS
cord-014462-11ggaqf1	642	18	to	to	TO
cord-014462-11ggaqf1	642	19	diagnose	diagnose	VB
cord-014462-11ggaqf1	642	20	the	the	DT
cord-014462-11ggaqf1	642	21	virus	virus	NN
cord-014462-11ggaqf1	642	22	.	.	.
cord-014462-11ggaqf1	643	1	This	this	DT
cord-014462-11ggaqf1	643	2	assay	assay	NN
cord-014462-11ggaqf1	643	3	has	have	VBZ
cord-014462-11ggaqf1	643	4	been	be	VBN
cord-014462-11ggaqf1	643	5	found	find	VBN
cord-014462-11ggaqf1	643	6	efficient	efficient	JJ
cord-014462-11ggaqf1	643	7	in	in	IN
cord-014462-11ggaqf1	643	8	detecting	detect	VBG
cord-014462-11ggaqf1	643	9	the	the	DT
cord-014462-11ggaqf1	643	10	virus	virus	NN
cord-014462-11ggaqf1	643	11	in	in	IN
cord-014462-11ggaqf1	643	12	asymptomatic	asymptomatic	JJ
cord-014462-11ggaqf1	643	13	plants	plant	NNS
cord-014462-11ggaqf1	643	14	and	and	CC
cord-014462-11ggaqf1	643	15	tissue	tissue	NN
cord-014462-11ggaqf1	643	16	culture	culture	NN
cord-014462-11ggaqf1	643	17	derived	derive	VBN
cord-014462-11ggaqf1	643	18	seedlings	seedling	NNS
cord-014462-11ggaqf1	643	19	.	.	.
cord-014462-11ggaqf1	644	1	Elimination	elimination	NN
cord-014462-11ggaqf1	644	2	of	of	IN
cord-014462-11ggaqf1	644	3	the	the	DT
cord-014462-11ggaqf1	644	4	virus	virus	NN
cord-014462-11ggaqf1	644	5	through	through	IN
cord-014462-11ggaqf1	644	6	meristem	meristem	NN
cord-014462-11ggaqf1	644	7	culture	culture	NN
cord-014462-11ggaqf1	644	8	has	have	VBZ
cord-014462-11ggaqf1	644	9	been	be	VBN
cord-014462-11ggaqf1	644	10	demonstrated	demonstrate	VBN
cord-014462-11ggaqf1	644	11	to	to	TO
cord-014462-11ggaqf1	644	12	purify	purify	VB
cord-014462-11ggaqf1	644	13	the	the	DT
cord-014462-11ggaqf1	644	14	virus	virus	NN
cord-014462-11ggaqf1	644	15	from	from	IN
cord-014462-11ggaqf1	644	16	the	the	DT
cord-014462-11ggaqf1	644	17	infected	infected	JJ
cord-014462-11ggaqf1	644	18	planting	planting	NN
cord-014462-11ggaqf1	644	19	materials	material	NNS
cord-014462-11ggaqf1	644	20	and	and	CC
cord-014462-11ggaqf1	644	21	this	this	DT
cord-014462-11ggaqf1	644	22	technique	technique	NN
cord-014462-11ggaqf1	644	23	needs	need	VBZ
cord-014462-11ggaqf1	644	24	to	to	TO
cord-014462-11ggaqf1	644	25	be	be	VB
cord-014462-11ggaqf1	644	26	adopted	adopt	VBN
cord-014462-11ggaqf1	644	27	to	to	TO
cord-014462-11ggaqf1	644	28	supply	supply	VB
cord-014462-11ggaqf1	644	29	disease	disease	NN
cord-014462-11ggaqf1	644	30	-	-	HYPH
cord-014462-11ggaqf1	644	31	free	free	JJ
cord-014462-11ggaqf1	644	32	planting	planting	NN
cord-014462-11ggaqf1	644	33	materials	material	NNS
cord-014462-11ggaqf1	644	34	for	for	IN
cord-014462-11ggaqf1	644	35	effective	effective	JJ
cord-014462-11ggaqf1	644	36	management	management	NN
cord-014462-11ggaqf1	644	37	of	of	IN
cord-014462-11ggaqf1	644	38	the	the	DT
cord-014462-11ggaqf1	644	39	disease	disease	NN
cord-014462-11ggaqf1	644	40	.	.	.
cord-014462-11ggaqf1	645	1	Studies	study	NNS
cord-014462-11ggaqf1	645	2	are	be	VBP
cord-014462-11ggaqf1	645	3	also	also	RB
cord-014462-11ggaqf1	645	4	in	in	IN
cord-014462-11ggaqf1	645	5	progress	progress	NN
cord-014462-11ggaqf1	645	6	to	to	TO
cord-014462-11ggaqf1	645	7	identify	identify	VB
cord-014462-11ggaqf1	645	8	the	the	DT
cord-014462-11ggaqf1	645	9	YLD	YLD	NNP
cord-014462-11ggaqf1	645	10	-	-	HYPH
cord-014462-11ggaqf1	645	11	resistant	resistant	JJ
cord-014462-11ggaqf1	645	12	sources	source	NNS
cord-014462-11ggaqf1	645	13	in	in	IN
cord-014462-11ggaqf1	645	14	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	645	15	germplasm	germplasm	NN
cord-014462-11ggaqf1	645	16	to	to	TO
cord-014462-11ggaqf1	645	17	initiate	initiate	VB
cord-014462-11ggaqf1	645	18	breeding	breed	VBG
cord-014462-11ggaqf1	645	19	for	for	IN
cord-014462-11ggaqf1	645	20	YLD	yld	NN
cord-014462-11ggaqf1	645	21	-	-	HYPH
cord-014462-11ggaqf1	645	22	resistance	resistance	NN
cord-014462-11ggaqf1	645	23	in	in	IN
cord-014462-11ggaqf1	645	24	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	645	25	.	.	.
cord-014462-11ggaqf1	646	1	Mycoviruses	mycoviruse	NNS
cord-014462-11ggaqf1	646	2	are	be	VBP
cord-014462-11ggaqf1	646	3	viruses	virus	NNS
cord-014462-11ggaqf1	646	4	that	that	WDT
cord-014462-11ggaqf1	646	5	infect	infect	VBP
cord-014462-11ggaqf1	646	6	fungi	fungus	NNS
cord-014462-11ggaqf1	646	7	.	.	.
cord-014462-11ggaqf1	647	1	They	-PRON-	PRP
cord-014462-11ggaqf1	647	2	have	have	VBP
cord-014462-11ggaqf1	647	3	been	be	VBN
cord-014462-11ggaqf1	647	4	identified	identify	VBN
cord-014462-11ggaqf1	647	5	in	in	IN
cord-014462-11ggaqf1	647	6	all	all	DT
cord-014462-11ggaqf1	647	7	major	major	JJ
cord-014462-11ggaqf1	647	8	fungal	fungal	JJ
cord-014462-11ggaqf1	647	9	families	family	NNS
cord-014462-11ggaqf1	647	10	.	.	.
cord-014462-11ggaqf1	648	1	In	in	IN
cord-014462-11ggaqf1	648	2	the	the	DT
cord-014462-11ggaqf1	648	3	present	present	JJ
cord-014462-11ggaqf1	648	4	scenario	scenario	NN
cord-014462-11ggaqf1	648	5	,	,	,
cord-014462-11ggaqf1	648	6	mycoviruses	mycoviruse	NNS
cord-014462-11ggaqf1	648	7	are	be	VBP
cord-014462-11ggaqf1	648	8	the	the	DT
cord-014462-11ggaqf1	648	9	important	important	JJ
cord-014462-11ggaqf1	648	10	means	mean	NNS
cord-014462-11ggaqf1	648	11	of	of	IN
cord-014462-11ggaqf1	648	12	biocontrol	biocontrol	NN
cord-014462-11ggaqf1	648	13	of	of	IN
cord-014462-11ggaqf1	648	14	plant	plant	NN
cord-014462-11ggaqf1	648	15	fungal	fungal	NN
cord-014462-11ggaqf1	648	16	pathogens	pathogen	NNS
cord-014462-11ggaqf1	648	17	.	.	.
cord-014462-11ggaqf1	649	1	Most	Most	JJS
cord-014462-11ggaqf1	649	2	identified	identify	VBN
cord-014462-11ggaqf1	649	3	fungal	fungal	NN
cord-014462-11ggaqf1	649	4	viruses	virus	NNS
cord-014462-11ggaqf1	649	5	have	have	VBP
cord-014462-11ggaqf1	649	6	double	double	JJ
cord-014462-11ggaqf1	649	7	stranded	strand	VBN
cord-014462-11ggaqf1	649	8	RNA	RNA	NNP
cord-014462-11ggaqf1	649	9	genomes	genome	NNS
cord-014462-11ggaqf1	649	10	,	,	,
cord-014462-11ggaqf1	649	11	often	often	RB
cord-014462-11ggaqf1	649	12	with	with	IN
cord-014462-11ggaqf1	649	13	more	more	JJR
cord-014462-11ggaqf1	649	14	than	than	IN
cord-014462-11ggaqf1	649	15	one	one	CD
cord-014462-11ggaqf1	649	16	dsRNA	dsrna	NN
cord-014462-11ggaqf1	649	17	present	present	JJ
cord-014462-11ggaqf1	649	18	per	per	IN
cord-014462-11ggaqf1	649	19	virus	virus	NN
cord-014462-11ggaqf1	649	20	particle	particle	NN
cord-014462-11ggaqf1	649	21	,	,	,
cord-014462-11ggaqf1	649	22	and	and	CC
cord-014462-11ggaqf1	649	23	have	have	VBP
cord-014462-11ggaqf1	649	24	been	be	VBN
cord-014462-11ggaqf1	649	25	spherical	spherical	JJ
cord-014462-11ggaqf1	649	26	in	in	IN
cord-014462-11ggaqf1	649	27	shape	shape	NN
cord-014462-11ggaqf1	649	28	.	.	.
cord-014462-11ggaqf1	650	1	These	these	DT
cord-014462-11ggaqf1	650	2	viruses	virus	NNS
cord-014462-11ggaqf1	650	3	are	be	VBP
cord-014462-11ggaqf1	650	4	mostly	mostly	RB
cord-014462-11ggaqf1	650	5	vesicle	vesicle	NN
cord-014462-11ggaqf1	650	6	bound	bind	VBN
cord-014462-11ggaqf1	650	7	,	,	,
cord-014462-11ggaqf1	650	8	as	as	IN
cord-014462-11ggaqf1	650	9	other	other	JJ
cord-014462-11ggaqf1	650	10	viruses	virus	NNS
cord-014462-11ggaqf1	650	11	have	have	VBP
cord-014462-11ggaqf1	650	12	protein	protein	NN
cord-014462-11ggaqf1	650	13	coatings	coating	NNS
cord-014462-11ggaqf1	650	14	.	.	.
cord-014462-11ggaqf1	651	1	To	to	TO
cord-014462-11ggaqf1	651	2	be	be	VB
cord-014462-11ggaqf1	651	3	a	a	DT
cord-014462-11ggaqf1	651	4	true	true	JJ
cord-014462-11ggaqf1	651	5	mycovirus	mycovirus	NN
cord-014462-11ggaqf1	651	6	,	,	,
cord-014462-11ggaqf1	651	7	they	-PRON-	PRP
cord-014462-11ggaqf1	651	8	must	must	MD
cord-014462-11ggaqf1	651	9	demonstrate	demonstrate	VB
cord-014462-11ggaqf1	651	10	an	an	DT
cord-014462-11ggaqf1	651	11	ability	ability	NN
cord-014462-11ggaqf1	651	12	to	to	TO
cord-014462-11ggaqf1	651	13	be	be	VB
cord-014462-11ggaqf1	651	14	transmitted	transmit	VBN
cord-014462-11ggaqf1	651	15	-	-	:
cord-014462-11ggaqf1	651	16	in	in	IN
cord-014462-11ggaqf1	651	17	other	other	JJ
cord-014462-11ggaqf1	651	18	words	word	NNS
cord-014462-11ggaqf1	651	19	be	be	VB
cord-014462-11ggaqf1	651	20	able	able	JJ
cord-014462-11ggaqf1	651	21	to	to	TO
cord-014462-11ggaqf1	651	22	infect	infect	VB
cord-014462-11ggaqf1	651	23	other	other	JJ
cord-014462-11ggaqf1	651	24	healthy	healthy	JJ
cord-014462-11ggaqf1	651	25	fungi	fungus	NNS
cord-014462-11ggaqf1	651	26	through	through	IN
cord-014462-11ggaqf1	651	27	anastomosis	anastomosis	NN
cord-014462-11ggaqf1	651	28	and	and	CC
cord-014462-11ggaqf1	651	29	spores	spore	NNS
cord-014462-11ggaqf1	651	30	.	.	.
cord-014462-11ggaqf1	652	1	Mycoviruses	mycoviruse	NNS
cord-014462-11ggaqf1	652	2	lead	lead	VBP
cord-014462-11ggaqf1	652	3	'	'	``
cord-014462-11ggaqf1	652	4	secret	secret	JJ
cord-014462-11ggaqf1	652	5	lives	life	NNS
cord-014462-11ggaqf1	652	6	'	'	''
cord-014462-11ggaqf1	652	7	,	,	,
cord-014462-11ggaqf1	652	8	reduce	reduce	VB
cord-014462-11ggaqf1	652	9	the	the	DT
cord-014462-11ggaqf1	652	10	ability	ability	NN
cord-014462-11ggaqf1	652	11	of	of	IN
cord-014462-11ggaqf1	652	12	their	-PRON-	PRP$
cord-014462-11ggaqf1	652	13	fungal	fungal	JJ
cord-014462-11ggaqf1	652	14	hosts	host	NNS
cord-014462-11ggaqf1	652	15	to	to	TO
cord-014462-11ggaqf1	652	16	cause	cause	VB
cord-014462-11ggaqf1	652	17	disease	disease	NN
cord-014462-11ggaqf1	652	18	in	in	IN
cord-014462-11ggaqf1	652	19	plants	plant	NNS
cord-014462-11ggaqf1	652	20	.	.	.
cord-014462-11ggaqf1	653	1	This	this	DT
cord-014462-11ggaqf1	653	2	property	property	NN
cord-014462-11ggaqf1	653	3	,	,	,
cord-014462-11ggaqf1	653	4	known	know	VBN
cord-014462-11ggaqf1	653	5	as	as	IN
cord-014462-11ggaqf1	653	6	hypovirulence	hypovirulence	NN
cord-014462-11ggaqf1	653	7	(	(	-LRB-
cord-014462-11ggaqf1	653	8	Hypovirulence	Hypovirulence	NNP
cord-014462-11ggaqf1	653	9	is	be	VBZ
cord-014462-11ggaqf1	653	10	a	a	DT
cord-014462-11ggaqf1	653	11	term	term	NN
cord-014462-11ggaqf1	653	12	used	use	VBN
cord-014462-11ggaqf1	653	13	to	to	TO
cord-014462-11ggaqf1	653	14	describe	describe	VB
cord-014462-11ggaqf1	653	15	reduced	reduced	JJ
cord-014462-11ggaqf1	653	16	virulence	virulence	NN
cord-014462-11ggaqf1	653	17	found	find	VBN
cord-014462-11ggaqf1	653	18	in	in	IN
cord-014462-11ggaqf1	653	19	strains	strain	NNS
cord-014462-11ggaqf1	653	20	of	of	IN
cord-014462-11ggaqf1	653	21	pathogens	pathogen	NNS
cord-014462-11ggaqf1	653	22	)	)	-RRB-
cord-014462-11ggaqf1	653	23	,	,	,
cord-014462-11ggaqf1	653	24	this	this	DT
cord-014462-11ggaqf1	653	25	phenomenon	phenomenon	NN
cord-014462-11ggaqf1	653	26	was	be	VBD
cord-014462-11ggaqf1	653	27	first	first	RB
cord-014462-11ggaqf1	653	28	observed	observe	VBN
cord-014462-11ggaqf1	653	29	in	in	IN
cord-014462-11ggaqf1	653	30	Cryphonectria	Cryphonectria	NNP
cord-014462-11ggaqf1	653	31	(	(	-LRB-
cord-014462-11ggaqf1	653	32	Endothia	Endothia	NNP
cord-014462-11ggaqf1	653	33	)	)	-RRB-
cord-014462-11ggaqf1	653	34	parasitica	parasitica	NNP
cord-014462-11ggaqf1	653	35	(	(	-LRB-
cord-014462-11ggaqf1	653	36	chestnut	chestnut	NN
cord-014462-11ggaqf1	653	37	blight	blight	NN
cord-014462-11ggaqf1	653	38	fungus	fungus	NN
cord-014462-11ggaqf1	653	39	)	)	-RRB-
cord-014462-11ggaqf1	653	40	on	on	IN
cord-014462-11ggaqf1	653	41	European	European	NNP
cord-014462-11ggaqf1	653	42	Castanea	Castanea	NNP
cord-014462-11ggaqf1	653	43	sativa	sativa	NN
cord-014462-11ggaqf1	653	44	in	in	IN
cord-014462-11ggaqf1	653	45	Italy	Italy	NNP
cord-014462-11ggaqf1	653	46	,	,	,
cord-014462-11ggaqf1	653	47	where	where	WRB
cord-014462-11ggaqf1	653	48	naturally	naturally	RB
cord-014462-11ggaqf1	653	49	occuring	occur	VBG
cord-014462-11ggaqf1	653	50	hypovirulent	hypovirulent	NN
cord-014462-11ggaqf1	653	51	strains	strain	NNS
cord-014462-11ggaqf1	653	52	were	be	VBD
cord-014462-11ggaqf1	653	53	able	able	JJ
cord-014462-11ggaqf1	653	54	to	to	TO
cord-014462-11ggaqf1	653	55	reduce	reduce	VB
cord-014462-11ggaqf1	653	56	the	the	DT
cord-014462-11ggaqf1	653	57	effect	effect	NN
cord-014462-11ggaqf1	653	58	of	of	IN
cord-014462-11ggaqf1	653	59	virulent	virulent	JJ
cord-014462-11ggaqf1	653	60	ones	one	NNS
cord-014462-11ggaqf1	653	61	.	.	.
cord-014462-11ggaqf1	654	1	These	these	DT
cord-014462-11ggaqf1	654	2	slower	slow	JJR
cord-014462-11ggaqf1	654	3	growing	grow	VBG
cord-014462-11ggaqf1	654	4	hypovirulent	hypovirulent	NN
cord-014462-11ggaqf1	654	5	strains	strain	NNS
cord-014462-11ggaqf1	654	6	of	of	IN
cord-014462-11ggaqf1	654	7	C.	C.	NNP
cord-014462-11ggaqf1	654	8	parasitica	parasitica	NNP
cord-014462-11ggaqf1	654	9	contain	contain	VBP
cord-014462-11ggaqf1	654	10	a	a	DT
cord-014462-11ggaqf1	654	11	single	single	JJ
cord-014462-11ggaqf1	654	12	cytoplasmic	cytoplasmic	JJ
cord-014462-11ggaqf1	654	13	element	element	NN
cord-014462-11ggaqf1	654	14	of	of	IN
cord-014462-11ggaqf1	654	15	double	double	RB
cord-014462-11ggaqf1	654	16	-	-	HYPH
cord-014462-11ggaqf1	654	17	stranded	strand	VBN
cord-014462-11ggaqf1	654	18	RNA	RNA	NNP
cord-014462-11ggaqf1	654	19	(	(	-LRB-
cord-014462-11ggaqf1	654	20	ds	ds	NNP
cord-014462-11ggaqf1	654	21	RNA	RNA	NNP
cord-014462-11ggaqf1	654	22	)	)	-RRB-
cord-014462-11ggaqf1	654	23	similar	similar	JJ
cord-014462-11ggaqf1	654	24	to	to	IN
cord-014462-11ggaqf1	654	25	that	that	DT
cord-014462-11ggaqf1	654	26	found	find	VBN
cord-014462-11ggaqf1	654	27	in	in	IN
cord-014462-11ggaqf1	654	28	mycoviruses	mycoviruse	NNS
cord-014462-11ggaqf1	654	29	that	that	WDT
cord-014462-11ggaqf1	654	30	was	be	VBD
cord-014462-11ggaqf1	654	31	transmitted	transmit	VBN
cord-014462-11ggaqf1	654	32	by	by	IN
cord-014462-11ggaqf1	654	33	anastomosis	anastomosis	NN
cord-014462-11ggaqf1	654	34	in	in	IN
cord-014462-11ggaqf1	654	35	compatible	compatible	JJ
cord-014462-11ggaqf1	654	36	strains	strain	NNS
cord-014462-11ggaqf1	654	37	through	through	IN
cord-014462-11ggaqf1	654	38	natural	natural	JJ
cord-014462-11ggaqf1	654	39	virulent	virulent	JJ
cord-014462-11ggaqf1	654	40	populations	population	NNS
cord-014462-11ggaqf1	654	41	of	of	IN
cord-014462-11ggaqf1	654	42	C.	C.	NNP
cord-014462-11ggaqf1	654	43	parasitica	parasitica	NNP
cord-014462-11ggaqf1	654	44	.	.	.
cord-014462-11ggaqf1	655	1	Hypovirulence	Hypovirulence	NNP
cord-014462-11ggaqf1	655	2	has	have	VBZ
cord-014462-11ggaqf1	655	3	also	also	RB
cord-014462-11ggaqf1	655	4	been	be	VBN
cord-014462-11ggaqf1	655	5	reported	report	VBN
cord-014462-11ggaqf1	655	6	in	in	IN
cord-014462-11ggaqf1	655	7	many	many	JJ
cord-014462-11ggaqf1	655	8	other	other	JJ
cord-014462-11ggaqf1	655	9	fungal	fungal	NN
cord-014462-11ggaqf1	655	10	plant	plant	NN
cord-014462-11ggaqf1	655	11	pathogens	pathogen	NNS
cord-014462-11ggaqf1	655	12	,	,	,
cord-014462-11ggaqf1	655	13	including	include	VBG
cord-014462-11ggaqf1	655	14	Rhizoctonia	Rhizoctonia	NNP
cord-014462-11ggaqf1	655	15	solani	solani	NNS
cord-014462-11ggaqf1	655	16	,	,	,
cord-014462-11ggaqf1	655	17	Gaeumannomyces	Gaeumannomyces	NNPS
cord-014462-11ggaqf1	655	18	gramini	gramini	NNP
cord-014462-11ggaqf1	655	19	var	var	NNP
cord-014462-11ggaqf1	655	20	.	.	.
cord-014462-11ggaqf1	656	1	tritici	tritici	NNP
cord-014462-11ggaqf1	656	2	,	,	,
cord-014462-11ggaqf1	656	3	Ophiostoma	Ophiostoma	NNP
cord-014462-11ggaqf1	656	4	ulmi	ulmi	NNP
cord-014462-11ggaqf1	656	5	,	,	,
cord-014462-11ggaqf1	656	6	Sclerotinia	Sclerotinia	NNP
cord-014462-11ggaqf1	656	7	homoeocarpa	homoeocarpa	NNP
cord-014462-11ggaqf1	656	8	,	,	,
cord-014462-11ggaqf1	656	9	Diaporthe	Diaporthe	NNP
cord-014462-11ggaqf1	656	10	ambigua	ambigua	NN
cord-014462-11ggaqf1	656	11	Alternaria	Alternaria	NNP
cord-014462-11ggaqf1	656	12	alternata	alternata	NNP
cord-014462-11ggaqf1	656	13	,	,	,
cord-014462-11ggaqf1	656	14	and	and	CC
cord-014462-11ggaqf1	656	15	Fusarium	Fusarium	NNP
cord-014462-11ggaqf1	656	16	sp	sp	NN
cord-014462-11ggaqf1	656	17	.	.	.
cord-014462-11ggaqf1	657	1	etc	etc	FW
cord-014462-11ggaqf1	657	2	.	.	.
cord-014462-11ggaqf1	658	1	Hypovirulence	Hypovirulence	NNP
cord-014462-11ggaqf1	658	2	has	have	VBZ
cord-014462-11ggaqf1	658	3	attracted	attract	VBN
cord-014462-11ggaqf1	658	4	attention	attention	NN
cord-014462-11ggaqf1	658	5	owing	owe	VBG
cord-014462-11ggaqf1	658	6	to	to	IN
cord-014462-11ggaqf1	658	7	the	the	DT
cord-014462-11ggaqf1	658	8	importance	importance	NN
cord-014462-11ggaqf1	658	9	of	of	IN
cord-014462-11ggaqf1	658	10	fungal	fungal	JJ
cord-014462-11ggaqf1	658	11	diseases	disease	NNS
cord-014462-11ggaqf1	658	12	in	in	IN
cord-014462-11ggaqf1	658	13	agriculture	agriculture	NN
cord-014462-11ggaqf1	658	14	and	and	CC
cord-014462-11ggaqf1	658	15	the	the	DT
cord-014462-11ggaqf1	658	16	limited	limited	JJ
cord-014462-11ggaqf1	658	17	strategies	strategy	NNS
cord-014462-11ggaqf1	658	18	that	that	WDT
cord-014462-11ggaqf1	658	19	are	be	VBP
cord-014462-11ggaqf1	658	20	available	available	JJ
cord-014462-11ggaqf1	658	21	for	for	IN
cord-014462-11ggaqf1	658	22	the	the	DT
cord-014462-11ggaqf1	658	23	control	control	NN
cord-014462-11ggaqf1	658	24	of	of	IN
cord-014462-11ggaqf1	658	25	these	these	DT
cord-014462-11ggaqf1	658	26	diseases	disease	NNS
cord-014462-11ggaqf1	658	27	.	.	.
cord-014462-11ggaqf1	659	1	It	-PRON-	PRP
cord-014462-11ggaqf1	659	2	reduces	reduce	VBZ
cord-014462-11ggaqf1	659	3	the	the	DT
cord-014462-11ggaqf1	659	4	use	use	NN
cord-014462-11ggaqf1	659	5	of	of	IN
cord-014462-11ggaqf1	659	6	toxic	toxic	JJ
cord-014462-11ggaqf1	659	7	fungicides	fungicide	NNS
cord-014462-11ggaqf1	659	8	which	which	WDT
cord-014462-11ggaqf1	659	9	also	also	RB
cord-014462-11ggaqf1	659	10	affect	affect	VBP
cord-014462-11ggaqf1	659	11	the	the	DT
cord-014462-11ggaqf1	659	12	plant	plant	NN
cord-014462-11ggaqf1	659	13	growth	growth	NN
cord-014462-11ggaqf1	659	14	.	.	.
cord-014462-11ggaqf1	660	1	The	the	DT
cord-014462-11ggaqf1	660	2	symptoms	symptom	NNS
cord-014462-11ggaqf1	660	3	resulted	result	VBD
cord-014462-11ggaqf1	660	4	by	by	IN
cord-014462-11ggaqf1	660	5	the	the	DT
cord-014462-11ggaqf1	660	6	mycoviruses	mycoviruse	NNS
cord-014462-11ggaqf1	660	7	are	be	VBP
cord-014462-11ggaqf1	660	8	reduction	reduction	NN
cord-014462-11ggaqf1	660	9	in	in	IN
cord-014462-11ggaqf1	660	10	growth	growth	NN
cord-014462-11ggaqf1	660	11	,	,	,
cord-014462-11ggaqf1	660	12	reduction	reduction	NN
cord-014462-11ggaqf1	660	13	in	in	IN
cord-014462-11ggaqf1	660	14	pigmentation	pigmentation	NN
cord-014462-11ggaqf1	660	15	and	and	CC
cord-014462-11ggaqf1	660	16	sporulation	sporulation	NN
cord-014462-11ggaqf1	660	17	,	,	,
cord-014462-11ggaqf1	660	18	excessive	excessive	JJ
cord-014462-11ggaqf1	660	19	sectoring	sectoring	JJ
cord-014462-11ggaqf1	660	20	and	and	CC
cord-014462-11ggaqf1	660	21	aerial	aerial	JJ
cord-014462-11ggaqf1	660	22	mycelial	mycelial	JJ
cord-014462-11ggaqf1	660	23	collapse	collapse	NN
cord-014462-11ggaqf1	660	24	.	.	.
cord-014462-11ggaqf1	661	1	These	these	DT
cord-014462-11ggaqf1	661	2	are	be	VBP
cord-014462-11ggaqf1	661	3	the	the	DT
cord-014462-11ggaqf1	661	4	consequences	consequence	NNS
cord-014462-11ggaqf1	661	5	of	of	IN
cord-014462-11ggaqf1	661	6	alteration	alteration	NN
cord-014462-11ggaqf1	661	7	in	in	IN
cord-014462-11ggaqf1	661	8	complex	complex	JJ
cord-014462-11ggaqf1	661	9	physiological	physiological	JJ
cord-014462-11ggaqf1	661	10	and	and	CC
cord-014462-11ggaqf1	661	11	biochemical	biochemical	JJ
cord-014462-11ggaqf1	661	12	processes	process	NNS
cord-014462-11ggaqf1	661	13	involving	involve	VBG
cord-014462-11ggaqf1	661	14	interaction	interaction	NN
cord-014462-11ggaqf1	661	15	between	between	IN
cord-014462-11ggaqf1	661	16	host	host	NN
cord-014462-11ggaqf1	661	17	and	and	CC
cord-014462-11ggaqf1	661	18	virus	virus	NN
cord-014462-11ggaqf1	661	19	.	.	.
cord-014462-11ggaqf1	662	1	Cassava	cassava	NN
cord-014462-11ggaqf1	662	2	(	(	-LRB-
cord-014462-11ggaqf1	662	3	Manihot	Manihot	NNP
cord-014462-11ggaqf1	662	4	esculenta	esculenta	NN
cord-014462-11ggaqf1	662	5	Crantz	Crantz	NNP
cord-014462-11ggaqf1	662	6	.	.	.
cord-014462-11ggaqf1	662	7	)	)	-RRB-
cord-014462-11ggaqf1	662	8	is	be	VBZ
cord-014462-11ggaqf1	662	9	the	the	DT
cord-014462-11ggaqf1	662	10	major	major	JJ
cord-014462-11ggaqf1	662	11	tuber	tuber	NN
cord-014462-11ggaqf1	662	12	crop	crop	NN
cord-014462-11ggaqf1	662	13	in	in	IN
cord-014462-11ggaqf1	662	14	Peninsular	Peninsular	NNP
cord-014462-11ggaqf1	662	15	India	India	NNP
cord-014462-11ggaqf1	662	16	,	,	,
cord-014462-11ggaqf1	662	17	it	-PRON-	PRP
cord-014462-11ggaqf1	662	18	is	be	VBZ
cord-014462-11ggaqf1	662	19	grown	grow	VBN
cord-014462-11ggaqf1	662	20	in	in	IN
cord-014462-11ggaqf1	662	21	an	an	DT
cord-014462-11ggaqf1	662	22	area	area	NN
cord-014462-11ggaqf1	662	23	of	of	IN
cord-014462-11ggaqf1	662	24	2.4	2.4	CD
cord-014462-11ggaqf1	662	25	lakh	lakh	NN
cord-014462-11ggaqf1	662	26	hectares	hectare	NNS
cord-014462-11ggaqf1	662	27	with	with	IN
cord-014462-11ggaqf1	662	28	the	the	DT
cord-014462-11ggaqf1	662	29	annual	annual	JJ
cord-014462-11ggaqf1	662	30	production	production	NN
cord-014462-11ggaqf1	662	31	of	of	IN
cord-014462-11ggaqf1	662	32	6.7	6.7	CD
cord-014462-11ggaqf1	662	33	million	million	CD
cord-014462-11ggaqf1	662	34	tonnes	tonne	NNS
cord-014462-11ggaqf1	662	35	both	both	DT
cord-014462-11ggaqf1	662	36	for	for	IN
cord-014462-11ggaqf1	662	37	direct	direct	JJ
cord-014462-11ggaqf1	662	38	consumption	consumption	NN
cord-014462-11ggaqf1	662	39	and	and	CC
cord-014462-11ggaqf1	662	40	the	the	DT
cord-014462-11ggaqf1	662	41	starch	starch	NN
cord-014462-11ggaqf1	662	42	grain	grain	NN
cord-014462-11ggaqf1	662	43	(	(	-LRB-
cord-014462-11ggaqf1	662	44	sago	sago	NN
cord-014462-11ggaqf1	662	45	)	)	-RRB-
cord-014462-11ggaqf1	662	46	producing	produce	VBG
cord-014462-11ggaqf1	662	47	industries	industry	NNS
cord-014462-11ggaqf1	662	48	,	,	,
cord-014462-11ggaqf1	662	49	mainly	mainly	RB
cord-014462-11ggaqf1	662	50	in	in	IN
cord-014462-11ggaqf1	662	51	the	the	DT
cord-014462-11ggaqf1	662	52	southern	southern	JJ
cord-014462-11ggaqf1	662	53	states	state	NNS
cord-014462-11ggaqf1	662	54	of	of	IN
cord-014462-11ggaqf1	662	55	Tamil	Tamil	NNP
cord-014462-11ggaqf1	662	56	Nadu	Nadu	NNP
cord-014462-11ggaqf1	662	57	,	,	,
cord-014462-11ggaqf1	662	58	Kerala	Kerala	NNP
cord-014462-11ggaqf1	662	59	and	and	CC
cord-014462-11ggaqf1	662	60	Andhra	Andhra	NNP
cord-014462-11ggaqf1	662	61	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	662	62	(	(	-LRB-
cord-014462-11ggaqf1	662	63	FAO	FAO	NNP
cord-014462-11ggaqf1	662	64	2005	2005	CD
cord-014462-11ggaqf1	662	65	)	)	-RRB-
cord-014462-11ggaqf1	662	66	.	.	.
cord-014462-11ggaqf1	663	1	In	in	IN
cord-014462-11ggaqf1	663	2	Tamil	Tamil	NNP
cord-014462-11ggaqf1	663	3	Nadu	Nadu	NNP
cord-014462-11ggaqf1	663	4	,	,	,
cord-014462-11ggaqf1	663	5	cassava	cassava	NN
cord-014462-11ggaqf1	663	6	primarily	primarily	RB
cord-014462-11ggaqf1	663	7	produced	produce	VBN
cord-014462-11ggaqf1	663	8	for	for	IN
cord-014462-11ggaqf1	663	9	sago	sago	NN
cord-014462-11ggaqf1	663	10	producing	produce	VBG
cord-014462-11ggaqf1	663	11	industries	industry	NNS
cord-014462-11ggaqf1	663	12	where	where	WRB
cord-014462-11ggaqf1	663	13	it	-PRON-	PRP
cord-014462-11ggaqf1	663	14	is	be	VBZ
cord-014462-11ggaqf1	663	15	considered	consider	VBN
cord-014462-11ggaqf1	663	16	as	as	IN
cord-014462-11ggaqf1	663	17	an	an	DT
cord-014462-11ggaqf1	663	18	industrial	industrial	JJ
cord-014462-11ggaqf1	663	19	crop	crop	NN
cord-014462-11ggaqf1	663	20	rather	rather	RB
cord-014462-11ggaqf1	663	21	than	than	IN
cord-014462-11ggaqf1	663	22	food	food	NN
cord-014462-11ggaqf1	663	23	crop	crop	NN
cord-014462-11ggaqf1	663	24	,	,	,
cord-014462-11ggaqf1	663	25	so	so	CC
cord-014462-11ggaqf1	663	26	the	the	DT
cord-014462-11ggaqf1	663	27	resource	resource	NN
cord-014462-11ggaqf1	663	28	rich	rich	JJ
cord-014462-11ggaqf1	663	29	farmers	farmer	NNS
cord-014462-11ggaqf1	663	30	are	be	VBP
cord-014462-11ggaqf1	663	31	cultivating	cultivate	VBG
cord-014462-11ggaqf1	663	32	the	the	DT
cord-014462-11ggaqf1	663	33	cassava	cassava	NN
cord-014462-11ggaqf1	663	34	as	as	IN
cord-014462-11ggaqf1	663	35	irrigated	irrigate	VBN
cord-014462-11ggaqf1	663	36	crop	crop	NN
cord-014462-11ggaqf1	663	37	in	in	IN
cord-014462-11ggaqf1	663	38	their	-PRON-	PRP$
cord-014462-11ggaqf1	663	39	fertile	fertile	JJ
cord-014462-11ggaqf1	663	40	land	land	NN
cord-014462-11ggaqf1	663	41	and	and	CC
cord-014462-11ggaqf1	663	42	the	the	DT
cord-014462-11ggaqf1	663	43	poor	poor	JJ
cord-014462-11ggaqf1	663	44	farmers	farmer	NNS
cord-014462-11ggaqf1	663	45	are	be	VBP
cord-014462-11ggaqf1	663	46	raising	raise	VBG
cord-014462-11ggaqf1	663	47	the	the	DT
cord-014462-11ggaqf1	663	48	crop	crop	NN
cord-014462-11ggaqf1	663	49	under	under	IN
cord-014462-11ggaqf1	663	50	rainfed	rainfed	JJ
cord-014462-11ggaqf1	663	51	conditions	condition	NNS
cord-014462-11ggaqf1	663	52	.	.	.
cord-014462-11ggaqf1	664	1	In	in	IN
cord-014462-11ggaqf1	664	2	south	south	JJ
cord-014462-11ggaqf1	664	3	India	India	NNP
cord-014462-11ggaqf1	664	4	in	in	IN
cord-014462-11ggaqf1	664	5	addition	addition	NN
cord-014462-11ggaqf1	664	6	to	to	IN
cord-014462-11ggaqf1	664	7	cassava	cassava	NN
cord-014462-11ggaqf1	664	8	there	there	EX
cord-014462-11ggaqf1	664	9	is	be	VBZ
cord-014462-11ggaqf1	664	10	a	a	DT
cord-014462-11ggaqf1	664	11	practice	practice	NN
cord-014462-11ggaqf1	664	12	of	of	IN
cord-014462-11ggaqf1	664	13	intercropping	intercrop	VBG
cord-014462-11ggaqf1	664	14	important	important	JJ
cord-014462-11ggaqf1	664	15	vegetable	vegetable	NN
cord-014462-11ggaqf1	664	16	crops	crop	NNS
cord-014462-11ggaqf1	664	17	like	like	IN
cord-014462-11ggaqf1	664	18	,	,	,
cord-014462-11ggaqf1	664	19	tomato	tomato	NN
cord-014462-11ggaqf1	664	20	,	,	,
cord-014462-11ggaqf1	664	21	brinjal	brinjal	NN
cord-014462-11ggaqf1	664	22	,	,	,
cord-014462-11ggaqf1	664	23	legumes	legume	NNS
cord-014462-11ggaqf1	664	24	and	and	CC
cord-014462-11ggaqf1	664	25	gourds	gourd	NNS
cord-014462-11ggaqf1	664	26	in	in	IN
cord-014462-11ggaqf1	664	27	Cassava	cassava	NN
cord-014462-11ggaqf1	664	28	fields	field	NNS
cord-014462-11ggaqf1	664	29	since	since	IN
cord-014462-11ggaqf1	664	30	all	all	PDT
cord-014462-11ggaqf1	664	31	the	the	DT
cord-014462-11ggaqf1	664	32	above	above	RB
cord-014462-11ggaqf1	664	33	mentioned	mention	VBN
cord-014462-11ggaqf1	664	34	crops	crop	NNS
cord-014462-11ggaqf1	664	35	are	be	VBP
cord-014462-11ggaqf1	664	36	short	short	JJ
cord-014462-11ggaqf1	664	37	duration	duration	NN
cord-014462-11ggaqf1	664	38	and	and	CC
cord-014462-11ggaqf1	664	39	are	be	VBP
cord-014462-11ggaqf1	664	40	money	money	NN
cord-014462-11ggaqf1	664	41	spinners	spinner	NNS
cord-014462-11ggaqf1	664	42	for	for	IN
cord-014462-11ggaqf1	664	43	the	the	DT
cord-014462-11ggaqf1	664	44	farmers	farmer	NNS
cord-014462-11ggaqf1	664	45	.	.	.
cord-014462-11ggaqf1	665	1	Unfortunately	unfortunately	RB
cord-014462-11ggaqf1	665	2	,	,	,
cord-014462-11ggaqf1	665	3	the	the	DT
cord-014462-11ggaqf1	665	4	major	major	JJ
cord-014462-11ggaqf1	665	5	production	production	NN
cord-014462-11ggaqf1	665	6	constraint	constraint	NN
cord-014462-11ggaqf1	665	7	in	in	IN
cord-014462-11ggaqf1	665	8	these	these	DT
cord-014462-11ggaqf1	665	9	vegetable	vegetable	NN
cord-014462-11ggaqf1	665	10	crops	crop	NNS
cord-014462-11ggaqf1	665	11	including	include	VBG
cord-014462-11ggaqf1	665	12	Cassava	Cassava	NNP
cord-014462-11ggaqf1	665	13	is	be	VBZ
cord-014462-11ggaqf1	665	14	the	the	DT
cord-014462-11ggaqf1	665	15	Geminiviruses	Geminiviruses	NNP
cord-014462-11ggaqf1	665	16	belonging	belong	VBG
cord-014462-11ggaqf1	665	17	to	to	IN
cord-014462-11ggaqf1	665	18	the	the	DT
cord-014462-11ggaqf1	665	19	family	family	NN
cord-014462-11ggaqf1	665	20	of	of	IN
cord-014462-11ggaqf1	666	1	In	in	IN
cord-014462-11ggaqf1	666	2	recent	recent	JJ
cord-014462-11ggaqf1	666	3	years	year	NNS
cord-014462-11ggaqf1	666	4	there	there	EX
cord-014462-11ggaqf1	666	5	has	have	VBZ
cord-014462-11ggaqf1	666	6	been	be	VBN
cord-014462-11ggaqf1	666	7	growing	grow	VBG
cord-014462-11ggaqf1	666	8	concern	concern	NN
cord-014462-11ggaqf1	666	9	regarding	regard	VBG
cord-014462-11ggaqf1	666	10	the	the	DT
cord-014462-11ggaqf1	666	11	standard	standard	NN
cord-014462-11ggaqf1	666	12	of	of	IN
cord-014462-11ggaqf1	666	13	scientific	scientific	JJ
cord-014462-11ggaqf1	666	14	researches	research	NNS
cord-014462-11ggaqf1	666	15	in	in	IN
cord-014462-11ggaqf1	666	16	India	India	NNP
cord-014462-11ggaqf1	666	17	.	.	.
cord-014462-11ggaqf1	667	1	The	the	DT
cord-014462-11ggaqf1	667	2	strengths	strength	NNS
cord-014462-11ggaqf1	667	3	,	,	,
cord-014462-11ggaqf1	667	4	weaknesses	weakness	NNS
cord-014462-11ggaqf1	667	5	,	,	,
cord-014462-11ggaqf1	667	6	opportunities	opportunity	NNS
cord-014462-11ggaqf1	667	7	and	and	CC
cord-014462-11ggaqf1	667	8	Threats	Threats	NNPS
cord-014462-11ggaqf1	667	9	(	(	-LRB-
cord-014462-11ggaqf1	667	10	SWOT	SWOT	NNP
cord-014462-11ggaqf1	667	11	)	)	-RRB-
cord-014462-11ggaqf1	667	12	analysis	analysis	NN
cord-014462-11ggaqf1	667	13	on	on	IN
cord-014462-11ggaqf1	667	14	Indian	indian	JJ
cord-014462-11ggaqf1	667	15	scientific	scientific	JJ
cord-014462-11ggaqf1	667	16	research	research	NN
cord-014462-11ggaqf1	667	17	reviewed	review	VBD
cord-014462-11ggaqf1	667	18	the	the	DT
cord-014462-11ggaqf1	667	19	progress	progress	NN
cord-014462-11ggaqf1	667	20	of	of	IN
cord-014462-11ggaqf1	667	21	science	science	NN
cord-014462-11ggaqf1	667	22	during	during	IN
cord-014462-11ggaqf1	667	23	the	the	DT
cord-014462-11ggaqf1	667	24	last	last	JJ
cord-014462-11ggaqf1	667	25	six	six	CD
cord-014462-11ggaqf1	667	26	decades	decade	NNS
cord-014462-11ggaqf1	667	27	.	.	.
cord-014462-11ggaqf1	668	1	Although	although	IN
cord-014462-11ggaqf1	668	2	the	the	DT
cord-014462-11ggaqf1	668	3	'	'	``
cord-014462-11ggaqf1	668	4	strengths	strength	NNS
cord-014462-11ggaqf1	668	5	'	'	''
cord-014462-11ggaqf1	668	6	were	be	VBD
cord-014462-11ggaqf1	668	7	highlighted	highlight	VBN
cord-014462-11ggaqf1	668	8	in	in	IN
cord-014462-11ggaqf1	668	9	good	good	JJ
cord-014462-11ggaqf1	668	10	measure	measure	NN
cord-014462-11ggaqf1	668	11	,	,	,
cord-014462-11ggaqf1	668	12	it	-PRON-	PRP
cord-014462-11ggaqf1	668	13	was	be	VBD
cord-014462-11ggaqf1	668	14	the	the	DT
cord-014462-11ggaqf1	668	15	list	list	NN
cord-014462-11ggaqf1	668	16	of	of	IN
cord-014462-11ggaqf1	668	17	'	'	``
cord-014462-11ggaqf1	668	18	weaknesses	weakness	NNS
cord-014462-11ggaqf1	668	19	'	'	''
cord-014462-11ggaqf1	668	20	that	that	WDT
cord-014462-11ggaqf1	668	21	called	call	VBD
cord-014462-11ggaqf1	668	22	for	for	IN
cord-014462-11ggaqf1	668	23	attention	attention	NN
cord-014462-11ggaqf1	668	24	to	to	TO
cord-014462-11ggaqf1	668	25	upgrade	upgrade	VB
cord-014462-11ggaqf1	668	26	the	the	DT
cord-014462-11ggaqf1	668	27	standard	standard	NN
cord-014462-11ggaqf1	668	28	of	of	IN
cord-014462-11ggaqf1	668	29	research	research	NN
cord-014462-11ggaqf1	668	30	and	and	CC
cord-014462-11ggaqf1	668	31	'	'	``
cord-014462-11ggaqf1	668	32	opportunities	opportunity	NNS
cord-014462-11ggaqf1	668	33	'	'	''
cord-014462-11ggaqf1	668	34	that	that	WDT
cord-014462-11ggaqf1	668	35	provide	provide	VBP
cord-014462-11ggaqf1	668	36	scope	scope	NN
cord-014462-11ggaqf1	668	37	for	for	IN
cord-014462-11ggaqf1	668	38	overall	overall	JJ
cord-014462-11ggaqf1	668	39	scientific	scientific	JJ
cord-014462-11ggaqf1	668	40	growth	growth	NN
cord-014462-11ggaqf1	668	41	.	.	.
cord-014462-11ggaqf1	669	1	A	a	DT
cord-014462-11ggaqf1	669	2	comparison	comparison	NN
cord-014462-11ggaqf1	669	3	between	between	IN
cord-014462-11ggaqf1	669	4	India	India	NNP
cord-014462-11ggaqf1	669	5	and	and	CC
cord-014462-11ggaqf1	669	6	other	other	JJ
cord-014462-11ggaqf1	669	7	countries	country	NNS
cord-014462-11ggaqf1	669	8	in	in	IN
cord-014462-11ggaqf1	669	9	terms	term	NNS
cord-014462-11ggaqf1	669	10	of	of	IN
cord-014462-11ggaqf1	669	11	research	research	NN
cord-014462-11ggaqf1	669	12	papers	paper	NNS
cord-014462-11ggaqf1	669	13	published	publish	VBN
cord-014462-11ggaqf1	669	14	revealed	reveal	VBD
cord-014462-11ggaqf1	669	15	that	that	IN
cord-014462-11ggaqf1	669	16	India	India	NNP
cord-014462-11ggaqf1	669	17	's	's	POS
cord-014462-11ggaqf1	669	18	contribution	contribution	NN
cord-014462-11ggaqf1	669	19	to	to	IN
cord-014462-11ggaqf1	669	20	science	science	NN
cord-014462-11ggaqf1	669	21	has	have	VBZ
cord-014462-11ggaqf1	669	22	come	come	VBN
cord-014462-11ggaqf1	669	23	down	down	RP
cord-014462-11ggaqf1	669	24	enormously	enormously	RB
cord-014462-11ggaqf1	669	25	.	.	.
cord-014462-11ggaqf1	670	1	What	what	WP
cord-014462-11ggaqf1	670	2	ails	ail	VBZ
cord-014462-11ggaqf1	670	3	Indian	indian	JJ
cord-014462-11ggaqf1	670	4	Science	science	NN
cord-014462-11ggaqf1	670	5	?	?	.
cord-014462-11ggaqf1	671	1	Should	Should	MD
cord-014462-11ggaqf1	671	2	we	-PRON-	PRP
cord-014462-11ggaqf1	671	3	compare	compare	VB
cord-014462-11ggaqf1	671	4	the	the	DT
cord-014462-11ggaqf1	671	5	growth	growth	NN
cord-014462-11ggaqf1	671	6	of	of	IN
cord-014462-11ggaqf1	671	7	Indian	indian	JJ
cord-014462-11ggaqf1	671	8	science	science	NN
cord-014462-11ggaqf1	671	9	with	with	IN
cord-014462-11ggaqf1	671	10	other	other	JJ
cord-014462-11ggaqf1	671	11	developed	develop	VBN
cord-014462-11ggaqf1	671	12	countries	country	NNS
cord-014462-11ggaqf1	671	13	?	?	.
cord-014462-11ggaqf1	672	1	What	what	WDT
cord-014462-11ggaqf1	672	2	criteria	criterion	NNS
cord-014462-11ggaqf1	672	3	should	should	MD
cord-014462-11ggaqf1	672	4	be	be	VB
cord-014462-11ggaqf1	672	5	adopted	adopt	VBN
cord-014462-11ggaqf1	672	6	to	to	TO
cord-014462-11ggaqf1	672	7	judge	judge	VB
cord-014462-11ggaqf1	672	8	the	the	DT
cord-014462-11ggaqf1	672	9	quality	quality	NN
cord-014462-11ggaqf1	672	10	and	and	CC
cord-014462-11ggaqf1	672	11	standard	standard	NN
cord-014462-11ggaqf1	672	12	of	of	IN
cord-014462-11ggaqf1	672	13	scientific	scientific	JJ
cord-014462-11ggaqf1	672	14	research	research	NN
cord-014462-11ggaqf1	672	15	?	?	.
cord-014462-11ggaqf1	673	1	How	how	WRB
cord-014462-11ggaqf1	673	2	to	to	TO
cord-014462-11ggaqf1	673	3	motivate	motivate	VB
cord-014462-11ggaqf1	673	4	the	the	DT
cord-014462-11ggaqf1	673	5	scientists	scientist	NNS
cord-014462-11ggaqf1	673	6	to	to	TO
cord-014462-11ggaqf1	673	7	improve	improve	VB
cord-014462-11ggaqf1	673	8	their	-PRON-	PRP$
cord-014462-11ggaqf1	673	9	scientific	scientific	JJ
cord-014462-11ggaqf1	673	10	output	output	NN
cord-014462-11ggaqf1	673	11	?	?	.
cord-014462-11ggaqf1	674	1	How	how	WRB
cord-014462-11ggaqf1	674	2	do	do	VBP
cord-014462-11ggaqf1	674	3	motivate	motivate	VB
cord-014462-11ggaqf1	674	4	the	the	DT
cord-014462-11ggaqf1	674	5	scientists	scientist	NNS
cord-014462-11ggaqf1	674	6	to	to	TO
cord-014462-11ggaqf1	674	7	improve	improve	VB
cord-014462-11ggaqf1	674	8	their	-PRON-	PRP$
cord-014462-11ggaqf1	674	9	scientific	scientific	JJ
cord-014462-11ggaqf1	674	10	output	output	NN
cord-014462-11ggaqf1	674	11	?	?	.
cord-014462-11ggaqf1	675	1	How	how	WRB
cord-014462-11ggaqf1	675	2	do	do	VBP
cord-014462-11ggaqf1	675	3	Indian	indian	JJ
cord-014462-11ggaqf1	675	4	journals	journal	NNS
cord-014462-11ggaqf1	675	5	perform	perform	VB
cord-014462-11ggaqf1	675	6	in	in	IN
cord-014462-11ggaqf1	675	7	Maintaining	maintain	VBG
cord-014462-11ggaqf1	675	8	quality	quality	NN
cord-014462-11ggaqf1	675	9	?	?	.
cord-014462-11ggaqf1	676	1	This	this	DT
cord-014462-11ggaqf1	676	2	paper	paper	NN
cord-014462-11ggaqf1	676	3	analyses	analyse	VBZ
cord-014462-11ggaqf1	676	4	critically	critically	RB
cord-014462-11ggaqf1	676	5	the	the	DT
cord-014462-11ggaqf1	676	6	scientific	scientific	JJ
cord-014462-11ggaqf1	676	7	journals	journal	NNS
cord-014462-11ggaqf1	676	8	around	around	IN
cord-014462-11ggaqf1	676	9	the	the	DT
cord-014462-11ggaqf1	676	10	world	world	NN
cord-014462-11ggaqf1	676	11	,	,	,
cord-014462-11ggaqf1	676	12	based	base	VBN
cord-014462-11ggaqf1	676	13	on	on	IN
cord-014462-11ggaqf1	676	14	the	the	DT
cord-014462-11ggaqf1	676	15	scores	score	NNS
cord-014462-11ggaqf1	676	16	allotted	allot	VBN
cord-014462-11ggaqf1	676	17	by	by	IN
cord-014462-11ggaqf1	676	18	the	the	DT
cord-014462-11ggaqf1	676	19	National	National	NNP
cord-014462-11ggaqf1	676	20	Academy	Academy	NNP
cord-014462-11ggaqf1	676	21	of	of	IN
cord-014462-11ggaqf1	676	22	Agriculture	Agriculture	NNP
cord-014462-11ggaqf1	676	23	sciences	sciences	NNPS
cord-014462-11ggaqf1	676	24	(	(	-LRB-
cord-014462-11ggaqf1	676	25	NAAS	NAAS	NNP
cord-014462-11ggaqf1	676	26	)	)	-RRB-
cord-014462-11ggaqf1	676	27	in	in	IN
cord-014462-11ggaqf1	676	28	2003	2003	CD
cord-014462-11ggaqf1	676	29	and	and	CC
cord-014462-11ggaqf1	676	30	2007	2007	CD
cord-014462-11ggaqf1	676	31	for	for	IN
cord-014462-11ggaqf1	676	32	1460	1460	CD
cord-014462-11ggaqf1	676	33	and	and	CC
cord-014462-11ggaqf1	676	34	1608	1608	CD
cord-014462-11ggaqf1	676	35	journals	journal	NNS
cord-014462-11ggaqf1	676	36	respectively	respectively	RB
cord-014462-11ggaqf1	676	37	.	.	.
cord-014462-11ggaqf1	677	1	In	in	IN
cord-014462-11ggaqf1	677	2	general	general	JJ
cord-014462-11ggaqf1	677	3	,	,	,
cord-014462-11ggaqf1	677	4	the	the	DT
cord-014462-11ggaqf1	677	5	Indian	indian	JJ
cord-014462-11ggaqf1	677	6	journals	journal	NNS
cord-014462-11ggaqf1	677	7	performed	perform	VBN
cord-014462-11ggaqf1	677	8	poorly	poorly	RB
cord-014462-11ggaqf1	677	9	irrespective	irrespective	RB
cord-014462-11ggaqf1	677	10	of	of	IN
cord-014462-11ggaqf1	677	11	the	the	DT
cord-014462-11ggaqf1	677	12	disciplines	discipline	NNS
cord-014462-11ggaqf1	677	13	with	with	IN
cord-014462-11ggaqf1	677	14	only	only	RB
cord-014462-11ggaqf1	677	15	25	25	CD
cord-014462-11ggaqf1	677	16	-	-	SYM
cord-014462-11ggaqf1	677	17	30	30	CD
cord-014462-11ggaqf1	677	18	%	%	NN
cord-014462-11ggaqf1	677	19	in	in	IN
cord-014462-11ggaqf1	677	20	the	the	DT
cord-014462-11ggaqf1	677	21	high	high	JJ
cord-014462-11ggaqf1	677	22	standard	standard	NN
cord-014462-11ggaqf1	677	23	.	.	.
cord-014462-11ggaqf1	678	1	The	the	DT
cord-014462-11ggaqf1	678	2	paper	paper	NN
cord-014462-11ggaqf1	678	3	dealt	deal	VBD
cord-014462-11ggaqf1	678	4	with	with	IN
cord-014462-11ggaqf1	678	5	the	the	DT
cord-014462-11ggaqf1	678	6	reasons	reason	NNS
cord-014462-11ggaqf1	678	7	for	for	IN
cord-014462-11ggaqf1	678	8	low	low	JJ
cord-014462-11ggaqf1	678	9	impact	impact	NN
cord-014462-11ggaqf1	678	10	factor	factor	NN
cord-014462-11ggaqf1	678	11	,	,	,
cord-014462-11ggaqf1	678	12	the	the	DT
cord-014462-11ggaqf1	678	13	anomalies	anomaly	NNS
cord-014462-11ggaqf1	678	14	in	in	IN
cord-014462-11ggaqf1	678	15	the	the	DT
cord-014462-11ggaqf1	678	16	allotment	allotment	NN
cord-014462-11ggaqf1	678	17	of	of	IN
cord-014462-11ggaqf1	678	18	scores	score	NNS
cord-014462-11ggaqf1	678	19	to	to	IN
cord-014462-11ggaqf1	678	20	wide	wide	JJ
cord-014462-11ggaqf1	678	21	spectrum	spectrum	NN
cord-014462-11ggaqf1	678	22	of	of	IN
cord-014462-11ggaqf1	678	23	the	the	DT
cord-014462-11ggaqf1	678	24	journals	journal	NNS
cord-014462-11ggaqf1	678	25	and	and	CC
cord-014462-11ggaqf1	678	26	the	the	DT
cord-014462-11ggaqf1	678	27	disadvantages	disadvantage	NNS
cord-014462-11ggaqf1	678	28	the	the	DT
cord-014462-11ggaqf1	678	29	scientists	scientist	NNS
cord-014462-11ggaqf1	678	30	face	face	VBP
cord-014462-11ggaqf1	678	31	with	with	IN
cord-014462-11ggaqf1	678	32	the	the	DT
cord-014462-11ggaqf1	678	33	scoring	scoring	NN
cord-014462-11ggaqf1	678	34	system	system	NN
cord-014462-11ggaqf1	678	35	.	.	.
cord-014462-11ggaqf1	679	1	A	a	DT
cord-014462-11ggaqf1	679	2	case	case	NN
cord-014462-11ggaqf1	679	3	study	study	NN
cord-014462-11ggaqf1	679	4	was	be	VBD
cord-014462-11ggaqf1	679	5	presented	present	VBN
cord-014462-11ggaqf1	679	6	of	of	IN
cord-014462-11ggaqf1	679	7	an	an	DT
cord-014462-11ggaqf1	679	8	Institute	Institute	NNP
cord-014462-11ggaqf1	679	9	with	with	IN
cord-014462-11ggaqf1	679	10	over	over	IN
cord-014462-11ggaqf1	679	11	50	50	CD
cord-014462-11ggaqf1	679	12	scientists	scientist	NNS
cord-014462-11ggaqf1	679	13	whose	whose	WP$
cord-014462-11ggaqf1	679	14	publications	publication	NNS
cord-014462-11ggaqf1	679	15	were	be	VBD
cord-014462-11ggaqf1	679	16	analyzed	analyze	VBN
cord-014462-11ggaqf1	679	17	to	to	TO
cord-014462-11ggaqf1	679	18	discuss	discuss	VB
cord-014462-11ggaqf1	679	19	the	the	DT
cord-014462-11ggaqf1	679	20	merits	merit	NNS
cord-014462-11ggaqf1	679	21	and	and	CC
cord-014462-11ggaqf1	679	22	demerits	demerit	NNS
cord-014462-11ggaqf1	679	23	of	of	IN
cord-014462-11ggaqf1	679	24	the	the	DT
cord-014462-11ggaqf1	679	25	system	system	NN
cord-014462-11ggaqf1	679	26	.	.	.
cord-014462-11ggaqf1	680	1	The	the	DT
cord-014462-11ggaqf1	680	2	performance	performance	NN
cord-014462-11ggaqf1	680	3	of	of	IN
cord-014462-11ggaqf1	680	4	the	the	DT
cord-014462-11ggaqf1	680	5	journals	journal	NNS
cord-014462-11ggaqf1	680	6	published	publish	VBN
cord-014462-11ggaqf1	680	7	by	by	IN
cord-014462-11ggaqf1	680	8	prestigious	prestigious	JJ
cord-014462-11ggaqf1	680	9	academics	academic	NNS
cord-014462-11ggaqf1	680	10	,	,	,
cord-014462-11ggaqf1	680	11	societies	society	NNS
cord-014462-11ggaqf1	680	12	and	and	CC
cord-014462-11ggaqf1	680	13	councils	council	NNS
cord-014462-11ggaqf1	680	14	was	be	VBD
cord-014462-11ggaqf1	680	15	also	also	RB
cord-014462-11ggaqf1	680	16	projected	project	VBN
cord-014462-11ggaqf1	680	17	.	.	.
cord-014462-11ggaqf1	681	1	The	the	DT
cord-014462-11ggaqf1	681	2	paper	paper	NN
cord-014462-11ggaqf1	681	3	concluded	conclude	VBD
cord-014462-11ggaqf1	681	4	with	with	IN
cord-014462-11ggaqf1	681	5	the	the	DT
cord-014462-11ggaqf1	681	6	need	need	NN
cord-014462-11ggaqf1	681	7	for	for	IN
cord-014462-11ggaqf1	681	8	enhancing	enhance	VBG
cord-014462-11ggaqf1	681	9	the	the	DT
cord-014462-11ggaqf1	681	10	image	image	NN
cord-014462-11ggaqf1	681	11	of	of	IN
cord-014462-11ggaqf1	681	12	the	the	DT
cord-014462-11ggaqf1	681	13	country	country	NN
cord-014462-11ggaqf1	681	14	through	through	IN
cord-014462-11ggaqf1	681	15	research	research	NN
cord-014462-11ggaqf1	681	16	publications	publication	NNS
cord-014462-11ggaqf1	681	17	in	in	IN
cord-014462-11ggaqf1	681	18	high	high	JJ
cord-014462-11ggaqf1	681	19	standard	standard	JJ
cord-014462-11ggaqf1	681	20	journals	journal	NNS
cord-014462-11ggaqf1	681	21	and	and	CC
cord-014462-11ggaqf1	681	22	the	the	DT
cord-014462-11ggaqf1	681	23	role	role	NN
cord-014462-11ggaqf1	681	24	of	of	IN
cord-014462-11ggaqf1	681	25	various	various	JJ
cord-014462-11ggaqf1	681	26	scientific	scientific	JJ
cord-014462-11ggaqf1	681	27	bodies	body	NNS
cord-014462-11ggaqf1	681	28	with	with	IN
cord-014462-11ggaqf1	681	29	shore	shore	NN
cord-014462-11ggaqf1	681	30	and	and	CC
cord-014462-11ggaqf1	681	31	long	long	JJ
cord-014462-11ggaqf1	681	32	term	term	NN
cord-014462-11ggaqf1	681	33	measures	measure	NNS
cord-014462-11ggaqf1	681	34	.	.	.
cord-014462-11ggaqf1	682	1	Poster	poster	NN
cord-014462-11ggaqf1	682	2	Session	session	NN
cord-014462-11ggaqf1	682	3	Herpes	Herpes	NNP
cord-014462-11ggaqf1	682	4	Simplex	Simplex	NNP
cord-014462-11ggaqf1	682	5	Virus	Virus	NNP
cord-014462-11ggaqf1	682	6	(	(	-LRB-
cord-014462-11ggaqf1	682	7	HSV	HSV	NNP
cord-014462-11ggaqf1	682	8	)	)	-RRB-
cord-014462-11ggaqf1	682	9	keratitis	keratitis	NN
cord-014462-11ggaqf1	682	10	is	be	VBZ
cord-014462-11ggaqf1	682	11	a	a	DT
cord-014462-11ggaqf1	682	12	leading	leading	JJ
cord-014462-11ggaqf1	682	13	cause	cause	NN
cord-014462-11ggaqf1	682	14	of	of	IN
cord-014462-11ggaqf1	682	15	corneal	corneal	JJ
cord-014462-11ggaqf1	682	16	blindness	blindness	NN
cord-014462-11ggaqf1	682	17	throughout	throughout	IN
cord-014462-11ggaqf1	682	18	the	the	DT
cord-014462-11ggaqf1	682	19	world	world	NN
cord-014462-11ggaqf1	682	20	.	.	.
cord-014462-11ggaqf1	683	1	The	the	DT
cord-014462-11ggaqf1	683	2	infection	infection	NN
cord-014462-11ggaqf1	683	3	can	can	MD
cord-014462-11ggaqf1	683	4	be	be	VB
cord-014462-11ggaqf1	683	5	diagnosed	diagnose	VBN
cord-014462-11ggaqf1	683	6	by	by	IN
cord-014462-11ggaqf1	683	7	clinical	clinical	JJ
cord-014462-11ggaqf1	683	8	manifestations	manifestation	NNS
cord-014462-11ggaqf1	683	9	but	but	CC
cord-014462-11ggaqf1	683	10	in	in	IN
cord-014462-11ggaqf1	683	11	case	case	NN
cord-014462-11ggaqf1	683	12	of	of	IN
cord-014462-11ggaqf1	683	13	atypical	atypical	JJ
cord-014462-11ggaqf1	683	14	ocular	ocular	JJ
cord-014462-11ggaqf1	683	15	cases	case	NNS
cord-014462-11ggaqf1	683	16	,	,	,
cord-014462-11ggaqf1	683	17	laboratory	laboratory	NN
cord-014462-11ggaqf1	683	18	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	683	19	is	be	VBZ
cord-014462-11ggaqf1	683	20	more	more	RBR
cord-014462-11ggaqf1	683	21	helpful	helpful	JJ
cord-014462-11ggaqf1	683	22	in	in	IN
cord-014462-11ggaqf1	683	23	timely	timely	JJ
cord-014462-11ggaqf1	683	24	management	management	NN
cord-014462-11ggaqf1	683	25	of	of	IN
cord-014462-11ggaqf1	683	26	disease	disease	NN
cord-014462-11ggaqf1	683	27	.	.	.
cord-014462-11ggaqf1	684	1	Collection	collection	NN
cord-014462-11ggaqf1	684	2	of	of	IN
cord-014462-11ggaqf1	684	3	corneal	corneal	JJ
cord-014462-11ggaqf1	684	4	scrapings	scraping	NNS
cord-014462-11ggaqf1	684	5	in	in	IN
cord-014462-11ggaqf1	684	6	all	all	DT
cord-014462-11ggaqf1	684	7	cases	case	NNS
cord-014462-11ggaqf1	684	8	of	of	IN
cord-014462-11ggaqf1	684	9	stromal	stromal	JJ
cord-014462-11ggaqf1	684	10	and	and	CC
cord-014462-11ggaqf1	684	11	epithelial	epithelial	JJ
cord-014462-11ggaqf1	684	12	keratitis	keratitis	NN
cord-014462-11ggaqf1	684	13	may	may	MD
cord-014462-11ggaqf1	684	14	not	not	RB
cord-014462-11ggaqf1	684	15	be	be	VB
cord-014462-11ggaqf1	684	16	possible	possible	JJ
cord-014462-11ggaqf1	684	17	,	,	,
cord-014462-11ggaqf1	684	18	but	but	CC
cord-014462-11ggaqf1	684	19	collecting	collect	VBG
cord-014462-11ggaqf1	684	20	tear	tear	JJ
cord-014462-11ggaqf1	684	21	fluid	fluid	NN
cord-014462-11ggaqf1	684	22	is	be	VBZ
cord-014462-11ggaqf1	684	23	a	a	DT
cord-014462-11ggaqf1	684	24	convenient	convenient	JJ
cord-014462-11ggaqf1	684	25	procedure	procedure	NN
cord-014462-11ggaqf1	684	26	causing	cause	VBG
cord-014462-11ggaqf1	684	27	less	less	JJR
cord-014462-11ggaqf1	684	28	discomfort	discomfort	NN
cord-014462-11ggaqf1	684	29	to	to	IN
cord-014462-11ggaqf1	684	30	the	the	DT
cord-014462-11ggaqf1	684	31	patients	patient	NNS
cord-014462-11ggaqf1	684	32	.	.	.
cord-014462-11ggaqf1	685	1	Therefore	therefore	RB
cord-014462-11ggaqf1	685	2	,	,	,
cord-014462-11ggaqf1	685	3	the	the	DT
cord-014462-11ggaqf1	685	4	present	present	JJ
cord-014462-11ggaqf1	685	5	study	study	NN
cord-014462-11ggaqf1	685	6	was	be	VBD
cord-014462-11ggaqf1	685	7	intended	intend	VBN
cord-014462-11ggaqf1	685	8	to	to	TO
cord-014462-11ggaqf1	685	9	evaluate	evaluate	VB
cord-014462-11ggaqf1	685	10	the	the	DT
cord-014462-11ggaqf1	685	11	suitability	suitability	NN
cord-014462-11ggaqf1	685	12	of	of	IN
cord-014462-11ggaqf1	685	13	tear	tear	NN
cord-014462-11ggaqf1	685	14	specimens	specimen	NNS
cord-014462-11ggaqf1	685	15	for	for	IN
cord-014462-11ggaqf1	685	16	detecting	detect	VBG
cord-014462-11ggaqf1	685	17	HSV	HSV	NNP
cord-014462-11ggaqf1	685	18	by	by	IN
cord-014462-11ggaqf1	685	19	polymerase	polymerase	NN
cord-014462-11ggaqf1	685	20	chain	chain	NN
cord-014462-11ggaqf1	685	21	reaction	reaction	NN
cord-014462-11ggaqf1	685	22	(	(	-LRB-
cord-014462-11ggaqf1	685	23	PCR	PCR	NNP
cord-014462-11ggaqf1	685	24	)	)	-RRB-
cord-014462-11ggaqf1	685	25	and	and	CC
cord-014462-11ggaqf1	685	26	immunofluorescence	immunofluorescence	NN
cord-014462-11ggaqf1	685	27	(	(	-LRB-
cord-014462-11ggaqf1	685	28	IFA	IFA	NNP
cord-014462-11ggaqf1	685	29	)	)	-RRB-
cord-014462-11ggaqf1	685	30	.	.	.
cord-014462-11ggaqf1	686	1	Tear	tear	VB
cord-014462-11ggaqf1	686	2	fluid	fluid	NN
cord-014462-11ggaqf1	686	3	and	and	CC
cord-014462-11ggaqf1	686	4	corneal	corneal	JJ
cord-014462-11ggaqf1	686	5	scrapings	scraping	NNS
cord-014462-11ggaqf1	686	6	were	be	VBD
cord-014462-11ggaqf1	686	7	collected	collect	VBN
cord-014462-11ggaqf1	686	8	from	from	IN
cord-014462-11ggaqf1	686	9	134	134	CD
cord-014462-11ggaqf1	686	10	patients	patient	NNS
cord-014462-11ggaqf1	686	11	of	of	IN
cord-014462-11ggaqf1	686	12	suspected	suspect	VBN
cord-014462-11ggaqf1	686	13	herpetic	herpetic	JJ
cord-014462-11ggaqf1	686	14	keratitis	keratiti	NNS
cord-014462-11ggaqf1	686	15	.	.	.
cord-014462-11ggaqf1	687	1	HSV-1	HSV-1	NNP
cord-014462-11ggaqf1	687	2	antigen	antigen	NN
cord-014462-11ggaqf1	687	3	was	be	VBD
cord-014462-11ggaqf1	687	4	detected	detect	VBN
cord-014462-11ggaqf1	687	5	by	by	IN
cord-014462-11ggaqf1	687	6	IFA	IFA	NNP
cord-014462-11ggaqf1	687	7	using	use	VBG
cord-014462-11ggaqf1	687	8	rabbit	rabbit	NN
cord-014462-11ggaqf1	687	9	anti	anti	JJ
cord-014462-11ggaqf1	687	10	-	-	JJ
cord-014462-11ggaqf1	687	11	HSV	hsv	JJ
cord-014462-11ggaqf1	687	12	antibodies	antibody	NNS
cord-014462-11ggaqf1	687	13	.	.	.
cord-014462-11ggaqf1	688	1	PCR	PCR	NNP
cord-014462-11ggaqf1	688	2	was	be	VBD
cord-014462-11ggaqf1	688	3	performed	perform	VBN
cord-014462-11ggaqf1	688	4	to	to	TO
cord-014462-11ggaqf1	688	5	amplify	amplify	VB
cord-014462-11ggaqf1	688	6	111	111	CD
cord-014462-11ggaqf1	688	7	bp	bp	NNP
cord-014462-11ggaqf1	688	8	region	region	NN
cord-014462-11ggaqf1	688	9	of	of	IN
cord-014462-11ggaqf1	688	10	thymidine	thymidine	NN
cord-014462-11ggaqf1	688	11	kinase	kinase	NN
cord-014462-11ggaqf1	688	12	(	(	-LRB-
cord-014462-11ggaqf1	688	13	tk	tk	NNP
cord-014462-11ggaqf1	688	14	)	)	-RRB-
cord-014462-11ggaqf1	688	15	coding	code	VBG
cord-014462-11ggaqf1	688	16	gene	gene	NN
cord-014462-11ggaqf1	688	17	and	and	CC
cord-014462-11ggaqf1	688	18	144	144	CD
cord-014462-11ggaqf1	688	19	bp	bp	NNP
cord-014462-11ggaqf1	688	20	region	region	NN
cord-014462-11ggaqf1	688	21	from	from	IN
cord-014462-11ggaqf1	688	22	DNA	dna	NN
cord-014462-11ggaqf1	688	23	polymerase	polymerase	NN
cord-014462-11ggaqf1	688	24	coding	coding	NN
cord-014462-11ggaqf1	688	25	gene	gene	NN
cord-014462-11ggaqf1	688	26	of	of	IN
cord-014462-11ggaqf1	688	27	HSV	HSV	NNP
cord-014462-11ggaqf1	688	28	.	.	.
cord-014462-11ggaqf1	689	1	Out	out	IN
cord-014462-11ggaqf1	689	2	of	of	IN
cord-014462-11ggaqf1	689	3	134	134	CD
cord-014462-11ggaqf1	689	4	patients	patient	NNS
cord-014462-11ggaqf1	689	5	HSV	HSV	NNP
cord-014462-11ggaqf1	689	6	antigen	antigen	NN
cord-014462-11ggaqf1	689	7	was	be	VBD
cord-014462-11ggaqf1	689	8	detected	detect	VBN
cord-014462-11ggaqf1	689	9	in	in	IN
cord-014462-11ggaqf1	689	10	25	25	CD
cord-014462-11ggaqf1	689	11	(	(	-LRB-
cord-014462-11ggaqf1	689	12	18.65	18.65	CD
cord-014462-11ggaqf1	689	13	%	%	NN
cord-014462-11ggaqf1	689	14	)	)	-RRB-
cord-014462-11ggaqf1	689	15	of	of	IN
cord-014462-11ggaqf1	689	16	corneal	corneal	JJ
cord-014462-11ggaqf1	689	17	scrapings	scraping	NNS
cord-014462-11ggaqf1	689	18	and	and	CC
cord-014462-11ggaqf1	689	19	15	15	CD
cord-014462-11ggaqf1	689	20	(	(	-LRB-
cord-014462-11ggaqf1	689	21	11.19	11.19	CD
cord-014462-11ggaqf1	689	22	%	%	NN
cord-014462-11ggaqf1	689	23	)	)	-RRB-
cord-014462-11ggaqf1	689	24	of	of	IN
cord-014462-11ggaqf1	689	25	tear	tear	JJ
cord-014462-11ggaqf1	689	26	specimens	specimen	NNS
cord-014462-11ggaqf1	689	27	and	and	CC
cord-014462-11ggaqf1	689	28	in	in	IN
cord-014462-11ggaqf1	689	29	12	12	CD
cord-014462-11ggaqf1	689	30	(	(	-LRB-
cord-014462-11ggaqf1	689	31	8.95	8.95	CD
cord-014462-11ggaqf1	689	32	%	%	NN
cord-014462-11ggaqf1	689	33	)	)	-RRB-
cord-014462-11ggaqf1	689	34	patients	patient	NNS
cord-014462-11ggaqf1	689	35	from	from	IN
cord-014462-11ggaqf1	689	36	both	both	CC
cord-014462-11ggaqf1	689	37	the	the	DT
cord-014462-11ggaqf1	689	38	specimens	specimen	NNS
cord-014462-11ggaqf1	689	39	.	.	.
cord-014462-11ggaqf1	690	1	HSV	HSV	NNP
cord-014462-11ggaqf1	690	2	gene	gene	NN
cord-014462-11ggaqf1	690	3	could	could	MD
cord-014462-11ggaqf1	690	4	be	be	VB
cord-014462-11ggaqf1	690	5	amplified	amplify	VBN
cord-014462-11ggaqf1	690	6	in	in	IN
cord-014462-11ggaqf1	690	7	44	44	CD
cord-014462-11ggaqf1	690	8	(	(	-LRB-
cord-014462-11ggaqf1	690	9	32.83	32.83	CD
cord-014462-11ggaqf1	690	10	%	%	NN
cord-014462-11ggaqf1	690	11	)	)	-RRB-
cord-014462-11ggaqf1	690	12	of	of	IN
cord-014462-11ggaqf1	690	13	corneal	corneal	JJ
cord-014462-11ggaqf1	690	14	scrapings	scraping	NNS
cord-014462-11ggaqf1	690	15	and	and	CC
cord-014462-11ggaqf1	690	16	16	16	CD
cord-014462-11ggaqf1	690	17	(	(	-LRB-
cord-014462-11ggaqf1	690	18	11.94	11.94	CD
cord-014462-11ggaqf1	690	19	%	%	NN
cord-014462-11ggaqf1	690	20	)	)	-RRB-
cord-014462-11ggaqf1	690	21	of	of	IN
cord-014462-11ggaqf1	690	22	tear	tear	JJ
cord-014462-11ggaqf1	690	23	fluids	fluid	NNS
cord-014462-11ggaqf1	690	24	and	and	CC
cord-014462-11ggaqf1	690	25	in	in	IN
cord-014462-11ggaqf1	690	26	13	13	CD
cord-014462-11ggaqf1	690	27	(	(	-LRB-
cord-014462-11ggaqf1	690	28	9.71	9.71	CD
cord-014462-11ggaqf1	690	29	%	%	NN
cord-014462-11ggaqf1	690	30	)	)	-RRB-
cord-014462-11ggaqf1	690	31	patients	patient	NNS
cord-014462-11ggaqf1	690	32	from	from	IN
cord-014462-11ggaqf1	690	33	both	both	CC
cord-014462-11ggaqf1	690	34	the	the	DT
cord-014462-11ggaqf1	690	35	specimens	specimen	NNS
cord-014462-11ggaqf1	690	36	.	.	.
cord-014462-11ggaqf1	691	1	Although	although	IN
cord-014462-11ggaqf1	691	2	,	,	,
cord-014462-11ggaqf1	691	3	corneal	corneal	JJ
cord-014462-11ggaqf1	691	4	scraping	scraping	NN
cord-014462-11ggaqf1	691	5	seemed	seem	VBD
cord-014462-11ggaqf1	691	6	to	to	TO
cord-014462-11ggaqf1	691	7	be	be	VB
cord-014462-11ggaqf1	691	8	marginally	marginally	RB
cord-014462-11ggaqf1	691	9	superior	superior	JJ
cord-014462-11ggaqf1	691	10	material	material	NN
cord-014462-11ggaqf1	691	11	for	for	IN
cord-014462-11ggaqf1	691	12	detection	detection	NN
cord-014462-11ggaqf1	691	13	of	of	IN
cord-014462-11ggaqf1	691	14	HSV	HSV	NNP
cord-014462-11ggaqf1	691	15	,	,	,
cord-014462-11ggaqf1	691	16	tear	tear	JJ
cord-014462-11ggaqf1	691	17	fluid	fluid	NN
cord-014462-11ggaqf1	691	18	may	may	MD
cord-014462-11ggaqf1	691	19	also	also	RB
cord-014462-11ggaqf1	691	20	serve	serve	VB
cord-014462-11ggaqf1	691	21	as	as	IN
cord-014462-11ggaqf1	691	22	an	an	DT
cord-014462-11ggaqf1	691	23	appropriate	appropriate	JJ
cord-014462-11ggaqf1	691	24	alternative	alternative	JJ
cord-014462-11ggaqf1	691	25	clinical	clinical	JJ
cord-014462-11ggaqf1	691	26	specimen	specimen	NN
cord-014462-11ggaqf1	691	27	,	,	,
cord-014462-11ggaqf1	691	28	due	due	IN
cord-014462-11ggaqf1	691	29	to	to	IN
cord-014462-11ggaqf1	691	30	ease	ease	NN
cord-014462-11ggaqf1	691	31	of	of	IN
cord-014462-11ggaqf1	691	32	collection	collection	NN
cord-014462-11ggaqf1	691	33	and	and	CC
cord-014462-11ggaqf1	691	34	least	least	JJS
cord-014462-11ggaqf1	691	35	discomfort	discomfort	NN
cord-014462-11ggaqf1	691	36	to	to	IN
cord-014462-11ggaqf1	691	37	the	the	DT
cord-014462-11ggaqf1	691	38	patients	patient	NNS
cord-014462-11ggaqf1	691	39	.	.	.
cord-014462-11ggaqf1	692	1	In	in	IN
cord-014462-11ggaqf1	692	2	either	either	DT
cord-014462-11ggaqf1	692	3	cases	case	NNS
cord-014462-11ggaqf1	692	4	PCR	PCR	NNP
cord-014462-11ggaqf1	692	5	detected	detect	VBD
cord-014462-11ggaqf1	692	6	higher	high	JJR
cord-014462-11ggaqf1	692	7	number	number	NN
cord-014462-11ggaqf1	692	8	of	of	IN
cord-014462-11ggaqf1	692	9	HSV	HSV	NNP
cord-014462-11ggaqf1	692	10	cases	case	NNS
cord-014462-11ggaqf1	692	11	than	than	IN
cord-014462-11ggaqf1	692	12	IFA	IFA	NNP
cord-014462-11ggaqf1	692	13	.	.	.
cord-014462-11ggaqf1	693	1	Therefore	therefore	RB
cord-014462-11ggaqf1	693	2	if	if	IN
cord-014462-11ggaqf1	693	3	and	and	CC
cord-014462-11ggaqf1	693	4	when	when	WRB
cord-014462-11ggaqf1	693	5	feasible	feasible	JJ
cord-014462-11ggaqf1	693	6	,	,	,
cord-014462-11ggaqf1	693	7	both	both	CC
cord-014462-11ggaqf1	693	8	IFA	IFA	NNP
cord-014462-11ggaqf1	693	9	and	and	CC
cord-014462-11ggaqf1	693	10	PCR	PCR	NNP
cord-014462-11ggaqf1	693	11	should	should	MD
cord-014462-11ggaqf1	693	12	be	be	VB
cord-014462-11ggaqf1	693	13	used	use	VBN
cord-014462-11ggaqf1	693	14	simultaneously	simultaneously	RB
cord-014462-11ggaqf1	693	15	on	on	IN
cord-014462-11ggaqf1	693	16	each	each	DT
cord-014462-11ggaqf1	693	17	specimen	specimen	NN
cord-014462-11ggaqf1	693	18	to	to	TO
cord-014462-11ggaqf1	693	19	obtain	obtain	VB
cord-014462-11ggaqf1	693	20	best	good	JJS
cord-014462-11ggaqf1	693	21	results	result	NNS
cord-014462-11ggaqf1	693	22	.	.	.
cord-014462-11ggaqf1	694	1	Cytokines	cytokine	NNS
cord-014462-11ggaqf1	694	2	play	play	VBP
cord-014462-11ggaqf1	694	3	a	a	DT
cord-014462-11ggaqf1	694	4	key	key	JJ
cord-014462-11ggaqf1	694	5	role	role	NN
cord-014462-11ggaqf1	694	6	in	in	IN
cord-014462-11ggaqf1	694	7	the	the	DT
cord-014462-11ggaqf1	694	8	regulation	regulation	NN
cord-014462-11ggaqf1	694	9	of	of	IN
cord-014462-11ggaqf1	694	10	immune	immune	JJ
cord-014462-11ggaqf1	694	11	responses	response	NNS
cord-014462-11ggaqf1	694	12	.	.	.
cord-014462-11ggaqf1	695	1	In	in	IN
cord-014462-11ggaqf1	695	2	hepatitis	hepatitis	NN
cord-014462-11ggaqf1	695	3	C	c	NN
cord-014462-11ggaqf1	695	4	virus	virus	NN
cord-014462-11ggaqf1	695	5	infection	infection	NN
cord-014462-11ggaqf1	695	6	(	(	-LRB-
cord-014462-11ggaqf1	695	7	HCV	HCV	NNP
cord-014462-11ggaqf1	695	8	)	)	-RRB-
cord-014462-11ggaqf1	695	9	,	,	,
cord-014462-11ggaqf1	695	10	the	the	DT
cord-014462-11ggaqf1	695	11	production	production	NN
cord-014462-11ggaqf1	695	12	of	of	IN
cord-014462-11ggaqf1	695	13	inappropriate	inappropriate	JJ
cord-014462-11ggaqf1	695	14	cytokine	cytokine	NN
cord-014462-11ggaqf1	695	15	levels	level	NNS
cord-014462-11ggaqf1	695	16	appears	appear	VBZ
cord-014462-11ggaqf1	695	17	to	to	TO
cord-014462-11ggaqf1	695	18	contribute	contribute	VB
cord-014462-11ggaqf1	695	19	to	to	IN
cord-014462-11ggaqf1	695	20	viral	viral	JJ
cord-014462-11ggaqf1	695	21	persistence	persistence	NN
cord-014462-11ggaqf1	695	22	and	and	CC
cord-014462-11ggaqf1	695	23	to	to	TO
cord-014462-11ggaqf1	695	24	affect	affect	VB
cord-014462-11ggaqf1	695	25	response	response	NN
cord-014462-11ggaqf1	695	26	to	to	IN
cord-014462-11ggaqf1	695	27	therapy	therapy	NN
cord-014462-11ggaqf1	695	28	.	.	.
cord-014462-11ggaqf1	696	1	IL-6	IL-6	NNP
cord-014462-11ggaqf1	696	2	is	be	VBZ
cord-014462-11ggaqf1	696	3	produced	produce	VBN
cord-014462-11ggaqf1	696	4	by	by	IN
cord-014462-11ggaqf1	696	5	a	a	DT
cord-014462-11ggaqf1	696	6	variety	variety	NN
cord-014462-11ggaqf1	696	7	of	of	IN
cord-014462-11ggaqf1	696	8	cells	cell	NNS
cord-014462-11ggaqf1	696	9	including	include	VBG
cord-014462-11ggaqf1	696	10	T	t	NN
cord-014462-11ggaqf1	696	11	cells	cell	NNS
cord-014462-11ggaqf1	696	12	,	,	,
cord-014462-11ggaqf1	696	13	phagocytes	phagocyte	NNS
cord-014462-11ggaqf1	696	14	and	and	CC
cord-014462-11ggaqf1	696	15	fibroblast	fibroblast	NN
cord-014462-11ggaqf1	696	16	.	.	.
cord-014462-11ggaqf1	697	1	Cytokine	cytokine	NN
cord-014462-11ggaqf1	697	2	genes	gene	NNS
cord-014462-11ggaqf1	697	3	are	be	VBP
cord-014462-11ggaqf1	697	4	polymorphic	polymorphic	JJ
cord-014462-11ggaqf1	697	5	at	at	IN
cord-014462-11ggaqf1	697	6	specific	specific	JJ
cord-014462-11ggaqf1	697	7	sites	site	NNS
cord-014462-11ggaqf1	697	8	,	,	,
cord-014462-11ggaqf1	697	9	and	and	CC
cord-014462-11ggaqf1	697	10	certain	certain	JJ
cord-014462-11ggaqf1	697	11	mutations	mutation	NNS
cord-014462-11ggaqf1	697	12	located	locate	VBN
cord-014462-11ggaqf1	697	13	within	within	IN
cord-014462-11ggaqf1	697	14	coding	code	VBG
cord-014462-11ggaqf1	697	15	/	/	SYM
cord-014462-11ggaqf1	697	16	regulatory	regulatory	JJ
cord-014462-11ggaqf1	697	17	regions	region	NNS
cord-014462-11ggaqf1	697	18	have	have	VBP
cord-014462-11ggaqf1	697	19	been	be	VBN
cord-014462-11ggaqf1	697	20	shown	show	VBN
cord-014462-11ggaqf1	697	21	to	to	TO
cord-014462-11ggaqf1	697	22	affect	affect	VB
cord-014462-11ggaqf1	697	23	the	the	DT
cord-014462-11ggaqf1	697	24	overall	overall	JJ
cord-014462-11ggaqf1	697	25	expression	expression	NN
cord-014462-11ggaqf1	697	26	and	and	CC
cord-014462-11ggaqf1	697	27	secretion	secretion	NN
cord-014462-11ggaqf1	697	28	of	of	IN
cord-014462-11ggaqf1	697	29	cytokines	cytokine	NNS
cord-014462-11ggaqf1	697	30	in	in	IN
cord-014462-11ggaqf1	697	31	patients	patient	NNS
cord-014462-11ggaqf1	697	32	with	with	IN
cord-014462-11ggaqf1	697	33	HCV	HCV	NNP
cord-014462-11ggaqf1	697	34	infection	infection	NN
cord-014462-11ggaqf1	697	35	.	.	.
cord-014462-11ggaqf1	698	1	To	to	TO
cord-014462-11ggaqf1	698	2	correlate	correlate	VB
cord-014462-11ggaqf1	698	3	the	the	DT
cord-014462-11ggaqf1	698	4	serum	serum	NN
cord-014462-11ggaqf1	698	5	levels	level	NNS
cord-014462-11ggaqf1	698	6	and	and	CC
cord-014462-11ggaqf1	698	7	polymorphism	polymorphism	NN
cord-014462-11ggaqf1	698	8	of	of	IN
cord-014462-11ggaqf1	698	9	IL-6	IL-6	NNP
cord-014462-11ggaqf1	698	10	gene	gene	NN
cord-014462-11ggaqf1	698	11	in	in	IN
cord-014462-11ggaqf1	698	12	chronic	chronic	JJ
cord-014462-11ggaqf1	698	13	hepatitis	hepatitis	NN
cord-014462-11ggaqf1	698	14	C	C	NNP
cord-014462-11ggaqf1	698	15	patients	patient	NNS
cord-014462-11ggaqf1	698	16	and	and	CC
cord-014462-11ggaqf1	698	17	healthy	healthy	JJ
cord-014462-11ggaqf1	698	18	controls	control	NNS
cord-014462-11ggaqf1	698	19	.	.	.
cord-014462-11ggaqf1	699	1	Forty	forty	CD
cord-014462-11ggaqf1	699	2	patients	patient	NNS
cord-014462-11ggaqf1	699	3	positive	positive	JJ
cord-014462-11ggaqf1	699	4	for	for	IN
cord-014462-11ggaqf1	699	5	HCV	HCV	NNP
cord-014462-11ggaqf1	699	6	RNA	RNA	NNP
cord-014462-11ggaqf1	699	7	attending	attend	VBG
cord-014462-11ggaqf1	699	8	the	the	DT
cord-014462-11ggaqf1	699	9	Medicine	Medicine	NNP
cord-014462-11ggaqf1	699	10	out	out	RP
cord-014462-11ggaqf1	699	11	patient	patient	JJ
cord-014462-11ggaqf1	699	12	department	department	NN
cord-014462-11ggaqf1	699	13	and	and	CC
cord-014462-11ggaqf1	699	14	wards	ward	NNS
cord-014462-11ggaqf1	699	15	of	of	IN
cord-014462-11ggaqf1	699	16	Lok	Lok	NNP
cord-014462-11ggaqf1	699	17	Nayak	Nayak	NNP
cord-014462-11ggaqf1	699	18	Hospital	Hospital	NNP
cord-014462-11ggaqf1	699	19	,	,	,
cord-014462-11ggaqf1	699	20	New	New	NNP
cord-014462-11ggaqf1	699	21	Delhi	Delhi	NNP
cord-014462-11ggaqf1	699	22	as	as	RB
cord-014462-11ggaqf1	699	23	well	well	RB
cord-014462-11ggaqf1	699	24	as	as	IN
cord-014462-11ggaqf1	699	25	forty	forty	CD
cord-014462-11ggaqf1	699	26	healthy	healthy	JJ
cord-014462-11ggaqf1	699	27	controls	control	NNS
cord-014462-11ggaqf1	699	28	were	be	VBD
cord-014462-11ggaqf1	699	29	enrolled	enrol	VBN
cord-014462-11ggaqf1	699	30	for	for	IN
cord-014462-11ggaqf1	699	31	the	the	DT
cord-014462-11ggaqf1	699	32	study	study	NN
cord-014462-11ggaqf1	699	33	.	.	.
cord-014462-11ggaqf1	700	1	The	the	DT
cord-014462-11ggaqf1	700	2	serum	serum	NN
cord-014462-11ggaqf1	700	3	level	level	NN
cord-014462-11ggaqf1	700	4	of	of	IN
cord-014462-11ggaqf1	700	5	IL-6	IL-6	NNP
cord-014462-11ggaqf1	700	6	was	be	VBD
cord-014462-11ggaqf1	700	7	detected	detect	VBN
cord-014462-11ggaqf1	700	8	by	by	IN
cord-014462-11ggaqf1	700	9	using	use	VBG
cord-014462-11ggaqf1	700	10	ELISA	ELISA	NNP
cord-014462-11ggaqf1	700	11	.	.	.
cord-014462-11ggaqf1	701	1	Genomic	genomic	JJ
cord-014462-11ggaqf1	701	2	DNA	dna	NN
cord-014462-11ggaqf1	701	3	was	be	VBD
cord-014462-11ggaqf1	701	4	extracted	extract	VBN
cord-014462-11ggaqf1	701	5	from	from	IN
cord-014462-11ggaqf1	701	6	whole	whole	JJ
cord-014462-11ggaqf1	701	7	blood	blood	NN
cord-014462-11ggaqf1	701	8	of	of	IN
cord-014462-11ggaqf1	701	9	HCV	HCV	NNP
cord-014462-11ggaqf1	701	10	infected	infect	VBN
cord-014462-11ggaqf1	701	11	patients	patient	NNS
cord-014462-11ggaqf1	701	12	and	and	CC
cord-014462-11ggaqf1	701	13	healthy	healthy	JJ
cord-014462-11ggaqf1	701	14	controls	control	NNS
cord-014462-11ggaqf1	701	15	by	by	IN
cord-014462-11ggaqf1	701	16	using	use	VBG
cord-014462-11ggaqf1	701	17	AccuPrep	AccuPrep	NNP
cord-014462-11ggaqf1	701	18	Genomic	Genomic	NNP
cord-014462-11ggaqf1	701	19	DNA	DNA	NNP
cord-014462-11ggaqf1	701	20	Extraction	Extraction	NNP
cord-014462-11ggaqf1	701	21	Kit	kit	NN
cord-014462-11ggaqf1	701	22	according	accord	VBG
cord-014462-11ggaqf1	701	23	to	to	TO
cord-014462-11ggaqf1	701	24	manufacture	manufacture	VB
cord-014462-11ggaqf1	701	25	's	's	POS
cord-014462-11ggaqf1	701	26	instruction	instruction	NN
cord-014462-11ggaqf1	701	27	.	.	.
cord-014462-11ggaqf1	702	1	The	the	DT
cord-014462-11ggaqf1	702	2	genotyping	genotyping	NN
cord-014462-11ggaqf1	702	3	of	of	IN
cord-014462-11ggaqf1	702	4	IL-6	IL-6	NNP
cord-014462-11ggaqf1	702	5	promoter	promoter	NN
cord-014462-11ggaqf1	702	6	(	(	-LRB-
cord-014462-11ggaqf1	702	7	-174	-174	NNP
cord-014462-11ggaqf1	702	8	variant	variant	NN
cord-014462-11ggaqf1	702	9	)	)	-RRB-
cord-014462-11ggaqf1	702	10	was	be	VBD
cord-014462-11ggaqf1	702	11	carried	carry	VBN
cord-014462-11ggaqf1	702	12	out	out	RP
cord-014462-11ggaqf1	702	13	by	by	IN
cord-014462-11ggaqf1	702	14	PCR	PCR	NNP
cord-014462-11ggaqf1	702	15	and	and	CC
cord-014462-11ggaqf1	702	16	direct	direct	JJ
cord-014462-11ggaqf1	702	17	sequencing	sequencing	NN
cord-014462-11ggaqf1	702	18	using	use	VBG
cord-014462-11ggaqf1	702	19	the	the	DT
cord-014462-11ggaqf1	702	20	method	method	NN
cord-014462-11ggaqf1	702	21	of	of	IN
cord-014462-11ggaqf1	702	22	Patricia	Patricia	NNP
cord-014462-11ggaqf1	702	23	Woo	Woo	NNP
cord-014462-11ggaqf1	702	24	et	et	NNP
cord-014462-11ggaqf1	702	25	al	al	NNP
cord-014462-11ggaqf1	702	26	.	.	.
cord-014462-11ggaqf1	703	1	1998	1998	CD
cord-014462-11ggaqf1	703	2	.	.	.
cord-014462-11ggaqf1	704	1	The	the	DT
cord-014462-11ggaqf1	704	2	serum	serum	NN
cord-014462-11ggaqf1	704	3	level	level	NN
cord-014462-11ggaqf1	704	4	of	of	IN
cord-014462-11ggaqf1	704	5	IL-6	IL-6	NNP
cord-014462-11ggaqf1	704	6	was	be	VBD
cord-014462-11ggaqf1	704	7	significantly	significantly	RB
cord-014462-11ggaqf1	704	8	down	down	RB
cord-014462-11ggaqf1	704	9	regulated	regulate	VBN
cord-014462-11ggaqf1	704	10	in	in	IN
cord-014462-11ggaqf1	704	11	HCV	HCV	NNP
cord-014462-11ggaqf1	704	12	infected	infected	JJ
cord-014462-11ggaqf1	704	13	chronic	chronic	JJ
cord-014462-11ggaqf1	704	14	patients	patient	NNS
cord-014462-11ggaqf1	704	15	as	as	IN
cord-014462-11ggaqf1	704	16	compared	compare	VBN
cord-014462-11ggaqf1	704	17	to	to	IN
cord-014462-11ggaqf1	704	18	the	the	DT
cord-014462-11ggaqf1	704	19	healthy	healthy	JJ
cord-014462-11ggaqf1	704	20	controls	control	NNS
cord-014462-11ggaqf1	704	21	.	.	.
cord-014462-11ggaqf1	705	1	Genotyping	Genotyping	NNP
cord-014462-11ggaqf1	705	2	of	of	IN
cord-014462-11ggaqf1	705	3	-174	-174	NN
cord-014462-11ggaqf1	705	4	promoter	promoter	NN
cord-014462-11ggaqf1	705	5	variant	variant	NN
cord-014462-11ggaqf1	705	6	of	of	IN
cord-014462-11ggaqf1	705	7	IL-6	IL-6	NNP
cord-014462-11ggaqf1	705	8	was	be	VBD
cord-014462-11ggaqf1	705	9	performed	perform	VBN
cord-014462-11ggaqf1	705	10	by	by	IN
cord-014462-11ggaqf1	705	11	PCR	PCR	NNP
cord-014462-11ggaqf1	705	12	and	and	CC
cord-014462-11ggaqf1	705	13	direct	direct	JJ
cord-014462-11ggaqf1	705	14	sequencing	sequencing	NN
cord-014462-11ggaqf1	705	15	.	.	.
cord-014462-11ggaqf1	706	1	IL-6	IL-6	NNP
cord-014462-11ggaqf1	706	2	Polymorphism	Polymorphism	NNP
cord-014462-11ggaqf1	706	3	in	in	IN
cord-014462-11ggaqf1	706	4	the	the	DT
cord-014462-11ggaqf1	706	5	G	g	NN
cord-014462-11ggaqf1	706	6	/	/	SYM
cord-014462-11ggaqf1	706	7	G	g	NN
cord-014462-11ggaqf1	706	8	,	,	,
cord-014462-11ggaqf1	706	9	G	G	NNP
cord-014462-11ggaqf1	706	10	/	/	SYM
cord-014462-11ggaqf1	706	11	C	C	NNP
cord-014462-11ggaqf1	706	12	and	and	CC
cord-014462-11ggaqf1	706	13	C	C	NNP
cord-014462-11ggaqf1	706	14	/	/	SYM
cord-014462-11ggaqf1	706	15	C	C	NNP
cord-014462-11ggaqf1	706	16	allele	allele	NN
cord-014462-11ggaqf1	706	17	was	be	VBD
cord-014462-11ggaqf1	706	18	non	non	JJ
cord-014462-11ggaqf1	706	19	significant	significant	JJ
cord-014462-11ggaqf1	706	20	when	when	WRB
cord-014462-11ggaqf1	706	21	compared	compare	VBN
cord-014462-11ggaqf1	706	22	to	to	IN
cord-014462-11ggaqf1	706	23	HCV	HCV	NNP
cord-014462-11ggaqf1	706	24	patients	patient	NNS
cord-014462-11ggaqf1	706	25	and	and	CC
cord-014462-11ggaqf1	706	26	healthy	healthy	JJ
cord-014462-11ggaqf1	706	27	controls	control	NNS
cord-014462-11ggaqf1	706	28	.	.	.
cord-014462-11ggaqf1	707	1	The	the	DT
cord-014462-11ggaqf1	707	2	IL-6	IL-6	NNP
cord-014462-11ggaqf1	707	3	serum	serum	NN
cord-014462-11ggaqf1	707	4	levels	level	NNS
cord-014462-11ggaqf1	707	5	were	be	VBD
cord-014462-11ggaqf1	707	6	significant	significant	JJ
cord-014462-11ggaqf1	707	7	among	among	IN
cord-014462-11ggaqf1	707	8	HCV	HCV	NNP
cord-014462-11ggaqf1	707	9	infected	infect	VBN
cord-014462-11ggaqf1	707	10	patients	patient	NNS
cord-014462-11ggaqf1	707	11	when	when	WRB
cord-014462-11ggaqf1	707	12	compared	compare	VBN
cord-014462-11ggaqf1	707	13	to	to	IN
cord-014462-11ggaqf1	707	14	healthy	healthy	JJ
cord-014462-11ggaqf1	707	15	controls	control	NNS
cord-014462-11ggaqf1	707	16	.	.	.
cord-014462-11ggaqf1	708	1	The	the	DT
cord-014462-11ggaqf1	708	2	polymorphism	polymorphism	NN
cord-014462-11ggaqf1	708	3	in	in	IN
cord-014462-11ggaqf1	708	4	the	the	DT
cord-014462-11ggaqf1	708	5	promoter	promoter	NN
cord-014462-11ggaqf1	708	6	region	region	NN
cord-014462-11ggaqf1	708	7	of	of	IN
cord-014462-11ggaqf1	708	8	IL-6	IL-6	NNP
cord-014462-11ggaqf1	708	9	(	(	-LRB-
cord-014462-11ggaqf1	708	10	-174	-174	NNP
cord-014462-11ggaqf1	708	11	)	)	-RRB-
cord-014462-11ggaqf1	708	12	was	be	VBD
cord-014462-11ggaqf1	708	13	found	find	VBN
cord-014462-11ggaqf1	708	14	nonsignificantly	nonsignificantly	RB
cord-014462-11ggaqf1	708	15	associated	associate	VBN
cord-014462-11ggaqf1	708	16	in	in	IN
cord-014462-11ggaqf1	708	17	HCV	HCV	NNP
cord-014462-11ggaqf1	708	18	patients	patient	NNS
cord-014462-11ggaqf1	708	19	compared	compare	VBN
cord-014462-11ggaqf1	708	20	to	to	IN
cord-014462-11ggaqf1	708	21	healthy	healthy	JJ
cord-014462-11ggaqf1	708	22	controls	control	NNS
cord-014462-11ggaqf1	708	23	.	.	.
cord-014462-11ggaqf1	709	1	In	in	IN
cord-014462-11ggaqf1	709	2	conclusion	conclusion	NN
cord-014462-11ggaqf1	709	3	,	,	,
cord-014462-11ggaqf1	709	4	the	the	DT
cord-014462-11ggaqf1	709	5	present	present	JJ
cord-014462-11ggaqf1	709	6	study	study	NN
cord-014462-11ggaqf1	709	7	suggests	suggest	VBZ
cord-014462-11ggaqf1	709	8	that	that	IN
cord-014462-11ggaqf1	709	9	the	the	DT
cord-014462-11ggaqf1	709	10	host	host	NN
cord-014462-11ggaqf1	709	11	IL-6	IL-6	NNP
cord-014462-11ggaqf1	709	12	polymorphism	polymorphism	NN
cord-014462-11ggaqf1	709	13	alone	alone	RB
cord-014462-11ggaqf1	709	14	may	may	MD
cord-014462-11ggaqf1	709	15	not	not	RB
cord-014462-11ggaqf1	709	16	play	play	VB
cord-014462-11ggaqf1	709	17	a	a	DT
cord-014462-11ggaqf1	709	18	significant	significant	JJ
cord-014462-11ggaqf1	709	19	role	role	NN
cord-014462-11ggaqf1	709	20	in	in	IN
cord-014462-11ggaqf1	709	21	the	the	DT
cord-014462-11ggaqf1	709	22	outcome	outcome	NN
cord-014462-11ggaqf1	709	23	of	of	IN
cord-014462-11ggaqf1	709	24	HCV	HCV	NNP
cord-014462-11ggaqf1	709	25	infection	infection	NN
cord-014462-11ggaqf1	709	26	.	.	.
cord-014462-11ggaqf1	710	1	Acute	acute	JJ
cord-014462-11ggaqf1	710	2	gastroenteritis	gastroenteritis	NN
cord-014462-11ggaqf1	710	3	(	(	-LRB-
cord-014462-11ggaqf1	710	4	AGE	AGE	NNP
cord-014462-11ggaqf1	710	5	)	)	-RRB-
cord-014462-11ggaqf1	710	6	is	be	VBZ
cord-014462-11ggaqf1	710	7	a	a	DT
cord-014462-11ggaqf1	710	8	global	global	JJ
cord-014462-11ggaqf1	710	9	health	health	NN
cord-014462-11ggaqf1	710	10	problem	problem	NN
cord-014462-11ggaqf1	710	11	and	and	CC
cord-014462-11ggaqf1	710	12	has	have	VBZ
cord-014462-11ggaqf1	710	13	been	be	VBN
cord-014462-11ggaqf1	710	14	associated	associate	VBN
cord-014462-11ggaqf1	710	15	with	with	IN
cord-014462-11ggaqf1	710	16	multiple	multiple	JJ
cord-014462-11ggaqf1	710	17	etiological	etiological	JJ
cord-014462-11ggaqf1	710	18	agents	agent	NNS
cord-014462-11ggaqf1	710	19	,	,	,
cord-014462-11ggaqf1	710	20	which	which	WDT
cord-014462-11ggaqf1	710	21	include	include	VBP
cord-014462-11ggaqf1	710	22	bacteria	bacteria	NNS
cord-014462-11ggaqf1	710	23	,	,	,
cord-014462-11ggaqf1	710	24	protozoa	protozoan	NNS
cord-014462-11ggaqf1	710	25	and	and	CC
cord-014462-11ggaqf1	710	26	viruses	virus	NNS
cord-014462-11ggaqf1	710	27	.	.	.
cord-014462-11ggaqf1	711	1	Viral	viral	JJ
cord-014462-11ggaqf1	711	2	gastroenteritis	gastroenteritis	NN
cord-014462-11ggaqf1	711	3	is	be	VBZ
cord-014462-11ggaqf1	711	4	considered	consider	VBN
cord-014462-11ggaqf1	711	5	as	as	IN
cord-014462-11ggaqf1	711	6	the	the	DT
cord-014462-11ggaqf1	711	7	second	second	JJ
cord-014462-11ggaqf1	711	8	most	most	RBS
cord-014462-11ggaqf1	711	9	common	common	JJ
cord-014462-11ggaqf1	711	10	illness	illness	NN
cord-014462-11ggaqf1	711	11	in	in	IN
cord-014462-11ggaqf1	711	12	children	child	NNS
cord-014462-11ggaqf1	711	13	after	after	IN
cord-014462-11ggaqf1	711	14	upper	upper	JJ
cord-014462-11ggaqf1	711	15	respiratory	respiratory	JJ
cord-014462-11ggaqf1	711	16	tract	tract	NN
cord-014462-11ggaqf1	711	17	infection	infection	NN
cord-014462-11ggaqf1	711	18	.	.	.
cord-014462-11ggaqf1	712	1	Among	among	IN
cord-014462-11ggaqf1	712	2	enteric	enteric	JJ
cord-014462-11ggaqf1	712	3	viruses	virus	NNS
cord-014462-11ggaqf1	712	4	,	,	,
cord-014462-11ggaqf1	712	5	rota	rota	NN
cord-014462-11ggaqf1	712	6	,	,	,
cord-014462-11ggaqf1	712	7	noro	noro	NNP
cord-014462-11ggaqf1	712	8	,	,	,
cord-014462-11ggaqf1	712	9	enteric	enteric	JJ
cord-014462-11ggaqf1	712	10	adeno	adeno	NNP
cord-014462-11ggaqf1	712	11	,	,	,
cord-014462-11ggaqf1	712	12	astro	astro	NNP
cord-014462-11ggaqf1	712	13	and	and	CC
cord-014462-11ggaqf1	712	14	enterovirus	enteroviru	NNS
cord-014462-11ggaqf1	712	15	are	be	VBP
cord-014462-11ggaqf1	712	16	found	find	VBN
cord-014462-11ggaqf1	712	17	to	to	TO
cord-014462-11ggaqf1	712	18	be	be	VB
cord-014462-11ggaqf1	712	19	associated	associate	VBN
cord-014462-11ggaqf1	712	20	with	with	IN
cord-014462-11ggaqf1	712	21	gastroenteritis	gastroenteritis	NN
cord-014462-11ggaqf1	712	22	.	.	.
cord-014462-11ggaqf1	713	1	Although	although	IN
cord-014462-11ggaqf1	713	2	,	,	,
cord-014462-11ggaqf1	713	3	association	association	NN
cord-014462-11ggaqf1	713	4	of	of	IN
cord-014462-11ggaqf1	713	5	enteric	enteric	JJ
cord-014462-11ggaqf1	713	6	viruses	virus	NNS
cord-014462-11ggaqf1	713	7	has	have	VBZ
cord-014462-11ggaqf1	713	8	been	be	VBN
cord-014462-11ggaqf1	713	9	established	establish	VBN
cord-014462-11ggaqf1	713	10	in	in	IN
cord-014462-11ggaqf1	713	11	children	child	NNS
cord-014462-11ggaqf1	713	12	hospitalized	hospitalize	VBN
cord-014462-11ggaqf1	713	13	for	for	IN
cord-014462-11ggaqf1	713	14	AGE	AGE	NNP
cord-014462-11ggaqf1	713	15	no	no	DT
cord-014462-11ggaqf1	713	16	such	such	JJ
cord-014462-11ggaqf1	713	17	data	data	NN
cord-014462-11ggaqf1	713	18	is	be	VBZ
cord-014462-11ggaqf1	713	19	available	available	JJ
cord-014462-11ggaqf1	713	20	from	from	IN
cord-014462-11ggaqf1	713	21	hospitalized	hospitalize	VBN
cord-014462-11ggaqf1	713	22	children	child	NNS
cord-014462-11ggaqf1	713	23	other	other	JJ
cord-014462-11ggaqf1	713	24	than	than	IN
cord-014462-11ggaqf1	713	25	enteric	enteric	JJ
cord-014462-11ggaqf1	713	26	infections	infection	NNS
cord-014462-11ggaqf1	713	27	.	.	.
cord-014462-11ggaqf1	714	1	To	to	TO
cord-014462-11ggaqf1	714	2	determine	determine	VB
cord-014462-11ggaqf1	714	3	the	the	DT
cord-014462-11ggaqf1	714	4	prevalence	prevalence	NN
cord-014462-11ggaqf1	714	5	of	of	IN
cord-014462-11ggaqf1	714	6	enteric	enteric	JJ
cord-014462-11ggaqf1	714	7	viruses	virus	NNS
cord-014462-11ggaqf1	714	8	circulating	circulate	VBG
cord-014462-11ggaqf1	714	9	in	in	IN
cord-014462-11ggaqf1	714	10	hospitalized	hospitalize	VBN
cord-014462-11ggaqf1	714	11	children	child	NNS
cord-014462-11ggaqf1	714	12	.	.	.
cord-014462-11ggaqf1	715	1	Fecal	fecal	JJ
cord-014462-11ggaqf1	715	2	samples	sample	NNS
cord-014462-11ggaqf1	715	3	,	,	,
cord-014462-11ggaqf1	715	4	n	n	NN
cord-014462-11ggaqf1	715	5	=	=	SYM
cord-014462-11ggaqf1	715	6	292	292	CD
cord-014462-11ggaqf1	715	7	(	(	-LRB-
cord-014462-11ggaqf1	715	8	177	177	CD
cord-014462-11ggaqf1	715	9	symptomatic	symptomatic	JJ
cord-014462-11ggaqf1	715	10	and	and	CC
cord-014462-11ggaqf1	715	11	115	115	CD
cord-014462-11ggaqf1	715	12	asymptomatic	asymptomatic	JJ
cord-014462-11ggaqf1	715	13	for	for	IN
cord-014462-11ggaqf1	715	14	AGE	age	NN
cord-014462-11ggaqf1	715	15	)	)	-RRB-
cord-014462-11ggaqf1	715	16	were	be	VBD
cord-014462-11ggaqf1	715	17	collected	collect	VBN
cord-014462-11ggaqf1	715	18	from	from	IN
cord-014462-11ggaqf1	715	19	children	child	NNS
cord-014462-11ggaqf1	715	20	\5	\5	CD
cord-014462-11ggaqf1	715	21	year	year	NN
cord-014462-11ggaqf1	715	22	of	of	IN
cord-014462-11ggaqf1	715	23	age	age	NN
cord-014462-11ggaqf1	715	24	from	from	IN
cord-014462-11ggaqf1	715	25	three	three	CD
cord-014462-11ggaqf1	715	26	different	different	JJ
cord-014462-11ggaqf1	715	27	hospitals	hospital	NNS
cord-014462-11ggaqf1	715	28	across	across	IN
cord-014462-11ggaqf1	715	29	the	the	DT
cord-014462-11ggaqf1	715	30	city	city	NN
cord-014462-11ggaqf1	715	31	of	of	IN
cord-014462-11ggaqf1	715	32	Pune	Pune	NNP
cord-014462-11ggaqf1	715	33	from	from	IN
cord-014462-11ggaqf1	715	34	June	June	NNP
cord-014462-11ggaqf1	715	35	2008	2008	CD
cord-014462-11ggaqf1	715	36	to	to	IN
cord-014462-11ggaqf1	715	37	Feb.	February	NNP
cord-014462-11ggaqf1	715	38	2009	2009	CD
cord-014462-11ggaqf1	715	39	.	.	.
cord-014462-11ggaqf1	716	1	Detection	detection	NN
cord-014462-11ggaqf1	716	2	of	of	IN
cord-014462-11ggaqf1	716	3	group	group	NN
cord-014462-11ggaqf1	716	4	A	a	DT
cord-014462-11ggaqf1	716	5	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	716	6	was	be	VBD
cord-014462-11ggaqf1	716	7	carried	carry	VBN
cord-014462-11ggaqf1	716	8	out	out	RP
cord-014462-11ggaqf1	716	9	by	by	IN
cord-014462-11ggaqf1	716	10	using	use	VBG
cord-014462-11ggaqf1	716	11	antigen	antigen	NN
cord-014462-11ggaqf1	716	12	captured	capture	VBN
cord-014462-11ggaqf1	716	13	ELISA	ELISA	NNP
cord-014462-11ggaqf1	716	14	.	.	.
cord-014462-11ggaqf1	717	1	RT	RT	NNP
cord-014462-11ggaqf1	717	2	-	-	HYPH
cord-014462-11ggaqf1	717	3	PCR	PCR	NNP
cord-014462-11ggaqf1	717	4	and	and	CC
cord-014462-11ggaqf1	717	5	PCR	PCR	NNP
cord-014462-11ggaqf1	717	6	was	be	VBD
cord-014462-11ggaqf1	717	7	carried	carry	VBN
cord-014462-11ggaqf1	717	8	out	out	RP
cord-014462-11ggaqf1	717	9	for	for	IN
cord-014462-11ggaqf1	717	10	the	the	DT
cord-014462-11ggaqf1	717	11	detection	detection	NN
cord-014462-11ggaqf1	717	12	of	of	IN
cord-014462-11ggaqf1	717	13	norovirus	norovirus	NN
cord-014462-11ggaqf1	717	14	,	,	,
cord-014462-11ggaqf1	717	15	enterovirus	enterovirus	NN
cord-014462-11ggaqf1	717	16	,	,	,
cord-014462-11ggaqf1	717	17	astrovirus	astrovirus	NNP
cord-014462-11ggaqf1	717	18	and	and	CC
cord-014462-11ggaqf1	717	19	enteric	enteric	JJ
cord-014462-11ggaqf1	717	20	adenovirus	adenovirus	NN
cord-014462-11ggaqf1	717	21	detection	detection	NN
cord-014462-11ggaqf1	717	22	by	by	IN
cord-014462-11ggaqf1	717	23	using	use	VBG
cord-014462-11ggaqf1	717	24	primers	primer	NNS
cord-014462-11ggaqf1	717	25	targeted	target	VBN
cord-014462-11ggaqf1	717	26	to	to	IN
cord-014462-11ggaqf1	717	27	RdRp	RdRp	NNP
cord-014462-11ggaqf1	717	28	gene	gene	NN
cord-014462-11ggaqf1	717	29	,	,	,
cord-014462-11ggaqf1	717	30	5	5	CD
cord-014462-11ggaqf1	717	31	0	0	CD
cord-014462-11ggaqf1	717	32	NCR	NCR	NNP
cord-014462-11ggaqf1	717	33	gene	gene	NN
cord-014462-11ggaqf1	717	34	and	and	CC
cord-014462-11ggaqf1	717	35	consevered	consevered	JJ
cord-014462-11ggaqf1	717	36	gene	gene	NN
cord-014462-11ggaqf1	717	37	for	for	IN
cord-014462-11ggaqf1	717	38	serine	serine	JJ
cord-014462-11ggaqf1	717	39	protease	protease	NN
cord-014462-11ggaqf1	717	40	and	and	CC
cord-014462-11ggaqf1	717	41	hexon	hexon	NN
cord-014462-11ggaqf1	717	42	gene	gene	NN
cord-014462-11ggaqf1	717	43	respectively	respectively	RB
cord-014462-11ggaqf1	717	44	.	.	.
cord-014462-11ggaqf1	718	1	Out	out	IN
cord-014462-11ggaqf1	718	2	of	of	IN
cord-014462-11ggaqf1	718	3	177	177	CD
cord-014462-11ggaqf1	718	4	fecal	fecal	JJ
cord-014462-11ggaqf1	718	5	samples	sample	NNS
cord-014462-11ggaqf1	718	6	tested	test	VBN
cord-014462-11ggaqf1	718	7	for	for	IN
cord-014462-11ggaqf1	718	8	enteric	enteric	JJ
cord-014462-11ggaqf1	718	9	viruses	virus	NNS
cord-014462-11ggaqf1	718	10	in	in	IN
cord-014462-11ggaqf1	718	11	AGE	age	NN
cord-014462-11ggaqf1	718	12	cases	case	NNS
cord-014462-11ggaqf1	718	13	,	,	,
cord-014462-11ggaqf1	718	14	the	the	DT
cord-014462-11ggaqf1	718	15	prevalence	prevalence	NN
cord-014462-11ggaqf1	718	16	of	of	IN
cord-014462-11ggaqf1	718	17	rota	rota	NN
cord-014462-11ggaqf1	718	18	,	,	,
cord-014462-11ggaqf1	718	19	entero	entero	NNP
cord-014462-11ggaqf1	718	20	,	,	,
cord-014462-11ggaqf1	718	21	noro	noro	NNP
cord-014462-11ggaqf1	718	22	,	,	,
cord-014462-11ggaqf1	718	23	enteric	enteric	JJ
cord-014462-11ggaqf1	718	24	adeno	adeno	NNP
cord-014462-11ggaqf1	718	25	and	and	CC
cord-014462-11ggaqf1	718	26	astrovirus	astrovirus	NNP
cord-014462-11ggaqf1	718	27	were	be	VBD
cord-014462-11ggaqf1	718	28	33.3	33.3	CD
cord-014462-11ggaqf1	718	29	%	%	NN
cord-014462-11ggaqf1	718	30	(	(	-LRB-
cord-014462-11ggaqf1	718	31	59	59	CD
cord-014462-11ggaqf1	718	32	)	)	-RRB-
cord-014462-11ggaqf1	718	33	,	,	,
cord-014462-11ggaqf1	718	34	14.7	14.7	CD
cord-014462-11ggaqf1	718	35	%	%	NN
cord-014462-11ggaqf1	718	36	(	(	-LRB-
cord-014462-11ggaqf1	718	37	26	26	CD
cord-014462-11ggaqf1	718	38	)	)	-RRB-
cord-014462-11ggaqf1	718	39	,	,	,
cord-014462-11ggaqf1	718	40	6.2	6.2	CD
cord-014462-11ggaqf1	718	41	%	%	NN
cord-014462-11ggaqf1	718	42	(	(	-LRB-
cord-014462-11ggaqf1	718	43	11	11	CD
cord-014462-11ggaqf1	718	44	)	)	-RRB-
cord-014462-11ggaqf1	718	45	,	,	,
cord-014462-11ggaqf1	718	46	2.8	2.8	CD
cord-014462-11ggaqf1	718	47	%	%	NN
cord-014462-11ggaqf1	718	48	(	(	-LRB-
cord-014462-11ggaqf1	718	49	5	5	CD
cord-014462-11ggaqf1	718	50	)	)	-RRB-
cord-014462-11ggaqf1	718	51	and	and	CC
cord-014462-11ggaqf1	718	52	1.1	1.1	CD
cord-014462-11ggaqf1	718	53	%	%	NN
cord-014462-11ggaqf1	718	54	(	(	-LRB-
cord-014462-11ggaqf1	718	55	2	2	LS
cord-014462-11ggaqf1	718	56	)	)	-RRB-
cord-014462-11ggaqf1	718	57	respectively	respectively	RB
cord-014462-11ggaqf1	718	58	.	.	.
cord-014462-11ggaqf1	719	1	However	however	RB
cord-014462-11ggaqf1	719	2	,	,	,
cord-014462-11ggaqf1	719	3	the	the	DT
cord-014462-11ggaqf1	719	4	presence	presence	NN
cord-014462-11ggaqf1	719	5	of	of	IN
cord-014462-11ggaqf1	719	6	these	these	DT
cord-014462-11ggaqf1	719	7	viruses	virus	NNS
cord-014462-11ggaqf1	719	8	in	in	IN
cord-014462-11ggaqf1	719	9	the	the	DT
cord-014462-11ggaqf1	719	10	asymptomatic	asymptomatic	JJ
cord-014462-11ggaqf1	719	11	cases	case	NNS
cord-014462-11ggaqf1	719	12	(	(	-LRB-
cord-014462-11ggaqf1	719	13	n	n	NN
cord-014462-11ggaqf1	719	14	=	=	SYM
cord-014462-11ggaqf1	719	15	115	115	CD
cord-014462-11ggaqf1	719	16	)	)	-RRB-
cord-014462-11ggaqf1	719	17	was	be	VBD
cord-014462-11ggaqf1	719	18	detected	detect	VBN
cord-014462-11ggaqf1	719	19	at	at	IN
cord-014462-11ggaqf1	719	20	7.8	7.8	CD
cord-014462-11ggaqf1	719	21	%	%	NN
cord-014462-11ggaqf1	719	22	(	(	-LRB-
cord-014462-11ggaqf1	719	23	9	9	CD
cord-014462-11ggaqf1	719	24	)	)	-RRB-
cord-014462-11ggaqf1	719	25	,	,	,
cord-014462-11ggaqf1	719	26	5.2	5.2	CD
cord-014462-11ggaqf1	719	27	%	%	NN
cord-014462-11ggaqf1	719	28	(	(	-LRB-
cord-014462-11ggaqf1	719	29	6	6	CD
cord-014462-11ggaqf1	719	30	)	)	-RRB-
cord-014462-11ggaqf1	719	31	,	,	,
cord-014462-11ggaqf1	719	32	7.8	7.8	CD
cord-014462-11ggaqf1	719	33	%	%	NN
cord-014462-11ggaqf1	719	34	(	(	-LRB-
cord-014462-11ggaqf1	719	35	9	9	CD
cord-014462-11ggaqf1	719	36	)	)	-RRB-
cord-014462-11ggaqf1	719	37	,	,	,
cord-014462-11ggaqf1	719	38	0.86	0.86	CD
cord-014462-11ggaqf1	719	39	%	%	NN
cord-014462-11ggaqf1	719	40	(	(	-LRB-
cord-014462-11ggaqf1	719	41	1	1	CD
cord-014462-11ggaqf1	719	42	)	)	-RRB-
cord-014462-11ggaqf1	719	43	and	and	CC
cord-014462-11ggaqf1	719	44	1.7	1.7	CD
cord-014462-11ggaqf1	719	45	%	%	NN
cord-014462-11ggaqf1	719	46	(	(	-LRB-
cord-014462-11ggaqf1	719	47	2	2	CD
cord-014462-11ggaqf1	719	48	)	)	-RRB-
cord-014462-11ggaqf1	719	49	levels	level	NNS
cord-014462-11ggaqf1	719	50	respectively	respectively	RB
cord-014462-11ggaqf1	719	51	.	.	.
cord-014462-11ggaqf1	720	1	Mixed	mixed	JJ
cord-014462-11ggaqf1	720	2	infections	infection	NNS
cord-014462-11ggaqf1	720	3	of	of	IN
cord-014462-11ggaqf1	720	4	enterovirus	enterovirus	NN
cord-014462-11ggaqf1	720	5	and	and	CC
cord-014462-11ggaqf1	720	6	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	720	7	were	be	VBD
cord-014462-11ggaqf1	720	8	found	find	VBN
cord-014462-11ggaqf1	720	9	in	in	IN
cord-014462-11ggaqf1	720	10	both	both	CC
cord-014462-11ggaqf1	720	11	symptomatic	symptomatic	JJ
cord-014462-11ggaqf1	720	12	1.6	1.6	CD
cord-014462-11ggaqf1	720	13	%	%	NN
cord-014462-11ggaqf1	720	14	(	(	-LRB-
cord-014462-11ggaqf1	720	15	3	3	CD
cord-014462-11ggaqf1	720	16	)	)	-RRB-
cord-014462-11ggaqf1	720	17	and	and	CC
cord-014462-11ggaqf1	720	18	asymptomatic	asymptomatic	JJ
cord-014462-11ggaqf1	720	19	cases	case	NNS
cord-014462-11ggaqf1	720	20	0.8	0.8	CD
cord-014462-11ggaqf1	720	21	%	%	NN
cord-014462-11ggaqf1	720	22	(	(	-LRB-
cord-014462-11ggaqf1	720	23	1	1	CD
cord-014462-11ggaqf1	720	24	)	)	-RRB-
cord-014462-11ggaqf1	720	25	.	.	.
cord-014462-11ggaqf1	721	1	However	however	RB
cord-014462-11ggaqf1	721	2	,	,	,
cord-014462-11ggaqf1	721	3	mixed	mixed	JJ
cord-014462-11ggaqf1	721	4	infection	infection	NN
cord-014462-11ggaqf1	721	5	of	of	IN
cord-014462-11ggaqf1	721	6	enterovirus	enterovirus	NN
cord-014462-11ggaqf1	721	7	with	with	IN
cord-014462-11ggaqf1	721	8	adenovirus	adenovirus	NN
cord-014462-11ggaqf1	721	9	were	be	VBD
cord-014462-11ggaqf1	721	10	found	find	VBN
cord-014462-11ggaqf1	721	11	only	only	RB
cord-014462-11ggaqf1	721	12	in	in	IN
cord-014462-11ggaqf1	721	13	asymptomatic	asymptomatic	JJ
cord-014462-11ggaqf1	721	14	cases	case	NNS
cord-014462-11ggaqf1	721	15	0.8	0.8	CD
cord-014462-11ggaqf1	721	16	%	%	NN
cord-014462-11ggaqf1	721	17	(	(	-LRB-
cord-014462-11ggaqf1	721	18	1	1	CD
cord-014462-11ggaqf1	721	19	)	)	-RRB-
cord-014462-11ggaqf1	721	20	.	.	.
cord-014462-11ggaqf1	722	1	No	no	DT
cord-014462-11ggaqf1	722	2	marked	marked	JJ
cord-014462-11ggaqf1	722	3	difference	difference	NN
cord-014462-11ggaqf1	722	4	was	be	VBD
cord-014462-11ggaqf1	722	5	observed	observe	VBN
cord-014462-11ggaqf1	722	6	in	in	IN
cord-014462-11ggaqf1	722	7	the	the	DT
cord-014462-11ggaqf1	722	8	seasonal	seasonal	JJ
cord-014462-11ggaqf1	722	9	pattern	pattern	NN
cord-014462-11ggaqf1	722	10	of	of	IN
cord-014462-11ggaqf1	722	11	all	all	DT
cord-014462-11ggaqf1	722	12	viruses	virus	NNS
cord-014462-11ggaqf1	722	13	in	in	IN
cord-014462-11ggaqf1	722	14	the	the	DT
cord-014462-11ggaqf1	722	15	patients	patient	NNS
cord-014462-11ggaqf1	722	16	with	with	IN
cord-014462-11ggaqf1	722	17	or	or	CC
cord-014462-11ggaqf1	722	18	without	without	IN
cord-014462-11ggaqf1	722	19	gastroenteritis	gastroenteritis	NN
cord-014462-11ggaqf1	722	20	.	.	.
cord-014462-11ggaqf1	723	1	The	the	DT
cord-014462-11ggaqf1	723	2	findings	finding	NNS
cord-014462-11ggaqf1	723	3	of	of	IN
cord-014462-11ggaqf1	723	4	this	this	DT
cord-014462-11ggaqf1	723	5	study	study	NN
cord-014462-11ggaqf1	723	6	document	document	NN
cord-014462-11ggaqf1	723	7	highest	high	JJS
cord-014462-11ggaqf1	723	8	circulation	circulation	NN
cord-014462-11ggaqf1	723	9	of	of	IN
cord-014462-11ggaqf1	723	10	rotaviruses	rotaviruses	NNP
cord-014462-11ggaqf1	723	11	in	in	IN
cord-014462-11ggaqf1	723	12	patients	patient	NNS
cord-014462-11ggaqf1	723	13	symptomatic	symptomatic	JJ
cord-014462-11ggaqf1	723	14	and	and	CC
cord-014462-11ggaqf1	723	15	asymptomatic	asymptomatic	JJ
cord-014462-11ggaqf1	723	16	for	for	IN
cord-014462-11ggaqf1	723	17	AGE	AGE	NNP
cord-014462-11ggaqf1	723	18	.	.	.
cord-014462-11ggaqf1	724	1	The	the	DT
cord-014462-11ggaqf1	724	2	entero	entero	NNP
cord-014462-11ggaqf1	724	3	and	and	CC
cord-014462-11ggaqf1	724	4	noroviruses	noroviruse	NNS
cord-014462-11ggaqf1	724	5	remain	remain	VBP
cord-014462-11ggaqf1	724	6	second	second	RB
cord-014462-11ggaqf1	724	7	most	most	RBS
cord-014462-11ggaqf1	724	8	important	important	JJ
cord-014462-11ggaqf1	724	9	enteric	enteric	JJ
cord-014462-11ggaqf1	724	10	viruses	virus	NNS
cord-014462-11ggaqf1	724	11	in	in	IN
cord-014462-11ggaqf1	724	12	these	these	DT
cord-014462-11ggaqf1	724	13	patients	patient	NNS
cord-014462-11ggaqf1	724	14	.	.	.
cord-014462-11ggaqf1	725	1	Influenza	influenza	NN
cord-014462-11ggaqf1	725	2	in	in	IN
cord-014462-11ggaqf1	725	3	humans	human	NNS
cord-014462-11ggaqf1	725	4	is	be	VBZ
cord-014462-11ggaqf1	725	5	a	a	DT
cord-014462-11ggaqf1	725	6	major	major	JJ
cord-014462-11ggaqf1	725	7	public	public	JJ
cord-014462-11ggaqf1	725	8	health	health	NN
cord-014462-11ggaqf1	725	9	concern	concern	NN
cord-014462-11ggaqf1	725	10	and	and	CC
cord-014462-11ggaqf1	725	11	the	the	DT
cord-014462-11ggaqf1	725	12	understanding	understanding	NN
cord-014462-11ggaqf1	725	13	of	of	IN
cord-014462-11ggaqf1	725	14	its	-PRON-	PRP$
cord-014462-11ggaqf1	725	15	evolution	evolution	NN
cord-014462-11ggaqf1	725	16	in	in	IN
cord-014462-11ggaqf1	725	17	the	the	DT
cord-014462-11ggaqf1	725	18	light	light	NN
cord-014462-11ggaqf1	725	19	of	of	IN
cord-014462-11ggaqf1	725	20	its	-PRON-	PRP$
cord-014462-11ggaqf1	725	21	'	'	``
cord-014462-11ggaqf1	725	22	'	'	``
cord-014462-11ggaqf1	725	23	antigenic	antigenic	JJ
cord-014462-11ggaqf1	725	24	drift	drift	NN
cord-014462-11ggaqf1	725	25	'	'	''
cord-014462-11ggaqf1	725	26	'	'	''
cord-014462-11ggaqf1	725	27	helps	help	VBZ
cord-014462-11ggaqf1	725	28	prediction	prediction	NN
cord-014462-11ggaqf1	725	29	of	of	IN
cord-014462-11ggaqf1	725	30	epidemics	epidemic	NNS
cord-014462-11ggaqf1	725	31	and	and	CC
cord-014462-11ggaqf1	725	32	update	update	NN
cord-014462-11ggaqf1	725	33	of	of	IN
cord-014462-11ggaqf1	725	34	yearly	yearly	JJ
cord-014462-11ggaqf1	725	35	influenza	influenza	NN
cord-014462-11ggaqf1	725	36	vaccine	vaccine	NN
cord-014462-11ggaqf1	725	37	.	.	.
cord-014462-11ggaqf1	726	1	To	to	TO
cord-014462-11ggaqf1	726	2	antigenically	antigenically	RB
cord-014462-11ggaqf1	726	3	characterize	characterize	VB
cord-014462-11ggaqf1	726	4	influenza	influenza	NN
cord-014462-11ggaqf1	726	5	A	a	NN
cord-014462-11ggaqf1	726	6	(	(	-LRB-
cord-014462-11ggaqf1	726	7	H3N2	H3N2	NNP
cord-014462-11ggaqf1	726	8	)	)	-RRB-
cord-014462-11ggaqf1	726	9	isolates	isolate	NNS
cord-014462-11ggaqf1	726	10	and	and	CC
cord-014462-11ggaqf1	726	11	study	study	VB
cord-014462-11ggaqf1	726	12	antigenic	antigenic	JJ
cord-014462-11ggaqf1	726	13	drift	drift	NN
cord-014462-11ggaqf1	726	14	during	during	IN
cord-014462-11ggaqf1	726	15	1990	1990	CD
cord-014462-11ggaqf1	726	16	to	to	IN
cord-014462-11ggaqf1	726	17	2009	2009	CD
cord-014462-11ggaqf1	726	18	in	in	IN
cord-014462-11ggaqf1	726	19	Pune	Pune	NNP
cord-014462-11ggaqf1	726	20	city	city	NN
cord-014462-11ggaqf1	726	21	.	.	.
cord-014462-11ggaqf1	727	1	Patients	patient	NNS
cord-014462-11ggaqf1	727	2	with	with	IN
cord-014462-11ggaqf1	727	3	Influenza	Influenza	NNP
cord-014462-11ggaqf1	727	4	like	like	IN
cord-014462-11ggaqf1	727	5	illness	illness	NN
cord-014462-11ggaqf1	727	6	were	be	VBD
cord-014462-11ggaqf1	727	7	identified	identify	VBN
cord-014462-11ggaqf1	727	8	using	use	VBG
cord-014462-11ggaqf1	727	9	a	a	DT
cord-014462-11ggaqf1	727	10	strict	strict	JJ
cord-014462-11ggaqf1	727	11	case	case	NN
cord-014462-11ggaqf1	727	12	definition	definition	NN
cord-014462-11ggaqf1	727	13	from	from	IN
cord-014462-11ggaqf1	727	14	dispensaries	dispensary	NNS
cord-014462-11ggaqf1	727	15	located	locate	VBN
cord-014462-11ggaqf1	727	16	in	in	IN
cord-014462-11ggaqf1	727	17	different	different	JJ
cord-014462-11ggaqf1	727	18	areas	area	NNS
cord-014462-11ggaqf1	727	19	in	in	IN
cord-014462-11ggaqf1	727	20	Pune	Pune	NNP
cord-014462-11ggaqf1	727	21	and	and	CC
cord-014462-11ggaqf1	727	22	clinical	clinical	JJ
cord-014462-11ggaqf1	727	23	samples	sample	NNS
cord-014462-11ggaqf1	727	24	(	(	-LRB-
cord-014462-11ggaqf1	727	25	NS	NS	NNP
cord-014462-11ggaqf1	727	26	/	/	SYM
cord-014462-11ggaqf1	727	27	TS	TS	NNP
cord-014462-11ggaqf1	727	28	)	)	-RRB-
cord-014462-11ggaqf1	727	29	were	be	VBD
cord-014462-11ggaqf1	727	30	collected	collect	VBN
cord-014462-11ggaqf1	727	31	after	after	IN
cord-014462-11ggaqf1	727	32	obtaining	obtain	VBG
cord-014462-11ggaqf1	727	33	informed	informed	JJ
cord-014462-11ggaqf1	727	34	consent	consent	NN
cord-014462-11ggaqf1	727	35	.	.	.
cord-014462-11ggaqf1	728	1	These	these	DT
cord-014462-11ggaqf1	728	2	clinical	clinical	JJ
cord-014462-11ggaqf1	728	3	samples	sample	NNS
cord-014462-11ggaqf1	728	4	were	be	VBD
cord-014462-11ggaqf1	728	5	processed	process	VBN
cord-014462-11ggaqf1	728	6	in	in	IN
cord-014462-11ggaqf1	728	7	vivo	vivo	NN
cord-014462-11ggaqf1	728	8	(	(	-LRB-
cord-014462-11ggaqf1	728	9	in	in	IN
cord-014462-11ggaqf1	728	10	fertile	fertile	JJ
cord-014462-11ggaqf1	728	11	eggs	egg	NNS
cord-014462-11ggaqf1	728	12	)	)	-RRB-
cord-014462-11ggaqf1	728	13	and	and	CC
cord-014462-11ggaqf1	728	14	in	in	IN
cord-014462-11ggaqf1	728	15	vitro	vitro	FW
cord-014462-11ggaqf1	728	16	(	(	-LRB-
cord-014462-11ggaqf1	728	17	Overall	overall	RB
cord-014462-11ggaqf1	728	18	,	,	,
cord-014462-11ggaqf1	728	19	an	an	DT
cord-014462-11ggaqf1	728	20	additional	additional	JJ
cord-014462-11ggaqf1	728	21	35	35	CD
cord-014462-11ggaqf1	728	22	(	(	-LRB-
cord-014462-11ggaqf1	728	23	39.7	39.7	CD
cord-014462-11ggaqf1	728	24	%	%	NN
cord-014462-11ggaqf1	728	25	)	)	-RRB-
cord-014462-11ggaqf1	728	26	positive	positive	JJ
cord-014462-11ggaqf1	728	27	cases	case	NNS
cord-014462-11ggaqf1	728	28	of	of	IN
cord-014462-11ggaqf1	728	29	Dengue	dengue	NN
cord-014462-11ggaqf1	728	30	could	could	MD
cord-014462-11ggaqf1	728	31	be	be	VB
cord-014462-11ggaqf1	728	32	detected	detect	VBN
cord-014462-11ggaqf1	728	33	when	when	WRB
cord-014462-11ggaqf1	728	34	NS1	ns1	NN
cord-014462-11ggaqf1	728	35	antigen	antigen	NN
cord-014462-11ggaqf1	728	36	assay	assay	NN
cord-014462-11ggaqf1	728	37	was	be	VBD
cord-014462-11ggaqf1	728	38	also	also	RB
cord-014462-11ggaqf1	728	39	used	use	VBN
cord-014462-11ggaqf1	728	40	in	in	IN
cord-014462-11ggaqf1	728	41	the	the	DT
cord-014462-11ggaqf1	728	42	study	study	NN
cord-014462-11ggaqf1	728	43	.	.	.
cord-014462-11ggaqf1	729	1	Highest	high	JJS
cord-014462-11ggaqf1	729	2	NS1	ns1	NN
cord-014462-11ggaqf1	729	3	antigen	antigen	NN
cord-014462-11ggaqf1	729	4	positivity	positivity	NN
cord-014462-11ggaqf1	729	5	was	be	VBD
cord-014462-11ggaqf1	729	6	encountered	encounter	VBN
cord-014462-11ggaqf1	729	7	among	among	IN
cord-014462-11ggaqf1	729	8	the	the	DT
cord-014462-11ggaqf1	729	9	samples	sample	NNS
cord-014462-11ggaqf1	729	10	collected	collect	VBN
cord-014462-11ggaqf1	729	11	on	on	IN
cord-014462-11ggaqf1	729	12	the	the	DT
cord-014462-11ggaqf1	729	13	3rd	3rd	JJ
cord-014462-11ggaqf1	729	14	day	day	NN
cord-014462-11ggaqf1	729	15	of	of	IN
cord-014462-11ggaqf1	729	16	fever	fever	NN
cord-014462-11ggaqf1	729	17	whereas	whereas	IN
cord-014462-11ggaqf1	729	18	MAC	MAC	NNP
cord-014462-11ggaqf1	729	19	ELISA	ELISA	NNP
cord-014462-11ggaqf1	729	20	for	for	IN
cord-014462-11ggaqf1	729	21	anti	anti	JJ
cord-014462-11ggaqf1	729	22	IgM	IgM	NNP
cord-014462-11ggaqf1	729	23	antibody	antibody	NNP
cord-014462-11ggaqf1	729	24	was	be	VBD
cord-014462-11ggaqf1	729	25	positive	positive	JJ
cord-014462-11ggaqf1	729	26	after	after	IN
cord-014462-11ggaqf1	729	27	4th	4th	JJ
cord-014462-11ggaqf1	729	28	day	day	NN
cord-014462-11ggaqf1	729	29	and	and	CC
cord-014462-11ggaqf1	729	30	gradually	gradually	RB
cord-014462-11ggaqf1	729	31	there	there	EX
cord-014462-11ggaqf1	729	32	was	be	VBD
cord-014462-11ggaqf1	729	33	an	an	DT
cord-014462-11ggaqf1	729	34	increase	increase	NN
cord-014462-11ggaqf1	729	35	in	in	IN
cord-014462-11ggaqf1	729	36	the	the	DT
cord-014462-11ggaqf1	729	37	positivity	positivity	NN
cord-014462-11ggaqf1	729	38	towards	towards	IN
cord-014462-11ggaqf1	729	39	the	the	DT
cord-014462-11ggaqf1	729	40	convalescent	convalescent	JJ
cord-014462-11ggaqf1	729	41	phase	phase	NN
cord-014462-11ggaqf1	729	42	of	of	IN
cord-014462-11ggaqf1	729	43	the	the	DT
cord-014462-11ggaqf1	729	44	disease	disease	NN
cord-014462-11ggaqf1	729	45	.	.	.
cord-014462-11ggaqf1	730	1	The	the	DT
cord-014462-11ggaqf1	730	2	results	result	NNS
cord-014462-11ggaqf1	730	3	of	of	IN
cord-014462-11ggaqf1	730	4	this	this	DT
cord-014462-11ggaqf1	730	5	study	study	NN
cord-014462-11ggaqf1	730	6	indicate	indicate	VBP
cord-014462-11ggaqf1	730	7	that	that	IN
cord-014462-11ggaqf1	730	8	NS1	ns1	NN
cord-014462-11ggaqf1	730	9	antigen	antigen	NN
cord-014462-11ggaqf1	730	10	based	base	VBN
cord-014462-11ggaqf1	730	11	ELISA	ELISA	NNP
cord-014462-11ggaqf1	730	12	test	test	NN
cord-014462-11ggaqf1	730	13	can	can	MD
cord-014462-11ggaqf1	730	14	be	be	VB
cord-014462-11ggaqf1	730	15	an	an	DT
cord-014462-11ggaqf1	730	16	useful	useful	JJ
cord-014462-11ggaqf1	730	17	tool	tool	NN
cord-014462-11ggaqf1	730	18	to	to	TO
cord-014462-11ggaqf1	730	19	detect	detect	VB
cord-014462-11ggaqf1	730	20	the	the	DT
cord-014462-11ggaqf1	730	21	dengue	dengue	NN
cord-014462-11ggaqf1	730	22	virus	virus	NN
cord-014462-11ggaqf1	730	23	infection	infection	NN
cord-014462-11ggaqf1	730	24	in	in	IN
cord-014462-11ggaqf1	730	25	patients	patient	NNS
cord-014462-11ggaqf1	730	26	during	during	IN
cord-014462-11ggaqf1	730	27	the	the	DT
cord-014462-11ggaqf1	730	28	early	early	JJ
cord-014462-11ggaqf1	730	29	acute	acute	JJ
cord-014462-11ggaqf1	730	30	phase	phase	NN
cord-014462-11ggaqf1	730	31	of	of	IN
cord-014462-11ggaqf1	730	32	disease	disease	NN
cord-014462-11ggaqf1	730	33	since	since	IN
cord-014462-11ggaqf1	730	34	appearance	appearance	NN
cord-014462-11ggaqf1	730	35	of	of	IN
cord-014462-11ggaqf1	730	36	IgM	IgM	NNP
cord-014462-11ggaqf1	730	37	antibodies	antibody	NNS
cord-014462-11ggaqf1	730	38	usually	usually	RB
cord-014462-11ggaqf1	730	39	occur	occur	VBP
cord-014462-11ggaqf1	730	40	after	after	IN
cord-014462-11ggaqf1	730	41	fifth	fifth	JJ
cord-014462-11ggaqf1	730	42	day	day	NN
cord-014462-11ggaqf1	730	43	of	of	IN
cord-014462-11ggaqf1	730	44	the	the	DT
cord-014462-11ggaqf1	730	45	infection	infection	NN
cord-014462-11ggaqf1	730	46	.	.	.
cord-014462-11ggaqf1	731	1	Concurrent	concurrent	JJ
cord-014462-11ggaqf1	731	2	use	use	NN
cord-014462-11ggaqf1	731	3	of	of	IN
cord-014462-11ggaqf1	731	4	both	both	CC
cord-014462-11ggaqf1	731	5	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	731	6	assays	assay	NNS
cord-014462-11ggaqf1	731	7	namely	namely	RB
cord-014462-11ggaqf1	731	8	NS1	NS1	VBZ
cord-014462-11ggaqf1	731	9	antigen	antigen	NN
cord-014462-11ggaqf1	731	10	as	as	RB
cord-014462-11ggaqf1	731	11	well	well	RB
cord-014462-11ggaqf1	731	12	as	as	IN
cord-014462-11ggaqf1	731	13	MAC	MAC	NNP
cord-014462-11ggaqf1	731	14	ELISA	ELISA	NNP
cord-014462-11ggaqf1	731	15	will	will	MD
cord-014462-11ggaqf1	731	16	improve	improve	VB
cord-014462-11ggaqf1	731	17	the	the	DT
cord-014462-11ggaqf1	731	18	overall	overall	JJ
cord-014462-11ggaqf1	731	19	detection	detection	NN
cord-014462-11ggaqf1	731	20	of	of	IN
cord-014462-11ggaqf1	731	21	dengue	dengue	NN
cord-014462-11ggaqf1	731	22	infection	infection	NN
cord-014462-11ggaqf1	731	23	.	.	.
cord-014462-11ggaqf1	732	1	Early	early	JJ
cord-014462-11ggaqf1	732	2	detection	detection	NN
cord-014462-11ggaqf1	732	3	of	of	IN
cord-014462-11ggaqf1	732	4	acute	acute	JJ
cord-014462-11ggaqf1	732	5	dengue	dengue	NN
cord-014462-11ggaqf1	732	6	virus	virus	NN
cord-014462-11ggaqf1	732	7	infection	infection	NN
cord-014462-11ggaqf1	732	8	is	be	VBZ
cord-014462-11ggaqf1	732	9	crucial	crucial	JJ
cord-014462-11ggaqf1	732	10	to	to	TO
cord-014462-11ggaqf1	732	11	provide	provide	VB
cord-014462-11ggaqf1	732	12	timely	timely	JJ
cord-014462-11ggaqf1	732	13	information	information	NN
cord-014462-11ggaqf1	732	14	for	for	IN
cord-014462-11ggaqf1	732	15	the	the	DT
cord-014462-11ggaqf1	732	16	management	management	NN
cord-014462-11ggaqf1	732	17	of	of	IN
cord-014462-11ggaqf1	732	18	patients	patient	NNS
cord-014462-11ggaqf1	732	19	.	.	.
cord-014462-11ggaqf1	733	1	Human	human	JJ
cord-014462-11ggaqf1	733	2	parvovirus	parvovirus	NN
cord-014462-11ggaqf1	733	3	B19	B19	NNP
cord-014462-11ggaqf1	733	4	,	,	,
cord-014462-11ggaqf1	733	5	a	a	DT
cord-014462-11ggaqf1	733	6	member	member	NN
cord-014462-11ggaqf1	733	7	of	of	IN
cord-014462-11ggaqf1	733	8	the	the	DT
cord-014462-11ggaqf1	733	9	Parvoviridae	Parvoviridae	NNP
cord-014462-11ggaqf1	733	10	family	family	NN
cord-014462-11ggaqf1	733	11	,	,	,
cord-014462-11ggaqf1	733	12	is	be	VBZ
cord-014462-11ggaqf1	733	13	a	a	DT
cord-014462-11ggaqf1	733	14	pathogen	pathogen	NN
cord-014462-11ggaqf1	733	15	associated	associate	VBN
cord-014462-11ggaqf1	733	16	with	with	IN
cord-014462-11ggaqf1	733	17	a	a	DT
cord-014462-11ggaqf1	733	18	wide	wide	JJ
cord-014462-11ggaqf1	733	19	variety	variety	NN
cord-014462-11ggaqf1	733	20	of	of	IN
cord-014462-11ggaqf1	733	21	diseases	disease	NNS
cord-014462-11ggaqf1	733	22	.	.	.
cord-014462-11ggaqf1	734	1	Most	most	RBS
cord-014462-11ggaqf1	734	2	commonly	commonly	RB
cord-014462-11ggaqf1	734	3	,	,	,
cord-014462-11ggaqf1	734	4	it	-PRON-	PRP
cord-014462-11ggaqf1	734	5	causes	cause	VBZ
cord-014462-11ggaqf1	734	6	childhood	childhood	NN
cord-014462-11ggaqf1	734	7	rash	rash	JJ
cord-014462-11ggaqf1	734	8	erythema	erythema	NN
cord-014462-11ggaqf1	734	9	infectiosum	infectiosum	NN
cord-014462-11ggaqf1	734	10	,	,	,
cord-014462-11ggaqf1	734	11	but	but	CC
cord-014462-11ggaqf1	734	12	in	in	IN
cord-014462-11ggaqf1	734	13	some	some	DT
cord-014462-11ggaqf1	734	14	cases	case	NNS
cord-014462-11ggaqf1	734	15	more	more	RBR
cord-014462-11ggaqf1	734	16	serious	serious	JJ
cord-014462-11ggaqf1	734	17	symptoms	symptom	NNS
cord-014462-11ggaqf1	734	18	such	such	JJ
cord-014462-11ggaqf1	734	19	as	as	IN
cord-014462-11ggaqf1	734	20	persistent	persistent	JJ
cord-014462-11ggaqf1	734	21	arthropathy	arthropathy	NNP
cord-014462-11ggaqf1	734	22	,	,	,
cord-014462-11ggaqf1	734	23	critical	critical	JJ
cord-014462-11ggaqf1	734	24	failures	failure	NNS
cord-014462-11ggaqf1	734	25	of	of	IN
cord-014462-11ggaqf1	734	26	red	red	JJ
cord-014462-11ggaqf1	734	27	cell	cell	NN
cord-014462-11ggaqf1	734	28	production	production	NN
cord-014462-11ggaqf1	734	29	causing	cause	VBG
cord-014462-11ggaqf1	734	30	transient	transient	JJ
cord-014462-11ggaqf1	734	31	aplastic	aplastic	NN
cord-014462-11ggaqf1	734	32	crisis	crisis	NN
cord-014462-11ggaqf1	734	33	,	,	,
cord-014462-11ggaqf1	734	34	this	this	DT
cord-014462-11ggaqf1	734	35	infection	infection	NN
cord-014462-11ggaqf1	734	36	in	in	IN
cord-014462-11ggaqf1	734	37	pregnancy	pregnancy	NN
cord-014462-11ggaqf1	734	38	causes	cause	VBZ
cord-014462-11ggaqf1	734	39	hydrops	hydrops	NNP
cord-014462-11ggaqf1	734	40	fetalis	fetalis	NNP
cord-014462-11ggaqf1	734	41	and	and	CC
cord-014462-11ggaqf1	734	42	myocarditis	myocarditis	NN
cord-014462-11ggaqf1	734	43	.	.	.
cord-014462-11ggaqf1	735	1	Traditional	traditional	JJ
cord-014462-11ggaqf1	735	2	immunosuppressive	immunosuppressive	JJ
cord-014462-11ggaqf1	735	3	therapy	therapy	NN
cord-014462-11ggaqf1	735	4	being	be	VBG
cord-014462-11ggaqf1	735	5	unsuccessful	unsuccessful	JJ
cord-014462-11ggaqf1	735	6	,	,	,
cord-014462-11ggaqf1	735	7	anti	anti	JJ
cord-014462-11ggaqf1	735	8	-	-	JJ
cord-014462-11ggaqf1	735	9	viral	viral	JJ
cord-014462-11ggaqf1	735	10	therapy	therapy	NN
cord-014462-11ggaqf1	735	11	might	may	MD
cord-014462-11ggaqf1	735	12	be	be	VB
cord-014462-11ggaqf1	735	13	worthy	worthy	JJ
cord-014462-11ggaqf1	735	14	of	of	IN
cord-014462-11ggaqf1	735	15	consideration	consideration	NN
cord-014462-11ggaqf1	735	16	.	.	.
cord-014462-11ggaqf1	736	1	Functional	functional	JJ
cord-014462-11ggaqf1	736	2	annotation	annotation	NN
cord-014462-11ggaqf1	736	3	would	would	MD
cord-014462-11ggaqf1	736	4	provide	provide	VB
cord-014462-11ggaqf1	736	5	role	role	NN
cord-014462-11ggaqf1	736	6	of	of	IN
cord-014462-11ggaqf1	736	7	viral	viral	JJ
cord-014462-11ggaqf1	736	8	proteome	proteome	NN
cord-014462-11ggaqf1	736	9	in	in	IN
cord-014462-11ggaqf1	736	10	its	-PRON-	PRP$
cord-014462-11ggaqf1	736	11	survival	survival	NN
cord-014462-11ggaqf1	736	12	and	and	CC
cord-014462-11ggaqf1	736	13	pathogenic	pathogenic	JJ
cord-014462-11ggaqf1	736	14	mechanisms	mechanism	NNS
cord-014462-11ggaqf1	736	15	.	.	.
cord-014462-11ggaqf1	737	1	SVMProt	SVMProt	NNP
cord-014462-11ggaqf1	737	2	functional	functional	JJ
cord-014462-11ggaqf1	737	3	family	family	NN
cord-014462-11ggaqf1	737	4	annotations	annotation	NNS
cord-014462-11ggaqf1	737	5	of	of	IN
cord-014462-11ggaqf1	737	6	VP2	VP2	NNP
cord-014462-11ggaqf1	737	7	protein	protein	NN
cord-014462-11ggaqf1	737	8	had	have	VBD
cord-014462-11ggaqf1	737	9	deciphered	decipher	VBN
cord-014462-11ggaqf1	737	10	its	-PRON-	PRP$
cord-014462-11ggaqf1	737	11	zincbinding	zincbinding	NN
cord-014462-11ggaqf1	737	12	,	,	,
cord-014462-11ggaqf1	737	13	coat	coat	NN
cord-014462-11ggaqf1	737	14	protein	protein	NN
cord-014462-11ggaqf1	737	15	,	,	,
cord-014462-11ggaqf1	737	16	outer	outer	JJ
cord-014462-11ggaqf1	737	17	membrane	membrane	NN
cord-014462-11ggaqf1	737	18	,	,	,
cord-014462-11ggaqf1	737	19	chlorophyll	chlorophyll	NN
cord-014462-11ggaqf1	737	20	biosynthesis	biosynthesis	NN
cord-014462-11ggaqf1	737	21	,	,	,
cord-014462-11ggaqf1	737	22	DNA	dna	NN
cord-014462-11ggaqf1	737	23	repair	repair	NN
cord-014462-11ggaqf1	737	24	and	and	CC
cord-014462-11ggaqf1	737	25	calcium	calcium	NN
cord-014462-11ggaqf1	737	26	-	-	HYPH
cord-014462-11ggaqf1	737	27	binding	bind	VBG
cord-014462-11ggaqf1	737	28	nature	nature	NN
cord-014462-11ggaqf1	737	29	.	.	.
cord-014462-11ggaqf1	738	1	VP2	VP2	NNP
cord-014462-11ggaqf1	738	2	protein	protein	NN
cord-014462-11ggaqf1	738	3	is	be	VBZ
cord-014462-11ggaqf1	738	4	having	have	VBG
cord-014462-11ggaqf1	738	5	a	a	DT
cord-014462-11ggaqf1	738	6	key	key	JJ
cord-014462-11ggaqf1	738	7	role	role	NN
cord-014462-11ggaqf1	738	8	in	in	IN
cord-014462-11ggaqf1	738	9	viral	viral	JJ
cord-014462-11ggaqf1	738	10	assembly	assembly	NN
cord-014462-11ggaqf1	738	11	of	of	IN
cord-014462-11ggaqf1	738	12	B19	B19	NNP
cord-014462-11ggaqf1	738	13	virus	virus	NN
cord-014462-11ggaqf1	738	14	and	and	CC
cord-014462-11ggaqf1	738	15	being	be	VBG
cord-014462-11ggaqf1	738	16	non	non	JJ
cord-014462-11ggaqf1	738	17	-	-	JJ
cord-014462-11ggaqf1	738	18	homologous	homologous	JJ
cord-014462-11ggaqf1	738	19	to	to	IN
cord-014462-11ggaqf1	738	20	human	human	JJ
cord-014462-11ggaqf1	738	21	proteome	proteome	NN
cord-014462-11ggaqf1	738	22	,	,	,
cord-014462-11ggaqf1	738	23	it	-PRON-	PRP
cord-014462-11ggaqf1	738	24	was	be	VBD
cord-014462-11ggaqf1	738	25	identified	identify	VBN
cord-014462-11ggaqf1	738	26	as	as	IN
cord-014462-11ggaqf1	738	27	an	an	DT
cord-014462-11ggaqf1	738	28	attractive	attractive	JJ
cord-014462-11ggaqf1	738	29	molecular	molecular	JJ
cord-014462-11ggaqf1	738	30	target	target	NN
cord-014462-11ggaqf1	738	31	for	for	IN
cord-014462-11ggaqf1	738	32	structure	structure	NN
cord-014462-11ggaqf1	738	33	based	base	VBN
cord-014462-11ggaqf1	738	34	drug	drug	NN
cord-014462-11ggaqf1	738	35	discovery	discovery	NN
cord-014462-11ggaqf1	738	36	.	.	.
cord-014462-11ggaqf1	739	1	The	the	DT
cord-014462-11ggaqf1	739	2	VP2	VP2	NNP
cord-014462-11ggaqf1	739	3	protein	protein	NN
cord-014462-11ggaqf1	739	4	crystal	crystal	NN
cord-014462-11ggaqf1	739	5	structure	structure	NN
cord-014462-11ggaqf1	739	6	was	be	VBD
cord-014462-11ggaqf1	739	7	energy	energy	NN
cord-014462-11ggaqf1	739	8	minimized	minimize	VBN
cord-014462-11ggaqf1	739	9	using	use	VBG
cord-014462-11ggaqf1	739	10	CHARMM	CHARMM	NNP
cord-014462-11ggaqf1	739	11	.	.	.
cord-014462-11ggaqf1	740	1	A	a	DT
cord-014462-11ggaqf1	740	2	structure	structure	NN
cord-014462-11ggaqf1	740	3	based	base	VBN
cord-014462-11ggaqf1	740	4	virtual	virtual	JJ
cord-014462-11ggaqf1	740	5	screening	screening	NN
cord-014462-11ggaqf1	740	6	method	method	NN
cord-014462-11ggaqf1	740	7	was	be	VBD
cord-014462-11ggaqf1	740	8	applied	apply	VBN
cord-014462-11ggaqf1	740	9	using	use	VBG
cord-014462-11ggaqf1	740	10	LigandFit	LigandFit	NNP
cord-014462-11ggaqf1	740	11	to	to	TO
cord-014462-11ggaqf1	740	12	identify	identify	VB
cord-014462-11ggaqf1	740	13	potential	potential	JJ
cord-014462-11ggaqf1	740	14	inhibitors	inhibitor	NNS
cord-014462-11ggaqf1	740	15	of	of	IN
cord-014462-11ggaqf1	740	16	VP2	vp2	JJ
cord-014462-11ggaqf1	740	17	protein	protein	NN
cord-014462-11ggaqf1	740	18	from	from	IN
cord-014462-11ggaqf1	740	19	ChemBank	ChemBank	NNP
cord-014462-11ggaqf1	740	20	database	database	NN
cord-014462-11ggaqf1	740	21	and	and	CC
cord-014462-11ggaqf1	740	22	ten	ten	CD
cord-014462-11ggaqf1	740	23	potential	potential	JJ
cord-014462-11ggaqf1	740	24	Human	human	JJ
cord-014462-11ggaqf1	740	25	parvovirus	parvovirus	NN
cord-014462-11ggaqf1	740	26	B19	B19	NNP
cord-014462-11ggaqf1	740	27	VP2	vp2	NN
cord-014462-11ggaqf1	740	28	inhibitors	inhibitor	NNS
cord-014462-11ggaqf1	740	29	were	be	VBD
cord-014462-11ggaqf1	740	30	proposed	propose	VBN
cord-014462-11ggaqf1	740	31	.	.	.
cord-014462-11ggaqf1	741	1	PRISM	prism	NN
cord-014462-11ggaqf1	741	2	310	310	CD
cord-014462-11ggaqf1	741	3	genetic	genetic	JJ
cord-014462-11ggaqf1	741	4	analyzer	analyzer	NN
cord-014462-11ggaqf1	741	5	.	.	.
cord-014462-11ggaqf1	742	1	The	the	DT
cord-014462-11ggaqf1	742	2	drafting	drafting	NN
cord-014462-11ggaqf1	742	3	of	of	IN
cord-014462-11ggaqf1	742	4	the	the	DT
cord-014462-11ggaqf1	742	5	sequences	sequence	NNS
cord-014462-11ggaqf1	742	6	was	be	VBD
cord-014462-11ggaqf1	742	7	performed	perform	VBN
cord-014462-11ggaqf1	742	8	using	use	VBG
cord-014462-11ggaqf1	742	9	BioEdit	BioEdit	NNP
cord-014462-11ggaqf1	742	10	software	software	NN
cord-014462-11ggaqf1	742	11	and	and	CC
cord-014462-11ggaqf1	742	12	were	be	VBD
cord-014462-11ggaqf1	742	13	submitted	submit	VBN
cord-014462-11ggaqf1	742	14	in	in	IN
cord-014462-11ggaqf1	742	15	GenBank	GenBank	NNP
cord-014462-11ggaqf1	742	16	.	.	.
cord-014462-11ggaqf1	743	1	For	for	IN
cord-014462-11ggaqf1	743	2	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	743	3	interpretation	interpretation	NN
cord-014462-11ggaqf1	743	4	DENV	DENV	NNP
cord-014462-11ggaqf1	743	5	representing	represent	VBG
cord-014462-11ggaqf1	743	6	the	the	DT
cord-014462-11ggaqf1	743	7	full	full	JJ
cord-014462-11ggaqf1	743	8	extent	extent	NN
cord-014462-11ggaqf1	743	9	of	of	IN
cord-014462-11ggaqf1	743	10	genetic	genetic	JJ
cord-014462-11ggaqf1	743	11	diversity	diversity	NN
cord-014462-11ggaqf1	743	12	in	in	IN
cord-014462-11ggaqf1	743	13	DENV-1	DENV-1	NNS
cord-014462-11ggaqf1	743	14	,	,	,
cord-014462-11ggaqf1	743	15	DENV-2	DENV-2	NNP
cord-014462-11ggaqf1	743	16	and	and	CC
cord-014462-11ggaqf1	743	17	DENV-3	DENV-3	NNS
cord-014462-11ggaqf1	743	18	were	be	VBD
cord-014462-11ggaqf1	743	19	collected	collect	VBN
cord-014462-11ggaqf1	743	20	from	from	IN
cord-014462-11ggaqf1	743	21	GenBank	GenBank	NNP
cord-014462-11ggaqf1	743	22	.	.	.
cord-014462-11ggaqf1	744	1	Neighbor	neighbor	NN
cord-014462-11ggaqf1	744	2	joining	join	VBG
cord-014462-11ggaqf1	744	3	algorithm	algorithm	NN
cord-014462-11ggaqf1	744	4	was	be	VBD
cord-014462-11ggaqf1	744	5	implemented	implement	VBN
cord-014462-11ggaqf1	744	6	with	with	IN
cord-014462-11ggaqf1	744	7	bootstrap	bootstrap	NN
cord-014462-11ggaqf1	744	8	value	value	NN
cord-014462-11ggaqf1	744	9	of	of	IN
cord-014462-11ggaqf1	744	10	10,000	10,000	CD
cord-014462-11ggaqf1	744	11	replicates	replicate	NNS
cord-014462-11ggaqf1	744	12	for	for	IN
cord-014462-11ggaqf1	744	13	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	744	14	inference	inference	NN
cord-014462-11ggaqf1	744	15	using	use	VBG
cord-014462-11ggaqf1	744	16	MEGA	MEGA	NNP
cord-014462-11ggaqf1	744	17	4.0.2	4.0.2	CD
cord-014462-11ggaqf1	744	18	.	.	.
cord-014462-11ggaqf1	745	1	The	the	DT
cord-014462-11ggaqf1	745	2	genomic	genomic	JJ
cord-014462-11ggaqf1	745	3	region	region	NN
cord-014462-11ggaqf1	745	4	134	134	CD
cord-014462-11ggaqf1	745	5	to	to	IN
cord-014462-11ggaqf1	745	6	644	644	CD
cord-014462-11ggaqf1	745	7	(	(	-LRB-
cord-014462-11ggaqf1	745	8	C	C	NNP
cord-014462-11ggaqf1	745	9	-	-	HYPH
cord-014462-11ggaqf1	745	10	prM	prm	JJ
cord-014462-11ggaqf1	745	11	gene	gene	NN
cord-014462-11ggaqf1	745	12	junction	junction	NN
cord-014462-11ggaqf1	745	13	)	)	-RRB-
cord-014462-11ggaqf1	745	14	of	of	IN
cord-014462-11ggaqf1	745	15	DENV	DENV	NNP
cord-014462-11ggaqf1	745	16	were	be	VBD
cord-014462-11ggaqf1	745	17	amplified	amplify	VBN
cord-014462-11ggaqf1	745	18	directly	directly	RB
cord-014462-11ggaqf1	745	19	from	from	IN
cord-014462-11ggaqf1	745	20	patient	patient	JJ
cord-014462-11ggaqf1	745	21	serum	serum	NN
cord-014462-11ggaqf1	745	22	.	.	.
cord-014462-11ggaqf1	746	1	Twelve	twelve	CD
cord-014462-11ggaqf1	746	2	of	of	IN
cord-014462-11ggaqf1	746	3	72	72	CD
cord-014462-11ggaqf1	746	4	samples	sample	NNS
cord-014462-11ggaqf1	746	5	were	be	VBD
cord-014462-11ggaqf1	746	6	positive	positive	JJ
cord-014462-11ggaqf1	746	7	for	for	IN
cord-014462-11ggaqf1	746	8	dengue	dengue	NN
cord-014462-11ggaqf1	746	9	viral	viral	JJ
cord-014462-11ggaqf1	746	10	RNA	RNA	NNP
cord-014462-11ggaqf1	746	11	.	.	.
cord-014462-11ggaqf1	747	1	Of	of	IN
cord-014462-11ggaqf1	747	2	these	these	DT
cord-014462-11ggaqf1	747	3	4	4	CD
cord-014462-11ggaqf1	747	4	were	be	VBD
cord-014462-11ggaqf1	747	5	Dengue	dengue	NN
cord-014462-11ggaqf1	747	6	type	type	NN
cord-014462-11ggaqf1	747	7	1	1	CD
cord-014462-11ggaqf1	747	8	,	,	,
cord-014462-11ggaqf1	747	9	1	1	CD
cord-014462-11ggaqf1	747	10	was	be	VBD
cord-014462-11ggaqf1	747	11	Dengue	dengue	NN
cord-014462-11ggaqf1	747	12	type	type	NN
cord-014462-11ggaqf1	747	13	2	2	CD
cord-014462-11ggaqf1	747	14	and	and	CC
cord-014462-11ggaqf1	747	15	7	7	CD
cord-014462-11ggaqf1	748	1	were	be	VBD
cord-014462-11ggaqf1	748	2	Dengue	dengue	NN
cord-014462-11ggaqf1	748	3	type	type	NN
cord-014462-11ggaqf1	748	4	3	3	CD
cord-014462-11ggaqf1	748	5	.	.	.
cord-014462-11ggaqf1	749	1	For	for	IN
cord-014462-11ggaqf1	749	2	molecular	molecular	JJ
cord-014462-11ggaqf1	749	3	epidemiological	epidemiological	JJ
cord-014462-11ggaqf1	749	4	survey	survey	NN
cord-014462-11ggaqf1	749	5	and	and	CC
cord-014462-11ggaqf1	749	6	genotyping	genotyping	NN
cord-014462-11ggaqf1	749	7	of	of	IN
cord-014462-11ggaqf1	749	8	the	the	DT
cord-014462-11ggaqf1	749	9	sequences	sequence	NNS
cord-014462-11ggaqf1	749	10	more	more	JJR
cord-014462-11ggaqf1	749	11	than	than	IN
cord-014462-11ggaqf1	749	12	100	100	CD
cord-014462-11ggaqf1	749	13	sequences	sequence	NNS
cord-014462-11ggaqf1	749	14	from	from	IN
cord-014462-11ggaqf1	749	15	different	different	JJ
cord-014462-11ggaqf1	749	16	geographical	geographical	JJ
cord-014462-11ggaqf1	749	17	areas	area	NNS
cord-014462-11ggaqf1	749	18	including	include	VBG
cord-014462-11ggaqf1	749	19	sequences	sequence	NNS
cord-014462-11ggaqf1	749	20	form	form	VBP
cord-014462-11ggaqf1	749	21	previously	previously	RB
cord-014462-11ggaqf1	749	22	reported	report	VBN
cord-014462-11ggaqf1	749	23	north	north	JJ
cord-014462-11ggaqf1	749	24	Indian	indian	JJ
cord-014462-11ggaqf1	749	25	isolates	isolate	NNS
cord-014462-11ggaqf1	749	26	were	be	VBD
cord-014462-11ggaqf1	749	27	compared	compare	VBN
cord-014462-11ggaqf1	749	28	with	with	IN
cord-014462-11ggaqf1	749	29	our	-PRON-	PRP$
cord-014462-11ggaqf1	749	30	present	present	JJ
cord-014462-11ggaqf1	749	31	data	data	NN
cord-014462-11ggaqf1	749	32	set	set	NN
cord-014462-11ggaqf1	749	33	.	.	.
cord-014462-11ggaqf1	750	1	The	the	DT
cord-014462-11ggaqf1	750	2	critical	critical	JJ
cord-014462-11ggaqf1	750	3	analysis	analysis	NN
cord-014462-11ggaqf1	750	4	of	of	IN
cord-014462-11ggaqf1	750	5	the	the	DT
cord-014462-11ggaqf1	750	6	sequences	sequence	NNS
cord-014462-11ggaqf1	750	7	revealed	reveal	VBD
cord-014462-11ggaqf1	750	8	:	:	:
cord-014462-11ggaqf1	750	9	4	4	LS
cord-014462-11ggaqf1	750	10	Dengue	dengue	NN
cord-014462-11ggaqf1	750	11	Type	type	NN
cord-014462-11ggaqf1	750	12	1	1	CD
cord-014462-11ggaqf1	750	13	sequences	sequence	NNS
cord-014462-11ggaqf1	750	14	were	be	VBD
cord-014462-11ggaqf1	750	15	clustered	cluster	VBN
cord-014462-11ggaqf1	750	16	within	within	IN
cord-014462-11ggaqf1	750	17	sub	sub	JJ
cord-014462-11ggaqf1	750	18	-	-	JJ
cord-014462-11ggaqf1	750	19	type	type	JJ
cord-014462-11ggaqf1	750	20	2	2	CD
cord-014462-11ggaqf1	750	21	of	of	IN
cord-014462-11ggaqf1	750	22	genotype	genotype	NN
cord-014462-11ggaqf1	750	23	III	III	NNP
cord-014462-11ggaqf1	750	24	and	and	CC
cord-014462-11ggaqf1	750	25	all	all	PDT
cord-014462-11ggaqf1	750	26	the	the	DT
cord-014462-11ggaqf1	750	27	7	7	CD
cord-014462-11ggaqf1	750	28	sequences	sequence	NNS
cord-014462-11ggaqf1	750	29	of	of	IN
cord-014462-11ggaqf1	750	30	DEN-3	den-3	NN
cord-014462-11ggaqf1	750	31	clustered	cluster	VBN
cord-014462-11ggaqf1	750	32	along	along	RB
cord-014462-11ggaqf1	750	33	with	with	IN
cord-014462-11ggaqf1	750	34	genotype	genotype	NN
cord-014462-11ggaqf1	750	35	III	III	NNP
cord-014462-11ggaqf1	750	36	.	.	.
cord-014462-11ggaqf1	751	1	Thus	thus	RB
cord-014462-11ggaqf1	751	2	,	,	,
cord-014462-11ggaqf1	751	3	among	among	IN
cord-014462-11ggaqf1	751	4	the	the	DT
cord-014462-11ggaqf1	751	5	dengue	dengue	NN
cord-014462-11ggaqf1	751	6	types	type	NNS
cord-014462-11ggaqf1	751	7	1	1	CD
cord-014462-11ggaqf1	751	8	,	,	,
cord-014462-11ggaqf1	751	9	2	2	CD
cord-014462-11ggaqf1	751	10	and	and	CC
cord-014462-11ggaqf1	751	11	3	3	CD
cord-014462-11ggaqf1	751	12	currently	currently	RB
cord-014462-11ggaqf1	751	13	circulating	circulate	VBG
cord-014462-11ggaqf1	751	14	in	in	IN
cord-014462-11ggaqf1	751	15	North	North	NNP
cord-014462-11ggaqf1	751	16	India	India	NNP
cord-014462-11ggaqf1	751	17	,	,	,
cord-014462-11ggaqf1	751	18	Dengue	Dengue	NNP
cord-014462-11ggaqf1	751	19	type	type	NN
cord-014462-11ggaqf1	751	20	3	3	CD
cord-014462-11ggaqf1	751	21	,	,	,
cord-014462-11ggaqf1	751	22	genotype	genotype	NN
cord-014462-11ggaqf1	751	23	III	III	NNP
cord-014462-11ggaqf1	751	24	,	,	,
cord-014462-11ggaqf1	751	25	being	be	VBG
cord-014462-11ggaqf1	751	26	the	the	DT
cord-014462-11ggaqf1	751	27	predominant	predominant	JJ
cord-014462-11ggaqf1	751	28	one	one	NN
cord-014462-11ggaqf1	751	29	followed	follow	VBN
cord-014462-11ggaqf1	751	30	by	by	IN
cord-014462-11ggaqf1	751	31	,	,	,
cord-014462-11ggaqf1	751	32	genotype	genotype	NN
cord-014462-11ggaqf1	751	33	III	III	NNP
cord-014462-11ggaqf1	751	34	of	of	IN
cord-014462-11ggaqf1	751	35	Dengue	Dengue	NNP
cord-014462-11ggaqf1	751	36	type	type	NN
cord-014462-11ggaqf1	751	37	1	1	CD
cord-014462-11ggaqf1	751	38	.	.	.
cord-014462-11ggaqf1	752	1	Although	although	IN
cord-014462-11ggaqf1	752	2	there	there	EX
cord-014462-11ggaqf1	752	3	is	be	VBZ
cord-014462-11ggaqf1	752	4	no	no	DT
cord-014462-11ggaqf1	752	5	specific	specific	JJ
cord-014462-11ggaqf1	752	6	treatment	treatment	NN
cord-014462-11ggaqf1	752	7	or	or	CC
cord-014462-11ggaqf1	752	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	752	9	available	available	JJ
cord-014462-11ggaqf1	752	10	currently	currently	RB
cord-014462-11ggaqf1	752	11	,	,	,
cord-014462-11ggaqf1	752	12	the	the	DT
cord-014462-11ggaqf1	752	13	confirmative	confirmative	JJ
cord-014462-11ggaqf1	752	14	rapid	rapid	JJ
cord-014462-11ggaqf1	752	15	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	752	16	based	base	VBN
cord-014462-11ggaqf1	752	17	on	on	IN
cord-014462-11ggaqf1	752	18	detection	detection	NN
cord-014462-11ggaqf1	752	19	of	of	IN
cord-014462-11ggaqf1	752	20	viral	viral	JJ
cord-014462-11ggaqf1	752	21	nucleic	nucleic	JJ
cord-014462-11ggaqf1	752	22	acid	acid	NN
cord-014462-11ggaqf1	752	23	or	or	CC
cord-014462-11ggaqf1	752	24	IgM	IgM	NNP
cord-014462-11ggaqf1	752	25	antibodies	antibody	NNS
cord-014462-11ggaqf1	752	26	in	in	IN
cord-014462-11ggaqf1	752	27	serum	serum	NN
cord-014462-11ggaqf1	752	28	,	,	,
cord-014462-11ggaqf1	752	29	an	an	DT
cord-014462-11ggaqf1	752	30	indication	indication	NN
cord-014462-11ggaqf1	752	31	of	of	IN
cord-014462-11ggaqf1	752	32	recent	recent	JJ
cord-014462-11ggaqf1	752	33	infection	infection	NN
cord-014462-11ggaqf1	752	34	,	,	,
cord-014462-11ggaqf1	752	35	helps	help	VBZ
cord-014462-11ggaqf1	752	36	in	in	IN
cord-014462-11ggaqf1	752	37	epidemiological	epidemiological	JJ
cord-014462-11ggaqf1	752	38	monitoring	monitoring	NN
cord-014462-11ggaqf1	752	39	,	,	,
cord-014462-11ggaqf1	752	40	symptomatic	symptomatic	JJ
cord-014462-11ggaqf1	752	41	treatment	treatment	NN
cord-014462-11ggaqf1	752	42	of	of	IN
cord-014462-11ggaqf1	752	43	patients	patient	NNS
cord-014462-11ggaqf1	752	44	and	and	CC
cord-014462-11ggaqf1	752	45	determining	determine	VBG
cord-014462-11ggaqf1	752	46	prognosis	prognosis	NN
cord-014462-11ggaqf1	752	47	.	.	.
cord-014462-11ggaqf1	753	1	Serological	serological	JJ
cord-014462-11ggaqf1	753	2	detection	detection	NN
cord-014462-11ggaqf1	753	3	of	of	IN
cord-014462-11ggaqf1	753	4	anti	anti	JJ
cord-014462-11ggaqf1	753	5	-	-	JJ
cord-014462-11ggaqf1	753	6	CGV	cgv	JJ
cord-014462-11ggaqf1	753	7	IgM	igm	NN
cord-014462-11ggaqf1	753	8	antibodies	antibody	NNS
cord-014462-11ggaqf1	753	9	was	be	VBD
cord-014462-11ggaqf1	753	10	performed	perform	VBN
cord-014462-11ggaqf1	753	11	using	use	VBG
cord-014462-11ggaqf1	753	12	rapid	rapid	JJ
cord-014462-11ggaqf1	753	13	immuno	immuno	JJ
cord-014462-11ggaqf1	753	14	-	-	JJ
cord-014462-11ggaqf1	753	15	chromatographic	chromatographic	JJ
cord-014462-11ggaqf1	753	16	assay	assay	NN
cord-014462-11ggaqf1	753	17	(	(	-LRB-
cord-014462-11ggaqf1	753	18	RICA	RICA	NNP
cord-014462-11ggaqf1	753	19	)	)	-RRB-
cord-014462-11ggaqf1	753	20	and	and	CC
cord-014462-11ggaqf1	753	21	IgM	igm	NN
cord-014462-11ggaqf1	753	22	-	-	HYPH
cord-014462-11ggaqf1	753	23	antibody	antibody	NN
cord-014462-11ggaqf1	753	24	capture	capture	NN
cord-014462-11ggaqf1	753	25	enzyme	enzyme	NN
cord-014462-11ggaqf1	753	26	linked	link	VBN
cord-014462-11ggaqf1	753	27	immunosorbant	immunosorbant	JJ
cord-014462-11ggaqf1	753	28	assay	assay	NN
cord-014462-11ggaqf1	753	29	(	(	-LRB-
cord-014462-11ggaqf1	753	30	MAC	MAC	NNP
cord-014462-11ggaqf1	753	31	-	-	HYPH
cord-014462-11ggaqf1	753	32	ELISA	ELISA	NNP
cord-014462-11ggaqf1	753	33	)	)	-RRB-
cord-014462-11ggaqf1	753	34	.	.	.
cord-014462-11ggaqf1	754	1	Eighty	eighty	CD
cord-014462-11ggaqf1	754	2	convalescent	convalescent	JJ
cord-014462-11ggaqf1	754	3	sera	sera	NNP
cord-014462-11ggaqf1	754	4	were	be	VBD
cord-014462-11ggaqf1	754	5	tested	test	VBN
cord-014462-11ggaqf1	754	6	by	by	IN
cord-014462-11ggaqf1	754	7	RICA	RICA	NNP
cord-014462-11ggaqf1	754	8	and	and	CC
cord-014462-11ggaqf1	754	9	60	60	CD
cord-014462-11ggaqf1	754	10	of	of	IN
cord-014462-11ggaqf1	754	11	them	-PRON-	PRP
cord-014462-11ggaqf1	754	12	were	be	VBD
cord-014462-11ggaqf1	754	13	found	find	VBN
cord-014462-11ggaqf1	754	14	positive	positive	JJ
cord-014462-11ggaqf1	754	15	for	for	IN
cord-014462-11ggaqf1	754	16	anti	anti	JJ
cord-014462-11ggaqf1	754	17	-	-	JJ
cord-014462-11ggaqf1	754	18	CGV	cgv	JJ
cord-014462-11ggaqf1	754	19	IgM	igm	NN
cord-014462-11ggaqf1	754	20	antibodies	antibody	NNS
cord-014462-11ggaqf1	754	21	.	.	.
cord-014462-11ggaqf1	755	1	Twenty	twenty	CD
cord-014462-11ggaqf1	755	2	-	-	HYPH
cord-014462-11ggaqf1	755	3	five	five	CD
cord-014462-11ggaqf1	755	4	anti	anti	JJ
cord-014462-11ggaqf1	755	5	-	-	JJ
cord-014462-11ggaqf1	755	6	CGV	cgv	JJ
cord-014462-11ggaqf1	755	7	IgM	IgM	NNP
cord-014462-11ggaqf1	755	8	antibody	antibody	NN
cord-014462-11ggaqf1	755	9	RICA	RICA	NNP
cord-014462-11ggaqf1	755	10	positive	positive	JJ
cord-014462-11ggaqf1	755	11	sera	sera	NNP
cord-014462-11ggaqf1	755	12	were	be	VBD
cord-014462-11ggaqf1	755	13	further	further	RB
cord-014462-11ggaqf1	755	14	assayed	assay	VBN
cord-014462-11ggaqf1	755	15	using	use	VBG
cord-014462-11ggaqf1	755	16	MAC	MAC	NNP
cord-014462-11ggaqf1	755	17	-	-	HYPH
cord-014462-11ggaqf1	755	18	ELISA	ELISA	NNP
cord-014462-11ggaqf1	755	19	.	.	.
cord-014462-11ggaqf1	756	1	More	more	RBR
cord-014462-11ggaqf1	756	2	sera	sera	NNP
cord-014462-11ggaqf1	756	3	from	from	IN
cord-014462-11ggaqf1	756	4	the	the	DT
cord-014462-11ggaqf1	756	5	patients	patient	NNS
cord-014462-11ggaqf1	756	6	are	be	VBP
cord-014462-11ggaqf1	756	7	currently	currently	RB
cord-014462-11ggaqf1	756	8	being	be	VBG
cord-014462-11ggaqf1	756	9	tested	test	VBN
cord-014462-11ggaqf1	756	10	to	to	TO
cord-014462-11ggaqf1	756	11	compare	compare	VB
cord-014462-11ggaqf1	756	12	the	the	DT
cord-014462-11ggaqf1	756	13	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	756	14	of	of	IN
cord-014462-11ggaqf1	756	15	these	these	DT
cord-014462-11ggaqf1	756	16	two	two	CD
cord-014462-11ggaqf1	756	17	serological	serological	JJ
cord-014462-11ggaqf1	756	18	assays	assay	NNS
cord-014462-11ggaqf1	756	19	in	in	IN
cord-014462-11ggaqf1	756	20	anti	anti	JJ
cord-014462-11ggaqf1	756	21	-	-	JJ
cord-014462-11ggaqf1	756	22	CGV	cgv	JJ
cord-014462-11ggaqf1	756	23	IgM	igm	NN
cord-014462-11ggaqf1	756	24	antibody	antibody	NN
cord-014462-11ggaqf1	756	25	based	base	VBD
cord-014462-11ggaqf1	756	26	early	early	JJ
cord-014462-11ggaqf1	756	27	serological	serological	JJ
cord-014462-11ggaqf1	756	28	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	756	29	of	of	IN
cord-014462-11ggaqf1	756	30	CGV	CGV	NNP
cord-014462-11ggaqf1	756	31	infection	infection	NN
cord-014462-11ggaqf1	756	32	and	and	CC
cord-014462-11ggaqf1	756	33	the	the	DT
cord-014462-11ggaqf1	756	34	findings	finding	NNS
cord-014462-11ggaqf1	756	35	will	will	MD
cord-014462-11ggaqf1	756	36	be	be	VB
cord-014462-11ggaqf1	756	37	presented	present	VBN
cord-014462-11ggaqf1	756	38	.	.	.
cord-014462-11ggaqf1	757	1	Thus	thus	RB
cord-014462-11ggaqf1	757	2	the	the	DT
cord-014462-11ggaqf1	757	3	present	present	JJ
cord-014462-11ggaqf1	757	4	study	study	NN
cord-014462-11ggaqf1	757	5	was	be	VBD
cord-014462-11ggaqf1	757	6	designed	design	VBN
cord-014462-11ggaqf1	757	7	to	to	TO
cord-014462-11ggaqf1	757	8	evaluate	evaluate	VB
cord-014462-11ggaqf1	757	9	the	the	DT
cord-014462-11ggaqf1	757	10	utility	utility	NN
cord-014462-11ggaqf1	757	11	of	of	IN
cord-014462-11ggaqf1	757	12	multiplex	multiplex	NN
cord-014462-11ggaqf1	757	13	PCR	PCR	NNP
cord-014462-11ggaqf1	757	14	(	(	-LRB-
cord-014462-11ggaqf1	757	15	mPCR	mPCR	NNP
cord-014462-11ggaqf1	757	16	)	)	-RRB-
cord-014462-11ggaqf1	757	17	for	for	IN
cord-014462-11ggaqf1	757	18	simultaneous	simultaneous	JJ
cord-014462-11ggaqf1	757	19	and	and	CC
cord-014462-11ggaqf1	757	20	rapid	rapid	JJ
cord-014462-11ggaqf1	757	21	detection	detection	NN
cord-014462-11ggaqf1	757	22	of	of	IN
cord-014462-11ggaqf1	757	23	dengue	dengue	NN
cord-014462-11ggaqf1	757	24	and	and	CC
cord-014462-11ggaqf1	757	25	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	757	26	viral	viral	JJ
cord-014462-11ggaqf1	757	27	infections	infection	NNS
cord-014462-11ggaqf1	757	28	.	.	.
cord-014462-11ggaqf1	758	1	Seventy	seventy	CD
cord-014462-11ggaqf1	758	2	-	-	HYPH
cord-014462-11ggaqf1	758	3	two	two	CD
cord-014462-11ggaqf1	758	4	acute	acute	JJ
cord-014462-11ggaqf1	758	5	phase	phase	NN
cord-014462-11ggaqf1	758	6	blood	blood	NN
cord-014462-11ggaqf1	758	7	samples	sample	NNS
cord-014462-11ggaqf1	758	8	from	from	IN
cord-014462-11ggaqf1	758	9	clinically	clinically	RB
cord-014462-11ggaqf1	758	10	suspected	suspect	VBN
cord-014462-11ggaqf1	758	11	dengue	dengue	NN
cord-014462-11ggaqf1	758	12	cases	case	NNS
cord-014462-11ggaqf1	758	13	were	be	VBD
cord-014462-11ggaqf1	758	14	subjected	subject	VBN
cord-014462-11ggaqf1	758	15	for	for	IN
cord-014462-11ggaqf1	758	16	dengue	dengue	NN
cord-014462-11ggaqf1	758	17	and	and	CC
cord-014462-11ggaqf1	758	18	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	758	19	uniplex	uniplex	NN
cord-014462-11ggaqf1	758	20	PCR	PCR	NNP
cord-014462-11ggaqf1	758	21	using	use	VBG
cord-014462-11ggaqf1	758	22	dengue	dengue	NN
cord-014462-11ggaqf1	758	23	genus	genus	VBP
cord-014462-11ggaqf1	758	24	specific	specific	JJ
cord-014462-11ggaqf1	758	25	primers	primer	NNS
cord-014462-11ggaqf1	758	26	and	and	CC
cord-014462-11ggaqf1	758	27	E	e	NN
cord-014462-11ggaqf1	758	28	gene	gene	NN
cord-014462-11ggaqf1	758	29	specific	specific	JJ
cord-014462-11ggaqf1	758	30	primers	primer	NNS
cord-014462-11ggaqf1	758	31	for	for	IN
cord-014462-11ggaqf1	758	32	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	758	33	virus	virus	NN
cord-014462-11ggaqf1	758	34	as	as	RB
cord-014462-11ggaqf1	758	35	well	well	RB
cord-014462-11ggaqf1	758	36	as	as	IN
cord-014462-11ggaqf1	758	37	multiplex	multiplex	NN
cord-014462-11ggaqf1	758	38	PCR	PCR	NNP
cord-014462-11ggaqf1	758	39	was	be	VBD
cord-014462-11ggaqf1	758	40	developed	develop	VBN
cord-014462-11ggaqf1	758	41	for	for	IN
cord-014462-11ggaqf1	758	42	simultaneous	simultaneous	JJ
cord-014462-11ggaqf1	758	43	detection	detection	NN
cord-014462-11ggaqf1	758	44	of	of	IN
cord-014462-11ggaqf1	758	45	dengue	dengue	NN
cord-014462-11ggaqf1	758	46	and	and	CC
cord-014462-11ggaqf1	758	47	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	758	48	infection	infection	NN
cord-014462-11ggaqf1	758	49	.	.	.
cord-014462-11ggaqf1	759	1	Standard	standard	JJ
cord-014462-11ggaqf1	759	2	strains	strain	NNS
cord-014462-11ggaqf1	759	3	of	of	IN
cord-014462-11ggaqf1	759	4	dengue	dengue	NN
cord-014462-11ggaqf1	759	5	and	and	CC
cord-014462-11ggaqf1	759	6	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	759	7	virus	virus	NN
cord-014462-11ggaqf1	759	8	were	be	VBD
cord-014462-11ggaqf1	759	9	used	use	VBN
cord-014462-11ggaqf1	759	10	as	as	IN
cord-014462-11ggaqf1	759	11	controls	control	NNS
cord-014462-11ggaqf1	759	12	.	.	.
cord-014462-11ggaqf1	760	1	13	13	CD
cord-014462-11ggaqf1	760	2	of	of	IN
cord-014462-11ggaqf1	760	3	the	the	DT
cord-014462-11ggaqf1	760	4	72	72	CD
cord-014462-11ggaqf1	760	5	clinically	clinically	RB
cord-014462-11ggaqf1	760	6	suspected	suspect	VBN
cord-014462-11ggaqf1	760	7	dengue	dengue	NN
cord-014462-11ggaqf1	760	8	samples	sample	NNS
cord-014462-11ggaqf1	760	9	were	be	VBD
cord-014462-11ggaqf1	760	10	found	find	VBN
cord-014462-11ggaqf1	760	11	to	to	TO
cord-014462-11ggaqf1	760	12	be	be	VB
cord-014462-11ggaqf1	760	13	positive	positive	JJ
cord-014462-11ggaqf1	760	14	for	for	IN
cord-014462-11ggaqf1	760	15	dengue	dengue	NN
cord-014462-11ggaqf1	760	16	viral	viral	JJ
cord-014462-11ggaqf1	760	17	RNA	RNA	NNP
cord-014462-11ggaqf1	760	18	by	by	IN
cord-014462-11ggaqf1	760	19	dengue	dengue	NN
cord-014462-11ggaqf1	760	20	uniplex	uniplex	NN
cord-014462-11ggaqf1	760	21	PCR	PCR	NNP
cord-014462-11ggaqf1	760	22	as	as	RB
cord-014462-11ggaqf1	760	23	well	well	RB
cord-014462-11ggaqf1	760	24	as	as	IN
cord-014462-11ggaqf1	760	25	dengue	dengue	NN
cord-014462-11ggaqf1	760	26	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	760	27	mPCR	mpcr	XX
cord-014462-11ggaqf1	761	1	whereas	whereas	IN
cord-014462-11ggaqf1	761	2	none	none	NN
cord-014462-11ggaqf1	761	3	of	of	IN
cord-014462-11ggaqf1	761	4	the	the	DT
cord-014462-11ggaqf1	761	5	samples	sample	NNS
cord-014462-11ggaqf1	761	6	were	be	VBD
cord-014462-11ggaqf1	761	7	positive	positive	JJ
cord-014462-11ggaqf1	761	8	for	for	IN
cord-014462-11ggaqf1	761	9	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	761	10	virus	virus	NN
cord-014462-11ggaqf1	761	11	infection	infection	NN
cord-014462-11ggaqf1	761	12	by	by	IN
cord-014462-11ggaqf1	761	13	both	both	DT
cord-014462-11ggaqf1	761	14	uniplex	uniplex	JJ
cord-014462-11ggaqf1	761	15	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	761	16	PCR	PCR	NNP
cord-014462-11ggaqf1	761	17	and	and	CC
cord-014462-11ggaqf1	761	18	dengue	dengue	NN
cord-014462-11ggaqf1	761	19	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	761	20	mPCR	mPCR	NNP
cord-014462-11ggaqf1	761	21	.	.	.
cord-014462-11ggaqf1	762	1	The	the	DT
cord-014462-11ggaqf1	762	2	result	result	NN
cord-014462-11ggaqf1	762	3	of	of	IN
cord-014462-11ggaqf1	762	4	dengue	dengue	NN
cord-014462-11ggaqf1	762	5	and	and	CC
cord-014462-11ggaqf1	762	6	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	762	7	uniplex	uniplex	NN
cord-014462-11ggaqf1	762	8	PCR	PCR	NNP
cord-014462-11ggaqf1	762	9	was	be	VBD
cord-014462-11ggaqf1	762	10	found	find	VBN
cord-014462-11ggaqf1	762	11	to	to	TO
cord-014462-11ggaqf1	762	12	be	be	VB
cord-014462-11ggaqf1	762	13	100	100	CD
cord-014462-11ggaqf1	762	14	%	%	NN
cord-014462-11ggaqf1	762	15	concordant	concordant	JJ
cord-014462-11ggaqf1	762	16	with	with	IN
cord-014462-11ggaqf1	762	17	dengue	dengue	NN
cord-014462-11ggaqf1	762	18	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	762	19	multiplex	multiplex	NN
cord-014462-11ggaqf1	762	20	PCR	PCR	NNP
cord-014462-11ggaqf1	762	21	.	.	.
cord-014462-11ggaqf1	763	1	Dengue	dengue	NN
cord-014462-11ggaqf1	763	2	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	763	3	multiplex	multiplex	NN
cord-014462-11ggaqf1	763	4	PCR	PCR	NNP
cord-014462-11ggaqf1	763	5	was	be	VBD
cord-014462-11ggaqf1	763	6	found	find	VBN
cord-014462-11ggaqf1	763	7	to	to	TO
cord-014462-11ggaqf1	763	8	be	be	VB
cord-014462-11ggaqf1	763	9	a	a	DT
cord-014462-11ggaqf1	763	10	potential	potential	JJ
cord-014462-11ggaqf1	763	11	rapid	rapid	JJ
cord-014462-11ggaqf1	763	12	test	test	NN
cord-014462-11ggaqf1	763	13	to	to	TO
cord-014462-11ggaqf1	763	14	detect	detect	VB
cord-014462-11ggaqf1	763	15	dengue	dengue	NN
cord-014462-11ggaqf1	763	16	and	and	CC
cord-014462-11ggaqf1	763	17	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	763	18	viral	viral	JJ
cord-014462-11ggaqf1	763	19	infections	infection	NNS
cord-014462-11ggaqf1	763	20	simultaneously	simultaneously	RB
cord-014462-11ggaqf1	763	21	in	in	IN
cord-014462-11ggaqf1	763	22	clinical	clinical	JJ
cord-014462-11ggaqf1	763	23	samples	sample	NNS
cord-014462-11ggaqf1	763	24	.	.	.
cord-014462-11ggaqf1	764	1	Sheetal	Sheetal	NNP
cord-014462-11ggaqf1	764	2	Malhotra	Malhotra	NNP
cord-014462-11ggaqf1	764	3	,	,	,
cord-014462-11ggaqf1	764	4	Neelam	Neelam	NNP
cord-014462-11ggaqf1	764	5	Marwaha	Marwaha	NNP
cord-014462-11ggaqf1	764	6	,	,	,
cord-014462-11ggaqf1	764	7	Karan	Karan	NNP
cord-014462-11ggaqf1	764	8	Saluja	Saluja	NNP
cord-014462-11ggaqf1	764	9	,	,	,
cord-014462-11ggaqf1	764	10	Ratti	Ratti	NNP
cord-014462-11ggaqf1	764	11	Ram	Ram	NNP
cord-014462-11ggaqf1	764	12	Sharma	Sharma	NNP
cord-014462-11ggaqf1	764	13	Department	Department	NNP
cord-014462-11ggaqf1	764	14	of	of	IN
cord-014462-11ggaqf1	764	15	Transfusion	Transfusion	NNP
cord-014462-11ggaqf1	764	16	Medicine	Medicine	NNP
cord-014462-11ggaqf1	764	17	,	,	,
cord-014462-11ggaqf1	764	18	PGIMER	PGIMER	NNP
cord-014462-11ggaqf1	764	19	,	,	,
cord-014462-11ggaqf1	765	1	Chandigarh	Chandigarh	NNP
cord-014462-11ggaqf1	765	2	160012	160012	CD
cord-014462-11ggaqf1	765	3	Transmission	Transmission	NNP
cord-014462-11ggaqf1	765	4	through	through	IN
cord-014462-11ggaqf1	765	5	blood	blood	NN
cord-014462-11ggaqf1	765	6	and	and	CC
cord-014462-11ggaqf1	765	7	blood	blood	NN
cord-014462-11ggaqf1	765	8	products	product	NNS
cord-014462-11ggaqf1	765	9	can	can	MD
cord-014462-11ggaqf1	765	10	be	be	VB
cord-014462-11ggaqf1	765	11	reduced	reduce	VBN
cord-014462-11ggaqf1	765	12	to	to	IN
cord-014462-11ggaqf1	765	13	a	a	DT
cord-014462-11ggaqf1	765	14	great	great	JJ
cord-014462-11ggaqf1	765	15	extent	extent	NN
cord-014462-11ggaqf1	765	16	by	by	IN
cord-014462-11ggaqf1	765	17	efficient	efficient	JJ
cord-014462-11ggaqf1	765	18	and	and	CC
cord-014462-11ggaqf1	765	19	reliable	reliable	JJ
cord-014462-11ggaqf1	765	20	testing	testing	NN
cord-014462-11ggaqf1	765	21	of	of	IN
cord-014462-11ggaqf1	765	22	the	the	DT
cord-014462-11ggaqf1	765	23	blood	blood	NN
cord-014462-11ggaqf1	765	24	.	.	.
cord-014462-11ggaqf1	766	1	The	the	DT
cord-014462-11ggaqf1	766	2	newer	new	JJR
cord-014462-11ggaqf1	766	3	fourth	fourth	JJ
cord-014462-11ggaqf1	766	4	generation	generation	NN
cord-014462-11ggaqf1	766	5	ELISA	ELISA	NNP
cord-014462-11ggaqf1	766	6	assays	assay	NNS
cord-014462-11ggaqf1	766	7	simultaneously	simultaneously	RB
cord-014462-11ggaqf1	766	8	detect	detect	VBP
cord-014462-11ggaqf1	766	9	antibodies	antibody	NNS
cord-014462-11ggaqf1	766	10	against	against	IN
cord-014462-11ggaqf1	766	11	HIV-1	HIV-1	NNP
cord-014462-11ggaqf1	766	12	and	and	CC
cord-014462-11ggaqf1	766	13	2	2	CD
cord-014462-11ggaqf1	766	14	and	and	CC
cord-014462-11ggaqf1	766	15	the	the	DT
cord-014462-11ggaqf1	766	16	presence	presence	NN
cord-014462-11ggaqf1	766	17	of	of	IN
cord-014462-11ggaqf1	766	18	p24	p24	NN
cord-014462-11ggaqf1	766	19	antigen	antigen	NN
cord-014462-11ggaqf1	766	20	and	and	CC
cord-014462-11ggaqf1	766	21	thus	thus	RB
cord-014462-11ggaqf1	766	22	shorten	shorten	VB
cord-014462-11ggaqf1	766	23	the	the	DT
cord-014462-11ggaqf1	766	24	window	window	NN
cord-014462-11ggaqf1	766	25	period	period	NN
cord-014462-11ggaqf1	766	26	to	to	IN
cord-014462-11ggaqf1	766	27	about	about	IN
cord-014462-11ggaqf1	766	28	14	14	CD
cord-014462-11ggaqf1	766	29	days	day	NNS
cord-014462-11ggaqf1	766	30	,	,	,
cord-014462-11ggaqf1	766	31	as	as	IN
cord-014462-11ggaqf1	766	32	compared	compare	VBN
cord-014462-11ggaqf1	766	33	to	to	IN
cord-014462-11ggaqf1	766	34	22	22	CD
cord-014462-11ggaqf1	766	35	days	day	NNS
cord-014462-11ggaqf1	766	36	with	with	IN
cord-014462-11ggaqf1	766	37	third	third	JJ
cord-014462-11ggaqf1	766	38	generation	generation	NN
cord-014462-11ggaqf1	766	39	ELISA	ELISA	NNP
cord-014462-11ggaqf1	766	40	.	.	.
cord-014462-11ggaqf1	767	1	To	to	TO
cord-014462-11ggaqf1	767	2	compare	compare	VB
cord-014462-11ggaqf1	767	3	the	the	DT
cord-014462-11ggaqf1	767	4	HIV	HIV	NNP
cord-014462-11ggaqf1	767	5	seroprevalance	seroprevalance	NN
cord-014462-11ggaqf1	767	6	among	among	IN
cord-014462-11ggaqf1	767	7	blood	blood	NN
cord-014462-11ggaqf1	767	8	donors	donor	NNS
cord-014462-11ggaqf1	767	9	using	use	VBG
cord-014462-11ggaqf1	767	10	fourth	fourth	JJ
cord-014462-11ggaqf1	767	11	generation	generation	NN
cord-014462-11ggaqf1	767	12	ELISA	ELISA	NNP
cord-014462-11ggaqf1	767	13	(	(	-LRB-
cord-014462-11ggaqf1	767	14	antigen	antigen	NN
cord-014462-11ggaqf1	767	15	-	-	HYPH
cord-014462-11ggaqf1	767	16	antibody	antibody	NN
cord-014462-11ggaqf1	767	17	)	)	-RRB-
cord-014462-11ggaqf1	767	18	versus	versus	IN
cord-014462-11ggaqf1	767	19	third	third	JJ
cord-014462-11ggaqf1	767	20	generation	generation	NN
cord-014462-11ggaqf1	767	21	ELISA	ELISA	NNP
cord-014462-11ggaqf1	767	22	(	(	-LRB-
cord-014462-11ggaqf1	767	23	antibody	antibody	NN
cord-014462-11ggaqf1	767	24	)	)	-RRB-
cord-014462-11ggaqf1	767	25	assay	assay	NN
cord-014462-11ggaqf1	767	26	.	.	.
cord-014462-11ggaqf1	768	1	This	this	DT
cord-014462-11ggaqf1	768	2	was	be	VBD
cord-014462-11ggaqf1	768	3	a	a	DT
cord-014462-11ggaqf1	768	4	prospective	prospective	JJ
cord-014462-11ggaqf1	768	5	study	study	NN
cord-014462-11ggaqf1	768	6	involving	involve	VBG
cord-014462-11ggaqf1	768	7	5100	5100	CD
cord-014462-11ggaqf1	768	8	blood	blood	NN
cord-014462-11ggaqf1	768	9	donors	donor	NNS
cord-014462-11ggaqf1	769	1	of	of	IN
cord-014462-11ggaqf1	769	2	which	which	WDT
cord-014462-11ggaqf1	769	3	3400	3400	CD
cord-014462-11ggaqf1	769	4	were	be	VBD
cord-014462-11ggaqf1	769	5	voluntary	voluntary	JJ
cord-014462-11ggaqf1	769	6	donors	donor	NNS
cord-014462-11ggaqf1	769	7	(	(	-LRB-
cord-014462-11ggaqf1	769	8	1700	1700	CD
cord-014462-11ggaqf1	769	9	being	be	VBG
cord-014462-11ggaqf1	769	10	students	student	NNS
cord-014462-11ggaqf1	769	11	and	and	CC
cord-014462-11ggaqf1	769	12	1700	1700	CD
cord-014462-11ggaqf1	769	13	being	be	VBG
cord-014462-11ggaqf1	769	14	non	non	JJ
cord-014462-11ggaqf1	769	15	students	student	NNS
cord-014462-11ggaqf1	769	16	)	)	-RRB-
cord-014462-11ggaqf1	769	17	and	and	CC
cord-014462-11ggaqf1	769	18	1700	1700	CD
cord-014462-11ggaqf1	769	19	were	be	VBD
cord-014462-11ggaqf1	769	20	replacement	replacement	NN
cord-014462-11ggaqf1	769	21	donors	donor	NNS
cord-014462-11ggaqf1	769	22	.	.	.
cord-014462-11ggaqf1	770	1	Sex	sex	NN
cord-014462-11ggaqf1	770	2	workers	worker	NNS
cord-014462-11ggaqf1	770	3	are	be	VBP
cord-014462-11ggaqf1	770	4	one	one	CD
cord-014462-11ggaqf1	770	5	of	of	IN
cord-014462-11ggaqf1	770	6	the	the	DT
cord-014462-11ggaqf1	770	7	core	core	NN
cord-014462-11ggaqf1	770	8	group	group	NN
cord-014462-11ggaqf1	770	9	for	for	IN
cord-014462-11ggaqf1	770	10	transmission	transmission	NN
cord-014462-11ggaqf1	770	11	of	of	IN
cord-014462-11ggaqf1	770	12	STI	STI	NNP
cord-014462-11ggaqf1	770	13	/	/	SYM
cord-014462-11ggaqf1	770	14	HIV	HIV	NNP
cord-014462-11ggaqf1	770	15	and	and	CC
cord-014462-11ggaqf1	770	16	as	as	IN
cord-014462-11ggaqf1	770	17	a	a	DT
cord-014462-11ggaqf1	770	18	'	'	''
cord-014462-11ggaqf1	770	19	'	'	''
cord-014462-11ggaqf1	770	20	bridge	bridge	NN
cord-014462-11ggaqf1	770	21	group	group	NN
cord-014462-11ggaqf1	770	22	'	'	''
cord-014462-11ggaqf1	770	23	'	'	''
cord-014462-11ggaqf1	770	24	to	to	IN
cord-014462-11ggaqf1	770	25	the	the	DT
cord-014462-11ggaqf1	770	26	general	general	JJ
cord-014462-11ggaqf1	770	27	population	population	NN
cord-014462-11ggaqf1	770	28	.	.	.
cord-014462-11ggaqf1	771	1	Accordingly	accordingly	RB
cord-014462-11ggaqf1	771	2	,	,	,
cord-014462-11ggaqf1	771	3	highest	high	JJS
cord-014462-11ggaqf1	771	4	priority	priority	NN
cord-014462-11ggaqf1	771	5	is	be	VBZ
cord-014462-11ggaqf1	771	6	given	give	VBN
cord-014462-11ggaqf1	771	7	to	to	IN
cord-014462-11ggaqf1	771	8	this	this	DT
cord-014462-11ggaqf1	771	9	group	group	NN
cord-014462-11ggaqf1	771	10	in	in	IN
cord-014462-11ggaqf1	771	11	targeted	target	VBN
cord-014462-11ggaqf1	771	12	intervention	intervention	NN
cord-014462-11ggaqf1	771	13	for	for	IN
cord-014462-11ggaqf1	771	14	prevention	prevention	NN
cord-014462-11ggaqf1	771	15	of	of	IN
cord-014462-11ggaqf1	771	16	HIV	HIV	NNP
cord-014462-11ggaqf1	771	17	/	/	SYM
cord-014462-11ggaqf1	771	18	AIDS	AIDS	NNP
cord-014462-11ggaqf1	771	19	.	.	.
cord-014462-11ggaqf1	772	1	Here	here	RB
cord-014462-11ggaqf1	772	2	we	-PRON-	PRP
cord-014462-11ggaqf1	772	3	are	be	VBP
cord-014462-11ggaqf1	772	4	describing	describe	VBG
cord-014462-11ggaqf1	772	5	one	one	CD
cord-014462-11ggaqf1	772	6	such	such	JJ
cord-014462-11ggaqf1	772	7	female	female	JJ
cord-014462-11ggaqf1	772	8	sex	sex	NN
cord-014462-11ggaqf1	772	9	worker	worker	NN
cord-014462-11ggaqf1	772	10	who	who	WP
cord-014462-11ggaqf1	772	11	was	be	VBD
cord-014462-11ggaqf1	772	12	harbouring	harbour	VBG
cord-014462-11ggaqf1	772	13	5	5	CD
cord-014462-11ggaqf1	772	14	concomitant	concomitant	JJ
cord-014462-11ggaqf1	772	15	STI	STI	NNP
cord-014462-11ggaqf1	772	16	including	include	VBG
cord-014462-11ggaqf1	772	17	4	4	CD
cord-014462-11ggaqf1	772	18	viral	viral	JJ
cord-014462-11ggaqf1	772	19	STI	STI	NNP
cord-014462-11ggaqf1	772	20	.	.	.
cord-014462-11ggaqf1	773	1	A	a	DT
cord-014462-11ggaqf1	773	2	25	25	CD
cord-014462-11ggaqf1	773	3	year	year	NN
cord-014462-11ggaqf1	773	4	old	old	JJ
cord-014462-11ggaqf1	773	5	female	female	JJ
cord-014462-11ggaqf1	773	6	sex	sex	NN
cord-014462-11ggaqf1	773	7	worker	worker	NN
cord-014462-11ggaqf1	773	8	was	be	VBD
cord-014462-11ggaqf1	773	9	brought	bring	VBN
cord-014462-11ggaqf1	773	10	to	to	IN
cord-014462-11ggaqf1	773	11	the	the	DT
cord-014462-11ggaqf1	773	12	STI	STI	NNP
cord-014462-11ggaqf1	773	13	clinic	clinic	NN
cord-014462-11ggaqf1	773	14	of	of	IN
cord-014462-11ggaqf1	773	15	a	a	DT
cord-014462-11ggaqf1	773	16	tertiary	tertiary	JJ
cord-014462-11ggaqf1	773	17	care	care	NN
cord-014462-11ggaqf1	773	18	hospital	hospital	NN
cord-014462-11ggaqf1	773	19	by	by	IN
cord-014462-11ggaqf1	773	20	NGO	NGO	NNP
cord-014462-11ggaqf1	773	21	with	with	IN
cord-014462-11ggaqf1	773	22	complaint	complaint	NN
cord-014462-11ggaqf1	773	23	of	of	IN
cord-014462-11ggaqf1	773	24	genital	genital	JJ
cord-014462-11ggaqf1	773	25	discharge	discharge	NN
cord-014462-11ggaqf1	773	26	for	for	IN
cord-014462-11ggaqf1	773	27	3	3	CD
cord-014462-11ggaqf1	773	28	days	day	NNS
cord-014462-11ggaqf1	773	29	.	.	.
cord-014462-11ggaqf1	774	1	On	on	IN
cord-014462-11ggaqf1	774	2	per	per	IN
cord-014462-11ggaqf1	774	3	speculum	speculum	NN
cord-014462-11ggaqf1	774	4	examination	examination	NN
cord-014462-11ggaqf1	774	5	,	,	,
cord-014462-11ggaqf1	774	6	cervix	cervix	NN
cord-014462-11ggaqf1	774	7	was	be	VBD
cord-014462-11ggaqf1	774	8	slightly	slightly	RB
cord-014462-11ggaqf1	774	9	erythematous	erythematous	JJ
cord-014462-11ggaqf1	774	10	,	,	,
cord-014462-11ggaqf1	774	11	tender	tender	JJ
cord-014462-11ggaqf1	774	12	with	with	IN
cord-014462-11ggaqf1	774	13	mucopurulent	mucopurulent	NN
cord-014462-11ggaqf1	774	14	discharge	discharge	NN
cord-014462-11ggaqf1	774	15	.	.	.
cord-014462-11ggaqf1	775	1	There	there	EX
cord-014462-11ggaqf1	775	2	was	be	VBD
cord-014462-11ggaqf1	775	3	no	no	DT
cord-014462-11ggaqf1	775	4	vaginal	vaginal	JJ
cord-014462-11ggaqf1	775	5	discharge	discharge	NN
cord-014462-11ggaqf1	775	6	or	or	CC
cord-014462-11ggaqf1	775	7	ulcer	ulcer	NN
cord-014462-11ggaqf1	775	8	in	in	IN
cord-014462-11ggaqf1	775	9	anogenital	anogenital	JJ
cord-014462-11ggaqf1	775	10	area	area	NN
cord-014462-11ggaqf1	775	11	.	.	.
cord-014462-11ggaqf1	776	1	However	however	RB
cord-014462-11ggaqf1	776	2	,	,	,
cord-014462-11ggaqf1	776	3	there	there	EX
cord-014462-11ggaqf1	776	4	was	be	VBD
cord-014462-11ggaqf1	776	5	a	a	DT
cord-014462-11ggaqf1	776	6	wart	wart	NN
cord-014462-11ggaqf1	776	7	at	at	IN
cord-014462-11ggaqf1	776	8	lateral	lateral	JJ
cord-014462-11ggaqf1	776	9	wall	wall	NN
cord-014462-11ggaqf1	776	10	of	of	IN
cord-014462-11ggaqf1	776	11	vagina	vagina	NN
cord-014462-11ggaqf1	776	12	.	.	.
cord-014462-11ggaqf1	777	1	As	as	IN
cord-014462-11ggaqf1	777	2	per	per	IN
cord-014462-11ggaqf1	777	3	NACO	NACO	NNP
cord-014462-11ggaqf1	777	4	syndromic	syndromic	NNP
cord-014462-11ggaqf1	777	5	management	management	NN
cord-014462-11ggaqf1	777	6	guideline	guideline	NN
cord-014462-11ggaqf1	777	7	,	,	,
cord-014462-11ggaqf1	777	8	treatment	treatment	NN
cord-014462-11ggaqf1	777	9	was	be	VBD
cord-014462-11ggaqf1	777	10	given	give	VBN
cord-014462-11ggaqf1	777	11	for	for	IN
cord-014462-11ggaqf1	777	12	N.	N.	NNP
cord-014462-11ggaqf1	777	13	gonorrhoeae	gonorrhoeae	NNP
cord-014462-11ggaqf1	777	14	,	,	,
cord-014462-11ggaqf1	777	15	C.	C.	NNP
cord-014462-11ggaqf1	777	16	trachomatis	trachomatis	NN
cord-014462-11ggaqf1	777	17	and	and	CC
cord-014462-11ggaqf1	777	18	HPV	hpv	NN
cord-014462-11ggaqf1	777	19	.	.	.
cord-014462-11ggaqf1	778	1	Cervical	cervical	JJ
cord-014462-11ggaqf1	778	2	swab	swab	NN
cord-014462-11ggaqf1	778	3	was	be	VBD
cord-014462-11ggaqf1	778	4	taken	take	VBN
cord-014462-11ggaqf1	778	5	and	and	CC
cord-014462-11ggaqf1	778	6	subjected	subject	VBN
cord-014462-11ggaqf1	778	7	to	to	IN
cord-014462-11ggaqf1	778	8	various	various	JJ
cord-014462-11ggaqf1	778	9	microbiological	microbiological	JJ
cord-014462-11ggaqf1	778	10	investigation	investigation	NN
cord-014462-11ggaqf1	778	11	for	for	IN
cord-014462-11ggaqf1	778	12	the	the	DT
cord-014462-11ggaqf1	778	13	detection	detection	NN
cord-014462-11ggaqf1	778	14	of	of	IN
cord-014462-11ggaqf1	778	15	STI	STI	NNP
cord-014462-11ggaqf1	778	16	viz	viz	NN
cord-014462-11ggaqf1	778	17	N.	N.	NNP
cord-014462-11ggaqf1	778	18	gonorrhoeae	gonorrhoeae	NNP
cord-014462-11ggaqf1	778	19	,	,	,
cord-014462-11ggaqf1	778	20	C.	C.	NNP
cord-014462-11ggaqf1	778	21	trachomatis	trachomatis	NN
cord-014462-11ggaqf1	778	22	,	,	,
cord-014462-11ggaqf1	778	23	T.	t.	NN
cord-014462-11ggaqf1	778	24	pallidum	pallidum	NN
cord-014462-11ggaqf1	778	25	,	,	,
cord-014462-11ggaqf1	778	26	Candida	Candida	NNP
cord-014462-11ggaqf1	778	27	spp	spp	NNS
cord-014462-11ggaqf1	778	28	.	.	.
cord-014462-11ggaqf1	779	1	,	,	,
cord-014462-11ggaqf1	779	2	T.vaginalis	t.vaginali	NNS
cord-014462-11ggaqf1	779	3	,	,	,
cord-014462-11ggaqf1	779	4	HSV-1	hsv-1	NN
cord-014462-11ggaqf1	779	5	,	,	,
cord-014462-11ggaqf1	779	6	HSV-2	HSV-2	NNP
cord-014462-11ggaqf1	779	7	,	,	,
cord-014462-11ggaqf1	779	8	HIV	HIV	NNP
cord-014462-11ggaqf1	779	9	,	,	,
cord-014462-11ggaqf1	779	10	HBV	HBV	NNP
cord-014462-11ggaqf1	779	11	,	,	,
cord-014462-11ggaqf1	779	12	HCV	HCV	NNP
cord-014462-11ggaqf1	779	13	,	,	,
cord-014462-11ggaqf1	779	14	HPV	HPV	NNP
cord-014462-11ggaqf1	779	15	and	and	CC
cord-014462-11ggaqf1	779	16	M.	M.	NNP
cord-014462-11ggaqf1	779	17	contagiosum	contagiosum	NN
cord-014462-11ggaqf1	779	18	.	.	.
cord-014462-11ggaqf1	780	1	Saline	saline	JJ
cord-014462-11ggaqf1	780	2	wet	wet	JJ
cord-014462-11ggaqf1	780	3	mount	mount	NN
cord-014462-11ggaqf1	780	4	showed	show	VBD
cord-014462-11ggaqf1	780	5	pus	pus	NN
cord-014462-11ggaqf1	780	6	cells	cell	NNS
cord-014462-11ggaqf1	780	7	,	,	,
cord-014462-11ggaqf1	780	8	but	but	CC
cord-014462-11ggaqf1	780	9	no	no	DT
cord-014462-11ggaqf1	780	10	yeast	yeast	NN
cord-014462-11ggaqf1	780	11	cells	cell	NNS
cord-014462-11ggaqf1	780	12	or	or	CC
cord-014462-11ggaqf1	780	13	trophozoite	trophozoite	NN
cord-014462-11ggaqf1	780	14	of	of	IN
cord-014462-11ggaqf1	780	15	Trichomonas	Trichomonas	NNP
cord-014462-11ggaqf1	780	16	vaginalis	vaginalis	NN
cord-014462-11ggaqf1	780	17	.	.	.
cord-014462-11ggaqf1	781	1	Gram	gram	NN
cord-014462-11ggaqf1	781	2	stained	stained	JJ
cord-014462-11ggaqf1	781	3	smear	smear	NN
cord-014462-11ggaqf1	781	4	showed	show	VBD
cord-014462-11ggaqf1	781	5	more	more	JJR
cord-014462-11ggaqf1	781	6	than	than	IN
cord-014462-11ggaqf1	781	7	four	four	CD
cord-014462-11ggaqf1	781	8	polymorphonuclear	polymorphonuclear	JJ
cord-014462-11ggaqf1	781	9	leucocytes	leucocyte	NNS
cord-014462-11ggaqf1	781	10	in	in	IN
cord-014462-11ggaqf1	781	11	the	the	DT
cord-014462-11ggaqf1	781	12	absence	absence	NN
cord-014462-11ggaqf1	781	13	of	of	IN
cord-014462-11ggaqf1	781	14	gramnegative	gramnegative	NNP
cord-014462-11ggaqf1	781	15	intracellular	intracellular	JJ
cord-014462-11ggaqf1	781	16	diplococci	diplococcus	NNS
cord-014462-11ggaqf1	781	17	and	and	CC
cord-014462-11ggaqf1	781	18	a	a	DT
cord-014462-11ggaqf1	781	19	presumptive	presumptive	JJ
cord-014462-11ggaqf1	781	20	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	781	21	of	of	IN
cord-014462-11ggaqf1	781	22	non	non	JJ
cord-014462-11ggaqf1	781	23	gonococcal	gonococcal	JJ
cord-014462-11ggaqf1	781	24	urethritis	urethritis	NN
cord-014462-11ggaqf1	781	25	was	be	VBD
cord-014462-11ggaqf1	781	26	made	make	VBN
cord-014462-11ggaqf1	781	27	.	.	.
cord-014462-11ggaqf1	782	1	No	no	DT
cord-014462-11ggaqf1	782	2	organism	organism	NN
cord-014462-11ggaqf1	782	3	was	be	VBD
cord-014462-11ggaqf1	782	4	isolated	isolate	VBN
cord-014462-11ggaqf1	782	5	on	on	IN
cord-014462-11ggaqf1	782	6	any	any	DT
cord-014462-11ggaqf1	782	7	culture	culture	NN
cord-014462-11ggaqf1	782	8	media	medium	NNS
cord-014462-11ggaqf1	782	9	after	after	IN
cord-014462-11ggaqf1	782	10	appropriate	appropriate	JJ
cord-014462-11ggaqf1	782	11	incubation	incubation	NN
cord-014462-11ggaqf1	782	12	.	.	.
cord-014462-11ggaqf1	783	1	Cervical	cervical	JJ
cord-014462-11ggaqf1	783	2	swab	swab	NN
cord-014462-11ggaqf1	783	3	was	be	VBD
cord-014462-11ggaqf1	783	4	negative	negative	JJ
cord-014462-11ggaqf1	783	5	for	for	IN
cord-014462-11ggaqf1	783	6	antigen	antigen	NN
cord-014462-11ggaqf1	783	7	of	of	IN
cord-014462-11ggaqf1	783	8	C.	C.	NNP
cord-014462-11ggaqf1	783	9	trachomatis	trachomatis	NN
cord-014462-11ggaqf1	783	10	.	.	.
cord-014462-11ggaqf1	784	1	Serum	serum	NN
cord-014462-11ggaqf1	784	2	was	be	VBD
cord-014462-11ggaqf1	784	3	tested	test	VBN
cord-014462-11ggaqf1	784	4	positive	positive	JJ
cord-014462-11ggaqf1	784	5	for	for	IN
cord-014462-11ggaqf1	784	6	HBV	HBV	NNP
cord-014462-11ggaqf1	784	7	,	,	,
cord-014462-11ggaqf1	784	8	HCV	HCV	NNP
cord-014462-11ggaqf1	784	9	,	,	,
cord-014462-11ggaqf1	784	10	HSV-2	HSV-2	NNP
cord-014462-11ggaqf1	784	11	and	and	CC
cord-014462-11ggaqf1	784	12	T.	T.	NNP
cord-014462-11ggaqf1	784	13	pallidum	pallidum	NN
cord-014462-11ggaqf1	784	14	though	though	IN
cord-014462-11ggaqf1	784	15	it	-PRON-	PRP
cord-014462-11ggaqf1	784	16	was	be	VBD
cord-014462-11ggaqf1	784	17	seronegative	seronegative	JJ
cord-014462-11ggaqf1	784	18	for	for	IN
cord-014462-11ggaqf1	784	19	HIV	HIV	NNP
cord-014462-11ggaqf1	784	20	.	.	.
cord-014462-11ggaqf1	785	1	In	in	IN
cord-014462-11ggaqf1	785	2	the	the	DT
cord-014462-11ggaqf1	785	3	present	present	JJ
cord-014462-11ggaqf1	785	4	case	case	NN
cord-014462-11ggaqf1	785	5	,	,	,
cord-014462-11ggaqf1	785	6	the	the	DT
cord-014462-11ggaqf1	785	7	female	female	JJ
cord-014462-11ggaqf1	785	8	sex	sex	NN
cord-014462-11ggaqf1	785	9	worker	worker	NN
cord-014462-11ggaqf1	785	10	was	be	VBD
cord-014462-11ggaqf1	785	11	harbouring	harbour	VBG
cord-014462-11ggaqf1	785	12	four	four	CD
cord-014462-11ggaqf1	785	13	viral	viral	JJ
cord-014462-11ggaqf1	785	14	STI	STI	NNP
cord-014462-11ggaqf1	785	15	viz	viz	NN
cord-014462-11ggaqf1	785	16	HSV-2	HSV-2	NNP
cord-014462-11ggaqf1	785	17	,	,	,
cord-014462-11ggaqf1	785	18	HBV	HBV	NNP
cord-014462-11ggaqf1	785	19	,	,	,
cord-014462-11ggaqf1	785	20	HCV	HCV	NNP
cord-014462-11ggaqf1	785	21	and	and	CC
cord-014462-11ggaqf1	785	22	HPV	HPV	NNP
cord-014462-11ggaqf1	785	23	alongwith	alongwith	IN
cord-014462-11ggaqf1	785	24	T.	t.	NN
cord-014462-11ggaqf1	785	25	pallidum	pallidum	NN
cord-014462-11ggaqf1	785	26	.	.	.
cord-014462-11ggaqf1	786	1	However	however	RB
cord-014462-11ggaqf1	786	2	clinically	clinically	RB
cord-014462-11ggaqf1	786	3	she	-PRON-	PRP
cord-014462-11ggaqf1	786	4	was	be	VBD
cord-014462-11ggaqf1	786	5	diagnosed	diagnose	VBN
cord-014462-11ggaqf1	786	6	and	and	CC
cord-014462-11ggaqf1	786	7	treated	treat	VBN
cord-014462-11ggaqf1	786	8	accurately	accurately	RB
cord-014462-11ggaqf1	786	9	only	only	RB
cord-014462-11ggaqf1	786	10	for	for	IN
cord-014462-11ggaqf1	786	11	genital	genital	JJ
cord-014462-11ggaqf1	786	12	wart	wart	NN
cord-014462-11ggaqf1	786	13	while	while	IN
cord-014462-11ggaqf1	786	14	cervical	cervical	JJ
cord-014462-11ggaqf1	786	15	discharge	discharge	NN
cord-014462-11ggaqf1	786	16	due	due	IN
cord-014462-11ggaqf1	786	17	to	to	IN
cord-014462-11ggaqf1	786	18	HSV-2	HSV-2	NNP
cord-014462-11ggaqf1	786	19	was	be	VBD
cord-014462-11ggaqf1	786	20	misdiagnosed	misdiagnose	VBN
cord-014462-11ggaqf1	786	21	.	.	.
cord-014462-11ggaqf1	787	1	It	-PRON-	PRP
cord-014462-11ggaqf1	787	2	is	be	VBZ
cord-014462-11ggaqf1	787	3	necessary	necessary	JJ
cord-014462-11ggaqf1	787	4	to	to	TO
cord-014462-11ggaqf1	787	5	try	try	VB
cord-014462-11ggaqf1	787	6	to	to	TO
cord-014462-11ggaqf1	787	7	test	test	VB
cord-014462-11ggaqf1	787	8	alternative	alternative	JJ
cord-014462-11ggaqf1	787	9	approaches	approach	NNS
cord-014462-11ggaqf1	787	10	such	such	JJ
cord-014462-11ggaqf1	787	11	as	as	IN
cord-014462-11ggaqf1	787	12	periodic	periodic	JJ
cord-014462-11ggaqf1	787	13	presumptive	presumptive	JJ
cord-014462-11ggaqf1	787	14	therapy	therapy	NN
cord-014462-11ggaqf1	787	15	of	of	IN
cord-014462-11ggaqf1	787	16	viral	viral	JJ
cord-014462-11ggaqf1	787	17	STI	STI	NNP
cord-014462-11ggaqf1	787	18	,	,	,
cord-014462-11ggaqf1	787	19	because	because	IN
cord-014462-11ggaqf1	787	20	this	this	DT
cord-014462-11ggaqf1	787	21	will	will	MD
cord-014462-11ggaqf1	787	22	not	not	RB
cord-014462-11ggaqf1	787	23	only	only	RB
cord-014462-11ggaqf1	787	24	boost	boost	VB
cord-014462-11ggaqf1	787	25	up	up	RP
cord-014462-11ggaqf1	787	26	the	the	DT
cord-014462-11ggaqf1	787	27	efforts	effort	NNS
cord-014462-11ggaqf1	787	28	of	of	IN
cord-014462-11ggaqf1	787	29	STI	STI	NNP
cord-014462-11ggaqf1	787	30	control	control	NN
cord-014462-11ggaqf1	787	31	in	in	IN
cord-014462-11ggaqf1	787	32	the	the	DT
cord-014462-11ggaqf1	787	33	target	target	NN
cord-014462-11ggaqf1	787	34	group	group	NN
cord-014462-11ggaqf1	787	35	but	but	CC
cord-014462-11ggaqf1	787	36	also	also	RB
cord-014462-11ggaqf1	787	37	help	help	VBP
cord-014462-11ggaqf1	787	38	in	in	IN
cord-014462-11ggaqf1	787	39	HIV	HIV	NNP
cord-014462-11ggaqf1	787	40	control	control	NN
cord-014462-11ggaqf1	787	41	.	.	.
cord-014462-11ggaqf1	788	1	Alternatively	alternatively	RB
cord-014462-11ggaqf1	788	2	,	,	,
cord-014462-11ggaqf1	788	3	regular	regular	JJ
cord-014462-11ggaqf1	788	4	clinical	clinical	JJ
cord-014462-11ggaqf1	788	5	and	and	CC
cord-014462-11ggaqf1	788	6	laboratory	laboratory	NN
cord-014462-11ggaqf1	788	7	screening	screening	NN
cord-014462-11ggaqf1	788	8	for	for	IN
cord-014462-11ggaqf1	788	9	viral	viral	JJ
cord-014462-11ggaqf1	788	10	STI	STI	NNP
cord-014462-11ggaqf1	788	11	may	may	MD
cord-014462-11ggaqf1	788	12	be	be	VB
cord-014462-11ggaqf1	788	13	tried	try	VBN
cord-014462-11ggaqf1	788	14	.	.	.
cord-014462-11ggaqf1	789	1	Densonucleosis	densonucleosis	NN
cord-014462-11ggaqf1	789	2	viruses	virus	NNS
cord-014462-11ggaqf1	789	3	(	(	-LRB-
cord-014462-11ggaqf1	789	4	DNV	DNV	NNP
cord-014462-11ggaqf1	789	5	)	)	-RRB-
cord-014462-11ggaqf1	789	6	belong	belong	VBP
cord-014462-11ggaqf1	789	7	to	to	IN
cord-014462-11ggaqf1	789	8	Parvoviridae	Parvoviridae	NNP
cord-014462-11ggaqf1	789	9	family	family	NN
cord-014462-11ggaqf1	789	10	.	.	.
cord-014462-11ggaqf1	790	1	They	-PRON-	PRP
cord-014462-11ggaqf1	790	2	are	be	VBP
cord-014462-11ggaqf1	790	3	the	the	DT
cord-014462-11ggaqf1	790	4	etiological	etiological	JJ
cord-014462-11ggaqf1	790	5	agents	agent	NNS
cord-014462-11ggaqf1	790	6	of	of	IN
cord-014462-11ggaqf1	790	7	insect	insect	NN
cord-014462-11ggaqf1	790	8	's	's	POS
cord-014462-11ggaqf1	790	9	disease	disease	NN
cord-014462-11ggaqf1	790	10	known	know	VBN
cord-014462-11ggaqf1	790	11	as	as	IN
cord-014462-11ggaqf1	790	12	densonucleosis	densonucleosis	NNP
cord-014462-11ggaqf1	790	13	,	,	,
cord-014462-11ggaqf1	790	14	which	which	WDT
cord-014462-11ggaqf1	790	15	leads	lead	VBZ
cord-014462-11ggaqf1	790	16	to	to	IN
cord-014462-11ggaqf1	790	17	death	death	NN
cord-014462-11ggaqf1	790	18	or	or	CC
cord-014462-11ggaqf1	790	19	loss	loss	NN
cord-014462-11ggaqf1	790	20	of	of	IN
cord-014462-11ggaqf1	790	21	vital	vital	JJ
cord-014462-11ggaqf1	790	22	functions	function	NNS
cord-014462-11ggaqf1	790	23	of	of	IN
cord-014462-11ggaqf1	790	24	the	the	DT
cord-014462-11ggaqf1	790	25	infected	infected	JJ
cord-014462-11ggaqf1	790	26	insect	insect	NN
cord-014462-11ggaqf1	790	27	.	.	.
cord-014462-11ggaqf1	791	1	Densonucleosis	densonucleosis	NN
cord-014462-11ggaqf1	791	2	virus	virus	NN
cord-014462-11ggaqf1	791	3	of	of	IN
cord-014462-11ggaqf1	791	4	mosquitoes	mosquito	NNS
cord-014462-11ggaqf1	791	5	has	have	VBZ
cord-014462-11ggaqf1	791	6	generated	generate	VBN
cord-014462-11ggaqf1	791	7	lot	lot	NN
cord-014462-11ggaqf1	791	8	of	of	IN
cord-014462-11ggaqf1	791	9	scientific	scientific	JJ
cord-014462-11ggaqf1	791	10	interests	interest	NNS
cord-014462-11ggaqf1	791	11	because	because	IN
cord-014462-11ggaqf1	791	12	of	of	IN
cord-014462-11ggaqf1	791	13	its	-PRON-	PRP$
cord-014462-11ggaqf1	791	14	tremendous	tremendous	JJ
cord-014462-11ggaqf1	791	15	potential	potential	NN
cord-014462-11ggaqf1	791	16	in	in	IN
cord-014462-11ggaqf1	791	17	biological	biological	JJ
cord-014462-11ggaqf1	791	18	control	control	NN
cord-014462-11ggaqf1	791	19	and	and	CC
cord-014462-11ggaqf1	791	20	its	-PRON-	PRP$
cord-014462-11ggaqf1	791	21	application	application	NN
cord-014462-11ggaqf1	791	22	as	as	IN
cord-014462-11ggaqf1	791	23	a	a	DT
cord-014462-11ggaqf1	791	24	transducing	transducing	NN
cord-014462-11ggaqf1	791	25	vector	vector	NN
cord-014462-11ggaqf1	791	26	.	.	.
cord-014462-11ggaqf1	792	1	Earlier	early	RBR
cord-014462-11ggaqf1	792	2	,	,	,
cord-014462-11ggaqf1	792	3	we	-PRON-	PRP
cord-014462-11ggaqf1	792	4	have	have	VBP
cord-014462-11ggaqf1	792	5	reported	report	VBN
cord-014462-11ggaqf1	792	6	the	the	DT
cord-014462-11ggaqf1	792	7	isolation	isolation	NN
cord-014462-11ggaqf1	792	8	and	and	CC
cord-014462-11ggaqf1	792	9	characterization	characterization	NN
cord-014462-11ggaqf1	792	10	of	of	IN
cord-014462-11ggaqf1	792	11	a	a	DT
cord-014462-11ggaqf1	792	12	DNV	DNV	NNP
cord-014462-11ggaqf1	792	13	from	from	IN
cord-014462-11ggaqf1	792	14	Aedes	Aedes	NNP
cord-014462-11ggaqf1	792	15	aegypti	aegypti	NN
cord-014462-11ggaqf1	792	16	mosquitoes	mosquito	NNS
cord-014462-11ggaqf1	792	17	and	and	CC
cord-014462-11ggaqf1	792	18	its	-PRON-	PRP$
cord-014462-11ggaqf1	792	19	prevalence	prevalence	NN
cord-014462-11ggaqf1	792	20	among	among	IN
cord-014462-11ggaqf1	792	21	different	different	JJ
cord-014462-11ggaqf1	792	22	Ae	Ae	NNS
cord-014462-11ggaqf1	792	23	.	.	.
cord-014462-11ggaqf1	793	1	aegypti	aegypti	NN
cord-014462-11ggaqf1	793	2	populations	population	NNS
cord-014462-11ggaqf1	793	3	from	from	IN
cord-014462-11ggaqf1	793	4	India	India	NNP
cord-014462-11ggaqf1	793	5	.	.	.
cord-014462-11ggaqf1	794	1	There	there	EX
cord-014462-11ggaqf1	794	2	are	be	VBP
cord-014462-11ggaqf1	794	3	reports	report	NNS
cord-014462-11ggaqf1	794	4	suggesting	suggest	VBG
cord-014462-11ggaqf1	794	5	that	that	IN
cord-014462-11ggaqf1	794	6	when	when	WRB
cord-014462-11ggaqf1	794	7	Aedes	Aedes	NNP
cord-014462-11ggaqf1	794	8	albopictus	albopictus	NN
cord-014462-11ggaqf1	794	9	mosquitoes	mosquito	NNS
cord-014462-11ggaqf1	794	10	co	co	VBD
cord-014462-11ggaqf1	794	11	-	-	VBN
cord-014462-11ggaqf1	794	12	infected	infect	VBN
cord-014462-11ggaqf1	794	13	with	with	IN
cord-014462-11ggaqf1	794	14	Dengue-2	Dengue-2	NNP
cord-014462-11ggaqf1	794	15	and	and	CC
cord-014462-11ggaqf1	794	16	DNV	DNV	NNP
cord-014462-11ggaqf1	794	17	,	,	,
cord-014462-11ggaqf1	794	18	the	the	DT
cord-014462-11ggaqf1	794	19	multiplication	multiplication	NN
cord-014462-11ggaqf1	794	20	of	of	IN
cord-014462-11ggaqf1	794	21	DEN-2	DEN-2	NNP
cord-014462-11ggaqf1	794	22	is	be	VBZ
cord-014462-11ggaqf1	794	23	suppressed	suppress	VBN
cord-014462-11ggaqf1	794	24	.	.	.
cord-014462-11ggaqf1	795	1	The	the	DT
cord-014462-11ggaqf1	795	2	present	present	JJ
cord-014462-11ggaqf1	795	3	study	study	NN
cord-014462-11ggaqf1	795	4	focus	focus	NN
cord-014462-11ggaqf1	795	5	on	on	IN
cord-014462-11ggaqf1	795	6	the	the	DT
cord-014462-11ggaqf1	795	7	effect	effect	NN
cord-014462-11ggaqf1	795	8	of	of	IN
cord-014462-11ggaqf1	795	9	coinfection	coinfection	NN
cord-014462-11ggaqf1	795	10	of	of	IN
cord-014462-11ggaqf1	795	11	Ae	Ae	NNP
cord-014462-11ggaqf1	795	12	.	.	.
cord-014462-11ggaqf1	796	1	aegypti	aegypti	NN
cord-014462-11ggaqf1	796	2	mosquitoes	mosquito	NNS
cord-014462-11ggaqf1	796	3	with	with	IN
cord-014462-11ggaqf1	796	4	DNV	DNV	NNP
cord-014462-11ggaqf1	796	5	and	and	CC
cord-014462-11ggaqf1	796	6	Chikungunya	Chikungunya	NNP
cord-014462-11ggaqf1	796	7	virus	virus	NN
cord-014462-11ggaqf1	796	8	(	(	-LRB-
cord-014462-11ggaqf1	796	9	CHIK	CHIK	NNP
cord-014462-11ggaqf1	796	10	)	)	-RRB-
cord-014462-11ggaqf1	796	11	.	.	.
cord-014462-11ggaqf1	797	1	The	the	DT
cord-014462-11ggaqf1	797	2	first	first	JJ
cord-014462-11ggaqf1	797	3	instar	instar	JJ
cord-014462-11ggaqf1	797	4	mosquito	mosquito	NN
cord-014462-11ggaqf1	797	5	larvae	larva	NNS
cord-014462-11ggaqf1	797	6	were	be	VBD
cord-014462-11ggaqf1	797	7	infected	infect	VBN
cord-014462-11ggaqf1	797	8	with	with	IN
cord-014462-11ggaqf1	797	9	DNV	DNV	NNP
cord-014462-11ggaqf1	797	10	and	and	CC
cord-014462-11ggaqf1	797	11	the	the	DT
cord-014462-11ggaqf1	797	12	emerging	emerge	VBG
cord-014462-11ggaqf1	797	13	DNV	DNV	NNP
cord-014462-11ggaqf1	797	14	infected	infect	VBN
cord-014462-11ggaqf1	797	15	females	female	NNS
cord-014462-11ggaqf1	797	16	were	be	VBD
cord-014462-11ggaqf1	797	17	then	then	RB
cord-014462-11ggaqf1	797	18	infected	infect	VBN
cord-014462-11ggaqf1	797	19	with	with	IN
cord-014462-11ggaqf1	797	20	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	797	21	by	by	IN
cord-014462-11ggaqf1	797	22	oral	oral	JJ
cord-014462-11ggaqf1	797	23	feeding	feeding	NN
cord-014462-11ggaqf1	797	24	.	.	.
cord-014462-11ggaqf1	798	1	Thus	thus	RB
cord-014462-11ggaqf1	798	2	obtained	obtain	VBN
cord-014462-11ggaqf1	798	3	CHIK	CHIK	NNP
cord-014462-11ggaqf1	798	4	infected	infect	VBN
cord-014462-11ggaqf1	798	5	female	female	JJ
cord-014462-11ggaqf1	798	6	mosquitoes	mosquito	NNS
cord-014462-11ggaqf1	798	7	were	be	VBD
cord-014462-11ggaqf1	798	8	analyzed	analyze	VBN
cord-014462-11ggaqf1	798	9	by	by	IN
cord-014462-11ggaqf1	798	10	real	real	JJ
cord-014462-11ggaqf1	798	11	time	time	NN
cord-014462-11ggaqf1	798	12	PCR	PCR	NNP
cord-014462-11ggaqf1	798	13	for	for	IN
cord-014462-11ggaqf1	798	14	both	both	DT
cord-014462-11ggaqf1	798	15	DNV	DNV	NNP
cord-014462-11ggaqf1	798	16	and	and	CC
cord-014462-11ggaqf1	798	17	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	798	18	on	on	IN
cord-014462-11ggaqf1	798	19	alternate	alternate	JJ
cord-014462-11ggaqf1	798	20	days	day	NNS
cord-014462-11ggaqf1	798	21	post	post	NN
cord-014462-11ggaqf1	798	22	-	-	NN
cord-014462-11ggaqf1	798	23	infection	infection	NN
cord-014462-11ggaqf1	798	24	,	,	,
cord-014462-11ggaqf1	798	25	up	up	IN
cord-014462-11ggaqf1	798	26	to	to	IN
cord-014462-11ggaqf1	798	27	the	the	DT
cord-014462-11ggaqf1	798	28	14th	14th	JJ
cord-014462-11ggaqf1	798	29	day	day	NN
cord-014462-11ggaqf1	798	30	.	.	.
cord-014462-11ggaqf1	799	1	The	the	DT
cord-014462-11ggaqf1	799	2	data	datum	NNS
cord-014462-11ggaqf1	799	3	showed	show	VBD
cord-014462-11ggaqf1	799	4	no	no	DT
cord-014462-11ggaqf1	799	5	significant	significant	JJ
cord-014462-11ggaqf1	799	6	difference	difference	NN
cord-014462-11ggaqf1	799	7	in	in	IN
cord-014462-11ggaqf1	799	8	the	the	DT
cord-014462-11ggaqf1	799	9	multiplication	multiplication	NN
cord-014462-11ggaqf1	799	10	of	of	IN
cord-014462-11ggaqf1	799	11	either	either	DT
cord-014462-11ggaqf1	799	12	of	of	IN
cord-014462-11ggaqf1	799	13	the	the	DT
cord-014462-11ggaqf1	799	14	viruses	virus	NNS
cord-014462-11ggaqf1	799	15	after	after	IN
cord-014462-11ggaqf1	799	16	co	co	NN
cord-014462-11ggaqf1	799	17	-	-	NN
cord-014462-11ggaqf1	799	18	infection	infection	NN
cord-014462-11ggaqf1	799	19	.	.	.
cord-014462-11ggaqf1	800	1	Results	result	NNS
cord-014462-11ggaqf1	800	2	suggest	suggest	VBP
cord-014462-11ggaqf1	800	3	that	that	IN
cord-014462-11ggaqf1	800	4	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	800	5	neither	neither	CC
cord-014462-11ggaqf1	800	6	stimulates	stimulate	VBZ
cord-014462-11ggaqf1	800	7	the	the	DT
cord-014462-11ggaqf1	800	8	replication	replication	NN
cord-014462-11ggaqf1	800	9	of	of	IN
cord-014462-11ggaqf1	800	10	DNV	DNV	NNP
cord-014462-11ggaqf1	800	11	nor	nor	CC
cord-014462-11ggaqf1	800	12	is	be	VBZ
cord-014462-11ggaqf1	800	13	its	-PRON-	PRP$
cord-014462-11ggaqf1	800	14	own	own	JJ
cord-014462-11ggaqf1	800	15	replication	replication	NN
cord-014462-11ggaqf1	800	16	suppressed	suppress	VBN
cord-014462-11ggaqf1	800	17	due	due	IN
cord-014462-11ggaqf1	800	18	to	to	IN
cord-014462-11ggaqf1	800	19	co	co	NN
cord-014462-11ggaqf1	800	20	-	-	NN
cord-014462-11ggaqf1	800	21	infection	infection	NN
cord-014462-11ggaqf1	800	22	.	.	.
cord-014462-11ggaqf1	801	1	This	this	DT
cord-014462-11ggaqf1	801	2	study	study	NN
cord-014462-11ggaqf1	801	3	forms	form	VBZ
cord-014462-11ggaqf1	801	4	an	an	DT
cord-014462-11ggaqf1	801	5	initial	initial	JJ
cord-014462-11ggaqf1	801	6	step	step	NN
cord-014462-11ggaqf1	801	7	in	in	IN
cord-014462-11ggaqf1	801	8	understanding	understand	VBG
cord-014462-11ggaqf1	801	9	the	the	DT
cord-014462-11ggaqf1	801	10	role	role	NN
cord-014462-11ggaqf1	801	11	played	play	VBN
cord-014462-11ggaqf1	801	12	by	by	IN
cord-014462-11ggaqf1	801	13	such	such	JJ
cord-014462-11ggaqf1	801	14	endogenous	endogenous	JJ
cord-014462-11ggaqf1	801	15	viruses	virus	NNS
cord-014462-11ggaqf1	801	16	on	on	IN
cord-014462-11ggaqf1	801	17	the	the	DT
cord-014462-11ggaqf1	801	18	vector	vector	NN
cord-014462-11ggaqf1	801	19	dynamics	dynamic	NNS
cord-014462-11ggaqf1	801	20	.	.	.
cord-014462-11ggaqf1	802	1	Chandipura	Chandipura	NNP
cord-014462-11ggaqf1	802	2	virus	virus	NN
cord-014462-11ggaqf1	802	3	pathogenesis	pathogenesis	NN
cord-014462-11ggaqf1	802	4	is	be	VBZ
cord-014462-11ggaqf1	802	5	manifested	manifest	VBN
cord-014462-11ggaqf1	802	6	as	as	RB
cord-014462-11ggaqf1	802	7	encephalitis	encephalitis	JJ
cord-014462-11ggaqf1	802	8	in	in	IN
cord-014462-11ggaqf1	802	9	young	young	JJ
cord-014462-11ggaqf1	802	10	children	child	NNS
cord-014462-11ggaqf1	802	11	with	with	IN
cord-014462-11ggaqf1	802	12	a	a	DT
cord-014462-11ggaqf1	802	13	very	very	RB
cord-014462-11ggaqf1	802	14	high	high	JJ
cord-014462-11ggaqf1	802	15	mortality	mortality	NN
cord-014462-11ggaqf1	802	16	rate	rate	NN
cord-014462-11ggaqf1	802	17	.	.	.
cord-014462-11ggaqf1	803	1	This	this	DT
cord-014462-11ggaqf1	803	2	damage	damage	NN
cord-014462-11ggaqf1	803	3	could	could	MD
cord-014462-11ggaqf1	803	4	be	be	VB
cord-014462-11ggaqf1	803	5	due	due	JJ
cord-014462-11ggaqf1	803	6	to	to	IN
cord-014462-11ggaqf1	803	7	direct	direct	JJ
cord-014462-11ggaqf1	803	8	replication	replication	NN
cord-014462-11ggaqf1	803	9	of	of	IN
cord-014462-11ggaqf1	803	10	the	the	DT
cord-014462-11ggaqf1	803	11	virus	virus	NN
cord-014462-11ggaqf1	803	12	in	in	IN
cord-014462-11ggaqf1	803	13	brain	brain	NN
cord-014462-11ggaqf1	803	14	parenchymal	parenchymal	NN
cord-014462-11ggaqf1	803	15	tissue	tissue	NN
cord-014462-11ggaqf1	803	16	or	or	CC
cord-014462-11ggaqf1	803	17	immune	immune	JJ
cord-014462-11ggaqf1	803	18	system	system	NN
cord-014462-11ggaqf1	803	19	mediated	mediate	VBN
cord-014462-11ggaqf1	803	20	.	.	.
cord-014462-11ggaqf1	804	1	This	this	DT
cord-014462-11ggaqf1	804	2	study	study	NN
cord-014462-11ggaqf1	804	3	aims	aim	VBZ
cord-014462-11ggaqf1	804	4	at	at	IN
cord-014462-11ggaqf1	804	5	elucidating	elucidate	VBG
cord-014462-11ggaqf1	804	6	the	the	DT
cord-014462-11ggaqf1	804	7	role	role	NN
cord-014462-11ggaqf1	804	8	of	of	IN
cord-014462-11ggaqf1	804	9	brain	brain	NN
cord-014462-11ggaqf1	804	10	infiltrating	infiltrate	VBG
cord-014462-11ggaqf1	804	11	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	804	12	in	in	IN
cord-014462-11ggaqf1	804	13	pathogenesis	pathogenesis	NN
cord-014462-11ggaqf1	804	14	using	use	VBG
cord-014462-11ggaqf1	804	15	mice	mouse	NNS
cord-014462-11ggaqf1	804	16	as	as	IN
cord-014462-11ggaqf1	804	17	the	the	DT
cord-014462-11ggaqf1	804	18	model	model	NN
cord-014462-11ggaqf1	804	19	system	system	NN
cord-014462-11ggaqf1	804	20	.	.	.
cord-014462-11ggaqf1	805	1	Mice	mouse	NNS
cord-014462-11ggaqf1	805	2	were	be	VBD
cord-014462-11ggaqf1	805	3	inoculated	inoculate	VBN
cord-014462-11ggaqf1	805	4	intracerebrally	intracerebrally	RB
cord-014462-11ggaqf1	805	5	with	with	IN
cord-014462-11ggaqf1	805	6	the	the	DT
cord-014462-11ggaqf1	805	7	virus	virus	NN
cord-014462-11ggaqf1	805	8	and	and	CC
cord-014462-11ggaqf1	805	9	the	the	DT
cord-014462-11ggaqf1	805	10	perfused	perfuse	VBN
cord-014462-11ggaqf1	805	11	brain	brain	NN
cord-014462-11ggaqf1	805	12	tissue	tissue	NN
cord-014462-11ggaqf1	805	13	was	be	VBD
cord-014462-11ggaqf1	805	14	used	use	VBN
cord-014462-11ggaqf1	805	15	to	to	TO
cord-014462-11ggaqf1	805	16	isolate	isolate	VB
cord-014462-11ggaqf1	805	17	the	the	DT
cord-014462-11ggaqf1	805	18	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	805	19	.	.	.
cord-014462-11ggaqf1	806	1	Control	control	NN
cord-014462-11ggaqf1	806	2	mice	mouse	NNS
cord-014462-11ggaqf1	806	3	were	be	VBD
cord-014462-11ggaqf1	806	4	inoculated	inoculate	VBN
cord-014462-11ggaqf1	806	5	with	with	IN
cord-014462-11ggaqf1	806	6	an	an	DT
cord-014462-11ggaqf1	806	7	equal	equal	JJ
cord-014462-11ggaqf1	806	8	amount	amount	NN
cord-014462-11ggaqf1	806	9	of	of	IN
cord-014462-11ggaqf1	806	10	media	medium	NNS
cord-014462-11ggaqf1	806	11	.	.	.
cord-014462-11ggaqf1	807	1	In	in	IN
cord-014462-11ggaqf1	807	2	order	order	NN
cord-014462-11ggaqf1	807	3	to	to	TO
cord-014462-11ggaqf1	807	4	standardize	standardize	VB
cord-014462-11ggaqf1	807	5	the	the	DT
cord-014462-11ggaqf1	807	6	procedure	procedure	NN
cord-014462-11ggaqf1	807	7	for	for	IN
cord-014462-11ggaqf1	807	8	isolation	isolation	NN
cord-014462-11ggaqf1	807	9	of	of	IN
cord-014462-11ggaqf1	807	10	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	807	11	from	from	IN
cord-014462-11ggaqf1	807	12	brain	brain	NN
cord-014462-11ggaqf1	807	13	tissue	tissue	NN
cord-014462-11ggaqf1	807	14	,	,	,
cord-014462-11ggaqf1	807	15	splenocytes	splenocytes	NNP
cord-014462-11ggaqf1	807	16	were	be	VBD
cord-014462-11ggaqf1	807	17	processed	process	VBN
cord-014462-11ggaqf1	807	18	to	to	TO
cord-014462-11ggaqf1	807	19	isolate	isolate	VB
cord-014462-11ggaqf1	807	20	the	the	DT
cord-014462-11ggaqf1	807	21	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	807	22	using	use	VBG
cord-014462-11ggaqf1	807	23	Histopaque	Histopaque	NNP
cord-014462-11ggaqf1	807	24	density	density	NN
cord-014462-11ggaqf1	807	25	gradient	gradient	NN
cord-014462-11ggaqf1	807	26	method	method	NN
cord-014462-11ggaqf1	807	27	.	.	.
cord-014462-11ggaqf1	808	1	Methods	method	NNS
cord-014462-11ggaqf1	808	2	to	to	TO
cord-014462-11ggaqf1	808	3	isolate	isolate	VB
cord-014462-11ggaqf1	808	4	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	808	5	from	from	IN
cord-014462-11ggaqf1	808	6	brain	brain	NN
cord-014462-11ggaqf1	808	7	tissue	tissue	NN
cord-014462-11ggaqf1	808	8	as	as	IN
cord-014462-11ggaqf1	808	9	described	describe	VBN
cord-014462-11ggaqf1	808	10	by	by	IN
cord-014462-11ggaqf1	808	11	earlier	early	JJR
cord-014462-11ggaqf1	808	12	workers	worker	NNS
cord-014462-11ggaqf1	808	13	were	be	VBD
cord-014462-11ggaqf1	808	14	tested	test	VBN
cord-014462-11ggaqf1	808	15	for	for	IN
cord-014462-11ggaqf1	808	16	the	the	DT
cord-014462-11ggaqf1	808	17	ease	ease	NN
cord-014462-11ggaqf1	808	18	and	and	CC
cord-014462-11ggaqf1	808	19	efficiency	efficiency	NN
cord-014462-11ggaqf1	808	20	of	of	IN
cord-014462-11ggaqf1	808	21	procedure	procedure	NN
cord-014462-11ggaqf1	808	22	using	use	VBG
cord-014462-11ggaqf1	808	23	known	know	VBN
cord-014462-11ggaqf1	808	24	suspension	suspension	NN
cord-014462-11ggaqf1	808	25	of	of	IN
cord-014462-11ggaqf1	808	26	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	808	27	from	from	IN
cord-014462-11ggaqf1	808	28	spleen	spleen	NNS
cord-014462-11ggaqf1	808	29	.	.	.
cord-014462-11ggaqf1	809	1	Percoll	Percoll	NNP
cord-014462-11ggaqf1	809	2	density	density	NN
cord-014462-11ggaqf1	809	3	gradient	gradient	NN
cord-014462-11ggaqf1	809	4	method	method	NN
cord-014462-11ggaqf1	809	5	provided	provide	VBN
cord-014462-11ggaqf1	809	6	optimum	optimum	JJ
cord-014462-11ggaqf1	809	7	yield	yield	NN
cord-014462-11ggaqf1	809	8	of	of	IN
cord-014462-11ggaqf1	809	9	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	809	10	with	with	IN
cord-014462-11ggaqf1	809	11	an	an	DT
cord-014462-11ggaqf1	809	12	ease	ease	NN
cord-014462-11ggaqf1	809	13	of	of	IN
cord-014462-11ggaqf1	809	14	handling	handling	NN
cord-014462-11ggaqf1	809	15	.	.	.
cord-014462-11ggaqf1	810	1	In	in	IN
cord-014462-11ggaqf1	810	2	this	this	DT
cord-014462-11ggaqf1	810	3	,	,	,
cord-014462-11ggaqf1	810	4	brain	brain	NN
cord-014462-11ggaqf1	810	5	cell	cell	NN
cord-014462-11ggaqf1	810	6	suspension	suspension	NN
cord-014462-11ggaqf1	810	7	used	use	VBN
cord-014462-11ggaqf1	810	8	to	to	TO
cord-014462-11ggaqf1	810	9	prepare	prepare	VB
cord-014462-11ggaqf1	810	10	30	30	CD
cord-014462-11ggaqf1	810	11	%	%	NN
cord-014462-11ggaqf1	810	12	Percoll	Percoll	NNP
cord-014462-11ggaqf1	810	13	is	be	VBZ
cord-014462-11ggaqf1	810	14	layered	layer	VBN
cord-014462-11ggaqf1	810	15	over	over	IN
cord-014462-11ggaqf1	810	16	70	70	CD
cord-014462-11ggaqf1	810	17	%	%	NN
cord-014462-11ggaqf1	810	18	Percoll	Percoll	NNP
cord-014462-11ggaqf1	810	19	prepared	prepare	VBD
cord-014462-11ggaqf1	810	20	using	use	VBG
cord-014462-11ggaqf1	810	21	media	medium	NNS
cord-014462-11ggaqf1	810	22	in	in	IN
cord-014462-11ggaqf1	810	23	1:2	1:2	CD
cord-014462-11ggaqf1	810	24	ratio	ratio	NN
cord-014462-11ggaqf1	810	25	.	.	.
cord-014462-11ggaqf1	811	1	Density	density	NN
cord-014462-11ggaqf1	811	2	gradient	gradient	NN
cord-014462-11ggaqf1	811	3	centrifugation	centrifugation	NN
cord-014462-11ggaqf1	811	4	is	be	VBZ
cord-014462-11ggaqf1	811	5	carried	carry	VBN
cord-014462-11ggaqf1	811	6	out	out	RP
cord-014462-11ggaqf1	811	7	at	at	IN
cord-014462-11ggaqf1	811	8	9009	9009	CD
cord-014462-11ggaqf1	811	9	g	g	NN
cord-014462-11ggaqf1	811	10	for	for	IN
cord-014462-11ggaqf1	811	11	20	20	CD
cord-014462-11ggaqf1	811	12	min	min	NN
cord-014462-11ggaqf1	811	13	at	at	IN
cord-014462-11ggaqf1	811	14	15	15	CD
cord-014462-11ggaqf1	811	15	°	°	NN
cord-014462-11ggaqf1	811	16	C	c	NN
cord-014462-11ggaqf1	811	17	to	to	TO
cord-014462-11ggaqf1	811	18	obtain	obtain	VB
cord-014462-11ggaqf1	811	19	lymphocyte	lymphocyte	NN
cord-014462-11ggaqf1	811	20	layer	layer	NN
cord-014462-11ggaqf1	811	21	at	at	IN
cord-014462-11ggaqf1	811	22	the	the	DT
cord-014462-11ggaqf1	811	23	interface	interface	NN
cord-014462-11ggaqf1	811	24	.	.	.
cord-014462-11ggaqf1	812	1	Leishman	Leishman	NNP
cord-014462-11ggaqf1	812	2	staining	staining	NN
cord-014462-11ggaqf1	812	3	was	be	VBD
cord-014462-11ggaqf1	812	4	performed	perform	VBN
cord-014462-11ggaqf1	812	5	to	to	TO
cord-014462-11ggaqf1	812	6	analyze	analyze	VB
cord-014462-11ggaqf1	812	7	the	the	DT
cord-014462-11ggaqf1	812	8	morphological	morphological	JJ
cord-014462-11ggaqf1	812	9	characteristics	characteristic	NNS
cord-014462-11ggaqf1	812	10	of	of	IN
cord-014462-11ggaqf1	812	11	isolated	isolate	VBN
cord-014462-11ggaqf1	812	12	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	812	13	.	.	.
cord-014462-11ggaqf1	813	1	Normal	normal	JJ
cord-014462-11ggaqf1	813	2	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	813	3	showed	show	VBD
cord-014462-11ggaqf1	813	4	dark	dark	JJ
cord-014462-11ggaqf1	813	5	blue	blue	JJ
cord-014462-11ggaqf1	813	6	stained	stain	VBN
cord-014462-11ggaqf1	813	7	nucleus	nucleus	NN
cord-014462-11ggaqf1	813	8	.	.	.
cord-014462-11ggaqf1	814	1	Some	some	DT
cord-014462-11ggaqf1	814	2	bigger	big	JJR
cord-014462-11ggaqf1	814	3	sized	sized	JJ
cord-014462-11ggaqf1	814	4	cells	cell	NNS
cord-014462-11ggaqf1	814	5	with	with	IN
cord-014462-11ggaqf1	814	6	diffused	diffuse	VBN
cord-014462-11ggaqf1	814	7	nucleus	nucleus	JJ
cord-014462-11ggaqf1	814	8	characteristic	characteristic	NN
cord-014462-11ggaqf1	814	9	of	of	IN
cord-014462-11ggaqf1	814	10	atypical	atypical	JJ
cord-014462-11ggaqf1	814	11	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	814	12	were	be	VBD
cord-014462-11ggaqf1	814	13	observed	observe	VBN
cord-014462-11ggaqf1	814	14	and	and	CC
cord-014462-11ggaqf1	814	15	some	some	DT
cord-014462-11ggaqf1	814	16	of	of	IN
cord-014462-11ggaqf1	814	17	the	the	DT
cord-014462-11ggaqf1	814	18	cells	cell	NNS
cord-014462-11ggaqf1	814	19	were	be	VBD
cord-014462-11ggaqf1	814	20	surrounded	surround	VBN
cord-014462-11ggaqf1	814	21	by	by	IN
cord-014462-11ggaqf1	814	22	hair	hair	NN
cord-014462-11ggaqf1	814	23	like	like	IN
cord-014462-11ggaqf1	814	24	structures	structure	NNS
cord-014462-11ggaqf1	814	25	.	.	.
cord-014462-11ggaqf1	815	1	Phenotypic	phenotypic	JJ
cord-014462-11ggaqf1	815	2	characterization	characterization	NN
cord-014462-11ggaqf1	815	3	was	be	VBD
cord-014462-11ggaqf1	815	4	carried	carry	VBN
cord-014462-11ggaqf1	815	5	out	out	RP
cord-014462-11ggaqf1	815	6	using	use	VBG
cord-014462-11ggaqf1	815	7	flow	flow	NN
cord-014462-11ggaqf1	815	8	cytometry	cytometry	NN
cord-014462-11ggaqf1	815	9	.	.	.
cord-014462-11ggaqf1	816	1	The	the	DT
cord-014462-11ggaqf1	816	2	presence	presence	NN
cord-014462-11ggaqf1	816	3	of	of	IN
cord-014462-11ggaqf1	816	4	CD4	CD4	NNP
cord-014462-11ggaqf1	816	5	+	+	CC
cord-014462-11ggaqf1	816	6	,	,	,
cord-014462-11ggaqf1	816	7	CD8	CD8	NNP
cord-014462-11ggaqf1	816	8	+	+	CC
cord-014462-11ggaqf1	816	9	and	and	CC
cord-014462-11ggaqf1	816	10	CD19	CD19	NNP
cord-014462-11ggaqf1	816	11	+	+	CC
cord-014462-11ggaqf1	816	12	cells	cell	NNS
cord-014462-11ggaqf1	816	13	was	be	VBD
cord-014462-11ggaqf1	816	14	observed	observe	VBN
cord-014462-11ggaqf1	816	15	.	.	.
cord-014462-11ggaqf1	817	1	The	the	DT
cord-014462-11ggaqf1	817	2	percentages	percentage	NNS
cord-014462-11ggaqf1	817	3	of	of	IN
cord-014462-11ggaqf1	817	4	CD8	CD8	NNP
cord-014462-11ggaqf1	817	5	+	+	CC
cord-014462-11ggaqf1	817	6	,	,	,
cord-014462-11ggaqf1	817	7	CD4	CD4	NNP
cord-014462-11ggaqf1	817	8	+	+	CC
cord-014462-11ggaqf1	817	9	and	and	CC
cord-014462-11ggaqf1	817	10	CD19	CD19	NNP
cord-014462-11ggaqf1	817	11	+	+	CC
cord-014462-11ggaqf1	817	12	cells	cell	NNS
cord-014462-11ggaqf1	817	13	was	be	VBD
cord-014462-11ggaqf1	817	14	found	find	VBN
cord-014462-11ggaqf1	817	15	to	to	TO
cord-014462-11ggaqf1	817	16	be	be	VB
cord-014462-11ggaqf1	817	17	7.60	7.60	CD
cord-014462-11ggaqf1	817	18	%	%	NN
cord-014462-11ggaqf1	817	19	,	,	,
cord-014462-11ggaqf1	817	20	35.14	35.14	CD
cord-014462-11ggaqf1	817	21	%	%	NN
cord-014462-11ggaqf1	817	22	and	and	CC
cord-014462-11ggaqf1	817	23	34.32	34.32	CD
cord-014462-11ggaqf1	817	24	%	%	NN
cord-014462-11ggaqf1	817	25	respectively	respectively	RB
cord-014462-11ggaqf1	817	26	in	in	IN
cord-014462-11ggaqf1	817	27	the	the	DT
cord-014462-11ggaqf1	817	28	lymphocytes	lymphocyte	NNS
cord-014462-11ggaqf1	817	29	isolated	isolate	VBN
cord-014462-11ggaqf1	817	30	from	from	IN
cord-014462-11ggaqf1	817	31	infected	infected	JJ
cord-014462-11ggaqf1	817	32	animal	animal	NN
cord-014462-11ggaqf1	817	33	and	and	CC
cord-014462-11ggaqf1	817	34	5.65	5.65	CD
cord-014462-11ggaqf1	817	35	%	%	NN
cord-014462-11ggaqf1	817	36	,	,	,
cord-014462-11ggaqf1	817	37	30.27	30.27	CD
cord-014462-11ggaqf1	817	38	%	%	NN
cord-014462-11ggaqf1	817	39	and	and	CC
cord-014462-11ggaqf1	817	40	3.13	3.13	CD
cord-014462-11ggaqf1	817	41	%	%	NN
cord-014462-11ggaqf1	817	42	respectively	respectively	RB
cord-014462-11ggaqf1	817	43	from	from	IN
cord-014462-11ggaqf1	817	44	control	control	NN
cord-014462-11ggaqf1	817	45	animal	animal	NN
cord-014462-11ggaqf1	817	46	.	.	.
cord-014462-11ggaqf1	818	1	Hence	hence	RB
cord-014462-11ggaqf1	818	2	,	,	,
cord-014462-11ggaqf1	818	3	CD19	CD19	NNP
cord-014462-11ggaqf1	818	4	+	+	CC
cord-014462-11ggaqf1	818	5	cells	cell	NNS
cord-014462-11ggaqf1	818	6	showed	show	VBD
cord-014462-11ggaqf1	818	7	maximum	maximum	JJ
cord-014462-11ggaqf1	818	8	infiltration	infiltration	NN
cord-014462-11ggaqf1	818	9	after	after	IN
cord-014462-11ggaqf1	818	10	infection	infection	NN
cord-014462-11ggaqf1	818	11	.	.	.
cord-014462-11ggaqf1	819	1	(	(	-LRB-
cord-014462-11ggaqf1	819	2	Santosh	Santosh	NNP
cord-014462-11ggaqf1	819	3	et	et	FW
cord-014462-11ggaqf1	819	4	al	al	NNP
cord-014462-11ggaqf1	819	5	.	.	.
cord-014462-11ggaqf1	820	1	2008	2008	CD
cord-014462-11ggaqf1	820	2	;	;	:
cord-014462-11ggaqf1	820	3	Pradeep	Pradeep	NNP
cord-014462-11ggaqf1	820	4	et	et	NNP
cord-014462-11ggaqf1	820	5	al	al	NNP
cord-014462-11ggaqf1	820	6	.	.	NNP
cord-014462-11ggaqf1	820	7	2008	2008	CD
cord-014462-11ggaqf1	820	8	)	)	-RRB-
cord-014462-11ggaqf1	820	9	.	.	.
cord-014462-11ggaqf1	821	1	In	in	IN
cord-014462-11ggaqf1	821	2	the	the	DT
cord-014462-11ggaqf1	821	3	Present	Present	NNP
cord-014462-11ggaqf1	821	4	study	study	NN
cord-014462-11ggaqf1	821	5	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	821	6	suspected	suspect	VBD
cord-014462-11ggaqf1	821	7	blood	blood	NN
cord-014462-11ggaqf1	821	8	samples	sample	NNS
cord-014462-11ggaqf1	821	9	were	be	VBD
cord-014462-11ggaqf1	821	10	collected	collect	VBN
cord-014462-11ggaqf1	821	11	and	and	CC
cord-014462-11ggaqf1	821	12	the	the	DT
cord-014462-11ggaqf1	821	13	acute	acute	JJ
cord-014462-11ggaqf1	821	14	phase	phase	NN
cord-014462-11ggaqf1	821	15	samples	sample	NNS
cord-014462-11ggaqf1	821	16	were	be	VBD
cord-014462-11ggaqf1	821	17	subjected	subject	VBN
cord-014462-11ggaqf1	821	18	to	to	IN
cord-014462-11ggaqf1	821	19	RT	RT	NNP
cord-014462-11ggaqf1	821	20	-	-	HYPH
cord-014462-11ggaqf1	821	21	PCR	PCR	NNP
cord-014462-11ggaqf1	821	22	for	for	IN
cord-014462-11ggaqf1	821	23	the	the	DT
cord-014462-11ggaqf1	821	24	presence	presence	NN
cord-014462-11ggaqf1	821	25	of	of	IN
cord-014462-11ggaqf1	821	26	virus	virus	NN
cord-014462-11ggaqf1	821	27	specific	specific	JJ
cord-014462-11ggaqf1	821	28	RNA	RNA	NNP
cord-014462-11ggaqf1	821	29	by	by	IN
cord-014462-11ggaqf1	821	30	using	use	VBG
cord-014462-11ggaqf1	821	31	the	the	DT
cord-014462-11ggaqf1	821	32	primer	primer	NN
cord-014462-11ggaqf1	821	33	pair	pair	NN
cord-014462-11ggaqf1	821	34	DVRChk	DVRChk	NNP
cord-014462-11ggaqf1	821	35	-	-	HYPH
cord-014462-11ggaqf1	821	36	F	F	NNP
cord-014462-11ggaqf1	821	37	/	/	SYM
cord-014462-11ggaqf1	821	38	DVRChk	DVRChk	NNP
cord-014462-11ggaqf1	821	39	-	-	HYPH
cord-014462-11ggaqf1	821	40	R	R	NNP
cord-014462-11ggaqf1	821	41	as	as	IN
cord-014462-11ggaqf1	821	42	described	describe	VBN
cord-014462-11ggaqf1	821	43	by	by	IN
cord-014462-11ggaqf1	821	44	us	-PRON-	PRP
cord-014462-11ggaqf1	821	45	earlier	early	RBR
cord-014462-11ggaqf1	822	1	(	(	-LRB-
cord-014462-11ggaqf1	822	2	Naresh	Naresh	NNP
cord-014462-11ggaqf1	822	3	Kumar	Kumar	NNP
cord-014462-11ggaqf1	822	4	et	et	NNP
cord-014462-11ggaqf1	822	5	al	al	NNP
cord-014462-11ggaqf1	822	6	.	.	NNP
cord-014462-11ggaqf1	822	7	2007	2007	CD
cord-014462-11ggaqf1	822	8	)	)	-RRB-
cord-014462-11ggaqf1	822	9	.	.	.
cord-014462-11ggaqf1	823	1	The	the	DT
cord-014462-11ggaqf1	823	2	convalescent	convalescent	JJ
cord-014462-11ggaqf1	823	3	phase	phase	NN
cord-014462-11ggaqf1	823	4	samples	sample	NNS
cord-014462-11ggaqf1	823	5	were	be	VBD
cord-014462-11ggaqf1	823	6	screened	screen	VBN
cord-014462-11ggaqf1	823	7	for	for	IN
cord-014462-11ggaqf1	823	8	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	823	9	specific	specific	JJ
cord-014462-11ggaqf1	823	10	antibodies	antibody	NNS
cord-014462-11ggaqf1	823	11	by	by	IN
cord-014462-11ggaqf1	823	12	using	use	VBG
cord-014462-11ggaqf1	823	13	SD	SD	NNP
cord-014462-11ggaqf1	823	14	Bioline	Bioline	NNP
cord-014462-11ggaqf1	823	15	Chikungunya	Chikungunya	NNP
cord-014462-11ggaqf1	823	16	IgM	igm	NN
cord-014462-11ggaqf1	823	17	rapid	rapid	JJ
cord-014462-11ggaqf1	823	18	test	test	NN
cord-014462-11ggaqf1	823	19	.	.	.
cord-014462-11ggaqf1	824	1	Six	six	CD
cord-014462-11ggaqf1	824	2	sets	set	NNS
cord-014462-11ggaqf1	824	3	of	of	IN
cord-014462-11ggaqf1	824	4	primers	primer	NNS
cord-014462-11ggaqf1	824	5	were	be	VBD
cord-014462-11ggaqf1	824	6	designed	design	VBN
cord-014462-11ggaqf1	824	7	to	to	TO
cord-014462-11ggaqf1	824	8	amplify	amplify	VB
cord-014462-11ggaqf1	824	9	the	the	DT
cord-014462-11ggaqf1	824	10	complete	complete	JJ
cord-014462-11ggaqf1	824	11	NSP4	NSP4	NNP
cord-014462-11ggaqf1	824	12	and	and	CC
cord-014462-11ggaqf1	824	13	Complete	complete	JJ
cord-014462-11ggaqf1	824	14	structural	structural	JJ
cord-014462-11ggaqf1	824	15	genes	gene	NNS
cord-014462-11ggaqf1	824	16	of	of	IN
cord-014462-11ggaqf1	824	17	Chikungunya	Chikungunya	NNP
cord-014462-11ggaqf1	824	18	virus	virus	NN
cord-014462-11ggaqf1	824	19	.	.	.
cord-014462-11ggaqf1	825	1	The	the	DT
cord-014462-11ggaqf1	825	2	products	product	NNS
cord-014462-11ggaqf1	825	3	were	be	VBD
cord-014462-11ggaqf1	825	4	further	further	JJ
cord-014462-11ggaqf1	825	5	gel	gel	NN
cord-014462-11ggaqf1	825	6	purified	purify	VBN
cord-014462-11ggaqf1	825	7	,	,	,
cord-014462-11ggaqf1	825	8	cloned	clone	VBN
cord-014462-11ggaqf1	825	9	in	in	IN
cord-014462-11ggaqf1	825	10	pTZ57R	pTZ57R	NNS
cord-014462-11ggaqf1	825	11	/	/	SYM
cord-014462-11ggaqf1	825	12	T	t	NN
cord-014462-11ggaqf1	825	13	vector	vector	NN
cord-014462-11ggaqf1	825	14	and	and	CC
cord-014462-11ggaqf1	825	15	the	the	DT
cord-014462-11ggaqf1	825	16	recombinant	recombinant	JJ
cord-014462-11ggaqf1	825	17	clones	clone	NNS
cord-014462-11ggaqf1	825	18	were	be	VBD
cord-014462-11ggaqf1	825	19	sequenced	sequence	VBN
cord-014462-11ggaqf1	825	20	and	and	CC
cord-014462-11ggaqf1	825	21	submitted	submit	VBN
cord-014462-11ggaqf1	825	22	to	to	IN
cord-014462-11ggaqf1	825	23	the	the	DT
cord-014462-11ggaqf1	825	24	Genbank	Genbank	NNP
cord-014462-11ggaqf1	825	25	.	.	.
cord-014462-11ggaqf1	826	1	The	the	DT
cord-014462-11ggaqf1	826	2	complete	complete	JJ
cord-014462-11ggaqf1	826	3	NS4gene	NS4gene	NNP
cord-014462-11ggaqf1	826	4	and	and	CC
cord-014462-11ggaqf1	826	5	Structural	structural	JJ
cord-014462-11ggaqf1	826	6	genes	gene	NNS
cord-014462-11ggaqf1	826	7	were	be	VBD
cord-014462-11ggaqf1	826	8	compared	compare	VBN
cord-014462-11ggaqf1	826	9	with	with	IN
cord-014462-11ggaqf1	826	10	other	other	JJ
cord-014462-11ggaqf1	826	11	available	available	JJ
cord-014462-11ggaqf1	826	12	sequences	sequence	NNS
cord-014462-11ggaqf1	826	13	in	in	IN
cord-014462-11ggaqf1	826	14	the	the	DT
cord-014462-11ggaqf1	826	15	Genbank	Genbank	NNP
cord-014462-11ggaqf1	826	16	.	.	.
cord-014462-11ggaqf1	827	1	Sequence	sequence	NN
cord-014462-11ggaqf1	827	2	analysis	analysis	NN
cord-014462-11ggaqf1	827	3	results	result	NNS
cord-014462-11ggaqf1	827	4	will	will	MD
cord-014462-11ggaqf1	827	5	be	be	VB
cord-014462-11ggaqf1	827	6	presented	present	VBN
cord-014462-11ggaqf1	827	7	.	.	.
cord-014462-11ggaqf1	828	1	The	the	DT
cord-014462-11ggaqf1	828	2	present	present	JJ
cord-014462-11ggaqf1	828	3	study	study	NN
cord-014462-11ggaqf1	828	4	discusses	discuss	VBZ
cord-014462-11ggaqf1	828	5	these	these	DT
cord-014462-11ggaqf1	828	6	aspects	aspect	NNS
cord-014462-11ggaqf1	828	7	in	in	IN
cord-014462-11ggaqf1	828	8	detail	detail	NN
cord-014462-11ggaqf1	828	9	.	.	.
cord-014462-11ggaqf1	828	10	.	.	.
cord-014462-11ggaqf1	829	1	Some	some	DT
cord-014462-11ggaqf1	829	2	of	of	IN
cord-014462-11ggaqf1	829	3	these	these	DT
cord-014462-11ggaqf1	829	4	phages	phage	NNS
cord-014462-11ggaqf1	829	5	(	(	-LRB-
cord-014462-11ggaqf1	829	6	viz	viz	NN
cord-014462-11ggaqf1	829	7	.	.	.
cord-014462-11ggaqf1	830	1	V953	V953	NNP
cord-014462-11ggaqf1	830	2	,	,	,
cord-014462-11ggaqf1	830	3	V954	V954	NNP
cord-014462-11ggaqf1	830	4	)	)	-RRB-
cord-014462-11ggaqf1	830	5	showed	show	VBD
cord-014462-11ggaqf1	830	6	plaques	plaque	NNS
cord-014462-11ggaqf1	830	7	at	at	IN
cord-014462-11ggaqf1	830	8	42	42	CD
cord-014462-11ggaqf1	830	9	°	°	NN
cord-014462-11ggaqf1	830	10	C	c	NN
cord-014462-11ggaqf1	830	11	but	but	CC
cord-014462-11ggaqf1	830	12	not	not	RB
cord-014462-11ggaqf1	830	13	at	at	IN
cord-014462-11ggaqf1	830	14	37	37	CD
cord-014462-11ggaqf1	830	15	°	°	NN
cord-014462-11ggaqf1	830	16	C	c	NN
cord-014462-11ggaqf1	830	17	.	.	.
cord-014462-11ggaqf1	831	1	Thus	thus	RB
cord-014462-11ggaqf1	831	2	they	-PRON-	PRP
cord-014462-11ggaqf1	831	3	seem	seem	VBP
cord-014462-11ggaqf1	831	4	to	to	TO
cord-014462-11ggaqf1	831	5	be	be	VB
cord-014462-11ggaqf1	831	6	lysogenic	lysogenic	JJ
cord-014462-11ggaqf1	831	7	.	.	.
cord-014462-11ggaqf1	832	1	For	for	IN
cord-014462-11ggaqf1	832	2	propagating	propagate	VBG
cord-014462-11ggaqf1	832	3	and	and	CC
cord-014462-11ggaqf1	832	4	increasing	increase	VBG
cord-014462-11ggaqf1	832	5	the	the	DT
cord-014462-11ggaqf1	832	6	titre	titre	NN
cord-014462-11ggaqf1	832	7	of	of	IN
cord-014462-11ggaqf1	832	8	all	all	PDT
cord-014462-11ggaqf1	832	9	the	the	DT
cord-014462-11ggaqf1	832	10	above	above	JJ
cord-014462-11ggaqf1	832	11	isolates	isolate	NNS
cord-014462-11ggaqf1	832	12	,	,	,
cord-014462-11ggaqf1	832	13	various	various	JJ
cord-014462-11ggaqf1	832	14	previously	previously	RB
cord-014462-11ggaqf1	832	15	described	describe	VBN
cord-014462-11ggaqf1	832	16	methods	method	NNS
cord-014462-11ggaqf1	832	17	were	be	VBD
cord-014462-11ggaqf1	832	18	attempted	attempt	VBN
cord-014462-11ggaqf1	832	19	,	,	,
cord-014462-11ggaqf1	832	20	but	but	CC
cord-014462-11ggaqf1	832	21	none	none	NN
cord-014462-11ggaqf1	832	22	of	of	IN
cord-014462-11ggaqf1	832	23	these	these	DT
cord-014462-11ggaqf1	832	24	methods	method	NNS
cord-014462-11ggaqf1	832	25	were	be	VBD
cord-014462-11ggaqf1	832	26	satisfactory	satisfactory	JJ
cord-014462-11ggaqf1	832	27	.	.	.
cord-014462-11ggaqf1	833	1	But	but	CC
cord-014462-11ggaqf1	833	2	when	when	WRB
cord-014462-11ggaqf1	833	3	siliconized	siliconized	NNP
cord-014462-11ggaqf1	833	4	glassware	glassware	NN
cord-014462-11ggaqf1	833	5	and	and	CC
cord-014462-11ggaqf1	833	6	plastic	plastic	NN
cord-014462-11ggaqf1	833	7	-	-	HYPH
cord-014462-11ggaqf1	833	8	ware	ware	NN
cord-014462-11ggaqf1	833	9	were	be	VBD
cord-014462-11ggaqf1	833	10	used	use	VBN
cord-014462-11ggaqf1	833	11	,	,	,
cord-014462-11ggaqf1	833	12	propagation	propagation	NN
cord-014462-11ggaqf1	833	13	was	be	VBD
cord-014462-11ggaqf1	833	14	successful	successful	JJ
cord-014462-11ggaqf1	833	15	.	.	.
cord-014462-11ggaqf1	834	1	We	-PRON-	PRP
cord-014462-11ggaqf1	834	2	showed	show	VBD
cord-014462-11ggaqf1	834	3	that	that	IN
cord-014462-11ggaqf1	834	4	siliconization	siliconization	NN
cord-014462-11ggaqf1	834	5	of	of	IN
cord-014462-11ggaqf1	834	6	glassware	glassware	NN
cord-014462-11ggaqf1	834	7	and	and	CC
cord-014462-11ggaqf1	834	8	plastic	plastic	NN
cord-014462-11ggaqf1	834	9	-	-	HYPH
cord-014462-11ggaqf1	834	10	ware	ware	NN
cord-014462-11ggaqf1	834	11	was	be	VBD
cord-014462-11ggaqf1	834	12	essential	essential	JJ
cord-014462-11ggaqf1	834	13	for	for	IN
cord-014462-11ggaqf1	834	14	the	the	DT
cord-014462-11ggaqf1	834	15	propagation	propagation	NN
cord-014462-11ggaqf1	834	16	of	of	IN
cord-014462-11ggaqf1	834	17	our	-PRON-	PRP$
cord-014462-11ggaqf1	834	18	mycobacteriophage	mycobacteriophage	NN
cord-014462-11ggaqf1	834	19	isolates	isolate	NNS
cord-014462-11ggaqf1	834	20	V951	V951	NNP
cord-014462-11ggaqf1	834	21	,	,	,
cord-014462-11ggaqf1	834	22	V952	V952	NNS
cord-014462-11ggaqf1	834	23	,	,	,
cord-014462-11ggaqf1	834	24	V953	V953	NNS
cord-014462-11ggaqf1	834	25	,	,	,
cord-014462-11ggaqf1	834	26	V954	V954	NNP
cord-014462-11ggaqf1	834	27	and	and	CC
cord-014462-11ggaqf1	834	28	V955	v955	NN
cord-014462-11ggaqf1	834	29	.	.	.
cord-014462-11ggaqf1	835	1	Also	also	RB
cord-014462-11ggaqf1	835	2	,	,	,
cord-014462-11ggaqf1	835	3	phage	phage	NN
cord-014462-11ggaqf1	835	4	dilution	dilution	NN
cord-014462-11ggaqf1	835	5	medium	medium	NN
cord-014462-11ggaqf1	835	6	(	(	-LRB-
cord-014462-11ggaqf1	835	7	PDM	PDM	NNP
cord-014462-11ggaqf1	835	8	)	)	-RRB-
cord-014462-11ggaqf1	835	9	as	as	IN
cord-014462-11ggaqf1	835	10	described	describe	VBN
cord-014462-11ggaqf1	835	11	by	by	IN
cord-014462-11ggaqf1	835	12	Chaterjee	Chaterjee	NNP
cord-014462-11ggaqf1	835	13	et	et	NNP
cord-014462-11ggaqf1	835	14	al	al	NNP
cord-014462-11ggaqf1	835	15	.	.	.
cord-014462-11ggaqf1	836	1	(	(	-LRB-
cord-014462-11ggaqf1	836	2	2000	2000	CD
cord-014462-11ggaqf1	836	3	)	)	-RRB-
cord-014462-11ggaqf1	836	4	was	be	VBD
cord-014462-11ggaqf1	836	5	found	find	VBN
cord-014462-11ggaqf1	836	6	to	to	TO
cord-014462-11ggaqf1	836	7	be	be	VB
cord-014462-11ggaqf1	836	8	effective	effective	JJ
cord-014462-11ggaqf1	836	9	for	for	IN
cord-014462-11ggaqf1	836	10	picking	pick	VBG
cord-014462-11ggaqf1	836	11	out	out	IN
cord-014462-11ggaqf1	836	12	of	of	IN
cord-014462-11ggaqf1	836	13	the	the	DT
cord-014462-11ggaqf1	836	14	plaques	plaque	NNS
cord-014462-11ggaqf1	836	15	made	make	VBN
cord-014462-11ggaqf1	836	16	by	by	IN
cord-014462-11ggaqf1	836	17	the	the	DT
cord-014462-11ggaqf1	836	18	phages	phage	NNS
cord-014462-11ggaqf1	836	19	.	.	.
cord-014462-11ggaqf1	837	1	In	in	IN
cord-014462-11ggaqf1	837	2	this	this	DT
cord-014462-11ggaqf1	837	3	way	way	NN
cord-014462-11ggaqf1	837	4	,	,	,
cord-014462-11ggaqf1	837	5	the	the	DT
cord-014462-11ggaqf1	837	6	phage	phage	NN
cord-014462-11ggaqf1	837	7	isolates	isolate	NNS
cord-014462-11ggaqf1	837	8	were	be	VBD
cord-014462-11ggaqf1	837	9	propagated	propagate	VBN
cord-014462-11ggaqf1	837	10	up	up	IN
cord-014462-11ggaqf1	837	11	to	to	IN
cord-014462-11ggaqf1	837	12	P	p	NN
cord-014462-11ggaqf1	837	13	3	3	CD
cord-014462-11ggaqf1	837	14	.	.	.
cord-014462-11ggaqf1	838	1	The	the	DT
cord-014462-11ggaqf1	838	2	various	various	JJ
cord-014462-11ggaqf1	838	3	passages	passage	NNS
cord-014462-11ggaqf1	838	4	of	of	IN
cord-014462-11ggaqf1	838	5	the	the	DT
cord-014462-11ggaqf1	838	6	phage	phage	NN
cord-014462-11ggaqf1	838	7	isolates	isolate	NNS
cord-014462-11ggaqf1	838	8	V951	V951	NNP
cord-014462-11ggaqf1	838	9	,	,	,
cord-014462-11ggaqf1	838	10	V952	V952	NNS
cord-014462-11ggaqf1	838	11	,	,	,
cord-014462-11ggaqf1	838	12	V953	V953	NNS
cord-014462-11ggaqf1	838	13	,	,	,
cord-014462-11ggaqf1	838	14	V954	V954	NNP
cord-014462-11ggaqf1	838	15	and	and	CC
cord-014462-11ggaqf1	838	16	V955	v955	NN
cord-014462-11ggaqf1	839	1	(	(	-LRB-
cord-014462-11ggaqf1	839	2	i.e.	i.e.	FW
cord-014462-11ggaqf1	839	3	original	original	JJ
cord-014462-11ggaqf1	839	4	,	,	,
cord-014462-11ggaqf1	839	5	P	p	NN
cord-014462-11ggaqf1	839	6	1	1	CD
cord-014462-11ggaqf1	839	7	,	,	,
cord-014462-11ggaqf1	839	8	P	p	NN
cord-014462-11ggaqf1	839	9	2	2	CD
cord-014462-11ggaqf1	839	10	and	and	CC
cord-014462-11ggaqf1	839	11	P	p	NN
cord-014462-11ggaqf1	839	12	3	3	CD
cord-014462-11ggaqf1	839	13	)	)	-RRB-
cord-014462-11ggaqf1	839	14	were	be	VBD
cord-014462-11ggaqf1	839	15	stored	store	VBN
cord-014462-11ggaqf1	839	16	at	at	IN
cord-014462-11ggaqf1	839	17	-80	-80	NNP
cord-014462-11ggaqf1	839	18	°	°	NN
cord-014462-11ggaqf1	839	19	C	C	NNP
cord-014462-11ggaqf1	839	20	.	.	.
cord-014462-11ggaqf1	840	1	The	the	DT
cord-014462-11ggaqf1	840	2	four	four	CD
cord-014462-11ggaqf1	840	3	major	major	JJ
cord-014462-11ggaqf1	840	4	routes	route	NNS
cord-014462-11ggaqf1	840	5	of	of	IN
cord-014462-11ggaqf1	840	6	transmission	transmission	NN
cord-014462-11ggaqf1	840	7	are	be	VBP
cord-014462-11ggaqf1	840	8	unsafe	unsafe	JJ
cord-014462-11ggaqf1	840	9	sex	sex	NN
cord-014462-11ggaqf1	840	10	,	,	,
cord-014462-11ggaqf1	840	11	contaminated	contaminated	JJ
cord-014462-11ggaqf1	840	12	needles	needle	NNS
cord-014462-11ggaqf1	840	13	,	,	,
cord-014462-11ggaqf1	840	14	transmission	transmission	NN
cord-014462-11ggaqf1	840	15	from	from	IN
cord-014462-11ggaqf1	840	16	an	an	DT
cord-014462-11ggaqf1	840	17	infected	infected	JJ
cord-014462-11ggaqf1	840	18	mother	mother	NN
cord-014462-11ggaqf1	840	19	to	to	IN
cord-014462-11ggaqf1	840	20	her	-PRON-	PRP$
cord-014462-11ggaqf1	840	21	baby	baby	NN
cord-014462-11ggaqf1	840	22	at	at	IN
cord-014462-11ggaqf1	840	23	birth	birth	NN
cord-014462-11ggaqf1	840	24	(	(	-LRB-
cord-014462-11ggaqf1	840	25	vertical	vertical	JJ
cord-014462-11ggaqf1	840	26	transmission	transmission	NN
cord-014462-11ggaqf1	840	27	)	)	-RRB-
cord-014462-11ggaqf1	840	28	and	and	CC
cord-014462-11ggaqf1	840	29	breast	breast	NN
cord-014462-11ggaqf1	840	30	milk	milk	NN
cord-014462-11ggaqf1	840	31	.	.	.
cord-014462-11ggaqf1	841	1	Screening	screening	NN
cord-014462-11ggaqf1	841	2	of	of	IN
cord-014462-11ggaqf1	841	3	blood	blood	NN
cord-014462-11ggaqf1	841	4	products	product	NNS
cord-014462-11ggaqf1	841	5	for	for	IN
cord-014462-11ggaqf1	841	6	HIV	HIV	NNP
cord-014462-11ggaqf1	841	7	has	have	VBZ
cord-014462-11ggaqf1	841	8	largely	largely	RB
cord-014462-11ggaqf1	841	9	eliminated	eliminate	VBN
cord-014462-11ggaqf1	841	10	transmission	transmission	NN
cord-014462-11ggaqf1	841	11	through	through	IN
cord-014462-11ggaqf1	841	12	blood	blood	NN
cord-014462-11ggaqf1	841	13	transfusions	transfusion	NNS
cord-014462-11ggaqf1	841	14	or	or	CC
cord-014462-11ggaqf1	841	15	infected	infected	JJ
cord-014462-11ggaqf1	841	16	blood	blood	NN
cord-014462-11ggaqf1	841	17	products	product	NNS
cord-014462-11ggaqf1	841	18	in	in	IN
cord-014462-11ggaqf1	841	19	the	the	DT
cord-014462-11ggaqf1	841	20	developed	develop	VBN
cord-014462-11ggaqf1	841	21	world	world	NN
cord-014462-11ggaqf1	841	22	.	.	.
cord-014462-11ggaqf1	842	1	In	in	IN
cord-014462-11ggaqf1	842	2	2008	2008	CD
cord-014462-11ggaqf1	842	3	,	,	,
cord-014462-11ggaqf1	842	4	globally	globally	RB
cord-014462-11ggaqf1	842	5	,	,	,
cord-014462-11ggaqf1	842	6	about	about	RB
cord-014462-11ggaqf1	842	7	2	2	CD
cord-014462-11ggaqf1	842	8	million	million	CD
cord-014462-11ggaqf1	842	9	people	people	NNS
cord-014462-11ggaqf1	842	10	died	die	VBD
cord-014462-11ggaqf1	842	11	of	of	IN
cord-014462-11ggaqf1	842	12	AIDS	AIDS	NNP
cord-014462-11ggaqf1	842	13	,	,	,
cord-014462-11ggaqf1	842	14	33.4	33.4	CD
cord-014462-11ggaqf1	842	15	million	million	CD
cord-014462-11ggaqf1	842	16	were	be	VBD
cord-014462-11ggaqf1	842	17	living	live	VBG
cord-014462-11ggaqf1	842	18	with	with	IN
cord-014462-11ggaqf1	842	19	HIV	HIV	NNP
cord-014462-11ggaqf1	842	20	and	and	CC
cord-014462-11ggaqf1	842	21	2.7	2.7	CD
cord-014462-11ggaqf1	842	22	million	million	CD
cord-014462-11ggaqf1	842	23	people	people	NNS
cord-014462-11ggaqf1	842	24	were	be	VBD
cord-014462-11ggaqf1	842	25	newly	newly	RB
cord-014462-11ggaqf1	842	26	infected	infect	VBN
cord-014462-11ggaqf1	842	27	with	with	IN
cord-014462-11ggaqf1	842	28	the	the	DT
cord-014462-11ggaqf1	842	29	virus	virus	NN
cord-014462-11ggaqf1	842	30	.	.	.
cord-014462-11ggaqf1	843	1	HIV	HIV	NNP
cord-014462-11ggaqf1	843	2	infections	infection	NNS
cord-014462-11ggaqf1	843	3	and	and	CC
cord-014462-11ggaqf1	843	4	AIDS	AIDS	NNP
cord-014462-11ggaqf1	843	5	deaths	death	NNS
cord-014462-11ggaqf1	843	6	are	be	VBP
cord-014462-11ggaqf1	843	7	unevenly	unevenly	RB
cord-014462-11ggaqf1	843	8	distributed	distribute	VBN
cord-014462-11ggaqf1	843	9	geographically	geographically	RB
cord-014462-11ggaqf1	843	10	and	and	CC
cord-014462-11ggaqf1	843	11	the	the	DT
cord-014462-11ggaqf1	843	12	nature	nature	NN
cord-014462-11ggaqf1	843	13	of	of	IN
cord-014462-11ggaqf1	843	14	the	the	DT
cord-014462-11ggaqf1	843	15	epidemics	epidemic	NNS
cord-014462-11ggaqf1	843	16	vary	vary	VBP
cord-014462-11ggaqf1	843	17	by	by	IN
cord-014462-11ggaqf1	843	18	region	region	NN
cord-014462-11ggaqf1	843	19	.	.	.
cord-014462-11ggaqf1	844	1	More	More	JJR
cord-014462-11ggaqf1	844	2	than	than	IN
cord-014462-11ggaqf1	844	3	90	90	CD
cord-014462-11ggaqf1	844	4	%	%	NN
cord-014462-11ggaqf1	844	5	of	of	IN
cord-014462-11ggaqf1	844	6	people	people	NNS
cord-014462-11ggaqf1	844	7	with	with	IN
cord-014462-11ggaqf1	844	8	HIV	HIV	NNP
cord-014462-11ggaqf1	844	9	are	be	VBP
cord-014462-11ggaqf1	844	10	living	live	VBG
cord-014462-11ggaqf1	844	11	in	in	IN
cord-014462-11ggaqf1	844	12	the	the	DT
cord-014462-11ggaqf1	844	13	developing	develop	VBG
cord-014462-11ggaqf1	844	14	world	world	NN
cord-014462-11ggaqf1	844	15	.	.	.
cord-014462-11ggaqf1	845	1	There	there	EX
cord-014462-11ggaqf1	845	2	is	be	VBZ
cord-014462-11ggaqf1	845	3	growing	grow	VBG
cord-014462-11ggaqf1	845	4	recognition	recognition	NN
cord-014462-11ggaqf1	845	5	that	that	IN
cord-014462-11ggaqf1	845	6	the	the	DT
cord-014462-11ggaqf1	845	7	virus	virus	NN
cord-014462-11ggaqf1	845	8	does	do	VBZ
cord-014462-11ggaqf1	845	9	not	not	RB
cord-014462-11ggaqf1	845	10	discriminate	discriminate	VB
cord-014462-11ggaqf1	845	11	by	by	IN
cord-014462-11ggaqf1	845	12	age	age	NN
cord-014462-11ggaqf1	845	13	,	,	,
cord-014462-11ggaqf1	845	14	race	race	NN
cord-014462-11ggaqf1	845	15	,	,	,
cord-014462-11ggaqf1	845	16	gender	gender	NN
cord-014462-11ggaqf1	845	17	,	,	,
cord-014462-11ggaqf1	845	18	ethnicity	ethnicity	NN
cord-014462-11ggaqf1	845	19	,	,	,
cord-014462-11ggaqf1	845	20	socioeconomic	socioeconomic	JJ
cord-014462-11ggaqf1	845	21	status-	status-	NN
cord-014462-11ggaqf1	846	1	everyone	everyone	NN
cord-014462-11ggaqf1	846	2	is	be	VBZ
cord-014462-11ggaqf1	846	3	susceptible	susceptible	JJ
cord-014462-11ggaqf1	846	4	.	.	.
cord-014462-11ggaqf1	847	1	However	however	RB
cord-014462-11ggaqf1	847	2	,	,	,
cord-014462-11ggaqf1	847	3	certain	certain	JJ
cord-014462-11ggaqf1	847	4	groups	group	NNS
cord-014462-11ggaqf1	847	5	are	be	VBP
cord-014462-11ggaqf1	847	6	at	at	IN
cord-014462-11ggaqf1	847	7	particular	particular	JJ
cord-014462-11ggaqf1	847	8	risk	risk	NN
cord-014462-11ggaqf1	847	9	of	of	IN
cord-014462-11ggaqf1	847	10	HIV	HIV	NNP
cord-014462-11ggaqf1	847	11	,	,	,
cord-014462-11ggaqf1	847	12	including	include	VBG
cord-014462-11ggaqf1	847	13	men	man	NNS
cord-014462-11ggaqf1	847	14	who	who	WP
cord-014462-11ggaqf1	847	15	have	have	VBP
cord-014462-11ggaqf1	847	16	sex	sex	NN
cord-014462-11ggaqf1	847	17	with	with	IN
cord-014462-11ggaqf1	847	18	men	man	NNS
cord-014462-11ggaqf1	847	19	(	(	-LRB-
cord-014462-11ggaqf1	847	20	MSM	MSM	NNP
cord-014462-11ggaqf1	847	21	)	)	-RRB-
cord-014462-11ggaqf1	847	22	,	,	,
cord-014462-11ggaqf1	847	23	injecting	inject	VBG
cord-014462-11ggaqf1	847	24	drug	drug	NN
cord-014462-11ggaqf1	847	25	users	user	NNS
cord-014462-11ggaqf1	847	26	(	(	-LRB-
cord-014462-11ggaqf1	847	27	IDUs	IDUs	NNP
cord-014462-11ggaqf1	847	28	)	)	-RRB-
cord-014462-11ggaqf1	847	29	,	,	,
cord-014462-11ggaqf1	847	30	and	and	CC
cord-014462-11ggaqf1	847	31	commercial	commercial	JJ
cord-014462-11ggaqf1	847	32	sex	sex	NN
cord-014462-11ggaqf1	847	33	workers	worker	NNS
cord-014462-11ggaqf1	847	34	(	(	-LRB-
cord-014462-11ggaqf1	847	35	CSWs	CSWs	NNP
cord-014462-11ggaqf1	847	36	)	)	-RRB-
cord-014462-11ggaqf1	847	37	.	.	.
cord-014462-11ggaqf1	848	1	The	the	DT
cord-014462-11ggaqf1	848	2	present	present	JJ
cord-014462-11ggaqf1	848	3	study	study	NN
cord-014462-11ggaqf1	848	4	indicates	indicate	VBZ
cord-014462-11ggaqf1	848	5	the	the	DT
cord-014462-11ggaqf1	848	6	prevalence	prevalence	NN
cord-014462-11ggaqf1	848	7	of	of	IN
cord-014462-11ggaqf1	848	8	HIV	HIV	NNP
cord-014462-11ggaqf1	848	9	infection	infection	NN
cord-014462-11ggaqf1	848	10	among	among	IN
cord-014462-11ggaqf1	848	11	the	the	DT
cord-014462-11ggaqf1	848	12	people	people	NNS
cord-014462-11ggaqf1	848	13	residing	reside	VBG
cord-014462-11ggaqf1	848	14	in	in	IN
cord-014462-11ggaqf1	848	15	the	the	DT
cord-014462-11ggaqf1	848	16	northern	northern	JJ
cord-014462-11ggaqf1	848	17	region	region	NN
cord-014462-11ggaqf1	848	18	of	of	IN
cord-014462-11ggaqf1	848	19	India	India	NNP
cord-014462-11ggaqf1	848	20	predominantly	predominantly	RB
cord-014462-11ggaqf1	848	21	among	among	IN
cord-014462-11ggaqf1	848	22	the	the	DT
cord-014462-11ggaqf1	848	23	foothills	foothill	NNS
cord-014462-11ggaqf1	848	24	of	of	IN
cord-014462-11ggaqf1	848	25	the	the	DT
cord-014462-11ggaqf1	848	26	Himalayas	Himalayas	NNP
cord-014462-11ggaqf1	848	27	.	.	.
cord-014462-11ggaqf1	849	1	The	the	DT
cord-014462-11ggaqf1	849	2	study	study	NN
cord-014462-11ggaqf1	849	3	was	be	VBD
cord-014462-11ggaqf1	849	4	carried	carry	VBN
cord-014462-11ggaqf1	849	5	out	out	RP
cord-014462-11ggaqf1	849	6	on	on	IN
cord-014462-11ggaqf1	849	7	the	the	DT
cord-014462-11ggaqf1	849	8	patients	patient	NNS
cord-014462-11ggaqf1	849	9	visiting	visit	VBG
cord-014462-11ggaqf1	849	10	Herbertpur	Herbertpur	NNP
cord-014462-11ggaqf1	849	11	Christian	Christian	NNP
cord-014462-11ggaqf1	849	12	Hospital	Hospital	NNP
cord-014462-11ggaqf1	849	13	(	(	-LRB-
cord-014462-11ggaqf1	849	14	A	a	DT
cord-014462-11ggaqf1	849	15	unit	unit	NN
cord-014462-11ggaqf1	849	16	of	of	IN
cord-014462-11ggaqf1	849	17	Emmanuel	Emmanuel	NNP
cord-014462-11ggaqf1	849	18	Hospital	Hospital	NNP
cord-014462-11ggaqf1	849	19	association	association	NN
cord-014462-11ggaqf1	849	20	)	)	-RRB-
cord-014462-11ggaqf1	849	21	under	under	IN
cord-014462-11ggaqf1	849	22	the	the	DT
cord-014462-11ggaqf1	849	23	integrated	integrate	VBN
cord-014462-11ggaqf1	849	24	counselling	counselling	NN
cord-014462-11ggaqf1	849	25	and	and	CC
cord-014462-11ggaqf1	849	26	testing	testing	NN
cord-014462-11ggaqf1	849	27	centre	centre	NN
cord-014462-11ggaqf1	849	28	scheme	scheme	NN
cord-014462-11ggaqf1	849	29	at	at	IN
cord-014462-11ggaqf1	849	30	the	the	DT
cord-014462-11ggaqf1	849	31	respective	respective	JJ
cord-014462-11ggaqf1	849	32	hospital	hospital	NN
cord-014462-11ggaqf1	849	33	during	during	IN
cord-014462-11ggaqf1	849	34	the	the	DT
cord-014462-11ggaqf1	849	35	2009	2009	CD
cord-014462-11ggaqf1	849	36	-	-	SYM
cord-014462-11ggaqf1	849	37	2010	2010	CD
cord-014462-11ggaqf1	849	38	.	.	.
cord-014462-11ggaqf1	850	1	The	the	DT
cord-014462-11ggaqf1	850	2	study	study	NN
cord-014462-11ggaqf1	850	3	indicates	indicate	VBZ
cord-014462-11ggaqf1	850	4	the	the	DT
cord-014462-11ggaqf1	850	5	screening	screening	NN
cord-014462-11ggaqf1	850	6	of	of	IN
cord-014462-11ggaqf1	850	7	people	people	NNS
cord-014462-11ggaqf1	850	8	groups	group	NNS
cord-014462-11ggaqf1	850	9	residing	reside	VBG
cord-014462-11ggaqf1	850	10	in	in	IN
cord-014462-11ggaqf1	850	11	the	the	DT
cord-014462-11ggaqf1	850	12	respective	respective	JJ
cord-014462-11ggaqf1	850	13	area	area	NN
cord-014462-11ggaqf1	850	14	through	through	IN
cord-014462-11ggaqf1	850	15	community	community	NN
cord-014462-11ggaqf1	850	16	health	health	NN
cord-014462-11ggaqf1	850	17	schemes	scheme	NNS
cord-014462-11ggaqf1	850	18	.	.	.
cord-014462-11ggaqf1	851	1	The	the	DT
cord-014462-11ggaqf1	851	2	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	851	3	of	of	IN
cord-014462-11ggaqf1	851	4	the	the	DT
cord-014462-11ggaqf1	851	5	HIV	HIV	NNP
cord-014462-11ggaqf1	851	6	infection	infection	NN
cord-014462-11ggaqf1	851	7	is	be	VBZ
cord-014462-11ggaqf1	851	8	done	do	VBN
cord-014462-11ggaqf1	851	9	by	by	IN
cord-014462-11ggaqf1	851	10	three	three	CD
cord-014462-11ggaqf1	851	11	types	type	NNS
cord-014462-11ggaqf1	851	12	of	of	IN
cord-014462-11ggaqf1	851	13	assays	assay	NNS
cord-014462-11ggaqf1	851	14	namely	namely	RB
cord-014462-11ggaqf1	851	15	.	.	.
cord-014462-11ggaqf1	852	1	The	the	DT
cord-014462-11ggaqf1	852	2	tridot	tridot	NN
cord-014462-11ggaqf1	852	3	method	method	NN
cord-014462-11ggaqf1	852	4	which	which	WDT
cord-014462-11ggaqf1	852	5	is	be	VBZ
cord-014462-11ggaqf1	852	6	the	the	DT
cord-014462-11ggaqf1	852	7	rapid	rapid	JJ
cord-014462-11ggaqf1	852	8	method	method	NN
cord-014462-11ggaqf1	852	9	of	of	IN
cord-014462-11ggaqf1	852	10	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	852	11	followed	follow	VBN
cord-014462-11ggaqf1	852	12	by	by	IN
cord-014462-11ggaqf1	852	13	the	the	DT
cord-014462-11ggaqf1	852	14	.	.	.
cord-014462-11ggaqf1	853	1	HIV	HIV	NNP
cord-014462-11ggaqf1	853	2	Coombs	Coombs	NNP
cord-014462-11ggaqf1	853	3	test	test	NN
cord-014462-11ggaqf1	853	4	which	which	WDT
cord-014462-11ggaqf1	853	5	involves	involve	VBZ
cord-014462-11ggaqf1	853	6	the	the	DT
cord-014462-11ggaqf1	853	7	DOT	DOT	NNP
cord-014462-11ggaqf1	853	8	immunoassay	immunoassay	NN
cord-014462-11ggaqf1	853	9	principle	principle	NN
cord-014462-11ggaqf1	853	10	.	.	.
cord-014462-11ggaqf1	854	1	The	the	DT
cord-014462-11ggaqf1	854	2	third	third	JJ
cord-014462-11ggaqf1	854	3	assay	assay	NN
cord-014462-11ggaqf1	854	4	is	be	VBZ
cord-014462-11ggaqf1	854	5	the	the	DT
cord-014462-11ggaqf1	854	6	enzyme	enzyme	NN
cord-014462-11ggaqf1	854	7	linked	link	VBN
cord-014462-11ggaqf1	854	8	immunosorbent	immunosorbent	JJ
cord-014462-11ggaqf1	854	9	assay	assay	NN
cord-014462-11ggaqf1	854	10	(	(	-LRB-
cord-014462-11ggaqf1	854	11	ELISA	ELISA	NNP
cord-014462-11ggaqf1	854	12	)	)	-RRB-
cord-014462-11ggaqf1	854	13	.	.	.
cord-014462-11ggaqf1	855	1	The	the	DT
cord-014462-11ggaqf1	855	2	number	number	NN
cord-014462-11ggaqf1	855	3	of	of	IN
cord-014462-11ggaqf1	855	4	patients	patient	NNS
cord-014462-11ggaqf1	855	5	screened	screen	VBN
cord-014462-11ggaqf1	855	6	during	during	IN
cord-014462-11ggaqf1	855	7	the	the	DT
cord-014462-11ggaqf1	855	8	period	period	NN
cord-014462-11ggaqf1	855	9	of	of	IN
cord-014462-11ggaqf1	855	10	September	September	NNP
cord-014462-11ggaqf1	855	11	2009	2009	CD
cord-014462-11ggaqf1	855	12	to	to	IN
cord-014462-11ggaqf1	855	13	March	March	NNP
cord-014462-11ggaqf1	855	14	2010	2010	CD
cord-014462-11ggaqf1	855	15	is	be	VBZ
cord-014462-11ggaqf1	855	16	635	635	CD
cord-014462-11ggaqf1	855	17	which	which	WDT
cord-014462-11ggaqf1	855	18	include	include	VBP
cord-014462-11ggaqf1	855	19	patients	patient	NNS
cord-014462-11ggaqf1	855	20	coming	come	VBG
cord-014462-11ggaqf1	855	21	from	from	IN
cord-014462-11ggaqf1	855	22	four	four	CD
cord-014462-11ggaqf1	855	23	different	different	JJ
cord-014462-11ggaqf1	855	24	states	state	NNS
cord-014462-11ggaqf1	855	25	namely	namely	RB
cord-014462-11ggaqf1	855	26	Haryana	Haryana	NNP
cord-014462-11ggaqf1	855	27	Uttarakhand	Uttarakhand	NNP
cord-014462-11ggaqf1	855	28	Uttarpradesh	Uttarpradesh	NNP
cord-014462-11ggaqf1	855	29	and	and	CC
cord-014462-11ggaqf1	855	30	Himachal	Himachal	NNP
cord-014462-11ggaqf1	855	31	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	855	32	.	.	.
cord-014462-11ggaqf1	856	1	The	the	DT
cord-014462-11ggaqf1	856	2	number	number	NN
cord-014462-11ggaqf1	856	3	of	of	IN
cord-014462-11ggaqf1	856	4	people	people	NNS
cord-014462-11ggaqf1	856	5	who	who	WP
cord-014462-11ggaqf1	856	6	were	be	VBD
cord-014462-11ggaqf1	856	7	tested	test	VBN
cord-014462-11ggaqf1	856	8	positive	positive	JJ
cord-014462-11ggaqf1	856	9	are	be	VBP
cord-014462-11ggaqf1	856	10	8	8	CD
cord-014462-11ggaqf1	856	11	and	and	CC
cord-014462-11ggaqf1	856	12	the	the	DT
cord-014462-11ggaqf1	856	13	number	number	NN
cord-014462-11ggaqf1	856	14	of	of	IN
cord-014462-11ggaqf1	856	15	people	people	NNS
cord-014462-11ggaqf1	856	16	who	who	WP
cord-014462-11ggaqf1	856	17	were	be	VBD
cord-014462-11ggaqf1	856	18	tested	test	VBN
cord-014462-11ggaqf1	856	19	negative	negative	JJ
cord-014462-11ggaqf1	856	20	are	be	VBP
cord-014462-11ggaqf1	856	21	627	627	CD
cord-014462-11ggaqf1	856	22	.	.	.
cord-014462-11ggaqf1	857	1	The	the	DT
cord-014462-11ggaqf1	857	2	people	people	NNS
cord-014462-11ggaqf1	857	3	tested	test	VBD
cord-014462-11ggaqf1	857	4	positive	positive	JJ
cord-014462-11ggaqf1	857	5	are	be	VBP
cord-014462-11ggaqf1	857	6	sent	send	VBN
cord-014462-11ggaqf1	857	7	to	to	IN
cord-014462-11ggaqf1	857	8	the	the	DT
cord-014462-11ggaqf1	857	9	higher	high	JJR
cord-014462-11ggaqf1	857	10	centre	centre	NN
cord-014462-11ggaqf1	857	11	for	for	IN
cord-014462-11ggaqf1	857	12	other	other	JJ
cord-014462-11ggaqf1	857	13	confirmatory	confirmatory	JJ
cord-014462-11ggaqf1	857	14	tests	test	NNS
cord-014462-11ggaqf1	857	15	such	such	JJ
cord-014462-11ggaqf1	857	16	as	as	IN
cord-014462-11ggaqf1	857	17	PCR	PCR	NNP
cord-014462-11ggaqf1	857	18	and	and	CC
cord-014462-11ggaqf1	857	19	western	western	JJ
cord-014462-11ggaqf1	857	20	blot	blot	NN
cord-014462-11ggaqf1	857	21	analysis	analysis	NN
cord-014462-11ggaqf1	857	22	.	.	.
cord-014462-11ggaqf1	858	1	These	these	DT
cord-014462-11ggaqf1	858	2	patients	patient	NNS
cord-014462-11ggaqf1	858	3	are	be	VBP
cord-014462-11ggaqf1	858	4	sent	send	VBN
cord-014462-11ggaqf1	858	5	for	for	IN
cord-014462-11ggaqf1	858	6	treatment	treatment	NN
cord-014462-11ggaqf1	858	7	and	and	CC
cord-014462-11ggaqf1	858	8	prophylaxis	prophylaxis	NN
cord-014462-11ggaqf1	858	9	at	at	IN
cord-014462-11ggaqf1	858	10	a	a	DT
cord-014462-11ggaqf1	858	11	respective	respective	JJ
cord-014462-11ggaqf1	858	12	recognised	recognise	VBN
cord-014462-11ggaqf1	858	13	centre	centre	NN
cord-014462-11ggaqf1	858	14	in	in	IN
cord-014462-11ggaqf1	858	15	Dehradun	Dehradun	NNP
cord-014462-11ggaqf1	858	16	.	.	.
cord-014462-11ggaqf1	859	1	The	the	DT
cord-014462-11ggaqf1	859	2	present	present	JJ
cord-014462-11ggaqf1	859	3	study	study	NN
cord-014462-11ggaqf1	859	4	determines	determine	VBZ
cord-014462-11ggaqf1	859	5	a	a	DT
cord-014462-11ggaqf1	859	6	consistent	consistent	JJ
cord-014462-11ggaqf1	859	7	community	community	NN
cord-014462-11ggaqf1	859	8	HIV	HIV	NNP
cord-014462-11ggaqf1	859	9	screening	screening	NN
cord-014462-11ggaqf1	859	10	and	and	CC
cord-014462-11ggaqf1	859	11	treatment	treatment	NN
cord-014462-11ggaqf1	859	12	approach	approach	NN
cord-014462-11ggaqf1	859	13	through	through	IN
cord-014462-11ggaqf1	859	14	diagnostics	diagnostic	NNS
cord-014462-11ggaqf1	859	15	counselling	counselling	NN
cord-014462-11ggaqf1	859	16	and	and	CC
cord-014462-11ggaqf1	859	17	awareness	awareness	NN
cord-014462-11ggaqf1	859	18	programmes	programme	NNS
cord-014462-11ggaqf1	859	19	.	.	.
cord-014462-11ggaqf1	860	1	Classical	classical	JJ
cord-014462-11ggaqf1	860	2	swine	swine	NN
cord-014462-11ggaqf1	860	3	fever	fever	NN
cord-014462-11ggaqf1	860	4	(	(	-LRB-
cord-014462-11ggaqf1	860	5	CSF	CSF	NNP
cord-014462-11ggaqf1	860	6	)	)	-RRB-
cord-014462-11ggaqf1	860	7	also	also	RB
cord-014462-11ggaqf1	860	8	known	know	VBN
cord-014462-11ggaqf1	860	9	as	as	IN
cord-014462-11ggaqf1	860	10	hog	hog	NN
cord-014462-11ggaqf1	860	11	cholera	cholera	NN
cord-014462-11ggaqf1	860	12	is	be	VBZ
cord-014462-11ggaqf1	860	13	a	a	DT
cord-014462-11ggaqf1	860	14	highly	highly	RB
cord-014462-11ggaqf1	860	15	contagious	contagious	JJ
cord-014462-11ggaqf1	860	16	and	and	CC
cord-014462-11ggaqf1	860	17	fatal	fatal	JJ
cord-014462-11ggaqf1	860	18	disease	disease	NN
cord-014462-11ggaqf1	860	19	of	of	IN
cord-014462-11ggaqf1	860	20	swine	swine	NN
cord-014462-11ggaqf1	860	21	.	.	.
cord-014462-11ggaqf1	861	1	CSF	CSF	NNP
cord-014462-11ggaqf1	861	2	became	become	VBD
cord-014462-11ggaqf1	861	3	rapidly	rapidly	RB
cord-014462-11ggaqf1	861	4	a	a	DT
cord-014462-11ggaqf1	861	5	major	major	JJ
cord-014462-11ggaqf1	861	6	issue	issue	NN
cord-014462-11ggaqf1	861	7	of	of	IN
cord-014462-11ggaqf1	861	8	pig	pig	NN
cord-014462-11ggaqf1	861	9	industries	industry	NNS
cord-014462-11ggaqf1	861	10	.	.	.
cord-014462-11ggaqf1	862	1	It	-PRON-	PRP
cord-014462-11ggaqf1	862	2	still	still	RB
cord-014462-11ggaqf1	862	3	causes	cause	VBZ
cord-014462-11ggaqf1	862	4	important	important	JJ
cord-014462-11ggaqf1	862	5	economical	economical	JJ
cord-014462-11ggaqf1	862	6	losses	loss	NNS
cord-014462-11ggaqf1	862	7	worldwide	worldwide	RB
cord-014462-11ggaqf1	862	8	.	.	.
cord-014462-11ggaqf1	863	1	It	-PRON-	PRP
cord-014462-11ggaqf1	863	2	is	be	VBZ
cord-014462-11ggaqf1	863	3	considered	consider	VBN
cord-014462-11ggaqf1	863	4	as	as	IN
cord-014462-11ggaqf1	863	5	a	a	DT
cord-014462-11ggaqf1	863	6	major	major	JJ
cord-014462-11ggaqf1	863	7	health	health	NN
cord-014462-11ggaqf1	863	8	problem	problem	NN
cord-014462-11ggaqf1	863	9	of	of	IN
cord-014462-11ggaqf1	863	10	swines	swine	NNS
cord-014462-11ggaqf1	863	11	in	in	IN
cord-014462-11ggaqf1	863	12	India	India	NNP
cord-014462-11ggaqf1	863	13	.	.	.
cord-014462-11ggaqf1	864	1	During	during	IN
cord-014462-11ggaqf1	864	2	the	the	DT
cord-014462-11ggaqf1	864	3	month	month	NN
cord-014462-11ggaqf1	864	4	of	of	IN
cord-014462-11ggaqf1	864	5	August	August	NNP
cord-014462-11ggaqf1	864	6	to	to	IN
cord-014462-11ggaqf1	864	7	October	October	NNP
cord-014462-11ggaqf1	864	8	2009	2009	CD
cord-014462-11ggaqf1	864	9	there	there	EX
cord-014462-11ggaqf1	864	10	was	be	VBD
cord-014462-11ggaqf1	864	11	an	an	DT
cord-014462-11ggaqf1	864	12	outbreak	outbreak	NN
cord-014462-11ggaqf1	864	13	of	of	IN
cord-014462-11ggaqf1	864	14	classical	classical	JJ
cord-014462-11ggaqf1	864	15	swine	swine	NN
cord-014462-11ggaqf1	864	16	fever	fever	NN
cord-014462-11ggaqf1	864	17	in	in	IN
cord-014462-11ggaqf1	864	18	Bihar	Bihar	NNP
cord-014462-11ggaqf1	864	19	.	.	.
cord-014462-11ggaqf1	865	1	From	from	IN
cord-014462-11ggaqf1	865	2	three	three	CD
cord-014462-11ggaqf1	865	3	districts	district	NNS
cord-014462-11ggaqf1	865	4	Darbhanga	Darbhanga	NNP
cord-014462-11ggaqf1	865	5	,	,	,
cord-014462-11ggaqf1	865	6	Patna	Patna	NNP
cord-014462-11ggaqf1	865	7	and	and	CC
cord-014462-11ggaqf1	865	8	Supol	Supol	NNP
cord-014462-11ggaqf1	865	9	,	,	,
cord-014462-11ggaqf1	865	10	total	total	JJ
cord-014462-11ggaqf1	865	11	36	36	CD
cord-014462-11ggaqf1	865	12	numbers	number	NNS
cord-014462-11ggaqf1	865	13	of	of	IN
cord-014462-11ggaqf1	865	14	different	different	JJ
cord-014462-11ggaqf1	865	15	infected	infect	VBN
cord-014462-11ggaqf1	865	16	tissue	tissue	NN
cord-014462-11ggaqf1	865	17	samples	sample	NNS
cord-014462-11ggaqf1	865	18	like	like	IN
cord-014462-11ggaqf1	865	19	kidney	kidney	NN
cord-014462-11ggaqf1	865	20	,	,	,
cord-014462-11ggaqf1	865	21	spleen	spleen	NN
cord-014462-11ggaqf1	865	22	and	and	CC
cord-014462-11ggaqf1	865	23	lymphnode	lymphnode	NNP
cord-014462-11ggaqf1	865	24	were	be	VBD
cord-014462-11ggaqf1	865	25	collected	collect	VBN
cord-014462-11ggaqf1	865	26	from	from	IN
cord-014462-11ggaqf1	865	27	the	the	DT
cord-014462-11ggaqf1	865	28	dead	dead	JJ
cord-014462-11ggaqf1	865	29	morbid	morbid	JJ
cord-014462-11ggaqf1	865	30	/	/	SYM
cord-014462-11ggaqf1	865	31	pigs	pig	NNS
cord-014462-11ggaqf1	865	32	.	.	.
cord-014462-11ggaqf1	866	1	Total	Total	NNP
cord-014462-11ggaqf1	866	2	RNA	RNA	NNP
cord-014462-11ggaqf1	866	3	was	be	VBD
cord-014462-11ggaqf1	866	4	isolated	isolate	VBN
cord-014462-11ggaqf1	866	5	from	from	IN
cord-014462-11ggaqf1	866	6	20	20	CD
cord-014462-11ggaqf1	866	7	%	%	NN
cord-014462-11ggaqf1	866	8	homogenate	homogenate	NN
cord-014462-11ggaqf1	866	9	of	of	IN
cord-014462-11ggaqf1	866	10	infected	infected	JJ
cord-014462-11ggaqf1	866	11	tissues	tissue	NNS
cord-014462-11ggaqf1	866	12	in	in	IN
cord-014462-11ggaqf1	866	13	sterile	sterile	JJ
cord-014462-11ggaqf1	866	14	PBS	PBS	NNP
cord-014462-11ggaqf1	866	15	by	by	IN
cord-014462-11ggaqf1	866	16	Tri	Tri	NNP
cord-014462-11ggaqf1	866	17	-	-	NN
cord-014462-11ggaqf1	866	18	reagent	reagent	NN
cord-014462-11ggaqf1	866	19	(	(	-LRB-
cord-014462-11ggaqf1	866	20	Sigma	Sigma	NNP
cord-014462-11ggaqf1	866	21	,	,	,
cord-014462-11ggaqf1	866	22	USA	USA	NNP
cord-014462-11ggaqf1	866	23	)	)	-RRB-
cord-014462-11ggaqf1	866	24	according	accord	VBG
cord-014462-11ggaqf1	866	25	to	to	IN
cord-014462-11ggaqf1	866	26	the	the	DT
cord-014462-11ggaqf1	866	27	manufacturer	manufacturer	NN
cord-014462-11ggaqf1	866	28	's	's	POS
cord-014462-11ggaqf1	866	29	instructions	instruction	NNS
cord-014462-11ggaqf1	866	30	and	and	CC
cord-014462-11ggaqf1	866	31	cDNA	cdna	NN
cord-014462-11ggaqf1	866	32	was	be	VBD
cord-014462-11ggaqf1	866	33	prepared	prepare	VBN
cord-014462-11ggaqf1	866	34	by	by	IN
cord-014462-11ggaqf1	866	35	using	use	VBG
cord-014462-11ggaqf1	866	36	commercial	commercial	JJ
cord-014462-11ggaqf1	866	37	available	available	JJ
cord-014462-11ggaqf1	866	38	kit	kit	NN
cord-014462-11ggaqf1	866	39	.	.	.
cord-014462-11ggaqf1	867	1	The	the	DT
cord-014462-11ggaqf1	867	2	cDNA	cdna	NN
cord-014462-11ggaqf1	867	3	was	be	VBD
cord-014462-11ggaqf1	867	4	stored	store	VBN
cord-014462-11ggaqf1	867	5	frozen	frozen	JJ
cord-014462-11ggaqf1	867	6	at	at	IN
cord-014462-11ggaqf1	867	7	-20	-20	NNP
cord-014462-11ggaqf1	867	8	°	°	NN
cord-014462-11ggaqf1	867	9	C	C	NNP
cord-014462-11ggaqf1	867	10	until	until	IN
cord-014462-11ggaqf1	867	11	used	use	VBN
cord-014462-11ggaqf1	867	12	.	.	.
cord-014462-11ggaqf1	868	1	For	for	IN
cord-014462-11ggaqf1	868	2	the	the	DT
cord-014462-11ggaqf1	868	3	molecular	molecular	JJ
cord-014462-11ggaqf1	868	4	detection	detection	NN
cord-014462-11ggaqf1	868	5	of	of	IN
cord-014462-11ggaqf1	868	6	classical	classical	JJ
cord-014462-11ggaqf1	868	7	swine	swine	NN
cord-014462-11ggaqf1	868	8	fever	fever	NN
cord-014462-11ggaqf1	868	9	virus	virus	NN
cord-014462-11ggaqf1	868	10	specific	specific	JJ
cord-014462-11ggaqf1	868	11	nested	nest	VBN
cord-014462-11ggaqf1	868	12	PCR	PCR	NNP
cord-014462-11ggaqf1	868	13	amplification	amplification	NN
cord-014462-11ggaqf1	868	14	of	of	IN
cord-014462-11ggaqf1	868	15	E2	E2	NNP
cord-014462-11ggaqf1	868	16	and	and	CC
cord-014462-11ggaqf1	868	17	5	5	CD
cord-014462-11ggaqf1	868	18	0	0	CD
cord-014462-11ggaqf1	868	19	NTR	NTR	NNP
cord-014462-11ggaqf1	868	20	was	be	VBD
cord-014462-11ggaqf1	868	21	done	do	VBN
cord-014462-11ggaqf1	868	22	along	along	RB
cord-014462-11ggaqf1	868	23	with	with	IN
cord-014462-11ggaqf1	868	24	NS5B	NS5B	NNP
cord-014462-11ggaqf1	868	25	and	and	CC
cord-014462-11ggaqf1	868	26	E	e	NN
cord-014462-11ggaqf1	868	27	rns	rns	NN
cord-014462-11ggaqf1	868	28	amplification	amplification	NN
cord-014462-11ggaqf1	868	29	.	.	.
cord-014462-11ggaqf1	869	1	Primarily	primarily	RB
cord-014462-11ggaqf1	869	2	these	these	DT
cord-014462-11ggaqf1	869	3	samples	sample	NNS
cord-014462-11ggaqf1	869	4	were	be	VBD
cord-014462-11ggaqf1	869	5	found	find	VBN
cord-014462-11ggaqf1	869	6	positive	positive	JJ
cord-014462-11ggaqf1	869	7	with	with	IN
cord-014462-11ggaqf1	869	8	these	these	DT
cord-014462-11ggaqf1	869	9	primers	primer	NNS
cord-014462-11ggaqf1	869	10	.	.	.
cord-014462-11ggaqf1	870	1	Further	further	JJ
cord-014462-11ggaqf1	870	2	confirmation	confirmation	NN
cord-014462-11ggaqf1	870	3	by	by	IN
cord-014462-11ggaqf1	870	4	sequencing	sequencing	NN
cord-014462-11ggaqf1	870	5	was	be	VBD
cord-014462-11ggaqf1	870	6	done	do	VBN
cord-014462-11ggaqf1	870	7	by	by	IN
cord-014462-11ggaqf1	870	8	cloning	clone	VBG
cord-014462-11ggaqf1	870	9	of	of	IN
cord-014462-11ggaqf1	870	10	these	these	DT
cord-014462-11ggaqf1	870	11	PCR	PCR	NNP
cord-014462-11ggaqf1	870	12	products	product	NNS
cord-014462-11ggaqf1	870	13	in	in	IN
cord-014462-11ggaqf1	870	14	pGEM	pGEM	NNP
cord-014462-11ggaqf1	870	15	-	-	HYPH
cord-014462-11ggaqf1	870	16	T	t	NN
cord-014462-11ggaqf1	870	17	easy	easy	JJ
cord-014462-11ggaqf1	870	18	vector	vector	NN
cord-014462-11ggaqf1	870	19	.	.	.
cord-014462-11ggaqf1	871	1	E2	E2	NNP
cord-014462-11ggaqf1	871	2	and	and	CC
cord-014462-11ggaqf1	871	3	5	5	CD
cord-014462-11ggaqf1	871	4	0	0	CD
cord-014462-11ggaqf1	871	5	NTR	NTR	NNP
cord-014462-11ggaqf1	871	6	sequences	sequence	NNS
cord-014462-11ggaqf1	871	7	were	be	VBD
cord-014462-11ggaqf1	871	8	considered	consider	VBN
cord-014462-11ggaqf1	871	9	for	for	IN
cord-014462-11ggaqf1	871	10	phylogentic	phylogentic	JJ
cord-014462-11ggaqf1	871	11	analysis	analysis	NN
cord-014462-11ggaqf1	871	12	along	along	IN
cord-014462-11ggaqf1	871	13	with	with	IN
cord-014462-11ggaqf1	871	14	20	20	CD
cord-014462-11ggaqf1	871	15	complete	complete	JJ
cord-014462-11ggaqf1	871	16	available	available	JJ
cord-014462-11ggaqf1	871	17	sequences	sequence	NNS
cord-014462-11ggaqf1	871	18	of	of	IN
cord-014462-11ggaqf1	871	19	CSFV	CSFV	NNP
cord-014462-11ggaqf1	871	20	.	.	.
cord-014462-11ggaqf1	872	1	Nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	872	2	sequence	sequence	NN
cord-014462-11ggaqf1	872	3	alignments	alignment	NNS
cord-014462-11ggaqf1	872	4	were	be	VBD
cord-014462-11ggaqf1	872	5	carried	carry	VBN
cord-014462-11ggaqf1	872	6	out	out	RP
cord-014462-11ggaqf1	872	7	using	use	VBG
cord-014462-11ggaqf1	872	8	the	the	DT
cord-014462-11ggaqf1	872	9	ClustalW	ClustalW	NNP
cord-014462-11ggaqf1	872	10	program	program	NN
cord-014462-11ggaqf1	872	11	(	(	-LRB-
cord-014462-11ggaqf1	872	12	DNASTAR	DNASTAR	NNP
cord-014462-11ggaqf1	872	13	)	)	-RRB-
cord-014462-11ggaqf1	872	14	and	and	CC
cord-014462-11ggaqf1	872	15	Phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	872	16	tree	tree	NN
cord-014462-11ggaqf1	872	17	analysis	analysis	NN
cord-014462-11ggaqf1	872	18	(	(	-LRB-
cord-014462-11ggaqf1	872	19	DNASTAR	DNASTAR	NNP
cord-014462-11ggaqf1	872	20	)	)	-RRB-
cord-014462-11ggaqf1	872	21	showed	show	VBD
cord-014462-11ggaqf1	872	22	that	that	IN
cord-014462-11ggaqf1	872	23	5	5	CD
cord-014462-11ggaqf1	872	24	0	0	CD
cord-014462-11ggaqf1	872	25	NTR	NTR	NNP
cord-014462-11ggaqf1	872	26	have	have	VBP
cord-014462-11ggaqf1	872	27	close	close	JJ
cord-014462-11ggaqf1	872	28	proximity	proximity	NN
cord-014462-11ggaqf1	872	29	with	with	IN
cord-014462-11ggaqf1	872	30	Taiwan	Taiwan	NNP
cord-014462-11ggaqf1	872	31	strain	strain	NN
cord-014462-11ggaqf1	872	32	(	(	-LRB-
cord-014462-11ggaqf1	873	1	Accession	Accession	NNP
cord-014462-11ggaqf1	873	2	No	no	NN
cord-014462-11ggaqf1	873	3	.	.	.
cord-014462-11ggaqf1	873	4	AY568569	AY568569	NNP
cord-014462-11ggaqf1	873	5	)	)	-RRB-
cord-014462-11ggaqf1	873	6	and	and	CC
cord-014462-11ggaqf1	873	7	E2	E2	NNP
cord-014462-11ggaqf1	873	8	shows	show	VBZ
cord-014462-11ggaqf1	873	9	close	close	JJ
cord-014462-11ggaqf1	873	10	proximity	proximity	NN
cord-014462-11ggaqf1	873	11	with	with	IN
cord-014462-11ggaqf1	873	12	Chinese	chinese	JJ
cord-014462-11ggaqf1	873	13	isolate	isolate	VBP
cord-014462-11ggaqf1	874	1	CSFV-39	CSFV-39	.
cord-014462-11ggaqf1	875	1	(	(	-LRB-
cord-014462-11ggaqf1	875	2	Accession	Accession	NNP
cord-014462-11ggaqf1	875	3	No	No	NNP
cord-014462-11ggaqf1	875	4	.	.	.
cord-014462-11ggaqf1	875	5	AF407339	AF407339	NNP
cord-014462-11ggaqf1	875	6	)	)	-RRB-
cord-014462-11ggaqf1	875	7	.	.	.
cord-014462-11ggaqf1	876	1	Peste	Peste	NNP
cord-014462-11ggaqf1	876	2	des	des	FW
cord-014462-11ggaqf1	876	3	petits	petit	NNS
cord-014462-11ggaqf1	876	4	ruminants	ruminant	NNS
cord-014462-11ggaqf1	876	5	(	(	-LRB-
cord-014462-11ggaqf1	876	6	PPR	PPR	NNP
cord-014462-11ggaqf1	876	7	)	)	-RRB-
cord-014462-11ggaqf1	876	8	and	and	CC
cord-014462-11ggaqf1	876	9	sheeppox	sheeppox	NNP
cord-014462-11ggaqf1	876	10	are	be	VBP
cord-014462-11ggaqf1	876	11	OIE	OIE	NNP
cord-014462-11ggaqf1	876	12	notifiable	notifiable	JJ
cord-014462-11ggaqf1	876	13	diseases	disease	NNS
cord-014462-11ggaqf1	876	14	of	of	IN
cord-014462-11ggaqf1	876	15	small	small	JJ
cord-014462-11ggaqf1	876	16	ruminants	ruminant	NNS
cord-014462-11ggaqf1	876	17	especially	especially	RB
cord-014462-11ggaqf1	876	18	sheep	sheep	NN
cord-014462-11ggaqf1	876	19	and	and	CC
cord-014462-11ggaqf1	876	20	goat	goat	NN
cord-014462-11ggaqf1	876	21	.	.	.
cord-014462-11ggaqf1	877	1	Both	both	DT
cord-014462-11ggaqf1	877	2	the	the	DT
cord-014462-11ggaqf1	877	3	diseases	disease	NNS
cord-014462-11ggaqf1	877	4	are	be	VBP
cord-014462-11ggaqf1	877	5	economically	economically	RB
cord-014462-11ggaqf1	877	6	important	important	JJ
cord-014462-11ggaqf1	877	7	,	,	,
cord-014462-11ggaqf1	877	8	in	in	IN
cord-014462-11ggaqf1	877	9	enzootic	enzootic	JJ
cord-014462-11ggaqf1	877	10	countries	country	NNS
cord-014462-11ggaqf1	877	11	like	like	IN
cord-014462-11ggaqf1	877	12	India	India	NNP
cord-014462-11ggaqf1	877	13	and	and	CC
cord-014462-11ggaqf1	877	14	are	be	VBP
cord-014462-11ggaqf1	877	15	major	major	JJ
cord-014462-11ggaqf1	877	16	constraints	constraint	NNS
cord-014462-11ggaqf1	877	17	in	in	IN
cord-014462-11ggaqf1	877	18	the	the	DT
cord-014462-11ggaqf1	877	19	productivity	productivity	NN
cord-014462-11ggaqf1	877	20	of	of	IN
cord-014462-11ggaqf1	877	21	animals	animal	NNS
cord-014462-11ggaqf1	877	22	.	.	.
cord-014462-11ggaqf1	878	1	Considering	consider	VBG
cord-014462-11ggaqf1	878	2	the	the	DT
cord-014462-11ggaqf1	878	3	geographical	geographical	JJ
cord-014462-11ggaqf1	878	4	distribution	distribution	NN
cord-014462-11ggaqf1	878	5	of	of	IN
cord-014462-11ggaqf1	878	6	both	both	CC
cord-014462-11ggaqf1	878	7	PPR	PPR	NNP
cord-014462-11ggaqf1	878	8	and	and	CC
cord-014462-11ggaqf1	878	9	sheep	sheep	NN
cord-014462-11ggaqf1	878	10	pox	pox	NN
cord-014462-11ggaqf1	878	11	infections	infection	NNS
cord-014462-11ggaqf1	878	12	and	and	CC
cord-014462-11ggaqf1	878	13	prevalence	prevalence	NN
cord-014462-11ggaqf1	878	14	of	of	IN
cord-014462-11ggaqf1	878	15	mixed	mixed	JJ
cord-014462-11ggaqf1	878	16	infection	infection	NN
cord-014462-11ggaqf1	878	17	,	,	,
cord-014462-11ggaqf1	878	18	in	in	IN
cord-014462-11ggaqf1	878	19	the	the	DT
cord-014462-11ggaqf1	878	20	present	present	JJ
cord-014462-11ggaqf1	878	21	study	study	NN
cord-014462-11ggaqf1	878	22	,	,	,
cord-014462-11ggaqf1	878	23	safety	safety	NN
cord-014462-11ggaqf1	878	24	and	and	CC
cord-014462-11ggaqf1	878	25	potency	potency	NN
cord-014462-11ggaqf1	878	26	of	of	IN
cord-014462-11ggaqf1	878	27	the	the	DT
cord-014462-11ggaqf1	878	28	experimental	experimental	JJ
cord-014462-11ggaqf1	878	29	duel	duel	NN
cord-014462-11ggaqf1	878	30	vaccine	vaccine	NN
cord-014462-11ggaqf1	878	31	comprising	comprise	VBG
cord-014462-11ggaqf1	878	32	attenuated	attenuated	JJ
cord-014462-11ggaqf1	878	33	strains	strain	NNS
cord-014462-11ggaqf1	878	34	of	of	IN
cord-014462-11ggaqf1	878	35	thermostable	thermostable	JJ
cord-014462-11ggaqf1	878	36	-	-	HYPH
cord-014462-11ggaqf1	878	37	PPR	ppr	NN
cord-014462-11ggaqf1	878	38	virus	virus	NN
cord-014462-11ggaqf1	878	39	(	(	-LRB-
cord-014462-11ggaqf1	878	40	PPRV	PPRV	NNP
cord-014462-11ggaqf1	878	41	-	-	HYPH
cord-014462-11ggaqf1	878	42	Revati	Revati	NNP
cord-014462-11ggaqf1	878	43	,	,	,
cord-014462-11ggaqf1	878	44	P-50	P-50	NNP
cord-014462-11ggaqf1	878	45	)	)	-RRB-
cord-014462-11ggaqf1	879	1	grown	grow	VBN
cord-014462-11ggaqf1	879	2	at	at	IN
cord-014462-11ggaqf1	879	3	40	40	CD
cord-014462-11ggaqf1	879	4	°	°	NN
cord-014462-11ggaqf1	879	5	C	c	NN
cord-014462-11ggaqf1	879	6	and	and	CC
cord-014462-11ggaqf1	879	7	attenuated	attenuated	JJ
cord-014462-11ggaqf1	879	8	sheep	sheep	NN
cord-014462-11ggaqf1	879	9	poxvirus	poxvirus	NNP
cord-014462-11ggaqf1	879	10	(	(	-LRB-
cord-014462-11ggaqf1	879	11	SPPV	SPPV	NNP
cord-014462-11ggaqf1	879	12	-	-	HYPH
cord-014462-11ggaqf1	879	13	Srinagar	Srinagar	NNP
cord-014462-11ggaqf1	879	14	,	,	,
cord-014462-11ggaqf1	879	15	P40	P40	NNP
cord-014462-11ggaqf1	879	16	)	)	-RRB-
cord-014462-11ggaqf1	879	17	was	be	VBD
cord-014462-11ggaqf1	879	18	evaluated	evaluate	VBN
cord-014462-11ggaqf1	879	19	in	in	IN
cord-014462-11ggaqf1	879	20	local	local	JJ
cord-014462-11ggaqf1	879	21	non	non	JJ
cord-014462-11ggaqf1	879	22	-	-	JJ
cord-014462-11ggaqf1	879	23	descript	descript	JJ
cord-014462-11ggaqf1	879	24	sheep	sheep	NNS
cord-014462-11ggaqf1	879	25	.	.	.
cord-014462-11ggaqf1	880	1	Experimental	experimental	JJ
cord-014462-11ggaqf1	880	2	animals	animal	NNS
cord-014462-11ggaqf1	880	3	were	be	VBD
cord-014462-11ggaqf1	880	4	grouped	group	VBN
cord-014462-11ggaqf1	880	5	into	into	IN
cord-014462-11ggaqf1	880	6	four	four	CD
cord-014462-11ggaqf1	880	7	groups	group	NNS
cord-014462-11ggaqf1	880	8	and	and	CC
cord-014462-11ggaqf1	880	9	each	each	DT
cord-014462-11ggaqf1	880	10	group	group	NN
cord-014462-11ggaqf1	880	11	was	be	VBD
cord-014462-11ggaqf1	880	12	comprising	comprise	VBG
cord-014462-11ggaqf1	880	13	six	six	CD
cord-014462-11ggaqf1	880	14	animals	animal	NNS
cord-014462-11ggaqf1	880	15	,	,	,
cord-014462-11ggaqf1	880	16	received	receive	VBD
cord-014462-11ggaqf1	880	17	100	100	CD
cord-014462-11ggaqf1	880	18	doses	dose	NNS
cord-014462-11ggaqf1	880	19	(	(	-LRB-
cord-014462-11ggaqf1	880	20	10	10	CD
cord-014462-11ggaqf1	880	21	5	5	CD
cord-014462-11ggaqf1	880	22	TCID	TCID	NNP
cord-014462-11ggaqf1	880	23	50	50	CD
cord-014462-11ggaqf1	880	24	)	)	-RRB-
cord-014462-11ggaqf1	880	25	,	,	,
cord-014462-11ggaqf1	880	26	1	1	CD
cord-014462-11ggaqf1	880	27	dose	dose	NN
cord-014462-11ggaqf1	880	28	(	(	-LRB-
cord-014462-11ggaqf1	880	29	10	10	CD
cord-014462-11ggaqf1	880	30	3	3	CD
cord-014462-11ggaqf1	880	31	TCID	TCID	NNP
cord-014462-11ggaqf1	880	32	50	50	CD
cord-014462-11ggaqf1	880	33	)	)	-RRB-
cord-014462-11ggaqf1	880	34	and	and	CC
cord-014462-11ggaqf1	880	35	1/10th	1/10th	CD
cord-014462-11ggaqf1	880	36	dose	dose	NN
cord-014462-11ggaqf1	880	37	of	of	IN
cord-014462-11ggaqf1	880	38	vaccines	vaccine	NNS
cord-014462-11ggaqf1	880	39	and	and	CC
cord-014462-11ggaqf1	880	40	normal	normal	JJ
cord-014462-11ggaqf1	880	41	saline	saline	NN
cord-014462-11ggaqf1	880	42	as	as	IN
cord-014462-11ggaqf1	880	43	control	control	NN
cord-014462-11ggaqf1	880	44	in	in	IN
cord-014462-11ggaqf1	880	45	1	1	CD
cord-014462-11ggaqf1	880	46	ml	ml	NN
cord-014462-11ggaqf1	880	47	volume	volume	NN
cord-014462-11ggaqf1	880	48	subcutaneously	subcutaneously	RB
cord-014462-11ggaqf1	880	49	,	,	,
cord-014462-11ggaqf1	880	50	respectively	respectively	RB
cord-014462-11ggaqf1	880	51	.	.	.
cord-014462-11ggaqf1	881	1	Serum	serum	NN
cord-014462-11ggaqf1	881	2	samples	sample	NNS
cord-014462-11ggaqf1	881	3	were	be	VBD
cord-014462-11ggaqf1	881	4	collected	collect	VBN
cord-014462-11ggaqf1	881	5	on	on	IN
cord-014462-11ggaqf1	881	6	0	0	CD
cord-014462-11ggaqf1	881	7	,	,	,
cord-014462-11ggaqf1	881	8	7	7	CD
cord-014462-11ggaqf1	881	9	,	,	,
cord-014462-11ggaqf1	881	10	14	14	CD
cord-014462-11ggaqf1	881	11	,	,	,
cord-014462-11ggaqf1	881	12	21	21	CD
cord-014462-11ggaqf1	881	13	and	and	CC
cord-014462-11ggaqf1	881	14	28th	28th	JJ
cord-014462-11ggaqf1	881	15	day	day	NN
cord-014462-11ggaqf1	881	16	post	post	NN
cord-014462-11ggaqf1	881	17	vaccination	vaccination	NN
cord-014462-11ggaqf1	881	18	.	.	.
cord-014462-11ggaqf1	882	1	Sheep	Sheep	NNS
cord-014462-11ggaqf1	882	2	simultaneously	simultaneously	RB
cord-014462-11ggaqf1	882	3	immunized	immunize	VBD
cord-014462-11ggaqf1	882	4	with	with	IN
cord-014462-11ggaqf1	882	5	1	1	CD
cord-014462-11ggaqf1	882	6	ml	ml	NNS
cord-014462-11ggaqf1	882	7	of	of	IN
cord-014462-11ggaqf1	882	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	882	9	consisting	consist	VBG
cord-014462-11ggaqf1	882	10	of	of	IN
cord-014462-11ggaqf1	882	11	either	either	DT
cord-014462-11ggaqf1	882	12	100	100	CD
cord-014462-11ggaqf1	882	13	or	or	CC
cord-014462-11ggaqf1	882	14	1	1	CD
cord-014462-11ggaqf1	882	15	doses	dose	NNS
cord-014462-11ggaqf1	882	16	of	of	IN
cord-014462-11ggaqf1	882	17	each	each	DT
cord-014462-11ggaqf1	882	18	of	of	IN
cord-014462-11ggaqf1	882	19	PPRV	PPRV	NNP
cord-014462-11ggaqf1	882	20	and	and	CC
cord-014462-11ggaqf1	882	21	SPPV	SPPV	NNP
cord-014462-11ggaqf1	882	22	were	be	VBD
cord-014462-11ggaqf1	882	23	monitored	monitor	VBN
cord-014462-11ggaqf1	882	24	for	for	IN
cord-014462-11ggaqf1	882	25	clinical	clinical	JJ
cord-014462-11ggaqf1	882	26	and	and	CC
cord-014462-11ggaqf1	882	27	serological	serological	JJ
cord-014462-11ggaqf1	882	28	responses	response	NNS
cord-014462-11ggaqf1	882	29	for	for	IN
cord-014462-11ggaqf1	882	30	a	a	DT
cord-014462-11ggaqf1	882	31	period	period	NN
cord-014462-11ggaqf1	882	32	of	of	IN
cord-014462-11ggaqf1	882	33	3	3	CD
cord-014462-11ggaqf1	882	34	-	-	SYM
cord-014462-11ggaqf1	882	35	4	4	CD
cord-014462-11ggaqf1	882	36	weeks	week	NNS
cord-014462-11ggaqf1	882	37	post	post	NN
cord-014462-11ggaqf1	882	38	-	-	NN
cord-014462-11ggaqf1	882	39	immunization	immunization	JJ
cord-014462-11ggaqf1	882	40	(	(	-LRB-
cord-014462-11ggaqf1	882	41	pi	pi	NNP
cord-014462-11ggaqf1	882	42	)	)	-RRB-
cord-014462-11ggaqf1	882	43	and	and	CC
cord-014462-11ggaqf1	882	44	post	post	NN
cord-014462-11ggaqf1	882	45	challenge	challenge	NN
cord-014462-11ggaqf1	882	46	(	(	-LRB-
cord-014462-11ggaqf1	882	47	pc	pc	NNP
cord-014462-11ggaqf1	882	48	)	)	-RRB-
cord-014462-11ggaqf1	882	49	.	.	.
cord-014462-11ggaqf1	883	1	Specific	specific	JJ
cord-014462-11ggaqf1	883	2	immune	immune	JJ
cord-014462-11ggaqf1	883	3	responses	response	NNS
cord-014462-11ggaqf1	883	4	i.e.	i.e.	FW
cord-014462-11ggaqf1	883	5	,	,	,
cord-014462-11ggaqf1	883	6	antibodies	antibody	NNS
cord-014462-11ggaqf1	883	7	directed	direct	VBN
cord-014462-11ggaqf1	883	8	to	to	IN
cord-014462-11ggaqf1	883	9	both	both	CC
cord-014462-11ggaqf1	883	10	PPRV	PPRV	NNP
cord-014462-11ggaqf1	883	11	and	and	CC
cord-014462-11ggaqf1	883	12	SPPV	SPPV	NNP
cord-014462-11ggaqf1	883	13	could	could	MD
cord-014462-11ggaqf1	883	14	be	be	VB
cord-014462-11ggaqf1	883	15	demonstrated	demonstrate	VBN
cord-014462-11ggaqf1	883	16	by	by	IN
cord-014462-11ggaqf1	883	17	PPR	PPR	NNP
cord-014462-11ggaqf1	883	18	competitive	competitive	JJ
cord-014462-11ggaqf1	883	19	ELISA	ELISA	NNP
cord-014462-11ggaqf1	883	20	kit	kit	NN
cord-014462-11ggaqf1	883	21	and	and	CC
cord-014462-11ggaqf1	883	22	capripox	capripox	VB
cord-014462-11ggaqf1	883	23	indirect	indirect	JJ
cord-014462-11ggaqf1	883	24	ELISA	ELISA	NNP
cord-014462-11ggaqf1	883	25	,	,	,
cord-014462-11ggaqf1	883	26	respectively	respectively	RB
cord-014462-11ggaqf1	883	27	following	follow	VBG
cord-014462-11ggaqf1	883	28	immunization	immunization	NN
cord-014462-11ggaqf1	883	29	.	.	.
cord-014462-11ggaqf1	884	1	All	all	PDT
cord-014462-11ggaqf1	884	2	the	the	DT
cord-014462-11ggaqf1	884	3	immunized	immunize	VBN
cord-014462-11ggaqf1	884	4	animals	animal	NNS
cord-014462-11ggaqf1	884	5	'	'	POS
cord-014462-11ggaqf1	884	6	resisted	resist	VBN
cord-014462-11ggaqf1	884	7	infection	infection	NN
cord-014462-11ggaqf1	884	8	when	when	WRB
cord-014462-11ggaqf1	884	9	challenged	challenge	VBN
cord-014462-11ggaqf1	884	10	with	with	IN
cord-014462-11ggaqf1	884	11	virulent	virulent	JJ
cord-014462-11ggaqf1	884	12	strain	strain	NN
cord-014462-11ggaqf1	884	13	of	of	IN
cord-014462-11ggaqf1	884	14	SPPV	SPPV	NNP
cord-014462-11ggaqf1	884	15	(	(	-LRB-
cord-014462-11ggaqf1	884	16	Srinagar	Srinagar	NNP
cord-014462-11ggaqf1	884	17	isolate	isolate	VBP
cord-014462-11ggaqf1	884	18	at	at	IN
cord-014462-11ggaqf1	884	19	P-6	P-6	NNP
cord-014462-11ggaqf1	884	20	)	)	-RRB-
cord-014462-11ggaqf1	884	21	on	on	IN
cord-014462-11ggaqf1	884	22	day	day	NN
cord-014462-11ggaqf1	884	23	28	28	CD
cord-014462-11ggaqf1	884	24	dpi	dpi	NN
cord-014462-11ggaqf1	884	25	,	,	,
cord-014462-11ggaqf1	884	26	while	while	IN
cord-014462-11ggaqf1	884	27	in	in	IN
cord-014462-11ggaqf1	884	28	contact	contact	NN
cord-014462-11ggaqf1	884	29	control	control	NN
cord-014462-11ggaqf1	884	30	animals	animal	NNS
cord-014462-11ggaqf1	884	31	developed	develop	VBD
cord-014462-11ggaqf1	884	32	characteristic	characteristic	JJ
cord-014462-11ggaqf1	884	33	signs	sign	NNS
cord-014462-11ggaqf1	884	34	of	of	IN
cord-014462-11ggaqf1	884	35	sheeppox	sheeppox	NNP
cord-014462-11ggaqf1	884	36	.	.	.
cord-014462-11ggaqf1	885	1	The	the	DT
cord-014462-11ggaqf1	885	2	challenge	challenge	NN
cord-014462-11ggaqf1	885	3	of	of	IN
cord-014462-11ggaqf1	885	4	the	the	DT
cord-014462-11ggaqf1	885	5	sheep	sheep	NN
cord-014462-11ggaqf1	885	6	against	against	IN
cord-014462-11ggaqf1	885	7	PPR	PPR	NNP
cord-014462-11ggaqf1	885	8	was	be	VBD
cord-014462-11ggaqf1	885	9	not	not	RB
cord-014462-11ggaqf1	885	10	carried	carry	VBN
cord-014462-11ggaqf1	885	11	out	out	RP
cord-014462-11ggaqf1	885	12	,	,	,
cord-014462-11ggaqf1	885	13	however	however	RB
cord-014462-11ggaqf1	885	14	,	,	,
cord-014462-11ggaqf1	885	15	the	the	DT
cord-014462-11ggaqf1	885	16	antibody	antibody	NN
cord-014462-11ggaqf1	885	17	titre	titre	NN
cord-014462-11ggaqf1	885	18	after	after	IN
cord-014462-11ggaqf1	885	19	immunization	immunization	NN
cord-014462-11ggaqf1	885	20	determined	determine	VBN
cord-014462-11ggaqf1	885	21	by	by	IN
cord-014462-11ggaqf1	885	22	SNT	SNT	NNP
cord-014462-11ggaqf1	885	23	and	and	CC
cord-014462-11ggaqf1	885	24	ELISA	ELISA	NNP
cord-014462-11ggaqf1	885	25	,	,	,
cord-014462-11ggaqf1	885	26	indicated	indicate	VBD
cord-014462-11ggaqf1	885	27	that	that	IN
cord-014462-11ggaqf1	885	28	protective	protective	JJ
cord-014462-11ggaqf1	885	29	titre	titre	NN
cord-014462-11ggaqf1	885	30	,	,	,
cord-014462-11ggaqf1	885	31	as	as	IN
cord-014462-11ggaqf1	885	32	per	per	IN
cord-014462-11ggaqf1	885	33	earlier	early	JJR
cord-014462-11ggaqf1	885	34	report	report	NN
cord-014462-11ggaqf1	885	35	on	on	IN
cord-014462-11ggaqf1	885	36	the	the	DT
cord-014462-11ggaqf1	885	37	goats	goat	NNS
cord-014462-11ggaqf1	885	38	.	.	.
cord-014462-11ggaqf1	886	1	Dual	dual	JJ
cord-014462-11ggaqf1	886	2	vaccine	vaccine	NN
cord-014462-11ggaqf1	886	3	was	be	VBD
cord-014462-11ggaqf1	886	4	found	find	VBN
cord-014462-11ggaqf1	886	5	safe	safe	JJ
cord-014462-11ggaqf1	886	6	at	at	IN
cord-014462-11ggaqf1	886	7	higher	high	JJR
cord-014462-11ggaqf1	886	8	dose	dose	NN
cord-014462-11ggaqf1	886	9	and	and	CC
cord-014462-11ggaqf1	886	10	induced	induce	VBN
cord-014462-11ggaqf1	886	11	protective	protective	JJ
cord-014462-11ggaqf1	886	12	immune	immune	JJ
cord-014462-11ggaqf1	886	13	response	response	NN
cord-014462-11ggaqf1	886	14	even	even	RB
cord-014462-11ggaqf1	886	15	at	at	IN
cord-014462-11ggaqf1	886	16	lower	low	JJR
cord-014462-11ggaqf1	886	17	dose	dose	NN
cord-014462-11ggaqf1	886	18	(	(	-LRB-
cord-014462-11ggaqf1	886	19	10	10	CD
cord-014462-11ggaqf1	886	20	2	2	CD
cord-014462-11ggaqf1	886	21	TCID	TCID	NNP
cord-014462-11ggaqf1	886	22	50	50	CD
cord-014462-11ggaqf1	886	23	)	)	-RRB-
cord-014462-11ggaqf1	886	24	in	in	IN
cord-014462-11ggaqf1	886	25	sheep	sheep	NN
cord-014462-11ggaqf1	886	26	,	,	,
cord-014462-11ggaqf1	886	27	which	which	WDT
cord-014462-11ggaqf1	886	28	was	be	VBD
cord-014462-11ggaqf1	886	29	evident	evident	JJ
cord-014462-11ggaqf1	886	30	from	from	IN
cord-014462-11ggaqf1	886	31	sero	sero	NN
cord-014462-11ggaqf1	886	32	-	-	HYPH
cord-014462-11ggaqf1	886	33	conversion	conversion	NN
cord-014462-11ggaqf1	886	34	as	as	RB
cord-014462-11ggaqf1	886	35	well	well	RB
cord-014462-11ggaqf1	886	36	as	as	IN
cord-014462-11ggaqf1	886	37	challenge	challenge	NN
cord-014462-11ggaqf1	886	38	study	study	NN
cord-014462-11ggaqf1	886	39	with	with	IN
cord-014462-11ggaqf1	886	40	SPPV	SPPV	NNP
cord-014462-11ggaqf1	886	41	.	.	.
cord-014462-11ggaqf1	887	1	The	the	DT
cord-014462-11ggaqf1	887	2	study	study	NN
cord-014462-11ggaqf1	887	3	indicated	indicate	VBD
cord-014462-11ggaqf1	887	4	that	that	IN
cord-014462-11ggaqf1	887	5	both	both	PDT
cord-014462-11ggaqf1	887	6	the	the	DT
cord-014462-11ggaqf1	887	7	viruses	virus	NNS
cord-014462-11ggaqf1	887	8	are	be	VBP
cord-014462-11ggaqf1	887	9	compatible	compatible	JJ
cord-014462-11ggaqf1	887	10	and	and	CC
cord-014462-11ggaqf1	887	11	did	do	VBD
cord-014462-11ggaqf1	887	12	not	not	RB
cord-014462-11ggaqf1	887	13	interfere	interfere	VB
cord-014462-11ggaqf1	887	14	with	with	IN
cord-014462-11ggaqf1	887	15	each	each	DT
cord-014462-11ggaqf1	887	16	other	other	JJ
cord-014462-11ggaqf1	887	17	in	in	IN
cord-014462-11ggaqf1	887	18	eliciting	elicit	VBG
cord-014462-11ggaqf1	887	19	immune	immune	JJ
cord-014462-11ggaqf1	887	20	response	response	NN
cord-014462-11ggaqf1	887	21	,	,	,
cord-014462-11ggaqf1	887	22	paving	pave	VBG
cord-014462-11ggaqf1	887	23	the	the	DT
cord-014462-11ggaqf1	887	24	feasibility	feasibility	NN
cord-014462-11ggaqf1	887	25	of	of	IN
cord-014462-11ggaqf1	887	26	use	use	NN
cord-014462-11ggaqf1	887	27	of	of	IN
cord-014462-11ggaqf1	887	28	this	this	DT
cord-014462-11ggaqf1	887	29	dual	dual	JJ
cord-014462-11ggaqf1	887	30	vaccine	vaccine	NN
cord-014462-11ggaqf1	887	31	in	in	IN
cord-014462-11ggaqf1	887	32	combating	combat	VBG
cord-014462-11ggaqf1	887	33	both	both	DT
cord-014462-11ggaqf1	887	34	infections	infection	NNS
cord-014462-11ggaqf1	887	35	simultaneously	simultaneously	RB
cord-014462-11ggaqf1	887	36	.	.	.
cord-014462-11ggaqf1	888	1	Goatpox	Goatpox	NNP
cord-014462-11ggaqf1	888	2	is	be	VBZ
cord-014462-11ggaqf1	888	3	one	one	CD
cord-014462-11ggaqf1	888	4	of	of	IN
cord-014462-11ggaqf1	888	5	the	the	DT
cord-014462-11ggaqf1	888	6	highly	highly	RB
cord-014462-11ggaqf1	888	7	contagious	contagious	JJ
cord-014462-11ggaqf1	888	8	,	,	,
cord-014462-11ggaqf1	888	9	OIE	OIE	NNP
cord-014462-11ggaqf1	888	10	notifiable	notifiable	NN
cord-014462-11ggaqf1	888	11	and	and	CC
cord-014462-11ggaqf1	888	12	economically	economically	RB
cord-014462-11ggaqf1	888	13	important	important	JJ
cord-014462-11ggaqf1	888	14	viral	viral	JJ
cord-014462-11ggaqf1	888	15	diseases	disease	NNS
cord-014462-11ggaqf1	888	16	of	of	IN
cord-014462-11ggaqf1	888	17	goats	goat	NNS
cord-014462-11ggaqf1	888	18	.	.	.
cord-014462-11ggaqf1	889	1	The	the	DT
cord-014462-11ggaqf1	889	2	disease	disease	NN
cord-014462-11ggaqf1	889	3	is	be	VBZ
cord-014462-11ggaqf1	889	4	caused	cause	VBN
cord-014462-11ggaqf1	889	5	by	by	IN
cord-014462-11ggaqf1	889	6	goatpox	goatpox	NN
cord-014462-11ggaqf1	889	7	virus	virus	NN
cord-014462-11ggaqf1	889	8	(	(	-LRB-
cord-014462-11ggaqf1	889	9	GTPV	GTPV	NNP
cord-014462-11ggaqf1	889	10	)	)	-RRB-
cord-014462-11ggaqf1	889	11	is	be	VBZ
cord-014462-11ggaqf1	889	12	classified	classify	VBN
cord-014462-11ggaqf1	889	13	of	of	IN
cord-014462-11ggaqf1	889	14	the	the	DT
cord-014462-11ggaqf1	889	15	genus	genus	JJ
cord-014462-11ggaqf1	889	16	Capripoxvirus	Capripoxvirus	NNP
cord-014462-11ggaqf1	889	17	in	in	IN
cord-014462-11ggaqf1	889	18	the	the	DT
cord-014462-11ggaqf1	889	19	family	family	NN
cord-014462-11ggaqf1	889	20	Poxviridae	Poxviridae	NNP
cord-014462-11ggaqf1	889	21	.	.	.
cord-014462-11ggaqf1	890	1	The	the	DT
cord-014462-11ggaqf1	890	2	disease	disease	NN
cord-014462-11ggaqf1	890	3	incurs	incur	VBZ
cord-014462-11ggaqf1	890	4	severe	severe	JJ
cord-014462-11ggaqf1	890	5	economic	economic	JJ
cord-014462-11ggaqf1	890	6	losses	loss	NNS
cord-014462-11ggaqf1	890	7	in	in	IN
cord-014462-11ggaqf1	890	8	terms	term	NNS
cord-014462-11ggaqf1	890	9	of	of	IN
cord-014462-11ggaqf1	890	10	high	high	JJ
cord-014462-11ggaqf1	890	11	morbidity	morbidity	NN
cord-014462-11ggaqf1	890	12	in	in	IN
cord-014462-11ggaqf1	890	13	adults	adult	NNS
cord-014462-11ggaqf1	890	14	and	and	CC
cord-014462-11ggaqf1	890	15	heavy	heavy	JJ
cord-014462-11ggaqf1	890	16	mortality	mortality	NN
cord-014462-11ggaqf1	890	17	in	in	IN
cord-014462-11ggaqf1	890	18	young	young	JJ
cord-014462-11ggaqf1	890	19	kids	kid	NNS
cord-014462-11ggaqf1	890	20	and	and	CC
cord-014462-11ggaqf1	890	21	is	be	VBZ
cord-014462-11ggaqf1	890	22	a	a	DT
cord-014462-11ggaqf1	890	23	major	major	JJ
cord-014462-11ggaqf1	890	24	constraint	constraint	NN
cord-014462-11ggaqf1	890	25	in	in	IN
cord-014462-11ggaqf1	890	26	goat	goat	NN
cord-014462-11ggaqf1	890	27	farming	farming	NN
cord-014462-11ggaqf1	890	28	in	in	IN
cord-014462-11ggaqf1	890	29	India	India	NNP
cord-014462-11ggaqf1	890	30	.	.	.
cord-014462-11ggaqf1	891	1	Considering	consider	VBG
cord-014462-11ggaqf1	891	2	the	the	DT
cord-014462-11ggaqf1	891	3	enzotic	enzotic	JJ
cord-014462-11ggaqf1	891	4	nature	nature	NN
cord-014462-11ggaqf1	891	5	and	and	CC
cord-014462-11ggaqf1	891	6	economic	economic	JJ
cord-014462-11ggaqf1	891	7	impact	impact	NN
cord-014462-11ggaqf1	891	8	of	of	IN
cord-014462-11ggaqf1	891	9	the	the	DT
cord-014462-11ggaqf1	891	10	disease	disease	NN
cord-014462-11ggaqf1	891	11	,	,	,
cord-014462-11ggaqf1	891	12	it	-PRON-	PRP
cord-014462-11ggaqf1	891	13	is	be	VBZ
cord-014462-11ggaqf1	891	14	all	all	RB
cord-014462-11ggaqf1	891	15	important	important	JJ
cord-014462-11ggaqf1	891	16	to	to	TO
cord-014462-11ggaqf1	891	17	control	control	VB
cord-014462-11ggaqf1	891	18	the	the	DT
cord-014462-11ggaqf1	891	19	infection	infection	NN
cord-014462-11ggaqf1	891	20	by	by	IN
cord-014462-11ggaqf1	891	21	developing	develop	VBG
cord-014462-11ggaqf1	891	22	an	an	DT
cord-014462-11ggaqf1	891	23	effective	effective	JJ
cord-014462-11ggaqf1	891	24	vaccine	vaccine	NN
cord-014462-11ggaqf1	891	25	.	.	.
cord-014462-11ggaqf1	892	1	Recently	recently	RB
cord-014462-11ggaqf1	892	2	,	,	,
cord-014462-11ggaqf1	892	3	Vero	Vero	NNP
cord-014462-11ggaqf1	892	4	cell	cell	NN
cord-014462-11ggaqf1	892	5	based	base	VBD
cord-014462-11ggaqf1	892	6	a	a	DT
cord-014462-11ggaqf1	892	7	live	live	JJ
cord-014462-11ggaqf1	892	8	attenuated	attenuated	JJ
cord-014462-11ggaqf1	892	9	goat	goat	NN
cord-014462-11ggaqf1	892	10	pox	pox	NN
cord-014462-11ggaqf1	892	11	vaccine	vaccine	NN
cord-014462-11ggaqf1	892	12	;	;	:
cord-014462-11ggaqf1	892	13	using	use	VBG
cord-014462-11ggaqf1	892	14	GTPV	GTPV	NNP
cord-014462-11ggaqf1	892	15	Uttarkashi	Uttarkashi	NNP
cord-014462-11ggaqf1	892	16	isolate	isolate	VB
cord-014462-11ggaqf1	892	17	(	(	-LRB-
cord-014462-11ggaqf1	892	18	P60	P60	NNP
cord-014462-11ggaqf1	892	19	)	)	-RRB-
cord-014462-11ggaqf1	892	20	has	have	VBZ
cord-014462-11ggaqf1	892	21	been	be	VBN
cord-014462-11ggaqf1	892	22	developed	develop	VBN
cord-014462-11ggaqf1	892	23	in	in	IN
cord-014462-11ggaqf1	892	24	authors	author	NNS
cord-014462-11ggaqf1	892	25	'	'	POS
cord-014462-11ggaqf1	892	26	laboratory	laboratory	NN
cord-014462-11ggaqf1	892	27	and	and	CC
cord-014462-11ggaqf1	892	28	evaluated	evaluate	VBN
cord-014462-11ggaqf1	892	29	in	in	IN
cord-014462-11ggaqf1	892	30	goats	goat	NNS
cord-014462-11ggaqf1	892	31	.	.	.
cord-014462-11ggaqf1	893	1	The	the	DT
cord-014462-11ggaqf1	893	2	vaccine	vaccine	NN
cord-014462-11ggaqf1	893	3	was	be	VBD
cord-014462-11ggaqf1	893	4	found	find	VBN
cord-014462-11ggaqf1	893	5	safe	safe	JJ
cord-014462-11ggaqf1	893	6	,	,	,
cord-014462-11ggaqf1	893	7	potent	potent	JJ
cord-014462-11ggaqf1	893	8	and	and	CC
cord-014462-11ggaqf1	893	9	immunogenic	immunogenic	JJ
cord-014462-11ggaqf1	893	10	experimentally	experimentally	RB
cord-014462-11ggaqf1	893	11	and	and	CC
cord-014462-11ggaqf1	893	12	even	even	RB
cord-014462-11ggaqf1	893	13	at	at	IN
cord-014462-11ggaqf1	893	14	field	field	NN
cord-014462-11ggaqf1	893	15	trials	trial	NNS
cord-014462-11ggaqf1	893	16	.	.	.
cord-014462-11ggaqf1	894	1	The	the	DT
cord-014462-11ggaqf1	894	2	vaccine	vaccine	NN
cord-014462-11ggaqf1	894	3	has	have	VBZ
cord-014462-11ggaqf1	894	4	been	be	VBN
cord-014462-11ggaqf1	894	5	evaluated	evaluate	VBN
cord-014462-11ggaqf1	894	6	at	at	IN
cord-014462-11ggaqf1	894	7	large	large	JJ
cord-014462-11ggaqf1	894	8	-	-	HYPH
cord-014462-11ggaqf1	894	9	scale	scale	NN
cord-014462-11ggaqf1	894	10	at	at	IN
cord-014462-11ggaqf1	894	11	different	different	JJ
cord-014462-11ggaqf1	894	12	regions	region	NNS
cord-014462-11ggaqf1	894	13	of	of	IN
cord-014462-11ggaqf1	894	14	the	the	DT
cord-014462-11ggaqf1	894	15	country	country	NN
cord-014462-11ggaqf1	894	16	and	and	CC
cord-014462-11ggaqf1	894	17	found	find	VBD
cord-014462-11ggaqf1	894	18	suitable	suitable	JJ
cord-014462-11ggaqf1	894	19	for	for	IN
cord-014462-11ggaqf1	894	20	mass	mass	JJ
cord-014462-11ggaqf1	894	21	vaccination	vaccination	NN
cord-014462-11ggaqf1	894	22	.	.	.
cord-014462-11ggaqf1	895	1	However	however	RB
cord-014462-11ggaqf1	895	2	,	,	,
cord-014462-11ggaqf1	895	3	the	the	DT
cord-014462-11ggaqf1	895	4	longevity	longevity	NN
cord-014462-11ggaqf1	895	5	of	of	IN
cord-014462-11ggaqf1	895	6	potency	potency	NN
cord-014462-11ggaqf1	895	7	was	be	VBD
cord-014462-11ggaqf1	895	8	not	not	RB
cord-014462-11ggaqf1	895	9	evaluated	evaluate	VBN
cord-014462-11ggaqf1	895	10	.	.	.
cord-014462-11ggaqf1	896	1	Therefore	therefore	RB
cord-014462-11ggaqf1	896	2	,	,	,
cord-014462-11ggaqf1	896	3	a	a	DT
cord-014462-11ggaqf1	896	4	long	long	JJ
cord-014462-11ggaqf1	896	5	term	term	NN
cord-014462-11ggaqf1	896	6	potency	potency	NN
cord-014462-11ggaqf1	896	7	trials	trial	NNS
cord-014462-11ggaqf1	896	8	were	be	VBD
cord-014462-11ggaqf1	896	9	studied	study	VBN
cord-014462-11ggaqf1	896	10	for	for	IN
cord-014462-11ggaqf1	896	11	a	a	DT
cord-014462-11ggaqf1	896	12	period	period	NN
cord-014462-11ggaqf1	896	13	of	of	IN
cord-014462-11ggaqf1	896	14	4	4	CD
cord-014462-11ggaqf1	896	15	years	year	NNS
cord-014462-11ggaqf1	896	16	with	with	IN
cord-014462-11ggaqf1	896	17	annual	annual	JJ
cord-014462-11ggaqf1	896	18	challenge	challenge	NN
cord-014462-11ggaqf1	896	19	by	by	IN
cord-014462-11ggaqf1	896	20	using	use	VBG
cord-014462-11ggaqf1	896	21	virulent	virulent	JJ
cord-014462-11ggaqf1	896	22	goatpox	goatpox	NNP
cord-014462-11ggaqf1	896	23	virus	virus	NN
cord-014462-11ggaqf1	896	24	and	and	CC
cord-014462-11ggaqf1	896	25	sero	sero	NN
cord-014462-11ggaqf1	896	26	-	-	HYPH
cord-014462-11ggaqf1	896	27	monitoring	monitoring	NN
cord-014462-11ggaqf1	896	28	.	.	.
cord-014462-11ggaqf1	897	1	A	a	DT
cord-014462-11ggaqf1	897	2	sufficient	sufficient	JJ
cord-014462-11ggaqf1	897	3	number	number	NN
cord-014462-11ggaqf1	897	4	of	of	IN
cord-014462-11ggaqf1	897	5	hill	hill	NN
cord-014462-11ggaqf1	897	6	goats	goat	NNS
cord-014462-11ggaqf1	897	7	has	have	VBZ
cord-014462-11ggaqf1	897	8	been	be	VBN
cord-014462-11ggaqf1	897	9	vaccinated	vaccinate	VBN
cord-014462-11ggaqf1	897	10	with	with	IN
cord-014462-11ggaqf1	897	11	1	1	CD
cord-014462-11ggaqf1	897	12	dose	dose	NN
cord-014462-11ggaqf1	897	13	of	of	IN
cord-014462-11ggaqf1	897	14	vaccine	vaccine	NN
cord-014462-11ggaqf1	897	15	(	(	-LRB-
cord-014462-11ggaqf1	897	16	10	10	CD
cord-014462-11ggaqf1	897	17	2.5	2.5	CD
cord-014462-11ggaqf1	897	18	TCID	TCID	NNP
cord-014462-11ggaqf1	897	19	50	50	CD
cord-014462-11ggaqf1	897	20	/ml	/ml	.
cord-014462-11ggaqf1	897	21	)	)	-RRB-
cord-014462-11ggaqf1	897	22	and	and	CC
cord-014462-11ggaqf1	897	23	monitored	monitor	VBN
cord-014462-11ggaqf1	897	24	for	for	IN
cord-014462-11ggaqf1	897	25	clinical	clinical	JJ
cord-014462-11ggaqf1	897	26	and	and	CC
cord-014462-11ggaqf1	897	27	serological	serological	JJ
cord-014462-11ggaqf1	897	28	response	response	NN
cord-014462-11ggaqf1	897	29	.	.	.
cord-014462-11ggaqf1	898	1	Every	every	DT
cord-014462-11ggaqf1	898	2	year	year	NN
cord-014462-11ggaqf1	898	3	,	,	,
cord-014462-11ggaqf1	898	4	significant	significant	JJ
cord-014462-11ggaqf1	898	5	number	number	NN
cord-014462-11ggaqf1	898	6	of	of	IN
cord-014462-11ggaqf1	898	7	vaccinated	vaccinated	JJ
cord-014462-11ggaqf1	898	8	(	(	-LRB-
cord-014462-11ggaqf1	898	9	n	n	NN
cord-014462-11ggaqf1	898	10	=	=	SYM
cord-014462-11ggaqf1	898	11	5	5	CD
cord-014462-11ggaqf1	898	12	)	)	-RRB-
cord-014462-11ggaqf1	898	13	and	and	CC
cord-014462-11ggaqf1	898	14	control	control	NN
cord-014462-11ggaqf1	898	15	animals	animal	NNS
cord-014462-11ggaqf1	898	16	(	(	-LRB-
cord-014462-11ggaqf1	898	17	n	n	NN
cord-014462-11ggaqf1	898	18	=	=	SYM
cord-014462-11ggaqf1	898	19	2	2	CD
cord-014462-11ggaqf1	898	20	)	)	-RRB-
cord-014462-11ggaqf1	898	21	were	be	VBD
cord-014462-11ggaqf1	898	22	used	use	VBN
cord-014462-11ggaqf1	898	23	for	for	IN
cord-014462-11ggaqf1	898	24	challenge	challenge	NN
cord-014462-11ggaqf1	898	25	with	with	IN
cord-014462-11ggaqf1	898	26	virulent	virulent	JJ
cord-014462-11ggaqf1	898	27	strain	strain	NN
cord-014462-11ggaqf1	898	28	(	(	-LRB-
cord-014462-11ggaqf1	899	1	2	2	CD
cord-014462-11ggaqf1	899	2	9	9	CD
cord-014462-11ggaqf1	899	3	10	10	CD
cord-014462-11ggaqf1	899	4	7.0	7.0	CD
cord-014462-11ggaqf1	899	5	SRD	SRD	NNP
cord-014462-11ggaqf1	899	6	50	50	CD
cord-014462-11ggaqf1	899	7	/ml	/ml	NFP
cord-014462-11ggaqf1	899	8	,	,	,
cord-014462-11ggaqf1	899	9	GTPV	GTPV	NNP
cord-014462-11ggaqf1	899	10	Mukteswar	Mukteswar	NNP
cord-014462-11ggaqf1	899	11	)	)	-RRB-
cord-014462-11ggaqf1	899	12	.	.	.
cord-014462-11ggaqf1	900	1	Sera	Sera	NNP
cord-014462-11ggaqf1	900	2	of	of	IN
cord-014462-11ggaqf1	900	3	pre	pre	JJ
cord-014462-11ggaqf1	900	4	-	-	JJ
cord-014462-11ggaqf1	900	5	and	and	CC
cord-014462-11ggaqf1	900	6	post	post	VB
cord-014462-11ggaqf1	900	7	-	-	JJ
cord-014462-11ggaqf1	900	8	challenged	challenge	VBN
cord-014462-11ggaqf1	900	9	(	(	-LRB-
cord-014462-11ggaqf1	900	10	14	14	CD
cord-014462-11ggaqf1	900	11	dpc	dpc	NNS
cord-014462-11ggaqf1	900	12	)	)	-RRB-
cord-014462-11ggaqf1	900	13	animals	animal	NNS
cord-014462-11ggaqf1	900	14	including	include	VBG
cord-014462-11ggaqf1	900	15	controls	control	NNS
cord-014462-11ggaqf1	900	16	have	have	VBP
cord-014462-11ggaqf1	900	17	been	be	VBN
cord-014462-11ggaqf1	900	18	collected	collect	VBN
cord-014462-11ggaqf1	900	19	and	and	CC
cord-014462-11ggaqf1	900	20	monitored	monitor	VBN
cord-014462-11ggaqf1	900	21	for	for	IN
cord-014462-11ggaqf1	900	22	serological	serological	JJ
cord-014462-11ggaqf1	900	23	response	response	NN
cord-014462-11ggaqf1	900	24	in	in	IN
cord-014462-11ggaqf1	900	25	the	the	DT
cord-014462-11ggaqf1	900	26	form	form	NN
cord-014462-11ggaqf1	900	27	of	of	IN
cord-014462-11ggaqf1	900	28	specific	specific	JJ
cord-014462-11ggaqf1	900	29	antibody	antibody	NN
cord-014462-11ggaqf1	900	30	production	production	NN
cord-014462-11ggaqf1	900	31	by	by	IN
cord-014462-11ggaqf1	900	32	SNT	SNT	NNP
cord-014462-11ggaqf1	900	33	and	and	CC
cord-014462-11ggaqf1	900	34	indirect	indirect	JJ
cord-014462-11ggaqf1	900	35	ELISA	ELISA	NNP
cord-014462-11ggaqf1	900	36	.	.	.
cord-014462-11ggaqf1	901	1	All	all	PDT
cord-014462-11ggaqf1	901	2	the	the	DT
cord-014462-11ggaqf1	901	3	vaccinated	vaccinate	VBN
cord-014462-11ggaqf1	901	4	animals	animal	NNS
cord-014462-11ggaqf1	901	5	were	be	VBD
cord-014462-11ggaqf1	901	6	protected	protect	VBN
cord-014462-11ggaqf1	901	7	on	on	IN
cord-014462-11ggaqf1	901	8	challenge	challenge	NN
cord-014462-11ggaqf1	901	9	,	,	,
cord-014462-11ggaqf1	901	10	whereas	whereas	RB
cord-014462-11ggaqf1	901	11	,	,	,
cord-014462-11ggaqf1	901	12	all	all	DT
cord-014462-11ggaqf1	901	13	unvaccinated	unvaccinated	JJ
cord-014462-11ggaqf1	901	14	controls	control	NNS
cord-014462-11ggaqf1	901	15	developed	develop	VBD
cord-014462-11ggaqf1	901	16	infections	infection	NNS
cord-014462-11ggaqf1	901	17	.	.	.
cord-014462-11ggaqf1	902	1	The	the	DT
cord-014462-11ggaqf1	902	2	same	same	JJ
cord-014462-11ggaqf1	902	3	has	have	VBZ
cord-014462-11ggaqf1	902	4	been	be	VBN
cord-014462-11ggaqf1	902	5	reflected	reflect	VBN
cord-014462-11ggaqf1	902	6	in	in	IN
cord-014462-11ggaqf1	902	7	sero	sero	NNP
cord-014462-11ggaqf1	902	8	monitoring	monitoring	NN
cord-014462-11ggaqf1	902	9	of	of	IN
cord-014462-11ggaqf1	902	10	collected	collect	VBN
cord-014462-11ggaqf1	902	11	sera	sera	NNP
cord-014462-11ggaqf1	902	12	.	.	.
cord-014462-11ggaqf1	903	1	So	so	RB
cord-014462-11ggaqf1	903	2	the	the	DT
cord-014462-11ggaqf1	903	3	developed	develop	VBN
cord-014462-11ggaqf1	903	4	live	live	JJ
cord-014462-11ggaqf1	903	5	attenuated	attenuated	JJ
cord-014462-11ggaqf1	903	6	goat	goat	NNP
cord-014462-11ggaqf1	903	7	pox	pox	NN
cord-014462-11ggaqf1	903	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	903	9	was	be	VBD
cord-014462-11ggaqf1	903	10	found	find	VBN
cord-014462-11ggaqf1	903	11	safe	safe	JJ
cord-014462-11ggaqf1	903	12	,	,	,
cord-014462-11ggaqf1	903	13	immunogenic	immunogenic	JJ
cord-014462-11ggaqf1	903	14	and	and	CC
cord-014462-11ggaqf1	903	15	potent	potent	JJ
cord-014462-11ggaqf1	903	16	for	for	IN
cord-014462-11ggaqf1	903	17	a	a	DT
cord-014462-11ggaqf1	903	18	period	period	NN
cord-014462-11ggaqf1	903	19	of	of	IN
cord-014462-11ggaqf1	903	20	4	4	CD
cord-014462-11ggaqf1	903	21	years	year	NNS
cord-014462-11ggaqf1	903	22	of	of	IN
cord-014462-11ggaqf1	903	23	immunization	immunization	NN
cord-014462-11ggaqf1	903	24	and	and	CC
cord-014462-11ggaqf1	903	25	suitable	suitable	JJ
cord-014462-11ggaqf1	903	26	for	for	IN
cord-014462-11ggaqf1	903	27	mass	mass	JJ
cord-014462-11ggaqf1	903	28	scale	scale	NN
cord-014462-11ggaqf1	903	29	vaccination	vaccination	NN
cord-014462-11ggaqf1	903	30	in	in	IN
cord-014462-11ggaqf1	903	31	control	control	NN
cord-014462-11ggaqf1	903	32	and	and	CC
cord-014462-11ggaqf1	903	33	eradication	eradication	NN
cord-014462-11ggaqf1	903	34	of	of	IN
cord-014462-11ggaqf1	903	35	goat	goat	NN
cord-014462-11ggaqf1	903	36	pox	pox	NN
cord-014462-11ggaqf1	903	37	along	along	IN
cord-014462-11ggaqf1	903	38	with	with	IN
cord-014462-11ggaqf1	903	39	a	a	DT
cord-014462-11ggaqf1	903	40	/	/	,
cord-014462-11ggaqf1	903	41	are	be	VBP
cord-014462-11ggaqf1	903	42	suitable	suitable	JJ
cord-014462-11ggaqf1	903	43	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	903	44	tool	tool	NN
cord-014462-11ggaqf1	903	45	/	/	SYM
cord-014462-11ggaqf1	903	46	s	s	NN
cord-014462-11ggaqf1	903	47	in	in	IN
cord-014462-11ggaqf1	903	48	goatpox	goatpox	NNP
cord-014462-11ggaqf1	903	49	enzootic	enzootic	JJ
cord-014462-11ggaqf1	903	50	country	country	NN
cord-014462-11ggaqf1	903	51	like	like	IN
cord-014462-11ggaqf1	903	52	India	India	NNP
cord-014462-11ggaqf1	903	53	.	.	.
cord-014462-11ggaqf1	904	1	Rotavirus	rotavirus	NN
cord-014462-11ggaqf1	904	2	infection	infection	NN
cord-014462-11ggaqf1	904	3	in	in	IN
cord-014462-11ggaqf1	904	4	avian	avian	JJ
cord-014462-11ggaqf1	904	5	species	species	NN
cord-014462-11ggaqf1	904	6	varies	vary	VBZ
cord-014462-11ggaqf1	904	7	from	from	IN
cord-014462-11ggaqf1	904	8	subclinical	subclinical	JJ
cord-014462-11ggaqf1	904	9	infections	infection	NNS
cord-014462-11ggaqf1	904	10	to	to	IN
cord-014462-11ggaqf1	904	11	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	904	12	of	of	IN
cord-014462-11ggaqf1	904	13	diarrhea	diarrhea	NN
cord-014462-11ggaqf1	904	14	.	.	.
cord-014462-11ggaqf1	905	1	The	the	DT
cord-014462-11ggaqf1	905	2	economic	economic	JJ
cord-014462-11ggaqf1	905	3	significance	significance	NN
cord-014462-11ggaqf1	905	4	of	of	IN
cord-014462-11ggaqf1	905	5	rotaviral	rotaviral	JJ
cord-014462-11ggaqf1	905	6	enteritis	enteritis	NN
cord-014462-11ggaqf1	905	7	to	to	IN
cord-014462-11ggaqf1	905	8	the	the	DT
cord-014462-11ggaqf1	905	9	poultry	poultry	NN
cord-014462-11ggaqf1	905	10	industry	industry	NN
cord-014462-11ggaqf1	905	11	has	have	VBZ
cord-014462-11ggaqf1	905	12	not	not	RB
cord-014462-11ggaqf1	905	13	yet	yet	RB
cord-014462-11ggaqf1	905	14	been	be	VBN
cord-014462-11ggaqf1	905	15	defined	define	VBN
cord-014462-11ggaqf1	905	16	,	,	,
cord-014462-11ggaqf1	905	17	but	but	CC
cord-014462-11ggaqf1	905	18	by	by	IN
cord-014462-11ggaqf1	905	19	analogy	analogy	NN
cord-014462-11ggaqf1	905	20	to	to	IN
cord-014462-11ggaqf1	905	21	the	the	DT
cord-014462-11ggaqf1	905	22	situation	situation	NN
cord-014462-11ggaqf1	905	23	in	in	IN
cord-014462-11ggaqf1	905	24	mammals	mammal	NNS
cord-014462-11ggaqf1	905	25	,	,	,
cord-014462-11ggaqf1	905	26	it	-PRON-	PRP
cord-014462-11ggaqf1	905	27	is	be	VBZ
cord-014462-11ggaqf1	905	28	likely	likely	JJ
cord-014462-11ggaqf1	905	29	to	to	TO
cord-014462-11ggaqf1	905	30	be	be	VB
cord-014462-11ggaqf1	905	31	significant	significant	JJ
cord-014462-11ggaqf1	905	32	.	.	.
cord-014462-11ggaqf1	906	1	Unlike	unlike	IN
cord-014462-11ggaqf1	906	2	the	the	DT
cord-014462-11ggaqf1	906	3	extensive	extensive	JJ
cord-014462-11ggaqf1	906	4	studies	study	NNS
cord-014462-11ggaqf1	906	5	performed	perform	VBN
cord-014462-11ggaqf1	906	6	on	on	IN
cord-014462-11ggaqf1	906	7	rotavirus	rotavirus	JJ
cord-014462-11ggaqf1	906	8	infection	infection	NN
cord-014462-11ggaqf1	906	9	in	in	IN
cord-014462-11ggaqf1	906	10	humans	human	NNS
cord-014462-11ggaqf1	906	11	and	and	CC
cord-014462-11ggaqf1	906	12	animals	animal	NNS
cord-014462-11ggaqf1	906	13	,	,	,
cord-014462-11ggaqf1	906	14	limited	limited	JJ
cord-014462-11ggaqf1	906	15	studies	study	NNS
cord-014462-11ggaqf1	906	16	have	have	VBP
cord-014462-11ggaqf1	906	17	been	be	VBN
cord-014462-11ggaqf1	906	18	carried	carry	VBN
cord-014462-11ggaqf1	906	19	out	out	RP
cord-014462-11ggaqf1	906	20	to	to	TO
cord-014462-11ggaqf1	906	21	determine	determine	VB
cord-014462-11ggaqf1	906	22	the	the	DT
cord-014462-11ggaqf1	906	23	extent	extent	NN
cord-014462-11ggaqf1	906	24	of	of	IN
cord-014462-11ggaqf1	906	25	exposure	exposure	NN
cord-014462-11ggaqf1	906	26	of	of	IN
cord-014462-11ggaqf1	906	27	poultry	poultry	NN
cord-014462-11ggaqf1	906	28	birds	bird	NNS
cord-014462-11ggaqf1	906	29	to	to	IN
cord-014462-11ggaqf1	906	30	rotaviruses	rotavirus	NNS
cord-014462-11ggaqf1	906	31	.	.	.
cord-014462-11ggaqf1	907	1	To	to	TO
cord-014462-11ggaqf1	907	2	determine	determine	VB
cord-014462-11ggaqf1	907	3	the	the	DT
cord-014462-11ggaqf1	907	4	prevalence	prevalence	NN
cord-014462-11ggaqf1	907	5	of	of	IN
cord-014462-11ggaqf1	907	6	avian	avian	JJ
cord-014462-11ggaqf1	907	7	rotavirus	rotavirus	JJ
cord-014462-11ggaqf1	907	8	antibodies	antibody	NNS
cord-014462-11ggaqf1	907	9	in	in	IN
cord-014462-11ggaqf1	907	10	commercial	commercial	JJ
cord-014462-11ggaqf1	907	11	broiler	broiler	NN
cord-014462-11ggaqf1	907	12	chickens	chicken	NNS
cord-014462-11ggaqf1	907	13	.	.	.
cord-014462-11ggaqf1	908	1	A	a	DT
cord-014462-11ggaqf1	908	2	total	total	NN
cord-014462-11ggaqf1	908	3	of	of	IN
cord-014462-11ggaqf1	908	4	120	120	CD
cord-014462-11ggaqf1	908	5	chicken	chicken	NN
cord-014462-11ggaqf1	908	6	serum	serum	NN
cord-014462-11ggaqf1	908	7	samples	sample	NNS
cord-014462-11ggaqf1	908	8	were	be	VBD
cord-014462-11ggaqf1	908	9	collected	collect	VBN
cord-014462-11ggaqf1	908	10	from	from	IN
cord-014462-11ggaqf1	908	11	the	the	DT
cord-014462-11ggaqf1	908	12	lairage	lairage	NN
cord-014462-11ggaqf1	908	13	of	of	IN
cord-014462-11ggaqf1	908	14	a	a	DT
cord-014462-11ggaqf1	908	15	poultry	poultry	NN
cord-014462-11ggaqf1	908	16	slaughter	slaughter	NN
cord-014462-11ggaqf1	908	17	house	house	NN
cord-014462-11ggaqf1	908	18	where	where	WRB
cord-014462-11ggaqf1	908	19	birds	bird	NNS
cord-014462-11ggaqf1	908	20	from	from	IN
cord-014462-11ggaqf1	908	21	four	four	CD
cord-014462-11ggaqf1	908	22	different	different	JJ
cord-014462-11ggaqf1	908	23	broiler	broiler	NN
cord-014462-11ggaqf1	908	24	farms	farm	NNS
cord-014462-11ggaqf1	908	25	in	in	IN
cord-014462-11ggaqf1	908	26	and	and	CC
cord-014462-11ggaqf1	908	27	around	around	IN
cord-014462-11ggaqf1	908	28	Pune	Pune	NNP
cord-014462-11ggaqf1	908	29	city	city	NN
cord-014462-11ggaqf1	908	30	were	be	VBD
cord-014462-11ggaqf1	908	31	supplied	supply	VBN
cord-014462-11ggaqf1	908	32	to	to	IN
cord-014462-11ggaqf1	908	33	.	.	.
cord-014462-11ggaqf1	909	1	The	the	DT
cord-014462-11ggaqf1	909	2	serum	serum	NN
cord-014462-11ggaqf1	909	3	samples	sample	NNS
cord-014462-11ggaqf1	909	4	were	be	VBD
cord-014462-11ggaqf1	909	5	tested	test	VBN
cord-014462-11ggaqf1	909	6	by	by	IN
cord-014462-11ggaqf1	909	7	an	an	DT
cord-014462-11ggaqf1	909	8	IgG	IgG	NNP
cord-014462-11ggaqf1	909	9	antibody	antibody	NN
cord-014462-11ggaqf1	909	10	capture	capture	NN
cord-014462-11ggaqf1	909	11	ELISA	ELISA	NNP
cord-014462-11ggaqf1	909	12	wherein	wherein	WRB
cord-014462-11ggaqf1	909	13	purified	purify	VBN
cord-014462-11ggaqf1	909	14	chicken	chicken	NN
cord-014462-11ggaqf1	909	15	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	909	16	Ch2	Ch2	NNP
cord-014462-11ggaqf1	909	17	was	be	VBD
cord-014462-11ggaqf1	909	18	used	use	VBN
cord-014462-11ggaqf1	909	19	as	as	IN
cord-014462-11ggaqf1	909	20	coating	coating	NN
cord-014462-11ggaqf1	909	21	antigen	antigen	NN
cord-014462-11ggaqf1	909	22	.	.	.
cord-014462-11ggaqf1	910	1	Sera	Sera	NNP
cord-014462-11ggaqf1	910	2	from	from	IN
cord-014462-11ggaqf1	910	3	specific	specific	JJ
cord-014462-11ggaqf1	910	4	pathogen	pathogen	NN
cord-014462-11ggaqf1	910	5	free	free	JJ
cord-014462-11ggaqf1	910	6	(	(	-LRB-
cord-014462-11ggaqf1	910	7	SPF	SPF	NNP
cord-014462-11ggaqf1	910	8	)	)	-RRB-
cord-014462-11ggaqf1	910	9	chick	chick	NNP
cord-014462-11ggaqf1	910	10	(	(	-LRB-
cord-014462-11ggaqf1	910	11	n	n	NN
cord-014462-11ggaqf1	910	12	=	=	SYM
cord-014462-11ggaqf1	910	13	20	20	CD
cord-014462-11ggaqf1	910	14	)	)	-RRB-
cord-014462-11ggaqf1	910	15	served	serve	VBD
cord-014462-11ggaqf1	910	16	as	as	IN
cord-014462-11ggaqf1	910	17	negative	negative	JJ
cord-014462-11ggaqf1	910	18	control	control	NN
cord-014462-11ggaqf1	910	19	in	in	IN
cord-014462-11ggaqf1	910	20	the	the	DT
cord-014462-11ggaqf1	910	21	test	test	NN
cord-014462-11ggaqf1	910	22	.	.	.
cord-014462-11ggaqf1	911	1	Cut	cut	VB
cord-014462-11ggaqf1	911	2	off	off	RP
cord-014462-11ggaqf1	911	3	was	be	VBD
cord-014462-11ggaqf1	911	4	calculated	calculate	VBN
cord-014462-11ggaqf1	911	5	as	as	IN
cord-014462-11ggaqf1	911	6	Mean	mean	JJ
cord-014462-11ggaqf1	911	7	negative	negative	JJ
cord-014462-11ggaqf1	911	8	control	control	NN
cord-014462-11ggaqf1	911	9	?	?	.
cord-014462-11ggaqf1	912	1	3SD	3SD	NNP
cord-014462-11ggaqf1	912	2	(	(	-LRB-
cord-014462-11ggaqf1	912	3	standard	standard	JJ
cord-014462-11ggaqf1	912	4	deviation	deviation	NN
cord-014462-11ggaqf1	912	5	)	)	-RRB-
cord-014462-11ggaqf1	912	6	.	.	.
cord-014462-11ggaqf1	913	1	S	S	NNP
cord-014462-11ggaqf1	913	2	/	/	SYM
cord-014462-11ggaqf1	913	3	CO	CO	NNP
cord-014462-11ggaqf1	913	4	(	(	-LRB-
cord-014462-11ggaqf1	913	5	mean	mean	VB
cord-014462-11ggaqf1	914	1	sample	sample	NN
cord-014462-11ggaqf1	914	2	OD	OD	NNP
cord-014462-11ggaqf1	914	3	450	450	CD
cord-014462-11ggaqf1	914	4	/cut	/cut	NFP
cord-014462-11ggaqf1	914	5	off	off	RB
cord-014462-11ggaqf1	914	6	)	)	-RRB-
cord-014462-11ggaqf1	915	1	values	value	NNS
cord-014462-11ggaqf1	915	2	above	above	IN
cord-014462-11ggaqf1	915	3	1	1	CD
cord-014462-11ggaqf1	915	4	(	(	-LRB-
cord-014462-11ggaqf1	915	5	1.113	1.113	CD
cord-014462-11ggaqf1	915	6	-	-	SYM
cord-014462-11ggaqf1	915	7	4.445	4.445	CD
cord-014462-11ggaqf1	915	8	)	)	-RRB-
cord-014462-11ggaqf1	915	9	in	in	IN
cord-014462-11ggaqf1	915	10	60	60	CD
cord-014462-11ggaqf1	915	11	%	%	NN
cord-014462-11ggaqf1	915	12	(	(	-LRB-
cord-014462-11ggaqf1	915	13	72/120	72/120	CD
cord-014462-11ggaqf1	915	14	)	)	-RRB-
cord-014462-11ggaqf1	915	15	serum	serum	NN
cord-014462-11ggaqf1	915	16	samples	sample	NNS
cord-014462-11ggaqf1	915	17	were	be	VBD
cord-014462-11ggaqf1	915	18	indicating	indicate	VBG
cord-014462-11ggaqf1	915	19	positivity	positivity	NN
cord-014462-11ggaqf1	915	20	to	to	IN
cord-014462-11ggaqf1	915	21	rotavirus	rotavirus	JJ
cord-014462-11ggaqf1	915	22	antibodies	antibody	NNS
cord-014462-11ggaqf1	915	23	.	.	.
cord-014462-11ggaqf1	916	1	The	the	DT
cord-014462-11ggaqf1	916	2	result	result	NN
cord-014462-11ggaqf1	916	3	of	of	IN
cord-014462-11ggaqf1	916	4	the	the	DT
cord-014462-11ggaqf1	916	5	study	study	NN
cord-014462-11ggaqf1	916	6	indicates	indicate	VBZ
cord-014462-11ggaqf1	916	7	exposure	exposure	NN
cord-014462-11ggaqf1	916	8	of	of	IN
cord-014462-11ggaqf1	916	9	the	the	DT
cord-014462-11ggaqf1	916	10	birds	bird	NNS
cord-014462-11ggaqf1	916	11	to	to	IN
cord-014462-11ggaqf1	916	12	avian	avian	JJ
cord-014462-11ggaqf1	916	13	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	916	14	or	or	CC
cord-014462-11ggaqf1	916	15	similar	similar	JJ
cord-014462-11ggaqf1	916	16	agent	agent	NN
cord-014462-11ggaqf1	916	17	that	that	WDT
cord-014462-11ggaqf1	916	18	is	be	VBZ
cord-014462-11ggaqf1	916	19	circulating	circulate	VBG
cord-014462-11ggaqf1	916	20	in	in	IN
cord-014462-11ggaqf1	916	21	Pune	Pune	NNP
cord-014462-11ggaqf1	916	22	city	city	NN
cord-014462-11ggaqf1	916	23	.	.	.
cord-014462-11ggaqf1	917	1	Bluetongue	Bluetongue	NNP
cord-014462-11ggaqf1	917	2	has	have	VBZ
cord-014462-11ggaqf1	917	3	become	become	VBN
cord-014462-11ggaqf1	917	4	established	establish	VBN
cord-014462-11ggaqf1	917	5	in	in	IN
cord-014462-11ggaqf1	917	6	south	south	JJ
cord-014462-11ggaqf1	917	7	India	India	NNP
cord-014462-11ggaqf1	917	8	causing	cause	VBG
cord-014462-11ggaqf1	917	9	regular	regular	JJ
cord-014462-11ggaqf1	917	10	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	917	11	in	in	IN
cord-014462-11ggaqf1	917	12	sheep	sheep	NNS
cord-014462-11ggaqf1	917	13	.	.	.
cord-014462-11ggaqf1	918	1	BTV	BTV	NNP
cord-014462-11ggaqf1	918	2	serotypes	serotypes	NNP
cord-014462-11ggaqf1	918	3	2	2	CD
cord-014462-11ggaqf1	918	4	,	,	,
cord-014462-11ggaqf1	918	5	9	9	CD
cord-014462-11ggaqf1	918	6	,	,	,
cord-014462-11ggaqf1	918	7	15	15	CD
cord-014462-11ggaqf1	918	8	and	and	CC
cord-014462-11ggaqf1	918	9	21	21	CD
cord-014462-11ggaqf1	918	10	were	be	VBD
cord-014462-11ggaqf1	918	11	isolated	isolate	VBN
cord-014462-11ggaqf1	918	12	from	from	IN
cord-014462-11ggaqf1	918	13	native	native	JJ
cord-014462-11ggaqf1	918	14	sheep	sheep	NNS
cord-014462-11ggaqf1	918	15	of	of	IN
cord-014462-11ggaqf1	918	16	Andhra	Andhra	NNP
cord-014462-11ggaqf1	918	17	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	918	18	.	.	.
cord-014462-11ggaqf1	919	1	The	the	DT
cord-014462-11ggaqf1	919	2	other	other	JJ
cord-014462-11ggaqf1	919	3	serotypes	serotype	NNS
cord-014462-11ggaqf1	919	4	circulating	circulate	VBG
cord-014462-11ggaqf1	919	5	in	in	IN
cord-014462-11ggaqf1	919	6	the	the	DT
cord-014462-11ggaqf1	919	7	state	state	NN
cord-014462-11ggaqf1	919	8	need	need	VBP
cord-014462-11ggaqf1	919	9	to	to	TO
cord-014462-11ggaqf1	919	10	be	be	VB
cord-014462-11ggaqf1	919	11	identified	identify	VBN
cord-014462-11ggaqf1	919	12	.	.	.
cord-014462-11ggaqf1	920	1	However	however	RB
cord-014462-11ggaqf1	920	2	the	the	DT
cord-014462-11ggaqf1	920	3	major	major	JJ
cord-014462-11ggaqf1	920	4	constraint	constraint	NN
cord-014462-11ggaqf1	920	5	is	be	VBZ
cord-014462-11ggaqf1	920	6	the	the	DT
cord-014462-11ggaqf1	920	7	serotype	serotype	NN
cord-014462-11ggaqf1	920	8	identification	identification	NN
cord-014462-11ggaqf1	920	9	.	.	.
cord-014462-11ggaqf1	921	1	To	to	TO
cord-014462-11ggaqf1	921	2	overcome	overcome	VB
cord-014462-11ggaqf1	921	3	the	the	DT
cord-014462-11ggaqf1	921	4	difficulties	difficulty	NNS
cord-014462-11ggaqf1	921	5	of	of	IN
cord-014462-11ggaqf1	921	6	traditional	traditional	JJ
cord-014462-11ggaqf1	921	7	serotyping	serotyping	NN
cord-014462-11ggaqf1	921	8	methods	method	NNS
cord-014462-11ggaqf1	921	9	(	(	-LRB-
cord-014462-11ggaqf1	921	10	neutralization	neutralization	NN
cord-014462-11ggaqf1	921	11	tests	test	NNS
cord-014462-11ggaqf1	921	12	)	)	-RRB-
cord-014462-11ggaqf1	921	13	,	,	,
cord-014462-11ggaqf1	921	14	nucleic	nucleic	JJ
cord-014462-11ggaqf1	921	15	acid	acid	NN
cord-014462-11ggaqf1	921	16	based	base	VBN
cord-014462-11ggaqf1	921	17	tests	test	NNS
cord-014462-11ggaqf1	921	18	are	be	VBP
cord-014462-11ggaqf1	921	19	being	be	VBG
cord-014462-11ggaqf1	921	20	tried	try	VBN
cord-014462-11ggaqf1	921	21	.	.	.
cord-014462-11ggaqf1	922	1	RT	RT	NNP
cord-014462-11ggaqf1	922	2	-	-	HYPH
cord-014462-11ggaqf1	922	3	PCR	PCR	NNP
cord-014462-11ggaqf1	922	4	for	for	IN
cord-014462-11ggaqf1	922	5	serotyping	serotyping	NN
cord-014462-11ggaqf1	922	6	was	be	VBD
cord-014462-11ggaqf1	922	7	standardized	standardize	VBN
cord-014462-11ggaqf1	922	8	using	use	VBG
cord-014462-11ggaqf1	922	9	primers	primer	NNS
cord-014462-11ggaqf1	922	10	specific	specific	JJ
cord-014462-11ggaqf1	922	11	to	to	IN
cord-014462-11ggaqf1	922	12	VP2	vp2	JJ
cord-014462-11ggaqf1	922	13	gene	gene	NN
cord-014462-11ggaqf1	922	14	of	of	IN
cord-014462-11ggaqf1	922	15	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	922	16	,	,	,
cord-014462-11ggaqf1	922	17	9	9	CD
cord-014462-11ggaqf1	922	18	and	and	CC
cord-014462-11ggaqf1	922	19	15	15	CD
cord-014462-11ggaqf1	922	20	serotypes	serotype	NNS
cord-014462-11ggaqf1	922	21	.	.	.
cord-014462-11ggaqf1	923	1	RT	RT	NNP
cord-014462-11ggaqf1	923	2	-	-	HYPH
cord-014462-11ggaqf1	923	3	PCR	PCR	NNP
cord-014462-11ggaqf1	923	4	resulted	result	VBD
cord-014462-11ggaqf1	923	5	in	in	IN
cord-014462-11ggaqf1	923	6	653	653	CD
cord-014462-11ggaqf1	923	7	bp	bp	NNP
cord-014462-11ggaqf1	923	8	product	product	NN
cord-014462-11ggaqf1	923	9	of	of	IN
cord-014462-11ggaqf1	923	10	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	923	11	,	,	,
cord-014462-11ggaqf1	923	12	1241	1241	CD
cord-014462-11ggaqf1	923	13	bp	bp	NNP
cord-014462-11ggaqf1	923	14	product	product	NN
cord-014462-11ggaqf1	923	15	of	of	IN
cord-014462-11ggaqf1	923	16	BTV-9	BTV-9	NNP
cord-014462-11ggaqf1	923	17	which	which	WDT
cord-014462-11ggaqf1	923	18	was	be	VBD
cord-014462-11ggaqf1	923	19	defined	define	VBN
cord-014462-11ggaqf1	923	20	by	by	IN
cord-014462-11ggaqf1	923	21	specific	specific	JJ
cord-014462-11ggaqf1	923	22	primers	primer	NNS
cord-014462-11ggaqf1	923	23	.	.	.
cord-014462-11ggaqf1	924	1	However	however	RB
cord-014462-11ggaqf1	924	2	non	non	JJ
cord-014462-11ggaqf1	924	3	specific	specific	JJ
cord-014462-11ggaqf1	924	4	amplification	amplification	NN
cord-014462-11ggaqf1	924	5	at	at	IN
cord-014462-11ggaqf1	924	6	two	two	CD
cord-014462-11ggaqf1	924	7	different	different	JJ
cord-014462-11ggaqf1	924	8	sites	site	NNS
cord-014462-11ggaqf1	924	9	i.e.	i.e.	IN
cord-014462-11ggaqf1	924	10	700	700	CD
cord-014462-11ggaqf1	924	11	bp	bp	NNP
cord-014462-11ggaqf1	924	12	and	and	CC
cord-014462-11ggaqf1	924	13	1500	1500	CD
cord-014462-11ggaqf1	924	14	bp	bp	NNP
cord-014462-11ggaqf1	924	15	was	be	VBD
cord-014462-11ggaqf1	924	16	noticed	notice	VBN
cord-014462-11ggaqf1	924	17	for	for	IN
cord-014462-11ggaqf1	924	18	BTV-15	BTV-15	NNP
cord-014462-11ggaqf1	924	19	.	.	.
cord-014462-11ggaqf1	925	1	Specificity	specificity	NN
cord-014462-11ggaqf1	925	2	of	of	IN
cord-014462-11ggaqf1	925	3	RT	RT	NNP
cord-014462-11ggaqf1	925	4	-	-	HYPH
cord-014462-11ggaqf1	925	5	PCR	PCR	NNP
cord-014462-11ggaqf1	925	6	was	be	VBD
cord-014462-11ggaqf1	925	7	evaluated	evaluate	VBN
cord-014462-11ggaqf1	925	8	.	.	.
cord-014462-11ggaqf1	926	1	BTV-2	btv-2	JJ
cord-014462-11ggaqf1	926	2	and	and	CC
cord-014462-11ggaqf1	926	3	BTV-9	btv-9	JJ
cord-014462-11ggaqf1	926	4	specific	specific	JJ
cord-014462-11ggaqf1	926	5	primers	primer	NNS
cord-014462-11ggaqf1	926	6	could	could	MD
cord-014462-11ggaqf1	926	7	amplify	amplify	VB
cord-014462-11ggaqf1	926	8	only	only	RB
cord-014462-11ggaqf1	926	9	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	926	10	and	and	CC
cord-014462-11ggaqf1	926	11	BTV-9	btv-9	JJ
cord-014462-11ggaqf1	926	12	respectively	respectively	RB
cord-014462-11ggaqf1	926	13	where	where	WRB
cord-014462-11ggaqf1	926	14	as	as	IN
cord-014462-11ggaqf1	926	15	BTV-15	btv-15	DT
cord-014462-11ggaqf1	926	16	type	type	NN
cord-014462-11ggaqf1	926	17	specific	specific	JJ
cord-014462-11ggaqf1	926	18	primers	primer	NNS
cord-014462-11ggaqf1	926	19	amplified	amplify	VBN
cord-014462-11ggaqf1	926	20	not	not	RB
cord-014462-11ggaqf1	926	21	only	only	RB
cord-014462-11ggaqf1	926	22	BTV-15	btv-15	XX
cord-014462-11ggaqf1	927	1	but	but	CC
cord-014462-11ggaqf1	927	2	also	also	RB
cord-014462-11ggaqf1	927	3	BTV-2	btv-2	VB
cord-014462-11ggaqf1	928	1	and	and	CC
cord-014462-11ggaqf1	928	2	BTV-9	BTV-9	NNP
cord-014462-11ggaqf1	928	3	.	.	.
cord-014462-11ggaqf1	929	1	Nucleic	nucleic	JJ
cord-014462-11ggaqf1	929	2	acid	acid	NN
cord-014462-11ggaqf1	929	3	sequence	sequence	NN
cord-014462-11ggaqf1	929	4	data	datum	NNS
cord-014462-11ggaqf1	929	5	obtained	obtain	VBN
cord-014462-11ggaqf1	929	6	from	from	IN
cord-014462-11ggaqf1	929	7	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	929	8	PCR	PCR	NNP
cord-014462-11ggaqf1	929	9	product	product	NN
cord-014462-11ggaqf1	929	10	and	and	CC
cord-014462-11ggaqf1	929	11	BTV-9	btv-9	JJ
cord-014462-11ggaqf1	929	12	cloned	clone	VBN
cord-014462-11ggaqf1	929	13	products	product	NNS
cord-014462-11ggaqf1	929	14	were	be	VBD
cord-014462-11ggaqf1	929	15	specific	specific	JJ
cord-014462-11ggaqf1	929	16	to	to	IN
cord-014462-11ggaqf1	929	17	VP2	vp2	JJ
cord-014462-11ggaqf1	929	18	gene	gene	NN
cord-014462-11ggaqf1	929	19	of	of	IN
cord-014462-11ggaqf1	930	1	BTV-2	btv-2	JJ
cord-014462-11ggaqf1	930	2	and	and	CC
cord-014462-11ggaqf1	930	3	BTV-9	btv-9	JJ
cord-014462-11ggaqf1	930	4	respectively	respectively	RB
cord-014462-11ggaqf1	930	5	.	.	.
cord-014462-11ggaqf1	931	1	However	however	RB
cord-014462-11ggaqf1	931	2	,	,	,
cord-014462-11ggaqf1	931	3	700	700	CD
cord-014462-11ggaqf1	931	4	and	and	CC
cord-014462-11ggaqf1	931	5	1500	1500	CD
cord-014462-11ggaqf1	931	6	bp	bp	NNP
cord-014462-11ggaqf1	931	7	products	product	NNS
cord-014462-11ggaqf1	931	8	of	of	IN
cord-014462-11ggaqf1	931	9	BTV-15	BTV-15	NNP
cord-014462-11ggaqf1	931	10	were	be	VBD
cord-014462-11ggaqf1	931	11	identical	identical	JJ
cord-014462-11ggaqf1	931	12	to	to	IN
cord-014462-11ggaqf1	931	13	VP	VP	NNP
cord-014462-11ggaqf1	931	14	4	4	CD
cord-014462-11ggaqf1	931	15	gene	gene	NN
cord-014462-11ggaqf1	931	16	of	of	IN
cord-014462-11ggaqf1	931	17	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	931	18	,	,	,
cord-014462-11ggaqf1	931	19	8	8	CD
cord-014462-11ggaqf1	931	20	,	,	,
cord-014462-11ggaqf1	931	21	10	10	CD
cord-014462-11ggaqf1	931	22	,	,	,
cord-014462-11ggaqf1	931	23	11	11	CD
cord-014462-11ggaqf1	931	24	,	,	,
cord-014462-11ggaqf1	931	25	13	13	CD
cord-014462-11ggaqf1	931	26	and	and	CC
cord-014462-11ggaqf1	931	27	18	18	CD
cord-014462-11ggaqf1	931	28	and	and	CC
cord-014462-11ggaqf1	931	29	VP	VP	NNP
cord-014462-11ggaqf1	931	30	1	1	CD
cord-014462-11ggaqf1	931	31	gene	gene	NN
cord-014462-11ggaqf1	931	32	of	of	IN
cord-014462-11ggaqf1	931	33	BTV-2	BTV-2	NNP
cord-014462-11ggaqf1	931	34	,	,	,
cord-014462-11ggaqf1	931	35	8	8	CD
cord-014462-11ggaqf1	931	36	and	and	CC
cord-014462-11ggaqf1	931	37	10	10	CD
cord-014462-11ggaqf1	931	38	respectively	respectively	RB
cord-014462-11ggaqf1	931	39	,	,	,
cord-014462-11ggaqf1	931	40	indicating	indicate	VBG
cord-014462-11ggaqf1	931	41	the	the	DT
cord-014462-11ggaqf1	931	42	non	non	JJ
cord-014462-11ggaqf1	931	43	specific	specific	JJ
cord-014462-11ggaqf1	931	44	amplification	amplification	NN
cord-014462-11ggaqf1	931	45	of	of	IN
cord-014462-11ggaqf1	931	46	BTV-15	BTV-15	NNP
cord-014462-11ggaqf1	931	47	.	.	.
cord-014462-11ggaqf1	932	1	Foot	foot	NN
cord-014462-11ggaqf1	932	2	and	and	CC
cord-014462-11ggaqf1	932	3	mouth	mouth	NN
cord-014462-11ggaqf1	932	4	disease	disease	NN
cord-014462-11ggaqf1	932	5	is	be	VBZ
cord-014462-11ggaqf1	932	6	the	the	DT
cord-014462-11ggaqf1	932	7	most	most	JJS
cord-014462-11ggaqf1	932	8	contagions	contagion	NNS
cord-014462-11ggaqf1	932	9	and	and	CC
cord-014462-11ggaqf1	932	10	highly	highly	RB
cord-014462-11ggaqf1	932	11	economically	economically	RB
cord-014462-11ggaqf1	932	12	impotent	impotent	JJ
cord-014462-11ggaqf1	932	13	disease	disease	NN
cord-014462-11ggaqf1	932	14	of	of	IN
cord-014462-11ggaqf1	932	15	cloven	cloven	NN
cord-014462-11ggaqf1	932	16	footed	footed	JJ
cord-014462-11ggaqf1	932	17	animals	animal	NNS
cord-014462-11ggaqf1	932	18	.	.	.
cord-014462-11ggaqf1	933	1	The	the	DT
cord-014462-11ggaqf1	933	2	disease	disease	NN
cord-014462-11ggaqf1	933	3	is	be	VBZ
cord-014462-11ggaqf1	933	4	controlled	control	VBN
cord-014462-11ggaqf1	933	5	by	by	IN
cord-014462-11ggaqf1	933	6	regular	regular	JJ
cord-014462-11ggaqf1	933	7	vaccination	vaccination	NN
cord-014462-11ggaqf1	933	8	using	use	VBG
cord-014462-11ggaqf1	933	9	the	the	DT
cord-014462-11ggaqf1	933	10	vaccine	vaccine	NN
cord-014462-11ggaqf1	933	11	produced	produce	VBN
cord-014462-11ggaqf1	933	12	from	from	IN
cord-014462-11ggaqf1	933	13	the	the	DT
cord-014462-11ggaqf1	933	14	virus	virus	NN
cord-014462-11ggaqf1	933	15	grown	grow	VBN
cord-014462-11ggaqf1	933	16	in	in	IN
cord-014462-11ggaqf1	933	17	the	the	DT
cord-014462-11ggaqf1	933	18	cell	cell	NN
cord-014462-11ggaqf1	933	19	culture	culture	NN
cord-014462-11ggaqf1	933	20	.	.	.
cord-014462-11ggaqf1	934	1	The	the	DT
cord-014462-11ggaqf1	934	2	vaccine	vaccine	NN
cord-014462-11ggaqf1	934	3	strain	strain	NN
cord-014462-11ggaqf1	934	4	used	use	VBN
cord-014462-11ggaqf1	934	5	for	for	IN
cord-014462-11ggaqf1	934	6	vaccine	vaccine	NN
cord-014462-11ggaqf1	934	7	production	production	NN
cord-014462-11ggaqf1	934	8	is	be	VBZ
cord-014462-11ggaqf1	934	9	selected	select	VBN
cord-014462-11ggaqf1	934	10	from	from	IN
cord-014462-11ggaqf1	934	11	the	the	DT
cord-014462-11ggaqf1	934	12	field	field	NN
cord-014462-11ggaqf1	934	13	isolates	isolate	VBZ
cord-014462-11ggaqf1	934	14	based	base	VBN
cord-014462-11ggaqf1	934	15	on	on	IN
cord-014462-11ggaqf1	934	16	the	the	DT
cord-014462-11ggaqf1	934	17	adaptability	adaptability	NN
cord-014462-11ggaqf1	934	18	and	and	CC
cord-014462-11ggaqf1	934	19	growth	growth	NN
cord-014462-11ggaqf1	934	20	kinetics	kinetic	NNS
cord-014462-11ggaqf1	934	21	in	in	IN
cord-014462-11ggaqf1	934	22	BHK21	BHK21	NNP
cord-014462-11ggaqf1	934	23	cells	cell	NNS
cord-014462-11ggaqf1	934	24	and	and	CC
cord-014462-11ggaqf1	934	25	antigen	antigen	NN
cord-014462-11ggaqf1	934	26	coverage	coverage	NN
cord-014462-11ggaqf1	934	27	.	.	.
cord-014462-11ggaqf1	935	1	However	however	RB
cord-014462-11ggaqf1	935	2	the	the	DT
cord-014462-11ggaqf1	935	3	field	field	NN
cord-014462-11ggaqf1	935	4	viruses	virus	NNS
cord-014462-11ggaqf1	935	5	need	need	VBP
cord-014462-11ggaqf1	935	6	to	to	TO
cord-014462-11ggaqf1	935	7	be	be	VB
cord-014462-11ggaqf1	935	8	passaged	passage	VBN
cord-014462-11ggaqf1	935	9	several	several	JJ
cord-014462-11ggaqf1	935	10	times	time	NNS
cord-014462-11ggaqf1	935	11	to	to	TO
cord-014462-11ggaqf1	935	12	adapt	adapt	VB
cord-014462-11ggaqf1	935	13	in	in	IN
cord-014462-11ggaqf1	935	14	tissue	tissue	NN
cord-014462-11ggaqf1	935	15	culture	culture	NN
cord-014462-11ggaqf1	935	16	.	.	.
cord-014462-11ggaqf1	936	1	Passage	passage	NN
cord-014462-11ggaqf1	936	2	of	of	IN
cord-014462-11ggaqf1	936	3	field	field	NN
cord-014462-11ggaqf1	936	4	viruses	virus	NNS
cord-014462-11ggaqf1	936	5	in	in	IN
cord-014462-11ggaqf1	936	6	tissue	tissue	NN
cord-014462-11ggaqf1	936	7	culture	culture	NN
cord-014462-11ggaqf1	936	8	may	may	MD
cord-014462-11ggaqf1	936	9	results	result	NNS
cord-014462-11ggaqf1	936	10	in	in	IN
cord-014462-11ggaqf1	936	11	development	development	NN
cord-014462-11ggaqf1	936	12	of	of	IN
cord-014462-11ggaqf1	936	13	mutants	mutant	NNS
cord-014462-11ggaqf1	936	14	whose	whose	WP$
cord-014462-11ggaqf1	936	15	genetic	genetic	JJ
cord-014462-11ggaqf1	936	16	makeup	makeup	NN
cord-014462-11ggaqf1	936	17	may	may	MD
cord-014462-11ggaqf1	936	18	differ	differ	VB
cord-014462-11ggaqf1	936	19	from	from	IN
cord-014462-11ggaqf1	936	20	the	the	DT
cord-014462-11ggaqf1	936	21	field	field	NN
cord-014462-11ggaqf1	936	22	samples	sample	NNS
cord-014462-11ggaqf1	936	23	also	also	RB
cord-014462-11ggaqf1	936	24	some	some	DT
cord-014462-11ggaqf1	936	25	of	of	IN
cord-014462-11ggaqf1	936	26	the	the	DT
cord-014462-11ggaqf1	936	27	field	field	NN
cord-014462-11ggaqf1	936	28	strains	strain	NNS
cord-014462-11ggaqf1	936	29	may	may	MD
cord-014462-11ggaqf1	936	30	fail	fail	VB
cord-014462-11ggaqf1	936	31	to	to	TO
cord-014462-11ggaqf1	936	32	adapt	adapt	VB
cord-014462-11ggaqf1	936	33	or	or	CC
cord-014462-11ggaqf1	936	34	may	may	MD
cord-014462-11ggaqf1	936	35	grow	grow	VB
cord-014462-11ggaqf1	936	36	poorly	poorly	RB
cord-014462-11ggaqf1	936	37	in	in	IN
cord-014462-11ggaqf1	936	38	the	the	DT
cord-014462-11ggaqf1	936	39	tissue	tissue	NN
cord-014462-11ggaqf1	936	40	culture	culture	NN
cord-014462-11ggaqf1	936	41	,	,	,
cord-014462-11ggaqf1	936	42	thus	thus	RB
cord-014462-11ggaqf1	936	43	the	the	DT
cord-014462-11ggaqf1	936	44	efficiency	efficiency	NN
cord-014462-11ggaqf1	936	45	of	of	IN
cord-014462-11ggaqf1	936	46	the	the	DT
cord-014462-11ggaqf1	936	47	vaccine	vaccine	NN
cord-014462-11ggaqf1	936	48	gets	get	VBZ
cord-014462-11ggaqf1	936	49	affected	affect	VBN
cord-014462-11ggaqf1	936	50	.	.	.
cord-014462-11ggaqf1	937	1	Structural	structural	JJ
cord-014462-11ggaqf1	937	2	proteins	protein	NNS
cord-014462-11ggaqf1	937	3	of	of	IN
cord-014462-11ggaqf1	937	4	FMDV	FMDV	NNP
cord-014462-11ggaqf1	937	5	carry	carry	VBP
cord-014462-11ggaqf1	937	6	the	the	DT
cord-014462-11ggaqf1	937	7	sequences	sequence	NNS
cord-014462-11ggaqf1	937	8	which	which	WDT
cord-014462-11ggaqf1	937	9	determine	determine	VBP
cord-014462-11ggaqf1	937	10	the	the	DT
cord-014462-11ggaqf1	937	11	serotype	serotype	NN
cord-014462-11ggaqf1	937	12	specificity	specificity	NN
cord-014462-11ggaqf1	937	13	and	and	CC
cord-014462-11ggaqf1	937	14	immunogenicity	immunogenicity	NN
cord-014462-11ggaqf1	937	15	.	.	.
cord-014462-11ggaqf1	938	1	Thus	thus	RB
cord-014462-11ggaqf1	938	2	one	one	PRP
cord-014462-11ggaqf1	938	3	may	may	MD
cord-014462-11ggaqf1	938	4	replace	replace	VB
cord-014462-11ggaqf1	938	5	the	the	DT
cord-014462-11ggaqf1	938	6	gene	gene	NN
cord-014462-11ggaqf1	938	7	coding	code	VBG
cord-014462-11ggaqf1	938	8	for	for	IN
cord-014462-11ggaqf1	938	9	structural	structural	JJ
cord-014462-11ggaqf1	938	10	proteins	protein	NNS
cord-014462-11ggaqf1	938	11	from	from	IN
cord-014462-11ggaqf1	938	12	the	the	DT
cord-014462-11ggaqf1	938	13	full	full	JJ
cord-014462-11ggaqf1	938	14	length	length	NN
cord-014462-11ggaqf1	938	15	cDNA	cdna	NN
cord-014462-11ggaqf1	938	16	copy	copy	NN
cord-014462-11ggaqf1	938	17	of	of	IN
cord-014462-11ggaqf1	938	18	the	the	DT
cord-014462-11ggaqf1	938	19	vaccine	vaccine	NN
cord-014462-11ggaqf1	938	20	strain	strain	NN
cord-014462-11ggaqf1	938	21	that	that	WDT
cord-014462-11ggaqf1	938	22	has	have	VBZ
cord-014462-11ggaqf1	938	23	been	be	VBN
cord-014462-11ggaqf1	938	24	adapted	adapt	VBN
cord-014462-11ggaqf1	938	25	to	to	IN
cord-014462-11ggaqf1	938	26	the	the	DT
cord-014462-11ggaqf1	938	27	tissue	tissue	NN
cord-014462-11ggaqf1	938	28	culture	culture	NN
cord-014462-11ggaqf1	938	29	with	with	IN
cord-014462-11ggaqf1	938	30	the	the	DT
cord-014462-11ggaqf1	938	31	poly	poly	JJ
cord-014462-11ggaqf1	938	32	-	-	HYPH
cord-014462-11ggaqf1	938	33	structural	structural	JJ
cord-014462-11ggaqf1	938	34	protein	protein	NN
cord-014462-11ggaqf1	938	35	gene	gene	NN
cord-014462-11ggaqf1	938	36	(	(	-LRB-
cord-014462-11ggaqf1	938	37	PI	PI	NNP
cord-014462-11ggaqf1	938	38	)	)	-RRB-
cord-014462-11ggaqf1	938	39	so	so	IN
cord-014462-11ggaqf1	938	40	that	that	IN
cord-014462-11ggaqf1	938	41	the	the	DT
cord-014462-11ggaqf1	938	42	chimeric	chimeric	JJ
cord-014462-11ggaqf1	938	43	virus	virus	NN
cord-014462-11ggaqf1	938	44	gets	get	VBZ
cord-014462-11ggaqf1	938	45	the	the	DT
cord-014462-11ggaqf1	938	46	serotype	serotype	JJ
cord-014462-11ggaqf1	938	47	specificity	specificity	NN
cord-014462-11ggaqf1	938	48	of	of	IN
cord-014462-11ggaqf1	938	49	the	the	DT
cord-014462-11ggaqf1	938	50	field	field	NN
cord-014462-11ggaqf1	938	51	strain	strain	NN
cord-014462-11ggaqf1	938	52	besides	besides	IN
cord-014462-11ggaqf1	938	53	retaining	retain	VBG
cord-014462-11ggaqf1	938	54	the	the	DT
cord-014462-11ggaqf1	938	55	other	other	JJ
cord-014462-11ggaqf1	938	56	characteristics	characteristic	NNS
cord-014462-11ggaqf1	938	57	that	that	WDT
cord-014462-11ggaqf1	938	58	are	be	VBP
cord-014462-11ggaqf1	938	59	needed	need	VBN
cord-014462-11ggaqf1	938	60	for	for	IN
cord-014462-11ggaqf1	938	61	a	a	DT
cord-014462-11ggaqf1	938	62	vaccine	vaccine	NN
cord-014462-11ggaqf1	938	63	virus	virus	NN
cord-014462-11ggaqf1	938	64	.	.	.
cord-014462-11ggaqf1	939	1	We	-PRON-	PRP
cord-014462-11ggaqf1	939	2	have	have	VBP
cord-014462-11ggaqf1	939	3	made	make	VBN
cord-014462-11ggaqf1	939	4	replication	replication	NN
cord-014462-11ggaqf1	939	5	competent	competent	JJ
cord-014462-11ggaqf1	939	6	FMDV	FMDV	NNP
cord-014462-11ggaqf1	939	7	Asia	Asia	NNP
cord-014462-11ggaqf1	940	1	I	-PRON-	PRP
cord-014462-11ggaqf1	940	2	full	full	JJ
cord-014462-11ggaqf1	940	3	length	length	NN
cord-014462-11ggaqf1	940	4	genome	genome	NN
cord-014462-11ggaqf1	940	5	and	and	CC
cord-014462-11ggaqf1	940	6	cloned	clone	VBN
cord-014462-11ggaqf1	940	7	under	under	IN
cord-014462-11ggaqf1	940	8	T7	T7	NNP
cord-014462-11ggaqf1	940	9	and	and	CC
cord-014462-11ggaqf1	940	10	CMV	CMV	NNP
cord-014462-11ggaqf1	940	11	promoter	promoter	NN
cord-014462-11ggaqf1	940	12	separately	separately	RB
cord-014462-11ggaqf1	940	13	in	in	IN
cord-014462-11ggaqf1	940	14	plasmid	plasmid	NN
cord-014462-11ggaqf1	940	15	vectors	vector	NNS
cord-014462-11ggaqf1	940	16	.	.	.
cord-014462-11ggaqf1	941	1	Bam	Bam	NNP
cord-014462-11ggaqf1	941	2	H1	H1	NNP
cord-014462-11ggaqf1	941	3	sites	site	NNS
cord-014462-11ggaqf1	941	4	were	be	VBD
cord-014462-11ggaqf1	941	5	created	create	VBN
cord-014462-11ggaqf1	941	6	for	for	IN
cord-014462-11ggaqf1	941	7	inserting	insert	VBG
cord-014462-11ggaqf1	941	8	PI-2A	PI-2A	NNP
cord-014462-11ggaqf1	941	9	gene	gene	NN
cord-014462-11ggaqf1	941	10	of	of	IN
cord-014462-11ggaqf1	941	11	other	other	JJ
cord-014462-11ggaqf1	941	12	field	field	NN
cord-014462-11ggaqf1	941	13	strains	strain	NNS
cord-014462-11ggaqf1	941	14	.	.	.
cord-014462-11ggaqf1	942	1	The	the	DT
cord-014462-11ggaqf1	942	2	P1	P1	NNP
cord-014462-11ggaqf1	942	3	-	-	HYPH
cord-014462-11ggaqf1	942	4	2A	2a	CD
cord-014462-11ggaqf1	942	5	of	of	IN
cord-014462-11ggaqf1	942	6	type	type	NN
cord-014462-11ggaqf1	942	7	'	'	``
cord-014462-11ggaqf1	942	8	O	o	UH
cord-014462-11ggaqf1	942	9	'	'	''
cord-014462-11ggaqf1	942	10	vaccine	vaccine	NN
cord-014462-11ggaqf1	942	11	strain	strain	NN
cord-014462-11ggaqf1	942	12	was	be	VBD
cord-014462-11ggaqf1	942	13	amplified	amplify	VBN
cord-014462-11ggaqf1	942	14	directly	directly	RB
cord-014462-11ggaqf1	942	15	from	from	IN
cord-014462-11ggaqf1	942	16	the	the	DT
cord-014462-11ggaqf1	942	17	cattle	cattle	NNS
cord-014462-11ggaqf1	942	18	tongue	tongue	NN
cord-014462-11ggaqf1	942	19	material	material	NN
cord-014462-11ggaqf1	942	20	,	,	,
cord-014462-11ggaqf1	942	21	cloned	clone	VBN
cord-014462-11ggaqf1	942	22	in	in	IN
cord-014462-11ggaqf1	942	23	plasmid	plasmid	NN
cord-014462-11ggaqf1	942	24	vector	vector	NN
cord-014462-11ggaqf1	942	25	and	and	CC
cord-014462-11ggaqf1	942	26	studied	study	VBD
cord-014462-11ggaqf1	942	27	the	the	DT
cord-014462-11ggaqf1	942	28	specificity	specificity	NN
cord-014462-11ggaqf1	942	29	by	by	IN
cord-014462-11ggaqf1	942	30	sequence	sequence	NN
cord-014462-11ggaqf1	942	31	analysis	analysis	NN
cord-014462-11ggaqf1	942	32	and	and	CC
cord-014462-11ggaqf1	942	33	gene	gene	NN
cord-014462-11ggaqf1	942	34	expression	expression	NN
cord-014462-11ggaqf1	942	35	.	.	.
cord-014462-11ggaqf1	943	1	We	-PRON-	PRP
cord-014462-11ggaqf1	943	2	have	have	VBP
cord-014462-11ggaqf1	943	3	introduced	introduce	VBN
cord-014462-11ggaqf1	943	4	'	'	``
cord-014462-11ggaqf1	943	5	O	o	UH
cord-014462-11ggaqf1	943	6	'	'	''
cord-014462-11ggaqf1	943	7	P1	p1	NN
cord-014462-11ggaqf1	943	8	-	-	HYPH
cord-014462-11ggaqf1	943	9	2A	2a	CD
cord-014462-11ggaqf1	943	10	gene	gene	NN
cord-014462-11ggaqf1	943	11	into	into	IN
cord-014462-11ggaqf1	943	12	the	the	DT
cord-014462-11ggaqf1	943	13	full	full	JJ
cord-014462-11ggaqf1	943	14	length	length	NN
cord-014462-11ggaqf1	943	15	construct	construct	NN
cord-014462-11ggaqf1	943	16	devoid	devoid	JJ
cord-014462-11ggaqf1	943	17	of	of	IN
cord-014462-11ggaqf1	943	18	Asia	Asia	NNP
cord-014462-11ggaqf1	943	19	1	1	CD
cord-014462-11ggaqf1	943	20	structural	structural	JJ
cord-014462-11ggaqf1	943	21	protein	protein	NN
cord-014462-11ggaqf1	943	22	gene	gene	NN
cord-014462-11ggaqf1	943	23	,	,	,
cord-014462-11ggaqf1	943	24	P1	P1	NNP
cord-014462-11ggaqf1	943	25	-	-	HYPH
cord-014462-11ggaqf1	943	26	2A.	2a.	CD
cord-014462-11ggaqf1	944	1	The	the	DT
cord-014462-11ggaqf1	944	2	in	in	IN
cord-014462-11ggaqf1	944	3	vitro	vitro	FW
cord-014462-11ggaqf1	944	4	transcribed	transcribe	VBN
cord-014462-11ggaqf1	944	5	RNA	RNA	NNP
cord-014462-11ggaqf1	944	6	in	in	IN
cord-014462-11ggaqf1	944	7	case	case	NN
cord-014462-11ggaqf1	944	8	of	of	IN
cord-014462-11ggaqf1	944	9	T7	t7	NN
cord-014462-11ggaqf1	944	10	promotered	promotere	VBN
cord-014462-11ggaqf1	944	11	construct	construct	NN
cord-014462-11ggaqf1	944	12	and	and	CC
cord-014462-11ggaqf1	944	13	plasmid	plasmid	NN
cord-014462-11ggaqf1	944	14	DNA	dna	NN
cord-014462-11ggaqf1	944	15	in	in	IN
cord-014462-11ggaqf1	944	16	case	case	NN
cord-014462-11ggaqf1	944	17	of	of	IN
cord-014462-11ggaqf1	944	18	CMV	CMV	NNP
cord-014462-11ggaqf1	944	19	promotered	promotere	VBN
cord-014462-11ggaqf1	944	20	construct	construct	NN
cord-014462-11ggaqf1	944	21	were	be	VBD
cord-014462-11ggaqf1	944	22	transfected	transfecte	VBN
cord-014462-11ggaqf1	944	23	into	into	IN
cord-014462-11ggaqf1	944	24	the	the	DT
cord-014462-11ggaqf1	944	25	BHK21	BHK21	NNP
cord-014462-11ggaqf1	944	26	cells	cell	NNS
cord-014462-11ggaqf1	944	27	.	.	.
cord-014462-11ggaqf1	945	1	After	after	IN
cord-014462-11ggaqf1	945	2	the	the	DT
cord-014462-11ggaqf1	945	3	passaging	passaging	NN
cord-014462-11ggaqf1	945	4	the	the	DT
cord-014462-11ggaqf1	945	5	virus	virus	NN
cord-014462-11ggaqf1	945	6	obtained	obtain	VBN
cord-014462-11ggaqf1	945	7	was	be	VBD
cord-014462-11ggaqf1	945	8	studied	study	VBN
cord-014462-11ggaqf1	945	9	for	for	IN
cord-014462-11ggaqf1	945	10	the	the	DT
cord-014462-11ggaqf1	945	11	speciality	speciality	NN
cord-014462-11ggaqf1	945	12	.	.	.
cord-014462-11ggaqf1	946	1	This	this	DT
cord-014462-11ggaqf1	946	2	approach	approach	NN
cord-014462-11ggaqf1	946	3	may	may	MD
cord-014462-11ggaqf1	946	4	be	be	VB
cord-014462-11ggaqf1	946	5	used	use	VBN
cord-014462-11ggaqf1	946	6	not	not	RB
cord-014462-11ggaqf1	946	7	only	only	RB
cord-014462-11ggaqf1	946	8	for	for	IN
cord-014462-11ggaqf1	946	9	rapid	rapid	JJ
cord-014462-11ggaqf1	946	10	selection	selection	NN
cord-014462-11ggaqf1	946	11	of	of	IN
cord-014462-11ggaqf1	946	12	vaccine	vaccine	NN
cord-014462-11ggaqf1	946	13	strain	strain	NN
cord-014462-11ggaqf1	946	14	and	and	CC
cord-014462-11ggaqf1	946	15	also	also	RB
cord-014462-11ggaqf1	946	16	as	as	IN
cord-014462-11ggaqf1	946	17	a	a	DT
cord-014462-11ggaqf1	946	18	repository	repository	NN
cord-014462-11ggaqf1	946	19	of	of	IN
cord-014462-11ggaqf1	946	20	the	the	DT
cord-014462-11ggaqf1	946	21	cDNA	cdna	NN
cord-014462-11ggaqf1	946	22	copy	copy	NN
cord-014462-11ggaqf1	946	23	of	of	IN
cord-014462-11ggaqf1	946	24	the	the	DT
cord-014462-11ggaqf1	946	25	virus	virus	NN
cord-014462-11ggaqf1	946	26	.	.	.
cord-014462-11ggaqf1	947	1	The	the	DT
cord-014462-11ggaqf1	947	2	P1	P1	NNP
cord-014462-11ggaqf1	947	3	is	be	VBZ
cord-014462-11ggaqf1	947	4	composed	compose	VBN
cord-014462-11ggaqf1	947	5	of	of	IN
cord-014462-11ggaqf1	947	6	1A	1a	CD
cord-014462-11ggaqf1	947	7	,	,	,
cord-014462-11ggaqf1	947	8	1B	1b	CD
cord-014462-11ggaqf1	947	9	,	,	,
cord-014462-11ggaqf1	947	10	1C	1C	NNP
cord-014462-11ggaqf1	947	11	and	and	CC
cord-014462-11ggaqf1	947	12	1D	1D	NNP
cord-014462-11ggaqf1	947	13	(	(	-LRB-
cord-014462-11ggaqf1	947	14	VP4	VP4	NNP
cord-014462-11ggaqf1	947	15	,	,	,
cord-014462-11ggaqf1	947	16	VP2	vp2	NN
cord-014462-11ggaqf1	947	17	,	,	,
cord-014462-11ggaqf1	947	18	VP3	VP3	NNP
cord-014462-11ggaqf1	947	19	,	,	,
cord-014462-11ggaqf1	947	20	and	and	CC
cord-014462-11ggaqf1	947	21	VP1	VP1	NNP
cord-014462-11ggaqf1	947	22	)	)	-RRB-
cord-014462-11ggaqf1	948	1	respectively	respectively	RB
cord-014462-11ggaqf1	948	2	of	of	IN
cord-014462-11ggaqf1	948	3	which	which	WDT
cord-014462-11ggaqf1	948	4	the	the	DT
cord-014462-11ggaqf1	948	5	VP1	VP1	NNP
cord-014462-11ggaqf1	948	6	is	be	VBZ
cord-014462-11ggaqf1	948	7	the	the	DT
cord-014462-11ggaqf1	948	8	most	most	RBS
cord-014462-11ggaqf1	948	9	immunogenic	immunogenic	JJ
cord-014462-11ggaqf1	948	10	and	and	CC
cord-014462-11ggaqf1	948	11	subunit	subunit	JJ
cord-014462-11ggaqf1	948	12	vaccine	vaccine	NN
cord-014462-11ggaqf1	948	13	produced	produce	VBN
cord-014462-11ggaqf1	948	14	with	with	IN
cord-014462-11ggaqf1	948	15	VP1	VP1	NNP
cord-014462-11ggaqf1	948	16	alone	alone	JJ
cord-014462-11ggaqf1	949	1	was	be	VBD
cord-014462-11ggaqf1	949	2	able	able	JJ
cord-014462-11ggaqf1	949	3	to	to	TO
cord-014462-11ggaqf1	949	4	induce	induce	VB
cord-014462-11ggaqf1	949	5	high	high	JJ
cord-014462-11ggaqf1	949	6	level	level	NN
cord-014462-11ggaqf1	949	7	of	of	IN
cord-014462-11ggaqf1	949	8	neutralising	neutralise	VBG
cord-014462-11ggaqf1	949	9	antibodies	antibody	NNS
cord-014462-11ggaqf1	949	10	.	.	.
cord-014462-11ggaqf1	950	1	Thus	thus	RB
cord-014462-11ggaqf1	950	2	to	to	TO
cord-014462-11ggaqf1	950	3	control	control	VB
cord-014462-11ggaqf1	950	4	the	the	DT
cord-014462-11ggaqf1	950	5	disease	disease	NN
cord-014462-11ggaqf1	950	6	in	in	IN
cord-014462-11ggaqf1	950	7	India	India	NNP
cord-014462-11ggaqf1	950	8	polyvalent	polyvalent	JJ
cord-014462-11ggaqf1	950	9	vaccine	vaccine	NN
cord-014462-11ggaqf1	950	10	consisting	consist	VBG
cord-014462-11ggaqf1	950	11	of	of	IN
cord-014462-11ggaqf1	950	12	the	the	DT
cord-014462-11ggaqf1	950	13	inactivated	inactivate	VBN
cord-014462-11ggaqf1	950	14	virus	virus	NN
cord-014462-11ggaqf1	950	15	of	of	IN
cord-014462-11ggaqf1	950	16	all	all	PDT
cord-014462-11ggaqf1	950	17	the	the	DT
cord-014462-11ggaqf1	950	18	three	three	CD
cord-014462-11ggaqf1	950	19	serotypes	serotype	NNS
cord-014462-11ggaqf1	950	20	are	be	VBP
cord-014462-11ggaqf1	950	21	in	in	IN
cord-014462-11ggaqf1	950	22	use	use	NN
cord-014462-11ggaqf1	950	23	.	.	.
cord-014462-11ggaqf1	951	1	However	however	RB
cord-014462-11ggaqf1	951	2	the	the	DT
cord-014462-11ggaqf1	951	3	conventional	conventional	JJ
cord-014462-11ggaqf1	951	4	vaccines	vaccine	NNS
cord-014462-11ggaqf1	951	5	have	have	VBP
cord-014462-11ggaqf1	951	6	several	several	JJ
cord-014462-11ggaqf1	951	7	drawbacks	drawback	NNS
cord-014462-11ggaqf1	951	8	which	which	WDT
cord-014462-11ggaqf1	951	9	include	include	VBP
cord-014462-11ggaqf1	951	10	safety	safety	NN
cord-014462-11ggaqf1	951	11	and	and	CC
cord-014462-11ggaqf1	951	12	temperature	temperature	NN
cord-014462-11ggaqf1	951	13	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	951	14	.	.	.
cord-014462-11ggaqf1	952	1	Hence	hence	RB
cord-014462-11ggaqf1	952	2	alternatively	alternatively	RB
cord-014462-11ggaqf1	952	3	sub	sub	JJ
cord-014462-11ggaqf1	952	4	-	-	JJ
cord-014462-11ggaqf1	952	5	unit	unit	JJ
cord-014462-11ggaqf1	952	6	vaccines	vaccine	NNS
cord-014462-11ggaqf1	952	7	consisting	consist	VBG
cord-014462-11ggaqf1	952	8	of	of	IN
cord-014462-11ggaqf1	952	9	VP1	VP1	NNP
cord-014462-11ggaqf1	952	10	protein	protein	NN
cord-014462-11ggaqf1	952	11	has	have	VBZ
cord-014462-11ggaqf1	952	12	been	be	VBN
cord-014462-11ggaqf1	952	13	tried	try	VBN
cord-014462-11ggaqf1	952	14	.	.	.
cord-014462-11ggaqf1	953	1	However	however	RB
cord-014462-11ggaqf1	953	2	this	this	DT
cord-014462-11ggaqf1	953	3	showed	show	VBD
cord-014462-11ggaqf1	953	4	limited	limited	JJ
cord-014462-11ggaqf1	953	5	success	success	NN
cord-014462-11ggaqf1	953	6	due	due	IN
cord-014462-11ggaqf1	953	7	to	to	IN
cord-014462-11ggaqf1	953	8	the	the	DT
cord-014462-11ggaqf1	953	9	antigenic	antigenic	JJ
cord-014462-11ggaqf1	953	10	variations	variation	NNS
cord-014462-11ggaqf1	953	11	occurring	occur	VBG
cord-014462-11ggaqf1	953	12	in	in	IN
cord-014462-11ggaqf1	953	13	the	the	DT
cord-014462-11ggaqf1	953	14	field	field	NN
cord-014462-11ggaqf1	953	15	viruses	virus	NNS
cord-014462-11ggaqf1	953	16	thus	thus	RB
cord-014462-11ggaqf1	953	17	escaping	escape	VBG
cord-014462-11ggaqf1	953	18	the	the	DT
cord-014462-11ggaqf1	953	19	neutralization	neutralization	NN
cord-014462-11ggaqf1	953	20	from	from	IN
cord-014462-11ggaqf1	953	21	the	the	DT
cord-014462-11ggaqf1	953	22	antibodies	antibody	NNS
cord-014462-11ggaqf1	953	23	generated	generate	VBN
cord-014462-11ggaqf1	953	24	from	from	IN
cord-014462-11ggaqf1	953	25	single	single	JJ
cord-014462-11ggaqf1	953	26	cloned	clone	VBN
cord-014462-11ggaqf1	953	27	protein	protein	NN
cord-014462-11ggaqf1	953	28	.	.	.
cord-014462-11ggaqf1	954	1	Hence	hence	RB
cord-014462-11ggaqf1	954	2	the	the	DT
cord-014462-11ggaqf1	954	3	present	present	JJ
cord-014462-11ggaqf1	954	4	study	study	NN
cord-014462-11ggaqf1	954	5	was	be	VBD
cord-014462-11ggaqf1	954	6	undertaken	undertake	VBN
cord-014462-11ggaqf1	954	7	with	with	IN
cord-014462-11ggaqf1	954	8	an	an	DT
cord-014462-11ggaqf1	954	9	objective	objective	NN
cord-014462-11ggaqf1	954	10	to	to	TO
cord-014462-11ggaqf1	954	11	include	include	VB
cord-014462-11ggaqf1	954	12	all	all	PDT
cord-014462-11ggaqf1	954	13	the	the	DT
cord-014462-11ggaqf1	954	14	neutralizing	neutralize	VBG
cord-014462-11ggaqf1	954	15	epitopes	epitope	NNS
cord-014462-11ggaqf1	954	16	present	present	JJ
cord-014462-11ggaqf1	954	17	in	in	IN
cord-014462-11ggaqf1	954	18	the	the	DT
cord-014462-11ggaqf1	954	19	three	three	CD
cord-014462-11ggaqf1	954	20	serotypes	serotype	NNS
cord-014462-11ggaqf1	954	21	by	by	IN
cord-014462-11ggaqf1	954	22	linking	link	VBG
cord-014462-11ggaqf1	954	23	VP1	VP1	NNP
cord-014462-11ggaqf1	954	24	(	(	-LRB-
cord-014462-11ggaqf1	954	25	1D	1D	NNP
cord-014462-11ggaqf1	954	26	)	)	-RRB-
cord-014462-11ggaqf1	954	27	genes	gene	NNS
cord-014462-11ggaqf1	954	28	and	and	CC
cord-014462-11ggaqf1	954	29	produce	produce	VB
cord-014462-11ggaqf1	954	30	a	a	DT
cord-014462-11ggaqf1	954	31	poly	poly	JJ
cord-014462-11ggaqf1	954	32	valent	valent	NN
cord-014462-11ggaqf1	954	33	protein	protein	NN
cord-014462-11ggaqf1	954	34	for	for	IN
cord-014462-11ggaqf1	954	35	using	use	VBG
cord-014462-11ggaqf1	954	36	as	as	IN
cord-014462-11ggaqf1	954	37	poly	poly	NNP
cord-014462-11ggaqf1	954	38	subunit	subunit	NN
cord-014462-11ggaqf1	954	39	vaccine	vaccine	NN
cord-014462-11ggaqf1	954	40	.	.	.
cord-014462-11ggaqf1	955	1	In	in	IN
cord-014462-11ggaqf1	955	2	this	this	DT
cord-014462-11ggaqf1	955	3	study	study	NN
cord-014462-11ggaqf1	955	4	we	-PRON-	PRP
cord-014462-11ggaqf1	955	5	have	have	VBP
cord-014462-11ggaqf1	955	6	constructed	construct	VBN
cord-014462-11ggaqf1	955	7	a	a	DT
cord-014462-11ggaqf1	955	8	cassette	cassette	NN
cord-014462-11ggaqf1	955	9	by	by	IN
cord-014462-11ggaqf1	955	10	linking	link	VBG
cord-014462-11ggaqf1	955	11	the	the	DT
cord-014462-11ggaqf1	955	12	genes	gene	NNS
cord-014462-11ggaqf1	955	13	of	of	IN
cord-014462-11ggaqf1	955	14	three	three	CD
cord-014462-11ggaqf1	955	15	serotypes	serotype	NNS
cord-014462-11ggaqf1	955	16	'	'	``
cord-014462-11ggaqf1	955	17	O	o	UH
cord-014462-11ggaqf1	955	18	'	'	''
cord-014462-11ggaqf1	955	19	(	(	-LRB-
cord-014462-11ggaqf1	955	20	622	622	CD
cord-014462-11ggaqf1	955	21	bp	bp	NNP
cord-014462-11ggaqf1	955	22	)	)	-RRB-
cord-014462-11ggaqf1	955	23	,	,	,
cord-014462-11ggaqf1	955	24	'	'	``
cord-014462-11ggaqf1	955	25	A	a	DT
cord-014462-11ggaqf1	955	26	'	'	''
cord-014462-11ggaqf1	955	27	(	(	-LRB-
cord-014462-11ggaqf1	955	28	640	640	CD
cord-014462-11ggaqf1	955	29	bp	bp	NNP
cord-014462-11ggaqf1	955	30	)	)	-RRB-
cord-014462-11ggaqf1	955	31	and	and	CC
cord-014462-11ggaqf1	955	32	'	'	``
cord-014462-11ggaqf1	955	33	Asia	Asia	NNP
cord-014462-11ggaqf1	955	34	1	1	CD
cord-014462-11ggaqf1	955	35	'	'	''
cord-014462-11ggaqf1	955	36	(	(	-LRB-
cord-014462-11ggaqf1	955	37	622	622	CD
cord-014462-11ggaqf1	955	38	bp	bp	NNP
cord-014462-11ggaqf1	955	39	)	)	-RRB-
cord-014462-11ggaqf1	955	40	.	.	.
cord-014462-11ggaqf1	956	1	These	these	DT
cord-014462-11ggaqf1	956	2	genes	gene	NNS
cord-014462-11ggaqf1	956	3	were	be	VBD
cord-014462-11ggaqf1	956	4	cloned	clone	VBN
cord-014462-11ggaqf1	956	5	individually	individually	RB
cord-014462-11ggaqf1	956	6	in	in	IN
cord-014462-11ggaqf1	956	7	commercially	commercially	RB
cord-014462-11ggaqf1	956	8	pBSk	pbsk	CD
cord-014462-11ggaqf1	956	9	vector	vector	NN
cord-014462-11ggaqf1	956	10	and	and	CC
cord-014462-11ggaqf1	956	11	confirmed	confirm	VBN
cord-014462-11ggaqf1	956	12	by	by	IN
cord-014462-11ggaqf1	956	13	sequence	sequence	NN
cord-014462-11ggaqf1	956	14	analysis	analysis	NN
cord-014462-11ggaqf1	956	15	before	before	IN
cord-014462-11ggaqf1	956	16	linking	link	VBG
cord-014462-11ggaqf1	956	17	in	in	IN
cord-014462-11ggaqf1	956	18	pC	pc	JJ
cord-014462-11ggaqf1	956	19	DNA	dna	NN
cord-014462-11ggaqf1	956	20	vector	vector	NN
cord-014462-11ggaqf1	956	21	.	.	.
cord-014462-11ggaqf1	957	1	The	the	DT
cord-014462-11ggaqf1	957	2	linked	link	VBN
cord-014462-11ggaqf1	957	3	gene	gene	NN
cord-014462-11ggaqf1	957	4	construct	construct	NN
cord-014462-11ggaqf1	957	5	was	be	VBD
cord-014462-11ggaqf1	957	6	sub	sub	JJ
cord-014462-11ggaqf1	957	7	-	-	JJ
cord-014462-11ggaqf1	957	8	cloned	clone	VBN
cord-014462-11ggaqf1	957	9	in	in	IN
cord-014462-11ggaqf1	957	10	pET32	pet32	JJ
cord-014462-11ggaqf1	957	11	expression	expression	NN
cord-014462-11ggaqf1	957	12	vector	vector	NN
cord-014462-11ggaqf1	957	13	.	.	.
cord-014462-11ggaqf1	958	1	The	the	DT
cord-014462-11ggaqf1	958	2	expression	expression	NN
cord-014462-11ggaqf1	958	3	of	of	IN
cord-014462-11ggaqf1	958	4	the	the	DT
cord-014462-11ggaqf1	958	5	protein	protein	NN
cord-014462-11ggaqf1	958	6	gene	gene	NN
cord-014462-11ggaqf1	958	7	from	from	IN
cord-014462-11ggaqf1	958	8	the	the	DT
cord-014462-11ggaqf1	958	9	pET	pet	CD
cord-014462-11ggaqf1	958	10	vector	vector	NN
cord-014462-11ggaqf1	958	11	was	be	VBD
cord-014462-11ggaqf1	958	12	induced	induce	VBN
cord-014462-11ggaqf1	958	13	with	with	IN
cord-014462-11ggaqf1	958	14	IPTG	IPTG	NNP
cord-014462-11ggaqf1	958	15	and	and	CC
cord-014462-11ggaqf1	958	16	analysed	analyse	VBN
cord-014462-11ggaqf1	958	17	by	by	IN
cord-014462-11ggaqf1	958	18	sodium	sodium	NN
cord-014462-11ggaqf1	958	19	dodecyl	dodecyl	NNP
cord-014462-11ggaqf1	958	20	sulphate	sulphate	NN
cord-014462-11ggaqf1	958	21	polyacrylamide	polyacrylamide	NN
cord-014462-11ggaqf1	958	22	gel	gel	NN
cord-014462-11ggaqf1	958	23	electrophoresis	electrophoresis	NN
cord-014462-11ggaqf1	958	24	(	(	-LRB-
cord-014462-11ggaqf1	958	25	SDS	SDS	NNP
cord-014462-11ggaqf1	958	26	-	-	HYPH
cord-014462-11ggaqf1	958	27	PAGE	PAGE	NNP
cord-014462-11ggaqf1	958	28	)	)	-RRB-
cord-014462-11ggaqf1	958	29	.	.	.
cord-014462-11ggaqf1	959	1	A	a	DT
cord-014462-11ggaqf1	959	2	fusion	fusion	NN
cord-014462-11ggaqf1	959	3	protein	protein	NN
cord-014462-11ggaqf1	959	4	of	of	IN
cord-014462-11ggaqf1	959	5	size	size	NN
cord-014462-11ggaqf1	959	6	72	72	CD
cord-014462-11ggaqf1	959	7	kDa	kDa	NNS
cord-014462-11ggaqf1	959	8	was	be	VBD
cord-014462-11ggaqf1	959	9	observed	observe	VBN
cord-014462-11ggaqf1	959	10	in	in	IN
cord-014462-11ggaqf1	959	11	PAGE	page	NN
cord-014462-11ggaqf1	959	12	gels	gel	NNS
cord-014462-11ggaqf1	959	13	.	.	.
cord-014462-11ggaqf1	960	1	Since	since	IN
cord-014462-11ggaqf1	960	2	the	the	DT
cord-014462-11ggaqf1	960	3	protein	protein	NN
cord-014462-11ggaqf1	960	4	contains	contain	VBZ
cord-014462-11ggaqf1	960	5	6	6	CD
cord-014462-11ggaqf1	961	1	His	-PRON-	PRP$
cord-014462-11ggaqf1	961	2	residues	residue	NNS
cord-014462-11ggaqf1	961	3	from	from	IN
cord-014462-11ggaqf1	961	4	the	the	DT
cord-014462-11ggaqf1	961	5	vector	vector	NN
cord-014462-11ggaqf1	961	6	at	at	IN
cord-014462-11ggaqf1	961	7	the	the	DT
cord-014462-11ggaqf1	961	8	N	n	CD
cord-014462-11ggaqf1	961	9	-	-	HYPH
cord-014462-11ggaqf1	961	10	terminal	terminal	JJ
cord-014462-11ggaqf1	961	11	end	end	NN
cord-014462-11ggaqf1	961	12	,	,	,
cord-014462-11ggaqf1	961	13	affinity	affinity	NN
cord-014462-11ggaqf1	961	14	purification	purification	NN
cord-014462-11ggaqf1	961	15	was	be	VBD
cord-014462-11ggaqf1	961	16	carried	carry	VBN
cord-014462-11ggaqf1	961	17	out	out	RP
cord-014462-11ggaqf1	961	18	using	use	VBG
cord-014462-11ggaqf1	961	19	nickel	nickel	NN
cord-014462-11ggaqf1	961	20	nitrilo	nitrilo	JJ
cord-014462-11ggaqf1	961	21	-	-	HYPH
cord-014462-11ggaqf1	961	22	tri	tri	JJ
cord-014462-11ggaqf1	961	23	-	-	JJ
cord-014462-11ggaqf1	961	24	acetic	acetic	JJ
cord-014462-11ggaqf1	961	25	-	-	HYPH
cord-014462-11ggaqf1	961	26	acid	acid	NN
cord-014462-11ggaqf1	961	27	(	(	-LRB-
cord-014462-11ggaqf1	961	28	Ni	Ni	NNP
cord-014462-11ggaqf1	961	29	-	-	HYPH
cord-014462-11ggaqf1	961	30	NTA	NTA	NNP
cord-014462-11ggaqf1	961	31	)	)	-RRB-
cord-014462-11ggaqf1	961	32	agarose	agarose	VBD
cord-014462-11ggaqf1	961	33	matrix	matrix	NN
cord-014462-11ggaqf1	961	34	.	.	.
cord-014462-11ggaqf1	962	1	The	the	DT
cord-014462-11ggaqf1	962	2	immunoreactivity	immunoreactivity	NN
cord-014462-11ggaqf1	962	3	of	of	IN
cord-014462-11ggaqf1	962	4	the	the	DT
cord-014462-11ggaqf1	962	5	purified	purify	VBN
cord-014462-11ggaqf1	962	6	protein	protein	NN
cord-014462-11ggaqf1	962	7	was	be	VBD
cord-014462-11ggaqf1	962	8	assayed	assay	VBN
cord-014462-11ggaqf1	962	9	by	by	IN
cord-014462-11ggaqf1	962	10	western	western	JJ
cord-014462-11ggaqf1	962	11	blot	blot	NN
cord-014462-11ggaqf1	962	12	with	with	IN
cord-014462-11ggaqf1	962	13	the	the	DT
cord-014462-11ggaqf1	962	14	anti	anti	JJ
cord-014462-11ggaqf1	962	15	FMDV	FMDV	NNP
cord-014462-11ggaqf1	962	16	type	type	NN
cord-014462-11ggaqf1	962	17	'	'	``
cord-014462-11ggaqf1	962	18	O	o	UH
cord-014462-11ggaqf1	962	19	'	'	''
cord-014462-11ggaqf1	962	20	and	and	CC
cord-014462-11ggaqf1	962	21	'	'	''
cord-014462-11ggaqf1	962	22	Asia	Asia	NNP
cord-014462-11ggaqf1	962	23	1	1	CD
cord-014462-11ggaqf1	962	24	'	'	''
cord-014462-11ggaqf1	962	25	specific	specific	JJ
cord-014462-11ggaqf1	962	26	sera	sera	NNP
cord-014462-11ggaqf1	962	27	.	.	.
cord-014462-11ggaqf1	963	1	The	the	DT
cord-014462-11ggaqf1	963	2	may	may	MD
cord-014462-11ggaqf1	963	3	be	be	VB
cord-014462-11ggaqf1	963	4	used	use	VBN
cord-014462-11ggaqf1	963	5	as	as	IN
cord-014462-11ggaqf1	963	6	a	a	DT
cord-014462-11ggaqf1	963	7	subunit	subunit	NN
cord-014462-11ggaqf1	963	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	963	9	.	.	.
cord-014462-11ggaqf1	964	1	Silkworm	silkworm	NN
cord-014462-11ggaqf1	964	2	diseases	disease	NNS
cord-014462-11ggaqf1	964	3	caused	cause	VBN
cord-014462-11ggaqf1	964	4	by	by	IN
cord-014462-11ggaqf1	964	5	viruses	virus	NNS
cord-014462-11ggaqf1	964	6	,	,	,
cord-014462-11ggaqf1	964	7	bacteria	bacteria	NNS
cord-014462-11ggaqf1	964	8	,	,	,
cord-014462-11ggaqf1	964	9	fungi	fungus	NNS
cord-014462-11ggaqf1	964	10	and	and	CC
cord-014462-11ggaqf1	964	11	protozoans	protozoan	NNS
cord-014462-11ggaqf1	964	12	form	form	VBP
cord-014462-11ggaqf1	964	13	major	major	JJ
cord-014462-11ggaqf1	964	14	constraints	constraint	NNS
cord-014462-11ggaqf1	964	15	for	for	IN
cord-014462-11ggaqf1	964	16	the	the	DT
cord-014462-11ggaqf1	964	17	silk	silk	NN
cord-014462-11ggaqf1	964	18	cocoon	cocoon	NN
cord-014462-11ggaqf1	964	19	production	production	NN
cord-014462-11ggaqf1	964	20	in	in	IN
cord-014462-11ggaqf1	964	21	all	all	PDT
cord-014462-11ggaqf1	964	22	the	the	DT
cord-014462-11ggaqf1	964	23	sericultural	sericultural	JJ
cord-014462-11ggaqf1	964	24	countries	country	NNS
cord-014462-11ggaqf1	964	25	and	and	CC
cord-014462-11ggaqf1	964	26	among	among	IN
cord-014462-11ggaqf1	964	27	these	these	DT
cord-014462-11ggaqf1	964	28	silkworm	silkworm	NN
cord-014462-11ggaqf1	964	29	viral	viral	JJ
cord-014462-11ggaqf1	964	30	diseases	disease	NNS
cord-014462-11ggaqf1	964	31	viz	viz	NN
cord-014462-11ggaqf1	964	32	.	.	.
cord-014462-11ggaqf1	965	1	,	,	,
cord-014462-11ggaqf1	965	2	nuclear	nuclear	JJ
cord-014462-11ggaqf1	965	3	polyhedrosis	polyhedrosis	NN
cord-014462-11ggaqf1	965	4	and	and	CC
cord-014462-11ggaqf1	965	5	infectious	infectious	JJ
cord-014462-11ggaqf1	965	6	flacherie	flacherie	NN
cord-014462-11ggaqf1	965	7	caused	cause	VBN
cord-014462-11ggaqf1	965	8	by	by	IN
cord-014462-11ggaqf1	966	1	BmNPV	BmNPV	NNP
cord-014462-11ggaqf1	966	2	and	and	CC
cord-014462-11ggaqf1	966	3	BmIFV	BmIFV	NNP
cord-014462-11ggaqf1	966	4	cause	cause	VB
cord-014462-11ggaqf1	966	5	severe	severe	JJ
cord-014462-11ggaqf1	966	6	crop	crop	NN
cord-014462-11ggaqf1	966	7	loss	loss	NN
cord-014462-11ggaqf1	966	8	.	.	.
cord-014462-11ggaqf1	967	1	The	the	DT
cord-014462-11ggaqf1	967	2	traditional	traditional	JJ
cord-014462-11ggaqf1	967	3	disease	disease	NN
cord-014462-11ggaqf1	967	4	management	management	NN
cord-014462-11ggaqf1	967	5	strategies	strategy	NNS
cord-014462-11ggaqf1	967	6	include	include	VBP
cord-014462-11ggaqf1	967	7	prophylactic	prophylactic	JJ
cord-014462-11ggaqf1	967	8	measures	measure	NNS
cord-014462-11ggaqf1	967	9	and	and	CC
cord-014462-11ggaqf1	967	10	use	use	NN
cord-014462-11ggaqf1	967	11	of	of	IN
cord-014462-11ggaqf1	967	12	disease	disease	NN
cord-014462-11ggaqf1	967	13	free	free	JJ
cord-014462-11ggaqf1	967	14	silkworm	silkworm	NN
cord-014462-11ggaqf1	967	15	eggs	egg	NNS
cord-014462-11ggaqf1	967	16	.	.	.
cord-014462-11ggaqf1	968	1	The	the	DT
cord-014462-11ggaqf1	968	2	prophylactic	prophylactic	JJ
cord-014462-11ggaqf1	968	3	measures	measure	NNS
cord-014462-11ggaqf1	968	4	such	such	JJ
cord-014462-11ggaqf1	968	5	as	as	IN
cord-014462-11ggaqf1	968	6	disinfection	disinfection	NN
cord-014462-11ggaqf1	968	7	of	of	IN
cord-014462-11ggaqf1	968	8	silkworm	silkworm	NN
cord-014462-11ggaqf1	968	9	rearing	rear	VBG
cord-014462-11ggaqf1	968	10	house	house	NN
cord-014462-11ggaqf1	968	11	and	and	CC
cord-014462-11ggaqf1	968	12	appliances	appliance	NNS
cord-014462-11ggaqf1	968	13	,	,	,
cord-014462-11ggaqf1	968	14	egg	egg	NN
cord-014462-11ggaqf1	968	15	surface	surface	NN
cord-014462-11ggaqf1	968	16	,	,	,
cord-014462-11ggaqf1	968	17	silkworm	silkworm	NN
cord-014462-11ggaqf1	968	18	bed	bed	NN
cord-014462-11ggaqf1	968	19	disinfection	disinfection	NN
cord-014462-11ggaqf1	968	20	and	and	CC
cord-014462-11ggaqf1	968	21	rearing	rearing	NN
cord-014462-11ggaqf1	968	22	surroundings	surrounding	NNS
cord-014462-11ggaqf1	968	23	.	.	.
cord-014462-11ggaqf1	969	1	The	the	DT
cord-014462-11ggaqf1	969	2	disinfectants	disinfectant	NNS
cord-014462-11ggaqf1	969	3	used	use	VBD
cord-014462-11ggaqf1	969	4	presently	presently	RB
cord-014462-11ggaqf1	969	5	in	in	IN
cord-014462-11ggaqf1	969	6	sericulture	sericulture	NN
cord-014462-11ggaqf1	969	7	are	be	VBP
cord-014462-11ggaqf1	969	8	either	either	CC
cord-014462-11ggaqf1	969	9	formaldehyde	formaldehyde	NN
cord-014462-11ggaqf1	969	10	or	or	CC
cord-014462-11ggaqf1	969	11	chlorine	chlorine	NN
cord-014462-11ggaqf1	969	12	based	base	VBN
cord-014462-11ggaqf1	969	13	products	product	NNS
cord-014462-11ggaqf1	969	14	,	,	,
cord-014462-11ggaqf1	969	15	but	but	CC
cord-014462-11ggaqf1	969	16	these	these	DT
cord-014462-11ggaqf1	969	17	chemicals	chemical	NNS
cord-014462-11ggaqf1	969	18	are	be	VBP
cord-014462-11ggaqf1	969	19	neither	neither	RB
cord-014462-11ggaqf1	969	20	eco	eco	NN
cord-014462-11ggaqf1	969	21	-	-	:
cord-014462-11ggaqf1	969	22	nor	nor	CC
cord-014462-11ggaqf1	969	23	user	user	NN
cord-014462-11ggaqf1	969	24	-	-	HYPH
cord-014462-11ggaqf1	969	25	friendly	friendly	JJ
cord-014462-11ggaqf1	969	26	.	.	.
cord-014462-11ggaqf1	970	1	The	the	DT
cord-014462-11ggaqf1	970	2	awareness	awareness	NN
cord-014462-11ggaqf1	970	3	about	about	IN
cord-014462-11ggaqf1	970	4	health	health	NN
cord-014462-11ggaqf1	970	5	hazards	hazard	NNS
cord-014462-11ggaqf1	970	6	caused	cause	VBN
cord-014462-11ggaqf1	970	7	by	by	IN
cord-014462-11ggaqf1	970	8	formaldehyde	formaldehyde	NN
cord-014462-11ggaqf1	970	9	and	and	CC
cord-014462-11ggaqf1	970	10	environmental	environmental	JJ
cord-014462-11ggaqf1	970	11	pollution	pollution	NN
cord-014462-11ggaqf1	970	12	caused	cause	VBN
cord-014462-11ggaqf1	970	13	by	by	IN
cord-014462-11ggaqf1	970	14	Cl	Cl	NNP
cord-014462-11ggaqf1	970	15	2	2	CD
cord-014462-11ggaqf1	970	16	necessitated	necessitate	VBD
cord-014462-11ggaqf1	970	17	the	the	DT
cord-014462-11ggaqf1	970	18	development	development	NN
cord-014462-11ggaqf1	970	19	of	of	IN
cord-014462-11ggaqf1	970	20	eco	eco	NN
cord-014462-11ggaqf1	970	21	-	-	:
cord-014462-11ggaqf1	970	22	and	and	CC
cord-014462-11ggaqf1	970	23	user	user	NN
cord-014462-11ggaqf1	970	24	-	-	HYPH
cord-014462-11ggaqf1	970	25	friendly	friendly	JJ
cord-014462-11ggaqf1	970	26	disinfectant	disinfectant	NN
cord-014462-11ggaqf1	970	27	products	product	NNS
cord-014462-11ggaqf1	970	28	for	for	IN
cord-014462-11ggaqf1	970	29	use	use	NN
cord-014462-11ggaqf1	970	30	in	in	IN
cord-014462-11ggaqf1	970	31	sericulture	sericulture	NN
cord-014462-11ggaqf1	970	32	.	.	.
cord-014462-11ggaqf1	971	1	These	these	DT
cord-014462-11ggaqf1	971	2	include	include	VBP
cord-014462-11ggaqf1	971	3	alternative	alternative	JJ
cord-014462-11ggaqf1	971	4	disinfectant	disinfectant	NN
cord-014462-11ggaqf1	971	5	products	product	NNS
cord-014462-11ggaqf1	971	6	developed	develop	VBN
cord-014462-11ggaqf1	971	7	using	use	VBG
cord-014462-11ggaqf1	971	8	biodegradable	biodegradable	JJ
cord-014462-11ggaqf1	971	9	chemicals	chemical	NNS
cord-014462-11ggaqf1	971	10	and	and	CC
cord-014462-11ggaqf1	971	11	plant	plant	NN
cord-014462-11ggaqf1	971	12	based	base	VBN
cord-014462-11ggaqf1	971	13	ingredients	ingredient	NNS
cord-014462-11ggaqf1	971	14	by	by	IN
cord-014462-11ggaqf1	971	15	APSSRDI	APSSRDI	NNP
cord-014462-11ggaqf1	971	16	,	,	,
cord-014462-11ggaqf1	971	17	Hindupur	Hindupur	NNP
cord-014462-11ggaqf1	971	18	and	and	CC
cord-014462-11ggaqf1	971	19	Central	Central	NNP
cord-014462-11ggaqf1	971	20	Silk	Silk	NNP
cord-014462-11ggaqf1	971	21	Board	Board	NNP
cord-014462-11ggaqf1	971	22	for	for	IN
cord-014462-11ggaqf1	971	23	the	the	DT
cord-014462-11ggaqf1	971	24	management	management	NN
cord-014462-11ggaqf1	971	25	of	of	IN
cord-014462-11ggaqf1	971	26	silkworm	silkworm	NN
cord-014462-11ggaqf1	971	27	diseases	disease	NNS
cord-014462-11ggaqf1	971	28	in	in	IN
cord-014462-11ggaqf1	971	29	India	India	NNP
cord-014462-11ggaqf1	971	30	.	.	.
cord-014462-11ggaqf1	972	1	The	the	DT
cord-014462-11ggaqf1	972	2	ideal	ideal	JJ
cord-014462-11ggaqf1	972	3	disinfectant	disinfectant	NN
cord-014462-11ggaqf1	972	4	for	for	IN
cord-014462-11ggaqf1	972	5	sericulture	sericulture	NN
cord-014462-11ggaqf1	972	6	would	would	MD
cord-014462-11ggaqf1	972	7	be	be	VB
cord-014462-11ggaqf1	972	8	the	the	DT
cord-014462-11ggaqf1	972	9	one	one	NN
cord-014462-11ggaqf1	972	10	which	which	WDT
cord-014462-11ggaqf1	972	11	can	can	MD
cord-014462-11ggaqf1	972	12	inactivate	inactivate	VB
cord-014462-11ggaqf1	972	13	silkworm	silkworm	NN
cord-014462-11ggaqf1	972	14	pathogens	pathogen	NNS
cord-014462-11ggaqf1	972	15	of	of	IN
cord-014462-11ggaqf1	972	16	diverse	diverse	JJ
cord-014462-11ggaqf1	972	17	origin	origin	NN
cord-014462-11ggaqf1	972	18	and	and	CC
cord-014462-11ggaqf1	972	19	economical	economical	JJ
cord-014462-11ggaqf1	972	20	for	for	IN
cord-014462-11ggaqf1	972	21	sericulture	sericulture	NN
cord-014462-11ggaqf1	972	22	.	.	.
cord-014462-11ggaqf1	973	1	The	the	DT
cord-014462-11ggaqf1	973	2	paper	paper	NN
cord-014462-11ggaqf1	973	3	discusses	discuss	VBZ
cord-014462-11ggaqf1	973	4	on	on	IN
cord-014462-11ggaqf1	973	5	the	the	DT
cord-014462-11ggaqf1	973	6	disadvantages	disadvantage	NNS
cord-014462-11ggaqf1	973	7	of	of	IN
cord-014462-11ggaqf1	973	8	HCHO	HCHO	NNP
cord-014462-11ggaqf1	973	9	and	and	CC
cord-014462-11ggaqf1	973	10	Cl	Cl	NNP
cord-014462-11ggaqf1	973	11	2	2	CD
cord-014462-11ggaqf1	973	12	based	base	VBN
cord-014462-11ggaqf1	973	13	disinfectants	disinfectant	NNS
cord-014462-11ggaqf1	973	14	and	and	CC
cord-014462-11ggaqf1	973	15	advantages	advantage	NNS
cord-014462-11ggaqf1	973	16	of	of	IN
cord-014462-11ggaqf1	973	17	eco	eco	NN
cord-014462-11ggaqf1	973	18	-	-	:
cord-014462-11ggaqf1	973	19	and	and	CC
cord-014462-11ggaqf1	973	20	user	user	NN
cord-014462-11ggaqf1	973	21	-	-	HYPH
cord-014462-11ggaqf1	973	22	friendly	friendly	JJ
cord-014462-11ggaqf1	973	23	disinfectant	disinfectant	NN
cord-014462-11ggaqf1	973	24	for	for	IN
cord-014462-11ggaqf1	973	25	the	the	DT
cord-014462-11ggaqf1	973	26	management	management	NN
cord-014462-11ggaqf1	973	27	of	of	IN
cord-014462-11ggaqf1	973	28	silkworm	silkworm	NN
cord-014462-11ggaqf1	973	29	diseases	disease	NNS
cord-014462-11ggaqf1	973	30	especially	especially	RB
cord-014462-11ggaqf1	973	31	the	the	DT
cord-014462-11ggaqf1	973	32	ones	one	NNS
cord-014462-11ggaqf1	973	33	caused	cause	VBN
cord-014462-11ggaqf1	973	34	by	by	IN
cord-014462-11ggaqf1	973	35	viruses	virus	NNS
cord-014462-11ggaqf1	973	36	.	.	.
cord-014462-11ggaqf1	974	1	The	the	DT
cord-014462-11ggaqf1	974	2	Baculovirus	Baculovirus	NNP
cord-014462-11ggaqf1	974	3	Expression	Expression	NNP
cord-014462-11ggaqf1	974	4	Vector	Vector	NNP
cord-014462-11ggaqf1	974	5	System	System	NNP
cord-014462-11ggaqf1	974	6	(	(	-LRB-
cord-014462-11ggaqf1	974	7	BEVS	BEVS	NNP
cord-014462-11ggaqf1	974	8	)	)	-RRB-
cord-014462-11ggaqf1	974	9	is	be	VBZ
cord-014462-11ggaqf1	974	10	widely	widely	RB
cord-014462-11ggaqf1	974	11	used	use	VBN
cord-014462-11ggaqf1	974	12	for	for	IN
cord-014462-11ggaqf1	974	13	the	the	DT
cord-014462-11ggaqf1	974	14	production	production	NN
cord-014462-11ggaqf1	974	15	of	of	IN
cord-014462-11ggaqf1	974	16	high	high	JJ
cord-014462-11ggaqf1	974	17	levels	level	NNS
cord-014462-11ggaqf1	974	18	of	of	IN
cord-014462-11ggaqf1	974	19	properly	properly	RB
cord-014462-11ggaqf1	974	20	post	post	JJ
cord-014462-11ggaqf1	974	21	-	-	JJ
cord-014462-11ggaqf1	974	22	translationally	translationally	RB
cord-014462-11ggaqf1	974	23	modified	modify	VBN
cord-014462-11ggaqf1	974	24	,	,	,
cord-014462-11ggaqf1	974	25	biologically	biologically	RB
cord-014462-11ggaqf1	974	26	active	active	JJ
cord-014462-11ggaqf1	974	27	and	and	CC
cord-014462-11ggaqf1	974	28	functional	functional	JJ
cord-014462-11ggaqf1	974	29	recombinant	recombinant	JJ
cord-014462-11ggaqf1	974	30	proteins	protein	NNS
cord-014462-11ggaqf1	974	31	and	and	CC
cord-014462-11ggaqf1	974	32	has	have	VBZ
cord-014462-11ggaqf1	974	33	facilitated	facilitate	VBN
cord-014462-11ggaqf1	974	34	basic	basic	JJ
cord-014462-11ggaqf1	974	35	biomedical	biomedical	JJ
cord-014462-11ggaqf1	974	36	research	research	NN
cord-014462-11ggaqf1	974	37	on	on	IN
cord-014462-11ggaqf1	974	38	protein	protein	NN
cord-014462-11ggaqf1	974	39	structure	structure	NN
cord-014462-11ggaqf1	974	40	,	,	,
cord-014462-11ggaqf1	974	41	function	function	NN
cord-014462-11ggaqf1	974	42	,	,	,
cord-014462-11ggaqf1	974	43	drug	drug	NN
cord-014462-11ggaqf1	974	44	discovery	discovery	NN
cord-014462-11ggaqf1	974	45	and	and	CC
cord-014462-11ggaqf1	974	46	the	the	DT
cord-014462-11ggaqf1	974	47	roles	role	NNS
cord-014462-11ggaqf1	974	48	of	of	IN
cord-014462-11ggaqf1	974	49	various	various	JJ
cord-014462-11ggaqf1	974	50	proteins	protein	NNS
cord-014462-11ggaqf1	974	51	in	in	IN
cord-014462-11ggaqf1	974	52	disease	disease	NN
cord-014462-11ggaqf1	974	53	.	.	.
cord-014462-11ggaqf1	975	1	BEVS	BEVS	NNP
cord-014462-11ggaqf1	975	2	is	be	VBZ
cord-014462-11ggaqf1	975	3	based	base	VBN
cord-014462-11ggaqf1	975	4	on	on	IN
cord-014462-11ggaqf1	975	5	the	the	DT
cord-014462-11ggaqf1	975	6	introduction	introduction	NN
cord-014462-11ggaqf1	975	7	of	of	IN
cord-014462-11ggaqf1	975	8	a	a	DT
cord-014462-11ggaqf1	975	9	foreign	foreign	JJ
cord-014462-11ggaqf1	975	10	gene	gene	NN
cord-014462-11ggaqf1	975	11	into	into	IN
cord-014462-11ggaqf1	975	12	nonessential	nonessential	JJ
cord-014462-11ggaqf1	975	13	for	for	IN
cord-014462-11ggaqf1	975	14	viral	viral	JJ
cord-014462-11ggaqf1	975	15	replication	replication	NN
cord-014462-11ggaqf1	975	16	genome	genome	NN
cord-014462-11ggaqf1	975	17	region	region	NN
cord-014462-11ggaqf1	975	18	via	via	IN
cord-014462-11ggaqf1	975	19	of	of	IN
cord-014462-11ggaqf1	975	20	homologous	homologous	JJ
cord-014462-11ggaqf1	975	21	recombination	recombination	NN
cord-014462-11ggaqf1	975	22	with	with	IN
cord-014462-11ggaqf1	975	23	a	a	DT
cord-014462-11ggaqf1	975	24	transfer	transfer	NN
cord-014462-11ggaqf1	975	25	vector	vector	NN
cord-014462-11ggaqf1	975	26	containing	contain	VBG
cord-014462-11ggaqf1	975	27	target	target	NN
cord-014462-11ggaqf1	975	28	gene	gene	NN
cord-014462-11ggaqf1	975	29	.	.	.
cord-014462-11ggaqf1	976	1	The	the	DT
cord-014462-11ggaqf1	976	2	resulting	result	VBG
cord-014462-11ggaqf1	976	3	recombinant	recombinant	JJ
cord-014462-11ggaqf1	976	4	baculovirus	baculovirus	NN
cord-014462-11ggaqf1	976	5	lacks	lack	VBZ
cord-014462-11ggaqf1	976	6	one	one	CD
cord-014462-11ggaqf1	976	7	of	of	IN
cord-014462-11ggaqf1	976	8	nonessential	nonessential	JJ
cord-014462-11ggaqf1	976	9	gene	gene	NN
cord-014462-11ggaqf1	976	10	(	(	-LRB-
cord-014462-11ggaqf1	976	11	polh	polh	NN
cord-014462-11ggaqf1	976	12	,	,	,
cord-014462-11ggaqf1	976	13	v	v	NN
cord-014462-11ggaqf1	976	14	-	-	HYPH
cord-014462-11ggaqf1	976	15	cath	cath	NN
cord-014462-11ggaqf1	976	16	,	,	,
cord-014462-11ggaqf1	976	17	chiA	chia	JJ
cord-014462-11ggaqf1	976	18	etc	etc	FW
cord-014462-11ggaqf1	976	19	.	.	.
cord-014462-11ggaqf1	976	20	)	)	-RRB-
cord-014462-11ggaqf1	977	1	replaced	replace	VBN
cord-014462-11ggaqf1	977	2	with	with	IN
cord-014462-11ggaqf1	977	3	foreign	foreign	JJ
cord-014462-11ggaqf1	977	4	gene	gene	NN
cord-014462-11ggaqf1	977	5	encoding	encode	VBG
cord-014462-11ggaqf1	977	6	heterologous	heterologous	NNP
cord-014462-11ggaqf1	977	7	protein	protein	NN
cord-014462-11ggaqf1	977	8	which	which	WDT
cord-014462-11ggaqf1	977	9	can	can	MD
cord-014462-11ggaqf1	977	10	be	be	VB
cord-014462-11ggaqf1	977	11	expressed	express	VBN
cord-014462-11ggaqf1	977	12	in	in	IN
cord-014462-11ggaqf1	977	13	cultured	cultured	JJ
cord-014462-11ggaqf1	977	14	insect	insect	NN
cord-014462-11ggaqf1	977	15	cells	cell	NNS
cord-014462-11ggaqf1	977	16	and	and	CC
cord-014462-11ggaqf1	977	17	insect	insect	NN
cord-014462-11ggaqf1	977	18	larvae	larva	NNS
cord-014462-11ggaqf1	977	19	.	.	.
cord-014462-11ggaqf1	978	1	Insect	insect	NN
cord-014462-11ggaqf1	978	2	cell	cell	NN
cord-014462-11ggaqf1	978	3	-	-	:
cord-014462-11ggaqf1	978	4	BEV	BEV	NNP
cord-014462-11ggaqf1	978	5	system	system	NN
cord-014462-11ggaqf1	978	6	is	be	VBZ
cord-014462-11ggaqf1	978	7	widely	widely	RB
cord-014462-11ggaqf1	978	8	used	use	VBN
cord-014462-11ggaqf1	978	9	to	to	TO
cord-014462-11ggaqf1	978	10	produce	produce	VB
cord-014462-11ggaqf1	978	11	recombinant	recombinant	JJ
cord-014462-11ggaqf1	978	12	proteins	protein	NNS
cord-014462-11ggaqf1	978	13	.	.	.
cord-014462-11ggaqf1	979	1	BEVS	BEVS	NNP
cord-014462-11ggaqf1	979	2	also	also	RB
cord-014462-11ggaqf1	979	3	eliminates	eliminate	VBZ
cord-014462-11ggaqf1	979	4	concerns	concern	NNS
cord-014462-11ggaqf1	979	5	regarding	regard	VBG
cord-014462-11ggaqf1	979	6	pathogens	pathogen	NNS
cord-014462-11ggaqf1	979	7	that	that	WDT
cord-014462-11ggaqf1	979	8	could	could	MD
cord-014462-11ggaqf1	979	9	potentially	potentially	RB
cord-014462-11ggaqf1	979	10	be	be	VB
cord-014462-11ggaqf1	979	11	transmitted	transmit	VBN
cord-014462-11ggaqf1	979	12	to	to	IN
cord-014462-11ggaqf1	979	13	humans	human	NNS
cord-014462-11ggaqf1	979	14	as	as	IN
cord-014462-11ggaqf1	979	15	it	-PRON-	PRP
cord-014462-11ggaqf1	979	16	is	be	VBZ
cord-014462-11ggaqf1	979	17	non	non	JJ
cord-014462-11ggaqf1	979	18	-	-	JJ
cord-014462-11ggaqf1	979	19	infectious	infectious	JJ
cord-014462-11ggaqf1	979	20	to	to	IN
cord-014462-11ggaqf1	979	21	vertebral	vertebral	JJ
cord-014462-11ggaqf1	979	22	animals	animal	NNS
cord-014462-11ggaqf1	979	23	.	.	.
cord-014462-11ggaqf1	980	1	These	these	DT
cord-014462-11ggaqf1	980	2	features	feature	NNS
cord-014462-11ggaqf1	980	3	make	make	VBP
cord-014462-11ggaqf1	980	4	silkworm	silkworm	NN
cord-014462-11ggaqf1	980	5	system	system	NN
cord-014462-11ggaqf1	980	6	an	an	DT
cord-014462-11ggaqf1	980	7	ideal	ideal	JJ
cord-014462-11ggaqf1	980	8	expression	expression	NN
cord-014462-11ggaqf1	980	9	and	and	CC
cord-014462-11ggaqf1	980	10	delivery	delivery	NN
cord-014462-11ggaqf1	980	11	package	package	NN
cord-014462-11ggaqf1	980	12	for	for	IN
cord-014462-11ggaqf1	980	13	producing	produce	VBG
cord-014462-11ggaqf1	980	14	proteins	protein	NNS
cord-014462-11ggaqf1	980	15	of	of	IN
cord-014462-11ggaqf1	980	16	medicinal	medicinal	JJ
cord-014462-11ggaqf1	980	17	importance	importance	NN
cord-014462-11ggaqf1	980	18	.	.	.
cord-014462-11ggaqf1	981	1	The	the	DT
cord-014462-11ggaqf1	981	2	efficiency	efficiency	NN
cord-014462-11ggaqf1	981	3	,	,	,
cord-014462-11ggaqf1	981	4	low	low	JJ
cord-014462-11ggaqf1	981	5	cost	cost	NN
cord-014462-11ggaqf1	981	6	and	and	CC
cord-014462-11ggaqf1	981	7	large	large	JJ
cord-014462-11ggaqf1	981	8	-	-	HYPH
cord-014462-11ggaqf1	981	9	scale	scale	NN
cord-014462-11ggaqf1	981	10	production	production	NN
cord-014462-11ggaqf1	981	11	of	of	IN
cord-014462-11ggaqf1	981	12	proteins	protein	NNS
cord-014462-11ggaqf1	981	13	using	use	VBG
cord-014462-11ggaqf1	981	14	BEVS	BEVS	NNP
cord-014462-11ggaqf1	981	15	represents	represent	VBZ
cord-014462-11ggaqf1	981	16	breakthrough	breakthrough	NN
cord-014462-11ggaqf1	981	17	technology	technology	NN
cord-014462-11ggaqf1	981	18	that	that	WDT
cord-014462-11ggaqf1	981	19	is	be	VBZ
cord-014462-11ggaqf1	981	20	facilitating	facilitate	VBG
cord-014462-11ggaqf1	981	21	highthroughput	highthroughput	NN
cord-014462-11ggaqf1	981	22	proteomic	proteomic	JJ
cord-014462-11ggaqf1	981	23	studies	study	NNS
cord-014462-11ggaqf1	981	24	.	.	.
cord-014462-11ggaqf1	982	1	The	the	DT
cord-014462-11ggaqf1	982	2	BEVS	BEVS	NNP
cord-014462-11ggaqf1	982	3	has	have	VBZ
cord-014462-11ggaqf1	982	4	become	become	VBN
cord-014462-11ggaqf1	982	5	a	a	DT
cord-014462-11ggaqf1	982	6	core	core	NN
cord-014462-11ggaqf1	982	7	technology	technology	NN
cord-014462-11ggaqf1	982	8	for	for	IN
cord-014462-11ggaqf1	982	9	cloning	cloning	NN
cord-014462-11ggaqf1	982	10	and	and	CC
cord-014462-11ggaqf1	982	11	expression	expression	NN
cord-014462-11ggaqf1	982	12	of	of	IN
cord-014462-11ggaqf1	982	13	genes	gene	NNS
cord-014462-11ggaqf1	982	14	for	for	IN
cord-014462-11ggaqf1	982	15	study	study	NN
cord-014462-11ggaqf1	982	16	of	of	IN
cord-014462-11ggaqf1	982	17	protein	protein	NN
cord-014462-11ggaqf1	982	18	structure	structure	NN
cord-014462-11ggaqf1	982	19	,	,	,
cord-014462-11ggaqf1	982	20	processing	processing	NN
cord-014462-11ggaqf1	982	21	and	and	CC
cord-014462-11ggaqf1	982	22	function	function	NN
cord-014462-11ggaqf1	982	23	;	;	:
cord-014462-11ggaqf1	982	24	production	production	NN
cord-014462-11ggaqf1	982	25	of	of	IN
cord-014462-11ggaqf1	982	26	biochemical	biochemical	JJ
cord-014462-11ggaqf1	982	27	reagents	reagent	NNS
cord-014462-11ggaqf1	982	28	;	;	:
cord-014462-11ggaqf1	982	29	study	study	NN
cord-014462-11ggaqf1	982	30	of	of	IN
cord-014462-11ggaqf1	982	31	regulation	regulation	NN
cord-014462-11ggaqf1	982	32	of	of	IN
cord-014462-11ggaqf1	982	33	gene	gene	NN
cord-014462-11ggaqf1	982	34	expression	expression	NN
cord-014462-11ggaqf1	982	35	;	;	:
cord-014462-11ggaqf1	982	36	commercial	commercial	JJ
cord-014462-11ggaqf1	982	37	exploration	exploration	NN
cord-014462-11ggaqf1	982	38	,	,	,
cord-014462-11ggaqf1	982	39	development	development	NN
cord-014462-11ggaqf1	982	40	and	and	CC
cord-014462-11ggaqf1	982	41	production	production	NN
cord-014462-11ggaqf1	982	42	of	of	IN
cord-014462-11ggaqf1	982	43	vaccines	vaccine	NNS
cord-014462-11ggaqf1	982	44	,	,	,
cord-014462-11ggaqf1	982	45	therapeutics	therapeutic	NNS
cord-014462-11ggaqf1	982	46	and	and	CC
cord-014462-11ggaqf1	982	47	diagnostics	diagnostic	NNS
cord-014462-11ggaqf1	982	48	;	;	:
cord-014462-11ggaqf1	982	49	drug	drug	NN
cord-014462-11ggaqf1	982	50	discovery	discovery	NN
cord-014462-11ggaqf1	982	51	research	research	NN
cord-014462-11ggaqf1	982	52	;	;	:
cord-014462-11ggaqf1	982	53	exploration	exploration	NN
cord-014462-11ggaqf1	982	54	and	and	CC
cord-014462-11ggaqf1	982	55	development	development	NN
cord-014462-11ggaqf1	982	56	of	of	IN
cord-014462-11ggaqf1	982	57	safer	safe	JJR
cord-014462-11ggaqf1	982	58	,	,	,
cord-014462-11ggaqf1	982	59	more	more	RBR
cord-014462-11ggaqf1	982	60	selective	selective	JJ
cord-014462-11ggaqf1	982	61	and	and	CC
cord-014462-11ggaqf1	982	62	environmentally	environmentally	RB
cord-014462-11ggaqf1	982	63	compatible	compatible	JJ
cord-014462-11ggaqf1	982	64	biopesticides	biopesticide	NNS
cord-014462-11ggaqf1	982	65	.	.	.
cord-014462-11ggaqf1	983	1	Utilization	utilization	NN
cord-014462-11ggaqf1	983	2	of	of	IN
cord-014462-11ggaqf1	983	3	silkworm	silkworm	NN
cord-014462-11ggaqf1	983	4	larvae	larva	NNS
cord-014462-11ggaqf1	983	5	and	and	CC
cord-014462-11ggaqf1	983	6	pupae	pupa	NNS
cord-014462-11ggaqf1	983	7	as	as	IN
cord-014462-11ggaqf1	983	8	bioreactor	bioreactor	NN
cord-014462-11ggaqf1	983	9	with	with	IN
cord-014462-11ggaqf1	983	10	recombinant	recombinant	JJ
cord-014462-11ggaqf1	983	11	BmNPV	BmNPV	NNP
cord-014462-11ggaqf1	983	12	producing	produce	VBG
cord-014462-11ggaqf1	983	13	foreign	foreign	JJ
cord-014462-11ggaqf1	983	14	proteins	protein	NNS
cord-014462-11ggaqf1	983	15	extends	extend	VBZ
cord-014462-11ggaqf1	983	16	the	the	DT
cord-014462-11ggaqf1	983	17	usages	usage	NNS
cord-014462-11ggaqf1	983	18	of	of	IN
cord-014462-11ggaqf1	983	19	silkworms	silkworm	NNS
cord-014462-11ggaqf1	983	20	.	.	.
cord-014462-11ggaqf1	984	1	Due	due	IN
cord-014462-11ggaqf1	984	2	to	to	IN
cord-014462-11ggaqf1	984	3	its	-PRON-	PRP$
cord-014462-11ggaqf1	984	4	large	large	JJ
cord-014462-11ggaqf1	984	5	-	-	HYPH
cord-014462-11ggaqf1	984	6	size	size	NN
cord-014462-11ggaqf1	984	7	and	and	CC
cord-014462-11ggaqf1	984	8	high	high	JJ
cord-014462-11ggaqf1	984	9	protein	protein	NN
cord-014462-11ggaqf1	984	10	synthesis	synthesis	NN
cord-014462-11ggaqf1	984	11	ability	ability	NN
cord-014462-11ggaqf1	984	12	as	as	RB
cord-014462-11ggaqf1	984	13	well	well	RB
cord-014462-11ggaqf1	984	14	as	as	IN
cord-014462-11ggaqf1	984	15	the	the	DT
cord-014462-11ggaqf1	984	16	expediency	expediency	NN
cord-014462-11ggaqf1	984	17	in	in	IN
cord-014462-11ggaqf1	984	18	mass	mass	NN
cord-014462-11ggaqf1	984	19	culture	culture	NN
cord-014462-11ggaqf1	984	20	,	,	,
cord-014462-11ggaqf1	984	21	silkworm	silkworm	NN
cord-014462-11ggaqf1	984	22	is	be	VBZ
cord-014462-11ggaqf1	984	23	considered	consider	VBN
cord-014462-11ggaqf1	984	24	as	as	IN
cord-014462-11ggaqf1	984	25	good	good	JJ
cord-014462-11ggaqf1	984	26	candidate	candidate	NN
cord-014462-11ggaqf1	984	27	for	for	IN
cord-014462-11ggaqf1	984	28	producing	produce	VBG
cord-014462-11ggaqf1	984	29	recombinant	recombinant	JJ
cord-014462-11ggaqf1	984	30	proteins	protein	NNS
cord-014462-11ggaqf1	984	31	.	.	.
cord-014462-11ggaqf1	985	1	WSSBV	WSSBV	NNP
cord-014462-11ggaqf1	985	2	is	be	VBZ
cord-014462-11ggaqf1	985	3	the	the	DT
cord-014462-11ggaqf1	985	4	causative	causative	JJ
cord-014462-11ggaqf1	985	5	agent	agent	NN
cord-014462-11ggaqf1	985	6	of	of	IN
cord-014462-11ggaqf1	985	7	a	a	DT
cord-014462-11ggaqf1	985	8	disease	disease	NN
cord-014462-11ggaqf1	985	9	,	,	,
cord-014462-11ggaqf1	985	10	which	which	WDT
cord-014462-11ggaqf1	985	11	has	have	VBZ
cord-014462-11ggaqf1	985	12	recently	recently	RB
cord-014462-11ggaqf1	985	13	caused	cause	VBN
cord-014462-11ggaqf1	985	14	high	high	JJ
cord-014462-11ggaqf1	985	15	shrimp	shrimp	NN
cord-014462-11ggaqf1	985	16	mortalities	mortality	NNS
cord-014462-11ggaqf1	985	17	and	and	CC
cord-014462-11ggaqf1	985	18	severe	severe	JJ
cord-014462-11ggaqf1	985	19	damage	damage	NN
cord-014462-11ggaqf1	985	20	to	to	IN
cord-014462-11ggaqf1	985	21	shrimp	shrimp	NN
cord-014462-11ggaqf1	985	22	culture	culture	NN
cord-014462-11ggaqf1	985	23	.	.	.
cord-014462-11ggaqf1	986	1	WSSBV	WSSBV	NNP
cord-014462-11ggaqf1	986	2	has	have	VBZ
cord-014462-11ggaqf1	986	3	been	be	VBN
cord-014462-11ggaqf1	986	4	found	find	VBN
cord-014462-11ggaqf1	986	5	across	across	IN
cord-014462-11ggaqf1	986	6	different	different	JJ
cord-014462-11ggaqf1	986	7	penaeid	penaeid	NN
cord-014462-11ggaqf1	986	8	shrimp	shrimp	NN
cord-014462-11ggaqf1	986	9	species	specie	NNS
cord-014462-11ggaqf1	986	10	.	.	.
cord-014462-11ggaqf1	987	1	In	in	IN
cord-014462-11ggaqf1	987	2	order	order	NN
cord-014462-11ggaqf1	987	3	to	to	TO
cord-014462-11ggaqf1	987	4	develop	develop	VB
cord-014462-11ggaqf1	987	5	a	a	DT
cord-014462-11ggaqf1	987	6	effective	effective	JJ
cord-014462-11ggaqf1	987	7	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	987	8	tool	tool	NN
cord-014462-11ggaqf1	987	9	,	,	,
cord-014462-11ggaqf1	987	10	a	a	DT
cord-014462-11ggaqf1	987	11	WSSBV	WSSBV	NNP
cord-014462-11ggaqf1	987	12	genomic	genomic	JJ
cord-014462-11ggaqf1	987	13	library	library	NN
cord-014462-11ggaqf1	987	14	was	be	VBD
cord-014462-11ggaqf1	987	15	constructed	construct	VBN
cord-014462-11ggaqf1	987	16	by	by	IN
cord-014462-11ggaqf1	987	17	cloning	clone	VBG
cord-014462-11ggaqf1	987	18	WSSBV	WSSBV	NNP
cord-014462-11ggaqf1	987	19	genomic	genomic	JJ
cord-014462-11ggaqf1	987	20	DNA	dna	NN
cord-014462-11ggaqf1	987	21	extracted	extract	VBN
cord-014462-11ggaqf1	987	22	from	from	IN
cord-014462-11ggaqf1	987	23	purified	purify	VBN
cord-014462-11ggaqf1	987	24	virions	virion	NNS
cord-014462-11ggaqf1	987	25	.	.	.
cord-014462-11ggaqf1	988	1	In	in	IN
cord-014462-11ggaqf1	988	2	the	the	DT
cord-014462-11ggaqf1	988	3	present	present	JJ
cord-014462-11ggaqf1	988	4	study	study	NN
cord-014462-11ggaqf1	988	5	WSSV	WSSV	NNP
cord-014462-11ggaqf1	988	6	disease	disease	NN
cord-014462-11ggaqf1	988	7	free	free	JJ
cord-014462-11ggaqf1	988	8	(	(	-LRB-
cord-014462-11ggaqf1	988	9	confirmed	confirm	VBN
cord-014462-11ggaqf1	988	10	by	by	IN
cord-014462-11ggaqf1	988	11	PCR	PCR	NNP
cord-014462-11ggaqf1	988	12	analysis	analysis	NN
cord-014462-11ggaqf1	988	13	)	)	-RRB-
cord-014462-11ggaqf1	988	14	were	be	VBD
cord-014462-11ggaqf1	988	15	collected	collect	VBN
cord-014462-11ggaqf1	988	16	from	from	IN
cord-014462-11ggaqf1	988	17	hatcheries	hatchery	NNS
cord-014462-11ggaqf1	988	18	from	from	IN
cord-014462-11ggaqf1	988	19	different	different	JJ
cord-014462-11ggaqf1	988	20	areas	area	NNS
cord-014462-11ggaqf1	988	21	of	of	IN
cord-014462-11ggaqf1	988	22	Guntur	Guntur	NNP
cord-014462-11ggaqf1	988	23	and	and	CC
cord-014462-11ggaqf1	988	24	Prakasam	Prakasam	NNP
cord-014462-11ggaqf1	988	25	districts	district	NNS
cord-014462-11ggaqf1	988	26	and	and	CC
cord-014462-11ggaqf1	988	27	analysed	analyse	VBD
cord-014462-11ggaqf1	988	28	to	to	TO
cord-014462-11ggaqf1	988	29	study	study	VB
cord-014462-11ggaqf1	988	30	the	the	DT
cord-014462-11ggaqf1	988	31	effect	effect	NN
cord-014462-11ggaqf1	988	32	of	of	IN
cord-014462-11ggaqf1	988	33	various	various	JJ
cord-014462-11ggaqf1	988	34	physical	physical	JJ
cord-014462-11ggaqf1	988	35	parameters	parameter	NNS
cord-014462-11ggaqf1	988	36	like	like	IN
cord-014462-11ggaqf1	988	37	temperature	temperature	NN
cord-014462-11ggaqf1	988	38	,	,	,
cord-014462-11ggaqf1	988	39	p	p	NN
cord-014462-11ggaqf1	988	40	H	h	NN
cord-014462-11ggaqf1	988	41	,	,	,
cord-014462-11ggaqf1	988	42	salinity	salinity	NN
cord-014462-11ggaqf1	988	43	and	and	CC
cord-014462-11ggaqf1	988	44	turbidity	turbidity	NN
cord-014462-11ggaqf1	988	45	on	on	IN
cord-014462-11ggaqf1	988	46	the	the	DT
cord-014462-11ggaqf1	988	47	prevalence	prevalence	NN
cord-014462-11ggaqf1	988	48	of	of	IN
cord-014462-11ggaqf1	988	49	above	above	JJ
cord-014462-11ggaqf1	988	50	disease	disease	NN
cord-014462-11ggaqf1	988	51	.	.	.
cord-014462-11ggaqf1	989	1	The	the	DT
cord-014462-11ggaqf1	989	2	studies	study	NNS
cord-014462-11ggaqf1	989	3	on	on	IN
cord-014462-11ggaqf1	989	4	the	the	DT
cord-014462-11ggaqf1	989	5	surface	surface	NN
cord-014462-11ggaqf1	989	6	water	water	NN
cord-014462-11ggaqf1	989	7	temperature	temperature	NN
cord-014462-11ggaqf1	989	8	revealed	reveal	VBD
cord-014462-11ggaqf1	989	9	fluctuations	fluctuation	NNS
cord-014462-11ggaqf1	989	10	in	in	IN
cord-014462-11ggaqf1	989	11	the	the	DT
cord-014462-11ggaqf1	989	12	ponds	pond	NNS
cord-014462-11ggaqf1	989	13	ranging	range	VBG
cord-014462-11ggaqf1	989	14	between	between	IN
cord-014462-11ggaqf1	989	15	19	19	CD
cord-014462-11ggaqf1	989	16	to	to	IN
cord-014462-11ggaqf1	989	17	30.2	30.2	CD
cord-014462-11ggaqf1	989	18	°	°	NN
cord-014462-11ggaqf1	989	19	C	c	NN
cord-014462-11ggaqf1	989	20	in	in	IN
cord-014462-11ggaqf1	989	21	diseased	diseased	JJ
cord-014462-11ggaqf1	989	22	ponds	pond	NNS
cord-014462-11ggaqf1	989	23	and	and	CC
cord-014462-11ggaqf1	989	24	25.2	25.2	CD
cord-014462-11ggaqf1	989	25	to	to	IN
cord-014462-11ggaqf1	989	26	34.5	34.5	CD
cord-014462-11ggaqf1	989	27	°	°	NN
cord-014462-11ggaqf1	989	28	C	c	NN
cord-014462-11ggaqf1	989	29	in	in	IN
cord-014462-11ggaqf1	989	30	healthy	healthy	JJ
cord-014462-11ggaqf1	989	31	ponds	pond	NNS
cord-014462-11ggaqf1	989	32	.	.	.
cord-014462-11ggaqf1	990	1	These	these	DT
cord-014462-11ggaqf1	990	2	results	result	NNS
cord-014462-11ggaqf1	990	3	show	show	VBP
cord-014462-11ggaqf1	990	4	definite	definite	JJ
cord-014462-11ggaqf1	990	5	influence	influence	NN
cord-014462-11ggaqf1	990	6	of	of	IN
cord-014462-11ggaqf1	990	7	temperature	temperature	NN
cord-014462-11ggaqf1	990	8	on	on	IN
cord-014462-11ggaqf1	990	9	the	the	DT
cord-014462-11ggaqf1	990	10	prevalence	prevalence	NN
cord-014462-11ggaqf1	990	11	of	of	IN
cord-014462-11ggaqf1	990	12	WSSV	WSSV	NNP
cord-014462-11ggaqf1	990	13	.	.	.
cord-014462-11ggaqf1	991	1	Present	present	JJ
cord-014462-11ggaqf1	991	2	day	day	NN
cord-014462-11ggaqf1	991	3	strategy	strategy	NN
cord-014462-11ggaqf1	991	4	in	in	IN
cord-014462-11ggaqf1	991	5	vaccine	vaccine	NN
cord-014462-11ggaqf1	991	6	development	development	NN
cord-014462-11ggaqf1	991	7	is	be	VBZ
cord-014462-11ggaqf1	991	8	to	to	TO
cord-014462-11ggaqf1	991	9	include	include	VB
cord-014462-11ggaqf1	991	10	marker	marker	NN
cord-014462-11ggaqf1	991	11	facility	facility	NN
cord-014462-11ggaqf1	991	12	that	that	WDT
cord-014462-11ggaqf1	991	13	helps	help	VBZ
cord-014462-11ggaqf1	991	14	in	in	IN
cord-014462-11ggaqf1	991	15	distinguishing	distinguish	VBG
cord-014462-11ggaqf1	991	16	antibody	antibody	NN
cord-014462-11ggaqf1	991	17	response	response	NN
cord-014462-11ggaqf1	991	18	due	due	IN
cord-014462-11ggaqf1	991	19	to	to	IN
cord-014462-11ggaqf1	991	20	vaccination	vaccination	NN
cord-014462-11ggaqf1	991	21	vis	vis	FW
cord-014462-11ggaqf1	991	22	-	-	HYPH
cord-014462-11ggaqf1	991	23	à	à	FW
cord-014462-11ggaqf1	991	24	-	-	HYPH
cord-014462-11ggaqf1	991	25	vis	vis	FW
cord-014462-11ggaqf1	991	26	infection	infection	NN
cord-014462-11ggaqf1	991	27	in	in	IN
cord-014462-11ggaqf1	991	28	vaccinated	vaccinated	JJ
cord-014462-11ggaqf1	991	29	animals	animal	NNS
cord-014462-11ggaqf1	991	30	.	.	.
cord-014462-11ggaqf1	992	1	Such	such	JJ
cord-014462-11ggaqf1	992	2	information	information	NN
cord-014462-11ggaqf1	992	3	becomes	become	VBZ
cord-014462-11ggaqf1	992	4	relevant	relevant	JJ
cord-014462-11ggaqf1	992	5	for	for	IN
cord-014462-11ggaqf1	992	6	effective	effective	JJ
cord-014462-11ggaqf1	992	7	disease	disease	NN
cord-014462-11ggaqf1	992	8	control	control	NN
cord-014462-11ggaqf1	992	9	programmes	programme	NNS
cord-014462-11ggaqf1	992	10	especially	especially	RB
cord-014462-11ggaqf1	992	11	when	when	WRB
cord-014462-11ggaqf1	992	12	using	use	VBG
cord-014462-11ggaqf1	992	13	inactivated	inactivate	VBN
cord-014462-11ggaqf1	992	14	virus	virus	NN
cord-014462-11ggaqf1	992	15	vaccines	vaccine	NNS
cord-014462-11ggaqf1	992	16	like	like	IN
cord-014462-11ggaqf1	992	17	foot	foot	NN
cord-014462-11ggaqf1	992	18	and	and	CC
cord-014462-11ggaqf1	992	19	mouth	mouth	NN
cord-014462-11ggaqf1	992	20	disease	disease	NN
cord-014462-11ggaqf1	992	21	(	(	-LRB-
cord-014462-11ggaqf1	992	22	FMD	FMD	NNP
cord-014462-11ggaqf1	992	23	)	)	-RRB-
cord-014462-11ggaqf1	992	24	.	.	.
cord-014462-11ggaqf1	993	1	The	the	DT
cord-014462-11ggaqf1	993	2	antibodies	antibody	NNS
cord-014462-11ggaqf1	993	3	generated	generate	VBN
cord-014462-11ggaqf1	993	4	in	in	IN
cord-014462-11ggaqf1	993	5	the	the	DT
cord-014462-11ggaqf1	993	6	animals	animal	NNS
cord-014462-11ggaqf1	993	7	,	,	,
cord-014462-11ggaqf1	993	8	only	only	RB
cord-014462-11ggaqf1	993	9	through	through	IN
cord-014462-11ggaqf1	993	10	vaccination	vaccination	NN
cord-014462-11ggaqf1	993	11	,	,	,
cord-014462-11ggaqf1	993	12	is	be	VBZ
cord-014462-11ggaqf1	993	13	the	the	DT
cord-014462-11ggaqf1	993	14	measure	measure	NN
cord-014462-11ggaqf1	993	15	of	of	IN
cord-014462-11ggaqf1	993	16	vaccine	vaccine	NN
cord-014462-11ggaqf1	993	17	efficacy	efficacy	NN
cord-014462-11ggaqf1	993	18	and	and	CC
cord-014462-11ggaqf1	993	19	safety	safety	NN
cord-014462-11ggaqf1	993	20	.	.	.
cord-014462-11ggaqf1	994	1	Presently	presently	RB
cord-014462-11ggaqf1	994	2	inactivated	inactivate	VBN
cord-014462-11ggaqf1	994	3	FMD	FMD	NNP
cord-014462-11ggaqf1	994	4	virus	virus	NN
cord-014462-11ggaqf1	994	5	(	(	-LRB-
cord-014462-11ggaqf1	994	6	FMDV	FMDV	NNP
cord-014462-11ggaqf1	994	7	)	)	-RRB-
cord-014462-11ggaqf1	994	8	vaccines	vaccine	NNS
cord-014462-11ggaqf1	994	9	are	be	VBP
cord-014462-11ggaqf1	994	10	used	use	VBN
cord-014462-11ggaqf1	994	11	to	to	TO
cord-014462-11ggaqf1	994	12	control	control	VB
cord-014462-11ggaqf1	994	13	the	the	DT
cord-014462-11ggaqf1	994	14	disease	disease	NN
cord-014462-11ggaqf1	994	15	in	in	IN
cord-014462-11ggaqf1	994	16	the	the	DT
cord-014462-11ggaqf1	994	17	endemic	endemic	JJ
cord-014462-11ggaqf1	994	18	countries	country	NNS
cord-014462-11ggaqf1	994	19	like	like	IN
cord-014462-11ggaqf1	994	20	India	India	NNP
cord-014462-11ggaqf1	994	21	.	.	.
cord-014462-11ggaqf1	995	1	The	the	DT
cord-014462-11ggaqf1	995	2	quality	quality	NN
cord-014462-11ggaqf1	995	3	assurance	assurance	NN
cord-014462-11ggaqf1	995	4	of	of	IN
cord-014462-11ggaqf1	995	5	the	the	DT
cord-014462-11ggaqf1	995	6	vaccine	vaccine	NN
cord-014462-11ggaqf1	995	7	depends	depend	VBZ
cord-014462-11ggaqf1	995	8	on	on	IN
cord-014462-11ggaqf1	995	9	the	the	DT
cord-014462-11ggaqf1	995	10	efficacy	efficacy	NN
cord-014462-11ggaqf1	995	11	of	of	IN
cord-014462-11ggaqf1	995	12	the	the	DT
cord-014462-11ggaqf1	995	13	vaccine	vaccine	NN
cord-014462-11ggaqf1	995	14	in	in	IN
cord-014462-11ggaqf1	995	15	generating	generate	VBG
cord-014462-11ggaqf1	995	16	protective	protective	JJ
cord-014462-11ggaqf1	995	17	antibody	antibody	NN
cord-014462-11ggaqf1	995	18	without	without	IN
cord-014462-11ggaqf1	995	19	causing	cause	VBG
cord-014462-11ggaqf1	995	20	subclinical	subclinical	JJ
cord-014462-11ggaqf1	995	21	disease	disease	NN
cord-014462-11ggaqf1	995	22	due	due	IN
cord-014462-11ggaqf1	995	23	to	to	IN
cord-014462-11ggaqf1	995	24	improper	improper	JJ
cord-014462-11ggaqf1	995	25	inactivation	inactivation	NN
cord-014462-11ggaqf1	995	26	.	.	.
cord-014462-11ggaqf1	996	1	Since	since	IN
cord-014462-11ggaqf1	996	2	protective	protective	JJ
cord-014462-11ggaqf1	996	3	antibody	antibody	NN
cord-014462-11ggaqf1	996	4	response	response	NN
cord-014462-11ggaqf1	996	5	in	in	IN
cord-014462-11ggaqf1	996	6	vaccinated	vaccinate	VBN
cord-014462-11ggaqf1	996	7	animals	animal	NNS
cord-014462-11ggaqf1	996	8	can	can	MD
cord-014462-11ggaqf1	996	9	not	not	RB
cord-014462-11ggaqf1	996	10	be	be	VB
cord-014462-11ggaqf1	996	11	distinguished	distinguish	VBN
cord-014462-11ggaqf1	996	12	from	from	IN
cord-014462-11ggaqf1	996	13	that	that	DT
cord-014462-11ggaqf1	996	14	of	of	IN
cord-014462-11ggaqf1	996	15	infected	infected	JJ
cord-014462-11ggaqf1	996	16	animals	animal	NNS
cord-014462-11ggaqf1	996	17	one	one	PRP
cord-014462-11ggaqf1	996	18	needs	need	VBZ
cord-014462-11ggaqf1	996	19	to	to	TO
cord-014462-11ggaqf1	996	20	assay	assay	VB
cord-014462-11ggaqf1	996	21	the	the	DT
cord-014462-11ggaqf1	996	22	antibody	antibody	NN
cord-014462-11ggaqf1	996	23	response	response	NN
cord-014462-11ggaqf1	996	24	against	against	IN
cord-014462-11ggaqf1	996	25	non	non	JJ
cord-014462-11ggaqf1	996	26	structural	structural	JJ
cord-014462-11ggaqf1	996	27	proteins	protein	NNS
cord-014462-11ggaqf1	996	28	(	(	-LRB-
cord-014462-11ggaqf1	996	29	NSPs	NSPs	NNP
cord-014462-11ggaqf1	996	30	)	)	-RRB-
cord-014462-11ggaqf1	996	31	and	and	CC
cord-014462-11ggaqf1	996	32	the	the	DT
cord-014462-11ggaqf1	996	33	vaccine	vaccine	NN
cord-014462-11ggaqf1	996	34	must	must	MD
cord-014462-11ggaqf1	996	35	be	be	VB
cord-014462-11ggaqf1	996	36	free	free	JJ
cord-014462-11ggaqf1	996	37	of	of	IN
cord-014462-11ggaqf1	996	38	contaminated	contaminated	JJ
cord-014462-11ggaqf1	996	39	NSPs	nsp	NNS
cord-014462-11ggaqf1	996	40	.	.	.
cord-014462-11ggaqf1	997	1	Production	production	NN
cord-014462-11ggaqf1	997	2	of	of	IN
cord-014462-11ggaqf1	997	3	vaccine	vaccine	NN
cord-014462-11ggaqf1	997	4	free	free	JJ
cord-014462-11ggaqf1	997	5	of	of	IN
cord-014462-11ggaqf1	997	6	NSPs	nsp	NNS
cord-014462-11ggaqf1	997	7	requires	require	VBZ
cord-014462-11ggaqf1	997	8	the	the	DT
cord-014462-11ggaqf1	997	9	cumbersome	cumbersome	JJ
cord-014462-11ggaqf1	997	10	method	method	NN
cord-014462-11ggaqf1	997	11	of	of	IN
cord-014462-11ggaqf1	997	12	virus	virus	NN
cord-014462-11ggaqf1	997	13	purification	purification	NN
cord-014462-11ggaqf1	997	14	which	which	WDT
cord-014462-11ggaqf1	997	15	adds	add	VBZ
cord-014462-11ggaqf1	997	16	to	to	IN
cord-014462-11ggaqf1	997	17	the	the	DT
cord-014462-11ggaqf1	997	18	cost	cost	NN
cord-014462-11ggaqf1	997	19	of	of	IN
cord-014462-11ggaqf1	997	20	the	the	DT
cord-014462-11ggaqf1	997	21	vaccine	vaccine	NN
cord-014462-11ggaqf1	997	22	.	.	.
cord-014462-11ggaqf1	998	1	Alternatively	alternatively	RB
cord-014462-11ggaqf1	998	2	one	one	PRP
cord-014462-11ggaqf1	998	3	may	may	MD
cord-014462-11ggaqf1	998	4	develop	develop	VB
cord-014462-11ggaqf1	998	5	a	a	DT
cord-014462-11ggaqf1	998	6	positive	positive	JJ
cord-014462-11ggaqf1	998	7	marker	marker	NN
cord-014462-11ggaqf1	998	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	998	9	by	by	IN
cord-014462-11ggaqf1	998	10	including	include	VBG
cord-014462-11ggaqf1	998	11	a	a	DT
cord-014462-11ggaqf1	998	12	foreign	foreign	JJ
cord-014462-11ggaqf1	998	13	protein	protein	NN
cord-014462-11ggaqf1	998	14	or	or	CC
cord-014462-11ggaqf1	998	15	epitope	epitope	NN
cord-014462-11ggaqf1	998	16	which	which	WDT
cord-014462-11ggaqf1	998	17	is	be	VBZ
cord-014462-11ggaqf1	998	18	not	not	RB
cord-014462-11ggaqf1	998	19	expected	expect	VBN
cord-014462-11ggaqf1	998	20	to	to	TO
cord-014462-11ggaqf1	998	21	be	be	VB
cord-014462-11ggaqf1	998	22	present	present	JJ
cord-014462-11ggaqf1	998	23	in	in	IN
cord-014462-11ggaqf1	998	24	the	the	DT
cord-014462-11ggaqf1	998	25	vaccine	vaccine	NN
cord-014462-11ggaqf1	998	26	and	and	CC
cord-014462-11ggaqf1	998	27	the	the	DT
cord-014462-11ggaqf1	998	28	antibodies	antibody	NNS
cord-014462-11ggaqf1	998	29	generated	generate	VBN
cord-014462-11ggaqf1	998	30	against	against	IN
cord-014462-11ggaqf1	998	31	which	which	WDT
cord-014462-11ggaqf1	998	32	helps	help	VBZ
cord-014462-11ggaqf1	998	33	in	in	IN
cord-014462-11ggaqf1	998	34	detecting	detect	VBG
cord-014462-11ggaqf1	998	35	the	the	DT
cord-014462-11ggaqf1	998	36	vaccine	vaccine	NN
cord-014462-11ggaqf1	998	37	related	relate	VBN
cord-014462-11ggaqf1	998	38	response	response	NN
cord-014462-11ggaqf1	998	39	.	.	.
cord-014462-11ggaqf1	999	1	Here	here	RB
cord-014462-11ggaqf1	999	2	we	-PRON-	PRP
cord-014462-11ggaqf1	999	3	report	report	VBP
cord-014462-11ggaqf1	999	4	a	a	DT
cord-014462-11ggaqf1	999	5	molecular	molecular	JJ
cord-014462-11ggaqf1	999	6	approach	approach	NN
cord-014462-11ggaqf1	999	7	by	by	IN
cord-014462-11ggaqf1	999	8	which	which	WDT
cord-014462-11ggaqf1	999	9	we	-PRON-	PRP
cord-014462-11ggaqf1	999	10	introduced	introduce	VBD
cord-014462-11ggaqf1	999	11	a	a	DT
cord-014462-11ggaqf1	999	12	immuno	immuno	JJ
cord-014462-11ggaqf1	999	13	-	-	JJ
cord-014462-11ggaqf1	999	14	dominant	dominant	JJ
cord-014462-11ggaqf1	999	15	epitope	epitope	NN
cord-014462-11ggaqf1	999	16	of	of	IN
cord-014462-11ggaqf1	999	17	green	green	JJ
cord-014462-11ggaqf1	999	18	fluorescent	fluorescent	NN
cord-014462-11ggaqf1	999	19	protein	protein	NN
cord-014462-11ggaqf1	999	20	(	(	-LRB-
cord-014462-11ggaqf1	999	21	GFP	GFP	NNP
cord-014462-11ggaqf1	999	22	)	)	-RRB-
cord-014462-11ggaqf1	999	23	into	into	IN
cord-014462-11ggaqf1	999	24	the	the	DT
cord-014462-11ggaqf1	999	25	structural	structural	JJ
cord-014462-11ggaqf1	999	26	protein	protein	NN
cord-014462-11ggaqf1	999	27	gene	gene	NN
cord-014462-11ggaqf1	999	28	of	of	IN
cord-014462-11ggaqf1	999	29	foot	foot	NN
cord-014462-11ggaqf1	999	30	and	and	CC
cord-014462-11ggaqf1	999	31	mouth	mouth	NN
cord-014462-11ggaqf1	999	32	disease	disease	NNP
cord-014462-11ggaqf1	999	33	virus	virus	NN
cord-014462-11ggaqf1	999	34	vaccine	vaccine	NN
cord-014462-11ggaqf1	1000	1	strain	strain	VB
cord-014462-11ggaqf1	1000	2	Asia	Asia	NNP
cord-014462-11ggaqf1	1000	3	1	1	CD
cord-014462-11ggaqf1	1000	4	(	(	-LRB-
cord-014462-11ggaqf1	1000	5	63/72	63/72	CD
cord-014462-11ggaqf1	1000	6	)	)	-RRB-
cord-014462-11ggaqf1	1000	7	.	.	.
cord-014462-11ggaqf1	1001	1	Our	-PRON-	PRP$
cord-014462-11ggaqf1	1001	2	laboratory	laboratory	NN
cord-014462-11ggaqf1	1001	3	has	have	VBZ
cord-014462-11ggaqf1	1001	4	produced	produce	VBN
cord-014462-11ggaqf1	1001	5	a	a	DT
cord-014462-11ggaqf1	1001	6	mini	mini	NN
cord-014462-11ggaqf1	1001	7	-	-	NN
cord-014462-11ggaqf1	1001	8	genome	genome	NN
cord-014462-11ggaqf1	1001	9	of	of	IN
cord-014462-11ggaqf1	1001	10	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1001	11	Asia	Asia	NNP
cord-014462-11ggaqf1	1001	12	1	1	CD
cord-014462-11ggaqf1	1001	13	that	that	WDT
cord-014462-11ggaqf1	1001	14	lacks	lack	VBZ
cord-014462-11ggaqf1	1001	15	structural	structural	JJ
cord-014462-11ggaqf1	1001	16	protein	protein	NN
cord-014462-11ggaqf1	1001	17	gene	gene	NN
cord-014462-11ggaqf1	1001	18	(	(	-LRB-
cord-014462-11ggaqf1	1001	19	P1	P1	NNP
cord-014462-11ggaqf1	1001	20	-	-	HYPH
cord-014462-11ggaqf1	1001	21	2A	2a	CD
cord-014462-11ggaqf1	1001	22	)	)	-RRB-
cord-014462-11ggaqf1	1001	23	coding	code	VBG
cord-014462-11ggaqf1	1001	24	for	for	IN
cord-014462-11ggaqf1	1001	25	all	all	PDT
cord-014462-11ggaqf1	1001	26	the	the	DT
cord-014462-11ggaqf1	1001	27	structural	structural	JJ
cord-014462-11ggaqf1	1001	28	proteins	protein	NNS
cord-014462-11ggaqf1	1001	29	(	(	-LRB-
cord-014462-11ggaqf1	1001	30	VP1	VP1	NNP
cord-014462-11ggaqf1	1001	31	-	-	HYPH
cord-014462-11ggaqf1	1001	32	4	4	CD
cord-014462-11ggaqf1	1001	33	)	)	-RRB-
cord-014462-11ggaqf1	1001	34	of	of	IN
cord-014462-11ggaqf1	1001	35	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1001	36	Asia	Asia	NNP
cord-014462-11ggaqf1	1001	37	1	1	CD
cord-014462-11ggaqf1	1001	38	as	as	IN
cord-014462-11ggaqf1	1001	39	a	a	DT
cord-014462-11ggaqf1	1001	40	vector	vector	NN
cord-014462-11ggaqf1	1001	41	(	(	-LRB-
cord-014462-11ggaqf1	1001	42	pCFL	pCFL	NNP
cord-014462-11ggaqf1	1001	43	DAsia	DAsia	NNP
cord-014462-11ggaqf1	1001	44	1	1	CD
cord-014462-11ggaqf1	1001	45	)	)	-RRB-
cord-014462-11ggaqf1	1001	46	.	.	.
cord-014462-11ggaqf1	1002	1	The	the	DT
cord-014462-11ggaqf1	1002	2	P1	P1	NNP
cord-014462-11ggaqf1	1002	3	-	-	HYPH
cord-014462-11ggaqf1	1002	4	2A	2a	CD
cord-014462-11ggaqf1	1002	5	of	of	IN
cord-014462-11ggaqf1	1002	6	the	the	DT
cord-014462-11ggaqf1	1002	7	Asia	Asia	NNP
cord-014462-11ggaqf1	1002	8	1	1	CD
cord-014462-11ggaqf1	1002	9	vaccine	vaccine	NN
cord-014462-11ggaqf1	1002	10	strain	strain	NN
cord-014462-11ggaqf1	1002	11	was	be	VBD
cord-014462-11ggaqf1	1002	12	cloned	clone	VBN
cord-014462-11ggaqf1	1002	13	separately	separately	RB
cord-014462-11ggaqf1	1002	14	into	into	IN
cord-014462-11ggaqf1	1002	15	a	a	DT
cord-014462-11ggaqf1	1002	16	plasmid	plasmid	NN
cord-014462-11ggaqf1	1002	17	vector	vector	NN
cord-014462-11ggaqf1	1002	18	and	and	CC
cord-014462-11ggaqf1	1002	19	by	by	IN
cord-014462-11ggaqf1	1002	20	successive	successive	JJ
cord-014462-11ggaqf1	1002	21	PCR	PCR	NNP
cord-014462-11ggaqf1	1002	22	mutagenesis	mutagenesis	NN
cord-014462-11ggaqf1	1002	23	and	and	CC
cord-014462-11ggaqf1	1002	24	cloning	clone	VBG
cord-014462-11ggaqf1	1002	25	we	-PRON-	PRP
cord-014462-11ggaqf1	1002	26	have	have	VBP
cord-014462-11ggaqf1	1002	27	introduced	introduce	VBN
cord-014462-11ggaqf1	1002	28	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1002	29	sequence	sequence	NN
cord-014462-11ggaqf1	1002	30	corresponding	correspond	VBG
cord-014462-11ggaqf1	1002	31	to	to	IN
cord-014462-11ggaqf1	1002	32	9	9	CD
cord-014462-11ggaqf1	1002	33	amino	amino	NN
cord-014462-11ggaqf1	1002	34	acid	acid	NN
cord-014462-11ggaqf1	1002	35	epitope	epitope	NN
cord-014462-11ggaqf1	1002	36	of	of	IN
cord-014462-11ggaqf1	1002	37	GFP	GFP	NNP
cord-014462-11ggaqf1	1002	38	into	into	IN
cord-014462-11ggaqf1	1002	39	P1	P1	NNP
cord-014462-11ggaqf1	1002	40	-	-	HYPH
cord-014462-11ggaqf1	1002	41	2A	2a	CD
cord-014462-11ggaqf1	1002	42	gene	gene	NN
cord-014462-11ggaqf1	1002	43	.	.	.
cord-014462-11ggaqf1	1003	1	GFP	GFP	NNP
cord-014462-11ggaqf1	1003	2	epitope	epitope	NN
cord-014462-11ggaqf1	1003	3	was	be	VBD
cord-014462-11ggaqf1	1003	4	inserted	insert	VBN
cord-014462-11ggaqf1	1003	5	by	by	IN
cord-014462-11ggaqf1	1003	6	replacement	replacement	NN
cord-014462-11ggaqf1	1003	7	at	at	IN
cord-014462-11ggaqf1	1003	8	N	n	CD
cord-014462-11ggaqf1	1003	9	-	-	HYPH
cord-014462-11ggaqf1	1003	10	terminal	terminal	JJ
cord-014462-11ggaqf1	1003	11	region	region	NN
cord-014462-11ggaqf1	1003	12	of	of	IN
cord-014462-11ggaqf1	1003	13	VP-2	VP-2	NNP
cord-014462-11ggaqf1	1003	14	which	which	WDT
cord-014462-11ggaqf1	1003	15	is	be	VBZ
cord-014462-11ggaqf1	1003	16	not	not	RB
cord-014462-11ggaqf1	1003	17	immunogenic	immunogenic	JJ
cord-014462-11ggaqf1	1003	18	.	.	.
cord-014462-11ggaqf1	1004	1	The	the	DT
cord-014462-11ggaqf1	1004	2	modified	modify	VBN
cord-014462-11ggaqf1	1004	3	P1	P1	NNP
cord-014462-11ggaqf1	1004	4	-	-	HYPH
cord-014462-11ggaqf1	1004	5	2A	2A	NNP
cord-014462-11ggaqf1	1004	6	was	be	VBD
cord-014462-11ggaqf1	1004	7	expressed	express	VBN
cord-014462-11ggaqf1	1004	8	in	in	IN
cord-014462-11ggaqf1	1004	9	E.	E.	NNP
cord-014462-11ggaqf1	1004	10	coli	coli	NNS
cord-014462-11ggaqf1	1004	11	and	and	CC
cord-014462-11ggaqf1	1004	12	studied	study	VBN
cord-014462-11ggaqf1	1004	13	.	.	.
cord-014462-11ggaqf1	1005	1	The	the	DT
cord-014462-11ggaqf1	1005	2	modified	modify	VBN
cord-014462-11ggaqf1	1005	3	P1	P1	NNP
cord-014462-11ggaqf1	1005	4	-	-	HYPH
cord-014462-11ggaqf1	1005	5	2A	2a	CD
cord-014462-11ggaqf1	1005	6	gene	gene	NN
cord-014462-11ggaqf1	1005	7	with	with	IN
cord-014462-11ggaqf1	1005	8	GFP	GFP	NNP
cord-014462-11ggaqf1	1005	9	epitope	epitope	NN
cord-014462-11ggaqf1	1005	10	was	be	VBD
cord-014462-11ggaqf1	1005	11	inserted	insert	VBN
cord-014462-11ggaqf1	1005	12	into	into	IN
cord-014462-11ggaqf1	1005	13	the	the	DT
cord-014462-11ggaqf1	1005	14	pCFL	pcfl	NN
cord-014462-11ggaqf1	1005	15	DAsia	DAsia	NNS
cord-014462-11ggaqf1	1005	16	1	1	CD
cord-014462-11ggaqf1	1005	17	to	to	TO
cord-014462-11ggaqf1	1005	18	get	get	VB
cord-014462-11ggaqf1	1005	19	full	full	JJ
cord-014462-11ggaqf1	1005	20	length	length	NN
cord-014462-11ggaqf1	1005	21	replication	replication	NN
cord-014462-11ggaqf1	1005	22	competent	competent	JJ
cord-014462-11ggaqf1	1005	23	cDNA	cdna	NN
cord-014462-11ggaqf1	1005	24	cloned	clone	VBN
cord-014462-11ggaqf1	1005	25	under	under	IN
cord-014462-11ggaqf1	1005	26	CMV	CMV	NNP
cord-014462-11ggaqf1	1005	27	promoter	promoter	NN
cord-014462-11ggaqf1	1005	28	in	in	IN
cord-014462-11ggaqf1	1005	29	pCDNA	pcdna	JJ
cord-014462-11ggaqf1	1005	30	(	(	-LRB-
cord-014462-11ggaqf1	1005	31	pCFLAsiaGFP	pcflasiagfp	NN
cord-014462-11ggaqf1	1005	32	)	)	-RRB-
cord-014462-11ggaqf1	1005	33	.	.	.
cord-014462-11ggaqf1	1006	1	This	this	DT
cord-014462-11ggaqf1	1006	2	can	can	MD
cord-014462-11ggaqf1	1006	3	be	be	VB
cord-014462-11ggaqf1	1006	4	used	use	VBN
cord-014462-11ggaqf1	1006	5	to	to	TO
cord-014462-11ggaqf1	1006	6	produce	produce	VB
cord-014462-11ggaqf1	1006	7	synthetic	synthetic	JJ
cord-014462-11ggaqf1	1006	8	virus	virus	NN
cord-014462-11ggaqf1	1006	9	with	with	IN
cord-014462-11ggaqf1	1006	10	GFP	GFP	NNP
cord-014462-11ggaqf1	1006	11	epitope	epitope	NN
cord-014462-11ggaqf1	1006	12	that	that	WDT
cord-014462-11ggaqf1	1006	13	can	can	MD
cord-014462-11ggaqf1	1006	14	generate	generate	VB
cord-014462-11ggaqf1	1006	15	antibodies	antibody	NNS
cord-014462-11ggaqf1	1006	16	not	not	RB
cord-014462-11ggaqf1	1006	17	only	only	RB
cord-014462-11ggaqf1	1006	18	against	against	IN
cord-014462-11ggaqf1	1006	19	neutralizing	neutralize	VBG
cord-014462-11ggaqf1	1006	20	epitopes	epitope	NNS
cord-014462-11ggaqf1	1006	21	but	but	CC
cord-014462-11ggaqf1	1006	22	also	also	RB
cord-014462-11ggaqf1	1006	23	against	against	IN
cord-014462-11ggaqf1	1006	24	GFP	GFP	NNP
cord-014462-11ggaqf1	1006	25	epitope	epitope	NN
cord-014462-11ggaqf1	1006	26	.	.	.
cord-014462-11ggaqf1	1007	1	Presence	presence	NN
cord-014462-11ggaqf1	1007	2	of	of	IN
cord-014462-11ggaqf1	1007	3	antibody	antibody	NN
cord-014462-11ggaqf1	1007	4	against	against	IN
cord-014462-11ggaqf1	1007	5	GFP	GFP	NNP
cord-014462-11ggaqf1	1007	6	epitope	epitope	NN
cord-014462-11ggaqf1	1007	7	in	in	IN
cord-014462-11ggaqf1	1007	8	the	the	DT
cord-014462-11ggaqf1	1007	9	vaccinated	vaccinated	JJ
cord-014462-11ggaqf1	1007	10	animal	animal	NN
cord-014462-11ggaqf1	1007	11	will	will	MD
cord-014462-11ggaqf1	1007	12	reveal	reveal	VB
cord-014462-11ggaqf1	1007	13	vaccine	vaccine	NN
cord-014462-11ggaqf1	1007	14	efficacy	efficacy	NN
cord-014462-11ggaqf1	1007	15	.	.	.
cord-014462-11ggaqf1	1008	1	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1008	2	against	against	IN
cord-014462-11ggaqf1	1008	3	GFP	GFP	NNP
cord-014462-11ggaqf1	1008	4	can	can	MD
cord-014462-11ggaqf1	1008	5	be	be	VB
cord-014462-11ggaqf1	1008	6	used	use	VBN
cord-014462-11ggaqf1	1008	7	as	as	IN
cord-014462-11ggaqf1	1008	8	a	a	DT
cord-014462-11ggaqf1	1008	9	companion	companion	NN
cord-014462-11ggaqf1	1008	10	test	test	NN
cord-014462-11ggaqf1	1008	11	not	not	RB
cord-014462-11ggaqf1	1008	12	only	only	RB
cord-014462-11ggaqf1	1008	13	for	for	IN
cord-014462-11ggaqf1	1008	14	safety	safety	NN
cord-014462-11ggaqf1	1008	15	evaluation	evaluation	NN
cord-014462-11ggaqf1	1008	16	but	but	CC
cord-014462-11ggaqf1	1008	17	also	also	RB
cord-014462-11ggaqf1	1008	18	for	for	IN
cord-014462-11ggaqf1	1008	19	quick	quick	JJ
cord-014462-11ggaqf1	1008	20	evaluation	evaluation	NN
cord-014462-11ggaqf1	1008	21	of	of	IN
cord-014462-11ggaqf1	1008	22	efficacy	efficacy	NN
cord-014462-11ggaqf1	1008	23	.	.	.
cord-014462-11ggaqf1	1009	1	Further	further	JJ
cord-014462-11ggaqf1	1009	2	absence	absence	NN
cord-014462-11ggaqf1	1009	3	of	of	IN
cord-014462-11ggaqf1	1009	4	NSP	nsp	NN
cord-014462-11ggaqf1	1009	5	antibodies	antibody	NNS
cord-014462-11ggaqf1	1009	6	in	in	IN
cord-014462-11ggaqf1	1009	7	the	the	DT
cord-014462-11ggaqf1	1009	8	serum	serum	NN
cord-014462-11ggaqf1	1009	9	may	may	MD
cord-014462-11ggaqf1	1009	10	reveal	reveal	VB
cord-014462-11ggaqf1	1009	11	the	the	DT
cord-014462-11ggaqf1	1009	12	quality	quality	NN
cord-014462-11ggaqf1	1009	13	of	of	IN
cord-014462-11ggaqf1	1009	14	the	the	DT
cord-014462-11ggaqf1	1009	15	vaccine	vaccine	NN
cord-014462-11ggaqf1	1009	16	in	in	IN
cord-014462-11ggaqf1	1009	17	respect	respect	NN
cord-014462-11ggaqf1	1009	18	of	of	IN
cord-014462-11ggaqf1	1009	19	safety	safety	NN
cord-014462-11ggaqf1	1009	20	.	.	.
cord-014462-11ggaqf1	1010	1	Self	self	NN
cord-014462-11ggaqf1	1010	2	replicating	replicate	VBG
cord-014462-11ggaqf1	1010	3	DNA	dna	NN
cord-014462-11ggaqf1	1010	4	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1010	5	are	be	VBP
cord-014462-11ggaqf1	1010	6	developed	develop	VBN
cord-014462-11ggaqf1	1010	7	to	to	TO
cord-014462-11ggaqf1	1010	8	achieve	achieve	VB
cord-014462-11ggaqf1	1010	9	robust	robust	JJ
cord-014462-11ggaqf1	1010	10	immune	immune	JJ
cord-014462-11ggaqf1	1010	11	response	response	NN
cord-014462-11ggaqf1	1010	12	through	through	IN
cord-014462-11ggaqf1	1010	13	enhanced	enhance	VBN
cord-014462-11ggaqf1	1010	14	antigen	antigen	NN
cord-014462-11ggaqf1	1010	15	production	production	NN
cord-014462-11ggaqf1	1010	16	and	and	CC
cord-014462-11ggaqf1	1010	17	gamma	gamma	NN
cord-014462-11ggaqf1	1010	18	interferon	interferon	NN
cord-014462-11ggaqf1	1010	19	expression	expression	NN
cord-014462-11ggaqf1	1010	20	in	in	IN
cord-014462-11ggaqf1	1010	21	vaccinated	vaccinated	JJ
cord-014462-11ggaqf1	1010	22	animals	animal	NNS
cord-014462-11ggaqf1	1010	23	.	.	.
cord-014462-11ggaqf1	1011	1	Since	since	IN
cord-014462-11ggaqf1	1011	2	self	self	NN
cord-014462-11ggaqf1	1011	3	replicating	replicate	VBG
cord-014462-11ggaqf1	1011	4	DNA	dna	NN
cord-014462-11ggaqf1	1011	5	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1011	6	induce	induce	VBP
cord-014462-11ggaqf1	1011	7	gamma	gamma	NN
cord-014462-11ggaqf1	1011	8	interferon	interferon	NN
cord-014462-11ggaqf1	1011	9	expression	expression	NN
cord-014462-11ggaqf1	1011	10	which	which	WDT
cord-014462-11ggaqf1	1011	11	helps	help	VBZ
cord-014462-11ggaqf1	1011	12	in	in	IN
cord-014462-11ggaqf1	1011	13	viral	viral	JJ
cord-014462-11ggaqf1	1011	14	clearance	clearance	NN
cord-014462-11ggaqf1	1011	15	such	such	JJ
cord-014462-11ggaqf1	1011	16	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1011	17	are	be	VBP
cord-014462-11ggaqf1	1011	18	expected	expect	VBN
cord-014462-11ggaqf1	1011	19	to	to	TO
cord-014462-11ggaqf1	1011	20	be	be	VB
cord-014462-11ggaqf1	1011	21	useful	useful	JJ
cord-014462-11ggaqf1	1011	22	to	to	TO
cord-014462-11ggaqf1	1011	23	cure	cure	VB
cord-014462-11ggaqf1	1011	24	even	even	RB
cord-014462-11ggaqf1	1011	25	the	the	DT
cord-014462-11ggaqf1	1011	26	carrier	carrier	NN
cord-014462-11ggaqf1	1011	27	and	and	CC
cord-014462-11ggaqf1	1011	28	persistently	persistently	RB
cord-014462-11ggaqf1	1011	29	infected	infected	JJ
cord-014462-11ggaqf1	1011	30	animals	animal	NNS
cord-014462-11ggaqf1	1011	31	.	.	.
cord-014462-11ggaqf1	1012	1	Understanding	understand	VBG
cord-014462-11ggaqf1	1012	2	the	the	DT
cord-014462-11ggaqf1	1012	3	events	event	NNS
cord-014462-11ggaqf1	1012	4	that	that	WDT
cord-014462-11ggaqf1	1012	5	help	help	VBP
cord-014462-11ggaqf1	1012	6	in	in	IN
cord-014462-11ggaqf1	1012	7	the	the	DT
cord-014462-11ggaqf1	1012	8	elicitation	elicitation	NN
cord-014462-11ggaqf1	1012	9	of	of	IN
cord-014462-11ggaqf1	1012	10	both	both	CC
cord-014462-11ggaqf1	1012	11	the	the	DT
cord-014462-11ggaqf1	1012	12	arms	arm	NNS
cord-014462-11ggaqf1	1012	13	of	of	IN
cord-014462-11ggaqf1	1012	14	immune	immune	JJ
cord-014462-11ggaqf1	1012	15	response	response	NN
cord-014462-11ggaqf1	1012	16	in	in	IN
cord-014462-11ggaqf1	1012	17	vaccinated	vaccinated	JJ
cord-014462-11ggaqf1	1012	18	animals	animal	NNS
cord-014462-11ggaqf1	1012	19	is	be	VBZ
cord-014462-11ggaqf1	1012	20	necessary	necessary	JJ
cord-014462-11ggaqf1	1012	21	to	to	TO
cord-014462-11ggaqf1	1012	22	understand	understand	VB
cord-014462-11ggaqf1	1012	23	the	the	DT
cord-014462-11ggaqf1	1012	24	effectiveness	effectiveness	NN
cord-014462-11ggaqf1	1012	25	of	of	IN
cord-014462-11ggaqf1	1012	26	the	the	DT
cord-014462-11ggaqf1	1012	27	vaccine	vaccine	NN
cord-014462-11ggaqf1	1012	28	.	.	.
cord-014462-11ggaqf1	1013	1	The	the	DT
cord-014462-11ggaqf1	1013	2	work	work	NN
cord-014462-11ggaqf1	1013	3	presented	present	VBD
cord-014462-11ggaqf1	1013	4	here	here	RB
cord-014462-11ggaqf1	1013	5	deals	deal	VBZ
cord-014462-11ggaqf1	1013	6	with	with	IN
cord-014462-11ggaqf1	1013	7	the	the	DT
cord-014462-11ggaqf1	1013	8	immunological	immunological	JJ
cord-014462-11ggaqf1	1013	9	evaluation	evaluation	NN
cord-014462-11ggaqf1	1013	10	of	of	IN
cord-014462-11ggaqf1	1013	11	a	a	DT
cord-014462-11ggaqf1	1013	12	Sindbis	Sindbis	NNP
cord-014462-11ggaqf1	1013	13	virus	virus	NN
cord-014462-11ggaqf1	1013	14	replicase	replicase	NN
cord-014462-11ggaqf1	1013	15	based	base	VBN
cord-014462-11ggaqf1	1013	16	DNA	DNA	NNP
cord-014462-11ggaqf1	1013	17	vaccine	vaccine	NN
cord-014462-11ggaqf1	1013	18	carrying	carry	VBG
cord-014462-11ggaqf1	1013	19	linked	link	VBN
cord-014462-11ggaqf1	1013	20	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1013	21	VP1	VP1	NNP
cord-014462-11ggaqf1	1013	22	genes	gene	NNS
cord-014462-11ggaqf1	1013	23	in	in	IN
cord-014462-11ggaqf1	1013	24	vaccinated	vaccinated	JJ
cord-014462-11ggaqf1	1013	25	guinea	guinea	NN
cord-014462-11ggaqf1	1013	26	pigs	pig	NNS
cord-014462-11ggaqf1	1013	27	.	.	.
cord-014462-11ggaqf1	1014	1	We	-PRON-	PRP
cord-014462-11ggaqf1	1014	2	have	have	VBP
cord-014462-11ggaqf1	1014	3	constructed	construct	VBN
cord-014462-11ggaqf1	1014	4	self	self	NN
cord-014462-11ggaqf1	1014	5	replicating	replicate	VBG
cord-014462-11ggaqf1	1014	6	DNA	dna	NN
cord-014462-11ggaqf1	1014	7	vaccine	vaccine	NN
cord-014462-11ggaqf1	1014	8	vector	vector	NN
cord-014462-11ggaqf1	1014	9	and	and	CC
cord-014462-11ggaqf1	1014	10	to	to	IN
cord-014462-11ggaqf1	1014	11	the	the	DT
cord-014462-11ggaqf1	1014	12	down	down	JJ
cord-014462-11ggaqf1	1014	13	stream	stream	NN
cord-014462-11ggaqf1	1014	14	of	of	IN
cord-014462-11ggaqf1	1014	15	a	a	DT
cord-014462-11ggaqf1	1014	16	sub	sub	JJ
cord-014462-11ggaqf1	1014	17	genomic	genomic	JJ
cord-014462-11ggaqf1	1014	18	promoter	promoter	NN
cord-014462-11ggaqf1	1014	19	we	-PRON-	PRP
cord-014462-11ggaqf1	1014	20	have	have	VBP
cord-014462-11ggaqf1	1014	21	inserted	insert	VBN
cord-014462-11ggaqf1	1014	22	secretory	secretory	JJ
cord-014462-11ggaqf1	1014	23	signal	signal	NN
cord-014462-11ggaqf1	1014	24	followed	follow	VBN
cord-014462-11ggaqf1	1014	25	by	by	IN
cord-014462-11ggaqf1	1014	26	linked	link	VBN
cord-014462-11ggaqf1	1014	27	-	-	HYPH
cord-014462-11ggaqf1	1014	28	VP1	vp1	NN
cord-014462-11ggaqf1	1014	29	genes	gene	NNS
cord-014462-11ggaqf1	1014	30	of	of	IN
cord-014462-11ggaqf1	1014	31	3FMDV	3fmdv	CD
cord-014462-11ggaqf1	1014	32	serotypes	serotype	NNS
cord-014462-11ggaqf1	1014	33	(	(	-LRB-
cord-014462-11ggaqf1	1014	34	O	o	UH
cord-014462-11ggaqf1	1014	35	-	-	HYPH
cord-014462-11ggaqf1	1014	36	A	A	NNP
cord-014462-11ggaqf1	1014	37	-	-	HYPH
cord-014462-11ggaqf1	1014	38	Asia	Asia	NNP
cord-014462-11ggaqf1	1014	39	1	1	CD
cord-014462-11ggaqf1	1014	40	)	)	-RRB-
cord-014462-11ggaqf1	1014	41	with	with	IN
cord-014462-11ggaqf1	1014	42	glycine	glycine	NN
cord-014462-11ggaqf1	1014	43	and	and	CC
cord-014462-11ggaqf1	1014	44	proline	proline	NN
cord-014462-11ggaqf1	1014	45	bridge	bridge	NN
cord-014462-11ggaqf1	1014	46	in	in	IN
cord-014462-11ggaqf1	1014	47	between	between	IN
cord-014462-11ggaqf1	1014	48	.	.	.
cord-014462-11ggaqf1	1015	1	Guinea	guinea	NN
cord-014462-11ggaqf1	1015	2	pigs	pig	NNS
cord-014462-11ggaqf1	1015	3	were	be	VBD
cord-014462-11ggaqf1	1015	4	vaccinated	vaccinate	VBN
cord-014462-11ggaqf1	1015	5	with	with	IN
cord-014462-11ggaqf1	1015	6	the	the	DT
cord-014462-11ggaqf1	1015	7	construct	construct	NN
cord-014462-11ggaqf1	1015	8	and	and	CC
cord-014462-11ggaqf1	1015	9	the	the	DT
cord-014462-11ggaqf1	1015	10	sera	sera	NNP
cord-014462-11ggaqf1	1015	11	at	at	IN
cord-014462-11ggaqf1	1015	12	28	28	CD
cord-014462-11ggaqf1	1015	13	days	day	NNS
cord-014462-11ggaqf1	1015	14	post	post	NN
cord-014462-11ggaqf1	1015	15	vaccination	vaccination	NN
cord-014462-11ggaqf1	1015	16	were	be	VBD
cord-014462-11ggaqf1	1015	17	evaluated	evaluate	VBN
cord-014462-11ggaqf1	1015	18	both	both	CC
cord-014462-11ggaqf1	1015	19	for	for	IN
cord-014462-11ggaqf1	1015	20	cellular	cellular	JJ
cord-014462-11ggaqf1	1015	21	response	response	NN
cord-014462-11ggaqf1	1015	22	by	by	IN
cord-014462-11ggaqf1	1015	23	studying	study	VBG
cord-014462-11ggaqf1	1015	24	the	the	DT
cord-014462-11ggaqf1	1015	25	CD8	CD8	NNP
cord-014462-11ggaqf1	1015	26	levels	level	NNS
cord-014462-11ggaqf1	1015	27	and	and	CC
cord-014462-11ggaqf1	1015	28	by	by	IN
cord-014462-11ggaqf1	1015	29	MTT	MTT	NNP
cord-014462-11ggaqf1	1015	30	and	and	CC
cord-014462-11ggaqf1	1015	31	cytokine	cytokine	NN
cord-014462-11ggaqf1	1015	32	profiles	profile	NNS
cord-014462-11ggaqf1	1015	33	by	by	IN
cord-014462-11ggaqf1	1015	34	real	real	JJ
cord-014462-11ggaqf1	1015	35	time	time	NN
cord-014462-11ggaqf1	1015	36	assays	assay	NNS
cord-014462-11ggaqf1	1015	37	.	.	.
cord-014462-11ggaqf1	1016	1	The	the	DT
cord-014462-11ggaqf1	1016	2	humoral	humoral	JJ
cord-014462-11ggaqf1	1016	3	response	response	NN
cord-014462-11ggaqf1	1016	4	was	be	VBD
cord-014462-11ggaqf1	1016	5	evaluated	evaluate	VBN
cord-014462-11ggaqf1	1016	6	by	by	IN
cord-014462-11ggaqf1	1016	7	studying	study	VBG
cord-014462-11ggaqf1	1016	8	CD4	CD4	NNP
cord-014462-11ggaqf1	1016	9	levels	level	NNS
cord-014462-11ggaqf1	1016	10	in	in	IN
cord-014462-11ggaqf1	1016	11	the	the	DT
cord-014462-11ggaqf1	1016	12	whole	whole	JJ
cord-014462-11ggaqf1	1016	13	blood	blood	NN
cord-014462-11ggaqf1	1016	14	by	by	IN
cord-014462-11ggaqf1	1016	15	Facs	Facs	NNP
cord-014462-11ggaqf1	1016	16	analysis	analysis	NN
cord-014462-11ggaqf1	1016	17	and	and	CC
cord-014462-11ggaqf1	1016	18	serum	serum	NN
cord-014462-11ggaqf1	1016	19	antibody	antibody	NN
cord-014462-11ggaqf1	1016	20	levels	level	NNS
cord-014462-11ggaqf1	1016	21	by	by	IN
cord-014462-11ggaqf1	1016	22	SNT	SNT	NNP
cord-014462-11ggaqf1	1016	23	and	and	CC
cord-014462-11ggaqf1	1016	24	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1016	25	.	.	.
cord-014462-11ggaqf1	1017	1	The	the	DT
cord-014462-11ggaqf1	1017	2	animals	animal	NNS
cord-014462-11ggaqf1	1017	3	were	be	VBD
cord-014462-11ggaqf1	1017	4	challenged	challenge	VBN
cord-014462-11ggaqf1	1017	5	with	with	IN
cord-014462-11ggaqf1	1017	6	100	100	CD
cord-014462-11ggaqf1	1017	7	GP	gp	NN
cord-014462-11ggaqf1	1017	8	infective	infective	JJ
cord-014462-11ggaqf1	1017	9	dose	dose	NN
cord-014462-11ggaqf1	1017	10	of	of	IN
cord-014462-11ggaqf1	1017	11	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1017	12	type	type	NN
cord-014462-11ggaqf1	1017	13	'	'	``
cord-014462-11ggaqf1	1017	14	O	o	UH
cord-014462-11ggaqf1	1017	15	'	'	''
cord-014462-11ggaqf1	1017	16	virus	virus	NN
cord-014462-11ggaqf1	1017	17	lesions	lesion	NNS
cord-014462-11ggaqf1	1017	18	were	be	VBD
cord-014462-11ggaqf1	1017	19	scored	score	VBN
cord-014462-11ggaqf1	1017	20	.	.	.
cord-014462-11ggaqf1	1018	1	Further	further	RB
cord-014462-11ggaqf1	1018	2	the	the	DT
cord-014462-11ggaqf1	1018	3	replicative	replicative	JJ
cord-014462-11ggaqf1	1018	4	efficiency	efficiency	NN
cord-014462-11ggaqf1	1018	5	of	of	IN
cord-014462-11ggaqf1	1018	6	the	the	DT
cord-014462-11ggaqf1	1018	7	challenge	challenge	NN
cord-014462-11ggaqf1	1018	8	virus	virus	NN
cord-014462-11ggaqf1	1018	9	was	be	VBD
cord-014462-11ggaqf1	1018	10	studied	study	VBN
cord-014462-11ggaqf1	1018	11	by	by	IN
cord-014462-11ggaqf1	1018	12	3AB	3AB	NNP
cord-014462-11ggaqf1	1018	13	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1018	14	.	.	.
cord-014462-11ggaqf1	1019	1	The	the	DT
cord-014462-11ggaqf1	1019	2	results	result	NNS
cord-014462-11ggaqf1	1019	3	showed	show	VBD
cord-014462-11ggaqf1	1019	4	that	that	IN
cord-014462-11ggaqf1	1019	5	all	all	PDT
cord-014462-11ggaqf1	1019	6	the	the	DT
cord-014462-11ggaqf1	1019	7	assays	assay	NNS
cord-014462-11ggaqf1	1019	8	except	except	IN
cord-014462-11ggaqf1	1019	9	antibodies	antibody	NNS
cord-014462-11ggaqf1	1019	10	against	against	IN
cord-014462-11ggaqf1	1019	11	3AB	3ab	JJ
cord-014462-11ggaqf1	1019	12	protein	protein	NN
cord-014462-11ggaqf1	1019	13	have	have	VBP
cord-014462-11ggaqf1	1019	14	positive	positive	JJ
cord-014462-11ggaqf1	1019	15	correlation	correlation	NN
cord-014462-11ggaqf1	1019	16	with	with	IN
cord-014462-11ggaqf1	1019	17	the	the	DT
cord-014462-11ggaqf1	1019	18	protection	protection	NN
cord-014462-11ggaqf1	1019	19	.	.	.
cord-014462-11ggaqf1	1020	1	As	as	IN
cord-014462-11ggaqf1	1020	2	expected	expect	VBN
cord-014462-11ggaqf1	1020	3	the	the	DT
cord-014462-11ggaqf1	1020	4	titre	titre	NN
cord-014462-11ggaqf1	1020	5	of	of	IN
cord-014462-11ggaqf1	1020	6	the	the	DT
cord-014462-11ggaqf1	1020	7	antibodies	antibody	NNS
cord-014462-11ggaqf1	1020	8	against	against	IN
cord-014462-11ggaqf1	1020	9	3AB	3ab	JJ
cord-014462-11ggaqf1	1020	10	protein	protein	NN
cord-014462-11ggaqf1	1020	11	was	be	VBD
cord-014462-11ggaqf1	1020	12	lower	low	JJR
cord-014462-11ggaqf1	1020	13	indicating	indicate	VBG
cord-014462-11ggaqf1	1020	14	that	that	IN
cord-014462-11ggaqf1	1020	15	the	the	DT
cord-014462-11ggaqf1	1020	16	challenge	challenge	NN
cord-014462-11ggaqf1	1020	17	virus	virus	NN
cord-014462-11ggaqf1	1020	18	replication	replication	NN
cord-014462-11ggaqf1	1020	19	was	be	VBD
cord-014462-11ggaqf1	1020	20	inhibited	inhibit	VBN
cord-014462-11ggaqf1	1020	21	in	in	IN
cord-014462-11ggaqf1	1020	22	the	the	DT
cord-014462-11ggaqf1	1020	23	vaccinated	vaccinate	VBN
cord-014462-11ggaqf1	1020	24	animals	animal	NNS
cord-014462-11ggaqf1	1020	25	.	.	.
cord-014462-11ggaqf1	1021	1	The	the	DT
cord-014462-11ggaqf1	1021	2	limited	limited	JJ
cord-014462-11ggaqf1	1021	3	studies	study	NNS
cord-014462-11ggaqf1	1021	4	conducted	conduct	VBN
cord-014462-11ggaqf1	1021	5	by	by	IN
cord-014462-11ggaqf1	1021	6	us	-PRON-	PRP
cord-014462-11ggaqf1	1021	7	showed	show	VBD
cord-014462-11ggaqf1	1021	8	that	that	IN
cord-014462-11ggaqf1	1021	9	self	self	NN
cord-014462-11ggaqf1	1021	10	replicating	replicate	VBG
cord-014462-11ggaqf1	1021	11	vaccine	vaccine	NN
cord-014462-11ggaqf1	1021	12	has	have	VBZ
cord-014462-11ggaqf1	1021	13	a	a	DT
cord-014462-11ggaqf1	1021	14	potentiality	potentiality	NN
cord-014462-11ggaqf1	1021	15	to	to	TO
cord-014462-11ggaqf1	1021	16	emerge	emerge	VB
cord-014462-11ggaqf1	1021	17	as	as	IN
cord-014462-11ggaqf1	1021	18	potent	potent	JJ
cord-014462-11ggaqf1	1021	19	vaccine	vaccine	NN
cord-014462-11ggaqf1	1021	20	for	for	IN
cord-014462-11ggaqf1	1021	21	FMD	FMD	NNP
cord-014462-11ggaqf1	1021	22	.	.	.
cord-014462-11ggaqf1	1022	1	Ganjam	ganjam	JJ
cord-014462-11ggaqf1	1022	2	virus	virus	NN
cord-014462-11ggaqf1	1022	3	(	(	-LRB-
cord-014462-11ggaqf1	1022	4	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1022	5	)	)	-RRB-
cord-014462-11ggaqf1	1022	6	belongs	belong	VBZ
cord-014462-11ggaqf1	1022	7	to	to	IN
cord-014462-11ggaqf1	1022	8	the	the	DT
cord-014462-11ggaqf1	1022	9	genus	genus	NN
cord-014462-11ggaqf1	1022	10	Nairoviruses	Nairoviruses	NNP
cord-014462-11ggaqf1	1022	11	(	(	-LRB-
cord-014462-11ggaqf1	1022	12	family	family	NN
cord-014462-11ggaqf1	1022	13	Bunyaviridae	Bunyaviridae	NNP
cord-014462-11ggaqf1	1022	14	)	)	-RRB-
cord-014462-11ggaqf1	1022	15	.	.	.
cord-014462-11ggaqf1	1023	1	These	these	DT
cord-014462-11ggaqf1	1023	2	viruses	virus	NNS
cord-014462-11ggaqf1	1023	3	cause	cause	VBP
cord-014462-11ggaqf1	1023	4	diseases	disease	NNS
cord-014462-11ggaqf1	1023	5	in	in	IN
cord-014462-11ggaqf1	1023	6	livestock	livestock	NN
cord-014462-11ggaqf1	1023	7	.	.	.
cord-014462-11ggaqf1	1024	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1024	2	has	have	VBZ
cord-014462-11ggaqf1	1024	3	been	be	VBN
cord-014462-11ggaqf1	1024	4	isolated	isolate	VBN
cord-014462-11ggaqf1	1024	5	from	from	IN
cord-014462-11ggaqf1	1024	6	different	different	JJ
cord-014462-11ggaqf1	1024	7	animal	animal	NN
cord-014462-11ggaqf1	1024	8	hosts	host	NNS
cord-014462-11ggaqf1	1024	9	and	and	CC
cord-014462-11ggaqf1	1024	10	tick	tick	VB
cord-014462-11ggaqf1	1024	11	vectors	vector	NNS
cord-014462-11ggaqf1	1024	12	from	from	IN
cord-014462-11ggaqf1	1024	13	India	India	NNP
cord-014462-11ggaqf1	1024	14	.	.	.
cord-014462-11ggaqf1	1025	1	Genus	Genus	NNP
cord-014462-11ggaqf1	1025	2	Nairoviruses	Nairoviruses	NNP
cord-014462-11ggaqf1	1025	3	includes	include	VBZ
cord-014462-11ggaqf1	1025	4	a	a	DT
cord-014462-11ggaqf1	1025	5	total	total	NN
cord-014462-11ggaqf1	1025	6	of	of	IN
cord-014462-11ggaqf1	1025	7	34	34	CD
cord-014462-11ggaqf1	1025	8	tick	tick	VB
cord-014462-11ggaqf1	1025	9	-	-	HYPH
cord-014462-11ggaqf1	1025	10	borne	bear	VBN
cord-014462-11ggaqf1	1025	11	viruses	virus	NNS
cord-014462-11ggaqf1	1025	12	,	,	,
cord-014462-11ggaqf1	1025	13	classified	classify	VBN
cord-014462-11ggaqf1	1025	14	into	into	IN
cord-014462-11ggaqf1	1025	15	7	7	CD
cord-014462-11ggaqf1	1025	16	serogroups	serogroup	NNS
cord-014462-11ggaqf1	1025	17	.	.	.
cord-014462-11ggaqf1	1026	1	The	the	DT
cord-014462-11ggaqf1	1026	2	important	important	JJ
cord-014462-11ggaqf1	1026	3	serogroups	serogroup	NNS
cord-014462-11ggaqf1	1026	4	are	be	VBP
cord-014462-11ggaqf1	1026	5	Crimean	crimean	JJ
cord-014462-11ggaqf1	1026	6	Congo	Congo	NNP
cord-014462-11ggaqf1	1026	7	hemorrhagic	hemorrhagic	JJ
cord-014462-11ggaqf1	1026	8	fever	fever	NN
cord-014462-11ggaqf1	1026	9	(	(	-LRB-
cord-014462-11ggaqf1	1026	10	CCHF	CCHF	NNP
cord-014462-11ggaqf1	1026	11	)	)	-RRB-
cord-014462-11ggaqf1	1026	12	and	and	CC
cord-014462-11ggaqf1	1026	13	the	the	DT
cord-014462-11ggaqf1	1026	14	Nairobi	Nairobi	NNP
cord-014462-11ggaqf1	1026	15	sheep	sheep	NN
cord-014462-11ggaqf1	1026	16	disease	disease	NN
cord-014462-11ggaqf1	1026	17	(	(	-LRB-
cord-014462-11ggaqf1	1026	18	NSD	NSD	NNP
cord-014462-11ggaqf1	1026	19	)	)	-RRB-
cord-014462-11ggaqf1	1026	20	.	.	.
cord-014462-11ggaqf1	1027	1	The	the	DT
cord-014462-11ggaqf1	1027	2	main	main	JJ
cord-014462-11ggaqf1	1027	3	members	member	NNS
cord-014462-11ggaqf1	1027	4	of	of	IN
cord-014462-11ggaqf1	1027	5	the	the	DT
cord-014462-11ggaqf1	1027	6	NSD	NSD	NNP
cord-014462-11ggaqf1	1027	7	group	group	NN
cord-014462-11ggaqf1	1027	8	are	be	VBP
cord-014462-11ggaqf1	1027	9	NSD	NSD	NNP
cord-014462-11ggaqf1	1027	10	and	and	CC
cord-014462-11ggaqf1	1027	11	Dubge	Dubge	NNP
cord-014462-11ggaqf1	1027	12	viruses	virus	NNS
cord-014462-11ggaqf1	1027	13	.	.	.
cord-014462-11ggaqf1	1028	1	Their	-PRON-	PRP$
cord-014462-11ggaqf1	1028	2	genome	genome	NN
cord-014462-11ggaqf1	1028	3	consists	consist	VBZ
cord-014462-11ggaqf1	1028	4	of	of	IN
cord-014462-11ggaqf1	1028	5	three	three	CD
cord-014462-11ggaqf1	1028	6	segments	segment	NNS
cord-014462-11ggaqf1	1028	7	of	of	IN
cord-014462-11ggaqf1	1028	8	single	single	JJ
cord-014462-11ggaqf1	1028	9	stranded	strand	VBN
cord-014462-11ggaqf1	1028	10	RNA	RNA	NNP
cord-014462-11ggaqf1	1028	11	,	,	,
cord-014462-11ggaqf1	1028	12	viz	viz	NN
cord-014462-11ggaqf1	1028	13	.	.	.
cord-014462-11ggaqf1	1029	1	S	S	NNP
cord-014462-11ggaqf1	1029	2	,	,	,
cord-014462-11ggaqf1	1029	3	M	M	NNP
cord-014462-11ggaqf1	1029	4	and	and	CC
cord-014462-11ggaqf1	1029	5	L	L	NNP
cord-014462-11ggaqf1	1029	6	that	that	WDT
cord-014462-11ggaqf1	1029	7	encodes	encode	VBZ
cord-014462-11ggaqf1	1029	8	viral	viral	JJ
cord-014462-11ggaqf1	1029	9	nucleocapsid	nucleocapsid	NNP
cord-014462-11ggaqf1	1029	10	protein	protein	NN
cord-014462-11ggaqf1	1029	11	,	,	,
cord-014462-11ggaqf1	1029	12	Viral	viral	JJ
cord-014462-11ggaqf1	1029	13	glycoprotein	glycoprotein	NN
cord-014462-11ggaqf1	1029	14	G1	G1	NNP
cord-014462-11ggaqf1	1029	15	and	and	CC
cord-014462-11ggaqf1	1029	16	G2	G2	NNP
cord-014462-11ggaqf1	1029	17	and	and	CC
cord-014462-11ggaqf1	1029	18	the	the	DT
cord-014462-11ggaqf1	1029	19	Viral	viral	JJ
cord-014462-11ggaqf1	1029	20	polymerase	polymerase	NN
cord-014462-11ggaqf1	1029	21	respectively	respectively	RB
cord-014462-11ggaqf1	1029	22	.	.	.
cord-014462-11ggaqf1	1030	1	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1030	2	is	be	VBZ
cord-014462-11ggaqf1	1030	3	very	very	RB
cord-014462-11ggaqf1	1030	4	closely	closely	RB
cord-014462-11ggaqf1	1030	5	related	related	JJ
cord-014462-11ggaqf1	1030	6	to	to	IN
cord-014462-11ggaqf1	1030	7	(	(	-LRB-
cord-014462-11ggaqf1	1030	8	NSDV	NSDV	NNP
cord-014462-11ggaqf1	1030	9	)	)	-RRB-
cord-014462-11ggaqf1	1030	10	.	.	.
cord-014462-11ggaqf1	1031	1	NSDV	NSDV	NNP
cord-014462-11ggaqf1	1031	2	is	be	VBZ
cord-014462-11ggaqf1	1031	3	found	find	VBN
cord-014462-11ggaqf1	1031	4	in	in	IN
cord-014462-11ggaqf1	1031	5	East	East	NNP
cord-014462-11ggaqf1	1031	6	and	and	CC
cord-014462-11ggaqf1	1031	7	central	central	JJ
cord-014462-11ggaqf1	1031	8	Africa	Africa	NNP
cord-014462-11ggaqf1	1031	9	,	,	,
cord-014462-11ggaqf1	1031	10	causes	cause	VBZ
cord-014462-11ggaqf1	1031	11	very	very	RB
cord-014462-11ggaqf1	1031	12	high	high	JJ
cord-014462-11ggaqf1	1031	13	morbidity	morbidity	NN
cord-014462-11ggaqf1	1031	14	and	and	CC
cord-014462-11ggaqf1	1031	15	mortality	mortality	NN
cord-014462-11ggaqf1	1031	16	in	in	IN
cord-014462-11ggaqf1	1031	17	livestock	livestock	NN
cord-014462-11ggaqf1	1031	18	.	.	.
cord-014462-11ggaqf1	1032	1	The	the	DT
cord-014462-11ggaqf1	1032	2	present	present	JJ
cord-014462-11ggaqf1	1032	3	study	study	NN
cord-014462-11ggaqf1	1032	4	involves	involve	VBZ
cord-014462-11ggaqf1	1032	5	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1032	6	comparison	comparison	NN
cord-014462-11ggaqf1	1032	7	of	of	IN
cord-014462-11ggaqf1	1032	8	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1032	9	isolates	isolate	NNS
cord-014462-11ggaqf1	1032	10	from	from	IN
cord-014462-11ggaqf1	1032	11	India	India	NNP
cord-014462-11ggaqf1	1032	12	with	with	IN
cord-014462-11ggaqf1	1032	13	other	other	JJ
cord-014462-11ggaqf1	1032	14	nairoviruses	nairoviruse	NNS
cord-014462-11ggaqf1	1032	15	based	base	VBN
cord-014462-11ggaqf1	1032	16	on	on	IN
cord-014462-11ggaqf1	1032	17	complete	complete	JJ
cord-014462-11ggaqf1	1032	18	N	n	CD
cord-014462-11ggaqf1	1032	19	gene	gene	NN
cord-014462-11ggaqf1	1032	20	.	.	.
cord-014462-11ggaqf1	1033	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1033	2	will	will	MD
cord-014462-11ggaqf1	1033	3	help	help	VB
cord-014462-11ggaqf1	1033	4	to	to	TO
cord-014462-11ggaqf1	1033	5	understand	understand	VB
cord-014462-11ggaqf1	1033	6	the	the	DT
cord-014462-11ggaqf1	1033	7	kind	kind	NN
cord-014462-11ggaqf1	1033	8	of	of	IN
cord-014462-11ggaqf1	1033	9	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1033	10	(	(	-LRB-
cord-014462-11ggaqf1	1033	11	nt	nt	RB
cord-014462-11ggaqf1	1033	12	)	)	-RRB-
cord-014462-11ggaqf1	1033	13	and	and	CC
cord-014462-11ggaqf1	1033	14	amino	amino	NN
cord-014462-11ggaqf1	1033	15	acid	acid	NN
cord-014462-11ggaqf1	1033	16	(	(	-LRB-
cord-014462-11ggaqf1	1033	17	aa	aa	NNP
cord-014462-11ggaqf1	1033	18	)	)	-RRB-
cord-014462-11ggaqf1	1033	19	changes	change	VBZ
cord-014462-11ggaqf1	1033	20	that	that	WDT
cord-014462-11ggaqf1	1033	21	have	have	VBP
cord-014462-11ggaqf1	1033	22	occurred	occur	VBN
cord-014462-11ggaqf1	1033	23	in	in	IN
cord-014462-11ggaqf1	1033	24	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1033	25	strains	strain	NNS
cord-014462-11ggaqf1	1033	26	from	from	IN
cord-014462-11ggaqf1	1033	27	different	different	JJ
cord-014462-11ggaqf1	1033	28	geographical	geographical	JJ
cord-014462-11ggaqf1	1033	29	areas	area	NNS
cord-014462-11ggaqf1	1033	30	.	.	.
cord-014462-11ggaqf1	1034	1	Eight	eight	CD
cord-014462-11ggaqf1	1034	2	strains	strain	NNS
cord-014462-11ggaqf1	1034	3	of	of	IN
cord-014462-11ggaqf1	1034	4	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1034	5	isolated	isolate	VBN
cord-014462-11ggaqf1	1034	6	at	at	IN
cord-014462-11ggaqf1	1034	7	NIV	NIV	NNP
cord-014462-11ggaqf1	1034	8	during	during	IN
cord-014462-11ggaqf1	1034	9	1954	1954	CD
cord-014462-11ggaqf1	1034	10	-	-	SYM
cord-014462-11ggaqf1	1034	11	2002	2002	CD
cord-014462-11ggaqf1	1034	12	from	from	IN
cord-014462-11ggaqf1	1034	13	different	different	JJ
cord-014462-11ggaqf1	1034	14	parts	part	NNS
cord-014462-11ggaqf1	1034	15	of	of	IN
cord-014462-11ggaqf1	1034	16	India	India	NNP
cord-014462-11ggaqf1	1034	17	were	be	VBD
cord-014462-11ggaqf1	1034	18	used	use	VBN
cord-014462-11ggaqf1	1034	19	in	in	IN
cord-014462-11ggaqf1	1034	20	this	this	DT
cord-014462-11ggaqf1	1034	21	study	study	NN
cord-014462-11ggaqf1	1034	22	.	.	.
cord-014462-11ggaqf1	1035	1	Virus	virus	NN
cord-014462-11ggaqf1	1035	2	stocks	stock	NNS
cord-014462-11ggaqf1	1035	3	were	be	VBD
cord-014462-11ggaqf1	1035	4	prepared	prepare	VBN
cord-014462-11ggaqf1	1035	5	in	in	IN
cord-014462-11ggaqf1	1035	6	Vero	Vero	NNP
cord-014462-11ggaqf1	1035	7	E6	E6	NNP
cord-014462-11ggaqf1	1035	8	cell	cell	NN
cord-014462-11ggaqf1	1035	9	line	line	NN
cord-014462-11ggaqf1	1035	10	these	these	DT
cord-014462-11ggaqf1	1035	11	were	be	VBD
cord-014462-11ggaqf1	1035	12	used	use	VBN
cord-014462-11ggaqf1	1035	13	as	as	IN
cord-014462-11ggaqf1	1035	14	the	the	DT
cord-014462-11ggaqf1	1035	15	source	source	NN
cord-014462-11ggaqf1	1035	16	of	of	IN
cord-014462-11ggaqf1	1035	17	viral	viral	JJ
cord-014462-11ggaqf1	1035	18	RNA	RNA	NNP
cord-014462-11ggaqf1	1035	19	.	.	.
cord-014462-11ggaqf1	1036	1	The	the	DT
cord-014462-11ggaqf1	1036	2	N	N	NNP
cord-014462-11ggaqf1	1036	3	gene	gene	NN
cord-014462-11ggaqf1	1036	4	was	be	VBD
cord-014462-11ggaqf1	1036	5	amplified	amplify	VBN
cord-014462-11ggaqf1	1036	6	either	either	CC
cord-014462-11ggaqf1	1036	7	as	as	IN
cord-014462-11ggaqf1	1036	8	a	a	DT
cord-014462-11ggaqf1	1036	9	complete	complete	JJ
cord-014462-11ggaqf1	1036	10	gene	gene	NN
cord-014462-11ggaqf1	1036	11	in	in	IN
cord-014462-11ggaqf1	1036	12	one	one	CD
cord-014462-11ggaqf1	1036	13	reaction	reaction	NN
cord-014462-11ggaqf1	1036	14	or	or	CC
cord-014462-11ggaqf1	1036	15	in	in	IN
cord-014462-11ggaqf1	1036	16	fragments	fragment	NNS
cord-014462-11ggaqf1	1036	17	whenever	whenever	WRB
cord-014462-11ggaqf1	1036	18	necessary	necessary	JJ
cord-014462-11ggaqf1	1036	19	.	.	.
cord-014462-11ggaqf1	1037	1	Thus	thus	RB
cord-014462-11ggaqf1	1037	2	obtained	obtain	VBN
cord-014462-11ggaqf1	1037	3	sequences	sequence	NNS
cord-014462-11ggaqf1	1037	4	were	be	VBD
cord-014462-11ggaqf1	1037	5	analyzed	analyze	VBN
cord-014462-11ggaqf1	1037	6	;	;	:
cord-014462-11ggaqf1	1037	7	annotated	annotate	VBN
cord-014462-11ggaqf1	1037	8	to	to	TO
cord-014462-11ggaqf1	1037	9	get	get	VB
cord-014462-11ggaqf1	1037	10	a	a	DT
cord-014462-11ggaqf1	1037	11	consensus	consensus	NN
cord-014462-11ggaqf1	1037	12	sequence	sequence	NN
cord-014462-11ggaqf1	1037	13	,	,	,
cord-014462-11ggaqf1	1037	14	aligned	align	VBN
cord-014462-11ggaqf1	1037	15	against	against	IN
cord-014462-11ggaqf1	1037	16	the	the	DT
cord-014462-11ggaqf1	1037	17	sequence	sequence	NN
cord-014462-11ggaqf1	1037	18	of	of	IN
cord-014462-11ggaqf1	1037	19	prototype	prototype	NN
cord-014462-11ggaqf1	1037	20	strain	strain	NN
cord-014462-11ggaqf1	1037	21	of	of	IN
cord-014462-11ggaqf1	1037	22	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1037	23	and	and	CC
cord-014462-11ggaqf1	1037	24	other	other	JJ
cord-014462-11ggaqf1	1037	25	representative	representative	JJ
cord-014462-11ggaqf1	1037	26	nairoviruses	nairoviruse	NNS
cord-014462-11ggaqf1	1037	27	.	.	.
cord-014462-11ggaqf1	1038	1	The	the	DT
cord-014462-11ggaqf1	1038	2	nt	nt	NNP
cord-014462-11ggaqf1	1038	3	sequences	sequence	NNS
cord-014462-11ggaqf1	1038	4	were	be	VBD
cord-014462-11ggaqf1	1038	5	converted	convert	VBN
cord-014462-11ggaqf1	1038	6	to	to	IN
cord-014462-11ggaqf1	1038	7	aa	aa	NNP
cord-014462-11ggaqf1	1038	8	sequences	sequence	NNS
cord-014462-11ggaqf1	1038	9	and	and	CC
cord-014462-11ggaqf1	1038	10	analysis	analysis	NN
cord-014462-11ggaqf1	1038	11	was	be	VBD
cord-014462-11ggaqf1	1038	12	done	do	VBN
cord-014462-11ggaqf1	1038	13	at	at	IN
cord-014462-11ggaqf1	1038	14	both	both	DT
cord-014462-11ggaqf1	1038	15	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1038	16	and	and	CC
cord-014462-11ggaqf1	1038	17	amino	amino	NN
cord-014462-11ggaqf1	1038	18	acid	acid	NN
cord-014462-11ggaqf1	1038	19	levels	level	NNS
cord-014462-11ggaqf1	1038	20	.	.	.
cord-014462-11ggaqf1	1039	1	Based	base	VBN
cord-014462-11ggaqf1	1039	2	on	on	IN
cord-014462-11ggaqf1	1039	3	what	what	WP
cord-014462-11ggaqf1	1039	4	nt	nt	NN
cord-014462-11ggaqf1	1039	5	or	or	CC
cord-014462-11ggaqf1	1039	6	aa	aa	NNP
cord-014462-11ggaqf1	1039	7	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1039	8	tree	tree	NN
cord-014462-11ggaqf1	1039	9	was	be	VBD
cord-014462-11ggaqf1	1039	10	constructed	construct	VBN
cord-014462-11ggaqf1	1039	11	and	and	CC
cord-014462-11ggaqf1	1039	12	compared	compare	VBN
cord-014462-11ggaqf1	1039	13	with	with	IN
cord-014462-11ggaqf1	1039	14	other	other	JJ
cord-014462-11ggaqf1	1039	15	nairoviruses	nairoviruse	NNS
cord-014462-11ggaqf1	1039	16	(	(	-LRB-
cord-014462-11ggaqf1	1039	17	CCHF	CCHF	NNP
cord-014462-11ggaqf1	1039	18	,	,	,
cord-014462-11ggaqf1	1039	19	DUGV	DUGV	NNP
cord-014462-11ggaqf1	1039	20	,	,	,
cord-014462-11ggaqf1	1039	21	HAZV	HAZV	NNP
cord-014462-11ggaqf1	1039	22	,	,	,
cord-014462-11ggaqf1	1039	23	KUPV	KUPV	NNP
cord-014462-11ggaqf1	1039	24	and	and	CC
cord-014462-11ggaqf1	1039	25	NSDV	NSDV	NNP
cord-014462-11ggaqf1	1039	26	)	)	-RRB-
cord-014462-11ggaqf1	1039	27	where	where	WRB
cord-014462-11ggaqf1	1039	28	complete	complete	JJ
cord-014462-11ggaqf1	1039	29	S	S	NNP
cord-014462-11ggaqf1	1039	30	segment	segment	NN
cord-014462-11ggaqf1	1039	31	sequences	sequence	NNS
cord-014462-11ggaqf1	1039	32	were	be	VBD
cord-014462-11ggaqf1	1039	33	available	available	JJ
cord-014462-11ggaqf1	1039	34	Gen	Gen	NNP
cord-014462-11ggaqf1	1039	35	-	-	HYPH
cord-014462-11ggaqf1	1039	36	Bank	Bank	NNP
cord-014462-11ggaqf1	1039	37	database	database	NN
cord-014462-11ggaqf1	1039	38	(	(	-LRB-
cord-014462-11ggaqf1	1039	39	NCBI	NCBI	NNP
cord-014462-11ggaqf1	1039	40	)	)	-RRB-
cord-014462-11ggaqf1	1039	41	.	.	.
cord-014462-11ggaqf1	1040	1	The	the	DT
cord-014462-11ggaqf1	1040	2	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1040	3	data	datum	NNS
cord-014462-11ggaqf1	1040	4	at	at	IN
cord-014462-11ggaqf1	1040	5	both	both	CC
cord-014462-11ggaqf1	1040	6	the	the	DT
cord-014462-11ggaqf1	1040	7	nt	nt	NN
cord-014462-11ggaqf1	1040	8	and	and	CC
cord-014462-11ggaqf1	1040	9	aa	aa	NNP
cord-014462-11ggaqf1	1040	10	levels	level	NNS
cord-014462-11ggaqf1	1040	11	showed	show	VBD
cord-014462-11ggaqf1	1040	12	that	that	IN
cord-014462-11ggaqf1	1040	13	all	all	PDT
cord-014462-11ggaqf1	1040	14	the	the	DT
cord-014462-11ggaqf1	1040	15	strains	strain	NNS
cord-014462-11ggaqf1	1040	16	of	of	IN
cord-014462-11ggaqf1	1040	17	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1040	18	form	form	NN
cord-014462-11ggaqf1	1040	19	monophyletic	monophyletic	JJ
cord-014462-11ggaqf1	1040	20	lineage	lineage	NN
cord-014462-11ggaqf1	1040	21	with	with	IN
cord-014462-11ggaqf1	1040	22	the	the	DT
cord-014462-11ggaqf1	1040	23	NSDV	NSDV	NNP
cord-014462-11ggaqf1	1040	24	.	.	.
cord-014462-11ggaqf1	1041	1	CCHFV	CCHFV	NNP
cord-014462-11ggaqf1	1041	2	and	and	CC
cord-014462-11ggaqf1	1041	3	HAZV	HAZV	NNP
cord-014462-11ggaqf1	1041	4	together	together	RB
cord-014462-11ggaqf1	1041	5	formed	form	VBD
cord-014462-11ggaqf1	1041	6	another	another	DT
cord-014462-11ggaqf1	1041	7	clade	clade	NN
cord-014462-11ggaqf1	1041	8	,	,	,
cord-014462-11ggaqf1	1041	9	whereas	whereas	IN
cord-014462-11ggaqf1	1041	10	DUGV	DUGV	NNP
cord-014462-11ggaqf1	1041	11	and	and	CC
cord-014462-11ggaqf1	1041	12	KUPV	KUPV	NNP
cord-014462-11ggaqf1	1041	13	made	make	VBD
cord-014462-11ggaqf1	1041	14	a	a	DT
cord-014462-11ggaqf1	1041	15	separate	separate	JJ
cord-014462-11ggaqf1	1041	16	branch	branch	NN
cord-014462-11ggaqf1	1041	17	in	in	IN
cord-014462-11ggaqf1	1041	18	the	the	DT
cord-014462-11ggaqf1	1041	19	tree	tree	NN
cord-014462-11ggaqf1	1041	20	.	.	.
cord-014462-11ggaqf1	1042	1	The	the	DT
cord-014462-11ggaqf1	1042	2	different	different	JJ
cord-014462-11ggaqf1	1042	3	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1042	4	strains	strain	NNS
cord-014462-11ggaqf1	1042	5	showed	show	VBD
cord-014462-11ggaqf1	1042	6	9	9	CD
cord-014462-11ggaqf1	1042	7	-	-	SYM
cord-014462-11ggaqf1	1042	8	10	10	CD
cord-014462-11ggaqf1	1042	9	%	%	NN
cord-014462-11ggaqf1	1042	10	difference	difference	NN
cord-014462-11ggaqf1	1042	11	with	with	IN
cord-014462-11ggaqf1	1042	12	NSDV	NSDV	NNP
cord-014462-11ggaqf1	1042	13	at	at	IN
cord-014462-11ggaqf1	1042	14	the	the	DT
cord-014462-11ggaqf1	1042	15	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1042	16	level	level	NN
cord-014462-11ggaqf1	1042	17	and	and	CC
cord-014462-11ggaqf1	1042	18	3	3	CD
cord-014462-11ggaqf1	1042	19	-	-	SYM
cord-014462-11ggaqf1	1042	20	4	4	CD
cord-014462-11ggaqf1	1042	21	%	%	NN
cord-014462-11ggaqf1	1042	22	difference	difference	NN
cord-014462-11ggaqf1	1042	23	at	at	IN
cord-014462-11ggaqf1	1042	24	the	the	DT
cord-014462-11ggaqf1	1042	25	amino	amino	NN
cord-014462-11ggaqf1	1042	26	acid	acid	NN
cord-014462-11ggaqf1	1042	27	level	level	NN
cord-014462-11ggaqf1	1042	28	.	.	.
cord-014462-11ggaqf1	1043	1	HAZV	HAZV	NNP
cord-014462-11ggaqf1	1043	2	showed	show	VBD
cord-014462-11ggaqf1	1043	3	37	37	CD
cord-014462-11ggaqf1	1043	4	-	-	SYM
cord-014462-11ggaqf1	1043	5	38	38	CD
cord-014462-11ggaqf1	1043	6	%	%	NN
cord-014462-11ggaqf1	1043	7	difference	difference	NN
cord-014462-11ggaqf1	1043	8	at	at	IN
cord-014462-11ggaqf1	1043	9	the	the	DT
cord-014462-11ggaqf1	1043	10	nt	nt	JJ
cord-014462-11ggaqf1	1043	11	level	level	NN
cord-014462-11ggaqf1	1043	12	and	and	CC
cord-014462-11ggaqf1	1043	13	37	37	CD
cord-014462-11ggaqf1	1043	14	%	%	NN
cord-014462-11ggaqf1	1043	15	difference	difference	NN
cord-014462-11ggaqf1	1043	16	at	at	IN
cord-014462-11ggaqf1	1043	17	the	the	DT
cord-014462-11ggaqf1	1043	18	aa	aa	NNP
cord-014462-11ggaqf1	1043	19	level	level	NN
cord-014462-11ggaqf1	1043	20	with	with	IN
cord-014462-11ggaqf1	1043	21	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1043	22	as	as	RB
cord-014462-11ggaqf1	1043	23	well	well	RB
cord-014462-11ggaqf1	1043	24	as	as	IN
cord-014462-11ggaqf1	1043	25	NSDV	NSDV	NNP
cord-014462-11ggaqf1	1043	26	.	.	.
cord-014462-11ggaqf1	1044	1	The	the	DT
cord-014462-11ggaqf1	1044	2	present	present	JJ
cord-014462-11ggaqf1	1044	3	data	datum	NNS
cord-014462-11ggaqf1	1044	4	obtained	obtain	VBD
cord-014462-11ggaqf1	1044	5	suggests	suggest	VBZ
cord-014462-11ggaqf1	1044	6	that	that	IN
cord-014462-11ggaqf1	1044	7	GANJV	GANJV	NNP
cord-014462-11ggaqf1	1044	8	and	and	CC
cord-014462-11ggaqf1	1044	9	NSDV	NSDV	NNP
cord-014462-11ggaqf1	1044	10	are	be	VBP
cord-014462-11ggaqf1	1044	11	minor	minor	JJ
cord-014462-11ggaqf1	1044	12	variants	variant	NNS
cord-014462-11ggaqf1	1044	13	of	of	IN
cord-014462-11ggaqf1	1044	14	the	the	DT
cord-014462-11ggaqf1	1044	15	same	same	JJ
cord-014462-11ggaqf1	1044	16	virus	virus	NN
cord-014462-11ggaqf1	1044	17	.	.	.
cord-014462-11ggaqf1	1045	1	Diarrhoeal	Diarrhoeal	NNP
cord-014462-11ggaqf1	1045	2	syndrome	syndrome	NN
cord-014462-11ggaqf1	1045	3	is	be	VBZ
cord-014462-11ggaqf1	1045	4	one	one	CD
cord-014462-11ggaqf1	1045	5	of	of	IN
cord-014462-11ggaqf1	1045	6	the	the	DT
cord-014462-11ggaqf1	1045	7	major	major	JJ
cord-014462-11ggaqf1	1045	8	concerns	concern	NNS
cord-014462-11ggaqf1	1045	9	of	of	IN
cord-014462-11ggaqf1	1045	10	the	the	DT
cord-014462-11ggaqf1	1045	11	livestock	livestock	NN
cord-014462-11ggaqf1	1045	12	industry	industry	NN
cord-014462-11ggaqf1	1045	13	.	.	.
cord-014462-11ggaqf1	1046	1	Most	Most	JJS
cord-014462-11ggaqf1	1046	2	of	of	IN
cord-014462-11ggaqf1	1046	3	the	the	DT
cord-014462-11ggaqf1	1046	4	diarrheic	diarrheic	NNS
cord-014462-11ggaqf1	1046	5	cases	case	NNS
cord-014462-11ggaqf1	1046	6	in	in	IN
cord-014462-11ggaqf1	1046	7	animals	animal	NNS
cord-014462-11ggaqf1	1046	8	go	go	VBP
cord-014462-11ggaqf1	1046	9	unnoticed	unnoticed	JJ
cord-014462-11ggaqf1	1046	10	and	and	CC
cord-014462-11ggaqf1	1046	11	limited	limited	JJ
cord-014462-11ggaqf1	1046	12	attention	attention	NN
cord-014462-11ggaqf1	1046	13	is	be	VBZ
cord-014462-11ggaqf1	1046	14	paid	pay	VBN
cord-014462-11ggaqf1	1046	15	on	on	IN
cord-014462-11ggaqf1	1046	16	viral	viral	JJ
cord-014462-11ggaqf1	1046	17	etiology	etiology	NN
cord-014462-11ggaqf1	1046	18	.	.	.
cord-014462-11ggaqf1	1047	1	Presence	presence	NN
cord-014462-11ggaqf1	1047	2	of	of	IN
cord-014462-11ggaqf1	1047	3	large	large	JJ
cord-014462-11ggaqf1	1047	4	amount	amount	NN
cord-014462-11ggaqf1	1047	5	of	of	IN
cord-014462-11ggaqf1	1047	6	fecal	fecal	JJ
cord-014462-11ggaqf1	1047	7	matter	matter	NN
cord-014462-11ggaqf1	1047	8	in	in	IN
cord-014462-11ggaqf1	1047	9	animal	animal	NN
cord-014462-11ggaqf1	1047	10	shed	shed	NN
cord-014462-11ggaqf1	1047	11	acts	act	NNS
cord-014462-11ggaqf1	1047	12	as	as	IN
cord-014462-11ggaqf1	1047	13	a	a	DT
cord-014462-11ggaqf1	1047	14	source	source	NN
cord-014462-11ggaqf1	1047	15	of	of	IN
cord-014462-11ggaqf1	1047	16	infection	infection	NN
cord-014462-11ggaqf1	1047	17	for	for	IN
cord-014462-11ggaqf1	1047	18	calves	calf	NNS
cord-014462-11ggaqf1	1047	19	via	via	IN
cord-014462-11ggaqf1	1047	20	drinking	drinking	NN
cord-014462-11ggaqf1	1047	21	water	water	NN
cord-014462-11ggaqf1	1047	22	,	,	,
cord-014462-11ggaqf1	1047	23	feed	feed	NN
cord-014462-11ggaqf1	1047	24	,	,	,
cord-014462-11ggaqf1	1047	25	or	or	CC
cord-014462-11ggaqf1	1047	26	contaminated	contaminate	VBN
cord-014462-11ggaqf1	1047	27	soil	soil	NN
cord-014462-11ggaqf1	1047	28	.	.	.
cord-014462-11ggaqf1	1048	1	Keeping	keep	VBG
cord-014462-11ggaqf1	1048	2	this	this	DT
cord-014462-11ggaqf1	1048	3	in	in	IN
cord-014462-11ggaqf1	1048	4	view	view	NN
cord-014462-11ggaqf1	1048	5	,	,	,
cord-014462-11ggaqf1	1048	6	investigation	investigation	NN
cord-014462-11ggaqf1	1048	7	was	be	VBD
cord-014462-11ggaqf1	1048	8	planned	plan	VBN
cord-014462-11ggaqf1	1048	9	to	to	TO
cord-014462-11ggaqf1	1048	10	detect	detect	VB
cord-014462-11ggaqf1	1048	11	the	the	DT
cord-014462-11ggaqf1	1048	12	association	association	NN
cord-014462-11ggaqf1	1048	13	of	of	IN
cord-014462-11ggaqf1	1048	14	rotaviruses	rotaviruses	NNP
cord-014462-11ggaqf1	1048	15	with	with	IN
cord-014462-11ggaqf1	1048	16	diarrhea	diarrhea	NN
cord-014462-11ggaqf1	1048	17	in	in	IN
cord-014462-11ggaqf1	1048	18	dairy	dairy	NN
cord-014462-11ggaqf1	1048	19	calves	calf	NNS
cord-014462-11ggaqf1	1048	20	and	and	CC
cord-014462-11ggaqf1	1048	21	to	to	TO
cord-014462-11ggaqf1	1048	22	observe	observe	VB
cord-014462-11ggaqf1	1048	23	the	the	DT
cord-014462-11ggaqf1	1048	24	genomic	genomic	JJ
cord-014462-11ggaqf1	1048	25	diversity	diversity	NN
cord-014462-11ggaqf1	1048	26	among	among	IN
cord-014462-11ggaqf1	1048	27	the	the	DT
cord-014462-11ggaqf1	1048	28	circulating	circulate	VBG
cord-014462-11ggaqf1	1048	29	viruses	virus	NNS
cord-014462-11ggaqf1	1048	30	in	in	IN
cord-014462-11ggaqf1	1048	31	Tarai	Tarai	NNP
cord-014462-11ggaqf1	1048	32	area	area	NN
cord-014462-11ggaqf1	1048	33	of	of	IN
cord-014462-11ggaqf1	1048	34	Uttarakhand	Uttarakhand	NNP
cord-014462-11ggaqf1	1048	35	.	.	.
cord-014462-11ggaqf1	1049	1	A	a	DT
cord-014462-11ggaqf1	1049	2	total	total	NN
cord-014462-11ggaqf1	1049	3	of	of	IN
cord-014462-11ggaqf1	1049	4	63	63	CD
cord-014462-11ggaqf1	1049	5	diarrheic	diarrheic	JJ
cord-014462-11ggaqf1	1049	6	fecal	fecal	JJ
cord-014462-11ggaqf1	1049	7	samples	sample	NNS
cord-014462-11ggaqf1	1049	8	collected	collect	VBN
cord-014462-11ggaqf1	1049	9	from	from	IN
cord-014462-11ggaqf1	1049	10	Instructional	Instructional	NNP
cord-014462-11ggaqf1	1049	11	Dairy	Dairy	NNP
cord-014462-11ggaqf1	1049	12	Farm	Farm	NNP
cord-014462-11ggaqf1	1049	13	,	,	,
cord-014462-11ggaqf1	1049	14	Nagla	Nagla	NNP
cord-014462-11ggaqf1	1049	15	,	,	,
cord-014462-11ggaqf1	1049	16	Pantnagar	Pantnagar	NNP
cord-014462-11ggaqf1	1049	17	,	,	,
cord-014462-11ggaqf1	1049	18	Uttarakhand	Uttarakhand	NNP
cord-014462-11ggaqf1	1049	19	were	be	VBD
cord-014462-11ggaqf1	1049	20	screened	screen	VBN
cord-014462-11ggaqf1	1049	21	during	during	IN
cord-014462-11ggaqf1	1049	22	the	the	DT
cord-014462-11ggaqf1	1049	23	study	study	NN
cord-014462-11ggaqf1	1049	24	.	.	.
cord-014462-11ggaqf1	1050	1	Samples	sample	NNS
cord-014462-11ggaqf1	1050	2	were	be	VBD
cord-014462-11ggaqf1	1050	3	collected	collect	VBN
cord-014462-11ggaqf1	1050	4	from	from	IN
cord-014462-11ggaqf1	1050	5	both	both	DT
cord-014462-11ggaqf1	1050	6	cow	cow	NN
cord-014462-11ggaqf1	1050	7	calves	calf	NNS
cord-014462-11ggaqf1	1050	8	and	and	CC
cord-014462-11ggaqf1	1050	9	buffalo	buffalo	NNP
cord-014462-11ggaqf1	1050	10	calves	calf	NNS
cord-014462-11ggaqf1	1050	11	in	in	IN
cord-014462-11ggaqf1	1050	12	0	0	CD
cord-014462-11ggaqf1	1050	13	-	-	SYM
cord-014462-11ggaqf1	1050	14	3	3	CD
cord-014462-11ggaqf1	1050	15	months	month	NNS
cord-014462-11ggaqf1	1050	16	of	of	IN
cord-014462-11ggaqf1	1050	17	age	age	NN
cord-014462-11ggaqf1	1050	18	.	.	.
cord-014462-11ggaqf1	1051	1	For	for	IN
cord-014462-11ggaqf1	1051	2	the	the	DT
cord-014462-11ggaqf1	1051	3	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	1051	4	of	of	IN
cord-014462-11ggaqf1	1051	5	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	1051	6	,	,	,
cord-014462-11ggaqf1	1051	7	all	all	PDT
cord-014462-11ggaqf1	1051	8	the	the	DT
cord-014462-11ggaqf1	1051	9	fecal	fecal	JJ
cord-014462-11ggaqf1	1051	10	samples	sample	NNS
cord-014462-11ggaqf1	1051	11	were	be	VBD
cord-014462-11ggaqf1	1051	12	subjected	subject	VBN
cord-014462-11ggaqf1	1051	13	to	to	IN
cord-014462-11ggaqf1	1051	14	RNA	rna	NN
cord-014462-11ggaqf1	1051	15	-	-	HYPH
cord-014462-11ggaqf1	1051	16	electrophoresis	electrophoresis	NN
cord-014462-11ggaqf1	1051	17	after	after	IN
cord-014462-11ggaqf1	1051	18	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1051	19	acid	acid	NN
cord-014462-11ggaqf1	1051	20	extraction	extraction	NN
cord-014462-11ggaqf1	1051	21	.	.	.
cord-014462-11ggaqf1	1052	1	Viral	viral	JJ
cord-014462-11ggaqf1	1052	2	genome	genome	NN
cord-014462-11ggaqf1	1052	3	segments	segment	NNS
cord-014462-11ggaqf1	1052	4	were	be	VBD
cord-014462-11ggaqf1	1052	5	visualized	visualize	VBN
cord-014462-11ggaqf1	1052	6	by	by	IN
cord-014462-11ggaqf1	1052	7	silver	silver	JJ
cord-014462-11ggaqf1	1052	8	staining	staining	NN
cord-014462-11ggaqf1	1052	9	.	.	.
cord-014462-11ggaqf1	1053	1	Out	out	IN
cord-014462-11ggaqf1	1053	2	of	of	IN
cord-014462-11ggaqf1	1053	3	the	the	DT
cord-014462-11ggaqf1	1053	4	total	total	JJ
cord-014462-11ggaqf1	1053	5	63	63	CD
cord-014462-11ggaqf1	1053	6	samples	sample	NNS
cord-014462-11ggaqf1	1053	7	tested	test	VBN
cord-014462-11ggaqf1	1053	8	,	,	,
cord-014462-11ggaqf1	1053	9	seven	seven	CD
cord-014462-11ggaqf1	1053	10	were	be	VBD
cord-014462-11ggaqf1	1053	11	found	find	VBN
cord-014462-11ggaqf1	1053	12	positive	positive	JJ
cord-014462-11ggaqf1	1053	13	in	in	IN
cord-014462-11ggaqf1	1053	14	RNA	RNA	NNP
cord-014462-11ggaqf1	1053	15	-	-	HYPH
cord-014462-11ggaqf1	1053	16	PAGE	PAGE	NNP
cord-014462-11ggaqf1	1053	17	showing	show	VBG
cord-014462-11ggaqf1	1053	18	typical	typical	JJ
cord-014462-11ggaqf1	1053	19	11	11	CD
cord-014462-11ggaqf1	1053	20	genome	genome	NN
cord-014462-11ggaqf1	1053	21	segments	segment	NNS
cord-014462-11ggaqf1	1053	22	migration	migration	NN
cord-014462-11ggaqf1	1053	23	pattern	pattern	NN
cord-014462-11ggaqf1	1053	24	of	of	IN
cord-014462-11ggaqf1	1053	25	bovine	bovine	JJ
cord-014462-11ggaqf1	1053	26	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	1053	27	.	.	.
cord-014462-11ggaqf1	1054	1	In	in	IN
cord-014462-11ggaqf1	1054	2	the	the	DT
cord-014462-11ggaqf1	1054	3	given	give	VBN
cord-014462-11ggaqf1	1054	4	samples	sample	NNS
cord-014462-11ggaqf1	1054	5	prevalence	prevalence	NN
cord-014462-11ggaqf1	1054	6	of	of	IN
cord-014462-11ggaqf1	1054	7	bovine	bovine	JJ
cord-014462-11ggaqf1	1054	8	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	1054	9	was	be	VBD
cord-014462-11ggaqf1	1054	10	11.32	11.32	CD
cord-014462-11ggaqf1	1054	11	%	%	NN
cord-014462-11ggaqf1	1054	12	and	and	CC
cord-014462-11ggaqf1	1054	13	10	10	CD
cord-014462-11ggaqf1	1054	14	%	%	NN
cord-014462-11ggaqf1	1054	15	in	in	IN
cord-014462-11ggaqf1	1054	16	cow	cow	NN
cord-014462-11ggaqf1	1054	17	and	and	CC
cord-014462-11ggaqf1	1054	18	buffalo	buffalo	NNP
cord-014462-11ggaqf1	1054	19	calves	calf	NNS
cord-014462-11ggaqf1	1054	20	,	,	,
cord-014462-11ggaqf1	1054	21	respectively	respectively	RB
cord-014462-11ggaqf1	1054	22	.	.	.
cord-014462-11ggaqf1	1055	1	On	on	IN
cord-014462-11ggaqf1	1055	2	the	the	DT
cord-014462-11ggaqf1	1055	3	basis	basis	NN
cord-014462-11ggaqf1	1055	4	of	of	IN
cord-014462-11ggaqf1	1055	5	migration	migration	NN
cord-014462-11ggaqf1	1055	6	patterns	pattern	NNS
cord-014462-11ggaqf1	1055	7	of	of	IN
cord-014462-11ggaqf1	1055	8	rotavirus	rotavirus	NN
cord-014462-11ggaqf1	1055	9	in	in	IN
cord-014462-11ggaqf1	1055	10	RNA	RNA	NNP
cord-014462-11ggaqf1	1055	11	-	-	HYPH
cord-014462-11ggaqf1	1055	12	PAGE	PAGE	NNP
cord-014462-11ggaqf1	1055	13	,	,	,
cord-014462-11ggaqf1	1055	14	group	group	NN
cord-014462-11ggaqf1	1055	15	A	A	NNP
cord-014462-11ggaqf1	1055	16	were	be	VBD
cord-014462-11ggaqf1	1055	17	identified	identify	VBN
cord-014462-11ggaqf1	1055	18	with	with	IN
cord-014462-11ggaqf1	1055	19	typical	typical	JJ
cord-014462-11ggaqf1	1055	20	4:2:3:2	4:2:3:2	CD
cord-014462-11ggaqf1	1055	21	pattern	pattern	NN
cord-014462-11ggaqf1	1055	22	.	.	.
cord-014462-11ggaqf1	1056	1	Variation	variation	NN
cord-014462-11ggaqf1	1056	2	within	within	IN
cord-014462-11ggaqf1	1056	3	movement	movement	NN
cord-014462-11ggaqf1	1056	4	of	of	IN
cord-014462-11ggaqf1	1056	5	various	various	JJ
cord-014462-11ggaqf1	1056	6	genome	genome	NN
cord-014462-11ggaqf1	1056	7	segments	segment	NNS
cord-014462-11ggaqf1	1056	8	among	among	IN
cord-014462-11ggaqf1	1056	9	isolates	isolate	NNS
cord-014462-11ggaqf1	1056	10	of	of	IN
cord-014462-11ggaqf1	1056	11	bovine	bovine	JJ
cord-014462-11ggaqf1	1056	12	rotaviruses	rotavirus	NNS
cord-014462-11ggaqf1	1056	13	was	be	VBD
cord-014462-11ggaqf1	1056	14	observed	observe	VBN
cord-014462-11ggaqf1	1056	15	during	during	IN
cord-014462-11ggaqf1	1056	16	the	the	DT
cord-014462-11ggaqf1	1056	17	study	study	NN
cord-014462-11ggaqf1	1056	18	that	that	WDT
cord-014462-11ggaqf1	1056	19	may	may	MD
cord-014462-11ggaqf1	1056	20	be	be	VB
cord-014462-11ggaqf1	1056	21	indicative	indicative	JJ
cord-014462-11ggaqf1	1056	22	of	of	IN
cord-014462-11ggaqf1	1056	23	emergence	emergence	NN
cord-014462-11ggaqf1	1056	24	of	of	IN
cord-014462-11ggaqf1	1056	25	mutants	mutant	NNS
cord-014462-11ggaqf1	1056	26	in	in	IN
cord-014462-11ggaqf1	1056	27	the	the	DT
cord-014462-11ggaqf1	1056	28	circulating	circulate	VBG
cord-014462-11ggaqf1	1056	29	isolates	isolate	NNS
cord-014462-11ggaqf1	1056	30	.	.	.
cord-014462-11ggaqf1	1057	1	The	the	DT
cord-014462-11ggaqf1	1057	2	VP6	vp6	NN
cord-014462-11ggaqf1	1057	3	gene	gene	NN
cord-014462-11ggaqf1	1057	4	based	base	VBN
cord-014462-11ggaqf1	1057	5	group	group	NN
cord-014462-11ggaqf1	1057	6	A	a	DT
cord-014462-11ggaqf1	1057	7	specific	specific	JJ
cord-014462-11ggaqf1	1057	8	RT	RT	NNP
cord-014462-11ggaqf1	1057	9	-	-	HYPH
cord-014462-11ggaqf1	1057	10	PCR	PCR	NNP
cord-014462-11ggaqf1	1057	11	was	be	VBD
cord-014462-11ggaqf1	1057	12	standardized	standardize	VBN
cord-014462-11ggaqf1	1057	13	and	and	CC
cord-014462-11ggaqf1	1057	14	all	all	PDT
cord-014462-11ggaqf1	1057	15	the	the	DT
cord-014462-11ggaqf1	1057	16	isolates	isolate	NNS
cord-014462-11ggaqf1	1057	17	in	in	IN
cord-014462-11ggaqf1	1057	18	this	this	DT
cord-014462-11ggaqf1	1057	19	area	area	NN
cord-014462-11ggaqf1	1057	20	were	be	VBD
cord-014462-11ggaqf1	1057	21	confirmed	confirm	VBN
cord-014462-11ggaqf1	1057	22	to	to	TO
cord-014462-11ggaqf1	1057	23	be	be	VB
cord-014462-11ggaqf1	1057	24	of	of	IN
cord-014462-11ggaqf1	1057	25	group	group	NN
cord-014462-11ggaqf1	1057	26	A	a	DT
cord-014462-11ggaqf1	1057	27	type	type	NN
cord-014462-11ggaqf1	1057	28	.	.	.
cord-014462-11ggaqf1	1058	1	Work	work	NN
cord-014462-11ggaqf1	1058	2	is	be	VBZ
cord-014462-11ggaqf1	1058	3	in	in	IN
cord-014462-11ggaqf1	1058	4	progress	progress	NN
cord-014462-11ggaqf1	1058	5	to	to	TO
cord-014462-11ggaqf1	1058	6	genotype	genotype	VB
cord-014462-11ggaqf1	1058	7	the	the	DT
cord-014462-11ggaqf1	1058	8	bovine	bovine	JJ
cord-014462-11ggaqf1	1058	9	rotaviruses	rotavirus	NNS
cord-014462-11ggaqf1	1058	10	of	of	IN
cord-014462-11ggaqf1	1058	11	this	this	DT
cord-014462-11ggaqf1	1058	12	region	region	NN
cord-014462-11ggaqf1	1058	13	based	base	VBN
cord-014462-11ggaqf1	1058	14	on	on	IN
cord-014462-11ggaqf1	1058	15	VP7	vp7	NN
cord-014462-11ggaqf1	1058	16	and	and	CC
cord-014462-11ggaqf1	1058	17	VP4	vp4	JJ
cord-014462-11ggaqf1	1058	18	genes	gene	NNS
cord-014462-11ggaqf1	1058	19	.	.	.
cord-014462-11ggaqf1	1059	1	This	this	DT
cord-014462-11ggaqf1	1059	2	study	study	NN
cord-014462-11ggaqf1	1059	3	emphasizes	emphasize	VBZ
cord-014462-11ggaqf1	1059	4	the	the	DT
cord-014462-11ggaqf1	1059	5	need	need	NN
cord-014462-11ggaqf1	1059	6	to	to	TO
cord-014462-11ggaqf1	1059	7	explore	explore	VB
cord-014462-11ggaqf1	1059	8	the	the	DT
cord-014462-11ggaqf1	1059	9	prevalence	prevalence	NN
cord-014462-11ggaqf1	1059	10	of	of	IN
cord-014462-11ggaqf1	1059	11	bovine	bovine	JJ
cord-014462-11ggaqf1	1059	12	group	group	NN
cord-014462-11ggaqf1	1060	1	A	a	DT
cord-014462-11ggaqf1	1060	2	rotaviruses	rotavirus	NNS
cord-014462-11ggaqf1	1060	3	in	in	IN
cord-014462-11ggaqf1	1060	4	different	different	JJ
cord-014462-11ggaqf1	1060	5	places	place	NNS
cord-014462-11ggaqf1	1060	6	of	of	IN
cord-014462-11ggaqf1	1060	7	Uttarakhand	Uttarakhand	NNP
cord-014462-11ggaqf1	1060	8	and	and	CC
cord-014462-11ggaqf1	1060	9	their	-PRON-	PRP$
cord-014462-11ggaqf1	1060	10	genetic	genetic	JJ
cord-014462-11ggaqf1	1060	11	characterization	characterization	NN
cord-014462-11ggaqf1	1060	12	which	which	WDT
cord-014462-11ggaqf1	1060	13	could	could	MD
cord-014462-11ggaqf1	1060	14	help	help	VB
cord-014462-11ggaqf1	1060	15	in	in	IN
cord-014462-11ggaqf1	1060	16	selection	selection	NN
cord-014462-11ggaqf1	1060	17	of	of	IN
cord-014462-11ggaqf1	1060	18	control	control	NN
cord-014462-11ggaqf1	1060	19	strategies	strategy	NNS
cord-014462-11ggaqf1	1060	20	for	for	IN
cord-014462-11ggaqf1	1060	21	rotavirus	rotavirus	JJ
cord-014462-11ggaqf1	1060	22	infections	infection	NNS
cord-014462-11ggaqf1	1060	23	.	.	.
cord-014462-11ggaqf1	1061	1	Foot	foot	NN
cord-014462-11ggaqf1	1061	2	-	-	HYPH
cord-014462-11ggaqf1	1061	3	and	and	CC
cord-014462-11ggaqf1	1061	4	-	-	HYPH
cord-014462-11ggaqf1	1061	5	mouth	mouth	NN
cord-014462-11ggaqf1	1061	6	disease	disease	NN
cord-014462-11ggaqf1	1061	7	(	(	-LRB-
cord-014462-11ggaqf1	1061	8	FMD	FMD	NNP
cord-014462-11ggaqf1	1061	9	)	)	-RRB-
cord-014462-11ggaqf1	1061	10	is	be	VBZ
cord-014462-11ggaqf1	1061	11	endemic	endemic	JJ
cord-014462-11ggaqf1	1061	12	in	in	IN
cord-014462-11ggaqf1	1061	13	India	India	NNP
cord-014462-11ggaqf1	1061	14	causing	cause	VBG
cord-014462-11ggaqf1	1061	15	enormous	enormous	JJ
cord-014462-11ggaqf1	1061	16	economic	economic	JJ
cord-014462-11ggaqf1	1061	17	loss	loss	NN
cord-014462-11ggaqf1	1061	18	to	to	IN
cord-014462-11ggaqf1	1061	19	the	the	DT
cord-014462-11ggaqf1	1061	20	animal	animal	NN
cord-014462-11ggaqf1	1061	21	keepers	keeper	NNS
cord-014462-11ggaqf1	1061	22	and	and	CC
cord-014462-11ggaqf1	1061	23	trade	trade	NN
cord-014462-11ggaqf1	1061	24	embargo	embargo	NN
cord-014462-11ggaqf1	1061	25	with	with	IN
cord-014462-11ggaqf1	1061	26	FMD	FMD	NNP
cord-014462-11ggaqf1	1061	27	free	free	JJ
cord-014462-11ggaqf1	1061	28	countries	country	NNS
cord-014462-11ggaqf1	1061	29	in	in	IN
cord-014462-11ggaqf1	1061	30	livestock	livestock	NN
cord-014462-11ggaqf1	1061	31	and	and	CC
cord-014462-11ggaqf1	1061	32	animal	animal	NN
cord-014462-11ggaqf1	1061	33	products	product	NNS
cord-014462-11ggaqf1	1061	34	.	.	.
cord-014462-11ggaqf1	1062	1	Rapid	rapid	JJ
cord-014462-11ggaqf1	1062	2	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	1062	3	of	of	IN
cord-014462-11ggaqf1	1062	4	FMD	FMD	NNP
cord-014462-11ggaqf1	1062	5	is	be	VBZ
cord-014462-11ggaqf1	1062	6	of	of	IN
cord-014462-11ggaqf1	1062	7	immense	immense	JJ
cord-014462-11ggaqf1	1062	8	importance	importance	NN
cord-014462-11ggaqf1	1062	9	in	in	IN
cord-014462-11ggaqf1	1062	10	prevention	prevention	NN
cord-014462-11ggaqf1	1062	11	and	and	CC
cord-014462-11ggaqf1	1062	12	control	control	NN
cord-014462-11ggaqf1	1062	13	of	of	IN
cord-014462-11ggaqf1	1062	14	the	the	DT
cord-014462-11ggaqf1	1062	15	disease	disease	NN
cord-014462-11ggaqf1	1062	16	.	.	.
cord-014462-11ggaqf1	1063	1	FMD	FMD	NNP
cord-014462-11ggaqf1	1063	2	is	be	VBZ
cord-014462-11ggaqf1	1063	3	initially	initially	RB
cord-014462-11ggaqf1	1063	4	diagnosed	diagnose	VBN
cord-014462-11ggaqf1	1063	5	clinically	clinically	RB
cord-014462-11ggaqf1	1063	6	and	and	CC
cord-014462-11ggaqf1	1063	7	confirmed	confirm	VBN
cord-014462-11ggaqf1	1063	8	by	by	IN
cord-014462-11ggaqf1	1063	9	laboratory	laboratory	NN
cord-014462-11ggaqf1	1063	10	tests	test	NNS
cord-014462-11ggaqf1	1063	11	.	.	.
cord-014462-11ggaqf1	1064	1	Virus	virus	NN
cord-014462-11ggaqf1	1064	2	isolation	isolation	NN
cord-014462-11ggaqf1	1064	3	in	in	IN
cord-014462-11ggaqf1	1064	4	cell	cell	NN
cord-014462-11ggaqf1	1064	5	culture	culture	NN
cord-014462-11ggaqf1	1064	6	and	and	CC
cord-014462-11ggaqf1	1064	7	sandwich	sandwich	NN
cord-014462-11ggaqf1	1064	8	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1064	9	for	for	IN
cord-014462-11ggaqf1	1064	10	antigen	antigen	NN
cord-014462-11ggaqf1	1064	11	detection	detection	NN
cord-014462-11ggaqf1	1064	12	are	be	VBP
cord-014462-11ggaqf1	1064	13	commonly	commonly	RB
cord-014462-11ggaqf1	1064	14	practiced	practice	VBN
cord-014462-11ggaqf1	1064	15	in	in	IN
cord-014462-11ggaqf1	1064	16	laboratories	laboratory	NNS
cord-014462-11ggaqf1	1064	17	.	.	.
cord-014462-11ggaqf1	1065	1	The	the	DT
cord-014462-11ggaqf1	1065	2	virus	virus	NN
cord-014462-11ggaqf1	1065	3	isolation	isolation	NN
cord-014462-11ggaqf1	1065	4	though	though	RB
cord-014462-11ggaqf1	1065	5	is	be	VBZ
cord-014462-11ggaqf1	1065	6	very	very	RB
cord-014462-11ggaqf1	1065	7	sensitive	sensitive	JJ
cord-014462-11ggaqf1	1065	8	but	but	CC
cord-014462-11ggaqf1	1065	9	it	-PRON-	PRP
cord-014462-11ggaqf1	1065	10	can	can	MD
cord-014462-11ggaqf1	1065	11	be	be	VB
cord-014462-11ggaqf1	1065	12	slow	slow	JJ
cord-014462-11ggaqf1	1065	13	and	and	CC
cord-014462-11ggaqf1	1065	14	analytical	analytical	JJ
cord-014462-11ggaqf1	1065	15	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1065	16	of	of	IN
cord-014462-11ggaqf1	1065	17	the	the	DT
cord-014462-11ggaqf1	1065	18	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1065	19	is	be	VBZ
cord-014462-11ggaqf1	1065	20	lower	low	JJR
cord-014462-11ggaqf1	1065	21	and	and	CC
cord-014462-11ggaqf1	1065	22	can	can	MD
cord-014462-11ggaqf1	1065	23	not	not	RB
cord-014462-11ggaqf1	1065	24	be	be	VB
cord-014462-11ggaqf1	1065	25	used	use	VBN
cord-014462-11ggaqf1	1065	26	with	with	IN
cord-014462-11ggaqf1	1065	27	certain	certain	JJ
cord-014462-11ggaqf1	1065	28	sample	sample	NN
cord-014462-11ggaqf1	1065	29	types	type	NNS
cord-014462-11ggaqf1	1065	30	.	.	.
cord-014462-11ggaqf1	1066	1	The	the	DT
cord-014462-11ggaqf1	1066	2	use	use	NN
cord-014462-11ggaqf1	1066	3	of	of	IN
cord-014462-11ggaqf1	1066	4	molecular	molecular	JJ
cord-014462-11ggaqf1	1066	5	techniques	technique	NNS
cord-014462-11ggaqf1	1066	6	in	in	IN
cord-014462-11ggaqf1	1066	7	the	the	DT
cord-014462-11ggaqf1	1066	8	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1066	9	laboratory	laboratory	NN
cord-014462-11ggaqf1	1066	10	has	have	VBZ
cord-014462-11ggaqf1	1066	11	greatly	greatly	RB
cord-014462-11ggaqf1	1066	12	increased	increase	VBN
cord-014462-11ggaqf1	1066	13	the	the	DT
cord-014462-11ggaqf1	1066	14	speed	speed	NN
cord-014462-11ggaqf1	1066	15	,	,	,
cord-014462-11ggaqf1	1066	16	specificity	specificity	NN
cord-014462-11ggaqf1	1066	17	and	and	CC
cord-014462-11ggaqf1	1066	18	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1066	19	of	of	IN
cord-014462-11ggaqf1	1066	20	FMD	FMD	NNP
cord-014462-11ggaqf1	1066	21	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1066	22	tests	test	NNS
cord-014462-11ggaqf1	1066	23	.	.	.
cord-014462-11ggaqf1	1067	1	Molecular	molecular	JJ
cord-014462-11ggaqf1	1067	2	techniques	technique	NNS
cord-014462-11ggaqf1	1067	3	like	like	IN
cord-014462-11ggaqf1	1067	4	RT	RT	NNP
cord-014462-11ggaqf1	1067	5	-	-	HYPH
cord-014462-11ggaqf1	1067	6	PCR	PCR	NNP
cord-014462-11ggaqf1	1067	7	,	,	,
cord-014462-11ggaqf1	1067	8	PCR	PCR	NNP
cord-014462-11ggaqf1	1067	9	-	-	HYPH
cord-014462-11ggaqf1	1067	10	ELSA	ELSA	NNP
cord-014462-11ggaqf1	1067	11	and	and	CC
cord-014462-11ggaqf1	1067	12	dot	dot	NN
cord-014462-11ggaqf1	1067	13	hybridization	hybridization	NN
cord-014462-11ggaqf1	1067	14	can	can	MD
cord-014462-11ggaqf1	1067	15	be	be	VB
cord-014462-11ggaqf1	1067	16	used	use	VBN
cord-014462-11ggaqf1	1067	17	with	with	IN
cord-014462-11ggaqf1	1067	18	more	more	JJR
cord-014462-11ggaqf1	1067	19	success	success	NN
cord-014462-11ggaqf1	1067	20	for	for	IN
cord-014462-11ggaqf1	1067	21	detecting	detect	VBG
cord-014462-11ggaqf1	1067	22	carrier	carrier	NN
cord-014462-11ggaqf1	1067	23	animals	animal	NNS
cord-014462-11ggaqf1	1067	24	and	and	CC
cord-014462-11ggaqf1	1067	25	animals	animal	NNS
cord-014462-11ggaqf1	1067	26	harboring	harbor	VBG
cord-014462-11ggaqf1	1067	27	sub	sub	JJ
cord-014462-11ggaqf1	1067	28	-	-	JJ
cord-014462-11ggaqf1	1067	29	clinical	clinical	JJ
cord-014462-11ggaqf1	1067	30	infection	infection	NN
cord-014462-11ggaqf1	1067	31	and	and	CC
cord-014462-11ggaqf1	1067	32	can	can	MD
cord-014462-11ggaqf1	1067	33	be	be	VB
cord-014462-11ggaqf1	1067	34	applied	apply	VBN
cord-014462-11ggaqf1	1067	35	in	in	IN
cord-014462-11ggaqf1	1067	36	a	a	DT
cord-014462-11ggaqf1	1067	37	wide	wide	JJ
cord-014462-11ggaqf1	1067	38	range	range	NN
cord-014462-11ggaqf1	1067	39	of	of	IN
cord-014462-11ggaqf1	1067	40	clinical	clinical	JJ
cord-014462-11ggaqf1	1067	41	sample	sample	NN
cord-014462-11ggaqf1	1067	42	types	type	NNS
cord-014462-11ggaqf1	1067	43	.	.	.
cord-014462-11ggaqf1	1068	1	These	these	DT
cord-014462-11ggaqf1	1068	2	techniques	technique	NNS
cord-014462-11ggaqf1	1068	3	can	can	MD
cord-014462-11ggaqf1	1068	4	be	be	VB
cord-014462-11ggaqf1	1068	5	used	use	VBN
cord-014462-11ggaqf1	1068	6	as	as	IN
cord-014462-11ggaqf1	1068	7	genus	genus	NN
cord-014462-11ggaqf1	1068	8	and	and	CC
cord-014462-11ggaqf1	1068	9	serotype	serotype	JJ
cord-014462-11ggaqf1	1068	10	specific	specific	JJ
cord-014462-11ggaqf1	1068	11	test	test	NN
cord-014462-11ggaqf1	1068	12	including	include	VBG
cord-014462-11ggaqf1	1068	13	detection	detection	NN
cord-014462-11ggaqf1	1068	14	of	of	IN
cord-014462-11ggaqf1	1068	15	particular	particular	JJ
cord-014462-11ggaqf1	1068	16	lineage	lineage	NN
cord-014462-11ggaqf1	1068	17	/	/	SYM
cord-014462-11ggaqf1	1068	18	genotypes	genotype	NNS
cord-014462-11ggaqf1	1068	19	with	with	IN
cord-014462-11ggaqf1	1068	20	in	in	IN
cord-014462-11ggaqf1	1068	21	the	the	DT
cord-014462-11ggaqf1	1068	22	serotype	serotype	NN
cord-014462-11ggaqf1	1068	23	.	.	.
cord-014462-11ggaqf1	1069	1	Multiplex	Multiplex	NNP
cord-014462-11ggaqf1	1069	2	PCR	PCR	NNP
cord-014462-11ggaqf1	1069	3	has	have	VBZ
cord-014462-11ggaqf1	1069	4	been	be	VBN
cord-014462-11ggaqf1	1069	5	used	use	VBN
cord-014462-11ggaqf1	1069	6	to	to	TO
cord-014462-11ggaqf1	1069	7	differentiate	differentiate	VB
cord-014462-11ggaqf1	1069	8	serotypes	serotype	NNS
cord-014462-11ggaqf1	1069	9	of	of	IN
cord-014462-11ggaqf1	1069	10	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1069	11	and	and	CC
cord-014462-11ggaqf1	1069	12	the	the	DT
cord-014462-11ggaqf1	1069	13	technique	technique	NN
cord-014462-11ggaqf1	1069	14	is	be	VBZ
cord-014462-11ggaqf1	1069	15	sensitive	sensitive	JJ
cord-014462-11ggaqf1	1069	16	,	,	,
cord-014462-11ggaqf1	1069	17	experimentally	experimentally	RB
cord-014462-11ggaqf1	1069	18	simpler	simple	JJR
cord-014462-11ggaqf1	1069	19	,	,	,
cord-014462-11ggaqf1	1069	20	cost	cost	VBP
cord-014462-11ggaqf1	1069	21	effective	effective	JJ
cord-014462-11ggaqf1	1069	22	and	and	CC
cord-014462-11ggaqf1	1069	23	less	less	JJR
cord-014462-11ggaqf1	1069	24	time	time	NN
cord-014462-11ggaqf1	1069	25	consuming	consume	VBG
cord-014462-11ggaqf1	1069	26	.	.	.
cord-014462-11ggaqf1	1070	1	The	the	DT
cord-014462-11ggaqf1	1070	2	assay	assay	NN
cord-014462-11ggaqf1	1070	3	can	can	MD
cord-014462-11ggaqf1	1070	4	be	be	VB
cord-014462-11ggaqf1	1070	5	used	use	VBN
cord-014462-11ggaqf1	1070	6	for	for	IN
cord-014462-11ggaqf1	1070	7	serotyping	serotype	VBG
cord-014462-11ggaqf1	1070	8	on	on	IN
cord-014462-11ggaqf1	1070	9	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1070	10	negative	negative	JJ
cord-014462-11ggaqf1	1070	11	samples	sample	NNS
cord-014462-11ggaqf1	1070	12	.	.	.
cord-014462-11ggaqf1	1071	1	The	the	DT
cord-014462-11ggaqf1	1071	2	molecular	molecular	JJ
cord-014462-11ggaqf1	1071	3	techniques	technique	NNS
cord-014462-11ggaqf1	1071	4	not	not	RB
cord-014462-11ggaqf1	1071	5	only	only	RB
cord-014462-11ggaqf1	1071	6	help	help	VBP
cord-014462-11ggaqf1	1071	7	in	in	IN
cord-014462-11ggaqf1	1071	8	diagnosis	diagnosis	NN
cord-014462-11ggaqf1	1071	9	but	but	CC
cord-014462-11ggaqf1	1071	10	also	also	RB
cord-014462-11ggaqf1	1071	11	useful	useful	JJ
cord-014462-11ggaqf1	1071	12	for	for	IN
cord-014462-11ggaqf1	1071	13	epidemiological	epidemiological	JJ
cord-014462-11ggaqf1	1071	14	studies	study	NNS
cord-014462-11ggaqf1	1071	15	.	.	.
cord-014462-11ggaqf1	1072	1	Lineage	lineage	NN
cord-014462-11ggaqf1	1072	2	differentiating	differentiate	VBG
cord-014462-11ggaqf1	1072	3	RT	RT	NNP
cord-014462-11ggaqf1	1072	4	-	-	HYPH
cord-014462-11ggaqf1	1072	5	PCR	PCR	NNP
cord-014462-11ggaqf1	1072	6	has	have	VBZ
cord-014462-11ggaqf1	1072	7	been	be	VBN
cord-014462-11ggaqf1	1072	8	useful	useful	JJ
cord-014462-11ggaqf1	1072	9	in	in	IN
cord-014462-11ggaqf1	1072	10	identifying	identify	VBG
cord-014462-11ggaqf1	1072	11	different	different	JJ
cord-014462-11ggaqf1	1072	12	lineages	lineage	NNS
cord-014462-11ggaqf1	1072	13	of	of	IN
cord-014462-11ggaqf1	1072	14	serotype	serotype	NN
cord-014462-11ggaqf1	1072	15	Asia	Asia	NNP
cord-014462-11ggaqf1	1072	16	1	1	CD
cord-014462-11ggaqf1	1073	1	(	(	-LRB-
cord-014462-11ggaqf1	1073	2	Lineage	Lineage	NNP
cord-014462-11ggaqf1	1073	3	B	B	NNP
cord-014462-11ggaqf1	1073	4	,	,	,
cord-014462-11ggaqf1	1073	5	C	c	NN
cord-014462-11ggaqf1	1073	6	and	and	CC
cord-014462-11ggaqf1	1073	7	D	D	NNP
cord-014462-11ggaqf1	1073	8	)	)	-RRB-
cord-014462-11ggaqf1	1073	9	before	before	IN
cord-014462-11ggaqf1	1073	10	proceeding	proceed	VBG
cord-014462-11ggaqf1	1073	11	with	with	IN
cord-014462-11ggaqf1	1073	12	sequencing	sequencing	NN
cord-014462-11ggaqf1	1073	13	of	of	IN
cord-014462-11ggaqf1	1073	14	1D	1d	CD
cord-014462-11ggaqf1	1073	15	region	region	NN
cord-014462-11ggaqf1	1073	16	.	.	.
cord-014462-11ggaqf1	1074	1	Similarly	similarly	RB
cord-014462-11ggaqf1	1074	2	genotype	genotype	NN
cord-014462-11ggaqf1	1074	3	differentiating	differentiate	VBG
cord-014462-11ggaqf1	1074	4	RT	RT	NNP
cord-014462-11ggaqf1	1074	5	-	-	HYPH
cord-014462-11ggaqf1	1074	6	PCR	PCR	NNP
cord-014462-11ggaqf1	1074	7	has	have	VBZ
cord-014462-11ggaqf1	1074	8	been	be	VBN
cord-014462-11ggaqf1	1074	9	developed	develop	VBN
cord-014462-11ggaqf1	1074	10	and	and	CC
cord-014462-11ggaqf1	1074	11	used	use	VBN
cord-014462-11ggaqf1	1074	12	in	in	IN
cord-014462-11ggaqf1	1074	13	differentiating	differentiate	VBG
cord-014462-11ggaqf1	1074	14	two	two	CD
cord-014462-11ggaqf1	1074	15	different	different	JJ
cord-014462-11ggaqf1	1074	16	genotypes	genotype	NNS
cord-014462-11ggaqf1	1074	17	of	of	IN
cord-014462-11ggaqf1	1074	18	serotype	serotype	NN
cord-014462-11ggaqf1	1074	19	A	a	NN
cord-014462-11ggaqf1	1074	20	(	(	-LRB-
cord-014462-11ggaqf1	1074	21	Genotype	Genotype	NNP
cord-014462-11ggaqf1	1074	22	VI	VI	NNP
cord-014462-11ggaqf1	1074	23	and	and	CC
cord-014462-11ggaqf1	1074	24	VII	VII	NNP
cord-014462-11ggaqf1	1074	25	)	)	-RRB-
cord-014462-11ggaqf1	1074	26	.	.	.
cord-014462-11ggaqf1	1075	1	These	these	DT
cord-014462-11ggaqf1	1075	2	assays	assay	NNS
cord-014462-11ggaqf1	1075	3	have	have	VBP
cord-014462-11ggaqf1	1075	4	the	the	DT
cord-014462-11ggaqf1	1075	5	potential	potential	NN
cord-014462-11ggaqf1	1075	6	to	to	TO
cord-014462-11ggaqf1	1075	7	be	be	VB
cord-014462-11ggaqf1	1075	8	applied	apply	VBN
cord-014462-11ggaqf1	1075	9	on	on	IN
cord-014462-11ggaqf1	1075	10	clinical	clinical	JJ
cord-014462-11ggaqf1	1075	11	samples	sample	NNS
cord-014462-11ggaqf1	1075	12	directly	directly	RB
cord-014462-11ggaqf1	1075	13	,	,	,
cord-014462-11ggaqf1	1075	14	thereby	thereby	RB
cord-014462-11ggaqf1	1075	15	saving	save	VBG
cord-014462-11ggaqf1	1075	16	much	much	JJ
cord-014462-11ggaqf1	1075	17	time	time	NN
cord-014462-11ggaqf1	1075	18	needed	need	VBN
cord-014462-11ggaqf1	1075	19	for	for	IN
cord-014462-11ggaqf1	1075	20	sample	sample	NN
cord-014462-11ggaqf1	1075	21	processing	processing	NN
cord-014462-11ggaqf1	1075	22	and	and	CC
cord-014462-11ggaqf1	1075	23	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1075	24	sequencing	sequencing	NN
cord-014462-11ggaqf1	1075	25	.	.	.
cord-014462-11ggaqf1	1076	1	Recent	recent	JJ
cord-014462-11ggaqf1	1076	2	development	development	NN
cord-014462-11ggaqf1	1076	3	of	of	IN
cord-014462-11ggaqf1	1076	4	real	real	JJ
cord-014462-11ggaqf1	1076	5	time	time	NN
cord-014462-11ggaqf1	1076	6	RT	RT	NNP
cord-014462-11ggaqf1	1076	7	-	-	HYPH
cord-014462-11ggaqf1	1076	8	PCR	PCR	NNP
cord-014462-11ggaqf1	1076	9	methodology	methodology	NN
cord-014462-11ggaqf1	1076	10	has	have	VBZ
cord-014462-11ggaqf1	1076	11	allowed	allow	VBN
cord-014462-11ggaqf1	1076	12	the	the	DT
cord-014462-11ggaqf1	1076	13	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1076	14	potential	potential	NN
cord-014462-11ggaqf1	1076	15	of	of	IN
cord-014462-11ggaqf1	1076	16	molecular	molecular	JJ
cord-014462-11ggaqf1	1076	17	assays	assay	NNS
cord-014462-11ggaqf1	1076	18	to	to	TO
cord-014462-11ggaqf1	1076	19	be	be	VB
cord-014462-11ggaqf1	1076	20	realised	realise	VBN
cord-014462-11ggaqf1	1076	21	.	.	.
cord-014462-11ggaqf1	1077	1	Advancement	advancement	NN
cord-014462-11ggaqf1	1077	2	in	in	IN
cord-014462-11ggaqf1	1077	3	real	real	JJ
cord-014462-11ggaqf1	1077	4	time	time	NN
cord-014462-11ggaqf1	1077	5	PCR	PCR	NNP
cord-014462-11ggaqf1	1077	6	technology	technology	NN
cord-014462-11ggaqf1	1077	7	made	make	VBD
cord-014462-11ggaqf1	1077	8	it	-PRON-	PRP
cord-014462-11ggaqf1	1077	9	possible	possible	JJ
cord-014462-11ggaqf1	1077	10	to	to	TO
cord-014462-11ggaqf1	1077	11	combine	combine	VB
cord-014462-11ggaqf1	1077	12	several	several	JJ
cord-014462-11ggaqf1	1077	13	assays	assay	NNS
cord-014462-11ggaqf1	1077	14	within	within	IN
cord-014462-11ggaqf1	1077	15	a	a	DT
cord-014462-11ggaqf1	1077	16	single	single	JJ
cord-014462-11ggaqf1	1077	17	tube	tube	NN
cord-014462-11ggaqf1	1077	18	which	which	WDT
cord-014462-11ggaqf1	1077	19	is	be	VBZ
cord-014462-11ggaqf1	1077	20	in	in	IN
cord-014462-11ggaqf1	1077	21	the	the	DT
cord-014462-11ggaqf1	1077	22	progress	progress	NN
cord-014462-11ggaqf1	1077	23	in	in	IN
cord-014462-11ggaqf1	1077	24	our	-PRON-	PRP$
cord-014462-11ggaqf1	1077	25	laboratory	laboratory	NN
cord-014462-11ggaqf1	1077	26	.	.	.
cord-014462-11ggaqf1	1078	1	Integration	integration	NN
cord-014462-11ggaqf1	1078	2	of	of	IN
cord-014462-11ggaqf1	1078	3	these	these	DT
cord-014462-11ggaqf1	1078	4	assays	assay	NNS
cord-014462-11ggaqf1	1078	5	onto	onto	IN
cord-014462-11ggaqf1	1078	6	automated	automate	VBN
cord-014462-11ggaqf1	1078	7	high	high	JJ
cord-014462-11ggaqf1	1078	8	throughput	throughput	NN
cord-014462-11ggaqf1	1078	9	platforms	platform	NNS
cord-014462-11ggaqf1	1078	10	provides	provide	VBZ
cord-014462-11ggaqf1	1078	11	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1078	12	laboratories	laboratory	NNS
cord-014462-11ggaqf1	1078	13	with	with	IN
cord-014462-11ggaqf1	1078	14	the	the	DT
cord-014462-11ggaqf1	1078	15	capability	capability	NN
cord-014462-11ggaqf1	1078	16	to	to	TO
cord-014462-11ggaqf1	1078	17	test	test	VB
cord-014462-11ggaqf1	1078	18	large	large	JJ
cord-014462-11ggaqf1	1078	19	numbers	number	NNS
cord-014462-11ggaqf1	1078	20	of	of	IN
cord-014462-11ggaqf1	1078	21	samples	sample	NNS
cord-014462-11ggaqf1	1078	22	.	.	.
cord-014462-11ggaqf1	1079	1	Microarray	Microarray	NNP
cord-014462-11ggaqf1	1079	2	technology	technology	NN
cord-014462-11ggaqf1	1079	3	was	be	VBD
cord-014462-11ggaqf1	1079	4	provided	provide	VBN
cord-014462-11ggaqf1	1079	5	greater	great	JJR
cord-014462-11ggaqf1	1079	6	screening	screening	NN
cord-014462-11ggaqf1	1079	7	capabilities	capability	NNS
cord-014462-11ggaqf1	1079	8	for	for	IN
cord-014462-11ggaqf1	1079	9	pathogen	pathogen	NN
cord-014462-11ggaqf1	1079	10	detection	detection	NN
cord-014462-11ggaqf1	1079	11	.	.	.
cord-014462-11ggaqf1	1080	1	The	the	DT
cord-014462-11ggaqf1	1080	2	microarray	microarray	NN
cord-014462-11ggaqf1	1080	3	allows	allow	VBZ
cord-014462-11ggaqf1	1080	4	the	the	DT
cord-014462-11ggaqf1	1080	5	addition	addition	NN
cord-014462-11ggaqf1	1080	6	of	of	IN
cord-014462-11ggaqf1	1080	7	large	large	JJ
cord-014462-11ggaqf1	1080	8	number	number	NN
cord-014462-11ggaqf1	1080	9	of	of	IN
cord-014462-11ggaqf1	1080	10	oligonucleotide	oligonucleotide	JJ
cord-014462-11ggaqf1	1080	11	probes	probe	NNS
cord-014462-11ggaqf1	1080	12	for	for	IN
cord-014462-11ggaqf1	1080	13	identification	identification	NN
cord-014462-11ggaqf1	1080	14	of	of	IN
cord-014462-11ggaqf1	1080	15	mutant	mutant	JJ
cord-014462-11ggaqf1	1080	16	pathogen	pathogen	NN
cord-014462-11ggaqf1	1080	17	and	and	CC
cord-014462-11ggaqf1	1080	18	also	also	RB
cord-014462-11ggaqf1	1080	19	for	for	IN
cord-014462-11ggaqf1	1080	20	subtype	subtype	NN
cord-014462-11ggaqf1	1080	21	determination	determination	NN
cord-014462-11ggaqf1	1080	22	.	.	.
cord-014462-11ggaqf1	1081	1	The	the	DT
cord-014462-11ggaqf1	1081	2	combined	combined	JJ
cord-014462-11ggaqf1	1081	3	properties	property	NNS
cord-014462-11ggaqf1	1081	4	of	of	IN
cord-014462-11ggaqf1	1081	5	high	high	JJ
cord-014462-11ggaqf1	1081	6	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1081	7	and	and	CC
cord-014462-11ggaqf1	1081	8	specificity	specificity	NN
cord-014462-11ggaqf1	1081	9	,	,	,
cord-014462-11ggaqf1	1081	10	low	low	JJ
cord-014462-11ggaqf1	1081	11	contamination	contamination	NN
cord-014462-11ggaqf1	1081	12	risk	risk	NN
cord-014462-11ggaqf1	1081	13	,	,	,
cord-014462-11ggaqf1	1081	14	and	and	CC
cord-014462-11ggaqf1	1081	15	speed	speed	NN
cord-014462-11ggaqf1	1081	16	has	have	VBZ
cord-014462-11ggaqf1	1081	17	made	make	VBN
cord-014462-11ggaqf1	1081	18	realtime	realtime	JJ
cord-014462-11ggaqf1	1081	19	PCR	PCR	NNP
cord-014462-11ggaqf1	1081	20	and	and	CC
cord-014462-11ggaqf1	1081	21	microarray	microarray	NN
cord-014462-11ggaqf1	1081	22	technology	technology	NN
cord-014462-11ggaqf1	1081	23	a	a	DT
cord-014462-11ggaqf1	1081	24	highly	highly	RB
cord-014462-11ggaqf1	1081	25	attractive	attractive	JJ
cord-014462-11ggaqf1	1081	26	alternative	alternative	NN
cord-014462-11ggaqf1	1081	27	to	to	IN
cord-014462-11ggaqf1	1081	28	conventional	conventional	JJ
cord-014462-11ggaqf1	1081	29	methods	method	NNS
cord-014462-11ggaqf1	1081	30	in	in	IN
cord-014462-11ggaqf1	1081	31	increasing	increase	VBG
cord-014462-11ggaqf1	1081	32	percentage	percentage	NN
cord-014462-11ggaqf1	1081	33	of	of	IN
cord-014462-11ggaqf1	1081	34	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	1081	35	confirmed	confirm	VBN
cord-014462-11ggaqf1	1081	36	and	and	CC
cord-014462-11ggaqf1	1081	37	analyzed	analyze	VBD
cord-014462-11ggaqf1	1081	38	and	and	CC
cord-014462-11ggaqf1	1081	39	for	for	IN
cord-014462-11ggaqf1	1081	40	tracing	trace	VBG
cord-014462-11ggaqf1	1081	41	the	the	DT
cord-014462-11ggaqf1	1081	42	origin	origin	NN
cord-014462-11ggaqf1	1081	43	of	of	IN
cord-014462-11ggaqf1	1081	44	FMD	FMD	NNP
cord-014462-11ggaqf1	1081	45	virus	virus	NN
cord-014462-11ggaqf1	1081	46	responsible	responsible	JJ
cord-014462-11ggaqf1	1081	47	for	for	IN
cord-014462-11ggaqf1	1081	48	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	1081	49	.	.	.
cord-014462-11ggaqf1	1082	1	DNA	DNA	NNP
cord-014462-11ggaqf1	1082	2	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1082	3	are	be	VBP
cord-014462-11ggaqf1	1082	4	expected	expect	VBN
cord-014462-11ggaqf1	1082	5	to	to	TO
cord-014462-11ggaqf1	1082	6	elicit	elicit	VB
cord-014462-11ggaqf1	1082	7	both	both	DT
cord-014462-11ggaqf1	1082	8	humoral	humoral	JJ
cord-014462-11ggaqf1	1082	9	and	and	CC
cord-014462-11ggaqf1	1082	10	cellular	cellular	JJ
cord-014462-11ggaqf1	1082	11	responses	response	NNS
cord-014462-11ggaqf1	1082	12	,	,	,
cord-014462-11ggaqf1	1082	13	cellular	cellular	JJ
cord-014462-11ggaqf1	1082	14	response	response	NN
cord-014462-11ggaqf1	1082	15	being	be	VBG
cord-014462-11ggaqf1	1082	16	long	long	RB
cord-014462-11ggaqf1	1082	17	lasting	last	VBG
cord-014462-11ggaqf1	1082	18	.	.	.
cord-014462-11ggaqf1	1083	1	However	however	RB
cord-014462-11ggaqf1	1083	2	the	the	DT
cord-014462-11ggaqf1	1083	3	approach	approach	NN
cord-014462-11ggaqf1	1083	4	has	have	VBZ
cord-014462-11ggaqf1	1083	5	several	several	JJ
cord-014462-11ggaqf1	1083	6	limitations	limitation	NNS
cord-014462-11ggaqf1	1083	7	like	like	IN
cord-014462-11ggaqf1	1083	8	poor	poor	JJ
cord-014462-11ggaqf1	1083	9	stability	stability	NN
cord-014462-11ggaqf1	1083	10	of	of	IN
cord-014462-11ggaqf1	1083	11	DNA	dna	NN
cord-014462-11ggaqf1	1083	12	,	,	,
cord-014462-11ggaqf1	1083	13	poor	poor	JJ
cord-014462-11ggaqf1	1083	14	expression	expression	NN
cord-014462-11ggaqf1	1083	15	and	and	CC
cord-014462-11ggaqf1	1083	16	risk	risk	NN
cord-014462-11ggaqf1	1083	17	of	of	IN
cord-014462-11ggaqf1	1083	18	integration	integration	NN
cord-014462-11ggaqf1	1083	19	.	.	.
cord-014462-11ggaqf1	1084	1	Poor	poor	JJ
cord-014462-11ggaqf1	1084	2	expression	expression	NN
cord-014462-11ggaqf1	1084	3	becomes	become	VBZ
cord-014462-11ggaqf1	1084	4	the	the	DT
cord-014462-11ggaqf1	1084	5	major	major	JJ
cord-014462-11ggaqf1	1084	6	limitation	limitation	NN
cord-014462-11ggaqf1	1084	7	in	in	IN
cord-014462-11ggaqf1	1084	8	the	the	DT
cord-014462-11ggaqf1	1084	9	case	case	NN
cord-014462-11ggaqf1	1084	10	of	of	IN
cord-014462-11ggaqf1	1084	11	FMD	FMD	NNP
cord-014462-11ggaqf1	1084	12	as	as	IN
cord-014462-11ggaqf1	1084	13	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1084	14	proteins	protein	NNS
cord-014462-11ggaqf1	1084	15	are	be	VBP
cord-014462-11ggaqf1	1084	16	poor	poor	JJ
cord-014462-11ggaqf1	1084	17	immunogens	immunogen	NNS
cord-014462-11ggaqf1	1084	18	.	.	.
cord-014462-11ggaqf1	1085	1	Also	also	RB
cord-014462-11ggaqf1	1085	2	DNA	dna	NN
cord-014462-11ggaqf1	1085	3	vaccine	vaccine	NN
cord-014462-11ggaqf1	1085	4	vectors	vector	NNS
cord-014462-11ggaqf1	1085	5	carrying	carry	VBG
cord-014462-11ggaqf1	1085	6	only	only	RB
cord-014462-11ggaqf1	1085	7	eukaryotic	eukaryotic	JJ
cord-014462-11ggaqf1	1085	8	promoters	promoter	NNS
cord-014462-11ggaqf1	1085	9	elicit	elicit	VBP
cord-014462-11ggaqf1	1085	10	strong	strong	JJ
cord-014462-11ggaqf1	1085	11	CMI	CMI	NNP
cord-014462-11ggaqf1	1085	12	response	response	NN
cord-014462-11ggaqf1	1085	13	and	and	CC
cord-014462-11ggaqf1	1085	14	weak	weak	JJ
cord-014462-11ggaqf1	1085	15	humoral	humoral	JJ
cord-014462-11ggaqf1	1085	16	response	response	NN
cord-014462-11ggaqf1	1085	17	.	.	.
cord-014462-11ggaqf1	1086	1	The	the	DT
cord-014462-11ggaqf1	1086	2	methodology	methodology	NN
cord-014462-11ggaqf1	1086	3	to	to	TO
cord-014462-11ggaqf1	1086	4	achieve	achieve	VB
cord-014462-11ggaqf1	1086	5	humoral	humoral	JJ
cord-014462-11ggaqf1	1086	6	response	response	NN
cord-014462-11ggaqf1	1086	7	involves	involve	VBZ
cord-014462-11ggaqf1	1086	8	the	the	DT
cord-014462-11ggaqf1	1086	9	expression	expression	NN
cord-014462-11ggaqf1	1086	10	and	and	CC
cord-014462-11ggaqf1	1086	11	secretion	secretion	NN
cord-014462-11ggaqf1	1086	12	of	of	IN
cord-014462-11ggaqf1	1086	13	the	the	DT
cord-014462-11ggaqf1	1086	14	expressed	express	VBN
cord-014462-11ggaqf1	1086	15	protein	protein	NN
cord-014462-11ggaqf1	1086	16	so	so	IN
cord-014462-11ggaqf1	1086	17	that	that	IN
cord-014462-11ggaqf1	1086	18	the	the	DT
cord-014462-11ggaqf1	1086	19	antigen	antigen	NN
cord-014462-11ggaqf1	1086	20	presenting	present	VBG
cord-014462-11ggaqf1	1086	21	cells	cell	NNS
cord-014462-11ggaqf1	1086	22	will	will	MD
cord-014462-11ggaqf1	1086	23	be	be	VB
cord-014462-11ggaqf1	1086	24	able	able	JJ
cord-014462-11ggaqf1	1086	25	to	to	TO
cord-014462-11ggaqf1	1086	26	process	process	VB
cord-014462-11ggaqf1	1086	27	the	the	DT
cord-014462-11ggaqf1	1086	28	antigen	antigen	NN
cord-014462-11ggaqf1	1086	29	and	and	CC
cord-014462-11ggaqf1	1086	30	produce	produce	VB
cord-014462-11ggaqf1	1086	31	humoral	humoral	JJ
cord-014462-11ggaqf1	1086	32	response	response	NN
cord-014462-11ggaqf1	1086	33	.	.	.
cord-014462-11ggaqf1	1087	1	In	in	IN
cord-014462-11ggaqf1	1087	2	case	case	NN
cord-014462-11ggaqf1	1087	3	of	of	IN
cord-014462-11ggaqf1	1087	4	FMD	FMD	NNP
cord-014462-11ggaqf1	1087	5	humoral	humoral	JJ
cord-014462-11ggaqf1	1087	6	response	response	NN
cord-014462-11ggaqf1	1087	7	is	be	VBZ
cord-014462-11ggaqf1	1087	8	as	as	RB
cord-014462-11ggaqf1	1087	9	important	important	JJ
cord-014462-11ggaqf1	1087	10	as	as	IN
cord-014462-11ggaqf1	1087	11	cellular	cellular	JJ
cord-014462-11ggaqf1	1087	12	response	response	NN
cord-014462-11ggaqf1	1087	13	.	.	.
cord-014462-11ggaqf1	1088	1	The	the	DT
cord-014462-11ggaqf1	1088	2	present	present	JJ
cord-014462-11ggaqf1	1088	3	project	project	NN
cord-014462-11ggaqf1	1088	4	aims	aim	VBZ
cord-014462-11ggaqf1	1088	5	at	at	IN
cord-014462-11ggaqf1	1088	6	addressing	address	VBG
cord-014462-11ggaqf1	1088	7	these	these	DT
cord-014462-11ggaqf1	1088	8	issues	issue	NNS
cord-014462-11ggaqf1	1088	9	;	;	,
cord-014462-11ggaqf1	1088	10	achieving	achieve	VBG
cord-014462-11ggaqf1	1088	11	higher	high	JJR
cord-014462-11ggaqf1	1088	12	expression	expression	NN
cord-014462-11ggaqf1	1088	13	and	and	CC
cord-014462-11ggaqf1	1088	14	getting	get	VBG
cord-014462-11ggaqf1	1088	15	the	the	DT
cord-014462-11ggaqf1	1088	16	protein	protein	NN
cord-014462-11ggaqf1	1088	17	secreted	secrete	VBN
cord-014462-11ggaqf1	1088	18	out	out	RP
cord-014462-11ggaqf1	1088	19	by	by	IN
cord-014462-11ggaqf1	1088	20	constructing	construct	VBG
cord-014462-11ggaqf1	1088	21	self	self	NN
cord-014462-11ggaqf1	1088	22	replicating	replicate	VBG
cord-014462-11ggaqf1	1088	23	gene	gene	NN
cord-014462-11ggaqf1	1088	24	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1088	25	for	for	IN
cord-014462-11ggaqf1	1088	26	FMD	FMD	NNP
cord-014462-11ggaqf1	1088	27	and	and	CC
cord-014462-11ggaqf1	1088	28	studying	study	VBG
cord-014462-11ggaqf1	1088	29	their	-PRON-	PRP$
cord-014462-11ggaqf1	1088	30	efficacy	efficacy	NN
cord-014462-11ggaqf1	1088	31	.	.	.
cord-014462-11ggaqf1	1089	1	The	the	DT
cord-014462-11ggaqf1	1089	2	vector	vector	NN
cord-014462-11ggaqf1	1089	3	for	for	IN
cord-014462-11ggaqf1	1089	4	humoral	humoral	JJ
cord-014462-11ggaqf1	1089	5	immune	immune	JJ
cord-014462-11ggaqf1	1089	6	response	response	NN
cord-014462-11ggaqf1	1089	7	contains	contain	VBZ
cord-014462-11ggaqf1	1089	8	eEF1	eEF1	NNP
cord-014462-11ggaqf1	1089	9	promoter	promoter	NN
cord-014462-11ggaqf1	1089	10	,	,	,
cord-014462-11ggaqf1	1089	11	Sindbis	Sindbis	NNP
cord-014462-11ggaqf1	1089	12	virus	virus	NN
cord-014462-11ggaqf1	1089	13	polymerase	polymerase	NN
cord-014462-11ggaqf1	1089	14	gene	gene	NN
cord-014462-11ggaqf1	1089	15	and	and	CC
cord-014462-11ggaqf1	1089	16	secretory	secretory	NN
cord-014462-11ggaqf1	1089	17	and	and	CC
cord-014462-11ggaqf1	1089	18	anchoring	anchoring	NN
cord-014462-11ggaqf1	1089	19	signals	signal	NNS
cord-014462-11ggaqf1	1089	20	.	.	.
cord-014462-11ggaqf1	1090	1	The	the	DT
cord-014462-11ggaqf1	1090	2	integrity	integrity	NN
cord-014462-11ggaqf1	1090	3	of	of	IN
cord-014462-11ggaqf1	1090	4	the	the	DT
cord-014462-11ggaqf1	1090	5	vectors	vector	NNS
cord-014462-11ggaqf1	1090	6	was	be	VBD
cord-014462-11ggaqf1	1090	7	confirmed	confirm	VBN
cord-014462-11ggaqf1	1090	8	by	by	IN
cord-014462-11ggaqf1	1090	9	sequence	sequence	NN
cord-014462-11ggaqf1	1090	10	analysis	analysis	NN
cord-014462-11ggaqf1	1090	11	.	.	.
cord-014462-11ggaqf1	1091	1	The	the	DT
cord-014462-11ggaqf1	1091	2	linked	link	VBN
cord-014462-11ggaqf1	1091	3	polyvalent	polyvalent	JJ
cord-014462-11ggaqf1	1091	4	protein	protein	NN
cord-014462-11ggaqf1	1091	5	genes	gene	NNS
cord-014462-11ggaqf1	1091	6	of	of	IN
cord-014462-11ggaqf1	1091	7	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1091	8	serotype	serotype	NN
cord-014462-11ggaqf1	1091	9	A	A	NNP
cord-014462-11ggaqf1	1091	10	,	,	,
cord-014462-11ggaqf1	1091	11	O	o	UH
cord-014462-11ggaqf1	1091	12	and	and	CC
cord-014462-11ggaqf1	1091	13	Asia	Asia	NNP
cord-014462-11ggaqf1	1091	14	1	1	CD
cord-014462-11ggaqf1	1091	15	were	be	VBD
cord-014462-11ggaqf1	1091	16	cloned	clone	VBN
cord-014462-11ggaqf1	1091	17	into	into	IN
cord-014462-11ggaqf1	1091	18	the	the	DT
cord-014462-11ggaqf1	1091	19	vectors	vector	NNS
cord-014462-11ggaqf1	1091	20	and	and	CC
cord-014462-11ggaqf1	1091	21	the	the	DT
cord-014462-11ggaqf1	1091	22	presence	presence	NN
cord-014462-11ggaqf1	1091	23	of	of	IN
cord-014462-11ggaqf1	1091	24	the	the	DT
cord-014462-11ggaqf1	1091	25	insert	insert	NN
cord-014462-11ggaqf1	1091	26	was	be	VBD
cord-014462-11ggaqf1	1091	27	confirmed	confirm	VBN
cord-014462-11ggaqf1	1091	28	by	by	IN
cord-014462-11ggaqf1	1091	29	restriction	restriction	NN
cord-014462-11ggaqf1	1091	30	enzyme	enzyme	NN
cord-014462-11ggaqf1	1091	31	digestion	digestion	NN
cord-014462-11ggaqf1	1091	32	.	.	.
cord-014462-11ggaqf1	1092	1	The	the	DT
cord-014462-11ggaqf1	1092	2	functionality	functionality	NN
cord-014462-11ggaqf1	1092	3	of	of	IN
cord-014462-11ggaqf1	1092	4	the	the	DT
cord-014462-11ggaqf1	1092	5	constructed	construct	VBN
cord-014462-11ggaqf1	1092	6	DNA	dna	NN
cord-014462-11ggaqf1	1092	7	vaccine	vaccine	NN
cord-014462-11ggaqf1	1092	8	vector	vector	NN
cord-014462-11ggaqf1	1092	9	(	(	-LRB-
cord-014462-11ggaqf1	1092	10	pVac	pVac	NNP
cord-014462-11ggaqf1	1092	11	Self	Self	NNP
cord-014462-11ggaqf1	1092	12	Rep	Rep	NNP
cord-014462-11ggaqf1	1092	13	990	990	CD
cord-014462-11ggaqf1	1092	14	)	)	-RRB-
cord-014462-11ggaqf1	1092	15	was	be	VBD
cord-014462-11ggaqf1	1092	16	assayed	assay	VBN
cord-014462-11ggaqf1	1092	17	by	by	IN
cord-014462-11ggaqf1	1092	18	transfecting	transfecte	VBG
cord-014462-11ggaqf1	1092	19	the	the	DT
cord-014462-11ggaqf1	1092	20	DNA	DNA	NNP
cord-014462-11ggaqf1	1092	21	into	into	IN
cord-014462-11ggaqf1	1092	22	BHK	BHK	NNP
cord-014462-11ggaqf1	1092	23	21	21	CD
cord-014462-11ggaqf1	1092	24	cell	cell	NN
cord-014462-11ggaqf1	1092	25	monolayer	monolayer	NN
cord-014462-11ggaqf1	1092	26	and	and	CC
cord-014462-11ggaqf1	1092	27	studying	study	VBG
cord-014462-11ggaqf1	1092	28	the	the	DT
cord-014462-11ggaqf1	1092	29	35	35	CD
cord-014462-11ggaqf1	1092	30	S	S	NNP
cord-014462-11ggaqf1	1092	31	labeled	label	VBD
cord-014462-11ggaqf1	1092	32	proteins	protein	NNS
cord-014462-11ggaqf1	1092	33	in	in	IN
cord-014462-11ggaqf1	1092	34	immuno	immuno	JJ
cord-014462-11ggaqf1	1092	35	-	-	HYPH
cord-014462-11ggaqf1	1092	36	precipitation	precipitation	NN
cord-014462-11ggaqf1	1092	37	assays	assay	NNS
cord-014462-11ggaqf1	1092	38	.	.	.
cord-014462-11ggaqf1	1093	1	The	the	DT
cord-014462-11ggaqf1	1093	2	studies	study	NNS
cord-014462-11ggaqf1	1093	3	showed	show	VBD
cord-014462-11ggaqf1	1093	4	high	high	JJ
cord-014462-11ggaqf1	1093	5	level	level	NN
cord-014462-11ggaqf1	1093	6	of	of	IN
cord-014462-11ggaqf1	1093	7	expression	expression	NN
cord-014462-11ggaqf1	1093	8	in	in	IN
cord-014462-11ggaqf1	1093	9	case	case	NN
cord-014462-11ggaqf1	1093	10	of	of	IN
cord-014462-11ggaqf1	1093	11	constructed	construct	VBN
cord-014462-11ggaqf1	1093	12	vector	vector	NN
cord-014462-11ggaqf1	1093	13	as	as	IN
cord-014462-11ggaqf1	1093	14	compared	compare	VBN
cord-014462-11ggaqf1	1093	15	to	to	IN
cord-014462-11ggaqf1	1093	16	infected	infected	JJ
cord-014462-11ggaqf1	1093	17	virus	virus	NN
cord-014462-11ggaqf1	1093	18	for	for	IN
cord-014462-11ggaqf1	1093	19	the	the	DT
cord-014462-11ggaqf1	1093	20	specific	specific	JJ
cord-014462-11ggaqf1	1093	21	protein	protein	NN
cord-014462-11ggaqf1	1093	22	.	.	.
cord-014462-11ggaqf1	1094	1	The	the	DT
cord-014462-11ggaqf1	1094	2	secretion	secretion	NN
cord-014462-11ggaqf1	1094	3	of	of	IN
cord-014462-11ggaqf1	1094	4	the	the	DT
cord-014462-11ggaqf1	1094	5	expressed	express	VBN
cord-014462-11ggaqf1	1094	6	protein	protein	NN
cord-014462-11ggaqf1	1094	7	was	be	VBD
cord-014462-11ggaqf1	1094	8	assayed	assay	VBN
cord-014462-11ggaqf1	1094	9	by	by	IN
cord-014462-11ggaqf1	1094	10	Immuno	immuno	JJ
cord-014462-11ggaqf1	1094	11	-	-	HYPH
cord-014462-11ggaqf1	1094	12	fluorescence	fluorescence	NN
cord-014462-11ggaqf1	1094	13	assay	assay	NN
cord-014462-11ggaqf1	1094	14	and	and	CC
cord-014462-11ggaqf1	1094	15	found	find	VBD
cord-014462-11ggaqf1	1094	16	to	to	TO
cord-014462-11ggaqf1	1094	17	be	be	VB
cord-014462-11ggaqf1	1094	18	positive	positive	JJ
cord-014462-11ggaqf1	1094	19	.	.	.
cord-014462-11ggaqf1	1095	1	Encouraged	encourage	VBN
cord-014462-11ggaqf1	1095	2	with	with	IN
cord-014462-11ggaqf1	1095	3	these	these	DT
cord-014462-11ggaqf1	1095	4	studies	study	NNS
cord-014462-11ggaqf1	1095	5	the	the	DT
cord-014462-11ggaqf1	1095	6	preliminary	preliminary	JJ
cord-014462-11ggaqf1	1095	7	studies	study	NNS
cord-014462-11ggaqf1	1095	8	were	be	VBD
cord-014462-11ggaqf1	1095	9	conducted	conduct	VBN
cord-014462-11ggaqf1	1095	10	on	on	IN
cord-014462-11ggaqf1	1095	11	vaccine	vaccine	NN
cord-014462-11ggaqf1	1095	12	efficacy	efficacy	NN
cord-014462-11ggaqf1	1095	13	studies	study	NNS
cord-014462-11ggaqf1	1095	14	in	in	IN
cord-014462-11ggaqf1	1095	15	guinea	guinea	NNP
cord-014462-11ggaqf1	1095	16	pig	pig	NN
cord-014462-11ggaqf1	1095	17	model	model	NN
cord-014462-11ggaqf1	1095	18	.	.	.
cord-014462-11ggaqf1	1096	1	The	the	DT
cord-014462-11ggaqf1	1096	2	immunized	immunize	VBN
cord-014462-11ggaqf1	1096	3	guinea	guinea	NN
cord-014462-11ggaqf1	1096	4	pigs	pig	NNS
cord-014462-11ggaqf1	1096	5	showed	show	VBD
cord-014462-11ggaqf1	1096	6	high	high	JJ
cord-014462-11ggaqf1	1096	7	antibody	antibody	NN
cord-014462-11ggaqf1	1096	8	titres	titre	NNS
cord-014462-11ggaqf1	1096	9	by	by	IN
cord-014462-11ggaqf1	1096	10	SNT	SNT	NNP
cord-014462-11ggaqf1	1096	11	and	and	CC
cord-014462-11ggaqf1	1096	12	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1096	13	,	,	,
cord-014462-11ggaqf1	1096	14	as	as	IN
cord-014462-11ggaqf1	1096	15	compared	compare	VBN
cord-014462-11ggaqf1	1096	16	to	to	IN
cord-014462-11ggaqf1	1096	17	conventional	conventional	JJ
cord-014462-11ggaqf1	1096	18	DNA	dna	NN
cord-014462-11ggaqf1	1096	19	Vaccines	vaccine	NNS
cord-014462-11ggaqf1	1096	20	(	(	-LRB-
cord-014462-11ggaqf1	1096	21	pUP3CD	pup3cd	LS
cord-014462-11ggaqf1	1096	22	)	)	-RRB-
cord-014462-11ggaqf1	1096	23	even	even	RB
cord-014462-11ggaqf1	1096	24	at	at	IN
cord-014462-11ggaqf1	1096	25	1/10th	1/10th	CD
cord-014462-11ggaqf1	1096	26	of	of	IN
cord-014462-11ggaqf1	1096	27	the	the	DT
cord-014462-11ggaqf1	1096	28	dose	dose	NN
cord-014462-11ggaqf1	1096	29	.	.	.
cord-014462-11ggaqf1	1097	1	This	this	DT
cord-014462-11ggaqf1	1097	2	approach	approach	NN
cord-014462-11ggaqf1	1097	3	of	of	IN
cord-014462-11ggaqf1	1097	4	constructing	construct	VBG
cord-014462-11ggaqf1	1097	5	self	self	NN
cord-014462-11ggaqf1	1097	6	replicating	replicate	VBG
cord-014462-11ggaqf1	1097	7	DNA	dna	NN
cord-014462-11ggaqf1	1097	8	vaccine	vaccine	NN
cord-014462-11ggaqf1	1097	9	for	for	IN
cord-014462-11ggaqf1	1097	10	humoral	humoral	JJ
cord-014462-11ggaqf1	1097	11	response	response	NN
cord-014462-11ggaqf1	1097	12	is	be	VBZ
cord-014462-11ggaqf1	1097	13	the	the	DT
cord-014462-11ggaqf1	1097	14	first	first	JJ
cord-014462-11ggaqf1	1097	15	report	report	NN
cord-014462-11ggaqf1	1097	16	.	.	.
cord-014462-11ggaqf1	1098	1	Genetically	genetically	RB
cord-014462-11ggaqf1	1098	2	engineered	engineer	VBN
cord-014462-11ggaqf1	1098	3	microorganisms	microorganism	NNS
cord-014462-11ggaqf1	1098	4	are	be	VBP
cord-014462-11ggaqf1	1098	5	important	important	JJ
cord-014462-11ggaqf1	1098	6	sources	source	NNS
cord-014462-11ggaqf1	1098	7	of	of	IN
cord-014462-11ggaqf1	1098	8	industrial	industrial	JJ
cord-014462-11ggaqf1	1098	9	and	and	CC
cord-014462-11ggaqf1	1098	10	medicinal	medicinal	JJ
cord-014462-11ggaqf1	1098	11	proteins	protein	NNS
cord-014462-11ggaqf1	1098	12	.	.	.
cord-014462-11ggaqf1	1099	1	Over	over	IN
cord-014462-11ggaqf1	1099	2	the	the	DT
cord-014462-11ggaqf1	1099	3	past	past	JJ
cord-014462-11ggaqf1	1099	4	decade	decade	NN
cord-014462-11ggaqf1	1099	5	,	,	,
cord-014462-11ggaqf1	1099	6	plant	plant	NN
cord-014462-11ggaqf1	1099	7	host	host	NN
cord-014462-11ggaqf1	1099	8	system	system	NN
cord-014462-11ggaqf1	1099	9	has	have	VBZ
cord-014462-11ggaqf1	1099	10	been	be	VBN
cord-014462-11ggaqf1	1099	11	investigated	investigate	VBN
cord-014462-11ggaqf1	1099	12	as	as	IN
cord-014462-11ggaqf1	1099	13	potential	potential	JJ
cord-014462-11ggaqf1	1099	14	host	host	NN
cord-014462-11ggaqf1	1099	15	system	system	NN
cord-014462-11ggaqf1	1099	16	for	for	IN
cord-014462-11ggaqf1	1099	17	expressing	express	VBG
cord-014462-11ggaqf1	1099	18	proteins	protein	NNS
cord-014462-11ggaqf1	1099	19	of	of	IN
cord-014462-11ggaqf1	1099	20	therapeutic	therapeutic	JJ
cord-014462-11ggaqf1	1099	21	and	and	CC
cord-014462-11ggaqf1	1099	22	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1099	23	use	use	NN
cord-014462-11ggaqf1	1099	24	.	.	.
cord-014462-11ggaqf1	1100	1	However	however	RB
cord-014462-11ggaqf1	1100	2	concerns	concern	NNS
cord-014462-11ggaqf1	1100	3	regarding	regard	VBG
cord-014462-11ggaqf1	1100	4	the	the	DT
cord-014462-11ggaqf1	1100	5	stability	stability	NN
cord-014462-11ggaqf1	1100	6	and	and	CC
cord-014462-11ggaqf1	1100	7	environmental	environmental	JJ
cord-014462-11ggaqf1	1100	8	safety	safety	NN
cord-014462-11ggaqf1	1100	9	need	need	NN
cord-014462-11ggaqf1	1100	10	to	to	TO
cord-014462-11ggaqf1	1100	11	be	be	VB
cord-014462-11ggaqf1	1100	12	addressed	address	VBN
cord-014462-11ggaqf1	1100	13	.	.	.
cord-014462-11ggaqf1	1101	1	Chloroplast	chloroplast	JJ
cord-014462-11ggaqf1	1101	2	engineering	engineering	NN
cord-014462-11ggaqf1	1101	3	is	be	VBZ
cord-014462-11ggaqf1	1101	4	expected	expect	VBN
cord-014462-11ggaqf1	1101	5	to	to	TO
cord-014462-11ggaqf1	1101	6	resolve	resolve	VB
cord-014462-11ggaqf1	1101	7	some	some	DT
cord-014462-11ggaqf1	1101	8	of	of	IN
cord-014462-11ggaqf1	1101	9	these	these	DT
cord-014462-11ggaqf1	1101	10	issues	issue	NNS
cord-014462-11ggaqf1	1101	11	since	since	IN
cord-014462-11ggaqf1	1101	12	,	,	,
cord-014462-11ggaqf1	1101	13	plastids	plastid	NNS
cord-014462-11ggaqf1	1101	14	/	/	SYM
cord-014462-11ggaqf1	1101	15	chloroplasts	chloroplast	NNS
cord-014462-11ggaqf1	1101	16	are	be	VBP
cord-014462-11ggaqf1	1101	17	inherited	inherit	VBN
cord-014462-11ggaqf1	1101	18	maternally	maternally	RB
cord-014462-11ggaqf1	1101	19	and	and	CC
cord-014462-11ggaqf1	1101	20	are	be	VBP
cord-014462-11ggaqf1	1101	21	not	not	RB
cord-014462-11ggaqf1	1101	22	disseminated	disseminate	VBN
cord-014462-11ggaqf1	1101	23	through	through	IN
cord-014462-11ggaqf1	1101	24	pollen	pollen	NN
cord-014462-11ggaqf1	1101	25	.	.	.
cord-014462-11ggaqf1	1102	1	This	this	DT
cord-014462-11ggaqf1	1102	2	makes	make	VBZ
cord-014462-11ggaqf1	1102	3	plastid	plastid	NN
cord-014462-11ggaqf1	1102	4	transformation	transformation	NN
cord-014462-11ggaqf1	1102	5	a	a	DT
cord-014462-11ggaqf1	1102	6	valuable	valuable	JJ
cord-014462-11ggaqf1	1102	7	tool	tool	NN
cord-014462-11ggaqf1	1102	8	for	for	IN
cord-014462-11ggaqf1	1102	9	transgenic	transgenic	JJ
cord-014462-11ggaqf1	1102	10	creation	creation	NN
cord-014462-11ggaqf1	1102	11	besides	besides	IN
cord-014462-11ggaqf1	1102	12	offering	offer	VBG
cord-014462-11ggaqf1	1102	13	biological	biological	JJ
cord-014462-11ggaqf1	1102	14	containment	containment	NN
cord-014462-11ggaqf1	1102	15	.	.	.
cord-014462-11ggaqf1	1103	1	Since	since	IN
cord-014462-11ggaqf1	1103	2	foot	foot	NN
cord-014462-11ggaqf1	1103	3	and	and	CC
cord-014462-11ggaqf1	1103	4	mouth	mouth	NN
cord-014462-11ggaqf1	1103	5	disease	disease	NN
cord-014462-11ggaqf1	1103	6	(	(	-LRB-
cord-014462-11ggaqf1	1103	7	FMD	FMD	NNP
cord-014462-11ggaqf1	1103	8	)	)	-RRB-
cord-014462-11ggaqf1	1103	9	of	of	IN
cord-014462-11ggaqf1	1103	10	cloven	cloven	NN
cord-014462-11ggaqf1	1103	11	footed	footed	JJ
cord-014462-11ggaqf1	1103	12	animals	animal	NNS
cord-014462-11ggaqf1	1103	13	is	be	VBZ
cord-014462-11ggaqf1	1103	14	a	a	DT
cord-014462-11ggaqf1	1103	15	major	major	JJ
cord-014462-11ggaqf1	1103	16	concern	concern	NN
cord-014462-11ggaqf1	1103	17	in	in	IN
cord-014462-11ggaqf1	1103	18	the	the	DT
cord-014462-11ggaqf1	1103	19	world	world	NN
cord-014462-11ggaqf1	1103	20	over	over	RB
cord-014462-11ggaqf1	1103	21	.	.	.
cord-014462-11ggaqf1	1104	1	Foot	foot	NN
cord-014462-11ggaqf1	1104	2	and	and	CC
cord-014462-11ggaqf1	1104	3	mouth	mouth	NN
cord-014462-11ggaqf1	1104	4	disease	disease	NN
cord-014462-11ggaqf1	1104	5	(	(	-LRB-
cord-014462-11ggaqf1	1104	6	FMD	FMD	NNP
cord-014462-11ggaqf1	1104	7	)	)	-RRB-
cord-014462-11ggaqf1	1104	8	is	be	VBZ
cord-014462-11ggaqf1	1104	9	the	the	DT
cord-014462-11ggaqf1	1104	10	most	most	RBS
cord-014462-11ggaqf1	1104	11	feared	fear	VBN
cord-014462-11ggaqf1	1104	12	,	,	,
cord-014462-11ggaqf1	1104	13	viral	viral	JJ
cord-014462-11ggaqf1	1104	14	disease	disease	NN
cord-014462-11ggaqf1	1104	15	of	of	IN
cord-014462-11ggaqf1	1104	16	the	the	DT
cord-014462-11ggaqf1	1104	17	cloven	cloven	NNP
cord-014462-11ggaqf1	1104	18	footed	footed	JJ
cord-014462-11ggaqf1	1104	19	animals	animal	NNS
cord-014462-11ggaqf1	1104	20	causing	cause	VBG
cord-014462-11ggaqf1	1104	21	heavy	heavy	JJ
cord-014462-11ggaqf1	1104	22	losses	loss	NNS
cord-014462-11ggaqf1	1104	23	to	to	IN
cord-014462-11ggaqf1	1104	24	the	the	DT
cord-014462-11ggaqf1	1104	25	live	live	JJ
cord-014462-11ggaqf1	1104	26	stock	stock	NN
cord-014462-11ggaqf1	1104	27	industry	industry	NN
cord-014462-11ggaqf1	1104	28	.	.	.
cord-014462-11ggaqf1	1105	1	The	the	DT
cord-014462-11ggaqf1	1105	2	disease	disease	NN
cord-014462-11ggaqf1	1105	3	is	be	VBZ
cord-014462-11ggaqf1	1105	4	enzootic	enzootic	JJ
cord-014462-11ggaqf1	1105	5	in	in	IN
cord-014462-11ggaqf1	1105	6	many	many	JJ
cord-014462-11ggaqf1	1105	7	parts	part	NNS
cord-014462-11ggaqf1	1105	8	of	of	IN
cord-014462-11ggaqf1	1105	9	the	the	DT
cord-014462-11ggaqf1	1105	10	world	world	NN
cord-014462-11ggaqf1	1105	11	including	include	VBG
cord-014462-11ggaqf1	1105	12	Asia	Asia	NNP
cord-014462-11ggaqf1	1105	13	.	.	.
cord-014462-11ggaqf1	1106	1	The	the	DT
cord-014462-11ggaqf1	1106	2	conventional	conventional	JJ
cord-014462-11ggaqf1	1106	3	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1106	4	for	for	IN
cord-014462-11ggaqf1	1106	5	FMD	FMD	NNP
cord-014462-11ggaqf1	1106	6	have	have	VBP
cord-014462-11ggaqf1	1106	7	several	several	JJ
cord-014462-11ggaqf1	1106	8	limitations	limitation	NNS
cord-014462-11ggaqf1	1106	9	which	which	WDT
cord-014462-11ggaqf1	1106	10	include	include	VBP
cord-014462-11ggaqf1	1106	11	safety	safety	NN
cord-014462-11ggaqf1	1106	12	,	,	,
cord-014462-11ggaqf1	1106	13	temperature	temperature	NN
cord-014462-11ggaqf1	1106	14	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1106	15	and	and	CC
cord-014462-11ggaqf1	1106	16	duration	duration	NN
cord-014462-11ggaqf1	1106	17	of	of	IN
cord-014462-11ggaqf1	1106	18	immunity	immunity	NN
cord-014462-11ggaqf1	1106	19	.	.	.
cord-014462-11ggaqf1	1107	1	Attempts	attempt	NNS
cord-014462-11ggaqf1	1107	2	have	have	VBP
cord-014462-11ggaqf1	1107	3	been	be	VBN
cord-014462-11ggaqf1	1107	4	made	make	VBN
cord-014462-11ggaqf1	1107	5	to	to	TO
cord-014462-11ggaqf1	1107	6	overcome	overcome	VB
cord-014462-11ggaqf1	1107	7	these	these	DT
cord-014462-11ggaqf1	1107	8	limitations	limitation	NNS
cord-014462-11ggaqf1	1107	9	using	use	VBG
cord-014462-11ggaqf1	1107	10	recombinant	recombinant	JJ
cord-014462-11ggaqf1	1107	11	DNA	dna	NN
cord-014462-11ggaqf1	1107	12	technology	technology	NN
cord-014462-11ggaqf1	1107	13	.	.	.
cord-014462-11ggaqf1	1108	1	Amongst	amongst	IN
cord-014462-11ggaqf1	1108	2	the	the	DT
cord-014462-11ggaqf1	1108	3	newer	new	JJR
cord-014462-11ggaqf1	1108	4	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1108	5	,	,	,
cord-014462-11ggaqf1	1108	6	edible	edible	JJ
cord-014462-11ggaqf1	1108	7	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1108	8	are	be	VBP
cord-014462-11ggaqf1	1108	9	cost	cost	VBN
cord-014462-11ggaqf1	1108	10	effective	effective	JJ
cord-014462-11ggaqf1	1108	11	and	and	CC
cord-014462-11ggaqf1	1108	12	easy	easy	JJ
cord-014462-11ggaqf1	1108	13	to	to	TO
cord-014462-11ggaqf1	1108	14	administer	administer	VB
cord-014462-11ggaqf1	1108	15	.	.	.
cord-014462-11ggaqf1	1109	1	Since	since	IN
cord-014462-11ggaqf1	1109	2	the	the	DT
cord-014462-11ggaqf1	1109	3	stability	stability	NN
cord-014462-11ggaqf1	1109	4	of	of	IN
cord-014462-11ggaqf1	1109	5	the	the	DT
cord-014462-11ggaqf1	1109	6	gene	gene	NN
cord-014462-11ggaqf1	1109	7	of	of	IN
cord-014462-11ggaqf1	1109	8	interest	interest	NN
cord-014462-11ggaqf1	1109	9	is	be	VBZ
cord-014462-11ggaqf1	1109	10	the	the	DT
cord-014462-11ggaqf1	1109	11	major	major	JJ
cord-014462-11ggaqf1	1109	12	concern	concern	NN
cord-014462-11ggaqf1	1109	13	in	in	IN
cord-014462-11ggaqf1	1109	14	the	the	DT
cord-014462-11ggaqf1	1109	15	case	case	NN
cord-014462-11ggaqf1	1109	16	of	of	IN
cord-014462-11ggaqf1	1109	17	plant	plant	NN
cord-014462-11ggaqf1	1109	18	transgenics	transgenic	NNS
cord-014462-11ggaqf1	1109	19	,	,	,
cord-014462-11ggaqf1	1109	20	marker	marker	NN
cord-014462-11ggaqf1	1109	21	genes	gene	NNS
cord-014462-11ggaqf1	1109	22	are	be	VBP
cord-014462-11ggaqf1	1109	23	used	use	VBN
cord-014462-11ggaqf1	1109	24	for	for	IN
cord-014462-11ggaqf1	1109	25	regular	regular	JJ
cord-014462-11ggaqf1	1109	26	selection	selection	NN
cord-014462-11ggaqf1	1109	27	.	.	.
cord-014462-11ggaqf1	1110	1	The	the	DT
cord-014462-11ggaqf1	1110	2	detection	detection	NN
cord-014462-11ggaqf1	1110	3	methods	method	NNS
cord-014462-11ggaqf1	1110	4	based	base	VBN
cord-014462-11ggaqf1	1110	5	on	on	IN
cord-014462-11ggaqf1	1110	6	the	the	DT
cord-014462-11ggaqf1	1110	7	available	available	JJ
cord-014462-11ggaqf1	1110	8	marker	marker	NN
cord-014462-11ggaqf1	1110	9	proteins	protein	NNS
cord-014462-11ggaqf1	1110	10	like	like	IN
cord-014462-11ggaqf1	1110	11	b	b	DT
cord-014462-11ggaqf1	1110	12	Glucoronidase	Glucoronidase	NNP
cord-014462-11ggaqf1	1110	13	(	(	-LRB-
cord-014462-11ggaqf1	1110	14	GUS	GUS	NNP
cord-014462-11ggaqf1	1110	15	)	)	-RRB-
cord-014462-11ggaqf1	1110	16	protein	protein	NN
cord-014462-11ggaqf1	1110	17	/	/	SYM
cord-014462-11ggaqf1	1110	18	antibiotic	antibiotic	NN
cord-014462-11ggaqf1	1110	19	selection	selection	NN
cord-014462-11ggaqf1	1110	20	are	be	VBP
cord-014462-11ggaqf1	1110	21	cumbersome	cumbersome	JJ
cord-014462-11ggaqf1	1110	22	and	and	CC
cord-014462-11ggaqf1	1110	23	cost	cost	VBP
cord-014462-11ggaqf1	1110	24	intensive	intensive	JJ
cord-014462-11ggaqf1	1110	25	.	.	.
cord-014462-11ggaqf1	1111	1	However	however	RB
cord-014462-11ggaqf1	1111	2	selection	selection	NN
cord-014462-11ggaqf1	1111	3	based	base	VBN
cord-014462-11ggaqf1	1111	4	on	on	IN
cord-014462-11ggaqf1	1111	5	herbicide	herbicide	NN
cord-014462-11ggaqf1	1111	6	resistance	resistance	NN
cord-014462-11ggaqf1	1111	7	is	be	VBZ
cord-014462-11ggaqf1	1111	8	much	much	RB
cord-014462-11ggaqf1	1111	9	simpler	simple	JJR
cord-014462-11ggaqf1	1111	10	and	and	CC
cord-014462-11ggaqf1	1111	11	easy	easy	JJ
cord-014462-11ggaqf1	1111	12	.	.	.
cord-014462-11ggaqf1	1112	1	Hence	hence	RB
cord-014462-11ggaqf1	1112	2	in	in	IN
cord-014462-11ggaqf1	1112	3	the	the	DT
cord-014462-11ggaqf1	1112	4	present	present	JJ
cord-014462-11ggaqf1	1112	5	study	study	NN
cord-014462-11ggaqf1	1112	6	,	,	,
cord-014462-11ggaqf1	1112	7	the	the	DT
cord-014462-11ggaqf1	1112	8	5-enolpyruvylshikimate-3-phosphate	5-enolpyruvylshikimate-3-phosphate	CD
cord-014462-11ggaqf1	1112	9	synthase	synthase	NN
cord-014462-11ggaqf1	1112	10	(	(	-LRB-
cord-014462-11ggaqf1	1112	11	EPSP	EPSP	NNP
cord-014462-11ggaqf1	1112	12	)	)	-RRB-
cord-014462-11ggaqf1	1112	13	gene	gene	NN
cord-014462-11ggaqf1	1112	14	was	be	VBD
cord-014462-11ggaqf1	1112	15	used	use	VBN
cord-014462-11ggaqf1	1112	16	as	as	IN
cord-014462-11ggaqf1	1112	17	a	a	DT
cord-014462-11ggaqf1	1112	18	marker	marker	NN
cord-014462-11ggaqf1	1112	19	along	along	IN
cord-014462-11ggaqf1	1112	20	with	with	IN
cord-014462-11ggaqf1	1112	21	the	the	DT
cord-014462-11ggaqf1	1112	22	immunogen	immunogen	NN
cord-014462-11ggaqf1	1112	23	gene	gene	NN
cord-014462-11ggaqf1	1112	24	of	of	IN
cord-014462-11ggaqf1	1112	25	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1112	26	.	.	.
cord-014462-11ggaqf1	1113	1	EPSP	EPSP	NNP
cord-014462-11ggaqf1	1113	2	is	be	VBZ
cord-014462-11ggaqf1	1113	3	the	the	DT
cord-014462-11ggaqf1	1113	4	key	key	JJ
cord-014462-11ggaqf1	1113	5	enzyme	enzyme	NN
cord-014462-11ggaqf1	1113	6	in	in	IN
cord-014462-11ggaqf1	1113	7	the	the	DT
cord-014462-11ggaqf1	1113	8	shikimate	shikimate	NNP
cord-014462-11ggaqf1	1113	9	biosynthesis	biosynthesis	NN
cord-014462-11ggaqf1	1113	10	pathway	pathway	NN
cord-014462-11ggaqf1	1113	11	necessary	necessary	JJ
cord-014462-11ggaqf1	1113	12	for	for	IN
cord-014462-11ggaqf1	1113	13	the	the	DT
cord-014462-11ggaqf1	1113	14	aromatic	aromatic	JJ
cord-014462-11ggaqf1	1113	15	amino	amino	JJ
cord-014462-11ggaqf1	1113	16	acids	acid	NNS
cord-014462-11ggaqf1	1113	17	production	production	NN
cord-014462-11ggaqf1	1113	18	.	.	.
cord-014462-11ggaqf1	1114	1	In	in	IN
cord-014462-11ggaqf1	1114	2	order	order	NN
cord-014462-11ggaqf1	1114	3	to	to	TO
cord-014462-11ggaqf1	1114	4	investigate	investigate	VB
cord-014462-11ggaqf1	1114	5	the	the	DT
cord-014462-11ggaqf1	1114	6	mechanism	mechanism	NN
cord-014462-11ggaqf1	1114	7	of	of	IN
cord-014462-11ggaqf1	1114	8	long	long	JJ
cord-014462-11ggaqf1	1114	9	term	term	NN
cord-014462-11ggaqf1	1114	10	immunity	immunity	NN
cord-014462-11ggaqf1	1114	11	and	and	CC
cord-014462-11ggaqf1	1114	12	the	the	DT
cord-014462-11ggaqf1	1114	13	effect	effect	NN
cord-014462-11ggaqf1	1114	14	of	of	IN
cord-014462-11ggaqf1	1114	15	protective	protective	JJ
cord-014462-11ggaqf1	1114	16	immunity	immunity	NN
cord-014462-11ggaqf1	1114	17	induced	induce	VBN
cord-014462-11ggaqf1	1114	18	by	by	IN
cord-014462-11ggaqf1	1114	19	cationic	cationic	JJ
cord-014462-11ggaqf1	1114	20	PLG	PLG	NNP
cord-014462-11ggaqf1	1114	21	micro	micro	NN
cord-014462-11ggaqf1	1114	22	particle	particle	NN
cord-014462-11ggaqf1	1114	23	coated	coat	VBD
cord-014462-11ggaqf1	1114	24	DNA	DNA	NNP
cord-014462-11ggaqf1	1114	25	vaccination	vaccination	NN
cord-014462-11ggaqf1	1114	26	.	.	.
cord-014462-11ggaqf1	1115	1	We	-PRON-	PRP
cord-014462-11ggaqf1	1115	2	constructed	construct	VBD
cord-014462-11ggaqf1	1115	3	the	the	DT
cord-014462-11ggaqf1	1115	4	expression	expression	NN
cord-014462-11ggaqf1	1115	5	plasmid	plasmid	NN
cord-014462-11ggaqf1	1115	6	containing	contain	VBG
cord-014462-11ggaqf1	1115	7	a	a	DT
cord-014462-11ggaqf1	1115	8	Foot	Foot	NNP
cord-014462-11ggaqf1	1115	9	-	-	HYPH
cord-014462-11ggaqf1	1115	10	and	and	CC
cord-014462-11ggaqf1	1115	11	-	-	HYPH
cord-014462-11ggaqf1	1115	12	mouth	mouth	NN
cord-014462-11ggaqf1	1115	13	disease	disease	NN
cord-014462-11ggaqf1	1115	14	virus	virus	NN
cord-014462-11ggaqf1	1115	15	(	(	-LRB-
cord-014462-11ggaqf1	1115	16	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1115	17	)	)	-RRB-
cord-014462-11ggaqf1	1115	18	ID	ID	NNP
cord-014462-11ggaqf1	1115	19	gene	gene	NN
cord-014462-11ggaqf1	1115	20	sero	sero	NNP
cord-014462-11ggaqf1	1115	21	type	type	NN
cord-014462-11ggaqf1	1115	22	A.	A.	NNP
cord-014462-11ggaqf1	1115	23	Intramuscular	intramuscular	JJ
cord-014462-11ggaqf1	1115	24	vaccination	vaccination	NN
cord-014462-11ggaqf1	1115	25	of	of	IN
cord-014462-11ggaqf1	1115	26	Guinea	Guinea	NNP
cord-014462-11ggaqf1	1115	27	pigs	pig	NNS
cord-014462-11ggaqf1	1115	28	with	with	IN
cord-014462-11ggaqf1	1115	29	the	the	DT
cord-014462-11ggaqf1	1115	30	micro	micro	JJ
cord-014462-11ggaqf1	1115	31	particles	particle	NNS
cord-014462-11ggaqf1	1115	32	coated	coat	VBN
cord-014462-11ggaqf1	1115	33	plasmid	plasmid	NN
cord-014462-11ggaqf1	1115	34	DNA	DNA	NNP
cord-014462-11ggaqf1	1115	35	Induced	induce	VBN
cord-014462-11ggaqf1	1115	36	a	a	DT
cord-014462-11ggaqf1	1115	37	strong	strong	JJ
cord-014462-11ggaqf1	1115	38	antibody	antibody	NN
cord-014462-11ggaqf1	1115	39	response	response	NN
cord-014462-11ggaqf1	1115	40	and	and	CC
cord-014462-11ggaqf1	1115	41	neutralization	neutralization	NN
cord-014462-11ggaqf1	1115	42	antibodies	antibody	NNS
cord-014462-11ggaqf1	1115	43	,	,	,
cord-014462-11ggaqf1	1115	44	cellular	cellular	JJ
cord-014462-11ggaqf1	1115	45	mediated	mediate	VBN
cord-014462-11ggaqf1	1115	46	immune	immune	JJ
cord-014462-11ggaqf1	1115	47	response	response	NN
cord-014462-11ggaqf1	1115	48	which	which	WDT
cord-014462-11ggaqf1	1115	49	lasted	last	VBD
cord-014462-11ggaqf1	1115	50	1	1	CD
cord-014462-11ggaqf1	1115	51	year	year	NN
cord-014462-11ggaqf1	1115	52	.	.	.
cord-014462-11ggaqf1	1116	1	We	-PRON-	PRP
cord-014462-11ggaqf1	1116	2	further	further	RB
cord-014462-11ggaqf1	1116	3	analyzed	analyze	VBD
cord-014462-11ggaqf1	1116	4	the	the	DT
cord-014462-11ggaqf1	1116	5	persistence	persistence	NN
cord-014462-11ggaqf1	1116	6	and	and	CC
cord-014462-11ggaqf1	1116	7	expression	expression	NN
cord-014462-11ggaqf1	1116	8	of	of	IN
cord-014462-11ggaqf1	1116	9	ID	ID	NNP
cord-014462-11ggaqf1	1116	10	gene	gene	NN
cord-014462-11ggaqf1	1116	11	by	by	IN
cord-014462-11ggaqf1	1116	12	polymerase	polymerase	NN
cord-014462-11ggaqf1	1116	13	chain	chain	NN
cord-014462-11ggaqf1	1116	14	reaction	reaction	NN
cord-014462-11ggaqf1	1116	15	and	and	CC
cord-014462-11ggaqf1	1116	16	reverse	reverse	JJ
cord-014462-11ggaqf1	1116	17	transcriptase	transcriptase	NN
cord-014462-11ggaqf1	1116	18	polymerase	polymerase	NN
cord-014462-11ggaqf1	1116	19	chain	chain	NN
cord-014462-11ggaqf1	1116	20	reaction	reaction	NN
cord-014462-11ggaqf1	1116	21	and	and	CC
cord-014462-11ggaqf1	1116	22	quantitative	quantitative	JJ
cord-014462-11ggaqf1	1116	23	PCR	PCR	NNP
cord-014462-11ggaqf1	1116	24	.	.	.
cord-014462-11ggaqf1	1117	1	The	the	DT
cord-014462-11ggaqf1	1117	2	results	result	NNS
cord-014462-11ggaqf1	1117	3	showed	show	VBD
cord-014462-11ggaqf1	1117	4	that	that	IN
cord-014462-11ggaqf1	1117	5	ID	ID	NNP
cord-014462-11ggaqf1	1117	6	gene	gene	NN
cord-014462-11ggaqf1	1117	7	was	be	VBD
cord-014462-11ggaqf1	1117	8	present	present	JJ
cord-014462-11ggaqf1	1117	9	and	and	CC
cord-014462-11ggaqf1	1117	10	expressed	express	VBN
cord-014462-11ggaqf1	1117	11	in	in	IN
cord-014462-11ggaqf1	1117	12	the	the	DT
cord-014462-11ggaqf1	1117	13	muscle	muscle	NN
cord-014462-11ggaqf1	1117	14	cells	cell	NNS
cord-014462-11ggaqf1	1117	15	up	up	IN
cord-014462-11ggaqf1	1117	16	to	to	IN
cord-014462-11ggaqf1	1117	17	1	1	CD
cord-014462-11ggaqf1	1117	18	year	year	NN
cord-014462-11ggaqf1	1117	19	after	after	IN
cord-014462-11ggaqf1	1117	20	days	day	NNS
cord-014462-11ggaqf1	1117	21	post	post	NN
cord-014462-11ggaqf1	1117	22	vaccination	vaccination	NN
cord-014462-11ggaqf1	1117	23	.	.	.
cord-014462-11ggaqf1	1118	1	Furthermore	furthermore	RB
cord-014462-11ggaqf1	1118	2	,	,	,
cord-014462-11ggaqf1	1118	3	Guinea	Guinea	NNP
cord-014462-11ggaqf1	1118	4	pigs	pig	NNS
cord-014462-11ggaqf1	1118	5	vaccinated	vaccinate	VBN
cord-014462-11ggaqf1	1118	6	with	with	IN
cord-014462-11ggaqf1	1118	7	micro	micro	JJ
cord-014462-11ggaqf1	1118	8	particles	particle	NNS
cord-014462-11ggaqf1	1118	9	coated	coat	VBN
cord-014462-11ggaqf1	1118	10	plasmid	plasmid	NN
cord-014462-11ggaqf1	1118	11	DNA	DNA	NNP
cord-014462-11ggaqf1	1118	12	were	be	VBD
cord-014462-11ggaqf1	1118	13	protected	protect	VBN
cord-014462-11ggaqf1	1118	14	against	against	IN
cord-014462-11ggaqf1	1118	15	a	a	DT
cord-014462-11ggaqf1	1118	16	Challenge	challenge	NN
cord-014462-11ggaqf1	1118	17	with	with	IN
cord-014462-11ggaqf1	1118	18	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1118	19	virus	virus	NN
cord-014462-11ggaqf1	1118	20	.	.	.
cord-014462-11ggaqf1	1119	1	Therefore	therefore	RB
cord-014462-11ggaqf1	1119	2	the	the	DT
cord-014462-11ggaqf1	1119	3	micro	micro	JJ
cord-014462-11ggaqf1	1119	4	particles	particle	NNS
cord-014462-11ggaqf1	1119	5	coated	coat	VBN
cord-014462-11ggaqf1	1119	6	plasmid	plasmid	NN
cord-014462-11ggaqf1	1119	7	DNA	dna	NN
cord-014462-11ggaqf1	1119	8	vaccination	vaccination	NN
cord-014462-11ggaqf1	1119	9	dose	dose	NN
cord-014462-11ggaqf1	1119	10	induce	induce	VB
cord-014462-11ggaqf1	1119	11	a	a	DT
cord-014462-11ggaqf1	1119	12	protective	protective	JJ
cord-014462-11ggaqf1	1119	13	immunity	immunity	NN
cord-014462-11ggaqf1	1119	14	and	and	CC
cord-014462-11ggaqf1	1119	15	long	long	JJ
cord-014462-11ggaqf1	1119	16	term	term	NN
cord-014462-11ggaqf1	1119	17	humoral	humoral	JJ
cord-014462-11ggaqf1	1119	18	,	,	,
cord-014462-11ggaqf1	1119	19	cellular	cellular	JJ
cord-014462-11ggaqf1	1119	20	immuno	immuno	JJ
cord-014462-11ggaqf1	1119	21	responses	response	NNS
cord-014462-11ggaqf1	1119	22	against	against	IN
cord-014462-11ggaqf1	1119	23	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1119	24	,	,	,
cord-014462-11ggaqf1	1119	25	which	which	WDT
cord-014462-11ggaqf1	1119	26	could	could	MD
cord-014462-11ggaqf1	1119	27	be	be	VB
cord-014462-11ggaqf1	1119	28	maintained	maintain	VBN
cord-014462-11ggaqf1	1119	29	by	by	IN
cord-014462-11ggaqf1	1119	30	persistent	persistent	JJ
cord-014462-11ggaqf1	1119	31	expression	expression	NN
cord-014462-11ggaqf1	1119	32	of	of	IN
cord-014462-11ggaqf1	1119	33	ID	ID	NNP
cord-014462-11ggaqf1	1119	34	gene	gene	NN
cord-014462-11ggaqf1	1119	35	in	in	IN
cord-014462-11ggaqf1	1119	36	muscle	muscle	NN
cord-014462-11ggaqf1	1119	37	cells	cell	NNS
cord-014462-11ggaqf1	1119	38	.	.	.
cord-014462-11ggaqf1	1120	1	Foot	foot	NN
cord-014462-11ggaqf1	1120	2	and	and	CC
cord-014462-11ggaqf1	1120	3	mouth	mouth	NN
cord-014462-11ggaqf1	1120	4	disease	disease	NN
cord-014462-11ggaqf1	1120	5	virus	virus	NN
cord-014462-11ggaqf1	1120	6	(	(	-LRB-
cord-014462-11ggaqf1	1120	7	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1120	8	)	)	-RRB-
cord-014462-11ggaqf1	1120	9	causes	cause	VBZ
cord-014462-11ggaqf1	1120	10	a	a	DT
cord-014462-11ggaqf1	1120	11	highly	highly	RB
cord-014462-11ggaqf1	1120	12	contagious	contagious	JJ
cord-014462-11ggaqf1	1120	13	viral	viral	JJ
cord-014462-11ggaqf1	1120	14	disease	disease	NN
cord-014462-11ggaqf1	1120	15	of	of	IN
cord-014462-11ggaqf1	1120	16	cloven	cloven	NN
cord-014462-11ggaqf1	1120	17	hoofed	hoofed	JJ
cord-014462-11ggaqf1	1120	18	animals	animal	NNS
cord-014462-11ggaqf1	1120	19	,	,	,
cord-014462-11ggaqf1	1120	20	which	which	WDT
cord-014462-11ggaqf1	1120	21	has	have	VBZ
cord-014462-11ggaqf1	1120	22	a	a	DT
cord-014462-11ggaqf1	1120	23	considerable	considerable	JJ
cord-014462-11ggaqf1	1120	24	socioeconomic	socioeconomic	JJ
cord-014462-11ggaqf1	1120	25	impact	impact	NN
cord-014462-11ggaqf1	1120	26	on	on	IN
cord-014462-11ggaqf1	1120	27	the	the	DT
cord-014462-11ggaqf1	1120	28	countries	country	NNS
cord-014462-11ggaqf1	1120	29	affected	affect	VBN
cord-014462-11ggaqf1	1120	30	.	.	.
cord-014462-11ggaqf1	1121	1	Interleukin-18	Interleukin-18	NNP
cord-014462-11ggaqf1	1121	2	(	(	-LRB-
cord-014462-11ggaqf1	1121	3	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1121	4	)	)	-RRB-
cord-014462-11ggaqf1	1121	5	enhances	enhance	VBZ
cord-014462-11ggaqf1	1121	6	the	the	DT
cord-014462-11ggaqf1	1121	7	IL-12	IL-12	NNP
cord-014462-11ggaqf1	1121	8	driven	drive	VBN
cord-014462-11ggaqf1	1121	9	Th1	th1	CD
cord-014462-11ggaqf1	1121	10	immune	immune	JJ
cord-014462-11ggaqf1	1121	11	response	response	NN
cord-014462-11ggaqf1	1121	12	that	that	WDT
cord-014462-11ggaqf1	1121	13	is	be	VBZ
cord-014462-11ggaqf1	1121	14	important	important	JJ
cord-014462-11ggaqf1	1121	15	in	in	IN
cord-014462-11ggaqf1	1121	16	immunity	immunity	NN
cord-014462-11ggaqf1	1121	17	against	against	IN
cord-014462-11ggaqf1	1121	18	intracellular	intracellular	JJ
cord-014462-11ggaqf1	1121	19	pathogens	pathogen	NNS
cord-014462-11ggaqf1	1121	20	.	.	.
cord-014462-11ggaqf1	1122	1	The	the	DT
cord-014462-11ggaqf1	1122	2	multiple	multiple	JJ
cord-014462-11ggaqf1	1122	3	roles	role	NNS
cord-014462-11ggaqf1	1122	4	of	of	IN
cord-014462-11ggaqf1	1122	5	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1122	6	in	in	IN
cord-014462-11ggaqf1	1122	7	many	many	JJ
cord-014462-11ggaqf1	1122	8	physiological	physiological	JJ
cord-014462-11ggaqf1	1122	9	and	and	CC
cord-014462-11ggaqf1	1122	10	pathological	pathological	JJ
cord-014462-11ggaqf1	1122	11	processes	process	NNS
cord-014462-11ggaqf1	1122	12	have	have	VBP
cord-014462-11ggaqf1	1122	13	generated	generate	VBN
cord-014462-11ggaqf1	1122	14	a	a	DT
cord-014462-11ggaqf1	1122	15	great	great	JJ
cord-014462-11ggaqf1	1122	16	deal	deal	NN
cord-014462-11ggaqf1	1122	17	of	of	IN
cord-014462-11ggaqf1	1122	18	interest	interest	NN
cord-014462-11ggaqf1	1122	19	in	in	IN
cord-014462-11ggaqf1	1122	20	recent	recent	JJ
cord-014462-11ggaqf1	1122	21	years	year	NNS
cord-014462-11ggaqf1	1122	22	.	.	.
cord-014462-11ggaqf1	1123	1	Antiviral	antiviral	JJ
cord-014462-11ggaqf1	1123	2	effects	effect	NNS
cord-014462-11ggaqf1	1123	3	of	of	IN
cord-014462-11ggaqf1	1123	4	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1123	5	have	have	VBP
cord-014462-11ggaqf1	1123	6	been	be	VBN
cord-014462-11ggaqf1	1123	7	reported	report	VBN
cord-014462-11ggaqf1	1123	8	.	.	.
cord-014462-11ggaqf1	1124	1	We	-PRON-	PRP
cord-014462-11ggaqf1	1124	2	evaluated	evaluate	VBD
cord-014462-11ggaqf1	1124	3	the	the	DT
cord-014462-11ggaqf1	1124	4	effects	effect	NNS
cord-014462-11ggaqf1	1124	5	interleukin-18	interleukin-18	NN
cord-014462-11ggaqf1	1124	6	(	(	-LRB-
cord-014462-11ggaqf1	1124	7	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1124	8	)	)	-RRB-
cord-014462-11ggaqf1	1124	9	on	on	IN
cord-014462-11ggaqf1	1124	10	the	the	DT
cord-014462-11ggaqf1	1124	11	replication	replication	NN
cord-014462-11ggaqf1	1124	12	of	of	IN
cord-014462-11ggaqf1	1124	13	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1124	14	in	in	IN
cord-014462-11ggaqf1	1124	15	vitro	vitro	FW
cord-014462-11ggaqf1	1124	16	in	in	IN
cord-014462-11ggaqf1	1124	17	BHK-21	BHK-21	NNP
cord-014462-11ggaqf1	1124	18	cells	cell	NNS
cord-014462-11ggaqf1	1124	19	.	.	.
cord-014462-11ggaqf1	1125	1	Bovine	Bovine	NNP
cord-014462-11ggaqf1	1125	2	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1125	3	mature	mature	JJ
cord-014462-11ggaqf1	1125	4	protein	protein	NN
cord-014462-11ggaqf1	1125	5	coding	coding	NN
cord-014462-11ggaqf1	1125	6	sequence	sequence	NN
cord-014462-11ggaqf1	1125	7	was	be	VBD
cord-014462-11ggaqf1	1125	8	amplified	amplify	VBN
cord-014462-11ggaqf1	1125	9	from	from	IN
cord-014462-11ggaqf1	1125	10	the	the	DT
cord-014462-11ggaqf1	1125	11	bovine	bovine	JJ
cord-014462-11ggaqf1	1125	12	PBMC	PBMC	NNP
cord-014462-11ggaqf1	1125	13	cells	cell	NNS
cord-014462-11ggaqf1	1125	14	and	and	CC
cord-014462-11ggaqf1	1125	15	cloned	clone	VBN
cord-014462-11ggaqf1	1125	16	into	into	IN
cord-014462-11ggaqf1	1125	17	prokaryotic	prokaryotic	JJ
cord-014462-11ggaqf1	1125	18	expression	expression	NN
cord-014462-11ggaqf1	1125	19	vector	vector	NN
cord-014462-11ggaqf1	1125	20	pET32a	pET32a	NNS
cord-014462-11ggaqf1	1125	21	.	.	.
cord-014462-11ggaqf1	1126	1	Protein	protein	NN
cord-014462-11ggaqf1	1126	2	expressed	express	VBD
cord-014462-11ggaqf1	1126	3	was	be	VBD
cord-014462-11ggaqf1	1126	4	purified	purify	VBN
cord-014462-11ggaqf1	1126	5	and	and	CC
cord-014462-11ggaqf1	1126	6	specificity	specificity	NN
cord-014462-11ggaqf1	1126	7	was	be	VBD
cord-014462-11ggaqf1	1126	8	confirmed	confirm	VBN
cord-014462-11ggaqf1	1126	9	by	by	IN
cord-014462-11ggaqf1	1126	10	immunoblotting	immunoblotte	VBG
cord-014462-11ggaqf1	1126	11	.	.	.
cord-014462-11ggaqf1	1127	1	BHK-21	BHK-21	NNP
cord-014462-11ggaqf1	1128	1	cells	cell	NNS
cord-014462-11ggaqf1	1128	2	were	be	VBD
cord-014462-11ggaqf1	1128	3	treated	treat	VBN
cord-014462-11ggaqf1	1128	4	with	with	IN
cord-014462-11ggaqf1	1128	5	purified	purify	VBN
cord-014462-11ggaqf1	1128	6	expressed	express	VBN
cord-014462-11ggaqf1	1128	7	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1128	8	protein	protein	NN
cord-014462-11ggaqf1	1128	9	with	with	IN
cord-014462-11ggaqf1	1128	10	(	(	-LRB-
cord-014462-11ggaqf1	1128	11	2	2	CD
cord-014462-11ggaqf1	1128	12	lg	lg	NN
cord-014462-11ggaqf1	1128	13	/	/	SYM
cord-014462-11ggaqf1	1128	14	ml	ml	NN
cord-014462-11ggaqf1	1128	15	)	)	-RRB-
cord-014462-11ggaqf1	1129	1	4	4	LS
cord-014462-11ggaqf1	1129	2	h	h	NN
cord-014462-11ggaqf1	1129	3	prior	prior	RB
cord-014462-11ggaqf1	1129	4	to	to	IN
cord-014462-11ggaqf1	1129	5	FMD	FMD	NNP
cord-014462-11ggaqf1	1129	6	infection	infection	NN
cord-014462-11ggaqf1	1129	7	.	.	.
cord-014462-11ggaqf1	1130	1	Cell	cell	NN
cord-014462-11ggaqf1	1130	2	culture	culture	NN
cord-014462-11ggaqf1	1130	3	supernatants	supernatant	NNS
cord-014462-11ggaqf1	1130	4	were	be	VBD
cord-014462-11ggaqf1	1130	5	collected	collect	VBN
cord-014462-11ggaqf1	1130	6	at	at	IN
cord-014462-11ggaqf1	1130	7	24	24	CD
cord-014462-11ggaqf1	1130	8	h	h	NN
cord-014462-11ggaqf1	1130	9	post	post	NN
cord-014462-11ggaqf1	1130	10	infection	infection	NN
cord-014462-11ggaqf1	1130	11	were	be	VBD
cord-014462-11ggaqf1	1130	12	subjected	subject	VBN
cord-014462-11ggaqf1	1130	13	for	for	IN
cord-014462-11ggaqf1	1130	14	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1130	15	and	and	CC
cord-014462-11ggaqf1	1130	16	virus	virus	NN
cord-014462-11ggaqf1	1130	17	titration	titration	NN
cord-014462-11ggaqf1	1130	18	assay	assay	NN
cord-014462-11ggaqf1	1130	19	.	.	.
cord-014462-11ggaqf1	1131	1	RNA	RNA	NNP
cord-014462-11ggaqf1	1131	2	extracted	extract	VBN
cord-014462-11ggaqf1	1131	3	from	from	IN
cord-014462-11ggaqf1	1131	4	the	the	DT
cord-014462-11ggaqf1	1131	5	cells	cell	NNS
cord-014462-11ggaqf1	1131	6	was	be	VBD
cord-014462-11ggaqf1	1131	7	subjected	subject	VBN
cord-014462-11ggaqf1	1131	8	to	to	IN
cord-014462-11ggaqf1	1131	9	Real	Real	NNP
cord-014462-11ggaqf1	1131	10	Time	Time	NNP
cord-014462-11ggaqf1	1131	11	PCR	PCR	NNP
cord-014462-11ggaqf1	1131	12	for	for	IN
cord-014462-11ggaqf1	1131	13	viral	viral	JJ
cord-014462-11ggaqf1	1131	14	RNA	RNA	NNP
cord-014462-11ggaqf1	1131	15	quantification	quantification	NN
cord-014462-11ggaqf1	1131	16	.	.	.
cord-014462-11ggaqf1	1132	1	2	2	CD
cord-014462-11ggaqf1	1132	2	log	log	NN
cord-014462-11ggaqf1	1132	3	titer	titer	NN
cord-014462-11ggaqf1	1132	4	reduction	reduction	NN
cord-014462-11ggaqf1	1132	5	was	be	VBD
cord-014462-11ggaqf1	1132	6	observed	observe	VBN
cord-014462-11ggaqf1	1132	7	in	in	IN
cord-014462-11ggaqf1	1132	8	the	the	DT
cord-014462-11ggaqf1	1132	9	FMD	FMD	NNP
cord-014462-11ggaqf1	1132	10	virus	virus	NN
cord-014462-11ggaqf1	1132	11	titer	titer	NN
cord-014462-11ggaqf1	1132	12	in	in	IN
cord-014462-11ggaqf1	1132	13	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1132	14	treated	treat	VBD
cord-014462-11ggaqf1	1132	15	cells	cell	NNS
cord-014462-11ggaqf1	1132	16	compared	compare	VBN
cord-014462-11ggaqf1	1132	17	to	to	IN
cord-014462-11ggaqf1	1132	18	the	the	DT
cord-014462-11ggaqf1	1132	19	untreated	untreated	JJ
cord-014462-11ggaqf1	1132	20	cells	cell	NNS
cord-014462-11ggaqf1	1132	21	where	where	WRB
cord-014462-11ggaqf1	1132	22	as	as	IN
cord-014462-11ggaqf1	1132	23	virus	virus	NN
cord-014462-11ggaqf1	1132	24	antigen	antigen	NN
cord-014462-11ggaqf1	1132	25	quantified	quantify	VBN
cord-014462-11ggaqf1	1132	26	by	by	IN
cord-014462-11ggaqf1	1132	27	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1132	28	has	have	VBZ
cord-014462-11ggaqf1	1132	29	shown	show	VBN
cord-014462-11ggaqf1	1132	30	a	a	DT
cord-014462-11ggaqf1	1132	31	reduction	reduction	NN
cord-014462-11ggaqf1	1132	32	of	of	IN
cord-014462-11ggaqf1	1132	33	60-folds	60-folds	CD
cord-014462-11ggaqf1	1132	34	.	.	.
cord-014462-11ggaqf1	1132	35	69-fold	69-fold	CD
cord-014462-11ggaqf1	1132	36	reduction	reduction	NN
cord-014462-11ggaqf1	1132	37	in	in	IN
cord-014462-11ggaqf1	1132	38	the	the	DT
cord-014462-11ggaqf1	1132	39	FMD	FMD	NNP
cord-014462-11ggaqf1	1132	40	viral	viral	JJ
cord-014462-11ggaqf1	1132	41	RNA	RNA	NNP
cord-014462-11ggaqf1	1132	42	copy	copy	NN
cord-014462-11ggaqf1	1132	43	number	number	NN
cord-014462-11ggaqf1	1132	44	was	be	VBD
cord-014462-11ggaqf1	1132	45	observed	observe	VBN
cord-014462-11ggaqf1	1132	46	in	in	IN
cord-014462-11ggaqf1	1132	47	the	the	DT
cord-014462-11ggaqf1	1132	48	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1132	49	treated	treat	VBN
cord-014462-11ggaqf1	1132	50	cell	cell	NN
cord-014462-11ggaqf1	1132	51	compared	compare	VBN
cord-014462-11ggaqf1	1132	52	to	to	IN
cord-014462-11ggaqf1	1132	53	the	the	DT
cord-014462-11ggaqf1	1132	54	untreated	untreated	JJ
cord-014462-11ggaqf1	1132	55	measured	measure	VBN
cord-014462-11ggaqf1	1132	56	by	by	IN
cord-014462-11ggaqf1	1132	57	qPCR	qPCR	NNP
cord-014462-11ggaqf1	1132	58	.	.	.
cord-014462-11ggaqf1	1133	1	Current	current	JJ
cord-014462-11ggaqf1	1133	2	study	study	NN
cord-014462-11ggaqf1	1133	3	demonstrated	demonstrate	VBD
cord-014462-11ggaqf1	1133	4	the	the	DT
cord-014462-11ggaqf1	1133	5	potent	potent	JJ
cord-014462-11ggaqf1	1133	6	anti	anti	JJ
cord-014462-11ggaqf1	1133	7	viral	viral	JJ
cord-014462-11ggaqf1	1133	8	activity	activity	NN
cord-014462-11ggaqf1	1133	9	of	of	IN
cord-014462-11ggaqf1	1133	10	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1133	11	on	on	IN
cord-014462-11ggaqf1	1133	12	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1133	13	by	by	IN
cord-014462-11ggaqf1	1133	14	inhibiting	inhibit	VBG
cord-014462-11ggaqf1	1133	15	the	the	DT
cord-014462-11ggaqf1	1133	16	viral	viral	JJ
cord-014462-11ggaqf1	1133	17	replication	replication	NN
cord-014462-11ggaqf1	1133	18	.	.	.
cord-014462-11ggaqf1	1134	1	These	these	DT
cord-014462-11ggaqf1	1134	2	results	result	NNS
cord-014462-11ggaqf1	1134	3	further	further	RB
cord-014462-11ggaqf1	1134	4	suggests	suggest	VBZ
cord-014462-11ggaqf1	1134	5	that	that	IN
cord-014462-11ggaqf1	1134	6	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1134	7	has	have	VBZ
cord-014462-11ggaqf1	1134	8	the	the	DT
cord-014462-11ggaqf1	1134	9	potential	potential	JJ
cord-014462-11ggaqf1	1134	10	role	role	NN
cord-014462-11ggaqf1	1134	11	of	of	IN
cord-014462-11ggaqf1	1134	12	IL-18	IL-18	NNP
cord-014462-11ggaqf1	1134	13	as	as	IN
cord-014462-11ggaqf1	1134	14	molecular	molecular	JJ
cord-014462-11ggaqf1	1134	15	adjuvant	adjuvant	NN
cord-014462-11ggaqf1	1134	16	in	in	IN
cord-014462-11ggaqf1	1134	17	FMD	FMD	NNP
cord-014462-11ggaqf1	1134	18	vaccine	vaccine	NN
cord-014462-11ggaqf1	1134	19	development	development	NN
cord-014462-11ggaqf1	1134	20	and	and	CC
cord-014462-11ggaqf1	1134	21	development	development	NN
cord-014462-11ggaqf1	1134	22	of	of	IN
cord-014462-11ggaqf1	1134	23	therapeutic	therapeutic	JJ
cord-014462-11ggaqf1	1134	24	for	for	IN
cord-014462-11ggaqf1	1134	25	FMD	FMD	NNP
cord-014462-11ggaqf1	1134	26	.	.	.
cord-014462-11ggaqf1	1135	1	Foot	foot	NN
cord-014462-11ggaqf1	1135	2	and	and	CC
cord-014462-11ggaqf1	1135	3	mouth	mouth	NN
cord-014462-11ggaqf1	1135	4	disease	disease	NN
cord-014462-11ggaqf1	1135	5	is	be	VBZ
cord-014462-11ggaqf1	1135	6	the	the	DT
cord-014462-11ggaqf1	1135	7	most	most	RBS
cord-014462-11ggaqf1	1135	8	contagious	contagious	JJ
cord-014462-11ggaqf1	1135	9	viral	viral	JJ
cord-014462-11ggaqf1	1135	10	disease	disease	NN
cord-014462-11ggaqf1	1135	11	of	of	IN
cord-014462-11ggaqf1	1135	12	farm	farm	NN
cord-014462-11ggaqf1	1135	13	animals	animal	NNS
cord-014462-11ggaqf1	1135	14	.	.	.
cord-014462-11ggaqf1	1136	1	Control	control	NN
cord-014462-11ggaqf1	1136	2	of	of	IN
cord-014462-11ggaqf1	1136	3	the	the	DT
cord-014462-11ggaqf1	1136	4	disease	disease	NN
cord-014462-11ggaqf1	1136	5	in	in	IN
cord-014462-11ggaqf1	1136	6	animals	animal	NNS
cord-014462-11ggaqf1	1136	7	is	be	VBZ
cord-014462-11ggaqf1	1136	8	by	by	IN
cord-014462-11ggaqf1	1136	9	vaccination	vaccination	NN
cord-014462-11ggaqf1	1136	10	and	and	CC
cord-014462-11ggaqf1	1136	11	slaughtering	slaughtering	NN
cord-014462-11ggaqf1	1136	12	of	of	IN
cord-014462-11ggaqf1	1136	13	infected	infected	JJ
cord-014462-11ggaqf1	1136	14	animals	animal	NNS
cord-014462-11ggaqf1	1136	15	.	.	.
cord-014462-11ggaqf1	1137	1	Conventional	conventional	JJ
cord-014462-11ggaqf1	1137	2	oil	oil	NN
cord-014462-11ggaqf1	1137	3	adjuvant	adjuvant	NN
cord-014462-11ggaqf1	1137	4	vaccine	vaccine	NN
cord-014462-11ggaqf1	1137	5	has	have	VBZ
cord-014462-11ggaqf1	1137	6	its	-PRON-	PRP$
cord-014462-11ggaqf1	1137	7	own	own	JJ
cord-014462-11ggaqf1	1137	8	limitation	limitation	NN
cord-014462-11ggaqf1	1137	9	.	.	.
cord-014462-11ggaqf1	1138	1	Alternate	alternate	JJ
cord-014462-11ggaqf1	1138	2	to	to	IN
cord-014462-11ggaqf1	1138	3	this	this	DT
cord-014462-11ggaqf1	1138	4	genetic	genetic	JJ
cord-014462-11ggaqf1	1138	5	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1138	6	where	where	WRB
cord-014462-11ggaqf1	1138	7	the	the	DT
cord-014462-11ggaqf1	1138	8	DNA	dna	NN
cord-014462-11ggaqf1	1138	9	encoding	encode	VBG
cord-014462-11ggaqf1	1138	10	viral	viral	JJ
cord-014462-11ggaqf1	1138	11	antigen	antigen	NN
cord-014462-11ggaqf1	1138	12	may	may	MD
cord-014462-11ggaqf1	1138	13	be	be	VB
cord-014462-11ggaqf1	1138	14	a	a	DT
cord-014462-11ggaqf1	1138	15	promising	promising	JJ
cord-014462-11ggaqf1	1138	16	approach	approach	NN
cord-014462-11ggaqf1	1138	17	.	.	.
cord-014462-11ggaqf1	1139	1	Naked	naked	JJ
cord-014462-11ggaqf1	1139	2	DNA	dna	NN
cord-014462-11ggaqf1	1139	3	vaccine	vaccine	NN
cord-014462-11ggaqf1	1139	4	has	have	VBZ
cord-014462-11ggaqf1	1139	5	limitations	limitation	NNS
cord-014462-11ggaqf1	1139	6	like	like	IN
cord-014462-11ggaqf1	1139	7	poor	poor	JJ
cord-014462-11ggaqf1	1139	8	uptake	uptake	NN
cord-014462-11ggaqf1	1139	9	of	of	IN
cord-014462-11ggaqf1	1139	10	DNA	DNA	NNP
cord-014462-11ggaqf1	1139	11	by	by	IN
cord-014462-11ggaqf1	1139	12	cells	cell	NNS
cord-014462-11ggaqf1	1139	13	and	and	CC
cord-014462-11ggaqf1	1139	14	more	more	RBR
cord-014462-11ggaqf1	1139	15	importantly	importantly	RB
cord-014462-11ggaqf1	1139	16	by	by	IN
cord-014462-11ggaqf1	1139	17	nucleus	nucleus	NN
cord-014462-11ggaqf1	1139	18	.	.	.
cord-014462-11ggaqf1	1140	1	As	as	IN
cord-014462-11ggaqf1	1140	2	a	a	DT
cord-014462-11ggaqf1	1140	3	result	result	NN
cord-014462-11ggaqf1	1140	4	delivery	delivery	NN
cord-014462-11ggaqf1	1140	5	of	of	IN
cord-014462-11ggaqf1	1140	6	naked	naked	JJ
cord-014462-11ggaqf1	1140	7	DNA	dna	NN
cord-014462-11ggaqf1	1140	8	through	through	IN
cord-014462-11ggaqf1	1140	9	calcium	calcium	NN
cord-014462-11ggaqf1	1140	10	phosphate	phosphate	NN
cord-014462-11ggaqf1	1140	11	nanoparticle	nanoparticle	NN
cord-014462-11ggaqf1	1140	12	was	be	VBD
cord-014462-11ggaqf1	1140	13	attempted	attempt	VBN
cord-014462-11ggaqf1	1140	14	.	.	.
cord-014462-11ggaqf1	1141	1	Calcium	calcium	NN
cord-014462-11ggaqf1	1141	2	phosphate	phosphate	NN
cord-014462-11ggaqf1	1141	3	nanoparticle	nanoparticle	NN
cord-014462-11ggaqf1	1141	4	is	be	VBZ
cord-014462-11ggaqf1	1141	5	a	a	DT
cord-014462-11ggaqf1	1141	6	potential	potential	JJ
cord-014462-11ggaqf1	1141	7	delivery	delivery	NN
cord-014462-11ggaqf1	1141	8	agent	agent	NN
cord-014462-11ggaqf1	1141	9	which	which	WDT
cord-014462-11ggaqf1	1141	10	proved	prove	VBD
cord-014462-11ggaqf1	1141	11	to	to	TO
cord-014462-11ggaqf1	1141	12	enhance	enhance	VB
cord-014462-11ggaqf1	1141	13	the	the	DT
cord-014462-11ggaqf1	1141	14	immune	immune	JJ
cord-014462-11ggaqf1	1141	15	response	response	NN
cord-014462-11ggaqf1	1141	16	.	.	.
cord-014462-11ggaqf1	1142	1	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1142	2	P1	P1	NNP
cord-014462-11ggaqf1	1142	3	-	-	HYPH
cord-014462-11ggaqf1	1142	4	3CD	3CD	NNP
cord-014462-11ggaqf1	1142	5	'	'	POS
cord-014462-11ggaqf1	1142	6	'	'	``
cord-014462-11ggaqf1	1142	7	O	o	UH
cord-014462-11ggaqf1	1142	8	'	'	''
cord-014462-11ggaqf1	1142	9	'	'	''
cord-014462-11ggaqf1	1142	10	vaccine	vaccine	NN
cord-014462-11ggaqf1	1142	11	gene	gene	NN
cord-014462-11ggaqf1	1142	12	constructs	construct	VBZ
cord-014462-11ggaqf1	1142	13	in	in	IN
cord-014462-11ggaqf1	1142	14	pCDNA3.1	pcdna3.1	NN
cord-014462-11ggaqf1	1142	15	?	?	.
cord-014462-11ggaqf1	1142	16	entrapped	entrap	VBN
cord-014462-11ggaqf1	1142	17	by	by	IN
cord-014462-11ggaqf1	1142	18	the	the	DT
cord-014462-11ggaqf1	1142	19	nanoparticles	nanoparticle	NNS
cord-014462-11ggaqf1	1142	20	was	be	VBD
cord-014462-11ggaqf1	1142	21	prepared	prepare	VBN
cord-014462-11ggaqf1	1142	22	by	by	IN
cord-014462-11ggaqf1	1142	23	using	use	VBG
cord-014462-11ggaqf1	1142	24	different	different	JJ
cord-014462-11ggaqf1	1142	25	molarity	molarity	NN
cord-014462-11ggaqf1	1142	26	of	of	IN
cord-014462-11ggaqf1	1142	27	calcium	calcium	NN
cord-014462-11ggaqf1	1142	28	chloride	chloride	NN
cord-014462-11ggaqf1	1142	29	and	and	CC
cord-014462-11ggaqf1	1142	30	disodium	disodium	NN
cord-014462-11ggaqf1	1142	31	hydrogen	hydrogen	NN
cord-014462-11ggaqf1	1142	32	orthophosphate	orthophosphate	NN
cord-014462-11ggaqf1	1142	33	.	.	.
cord-014462-11ggaqf1	1143	1	The	the	DT
cord-014462-11ggaqf1	1143	2	nanoparticles	nanoparticle	NNS
cord-014462-11ggaqf1	1143	3	entrapping	entrap	VBG
cord-014462-11ggaqf1	1143	4	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1143	5	P1	P1	NNP
cord-014462-11ggaqf1	1143	6	-	-	HYPH
cord-014462-11ggaqf1	1143	7	3CD	3CD	NNP
cord-014462-11ggaqf1	1143	8	'	'	POS
cord-014462-11ggaqf1	1143	9	'	'	``
cord-014462-11ggaqf1	1143	10	O	o	UH
cord-014462-11ggaqf1	1143	11	'	'	''
cord-014462-11ggaqf1	1143	12	'	'	''
cord-014462-11ggaqf1	1143	13	and	and	CC
cord-014462-11ggaqf1	1143	14	naked	naked	JJ
cord-014462-11ggaqf1	1143	15	DNA	DNA	NNP
cord-014462-11ggaqf1	1143	16	were	be	VBD
cord-014462-11ggaqf1	1143	17	presented	present	VBN
cord-014462-11ggaqf1	1143	18	to	to	IN
cord-014462-11ggaqf1	1143	19	the	the	DT
cord-014462-11ggaqf1	1143	20	guinea	guinea	NN
cord-014462-11ggaqf1	1143	21	pigs	pig	NNS
cord-014462-11ggaqf1	1143	22	through	through	IN
cord-014462-11ggaqf1	1143	23	intramuscular	intramuscular	JJ
cord-014462-11ggaqf1	1143	24	injection	injection	NN
cord-014462-11ggaqf1	1143	25	to	to	TO
cord-014462-11ggaqf1	1143	26	study	study	VB
cord-014462-11ggaqf1	1143	27	the	the	DT
cord-014462-11ggaqf1	1143	28	mRNA	mRNA	NNP
cord-014462-11ggaqf1	1143	29	expression	expression	NN
cord-014462-11ggaqf1	1143	30	of	of	IN
cord-014462-11ggaqf1	1143	31	antigen	antigen	NN
cord-014462-11ggaqf1	1143	32	by	by	IN
cord-014462-11ggaqf1	1143	33	RT	RT	NNP
cord-014462-11ggaqf1	1143	34	-	-	HYPH
cord-014462-11ggaqf1	1143	35	PCR	PCR	NNP
cord-014462-11ggaqf1	1143	36	.	.	.
cord-014462-11ggaqf1	1144	1	Animals	animal	NNS
cord-014462-11ggaqf1	1144	2	were	be	VBD
cord-014462-11ggaqf1	1144	3	sacrificed	sacrifice	VBN
cord-014462-11ggaqf1	1144	4	at	at	IN
cord-014462-11ggaqf1	1144	5	defined	define	VBN
cord-014462-11ggaqf1	1144	6	time	time	NN
cord-014462-11ggaqf1	1144	7	to	to	TO
cord-014462-11ggaqf1	1144	8	collect	collect	VB
cord-014462-11ggaqf1	1144	9	different	different	JJ
cord-014462-11ggaqf1	1144	10	organs	organ	NNS
cord-014462-11ggaqf1	1144	11	and	and	CC
cord-014462-11ggaqf1	1144	12	total	total	JJ
cord-014462-11ggaqf1	1144	13	RNA	RNA	NNP
cord-014462-11ggaqf1	1144	14	was	be	VBD
cord-014462-11ggaqf1	1144	15	extracted	extract	VBN
cord-014462-11ggaqf1	1144	16	.	.	.
cord-014462-11ggaqf1	1145	1	Each	each	DT
cord-014462-11ggaqf1	1145	2	time	time	NN
cord-014462-11ggaqf1	1145	3	blood	blood	NN
cord-014462-11ggaqf1	1145	4	was	be	VBD
cord-014462-11ggaqf1	1145	5	collected	collect	VBN
cord-014462-11ggaqf1	1145	6	to	to	TO
cord-014462-11ggaqf1	1145	7	analyse	analyse	VB
cord-014462-11ggaqf1	1145	8	the	the	DT
cord-014462-11ggaqf1	1145	9	FMDV	fmdv	JJ
cord-014462-11ggaqf1	1145	10	specific	specific	JJ
cord-014462-11ggaqf1	1145	11	serum	serum	NN
cord-014462-11ggaqf1	1145	12	antibodies	antibody	NNS
cord-014462-11ggaqf1	1145	13	.	.	.
cord-014462-11ggaqf1	1146	1	DNA	DNA	NNP
cord-014462-11ggaqf1	1146	2	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1146	3	presented	present	VBN
cord-014462-11ggaqf1	1146	4	through	through	IN
cord-014462-11ggaqf1	1146	5	calcium	calcium	NN
cord-014462-11ggaqf1	1146	6	phosphate	phosphate	NN
cord-014462-11ggaqf1	1146	7	produced	produce	VBD
cord-014462-11ggaqf1	1146	8	transcripts	transcript	NNS
cord-014462-11ggaqf1	1146	9	in	in	IN
cord-014462-11ggaqf1	1146	10	the	the	DT
cord-014462-11ggaqf1	1146	11	injected	inject	VBN
cord-014462-11ggaqf1	1146	12	muscle	muscle	NN
cord-014462-11ggaqf1	1146	13	up	up	IN
cord-014462-11ggaqf1	1146	14	to	to	TO
cord-014462-11ggaqf1	1146	15	240	240	CD
cord-014462-11ggaqf1	1146	16	days	day	NNS
cord-014462-11ggaqf1	1146	17	whereas	whereas	IN
cord-014462-11ggaqf1	1146	18	naked	naked	JJ
cord-014462-11ggaqf1	1146	19	DNA	dna	NN
cord-014462-11ggaqf1	1146	20	up	up	RP
cord-014462-11ggaqf1	1146	21	to	to	TO
cord-014462-11ggaqf1	1146	22	120	120	CD
cord-014462-11ggaqf1	1146	23	days	day	NNS
cord-014462-11ggaqf1	1146	24	.	.	.
cord-014462-11ggaqf1	1147	1	Serum	serum	NN
cord-014462-11ggaqf1	1147	2	antibody	antibody	NN
cord-014462-11ggaqf1	1147	3	levels	level	NNS
cord-014462-11ggaqf1	1147	4	of	of	IN
cord-014462-11ggaqf1	1147	5	naked	naked	JJ
cord-014462-11ggaqf1	1147	6	DNA	dna	NN
cord-014462-11ggaqf1	1147	7	vaccine	vaccine	NN
cord-014462-11ggaqf1	1147	8	showed	show	VBD
cord-014462-11ggaqf1	1147	9	antibody	antibody	NN
cord-014462-11ggaqf1	1147	10	titre	titre	NN
cord-014462-11ggaqf1	1147	11	till	till	IN
cord-014462-11ggaqf1	1147	12	60	60	CD
cord-014462-11ggaqf1	1147	13	days	day	NNS
cord-014462-11ggaqf1	1147	14	.	.	.
cord-014462-11ggaqf1	1148	1	Whereas	whereas	IN
cord-014462-11ggaqf1	1148	2	nanoparticle	nanoparticle	NN
cord-014462-11ggaqf1	1148	3	injected	inject	VBD
cord-014462-11ggaqf1	1148	4	animals	animal	NNS
cord-014462-11ggaqf1	1148	5	showed	show	VBD
cord-014462-11ggaqf1	1148	6	serum	serum	NN
cord-014462-11ggaqf1	1148	7	antibody	antibody	NN
cord-014462-11ggaqf1	1148	8	till	till	IN
cord-014462-11ggaqf1	1148	9	120	120	CD
cord-014462-11ggaqf1	1148	10	days	day	NNS
cord-014462-11ggaqf1	1148	11	.	.	.
cord-014462-11ggaqf1	1149	1	Serum	serum	NN
cord-014462-11ggaqf1	1149	2	neutralization	neutralization	NN
cord-014462-11ggaqf1	1149	3	titres	titre	NNS
cord-014462-11ggaqf1	1149	4	of	of	IN
cord-014462-11ggaqf1	1149	5	1.5	1.5	CD
cord-014462-11ggaqf1	1149	6	were	be	VBD
cord-014462-11ggaqf1	1149	7	observed	observe	VBN
cord-014462-11ggaqf1	1149	8	in	in	IN
cord-014462-11ggaqf1	1149	9	calcium	calcium	NN
cord-014462-11ggaqf1	1149	10	phosphate	phosphate	NN
cord-014462-11ggaqf1	1149	11	DNA	dna	NN
cord-014462-11ggaqf1	1149	12	Vaccines	vaccine	NNS
cord-014462-11ggaqf1	1149	13	at	at	IN
cord-014462-11ggaqf1	1149	14	about	about	RB
cord-014462-11ggaqf1	1149	15	28	28	CD
cord-014462-11ggaqf1	1149	16	-	-	SYM
cord-014462-11ggaqf1	1149	17	150	150	CD
cord-014462-11ggaqf1	1149	18	days	day	NNS
cord-014462-11ggaqf1	1149	19	,	,	,
cord-014462-11ggaqf1	1149	20	where	where	WRB
cord-014462-11ggaqf1	1149	21	as	as	IN
cord-014462-11ggaqf1	1149	22	naked	naked	JJ
cord-014462-11ggaqf1	1149	23	DNA	dna	NN
cord-014462-11ggaqf1	1149	24	SN	sn	NN
cord-014462-11ggaqf1	1149	25	titers	titer	NNS
cord-014462-11ggaqf1	1149	26	were	be	VBD
cord-014462-11ggaqf1	1149	27	observed	observe	VBN
cord-014462-11ggaqf1	1149	28	for	for	IN
cord-014462-11ggaqf1	1149	29	short	short	JJ
cord-014462-11ggaqf1	1149	30	period	period	NN
cord-014462-11ggaqf1	1149	31	of	of	IN
cord-014462-11ggaqf1	1149	32	30	30	CD
cord-014462-11ggaqf1	1149	33	-	-	SYM
cord-014462-11ggaqf1	1149	34	90	90	CD
cord-014462-11ggaqf1	1149	35	days	day	NNS
cord-014462-11ggaqf1	1149	36	.	.	.
cord-014462-11ggaqf1	1150	1	The	the	DT
cord-014462-11ggaqf1	1150	2	study	study	NN
cord-014462-11ggaqf1	1150	3	clearly	clearly	RB
cord-014462-11ggaqf1	1150	4	showed	show	VBD
cord-014462-11ggaqf1	1150	5	calcium	calcium	NN
cord-014462-11ggaqf1	1150	6	phosphate	phosphate	NN
cord-014462-11ggaqf1	1150	7	nanoparticle	nanoparticle	NN
cord-014462-11ggaqf1	1150	8	entrapping	entrap	VBG
cord-014462-11ggaqf1	1150	9	FMDV	FMDV	NNP
cord-014462-11ggaqf1	1150	10	vaccine	vaccine	NN
cord-014462-11ggaqf1	1150	11	DNA	dna	NN
cord-014462-11ggaqf1	1150	12	may	may	MD
cord-014462-11ggaqf1	1150	13	be	be	VB
cord-014462-11ggaqf1	1150	14	a	a	DT
cord-014462-11ggaqf1	1150	15	better	well	JJR
cord-014462-11ggaqf1	1150	16	delivery	delivery	NN
cord-014462-11ggaqf1	1150	17	system	system	NN
cord-014462-11ggaqf1	1150	18	for	for	IN
cord-014462-11ggaqf1	1150	19	DNA	dna	NN
cord-014462-11ggaqf1	1150	20	vaccines	vaccine	NNS
cord-014462-11ggaqf1	1150	21	as	as	IN
cord-014462-11ggaqf1	1150	22	it	-PRON-	PRP
cord-014462-11ggaqf1	1150	23	confirms	confirm	VBZ
cord-014462-11ggaqf1	1150	24	availability	availability	NN
cord-014462-11ggaqf1	1150	25	of	of	IN
cord-014462-11ggaqf1	1150	26	the	the	DT
cord-014462-11ggaqf1	1150	27	antigen	antigen	NN
cord-014462-11ggaqf1	1150	28	and	and	CC
cord-014462-11ggaqf1	1150	29	persistence	persistence	NN
cord-014462-11ggaqf1	1150	30	of	of	IN
cord-014462-11ggaqf1	1150	31	antibody	antibody	NN
cord-014462-11ggaqf1	1150	32	for	for	IN
cord-014462-11ggaqf1	1150	33	longer	long	JJR
cord-014462-11ggaqf1	1150	34	duration	duration	NN
cord-014462-11ggaqf1	1150	35	than	than	IN
cord-014462-11ggaqf1	1150	36	naked	naked	JJ
cord-014462-11ggaqf1	1150	37	DNA	dna	NN
cord-014462-11ggaqf1	1150	38	.	.	.
cord-014462-11ggaqf1	1151	1	Capripox	Capripox	NNP
cord-014462-11ggaqf1	1151	2	is	be	VBZ
cord-014462-11ggaqf1	1151	3	highly	highly	RB
cord-014462-11ggaqf1	1151	4	infectious	infectious	JJ
cord-014462-11ggaqf1	1151	5	,	,	,
cord-014462-11ggaqf1	1151	6	contagious	contagious	JJ
cord-014462-11ggaqf1	1151	7	,	,	,
cord-014462-11ggaqf1	1151	8	and	and	CC
cord-014462-11ggaqf1	1151	9	OIE	OIE	NNP
cord-014462-11ggaqf1	1151	10	notifiable	notifiable	JJ
cord-014462-11ggaqf1	1151	11	disease	disease	NN
cord-014462-11ggaqf1	1151	12	of	of	IN
cord-014462-11ggaqf1	1151	13	small	small	JJ
cord-014462-11ggaqf1	1151	14	ruminants	ruminant	NNS
cord-014462-11ggaqf1	1151	15	,	,	,
cord-014462-11ggaqf1	1151	16	caused	cause	VBN
cord-014462-11ggaqf1	1151	17	by	by	IN
cord-014462-11ggaqf1	1151	18	sheeppox	sheeppox	NNP
cord-014462-11ggaqf1	1151	19	and	and	CC
cord-014462-11ggaqf1	1151	20	goatpox	goatpox	NNP
cord-014462-11ggaqf1	1151	21	viruses	virus	NNS
cord-014462-11ggaqf1	1151	22	which	which	WDT
cord-014462-11ggaqf1	1151	23	are	be	VBP
cord-014462-11ggaqf1	1151	24	members	member	NNS
cord-014462-11ggaqf1	1151	25	of	of	IN
cord-014462-11ggaqf1	1151	26	capripoxvirus	capripoxvirus	NNP
cord-014462-11ggaqf1	1151	27	genus	genus	NN
cord-014462-11ggaqf1	1151	28	of	of	IN
cord-014462-11ggaqf1	1151	29	the	the	DT
cord-014462-11ggaqf1	1151	30	family	family	NN
cord-014462-11ggaqf1	1151	31	Poxviridae	Poxviridae	NNP
cord-014462-11ggaqf1	1151	32	.	.	.
cord-014462-11ggaqf1	1152	1	In	in	IN
cord-014462-11ggaqf1	1152	2	the	the	DT
cord-014462-11ggaqf1	1152	3	present	present	JJ
cord-014462-11ggaqf1	1152	4	study	study	NN
cord-014462-11ggaqf1	1152	5	,	,	,
cord-014462-11ggaqf1	1152	6	we	-PRON-	PRP
cord-014462-11ggaqf1	1152	7	analyzed	analyze	VBD
cord-014462-11ggaqf1	1152	8	the	the	DT
cord-014462-11ggaqf1	1152	9	partial	partial	JJ
cord-014462-11ggaqf1	1152	10	gene	gene	NN
cord-014462-11ggaqf1	1152	11	sequences	sequence	NNS
cord-014462-11ggaqf1	1152	12	of	of	IN
cord-014462-11ggaqf1	1152	13	P32	P32	NNP
cord-014462-11ggaqf1	1152	14	protein	protein	NN
cord-014462-11ggaqf1	1152	15	,	,	,
cord-014462-11ggaqf1	1152	16	an	an	DT
cord-014462-11ggaqf1	1152	17	immunogenic	immunogenic	JJ
cord-014462-11ggaqf1	1152	18	envelope	envelope	NN
cord-014462-11ggaqf1	1152	19	protein	protein	NN
cord-014462-11ggaqf1	1152	20	of	of	IN
cord-014462-11ggaqf1	1152	21	Capripox	Capripox	NNP
cord-014462-11ggaqf1	1152	22	viruses	virus	NNS
cord-014462-11ggaqf1	1152	23	(	(	-LRB-
cord-014462-11ggaqf1	1152	24	CaPV	CaPV	NNP
cord-014462-11ggaqf1	1152	25	)	)	-RRB-
cord-014462-11ggaqf1	1152	26	to	to	TO
cord-014462-11ggaqf1	1152	27	assess	assess	VB
cord-014462-11ggaqf1	1152	28	the	the	DT
cord-014462-11ggaqf1	1152	29	genetic	genetic	JJ
cord-014462-11ggaqf1	1152	30	relationship	relationship	NN
cord-014462-11ggaqf1	1152	31	among	among	IN
cord-014462-11ggaqf1	1152	32	different	different	JJ
cord-014462-11ggaqf1	1152	33	sheep	sheep	NN
cord-014462-11ggaqf1	1152	34	pox	pox	NN
cord-014462-11ggaqf1	1152	35	and	and	CC
cord-014462-11ggaqf1	1152	36	goat	goat	NNP
cord-014462-11ggaqf1	1152	37	pox	pox	NN
cord-014462-11ggaqf1	1152	38	virus	virus	NN
cord-014462-11ggaqf1	1152	39	isolates	isolate	VBZ
cord-014462-11ggaqf1	1152	40	from	from	IN
cord-014462-11ggaqf1	1152	41	different	different	JJ
cord-014462-11ggaqf1	1152	42	geographical	geographical	JJ
cord-014462-11ggaqf1	1152	43	areas	area	NNS
cord-014462-11ggaqf1	1152	44	of	of	IN
cord-014462-11ggaqf1	1152	45	the	the	DT
cord-014462-11ggaqf1	1152	46	country	country	NN
cord-014462-11ggaqf1	1152	47	.	.	.
cord-014462-11ggaqf1	1153	1	Product	product	NN
cord-014462-11ggaqf1	1153	2	of	of	IN
cord-014462-11ggaqf1	1153	3	this	this	DT
cord-014462-11ggaqf1	1153	4	gene	gene	NN
cord-014462-11ggaqf1	1153	5	has	have	VBZ
cord-014462-11ggaqf1	1153	6	been	be	VBN
cord-014462-11ggaqf1	1153	7	shown	show	VBN
cord-014462-11ggaqf1	1153	8	to	to	TO
cord-014462-11ggaqf1	1153	9	be	be	VB
cord-014462-11ggaqf1	1153	10	important	important	JJ
cord-014462-11ggaqf1	1153	11	in	in	IN
cord-014462-11ggaqf1	1153	12	attachment	attachment	NN
cord-014462-11ggaqf1	1153	13	of	of	IN
cord-014462-11ggaqf1	1153	14	CaPV	CaPV	NNP
cord-014462-11ggaqf1	1153	15	to	to	TO
cord-014462-11ggaqf1	1153	16	host	host	VB
cord-014462-11ggaqf1	1153	17	cell	cell	NN
cord-014462-11ggaqf1	1153	18	surface	surface	NN
cord-014462-11ggaqf1	1153	19	receptors	receptor	NNS
cord-014462-11ggaqf1	1153	20	during	during	IN
cord-014462-11ggaqf1	1153	21	viral	viral	JJ
cord-014462-11ggaqf1	1153	22	entry	entry	NN
cord-014462-11ggaqf1	1153	23	and	and	CC
cord-014462-11ggaqf1	1153	24	host	host	NN
cord-014462-11ggaqf1	1153	25	immune	immune	JJ
cord-014462-11ggaqf1	1153	26	response	response	NN
cord-014462-11ggaqf1	1153	27	.	.	.
cord-014462-11ggaqf1	1154	1	The	the	DT
cord-014462-11ggaqf1	1154	2	following	following	JJ
cord-014462-11ggaqf1	1154	3	virus	virus	NN
cord-014462-11ggaqf1	1154	4	isolates	isolate	NNS
cord-014462-11ggaqf1	1154	5	have	have	VBP
cord-014462-11ggaqf1	1154	6	been	be	VBN
cord-014462-11ggaqf1	1154	7	used	use	VBN
cord-014462-11ggaqf1	1154	8	in	in	IN
cord-014462-11ggaqf1	1154	9	the	the	DT
cord-014462-11ggaqf1	1154	10	analysis	analysis	NN
cord-014462-11ggaqf1	1154	11	:	:	:
cord-014462-11ggaqf1	1154	12	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1154	13	-	-	HYPH
cord-014462-11ggaqf1	1154	14	Uttarkashi	Uttarkashi	NNP
cord-014462-11ggaqf1	1154	15	,	,	,
cord-014462-11ggaqf1	1154	16	P60	P60	NNP
cord-014462-11ggaqf1	1154	17	,	,	,
cord-014462-11ggaqf1	1154	18	vaccine	vaccine	NN
cord-014462-11ggaqf1	1154	19	virus	virus	NN
cord-014462-11ggaqf1	1154	20	;	;	:
cord-014462-11ggaqf1	1154	21	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1154	22	Mukteswar	Mukteswar	NNP
cord-014462-11ggaqf1	1154	23	,	,	,
cord-014462-11ggaqf1	1154	24	P10	P10	NNP
cord-014462-11ggaqf1	1154	25	,	,	,
cord-014462-11ggaqf1	1154	26	Challenge	Challenge	NNP
cord-014462-11ggaqf1	1154	27	virus	virus	NN
cord-014462-11ggaqf1	1154	28	;	;	:
cord-014462-11ggaqf1	1154	29	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1154	30	(	(	-LRB-
cord-014462-11ggaqf1	1154	31	Akola	Akola	NNP
cord-014462-11ggaqf1	1154	32	)	)	-RRB-
cord-014462-11ggaqf1	1154	33	,	,	,
cord-014462-11ggaqf1	1154	34	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1154	35	Bareilly/00	bareilly/00	CD
cord-014462-11ggaqf1	1154	36	,	,	,
cord-014462-11ggaqf1	1154	37	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1154	38	Ladakh/01	ladakh/01	JJ
cord-014462-11ggaqf1	1154	39	and	and	CC
cord-014462-11ggaqf1	1154	40	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1154	41	Sambalpur/82	sambalpur/82	JJ
cord-014462-11ggaqf1	1154	42	,	,	,
cord-014462-11ggaqf1	1154	43	field	field	NN
cord-014462-11ggaqf1	1154	44	isolates	isolate	NNS
cord-014462-11ggaqf1	1154	45	and	and	CC
cord-014462-11ggaqf1	1154	46	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1154	47	Srinagar	Srinagar	NNP
cord-014462-11ggaqf1	1154	48	,	,	,
cord-014462-11ggaqf1	1154	49	P40	P40	NNP
cord-014462-11ggaqf1	1154	50	;	;	:
cord-014462-11ggaqf1	1155	1	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1155	2	Ranipet	Ranipet	NNP
cord-014462-11ggaqf1	1155	3	,	,	,
cord-014462-11ggaqf1	1155	4	P50	P50	NNP
cord-014462-11ggaqf1	1155	5	;	;	:
cord-014462-11ggaqf1	1155	6	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1155	7	-	-	HYPH
cord-014462-11ggaqf1	1155	8	RF	RF	NNP
cord-014462-11ggaqf1	1155	9	,	,	,
cord-014462-11ggaqf1	1155	10	P50	P50	NNP
cord-014462-11ggaqf1	1155	11	,	,	,
cord-014462-11ggaqf1	1155	12	vaccine	vaccine	NN
cord-014462-11ggaqf1	1155	13	viruses	virus	NNS
cord-014462-11ggaqf1	1155	14	and	and	CC
cord-014462-11ggaqf1	1155	15	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1155	16	Makdhoom/07	Makdhoom/07	NNP
cord-014462-11ggaqf1	1155	17	,	,	,
cord-014462-11ggaqf1	1155	18	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1155	19	CIRG/08	cirg/08	NN
cord-014462-11ggaqf1	1155	20	,	,	,
cord-014462-11ggaqf1	1155	21	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1155	22	Pune/08	Pune/08	NNP
cord-014462-11ggaqf1	1155	23	,	,	,
cord-014462-11ggaqf1	1155	24	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1155	25	Bareilly	Bareilly	NNP
cord-014462-11ggaqf1	1155	26	,	,	,
cord-014462-11ggaqf1	1155	27	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1155	28	183/03	183/03	CD
cord-014462-11ggaqf1	1155	29	and	and	CC
cord-014462-11ggaqf1	1155	30	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1155	31	125/02	125/02	CD
cord-014462-11ggaqf1	1155	32	,	,	,
cord-014462-11ggaqf1	1155	33	field	field	NN
cord-014462-11ggaqf1	1155	34	isolates	isolate	NNS
cord-014462-11ggaqf1	1155	35	.	.	.
cord-014462-11ggaqf1	1156	1	In	in	IN
cord-014462-11ggaqf1	1156	2	this	this	DT
cord-014462-11ggaqf1	1156	3	study	study	NN
cord-014462-11ggaqf1	1156	4	,	,	,
cord-014462-11ggaqf1	1156	5	all	all	DT
cord-014462-11ggaqf1	1156	6	virus	virus	NN
cord-014462-11ggaqf1	1156	7	isolates	isolate	NNS
cord-014462-11ggaqf1	1156	8	were	be	VBD
cord-014462-11ggaqf1	1156	9	confirmed	confirm	VBN
cord-014462-11ggaqf1	1156	10	by	by	IN
cord-014462-11ggaqf1	1156	11	PCR	PCR	NNP
cord-014462-11ggaqf1	1156	12	amplification	amplification	NN
cord-014462-11ggaqf1	1156	13	and	and	CC
cord-014462-11ggaqf1	1156	14	analysed	analyse	VBD
cord-014462-11ggaqf1	1156	15	in	in	IN
cord-014462-11ggaqf1	1156	16	PCR	PCR	NNP
cord-014462-11ggaqf1	1156	17	-	-	HYPH
cord-014462-11ggaqf1	1156	18	Restriction	restriction	NN
cord-014462-11ggaqf1	1156	19	fragment	fragment	NN
cord-014462-11ggaqf1	1156	20	length	length	NN
cord-014462-11ggaqf1	1156	21	polymorphism	polymorphism	NN
cord-014462-11ggaqf1	1156	22	(	(	-LRB-
cord-014462-11ggaqf1	1156	23	PCR	PCR	NNP
cord-014462-11ggaqf1	1156	24	-	-	HYPH
cord-014462-11ggaqf1	1156	25	RFLP	RFLP	NNP
cord-014462-11ggaqf1	1156	26	)	)	-RRB-
cord-014462-11ggaqf1	1156	27	using	use	VBG
cord-014462-11ggaqf1	1156	28	EcoRI	ecori	NN
cord-014462-11ggaqf1	1156	29	enzyme	enzyme	NN
cord-014462-11ggaqf1	1156	30	to	to	TO
cord-014462-11ggaqf1	1156	31	confirm	confirm	VB
cord-014462-11ggaqf1	1156	32	their	-PRON-	PRP$
cord-014462-11ggaqf1	1156	33	specificity	specificity	NN
cord-014462-11ggaqf1	1156	34	.	.	.
cord-014462-11ggaqf1	1157	1	Further	further	RB
cord-014462-11ggaqf1	1157	2	,	,	,
cord-014462-11ggaqf1	1157	3	the	the	DT
cord-014462-11ggaqf1	1157	4	amplicons	amplicon	NNS
cord-014462-11ggaqf1	1157	5	were	be	VBD
cord-014462-11ggaqf1	1157	6	cloned	clone	VBN
cord-014462-11ggaqf1	1157	7	and	and	CC
cord-014462-11ggaqf1	1157	8	sequenced	sequence	VBN
cord-014462-11ggaqf1	1157	9	commercially	commercially	RB
cord-014462-11ggaqf1	1157	10	.	.	.
cord-014462-11ggaqf1	1158	1	Nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1158	2	and	and	CC
cord-014462-11ggaqf1	1158	3	the	the	DT
cord-014462-11ggaqf1	1158	4	deduced	deduce	VBN
cord-014462-11ggaqf1	1158	5	amino	amino	NN
cord-014462-11ggaqf1	1158	6	acid	acid	NN
cord-014462-11ggaqf1	1158	7	(	(	-LRB-
cord-014462-11ggaqf1	1158	8	aa	aa	NNP
cord-014462-11ggaqf1	1158	9	)	)	-RRB-
cord-014462-11ggaqf1	1158	10	sequences	sequence	NNS
cord-014462-11ggaqf1	1158	11	were	be	VBD
cord-014462-11ggaqf1	1158	12	compared	compare	VBN
cord-014462-11ggaqf1	1158	13	with	with	IN
cord-014462-11ggaqf1	1158	14	published	publish	VBN
cord-014462-11ggaqf1	1158	15	sequences	sequence	NNS
cord-014462-11ggaqf1	1158	16	of	of	IN
cord-014462-11ggaqf1	1158	17	the	the	DT
cord-014462-11ggaqf1	1158	18	members	member	NNS
cord-014462-11ggaqf1	1158	19	of	of	IN
cord-014462-11ggaqf1	1158	20	the	the	DT
cord-014462-11ggaqf1	1158	21	genus	genus	NN
cord-014462-11ggaqf1	1158	22	Capripox	Capripox	NNP
cord-014462-11ggaqf1	1158	23	virus	virus	NN
cord-014462-11ggaqf1	1158	24	.	.	.
cord-014462-11ggaqf1	1159	1	Sequence	sequence	NN
cord-014462-11ggaqf1	1159	2	analysis	analysis	NN
cord-014462-11ggaqf1	1159	3	of	of	IN
cord-014462-11ggaqf1	1159	4	partial	partial	JJ
cord-014462-11ggaqf1	1159	5	172	172	CD
cord-014462-11ggaqf1	1159	6	bp	bp	NNP
cord-014462-11ggaqf1	1159	7	sequence	sequence	NN
cord-014462-11ggaqf1	1159	8	has	have	VBZ
cord-014462-11ggaqf1	1159	9	shown	show	VBN
cord-014462-11ggaqf1	1159	10	high	high	JJ
cord-014462-11ggaqf1	1159	11	sequence	sequence	NN
cord-014462-11ggaqf1	1159	12	identity	identity	NN
cord-014462-11ggaqf1	1159	13	among	among	IN
cord-014462-11ggaqf1	1159	14	all	all	DT
cord-014462-11ggaqf1	1159	15	Indian	indian	JJ
cord-014462-11ggaqf1	1159	16	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1159	17	and	and	CC
cord-014462-11ggaqf1	1159	18	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1159	19	isolates	isolate	VBZ
cord-014462-11ggaqf1	1159	20	at	at	IN
cord-014462-11ggaqf1	1159	21	both	both	CC
cord-014462-11ggaqf1	1159	22	nt	nt	RB
cord-014462-11ggaqf1	1159	23	and	and	CC
cord-014462-11ggaqf1	1159	24	aa	aa	NNP
cord-014462-11ggaqf1	1159	25	levels	level	NNS
cord-014462-11ggaqf1	1159	26	.	.	.
cord-014462-11ggaqf1	1160	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1160	2	revealed	reveal	VBD
cord-014462-11ggaqf1	1160	3	a	a	DT
cord-014462-11ggaqf1	1160	4	99.4	99.4	CD
cord-014462-11ggaqf1	1160	5	-	-	SYM
cord-014462-11ggaqf1	1160	6	100	100	CD
cord-014462-11ggaqf1	1160	7	%	%	NN
cord-014462-11ggaqf1	1160	8	and	and	CC
cord-014462-11ggaqf1	1160	9	98.2	98.2	CD
cord-014462-11ggaqf1	1160	10	for	for	IN
cord-014462-11ggaqf1	1160	11	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1160	12	field	field	NN
cord-014462-11ggaqf1	1160	13	isolates	isolate	VBZ
cord-014462-11ggaqf1	1160	14	where	where	WRB
cord-014462-11ggaqf1	1160	15	as	as	IN
cord-014462-11ggaqf1	1160	16	,	,	,
cord-014462-11ggaqf1	1160	17	100	100	CD
cord-014462-11ggaqf1	1160	18	%	%	NN
cord-014462-11ggaqf1	1160	19	for	for	IN
cord-014462-11ggaqf1	1160	20	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1160	21	field	field	NN
cord-014462-11ggaqf1	1160	22	isolates	isolate	NNS
cord-014462-11ggaqf1	1160	23	at	at	IN
cord-014462-11ggaqf1	1160	24	both	both	CC
cord-014462-11ggaqf1	1160	25	the	the	DT
cord-014462-11ggaqf1	1160	26	nt	nt	NN
cord-014462-11ggaqf1	1160	27	and	and	CC
cord-014462-11ggaqf1	1160	28	aa	aa	NNP
cord-014462-11ggaqf1	1160	29	levels	level	NNS
cord-014462-11ggaqf1	1160	30	.	.	.
cord-014462-11ggaqf1	1161	1	In	in	IN
cord-014462-11ggaqf1	1161	2	general	general	JJ
cord-014462-11ggaqf1	1161	3	,	,	,
cord-014462-11ggaqf1	1161	4	CaPV	CaPV	NNP
cord-014462-11ggaqf1	1161	5	isolates	isolate	NNS
cord-014462-11ggaqf1	1161	6	in	in	IN
cord-014462-11ggaqf1	1161	7	this	this	DT
cord-014462-11ggaqf1	1161	8	study	study	NN
cord-014462-11ggaqf1	1161	9	shown	show	VBD
cord-014462-11ggaqf1	1161	10	98.3	98.3	CD
cord-014462-11ggaqf1	1161	11	-	-	HYPH
cord-014462-11ggaqf1	1161	12	98.8	98.8	CD
cord-014462-11ggaqf1	1161	13	and	and	CC
cord-014462-11ggaqf1	1161	14	96.5	96.5	CD
cord-014462-11ggaqf1	1161	15	%	%	NN
cord-014462-11ggaqf1	1161	16	homology	homology	NN
cord-014462-11ggaqf1	1161	17	between	between	IN
cord-014462-11ggaqf1	1161	18	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1161	19	and	and	CC
cord-014462-11ggaqf1	1161	20	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1161	21	at	at	IN
cord-014462-11ggaqf1	1161	22	nt	nt	RB
cord-014462-11ggaqf1	1161	23	and	and	CC
cord-014462-11ggaqf1	1161	24	aa	aa	NNP
cord-014462-11ggaqf1	1161	25	levels	level	NNS
cord-014462-11ggaqf1	1161	26	as	as	IN
cord-014462-11ggaqf1	1161	27	reported	report	VBN
cord-014462-11ggaqf1	1161	28	earlier	early	RBR
cord-014462-11ggaqf1	1161	29	.	.	.
cord-014462-11ggaqf1	1162	1	Further	further	RB
cord-014462-11ggaqf1	1162	2	,	,	,
cord-014462-11ggaqf1	1162	3	it	-PRON-	PRP
cord-014462-11ggaqf1	1162	4	revealed	reveal	VBD
cord-014462-11ggaqf1	1162	5	a	a	DT
cord-014462-11ggaqf1	1162	6	unique	unique	JJ
cord-014462-11ggaqf1	1162	7	change	change	NN
cord-014462-11ggaqf1	1162	8	of	of	IN
cord-014462-11ggaqf1	1162	9	G120A	G120A	NNP
cord-014462-11ggaqf1	1162	10	in	in	IN
cord-014462-11ggaqf1	1162	11	all	all	DT
cord-014462-11ggaqf1	1162	12	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1162	13	isolates	isolate	NNS
cord-014462-11ggaqf1	1162	14	resulting	result	VBG
cord-014462-11ggaqf1	1162	15	in	in	IN
cord-014462-11ggaqf1	1162	16	formation	formation	NN
cord-014462-11ggaqf1	1162	17	of	of	IN
cord-014462-11ggaqf1	1162	18	DraI	DraI	NNP
cord-014462-11ggaqf1	1162	19	site	site	NN
cord-014462-11ggaqf1	1162	20	in	in	IN
cord-014462-11ggaqf1	1162	21	place	place	NN
cord-014462-11ggaqf1	1162	22	of	of	IN
cord-014462-11ggaqf1	1162	23	EcoRI	ecori	NN
cord-014462-11ggaqf1	1162	24	and	and	CC
cord-014462-11ggaqf1	1162	25	possible	possible	JJ
cord-014462-11ggaqf1	1162	26	development	development	NN
cord-014462-11ggaqf1	1162	27	of	of	IN
cord-014462-11ggaqf1	1162	28	restriction	restriction	NN
cord-014462-11ggaqf1	1162	29	enzyme	enzyme	NN
cord-014462-11ggaqf1	1162	30	specific	specific	JJ
cord-014462-11ggaqf1	1162	31	PCR	PCR	NNP
cord-014462-11ggaqf1	1162	32	-	-	HYPH
cord-014462-11ggaqf1	1162	33	RFLP	RFLP	NNP
cord-014462-11ggaqf1	1162	34	for	for	IN
cord-014462-11ggaqf1	1162	35	differentiation	differentiation	NN
cord-014462-11ggaqf1	1162	36	of	of	IN
cord-014462-11ggaqf1	1162	37	SPPV	SPPV	NNP
cord-014462-11ggaqf1	1162	38	and	and	CC
cord-014462-11ggaqf1	1162	39	GTPV	GTPV	NNP
cord-014462-11ggaqf1	1162	40	from	from	IN
cord-014462-11ggaqf1	1162	41	field	field	NN
cord-014462-11ggaqf1	1162	42	isolates	isolate	NNS
cord-014462-11ggaqf1	1162	43	.	.	.
cord-014462-11ggaqf1	1163	1	Orf	Orf	NNP
cord-014462-11ggaqf1	1163	2	or	or	CC
cord-014462-11ggaqf1	1163	3	contagious	contagious	JJ
cord-014462-11ggaqf1	1163	4	ecthyma	ecthyma	NN
cord-014462-11ggaqf1	1163	5	is	be	VBZ
cord-014462-11ggaqf1	1163	6	considered	consider	VBN
cord-014462-11ggaqf1	1163	7	as	as	IN
cord-014462-11ggaqf1	1163	8	non	non	JJ
cord-014462-11ggaqf1	1163	9	-	-	JJ
cord-014462-11ggaqf1	1163	10	contagious	contagious	JJ
cord-014462-11ggaqf1	1163	11	,	,	,
cord-014462-11ggaqf1	1163	12	proliferative	proliferative	JJ
cord-014462-11ggaqf1	1163	13	disease	disease	NN
cord-014462-11ggaqf1	1163	14	and	and	CC
cord-014462-11ggaqf1	1163	15	is	be	VBZ
cord-014462-11ggaqf1	1163	16	caused	cause	VBN
cord-014462-11ggaqf1	1163	17	by	by	IN
cord-014462-11ggaqf1	1163	18	Orf	Orf	NNP
cord-014462-11ggaqf1	1163	19	virus	virus	NN
cord-014462-11ggaqf1	1163	20	of	of	IN
cord-014462-11ggaqf1	1163	21	the	the	DT
cord-014462-11ggaqf1	1163	22	genus	genus	NNP
cord-014462-11ggaqf1	1163	23	parapox	parapox	NNP
cord-014462-11ggaqf1	1163	24	virus	virus	NN
cord-014462-11ggaqf1	1163	25	of	of	IN
cord-014462-11ggaqf1	1163	26	the	the	DT
cord-014462-11ggaqf1	1163	27	family	family	NN
cord-014462-11ggaqf1	1163	28	poxviridae	poxviridae	NN
cord-014462-11ggaqf1	1163	29	.	.	.
cord-014462-11ggaqf1	1164	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1164	2	is	be	VBZ
cord-014462-11ggaqf1	1164	3	reported	report	VBN
cord-014462-11ggaqf1	1164	4	most	most	RBS
cord-014462-11ggaqf1	1164	5	commonly	commonly	RB
cord-014462-11ggaqf1	1164	6	in	in	IN
cord-014462-11ggaqf1	1164	7	sheep	sheep	NNS
cord-014462-11ggaqf1	1164	8	and	and	CC
cord-014462-11ggaqf1	1164	9	goats	goat	NNS
cord-014462-11ggaqf1	1164	10	and	and	CC
cord-014462-11ggaqf1	1164	11	also	also	RB
cord-014462-11ggaqf1	1164	12	a	a	DT
cord-014462-11ggaqf1	1164	13	zoonotic	zoonotic	JJ
cord-014462-11ggaqf1	1164	14	agent	agent	NN
cord-014462-11ggaqf1	1164	15	.	.	.
cord-014462-11ggaqf1	1165	1	Camels	camel	NNS
cord-014462-11ggaqf1	1165	2	are	be	VBP
cord-014462-11ggaqf1	1165	3	also	also	RB
cord-014462-11ggaqf1	1165	4	infected	infect	VBN
cord-014462-11ggaqf1	1165	5	by	by	IN
cord-014462-11ggaqf1	1165	6	Orf	Orf	NNP
cord-014462-11ggaqf1	1165	7	virus	virus	NN
cord-014462-11ggaqf1	1165	8	and	and	CC
cord-014462-11ggaqf1	1165	9	reported	report	VBD
cord-014462-11ggaqf1	1165	10	in	in	IN
cord-014462-11ggaqf1	1165	11	camel	camel	NN
cord-014462-11ggaqf1	1165	12	rearing	rearing	NN
cord-014462-11ggaqf1	1165	13	countries	country	NNS
cord-014462-11ggaqf1	1165	14	as	as	IN
cord-014462-11ggaqf1	1165	15	a	a	DT
cord-014462-11ggaqf1	1165	16	mixed	mixed	JJ
cord-014462-11ggaqf1	1165	17	infection	infection	NN
cord-014462-11ggaqf1	1165	18	with	with	IN
cord-014462-11ggaqf1	1165	19	camel	camel	NN
cord-014462-11ggaqf1	1165	20	pox	pox	NN
cord-014462-11ggaqf1	1165	21	,	,	,
cord-014462-11ggaqf1	1165	22	the	the	DT
cord-014462-11ggaqf1	1165	23	later	later	RB
cord-014462-11ggaqf1	1165	24	is	be	VBZ
cord-014462-11ggaqf1	1165	25	caused	cause	VBN
cord-014462-11ggaqf1	1165	26	by	by	IN
cord-014462-11ggaqf1	1165	27	an	an	DT
cord-014462-11ggaqf1	1165	28	orthopox	orthopox	NN
cord-014462-11ggaqf1	1165	29	virus	virus	NN
cord-014462-11ggaqf1	1165	30	.	.	.
cord-014462-11ggaqf1	1166	1	In	in	IN
cord-014462-11ggaqf1	1166	2	India	India	NNP
cord-014462-11ggaqf1	1166	3	,	,	,
cord-014462-11ggaqf1	1166	4	there	there	EX
cord-014462-11ggaqf1	1166	5	are	be	VBP
cord-014462-11ggaqf1	1166	6	few	few	JJ
cord-014462-11ggaqf1	1166	7	reports	report	NNS
cord-014462-11ggaqf1	1166	8	of	of	IN
cord-014462-11ggaqf1	1166	9	the	the	DT
cord-014462-11ggaqf1	1166	10	Orf	Orf	NNP
cord-014462-11ggaqf1	1166	11	virus	virus	NN
cord-014462-11ggaqf1	1166	12	infection	infection	NN
cord-014462-11ggaqf1	1166	13	in	in	IN
cord-014462-11ggaqf1	1166	14	camels	camel	NNS
cord-014462-11ggaqf1	1166	15	and	and	CC
cord-014462-11ggaqf1	1166	16	identified	identify	VBN
cord-014462-11ggaqf1	1166	17	by	by	IN
cord-014462-11ggaqf1	1166	18	clinical	clinical	JJ
cord-014462-11ggaqf1	1166	19	signs	sign	NNS
cord-014462-11ggaqf1	1166	20	and	and	CC
cord-014462-11ggaqf1	1166	21	PCR	PCR	NNP
cord-014462-11ggaqf1	1166	22	.	.	.
cord-014462-11ggaqf1	1167	1	In	in	IN
cord-014462-11ggaqf1	1167	2	this	this	DT
cord-014462-11ggaqf1	1167	3	study	study	NN
cord-014462-11ggaqf1	1167	4	,	,	,
cord-014462-11ggaqf1	1167	5	we	-PRON-	PRP
cord-014462-11ggaqf1	1167	6	identified	identify	VBD
cord-014462-11ggaqf1	1167	7	the	the	DT
cord-014462-11ggaqf1	1167	8	presence	presence	NN
cord-014462-11ggaqf1	1167	9	of	of	IN
cord-014462-11ggaqf1	1167	10	Orf	Orf	NNP
cord-014462-11ggaqf1	1167	11	virus	virus	NN
cord-014462-11ggaqf1	1167	12	from	from	IN
cord-014462-11ggaqf1	1167	13	clinical	clinical	JJ
cord-014462-11ggaqf1	1167	14	samples	sample	NNS
cord-014462-11ggaqf1	1167	15	of	of	IN
cord-014462-11ggaqf1	1167	16	suspected	suspect	VBN
cord-014462-11ggaqf1	1167	17	case	case	NN
cord-014462-11ggaqf1	1167	18	of	of	IN
cord-014462-11ggaqf1	1167	19	sporadic	sporadic	JJ
cord-014462-11ggaqf1	1167	20	infection	infection	NN
cord-014462-11ggaqf1	1167	21	in	in	IN
cord-014462-11ggaqf1	1167	22	camels	camel	NNS
cord-014462-11ggaqf1	1167	23	by	by	IN
cord-014462-11ggaqf1	1167	24	serological	serological	JJ
cord-014462-11ggaqf1	1167	25	and	and	CC
cord-014462-11ggaqf1	1167	26	molecular	molecular	JJ
cord-014462-11ggaqf1	1167	27	techniques	technique	NNS
cord-014462-11ggaqf1	1167	28	.	.	.
cord-014462-11ggaqf1	1168	1	Viral	viral	JJ
cord-014462-11ggaqf1	1168	2	DNA	DNA	NNP
cord-014462-11ggaqf1	1168	3	isolated	isolate	VBN
cord-014462-11ggaqf1	1168	4	from	from	IN
cord-014462-11ggaqf1	1168	5	processed	process	VBN
cord-014462-11ggaqf1	1168	6	scabs	scab	NNS
cord-014462-11ggaqf1	1168	7	used	use	VBN
cord-014462-11ggaqf1	1168	8	initially	initially	RB
cord-014462-11ggaqf1	1168	9	in	in	IN
cord-014462-11ggaqf1	1168	10	nested	nested	JJ
cord-014462-11ggaqf1	1168	11	polymerase	polymerase	NN
cord-014462-11ggaqf1	1168	12	chain	chain	NN
cord-014462-11ggaqf1	1168	13	reaction	reaction	NN
cord-014462-11ggaqf1	1168	14	as	as	IN
cord-014462-11ggaqf1	1168	15	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1168	16	PCR	PCR	NNP
cord-014462-11ggaqf1	1168	17	which	which	WDT
cord-014462-11ggaqf1	1168	18	successfully	successfully	RB
cord-014462-11ggaqf1	1168	19	amplified	amplify	VBD
cord-014462-11ggaqf1	1168	20	235	235	CD
cord-014462-11ggaqf1	1168	21	bp	bp	NNP
cord-014462-11ggaqf1	1168	22	fragments	fragment	NNS
cord-014462-11ggaqf1	1168	23	and	and	CC
cord-014462-11ggaqf1	1168	24	also	also	RB
cord-014462-11ggaqf1	1168	25	sequenced	sequence	VBN
cord-014462-11ggaqf1	1168	26	to	to	TO
cord-014462-11ggaqf1	1168	27	check	check	VB
cord-014462-11ggaqf1	1168	28	the	the	DT
cord-014462-11ggaqf1	1168	29	fidelity	fidelity	NN
cord-014462-11ggaqf1	1168	30	of	of	IN
cord-014462-11ggaqf1	1168	31	the	the	DT
cord-014462-11ggaqf1	1168	32	product	product	NN
cord-014462-11ggaqf1	1168	33	.	.	.
cord-014462-11ggaqf1	1169	1	After	after	IN
cord-014462-11ggaqf1	1169	2	confirming	confirm	VBG
cord-014462-11ggaqf1	1169	3	the	the	DT
cord-014462-11ggaqf1	1169	4	infection	infection	NN
cord-014462-11ggaqf1	1169	5	by	by	IN
cord-014462-11ggaqf1	1169	6	PCR	PCR	NNP
cord-014462-11ggaqf1	1169	7	,	,	,
cord-014462-11ggaqf1	1169	8	some	some	DT
cord-014462-11ggaqf1	1169	9	of	of	IN
cord-014462-11ggaqf1	1169	10	the	the	DT
cord-014462-11ggaqf1	1169	11	structural	structural	JJ
cord-014462-11ggaqf1	1169	12	and	and	CC
cord-014462-11ggaqf1	1169	13	non	non	JJ
cord-014462-11ggaqf1	1169	14	-	-	JJ
cord-014462-11ggaqf1	1169	15	structural	structural	JJ
cord-014462-11ggaqf1	1169	16	genes	gene	NNS
cord-014462-11ggaqf1	1169	17	were	be	VBD
cord-014462-11ggaqf1	1169	18	amplified	amplify	VBN
cord-014462-11ggaqf1	1169	19	for	for	IN
cord-014462-11ggaqf1	1169	20	sequence	sequence	NN
cord-014462-11ggaqf1	1169	21	analysis	analysis	NN
cord-014462-11ggaqf1	1169	22	.	.	.
cord-014462-11ggaqf1	1170	1	Out	out	IN
cord-014462-11ggaqf1	1170	2	of	of	IN
cord-014462-11ggaqf1	1170	3	the	the	DT
cord-014462-11ggaqf1	1170	4	five	five	CD
cord-014462-11ggaqf1	1170	5	genes	gene	NNS
cord-014462-11ggaqf1	1170	6	characterized	characterize	VBN
cord-014462-11ggaqf1	1170	7	,	,	,
cord-014462-11ggaqf1	1170	8	the	the	DT
cord-014462-11ggaqf1	1170	9	major	major	JJ
cord-014462-11ggaqf1	1170	10	important	important	JJ
cord-014462-11ggaqf1	1170	11	one	one	CD
cord-014462-11ggaqf1	1170	12	selected	select	VBN
cord-014462-11ggaqf1	1170	13	for	for	IN
cord-014462-11ggaqf1	1170	14	sequence	sequence	NN
cord-014462-11ggaqf1	1170	15	and	and	CC
cord-014462-11ggaqf1	1170	16	phylogenetic	phylogenetic	NN
cord-014462-11ggaqf1	1170	17	analysis	analysis	NN
cord-014462-11ggaqf1	1170	18	is	be	VBZ
cord-014462-11ggaqf1	1170	19	B2L	b2l	NN
cord-014462-11ggaqf1	1170	20	gene	gene	NN
cord-014462-11ggaqf1	1170	21	which	which	WDT
cord-014462-11ggaqf1	1170	22	is	be	VBZ
cord-014462-11ggaqf1	1170	23	homologous	homologous	JJ
cord-014462-11ggaqf1	1170	24	to	to	IN
cord-014462-11ggaqf1	1170	25	a	a	DT
cord-014462-11ggaqf1	1170	26	major	major	JJ
cord-014462-11ggaqf1	1170	27	envelope	envelope	NN
cord-014462-11ggaqf1	1170	28	protein	protein	NN
cord-014462-11ggaqf1	1170	29	P37k	P37k	NNP
cord-014462-11ggaqf1	1170	30	of	of	IN
cord-014462-11ggaqf1	1170	31	vaccinia	vaccinia	NN
cord-014462-11ggaqf1	1170	32	virus	virus	NN
cord-014462-11ggaqf1	1170	33	.	.	.
cord-014462-11ggaqf1	1171	1	Full	full	JJ
cord-014462-11ggaqf1	1171	2	open	open	JJ
cord-014462-11ggaqf1	1171	3	reading	reading	NN
cord-014462-11ggaqf1	1171	4	frame	frame	NN
cord-014462-11ggaqf1	1171	5	of	of	IN
cord-014462-11ggaqf1	1171	6	1137	1137	CD
cord-014462-11ggaqf1	1171	7	bp	bp	NNP
cord-014462-11ggaqf1	1171	8	from	from	IN
cord-014462-11ggaqf1	1171	9	Orf	Orf	NNP
cord-014462-11ggaqf1	1171	10	B2L	B2L	NNP
cord-014462-11ggaqf1	1171	11	was	be	VBD
cord-014462-11ggaqf1	1171	12	amplified	amplify	VBN
cord-014462-11ggaqf1	1171	13	by	by	IN
cord-014462-11ggaqf1	1171	14	PCR	PCR	NNP
cord-014462-11ggaqf1	1171	15	,	,	,
cord-014462-11ggaqf1	1171	16	cloned	clone	VBN
cord-014462-11ggaqf1	1171	17	and	and	CC
cord-014462-11ggaqf1	1171	18	sequenced	sequence	VBN
cord-014462-11ggaqf1	1171	19	commercially	commercially	RB
cord-014462-11ggaqf1	1171	20	.	.	.
cord-014462-11ggaqf1	1172	1	Nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1172	2	and	and	CC
cord-014462-11ggaqf1	1172	3	deduced	deduce	VBD
cord-014462-11ggaqf1	1172	4	amino	amino	NN
cord-014462-11ggaqf1	1172	5	acid	acid	NN
cord-014462-11ggaqf1	1172	6	sequences	sequence	NNS
cord-014462-11ggaqf1	1172	7	of	of	IN
cord-014462-11ggaqf1	1172	8	B2L	B2L	NNP
cord-014462-11ggaqf1	1172	9	were	be	VBD
cord-014462-11ggaqf1	1172	10	compared	compare	VBN
cord-014462-11ggaqf1	1172	11	with	with	IN
cord-014462-11ggaqf1	1172	12	other	other	JJ
cord-014462-11ggaqf1	1172	13	published	publish	VBN
cord-014462-11ggaqf1	1172	14	sequences	sequence	NNS
cord-014462-11ggaqf1	1172	15	of	of	IN
cord-014462-11ggaqf1	1172	16	the	the	DT
cord-014462-11ggaqf1	1172	17	members	member	NNS
cord-014462-11ggaqf1	1172	18	of	of	IN
cord-014462-11ggaqf1	1172	19	the	the	DT
cord-014462-11ggaqf1	1172	20	genus	genus	NNP
cord-014462-11ggaqf1	1172	21	papapox	papapox	NNP
cord-014462-11ggaqf1	1172	22	virus	virus	NN
cord-014462-11ggaqf1	1172	23	.	.	.
cord-014462-11ggaqf1	1173	1	Sequence	sequence	NN
cord-014462-11ggaqf1	1173	2	analysis	analysis	NN
cord-014462-11ggaqf1	1173	3	shows	show	VBZ
cord-014462-11ggaqf1	1173	4	a	a	DT
cord-014462-11ggaqf1	1173	5	maximum	maximum	JJ
cord-014462-11ggaqf1	1173	6	percent	percent	NN
cord-014462-11ggaqf1	1173	7	identity	identity	NN
cord-014462-11ggaqf1	1173	8	of	of	IN
cord-014462-11ggaqf1	1173	9	94.8	94.8	CD
cord-014462-11ggaqf1	1173	10	and	and	CC
cord-014462-11ggaqf1	1173	11	95	95	CD
cord-014462-11ggaqf1	1173	12	(	(	-LRB-
cord-014462-11ggaqf1	1173	13	Indian	Indian	NNP
cord-014462-11ggaqf1	1173	14	Orf	Orf	NNP
cord-014462-11ggaqf1	1173	15	virus	virus	NN
cord-014462-11ggaqf1	1173	16	isolates	isolate	VBZ
cord-014462-11ggaqf1	1173	17	)	)	-RRB-
cord-014462-11ggaqf1	1173	18	;	;	:
cord-014462-11ggaqf1	1173	19	94.7	94.7	CD
cord-014462-11ggaqf1	1173	20	and	and	CC
cord-014462-11ggaqf1	1173	21	94.5	94.5	CD
cord-014462-11ggaqf1	1173	22	(	(	-LRB-
cord-014462-11ggaqf1	1173	23	other	other	JJ
cord-014462-11ggaqf1	1173	24	Orf	Orf	NNP
cord-014462-11ggaqf1	1173	25	isolates	isolate	NNS
cord-014462-11ggaqf1	1173	26	)	)	-RRB-
cord-014462-11ggaqf1	1173	27	;	;	:
cord-014462-11ggaqf1	1173	28	98.8	98.8	CD
cord-014462-11ggaqf1	1173	29	and	and	CC
cord-014462-11ggaqf1	1173	30	98.7	98.7	CD
cord-014462-11ggaqf1	1173	31	(	(	-LRB-
cord-014462-11ggaqf1	1173	32	Orf	Orf	NNP
cord-014462-11ggaqf1	1173	33	-	-	HYPH
cord-014462-11ggaqf1	1173	34	camel	camel	NN
cord-014462-11ggaqf1	1173	35	/	/	SYM
cord-014462-11ggaqf1	1173	36	Jodhpur/08	jodhpur/08	NN
cord-014462-11ggaqf1	1173	37	)	)	-RRB-
cord-014462-11ggaqf1	1173	38	;	;	:
cord-014462-11ggaqf1	1173	39	85	85	CD
cord-014462-11ggaqf1	1173	40	and	and	CC
cord-014462-11ggaqf1	1173	41	82.8	82.8	CD
cord-014462-11ggaqf1	1173	42	(	(	-LRB-
cord-014462-11ggaqf1	1173	43	bovine	bovine	JJ
cord-014462-11ggaqf1	1173	44	popular	popular	JJ
cord-014462-11ggaqf1	1173	45	stomatitis	stomatitis	NN
cord-014462-11ggaqf1	1173	46	virus	virus	NN
cord-014462-11ggaqf1	1173	47	)	)	-RRB-
cord-014462-11ggaqf1	1173	48	and	and	CC
cord-014462-11ggaqf1	1173	49	finally	finally	RB
cord-014462-11ggaqf1	1173	50	97.4	97.4	CD
cord-014462-11ggaqf1	1173	51	and	and	CC
cord-014462-11ggaqf1	1173	52	97.6	97.6	CD
cord-014462-11ggaqf1	1173	53	(	(	-LRB-
cord-014462-11ggaqf1	1173	54	pseudo	pseudo	JJ
cord-014462-11ggaqf1	1173	55	cowpox	cowpox	NN
cord-014462-11ggaqf1	1173	56	virus	virus	NN
cord-014462-11ggaqf1	1173	57	)	)	-RRB-
cord-014462-11ggaqf1	1173	58	respectively	respectively	RB
cord-014462-11ggaqf1	1173	59	at	at	IN
cord-014462-11ggaqf1	1173	60	nt	nt	RB
cord-014462-11ggaqf1	1173	61	and	and	CC
cord-014462-11ggaqf1	1173	62	aa	aa	NNP
cord-014462-11ggaqf1	1173	63	levels	level	NNS
cord-014462-11ggaqf1	1173	64	.	.	.
cord-014462-11ggaqf1	1174	1	Phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1174	2	analysis	analysis	NN
cord-014462-11ggaqf1	1174	3	of	of	IN
cord-014462-11ggaqf1	1174	4	the	the	DT
cord-014462-11ggaqf1	1174	5	isolate	isolate	NN
cord-014462-11ggaqf1	1174	6	was	be	VBD
cord-014462-11ggaqf1	1174	7	also	also	RB
cord-014462-11ggaqf1	1174	8	performed	perform	VBN
cord-014462-11ggaqf1	1174	9	using	use	VBG
cord-014462-11ggaqf1	1174	10	the	the	DT
cord-014462-11ggaqf1	1174	11	neighbour	neighbour	NN
cord-014462-11ggaqf1	1174	12	joining	join	VBG
cord-014462-11ggaqf1	1174	13	method	method	NN
cord-014462-11ggaqf1	1174	14	in	in	IN
cord-014462-11ggaqf1	1174	15	MEGA	MEGA	NNP
cord-014462-11ggaqf1	1174	16	4	4	CD
cord-014462-11ggaqf1	1174	17	program	program	NN
cord-014462-11ggaqf1	1174	18	to	to	TO
cord-014462-11ggaqf1	1174	19	know	know	VB
cord-014462-11ggaqf1	1174	20	the	the	DT
cord-014462-11ggaqf1	1174	21	phylogeny	phylogeny	NN
cord-014462-11ggaqf1	1174	22	relatedness	relatedness	NN
cord-014462-11ggaqf1	1174	23	of	of	IN
cord-014462-11ggaqf1	1174	24	the	the	DT
cord-014462-11ggaqf1	1174	25	virus	virus	NN
cord-014462-11ggaqf1	1174	26	,	,	,
cord-014462-11ggaqf1	1174	27	which	which	WDT
cord-014462-11ggaqf1	1174	28	revealed	reveal	VBD
cord-014462-11ggaqf1	1174	29	that	that	IN
cord-014462-11ggaqf1	1174	30	the	the	DT
cord-014462-11ggaqf1	1174	31	isolate	isolate	NN
cord-014462-11ggaqf1	1174	32	is	be	VBZ
cord-014462-11ggaqf1	1174	33	well	well	RB
cord-014462-11ggaqf1	1174	34	grouped	group	VBN
cord-014462-11ggaqf1	1174	35	with	with	IN
cord-014462-11ggaqf1	1174	36	the	the	DT
cord-014462-11ggaqf1	1174	37	Jodhpur	Jodhpur	NNP
cord-014462-11ggaqf1	1174	38	isolate	isolate	VB
cord-014462-11ggaqf1	1174	39	and	and	CC
cord-014462-11ggaqf1	1174	40	closely	closely	RB
cord-014462-11ggaqf1	1174	41	related	related	JJ
cord-014462-11ggaqf1	1174	42	to	to	IN
cord-014462-11ggaqf1	1174	43	pseudo	pseudo	JJ
cord-014462-11ggaqf1	1174	44	cowpox	cowpox	NN
cord-014462-11ggaqf1	1174	45	virus	virus	NN
cord-014462-11ggaqf1	1174	46	.	.	.
cord-014462-11ggaqf1	1175	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1175	2	warrants	warrant	VBZ
cord-014462-11ggaqf1	1175	3	further	further	JJ
cord-014462-11ggaqf1	1175	4	analysis	analysis	NN
cord-014462-11ggaqf1	1175	5	of	of	IN
cord-014462-11ggaqf1	1175	6	other	other	JJ
cord-014462-11ggaqf1	1175	7	potential	potential	JJ
cord-014462-11ggaqf1	1175	8	genes	gene	NNS
cord-014462-11ggaqf1	1175	9	to	to	TO
cord-014462-11ggaqf1	1175	10	confirm	confirm	VB
cord-014462-11ggaqf1	1175	11	the	the	DT
cord-014462-11ggaqf1	1175	12	causative	causative	JJ
cord-014462-11ggaqf1	1175	13	agent	agent	NN
cord-014462-11ggaqf1	1175	14	of	of	IN
cord-014462-11ggaqf1	1175	15	the	the	DT
cord-014462-11ggaqf1	1175	16	contagious	contagious	JJ
cord-014462-11ggaqf1	1175	17	ecthyma	ecthyma	NN
cord-014462-11ggaqf1	1175	18	in	in	IN
cord-014462-11ggaqf1	1175	19	camels	camel	NNS
cord-014462-11ggaqf1	1175	20	as	as	IN
cord-014462-11ggaqf1	1175	21	pseudo	pseudo	JJ
cord-014462-11ggaqf1	1175	22	cowpox	cowpox	NN
cord-014462-11ggaqf1	1175	23	virus	virus	NN
cord-014462-11ggaqf1	1175	24	.	.	.
cord-014462-11ggaqf1	1176	1	Chikungunya	Chikungunya	NNP
cord-014462-11ggaqf1	1176	2	an	an	DT
cord-014462-11ggaqf1	1176	3	arboviral	arboviral	JJ
cord-014462-11ggaqf1	1176	4	disease	disease	NN
cord-014462-11ggaqf1	1176	5	is	be	VBZ
cord-014462-11ggaqf1	1176	6	transmitted	transmit	VBN
cord-014462-11ggaqf1	1176	7	through	through	IN
cord-014462-11ggaqf1	1176	8	the	the	DT
cord-014462-11ggaqf1	1176	9	bite	bite	NN
cord-014462-11ggaqf1	1176	10	of	of	IN
cord-014462-11ggaqf1	1176	11	an	an	DT
cord-014462-11ggaqf1	1176	12	infected	infected	JJ
cord-014462-11ggaqf1	1176	13	Aedes	Aedes	NNP
cord-014462-11ggaqf1	1176	14	mosquito	mosquito	NN
cord-014462-11ggaqf1	1176	15	.	.	.
cord-014462-11ggaqf1	1177	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1177	2	causes	cause	VBZ
cord-014462-11ggaqf1	1177	3	a	a	DT
cord-014462-11ggaqf1	1177	4	self	self	NN
cord-014462-11ggaqf1	1177	5	limited	limit	VBN
cord-014462-11ggaqf1	1177	6	febrile	febrile	JJ
cord-014462-11ggaqf1	1177	7	illness	illness	NN
cord-014462-11ggaqf1	1177	8	along	along	IN
cord-014462-11ggaqf1	1177	9	with	with	IN
cord-014462-11ggaqf1	1177	10	arthralgia	arthralgia	NNP
cord-014462-11ggaqf1	1177	11	and	and	CC
cord-014462-11ggaqf1	1177	12	myalgia	myalgia	NNP
cord-014462-11ggaqf1	1177	13	.	.	.
cord-014462-11ggaqf1	1178	1	In	in	IN
cord-014462-11ggaqf1	1178	2	some	some	DT
cord-014462-11ggaqf1	1178	3	cases	case	NNS
cord-014462-11ggaqf1	1178	4	neurological	neurological	JJ
cord-014462-11ggaqf1	1178	5	and	and	CC
cord-014462-11ggaqf1	1178	6	severe	severe	JJ
cord-014462-11ggaqf1	1178	7	hemorrhagic	hemorrhagic	JJ
cord-014462-11ggaqf1	1178	8	manifestations	manifestation	NNS
cord-014462-11ggaqf1	1178	9	has	have	VBZ
cord-014462-11ggaqf1	1178	10	been	be	VBN
cord-014462-11ggaqf1	1178	11	observed	observe	VBN
cord-014462-11ggaqf1	1178	12	.	.	.
cord-014462-11ggaqf1	1179	1	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	1179	2	epidemic	epidemic	NN
cord-014462-11ggaqf1	1179	3	has	have	VBZ
cord-014462-11ggaqf1	1179	4	been	be	VBN
cord-014462-11ggaqf1	1179	5	reported	report	VBN
cord-014462-11ggaqf1	1179	6	in	in	IN
cord-014462-11ggaqf1	1179	7	Africa	Africa	NNP
cord-014462-11ggaqf1	1179	8	,	,	,
cord-014462-11ggaqf1	1179	9	India	India	NNP
cord-014462-11ggaqf1	1179	10	,	,	,
cord-014462-11ggaqf1	1179	11	South	South	NNP
cord-014462-11ggaqf1	1179	12	East	East	NNP
cord-014462-11ggaqf1	1179	13	Asian	asian	JJ
cord-014462-11ggaqf1	1179	14	countries	country	NNS
cord-014462-11ggaqf1	1179	15	and	and	CC
cord-014462-11ggaqf1	1179	16	during	during	IN
cord-014462-11ggaqf1	1179	17	the	the	DT
cord-014462-11ggaqf1	1179	18	current	current	JJ
cord-014462-11ggaqf1	1179	19	out	out	RP
cord-014462-11ggaqf1	1179	20	break	break	NN
cord-014462-11ggaqf1	1180	1	imported	import	VBN
cord-014462-11ggaqf1	1180	2	cases	case	NNS
cord-014462-11ggaqf1	1180	3	of	of	IN
cord-014462-11ggaqf1	1180	4	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	1180	5	has	have	VBZ
cord-014462-11ggaqf1	1180	6	been	be	VBN
cord-014462-11ggaqf1	1180	7	encountered	encounter	VBN
cord-014462-11ggaqf1	1180	8	in	in	IN
cord-014462-11ggaqf1	1180	9	most	most	JJS
cord-014462-11ggaqf1	1180	10	of	of	IN
cord-014462-11ggaqf1	1180	11	the	the	DT
cord-014462-11ggaqf1	1180	12	European	european	JJ
cord-014462-11ggaqf1	1180	13	countries	country	NNS
cord-014462-11ggaqf1	1180	14	.	.	.
cord-014462-11ggaqf1	1181	1	The	the	DT
cord-014462-11ggaqf1	1181	2	causative	causative	JJ
cord-014462-11ggaqf1	1181	3	agent	agent	NN
cord-014462-11ggaqf1	1181	4	belongs	belong	VBZ
cord-014462-11ggaqf1	1181	5	to	to	IN
cord-014462-11ggaqf1	1181	6	the	the	DT
cord-014462-11ggaqf1	1181	7	genus	genus	NN
cord-014462-11ggaqf1	1181	8	Alphavirus	Alphavirus	NNP
cord-014462-11ggaqf1	1181	9	family	family	NN
cord-014462-11ggaqf1	1181	10	Togaviridae	Togaviridae	NNP
cord-014462-11ggaqf1	1181	11	.	.	.
cord-014462-11ggaqf1	1182	1	Human	human	JJ
cord-014462-11ggaqf1	1182	2	beings	being	NNS
cord-014462-11ggaqf1	1182	3	serve	serve	VBP
cord-014462-11ggaqf1	1182	4	as	as	IN
cord-014462-11ggaqf1	1182	5	the	the	DT
cord-014462-11ggaqf1	1182	6	chikungunya	chikungunya	NN
cord-014462-11ggaqf1	1182	7	virus	virus	NN
cord-014462-11ggaqf1	1182	8	reservoir	reservoir	NN
cord-014462-11ggaqf1	1182	9	host	host	NN
cord-014462-11ggaqf1	1182	10	during	during	IN
cord-014462-11ggaqf1	1182	11	epidemic	epidemic	JJ
cord-014462-11ggaqf1	1182	12	periods	period	NNS
cord-014462-11ggaqf1	1182	13	.	.	.
cord-014462-11ggaqf1	1183	1	Outside	outside	IN
cord-014462-11ggaqf1	1183	2	these	these	DT
cord-014462-11ggaqf1	1183	3	periods	period	NNS
cord-014462-11ggaqf1	1183	4	the	the	DT
cord-014462-11ggaqf1	1183	5	main	main	JJ
cord-014462-11ggaqf1	1183	6	reservoirs	reservoir	NNS
cord-014462-11ggaqf1	1183	7	are	be	VBP
cord-014462-11ggaqf1	1183	8	monkeys	monkey	NNS
cord-014462-11ggaqf1	1183	9	,	,	,
cord-014462-11ggaqf1	1183	10	rodents	rodent	NNS
cord-014462-11ggaqf1	1183	11	,	,	,
cord-014462-11ggaqf1	1183	12	birds	bird	NNS
cord-014462-11ggaqf1	1183	13	,	,	,
cord-014462-11ggaqf1	1183	14	and	and	CC
cord-014462-11ggaqf1	1183	15	other	other	JJ
cord-014462-11ggaqf1	1183	16	unidentified	unidentified	JJ
cord-014462-11ggaqf1	1183	17	vertebrates	vertebrate	NNS
cord-014462-11ggaqf1	1183	18	.	.	.
cord-014462-11ggaqf1	1184	1	Antibodies	antibody	NNS
cord-014462-11ggaqf1	1184	2	to	to	IN
cord-014462-11ggaqf1	1184	3	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	1184	4	have	have	VBP
cord-014462-11ggaqf1	1184	5	been	be	VBN
cord-014462-11ggaqf1	1184	6	detected	detect	VBN
cord-014462-11ggaqf1	1184	7	in	in	IN
cord-014462-11ggaqf1	1184	8	domestic	domestic	JJ
cord-014462-11ggaqf1	1184	9	animals	animal	NNS
cord-014462-11ggaqf1	1184	10	.	.	.
cord-014462-11ggaqf1	1185	1	In	in	IN
cord-014462-11ggaqf1	1185	2	the	the	DT
cord-014462-11ggaqf1	1185	3	present	present	JJ
cord-014462-11ggaqf1	1185	4	study	study	NN
cord-014462-11ggaqf1	1185	5	we	-PRON-	PRP
cord-014462-11ggaqf1	1185	6	surveyed	survey	VBD
cord-014462-11ggaqf1	1185	7	Madanapalli	Madanapalli	NNP
cord-014462-11ggaqf1	1185	8	,	,	,
cord-014462-11ggaqf1	1185	9	Palamaner	Palamaner	NNP
cord-014462-11ggaqf1	1185	10	,	,	,
cord-014462-11ggaqf1	1185	11	B.	B.	NNP
cord-014462-11ggaqf1	1185	12	Kotta	Kotta	NNP
cord-014462-11ggaqf1	1185	13	Kota	Kota	NNP
cord-014462-11ggaqf1	1185	14	and	and	CC
cord-014462-11ggaqf1	1185	15	Tirupati	Tirupati	NNP
cord-014462-11ggaqf1	1185	16	and	and	CC
cord-014462-11ggaqf1	1185	17	collected	collect	VBD
cord-014462-11ggaqf1	1185	18	a	a	DT
cord-014462-11ggaqf1	1185	19	total	total	NN
cord-014462-11ggaqf1	1185	20	of	of	IN
cord-014462-11ggaqf1	1185	21	67	67	CD
cord-014462-11ggaqf1	1185	22	rodent	rodent	NN
cord-014462-11ggaqf1	1185	23	samples	sample	NNS
cord-014462-11ggaqf1	1185	24	,	,	,
cord-014462-11ggaqf1	1185	25	75	75	CD
cord-014462-11ggaqf1	1185	26	bovine	bovine	JJ
cord-014462-11ggaqf1	1185	27	samples	sample	NNS
cord-014462-11ggaqf1	1185	28	;	;	:
cord-014462-11ggaqf1	1185	29	20	20	CD
cord-014462-11ggaqf1	1185	30	sheep	sheep	NN
cord-014462-11ggaqf1	1185	31	samples	sample	NNS
cord-014462-11ggaqf1	1185	32	and	and	CC
cord-014462-11ggaqf1	1185	33	15	15	CD
cord-014462-11ggaqf1	1185	34	canine	canine	JJ
cord-014462-11ggaqf1	1185	35	samples	sample	NNS
cord-014462-11ggaqf1	1185	36	.	.	.
cord-014462-11ggaqf1	1186	1	Total	Total	NNP
cord-014462-11ggaqf1	1186	2	RNA	RNA	NNP
cord-014462-11ggaqf1	1186	3	was	be	VBD
cord-014462-11ggaqf1	1186	4	isolated	isolate	VBN
cord-014462-11ggaqf1	1186	5	from	from	IN
cord-014462-11ggaqf1	1186	6	all	all	PDT
cord-014462-11ggaqf1	1186	7	these	these	DT
cord-014462-11ggaqf1	1186	8	samples	sample	NNS
cord-014462-11ggaqf1	1186	9	and	and	CC
cord-014462-11ggaqf1	1186	10	subjected	subject	VBN
cord-014462-11ggaqf1	1186	11	to	to	IN
cord-014462-11ggaqf1	1186	12	RT	RT	NNP
cord-014462-11ggaqf1	1186	13	-	-	HYPH
cord-014462-11ggaqf1	1186	14	PCR	PCR	NNP
cord-014462-11ggaqf1	1186	15	using	use	VBG
cord-014462-11ggaqf1	1186	16	a	a	DT
cord-014462-11ggaqf1	1186	17	primer	primer	NN
cord-014462-11ggaqf1	1186	18	pair	pair	NN
cord-014462-11ggaqf1	1186	19	DVRChk	DVRChk	NNP
cord-014462-11ggaqf1	1186	20	-	-	HYPH
cord-014462-11ggaqf1	1186	21	F	F	NNP
cord-014462-11ggaqf1	1186	22	/	/	SYM
cord-014462-11ggaqf1	1186	23	DVRChk	DVRChk	NNP
cord-014462-11ggaqf1	1186	24	-	-	HYPH
cord-014462-11ggaqf1	1186	25	R	R	NNP
cord-014462-11ggaqf1	1186	26	which	which	WDT
cord-014462-11ggaqf1	1186	27	could	could	MD
cord-014462-11ggaqf1	1186	28	amplify	amplify	VB
cord-014462-11ggaqf1	1186	29	a	a	DT
cord-014462-11ggaqf1	1186	30	330	330	CD
cord-014462-11ggaqf1	1186	31	bp	bp	NNP
cord-014462-11ggaqf1	1186	32	E1	e1	NN
cord-014462-11ggaqf1	1186	33	gene	gene	NN
cord-014462-11ggaqf1	1186	34	product	product	NN
cord-014462-11ggaqf1	1186	35	specific	specific	JJ
cord-014462-11ggaqf1	1186	36	to	to	IN
cord-014462-11ggaqf1	1186	37	Chikungunya	Chikungunya	NNP
cord-014462-11ggaqf1	1186	38	virus	virus	NN
cord-014462-11ggaqf1	1187	1	(	(	-LRB-
cord-014462-11ggaqf1	1187	2	Naresh	Naresh	NNP
cord-014462-11ggaqf1	1187	3	Kumar	Kumar	NNP
cord-014462-11ggaqf1	1187	4	et	et	NNP
cord-014462-11ggaqf1	1187	5	al	al	NNP
cord-014462-11ggaqf1	1187	6	.	.	NNP
cord-014462-11ggaqf1	1187	7	2007	2007	CD
cord-014462-11ggaqf1	1187	8	)	)	-RRB-
cord-014462-11ggaqf1	1187	9	.	.	.
cord-014462-11ggaqf1	1188	1	All	all	PDT
cord-014462-11ggaqf1	1188	2	the	the	DT
cord-014462-11ggaqf1	1188	3	Serum	serum	NN
cord-014462-11ggaqf1	1188	4	samples	sample	NNS
cord-014462-11ggaqf1	1188	5	were	be	VBD
cord-014462-11ggaqf1	1188	6	further	further	RB
cord-014462-11ggaqf1	1188	7	screened	screen	VBN
cord-014462-11ggaqf1	1188	8	for	for	IN
cord-014462-11ggaqf1	1188	9	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	1188	10	specific	specific	JJ
cord-014462-11ggaqf1	1188	11	IgM	IgM	NNP
cord-014462-11ggaqf1	1188	12	antibodies	antibody	NNS
cord-014462-11ggaqf1	1188	13	using	use	VBG
cord-014462-11ggaqf1	1188	14	commercially	commercially	RB
cord-014462-11ggaqf1	1188	15	available	available	JJ
cord-014462-11ggaqf1	1188	16	CTK	CTK	NNP
cord-014462-11ggaqf1	1188	17	biotech	biotech	NN
cord-014462-11ggaqf1	1188	18	strips	strip	NNS
cord-014462-11ggaqf1	1188	19	.	.	.
cord-014462-11ggaqf1	1189	1	None	none	NN
cord-014462-11ggaqf1	1189	2	of	of	IN
cord-014462-11ggaqf1	1189	3	the	the	DT
cord-014462-11ggaqf1	1189	4	samples	sample	NNS
cord-014462-11ggaqf1	1189	5	were	be	VBD
cord-014462-11ggaqf1	1189	6	found	find	VBN
cord-014462-11ggaqf1	1189	7	positive	positive	JJ
cord-014462-11ggaqf1	1189	8	either	either	CC
cord-014462-11ggaqf1	1189	9	for	for	IN
cord-014462-11ggaqf1	1189	10	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	1189	11	specific	specific	JJ
cord-014462-11ggaqf1	1189	12	RNA	RNA	NNP
cord-014462-11ggaqf1	1189	13	or	or	CC
cord-014462-11ggaqf1	1189	14	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	1189	15	specific	specific	JJ
cord-014462-11ggaqf1	1189	16	IgM	IgM	NNP
cord-014462-11ggaqf1	1189	17	antibodies	antibody	NNS
cord-014462-11ggaqf1	1189	18	.	.	.
cord-014462-11ggaqf1	1190	1	More	More	JJR
cord-014462-11ggaqf1	1190	2	number	number	NN
cord-014462-11ggaqf1	1190	3	of	of	IN
cord-014462-11ggaqf1	1190	4	samples	sample	NNS
cord-014462-11ggaqf1	1190	5	from	from	IN
cord-014462-11ggaqf1	1190	6	domestic	domestic	JJ
cord-014462-11ggaqf1	1190	7	animals	animal	NNS
cord-014462-11ggaqf1	1190	8	as	as	RB
cord-014462-11ggaqf1	1190	9	well	well	RB
cord-014462-11ggaqf1	1190	10	as	as	IN
cord-014462-11ggaqf1	1190	11	rodents	rodent	NNS
cord-014462-11ggaqf1	1190	12	are	be	VBP
cord-014462-11ggaqf1	1190	13	being	be	VBG
cord-014462-11ggaqf1	1190	14	screened	screen	VBN
cord-014462-11ggaqf1	1190	15	to	to	TO
cord-014462-11ggaqf1	1190	16	study	study	VB
cord-014462-11ggaqf1	1190	17	their	-PRON-	PRP$
cord-014462-11ggaqf1	1190	18	possible	possible	JJ
cord-014462-11ggaqf1	1190	19	role	role	NN
cord-014462-11ggaqf1	1190	20	if	if	IN
cord-014462-11ggaqf1	1190	21	any	any	DT
cord-014462-11ggaqf1	1190	22	in	in	IN
cord-014462-11ggaqf1	1190	23	the	the	DT
cord-014462-11ggaqf1	1190	24	maintenance	maintenance	NN
cord-014462-11ggaqf1	1190	25	of	of	IN
cord-014462-11ggaqf1	1190	26	CHIKV	CHIKV	NNP
cord-014462-11ggaqf1	1190	27	in	in	IN
cord-014462-11ggaqf1	1190	28	nature	nature	NN
cord-014462-11ggaqf1	1190	29	and	and	CC
cord-014462-11ggaqf1	1190	30	during	during	IN
cord-014462-11ggaqf1	1190	31	the	the	DT
cord-014462-11ggaqf1	1190	32	inter	inter	JJ
cord-014462-11ggaqf1	1190	33	epidemic	epidemic	NN
cord-014462-11ggaqf1	1190	34	periods	period	NNS
cord-014462-11ggaqf1	1190	35	.	.	.
cord-014462-11ggaqf1	1191	1	The	the	DT
cord-014462-11ggaqf1	1191	2	present	present	JJ
cord-014462-11ggaqf1	1191	3	study	study	NN
cord-014462-11ggaqf1	1191	4	discusses	discuss	VBZ
cord-014462-11ggaqf1	1191	5	these	these	DT
cord-014462-11ggaqf1	1191	6	aspects	aspect	NNS
cord-014462-11ggaqf1	1191	7	in	in	IN
cord-014462-11ggaqf1	1191	8	detail	detail	NN
cord-014462-11ggaqf1	1191	9	.	.	.
cord-014462-11ggaqf1	1192	1	Petunia	Petunia	NNP
cord-014462-11ggaqf1	1192	2	hybrida	hybrida	NNP
cord-014462-11ggaqf1	1192	3	is	be	VBZ
cord-014462-11ggaqf1	1192	4	widely	widely	RB
cord-014462-11ggaqf1	1192	5	used	use	VBN
cord-014462-11ggaqf1	1192	6	as	as	IN
cord-014462-11ggaqf1	1192	7	experimental	experimental	JJ
cord-014462-11ggaqf1	1192	8	host	host	NN
cord-014462-11ggaqf1	1192	9	plant	plant	NN
cord-014462-11ggaqf1	1192	10	for	for	IN
cord-014462-11ggaqf1	1192	11	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1192	12	identification	identification	NN
cord-014462-11ggaqf1	1192	13	and	and	CC
cord-014462-11ggaqf1	1192	14	its	-PRON-	PRP$
cord-014462-11ggaqf1	1192	15	characterization	characterization	NN
cord-014462-11ggaqf1	1192	16	.	.	.
cord-014462-11ggaqf1	1193	1	Hitherto	hitherto	RB
cord-014462-11ggaqf1	1193	2	,	,	,
cord-014462-11ggaqf1	1193	3	natural	natural	JJ
cord-014462-11ggaqf1	1193	4	infection	infection	NN
cord-014462-11ggaqf1	1193	5	of	of	IN
cord-014462-11ggaqf1	1193	6	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1193	7	on	on	IN
cord-014462-11ggaqf1	1193	8	Petunia	Petunia	NNP
cord-014462-11ggaqf1	1193	9	has	have	VBZ
cord-014462-11ggaqf1	1193	10	not	not	RB
cord-014462-11ggaqf1	1193	11	been	be	VBN
cord-014462-11ggaqf1	1193	12	reported	report	VBN
cord-014462-11ggaqf1	1193	13	in	in	IN
cord-014462-11ggaqf1	1193	14	India	India	NNP
cord-014462-11ggaqf1	1193	15	.	.	.
cord-014462-11ggaqf1	1194	1	Recently	recently	RB
cord-014462-11ggaqf1	1194	2	,	,	,
cord-014462-11ggaqf1	1194	3	Petunia	Petunia	NNP
cord-014462-11ggaqf1	1194	4	hybrida	hybrida	NNP
cord-014462-11ggaqf1	1194	5	grown	grow	VBN
cord-014462-11ggaqf1	1194	6	in	in	IN
cord-014462-11ggaqf1	1194	7	and	and	CC
cord-014462-11ggaqf1	1194	8	around	around	IN
cord-014462-11ggaqf1	1194	9	Ludhiana	Ludhiana	NNP
cord-014462-11ggaqf1	1194	10	were	be	VBD
cord-014462-11ggaqf1	1194	11	found	find	VBN
cord-014462-11ggaqf1	1194	12	to	to	TO
cord-014462-11ggaqf1	1194	13	be	be	VB
cord-014462-11ggaqf1	1194	14	depicting	depict	VBG
cord-014462-11ggaqf1	1194	15	typical	typical	JJ
cord-014462-11ggaqf1	1194	16	symptoms	symptom	NNS
cord-014462-11ggaqf1	1194	17	caused	cause	VBN
cord-014462-11ggaqf1	1194	18	by	by	IN
cord-014462-11ggaqf1	1194	19	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1194	20	.	.	.
cord-014462-11ggaqf1	1195	1	The	the	DT
cord-014462-11ggaqf1	1195	2	symptoms	symptom	NNS
cord-014462-11ggaqf1	1195	3	include	include	VBP
cord-014462-11ggaqf1	1195	4	severe	severe	JJ
cord-014462-11ggaqf1	1195	5	reduction	reduction	NN
cord-014462-11ggaqf1	1195	6	in	in	IN
cord-014462-11ggaqf1	1195	7	leaf	leaf	NN
cord-014462-11ggaqf1	1195	8	size	size	NN
cord-014462-11ggaqf1	1195	9	,	,	,
cord-014462-11ggaqf1	1195	10	downward	downward	JJ
cord-014462-11ggaqf1	1195	11	curling	curling	NN
cord-014462-11ggaqf1	1195	12	and	and	CC
cord-014462-11ggaqf1	1195	13	distorted	distorted	JJ
cord-014462-11ggaqf1	1195	14	leaves	leave	NNS
cord-014462-11ggaqf1	1195	15	.	.	.
cord-014462-11ggaqf1	1196	1	Severely	severely	RB
cord-014462-11ggaqf1	1196	2	infected	infect	VBN
cord-014462-11ggaqf1	1196	3	plant	plant	NN
cord-014462-11ggaqf1	1196	4	became	become	VBD
cord-014462-11ggaqf1	1196	5	bushy	bushy	JJ
cord-014462-11ggaqf1	1196	6	,	,	,
cord-014462-11ggaqf1	1196	7	stunted	stunted	JJ
cord-014462-11ggaqf1	1196	8	and	and	CC
cord-014462-11ggaqf1	1196	9	produces	produce	VBZ
cord-014462-11ggaqf1	1196	10	no	no	DT
cord-014462-11ggaqf1	1196	11	flower	flower	NN
cord-014462-11ggaqf1	1196	12	.	.	.
cord-014462-11ggaqf1	1197	1	Total	total	JJ
cord-014462-11ggaqf1	1197	2	genomic	genomic	JJ
cord-014462-11ggaqf1	1197	3	DNA	dna	NN
cord-014462-11ggaqf1	1197	4	was	be	VBD
cord-014462-11ggaqf1	1197	5	extracted	extract	VBN
cord-014462-11ggaqf1	1197	6	from	from	IN
cord-014462-11ggaqf1	1197	7	the	the	DT
cord-014462-11ggaqf1	1197	8	plants	plant	NNS
cord-014462-11ggaqf1	1197	9	showing	show	VBG
cord-014462-11ggaqf1	1197	10	symptoms	symptom	NNS
cord-014462-11ggaqf1	1197	11	of	of	IN
cord-014462-11ggaqf1	1197	12	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1197	13	,	,	,
cord-014462-11ggaqf1	1197	14	by	by	IN
cord-014462-11ggaqf1	1197	15	CTAB	CTAB	NNP
cord-014462-11ggaqf1	1197	16	method	method	NN
cord-014462-11ggaqf1	1197	17	.	.	.
cord-014462-11ggaqf1	1198	1	The	the	DT
cord-014462-11ggaqf1	1198	2	presence	presence	NN
cord-014462-11ggaqf1	1198	3	of	of	IN
cord-014462-11ggaqf1	1198	4	virus	virus	NN
cord-014462-11ggaqf1	1198	5	was	be	VBD
cord-014462-11ggaqf1	1198	6	confirmed	confirm	VBN
cord-014462-11ggaqf1	1198	7	by	by	IN
cord-014462-11ggaqf1	1198	8	using	use	VBG
cord-014462-11ggaqf1	1198	9	degenerated	degenerate	VBN
cord-014462-11ggaqf1	1198	10	primers	primer	NNS
cord-014462-11ggaqf1	1198	11	,	,	,
cord-014462-11ggaqf1	1198	12	designed	design	VBN
cord-014462-11ggaqf1	1198	13	to	to	TO
cord-014462-11ggaqf1	1198	14	identify	identify	VB
cord-014462-11ggaqf1	1198	15	all	all	PDT
cord-014462-11ggaqf1	1198	16	the	the	DT
cord-014462-11ggaqf1	1198	17	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1198	18	prevailing	prevail	VBG
cord-014462-11ggaqf1	1198	19	in	in	IN
cord-014462-11ggaqf1	1198	20	the	the	DT
cord-014462-11ggaqf1	1198	21	world	world	NN
cord-014462-11ggaqf1	1198	22	.	.	.
cord-014462-11ggaqf1	1199	1	To	to	TO
cord-014462-11ggaqf1	1199	2	identify	identify	VB
cord-014462-11ggaqf1	1199	3	the	the	DT
cord-014462-11ggaqf1	1199	4	strain	strain	NN
cord-014462-11ggaqf1	1199	5	associated	associate	VBN
cord-014462-11ggaqf1	1199	6	with	with	IN
cord-014462-11ggaqf1	1199	7	the	the	DT
cord-014462-11ggaqf1	1199	8	disease	disease	NN
cord-014462-11ggaqf1	1199	9	,	,	,
cord-014462-11ggaqf1	1199	10	the	the	DT
cord-014462-11ggaqf1	1199	11	positive	positive	JJ
cord-014462-11ggaqf1	1199	12	samples	sample	NNS
cord-014462-11ggaqf1	1199	13	along	along	IN
cord-014462-11ggaqf1	1199	14	with	with	IN
cord-014462-11ggaqf1	1199	15	healthy	healthy	JJ
cord-014462-11ggaqf1	1199	16	control	control	NN
cord-014462-11ggaqf1	1199	17	were	be	VBD
cord-014462-11ggaqf1	1199	18	tested	test	VBN
cord-014462-11ggaqf1	1199	19	against	against	IN
cord-014462-11ggaqf1	1199	20	different	different	JJ
cord-014462-11ggaqf1	1199	21	strain	strain	NN
cord-014462-11ggaqf1	1199	22	specific	specific	JJ
cord-014462-11ggaqf1	1199	23	primers	primer	NNS
cord-014462-11ggaqf1	1199	24	of	of	IN
cord-014462-11ggaqf1	1199	25	tomato	tomato	NN
cord-014462-11ggaqf1	1199	26	leaf	leaf	NN
cord-014462-11ggaqf1	1199	27	curl	curl	NN
cord-014462-11ggaqf1	1199	28	virus	virus	NN
cord-014462-11ggaqf1	1199	29	,	,	,
cord-014462-11ggaqf1	1199	30	so	so	RB
cord-014462-11ggaqf1	1199	31	far	far	RB
cord-014462-11ggaqf1	1199	32	reported	report	VBN
cord-014462-11ggaqf1	1199	33	in	in	IN
cord-014462-11ggaqf1	1199	34	India	India	NNP
cord-014462-11ggaqf1	1200	1	i.e.	i.e.	FW
cord-014462-11ggaqf1	1200	2	tomato	tomato	NN
cord-014462-11ggaqf1	1200	3	leaf	leaf	NN
cord-014462-11ggaqf1	1200	4	curl	curl	NN
cord-014462-11ggaqf1	1200	5	New	New	NNP
cord-014462-11ggaqf1	1200	6	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1200	7	virus	virus	NN
cord-014462-11ggaqf1	1200	8	,	,	,
cord-014462-11ggaqf1	1200	9	tomato	tomato	NN
cord-014462-11ggaqf1	1200	10	leaf	leaf	NN
cord-014462-11ggaqf1	1200	11	curl	curl	NN
cord-014462-11ggaqf1	1200	12	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1200	13	virus	virus	NN
cord-014462-11ggaqf1	1200	14	,	,	,
cord-014462-11ggaqf1	1200	15	tomato	tomato	NN
cord-014462-11ggaqf1	1200	16	leaf	leaf	NN
cord-014462-11ggaqf1	1200	17	curl	curl	NN
cord-014462-11ggaqf1	1200	18	Banglore	Banglore	NNP
cord-014462-11ggaqf1	1200	19	virus	virus	NN
cord-014462-11ggaqf1	1200	20	,	,	,
cord-014462-11ggaqf1	1200	21	tomato	tomato	NN
cord-014462-11ggaqf1	1200	22	leaf	leaf	NN
cord-014462-11ggaqf1	1200	23	curl	curl	NN
cord-014462-11ggaqf1	1200	24	Karnataka	Karnataka	NNP
cord-014462-11ggaqf1	1200	25	virus	virus	NN
cord-014462-11ggaqf1	1200	26	and	and	CC
cord-014462-11ggaqf1	1200	27	tomato	tomato	NN
cord-014462-11ggaqf1	1200	28	leaf	leaf	NN
cord-014462-11ggaqf1	1200	29	curl	curl	NN
cord-014462-11ggaqf1	1200	30	Gujarat	Gujarat	NNP
cord-014462-11ggaqf1	1200	31	virus	virus	NN
cord-014462-11ggaqf1	1200	32	.	.	.
cord-014462-11ggaqf1	1201	1	Among	among	IN
cord-014462-11ggaqf1	1201	2	these	these	DT
cord-014462-11ggaqf1	1201	3	,	,	,
cord-014462-11ggaqf1	1201	4	only	only	RB
cord-014462-11ggaqf1	1201	5	tomato	tomato	NN
cord-014462-11ggaqf1	1201	6	leaf	leaf	NN
cord-014462-11ggaqf1	1201	7	curl	curl	NN
cord-014462-11ggaqf1	1201	8	New	New	NNP
cord-014462-11ggaqf1	1201	9	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1201	10	virus	virus	NN
cord-014462-11ggaqf1	1201	11	specific	specific	JJ
cord-014462-11ggaqf1	1201	12	primer	primer	NN
cord-014462-11ggaqf1	1201	13	was	be	VBD
cord-014462-11ggaqf1	1201	14	able	able	JJ
cord-014462-11ggaqf1	1201	15	to	to	TO
cord-014462-11ggaqf1	1201	16	give	give	VB
cord-014462-11ggaqf1	1201	17	the	the	DT
cord-014462-11ggaqf1	1201	18	desired	desire	VBN
cord-014462-11ggaqf1	1201	19	amplicon	amplicon	NN
cord-014462-11ggaqf1	1201	20	of	of	IN
cord-014462-11ggaqf1	1201	21	*	*	NFP
cord-014462-11ggaqf1	1201	22	1180	1180	CD
cord-014462-11ggaqf1	1201	23	bp	bp	NNP
cord-014462-11ggaqf1	1201	24	.	.	.
cord-014462-11ggaqf1	1202	1	Hence	hence	RB
cord-014462-11ggaqf1	1202	2	,	,	,
cord-014462-11ggaqf1	1202	3	it	-PRON-	PRP
cord-014462-11ggaqf1	1202	4	is	be	VBZ
cord-014462-11ggaqf1	1202	5	confirmed	confirm	VBN
cord-014462-11ggaqf1	1202	6	that	that	IN
cord-014462-11ggaqf1	1202	7	the	the	DT
cord-014462-11ggaqf1	1202	8	leaf	leaf	NN
cord-014462-11ggaqf1	1202	9	curl	curl	NN
cord-014462-11ggaqf1	1202	10	disease	disease	NN
cord-014462-11ggaqf1	1202	11	of	of	IN
cord-014462-11ggaqf1	1202	12	Petunia	Petunia	NNP
cord-014462-11ggaqf1	1202	13	hybrida	hybrida	NNP
cord-014462-11ggaqf1	1202	14	is	be	VBZ
cord-014462-11ggaqf1	1202	15	associated	associate	VBN
cord-014462-11ggaqf1	1202	16	with	with	IN
cord-014462-11ggaqf1	1202	17	tomato	tomato	NN
cord-014462-11ggaqf1	1202	18	leaf	leaf	NN
cord-014462-11ggaqf1	1202	19	curl	curl	NN
cord-014462-11ggaqf1	1202	20	New	New	NNP
cord-014462-11ggaqf1	1202	21	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1202	22	virus	virus	NN
cord-014462-11ggaqf1	1202	23	.	.	.
cord-014462-11ggaqf1	1203	1	This	this	DT
cord-014462-11ggaqf1	1203	2	disease	disease	NN
cord-014462-11ggaqf1	1203	3	of	of	IN
cord-014462-11ggaqf1	1203	4	petunia	petunia	NN
cord-014462-11ggaqf1	1203	5	can	can	MD
cord-014462-11ggaqf1	1203	6	become	become	VB
cord-014462-11ggaqf1	1203	7	a	a	DT
cord-014462-11ggaqf1	1203	8	sever	sever	NN
cord-014462-11ggaqf1	1203	9	production	production	NN
cord-014462-11ggaqf1	1203	10	constraint	constraint	NN
cord-014462-11ggaqf1	1203	11	in	in	IN
cord-014462-11ggaqf1	1203	12	coming	come	VBG
cord-014462-11ggaqf1	1203	13	years	year	NNS
cord-014462-11ggaqf1	1203	14	.	.	.
cord-014462-11ggaqf1	1204	1	From	from	IN
cord-014462-11ggaqf1	1204	2	last	last	JJ
cord-014462-11ggaqf1	1204	3	2	2	CD
cord-014462-11ggaqf1	1204	4	years	year	NNS
cord-014462-11ggaqf1	1204	5	(	(	-LRB-
cord-014462-11ggaqf1	1204	6	2008	2008	CD
cord-014462-11ggaqf1	1204	7	and	and	CC
cord-014462-11ggaqf1	1204	8	2009	2009	CD
cord-014462-11ggaqf1	1204	9	)	)	-RRB-
cord-014462-11ggaqf1	1204	10	it	-PRON-	PRP
cord-014462-11ggaqf1	1204	11	was	be	VBD
cord-014462-11ggaqf1	1204	12	observed	observe	VBN
cord-014462-11ggaqf1	1204	13	that	that	IN
cord-014462-11ggaqf1	1204	14	some	some	DT
cord-014462-11ggaqf1	1204	15	varieties	variety	NNS
cord-014462-11ggaqf1	1204	16	of	of	IN
cord-014462-11ggaqf1	1204	17	brinjal	brinjal	NN
cord-014462-11ggaqf1	1204	18	grown	grow	VBN
cord-014462-11ggaqf1	1204	19	in	in	IN
cord-014462-11ggaqf1	1204	20	rainy	rainy	JJ
cord-014462-11ggaqf1	1204	21	season	season	NN
cord-014462-11ggaqf1	1204	22	,	,	,
cord-014462-11ggaqf1	1204	23	showed	show	VBD
cord-014462-11ggaqf1	1204	24	typical	typical	JJ
cord-014462-11ggaqf1	1204	25	leaf	leaf	NN
cord-014462-11ggaqf1	1204	26	curl	curl	NN
cord-014462-11ggaqf1	1204	27	type	type	NN
cord-014462-11ggaqf1	1204	28	of	of	IN
cord-014462-11ggaqf1	1204	29	symptoms	symptom	NNS
cord-014462-11ggaqf1	1204	30	.	.	.
cord-014462-11ggaqf1	1205	1	The	the	DT
cord-014462-11ggaqf1	1205	2	symptoms	symptom	NNS
cord-014462-11ggaqf1	1205	3	include	include	VBP
cord-014462-11ggaqf1	1205	4	upward	upward	RB
cord-014462-11ggaqf1	1205	5	curling	curling	NN
cord-014462-11ggaqf1	1205	6	of	of	IN
cord-014462-11ggaqf1	1205	7	the	the	DT
cord-014462-11ggaqf1	1205	8	leaves	leave	NNS
cord-014462-11ggaqf1	1205	9	,	,	,
cord-014462-11ggaqf1	1205	10	cupping	cupping	NN
cord-014462-11ggaqf1	1205	11	,	,	,
cord-014462-11ggaqf1	1205	12	vein	vein	NN
cord-014462-11ggaqf1	1205	13	thickening	thickening	NN
cord-014462-11ggaqf1	1205	14	,	,	,
cord-014462-11ggaqf1	1205	15	reduction	reduction	NN
cord-014462-11ggaqf1	1205	16	in	in	IN
cord-014462-11ggaqf1	1205	17	leaf	leaf	NN
cord-014462-11ggaqf1	1205	18	size	size	NN
cord-014462-11ggaqf1	1205	19	and	and	CC
cord-014462-11ggaqf1	1205	20	distortion	distortion	NN
cord-014462-11ggaqf1	1205	21	of	of	IN
cord-014462-11ggaqf1	1205	22	leaves	leave	NNS
cord-014462-11ggaqf1	1205	23	.	.	.
cord-014462-11ggaqf1	1206	1	The	the	DT
cord-014462-11ggaqf1	1206	2	severely	severely	RB
cord-014462-11ggaqf1	1206	3	infected	infect	VBN
cord-014462-11ggaqf1	1206	4	plant	plant	NN
cord-014462-11ggaqf1	1206	5	remains	remain	VBZ
cord-014462-11ggaqf1	1206	6	stunted	stunted	JJ
cord-014462-11ggaqf1	1206	7	and	and	CC
cord-014462-11ggaqf1	1206	8	bushy	bushy	JJ
cord-014462-11ggaqf1	1206	9	,	,	,
cord-014462-11ggaqf1	1206	10	became	become	VBD
cord-014462-11ggaqf1	1206	11	unproductive	unproductive	JJ
cord-014462-11ggaqf1	1206	12	or	or	CC
cord-014462-11ggaqf1	1206	13	produces	produce	VBZ
cord-014462-11ggaqf1	1206	14	only	only	RB
cord-014462-11ggaqf1	1206	15	few	few	JJ
cord-014462-11ggaqf1	1206	16	fruits	fruit	NNS
cord-014462-11ggaqf1	1206	17	.	.	.
cord-014462-11ggaqf1	1207	1	The	the	DT
cord-014462-11ggaqf1	1207	2	disease	disease	NN
cord-014462-11ggaqf1	1207	3	was	be	VBD
cord-014462-11ggaqf1	1207	4	experimentally	experimentally	RB
cord-014462-11ggaqf1	1207	5	transmitted	transmit	VBN
cord-014462-11ggaqf1	1207	6	from	from	IN
cord-014462-11ggaqf1	1207	7	naturally	naturally	RB
cord-014462-11ggaqf1	1207	8	infected	infect	VBN
cord-014462-11ggaqf1	1207	9	brinjal	brinjal	NN
cord-014462-11ggaqf1	1207	10	to	to	IN
cord-014462-11ggaqf1	1207	11	healthy	healthy	JJ
cord-014462-11ggaqf1	1207	12	seedlings	seedling	NNS
cord-014462-11ggaqf1	1207	13	by	by	IN
cord-014462-11ggaqf1	1207	14	whiteflies	whitefly	NNS
cord-014462-11ggaqf1	1207	15	(	(	-LRB-
cord-014462-11ggaqf1	1207	16	Bemisia	Bemisia	NNP
cord-014462-11ggaqf1	1207	17	tabaci	tabaci	NNP
cord-014462-11ggaqf1	1207	18	)	)	-RRB-
cord-014462-11ggaqf1	1207	19	and	and	CC
cord-014462-11ggaqf1	1207	20	grafting	grafting	NN
cord-014462-11ggaqf1	1207	21	,	,	,
cord-014462-11ggaqf1	1207	22	but	but	CC
cord-014462-11ggaqf1	1207	23	not	not	RB
cord-014462-11ggaqf1	1207	24	by	by	IN
cord-014462-11ggaqf1	1207	25	mechanical	mechanical	JJ
cord-014462-11ggaqf1	1207	26	or	or	CC
cord-014462-11ggaqf1	1207	27	aphid	aphid	NN
cord-014462-11ggaqf1	1207	28	transmission	transmission	NN
cord-014462-11ggaqf1	1207	29	.	.	.
cord-014462-11ggaqf1	1208	1	To	to	TO
cord-014462-11ggaqf1	1208	2	detect	detect	VB
cord-014462-11ggaqf1	1208	3	the	the	DT
cord-014462-11ggaqf1	1208	4	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1208	5	associated	associate	VBN
cord-014462-11ggaqf1	1208	6	,	,	,
cord-014462-11ggaqf1	1208	7	total	total	JJ
cord-014462-11ggaqf1	1208	8	genomic	genomic	JJ
cord-014462-11ggaqf1	1208	9	DNA	dna	NN
cord-014462-11ggaqf1	1208	10	was	be	VBD
cord-014462-11ggaqf1	1208	11	extracted	extract	VBN
cord-014462-11ggaqf1	1208	12	from	from	IN
cord-014462-11ggaqf1	1208	13	the	the	DT
cord-014462-11ggaqf1	1208	14	plants	plant	NNS
cord-014462-11ggaqf1	1208	15	showing	show	VBG
cord-014462-11ggaqf1	1208	16	disease	disease	NN
cord-014462-11ggaqf1	1208	17	symptoms	symptom	NNS
cord-014462-11ggaqf1	1208	18	.	.	.
cord-014462-11ggaqf1	1209	1	The	the	DT
cord-014462-11ggaqf1	1209	2	presence	presence	NN
cord-014462-11ggaqf1	1209	3	of	of	IN
cord-014462-11ggaqf1	1209	4	virus	virus	NN
cord-014462-11ggaqf1	1209	5	was	be	VBD
cord-014462-11ggaqf1	1209	6	confirmed	confirm	VBN
cord-014462-11ggaqf1	1209	7	by	by	IN
cord-014462-11ggaqf1	1209	8	using	use	VBG
cord-014462-11ggaqf1	1209	9	PCR	PCR	NNP
cord-014462-11ggaqf1	1209	10	based	base	VBN
cord-014462-11ggaqf1	1209	11	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1209	12	geneus	geneus	NNP
cord-014462-11ggaqf1	1209	13	-	-	HYPH
cord-014462-11ggaqf1	1209	14	specific	specific	JJ
cord-014462-11ggaqf1	1209	15	primers	primer	NNS
cord-014462-11ggaqf1	1209	16	designed	design	VBN
cord-014462-11ggaqf1	1209	17	by	by	IN
cord-014462-11ggaqf1	1209	18	Deng	Deng	NNP
cord-014462-11ggaqf1	1209	19	et	et	NNP
cord-014462-11ggaqf1	1209	20	al	al	NNP
cord-014462-11ggaqf1	1209	21	.	.	.
cord-014462-11ggaqf1	1210	1	,	,	,
cord-014462-11ggaqf1	1210	2	Wyatt	Wyatt	NNP
cord-014462-11ggaqf1	1210	3	and	and	CC
cord-014462-11ggaqf1	1210	4	Brown	Brown	NNP
cord-014462-11ggaqf1	1210	5	and	and	CC
cord-014462-11ggaqf1	1210	6	Rojas	Rojas	NNP
cord-014462-11ggaqf1	1210	7	et	et	NNP
cord-014462-11ggaqf1	1210	8	al	al	NNP
cord-014462-11ggaqf1	1210	9	.	.	.
cord-014462-11ggaqf1	1211	1	These	these	DT
cord-014462-11ggaqf1	1211	2	degenerated	degenerate	VBN
cord-014462-11ggaqf1	1211	3	primers	primer	NNS
cord-014462-11ggaqf1	1211	4	give	give	VBP
cord-014462-11ggaqf1	1211	5	the	the	DT
cord-014462-11ggaqf1	1211	6	expected	expect	VBN
cord-014462-11ggaqf1	1211	7	product	product	NN
cord-014462-11ggaqf1	1211	8	size	size	NN
cord-014462-11ggaqf1	1211	9	of	of	IN
cord-014462-11ggaqf1	1211	10	*	*	NFP
cord-014462-11ggaqf1	1211	11	530	530	CD
cord-014462-11ggaqf1	1211	12	,	,	,
cord-014462-11ggaqf1	1212	1	*	*	NFP
cord-014462-11ggaqf1	1212	2	575	575	CD
cord-014462-11ggaqf1	1212	3	and	and	CC
cord-014462-11ggaqf1	1213	1	*	*	NFP
cord-014462-11ggaqf1	1213	2	1280	1280	CD
cord-014462-11ggaqf1	1213	3	bp	bp	NNP
cord-014462-11ggaqf1	1213	4	,	,	,
cord-014462-11ggaqf1	1213	5	respectively	respectively	RB
cord-014462-11ggaqf1	1213	6	.	.	.
cord-014462-11ggaqf1	1214	1	Core	core	NN
cord-014462-11ggaqf1	1214	2	coat	coat	NN
cord-014462-11ggaqf1	1214	3	protein	protein	NN
cord-014462-11ggaqf1	1214	4	(	(	-LRB-
cord-014462-11ggaqf1	1214	5	CP	CP	NNP
cord-014462-11ggaqf1	1214	6	)	)	-RRB-
cord-014462-11ggaqf1	1214	7	gene	gene	NN
cord-014462-11ggaqf1	1214	8	and	and	CC
cord-014462-11ggaqf1	1214	9	DNA	DNA	NNP
cord-014462-11ggaqf1	1214	10	-	-	HYPH
cord-014462-11ggaqf1	1214	11	b	b	NN
cord-014462-11ggaqf1	1214	12	was	be	VBD
cord-014462-11ggaqf1	1214	13	also	also	RB
cord-014462-11ggaqf1	1214	14	amplified	amplify	VBN
cord-014462-11ggaqf1	1214	15	in	in	IN
cord-014462-11ggaqf1	1214	16	the	the	DT
cord-014462-11ggaqf1	1214	17	samples	sample	NNS
cord-014462-11ggaqf1	1214	18	using	use	VBG
cord-014462-11ggaqf1	1214	19	specific	specific	JJ
cord-014462-11ggaqf1	1214	20	primers	primer	NNS
cord-014462-11ggaqf1	1214	21	.	.	.
cord-014462-11ggaqf1	1215	1	To	to	TO
cord-014462-11ggaqf1	1215	2	identify	identify	VB
cord-014462-11ggaqf1	1215	3	the	the	DT
cord-014462-11ggaqf1	1215	4	strain	strain	NN
cord-014462-11ggaqf1	1215	5	associated	associate	VBN
cord-014462-11ggaqf1	1215	6	with	with	IN
cord-014462-11ggaqf1	1215	7	leaf	leaf	NN
cord-014462-11ggaqf1	1215	8	curl	curl	NN
cord-014462-11ggaqf1	1215	9	virus	virus	NN
cord-014462-11ggaqf1	1215	10	,	,	,
cord-014462-11ggaqf1	1215	11	DNA	DNA	NNP
cord-014462-11ggaqf1	1215	12	was	be	VBD
cord-014462-11ggaqf1	1215	13	subjected	subject	VBN
cord-014462-11ggaqf1	1215	14	against	against	IN
cord-014462-11ggaqf1	1215	15	primers	primer	NNS
cord-014462-11ggaqf1	1215	16	of	of	IN
cord-014462-11ggaqf1	1215	17	different	different	JJ
cord-014462-11ggaqf1	1215	18	Indian	indian	JJ
cord-014462-11ggaqf1	1215	19	tomato	tomato	NN
cord-014462-11ggaqf1	1215	20	leaf	leaf	NN
cord-014462-11ggaqf1	1215	21	curl	curl	NN
cord-014462-11ggaqf1	1215	22	virus	virus	NN
cord-014462-11ggaqf1	1215	23	strain	strain	NN
cord-014462-11ggaqf1	1215	24	i.e.	i.e.	FW
cord-014462-11ggaqf1	1215	25	Tomato	tomato	NN
cord-014462-11ggaqf1	1215	26	leaf	leaf	NN
cord-014462-11ggaqf1	1215	27	curl	curl	NN
cord-014462-11ggaqf1	1215	28	New	New	NNP
cord-014462-11ggaqf1	1215	29	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1215	30	virus	virus	NN
cord-014462-11ggaqf1	1215	31	,	,	,
cord-014462-11ggaqf1	1215	32	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1215	33	leaf	leaf	NN
cord-014462-11ggaqf1	1215	34	curl	curl	NN
cord-014462-11ggaqf1	1215	35	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1215	36	virus	virus	NN
cord-014462-11ggaqf1	1215	37	,	,	,
cord-014462-11ggaqf1	1215	38	Tomato	tomato	NN
cord-014462-11ggaqf1	1215	39	leaf	leaf	NN
cord-014462-11ggaqf1	1215	40	curl	curl	NN
cord-014462-11ggaqf1	1215	41	Banglore	Banglore	NNP
cord-014462-11ggaqf1	1215	42	virus	virus	NN
cord-014462-11ggaqf1	1215	43	,	,	,
cord-014462-11ggaqf1	1215	44	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1215	45	leaf	leaf	NN
cord-014462-11ggaqf1	1215	46	curl	curl	NN
cord-014462-11ggaqf1	1215	47	Karnataka	Karnataka	NNP
cord-014462-11ggaqf1	1215	48	virus	virus	NN
cord-014462-11ggaqf1	1215	49	and	and	CC
cord-014462-11ggaqf1	1215	50	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1215	51	leaf	leaf	NN
cord-014462-11ggaqf1	1215	52	curl	curl	NN
cord-014462-11ggaqf1	1215	53	Gujarat	Gujarat	NNP
cord-014462-11ggaqf1	1215	54	virus	virus	NN
cord-014462-11ggaqf1	1215	55	,	,	,
cord-014462-11ggaqf1	1215	56	using	use	VBG
cord-014462-11ggaqf1	1215	57	PCR	PCR	NNP
cord-014462-11ggaqf1	1215	58	.	.	.
cord-014462-11ggaqf1	1216	1	Among	among	IN
cord-014462-11ggaqf1	1216	2	these	these	DT
cord-014462-11ggaqf1	1216	3	,	,	,
cord-014462-11ggaqf1	1216	4	only	only	RB
cord-014462-11ggaqf1	1216	5	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1216	6	leaf	leaf	NN
cord-014462-11ggaqf1	1216	7	curl	curl	NN
cord-014462-11ggaqf1	1216	8	New	New	NNP
cord-014462-11ggaqf1	1216	9	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1216	10	virus	virus	NN
cord-014462-11ggaqf1	1216	11	primer	primer	NN
cord-014462-11ggaqf1	1216	12	was	be	VBD
cord-014462-11ggaqf1	1216	13	able	able	JJ
cord-014462-11ggaqf1	1216	14	to	to	TO
cord-014462-11ggaqf1	1216	15	show	show	VB
cord-014462-11ggaqf1	1216	16	the	the	DT
cord-014462-11ggaqf1	1216	17	desired	desire	VBN
cord-014462-11ggaqf1	1216	18	product	product	NN
cord-014462-11ggaqf1	1216	19	size	size	NN
cord-014462-11ggaqf1	1216	20	of	of	IN
cord-014462-11ggaqf1	1216	21	*	*	NFP
cord-014462-11ggaqf1	1216	22	1180	1180	CD
cord-014462-11ggaqf1	1216	23	bp	bp	NNP
cord-014462-11ggaqf1	1216	24	.	.	.
cord-014462-11ggaqf1	1217	1	Therefore	therefore	RB
cord-014462-11ggaqf1	1217	2	,	,	,
cord-014462-11ggaqf1	1217	3	it	-PRON-	PRP
cord-014462-11ggaqf1	1217	4	was	be	VBD
cord-014462-11ggaqf1	1217	5	confirmed	confirm	VBN
cord-014462-11ggaqf1	1217	6	that	that	IN
cord-014462-11ggaqf1	1217	7	leaf	leaf	NN
cord-014462-11ggaqf1	1217	8	curl	curl	NN
cord-014462-11ggaqf1	1217	9	disease	disease	NN
cord-014462-11ggaqf1	1217	10	of	of	IN
cord-014462-11ggaqf1	1217	11	brinjal	brinjal	NNP
cord-014462-11ggaqf1	1217	12	is	be	VBZ
cord-014462-11ggaqf1	1217	13	caused	cause	VBN
cord-014462-11ggaqf1	1217	14	by	by	IN
cord-014462-11ggaqf1	1217	15	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1217	16	leaf	leaf	NN
cord-014462-11ggaqf1	1217	17	curl	curl	NN
cord-014462-11ggaqf1	1217	18	New	New	NNP
cord-014462-11ggaqf1	1217	19	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1217	20	virus	virus	NN
cord-014462-11ggaqf1	1217	21	in	in	IN
cord-014462-11ggaqf1	1217	22	association	association	NN
cord-014462-11ggaqf1	1217	23	with	with	IN
cord-014462-11ggaqf1	1217	24	satellite	satellite	NN
cord-014462-11ggaqf1	1217	25	b	b	NNP
cord-014462-11ggaqf1	1217	26	-	-	HYPH
cord-014462-11ggaqf1	1217	27	DNA	dna	NN
cord-014462-11ggaqf1	1217	28	.	.	.
cord-014462-11ggaqf1	1218	1	To	to	TO
cord-014462-11ggaqf1	1218	2	identify	identify	VB
cord-014462-11ggaqf1	1218	3	the	the	DT
cord-014462-11ggaqf1	1218	4	strain	strain	NN
cord-014462-11ggaqf1	1218	5	associated	associate	VBN
cord-014462-11ggaqf1	1218	6	with	with	IN
cord-014462-11ggaqf1	1218	7	the	the	DT
cord-014462-11ggaqf1	1218	8	disease	disease	NN
cord-014462-11ggaqf1	1218	9	,	,	,
cord-014462-11ggaqf1	1218	10	all	all	DT
cord-014462-11ggaqf1	1218	11	samples	sample	NNS
cord-014462-11ggaqf1	1218	12	were	be	VBD
cord-014462-11ggaqf1	1218	13	further	further	RB
cord-014462-11ggaqf1	1218	14	subjected	subject	VBN
cord-014462-11ggaqf1	1218	15	to	to	IN
cord-014462-11ggaqf1	1218	16	the	the	DT
cord-014462-11ggaqf1	1218	17	specific	specific	JJ
cord-014462-11ggaqf1	1218	18	primers	primer	NNS
cord-014462-11ggaqf1	1218	19	,	,	,
cord-014462-11ggaqf1	1218	20	designed	design	VBN
cord-014462-11ggaqf1	1218	21	to	to	TO
cord-014462-11ggaqf1	1218	22	amplify	amplify	VB
cord-014462-11ggaqf1	1218	23	all	all	PDT
cord-014462-11ggaqf1	1218	24	the	the	DT
cord-014462-11ggaqf1	1218	25	tomato	tomato	NN
cord-014462-11ggaqf1	1218	26	leaf	leaf	NN
cord-014462-11ggaqf1	1218	27	curl	curl	NN
cord-014462-11ggaqf1	1218	28	virus	virus	NN
cord-014462-11ggaqf1	1218	29	strains	strain	NNS
cord-014462-11ggaqf1	1218	30	,	,	,
cord-014462-11ggaqf1	1218	31	so	so	RB
cord-014462-11ggaqf1	1218	32	far	far	RB
cord-014462-11ggaqf1	1218	33	reported	report	VBN
cord-014462-11ggaqf1	1218	34	from	from	IN
cord-014462-11ggaqf1	1218	35	India	India	NNP
cord-014462-11ggaqf1	1219	1	i.e.	i.e.	FW
cord-014462-11ggaqf1	1219	2	tomato	tomato	NN
cord-014462-11ggaqf1	1219	3	leaf	leaf	NN
cord-014462-11ggaqf1	1219	4	curl	curl	NN
cord-014462-11ggaqf1	1219	5	New	New	NNP
cord-014462-11ggaqf1	1219	6	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1219	7	virus	virus	NN
cord-014462-11ggaqf1	1219	8	,	,	,
cord-014462-11ggaqf1	1219	9	tomato	tomato	NN
cord-014462-11ggaqf1	1219	10	leaf	leaf	NN
cord-014462-11ggaqf1	1219	11	curl	curl	NN
cord-014462-11ggaqf1	1219	12	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1219	13	virus	virus	NN
cord-014462-11ggaqf1	1219	14	,	,	,
cord-014462-11ggaqf1	1219	15	tomato	tomato	NN
cord-014462-11ggaqf1	1219	16	leaf	leaf	NN
cord-014462-11ggaqf1	1219	17	curl	curl	NN
cord-014462-11ggaqf1	1219	18	Banglore	Banglore	NNP
cord-014462-11ggaqf1	1219	19	virus	virus	NN
cord-014462-11ggaqf1	1219	20	,	,	,
cord-014462-11ggaqf1	1219	21	tomato	tomato	NN
cord-014462-11ggaqf1	1219	22	leaf	leaf	NN
cord-014462-11ggaqf1	1219	23	curl	curl	NN
cord-014462-11ggaqf1	1219	24	Karnataka	Karnataka	NNP
cord-014462-11ggaqf1	1219	25	virus	virus	NN
cord-014462-11ggaqf1	1219	26	and	and	CC
cord-014462-11ggaqf1	1219	27	tomato	tomato	NN
cord-014462-11ggaqf1	1219	28	leaf	leaf	NN
cord-014462-11ggaqf1	1219	29	curl	curl	NN
cord-014462-11ggaqf1	1219	30	Gujarat	Gujarat	NNP
cord-014462-11ggaqf1	1219	31	virus	virus	NN
cord-014462-11ggaqf1	1219	32	,	,	,
cord-014462-11ggaqf1	1219	33	using	use	VBG
cord-014462-11ggaqf1	1219	34	PCR	PCR	NNP
cord-014462-11ggaqf1	1219	35	.	.	.
cord-014462-11ggaqf1	1220	1	Among	among	IN
cord-014462-11ggaqf1	1220	2	these	these	DT
cord-014462-11ggaqf1	1220	3	,	,	,
cord-014462-11ggaqf1	1220	4	only	only	RB
cord-014462-11ggaqf1	1220	5	tomato	tomato	NN
cord-014462-11ggaqf1	1220	6	leaf	leaf	NN
cord-014462-11ggaqf1	1220	7	curl	curl	NN
cord-014462-11ggaqf1	1220	8	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1220	9	virus	virus	NN
cord-014462-11ggaqf1	1220	10	specific	specific	JJ
cord-014462-11ggaqf1	1220	11	primer	primer	NN
cord-014462-11ggaqf1	1220	12	was	be	VBD
cord-014462-11ggaqf1	1220	13	able	able	JJ
cord-014462-11ggaqf1	1220	14	to	to	TO
cord-014462-11ggaqf1	1220	15	give	give	VB
cord-014462-11ggaqf1	1220	16	the	the	DT
cord-014462-11ggaqf1	1220	17	expected	expect	VBN
cord-014462-11ggaqf1	1220	18	product	product	NN
cord-014462-11ggaqf1	1220	19	size	size	NN
cord-014462-11ggaqf1	1220	20	of	of	IN
cord-014462-11ggaqf1	1220	21	*	*	NFP
cord-014462-11ggaqf1	1220	22	900	900	CD
cord-014462-11ggaqf1	1220	23	bp	bp	NNP
cord-014462-11ggaqf1	1220	24	.	.	.
cord-014462-11ggaqf1	1221	1	This	this	DT
cord-014462-11ggaqf1	1221	2	shows	show	VBZ
cord-014462-11ggaqf1	1221	3	the	the	DT
cord-014462-11ggaqf1	1221	4	association	association	NNP
cord-014462-11ggaqf1	1221	5	of	of	IN
cord-014462-11ggaqf1	1221	6	tomato	tomato	NNP
cord-014462-11ggaqf1	1221	7	leaf	leaf	NN
cord-014462-11ggaqf1	1221	8	curl	curl	NN
cord-014462-11ggaqf1	1221	9	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1221	10	virus	virus	NN
cord-014462-11ggaqf1	1221	11	with	with	IN
cord-014462-11ggaqf1	1221	12	leaf	leaf	NN
cord-014462-11ggaqf1	1221	13	curl	curl	NN
cord-014462-11ggaqf1	1221	14	disease	disease	NN
cord-014462-11ggaqf1	1221	15	of	of	IN
cord-014462-11ggaqf1	1221	16	Calendula	Calendula	NNP
cord-014462-11ggaqf1	1221	17	and	and	CC
cord-014462-11ggaqf1	1221	18	Marigold	Marigold	NNP
cord-014462-11ggaqf1	1221	19	.	.	.
cord-014462-11ggaqf1	1222	1	Thus	thus	RB
cord-014462-11ggaqf1	1222	2	,	,	,
cord-014462-11ggaqf1	1222	3	Calendula	Calendula	NNP
cord-014462-11ggaqf1	1222	4	and	and	CC
cord-014462-11ggaqf1	1222	5	Marigold	Marigold	NNP
cord-014462-11ggaqf1	1222	6	can	can	MD
cord-014462-11ggaqf1	1222	7	act	act	VB
cord-014462-11ggaqf1	1222	8	as	as	IN
cord-014462-11ggaqf1	1222	9	a	a	DT
cord-014462-11ggaqf1	1222	10	reservoir	reservoir	NN
cord-014462-11ggaqf1	1222	11	for	for	IN
cord-014462-11ggaqf1	1222	12	the	the	DT
cord-014462-11ggaqf1	1222	13	tomato	tomato	NN
cord-014462-11ggaqf1	1222	14	leaf	leaf	NN
cord-014462-11ggaqf1	1222	15	curl	curl	NN
cord-014462-11ggaqf1	1222	16	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1222	17	virus	virus	NN
cord-014462-11ggaqf1	1222	18	and	and	CC
cord-014462-11ggaqf1	1222	19	may	may	MD
cord-014462-11ggaqf1	1222	20	cause	cause	VB
cord-014462-11ggaqf1	1222	21	severe	severe	JJ
cord-014462-11ggaqf1	1222	22	constrain	constrain	VB
cord-014462-11ggaqf1	1222	23	in	in	IN
cord-014462-11ggaqf1	1222	24	the	the	DT
cord-014462-11ggaqf1	1222	25	production	production	NN
cord-014462-11ggaqf1	1222	26	of	of	IN
cord-014462-11ggaqf1	1222	27	these	these	DT
cord-014462-11ggaqf1	1222	28	important	important	JJ
cord-014462-11ggaqf1	1222	29	ornamental	ornamental	JJ
cord-014462-11ggaqf1	1222	30	plants	plant	NNS
cord-014462-11ggaqf1	1222	31	.	.	.
cord-014462-11ggaqf1	1223	1	Groundnut	Groundnut	NNP
cord-014462-11ggaqf1	1223	2	bud	bud	NN
cord-014462-11ggaqf1	1223	3	necrosis	necrosis	NN
cord-014462-11ggaqf1	1223	4	virus	virus	NN
cord-014462-11ggaqf1	1223	5	(	(	-LRB-
cord-014462-11ggaqf1	1223	6	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1223	7	)	)	-RRB-
cord-014462-11ggaqf1	1223	8	belongs	belong	VBZ
cord-014462-11ggaqf1	1223	9	to	to	TO
cord-014462-11ggaqf1	1223	10	serogroup	serogroup	VB
cord-014462-11ggaqf1	1223	11	IV	IV	NNP
cord-014462-11ggaqf1	1223	12	of	of	IN
cord-014462-11ggaqf1	1223	13	the	the	DT
cord-014462-11ggaqf1	1223	14	genus	genus	NN
cord-014462-11ggaqf1	1224	1	Tospovirus	Tospovirus	NNP
cord-014462-11ggaqf1	1224	2	in	in	IN
cord-014462-11ggaqf1	1224	3	Bynayaviridae	Bynayaviridae	NNP
cord-014462-11ggaqf1	1224	4	family	family	NN
cord-014462-11ggaqf1	1224	5	and	and	CC
cord-014462-11ggaqf1	1224	6	infects	infect	VBZ
cord-014462-11ggaqf1	1224	7	several	several	JJ
cord-014462-11ggaqf1	1224	8	economically	economically	RB
cord-014462-11ggaqf1	1224	9	important	important	JJ
cord-014462-11ggaqf1	1224	10	crops	crop	NNS
cord-014462-11ggaqf1	1224	11	all	all	RB
cord-014462-11ggaqf1	1224	12	over	over	IN
cord-014462-11ggaqf1	1224	13	India	India	NNP
cord-014462-11ggaqf1	1224	14	.	.	.
cord-014462-11ggaqf1	1225	1	The	the	DT
cord-014462-11ggaqf1	1225	2	nucleocapsid	nucleocapsid	NN
cord-014462-11ggaqf1	1225	3	protein	protein	NN
cord-014462-11ggaqf1	1225	4	(	(	-LRB-
cord-014462-11ggaqf1	1225	5	NP	NP	NNP
cord-014462-11ggaqf1	1225	6	)	)	-RRB-
cord-014462-11ggaqf1	1225	7	encoded	encode	VBN
cord-014462-11ggaqf1	1225	8	by	by	IN
cord-014462-11ggaqf1	1225	9	the	the	DT
cord-014462-11ggaqf1	1225	10	small	small	JJ
cord-014462-11ggaqf1	1225	11	RNA	RNA	NNP
cord-014462-11ggaqf1	1225	12	of	of	IN
cord-014462-11ggaqf1	1225	13	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1225	14	encapsidates	encapsidate	VBZ
cord-014462-11ggaqf1	1225	15	the	the	DT
cord-014462-11ggaqf1	1225	16	viral	viral	JJ
cord-014462-11ggaqf1	1225	17	RNAs	rna	NNS
cord-014462-11ggaqf1	1225	18	.	.	.
cord-014462-11ggaqf1	1226	1	Apart	apart	RB
cord-014462-11ggaqf1	1226	2	from	from	IN
cord-014462-11ggaqf1	1226	3	this	this	DT
cord-014462-11ggaqf1	1226	4	structural	structural	JJ
cord-014462-11ggaqf1	1226	5	role	role	NN
cord-014462-11ggaqf1	1226	6	,	,	,
cord-014462-11ggaqf1	1226	7	the	the	DT
cord-014462-11ggaqf1	1226	8	NP	NP	NNP
cord-014462-11ggaqf1	1226	9	has	have	VBZ
cord-014462-11ggaqf1	1226	10	also	also	RB
cord-014462-11ggaqf1	1226	11	been	be	VBN
cord-014462-11ggaqf1	1226	12	implicated	implicate	VBN
cord-014462-11ggaqf1	1226	13	in	in	IN
cord-014462-11ggaqf1	1226	14	the	the	DT
cord-014462-11ggaqf1	1226	15	replication	replication	NN
cord-014462-11ggaqf1	1226	16	,	,	,
cord-014462-11ggaqf1	1226	17	transcription	transcription	NN
cord-014462-11ggaqf1	1226	18	,	,	,
cord-014462-11ggaqf1	1226	19	maturation	maturation	NN
cord-014462-11ggaqf1	1226	20	and	and	CC
cord-014462-11ggaqf1	1226	21	cell	cell	NN
cord-014462-11ggaqf1	1226	22	to	to	IN
cord-014462-11ggaqf1	1226	23	cell	cell	NN
cord-014462-11ggaqf1	1226	24	movement	movement	NN
cord-014462-11ggaqf1	1226	25	.	.	.
cord-014462-11ggaqf1	1227	1	With	with	IN
cord-014462-11ggaqf1	1227	2	a	a	DT
cord-014462-11ggaqf1	1227	3	view	view	NN
cord-014462-11ggaqf1	1227	4	to	to	TO
cord-014462-11ggaqf1	1227	5	study	study	VB
cord-014462-11ggaqf1	1227	6	the	the	DT
cord-014462-11ggaqf1	1227	7	structure	structure	NN
cord-014462-11ggaqf1	1227	8	and	and	CC
cord-014462-11ggaqf1	1227	9	function	function	NN
cord-014462-11ggaqf1	1227	10	,	,	,
cord-014462-11ggaqf1	1227	11	the	the	DT
cord-014462-11ggaqf1	1227	12	NP	NP	NNP
cord-014462-11ggaqf1	1227	13	of	of	IN
cord-014462-11ggaqf1	1227	14	GBNVtomato	GBNVtomato	NNP
cord-014462-11ggaqf1	1227	15	isolate	isolate	NN
cord-014462-11ggaqf1	1227	16	from	from	IN
cord-014462-11ggaqf1	1227	17	Karnataka	Karnataka	NNP
cord-014462-11ggaqf1	1227	18	was	be	VBD
cord-014462-11ggaqf1	1227	19	over	over	RB
cord-014462-11ggaqf1	1227	20	expressed	express	VBN
cord-014462-11ggaqf1	1227	21	in	in	IN
cord-014462-11ggaqf1	1227	22	E.	E.	NNP
cord-014462-11ggaqf1	1227	23	coli	coli	NNS
cord-014462-11ggaqf1	1227	24	and	and	CC
cord-014462-11ggaqf1	1227	25	purified	purify	VBN
cord-014462-11ggaqf1	1227	26	by	by	IN
cord-014462-11ggaqf1	1227	27	Ni	Ni	NNP
cord-014462-11ggaqf1	1227	28	-	-	HYPH
cord-014462-11ggaqf1	1227	29	NTA	NTA	NNP
cord-014462-11ggaqf1	1227	30	chromatography	chromatography	NN
cord-014462-11ggaqf1	1227	31	.	.	.
cord-014462-11ggaqf1	1228	1	The	the	DT
cord-014462-11ggaqf1	1228	2	purified	purify	VBN
cord-014462-11ggaqf1	1228	3	NP	NP	NNP
cord-014462-11ggaqf1	1228	4	was	be	VBD
cord-014462-11ggaqf1	1228	5	present	present	JJ
cord-014462-11ggaqf1	1228	6	as	as	IN
cord-014462-11ggaqf1	1228	7	ribonucleoprotein	ribonucleoprotein	NN
cord-014462-11ggaqf1	1228	8	complex	complex	NN
cord-014462-11ggaqf1	1228	9	and	and	CC
cord-014462-11ggaqf1	1228	10	as	as	RB
cord-014462-11ggaqf1	1228	11	heterogeneous	heterogeneous	JJ
cord-014462-11ggaqf1	1228	12	mixture	mixture	NN
cord-014462-11ggaqf1	1228	13	containing	contain	VBG
cord-014462-11ggaqf1	1228	14	monomers	monomer	NNS
cord-014462-11ggaqf1	1228	15	,	,	,
cord-014462-11ggaqf1	1228	16	tetramers	tetramer	NNS
cord-014462-11ggaqf1	1228	17	and	and	CC
cord-014462-11ggaqf1	1228	18	higher	high	JJR
cord-014462-11ggaqf1	1228	19	order	order	NN
cord-014462-11ggaqf1	1228	20	multimers	multimer	NNS
cord-014462-11ggaqf1	1228	21	.	.	.
cord-014462-11ggaqf1	1229	1	In	in	IN
cord-014462-11ggaqf1	1229	2	order	order	NN
cord-014462-11ggaqf1	1229	3	to	to	TO
cord-014462-11ggaqf1	1229	4	determine	determine	VB
cord-014462-11ggaqf1	1229	5	the	the	DT
cord-014462-11ggaqf1	1229	6	regions	region	NNS
cord-014462-11ggaqf1	1229	7	involved	involve	VBN
cord-014462-11ggaqf1	1229	8	in	in	IN
cord-014462-11ggaqf1	1229	9	oligomerization	oligomerization	NN
cord-014462-11ggaqf1	1229	10	and	and	CC
cord-014462-11ggaqf1	1229	11	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1229	12	acid	acid	NN
cord-014462-11ggaqf1	1229	13	binding	bind	VBG
cord-014462-11ggaqf1	1229	14	,	,	,
cord-014462-11ggaqf1	1229	15	mutational	mutational	JJ
cord-014462-11ggaqf1	1229	16	approach	approach	NN
cord-014462-11ggaqf1	1229	17	was	be	VBD
cord-014462-11ggaqf1	1229	18	taken	take	VBN
cord-014462-11ggaqf1	1229	19	.	.	.
cord-014462-11ggaqf1	1230	1	N	n	CD
cord-014462-11ggaqf1	1230	2	-	-	:
cord-014462-11ggaqf1	1230	3	and	and	CC
cord-014462-11ggaqf1	1230	4	C	c	NN
cord-014462-11ggaqf1	1230	5	-	-	HYPH
cord-014462-11ggaqf1	1230	6	terminal	terminal	NN
cord-014462-11ggaqf1	1230	7	deletion	deletion	NN
cord-014462-11ggaqf1	1230	8	clones	clone	NNS
cord-014462-11ggaqf1	1230	9	were	be	VBD
cord-014462-11ggaqf1	1230	10	generated	generate	VBN
cord-014462-11ggaqf1	1230	11	(	(	-LRB-
cord-014462-11ggaqf1	1230	12	N20NP	n20np	UH
cord-014462-11ggaqf1	1230	13	,	,	,
cord-014462-11ggaqf1	1230	14	N40NP	n40np	PRP
cord-014462-11ggaqf1	1230	15	,	,	,
cord-014462-11ggaqf1	1230	16	C15NP	C15NP	NNP
cord-014462-11ggaqf1	1230	17	and	and	CC
cord-014462-11ggaqf1	1230	18	C37NP	C37NP	NNP
cord-014462-11ggaqf1	1230	19	)	)	-RRB-
cord-014462-11ggaqf1	1230	20	,	,	,
cord-014462-11ggaqf1	1230	21	over	over	IN
cord-014462-11ggaqf1	1230	22	expressed	express	VBN
cord-014462-11ggaqf1	1230	23	in	in	IN
cord-014462-11ggaqf1	1230	24	E.	E.	NNP
cord-014462-11ggaqf1	1230	25	coli	coli	NNS
cord-014462-11ggaqf1	1230	26	,	,	,
cord-014462-11ggaqf1	1230	27	and	and	CC
cord-014462-11ggaqf1	1230	28	were	be	VBD
cord-014462-11ggaqf1	1230	29	purified	purify	VBN
cord-014462-11ggaqf1	1230	30	by	by	IN
cord-014462-11ggaqf1	1230	31	a	a	DT
cord-014462-11ggaqf1	1230	32	procedure	procedure	NN
cord-014462-11ggaqf1	1230	33	identical	identical	JJ
cord-014462-11ggaqf1	1230	34	to	to	IN
cord-014462-11ggaqf1	1230	35	that	that	DT
cord-014462-11ggaqf1	1230	36	used	use	VBN
cord-014462-11ggaqf1	1230	37	for	for	IN
cord-014462-11ggaqf1	1230	38	the	the	DT
cord-014462-11ggaqf1	1230	39	wild	wild	JJ
cord-014462-11ggaqf1	1230	40	type	type	NN
cord-014462-11ggaqf1	1230	41	protein	protein	NN
cord-014462-11ggaqf1	1230	42	.	.	.
cord-014462-11ggaqf1	1231	1	Initial	initial	JJ
cord-014462-11ggaqf1	1231	2	studies	study	NNS
cord-014462-11ggaqf1	1231	3	on	on	IN
cord-014462-11ggaqf1	1231	4	oligomeric	oligomeric	JJ
cord-014462-11ggaqf1	1231	5	status	status	NN
cord-014462-11ggaqf1	1231	6	suggested	suggest	VBD
cord-014462-11ggaqf1	1231	7	that	that	IN
cord-014462-11ggaqf1	1231	8	in	in	IN
cord-014462-11ggaqf1	1231	9	addition	addition	NN
cord-014462-11ggaqf1	1231	10	to	to	IN
cord-014462-11ggaqf1	1231	11	N	n	CD
cord-014462-11ggaqf1	1231	12	-	-	:
cord-014462-11ggaqf1	1231	13	and	and	CC
cord-014462-11ggaqf1	1231	14	C	c	NN
cord-014462-11ggaqf1	1231	15	-	-	HYPH
cord-014462-11ggaqf1	1231	16	terminal	terminal	NN
cord-014462-11ggaqf1	1231	17	regions	region	NNS
cord-014462-11ggaqf1	1231	18	there	there	RB
cord-014462-11ggaqf1	1231	19	may	may	MD
cord-014462-11ggaqf1	1231	20	be	be	VB
cord-014462-11ggaqf1	1231	21	additional	additional	JJ
cord-014462-11ggaqf1	1231	22	regions	region	NNS
cord-014462-11ggaqf1	1231	23	or	or	CC
cord-014462-11ggaqf1	1231	24	residues	residue	NNS
cord-014462-11ggaqf1	1231	25	which	which	WDT
cord-014462-11ggaqf1	1231	26	contribute	contribute	VBP
cord-014462-11ggaqf1	1231	27	to	to	IN
cord-014462-11ggaqf1	1231	28	multimerization	multimerization	NN
cord-014462-11ggaqf1	1231	29	of	of	IN
cord-014462-11ggaqf1	1231	30	NP	NP	NNP
cord-014462-11ggaqf1	1231	31	.	.	.
cord-014462-11ggaqf1	1232	1	The	the	DT
cord-014462-11ggaqf1	1232	2	amount	amount	NN
cord-014462-11ggaqf1	1232	3	of	of	IN
cord-014462-11ggaqf1	1232	4	RNA	RNA	NNP
cord-014462-11ggaqf1	1232	5	bound	bind	VBN
cord-014462-11ggaqf1	1232	6	to	to	IN
cord-014462-11ggaqf1	1232	7	the	the	DT
cord-014462-11ggaqf1	1232	8	truncated	truncated	JJ
cord-014462-11ggaqf1	1232	9	proteins	protein	NNS
cord-014462-11ggaqf1	1232	10	was	be	VBD
cord-014462-11ggaqf1	1232	11	reduced	reduce	VBN
cord-014462-11ggaqf1	1232	12	in	in	IN
cord-014462-11ggaqf1	1232	13	case	case	NN
cord-014462-11ggaqf1	1232	14	of	of	IN
cord-014462-11ggaqf1	1232	15	N20NP	N20NP	NNP
cord-014462-11ggaqf1	1232	16	,	,	,
cord-014462-11ggaqf1	1232	17	N40NP	n40np	PRP
cord-014462-11ggaqf1	1232	18	and	and	CC
cord-014462-11ggaqf1	1232	19	C15NP	C15NP	NNP
cord-014462-11ggaqf1	1232	20	.	.	.
cord-014462-11ggaqf1	1233	1	Interestingly	interestingly	RB
cord-014462-11ggaqf1	1233	2	removal	removal	NN
cord-014462-11ggaqf1	1233	3	of	of	IN
cord-014462-11ggaqf1	1233	4	37	37	CD
cord-014462-11ggaqf1	1233	5	amino	amino	NN
cord-014462-11ggaqf1	1233	6	acid	acid	NN
cord-014462-11ggaqf1	1233	7	residues	residue	NNS
cord-014462-11ggaqf1	1233	8	(	(	-LRB-
cord-014462-11ggaqf1	1233	9	natively	natively	RB
cord-014462-11ggaqf1	1233	10	unfolded	unfold	VBN
cord-014462-11ggaqf1	1233	11	region	region	NN
cord-014462-11ggaqf1	1233	12	)	)	-RRB-
cord-014462-11ggaqf1	1233	13	from	from	IN
cord-014462-11ggaqf1	1233	14	the	the	DT
cord-014462-11ggaqf1	1233	15	C	C	NNP
cord-014462-11ggaqf1	1233	16	terminus	terminus	NN
cord-014462-11ggaqf1	1233	17	resulted	result	VBD
cord-014462-11ggaqf1	1233	18	in	in	IN
cord-014462-11ggaqf1	1233	19	complete	complete	JJ
cord-014462-11ggaqf1	1233	20	loss	loss	NN
cord-014462-11ggaqf1	1233	21	of	of	IN
cord-014462-11ggaqf1	1233	22	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1233	23	acid	acid	NN
cord-014462-11ggaqf1	1233	24	binding	binding	NN
cord-014462-11ggaqf1	1233	25	suggesting	suggest	VBG
cord-014462-11ggaqf1	1233	26	that	that	IN
cord-014462-11ggaqf1	1233	27	the	the	DT
cord-014462-11ggaqf1	1233	28	RNA	RNA	NNP
cord-014462-11ggaqf1	1233	29	binding	binding	NN
cord-014462-11ggaqf1	1233	30	domain	domain	NN
cord-014462-11ggaqf1	1233	31	was	be	VBD
cord-014462-11ggaqf1	1233	32	located	locate	VBN
cord-014462-11ggaqf1	1233	33	in	in	IN
cord-014462-11ggaqf1	1233	34	C	c	NN
cord-014462-11ggaqf1	1233	35	-	-	HYPH
cord-014462-11ggaqf1	1233	36	terminal	terminal	NN
cord-014462-11ggaqf1	1233	37	region	region	NN
cord-014462-11ggaqf1	1233	38	of	of	IN
cord-014462-11ggaqf1	1233	39	NP	NP	NNP
cord-014462-11ggaqf1	1233	40	.	.	.
cord-014462-11ggaqf1	1234	1	Further	further	JJ
cord-014462-11ggaqf1	1234	2	NP	NP	NNP
cord-014462-11ggaqf1	1234	3	was	be	VBD
cord-014462-11ggaqf1	1234	4	observed	observe	VBN
cord-014462-11ggaqf1	1234	5	to	to	TO
cord-014462-11ggaqf1	1234	6	get	get	VB
cord-014462-11ggaqf1	1234	7	phosphorylated	phosphorylate	VBN
cord-014462-11ggaqf1	1234	8	in	in	IN
cord-014462-11ggaqf1	1234	9	in	in	IN
cord-014462-11ggaqf1	1234	10	vitro	vitro	FW
cord-014462-11ggaqf1	1234	11	kinase	kinase	NN
cord-014462-11ggaqf1	1234	12	assays	assay	NNS
cord-014462-11ggaqf1	1234	13	by	by	IN
cord-014462-11ggaqf1	1234	14	a	a	DT
cord-014462-11ggaqf1	1234	15	kinase	kinase	NN
cord-014462-11ggaqf1	1234	16	present	present	JJ
cord-014462-11ggaqf1	1234	17	in	in	IN
cord-014462-11ggaqf1	1234	18	the	the	DT
cord-014462-11ggaqf1	1234	19	soluble	soluble	JJ
cord-014462-11ggaqf1	1234	20	fraction	fraction	NN
cord-014462-11ggaqf1	1234	21	of	of	IN
cord-014462-11ggaqf1	1234	22	tobacco	tobacco	NN
cord-014462-11ggaqf1	1234	23	plant	plant	NN
cord-014462-11ggaqf1	1234	24	sap	sap	NNP
cord-014462-11ggaqf1	1234	25	.	.	.
cord-014462-11ggaqf1	1235	1	Both	both	DT
cord-014462-11ggaqf1	1235	2	ATP	ATP	NNP
cord-014462-11ggaqf1	1235	3	and	and	CC
cord-014462-11ggaqf1	1235	4	GTP	GTP	NNP
cord-014462-11ggaqf1	1235	5	were	be	VBD
cord-014462-11ggaqf1	1235	6	utilized	utilize	VBN
cord-014462-11ggaqf1	1235	7	as	as	IN
cord-014462-11ggaqf1	1235	8	phosporyl	phosporyl	NN
cord-014462-11ggaqf1	1235	9	donors	donor	NNS
cord-014462-11ggaqf1	1235	10	and	and	CC
cord-014462-11ggaqf1	1235	11	Mn	Mn	NNP
cord-014462-11ggaqf1	1235	12	2	2	CD
cord-014462-11ggaqf1	1235	13	?	?	.
cord-014462-11ggaqf1	1236	1	was	be	VBD
cord-014462-11ggaqf1	1236	2	the	the	DT
cord-014462-11ggaqf1	1236	3	preferred	preferred	JJ
cord-014462-11ggaqf1	1236	4	metal	metal	NN
cord-014462-11ggaqf1	1236	5	ion	ion	NN
cord-014462-11ggaqf1	1236	6	which	which	WDT
cord-014462-11ggaqf1	1236	7	suggests	suggest	VBZ
cord-014462-11ggaqf1	1236	8	that	that	IN
cord-014462-11ggaqf1	1236	9	NP	NP	NNP
cord-014462-11ggaqf1	1236	10	might	may	MD
cord-014462-11ggaqf1	1236	11	be	be	VB
cord-014462-11ggaqf1	1236	12	phosphorylated	phosphorylate	VBN
cord-014462-11ggaqf1	1236	13	by	by	IN
cord-014462-11ggaqf1	1236	14	a	a	DT
cord-014462-11ggaqf1	1236	15	CK2-like	ck2-like	NN
cord-014462-11ggaqf1	1236	16	protein	protein	NN
cord-014462-11ggaqf1	1236	17	kinase	kinase	NN
cord-014462-11ggaqf1	1236	18	.	.	.
cord-014462-11ggaqf1	1237	1	Phosphorylation	Phosphorylation	NNP
cord-014462-11ggaqf1	1237	2	studies	study	NNS
cord-014462-11ggaqf1	1237	3	with	with	IN
cord-014462-11ggaqf1	1237	4	N	n	CD
cord-014462-11ggaqf1	1237	5	-	-	:
cord-014462-11ggaqf1	1237	6	and	and	CC
cord-014462-11ggaqf1	1237	7	C	C	NNP
cord-014462-11ggaqf1	1237	8	-	-	HYPH
cord-014462-11ggaqf1	1237	9	terminal	terminal	NN
cord-014462-11ggaqf1	1237	10	truncated	truncated	JJ
cord-014462-11ggaqf1	1237	11	proteins	protein	NNS
cord-014462-11ggaqf1	1237	12	revealed	reveal	VBD
cord-014462-11ggaqf1	1237	13	that	that	IN
cord-014462-11ggaqf1	1237	14	the	the	DT
cord-014462-11ggaqf1	1237	15	site	site	NN
cord-014462-11ggaqf1	1237	16	of	of	IN
cord-014462-11ggaqf1	1237	17	phosphorylation	phosphorylation	NN
cord-014462-11ggaqf1	1237	18	lies	lie	NNS
cord-014462-11ggaqf1	1237	19	within	within	IN
cord-014462-11ggaqf1	1237	20	the	the	DT
cord-014462-11ggaqf1	1237	21	amino	amino	NN
cord-014462-11ggaqf1	1237	22	acid	acid	NN
cord-014462-11ggaqf1	1237	23	residues	residue	NNS
cord-014462-11ggaqf1	1237	24	40	40	CD
cord-014462-11ggaqf1	1237	25	-	-	SYM
cord-014462-11ggaqf1	1237	26	239	239	CD
cord-014462-11ggaqf1	1237	27	.	.	.
cord-014462-11ggaqf1	1238	1	By	by	IN
cord-014462-11ggaqf1	1238	2	Mass	Mass	NNP
cord-014462-11ggaqf1	1238	3	spectrometric	spectrometric	JJ
cord-014462-11ggaqf1	1238	4	analysis	analysis	NN
cord-014462-11ggaqf1	1238	5	of	of	IN
cord-014462-11ggaqf1	1238	6	the	the	DT
cord-014462-11ggaqf1	1238	7	protein	protein	NN
cord-014462-11ggaqf1	1238	8	Threonine-84	Threonine-84	NNS
cord-014462-11ggaqf1	1238	9	and	and	CC
cord-014462-11ggaqf1	1238	10	Serine-202	Serine-202	NNP
cord-014462-11ggaqf1	1238	11	were	be	VBD
cord-014462-11ggaqf1	1238	12	identified	identify	VBN
cord-014462-11ggaqf1	1238	13	as	as	IN
cord-014462-11ggaqf1	1238	14	possible	possible	JJ
cord-014462-11ggaqf1	1238	15	phosphorylation	phosphorylation	NN
cord-014462-11ggaqf1	1238	16	sites	site	NNS
cord-014462-11ggaqf1	1238	17	.	.	.
cord-014462-11ggaqf1	1239	1	A	a	DT
cord-014462-11ggaqf1	1239	2	naturally	naturally	RB
cord-014462-11ggaqf1	1239	3	occurring	occur	VBG
cord-014462-11ggaqf1	1239	4	isolate	isolate	NN
cord-014462-11ggaqf1	1239	5	of	of	IN
cord-014462-11ggaqf1	1239	6	virus	virus	NN
cord-014462-11ggaqf1	1239	7	infecting	infect	VBG
cord-014462-11ggaqf1	1239	8	Gherkin	Gherkin	NNP
cord-014462-11ggaqf1	1239	9	(	(	-LRB-
cord-014462-11ggaqf1	1239	10	Cucumis	Cucumis	NNP
cord-014462-11ggaqf1	1239	11	anguira	anguira	NNP
cord-014462-11ggaqf1	1239	12	L.	L.	NNP
cord-014462-11ggaqf1	1239	13	)	)	-RRB-
cord-014462-11ggaqf1	1239	14	showing	show	VBG
cord-014462-11ggaqf1	1239	15	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1239	16	symptoms	symptom	NNS
cord-014462-11ggaqf1	1239	17	of	of	IN
cord-014462-11ggaqf1	1239	18	mosaic	mosaic	NN
cord-014462-11ggaqf1	1239	19	,	,	,
cord-014462-11ggaqf1	1239	20	leaf	leaf	NN
cord-014462-11ggaqf1	1239	21	distortion	distortion	NN
cord-014462-11ggaqf1	1239	22	and	and	CC
cord-014462-11ggaqf1	1239	23	dark	dark	JJ
cord-014462-11ggaqf1	1239	24	green	green	JJ
cord-014462-11ggaqf1	1239	25	islands	island	NNS
cord-014462-11ggaqf1	1239	26	in	in	IN
cord-014462-11ggaqf1	1239	27	the	the	DT
cord-014462-11ggaqf1	1239	28	lamina	lamina	NN
cord-014462-11ggaqf1	1239	29	was	be	VBD
cord-014462-11ggaqf1	1239	30	identified	identify	VBN
cord-014462-11ggaqf1	1239	31	in	in	IN
cord-014462-11ggaqf1	1239	32	the	the	DT
cord-014462-11ggaqf1	1239	33	export	export	NN
cord-014462-11ggaqf1	1239	34	cultivars	cultivar	NNS
cord-014462-11ggaqf1	1239	35	of	of	IN
cord-014462-11ggaqf1	1239	36	gherkin	gherkin	NN
cord-014462-11ggaqf1	1239	37	grown	grow	VBN
cord-014462-11ggaqf1	1239	38	in	in	IN
cord-014462-11ggaqf1	1239	39	commercial	commercial	JJ
cord-014462-11ggaqf1	1239	40	fields	field	NNS
cord-014462-11ggaqf1	1239	41	of	of	IN
cord-014462-11ggaqf1	1239	42	Kuppam	Kuppam	NNP
cord-014462-11ggaqf1	1239	43	rural	rural	NN
cord-014462-11ggaqf1	1239	44	,	,	,
cord-014462-11ggaqf1	1239	45	Chittoor	Chittoor	NNP
cord-014462-11ggaqf1	1239	46	District	District	NNP
cord-014462-11ggaqf1	1239	47	,	,	,
cord-014462-11ggaqf1	1239	48	Andhra	Andhra	NNP
cord-014462-11ggaqf1	1239	49	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1239	50	.	.	.
cord-014462-11ggaqf1	1240	1	The	the	DT
cord-014462-11ggaqf1	1240	2	virus	virus	NN
cord-014462-11ggaqf1	1240	3	infection	infection	NN
cord-014462-11ggaqf1	1240	4	was	be	VBD
cord-014462-11ggaqf1	1240	5	deadly	deadly	JJ
cord-014462-11ggaqf1	1240	6	prevalent	prevalent	JJ
cord-014462-11ggaqf1	1240	7	among	among	IN
cord-014462-11ggaqf1	1240	8	the	the	DT
cord-014462-11ggaqf1	1240	9	field	field	NN
cord-014462-11ggaqf1	1240	10	that	that	WDT
cord-014462-11ggaqf1	1240	11	caused	cause	VBD
cord-014462-11ggaqf1	1240	12	a	a	DT
cord-014462-11ggaqf1	1240	13	lot	lot	NN
cord-014462-11ggaqf1	1240	14	of	of	IN
cord-014462-11ggaqf1	1240	15	economic	economic	JJ
cord-014462-11ggaqf1	1240	16	damage	damage	NN
cord-014462-11ggaqf1	1240	17	to	to	IN
cord-014462-11ggaqf1	1240	18	the	the	DT
cord-014462-11ggaqf1	1240	19	crop	crop	NN
cord-014462-11ggaqf1	1240	20	that	that	WDT
cord-014462-11ggaqf1	1240	21	resulted	result	VBD
cord-014462-11ggaqf1	1240	22	in	in	IN
cord-014462-11ggaqf1	1240	23	yield	yield	NN
cord-014462-11ggaqf1	1240	24	losses	loss	NNS
cord-014462-11ggaqf1	1240	25	and	and	CC
cord-014462-11ggaqf1	1240	26	reduced	reduce	VBN
cord-014462-11ggaqf1	1240	27	quality	quality	NN
cord-014462-11ggaqf1	1240	28	of	of	IN
cord-014462-11ggaqf1	1240	29	fruits	fruit	NNS
cord-014462-11ggaqf1	1240	30	meant	mean	VBN
cord-014462-11ggaqf1	1240	31	for	for	IN
cord-014462-11ggaqf1	1240	32	export	export	NN
cord-014462-11ggaqf1	1240	33	.	.	.
cord-014462-11ggaqf1	1241	1	Symptoms	symptom	NNS
cord-014462-11ggaqf1	1241	2	of	of	IN
cord-014462-11ggaqf1	1241	3	the	the	DT
cord-014462-11ggaqf1	1241	4	infected	infect	VBN
cord-014462-11ggaqf1	1241	5	fruit	fruit	NN
cord-014462-11ggaqf1	1241	6	included	include	VBD
cord-014462-11ggaqf1	1241	7	blistering	blistering	NN
cord-014462-11ggaqf1	1241	8	and	and	CC
cord-014462-11ggaqf1	1241	9	malformation	malformation	NN
cord-014462-11ggaqf1	1241	10	of	of	IN
cord-014462-11ggaqf1	1241	11	the	the	DT
cord-014462-11ggaqf1	1241	12	fruit	fruit	NN
cord-014462-11ggaqf1	1241	13	.	.	.
cord-014462-11ggaqf1	1242	1	The	the	DT
cord-014462-11ggaqf1	1242	2	virus	virus	NN
cord-014462-11ggaqf1	1242	3	infected	infect	VBN
cord-014462-11ggaqf1	1242	4	leaf	leaf	NN
cord-014462-11ggaqf1	1242	5	samples	sample	NNS
cord-014462-11ggaqf1	1242	6	were	be	VBD
cord-014462-11ggaqf1	1242	7	collected	collect	VBN
cord-014462-11ggaqf1	1242	8	and	and	CC
cord-014462-11ggaqf1	1242	9	initial	initial	JJ
cord-014462-11ggaqf1	1242	10	host	host	NN
cord-014462-11ggaqf1	1242	11	range	range	NN
cord-014462-11ggaqf1	1242	12	tests	test	NNS
cord-014462-11ggaqf1	1242	13	were	be	VBD
cord-014462-11ggaqf1	1242	14	conducted	conduct	VBN
cord-014462-11ggaqf1	1242	15	with	with	IN
cord-014462-11ggaqf1	1242	16	different	different	JJ
cord-014462-11ggaqf1	1242	17	cucurbit	cucurbit	NN
cord-014462-11ggaqf1	1242	18	species	specie	NNS
cord-014462-11ggaqf1	1242	19	showed	show	VBD
cord-014462-11ggaqf1	1242	20	that	that	IN
cord-014462-11ggaqf1	1242	21	the	the	DT
cord-014462-11ggaqf1	1242	22	host	host	NN
cord-014462-11ggaqf1	1242	23	range	range	NN
cord-014462-11ggaqf1	1242	24	include	include	VBP
cord-014462-11ggaqf1	1242	25	propagation	propagation	NN
cord-014462-11ggaqf1	1242	26	hosts	host	NNS
cord-014462-11ggaqf1	1242	27	like	like	IN
cord-014462-11ggaqf1	1242	28	Cucumis	Cucumis	NNP
cord-014462-11ggaqf1	1242	29	anguira	anguira	NNP
cord-014462-11ggaqf1	1242	30	(	(	-LRB-
cord-014462-11ggaqf1	1242	31	Gherkin	Gherkin	NNP
cord-014462-11ggaqf1	1242	32	)	)	-RRB-
cord-014462-11ggaqf1	1242	33	,	,	,
cord-014462-11ggaqf1	1242	34	Cucumis	Cucumis	NNP
cord-014462-11ggaqf1	1242	35	sativus	sativus	NN
cord-014462-11ggaqf1	1242	36	,	,	,
cord-014462-11ggaqf1	1242	37	Cucurbita	Cucurbita	NNP
cord-014462-11ggaqf1	1242	38	pepo	pepo	NN
cord-014462-11ggaqf1	1242	39	,	,	,
cord-014462-11ggaqf1	1242	40	Cucumis	Cucumis	NNP
cord-014462-11ggaqf1	1242	41	melo	melo	NNP
cord-014462-11ggaqf1	1242	42	,	,	,
cord-014462-11ggaqf1	1242	43	Langeneria	Langeneria	NNP
cord-014462-11ggaqf1	1242	44	vulgaris	vulgaris	NN
cord-014462-11ggaqf1	1242	45	,	,	,
cord-014462-11ggaqf1	1242	46	Momordica	Momordica	NNP
cord-014462-11ggaqf1	1242	47	charantia	charantia	NN
cord-014462-11ggaqf1	1242	48	and	and	CC
cord-014462-11ggaqf1	1242	49	local	local	JJ
cord-014462-11ggaqf1	1242	50	assay	assay	NN
cord-014462-11ggaqf1	1242	51	host	host	NN
cord-014462-11ggaqf1	1242	52	like	like	IN
cord-014462-11ggaqf1	1242	53	Chenopodium	Chenopodium	NNP
cord-014462-11ggaqf1	1242	54	amaranticolor	amaranticolor	NNP
cord-014462-11ggaqf1	1242	55	.	.	.
cord-014462-11ggaqf1	1243	1	The	the	DT
cord-014462-11ggaqf1	1243	2	virus	virus	NN
cord-014462-11ggaqf1	1243	3	host	host	NN
cord-014462-11ggaqf1	1243	4	range	range	NN
cord-014462-11ggaqf1	1243	5	was	be	VBD
cord-014462-11ggaqf1	1243	6	only	only	RB
cord-014462-11ggaqf1	1243	7	restricted	restrict	VBN
cord-014462-11ggaqf1	1243	8	to	to	IN
cord-014462-11ggaqf1	1243	9	Cucurbit	Cucurbit	NNP
cord-014462-11ggaqf1	1243	10	species	specie	NNS
cord-014462-11ggaqf1	1243	11	and	and	CC
cord-014462-11ggaqf1	1243	12	Chenopodium	Chenopodium	NNP
cord-014462-11ggaqf1	1243	13	.	.	.
cord-014462-11ggaqf1	1244	1	The	the	DT
cord-014462-11ggaqf1	1244	2	virus	virus	NN
cord-014462-11ggaqf1	1244	3	was	be	VBD
cord-014462-11ggaqf1	1244	4	maintained	maintain	VBN
cord-014462-11ggaqf1	1244	5	for	for	IN
cord-014462-11ggaqf1	1244	6	further	further	JJ
cord-014462-11ggaqf1	1244	7	studies	study	NNS
cord-014462-11ggaqf1	1244	8	on	on	IN
cord-014462-11ggaqf1	1244	9	Cucurbita	Cucurbita	NNP
cord-014462-11ggaqf1	1244	10	pepo	pepo	NNP
cord-014462-11ggaqf1	1244	11	by	by	IN
cord-014462-11ggaqf1	1244	12	sap	sap	NN
cord-014462-11ggaqf1	1244	13	or	or	CC
cord-014462-11ggaqf1	1244	14	mechanical	mechanical	JJ
cord-014462-11ggaqf1	1244	15	inoculation	inoculation	NN
cord-014462-11ggaqf1	1244	16	.	.	.
cord-014462-11ggaqf1	1245	1	The	the	DT
cord-014462-11ggaqf1	1245	2	virus	virus	NN
cord-014462-11ggaqf1	1245	3	induced	induce	VBN
cord-014462-11ggaqf1	1245	4	mosaic	mosaic	NN
cord-014462-11ggaqf1	1245	5	,	,	,
cord-014462-11ggaqf1	1245	6	vein	vein	NN
cord-014462-11ggaqf1	1245	7	clearing	clearing	NN
cord-014462-11ggaqf1	1245	8	symptoms	symptom	NNS
cord-014462-11ggaqf1	1245	9	on	on	IN
cord-014462-11ggaqf1	1245	10	Pumpkin	Pumpkin	NNP
cord-014462-11ggaqf1	1245	11	.	.	.
cord-014462-11ggaqf1	1246	1	Electron	electron	NN
cord-014462-11ggaqf1	1246	2	microscopy	microscopy	NN
cord-014462-11ggaqf1	1246	3	of	of	IN
cord-014462-11ggaqf1	1246	4	the	the	DT
cord-014462-11ggaqf1	1246	5	leaf	leaf	NN
cord-014462-11ggaqf1	1246	6	dip	dip	NN
cord-014462-11ggaqf1	1246	7	preparations	preparation	NNS
cord-014462-11ggaqf1	1246	8	stained	stain	VBN
cord-014462-11ggaqf1	1246	9	with	with	IN
cord-014462-11ggaqf1	1246	10	2	2	CD
cord-014462-11ggaqf1	1246	11	%	%	NN
cord-014462-11ggaqf1	1246	12	Uranyl	Uranyl	NNP
cord-014462-11ggaqf1	1246	13	acetate	acetate	NN
cord-014462-11ggaqf1	1246	14	from	from	IN
cord-014462-11ggaqf1	1246	15	the	the	DT
cord-014462-11ggaqf1	1246	16	pumpkin	pumpkin	NN
cord-014462-11ggaqf1	1246	17	leaves	leave	NNS
cord-014462-11ggaqf1	1246	18	showing	show	VBG
cord-014462-11ggaqf1	1246	19	symptoms	symptom	NNS
cord-014462-11ggaqf1	1246	20	revealed	reveal	VBD
cord-014462-11ggaqf1	1246	21	the	the	DT
cord-014462-11ggaqf1	1246	22	presence	presence	NN
cord-014462-11ggaqf1	1246	23	of	of	IN
cord-014462-11ggaqf1	1246	24	a	a	DT
cord-014462-11ggaqf1	1246	25	long	long	JJ
cord-014462-11ggaqf1	1246	26	flexuous	flexuous	JJ
cord-014462-11ggaqf1	1246	27	filamentous	filamentous	JJ
cord-014462-11ggaqf1	1246	28	particle	particle	NN
cord-014462-11ggaqf1	1246	29	measuring	measure	VBG
cord-014462-11ggaqf1	1246	30	750	750	CD
cord-014462-11ggaqf1	1246	31	9	9	CD
cord-014462-11ggaqf1	1246	32	12	12	CD
cord-014462-11ggaqf1	1246	33	nm	nm	NN
cord-014462-11ggaqf1	1246	34	.	.	.
cord-014462-11ggaqf1	1247	1	The	the	DT
cord-014462-11ggaqf1	1247	2	virus	virus	NN
cord-014462-11ggaqf1	1247	3	positively	positively	RB
cord-014462-11ggaqf1	1247	4	reacted	react	VBD
cord-014462-11ggaqf1	1247	5	to	to	IN
cord-014462-11ggaqf1	1247	6	the	the	DT
cord-014462-11ggaqf1	1247	7	polyclonal	polyclonal	JJ
cord-014462-11ggaqf1	1247	8	antisera	antisera	NN
cord-014462-11ggaqf1	1247	9	of	of	IN
cord-014462-11ggaqf1	1247	10	Papaya	Papaya	NNP
cord-014462-11ggaqf1	1247	11	ringspot	ringspot	NN
cord-014462-11ggaqf1	1247	12	virus	virus	NN
cord-014462-11ggaqf1	1247	13	-	-	:
cord-014462-11ggaqf1	1247	14	W	W	NNP
cord-014462-11ggaqf1	1247	15	,	,	,
cord-014462-11ggaqf1	1247	16	Potato	Potato	NNP
cord-014462-11ggaqf1	1247	17	virus	virus	NN
cord-014462-11ggaqf1	1247	18	Y	Y	NNP
cord-014462-11ggaqf1	1247	19	,	,	,
cord-014462-11ggaqf1	1247	20	Tobacco	Tobacco	NNP
cord-014462-11ggaqf1	1247	21	etch	etch	NN
cord-014462-11ggaqf1	1247	22	virus	virus	NN
cord-014462-11ggaqf1	1247	23	and	and	CC
cord-014462-11ggaqf1	1247	24	also	also	RB
cord-014462-11ggaqf1	1247	25	strongly	strongly	RB
cord-014462-11ggaqf1	1247	26	reacted	react	VBD
cord-014462-11ggaqf1	1247	27	with	with	IN
cord-014462-11ggaqf1	1247	28	the	the	DT
cord-014462-11ggaqf1	1247	29	polyclonal	polyclonal	JJ
cord-014462-11ggaqf1	1247	30	antiserum	antiserum	NN
cord-014462-11ggaqf1	1247	31	of	of	IN
cord-014462-11ggaqf1	1247	32	Zucchini	Zucchini	NNP
cord-014462-11ggaqf1	1247	33	yellow	yellow	JJ
cord-014462-11ggaqf1	1247	34	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1247	35	virus	virus	NN
cord-014462-11ggaqf1	1247	36	in	in	IN
cord-014462-11ggaqf1	1247	37	Direct	Direct	NNP
cord-014462-11ggaqf1	1247	38	Antigen	Antigen	NNP
cord-014462-11ggaqf1	1247	39	Coated	Coated	NNP
cord-014462-11ggaqf1	1247	40	-	-	HYPH
cord-014462-11ggaqf1	1247	41	Enzyme	Enzyme	NNP
cord-014462-11ggaqf1	1247	42	Linked	link	VBN
cord-014462-11ggaqf1	1247	43	Immunosorbent	Immunosorbent	NNP
cord-014462-11ggaqf1	1247	44	Assay	Assay	NNP
cord-014462-11ggaqf1	1247	45	(	(	-LRB-
cord-014462-11ggaqf1	1247	46	DAC	DAC	NNP
cord-014462-11ggaqf1	1247	47	-	-	HYPH
cord-014462-11ggaqf1	1247	48	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1247	49	)	)	-RRB-
cord-014462-11ggaqf1	1247	50	.	.	.
cord-014462-11ggaqf1	1248	1	Because	because	IN
cord-014462-11ggaqf1	1248	2	of	of	IN
cord-014462-11ggaqf1	1248	3	very	very	RB
cord-014462-11ggaqf1	1248	4	strong	strong	JJ
cord-014462-11ggaqf1	1248	5	reaction	reaction	NN
cord-014462-11ggaqf1	1248	6	to	to	IN
cord-014462-11ggaqf1	1248	7	polyclonal	polyclonal	JJ
cord-014462-11ggaqf1	1248	8	antisera	antisera	NN
cord-014462-11ggaqf1	1248	9	of	of	IN
cord-014462-11ggaqf1	1248	10	Zucchini	Zucchini	NNP
cord-014462-11ggaqf1	1248	11	yellow	yellow	JJ
cord-014462-11ggaqf1	1248	12	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1248	13	virus	virus	NN
cord-014462-11ggaqf1	1248	14	,	,	,
cord-014462-11ggaqf1	1248	15	we	-PRON-	PRP
cord-014462-11ggaqf1	1248	16	tried	try	VBD
cord-014462-11ggaqf1	1248	17	to	to	TO
cord-014462-11ggaqf1	1248	18	amplify	amplify	VB
cord-014462-11ggaqf1	1248	19	the	the	DT
cord-014462-11ggaqf1	1248	20	partial	partial	JJ
cord-014462-11ggaqf1	1248	21	Nib	Nib	NNP
cord-014462-11ggaqf1	1248	22	and	and	CC
cord-014462-11ggaqf1	1248	23	CP	CP	NNP
cord-014462-11ggaqf1	1248	24	genes	gene	NNS
cord-014462-11ggaqf1	1248	25	of	of	IN
cord-014462-11ggaqf1	1248	26	the	the	DT
cord-014462-11ggaqf1	1248	27	virus	virus	NN
cord-014462-11ggaqf1	1248	28	along	along	IN
cord-014462-11ggaqf1	1248	29	with	with	IN
cord-014462-11ggaqf1	1248	30	the	the	DT
cord-014462-11ggaqf1	1248	31	3	3	CD
cord-014462-11ggaqf1	1248	32	0	0	CD
cord-014462-11ggaqf1	1248	33	UTR	UTR	NNP
cord-014462-11ggaqf1	1248	34	by	by	IN
cord-014462-11ggaqf1	1248	35	using	use	VBG
cord-014462-11ggaqf1	1248	36	two	two	CD
cord-014462-11ggaqf1	1248	37	primers	primer	NNS
cord-014462-11ggaqf1	1248	38	ZY2	zy2	VBP
cord-014462-11ggaqf1	1248	39	5	5	CD
cord-014462-11ggaqf1	1248	40	0	0	CD
cord-014462-11ggaqf1	1248	41	GCTCCATACATAGCTGAG	GCTCCATACATAGCTGAG	NNP
cord-014462-11ggaqf1	1248	42	ACAGC3	ACAGC3	NNP
cord-014462-11ggaqf1	1248	43	0	0	NFP
cord-014462-11ggaqf1	1248	44	and	and	CC
cord-014462-11ggaqf1	1248	45	ZY3	ZY3	NNP
cord-014462-11ggaqf1	1248	46	5	5	CD
cord-014462-11ggaqf1	1248	47	0	0	CD
cord-014462-11ggaqf1	1248	48	TAGGCTTTTTGCAAACGGAGTCTA	TAGGCTTTTTGCAAACGGAGTCTA	NNP
cord-014462-11ggaqf1	1249	1	AT	at	IN
cord-014462-11ggaqf1	1249	2	C3	c3	NN
cord-014462-11ggaqf1	1249	3	0	0	CD
cord-014462-11ggaqf1	1249	4	.	.	.
cord-014462-11ggaqf1	1250	1	Total	Total	NNP
cord-014462-11ggaqf1	1250	2	RNA	RNA	NNP
cord-014462-11ggaqf1	1250	3	from	from	IN
cord-014462-11ggaqf1	1250	4	Gherkin	Gherkin	NNP
cord-014462-11ggaqf1	1250	5	infected	infected	JJ
cord-014462-11ggaqf1	1250	6	leaves	leave	NNS
cord-014462-11ggaqf1	1250	7	was	be	VBD
cord-014462-11ggaqf1	1250	8	isolated	isolate	VBN
cord-014462-11ggaqf1	1250	9	using	use	VBG
cord-014462-11ggaqf1	1250	10	Trizol	Trizol	NNP
cord-014462-11ggaqf1	1250	11	LS	LS	NNP
cord-014462-11ggaqf1	1250	12	reagent	reagent	NN
cord-014462-11ggaqf1	1250	13	(	(	-LRB-
cord-014462-11ggaqf1	1250	14	Sigma	Sigma	NNP
cord-014462-11ggaqf1	1250	15	)	)	-RRB-
cord-014462-11ggaqf1	1250	16	.	.	.
cord-014462-11ggaqf1	1251	1	RT	RT	NNP
cord-014462-11ggaqf1	1251	2	-	-	HYPH
cord-014462-11ggaqf1	1251	3	PCR	PCR	NNP
cord-014462-11ggaqf1	1251	4	was	be	VBD
cord-014462-11ggaqf1	1251	5	performed	perform	VBN
cord-014462-11ggaqf1	1251	6	to	to	TO
cord-014462-11ggaqf1	1251	7	obtain	obtain	VB
cord-014462-11ggaqf1	1251	8	an	an	DT
cord-014462-11ggaqf1	1251	9	amplicon	amplicon	NN
cord-014462-11ggaqf1	1251	10	of	of	IN
cord-014462-11ggaqf1	1251	11	*	*	NFP
cord-014462-11ggaqf1	1251	12	1.2kbp	1.2kbp	CD
cord-014462-11ggaqf1	1251	13	,	,	,
cord-014462-11ggaqf1	1251	14	cloned	clone	VBN
cord-014462-11ggaqf1	1251	15	into	into	IN
cord-014462-11ggaqf1	1251	16	Fermentas	Fermentas	NNP
cord-014462-11ggaqf1	1251	17	pTZ57R	pTZ57R	NNP
cord-014462-11ggaqf1	1251	18	/	/	SYM
cord-014462-11ggaqf1	1251	19	T	t	NN
cord-014462-11ggaqf1	1251	20	vector	vector	NN
cord-014462-11ggaqf1	1251	21	and	and	CC
cord-014462-11ggaqf1	1251	22	sequenced	sequence	VBN
cord-014462-11ggaqf1	1251	23	at	at	IN
cord-014462-11ggaqf1	1251	24	MWG	MWG	NNP
cord-014462-11ggaqf1	1251	25	biotech	biotech	NN
cord-014462-11ggaqf1	1251	26	,	,	,
cord-014462-11ggaqf1	1251	27	Bangalore	Bangalore	NNP
cord-014462-11ggaqf1	1251	28	.	.	.
cord-014462-11ggaqf1	1252	1	Sequence	sequence	NN
cord-014462-11ggaqf1	1252	2	analysis	analysis	NN
cord-014462-11ggaqf1	1252	3	revealed	reveal	VBD
cord-014462-11ggaqf1	1252	4	that	that	IN
cord-014462-11ggaqf1	1252	5	the	the	DT
cord-014462-11ggaqf1	1252	6	virus	virus	NN
cord-014462-11ggaqf1	1252	7	was	be	VBD
cord-014462-11ggaqf1	1252	8	isolate	isolate	NN
cord-014462-11ggaqf1	1252	9	of	of	IN
cord-014462-11ggaqf1	1252	10	Zucchini	Zucchini	NNP
cord-014462-11ggaqf1	1252	11	yellow	yellow	JJ
cord-014462-11ggaqf1	1252	12	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1252	13	virus	virus	NN
cord-014462-11ggaqf1	1252	14	and	and	CC
cord-014462-11ggaqf1	1252	15	was	be	VBD
cord-014462-11ggaqf1	1252	16	showing	show	VBG
cord-014462-11ggaqf1	1252	17	98	98	CD
cord-014462-11ggaqf1	1252	18	%	%	NN
cord-014462-11ggaqf1	1252	19	of	of	IN
cord-014462-11ggaqf1	1252	20	homology	homology	NN
cord-014462-11ggaqf1	1252	21	to	to	IN
cord-014462-11ggaqf1	1252	22	that	that	DT
cord-014462-11ggaqf1	1252	23	of	of	IN
cord-014462-11ggaqf1	1252	24	the	the	DT
cord-014462-11ggaqf1	1252	25	Zucchini	Zucchini	NNP
cord-014462-11ggaqf1	1252	26	yellow	yellow	JJ
cord-014462-11ggaqf1	1252	27	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1252	28	virus	virus	NN
cord-014462-11ggaqf1	1252	29	strain	strain	NN
cord-014462-11ggaqf1	1252	30	B	B	NNP
cord-014462-11ggaqf1	1252	31	genome	genome	NN
cord-014462-11ggaqf1	1252	32	AY188994	ay188994	NN
cord-014462-11ggaqf1	1252	33	and	and	CC
cord-014462-11ggaqf1	1252	34	Zucchini	Zucchini	NNP
cord-014462-11ggaqf1	1252	35	yellow	yellow	JJ
cord-014462-11ggaqf1	1252	36	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1252	37	virus	virus	NN
cord-014462-11ggaqf1	1252	38	NAT	NAT	NNP
cord-014462-11ggaqf1	1252	39	genome	genome	NN
cord-014462-11ggaqf1	1252	40	EF062582	ef062582	NN
cord-014462-11ggaqf1	1252	41	which	which	WDT
cord-014462-11ggaqf1	1252	42	were	be	VBD
cord-014462-11ggaqf1	1252	43	strains	strain	NNS
cord-014462-11ggaqf1	1252	44	reported	report	VBN
cord-014462-11ggaqf1	1252	45	from	from	IN
cord-014462-11ggaqf1	1252	46	Israel	Israel	NNP
cord-014462-11ggaqf1	1252	47	.	.	.
cord-014462-11ggaqf1	1253	1	The	the	DT
cord-014462-11ggaqf1	1253	2	sequence	sequence	NN
cord-014462-11ggaqf1	1253	3	of	of	IN
cord-014462-11ggaqf1	1253	4	the	the	DT
cord-014462-11ggaqf1	1253	5	present	present	JJ
cord-014462-11ggaqf1	1253	6	study	study	NN
cord-014462-11ggaqf1	1253	7	was	be	VBD
cord-014462-11ggaqf1	1253	8	submitted	submit	VBN
cord-014462-11ggaqf1	1253	9	to	to	IN
cord-014462-11ggaqf1	1253	10	the	the	DT
cord-014462-11ggaqf1	1253	11	Genbank	Genbank	NNP
cord-014462-11ggaqf1	1253	12	GQ482976	GQ482976	NNP
cord-014462-11ggaqf1	1253	13	.	.	.
cord-014462-11ggaqf1	1254	1	The	the	DT
cord-014462-11ggaqf1	1254	2	results	result	NNS
cord-014462-11ggaqf1	1254	3	state	state	VBP
cord-014462-11ggaqf1	1254	4	a	a	DT
cord-014462-11ggaqf1	1254	5	suspicion	suspicion	NN
cord-014462-11ggaqf1	1254	6	that	that	IN
cord-014462-11ggaqf1	1254	7	the	the	DT
cord-014462-11ggaqf1	1254	8	virus	virus	NN
cord-014462-11ggaqf1	1254	9	could	could	MD
cord-014462-11ggaqf1	1254	10	have	have	VB
cord-014462-11ggaqf1	1254	11	been	be	VBN
cord-014462-11ggaqf1	1254	12	mobilized	mobilize	VBN
cord-014462-11ggaqf1	1254	13	by	by	IN
cord-014462-11ggaqf1	1254	14	some	some	DT
cord-014462-11ggaqf1	1254	15	infected	infect	VBN
cord-014462-11ggaqf1	1254	16	source	source	NN
cord-014462-11ggaqf1	1254	17	brought	bring	VBN
cord-014462-11ggaqf1	1254	18	by	by	IN
cord-014462-11ggaqf1	1254	19	the	the	DT
cord-014462-11ggaqf1	1254	20	Commercial	Commercial	NNP
cord-014462-11ggaqf1	1254	21	Israeli	Israeli	NNP
cord-014462-11ggaqf1	1254	22	based	base	VBN
cord-014462-11ggaqf1	1254	23	companies	company	NNS
cord-014462-11ggaqf1	1254	24	into	into	IN
cord-014462-11ggaqf1	1254	25	India	India	NNP
cord-014462-11ggaqf1	1254	26	due	due	JJ
cord-014462-11ggaqf1	1254	27	to	to	IN
cord-014462-11ggaqf1	1254	28	poor	poor	JJ
cord-014462-11ggaqf1	1254	29	quarantine	quarantine	NN
cord-014462-11ggaqf1	1254	30	regulations	regulation	NNS
cord-014462-11ggaqf1	1254	31	as	as	IN
cord-014462-11ggaqf1	1254	32	the	the	DT
cord-014462-11ggaqf1	1254	33	Gherkin	Gherkin	NNP
cord-014462-11ggaqf1	1254	34	cultivation	cultivation	NN
cord-014462-11ggaqf1	1254	35	in	in	IN
cord-014462-11ggaqf1	1254	36	these	these	DT
cord-014462-11ggaqf1	1254	37	regions	region	NNS
cord-014462-11ggaqf1	1254	38	is	be	VBZ
cord-014462-11ggaqf1	1254	39	chiefly	chiefly	RB
cord-014462-11ggaqf1	1254	40	supported	support	VBN
cord-014462-11ggaqf1	1254	41	,	,	,
cord-014462-11ggaqf1	1254	42	purchased	purchase	VBN
cord-014462-11ggaqf1	1254	43	,	,	,
cord-014462-11ggaqf1	1254	44	exported	export	VBN
cord-014462-11ggaqf1	1254	45	and	and	CC
cord-014462-11ggaqf1	1254	46	marketed	market	VBN
cord-014462-11ggaqf1	1254	47	by	by	IN
cord-014462-11ggaqf1	1254	48	these	these	DT
cord-014462-11ggaqf1	1254	49	private	private	JJ
cord-014462-11ggaqf1	1254	50	companies	company	NNS
cord-014462-11ggaqf1	1254	51	that	that	WDT
cord-014462-11ggaqf1	1254	52	are	be	VBP
cord-014462-11ggaqf1	1254	53	based	base	VBN
cord-014462-11ggaqf1	1254	54	from	from	IN
cord-014462-11ggaqf1	1254	55	Israel	Israel	NNP
cord-014462-11ggaqf1	1254	56	.	.	.
cord-014462-11ggaqf1	1255	1	This	this	DT
cord-014462-11ggaqf1	1255	2	is	be	VBZ
cord-014462-11ggaqf1	1255	3	the	the	DT
cord-014462-11ggaqf1	1255	4	first	first	JJ
cord-014462-11ggaqf1	1255	5	report	report	NN
cord-014462-11ggaqf1	1255	6	on	on	IN
cord-014462-11ggaqf1	1255	7	Molecular	molecular	JJ
cord-014462-11ggaqf1	1255	8	characterisation	characterisation	NN
cord-014462-11ggaqf1	1255	9	of	of	IN
cord-014462-11ggaqf1	1255	10	Zucchini	Zucchini	NNP
cord-014462-11ggaqf1	1255	11	yellow	yellow	JJ
cord-014462-11ggaqf1	1255	12	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1255	13	virus	virus	NN
cord-014462-11ggaqf1	1255	14	infecting	infect	VBG
cord-014462-11ggaqf1	1255	15	Cucumis	Cucumis	NNP
cord-014462-11ggaqf1	1255	16	anguira	anguira	NNP
cord-014462-11ggaqf1	1255	17	(	(	-LRB-
cord-014462-11ggaqf1	1255	18	Gherkin	Gherkin	NNP
cord-014462-11ggaqf1	1255	19	)	)	-RRB-
cord-014462-11ggaqf1	1255	20	from	from	IN
cord-014462-11ggaqf1	1255	21	India	India	NNP
cord-014462-11ggaqf1	1255	22	.	.	.
cord-014462-11ggaqf1	1256	1	They	-PRON-	PRP
cord-014462-11ggaqf1	1256	2	also	also	RB
cord-014462-11ggaqf1	1256	3	exhibited	exhibit	VBD
cord-014462-11ggaqf1	1256	4	synergism	synergism	NN
cord-014462-11ggaqf1	1256	5	with	with	IN
cord-014462-11ggaqf1	1256	6	other	other	JJ
cord-014462-11ggaqf1	1256	7	virus	virus	NN
cord-014462-11ggaqf1	1256	8	which	which	WDT
cord-014462-11ggaqf1	1256	9	was	be	VBD
cord-014462-11ggaqf1	1256	10	region	region	NN
cord-014462-11ggaqf1	1256	11	specific	specific	JJ
cord-014462-11ggaqf1	1256	12	.	.	.
cord-014462-11ggaqf1	1257	1	Fifty	fifty	CD
cord-014462-11ggaqf1	1257	2	percent	percent	NN
cord-014462-11ggaqf1	1257	3	of	of	IN
cord-014462-11ggaqf1	1257	4	the	the	DT
cord-014462-11ggaqf1	1257	5	total	total	JJ
cord-014462-11ggaqf1	1257	6	symptomatic	symptomatic	JJ
cord-014462-11ggaqf1	1257	7	plant	plant	NN
cord-014462-11ggaqf1	1257	8	population	population	NN
cord-014462-11ggaqf1	1257	9	was	be	VBD
cord-014462-11ggaqf1	1257	10	found	find	VBN
cord-014462-11ggaqf1	1257	11	be	be	VB
cord-014462-11ggaqf1	1257	12	positive	positive	JJ
cord-014462-11ggaqf1	1257	13	only	only	RB
cord-014462-11ggaqf1	1257	14	for	for	IN
cord-014462-11ggaqf1	1257	15	carla	carla	NNP
cord-014462-11ggaqf1	1257	16	while	while	IN
cord-014462-11ggaqf1	1257	17	remaining	remain	VBG
cord-014462-11ggaqf1	1257	18	showed	show	VBD
cord-014462-11ggaqf1	1257	19	mixed	mixed	JJ
cord-014462-11ggaqf1	1257	20	infection	infection	NN
cord-014462-11ggaqf1	1257	21	of	of	IN
cord-014462-11ggaqf1	1257	22	Carla	Carla	NNP
cord-014462-11ggaqf1	1257	23	with	with	IN
cord-014462-11ggaqf1	1257	24	Tospo	Tospo	NNP
cord-014462-11ggaqf1	1257	25	in	in	IN
cord-014462-11ggaqf1	1257	26	some	some	DT
cord-014462-11ggaqf1	1257	27	regions	region	NNS
cord-014462-11ggaqf1	1257	28	while	while	IN
cord-014462-11ggaqf1	1257	29	in	in	IN
cord-014462-11ggaqf1	1257	30	others	other	NNS
cord-014462-11ggaqf1	1257	31	carla	carla	NNP
cord-014462-11ggaqf1	1257	32	virus	virus	NN
cord-014462-11ggaqf1	1257	33	was	be	VBD
cord-014462-11ggaqf1	1257	34	found	find	VBN
cord-014462-11ggaqf1	1257	35	to	to	TO
cord-014462-11ggaqf1	1257	36	be	be	VB
cord-014462-11ggaqf1	1257	37	associated	associate	VBN
cord-014462-11ggaqf1	1257	38	with	with	IN
cord-014462-11ggaqf1	1257	39	CMV	CMV	NNP
cord-014462-11ggaqf1	1257	40	.	.	.
cord-014462-11ggaqf1	1258	1	Presence	presence	NN
cord-014462-11ggaqf1	1258	2	of	of	IN
cord-014462-11ggaqf1	1258	3	only	only	JJ
cord-014462-11ggaqf1	1258	4	carlavirus	carlavirus	NNP
cord-014462-11ggaqf1	1258	5	was	be	VBD
cord-014462-11ggaqf1	1258	6	up	up	RB
cord-014462-11ggaqf1	1258	7	to	to	TO
cord-014462-11ggaqf1	1258	8	10	10	CD
cord-014462-11ggaqf1	1258	9	-	-	SYM
cord-014462-11ggaqf1	1258	10	20	20	CD
cord-014462-11ggaqf1	1258	11	%	%	NN
cord-014462-11ggaqf1	1258	12	incidence	incidence	NN
cord-014462-11ggaqf1	1258	13	,	,	,
cord-014462-11ggaqf1	1258	14	without	without	IN
cord-014462-11ggaqf1	1258	15	association	association	NN
cord-014462-11ggaqf1	1258	16	of	of	IN
cord-014462-11ggaqf1	1258	17	Tospo	Tospo	NNP
cord-014462-11ggaqf1	1258	18	,	,	,
cord-014462-11ggaqf1	1258	19	CMV	CMV	NNP
cord-014462-11ggaqf1	1258	20	,	,	,
cord-014462-11ggaqf1	1258	21	Poty	Poty	NNP
cord-014462-11ggaqf1	1258	22	or	or	CC
cord-014462-11ggaqf1	1258	23	Tobamo	Tobamo	NNP
cord-014462-11ggaqf1	1259	1	viruses	virus	NNS
cord-014462-11ggaqf1	1259	2	was	be	VBD
cord-014462-11ggaqf1	1259	3	also	also	RB
cord-014462-11ggaqf1	1259	4	observed	observe	VBN
cord-014462-11ggaqf1	1259	5	in	in	IN
cord-014462-11ggaqf1	1259	6	some	some	DT
cord-014462-11ggaqf1	1259	7	fields	field	NNS
cord-014462-11ggaqf1	1259	8	.	.	.
cord-014462-11ggaqf1	1260	1	Avijit	Avijit	NNP
cord-014462-11ggaqf1	1260	2	Tarafdar	Tarafdar	NNP
cord-014462-11ggaqf1	1260	3	,	,	,
cord-014462-11ggaqf1	1260	4	Raju	Raju	NNP
cord-014462-11ggaqf1	1260	5	Ghosh	Ghosh	NNP
cord-014462-11ggaqf1	1260	6	,	,	,
cord-014462-11ggaqf1	1260	7	K.	K.	NNP
cord-014462-11ggaqf1	1260	8	K.	K.	NNP
cord-014462-11ggaqf1	1260	9	Biswas	Biswas	NNP
cord-014462-11ggaqf1	1260	10	Plant	Plant	NNP
cord-014462-11ggaqf1	1260	11	Virology	Virology	NNP
cord-014462-11ggaqf1	1260	12	Unit	Unit	NNP
cord-014462-11ggaqf1	1260	13	,	,	,
cord-014462-11ggaqf1	1260	14	Division	Division	NNP
cord-014462-11ggaqf1	1260	15	of	of	IN
cord-014462-11ggaqf1	1260	16	Plant	Plant	NNP
cord-014462-11ggaqf1	1260	17	Pathology	Pathology	NNP
cord-014462-11ggaqf1	1260	18	,	,	,
cord-014462-11ggaqf1	1260	19	Indian	Indian	NNP
cord-014462-11ggaqf1	1260	20	Agricultural	Agricultural	NNP
cord-014462-11ggaqf1	1260	21	Research	Research	NNP
cord-014462-11ggaqf1	1260	22	Institute	Institute	NNP
cord-014462-11ggaqf1	1260	23	,	,	,
cord-014462-11ggaqf1	1260	24	New	New	NNP
cord-014462-11ggaqf1	1260	25	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1260	26	110012	110012	CD
cord-014462-11ggaqf1	1260	27	Citrus	Citrus	NNP
cord-014462-11ggaqf1	1260	28	tristeza	tristeza	NNP
cord-014462-11ggaqf1	1260	29	virus	virus	NN
cord-014462-11ggaqf1	1260	30	(	(	-LRB-
cord-014462-11ggaqf1	1260	31	CTV	CTV	NNP
cord-014462-11ggaqf1	1260	32	)	)	-RRB-
cord-014462-11ggaqf1	1260	33	,	,	,
cord-014462-11ggaqf1	1260	34	a	a	DT
cord-014462-11ggaqf1	1260	35	brown	brown	JJ
cord-014462-11ggaqf1	1260	36	citrus	citrus	NN
cord-014462-11ggaqf1	1260	37	aphid	aphid	NN
cord-014462-11ggaqf1	1260	38	(	(	-LRB-
cord-014462-11ggaqf1	1260	39	Toxoptera	Toxoptera	NNP
cord-014462-11ggaqf1	1260	40	citricidus	citricidus	NNP
cord-014462-11ggaqf1	1260	41	)	)	-RRB-
cord-014462-11ggaqf1	1260	42	transmitted	transmit	VBD
cord-014462-11ggaqf1	1260	43	Closterovirus	Closterovirus	NNP
cord-014462-11ggaqf1	1260	44	under	under	IN
cord-014462-11ggaqf1	1260	45	family	family	NN
cord-014462-11ggaqf1	1260	46	Closteroviridae	Closteroviridae	NNP
cord-014462-11ggaqf1	1260	47	,	,	,
cord-014462-11ggaqf1	1260	48	is	be	VBZ
cord-014462-11ggaqf1	1260	49	one	one	CD
cord-014462-11ggaqf1	1260	50	of	of	IN
cord-014462-11ggaqf1	1260	51	the	the	DT
cord-014462-11ggaqf1	1260	52	major	major	JJ
cord-014462-11ggaqf1	1260	53	limiting	limit	VBG
cord-014462-11ggaqf1	1260	54	factors	factor	NNS
cord-014462-11ggaqf1	1260	55	in	in	IN
cord-014462-11ggaqf1	1260	56	cultivation	cultivation	NN
cord-014462-11ggaqf1	1260	57	of	of	IN
cord-014462-11ggaqf1	1260	58	citrus	citrus	NN
cord-014462-11ggaqf1	1260	59	worldwide	worldwide	RB
cord-014462-11ggaqf1	1260	60	.	.	.
cord-014462-11ggaqf1	1261	1	CTV	CTV	NNP
cord-014462-11ggaqf1	1261	2	is	be	VBZ
cord-014462-11ggaqf1	1261	3	a	a	DT
cord-014462-11ggaqf1	1261	4	longest	long	RBS
cord-014462-11ggaqf1	1261	5	known	know	VBN
cord-014462-11ggaqf1	1261	6	plant	plant	NN
cord-014462-11ggaqf1	1261	7	virus	virus	NN
cord-014462-11ggaqf1	1261	8	having	have	VBG
cord-014462-11ggaqf1	1261	9	flexuous	flexuous	JJ
cord-014462-11ggaqf1	1261	10	particle	particle	NN
cord-014462-11ggaqf1	1261	11	of	of	IN
cord-014462-11ggaqf1	1261	12	2000	2000	CD
cord-014462-11ggaqf1	1261	13	9	9	CD
cord-014462-11ggaqf1	1261	14	11	11	CD
cord-014462-11ggaqf1	1261	15	nm	nm	NN
cord-014462-11ggaqf1	1261	16	in	in	IN
cord-014462-11ggaqf1	1261	17	size	size	NN
cord-014462-11ggaqf1	1261	18	.	.	.
cord-014462-11ggaqf1	1262	1	CTV	CTV	NNP
cord-014462-11ggaqf1	1262	2	genome	genome	NN
cord-014462-11ggaqf1	1262	3	is	be	VBZ
cord-014462-11ggaqf1	1262	4	a	a	DT
cord-014462-11ggaqf1	1262	5	positive	positive	JJ
cord-014462-11ggaqf1	1262	6	sense	sense	NN
cord-014462-11ggaqf1	1262	7	ssRNA	ssRNA	''
cord-014462-11ggaqf1	1262	8	of	of	IN
cord-014462-11ggaqf1	1262	9	about	about	RB
cord-014462-11ggaqf1	1262	10	20	20	CD
cord-014462-11ggaqf1	1262	11	kb	kb	NNP
cord-014462-11ggaqf1	1262	12	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1262	13	containing	contain	VBG
cord-014462-11ggaqf1	1262	14	13	13	CD
cord-014462-11ggaqf1	1262	15	open	open	JJ
cord-014462-11ggaqf1	1262	16	reading	reading	NN
cord-014462-11ggaqf1	1262	17	frames	frame	NNS
cord-014462-11ggaqf1	1262	18	(	(	-LRB-
cord-014462-11ggaqf1	1262	19	ORFs	ORFs	NNP
cord-014462-11ggaqf1	1262	20	)	)	-RRB-
cord-014462-11ggaqf1	1262	21	encoding	encode	VBG
cord-014462-11ggaqf1	1262	22	17	17	CD
cord-014462-11ggaqf1	1262	23	proteins	protein	NNS
cord-014462-11ggaqf1	1262	24	.	.	.
cord-014462-11ggaqf1	1263	1	Several	several	JJ
cord-014462-11ggaqf1	1263	2	biological	biological	JJ
cord-014462-11ggaqf1	1263	3	as	as	RB
cord-014462-11ggaqf1	1263	4	well	well	RB
cord-014462-11ggaqf1	1263	5	as	as	IN
cord-014462-11ggaqf1	1263	6	genetic	genetic	JJ
cord-014462-11ggaqf1	1263	7	variants	variant	NNS
cord-014462-11ggaqf1	1263	8	of	of	IN
cord-014462-11ggaqf1	1263	9	CTV	CTV	NNP
cord-014462-11ggaqf1	1263	10	are	be	VBP
cord-014462-11ggaqf1	1263	11	reported	report	VBN
cord-014462-11ggaqf1	1263	12	in	in	IN
cord-014462-11ggaqf1	1263	13	all	all	PDT
cord-014462-11ggaqf1	1263	14	the	the	DT
cord-014462-11ggaqf1	1263	15	citrus	citrus	NN
cord-014462-11ggaqf1	1263	16	growing	grow	VBG
cord-014462-11ggaqf1	1263	17	countries	country	NNS
cord-014462-11ggaqf1	1263	18	in	in	IN
cord-014462-11ggaqf1	1263	19	the	the	DT
cord-014462-11ggaqf1	1263	20	world	world	NN
cord-014462-11ggaqf1	1263	21	.	.	.
cord-014462-11ggaqf1	1264	1	CTV	CTV	NNP
cord-014462-11ggaqf1	1264	2	causes	cause	VBZ
cord-014462-11ggaqf1	1264	3	decline	decline	NN
cord-014462-11ggaqf1	1264	4	and	and	CC
cord-014462-11ggaqf1	1264	5	death	death	NN
cord-014462-11ggaqf1	1264	6	of	of	IN
cord-014462-11ggaqf1	1264	7	millions	million	NNS
cord-014462-11ggaqf1	1264	8	of	of	IN
cord-014462-11ggaqf1	1264	9	citrus	citrus	NN
cord-014462-11ggaqf1	1264	10	trees	tree	NNS
cord-014462-11ggaqf1	1264	11	in	in	IN
cord-014462-11ggaqf1	1264	12	the	the	DT
cord-014462-11ggaqf1	1264	13	world	world	NN
cord-014462-11ggaqf1	1264	14	.	.	.
cord-014462-11ggaqf1	1265	1	In	in	IN
cord-014462-11ggaqf1	1265	2	India	India	NNP
cord-014462-11ggaqf1	1265	3	,	,	,
cord-014462-11ggaqf1	1265	4	CTV	CTV	NNP
cord-014462-11ggaqf1	1265	5	is	be	VBZ
cord-014462-11ggaqf1	1265	6	a	a	DT
cord-014462-11ggaqf1	1265	7	century	century	NN
cord-014462-11ggaqf1	1265	8	old	old	JJ
cord-014462-11ggaqf1	1265	9	problem	problem	NN
cord-014462-11ggaqf1	1265	10	,	,	,
cord-014462-11ggaqf1	1265	11	and	and	CC
cord-014462-11ggaqf1	1265	12	has	have	VBZ
cord-014462-11ggaqf1	1265	13	killed	kill	VBN
cord-014462-11ggaqf1	1265	14	an	an	DT
cord-014462-11ggaqf1	1265	15	estimated	estimate	VBN
cord-014462-11ggaqf1	1265	16	one	one	CD
cord-014462-11ggaqf1	1265	17	million	million	CD
cord-014462-11ggaqf1	1265	18	citrus	citrus	NN
cord-014462-11ggaqf1	1265	19	trees	tree	NNS
cord-014462-11ggaqf1	1265	20	till	till	IN
cord-014462-11ggaqf1	1265	21	today	today	NN
cord-014462-11ggaqf1	1265	22	.	.	.
cord-014462-11ggaqf1	1266	1	In	in	IN
cord-014462-11ggaqf1	1266	2	molecular	molecular	JJ
cord-014462-11ggaqf1	1266	3	and	and	CC
cord-014462-11ggaqf1	1266	4	genetic	genetic	JJ
cord-014462-11ggaqf1	1266	5	level	level	NN
cord-014462-11ggaqf1	1266	6	,	,	,
cord-014462-11ggaqf1	1266	7	CTV	CTV	NNP
cord-014462-11ggaqf1	1266	8	isolates	isolate	VBZ
cord-014462-11ggaqf1	1266	9	from	from	IN
cord-014462-11ggaqf1	1266	10	India	India	NNP
cord-014462-11ggaqf1	1266	11	were	be	VBD
cord-014462-11ggaqf1	1266	12	not	not	RB
cord-014462-11ggaqf1	1266	13	fully	fully	RB
cord-014462-11ggaqf1	1266	14	characterized	characterize	VBN
cord-014462-11ggaqf1	1266	15	.	.	.
cord-014462-11ggaqf1	1267	1	Genetic	genetic	JJ
cord-014462-11ggaqf1	1267	2	diversity	diversity	NN
cord-014462-11ggaqf1	1267	3	and	and	CC
cord-014462-11ggaqf1	1267	4	sequence	sequence	NN
cord-014462-11ggaqf1	1267	5	divergence	divergence	NN
cord-014462-11ggaqf1	1267	6	in	in	IN
cord-014462-11ggaqf1	1267	7	CTV	CTV	NNP
cord-014462-11ggaqf1	1267	8	isolates	isolate	NNS
cord-014462-11ggaqf1	1267	9	of	of	IN
cord-014462-11ggaqf1	1267	10	India	India	NNP
cord-014462-11ggaqf1	1267	11	are	be	VBP
cord-014462-11ggaqf1	1267	12	not	not	RB
cord-014462-11ggaqf1	1267	13	fully	fully	RB
cord-014462-11ggaqf1	1267	14	established	establish	VBN
cord-014462-11ggaqf1	1267	15	.	.	.
cord-014462-11ggaqf1	1268	1	Further	further	RB
cord-014462-11ggaqf1	1268	2	,	,	,
cord-014462-11ggaqf1	1268	3	evidence	evidence	NN
cord-014462-11ggaqf1	1268	4	of	of	IN
cord-014462-11ggaqf1	1268	5	recombination	recombination	NN
cord-014462-11ggaqf1	1268	6	and	and	CC
cord-014462-11ggaqf1	1268	7	causes	cause	NNS
cord-014462-11ggaqf1	1268	8	of	of	IN
cord-014462-11ggaqf1	1268	9	evolution	evolution	NN
cord-014462-11ggaqf1	1268	10	of	of	IN
cord-014462-11ggaqf1	1268	11	CTV	CTV	NNP
cord-014462-11ggaqf1	1268	12	variants	variant	NNS
cord-014462-11ggaqf1	1268	13	in	in	IN
cord-014462-11ggaqf1	1268	14	India	India	NNP
cord-014462-11ggaqf1	1268	15	have	have	VBP
cord-014462-11ggaqf1	1268	16	not	not	RB
cord-014462-11ggaqf1	1268	17	been	be	VBN
cord-014462-11ggaqf1	1268	18	studied	study	VBN
cord-014462-11ggaqf1	1268	19	till	till	IN
cord-014462-11ggaqf1	1268	20	date	date	NN
cord-014462-11ggaqf1	1268	21	.	.	.
cord-014462-11ggaqf1	1269	1	Therefore	therefore	RB
cord-014462-11ggaqf1	1269	2	,	,	,
cord-014462-11ggaqf1	1269	3	in	in	IN
cord-014462-11ggaqf1	1269	4	the	the	DT
cord-014462-11ggaqf1	1269	5	present	present	JJ
cord-014462-11ggaqf1	1269	6	study	study	NN
cord-014462-11ggaqf1	1269	7	,	,	,
cord-014462-11ggaqf1	1269	8	effort	effort	NN
cord-014462-11ggaqf1	1269	9	has	have	VBZ
cord-014462-11ggaqf1	1269	10	been	be	VBN
cord-014462-11ggaqf1	1269	11	made	make	VBN
cord-014462-11ggaqf1	1269	12	to	to	TO
cord-014462-11ggaqf1	1269	13	characterize	characterize	VB
cord-014462-11ggaqf1	1269	14	several	several	JJ
cord-014462-11ggaqf1	1269	15	Indian	indian	JJ
cord-014462-11ggaqf1	1269	16	CTV	CTV	NNP
cord-014462-11ggaqf1	1269	17	isolates	isolate	NNS
cord-014462-11ggaqf1	1269	18	in	in	IN
cord-014462-11ggaqf1	1269	19	genetic	genetic	JJ
cord-014462-11ggaqf1	1269	20	level	level	NN
cord-014462-11ggaqf1	1269	21	,	,	,
cord-014462-11ggaqf1	1269	22	examine	examine	VB
cord-014462-11ggaqf1	1269	23	their	-PRON-	PRP$
cord-014462-11ggaqf1	1269	24	genetic	genetic	JJ
cord-014462-11ggaqf1	1269	25	diversity	diversity	NN
cord-014462-11ggaqf1	1269	26	,	,	,
cord-014462-11ggaqf1	1269	27	identify	identify	VB
cord-014462-11ggaqf1	1269	28	recombination	recombination	NN
cord-014462-11ggaqf1	1269	29	events	event	NNS
cord-014462-11ggaqf1	1269	30	and	and	CC
cord-014462-11ggaqf1	1269	31	analyze	analyze	VB
cord-014462-11ggaqf1	1269	32	evolution	evolution	NN
cord-014462-11ggaqf1	1269	33	of	of	IN
cord-014462-11ggaqf1	1269	34	divergent	divergent	JJ
cord-014462-11ggaqf1	1269	35	CTV	CTV	NNP
cord-014462-11ggaqf1	1269	36	.	.	.
cord-014462-11ggaqf1	1270	1	A	a	DT
cord-014462-11ggaqf1	1270	2	total	total	JJ
cord-014462-11ggaqf1	1270	3	number	number	NN
cord-014462-11ggaqf1	1270	4	of	of	IN
cord-014462-11ggaqf1	1270	5	73	73	CD
cord-014462-11ggaqf1	1270	6	CTV	CTV	NNP
cord-014462-11ggaqf1	1270	7	isolates	isolate	NNS
cord-014462-11ggaqf1	1270	8	from	from	IN
cord-014462-11ggaqf1	1270	9	different	different	JJ
cord-014462-11ggaqf1	1270	10	regions	region	NNS
cord-014462-11ggaqf1	1270	11	of	of	IN
cord-014462-11ggaqf1	1270	12	India	India	NNP
cord-014462-11ggaqf1	1270	13	(	(	-LRB-
cord-014462-11ggaqf1	1270	14	35	35	CD
cord-014462-11ggaqf1	1270	15	from	from	IN
cord-014462-11ggaqf1	1270	16	Darjeeling	Darjeeling	NNP
cord-014462-11ggaqf1	1270	17	hills	hill	NNS
cord-014462-11ggaqf1	1270	18	,	,	,
cord-014462-11ggaqf1	1270	19	five	five	CD
cord-014462-11ggaqf1	1270	20	from	from	IN
cord-014462-11ggaqf1	1270	21	Bangalore	Bangalore	NNP
cord-014462-11ggaqf1	1270	22	,	,	,
cord-014462-11ggaqf1	1270	23	15	15	CD
cord-014462-11ggaqf1	1270	24	from	from	IN
cord-014462-11ggaqf1	1270	25	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1270	26	and	and	CC
cord-014462-11ggaqf1	1270	27	18	18	CD
cord-014462-11ggaqf1	1270	28	from	from	IN
cord-014462-11ggaqf1	1270	29	Vidarbha	Vidarbha	NNP
cord-014462-11ggaqf1	1270	30	)	)	-RRB-
cord-014462-11ggaqf1	1270	31	were	be	VBD
cord-014462-11ggaqf1	1270	32	under	under	IN
cord-014462-11ggaqf1	1270	33	taken	take	VBN
cord-014462-11ggaqf1	1270	34	for	for	IN
cord-014462-11ggaqf1	1270	35	genetic	genetic	JJ
cord-014462-11ggaqf1	1270	36	study	study	NN
cord-014462-11ggaqf1	1270	37	.	.	.
cord-014462-11ggaqf1	1271	1	Two	two	CD
cord-014462-11ggaqf1	1271	2	genomic	genomic	JJ
cord-014462-11ggaqf1	1271	3	regions	region	NNS
cord-014462-11ggaqf1	1271	4	of	of	IN
cord-014462-11ggaqf1	1271	5	CTV	CTV	NNP
cord-014462-11ggaqf1	1271	6	,	,	,
cord-014462-11ggaqf1	1271	7	i.e.	i.e.	FW
cord-014462-11ggaqf1	1271	8	,	,	,
cord-014462-11ggaqf1	1271	9	entire	entire	JJ
cord-014462-11ggaqf1	1271	10	CP	cp	NN
cord-014462-11ggaqf1	1271	11	gene	gene	NN
cord-014462-11ggaqf1	1271	12	(	(	-LRB-
cord-014462-11ggaqf1	1271	13	CPG	CPG	NNP
cord-014462-11ggaqf1	1271	14	)	)	-RRB-
cord-014462-11ggaqf1	1271	15	(	(	-LRB-
cord-014462-11ggaqf1	1271	16	672	672	CD
cord-014462-11ggaqf1	1271	17	nt	nt	NN
cord-014462-11ggaqf1	1271	18	)	)	-RRB-
cord-014462-11ggaqf1	1271	19	and	and	CC
cord-014462-11ggaqf1	1271	20	a	a	DT
cord-014462-11ggaqf1	1271	21	gene	gene	NN
cord-014462-11ggaqf1	1271	22	fragment	fragment	NN
cord-014462-11ggaqf1	1271	23	of	of	IN
cord-014462-11ggaqf1	1271	24	5	5	CD
cord-014462-11ggaqf1	1271	25	0	0	CD
cord-014462-11ggaqf1	1271	26	ORF1a	ORF1a	NNP
cord-014462-11ggaqf1	1271	27	(	(	-LRB-
cord-014462-11ggaqf1	1271	28	ORF1a	ORF1a	NNP
cord-014462-11ggaqf1	1271	29	)	)	-RRB-
cord-014462-11ggaqf1	1271	30	(	(	-LRB-
cord-014462-11ggaqf1	1271	31	404	404	CD
cord-014462-11ggaqf1	1271	32	nt	nt	NNP
cord-014462-11ggaqf1	1271	33	)	)	-RRB-
cord-014462-11ggaqf1	1271	34	were	be	VBD
cord-014462-11ggaqf1	1271	35	amplified	amplify	VBN
cord-014462-11ggaqf1	1271	36	,	,	,
cord-014462-11ggaqf1	1271	37	cloned	clone	VBN
cord-014462-11ggaqf1	1271	38	,	,	,
cord-014462-11ggaqf1	1271	39	sequenced	sequence	VBN
cord-014462-11ggaqf1	1271	40	and	and	CC
cord-014462-11ggaqf1	1271	41	nucleotides	nucleotide	NNS
cord-014462-11ggaqf1	1271	42	were	be	VBD
cord-014462-11ggaqf1	1271	43	analyzed	analyze	VBN
cord-014462-11ggaqf1	1271	44	.	.	.
cord-014462-11ggaqf1	1272	1	Based	base	VBN
cord-014462-11ggaqf1	1272	2	on	on	IN
cord-014462-11ggaqf1	1272	3	CPG	CPG	NNP
cord-014462-11ggaqf1	1272	4	,	,	,
cord-014462-11ggaqf1	1272	5	Indian	indian	JJ
cord-014462-11ggaqf1	1272	6	isolates	isolate	NNS
cord-014462-11ggaqf1	1272	7	shared	share	VBD
cord-014462-11ggaqf1	1272	8	88	88	CD
cord-014462-11ggaqf1	1272	9	-	-	SYM
cord-014462-11ggaqf1	1272	10	99	99	CD
cord-014462-11ggaqf1	1272	11	%	%	NN
cord-014462-11ggaqf1	1272	12	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1272	13	identity	identity	NN
cord-014462-11ggaqf1	1272	14	,	,	,
cord-014462-11ggaqf1	1272	15	and	and	CC
cord-014462-11ggaqf1	1272	16	based	base	VBN
cord-014462-11ggaqf1	1272	17	on	on	IN
cord-014462-11ggaqf1	1272	18	ORF1a	ORF1a	NNP
cord-014462-11ggaqf1	1272	19	they	-PRON-	PRP
cord-014462-11ggaqf1	1272	20	shared	share	VBD
cord-014462-11ggaqf1	1272	21	82	82	CD
cord-014462-11ggaqf1	1272	22	-	-	SYM
cord-014462-11ggaqf1	1272	23	99	99	CD
cord-014462-11ggaqf1	1272	24	%	%	NN
cord-014462-11ggaqf1	1272	25	identity	identity	NN
cord-014462-11ggaqf1	1272	26	,	,	,
cord-014462-11ggaqf1	1272	27	among	among	IN
cord-014462-11ggaqf1	1272	28	them	-PRON-	PRP
cord-014462-11ggaqf1	1272	29	.	.	.
cord-014462-11ggaqf1	1273	1	Incongruence	Incongruence	NNP
cord-014462-11ggaqf1	1273	2	of	of	IN
cord-014462-11ggaqf1	1273	3	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1273	4	relationship	relationship	NN
cord-014462-11ggaqf1	1273	5	was	be	VBD
cord-014462-11ggaqf1	1273	6	observed	observe	VBN
cord-014462-11ggaqf1	1273	7	as	as	IN
cord-014462-11ggaqf1	1273	8	on	on	IN
cord-014462-11ggaqf1	1273	9	sequence	sequence	NN
cord-014462-11ggaqf1	1273	10	analysis	analysis	NN
cord-014462-11ggaqf1	1273	11	five	five	CD
cord-014462-11ggaqf1	1273	12	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1273	13	clades	clade	NNS
cord-014462-11ggaqf1	1273	14	based	base	VBN
cord-014462-11ggaqf1	1273	15	on	on	IN
cord-014462-11ggaqf1	1273	16	CPG	CPG	NNP
cord-014462-11ggaqf1	1273	17	,	,	,
cord-014462-11ggaqf1	1273	18	and	and	CC
cord-014462-11ggaqf1	1273	19	eight	eight	CD
cord-014462-11ggaqf1	1273	20	clades	clade	NNS
cord-014462-11ggaqf1	1273	21	based	base	VBN
cord-014462-11ggaqf1	1273	22	on	on	IN
cord-014462-11ggaqf1	1273	23	ORF1a	ORF1a	NNP
cord-014462-11ggaqf1	1273	24	,	,	,
cord-014462-11ggaqf1	1273	25	were	be	VBD
cord-014462-11ggaqf1	1273	26	generated	generate	VBN
cord-014462-11ggaqf1	1273	27	suggesting	suggest	VBG
cord-014462-11ggaqf1	1273	28	the	the	DT
cord-014462-11ggaqf1	1273	29	recombination	recombination	NN
cord-014462-11ggaqf1	1273	30	events	event	NNS
cord-014462-11ggaqf1	1273	31	have	have	VBP
cord-014462-11ggaqf1	1273	32	been	be	VBN
cord-014462-11ggaqf1	1273	33	occurred	occur	VBN
cord-014462-11ggaqf1	1273	34	between	between	IN
cord-014462-11ggaqf1	1273	35	the	the	DT
cord-014462-11ggaqf1	1273	36	sequences	sequence	NNS
cord-014462-11ggaqf1	1273	37	of	of	IN
cord-014462-11ggaqf1	1273	38	Indian	indian	JJ
cord-014462-11ggaqf1	1273	39	CTV	CTV	NNP
cord-014462-11ggaqf1	1273	40	isolates	isolate	NNS
cord-014462-11ggaqf1	1273	41	.	.	.
cord-014462-11ggaqf1	1274	1	Thus	thus	RB
cord-014462-11ggaqf1	1274	2	,	,	,
cord-014462-11ggaqf1	1274	3	to	to	TO
cord-014462-11ggaqf1	1274	4	identify	identify	VB
cord-014462-11ggaqf1	1274	5	the	the	DT
cord-014462-11ggaqf1	1274	6	potential	potential	JJ
cord-014462-11ggaqf1	1274	7	recombination	recombination	NN
cord-014462-11ggaqf1	1274	8	events	event	NNS
cord-014462-11ggaqf1	1274	9	,	,	,
cord-014462-11ggaqf1	1274	10	and	and	CC
cord-014462-11ggaqf1	1274	11	determine	determine	VB
cord-014462-11ggaqf1	1274	12	the	the	DT
cord-014462-11ggaqf1	1274	13	parental	parental	JJ
cord-014462-11ggaqf1	1274	14	sequences	sequence	NNS
cord-014462-11ggaqf1	1274	15	in	in	IN
cord-014462-11ggaqf1	1274	16	CTV	CTV	NNP
cord-014462-11ggaqf1	1274	17	isolates	isolate	NNS
cord-014462-11ggaqf1	1274	18	,	,	,
cord-014462-11ggaqf1	1274	19	six	six	CD
cord-014462-11ggaqf1	1274	20	recombination	recombination	NN
cord-014462-11ggaqf1	1274	21	detecting	detect	VBG
cord-014462-11ggaqf1	1274	22	algorithms	algorithm	NNS
cord-014462-11ggaqf1	1274	23	,	,	,
cord-014462-11ggaqf1	1274	24	namely	namely	RB
cord-014462-11ggaqf1	1274	25	,	,	,
cord-014462-11ggaqf1	1274	26	RDP	RDP	NNP
cord-014462-11ggaqf1	1274	27	,	,	,
cord-014462-11ggaqf1	1274	28	Genconv	Genconv	NNP
cord-014462-11ggaqf1	1274	29	,	,	,
cord-014462-11ggaqf1	1274	30	Bootscan	Bootscan	NNP
cord-014462-11ggaqf1	1274	31	,	,	,
cord-014462-11ggaqf1	1274	32	Maxchi	Maxchi	NNP
cord-014462-11ggaqf1	1274	33	,	,	,
cord-014462-11ggaqf1	1274	34	Chimera	Chimera	NNP
cord-014462-11ggaqf1	1274	35	and	and	CC
cord-014462-11ggaqf1	1274	36	Siscan	Siscan	NNP
cord-014462-11ggaqf1	1274	37	were	be	VBD
cord-014462-11ggaqf1	1274	38	used	use	VBN
cord-014462-11ggaqf1	1274	39	.	.	.
cord-014462-11ggaqf1	1275	1	Out	out	IN
cord-014462-11ggaqf1	1275	2	of	of	IN
cord-014462-11ggaqf1	1275	3	73	73	CD
cord-014462-11ggaqf1	1275	4	Indian	indian	JJ
cord-014462-11ggaqf1	1275	5	CTV	CTV	NNP
cord-014462-11ggaqf1	1275	6	,	,	,
cord-014462-11ggaqf1	1275	7	CPG	CPG	NNP
cord-014462-11ggaqf1	1275	8	of	of	IN
cord-014462-11ggaqf1	1275	9	18	18	CD
cord-014462-11ggaqf1	1275	10	and	and	CC
cord-014462-11ggaqf1	1275	11	ORF1a	ORF1a	NNP
cord-014462-11ggaqf1	1275	12	of	of	IN
cord-014462-11ggaqf1	1275	13	47	47	CD
cord-014462-11ggaqf1	1275	14	isolates	isolate	NNS
cord-014462-11ggaqf1	1275	15	of	of	IN
cord-014462-11ggaqf1	1275	16	CTV	CTV	NNP
cord-014462-11ggaqf1	1275	17	showed	show	VBD
cord-014462-11ggaqf1	1275	18	recombination	recombination	NN
cord-014462-11ggaqf1	1275	19	events	event	NNS
cord-014462-11ggaqf1	1275	20	suggesting	suggest	VBG
cord-014462-11ggaqf1	1275	21	ORF1a	ORF1a	NNP
cord-014462-11ggaqf1	1275	22	was	be	VBD
cord-014462-11ggaqf1	1275	23	more	more	RBR
cord-014462-11ggaqf1	1275	24	prone	prone	JJ
cord-014462-11ggaqf1	1275	25	and	and	CC
cord-014462-11ggaqf1	1275	26	fragile	fragile	JJ
cord-014462-11ggaqf1	1275	27	to	to	IN
cord-014462-11ggaqf1	1275	28	RNA	rna	NN
cord-014462-11ggaqf1	1275	29	recombination	recombination	NN
cord-014462-11ggaqf1	1275	30	as	as	IN
cord-014462-11ggaqf1	1275	31	compared	compare	VBN
cord-014462-11ggaqf1	1275	32	to	to	IN
cord-014462-11ggaqf1	1275	33	CPG	CPG	NNP
cord-014462-11ggaqf1	1275	34	.	.	.
cord-014462-11ggaqf1	1276	1	This	this	DT
cord-014462-11ggaqf1	1276	2	findings	finding	NNS
cord-014462-11ggaqf1	1276	3	indicated	indicate	VBD
cord-014462-11ggaqf1	1276	4	that	that	IN
cord-014462-11ggaqf1	1276	5	high	high	JJ
cord-014462-11ggaqf1	1276	6	degrees	degree	NNS
cord-014462-11ggaqf1	1276	7	of	of	IN
cord-014462-11ggaqf1	1276	8	genetic	genetic	JJ
cord-014462-11ggaqf1	1276	9	diversity	diversity	NN
cord-014462-11ggaqf1	1276	10	and	and	CC
cord-014462-11ggaqf1	1276	11	incongruent	incongruent	JJ
cord-014462-11ggaqf1	1276	12	relationships	relationship	NNS
cord-014462-11ggaqf1	1276	13	of	of	IN
cord-014462-11ggaqf1	1276	14	Indian	indian	JJ
cord-014462-11ggaqf1	1276	15	CTV	CTV	NNP
cord-014462-11ggaqf1	1276	16	isolates	isolate	NNS
cord-014462-11ggaqf1	1276	17	are	be	VBP
cord-014462-11ggaqf1	1276	18	due	due	JJ
cord-014462-11ggaqf1	1276	19	to	to	IN
cord-014462-11ggaqf1	1276	20	genetic	genetic	JJ
cord-014462-11ggaqf1	1276	21	recombination	recombination	NN
cord-014462-11ggaqf1	1276	22	occurred	occur	VBD
cord-014462-11ggaqf1	1276	23	,	,	,
cord-014462-11ggaqf1	1276	24	which	which	WDT
cord-014462-11ggaqf1	1276	25	may	may	MD
cord-014462-11ggaqf1	1276	26	be	be	VB
cord-014462-11ggaqf1	1276	27	the	the	DT
cord-014462-11ggaqf1	1276	28	important	important	JJ
cord-014462-11ggaqf1	1276	29	factors	factor	NNS
cord-014462-11ggaqf1	1276	30	in	in	IN
cord-014462-11ggaqf1	1276	31	driving	drive	VBG
cord-014462-11ggaqf1	1276	32	evolution	evolution	NN
cord-014462-11ggaqf1	1276	33	CTV	CTV	NNP
cord-014462-11ggaqf1	1276	34	variants	variant	NNS
cord-014462-11ggaqf1	1276	35	in	in	IN
cord-014462-11ggaqf1	1276	36	India	India	NNP
cord-014462-11ggaqf1	1276	37	,	,	,
cord-014462-11ggaqf1	1276	38	that	that	WDT
cord-014462-11ggaqf1	1276	39	was	be	VBD
cord-014462-11ggaqf1	1276	40	also	also	RB
cord-014462-11ggaqf1	1276	41	supported	support	VBN
cord-014462-11ggaqf1	1276	42	by	by	IN
cord-014462-11ggaqf1	1276	43	a	a	DT
cord-014462-11ggaqf1	1276	44	splitTree	splitTree	NNP
cord-014462-11ggaqf1	1276	45	decomposition	decomposition	NN
cord-014462-11ggaqf1	1276	46	analysis	analysis	NN
cord-014462-11ggaqf1	1276	47	.	.	.
cord-014462-11ggaqf1	1277	1	B.	B.	NNP
cord-014462-11ggaqf1	1277	2	V.	V.	NNP
cord-014462-11ggaqf1	1277	3	Bhaskara	Bhaskara	NNP
cord-014462-11ggaqf1	1277	4	Reddy	Reddy	NNP
cord-014462-11ggaqf1	1277	5	,	,	,
cord-014462-11ggaqf1	1277	6	Y.	Y.	NNP
cord-014462-11ggaqf1	1277	7	Sivaprasad	Sivaprasad	NNP
cord-014462-11ggaqf1	1277	8	,	,	,
cord-014462-11ggaqf1	1277	9	K.	K.	NNP
cord-014462-11ggaqf1	1277	10	Rekha	Rekha	NNP
cord-014462-11ggaqf1	1277	11	Rani	Rani	NNP
cord-014462-11ggaqf1	1277	12	,	,	,
cord-014462-11ggaqf1	1277	13	K.	K.	NNP
cord-014462-11ggaqf1	1277	14	Raja	Raja	NNP
cord-014462-11ggaqf1	1277	15	Reddy	Reddy	NNP
cord-014462-11ggaqf1	1277	16	Department	Department	NNP
cord-014462-11ggaqf1	1277	17	of	of	IN
cord-014462-11ggaqf1	1277	18	Plant	Plant	NNP
cord-014462-11ggaqf1	1277	19	Pathology	Pathology	NNP
cord-014462-11ggaqf1	1277	20	,	,	,
cord-014462-11ggaqf1	1277	21	Regional	Regional	NNP
cord-014462-11ggaqf1	1277	22	Agricultural	Agricultural	NNP
cord-014462-11ggaqf1	1277	23	Research	Research	NNP
cord-014462-11ggaqf1	1277	24	Station	Station	NNP
cord-014462-11ggaqf1	1277	25	,	,	,
cord-014462-11ggaqf1	1277	26	Acharya	Acharya	NNP
cord-014462-11ggaqf1	1277	27	N.G.	N.G.	NNP
cord-014462-11ggaqf1	1277	28	Ranga	Ranga	NNP
cord-014462-11ggaqf1	1277	29	Agricultural	Agricultural	NNP
cord-014462-11ggaqf1	1277	30	University	University	NNP
cord-014462-11ggaqf1	1277	31	,	,	,
cord-014462-11ggaqf1	1277	32	Tirupati	Tirupati	NNP
cord-014462-11ggaqf1	1277	33	,	,	,
cord-014462-11ggaqf1	1277	34	Andhra	Andhra	NNP
cord-014462-11ggaqf1	1277	35	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1277	36	Sunflower	Sunflower	NNP
cord-014462-11ggaqf1	1277	37	(	(	-LRB-
cord-014462-11ggaqf1	1277	38	Helianthus	Helianthus	NNP
cord-014462-11ggaqf1	1277	39	annus	annus	NN
cord-014462-11ggaqf1	1277	40	L.	L.	NNP
cord-014462-11ggaqf1	1277	41	)	)	-RRB-
cord-014462-11ggaqf1	1277	42	is	be	VBZ
cord-014462-11ggaqf1	1277	43	one	one	CD
cord-014462-11ggaqf1	1277	44	of	of	IN
cord-014462-11ggaqf1	1277	45	the	the	DT
cord-014462-11ggaqf1	1277	46	most	most	RBS
cord-014462-11ggaqf1	1277	47	important	important	JJ
cord-014462-11ggaqf1	1277	48	oil	oil	NN
cord-014462-11ggaqf1	1277	49	seed	seed	NN
cord-014462-11ggaqf1	1277	50	crops	crop	NNS
cord-014462-11ggaqf1	1277	51	in	in	IN
cord-014462-11ggaqf1	1277	52	the	the	DT
cord-014462-11ggaqf1	1277	53	world	world	NN
cord-014462-11ggaqf1	1277	54	which	which	WDT
cord-014462-11ggaqf1	1277	55	ranks	rank	VBZ
cord-014462-11ggaqf1	1277	56	third	third	RB
cord-014462-11ggaqf1	1277	57	in	in	IN
cord-014462-11ggaqf1	1277	58	area	area	NN
cord-014462-11ggaqf1	1277	59	after	after	IN
cord-014462-11ggaqf1	1277	60	Soyabean	Soyabean	NNP
cord-014462-11ggaqf1	1277	61	and	and	CC
cord-014462-11ggaqf1	1277	62	Groundnut	Groundnut	NNP
cord-014462-11ggaqf1	1277	63	.	.	.
cord-014462-11ggaqf1	1278	1	The	the	DT
cord-014462-11ggaqf1	1278	2	Sunflower	Sunflower	NNP
cord-014462-11ggaqf1	1278	3	Necrosis	Necrosis	NNP
cord-014462-11ggaqf1	1278	4	Disease	Disease	NNP
cord-014462-11ggaqf1	1278	5	(	(	-LRB-
cord-014462-11ggaqf1	1278	6	SND	SND	NNP
cord-014462-11ggaqf1	1278	7	)	)	-RRB-
cord-014462-11ggaqf1	1278	8	is	be	VBZ
cord-014462-11ggaqf1	1278	9	characterized	characterize	VBN
cord-014462-11ggaqf1	1278	10	by	by	IN
cord-014462-11ggaqf1	1278	11	necrosis	necrosis	NN
cord-014462-11ggaqf1	1278	12	of	of	IN
cord-014462-11ggaqf1	1278	13	leaves	leave	NNS
cord-014462-11ggaqf1	1278	14	,	,	,
cord-014462-11ggaqf1	1278	15	necrosis	necrosis	NN
cord-014462-11ggaqf1	1278	16	streaks	streak	NNS
cord-014462-11ggaqf1	1278	17	on	on	IN
cord-014462-11ggaqf1	1278	18	petioles	petiole	NNS
cord-014462-11ggaqf1	1278	19	,	,	,
cord-014462-11ggaqf1	1278	20	stem	stem	NN
cord-014462-11ggaqf1	1278	21	,	,	,
cord-014462-11ggaqf1	1278	22	floral	floral	JJ
cord-014462-11ggaqf1	1278	23	parts	part	NNS
cord-014462-11ggaqf1	1278	24	and	and	CC
cord-014462-11ggaqf1	1278	25	stunted	stunted	JJ
cord-014462-11ggaqf1	1278	26	growth	growth	NN
cord-014462-11ggaqf1	1278	27	.	.	.
cord-014462-11ggaqf1	1279	1	The	the	DT
cord-014462-11ggaqf1	1279	2	causal	causal	JJ
cord-014462-11ggaqf1	1279	3	agent	agent	NN
cord-014462-11ggaqf1	1279	4	of	of	IN
cord-014462-11ggaqf1	1279	5	the	the	DT
cord-014462-11ggaqf1	1279	6	disease	disease	NN
cord-014462-11ggaqf1	1279	7	has	have	VBZ
cord-014462-11ggaqf1	1279	8	been	be	VBN
cord-014462-11ggaqf1	1279	9	identified	identify	VBN
cord-014462-11ggaqf1	1279	10	as	as	IN
cord-014462-11ggaqf1	1279	11	Tobacco	tobacco	NN
cord-014462-11ggaqf1	1279	12	streak	streak	NN
cord-014462-11ggaqf1	1279	13	virus	virus	NN
cord-014462-11ggaqf1	1279	14	(	(	-LRB-
cord-014462-11ggaqf1	1279	15	TSV	TSV	NNP
cord-014462-11ggaqf1	1279	16	)	)	-RRB-
cord-014462-11ggaqf1	1279	17	which	which	WDT
cord-014462-11ggaqf1	1279	18	belongs	belong	VBZ
cord-014462-11ggaqf1	1279	19	to	to	TO
cord-014462-11ggaqf1	1279	20	genus	genus	VB
cord-014462-11ggaqf1	1279	21	Ilarvirus	Ilarvirus	NNP
cord-014462-11ggaqf1	1279	22	of	of	IN
cord-014462-11ggaqf1	1279	23	the	the	DT
cord-014462-11ggaqf1	1279	24	family	family	NN
cord-014462-11ggaqf1	1279	25	Bromoviridae	Bromoviridae	NNP
cord-014462-11ggaqf1	1279	26	.	.	.
cord-014462-11ggaqf1	1280	1	The	the	DT
cord-014462-11ggaqf1	1280	2	suspected	suspect	VBN
cord-014462-11ggaqf1	1280	3	TSV	TSV	NNP
cord-014462-11ggaqf1	1280	4	infected	infected	JJ
cord-014462-11ggaqf1	1280	5	sunflower	sunflower	NN
cord-014462-11ggaqf1	1280	6	samples	sample	NNS
cord-014462-11ggaqf1	1280	7	collected	collect	VBN
cord-014462-11ggaqf1	1280	8	from	from	IN
cord-014462-11ggaqf1	1280	9	chittoor	chittoor	NNP
cord-014462-11ggaqf1	1280	10	district	district	NN
cord-014462-11ggaqf1	1280	11	in	in	IN
cord-014462-11ggaqf1	1280	12	Andhra	Andhra	NNP
cord-014462-11ggaqf1	1280	13	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1280	14	were	be	VBD
cord-014462-11ggaqf1	1280	15	found	find	VBN
cord-014462-11ggaqf1	1280	16	positive	positive	JJ
cord-014462-11ggaqf1	1280	17	for	for	IN
cord-014462-11ggaqf1	1280	18	TSV	TSV	NNP
cord-014462-11ggaqf1	1280	19	-	-	HYPH
cord-014462-11ggaqf1	1280	20	DAC	DAC	NNP
cord-014462-11ggaqf1	1280	21	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1280	22	.	.	.
cord-014462-11ggaqf1	1281	1	Total	Total	NNP
cord-014462-11ggaqf1	1281	2	RNA	RNA	NNP
cord-014462-11ggaqf1	1281	3	was	be	VBD
cord-014462-11ggaqf1	1281	4	extracted	extract	VBN
cord-014462-11ggaqf1	1281	5	from	from	IN
cord-014462-11ggaqf1	1281	6	sunflower	sunflower	NN
cord-014462-11ggaqf1	1281	7	using	use	VBG
cord-014462-11ggaqf1	1281	8	RNAeasy	rnaeasy	NN
cord-014462-11ggaqf1	1281	9	isolation	isolation	NN
cord-014462-11ggaqf1	1281	10	kit	kit	NN
cord-014462-11ggaqf1	1281	11	(	(	-LRB-
cord-014462-11ggaqf1	1281	12	QIAGEN	QIAGEN	NNP
cord-014462-11ggaqf1	1281	13	)	)	-RRB-
cord-014462-11ggaqf1	1281	14	.	.	.
cord-014462-11ggaqf1	1282	1	The	the	DT
cord-014462-11ggaqf1	1282	2	TSV	TSV	NNP
cord-014462-11ggaqf1	1282	3	coat	coat	NN
cord-014462-11ggaqf1	1282	4	protein	protein	NN
cord-014462-11ggaqf1	1282	5	(	(	-LRB-
cord-014462-11ggaqf1	1282	6	CP	CP	NNP
cord-014462-11ggaqf1	1282	7	)	)	-RRB-
cord-014462-11ggaqf1	1282	8	gene	gene	NN
cord-014462-11ggaqf1	1282	9	,	,	,
cord-014462-11ggaqf1	1282	10	movement	movement	NN
cord-014462-11ggaqf1	1282	11	protein	protein	NN
cord-014462-11ggaqf1	1282	12	(	(	-LRB-
cord-014462-11ggaqf1	1282	13	MP	MP	NNP
cord-014462-11ggaqf1	1282	14	)	)	-RRB-
cord-014462-11ggaqf1	1282	15	gene	gene	NN
cord-014462-11ggaqf1	1282	16	and	and	CC
cord-014462-11ggaqf1	1282	17	replicase	replicase	NN
cord-014462-11ggaqf1	1282	18	(	(	-LRB-
cord-014462-11ggaqf1	1282	19	Rep	Rep	NNP
cord-014462-11ggaqf1	1282	20	)	)	-RRB-
cord-014462-11ggaqf1	1282	21	gene	gene	NN
cord-014462-11ggaqf1	1282	22	were	be	VBD
cord-014462-11ggaqf1	1282	23	amplified	amplify	VBN
cord-014462-11ggaqf1	1282	24	by	by	IN
cord-014462-11ggaqf1	1282	25	RT	RT	NNP
cord-014462-11ggaqf1	1282	26	-	-	HYPH
cord-014462-11ggaqf1	1282	27	PCR	PCR	NNP
cord-014462-11ggaqf1	1282	28	with	with	IN
cord-014462-11ggaqf1	1282	29	specific	specific	JJ
cord-014462-11ggaqf1	1282	30	primers	primer	NNS
cord-014462-11ggaqf1	1282	31	,	,	,
cord-014462-11ggaqf1	1282	32	cloned	clone	VBN
cord-014462-11ggaqf1	1282	33	in	in	IN
cord-014462-11ggaqf1	1282	34	pTZ57R	pTZ57R	NNS
cord-014462-11ggaqf1	1282	35	/	/	SYM
cord-014462-11ggaqf1	1282	36	T	t	NN
cord-014462-11ggaqf1	1282	37	vector	vector	NN
cord-014462-11ggaqf1	1282	38	,	,	,
cord-014462-11ggaqf1	1282	39	sequenced	sequence	VBN
cord-014462-11ggaqf1	1282	40	and	and	CC
cord-014462-11ggaqf1	1282	41	deposited	deposit	VBN
cord-014462-11ggaqf1	1282	42	in	in	IN
cord-014462-11ggaqf1	1282	43	GenBank	GenBank	NNP
cord-014462-11ggaqf1	1282	44	(	(	-LRB-
cord-014462-11ggaqf1	1282	45	GU355899	gu355899	NN
cord-014462-11ggaqf1	1282	46	,	,	,
cord-014462-11ggaqf1	1282	47	GU355900	GU355900	NNP
cord-014462-11ggaqf1	1282	48	and	and	CC
cord-014462-11ggaqf1	1282	49	GU371445	gu371445	NN
cord-014462-11ggaqf1	1282	50	)	)	-RRB-
cord-014462-11ggaqf1	1282	51	.	.	.
cord-014462-11ggaqf1	1283	1	The	the	DT
cord-014462-11ggaqf1	1283	2	size	size	NN
cord-014462-11ggaqf1	1283	3	of	of	IN
cord-014462-11ggaqf1	1283	4	cloned	clone	VBN
cord-014462-11ggaqf1	1283	5	CP	cp	NN
cord-014462-11ggaqf1	1283	6	gene	gene	NN
cord-014462-11ggaqf1	1283	7	was	be	VBD
cord-014462-11ggaqf1	1283	8	717	717	CD
cord-014462-11ggaqf1	1283	9	bp	bp	NNP
cord-014462-11ggaqf1	1283	10	and	and	CC
cord-014462-11ggaqf1	1283	11	codes	code	NNS
cord-014462-11ggaqf1	1283	12	for	for	IN
cord-014462-11ggaqf1	1283	13	239	239	CD
cord-014462-11ggaqf1	1283	14	amino	amino	JJ
cord-014462-11ggaqf1	1283	15	acids	acid	NNS
cord-014462-11ggaqf1	1283	16	.	.	.
cord-014462-11ggaqf1	1284	1	The	the	DT
cord-014462-11ggaqf1	1284	2	CP	cp	NN
cord-014462-11ggaqf1	1284	3	gene	gene	NN
cord-014462-11ggaqf1	1284	4	sequence	sequence	NN
cord-014462-11ggaqf1	1284	5	analysis	analysis	NN
cord-014462-11ggaqf1	1284	6	revealed	reveal	VBD
cord-014462-11ggaqf1	1284	7	that	that	IN
cord-014462-11ggaqf1	1284	8	the	the	DT
cord-014462-11ggaqf1	1284	9	TSV	TSV	NNP
cord-014462-11ggaqf1	1284	10	-	-	HYPH
cord-014462-11ggaqf1	1284	11	TPT	TPT	NNP
cord-014462-11ggaqf1	1284	12	infecting	infect	VBG
cord-014462-11ggaqf1	1284	13	sunflower	sunflower	NN
cord-014462-11ggaqf1	1284	14	has	have	VBZ
cord-014462-11ggaqf1	1284	15	98	98	CD
cord-014462-11ggaqf1	1284	16	-	-	SYM
cord-014462-11ggaqf1	1284	17	100	100	CD
cord-014462-11ggaqf1	1284	18	%	%	NN
cord-014462-11ggaqf1	1284	19	homology	homology	NN
cord-014462-11ggaqf1	1284	20	at	at	IN
cord-014462-11ggaqf1	1284	21	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1284	22	level	level	NN
cord-014462-11ggaqf1	1284	23	with	with	IN
cord-014462-11ggaqf1	1284	24	soybean	soybean	NN
cord-014462-11ggaqf1	1284	25	,	,	,
cord-014462-11ggaqf1	1284	26	tagietus	tagietus	NN
cord-014462-11ggaqf1	1284	27	-	-	HYPH
cord-014462-11ggaqf1	1284	28	TPT	TPT	NNP
cord-014462-11ggaqf1	1284	29	and	and	CC
cord-014462-11ggaqf1	1284	30	okra	okra	NN
cord-014462-11ggaqf1	1284	31	-	-	HYPH
cord-014462-11ggaqf1	1284	32	TN	TN	NNP
cord-014462-11ggaqf1	1284	33	isolates	isolate	NNS
cord-014462-11ggaqf1	1284	34	and	and	CC
cord-014462-11ggaqf1	1284	35	93	93	CD
cord-014462-11ggaqf1	1284	36	-	-	SYM
cord-014462-11ggaqf1	1284	37	99	99	CD
cord-014462-11ggaqf1	1284	38	%	%	NN
cord-014462-11ggaqf1	1284	39	homology	homology	NN
cord-014462-11ggaqf1	1284	40	at	at	IN
cord-014462-11ggaqf1	1284	41	amino	amino	NN
cord-014462-11ggaqf1	1284	42	acid	acid	NN
cord-014462-11ggaqf1	1284	43	level	level	NN
cord-014462-11ggaqf1	1284	44	.	.	.
cord-014462-11ggaqf1	1285	1	The	the	DT
cord-014462-11ggaqf1	1285	2	movement	movement	NN
cord-014462-11ggaqf1	1285	3	protein	protein	NN
cord-014462-11ggaqf1	1285	4	gene	gene	NN
cord-014462-11ggaqf1	1285	5	was	be	VBD
cord-014462-11ggaqf1	1285	6	615	615	CD
cord-014462-11ggaqf1	1285	7	bp	bp	NNP
cord-014462-11ggaqf1	1285	8	and	and	CC
cord-014462-11ggaqf1	1285	9	codes	code	NNS
cord-014462-11ggaqf1	1285	10	for	for	IN
cord-014462-11ggaqf1	1285	11	205	205	CD
cord-014462-11ggaqf1	1285	12	amino	amino	JJ
cord-014462-11ggaqf1	1285	13	acids	acid	NNS
cord-014462-11ggaqf1	1285	14	.	.	.
cord-014462-11ggaqf1	1286	1	The	the	DT
cord-014462-11ggaqf1	1286	2	MP	MP	NNP
cord-014462-11ggaqf1	1286	3	gene	gene	NN
cord-014462-11ggaqf1	1286	4	sequence	sequence	NN
cord-014462-11ggaqf1	1286	5	analysis	analysis	NN
cord-014462-11ggaqf1	1286	6	showed	show	VBD
cord-014462-11ggaqf1	1286	7	that	that	IN
cord-014462-11ggaqf1	1286	8	it	-PRON-	PRP
cord-014462-11ggaqf1	1286	9	has	have	VBZ
cord-014462-11ggaqf1	1286	10	94	94	CD
cord-014462-11ggaqf1	1286	11	-	-	SYM
cord-014462-11ggaqf1	1286	12	97	97	CD
cord-014462-11ggaqf1	1286	13	%	%	NN
cord-014462-11ggaqf1	1286	14	homology	homology	NN
cord-014462-11ggaqf1	1286	15	at	at	IN
cord-014462-11ggaqf1	1286	16	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1286	17	level	level	NN
cord-014462-11ggaqf1	1286	18	and	and	CC
cord-014462-11ggaqf1	1286	19	92	92	CD
cord-014462-11ggaqf1	1286	20	-	-	SYM
cord-014462-11ggaqf1	1286	21	95	95	CD
cord-014462-11ggaqf1	1286	22	%	%	NN
cord-014462-11ggaqf1	1286	23	at	at	IN
cord-014462-11ggaqf1	1286	24	aminoacid	aminoacid	JJ
cord-014462-11ggaqf1	1286	25	level	level	NN
cord-014462-11ggaqf1	1286	26	.	.	.
cord-014462-11ggaqf1	1287	1	Chilli	Chilli	NNP
cord-014462-11ggaqf1	1287	2	(	(	-LRB-
cord-014462-11ggaqf1	1287	3	Capsicum	capsicum	NN
cord-014462-11ggaqf1	1287	4	annuum	annuum	NN
cord-014462-11ggaqf1	1287	5	)	)	-RRB-
cord-014462-11ggaqf1	1287	6	,	,	,
cord-014462-11ggaqf1	1287	7	the	the	DT
cord-014462-11ggaqf1	1287	8	important	important	JJ
cord-014462-11ggaqf1	1287	9	commercial	commercial	JJ
cord-014462-11ggaqf1	1287	10	vegetable	vegetable	NN
cord-014462-11ggaqf1	1287	11	/	/	SYM
cord-014462-11ggaqf1	1287	12	spice	spice	NN
cord-014462-11ggaqf1	1287	13	of	of	IN
cord-014462-11ggaqf1	1287	14	Himachal	Himachal	NNP
cord-014462-11ggaqf1	1287	15	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1287	16	,	,	,
cord-014462-11ggaqf1	1287	17	is	be	VBZ
cord-014462-11ggaqf1	1287	18	affected	affect	VBN
cord-014462-11ggaqf1	1287	19	by	by	IN
cord-014462-11ggaqf1	1287	20	several	several	JJ
cord-014462-11ggaqf1	1287	21	viral	viral	JJ
cord-014462-11ggaqf1	1287	22	diseases	disease	NNS
cord-014462-11ggaqf1	1287	23	;	;	:
cord-014462-11ggaqf1	1287	24	of	of	IN
cord-014462-11ggaqf1	1287	25	them	-PRON-	PRP
cord-014462-11ggaqf1	1287	26	Cucumo	Cucumo	NNP
cord-014462-11ggaqf1	1287	27	,	,	,
cord-014462-11ggaqf1	1287	28	Tospo	Tospo	NNP
cord-014462-11ggaqf1	1287	29	,	,	,
cord-014462-11ggaqf1	1287	30	Poty	Poty	NNP
cord-014462-11ggaqf1	1287	31	and	and	CC
cord-014462-11ggaqf1	1287	32	Gemini	Gemini	NNP
cord-014462-11ggaqf1	1287	33	viruses	virus	NNS
cord-014462-11ggaqf1	1287	34	are	be	VBP
cord-014462-11ggaqf1	1287	35	the	the	DT
cord-014462-11ggaqf1	1287	36	most	most	RBS
cord-014462-11ggaqf1	1287	37	common	common	JJ
cord-014462-11ggaqf1	1287	38	genera	genus	NNS
cord-014462-11ggaqf1	1287	39	.	.	.
cord-014462-11ggaqf1	1288	1	However	however	RB
cord-014462-11ggaqf1	1288	2	,	,	,
cord-014462-11ggaqf1	1288	3	these	these	DT
cord-014462-11ggaqf1	1288	4	viruses	virus	NNS
cord-014462-11ggaqf1	1288	5	are	be	VBP
cord-014462-11ggaqf1	1288	6	not	not	RB
cord-014462-11ggaqf1	1288	7	identified	identify	VBN
cord-014462-11ggaqf1	1288	8	clearly	clearly	RB
cord-014462-11ggaqf1	1288	9	and	and	CC
cord-014462-11ggaqf1	1288	10	characterized	characterize	VBN
cord-014462-11ggaqf1	1288	11	fully	fully	RB
cord-014462-11ggaqf1	1288	12	,	,	,
cord-014462-11ggaqf1	1288	13	which	which	WDT
cord-014462-11ggaqf1	1288	14	are	be	VBP
cord-014462-11ggaqf1	1288	15	foremost	foremost	RB
cord-014462-11ggaqf1	1288	16	needed	need	VBN
cord-014462-11ggaqf1	1288	17	to	to	TO
cord-014462-11ggaqf1	1288	18	formulate	formulate	VB
cord-014462-11ggaqf1	1288	19	the	the	DT
cord-014462-11ggaqf1	1288	20	management	management	NN
cord-014462-11ggaqf1	1288	21	strategy	strategy	NN
cord-014462-11ggaqf1	1288	22	.	.	.
cord-014462-11ggaqf1	1289	1	Therefore	therefore	RB
cord-014462-11ggaqf1	1289	2	,	,	,
cord-014462-11ggaqf1	1289	3	in	in	IN
cord-014462-11ggaqf1	1289	4	the	the	DT
cord-014462-11ggaqf1	1289	5	present	present	JJ
cord-014462-11ggaqf1	1289	6	study	study	NN
cord-014462-11ggaqf1	1289	7	,	,	,
cord-014462-11ggaqf1	1289	8	effort	effort	NN
cord-014462-11ggaqf1	1289	9	has	have	VBZ
cord-014462-11ggaqf1	1289	10	been	be	VBN
cord-014462-11ggaqf1	1289	11	made	make	VBN
cord-014462-11ggaqf1	1289	12	to	to	TO
cord-014462-11ggaqf1	1289	13	identify	identify	VB
cord-014462-11ggaqf1	1289	14	and	and	CC
cord-014462-11ggaqf1	1289	15	characterize	characterize	VB
cord-014462-11ggaqf1	1289	16	the	the	DT
cord-014462-11ggaqf1	1289	17	important	important	JJ
cord-014462-11ggaqf1	1289	18	viruses	virus	NNS
cord-014462-11ggaqf1	1289	19	causing	cause	VBG
cord-014462-11ggaqf1	1289	20	diseases	disease	NNS
cord-014462-11ggaqf1	1289	21	in	in	IN
cord-014462-11ggaqf1	1289	22	chilli	chilli	NN
cord-014462-11ggaqf1	1289	23	.	.	.
cord-014462-11ggaqf1	1290	1	In	in	IN
cord-014462-11ggaqf1	1290	2	this	this	DT
cord-014462-11ggaqf1	1290	3	study	study	NN
cord-014462-11ggaqf1	1290	4	,	,	,
cord-014462-11ggaqf1	1290	5	several	several	JJ
cord-014462-11ggaqf1	1290	6	farms	farm	NNS
cord-014462-11ggaqf1	1290	7	in	in	IN
cord-014462-11ggaqf1	1290	8	major	major	JJ
cord-014462-11ggaqf1	1290	9	chilli	chilli	NN
cord-014462-11ggaqf1	1290	10	growing	grow	VBG
cord-014462-11ggaqf1	1290	11	areas	area	NNS
cord-014462-11ggaqf1	1290	12	of	of	IN
cord-014462-11ggaqf1	1290	13	Bilaspur	Bilaspur	NNP
cord-014462-11ggaqf1	1290	14	and	and	CC
cord-014462-11ggaqf1	1290	15	Kangra	Kangra	NNP
cord-014462-11ggaqf1	1290	16	districts	district	NNS
cord-014462-11ggaqf1	1290	17	in	in	IN
cord-014462-11ggaqf1	1290	18	Himachal	Himachal	NNP
cord-014462-11ggaqf1	1290	19	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1290	20	were	be	VBD
cord-014462-11ggaqf1	1290	21	surveyed	survey	VBN
cord-014462-11ggaqf1	1290	22	and	and	CC
cord-014462-11ggaqf1	1290	23	infected	infected	JJ
cord-014462-11ggaqf1	1290	24	plant	plant	NN
cord-014462-11ggaqf1	1290	25	samples	sample	NNS
cord-014462-11ggaqf1	1290	26	were	be	VBD
cord-014462-11ggaqf1	1290	27	collected	collect	VBN
cord-014462-11ggaqf1	1290	28	randomly	randomly	RB
cord-014462-11ggaqf1	1290	29	.	.	.
cord-014462-11ggaqf1	1291	1	Virus	virus	NN
cord-014462-11ggaqf1	1291	2	infection	infection	NN
cord-014462-11ggaqf1	1291	3	in	in	IN
cord-014462-11ggaqf1	1291	4	these	these	DT
cord-014462-11ggaqf1	1291	5	samples	sample	NNS
cord-014462-11ggaqf1	1291	6	were	be	VBD
cord-014462-11ggaqf1	1291	7	detected	detect	VBN
cord-014462-11ggaqf1	1291	8	by	by	IN
cord-014462-11ggaqf1	1291	9	DAS	DAS	NNP
cord-014462-11ggaqf1	1291	10	-	-	HYPH
cord-014462-11ggaqf1	1291	11	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1291	12	using	use	VBG
cord-014462-11ggaqf1	1291	13	antisera	antisera	NN
cord-014462-11ggaqf1	1291	14	to	to	IN
cord-014462-11ggaqf1	1291	15	Cucumber	cucumber	NN
cord-014462-11ggaqf1	1291	16	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1291	17	virus	virus	NN
cord-014462-11ggaqf1	1291	18	(	(	-LRB-
cord-014462-11ggaqf1	1291	19	CMV	CMV	NNP
cord-014462-11ggaqf1	1291	20	)	)	-RRB-
cord-014462-11ggaqf1	1291	21	and	and	CC
cord-014462-11ggaqf1	1291	22	potyvirus	potyvirus	NNP
cord-014462-11ggaqf1	1291	23	(	(	-LRB-
cord-014462-11ggaqf1	1291	24	group	group	NN
cord-014462-11ggaqf1	1291	25	specific	specific	NNP
cord-014462-11ggaqf1	1291	26	)	)	-RRB-
cord-014462-11ggaqf1	1291	27	and	and	CC
cord-014462-11ggaqf1	1291	28	through	through	IN
cord-014462-11ggaqf1	1291	29	slot	slot	NN
cord-014462-11ggaqf1	1291	30	-	-	HYPH
cord-014462-11ggaqf1	1291	31	blot	blot	NN
cord-014462-11ggaqf1	1291	32	hybridization	hybridization	NN
cord-014462-11ggaqf1	1291	33	(	(	-LRB-
cord-014462-11ggaqf1	1291	34	SBH	SBH	NNP
cord-014462-11ggaqf1	1291	35	)	)	-RRB-
cord-014462-11ggaqf1	1291	36	using	use	VBG
cord-014462-11ggaqf1	1291	37	CMV	CMV	NNP
cord-014462-11ggaqf1	1291	38	,	,	,
cord-014462-11ggaqf1	1291	39	Iris	Iris	NNP
cord-014462-11ggaqf1	1291	40	severe	severe	JJ
cord-014462-11ggaqf1	1291	41	mosaic	mosaic	NN
cord-014462-11ggaqf1	1291	42	poty	poty	NNP
cord-014462-11ggaqf1	1291	43	virus	virus	NN
cord-014462-11ggaqf1	1291	44	(	(	-LRB-
cord-014462-11ggaqf1	1291	45	ISMV	ISMV	NNP
cord-014462-11ggaqf1	1291	46	)	)	-RRB-
cord-014462-11ggaqf1	1291	47	,	,	,
cord-014462-11ggaqf1	1291	48	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1291	49	spotted	spot	VBN
cord-014462-11ggaqf1	1291	50	wilt	wilt	NN
cord-014462-11ggaqf1	1291	51	tospo	tospo	NNP
cord-014462-11ggaqf1	1291	52	virus	virus	NN
cord-014462-11ggaqf1	1291	53	(	(	-LRB-
cord-014462-11ggaqf1	1291	54	TSWV	TSWV	NNP
cord-014462-11ggaqf1	1291	55	)	)	-RRB-
cord-014462-11ggaqf1	1291	56	and	and	CC
cord-014462-11ggaqf1	1291	57	Chilli	Chilli	NNP
cord-014462-11ggaqf1	1291	58	leaf	leaf	NN
cord-014462-11ggaqf1	1291	59	curl	curl	NN
cord-014462-11ggaqf1	1291	60	gemini	gemini	NN
cord-014462-11ggaqf1	1291	61	virus	virus	NN
cord-014462-11ggaqf1	1291	62	(	(	-LRB-
cord-014462-11ggaqf1	1291	63	CLCuV	CLCuV	NNP
cord-014462-11ggaqf1	1291	64	)	)	-RRB-
cord-014462-11ggaqf1	1291	65	.	.	.
cord-014462-11ggaqf1	1292	1	Based	base	VBN
cord-014462-11ggaqf1	1292	2	on	on	IN
cord-014462-11ggaqf1	1292	3	DAS	DAS	NNP
cord-014462-11ggaqf1	1292	4	-	-	HYPH
cord-014462-11ggaqf1	1292	5	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1292	6	and	and	CC
cord-014462-11ggaqf1	1292	7	SBH	SBH	NNP
cord-014462-11ggaqf1	1292	8	,	,	,
cord-014462-11ggaqf1	1292	9	the	the	DT
cord-014462-11ggaqf1	1292	10	incidence	incidence	NN
cord-014462-11ggaqf1	1292	11	of	of	IN
cord-014462-11ggaqf1	1292	12	disease	disease	NN
cord-014462-11ggaqf1	1292	13	was	be	VBD
cord-014462-11ggaqf1	1292	14	estimated	estimate	VBN
cord-014462-11ggaqf1	1292	15	and	and	CC
cord-014462-11ggaqf1	1292	16	ranged	range	VBD
cord-014462-11ggaqf1	1292	17	from	from	IN
cord-014462-11ggaqf1	1292	18	18.2	18.2	CD
cord-014462-11ggaqf1	1292	19	to	to	IN
cord-014462-11ggaqf1	1292	20	21.8	21.8	CD
cord-014462-11ggaqf1	1292	21	%	%	NN
cord-014462-11ggaqf1	1292	22	by	by	IN
cord-014462-11ggaqf1	1292	23	CMV	CMV	NNP
cord-014462-11ggaqf1	1292	24	and	and	CC
cord-014462-11ggaqf1	1292	25	3.5	3.5	CD
cord-014462-11ggaqf1	1292	26	to	to	TO
cord-014462-11ggaqf1	1292	27	5.4	5.4	CD
cord-014462-11ggaqf1	1292	28	%	%	NN
cord-014462-11ggaqf1	1292	29	by	by	IN
cord-014462-11ggaqf1	1292	30	potyvirus	potyvirus	NNP
cord-014462-11ggaqf1	1292	31	.	.	.
cord-014462-11ggaqf1	1293	1	To	to	TO
cord-014462-11ggaqf1	1293	2	detect	detect	VB
cord-014462-11ggaqf1	1293	3	Tospo	Tospo	NNP
cord-014462-11ggaqf1	1293	4	and	and	CC
cord-014462-11ggaqf1	1293	5	Geminivirus	Geminivirus	NNP
cord-014462-11ggaqf1	1293	6	in	in	IN
cord-014462-11ggaqf1	1293	7	the	the	DT
cord-014462-11ggaqf1	1293	8	infected	infected	JJ
cord-014462-11ggaqf1	1293	9	chilli	chilli	NN
cord-014462-11ggaqf1	1293	10	,	,	,
cord-014462-11ggaqf1	1293	11	SBH	SBH	NNP
cord-014462-11ggaqf1	1293	12	test	test	NN
cord-014462-11ggaqf1	1293	13	was	be	VBD
cord-014462-11ggaqf1	1293	14	carried	carry	VBN
cord-014462-11ggaqf1	1293	15	out	out	RP
cord-014462-11ggaqf1	1293	16	.	.	.
cord-014462-11ggaqf1	1294	1	Infected	infected	JJ
cord-014462-11ggaqf1	1294	2	samples	sample	NNS
cord-014462-11ggaqf1	1294	3	showed	show	VBD
cord-014462-11ggaqf1	1294	4	maximum	maximum	JJ
cord-014462-11ggaqf1	1294	5	virus	virus	NN
cord-014462-11ggaqf1	1294	6	titer	titer	NN
cord-014462-11ggaqf1	1294	7	in	in	IN
cord-014462-11ggaqf1	1294	8	both	both	CC
cord-014462-11ggaqf1	1294	9	DAS	DAS	NNP
cord-014462-11ggaqf1	1294	10	-	-	HYPH
cord-014462-11ggaqf1	1294	11	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1294	12	and	and	CC
cord-014462-11ggaqf1	1294	13	SBH	SBH	NNP
cord-014462-11ggaqf1	1294	14	test	test	NN
cord-014462-11ggaqf1	1294	15	were	be	VBD
cord-014462-11ggaqf1	1294	16	further	further	RB
cord-014462-11ggaqf1	1294	17	confirmed	confirm	VBN
cord-014462-11ggaqf1	1294	18	by	by	IN
cord-014462-11ggaqf1	1294	19	PCR	PCR	NNP
cord-014462-11ggaqf1	1294	20	using	use	VBG
cord-014462-11ggaqf1	1294	21	specific	specific	JJ
cord-014462-11ggaqf1	1294	22	primers	primer	NNS
cord-014462-11ggaqf1	1294	23	.	.	.
cord-014462-11ggaqf1	1295	1	Desired	desire	VBN
cord-014462-11ggaqf1	1295	2	sizes	size	NNS
cord-014462-11ggaqf1	1295	3	of	of	IN
cord-014462-11ggaqf1	1295	4	amplicons	amplicon	NNS
cord-014462-11ggaqf1	1295	5	;	;	.
cord-014462-11ggaqf1	1296	1	*	*	NFP
cord-014462-11ggaqf1	1296	2	540	540	CD
cord-014462-11ggaqf1	1296	3	bp	bp	NNP
cord-014462-11ggaqf1	1296	4	,	,	,
cord-014462-11ggaqf1	1296	5	*	*	NFP
cord-014462-11ggaqf1	1296	6	800	800	CD
cord-014462-11ggaqf1	1296	7	bp	bp	NNP
cord-014462-11ggaqf1	1296	8	,	,	,
cord-014462-11ggaqf1	1296	9	*	*	NFP
cord-014462-11ggaqf1	1297	1	570	570	CD
cord-014462-11ggaqf1	1297	2	bp	bp	NNP
cord-014462-11ggaqf1	1297	3	and	and	CC
cord-014462-11ggaqf1	1297	4	*	*	NFP
cord-014462-11ggaqf1	1297	5	460	460	CD
cord-014462-11ggaqf1	1297	6	bp	bp	NNP
cord-014462-11ggaqf1	1297	7	of	of	IN
cord-014462-11ggaqf1	1297	8	CMV	CMV	NNP
cord-014462-11ggaqf1	1297	9	,	,	,
cord-014462-11ggaqf1	1297	10	Poty	Poty	NNP
cord-014462-11ggaqf1	1297	11	,	,	,
cord-014462-11ggaqf1	1297	12	Gemini	Gemini	NNP
cord-014462-11ggaqf1	1297	13	and	and	CC
cord-014462-11ggaqf1	1297	14	Tospo	Tospo	NNP
cord-014462-11ggaqf1	1297	15	viruses	virus	NNS
cord-014462-11ggaqf1	1297	16	,	,	,
cord-014462-11ggaqf1	1297	17	respectively	respectively	RB
cord-014462-11ggaqf1	1297	18	,	,	,
cord-014462-11ggaqf1	1297	19	were	be	VBD
cord-014462-11ggaqf1	1297	20	obtained	obtain	VBN
cord-014462-11ggaqf1	1297	21	.	.	.
cord-014462-11ggaqf1	1298	1	As	as	IN
cord-014462-11ggaqf1	1298	2	the	the	DT
cord-014462-11ggaqf1	1298	3	present	present	JJ
cord-014462-11ggaqf1	1298	4	study	study	NN
cord-014462-11ggaqf1	1298	5	clearly	clearly	RB
cord-014462-11ggaqf1	1298	6	indicated	indicate	VBD
cord-014462-11ggaqf1	1298	7	that	that	IN
cord-014462-11ggaqf1	1298	8	CMV	CMV	NNP
cord-014462-11ggaqf1	1298	9	appeared	appear	VBD
cord-014462-11ggaqf1	1298	10	as	as	IN
cord-014462-11ggaqf1	1298	11	a	a	DT
cord-014462-11ggaqf1	1298	12	major	major	JJ
cord-014462-11ggaqf1	1298	13	one	one	NN
cord-014462-11ggaqf1	1298	14	among	among	IN
cord-014462-11ggaqf1	1298	15	the	the	DT
cord-014462-11ggaqf1	1298	16	viruses	virus	NNS
cord-014462-11ggaqf1	1298	17	infecting	infect	VBG
cord-014462-11ggaqf1	1298	18	chilli	chilli	NN
cord-014462-11ggaqf1	1298	19	in	in	IN
cord-014462-11ggaqf1	1298	20	the	the	DT
cord-014462-11ggaqf1	1298	21	hilly	hilly	JJ
cord-014462-11ggaqf1	1298	22	region	region	NN
cord-014462-11ggaqf1	1298	23	of	of	IN
cord-014462-11ggaqf1	1298	24	Himachal	Himachal	NNP
cord-014462-11ggaqf1	1298	25	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1298	26	,	,	,
cord-014462-11ggaqf1	1298	27	two	two	CD
cord-014462-11ggaqf1	1298	28	isolates	isolate	NNS
cord-014462-11ggaqf1	1298	29	of	of	IN
cord-014462-11ggaqf1	1298	30	CMV	CMV	NNP
cord-014462-11ggaqf1	1298	31	were	be	VBD
cord-014462-11ggaqf1	1298	32	characterized	characterize	VBN
cord-014462-11ggaqf1	1298	33	in	in	IN
cord-014462-11ggaqf1	1298	34	genetic	genetic	JJ
cord-014462-11ggaqf1	1298	35	level	level	NN
cord-014462-11ggaqf1	1298	36	.	.	.
cord-014462-11ggaqf1	1299	1	Thus	thus	RB
cord-014462-11ggaqf1	1299	2	the	the	DT
cord-014462-11ggaqf1	1299	3	amplified	amplified	JJ
cord-014462-11ggaqf1	1299	4	products	product	NNS
cord-014462-11ggaqf1	1299	5	(	(	-LRB-
cord-014462-11ggaqf1	1299	6	*	*	NFP
cord-014462-11ggaqf1	1299	7	540	540	CD
cord-014462-11ggaqf1	1299	8	bp	bp	NNP
cord-014462-11ggaqf1	1299	9	)	)	-RRB-
cord-014462-11ggaqf1	1299	10	of	of	IN
cord-014462-11ggaqf1	1299	11	CMV	CMV	NNP
cord-014462-11ggaqf1	1299	12	,	,	,
cord-014462-11ggaqf1	1299	13	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1299	14	1	1	CD
cord-014462-11ggaqf1	1299	15	and	and	CC
cord-014462-11ggaqf1	1299	16	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1299	17	2	2	CD
cord-014462-11ggaqf1	1299	18	were	be	VBD
cord-014462-11ggaqf1	1299	19	cloned	clone	VBN
cord-014462-11ggaqf1	1299	20	in	in	IN
cord-014462-11ggaqf1	1299	21	pGEMT	pGEMT	NNP
cord-014462-11ggaqf1	1299	22	cloning	cloning	NN
cord-014462-11ggaqf1	1299	23	vector	vector	NN
cord-014462-11ggaqf1	1299	24	,	,	,
cord-014462-11ggaqf1	1299	25	sequenced	sequence	VBN
cord-014462-11ggaqf1	1299	26	and	and	CC
cord-014462-11ggaqf1	1299	27	the	the	DT
cord-014462-11ggaqf1	1299	28	sequences	sequence	NNS
cord-014462-11ggaqf1	1299	29	were	be	VBD
cord-014462-11ggaqf1	1299	30	submitted	submit	VBN
cord-014462-11ggaqf1	1299	31	to	to	IN
cord-014462-11ggaqf1	1299	32	NCBI	NCBI	NNP
cord-014462-11ggaqf1	1299	33	database	database	NN
cord-014462-11ggaqf1	1299	34	(	(	-LRB-
cord-014462-11ggaqf1	1299	35	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1299	36	1	1	CD
cord-014462-11ggaqf1	1299	37	:	:	:
cord-014462-11ggaqf1	1299	38	Acc	acc	NN
cord-014462-11ggaqf1	1299	39	-	-	HYPH
cord-014462-11ggaqf1	1299	40	FM209497	FM209497	NNP
cord-014462-11ggaqf1	1299	41	and	and	CC
cord-014462-11ggaqf1	1299	42	Palampur	Palampur	NNP
cord-014462-11ggaqf1	1299	43	2	2	CD
cord-014462-11ggaqf1	1299	44	:	:	:
cord-014462-11ggaqf1	1299	45	Acc	acc	NN
cord-014462-11ggaqf1	1299	46	-	-	HYPH
cord-014462-11ggaqf1	1299	47	FM209498	FM209498	NNP
cord-014462-11ggaqf1	1299	48	)	)	-RRB-
cord-014462-11ggaqf1	1299	49	.	.	.
cord-014462-11ggaqf1	1300	1	The	the	DT
cord-014462-11ggaqf1	1300	2	sequences	sequence	NNS
cord-014462-11ggaqf1	1300	3	were	be	VBD
cord-014462-11ggaqf1	1300	4	then	then	RB
cord-014462-11ggaqf1	1300	5	analyzed	analyze	VBN
cord-014462-11ggaqf1	1300	6	and	and	CC
cord-014462-11ggaqf1	1300	7	compared	compare	VBN
cord-014462-11ggaqf1	1300	8	with	with	IN
cord-014462-11ggaqf1	1300	9	other	other	JJ
cord-014462-11ggaqf1	1300	10	sequences	sequence	NNS
cord-014462-11ggaqf1	1300	11	available	available	JJ
cord-014462-11ggaqf1	1300	12	in	in	IN
cord-014462-11ggaqf1	1300	13	the	the	DT
cord-014462-11ggaqf1	1300	14	data	data	NN
cord-014462-11ggaqf1	1300	15	base	base	NN
cord-014462-11ggaqf1	1300	16	.	.	.
cord-014462-11ggaqf1	1301	1	Based	base	VBN
cord-014462-11ggaqf1	1301	2	on	on	IN
cord-014462-11ggaqf1	1301	3	sequence	sequence	NN
cord-014462-11ggaqf1	1301	4	analysis	analysis	NN
cord-014462-11ggaqf1	1301	5	,	,	,
cord-014462-11ggaqf1	1301	6	it	-PRON-	PRP
cord-014462-11ggaqf1	1301	7	was	be	VBD
cord-014462-11ggaqf1	1301	8	found	find	VBN
cord-014462-11ggaqf1	1301	9	that	that	IN
cord-014462-11ggaqf1	1301	10	present	present	JJ
cord-014462-11ggaqf1	1301	11	CMV	CMV	NNP
cord-014462-11ggaqf1	1301	12	isolates	isolate	NNS
cord-014462-11ggaqf1	1301	13	shared	share	VBD
cord-014462-11ggaqf1	1301	14	99	99	CD
cord-014462-11ggaqf1	1301	15	%	%	NN
cord-014462-11ggaqf1	1301	16	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1301	17	identity	identity	NN
cord-014462-11ggaqf1	1301	18	between	between	IN
cord-014462-11ggaqf1	1301	19	them	-PRON-	PRP
cord-014462-11ggaqf1	1301	20	,	,	,
cord-014462-11ggaqf1	1301	21	are	be	VBP
cord-014462-11ggaqf1	1301	22	closely	closely	RB
cord-014462-11ggaqf1	1301	23	related	relate	VBN
cord-014462-11ggaqf1	1301	24	with	with	IN
cord-014462-11ggaqf1	1302	1	Australian	australian	JJ
cord-014462-11ggaqf1	1302	2	CMV	CMV	NNP
cord-014462-11ggaqf1	1302	3	isolate	isolate	VBP
cord-014462-11ggaqf1	1302	4	CMV	CMV	NNP
cord-014462-11ggaqf1	1302	5	-	-	HYPH
cord-014462-11ggaqf1	1302	6	Ly	Ly	NNP
cord-014462-11ggaqf1	1302	7	(	(	-LRB-
cord-014462-11ggaqf1	1302	8	Acc	acc	NN
cord-014462-11ggaqf1	1302	9	-	-	HYPH
cord-014462-11ggaqf1	1302	10	AF198103	AF198103	NNP
cord-014462-11ggaqf1	1302	11	)	)	-RRB-
cord-014462-11ggaqf1	1302	12	by	by	IN
cord-014462-11ggaqf1	1302	13	98	98	CD
cord-014462-11ggaqf1	1302	14	%	%	NN
cord-014462-11ggaqf1	1302	15	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1302	16	identity	identity	NN
cord-014462-11ggaqf1	1302	17	.	.	.
cord-014462-11ggaqf1	1303	1	In	in	IN
cord-014462-11ggaqf1	1303	2	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1303	3	tree	tree	NN
cord-014462-11ggaqf1	1303	4	analysis	analysis	NN
cord-014462-11ggaqf1	1303	5	,	,	,
cord-014462-11ggaqf1	1303	6	it	-PRON-	PRP
cord-014462-11ggaqf1	1303	7	was	be	VBD
cord-014462-11ggaqf1	1303	8	observed	observe	VBN
cord-014462-11ggaqf1	1303	9	that	that	IN
cord-014462-11ggaqf1	1303	10	Indian	indian	JJ
cord-014462-11ggaqf1	1303	11	CMV	CMV	NNP
cord-014462-11ggaqf1	1303	12	isolates	isolate	NNS
cord-014462-11ggaqf1	1303	13	formed	form	VBN
cord-014462-11ggaqf1	1303	14	same	same	JJ
cord-014462-11ggaqf1	1303	15	cluster	cluster	NN
cord-014462-11ggaqf1	1303	16	along	along	IN
cord-014462-11ggaqf1	1303	17	with	with	IN
cord-014462-11ggaqf1	1303	18	CMV	CMV	NNP
cord-014462-11ggaqf1	1303	19	-	-	HYPH
cord-014462-11ggaqf1	1303	20	Ly	Ly	NNP
cord-014462-11ggaqf1	1303	21	.	.	.
cord-014462-11ggaqf1	1304	1	As	as	IN
cord-014462-11ggaqf1	1304	2	it	-PRON-	PRP
cord-014462-11ggaqf1	1304	3	is	be	VBZ
cord-014462-11ggaqf1	1304	4	known	know	VBN
cord-014462-11ggaqf1	1304	5	that	that	IN
cord-014462-11ggaqf1	1304	6	CMV	CMV	NNP
cord-014462-11ggaqf1	1304	7	subgroup	subgroup	NN
cord-014462-11ggaqf1	1304	8	II	II	NNP
cord-014462-11ggaqf1	1304	9	comprises	comprise	VBZ
cord-014462-11ggaqf1	1304	10	CMV	CMV	NNP
cord-014462-11ggaqf1	1304	11	-	-	HYPH
cord-014462-11ggaqf1	1304	12	Ly	Ly	NNP
cord-014462-11ggaqf1	1304	13	,	,	,
cord-014462-11ggaqf1	1304	14	it	-PRON-	PRP
cord-014462-11ggaqf1	1304	15	is	be	VBZ
cord-014462-11ggaqf1	1304	16	concluded	conclude	VBN
cord-014462-11ggaqf1	1304	17	that	that	IN
cord-014462-11ggaqf1	1304	18	the	the	DT
cord-014462-11ggaqf1	1304	19	CMVs	cmv	NNS
cord-014462-11ggaqf1	1304	20	of	of	IN
cord-014462-11ggaqf1	1304	21	this	this	DT
cord-014462-11ggaqf1	1304	22	hilly	hilly	JJ
cord-014462-11ggaqf1	1304	23	region	region	NN
cord-014462-11ggaqf1	1304	24	of	of	IN
cord-014462-11ggaqf1	1304	25	Himachal	Himachal	NNP
cord-014462-11ggaqf1	1304	26	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1304	27	belong	belong	VBP
cord-014462-11ggaqf1	1304	28	to	to	IN
cord-014462-11ggaqf1	1304	29	subgroup	subgroup	NN
cord-014462-11ggaqf1	1304	30	II	II	NNP
cord-014462-11ggaqf1	1304	31	.	.	.
cord-014462-11ggaqf1	1305	1	Chilli	Chilli	NNP
cord-014462-11ggaqf1	1305	2	is	be	VBZ
cord-014462-11ggaqf1	1305	3	essentially	essentially	RB
cord-014462-11ggaqf1	1305	4	a	a	DT
cord-014462-11ggaqf1	1305	5	crop	crop	NN
cord-014462-11ggaqf1	1305	6	of	of	IN
cord-014462-11ggaqf1	1305	7	the	the	DT
cord-014462-11ggaqf1	1305	8	tropics	tropic	NNS
cord-014462-11ggaqf1	1305	9	and	and	CC
cord-014462-11ggaqf1	1305	10	grows	grow	VBZ
cord-014462-11ggaqf1	1305	11	better	well	JJR
cord-014462-11ggaqf1	1305	12	in	in	IN
cord-014462-11ggaqf1	1305	13	hotter	hot	JJR
cord-014462-11ggaqf1	1305	14	regions	region	NNS
cord-014462-11ggaqf1	1305	15	.	.	.
cord-014462-11ggaqf1	1306	1	Chlii	Chlii	NNP
cord-014462-11ggaqf1	1306	2	(	(	-LRB-
cord-014462-11ggaqf1	1306	3	Capsicum	capsicum	NN
cord-014462-11ggaqf1	1306	4	annuum	annuum	NN
cord-014462-11ggaqf1	1306	5	)	)	-RRB-
cord-014462-11ggaqf1	1306	6	,	,	,
cord-014462-11ggaqf1	1306	7	a	a	DT
cord-014462-11ggaqf1	1306	8	member	member	NN
cord-014462-11ggaqf1	1306	9	of	of	IN
cord-014462-11ggaqf1	1306	10	family	family	NN
cord-014462-11ggaqf1	1306	11	solanaceae	solanaceae	NN
cord-014462-11ggaqf1	1306	12	is	be	VBZ
cord-014462-11ggaqf1	1306	13	an	an	DT
cord-014462-11ggaqf1	1306	14	important	important	JJ
cord-014462-11ggaqf1	1306	15	vegetable	vegetable	NN
cord-014462-11ggaqf1	1306	16	and	and	CC
cord-014462-11ggaqf1	1306	17	spice	spice	NN
cord-014462-11ggaqf1	1306	18	crop	crop	NN
cord-014462-11ggaqf1	1306	19	of	of	IN
cord-014462-11ggaqf1	1306	20	immense	immense	JJ
cord-014462-11ggaqf1	1306	21	commercial	commercial	JJ
cord-014462-11ggaqf1	1306	22	importance	importance	NN
cord-014462-11ggaqf1	1306	23	.	.	.
cord-014462-11ggaqf1	1307	1	The	the	DT
cord-014462-11ggaqf1	1307	2	pungency	pungency	NN
cord-014462-11ggaqf1	1307	3	in	in	IN
cord-014462-11ggaqf1	1307	4	pepper	pepper	NN
cord-014462-11ggaqf1	1307	5	is	be	VBZ
cord-014462-11ggaqf1	1307	6	due	due	JJ
cord-014462-11ggaqf1	1307	7	to	to	IN
cord-014462-11ggaqf1	1307	8	an	an	DT
cord-014462-11ggaqf1	1307	9	alkaloid	alkaloid	NN
cord-014462-11ggaqf1	1307	10	known	know	VBN
cord-014462-11ggaqf1	1307	11	as	as	IN
cord-014462-11ggaqf1	1307	12	capsaicine	capsaicine	NN
cord-014462-11ggaqf1	1307	13	and	and	CC
cord-014462-11ggaqf1	1307	14	peppers	pepper	NNS
cord-014462-11ggaqf1	1307	15	are	be	VBP
cord-014462-11ggaqf1	1307	16	characterized	characterize	VBN
cord-014462-11ggaqf1	1307	17	as	as	IN
cord-014462-11ggaqf1	1307	18	sweet	sweet	JJ
cord-014462-11ggaqf1	1307	19	,	,	,
cord-014462-11ggaqf1	1307	20	hot	hot	JJ
cord-014462-11ggaqf1	1307	21	or	or	CC
cord-014462-11ggaqf1	1307	22	mild	mild	JJ
cord-014462-11ggaqf1	1307	23	depending	depending	NN
cord-014462-11ggaqf1	1307	24	on	on	IN
cord-014462-11ggaqf1	1307	25	capsaicine	capsaicine	NN
cord-014462-11ggaqf1	1307	26	content	content	NN
cord-014462-11ggaqf1	1307	27	.	.	.
cord-014462-11ggaqf1	1308	1	The	the	DT
cord-014462-11ggaqf1	1308	2	present	present	JJ
cord-014462-11ggaqf1	1308	3	investigation	investigation	NN
cord-014462-11ggaqf1	1308	4	were	be	VBD
cord-014462-11ggaqf1	1308	5	conducted	conduct	VBN
cord-014462-11ggaqf1	1308	6	to	to	TO
cord-014462-11ggaqf1	1308	7	find	find	VB
cord-014462-11ggaqf1	1308	8	out	out	RP
cord-014462-11ggaqf1	1308	9	the	the	DT
cord-014462-11ggaqf1	1308	10	highly	highly	RB
cord-014462-11ggaqf1	1308	11	resistant	resistant	JJ
cord-014462-11ggaqf1	1308	12	cultivars	cultivar	NNS
cord-014462-11ggaqf1	1308	13	of	of	IN
cord-014462-11ggaqf1	1308	14	Capsicum	capsicum	NN
cord-014462-11ggaqf1	1308	15	annuum	annuum	NN
cord-014462-11ggaqf1	1308	16	against	against	IN
cord-014462-11ggaqf1	1308	17	CMV	CMV	NNP
cord-014462-11ggaqf1	1308	18	and	and	CC
cord-014462-11ggaqf1	1308	19	TYLCV	TYLCV	NNP
cord-014462-11ggaqf1	1308	20	among	among	IN
cord-014462-11ggaqf1	1308	21	ten	ten	CD
cord-014462-11ggaqf1	1308	22	cultivars	cultivar	NNS
cord-014462-11ggaqf1	1308	23	of	of	IN
cord-014462-11ggaqf1	1308	24	chilli	chilli	NN
cord-014462-11ggaqf1	1308	25	in	in	IN
cord-014462-11ggaqf1	1308	26	agroclimatic	agroclimatic	JJ
cord-014462-11ggaqf1	1308	27	condition	condition	NN
cord-014462-11ggaqf1	1308	28	of	of	IN
cord-014462-11ggaqf1	1308	29	Aligarh	Aligarh	NNP
cord-014462-11ggaqf1	1308	30	.	.	.
cord-014462-11ggaqf1	1309	1	The	the	DT
cord-014462-11ggaqf1	1309	2	highest	high	JJS
cord-014462-11ggaqf1	1309	3	(	(	-LRB-
cord-014462-11ggaqf1	1309	4	70	70	CD
cord-014462-11ggaqf1	1309	5	and	and	CC
cord-014462-11ggaqf1	1309	6	80	80	CD
cord-014462-11ggaqf1	1309	7	)	)	-RRB-
cord-014462-11ggaqf1	1309	8	percentage	percentage	NN
cord-014462-11ggaqf1	1309	9	of	of	IN
cord-014462-11ggaqf1	1309	10	infection	infection	NN
cord-014462-11ggaqf1	1309	11	was	be	VBD
cord-014462-11ggaqf1	1309	12	observed	observe	VBN
cord-014462-11ggaqf1	1309	13	in	in	IN
cord-014462-11ggaqf1	1309	14	HC-201	hc-201	PRP
cord-014462-11ggaqf1	1309	15	and	and	CC
cord-014462-11ggaqf1	1309	16	Kalyanpur	Kalyanpur	NNP
cord-014462-11ggaqf1	1309	17	type-1	type-1	NN
cord-014462-11ggaqf1	1309	18	by	by	IN
cord-014462-11ggaqf1	1309	19	showing	show	VBG
cord-014462-11ggaqf1	1309	20	the	the	DT
cord-014462-11ggaqf1	1309	21	positive	positive	JJ
cord-014462-11ggaqf1	1309	22	reaction	reaction	NN
cord-014462-11ggaqf1	1309	23	to	to	IN
cord-014462-11ggaqf1	1309	24	CMV	CMV	NNP
cord-014462-11ggaqf1	1309	25	by	by	IN
cord-014462-11ggaqf1	1309	26	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1309	27	test	test	NN
cord-014462-11ggaqf1	1309	28	.	.	.
cord-014462-11ggaqf1	1310	1	No	no	DT
cord-014462-11ggaqf1	1310	2	symptoms	symptom	NNS
cord-014462-11ggaqf1	1310	3	was	be	VBD
cord-014462-11ggaqf1	1310	4	recorded	record	VBN
cord-014462-11ggaqf1	1310	5	in	in	IN
cord-014462-11ggaqf1	1310	6	case	case	NN
cord-014462-11ggaqf1	1310	7	of	of	IN
cord-014462-11ggaqf1	1310	8	BC-16	BC-16	NNP
cord-014462-11ggaqf1	1310	9	,	,	,
cord-014462-11ggaqf1	1310	10	LCA-235	LCA-235	NNP
cord-014462-11ggaqf1	1310	11	and	and	CC
cord-014462-11ggaqf1	1310	12	JCA-154	jca-154	RB
cord-014462-11ggaqf1	1310	13	and	and	CC
cord-014462-11ggaqf1	1310	14	showed	show	VBD
cord-014462-11ggaqf1	1310	15	negative	negative	JJ
cord-014462-11ggaqf1	1310	16	reaction	reaction	NN
cord-014462-11ggaqf1	1310	17	to	to	IN
cord-014462-11ggaqf1	1310	18	CMV	CMV	NNP
cord-014462-11ggaqf1	1310	19	by	by	IN
cord-014462-11ggaqf1	1310	20	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1310	21	.	.	.
cord-014462-11ggaqf1	1311	1	BC-16	BC-16	NNP
cord-014462-11ggaqf1	1311	2	and	and	CC
cord-014462-11ggaqf1	1311	3	LCA-235	LCA-235	NNP
cord-014462-11ggaqf1	1311	4	also	also	RB
cord-014462-11ggaqf1	1311	5	showed	show	VBD
cord-014462-11ggaqf1	1311	6	negative	negative	JJ
cord-014462-11ggaqf1	1311	7	reaction	reaction	NN
cord-014462-11ggaqf1	1311	8	to	to	IN
cord-014462-11ggaqf1	1311	9	TYLCV	TYLCV	NNP
cord-014462-11ggaqf1	1311	10	by	by	IN
cord-014462-11ggaqf1	1311	11	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1311	12	and	and	CC
cord-014462-11ggaqf1	1311	13	these	these	DT
cord-014462-11ggaqf1	1311	14	were	be	VBD
cord-014462-11ggaqf1	1311	15	symptomless	symptomless	JJ
cord-014462-11ggaqf1	1311	16	.	.	.
cord-014462-11ggaqf1	1312	1	Maximum	maximum	JJ
cord-014462-11ggaqf1	1312	2	infection	infection	NN
cord-014462-11ggaqf1	1312	3	(	(	-LRB-
cord-014462-11ggaqf1	1312	4	70	70	CD
cord-014462-11ggaqf1	1312	5	and	and	CC
cord-014462-11ggaqf1	1312	6	80	80	CD
cord-014462-11ggaqf1	1312	7	)	)	-RRB-
cord-014462-11ggaqf1	1312	8	was	be	VBD
cord-014462-11ggaqf1	1312	9	registered	register	VBN
cord-014462-11ggaqf1	1312	10	in	in	IN
cord-014462-11ggaqf1	1312	11	HC-201	HC-201	NNP
cord-014462-11ggaqf1	1312	12	and	and	CC
cord-014462-11ggaqf1	1312	13	C	C	NNP
cord-014462-11ggaqf1	1312	14	8	8	CD
cord-014462-11ggaqf1	1312	15	,	,	,
cord-014462-11ggaqf1	1312	16	cultivar	cultivar	NN
cord-014462-11ggaqf1	1312	17	.	.	.
cord-014462-11ggaqf1	1313	1	So	so	RB
cord-014462-11ggaqf1	1313	2	,	,	,
cord-014462-11ggaqf1	1313	3	the	the	DT
cord-014462-11ggaqf1	1313	4	BC-16	BC-16	NNP
cord-014462-11ggaqf1	1313	5	,	,	,
cord-014462-11ggaqf1	1313	6	LCA-235	LCA-235	NNP
cord-014462-11ggaqf1	1313	7	and	and	CC
cord-014462-11ggaqf1	1313	8	JCA-154	JCA-154	NNS
cord-014462-11ggaqf1	1313	9	has	have	VBZ
cord-014462-11ggaqf1	1313	10	proved	prove	VBN
cord-014462-11ggaqf1	1313	11	highly	highly	RB
cord-014462-11ggaqf1	1313	12	resistant	resistant	JJ
cord-014462-11ggaqf1	1313	13	varieties	variety	NNS
cord-014462-11ggaqf1	1313	14	against	against	IN
cord-014462-11ggaqf1	1313	15	CMV	CMV	NNP
cord-014462-11ggaqf1	1313	16	and	and	CC
cord-014462-11ggaqf1	1313	17	TYLCV	TYLCV	NNP
cord-014462-11ggaqf1	1313	18	and	and	CC
cord-014462-11ggaqf1	1313	19	these	these	DT
cord-014462-11ggaqf1	1313	20	may	may	MD
cord-014462-11ggaqf1	1313	21	be	be	VB
cord-014462-11ggaqf1	1313	22	used	use	VBN
cord-014462-11ggaqf1	1313	23	in	in	IN
cord-014462-11ggaqf1	1313	24	breeding	breed	VBG
cord-014462-11ggaqf1	1313	25	programmes	programme	NNS
cord-014462-11ggaqf1	1313	26	against	against	IN
cord-014462-11ggaqf1	1313	27	viruses	virus	NNS
cord-014462-11ggaqf1	1313	28	.	.	.
cord-014462-11ggaqf1	1314	1	Cotton	cotton	NN
cord-014462-11ggaqf1	1314	2	leaf	leaf	NN
cord-014462-11ggaqf1	1314	3	curl	curl	NN
cord-014462-11ggaqf1	1314	4	virus	virus	NN
cord-014462-11ggaqf1	1314	5	belongs	belong	VBZ
cord-014462-11ggaqf1	1314	6	to	to	IN
cord-014462-11ggaqf1	1314	7	the	the	DT
cord-014462-11ggaqf1	1314	8	family	family	NN
cord-014462-11ggaqf1	1314	9	Geminiviridae	Geminiviridae	NNP
cord-014462-11ggaqf1	1314	10	,	,	,
cord-014462-11ggaqf1	1314	11	genus	genus	NN
cord-014462-11ggaqf1	1314	12	Begomovirus	Begomovirus	NNP
cord-014462-11ggaqf1	1314	13	.	.	.
cord-014462-11ggaqf1	1315	1	The	the	DT
cord-014462-11ggaqf1	1315	2	members	member	NNS
cord-014462-11ggaqf1	1315	3	of	of	IN
cord-014462-11ggaqf1	1315	4	this	this	DT
cord-014462-11ggaqf1	1315	5	family	family	NN
cord-014462-11ggaqf1	1315	6	contain	contain	VBP
cord-014462-11ggaqf1	1315	7	circular	circular	JJ
cord-014462-11ggaqf1	1315	8	single	single	JJ
cord-014462-11ggaqf1	1315	9	stranded	strand	VBN
cord-014462-11ggaqf1	1315	10	DNA	dna	NN
cord-014462-11ggaqf1	1315	11	molecules	molecule	NNS
cord-014462-11ggaqf1	1315	12	as	as	IN
cord-014462-11ggaqf1	1315	13	their	-PRON-	PRP$
cord-014462-11ggaqf1	1315	14	genomes	genome	NNS
cord-014462-11ggaqf1	1315	15	.	.	.
cord-014462-11ggaqf1	1316	1	There	there	EX
cord-014462-11ggaqf1	1316	2	are	be	VBP
cord-014462-11ggaqf1	1316	3	two	two	CD
cord-014462-11ggaqf1	1316	4	kinds	kind	NNS
cord-014462-11ggaqf1	1316	5	of	of	IN
cord-014462-11ggaqf1	1316	6	begomoviruses	begomoviruse	NNS
cord-014462-11ggaqf1	1316	7	-	-	HYPH
cord-014462-11ggaqf1	1316	8	bipartite	bipartite	JJ
cord-014462-11ggaqf1	1316	9	viruses	virus	NNS
cord-014462-11ggaqf1	1316	10	with	with	IN
cord-014462-11ggaqf1	1316	11	genomes	genome	NNS
cord-014462-11ggaqf1	1316	12	consisting	consist	VBG
cord-014462-11ggaqf1	1316	13	of	of	IN
cord-014462-11ggaqf1	1316	14	two	two	CD
cord-014462-11ggaqf1	1316	15	DNA	dna	NN
cord-014462-11ggaqf1	1316	16	molecules	molecule	NNS
cord-014462-11ggaqf1	1316	17	designated	designate	VBN
cord-014462-11ggaqf1	1316	18	DNA	DNA	NNP
cord-014462-11ggaqf1	1316	19	-	-	HYPH
cord-014462-11ggaqf1	1316	20	A	A	NNP
cord-014462-11ggaqf1	1316	21	and	and	CC
cord-014462-11ggaqf1	1316	22	DNA	dna	NN
cord-014462-11ggaqf1	1316	23	-	-	HYPH
cord-014462-11ggaqf1	1316	24	B	b	NN
cord-014462-11ggaqf1	1316	25	and	and	CC
cord-014462-11ggaqf1	1316	26	the	the	DT
cord-014462-11ggaqf1	1316	27	monopartite	monopartite	JJ
cord-014462-11ggaqf1	1316	28	viruses	virus	NNS
cord-014462-11ggaqf1	1316	29	which	which	WDT
cord-014462-11ggaqf1	1316	30	contain	contain	VBP
cord-014462-11ggaqf1	1316	31	only	only	RB
cord-014462-11ggaqf1	1316	32	DNA	dna	NN
cord-014462-11ggaqf1	1316	33	-	-	HYPH
cord-014462-11ggaqf1	1316	34	A	a	NN
cord-014462-11ggaqf1	1317	1	but	but	CC
cord-014462-11ggaqf1	1317	2	not	not	RB
cord-014462-11ggaqf1	1317	3	DNA	DNA	NNP
cord-014462-11ggaqf1	1317	4	-	-	HYPH
cord-014462-11ggaqf1	1317	5	B.	b.	NN
cord-014462-11ggaqf1	1318	1	In	in	IN
cord-014462-11ggaqf1	1318	2	monopartite	monopartite	JJ
cord-014462-11ggaqf1	1318	3	viruses	virus	NNS
cord-014462-11ggaqf1	1318	4	,	,	,
cord-014462-11ggaqf1	1318	5	the	the	DT
cord-014462-11ggaqf1	1318	6	DNA	DNA	NNP
cord-014462-11ggaqf1	1318	7	-	-	HYPH
cord-014462-11ggaqf1	1318	8	A	A	NNP
cord-014462-11ggaqf1	1318	9	is	be	VBZ
cord-014462-11ggaqf1	1318	10	accompanied	accompany	VBN
cord-014462-11ggaqf1	1318	11	by	by	IN
cord-014462-11ggaqf1	1318	12	a	a	DT
cord-014462-11ggaqf1	1318	13	small	small	JJ
cord-014462-11ggaqf1	1318	14	circular	circular	JJ
cord-014462-11ggaqf1	1318	15	DNA	dna	NN
cord-014462-11ggaqf1	1318	16	molecule	molecule	NN
cord-014462-11ggaqf1	1318	17	called	call	VBN
cord-014462-11ggaqf1	1318	18	DNA	dna	NN
cord-014462-11ggaqf1	1318	19	-	-	HYPH
cord-014462-11ggaqf1	1318	20	b	b	NNP
cord-014462-11ggaqf1	1318	21	which	which	WDT
cord-014462-11ggaqf1	1318	22	is	be	VBZ
cord-014462-11ggaqf1	1318	23	essential	essential	JJ
cord-014462-11ggaqf1	1318	24	for	for	IN
cord-014462-11ggaqf1	1318	25	the	the	DT
cord-014462-11ggaqf1	1318	26	development	development	NN
cord-014462-11ggaqf1	1318	27	of	of	IN
cord-014462-11ggaqf1	1318	28	typical	typical	JJ
cord-014462-11ggaqf1	1318	29	disease	disease	NN
cord-014462-11ggaqf1	1318	30	symptoms	symptom	NNS
cord-014462-11ggaqf1	1318	31	.	.	.
cord-014462-11ggaqf1	1319	1	Cotton	cotton	NN
cord-014462-11ggaqf1	1319	2	leaf	leaf	NN
cord-014462-11ggaqf1	1319	3	curl	curl	NN
cord-014462-11ggaqf1	1319	4	virus	virus	NN
cord-014462-11ggaqf1	1319	5	is	be	VBZ
cord-014462-11ggaqf1	1319	6	a	a	DT
cord-014462-11ggaqf1	1319	7	monopartite	monopartite	JJ
cord-014462-11ggaqf1	1319	8	virus	virus	NN
cord-014462-11ggaqf1	1319	9	and	and	CC
cord-014462-11ggaqf1	1319	10	causes	cause	VBZ
cord-014462-11ggaqf1	1319	11	the	the	DT
cord-014462-11ggaqf1	1319	12	cotton	cotton	NN
cord-014462-11ggaqf1	1319	13	leaf	leaf	NN
cord-014462-11ggaqf1	1319	14	curl	curl	NN
cord-014462-11ggaqf1	1319	15	disease	disease	NN
cord-014462-11ggaqf1	1319	16	which	which	WDT
cord-014462-11ggaqf1	1319	17	has	have	VBZ
cord-014462-11ggaqf1	1319	18	emerged	emerge	VBN
cord-014462-11ggaqf1	1319	19	as	as	IN
cord-014462-11ggaqf1	1319	20	a	a	DT
cord-014462-11ggaqf1	1319	21	major	major	JJ
cord-014462-11ggaqf1	1319	22	disease	disease	NN
cord-014462-11ggaqf1	1319	23	of	of	IN
cord-014462-11ggaqf1	1319	24	cotton	cotton	NN
cord-014462-11ggaqf1	1319	25	in	in	IN
cord-014462-11ggaqf1	1319	26	the	the	DT
cord-014462-11ggaqf1	1319	27	Indian	indian	JJ
cord-014462-11ggaqf1	1319	28	subcontinent	subcontinent	NN
cord-014462-11ggaqf1	1319	29	.	.	.
cord-014462-11ggaqf1	1320	1	The	the	DT
cord-014462-11ggaqf1	1320	2	non	non	JJ
cord-014462-11ggaqf1	1320	3	-	-	JJ
cord-014462-11ggaqf1	1320	4	structural	structural	JJ
cord-014462-11ggaqf1	1320	5	protein	protein	NN
cord-014462-11ggaqf1	1320	6	AC4	AC4	NNP
cord-014462-11ggaqf1	1320	7	of	of	IN
cord-014462-11ggaqf1	1320	8	Cotton	Cotton	NNP
cord-014462-11ggaqf1	1320	9	leaf	leaf	NN
cord-014462-11ggaqf1	1320	10	curl	curl	NN
cord-014462-11ggaqf1	1320	11	Kokhran	Kokhran	NNP
cord-014462-11ggaqf1	1320	12	virus	virus	NN
cord-014462-11ggaqf1	1320	13	-	-	:
cord-014462-11ggaqf1	1320	14	Dabawali	Dabawali	NNP
cord-014462-11ggaqf1	1320	15	isolate	isolate	NN
cord-014462-11ggaqf1	1320	16	(	(	-LRB-
cord-014462-11ggaqf1	1320	17	CLCuKV	CLCuKV	NNP
cord-014462-11ggaqf1	1320	18	-	-	HYPH
cord-014462-11ggaqf1	1320	19	Dab	Dab	NNP
cord-014462-11ggaqf1	1320	20	)	)	-RRB-
cord-014462-11ggaqf1	1320	21	was	be	VBD
cord-014462-11ggaqf1	1320	22	cloned	clone	VBN
cord-014462-11ggaqf1	1320	23	into	into	IN
cord-014462-11ggaqf1	1320	24	PGEX5X2	pgex5x2	CD
cord-014462-11ggaqf1	1320	25	vector	vector	NN
cord-014462-11ggaqf1	1320	26	and	and	CC
cord-014462-11ggaqf1	1320	27	overexpressed	overexpresse	VBN
cord-014462-11ggaqf1	1320	28	in	in	IN
cord-014462-11ggaqf1	1320	29	BL21(DE3)PlysS	BL21(DE3)PlysS	NNP
cord-014462-11ggaqf1	1320	30	E.	E.	NNP
cord-014462-11ggaqf1	1320	31	coli	coli	NNS
cord-014462-11ggaqf1	1320	32	cells	cell	NNS
cord-014462-11ggaqf1	1320	33	.	.	.
cord-014462-11ggaqf1	1321	1	The	the	DT
cord-014462-11ggaqf1	1321	2	overexpressed	overexpresse	VBN
cord-014462-11ggaqf1	1321	3	GST	gst	NN
cord-014462-11ggaqf1	1321	4	-	-	HYPH
cord-014462-11ggaqf1	1321	5	AC4	ac4	NN
cord-014462-11ggaqf1	1321	6	protein	protein	NN
cord-014462-11ggaqf1	1321	7	was	be	VBD
cord-014462-11ggaqf1	1321	8	purified	purify	VBN
cord-014462-11ggaqf1	1321	9	by	by	IN
cord-014462-11ggaqf1	1321	10	glutathione	glutathione	NN
cord-014462-11ggaqf1	1321	11	Sepharose	Sepharose	NNP
cord-014462-11ggaqf1	1321	12	chromatography	chromatography	NN
cord-014462-11ggaqf1	1321	13	.	.	.
cord-014462-11ggaqf1	1322	1	The	the	DT
cord-014462-11ggaqf1	1322	2	purified	purify	VBN
cord-014462-11ggaqf1	1322	3	GST	gst	NN
cord-014462-11ggaqf1	1322	4	-	-	HYPH
cord-014462-11ggaqf1	1322	5	AC4	ac4	NN
cord-014462-11ggaqf1	1322	6	protein	protein	NN
cord-014462-11ggaqf1	1322	7	was	be	VBD
cord-014462-11ggaqf1	1322	8	found	find	VBN
cord-014462-11ggaqf1	1322	9	to	to	TO
cord-014462-11ggaqf1	1322	10	possess	possess	VB
cord-014462-11ggaqf1	1322	11	ATPase	ATPase	NNP
cord-014462-11ggaqf1	1322	12	activity	activity	NN
cord-014462-11ggaqf1	1322	13	.	.	.
cord-014462-11ggaqf1	1323	1	The	the	DT
cord-014462-11ggaqf1	1323	2	optimum	optimum	JJ
cord-014462-11ggaqf1	1323	3	temperature	temperature	NN
cord-014462-11ggaqf1	1323	4	and	and	CC
cord-014462-11ggaqf1	1323	5	pH	ph	NN
cord-014462-11ggaqf1	1323	6	for	for	IN
cord-014462-11ggaqf1	1323	7	the	the	DT
cord-014462-11ggaqf1	1323	8	activity	activity	NN
cord-014462-11ggaqf1	1323	9	were	be	VBD
cord-014462-11ggaqf1	1323	10	37	37	CD
cord-014462-11ggaqf1	1323	11	°	°	NN
cord-014462-11ggaqf1	1323	12	C	c	NN
cord-014462-11ggaqf1	1323	13	and	and	CC
cord-014462-11ggaqf1	1323	14	7.4	7.4	CD
cord-014462-11ggaqf1	1323	15	respectively	respectively	RB
cord-014462-11ggaqf1	1323	16	.	.	.
cord-014462-11ggaqf1	1324	1	The	the	DT
cord-014462-11ggaqf1	1324	2	ATPase	ATPase	NNP
cord-014462-11ggaqf1	1324	3	activity	activity	NN
cord-014462-11ggaqf1	1324	4	was	be	VBD
cord-014462-11ggaqf1	1324	5	inhibited	inhibit	VBN
cord-014462-11ggaqf1	1324	6	in	in	IN
cord-014462-11ggaqf1	1324	7	presence	presence	NN
cord-014462-11ggaqf1	1324	8	of	of	IN
cord-014462-11ggaqf1	1324	9	EDTA	EDTA	NNP
cord-014462-11ggaqf1	1324	10	,	,	,
cord-014462-11ggaqf1	1324	11	showing	show	VBG
cord-014462-11ggaqf1	1324	12	that	that	IN
cord-014462-11ggaqf1	1324	13	it	-PRON-	PRP
cord-014462-11ggaqf1	1324	14	is	be	VBZ
cord-014462-11ggaqf1	1324	15	dependent	dependent	JJ
cord-014462-11ggaqf1	1324	16	on	on	IN
cord-014462-11ggaqf1	1324	17	divalent	divalent	JJ
cord-014462-11ggaqf1	1324	18	metal	metal	NN
cord-014462-11ggaqf1	1324	19	ions	ion	NNS
cord-014462-11ggaqf1	1324	20	.	.	.
cord-014462-11ggaqf1	1325	1	The	the	DT
cord-014462-11ggaqf1	1325	2	activity	activity	NN
cord-014462-11ggaqf1	1325	3	was	be	VBD
cord-014462-11ggaqf1	1325	4	supported	support	VBN
cord-014462-11ggaqf1	1325	5	by	by	IN
cord-014462-11ggaqf1	1325	6	magnesium	magnesium	NN
cord-014462-11ggaqf1	1325	7	,	,	,
cord-014462-11ggaqf1	1325	8	manganese	manganese	NN
cord-014462-11ggaqf1	1325	9	and	and	CC
cord-014462-11ggaqf1	1325	10	zinc	zinc	NN
cord-014462-11ggaqf1	1325	11	ions	ion	NNS
cord-014462-11ggaqf1	1325	12	but	but	CC
cord-014462-11ggaqf1	1325	13	inhibited	inhibit	VBN
cord-014462-11ggaqf1	1325	14	in	in	IN
cord-014462-11ggaqf1	1325	15	presence	presence	NN
cord-014462-11ggaqf1	1325	16	of	of	IN
cord-014462-11ggaqf1	1325	17	calcium	calcium	NN
cord-014462-11ggaqf1	1325	18	ions	ion	NNS
cord-014462-11ggaqf1	1325	19	.	.	.
cord-014462-11ggaqf1	1326	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1326	2	was	be	VBD
cord-014462-11ggaqf1	1326	3	also	also	RB
cord-014462-11ggaqf1	1326	4	inhibited	inhibit	VBN
cord-014462-11ggaqf1	1326	5	by	by	IN
cord-014462-11ggaqf1	1326	6	the	the	DT
cord-014462-11ggaqf1	1326	7	non	non	JJ
cord-014462-11ggaqf1	1326	8	-	-	JJ
cord-014462-11ggaqf1	1326	9	hydrolyzable	hydrolyzable	JJ
cord-014462-11ggaqf1	1326	10	ATP	ATP	NNP
cord-014462-11ggaqf1	1326	11	analogue	analogue	NN
cord-014462-11ggaqf1	1326	12	adenosine	adenosine	NN
cord-014462-11ggaqf1	1326	13	-	-	HYPH
cord-014462-11ggaqf1	1326	14	b	b	NN
cord-014462-11ggaqf1	1326	15	,	,	,
cord-014462-11ggaqf1	1326	16	c	c	NN
cord-014462-11ggaqf1	1326	17	-	-	HYPH
cord-014462-11ggaqf1	1326	18	imido	imido	NNP
cord-014462-11ggaqf1	1326	19	triphosphate	triphosphate	NN
cord-014462-11ggaqf1	1326	20	and	and	CC
cord-014462-11ggaqf1	1326	21	in	in	IN
cord-014462-11ggaqf1	1326	22	the	the	DT
cord-014462-11ggaqf1	1326	23	presence	presence	NN
cord-014462-11ggaqf1	1326	24	of	of	IN
cord-014462-11ggaqf1	1326	25	other	other	JJ
cord-014462-11ggaqf1	1326	26	nucleotides	nucleotide	NNS
cord-014462-11ggaqf1	1326	27	like	like	IN
cord-014462-11ggaqf1	1326	28	CTP	CTP	NNP
cord-014462-11ggaqf1	1326	29	and	and	CC
cord-014462-11ggaqf1	1326	30	GTP	GTP	NNP
cord-014462-11ggaqf1	1326	31	.	.	.
cord-014462-11ggaqf1	1327	1	The	the	DT
cord-014462-11ggaqf1	1327	2	K	K	NNP
cord-014462-11ggaqf1	1327	3	m	m	NNP
cord-014462-11ggaqf1	1327	4	and	and	CC
cord-014462-11ggaqf1	1327	5	the	the	DT
cord-014462-11ggaqf1	1327	6	V	V	NNP
cord-014462-11ggaqf1	1327	7	max	max	NN
cord-014462-11ggaqf1	1327	8	of	of	IN
cord-014462-11ggaqf1	1327	9	the	the	DT
cord-014462-11ggaqf1	1327	10	reaction	reaction	NN
cord-014462-11ggaqf1	1327	11	for	for	IN
cord-014462-11ggaqf1	1327	12	ATP	ATP	NNP
cord-014462-11ggaqf1	1327	13	as	as	IN
cord-014462-11ggaqf1	1327	14	the	the	DT
cord-014462-11ggaqf1	1327	15	substrate	substrate	NN
cord-014462-11ggaqf1	1327	16	are	be	VBP
cord-014462-11ggaqf1	1327	17	1.54	1.54	CD
cord-014462-11ggaqf1	1327	18	mM	mm	CD
cord-014462-11ggaqf1	1327	19	and	and	CC
cord-014462-11ggaqf1	1327	20	95.2	95.2	CD
cord-014462-11ggaqf1	1327	21	nmol	nmol	JJ
cord-014462-11ggaqf1	1327	22	/	/	SYM
cord-014462-11ggaqf1	1327	23	min/	min/	NNP
cord-014462-11ggaqf1	1327	24	mg	mg	NNP
cord-014462-11ggaqf1	1327	25	of	of	IN
cord-014462-11ggaqf1	1327	26	the	the	DT
cord-014462-11ggaqf1	1327	27	protein	protein	NN
cord-014462-11ggaqf1	1327	28	respectively	respectively	RB
cord-014462-11ggaqf1	1327	29	.	.	.
cord-014462-11ggaqf1	1328	1	The	the	DT
cord-014462-11ggaqf1	1328	2	enzyme	enzyme	NN
cord-014462-11ggaqf1	1328	3	could	could	MD
cord-014462-11ggaqf1	1328	4	also	also	RB
cord-014462-11ggaqf1	1328	5	utilize	utilize	VB
cord-014462-11ggaqf1	1328	6	GTP	GTP	NNP
cord-014462-11ggaqf1	1328	7	as	as	IN
cord-014462-11ggaqf1	1328	8	the	the	DT
cord-014462-11ggaqf1	1328	9	substrate	substrate	NN
cord-014462-11ggaqf1	1328	10	.	.	.
cord-014462-11ggaqf1	1329	1	The	the	DT
cord-014462-11ggaqf1	1329	2	fact	fact	NN
cord-014462-11ggaqf1	1329	3	that	that	IN
cord-014462-11ggaqf1	1329	4	AC4	AC4	NNP
cord-014462-11ggaqf1	1329	5	is	be	VBZ
cord-014462-11ggaqf1	1329	6	specifically	specifically	RB
cord-014462-11ggaqf1	1329	7	an	an	DT
cord-014462-11ggaqf1	1329	8	NTPase	NTPase	NNP
cord-014462-11ggaqf1	1329	9	and	and	CC
cord-014462-11ggaqf1	1329	10	not	not	RB
cord-014462-11ggaqf1	1329	11	a	a	DT
cord-014462-11ggaqf1	1329	12	general	general	JJ
cord-014462-11ggaqf1	1329	13	phosphatase	phosphatase	NN
cord-014462-11ggaqf1	1329	14	is	be	VBZ
cord-014462-11ggaqf1	1329	15	revealed	reveal	VBN
cord-014462-11ggaqf1	1329	16	by	by	IN
cord-014462-11ggaqf1	1329	17	the	the	DT
cord-014462-11ggaqf1	1329	18	finding	finding	NN
cord-014462-11ggaqf1	1329	19	that	that	IN
cord-014462-11ggaqf1	1329	20	it	-PRON-	PRP
cord-014462-11ggaqf1	1329	21	does	do	VBZ
cord-014462-11ggaqf1	1329	22	not	not	RB
cord-014462-11ggaqf1	1329	23	hydrolyze	hydrolyze	VB
cord-014462-11ggaqf1	1329	24	p	p	CD
cord-014462-11ggaqf1	1329	25	-	-	:
cord-014462-11ggaqf1	1329	26	Nitrophenyl	nitrophenyl	NN
cord-014462-11ggaqf1	1329	27	phosphate	phosphate	NN
cord-014462-11ggaqf1	1329	28	to	to	TO
cord-014462-11ggaqf1	1329	29	yield	yield	VB
cord-014462-11ggaqf1	1329	30	yellow	yellow	JJ
cord-014462-11ggaqf1	1329	31	colour	colour	NN
cord-014462-11ggaqf1	1329	32	while	while	IN
cord-014462-11ggaqf1	1329	33	a	a	DT
cord-014462-11ggaqf1	1329	34	similar	similar	JJ
cord-014462-11ggaqf1	1329	35	reaction	reaction	NN
cord-014462-11ggaqf1	1329	36	carried	carry	VBN
cord-014462-11ggaqf1	1329	37	out	out	RP
cord-014462-11ggaqf1	1329	38	in	in	IN
cord-014462-11ggaqf1	1329	39	parallel	parallel	NN
cord-014462-11ggaqf1	1329	40	with	with	IN
cord-014462-11ggaqf1	1329	41	alkaline	alkaline	JJ
cord-014462-11ggaqf1	1329	42	phosphatase	phosphatase	NN
cord-014462-11ggaqf1	1329	43	readily	readily	RB
cord-014462-11ggaqf1	1329	44	yields	yield	VBZ
cord-014462-11ggaqf1	1329	45	the	the	DT
cord-014462-11ggaqf1	1329	46	colour	colour	NN
cord-014462-11ggaqf1	1329	47	.	.	.
cord-014462-11ggaqf1	1330	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1330	2	has	have	VBZ
cord-014462-11ggaqf1	1330	3	been	be	VBN
cord-014462-11ggaqf1	1330	4	suggested	suggest	VBN
cord-014462-11ggaqf1	1330	5	earlier	early	RBR
cord-014462-11ggaqf1	1330	6	that	that	IN
cord-014462-11ggaqf1	1330	7	AC4	AC4	NNP
cord-014462-11ggaqf1	1330	8	may	may	MD
cord-014462-11ggaqf1	1330	9	be	be	VB
cord-014462-11ggaqf1	1330	10	involved	involve	VBN
cord-014462-11ggaqf1	1330	11	in	in	IN
cord-014462-11ggaqf1	1330	12	cell	cell	NN
cord-014462-11ggaqf1	1330	13	to	to	IN
cord-014462-11ggaqf1	1330	14	cell	cell	NN
cord-014462-11ggaqf1	1330	15	movement	movement	NN
cord-014462-11ggaqf1	1330	16	of	of	IN
cord-014462-11ggaqf1	1330	17	the	the	DT
cord-014462-11ggaqf1	1330	18	virus	virus	NN
cord-014462-11ggaqf1	1331	1	(	(	-LRB-
cord-014462-11ggaqf1	1331	2	Rojas	Rojas	NNP
cord-014462-11ggaqf1	1331	3	et	et	NNP
cord-014462-11ggaqf1	1331	4	al	al	NNP
cord-014462-11ggaqf1	1331	5	.	.	NNP
cord-014462-11ggaqf1	1331	6	2001	2001	CD
cord-014462-11ggaqf1	1331	7	)	)	-RRB-
cord-014462-11ggaqf1	1331	8	.	.	.
cord-014462-11ggaqf1	1332	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1332	2	is	be	VBZ
cord-014462-11ggaqf1	1332	3	possible	possible	JJ
cord-014462-11ggaqf1	1332	4	that	that	IN
cord-014462-11ggaqf1	1332	5	by	by	IN
cord-014462-11ggaqf1	1332	6	its	-PRON-	PRP$
cord-014462-11ggaqf1	1332	7	ability	ability	NN
cord-014462-11ggaqf1	1332	8	to	to	TO
cord-014462-11ggaqf1	1332	9	hydrolyze	hydrolyze	VB
cord-014462-11ggaqf1	1332	10	ATP	ATP	NNP
cord-014462-11ggaqf1	1332	11	,	,	,
cord-014462-11ggaqf1	1332	12	AC4	AC4	NNP
cord-014462-11ggaqf1	1332	13	serves	serve	VBZ
cord-014462-11ggaqf1	1332	14	to	to	TO
cord-014462-11ggaqf1	1332	15	power	power	VB
cord-014462-11ggaqf1	1332	16	viral	viral	JJ
cord-014462-11ggaqf1	1332	17	movement	movement	NN
cord-014462-11ggaqf1	1332	18	in	in	IN
cord-014462-11ggaqf1	1332	19	the	the	DT
cord-014462-11ggaqf1	1332	20	plant	plant	NN
cord-014462-11ggaqf1	1332	21	.	.	.
cord-014462-11ggaqf1	1333	1	Thirteen	thirteen	CD
cord-014462-11ggaqf1	1333	2	Sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1333	3	yellow	yellow	JJ
cord-014462-11ggaqf1	1333	4	leaf	leaf	NN
cord-014462-11ggaqf1	1333	5	virus	virus	NN
cord-014462-11ggaqf1	1333	6	isolates	isolate	VBZ
cord-014462-11ggaqf1	1333	7	causing	cause	VBG
cord-014462-11ggaqf1	1333	8	yellow	yellow	JJ
cord-014462-11ggaqf1	1333	9	midrib	midrib	JJ
cord-014462-11ggaqf1	1333	10	and	and	CC
cord-014462-11ggaqf1	1333	11	irregular	irregular	JJ
cord-014462-11ggaqf1	1333	12	yellow	yellow	JJ
cord-014462-11ggaqf1	1333	13	spot	spot	NN
cord-014462-11ggaqf1	1333	14	pattern	pattern	NN
cord-014462-11ggaqf1	1333	15	from	from	IN
cord-014462-11ggaqf1	1333	16	six	six	CD
cord-014462-11ggaqf1	1333	17	states	state	NNS
cord-014462-11ggaqf1	1333	18	of	of	IN
cord-014462-11ggaqf1	1333	19	India	India	NNP
cord-014462-11ggaqf1	1333	20	were	be	VBD
cord-014462-11ggaqf1	1333	21	characterized	characterize	VBN
cord-014462-11ggaqf1	1333	22	by	by	IN
cord-014462-11ggaqf1	1333	23	RT	RT	NNP
cord-014462-11ggaqf1	1333	24	-	-	HYPH
cord-014462-11ggaqf1	1333	25	PCR	PCR	NNP
cord-014462-11ggaqf1	1333	26	assays	assay	NNS
cord-014462-11ggaqf1	1333	27	.	.	.
cord-014462-11ggaqf1	1334	1	SCYLV-615F	scylv-615f	JJ
cord-014462-11ggaqf1	1334	2	and	and	CC
cord-014462-11ggaqf1	1334	3	SCYLV-615R	scylv-615r	JJ
cord-014462-11ggaqf1	1334	4	primers	primer	NNS
cord-014462-11ggaqf1	1334	5	were	be	VBD
cord-014462-11ggaqf1	1334	6	used	use	VBN
cord-014462-11ggaqf1	1334	7	as	as	IN
cord-014462-11ggaqf1	1334	8	forward	forward	RB
cord-014462-11ggaqf1	1334	9	and	and	CC
cord-014462-11ggaqf1	1334	10	reverse	reverse	VB
cord-014462-11ggaqf1	1334	11	primer	primer	NN
cord-014462-11ggaqf1	1334	12	pairs	pair	NNS
cord-014462-11ggaqf1	1334	13	and	and	CC
cord-014462-11ggaqf1	1334	14	the	the	DT
cord-014462-11ggaqf1	1334	15	amplified	amplify	VBN
cord-014462-11ggaqf1	1334	16	products	product	NNS
cord-014462-11ggaqf1	1334	17	were	be	VBD
cord-014462-11ggaqf1	1334	18	cloned	clone	VBN
cord-014462-11ggaqf1	1334	19	and	and	CC
cord-014462-11ggaqf1	1334	20	sequenced	sequence	VBN
cord-014462-11ggaqf1	1334	21	.	.	.
cord-014462-11ggaqf1	1335	1	Comparative	comparative	JJ
cord-014462-11ggaqf1	1335	2	coat	coat	NN
cord-014462-11ggaqf1	1335	3	protein	protein	NN
cord-014462-11ggaqf1	1335	4	sequence	sequence	NN
cord-014462-11ggaqf1	1335	5	analysis	analysis	NN
cord-014462-11ggaqf1	1335	6	confirmed	confirm	VBD
cord-014462-11ggaqf1	1335	7	that	that	IN
cord-014462-11ggaqf1	1335	8	all	all	PDT
cord-014462-11ggaqf1	1335	9	the	the	DT
cord-014462-11ggaqf1	1335	10	SCYLV	SCYLV	NNP
cord-014462-11ggaqf1	1335	11	-	-	HYPH
cord-014462-11ggaqf1	1335	12	Indian	indian	JJ
cord-014462-11ggaqf1	1335	13	isolates	isolate	NNS
cord-014462-11ggaqf1	1335	14	were	be	VBD
cord-014462-11ggaqf1	1335	15	clustered	cluster	VBN
cord-014462-11ggaqf1	1335	16	into	into	IN
cord-014462-11ggaqf1	1335	17	two	two	CD
cord-014462-11ggaqf1	1335	18	major	major	JJ
cord-014462-11ggaqf1	1335	19	groups	group	NNS
cord-014462-11ggaqf1	1335	20	confirming	confirm	VBG
cord-014462-11ggaqf1	1335	21	the	the	DT
cord-014462-11ggaqf1	1335	22	existence	existence	NN
cord-014462-11ggaqf1	1335	23	of	of	IN
cord-014462-11ggaqf1	1335	24	two	two	CD
cord-014462-11ggaqf1	1335	25	strains	strain	NNS
cord-014462-11ggaqf1	1335	26	of	of	IN
cord-014462-11ggaqf1	1335	27	SCYLV	SCYLV	NNS
cord-014462-11ggaqf1	1335	28	affecting	affect	VBG
cord-014462-11ggaqf1	1335	29	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1335	30	crops	crop	NNS
cord-014462-11ggaqf1	1335	31	of	of	IN
cord-014462-11ggaqf1	1335	32	India	India	NNP
cord-014462-11ggaqf1	1335	33	.	.	.
cord-014462-11ggaqf1	1336	1	In	in	IN
cord-014462-11ggaqf1	1336	2	a	a	DT
cord-014462-11ggaqf1	1336	3	separate	separate	JJ
cord-014462-11ggaqf1	1336	4	experiment	experiment	NN
cord-014462-11ggaqf1	1336	5	,	,	,
cord-014462-11ggaqf1	1336	6	the	the	DT
cord-014462-11ggaqf1	1336	7	member	member	NN
cord-014462-11ggaqf1	1336	8	of	of	IN
cord-014462-11ggaqf1	1336	9	both	both	DT
cord-014462-11ggaqf1	1336	10	of	of	IN
cord-014462-11ggaqf1	1336	11	the	the	DT
cord-014462-11ggaqf1	1336	12	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1336	13	groups	group	NNS
cord-014462-11ggaqf1	1336	14	were	be	VBD
cord-014462-11ggaqf1	1336	15	found	find	VBN
cord-014462-11ggaqf1	1336	16	to	to	TO
cord-014462-11ggaqf1	1336	17	be	be	VB
cord-014462-11ggaqf1	1336	18	transmitted	transmit	VBN
cord-014462-11ggaqf1	1336	19	by	by	IN
cord-014462-11ggaqf1	1336	20	the	the	DT
cord-014462-11ggaqf1	1336	21	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1336	22	aphid	aphid	NN
cord-014462-11ggaqf1	1336	23	,	,	,
cord-014462-11ggaqf1	1336	24	Melanaphis	Melanaphis	NNP
cord-014462-11ggaqf1	1336	25	sacchari	sacchari	NNP
cord-014462-11ggaqf1	1336	26	from	from	IN
cord-014462-11ggaqf1	1336	27	infected	infect	VBN
cord-014462-11ggaqf1	1336	28	to	to	IN
cord-014462-11ggaqf1	1336	29	healthy	healthy	JJ
cord-014462-11ggaqf1	1336	30	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1336	31	suggesting	suggest	VBG
cord-014462-11ggaqf1	1336	32	its	-PRON-	PRP$
cord-014462-11ggaqf1	1336	33	secondary	secondary	JJ
cord-014462-11ggaqf1	1336	34	spread	spread	NN
cord-014462-11ggaqf1	1336	35	in	in	IN
cord-014462-11ggaqf1	1336	36	nature	nature	NN
cord-014462-11ggaqf1	1336	37	.	.	.
cord-014462-11ggaqf1	1337	1	The	the	DT
cord-014462-11ggaqf1	1337	2	symptoms	symptom	NNS
cord-014462-11ggaqf1	1337	3	produced	produce	VBN
cord-014462-11ggaqf1	1337	4	by	by	IN
cord-014462-11ggaqf1	1337	5	the	the	DT
cord-014462-11ggaqf1	1337	6	virus	virus	NN
cord-014462-11ggaqf1	1337	7	causing	cause	VBG
cord-014462-11ggaqf1	1337	8	cotton	cotton	NN
cord-014462-11ggaqf1	1337	9	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1337	10	disease	disease	NN
cord-014462-11ggaqf1	1337	11	were	be	VBD
cord-014462-11ggaqf1	1337	12	little	little	JJ
cord-014462-11ggaqf1	1337	13	bit	bit	NN
cord-014462-11ggaqf1	1337	14	different	different	JJ
cord-014462-11ggaqf1	1337	15	in	in	IN
cord-014462-11ggaqf1	1337	16	both	both	DT
cord-014462-11ggaqf1	1337	17	sap	sap	NN
cord-014462-11ggaqf1	1337	18	inoculation	inoculation	NN
cord-014462-11ggaqf1	1337	19	and	and	CC
cord-014462-11ggaqf1	1337	20	under	under	IN
cord-014462-11ggaqf1	1337	21	natural	natural	JJ
cord-014462-11ggaqf1	1337	22	field	field	NN
cord-014462-11ggaqf1	1337	23	condition	condition	NN
cord-014462-11ggaqf1	1337	24	.	.	.
cord-014462-11ggaqf1	1338	1	In	in	IN
cord-014462-11ggaqf1	1338	2	natural	natural	JJ
cord-014462-11ggaqf1	1338	3	field	field	NN
cord-014462-11ggaqf1	1338	4	condition	condition	NN
cord-014462-11ggaqf1	1338	5	it	-PRON-	PRP
cord-014462-11ggaqf1	1338	6	has	have	VBZ
cord-014462-11ggaqf1	1338	7	shown	show	VBN
cord-014462-11ggaqf1	1338	8	clear	clear	JJ
cord-014462-11ggaqf1	1338	9	chlorosis	chlorosis	NN
cord-014462-11ggaqf1	1338	10	type	type	NN
cord-014462-11ggaqf1	1338	11	of	of	IN
cord-014462-11ggaqf1	1338	12	symptoms	symptom	NNS
cord-014462-11ggaqf1	1338	13	on	on	IN
cord-014462-11ggaqf1	1338	14	major	major	JJ
cord-014462-11ggaqf1	1338	15	leaves	leave	NNS
cord-014462-11ggaqf1	1338	16	of	of	IN
cord-014462-11ggaqf1	1338	17	plants	plant	NNS
cord-014462-11ggaqf1	1338	18	but	but	CC
cord-014462-11ggaqf1	1338	19	in	in	IN
cord-014462-11ggaqf1	1338	20	sap	sap	NN
cord-014462-11ggaqf1	1338	21	inoculated	inoculate	VBD
cord-014462-11ggaqf1	1338	22	plants	plant	NNS
cord-014462-11ggaqf1	1338	23	veinal	veinal	JJ
cord-014462-11ggaqf1	1338	24	chlorosis	chlorosis	NN
cord-014462-11ggaqf1	1338	25	and	and	CC
cord-014462-11ggaqf1	1338	26	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1338	27	type	type	NN
cord-014462-11ggaqf1	1338	28	of	of	IN
cord-014462-11ggaqf1	1338	29	symptoms	symptom	NNS
cord-014462-11ggaqf1	1338	30	are	be	VBP
cord-014462-11ggaqf1	1338	31	found	find	VBN
cord-014462-11ggaqf1	1338	32	to	to	TO
cord-014462-11ggaqf1	1338	33	be	be	VB
cord-014462-11ggaqf1	1338	34	common	common	JJ
cord-014462-11ggaqf1	1338	35	.	.	.
cord-014462-11ggaqf1	1339	1	In	in	IN
cord-014462-11ggaqf1	1339	2	field	field	NN
cord-014462-11ggaqf1	1339	3	conditions	condition	NNS
cord-014462-11ggaqf1	1339	4	infected	infect	VBN
cord-014462-11ggaqf1	1339	5	plants	plant	NNS
cord-014462-11ggaqf1	1339	6	grows	grow	VBZ
cord-014462-11ggaqf1	1339	7	erect	erect	VB
cord-014462-11ggaqf1	1339	8	and	and	CC
cord-014462-11ggaqf1	1339	9	have	have	VBP
cord-014462-11ggaqf1	1339	10	less	less	JJR
cord-014462-11ggaqf1	1339	11	boll	boll	NN
cord-014462-11ggaqf1	1339	12	formation	formation	NN
cord-014462-11ggaqf1	1339	13	.	.	.
cord-014462-11ggaqf1	1340	1	There	there	EX
cord-014462-11ggaqf1	1340	2	is	be	VBZ
cord-014462-11ggaqf1	1340	3	no	no	DT
cord-014462-11ggaqf1	1340	4	effect	effect	NN
cord-014462-11ggaqf1	1340	5	found	find	VBN
cord-014462-11ggaqf1	1340	6	on	on	IN
cord-014462-11ggaqf1	1340	7	seed	seed	NN
cord-014462-11ggaqf1	1340	8	shape	shape	NN
cord-014462-11ggaqf1	1340	9	or	or	CC
cord-014462-11ggaqf1	1340	10	seed	seed	NN
cord-014462-11ggaqf1	1340	11	size	size	NN
cord-014462-11ggaqf1	1340	12	.	.	.
cord-014462-11ggaqf1	1341	1	The	the	DT
cord-014462-11ggaqf1	1341	2	initial	initial	JJ
cord-014462-11ggaqf1	1341	3	symptoms	symptom	NNS
cord-014462-11ggaqf1	1341	4	produced	produce	VBN
cord-014462-11ggaqf1	1341	5	on	on	IN
cord-014462-11ggaqf1	1341	6	cotton	cotton	NN
cord-014462-11ggaqf1	1341	7	leaves	leave	NNS
cord-014462-11ggaqf1	1341	8	after	after	IN
cord-014462-11ggaqf1	1341	9	inoculation	inoculation	NN
cord-014462-11ggaqf1	1341	10	were	be	VBD
cord-014462-11ggaqf1	1341	11	wonderful	wonderful	JJ
cord-014462-11ggaqf1	1341	12	.	.	.
cord-014462-11ggaqf1	1342	1	Local	local	JJ
cord-014462-11ggaqf1	1342	2	lesions	lesion	NNS
cord-014462-11ggaqf1	1342	3	observed	observe	VBN
cord-014462-11ggaqf1	1342	4	in	in	IN
cord-014462-11ggaqf1	1342	5	second	second	JJ
cord-014462-11ggaqf1	1342	6	week	week	NN
cord-014462-11ggaqf1	1342	7	from	from	IN
cord-014462-11ggaqf1	1342	8	inoculation	inoculation	NN
cord-014462-11ggaqf1	1342	9	and	and	CC
cord-014462-11ggaqf1	1342	10	then	then	RB
cord-014462-11ggaqf1	1342	11	they	-PRON-	PRP
cord-014462-11ggaqf1	1342	12	changes	change	VBZ
cord-014462-11ggaqf1	1342	13	to	to	IN
cord-014462-11ggaqf1	1342	14	chlorotic	chlorotic	JJ
cord-014462-11ggaqf1	1342	15	type	type	NN
cord-014462-11ggaqf1	1342	16	of	of	IN
cord-014462-11ggaqf1	1342	17	symptoms	symptom	NNS
cord-014462-11ggaqf1	1342	18	and	and	CC
cord-014462-11ggaqf1	1342	19	some	some	DT
cord-014462-11ggaqf1	1342	20	are	be	VBP
cord-014462-11ggaqf1	1342	21	necrotic	necrotic	JJ
cord-014462-11ggaqf1	1342	22	symptoms	symptom	NNS
cord-014462-11ggaqf1	1342	23	also	also	RB
cord-014462-11ggaqf1	1342	24	.	.	.
cord-014462-11ggaqf1	1343	1	The	the	DT
cord-014462-11ggaqf1	1343	2	plants	plant	NNS
cord-014462-11ggaqf1	1343	3	at	at	IN
cord-014462-11ggaqf1	1343	4	early	early	JJ
cord-014462-11ggaqf1	1343	5	stage	stage	NN
cord-014462-11ggaqf1	1343	6	are	be	VBP
cord-014462-11ggaqf1	1343	7	found	find	VBN
cord-014462-11ggaqf1	1343	8	to	to	TO
cord-014462-11ggaqf1	1343	9	be	be	VB
cord-014462-11ggaqf1	1343	10	affected	affect	VBN
cord-014462-11ggaqf1	1343	11	,	,	,
cord-014462-11ggaqf1	1343	12	has	have	VBZ
cord-014462-11ggaqf1	1343	13	less	less	JJR
cord-014462-11ggaqf1	1343	14	lateral	lateral	JJ
cord-014462-11ggaqf1	1343	15	branch	branch	NN
cord-014462-11ggaqf1	1343	16	development	development	NN
cord-014462-11ggaqf1	1343	17	and	and	CC
cord-014462-11ggaqf1	1343	18	hence	hence	RB
cord-014462-11ggaqf1	1343	19	reduction	reduction	NN
cord-014462-11ggaqf1	1343	20	in	in	IN
cord-014462-11ggaqf1	1343	21	yield	yield	NN
cord-014462-11ggaqf1	1343	22	production	production	NN
cord-014462-11ggaqf1	1343	23	.	.	.
cord-014462-11ggaqf1	1344	1	The	the	DT
cord-014462-11ggaqf1	1344	2	naturally	naturally	RB
cord-014462-11ggaqf1	1344	3	field	field	NN
cord-014462-11ggaqf1	1344	4	infected	infected	JJ
cord-014462-11ggaqf1	1344	5	plants	plant	NNS
cord-014462-11ggaqf1	1344	6	showing	show	VBG
cord-014462-11ggaqf1	1344	7	good	good	JJ
cord-014462-11ggaqf1	1344	8	symptoms	symptom	NNS
cord-014462-11ggaqf1	1344	9	are	be	VBP
cord-014462-11ggaqf1	1344	10	also	also	RB
cord-014462-11ggaqf1	1344	11	difficult	difficult	JJ
cord-014462-11ggaqf1	1344	12	to	to	TO
cord-014462-11ggaqf1	1344	13	identify	identify	VB
cord-014462-11ggaqf1	1344	14	in	in	IN
cord-014462-11ggaqf1	1344	15	lateral	lateral	JJ
cord-014462-11ggaqf1	1344	16	stage	stage	NN
cord-014462-11ggaqf1	1344	17	of	of	IN
cord-014462-11ggaqf1	1344	18	plant	plant	NN
cord-014462-11ggaqf1	1344	19	.	.	.
cord-014462-11ggaqf1	1345	1	Because	because	IN
cord-014462-11ggaqf1	1345	2	they	-PRON-	PRP
cord-014462-11ggaqf1	1345	3	disappear	disappear	VBP
cord-014462-11ggaqf1	1345	4	with	with	IN
cord-014462-11ggaqf1	1345	5	time	time	NN
cord-014462-11ggaqf1	1345	6	.	.	.
cord-014462-11ggaqf1	1346	1	The	the	DT
cord-014462-11ggaqf1	1346	2	virus	virus	NN
cord-014462-11ggaqf1	1346	3	is	be	VBZ
cord-014462-11ggaqf1	1346	4	very	very	RB
cord-014462-11ggaqf1	1346	5	easily	easily	RB
cord-014462-11ggaqf1	1346	6	sap	sap	NN
cord-014462-11ggaqf1	1346	7	transmissible	transmissible	JJ
cord-014462-11ggaqf1	1346	8	.	.	.
cord-014462-11ggaqf1	1347	1	The	the	DT
cord-014462-11ggaqf1	1347	2	virus	virus	NN
cord-014462-11ggaqf1	1347	3	is	be	VBZ
cord-014462-11ggaqf1	1347	4	found	find	VBN
cord-014462-11ggaqf1	1347	5	to	to	TO
cord-014462-11ggaqf1	1347	6	be	be	VB
cord-014462-11ggaqf1	1347	7	transmitted	transmit	VBN
cord-014462-11ggaqf1	1347	8	by	by	IN
cord-014462-11ggaqf1	1347	9	Thrips	Thrips	NNP
cord-014462-11ggaqf1	1347	10	palmi	palmi	NNP
cord-014462-11ggaqf1	1347	11	and	and	CC
cord-014462-11ggaqf1	1347	12	Thrips	Thrips	NNP
cord-014462-11ggaqf1	1347	13	tobacci	tobacci	NNS
cord-014462-11ggaqf1	1347	14	in	in	IN
cord-014462-11ggaqf1	1347	15	persistent	persistent	JJ
cord-014462-11ggaqf1	1347	16	manner	manner	NN
cord-014462-11ggaqf1	1347	17	.	.	.
cord-014462-11ggaqf1	1348	1	No	no	DT
cord-014462-11ggaqf1	1348	2	seed	seed	NN
cord-014462-11ggaqf1	1348	3	transmission	transmission	NN
cord-014462-11ggaqf1	1348	4	is	be	VBZ
cord-014462-11ggaqf1	1348	5	observed	observe	VBN
cord-014462-11ggaqf1	1348	6	.	.	.
cord-014462-11ggaqf1	1349	1	Virus	virus	NN
cord-014462-11ggaqf1	1349	2	showed	show	VBD
cord-014462-11ggaqf1	1349	3	same	same	JJ
cord-014462-11ggaqf1	1349	4	physical	physical	JJ
cord-014462-11ggaqf1	1349	5	properties	property	NNS
cord-014462-11ggaqf1	1349	6	as	as	IN
cord-014462-11ggaqf1	1349	7	it	-PRON-	PRP
cord-014462-11ggaqf1	1349	8	shows	show	VBZ
cord-014462-11ggaqf1	1349	9	in	in	IN
cord-014462-11ggaqf1	1349	10	stem	stem	NN
cord-014462-11ggaqf1	1349	11	necrosis	necrosis	NN
cord-014462-11ggaqf1	1349	12	of	of	IN
cord-014462-11ggaqf1	1349	13	peanut	peanut	NN
cord-014462-11ggaqf1	1349	14	or	or	CC
cord-014462-11ggaqf1	1349	15	sunflower	sunflower	NN
cord-014462-11ggaqf1	1349	16	necrosis	necrosis	NN
cord-014462-11ggaqf1	1349	17	disease	disease	NN
cord-014462-11ggaqf1	1349	18	.	.	.
cord-014462-11ggaqf1	1350	1	The	the	DT
cord-014462-11ggaqf1	1350	2	physical	physical	JJ
cord-014462-11ggaqf1	1350	3	properties	property	NNS
cord-014462-11ggaqf1	1350	4	are	be	VBP
cord-014462-11ggaqf1	1350	5	found	find	VBN
cord-014462-11ggaqf1	1350	6	to	to	TO
cord-014462-11ggaqf1	1350	7	be	be	VB
cord-014462-11ggaqf1	1350	8	thermal	thermal	JJ
cord-014462-11ggaqf1	1350	9	inactivation	inactivation	NN
cord-014462-11ggaqf1	1350	10	point	point	NN
cord-014462-11ggaqf1	1350	11	(	(	-LRB-
cord-014462-11ggaqf1	1350	12	TIP	tip	NN
cord-014462-11ggaqf1	1350	13	)	)	-RRB-
cord-014462-11ggaqf1	1350	14	55	55	CD
cord-014462-11ggaqf1	1350	15	-	-	SYM
cord-014462-11ggaqf1	1350	16	60	60	CD
cord-014462-11ggaqf1	1350	17	°	°	NN
cord-014462-11ggaqf1	1350	18	C	c	NN
cord-014462-11ggaqf1	1350	19	,	,	,
cord-014462-11ggaqf1	1350	20	dilution	dilution	NN
cord-014462-11ggaqf1	1350	21	end	end	NN
cord-014462-11ggaqf1	1350	22	point	point	NN
cord-014462-11ggaqf1	1350	23	(	(	-LRB-
cord-014462-11ggaqf1	1350	24	DEP	DEP	NNP
cord-014462-11ggaqf1	1350	25	)	)	-RRB-
cord-014462-11ggaqf1	1350	26	10	10	CD
cord-014462-11ggaqf1	1350	27	-2	-2	CD
cord-014462-11ggaqf1	1350	28	to	to	IN
cord-014462-11ggaqf1	1350	29	10	10	CD
cord-014462-11ggaqf1	1350	30	-3	-3	NN
cord-014462-11ggaqf1	1350	31	and	and	CC
cord-014462-11ggaqf1	1350	32	longevity	longevity	NN
cord-014462-11ggaqf1	1351	1	in	in	IN
cord-014462-11ggaqf1	1351	2	vitro	vitro	FW
cord-014462-11ggaqf1	1352	1	(	(	-LRB-
cord-014462-11ggaqf1	1352	2	LIV	LIV	NNP
cord-014462-11ggaqf1	1352	3	)	)	-RRB-
cord-014462-11ggaqf1	1352	4	5	5	CD
cord-014462-11ggaqf1	1352	5	h	h	NN
cord-014462-11ggaqf1	1352	6	,	,	,
cord-014462-11ggaqf1	1352	7	virus	virus	NN
cord-014462-11ggaqf1	1352	8	infecting	infect	VBG
cord-014462-11ggaqf1	1352	9	nineteen	nineteen	CD
cord-014462-11ggaqf1	1352	10	different	different	JJ
cord-014462-11ggaqf1	1352	11	host	host	NN
cord-014462-11ggaqf1	1352	12	plants	plant	NNS
cord-014462-11ggaqf1	1352	13	are	be	VBP
cord-014462-11ggaqf1	1352	14	identified	identify	VBN
cord-014462-11ggaqf1	1352	15	belonging	belong	VBG
cord-014462-11ggaqf1	1352	16	to	to	IN
cord-014462-11ggaqf1	1352	17	five	five	CD
cord-014462-11ggaqf1	1352	18	different	different	JJ
cord-014462-11ggaqf1	1352	19	types	type	NNS
cord-014462-11ggaqf1	1352	20	of	of	IN
cord-014462-11ggaqf1	1352	21	families	family	NNS
cord-014462-11ggaqf1	1352	22	viz	viz	JJ
cord-014462-11ggaqf1	1352	23	.	.	.
cord-014462-11ggaqf1	1353	1	malvaceae	malvaceae	NNP
cord-014462-11ggaqf1	1353	2	,	,	,
cord-014462-11ggaqf1	1353	3	chenopodiaceae	chenopodiaceae	NNP
cord-014462-11ggaqf1	1353	4	,	,	,
cord-014462-11ggaqf1	1353	5	compositae	compositae	NN
cord-014462-11ggaqf1	1353	6	,	,	,
cord-014462-11ggaqf1	1353	7	leguminaceae	leguminaceae	NNP
cord-014462-11ggaqf1	1353	8	and	and	CC
cord-014462-11ggaqf1	1353	9	solanaceae	solanaceae	NN
cord-014462-11ggaqf1	1353	10	.	.	.
cord-014462-11ggaqf1	1354	1	However	however	RB
cord-014462-11ggaqf1	1354	2	they	-PRON-	PRP
cord-014462-11ggaqf1	1354	3	found	find	VBD
cord-014462-11ggaqf1	1354	4	to	to	TO
cord-014462-11ggaqf1	1354	5	produce	produce	VB
cord-014462-11ggaqf1	1354	6	same	same	JJ
cord-014462-11ggaqf1	1354	7	types	type	NNS
cord-014462-11ggaqf1	1354	8	of	of	IN
cord-014462-11ggaqf1	1354	9	symptoms	symptom	NNS
cord-014462-11ggaqf1	1354	10	as	as	IN
cord-014462-11ggaqf1	1354	11	in	in	IN
cord-014462-11ggaqf1	1354	12	most	most	JJS
cord-014462-11ggaqf1	1354	13	of	of	IN
cord-014462-11ggaqf1	1354	14	the	the	DT
cord-014462-11ggaqf1	1354	15	host	host	NN
cord-014462-11ggaqf1	1354	16	that	that	WDT
cord-014462-11ggaqf1	1354	17	have	have	VBP
cord-014462-11ggaqf1	1354	18	been	be	VBN
cord-014462-11ggaqf1	1354	19	tested	test	VBN
cord-014462-11ggaqf1	1354	20	before	before	RB
cord-014462-11ggaqf1	1354	21	.	.	.
cord-014462-11ggaqf1	1355	1	In	in	IN
cord-014462-11ggaqf1	1355	2	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1355	3	test	test	NN
cord-014462-11ggaqf1	1355	4	report	report	NN
cord-014462-11ggaqf1	1355	5	it	-PRON-	PRP
cord-014462-11ggaqf1	1355	6	is	be	VBZ
cord-014462-11ggaqf1	1355	7	found	find	VBN
cord-014462-11ggaqf1	1355	8	that	that	IN
cord-014462-11ggaqf1	1355	9	the	the	DT
cord-014462-11ggaqf1	1355	10	virus	virus	NN
cord-014462-11ggaqf1	1355	11	showing	show	VBG
cord-014462-11ggaqf1	1355	12	positive	positive	JJ
cord-014462-11ggaqf1	1355	13	test	test	NN
cord-014462-11ggaqf1	1355	14	only	only	RB
cord-014462-11ggaqf1	1355	15	with	with	IN
cord-014462-11ggaqf1	1355	16	anti	anti	JJ
cord-014462-11ggaqf1	1355	17	serum	serum	NN
cord-014462-11ggaqf1	1355	18	of	of	IN
cord-014462-11ggaqf1	1355	19	TSV	TSV	NNP
cord-014462-11ggaqf1	1355	20	of	of	IN
cord-014462-11ggaqf1	1355	21	a	a	DT
cord-014462-11ggaqf1	1355	22	cowpea	cowpea	NN
cord-014462-11ggaqf1	1355	23	and	and	CC
cord-014462-11ggaqf1	1355	24	cotton	cotton	NN
cord-014462-11ggaqf1	1355	25	but	but	CC
cord-014462-11ggaqf1	1355	26	negative	negative	JJ
cord-014462-11ggaqf1	1355	27	reaction	reaction	NN
cord-014462-11ggaqf1	1355	28	with	with	IN
cord-014462-11ggaqf1	1355	29	PBNV	PBNV	NNP
cord-014462-11ggaqf1	1355	30	of	of	IN
cord-014462-11ggaqf1	1355	31	cowpea	cowpea	NN
cord-014462-11ggaqf1	1355	32	and	and	CC
cord-014462-11ggaqf1	1355	33	cotton	cotton	NN
cord-014462-11ggaqf1	1355	34	which	which	WDT
cord-014462-11ggaqf1	1355	35	clearly	clearly	RB
cord-014462-11ggaqf1	1355	36	denied	deny	VBD
cord-014462-11ggaqf1	1355	37	possibility	possibility	NN
cord-014462-11ggaqf1	1355	38	of	of	IN
cord-014462-11ggaqf1	1355	39	presence	presence	NN
cord-014462-11ggaqf1	1355	40	of	of	IN
cord-014462-11ggaqf1	1355	41	PBNV	PBNV	NNP
cord-014462-11ggaqf1	1355	42	in	in	IN
cord-014462-11ggaqf1	1355	43	cotton	cotton	NN
cord-014462-11ggaqf1	1355	44	producing	produce	VBG
cord-014462-11ggaqf1	1355	45	these	these	DT
cord-014462-11ggaqf1	1355	46	kinds	kind	NNS
cord-014462-11ggaqf1	1355	47	of	of	IN
cord-014462-11ggaqf1	1355	48	symptoms	symptom	NNS
cord-014462-11ggaqf1	1355	49	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1355	50	report	report	VBP
cord-014462-11ggaqf1	1355	51	clearly	clearly	RB
cord-014462-11ggaqf1	1355	52	shows	show	VBZ
cord-014462-11ggaqf1	1355	53	that	that	IN
cord-014462-11ggaqf1	1355	54	TSV	TSV	NNP
cord-014462-11ggaqf1	1355	55	antiserum	antiserum	NN
cord-014462-11ggaqf1	1355	56	of	of	IN
cord-014462-11ggaqf1	1355	57	cowpea	cowpea	NNP
cord-014462-11ggaqf1	1355	58	is	be	VBZ
cord-014462-11ggaqf1	1355	59	showing	show	VBG
cord-014462-11ggaqf1	1355	60	positive	positive	JJ
cord-014462-11ggaqf1	1355	61	results	result	NNS
cord-014462-11ggaqf1	1355	62	with	with	IN
cord-014462-11ggaqf1	1355	63	clear	clear	JJ
cord-014462-11ggaqf1	1355	64	chlorotic	chlorotic	JJ
cord-014462-11ggaqf1	1355	65	types	type	NNS
cord-014462-11ggaqf1	1355	66	of	of	IN
cord-014462-11ggaqf1	1355	67	symptoms	symptom	NNS
cord-014462-11ggaqf1	1355	68	.	.	.
cord-014462-11ggaqf1	1356	1	A	a	DT
cord-014462-11ggaqf1	1356	2	powerful	powerful	JJ
cord-014462-11ggaqf1	1356	3	approach	approach	NN
cord-014462-11ggaqf1	1356	4	to	to	IN
cord-014462-11ggaqf1	1356	5	functional	functional	JJ
cord-014462-11ggaqf1	1356	6	genomics	genomic	NNS
cord-014462-11ggaqf1	1356	7	,	,	,
cord-014462-11ggaqf1	1356	8	and	and	CC
cord-014462-11ggaqf1	1356	9	an	an	DT
cord-014462-11ggaqf1	1356	10	alternative	alternative	NN
cord-014462-11ggaqf1	1356	11	to	to	IN
cord-014462-11ggaqf1	1356	12	the	the	DT
cord-014462-11ggaqf1	1356	13	massive	massive	JJ
cord-014462-11ggaqf1	1356	14	generation	generation	NN
cord-014462-11ggaqf1	1356	15	of	of	IN
cord-014462-11ggaqf1	1356	16	transgenic	transgenic	JJ
cord-014462-11ggaqf1	1356	17	plants	plant	NNS
cord-014462-11ggaqf1	1356	18	,	,	,
cord-014462-11ggaqf1	1356	19	is	be	VBZ
cord-014462-11ggaqf1	1356	20	the	the	DT
cord-014462-11ggaqf1	1356	21	use	use	NN
cord-014462-11ggaqf1	1356	22	of	of	IN
cord-014462-11ggaqf1	1356	23	the	the	DT
cord-014462-11ggaqf1	1356	24	recently	recently	RB
cord-014462-11ggaqf1	1356	25	described	describe	VBN
cord-014462-11ggaqf1	1356	26	Virus	virus	NN
cord-014462-11ggaqf1	1356	27	Induced	Induced	NNP
cord-014462-11ggaqf1	1356	28	Gene	Gene	NNP
cord-014462-11ggaqf1	1356	29	Silencing	Silencing	NNP
cord-014462-11ggaqf1	1356	30	(	(	-LRB-
cord-014462-11ggaqf1	1356	31	VIGS	VIGS	NNP
cord-014462-11ggaqf1	1356	32	)	)	-RRB-
cord-014462-11ggaqf1	1356	33	process	process	NN
cord-014462-11ggaqf1	1356	34	,	,	,
cord-014462-11ggaqf1	1356	35	which	which	WDT
cord-014462-11ggaqf1	1356	36	allows	allow	VBZ
cord-014462-11ggaqf1	1356	37	viral	viral	JJ
cord-014462-11ggaqf1	1356	38	vectors	vector	NNS
cord-014462-11ggaqf1	1356	39	to	to	TO
cord-014462-11ggaqf1	1356	40	knock	knock	VB
cord-014462-11ggaqf1	1356	41	out	out	RP
cord-014462-11ggaqf1	1356	42	the	the	DT
cord-014462-11ggaqf1	1356	43	function	function	NN
cord-014462-11ggaqf1	1356	44	of	of	IN
cord-014462-11ggaqf1	1356	45	a	a	DT
cord-014462-11ggaqf1	1356	46	gene	gene	NN
cord-014462-11ggaqf1	1356	47	-	-	HYPH
cord-014462-11ggaqf1	1356	48	of	of	IN
cord-014462-11ggaqf1	1356	49	-	-	HYPH
cord-014462-11ggaqf1	1356	50	interest	interest	NN
cord-014462-11ggaqf1	1356	51	.	.	.
cord-014462-11ggaqf1	1357	1	VIGS	VIGS	NNP
cord-014462-11ggaqf1	1357	2	is	be	VBZ
cord-014462-11ggaqf1	1357	3	based	base	VBN
cord-014462-11ggaqf1	1357	4	on	on	IN
cord-014462-11ggaqf1	1357	5	a	a	DT
cord-014462-11ggaqf1	1357	6	silencing	silencing	NN
cord-014462-11ggaqf1	1357	7	mechanism	mechanism	NN
cord-014462-11ggaqf1	1357	8	that	that	WDT
cord-014462-11ggaqf1	1357	9	regulates	regulate	VBZ
cord-014462-11ggaqf1	1357	10	gene	gene	NN
cord-014462-11ggaqf1	1357	11	expression	expression	NN
cord-014462-11ggaqf1	1357	12	by	by	IN
cord-014462-11ggaqf1	1357	13	the	the	DT
cord-014462-11ggaqf1	1357	14	specific	specific	JJ
cord-014462-11ggaqf1	1357	15	degradation	degradation	NN
cord-014462-11ggaqf1	1357	16	of	of	IN
cord-014462-11ggaqf1	1357	17	RNA	RNA	NNP
cord-014462-11ggaqf1	1357	18	.	.	.
cord-014462-11ggaqf1	1358	1	As	as	IN
cord-014462-11ggaqf1	1358	2	a	a	DT
cord-014462-11ggaqf1	1358	3	tool	tool	NN
cord-014462-11ggaqf1	1358	4	for	for	IN
cord-014462-11ggaqf1	1358	5	reverse	reverse	JJ
cord-014462-11ggaqf1	1358	6	genetics	genetic	NNS
cord-014462-11ggaqf1	1358	7	,	,	,
cord-014462-11ggaqf1	1358	8	VIGS	VIGS	NNP
cord-014462-11ggaqf1	1358	9	has	have	VBZ
cord-014462-11ggaqf1	1358	10	many	many	JJ
cord-014462-11ggaqf1	1358	11	advantages	advantage	NNS
cord-014462-11ggaqf1	1358	12	over	over	IN
cord-014462-11ggaqf1	1358	13	other	other	JJ
cord-014462-11ggaqf1	1358	14	common	common	JJ
cord-014462-11ggaqf1	1358	15	ways	way	NNS
cord-014462-11ggaqf1	1358	16	to	to	TO
cord-014462-11ggaqf1	1358	17	study	study	VB
cord-014462-11ggaqf1	1358	18	gene	gene	NN
cord-014462-11ggaqf1	1358	19	function	function	NN
cord-014462-11ggaqf1	1358	20	because	because	IN
cord-014462-11ggaqf1	1358	21	of	of	IN
cord-014462-11ggaqf1	1358	22	the	the	DT
cord-014462-11ggaqf1	1358	23	ability	ability	NN
cord-014462-11ggaqf1	1358	24	of	of	IN
cord-014462-11ggaqf1	1358	25	viruses	virus	NNS
cord-014462-11ggaqf1	1358	26	to	to	TO
cord-014462-11ggaqf1	1358	27	replicate	replicate	VB
cord-014462-11ggaqf1	1358	28	and	and	CC
cord-014462-11ggaqf1	1358	29	move	move	VB
cord-014462-11ggaqf1	1358	30	systemically	systemically	RB
cord-014462-11ggaqf1	1358	31	within	within	IN
cord-014462-11ggaqf1	1358	32	a	a	DT
cord-014462-11ggaqf1	1358	33	plant	plant	NN
cord-014462-11ggaqf1	1358	34	.	.	.
cord-014462-11ggaqf1	1359	1	VIGS	VIGS	NNP
cord-014462-11ggaqf1	1359	2	can	can	MD
cord-014462-11ggaqf1	1359	3	generate	generate	VB
cord-014462-11ggaqf1	1359	4	a	a	DT
cord-014462-11ggaqf1	1359	5	phenocopy	phenocopy	NN
cord-014462-11ggaqf1	1359	6	of	of	IN
cord-014462-11ggaqf1	1359	7	a	a	DT
cord-014462-11ggaqf1	1359	8	mutant	mutant	NN
cord-014462-11ggaqf1	1359	9	without	without	IN
cord-014462-11ggaqf1	1359	10	all	all	PDT
cord-014462-11ggaqf1	1359	11	the	the	DT
cord-014462-11ggaqf1	1359	12	troubles	trouble	NNS
cord-014462-11ggaqf1	1359	13	of	of	IN
cord-014462-11ggaqf1	1359	14	traditional	traditional	JJ
cord-014462-11ggaqf1	1359	15	methods	method	NNS
cord-014462-11ggaqf1	1359	16	of	of	IN
cord-014462-11ggaqf1	1359	17	mutagenesis	mutagenesis	NN
cord-014462-11ggaqf1	1359	18	.	.	.
cord-014462-11ggaqf1	1360	1	Geminiviruses	Geminiviruses	NNP
cord-014462-11ggaqf1	1360	2	with	with	IN
cord-014462-11ggaqf1	1360	3	their	-PRON-	PRP$
cord-014462-11ggaqf1	1360	4	small	small	JJ
cord-014462-11ggaqf1	1360	5	DNA	dna	NN
cord-014462-11ggaqf1	1360	6	genomes	genome	NNS
cord-014462-11ggaqf1	1360	7	and	and	CC
cord-014462-11ggaqf1	1360	8	ease	ease	NN
cord-014462-11ggaqf1	1360	9	of	of	IN
cord-014462-11ggaqf1	1360	10	inoculation	inoculation	NN
cord-014462-11ggaqf1	1360	11	through	through	IN
cord-014462-11ggaqf1	1360	12	agrobacterium	agrobacterium	NN
cord-014462-11ggaqf1	1360	13	,	,	,
cord-014462-11ggaqf1	1360	14	are	be	VBP
cord-014462-11ggaqf1	1360	15	excellent	excellent	JJ
cord-014462-11ggaqf1	1360	16	candidates	candidate	NNS
cord-014462-11ggaqf1	1360	17	for	for	IN
cord-014462-11ggaqf1	1360	18	VIGS	vigs	NN
cord-014462-11ggaqf1	1360	19	vector	vector	NN
cord-014462-11ggaqf1	1360	20	development	development	NN
cord-014462-11ggaqf1	1360	21	.	.	.
cord-014462-11ggaqf1	1361	1	As	as	IN
cord-014462-11ggaqf1	1361	2	a	a	DT
cord-014462-11ggaqf1	1361	3	first	first	JJ
cord-014462-11ggaqf1	1361	4	step	step	NN
cord-014462-11ggaqf1	1361	5	,	,	,
cord-014462-11ggaqf1	1361	6	the	the	DT
cord-014462-11ggaqf1	1361	7	geminivirus	geminivirus	NNP
cord-014462-11ggaqf1	1361	8	Bhendi	Bhendi	NNP
cord-014462-11ggaqf1	1361	9	yellow	yellow	JJ
cord-014462-11ggaqf1	1361	10	vein	vein	NN
cord-014462-11ggaqf1	1361	11	mosaic	mosaic	NNP
cord-014462-11ggaqf1	1361	12	virus	virus	NN
cord-014462-11ggaqf1	1361	13	,	,	,
cord-014462-11ggaqf1	1361	14	characterized	characterize	VBN
cord-014462-11ggaqf1	1361	15	in	in	IN
cord-014462-11ggaqf1	1361	16	our	-PRON-	PRP$
cord-014462-11ggaqf1	1361	17	lab	lab	NN
cord-014462-11ggaqf1	1361	18	(	(	-LRB-
cord-014462-11ggaqf1	1361	19	Jose	Jose	NNP
cord-014462-11ggaqf1	1361	20	and	and	CC
cord-014462-11ggaqf1	1361	21	Usha	Usha	NNP
cord-014462-11ggaqf1	1361	22	,	,	,
cord-014462-11ggaqf1	1361	23	Virology	Virology	NNP
cord-014462-11ggaqf1	1361	24	305	305	CD
cord-014462-11ggaqf1	1361	25	:	:	:
cord-014462-11ggaqf1	1361	26	[	[	-LRB-
cord-014462-11ggaqf1	1361	27	310	310	CD
cord-014462-11ggaqf1	1361	28	]	]	-RRB-
cord-014462-11ggaqf1	1361	29	[	[	-LRB-
cord-014462-11ggaqf1	1361	30	311	311	CD
cord-014462-11ggaqf1	1361	31	]	]	-RRB-
cord-014462-11ggaqf1	1361	32	[	[	-LRB-
cord-014462-11ggaqf1	1361	33	312	312	CD
cord-014462-11ggaqf1	1361	34	]	]	-RRB-
cord-014462-11ggaqf1	1361	35	[	[	-LRB-
cord-014462-11ggaqf1	1361	36	313	313	CD
cord-014462-11ggaqf1	1361	37	]	]	-RRB-
cord-014462-11ggaqf1	1361	38	[	[	-LRB-
cord-014462-11ggaqf1	1361	39	314	314	CD
cord-014462-11ggaqf1	1361	40	]	]	-RRB-
cord-014462-11ggaqf1	1361	41	[	[	-LRB-
cord-014462-11ggaqf1	1361	42	315	315	CD
cord-014462-11ggaqf1	1361	43	]	]	-RRB-
cord-014462-11ggaqf1	1361	44	[	[	-LRB-
cord-014462-11ggaqf1	1361	45	316	316	CD
cord-014462-11ggaqf1	1361	46	]	]	-RRB-
cord-014462-11ggaqf1	1361	47	[	[	-LRB-
cord-014462-11ggaqf1	1361	48	317	317	CD
cord-014462-11ggaqf1	1361	49	]	]	-RRB-
cord-014462-11ggaqf1	1361	50	2003	2003	CD
cord-014462-11ggaqf1	1361	51	)	)	-RRB-
cord-014462-11ggaqf1	1361	52	has	have	VBZ
cord-014462-11ggaqf1	1361	53	been	be	VBN
cord-014462-11ggaqf1	1361	54	chosen	choose	VBN
cord-014462-11ggaqf1	1361	55	.	.	.
cord-014462-11ggaqf1	1362	1	The	the	DT
cord-014462-11ggaqf1	1362	2	satellite	satellite	NN
cord-014462-11ggaqf1	1362	3	b	b	NN
cord-014462-11ggaqf1	1362	4	DNA	dna	NN
cord-014462-11ggaqf1	1362	5	associated	associate	VBN
cord-014462-11ggaqf1	1362	6	with	with	IN
cord-014462-11ggaqf1	1362	7	this	this	DT
cord-014462-11ggaqf1	1362	8	virus	virus	NN
cord-014462-11ggaqf1	1362	9	has	have	VBZ
cord-014462-11ggaqf1	1362	10	a	a	DT
cord-014462-11ggaqf1	1362	11	single	single	JJ
cord-014462-11ggaqf1	1362	12	open	open	JJ
cord-014462-11ggaqf1	1362	13	reading	reading	NN
cord-014462-11ggaqf1	1362	14	frame	frame	NN
cord-014462-11ggaqf1	1362	15	(	(	-LRB-
cord-014462-11ggaqf1	1362	16	bC1	bc1	NN
cord-014462-11ggaqf1	1362	17	)	)	-RRB-
cord-014462-11ggaqf1	1362	18	.	.	.
cord-014462-11ggaqf1	1363	1	bC1	bC1	NNP
cord-014462-11ggaqf1	1363	2	is	be	VBZ
cord-014462-11ggaqf1	1363	3	essential	essential	JJ
cord-014462-11ggaqf1	1363	4	for	for	IN
cord-014462-11ggaqf1	1363	5	symptom	symptom	NN
cord-014462-11ggaqf1	1363	6	development	development	NN
cord-014462-11ggaqf1	1363	7	but	but	CC
cord-014462-11ggaqf1	1363	8	not	not	RB
cord-014462-11ggaqf1	1363	9	for	for	IN
cord-014462-11ggaqf1	1363	10	replication	replication	NN
cord-014462-11ggaqf1	1363	11	.	.	.
cord-014462-11ggaqf1	1364	1	Therefore	therefore	RB
cord-014462-11ggaqf1	1364	2	,	,	,
cord-014462-11ggaqf1	1364	3	bC1	bC1	NNP
cord-014462-11ggaqf1	1364	4	has	have	VBZ
cord-014462-11ggaqf1	1364	5	been	be	VBN
cord-014462-11ggaqf1	1364	6	replaced	replace	VBN
cord-014462-11ggaqf1	1364	7	by	by	IN
cord-014462-11ggaqf1	1364	8	a	a	DT
cord-014462-11ggaqf1	1364	9	multiple	multiple	JJ
cord-014462-11ggaqf1	1364	10	cloning	cloning	NN
cord-014462-11ggaqf1	1364	11	site	site	NN
cord-014462-11ggaqf1	1364	12	harbouring	harbour	VBG
cord-014462-11ggaqf1	1364	13	SalI	SalI	NNP
cord-014462-11ggaqf1	1364	14	,	,	,
cord-014462-11ggaqf1	1364	15	XbaI	XbaI	NNP
cord-014462-11ggaqf1	1364	16	,	,	,
cord-014462-11ggaqf1	1364	17	BamHI	BamHI	NNP
cord-014462-11ggaqf1	1364	18	,	,	,
cord-014462-11ggaqf1	1364	19	BsrGI	BsrGI	NNP
cord-014462-11ggaqf1	1364	20	and	and	CC
cord-014462-11ggaqf1	1364	21	XhoI	XhoI	NNP
cord-014462-11ggaqf1	1364	22	,	,	,
cord-014462-11ggaqf1	1364	23	initially	initially	RB
cord-014462-11ggaqf1	1364	24	in	in	IN
cord-014462-11ggaqf1	1364	25	a	a	DT
cord-014462-11ggaqf1	1364	26	cloning	cloning	NN
cord-014462-11ggaqf1	1364	27	vector	vector	NN
cord-014462-11ggaqf1	1364	28	and	and	CC
cord-014462-11ggaqf1	1364	29	then	then	RB
cord-014462-11ggaqf1	1364	30	in	in	IN
cord-014462-11ggaqf1	1364	31	the	the	DT
cord-014462-11ggaqf1	1364	32	binary	binary	JJ
cord-014462-11ggaqf1	1364	33	vector	vector	NN
cord-014462-11ggaqf1	1364	34	containing	contain	VBG
cord-014462-11ggaqf1	1364	35	the	the	DT
cord-014462-11ggaqf1	1364	36	partial	partial	JJ
cord-014462-11ggaqf1	1364	37	tandem	tandem	NN
cord-014462-11ggaqf1	1364	38	repeat	repeat	NN
cord-014462-11ggaqf1	1364	39	of	of	IN
cord-014462-11ggaqf1	1364	40	the	the	DT
cord-014462-11ggaqf1	1364	41	b	b	NN
cord-014462-11ggaqf1	1364	42	DNA	dna	NN
cord-014462-11ggaqf1	1364	43	.	.	.
cord-014462-11ggaqf1	1365	1	In	in	IN
cord-014462-11ggaqf1	1365	2	the	the	DT
cord-014462-11ggaqf1	1365	3	place	place	NN
cord-014462-11ggaqf1	1365	4	of	of	IN
cord-014462-11ggaqf1	1365	5	the	the	DT
cord-014462-11ggaqf1	1365	6	bC1	bC1	NNP
cord-014462-11ggaqf1	1365	7	ORF	ORF	NNP
cord-014462-11ggaqf1	1365	8	,	,	,
cord-014462-11ggaqf1	1365	9	the	the	DT
cord-014462-11ggaqf1	1365	10	plant	plant	NN
cord-014462-11ggaqf1	1366	1	Phytoene	phytoene	JJ
cord-014462-11ggaqf1	1366	2	desaturase	desaturase	NN
cord-014462-11ggaqf1	1366	3	gene	gene	NN
cord-014462-11ggaqf1	1366	4	has	have	VBZ
cord-014462-11ggaqf1	1366	5	been	be	VBN
cord-014462-11ggaqf1	1366	6	cloned	clone	VBN
cord-014462-11ggaqf1	1366	7	and	and	CC
cord-014462-11ggaqf1	1366	8	the	the	DT
cord-014462-11ggaqf1	1366	9	resulting	result	VBG
cord-014462-11ggaqf1	1366	10	construct	construct	NN
cord-014462-11ggaqf1	1366	11	was	be	VBD
cord-014462-11ggaqf1	1366	12	used	use	VBN
cord-014462-11ggaqf1	1366	13	for	for	IN
cord-014462-11ggaqf1	1366	14	agroinfiltration	agroinfiltration	NN
cord-014462-11ggaqf1	1366	15	along	along	IN
cord-014462-11ggaqf1	1366	16	with	with	IN
cord-014462-11ggaqf1	1366	17	the	the	DT
cord-014462-11ggaqf1	1366	18	partial	partial	JJ
cord-014462-11ggaqf1	1366	19	tandem	tandem	NN
cord-014462-11ggaqf1	1366	20	repeat	repeat	NN
cord-014462-11ggaqf1	1366	21	clone	clone	NN
cord-014462-11ggaqf1	1366	22	of	of	IN
cord-014462-11ggaqf1	1366	23	the	the	DT
cord-014462-11ggaqf1	1366	24	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1366	25	(	(	-LRB-
cord-014462-11ggaqf1	1366	26	DNA	DNA	NNP
cord-014462-11ggaqf1	1366	27	A	A	NNP
cord-014462-11ggaqf1	1366	28	component	component	NN
cord-014462-11ggaqf1	1366	29	Chilli	Chilli	NNP
cord-014462-11ggaqf1	1366	30	(	(	-LRB-
cord-014462-11ggaqf1	1366	31	Capsicum	Capsicum	NNP
cord-014462-11ggaqf1	1366	32	annuum	annuum	NN
cord-014462-11ggaqf1	1366	33	L.	L.	NNP
cord-014462-11ggaqf1	1366	34	)	)	-RRB-
cord-014462-11ggaqf1	1366	35	plants	plant	NNS
cord-014462-11ggaqf1	1366	36	exhibiting	exhibit	VBG
cord-014462-11ggaqf1	1366	37	prominent	prominent	JJ
cord-014462-11ggaqf1	1366	38	symptoms	symptom	NNS
cord-014462-11ggaqf1	1366	39	of	of	IN
cord-014462-11ggaqf1	1366	40	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1366	41	like	like	IN
cord-014462-11ggaqf1	1366	42	:	:	:
cord-014462-11ggaqf1	1366	43	leaf	leaf	NN
cord-014462-11ggaqf1	1366	44	curl	curl	NN
cord-014462-11ggaqf1	1366	45	,	,	,
cord-014462-11ggaqf1	1366	46	vein	vein	NN
cord-014462-11ggaqf1	1366	47	swelling	swelling	NN
cord-014462-11ggaqf1	1366	48	,	,	,
cord-014462-11ggaqf1	1366	49	shortening	shortening	NN
cord-014462-11ggaqf1	1366	50	of	of	IN
cord-014462-11ggaqf1	1366	51	petioles	petiole	NNS
cord-014462-11ggaqf1	1366	52	,	,	,
cord-014462-11ggaqf1	1366	53	crowding	crowd	VBG
cord-014462-11ggaqf1	1366	54	of	of	IN
cord-014462-11ggaqf1	1366	55	leaves	leave	NNS
cord-014462-11ggaqf1	1366	56	and	and	CC
cord-014462-11ggaqf1	1366	57	stunting	stunting	NN
cord-014462-11ggaqf1	1366	58	of	of	IN
cord-014462-11ggaqf1	1366	59	plants	plant	NNS
cord-014462-11ggaqf1	1366	60	were	be	VBD
cord-014462-11ggaqf1	1366	61	collected	collect	VBN
cord-014462-11ggaqf1	1366	62	from	from	IN
cord-014462-11ggaqf1	1366	63	Rorkee	Rorkee	NNP
cord-014462-11ggaqf1	1366	64	,	,	,
cord-014462-11ggaqf1	1366	65	Uttarakhand	Uttarakhand	NNP
cord-014462-11ggaqf1	1366	66	and	and	CC
cord-014462-11ggaqf1	1366	67	Dhaulpur	Dhaulpur	NNP
cord-014462-11ggaqf1	1366	68	,	,	,
cord-014462-11ggaqf1	1366	69	Rajasthan	Rajasthan	NNP
cord-014462-11ggaqf1	1366	70	,	,	,
cord-014462-11ggaqf1	1366	71	India	India	NNP
cord-014462-11ggaqf1	1366	72	.	.	.
cord-014462-11ggaqf1	1367	1	Total	total	JJ
cord-014462-11ggaqf1	1367	2	genomic	genomic	JJ
cord-014462-11ggaqf1	1367	3	DNA	dna	NN
cord-014462-11ggaqf1	1367	4	was	be	VBD
cord-014462-11ggaqf1	1367	5	isolated	isolate	VBN
cord-014462-11ggaqf1	1367	6	from	from	IN
cord-014462-11ggaqf1	1367	7	naturally	naturally	RB
cord-014462-11ggaqf1	1367	8	infected	infect	VBN
cord-014462-11ggaqf1	1367	9	chilli	chilli	NN
cord-014462-11ggaqf1	1367	10	samples	sample	NNS
cord-014462-11ggaqf1	1367	11	and	and	CC
cord-014462-11ggaqf1	1367	12	PCR	PCR	NNP
cord-014462-11ggaqf1	1367	13	was	be	VBD
cord-014462-11ggaqf1	1367	14	carried	carry	VBN
cord-014462-11ggaqf1	1367	15	out	out	RP
cord-014462-11ggaqf1	1367	16	with	with	IN
cord-014462-11ggaqf1	1367	17	Coat	Coat	NNP
cord-014462-11ggaqf1	1367	18	Protein	Protein	NNP
cord-014462-11ggaqf1	1367	19	(	(	-LRB-
cord-014462-11ggaqf1	1367	20	located	locate	VBN
cord-014462-11ggaqf1	1367	21	in	in	IN
cord-014462-11ggaqf1	1367	22	DNA	DNA	NNP
cord-014462-11ggaqf1	1367	23	-	-	HYPH
cord-014462-11ggaqf1	1367	24	A	a	NN
cord-014462-11ggaqf1	1367	25	)	)	-RRB-
cord-014462-11ggaqf1	1367	26	gene	gene	NN
cord-014462-11ggaqf1	1367	27	specific	specific	JJ
cord-014462-11ggaqf1	1367	28	primers	primer	NNS
cord-014462-11ggaqf1	1367	29	.	.	.
cord-014462-11ggaqf1	1368	1	As	as	IN
cord-014462-11ggaqf1	1368	2	expected	expect	VBN
cord-014462-11ggaqf1	1368	3	to	to	IN
cord-014462-11ggaqf1	1368	4	the	the	DT
cord-014462-11ggaqf1	1368	5	primers	primer	NNS
cord-014462-11ggaqf1	1368	6	,	,	,
cord-014462-11ggaqf1	1368	7	*	*	NFP
cord-014462-11ggaqf1	1368	8	800	800	CD
cord-014462-11ggaqf1	1368	9	bp	bp	NNP
cord-014462-11ggaqf1	1368	10	DNA	DNA	NNP
cord-014462-11ggaqf1	1368	11	fragments	fragment	NNS
cord-014462-11ggaqf1	1368	12	were	be	VBD
cord-014462-11ggaqf1	1368	13	amplified	amplify	VBN
cord-014462-11ggaqf1	1368	14	from	from	IN
cord-014462-11ggaqf1	1368	15	the	the	DT
cord-014462-11ggaqf1	1368	16	infected	infected	JJ
cord-014462-11ggaqf1	1368	17	chilli	chilli	NN
cord-014462-11ggaqf1	1368	18	samples	sample	NNS
cord-014462-11ggaqf1	1368	19	.	.	.
cord-014462-11ggaqf1	1369	1	To	to	TO
cord-014462-11ggaqf1	1369	2	know	know	VB
cord-014462-11ggaqf1	1369	3	the	the	DT
cord-014462-11ggaqf1	1369	4	bipartite	bipartite	JJ
cord-014462-11ggaqf1	1369	5	nature	nature	NN
cord-014462-11ggaqf1	1369	6	of	of	IN
cord-014462-11ggaqf1	1369	7	the	the	DT
cord-014462-11ggaqf1	1369	8	virus	virus	NN
cord-014462-11ggaqf1	1369	9	isolates	isolate	VBZ
cord-014462-11ggaqf1	1369	10	,	,	,
cord-014462-11ggaqf1	1370	1	Nuclear	Nuclear	NNP
cord-014462-11ggaqf1	1370	2	Shuttle	Shuttle	NNP
cord-014462-11ggaqf1	1370	3	Protein	Protein	NNP
cord-014462-11ggaqf1	1370	4	(	(	-LRB-
cord-014462-11ggaqf1	1370	5	located	locate	VBN
cord-014462-11ggaqf1	1370	6	in	in	IN
cord-014462-11ggaqf1	1370	7	DNA	dna	NN
cord-014462-11ggaqf1	1370	8	-	-	HYPH
cord-014462-11ggaqf1	1370	9	B	b	NN
cord-014462-11ggaqf1	1370	10	)	)	-RRB-
cord-014462-11ggaqf1	1370	11	gene	gene	NN
cord-014462-11ggaqf1	1370	12	specific	specific	JJ
cord-014462-11ggaqf1	1370	13	primers	primer	NNS
cord-014462-11ggaqf1	1370	14	were	be	VBD
cord-014462-11ggaqf1	1370	15	employed	employ	VBN
cord-014462-11ggaqf1	1370	16	which	which	WDT
cord-014462-11ggaqf1	1370	17	also	also	RB
cord-014462-11ggaqf1	1370	18	resulted	result	VBD
cord-014462-11ggaqf1	1370	19	in	in	IN
cord-014462-11ggaqf1	1370	20	positive	positive	JJ
cord-014462-11ggaqf1	1370	21	amplification	amplification	NN
cord-014462-11ggaqf1	1370	22	of	of	IN
cord-014462-11ggaqf1	1370	23	*	*	NFP
cord-014462-11ggaqf1	1370	24	850	850	CD
cord-014462-11ggaqf1	1370	25	bp	bp	NNP
cord-014462-11ggaqf1	1370	26	DNA	DNA	NNP
cord-014462-11ggaqf1	1370	27	bands	band	NNS
cord-014462-11ggaqf1	1370	28	with	with	IN
cord-014462-11ggaqf1	1370	29	all	all	PDT
cord-014462-11ggaqf1	1370	30	the	the	DT
cord-014462-11ggaqf1	1370	31	Coat	Coat	NNP
cord-014462-11ggaqf1	1370	32	Protein	Protein	NNP
cord-014462-11ggaqf1	1370	33	tested	test	VBD
cord-014462-11ggaqf1	1370	34	positive	positive	JJ
cord-014462-11ggaqf1	1370	35	samples	sample	NNS
cord-014462-11ggaqf1	1370	36	.	.	.
cord-014462-11ggaqf1	1371	1	To	to	TO
cord-014462-11ggaqf1	1371	2	ascertain	ascertain	VB
cord-014462-11ggaqf1	1371	3	the	the	DT
cord-014462-11ggaqf1	1371	4	association	association	NN
cord-014462-11ggaqf1	1371	5	of	of	IN
cord-014462-11ggaqf1	1371	6	DNAb	DNAb	NNP
cord-014462-11ggaqf1	1371	7	component	component	NN
cord-014462-11ggaqf1	1371	8	with	with	IN
cord-014462-11ggaqf1	1371	9	the	the	DT
cord-014462-11ggaqf1	1371	10	virus	virus	NN
cord-014462-11ggaqf1	1371	11	isolates	isolate	NNS
cord-014462-11ggaqf1	1371	12	,	,	,
cord-014462-11ggaqf1	1371	13	a	a	DT
cord-014462-11ggaqf1	1371	14	set	set	NN
cord-014462-11ggaqf1	1371	15	of	of	IN
cord-014462-11ggaqf1	1371	16	DNA	dna	NN
cord-014462-11ggaqf1	1371	17	-	-	HYPH
cord-014462-11ggaqf1	1371	18	b	b	NN
cord-014462-11ggaqf1	1371	19	specific	specific	JJ
cord-014462-11ggaqf1	1371	20	primers	primer	NNS
cord-014462-11ggaqf1	1371	21	were	be	VBD
cord-014462-11ggaqf1	1371	22	used	use	VBN
cord-014462-11ggaqf1	1371	23	which	which	WDT
cord-014462-11ggaqf1	1371	24	resulted	result	VBD
cord-014462-11ggaqf1	1371	25	in	in	IN
cord-014462-11ggaqf1	1371	26	positive	positive	JJ
cord-014462-11ggaqf1	1371	27	amplification	amplification	NN
cord-014462-11ggaqf1	1371	28	of	of	IN
cord-014462-11ggaqf1	1371	29	full	full	JJ
cord-014462-11ggaqf1	1371	30	length	length	NN
cord-014462-11ggaqf1	1372	1	(	(	-LRB-
cord-014462-11ggaqf1	1372	2	*	*	NFP
cord-014462-11ggaqf1	1372	3	1.3	1.3	CD
cord-014462-11ggaqf1	1372	4	kb	kb	NNP
cord-014462-11ggaqf1	1372	5	)	)	-RRB-
cord-014462-11ggaqf1	1372	6	DNA	dna	NN
cord-014462-11ggaqf1	1372	7	bands	band	NNS
cord-014462-11ggaqf1	1372	8	in	in	IN
cord-014462-11ggaqf1	1372	9	the	the	DT
cord-014462-11ggaqf1	1372	10	chilli	chilli	NN
cord-014462-11ggaqf1	1372	11	samples	sample	NNS
cord-014462-11ggaqf1	1372	12	collected	collect	VBN
cord-014462-11ggaqf1	1372	13	from	from	IN
cord-014462-11ggaqf1	1372	14	Rorkee	Rorkee	NNP
cord-014462-11ggaqf1	1372	15	,	,	,
cord-014462-11ggaqf1	1372	16	Uttarakhand	Uttarakhand	NNP
cord-014462-11ggaqf1	1372	17	,	,	,
cord-014462-11ggaqf1	1372	18	however	however	RB
cord-014462-11ggaqf1	1372	19	,	,	,
cord-014462-11ggaqf1	1372	20	multiple	multiple	JJ
cord-014462-11ggaqf1	1372	21	sizes	size	NNS
cord-014462-11ggaqf1	1372	22	bands	band	NNS
cord-014462-11ggaqf1	1372	23	were	be	VBD
cord-014462-11ggaqf1	1372	24	resulted	result	VBN
cord-014462-11ggaqf1	1372	25	with	with	IN
cord-014462-11ggaqf1	1372	26	the	the	DT
cord-014462-11ggaqf1	1372	27	samples	sample	NNS
cord-014462-11ggaqf1	1372	28	collected	collect	VBN
cord-014462-11ggaqf1	1372	29	from	from	IN
cord-014462-11ggaqf1	1372	30	Dhaulpur	Dhaulpur	NNP
cord-014462-11ggaqf1	1372	31	,	,	,
cord-014462-11ggaqf1	1372	32	Rajasthan	Rajasthan	NNP
cord-014462-11ggaqf1	1372	33	.	.	.
cord-014462-11ggaqf1	1373	1	These	these	DT
cord-014462-11ggaqf1	1373	2	findings	finding	NNS
cord-014462-11ggaqf1	1373	3	confirmed	confirm	VBD
cord-014462-11ggaqf1	1373	4	that	that	IN
cord-014462-11ggaqf1	1373	5	both	both	CC
cord-014462-11ggaqf1	1373	6	the	the	DT
cord-014462-11ggaqf1	1373	7	virus	virus	NN
cord-014462-11ggaqf1	1373	8	isolates	isolate	VBZ
cord-014462-11ggaqf1	1373	9	under	under	IN
cord-014462-11ggaqf1	1373	10	study	study	NN
cord-014462-11ggaqf1	1373	11	are	be	VBP
cord-014462-11ggaqf1	1373	12	bipartite	bipartite	JJ
cord-014462-11ggaqf1	1373	13	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1373	14	associated	associate	VBN
cord-014462-11ggaqf1	1373	15	with	with	IN
cord-014462-11ggaqf1	1373	16	DNA	dna	NN
cord-014462-11ggaqf1	1373	17	-	-	HYPH
cord-014462-11ggaqf1	1373	18	b	b	NN
cord-014462-11ggaqf1	1373	19	satellite	satellite	NN
cord-014462-11ggaqf1	1373	20	.	.	.
cord-014462-11ggaqf1	1374	1	The	the	DT
cord-014462-11ggaqf1	1374	2	sequencing	sequencing	NN
cord-014462-11ggaqf1	1374	3	of	of	IN
cord-014462-11ggaqf1	1374	4	the	the	DT
cord-014462-11ggaqf1	1374	5	PCR	PCR	NNP
cord-014462-11ggaqf1	1374	6	products	product	NNS
cord-014462-11ggaqf1	1374	7	is	be	VBZ
cord-014462-11ggaqf1	1374	8	under	under	IN
cord-014462-11ggaqf1	1374	9	progress	progress	NN
cord-014462-11ggaqf1	1374	10	which	which	WDT
cord-014462-11ggaqf1	1374	11	analysis	analysis	NN
cord-014462-11ggaqf1	1374	12	will	will	MD
cord-014462-11ggaqf1	1374	13	be	be	VB
cord-014462-11ggaqf1	1374	14	discussed	discuss	VBN
cord-014462-11ggaqf1	1374	15	.	.	.
cord-014462-11ggaqf1	1375	1	Groundnut	Groundnut	NNP
cord-014462-11ggaqf1	1375	2	bud	bud	NN
cord-014462-11ggaqf1	1375	3	necrosis	necrosis	NN
cord-014462-11ggaqf1	1375	4	virus	virus	NN
cord-014462-11ggaqf1	1375	5	(	(	-LRB-
cord-014462-11ggaqf1	1375	6	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1375	7	)	)	-RRB-
cord-014462-11ggaqf1	1376	1	belonging	belong	VBG
cord-014462-11ggaqf1	1376	2	to	to	IN
cord-014462-11ggaqf1	1376	3	the	the	DT
cord-014462-11ggaqf1	1376	4	genus	genus	NN
cord-014462-11ggaqf1	1376	5	Tospovirus	Tospovirus	NNP
cord-014462-11ggaqf1	1376	6	,	,	,
cord-014462-11ggaqf1	1376	7	which	which	WDT
cord-014462-11ggaqf1	1376	8	is	be	VBZ
cord-014462-11ggaqf1	1376	9	a	a	DT
cord-014462-11ggaqf1	1376	10	unique	unique	JJ
cord-014462-11ggaqf1	1376	11	member	member	NN
cord-014462-11ggaqf1	1376	12	of	of	IN
cord-014462-11ggaqf1	1376	13	the	the	DT
cord-014462-11ggaqf1	1376	14	family	family	NN
cord-014462-11ggaqf1	1376	15	Bunyaviridae	Bunyaviridae	NNP
cord-014462-11ggaqf1	1376	16	,	,	,
cord-014462-11ggaqf1	1376	17	infects	infect	VBZ
cord-014462-11ggaqf1	1376	18	several	several	JJ
cord-014462-11ggaqf1	1376	19	economically	economically	RB
cord-014462-11ggaqf1	1376	20	important	important	JJ
cord-014462-11ggaqf1	1376	21	crops	crop	NNS
cord-014462-11ggaqf1	1376	22	.	.	.
cord-014462-11ggaqf1	1377	1	The	the	DT
cord-014462-11ggaqf1	1377	2	virus	virus	NN
cord-014462-11ggaqf1	1377	3	has	have	VBZ
cord-014462-11ggaqf1	1377	4	three	three	CD
cord-014462-11ggaqf1	1377	5	genomic	genomic	JJ
cord-014462-11ggaqf1	1377	6	ssRNA	ssrna	NN
cord-014462-11ggaqf1	1377	7	segments	segment	NNS
cord-014462-11ggaqf1	1377	8	namely	namely	RB
cord-014462-11ggaqf1	1377	9	S	S	NNP
cord-014462-11ggaqf1	1377	10	(	(	-LRB-
cord-014462-11ggaqf1	1377	11	ambisense	ambisense	NNP
cord-014462-11ggaqf1	1377	12	)	)	-RRB-
cord-014462-11ggaqf1	1377	13	,	,	,
cord-014462-11ggaqf1	1377	14	M	M	NNP
cord-014462-11ggaqf1	1377	15	(	(	-LRB-
cord-014462-11ggaqf1	1377	16	ambisense	ambisense	NNP
cord-014462-11ggaqf1	1377	17	)	)	-RRB-
cord-014462-11ggaqf1	1377	18	and	and	CC
cord-014462-11ggaqf1	1377	19	L	L	NNP
cord-014462-11ggaqf1	1377	20	(	(	-LRB-
cord-014462-11ggaqf1	1377	21	negative	negative	JJ
cord-014462-11ggaqf1	1377	22	sense	sense	NN
cord-014462-11ggaqf1	1377	23	)	)	-RRB-
cord-014462-11ggaqf1	1377	24	.	.	.
cord-014462-11ggaqf1	1378	1	The	the	DT
cord-014462-11ggaqf1	1378	2	S	S	NNP
cord-014462-11ggaqf1	1378	3	RNA	RNA	NNP
cord-014462-11ggaqf1	1378	4	codes	code	NNS
cord-014462-11ggaqf1	1378	5	for	for	IN
cord-014462-11ggaqf1	1378	6	Nucleoprotein	Nucleoprotein	NNP
cord-014462-11ggaqf1	1378	7	(	(	-LRB-
cord-014462-11ggaqf1	1378	8	NP	NP	NNP
cord-014462-11ggaqf1	1378	9	)	)	-RRB-
cord-014462-11ggaqf1	1378	10	and	and	CC
cord-014462-11ggaqf1	1378	11	Non	Non	NNP
cord-014462-11ggaqf1	1378	12	-	-	JJ
cord-014462-11ggaqf1	1378	13	Structural	structural	JJ
cord-014462-11ggaqf1	1378	14	protein	protein	NN
cord-014462-11ggaqf1	1378	15	(	(	-LRB-
cord-014462-11ggaqf1	1378	16	NSs	NSs	NNP
cord-014462-11ggaqf1	1378	17	)	)	-RRB-
cord-014462-11ggaqf1	1378	18	from	from	IN
cord-014462-11ggaqf1	1378	19	viral	viral	JJ
cord-014462-11ggaqf1	1378	20	complimentary	complimentary	JJ
cord-014462-11ggaqf1	1378	21	and	and	CC
cord-014462-11ggaqf1	1378	22	viral	viral	JJ
cord-014462-11ggaqf1	1378	23	strands	strand	NNS
cord-014462-11ggaqf1	1378	24	respectively	respectively	RB
cord-014462-11ggaqf1	1378	25	.	.	.
cord-014462-11ggaqf1	1379	1	Many	many	JJ
cord-014462-11ggaqf1	1379	2	viral	viral	JJ
cord-014462-11ggaqf1	1379	3	nonstructural	nonstructural	JJ
cord-014462-11ggaqf1	1379	4	proteins	protein	NNS
cord-014462-11ggaqf1	1379	5	such	such	JJ
cord-014462-11ggaqf1	1379	6	as	as	IN
cord-014462-11ggaqf1	1379	7	NS3	ns3	RB
cord-014462-11ggaqf1	1379	8	of	of	IN
cord-014462-11ggaqf1	1379	9	Hepatitis	Hepatitis	NNP
cord-014462-11ggaqf1	1379	10	C	C	NNP
cord-014462-11ggaqf1	1379	11	virus	virus	NN
cord-014462-11ggaqf1	1379	12	,	,	,
cord-014462-11ggaqf1	1379	13	Yellow	yellow	JJ
cord-014462-11ggaqf1	1379	14	fever	fever	NN
cord-014462-11ggaqf1	1379	15	virus	virus	NN
cord-014462-11ggaqf1	1379	16	,	,	,
cord-014462-11ggaqf1	1379	17	Dengue	dengue	NN
cord-014462-11ggaqf1	1379	18	virus	virus	NN
cord-014462-11ggaqf1	1379	19	,	,	,
cord-014462-11ggaqf1	1379	20	SV40	SV40	NNP
cord-014462-11ggaqf1	1379	21	large	large	JJ
cord-014462-11ggaqf1	1379	22	T	t	NN
cord-014462-11ggaqf1	1379	23	antigen	antigen	NN
cord-014462-11ggaqf1	1379	24	and	and	CC
cord-014462-11ggaqf1	1379	25	cytoplasmic	cytoplasmic	JJ
cord-014462-11ggaqf1	1379	26	inclusion	inclusion	NN
cord-014462-11ggaqf1	1379	27	protein	protein	NN
cord-014462-11ggaqf1	1379	28	of	of	IN
cord-014462-11ggaqf1	1379	29	Tamarillo	Tamarillo	NNP
cord-014462-11ggaqf1	1379	30	mosaic	mosaic	NN
cord-014462-11ggaqf1	1379	31	potyvirus	potyviru	NNS
cord-014462-11ggaqf1	1379	32	are	be	VBP
cord-014462-11ggaqf1	1379	33	known	know	VBN
cord-014462-11ggaqf1	1379	34	to	to	TO
cord-014462-11ggaqf1	1379	35	exhibit	exhibit	VB
cord-014462-11ggaqf1	1379	36	RNA	RNA	NNP
cord-014462-11ggaqf1	1379	37	/	/	SYM
cord-014462-11ggaqf1	1379	38	DNA	DNA	NNP
cord-014462-11ggaqf1	1379	39	stimulated	stimulate	VBD
cord-014462-11ggaqf1	1379	40	NTPase	NTPase	NNP
cord-014462-11ggaqf1	1379	41	,	,	,
cord-014462-11ggaqf1	1379	42	dNTPase	dNTPase	NNP
cord-014462-11ggaqf1	1379	43	and	and	CC
cord-014462-11ggaqf1	1379	44	helicase	helicase	NN
cord-014462-11ggaqf1	1379	45	activity	activity	NN
cord-014462-11ggaqf1	1379	46	.	.	.
cord-014462-11ggaqf1	1380	1	NSs	NSs	NNP
cord-014462-11ggaqf1	1380	2	of	of	IN
cord-014462-11ggaqf1	1380	3	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1380	4	does	do	VBZ
cord-014462-11ggaqf1	1380	5	not	not	RB
cord-014462-11ggaqf1	1380	6	have	have	VB
cord-014462-11ggaqf1	1380	7	any	any	DT
cord-014462-11ggaqf1	1380	8	sequence	sequence	NN
cord-014462-11ggaqf1	1380	9	similarity	similarity	NN
cord-014462-11ggaqf1	1380	10	with	with	IN
cord-014462-11ggaqf1	1380	11	any	any	DT
cord-014462-11ggaqf1	1380	12	of	of	IN
cord-014462-11ggaqf1	1380	13	the	the	DT
cord-014462-11ggaqf1	1380	14	above	above	RB
cord-014462-11ggaqf1	1380	15	mentioned	mention	VBN
cord-014462-11ggaqf1	1380	16	viral	viral	JJ
cord-014462-11ggaqf1	1380	17	RNA	RNA	NNP
cord-014462-11ggaqf1	1380	18	/	/	SYM
cord-014462-11ggaqf1	1380	19	DNA	dna	NN
cord-014462-11ggaqf1	1380	20	helicases	helicase	NNS
cord-014462-11ggaqf1	1380	21	but	but	CC
cord-014462-11ggaqf1	1380	22	has	have	VBZ
cord-014462-11ggaqf1	1380	23	a	a	DT
cord-014462-11ggaqf1	1380	24	NTP	NTP	NNP
cord-014462-11ggaqf1	1380	25	binding	binding	NN
cord-014462-11ggaqf1	1380	26	domain	domain	NN
cord-014462-11ggaqf1	1380	27	.	.	.
cord-014462-11ggaqf1	1381	1	However	however	RB
cord-014462-11ggaqf1	1381	2	,	,	,
cord-014462-11ggaqf1	1381	3	it	-PRON-	PRP
cord-014462-11ggaqf1	1381	4	has	have	VBZ
cord-014462-11ggaqf1	1381	5	been	be	VBN
cord-014462-11ggaqf1	1381	6	implicated	implicate	VBN
cord-014462-11ggaqf1	1381	7	as	as	IN
cord-014462-11ggaqf1	1381	8	suppressor	suppressor	NN
cord-014462-11ggaqf1	1381	9	of	of	IN
cord-014462-11ggaqf1	1381	10	gene	gene	NN
cord-014462-11ggaqf1	1381	11	silencing	silencing	NN
cord-014462-11ggaqf1	1381	12	in	in	IN
cord-014462-11ggaqf1	1381	13	vivo	vivo	NNP
cord-014462-11ggaqf1	1381	14	.	.	.
cord-014462-11ggaqf1	1382	1	With	with	IN
cord-014462-11ggaqf1	1382	2	a	a	DT
cord-014462-11ggaqf1	1382	3	view	view	NN
cord-014462-11ggaqf1	1382	4	to	to	TO
cord-014462-11ggaqf1	1382	5	elucidate	elucidate	VB
cord-014462-11ggaqf1	1382	6	the	the	DT
cord-014462-11ggaqf1	1382	7	mechanism	mechanism	NN
cord-014462-11ggaqf1	1382	8	by	by	IN
cord-014462-11ggaqf1	1382	9	which	which	WDT
cord-014462-11ggaqf1	1382	10	NSs	NSs	NNP
cord-014462-11ggaqf1	1382	11	could	could	MD
cord-014462-11ggaqf1	1382	12	act	act	VB
cord-014462-11ggaqf1	1382	13	as	as	IN
cord-014462-11ggaqf1	1382	14	a	a	DT
cord-014462-11ggaqf1	1382	15	suppressor	suppressor	NN
cord-014462-11ggaqf1	1382	16	of	of	IN
cord-014462-11ggaqf1	1382	17	gene	gene	NN
cord-014462-11ggaqf1	1382	18	silencing	silencing	NN
cord-014462-11ggaqf1	1382	19	and	and	CC
cord-014462-11ggaqf1	1382	20	examine	examine	VB
cord-014462-11ggaqf1	1382	21	the	the	DT
cord-014462-11ggaqf1	1382	22	other	other	JJ
cord-014462-11ggaqf1	1382	23	potential	potential	JJ
cord-014462-11ggaqf1	1382	24	roles	role	NNS
cord-014462-11ggaqf1	1382	25	of	of	IN
cord-014462-11ggaqf1	1382	26	NSs	ns	NNS
cord-014462-11ggaqf1	1382	27	in	in	IN
cord-014462-11ggaqf1	1382	28	the	the	DT
cord-014462-11ggaqf1	1382	29	life	life	NN
cord-014462-11ggaqf1	1382	30	cycle	cycle	NN
cord-014462-11ggaqf1	1382	31	of	of	IN
cord-014462-11ggaqf1	1382	32	the	the	DT
cord-014462-11ggaqf1	1382	33	virus	virus	NN
cord-014462-11ggaqf1	1382	34	,	,	.
cord-014462-11ggaqf1	1383	1	the	the	DT
cord-014462-11ggaqf1	1383	2	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1383	3	(	(	-LRB-
cord-014462-11ggaqf1	1383	4	To	to	IN
cord-014462-11ggaqf1	1383	5	)	)	-RRB-
cord-014462-11ggaqf1	1383	6	NSs	NSs	NNP
cord-014462-11ggaqf1	1383	7	was	be	VBD
cord-014462-11ggaqf1	1383	8	over	over	RB
cord-014462-11ggaqf1	1383	9	-	-	HYPH
cord-014462-11ggaqf1	1383	10	expressed	express	VBN
cord-014462-11ggaqf1	1383	11	in	in	IN
cord-014462-11ggaqf1	1383	12	E.	E.	NNP
cord-014462-11ggaqf1	1383	13	coli	coli	NNS
cord-014462-11ggaqf1	1383	14	and	and	CC
cord-014462-11ggaqf1	1383	15	purified	purify	VBN
cord-014462-11ggaqf1	1383	16	by	by	IN
cord-014462-11ggaqf1	1383	17	Ni	Ni	NNP
cord-014462-11ggaqf1	1383	18	-	-	HYPH
cord-014462-11ggaqf1	1383	19	NTA	NTA	NNP
cord-014462-11ggaqf1	1383	20	chromatography	chromatography	NN
cord-014462-11ggaqf1	1383	21	.	.	.
cord-014462-11ggaqf1	1384	1	In	in	IN
cord-014462-11ggaqf1	1384	2	vitro	vitro	FW
cord-014462-11ggaqf1	1384	3	studies	study	NNS
cord-014462-11ggaqf1	1384	4	with	with	IN
cord-014462-11ggaqf1	1384	5	the	the	DT
cord-014462-11ggaqf1	1384	6	purified	purify	VBN
cord-014462-11ggaqf1	1384	7	rNSs	rnss	XX
cord-014462-11ggaqf1	1384	8	suggest	suggest	VBP
cord-014462-11ggaqf1	1384	9	that	that	IN
cord-014462-11ggaqf1	1384	10	it	-PRON-	PRP
cord-014462-11ggaqf1	1384	11	exhibits	exhibit	VBZ
cord-014462-11ggaqf1	1384	12	an	an	DT
cord-014462-11ggaqf1	1384	13	RNA	RNA	NNP
cord-014462-11ggaqf1	1384	14	stimulated	stimulate	VBD
cord-014462-11ggaqf1	1384	15	NTPase	NTPase	NNP
cord-014462-11ggaqf1	1384	16	activity	activity	NN
cord-014462-11ggaqf1	1384	17	.	.	.
cord-014462-11ggaqf1	1385	1	Many	many	JJ
cord-014462-11ggaqf1	1385	2	of	of	IN
cord-014462-11ggaqf1	1385	3	the	the	DT
cord-014462-11ggaqf1	1385	4	proteins	protein	NNS
cord-014462-11ggaqf1	1385	5	that	that	WDT
cord-014462-11ggaqf1	1385	6	possess	possess	VBP
cord-014462-11ggaqf1	1385	7	the	the	DT
cord-014462-11ggaqf1	1385	8	RNA/	rna/	JJ
cord-014462-11ggaqf1	1385	9	DNA	dna	NN
cord-014462-11ggaqf1	1385	10	stimulated	stimulate	VBD
cord-014462-11ggaqf1	1385	11	NTPase	NTPase	NNP
cord-014462-11ggaqf1	1385	12	and	and	CC
cord-014462-11ggaqf1	1385	13	dATPase	dATPase	NFP
cord-014462-11ggaqf1	1385	14	activity	activity	NN
cord-014462-11ggaqf1	1385	15	,	,	,
cord-014462-11ggaqf1	1385	16	are	be	VBP
cord-014462-11ggaqf1	1385	17	also	also	RB
cord-014462-11ggaqf1	1385	18	shown	show	VBN
cord-014462-11ggaqf1	1385	19	to	to	TO
cord-014462-11ggaqf1	1385	20	have	have	VB
cord-014462-11ggaqf1	1385	21	ATP	ATP	NNP
cord-014462-11ggaqf1	1385	22	dependent	dependent	JJ
cord-014462-11ggaqf1	1385	23	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1385	24	acid	acid	NN
cord-014462-11ggaqf1	1385	25	unwinding	unwind	VBG
cord-014462-11ggaqf1	1385	26	activity	activity	NN
cord-014462-11ggaqf1	1385	27	.	.	.
cord-014462-11ggaqf1	1386	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1386	2	was	be	VBD
cord-014462-11ggaqf1	1386	3	therefore	therefore	RB
cord-014462-11ggaqf1	1386	4	of	of	IN
cord-014462-11ggaqf1	1386	5	interest	interest	NN
cord-014462-11ggaqf1	1386	6	to	to	TO
cord-014462-11ggaqf1	1386	7	examine	examine	VB
cord-014462-11ggaqf1	1386	8	whether	whether	IN
cord-014462-11ggaqf1	1386	9	NSs	NSs	NNP
cord-014462-11ggaqf1	1386	10	has	have	VBZ
cord-014462-11ggaqf1	1386	11	the	the	DT
cord-014462-11ggaqf1	1386	12	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1386	13	acid	acid	NN
cord-014462-11ggaqf1	1386	14	unwinding	unwind	VBG
cord-014462-11ggaqf1	1386	15	activity	activity	NN
cord-014462-11ggaqf1	1386	16	.	.	.
cord-014462-11ggaqf1	1387	1	The	the	DT
cord-014462-11ggaqf1	1387	2	helicase	helicase	NN
cord-014462-11ggaqf1	1387	3	assays	assay	NNS
cord-014462-11ggaqf1	1387	4	revealed	reveal	VBD
cord-014462-11ggaqf1	1387	5	that	that	IN
cord-014462-11ggaqf1	1387	6	NSs	NSs	NNP
cord-014462-11ggaqf1	1387	7	has	have	VBZ
cord-014462-11ggaqf1	1387	8	DNA	DNA	NNP
cord-014462-11ggaqf1	1387	9	/	/	SYM
cord-014462-11ggaqf1	1387	10	RNA	RNA	NNP
cord-014462-11ggaqf1	1387	11	helicase	helicase	NN
cord-014462-11ggaqf1	1387	12	activity	activity	NN
cord-014462-11ggaqf1	1387	13	.	.	.
cord-014462-11ggaqf1	1388	1	Helicase	helicase	NN
cord-014462-11ggaqf1	1388	2	activity	activity	NN
cord-014462-11ggaqf1	1388	3	of	of	IN
cord-014462-11ggaqf1	1388	4	NSs	NSs	NNP
cord-014462-11ggaqf1	1388	5	was	be	VBD
cord-014462-11ggaqf1	1388	6	absolutely	absolutely	RB
cord-014462-11ggaqf1	1388	7	dependent	dependent	JJ
cord-014462-11ggaqf1	1388	8	on	on	IN
cord-014462-11ggaqf1	1388	9	ATP	ATP	NNP
cord-014462-11ggaqf1	1388	10	and	and	CC
cord-014462-11ggaqf1	1388	11	Mg	Mg	NNP
cord-014462-11ggaqf1	1388	12	2	2	CD
cord-014462-11ggaqf1	1388	13	?	?	.
cord-014462-11ggaqf1	1389	1	ion	ion	NN
cord-014462-11ggaqf1	1389	2	.	.	.
cord-014462-11ggaqf1	1390	1	NSs	NSs	NNP
cord-014462-11ggaqf1	1390	2	could	could	MD
cord-014462-11ggaqf1	1390	3	unwind	unwind	VB
cord-014462-11ggaqf1	1390	4	dsDNA	dsdna	RB
cord-014462-11ggaqf1	1390	5	substrate	substrate	NN
cord-014462-11ggaqf1	1390	6	with	with	IN
cord-014462-11ggaqf1	1390	7	5	5	CD
cord-014462-11ggaqf1	1390	8	0	0	CD
cord-014462-11ggaqf1	1390	9	overhang	overhang	NN
cord-014462-11ggaqf1	1390	10	,	,	,
cord-014462-11ggaqf1	1390	11	or	or	CC
cord-014462-11ggaqf1	1390	12	3	3	CD
cord-014462-11ggaqf1	1390	13	0	0	CD
cord-014462-11ggaqf1	1390	14	overhang	overhang	NN
cord-014462-11ggaqf1	1390	15	.	.	.
cord-014462-11ggaqf1	1391	1	Mutation	mutation	NN
cord-014462-11ggaqf1	1391	2	of	of	IN
cord-014462-11ggaqf1	1391	3	the	the	DT
cord-014462-11ggaqf1	1391	4	crucial	crucial	JJ
cord-014462-11ggaqf1	1391	5	lysine	lysine	NN
cord-014462-11ggaqf1	1391	6	in	in	IN
cord-014462-11ggaqf1	1391	7	Walker	Walker	NNP
cord-014462-11ggaqf1	1391	8	motif	motif	NN
cord-014462-11ggaqf1	1391	9	A	a	NN
cord-014462-11ggaqf1	1391	10	(	(	-LRB-
cord-014462-11ggaqf1	1391	11	K189	k189	VB
cord-014462-11ggaqf1	1391	12	)	)	-RRB-
cord-014462-11ggaqf1	1391	13	severely	severely	RB
cord-014462-11ggaqf1	1391	14	affected	affect	VBD
cord-014462-11ggaqf1	1391	15	the	the	DT
cord-014462-11ggaqf1	1391	16	unwinding	unwind	VBG
cord-014462-11ggaqf1	1391	17	activity	activity	NN
cord-014462-11ggaqf1	1391	18	where	where	WRB
cord-014462-11ggaqf1	1391	19	as	as	IN
cord-014462-11ggaqf1	1391	20	mutation	mutation	NN
cord-014462-11ggaqf1	1391	21	of	of	IN
cord-014462-11ggaqf1	1391	22	aspartate	aspartate	NN
cord-014462-11ggaqf1	1391	23	residue	residue	NN
cord-014462-11ggaqf1	1391	24	in	in	IN
cord-014462-11ggaqf1	1391	25	Walker	Walker	NNP
cord-014462-11ggaqf1	1391	26	motif	motif	NN
cord-014462-11ggaqf1	1391	27	B	b	NN
cord-014462-11ggaqf1	1391	28	(	(	-LRB-
cord-014462-11ggaqf1	1391	29	D159	D159	NNP
cord-014462-11ggaqf1	1391	30	)	)	-RRB-
cord-014462-11ggaqf1	1391	31	resulted	result	VBD
cord-014462-11ggaqf1	1391	32	in	in	IN
cord-014462-11ggaqf1	1391	33	only	only	RB
cord-014462-11ggaqf1	1391	34	20	20	CD
cord-014462-11ggaqf1	1391	35	%	%	NN
cord-014462-11ggaqf1	1391	36	loss	loss	NN
cord-014462-11ggaqf1	1391	37	of	of	IN
cord-014462-11ggaqf1	1391	38	activity	activity	NN
cord-014462-11ggaqf1	1391	39	.	.	.
cord-014462-11ggaqf1	1392	1	In	in	IN
cord-014462-11ggaqf1	1392	2	this	this	DT
cord-014462-11ggaqf1	1392	3	regard	regard	NN
cord-014462-11ggaqf1	1392	4	,	,	,
cord-014462-11ggaqf1	1392	5	rNSs	rNSs	NNP
cord-014462-11ggaqf1	1392	6	is	be	VBZ
cord-014462-11ggaqf1	1392	7	a	a	DT
cord-014462-11ggaqf1	1392	8	unique	unique	JJ
cord-014462-11ggaqf1	1392	9	enzyme	enzyme	NN
cord-014462-11ggaqf1	1392	10	which	which	WDT
cord-014462-11ggaqf1	1392	11	does	do	VBZ
cord-014462-11ggaqf1	1392	12	not	not	RB
cord-014462-11ggaqf1	1392	13	have	have	VB
cord-014462-11ggaqf1	1392	14	the	the	DT
cord-014462-11ggaqf1	1392	15	canonical	canonical	JJ
cord-014462-11ggaqf1	1392	16	helicase	helicase	NN
cord-014462-11ggaqf1	1392	17	motifs	motif	NNS
cord-014462-11ggaqf1	1392	18	but	but	CC
cord-014462-11ggaqf1	1392	19	can	can	MD
cord-014462-11ggaqf1	1392	20	catalyze	catalyze	VB
cord-014462-11ggaqf1	1392	21	dsDNA	dsdna	RB
cord-014462-11ggaqf1	1392	22	/	/	SYM
cord-014462-11ggaqf1	1392	23	dsRNA	dsrna	NN
cord-014462-11ggaqf1	1392	24	unwinding	unwind	VBG
cord-014462-11ggaqf1	1392	25	in	in	IN
cord-014462-11ggaqf1	1392	26	an	an	DT
cord-014462-11ggaqf1	1392	27	ATP	ATP	NNP
cord-014462-11ggaqf1	1392	28	and	and	CC
cord-014462-11ggaqf1	1392	29	Mg	Mg	NNP
cord-014462-11ggaqf1	1392	30	2	2	CD
cord-014462-11ggaqf1	1392	31	?	?	.
cord-014462-11ggaqf1	1393	1	dependent	dependent	JJ
cord-014462-11ggaqf1	1393	2	manner	manner	NN
cord-014462-11ggaqf1	1393	3	.	.	.
cord-014462-11ggaqf1	1394	1	The	the	DT
cord-014462-11ggaqf1	1394	2	rNSs	rNSs	NNP
cord-014462-11ggaqf1	1394	3	might	may	MD
cord-014462-11ggaqf1	1394	4	act	act	VB
cord-014462-11ggaqf1	1394	5	as	as	IN
cord-014462-11ggaqf1	1394	6	a	a	DT
cord-014462-11ggaqf1	1394	7	suppressor	suppressor	NN
cord-014462-11ggaqf1	1394	8	of	of	IN
cord-014462-11ggaqf1	1394	9	by	by	IN
cord-014462-11ggaqf1	1394	10	unwinding	unwind	VBG
cord-014462-11ggaqf1	1394	11	the	the	DT
cord-014462-11ggaqf1	1394	12	dsRNA	dsrna	NN
cord-014462-11ggaqf1	1394	13	,	,	,
cord-014462-11ggaqf1	1394	14	the	the	DT
cord-014462-11ggaqf1	1394	15	substrate	substrate	NN
cord-014462-11ggaqf1	1394	16	for	for	IN
cord-014462-11ggaqf1	1394	17	DICER	DICER	NNP
cord-014462-11ggaqf1	1394	18	.	.	.
cord-014462-11ggaqf1	1395	1	In	in	IN
cord-014462-11ggaqf1	1395	2	addition	addition	NN
cord-014462-11ggaqf1	1395	3	to	to	IN
cord-014462-11ggaqf1	1395	4	being	be	VBG
cord-014462-11ggaqf1	1395	5	a	a	DT
cord-014462-11ggaqf1	1395	6	suppressor	suppressor	NN
cord-014462-11ggaqf1	1395	7	of	of	IN
cord-014462-11ggaqf1	1395	8	PTGS	PTGS	NNP
cord-014462-11ggaqf1	1395	9	,	,	,
cord-014462-11ggaqf1	1395	10	NSs	NSs	NNP
cord-014462-11ggaqf1	1395	11	may	may	MD
cord-014462-11ggaqf1	1395	12	also	also	RB
cord-014462-11ggaqf1	1395	13	regulate	regulate	VB
cord-014462-11ggaqf1	1395	14	the	the	DT
cord-014462-11ggaqf1	1395	15	viral	viral	JJ
cord-014462-11ggaqf1	1395	16	replication	replication	NN
cord-014462-11ggaqf1	1395	17	and	and	CC
cord-014462-11ggaqf1	1395	18	transcription	transcription	NN
cord-014462-11ggaqf1	1395	19	by	by	IN
cord-014462-11ggaqf1	1395	20	modulating	modulate	VBG
cord-014462-11ggaqf1	1395	21	the	the	DT
cord-014462-11ggaqf1	1395	22	secondary	secondary	JJ
cord-014462-11ggaqf1	1395	23	structure	structure	NN
cord-014462-11ggaqf1	1395	24	of	of	IN
cord-014462-11ggaqf1	1395	25	the	the	DT
cord-014462-11ggaqf1	1395	26	viral	viral	JJ
cord-014462-11ggaqf1	1395	27	genome	genome	NN
cord-014462-11ggaqf1	1395	28	.	.	.
cord-014462-11ggaqf1	1396	1	This	this	DT
cord-014462-11ggaqf1	1396	2	new	new	JJ
cord-014462-11ggaqf1	1396	3	research	research	NN
cord-014462-11ggaqf1	1396	4	finding	find	VBG
cord-014462-11ggaqf1	1396	5	on	on	IN
cord-014462-11ggaqf1	1396	6	NSs	ns	NNS
cord-014462-11ggaqf1	1396	7	might	may	MD
cord-014462-11ggaqf1	1396	8	pave	pave	VB
cord-014462-11ggaqf1	1396	9	way	way	NN
cord-014462-11ggaqf1	1396	10	for	for	IN
cord-014462-11ggaqf1	1396	11	further	further	JJ
cord-014462-11ggaqf1	1396	12	studies	study	NNS
cord-014462-11ggaqf1	1396	13	on	on	IN
cord-014462-11ggaqf1	1396	14	its	-PRON-	PRP$
cord-014462-11ggaqf1	1396	15	role	role	NN
cord-014462-11ggaqf1	1396	16	in	in	IN
cord-014462-11ggaqf1	1396	17	viral	viral	JJ
cord-014462-11ggaqf1	1396	18	replication	replication	NN
cord-014462-11ggaqf1	1396	19	and	and	CC
cord-014462-11ggaqf1	1396	20	transcription	transcription	NN
cord-014462-11ggaqf1	1396	21	.	.	.
cord-014462-11ggaqf1	1397	1	Yellow	yellow	JJ
cord-014462-11ggaqf1	1397	2	vein	vein	NN
cord-014462-11ggaqf1	1397	3	mosaic	mosaic	NN
cord-014462-11ggaqf1	1397	4	disease	disease	NN
cord-014462-11ggaqf1	1397	5	of	of	IN
cord-014462-11ggaqf1	1397	6	pumpkin	pumpkin	NN
cord-014462-11ggaqf1	1397	7	(	(	-LRB-
cord-014462-11ggaqf1	1397	8	Cucurbita	Cucurbita	NNP
cord-014462-11ggaqf1	1397	9	moschata	moschata	NNS
cord-014462-11ggaqf1	1397	10	)	)	-RRB-
cord-014462-11ggaqf1	1397	11	poses	pose	VBZ
cord-014462-11ggaqf1	1397	12	a	a	DT
cord-014462-11ggaqf1	1397	13	serious	serious	JJ
cord-014462-11ggaqf1	1397	14	threat	threat	NN
cord-014462-11ggaqf1	1397	15	to	to	IN
cord-014462-11ggaqf1	1397	16	the	the	DT
cord-014462-11ggaqf1	1397	17	cultivation	cultivation	NN
cord-014462-11ggaqf1	1397	18	of	of	IN
cord-014462-11ggaqf1	1397	19	this	this	DT
cord-014462-11ggaqf1	1397	20	crop	crop	NN
cord-014462-11ggaqf1	1397	21	in	in	IN
cord-014462-11ggaqf1	1397	22	India	India	NNP
cord-014462-11ggaqf1	1397	23	.	.	.
cord-014462-11ggaqf1	1398	1	The	the	DT
cord-014462-11ggaqf1	1398	2	disease	disease	NN
cord-014462-11ggaqf1	1398	3	was	be	VBD
cord-014462-11ggaqf1	1398	4	found	find	VBN
cord-014462-11ggaqf1	1398	5	to	to	TO
cord-014462-11ggaqf1	1398	6	be	be	VB
cord-014462-11ggaqf1	1398	7	associated	associate	VBN
cord-014462-11ggaqf1	1398	8	with	with	IN
cord-014462-11ggaqf1	1398	9	whitefly	whitefly	NN
cord-014462-11ggaqf1	1398	10	-	-	HYPH
cord-014462-11ggaqf1	1398	11	transmitted	transmit	VBN
cord-014462-11ggaqf1	1398	12	bipartite	bipartite	JJ
cord-014462-11ggaqf1	1398	13	begomoviruses	begomoviruse	NNS
cord-014462-11ggaqf1	1398	14	were	be	VBD
cord-014462-11ggaqf1	1398	15	detected	detect	VBN
cord-014462-11ggaqf1	1398	16	in	in	IN
cord-014462-11ggaqf1	1398	17	Varanasi	Varanasi	NNP
cord-014462-11ggaqf1	1398	18	field	field	NN
cord-014462-11ggaqf1	1398	19	using	use	VBG
cord-014462-11ggaqf1	1398	20	polymerase	polymerase	NN
cord-014462-11ggaqf1	1398	21	chain	chain	NN
cord-014462-11ggaqf1	1398	22	reaction	reaction	NN
cord-014462-11ggaqf1	1398	23	(	(	-LRB-
cord-014462-11ggaqf1	1398	24	PCR	PCR	NNP
cord-014462-11ggaqf1	1398	25	)	)	-RRB-
cord-014462-11ggaqf1	1398	26	with	with	IN
cord-014462-11ggaqf1	1398	27	primer	primer	NN
cord-014462-11ggaqf1	1398	28	design	design	NN
cord-014462-11ggaqf1	1398	29	through	through	IN
cord-014462-11ggaqf1	1398	30	coat	coat	NN
cord-014462-11ggaqf1	1398	31	protein	protein	NN
cord-014462-11ggaqf1	1398	32	conserved	conserve	VBN
cord-014462-11ggaqf1	1398	33	region	region	NN
cord-014462-11ggaqf1	1398	34	of	of	IN
cord-014462-11ggaqf1	1398	35	begomoviruses	begomoviruse	NNS
cord-014462-11ggaqf1	1398	36	from	from	IN
cord-014462-11ggaqf1	1398	37	NCBI	NCBI	NNP
cord-014462-11ggaqf1	1398	38	database	database	NN
cord-014462-11ggaqf1	1398	39	.	.	.
cord-014462-11ggaqf1	1399	1	All	all	DT
cord-014462-11ggaqf1	1399	2	plant	plant	NN
cord-014462-11ggaqf1	1399	3	samples	sample	NNS
cord-014462-11ggaqf1	1399	4	showing	show	VBG
cord-014462-11ggaqf1	1399	5	symptoms	symptom	NNS
cord-014462-11ggaqf1	1399	6	were	be	VBD
cord-014462-11ggaqf1	1399	7	infected	infect	VBN
cord-014462-11ggaqf1	1399	8	with	with	IN
cord-014462-11ggaqf1	1399	9	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1399	10	.	.	.
cord-014462-11ggaqf1	1400	1	The	the	DT
cord-014462-11ggaqf1	1400	2	virus	virus	NN
cord-014462-11ggaqf1	1400	3	species	specie	NNS
cord-014462-11ggaqf1	1400	4	were	be	VBD
cord-014462-11ggaqf1	1400	5	provisionally	provisionally	RB
cord-014462-11ggaqf1	1400	6	identified	identify	VBN
cord-014462-11ggaqf1	1400	7	by	by	IN
cord-014462-11ggaqf1	1400	8	sequencing	sequence	VBG
cord-014462-11ggaqf1	1400	9	*	*	NFP
cord-014462-11ggaqf1	1400	10	750	750	CD
cord-014462-11ggaqf1	1400	11	bp	bp	NNS
cord-014462-11ggaqf1	1400	12	of	of	IN
cord-014462-11ggaqf1	1400	13	the	the	DT
cord-014462-11ggaqf1	1400	14	viral	viral	JJ
cord-014462-11ggaqf1	1400	15	coat	coat	NN
cord-014462-11ggaqf1	1400	16	protein	protein	NN
cord-014462-11ggaqf1	1400	17	gene	gene	NN
cord-014462-11ggaqf1	1401	1	(	(	-LRB-
cord-014462-11ggaqf1	1401	2	AV1	AV1	NNP
cord-014462-11ggaqf1	1401	3	Ageratum	Ageratum	NNP
cord-014462-11ggaqf1	1401	4	conyzoides	conyzoide	VBZ
cord-014462-11ggaqf1	1401	5	is	be	VBZ
cord-014462-11ggaqf1	1401	6	commonly	commonly	RB
cord-014462-11ggaqf1	1401	7	known	know	VBN
cord-014462-11ggaqf1	1401	8	as	as	IN
cord-014462-11ggaqf1	1401	9	Billygoat	Billygoat	NNP
cord-014462-11ggaqf1	1401	10	-	-	HYPH
cord-014462-11ggaqf1	1401	11	weed	weed	NN
cord-014462-11ggaqf1	1401	12	,	,	,
cord-014462-11ggaqf1	1401	13	Chick	Chick	NNP
cord-014462-11ggaqf1	1401	14	weed	weed	NN
cord-014462-11ggaqf1	1401	15	,	,	,
cord-014462-11ggaqf1	1401	16	Goatweed	Goatweed	NNP
cord-014462-11ggaqf1	1401	17	and	and	CC
cord-014462-11ggaqf1	1401	18	Whiteweed	Whiteweed	NNP
cord-014462-11ggaqf1	1401	19	.	.	.
cord-014462-11ggaqf1	1402	1	In	in	IN
cord-014462-11ggaqf1	1402	2	India	India	NNP
cord-014462-11ggaqf1	1402	3	it	-PRON-	PRP
cord-014462-11ggaqf1	1402	4	is	be	VBZ
cord-014462-11ggaqf1	1402	5	popularly	popularly	RB
cord-014462-11ggaqf1	1402	6	known	know	VBN
cord-014462-11ggaqf1	1402	7	as	as	IN
cord-014462-11ggaqf1	1402	8	bill	bill	NN
cord-014462-11ggaqf1	1402	9	goat	goat	NNP
cord-014462-11ggaqf1	1402	10	weed	weed	NN
cord-014462-11ggaqf1	1402	11	.	.	.
cord-014462-11ggaqf1	1403	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1403	2	is	be	VBZ
cord-014462-11ggaqf1	1403	3	an	an	DT
cord-014462-11ggaqf1	1403	4	annual	annual	JJ
cord-014462-11ggaqf1	1403	5	herbaceous	herbaceous	JJ
cord-014462-11ggaqf1	1403	6	plant	plant	NN
cord-014462-11ggaqf1	1403	7	with	with	IN
cord-014462-11ggaqf1	1403	8	a	a	DT
cord-014462-11ggaqf1	1403	9	long	long	JJ
cord-014462-11ggaqf1	1403	10	history	history	NN
cord-014462-11ggaqf1	1403	11	of	of	IN
cord-014462-11ggaqf1	1403	12	traditional	traditional	JJ
cord-014462-11ggaqf1	1403	13	medicinal	medicinal	JJ
cord-014462-11ggaqf1	1403	14	uses	use	NNS
cord-014462-11ggaqf1	1403	15	in	in	IN
cord-014462-11ggaqf1	1403	16	several	several	JJ
cord-014462-11ggaqf1	1403	17	countries	country	NNS
cord-014462-11ggaqf1	1403	18	of	of	IN
cord-014462-11ggaqf1	1403	19	the	the	DT
cord-014462-11ggaqf1	1403	20	world	world	NN
cord-014462-11ggaqf1	1403	21	and	and	CC
cord-014462-11ggaqf1	1403	22	also	also	RB
cord-014462-11ggaqf1	1403	23	reputed	repute	VBN
cord-014462-11ggaqf1	1403	24	to	to	TO
cord-014462-11ggaqf1	1403	25	possess	possess	VB
cord-014462-11ggaqf1	1403	26	varied	varied	JJ
cord-014462-11ggaqf1	1403	27	medicinal	medicinal	JJ
cord-014462-11ggaqf1	1403	28	properties	property	NNS
cord-014462-11ggaqf1	1403	29	including	include	VBG
cord-014462-11ggaqf1	1403	30	the	the	DT
cord-014462-11ggaqf1	1403	31	treatment	treatment	NN
cord-014462-11ggaqf1	1403	32	of	of	IN
cord-014462-11ggaqf1	1403	33	wounds	wound	NNS
cord-014462-11ggaqf1	1403	34	and	and	CC
cord-014462-11ggaqf1	1403	35	burns	burn	NNS
cord-014462-11ggaqf1	1403	36	.	.	.
cord-014462-11ggaqf1	1404	1	In	in	IN
cord-014462-11ggaqf1	1404	2	Cameroon	Cameroon	NNP
cord-014462-11ggaqf1	1404	3	and	and	CC
cord-014462-11ggaqf1	1404	4	Congo	Congo	NNP
cord-014462-11ggaqf1	1404	5	,	,	,
cord-014462-11ggaqf1	1404	6	it	-PRON-	PRP
cord-014462-11ggaqf1	1404	7	is	be	VBZ
cord-014462-11ggaqf1	1404	8	used	use	VBN
cord-014462-11ggaqf1	1404	9	traditionally	traditionally	RB
cord-014462-11ggaqf1	1404	10	to	to	TO
cord-014462-11ggaqf1	1404	11	treat	treat	VB
cord-014462-11ggaqf1	1404	12	fever	fever	NN
cord-014462-11ggaqf1	1404	13	,	,	,
cord-014462-11ggaqf1	1404	14	rheumatism	rheumatism	NN
cord-014462-11ggaqf1	1404	15	,	,	,
cord-014462-11ggaqf1	1404	16	headache	headache	NN
cord-014462-11ggaqf1	1404	17	,	,	,
cord-014462-11ggaqf1	1404	18	and	and	CC
cord-014462-11ggaqf1	1404	19	colic	colic	NN
cord-014462-11ggaqf1	1404	20	.	.	.
cord-014462-11ggaqf1	1405	1	During	during	IN
cord-014462-11ggaqf1	1405	2	survey	survey	NN
cord-014462-11ggaqf1	1405	3	in	in	IN
cord-014462-11ggaqf1	1405	4	and	and	CC
cord-014462-11ggaqf1	1405	5	around	around	IN
cord-014462-11ggaqf1	1405	6	Gorakhpur	Gorakhpur	NNP
cord-014462-11ggaqf1	1405	7	in	in	IN
cord-014462-11ggaqf1	1405	8	2009	2009	CD
cord-014462-11ggaqf1	1405	9	,	,	,
cord-014462-11ggaqf1	1405	10	Ageratum	Ageratum	NNP
cord-014462-11ggaqf1	1405	11	plants	plant	NNS
cord-014462-11ggaqf1	1405	12	were	be	VBD
cord-014462-11ggaqf1	1405	13	found	find	VBN
cord-014462-11ggaqf1	1405	14	affected	affect	VBN
cord-014462-11ggaqf1	1405	15	with	with	IN
cord-014462-11ggaqf1	1405	16	the	the	DT
cord-014462-11ggaqf1	1405	17	symptoms	symptom	NNS
cord-014462-11ggaqf1	1405	18	of	of	IN
cord-014462-11ggaqf1	1405	19	leaf	leaf	NN
cord-014462-11ggaqf1	1405	20	curling	curling	NN
cord-014462-11ggaqf1	1405	21	,	,	,
cord-014462-11ggaqf1	1405	22	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1405	23	mottling	mottling	NN
cord-014462-11ggaqf1	1405	24	and	and	CC
cord-014462-11ggaqf1	1405	25	leaf	leaf	NN
cord-014462-11ggaqf1	1405	26	yellows	yellow	NNS
cord-014462-11ggaqf1	1405	27	.	.	.
cord-014462-11ggaqf1	1406	1	The	the	DT
cord-014462-11ggaqf1	1406	2	infected	infected	JJ
cord-014462-11ggaqf1	1406	3	leaf	leaf	NN
cord-014462-11ggaqf1	1406	4	samples	sample	NNS
cord-014462-11ggaqf1	1406	5	were	be	VBD
cord-014462-11ggaqf1	1406	6	processed	process	VBN
cord-014462-11ggaqf1	1406	7	for	for	IN
cord-014462-11ggaqf1	1406	8	virus	virus	NN
cord-014462-11ggaqf1	1406	9	identification	identification	NN
cord-014462-11ggaqf1	1406	10	and	and	CC
cord-014462-11ggaqf1	1406	11	association	association	NN
cord-014462-11ggaqf1	1406	12	with	with	IN
cord-014462-11ggaqf1	1406	13	PCR	PCR	NNP
cord-014462-11ggaqf1	1406	14	assays	assay	NNS
cord-014462-11ggaqf1	1406	15	.	.	.
cord-014462-11ggaqf1	1407	1	Total	total	JJ
cord-014462-11ggaqf1	1407	2	DNA	DNA	NNP
cord-014462-11ggaqf1	1407	3	was	be	VBD
cord-014462-11ggaqf1	1407	4	extracted	extract	VBN
cord-014462-11ggaqf1	1407	5	and	and	CC
cord-014462-11ggaqf1	1407	6	PCR	PCR	NNP
cord-014462-11ggaqf1	1407	7	were	be	VBD
cord-014462-11ggaqf1	1407	8	performed	perform	VBN
cord-014462-11ggaqf1	1407	9	with	with	IN
cord-014462-11ggaqf1	1407	10	Begomovirus	Begomovirus	NNP
cord-014462-11ggaqf1	1407	11	specific	specific	JJ
cord-014462-11ggaqf1	1407	12	primers	primer	NNS
cord-014462-11ggaqf1	1407	13	(	(	-LRB-
cord-014462-11ggaqf1	1407	14	TLCV	tlcv	NN
cord-014462-11ggaqf1	1407	15	-	-	HYPH
cord-014462-11ggaqf1	1407	16	CP	cp	NN
cord-014462-11ggaqf1	1407	17	)	)	-RRB-
cord-014462-11ggaqf1	1407	18	.	.	.
cord-014462-11ggaqf1	1408	1	A	a	DT
cord-014462-11ggaqf1	1408	2	*	*	NFP
cord-014462-11ggaqf1	1408	3	800	800	CD
cord-014462-11ggaqf1	1408	4	bp	bp	NNP
cord-014462-11ggaqf1	1408	5	band	band	NN
cord-014462-11ggaqf1	1408	6	was	be	VBD
cord-014462-11ggaqf1	1408	7	consistently	consistently	RB
cord-014462-11ggaqf1	1408	8	amplified	amplify	VBN
cord-014462-11ggaqf1	1408	9	on	on	IN
cord-014462-11ggaqf1	1408	10	1	1	CD
cord-014462-11ggaqf1	1408	11	%	%	NN
cord-014462-11ggaqf1	1408	12	agarose	agarose	JJ
cord-014462-11ggaqf1	1408	13	.	.	.
cord-014462-11ggaqf1	1409	1	The	the	DT
cord-014462-11ggaqf1	1409	2	PCR	PCR	NNP
cord-014462-11ggaqf1	1409	3	products	product	NNS
cord-014462-11ggaqf1	1409	4	were	be	VBD
cord-014462-11ggaqf1	1409	5	directly	directly	RB
cord-014462-11ggaqf1	1409	6	sequenced	sequence	VBN
cord-014462-11ggaqf1	1409	7	and	and	CC
cord-014462-11ggaqf1	1409	8	sequence	sequence	NN
cord-014462-11ggaqf1	1409	9	was	be	VBD
cord-014462-11ggaqf1	1409	10	submitted	submit	VBN
cord-014462-11ggaqf1	1409	11	in	in	IN
cord-014462-11ggaqf1	1409	12	GenBank	GenBank	NNP
cord-014462-11ggaqf1	1409	13	with	with	IN
cord-014462-11ggaqf1	1409	14	the	the	DT
cord-014462-11ggaqf1	1409	15	accession	accession	NN
cord-014462-11ggaqf1	1409	16	no	no	UH
cord-014462-11ggaqf1	1409	17	.	.	.
cord-014462-11ggaqf1	1410	1	GQ412352	GQ412352	NNP
cord-014462-11ggaqf1	1410	2	.	.	.
cord-014462-11ggaqf1	1411	1	The	the	DT
cord-014462-11ggaqf1	1411	2	blast	blast	NN
cord-014462-11ggaqf1	1411	3	search	search	NN
cord-014462-11ggaqf1	1411	4	analysis	analysis	NN
cord-014462-11ggaqf1	1411	5	showed	show	VBD
cord-014462-11ggaqf1	1411	6	highest	high	JJS
cord-014462-11ggaqf1	1411	7	similarity	similarity	NN
cord-014462-11ggaqf1	1411	8	of	of	IN
cord-014462-11ggaqf1	1411	9	98	98	CD
cord-014462-11ggaqf1	1411	10	%	%	NN
cord-014462-11ggaqf1	1411	11	with	with	IN
cord-014462-11ggaqf1	1411	12	the	the	DT
cord-014462-11ggaqf1	1411	13	Ageratum	Ageratum	NNP
cord-014462-11ggaqf1	1411	14	enation	enation	NN
cord-014462-11ggaqf1	1411	15	virus	virus	NN
cord-014462-11ggaqf1	1411	16	.	.	.
cord-014462-11ggaqf1	1412	1	Vernonia	Vernonia	NNP
cord-014462-11ggaqf1	1412	2	cinerea	cinerea	NN
cord-014462-11ggaqf1	1412	3	leaves	leave	VBZ
cord-014462-11ggaqf1	1412	4	with	with	IN
cord-014462-11ggaqf1	1412	5	yellow	yellow	JJ
cord-014462-11ggaqf1	1412	6	vein	vein	NN
cord-014462-11ggaqf1	1412	7	symptoms	symptom	NNS
cord-014462-11ggaqf1	1412	8	were	be	VBD
cord-014462-11ggaqf1	1412	9	collected	collect	VBN
cord-014462-11ggaqf1	1412	10	around	around	IN
cord-014462-11ggaqf1	1412	11	crop	crop	NN
cord-014462-11ggaqf1	1412	12	fields	field	NNS
cord-014462-11ggaqf1	1412	13	in	in	IN
cord-014462-11ggaqf1	1412	14	Madurai	Madurai	NNP
cord-014462-11ggaqf1	1412	15	.	.	.
cord-014462-11ggaqf1	1413	1	A	a	DT
cord-014462-11ggaqf1	1413	2	550	550	CD
cord-014462-11ggaqf1	1413	3	bp	bp	NNP
cord-014462-11ggaqf1	1413	4	product	product	NN
cord-014462-11ggaqf1	1413	5	amplified	amplify	VBN
cord-014462-11ggaqf1	1413	6	from	from	IN
cord-014462-11ggaqf1	1413	7	total	total	JJ
cord-014462-11ggaqf1	1413	8	DNA	dna	NN
cord-014462-11ggaqf1	1413	9	extracted	extract	VBN
cord-014462-11ggaqf1	1413	10	from	from	IN
cord-014462-11ggaqf1	1413	11	symptomatic	symptomatic	JJ
cord-014462-11ggaqf1	1413	12	leaves	leave	NNS
cord-014462-11ggaqf1	1413	13	with	with	IN
cord-014462-11ggaqf1	1413	14	degenerate	degenerate	JJ
cord-014462-11ggaqf1	1413	15	primers	primer	NNS
cord-014462-11ggaqf1	1413	16	designed	design	VBN
cord-014462-11ggaqf1	1413	17	to	to	TO
cord-014462-11ggaqf1	1413	18	amplify	amplify	VB
cord-014462-11ggaqf1	1413	19	a	a	DT
cord-014462-11ggaqf1	1413	20	part	part	NN
cord-014462-11ggaqf1	1413	21	of	of	IN
cord-014462-11ggaqf1	1413	22	the	the	DT
cord-014462-11ggaqf1	1413	23	AV1	AV1	NNP
cord-014462-11ggaqf1	1413	24	gene	gene	NN
cord-014462-11ggaqf1	1413	25	from	from	IN
cord-014462-11ggaqf1	1413	26	begomoviral	begomoviral	NNP
cord-014462-11ggaqf1	1413	27	DNA	DNA	NNP
cord-014462-11ggaqf1	1413	28	A	A	NNP
cord-014462-11ggaqf1	1413	29	component	component	NN
cord-014462-11ggaqf1	1413	30	was	be	VBD
cord-014462-11ggaqf1	1413	31	cloned	clone	VBN
cord-014462-11ggaqf1	1413	32	and	and	CC
cord-014462-11ggaqf1	1413	33	sequenced	sequence	VBN
cord-014462-11ggaqf1	1413	34	.	.	.
cord-014462-11ggaqf1	1414	1	Based	base	VBN
cord-014462-11ggaqf1	1414	2	on	on	IN
cord-014462-11ggaqf1	1414	3	the	the	DT
cord-014462-11ggaqf1	1414	4	above	above	JJ
cord-014462-11ggaqf1	1414	5	sequences	sequence	NNS
cord-014462-11ggaqf1	1414	6	,	,	,
cord-014462-11ggaqf1	1414	7	specific	specific	JJ
cord-014462-11ggaqf1	1414	8	primers	primer	NNS
cord-014462-11ggaqf1	1414	9	were	be	VBD
cord-014462-11ggaqf1	1414	10	designed	design	VBN
cord-014462-11ggaqf1	1414	11	and	and	CC
cord-014462-11ggaqf1	1414	12	the	the	DT
cord-014462-11ggaqf1	1414	13	full	full	JJ
cord-014462-11ggaqf1	1414	14	length	length	NN
cord-014462-11ggaqf1	1415	1	DNA	DNA	NNP
cord-014462-11ggaqf1	1415	2	A	a	NN
cord-014462-11ggaqf1	1415	3	of	of	IN
cord-014462-11ggaqf1	1415	4	2745	2745	CD
cord-014462-11ggaqf1	1415	5	nucleotides	nucleotide	NNS
cord-014462-11ggaqf1	1415	6	with	with	IN
cord-014462-11ggaqf1	1415	7	typical	typical	JJ
cord-014462-11ggaqf1	1415	8	genome	genome	NN
cord-014462-11ggaqf1	1415	9	organization	organization	NN
cord-014462-11ggaqf1	1415	10	of	of	IN
cord-014462-11ggaqf1	1415	11	begomoviral	begomoviral	NNP
cord-014462-11ggaqf1	1415	12	DNA	DNA	NNP
cord-014462-11ggaqf1	1415	13	A	A	NNP
cord-014462-11ggaqf1	1415	14	was	be	VBD
cord-014462-11ggaqf1	1415	15	obtained	obtain	VBN
cord-014462-11ggaqf1	1415	16	and	and	CC
cord-014462-11ggaqf1	1415	17	was	be	VBD
cord-014462-11ggaqf1	1415	18	submitted	submit	VBN
cord-014462-11ggaqf1	1415	19	to	to	IN
cord-014462-11ggaqf1	1415	20	EMBL	EMBL	NNP
cord-014462-11ggaqf1	1415	21	data	datum	NNS
cord-014462-11ggaqf1	1415	22	base	base	NN
cord-014462-11ggaqf1	1416	1	(	(	-LRB-
cord-014462-11ggaqf1	1416	2	Acc	Acc	NNP
cord-014462-11ggaqf1	1416	3	No	no	NN
cord-014462-11ggaqf1	1416	4	:	:	:
cord-014462-11ggaqf1	1416	5	AM182232	am182232	NN
cord-014462-11ggaqf1	1416	6	)	)	-RRB-
cord-014462-11ggaqf1	1416	7	.	.	.
cord-014462-11ggaqf1	1417	1	The	the	DT
cord-014462-11ggaqf1	1417	2	sequence	sequence	NN
cord-014462-11ggaqf1	1417	3	comparison	comparison	NN
cord-014462-11ggaqf1	1417	4	with	with	IN
cord-014462-11ggaqf1	1417	5	other	other	JJ
cord-014462-11ggaqf1	1417	6	begomoviruses	begomoviruse	NNS
cord-014462-11ggaqf1	1417	7	revealed	reveal	VBD
cord-014462-11ggaqf1	1417	8	the	the	DT
cord-014462-11ggaqf1	1417	9	closest	close	JJS
cord-014462-11ggaqf1	1417	10	identity	identity	NN
cord-014462-11ggaqf1	1417	11	(	(	-LRB-
cord-014462-11ggaqf1	1417	12	83	83	CD
cord-014462-11ggaqf1	1417	13	%	%	NN
cord-014462-11ggaqf1	1417	14	)	)	-RRB-
cord-014462-11ggaqf1	1417	15	with	with	IN
cord-014462-11ggaqf1	1417	16	Emilia	Emilia	NNP
cord-014462-11ggaqf1	1417	17	yellow	yellow	JJ
cord-014462-11ggaqf1	1417	18	vein	vein	NN
cord-014462-11ggaqf1	1417	19	virus	virus	NN
cord-014462-11ggaqf1	1417	20	from	from	IN
cord-014462-11ggaqf1	1417	21	China	China	NNP
cord-014462-11ggaqf1	1417	22	and	and	CC
cord-014462-11ggaqf1	1417	23	less	less	JJR
cord-014462-11ggaqf1	1417	24	than	than	IN
cord-014462-11ggaqf1	1417	25	80	80	CD
cord-014462-11ggaqf1	1417	26	%	%	NN
cord-014462-11ggaqf1	1417	27	with	with	IN
cord-014462-11ggaqf1	1417	28	all	all	DT
cord-014462-11ggaqf1	1417	29	known	know	VBN
cord-014462-11ggaqf1	1417	30	begomoviruses	begomoviruse	NNS
cord-014462-11ggaqf1	1417	31	.	.	.
cord-014462-11ggaqf1	1418	1	The	the	DT
cord-014462-11ggaqf1	1418	2	International	International	NNP
cord-014462-11ggaqf1	1418	3	Committee	Committee	NNP
cord-014462-11ggaqf1	1418	4	on	on	IN
cord-014462-11ggaqf1	1418	5	Taxonomy	Taxonomy	NNP
cord-014462-11ggaqf1	1418	6	of	of	IN
cord-014462-11ggaqf1	1418	7	Viruses	Viruses	NNPS
cord-014462-11ggaqf1	1418	8	(	(	-LRB-
cord-014462-11ggaqf1	1418	9	ICTV	ICTV	NNP
cord-014462-11ggaqf1	1418	10	)	)	-RRB-
cord-014462-11ggaqf1	1418	11	has	have	VBZ
cord-014462-11ggaqf1	1418	12	therefore	therefore	RB
cord-014462-11ggaqf1	1418	13	recognized	recognize	VBN
cord-014462-11ggaqf1	1418	14	Vernonia	Vernonia	NNP
cord-014462-11ggaqf1	1418	15	yellow	yellow	JJ
cord-014462-11ggaqf1	1418	16	vein	vein	NN
cord-014462-11ggaqf1	1418	17	virus	virus	NN
cord-014462-11ggaqf1	1418	18	(	(	-LRB-
cord-014462-11ggaqf1	1418	19	VYVV	VYVV	NNP
cord-014462-11ggaqf1	1418	20	)	)	-RRB-
cord-014462-11ggaqf1	1418	21	as	as	IN
cord-014462-11ggaqf1	1418	22	a	a	DT
cord-014462-11ggaqf1	1418	23	distinct	distinct	JJ
cord-014462-11ggaqf1	1418	24	begomovirus	begomovirus	JJ
cord-014462-11ggaqf1	1418	25	species	specie	NNS
cord-014462-11ggaqf1	1418	26	.	.	.
cord-014462-11ggaqf1	1419	1	Conventional	conventional	JJ
cord-014462-11ggaqf1	1419	2	PCR	PCR	NNP
cord-014462-11ggaqf1	1419	3	could	could	MD
cord-014462-11ggaqf1	1419	4	not	not	RB
cord-014462-11ggaqf1	1419	5	amplify	amplify	VB
cord-014462-11ggaqf1	1419	6	the	the	DT
cord-014462-11ggaqf1	1419	7	DNA	dna	NN
cord-014462-11ggaqf1	1419	8	B	B	NNP
cord-014462-11ggaqf1	1419	9	or	or	CC
cord-014462-11ggaqf1	1419	10	DNA	DNA	NNP
cord-014462-11ggaqf1	1419	11	b	b	NNP
cord-014462-11ggaqf1	1419	12	from	from	IN
cord-014462-11ggaqf1	1419	13	the	the	DT
cord-014462-11ggaqf1	1419	14	infected	infected	JJ
cord-014462-11ggaqf1	1419	15	tissue	tissue	NN
cord-014462-11ggaqf1	1419	16	.	.	.
cord-014462-11ggaqf1	1420	1	However	however	RB
cord-014462-11ggaqf1	1420	2	,	,	,
cord-014462-11ggaqf1	1420	3	the	the	DT
cord-014462-11ggaqf1	1420	4	b	b	NN
cord-014462-11ggaqf1	1420	5	DNA	DNA	NNP
cord-014462-11ggaqf1	1420	6	(	(	-LRB-
cord-014462-11ggaqf1	1420	7	1364	1364	CD
cord-014462-11ggaqf1	1420	8	bp	bp	NNP
cord-014462-11ggaqf1	1420	9	)	)	-RRB-
cord-014462-11ggaqf1	1420	10	associated	associate	VBD
cord-014462-11ggaqf1	1420	11	with	with	IN
cord-014462-11ggaqf1	1420	12	the	the	DT
cord-014462-11ggaqf1	1420	13	disease	disease	NN
cord-014462-11ggaqf1	1420	14	was	be	VBD
cord-014462-11ggaqf1	1420	15	obtained	obtain	VBN
cord-014462-11ggaqf1	1420	16	(	(	-LRB-
cord-014462-11ggaqf1	1420	17	Acc	Acc	NNP
cord-014462-11ggaqf1	1420	18	No	no	NN
cord-014462-11ggaqf1	1420	19	:	:	:
cord-014462-11ggaqf1	1420	20	FN435836	fn435836	NN
cord-014462-11ggaqf1	1420	21	)	)	-RRB-
cord-014462-11ggaqf1	1420	22	by	by	IN
cord-014462-11ggaqf1	1420	23	the	the	DT
cord-014462-11ggaqf1	1420	24	Rolling	Rolling	NNP
cord-014462-11ggaqf1	1420	25	circle	circle	NN
cord-014462-11ggaqf1	1420	26	amplification	amplification	NN
cord-014462-11ggaqf1	1421	1	-Restriction	-Restriction	NNP
cord-014462-11ggaqf1	1421	2	fragment	fragment	NN
cord-014462-11ggaqf1	1421	3	length	length	NN
cord-014462-11ggaqf1	1421	4	polymorphism	polymorphism	NN
cord-014462-11ggaqf1	1421	5	method	method	NN
cord-014462-11ggaqf1	1421	6	(	(	-LRB-
cord-014462-11ggaqf1	1421	7	RCA	RCA	NNP
cord-014462-11ggaqf1	1421	8	-	-	HYPH
cord-014462-11ggaqf1	1421	9	RFLP	RFLP	NNP
cord-014462-11ggaqf1	1421	10	)	)	-RRB-
cord-014462-11ggaqf1	1421	11	using	use	VBG
cord-014462-11ggaqf1	1421	12	Phi29	Phi29	NNP
cord-014462-11ggaqf1	1421	13	DNA	dna	NN
cord-014462-11ggaqf1	1421	14	polymerase	polymerase	NN
cord-014462-11ggaqf1	1421	15	.	.	.
cord-014462-11ggaqf1	1422	1	Sequence	sequence	NN
cord-014462-11ggaqf1	1422	2	analysis	analysis	NN
cord-014462-11ggaqf1	1422	3	shows	show	VBZ
cord-014462-11ggaqf1	1422	4	that	that	IN
cord-014462-11ggaqf1	1422	5	DNA	DNA	NNP
cord-014462-11ggaqf1	1422	6	b	b	NNP
cord-014462-11ggaqf1	1422	7	of	of	IN
cord-014462-11ggaqf1	1422	8	VYVV	VYVV	NNP
cord-014462-11ggaqf1	1422	9	has	have	VBZ
cord-014462-11ggaqf1	1422	10	the	the	DT
cord-014462-11ggaqf1	1422	11	highest	high	JJS
cord-014462-11ggaqf1	1422	12	identity	identity	NN
cord-014462-11ggaqf1	1422	13	(	(	-LRB-
cord-014462-11ggaqf1	1422	14	81	81	CD
cord-014462-11ggaqf1	1422	15	%	%	NN
cord-014462-11ggaqf1	1422	16	)	)	-RRB-
cord-014462-11ggaqf1	1422	17	with	with	IN
cord-014462-11ggaqf1	1422	18	DNA	DNA	NNP
cord-014462-11ggaqf1	1422	19	b	b	NNP
cord-014462-11ggaqf1	1422	20	of	of	IN
cord-014462-11ggaqf1	1422	21	Ageratum	Ageratum	NNP
cord-014462-11ggaqf1	1422	22	leaf	leaf	NN
cord-014462-11ggaqf1	1422	23	curl	curl	NN
cord-014462-11ggaqf1	1422	24	disease	disease	NN
cord-014462-11ggaqf1	1422	25	and	and	CC
cord-014462-11ggaqf1	1422	26	58	58	CD
cord-014462-11ggaqf1	1422	27	-	-	SYM
cord-014462-11ggaqf1	1422	28	77	77	CD
cord-014462-11ggaqf1	1422	29	%	%	NN
cord-014462-11ggaqf1	1422	30	with	with	IN
cord-014462-11ggaqf1	1422	31	the	the	DT
cord-014462-11ggaqf1	1422	32	b	b	NN
cord-014462-11ggaqf1	1422	33	DNA	dna	NN
cord-014462-11ggaqf1	1422	34	associated	associate	VBN
cord-014462-11ggaqf1	1422	35	with	with	IN
cord-014462-11ggaqf1	1422	36	other	other	JJ
cord-014462-11ggaqf1	1422	37	begomoviruses	begomoviruse	NNS
cord-014462-11ggaqf1	1422	38	.	.	.
cord-014462-11ggaqf1	1423	1	Infectious	infectious	JJ
cord-014462-11ggaqf1	1423	2	clones	clone	NNS
cord-014462-11ggaqf1	1423	3	of	of	IN
cord-014462-11ggaqf1	1423	4	VYVV	VYVV	NNP
cord-014462-11ggaqf1	1423	5	DNA	DNA	NNP
cord-014462-11ggaqf1	1423	6	A	A	NNP
cord-014462-11ggaqf1	1423	7	and	and	CC
cord-014462-11ggaqf1	1423	8	DNA	dna	NN
cord-014462-11ggaqf1	1423	9	b	b	NNP
cord-014462-11ggaqf1	1423	10	as	as	IN
cord-014462-11ggaqf1	1423	11	dimers	dimer	NNS
cord-014462-11ggaqf1	1423	12	were	be	VBD
cord-014462-11ggaqf1	1423	13	made	make	VBN
cord-014462-11ggaqf1	1423	14	using	use	VBG
cord-014462-11ggaqf1	1423	15	the	the	DT
cord-014462-11ggaqf1	1423	16	products	product	NNS
cord-014462-11ggaqf1	1423	17	of	of	IN
cord-014462-11ggaqf1	1423	18	RCA	RCA	NNP
cord-014462-11ggaqf1	1423	19	-	-	HYPH
cord-014462-11ggaqf1	1423	20	RFLP	RFLP	NNP
cord-014462-11ggaqf1	1423	21	.	.	.
cord-014462-11ggaqf1	1424	1	These	these	DT
cord-014462-11ggaqf1	1424	2	infectious	infectious	JJ
cord-014462-11ggaqf1	1424	3	clones	clone	NNS
cord-014462-11ggaqf1	1424	4	will	will	MD
cord-014462-11ggaqf1	1424	5	be	be	VB
cord-014462-11ggaqf1	1424	6	used	use	VBN
cord-014462-11ggaqf1	1424	7	for	for	IN
cord-014462-11ggaqf1	1424	8	agroinfection	agroinfection	NN
cord-014462-11ggaqf1	1424	9	of	of	IN
cord-014462-11ggaqf1	1424	10	Vernonia	Vernonia	NNP
cord-014462-11ggaqf1	1424	11	and	and	CC
cord-014462-11ggaqf1	1424	12	the	the	DT
cord-014462-11ggaqf1	1424	13	results	result	NNS
cord-014462-11ggaqf1	1424	14	will	will	MD
cord-014462-11ggaqf1	1424	15	be	be	VB
cord-014462-11ggaqf1	1424	16	discussed	discuss	VBN
cord-014462-11ggaqf1	1424	17	.	.	.
cord-014462-11ggaqf1	1425	1	This	this	DT
cord-014462-11ggaqf1	1425	2	is	be	VBZ
cord-014462-11ggaqf1	1425	3	the	the	DT
cord-014462-11ggaqf1	1425	4	first	first	JJ
cord-014462-11ggaqf1	1425	5	report	report	NN
cord-014462-11ggaqf1	1425	6	of	of	IN
cord-014462-11ggaqf1	1425	7	the	the	DT
cord-014462-11ggaqf1	1425	8	molecular	molecular	JJ
cord-014462-11ggaqf1	1425	9	characterization	characterization	NN
cord-014462-11ggaqf1	1425	10	of	of	IN
cord-014462-11ggaqf1	1425	11	Vernonia	Vernonia	NNP
cord-014462-11ggaqf1	1425	12	yellow	yellow	JJ
cord-014462-11ggaqf1	1425	13	vein	vein	NN
cord-014462-11ggaqf1	1425	14	virus	virus	NN
cord-014462-11ggaqf1	1425	15	(	(	-LRB-
cord-014462-11ggaqf1	1425	16	VYVV	VYVV	NNP
cord-014462-11ggaqf1	1425	17	)	)	-RRB-
cord-014462-11ggaqf1	1425	18	from	from	IN
cord-014462-11ggaqf1	1425	19	Vernonia	Vernonia	NNP
cord-014462-11ggaqf1	1425	20	cinerea	cinerea	NN
cord-014462-11ggaqf1	1425	21	in	in	IN
cord-014462-11ggaqf1	1425	22	India	India	NNP
cord-014462-11ggaqf1	1425	23	.	.	.
cord-014462-11ggaqf1	1426	1	Production	production	NN
cord-014462-11ggaqf1	1426	2	of	of	IN
cord-014462-11ggaqf1	1426	3	bulb	bulb	NN
cord-014462-11ggaqf1	1426	4	and	and	CC
cord-014462-11ggaqf1	1426	5	seed	seed	NN
cord-014462-11ggaqf1	1426	6	crop	crop	NN
cord-014462-11ggaqf1	1426	7	of	of	IN
cord-014462-11ggaqf1	1426	8	onion	onion	NN
cord-014462-11ggaqf1	1426	9	(	(	-LRB-
cord-014462-11ggaqf1	1426	10	Allium	Allium	NNP
cord-014462-11ggaqf1	1426	11	cepa	cepa	NN
cord-014462-11ggaqf1	1426	12	L.	L.	NNP
cord-014462-11ggaqf1	1426	13	)	)	-RRB-
cord-014462-11ggaqf1	1426	14	is	be	VBZ
cord-014462-11ggaqf1	1426	15	hampered	hamper	VBN
cord-014462-11ggaqf1	1426	16	by	by	IN
cord-014462-11ggaqf1	1426	17	onion	onion	NN
cord-014462-11ggaqf1	1426	18	yellow	yellow	JJ
cord-014462-11ggaqf1	1426	19	dwarf	dwarf	NNP
cord-014462-11ggaqf1	1426	20	virus	virus	NN
cord-014462-11ggaqf1	1426	21	(	(	-LRB-
cord-014462-11ggaqf1	1426	22	OYDV	OYDV	NNP
cord-014462-11ggaqf1	1426	23	)	)	-RRB-
cord-014462-11ggaqf1	1426	24	and	and	CC
cord-014462-11ggaqf1	1426	25	iris	iris	NNP
cord-014462-11ggaqf1	1426	26	yellow	yellow	NNP
cord-014462-11ggaqf1	1426	27	spot	spot	NNP
cord-014462-11ggaqf1	1426	28	virus	virus	NN
cord-014462-11ggaqf1	1426	29	(	(	-LRB-
cord-014462-11ggaqf1	1426	30	IYSV	IYSV	NNP
cord-014462-11ggaqf1	1426	31	)	)	-RRB-
cord-014462-11ggaqf1	1426	32	with	with	IN
cord-014462-11ggaqf1	1426	33	an	an	DT
cord-014462-11ggaqf1	1426	34	incidence	incidence	NN
cord-014462-11ggaqf1	1426	35	of	of	IN
cord-014462-11ggaqf1	1426	36	83.22	83.22	CD
cord-014462-11ggaqf1	1426	37	%	%	NN
cord-014462-11ggaqf1	1426	38	and	and	CC
cord-014462-11ggaqf1	1426	39	89.97	89.97	CD
cord-014462-11ggaqf1	1426	40	%	%	NN
cord-014462-11ggaqf1	1426	41	in	in	IN
cord-014462-11ggaqf1	1426	42	bulb	bulb	NN
cord-014462-11ggaqf1	1426	43	crop	crop	NN
cord-014462-11ggaqf1	1426	44	and	and	CC
cord-014462-11ggaqf1	1426	45	90.65	90.65	CD
cord-014462-11ggaqf1	1426	46	%	%	NN
cord-014462-11ggaqf1	1426	47	and	and	CC
cord-014462-11ggaqf1	1426	48	89.58	89.58	CD
cord-014462-11ggaqf1	1426	49	%	%	NN
cord-014462-11ggaqf1	1426	50	in	in	IN
cord-014462-11ggaqf1	1426	51	seed	seed	NN
cord-014462-11ggaqf1	1426	52	crop	crop	NN
cord-014462-11ggaqf1	1426	53	,	,	,
cord-014462-11ggaqf1	1426	54	respectively	respectively	RB
cord-014462-11ggaqf1	1426	55	in	in	IN
cord-014462-11ggaqf1	1426	56	the	the	DT
cord-014462-11ggaqf1	1426	57	popularly	popularly	RB
cord-014462-11ggaqf1	1426	58	grown	grow	VBN
cord-014462-11ggaqf1	1426	59	cv	cv	NN
cord-014462-11ggaqf1	1426	60	.	.	.
cord-014462-11ggaqf1	1427	1	Hisar-2	Hisar-2	NNP
cord-014462-11ggaqf1	1427	2	.	.	.
cord-014462-11ggaqf1	1428	1	Four	four	CD
cord-014462-11ggaqf1	1428	2	symptom	symptom	NN
cord-014462-11ggaqf1	1428	3	-	-	HYPH
cord-014462-11ggaqf1	1428	4	based	base	VBN
cord-014462-11ggaqf1	1428	5	variants	variant	NNS
cord-014462-11ggaqf1	1428	6	of	of	IN
cord-014462-11ggaqf1	1428	7	OYDV	OYDV	NNP
cord-014462-11ggaqf1	1428	8	designated	designate	VBN
cord-014462-11ggaqf1	1428	9	as	as	IN
cord-014462-11ggaqf1	1428	10	Grade	Grade	NNP
cord-014462-11ggaqf1	1428	11	A	A	NNP
cord-014462-11ggaqf1	1428	12	,	,	,
cord-014462-11ggaqf1	1428	13	B	b	NN
cord-014462-11ggaqf1	1428	14	,	,	,
cord-014462-11ggaqf1	1428	15	C	C	NNP
cord-014462-11ggaqf1	1428	16	and	and	CC
cord-014462-11ggaqf1	1428	17	D	D	NNP
cord-014462-11ggaqf1	1428	18	produced	produce	VBD
cord-014462-11ggaqf1	1428	19	varied	varied	JJ
cord-014462-11ggaqf1	1428	20	types	type	NNS
cord-014462-11ggaqf1	1428	21	of	of	IN
cord-014462-11ggaqf1	1428	22	symptoms	symptom	NNS
cord-014462-11ggaqf1	1428	23	in	in	IN
cord-014462-11ggaqf1	1428	24	onion	onion	NN
cord-014462-11ggaqf1	1428	25	crop	crop	NN
cord-014462-11ggaqf1	1428	26	incurring	incur	VBG
cord-014462-11ggaqf1	1428	27	heavy	heavy	JJ
cord-014462-11ggaqf1	1428	28	losses	loss	NNS
cord-014462-11ggaqf1	1428	29	in	in	IN
cord-014462-11ggaqf1	1428	30	bulb	bulb	NN
cord-014462-11ggaqf1	1428	31	and	and	CC
cord-014462-11ggaqf1	1428	32	seed	seed	NN
cord-014462-11ggaqf1	1428	33	production	production	NN
cord-014462-11ggaqf1	1428	34	.	.	.
cord-014462-11ggaqf1	1429	1	IYSV	IYSV	NNP
cord-014462-11ggaqf1	1429	2	caused	cause	VBD
cord-014462-11ggaqf1	1429	3	tiny	tiny	JJ
cord-014462-11ggaqf1	1429	4	hay	hay	JJ
cord-014462-11ggaqf1	1429	5	coloured	coloured	JJ
cord-014462-11ggaqf1	1429	6	spots	spot	NNS
cord-014462-11ggaqf1	1429	7	of	of	IN
cord-014462-11ggaqf1	1429	8	different	different	JJ
cord-014462-11ggaqf1	1429	9	shapes	shape	NNS
cord-014462-11ggaqf1	1429	10	and	and	CC
cord-014462-11ggaqf1	1429	11	sizes	size	NNS
cord-014462-11ggaqf1	1429	12	on	on	IN
cord-014462-11ggaqf1	1429	13	leaves	leave	NNS
cord-014462-11ggaqf1	1429	14	and	and	CC
cord-014462-11ggaqf1	1429	15	scapes	scape	NNS
cord-014462-11ggaqf1	1429	16	which	which	WDT
cord-014462-11ggaqf1	1429	17	later	later	RB
cord-014462-11ggaqf1	1429	18	coalesced	coalesce	VBD
cord-014462-11ggaqf1	1429	19	and	and	CC
cord-014462-11ggaqf1	1429	20	led	lead	VBD
cord-014462-11ggaqf1	1429	21	to	to	IN
cord-014462-11ggaqf1	1429	22	drying	drying	NN
cord-014462-11ggaqf1	1429	23	and	and	CC
cord-014462-11ggaqf1	1429	24	lodging	lodging	NN
cord-014462-11ggaqf1	1429	25	of	of	IN
cord-014462-11ggaqf1	1429	26	scapes	scape	NNS
cord-014462-11ggaqf1	1429	27	.	.	.
cord-014462-11ggaqf1	1430	1	The	the	DT
cord-014462-11ggaqf1	1430	2	plant	plant	NN
cord-014462-11ggaqf1	1430	3	height	height	NN
cord-014462-11ggaqf1	1430	4	,	,	,
cord-014462-11ggaqf1	1430	5	bulb	bulb	NN
cord-014462-11ggaqf1	1430	6	weight	weight	NN
cord-014462-11ggaqf1	1430	7	and	and	CC
cord-014462-11ggaqf1	1430	8	bulb	bulb	NN
cord-014462-11ggaqf1	1430	9	size	size	NN
cord-014462-11ggaqf1	1430	10	were	be	VBD
cord-014462-11ggaqf1	1430	11	37.7	37.7	CD
cord-014462-11ggaqf1	1430	12	cm	cm	NNS
cord-014462-11ggaqf1	1430	13	,	,	,
cord-014462-11ggaqf1	1430	14	75.5	75.5	CD
cord-014462-11ggaqf1	1430	15	g	g	NN
cord-014462-11ggaqf1	1430	16	and	and	CC
cord-014462-11ggaqf1	1430	17	24.2	24.2	CD
cord-014462-11ggaqf1	1430	18	cm	cm	NNS
cord-014462-11ggaqf1	1430	19	2	2	CD
cord-014462-11ggaqf1	1430	20	in	in	IN
cord-014462-11ggaqf1	1430	21	plants	plant	NNS
cord-014462-11ggaqf1	1430	22	infected	infect	VBN
cord-014462-11ggaqf1	1430	23	with	with	IN
cord-014462-11ggaqf1	1430	24	OYDV	OYDV	NNP
cord-014462-11ggaqf1	1430	25	,	,	,
cord-014462-11ggaqf1	1430	26	39.6	39.6	CD
cord-014462-11ggaqf1	1430	27	cm	cm	NNS
cord-014462-11ggaqf1	1430	28	,	,	,
cord-014462-11ggaqf1	1430	29	79.7	79.7	CD
cord-014462-11ggaqf1	1430	30	g	g	NN
cord-014462-11ggaqf1	1430	31	and	and	CC
cord-014462-11ggaqf1	1430	32	25.5	25.5	CD
cord-014462-11ggaqf1	1430	33	cm	cm	NNS
cord-014462-11ggaqf1	1430	34	2	2	CD
cord-014462-11ggaqf1	1430	35	in	in	IN
cord-014462-11ggaqf1	1430	36	IYSV	IYSV	NNP
cord-014462-11ggaqf1	1430	37	infection	infection	NN
cord-014462-11ggaqf1	1430	38	,	,	,
cord-014462-11ggaqf1	1430	39	35.1	35.1	CD
cord-014462-11ggaqf1	1430	40	cm	cm	NNS
cord-014462-11ggaqf1	1430	41	,	,	,
cord-014462-11ggaqf1	1430	42	68.4	68.4	CD
cord-014462-11ggaqf1	1430	43	g	g	NN
cord-014462-11ggaqf1	1430	44	and	and	CC
cord-014462-11ggaqf1	1430	45	22.1	22.1	CD
cord-014462-11ggaqf1	1430	46	cm	cm	NNS
cord-014462-11ggaqf1	1430	47	2	2	CD
cord-014462-11ggaqf1	1430	48	due	due	IN
cord-014462-11ggaqf1	1430	49	to	to	IN
cord-014462-11ggaqf1	1430	50	their	-PRON-	PRP$
cord-014462-11ggaqf1	1430	51	combined	combine	VBN
cord-014462-11ggaqf1	1430	52	infection	infection	NN
cord-014462-11ggaqf1	1430	53	,	,	,
cord-014462-11ggaqf1	1430	54	as	as	IN
cord-014462-11ggaqf1	1430	55	compared	compare	VBN
cord-014462-11ggaqf1	1430	56	to	to	IN
cord-014462-11ggaqf1	1430	57	40.6	40.6	CD
cord-014462-11ggaqf1	1430	58	cm	cm	NNS
cord-014462-11ggaqf1	1430	59	,	,	,
cord-014462-11ggaqf1	1430	60	88.4	88.4	CD
cord-014462-11ggaqf1	1430	61	g	g	NN
cord-014462-11ggaqf1	1430	62	and	and	CC
cord-014462-11ggaqf1	1430	63	27.6	27.6	CD
cord-014462-11ggaqf1	1430	64	cm	cm	NNS
cord-014462-11ggaqf1	1430	65	2	2	CD
cord-014462-11ggaqf1	1430	66	respectively	respectively	RB
cord-014462-11ggaqf1	1430	67	,	,	,
cord-014462-11ggaqf1	1430	68	in	in	IN
cord-014462-11ggaqf1	1430	69	healthy	healthy	JJ
cord-014462-11ggaqf1	1430	70	plants	plant	NNS
cord-014462-11ggaqf1	1430	71	of	of	IN
cord-014462-11ggaqf1	1430	72	bulb	bulb	NN
cord-014462-11ggaqf1	1430	73	crop	crop	NN
cord-014462-11ggaqf1	1430	74	.	.	.
cord-014462-11ggaqf1	1431	1	In	in	IN
cord-014462-11ggaqf1	1431	2	plants	plant	NNS
cord-014462-11ggaqf1	1431	3	infected	infect	VBN
cord-014462-11ggaqf1	1431	4	with	with	IN
cord-014462-11ggaqf1	1431	5	OYDV	OYDV	NNP
cord-014462-11ggaqf1	1431	6	Grade	Grade	NNP
cord-014462-11ggaqf1	1431	7	A	A	NNP
cord-014462-11ggaqf1	1431	8	the	the	DT
cord-014462-11ggaqf1	1431	9	plant	plant	NN
cord-014462-11ggaqf1	1431	10	height	height	NN
cord-014462-11ggaqf1	1431	11	was	be	VBD
cord-014462-11ggaqf1	1431	12	minimum	minimum	JJ
cord-014462-11ggaqf1	1431	13	(	(	-LRB-
cord-014462-11ggaqf1	1431	14	90.33	90.33	CD
cord-014462-11ggaqf1	1431	15	cm	cm	NNS
cord-014462-11ggaqf1	1431	16	)	)	-RRB-
cord-014462-11ggaqf1	1431	17	whereas	whereas	IN
cord-014462-11ggaqf1	1431	18	the	the	DT
cord-014462-11ggaqf1	1431	19	number	number	NN
cord-014462-11ggaqf1	1431	20	of	of	IN
cord-014462-11ggaqf1	1431	21	umbels	umbel	NNS
cord-014462-11ggaqf1	1431	22	was	be	VBD
cord-014462-11ggaqf1	1431	23	maximum	maximum	JJ
cord-014462-11ggaqf1	1431	24	(	(	-LRB-
cord-014462-11ggaqf1	1432	1	9.20	9.20	CD
cord-014462-11ggaqf1	1432	2	umbels	umbel	NNS
cord-014462-11ggaqf1	1432	3	/	/	SYM
cord-014462-11ggaqf1	1432	4	pl	pl	NN
cord-014462-11ggaqf1	1432	5	.	.	.
cord-014462-11ggaqf1	1432	6	)	)	-RRB-
cord-014462-11ggaqf1	1433	1	but	but	CC
cord-014462-11ggaqf1	1433	2	other	other	JJ
cord-014462-11ggaqf1	1433	3	yield	yield	NN
cord-014462-11ggaqf1	1433	4	parameters	parameter	NNS
cord-014462-11ggaqf1	1433	5	viz	viz	NN
cord-014462-11ggaqf1	1433	6	.	.	.
cord-014462-11ggaqf1	1434	1	,	,	,
cord-014462-11ggaqf1	1434	2	weight	weight	NN
cord-014462-11ggaqf1	1434	3	/	/	SYM
cord-014462-11ggaqf1	1434	4	umbel	umbel	NN
cord-014462-11ggaqf1	1434	5	(	(	-LRB-
cord-014462-11ggaqf1	1434	6	2.32	2.32	CD
cord-014462-11ggaqf1	1434	7	g	g	NNP
cord-014462-11ggaqf1	1434	8	)	)	-RRB-
cord-014462-11ggaqf1	1434	9	,	,	,
cord-014462-11ggaqf1	1434	10	number	number	NN
cord-014462-11ggaqf1	1434	11	of	of	IN
cord-014462-11ggaqf1	1434	12	seeds	seed	NNS
cord-014462-11ggaqf1	1434	13	/	/	SYM
cord-014462-11ggaqf1	1434	14	umbel	umbel	NN
cord-014462-11ggaqf1	1434	15	(	(	-LRB-
cord-014462-11ggaqf1	1434	16	209	209	CD
cord-014462-11ggaqf1	1434	17	)	)	-RRB-
cord-014462-11ggaqf1	1434	18	,	,	,
cord-014462-11ggaqf1	1434	19	seed	seed	NN
cord-014462-11ggaqf1	1434	20	weight	weight	NN
cord-014462-11ggaqf1	1434	21	/	/	SYM
cord-014462-11ggaqf1	1434	22	umbel	umbel	NN
cord-014462-11ggaqf1	1434	23	(	(	-LRB-
cord-014462-11ggaqf1	1434	24	0.64	0.64	CD
cord-014462-11ggaqf1	1434	25	g	g	NN
cord-014462-11ggaqf1	1434	26	)	)	-RRB-
cord-014462-11ggaqf1	1434	27	and	and	CC
cord-014462-11ggaqf1	1434	28	seed	seed	NN
cord-014462-11ggaqf1	1434	29	yield	yield	NN
cord-014462-11ggaqf1	1434	30	/	/	SYM
cord-014462-11ggaqf1	1434	31	plant	plant	NN
cord-014462-11ggaqf1	1434	32	(	(	-LRB-
cord-014462-11ggaqf1	1434	33	5.88	5.88	CD
cord-014462-11ggaqf1	1434	34	g	g	NN
cord-014462-11ggaqf1	1434	35	)	)	-RRB-
cord-014462-11ggaqf1	1434	36	were	be	VBD
cord-014462-11ggaqf1	1434	37	recorded	record	VBN
cord-014462-11ggaqf1	1434	38	to	to	TO
cord-014462-11ggaqf1	1434	39	be	be	VB
cord-014462-11ggaqf1	1434	40	the	the	DT
cord-014462-11ggaqf1	1434	41	lowest	low	JJS
cord-014462-11ggaqf1	1434	42	.	.	.
cord-014462-11ggaqf1	1435	1	The	the	DT
cord-014462-11ggaqf1	1435	2	minimum	minimum	JJ
cord-014462-11ggaqf1	1435	3	reduction	reduction	NN
cord-014462-11ggaqf1	1435	4	in	in	IN
cord-014462-11ggaqf1	1435	5	plant	plant	NN
cord-014462-11ggaqf1	1435	6	height	height	NN
cord-014462-11ggaqf1	1435	7	(	(	-LRB-
cord-014462-11ggaqf1	1435	8	100.26	100.26	CD
cord-014462-11ggaqf1	1435	9	cm	cm	NNP
cord-014462-11ggaqf1	1435	10	)	)	-RRB-
cord-014462-11ggaqf1	1435	11	,	,	,
cord-014462-11ggaqf1	1435	12	weight	weight	NN
cord-014462-11ggaqf1	1435	13	/	/	SYM
cord-014462-11ggaqf1	1435	14	umbel	umbel	NN
cord-014462-11ggaqf1	1435	15	(	(	-LRB-
cord-014462-11ggaqf1	1435	16	6.72	6.72	CD
cord-014462-11ggaqf1	1435	17	g	g	NN
cord-014462-11ggaqf1	1435	18	)	)	-RRB-
cord-014462-11ggaqf1	1435	19	,	,	,
cord-014462-11ggaqf1	1435	20	number	number	NN
cord-014462-11ggaqf1	1435	21	of	of	IN
cord-014462-11ggaqf1	1435	22	seeds	seed	NNS
cord-014462-11ggaqf1	1435	23	/	/	SYM
cord-014462-11ggaqf1	1435	24	umbel	umbel	NN
cord-014462-11ggaqf1	1435	25	(	(	-LRB-
cord-014462-11ggaqf1	1435	26	633	633	CD
cord-014462-11ggaqf1	1435	27	)	)	-RRB-
cord-014462-11ggaqf1	1435	28	,	,	,
cord-014462-11ggaqf1	1435	29	seed	seed	NN
cord-014462-11ggaqf1	1435	30	weight	weight	NN
cord-014462-11ggaqf1	1435	31	/	/	SYM
cord-014462-11ggaqf1	1435	32	umbel	umbel	NN
cord-014462-11ggaqf1	1435	33	(	(	-LRB-
cord-014462-11ggaqf1	1435	34	2.36	2.36	CD
cord-014462-11ggaqf1	1435	35	g	g	NN
cord-014462-11ggaqf1	1435	36	)	)	-RRB-
cord-014462-11ggaqf1	1435	37	and	and	CC
cord-014462-11ggaqf1	1435	38	seed	seed	NN
cord-014462-11ggaqf1	1435	39	yield	yield	NN
cord-014462-11ggaqf1	1435	40	/	/	SYM
cord-014462-11ggaqf1	1435	41	plant	plant	NN
cord-014462-11ggaqf1	1435	42	(	(	-LRB-
cord-014462-11ggaqf1	1435	43	11.90	11.90	CD
cord-014462-11ggaqf1	1435	44	g	g	NN
cord-014462-11ggaqf1	1435	45	)	)	-RRB-
cord-014462-11ggaqf1	1435	46	were	be	VBD
cord-014462-11ggaqf1	1435	47	recorded	record	VBN
cord-014462-11ggaqf1	1435	48	in	in	IN
cord-014462-11ggaqf1	1435	49	OYDV	OYDV	NNP
cord-014462-11ggaqf1	1435	50	Grade	Grade	NNP
cord-014462-11ggaqf1	1435	51	D.	D.	NNP
cord-014462-11ggaqf1	1436	1	The	the	DT
cord-014462-11ggaqf1	1436	2	plant	plant	NN
cord-014462-11ggaqf1	1436	3	height	height	NN
cord-014462-11ggaqf1	1436	4	was	be	VBD
cord-014462-11ggaqf1	1436	5	98.84	98.84	CD
cord-014462-11ggaqf1	1436	6	cm	cm	NNS
cord-014462-11ggaqf1	1436	7	with	with	IN
cord-014462-11ggaqf1	1436	8	5.10	5.10	CD
cord-014462-11ggaqf1	1436	9	umbels	umbel	NNS
cord-014462-11ggaqf1	1436	10	per	per	IN
cord-014462-11ggaqf1	1436	11	plant	plant	NN
cord-014462-11ggaqf1	1436	12	,	,	,
cord-014462-11ggaqf1	1436	13	4.24	4.24	CD
cord-014462-11ggaqf1	1436	14	g	g	NN
cord-014462-11ggaqf1	1436	15	weight	weight	NN
cord-014462-11ggaqf1	1436	16	/	/	SYM
cord-014462-11ggaqf1	1436	17	umbel	umbel	NN
cord-014462-11ggaqf1	1436	18	,	,	,
cord-014462-11ggaqf1	1436	19	428	428	CD
cord-014462-11ggaqf1	1436	20	seeds	seed	NNS
cord-014462-11ggaqf1	1436	21	/	/	SYM
cord-014462-11ggaqf1	1436	22	umbel	umbel	NN
cord-014462-11ggaqf1	1436	23	,	,	,
cord-014462-11ggaqf1	1436	24	1.25	1.25	CD
cord-014462-11ggaqf1	1436	25	g	g	NN
cord-014462-11ggaqf1	1436	26	seed	seed	NN
cord-014462-11ggaqf1	1436	27	weight	weight	NN
cord-014462-11ggaqf1	1436	28	/	/	SYM
cord-014462-11ggaqf1	1436	29	umbel	umbel	NN
cord-014462-11ggaqf1	1436	30	and	and	CC
cord-014462-11ggaqf1	1436	31	6.37	6.37	CD
cord-014462-11ggaqf1	1436	32	g	g	NN
cord-014462-11ggaqf1	1436	33	seed	seed	NN
cord-014462-11ggaqf1	1436	34	yield	yield	NN
cord-014462-11ggaqf1	1436	35	/	/	SYM
cord-014462-11ggaqf1	1436	36	plant	plant	NN
cord-014462-11ggaqf1	1436	37	in	in	IN
cord-014462-11ggaqf1	1436	38	IYSV	IYSV	NNP
cord-014462-11ggaqf1	1436	39	infected	infected	JJ
cord-014462-11ggaqf1	1436	40	plants	plant	NNS
cord-014462-11ggaqf1	1436	41	.	.	.
cord-014462-11ggaqf1	1437	1	The	the	DT
cord-014462-11ggaqf1	1437	2	plant	plant	NN
cord-014462-11ggaqf1	1437	3	height	height	NN
cord-014462-11ggaqf1	1437	4	(	(	-LRB-
cord-014462-11ggaqf1	1437	5	96.26	96.26	CD
cord-014462-11ggaqf1	1437	6	cm	cm	NNP
cord-014462-11ggaqf1	1437	7	)	)	-RRB-
cord-014462-11ggaqf1	1437	8	,	,	,
cord-014462-11ggaqf1	1437	9	umbels	umbel	NNS
cord-014462-11ggaqf1	1437	10	/	/	SYM
cord-014462-11ggaqf1	1437	11	plant	plant	NN
cord-014462-11ggaqf1	1437	12	(	(	-LRB-
cord-014462-11ggaqf1	1437	13	5.97	5.97	CD
cord-014462-11ggaqf1	1437	14	)	)	-RRB-
cord-014462-11ggaqf1	1437	15	,	,	,
cord-014462-11ggaqf1	1437	16	weight	weight	NN
cord-014462-11ggaqf1	1437	17	/	/	SYM
cord-014462-11ggaqf1	1437	18	umbel	umbel	NN
cord-014462-11ggaqf1	1437	19	(	(	-LRB-
cord-014462-11ggaqf1	1437	20	4.60	4.60	CD
cord-014462-11ggaqf1	1437	21	g	g	NN
cord-014462-11ggaqf1	1437	22	)	)	-RRB-
cord-014462-11ggaqf1	1437	23	,	,	,
cord-014462-11ggaqf1	1437	24	number	number	NN
cord-014462-11ggaqf1	1437	25	of	of	IN
cord-014462-11ggaqf1	1437	26	seeds	seed	NNS
cord-014462-11ggaqf1	1437	27	/	/	SYM
cord-014462-11ggaqf1	1437	28	umbel	umbel	NN
cord-014462-11ggaqf1	1437	29	(	(	-LRB-
cord-014462-11ggaqf1	1437	30	432	432	CD
cord-014462-11ggaqf1	1437	31	)	)	-RRB-
cord-014462-11ggaqf1	1437	32	,	,	,
cord-014462-11ggaqf1	1437	33	seed	seed	NN
cord-014462-11ggaqf1	1437	34	weight	weight	NN
cord-014462-11ggaqf1	1437	35	/	/	SYM
cord-014462-11ggaqf1	1437	36	umbel	umbel	NN
cord-014462-11ggaqf1	1437	37	(	(	-LRB-
cord-014462-11ggaqf1	1437	38	1.42	1.42	CD
cord-014462-11ggaqf1	1437	39	g	g	NN
cord-014462-11ggaqf1	1437	40	)	)	-RRB-
cord-014462-11ggaqf1	1437	41	and	and	CC
cord-014462-11ggaqf1	1437	42	seed	seed	NN
cord-014462-11ggaqf1	1437	43	yield	yield	NN
cord-014462-11ggaqf1	1437	44	/	/	SYM
cord-014462-11ggaqf1	1437	45	plant	plant	NN
cord-014462-11ggaqf1	1437	46	(	(	-LRB-
cord-014462-11ggaqf1	1437	47	7.82	7.82	CD
cord-014462-11ggaqf1	1437	48	g	g	NN
cord-014462-11ggaqf1	1437	49	)	)	-RRB-
cord-014462-11ggaqf1	1437	50	were	be	VBD
cord-014462-11ggaqf1	1437	51	found	find	VBN
cord-014462-11ggaqf1	1437	52	to	to	TO
cord-014462-11ggaqf1	1437	53	be	be	VB
cord-014462-11ggaqf1	1437	54	the	the	DT
cord-014462-11ggaqf1	1437	55	lowest	low	JJS
cord-014462-11ggaqf1	1437	56	in	in	IN
cord-014462-11ggaqf1	1437	57	combined	combine	VBN
cord-014462-11ggaqf1	1437	58	infection	infection	NN
cord-014462-11ggaqf1	1437	59	of	of	IN
cord-014462-11ggaqf1	1437	60	OYDV	OYDV	NNP
cord-014462-11ggaqf1	1437	61	and	and	CC
cord-014462-11ggaqf1	1437	62	IYSV	IYSV	NNP
cord-014462-11ggaqf1	1437	63	diseases	disease	NNS
cord-014462-11ggaqf1	1437	64	in	in	IN
cord-014462-11ggaqf1	1437	65	comparison	comparison	NN
cord-014462-11ggaqf1	1437	66	to	to	IN
cord-014462-11ggaqf1	1437	67	higher	high	JJR
cord-014462-11ggaqf1	1437	68	values	value	NNS
cord-014462-11ggaqf1	1437	69	in	in	IN
cord-014462-11ggaqf1	1437	70	healthy	healthy	JJ
cord-014462-11ggaqf1	1437	71	controls	control	NNS
cord-014462-11ggaqf1	1437	72	(	(	-LRB-
cord-014462-11ggaqf1	1437	73	104.50	104.50	CD
cord-014462-11ggaqf1	1437	74	cm	cm	NNS
cord-014462-11ggaqf1	1437	75	,	,	,
cord-014462-11ggaqf1	1437	76	4.90	4.90	CD
cord-014462-11ggaqf1	1437	77	,	,	,
cord-014462-11ggaqf1	1437	78	7.84	7.84	CD
cord-014462-11ggaqf1	1437	79	g	g	NN
cord-014462-11ggaqf1	1437	80	,	,	,
cord-014462-11ggaqf1	1437	81	677	677	CD
cord-014462-11ggaqf1	1437	82	,	,	,
cord-014462-11ggaqf1	1437	83	2.60	2.60	CD
cord-014462-11ggaqf1	1437	84	g	g	NN
cord-014462-11ggaqf1	1437	85	,	,	,
cord-014462-11ggaqf1	1437	86	12.74	12.74	CD
cord-014462-11ggaqf1	1437	87	g	g	NN
cord-014462-11ggaqf1	1437	88	,	,	,
cord-014462-11ggaqf1	1437	89	respectively	respectively	RB
cord-014462-11ggaqf1	1437	90	)	)	-RRB-
cord-014462-11ggaqf1	1437	91	.	.	.
cord-014462-11ggaqf1	1438	1	A	a	DT
cord-014462-11ggaqf1	1438	2	minimum	minimum	JJ
cord-014462-11ggaqf1	1438	3	reduction	reduction	NN
cord-014462-11ggaqf1	1438	4	in	in	IN
cord-014462-11ggaqf1	1438	5	the	the	DT
cord-014462-11ggaqf1	1438	6	test	test	NN
cord-014462-11ggaqf1	1438	7	weight	weight	NN
cord-014462-11ggaqf1	1438	8	,	,	,
cord-014462-11ggaqf1	1438	9	germination	germination	NN
cord-014462-11ggaqf1	1438	10	and	and	CC
cord-014462-11ggaqf1	1438	11	seed	seed	NN
cord-014462-11ggaqf1	1438	12	vigour	vigour	NN
cord-014462-11ggaqf1	1438	13	index	index	NN
cord-014462-11ggaqf1	1438	14	were	be	VBD
cord-014462-11ggaqf1	1438	15	found	find	VBN
cord-014462-11ggaqf1	1438	16	(	(	-LRB-
cord-014462-11ggaqf1	1438	17	3.06	3.06	CD
cord-014462-11ggaqf1	1438	18	g	g	NN
cord-014462-11ggaqf1	1438	19	,	,	,
cord-014462-11ggaqf1	1438	20	75.68	75.68	CD
cord-014462-11ggaqf1	1438	21	%	%	NN
cord-014462-11ggaqf1	1438	22	and	and	CC
cord-014462-11ggaqf1	1438	23	926	926	CD
cord-014462-11ggaqf1	1438	24	)	)	-RRB-
cord-014462-11ggaqf1	1438	25	due	due	IN
cord-014462-11ggaqf1	1438	26	to	to	IN
cord-014462-11ggaqf1	1438	27	OYDV	OYDV	NNP
cord-014462-11ggaqf1	1438	28	grade	grade	NN
cord-014462-11ggaqf1	1438	29	A	a	DT
cord-014462-11ggaqf1	1438	30	infection	infection	NN
cord-014462-11ggaqf1	1438	31	,	,	,
cord-014462-11ggaqf1	1438	32	whereas	whereas	IN
cord-014462-11ggaqf1	1438	33	these	these	DT
cord-014462-11ggaqf1	1438	34	were	be	VBD
cord-014462-11ggaqf1	1438	35	2.92	2.92	CD
cord-014462-11ggaqf1	1438	36	g	g	NN
cord-014462-11ggaqf1	1438	37	,	,	,
cord-014462-11ggaqf1	1438	38	70.42	70.42	CD
cord-014462-11ggaqf1	1438	39	%	%	NN
cord-014462-11ggaqf1	1438	40	and	and	CC
cord-014462-11ggaqf1	1438	41	788	788	CD
cord-014462-11ggaqf1	1438	42	in	in	IN
cord-014462-11ggaqf1	1438	43	IYSV	IYSV	NNP
cord-014462-11ggaqf1	1438	44	disease	disease	NN
cord-014462-11ggaqf1	1438	45	infected	infect	VBD
cord-014462-11ggaqf1	1438	46	plants	plant	NNS
cord-014462-11ggaqf1	1438	47	and	and	CC
cord-014462-11ggaqf1	1438	48	2.62	2.62	CD
cord-014462-11ggaqf1	1438	49	g	g	NN
cord-014462-11ggaqf1	1438	50	,	,	,
cord-014462-11ggaqf1	1438	51	70.4	70.4	CD
cord-014462-11ggaqf1	1438	52	%	%	NN
cord-014462-11ggaqf1	1438	53	and	and	CC
cord-014462-11ggaqf1	1438	54	776	776	CD
cord-014462-11ggaqf1	1438	55	in	in	IN
cord-014462-11ggaqf1	1438	56	combined	combine	VBN
cord-014462-11ggaqf1	1438	57	infection	infection	NN
cord-014462-11ggaqf1	1438	58	of	of	IN
cord-014462-11ggaqf1	1438	59	OYDV	OYDV	NNP
cord-014462-11ggaqf1	1438	60	and	and	CC
cord-014462-11ggaqf1	1438	61	IYSV	IYSV	NNP
cord-014462-11ggaqf1	1438	62	diseases	disease	NNS
cord-014462-11ggaqf1	1438	63	in	in	IN
cord-014462-11ggaqf1	1438	64	comparison	comparison	NN
cord-014462-11ggaqf1	1438	65	to	to	IN
cord-014462-11ggaqf1	1438	66	3.84	3.84	CD
cord-014462-11ggaqf1	1438	67	g	g	NN
cord-014462-11ggaqf1	1438	68	,	,	,
cord-014462-11ggaqf1	1438	69	88.67	88.67	CD
cord-014462-11ggaqf1	1438	70	%	%	NN
cord-014462-11ggaqf1	1438	71	and	and	CC
cord-014462-11ggaqf1	1438	72	1276	1276	CD
cord-014462-11ggaqf1	1438	73	in	in	IN
cord-014462-11ggaqf1	1438	74	healthy	healthy	JJ
cord-014462-11ggaqf1	1438	75	plants	plant	NNS
cord-014462-11ggaqf1	1438	76	.	.	.
cord-014462-11ggaqf1	1439	1	The	the	DT
cord-014462-11ggaqf1	1439	2	maximum	maximum	JJ
cord-014462-11ggaqf1	1439	3	hampering	hampering	NN
cord-014462-11ggaqf1	1439	4	of	of	IN
cord-014462-11ggaqf1	1439	5	seed	seed	NN
cord-014462-11ggaqf1	1439	6	vigour	vigour	NN
cord-014462-11ggaqf1	1439	7	parameters	parameter	NNS
cord-014462-11ggaqf1	1439	8	was	be	VBD
cord-014462-11ggaqf1	1439	9	recorded	record	VBN
cord-014462-11ggaqf1	1439	10	due	due	IN
cord-014462-11ggaqf1	1439	11	to	to	IN
cord-014462-11ggaqf1	1439	12	IYSV	IYSV	NNP
cord-014462-11ggaqf1	1439	13	infection	infection	NN
cord-014462-11ggaqf1	1439	14	.	.	.
cord-014462-11ggaqf1	1440	1	Lodging	lodging	NN
cord-014462-11ggaqf1	1440	2	of	of	IN
cord-014462-11ggaqf1	1440	3	scapes	scape	NNS
cord-014462-11ggaqf1	1440	4	caused	cause	VBN
cord-014462-11ggaqf1	1440	5	by	by	IN
cord-014462-11ggaqf1	1440	6	this	this	DT
cord-014462-11ggaqf1	1440	7	disease	disease	NN
cord-014462-11ggaqf1	1440	8	was	be	VBD
cord-014462-11ggaqf1	1440	9	responsible	responsible	JJ
cord-014462-11ggaqf1	1440	10	for	for	IN
cord-014462-11ggaqf1	1440	11	heavy	heavy	JJ
cord-014462-11ggaqf1	1440	12	losses	loss	NNS
cord-014462-11ggaqf1	1440	13	in	in	IN
cord-014462-11ggaqf1	1440	14	seed	seed	NN
cord-014462-11ggaqf1	1440	15	production	production	NN
cord-014462-11ggaqf1	1440	16	and	and	CC
cord-014462-11ggaqf1	1440	17	seed	seed	NN
cord-014462-11ggaqf1	1440	18	quality	quality	NN
cord-014462-11ggaqf1	1440	19	.	.	.
cord-014462-11ggaqf1	1441	1	Cotton	cotton	NN
cord-014462-11ggaqf1	1441	2	leaf	leaf	NN
cord-014462-11ggaqf1	1441	3	curl	curl	NN
cord-014462-11ggaqf1	1441	4	disease	disease	NN
cord-014462-11ggaqf1	1441	5	is	be	VBZ
cord-014462-11ggaqf1	1441	6	one	one	CD
cord-014462-11ggaqf1	1441	7	of	of	IN
cord-014462-11ggaqf1	1441	8	the	the	DT
cord-014462-11ggaqf1	1441	9	major	major	JJ
cord-014462-11ggaqf1	1441	10	threats	threat	NNS
cord-014462-11ggaqf1	1441	11	to	to	IN
cord-014462-11ggaqf1	1441	12	cotton	cotton	VB
cord-014462-11ggaqf1	1441	13	cultivation	cultivation	NN
cord-014462-11ggaqf1	1441	14	from	from	IN
cord-014462-11ggaqf1	1441	15	Northern	Northern	NNP
cord-014462-11ggaqf1	1441	16	India	India	NNP
cord-014462-11ggaqf1	1441	17	.	.	.
cord-014462-11ggaqf1	1442	1	Survey	survey	NN
cord-014462-11ggaqf1	1442	2	conducted	conduct	VBN
cord-014462-11ggaqf1	1442	3	during	during	IN
cord-014462-11ggaqf1	1442	4	2009	2009	CD
cord-014462-11ggaqf1	1442	5	,	,	,
cord-014462-11ggaqf1	1442	6	observed	observe	VBD
cord-014462-11ggaqf1	1442	7	the	the	DT
cord-014462-11ggaqf1	1442	8	disease	disease	NN
cord-014462-11ggaqf1	1442	9	incidence	incidence	NN
cord-014462-11ggaqf1	1442	10	ranged	range	VBD
cord-014462-11ggaqf1	1442	11	from	from	IN
cord-014462-11ggaqf1	1442	12	70	70	CD
cord-014462-11ggaqf1	1442	13	to	to	TO
cord-014462-11ggaqf1	1442	14	90	90	CD
cord-014462-11ggaqf1	1442	15	%	%	NN
cord-014462-11ggaqf1	1442	16	from	from	IN
cord-014462-11ggaqf1	1442	17	Bhatinda	Bhatinda	NNP
cord-014462-11ggaqf1	1442	18	,	,	,
cord-014462-11ggaqf1	1442	19	Abohar	Abohar	NNP
cord-014462-11ggaqf1	1442	20	,	,	,
cord-014462-11ggaqf1	1442	21	Fazilka	Fazilka	NNP
cord-014462-11ggaqf1	1442	22	,	,	,
cord-014462-11ggaqf1	1442	23	Sri	Sri	NNP
cord-014462-11ggaqf1	1442	24	ganganagar	ganganagar	NNP
cord-014462-11ggaqf1	1442	25	,	,	,
cord-014462-11ggaqf1	1442	26	Hanumanghar	Hanumanghar	NNP
cord-014462-11ggaqf1	1442	27	.	.	.
cord-014462-11ggaqf1	1443	1	In	in	IN
cord-014462-11ggaqf1	1443	2	order	order	NN
cord-014462-11ggaqf1	1443	3	to	to	TO
cord-014462-11ggaqf1	1443	4	study	study	VB
cord-014462-11ggaqf1	1443	5	genetic	genetic	JJ
cord-014462-11ggaqf1	1443	6	variability	variability	NN
cord-014462-11ggaqf1	1443	7	in	in	IN
cord-014462-11ggaqf1	1443	8	the	the	DT
cord-014462-11ggaqf1	1443	9	virus	virus	NN
cord-014462-11ggaqf1	1443	10	,	,	,
cord-014462-11ggaqf1	1443	11	twelve	twelve	CD
cord-014462-11ggaqf1	1443	12	CLCuV	CLCuV	NNP
cord-014462-11ggaqf1	1443	13	isolates	isolate	NNS
cord-014462-11ggaqf1	1443	14	were	be	VBD
cord-014462-11ggaqf1	1443	15	partially	partially	RB
cord-014462-11ggaqf1	1443	16	characterized	characterize	VBN
cord-014462-11ggaqf1	1443	17	(	(	-LRB-
cord-014462-11ggaqf1	1443	18	700	700	CD
cord-014462-11ggaqf1	1443	19	bp	bp	NNP
cord-014462-11ggaqf1	1443	20	common	common	JJ
cord-014462-11ggaqf1	1443	21	region	region	NN
cord-014462-11ggaqf1	1443	22	,	,	,
cord-014462-11ggaqf1	1443	23	full	full	JJ
cord-014462-11ggaqf1	1443	24	length	length	NN
cord-014462-11ggaqf1	1443	25	AV2	AV2	NNP
cord-014462-11ggaqf1	1443	26	gene	gene	NN
cord-014462-11ggaqf1	1443	27	and	and	CC
cord-014462-11ggaqf1	1443	28	partial	partial	JJ
cord-014462-11ggaqf1	1443	29	sequences	sequence	NNS
cord-014462-11ggaqf1	1443	30	of	of	IN
cord-014462-11ggaqf1	1443	31	AC1	AC1	NNP
cord-014462-11ggaqf1	1443	32	and	and	CC
cord-014462-11ggaqf1	1443	33	AV1	AV1	NNP
cord-014462-11ggaqf1	1443	34	gene	gene	NN
cord-014462-11ggaqf1	1443	35	)	)	-RRB-
cord-014462-11ggaqf1	1443	36	.	.	.
cord-014462-11ggaqf1	1444	1	Full	full	JJ
cord-014462-11ggaqf1	1444	2	length	length	NN
cord-014462-11ggaqf1	1444	3	characterization	characterization	NN
cord-014462-11ggaqf1	1444	4	of	of	IN
cord-014462-11ggaqf1	1444	5	representative	representative	NN
cord-014462-11ggaqf1	1444	6	isolates	isolate	NNS
cord-014462-11ggaqf1	1444	7	from	from	IN
cord-014462-11ggaqf1	1444	8	Bhatinda	Bhatinda	NNP
cord-014462-11ggaqf1	1444	9	,	,	,
cord-014462-11ggaqf1	1444	10	Abohar	Abohar	NNP
cord-014462-11ggaqf1	1444	11	,	,	,
cord-014462-11ggaqf1	1444	12	Fazilka	Fazilka	NNP
cord-014462-11ggaqf1	1444	13	,	,	,
cord-014462-11ggaqf1	1445	1	Sri	Sri	NNP
cord-014462-11ggaqf1	1445	2	ganganagar	ganganagar	NNP
cord-014462-11ggaqf1	1446	1	,	,	,
cord-014462-11ggaqf1	1446	2	Hanumanghar	Hanumanghar	NNP
cord-014462-11ggaqf1	1446	3	is	be	VBZ
cord-014462-11ggaqf1	1446	4	under	under	IN
cord-014462-11ggaqf1	1446	5	progress	progress	NN
cord-014462-11ggaqf1	1446	6	.	.	.
cord-014462-11ggaqf1	1447	1	Partial	partial	JJ
cord-014462-11ggaqf1	1447	2	sequence	sequence	NN
cord-014462-11ggaqf1	1447	3	analysis	analysis	NN
cord-014462-11ggaqf1	1447	4	of	of	IN
cord-014462-11ggaqf1	1447	5	CLCuV	CLCuV	NNP
cord-014462-11ggaqf1	1447	6	isolates	isolate	NNS
cord-014462-11ggaqf1	1447	7	revealed	reveal	VBD
cord-014462-11ggaqf1	1447	8	that	that	IN
cord-014462-11ggaqf1	1447	9	,	,	,
cord-014462-11ggaqf1	1447	10	the	the	DT
cord-014462-11ggaqf1	1447	11	virus	virus	NN
cord-014462-11ggaqf1	1447	12	isolates	isolate	VBZ
cord-014462-11ggaqf1	1447	13	collected	collect	VBN
cord-014462-11ggaqf1	1447	14	during	during	IN
cord-014462-11ggaqf1	1447	15	2009	2009	CD
cord-014462-11ggaqf1	1447	16	cropping	crop	VBG
cord-014462-11ggaqf1	1447	17	season	season	NN
cord-014462-11ggaqf1	1447	18	are	be	VBP
cord-014462-11ggaqf1	1447	19	closely	closely	RB
cord-014462-11ggaqf1	1447	20	related	relate	VBN
cord-014462-11ggaqf1	1447	21	to	to	IN
cord-014462-11ggaqf1	1447	22	Cotton	cotton	NN
cord-014462-11ggaqf1	1447	23	leaf	leaf	NN
cord-014462-11ggaqf1	1447	24	curl	curl	NN
cord-014462-11ggaqf1	1447	25	Burewala	Burewala	NNP
cord-014462-11ggaqf1	1447	26	virus	virus	NN
cord-014462-11ggaqf1	1447	27	from	from	IN
cord-014462-11ggaqf1	1447	28	Pakistan	Pakistan	NNP
cord-014462-11ggaqf1	1447	29	and	and	CC
cord-014462-11ggaqf1	1447	30	results	result	NNS
cord-014462-11ggaqf1	1447	31	were	be	VBD
cord-014462-11ggaqf1	1447	32	discussed	discuss	VBN
cord-014462-11ggaqf1	1447	33	.	.	.
cord-014462-11ggaqf1	1448	1	Pratibha	Pratibha	NNP
cord-014462-11ggaqf1	1448	2	Singh	Singh	NNP
cord-014462-11ggaqf1	1448	3	,	,	,
cord-014462-11ggaqf1	1448	4	H.	H.	NNP
cord-014462-11ggaqf1	1448	5	S.	S.	NNP
cord-014462-11ggaqf1	1448	6	Savithri	Savithri	NNP
cord-014462-11ggaqf1	1448	7	Department	Department	NNP
cord-014462-11ggaqf1	1448	8	of	of	IN
cord-014462-11ggaqf1	1448	9	Biochemistry	Biochemistry	NNP
cord-014462-11ggaqf1	1448	10	,	,	,
cord-014462-11ggaqf1	1448	11	Indian	Indian	NNP
cord-014462-11ggaqf1	1448	12	Institute	Institute	NNP
cord-014462-11ggaqf1	1448	13	of	of	IN
cord-014462-11ggaqf1	1448	14	Science	Science	NNP
cord-014462-11ggaqf1	1448	15	,	,	,
cord-014462-11ggaqf1	1448	16	Bangalore	Bangalore	NNP
cord-014462-11ggaqf1	1448	17	Tospoviruses	Tospoviruses	NNP
cord-014462-11ggaqf1	1448	18	,	,	,
cord-014462-11ggaqf1	1448	19	belonging	belong	VBG
cord-014462-11ggaqf1	1448	20	to	to	IN
cord-014462-11ggaqf1	1448	21	the	the	DT
cord-014462-11ggaqf1	1448	22	family	family	NN
cord-014462-11ggaqf1	1448	23	Bunyavirideae	Bunyavirideae	NNP
cord-014462-11ggaqf1	1448	24	,	,	,
cord-014462-11ggaqf1	1448	25	infect	infect	VB
cord-014462-11ggaqf1	1448	26	economically	economically	RB
cord-014462-11ggaqf1	1448	27	important	important	JJ
cord-014462-11ggaqf1	1448	28	plants	plant	NNS
cord-014462-11ggaqf1	1448	29	such	such	JJ
cord-014462-11ggaqf1	1448	30	as	as	IN
cord-014462-11ggaqf1	1448	31	groundnut	groundnut	NN
cord-014462-11ggaqf1	1448	32	,	,	,
cord-014462-11ggaqf1	1448	33	tomato	tomato	NN
cord-014462-11ggaqf1	1448	34	,	,	,
cord-014462-11ggaqf1	1448	35	watermelon	watermelon	NN
cord-014462-11ggaqf1	1448	36	etc	etc	FW
cord-014462-11ggaqf1	1448	37	.	.	.
cord-014462-11ggaqf1	1449	1	They	-PRON-	PRP
cord-014462-11ggaqf1	1449	2	have	have	VBP
cord-014462-11ggaqf1	1449	3	a	a	DT
cord-014462-11ggaqf1	1449	4	tripartite	tripartite	JJ
cord-014462-11ggaqf1	1449	5	genome	genome	NN
cord-014462-11ggaqf1	1449	6	,	,	,
cord-014462-11ggaqf1	1449	7	with	with	IN
cord-014462-11ggaqf1	1449	8	L	L	NNP
cord-014462-11ggaqf1	1449	9	,	,	,
cord-014462-11ggaqf1	1449	10	M	M	NNP
cord-014462-11ggaqf1	1449	11	and	and	CC
cord-014462-11ggaqf1	1449	12	S	S	NNP
cord-014462-11ggaqf1	1449	13	segments	segment	NNS
cord-014462-11ggaqf1	1449	14	of	of	IN
cord-014462-11ggaqf1	1449	15	RNA	RNA	NNP
cord-014462-11ggaqf1	1449	16	,	,	,
cord-014462-11ggaqf1	1449	17	in	in	IN
cord-014462-11ggaqf1	1449	18	pseudo	pseudo	JJ
cord-014462-11ggaqf1	1449	19	circular	circular	JJ
cord-014462-11ggaqf1	1449	20	(	(	-LRB-
cord-014462-11ggaqf1	1449	21	panhandle	panhandle	NNP
cord-014462-11ggaqf1	1449	22	)	)	-RRB-
cord-014462-11ggaqf1	1449	23	form	form	NN
cord-014462-11ggaqf1	1449	24	.	.	.
cord-014462-11ggaqf1	1450	1	The	the	DT
cord-014462-11ggaqf1	1450	2	viral	viral	JJ
cord-014462-11ggaqf1	1450	3	genomes	genome	NNS
cord-014462-11ggaqf1	1450	4	encode	encode	VBP
cord-014462-11ggaqf1	1450	5	four	four	CD
cord-014462-11ggaqf1	1450	6	structural	structural	JJ
cord-014462-11ggaqf1	1450	7	proteins	protein	NNS
cord-014462-11ggaqf1	1450	8	(	(	-LRB-
cord-014462-11ggaqf1	1450	9	L	L	NNP
cord-014462-11ggaqf1	1450	10	,	,	,
cord-014462-11ggaqf1	1450	11	N	N	NNP
cord-014462-11ggaqf1	1450	12	,	,	,
cord-014462-11ggaqf1	1450	13	G1	G1	NNP
cord-014462-11ggaqf1	1450	14	and	and	CC
cord-014462-11ggaqf1	1450	15	G2	G2	NNP
cord-014462-11ggaqf1	1450	16	)	)	-RRB-
cord-014462-11ggaqf1	1450	17	in	in	IN
cord-014462-11ggaqf1	1450	18	the	the	DT
cord-014462-11ggaqf1	1450	19	antisense	antisense	NN
cord-014462-11ggaqf1	1450	20	orientation	orientation	NN
cord-014462-11ggaqf1	1450	21	,	,	,
cord-014462-11ggaqf1	1450	22	and	and	CC
cord-014462-11ggaqf1	1450	23	two	two	CD
cord-014462-11ggaqf1	1450	24	non	non	JJ
cord-014462-11ggaqf1	1450	25	structural	structural	JJ
cord-014462-11ggaqf1	1450	26	proteins	protein	NNS
cord-014462-11ggaqf1	1450	27	NSs	ns	NNS
cord-014462-11ggaqf1	1450	28	and	and	CC
cord-014462-11ggaqf1	1450	29	NSm	NSm	NNS
cord-014462-11ggaqf1	1450	30	in	in	IN
cord-014462-11ggaqf1	1450	31	the	the	DT
cord-014462-11ggaqf1	1450	32	sense	sense	NN
cord-014462-11ggaqf1	1450	33	orientation	orientation	NN
cord-014462-11ggaqf1	1450	34	.	.	.
cord-014462-11ggaqf1	1451	1	The	the	DT
cord-014462-11ggaqf1	1451	2	NSm	NSm	NNS
cord-014462-11ggaqf1	1451	3	is	be	VBZ
cord-014462-11ggaqf1	1451	4	the	the	DT
cord-014462-11ggaqf1	1451	5	only	only	JJ
cord-014462-11ggaqf1	1451	6	protein	protein	NN
cord-014462-11ggaqf1	1451	7	unique	unique	JJ
cord-014462-11ggaqf1	1451	8	to	to	IN
cord-014462-11ggaqf1	1451	9	Tospoviruseses	Tospoviruseses	NNP
cord-014462-11ggaqf1	1451	10	that	that	WDT
cord-014462-11ggaqf1	1451	11	infect	infect	VBP
cord-014462-11ggaqf1	1451	12	plants	plant	NNS
cord-014462-11ggaqf1	1451	13	in	in	IN
cord-014462-11ggaqf1	1451	14	the	the	DT
cord-014462-11ggaqf1	1451	15	bunyaviridae	bunyaviridae	NN
cord-014462-11ggaqf1	1451	16	family	family	NN
cord-014462-11ggaqf1	1451	17	and	and	CC
cord-014462-11ggaqf1	1451	18	hence	hence	RB
cord-014462-11ggaqf1	1451	19	is	be	VBZ
cord-014462-11ggaqf1	1451	20	proposed	propose	VBN
cord-014462-11ggaqf1	1451	21	to	to	TO
cord-014462-11ggaqf1	1451	22	be	be	VB
cord-014462-11ggaqf1	1451	23	important	important	JJ
cord-014462-11ggaqf1	1451	24	for	for	IN
cord-014462-11ggaqf1	1451	25	cell	cell	NN
cord-014462-11ggaqf1	1451	26	to	to	IN
cord-014462-11ggaqf1	1451	27	cell	cell	NN
cord-014462-11ggaqf1	1451	28	movement	movement	NN
cord-014462-11ggaqf1	1451	29	.	.	.
cord-014462-11ggaqf1	1452	1	Ground	ground	NN
cord-014462-11ggaqf1	1452	2	nut	nut	NN
cord-014462-11ggaqf1	1452	3	bud	bud	NN
cord-014462-11ggaqf1	1452	4	necrosis	necrosis	NN
cord-014462-11ggaqf1	1452	5	virus	virus	NN
cord-014462-11ggaqf1	1452	6	(	(	-LRB-
cord-014462-11ggaqf1	1452	7	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1452	8	)	)	-RRB-
cord-014462-11ggaqf1	1452	9	,	,	,
cord-014462-11ggaqf1	1452	10	a	a	DT
cord-014462-11ggaqf1	1452	11	member	member	NN
cord-014462-11ggaqf1	1452	12	of	of	IN
cord-014462-11ggaqf1	1452	13	the	the	DT
cord-014462-11ggaqf1	1452	14	tospovirus	tospovirus	NNP
cord-014462-11ggaqf1	1452	15	genus	genus	NN
cord-014462-11ggaqf1	1452	16	,	,	,
cord-014462-11ggaqf1	1452	17	is	be	VBZ
cord-014462-11ggaqf1	1452	18	the	the	DT
cord-014462-11ggaqf1	1452	19	most	most	RBS
cord-014462-11ggaqf1	1452	20	prevalent	prevalent	JJ
cord-014462-11ggaqf1	1452	21	virus	virus	NN
cord-014462-11ggaqf1	1452	22	infecting	infect	VBG
cord-014462-11ggaqf1	1452	23	several	several	JJ
cord-014462-11ggaqf1	1452	24	species	specie	NNS
cord-014462-11ggaqf1	1452	25	of	of	IN
cord-014462-11ggaqf1	1452	26	Leguminosae	Leguminosae	NNP
cord-014462-11ggaqf1	1452	27	and	and	CC
cord-014462-11ggaqf1	1452	28	Solanaceae	Solanaceae	NNP
cord-014462-11ggaqf1	1452	29	plants	plant	NNS
cord-014462-11ggaqf1	1452	30	in	in	IN
cord-014462-11ggaqf1	1452	31	India	India	NNP
cord-014462-11ggaqf1	1452	32	.	.	.
cord-014462-11ggaqf1	1453	1	Total	Total	NNP
cord-014462-11ggaqf1	1453	2	RNA	RNA	NNP
cord-014462-11ggaqf1	1453	3	was	be	VBD
cord-014462-11ggaqf1	1453	4	isolated	isolate	VBN
cord-014462-11ggaqf1	1453	5	from	from	IN
cord-014462-11ggaqf1	1453	6	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1453	7	infected	infect	VBN
cord-014462-11ggaqf1	1453	8	tomato	tomato	NN
cord-014462-11ggaqf1	1453	9	leaves	leave	NNS
cord-014462-11ggaqf1	1453	10	and	and	CC
cord-014462-11ggaqf1	1453	11	RT	RT	NNP
cord-014462-11ggaqf1	1453	12	-	-	HYPH
cord-014462-11ggaqf1	1453	13	PCR	PCR	NNP
cord-014462-11ggaqf1	1453	14	was	be	VBD
cord-014462-11ggaqf1	1453	15	performed	perform	VBN
cord-014462-11ggaqf1	1453	16	using	use	VBG
cord-014462-11ggaqf1	1453	17	appropriate	appropriate	JJ
cord-014462-11ggaqf1	1453	18	primers	primer	NNS
cord-014462-11ggaqf1	1453	19	to	to	TO
cord-014462-11ggaqf1	1453	20	amplify	amplify	VB
cord-014462-11ggaqf1	1453	21	the	the	DT
cord-014462-11ggaqf1	1453	22	NSm	NSm	NNP
cord-014462-11ggaqf1	1453	23	gene	gene	NN
cord-014462-11ggaqf1	1453	24	.	.	.
cord-014462-11ggaqf1	1454	1	The	the	DT
cord-014462-11ggaqf1	1454	2	PCR	PCR	NNP
cord-014462-11ggaqf1	1454	3	product	product	NN
cord-014462-11ggaqf1	1454	4	was	be	VBD
cord-014462-11ggaqf1	1454	5	cloned	clone	VBN
cord-014462-11ggaqf1	1454	6	in	in	IN
cord-014462-11ggaqf1	1454	7	pGEX5X2	pgex5x2	CD
cord-014462-11ggaqf1	1454	8	vector	vector	NN
cord-014462-11ggaqf1	1454	9	.	.	.
cord-014462-11ggaqf1	1455	1	The	the	DT
cord-014462-11ggaqf1	1455	2	recombinant	recombinant	JJ
cord-014462-11ggaqf1	1455	3	NSm	NSm	NNS
cord-014462-11ggaqf1	1455	4	clone	clone	NN
cord-014462-11ggaqf1	1455	5	was	be	VBD
cord-014462-11ggaqf1	1455	6	transformed	transform	VBN
cord-014462-11ggaqf1	1455	7	into	into	IN
cord-014462-11ggaqf1	1455	8	Bl21	Bl21	NNP
cord-014462-11ggaqf1	1456	1	(	(	-LRB-
cord-014462-11ggaqf1	1456	2	DE3	DE3	NNP
cord-014462-11ggaqf1	1456	3	)	)	-RRB-
cord-014462-11ggaqf1	1456	4	E.	E.	NNP
cord-014462-11ggaqf1	1456	5	coli	coli	NNS
cord-014462-11ggaqf1	1456	6	cells	cell	NNS
cord-014462-11ggaqf1	1456	7	and	and	CC
cord-014462-11ggaqf1	1456	8	over	over	RB
cord-014462-11ggaqf1	1456	9	-	-	HYPH
cord-014462-11ggaqf1	1456	10	expressed	express	VBN
cord-014462-11ggaqf1	1456	11	by	by	IN
cord-014462-11ggaqf1	1456	12	induction	induction	NN
cord-014462-11ggaqf1	1456	13	with	with	IN
cord-014462-11ggaqf1	1456	14	0.3	0.3	CD
cord-014462-11ggaqf1	1456	15	mM	mm	CD
cord-014462-11ggaqf1	1456	16	IPTG	IPTG	NNP
cord-014462-11ggaqf1	1456	17	.	.	.
cord-014462-11ggaqf1	1457	1	SDS	SDS	NNP
cord-014462-11ggaqf1	1457	2	-	-	HYPH
cord-014462-11ggaqf1	1457	3	PAGE	PAGE	NNP
cord-014462-11ggaqf1	1457	4	analysis	analysis	NN
cord-014462-11ggaqf1	1457	5	of	of	IN
cord-014462-11ggaqf1	1457	6	induced	induce	VBN
cord-014462-11ggaqf1	1457	7	and	and	CC
cord-014462-11ggaqf1	1457	8	uninduced	uninduced	JJ
cord-014462-11ggaqf1	1457	9	fraction	fraction	NN
cord-014462-11ggaqf1	1457	10	revealed	reveal	VBD
cord-014462-11ggaqf1	1457	11	the	the	DT
cord-014462-11ggaqf1	1457	12	presence	presence	NN
cord-014462-11ggaqf1	1457	13	of	of	IN
cord-014462-11ggaqf1	1457	14	overexpressed	overexpresse	VBN
cord-014462-11ggaqf1	1457	15	protein	protein	NN
cord-014462-11ggaqf1	1457	16	of	of	IN
cord-014462-11ggaqf1	1457	17	expected	expect	VBN
cord-014462-11ggaqf1	1457	18	size	size	NN
cord-014462-11ggaqf1	1457	19	.	.	.
cord-014462-11ggaqf1	1458	1	The	the	DT
cord-014462-11ggaqf1	1458	2	soluble	soluble	JJ
cord-014462-11ggaqf1	1458	3	GST	GST	NNP
cord-014462-11ggaqf1	1458	4	-	-	HYPH
cord-014462-11ggaqf1	1458	5	NSm	NSm	NNP
cord-014462-11ggaqf1	1458	6	was	be	VBD
cord-014462-11ggaqf1	1458	7	purified	purify	VBN
cord-014462-11ggaqf1	1458	8	by	by	IN
cord-014462-11ggaqf1	1458	9	GSH	GSH	NNP
cord-014462-11ggaqf1	1458	10	Sepharose	Sepharose	NNP
cord-014462-11ggaqf1	1458	11	affinity	affinity	NN
cord-014462-11ggaqf1	1458	12	chromatography	chromatography	NN
cord-014462-11ggaqf1	1458	13	.	.	.
cord-014462-11ggaqf1	1459	1	Purified	purify	VBN
cord-014462-11ggaqf1	1459	2	GST	GST	NNP
cord-014462-11ggaqf1	1459	3	-	-	HYPH
cord-014462-11ggaqf1	1459	4	NSm	NSm	NNP
cord-014462-11ggaqf1	1459	5	was	be	VBD
cord-014462-11ggaqf1	1459	6	shown	show	VBN
cord-014462-11ggaqf1	1459	7	to	to	TO
cord-014462-11ggaqf1	1459	8	interact	interact	VB
cord-014462-11ggaqf1	1459	9	with	with	IN
cord-014462-11ggaqf1	1459	10	in	in	IN
cord-014462-11ggaqf1	1459	11	vitro	vitro	FW
cord-014462-11ggaqf1	1459	12	transcribed	transcribe	VBN
cord-014462-11ggaqf1	1459	13	RNA	RNA	NNP
cord-014462-11ggaqf1	1459	14	transcript	transcript	NN
cord-014462-11ggaqf1	1459	15	by	by	IN
cord-014462-11ggaqf1	1459	16	electrophoretic	electrophoretic	JJ
cord-014462-11ggaqf1	1459	17	mobility	mobility	NN
cord-014462-11ggaqf1	1459	18	shift	shift	NN
cord-014462-11ggaqf1	1459	19	assay	assay	NN
cord-014462-11ggaqf1	1459	20	.	.	.
cord-014462-11ggaqf1	1460	1	Further	further	JJ
cord-014462-11ggaqf1	1460	2	NSm	NSm	NNS
cord-014462-11ggaqf1	1460	3	was	be	VBD
cord-014462-11ggaqf1	1460	4	shown	show	VBN
cord-014462-11ggaqf1	1460	5	to	to	TO
cord-014462-11ggaqf1	1460	6	interact	interact	VB
cord-014462-11ggaqf1	1460	7	with	with	IN
cord-014462-11ggaqf1	1460	8	viral	viral	JJ
cord-014462-11ggaqf1	1460	9	encoded	encode	VBN
cord-014462-11ggaqf1	1460	10	proteins	protein	NNS
cord-014462-11ggaqf1	1460	11	NP	NP	NNP
cord-014462-11ggaqf1	1460	12	and	and	CC
cord-014462-11ggaqf1	1460	13	NSs	ns	NNS
cord-014462-11ggaqf1	1460	14	using	use	VBG
cord-014462-11ggaqf1	1460	15	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1460	16	and	and	CC
cord-014462-11ggaqf1	1460	17	yeast	yeast	NN
cord-014462-11ggaqf1	1460	18	two	two	CD
cord-014462-11ggaqf1	1460	19	hybrid	hybrid	NN
cord-014462-11ggaqf1	1460	20	system	system	NN
cord-014462-11ggaqf1	1460	21	.	.	.
cord-014462-11ggaqf1	1461	1	NSm	NSm	NNP
cord-014462-11ggaqf1	1461	2	was	be	VBD
cord-014462-11ggaqf1	1461	3	also	also	RB
cord-014462-11ggaqf1	1461	4	shown	show	VBN
cord-014462-11ggaqf1	1461	5	to	to	TO
cord-014462-11ggaqf1	1461	6	be	be	VB
cord-014462-11ggaqf1	1461	7	phosphorylated	phosphorylate	VBN
cord-014462-11ggaqf1	1461	8	in	in	IN
cord-014462-11ggaqf1	1461	9	vitro	vitro	FW
cord-014462-11ggaqf1	1461	10	by	by	IN
cord-014462-11ggaqf1	1461	11	pellet	pellet	NN
cord-014462-11ggaqf1	1461	12	fraction	fraction	NN
cord-014462-11ggaqf1	1461	13	of	of	IN
cord-014462-11ggaqf1	1461	14	plant	plant	NN
cord-014462-11ggaqf1	1461	15	sap	sap	NN
cord-014462-11ggaqf1	1461	16	.	.	.
cord-014462-11ggaqf1	1462	1	Thus	thus	RB
cord-014462-11ggaqf1	1462	2	the	the	DT
cord-014462-11ggaqf1	1462	3	recombinant	recombinant	JJ
cord-014462-11ggaqf1	1462	4	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1463	1	Nsm	Nsm	NNP
cord-014462-11ggaqf1	1463	2	possesses	possess	VBZ
cord-014462-11ggaqf1	1463	3	the	the	DT
cord-014462-11ggaqf1	1463	4	characteristic	characteristic	JJ
cord-014462-11ggaqf1	1463	5	features	feature	NNS
cord-014462-11ggaqf1	1463	6	of	of	IN
cord-014462-11ggaqf1	1463	7	a	a	DT
cord-014462-11ggaqf1	1463	8	movement	movement	NN
cord-014462-11ggaqf1	1463	9	protein	protein	NN
cord-014462-11ggaqf1	1463	10	such	such	JJ
cord-014462-11ggaqf1	1463	11	as	as	IN
cord-014462-11ggaqf1	1463	12	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1463	13	acid	acid	NN
cord-014462-11ggaqf1	1463	14	binding	binding	NN
cord-014462-11ggaqf1	1463	15	,	,	,
cord-014462-11ggaqf1	1463	16	interaction	interaction	NN
cord-014462-11ggaqf1	1463	17	with	with	IN
cord-014462-11ggaqf1	1463	18	nucleocapsid	nucleocapsid	NNP
cord-014462-11ggaqf1	1463	19	protein	protein	NN
cord-014462-11ggaqf1	1463	20	,	,	,
cord-014462-11ggaqf1	1463	21	and	and	CC
cord-014462-11ggaqf1	1463	22	ability	ability	NN
cord-014462-11ggaqf1	1463	23	to	to	TO
cord-014462-11ggaqf1	1463	24	undergo	undergo	VB
cord-014462-11ggaqf1	1463	25	posttranslational	posttranslational	JJ
cord-014462-11ggaqf1	1463	26	modification	modification	NN
cord-014462-11ggaqf1	1463	27	.	.	.
cord-014462-11ggaqf1	1464	1	Solanum	Solanum	NNP
cord-014462-11ggaqf1	1464	2	melongena	melongena	NN
cord-014462-11ggaqf1	1464	3	,	,	,
cord-014462-11ggaqf1	1464	4	commonly	commonly	RB
cord-014462-11ggaqf1	1464	5	called	call	VBN
cord-014462-11ggaqf1	1464	6	as	as	IN
cord-014462-11ggaqf1	1464	7	Egg	Egg	NNP
cord-014462-11ggaqf1	1464	8	plant	plant	NN
cord-014462-11ggaqf1	1464	9	is	be	VBZ
cord-014462-11ggaqf1	1464	10	one	one	CD
cord-014462-11ggaqf1	1464	11	of	of	IN
cord-014462-11ggaqf1	1464	12	the	the	DT
cord-014462-11ggaqf1	1464	13	most	most	RBS
cord-014462-11ggaqf1	1464	14	important	important	JJ
cord-014462-11ggaqf1	1464	15	vegetable	vegetable	NN
cord-014462-11ggaqf1	1464	16	crop	crop	NN
cord-014462-11ggaqf1	1464	17	in	in	IN
cord-014462-11ggaqf1	1464	18	the	the	DT
cord-014462-11ggaqf1	1464	19	world	world	NN
cord-014462-11ggaqf1	1464	20	.	.	.
cord-014462-11ggaqf1	1465	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1465	2	is	be	VBZ
cord-014462-11ggaqf1	1465	3	cultivated	cultivate	VBN
cord-014462-11ggaqf1	1465	4	widely	widely	RB
cord-014462-11ggaqf1	1465	5	in	in	IN
cord-014462-11ggaqf1	1465	6	the	the	DT
cord-014462-11ggaqf1	1465	7	tropical	tropical	JJ
cord-014462-11ggaqf1	1465	8	and	and	CC
cord-014462-11ggaqf1	1465	9	sub	sub	JJ
cord-014462-11ggaqf1	1465	10	tropical	tropical	JJ
cord-014462-11ggaqf1	1465	11	regions	region	NNS
cord-014462-11ggaqf1	1465	12	.	.	.
cord-014462-11ggaqf1	1466	1	Several	several	JJ
cord-014462-11ggaqf1	1466	2	viruses	virus	NNS
cord-014462-11ggaqf1	1466	3	such	such	JJ
cord-014462-11ggaqf1	1466	4	as	as	IN
cord-014462-11ggaqf1	1466	5	Cucumber	Cucumber	NNP
cord-014462-11ggaqf1	1466	6	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1466	7	cucumo	cucumo	NN
cord-014462-11ggaqf1	1466	8	virus	virus	NN
cord-014462-11ggaqf1	1466	9	(	(	-LRB-
cord-014462-11ggaqf1	1466	10	CMV	CMV	NNP
cord-014462-11ggaqf1	1466	11	)	)	-RRB-
cord-014462-11ggaqf1	1466	12	,	,	,
cord-014462-11ggaqf1	1466	13	Potato	Potato	NNP
cord-014462-11ggaqf1	1466	14	virus	virus	NN
cord-014462-11ggaqf1	1466	15	-	-	:
cord-014462-11ggaqf1	1466	16	Y	Y	NNP
cord-014462-11ggaqf1	1466	17	(	(	-LRB-
cord-014462-11ggaqf1	1466	18	PVY	PVY	NNP
cord-014462-11ggaqf1	1466	19	)	)	-RRB-
cord-014462-11ggaqf1	1466	20	,	,	,
cord-014462-11ggaqf1	1466	21	Potato	Potato	NNP
cord-014462-11ggaqf1	1466	22	virus	virus	NN
cord-014462-11ggaqf1	1466	23	-	-	:
cord-014462-11ggaqf1	1466	24	X	x	NN
cord-014462-11ggaqf1	1466	25	(	(	-LRB-
cord-014462-11ggaqf1	1466	26	PVX	PVX	NNP
cord-014462-11ggaqf1	1466	27	)	)	-RRB-
cord-014462-11ggaqf1	1466	28	and	and	CC
cord-014462-11ggaqf1	1466	29	Tobacco	Tobacco	NNP
cord-014462-11ggaqf1	1466	30	ring	ring	NN
cord-014462-11ggaqf1	1466	31	spot	spot	NN
cord-014462-11ggaqf1	1466	32	virus	virus	NN
cord-014462-11ggaqf1	1466	33	(	(	-LRB-
cord-014462-11ggaqf1	1466	34	TRSV	trsv	NN
cord-014462-11ggaqf1	1466	35	)	)	-RRB-
cord-014462-11ggaqf1	1467	1	infect	infect	VB
cord-014462-11ggaqf1	1467	2	egg	egg	NN
cord-014462-11ggaqf1	1467	3	plant	plant	NN
cord-014462-11ggaqf1	1467	4	under	under	IN
cord-014462-11ggaqf1	1467	5	natural	natural	JJ
cord-014462-11ggaqf1	1467	6	conditions	condition	NNS
cord-014462-11ggaqf1	1467	7	.	.	.
cord-014462-11ggaqf1	1468	1	In	in	IN
cord-014462-11ggaqf1	1468	2	India	India	NNP
cord-014462-11ggaqf1	1468	3	major	major	JJ
cord-014462-11ggaqf1	1468	4	crop	crop	NN
cord-014462-11ggaqf1	1468	5	losses	loss	NNS
cord-014462-11ggaqf1	1468	6	due	due	JJ
cord-014462-11ggaqf1	1468	7	to	to	IN
cord-014462-11ggaqf1	1468	8	CMV	CMV	NNP
cord-014462-11ggaqf1	1468	9	infection	infection	NN
cord-014462-11ggaqf1	1468	10	in	in	IN
cord-014462-11ggaqf1	1468	11	brinjal	brinjal	NN
cord-014462-11ggaqf1	1468	12	is	be	VBZ
cord-014462-11ggaqf1	1468	13	57	57	CD
cord-014462-11ggaqf1	1468	14	%	%	NN
cord-014462-11ggaqf1	1468	15	(	(	-LRB-
cord-014462-11ggaqf1	1468	16	FAO	FAO	NNP
cord-014462-11ggaqf1	1468	17	STAT-2008	STAT-2008	NNP
cord-014462-11ggaqf1	1468	18	)	)	-RRB-
cord-014462-11ggaqf1	1468	19	.	.	.
cord-014462-11ggaqf1	1469	1	In	in	IN
cord-014462-11ggaqf1	1469	2	the	the	DT
cord-014462-11ggaqf1	1469	3	present	present	JJ
cord-014462-11ggaqf1	1469	4	study	study	NN
cord-014462-11ggaqf1	1469	5	the	the	DT
cord-014462-11ggaqf1	1469	6	infected	infected	JJ
cord-014462-11ggaqf1	1469	7	leaf	leaf	NN
cord-014462-11ggaqf1	1469	8	samples	sample	NNS
cord-014462-11ggaqf1	1469	9	were	be	VBD
cord-014462-11ggaqf1	1469	10	collected	collect	VBN
cord-014462-11ggaqf1	1469	11	from	from	IN
cord-014462-11ggaqf1	1469	12	local	local	JJ
cord-014462-11ggaqf1	1469	13	fields	field	NNS
cord-014462-11ggaqf1	1469	14	of	of	IN
cord-014462-11ggaqf1	1469	15	Ramapuram	Ramapuram	NNP
cord-014462-11ggaqf1	1469	16	,	,	,
cord-014462-11ggaqf1	1469	17	Chandamama	Chandamama	NNP
cord-014462-11ggaqf1	1469	18	palli	palli	NNP
cord-014462-11ggaqf1	1469	19	,	,	,
cord-014462-11ggaqf1	1469	20	Chandragiri	Chandragiri	NNP
cord-014462-11ggaqf1	1469	21	,	,	,
cord-014462-11ggaqf1	1469	22	Madanapalli	Madanapalli	NNP
cord-014462-11ggaqf1	1469	23	,	,	,
cord-014462-11ggaqf1	1469	24	Yadhamari	Yadhamari	NNP
cord-014462-11ggaqf1	1469	25	,	,	,
cord-014462-11ggaqf1	1469	26	Durgasamudram	Durgasamudram	NNP
cord-014462-11ggaqf1	1469	27	villages	village	NNS
cord-014462-11ggaqf1	1469	28	in	in	IN
cord-014462-11ggaqf1	1469	29	and	and	CC
cord-014462-11ggaqf1	1469	30	around	around	IN
cord-014462-11ggaqf1	1469	31	Tirupati	Tirupati	NNP
cord-014462-11ggaqf1	1469	32	,	,	,
cord-014462-11ggaqf1	1469	33	were	be	VBD
cord-014462-11ggaqf1	1469	34	tested	test	VBN
cord-014462-11ggaqf1	1469	35	for	for	IN
cord-014462-11ggaqf1	1469	36	CMV	CMV	NNP
cord-014462-11ggaqf1	1469	37	infection	infection	NN
cord-014462-11ggaqf1	1469	38	by	by	IN
cord-014462-11ggaqf1	1469	39	DAC	DAC	NNP
cord-014462-11ggaqf1	1469	40	-	-	HYPH
cord-014462-11ggaqf1	1469	41	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1469	42	with	with	IN
cord-014462-11ggaqf1	1469	43	CMV	CMV	NNP
cord-014462-11ggaqf1	1469	44	antisera	antisera	NN
cord-014462-11ggaqf1	1469	45	.	.	.
cord-014462-11ggaqf1	1470	1	The	the	DT
cord-014462-11ggaqf1	1470	2	resulting	result	VBG
cord-014462-11ggaqf1	1470	3	positive	positive	JJ
cord-014462-11ggaqf1	1470	4	samples	sample	NNS
cord-014462-11ggaqf1	1470	5	were	be	VBD
cord-014462-11ggaqf1	1470	6	further	further	RB
cord-014462-11ggaqf1	1470	7	inoculated	inoculate	VBN
cord-014462-11ggaqf1	1470	8	to	to	IN
cord-014462-11ggaqf1	1470	9	the	the	DT
cord-014462-11ggaqf1	1470	10	raised	raise	VBN
cord-014462-11ggaqf1	1470	11	brinjal	brinjal	NN
cord-014462-11ggaqf1	1470	12	seedlings	seedling	NNS
cord-014462-11ggaqf1	1470	13	of	of	IN
cord-014462-11ggaqf1	1470	14	selected	select	VBN
cord-014462-11ggaqf1	1470	15	varieties	variety	NNS
cord-014462-11ggaqf1	1470	16	through	through	IN
cord-014462-11ggaqf1	1470	17	mechanical	mechanical	JJ
cord-014462-11ggaqf1	1470	18	sap	sap	NN
cord-014462-11ggaqf1	1470	19	inoculation	inoculation	NN
cord-014462-11ggaqf1	1470	20	.	.	.
cord-014462-11ggaqf1	1471	1	Different	different	JJ
cord-014462-11ggaqf1	1471	2	varieties	variety	NNS
cord-014462-11ggaqf1	1471	3	of	of	IN
cord-014462-11ggaqf1	1471	4	brinjal	brinjal	NN
cord-014462-11ggaqf1	1471	5	like	like	IN
cord-014462-11ggaqf1	1471	6	Mullabadhine	Mullabadhine	NNP
cord-014462-11ggaqf1	1471	7	,	,	,
cord-014462-11ggaqf1	1471	8	Ankhur	Ankhur	NNP
cord-014462-11ggaqf1	1471	9	,	,	,
cord-014462-11ggaqf1	1471	10	Ravya	Ravya	NNP
cord-014462-11ggaqf1	1471	11	,	,	,
cord-014462-11ggaqf1	1471	12	Mattigulla	Mattigulla	NNP
cord-014462-11ggaqf1	1471	13	,	,	,
cord-014462-11ggaqf1	1471	14	Casper	Casper	NNP
cord-014462-11ggaqf1	1471	15	and	and	CC
cord-014462-11ggaqf1	1471	16	Easter	Easter	NNP
cord-014462-11ggaqf1	1471	17	egg	egg	NN
cord-014462-11ggaqf1	1471	18	were	be	VBD
cord-014462-11ggaqf1	1471	19	used	use	VBN
cord-014462-11ggaqf1	1471	20	for	for	IN
cord-014462-11ggaqf1	1471	21	monitoring	monitor	VBG
cord-014462-11ggaqf1	1471	22	the	the	DT
cord-014462-11ggaqf1	1471	23	susceptibility	susceptibility	NN
cord-014462-11ggaqf1	1471	24	to	to	IN
cord-014462-11ggaqf1	1471	25	CMV	CMV	NNP
cord-014462-11ggaqf1	1471	26	infection	infection	NN
cord-014462-11ggaqf1	1471	27	.	.	.
cord-014462-11ggaqf1	1472	1	The	the	DT
cord-014462-11ggaqf1	1472	2	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1472	3	symptoms	symptom	NNS
cord-014462-11ggaqf1	1472	4	were	be	VBD
cord-014462-11ggaqf1	1472	5	observed	observe	VBN
cord-014462-11ggaqf1	1472	6	after	after	IN
cord-014462-11ggaqf1	1472	7	2	2	CD
cord-014462-11ggaqf1	1472	8	weeks	week	NNS
cord-014462-11ggaqf1	1472	9	of	of	IN
cord-014462-11ggaqf1	1472	10	inoculation	inoculation	NN
cord-014462-11ggaqf1	1472	11	in	in	IN
cord-014462-11ggaqf1	1472	12	all	all	DT
cord-014462-11ggaqf1	1472	13	varities	varitie	NNS
cord-014462-11ggaqf1	1472	14	of	of	IN
cord-014462-11ggaqf1	1472	15	brinjal	brinjal	NN
cord-014462-11ggaqf1	1472	16	except	except	IN
cord-014462-11ggaqf1	1472	17	Mullabadhina	Mullabadhina	NNP
cord-014462-11ggaqf1	1472	18	.	.	.
cord-014462-11ggaqf1	1473	1	Among	among	IN
cord-014462-11ggaqf1	1473	2	all	all	PDT
cord-014462-11ggaqf1	1473	3	these	these	DT
cord-014462-11ggaqf1	1473	4	susceptible	susceptible	JJ
cord-014462-11ggaqf1	1473	5	varities	varitie	NNS
cord-014462-11ggaqf1	1473	6	Ankhur	Ankhur	NNP
cord-014462-11ggaqf1	1473	7	variety	variety	NN
cord-014462-11ggaqf1	1473	8	is	be	VBZ
cord-014462-11ggaqf1	1473	9	selected	select	VBN
cord-014462-11ggaqf1	1473	10	to	to	TO
cord-014462-11ggaqf1	1473	11	study	study	VB
cord-014462-11ggaqf1	1473	12	induced	induce	VBN
cord-014462-11ggaqf1	1473	13	biochemical	biochemical	JJ
cord-014462-11ggaqf1	1473	14	changes	change	NNS
cord-014462-11ggaqf1	1473	15	such	such	JJ
cord-014462-11ggaqf1	1473	16	as	as	IN
cord-014462-11ggaqf1	1473	17	Chlorophylls	Chlorophylls	NNP
cord-014462-11ggaqf1	1473	18	,	,	,
cord-014462-11ggaqf1	1473	19	Carbohydrates	Carbohydrates	NNPS
cord-014462-11ggaqf1	1473	20	,	,	,
cord-014462-11ggaqf1	1473	21	Proteins	protein	NNS
cord-014462-11ggaqf1	1473	22	,	,	,
cord-014462-11ggaqf1	1473	23	Nucleic	nucleic	JJ
cord-014462-11ggaqf1	1473	24	acids	acid	NNS
cord-014462-11ggaqf1	1473	25	and	and	CC
cord-014462-11ggaqf1	1473	26	Polyphenol	Polyphenol	NNP
cord-014462-11ggaqf1	1473	27	oxidases	oxidase	NNS
cord-014462-11ggaqf1	1473	28	in	in	IN
cord-014462-11ggaqf1	1473	29	CMV	CMV	NNP
cord-014462-11ggaqf1	1473	30	infected	infect	VBN
cord-014462-11ggaqf1	1473	31	brinjal	brinjal	NN
cord-014462-11ggaqf1	1473	32	leaves	leave	NNS
cord-014462-11ggaqf1	1473	33	.	.	.
cord-014462-11ggaqf1	1474	1	In	in	IN
cord-014462-11ggaqf1	1474	2	the	the	DT
cord-014462-11ggaqf1	1474	3	infected	infected	JJ
cord-014462-11ggaqf1	1474	4	leaves	leave	NNS
cord-014462-11ggaqf1	1474	5	considerable	considerable	JJ
cord-014462-11ggaqf1	1474	6	reduction	reduction	NN
cord-014462-11ggaqf1	1474	7	in	in	IN
cord-014462-11ggaqf1	1474	8	chlorophyll	chlorophyll	NN
cord-014462-11ggaqf1	1474	9	and	and	CC
cord-014462-11ggaqf1	1474	10	starch	starch	NN
cord-014462-11ggaqf1	1474	11	and	and	CC
cord-014462-11ggaqf1	1474	12	increase	increase	NN
cord-014462-11ggaqf1	1474	13	in	in	IN
cord-014462-11ggaqf1	1474	14	total	total	JJ
cord-014462-11ggaqf1	1474	15	Proteins	protein	NNS
cord-014462-11ggaqf1	1474	16	,	,	,
cord-014462-11ggaqf1	1474	17	Sugars	Sugars	NNPS
cord-014462-11ggaqf1	1474	18	,	,	,
cord-014462-11ggaqf1	1474	19	RNA	RNA	NNP
cord-014462-11ggaqf1	1474	20	and	and	CC
cord-014462-11ggaqf1	1474	21	Polyphenol	Polyphenol	NNP
cord-014462-11ggaqf1	1474	22	oxidases	oxidase	NNS
cord-014462-11ggaqf1	1474	23	was	be	VBD
cord-014462-11ggaqf1	1474	24	observed	observe	VBN
cord-014462-11ggaqf1	1474	25	when	when	WRB
cord-014462-11ggaqf1	1474	26	compared	compare	VBN
cord-014462-11ggaqf1	1474	27	to	to	IN
cord-014462-11ggaqf1	1474	28	healthy	healthy	JJ
cord-014462-11ggaqf1	1474	29	leaves	leave	NNS
cord-014462-11ggaqf1	1474	30	.	.	.
cord-014462-11ggaqf1	1475	1	The	the	DT
cord-014462-11ggaqf1	1475	2	amount	amount	NN
cord-014462-11ggaqf1	1475	3	of	of	IN
cord-014462-11ggaqf1	1475	4	total	total	JJ
cord-014462-11ggaqf1	1475	5	Starch	starch	NN
cord-014462-11ggaqf1	1475	6	,	,	,
cord-014462-11ggaqf1	1475	7	protein	protein	NN
cord-014462-11ggaqf1	1475	8	and	and	CC
cord-014462-11ggaqf1	1475	9	DNA	dna	NN
cord-014462-11ggaqf1	1475	10	decreased	decrease	VBD
cord-014462-11ggaqf1	1475	11	to	to	IN
cord-014462-11ggaqf1	1475	12	about	about	RB
cord-014462-11ggaqf1	1475	13	25	25	CD
cord-014462-11ggaqf1	1475	14	,	,	,
cord-014462-11ggaqf1	1475	15	136	136	CD
cord-014462-11ggaqf1	1475	16	and	and	CC
cord-014462-11ggaqf1	1475	17	645	645	CD
cord-014462-11ggaqf1	1475	18	lg	lg	NN
cord-014462-11ggaqf1	1475	19	/	/	SYM
cord-014462-11ggaqf1	1475	20	g	g	NNP
cord-014462-11ggaqf1	1475	21	respectively	respectively	RB
cord-014462-11ggaqf1	1475	22	in	in	IN
cord-014462-11ggaqf1	1475	23	infected	infected	JJ
cord-014462-11ggaqf1	1475	24	leaves	leave	NNS
cord-014462-11ggaqf1	1475	25	,	,	,
cord-014462-11ggaqf1	1475	26	where	where	WRB
cord-014462-11ggaqf1	1475	27	as	as	IN
cord-014462-11ggaqf1	1475	28	sugars	sugar	NNS
cord-014462-11ggaqf1	1475	29	(	(	-LRB-
cord-014462-11ggaqf1	1475	30	75	75	CD
cord-014462-11ggaqf1	1475	31	lg	lg	NN
cord-014462-11ggaqf1	1475	32	/	/	SYM
cord-014462-11ggaqf1	1475	33	g	g	NNP
cord-014462-11ggaqf1	1475	34	)	)	-RRB-
cord-014462-11ggaqf1	1475	35	,	,	,
cord-014462-11ggaqf1	1475	36	RNA	RNA	NNP
cord-014462-11ggaqf1	1475	37	content	content	NN
cord-014462-11ggaqf1	1475	38	(	(	-LRB-
cord-014462-11ggaqf1	1475	39	754	754	CD
cord-014462-11ggaqf1	1475	40	lg	lg	NN
cord-014462-11ggaqf1	1475	41	/	/	SYM
cord-014462-11ggaqf1	1475	42	g	g	NNP
cord-014462-11ggaqf1	1475	43	)	)	-RRB-
cord-014462-11ggaqf1	1475	44	and	and	CC
cord-014462-11ggaqf1	1475	45	Polyphenol	Polyphenol	NNP
cord-014462-11ggaqf1	1475	46	oxidase	oxidase	NN
cord-014462-11ggaqf1	1475	47	activity	activity	NN
cord-014462-11ggaqf1	1475	48	was	be	VBD
cord-014462-11ggaqf1	1475	49	increased	increase	VBN
cord-014462-11ggaqf1	1475	50	as	as	IN
cord-014462-11ggaqf1	1475	51	compared	compare	VBN
cord-014462-11ggaqf1	1475	52	to	to	IN
cord-014462-11ggaqf1	1475	53	healthy	healthy	JJ
cord-014462-11ggaqf1	1475	54	leaves	leave	NNS
cord-014462-11ggaqf1	1475	55	.	.	.
cord-014462-11ggaqf1	1476	1	The	the	DT
cord-014462-11ggaqf1	1476	2	above	above	JJ
cord-014462-11ggaqf1	1476	3	results	result	NNS
cord-014462-11ggaqf1	1476	4	suggests	suggest	VBZ
cord-014462-11ggaqf1	1476	5	that	that	IN
cord-014462-11ggaqf1	1476	6	there	there	EX
cord-014462-11ggaqf1	1476	7	is	be	VBZ
cord-014462-11ggaqf1	1476	8	an	an	DT
cord-014462-11ggaqf1	1476	9	altered	altered	JJ
cord-014462-11ggaqf1	1476	10	concentrations	concentration	NNS
cord-014462-11ggaqf1	1476	11	of	of	IN
cord-014462-11ggaqf1	1476	12	chlorophyll	chlorophyll	NN
cord-014462-11ggaqf1	1476	13	,	,	,
cord-014462-11ggaqf1	1476	14	proteins	protein	NNS
cord-014462-11ggaqf1	1476	15	,	,	,
cord-014462-11ggaqf1	1476	16	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1476	17	acids	acid	NNS
cord-014462-11ggaqf1	1476	18	,	,	,
cord-014462-11ggaqf1	1476	19	carbohydrates	carbohydrate	NNS
cord-014462-11ggaqf1	1476	20	and	and	CC
cord-014462-11ggaqf1	1476	21	Polyphenol	Polyphenol	NNP
cord-014462-11ggaqf1	1476	22	oxidase	oxidase	NN
cord-014462-11ggaqf1	1476	23	activity	activity	NN
cord-014462-11ggaqf1	1476	24	in	in	IN
cord-014462-11ggaqf1	1476	25	the	the	DT
cord-014462-11ggaqf1	1476	26	brinjal	brinjal	NN
cord-014462-11ggaqf1	1476	27	leaves	leave	NNS
cord-014462-11ggaqf1	1476	28	due	due	JJ
cord-014462-11ggaqf1	1476	29	to	to	IN
cord-014462-11ggaqf1	1476	30	the	the	DT
cord-014462-11ggaqf1	1476	31	effect	effect	NN
cord-014462-11ggaqf1	1476	32	of	of	IN
cord-014462-11ggaqf1	1476	33	Cucumber	Cucumber	NNP
cord-014462-11ggaqf1	1476	34	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1476	35	cucumo	cucumo	NN
cord-014462-11ggaqf1	1476	36	virus	virus	NN
cord-014462-11ggaqf1	1476	37	infection	infection	NN
cord-014462-11ggaqf1	1476	38	.	.	.
cord-014462-11ggaqf1	1477	1	Leaf	leaf	NN
cord-014462-11ggaqf1	1477	2	analysis	analysis	NN
cord-014462-11ggaqf1	1477	3	was	be	VBD
cord-014462-11ggaqf1	1477	4	found	find	VBN
cord-014462-11ggaqf1	1477	5	to	to	TO
cord-014462-11ggaqf1	1477	6	be	be	VB
cord-014462-11ggaqf1	1477	7	used	use	VBN
cord-014462-11ggaqf1	1477	8	as	as	IN
cord-014462-11ggaqf1	1477	9	widely	widely	RB
cord-014462-11ggaqf1	1477	10	accepted	accept	VBN
cord-014462-11ggaqf1	1477	11	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1477	12	tool	tool	NN
cord-014462-11ggaqf1	1477	13	to	to	TO
cord-014462-11ggaqf1	1477	14	assess	assess	VB
cord-014462-11ggaqf1	1477	15	the	the	DT
cord-014462-11ggaqf1	1477	16	nutritional	nutritional	JJ
cord-014462-11ggaqf1	1477	17	status	status	NN
cord-014462-11ggaqf1	1477	18	of	of	IN
cord-014462-11ggaqf1	1477	19	the	the	DT
cord-014462-11ggaqf1	1477	20	vegetables	vegetable	NNS
cord-014462-11ggaqf1	1477	21	.	.	.
cord-014462-11ggaqf1	1478	1	The	the	DT
cord-014462-11ggaqf1	1478	2	present	present	JJ
cord-014462-11ggaqf1	1478	3	study	study	NN
cord-014462-11ggaqf1	1478	4	deals	deal	NNS
cord-014462-11ggaqf1	1478	5	with	with	IN
cord-014462-11ggaqf1	1478	6	these	these	DT
cord-014462-11ggaqf1	1478	7	aspects	aspect	NNS
cord-014462-11ggaqf1	1478	8	in	in	IN
cord-014462-11ggaqf1	1478	9	detail	detail	NN
cord-014462-11ggaqf1	1478	10	.	.	.
cord-014462-11ggaqf1	1479	1	The	the	DT
cord-014462-11ggaqf1	1479	2	total	total	JJ
cord-014462-11ggaqf1	1479	3	RNA	RNA	NNP
cord-014462-11ggaqf1	1479	4	and	and	CC
cord-014462-11ggaqf1	1479	5	DNA	DNA	NNP
cord-014462-11ggaqf1	1479	6	was	be	VBD
cord-014462-11ggaqf1	1479	7	isolated	isolate	VBN
cord-014462-11ggaqf1	1479	8	from	from	IN
cord-014462-11ggaqf1	1479	9	infected	infected	JJ
cord-014462-11ggaqf1	1479	10	leaf	leaf	NN
cord-014462-11ggaqf1	1479	11	samples	sample	NNS
cord-014462-11ggaqf1	1479	12	.	.	.
cord-014462-11ggaqf1	1480	1	RT	RT	NNP
cord-014462-11ggaqf1	1480	2	-	-	HYPH
cord-014462-11ggaqf1	1480	3	PCR	PCR	NNP
cord-014462-11ggaqf1	1480	4	assays	assay	NNS
cord-014462-11ggaqf1	1480	5	were	be	VBD
cord-014462-11ggaqf1	1480	6	performed	perform	VBN
cord-014462-11ggaqf1	1480	7	using	use	VBG
cord-014462-11ggaqf1	1480	8	Sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1480	9	yellow	yellow	JJ
cord-014462-11ggaqf1	1480	10	leaf	leaf	NN
cord-014462-11ggaqf1	1480	11	virus	virus	NN
cord-014462-11ggaqf1	1480	12	(	(	-LRB-
cord-014462-11ggaqf1	1480	13	SCYLV	SCYLV	NNP
cord-014462-11ggaqf1	1480	14	)	)	-RRB-
cord-014462-11ggaqf1	1480	15	specific	specific	JJ
cord-014462-11ggaqf1	1480	16	primers	primer	NNS
cord-014462-11ggaqf1	1480	17	(	(	-LRB-
cord-014462-11ggaqf1	1480	18	SCYLV-615F	scylv-615f	NN
cord-014462-11ggaqf1	1480	19	and	and	CC
cord-014462-11ggaqf1	1480	20	SCYLV-615R	SCYLV-615R	NNP
cord-014462-11ggaqf1	1480	21	)	)	-RRB-
cord-014462-11ggaqf1	1480	22	.	.	.
cord-014462-11ggaqf1	1481	1	The	the	DT
cord-014462-11ggaqf1	1481	2	infection	infection	NN
cord-014462-11ggaqf1	1481	3	of	of	IN
cord-014462-11ggaqf1	1481	4	SCYLV	SCYLV	NNP
cord-014462-11ggaqf1	1481	5	was	be	VBD
cord-014462-11ggaqf1	1481	6	detected	detect	VBN
cord-014462-11ggaqf1	1481	7	in	in	IN
cord-014462-11ggaqf1	1481	8	all	all	PDT
cord-014462-11ggaqf1	1481	9	the	the	DT
cord-014462-11ggaqf1	1481	10	collected	collect	VBN
cord-014462-11ggaqf1	1481	11	samples	sample	NNS
cord-014462-11ggaqf1	1481	12	,	,	,
cord-014462-11ggaqf1	1481	13	which	which	WDT
cord-014462-11ggaqf1	1481	14	showed	show	VBD
cord-014462-11ggaqf1	1481	15	the	the	DT
cord-014462-11ggaqf1	1481	16	expected	expect	VBN
cord-014462-11ggaqf1	1481	17	size	size	NN
cord-014462-11ggaqf1	1481	18	(	(	-LRB-
cord-014462-11ggaqf1	1481	19	*	*	NFP
cord-014462-11ggaqf1	1481	20	610	610	CD
cord-014462-11ggaqf1	1481	21	bp	bp	NNP
cord-014462-11ggaqf1	1481	22	)	)	-RRB-
cord-014462-11ggaqf1	1481	23	amplicon	amplicon	NN
cord-014462-11ggaqf1	1481	24	during	during	IN
cord-014462-11ggaqf1	1481	25	RT	RT	NNP
cord-014462-11ggaqf1	1481	26	-	-	HYPH
cord-014462-11ggaqf1	1481	27	PCR	PCR	NNP
cord-014462-11ggaqf1	1481	28	.	.	.
cord-014462-11ggaqf1	1482	1	In	in	IN
cord-014462-11ggaqf1	1482	2	another	another	DT
cord-014462-11ggaqf1	1482	3	experiment	experiment	NN
cord-014462-11ggaqf1	1482	4	with	with	IN
cord-014462-11ggaqf1	1482	5	nested	nest	VBN
cord-014462-11ggaqf1	1482	6	PCR	PCR	NNP
cord-014462-11ggaqf1	1482	7	analysis	analysis	NN
cord-014462-11ggaqf1	1482	8	,	,	,
cord-014462-11ggaqf1	1482	9	a	a	DT
cord-014462-11ggaqf1	1482	10	phytoplasma	phytoplasma	NN
cord-014462-11ggaqf1	1482	11	characteristic	characteristic	NN
cord-014462-11ggaqf1	1482	12	1.2	1.2	CD
cord-014462-11ggaqf1	1482	13	kb	kb	NNP
cord-014462-11ggaqf1	1482	14	rDNA	rDNA	NNP
cord-014462-11ggaqf1	1482	15	PCR	PCR	NNP
cord-014462-11ggaqf1	1482	16	product	product	NN
cord-014462-11ggaqf1	1482	17	were	be	VBD
cord-014462-11ggaqf1	1482	18	amplified	amplify	VBN
cord-014462-11ggaqf1	1482	19	from	from	IN
cord-014462-11ggaqf1	1482	20	DNAs	dna	NNS
cord-014462-11ggaqf1	1482	21	of	of	IN
cord-014462-11ggaqf1	1482	22	all	all	DT
cord-014462-11ggaqf1	1482	23	infected	infected	JJ
cord-014462-11ggaqf1	1482	24	samples	sample	NNS
cord-014462-11ggaqf1	1482	25	but	but	CC
cord-014462-11ggaqf1	1482	26	not	not	RB
cord-014462-11ggaqf1	1482	27	in	in	IN
cord-014462-11ggaqf1	1482	28	healthy	healthy	JJ
cord-014462-11ggaqf1	1482	29	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1482	30	plants	plant	NNS
cord-014462-11ggaqf1	1482	31	tested	test	VBN
cord-014462-11ggaqf1	1482	32	using	use	VBG
cord-014462-11ggaqf1	1482	33	phytoplasma	phytoplasma	NNP
cord-014462-11ggaqf1	1482	34	universal	universal	NNP
cord-014462-11ggaqf1	1482	35	primer	primer	NN
cord-014462-11ggaqf1	1482	36	pairs	pair	NNS
cord-014462-11ggaqf1	1482	37	P1	P1	NNP
cord-014462-11ggaqf1	1482	38	/	/	SYM
cord-014462-11ggaqf1	1482	39	P7	p7	NN
cord-014462-11ggaqf1	1482	40	and	and	CC
cord-014462-11ggaqf1	1482	41	fU3	fU3	NNS
cord-014462-11ggaqf1	1482	42	/	/	SYM
cord-014462-11ggaqf1	1482	43	rU5	rU5	VBD
cord-014462-11ggaqf1	1482	44	.	.	.
cord-014462-11ggaqf1	1483	1	DNA	DNA	NNP
cord-014462-11ggaqf1	1483	2	extracts	extract	NNS
cord-014462-11ggaqf1	1483	3	from	from	IN
cord-014462-11ggaqf1	1483	4	plants	plant	NNS
cord-014462-11ggaqf1	1483	5	with	with	IN
cord-014462-11ggaqf1	1483	6	yellow	yellow	JJ
cord-014462-11ggaqf1	1483	7	mid	mid	JJ
cord-014462-11ggaqf1	1483	8	rib	rib	NN
cord-014462-11ggaqf1	1483	9	and	and	CC
cord-014462-11ggaqf1	1483	10	leaf	leaf	NN
cord-014462-11ggaqf1	1483	11	yellows	yellow	NNS
cord-014462-11ggaqf1	1483	12	produced	produce	VBD
cord-014462-11ggaqf1	1483	13	products	product	NNS
cord-014462-11ggaqf1	1483	14	of	of	IN
cord-014462-11ggaqf1	1483	15	1250	1250	CD
cord-014462-11ggaqf1	1483	16	bp	bp	NNP
cord-014462-11ggaqf1	1483	17	,	,	,
cord-014462-11ggaqf1	1483	18	which	which	WDT
cord-014462-11ggaqf1	1483	19	gave	give	VBD
cord-014462-11ggaqf1	1483	20	typical	typical	JJ
cord-014462-11ggaqf1	1483	21	phytoplasma	phytoplasma	NN
cord-014462-11ggaqf1	1483	22	profiles	profile	NNS
cord-014462-11ggaqf1	1483	23	when	when	WRB
cord-014462-11ggaqf1	1483	24	digested	digest	VBN
cord-014462-11ggaqf1	1483	25	with	with	IN
cord-014462-11ggaqf1	1483	26	Hae	Hae	NNP
cord-014462-11ggaqf1	1483	27	III	III	NNP
cord-014462-11ggaqf1	1483	28	and	and	CC
cord-014462-11ggaqf1	1483	29	Hha	Hha	NNP
cord-014462-11ggaqf1	1483	30	I.	I.	NNP
cord-014462-11ggaqf1	1483	31	No	no	NN
cord-014462-11ggaqf1	1483	32	PCR	PCR	NNP
cord-014462-11ggaqf1	1483	33	amplifications	amplification	NNS
cord-014462-11ggaqf1	1483	34	were	be	VBD
cord-014462-11ggaqf1	1483	35	produced	produce	VBN
cord-014462-11ggaqf1	1483	36	using	use	VBG
cord-014462-11ggaqf1	1483	37	DNA	dna	NN
cord-014462-11ggaqf1	1483	38	from	from	IN
cord-014462-11ggaqf1	1483	39	symptomless	symptomless	JJ
cord-014462-11ggaqf1	1483	40	plants	plant	NNS
cord-014462-11ggaqf1	1483	41	.	.	.
cord-014462-11ggaqf1	1484	1	Our	-PRON-	PRP$
cord-014462-11ggaqf1	1484	2	results	result	NNS
cord-014462-11ggaqf1	1484	3	suggest	suggest	VBP
cord-014462-11ggaqf1	1484	4	that	that	IN
cord-014462-11ggaqf1	1484	5	the	the	DT
cord-014462-11ggaqf1	1484	6	yellow	yellow	JJ
cord-014462-11ggaqf1	1484	7	mid	mid	JJ
cord-014462-11ggaqf1	1484	8	rib	rib	NN
cord-014462-11ggaqf1	1484	9	and	and	CC
cord-014462-11ggaqf1	1484	10	leaf	leaf	NN
cord-014462-11ggaqf1	1484	11	yellows	yellow	NNS
cord-014462-11ggaqf1	1484	12	symptoms	symptom	NNS
cord-014462-11ggaqf1	1484	13	on	on	IN
cord-014462-11ggaqf1	1484	14	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1484	15	varieties	variety	NNS
cord-014462-11ggaqf1	1484	16	in	in	IN
cord-014462-11ggaqf1	1484	17	Uttar	Uttar	NNP
cord-014462-11ggaqf1	1484	18	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1484	19	and	and	CC
cord-014462-11ggaqf1	1484	20	Uttarakhand	Uttarakhand	NNP
cord-014462-11ggaqf1	1484	21	states	state	NNS
cord-014462-11ggaqf1	1484	22	of	of	IN
cord-014462-11ggaqf1	1484	23	India	India	NNP
cord-014462-11ggaqf1	1484	24	exhibiting	exhibit	VBG
cord-014462-11ggaqf1	1484	25	midrib	midrib	JJ
cord-014462-11ggaqf1	1484	26	yellowing	yellowing	NN
cord-014462-11ggaqf1	1484	27	and	and	CC
cord-014462-11ggaqf1	1484	28	leaf	leaf	NN
cord-014462-11ggaqf1	1484	29	yellows	yellow	NNS
cord-014462-11ggaqf1	1484	30	symptoms	symptom	NNS
cord-014462-11ggaqf1	1484	31	is	be	VBZ
cord-014462-11ggaqf1	1484	32	mainly	mainly	RB
cord-014462-11ggaqf1	1484	33	caused	cause	VBN
cord-014462-11ggaqf1	1484	34	by	by	IN
cord-014462-11ggaqf1	1484	35	mixed	mixed	JJ
cord-014462-11ggaqf1	1484	36	infection	infection	NN
cord-014462-11ggaqf1	1484	37	of	of	IN
cord-014462-11ggaqf1	1484	38	SCYLV	SCYLV	NNS
cord-014462-11ggaqf1	1484	39	and	and	CC
cord-014462-11ggaqf1	1484	40	SCYLP	SCYLP	NNP
cord-014462-11ggaqf1	1484	41	.	.	.
cord-014462-11ggaqf1	1485	1	The	the	DT
cord-014462-11ggaqf1	1485	2	affected	affected	JJ
cord-014462-11ggaqf1	1485	3	clumps	clump	NNS
cord-014462-11ggaqf1	1485	4	showed	show	VBD
cord-014462-11ggaqf1	1485	5	reduction	reduction	NN
cord-014462-11ggaqf1	1485	6	in	in	IN
cord-014462-11ggaqf1	1485	7	stalk	stalk	NN
cord-014462-11ggaqf1	1485	8	height	height	NN
cord-014462-11ggaqf1	1485	9	as	as	IN
cord-014462-11ggaqf1	1485	10	compared	compare	VBN
cord-014462-11ggaqf1	1485	11	to	to	IN
cord-014462-11ggaqf1	1485	12	healthy	healthy	JJ
cord-014462-11ggaqf1	1485	13	fields	field	NNS
cord-014462-11ggaqf1	1485	14	.	.	.
cord-014462-11ggaqf1	1486	1	Thirty	thirty	CD
cord-014462-11ggaqf1	1486	2	-	-	HYPH
cord-014462-11ggaqf1	1486	3	one	one	CD
cord-014462-11ggaqf1	1486	4	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1486	5	mosaic	mosaic	NN
cord-014462-11ggaqf1	1486	6	isolates	isolate	NNS
cord-014462-11ggaqf1	1486	7	belonged	belong	VBD
cord-014462-11ggaqf1	1486	8	to	to	IN
cord-014462-11ggaqf1	1486	9	Sugarcane	Sugarcane	NNP
cord-014462-11ggaqf1	1486	10	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1486	11	virus	virus	NN
cord-014462-11ggaqf1	1486	12	(	(	-LRB-
cord-014462-11ggaqf1	1486	13	SCMV	SCMV	NNP
cord-014462-11ggaqf1	1486	14	)	)	-RRB-
cord-014462-11ggaqf1	1486	15	and	and	CC
cord-014462-11ggaqf1	1486	16	Sugarcane	Sugarcane	NNP
cord-014462-11ggaqf1	1486	17	streak	streak	NN
cord-014462-11ggaqf1	1486	18	mosaic	mosaic	NN
cord-014462-11ggaqf1	1486	19	virus	virus	NN
cord-014462-11ggaqf1	1487	1	(	(	-LRB-
cord-014462-11ggaqf1	1487	2	SCSMV	SCSMV	NNP
cord-014462-11ggaqf1	1487	3	were	be	VBD
cord-014462-11ggaqf1	1487	4	collected	collect	VBN
cord-014462-11ggaqf1	1487	5	from	from	IN
cord-014462-11ggaqf1	1487	6	China	China	NNP
cord-014462-11ggaqf1	1487	7	and	and	CC
cord-014462-11ggaqf1	1487	8	India	India	NNP
cord-014462-11ggaqf1	1487	9	)	)	-RRB-
cord-014462-11ggaqf1	1487	10	,	,	,
cord-014462-11ggaqf1	1487	11	confirmed	confirm	VBD
cord-014462-11ggaqf1	1487	12	in	in	IN
cord-014462-11ggaqf1	1487	13	indirect	indirect	JJ
cord-014462-11ggaqf1	1487	14	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1487	15	and	and	CC
cord-014462-11ggaqf1	1487	16	RT	RT	NNP
cord-014462-11ggaqf1	1487	17	-	-	HYPH
cord-014462-11ggaqf1	1487	18	PCR	PCR	NNP
cord-014462-11ggaqf1	1487	19	amplification	amplification	NN
cord-014462-11ggaqf1	1487	20	with	with	IN
cord-014462-11ggaqf1	1487	21	SCMV	SCMV	NNP
cord-014462-11ggaqf1	1487	22	and	and	CC
cord-014462-11ggaqf1	1487	23	SCSMV	SCSMV	NNP
cord-014462-11ggaqf1	1487	24	-	-	HYPH
cord-014462-11ggaqf1	1487	25	specific	specific	JJ
cord-014462-11ggaqf1	1487	26	primers	primer	NNS
cord-014462-11ggaqf1	1487	27	.	.	.
cord-014462-11ggaqf1	1488	1	The	the	DT
cord-014462-11ggaqf1	1488	2	amplicons	amplicon	NNS
cord-014462-11ggaqf1	1488	3	(	(	-LRB-
cord-014462-11ggaqf1	1488	4	0.8	0.8	CD
cord-014462-11ggaqf1	1488	5	kb	kb	NNP
cord-014462-11ggaqf1	1488	6	)	)	-RRB-
cord-014462-11ggaqf1	1488	7	from	from	IN
cord-014462-11ggaqf1	1488	8	the	the	DT
cord-014462-11ggaqf1	1488	9	coding	code	VBG
cord-014462-11ggaqf1	1488	10	region	region	NN
cord-014462-11ggaqf1	1488	11	of	of	IN
cord-014462-11ggaqf1	1488	12	coat	coat	NN
cord-014462-11ggaqf1	1488	13	protein	protein	NN
cord-014462-11ggaqf1	1488	14	(	(	-LRB-
cord-014462-11ggaqf1	1488	15	CP	CP	NNP
cord-014462-11ggaqf1	1488	16	)	)	-RRB-
cord-014462-11ggaqf1	1488	17	were	be	VBD
cord-014462-11ggaqf1	1488	18	cloned	clone	VBN
cord-014462-11ggaqf1	1488	19	,	,	,
cord-014462-11ggaqf1	1488	20	sequenced	sequence	VBN
cord-014462-11ggaqf1	1488	21	and	and	CC
cord-014462-11ggaqf1	1488	22	compared	compare	VBN
cord-014462-11ggaqf1	1488	23	to	to	IN
cord-014462-11ggaqf1	1488	24	each	each	DT
cord-014462-11ggaqf1	1488	25	other	other	JJ
cord-014462-11ggaqf1	1488	26	as	as	RB
cord-014462-11ggaqf1	1488	27	well	well	RB
cord-014462-11ggaqf1	1488	28	as	as	IN
cord-014462-11ggaqf1	1488	29	to	to	IN
cord-014462-11ggaqf1	1488	30	the	the	DT
cord-014462-11ggaqf1	1488	31	sequences	sequence	NNS
cord-014462-11ggaqf1	1488	32	of	of	IN
cord-014462-11ggaqf1	1488	33	15	15	CD
cord-014462-11ggaqf1	1488	34	SCMV	SCMV	NNP
cord-014462-11ggaqf1	1488	35	isolates	isolate	NNS
cord-014462-11ggaqf1	1488	36	from	from	IN
cord-014462-11ggaqf1	1488	37	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1488	38	(	(	-LRB-
cord-014462-11ggaqf1	1488	39	Australia	Australia	NNP
cord-014462-11ggaqf1	1488	40	,	,	,
cord-014462-11ggaqf1	1488	41	USA	USA	NNP
cord-014462-11ggaqf1	1488	42	,	,	,
cord-014462-11ggaqf1	1488	43	China	China	NNP
cord-014462-11ggaqf1	1488	44	,	,	,
cord-014462-11ggaqf1	1488	45	Brazil	Brazil	NNP
cord-014462-11ggaqf1	1488	46	,	,	,
cord-014462-11ggaqf1	1488	47	Mexico	Mexico	NNP
cord-014462-11ggaqf1	1488	48	and	and	CC
cord-014462-11ggaqf1	1488	49	South	South	NNP
cord-014462-11ggaqf1	1488	50	Africa	Africa	NNP
cord-014462-11ggaqf1	1488	51	)	)	-RRB-
cord-014462-11ggaqf1	1488	52	,	,	,
cord-014462-11ggaqf1	1488	53	maize	maize	NN
cord-014462-11ggaqf1	1488	54	(	(	-LRB-
cord-014462-11ggaqf1	1488	55	Australia	Australia	NNP
cord-014462-11ggaqf1	1488	56	,	,	,
cord-014462-11ggaqf1	1488	57	China	China	NNP
cord-014462-11ggaqf1	1488	58	,	,	,
cord-014462-11ggaqf1	1488	59	Iranian	Iranian	NNP
cord-014462-11ggaqf1	1488	60	)	)	-RRB-
cord-014462-11ggaqf1	1488	61	and	and	CC
cord-014462-11ggaqf1	1488	62	one	one	CD
cord-014462-11ggaqf1	1488	63	SCSMV	SCSMV	NNP
cord-014462-11ggaqf1	1488	64	isolate	isolate	VBP
cord-014462-11ggaqf1	1488	65	from	from	IN
cord-014462-11ggaqf1	1488	66	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1488	67	(	(	-LRB-
cord-014462-11ggaqf1	1488	68	India	India	NNP
cord-014462-11ggaqf1	1488	69	)	)	-RRB-
cord-014462-11ggaqf1	1488	70	in	in	IN
cord-014462-11ggaqf1	1488	71	Genbank	Genbank	NNP
cord-014462-11ggaqf1	1488	72	.	.	.
cord-014462-11ggaqf1	1489	1	Maximum	maximum	JJ
cord-014462-11ggaqf1	1489	2	likelihood	likelihood	NN
cord-014462-11ggaqf1	1489	3	and	and	CC
cord-014462-11ggaqf1	1489	4	maximum	maximum	JJ
cord-014462-11ggaqf1	1489	5	parsimony	parsimony	NN
cord-014462-11ggaqf1	1489	6	analyses	analysis	NNS
cord-014462-11ggaqf1	1489	7	robustly	robustly	RB
cord-014462-11ggaqf1	1489	8	supported	support	VBD
cord-014462-11ggaqf1	1489	9	two	two	CD
cord-014462-11ggaqf1	1489	10	major	major	JJ
cord-014462-11ggaqf1	1489	11	monophyletic	monophyletic	JJ
cord-014462-11ggaqf1	1489	12	groups	group	NNS
cord-014462-11ggaqf1	1489	13	that	that	WDT
cord-014462-11ggaqf1	1489	14	were	be	VBD
cord-014462-11ggaqf1	1489	15	correlated	correlate	VBN
cord-014462-11ggaqf1	1489	16	with	with	IN
cord-014462-11ggaqf1	1489	17	the	the	DT
cord-014462-11ggaqf1	1489	18	host	host	NN
cord-014462-11ggaqf1	1489	19	of	of	IN
cord-014462-11ggaqf1	1489	20	origin	origin	NN
cord-014462-11ggaqf1	1489	21	:	:	:
cord-014462-11ggaqf1	1489	22	the	the	DT
cord-014462-11ggaqf1	1489	23	SCMV	SCMV	NNP
cord-014462-11ggaqf1	1489	24	subgroup	subgroup	NN
cord-014462-11ggaqf1	1489	25	that	that	WDT
cord-014462-11ggaqf1	1489	26	included	include	VBD
cord-014462-11ggaqf1	1489	27	18	18	CD
cord-014462-11ggaqf1	1489	28	isolates	isolate	NNS
cord-014462-11ggaqf1	1489	29	from	from	IN
cord-014462-11ggaqf1	1489	30	China	China	NNP
cord-014462-11ggaqf1	1489	31	and	and	CC
cord-014462-11ggaqf1	1489	32	only	only	RB
cord-014462-11ggaqf1	1489	33	13	13	CD
cord-014462-11ggaqf1	1489	34	isolates	isolate	NNS
cord-014462-11ggaqf1	1489	35	from	from	IN
cord-014462-11ggaqf1	1489	36	India	India	NNP
cord-014462-11ggaqf1	1489	37	,	,	,
cord-014462-11ggaqf1	1489	38	and	and	CC
cord-014462-11ggaqf1	1489	39	the	the	DT
cord-014462-11ggaqf1	1489	40	SCSMV	SCSMV	NNP
cord-014462-11ggaqf1	1489	41	subgroup	subgroup	NN
cord-014462-11ggaqf1	1489	42	that	that	WDT
cord-014462-11ggaqf1	1489	43	contained	contain	VBD
cord-014462-11ggaqf1	1489	44	all	all	DT
cord-014462-11ggaqf1	1489	45	isolates	isolate	NNS
cord-014462-11ggaqf1	1489	46	from	from	IN
cord-014462-11ggaqf1	1489	47	India	India	NNP
cord-014462-11ggaqf1	1489	48	.	.	.
cord-014462-11ggaqf1	1490	1	Maize	maize	NN
cord-014462-11ggaqf1	1490	2	dwarf	dwarf	NN
cord-014462-11ggaqf1	1490	3	mosaic	mosaic	NN
cord-014462-11ggaqf1	1490	4	virus	virus	NN
cord-014462-11ggaqf1	1490	5	(	(	-LRB-
cord-014462-11ggaqf1	1490	6	MDMV	MDMV	NNP
cord-014462-11ggaqf1	1490	7	)	)	-RRB-
cord-014462-11ggaqf1	1490	8	and	and	CC
cord-014462-11ggaqf1	1490	9	Johnsongrass	Johnsongrass	NNP
cord-014462-11ggaqf1	1490	10	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1490	11	virus	virus	NN
cord-014462-11ggaqf1	1490	12	(	(	-LRB-
cord-014462-11ggaqf1	1490	13	JGMV	JGMV	NNP
cord-014462-11ggaqf1	1490	14	)	)	-RRB-
cord-014462-11ggaqf1	1490	15	were	be	VBD
cord-014462-11ggaqf1	1490	16	not	not	RB
cord-014462-11ggaqf1	1490	17	detected	detect	VBN
cord-014462-11ggaqf1	1490	18	in	in	IN
cord-014462-11ggaqf1	1490	19	any	any	DT
cord-014462-11ggaqf1	1490	20	of	of	IN
cord-014462-11ggaqf1	1490	21	the	the	DT
cord-014462-11ggaqf1	1490	22	samples	sample	NNS
cord-014462-11ggaqf1	1490	23	tested	test	VBN
cord-014462-11ggaqf1	1490	24	.	.	.
cord-014462-11ggaqf1	1491	1	A	a	DT
cord-014462-11ggaqf1	1491	2	strong	strong	JJ
cord-014462-11ggaqf1	1491	3	correlation	correlation	NN
cord-014462-11ggaqf1	1491	4	was	be	VBD
cord-014462-11ggaqf1	1491	5	observed	observe	VBN
cord-014462-11ggaqf1	1491	6	between	between	IN
cord-014462-11ggaqf1	1491	7	the	the	DT
cord-014462-11ggaqf1	1491	8	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1491	9	groups	group	NNS
cord-014462-11ggaqf1	1491	10	and	and	CC
cord-014462-11ggaqf1	1491	11	the	the	DT
cord-014462-11ggaqf1	1491	12	geographical	geographical	JJ
cord-014462-11ggaqf1	1491	13	origin	origin	NN
cord-014462-11ggaqf1	1491	14	of	of	IN
cord-014462-11ggaqf1	1491	15	the	the	DT
cord-014462-11ggaqf1	1491	16	SCMV	SCMV	NNP
cord-014462-11ggaqf1	1491	17	isolates	isolate	NNS
cord-014462-11ggaqf1	1491	18	.	.	.
cord-014462-11ggaqf1	1492	1	The	the	DT
cord-014462-11ggaqf1	1492	2	11	11	CD
cord-014462-11ggaqf1	1492	3	millable	millable	NN
cord-014462-11ggaqf1	1492	4	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1492	5	samples	sample	NNS
cord-014462-11ggaqf1	1492	6	from	from	IN
cord-014462-11ggaqf1	1492	7	China	China	NNP
cord-014462-11ggaqf1	1492	8	contained	contain	VBD
cord-014462-11ggaqf1	1492	9	a	a	DT
cord-014462-11ggaqf1	1492	10	virus	virus	NN
cord-014462-11ggaqf1	1492	11	tentatively	tentatively	RB
cord-014462-11ggaqf1	1492	12	described	describe	VBN
cord-014462-11ggaqf1	1492	13	as	as	IN
cord-014462-11ggaqf1	1492	14	Sorghum	Sorghum	NNP
cord-014462-11ggaqf1	1492	15	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1492	16	virus	virus	NN
cord-014462-11ggaqf1	1492	17	(	(	-LRB-
cord-014462-11ggaqf1	1492	18	SrMV	SrMV	NNP
cord-014462-11ggaqf1	1492	19	)	)	-RRB-
cord-014462-11ggaqf1	1492	20	.	.	.
cord-014462-11ggaqf1	1493	1	Three	three	CD
cord-014462-11ggaqf1	1493	2	isolates	isolate	NNS
cord-014462-11ggaqf1	1493	3	from	from	IN
cord-014462-11ggaqf1	1493	4	nine	nine	CD
cord-014462-11ggaqf1	1493	5	chewing	chew	VBG
cord-014462-11ggaqf1	1493	6	canes	cane	NNS
cord-014462-11ggaqf1	1493	7	in	in	IN
cord-014462-11ggaqf1	1493	8	Fujian	Fujian	NNP
cord-014462-11ggaqf1	1493	9	,	,	,
cord-014462-11ggaqf1	1493	10	Yunnan	Yunnan	NNP
cord-014462-11ggaqf1	1493	11	and	and	CC
cord-014462-11ggaqf1	1493	12	Guizhou	Guizhou	NNP
cord-014462-11ggaqf1	1494	1	provinces	province	NNS
cord-014462-11ggaqf1	1494	2	of	of	IN
cord-014462-11ggaqf1	1494	3	China	China	NNP
cord-014462-11ggaqf1	1494	4	also	also	RB
cord-014462-11ggaqf1	1494	5	contained	contain	VBD
cord-014462-11ggaqf1	1494	6	SrMV	SrMV	NNP
cord-014462-11ggaqf1	1494	7	,	,	,
cord-014462-11ggaqf1	1494	8	and	and	CC
cord-014462-11ggaqf1	1494	9	the	the	DT
cord-014462-11ggaqf1	1494	10	other	other	JJ
cord-014462-11ggaqf1	1494	11	12	12	CD
cord-014462-11ggaqf1	1494	12	samples	sample	NNS
cord-014462-11ggaqf1	1494	13	including	include	VBG
cord-014462-11ggaqf1	1494	14	five	five	CD
cord-014462-11ggaqf1	1494	15	isolates	isolate	NNS
cord-014462-11ggaqf1	1494	16	from	from	IN
cord-014462-11ggaqf1	1494	17	India	India	NNP
cord-014462-11ggaqf1	1494	18	was	be	VBD
cord-014462-11ggaqf1	1494	19	found	find	VBN
cord-014462-11ggaqf1	1494	20	infected	infect	VBN
cord-014462-11ggaqf1	1494	21	with	with	IN
cord-014462-11ggaqf1	1494	22	SCMV	SCMV	NNP
cord-014462-11ggaqf1	1494	23	.	.	.
cord-014462-11ggaqf1	1495	1	No	no	DT
cord-014462-11ggaqf1	1495	2	SrMV	srmv	JJ
cord-014462-11ggaqf1	1495	3	infection	infection	NN
cord-014462-11ggaqf1	1495	4	has	have	VBZ
cord-014462-11ggaqf1	1495	5	been	be	VBN
cord-014462-11ggaqf1	1495	6	detected	detect	VBN
cord-014462-11ggaqf1	1495	7	in	in	IN
cord-014462-11ggaqf1	1495	8	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1495	9	mosaic	mosaic	NN
cord-014462-11ggaqf1	1495	10	samples	sample	NNS
cord-014462-11ggaqf1	1495	11	from	from	IN
cord-014462-11ggaqf1	1495	12	India	India	NNP
cord-014462-11ggaqf1	1495	13	.	.	.
cord-014462-11ggaqf1	1496	1	Sequence	sequence	NN
cord-014462-11ggaqf1	1496	2	comparisons	comparison	NNS
cord-014462-11ggaqf1	1496	3	and	and	CC
cord-014462-11ggaqf1	1496	4	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1496	5	analysis	analysis	NN
cord-014462-11ggaqf1	1496	6	indicated	indicate	VBD
cord-014462-11ggaqf1	1496	7	that	that	IN
cord-014462-11ggaqf1	1496	8	SrMV	SrMV	NNP
cord-014462-11ggaqf1	1496	9	can	can	MD
cord-014462-11ggaqf1	1496	10	be	be	VB
cord-014462-11ggaqf1	1496	11	considered	consider	VBN
cord-014462-11ggaqf1	1496	12	as	as	IN
cord-014462-11ggaqf1	1496	13	the	the	DT
cord-014462-11ggaqf1	1496	14	most	most	RBS
cord-014462-11ggaqf1	1496	15	common	common	JJ
cord-014462-11ggaqf1	1496	16	and	and	CC
cord-014462-11ggaqf1	1496	17	prevalent	prevalent	JJ
cord-014462-11ggaqf1	1496	18	potyvirus	potyvirus	NN
cord-014462-11ggaqf1	1496	19	infecting	infect	VBG
cord-014462-11ggaqf1	1496	20	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1496	21	in	in	IN
cord-014462-11ggaqf1	1496	22	China	China	NNP
cord-014462-11ggaqf1	1496	23	,	,	,
cord-014462-11ggaqf1	1496	24	however	however	RB
cord-014462-11ggaqf1	1496	25	in	in	IN
cord-014462-11ggaqf1	1496	26	India	India	NNP
cord-014462-11ggaqf1	1496	27	Sugarcane	Sugarcane	NNP
cord-014462-11ggaqf1	1496	28	streak	streak	NN
cord-014462-11ggaqf1	1496	29	mosaic	mosaic	NN
cord-014462-11ggaqf1	1496	30	virus	virus	NN
cord-014462-11ggaqf1	1496	31	is	be	VBZ
cord-014462-11ggaqf1	1496	32	dominant	dominant	JJ
cord-014462-11ggaqf1	1496	33	in	in	IN
cord-014462-11ggaqf1	1496	34	causing	cause	VBG
cord-014462-11ggaqf1	1496	35	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1496	36	symptoms	symptom	NNS
cord-014462-11ggaqf1	1496	37	on	on	IN
cord-014462-11ggaqf1	1496	38	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1496	39	.	.	.
cord-014462-11ggaqf1	1497	1	DIG	dig	VB
cord-014462-11ggaqf1	1497	2	-	-	HYPH
cord-014462-11ggaqf1	1497	3	labeled	label	VBN
cord-014462-11ggaqf1	1497	4	DNA	dna	NN
cord-014462-11ggaqf1	1497	5	probe	probe	NN
cord-014462-11ggaqf1	1497	6	complementary	complementary	JJ
cord-014462-11ggaqf1	1497	7	to	to	TO
cord-014462-11ggaqf1	1497	8	coat	coat	VB
cord-014462-11ggaqf1	1497	9	protein	protein	NN
cord-014462-11ggaqf1	1497	10	(	(	-LRB-
cord-014462-11ggaqf1	1497	11	CP	CP	NNP
cord-014462-11ggaqf1	1497	12	)	)	-RRB-
cord-014462-11ggaqf1	1497	13	region	region	NN
cord-014462-11ggaqf1	1497	14	of	of	IN
cord-014462-11ggaqf1	1497	15	Tobacco	Tobacco	NNP
cord-014462-11ggaqf1	1497	16	streak	streak	NN
cord-014462-11ggaqf1	1497	17	virus	virus	NN
cord-014462-11ggaqf1	1497	18	(	(	-LRB-
cord-014462-11ggaqf1	1497	19	TSV	TSV	NNP
cord-014462-11ggaqf1	1497	20	)	)	-RRB-
cord-014462-11ggaqf1	1498	1	Sunflower	sunflower	NN
cord-014462-11ggaqf1	1498	2	isolate	isolate	NN
cord-014462-11ggaqf1	1498	3	was	be	VBD
cord-014462-11ggaqf1	1498	4	designed	design	VBN
cord-014462-11ggaqf1	1498	5	for	for	IN
cord-014462-11ggaqf1	1498	6	the	the	DT
cord-014462-11ggaqf1	1498	7	sensitive	sensitive	JJ
cord-014462-11ggaqf1	1498	8	and	and	CC
cord-014462-11ggaqf1	1498	9	broad	broad	JJ
cord-014462-11ggaqf1	1498	10	-	-	HYPH
cord-014462-11ggaqf1	1498	11	spectrum	spectrum	NN
cord-014462-11ggaqf1	1498	12	detection	detection	NN
cord-014462-11ggaqf1	1498	13	of	of	IN
cord-014462-11ggaqf1	1498	14	TSV	TSV	NNP
cord-014462-11ggaqf1	1498	15	isolates	isolate	NNS
cord-014462-11ggaqf1	1498	16	,	,	,
cord-014462-11ggaqf1	1498	17	the	the	DT
cord-014462-11ggaqf1	1498	18	most	most	RBS
cord-014462-11ggaqf1	1498	19	devastating	devastating	JJ
cord-014462-11ggaqf1	1498	20	virus	virus	NN
cord-014462-11ggaqf1	1498	21	in	in	IN
cord-014462-11ggaqf1	1498	22	India	India	NNP
cord-014462-11ggaqf1	1498	23	.	.	.
cord-014462-11ggaqf1	1499	1	Dot	dot	NN
cord-014462-11ggaqf1	1499	2	-	-	HYPH
cord-014462-11ggaqf1	1499	3	blot	blot	NN
cord-014462-11ggaqf1	1499	4	and	and	CC
cord-014462-11ggaqf1	1499	5	tissue	tissue	NN
cord-014462-11ggaqf1	1499	6	print	print	NN
cord-014462-11ggaqf1	1499	7	hybridizations	hybridization	NNS
cord-014462-11ggaqf1	1499	8	with	with	IN
cord-014462-11ggaqf1	1499	9	the	the	DT
cord-014462-11ggaqf1	1499	10	digoxigenin	digoxigenin	NNP
cord-014462-11ggaqf1	1499	11	labeled	label	VBN
cord-014462-11ggaqf1	1499	12	probe	probe	NN
cord-014462-11ggaqf1	1499	13	were	be	VBD
cord-014462-11ggaqf1	1499	14	performed	perform	VBN
cord-014462-11ggaqf1	1499	15	for	for	IN
cord-014462-11ggaqf1	1499	16	the	the	DT
cord-014462-11ggaqf1	1499	17	TSV	TSV	NNP
cord-014462-11ggaqf1	1499	18	detection	detection	NN
cord-014462-11ggaqf1	1499	19	at	at	IN
cord-014462-11ggaqf1	1499	20	field	field	NN
cord-014462-11ggaqf1	1499	21	levels	level	NNS
cord-014462-11ggaqf1	1499	22	.	.	.
cord-014462-11ggaqf1	1500	1	Here	here	RB
cord-014462-11ggaqf1	1500	2	,	,	,
cord-014462-11ggaqf1	1500	3	dot	dot	NN
cord-014462-11ggaqf1	1500	4	-	-	HYPH
cord-014462-11ggaqf1	1500	5	blot	blot	NN
cord-014462-11ggaqf1	1500	6	hybridization	hybridization	NN
cord-014462-11ggaqf1	1500	7	was	be	VBD
cord-014462-11ggaqf1	1500	8	used	use	VBN
cord-014462-11ggaqf1	1500	9	to	to	TO
cord-014462-11ggaqf1	1500	10	check	check	VB
cord-014462-11ggaqf1	1500	11	a	a	DT
cord-014462-11ggaqf1	1500	12	wide	wide	JJ
cord-014462-11ggaqf1	1500	13	number	number	NN
cord-014462-11ggaqf1	1500	14	of	of	IN
cord-014462-11ggaqf1	1500	15	TSV	TSV	NNP
cord-014462-11ggaqf1	1500	16	isolates	isolate	VBZ
cord-014462-11ggaqf1	1500	17	with	with	IN
cord-014462-11ggaqf1	1500	18	a	a	DT
cord-014462-11ggaqf1	1500	19	single	single	JJ
cord-014462-11ggaqf1	1500	20	probe	probe	NN
cord-014462-11ggaqf1	1500	21	and	and	CC
cord-014462-11ggaqf1	1500	22	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1500	23	with	with	IN
cord-014462-11ggaqf1	1500	24	different	different	JJ
cord-014462-11ggaqf1	1500	25	sample	sample	NN
cord-014462-11ggaqf1	1500	26	extraction	extraction	NN
cord-014462-11ggaqf1	1500	27	methods	method	NNS
cord-014462-11ggaqf1	1500	28	.	.	.
cord-014462-11ggaqf1	1501	1	The	the	DT
cord-014462-11ggaqf1	1501	2	probe	probe	NN
cord-014462-11ggaqf1	1501	3	with	with	IN
cord-014462-11ggaqf1	1501	4	CP	CP	NNP
cord-014462-11ggaqf1	1501	5	conserved	conserve	VBN
cord-014462-11ggaqf1	1501	6	region	region	NN
cord-014462-11ggaqf1	1501	7	prepared	prepare	VBN
cord-014462-11ggaqf1	1501	8	from	from	IN
cord-014462-11ggaqf1	1501	9	sunflower	sunflower	NN
cord-014462-11ggaqf1	1501	10	PCR	PCR	NNP
cord-014462-11ggaqf1	1501	11	amplicon	amplicon	NN
cord-014462-11ggaqf1	1501	12	was	be	VBD
cord-014462-11ggaqf1	1501	13	hybridized	hybridize	VBN
cord-014462-11ggaqf1	1501	14	with	with	IN
cord-014462-11ggaqf1	1501	15	the	the	DT
cord-014462-11ggaqf1	1501	16	TSV	TSV	NNP
cord-014462-11ggaqf1	1501	17	field	field	NN
cord-014462-11ggaqf1	1501	18	isolates	isolate	NNS
cord-014462-11ggaqf1	1501	19	of	of	IN
cord-014462-11ggaqf1	1501	20	Gherkin	Gherkin	NNP
cord-014462-11ggaqf1	1501	21	,	,	,
cord-014462-11ggaqf1	1501	22	Pumpkin	Pumpkin	NNP
cord-014462-11ggaqf1	1501	23	,	,	,
cord-014462-11ggaqf1	1501	24	Sunflower	Sunflower	NNP
cord-014462-11ggaqf1	1501	25	,	,	,
cord-014462-11ggaqf1	1501	26	Marigold	Marigold	NNP
cord-014462-11ggaqf1	1501	27	and	and	CC
cord-014462-11ggaqf1	1501	28	Globe	Globe	NNP
cord-014462-11ggaqf1	1501	29	amaranth	amaranth	NN
cord-014462-11ggaqf1	1501	30	samples	sample	NNS
cord-014462-11ggaqf1	1501	31	because	because	IN
cord-014462-11ggaqf1	1501	32	of	of	IN
cord-014462-11ggaqf1	1501	33	highly	highly	RB
cord-014462-11ggaqf1	1501	34	conserved	conserve	VBN
cord-014462-11ggaqf1	1501	35	with	with	IN
cord-014462-11ggaqf1	1501	36	little	little	JJ
cord-014462-11ggaqf1	1501	37	variability	variability	NN
cord-014462-11ggaqf1	1501	38	in	in	IN
cord-014462-11ggaqf1	1501	39	CP	cp	NN
cord-014462-11ggaqf1	1501	40	region	region	NN
cord-014462-11ggaqf1	1501	41	.	.	.
cord-014462-11ggaqf1	1502	1	The	the	DT
cord-014462-11ggaqf1	1502	2	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1502	3	limits	limit	NNS
cord-014462-11ggaqf1	1502	4	were	be	VBD
cord-014462-11ggaqf1	1502	5	decreased	decrease	VBN
cord-014462-11ggaqf1	1502	6	from	from	IN
cord-014462-11ggaqf1	1502	7	total	total	JJ
cord-014462-11ggaqf1	1502	8	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1502	9	acid	acid	NN
cord-014462-11ggaqf1	1502	10	to	to	TO
cord-014462-11ggaqf1	1502	11	partially	partially	RB
cord-014462-11ggaqf1	1502	12	purified	purify	VBN
cord-014462-11ggaqf1	1502	13	and	and	CC
cord-014462-11ggaqf1	1502	14	crude	crude	JJ
cord-014462-11ggaqf1	1502	15	extract	extract	NN
cord-014462-11ggaqf1	1502	16	preparations	preparation	NNS
cord-014462-11ggaqf1	1502	17	.	.	.
cord-014462-11ggaqf1	1503	1	In	in	IN
cord-014462-11ggaqf1	1503	2	particular	particular	JJ
cord-014462-11ggaqf1	1503	3	,	,	,
cord-014462-11ggaqf1	1503	4	tissue	tissue	NN
cord-014462-11ggaqf1	1503	5	blot	blot	NN
cord-014462-11ggaqf1	1503	6	hybridization	hybridization	NN
cord-014462-11ggaqf1	1503	7	offers	offer	VBZ
cord-014462-11ggaqf1	1503	8	a	a	DT
cord-014462-11ggaqf1	1503	9	simple	simple	JJ
cord-014462-11ggaqf1	1503	10	,	,	,
cord-014462-11ggaqf1	1503	11	reliable	reliable	JJ
cord-014462-11ggaqf1	1503	12	procedure	procedure	NN
cord-014462-11ggaqf1	1503	13	as	as	IN
cord-014462-11ggaqf1	1503	14	dot	dot	NN
cord-014462-11ggaqf1	1503	15	-	-	HYPH
cord-014462-11ggaqf1	1503	16	blot	blot	NN
cord-014462-11ggaqf1	1503	17	,	,	,
cord-014462-11ggaqf1	1503	18	but	but	CC
cord-014462-11ggaqf1	1503	19	requires	require	VBZ
cord-014462-11ggaqf1	1503	20	no	no	DT
cord-014462-11ggaqf1	1503	21	sample	sample	NN
cord-014462-11ggaqf1	1503	22	processing	processing	NN
cord-014462-11ggaqf1	1503	23	.	.	.
cord-014462-11ggaqf1	1504	1	Because	because	IN
cord-014462-11ggaqf1	1504	2	there	there	EX
cord-014462-11ggaqf1	1504	3	is	be	VBZ
cord-014462-11ggaqf1	1504	4	minimal	minimal	JJ
cord-014462-11ggaqf1	1504	5	sample	sample	NN
cord-014462-11ggaqf1	1504	6	preparation	preparation	NN
cord-014462-11ggaqf1	1504	7	,	,	,
cord-014462-11ggaqf1	1504	8	tissue	tissue	NN
cord-014462-11ggaqf1	1504	9	-	-	HYPH
cord-014462-11ggaqf1	1504	10	print	print	NN
cord-014462-11ggaqf1	1504	11	hybridization	hybridization	NN
cord-014462-11ggaqf1	1504	12	could	could	MD
cord-014462-11ggaqf1	1504	13	be	be	VB
cord-014462-11ggaqf1	1504	14	an	an	DT
cord-014462-11ggaqf1	1504	15	important	important	JJ
cord-014462-11ggaqf1	1504	16	component	component	NN
cord-014462-11ggaqf1	1504	17	of	of	IN
cord-014462-11ggaqf1	1504	18	TSV	TSV	NNP
cord-014462-11ggaqf1	1504	19	management	management	NN
cord-014462-11ggaqf1	1504	20	programs	program	NNS
cord-014462-11ggaqf1	1504	21	.	.	.
cord-014462-11ggaqf1	1505	1	Thus	thus	RB
cord-014462-11ggaqf1	1505	2	,	,	,
cord-014462-11ggaqf1	1505	3	the	the	DT
cord-014462-11ggaqf1	1505	4	above	above	JJ
cord-014462-11ggaqf1	1505	5	non	non	JJ
cord-014462-11ggaqf1	1505	6	-	-	JJ
cord-014462-11ggaqf1	1505	7	radioactive	radioactive	JJ
cord-014462-11ggaqf1	1505	8	labeled	label	VBN
cord-014462-11ggaqf1	1505	9	probe	probe	NN
cord-014462-11ggaqf1	1505	10	techniques	technique	NNS
cord-014462-11ggaqf1	1505	11	can	can	MD
cord-014462-11ggaqf1	1505	12	facilitate	facilitate	VB
cord-014462-11ggaqf1	1505	13	in	in	IN
cord-014462-11ggaqf1	1505	14	screening	screen	VBG
cord-014462-11ggaqf1	1505	15	the	the	DT
cord-014462-11ggaqf1	1505	16	samples	sample	NNS
cord-014462-11ggaqf1	1505	17	during	during	IN
cord-014462-11ggaqf1	1505	18	TSV	TSV	NNP
cord-014462-11ggaqf1	1505	19	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	1505	20	and	and	CC
cord-014462-11ggaqf1	1505	21	in	in	IN
cord-014462-11ggaqf1	1505	22	quarantine	quarantine	NN
cord-014462-11ggaqf1	1505	23	services	service	NNS
cord-014462-11ggaqf1	1505	24	.	.	.
cord-014462-11ggaqf1	1506	1	Savita	Savita	NNP
cord-014462-11ggaqf1	1506	2	Patil	Patil	NNP
cord-014462-11ggaqf1	1506	3	,	,	,
cord-014462-11ggaqf1	1506	4	Rupali	Rupali	NNP
cord-014462-11ggaqf1	1506	5	Sawant	Sawant	NNP
cord-014462-11ggaqf1	1506	6	*	*	NFP
cord-014462-11ggaqf1	1506	7	,	,	,
cord-014462-11ggaqf1	1506	8	K.	K.	NNP
cord-014462-11ggaqf1	1506	9	Banerjee	Banerjee	NNP
cord-014462-11ggaqf1	1506	10	Virology	Virology	NNP
cord-014462-11ggaqf1	1506	11	Group	Group	NNP
cord-014462-11ggaqf1	1506	12	,	,	,
cord-014462-11ggaqf1	1506	13	Agharkar	Agharkar	NNP
cord-014462-11ggaqf1	1506	14	Research	Research	NNP
cord-014462-11ggaqf1	1506	15	Institute	Institute	NNP
cord-014462-11ggaqf1	1506	16	,	,	,
cord-014462-11ggaqf1	1506	17	MACS	MACS	NNP
cord-014462-11ggaqf1	1506	18	,	,	,
cord-014462-11ggaqf1	1506	19	G.G.	G.G.	NNP
cord-014462-11ggaqf1	1506	20	Agarkar	Agarkar	NNP
cord-014462-11ggaqf1	1506	21	Road	Road	NNP
cord-014462-11ggaqf1	1506	22	,	,	,
cord-014462-11ggaqf1	1506	23	Pune	Pune	NNP
cord-014462-11ggaqf1	1506	24	411	411	CD
cord-014462-11ggaqf1	1506	25	004	004	CD
cord-014462-11ggaqf1	1506	26	Two	two	CD
cord-014462-11ggaqf1	1506	27	Mycobacterium	Mycobacterium	NNP
cord-014462-11ggaqf1	1506	28	smegmatis	smegmatis	NN
cord-014462-11ggaqf1	1506	29	strains	strain	NNS
cord-014462-11ggaqf1	1506	30	(	(	-LRB-
cord-014462-11ggaqf1	1506	31	ARI	ARI	NNP
cord-014462-11ggaqf1	1506	32	Lab	Lab	NNP
cord-014462-11ggaqf1	1506	33	Nos	Nos	NNP
cord-014462-11ggaqf1	1506	34	.	.	.
cord-014462-11ggaqf1	1507	1	V842	V842	:
cord-014462-11ggaqf1	1507	2	and	and	CC
cord-014462-11ggaqf1	1507	3	V946	V946	NNP
cord-014462-11ggaqf1	1507	4	)	)	-RRB-
cord-014462-11ggaqf1	1507	5	were	be	VBD
cord-014462-11ggaqf1	1507	6	employed	employ	VBN
cord-014462-11ggaqf1	1507	7	for	for	IN
cord-014462-11ggaqf1	1507	8	the	the	DT
cord-014462-11ggaqf1	1507	9	isolation	isolation	NN
cord-014462-11ggaqf1	1507	10	of	of	IN
cord-014462-11ggaqf1	1507	11	mycobacteriophages	mycobacteriophage	NNS
cord-014462-11ggaqf1	1507	12	from	from	IN
cord-014462-11ggaqf1	1507	13	soil	soil	NN
cord-014462-11ggaqf1	1507	14	and	and	CC
cord-014462-11ggaqf1	1507	15	sewage	sewage	NN
cord-014462-11ggaqf1	1507	16	samples	sample	NNS
cord-014462-11ggaqf1	1507	17	.	.	.
cord-014462-11ggaqf1	1508	1	Mycobacteriophages	mycobacteriophage	NNS
cord-014462-11ggaqf1	1508	2	were	be	VBD
cord-014462-11ggaqf1	1508	3	isolated	isolate	VBN
cord-014462-11ggaqf1	1508	4	from	from	IN
cord-014462-11ggaqf1	1508	5	soil	soil	NN
cord-014462-11ggaqf1	1508	6	samples	sample	NNS
cord-014462-11ggaqf1	1508	7	collected	collect	VBN
cord-014462-11ggaqf1	1508	8	from	from	IN
cord-014462-11ggaqf1	1508	9	an	an	DT
cord-014462-11ggaqf1	1508	10	area	area	NN
cord-014462-11ggaqf1	1508	11	surrounding	surround	VBG
cord-014462-11ggaqf1	1508	12	the	the	DT
cord-014462-11ggaqf1	1508	13	Tuberculosis	Tuberculosis	NNP
cord-014462-11ggaqf1	1508	14	(	(	-LRB-
cord-014462-11ggaqf1	1508	15	TB	TB	NNP
cord-014462-11ggaqf1	1508	16	)	)	-RRB-
cord-014462-11ggaqf1	1508	17	ward	ward	NNP
cord-014462-11ggaqf1	1508	18	,	,	,
cord-014462-11ggaqf1	1508	19	Naidu	Naidu	NNP
cord-014462-11ggaqf1	1508	20	hospital	hospital	NN
cord-014462-11ggaqf1	1508	21	,	,	,
cord-014462-11ggaqf1	1508	22	Pune	Pune	NNP
cord-014462-11ggaqf1	1508	23	,	,	,
cord-014462-11ggaqf1	1508	24	against	against	IN
cord-014462-11ggaqf1	1508	25	M.	M.	NNP
cord-014462-11ggaqf1	1508	26	smegmatis	smegmatis	NN
cord-014462-11ggaqf1	1508	27	strain	strain	NN
cord-014462-11ggaqf1	1508	28	V842	V842	NFP
cord-014462-11ggaqf1	1508	29	.	.	.
cord-014462-11ggaqf1	1509	1	These	these	DT
cord-014462-11ggaqf1	1509	2	were	be	VBD
cord-014462-11ggaqf1	1509	3	numbered	number	VBN
cord-014462-11ggaqf1	1509	4	as	as	IN
cord-014462-11ggaqf1	1509	5	V942	V942	NNP
cord-014462-11ggaqf1	1509	6	,	,	,
cord-014462-11ggaqf1	1509	7	V943	V943	NNP
cord-014462-11ggaqf1	1509	8	and	and	CC
cord-014462-11ggaqf1	1509	9	V944	v944	NN
cord-014462-11ggaqf1	1509	10	and	and	CC
cord-014462-11ggaqf1	1509	11	were	be	VBD
cord-014462-11ggaqf1	1509	12	isolated	isolate	VBN
cord-014462-11ggaqf1	1509	13	by	by	IN
cord-014462-11ggaqf1	1509	14	using	use	VBG
cord-014462-11ggaqf1	1509	15	washed	wash	VBN
cord-014462-11ggaqf1	1509	16	-	-	HYPH
cord-014462-11ggaqf1	1509	17	cell	cell	NN
cord-014462-11ggaqf1	1509	18	preparation	preparation	NN
cord-014462-11ggaqf1	1509	19	method	method	NN
cord-014462-11ggaqf1	1509	20	.	.	.
cord-014462-11ggaqf1	1510	1	The	the	DT
cord-014462-11ggaqf1	1510	2	Bacteriophages	Bacteriophages	NNPS
cord-014462-11ggaqf1	1510	3	against	against	IN
cord-014462-11ggaqf1	1510	4	the	the	DT
cord-014462-11ggaqf1	1510	5	other	other	JJ
cord-014462-11ggaqf1	1510	6	M.	M.	NNP
cord-014462-11ggaqf1	1510	7	smegmatis	smegmatis	NN
cord-014462-11ggaqf1	1510	8	strain	strain	NN
cord-014462-11ggaqf1	1510	9	,	,	,
cord-014462-11ggaqf1	1510	10	i.e.	i.e.	FW
cord-014462-11ggaqf1	1510	11	V946	V946	NNP
cord-014462-11ggaqf1	1510	12	,	,	,
cord-014462-11ggaqf1	1510	13	were	be	VBD
cord-014462-11ggaqf1	1510	14	isolated	isolate	VBN
cord-014462-11ggaqf1	1510	15	from	from	IN
cord-014462-11ggaqf1	1510	16	soil	soil	NN
cord-014462-11ggaqf1	1510	17	samples	sample	NNS
cord-014462-11ggaqf1	1510	18	(	(	-LRB-
cord-014462-11ggaqf1	1510	19	collected	collect	VBN
cord-014462-11ggaqf1	1510	20	from	from	IN
cord-014462-11ggaqf1	1510	21	around	around	IN
cord-014462-11ggaqf1	1510	22	TB	TB	NNP
cord-014462-11ggaqf1	1510	23	ward	ward	NN
cord-014462-11ggaqf1	1510	24	,	,	,
cord-014462-11ggaqf1	1510	25	Sassoon	Sassoon	NNP
cord-014462-11ggaqf1	1510	26	hospital	hospital	NN
cord-014462-11ggaqf1	1510	27	,	,	,
cord-014462-11ggaqf1	1510	28	Pune	Pune	NNP
cord-014462-11ggaqf1	1510	29	)	)	-RRB-
cord-014462-11ggaqf1	1510	30	.	.	.
cord-014462-11ggaqf1	1511	1	Some	some	DT
cord-014462-11ggaqf1	1511	2	of	of	IN
cord-014462-11ggaqf1	1511	3	these	these	DT
cord-014462-11ggaqf1	1511	4	phages	phage	NNS
cord-014462-11ggaqf1	1511	5	(	(	-LRB-
cord-014462-11ggaqf1	1511	6	viz	viz	NN
cord-014462-11ggaqf1	1511	7	.	.	.
cord-014462-11ggaqf1	1512	1	V953	V953	NNP
cord-014462-11ggaqf1	1512	2	,	,	,
cord-014462-11ggaqf1	1512	3	V954	V954	NNP
cord-014462-11ggaqf1	1512	4	)	)	-RRB-
cord-014462-11ggaqf1	1512	5	showed	show	VBD
cord-014462-11ggaqf1	1512	6	plaques	plaque	NNS
cord-014462-11ggaqf1	1512	7	at	at	IN
cord-014462-11ggaqf1	1512	8	42	42	CD
cord-014462-11ggaqf1	1512	9	°	°	NN
cord-014462-11ggaqf1	1512	10	C	c	NN
cord-014462-11ggaqf1	1512	11	but	but	CC
cord-014462-11ggaqf1	1512	12	not	not	RB
cord-014462-11ggaqf1	1512	13	at	at	IN
cord-014462-11ggaqf1	1512	14	37	37	CD
cord-014462-11ggaqf1	1512	15	°	°	NN
cord-014462-11ggaqf1	1512	16	C	c	NN
cord-014462-11ggaqf1	1512	17	.	.	.
cord-014462-11ggaqf1	1513	1	Thus	thus	RB
cord-014462-11ggaqf1	1513	2	they	-PRON-	PRP
cord-014462-11ggaqf1	1513	3	seem	seem	VBP
cord-014462-11ggaqf1	1513	4	to	to	TO
cord-014462-11ggaqf1	1513	5	be	be	VB
cord-014462-11ggaqf1	1513	6	lysogenic	lysogenic	JJ
cord-014462-11ggaqf1	1513	7	.	.	.
cord-014462-11ggaqf1	1514	1	For	for	IN
cord-014462-11ggaqf1	1514	2	propagating	propagate	VBG
cord-014462-11ggaqf1	1514	3	and	and	CC
cord-014462-11ggaqf1	1514	4	increasing	increase	VBG
cord-014462-11ggaqf1	1514	5	the	the	DT
cord-014462-11ggaqf1	1514	6	titre	titre	NN
cord-014462-11ggaqf1	1514	7	of	of	IN
cord-014462-11ggaqf1	1514	8	all	all	PDT
cord-014462-11ggaqf1	1514	9	the	the	DT
cord-014462-11ggaqf1	1514	10	above	above	JJ
cord-014462-11ggaqf1	1514	11	isolates	isolate	NNS
cord-014462-11ggaqf1	1514	12	,	,	,
cord-014462-11ggaqf1	1514	13	various	various	JJ
cord-014462-11ggaqf1	1514	14	previously	previously	RB
cord-014462-11ggaqf1	1514	15	described	describe	VBN
cord-014462-11ggaqf1	1514	16	methods	method	NNS
cord-014462-11ggaqf1	1514	17	were	be	VBD
cord-014462-11ggaqf1	1514	18	attempted	attempt	VBN
cord-014462-11ggaqf1	1514	19	,	,	,
cord-014462-11ggaqf1	1514	20	but	but	CC
cord-014462-11ggaqf1	1514	21	none	none	NN
cord-014462-11ggaqf1	1514	22	of	of	IN
cord-014462-11ggaqf1	1514	23	these	these	DT
cord-014462-11ggaqf1	1514	24	methods	method	NNS
cord-014462-11ggaqf1	1514	25	were	be	VBD
cord-014462-11ggaqf1	1514	26	satisfactory	satisfactory	JJ
cord-014462-11ggaqf1	1514	27	.	.	.
cord-014462-11ggaqf1	1515	1	But	but	CC
cord-014462-11ggaqf1	1515	2	when	when	WRB
cord-014462-11ggaqf1	1515	3	siliconized	siliconized	NNP
cord-014462-11ggaqf1	1515	4	glassware	glassware	NN
cord-014462-11ggaqf1	1515	5	and	and	CC
cord-014462-11ggaqf1	1515	6	plastic	plastic	NN
cord-014462-11ggaqf1	1515	7	-	-	HYPH
cord-014462-11ggaqf1	1515	8	ware	ware	NN
cord-014462-11ggaqf1	1515	9	were	be	VBD
cord-014462-11ggaqf1	1515	10	used	use	VBN
cord-014462-11ggaqf1	1515	11	,	,	,
cord-014462-11ggaqf1	1515	12	propagation	propagation	NN
cord-014462-11ggaqf1	1515	13	was	be	VBD
cord-014462-11ggaqf1	1515	14	successful	successful	JJ
cord-014462-11ggaqf1	1515	15	.	.	.
cord-014462-11ggaqf1	1516	1	We	-PRON-	PRP
cord-014462-11ggaqf1	1516	2	showed	show	VBD
cord-014462-11ggaqf1	1516	3	that	that	IN
cord-014462-11ggaqf1	1516	4	siliconization	siliconization	NN
cord-014462-11ggaqf1	1516	5	of	of	IN
cord-014462-11ggaqf1	1516	6	glassware	glassware	NN
cord-014462-11ggaqf1	1516	7	and	and	CC
cord-014462-11ggaqf1	1516	8	plastic	plastic	NN
cord-014462-11ggaqf1	1516	9	-	-	HYPH
cord-014462-11ggaqf1	1516	10	ware	ware	NN
cord-014462-11ggaqf1	1516	11	was	be	VBD
cord-014462-11ggaqf1	1516	12	essential	essential	JJ
cord-014462-11ggaqf1	1516	13	for	for	IN
cord-014462-11ggaqf1	1516	14	the	the	DT
cord-014462-11ggaqf1	1516	15	propagation	propagation	NN
cord-014462-11ggaqf1	1516	16	of	of	IN
cord-014462-11ggaqf1	1516	17	our	-PRON-	PRP$
cord-014462-11ggaqf1	1516	18	mycobacteriophage	mycobacteriophage	NN
cord-014462-11ggaqf1	1516	19	isolates	isolate	NNS
cord-014462-11ggaqf1	1516	20	V951	V951	NNP
cord-014462-11ggaqf1	1516	21	,	,	,
cord-014462-11ggaqf1	1516	22	V952	V952	NNS
cord-014462-11ggaqf1	1516	23	,	,	,
cord-014462-11ggaqf1	1516	24	V953	V953	NNS
cord-014462-11ggaqf1	1516	25	,	,	,
cord-014462-11ggaqf1	1516	26	V954	V954	NNP
cord-014462-11ggaqf1	1516	27	and	and	CC
cord-014462-11ggaqf1	1516	28	V955	v955	NN
cord-014462-11ggaqf1	1516	29	.	.	.
cord-014462-11ggaqf1	1517	1	Also	also	RB
cord-014462-11ggaqf1	1517	2	,	,	,
cord-014462-11ggaqf1	1517	3	phage	phage	NN
cord-014462-11ggaqf1	1517	4	dilution	dilution	NN
cord-014462-11ggaqf1	1517	5	medium	medium	NN
cord-014462-11ggaqf1	1517	6	(	(	-LRB-
cord-014462-11ggaqf1	1517	7	PDM	PDM	NNP
cord-014462-11ggaqf1	1517	8	)	)	-RRB-
cord-014462-11ggaqf1	1517	9	as	as	IN
cord-014462-11ggaqf1	1517	10	described	describe	VBN
cord-014462-11ggaqf1	1517	11	by	by	IN
cord-014462-11ggaqf1	1517	12	Chaterjee	Chaterjee	NNP
cord-014462-11ggaqf1	1517	13	et	et	NNP
cord-014462-11ggaqf1	1517	14	al	al	NNP
cord-014462-11ggaqf1	1517	15	.	.	.
cord-014462-11ggaqf1	1518	1	(	(	-LRB-
cord-014462-11ggaqf1	1518	2	2000	2000	CD
cord-014462-11ggaqf1	1518	3	)	)	-RRB-
cord-014462-11ggaqf1	1518	4	was	be	VBD
cord-014462-11ggaqf1	1518	5	found	find	VBN
cord-014462-11ggaqf1	1518	6	to	to	TO
cord-014462-11ggaqf1	1518	7	be	be	VB
cord-014462-11ggaqf1	1518	8	effective	effective	JJ
cord-014462-11ggaqf1	1518	9	for	for	IN
cord-014462-11ggaqf1	1518	10	picking	pick	VBG
cord-014462-11ggaqf1	1518	11	out	out	IN
cord-014462-11ggaqf1	1518	12	of	of	IN
cord-014462-11ggaqf1	1518	13	the	the	DT
cord-014462-11ggaqf1	1518	14	plaques	plaque	NNS
cord-014462-11ggaqf1	1518	15	made	make	VBN
cord-014462-11ggaqf1	1518	16	by	by	IN
cord-014462-11ggaqf1	1518	17	the	the	DT
cord-014462-11ggaqf1	1518	18	phages	phage	NNS
cord-014462-11ggaqf1	1518	19	.	.	.
cord-014462-11ggaqf1	1519	1	In	in	IN
cord-014462-11ggaqf1	1519	2	this	this	DT
cord-014462-11ggaqf1	1519	3	way	way	NN
cord-014462-11ggaqf1	1519	4	,	,	,
cord-014462-11ggaqf1	1519	5	the	the	DT
cord-014462-11ggaqf1	1519	6	phage	phage	NN
cord-014462-11ggaqf1	1519	7	isolates	isolate	NNS
cord-014462-11ggaqf1	1519	8	were	be	VBD
cord-014462-11ggaqf1	1519	9	propagated	propagate	VBN
cord-014462-11ggaqf1	1519	10	up	up	IN
cord-014462-11ggaqf1	1519	11	to	to	IN
cord-014462-11ggaqf1	1519	12	P	p	NN
cord-014462-11ggaqf1	1519	13	3	3	CD
cord-014462-11ggaqf1	1519	14	.	.	.
cord-014462-11ggaqf1	1520	1	The	the	DT
cord-014462-11ggaqf1	1520	2	various	various	JJ
cord-014462-11ggaqf1	1520	3	passages	passage	NNS
cord-014462-11ggaqf1	1520	4	of	of	IN
cord-014462-11ggaqf1	1520	5	the	the	DT
cord-014462-11ggaqf1	1520	6	phage	phage	NN
cord-014462-11ggaqf1	1520	7	isolates	isolate	NNS
cord-014462-11ggaqf1	1520	8	V951	V951	NNP
cord-014462-11ggaqf1	1520	9	,	,	,
cord-014462-11ggaqf1	1520	10	V952	V952	NNS
cord-014462-11ggaqf1	1520	11	,	,	,
cord-014462-11ggaqf1	1520	12	V953	V953	NNS
cord-014462-11ggaqf1	1520	13	,	,	,
cord-014462-11ggaqf1	1520	14	V954	V954	NNP
cord-014462-11ggaqf1	1520	15	and	and	CC
cord-014462-11ggaqf1	1520	16	V955	v955	NN
cord-014462-11ggaqf1	1521	1	(	(	-LRB-
cord-014462-11ggaqf1	1521	2	i.e.	i.e.	FW
cord-014462-11ggaqf1	1521	3	original	original	JJ
cord-014462-11ggaqf1	1521	4	,	,	,
cord-014462-11ggaqf1	1521	5	P	p	NN
cord-014462-11ggaqf1	1521	6	1	1	CD
cord-014462-11ggaqf1	1521	7	,	,	,
cord-014462-11ggaqf1	1521	8	P	p	NN
cord-014462-11ggaqf1	1521	9	2	2	CD
cord-014462-11ggaqf1	1521	10	and	and	CC
cord-014462-11ggaqf1	1521	11	P	p	NN
cord-014462-11ggaqf1	1521	12	3	3	CD
cord-014462-11ggaqf1	1521	13	)	)	-RRB-
cord-014462-11ggaqf1	1521	14	were	be	VBD
cord-014462-11ggaqf1	1521	15	stored	store	VBN
cord-014462-11ggaqf1	1521	16	at	at	IN
cord-014462-11ggaqf1	1521	17	-80	-80	NNP
cord-014462-11ggaqf1	1521	18	°	°	NN
cord-014462-11ggaqf1	1521	19	C	C	NNP
cord-014462-11ggaqf1	1521	20	.	.	.
cord-014462-11ggaqf1	1522	1	PVP-29	pvp-29	NN
cord-014462-11ggaqf1	1523	1	Effect	effect	NN
cord-014462-11ggaqf1	1523	2	on	on	IN
cord-014462-11ggaqf1	1523	3	Pigments	pigment	NNS
cord-014462-11ggaqf1	1524	1	Due	due	IN
cord-014462-11ggaqf1	1524	2	to	to	IN
cord-014462-11ggaqf1	1524	3	Geminivirus	Geminivirus	NNP
cord-014462-11ggaqf1	1524	4	Infection	Infection	NNP
cord-014462-11ggaqf1	1524	5	on	on	IN
cord-014462-11ggaqf1	1524	6	Cowpea	Cowpea	NNP
cord-014462-11ggaqf1	1524	7	(	(	-LRB-
cord-014462-11ggaqf1	1524	8	Vigna	Vigna	NNP
cord-014462-11ggaqf1	1524	9	unguiculata	unguiculata	NNP
cord-014462-11ggaqf1	1524	10	)	)	-RRB-
cord-014462-11ggaqf1	1525	1	Shail	Shail	NNP
cord-014462-11ggaqf1	1525	2	Pande	Pande	NNP
cord-014462-11ggaqf1	1525	3	*	*	NFP
cord-014462-11ggaqf1	1525	4	,	,	,
cord-014462-11ggaqf1	1525	5	Naveen	Naveen	NNP
cord-014462-11ggaqf1	1525	6	Pandey	Pandey	NNP
cord-014462-11ggaqf1	1525	7	,	,	,
cord-014462-11ggaqf1	1525	8	K.	K.	NNP
cord-014462-11ggaqf1	1525	9	Shukla	Shukla	NNP
cord-014462-11ggaqf1	1525	10	Mahatma	Mahatma	NNP
cord-014462-11ggaqf1	1525	11	Gandhi	Gandhi	NNP
cord-014462-11ggaqf1	1525	12	P.	P.	NNP
cord-014462-11ggaqf1	1525	13	G.	G.	NNP
cord-014462-11ggaqf1	1525	14	College	College	NNP
cord-014462-11ggaqf1	1525	15	Gorakhpur	Gorakhpur	NNP
cord-014462-11ggaqf1	1525	16	,	,	,
cord-014462-11ggaqf1	1525	17	D.D.U.	D.D.U.	NNP
cord-014462-11ggaqf1	1525	18	Gorakhpur	Gorakhpur	NNP
cord-014462-11ggaqf1	1525	19	University	University	NNP
cord-014462-11ggaqf1	1526	1	,	,	,
cord-014462-11ggaqf1	1526	2	Gorakhpur	Gorakhpur	NNP
cord-014462-11ggaqf1	1526	3	Geminiviruses	Geminiviruses	NNP
cord-014462-11ggaqf1	1526	4	are	be	VBP
cord-014462-11ggaqf1	1526	5	one	one	CD
cord-014462-11ggaqf1	1526	6	of	of	IN
cord-014462-11ggaqf1	1526	7	the	the	DT
cord-014462-11ggaqf1	1526	8	most	most	RBS
cord-014462-11ggaqf1	1526	9	important	important	JJ
cord-014462-11ggaqf1	1526	10	group	group	NN
cord-014462-11ggaqf1	1526	11	of	of	IN
cord-014462-11ggaqf1	1526	12	viruses	virus	NNS
cord-014462-11ggaqf1	1526	13	causing	cause	VBG
cord-014462-11ggaqf1	1526	14	economic	economic	JJ
cord-014462-11ggaqf1	1526	15	losses	loss	NNS
cord-014462-11ggaqf1	1526	16	in	in	IN
cord-014462-11ggaqf1	1526	17	tropics	tropic	NNS
cord-014462-11ggaqf1	1526	18	.	.	.
cord-014462-11ggaqf1	1527	1	The	the	DT
cord-014462-11ggaqf1	1527	2	symptom	symptom	NN
cord-014462-11ggaqf1	1527	3	produced	produce	VBN
cord-014462-11ggaqf1	1527	4	are	be	VBP
cord-014462-11ggaqf1	1527	5	yellowing	yellow	VBG
cord-014462-11ggaqf1	1527	6	of	of	IN
cord-014462-11ggaqf1	1527	7	leaves	leave	NNS
cord-014462-11ggaqf1	1527	8	which	which	WDT
cord-014462-11ggaqf1	1527	9	directly	directly	RB
cord-014462-11ggaqf1	1527	10	affect	affect	VBP
cord-014462-11ggaqf1	1527	11	the	the	DT
cord-014462-11ggaqf1	1527	12	pigments	pigment	NNS
cord-014462-11ggaqf1	1527	13	of	of	IN
cord-014462-11ggaqf1	1527	14	diseased	diseased	JJ
cord-014462-11ggaqf1	1527	15	plants	plant	NNS
cord-014462-11ggaqf1	1527	16	it	-PRON-	PRP
cord-014462-11ggaqf1	1527	17	in	in	IN
cord-014462-11ggaqf1	1527	18	turn	turn	NN
cord-014462-11ggaqf1	1527	19	affects	affect	VBZ
cord-014462-11ggaqf1	1527	20	productivity	productivity	NN
cord-014462-11ggaqf1	1527	21	and	and	CC
cord-014462-11ggaqf1	1527	22	yield	yield	NN
cord-014462-11ggaqf1	1527	23	of	of	IN
cord-014462-11ggaqf1	1527	24	diseased	diseased	JJ
cord-014462-11ggaqf1	1527	25	plant	plant	NN
cord-014462-11ggaqf1	1527	26	.	.	.
cord-014462-11ggaqf1	1528	1	Cowpea	Cowpea	NNP
cord-014462-11ggaqf1	1528	2	Vigna	Vigna	NNP
cord-014462-11ggaqf1	1528	3	unguiculata	unguiculata	NN
cord-014462-11ggaqf1	1528	4	is	be	VBZ
cord-014462-11ggaqf1	1528	5	one	one	CD
cord-014462-11ggaqf1	1528	6	of	of	IN
cord-014462-11ggaqf1	1528	7	the	the	DT
cord-014462-11ggaqf1	1528	8	important	important	JJ
cord-014462-11ggaqf1	1528	9	crop	crop	NN
cord-014462-11ggaqf1	1528	10	cultivated	cultivate	VBN
cord-014462-11ggaqf1	1528	11	throughout	throughout	IN
cord-014462-11ggaqf1	1528	12	India	India	NNP
cord-014462-11ggaqf1	1528	13	for	for	IN
cord-014462-11ggaqf1	1528	14	its	-PRON-	PRP$
cord-014462-11ggaqf1	1528	15	green	green	JJ
cord-014462-11ggaqf1	1528	16	pods	pod	NNS
cord-014462-11ggaqf1	1528	17	which	which	WDT
cord-014462-11ggaqf1	1528	18	are	be	VBP
cord-014462-11ggaqf1	1528	19	used	use	VBN
cord-014462-11ggaqf1	1528	20	as	as	IN
cord-014462-11ggaqf1	1528	21	vegetables	vegetable	NNS
cord-014462-11ggaqf1	1528	22	and	and	CC
cord-014462-11ggaqf1	1528	23	seeds	seed	NNS
cord-014462-11ggaqf1	1528	24	are	be	VBP
cord-014462-11ggaqf1	1528	25	used	use	VBN
cord-014462-11ggaqf1	1528	26	as	as	IN
cord-014462-11ggaqf1	1528	27	pulse	pulse	NN
cord-014462-11ggaqf1	1528	28	.	.	.
cord-014462-11ggaqf1	1529	1	Cowpea	Cowpea	NNP
cord-014462-11ggaqf1	1529	2	is	be	VBZ
cord-014462-11ggaqf1	1529	3	affected	affect	VBN
cord-014462-11ggaqf1	1529	4	by	by	IN
cord-014462-11ggaqf1	1529	5	many	many	JJ
cord-014462-11ggaqf1	1529	6	viruses	virus	NNS
cord-014462-11ggaqf1	1529	7	amongst	amongst	IN
cord-014462-11ggaqf1	1529	8	them	-PRON-	PRP
cord-014462-11ggaqf1	1529	9	geminiviruses	geminiviruse	NNS
cord-014462-11ggaqf1	1529	10	are	be	VBP
cord-014462-11ggaqf1	1529	11	one	one	CD
cord-014462-11ggaqf1	1529	12	of	of	IN
cord-014462-11ggaqf1	1529	13	the	the	DT
cord-014462-11ggaqf1	1529	14	important	important	JJ
cord-014462-11ggaqf1	1529	15	virus	virus	NN
cord-014462-11ggaqf1	1529	16	on	on	IN
cord-014462-11ggaqf1	1529	17	the	the	DT
cord-014462-11ggaqf1	1529	18	cowpea	cowpea	NN
cord-014462-11ggaqf1	1529	19	plant	plant	NN
cord-014462-11ggaqf1	1529	20	.	.	.
cord-014462-11ggaqf1	1530	1	In	in	IN
cord-014462-11ggaqf1	1530	2	the	the	DT
cord-014462-11ggaqf1	1530	3	present	present	JJ
cord-014462-11ggaqf1	1530	4	study	study	NN
cord-014462-11ggaqf1	1530	5	total	total	JJ
cord-014462-11ggaqf1	1530	6	chlorophyll	chlorophyll	NN
cord-014462-11ggaqf1	1530	7	content	content	NN
cord-014462-11ggaqf1	1530	8	was	be	VBD
cord-014462-11ggaqf1	1530	9	studied	study	VBN
cord-014462-11ggaqf1	1530	10	in	in	IN
cord-014462-11ggaqf1	1530	11	leaf	leaf	NN
cord-014462-11ggaqf1	1530	12	of	of	IN
cord-014462-11ggaqf1	1530	13	cowpea	cowpea	NN
cord-014462-11ggaqf1	1530	14	of	of	IN
cord-014462-11ggaqf1	1530	15	diseased	diseased	JJ
cord-014462-11ggaqf1	1530	16	and	and	CC
cord-014462-11ggaqf1	1530	17	healthy	healthy	JJ
cord-014462-11ggaqf1	1530	18	plants	plant	NNS
cord-014462-11ggaqf1	1530	19	using	use	VBG
cord-014462-11ggaqf1	1530	20	Arnon	Arnon	NNP
cord-014462-11ggaqf1	1530	21	's	's	POS
cord-014462-11ggaqf1	1530	22	method	method	NN
cord-014462-11ggaqf1	1530	23	.	.	.
cord-014462-11ggaqf1	1531	1	Carotenoids	carotenoid	NNS
cord-014462-11ggaqf1	1531	2	were	be	VBD
cord-014462-11ggaqf1	1531	3	also	also	RB
cord-014462-11ggaqf1	1531	4	studied	study	VBN
cord-014462-11ggaqf1	1531	5	using	use	VBG
cord-014462-11ggaqf1	1531	6	Ikan	Ikan	NNP
cord-014462-11ggaqf1	1531	7	's	's	POS
cord-014462-11ggaqf1	1531	8	method	method	NN
cord-014462-11ggaqf1	1531	9	.	.	.
cord-014462-11ggaqf1	1532	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1532	2	was	be	VBD
cord-014462-11ggaqf1	1532	3	found	find	VBN
cord-014462-11ggaqf1	1532	4	that	that	IN
cord-014462-11ggaqf1	1532	5	chlorophyll	chlorophyll	NN
cord-014462-11ggaqf1	1532	6	content	content	NN
cord-014462-11ggaqf1	1532	7	in	in	IN
cord-014462-11ggaqf1	1532	8	diseased	diseased	JJ
cord-014462-11ggaqf1	1532	9	plants	plant	NNS
cord-014462-11ggaqf1	1532	10	were	be	VBD
cord-014462-11ggaqf1	1532	11	lower	low	JJR
cord-014462-11ggaqf1	1532	12	compared	compare	VBN
cord-014462-11ggaqf1	1532	13	to	to	IN
cord-014462-11ggaqf1	1532	14	healthy	healthy	JJ
cord-014462-11ggaqf1	1532	15	plant	plant	NN
cord-014462-11ggaqf1	1532	16	similar	similar	JJ
cord-014462-11ggaqf1	1532	17	results	result	NNS
cord-014462-11ggaqf1	1532	18	were	be	VBD
cord-014462-11ggaqf1	1532	19	found	find	VBN
cord-014462-11ggaqf1	1532	20	with	with	IN
cord-014462-11ggaqf1	1532	21	carotenoids	carotenoid	NNS
cord-014462-11ggaqf1	1532	22	so	so	IN
cord-014462-11ggaqf1	1532	23	the	the	DT
cord-014462-11ggaqf1	1532	24	geminivirruses	geminivirruse	NNS
cord-014462-11ggaqf1	1532	25	infection	infection	NN
cord-014462-11ggaqf1	1532	26	lowers	lower	VBZ
cord-014462-11ggaqf1	1532	27	the	the	DT
cord-014462-11ggaqf1	1532	28	chlorophyll	chlorophyll	NN
cord-014462-11ggaqf1	1532	29	and	and	CC
cord-014462-11ggaqf1	1532	30	carotenoid	carotenoid	NN
cord-014462-11ggaqf1	1532	31	content	content	NN
cord-014462-11ggaqf1	1532	32	in	in	IN
cord-014462-11ggaqf1	1532	33	diseased	diseased	JJ
cord-014462-11ggaqf1	1532	34	plants	plant	NNS
cord-014462-11ggaqf1	1532	35	which	which	WDT
cord-014462-11ggaqf1	1532	36	reduces	reduce	VBZ
cord-014462-11ggaqf1	1532	37	yield	yield	NN
cord-014462-11ggaqf1	1532	38	of	of	IN
cord-014462-11ggaqf1	1532	39	diseased	diseased	JJ
cord-014462-11ggaqf1	1532	40	cowpea	cowpea	NN
cord-014462-11ggaqf1	1532	41	plant	plant	NN
cord-014462-11ggaqf1	1532	42	.	.	.
cord-014462-11ggaqf1	1533	1	Shweta	Shweta	NNP
cord-014462-11ggaqf1	1533	2	Sharma	Sharma	NNP
cord-014462-11ggaqf1	1533	3	1	1	CD
cord-014462-11ggaqf1	1533	4	,	,	,
cord-014462-11ggaqf1	1533	5	Amrita	Amrita	NNP
cord-014462-11ggaqf1	1533	6	Banerjee	Banerjee	NNP
cord-014462-11ggaqf1	1533	7	2	2	CD
cord-014462-11ggaqf1	1533	8	,	,	,
cord-014462-11ggaqf1	1533	9	J.	J.	NNP
cord-014462-11ggaqf1	1533	10	Tarafdar	Tarafdar	NNP
cord-014462-11ggaqf1	1533	11	2	2	CD
cord-014462-11ggaqf1	1533	12	,	,	,
cord-014462-11ggaqf1	1533	13	R.	R.	NNP
cord-014462-11ggaqf1	1533	14	Rabindran	Rabindran	NNP
cord-014462-11ggaqf1	1533	15	3	3	CD
cord-014462-11ggaqf1	1533	16	,	,	,
cord-014462-11ggaqf1	1533	17	Indranil	Indranil	NNP
cord-014462-11ggaqf1	1533	18	Dasgupta	Dasgupta	NNP
cord-014462-11ggaqf1	1533	19	1	1	CD
cord-014462-11ggaqf1	1533	20	*	*	SYM
cord-014462-11ggaqf1	1533	21	1	1	CD
cord-014462-11ggaqf1	1533	22	Department	Department	NNP
cord-014462-11ggaqf1	1533	23	of	of	IN
cord-014462-11ggaqf1	1533	24	Plant	Plant	NNP
cord-014462-11ggaqf1	1533	25	Molecular	Molecular	NNP
cord-014462-11ggaqf1	1533	26	Biology	Biology	NNP
cord-014462-11ggaqf1	1533	27	,	,	,
cord-014462-11ggaqf1	1533	28	University	University	NNP
cord-014462-11ggaqf1	1533	29	of	of	IN
cord-014462-11ggaqf1	1533	30	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1533	31	,	,	,
cord-014462-11ggaqf1	1533	32	South	South	NNP
cord-014462-11ggaqf1	1533	33	Campus	Campus	NNP
cord-014462-11ggaqf1	1533	34	,	,	,
cord-014462-11ggaqf1	1533	35	New	New	NNP
cord-014462-11ggaqf1	1533	36	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1533	37	;	;	:
cord-014462-11ggaqf1	1534	1	2	2	CD
cord-014462-11ggaqf1	1534	2	Bidhan	Bidhan	NNP
cord-014462-11ggaqf1	1534	3	Chandra	Chandra	NNP
cord-014462-11ggaqf1	1534	4	Krishi	Krishi	NNP
cord-014462-11ggaqf1	1534	5	Vishwavidayalaya	Vishwavidayalaya	NNP
cord-014462-11ggaqf1	1534	6	,	,	,
cord-014462-11ggaqf1	1534	7	Kalyani	Kalyani	NNP
cord-014462-11ggaqf1	1534	8	,	,	,
cord-014462-11ggaqf1	1534	9	Nadia	Nadia	NNP
cord-014462-11ggaqf1	1534	10	,	,	,
cord-014462-11ggaqf1	1534	11	West	West	NNP
cord-014462-11ggaqf1	1534	12	Bengal	Bengal	NNP
cord-014462-11ggaqf1	1534	13	741235	741235	CD
cord-014462-11ggaqf1	1534	14	;	;	:
cord-014462-11ggaqf1	1534	15	3	3	CD
cord-014462-11ggaqf1	1534	16	Tamil	Tamil	NNP
cord-014462-11ggaqf1	1534	17	Nadu	Nadu	NNP
cord-014462-11ggaqf1	1534	18	Agricultural	Agricultural	NNP
cord-014462-11ggaqf1	1534	19	University	University	NNP
cord-014462-11ggaqf1	1534	20	,	,	,
cord-014462-11ggaqf1	1534	21	Coimbatore	Coimbatore	NNP
cord-014462-11ggaqf1	1534	22	,	,	,
cord-014462-11ggaqf1	1534	23	Tamil	Tamil	NNP
cord-014462-11ggaqf1	1534	24	Nadu	Nadu	NNP
cord-014462-11ggaqf1	1534	25	641003	641003	CD
cord-014462-11ggaqf1	1534	26	Rice	Rice	NNP
cord-014462-11ggaqf1	1534	27	tungro	tungro	NNP
cord-014462-11ggaqf1	1534	28	disease	disease	NN
cord-014462-11ggaqf1	1534	29	is	be	VBZ
cord-014462-11ggaqf1	1534	30	an	an	DT
cord-014462-11ggaqf1	1534	31	important	important	JJ
cord-014462-11ggaqf1	1534	32	disease	disease	NN
cord-014462-11ggaqf1	1534	33	of	of	IN
cord-014462-11ggaqf1	1534	34	rice	rice	NN
cord-014462-11ggaqf1	1534	35	,	,	,
cord-014462-11ggaqf1	1534	36	caused	cause	VBN
cord-014462-11ggaqf1	1534	37	by	by	IN
cord-014462-11ggaqf1	1534	38	a	a	DT
cord-014462-11ggaqf1	1534	39	joint	joint	JJ
cord-014462-11ggaqf1	1534	40	infection	infection	NN
cord-014462-11ggaqf1	1534	41	by	by	IN
cord-014462-11ggaqf1	1534	42	two	two	CD
cord-014462-11ggaqf1	1534	43	viruses	virus	NNS
cord-014462-11ggaqf1	1534	44	:	:	:
cord-014462-11ggaqf1	1535	1	Rice	Rice	NNP
cord-014462-11ggaqf1	1535	2	tungro	tungro	NNP
cord-014462-11ggaqf1	1535	3	spherical	spherical	JJ
cord-014462-11ggaqf1	1535	4	virus	virus	NN
cord-014462-11ggaqf1	1535	5	(	(	-LRB-
cord-014462-11ggaqf1	1535	6	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1535	7	)	)	-RRB-
cord-014462-11ggaqf1	1535	8	and	and	CC
cord-014462-11ggaqf1	1535	9	Rice	Rice	NNP
cord-014462-11ggaqf1	1535	10	tungro	tungro	NNP
cord-014462-11ggaqf1	1535	11	bacilliform	bacilliform	NNP
cord-014462-11ggaqf1	1535	12	virus	virus	NN
cord-014462-11ggaqf1	1535	13	(	(	-LRB-
cord-014462-11ggaqf1	1535	14	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1535	15	)	)	-RRB-
cord-014462-11ggaqf1	1535	16	in	in	IN
cord-014462-11ggaqf1	1535	17	South	South	NNP
cord-014462-11ggaqf1	1535	18	and	and	CC
cord-014462-11ggaqf1	1535	19	Southeast	Southeast	NNP
cord-014462-11ggaqf1	1535	20	Asia	Asia	NNP
cord-014462-11ggaqf1	1535	21	.	.	.
cord-014462-11ggaqf1	1536	1	The	the	DT
cord-014462-11ggaqf1	1536	2	complex	complex	NN
cord-014462-11ggaqf1	1536	3	of	of	IN
cord-014462-11ggaqf1	1536	4	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1536	5	and	and	CC
cord-014462-11ggaqf1	1536	6	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1536	7	is	be	VBZ
cord-014462-11ggaqf1	1536	8	transmitted	transmit	VBN
cord-014462-11ggaqf1	1536	9	by	by	IN
cord-014462-11ggaqf1	1536	10	an	an	DT
cord-014462-11ggaqf1	1536	11	insect	insect	NN
cord-014462-11ggaqf1	1536	12	vector	vector	NN
cord-014462-11ggaqf1	1536	13	Green	Green	NNP
cord-014462-11ggaqf1	1536	14	Leaf	Leaf	NNP
cord-014462-11ggaqf1	1536	15	Hopper	Hopper	NNP
cord-014462-11ggaqf1	1536	16	(	(	-LRB-
cord-014462-11ggaqf1	1536	17	GLH	GLH	NNP
cord-014462-11ggaqf1	1536	18	)	)	-RRB-
cord-014462-11ggaqf1	1536	19	.	.	.
cord-014462-11ggaqf1	1537	1	Previously	previously	RB
cord-014462-11ggaqf1	1537	2	we	-PRON-	PRP
cord-014462-11ggaqf1	1537	3	reported	report	VBD
cord-014462-11ggaqf1	1537	4	complete	complete	JJ
cord-014462-11ggaqf1	1537	5	genomic	genomic	JJ
cord-014462-11ggaqf1	1537	6	sequences	sequence	NNS
cord-014462-11ggaqf1	1537	7	of	of	IN
cord-014462-11ggaqf1	1537	8	two	two	CD
cord-014462-11ggaqf1	1537	9	geographically	geographically	RB
cord-014462-11ggaqf1	1537	10	distinct	distinct	JJ
cord-014462-11ggaqf1	1537	11	isolates	isolate	NNS
cord-014462-11ggaqf1	1537	12	of	of	IN
cord-014462-11ggaqf1	1537	13	RTBV	rtbv	NN
cord-014462-11ggaqf1	1537	14	;	;	:
cord-014462-11ggaqf1	1537	15	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1537	16	-	-	HYPH
cord-014462-11ggaqf1	1537	17	WB	WB	NNP
cord-014462-11ggaqf1	1537	18	(	(	-LRB-
cord-014462-11ggaqf1	1537	19	West	West	NNP
cord-014462-11ggaqf1	1537	20	Bengal	Bengal	NNP
cord-014462-11ggaqf1	1537	21	)	)	-RRB-
cord-014462-11ggaqf1	1537	22	and	and	CC
cord-014462-11ggaqf1	1537	23	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1537	24	-	-	HYPH
cord-014462-11ggaqf1	1537	25	AP	AP	NNP
cord-014462-11ggaqf1	1537	26	(	(	-LRB-
cord-014462-11ggaqf1	1537	27	Andhra	Andhra	NNP
cord-014462-11ggaqf1	1537	28	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1537	29	)	)	-RRB-
cord-014462-11ggaqf1	1538	1	collected	collect	VBN
cord-014462-11ggaqf1	1538	2	from	from	IN
cord-014462-11ggaqf1	1538	3	the	the	DT
cord-014462-11ggaqf1	1538	4	field	field	NN
cord-014462-11ggaqf1	1538	5	in	in	IN
cord-014462-11ggaqf1	1538	6	mid-1990s	mid-1990	NNS
cord-014462-11ggaqf1	1538	7	.	.	.
cord-014462-11ggaqf1	1539	1	Both	both	DT
cord-014462-11ggaqf1	1539	2	the	the	DT
cord-014462-11ggaqf1	1539	3	sequences	sequence	NNS
cord-014462-11ggaqf1	1539	4	showed	show	VBD
cord-014462-11ggaqf1	1539	5	high	high	JJ
cord-014462-11ggaqf1	1539	6	homology	homology	NN
cord-014462-11ggaqf1	1539	7	all	all	RB
cord-014462-11ggaqf1	1539	8	along	along	IN
cord-014462-11ggaqf1	1539	9	the	the	DT
cord-014462-11ggaqf1	1539	10	genome	genome	NN
cord-014462-11ggaqf1	1539	11	but	but	CC
cord-014462-11ggaqf1	1539	12	showed	show	VBD
cord-014462-11ggaqf1	1539	13	divergence	divergence	NN
cord-014462-11ggaqf1	1539	14	from	from	IN
cord-014462-11ggaqf1	1539	15	previously	previously	RB
cord-014462-11ggaqf1	1539	16	reported	report	VBN
cord-014462-11ggaqf1	1539	17	Southeast	southeast	JJ
cord-014462-11ggaqf1	1539	18	Asian	asian	JJ
cord-014462-11ggaqf1	1539	19	isolate	isolate	VBP
cord-014462-11ggaqf1	1539	20	i.e.	i.e.	FW
cord-014462-11ggaqf1	1539	21	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1539	22	-	-	HYPH
cord-014462-11ggaqf1	1539	23	Phil	Phil	NNP
cord-014462-11ggaqf1	1539	24	(	(	-LRB-
cord-014462-11ggaqf1	1539	25	Philippines	Philippines	NNP
cord-014462-11ggaqf1	1539	26	)	)	-RRB-
cord-014462-11ggaqf1	1539	27	.	.	.
cord-014462-11ggaqf1	1540	1	To	to	TO
cord-014462-11ggaqf1	1540	2	check	check	VB
cord-014462-11ggaqf1	1540	3	whether	whether	IN
cord-014462-11ggaqf1	1540	4	a	a	DT
cord-014462-11ggaqf1	1540	5	time	time	NN
cord-014462-11ggaqf1	1540	6	period	period	NN
cord-014462-11ggaqf1	1540	7	of	of	IN
cord-014462-11ggaqf1	1540	8	a	a	DT
cord-014462-11ggaqf1	1540	9	decade	decade	NN
cord-014462-11ggaqf1	1540	10	has	have	VBZ
cord-014462-11ggaqf1	1540	11	resulted	result	VBN
cord-014462-11ggaqf1	1540	12	into	into	IN
cord-014462-11ggaqf1	1540	13	variability	variability	NN
cord-014462-11ggaqf1	1540	14	in	in	IN
cord-014462-11ggaqf1	1540	15	the	the	DT
cord-014462-11ggaqf1	1540	16	genomic	genomic	JJ
cord-014462-11ggaqf1	1540	17	sequence	sequence	NN
cord-014462-11ggaqf1	1540	18	of	of	IN
cord-014462-11ggaqf1	1540	19	different	different	JJ
cord-014462-11ggaqf1	1540	20	isolates	isolate	NNS
cord-014462-11ggaqf1	1540	21	of	of	IN
cord-014462-11ggaqf1	1540	22	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1540	23	in	in	IN
cord-014462-11ggaqf1	1540	24	India	India	NNP
cord-014462-11ggaqf1	1540	25	,	,	,
cord-014462-11ggaqf1	1540	26	we	-PRON-	PRP
cord-014462-11ggaqf1	1540	27	cloned	clone	VBD
cord-014462-11ggaqf1	1540	28	and	and	CC
cord-014462-11ggaqf1	1540	29	sequenced	sequence	VBD
cord-014462-11ggaqf1	1540	30	the	the	DT
cord-014462-11ggaqf1	1540	31	complete	complete	JJ
cord-014462-11ggaqf1	1540	32	genome	genome	NN
cord-014462-11ggaqf1	1540	33	of	of	IN
cord-014462-11ggaqf1	1540	34	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1540	35	from	from	IN
cord-014462-11ggaqf1	1540	36	two	two	CD
cord-014462-11ggaqf1	1540	37	geographically	geographically	RB
cord-014462-11ggaqf1	1540	38	distinct	distinct	JJ
cord-014462-11ggaqf1	1540	39	regions	region	NNS
cord-014462-11ggaqf1	1540	40	of	of	IN
cord-014462-11ggaqf1	1540	41	India	India	NNP
cord-014462-11ggaqf1	1540	42	i.e.	i.e.	FW
cord-014462-11ggaqf1	1540	43	West	West	NNP
cord-014462-11ggaqf1	1540	44	Bengal	Bengal	NNP
cord-014462-11ggaqf1	1540	45	and	and	CC
cord-014462-11ggaqf1	1540	46	Kanyakumari	Kanyakumari	NNP
cord-014462-11ggaqf1	1540	47	collected	collect	VBD
cord-014462-11ggaqf1	1540	48	from	from	IN
cord-014462-11ggaqf1	1540	49	the	the	DT
cord-014462-11ggaqf1	1540	50	field	field	NN
cord-014462-11ggaqf1	1540	51	in	in	IN
cord-014462-11ggaqf1	1540	52	2008	2008	CD
cord-014462-11ggaqf1	1540	53	.	.	.
cord-014462-11ggaqf1	1541	1	The	the	DT
cord-014462-11ggaqf1	1541	2	complete	complete	JJ
cord-014462-11ggaqf1	1541	3	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1541	4	sequence	sequence	NN
cord-014462-11ggaqf1	1541	5	of	of	IN
cord-014462-11ggaqf1	1541	6	the	the	DT
cord-014462-11ggaqf1	1541	7	DNA	dna	NN
cord-014462-11ggaqf1	1541	8	fragments	fragment	NNS
cord-014462-11ggaqf1	1541	9	covering	cover	VBG
cord-014462-11ggaqf1	1541	10	the	the	DT
cord-014462-11ggaqf1	1541	11	whole	whole	JJ
cord-014462-11ggaqf1	1541	12	genome	genome	NN
cord-014462-11ggaqf1	1541	13	of	of	IN
cord-014462-11ggaqf1	1541	14	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1541	15	was	be	VBD
cord-014462-11ggaqf1	1541	16	determined	determine	VBN
cord-014462-11ggaqf1	1541	17	using	use	VBG
cord-014462-11ggaqf1	1541	18	universal	universal	JJ
cord-014462-11ggaqf1	1541	19	primers	primer	NNS
cord-014462-11ggaqf1	1541	20	M13F	M13F	NNP
cord-014462-11ggaqf1	1541	21	and	and	CC
cord-014462-11ggaqf1	1541	22	M13R	M13R	NNP
cord-014462-11ggaqf1	1541	23	and	and	CC
cord-014462-11ggaqf1	1541	24	by	by	IN
cord-014462-11ggaqf1	1541	25	Primer	primer	NN
cord-014462-11ggaqf1	1541	26	walking	walk	VBG
cord-014462-11ggaqf1	1541	27	,	,	,
cord-014462-11ggaqf1	1541	28	without	without	IN
cord-014462-11ggaqf1	1541	29	any	any	DT
cord-014462-11ggaqf1	1541	30	ambiguities	ambiguity	NNS
cord-014462-11ggaqf1	1541	31	remaining	remain	VBG
cord-014462-11ggaqf1	1541	32	.	.	.
cord-014462-11ggaqf1	1542	1	The	the	DT
cord-014462-11ggaqf1	1542	2	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1542	3	sequences	sequence	NNS
cord-014462-11ggaqf1	1542	4	of	of	IN
cord-014462-11ggaqf1	1542	5	overlapping	overlap	VBG
cord-014462-11ggaqf1	1542	6	clones	clone	NNS
cord-014462-11ggaqf1	1542	7	were	be	VBD
cord-014462-11ggaqf1	1542	8	assembled	assemble	VBN
cord-014462-11ggaqf1	1542	9	and	and	CC
cord-014462-11ggaqf1	1542	10	analyzed	analyze	VBN
cord-014462-11ggaqf1	1542	11	using	use	VBG
cord-014462-11ggaqf1	1542	12	the	the	DT
cord-014462-11ggaqf1	1542	13	DNA	dna	NN
cord-014462-11ggaqf1	1542	14	analysis	analysis	NN
cord-014462-11ggaqf1	1542	15	software	software	NN
cord-014462-11ggaqf1	1542	16	GENERUNNER	GENERUNNER	NNP
cord-014462-11ggaqf1	1542	17	and	and	CC
cord-014462-11ggaqf1	1542	18	BLASTn	BLASTn	NNS
cord-014462-11ggaqf1	1542	19	program	program	NN
cord-014462-11ggaqf1	1542	20	of	of	IN
cord-014462-11ggaqf1	1542	21	NCBI	NCBI	NNP
cord-014462-11ggaqf1	1542	22	.	.	.
cord-014462-11ggaqf1	1543	1	Homology	homology	NN
cord-014462-11ggaqf1	1543	2	search	search	VBP
cord-014462-11ggaqf1	1543	3	at	at	IN
cord-014462-11ggaqf1	1543	4	the	the	DT
cord-014462-11ggaqf1	1543	5	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1543	6	and	and	CC
cord-014462-11ggaqf1	1543	7	amino	amino	NN
cord-014462-11ggaqf1	1543	8	acid	acid	NN
cord-014462-11ggaqf1	1543	9	level	level	NN
cord-014462-11ggaqf1	1543	10	were	be	VBD
cord-014462-11ggaqf1	1543	11	performed	perform	VBN
cord-014462-11ggaqf1	1543	12	using	use	VBG
cord-014462-11ggaqf1	1543	13	the	the	DT
cord-014462-11ggaqf1	1543	14	BLASTn	BLASTn	NNS
cord-014462-11ggaqf1	1543	15	and	and	CC
cord-014462-11ggaqf1	1543	16	BLASTp	BLASTp	NNS
cord-014462-11ggaqf1	1543	17	(	(	-LRB-
cord-014462-11ggaqf1	1543	18	respectively	respectively	RB
cord-014462-11ggaqf1	1543	19	)	)	-RRB-
cord-014462-11ggaqf1	1543	20	programs	program	NNS
cord-014462-11ggaqf1	1543	21	of	of	IN
cord-014462-11ggaqf1	1543	22	NCBI	NCBI	NNP
cord-014462-11ggaqf1	1543	23	.	.	.
cord-014462-11ggaqf1	1544	1	Multiple	multiple	JJ
cord-014462-11ggaqf1	1544	2	sequence	sequence	NN
cord-014462-11ggaqf1	1544	3	alignments	alignment	NNS
cord-014462-11ggaqf1	1544	4	were	be	VBD
cord-014462-11ggaqf1	1544	5	performed	perform	VBN
cord-014462-11ggaqf1	1544	6	using	use	VBG
cord-014462-11ggaqf1	1544	7	CLUS	CLUS	NNP
cord-014462-11ggaqf1	1544	8	-	-	HYPH
cord-014462-11ggaqf1	1544	9	TAL	TAL	NNP
cord-014462-11ggaqf1	1544	10	-	-	HYPH
cord-014462-11ggaqf1	1544	11	W	w	NN
cord-014462-11ggaqf1	1544	12	software	software	NN
cord-014462-11ggaqf1	1544	13	.	.	.
cord-014462-11ggaqf1	1545	1	Sequence	sequence	NN
cord-014462-11ggaqf1	1545	2	analysis	analysis	NN
cord-014462-11ggaqf1	1545	3	results	result	NNS
cord-014462-11ggaqf1	1545	4	thus	thus	RB
cord-014462-11ggaqf1	1545	5	obtained	obtain	VBN
cord-014462-11ggaqf1	1545	6	showed	show	VBD
cord-014462-11ggaqf1	1545	7	that	that	IN
cord-014462-11ggaqf1	1545	8	both	both	CC
cord-014462-11ggaqf1	1545	9	the	the	DT
cord-014462-11ggaqf1	1545	10	recently	recently	RB
cord-014462-11ggaqf1	1545	11	obtained	obtain	VBN
cord-014462-11ggaqf1	1545	12	complete	complete	JJ
cord-014462-11ggaqf1	1545	13	genomic	genomic	JJ
cord-014462-11ggaqf1	1545	14	sequences	sequence	NNS
cord-014462-11ggaqf1	1545	15	of	of	IN
cord-014462-11ggaqf1	1545	16	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1545	17	from	from	IN
cord-014462-11ggaqf1	1545	18	two	two	CD
cord-014462-11ggaqf1	1545	19	geographically	geographically	RB
cord-014462-11ggaqf1	1545	20	distinct	distinct	JJ
cord-014462-11ggaqf1	1545	21	regions	region	NNS
cord-014462-11ggaqf1	1545	22	of	of	IN
cord-014462-11ggaqf1	1545	23	India	India	NNP
cord-014462-11ggaqf1	1545	24	i.e.	i.e.	FW
cord-014462-11ggaqf1	1545	25	West	West	NNP
cord-014462-11ggaqf1	1545	26	Bengal	Bengal	NNP
cord-014462-11ggaqf1	1545	27	and	and	CC
cord-014462-11ggaqf1	1545	28	Kanyakumari	Kanyakumari	NNP
cord-014462-11ggaqf1	1545	29	showed	show	VBD
cord-014462-11ggaqf1	1545	30	very	very	RB
cord-014462-11ggaqf1	1545	31	high	high	JJ
cord-014462-11ggaqf1	1545	32	homology	homology	NN
cord-014462-11ggaqf1	1545	33	(	(	-LRB-
cord-014462-11ggaqf1	1545	34	both	both	CC
cord-014462-11ggaqf1	1545	35	at	at	IN
cord-014462-11ggaqf1	1545	36	the	the	DT
cord-014462-11ggaqf1	1545	37	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1545	38	and	and	CC
cord-014462-11ggaqf1	1545	39	amino	amino	NN
cord-014462-11ggaqf1	1545	40	acid	acid	NN
cord-014462-11ggaqf1	1545	41	levels	level	NNS
cord-014462-11ggaqf1	1545	42	)	)	-RRB-
cord-014462-11ggaqf1	1545	43	with	with	IN
cord-014462-11ggaqf1	1545	44	the	the	DT
cord-014462-11ggaqf1	1545	45	two	two	CD
cord-014462-11ggaqf1	1545	46	previously	previously	RB
cord-014462-11ggaqf1	1545	47	reported	report	VBN
cord-014462-11ggaqf1	1545	48	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1545	49	isolates	isolate	NNS
cord-014462-11ggaqf1	1545	50	from	from	IN
cord-014462-11ggaqf1	1545	51	India	India	NNP
cord-014462-11ggaqf1	1546	1	i.e.	i.e.	FW
cord-014462-11ggaqf1	1546	2	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1546	3	-	-	HYPH
cord-014462-11ggaqf1	1546	4	WB	WB	NNP
cord-014462-11ggaqf1	1546	5	(	(	-LRB-
cord-014462-11ggaqf1	1546	6	West	West	NNP
cord-014462-11ggaqf1	1546	7	Bengal	Bengal	NNP
cord-014462-11ggaqf1	1546	8	)	)	-RRB-
cord-014462-11ggaqf1	1546	9	and	and	CC
cord-014462-11ggaqf1	1546	10	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1546	11	-	-	HYPH
cord-014462-11ggaqf1	1546	12	AP	AP	NNP
cord-014462-11ggaqf1	1546	13	(	(	-LRB-
cord-014462-11ggaqf1	1546	14	Andhra	Andhra	NNP
cord-014462-11ggaqf1	1546	15	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1546	16	)	)	-RRB-
cord-014462-11ggaqf1	1546	17	all	all	RB
cord-014462-11ggaqf1	1546	18	along	along	IN
cord-014462-11ggaqf1	1546	19	the	the	DT
cord-014462-11ggaqf1	1546	20	genome	genome	NN
cord-014462-11ggaqf1	1546	21	.	.	.
cord-014462-11ggaqf1	1547	1	As	as	IN
cord-014462-11ggaqf1	1547	2	observed	observe	VBN
cord-014462-11ggaqf1	1547	3	earlier	early	RBR
cord-014462-11ggaqf1	1547	4	both	both	CC
cord-014462-11ggaqf1	1547	5	the	the	DT
cord-014462-11ggaqf1	1547	6	sequences	sequence	NNS
cord-014462-11ggaqf1	1547	7	diverged	diverge	VBD
cord-014462-11ggaqf1	1547	8	significantly	significantly	RB
cord-014462-11ggaqf1	1547	9	from	from	IN
cord-014462-11ggaqf1	1547	10	the	the	DT
cord-014462-11ggaqf1	1547	11	Southeast	southeast	JJ
cord-014462-11ggaqf1	1547	12	Asian	asian	JJ
cord-014462-11ggaqf1	1547	13	isolates	isolate	NNS
cord-014462-11ggaqf1	1547	14	.	.	.
cord-014462-11ggaqf1	1548	1	This	this	DT
cord-014462-11ggaqf1	1548	2	suggests	suggest	VBZ
cord-014462-11ggaqf1	1548	3	that	that	IN
cord-014462-11ggaqf1	1548	4	even	even	RB
cord-014462-11ggaqf1	1548	5	after	after	IN
cord-014462-11ggaqf1	1548	6	the	the	DT
cord-014462-11ggaqf1	1548	7	spatial	spatial	JJ
cord-014462-11ggaqf1	1548	8	and	and	CC
cord-014462-11ggaqf1	1548	9	temporal	temporal	JJ
cord-014462-11ggaqf1	1548	10	difference	difference	NN
cord-014462-11ggaqf1	1548	11	(	(	-LRB-
cord-014462-11ggaqf1	1548	12	a	a	DT
cord-014462-11ggaqf1	1548	13	time	time	NN
cord-014462-11ggaqf1	1548	14	gap	gap	NN
cord-014462-11ggaqf1	1548	15	of	of	IN
cord-014462-11ggaqf1	1548	16	approx	approx	NN
cord-014462-11ggaqf1	1548	17	10	10	CD
cord-014462-11ggaqf1	1548	18	years	year	NNS
cord-014462-11ggaqf1	1548	19	)	)	-RRB-
cord-014462-11ggaqf1	1548	20	between	between	IN
cord-014462-11ggaqf1	1548	21	the	the	DT
cord-014462-11ggaqf1	1548	22	two	two	CD
cord-014462-11ggaqf1	1548	23	previously	previously	RB
cord-014462-11ggaqf1	1548	24	reported	report	VBN
cord-014462-11ggaqf1	1548	25	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1548	26	isolates	isolate	NNS
cord-014462-11ggaqf1	1548	27	and	and	CC
cord-014462-11ggaqf1	1548	28	the	the	DT
cord-014462-11ggaqf1	1548	29	recently	recently	RB
cord-014462-11ggaqf1	1548	30	reported	report	VBN
cord-014462-11ggaqf1	1548	31	one	one	CD
cord-014462-11ggaqf1	1548	32	,	,	,
cord-014462-11ggaqf1	1548	33	there	there	EX
cord-014462-11ggaqf1	1548	34	is	be	VBZ
cord-014462-11ggaqf1	1548	35	very	very	RB
cord-014462-11ggaqf1	1548	36	little	little	JJ
cord-014462-11ggaqf1	1548	37	sequence	sequence	NN
cord-014462-11ggaqf1	1548	38	variability	variability	NN
cord-014462-11ggaqf1	1548	39	between	between	IN
cord-014462-11ggaqf1	1548	40	them	-PRON-	PRP
cord-014462-11ggaqf1	1548	41	.	.	.
cord-014462-11ggaqf1	1549	1	This	this	DT
cord-014462-11ggaqf1	1549	2	further	further	RB
cord-014462-11ggaqf1	1549	3	strengthens	strengthen	VBZ
cord-014462-11ggaqf1	1549	4	the	the	DT
cord-014462-11ggaqf1	1549	5	earlier	early	JJR
cord-014462-11ggaqf1	1549	6	reports	report	NNS
cord-014462-11ggaqf1	1549	7	that	that	IN
cord-014462-11ggaqf1	1549	8	the	the	DT
cord-014462-11ggaqf1	1549	9	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1549	10	genomes	genome	NNS
cord-014462-11ggaqf1	1549	11	in	in	IN
cord-014462-11ggaqf1	1549	12	India	India	NNP
cord-014462-11ggaqf1	1549	13	are	be	VBP
cord-014462-11ggaqf1	1549	14	highly	highly	RB
cord-014462-11ggaqf1	1549	15	conserved	conserve	VBN
cord-014462-11ggaqf1	1549	16	.	.	.
cord-014462-11ggaqf1	1550	1	Homology	homology	NN
cord-014462-11ggaqf1	1550	2	search	search	VBP
cord-014462-11ggaqf1	1550	3	at	at	IN
cord-014462-11ggaqf1	1550	4	the	the	DT
cord-014462-11ggaqf1	1550	5	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1550	6	level	level	NN
cord-014462-11ggaqf1	1550	7	using	use	VBG
cord-014462-11ggaqf1	1550	8	BLASTn	BLASTn	NNS
cord-014462-11ggaqf1	1550	9	program	program	NN
cord-014462-11ggaqf1	1550	10	with	with	IN
cord-014462-11ggaqf1	1550	11	the	the	DT
cord-014462-11ggaqf1	1550	12	previously	previously	RB
cord-014462-11ggaqf1	1550	13	existing	exist	VBG
cord-014462-11ggaqf1	1550	14	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1550	15	isolates	isolate	NNS
cord-014462-11ggaqf1	1550	16	revealed	reveal	VBD
cord-014462-11ggaqf1	1550	17	a	a	DT
cord-014462-11ggaqf1	1550	18	very	very	RB
cord-014462-11ggaqf1	1550	19	high	high	JJ
cord-014462-11ggaqf1	1550	20	percentage	percentage	NN
cord-014462-11ggaqf1	1550	21	identity	identity	NN
cord-014462-11ggaqf1	1550	22	of	of	IN
cord-014462-11ggaqf1	1550	23	99	99	CD
cord-014462-11ggaqf1	1550	24	%	%	NN
cord-014462-11ggaqf1	1550	25	with	with	IN
cord-014462-11ggaqf1	1550	26	the	the	DT
cord-014462-11ggaqf1	1550	27	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1550	28	West	West	NNP
cord-014462-11ggaqf1	1550	29	Bengal	Bengal	NNP
cord-014462-11ggaqf1	1550	30	isolate	isolate	VBP
cord-014462-11ggaqf1	1550	31	and	and	CC
cord-014462-11ggaqf1	1550	32	95	95	CD
cord-014462-11ggaqf1	1550	33	%	%	NN
cord-014462-11ggaqf1	1550	34	with	with	IN
cord-014462-11ggaqf1	1550	35	the	the	DT
cord-014462-11ggaqf1	1550	36	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1550	37	Andhra	Andhra	NNP
cord-014462-11ggaqf1	1550	38	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1550	39	isolate	isolate	VBP
cord-014462-11ggaqf1	1550	40	.	.	.
cord-014462-11ggaqf1	1551	1	This	this	DT
cord-014462-11ggaqf1	1551	2	further	further	RB
cord-014462-11ggaqf1	1551	3	strengthens	strengthen	VBZ
cord-014462-11ggaqf1	1551	4	the	the	DT
cord-014462-11ggaqf1	1551	5	earlier	early	JJR
cord-014462-11ggaqf1	1551	6	reports	report	NNS
cord-014462-11ggaqf1	1551	7	that	that	IN
cord-014462-11ggaqf1	1551	8	there	there	EX
cord-014462-11ggaqf1	1551	9	is	be	VBZ
cord-014462-11ggaqf1	1551	10	not	not	RB
cord-014462-11ggaqf1	1551	11	much	much	JJ
cord-014462-11ggaqf1	1551	12	genetic	genetic	JJ
cord-014462-11ggaqf1	1551	13	variability	variability	NN
cord-014462-11ggaqf1	1551	14	in	in	IN
cord-014462-11ggaqf1	1551	15	the	the	DT
cord-014462-11ggaqf1	1551	16	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1551	17	genomes	genome	NNS
cord-014462-11ggaqf1	1551	18	in	in	IN
cord-014462-11ggaqf1	1551	19	Indian	indian	JJ
cord-014462-11ggaqf1	1551	20	subcontinent	subcontinent	NN
cord-014462-11ggaqf1	1551	21	.	.	.
cord-014462-11ggaqf1	1552	1	Complete	complete	JJ
cord-014462-11ggaqf1	1552	2	genomic	genomic	JJ
cord-014462-11ggaqf1	1552	3	RNA	rna	NN
cord-014462-11ggaqf1	1552	4	sequences	sequence	NNS
cord-014462-11ggaqf1	1552	5	of	of	IN
cord-014462-11ggaqf1	1552	6	two	two	CD
cord-014462-11ggaqf1	1552	7	geographically	geographically	RB
cord-014462-11ggaqf1	1552	8	distinct	distinct	JJ
cord-014462-11ggaqf1	1552	9	isolates	isolate	NNS
cord-014462-11ggaqf1	1552	10	of	of	IN
cord-014462-11ggaqf1	1552	11	Rice	Rice	NNP
cord-014462-11ggaqf1	1552	12	tungro	tungro	NNP
cord-014462-11ggaqf1	1552	13	spherical	spherical	JJ
cord-014462-11ggaqf1	1552	14	virus	virus	NN
cord-014462-11ggaqf1	1552	15	(	(	-LRB-
cord-014462-11ggaqf1	1552	16	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1552	17	)	)	-RRB-
cord-014462-11ggaqf1	1552	18	,	,	,
cord-014462-11ggaqf1	1552	19	a	a	DT
cord-014462-11ggaqf1	1552	20	member	member	NN
cord-014462-11ggaqf1	1552	21	of	of	IN
cord-014462-11ggaqf1	1552	22	the	the	DT
cord-014462-11ggaqf1	1552	23	genus	genus	JJ
cord-014462-11ggaqf1	1552	24	Waikavirus	Waikavirus	NNP
cord-014462-11ggaqf1	1552	25	,	,	,
cord-014462-11ggaqf1	1552	26	family	family	NN
cord-014462-11ggaqf1	1552	27	Sequiviridae	Sequiviridae	NNP
cord-014462-11ggaqf1	1552	28	,	,	,
cord-014462-11ggaqf1	1552	29	were	be	VBD
cord-014462-11ggaqf1	1552	30	determined	determine	VBN
cord-014462-11ggaqf1	1552	31	from	from	IN
cord-014462-11ggaqf1	1552	32	India	India	NNP
cord-014462-11ggaqf1	1552	33	.	.	.
cord-014462-11ggaqf1	1553	1	Out	out	IN
cord-014462-11ggaqf1	1553	2	of	of	IN
cord-014462-11ggaqf1	1553	3	the	the	DT
cord-014462-11ggaqf1	1553	4	two	two	CD
cord-014462-11ggaqf1	1553	5	previously	previously	RB
cord-014462-11ggaqf1	1553	6	reported	report	VBN
cord-014462-11ggaqf1	1553	7	sequences	sequence	NNS
cord-014462-11ggaqf1	1553	8	,	,	,
cord-014462-11ggaqf1	1553	9	the	the	DT
cord-014462-11ggaqf1	1553	10	Indian	indian	JJ
cord-014462-11ggaqf1	1553	11	isolates	isolate	NNS
cord-014462-11ggaqf1	1553	12	were	be	VBD
cord-014462-11ggaqf1	1553	13	closer	close	JJR
cord-014462-11ggaqf1	1553	14	to	to	IN
cord-014462-11ggaqf1	1553	15	the	the	DT
cord-014462-11ggaqf1	1553	16	resistance	resistance	NN
cord-014462-11ggaqf1	1553	17	breaking	breaking	NN
cord-014462-11ggaqf1	1553	18	strain	strain	NN
cord-014462-11ggaqf1	1553	19	RTSV-[Vt6	rtsv-[vt6	ADD
cord-014462-11ggaqf1	1553	20	]	]	-RRB-
cord-014462-11ggaqf1	1554	1	than	than	IN
cord-014462-11ggaqf1	1554	2	RTSV-	rtsv-	VB
cord-014462-11ggaqf1	1554	3	[	[	-LRB-
cord-014462-11ggaqf1	1554	4	PhilA	PhilA	NNP
cord-014462-11ggaqf1	1554	5	]	]	-RRB-
cord-014462-11ggaqf1	1554	6	.	.	.
cord-014462-11ggaqf1	1555	1	Between	between	IN
cord-014462-11ggaqf1	1555	2	them	-PRON-	PRP
cord-014462-11ggaqf1	1555	3	,	,	,
cord-014462-11ggaqf1	1555	4	the	the	DT
cord-014462-11ggaqf1	1555	5	Indian	indian	JJ
cord-014462-11ggaqf1	1555	6	sequences	sequence	NNS
cord-014462-11ggaqf1	1555	7	showed	show	VBD
cord-014462-11ggaqf1	1555	8	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1555	9	as	as	RB
cord-014462-11ggaqf1	1555	10	well	well	RB
cord-014462-11ggaqf1	1555	11	as	as	IN
cord-014462-11ggaqf1	1555	12	amino	amino	NN
cord-014462-11ggaqf1	1555	13	acid	acid	NN
cord-014462-11ggaqf1	1555	14	identities	identity	NNS
cord-014462-11ggaqf1	1555	15	of	of	IN
cord-014462-11ggaqf1	1555	16	96	96	CD
cord-014462-11ggaqf1	1555	17	%	%	NN
cord-014462-11ggaqf1	1555	18	.	.	.
cord-014462-11ggaqf1	1556	1	A	a	DT
cord-014462-11ggaqf1	1556	2	moderate	moderate	JJ
cord-014462-11ggaqf1	1556	3	homology	homology	NN
cord-014462-11ggaqf1	1556	4	was	be	VBD
cord-014462-11ggaqf1	1556	5	observed	observe	VBN
cord-014462-11ggaqf1	1556	6	between	between	IN
cord-014462-11ggaqf1	1556	7	the	the	DT
cord-014462-11ggaqf1	1556	8	leader	leader	NN
cord-014462-11ggaqf1	1556	9	peptide	peptide	NN
cord-014462-11ggaqf1	1556	10	and	and	CC
cord-014462-11ggaqf1	1556	11	a	a	DT
cord-014462-11ggaqf1	1556	12	putative	putative	JJ
cord-014462-11ggaqf1	1556	13	helper	helper	NN
cord-014462-11ggaqf1	1556	14	component	component	NN
cord-014462-11ggaqf1	1556	15	protein	protein	NN
cord-014462-11ggaqf1	1556	16	involved	involve	VBN
cord-014462-11ggaqf1	1556	17	in	in	IN
cord-014462-11ggaqf1	1556	18	insect	insect	NN
cord-014462-11ggaqf1	1556	19	transmission	transmission	NN
cord-014462-11ggaqf1	1556	20	of	of	IN
cord-014462-11ggaqf1	1556	21	the	the	DT
cord-014462-11ggaqf1	1556	22	Maize	Maize	NNP
cord-014462-11ggaqf1	1556	23	chlorotic	chlorotic	JJ
cord-014462-11ggaqf1	1556	24	dwarf	dwarf	NN
cord-014462-11ggaqf1	1556	25	virus	virus	NN
cord-014462-11ggaqf1	1556	26	,	,	,
cord-014462-11ggaqf1	1556	27	a	a	DT
cord-014462-11ggaqf1	1556	28	closely	closely	RB
cord-014462-11ggaqf1	1556	29	related	related	JJ
cord-014462-11ggaqf1	1556	30	waikavirus	waikavirus	NNP
cord-014462-11ggaqf1	1556	31	,	,	,
cord-014462-11ggaqf1	1556	32	indicating	indicate	VBG
cord-014462-11ggaqf1	1556	33	its	-PRON-	PRP$
cord-014462-11ggaqf1	1556	34	possible	possible	JJ
cord-014462-11ggaqf1	1556	35	transmission	transmission	NN
cord-014462-11ggaqf1	1556	36	-	-	HYPH
cord-014462-11ggaqf1	1556	37	related	relate	VBN
cord-014462-11ggaqf1	1556	38	function	function	NN
cord-014462-11ggaqf1	1556	39	.	.	.
cord-014462-11ggaqf1	1557	1	Unlike	unlike	IN
cord-014462-11ggaqf1	1557	2	Rice	Rice	NNP
cord-014462-11ggaqf1	1557	3	tungro	tungro	NNP
cord-014462-11ggaqf1	1557	4	bacilliform	bacilliform	NN
cord-014462-11ggaqf1	1557	5	virus	virus	NN
cord-014462-11ggaqf1	1557	6	,	,	,
cord-014462-11ggaqf1	1557	7	which	which	WDT
cord-014462-11ggaqf1	1557	8	causes	cause	VBZ
cord-014462-11ggaqf1	1557	9	Rice	Rice	NNP
cord-014462-11ggaqf1	1557	10	tungro	tungro	NNP
cord-014462-11ggaqf1	1557	11	disease	disease	NN
cord-014462-11ggaqf1	1557	12	jointly	jointly	RB
cord-014462-11ggaqf1	1557	13	with	with	IN
cord-014462-11ggaqf1	1557	14	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1557	15	,	,	,
cord-014462-11ggaqf1	1557	16	and	and	CC
cord-014462-11ggaqf1	1557	17	is	be	VBZ
cord-014462-11ggaqf1	1557	18	significantly	significantly	RB
cord-014462-11ggaqf1	1557	19	different	different	JJ
cord-014462-11ggaqf1	1557	20	between	between	IN
cord-014462-11ggaqf1	1557	21	isolates	isolate	NNS
cord-014462-11ggaqf1	1557	22	from	from	IN
cord-014462-11ggaqf1	1557	23	India	India	NNP
cord-014462-11ggaqf1	1557	24	and	and	CC
cord-014462-11ggaqf1	1557	25	Philippines	Philippines	NNP
cord-014462-11ggaqf1	1557	26	,	,	,
cord-014462-11ggaqf1	1557	27	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1557	28	genomes	genome	NNS
cord-014462-11ggaqf1	1557	29	were	be	VBD
cord-014462-11ggaqf1	1557	30	observed	observe	VBN
cord-014462-11ggaqf1	1557	31	to	to	TO
cord-014462-11ggaqf1	1557	32	be	be	VB
cord-014462-11ggaqf1	1557	33	much	much	RB
cord-014462-11ggaqf1	1557	34	more	more	RBR
cord-014462-11ggaqf1	1557	35	conserved	conserve	VBN
cord-014462-11ggaqf1	1557	36	between	between	IN
cord-014462-11ggaqf1	1557	37	isolates	isolate	NNS
cord-014462-11ggaqf1	1557	38	from	from	IN
cord-014462-11ggaqf1	1557	39	the	the	DT
cord-014462-11ggaqf1	1557	40	two	two	CD
cord-014462-11ggaqf1	1557	41	countries	country	NNS
cord-014462-11ggaqf1	1557	42	.	.	.
cord-014462-11ggaqf1	1558	1	Rice	Rice	NNP
cord-014462-11ggaqf1	1558	2	tungro	tungro	NNP
cord-014462-11ggaqf1	1558	3	bacilliform	bacilliform	NNP
cord-014462-11ggaqf1	1558	4	virus	virus	NN
cord-014462-11ggaqf1	1558	5	(	(	-LRB-
cord-014462-11ggaqf1	1558	6	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1558	7	)	)	-RRB-
cord-014462-11ggaqf1	1558	8	are	be	VBP
cord-014462-11ggaqf1	1558	9	believed	believe	VBN
cord-014462-11ggaqf1	1558	10	to	to	TO
cord-014462-11ggaqf1	1558	11	be	be	VB
cord-014462-11ggaqf1	1558	12	the	the	DT
cord-014462-11ggaqf1	1558	13	joint	joint	JJ
cord-014462-11ggaqf1	1558	14	causative	causative	JJ
cord-014462-11ggaqf1	1558	15	agents	agent	NNS
cord-014462-11ggaqf1	1558	16	for	for	IN
cord-014462-11ggaqf1	1558	17	the	the	DT
cord-014462-11ggaqf1	1558	18	devastating	devastating	JJ
cord-014462-11ggaqf1	1558	19	tungro	tungro	JJ
cord-014462-11ggaqf1	1558	20	disease	disease	NN
cord-014462-11ggaqf1	1558	21	of	of	IN
cord-014462-11ggaqf1	1558	22	rice	rice	NN
cord-014462-11ggaqf1	1558	23	prevalent	prevalent	JJ
cord-014462-11ggaqf1	1558	24	in	in	IN
cord-014462-11ggaqf1	1558	25	South	South	NNP
cord-014462-11ggaqf1	1558	26	and	and	CC
cord-014462-11ggaqf1	1558	27	Southeast	Southeast	NNP
cord-014462-11ggaqf1	1558	28	Asia	Asia	NNP
cord-014462-11ggaqf1	1558	29	[	[	-LRB-
cord-014462-11ggaqf1	1558	30	11	11	CD
cord-014462-11ggaqf1	1558	31	]	]	-RRB-
cord-014462-11ggaqf1	1558	32	.	.	.
cord-014462-11ggaqf1	1559	1	Rice	Rice	NNP
cord-014462-11ggaqf1	1559	2	tungro	tungro	NNP
cord-014462-11ggaqf1	1559	3	disease	disease	NN
cord-014462-11ggaqf1	1559	4	has	have	VBZ
cord-014462-11ggaqf1	1559	5	become	become	VBN
cord-014462-11ggaqf1	1559	6	the	the	DT
cord-014462-11ggaqf1	1559	7	major	major	JJ
cord-014462-11ggaqf1	1559	8	cause	cause	NN
cord-014462-11ggaqf1	1559	9	of	of	IN
cord-014462-11ggaqf1	1559	10	production	production	NN
cord-014462-11ggaqf1	1559	11	losses	loss	NNS
cord-014462-11ggaqf1	1559	12	in	in	IN
cord-014462-11ggaqf1	1559	13	rice	rice	NN
cord-014462-11ggaqf1	1559	14	during	during	IN
cord-014462-11ggaqf1	1559	15	last	last	JJ
cord-014462-11ggaqf1	1559	16	three	three	CD
cord-014462-11ggaqf1	1559	17	decades	decade	NNS
cord-014462-11ggaqf1	1559	18	in	in	IN
cord-014462-11ggaqf1	1559	19	several	several	JJ
cord-014462-11ggaqf1	1559	20	rice	rice	NN
cord-014462-11ggaqf1	1559	21	growing	grow	VBG
cord-014462-11ggaqf1	1559	22	states	state	NNS
cord-014462-11ggaqf1	1559	23	of	of	IN
cord-014462-11ggaqf1	1559	24	India	India	NNP
cord-014462-11ggaqf1	1559	25	.	.	.
cord-014462-11ggaqf1	1560	1	Here	here	RB
cord-014462-11ggaqf1	1560	2	,	,	,
cord-014462-11ggaqf1	1560	3	we	-PRON-	PRP
cord-014462-11ggaqf1	1560	4	report	report	VBP
cord-014462-11ggaqf1	1560	5	,	,	,
cord-014462-11ggaqf1	1560	6	for	for	IN
cord-014462-11ggaqf1	1560	7	the	the	DT
cord-014462-11ggaqf1	1560	8	first	first	JJ
cord-014462-11ggaqf1	1560	9	time	time	NN
cord-014462-11ggaqf1	1560	10	the	the	DT
cord-014462-11ggaqf1	1560	11	complete	complete	JJ
cord-014462-11ggaqf1	1560	12	sequence	sequence	NN
cord-014462-11ggaqf1	1560	13	analysis	analysis	NN
cord-014462-11ggaqf1	1560	14	of	of	IN
cord-014462-11ggaqf1	1560	15	two	two	CD
cord-014462-11ggaqf1	1560	16	geographically	geographically	RB
cord-014462-11ggaqf1	1560	17	distinct	distinct	JJ
cord-014462-11ggaqf1	1560	18	Indian	indian	JJ
cord-014462-11ggaqf1	1560	19	isolates	isolate	NNS
cord-014462-11ggaqf1	1560	20	of	of	IN
cord-014462-11ggaqf1	1560	21	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1560	22	.	.	.
cord-014462-11ggaqf1	1561	1	We	-PRON-	PRP
cord-014462-11ggaqf1	1561	2	analyze	analyze	VBP
cord-014462-11ggaqf1	1561	3	the	the	DT
cord-014462-11ggaqf1	1561	4	deduced	deduce	VBN
cord-014462-11ggaqf1	1561	5	protein	protein	NN
cord-014462-11ggaqf1	1561	6	sequences	sequence	NNS
cord-014462-11ggaqf1	1561	7	and	and	CC
cord-014462-11ggaqf1	1561	8	their	-PRON-	PRP$
cord-014462-11ggaqf1	1561	9	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1561	10	relationship	relationship	NN
cord-014462-11ggaqf1	1561	11	with	with	IN
cord-014462-11ggaqf1	1561	12	the	the	DT
cord-014462-11ggaqf1	1561	13	two	two	CD
cord-014462-11ggaqf1	1561	14	complete	complete	JJ
cord-014462-11ggaqf1	1561	15	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1561	16	sequences	sequence	NNS
cord-014462-11ggaqf1	1561	17	from	from	IN
cord-014462-11ggaqf1	1561	18	Philippines	Philippines	NNP
cord-014462-11ggaqf1	1561	19	as	as	RB
cord-014462-11ggaqf1	1561	20	well	well	RB
cord-014462-11ggaqf1	1561	21	as	as	IN
cord-014462-11ggaqf1	1561	22	with	with	IN
cord-014462-11ggaqf1	1561	23	other	other	JJ
cord-014462-11ggaqf1	1561	24	members	member	NNS
cord-014462-11ggaqf1	1561	25	of	of	IN
cord-014462-11ggaqf1	1561	26	Sequiviridae	Sequiviridae	NNP
cord-014462-11ggaqf1	1561	27	family	family	NN
cord-014462-11ggaqf1	1561	28	.	.	.
cord-014462-11ggaqf1	1562	1	We	-PRON-	PRP
cord-014462-11ggaqf1	1562	2	provide	provide	VBP
cord-014462-11ggaqf1	1562	3	molecular	molecular	JJ
cord-014462-11ggaqf1	1562	4	evidence	evidence	NN
cord-014462-11ggaqf1	1562	5	that	that	IN
cord-014462-11ggaqf1	1562	6	the	the	DT
cord-014462-11ggaqf1	1562	7	Indian	indian	JJ
cord-014462-11ggaqf1	1562	8	isolates	isolate	NNS
cord-014462-11ggaqf1	1562	9	of	of	IN
cord-014462-11ggaqf1	1562	10	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1562	11	are	be	VBP
cord-014462-11ggaqf1	1562	12	closely	closely	RB
cord-014462-11ggaqf1	1562	13	related	related	JJ
cord-014462-11ggaqf1	1562	14	to	to	IN
cord-014462-11ggaqf1	1562	15	those	those	DT
cord-014462-11ggaqf1	1562	16	from	from	IN
cord-014462-11ggaqf1	1562	17	the	the	DT
cord-014462-11ggaqf1	1562	18	Philippines	Philippines	NNPS
cord-014462-11ggaqf1	1562	19	.	.	.
cord-014462-11ggaqf1	1563	1	We	-PRON-	PRP
cord-014462-11ggaqf1	1563	2	had	have	VBD
cord-014462-11ggaqf1	1563	3	earlier	early	RBR
cord-014462-11ggaqf1	1563	4	reported	report	VBN
cord-014462-11ggaqf1	1563	5	that	that	IN
cord-014462-11ggaqf1	1563	6	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1563	7	isolates	isolate	VBZ
cord-014462-11ggaqf1	1563	8	between	between	IN
cord-014462-11ggaqf1	1563	9	India	India	NNP
cord-014462-11ggaqf1	1563	10	and	and	CC
cord-014462-11ggaqf1	1563	11	Philippines	Philippines	NNP
cord-014462-11ggaqf1	1563	12	differ	differ	VBP
cord-014462-11ggaqf1	1563	13	significantly	significantly	RB
cord-014462-11ggaqf1	1563	14	from	from	IN
cord-014462-11ggaqf1	1563	15	each	each	DT
cord-014462-11ggaqf1	1563	16	other	other	JJ
cord-014462-11ggaqf1	1563	17	[	[	-LRB-
cord-014462-11ggaqf1	1563	18	18	18	CD
cord-014462-11ggaqf1	1563	19	]	]	-RRB-
cord-014462-11ggaqf1	1563	20	.	.	.
cord-014462-11ggaqf1	1564	1	This	this	DT
cord-014462-11ggaqf1	1564	2	study	study	NN
cord-014462-11ggaqf1	1564	3	was	be	VBD
cord-014462-11ggaqf1	1564	4	undertaken	undertake	VBN
cord-014462-11ggaqf1	1564	5	in	in	IN
cord-014462-11ggaqf1	1564	6	order	order	NN
cord-014462-11ggaqf1	1564	7	to	to	TO
cord-014462-11ggaqf1	1564	8	see	see	VB
cord-014462-11ggaqf1	1564	9	whether	whether	IN
cord-014462-11ggaqf1	1564	10	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1564	11	isolates	isolate	NNS
cord-014462-11ggaqf1	1564	12	from	from	IN
cord-014462-11ggaqf1	1564	13	India	India	NNP
cord-014462-11ggaqf1	1564	14	also	also	RB
cord-014462-11ggaqf1	1564	15	show	show	VBP
cord-014462-11ggaqf1	1564	16	similar	similar	JJ
cord-014462-11ggaqf1	1564	17	difference	difference	NN
cord-014462-11ggaqf1	1564	18	from	from	IN
cord-014462-11ggaqf1	1564	19	those	those	DT
cord-014462-11ggaqf1	1564	20	reported	report	VBN
cord-014462-11ggaqf1	1564	21	from	from	IN
cord-014462-11ggaqf1	1564	22	The	the	DT
cord-014462-11ggaqf1	1564	23	Philippines	Philippines	NNP
cord-014462-11ggaqf1	1564	24	.	.	.
cord-014462-11ggaqf1	1565	1	Frequent	frequent	JJ
cord-014462-11ggaqf1	1565	2	outbreaks	outbreak	NNS
cord-014462-11ggaqf1	1565	3	of	of	IN
cord-014462-11ggaqf1	1565	4	tungro	tungro	NNS
cord-014462-11ggaqf1	1565	5	were	be	VBD
cord-014462-11ggaqf1	1565	6	reported	report	VBN
cord-014462-11ggaqf1	1565	7	near	near	IN
cord-014462-11ggaqf1	1565	8	Kanyakumari	Kanyakumari	NNP
cord-014462-11ggaqf1	1565	9	in	in	IN
cord-014462-11ggaqf1	1565	10	the	the	DT
cord-014462-11ggaqf1	1565	11	last	last	JJ
cord-014462-11ggaqf1	1565	12	2	2	CD
cord-014462-11ggaqf1	1565	13	-	-	SYM
cord-014462-11ggaqf1	1565	14	3	3	CD
cord-014462-11ggaqf1	1565	15	years	year	NNS
cord-014462-11ggaqf1	1565	16	.	.	.
cord-014462-11ggaqf1	1566	1	The	the	DT
cord-014462-11ggaqf1	1566	2	present	present	JJ
cord-014462-11ggaqf1	1566	3	work	work	NN
cord-014462-11ggaqf1	1566	4	was	be	VBD
cord-014462-11ggaqf1	1566	5	undertaken	undertake	VBN
cord-014462-11ggaqf1	1566	6	to	to	TO
cord-014462-11ggaqf1	1566	7	clone	clone	VB
cord-014462-11ggaqf1	1566	8	and	and	CC
cord-014462-11ggaqf1	1566	9	sequence	sequence	VB
cord-014462-11ggaqf1	1566	10	the	the	DT
cord-014462-11ggaqf1	1566	11	full	full	JJ
cord-014462-11ggaqf1	1566	12	-	-	HYPH
cord-014462-11ggaqf1	1566	13	length	length	NN
cord-014462-11ggaqf1	1566	14	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1566	15	and	and	CC
cord-014462-11ggaqf1	1566	16	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1566	17	genomes	genome	NNS
cord-014462-11ggaqf1	1566	18	from	from	IN
cord-014462-11ggaqf1	1566	19	the	the	DT
cord-014462-11ggaqf1	1566	20	infected	infect	VBN
cord-014462-11ggaqf1	1566	21	rice	rice	NN
cord-014462-11ggaqf1	1566	22	plants	plant	NNS
cord-014462-11ggaqf1	1566	23	collected	collect	VBN
cord-014462-11ggaqf1	1566	24	from	from	IN
cord-014462-11ggaqf1	1566	25	above	above	IN
cord-014462-11ggaqf1	1566	26	region	region	NN
cord-014462-11ggaqf1	1566	27	and	and	CC
cord-014462-11ggaqf1	1566	28	to	to	TO
cord-014462-11ggaqf1	1566	29	analyze	analyze	VB
cord-014462-11ggaqf1	1566	30	the	the	DT
cord-014462-11ggaqf1	1566	31	similarity	similarity	NN
cord-014462-11ggaqf1	1566	32	of	of	IN
cord-014462-11ggaqf1	1566	33	its	-PRON-	PRP$
cord-014462-11ggaqf1	1566	34	genetic	genetic	JJ
cord-014462-11ggaqf1	1566	35	material	material	NN
cord-014462-11ggaqf1	1566	36	with	with	IN
cord-014462-11ggaqf1	1566	37	the	the	DT
cord-014462-11ggaqf1	1566	38	existing	exist	VBG
cord-014462-11ggaqf1	1566	39	Indian	indian	JJ
cord-014462-11ggaqf1	1566	40	isolates	isolate	NNS
cord-014462-11ggaqf1	1566	41	of	of	IN
cord-014462-11ggaqf1	1566	42	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1566	43	and	and	CC
cord-014462-11ggaqf1	1566	44	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1566	45	.	.	.
cord-014462-11ggaqf1	1567	1	A	a	DT
cord-014462-11ggaqf1	1567	2	1.1	1.1	CD
cord-014462-11ggaqf1	1567	3	kb	kb	NNP
cord-014462-11ggaqf1	1567	4	DNA	DNA	NNP
cord-014462-11ggaqf1	1567	5	fragment	fragment	NN
cord-014462-11ggaqf1	1567	6	encoding	encode	VBG
cord-014462-11ggaqf1	1567	7	the	the	DT
cord-014462-11ggaqf1	1567	8	Reverse	reverse	JJ
cord-014462-11ggaqf1	1567	9	transcriptase	transcriptase	NN
cord-014462-11ggaqf1	1567	10	gene	gene	NN
cord-014462-11ggaqf1	1567	11	of	of	IN
cord-014462-11ggaqf1	1567	12	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1567	13	genome	genome	NN
cord-014462-11ggaqf1	1567	14	was	be	VBD
cord-014462-11ggaqf1	1567	15	amplified	amplify	VBN
cord-014462-11ggaqf1	1567	16	and	and	CC
cord-014462-11ggaqf1	1567	17	cloned	clone	VBN
cord-014462-11ggaqf1	1567	18	in	in	IN
cord-014462-11ggaqf1	1567	19	T	T	NNP
cord-014462-11ggaqf1	1567	20	/	/	SYM
cord-014462-11ggaqf1	1567	21	A	a	DT
cord-014462-11ggaqf1	1567	22	vector	vector	NN
cord-014462-11ggaqf1	1567	23	and	and	CC
cord-014462-11ggaqf1	1567	24	was	be	VBD
cord-014462-11ggaqf1	1567	25	sequenced	sequence	VBN
cord-014462-11ggaqf1	1567	26	commercially	commercially	RB
cord-014462-11ggaqf1	1567	27	.	.	.
cord-014462-11ggaqf1	1568	1	Homology	homology	NN
cord-014462-11ggaqf1	1568	2	search	search	VBP
cord-014462-11ggaqf1	1568	3	at	at	IN
cord-014462-11ggaqf1	1568	4	the	the	DT
cord-014462-11ggaqf1	1568	5	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1568	6	level	level	NN
cord-014462-11ggaqf1	1568	7	using	use	VBG
cord-014462-11ggaqf1	1568	8	BLASTn	BLASTn	NNS
cord-014462-11ggaqf1	1568	9	program	program	NN
cord-014462-11ggaqf1	1568	10	with	with	IN
cord-014462-11ggaqf1	1568	11	the	the	DT
cord-014462-11ggaqf1	1568	12	previously	previously	RB
cord-014462-11ggaqf1	1568	13	existing	exist	VBG
cord-014462-11ggaqf1	1568	14	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1568	15	isolates	isolate	NNS
cord-014462-11ggaqf1	1568	16	revealed	reveal	VBD
cord-014462-11ggaqf1	1568	17	a	a	DT
cord-014462-11ggaqf1	1568	18	very	very	RB
cord-014462-11ggaqf1	1568	19	high	high	JJ
cord-014462-11ggaqf1	1568	20	percentage	percentage	NN
cord-014462-11ggaqf1	1568	21	identity	identity	NN
cord-014462-11ggaqf1	1568	22	of	of	IN
cord-014462-11ggaqf1	1568	23	99	99	CD
cord-014462-11ggaqf1	1568	24	%	%	NN
cord-014462-11ggaqf1	1568	25	with	with	IN
cord-014462-11ggaqf1	1568	26	the	the	DT
cord-014462-11ggaqf1	1568	27	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1568	28	West	West	NNP
cord-014462-11ggaqf1	1568	29	Bengal	Bengal	NNP
cord-014462-11ggaqf1	1568	30	isolate	isolate	VBP
cord-014462-11ggaqf1	1568	31	and	and	CC
cord-014462-11ggaqf1	1568	32	95	95	CD
cord-014462-11ggaqf1	1568	33	%	%	NN
cord-014462-11ggaqf1	1568	34	with	with	IN
cord-014462-11ggaqf1	1568	35	the	the	DT
cord-014462-11ggaqf1	1568	36	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1568	37	Andhra	Andhra	NNP
cord-014462-11ggaqf1	1568	38	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1568	39	isolate	isolate	VBP
cord-014462-11ggaqf1	1568	40	.	.	.
cord-014462-11ggaqf1	1569	1	This	this	DT
cord-014462-11ggaqf1	1569	2	further	further	RB
cord-014462-11ggaqf1	1569	3	strengthens	strengthen	VBZ
cord-014462-11ggaqf1	1569	4	the	the	DT
cord-014462-11ggaqf1	1569	5	earlier	early	JJR
cord-014462-11ggaqf1	1569	6	reports	report	NNS
cord-014462-11ggaqf1	1569	7	that	that	IN
cord-014462-11ggaqf1	1569	8	there	there	EX
cord-014462-11ggaqf1	1569	9	is	be	VBZ
cord-014462-11ggaqf1	1569	10	not	not	RB
cord-014462-11ggaqf1	1569	11	much	much	JJ
cord-014462-11ggaqf1	1569	12	genetic	genetic	JJ
cord-014462-11ggaqf1	1569	13	variability	variability	NN
cord-014462-11ggaqf1	1569	14	in	in	IN
cord-014462-11ggaqf1	1569	15	the	the	DT
cord-014462-11ggaqf1	1569	16	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1569	17	genomes	genome	NNS
cord-014462-11ggaqf1	1569	18	in	in	IN
cord-014462-11ggaqf1	1569	19	Indian	indian	JJ
cord-014462-11ggaqf1	1569	20	subcontinent	subcontinent	NN
cord-014462-11ggaqf1	1569	21	.	.	.
cord-014462-11ggaqf1	1570	1	Similarly	similarly	RB
cord-014462-11ggaqf1	1570	2	,	,	,
cord-014462-11ggaqf1	1570	3	the	the	DT
cord-014462-11ggaqf1	1570	4	CP3	CP3	NNP
cord-014462-11ggaqf1	1570	5	region	region	NN
cord-014462-11ggaqf1	1570	6	of	of	IN
cord-014462-11ggaqf1	1570	7	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1570	8	was	be	VBD
cord-014462-11ggaqf1	1570	9	amplified	amplify	VBN
cord-014462-11ggaqf1	1570	10	by	by	IN
cord-014462-11ggaqf1	1570	11	RT	RT	NNP
cord-014462-11ggaqf1	1570	12	-	-	HYPH
cord-014462-11ggaqf1	1570	13	PCR	PCR	NNP
cord-014462-11ggaqf1	1570	14	and	and	CC
cord-014462-11ggaqf1	1570	15	was	be	VBD
cord-014462-11ggaqf1	1570	16	cloned	clone	VBN
cord-014462-11ggaqf1	1570	17	in	in	IN
cord-014462-11ggaqf1	1570	18	T	T	NNP
cord-014462-11ggaqf1	1570	19	/	/	SYM
cord-014462-11ggaqf1	1570	20	A	a	DT
cord-014462-11ggaqf1	1570	21	vector	vector	NN
cord-014462-11ggaqf1	1570	22	.	.	.
cord-014462-11ggaqf1	1571	1	Recently	recently	RB
cord-014462-11ggaqf1	1571	2	,	,	,
cord-014462-11ggaqf1	1571	3	rice	rice	NN
cord-014462-11ggaqf1	1571	4	tungro	tungro	NNP
cord-014462-11ggaqf1	1571	5	disease	disease	NN
cord-014462-11ggaqf1	1571	6	has	have	VBZ
cord-014462-11ggaqf1	1571	7	been	be	VBN
cord-014462-11ggaqf1	1571	8	reported	report	VBN
cord-014462-11ggaqf1	1571	9	from	from	IN
cord-014462-11ggaqf1	1571	10	Kanyakumari	Kanyakumari	NNP
cord-014462-11ggaqf1	1571	11	district	district	NN
cord-014462-11ggaqf1	1571	12	of	of	IN
cord-014462-11ggaqf1	1571	13	Tamil	Tamil	NNP
cord-014462-11ggaqf1	1571	14	Nadu	Nadu	NNP
cord-014462-11ggaqf1	1571	15	.	.	.
cord-014462-11ggaqf1	1572	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1572	2	is	be	VBZ
cord-014462-11ggaqf1	1572	3	important	important	JJ
cord-014462-11ggaqf1	1572	4	to	to	TO
cord-014462-11ggaqf1	1572	5	determine	determine	VB
cord-014462-11ggaqf1	1572	6	the	the	DT
cord-014462-11ggaqf1	1572	7	genetic	genetic	JJ
cord-014462-11ggaqf1	1572	8	nature	nature	NN
cord-014462-11ggaqf1	1572	9	of	of	IN
cord-014462-11ggaqf1	1572	10	this	this	DT
cord-014462-11ggaqf1	1572	11	isolate	isolate	NN
cord-014462-11ggaqf1	1572	12	in	in	IN
cord-014462-11ggaqf1	1572	13	order	order	NN
cord-014462-11ggaqf1	1572	14	to	to	TO
cord-014462-11ggaqf1	1572	15	develop	develop	VB
cord-014462-11ggaqf1	1572	16	resistance	resistance	NN
cord-014462-11ggaqf1	1572	17	strategies	strategy	NNS
cord-014462-11ggaqf1	1572	18	.	.	.
cord-014462-11ggaqf1	1573	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1573	2	is	be	VBZ
cord-014462-11ggaqf1	1573	3	thus	thus	RB
cord-014462-11ggaqf1	1573	4	necessary	necessary	JJ
cord-014462-11ggaqf1	1573	5	to	to	TO
cord-014462-11ggaqf1	1573	6	clone	clone	VB
cord-014462-11ggaqf1	1573	7	and	and	CC
cord-014462-11ggaqf1	1573	8	characterize	characterize	VB
cord-014462-11ggaqf1	1573	9	the	the	DT
cord-014462-11ggaqf1	1573	10	viruses	virus	NNS
cord-014462-11ggaqf1	1573	11	from	from	IN
cord-014462-11ggaqf1	1573	12	Kanyakumari	Kanyakumari	NNP
cord-014462-11ggaqf1	1573	13	and	and	CC
cord-014462-11ggaqf1	1573	14	to	to	TO
cord-014462-11ggaqf1	1573	15	determine	determine	VB
cord-014462-11ggaqf1	1573	16	the	the	DT
cord-014462-11ggaqf1	1573	17	mechanism	mechanism	NN
cord-014462-11ggaqf1	1573	18	of	of	IN
cord-014462-11ggaqf1	1573	19	virus	virus	NN
cord-014462-11ggaqf1	1573	20	resistance	resistance	NN
cord-014462-11ggaqf1	1573	21	in	in	IN
cord-014462-11ggaqf1	1573	22	transgenic	transgenic	JJ
cord-014462-11ggaqf1	1573	23	lines	line	NNS
cord-014462-11ggaqf1	1573	24	.	.	.
cord-014462-11ggaqf1	1574	1	Rice	Rice	NNP
cord-014462-11ggaqf1	1574	2	tungro	tungro	NNP
cord-014462-11ggaqf1	1574	3	disease	disease	NN
cord-014462-11ggaqf1	1574	4	is	be	VBZ
cord-014462-11ggaqf1	1574	5	an	an	DT
cord-014462-11ggaqf1	1574	6	important	important	JJ
cord-014462-11ggaqf1	1574	7	viral	viral	JJ
cord-014462-11ggaqf1	1574	8	disease	disease	NN
cord-014462-11ggaqf1	1574	9	of	of	IN
cord-014462-11ggaqf1	1574	10	rice	rice	NN
cord-014462-11ggaqf1	1574	11	.	.	.
cord-014462-11ggaqf1	1575	1	Rice	Rice	NNP
cord-014462-11ggaqf1	1575	2	tungro	tungro	NNP
cord-014462-11ggaqf1	1575	3	is	be	VBZ
cord-014462-11ggaqf1	1575	4	caused	cause	VBN
cord-014462-11ggaqf1	1575	5	by	by	IN
cord-014462-11ggaqf1	1575	6	infection	infection	NN
cord-014462-11ggaqf1	1575	7	by	by	IN
cord-014462-11ggaqf1	1575	8	two	two	CD
cord-014462-11ggaqf1	1575	9	viruses	virus	NNS
cord-014462-11ggaqf1	1575	10	:	:	:
cord-014462-11ggaqf1	1575	11	Rice	Rice	NNP
cord-014462-11ggaqf1	1575	12	tungro	tungro	JJ
cord-014462-11ggaqf1	1575	13	bacilliform	bacilliform	NN
cord-014462-11ggaqf1	1575	14	virus	virus	NN
cord-014462-11ggaqf1	1575	15	(	(	-LRB-
cord-014462-11ggaqf1	1575	16	RTBV	RTBV	NNP
cord-014462-11ggaqf1	1575	17	)	)	-RRB-
cord-014462-11ggaqf1	1575	18	and	and	CC
cord-014462-11ggaqf1	1575	19	Rice	Rice	NNP
cord-014462-11ggaqf1	1575	20	tungro	tungro	NNP
cord-014462-11ggaqf1	1575	21	spherical	spherical	JJ
cord-014462-11ggaqf1	1575	22	virus	virus	NN
cord-014462-11ggaqf1	1575	23	(	(	-LRB-
cord-014462-11ggaqf1	1575	24	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1575	25	)	)	-RRB-
cord-014462-11ggaqf1	1575	26	.	.	.
cord-014462-11ggaqf1	1576	1	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1576	2	is	be	VBZ
cord-014462-11ggaqf1	1576	3	a	a	DT
cord-014462-11ggaqf1	1576	4	plant	plant	NN
cord-014462-11ggaqf1	1576	5	picornavirus	picornavirus	NN
cord-014462-11ggaqf1	1576	6	with	with	IN
cord-014462-11ggaqf1	1576	7	a	a	DT
cord-014462-11ggaqf1	1576	8	12	12	CD
cord-014462-11ggaqf1	1576	9	kb	kb	NNP
cord-014462-11ggaqf1	1576	10	single	single	JJ
cord-014462-11ggaqf1	1576	11	stranded	strand	VBN
cord-014462-11ggaqf1	1576	12	RNA	RNA	NNP
cord-014462-11ggaqf1	1576	13	genome	genome	NN
cord-014462-11ggaqf1	1576	14	.	.	.
cord-014462-11ggaqf1	1577	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1577	2	belongs	belong	VBZ
cord-014462-11ggaqf1	1577	3	to	to	TO
cord-014462-11ggaqf1	1577	4	genus	genus	VB
cord-014462-11ggaqf1	1577	5	Waikavirus	Waikavirus	NNP
cord-014462-11ggaqf1	1577	6	in	in	IN
cord-014462-11ggaqf1	1577	7	the	the	DT
cord-014462-11ggaqf1	1577	8	family	family	NN
cord-014462-11ggaqf1	1577	9	Sequiviridae	Sequiviridae	NNP
cord-014462-11ggaqf1	1577	10	and	and	CC
cord-014462-11ggaqf1	1577	11	is	be	VBZ
cord-014462-11ggaqf1	1577	12	necessary	necessary	JJ
cord-014462-11ggaqf1	1577	13	for	for	IN
cord-014462-11ggaqf1	1577	14	transmission	transmission	NN
cord-014462-11ggaqf1	1577	15	of	of	IN
cord-014462-11ggaqf1	1577	16	the	the	DT
cord-014462-11ggaqf1	1577	17	two	two	CD
cord-014462-11ggaqf1	1577	18	viruses	virus	NNS
cord-014462-11ggaqf1	1577	19	by	by	IN
cord-014462-11ggaqf1	1577	20	the	the	DT
cord-014462-11ggaqf1	1577	21	leafhopper	leafhopper	NN
cord-014462-11ggaqf1	1577	22	vector	vector	NN
cord-014462-11ggaqf1	1577	23	Nephotellix	Nephotellix	NNP
cord-014462-11ggaqf1	1577	24	virescens	virescen	NNS
cord-014462-11ggaqf1	1577	25	.	.	.
cord-014462-11ggaqf1	1578	1	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1578	2	RNA	RNA	NNP
cord-014462-11ggaqf1	1578	3	is	be	VBZ
cord-014462-11ggaqf1	1578	4	translated	translate	VBN
cord-014462-11ggaqf1	1578	5	to	to	TO
cord-014462-11ggaqf1	1578	6	form	form	VB
cord-014462-11ggaqf1	1578	7	a	a	DT
cord-014462-11ggaqf1	1578	8	large	large	JJ
cord-014462-11ggaqf1	1578	9	polyprotein	polyprotein	NN
cord-014462-11ggaqf1	1578	10	,	,	,
cord-014462-11ggaqf1	1578	11	which	which	WDT
cord-014462-11ggaqf1	1578	12	is	be	VBZ
cord-014462-11ggaqf1	1578	13	then	then	RB
cord-014462-11ggaqf1	1578	14	self	self	NN
cord-014462-11ggaqf1	1578	15	cleaved	cleave	VBN
cord-014462-11ggaqf1	1578	16	to	to	TO
cord-014462-11ggaqf1	1578	17	form	form	VB
cord-014462-11ggaqf1	1578	18	the	the	DT
cord-014462-11ggaqf1	1578	19	viral	viral	JJ
cord-014462-11ggaqf1	1578	20	proteins	protein	NNS
cord-014462-11ggaqf1	1578	21	,	,	,
cord-014462-11ggaqf1	1578	22	including	include	VBG
cord-014462-11ggaqf1	1578	23	the	the	DT
cord-014462-11ggaqf1	1578	24	three	three	CD
cord-014462-11ggaqf1	1578	25	coat	coat	NN
cord-014462-11ggaqf1	1578	26	proteins	protein	NNS
cord-014462-11ggaqf1	1578	27	,	,	,
cord-014462-11ggaqf1	1578	28	replicase	replicase	NN
cord-014462-11ggaqf1	1578	29	,	,	,
cord-014462-11ggaqf1	1578	30	protease	protease	NN
cord-014462-11ggaqf1	1578	31	.	.	.
cord-014462-11ggaqf1	1579	1	Studies	study	NNS
cord-014462-11ggaqf1	1579	2	have	have	VBP
cord-014462-11ggaqf1	1579	3	been	be	VBN
cord-014462-11ggaqf1	1579	4	conducted	conduct	VBN
cord-014462-11ggaqf1	1579	5	on	on	IN
cord-014462-11ggaqf1	1579	6	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1579	7	from	from	IN
cord-014462-11ggaqf1	1579	8	Philippines	Philippines	NNP
cord-014462-11ggaqf1	1579	9	.	.	.
cord-014462-11ggaqf1	1580	1	Correct	correct	JJ
cord-014462-11ggaqf1	1580	2	information	information	NN
cord-014462-11ggaqf1	1580	3	of	of	IN
cord-014462-11ggaqf1	1580	4	sequence	sequence	NN
cord-014462-11ggaqf1	1580	5	variability	variability	NN
cord-014462-11ggaqf1	1580	6	of	of	IN
cord-014462-11ggaqf1	1580	7	viral	viral	JJ
cord-014462-11ggaqf1	1580	8	isolates	isolate	NNS
cord-014462-11ggaqf1	1580	9	to	to	TO
cord-014462-11ggaqf1	1580	10	check	check	VB
cord-014462-11ggaqf1	1580	11	whether	whether	IN
cord-014462-11ggaqf1	1580	12	different	different	JJ
cord-014462-11ggaqf1	1580	13	geographical	geographical	JJ
cord-014462-11ggaqf1	1580	14	conditions	condition	NNS
cord-014462-11ggaqf1	1580	15	like	like	IN
cord-014462-11ggaqf1	1580	16	those	those	DT
cord-014462-11ggaqf1	1580	17	present	present	JJ
cord-014462-11ggaqf1	1580	18	in	in	IN
cord-014462-11ggaqf1	1580	19	India	India	NNP
cord-014462-11ggaqf1	1580	20	select	select	VB
cord-014462-11ggaqf1	1580	21	for	for	IN
cord-014462-11ggaqf1	1580	22	genotypically	genotypically	RB
cord-014462-11ggaqf1	1580	23	variable	variable	JJ
cord-014462-11ggaqf1	1580	24	strain	strain	NN
cord-014462-11ggaqf1	1580	25	and	and	CC
cord-014462-11ggaqf1	1580	26	to	to	TO
cord-014462-11ggaqf1	1580	27	design	design	VB
cord-014462-11ggaqf1	1580	28	for	for	IN
cord-014462-11ggaqf1	1580	29	transgenic	transgenic	JJ
cord-014462-11ggaqf1	1580	30	resistance	resistance	NN
cord-014462-11ggaqf1	1580	31	strategy	strategy	NN
cord-014462-11ggaqf1	1580	32	,	,	,
cord-014462-11ggaqf1	1580	33	information	information	NN
cord-014462-11ggaqf1	1580	34	on	on	IN
cord-014462-11ggaqf1	1580	35	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1580	36	from	from	IN
cord-014462-11ggaqf1	1580	37	India	India	NNP
cord-014462-11ggaqf1	1580	38	is	be	VBZ
cord-014462-11ggaqf1	1580	39	absolutely	absolutely	RB
cord-014462-11ggaqf1	1580	40	essential	essential	JJ
cord-014462-11ggaqf1	1580	41	.	.	.
cord-014462-11ggaqf1	1581	1	The	the	DT
cord-014462-11ggaqf1	1581	2	objective	objective	NN
cord-014462-11ggaqf1	1581	3	of	of	IN
cord-014462-11ggaqf1	1581	4	this	this	DT
cord-014462-11ggaqf1	1581	5	study	study	NN
cord-014462-11ggaqf1	1581	6	was	be	VBD
cord-014462-11ggaqf1	1581	7	to	to	TO
cord-014462-11ggaqf1	1581	8	clone	clone	VB
cord-014462-11ggaqf1	1581	9	RTSV	RTSV	NNP
cord-014462-11ggaqf1	1581	10	isolates	isolate	NNS
cord-014462-11ggaqf1	1581	11	from	from	IN
cord-014462-11ggaqf1	1581	12	India	India	NNP
cord-014462-11ggaqf1	1581	13	and	and	CC
cord-014462-11ggaqf1	1581	14	compare	compare	VB
cord-014462-11ggaqf1	1581	15	the	the	DT
cord-014462-11ggaqf1	1581	16	genetic	genetic	JJ
cord-014462-11ggaqf1	1581	17	diversity	diversity	NN
cord-014462-11ggaqf1	1581	18	of	of	IN
cord-014462-11ggaqf1	1581	19	Indian	indian	JJ
cord-014462-11ggaqf1	1581	20	isolates	isolate	NNS
cord-014462-11ggaqf1	1581	21	from	from	IN
cord-014462-11ggaqf1	1581	22	other	other	JJ
cord-014462-11ggaqf1	1581	23	Southeast	southeast	JJ
cord-014462-11ggaqf1	1581	24	Asian	asian	JJ
cord-014462-11ggaqf1	1581	25	isolates	isolate	NNS
cord-014462-11ggaqf1	1581	26	and	and	CC
cord-014462-11ggaqf1	1581	27	amongst	amongst	IN
cord-014462-11ggaqf1	1581	28	each	each	DT
cord-014462-11ggaqf1	1581	29	other	other	JJ
cord-014462-11ggaqf1	1581	30	.	.	.
cord-014462-11ggaqf1	1582	1	Also	also	RB
cord-014462-11ggaqf1	1582	2	develop	develop	VB
cord-014462-11ggaqf1	1582	3	strategy	strategy	NN
cord-014462-11ggaqf1	1582	4	to	to	TO
cord-014462-11ggaqf1	1582	5	impair	impair	VB
cord-014462-11ggaqf1	1582	6	the	the	DT
cord-014462-11ggaqf1	1582	7	attack	attack	NN
cord-014462-11ggaqf1	1582	8	of	of	IN
cord-014462-11ggaqf1	1582	9	virus	virus	NN
cord-014462-11ggaqf1	1582	10	-	-	HYPH
cord-014462-11ggaqf1	1582	11	complex	complex	JJ
cord-014462-11ggaqf1	1582	12	on	on	IN
cord-014462-11ggaqf1	1582	13	rice	rice	NN
cord-014462-11ggaqf1	1582	14	.	.	.
cord-014462-11ggaqf1	1583	1	The	the	DT
cord-014462-11ggaqf1	1583	2	achieve	achieve	VBP
cord-014462-11ggaqf1	1583	3	this	this	DT
cord-014462-11ggaqf1	1583	4	,	,	,
cord-014462-11ggaqf1	1583	5	complete	complete	JJ
cord-014462-11ggaqf1	1583	6	genomes	genome	NNS
cord-014462-11ggaqf1	1583	7	of	of	IN
cord-014462-11ggaqf1	1583	8	two	two	CD
cord-014462-11ggaqf1	1583	9	isolates	isolate	NNS
cord-014462-11ggaqf1	1583	10	from	from	IN
cord-014462-11ggaqf1	1583	11	India	India	NNP
cord-014462-11ggaqf1	1583	12	were	be	VBD
cord-014462-11ggaqf1	1583	13	cloned	clone	VBN
cord-014462-11ggaqf1	1583	14	by	by	IN
cord-014462-11ggaqf1	1583	15	amplifying	amplify	VBG
cord-014462-11ggaqf1	1583	16	different	different	JJ
cord-014462-11ggaqf1	1583	17	genes	gene	NNS
cord-014462-11ggaqf1	1583	18	by	by	IN
cord-014462-11ggaqf1	1583	19	RT	RT	NNP
cord-014462-11ggaqf1	1583	20	-	-	HYPH
cord-014462-11ggaqf1	1583	21	PCR	PCR	NNP
cord-014462-11ggaqf1	1583	22	and	and	CC
cord-014462-11ggaqf1	1583	23	subsequently	subsequently	RB
cord-014462-11ggaqf1	1583	24	cloned	clone	VBN
cord-014462-11ggaqf1	1583	25	in	in	IN
cord-014462-11ggaqf1	1583	26	TA	TA	NNP
cord-014462-11ggaqf1	1583	27	vectors	vector	NNS
cord-014462-11ggaqf1	1583	28	,	,	,
cord-014462-11ggaqf1	1583	29	followed	follow	VBN
cord-014462-11ggaqf1	1583	30	by	by	IN
cord-014462-11ggaqf1	1583	31	sequencing	sequence	VBG
cord-014462-11ggaqf1	1583	32	.	.	.
cord-014462-11ggaqf1	1584	1	Subsequently	subsequently	RB
cord-014462-11ggaqf1	1584	2	constructs	construct	VBZ
cord-014462-11ggaqf1	1584	3	containing	contain	VBG
cord-014462-11ggaqf1	1584	4	CP1	CP1	NNP
cord-014462-11ggaqf1	1584	5	-	-	HYPH
cord-014462-11ggaqf1	1584	6	3	3	NNP
cord-014462-11ggaqf1	1584	7	,	,	,
cord-014462-11ggaqf1	1584	8	antisense	antisense	NNP
cord-014462-11ggaqf1	1584	9	Replicase	Replicase	NNP
cord-014462-11ggaqf1	1584	10	,	,	,
cord-014462-11ggaqf1	1584	11	sense	sense	NN
cord-014462-11ggaqf1	1584	12	Replicase	Replicase	NNP
cord-014462-11ggaqf1	1584	13	and	and	CC
cord-014462-11ggaqf1	1584	14	double	double	JJ
cord-014462-11ggaqf1	1584	15	stranded	strand	VBN
cord-014462-11ggaqf1	1584	16	Replicase	Replicase	NNP
cord-014462-11ggaqf1	1584	17	were	be	VBD
cord-014462-11ggaqf1	1584	18	cloned	clone	VBN
cord-014462-11ggaqf1	1584	19	in	in	IN
cord-014462-11ggaqf1	1584	20	plant	plant	NN
cord-014462-11ggaqf1	1584	21	transformation	transformation	NN
cord-014462-11ggaqf1	1584	22	vector	vector	NN
cord-014462-11ggaqf1	1584	23	.	.	.
cord-014462-11ggaqf1	1585	1	These	these	DT
cord-014462-11ggaqf1	1585	2	constructs	construct	NNS
cord-014462-11ggaqf1	1585	3	were	be	VBD
cord-014462-11ggaqf1	1585	4	used	use	VBN
cord-014462-11ggaqf1	1585	5	to	to	TO
cord-014462-11ggaqf1	1585	6	transform	transform	VB
cord-014462-11ggaqf1	1585	7	aromatic	aromatic	JJ
cord-014462-11ggaqf1	1585	8	rice	rice	NN
cord-014462-11ggaqf1	1585	9	variety	variety	NN
cord-014462-11ggaqf1	1585	10	from	from	IN
cord-014462-11ggaqf1	1585	11	Indian	Indian	NNP
cord-014462-11ggaqf1	1585	12	-	-	HYPH
cord-014462-11ggaqf1	1585	13	Pusa	Pusa	NNP
cord-014462-11ggaqf1	1585	14	Basmati	Basmati	NNP
cord-014462-11ggaqf1	1585	15	(	(	-LRB-
cord-014462-11ggaqf1	1585	16	PB1	PB1	NNP
cord-014462-11ggaqf1	1585	17	)	)	-RRB-
cord-014462-11ggaqf1	1585	18	.	.	.
cord-014462-11ggaqf1	1586	1	PCR	PCR	NNP
cord-014462-11ggaqf1	1586	2	analysis	analysis	NN
cord-014462-11ggaqf1	1586	3	of	of	IN
cord-014462-11ggaqf1	1586	4	the	the	DT
cord-014462-11ggaqf1	1586	5	above	above	JJ
cord-014462-11ggaqf1	1586	6	plants	plant	NNS
cord-014462-11ggaqf1	1586	7	was	be	VBD
cord-014462-11ggaqf1	1586	8	done	do	VBN
cord-014462-11ggaqf1	1586	9	to	to	TO
cord-014462-11ggaqf1	1586	10	check	check	VB
cord-014462-11ggaqf1	1586	11	the	the	DT
cord-014462-11ggaqf1	1586	12	stable	stable	JJ
cord-014462-11ggaqf1	1586	13	insertion	insertion	NN
cord-014462-11ggaqf1	1586	14	of	of	IN
cord-014462-11ggaqf1	1586	15	insert	insert	NN
cord-014462-11ggaqf1	1586	16	in	in	IN
cord-014462-11ggaqf1	1586	17	the	the	DT
cord-014462-11ggaqf1	1586	18	transgenics	transgenic	NNS
cord-014462-11ggaqf1	1586	19	.	.	.
cord-014462-11ggaqf1	1587	1	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1587	2	(	(	-LRB-
cord-014462-11ggaqf1	1587	3	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1587	4	curcas	curcas	NN
cord-014462-11ggaqf1	1587	5	)	)	-RRB-
cord-014462-11ggaqf1	1587	6	of	of	IN
cord-014462-11ggaqf1	1587	7	the	the	DT
cord-014462-11ggaqf1	1587	8	family	family	NN
cord-014462-11ggaqf1	1588	1	Euphorbiaceae	Euphorbiaceae	NNP
cord-014462-11ggaqf1	1588	2	is	be	VBZ
cord-014462-11ggaqf1	1588	3	being	be	VBG
cord-014462-11ggaqf1	1588	4	grown	grow	VBN
cord-014462-11ggaqf1	1588	5	in	in	IN
cord-014462-11ggaqf1	1588	6	India	India	NNP
cord-014462-11ggaqf1	1588	7	as	as	IN
cord-014462-11ggaqf1	1588	8	a	a	DT
cord-014462-11ggaqf1	1588	9	major	major	JJ
cord-014462-11ggaqf1	1588	10	commercial	commercial	JJ
cord-014462-11ggaqf1	1588	11	fuel	fuel	NN
cord-014462-11ggaqf1	1588	12	(	(	-LRB-
cord-014462-11ggaqf1	1588	13	bio	bio	JJ
cord-014462-11ggaqf1	1588	14	-	-	JJ
cord-014462-11ggaqf1	1588	15	diesel	diesel	JJ
cord-014462-11ggaqf1	1588	16	)	)	-RRB-
cord-014462-11ggaqf1	1588	17	crop	crop	NN
cord-014462-11ggaqf1	1588	18	.	.	.
cord-014462-11ggaqf1	1589	1	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1589	2	is	be	VBZ
cord-014462-11ggaqf1	1589	3	cultivated	cultivate	VBN
cord-014462-11ggaqf1	1589	4	in	in	IN
cord-014462-11ggaqf1	1589	5	200	200	CD
cord-014462-11ggaqf1	1589	6	districts	district	NNS
cord-014462-11ggaqf1	1589	7	of	of	IN
cord-014462-11ggaqf1	1589	8	19	19	CD
cord-014462-11ggaqf1	1589	9	potential	potential	JJ
cord-014462-11ggaqf1	1589	10	states	state	NNS
cord-014462-11ggaqf1	1589	11	of	of	IN
cord-014462-11ggaqf1	1589	12	India	India	NNP
cord-014462-11ggaqf1	1589	13	.	.	.
cord-014462-11ggaqf1	1590	1	Unfortunately	unfortunately	RB
cord-014462-11ggaqf1	1590	2	,	,	,
cord-014462-11ggaqf1	1590	3	the	the	DT
cord-014462-11ggaqf1	1590	4	cultivation	cultivation	NN
cord-014462-11ggaqf1	1590	5	of	of	IN
cord-014462-11ggaqf1	1590	6	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1590	7	is	be	VBZ
cord-014462-11ggaqf1	1590	8	limited	limit	VBN
cord-014462-11ggaqf1	1590	9	by	by	IN
cord-014462-11ggaqf1	1590	10	the	the	DT
cord-014462-11ggaqf1	1590	11	severe	severe	JJ
cord-014462-11ggaqf1	1590	12	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1590	13	disease	disease	NN
cord-014462-11ggaqf1	1590	14	.	.	.
cord-014462-11ggaqf1	1591	1	Recently	recently	RB
cord-014462-11ggaqf1	1591	2	,	,	,
cord-014462-11ggaqf1	1591	3	a	a	DT
cord-014462-11ggaqf1	1591	4	severe	severe	JJ
cord-014462-11ggaqf1	1591	5	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1591	6	disease	disease	NN
cord-014462-11ggaqf1	1591	7	with	with	IN
cord-014462-11ggaqf1	1591	8	significant	significant	JJ
cord-014462-11ggaqf1	1591	9	disease	disease	NN
cord-014462-11ggaqf1	1591	10	incidence	incidence	NN
cord-014462-11ggaqf1	1591	11	was	be	VBD
cord-014462-11ggaqf1	1591	12	observed	observe	VBN
cord-014462-11ggaqf1	1591	13	in	in	IN
cord-014462-11ggaqf1	1591	14	2006	2006	CD
cord-014462-11ggaqf1	1591	15	-	-	SYM
cord-014462-11ggaqf1	1591	16	2009	2009	CD
cord-014462-11ggaqf1	1591	17	on	on	IN
cord-014462-11ggaqf1	1591	18	J.	J.	NNP
cord-014462-11ggaqf1	1591	19	curcas	curcas	NNP
cord-014462-11ggaqf1	1591	20	grown	grow	VBN
cord-014462-11ggaqf1	1591	21	in	in	IN
cord-014462-11ggaqf1	1591	22	experimental	experimental	JJ
cord-014462-11ggaqf1	1591	23	plots	plot	NNS
cord-014462-11ggaqf1	1591	24	of	of	IN
cord-014462-11ggaqf1	1591	25	NBRI	NBRI	NNP
cord-014462-11ggaqf1	1591	26	and	and	CC
cord-014462-11ggaqf1	1591	27	J.	J.	NNP
cord-014462-11ggaqf1	1591	28	gossypifolia	gossypifolia	NNP
cord-014462-11ggaqf1	1591	29	,	,	,
cord-014462-11ggaqf1	1591	30	a	a	DT
cord-014462-11ggaqf1	1591	31	weed	weed	NN
cord-014462-11ggaqf1	1591	32	growing	grow	VBG
cord-014462-11ggaqf1	1591	33	road	road	NN
cord-014462-11ggaqf1	1591	34	side	side	NN
cord-014462-11ggaqf1	1591	35	around	around	IN
cord-014462-11ggaqf1	1591	36	Lucknow	Lucknow	NNP
cord-014462-11ggaqf1	1591	37	and	and	CC
cord-014462-11ggaqf1	1591	38	Kathaupahadi	Kathaupahadi	NNP
cord-014462-11ggaqf1	1591	39	,	,	,
cord-014462-11ggaqf1	1591	40	Madhya	Madhya	NNP
cord-014462-11ggaqf1	1591	41	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1591	42	.	.	.
cord-014462-11ggaqf1	1592	1	The	the	DT
cord-014462-11ggaqf1	1592	2	disease	disease	NN
cord-014462-11ggaqf1	1592	3	consisted	consist	VBD
cord-014462-11ggaqf1	1592	4	of	of	IN
cord-014462-11ggaqf1	1592	5	the	the	DT
cord-014462-11ggaqf1	1592	6	symptoms	symptom	NNS
cord-014462-11ggaqf1	1592	7	of	of	IN
cord-014462-11ggaqf1	1592	8	severe	severe	JJ
cord-014462-11ggaqf1	1592	9	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1592	10	,	,	,
cord-014462-11ggaqf1	1592	11	blistering	blistering	JJ
cord-014462-11ggaqf1	1592	12	,	,	,
cord-014462-11ggaqf1	1592	13	leaf	leaf	NN
cord-014462-11ggaqf1	1592	14	distortion	distortion	NN
cord-014462-11ggaqf1	1592	15	and	and	CC
cord-014462-11ggaqf1	1592	16	stunting	stunting	NN
cord-014462-11ggaqf1	1592	17	of	of	IN
cord-014462-11ggaqf1	1592	18	whole	whole	JJ
cord-014462-11ggaqf1	1592	19	plant	plant	NN
cord-014462-11ggaqf1	1592	20	and	and	CC
cord-014462-11ggaqf1	1592	21	no	no	DT
cord-014462-11ggaqf1	1592	22	fruit	fruit	NN
cord-014462-11ggaqf1	1592	23	/	/	SYM
cord-014462-11ggaqf1	1592	24	seed	seed	NN
cord-014462-11ggaqf1	1592	25	production	production	NN
cord-014462-11ggaqf1	1592	26	in	in	IN
cord-014462-11ggaqf1	1592	27	severely	severely	RB
cord-014462-11ggaqf1	1592	28	affected	affect	VBN
cord-014462-11ggaqf1	1592	29	plants	plant	NNS
cord-014462-11ggaqf1	1592	30	.	.	.
cord-014462-11ggaqf1	1593	1	Symptomatology	symptomatology	NN
cord-014462-11ggaqf1	1593	2	and	and	CC
cord-014462-11ggaqf1	1593	3	whitefly	whitefly	NN
cord-014462-11ggaqf1	1593	4	population	population	NN
cord-014462-11ggaqf1	1593	5	observed	observe	VBD
cord-014462-11ggaqf1	1593	6	on	on	IN
cord-014462-11ggaqf1	1593	7	them	-PRON-	PRP
cord-014462-11ggaqf1	1593	8	suggested	suggest	VBD
cord-014462-11ggaqf1	1593	9	the	the	DT
cord-014462-11ggaqf1	1593	10	occurrence	occurrence	NN
cord-014462-11ggaqf1	1593	11	of	of	IN
cord-014462-11ggaqf1	1593	12	Begomovirus	Begomovirus	NNP
cord-014462-11ggaqf1	1593	13	infection	infection	NN
cord-014462-11ggaqf1	1593	14	.	.	.
cord-014462-11ggaqf1	1594	1	To	to	TO
cord-014462-11ggaqf1	1594	2	detect	detect	VB
cord-014462-11ggaqf1	1594	3	the	the	DT
cord-014462-11ggaqf1	1594	4	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1594	5	infection	infection	NN
cord-014462-11ggaqf1	1594	6	,	,	,
cord-014462-11ggaqf1	1594	7	the	the	DT
cord-014462-11ggaqf1	1594	8	total	total	JJ
cord-014462-11ggaqf1	1594	9	DNA	dna	NN
cord-014462-11ggaqf1	1594	10	from	from	IN
cord-014462-11ggaqf1	1594	11	leaf	leaf	NN
cord-014462-11ggaqf1	1594	12	samples	sample	NNS
cord-014462-11ggaqf1	1594	13	of	of	IN
cord-014462-11ggaqf1	1594	14	infected	infected	JJ
cord-014462-11ggaqf1	1594	15	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1594	16	plants	plant	NNS
cord-014462-11ggaqf1	1594	17	was	be	VBD
cord-014462-11ggaqf1	1594	18	extracted	extract	VBN
cord-014462-11ggaqf1	1594	19	and	and	CC
cord-014462-11ggaqf1	1594	20	polymerase	polymerase	NN
cord-014462-11ggaqf1	1594	21	chain	chain	NN
cord-014462-11ggaqf1	1594	22	reaction	reaction	NN
cord-014462-11ggaqf1	1594	23	(	(	-LRB-
cord-014462-11ggaqf1	1594	24	PCR	PCR	NNP
cord-014462-11ggaqf1	1594	25	)	)	-RRB-
cord-014462-11ggaqf1	1594	26	were	be	VBD
cord-014462-11ggaqf1	1594	27	performed	perform	VBN
cord-014462-11ggaqf1	1594	28	using	use	VBG
cord-014462-11ggaqf1	1594	29	three	three	CD
cord-014462-11ggaqf1	1594	30	sets	set	NNS
cord-014462-11ggaqf1	1594	31	of	of	IN
cord-014462-11ggaqf1	1594	32	begomovirus	begomovirus	JJ
cord-014462-11ggaqf1	1594	33	genus	genus	NN
cord-014462-11ggaqf1	1594	34	specific	specific	JJ
cord-014462-11ggaqf1	1594	35	(	(	-LRB-
cord-014462-11ggaqf1	1594	36	CPIT	CPIT	NNP
cord-014462-11ggaqf1	1594	37	-	-	HYPH
cord-014462-11ggaqf1	1594	38	I	I	NNP
cord-014462-11ggaqf1	1594	39	/	/	SYM
cord-014462-11ggaqf1	1594	40	CPIT	CPIT	NNP
cord-014462-11ggaqf1	1594	41	-	-	HYPH
cord-014462-11ggaqf1	1594	42	T	T	NNP
cord-014462-11ggaqf1	1594	43	,	,	,
cord-014462-11ggaqf1	1594	44	PALIv	PALIv	NNP
cord-014462-11ggaqf1	1594	45	1978	1978	CD
cord-014462-11ggaqf1	1594	46	/	/	SYM
cord-014462-11ggaqf1	1594	47	PARIc	PARIc	NNS
cord-014462-11ggaqf1	1594	48	496	496	CD
cord-014462-11ggaqf1	1594	49	and	and	CC
cord-014462-11ggaqf1	1594	50	PALIv	PALIv	NNS
cord-014462-11ggaqf1	1594	51	722	722	CD
cord-014462-11ggaqf1	1594	52	/	/	SYM
cord-014462-11ggaqf1	1594	53	PALIc	PALIc	NNS
cord-014462-11ggaqf1	1594	54	1960	1960	CD
cord-014462-11ggaqf1	1594	55	)	)	-RRB-
cord-014462-11ggaqf1	1594	56	primers	primer	NNS
cord-014462-11ggaqf1	1594	57	and	and	CC
cord-014462-11ggaqf1	1594	58	the	the	DT
cord-014462-11ggaqf1	1594	59	expected	expect	VBN
cord-014462-11ggaqf1	1594	60	size	size	NN
cord-014462-11ggaqf1	1594	61	*	*	NFP
cord-014462-11ggaqf1	1594	62	800	800	CD
cord-014462-11ggaqf1	1594	63	bp	bp	NNP
cord-014462-11ggaqf1	1594	64	,	,	,
cord-014462-11ggaqf1	1594	65	1.2	1.2	CD
cord-014462-11ggaqf1	1594	66	kb	kb	NNP
cord-014462-11ggaqf1	1594	67	and	and	CC
cord-014462-11ggaqf1	1594	68	1.2	1.2	CD
cord-014462-11ggaqf1	1594	69	kb	kb	NNP
cord-014462-11ggaqf1	1594	70	amplicons	amplicon	NNS
cord-014462-11ggaqf1	1594	71	were	be	VBD
cord-014462-11ggaqf1	1594	72	obtained	obtain	VBN
cord-014462-11ggaqf1	1594	73	which	which	WDT
cord-014462-11ggaqf1	1594	74	confirmed	confirm	VBD
cord-014462-11ggaqf1	1594	75	the	the	DT
cord-014462-11ggaqf1	1594	76	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1594	77	infection	infection	NN
cord-014462-11ggaqf1	1594	78	.	.	.
cord-014462-11ggaqf1	1595	1	Further	further	RB
cord-014462-11ggaqf1	1595	2	to	to	TO
cord-014462-11ggaqf1	1595	3	identify	identify	VB
cord-014462-11ggaqf1	1595	4	the	the	DT
cord-014462-11ggaqf1	1595	5	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1595	6	/	/	SYM
cord-014462-11ggaqf1	1595	7	es	es	XX
cord-014462-11ggaqf1	1595	8	and	and	CC
cord-014462-11ggaqf1	1595	9	investigate	investigate	VB
cord-014462-11ggaqf1	1595	10	the	the	DT
cord-014462-11ggaqf1	1595	11	genetic	genetic	JJ
cord-014462-11ggaqf1	1595	12	diversity	diversity	NN
cord-014462-11ggaqf1	1595	13	among	among	IN
cord-014462-11ggaqf1	1595	14	them	-PRON-	PRP
cord-014462-11ggaqf1	1595	15	exists	exist	VBZ
cord-014462-11ggaqf1	1595	16	if	if	IN
cord-014462-11ggaqf1	1595	17	any	any	DT
cord-014462-11ggaqf1	1595	18	,	,	,
cord-014462-11ggaqf1	1595	19	the	the	DT
cord-014462-11ggaqf1	1595	20	*	*	NFP
cord-014462-11ggaqf1	1595	21	1.2	1.2	CD
cord-014462-11ggaqf1	1595	22	kb	kb	NNP
cord-014462-11ggaqf1	1595	23	amplicons	amplicon	NNS
cord-014462-11ggaqf1	1595	24	were	be	VBD
cord-014462-11ggaqf1	1595	25	cloned	clone	VBN
cord-014462-11ggaqf1	1595	26	and	and	CC
cord-014462-11ggaqf1	1595	27	sequenced	sequence	VBN
cord-014462-11ggaqf1	1595	28	.	.	.
cord-014462-11ggaqf1	1596	1	The	the	DT
cord-014462-11ggaqf1	1596	2	sequence	sequence	NN
cord-014462-11ggaqf1	1596	3	data	datum	NNS
cord-014462-11ggaqf1	1596	4	were	be	VBD
cord-014462-11ggaqf1	1596	5	deposited	deposit	VBN
cord-014462-11ggaqf1	1596	6	in	in	IN
cord-014462-11ggaqf1	1596	7	the	the	DT
cord-014462-11ggaqf1	1596	8	GenBank	GenBank	NNP
cord-014462-11ggaqf1	1596	9	database	database	NN
cord-014462-11ggaqf1	1596	10	under	under	IN
cord-014462-11ggaqf1	1596	11	accession	accession	NN
cord-014462-11ggaqf1	1596	12	nos	nos	NNP
cord-014462-11ggaqf1	1596	13	.	.	NNP
cord-014462-11ggaqf1	1596	14	:	:	:
cord-014462-11ggaqf1	1597	1	GQ847545	GQ847545	NNP
cord-014462-11ggaqf1	1597	2	and	and	CC
cord-014462-11ggaqf1	1597	3	FJ346232	FJ346232	NNP
cord-014462-11ggaqf1	1597	4	(	(	-LRB-
cord-014462-11ggaqf1	1597	5	from	from	IN
cord-014462-11ggaqf1	1597	6	J.	J.	NNP
cord-014462-11ggaqf1	1597	7	curcas	curcas	NNP
cord-014462-11ggaqf1	1597	8	)	)	-RRB-
cord-014462-11ggaqf1	1597	9	and	and	CC
cord-014462-11ggaqf1	1597	10	EU727086	EU727086	NNP
cord-014462-11ggaqf1	1597	11	and	and	CC
cord-014462-11ggaqf1	1597	12	FJ177030	FJ177030	NNP
cord-014462-11ggaqf1	1597	13	(	(	-LRB-
cord-014462-11ggaqf1	1597	14	from	from	IN
cord-014462-11ggaqf1	1597	15	J.	J.	NNP
cord-014462-11ggaqf1	1597	16	gossypifolia	gossypifolia	NNP
cord-014462-11ggaqf1	1597	17	)	)	-RRB-
cord-014462-11ggaqf1	1597	18	.	.	.
cord-014462-11ggaqf1	1598	1	During	during	IN
cord-014462-11ggaqf1	1598	2	BLAST	blast	NN
cord-014462-11ggaqf1	1598	3	analysis	analysis	NN
cord-014462-11ggaqf1	1599	1	GQ847545	GQ847545	NNP
cord-014462-11ggaqf1	1599	2	and	and	CC
cord-014462-11ggaqf1	1599	3	FJ346232	FJ346232	NNP
cord-014462-11ggaqf1	1599	4	shared	share	VBD
cord-014462-11ggaqf1	1599	5	highest	high	JJS
cord-014462-11ggaqf1	1599	6	95	95	CD
cord-014462-11ggaqf1	1599	7	%	%	NN
cord-014462-11ggaqf1	1599	8	sequence	sequence	NN
cord-014462-11ggaqf1	1599	9	identity	identity	NN
cord-014462-11ggaqf1	1599	10	with	with	IN
cord-014462-11ggaqf1	1599	11	each	each	DT
cord-014462-11ggaqf1	1599	12	other	other	JJ
cord-014462-11ggaqf1	1599	13	and	and	CC
cord-014462-11ggaqf1	1599	14	84	84	CD
cord-014462-11ggaqf1	1599	15	-	-	SYM
cord-014462-11ggaqf1	1599	16	88%%	88%%	CD
cord-014462-11ggaqf1	1599	17	with	with	IN
cord-014462-11ggaqf1	1599	18	Sri	Sri	NNP
cord-014462-11ggaqf1	1599	19	Lankan	Lankan	NNP
cord-014462-11ggaqf1	1599	20	cassava	cassava	NN
cord-014462-11ggaqf1	1599	21	mosaic	mosaic	NN
cord-014462-11ggaqf1	1599	22	virus	virus	NN
cord-014462-11ggaqf1	1599	23	(	(	-LRB-
cord-014462-11ggaqf1	1599	24	AJ579307	AJ579307	NNP
cord-014462-11ggaqf1	1599	25	,	,	,
cord-014462-11ggaqf1	1599	26	AJ607394	aj607394	JJ
cord-014462-11ggaqf1	1599	27	,	,	,
cord-014462-11ggaqf1	1599	28	AJ890225	aj890225	JJ
cord-014462-11ggaqf1	1599	29	,	,	,
cord-014462-11ggaqf1	1600	1	AJ89	AJ89	NNP
cord-014462-11ggaqf1	1600	2	0229	0229	CD
cord-014462-11ggaqf1	1600	3	and	and	CC
cord-014462-11ggaqf1	1600	4	AJ890224	aj890224	NN
cord-014462-11ggaqf1	1600	5	)	)	-RRB-
cord-014462-11ggaqf1	1600	6	and	and	CC
cord-014462-11ggaqf1	1600	7	Indian	indian	JJ
cord-014462-11ggaqf1	1600	8	cassava	cassava	NN
cord-014462-11ggaqf1	1600	9	mosaic	mosaic	NN
cord-014462-11ggaqf1	1600	10	virus	virus	NN
cord-014462-11ggaqf1	1600	11	from	from	IN
cord-014462-11ggaqf1	1600	12	India	India	NNP
cord-014462-11ggaqf1	1600	13	(	(	-LRB-
cord-014462-11ggaqf1	1600	14	AY738105	ay738105	NN
cord-014462-11ggaqf1	1600	15	)	)	-RRB-
cord-014462-11ggaqf1	1601	1	therefore	therefore	RB
cord-014462-11ggaqf1	1601	2	,	,	,
cord-014462-11ggaqf1	1601	3	designated	designate	VBN
cord-014462-11ggaqf1	1601	4	as	as	IN
cord-014462-11ggaqf1	1601	5	two	two	CD
cord-014462-11ggaqf1	1601	6	strains	strain	NNS
cord-014462-11ggaqf1	1601	7	of	of	IN
cord-014462-11ggaqf1	1601	8	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1601	9	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1601	10	India	India	NNP
cord-014462-11ggaqf1	1601	11	virus	virus	NN
cord-014462-11ggaqf1	1601	12	-	-	:
cord-014462-11ggaqf1	1601	13	Lucknow	Lucknow	NNP
cord-014462-11ggaqf1	1601	14	.	.	.
cord-014462-11ggaqf1	1602	1	BLAST	blast	NN
cord-014462-11ggaqf1	1602	2	analysis	analysis	NN
cord-014462-11ggaqf1	1602	3	of	of	IN
cord-014462-11ggaqf1	1602	4	EU727086	EU727086	NNP
cord-014462-11ggaqf1	1602	5	showed	show	VBD
cord-014462-11ggaqf1	1602	6	maximum	maximum	JJ
cord-014462-11ggaqf1	1602	7	93	93	CD
cord-014462-11ggaqf1	1602	8	%	%	NN
cord-014462-11ggaqf1	1602	9	similarities	similarity	NNS
cord-014462-11ggaqf1	1602	10	with	with	IN
cord-014462-11ggaqf1	1602	11	Croton	Croton	NNP
cord-014462-11ggaqf1	1602	12	yellow	yellow	JJ
cord-014462-11ggaqf1	1602	13	vein	vein	NN
cord-014462-11ggaqf1	1602	14	mosaic	mosaic	NN
cord-014462-11ggaqf1	1602	15	virus	virus	NN
cord-014462-11ggaqf1	1602	16	(	(	-LRB-
cord-014462-11ggaqf1	1602	17	AJ507777	AJ507777	NNP
cord-014462-11ggaqf1	1602	18	)	)	-RRB-
cord-014462-11ggaqf1	1602	19	,	,	,
cord-014462-11ggaqf1	1602	20	82	82	CD
cord-014462-11ggaqf1	1602	21	%	%	NN
cord-014462-11ggaqf1	1602	22	with	with	IN
cord-014462-11ggaqf1	1602	23	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1602	24	leaf	leaf	NN
cord-014462-11ggaqf1	1602	25	curl	curl	NN
cord-014462-11ggaqf1	1602	26	New	New	NNP
cord-014462-11ggaqf1	1602	27	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1602	28	virus	virus	NN
cord-014462-11ggaqf1	1602	29	(	(	-LRB-
cord-014462-11ggaqf1	1602	30	DQ629102	dq629102	NN
cord-014462-11ggaqf1	1602	31	)	)	-RRB-
cord-014462-11ggaqf1	1602	32	and	and	CC
cord-014462-11ggaqf1	1602	33	80	80	CD
cord-014462-11ggaqf1	1602	34	-	-	SYM
cord-014462-11ggaqf1	1602	35	79	79	CD
cord-014462-11ggaqf1	1602	36	%	%	NN
cord-014462-11ggaqf1	1602	37	with	with	IN
cord-014462-11ggaqf1	1602	38	Papaya	Papaya	NNP
cord-014462-11ggaqf1	1602	39	leaf	leaf	NN
cord-014462-11ggaqf1	1602	40	curl	curl	NN
cord-014462-11ggaqf1	1602	41	virus	virus	NN
cord-014462-11ggaqf1	1602	42	(	(	-LRB-
cord-014462-11ggaqf1	1602	43	AJ436992	aj436992	NN
cord-014462-11ggaqf1	1602	44	and	and	CC
cord-014462-11ggaqf1	1602	45	Y15934	Y15934	NNP
cord-014462-11ggaqf1	1602	46	)	)	-RRB-
cord-014462-11ggaqf1	1602	47	,	,	,
cord-014462-11ggaqf1	1602	48	therefore	therefore	RB
cord-014462-11ggaqf1	1602	49	,	,	,
cord-014462-11ggaqf1	1602	50	identified	identify	VBN
cord-014462-11ggaqf1	1602	51	as	as	IN
cord-014462-11ggaqf1	1602	52	strain	strain	NN
cord-014462-11ggaqf1	1602	53	of	of	IN
cord-014462-11ggaqf1	1602	54	Croton	Croton	NNP
cord-014462-11ggaqf1	1602	55	yellow	yellow	JJ
cord-014462-11ggaqf1	1602	56	vein	vein	NN
cord-014462-11ggaqf1	1602	57	mosaic	mosaic	NN
cord-014462-11ggaqf1	1602	58	virus	virus	NN
cord-014462-11ggaqf1	1602	59	.	.	.
cord-014462-11ggaqf1	1603	1	BLAST	blast	NN
cord-014462-11ggaqf1	1603	2	analysis	analysis	NN
cord-014462-11ggaqf1	1603	3	of	of	IN
cord-014462-11ggaqf1	1603	4	the	the	DT
cord-014462-11ggaqf1	1603	5	virus	virus	NN
cord-014462-11ggaqf1	1603	6	isolate	isolate	VB
cord-014462-11ggaqf1	1603	7	(	(	-LRB-
cord-014462-11ggaqf1	1603	8	FJ177030	fj177030	NN
cord-014462-11ggaqf1	1603	9	)	)	-RRB-
cord-014462-11ggaqf1	1603	10	showed	show	VBD
cord-014462-11ggaqf1	1603	11	highest	high	JJS
cord-014462-11ggaqf1	1603	12	83	83	CD
cord-014462-11ggaqf1	1603	13	%	%	NN
cord-014462-11ggaqf1	1603	14	identities	identity	NNS
cord-014462-11ggaqf1	1603	15	with	with	IN
cord-014462-11ggaqf1	1603	16	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1603	17	leaf	leaf	NN
cord-014462-11ggaqf1	1603	18	curl	curl	NN
cord-014462-11ggaqf1	1603	19	virus	virus	NN
cord-014462-11ggaqf1	1603	20	-	-	:
cord-014462-11ggaqf1	1603	21	Bangalore	Bangalore	NNP
cord-014462-11ggaqf1	1603	22	II	II	NNP
cord-014462-11ggaqf1	1603	23	(	(	-LRB-
cord-014462-11ggaqf1	1603	24	ToLCV	ToLCV	NNP
cord-014462-11ggaqf1	1603	25	-	-	HYPH
cord-014462-11ggaqf1	1603	26	B	B	NNP
cord-014462-11ggaqf1	1603	27	II	II	NNP
cord-014462-11ggaqf1	1603	28	-	-	HYPH
cord-014462-11ggaqf1	1603	29	U38239	U38239	NNP
cord-014462-11ggaqf1	1603	30	)	)	-RRB-
cord-014462-11ggaqf1	1603	31	and	and	CC
cord-014462-11ggaqf1	1603	32	82	82	CD
cord-014462-11ggaqf1	1603	33	-	-	SYM
cord-014462-11ggaqf1	1603	34	81	81	CD
cord-014462-11ggaqf1	1603	35	%	%	NN
cord-014462-11ggaqf1	1603	36	with	with	IN
cord-014462-11ggaqf1	1603	37	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1603	38	leaf	leaf	NN
cord-014462-11ggaqf1	1603	39	curl	curl	NN
cord-014462-11ggaqf1	1603	40	Karnataka	Karnataka	NNP
cord-014462-11ggaqf1	1603	41	virus	virus	NN
cord-014462-11ggaqf1	1603	42	(	(	-LRB-
cord-014462-11ggaqf1	1603	43	ToL	ToL	NNP
cord-014462-11ggaqf1	1603	44	-	-	HYPH
cord-014462-11ggaqf1	1603	45	CKV	CKV	NNP
cord-014462-11ggaqf1	1603	46	,	,	,
cord-014462-11ggaqf1	1603	47	AY754812	AY754812	NNP
cord-014462-11ggaqf1	1603	48	,	,	,
cord-014462-11ggaqf1	1603	49	FJ514798	FJ514798	NNP
cord-014462-11ggaqf1	1603	50	)	)	-RRB-
cord-014462-11ggaqf1	1603	51	,	,	,
cord-014462-11ggaqf1	1603	52	therefore	therefore	RB
cord-014462-11ggaqf1	1603	53	,	,	,
cord-014462-11ggaqf1	1603	54	considered	consider	VBN
cord-014462-11ggaqf1	1603	55	as	as	IN
cord-014462-11ggaqf1	1603	56	new	new	JJ
cord-014462-11ggaqf1	1603	57	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1603	58	species	specie	NNS
cord-014462-11ggaqf1	1603	59	'	'	''
cord-014462-11ggaqf1	1603	60	'	'	''
cord-014462-11ggaqf1	1603	61	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1603	62	yellow	yellow	NN
cord-014462-11ggaqf1	1603	63	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1603	64	India	India	NNP
cord-014462-11ggaqf1	1603	65	virus	virus	NN
cord-014462-11ggaqf1	1603	66	'	'	''
cord-014462-11ggaqf1	1603	67	'	'	''
cord-014462-11ggaqf1	1603	68	.	.	.
cord-014462-11ggaqf1	1604	1	The	the	DT
cord-014462-11ggaqf1	1604	2	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1604	3	analysis	analysis	NN
cord-014462-11ggaqf1	1604	4	of	of	IN
cord-014462-11ggaqf1	1604	5	GQ847545	GQ847545	NNP
cord-014462-11ggaqf1	1604	6	and	and	CC
cord-014462-11ggaqf1	1604	7	FJ346232	FJ346232	NNP
cord-014462-11ggaqf1	1604	8	(	(	-LRB-
cord-014462-11ggaqf1	1604	9	from	from	IN
cord-014462-11ggaqf1	1604	10	J.	J.	NNP
cord-014462-11ggaqf1	1604	11	curcas	curcas	NNP
cord-014462-11ggaqf1	1604	12	)	)	-RRB-
cord-014462-11ggaqf1	1604	13	and	and	CC
cord-014462-11ggaqf1	1604	14	EU727086	EU727086	NNP
cord-014462-11ggaqf1	1604	15	and	and	CC
cord-014462-11ggaqf1	1604	16	FJ177030	FJ177030	NNP
cord-014462-11ggaqf1	1604	17	(	(	-LRB-
cord-014462-11ggaqf1	1604	18	from	from	IN
cord-014462-11ggaqf1	1604	19	J.	J.	NNP
cord-014462-11ggaqf1	1604	20	gossypifolia	gossypifolia	NNP
cord-014462-11ggaqf1	1604	21	)	)	-RRB-
cord-014462-11ggaqf1	1604	22	was	be	VBD
cord-014462-11ggaqf1	1604	23	performed	perform	VBN
cord-014462-11ggaqf1	1604	24	along	along	IN
cord-014462-11ggaqf1	1604	25	with	with	IN
cord-014462-11ggaqf1	1604	26	some	some	DT
cord-014462-11ggaqf1	1604	27	selected	select	VBN
cord-014462-11ggaqf1	1604	28	isolates	isolate	NNS
cord-014462-11ggaqf1	1604	29	of	of	IN
cord-014462-11ggaqf1	1604	30	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1604	31	which	which	WDT
cord-014462-11ggaqf1	1604	32	showed	show	VBD
cord-014462-11ggaqf1	1604	33	[	[	-LRB-
cord-014462-11ggaqf1	1604	34	90	90	CD
cord-014462-11ggaqf1	1604	35	%	%	NN
cord-014462-11ggaqf1	1604	36	sequence	sequence	NN
cord-014462-11ggaqf1	1604	37	identities	identity	NNS
cord-014462-11ggaqf1	1604	38	during	during	IN
cord-014462-11ggaqf1	1604	39	BLAST	blast	NN
cord-014462-11ggaqf1	1604	40	analysis	analysis	NN
cord-014462-11ggaqf1	1604	41	.	.	.
cord-014462-11ggaqf1	1605	1	The	the	DT
cord-014462-11ggaqf1	1605	2	isolate	isolate	NN
cord-014462-11ggaqf1	1605	3	EU727086	EU727086	NNP
cord-014462-11ggaqf1	1605	4	showed	show	VBD
cord-014462-11ggaqf1	1605	5	closest	close	JJS
cord-014462-11ggaqf1	1605	6	relationship	relationship	NN
cord-014462-11ggaqf1	1605	7	with	with	IN
cord-014462-11ggaqf1	1605	8	Croton	Croton	NNP
cord-014462-11ggaqf1	1605	9	yellow	yellow	JJ
cord-014462-11ggaqf1	1605	10	vein	vein	NN
cord-014462-11ggaqf1	1605	11	mosaic	mosaic	NN
cord-014462-11ggaqf1	1605	12	virus	virus	NN
cord-014462-11ggaqf1	1605	13	while	while	IN
cord-014462-11ggaqf1	1605	14	FJ177030	FJ177030	NNP
cord-014462-11ggaqf1	1605	15	showed	show	VBD
cord-014462-11ggaqf1	1605	16	separate	separate	JJ
cord-014462-11ggaqf1	1605	17	clustering	clustering	NN
cord-014462-11ggaqf1	1605	18	of	of	IN
cord-014462-11ggaqf1	1605	19	all	all	PDT
cord-014462-11ggaqf1	1605	20	the	the	DT
cord-014462-11ggaqf1	1605	21	four	four	CD
cord-014462-11ggaqf1	1605	22	begomovirus	begomovirus	NN
cord-014462-11ggaqf1	1605	23	from	from	IN
cord-014462-11ggaqf1	1605	24	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1605	25	species	specie	NNS
cord-014462-11ggaqf1	1605	26	.	.	.
cord-014462-11ggaqf1	1606	1	During	during	IN
cord-014462-11ggaqf1	1606	2	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1606	3	analysis	analysis	NN
cord-014462-11ggaqf1	1606	4	these	these	DT
cord-014462-11ggaqf1	1606	5	isolates	isolate	NNS
cord-014462-11ggaqf1	1606	6	formed	form	VBD
cord-014462-11ggaqf1	1606	7	three	three	CD
cord-014462-11ggaqf1	1606	8	separate	separate	JJ
cord-014462-11ggaqf1	1606	9	clusters	cluster	NNS
cord-014462-11ggaqf1	1606	10	,	,	,
cord-014462-11ggaqf1	1606	11	therefore	therefore	RB
cord-014462-11ggaqf1	1606	12	,	,	,
cord-014462-11ggaqf1	1606	13	they	-PRON-	PRP
cord-014462-11ggaqf1	1606	14	were	be	VBD
cord-014462-11ggaqf1	1606	15	considered	consider	VBN
cord-014462-11ggaqf1	1606	16	as	as	IN
cord-014462-11ggaqf1	1606	17	three	three	CD
cord-014462-11ggaqf1	1606	18	distinct	distinct	JJ
cord-014462-11ggaqf1	1606	19	begomoviruses	begomoviruse	NNS
cord-014462-11ggaqf1	1606	20	.	.	.
cord-014462-11ggaqf1	1607	1	The	the	DT
cord-014462-11ggaqf1	1607	2	above	above	JJ
cord-014462-11ggaqf1	1607	3	data	datum	NNS
cord-014462-11ggaqf1	1607	4	clearly	clearly	RB
cord-014462-11ggaqf1	1607	5	show	show	VBP
cord-014462-11ggaqf1	1607	6	that	that	IN
cord-014462-11ggaqf1	1607	7	some	some	DT
cord-014462-11ggaqf1	1607	8	genetic	genetic	JJ
cord-014462-11ggaqf1	1607	9	diversity	diversity	NN
cord-014462-11ggaqf1	1607	10	exists	exist	VBZ
cord-014462-11ggaqf1	1607	11	among	among	IN
cord-014462-11ggaqf1	1607	12	the	the	DT
cord-014462-11ggaqf1	1607	13	begomoviruses	begomoviruse	NNS
cord-014462-11ggaqf1	1607	14	infecting	infect	VBG
cord-014462-11ggaqf1	1607	15	Jatropha	Jatropha	NNP
cord-014462-11ggaqf1	1607	16	species	specie	NNS
cord-014462-11ggaqf1	1607	17	in	in	IN
cord-014462-11ggaqf1	1607	18	India	India	NNP
cord-014462-11ggaqf1	1607	19	.	.	.
cord-014462-11ggaqf1	1608	1	Bitter	bitter	JJ
cord-014462-11ggaqf1	1608	2	gourd	gourd	NN
cord-014462-11ggaqf1	1608	3	(	(	-LRB-
cord-014462-11ggaqf1	1608	4	Momordica	Momordica	NNP
cord-014462-11ggaqf1	1608	5	charantia	charantia	NN
cord-014462-11ggaqf1	1608	6	L.	L.	NNP
cord-014462-11ggaqf1	1608	7	)	)	-RRB-
cord-014462-11ggaqf1	1608	8	of	of	IN
cord-014462-11ggaqf1	1608	9	the	the	DT
cord-014462-11ggaqf1	1608	10	family	family	NN
cord-014462-11ggaqf1	1608	11	Cucurbitaceae	Cucurbitaceae	NNP
cord-014462-11ggaqf1	1608	12	,	,	,
cord-014462-11ggaqf1	1608	13	also	also	RB
cord-014462-11ggaqf1	1608	14	known	know	VBN
cord-014462-11ggaqf1	1608	15	as	as	IN
cord-014462-11ggaqf1	1608	16	bitter	bitter	JJ
cord-014462-11ggaqf1	1608	17	melon	melon	NN
cord-014462-11ggaqf1	1608	18	is	be	VBZ
cord-014462-11ggaqf1	1608	19	extensively	extensively	RB
cord-014462-11ggaqf1	1608	20	cultivated	cultivate	VBN
cord-014462-11ggaqf1	1608	21	in	in	IN
cord-014462-11ggaqf1	1608	22	north	north	JJ
cord-014462-11ggaqf1	1608	23	eastern	eastern	JJ
cord-014462-11ggaqf1	1608	24	region	region	NN
cord-014462-11ggaqf1	1608	25	of	of	IN
cord-014462-11ggaqf1	1608	26	Uttar	Uttar	NNP
cord-014462-11ggaqf1	1608	27	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1608	28	,	,	,
cord-014462-11ggaqf1	1608	29	India	India	NNP
cord-014462-11ggaqf1	1608	30	.	.	.
cord-014462-11ggaqf1	1609	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1609	2	is	be	VBZ
cord-014462-11ggaqf1	1609	3	regarded	regard	VBN
cord-014462-11ggaqf1	1609	4	as	as	IN
cord-014462-11ggaqf1	1609	5	one	one	CD
cord-014462-11ggaqf1	1609	6	of	of	IN
cord-014462-11ggaqf1	1609	7	the	the	DT
cord-014462-11ggaqf1	1609	8	world	world	NN
cord-014462-11ggaqf1	1609	9	's	's	POS
cord-014462-11ggaqf1	1609	10	major	major	JJ
cord-014462-11ggaqf1	1609	11	vegetable	vegetable	NN
cord-014462-11ggaqf1	1609	12	crops	crop	NNS
cord-014462-11ggaqf1	1609	13	and	and	CC
cord-014462-11ggaqf1	1609	14	has	have	VBZ
cord-014462-11ggaqf1	1609	15	great	great	JJ
cord-014462-11ggaqf1	1609	16	economic	economic	JJ
cord-014462-11ggaqf1	1609	17	importance	importance	NN
cord-014462-11ggaqf1	1609	18	.	.	.
cord-014462-11ggaqf1	1610	1	A	a	DT
cord-014462-11ggaqf1	1610	2	severe	severe	JJ
cord-014462-11ggaqf1	1610	3	yellow	yellow	JJ
cord-014462-11ggaqf1	1610	4	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1610	5	disease	disease	NN
cord-014462-11ggaqf1	1610	6	on	on	IN
cord-014462-11ggaqf1	1610	7	bitter	bitter	JJ
cord-014462-11ggaqf1	1610	8	gourd	gourd	NN
cord-014462-11ggaqf1	1610	9	(	(	-LRB-
cord-014462-11ggaqf1	1610	10	Momordica	Momordica	NNP
cord-014462-11ggaqf1	1610	11	charantia	charantia	NN
cord-014462-11ggaqf1	1610	12	)	)	-RRB-
cord-014462-11ggaqf1	1610	13	with	with	IN
cord-014462-11ggaqf1	1610	14	a	a	DT
cord-014462-11ggaqf1	1610	15	significant	significant	JJ
cord-014462-11ggaqf1	1610	16	disease	disease	NN
cord-014462-11ggaqf1	1610	17	incidence	incidence	NN
cord-014462-11ggaqf1	1610	18	was	be	VBD
cord-014462-11ggaqf1	1610	19	observed	observe	VBN
cord-014462-11ggaqf1	1610	20	during	during	IN
cord-014462-11ggaqf1	1610	21	the	the	DT
cord-014462-11ggaqf1	1610	22	survey	survey	NN
cord-014462-11ggaqf1	1610	23	of	of	IN
cord-014462-11ggaqf1	1610	24	different	different	JJ
cord-014462-11ggaqf1	1610	25	locations	location	NNS
cord-014462-11ggaqf1	1610	26	of	of	IN
cord-014462-11ggaqf1	1610	27	Eastern	Eastern	NNP
cord-014462-11ggaqf1	1610	28	UP	UP	NNP
cord-014462-11ggaqf1	1610	29	,	,	,
cord-014462-11ggaqf1	1610	30	India	India	NNP
cord-014462-11ggaqf1	1610	31	in	in	IN
cord-014462-11ggaqf1	1610	32	the	the	DT
cord-014462-11ggaqf1	1610	33	year	year	NN
cord-014462-11ggaqf1	1610	34	2007	2007	CD
cord-014462-11ggaqf1	1610	35	.	.	.
cord-014462-11ggaqf1	1611	1	The	the	DT
cord-014462-11ggaqf1	1611	2	whitefly	whitefly	NN
cord-014462-11ggaqf1	1611	3	(	(	-LRB-
cord-014462-11ggaqf1	1611	4	Bemisia	Bemisia	NNP
cord-014462-11ggaqf1	1611	5	tabaci	tabaci	NNP
cord-014462-11ggaqf1	1611	6	)	)	-RRB-
cord-014462-11ggaqf1	1611	7	population	population	NN
cord-014462-11ggaqf1	1611	8	was	be	VBD
cord-014462-11ggaqf1	1611	9	also	also	RB
cord-014462-11ggaqf1	1611	10	observed	observe	VBN
cord-014462-11ggaqf1	1611	11	in	in	IN
cord-014462-11ggaqf1	1611	12	the	the	DT
cord-014462-11ggaqf1	1611	13	vicinity	vicinity	NN
cord-014462-11ggaqf1	1611	14	.	.	.
cord-014462-11ggaqf1	1612	1	The	the	DT
cord-014462-11ggaqf1	1612	2	characteristic	characteristic	JJ
cord-014462-11ggaqf1	1612	3	disease	disease	NN
cord-014462-11ggaqf1	1612	4	symptoms	symptom	NNS
cord-014462-11ggaqf1	1612	5	and	and	CC
cord-014462-11ggaqf1	1612	6	whitefly	whitefly	NN
cord-014462-11ggaqf1	1612	7	population	population	NN
cord-014462-11ggaqf1	1612	8	indicated	indicate	VBD
cord-014462-11ggaqf1	1612	9	the	the	DT
cord-014462-11ggaqf1	1612	10	possibility	possibility	NN
cord-014462-11ggaqf1	1612	11	of	of	IN
cord-014462-11ggaqf1	1612	12	begomovirus	begomovirus	JJ
cord-014462-11ggaqf1	1612	13	infection	infection	NN
cord-014462-11ggaqf1	1612	14	.	.	.
cord-014462-11ggaqf1	1613	1	Total	total	JJ
cord-014462-11ggaqf1	1613	2	DNA	DNA	NNP
cord-014462-11ggaqf1	1613	3	were	be	VBD
cord-014462-11ggaqf1	1613	4	isolated	isolate	VBN
cord-014462-11ggaqf1	1613	5	from	from	IN
cord-014462-11ggaqf1	1613	6	infected	infect	VBN
cord-014462-11ggaqf1	1613	7	as	as	RB
cord-014462-11ggaqf1	1613	8	well	well	RB
cord-014462-11ggaqf1	1613	9	as	as	IN
cord-014462-11ggaqf1	1613	10	healthy	healthy	JJ
cord-014462-11ggaqf1	1613	11	leaf	leaf	NN
cord-014462-11ggaqf1	1613	12	samples	sample	NNS
cord-014462-11ggaqf1	1613	13	.	.	.
cord-014462-11ggaqf1	1614	1	Two	two	CD
cord-014462-11ggaqf1	1614	2	primer	primer	NN
cord-014462-11ggaqf1	1614	3	pair	pair	NN
cord-014462-11ggaqf1	1614	4	(	(	-LRB-
cord-014462-11ggaqf1	1614	5	TLCV	TLCV	NNP
cord-014462-11ggaqf1	1614	6	-	-	HYPH
cord-014462-11ggaqf1	1614	7	CP	CP	NNP
cord-014462-11ggaqf1	1614	8	and	and	CC
cord-014462-11ggaqf1	1614	9	Roja	Roja	NNP
cord-014462-11ggaqf1	1614	10	's	's	POS
cord-014462-11ggaqf1	1614	11	Primer	primer	NN
cord-014462-11ggaqf1	1614	12	)	)	-RRB-
cord-014462-11ggaqf1	1614	13	were	be	VBD
cord-014462-11ggaqf1	1614	14	used	use	VBN
cord-014462-11ggaqf1	1614	15	to	to	TO
cord-014462-11ggaqf1	1614	16	study	study	VB
cord-014462-11ggaqf1	1614	17	,	,	,
cord-014462-11ggaqf1	1614	18	which	which	WDT
cord-014462-11ggaqf1	1614	19	resulted	result	VBD
cord-014462-11ggaqf1	1614	20	*	*	NFP
cord-014462-11ggaqf1	1614	21	800	800	CD
cord-014462-11ggaqf1	1614	22	bp	bp	NNP
cord-014462-11ggaqf1	1614	23	with	with	IN
cord-014462-11ggaqf1	1614	24	TLCV	TLCV	NNP
cord-014462-11ggaqf1	1614	25	-	-	HYPH
cord-014462-11ggaqf1	1614	26	CP	cp	NN
cord-014462-11ggaqf1	1614	27	in	in	IN
cord-014462-11ggaqf1	1614	28	3/3	3/3	CD
cord-014462-11ggaqf1	1614	29	samples	sample	NNS
cord-014462-11ggaqf1	1614	30	and	and	CC
cord-014462-11ggaqf1	1614	31	*	*	NFP
cord-014462-11ggaqf1	1614	32	1.3	1.3	CD
cord-014462-11ggaqf1	1614	33	kb	kb	NNP
cord-014462-11ggaqf1	1614	34	amplicons	amplicon	NNS
cord-014462-11ggaqf1	1614	35	with	with	IN
cord-014462-11ggaqf1	1614	36	Roja	Roja	NNP
cord-014462-11ggaqf1	1614	37	's	's	POS
cord-014462-11ggaqf1	1614	38	primer	primer	NN
cord-014462-11ggaqf1	1614	39	in	in	IN
cord-014462-11ggaqf1	1614	40	3/4	3/4	CD
cord-014462-11ggaqf1	1614	41	samples	sample	NNS
cord-014462-11ggaqf1	1614	42	.	.	.
cord-014462-11ggaqf1	1615	1	For	for	IN
cord-014462-11ggaqf1	1615	2	further	further	JJ
cord-014462-11ggaqf1	1615	3	identification	identification	NN
cord-014462-11ggaqf1	1615	4	of	of	IN
cord-014462-11ggaqf1	1615	5	the	the	DT
cord-014462-11ggaqf1	1615	6	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1615	7	,	,	,
cord-014462-11ggaqf1	1615	8	the	the	DT
cord-014462-11ggaqf1	1615	9	PCR	PCR	NNP
cord-014462-11ggaqf1	1615	10	amplicons	amplicon	NNS
cord-014462-11ggaqf1	1615	11	were	be	VBD
cord-014462-11ggaqf1	1615	12	cloned	clone	VBN
cord-014462-11ggaqf1	1615	13	and	and	CC
cord-014462-11ggaqf1	1615	14	sequenced	sequence	VBN
cord-014462-11ggaqf1	1616	1	(	(	-LRB-
cord-014462-11ggaqf1	1616	2	GenBank	GenBank	NNP
cord-014462-11ggaqf1	1616	3	accession	accession	NN
cord-014462-11ggaqf1	1616	4	no	no	UH
cord-014462-11ggaqf1	1616	5	.	.	.
cord-014462-11ggaqf1	1617	1	EU439260	eu439260	NN
cord-014462-11ggaqf1	1617	2	and	and	CC
cord-014462-11ggaqf1	1617	3	EU888908	eu888908	NN
cord-014462-11ggaqf1	1617	4	,	,	,
cord-014462-11ggaqf1	1617	5	respectively	respectively	RB
cord-014462-11ggaqf1	1617	6	)	)	-RRB-
cord-014462-11ggaqf1	1617	7	.	.	.
cord-014462-11ggaqf1	1618	1	The	the	DT
cord-014462-11ggaqf1	1618	2	BLASTn	BLASTn	NNS
cord-014462-11ggaqf1	1618	3	search	search	NN
cord-014462-11ggaqf1	1618	4	analysis	analysis	NN
cord-014462-11ggaqf1	1618	5	of	of	IN
cord-014462-11ggaqf1	1618	6	EU439260	eu439260	NN
cord-014462-11ggaqf1	1618	7	indicated	indicate	VBD
cord-014462-11ggaqf1	1618	8	99	99	CD
cord-014462-11ggaqf1	1618	9	-	-	SYM
cord-014462-11ggaqf1	1618	10	95	95	CD
cord-014462-11ggaqf1	1618	11	%	%	NN
cord-014462-11ggaqf1	1618	12	identity	identity	NN
cord-014462-11ggaqf1	1618	13	with	with	IN
cord-014462-11ggaqf1	1618	14	several	several	JJ
cord-014462-11ggaqf1	1618	15	isolates	isolate	NNS
cord-014462-11ggaqf1	1618	16	of	of	IN
cord-014462-11ggaqf1	1618	17	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1618	18	leaf	leaf	NN
cord-014462-11ggaqf1	1618	19	curl	curl	NN
cord-014462-11ggaqf1	1618	20	New	New	NNP
cord-014462-11ggaqf1	1618	21	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1618	22	virus	virus	NN
cord-014462-11ggaqf1	1618	23	(	(	-LRB-
cord-014462-11ggaqf1	1618	24	ToLCNDV	ToLCNDV	NNP
cord-014462-11ggaqf1	1618	25	)	)	-RRB-
cord-014462-11ggaqf1	1618	26	.	.	.
cord-014462-11ggaqf1	1619	1	The	the	DT
cord-014462-11ggaqf1	1619	2	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1619	3	analysis	analysis	NN
cord-014462-11ggaqf1	1619	4	also	also	RB
cord-014462-11ggaqf1	1619	5	showed	show	VBD
cord-014462-11ggaqf1	1619	6	closest	close	JJS
cord-014462-11ggaqf1	1619	7	relationships	relationship	NNS
cord-014462-11ggaqf1	1619	8	of	of	IN
cord-014462-11ggaqf1	1619	9	the	the	DT
cord-014462-11ggaqf1	1619	10	isolate	isolate	NN
cord-014462-11ggaqf1	1619	11	(	(	-LRB-
cord-014462-11ggaqf1	1619	12	EU439260	eu439260	NN
cord-014462-11ggaqf1	1619	13	)	)	-RRB-
cord-014462-11ggaqf1	1619	14	with	with	IN
cord-014462-11ggaqf1	1619	15	ToLCNDV	tolcndv	JJ
cord-014462-11ggaqf1	1619	16	isolates	isolate	NNS
cord-014462-11ggaqf1	1619	17	.	.	.
cord-014462-11ggaqf1	1620	1	Based	base	VBN
cord-014462-11ggaqf1	1620	2	on	on	IN
cord-014462-11ggaqf1	1620	3	highest	high	JJS
cord-014462-11ggaqf1	1620	4	sequence	sequence	NN
cord-014462-11ggaqf1	1620	5	identity	identity	NN
cord-014462-11ggaqf1	1620	6	and	and	CC
cord-014462-11ggaqf1	1620	7	closed	close	VBN
cord-014462-11ggaqf1	1620	8	relationships	relationship	NNS
cord-014462-11ggaqf1	1620	9	with	with	IN
cord-014462-11ggaqf1	1620	10	ToLCNDV	ToLCNDV	,
cord-014462-11ggaqf1	1620	11	the	the	DT
cord-014462-11ggaqf1	1620	12	virus	virus	NN
cord-014462-11ggaqf1	1620	13	isolated	isolate	VBN
cord-014462-11ggaqf1	1620	14	from	from	IN
cord-014462-11ggaqf1	1620	15	bitter	bitter	JJ
cord-014462-11ggaqf1	1620	16	gourd	gourd	NN
cord-014462-11ggaqf1	1620	17	was	be	VBD
cord-014462-11ggaqf1	1620	18	considered	consider	VBN
cord-014462-11ggaqf1	1620	19	as	as	IN
cord-014462-11ggaqf1	1620	20	an	an	DT
cord-014462-11ggaqf1	1620	21	isolate	isolate	NN
cord-014462-11ggaqf1	1620	22	of	of	IN
cord-014462-11ggaqf1	1620	23	Tomato	Tomato	NNP
cord-014462-11ggaqf1	1620	24	leaf	leaf	NN
cord-014462-11ggaqf1	1620	25	curl	curl	NN
cord-014462-11ggaqf1	1620	26	New	New	NNP
cord-014462-11ggaqf1	1620	27	Delhi	Delhi	NNP
cord-014462-11ggaqf1	1620	28	virus	virus	NN
cord-014462-11ggaqf1	1620	29	.	.	.
cord-014462-11ggaqf1	1621	1	While	while	IN
cord-014462-11ggaqf1	1621	2	,	,	,
cord-014462-11ggaqf1	1621	3	BLASTn	BLASTn	NNS
cord-014462-11ggaqf1	1621	4	search	search	NN
cord-014462-11ggaqf1	1621	5	analysis	analysis	NN
cord-014462-11ggaqf1	1621	6	of	of	IN
cord-014462-11ggaqf1	1621	7	EU888908	EU888908	``
cord-014462-11ggaqf1	1621	8	isolate	isolate	NN
cord-014462-11ggaqf1	1621	9	,	,	,
cord-014462-11ggaqf1	1621	10	shared	share	VBD
cord-014462-11ggaqf1	1621	11	highest	high	JJS
cord-014462-11ggaqf1	1621	12	99	99	CD
cord-014462-11ggaqf1	1621	13	-	-	SYM
cord-014462-11ggaqf1	1621	14	97	97	CD
cord-014462-11ggaqf1	1621	15	%	%	NN
cord-014462-11ggaqf1	1621	16	identites	identite	NNS
cord-014462-11ggaqf1	1621	17	with	with	IN
cord-014462-11ggaqf1	1621	18	Pepper	Pepper	NNP
cord-014462-11ggaqf1	1621	19	leaf	leaf	NN
cord-014462-11ggaqf1	1621	20	curl	curl	NN
cord-014462-11ggaqf1	1621	21	Bangladesh	Bangladesh	NNP
cord-014462-11ggaqf1	1621	22	virus	virus	NN
cord-014462-11ggaqf1	1621	23	(	(	-LRB-
cord-014462-11ggaqf1	1621	24	PepLCBV	peplcbv	NN
cord-014462-11ggaqf1	1621	25	)	)	-RRB-
cord-014462-11ggaqf1	1621	26	isolates	isolate	NNS
cord-014462-11ggaqf1	1621	27	.	.	.
cord-014462-11ggaqf1	1622	1	The	the	DT
cord-014462-11ggaqf1	1622	2	phylogenetic	phylogenetic	JJ
cord-014462-11ggaqf1	1622	3	analysis	analysis	NN
cord-014462-11ggaqf1	1622	4	of	of	IN
cord-014462-11ggaqf1	1622	5	the	the	DT
cord-014462-11ggaqf1	1622	6	virus	virus	NN
cord-014462-11ggaqf1	1622	7	isolate	isolate	VBP
cord-014462-11ggaqf1	1622	8	with	with	IN
cord-014462-11ggaqf1	1622	9	selected	select	VBN
cord-014462-11ggaqf1	1622	10	begomovirus	begomovirus	NNP
cord-014462-11ggaqf1	1622	11	isolates	isolate	NNS
cord-014462-11ggaqf1	1622	12	revealed	reveal	VBD
cord-014462-11ggaqf1	1622	13	a	a	DT
cord-014462-11ggaqf1	1622	14	closest	close	JJS
cord-014462-11ggaqf1	1622	15	relationship	relationship	NN
cord-014462-11ggaqf1	1622	16	with	with	IN
cord-014462-11ggaqf1	1622	17	PepLCBV	peplcbv	NN
cord-014462-11ggaqf1	1622	18	.	.	.
cord-014462-11ggaqf1	1623	1	These	these	DT
cord-014462-11ggaqf1	1623	2	results	result	NNS
cord-014462-11ggaqf1	1623	3	confirmed	confirm	VBD
cord-014462-11ggaqf1	1623	4	the	the	DT
cord-014462-11ggaqf1	1623	5	association	association	NN
cord-014462-11ggaqf1	1623	6	of	of	IN
cord-014462-11ggaqf1	1623	7	PepLCBV	PepLCBV	NNP
cord-014462-11ggaqf1	1623	8	on	on	IN
cord-014462-11ggaqf1	1623	9	bitter	bitter	JJ
cord-014462-11ggaqf1	1623	10	gourd	gourd	NN
cord-014462-11ggaqf1	1623	11	.	.	.
cord-014462-11ggaqf1	1624	1	Study	study	NN
cord-014462-11ggaqf1	1624	2	revealed	reveal	VBD
cord-014462-11ggaqf1	1624	3	the	the	DT
cord-014462-11ggaqf1	1624	4	variability	variability	NN
cord-014462-11ggaqf1	1624	5	of	of	IN
cord-014462-11ggaqf1	1624	6	viruses	virus	NNS
cord-014462-11ggaqf1	1624	7	on	on	IN
cord-014462-11ggaqf1	1624	8	bitter	bitter	JJ
cord-014462-11ggaqf1	1624	9	gourd	gourd	NN
cord-014462-11ggaqf1	1624	10	in	in	IN
cord-014462-11ggaqf1	1624	11	Eastern	Eastern	NNP
cord-014462-11ggaqf1	1624	12	UP	UP	NNP
cord-014462-11ggaqf1	1624	13	,	,	,
cord-014462-11ggaqf1	1624	14	India	India	NNP
cord-014462-11ggaqf1	1624	15	.	.	.
cord-014462-11ggaqf1	1625	1	Tobacco	tobacco	NN
cord-014462-11ggaqf1	1625	2	streak	streak	NN
cord-014462-11ggaqf1	1625	3	virus	virus	NN
cord-014462-11ggaqf1	1625	4	groundnut	groundnut	NN
cord-014462-11ggaqf1	1625	5	isolate	isolate	NN
cord-014462-11ggaqf1	1625	6	was	be	VBD
cord-014462-11ggaqf1	1625	7	characterized	characterize	VBN
cord-014462-11ggaqf1	1625	8	biologically	biologically	RB
cord-014462-11ggaqf1	1625	9	by	by	IN
cord-014462-11ggaqf1	1625	10	taking	take	VBG
cord-014462-11ggaqf1	1625	11	six	six	CD
cord-014462-11ggaqf1	1625	12	cultivars	cultivar	NNS
cord-014462-11ggaqf1	1625	13	(	(	-LRB-
cord-014462-11ggaqf1	1625	14	JL24	JL24	NNP
cord-014462-11ggaqf1	1625	15	,	,	,
cord-014462-11ggaqf1	1625	16	TMV2	TMV2	NNP
cord-014462-11ggaqf1	1625	17	,	,	,
cord-014462-11ggaqf1	1625	18	K6	K6	NNP
cord-014462-11ggaqf1	1625	19	,	,	,
cord-014462-11ggaqf1	1625	20	K7	K7	NNP
cord-014462-11ggaqf1	1625	21	,	,	,
cord-014462-11ggaqf1	1625	22	K9	K9	NNP
cord-014462-11ggaqf1	1625	23	)	)	-RRB-
cord-014462-11ggaqf1	1625	24	and	and	CC
cord-014462-11ggaqf1	1625	25	one	one	CD
cord-014462-11ggaqf1	1625	26	pre	pre	JJ
cord-014462-11ggaqf1	1625	27	-	-	JJ
cord-014462-11ggaqf1	1625	28	release	release	JJ
cord-014462-11ggaqf1	1625	29	culture	culture	NN
cord-014462-11ggaqf1	1625	30	(	(	-LRB-
cord-014462-11ggaqf1	1625	31	K1271	K1271	NNP
cord-014462-11ggaqf1	1625	32	)	)	-RRB-
cord-014462-11ggaqf1	1625	33	using	use	VBG
cord-014462-11ggaqf1	1625	34	seedlings	seedling	NNS
cord-014462-11ggaqf1	1625	35	of	of	IN
cord-014462-11ggaqf1	1625	36	7	7	CD
cord-014462-11ggaqf1	1625	37	-	-	SYM
cord-014462-11ggaqf1	1625	38	84	84	CD
cord-014462-11ggaqf1	1625	39	days	day	NNS
cord-014462-11ggaqf1	1625	40	old	old	JJ
cord-014462-11ggaqf1	1625	41	under	under	IN
cord-014462-11ggaqf1	1625	42	glasshouse	glasshouse	NN
cord-014462-11ggaqf1	1625	43	conditions	condition	NNS
cord-014462-11ggaqf1	1625	44	.	.	.
cord-014462-11ggaqf1	1626	1	There	there	EX
cord-014462-11ggaqf1	1626	2	were	be	VBD
cord-014462-11ggaqf1	1626	3	clear	clear	JJ
cord-014462-11ggaqf1	1626	4	differences	difference	NNS
cord-014462-11ggaqf1	1626	5	were	be	VBD
cord-014462-11ggaqf1	1626	6	observed	observe	VBN
cord-014462-11ggaqf1	1626	7	among	among	IN
cord-014462-11ggaqf1	1626	8	cultivars	cultivar	NNS
cord-014462-11ggaqf1	1626	9	tested	test	VBD
cord-014462-11ggaqf1	1626	10	regarding	regard	VBG
cord-014462-11ggaqf1	1626	11	incubation	incubation	NN
cord-014462-11ggaqf1	1626	12	period	period	NN
cord-014462-11ggaqf1	1626	13	,	,	,
cord-014462-11ggaqf1	1626	14	percent	percent	NN
cord-014462-11ggaqf1	1626	15	seedling	seedling	NN
cord-014462-11ggaqf1	1626	16	wilt	wilt	NN
cord-014462-11ggaqf1	1626	17	and	and	CC
cord-014462-11ggaqf1	1626	18	time	time	NN
cord-014462-11ggaqf1	1626	19	taken	take	VBN
cord-014462-11ggaqf1	1626	20	to	to	IN
cord-014462-11ggaqf1	1626	21	death	death	NN
cord-014462-11ggaqf1	1626	22	of	of	IN
cord-014462-11ggaqf1	1626	23	seedlings	seedling	NNS
cord-014462-11ggaqf1	1626	24	.	.	.
cord-014462-11ggaqf1	1627	1	K-7	K-7	NNP
cord-014462-11ggaqf1	1627	2	was	be	VBD
cord-014462-11ggaqf1	1627	3	least	least	RBS
cord-014462-11ggaqf1	1627	4	susceptible	susceptible	JJ
cord-014462-11ggaqf1	1627	5	among	among	IN
cord-014462-11ggaqf1	1627	6	all	all	PDT
cord-014462-11ggaqf1	1627	7	the	the	DT
cord-014462-11ggaqf1	1627	8	cultivars	cultivar	NNS
cord-014462-11ggaqf1	1627	9	tested	test	VBN
cord-014462-11ggaqf1	1627	10	and	and	CC
cord-014462-11ggaqf1	1627	11	it	-PRON-	PRP
cord-014462-11ggaqf1	1627	12	supported	support	VBD
cord-014462-11ggaqf1	1627	13	least	least	JJS
cord-014462-11ggaqf1	1627	14	virus	virus	NN
cord-014462-11ggaqf1	1627	15	titer	titer	NN
cord-014462-11ggaqf1	1627	16	(	(	-LRB-
cord-014462-11ggaqf1	1627	17	A	A	NNP
cord-014462-11ggaqf1	1627	18	405	405	CD
cord-014462-11ggaqf1	1627	19	nm	nm	NN
cord-014462-11ggaqf1	1627	20	:	:	:
cord-014462-11ggaqf1	1627	21	0.11	0.11	CD
cord-014462-11ggaqf1	1627	22	-	-	SYM
cord-014462-11ggaqf1	1627	23	1.23	1.23	CD
cord-014462-11ggaqf1	1627	24	)	)	-RRB-
cord-014462-11ggaqf1	1627	25	.	.	.
cord-014462-11ggaqf1	1628	1	Both	both	DT
cord-014462-11ggaqf1	1628	2	localized	localized	JJ
cord-014462-11ggaqf1	1628	3	(	(	-LRB-
cord-014462-11ggaqf1	1628	4	necrotic	necrotic	JJ
cord-014462-11ggaqf1	1628	5	lesions	lesion	NNS
cord-014462-11ggaqf1	1628	6	on	on	IN
cord-014462-11ggaqf1	1628	7	leaf	leaf	NN
cord-014462-11ggaqf1	1628	8	,	,	,
cord-014462-11ggaqf1	1628	9	veinal	veinal	JJ
cord-014462-11ggaqf1	1628	10	necrosis	necrosis	NN
cord-014462-11ggaqf1	1628	11	,	,	,
cord-014462-11ggaqf1	1628	12	leaf	leaf	NN
cord-014462-11ggaqf1	1628	13	yellowing	yellowing	NN
cord-014462-11ggaqf1	1628	14	,	,	,
cord-014462-11ggaqf1	1628	15	wilting	wilt	VBG
cord-014462-11ggaqf1	1628	16	)	)	-RRB-
cord-014462-11ggaqf1	1628	17	and	and	CC
cord-014462-11ggaqf1	1628	18	systemic	systemic	JJ
cord-014462-11ggaqf1	1628	19	(	(	-LRB-
cord-014462-11ggaqf1	1628	20	petiole	petiole	JJ
cord-014462-11ggaqf1	1628	21	necrosis	necrosis	NN
cord-014462-11ggaqf1	1628	22	,	,	,
cord-014462-11ggaqf1	1628	23	necrotic	necrotic	JJ
cord-014462-11ggaqf1	1628	24	lesions	lesion	NNS
cord-014462-11ggaqf1	1628	25	on	on	IN
cord-014462-11ggaqf1	1628	26	young	young	JJ
cord-014462-11ggaqf1	1628	27	leaves	leave	NNS
cord-014462-11ggaqf1	1628	28	,	,	,
cord-014462-11ggaqf1	1628	29	death	death	NN
cord-014462-11ggaqf1	1628	30	of	of	IN
cord-014462-11ggaqf1	1628	31	top	top	JJ
cord-014462-11ggaqf1	1628	32	growing	grow	VBG
cord-014462-11ggaqf1	1628	33	buds	bud	NNS
cord-014462-11ggaqf1	1628	34	not	not	RB
cord-014462-11ggaqf1	1628	35	only	only	RB
cord-014462-11ggaqf1	1628	36	on	on	IN
cord-014462-11ggaqf1	1628	37	main	main	JJ
cord-014462-11ggaqf1	1628	38	stem	stem	NN
cord-014462-11ggaqf1	1628	39	but	but	CC
cord-014462-11ggaqf1	1628	40	also	also	RB
cord-014462-11ggaqf1	1628	41	on	on	IN
cord-014462-11ggaqf1	1628	42	all	all	DT
cord-014462-11ggaqf1	1628	43	primaries	primary	NNS
cord-014462-11ggaqf1	1628	44	(	(	-LRB-
cord-014462-11ggaqf1	1628	45	side	side	NN
cord-014462-11ggaqf1	1628	46	shoots	shoot	NNS
cord-014462-11ggaqf1	1628	47	)	)	-RRB-
cord-014462-11ggaqf1	1628	48	,	,	,
cord-014462-11ggaqf1	1628	49	followed	follow	VBN
cord-014462-11ggaqf1	1628	50	by	by	IN
cord-014462-11ggaqf1	1628	51	stem	stem	NN
cord-014462-11ggaqf1	1628	52	necrosis	necrosis	NN
cord-014462-11ggaqf1	1628	53	,	,	,
cord-014462-11ggaqf1	1628	54	stunted	stunted	JJ
cord-014462-11ggaqf1	1628	55	growth	growth	NN
cord-014462-11ggaqf1	1628	56	,	,	,
cord-014462-11ggaqf1	1628	57	axillary	axillary	JJ
cord-014462-11ggaqf1	1628	58	shoot	shoot	NN
cord-014462-11ggaqf1	1628	59	proliferation	proliferation	NN
cord-014462-11ggaqf1	1628	60	with	with	IN
cord-014462-11ggaqf1	1628	61	small	small	JJ
cord-014462-11ggaqf1	1628	62	leaves	leave	NNS
cord-014462-11ggaqf1	1628	63	having	have	VBG
cord-014462-11ggaqf1	1628	64	general	general	JJ
cord-014462-11ggaqf1	1628	65	chlorosis	chlorosis	NN
cord-014462-11ggaqf1	1628	66	,	,	,
cord-014462-11ggaqf1	1628	67	peg	peg	NN
cord-014462-11ggaqf1	1628	68	necrosis	necrosis	NN
cord-014462-11ggaqf1	1628	69	,	,	,
cord-014462-11ggaqf1	1628	70	pod	pod	NN
cord-014462-11ggaqf1	1628	71	necrosis	necrosis	NN
cord-014462-11ggaqf1	1628	72	,	,	,
cord-014462-11ggaqf1	1628	73	pod	pod	NN
cord-014462-11ggaqf1	1628	74	size	size	NN
cord-014462-11ggaqf1	1628	75	reduction	reduction	NN
cord-014462-11ggaqf1	1628	76	,	,	,
cord-014462-11ggaqf1	1628	77	wilt	wilt	NN
cord-014462-11ggaqf1	1628	78	of	of	IN
cord-014462-11ggaqf1	1628	79	plants	plant	NNS
cord-014462-11ggaqf1	1628	80	)	)	-RRB-
cord-014462-11ggaqf1	1629	1	symptom	symptom	NN
cord-014462-11ggaqf1	1629	2	were	be	VBD
cord-014462-11ggaqf1	1629	3	observed	observe	VBN
cord-014462-11ggaqf1	1629	4	in	in	IN
cord-014462-11ggaqf1	1629	5	all	all	DT
cord-014462-11ggaqf1	1629	6	cultivars	cultivar	NNS
cord-014462-11ggaqf1	1629	7	tested	test	VBN
cord-014462-11ggaqf1	1629	8	.	.	.
cord-014462-11ggaqf1	1630	1	Biological	biological	JJ
cord-014462-11ggaqf1	1630	2	differentiation	differentiation	NN
cord-014462-11ggaqf1	1630	3	of	of	IN
cord-014462-11ggaqf1	1630	4	TSV	TSV	NNP
cord-014462-11ggaqf1	1630	5	and	and	CC
cord-014462-11ggaqf1	1630	6	GBNV	GBNV	NNP
cord-014462-11ggaqf1	1630	7	was	be	VBD
cord-014462-11ggaqf1	1630	8	made	make	VBN
cord-014462-11ggaqf1	1630	9	by	by	IN
cord-014462-11ggaqf1	1630	10	sap	sap	NN
cord-014462-11ggaqf1	1630	11	inoculation	inoculation	NN
cord-014462-11ggaqf1	1630	12	of	of	IN
cord-014462-11ggaqf1	1630	13	both	both	DT
cord-014462-11ggaqf1	1630	14	viruses	virus	NNS
cord-014462-11ggaqf1	1630	15	separately	separately	RB
cord-014462-11ggaqf1	1630	16	using	use	VBG
cord-014462-11ggaqf1	1630	17	susceptible	susceptible	JJ
cord-014462-11ggaqf1	1630	18	groundnut	groundnut	NN
cord-014462-11ggaqf1	1630	19	cultivar	cultivar	NN
cord-014462-11ggaqf1	1630	20	JL24	JL24	NNP
cord-014462-11ggaqf1	1630	21	under	under	IN
cord-014462-11ggaqf1	1630	22	glasshouse	glasshouse	NN
cord-014462-11ggaqf1	1630	23	conditions	condition	NNS
cord-014462-11ggaqf1	1630	24	.	.	.
cord-014462-11ggaqf1	1631	1	There	there	EX
cord-014462-11ggaqf1	1631	2	were	be	VBD
cord-014462-11ggaqf1	1632	1	certain	certain	JJ
cord-014462-11ggaqf1	1632	2	similarities	similarity	NNS
cord-014462-11ggaqf1	1632	3	and	and	CC
cord-014462-11ggaqf1	1632	4	differences	difference	NNS
cord-014462-11ggaqf1	1632	5	were	be	VBD
cord-014462-11ggaqf1	1632	6	observed	observe	VBN
cord-014462-11ggaqf1	1632	7	between	between	IN
cord-014462-11ggaqf1	1632	8	these	these	DT
cord-014462-11ggaqf1	1632	9	viruses	virus	NNS
cord-014462-11ggaqf1	1632	10	infecting	infect	VBG
cord-014462-11ggaqf1	1632	11	groundnut	groundnut	NN
cord-014462-11ggaqf1	1632	12	.	.	.
cord-014462-11ggaqf1	1633	1	Seed	seed	NN
cord-014462-11ggaqf1	1633	2	infection	infection	NN
cord-014462-11ggaqf1	1633	3	of	of	IN
cord-014462-11ggaqf1	1633	4	TSV	TSV	NNP
cord-014462-11ggaqf1	1633	5	ranged	range	VBD
cord-014462-11ggaqf1	1633	6	from	from	IN
cord-014462-11ggaqf1	1633	7	18.9	18.9	CD
cord-014462-11ggaqf1	1633	8	to	to	IN
cord-014462-11ggaqf1	1633	9	28.9	28.9	CD
cord-014462-11ggaqf1	1633	10	%	%	NN
cord-014462-11ggaqf1	1633	11	in	in	IN
cord-014462-11ggaqf1	1633	12	seeds	seed	NNS
cord-014462-11ggaqf1	1633	13	collected	collect	VBN
cord-014462-11ggaqf1	1633	14	from	from	IN
cord-014462-11ggaqf1	1633	15	naturally	naturally	RB
cord-014462-11ggaqf1	1633	16	infected	infect	VBN
cord-014462-11ggaqf1	1633	17	and	and	CC
cord-014462-11ggaqf1	1633	18	sap	sap	NN
cord-014462-11ggaqf1	1633	19	inoculated	inoculate	VBD
cord-014462-11ggaqf1	1633	20	groundnut	groundnut	NN
cord-014462-11ggaqf1	1633	21	cultivars	cultivar	NNS
cord-014462-11ggaqf1	1633	22	/	/	SYM
cord-014462-11ggaqf1	1633	23	pre	pre	NNS
cord-014462-11ggaqf1	1633	24	-	-	NNS
cord-014462-11ggaqf1	1633	25	releases	release	NNS
cord-014462-11ggaqf1	1633	26	(	(	-LRB-
cord-014462-11ggaqf1	1633	27	JL24	JL24	NNP
cord-014462-11ggaqf1	1633	28	,	,	,
cord-014462-11ggaqf1	1633	29	TMV2	TMV2	NNP
cord-014462-11ggaqf1	1633	30	,	,	,
cord-014462-11ggaqf1	1633	31	K-6	K-6	NNP
cord-014462-11ggaqf1	1633	32	,	,	,
cord-014462-11ggaqf1	1633	33	K-7	K-7	NNP
cord-014462-11ggaqf1	1633	34	,	,	,
cord-014462-11ggaqf1	1633	35	K-9	K-9	NNP
cord-014462-11ggaqf1	1633	36	and	and	CC
cord-014462-11ggaqf1	1633	37	K-1271	K-1271	NNP
cord-014462-11ggaqf1	1633	38	)	)	-RRB-
cord-014462-11ggaqf1	1633	39	belonging	belong	VBG
cord-014462-11ggaqf1	1633	40	to	to	IN
cord-014462-11ggaqf1	1633	41	spanish	spanish	NNP
cord-014462-11ggaqf1	1633	42	and	and	CC
cord-014462-11ggaqf1	1633	43	virginia	virginia	NNP
cord-014462-11ggaqf1	1633	44	types	type	NNS
cord-014462-11ggaqf1	1633	45	.	.	.
cord-014462-11ggaqf1	1634	1	TSV	TSV	NNP
cord-014462-11ggaqf1	1634	2	was	be	VBD
cord-014462-11ggaqf1	1634	3	detected	detect	VBN
cord-014462-11ggaqf1	1634	4	both	both	CC
cord-014462-11ggaqf1	1634	5	in	in	IN
cord-014462-11ggaqf1	1634	6	pod	pod	NN
cord-014462-11ggaqf1	1634	7	shell	shell	NN
cord-014462-11ggaqf1	1634	8	and	and	CC
cord-014462-11ggaqf1	1634	9	seed	seed	NNP
cord-014462-11ggaqf1	1634	10	testa	testa	NNP
cord-014462-11ggaqf1	1634	11	from	from	IN
cord-014462-11ggaqf1	1634	12	pod	pod	NN
cord-014462-11ggaqf1	1634	13	samples	sample	NNS
cord-014462-11ggaqf1	1634	14	produced	produce	VBN
cord-014462-11ggaqf1	1634	15	by	by	IN
cord-014462-11ggaqf1	1634	16	sap	sap	NN
cord-014462-11ggaqf1	1634	17	inoculation	inoculation	NN
cord-014462-11ggaqf1	1634	18	under	under	IN
cord-014462-11ggaqf1	1634	19	glasshouse	glasshouse	NN
cord-014462-11ggaqf1	1634	20	conditions	condition	NNS
cord-014462-11ggaqf1	1634	21	.	.	.
cord-014462-11ggaqf1	1635	1	However	however	RB
cord-014462-11ggaqf1	1635	2	,	,	,
cord-014462-11ggaqf1	1635	3	seed	seed	NN
cord-014462-11ggaqf1	1635	4	transmission	transmission	NN
cord-014462-11ggaqf1	1635	5	of	of	IN
cord-014462-11ggaqf1	1635	6	TSV	TSV	NNP
cord-014462-11ggaqf1	1635	7	was	be	VBD
cord-014462-11ggaqf1	1635	8	not	not	RB
cord-014462-11ggaqf1	1635	9	observed	observe	VBN
cord-014462-11ggaqf1	1635	10	in	in	IN
cord-014462-11ggaqf1	1635	11	groundnut	groundnut	NN
cord-014462-11ggaqf1	1635	12	.	.	.
cord-014462-11ggaqf1	1636	1	Coat	coat	NN
cord-014462-11ggaqf1	1636	2	protein	protein	NN
cord-014462-11ggaqf1	1636	3	(	(	-LRB-
cord-014462-11ggaqf1	1636	4	CP	CP	NNP
cord-014462-11ggaqf1	1636	5	)	)	-RRB-
cord-014462-11ggaqf1	1636	6	gene	gene	NN
cord-014462-11ggaqf1	1636	7	of	of	IN
cord-014462-11ggaqf1	1636	8	three	three	CD
cord-014462-11ggaqf1	1636	9	groundnut	groundnut	NN
cord-014462-11ggaqf1	1636	10	TSV	TSV	NNP
cord-014462-11ggaqf1	1636	11	isolates	isolate	VBZ
cord-014462-11ggaqf1	1637	1	(	(	-LRB-
cord-014462-11ggaqf1	1637	2	GN	GN	NNP
cord-014462-11ggaqf1	1637	3	-	-	HYPH
cord-014462-11ggaqf1	1637	4	AP-1	AP-1	NNP
cord-014462-11ggaqf1	1637	5	-	-	HYPH
cord-014462-11ggaqf1	1637	6	00	00	NFP
cord-014462-11ggaqf1	1637	7	;	;	:
cord-014462-11ggaqf1	1637	8	GN	GN	NNP
cord-014462-11ggaqf1	1637	9	-	-	HYPH
cord-014462-11ggaqf1	1637	10	AP2	AP2	NNP
cord-014462-11ggaqf1	1637	11	-	-	HYPH
cord-014462-11ggaqf1	1637	12	04	04	CD
cord-014462-11ggaqf1	1637	13	;	;	:
cord-014462-11ggaqf1	1637	14	GN	GN	NNP
cord-014462-11ggaqf1	1637	15	-	-	HYPH
cord-014462-11ggaqf1	1637	16	AP3	AP3	NNP
cord-014462-11ggaqf1	1637	17	-	-	HYPH
cord-014462-11ggaqf1	1637	18	07	07	CD
cord-014462-11ggaqf1	1637	19	)	)	-RRB-
cord-014462-11ggaqf1	1637	20	were	be	VBD
cord-014462-11ggaqf1	1637	21	sequenced	sequence	VBN
cord-014462-11ggaqf1	1637	22	and	and	CC
cord-014462-11ggaqf1	1637	23	all	all	PDT
cord-014462-11ggaqf1	1637	24	the	the	DT
cord-014462-11ggaqf1	1637	25	three	three	CD
cord-014462-11ggaqf1	1637	26	isolates	isolate	NNS
cord-014462-11ggaqf1	1637	27	contained	contain	VBD
cord-014462-11ggaqf1	1637	28	a	a	DT
cord-014462-11ggaqf1	1637	29	single	single	JJ
cord-014462-11ggaqf1	1637	30	open	open	JJ
cord-014462-11ggaqf1	1637	31	reading	reading	NN
cord-014462-11ggaqf1	1637	32	frame	frame	NN
cord-014462-11ggaqf1	1637	33	(	(	-LRB-
cord-014462-11ggaqf1	1637	34	ORF	ORF	NNP
cord-014462-11ggaqf1	1637	35	)	)	-RRB-
cord-014462-11ggaqf1	1637	36	of	of	IN
cord-014462-11ggaqf1	1637	37	717	717	CD
cord-014462-11ggaqf1	1637	38	bp	bp	NNP
cord-014462-11ggaqf1	1637	39	nucleotide	nucleotide	NN
cord-014462-11ggaqf1	1637	40	and	and	CC
cord-014462-11ggaqf1	1637	41	could	could	MD
cord-014462-11ggaqf1	1637	42	potentially	potentially	RB
cord-014462-11ggaqf1	1637	43	code	code	VB
cord-014462-11ggaqf1	1637	44	for	for	IN
cord-014462-11ggaqf1	1637	45	238	238	CD
cord-014462-11ggaqf1	1637	46	amino	amino	JJ
cord-014462-11ggaqf1	1637	47	acids	acid	NNS
cord-014462-11ggaqf1	1637	48	(	(	-LRB-
cord-014462-11ggaqf1	1637	49	aa	aa	NNP
cord-014462-11ggaqf1	1637	50	)	)	-RRB-
cord-014462-11ggaqf1	1637	51	.	.	.
cord-014462-11ggaqf1	1638	1	CP	cp	NN
cord-014462-11ggaqf1	1638	2	gene	gene	NN
cord-014462-11ggaqf1	1638	3	of	of	IN
cord-014462-11ggaqf1	1638	4	TSV	TSV	NNP
cord-014462-11ggaqf1	1638	5	isolates	isolate	NNS
cord-014462-11ggaqf1	1638	6	originating	originate	VBG
cord-014462-11ggaqf1	1638	7	from	from	IN
cord-014462-11ggaqf1	1638	8	different	different	JJ
cord-014462-11ggaqf1	1638	9	hosts	host	NNS
cord-014462-11ggaqf1	1638	10	shared	share	VBD
cord-014462-11ggaqf1	1638	11	high	high	JJ
cord-014462-11ggaqf1	1638	12	degree	degree	NN
cord-014462-11ggaqf1	1638	13	of	of	IN
cord-014462-11ggaqf1	1638	14	sequence	sequence	NN
cord-014462-11ggaqf1	1638	15	identity	identity	NN
cord-014462-11ggaqf1	1638	16	both	both	CC
cord-014462-11ggaqf1	1638	17	at	at	IN
cord-014462-11ggaqf1	1638	18	nucleotide	nucleotide	JJ
cord-014462-11ggaqf1	1638	19	(	(	-LRB-
cord-014462-11ggaqf1	1638	20	97.6	97.6	CD
cord-014462-11ggaqf1	1638	21	-	-	SYM
cord-014462-11ggaqf1	1638	22	100	100	CD
cord-014462-11ggaqf1	1638	23	%	%	NN
cord-014462-11ggaqf1	1638	24	)	)	-RRB-
cord-014462-11ggaqf1	1638	25	and	and	CC
cord-014462-11ggaqf1	1638	26	amino	amino	NN
cord-014462-11ggaqf1	1638	27	acid	acid	NN
cord-014462-11ggaqf1	1638	28	(	(	-LRB-
cord-014462-11ggaqf1	1638	29	95.7	95.7	CD
cord-014462-11ggaqf1	1638	30	-	-	SYM
cord-014462-11ggaqf1	1638	31	100	100	CD
cord-014462-11ggaqf1	1638	32	%	%	NN
cord-014462-11ggaqf1	1638	33	)	)	-RRB-
cord-014462-11ggaqf1	1638	34	levels	level	NNS
cord-014462-11ggaqf1	1638	35	respectively	respectively	RB
cord-014462-11ggaqf1	1638	36	.	.	.
cord-014462-11ggaqf1	1639	1	tones	tone	NNS
cord-014462-11ggaqf1	1639	2	grown	grow	VBN
cord-014462-11ggaqf1	1639	3	in	in	IN
cord-014462-11ggaqf1	1639	4	an	an	DT
cord-014462-11ggaqf1	1639	5	area	area	NN
cord-014462-11ggaqf1	1639	6	of	of	IN
cord-014462-11ggaqf1	1639	7	3.83.430	3.83.430	CD
cord-014462-11ggaqf1	1639	8	ha	ha	UH
cord-014462-11ggaqf1	1639	9	(	(	-LRB-
cord-014462-11ggaqf1	1639	10	FAO	FAO	NNP
cord-014462-11ggaqf1	1639	11	STAT2007	STAT2007	NNP
cord-014462-11ggaqf1	1639	12	)	)	-RRB-
cord-014462-11ggaqf1	1639	13	.	.	.
cord-014462-11ggaqf1	1640	1	In	in	IN
cord-014462-11ggaqf1	1640	2	India	India	NNP
cord-014462-11ggaqf1	1640	3	papaya	papaya	NN
cord-014462-11ggaqf1	1640	4	is	be	VBZ
cord-014462-11ggaqf1	1640	5	grown	grow	VBN
cord-014462-11ggaqf1	1640	6	in	in	IN
cord-014462-11ggaqf1	1640	7	nearly	nearly	RB
cord-014462-11ggaqf1	1640	8	80,000	80,000	CD
cord-014462-11ggaqf1	1640	9	ha	ha	UH
cord-014462-11ggaqf1	1640	10	with	with	IN
cord-014462-11ggaqf1	1640	11	an	an	DT
cord-014462-11ggaqf1	1640	12	annual	annual	JJ
cord-014462-11ggaqf1	1640	13	production	production	NN
cord-014462-11ggaqf1	1640	14	of	of	IN
cord-014462-11ggaqf1	1640	15	7,00,000	7,00,000	CD
cord-014462-11ggaqf1	1640	16	tones	tone	NNS
cord-014462-11ggaqf1	1640	17	(	(	-LRB-
cord-014462-11ggaqf1	1640	18	FAO	FAO	NNP
cord-014462-11ggaqf1	1640	19	STAT	STAT	NNP
cord-014462-11ggaqf1	1640	20	2007	2007	CD
cord-014462-11ggaqf1	1640	21	)	)	-RRB-
cord-014462-11ggaqf1	1640	22	and	and	CC
cord-014462-11ggaqf1	1640	23	occupies	occupy	VBZ
cord-014462-11ggaqf1	1640	24	fourth	fourth	JJ
cord-014462-11ggaqf1	1640	25	place	place	NN
cord-014462-11ggaqf1	1640	26	in	in	IN
cord-014462-11ggaqf1	1640	27	the	the	DT
cord-014462-11ggaqf1	1640	28	world	world	NN
cord-014462-11ggaqf1	1640	29	.	.	.
cord-014462-11ggaqf1	1641	1	The	the	DT
cord-014462-11ggaqf1	1641	2	crop	crop	NN
cord-014462-11ggaqf1	1641	3	is	be	VBZ
cord-014462-11ggaqf1	1641	4	severely	severely	RB
cord-014462-11ggaqf1	1641	5	affected	affect	VBN
cord-014462-11ggaqf1	1641	6	by	by	IN
cord-014462-11ggaqf1	1641	7	a	a	DT
cord-014462-11ggaqf1	1641	8	number	number	NN
cord-014462-11ggaqf1	1641	9	of	of	IN
cord-014462-11ggaqf1	1641	10	viruses	virus	NNS
cord-014462-11ggaqf1	1641	11	.	.	.
cord-014462-11ggaqf1	1642	1	Papaya	papaya	NN
cord-014462-11ggaqf1	1642	2	ring	ring	NN
cord-014462-11ggaqf1	1642	3	spot	spot	NN
cord-014462-11ggaqf1	1642	4	virus	virus	NN
cord-014462-11ggaqf1	1642	5	(	(	-LRB-
cord-014462-11ggaqf1	1642	6	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1642	7	-	-	HYPH
cord-014462-11ggaqf1	1642	8	P	P	NNP
cord-014462-11ggaqf1	1642	9	)	)	-RRB-
cord-014462-11ggaqf1	1642	10	is	be	VBZ
cord-014462-11ggaqf1	1642	11	the	the	DT
cord-014462-11ggaqf1	1642	12	most	most	RBS
cord-014462-11ggaqf1	1642	13	important	important	JJ
cord-014462-11ggaqf1	1642	14	virus	virus	NN
cord-014462-11ggaqf1	1642	15	.	.	.
cord-014462-11ggaqf1	1643	1	The	the	DT
cord-014462-11ggaqf1	1643	2	detection	detection	NN
cord-014462-11ggaqf1	1643	3	of	of	IN
cord-014462-11ggaqf1	1643	4	virus	virus	NN
cord-014462-11ggaqf1	1643	5	infection	infection	NN
cord-014462-11ggaqf1	1643	6	in	in	IN
cord-014462-11ggaqf1	1643	7	plants	plant	NNS
cord-014462-11ggaqf1	1643	8	has	have	VBZ
cord-014462-11ggaqf1	1643	9	traditionally	traditionally	RB
cord-014462-11ggaqf1	1643	10	involved	involve	VBN
cord-014462-11ggaqf1	1643	11	either	either	CC
cord-014462-11ggaqf1	1643	12	bioassay	bioassay	NN
cord-014462-11ggaqf1	1643	13	on	on	IN
cord-014462-11ggaqf1	1643	14	indexing	indexing	NN
cord-014462-11ggaqf1	1643	15	plants	plant	NNS
cord-014462-11ggaqf1	1643	16	and	and	CC
cord-014462-11ggaqf1	1643	17	or	or	CC
cord-014462-11ggaqf1	1643	18	immunological	immunological	JJ
cord-014462-11ggaqf1	1643	19	methods	method	NNS
cord-014462-11ggaqf1	1643	20	(	(	-LRB-
cord-014462-11ggaqf1	1643	21	Hill	Hill	NNP
cord-014462-11ggaqf1	1643	22	1981	1981	CD
cord-014462-11ggaqf1	1643	23	,	,	,
cord-014462-11ggaqf1	1643	24	Torrence	Torrence	NNP
cord-014462-11ggaqf1	1643	25	and	and	CC
cord-014462-11ggaqf1	1643	26	Jones	Jones	NNP
cord-014462-11ggaqf1	1643	27	1981	1981	CD
cord-014462-11ggaqf1	1643	28	)	)	-RRB-
cord-014462-11ggaqf1	1643	29	.	.	.
cord-014462-11ggaqf1	1644	1	Use	use	NN
cord-014462-11ggaqf1	1644	2	of	of	IN
cord-014462-11ggaqf1	1644	3	nucleic	nucleic	JJ
cord-014462-11ggaqf1	1644	4	acid	acid	NN
cord-014462-11ggaqf1	1644	5	probes	probe	NNS
cord-014462-11ggaqf1	1644	6	has	have	VBZ
cord-014462-11ggaqf1	1644	7	improved	improve	VBN
cord-014462-11ggaqf1	1644	8	the	the	DT
cord-014462-11ggaqf1	1644	9	detection	detection	NN
cord-014462-11ggaqf1	1644	10	and	and	CC
cord-014462-11ggaqf1	1644	11	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1644	12	of	of	IN
cord-014462-11ggaqf1	1644	13	viruses	virus	NNS
cord-014462-11ggaqf1	1644	14	.	.	.
cord-014462-11ggaqf1	1645	1	The	the	DT
cord-014462-11ggaqf1	1645	2	most	most	RBS
cord-014462-11ggaqf1	1645	3	common	common	JJ
cord-014462-11ggaqf1	1645	4	non	non	JJ
cord-014462-11ggaqf1	1645	5	-	-	JJ
cord-014462-11ggaqf1	1645	6	radioactive	radioactive	JJ
cord-014462-11ggaqf1	1645	7	probes	probe	NNS
cord-014462-11ggaqf1	1645	8	are	be	VBP
cord-014462-11ggaqf1	1645	9	Biotynilated	biotynilate	VBN
cord-014462-11ggaqf1	1645	10	probes	probe	NNS
cord-014462-11ggaqf1	1645	11	,	,	,
cord-014462-11ggaqf1	1645	12	which	which	WDT
cord-014462-11ggaqf1	1645	13	are	be	VBP
cord-014462-11ggaqf1	1645	14	very	very	RB
cord-014462-11ggaqf1	1645	15	specific	specific	JJ
cord-014462-11ggaqf1	1645	16	and	and	CC
cord-014462-11ggaqf1	1645	17	sensitive	sensitive	JJ
cord-014462-11ggaqf1	1645	18	.	.	.
cord-014462-11ggaqf1	1646	1	Papaya	papaya	NN
cord-014462-11ggaqf1	1646	2	ring	ring	NN
cord-014462-11ggaqf1	1646	3	spot	spot	NN
cord-014462-11ggaqf1	1646	4	virus	virus	NN
cord-014462-11ggaqf1	1646	5	(	(	-LRB-
cord-014462-11ggaqf1	1646	6	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1646	7	-	-	HYPH
cord-014462-11ggaqf1	1646	8	P	P	NNP
cord-014462-11ggaqf1	1646	9	)	)	-RRB-
cord-014462-11ggaqf1	1646	10	is	be	VBZ
cord-014462-11ggaqf1	1646	11	a	a	DT
cord-014462-11ggaqf1	1646	12	positive	positive	JJ
cord-014462-11ggaqf1	1646	13	sense	sense	NN
cord-014462-11ggaqf1	1646	14	ssRNA	ssRNA	''
cord-014462-11ggaqf1	1646	15	virus	virus	NN
cord-014462-11ggaqf1	1646	16	belonging	belong	VBG
cord-014462-11ggaqf1	1646	17	to	to	IN
cord-014462-11ggaqf1	1646	18	the	the	DT
cord-014462-11ggaqf1	1646	19	genus	genus	NNP
cord-014462-11ggaqf1	1646	20	potyvirus	potyvirus	NNP
cord-014462-11ggaqf1	1646	21	Family	Family	NNP
cord-014462-11ggaqf1	1646	22	potyviridae	potyviridae	NN
cord-014462-11ggaqf1	1646	23	and	and	CC
cord-014462-11ggaqf1	1646	24	transmitted	transmit	VBN
cord-014462-11ggaqf1	1646	25	by	by	IN
cord-014462-11ggaqf1	1646	26	aphids	aphid	NNS
cord-014462-11ggaqf1	1646	27	.	.	.
cord-014462-11ggaqf1	1647	1	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1647	2	-	-	HYPH
cord-014462-11ggaqf1	1647	3	P	p	NN
cord-014462-11ggaqf1	1647	4	coat	coat	NN
cord-014462-11ggaqf1	1647	5	protein	protein	NN
cord-014462-11ggaqf1	1647	6	gene	gene	NN
cord-014462-11ggaqf1	1647	7	region	region	NN
cord-014462-11ggaqf1	1647	8	was	be	VBD
cord-014462-11ggaqf1	1647	9	used	use	VBN
cord-014462-11ggaqf1	1647	10	as	as	IN
cord-014462-11ggaqf1	1647	11	template	template	NN
cord-014462-11ggaqf1	1647	12	cDNA	cdna	NN
cord-014462-11ggaqf1	1647	13	for	for	IN
cord-014462-11ggaqf1	1647	14	probe	probe	NN
cord-014462-11ggaqf1	1647	15	preparation	preparation	NN
cord-014462-11ggaqf1	1647	16	.	.	.
cord-014462-11ggaqf1	1648	1	Dot	dot	NN
cord-014462-11ggaqf1	1648	2	-	-	HYPH
cord-014462-11ggaqf1	1648	3	blot	blot	NN
cord-014462-11ggaqf1	1648	4	hybridization	hybridization	NN
cord-014462-11ggaqf1	1648	5	with	with	IN
cord-014462-11ggaqf1	1648	6	the	the	DT
cord-014462-11ggaqf1	1648	7	biotin	biotin	NN
cord-014462-11ggaqf1	1648	8	labeled	label	VBN
cord-014462-11ggaqf1	1648	9	probe	probe	NN
cord-014462-11ggaqf1	1648	10	were	be	VBD
cord-014462-11ggaqf1	1648	11	performed	perform	VBN
cord-014462-11ggaqf1	1648	12	for	for	IN
cord-014462-11ggaqf1	1648	13	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1648	14	-	-	HYPH
cord-014462-11ggaqf1	1648	15	P	p	NN
cord-014462-11ggaqf1	1648	16	detection	detection	NN
cord-014462-11ggaqf1	1648	17	.	.	.
cord-014462-11ggaqf1	1649	1	The	the	DT
cord-014462-11ggaqf1	1649	2	clarified	clarify	VBN
cord-014462-11ggaqf1	1649	3	sap	sap	NN
cord-014462-11ggaqf1	1649	4	of	of	IN
cord-014462-11ggaqf1	1649	5	healthy	healthy	JJ
cord-014462-11ggaqf1	1649	6	and	and	CC
cord-014462-11ggaqf1	1649	7	infected	infected	JJ
cord-014462-11ggaqf1	1649	8	plants	plant	NNS
cord-014462-11ggaqf1	1649	9	were	be	VBD
cord-014462-11ggaqf1	1649	10	serially	serially	RB
cord-014462-11ggaqf1	1649	11	diluted	dilute	VBN
cord-014462-11ggaqf1	1649	12	and	and	CC
cord-014462-11ggaqf1	1649	13	spotted	spot	VBN
cord-014462-11ggaqf1	1649	14	onto	onto	IN
cord-014462-11ggaqf1	1649	15	the	the	DT
cord-014462-11ggaqf1	1649	16	nitrocellulose	nitrocellulose	JJ
cord-014462-11ggaqf1	1649	17	membrane	membrane	NN
cord-014462-11ggaqf1	1649	18	,	,	,
cord-014462-11ggaqf1	1649	19	hybridized	hybridize	VBN
cord-014462-11ggaqf1	1649	20	to	to	IN
cord-014462-11ggaqf1	1649	21	biotin	biotin	NN
cord-014462-11ggaqf1	1649	22	labeled	label	VBN
cord-014462-11ggaqf1	1649	23	probe	probe	NN
cord-014462-11ggaqf1	1649	24	.	.	.
cord-014462-11ggaqf1	1650	1	Biotin	Biotin	NNP
cord-014462-11ggaqf1	1650	2	labeled	label	VBD
cord-014462-11ggaqf1	1650	3	RNA	RNA	NNP
cord-014462-11ggaqf1	1650	4	's	's	POS
cord-014462-11ggaqf1	1650	5	are	be	VBP
cord-014462-11ggaqf1	1650	6	employed	employ	VBN
cord-014462-11ggaqf1	1650	7	as	as	IN
cord-014462-11ggaqf1	1650	8	probes	probe	NNS
cord-014462-11ggaqf1	1650	9	,	,	,
cord-014462-11ggaqf1	1650	10	with	with	IN
cord-014462-11ggaqf1	1650	11	a	a	DT
cord-014462-11ggaqf1	1650	12	subsequent	subsequent	JJ
cord-014462-11ggaqf1	1650	13	detection	detection	NN
cord-014462-11ggaqf1	1650	14	based	base	VBN
cord-014462-11ggaqf1	1650	15	on	on	IN
cord-014462-11ggaqf1	1650	16	streptavidin	streptavidin	NN
cord-014462-11ggaqf1	1650	17	-	-	HYPH
cord-014462-11ggaqf1	1650	18	alkaline	alkaline	JJ
cord-014462-11ggaqf1	1650	19	phosphatase	phosphatase	NN
cord-014462-11ggaqf1	1650	20	conjugates	conjugate	NNS
cord-014462-11ggaqf1	1650	21	.	.	.
cord-014462-11ggaqf1	1651	1	The	the	DT
cord-014462-11ggaqf1	1651	2	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1651	3	for	for	IN
cord-014462-11ggaqf1	1651	4	viral	viral	JJ
cord-014462-11ggaqf1	1651	5	detection	detection	NN
cord-014462-11ggaqf1	1651	6	of	of	IN
cord-014462-11ggaqf1	1651	7	the	the	DT
cord-014462-11ggaqf1	1651	8	biotin	biotin	NN
cord-014462-11ggaqf1	1651	9	labeled	label	VBN
cord-014462-11ggaqf1	1651	10	probe	probe	NN
cord-014462-11ggaqf1	1651	11	was	be	VBD
cord-014462-11ggaqf1	1651	12	found	find	VBN
cord-014462-11ggaqf1	1651	13	to	to	TO
cord-014462-11ggaqf1	1651	14	be	be	VB
cord-014462-11ggaqf1	1651	15	sensitive	sensitive	JJ
cord-014462-11ggaqf1	1651	16	than	than	IN
cord-014462-11ggaqf1	1651	17	Enzyme	Enzyme	NNP
cord-014462-11ggaqf1	1651	18	Linked	link	VBN
cord-014462-11ggaqf1	1651	19	Immunosorbent	Immunosorbent	NNP
cord-014462-11ggaqf1	1651	20	Assay	Assay	NNP
cord-014462-11ggaqf1	1651	21	(	(	-LRB-
cord-014462-11ggaqf1	1651	22	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1651	23	)	)	-RRB-
cord-014462-11ggaqf1	1651	24	.	.	.
cord-014462-11ggaqf1	1652	1	In	in	IN
cord-014462-11ggaqf1	1652	2	recent	recent	JJ
cord-014462-11ggaqf1	1652	3	years	year	NNS
cord-014462-11ggaqf1	1652	4	tospovirus	tospovirus	NNP
cord-014462-11ggaqf1	1652	5	is	be	VBZ
cord-014462-11ggaqf1	1652	6	causing	cause	VBG
cord-014462-11ggaqf1	1652	7	devastating	devastating	JJ
cord-014462-11ggaqf1	1652	8	damage	damage	NN
cord-014462-11ggaqf1	1652	9	to	to	IN
cord-014462-11ggaqf1	1652	10	the	the	DT
cord-014462-11ggaqf1	1652	11	yield	yield	NN
cord-014462-11ggaqf1	1652	12	of	of	IN
cord-014462-11ggaqf1	1652	13	vegetables	vegetable	NNS
cord-014462-11ggaqf1	1652	14	in	in	IN
cord-014462-11ggaqf1	1652	15	India	India	NNP
cord-014462-11ggaqf1	1652	16	.	.	.
cord-014462-11ggaqf1	1653	1	It	-PRON-	PRP
cord-014462-11ggaqf1	1653	2	infects	infect	VBZ
cord-014462-11ggaqf1	1653	3	economically	economically	RB
cord-014462-11ggaqf1	1653	4	important	important	JJ
cord-014462-11ggaqf1	1653	5	crops	crop	NNS
cord-014462-11ggaqf1	1653	6	viz	viz	NN
cord-014462-11ggaqf1	1653	7	.	.	.
cord-014462-11ggaqf1	1654	1	,	,	,
cord-014462-11ggaqf1	1654	2	tomato	tomato	NN
cord-014462-11ggaqf1	1654	3	,	,	,
cord-014462-11ggaqf1	1654	4	chilli	chilli	NN
cord-014462-11ggaqf1	1654	5	,	,	,
cord-014462-11ggaqf1	1654	6	peppers	pepper	NNS
cord-014462-11ggaqf1	1654	7	,	,	,
cord-014462-11ggaqf1	1654	8	groundnut	groundnut	NN
cord-014462-11ggaqf1	1654	9	,	,	,
cord-014462-11ggaqf1	1654	10	watermelon	watermelon	NN
cord-014462-11ggaqf1	1654	11	and	and	CC
cord-014462-11ggaqf1	1654	12	various	various	JJ
cord-014462-11ggaqf1	1654	13	legumes	legume	NNS
cord-014462-11ggaqf1	1654	14	.	.	.
cord-014462-11ggaqf1	1655	1	Now	now	RB
cord-014462-11ggaqf1	1655	2	it	-PRON-	PRP
cord-014462-11ggaqf1	1655	3	is	be	VBZ
cord-014462-11ggaqf1	1655	4	emerging	emerge	VBG
cord-014462-11ggaqf1	1655	5	as	as	IN
cord-014462-11ggaqf1	1655	6	severe	severe	JJ
cord-014462-11ggaqf1	1655	7	disease	disease	NN
cord-014462-11ggaqf1	1655	8	in	in	IN
cord-014462-11ggaqf1	1655	9	brinjal	brinjal	NNP
cord-014462-11ggaqf1	1655	10	also	also	RB
cord-014462-11ggaqf1	1655	11	.	.	.
cord-014462-11ggaqf1	1656	1	In	in	IN
cord-014462-11ggaqf1	1656	2	order	order	NN
cord-014462-11ggaqf1	1656	3	to	to	TO
cord-014462-11ggaqf1	1656	4	monitor	monitor	VB
cord-014462-11ggaqf1	1656	5	the	the	DT
cord-014462-11ggaqf1	1656	6	natural	natural	JJ
cord-014462-11ggaqf1	1656	7	occurrence	occurrence	NN
cord-014462-11ggaqf1	1656	8	and	and	CC
cord-014462-11ggaqf1	1656	9	distribution	distribution	NN
cord-014462-11ggaqf1	1656	10	of	of	IN
cord-014462-11ggaqf1	1656	11	Tospovirus	Tospovirus	NNP
cord-014462-11ggaqf1	1656	12	in	in	IN
cord-014462-11ggaqf1	1656	13	vegetable	vegetable	NN
cord-014462-11ggaqf1	1656	14	,	,	,
cord-014462-11ggaqf1	1656	15	surveys	survey	NNS
cord-014462-11ggaqf1	1656	16	were	be	VBD
cord-014462-11ggaqf1	1656	17	conducted	conduct	VBN
cord-014462-11ggaqf1	1656	18	in	in	IN
cord-014462-11ggaqf1	1656	19	the	the	DT
cord-014462-11ggaqf1	1656	20	predominant	predominant	JJ
cord-014462-11ggaqf1	1656	21	brinjal	brinjal	NN
cord-014462-11ggaqf1	1656	22	growing	grow	VBG
cord-014462-11ggaqf1	1656	23	areas	area	NNS
cord-014462-11ggaqf1	1656	24	of	of	IN
cord-014462-11ggaqf1	1656	25	Gujarat	Gujarat	NNP
cord-014462-11ggaqf1	1656	26	,	,	,
cord-014462-11ggaqf1	1656	27	Karnataka	Karnataka	NNP
cord-014462-11ggaqf1	1656	28	,	,	,
cord-014462-11ggaqf1	1656	29	Maharashtra	Maharashtra	NNP
cord-014462-11ggaqf1	1656	30	and	and	CC
cord-014462-11ggaqf1	1656	31	Andhra	Andhra	NNP
cord-014462-11ggaqf1	1656	32	Pradesh	Pradesh	NNP
cord-014462-11ggaqf1	1656	33	during	during	IN
cord-014462-11ggaqf1	1656	34	2008	2008	CD
cord-014462-11ggaqf1	1656	35	-	-	SYM
cord-014462-11ggaqf1	1656	36	2010	2010	CD
cord-014462-11ggaqf1	1656	37	incidence	incidence	NN
cord-014462-11ggaqf1	1656	38	ranging	range	VBG
cord-014462-11ggaqf1	1656	39	from	from	IN
cord-014462-11ggaqf1	1656	40	5	5	CD
cord-014462-11ggaqf1	1656	41	to	to	TO
cord-014462-11ggaqf1	1656	42	10	10	CD
cord-014462-11ggaqf1	1656	43	%	%	NN
cord-014462-11ggaqf1	1656	44	,	,	,
cord-014462-11ggaqf1	1656	45	0	0	CD
cord-014462-11ggaqf1	1656	46	to	to	IN
cord-014462-11ggaqf1	1656	47	80	80	CD
cord-014462-11ggaqf1	1656	48	%	%	NN
cord-014462-11ggaqf1	1656	49	,	,	,
cord-014462-11ggaqf1	1656	50	1	1	CD
cord-014462-11ggaqf1	1656	51	to	to	TO
cord-014462-11ggaqf1	1656	52	40	40	CD
cord-014462-11ggaqf1	1656	53	%	%	NN
cord-014462-11ggaqf1	1656	54	,	,	,
cord-014462-11ggaqf1	1656	55	and	and	CC
cord-014462-11ggaqf1	1656	56	0	0	CD
cord-014462-11ggaqf1	1656	57	to	to	IN
cord-014462-11ggaqf1	1656	58	55.78	55.78	CD
cord-014462-11ggaqf1	1656	59	%	%	NN
cord-014462-11ggaqf1	1656	60	respectively	respectively	RB
cord-014462-11ggaqf1	1656	61	.	.	.
cord-014462-11ggaqf1	1657	1	Samples	sample	NNS
cord-014462-11ggaqf1	1657	2	collected	collect	VBN
cord-014462-11ggaqf1	1657	3	from	from	IN
cord-014462-11ggaqf1	1657	4	different	different	JJ
cord-014462-11ggaqf1	1657	5	places	place	NNS
cord-014462-11ggaqf1	1657	6	of	of	IN
cord-014462-11ggaqf1	1657	7	India	India	NNP
cord-014462-11ggaqf1	1657	8	were	be	VBD
cord-014462-11ggaqf1	1657	9	found	find	VBN
cord-014462-11ggaqf1	1657	10	positive	positive	JJ
cord-014462-11ggaqf1	1657	11	to	to	IN
cord-014462-11ggaqf1	1657	12	PBNV	PBNV	NNP
cord-014462-11ggaqf1	1657	13	in	in	IN
cord-014462-11ggaqf1	1657	14	direct	direct	JJ
cord-014462-11ggaqf1	1657	15	antigen	antigen	NN
cord-014462-11ggaqf1	1657	16	coating	coating	NN
cord-014462-11ggaqf1	1657	17	-	-	HYPH
cord-014462-11ggaqf1	1657	18	enzyme	enzyme	NN
cord-014462-11ggaqf1	1657	19	linked	link	VBN
cord-014462-11ggaqf1	1657	20	immunosorbent	immunosorbent	JJ
cord-014462-11ggaqf1	1657	21	assay	assay	NN
cord-014462-11ggaqf1	1657	22	(	(	-LRB-
cord-014462-11ggaqf1	1657	23	DAC	DAC	NNP
cord-014462-11ggaqf1	1657	24	-	-	HYPH
cord-014462-11ggaqf1	1657	25	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1657	26	)	)	-RRB-
cord-014462-11ggaqf1	1657	27	.	.	.
cord-014462-11ggaqf1	1658	1	PBNV	PBNV	NNP
cord-014462-11ggaqf1	1658	2	infected	infect	VBD
cord-014462-11ggaqf1	1658	3	brinjal	brinjal	NN
cord-014462-11ggaqf1	1658	4	plants	plant	NNS
cord-014462-11ggaqf1	1659	1	showed	show	VBD
cord-014462-11ggaqf1	1659	2	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1659	3	mottling	mottling	NN
cord-014462-11ggaqf1	1659	4	of	of	IN
cord-014462-11ggaqf1	1659	5	leaves	leave	NNS
cord-014462-11ggaqf1	1659	6	with	with	IN
cord-014462-11ggaqf1	1659	7	leaf	leaf	NN
cord-014462-11ggaqf1	1659	8	distortion	distortion	NN
cord-014462-11ggaqf1	1659	9	,	,	,
cord-014462-11ggaqf1	1659	10	longitudinal	longitudinal	JJ
cord-014462-11ggaqf1	1659	11	streaks	streak	NNS
cord-014462-11ggaqf1	1659	12	on	on	IN
cord-014462-11ggaqf1	1659	13	the	the	DT
cord-014462-11ggaqf1	1659	14	stem	stem	NN
cord-014462-11ggaqf1	1659	15	and	and	CC
cord-014462-11ggaqf1	1659	16	necrotic	necrotic	JJ
cord-014462-11ggaqf1	1659	17	rings	ring	NNS
cord-014462-11ggaqf1	1659	18	on	on	IN
cord-014462-11ggaqf1	1659	19	leaves	leave	NNS
cord-014462-11ggaqf1	1659	20	and	and	CC
cord-014462-11ggaqf1	1659	21	fruits	fruit	NNS
cord-014462-11ggaqf1	1659	22	.	.	.
cord-014462-11ggaqf1	1660	1	Early	early	JJ
cord-014462-11ggaqf1	1660	2	infection	infection	NN
cord-014462-11ggaqf1	1660	3	led	lead	VBD
cord-014462-11ggaqf1	1660	4	to	to	IN
cord-014462-11ggaqf1	1660	5	severe	severe	JJ
cord-014462-11ggaqf1	1660	6	stunting	stunting	NN
cord-014462-11ggaqf1	1660	7	and	and	CC
cord-014462-11ggaqf1	1660	8	abnormal	abnormal	JJ
cord-014462-11ggaqf1	1660	9	fruiting	fruiting	NN
cord-014462-11ggaqf1	1660	10	.	.	.
cord-014462-11ggaqf1	1661	1	Biological	biological	JJ
cord-014462-11ggaqf1	1661	2	and	and	CC
cord-014462-11ggaqf1	1661	3	molecular	molecular	JJ
cord-014462-11ggaqf1	1661	4	characterization	characterization	NN
cord-014462-11ggaqf1	1661	5	of	of	IN
cord-014462-11ggaqf1	1661	6	PBNV	PBNV	NNP
cord-014462-11ggaqf1	1661	7	-	-	HYPH
cord-014462-11ggaqf1	1661	8	brinjal	brinjal	NN
cord-014462-11ggaqf1	1661	9	isolates	isolate	NNS
cord-014462-11ggaqf1	1661	10	were	be	VBD
cord-014462-11ggaqf1	1661	11	compared	compare	VBN
cord-014462-11ggaqf1	1661	12	with	with	IN
cord-014462-11ggaqf1	1661	13	other	other	JJ
cord-014462-11ggaqf1	1661	14	isolates	isolate	NNS
cord-014462-11ggaqf1	1661	15	and	and	CC
cord-014462-11ggaqf1	1661	16	results	result	NNS
cord-014462-11ggaqf1	1661	17	are	be	VBP
cord-014462-11ggaqf1	1661	18	discussed	discuss	VBN
cord-014462-11ggaqf1	1661	19	.	.	.
cord-014462-11ggaqf1	1662	1	For	for	IN
cord-014462-11ggaqf1	1662	2	identification	identification	NN
cord-014462-11ggaqf1	1662	3	of	of	IN
cord-014462-11ggaqf1	1662	4	virus	virus	NN
cord-014462-11ggaqf1	1662	5	causing	cause	VBG
cord-014462-11ggaqf1	1662	6	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1662	7	symptoms	symptom	NNS
cord-014462-11ggaqf1	1662	8	on	on	IN
cord-014462-11ggaqf1	1662	9	soybean	soybean	NN
cord-014462-11ggaqf1	1662	10	various	various	JJ
cord-014462-11ggaqf1	1662	11	host	host	NN
cord-014462-11ggaqf1	1662	12	plants	plant	NNS
cord-014462-11ggaqf1	1662	13	were	be	VBD
cord-014462-11ggaqf1	1662	14	tested	test	VBN
cord-014462-11ggaqf1	1662	15	.	.	.
cord-014462-11ggaqf1	1663	1	Plants	plant	NNS
cord-014462-11ggaqf1	1663	2	species	specie	NNS
cord-014462-11ggaqf1	1663	3	belonging	belong	VBG
cord-014462-11ggaqf1	1663	4	to	to	IN
cord-014462-11ggaqf1	1663	5	the	the	DT
cord-014462-11ggaqf1	1663	6	different	different	JJ
cord-014462-11ggaqf1	1663	7	families	family	NNS
cord-014462-11ggaqf1	1663	8	viz	viz	JJ
cord-014462-11ggaqf1	1663	9	.	.	.
cord-014462-11ggaqf1	1664	1	caricaceae	caricaceae	NNP
cord-014462-11ggaqf1	1664	2	,	,	,
cord-014462-11ggaqf1	1664	3	graminae	graminae	NNP
cord-014462-11ggaqf1	1664	4	,	,	,
cord-014462-11ggaqf1	1664	5	leguminosae	leguminosae	NNP
cord-014462-11ggaqf1	1664	6	,	,	,
cord-014462-11ggaqf1	1664	7	malvaceae	malvaceae	NNP
cord-014462-11ggaqf1	1664	8	and	and	CC
cord-014462-11ggaqf1	1664	9	solanaceae	solanaceae	NNP
cord-014462-11ggaqf1	1664	10	were	be	VBD
cord-014462-11ggaqf1	1664	11	tested	test	VBN
cord-014462-11ggaqf1	1664	12	.	.	.
cord-014462-11ggaqf1	1665	1	The	the	DT
cord-014462-11ggaqf1	1665	2	virus	virus	NN
cord-014462-11ggaqf1	1665	3	produced	produce	VBD
cord-014462-11ggaqf1	1665	4	symptoms	symptom	NNS
cord-014462-11ggaqf1	1665	5	on	on	IN
cord-014462-11ggaqf1	1665	6	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1665	7	plant	plant	NN
cord-014462-11ggaqf1	1665	8	species	specie	NNS
cord-014462-11ggaqf1	1665	9	like	like	IN
cord-014462-11ggaqf1	1665	10	Chenopodium	Chenopodium	NNP
cord-014462-11ggaqf1	1665	11	album	album	NN
cord-014462-11ggaqf1	1665	12	,	,	,
cord-014462-11ggaqf1	1665	13	C.	C.	NNP
cord-014462-11ggaqf1	1665	14	quinoa	quinoa	NN
cord-014462-11ggaqf1	1665	15	,	,	,
cord-014462-11ggaqf1	1665	16	Helianthus	Helianthus	NNP
cord-014462-11ggaqf1	1665	17	anus	anus	NN
cord-014462-11ggaqf1	1665	18	,	,	,
cord-014462-11ggaqf1	1665	19	Phaseolus	Phaseolus	NNP
cord-014462-11ggaqf1	1665	20	vulgaris	vulgaris	NN
cord-014462-11ggaqf1	1665	21	and	and	CC
cord-014462-11ggaqf1	1665	22	Vigna	Vigna	NNP
cord-014462-11ggaqf1	1665	23	ungiculata	ungiculata	NNP
cord-014462-11ggaqf1	1665	24	.	.	.
cord-014462-11ggaqf1	1666	1	Among	among	IN
cord-014462-11ggaqf1	1666	2	tested	test	VBN
cord-014462-11ggaqf1	1666	3	families	family	NNS
cord-014462-11ggaqf1	1666	4	the	the	DT
cord-014462-11ggaqf1	1666	5	leguminosae	leguminosae	NN
cord-014462-11ggaqf1	1666	6	that	that	WDT
cord-014462-11ggaqf1	1666	7	were	be	VBD
cord-014462-11ggaqf1	1666	8	the	the	DT
cord-014462-11ggaqf1	1666	9	host	host	NN
cord-014462-11ggaqf1	1666	10	of	of	IN
cord-014462-11ggaqf1	1666	11	virus	virus	NN
cord-014462-11ggaqf1	1666	12	included	include	VBD
cord-014462-11ggaqf1	1666	13	Arachis	Arachis	NNP
cord-014462-11ggaqf1	1666	14	hypogea	hypogea	NNP
cord-014462-11ggaqf1	1666	15	,	,	,
cord-014462-11ggaqf1	1666	16	The	the	DT
cord-014462-11ggaqf1	1666	17	virus	virus	NN
cord-014462-11ggaqf1	1666	18	causing	cause	VBG
cord-014462-11ggaqf1	1666	19	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1666	20	symptoms	symptom	NNS
cord-014462-11ggaqf1	1666	21	in	in	IN
cord-014462-11ggaqf1	1666	22	soybean	soybean	NN
cord-014462-11ggaqf1	1666	23	is	be	VBZ
cord-014462-11ggaqf1	1666	24	inactivated	inactivate	VBN
cord-014462-11ggaqf1	1666	25	between	between	IN
cord-014462-11ggaqf1	1666	26	50	50	CD
cord-014462-11ggaqf1	1666	27	and	and	CC
cord-014462-11ggaqf1	1666	28	55	55	CD
cord-014462-11ggaqf1	1666	29	°	°	NN
cord-014462-11ggaqf1	1666	30	C	c	NN
cord-014462-11ggaqf1	1666	31	and	and	CC
cord-014462-11ggaqf1	1666	32	between	between	IN
cord-014462-11ggaqf1	1666	33	dilution	dilution	NN
cord-014462-11ggaqf1	1666	34	of	of	IN
cord-014462-11ggaqf1	1666	35	10	10	CD
cord-014462-11ggaqf1	1666	36	-4	-4	NNS
cord-014462-11ggaqf1	1666	37	to	to	IN
cord-014462-11ggaqf1	1666	38	10	10	CD
cord-014462-11ggaqf1	1666	39	-5	-5	NN
cord-014462-11ggaqf1	1666	40	.	.	.
cord-014462-11ggaqf1	1667	1	All	all	PDT
cord-014462-11ggaqf1	1667	2	the	the	DT
cord-014462-11ggaqf1	1667	3	inoculated	inoculate	VBN
cord-014462-11ggaqf1	1667	4	plants	plant	NNS
cord-014462-11ggaqf1	1667	5	of	of	IN
cord-014462-11ggaqf1	1667	6	assay	assay	NN
cord-014462-11ggaqf1	1667	7	host	host	NN
cord-014462-11ggaqf1	1667	8	showed	show	VBD
cord-014462-11ggaqf1	1667	9	the	the	DT
cord-014462-11ggaqf1	1667	10	symptoms	symptom	NNS
cord-014462-11ggaqf1	1667	11	at	at	IN
cord-014462-11ggaqf1	1667	12	50	50	CD
cord-014462-11ggaqf1	1667	13	°	°	NN
cord-014462-11ggaqf1	1667	14	C	c	NN
cord-014462-11ggaqf1	1667	15	but	but	CC
cord-014462-11ggaqf1	1667	16	not	not	RB
cord-014462-11ggaqf1	1667	17	at	at	IN
cord-014462-11ggaqf1	1667	18	55	55	CD
cord-014462-11ggaqf1	1667	19	°	°	NN
cord-014462-11ggaqf1	1667	20	C	c	NN
cord-014462-11ggaqf1	1667	21	.	.	.
cord-014462-11ggaqf1	1668	1	Similarly	similarly	RB
cord-014462-11ggaqf1	1668	2	local	local	JJ
cord-014462-11ggaqf1	1668	3	lesions	lesion	NNS
cord-014462-11ggaqf1	1668	4	produced	produce	VBN
cord-014462-11ggaqf1	1668	5	at	at	IN
cord-014462-11ggaqf1	1668	6	10	10	CD
cord-014462-11ggaqf1	1668	7	-4	-4	NNS
cord-014462-11ggaqf1	1668	8	but	but	CC
cord-014462-11ggaqf1	1668	9	not	not	RB
cord-014462-11ggaqf1	1668	10	at	at	IN
cord-014462-11ggaqf1	1668	11	10	10	CD
cord-014462-11ggaqf1	1669	1	-5	-5	NNP
cord-014462-11ggaqf1	1669	2	.	.	.
cord-014462-11ggaqf1	1670	1	The	the	DT
cord-014462-11ggaqf1	1670	2	virus	virus	NN
cord-014462-11ggaqf1	1670	3	in	in	IN
cord-014462-11ggaqf1	1670	4	crude	crude	JJ
cord-014462-11ggaqf1	1670	5	sap	sap	NN
cord-014462-11ggaqf1	1670	6	was	be	VBD
cord-014462-11ggaqf1	1670	7	infectious	infectious	JJ
cord-014462-11ggaqf1	1670	8	up	up	IN
cord-014462-11ggaqf1	1670	9	to	to	IN
cord-014462-11ggaqf1	1670	10	72	72	CD
cord-014462-11ggaqf1	1670	11	h	h	NN
cord-014462-11ggaqf1	1670	12	but	but	CC
cord-014462-11ggaqf1	1670	13	not	not	RB
cord-014462-11ggaqf1	1670	14	at	at	IN
cord-014462-11ggaqf1	1670	15	96	96	CD
cord-014462-11ggaqf1	1670	16	h	h	NN
cord-014462-11ggaqf1	1670	17	at	at	IN
cord-014462-11ggaqf1	1670	18	room	room	NN
cord-014462-11ggaqf1	1670	19	temperature	temperature	NN
cord-014462-11ggaqf1	1670	20	.	.	.
cord-014462-11ggaqf1	1671	1	However	however	RB
cord-014462-11ggaqf1	1671	2	,	,	,
cord-014462-11ggaqf1	1671	3	the	the	DT
cord-014462-11ggaqf1	1671	4	percentage	percentage	NN
cord-014462-11ggaqf1	1671	5	infectivity	infectivity	NN
cord-014462-11ggaqf1	1671	6	decreased	decrease	VBD
cord-014462-11ggaqf1	1671	7	progressively	progressively	RB
cord-014462-11ggaqf1	1671	8	as	as	IN
cord-014462-11ggaqf1	1671	9	the	the	DT
cord-014462-11ggaqf1	1671	10	aging	aging	NN
cord-014462-11ggaqf1	1671	11	of	of	IN
cord-014462-11ggaqf1	1671	12	the	the	DT
cord-014462-11ggaqf1	1671	13	sap	sap	NN
cord-014462-11ggaqf1	1671	14	was	be	VBD
cord-014462-11ggaqf1	1671	15	increased	increase	VBN
cord-014462-11ggaqf1	1671	16	at	at	IN
cord-014462-11ggaqf1	1671	17	room	room	NN
cord-014462-11ggaqf1	1671	18	temperature	temperature	NN
cord-014462-11ggaqf1	1671	19	.	.	.
cord-014462-11ggaqf1	1672	1	On	on	IN
cord-014462-11ggaqf1	1672	2	the	the	DT
cord-014462-11ggaqf1	1672	3	basis	basis	NN
cord-014462-11ggaqf1	1672	4	of	of	IN
cord-014462-11ggaqf1	1672	5	reactions	reaction	NNS
cord-014462-11ggaqf1	1672	6	on	on	IN
cord-014462-11ggaqf1	1672	7	diagnostic	diagnostic	JJ
cord-014462-11ggaqf1	1672	8	hosts	host	NNS
cord-014462-11ggaqf1	1672	9	PVP-38	PVP-38	NNP
cord-014462-11ggaqf1	1672	10	Identification	Identification	NNP
cord-014462-11ggaqf1	1672	11	and	and	CC
cord-014462-11ggaqf1	1672	12	Characterization	characterization	NN
cord-014462-11ggaqf1	1672	13	of	of	IN
cord-014462-11ggaqf1	1672	14	Potyvirus	Potyvirus	NNP
cord-014462-11ggaqf1	1672	15	Infected	Infected	NNP
cord-014462-11ggaqf1	1672	16	Chilli	Chilli	NNP
cord-014462-11ggaqf1	1673	1	(	(	-LRB-
cord-014462-11ggaqf1	1673	2	Capsicul	Capsicul	NNP
cord-014462-11ggaqf1	1673	3	annum	annum	NN
cord-014462-11ggaqf1	1673	4	L	l	NN
cord-014462-11ggaqf1	1674	1	The	the	DT
cord-014462-11ggaqf1	1674	2	virus	virus	NN
cord-014462-11ggaqf1	1674	3	under	under	IN
cord-014462-11ggaqf1	1674	4	study	study	NN
cord-014462-11ggaqf1	1674	5	caused	cause	VBD
cord-014462-11ggaqf1	1674	6	mild	mild	JJ
cord-014462-11ggaqf1	1674	7	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1674	8	and	and	CC
cord-014462-11ggaqf1	1674	9	severe	severe	JJ
cord-014462-11ggaqf1	1674	10	mottling	mottling	NN
cord-014462-11ggaqf1	1674	11	symptom	symptom	NN
cord-014462-11ggaqf1	1674	12	in	in	IN
cord-014462-11ggaqf1	1674	13	leaves	leave	NNS
cord-014462-11ggaqf1	1674	14	of	of	IN
cord-014462-11ggaqf1	1674	15	infected	infected	JJ
cord-014462-11ggaqf1	1674	16	plants	plant	NNS
cord-014462-11ggaqf1	1674	17	.	.	.
cord-014462-11ggaqf1	1675	1	The	the	DT
cord-014462-11ggaqf1	1675	2	dilution	dilution	NN
cord-014462-11ggaqf1	1675	3	end	end	NN
cord-014462-11ggaqf1	1675	4	point	point	NN
cord-014462-11ggaqf1	1675	5	(	(	-LRB-
cord-014462-11ggaqf1	1675	6	DEP	DEP	NNP
cord-014462-11ggaqf1	1675	7	)	)	-RRB-
cord-014462-11ggaqf1	1675	8	of	of	IN
cord-014462-11ggaqf1	1675	9	the	the	DT
cord-014462-11ggaqf1	1675	10	virus	virus	NN
cord-014462-11ggaqf1	1675	11	was	be	VBD
cord-014462-11ggaqf1	1675	12	found	find	VBN
cord-014462-11ggaqf1	1675	13	to	to	TO
cord-014462-11ggaqf1	1675	14	be	be	VB
cord-014462-11ggaqf1	1675	15	10	10	CD
cord-014462-11ggaqf1	1675	16	-3	-3	CD
cord-014462-11ggaqf1	1675	17	to	to	IN
cord-014462-11ggaqf1	1675	18	10	10	CD
cord-014462-11ggaqf1	1675	19	-4	-4	ADD
cord-014462-11ggaqf1	1676	1	,	,	,
cord-014462-11ggaqf1	1676	2	Longevity	longevity	NN
cord-014462-11ggaqf1	1676	3	in	in	IN
cord-014462-11ggaqf1	1676	4	vitro	vitro	FW
cord-014462-11ggaqf1	1676	5	(	(	-LRB-
cord-014462-11ggaqf1	1676	6	LIV	LIV	NNP
cord-014462-11ggaqf1	1676	7	)	)	-RRB-
cord-014462-11ggaqf1	1676	8	1	1	CD
cord-014462-11ggaqf1	1676	9	-	-	SYM
cord-014462-11ggaqf1	1676	10	3	3	CD
cord-014462-11ggaqf1	1676	11	days	day	NNS
cord-014462-11ggaqf1	1676	12	at	at	IN
cord-014462-11ggaqf1	1676	13	room	room	NN
cord-014462-11ggaqf1	1676	14	temperature	temperature	NN
cord-014462-11ggaqf1	1676	15	(	(	-LRB-
cord-014462-11ggaqf1	1676	16	25	25	CD
cord-014462-11ggaqf1	1676	17	°	°	NN
cord-014462-11ggaqf1	1676	18	C	C	NNP
cord-014462-11ggaqf1	1676	19	)	)	-RRB-
cord-014462-11ggaqf1	1676	20	,	,	,
cord-014462-11ggaqf1	1676	21	Thermal	thermal	JJ
cord-014462-11ggaqf1	1676	22	inactivation	inactivation	NN
cord-014462-11ggaqf1	1676	23	point	point	NN
cord-014462-11ggaqf1	1676	24	(	(	-LRB-
cord-014462-11ggaqf1	1676	25	TIP	tip	NN
cord-014462-11ggaqf1	1676	26	)	)	-RRB-
cord-014462-11ggaqf1	1676	27	50	50	CD
cord-014462-11ggaqf1	1676	28	-	-	SYM
cord-014462-11ggaqf1	1676	29	55	55	CD
cord-014462-11ggaqf1	1676	30	°	°	NN
cord-014462-11ggaqf1	1676	31	C	c	NN
cord-014462-11ggaqf1	1676	32	.	.	.
cord-014462-11ggaqf1	1677	1	Electron	Electron	NNP
cord-014462-11ggaqf1	1677	2	Microscopy	Microscopy	NNP
cord-014462-11ggaqf1	1677	3	of	of	IN
cord-014462-11ggaqf1	1677	4	purified	purify	VBN
cord-014462-11ggaqf1	1677	5	virus	virus	NN
cord-014462-11ggaqf1	1677	6	preparation	preparation	NN
cord-014462-11ggaqf1	1677	7	revealed	reveal	VBD
cord-014462-11ggaqf1	1677	8	the	the	DT
cord-014462-11ggaqf1	1677	9	presence	presence	NN
cord-014462-11ggaqf1	1677	10	of	of	IN
cord-014462-11ggaqf1	1677	11	flexuous	flexuous	JJ
cord-014462-11ggaqf1	1677	12	particle	particle	NN
cord-014462-11ggaqf1	1677	13	of	of	IN
cord-014462-11ggaqf1	1677	14	size	size	NN
cord-014462-11ggaqf1	1677	15	780	780	CD
cord-014462-11ggaqf1	1677	16	nm	nm	NN
cord-014462-11ggaqf1	1677	17	long	long	JJ
cord-014462-11ggaqf1	1677	18	and	and	CC
cord-014462-11ggaqf1	1677	19	14	14	CD
cord-014462-11ggaqf1	1677	20	nm	nm	NN
cord-014462-11ggaqf1	1677	21	in	in	IN
cord-014462-11ggaqf1	1677	22	width	width	NN
cord-014462-11ggaqf1	1677	23	with	with	IN
cord-014462-11ggaqf1	1677	24	characteristic	characteristic	JJ
cord-014462-11ggaqf1	1677	25	cytoplasmic	cytoplasmic	JJ
cord-014462-11ggaqf1	1677	26	inclusions	inclusion	NNS
cord-014462-11ggaqf1	1677	27	:	:	:
cord-014462-11ggaqf1	1677	28	pinwheels	pinwheel	NNS
cord-014462-11ggaqf1	1677	29	and	and	CC
cord-014462-11ggaqf1	1677	30	scrolls	scroll	NNS
cord-014462-11ggaqf1	1677	31	.	.	.
cord-014462-11ggaqf1	1678	1	The	the	DT
cord-014462-11ggaqf1	1678	2	virus	virus	NN
cord-014462-11ggaqf1	1678	3	was	be	VBD
cord-014462-11ggaqf1	1678	4	transmitted	transmit	VBN
cord-014462-11ggaqf1	1678	5	by	by	IN
cord-014462-11ggaqf1	1678	6	sap	sap	NN
cord-014462-11ggaqf1	1678	7	and	and	CC
cord-014462-11ggaqf1	1678	8	by	by	IN
cord-014462-11ggaqf1	1678	9	aphid	aphid	NN
cord-014462-11ggaqf1	1678	10	Myzus	Myzus	NNP
cord-014462-11ggaqf1	1678	11	persicae	persicae	NN
cord-014462-11ggaqf1	1678	12	.	.	.
cord-014462-11ggaqf1	1679	1	The	the	DT
cord-014462-11ggaqf1	1679	2	host	host	NN
cord-014462-11ggaqf1	1679	3	range	range	NN
cord-014462-11ggaqf1	1679	4	study	study	NN
cord-014462-11ggaqf1	1679	5	revealed	reveal	VBD
cord-014462-11ggaqf1	1679	6	that	that	IN
cord-014462-11ggaqf1	1679	7	the	the	DT
cord-014462-11ggaqf1	1679	8	host	host	NN
cord-014462-11ggaqf1	1679	9	species	specie	NNS
cord-014462-11ggaqf1	1679	10	were	be	VBD
cord-014462-11ggaqf1	1679	11	restricted	restrict	VBN
cord-014462-11ggaqf1	1679	12	to	to	IN
cord-014462-11ggaqf1	1679	13	family	family	NN
cord-014462-11ggaqf1	1679	14	Chenopodiaceae	Chenopodiaceae	NNP
cord-014462-11ggaqf1	1679	15	and	and	CC
cord-014462-11ggaqf1	1679	16	Solanaceae	Solanaceae	NNP
cord-014462-11ggaqf1	1679	17	.	.	.
cord-014462-11ggaqf1	1680	1	On	on	IN
cord-014462-11ggaqf1	1680	2	the	the	DT
cord-014462-11ggaqf1	1680	3	basis	basis	NN
cord-014462-11ggaqf1	1680	4	of	of	IN
cord-014462-11ggaqf1	1680	5	above	above	IN
cord-014462-11ggaqf1	1680	6	characteristic	characteristic	NN
cord-014462-11ggaqf1	1680	7	,	,	,
cord-014462-11ggaqf1	1680	8	the	the	DT
cord-014462-11ggaqf1	1680	9	virus	virus	NN
cord-014462-11ggaqf1	1680	10	under	under	IN
cord-014462-11ggaqf1	1680	11	study	study	NN
cord-014462-11ggaqf1	1680	12	was	be	VBD
cord-014462-11ggaqf1	1680	13	identified	identify	VBN
cord-014462-11ggaqf1	1680	14	as	as	IN
cord-014462-11ggaqf1	1680	15	Potyvirus	Potyvirus	NNP
cord-014462-11ggaqf1	1680	16	associated	associate	VBN
cord-014462-11ggaqf1	1680	17	with	with	IN
cord-014462-11ggaqf1	1680	18	mild	mild	JJ
cord-014462-11ggaqf1	1680	19	mosaic	mosaic	JJ
cord-014462-11ggaqf1	1680	20	and	and	CC
cord-014462-11ggaqf1	1680	21	severe	severe	JJ
cord-014462-11ggaqf1	1680	22	mottling	mottling	NN
cord-014462-11ggaqf1	1680	23	symptom	symptom	NN
cord-014462-11ggaqf1	1680	24	in	in	IN
cord-014462-11ggaqf1	1680	25	Capsicum	capsicum	NN
cord-014462-11ggaqf1	1680	26	.	.	.
cord-014462-11ggaqf1	1681	1	Phytoplasma	Phytoplasma	NNP
cord-014462-11ggaqf1	1681	2	causing	cause	VBG
cord-014462-11ggaqf1	1681	3	Grassy	Grassy	NNP
cord-014462-11ggaqf1	1681	4	shoot	shoot	NN
cord-014462-11ggaqf1	1681	5	disease	disease	NN
cord-014462-11ggaqf1	1681	6	and	and	CC
cord-014462-11ggaqf1	1681	7	Sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1681	8	yellow	yellow	JJ
cord-014462-11ggaqf1	1681	9	leaf	leaf	NN
cord-014462-11ggaqf1	1681	10	viruses	virus	NNS
cord-014462-11ggaqf1	1681	11	are	be	VBP
cord-014462-11ggaqf1	1681	12	important	important	JJ
cord-014462-11ggaqf1	1681	13	pathogens	pathogen	NNS
cord-014462-11ggaqf1	1681	14	of	of	IN
cord-014462-11ggaqf1	1681	15	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1681	16	.	.	.
cord-014462-11ggaqf1	1682	1	These	these	DT
cord-014462-11ggaqf1	1682	2	pathogens	pathogen	NNS
cord-014462-11ggaqf1	1682	3	are	be	VBP
cord-014462-11ggaqf1	1682	4	causing	cause	VBG
cord-014462-11ggaqf1	1682	5	severe	severe	JJ
cord-014462-11ggaqf1	1682	6	losses	loss	NNS
cord-014462-11ggaqf1	1682	7	in	in	IN
cord-014462-11ggaqf1	1682	8	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1682	9	productivity	productivity	NN
cord-014462-11ggaqf1	1682	10	.	.	.
cord-014462-11ggaqf1	1683	1	With	with	IN
cord-014462-11ggaqf1	1683	2	a	a	DT
cord-014462-11ggaqf1	1683	3	view	view	NN
cord-014462-11ggaqf1	1683	4	to	to	IN
cord-014462-11ggaqf1	1683	5	producing	produce	VBG
cord-014462-11ggaqf1	1683	6	virus	virus	NN
cord-014462-11ggaqf1	1683	7	and	and	CC
cord-014462-11ggaqf1	1683	8	phytoplasma	phytoplasma	NNP
cord-014462-11ggaqf1	1683	9	free	free	JJ
cord-014462-11ggaqf1	1683	10	planting	planting	NN
cord-014462-11ggaqf1	1683	11	material	material	NN
cord-014462-11ggaqf1	1683	12	of	of	IN
cord-014462-11ggaqf1	1683	13	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1683	14	,	,	,
cord-014462-11ggaqf1	1683	15	experiments	experiment	NNS
cord-014462-11ggaqf1	1683	16	were	be	VBD
cord-014462-11ggaqf1	1683	17	undertaken	undertake	VBN
cord-014462-11ggaqf1	1683	18	using	use	VBG
cord-014462-11ggaqf1	1683	19	infected	infected	JJ
cord-014462-11ggaqf1	1683	20	varieties	variety	NNS
cord-014462-11ggaqf1	1683	21	of	of	IN
cord-014462-11ggaqf1	1683	22	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1683	23	growing	grow	VBG
cord-014462-11ggaqf1	1683	24	at	at	IN
cord-014462-11ggaqf1	1683	25	the	the	DT
cord-014462-11ggaqf1	1683	26	farms	farm	NNS
cord-014462-11ggaqf1	1683	27	of	of	IN
cord-014462-11ggaqf1	1683	28	Sugarcane	Sugarcane	NNP
cord-014462-11ggaqf1	1683	29	Research	Research	NNP
cord-014462-11ggaqf1	1683	30	Institute	Institute	NNP
cord-014462-11ggaqf1	1683	31	.	.	.
cord-014462-11ggaqf1	1684	1	Apical	Apical	NNP
cord-014462-11ggaqf1	1684	2	meristems	meristem	NNS
cord-014462-11ggaqf1	1684	3	measuring	measure	VBG
cord-014462-11ggaqf1	1684	4	about	about	IN
cord-014462-11ggaqf1	1684	5	2	2	CD
cord-014462-11ggaqf1	1684	6	mm	mm	NNS
cord-014462-11ggaqf1	1684	7	in	in	IN
cord-014462-11ggaqf1	1684	8	length	length	NN
cord-014462-11ggaqf1	1684	9	,	,	,
cord-014462-11ggaqf1	1684	10	were	be	VBD
cord-014462-11ggaqf1	1684	11	dissected	dissect	VBN
cord-014462-11ggaqf1	1684	12	out	out	RP
cord-014462-11ggaqf1	1684	13	,	,	,
cord-014462-11ggaqf1	1684	14	surface	surface	NN
cord-014462-11ggaqf1	1684	15	sterilized	sterilize	VBN
cord-014462-11ggaqf1	1684	16	and	and	CC
cord-014462-11ggaqf1	1684	17	cultured	culture	VBN
cord-014462-11ggaqf1	1684	18	on	on	IN
cord-014462-11ggaqf1	1684	19	agar	agar	NN
cord-014462-11ggaqf1	1684	20	gelled	gel	VBN
cord-014462-11ggaqf1	1684	21	Murashige	Murashige	NNP
cord-014462-11ggaqf1	1684	22	and	and	CC
cord-014462-11ggaqf1	1684	23	Skoog	Skoog	NNP
cord-014462-11ggaqf1	1684	24	's	's	POS
cord-014462-11ggaqf1	1684	25	(	(	-LRB-
cord-014462-11ggaqf1	1684	26	MS	MS	NNP
cord-014462-11ggaqf1	1684	27	)	)	-RRB-
cord-014462-11ggaqf1	1684	28	medium	medium	NN
cord-014462-11ggaqf1	1684	29	containing	contain	VBG
cord-014462-11ggaqf1	1684	30	growth	growth	NN
cord-014462-11ggaqf1	1684	31	regulators	regulator	NNS
cord-014462-11ggaqf1	1684	32	for	for	IN
cord-014462-11ggaqf1	1684	33	shoot	shoot	NN
cord-014462-11ggaqf1	1684	34	induction	induction	NN
cord-014462-11ggaqf1	1684	35	.	.	.
cord-014462-11ggaqf1	1685	1	The	the	DT
cord-014462-11ggaqf1	1685	2	established	establish	VBN
cord-014462-11ggaqf1	1685	3	shoot	shoot	NN
cord-014462-11ggaqf1	1685	4	cultures	culture	NNS
cord-014462-11ggaqf1	1685	5	were	be	VBD
cord-014462-11ggaqf1	1685	6	multiplied	multiply	VBN
cord-014462-11ggaqf1	1685	7	through	through	IN
cord-014462-11ggaqf1	1685	8	repeated	repeat	VBN
cord-014462-11ggaqf1	1685	9	subcultures	subculture	NNS
cord-014462-11ggaqf1	1685	10	on	on	IN
cord-014462-11ggaqf1	1685	11	fresh	fresh	JJ
cord-014462-11ggaqf1	1685	12	media	medium	NNS
cord-014462-11ggaqf1	1685	13	at	at	IN
cord-014462-11ggaqf1	1685	14	10	10	CD
cord-014462-11ggaqf1	1685	15	-	-	SYM
cord-014462-11ggaqf1	1685	16	12	12	CD
cord-014462-11ggaqf1	1685	17	days	day	NNS
cord-014462-11ggaqf1	1685	18	interval	interval	NN
cord-014462-11ggaqf1	1685	19	.	.	.
cord-014462-11ggaqf1	1686	1	Elimination	elimination	NN
cord-014462-11ggaqf1	1686	2	of	of	IN
cord-014462-11ggaqf1	1686	3	GSD	GSD	NNP
cord-014462-11ggaqf1	1686	4	and	and	CC
cord-014462-11ggaqf1	1686	5	SCYLV	SCYLV	NNP
cord-014462-11ggaqf1	1686	6	was	be	VBD
cord-014462-11ggaqf1	1686	7	confirmed	confirm	VBN
cord-014462-11ggaqf1	1686	8	through	through	IN
cord-014462-11ggaqf1	1686	9	molecular	molecular	JJ
cord-014462-11ggaqf1	1686	10	analysis	analysis	NN
cord-014462-11ggaqf1	1686	11	of	of	IN
cord-014462-11ggaqf1	1686	12	regenerated	regenerated	JJ
cord-014462-11ggaqf1	1686	13	plants	plant	NNS
cord-014462-11ggaqf1	1686	14	using	use	VBG
cord-014462-11ggaqf1	1686	15	specific	specific	JJ
cord-014462-11ggaqf1	1686	16	primers	primer	NNS
cord-014462-11ggaqf1	1686	17	of	of	IN
cord-014462-11ggaqf1	1686	18	SCYLV	SCYLV	NNS
cord-014462-11ggaqf1	1686	19	and	and	CC
cord-014462-11ggaqf1	1686	20	GSD	GSD	NNP
cord-014462-11ggaqf1	1686	21	.	.	.
cord-014462-11ggaqf1	1687	1	Results	result	NNS
cord-014462-11ggaqf1	1687	2	revealed	reveal	VBD
cord-014462-11ggaqf1	1687	3	that	that	IN
cord-014462-11ggaqf1	1687	4	apical	apical	JJ
cord-014462-11ggaqf1	1687	5	meristem	meristem	NN
cord-014462-11ggaqf1	1687	6	culture	culture	NN
cord-014462-11ggaqf1	1687	7	technique	technique	NN
cord-014462-11ggaqf1	1687	8	is	be	VBZ
cord-014462-11ggaqf1	1687	9	effective	effective	JJ
cord-014462-11ggaqf1	1687	10	in	in	IN
cord-014462-11ggaqf1	1687	11	eliminating	eliminate	VBG
cord-014462-11ggaqf1	1687	12	the	the	DT
cord-014462-11ggaqf1	1687	13	pathogens	pathogen	NNS
cord-014462-11ggaqf1	1687	14	like	like	IN
cord-014462-11ggaqf1	1687	15	SCYLV	SCYLV	NNP
cord-014462-11ggaqf1	1687	16	and	and	CC
cord-014462-11ggaqf1	1687	17	Phytoplasma	Phytoplasma	NNP
cord-014462-11ggaqf1	1687	18	(	(	-LRB-
cord-014462-11ggaqf1	1687	19	GSD	GSD	NNP
cord-014462-11ggaqf1	1687	20	)	)	-RRB-
cord-014462-11ggaqf1	1687	21	from	from	IN
cord-014462-11ggaqf1	1687	22	the	the	DT
cord-014462-11ggaqf1	1687	23	infected	infected	JJ
cord-014462-11ggaqf1	1687	24	clones	clone	NNS
cord-014462-11ggaqf1	1687	25	.	.	.
cord-014462-11ggaqf1	1688	1	This	this	DT
cord-014462-11ggaqf1	1688	2	is	be	VBZ
cord-014462-11ggaqf1	1688	3	probably	probably	RB
cord-014462-11ggaqf1	1688	4	the	the	DT
cord-014462-11ggaqf1	1688	5	first	first	JJ
cord-014462-11ggaqf1	1688	6	report	report	NN
cord-014462-11ggaqf1	1688	7	on	on	IN
cord-014462-11ggaqf1	1688	8	elimination	elimination	NN
cord-014462-11ggaqf1	1688	9	of	of	IN
cord-014462-11ggaqf1	1688	10	Grassy	Grassy	NNP
cord-014462-11ggaqf1	1688	11	shoot	shoot	NN
cord-014462-11ggaqf1	1688	12	disease	disease	NN
cord-014462-11ggaqf1	1688	13	in	in	IN
cord-014462-11ggaqf1	1688	14	sugarcane	sugarcane	NN
cord-014462-11ggaqf1	1688	15	through	through	IN
cord-014462-11ggaqf1	1688	16	meristem	meristem	NN
cord-014462-11ggaqf1	1688	17	culture	culture	NN
cord-014462-11ggaqf1	1688	18	.	.	.
cord-014462-11ggaqf1	1689	1	Papaya	papaya	NN
cord-014462-11ggaqf1	1689	2	ringspot	ringspot	NN
cord-014462-11ggaqf1	1689	3	virus	virus	NN
cord-014462-11ggaqf1	1689	4	(	(	-LRB-
cord-014462-11ggaqf1	1689	5	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1689	6	)	)	-RRB-
cord-014462-11ggaqf1	1689	7	,	,	,
cord-014462-11ggaqf1	1689	8	which	which	WDT
cord-014462-11ggaqf1	1689	9	causes	cause	VBZ
cord-014462-11ggaqf1	1689	10	the	the	DT
cord-014462-11ggaqf1	1689	11	most	most	RBS
cord-014462-11ggaqf1	1689	12	widespread	widespread	JJ
cord-014462-11ggaqf1	1689	13	and	and	CC
cord-014462-11ggaqf1	1689	14	devastating	devastating	JJ
cord-014462-11ggaqf1	1689	15	disease	disease	NN
cord-014462-11ggaqf1	1689	16	in	in	IN
cord-014462-11ggaqf1	1689	17	papaya	papaya	NN
cord-014462-11ggaqf1	1689	18	,	,	,
cord-014462-11ggaqf1	1689	19	isolates	isolate	NNS
cord-014462-11ggaqf1	1689	20	originating	originate	VBG
cord-014462-11ggaqf1	1689	21	from	from	IN
cord-014462-11ggaqf1	1689	22	different	different	JJ
cord-014462-11ggaqf1	1689	23	geographical	geographical	JJ
cord-014462-11ggaqf1	1689	24	regions	region	NNS
cord-014462-11ggaqf1	1689	25	in	in	IN
cord-014462-11ggaqf1	1689	26	south	south	JJ
cord-014462-11ggaqf1	1689	27	India	India	NNP
cord-014462-11ggaqf1	1689	28	were	be	VBD
cord-014462-11ggaqf1	1689	29	collected	collect	VBN
cord-014462-11ggaqf1	1689	30	and	and	CC
cord-014462-11ggaqf1	1689	31	maintained	maintain	VBN
cord-014462-11ggaqf1	1689	32	on	on	IN
cord-014462-11ggaqf1	1689	33	natural	natural	JJ
cord-014462-11ggaqf1	1689	34	host	host	NN
cord-014462-11ggaqf1	1689	35	papaya	papaya	NN
cord-014462-11ggaqf1	1689	36	.	.	.
cord-014462-11ggaqf1	1690	1	The	the	DT
cord-014462-11ggaqf1	1690	2	entire	entire	JJ
cord-014462-11ggaqf1	1690	3	coat	coat	NN
cord-014462-11ggaqf1	1690	4	protein	protein	NN
cord-014462-11ggaqf1	1690	5	(	(	-LRB-
cord-014462-11ggaqf1	1690	6	CP	CP	NNP
cord-014462-11ggaqf1	1690	7	)	)	-RRB-
cord-014462-11ggaqf1	1690	8	gene	gene	NN
cord-014462-11ggaqf1	1690	9	of	of	IN
cord-014462-11ggaqf1	1690	10	Papaya	Papaya	NNP
cord-014462-11ggaqf1	1690	11	ringspot	ringspot	NN
cord-014462-11ggaqf1	1690	12	virus	virus	NN
cord-014462-11ggaqf1	1690	13	-	-	HYPH
cord-014462-11ggaqf1	1690	14	P	p	NN
cord-014462-11ggaqf1	1690	15	biotype	biotype	NN
cord-014462-11ggaqf1	1690	16	(	(	-LRB-
cord-014462-11ggaqf1	1690	17	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1690	18	-	-	HYPH
cord-014462-11ggaqf1	1690	19	P	P	NNP
cord-014462-11ggaqf1	1690	20	)	)	-RRB-
cord-014462-11ggaqf1	1690	21	was	be	VBD
cord-014462-11ggaqf1	1690	22	amplified	amplify	VBN
cord-014462-11ggaqf1	1690	23	by	by	IN
cord-014462-11ggaqf1	1690	24	reverse	reverse	JJ
cord-014462-11ggaqf1	1690	25	transcription	transcription	NN
cord-014462-11ggaqf1	1690	26	-	-	HYPH
cord-014462-11ggaqf1	1690	27	polymerase	polymerase	NN
cord-014462-11ggaqf1	1690	28	chain	chain	NN
cord-014462-11ggaqf1	1690	29	reaction	reaction	NN
cord-014462-11ggaqf1	1690	30	(	(	-LRB-
cord-014462-11ggaqf1	1690	31	RT	RT	NNP
cord-014462-11ggaqf1	1690	32	-	-	HYPH
cord-014462-11ggaqf1	1690	33	PCR	PCR	NNP
cord-014462-11ggaqf1	1690	34	)	)	-RRB-
cord-014462-11ggaqf1	1690	35	.	.	.
cord-014462-11ggaqf1	1691	1	The	the	DT
cord-014462-11ggaqf1	1691	2	amplicon	amplicon	NN
cord-014462-11ggaqf1	1691	3	was	be	VBD
cord-014462-11ggaqf1	1691	4	inserted	insert	VBN
cord-014462-11ggaqf1	1691	5	into	into	IN
cord-014462-11ggaqf1	1691	6	pGEM	pgem	JJ
cord-014462-11ggaqf1	1691	7	-	-	HYPH
cord-014462-11ggaqf1	1691	8	T	t	NN
cord-014462-11ggaqf1	1691	9	vector	vector	NN
cord-014462-11ggaqf1	1691	10	by	by	IN
cord-014462-11ggaqf1	1691	11	T	T	NNP
cord-014462-11ggaqf1	1691	12	-	-	HYPH
cord-014462-11ggaqf1	1691	13	A	a	DT
cord-014462-11ggaqf1	1691	14	cloning	cloning	NN
cord-014462-11ggaqf1	1691	15	method	method	NN
cord-014462-11ggaqf1	1691	16	,	,	,
cord-014462-11ggaqf1	1691	17	sequenced	sequence	VBN
cord-014462-11ggaqf1	1691	18	and	and	CC
cord-014462-11ggaqf1	1691	19	sub	sub	NN
cord-014462-11ggaqf1	1691	20	cloned	clone	VBN
cord-014462-11ggaqf1	1691	21	into	into	IN
cord-014462-11ggaqf1	1691	22	a	a	DT
cord-014462-11ggaqf1	1691	23	bacterial	bacterial	JJ
cord-014462-11ggaqf1	1691	24	expression	expression	NN
cord-014462-11ggaqf1	1691	25	vector	vector	NN
cord-014462-11ggaqf1	1691	26	pRSET	pRSET	NNS
cord-014462-11ggaqf1	1691	27	-	-	:
cord-014462-11ggaqf1	1691	28	A	a	NN
cord-014462-11ggaqf1	1691	29	using	use	VBG
cord-014462-11ggaqf1	1691	30	directional	directional	JJ
cord-014462-11ggaqf1	1691	31	cloning	cloning	NN
cord-014462-11ggaqf1	1691	32	strategy	strategy	NN
cord-014462-11ggaqf1	1691	33	.	.	.
cord-014462-11ggaqf1	1692	1	The	the	DT
cord-014462-11ggaqf1	1692	2	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1692	3	coat	coat	NN
cord-014462-11ggaqf1	1692	4	protein	protein	NN
cord-014462-11ggaqf1	1692	5	was	be	VBD
cord-014462-11ggaqf1	1692	6	over	over	RB
cord-014462-11ggaqf1	1692	7	expressed	express	VBN
cord-014462-11ggaqf1	1692	8	as	as	IN
cord-014462-11ggaqf1	1692	9	fusion	fusion	NN
cord-014462-11ggaqf1	1692	10	protein	protein	NN
cord-014462-11ggaqf1	1692	11	in	in	IN
cord-014462-11ggaqf1	1692	12	E.	E.	NNP
cord-014462-11ggaqf1	1692	13	coli	coli	NNS
cord-014462-11ggaqf1	1692	14	.	.	.
cord-014462-11ggaqf1	1693	1	SDS	SDS	NNP
cord-014462-11ggaqf1	1693	2	-	-	HYPH
cord-014462-11ggaqf1	1693	3	PAGE	PAGE	NNP
cord-014462-11ggaqf1	1693	4	gel	gel	NN
cord-014462-11ggaqf1	1693	5	revealed	reveal	VBD
cord-014462-11ggaqf1	1693	6	that	that	IN
cord-014462-11ggaqf1	1693	7	CP	CP	NNP
cord-014462-11ggaqf1	1693	8	expressed	express	VBD
cord-014462-11ggaqf1	1693	9	as	as	IN
cord-014462-11ggaqf1	1693	10	a	a	DT
cord-014462-11ggaqf1	1693	11	*	*	NFP
cord-014462-11ggaqf1	1693	12	40	40	CD
cord-014462-11ggaqf1	1693	13	kDa	kDa	NNP
cord-014462-11ggaqf1	1693	14	protein	protein	NN
cord-014462-11ggaqf1	1693	15	.	.	.
cord-014462-11ggaqf1	1694	1	The	the	DT
cord-014462-11ggaqf1	1694	2	recombinant	recombinant	JJ
cord-014462-11ggaqf1	1694	3	coat	coat	NN
cord-014462-11ggaqf1	1694	4	protein	protein	NN
cord-014462-11ggaqf1	1694	5	(	(	-LRB-
cord-014462-11ggaqf1	1694	6	rCP	rCP	NNP
cord-014462-11ggaqf1	1694	7	)	)	-RRB-
cord-014462-11ggaqf1	1694	8	fused	fuse	VBN
cord-014462-11ggaqf1	1694	9	with	with	IN
cord-014462-11ggaqf1	1694	10	69	69	CD
cord-014462-11ggaqf1	1694	11	His	-PRON-	PRP$
cord-014462-11ggaqf1	1694	12	-	-	HYPH
cord-014462-11ggaqf1	1694	13	tag	tag	NN
cord-014462-11ggaqf1	1694	14	was	be	VBD
cord-014462-11ggaqf1	1694	15	purified	purify	VBN
cord-014462-11ggaqf1	1694	16	from	from	IN
cord-014462-11ggaqf1	1694	17	E.	E.	NNP
cord-014462-11ggaqf1	1694	18	coli	coli	NNS
cord-014462-11ggaqf1	1694	19	using	use	VBG
cord-014462-11ggaqf1	1694	20	Ni	Ni	NNP
cord-014462-11ggaqf1	1694	21	-	-	HYPH
cord-014462-11ggaqf1	1694	22	NTA	NTA	NNP
cord-014462-11ggaqf1	1694	23	resin	resin	NN
cord-014462-11ggaqf1	1694	24	.	.	.
cord-014462-11ggaqf1	1695	1	The	the	DT
cord-014462-11ggaqf1	1695	2	antigenicity	antigenicity	NN
cord-014462-11ggaqf1	1695	3	of	of	IN
cord-014462-11ggaqf1	1695	4	the	the	DT
cord-014462-11ggaqf1	1695	5	fusion	fusion	NN
cord-014462-11ggaqf1	1695	6	protein	protein	NN
cord-014462-11ggaqf1	1695	7	was	be	VBD
cord-014462-11ggaqf1	1695	8	determined	determine	VBN
cord-014462-11ggaqf1	1695	9	by	by	IN
cord-014462-11ggaqf1	1695	10	western	western	JJ
cord-014462-11ggaqf1	1695	11	blot	blot	NN
cord-014462-11ggaqf1	1695	12	analysis	analysis	NN
cord-014462-11ggaqf1	1695	13	using	use	VBG
cord-014462-11ggaqf1	1695	14	antibodies	antibody	NNS
cord-014462-11ggaqf1	1695	15	raised	raise	VBD
cord-014462-11ggaqf1	1695	16	against	against	IN
cord-014462-11ggaqf1	1695	17	purified	purify	VBN
cord-014462-11ggaqf1	1695	18	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1695	19	.	.	.
cord-014462-11ggaqf1	1696	1	The	the	DT
cord-014462-11ggaqf1	1696	2	purified	purify	VBN
cord-014462-11ggaqf1	1696	3	rCP	rcp	NN
cord-014462-11ggaqf1	1696	4	was	be	VBD
cord-014462-11ggaqf1	1696	5	used	use	VBN
cord-014462-11ggaqf1	1696	6	as	as	IN
cord-014462-11ggaqf1	1696	7	an	an	DT
cord-014462-11ggaqf1	1696	8	antigen	antigen	NN
cord-014462-11ggaqf1	1696	9	to	to	TO
cord-014462-11ggaqf1	1696	10	produce	produce	VB
cord-014462-11ggaqf1	1696	11	high	high	JJ
cord-014462-11ggaqf1	1696	12	titer	titer	NN
cord-014462-11ggaqf1	1696	13	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1696	14	specific	specific	JJ
cord-014462-11ggaqf1	1696	15	polyclonal	polyclonal	JJ
cord-014462-11ggaqf1	1696	16	antiserum	antiserum	NN
cord-014462-11ggaqf1	1696	17	.	.	.
cord-014462-11ggaqf1	1697	1	The	the	DT
cord-014462-11ggaqf1	1697	2	resulting	result	VBG
cord-014462-11ggaqf1	1697	3	antiserum	antiserum	NN
cord-014462-11ggaqf1	1697	4	was	be	VBD
cord-014462-11ggaqf1	1697	5	used	use	VBN
cord-014462-11ggaqf1	1697	6	to	to	TO
cord-014462-11ggaqf1	1697	7	develop	develop	VB
cord-014462-11ggaqf1	1697	8	an	an	DT
cord-014462-11ggaqf1	1697	9	immunocapture	immunocapture	JJ
cord-014462-11ggaqf1	1697	10	reverse	reverse	NN
cord-014462-11ggaqf1	1697	11	transcription	transcription	NN
cord-014462-11ggaqf1	1697	12	-	-	HYPH
cord-014462-11ggaqf1	1697	13	polymerase	polymerase	NN
cord-014462-11ggaqf1	1697	14	chain	chain	NN
cord-014462-11ggaqf1	1697	15	reaction	reaction	NN
cord-014462-11ggaqf1	1697	16	(	(	-LRB-
cord-014462-11ggaqf1	1697	17	IC	IC	NNP
cord-014462-11ggaqf1	1697	18	-	-	HYPH
cord-014462-11ggaqf1	1697	19	RT	RT	NNP
cord-014462-11ggaqf1	1697	20	-	-	HYPH
cord-014462-11ggaqf1	1697	21	PCR	PCR	NNP
cord-014462-11ggaqf1	1697	22	)	)	-RRB-
cord-014462-11ggaqf1	1697	23	assay	assay	NN
cord-014462-11ggaqf1	1697	24	and	and	CC
cord-014462-11ggaqf1	1697	25	compared	compare	VBD
cord-014462-11ggaqf1	1697	26	its	-PRON-	PRP$
cord-014462-11ggaqf1	1697	27	sensitivity	sensitivity	NN
cord-014462-11ggaqf1	1697	28	levels	level	NNS
cord-014462-11ggaqf1	1697	29	with	with	IN
cord-014462-11ggaqf1	1697	30	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1697	31	based	base	VBN
cord-014462-11ggaqf1	1697	32	assays	assay	NNS
cord-014462-11ggaqf1	1697	33	for	for	IN
cord-014462-11ggaqf1	1697	34	detection	detection	NN
cord-014462-11ggaqf1	1697	35	of	of	IN
cord-014462-11ggaqf1	1697	36	PRSV	PRSV	NNP
cord-014462-11ggaqf1	1697	37	isolates	isolate	VBZ
cord-014462-11ggaqf1	1697	38	.	.	.
cord-014462-11ggaqf1	1698	1	IC	IC	NNP
cord-014462-11ggaqf1	1698	2	-	-	HYPH
cord-014462-11ggaqf1	1698	3	RT	RT	NNP
cord-014462-11ggaqf1	1698	4	-	-	HYPH
cord-014462-11ggaqf1	1698	5	PCR	PCR	NNP
cord-014462-11ggaqf1	1698	6	was	be	VBD
cord-014462-11ggaqf1	1698	7	shown	show	VBN
cord-014462-11ggaqf1	1698	8	to	to	TO
cord-014462-11ggaqf1	1698	9	be	be	VB
cord-014462-11ggaqf1	1698	10	the	the	DT
cord-014462-11ggaqf1	1698	11	most	most	RBS
cord-014462-11ggaqf1	1698	12	sensitive	sensitive	JJ
cord-014462-11ggaqf1	1698	13	test	test	NN
cord-014462-11ggaqf1	1698	14	followed	follow	VBN
cord-014462-11ggaqf1	1698	15	by	by	IN
cord-014462-11ggaqf1	1698	16	dot	dot	NN
cord-014462-11ggaqf1	1698	17	-	-	HYPH
cord-014462-11ggaqf1	1698	18	blot	blot	NN
cord-014462-11ggaqf1	1698	19	immunobinding	immunobinding	NN
cord-014462-11ggaqf1	1698	20	assay	assay	NN
cord-014462-11ggaqf1	1698	21	(	(	-LRB-
cord-014462-11ggaqf1	1698	22	DBIA	DBIA	NNP
cord-014462-11ggaqf1	1698	23	)	)	-RRB-
cord-014462-11ggaqf1	1698	24	and	and	CC
cord-014462-11ggaqf1	1698	25	plate	plate	NN
cord-014462-11ggaqf1	1698	26	trapped	trap	VBN
cord-014462-11ggaqf1	1698	27	ELISA	ELISA	NNP
cord-014462-11ggaqf1	1698	28	.	.	.