key: cord-014462-11ggaqf1
authors: nan
title: Abstracts of the Papers Presented in the XIX National Conference of Indian Virological Society, “Recent Trends in Viral Disease Problems and Management”, on 18–20 March, 2010, at S.V. University, Tirupati, Andhra Pradesh
date: 2011-04-21
journal: Indian J Virol
DOI: 10.1007/s13337-011-0027-2
sha: 
doc_id: 14462
cord_uid: 11ggaqf1

nan

patients showed rashes on face, hand and foot. EV detection carried out in vesicular fluid, stool, serum and throat swab specimens by RT-PCR of 5 0 NCR gene. Serotyping was carried out by using RT-PCR of viral protein of VP1/2A junction region followed by sequencing and phylogenetic analysis using neighbor-joining-algorithm and Kimura-2 parameter model of MEGA-4 software. Overall EV positivity detected in HFMD patients from Kerala, Tamil Nadu, West Bengal and Orissa states was found to be 51.6%, 66.6%, 62.5% and 71.4% respectively. Typing of VP1 gene sequences indicated presence of CA-6, EV-71, Echo-9 strains in Kerala and CA-16 in West Bengal, Orissa and Tamil Nadu. Phylogenetic analysis indicated CA-6, EV-71, Echo-9 strains showed 94.8-95.7% and 95-94.4% homology with Japanese, Australian and French strains. However, CA-16 strains were closer to Malaysian strains with 91.2-95.6% nucleotide homology. The present study documents the association of multiple types of EV's i.e., CA-6, EV-71, Echo-9 and CA-16 strains contributing as prime viral pathogens in HFMD epidemics in the reported regions with new emergence of CA-6 circulating strain in Kerala, India. Tasgaon September 2010. Sera were collected from 162 suspected hepatitis cases and there contacts and tested for anti HEV IgM/IgG antibodies (ELISA) and liver enzymes like Alanine Aminotransferase (ALT). Anti HEV IgM antibodies were detected in 45.7% (74/162) of the suspected cases. The overall attack rate was 0.7%. Male to female ratio was 2:1. Majority (60.4%) of the cases were in the age group 20-40 years and recovered without any clinical complications. Weekly distribution of cases showed that the majority (79.4%, 116/146) cases occurred between 2nd and 3rd week of June. Dark urine (97.5%), jaundice (93.5%), fatigue (35.9%), abdominal pain (32.6%), anorexia (29.4%), vomiting (26.5%), fever (22.8%), giddiness (14.3%), diarrhoea (12.6%) and arthalgia (3.7%) were the prominent symptoms. Sera collected from 73 antenatal cases (ANCs) showed anti HEV IgM antibody in 3. Affected pregnant women had a normal outcome. A death of 32 year, male hepatitis E case was reported during the outbreak period that had cirrhosis of liver with oesophageal varices. Sanitary survey revealed that water pipelines were laid down in close proximity of sewerage system, and water posts were without tap. These are the likely sources of faecal contamination of water supplies. Among 17 water samples collected from various places, 5 were found to be unfit for drinking based on the routine bacteriological tests conducted at State Public Health Laboratory, Pune. No case occurred after the pipelines were repaired. This typical outbreak of hepatitis E re-emphasizes need for proper water supply/sewage disposal pipelines and adequate maintenance measures.

Jayanthi Shastri, Nilima Vaidya, Sandhya Sawant, Umesh Aigal Department of Molecular Biology, Kasturba Hospital for Infectious Diseases, Mumbai, India Dengue and Dengue haemorrhagic fever are amongst the most important challenges in tropical diseases due to their expanding geographic distribution, increasing outbreak frequency, hyperendemicity and evolution of virulence. The gobal prevalence of dengue has grown dramatically in recent decades. WHO estimates 50-100 million cases of dengue virus infections worldwide every year resulting in 250,000 to 500,000 cases of DHF and 24,000 deaths each year. Public health laboratories require rapid diagnosis of dengue outbreaks for application of measures such as vector control. Laboratory diagnosis of dengue virus infection can be made by the detection of specific virus, viral antigen, genomic sequence and/or antibodies. Currently 3 basic methods used by laboratories for diagnosis of dengue virus infection are virus isolation and characterisation, detection of genomic sequence by nucleic acid amplification technology assay and detection of dengue virus specific antibodies/antigen. Molecular diagnosis based on reverse transcription (RT)-PCR s.a. one step or nested PCR, nucleic acid sequence based amplification (NASBA), or real time RT-PCR, has gradually replaced the virus isolation method as the new standard for the detection of dengue virus in acute phase serum samples. Several PCR protocols for detection have been described that vary in the extraction method, genomic location of primers, specificity, sensitivity and the methods to determine the products and the serotype. PCR-based dengue tests, due to the specificity of amplification, enable a definitive diagnosis and serotyping of the virus. In addition DNA sequencing of the amplification product enables the virus to be genotyped, providing important information on the sources of infection. More recently tests have incorporated flurogenic probe, so called Taq Man technology for the specific Real Time detection of dengue 1-4 amplicons. Product is detected by a specific oligodeoxy nucleotide probe that is labelled with 6 carboxy-fluorescein (FAM). This technology offers the advantage of being both rapid and potentially quantitative. Second, the detection of product by hybridisation of flurochrome labelled probes increases specificity. Third, as the product is detected without the need to open the reaction tube, the risk of contamination by product carry over is minimised. The advantages of speed, contamination minimisation and reduced turn around time justify application of this assay over the currently used nested PCR assay. During the period January 2007 to October 2009, Molecular laboratory received 900 samples from patients presenting with acute onset fever for Dengue .6%) samples were tested positive by this method. The disease peaks in the monsoon season with a percentage of 17.5%. Rapid tests, IgM and IgG capture ELISA are popularly used tests for diagnosis of dengue infection. Its utility is limited for diagnosing dengue in convalescecce (8-14 days) . Specificity is also compromised due to infections with flaviviruses: Japanese encephalitis and Chikungunya. Dengue NS1 Ag ELISA with its cost effectiveness, specificity and sensitivity should be considered as the test of choice for diagnosing Dengue in the acute phase of illness in the developing countries. Molecular diagnosis enables confirmatory diagnosis of Dengue in the acute phase of the illness and is suitable for further typing methods.

Assistant General Manager and R&D Coordinator, Division of Quality Control and R&D, Bharat Immunologicals and Biologicals Corporation Ltd., Village Chola, Bulandshahr, UP Vaccine development in India, though slow to start, has progressed by leaps and bounds in the past 60 years. It was dependent on imported vaccines but now it is not only self-sufficient in the production of vaccines conforming to international standards with major supplier of the same to UNICEF. The role of Drug authorities is to enhance the public health by assuring the availability of safe and effective A2

Indian J. Virol. (September 2010) 21(Suppl. 1):A1-A58 vaccines, allergenic extracts, and other related products. Vaccine development is tightly regulated by a hierarchy of regulatory bodies. Guidelines provided by the Indian Council of Medical Research (ICMR) set the rules of conduct for clinical trials from Phase I to IV studies as well as studies on combination vaccines. These guidelines address ethical issues that arise during a vaccine study. A network of Adverse Drug Reaction (ADR) monitoring centers along with the Adverse Events Following Immunization (AEFI) monitoring program provide the machinery for vaccine pharmacovigilance. Genetic modifications have been developed to develop effective and cheaper vaccines by the use of recombinant technology. To ensure safety of consumers, producers, experimental animals and environment, Governments all over the world are following regulatory mechanisms and guidelines for genetically modified products. As with other industrializing countries undergoing rapid shifts, India clearly recognizes the need to restructure its regulatory system so that its biopharmaceutical industry can compete in international markets. Genetic Engineering Approval Council (GEAC), Recombinant DNA Advisory Committee (RDAC), Review Committee on Genetic Manipulation (RCGM), Institutional Biosafety Committees (IBSC) are responsible for development, commitment for parameters and commercialization of recombinant vaccines. To centralize and coordinate the whole system, Government has taken to form two agencies to regulate the regulation laws to develop recombinant pharmaceuticals products including vaccines. The first is the creation of the National Biotechnology Regulatory Authority (NBRA), under the Department of Biotechnology (DBT), as part of India's long-term biotech sector development strategy. The second major initiative will affect the entire Indian pharmaceutical industry. This is the replacement of most state, district, and central drug regulatory agencies with a single, central, FDA-style agency, the Central Drug Authority (CDA). The CDA is expected to have separate, semi-autonomous departments for regulation, enforcement, legal, and consumer affairs; biotechnology products; pharmacovigilance and drugs safety; medical devices and diagnostics; imports; quality control; and traditional Indian medicines. It will set up offices throughout India and will be paid for inspection, registration, and license fees. Its enforcement powers will be strengthened by a new law increasing the criminal penalties for illegal clinical trials. In the manufacturing area, though, the country has been tightening the rules and enforcement. An amendment to the regulations, ''Schedule M'' of the Drug and Cosmetics Act, now specifies the Good Manufacturing Practice (GMP) requirements for factory premises and materials. These requirements were modeled after US FDA regulations, to improve regulatory coordination between Indian and US regulators. India has realized the importance of regulations in pharmaceutical specially in vaccine field but it will take several years to implementation of these. India has coordinated some of its regulatory functions with Western organizations. The US Pharmacopoeia established an office in Hyderabad in 2007. A representative of the Indian pharmaceutical lobby also recently has expressed openness to an expansion of the FDA's oversight of Indian manufacturing. As India expands its global drug and biologicals production, US and Europe, as the world's largest drug importers, will likely expand their regulatory support in the development of the country's regulatory systems. Rapid diagnosis of Japanese encephalitis virus (JEV) infections is important for timely clinical management and epidemiological control in areas where multiple flaviviruses are endemic. However, the speed and accuracy of diagnosis must be balanced against test cost and availability, especially in developing countries. An antigen capture enzyme-linked immunosorbent assay (ELISA) for detection of circulating JEV specific nonstructural protein 1 (NS1) was developed by using monoclonal antibodies (MAbs) specific to recombinant (NS1). The applicability of this JEV NS1 antigen capture ELISA for early clinical diagnosis was evaluated with 200 acute phase serum/ cerebrospinal fluid (CSF) specimens collected from different epidemics during [2007] [2008] [2009] . JEV NS1 antigen was detected in circulation from day 1 to 18. The sensitivity and specificity of JEV NS1 detection in serum/CSF specimens with reference to reverse transcriptase PCR was 82%, and 98.9% respectively. No crossreactions with any of the other closely related members of the genus Flaviviruses (Dengue, Westnile, Yellow fever and Saint Louis encephalitis (SLE) viruses) were observed when tested with either clinical specimens or virus cultures. These findings suggested that the reported JEV specific MAb-based NS1 antigen capture ELISA will be a rapid and reliable tool for early confirmatory diagnosis as well as surveillance of JE infections in developing countries.

Manmohan Parida

The recent emergence of a novel human influenza A virus (H1N1) poses a serious global health threat. The H1N1 virus has caused a considerable number of deaths within a short duration since its emergence. A two-step single tube accelerated rapid real-time and quantitative Swine flu virus specific H1 RTLAMP assay is reported by targeting the H1 gene of the novel H1N1 hybrid virus. The feasibility of Swine flu H1 RTLAMP for clinical diagnosis was validated with a panel of 239 suspected throat wash samples comprising 116 confirmed positive and 123 confirmed negative cases of ongoing epidemic. The comparative evaluation of H1 specific RTLAMP assay with real-time RT-PCR demonstrated exceptionally higher sensitivity by picking up all the 116 H1N1 positive and 36 additional positive cases amongst the negatives that were sequence confirmed as H1N1.

None of the Real-Time RTPCR positive samples were missed by RTLAMP system. The comparative study revealed that RTLAMP was 100-fold more sensitive than RTPCR with a detection limit of 1 copy number. These findings suggested that RTLAMP assay is a valuable tool for rapid, real-time detection as well as quantification of H1N1 virus in acute phase throat swab samples without requiring any sophisticated equipments.

because of its recurrent nature. Despite considerable progress in understanding of the virus at cellular and molecular levels, the proper management of the disease in its different stages is still a dilemma particularly whether to use antiviral or steroids or both. The risk of using steroids with its attendant complications has to be weighed against the risk of progression of the disease if avoiding the use of steroids. This dilemma can be reduced to a considerable extent if basic principles of virology and pathogenesis are kept in mind. This article reviews current concepts of virological and clinical aspects of HSV keratitis to enable a broad understanding of the disease process. It is recognized several influential host factors including the fact that HSK is more common in men than women. It is observed that the ability of HSV to establish latent infection in sensory neurons and possibly cornea, but have as yet been unable to use this knowledge to prevent the disease limitations. Acknowledging limitations may further stimulate application of laboratory knowledge in coping with HSK which constitutes to present major challenge in terms of management.

MVO-10 Study on Effect of Human bHsp90 in Immunity of HCV Core Protein and HBV HbsAg There are more than 500 million individuals with hepatitis B and C in the world. In spite of vaccination in the different areas there are several reports about patients who got vaccine before. Also there is not efficient vaccine against of hepatitis C and one of the important problems in vaccine project is development of effective and suitable adjuvant in human vaccines. At present research we applied human bHsp90 protein as adjuvant and chaperon. This protein injected to BalbC mice as adjuvant together with recombinant proteins of HCV core and HBV HbsAg. Then humoral and Cellular immune systems of the mice were studied. Core and HbsAg genes were cloned into pETDuet-1 vector and thermal vector of pGP1-2 was used for human heat shock protein 90 expressions. The different combination of these three proteins was injected to mice and we evaluated the total IgG and IgG2a of mice serums after a week. Two weeks after booster injection, we studied the proliferation and cytokine secretion of spleen, inguinal and popliteal lymph nodes lymphocytes in vitro and ex vivo conditions. So the Core/HbsAg + hsp and Core + HbsAg + hsp complexes induced total IgG and IgG2a secretion. The spleen lymphocytes proliferation were increased equal to serum IgG2a level that was constant in second time bleeding with significant different to complexes with freund's adjuvant. At first IL-4 and IL-5 cytokines were increased and then decrease of IL-4 meaned no hypersensitivity. The chaperon effect of Hsp90 on structure of core and HbsAg proteins was studied by CD and flourometer. It could fold the proteins after heating and unfolding. Hepatitis B virus (HBV) infection is vaccine preventable global public health problem. All commercially available vaccines contain one or more of the recombinant Hepatitis B envelope protein or surface antigen (HBsAg). Measurement of antigen responsible for immunogenicity of vaccine is central to quality assessment. The problems associated with the use of a polyclonal antibody in an assay with regard to its poorly defined nature and batch-to-batch variation has been mitigated by the use of MAbs as described in this paper. The initial capture of HBsAg by the MAb could orientate it such that the same antibody could bind to it as a detection antibody after labeling with out steric hindrance. The development of an immuno-capture ELISA (IC-ELISA) to measure the HBsAg content using a monoclonal antibody (MAb) specific to determinant ''a'' of HBsAg in the experimental vaccine formulations is being discussed. Murine MAbs developed against HBsAg, subtype adw2 were found to cross-react with the other subtypes viz. ad and ay too. The MAbs have been characterized following which, one MAb HBs06 was chosen for developing IC-ELISA format for the quantification of the HBsAg in the final Algel adsorbed vaccines. The unadsorbed HBsAg was used to establish the standard curve of HBsAg/a. The ELISA had a sensitivity of 10 ng/ml of HBsAg. The recovery rate of HBsAg/a was found to be around 70% in the vaccines treated to desorb the antigen from Algel. Twenty seven experimental batches of monovalent Hepatitis B vaccines were analyzed for the HBsAg content, both by IC-ELISA and a commercial kit (AxSym kit, Abbott Laboratories, USA). The statistical analysis of IC-ELISA results indicated that an experimental equation f(x) = 0.0062(x) + 0.184, could precisely estimate the amount of HBsAg in the adsorbed vaccines. The amounts of HBsAg recovered from the adsorbed vaccines as estimated by the IC-ELISA format had a good correlation with the estimates derived from a commercial kit, which is being used by several vaccine manufacturers in India for the quality control of vaccine antigen. The varying amounts of vaccine antigens that could be recovered seemed to depend on the quality of the HBsAg and the methods of HBsAg adsorption to the alum gel during vaccine manufacture.

epidemiology of the spread of H1N1 virus. Children of school going age have become victim of this deadly virus as evident from the reporting data generated in the past few weeks. The mortality rate has also been slightly increased. The disease spread in wave pattern and presently the world is passing through the second wave of pandemic with more severity in young and otherwise health people with a predilection for lungs leading to viral pneumonia and respiratory failure. Now the pandemic gained hold in the developing world affecting more severely as millions of people live under deprived conditions having multiple health problems, with little access to basic health care. Current data about the pandemic from developed counties need to be very closely watched in relation to Shift in virus sub type, Shift of the highest death rate to younger populations, Successive pandemic waves, Higher transmissibility than seasonal Influenza, and Demographic differences etc. Presently the world appears to be better prepared. Vaccine is available in market in many countries. Even vaccine trials are actively going on in Indian population. Effective antivirals are available. Although till now H1N1 diagnostic centers worked with CDC/WHO recommended H1N1 specific primer, probes with Taqman chemistry by Real Time PCR, efforts on the development of indigenous diagnostics, Vaccines and chemoprophylaxis is going on to have a better combat against this highly infectious virus. were positive for rotavirus infection by either PAGE or ELISA methods. The available data highlights the importance of rotavirus as a cause of diarrhea in children, which is severe enough to deserve specialized care. The observed proportion of 25.5% of all diarrhea cases being associated with rotavirus falls within the range of values reported by other workers. The reported positivity varies from 10.5 to 70.7%. In our study a complete concordance of ELISA and PAGE results were observed in 194 (97%) of the 200 tested specimens. This finding closely correlates with the findings of other authors who found a 96.7-97.14% concordance results between ELISA and PAGE methods. Some authors found RNA-PAGE method that is as sensitive and rapid as ELISA for detecting rotavirus In stool samples of cases of diarrhea and some others proposed ELISA is more sensitive than PAGE method fond to be 100% specific. The remaining 6 (3%) samples showed conflicting results. In a lone sample in which the OD value of ELISA test was 0.195, this value was almost at the cutoff level, the possibility of this sample being positive by ELISA test is doubtful. Negative result of the same sample in PAGE method is difficult to explain, the possibility of presence of lot of empty virus particles or due to low concentration of viral RNA in the fecal specimen and insufficient extraction of viral RNA could be possible. On the other hand, 5 of the samples which gave positive results by PAGE method were negative by ELISA test. These 5 samples had a typical 4-2-3-2 RNA pattern. The reason for their being ELISA negative thus remains unexplained, however blocking factors or the presence of inhibitory substance in stools might have been responsible. The samples containing predominantly complete particles can also give false negative results. Since, the group antigen is not exposed. Earlier studies have also reported PAGE to be the most sensitive technique although some are of view that it is laborious procedure. How ever, the PAGE system used in this study was very simple to perform and the results were available on the same day. The main requirement was of trained personnel and proper standardization of the technique. Most reports states that the greatest advantage of PAGE and silver stain method are its lack of ambiguity and the fact that it provides information about viral electropherotypes. The modified PAGE system was thus found to be reliable, simple and rapid, no expensive reagents were required. Locally available reagents from HI media were used. The cost of the chemical for PAGE per specimen was Rs. 24 approximately as compared to Rs. 110 per test by confirmatory ELISA. A locally produced slab gel electrophoresis system with power pack was the only equipment required. This method could be used for the routine diagnosis of rotavirus infection in the laboratory.

vaccine, rapid diagnosis plays an important role in early management of patients. In this study a QC-RT-PCR assay was developed to quantify Chikungunya virus RNA by targeting the conserved region of E1 gene. A competitor molecule containing an internal insertion was generated, that provided a stringent control of the quantification process. The introduction of 10-fold serially diluted competitor in each reaction was further used to determine sensitivity. The applicability of this assay for quantification of Chikungunya virus RNA was evaluated with human clinical samples and the results were compared with Real-time quantitative RT-PCR. The sensitivity of this assay was estimated to be 100 RNA copies per reaction with a dynamic detection range of 10 2 to 10 10 copies. Specificity was confirmed using closely related alpha and flaviviruses. The comparison of QC-RT-PCR result with real-time RT-PCR revealed 100% concordance. These findings demonstrated that the reported assay is convenient, sensitive and accurate method and has the potential usefulness for clinical diagnosis due to simultaneous detection and quantification of Chikungunya virus in acute-phase serum samples. In India, measles vaccine was introduced as part of expanded programme of immunization in 1985. Measles, mumps and rubella (MMR) vaccine is still not part of the national immunization schedule of India. The Indian association of paediatrics (IAP) recommends measles vaccine at 9 months of age and MMR vaccine at 15-18 months. However, in a recent policy update, IAP committee on immunisation opined that there is a need for a second dose of MMR vaccine for providing adequate immunity against MMR. The aim of the present study was to assess the extent of sero-protection against MMR at 4-6 years of age in children who have received one dose of MMR between 12 and 24 months of age. An attempt has also been made to assess the sero-response to the second dose of MMR vaccine in 4-6 years old children. A total of 106 consecutive children between the ages of 4-6 years who had received MMR vaccine between 12 and 24 months of age and attending the immunization clinic of GTB hospital, Delhi were enrolled. The vaccination status, anthropometry and physical examination findings were recorded. Three ml of venous sample was again withdrawn for estimation of post vaccination antibody titre. It was observed that 20.39%, 87.38% and 75.73% children were seroprotected for MMR respectively after 2.5-4.5 year of receiving first dose of MMR vaccine. Seroprotection rose to 72.62%, 100% and 100% for MMR respectively after 4-6 weeks of receiving second dose of MMR vaccine. Geometric mean concentration of antibody also rose significantly in all three diseases. In view of low seroprevalence of MMR and hence high susceptibility to infection at 4-6 years of age, who have already received MMR vaccine, there is need to boost the immune responses against these three diseases by giving a second dose of MMR vaccine. Baseline information on the epidemiology of viral agents causing STIs and types of risk behaviour of affected persons are essential for any meaningful targeted intervention. The present study documents the pattern of viral STIs in patients attending a tertiary care hospital, correlating the syndromic approach and the laboratory investigations to determine the aetiology. Three hundred consecutive patients attending the STI clinic were diagnosed and categorized according to the syndromic approach of the WHO along with detailed history and demographic data. Majority of the patients were men (53.12%) with a mean age of 24 years. Men received education up to middle school. Half of the female subjects were illiterate. Sixty percent of the patients were married and among these, 19% were regular condom users. First sexual contact at or before 18 years of age was more in men (31% vs. 22 .22% in women). Promiscuity was more among male patients who had contact with CSW. Genital Herpes was the commonest viral STI (86/300) followed by genital wart (60/300). Concomitant infection with more than one virus was seen in 35% of patients. HIV was prevalent in 10.3% of STI patients. Hepatitis B, Hepatitis C, Herpes simplex type 1 and Molluscum contagiosum were the other viral agents seen in STI clinic attendees at our centre. This disease currently Prevalent in more than 100 countries world wide and annually 50-100 million people are infected with Dengue virus among which 2.5-5 lakhs cases were Dengue Hemorrhagic Fever (DHF) and Dengue Shock Syndrome (DSS) which are serious forms of Dengue virus infection and due to this condition 25,000 deaths might occur annually World Wide and approximately 3 million children were hospitalized for the fast 3 decades. This disease is characterized by sudden onset of high fever with sever headache, pain in the back and limbs, lymphadenopathy macuolo-papulur rash over the skin and retro-bulbar pain. Early Diagnosis can be established with simple and rapid lgG/1gM antibodies detection in the blood samples of the patients based on the Bi-directional immunoassay system for its management and control to reduce morbidity and mortality. Details will be presented. Myocarditis and dilated cardiomyopathy (DCM) are common causes of morbidity and mortality both in children and adults. The most common viruses involved in myocarditis are coxsackievirus B or adenovirus. Recently, the coxsackievirus and adenovirus receptor (CAR), a common receptor for coxsackieviruses B3, B4 and adenoviruses 2, 5 has been identified. Increased expression of CAR has been reported in patients with DCM suggesting utilization of CAR by these viruses for cell entry. The present study was designed to study the expression of CAR in myocardial tissue of patients with DCM. Formalin fixed myocardial tissues were obtained from autopsy cases. A total of 26 cases of DCM and 20 cases of controls which included non-cardiac (Group-A) and cardiac disease other than DCM (Group-B) were included in the study. Expression of CAR was studied by immunohistochemical staining of myocardial tissue using CAR specific rabbit polyclonal antibody and biotin conjugated secondary antibody. The tissue sections were considered positive when[25% of the cell showed brown color staining by immunohistochemistry (IHC). The CAR positivity in DCM cases was found to be 96% (25/ 26) as compared to 30% in control group A and 40% in control group B respectively. The CAR positivity was significantly higher in the test group as compared to both the control groups. Further CAR positivity in all the cellular types (myocytes, endothelial cells and interstitial cells) was found significantly higher in test group as compared to both the control groups. The expression of CAR was significantly higher in myocytes as compared to both endothelial and interstitial cells in all the groups. However, no significant difference was observed in CAR positivity between endothelial and interstitial cells. The present study highlights the increased expression of CAR in DCM cases with further significance of CAR expression in myocytes and endothelial cells. This may help further in understanding the tropism of viruses or cellular susceptibility, which in turn will help in appropriate diagnostic and therapeutic approach in management of viral myocarditis and DCM cases. Food Security and Safety vary widely around the world, and reaching these goals is one of the major challenges, raising public concern for the wellbeing of mankind, in particular. Industrialized production and processing as well as improper environmental protection have clearly shown severe limitations such as worldwide contamination of the food chain and water. Contaminated water and food during the processes of production, processing and handling are essentially responsible for food and water borne viral infections/diseases. The cases of viral food borne outbreaks are on the rise, creating a threat to human health. Recent researches indicate that epidemiological studies are meager to focus the frequently contaminated foods and food borne viral diseases. Current paper projects the etiology of select food borne viral diseases, probable reasons for non availability of appropriate methods to detect the viruses responsible for the diseases, routes of water and food borne transmission of enteric viral infections, currently available methods of detection of select viruses and bio safety measures to prevent food borne viral infections. Dietary/Nutritional Management in food borne viral diseases is crucial to control weakness and gastro enteric intolerance due to disease condition and antibiotic therapy. It will principally improve food intake, resulting in better nutritional status leading to optimum immune response. Food borne viruses are mainly belong to rotaviruses, enteropathogenic viruses, astroviruses, adenoviruses and caliciviruses, causes acute gastroenteritis (AG) which is an important health problem. The frequency of rotavirus as a cause of sporadic cases of AG ranges between 17.3% and 37.4%. Astroviruses cause AG, with a frequency ranging between 2 and 26%: outbreaks have been described in schools and kindergartens, but also in adults and the elderly. The frequency of identification of adenoviruses 40 and 41 as causes of sporadic AG in non-immuno suppressed children ranges between 0.7% and 31.5%, although there is probably underreporting because the sensitivity of conventional techniques is low. Caliciviruses are separated phylogenetically into two genera: Norovirus and Sapovirus. Norovirus is frequently associated with food-and water-borne outbreaks of AG. It is estimated that 40% of cases of AG due to norovirus are food borne. In Sweden and some regions of the United States, norovirus is the first cause of outbreaks of food borne diseases. Sapovirus outbreaks due to person-to-person and food borne transmission affecting both children and adults have recently been reported in countries such as Canada and Japan. It has been predicted that the importance of diarrhoeal disease, mainly due to contaminated food and water, as a cause of death will decline worldwide. Evidence for such a downward trend is limited. This prediction presumes that improvements in the production and retail of microbiologically safe food will be sustained in the developed world and, moreover, will be rolled out to those countries of the developing world increasingly producing food for a global market. Sustaining food safety standards will depend on constant vigilance maintained by monitoring and surveillance but, with the rising importance of other food-related issues, such as food security, obesity and climate change, competition for resources in the future to enable this may be fierce. In addition the pathogen populations relevant to food safety are not static. Food is an excellent vehicle by which many pathogens (bacteria, viruses/prions and parasites) can reach an appropriate colonization site in a new host. Although food production practices change, the well-recognized food-borne pathogens, such as Salmonella spp. and Escherichia coli, seem able to evolve to exploit novel opportunities, for example fresh produce and even generate new public health challenges, for example antimicrobial resistance. In addition, previously unknown food-borne pathogens, many of which are zoonotic, are constantly emerging. Awareness and surveillance of viral food-borne pathogens is generally poor but emphasis is placed on Norovirus, Hepatitis A, rotaviruses and newly emerging viruses such as SARS. It is clear that one overall challenge is the generation and maintenance of constructive dialogue and collaboration between public health, veterinary and food safety experts, bringing together multidisciplinary skills and multi-pathogen expertise. Such collaboration is essential to monitor changing trends in the well-recognized diseases and detect emerging pathogens. It is also necessary to understand the multiple interactions between these pathogens and their environments during transmission along the food chain in order to develop effective prevention and control strategies. To analyse the effectiveness of these siRNAs targeting rabies virus L gene, the BHK-21 cells expressing siRNAs in shRNA form were produced by transduction of cells with rAdV-L. The transduced BHK-21 cells expressing siRNA were infected with rabies virus PV-11 strain. There was reduction in rabies virus multiplication as analysed by reduction in fluorescent foci forming unit (ffu) count by 51.85% (70 ffu in BHK-21 cells expressing siRNA-L compared to 135 ffu in BHK-21 cells expressing negative siRNA). The expression of L gene mRNA was reduced by 16.11fold in rabies virus infected rAdV-L transduced cells compared to rAdV-Neg transduced cells (Negative control) as detected using real-time PCR. After analyzing the effectiveness of rAdV-L in vitro, its effectiveness was also evaluated in vivo in mice after virulent rabies challenge. The mice were inoculated with 10 7 plaque forming units (PFU) of rAdV-L in masseter muscle (i/m route) and challenged with 15 LD 50 rabies virus challenge virus standard (CVS) strain. The results indicated 50% protection with improved median survival from 7 to 11 days compared with group of mice treated with rAdV-Neg. The results of this study indicated that siRNAs targeting rabies virus polymerase (L) gene delivered through adenoviral vector inhibited rabies virus multiplication in vitro and in vivo. and 4 were successfully produced and purified from the infected Spodoptera frugiperda (Sf-9) cells using these recombinant baculovirus. The morphology of the VLPs was validated by electron microscopy in comparison to the authentic BT virions. The VLPs produced here were stable and were highly immunogenic with intact outer layer which is rapidly lost during normal infection of BTV. These BTV-VLPs elicited long lasting protective immunity in vaccinated sheep against virulent virus challenge. With the use of BTV-VLPs it was also possible to differentiate the infected and vaccinated animals (DIVA). VLP-based BTV vaccine has potential advantages with regard to controlling the spread of BTV with multiple serotypes. It is possible to produce milligram quantities of correctly folded and processed protein complexes using this Baculovirus expression system and hence it is a more promising system for producing new generation vaccines like VLP subunit vaccine against any viral diseases in large scale. Peste des petits ruminants (PPR), goatpox and ORF are OIE notifiable diseases of small ruminants especially goat and sheep. These diseases are economically important, in enzootic countries like India and cause significant loss and are major constraints in the productivity. Considering the geographical distribution of PPR, goat pox and ORF infections and prevalence of mixed infection, in the present study, safety and potency of the experimental triple vaccine comprising attenuated strains of thermostable-PPR virus (PPRV Jhansi, P-50) grown at 40°C, high passaged goat poxvirus (GTPV Uttarkashi, P100) and attenuated ORF virus (ORFV Mukteswar, P51) was evaluated in sub-Himalayan local hill goats. Goats simultaneously immunized with 1 ml of vaccine consisting of either 10 3 TCID 50 or 10 5 TCID 50 of each of PPRV, GTPV and ORFV were monitored for clinical and serological responses for a period of 3-4 weeks post-immunization (pi) and post challenge (pc). Specific immune responses i.e., antibodies directed to PPRV, GTPV and ORFV could be demonstrated by PPR competitive ELISA kit and capripox indirect ELISA, SNT, respectively following immunization. All the immunized animals resisted infections when challenged with virulent strains of either GTPV or PPRV or ORFV on day 28 dpi, while in contact control animals developed characteristic signs of respective disease. Further, PPR viral antigen could be detected by using PPR sandwich ELISA kit in the excretions (nasal, ocular and oral swab materials) of unvaccinated control animals after challenge but not from any of the immunized goats. Triple vaccine was found safe at dose as higher as 10 5 TCID 50 and induced protective immune response even at lower dose (10 2 TCID 50 ) in goats, which was evident from sero-conversion as well as challenge studies. The study indicated that these viruses are compatible and did not interfere with each other in eliciting immune response, paving the feasibility of use of this triple vaccine in combating these infections simultaneously. Toll like receptors (TLRs), primary sensors of microbial origin, plays a crucial role in the innate immunity. Till now 13 mammalian TLRs have been identified, while there is no information available on TLRs of Yak. This study is part of World Bank Funded-ICAR project. Yak, named Bos grunniens for its distinctive vocalization and relationship with cattle, is natural habitant of extremely cold environment. When these animals comes to a lower altitude grazing land, adjacent to villages, become susceptible to the diseases of cattle, buffalo etc. Thus, present study was undertaken to with genetic characterization and evolutionary lineage analysis of Yak TLRs. We worked on TLR7 gene, which plays an important role in recognition of ssRNA viruses. Total RNA was extracted from mitogen stimulated PBMCs of Yak. The RT-PCR conditions were standardized for full length amplification of TLR gene 7 using specific self designed primers. The expected amplicon of 3559bps was obtained. It was cloned in pGEMT-Easy vector followed by transformation in E. coli Top10 strain. The recombinant clones were screened, picked up for plasmid isolation and release of TLR7 was confirmed by restriction digestion. The cloned TLR7 product was sequenced and analyzed for the nucleotide and deduced amino acid sequences, and 3D structure analysis. The results revealed that Yak shows more than 98% sequence homology with other Bos indicus breeds and Bos taurus breeds. However, identity was less than 88% with other animal species (equine, murine, feline, canine etc.). The evolutionary lineage findings cluster Yak more closely with bovine species. Point mutations revealed changes at 25 nucleotide positions with corresponding amino acid change at 15 positions. SMART analysis of Yak protein domain architecture revealed Toll-Interleukin I receptor (TIR), Leucine rich repeats (LRR) and signal peptide region. The variations in Yak mainly lie in the LRR region. Homology modeling revealed horse shoe shaped structure with 5 alpha helix. The additional alpha helix present in Bos indicus was not detected in Yak. The present study shows existence of genetic variability in TLR7 gene of Yak, in particular the LRR region, which plays an important role in the pathogen recognition and the evolutionary lineage analyses shows its closeness with other bovine species.

A.P. Aquaculture and Fisheries, Tirupati

In this new millennium, aquatic animal health management strategies in Asia expanded and adjusted to the current disease problems faced by the aquaculture sector. This presentation will briefly discuss some of the most serious trans-boundary pathogens affecting Asian aquaculture including a newly emerging disease and highlight recent regional and national efforts on responsible health management for mitigating the risks associated with aquatic animal movement. A regional approach is fundamental since many countries share common social, economic, industrial, environmental, biological and geographical characteristics. Capacity and awareness building on aquatic animal epidemiology, science-based risk analysis for aquatic animal transfers, surveillance and disease reporting, disease zoning and establishment of aquatic animal health information systems to support development of national disease control programs and emergency response to disease outbreaks are needed. Molecular diagnostics with emphasis towards standardization and harmonization, inter-calibration exercises and quality assurance in laboratories, accreditation program and utilization of regional resource centres on aquatic animal health will also be needed. Whilst most of these strategies are directed in support of government policies, implementation will require pro-active involvement, effective cooperation and strategic networking between governments, farmers, researchers, scientists, development and aid agencies, and relevant private sector stakeholders at all levels. Their contributions are essential to the health management process. Generally, aquaculture plays an important role in economy as harvests from natural waters have declined or, at best, remained static in most countries. Fish and shrimp, the main aquaculture product sources, have gained the most attention. Many factors can cause losses in yields of fish products and infectious disease in fish and shrimp is the biggest threat to the fishery industry. Shrimp and fish aquaculture has grown rapidly over several decades to become a major global industry that serves the increasing consumer demand for seafood and has contributed significantly to socio-economic development in many poor coastal communities. However, the ecological disturbances and changes in patterns of trade associated with the development of shrimp and fish farming have presented many of the pre-conditions for the emergence and spread of disease. Shrimp and fish are displaced from their natural environments, provided artificial or alternative feeds, stocked in high density, exposed to stress through changes in water quality and are transported nationally and internationally, either live or as frozen product. These practices have provided opportunities for increased pathogenicity of existing infections, exposure to new pathogens, and the rapid transmission and trans boundary spread of disease. Not surprisingly, a succession of new viral diseases has devastated the production and livelihoods of farmers and their sustaining communities. This review examines the major viral pathogens of farmed shrimp and fish, the likely reasons for their emergence and spread, and the consequences for the structure and operation of the shrimp farming industry. In addition, this review discusses the health management strategies that have been introduced to combat the major pathogens and the reasons that disease continues to have an impact, particularly on poor, smallholder farmers in Asia. BTV isolates from the same geographic region have been termed as 'topotypes' and initial observation on segment 3 nucleotide sequences identified a correlation between topotypes and genetic information. Later topotyping was proposed based on segment 10, on the premise that the encoding protein NS3, which is involved in virus egress from insect cells, would lead to evolutionary fitness in parallel with the geographic distribution of the different Culicoides species. Further studies attempted to extend this to nucleotide sequence homology in segments 7 and 10, but failed to identify clear cut correlations or any evidence for positive selection. For example, South African isolates were found not to cluster into separate African lineage. In this study, we carried out a more extensive analysis of segment 10 sequences. Our analysis showed no segregation of isolates into topographically distinct groups. Instead we observed topological clustering of the clades, and we attribute this to genetic bottleneck resulting in genetic drift and founder effect leading to homogenous gene pool in a geographical area. We hypothesize that when a new virus enters a geographical area where local BTV strains are already circulating, the new genes/segments would enter into a bigger gene pool. Consequently, the newer incursions into a heavily endemic area tend to get diluted and disappear from the population because the rate of drift is inversely proportional to the population size, unless they are positively selected. Use of live attenuated vaccine in Israel, Europe, South Africa and USA also led to more homogenous population similar to the vaccine strains due to continuous infusion of the vaccine type genes into the gene pool. We conclude that restriction of specific strains to certain geographical areas could generate uniquely imprinted genotypes which would not only indicate origin but also predict movement of viral strains to new areas.

VVO-10 Viral Diseases of Zoonotic Importance: Indian Context K. Prabhudas PD-ADMAS, IVRI, Campus, Hebbal, Bangalore 24

Zoonoses are generally defined as animal diseases that are transmissible to humans. They continue to represent an important health hazard in most parts of the world, where they cause considerable expenditure and losses for the health and agricultural sectors. The emergence of these zoonotic diseases are very distinct, hence their prevention and control will require unique strategies, apart from traditional approaches. Such strategies require rebuilding a cadre of trained professionals of several medical and biologic sciences. The article discusses virus infections that have significant zoonotic implications for India. Buffalopox is a contagious viral disease affecting milch buffaloes and rarely, cows, with a morbidity rate up to 80% in the affected herd. Although the disease is not responsible for high mortality, it adversely affects the productivity of the animals, resulting in large economic losses. Furthermore, the disease has zoonotic implications, as outbreaks are frequently associated with human infections, particularly in the milkers. The causative agent, buffalopox virus (BPXV), is closely related to vaccinia virus. The outbreaks of febrile rash illness among humans and buffaloes were investigated in the villages of districts Solapur and Kolhapur of Western Maharashtra. Clinico-epidemiological investigations of humans and buffaloes were carried out and representative clinical samples were collected respectively. The samples include vesicular fluid, scab, and blood. Laboratory investigations for Buffalo-Pox virus (BPXV) was done by PCR on blood samples, scabs and vesicular fluid. In vitro virus isolation attempts were carried out by using Vero E-6 cells. Negative staining electron microscopy was also employed for detection of virus particles. A total of 166 human cases with pox lesions on hand and other body parts from village Kasegaon, District-Solapur and 185 cases from 20 different villages of Kolhapur district were reported. Besides pox lesions patients were having fever, malaise, pain at site of lesion and axillary and inguinal lymphadenopathy. In Kasegaon village, attack rate in human cases was 6.6% and in buffaloes 41.9% (231/551). Whereas in Kolhapur area attack rate in buffaloes was 11.75% (2633/22398). BPXV was confirmed in blood, vesicular fluid and scab specimens from human cases and scab specimen from buffalo by polymerase chain reaction (PCR) method. The BPXV was also isolated from 3 different clinical specimens and further identified by PCR and electron microscopy. Clinical manifestation of the disease in buffaloes from Solapur district was as reported earlier like common pox lesions on teats and udders whereas the buffaloes from Kolhapur district had lesions on hairless parts of ears and on the eyelids with purulent discharge. BPXV from human and buffalo cases showed similarity. Vaccines have been made against several diseases and used for controlling the afflictions. However a few of them were not effective for successfully controlling the disease. The reasons for the failure are many, the major being, either the pathogen is not completely cleared from the vaccinated animal or it reemerges after changing its antigenic structure, thus making the vaccination programme less effective. In addition to this, emergences of newer diseases such as HIV the development of suitable vaccines have become a challenging task. This is especially true in the case of viral diseases. These challenges have warned the researchers ''that protection by vaccination is not that simple and strait forward approach'', and lot need to be understood in terms of host virus interaction and role of environment in perpetuating the disease. So the immediate step that was considered was the environmental safety by way using non infectious materials as vaccines. With the understanding that has been developed in molecular immunology and molecular biology and with the availability of molecular tools that have been developed through recombinant DNA technology the field of vaccinology has changed dramatically to emerge as modern vaccinology. This presentation deals with the modern approaches that are being used to produce effective vaccines in the case of foot and mouth disease of cloven footed animals. The similar approach may be worked out for other viral diseases also. Despite the availability of an inactivated vaccine that is noted to provide solid immunity against the disease over a short period of time, the search for an ideal vaccine, the criteria for which are; safety of the vaccine for environment, easy in its preparation, does not require a cold chain for its storage, provides longer lasting immunity, economically viable and may be able to clear the virus in case of persistent infection is on. The advent of recombinant DNA technology together with the information available on the molecular biology of viruses has enabled to design the development of newer vaccines that can induce strong cellular and humoral responses. The underlying principal in the present vaccine development strategy world over is the virus antigen gene has to be expressed in the tissue and the vaccine backbone has to trigger the immune system for eliciting desired immune response. Bangalore Campus of IVRI has been vigorously pursuing research to develop ideal vaccines for foot and mouth disease keeping above principal in mind to achieve the previously mentioned criteria. The approaches selected are to see that the virus antigen/s replicate transiently in the host. The self replicating vaccines that have been developed are pox virus vectored vaccines, alpha virus replicase based vaccines and FMDV vectored vaccines. The approach and the result obtained so far will be discussed. Silkworm, Bombyx mori is affected with various diseases caused by viruses viz., nuclearpolyhedrosis (BmNPV), densosnucleosis (BmDNV) and infectious flacherie (BmIFV). Silkworm viral diseases form major constraints for the silk cocoon production in all the sericultural countries. The losses due to silkworm diseases is estimated about 20-40% and among them viral diseases are most common. In sericulture, prophylactic measures play a vital role in the management of silkworm diseases. These include disinfection of silkworm rearing house and appliances, rearing area, rearing surroundings, silkworm egg and body, and rearing bed disinfection associated with maintenance of general hygiene and personnel hygiene. All these activities are generally carried out as rituals by using general disinfectants often with partial success. Recent trends in complete management of silkworm diseases include development of silkworm hybrids evolved from disease resistant/tolerant breeds, effective eco-and user-friendly disinfectants, anti-microbial feed-supplements and use of transgenic silkworms. Biotechnological breakthrough in this regard is through RNA interference (RNAi) approach involving dsRNA mediated nuclear polyhedrosis management and this is presently pursued by APSSRDI, HIndupur in collaboration with Centre for DNA Fingerprinting and Diagnostics (CDFD), Hyderabad. Nadu and Karnataka. The disease appears to be more severe in rural flocks than organized farms. Our investigations revealed the Morbidity, mortality and case fatality rates among rural and organised farms as 9.34%, 2.69%, 28.84% and 6.22%, 0.47%, 7.63% respectively. Higher morbidity and mortality in rural areas may be due to stress factors like poor nutrition, parasitic burden, fatigue due to long walks and non availability of veterinary aid. Kulkarni et al. 1992 also reported the severe BT outbreaks in rural areas of Maharashtra with overall morbidity, mortality and case fatality of 32%, 8% and 25% respectively. All the south Indian sheep breeds were found to be susceptible and clinical farm of the disease is evident in all of them though Saravanabava (1992) reported variations in susceptibility among the indigenous sheep. Trichy black and Ramnad white sheep were found to be more susceptible than the Vambur and Mecheri sheep of Tamil Nadu. Prevalence of bluetongue in sheep, goat and cattle appears to be high in the region. Serological surveys conducted in Andhra pradesh during 1991 revealed the prevalence of BTV antibodies in sheep (47.5%) goats (43.56%) cattle (33%) and buffaloe (20%). Similar high prevalence of BTV antibodies in sheep and goats were also reported from the other states in the region. Clinical disease has not been recorded in kerala though BTV antibodies were recorded in sheep (13.76%) and goats (7.10%) (Ravi Sankar 2003) . Culicoides are the known biological vectors of BTV. All the culicoides species are not capable of transmitting the BTV. The occurrence of the disease is related to the presence of the competent vectors in the area. Jain et al. (1988) established the involvement of the culicoides in transmitting the BTV by isolating the virus from culicoides at Haryana, the North Indian state. C. imicola and C. oxystoma were found to be prevalent in Andhra Pradesh and Tamil Nadu. Narladakar et al.(1993) reported the presence of C. schultzei, C. perigrinus and C. octoni in Marathwada region of Maharastra. Culicoid vectors are significantly affected by the climate and annual variations in the climate reflects the outcome of the disease. The monsoon season (June to Dec) with the temperature ranging from 21.2 to 35.6°C appears to be favourable period for the multiplication of culicoides. The maximum No of outbreaks were recorded during the North East monsoon period (Oct-Dec) followed by South West monsoon period (June to Sep) in the region. However, details on the distribution of the competent vectors, feeding habits and their dynamics in the region is lacking Multiple BTV serotypes were found to be circulating in the region. (Kulkarni and Kulkarni 1984; Janakiraman etal. 1991; Mehrotra et al. 1996) A total of 10 serotypes viz. 1-4, 8, 9, 15, 16, 18 and 23 were identified based on the virus isolations. Sreenivasulu et al. 1999 isolated BTV serotype 2 from an outbreak of BT in native sheep of Andhra Pradesh. BTV serotype 9, 15 and 21 were also isolated from the outbreaks occurred in Andhra Pradesh. Some of the isolates need to be serotyped. Deshmukh and Gujar (1999) isolated BTV type 1 from Maharashtra. Following is the summary of the distribution of BTV serotypes in this region. Clinical picture of BT in native sheep appears to be slightly different, the major difference being that swelling of lips and face was less conspicuous. Mucocutaneous borders appeared to be very sensitive to touch and bleed easily upon handling. The classical signs of cyanosis of tongue and reddening of coronary band are not the common features of the disease in native sheep. The disease was also confirmed by the virus isolation and identification. Clinical disease has not been reported in cattle, buffaloes and goats in spite of high seroprevalence. In conclusion BT is established in native sheep and causes severe economic losses to the farmers. The disease is concentrated in the southern peninsula of the country. The disease is seasonal and is associated with the rain fall.

Multiple serotypes appear to be circulating in this region. The BTV serotypes were of virulent in nature as evident by severe outbreaks.

S. Janardana Reddy*, D. C. Reddy Department of Fishery Science and Aquaculture, Sri Venkateswara University, Tirupati 517 502

In less than Three decades, the Penaeid shrimp culture industries of the world developed from their experimental beginnings into major industries providing hundreds of thousands of jobs, billions of U.S. dollars in revenue, and augmentation of the world's food supply with a high value crop. Concomitant with the growth of the shrimp culture industry has been the recognition of the ever increasing importance of disease, especially those caused by infectious agents. In India viral diseases have become an important limiting factor for growth of shrimp aquaculture industry. Although more than 30 different viral pathogens have been identified in different species of shrimp world wide, only a few viruses have identified which are causing disease problems in cultured Tiger shrimps in India, East Coast of Andhra Pradesh, in particular. Diagnostic methods for these pathogens include the traditional methods of morphological pathology (direct light microscopy, histopathology, and Transmission Electron Microscopy), enhancement and bioassay methods, traditional microbiology, and the application of serological methods. While tissue culture is considered to be a standard tool in medical and veterinary diagnostic labs, it has never been developed as a useable, routine diagnostic tool for shrimp pathogens. The need for rapid, sensitive diagnostic methods led to the application of modern biotechnology to Penaeid shrimp disease. The industry now has modern diagnostic genomic probes with nonradioactive labels for viral pathogens like Infectious hypodermal and hematopoietic Necrosis (IHHNV), Hepatopancreatic Virus (HPV), Taura Syndrome Virus (TSV), White Spot Syndrome Virus (WSSV), Monodon Baculo Virus (MBV), and BP. Highly sensitive detection methods for some pathogens that employ DNA amplification methods based on the polymerase chain reaction (PCR) now exist, and more PCR methods are being developed for additional agents. These advanced molecular methods promise to provide badly needed diagnostic and research tools to an industry reeling from catastrophic epizootics and which must become poised to go on with the next phase of its development as an industry that must be better able to understand and manage disease. Within this field, shrimp immunology is a key element in establishing strategies for the control of diseases in shrimp aquaculture. Research needs to be directed towards the development of assays to evaluate and monitor the immune state of shrimp. The establishment of regular immune checkups will permit the detection of shrimp immunodeficiencies but also to help monitor and improve environment quality. For this, immune effectors must be first identified and characterised. In the end, however, the assumption may be made that the sustainability of aquaculture will depend on the selection of disease-resistant shrimp, i.e. to develop research in immunology and genetics at the same time. The development of strategies for prophylaxis and control of shrimp diseases could be aided by the establishment of a collaborative network to contribute to progress in basic knowledge of penaeid immunity. However, to improve efficiency, it appears essential also to open this network to complementary research areas related to shrimp pathology, physiology, genetics and environment. Bluetongue is an important viral disease of sheep causing severe economic losses to the farmers. Lack of effective vaccine is the major impediments in controlling the disease. Multiple serotypes were found to be circulating in the state. Attempts are being made to develop the vaccine employing the available serotypes to control the disease. Hence, it is essential to identify the antigenic relationship among the serotypes to identify the candidate vaccine strains to be incorporated in the preparation of vaccine. Reciprocal cross neutralization test was employed to find out the R% values between BTV-2, -9 and -15 which indicated the extent of antigenic relationship between the serotypes. R% value between BTV-2 and BTV-9 was recorded as 2.8 R% value of 3.53 and 2.8 were observed between BTV-2 and -15 and BTV-9 and -15 respectively. The R% values recorded in the present study revealed a weak antigenic relationship between the BTV serotypes. The extent of antigenic relationship between the BTV serotypes was also determined by multiple sequence alignment of the nucleotide and amino acid sequences of the reference BTV serotypes 2, 9 and 15. The sequence analysis of the VP2 gene revealed a homology of 47-53% and 29-41% at the nucleotide and amino acid levels respectively. R% values obtained using reciprocal cross neutralization test with the BTV-2, 9 and 15 serotypes isolated in native sheep of Andhra Pradesh and the genomic analysis of the reference serotypes of BTV-2, 9 and 15 revealed very weak antigenic relationship and were highly divergent. Diseases especially those by viral pathogens cause greater economic losses in most horticultural crop species throughout the world as compared to agricultural crops. Non-genetic methods of management of these diseases include quarantine measures, eradication of infected plants and weed hosts, crop rotation, use of certified virus-free seed or planting stock and use of pesticides to control insect vector populations implicated in transmission of viruses. However, none of these measures is likely to provide an enduring solution against these diseases especially those caused by viruses due sometimes to the huge expenditure involved, but mostly to the questionable effectiveness and reliability of those methods. As key control pesticides are getting increasingly abandoned, development of alternative methods to control diseases has been a felt-need in the recent past. Though breeding for disease resistance generally provides a reliable security in a long run, introgression of host plant resistance did not materialise in most important crops. Non-availability of an appropriate source of resistance in inter-fertile relatives, linkage to undesirable traits, or often times polygenic nature of such sources of resistance are the stumbling blocks in breeding programs. The limitations of conventional breeding and routine cultural practices prompted the need for the development of other approaches of virus control that could be fully incorporated into traditional methods. In this perspective, the concept of pathogen-derived resistance offers an attractive strategy to evolve newer methods of virus management, by transforming crop plants with nucleotide sequences derived from the pathogen's genome. An increasing number of molecular characterisation of plant virus genomes and the stable transformation of a number of horticultural crop species have in fact opened an avenue for molecular breeding against virus pathogens. Successful field-testing of genetically modified crop cultivars renders proof of their supremacy over existing cultivars. It also contributes to demonstrate their capability with regard to environmental safety with a view to winning over public concern and scepticism. In general, the eventual commercialisation transgenic lines expressing virus resistance will rely upon a host of factors including their field performance, genetic stability, public acceptance and the resolution of environmental concerns and patent related issues. As such, elaborate field trials and allied studies are now required to adapt genetically engineered horticultural crops expressing virus resistance for their implementation into practical agriculture.

A few examples from current research at TNAU, in India or elsewhere will be discussed in this presentation.

Virology Unit, Division of Plant Pathology, IARI, New Delhi 12

In recent times there has been greater emphasis on vegetatively propagated crops in India to help diversify the Indian agriculture. Fruit, flower, spice and plantation crops are important vegetatively propagated horticultural crops, which have become a driving force for economic development in several parts of India. However, most of the vegetatively propagated crops are threatened by biotic stress caused by plant pathogens in general and plant viruses in particular. Plant viruses produce specific and non specific symptoms and in some cases no symptoms are produced. Correct identification and diagnosis of viral diseases is first step in the management of any disease including viral diseases. There have been two major breakthroughs in virus diagnostics during last four decades. The first one was serological assay using monoclonal or polyclonal antibodies in enzyme linked immunosorbent assay (ELISA) and the other one was the use of in vitro amplification of DNA in polymerase chain reaction (PCR). A significant development in serological assays has been its simplification in form of user's friendly quick strip/dip stick method. The one-step lateral-flow (LF) tests have been developed for the on-site detection and identification of several plant viruses. Rapid advancement in virus genome characterization has led to the development of novel approaches of nucleic acid based diagnostics which include conventional PCR, real time PCR, multiplex PCR, micro/macro arrays and biochips. PCR protocols already exist for many plant viruses of citrus, banana, apple, papaya, vegetables, ornamental and spice crops. A further advancement has led to development of realtime PCR assay which is relatively easy but requires training for diagnosticians. In real-time PCR assays, results can be available within 20 min. The nucleic acid template preparation in PCR has been simplified. Membrane based DNA template protocol and co-isolation of nucleic acid template preparation are novel approaches in PCR detection of virus and virus like pathogens. Since many of the horticultural crops are often infected by more than one virus, their individual detection by PCR is not only expensive but also time consuming. Therefore, multiplex PCR has been developed where in genome of more than one virus could be amplified and detected in the same reaction mixture. Development of nucleic acid based chip is now one of the fastest and recent growing areas in the field of pathogen detection. These nucleic acid based chips have been named as DNA/RNA chips, Biochips, Genechips, Biosensors or DNA arrays.

When it comes to applications of microarray technology for plant viruses, it is not too difficult to see the value of a method that could potentially detect a whole range of viruses using a single test. However, microarrays are unlikely to become the only method in use in a diagnostic laboratory. processing of germplasm including transgenic planting material imported for research purposes into the country. During the last two decades, a total of 49,923 samples of wheat including transgenics were imported from CIMMYT (Mexico), ICARDA (Syria) and many other countries. These were grown in post-entry quarantine nursery each year at NBPGR, New Delhi and the transgenic samples were grown in National Containment Facility of level-4 (CL-4) since its inception to ensure that no viable biological material/pollen/pathogen enters or leaves the facility during quarantine processing of transgenics. In addition, post-entry quarantine inspections of the transgenic wheat grown by indenters are also undertaken by NBPGR quarantine scientists. Virus-Induced Gene Silencing (VIGS) is a technique in which viral genomes are used, usually after appropriate modifications, for transient gene silencing in plants. The mechanism behind VIGS is the phenomenon called RNA-interference (RNAi), which is widespread in many organisms and is believed to be form of inherent defence system against intracellular pathogens, such as viruses and transposons. Double-stranded RNA or RNA containing strong secondary structures, commonly produced during viral infections, are believed to cause triggering of RNAi, which employs a battery of proteins and nucleoprotein complexes to identify and degrade specific viral transcripts. In VIGS, viral genomes not causing severe symptoms, but which can accumulate and spread efficiently in the host plant are used as vectors in which a host gene is cloned and introduced into the plant. Upon replication, the viral vector triggers RNAi response in the host plant, which also targets the host gene, leading to its silencing and subsequently, the silenced phenotype revealing gene function in vivo. VIGS has been used extensively to study gene functions in dicot plants, such as tobacco, tomato, pea, soybean, etc., using vectors derived from Reference genes are commonly used as an/the endogenous normalisation measure for the relative quantification of target genes. The expression (characteristics) of seven potential reference genes was evaluated in tissues of 180 healthy, physiologically stressed and Barley yellow dwarf virus (BYDV) infected cereal plants. These genes were tested by RT-qPCR and ranked according to the stability of their expression (characteristics) using three different methods (Two-way ANOVA, GeNorm and NormFinder tools). In most cases, the expression (characteristics) of all genes did not depend on the abiotic stress conditions or on the virus infections. All the genes showed significant differences in expression (characteristics) among plant species. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Beta-tubulin (TUBB) and 18S ribosomal RNA (18S rRNA) always ranked as the three most stable genes. On the other hand, Elongation factor-1 alpha (EF1A), Eukaryotic initiation factor 4a (EIF4A), and 28S ribosomal RNA (28S rRNA) for barley and oat samples; and Beta-tubulin (TUBB) for wheat samples were consistently ranked as the less reliable controls. The BYDV titre was determined in two oat varieties by RT-qPCR by three different quantification approaches. Statistically, there were no significant differences between the absolute and the relative quantification, or between quantification using GAPDH + TUBB + TUBA +18S rRNA and EF1A + EIF4A + 28S rRNA. The geometric average of GAPDH, 18S rRNA, TUBA and TUBB is suitable for normalisation of BYDV quantification in barley and oat tissues. For wheat samples, a combination of GAPDH, 18S rRNA, TUBB, EIF4A and E1FA is recommended.

Department of Microbiology, Yogi Vemana University, Vemanapuram, Kadapa 516 003

Large scale production and import of propagative material poses potential risk of introducing several destructive pathogens particularly viruses and Mycoplasma like organisms in our country. This demands adequate quarantine safe guards such as growing them under approved post entry quarantine facility for specific period so as to facilitate virus detection, thereby curtailing risk. When such facilities are coupled with propagation by tissue culture will ensure virus free propagative plant material. The requirement of nationwide network of post entry quarantine facility working in close collaboration with crop institutions are very much emphasized for considering import of high risk plant genera for agriculture development. Present paper discusses about virus disease of quarantine importance affecting ornamental and fruit plants such as Chrysanthimum, Dahlia, Dianthus, Rosabengalensis, Cattleya, Cymbidium, Dendrobium, Lilium, Citrus, Vitis etc. The paper also discusses on immunodiagnostic methods of detection and methods of obtaining virus free propagative material. Rice tungro occurs as epidemics in regular cycles and has been reported in the last 50 years from all the major rice growing regions of India, especially prevalent in the southern and eastern states. Development of the durable resistant varieties to tungro is crucial for the management of the disease. Molecular breeding, involving the use of DNA markers linked to the resistant gene(s) for selection, can overcome the difficulties encountered in conventional resistant breeding programs. For successful marker-assisted selection (MAS), the identification of closely linked markers through the process of gene tagging and mapping is a prerequisite. Attempts have been initiated for identification of tungro resistance genes through molecular mapping and their introgression into the target varieties using marker-assisted selection at DRR, Hyderabad. The inheritance of resistance to rice tungro virus disease was studied in seven resistant rice cultivars with field evaluation at hot spot locations. The microsatellite markers linked to rice tungro resistance in Utri Merah was studied and found that resistance genes were linked to RM 336 on chromosome 7. Through molecular mapping two QTL were identified controlling RTV resistance on chromosomes 7 and 2 in 'Utri Rajapan' explaining 40.8% and 21.6% of the phenotypic variance. In variety 'Vikramarya', another two QTL for RTV resistance were detected on chromosomes 7 and 1 explaining 18.7% and 16.4% of the phenotypic variance. The closely linked markers identified in this study flanking the gene of interest through mapping will improve the efficiency and precision of introgression programs in marker assisted breeding for RTV resistance. Functional characterization of these QTL for RTV resistance is under progress. There is only a limited pool of natural virus resistance in Cassava against cassava mosaic geminiviruses and cassava brown streak Ipomovirus hence the development of transgenic resistance in this significant crop might present an option. RNA mediated resistance through the expression of inverted-repeat dsRNA sequences derived from the virus genome and the modification of plant microRNA to produce antiviral artificial microRNA are strategies that have recently been proven very effective for induction of virus resistance (immunity) against a number of RNA viruses. Results from RNA interference strategies against geminiviruses never resulted in immunity of transgenes. However, it suggest that viral mRNA are targets of RNA silencing and that the success of the strategy depends on the relevance of the target gene in the systemic spread of the virus. We have generated a number of RNA silencing constructs to induce resistance against CBSV and the Indian cassava mosaic viruses ICMV and SLCMV. Due to the serious problems inherent with transformation of cassava and subsequent resistance screening, these constructs were tested for efficiency either by transient-or by transgenic expression in N. benthamiana. Complete immunity was reached in transgenic N. benthamiana against CBSV using inverted repeat or amiRNA constructs. Using different species of CBSV for resistance screening, immunity was broken, to show the minimum context for broad spectrum resistance. Similarly, highly specific resistance was reached in expression of amiRNA. In contrast, virus resistance against ICMV/ SLCMV using single amiRNA constructs was not successful. Results from the experiments to generate virus resistance against CBSV and ICMV/SLCMV will be shown; methods to evaluate efficiency of RNAi gene constructs by transient gene expression in N. benthamiana and strategies to develop efficient resistance against RNA and DNA viruses in cassava will be discussed. Bitter gourd (Momordica charantia L.) which is also called bitter melon, balsam apple and balsam pear belongs to family cucurbitaceae. It is an important traditional vegetable of nutritive and medicinal value that is cultivated in tropical and sub-tropical Asia, but is considered as a weed host reservoir for viruses in Jamaica. Viral disease-like symptoms were observed occurring naturally on the crops of bitter gourd grown in the fields of Northern India during 2007-2009. An incidence of 78.5% of diseased plants was recorded which showed chlorotic spots and mosaic ranging from mild mottling to green blisters along with leaf smalling, leaf and fruit deformations, bud necrosis and stunted growth whereas 20.2% plants exhibited leaf curling alone or in combination with mosaic-type disease. A reduction of 34.5% in fruit yield was recorded in mosaic-like disease which could be attributed to lesser fruit setting due to bud necrosis, smaller fruit size and stunted plant growth. Such plants produced deformed, notched, irregularly shaped fruits wherein pre-mature yellowing and necrosis on the anterior and posteriors ends made 22.4% fruits unfit for marketability. The dwindling yield and production of unmarketable fruits posed a major constraint for profitable cultivation of this economically important crop, thus warranting for studies on etiology and management of these diseases. The mosaic-like disease was transmitted to healthy seedlings of bitter gourd at 2-leaves stage by sap inoculation as well as by aphid viz., Myzus persicae Sulz. and Aphis gossypii Glov. initially studies were carried out to optimize protocols for efficient plant regeneration and Agrobacterium-mediated transformation for Nagpur sweet orange, which is a popular and elite citrus cultivar in India. Organogenesis was induced in etiolated epicotyl explants of one-month-old axenically raised polyembryonic seedlings by culturing them in MT medium supplemented with 30 g/l sucrose with varying concentrations of plant hormones. It was found that BAP at 1 mg/l without auxin was best for efficient shoot regeneration in Citrus using epicotyl explants. A 100% regeneration frequency was obtained and multiple shoot formation was obtained from both the cut ends of all the explants. An average of 8.24 well-differentiated shoots per explant were obtained, all of which rooted normally under the influence of 1 mg/l IBA. This improved regeneration protocol was utilized in standardizing Agrobacterium-mediated transformation of citrus using A. tumefaciens strain EHA 105, containing binary plasmid pCAMBIA 2301 that harbors GUS reporter gene and NPT-II plant selection marker gene. One-month-old epicotyl explants infected with over-night grown Agrobacterium (A 600 0.6-0.8) for 15 min and co-cultured for 3 days were found to be optimum for transformation as assessed on the basis of PCR analysis and GUS activity displayed by the stem and leaf sections of putative transgenics. Overall transformation frequency ranged from 38 to 48%. Current study focuses on the generation of citrus transgenics for CTV resistance using A. tumefaciens strain EHA 105 containing binary plasmid pBinAR harboring portion of coat protein gene of CTV and NPT-II gene employing the standardized protocols. Several putative transgenic shoots were recovered on selection medium and they are being utilized for molecular analyses and resistance against CTV. Work is also in progress on the generation of Citrus transformants using RNAi construct harboring CTV CP and p23 genes, singly and in conjunction. Our lab was also involved in developing rice transgenics for resistance against Rice tungro disease, which is one of the most important and widespread virus diseases of rice in South and Southeast Asia, causing an annual estimated loss in crop yield of Economic losses worth millions of rupees are caused due to these diseases annually. Virus diseases are frequently less conspicuous than those caused by other plant pathogens and last for much longer. This is especially true for perennial crops and those that are vegetatively propagated. One further problem with attending to assess losses due to various diseases on a global basis is that what most of the data are from small comparative trials rather than wide scale comprehensive surveys, even the small trials do not necessarily give data that can be used for more global estimates of losses. This is for several reasons, including:

(1) variation in losses by a particular crop from year to year; (2) variation from region to region and climatic zone to climatic zone: (3) differences in loss assessment methodologies; (4) identification of the viral etiology of the disease; 5 variation in the definition of the term 'losses' and (6) Chilli is the major vegetable and spice crop grown in Thar Desert areas of Rajasthan. Leaf curl disease (ChLCD) is one of the major constrains in chilli cultivation faced by farmers and cause yield loss up to 100%. A survey was conducted in major chilli growing areas of Thar Desert; Bikaner, Nagur, Jodhpur and Jalore districts of Rajasthan during November, 2009 to understand the present status of leaf curl disease in Chilli. Among the four district surveyed for ChLCD, the disease incidence was recorded maximum (up to 98%) in Jodhpur district followed by Jolore district (up to 88%). No relation was found between the disease incidence and varieties. The major varieties grown in these area are; Mehsana, RCH (Mandoria), Haripur Raipur, Mathania and local cultivars. The number of whitefly was also counted in top, middle and bottom leaf of chilli grown in these areas. The average number of whitefly per plant ranged from 0.0 to 4.0. More number of whitefly (4.0) was recorded in Jodhpur district and lowest (1.8) in Jalore district. Total DNA was extracted from three leaf curl infected samples from each district and tested for the presence of begomovirus using coat protein (CP) and DNA-b specific primers. All the samples were positive for CP and DNA-b amplifications by PCR. The cloning and sequencing of selected CP gene and DNA-b fragments are in progress. The preliminary investigations shows that the leaf curl disease of chilli is widespread in the arid region of Rajasthan and may be caused by begomovirus associated with satellite DNA-b. Bittergourd (Momordica charantia) is an important vegetable crop of Kerala. The crop is affected by several diseases of which Mosaic is a prominent one. A field experiment was conducted to evaluate the efficacy of potentised resistance inducing substances (RIS) viz., mosaic affected bittergourd plant tissue, ash of mosaic affected bittergourd plant tissue, plumbago and salicylic acid for control of bittergourd mosaic in March 2008. RIS were applied as drench and foliar spray at three potency levels twice, before flowering of the crop. The experimental crop was grown as per the package of practice recommendations in split plot design with five replications per treatment. The disease incidence, disease severity and yield of the crop were recorded. The result of the experiment shows that spraying was more effective than drenching of treatments for reducing mosaic incidence and severity. Among treatments, infected plant extract at 19 potency was the most effective one for reducing mosaic incidence and it showed the maximum incubation period and minimum disease severity. The spray application of treatments produced significantly higher yield than drenching. Among the treatments, ash of infected plant at 19 and 309 potency and infected plant extract at 69 potency were on par and produced comparatively higher yield. Elephant foot yam (Amoprhophallus paeoniifolius), colocasia (Colocasia esculenta) and tannia (Xanthosoma sagittifolium) are the major edible aroids cultivated in India. The elephant foot yam cultivation is gaining importance due to its high production potential, nutritional and medicinal values and good economic returns. All these aroids are vegetatively propagated and viral diseases are spreading through planting materials. CTCRI has the mandate of producing healthy planting materials of these edible aroids. Accurate diagnosis and identification of the virus is essential for production of healthy planting material and effective management of the disease. Though occurrences of viral diseases on edible aroids in India were known in 1960s, not much attention was given for detection and identification of the virus involved. In case of elephant foot yam 5-30% mosaic incidence was observed with varying symptoms of mosaic, puckering, filiformy etc. In colocasia and tannia, 5-10% incidence was noticed. RT-PCR amplification with potyvirus group specific primers and subsequent cloning and sequencing of the amplified product has confirmed the association of Dasheen mosaic virus (DsMV) with all the three edible aroids cultivated in India. The complete full length coat protein gene of DsMV infecting elephant foot yam was cloned in pGEM-T vector and sequenced. Further sequence analysis revealed that the CP of DsMV consisted of 942 nucleotides and the 3 0 UTR comprised of 260 nucleotides. BLAST and phylogenetic analysis showed highest similarity of 89% with that of DsMV isolate AF048981, reported from USA. The deduced amino acid sequence of CP had 92.0-98.0% identity with other DsMV isolates. BLAST analysis of the partial CP gene sequences of colocasia and tannia also confirmed that the virus involved is DsMV. RT-PCR analysis of large number of samples from all the three crops confirmed that the potyvirus group specific primers (MJ1 and MJ2) are good for rapid detection of DsMV in these crops. DsMV specific biotinylated cDNA and digoxigenin labelled cRNA probes were also prepared and DsMV in elephant foot yam was detected through nucleic acid spot hybridization. Yellow leaf disease (YLD) caused by Sugarcane yellow leaf virus (SCYLV) is a recently recorded disease in India and is found wide spread throughout country. In popular varieties, the disease incidence varied from 0 to 75.0% and attained epidemic levels under field conditions. Detailed studies on the impact of YLD on sugarcane revealed that the virus infection significantly reduces various cane growth parameters, cane yield and juice quality. Sequence comparisons of the coat protein (CP) and movement protein (MP) of 22 SCYLV isolates from India and database sequences showed a significant variation between Indian isolates and the database sequences both at nt and aa level in the CP/MP coding regions. The significant variation in our isolates with the database isolates, even in the least variable region of the SCYLV genome showed that the population existing in India is different from rest of the world. Further, comparison of partial sequences encoding for ORF 1 and 2 revealed that YLD in sugarcane in India is caused at least by three genotypes viz., CUB, IND and BRA-PER, of which a majority of the samples were found infected with Cuban genotype (CUB). The genotype IND was identified as a new genotype and this was found to have significant variation with the reported genotypes. We have identified specific primers from CP region of the virus and optimized RT-PCR conditions to diagnose the virus. This assay has been found efficient in detecting the virus in asymptomatic plants and tissue culture derived seedlings. Elimination of the virus through meristem culture has been demonstrated to purify the virus from the infected planting materials and this technique needs to be adopted to supply disease-free planting materials for effective management of the disease. Studies are also in progress to identify the YLD-resistant sources in sugarcane germplasm to initiate breeding for YLD-resistance in sugarcane. Mycoviruses are viruses that infect fungi. They have been identified in all major fungal families. In the present scenario, mycoviruses are the important means of biocontrol of plant fungal pathogens. Most identified fungal viruses have double stranded RNA genomes, often with more than one dsRNA present per virus particle, and have been spherical in shape. These viruses are mostly vesicle bound, as other viruses have protein coatings. To be a true mycovirus, they must demonstrate an ability to be transmitted-in other words be able to infect other healthy fungi through anastomosis and spores. Mycoviruses lead 'secret lives', reduce the ability of their fungal hosts to cause disease in plants. This property, known as hypovirulence (Hypovirulence is a term used to describe reduced virulence found in strains of pathogens), this phenomenon was first observed in Cryphonectria (Endothia) parasitica (chestnut blight fungus) on European Castanea sativa in Italy, where naturally occuring hypovirulent strains were able to reduce the effect of virulent ones. These slower growing hypovirulent strains of C. parasitica contain a single cytoplasmic element of double-stranded RNA (ds RNA) similar to that found in mycoviruses that was transmitted by anastomosis in compatible strains through natural virulent populations of C. parasitica. Hypovirulence has also been reported in many other fungal plant pathogens, including Rhizoctonia solani, Gaeumannomyces gramini var. tritici, Ophiostoma ulmi, Sclerotinia homoeocarpa, Diaporthe ambigua Alternaria alternata, and Fusarium sp. etc. Hypovirulence has attracted attention owing to the importance of fungal diseases in agriculture and the limited strategies that are available for the control of these diseases. It reduces the use of toxic fungicides which also affect the plant growth. The symptoms resulted by the mycoviruses are reduction in growth, reduction in pigmentation and sporulation, excessive sectoring and aerial mycelial collapse. These are the consequences of alteration in complex physiological and biochemical processes involving interaction between host and virus. Cassava (Manihot esculenta Crantz.) is the major tuber crop in Peninsular India, it is grown in an area of 2.4 lakh hectares with the annual production of 6.7 million tonnes both for direct consumption and the starch grain (sago) producing industries, mainly in the southern states of Tamil Nadu, Kerala and Andhra Pradesh (FAO 2005) . In Tamil Nadu, cassava primarily produced for sago producing industries where it is considered as an industrial crop rather than food crop, so the resource rich farmers are cultivating the cassava as irrigated crop in their fertile land and the poor farmers are raising the crop under rainfed conditions. In south India in addition to cassava there is a practice of intercropping important vegetable crops like, tomato, brinjal, legumes and gourds in Cassava fields since all the above mentioned crops are short duration and are money spinners for the farmers. Unfortunately, the major production constraint in these vegetable crops including Cassava is the Geminiviruses belonging to the family of In recent years there has been growing concern regarding the standard of scientific researches in India. The strengths, weaknesses, opportunities and Threats (SWOT) analysis on Indian scientific research reviewed the progress of science during the last six decades. Although the 'strengths' were highlighted in good measure, it was the list of 'weaknesses' that called for attention to upgrade the standard of research and 'opportunities' that provide scope for overall scientific growth. A comparison between India and other countries in terms of research papers published revealed that India's contribution to science has come down enormously. What ails Indian Science? Should we compare the growth of Indian science with other developed countries? What criteria should be adopted to judge the quality and standard of scientific research? How to motivate the scientists to improve their scientific output? How do motivate the scientists to improve their scientific output? How do Indian journals perform in Maintaining quality? This paper analyses critically the scientific journals around the world, based on the scores allotted by the National Academy of Agriculture sciences (NAAS) in 2003 and 2007 for 1460 and 1608 journals respectively. In general, the Indian journals performed poorly irrespective of the disciplines with only 25-30% in the high standard. The paper dealt with the reasons for low impact factor, the anomalies in the allotment of scores to wide spectrum of the journals and the disadvantages the scientists face with the scoring system. A case study was presented of an Institute with over 50 scientists whose publications were analyzed to discuss the merits and demerits of the system. The performance of the journals published by prestigious academics, societies and councils was also projected. The paper concluded with the need for enhancing the image of the country through research publications in high standard journals and the role of various scientific bodies with shore and long term measures.

Poster Session Herpes Simplex Virus (HSV) keratitis is a leading cause of corneal blindness throughout the world. The infection can be diagnosed by clinical manifestations but in case of atypical ocular cases, laboratory diagnosis is more helpful in timely management of disease. Collection of corneal scrapings in all cases of stromal and epithelial keratitis may not be possible, but collecting tear fluid is a convenient procedure causing less discomfort to the patients. Therefore, the present study was intended to evaluate the suitability of tear specimens for detecting HSV by polymerase chain reaction (PCR) and immunofluorescence (IFA). Tear fluid and corneal scrapings were collected from 134 patients of suspected herpetic keratitis. HSV-1 antigen was detected by IFA using rabbit anti-HSV antibodies. PCR was performed to amplify 111 bp region of thymidine kinase (tk) coding gene and 144 bp region from DNA polymerase coding gene of HSV. Out of 134 patients HSV antigen was detected in 25 (18.65%) of corneal scrapings and 15 (11.19%) of tear specimens and in 12 (8.95%) patients from both the specimens. HSV gene could be amplified in 44 (32.83%) of corneal scrapings and 16 (11.94%) of tear fluids and in 13 (9.71%) patients from both the specimens. Although, corneal scraping seemed to be marginally superior material for detection of HSV, tear fluid may also serve as an appropriate alternative clinical specimen, due to ease of collection and least discomfort to the patients. In either cases PCR detected higher number of HSV cases than IFA. Therefore if and when feasible, both IFA and PCR should be used simultaneously on each specimen to obtain best results. Cytokines play a key role in the regulation of immune responses. In hepatitis C virus infection (HCV), the production of inappropriate cytokine levels appears to contribute to viral persistence and to affect response to therapy. IL-6 is produced by a variety of cells including T cells, phagocytes and fibroblast. Cytokine genes are polymorphic at specific sites, and certain mutations located within coding/regulatory regions have been shown to affect the overall expression and secretion of cytokines in patients with HCV infection. To correlate the serum levels and polymorphism of IL-6 gene in chronic hepatitis C patients and healthy controls. Forty patients positive for HCV RNA attending the Medicine out patient department and wards of Lok Nayak Hospital, New Delhi as well as forty healthy controls were enrolled for the study. The serum level of IL-6 was detected by using ELISA. Genomic DNA was extracted from whole blood of HCV infected patients and healthy controls by using AccuPrep Genomic DNA Extraction Kit according to manufacture's instruction. The genotyping of IL-6 promoter (-174 variant) was carried out by PCR and direct sequencing using the method of Patricia Woo et al. 1998. The serum level of IL-6 was significantly down regulated in HCV infected chronic patients as compared to the healthy controls. Genotyping of -174 promoter variant of IL-6 was performed by PCR and direct sequencing. IL-6 Polymorphism in the G/G, G/C and C/C allele was non significant when compared to HCV patients and healthy controls. The IL-6 serum levels were significant among HCV infected patients when compared to healthy controls. The polymorphism in the promoter region of IL-6 (-174) was found nonsignificantly associated in HCV patients compared to healthy controls. In conclusion, the present study suggests that the host IL-6 polymorphism alone may not play a significant role in the outcome of HCV infection. Acute gastroenteritis (AGE) is a global health problem and has been associated with multiple etiological agents, which include bacteria, protozoa and viruses. Viral gastroenteritis is considered as the second most common illness in children after upper respiratory tract infection. Among enteric viruses, rota, noro, enteric adeno, astro and enterovirus are found to be associated with gastroenteritis. Although, association of enteric viruses has been established in children hospitalized for AGE no such data is available from hospitalized children other than enteric infections. To determine the prevalence of enteric viruses circulating in hospitalized children. Fecal samples, n = 292 (177 symptomatic and 115 asymptomatic for AGE) were collected from children \5 year of age from three different hospitals across the city of Pune from June 2008 to Feb. 2009. Detection of group A rotavirus was carried out by using antigen captured ELISA. RT-PCR and PCR was carried out for the detection of norovirus, enterovirus, astrovirus and enteric adenovirus detection by using primers targeted to RdRp gene, 5 0 NCR gene and consevered gene for serine protease and hexon gene respectively. Out of 177 fecal samples tested for enteric viruses in AGE cases, the prevalence of rota, entero, noro, enteric adeno and astrovirus were 33.3% (59), 14.7% (26), 6.2% (11), 2.8% (5) and 1.1% (2) respectively. However, the presence of these viruses in the asymptomatic cases (n = 115) was detected at 7.8% (9), 5.2% (6), 7.8% (9), 0.86% (1) and 1.7% (2) levels respectively. Mixed infections of enterovirus and rotavirus were found in both symptomatic 1.6% (3) and asymptomatic cases 0.8% (1). However, mixed infection of enterovirus with adenovirus were found only in asymptomatic cases 0.8% (1). No marked difference was observed in the seasonal pattern of all viruses in the patients with or without gastroenteritis. The findings of this study document highest circulation of rotaviruses in patients symptomatic and asymptomatic for AGE. The entero and noroviruses remain second most important enteric viruses in these patients. Influenza in humans is a major public health concern and the understanding of its evolution in the light of its ''antigenic drift'' helps prediction of epidemics and update of yearly influenza vaccine. To antigenically characterize influenza A (H3N2) isolates and study antigenic drift during 1990 to 2009 in Pune city. Patients with Influenza like illness were identified using a strict case definition from dispensaries located in different areas in Pune and clinical samples (NS/TS) were collected after obtaining informed consent. These clinical samples were processed in vivo (in fertile eggs) and in vitro ( Overall, an additional 35 (39.7%) positive cases of Dengue could be detected when NS1 antigen assay was also used in the study. Highest NS1 antigen positivity was encountered among the samples collected on the 3rd day of fever whereas MAC ELISA for anti IgM antibody was positive after 4th day and gradually there was an increase in the positivity towards the convalescent phase of the disease. The results of this study indicate that NS1 antigen based ELISA test can be an useful tool to detect the dengue virus infection in patients during the early acute phase of disease since appearance of IgM antibodies usually occur after fifth day of the infection. Concurrent use of both diagnostic assays namely NS1 antigen as well as MAC ELISA will improve the overall detection of dengue infection. Early detection of acute dengue virus infection is crucial to provide timely information for the management of patients. Human parvovirus B19, a member of the Parvoviridae family, is a pathogen associated with a wide variety of diseases. Most commonly, it causes childhood rash erythema infectiosum, but in some cases more serious symptoms such as persistent arthropathy, critical failures of red cell production causing transient aplastic crisis, this infection in pregnancy causes hydrops fetalis and myocarditis. Traditional immunosuppressive therapy being unsuccessful, anti-viral therapy might be worthy of consideration. Functional annotation would provide role of viral proteome in its survival and pathogenic mechanisms. SVMProt functional family annotations of VP2 protein had deciphered its zincbinding, coat protein, outer membrane, chlorophyll biosynthesis, DNA repair and calcium-binding nature. VP2 protein is having a key role in viral assembly of B19 virus and being non-homologous to human proteome, it was identified as an attractive molecular target for structure based drug discovery. The VP2 protein crystal structure was energy minimized using CHARMM. A structure based virtual screening method was applied using LigandFit to identify potential inhibitors of VP2 protein from ChemBank database and ten potential Human parvovirus B19 VP2 inhibitors were proposed. PRISM 310 genetic analyzer. The drafting of the sequences was performed using BioEdit software and were submitted in GenBank. For phylogenetic interpretation DENV representing the full extent of genetic diversity in DENV-1, DENV-2 and DENV-3 were collected from GenBank. Neighbor joining algorithm was implemented with bootstrap value of 10,000 replicates for phylogenetic inference using MEGA 4.0.2. The genomic region 134 to 644 (C-prM gene junction) of DENV were amplified directly from patient serum. Twelve of 72 samples were positive for dengue viral RNA. Of these 4 were Dengue type 1, 1 was Dengue type 2 and 7 were Dengue type 3. For molecular epidemiological survey and genotyping of the sequences more than 100 sequences from different geographical areas including sequences form previously reported north Indian isolates were compared with our present data set. The critical analysis of the sequences revealed: 4 Dengue Type 1 sequences were clustered within sub-type 2 of genotype III and all the 7 sequences of DEN-3 clustered along with genotype III. Thus, among the dengue types 1, 2 and 3 currently circulating in North India, Dengue type 3, genotype III, being the predominant one followed by, genotype III of Dengue type 1. Although there is no specific treatment or vaccine available currently, the confirmative rapid diagnosis based on detection of viral nucleic acid or IgM antibodies in serum, an indication of recent infection, helps in epidemiological monitoring, symptomatic treatment of patients and determining prognosis. Serological detection of anti-CGV IgM antibodies was performed using rapid immuno-chromatographic assay (RICA) and IgM-antibody capture enzyme linked immunosorbant assay (MAC-ELISA). Eighty convalescent sera were tested by RICA and 60 of them were found positive for anti-CGV IgM antibodies. Twenty-five anti-CGV IgM antibody RICA positive sera were further assayed using MAC-ELISA. More sera from the patients are currently being tested to compare the sensitivity of these two serological assays in anti-CGV IgM antibody based early serological diagnosis of CGV infection and the findings will be presented. Thus the present study was designed to evaluate the utility of multiplex PCR (mPCR) for simultaneous and rapid detection of dengue and chikungunya viral infections. Seventy-two acute phase blood samples from clinically suspected dengue cases were subjected for dengue and chikungunya uniplex PCR using dengue genus specific primers and E gene specific primers for chikungunya virus as well as multiplex PCR was developed for simultaneous detection of dengue and chikungunya infection. Standard strains of dengue and chikungunya virus were used as controls. 13 of the 72 clinically suspected dengue samples were found to be positive for dengue viral RNA by dengue uniplex PCR as well as dengue chikungunya mPCR whereas none of the samples were positive for chikungunya virus infection by both uniplex chikungunya PCR and dengue chikungunya mPCR. The result of dengue and chikungunya uniplex PCR was found to be 100% concordant with dengue chikungunya multiplex PCR. Dengue chikungunya multiplex PCR was found to be a potential rapid test to detect dengue and chikungunya viral infections simultaneously in clinical samples.

Sheetal Malhotra, Neelam Marwaha, Karan Saluja, Ratti Ram Sharma Department of Transfusion Medicine, PGIMER, Chandigarh 160012

Transmission through blood and blood products can be reduced to a great extent by efficient and reliable testing of the blood. The newer fourth generation ELISA assays simultaneously detect antibodies against HIV-1 and 2 and the presence of p24 antigen and thus shorten the window period to about 14 days, as compared to 22 days with third generation ELISA. To compare the HIV seroprevalance among blood donors using fourth generation ELISA (antigen-antibody) versus third generation ELISA (antibody) assay. This was a prospective study involving 5100 blood donors of which 3400 were voluntary donors (1700 being students and 1700 being non students) and 1700 were replacement donors. Sex workers are one of the core group for transmission of STI/HIV and as a ''bridge group'' to the general population. Accordingly, highest priority is given to this group in targeted intervention for prevention of HIV/AIDS. Here we are describing one such female sex worker who was harbouring 5 concomitant STI including 4 viral STI. A 25 year old female sex worker was brought to the STI clinic of a tertiary care hospital by NGO with complaint of genital discharge for 3 days. On per speculum examination, cervix was slightly erythematous, tender with mucopurulent discharge. There was no vaginal discharge or ulcer in anogenital area. However, there was a wart at lateral wall of vagina. As per NACO syndromic management guideline, treatment was given for N. gonorrhoeae, C. trachomatis and HPV. Cervical swab was taken and subjected to various microbiological investigation for the detection of STI viz N. gonorrhoeae, C. trachomatis, T. pallidum, Candida spp., T.vaginalis, HSV-1, HSV-2, HIV, HBV, HCV, HPV and M. contagiosum. Saline wet mount showed pus cells, but no yeast cells or trophozoite of Trichomonas vaginalis. Gram stained smear showed more than four polymorphonuclear leucocytes in the absence of gramnegative intracellular diplococci and a presumptive diagnosis of non gonococcal urethritis was made. No organism was isolated on any culture media after appropriate incubation. Cervical swab was negative for antigen of C. trachomatis. Serum was tested positive for HBV, HCV, HSV-2 and T. pallidum though it was seronegative for HIV. In the present case, the female sex worker was harbouring four viral STI viz HSV-2, HBV, HCV and HPV alongwith T. pallidum. However clinically she was diagnosed and treated accurately only for genital wart while cervical discharge due to HSV-2 was misdiagnosed. It is necessary to try to test alternative approaches such as periodic presumptive therapy of viral STI, because this will not only boost up the efforts of STI control in the target group but also help in HIV control. Alternatively, regular clinical and laboratory screening for viral STI may be tried. Densonucleosis viruses (DNV) belong to Parvoviridae family. They are the etiological agents of insect's disease known as densonucleosis, which leads to death or loss of vital functions of the infected insect. Densonucleosis virus of mosquitoes has generated lot of scientific interests because of its tremendous potential in biological control and its application as a transducing vector. Earlier, we have reported the isolation and characterization of a DNV from Aedes aegypti mosquitoes and its prevalence among different Ae. aegypti populations from India. There are reports suggesting that when Aedes albopictus mosquitoes co-infected with Dengue-2 and DNV, the multiplication of DEN-2 is suppressed. The present study focus on the effect of coinfection of Ae. aegypti mosquitoes with DNV and Chikungunya virus (CHIK). The first instar mosquito larvae were infected with DNV and the emerging DNV infected females were then infected with CHIKV by oral feeding. Thus obtained CHIK infected female mosquitoes were analyzed by real time PCR for both DNV and CHIKV on alternate days post-infection, up to the 14th day. The data showed no significant difference in the multiplication of either of the viruses after co-infection. Results suggest that CHIKV neither stimulates the replication of DNV nor is its own replication suppressed due to co-infection. This study forms an initial step in understanding the role played by such endogenous viruses on the vector dynamics. Chandipura virus pathogenesis is manifested as encephalitis in young children with a very high mortality rate. This damage could be due to direct replication of the virus in brain parenchymal tissue or immune system mediated. This study aims at elucidating the role of brain infiltrating lymphocytes in pathogenesis using mice as the model system. Mice were inoculated intracerebrally with the virus and the perfused brain tissue was used to isolate the lymphocytes. Control mice were inoculated with an equal amount of media. In order to standardize the procedure for isolation of lymphocytes from brain tissue, splenocytes were processed to isolate the lymphocytes using Histopaque density gradient method. Methods to isolate lymphocytes from brain tissue as described by earlier workers were tested for the ease and efficiency of procedure using known suspension of lymphocytes from spleen. Percoll density gradient method provided optimum yield of lymphocytes with an ease of handling. In this, brain cell suspension used to prepare 30% Percoll is layered over 70% Percoll prepared using media in 1:2 ratio. Density gradient centrifugation is carried out at 9009g for 20 min at 15°C to obtain lymphocyte layer at the interface. Leishman staining was performed to analyze the morphological characteristics of isolated lymphocytes. Normal lymphocytes showed dark blue stained nucleus. Some bigger sized cells with diffused nucleus characteristic of atypical lymphocytes were observed and some of the cells were surrounded by hair like structures. Phenotypic characterization was carried out using flow cytometry. The presence of CD4 + , CD8 + and CD19 + cells was observed. The percentages of CD8 + , CD4 + and CD19 + cells was found to be 7.60%, 35.14% and 34.32% respectively in the lymphocytes isolated from infected animal and 5.65%, 30.27% and 3.13% respectively from control animal. Hence, CD19 + cells showed maximum infiltration after infection. (Santosh et al. 2008; Pradeep et al. 2008 ). In the Present study CHIKV suspected blood samples were collected and the acute phase samples were subjected to RT-PCR for the presence of virus specific RNA by using the primer pair DVRChk-F/DVRChk-R as described by us earlier (Naresh Kumar et al. 2007 ). The convalescent phase samples were screened for CHIKV specific antibodies by using SD Bioline Chikungunya IgM rapid test. Six sets of primers were designed to amplify the complete NSP4 and Complete structural genes of Chikungunya virus. The products were further gel purified, cloned in pTZ57R/T vector and the recombinant clones were sequenced and submitted to the Genbank. The complete NS4gene and Structural genes were compared with other available sequences in the Genbank. Sequence analysis results will be presented. The present study discusses these aspects in detail. . Some of these phages (viz. V953, V954) showed plaques at 42°C but not at 37°C. Thus they seem to be lysogenic. For propagating and increasing the titre of all the above isolates, various previously described methods were attempted, but none of these methods were satisfactory. But when siliconized glassware and plastic-ware were used, propagation was successful. We showed that siliconization of glassware and plastic-ware was essential for the propagation of our mycobacteriophage isolates V951, V952, V953, V954 and V955. Also, phage dilution medium (PDM) as described by Chaterjee et al. (2000) was found to be effective for picking out of the plaques made by the phages. In this way, the phage isolates were propagated up to P 3 . The various passages of the phage isolates V951, V952, V953, V954 and V955 (i.e. original, P 1 , P 2 and P 3 ) were stored at -80°C. The four major routes of transmission are unsafe sex, contaminated needles, transmission from an infected mother to her baby at birth (vertical transmission) and breast milk. Screening of blood products for HIV has largely eliminated transmission through blood transfusions or infected blood products in the developed world. In 2008, globally, about 2 million people died of AIDS, 33.4 million were living with HIV and 2.7 million people were newly infected with the virus. HIV infections and AIDS deaths are unevenly distributed geographically and the nature of the epidemics vary by region. More than 90% of people with HIV are living in the developing world. There is growing recognition that the virus does not discriminate by age, race, gender, ethnicity, socioeconomic status-everyone is susceptible. However, certain groups are at particular risk of HIV, including men who have sex with men (MSM), injecting drug users (IDUs), and commercial sex workers (CSWs). The present study indicates the prevalence of HIV infection among the people residing in the northern region of India predominantly among the foothills of the Himalayas. The study was carried out on the patients visiting Herbertpur Christian Hospital (A unit of Emmanuel Hospital association) under the integrated counselling and testing centre scheme at the respective hospital during the 2009-2010. The study indicates the screening of people groups residing in the respective area through community health schemes. The diagnosis of the HIV infection is done by three types of assays namely. The tridot method which is the rapid method of diagnosis followed by the. HIV Coombs test which involves the DOT immunoassay principle. The third assay is the enzyme linked immunosorbent assay (ELISA). The number of patients screened during the period of September 2009 to March 2010 is 635 which include patients coming from four different states namely Haryana Uttarakhand Uttarpradesh and Himachal Pradesh. The number of people who were tested positive are 8 and the number of people who were tested negative are 627. The people tested positive are sent to the higher centre for other confirmatory tests such as PCR and western blot analysis. These patients are sent for treatment and prophylaxis at a respective recognised centre in Dehradun. The present study determines a consistent community HIV screening and treatment approach through diagnostics counselling and awareness programmes. Classical swine fever (CSF) also known as hog cholera is a highly contagious and fatal disease of swine. CSF became rapidly a major issue of pig industries. It still causes important economical losses worldwide. It is considered as a major health problem of swines in India. During the month of August to October 2009 there was an outbreak of classical swine fever in Bihar. From three districts Darbhanga, Patna and Supol, total 36 numbers of different infected tissue samples like kidney, spleen and lymphnode were collected from the dead morbid/pigs. Total RNA was isolated from 20% homogenate of infected tissues in sterile PBS by Tri-reagent (Sigma, USA) according to the manufacturer's instructions and cDNA was prepared by using commercial available kit. The cDNA was stored frozen at -20°C until used. For the molecular detection of classical swine fever virus specific nested PCR amplification of E2 and 5 0 NTR was done along with NS5B and E rns amplification. Primarily these samples were found positive with these primers. Further confirmation by sequencing was done by cloning of these PCR products in pGEM-T easy vector. E2 and 5 0 NTR sequences were considered for phylogentic analysis along with 20 complete available sequences of CSFV. Nucleotide sequence alignments were carried out using the ClustalW program (DNASTAR) and Phylogenetic tree analysis (DNASTAR) showed that 5 0 NTR have close proximity with Taiwan strain (Accession No. AY568569) and E2 shows close proximity with Chinese isolate CSFV-39 (Accession No. AF407339). Peste des petits ruminants (PPR) and sheeppox are OIE notifiable diseases of small ruminants especially sheep and goat. Both the diseases are economically important, in enzootic countries like India and are major constraints in the productivity of animals. Considering the geographical distribution of both PPR and sheep pox infections and prevalence of mixed infection, in the present study, safety and potency of the experimental duel vaccine comprising attenuated strains of thermostable-PPR virus (PPRV-Revati, P-50) grown at 40°C and attenuated sheep poxvirus (SPPV-Srinagar, P40) was evaluated in local non-descript sheep. Experimental animals were grouped into four groups and each group was comprising six animals, received 100 doses (10 5 TCID 50 ), 1 dose (10 3 TCID 50 ) and 1/10th dose of vaccines and normal saline as control in 1 ml volume subcutaneously, respectively. Serum samples were collected on 0, 7, 14, 21 and 28th day post vaccination. Sheep simultaneously immunized with 1 ml of vaccine consisting of either 100 or 1 doses of each of PPRV and SPPV were monitored for clinical and serological responses for a period of 3-4 weeks post-immunization (pi) and post challenge (pc). Specific immune responses i.e., antibodies directed to both PPRV and SPPV could be demonstrated by PPR competitive ELISA kit and capripox indirect ELISA, respectively following immunization. All the immunized animals' resisted infection when challenged with virulent strain of SPPV (Srinagar isolate at P-6) on day 28 dpi, while in contact control animals developed characteristic signs of sheeppox. The challenge of the sheep against PPR was not carried out, however, the antibody titre after immunization determined by SNT and ELISA, indicated that protective titre, as per earlier report on the goats. Dual vaccine was found safe at higher dose and induced protective immune response even at lower dose (10 2 TCID 50 ) in sheep, which was evident from sero-conversion as well as challenge study with SPPV. The study indicated that both the viruses are compatible and did not interfere with each other in eliciting immune response, paving the feasibility of use of this dual vaccine in combating both infections simultaneously. Goatpox is one of the highly contagious, OIE notifiable and economically important viral diseases of goats. The disease is caused by goatpox virus (GTPV) is classified of the genus Capripoxvirus in the family Poxviridae. The disease incurs severe economic losses in terms of high morbidity in adults and heavy mortality in young kids and is a major constraint in goat farming in India. Considering the enzotic nature and economic impact of the disease, it is all important to control the infection by developing an effective vaccine. Recently, Vero cell based a live attenuated goat pox vaccine; using GTPV Uttarkashi isolate (P60) has been developed in authors' laboratory and evaluated in goats. The vaccine was found safe, potent and immunogenic experimentally and even at field trials. The vaccine has been evaluated at large-scale at different regions of the country and found suitable for mass vaccination. However, the longevity of potency was not evaluated. Therefore, a long term potency trials were studied for a period of 4 years with annual challenge by using virulent goatpox virus and sero-monitoring. A sufficient number of hill goats has been vaccinated with 1 dose of vaccine (10 2.5 TCID 50 /ml) and monitored for clinical and serological response. Every year, significant number of vaccinated (n = 5) and control animals (n = 2) were used for challenge with virulent strain (2 9 10 7.0 SRD 50 /ml, GTPV Mukteswar). Sera of pre-and post-challenged (14 dpc) animals including controls have been collected and monitored for serological response in the form of specific antibody production by SNT and indirect ELISA. All the vaccinated animals were protected on challenge, whereas, all unvaccinated controls developed infections. The same has been reflected in sero monitoring of collected sera. So the developed live attenuated goat pox vaccine was found safe, immunogenic and potent for a period of 4 years of immunization and suitable for mass scale vaccination in control and eradication of goat pox along with a/are suitable diagnostic tool/s in goatpox enzootic country like India. Rotavirus infection in avian species varies from subclinical infections to outbreaks of diarrhea. The economic significance of rotaviral enteritis to the poultry industry has not yet been defined, but by analogy to the situation in mammals, it is likely to be significant. Unlike the extensive studies performed on rotavirus infection in humans and animals, limited studies have been carried out to determine the extent of exposure of poultry birds to rotaviruses. To determine the prevalence of avian rotavirus antibodies in commercial broiler chickens. A total of 120 chicken serum samples were collected from the lairage of a poultry slaughter house where birds from four different broiler farms in and around Pune city were supplied to. The serum samples were tested by an IgG antibody capture ELISA wherein purified chicken rotavirus Ch2 was used as coating antigen. Sera from specific pathogen free (SPF) chick (n = 20) served as negative control in the test. Cut off was calculated as Mean negative control ? 3SD (standard deviation). S/CO (mean sample OD 450 /cut off) values above 1 (1.113-4.445) in 60% (72/120) serum samples were indicating positivity to rotavirus antibodies. The result of the study indicates exposure of the birds to avian rotavirus or similar agent that is circulating in Pune city. Bluetongue has become established in south India causing regular outbreaks in sheep. BTV serotypes 2, 9, 15 and 21 were isolated from native sheep of Andhra Pradesh. The other serotypes circulating in the state need to be identified. However the major constraint is the serotype identification. To overcome the difficulties of traditional serotyping methods (neutralization tests), nucleic acid based tests are being tried. RT-PCR for serotyping was standardized using primers specific to VP2 gene of BTV-2, 9 and 15 serotypes. RT-PCR resulted in 653 bp product of BTV-2, 1241 bp product of BTV-9 which was defined by specific primers. However non specific amplification at two different sites i.e. 700 bp and 1500 bp was noticed for BTV-15. Specificity of RT-PCR was evaluated. BTV-2 and BTV-9 specific primers could amplify only BTV-2 and BTV-9 respectively where as BTV-15 type specific primers amplified not only BTV-15 but also BTV-2 and BTV-9. Nucleic acid sequence data obtained from BTV-2 PCR product and BTV-9 cloned products were specific to VP2 gene of BTV-2 and BTV-9 respectively. However, 700 and 1500 bp products of BTV-15 were identical to VP 4 gene of BTV-2, 8, 10, 11, 13 and 18 and VP 1 gene of BTV-2, 8 and 10 respectively, indicating the non specific amplification of BTV-15. Foot and mouth disease is the most contagions and highly economically impotent disease of cloven footed animals. The disease is controlled by regular vaccination using the vaccine produced from the virus grown in the cell culture. The vaccine strain used for vaccine production is selected from the field isolates based on the adaptability and growth kinetics in BHK21 cells and antigen coverage. However the field viruses need to be passaged several times to adapt in tissue culture. Passage of field viruses in tissue culture may results in development of mutants whose genetic makeup may differ from the field samples also some of the field strains may fail to adapt or may grow poorly in the tissue culture, thus the efficiency of the vaccine gets affected. Structural proteins of FMDV carry the sequences which determine the serotype specificity and immunogenicity. Thus one may replace the gene coding for structural proteins from the full length cDNA copy of the vaccine strain that has been adapted to the tissue culture with the poly-structural protein gene (PI) so that the chimeric virus gets the serotype specificity of the field strain besides retaining the other characteristics that are needed for a vaccine virus. We have made replication competent FMDV Asia I full length genome and cloned under T7 and CMV promoter separately in plasmid vectors. Bam H1 sites were created for inserting PI-2A gene of other field strains. The P1-2A of type 'O' vaccine strain was amplified directly from the cattle tongue material, cloned in plasmid vector and studied the specificity by sequence analysis and gene expression. We have introduced 'O' P1-2A gene into the full length construct devoid of Asia 1 structural protein gene, P1-2A. The in vitro transcribed RNA in case of T7 promotered construct and plasmid DNA in case of CMV promotered construct were transfected into the BHK21 cells. After the passaging the virus obtained was studied for the speciality. This approach may be used not only for rapid selection of vaccine strain and also as a repository of the cDNA copy of the virus. The P1 is composed of 1A, 1B, 1C and 1D (VP4, VP2, VP3, and VP1) respectively of which the VP1 is the most immunogenic and subunit vaccine produced with VP1 alone was able to induce high level of neutralising antibodies. Thus to control the disease in India polyvalent vaccine consisting of the inactivated virus of all the three serotypes are in use. However the conventional vaccines have several drawbacks which include safety and temperature sensitivity. Hence alternatively sub-unit vaccines consisting of VP1 protein has been tried. However this showed limited success due to the antigenic variations occurring in the field viruses thus escaping the neutralization from the antibodies generated from single cloned protein. Hence the present study was undertaken with an objective to include all the neutralizing epitopes present in the three serotypes by linking VP1 (1D) genes and produce a poly valent protein for using as poly subunit vaccine. In this study we have constructed a cassette by linking the genes of three serotypes 'O' (622 bp), 'A' (640 bp) and 'Asia 1' (622 bp). These genes were cloned individually in commercially pBSk vector and confirmed by sequence analysis before linking in pC DNA vector. The linked gene construct was sub-cloned in pET32 expression vector. The expression of the protein gene from the pET vector was induced with IPTG and analysed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). A fusion protein of size 72 kDa was observed in PAGE gels. Since the protein contains 6 His residues from the vector at the N-terminal end, affinity purification was carried out using nickel nitrilo-tri-acetic-acid (Ni-NTA) agarose matrix. The immunoreactivity of the purified protein was assayed by western blot with the anti FMDV type 'O' and 'Asia 1' specific sera. The may be used as a subunit vaccine. Silkworm diseases caused by viruses, bacteria, fungi and protozoans form major constraints for the silk cocoon production in all the sericultural countries and among these silkworm viral diseases viz., nuclear polyhedrosis and infectious flacherie caused by BmNPV and BmIFV cause severe crop loss. The traditional disease management strategies include prophylactic measures and use of disease free silkworm eggs. The prophylactic measures such as disinfection of silkworm rearing house and appliances, egg surface, silkworm bed disinfection and rearing surroundings. The disinfectants used presently in sericulture are either formaldehyde or chlorine based products, but these chemicals are neither eco-nor user-friendly. The awareness about health hazards caused by formaldehyde and environmental pollution caused by Cl 2 necessitated the development of eco-and user-friendly disinfectant products for use in sericulture. These include alternative disinfectant products developed using biodegradable chemicals and plant based ingredients by APSSRDI, Hindupur and Central Silk Board for the management of silkworm diseases in India. The ideal disinfectant for sericulture would be the one which can inactivate silkworm pathogens of diverse origin and economical for sericulture. The paper discusses on the disadvantages of HCHO and Cl 2 based disinfectants and advantages of eco-and user-friendly disinfectant for the management of silkworm diseases especially the ones caused by viruses. The Baculovirus Expression Vector System (BEVS) is widely used for the production of high levels of properly post-translationally modified, biologically active and functional recombinant proteins and has facilitated basic biomedical research on protein structure, function, drug discovery and the roles of various proteins in disease. BEVS is based on the introduction of a foreign gene into nonessential for viral replication genome region via of homologous recombination with a transfer vector containing target gene. The resulting recombinant baculovirus lacks one of nonessential gene (polh, v-cath, chiA etc.) replaced with foreign gene encoding heterologous protein which can be expressed in cultured insect cells and insect larvae. Insect cell-BEV system is widely used to produce recombinant proteins. BEVS also eliminates concerns regarding pathogens that could potentially be transmitted to humans as it is non-infectious to vertebral animals.

These features make silkworm system an ideal expression and delivery package for producing proteins of medicinal importance. The efficiency, low cost and large-scale production of proteins using BEVS represents breakthrough technology that is facilitating highthroughput proteomic studies. The BEVS has become a core technology for cloning and expression of genes for study of protein structure, processing and function; production of biochemical reagents; study of regulation of gene expression; commercial exploration, development and production of vaccines, therapeutics and diagnostics; drug discovery research; exploration and development of safer, more selective and environmentally compatible biopesticides. Utilization of silkworm larvae and pupae as bioreactor with recombinant BmNPV producing foreign proteins extends the usages of silkworms. Due to its large-size and high protein synthesis ability as well as the expediency in mass culture, silkworm is considered as good candidate for producing recombinant proteins. WSSBV is the causative agent of a disease, which has recently caused high shrimp mortalities and severe damage to shrimp culture. WSSBV has been found across different penaeid shrimp species. In order to develop a effective diagnostic tool, a WSSBV genomic library was constructed by cloning WSSBV genomic DNA extracted from purified virions. In the present study WSSV disease free (confirmed by PCR analysis) were collected from hatcheries from different areas of Guntur and Prakasam districts and analysed to study the effect of various physical parameters like temperature, p H , salinity and turbidity on the prevalence of above disease. The studies on the surface water temperature revealed fluctuations in the ponds ranging between 19 to 30.2°C in diseased ponds and 25.2 to 34.5°C in healthy ponds. These results show definite influence of temperature on the prevalence of WSSV. Present day strategy in vaccine development is to include marker facility that helps in distinguishing antibody response due to vaccination vis-à-vis infection in vaccinated animals. Such information becomes relevant for effective disease control programmes especially when using inactivated virus vaccines like foot and mouth disease (FMD). The antibodies generated in the animals, only through vaccination, is the measure of vaccine efficacy and safety. Presently inactivated FMD virus (FMDV) vaccines are used to control the disease in the endemic countries like India. The quality assurance of the vaccine depends on the efficacy of the vaccine in generating protective antibody without causing subclinical disease due to improper inactivation. Since protective antibody response in vaccinated animals can not be distinguished from that of infected animals one needs to assay the antibody response against non structural proteins (NSPs) and the vaccine must be free of contaminated NSPs. Production of vaccine free of NSPs requires the cumbersome method of virus purification which adds to the cost of the vaccine. Alternatively one may develop a positive marker vaccine by including a foreign protein or epitope which is not expected to be present in the vaccine and the antibodies generated against which helps in detecting the vaccine related response. Here we report a molecular approach by which we introduced a immuno-dominant epitope of green fluorescent protein (GFP) into the structural protein gene of foot and mouth disease virus vaccine strain Asia 1 (63/72). Our laboratory has produced a mini-genome of FMDV Asia 1 that lacks structural protein gene (P1-2A) coding for all the structural proteins (VP1-4) of FMDV Asia 1 as a vector (pCFL DAsia 1). The P1-2A of the Asia 1 vaccine strain was cloned separately into a plasmid vector and by successive PCR mutagenesis and cloning we have introduced nucleotide sequence corresponding to 9 amino acid epitope of GFP into P1-2A gene. GFP epitope was inserted by replacement at N-terminal region of VP-2 which is not immunogenic. The modified P1-2A was expressed in E. coli and studied. The modified P1-2A gene with GFP epitope was inserted into the pCFL DAsia 1 to get full length replication competent cDNA cloned under CMV promoter in pCDNA (pCFLAsiaGFP). This can be used to produce synthetic virus with GFP epitope that can generate antibodies not only against neutralizing epitopes but also against GFP epitope. Presence of antibody against GFP epitope in the vaccinated animal will reveal vaccine efficacy. ELISA against GFP can be used as a companion test not only for safety evaluation but also for quick evaluation of efficacy. Further absence of NSP antibodies in the serum may reveal the quality of the vaccine in respect of safety. Self replicating DNA vaccines are developed to achieve robust immune response through enhanced antigen production and gamma interferon expression in vaccinated animals. Since self replicating DNA vaccines induce gamma interferon expression which helps in viral clearance such vaccines are expected to be useful to cure even the carrier and persistently infected animals. Understanding the events that help in the elicitation of both the arms of immune response in vaccinated animals is necessary to understand the effectiveness of the vaccine. The work presented here deals with the immunological evaluation of a Sindbis virus replicase based DNA vaccine carrying linked FMDV VP1 genes in vaccinated guinea pigs. We have constructed self replicating DNA vaccine vector and to the down stream of a sub genomic promoter we have inserted secretory signal followed by linked-VP1 genes of 3FMDV serotypes (O-A-Asia 1) with glycine and proline bridge in between. Guinea pigs were vaccinated with the construct and the sera at 28 days post vaccination were evaluated both for cellular response by studying the CD8 levels and by MTT and cytokine profiles by real time assays. The humoral response was evaluated by studying CD4 levels in the whole blood by Facs analysis and serum antibody levels by SNT and ELISA. The animals were challenged with 100 GP infective dose of FMDV type 'O' virus lesions were scored. Further the replicative efficiency of the challenge virus was studied by 3AB ELISA. The results showed that all the assays except antibodies against 3AB protein have positive correlation with the protection. As expected the titre of the antibodies against 3AB protein was lower indicating that the challenge virus replication was inhibited in the vaccinated animals. The limited studies conducted by us showed that self replicating vaccine has a potentiality to emerge as potent vaccine for FMD. Ganjam virus (GANJV) belongs to the genus Nairoviruses (family Bunyaviridae). These viruses cause diseases in livestock. It has been isolated from different animal hosts and tick vectors from India. Genus Nairoviruses includes a total of 34 tick-borne viruses, classified into 7 serogroups. The important serogroups are Crimean Congo hemorrhagic fever (CCHF) and the Nairobi sheep disease (NSD). The main members of the NSD group are NSD and Dubge viruses. Their genome consists of three segments of single stranded RNA, viz. S, M and L that encodes viral nucleocapsid protein, Viral glycoprotein G1 and G2 and the Viral polymerase respectively. GANJV is very closely related to (NSDV). NSDV is found in East and central Africa, causes very high morbidity and mortality in livestock. The present study involves phylogenetic comparison of GANJV isolates from India with other nairoviruses based on complete N gene. It will help to understand the kind of nucleotide (nt) and amino acid (aa) changes that have occurred in GANJV strains from different geographical areas. Eight strains of GANJV isolated at NIV during 1954-2002 from different parts of India were used in this study. Virus stocks were prepared in Vero E6 cell line these were used as the source of viral RNA. The N gene was amplified either as a complete gene in one reaction or in fragments whenever necessary. Thus obtained sequences were analyzed; annotated to get a consensus sequence, aligned against the sequence of prototype strain of GANJV and other representative nairoviruses. The nt sequences were converted to aa sequences and analysis was done at both nucleotide and amino acid levels. Based on what nt or aa phylogenetic tree was constructed and compared with other nairoviruses (CCHF, DUGV, HAZV, KUPV and NSDV) where complete S segment sequences were available Gen-Bank database (NCBI). The phylogenetic data at both the nt and aa levels showed that all the strains of GANJV form monophyletic lineage with the NSDV. CCHFV and HAZV together formed another clade, whereas DUGV and KUPV made a separate branch in the tree. The different GANJV strains showed 9-10% difference with NSDV at the nucleotide level and 3-4% difference at the amino acid level. HAZV showed 37-38% difference at the nt level and 37% difference at the aa level with GANJV as well as NSDV. The present data obtained suggests that GANJV and NSDV are minor variants of the same virus. Diarrhoeal syndrome is one of the major concerns of the livestock industry. Most of the diarrheic cases in animals go unnoticed and limited attention is paid on viral etiology. Presence of large amount of fecal matter in animal shed acts as a source of infection for calves via drinking water, feed, or contaminated soil. Keeping this in view, investigation was planned to detect the association of rotaviruses with diarrhea in dairy calves and to observe the genomic diversity among the circulating viruses in Tarai area of Uttarakhand. A total of 63 diarrheic fecal samples collected from Instructional Dairy Farm, Nagla, Pantnagar, Uttarakhand were screened during the study. Samples were collected from both cow calves and buffalo calves in 0-3 months of age. For the diagnosis of rotavirus, all the fecal samples were subjected to RNA-electrophoresis after nucleic acid extraction. Viral genome segments were visualized by silver staining. Out of the total 63 samples tested, seven were found positive in RNA-PAGE showing typical 11 genome segments migration pattern of bovine rotavirus. In the given samples prevalence of bovine rotavirus was 11.32% and 10% in cow and buffalo calves, respectively. On the basis of migration patterns of rotavirus in RNA-PAGE, group A were identified with typical 4:2:3:2 pattern. Variation within movement of various genome segments among isolates of bovine rotaviruses was observed during the study that may be indicative of emergence of mutants in the circulating isolates. The VP6 gene based group A specific RT-PCR was standardized and all the isolates in this area were confirmed to be of group A type. Work is in progress to genotype the bovine rotaviruses of this region based on VP7 and VP4 genes. This study emphasizes the need to explore the prevalence of bovine group A rotaviruses in different places of Uttarakhand and their genetic characterization which could help in selection of control strategies for rotavirus infections. Foot-and-mouth disease (FMD) is endemic in India causing enormous economic loss to the animal keepers and trade embargo with FMD free countries in livestock and animal products. Rapid diagnosis of FMD is of immense importance in prevention and control of the disease. FMD is initially diagnosed clinically and confirmed by laboratory tests. Virus isolation in cell culture and sandwich ELISA for antigen detection are commonly practiced in laboratories. The virus isolation though is very sensitive but it can be slow and analytical sensitivity of the ELISA is lower and can not be used with certain sample types. The use of molecular techniques in the diagnostic laboratory has greatly increased the speed, specificity and sensitivity of FMD diagnostic tests. Molecular techniques like RT-PCR, PCR-ELSA and dot hybridization can be used with more success for detecting carrier animals and animals harboring sub-clinical infection and can be applied in a wide range of clinical sample types. These techniques can be used as genus and serotype specific test including detection of particular lineage/genotypes with in the serotype. Multiplex PCR has been used to differentiate serotypes of FMDV and the technique is sensitive, experimentally simpler, cost effective and less time consuming. The assay can be used for serotyping on ELISA negative samples. The molecular techniques not only help in diagnosis but also useful for epidemiological studies. Lineage differentiating RT-PCR has been useful in identifying different lineages of serotype Asia 1 (Lineage B, C and D) before proceeding with sequencing of 1D region. Similarly genotype differentiating RT-PCR has been developed and used in differentiating two different genotypes of serotype A (Genotype VI and VII). These assays have the potential to be applied on clinical samples directly, thereby saving much time needed for sample processing and nucleotide sequencing. Recent development of real time RT-PCR methodology has allowed the diagnostic potential of molecular assays to be realised. Advancement in real time PCR technology made it possible to combine several assays within a single tube which is in the progress in our laboratory. Integration of these assays onto automated high throughput platforms provides diagnostic laboratories with the capability to test large numbers of samples. Microarray technology was provided greater screening capabilities for pathogen detection. The microarray allows the addition of large number of oligonucleotide probes for identification of mutant pathogen and also for subtype determination. The combined properties of high sensitivity and specificity, low contamination risk, and speed has made realtime PCR and microarray technology a highly attractive alternative to conventional methods in increasing percentage of outbreaks confirmed and analyzed and for tracing the origin of FMD virus responsible for outbreaks. DNA vaccines are expected to elicit both humoral and cellular responses, cellular response being long lasting. However the approach has several limitations like poor stability of DNA, poor expression and risk of integration. Poor expression becomes the major limitation in the case of FMD as FMDV proteins are poor immunogens. Also DNA vaccine vectors carrying only eukaryotic promoters elicit strong CMI response and weak humoral response. The methodology to achieve humoral response involves the expression and secretion of the expressed protein so that the antigen presenting cells will be able to process the antigen and produce humoral response. In case of FMD humoral response is as important as cellular response. The present project aims at addressing these issues; achieving higher expression and getting the protein secreted out by constructing self replicating gene vaccines for FMD and studying their efficacy. The vector for humoral immune response contains eEF1 promoter, Sindbis virus polymerase gene and secretory and anchoring signals. The integrity of the vectors was confirmed by sequence analysis. The linked polyvalent protein genes of FMDV serotype A, O and Asia 1 were cloned into the vectors and the presence of the insert was confirmed by restriction enzyme digestion. The functionality of the constructed DNA vaccine vector (pVac Self Rep 990) was assayed by transfecting the DNA into BHK 21 cell monolayer and studying the 35 S labeled proteins in immuno-precipitation assays. The studies showed high level of expression in case of constructed vector as compared to infected virus for the specific protein. The secretion of the expressed protein was assayed by Immuno-fluorescence assay and found to be positive. Encouraged with these studies the preliminary studies were conducted on vaccine efficacy studies in guinea pig model. The immunized guinea pigs showed high antibody titres by SNT and ELISA, as compared to conventional DNA Vaccines (pUP3CD) even at 1/10th of the dose. This approach of constructing self replicating DNA vaccine for humoral response is the first report. Genetically engineered microorganisms are important sources of industrial and medicinal proteins. Over the past decade, plant host system has been investigated as potential host system for expressing proteins of therapeutic and diagnostic use. However concerns regarding the stability and environmental safety need to be addressed. Chloroplast engineering is expected to resolve some of these issues since, plastids/chloroplasts are inherited maternally and are not disseminated through pollen. This makes plastid transformation a valuable tool for transgenic creation besides offering biological containment. Since foot and mouth disease (FMD) of cloven footed animals is a major concern in the world over. Foot and mouth disease (FMD) is the most feared, viral disease of the cloven footed animals causing heavy losses to the live stock industry. The disease is enzootic in many parts of the world including Asia. The conventional vaccines for FMD have several limitations which include safety, temperature sensitivity and duration of immunity. Attempts have been made to overcome these limitations using recombinant DNA technology. Amongst the newer vaccines, edible vaccines are cost effective and easy to administer. Since the stability of the gene of interest is the major concern in the case of plant transgenics, marker genes are used for regular selection. The detection methods based on the available marker proteins like b Glucoronidase (GUS) protein/antibiotic selection are cumbersome and cost intensive. However selection based on herbicide resistance is much simpler and easy. Hence in the present study, the 5-enolpyruvylshikimate-3-phosphate synthase (EPSP) gene was used as a marker along with the immunogen gene of FMDV. EPSP is the key enzyme in the shikimate biosynthesis pathway necessary for the aromatic amino acids production. In order to investigate the mechanism of long term immunity and the effect of protective immunity induced by cationic PLG micro particle coated DNA vaccination. We constructed the expression plasmid containing a Foot-and-mouth disease virus (FMDV) ID gene sero type A. Intramuscular vaccination of Guinea pigs with the micro particles coated plasmid DNA Induced a strong antibody response and neutralization antibodies, cellular mediated immune response which lasted 1 year. We further analyzed the persistence and expression of ID gene by polymerase chain reaction and reverse transcriptase polymerase chain reaction and quantitative PCR. The results showed that ID gene was present and expressed in the muscle cells up to 1 year after days post vaccination. Furthermore, Guinea pigs vaccinated with micro particles coated plasmid DNA were protected against a Challenge with FMDV virus. Therefore the micro particles coated plasmid DNA vaccination dose induce a protective immunity and long term humoral, cellular immuno responses against FMDV, which could be maintained by persistent expression of ID gene in muscle cells. Foot and mouth disease virus (FMDV) causes a highly contagious viral disease of cloven hoofed animals, which has a considerable socioeconomic impact on the countries affected. Interleukin-18 (IL-18) enhances the IL-12 driven Th1 immune response that is important in immunity against intracellular pathogens. The multiple roles of IL-18 in many physiological and pathological processes have generated a great deal of interest in recent years. Antiviral effects of IL-18 have been reported. We evaluated the effects interleukin-18 (IL-18) on the replication of FMDV in vitro in BHK-21 cells. Bovine IL-18 mature protein coding sequence was amplified from the bovine PBMC cells and cloned into prokaryotic expression vector pET32a. Protein expressed was purified and specificity was confirmed by immunoblotting. BHK-21 cells were treated with purified expressed IL-18 protein with (2 lg/ml) 4 h prior to FMD infection. Cell culture supernatants were collected at 24 h post infection were subjected for ELISA and virus titration assay. RNA extracted from the cells was subjected to Real Time PCR for viral RNA quantification. 2 log titer reduction was observed in the FMD virus titer in IL-18 treated cells compared to the untreated cells where as virus antigen quantified by ELISA has shown a reduction of 60-folds. 69-fold reduction in the FMD viral RNA copy number was observed in the IL-18 treated cell compared to the untreated measured by qPCR. Current study demonstrated the potent anti viral activity of IL-18 on FMDV by inhibiting the viral replication. These results further suggests that IL-18 has the potential role of IL-18 as molecular adjuvant in FMD vaccine development and development of therapeutic for FMD. Foot and mouth disease is the most contagious viral disease of farm animals. Control of the disease in animals is by vaccination and slaughtering of infected animals. Conventional oil adjuvant vaccine has its own limitation. Alternate to this genetic vaccines where the DNA encoding viral antigen may be a promising approach. Naked DNA vaccine has limitations like poor uptake of DNA by cells and more importantly by nucleus. As a result delivery of naked DNA through calcium phosphate nanoparticle was attempted. Calcium phosphate nanoparticle is a potential delivery agent which proved to enhance the immune response. FMDV P1-3CD ''O'' vaccine gene constructs in pCDNA3.1? entrapped by the nanoparticles was prepared by using different molarity of calcium chloride and disodium hydrogen orthophosphate. The nanoparticles entrapping FMDV P1-3CD ''O'' and naked DNA were presented to the guinea pigs through intramuscular injection to study the mRNA expression of antigen by RT-PCR. Animals were sacrificed at defined time to collect different organs and total RNA was extracted. Each time blood was collected to analyse the FMDV specific serum antibodies. DNA vaccines presented through calcium phosphate produced transcripts in the injected muscle up to 240 days whereas naked DNA up to 120 days. Serum antibody levels of naked DNA vaccine showed antibody titre till 60 days. Whereas nanoparticle injected animals showed serum antibody till 120 days. Serum neutralization titres of 1.5 were observed in calcium phosphate DNA Vaccines at about 28-150 days, where as naked DNA SN titers were observed for short period of 30-90 days. The study clearly showed calcium phosphate nanoparticle entrapping FMDV vaccine DNA may be a better delivery system for DNA vaccines as it confirms availability of the antigen and persistence of antibody for longer duration than naked DNA. Capripox is highly infectious, contagious, and OIE notifiable disease of small ruminants, caused by sheeppox and goatpox viruses which are members of capripoxvirus genus of the family Poxviridae. In the present study, we analyzed the partial gene sequences of P32 protein, an immunogenic envelope protein of Capripox viruses (CaPV) to assess the genetic relationship among different sheep pox and goat pox virus isolates from different geographical areas of the country. Product of this gene has been shown to be important in attachment of CaPV to host cell surface receptors during viral entry and host immune response. The following virus isolates have been used in the analysis: GTPV-Uttarkashi, P60, vaccine virus; GTPV Mukteswar, P10, Challenge virus; GTPV (Akola), GTPV Bareilly/00, GTPV Ladakh/01 and GTPV Sambalpur/82, field isolates and SPPV Srinagar, P40; SPPV Ranipet, P50; SPPV-RF, P50, vaccine viruses and SPPV Makdhoom/07, SPPV CIRG/08, SPPV Pune/08, SPPV Bareilly, SPPV 183/03 and SPPV 125/02, field isolates. In this study, all virus isolates were confirmed by PCR amplification and analysed in PCR-Restriction fragment length polymorphism (PCR-RFLP) using EcoRI enzyme to confirm their specificity. Further, the amplicons were cloned and sequenced commercially. Nucleotide and the deduced amino acid (aa) sequences were compared with published sequences of the members of the genus Capripox virus. Sequence analysis of partial 172 bp sequence has shown high sequence identity among all Indian SPPV and GTPV isolates at both nt and aa levels. It revealed a 99.4-100% and 98.2 for GTPV field isolates where as, 100% for SPPV field isolates at both the nt and aa levels. In general, CaPV isolates in this study shown 98.3-98.8 and 96.5% homology between GTPV and SPPV at nt and aa levels as reported earlier.

Further, it revealed a unique change of G120A in all GTPV isolates resulting in formation of DraI site in place of EcoRI and possible development of restriction enzyme specific PCR-RFLP for differentiation of SPPV and GTPV from field isolates. Orf or contagious ecthyma is considered as non-contagious, proliferative disease and is caused by Orf virus of the genus parapox virus of the family poxviridae. It is reported most commonly in sheep and goats and also a zoonotic agent. Camels are also infected by Orf virus and reported in camel rearing countries as a mixed infection with camel pox, the later is caused by an orthopox virus. In India, there are few reports of the Orf virus infection in camels and identified by clinical signs and PCR. In this study, we identified the presence of Orf virus from clinical samples of suspected case of sporadic infection in camels by serological and molecular techniques. Viral DNA isolated from processed scabs used initially in nested polymerase chain reaction as diagnostic PCR which successfully amplified 235 bp fragments and also sequenced to check the fidelity of the product. After confirming the infection by PCR, some of the structural and non-structural genes were amplified for sequence analysis. Out of the five genes characterized, the major important one selected for sequence and phylogenetic analysis is B2L gene which is homologous to a major envelope protein P37k of vaccinia virus. Full open reading frame of 1137 bp from Orf B2L was amplified by PCR, cloned and sequenced commercially. Nucleotide and deduced amino acid sequences of B2L were compared with other published sequences of the members of the genus papapox virus. Sequence analysis shows a maximum percent identity of 94.8 and 95 (Indian Orf virus isolates); 94.7 and 94.5 (other Orf isolates); 98.8 and 98.7 (Orf-camel/Jodhpur/08); 85 and 82.8 (bovine popular stomatitis virus) and finally 97.4 and 97.6 (pseudo cowpox virus) respectively at nt and aa levels. Phylogenetic analysis of the isolate was also performed using the neighbour joining method in MEGA 4 program to know the phylogeny relatedness of the virus, which revealed that the isolate is well grouped with the Jodhpur isolate and closely related to pseudo cowpox virus. It warrants further analysis of other potential genes to confirm the causative agent of the contagious ecthyma in camels as pseudo cowpox virus. Chikungunya an arboviral disease is transmitted through the bite of an infected Aedes mosquito. It causes a self limited febrile illness along with arthralgia and myalgia. In some cases neurological and severe hemorrhagic manifestations has been observed. CHIKV epidemic has been reported in Africa, India, South East Asian countries and during the current out break imported cases of CHIKV has been encountered in most of the European countries. The causative agent belongs to the genus Alphavirus family Togaviridae. Human beings serve as the chikungunya virus reservoir host during epidemic periods. Outside these periods the main reservoirs are monkeys, rodents, birds, and other unidentified vertebrates. Antibodies to CHIKV have been detected in domestic animals. In the present study we surveyed Madanapalli, Palamaner, B. Kotta Kota and Tirupati and collected a total of 67 rodent samples, 75 bovine samples; 20 sheep samples and 15 canine samples. Total RNA was isolated from all these samples and subjected to RT-PCR using a primer pair DVRChk-F/DVRChk-R which could amplify a 330 bp E1 gene product specific to Chikungunya virus (Naresh Kumar et al. 2007 ). All the Serum samples were further screened for CHIKV specific IgM antibodies using commercially available CTK biotech strips. None of the samples were found positive either for CHIKV specific RNA or CHIKV specific IgM antibodies. More number of samples from domestic animals as well as rodents are being screened to study their possible role if any in the maintenance of CHIKV in nature and during the inter epidemic periods. The present study discusses these aspects in detail. Petunia hybrida is widely used as experimental host plant for begomovirus identification and its characterization. Hitherto, natural infection of begomovirus on Petunia has not been reported in India. Recently, Petunia hybrida grown in and around Ludhiana were found to be depicting typical symptoms caused by begomovirus. The symptoms include severe reduction in leaf size, downward curling and distorted leaves. Severely infected plant became bushy, stunted and produces no flower. Total genomic DNA was extracted from the plants showing symptoms of begomovirus, by CTAB method. The presence of virus was confirmed by using degenerated primers, designed to identify all the begomovirus prevailing in the world. To identify the strain associated with the disease, the positive samples along with healthy control were tested against different strain specific primers of tomato leaf curl virus, so far reported in India i.e. tomato leaf curl New Delhi virus, tomato leaf curl Palampur virus, tomato leaf curl Banglore virus, tomato leaf curl Karnataka virus and tomato leaf curl Gujarat virus. Among these, only tomato leaf curl New Delhi virus specific primer was able to give the desired amplicon of *1180 bp. Hence, it is confirmed that the leaf curl disease of Petunia hybrida is associated with tomato leaf curl New Delhi virus. This disease of petunia can become a sever production constraint in coming years. From last 2 years (2008 and 2009) it was observed that some varieties of brinjal grown in rainy season, showed typical leaf curl type of symptoms. The symptoms include upward curling of the leaves, cupping, vein thickening, reduction in leaf size and distortion of leaves. The severely infected plant remains stunted and bushy, became unproductive or produces only few fruits. The disease was experimentally transmitted from naturally infected brinjal to healthy seedlings by whiteflies (Bemisia tabaci) and grafting, but not by mechanical or aphid transmission. To detect the begomovirus associated, total genomic DNA was extracted from the plants showing disease symptoms. The presence of virus was confirmed by using PCR based begomovirus geneus-specific primers designed by Deng et al., Wyatt and Brown and Rojas et al. These degenerated primers give the expected product size of *530, *575 and *1280 bp, respectively. Core coat protein (CP) gene and DNA-b was also amplified in the samples using specific primers. To identify the strain associated with leaf curl virus, DNA was subjected against primers of different Indian tomato leaf curl virus strain i.e. Tomato leaf curl New Delhi virus, Tomato leaf curl Palampur virus, Tomato leaf curl Banglore virus, Tomato leaf curl Karnataka virus and Tomato leaf curl Gujarat virus, using PCR. Among these, only Tomato leaf curl New Delhi virus primer was able to show the desired product size of *1180 bp. Therefore, it was confirmed that leaf curl disease of brinjal is caused by Tomato leaf curl New Delhi virus in association with satellite b-DNA. To identify the strain associated with the disease, all samples were further subjected to the specific primers, designed to amplify all the tomato leaf curl virus strains, so far reported from India i.e. tomato leaf curl New Delhi virus, tomato leaf curl Palampur virus, tomato leaf curl Banglore virus, tomato leaf curl Karnataka virus and tomato leaf curl Gujarat virus, using PCR. Among these, only tomato leaf curl Palampur virus specific primer was able to give the expected product size of *900 bp. This shows the association of tomato leaf curl Palampur virus with leaf curl disease of Calendula and Marigold. Thus, Calendula and Marigold can act as a reservoir for the tomato leaf curl Palampur virus and may cause severe constrain in the production of these important ornamental plants. Groundnut bud necrosis virus (GBNV) belongs to serogroup IV of the genus Tospovirus in Bynayaviridae family and infects several economically important crops all over India. The nucleocapsid protein (NP) encoded by the small RNA of GBNV encapsidates the viral RNAs. Apart from this structural role, the NP has also been implicated in the replication, transcription, maturation and cell to cell movement. With a view to study the structure and function, the NP of GBNVtomato isolate from Karnataka was over expressed in E. coli and purified by Ni-NTA chromatography. The purified NP was present as ribonucleoprotein complex and as heterogeneous mixture containing monomers, tetramers and higher order multimers. In order to determine the regions involved in oligomerization and nucleic acid binding, mutational approach was taken. N-and C-terminal deletion clones were generated (N20NP, N40NP, C15NP and C37NP), over expressed in E. coli, and were purified by a procedure identical to that used for the wild type protein. Initial studies on oligomeric status suggested that in addition to N-and C-terminal regions there may be additional regions or residues which contribute to multimerization of NP. The amount of RNA bound to the truncated proteins was reduced in case of N20NP, N40NP and C15NP. Interestingly removal of 37 amino acid residues (natively unfolded region) from the C terminus resulted in complete loss of nucleic acid binding suggesting that the RNA binding domain was located in C-terminal region of NP. Further NP was observed to get phosphorylated in in vitro kinase assays by a kinase present in the soluble fraction of tobacco plant sap. Both ATP and GTP were utilized as phosporyl donors and Mn 2? was the preferred metal ion which suggests that NP might be phosphorylated by a CK2-like protein kinase. Phosphorylation studies with N-and C-terminal truncated proteins revealed that the site of phosphorylation lies within the amino acid residues 40-239. By Mass spectrometric analysis of the protein Threonine-84 and Serine-202 were identified as possible phosphorylation sites. A naturally occurring isolate of virus infecting Gherkin (Cucumis anguira L.) showing mosaic symptoms of mosaic, leaf distortion and dark green islands in the lamina was identified in the export cultivars of gherkin grown in commercial fields of Kuppam rural, Chittoor District, Andhra Pradesh. The virus infection was deadly prevalent among the field that caused a lot of economic damage to the crop that resulted in yield losses and reduced quality of fruits meant for export. Symptoms of the infected fruit included blistering and malformation of the fruit. The virus infected leaf samples were collected and initial host range tests were conducted with different cucurbit species showed that the host range include propagation hosts like Cucumis anguira (Gherkin), Cucumis sativus, Cucurbita pepo, Cucumis melo, Langeneria vulgaris, Momordica charantia and local assay host like Chenopodium amaranticolor. The virus host range was only restricted to Cucurbit species and Chenopodium. The virus was maintained for further studies on Cucurbita pepo by sap or mechanical inoculation. The virus induced mosaic, vein clearing symptoms on Pumpkin. Electron microscopy of the leaf dip preparations stained with 2% Uranyl acetate from the pumpkin leaves showing symptoms revealed the presence of a long flexuous filamentous particle measuring 750 9 12 nm. The virus positively reacted to the polyclonal antisera of Papaya ringspot virus-W, Potato virus Y, Tobacco etch virus and also strongly reacted with the polyclonal antiserum of Zucchini yellow mosaic virus in Direct Antigen Coated-Enzyme Linked Immunosorbent Assay (DAC-ELISA). Because of very strong reaction to polyclonal antisera of Zucchini yellow mosaic virus, we tried to amplify the partial Nib and CP genes of the virus along with the 3 0 UTR by using two primers ZY2 5 0 GCTCCATACATAGCTGAG ACAGC3 0 and ZY3 5 0 TAGGCTTTTTGCAAACGGAGTCTA AT C3 0 . Total RNA from Gherkin infected leaves was isolated using Trizol LS reagent (Sigma). RT-PCR was performed to obtain an amplicon of *1.2kbp, cloned into Fermentas pTZ57R/T vector and sequenced at MWG biotech, Bangalore. Sequence analysis revealed that the virus was isolate of Zucchini yellow mosaic virus and was showing 98% of homology to that of the Zucchini yellow mosaic virus strain B genome AY188994 and Zucchini yellow mosaic virus NAT genome EF062582 which were strains reported from Israel. The sequence of the present study was submitted to the Genbank GQ482976. The results state a suspicion that the virus could have been mobilized by some infected source brought by the Commercial Israeli based companies into India due to poor quarantine regulations as the Gherkin cultivation in these regions is chiefly supported, purchased, exported and marketed by these private companies that are based from Israel. This is the first report on Molecular characterisation of Zucchini yellow mosaic virus infecting Cucumis anguira (Gherkin) from India. They also exhibited synergism with other virus which was region specific. Fifty percent of the total symptomatic plant population was found be positive only for carla while remaining showed mixed infection of Carla with Tospo in some regions while in others carla virus was found to be associated with CMV. Presence of only carlavirus was up to 10-20% incidence, without association of Tospo, CMV, Poty or Tobamo viruses was also observed in some fields.

Avijit Tarafdar, Raju Ghosh, K. K. Biswas Plant Virology Unit, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi 110012

Citrus tristeza virus (CTV), a brown citrus aphid (Toxoptera citricidus) transmitted Closterovirus under family Closteroviridae, is one of the major limiting factors in cultivation of citrus worldwide. CTV is a longest known plant virus having flexuous particle of 2000 9 11 nm in size. CTV genome is a positive sense ssRNA of about 20 kb nucleotide containing 13 open reading frames (ORFs) encoding 17 proteins. Several biological as well as genetic variants of CTV are reported in all the citrus growing countries in the world. CTV causes decline and death of millions of citrus trees in the world. In India, CTV is a century old problem, and has killed an estimated one million citrus trees till today. In molecular and genetic level, CTV isolates from India were not fully characterized. Genetic diversity and sequence divergence in CTV isolates of India are not fully established. Further, evidence of recombination and causes of evolution of CTV variants in India have not been studied till date. Therefore, in the present study, effort has been made to characterize several Indian CTV isolates in genetic level, examine their genetic diversity, identify recombination events and analyze evolution of divergent CTV. A total number of 73 CTV isolates from different regions of India (35 from Darjeeling hills, five from Bangalore, 15 from Delhi and 18 from Vidarbha) were under taken for genetic study. Two genomic regions of CTV, i.e., entire CP gene (CPG) (672 nt) and a gene fragment of 5 0 ORF1a (ORF1a) (404 nt) were amplified, cloned, sequenced and nucleotides were analyzed. Based on CPG, Indian isolates shared 88-99% nucleotide identity, and based on ORF1a they shared 82-99% identity, among them. Incongruence of phylogenetic relationship was observed as on sequence analysis five phylogenetic clades based on CPG, and eight clades based on ORF1a, were generated suggesting the recombination events have been occurred between the sequences of Indian CTV isolates. Thus, to identify the potential recombination events, and determine the parental sequences in CTV isolates, six recombination detecting algorithms, namely, RDP, Genconv, Bootscan, Maxchi, Chimera and Siscan were used. Out of 73 Indian CTV, CPG of 18 and ORF1a of 47 isolates of CTV showed recombination events suggesting ORF1a was more prone and fragile to RNA recombination as compared to CPG. This findings indicated that high degrees of genetic diversity and incongruent relationships of Indian CTV isolates are due to genetic recombination occurred, which may be the important factors in driving evolution CTV variants in India, that was also supported by a splitTree decomposition analysis.

B. V. Bhaskara Reddy, Y. Sivaprasad, K. Rekha Rani, K. Raja Reddy Department of Plant Pathology, Regional Agricultural Research Station, Acharya N.G. Ranga Agricultural University, Tirupati, Andhra Pradesh Sunflower (Helianthus annus L.) is one of the most important oil seed crops in the world which ranks third in area after Soyabean and Groundnut. The Sunflower Necrosis Disease (SND) is characterized by necrosis of leaves, necrosis streaks on petioles, stem, floral parts and stunted growth. The causal agent of the disease has been identified as Tobacco streak virus (TSV) which belongs to genus Ilarvirus of the family Bromoviridae. The suspected TSV infected sunflower samples collected from chittoor district in Andhra Pradesh were found positive for TSV-DAC ELISA. Total RNA was extracted from sunflower using RNAeasy isolation kit (QIAGEN). The TSV coat protein (CP) gene, movement protein (MP) gene and replicase (Rep) gene were amplified by RT-PCR with specific primers, cloned in pTZ57R/T vector, sequenced and deposited in GenBank (GU355899, GU355900 and GU371445). The size of cloned CP gene was 717 bp and codes for 239 amino acids. The CP gene sequence analysis revealed that the TSV-TPT infecting sunflower has 98-100% homology at nucleotide level with soybean, tagietus-TPT and okra-TN isolates and 93-99% homology at amino acid level. The movement protein gene was 615 bp and codes for 205 amino acids. The MP gene sequence analysis showed that it has 94-97% homology at nucleotide level and 92-95% at aminoacid level. Chilli (Capsicum annuum), the important commercial vegetable/spice of Himachal Pradesh, is affected by several viral diseases; of them Cucumo, Tospo, Poty and Gemini viruses are the most common genera. However, these viruses are not identified clearly and characterized fully, which are foremost needed to formulate the management strategy. Therefore, in the present study, effort has been made to identify and characterize the important viruses causing diseases in chilli. In this study, several farms in major chilli growing areas of Bilaspur and Kangra districts in Himachal Pradesh were surveyed and infected plant samples were collected randomly. Virus infection in these samples were detected by DAS-ELISA using antisera to Cucumber mosaic virus (CMV) and potyvirus (group specific) and through slot-blot hybridization (SBH) using CMV, Iris severe mosaic poty virus (ISMV), Tomato spotted wilt tospo virus (TSWV) and Chilli leaf curl gemini virus (CLCuV). Based on DAS-ELISA and SBH, the incidence of disease was estimated and ranged from 18.2 to 21.8% by CMV and 3.5 to 5.4% by potyvirus. To detect Tospo and Geminivirus in the infected chilli, SBH test was carried out. Infected samples showed maximum virus titer in both DAS-ELISA and SBH test were further confirmed by PCR using specific primers. Desired sizes of amplicons; *540 bp, *800 bp, *570 bp and *460 bp of CMV, Poty, Gemini and Tospo viruses, respectively, were obtained. As the present study clearly indicated that CMV appeared as a major one among the viruses infecting chilli in the hilly region of Himachal Pradesh, two isolates of CMV were characterized in genetic level. Thus the amplified products (*540 bp) of CMV, Palampur 1 and Palampur 2 were cloned in pGEMT cloning vector, sequenced and the sequences were submitted to NCBI database (Palampur 1: Acc-FM209497 and Palampur 2: Acc-FM209498). The sequences were then analyzed and compared with other sequences available in the data base. Based on sequence analysis, it was found that present CMV isolates shared 99% nucleotide identity between them, are closely related with Australian CMV isolate CMV-Ly (Acc-AF198103) by 98% nucleotide identity. In phylogenetic tree analysis, it was observed that Indian CMV isolates formed same cluster along with CMV-Ly. As it is known that CMV subgroup II comprises CMV-Ly, it is concluded that the CMVs of this hilly region of Himachal Pradesh belong to subgroup II. Chilli is essentially a crop of the tropics and grows better in hotter regions. Chlii (Capsicum annuum), a member of family solanaceae is an important vegetable and spice crop of immense commercial importance. The pungency in pepper is due to an alkaloid known as capsaicine and peppers are characterized as sweet, hot or mild depending on capsaicine content. The present investigation were conducted to find out the highly resistant cultivars of Capsicum annuum against CMV and TYLCV among ten cultivars of chilli in agroclimatic condition of Aligarh. The highest (70 and 80) percentage of infection was observed in HC-201 and Kalyanpur type-1 by showing the positive reaction to CMV by ELISA test. No symptoms was recorded in case of BC-16, LCA-235 and JCA-154 and showed negative reaction to CMV by ELISA. BC-16 and LCA-235 also showed negative reaction to TYLCV by ELISA and these were symptomless. Maximum infection (70 and 80) was registered in HC-201 and C 8 , cultivar. So, the BC-16, LCA-235 and JCA-154 has proved highly resistant varieties against CMV and TYLCV and these may be used in breeding programmes against viruses. Cotton leaf curl virus belongs to the family Geminiviridae, genus Begomovirus. The members of this family contain circular single stranded DNA molecules as their genomes. There are two kinds of begomoviruses-bipartite viruses with genomes consisting of two DNA molecules designated DNA-A and DNA-B and the monopartite viruses which contain only DNA-A but not DNA-B. In monopartite viruses, the DNA-A is accompanied by a small circular DNA molecule called DNA-b which is essential for the development of typical disease symptoms. Cotton leaf curl virus is a monopartite virus and causes the cotton leaf curl disease which has emerged as a major disease of cotton in the Indian subcontinent. The non-structural protein AC4 of Cotton leaf curl Kokhran virus-Dabawali isolate (CLCuKV-Dab) was cloned into PGEX5X2 vector and overexpressed in BL21(DE3)PlysS E. coli cells. The overexpressed GST-AC4 protein was purified by glutathione Sepharose chromatography. The purified GST-AC4 protein was found to possess ATPase activity. The optimum temperature and pH for the activity were 37°C and 7.4 respectively. The ATPase activity was inhibited in presence of EDTA, showing that it is dependent on divalent metal ions. The activity was supported by magnesium, manganese and zinc ions but inhibited in presence of calcium ions. It was also inhibited by the non-hydrolyzable ATP analogue adenosine-b, c-imido triphosphate and in the presence of other nucleotides like CTP and GTP. The K m and the V max of the reaction for ATP as the substrate are 1.54 mM and 95.2 nmol/min/ mg of the protein respectively. The enzyme could also utilize GTP as the substrate. The fact that AC4 is specifically an NTPase and not a general phosphatase is revealed by the finding that it does not hydrolyze p-Nitrophenyl phosphate to yield yellow colour while a similar reaction carried out in parallel with alkaline phosphatase readily yields the colour. It has been suggested earlier that AC4 may be involved in cell to cell movement of the virus (Rojas et al. 2001) . It is possible that by its ability to hydrolyze ATP, AC4 serves to power viral movement in the plant. Thirteen Sugarcane yellow leaf virus isolates causing yellow midrib and irregular yellow spot pattern from six states of India were characterized by RT-PCR assays. SCYLV-615F and SCYLV-615R primers were used as forward and reverse primer pairs and the amplified products were cloned and sequenced. Comparative coat protein sequence analysis confirmed that all the SCYLV-Indian isolates were clustered into two major groups confirming the existence of two strains of SCYLV affecting sugarcane crops of India. In a separate experiment, the member of both of the phylogenetic groups were found to be transmitted by the sugarcane aphid, Melanaphis sacchari from infected to healthy sugarcane suggesting its secondary spread in nature. The symptoms produced by the virus causing cotton mosaic disease were little bit different in both sap inoculation and under natural field condition. In natural field condition it has shown clear chlorosis type of symptoms on major leaves of plants but in sap inoculated plants veinal chlorosis and mosaic type of symptoms are found to be common. In field conditions infected plants grows erect and have less boll formation. There is no effect found on seed shape or seed size. The initial symptoms produced on cotton leaves after inoculation were wonderful. Local lesions observed in second week from inoculation and then they changes to chlorotic type of symptoms and some are necrotic symptoms also. The plants at early stage are found to be affected, has less lateral branch development and hence reduction in yield production. The naturally field infected plants showing good symptoms are also difficult to identify in lateral stage of plant. Because they disappear with time. The virus is very easily sap transmissible. The virus is found to be transmitted by Thrips palmi and Thrips tobacci in persistent manner. No seed transmission is observed. Virus showed same physical properties as it shows in stem necrosis of peanut or sunflower necrosis disease. The physical properties are found to be thermal inactivation point (TIP) 55-60°C, dilution end point (DEP) 10 -2 to 10 -3 and longevity in vitro (LIV) 5 h, virus infecting nineteen different host plants are identified belonging to five different types of families viz. malvaceae, chenopodiaceae, compositae, leguminaceae and solanaceae. However they found to produce same types of symptoms as in most of the host that have been tested before. In ELISA test report it is found that the virus showing positive test only with anti serum of TSV of a cowpea and cotton but negative reaction with PBNV of cowpea and cotton which clearly denied possibility of presence of PBNV in cotton producing these kinds of symptoms ELISA report clearly shows that TSV antiserum of cowpea is showing positive results with clear chlorotic types of symptoms. A powerful approach to functional genomics, and an alternative to the massive generation of transgenic plants, is the use of the recently described Virus Induced Gene Silencing (VIGS) process, which allows viral vectors to knock out the function of a gene-of-interest. VIGS is based on a silencing mechanism that regulates gene expression by the specific degradation of RNA. As a tool for reverse genetics, VIGS has many advantages over other common ways to study gene function because of the ability of viruses to replicate and move systemically within a plant. VIGS can generate a phenocopy of a mutant without all the troubles of traditional methods of mutagenesis. Geminiviruses with their small DNA genomes and ease of inoculation through agrobacterium, are excellent candidates for VIGS vector development. As a first step, the geminivirus Bhendi yellow vein mosaic virus, characterized in our lab (Jose and Usha, Virology 305: [310] [311] [312] [313] [314] [315] [316] [317] 2003) has been chosen. The satellite b DNA associated with this virus has a single open reading frame (bC1). bC1 is essential for symptom development but not for replication. Therefore, bC1 has been replaced by a multiple cloning site harbouring SalI, XbaI, BamHI, BsrGI and XhoI, initially in a cloning vector and then in the binary vector containing the partial tandem repeat of the b DNA. In the place of the bC1 ORF, the plant Phytoene desaturase gene has been cloned and the resulting construct was used for agroinfiltration along with the partial tandem repeat clone of the begomovirus (DNA A component Chilli (Capsicum annuum L.) plants exhibiting prominent symptoms of begomovirus like: leaf curl, vein swelling, shortening of petioles, crowding of leaves and stunting of plants were collected from Rorkee, Uttarakhand and Dhaulpur, Rajasthan, India. Total genomic DNA was isolated from naturally infected chilli samples and PCR was carried out with Coat Protein (located in DNA-A) gene specific primers. As expected to the primers, *800 bp DNA fragments were amplified from the infected chilli samples. To know the bipartite nature of the virus isolates, Nuclear Shuttle Protein (located in DNA-B) gene specific primers were employed which also resulted in positive amplification of *850 bp DNA bands with all the Coat Protein tested positive samples. To ascertain the association of DNAb component with the virus isolates, a set of DNA-b specific primers were used which resulted in positive amplification of full length (*1.3 kb) DNA bands in the chilli samples collected from Rorkee, Uttarakhand, however, multiple sizes bands were resulted with the samples collected from Dhaulpur, Rajasthan. These findings confirmed that both the virus isolates under study are bipartite begomovirus associated with DNA-b satellite. The sequencing of the PCR products is under progress which analysis will be discussed. Groundnut bud necrosis virus (GBNV) belonging to the genus Tospovirus, which is a unique member of the family Bunyaviridae, infects several economically important crops. The virus has three genomic ssRNA segments namely S (ambisense), M (ambisense) and L (negative sense). The S RNA codes for Nucleoprotein (NP) and Non-Structural protein (NSs) from viral complimentary and viral strands respectively. Many viral nonstructural proteins such as NS3 of Hepatitis C virus, Yellow fever virus, Dengue virus, SV40 large T antigen and cytoplasmic inclusion protein of Tamarillo mosaic potyvirus are known to exhibit RNA/DNA stimulated NTPase, dNTPase and helicase activity. NSs of GBNV does not have any sequence similarity with any of the above mentioned viral RNA/DNA helicases but has a NTP binding domain. However, it has been implicated as suppressor of gene silencing in vivo. With a view to elucidate the mechanism by which NSs could act as a suppressor of gene silencing and examine the other potential roles of NSs in the life cycle of the virus, the GBNV (To) NSs was over-expressed in E. coli and purified by Ni-NTA chromatography. In vitro studies with the purified rNSs suggest that it exhibits an RNA stimulated NTPase activity. Many of the proteins that possess the RNA/ DNA stimulated NTPase and dATPase activity, are also shown to have ATP dependent nucleic acid unwinding activity. It was therefore of interest to examine whether NSs has the nucleic acid unwinding activity. The helicase assays revealed that NSs has DNA/RNA helicase activity. Helicase activity of NSs was absolutely dependent on ATP and Mg 2? ion. NSs could unwind dsDNA substrate with 5 0 overhang, or 3 0 overhang. Mutation of the crucial lysine in Walker motif A (K189) severely affected the unwinding activity where as mutation of aspartate residue in Walker motif B (D159) resulted in only 20% loss of activity. In this regard, rNSs is a unique enzyme which does not have the canonical helicase motifs but can catalyze dsDNA/dsRNA unwinding in an ATP and Mg 2? dependent manner. The rNSs might act as a suppressor of by unwinding the dsRNA, the substrate for DICER. In addition to being a suppressor of PTGS, NSs may also regulate the viral replication and transcription by modulating the secondary structure of the viral genome. This new research finding on NSs might pave way for further studies on its role in viral replication and transcription. Yellow vein mosaic disease of pumpkin (Cucurbita moschata) poses a serious threat to the cultivation of this crop in India. The disease was found to be associated with whitefly-transmitted bipartite begomoviruses were detected in Varanasi field using polymerase chain reaction (PCR) with primer design through coat protein conserved region of begomoviruses from NCBI database. All plant samples showing symptoms were infected with begomovirus. The virus species were provisionally identified by sequencing *750 bp of the viral coat protein gene (AV1 Ageratum conyzoides is commonly known as Billygoat-weed, Chick weed, Goatweed and Whiteweed. In India it is popularly known as bill goat weed. It is an annual herbaceous plant with a long history of traditional medicinal uses in several countries of the world and also reputed to possess varied medicinal properties including the treatment of wounds and burns. In Cameroon and Congo, it is used traditionally to treat fever, rheumatism, headache, and colic. During survey in and around Gorakhpur in 2009, Ageratum plants were found affected with the symptoms of leaf curling, mosaic mottling and leaf yellows. The infected leaf samples were processed for virus identification and association with PCR assays. Total DNA was extracted and PCR were performed with Begomovirus specific primers (TLCV-CP). A *800 bp band was consistently amplified on 1% agarose. The PCR products were directly sequenced and sequence was submitted in GenBank with the accession no. GQ412352. The blast search analysis showed highest similarity of 98% with the Ageratum enation virus. Vernonia cinerea leaves with yellow vein symptoms were collected around crop fields in Madurai. A 550 bp product amplified from total DNA extracted from symptomatic leaves with degenerate primers designed to amplify a part of the AV1 gene from begomoviral DNA A component was cloned and sequenced. Based on the above sequences, specific primers were designed and the full length DNA A of 2745 nucleotides with typical genome organization of begomoviral DNA A was obtained and was submitted to EMBL data base (Acc No: AM182232). The sequence comparison with other begomoviruses revealed the closest identity (83%) with Emilia yellow vein virus from China and less than 80% with all known begomoviruses. The International Committee on Taxonomy of Viruses (ICTV) has therefore recognized Vernonia yellow vein virus (VYVV) as a distinct begomovirus species. Conventional PCR could not amplify the DNA B or DNA b from the infected tissue. However, the b DNA (1364 bp) associated with the disease was obtained (Acc No: FN435836) by the Rolling circle amplification-Restriction fragment length polymorphism method (RCA-RFLP) using Phi29 DNA polymerase. Sequence analysis shows that DNA b of VYVV has the highest identity (81%) with DNA b of Ageratum leaf curl disease and 58-77% with the b DNA associated with other begomoviruses. Infectious clones of VYVV DNA A and DNA b as dimers were made using the products of RCA-RFLP. These infectious clones will be used for agroinfection of Vernonia and the results will be discussed. This is the first report of the molecular characterization of Vernonia yellow vein virus (VYVV) from Vernonia cinerea in India. Production of bulb and seed crop of onion (Allium cepa L.) is hampered by onion yellow dwarf virus (OYDV) and iris yellow spot virus (IYSV) with an incidence of 83.22% and 89.97% in bulb crop and 90.65% and 89.58% in seed crop, respectively in the popularly grown cv. Hisar-2. Four symptom-based variants of OYDV designated as Grade A, B, C and D produced varied types of symptoms in onion crop incurring heavy losses in bulb and seed production. IYSV caused tiny hay coloured spots of different shapes and sizes on leaves and scapes which later coalesced and led to drying and lodging of scapes. The plant height, bulb weight and bulb size were 37.7 cm, 75.5 g and 24.2 cm 2 in plants infected with OYDV, 39.6 cm, 79.7 g and 25.5 cm 2 in IYSV infection, 35.1 cm, 68.4 g and 22.1 cm 2 due to their combined infection, as compared to 40.6 cm, 88.4 g and 27.6 cm 2 respectively, in healthy plants of bulb crop. In plants infected with OYDV Grade A the plant height was minimum (90.33 cm) whereas the number of umbels was maximum (9.20 umbels/pl.) but other yield parameters viz., weight/umbel (2.32 g), number of seeds/umbel (209), seed weight/umbel (0.64 g) and seed yield/plant (5.88 g) were recorded to be the lowest. The minimum reduction in plant height (100.26 cm), weight/umbel (6.72 g), number of seeds/umbel (633), seed weight/umbel (2.36 g) and seed yield/plant (11.90 g) were recorded in OYDV Grade D. The plant height was 98.84 cm with 5.10 umbels per plant, 4.24 g weight/umbel, 428 seeds/umbel, 1.25 g seed weight/umbel and 6.37 g seed yield/plant in IYSV infected plants. The plant height (96.26 cm), umbels/plant (5.97), weight/umbel (4.60 g), number of seeds/umbel (432), seed weight/umbel (1.42 g) and seed yield/plant (7.82 g) were found to be the lowest in combined infection of OYDV and IYSV diseases in comparison to higher values in healthy controls (104.50 cm, 4.90, 7.84 g, 677, 2.60 g, 12.74 g, respectively). A minimum reduction in the test weight, germination and seed vigour index were found (3.06 g, 75.68% and 926) due to OYDV grade A infection, whereas these were 2.92 g, 70.42% and 788 in IYSV disease infected plants and 2.62 g, 70.4% and 776 in combined infection of OYDV and IYSV diseases in comparison to 3.84 g, 88.67% and 1276 in healthy plants. The maximum hampering of seed vigour parameters was recorded due to IYSV infection. Lodging of scapes caused by this disease was responsible for heavy losses in seed production and seed quality. Cotton leaf curl disease is one of the major threats to cotton cultivation from Northern India. Survey conducted during 2009, observed the disease incidence ranged from 70 to 90% from Bhatinda, Abohar, Fazilka, Sri ganganagar, Hanumanghar. In order to study genetic variability in the virus, twelve CLCuV isolates were partially characterized (700 bp common region, full length AV2 gene and partial sequences of AC1 and AV1 gene). Full length characterization of representative isolates from Bhatinda, Abohar, Fazilka, Sri ganganagar, Hanumanghar is under progress. Partial sequence analysis of CLCuV isolates revealed that, the virus isolates collected during 2009 cropping season are closely related to Cotton leaf curl Burewala virus from Pakistan and results were discussed.

Pratibha Singh, H. S. Savithri Department of Biochemistry, Indian Institute of Science, Bangalore Tospoviruses, belonging to the family Bunyavirideae, infect economically important plants such as groundnut, tomato, watermelon etc. They have a tripartite genome, with L, M and S segments of RNA, in pseudo circular (panhandle) form. The viral genomes encode four structural proteins (L, N, G1 and G2) in the antisense orientation, and two non structural proteins NSs and NSm in the sense orientation. The NSm is the only protein unique to Tospoviruseses that infect plants in the bunyaviridae family and hence is proposed to be important for cell to cell movement. Ground nut bud necrosis virus (GBNV), a member of the tospovirus genus, is the most prevalent virus infecting several species of Leguminosae and Solanaceae plants in India. Total RNA was isolated from GBNV infected tomato leaves and RT-PCR was performed using appropriate primers to amplify the NSm gene. The PCR product was cloned in pGEX5X2 vector. The recombinant NSm clone was transformed into Bl21 (DE3) E. coli cells and over-expressed by induction with 0.3 mM IPTG. SDS-PAGE analysis of induced and uninduced fraction revealed the presence of overexpressed protein of expected size. The soluble GST-NSm was purified by GSH Sepharose affinity chromatography. Purified GST-NSm was shown to interact with in vitro transcribed RNA transcript by electrophoretic mobility shift assay. Further NSm was shown to interact with viral encoded proteins NP and NSs using ELISA and yeast two hybrid system. NSm was also shown to be phosphorylated in vitro by pellet fraction of plant sap. Thus the recombinant GBNV Nsm possesses the characteristic features of a movement protein such as nucleic acid binding, interaction with nucleocapsid protein, and ability to undergo posttranslational modification. Solanum melongena, commonly called as Egg plant is one of the most important vegetable crop in the world. It is cultivated widely in the tropical and sub tropical regions. Several viruses such as Cucumber mosaic cucumo virus (CMV), Potato virus-Y (PVY), Potato virus-X (PVX) and Tobacco ring spot virus (TRSV) infect egg plant under natural conditions. In India major crop losses due to CMV infection in brinjal is 57% (FAO STAT-2008) . In the present study the infected leaf samples were collected from local fields of Ramapuram, Chandamama palli, Chandragiri, Madanapalli, Yadhamari, Durgasamudram villages in and around Tirupati, were tested for CMV infection by DAC-ELISA with CMV antisera. The resulting positive samples were further inoculated to the raised brinjal seedlings of selected varieties through mechanical sap inoculation. Different varieties of brinjal like Mullabadhine, Ankhur, Ravya, Mattigulla, Casper and Easter egg were used for monitoring the susceptibility to CMV infection. The mosaic symptoms were observed after 2 weeks of inoculation in all varities of brinjal except Mullabadhina. Among all these susceptible varities Ankhur variety is selected to study induced biochemical changes such as Chlorophylls, Carbohydrates, Proteins, Nucleic acids and Polyphenol oxidases in CMV infected brinjal leaves. In the infected leaves considerable reduction in chlorophyll and starch and increase in total Proteins, Sugars, RNA and Polyphenol oxidases was observed when compared to healthy leaves. The amount of total Starch, protein and DNA decreased to about 25, 136 and 645 lg/g respectively in infected leaves, where as sugars (75 lg/g), RNA content (754 lg/g) and Polyphenol oxidase activity was increased as compared to healthy leaves. The above results suggests that there is an altered concentrations of chlorophyll, proteins, nucleic acids, carbohydrates and Polyphenol oxidase activity in the brinjal leaves due to the effect of Cucumber mosaic cucumo virus infection. Leaf analysis was found to be used as widely accepted diagnostic tool to assess the nutritional status of the vegetables. The present study deals with these aspects in detail. The total RNA and DNA was isolated from infected leaf samples. RT-PCR assays were performed using Sugarcane yellow leaf virus (SCYLV) specific primers (SCYLV-615F and SCYLV-615R). The infection of SCYLV was detected in all the collected samples, which showed the expected size (*610 bp) amplicon during RT-PCR. In another experiment with nested PCR analysis, a phytoplasma characteristic 1.2 kb rDNA PCR product were amplified from DNAs of all infected samples but not in healthy sugarcane plants tested using phytoplasma universal primer pairs P1/P7 and fU3/rU5. DNA extracts from plants with yellow mid rib and leaf yellows produced products of 1250 bp, which gave typical phytoplasma profiles when digested with Hae III and Hha I. No PCR amplifications were produced using DNA from symptomless plants. Our results suggest that the yellow mid rib and leaf yellows symptoms on sugarcane varieties in Uttar Pradesh and Uttarakhand states of India exhibiting midrib yellowing and leaf yellows symptoms is mainly caused by mixed infection of SCYLV and SCYLP. The affected clumps showed reduction in stalk height as compared to healthy fields. Thirty-one sugarcane mosaic isolates belonged to Sugarcane mosaic virus (SCMV) and Sugarcane streak mosaic virus (SCSMV were collected from China and India), confirmed in indirect ELISA and RT-PCR amplification with SCMV and SCSMV-specific primers. The amplicons (0.8 kb) from the coding region of coat protein (CP) were cloned, sequenced and compared to each other as well as to the sequences of 15 SCMV isolates from sugarcane (Australia, USA, China, Brazil, Mexico and South Africa), maize (Australia, China, Iranian) and one SCSMV isolate from sugarcane (India) in Genbank. Maximum likelihood and maximum parsimony analyses robustly supported two major monophyletic groups that were correlated with the host of origin: the SCMV subgroup that included 18 isolates from China and only 13 isolates from India, and the SCSMV subgroup that contained all isolates from India. Maize dwarf mosaic virus (MDMV) and Johnsongrass mosaic virus (JGMV) were not detected in any of the samples tested. A strong correlation was observed between the sugarcane groups and the geographical origin of the SCMV isolates. The 11 millable sugarcane samples from China contained a virus tentatively described as Sorghum mosaic virus (SrMV). Three isolates from nine chewing canes in Fujian, Yunnan and Guizhou provinces of China also contained SrMV, and the other 12 samples including five isolates from India was found infected with SCMV. No SrMV infection has been detected in sugarcane mosaic samples from India. Sequence comparisons and phylogenetic analysis indicated that SrMV can be considered as the most common and prevalent potyvirus infecting sugarcane in China, however in India Sugarcane streak mosaic virus is dominant in causing mosaic symptoms on sugarcane. DIG-labeled DNA probe complementary to coat protein (CP) region of Tobacco streak virus (TSV) Sunflower isolate was designed for the sensitive and broad-spectrum detection of TSV isolates, the most devastating virus in India. Dot-blot and tissue print hybridizations with the digoxigenin labeled probe were performed for the TSV detection at field levels. Here, dot-blot hybridization was used to check a wide number of TSV isolates with a single probe and sensitivity with different sample extraction methods. The probe with CP conserved region prepared from sunflower PCR amplicon was hybridized with the TSV field isolates of Gherkin, Pumpkin, Sunflower, Marigold and Globe amaranth samples because of highly conserved with little variability in CP region. The sensitivity limits were decreased from total nucleic acid to partially purified and crude extract preparations. In particular, tissue blot hybridization offers a simple, reliable procedure as dot-blot, but requires no sample processing. Because there is minimal sample preparation, tissue-print hybridization could be an important component of TSV management programs. Thus, the above non-radioactive labeled probe techniques can facilitate in screening the samples during TSV outbreaks and in quarantine services.

Savita Patil, Rupali Sawant*, K. Banerjee Virology Group, Agharkar Research Institute, MACS, G.G. Agarkar Road, Pune 411 004 Two Mycobacterium smegmatis strains (ARI Lab Nos. V842 and V946) were employed for the isolation of mycobacteriophages from soil and sewage samples. Mycobacteriophages were isolated from soil samples collected from an area surrounding the Tuberculosis (TB) ward, Naidu hospital, Pune, against M. smegmatis strain V842. These were numbered as V942, V943 and V944 and were isolated by using washed-cell preparation method. The Bacteriophages against the other M. smegmatis strain, i.e. V946, were isolated from soil samples (collected from around TB ward, Sassoon hospital, Pune). Some of these phages (viz.V953, V954) showed plaques at 42°C but not at 37°C. Thus they seem to be lysogenic. For propagating and increasing the titre of all the above isolates, various previously described methods were attempted, but none of these methods were satisfactory. But when siliconized glassware and plastic-ware were used, propagation was successful. We showed that siliconization of glassware and plastic-ware was essential for the propagation of our mycobacteriophage isolates V951, V952, V953, V954 and V955. Also, phage dilution medium (PDM) as described by Chaterjee et al. (2000) was found to be effective for picking out of the plaques made by the phages. In this way, the phage isolates were propagated up to P 3 . The various passages of the phage isolates V951, V952, V953, V954 and V955 (i.e. original, P 1 , P 2 and P 3 ) were stored at -80°C.

PVP-29 Effect on Pigments Due to Geminivirus Infection on Cowpea (Vigna unguiculata) Shail Pande*, Naveen Pandey, K. Shukla Mahatma Gandhi P. G. College Gorakhpur, D.D.U. Gorakhpur University, Gorakhpur

Geminiviruses are one of the most important group of viruses causing economic losses in tropics. The symptom produced are yellowing of leaves which directly affect the pigments of diseased plants it in turn affects productivity and yield of diseased plant. Cowpea Vigna unguiculata is one of the important crop cultivated throughout India for its green pods which are used as vegetables and seeds are used as pulse. Cowpea is affected by many viruses amongst them geminiviruses are one of the important virus on the cowpea plant. In the present study total chlorophyll content was studied in leaf of cowpea of diseased and healthy plants using Arnon's method. Carotenoids were also studied using Ikan's method. It was found that chlorophyll content in diseased plants were lower compared to healthy plant similar results were found with carotenoids so the geminivirruses infection lowers the chlorophyll and carotenoid content in diseased plants which reduces yield of diseased cowpea plant.

Shweta Sharma 1 , Amrita Banerjee 2 , J. Tarafdar 2 , R. Rabindran 3 , Indranil Dasgupta 1 * 1 Department of Plant Molecular Biology, University of Delhi, South Campus, New Delhi; 2 Bidhan Chandra Krishi Vishwavidayalaya, Kalyani, Nadia, West Bengal 741235; 3 Tamil Nadu Agricultural University, Coimbatore, Tamil Nadu 641003 Rice tungro disease is an important disease of rice, caused by a joint infection by two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV) in South and Southeast Asia. The complex of RTBV and RTSV is transmitted by an insect vector Green Leaf Hopper (GLH). Previously we reported complete genomic sequences of two geographically distinct isolates of RTBV; RTBV-WB (West Bengal) and RTBV-AP (Andhra Pradesh) collected from the field in mid-1990s. Both the sequences showed high homology all along the genome but showed divergence from previously reported Southeast Asian isolate i.e. RTBV-Phil (Philippines). To check whether a time period of a decade has resulted into variability in the genomic sequence of different isolates of RTBV in India, we cloned and sequenced the complete genome of RTBV from two geographically distinct regions of India i.e. West Bengal and Kanyakumari collected from the field in 2008. The complete nucleotide sequence of the DNA fragments covering the whole genome of RTBV was determined using universal primers M13F and M13R and by Primer walking, without any ambiguities remaining. The nucleotide sequences of overlapping clones were assembled and analyzed using the DNA analysis software GENERUNNER and BLASTn program of NCBI. Homology search at the nucleotide and amino acid level were performed using the BLASTn and BLASTp (respectively) programs of NCBI. Multiple sequence alignments were performed using CLUS-TAL-W software. Sequence analysis results thus obtained showed that both the recently obtained complete genomic sequences of RTBV from two geographically distinct regions of India i.e. West Bengal and Kanyakumari showed very high homology (both at the nucleotide and amino acid levels) with the two previously reported RTBV isolates from India i.e. RTBV-WB (West Bengal) and RTBV-AP (Andhra Pradesh) all along the genome. As observed earlier both the sequences diverged significantly from the Southeast Asian isolates. This suggests that even after the spatial and temporal difference (a time gap of approx 10 years) between the two previously reported RTBV isolates and the recently reported one, there is very little sequence variability between them. This further strengthens the earlier reports that the RTBV genomes in India are highly conserved. Homology search at the nucleotide level using BLASTn program with the previously existing RTBV isolates revealed a very high percentage identity of 99% with the RTBV West Bengal isolate and 95% with the RTBV Andhra Pradesh isolate. This further strengthens the earlier reports that there is not much genetic variability in the RTBV genomes in Indian subcontinent. Complete genomic RNA sequences of two geographically distinct isolates of Rice tungro spherical virus (RTSV), a member of the genus Waikavirus, family Sequiviridae, were determined from India. Out of the two previously reported sequences, the Indian isolates were closer to the resistance breaking strain RTSV-[Vt6] than RTSV- [PhilA] . Between them, the Indian sequences showed nucleotide as well as amino acid identities of 96%. A moderate homology was observed between the leader peptide and a putative helper component protein involved in insect transmission of the Maize chlorotic dwarf virus, a closely related waikavirus, indicating its possible transmission-related function. Unlike Rice tungro bacilliform virus, which causes Rice tungro disease jointly with RTSV, and is significantly different between isolates from India and Philippines, RTSV genomes were observed to be much more conserved between isolates from the two countries. Rice tungro bacilliform virus (RTBV) are believed to be the joint causative agents for the devastating tungro disease of rice prevalent in South and Southeast Asia [11] . Rice tungro disease has become the major cause of production losses in rice during last three decades in several rice growing states of India. Here, we report, for the first time the complete sequence analysis of two geographically distinct Indian isolates of RTSV. We analyze the deduced protein sequences and their phylogenetic relationship with the two complete RTSV sequences from Philippines as well as with other members of Sequiviridae family. We provide molecular evidence that the Indian isolates of RTSV are closely related to those from the Philippines. We had earlier reported that RTBV isolates between India and Philippines differ significantly from each other [18] . This study was undertaken in order to see whether RTSV isolates from India also show similar difference from those reported from The Philippines. Frequent outbreaks of tungro were reported near Kanyakumari in the last 2-3 years. The present work was undertaken to clone and sequence the full-length RTBV and RTSV genomes from the infected rice plants collected from above region and to analyze the similarity of its genetic material with the existing Indian isolates of RTBV and RTSV. A 1.1 kb DNA fragment encoding the Reverse transcriptase gene of RTBV genome was amplified and cloned in T/A vector and was sequenced commercially. Homology search at the nucleotide level using BLASTn program with the previously existing RTBV isolates revealed a very high percentage identity of 99% with the RTBV West Bengal isolate and 95% with the RTBV Andhra Pradesh isolate. This further strengthens the earlier reports that there is not much genetic variability in the RTBV genomes in Indian subcontinent. Similarly, the CP3 region of RTSV was amplified by RT-PCR and was cloned in T/A vector. Recently, rice tungro disease has been reported from Kanyakumari district of Tamil Nadu. It is important to determine the genetic nature of this isolate in order to develop resistance strategies. It is thus necessary to clone and characterize the viruses from Kanyakumari and to determine the mechanism of virus resistance in transgenic lines. Rice tungro disease is an important viral disease of rice. Rice tungro is caused by infection by two viruses: Rice tungro bacilliform virus (RTBV) and Rice tungro spherical virus (RTSV). RTSV is a plant picornavirus with a 12 kb single stranded RNA genome. It belongs to genus Waikavirus in the family Sequiviridae and is necessary for transmission of the two viruses by the leafhopper vector Nephotellix virescens. RTSV RNA is translated to form a large polyprotein, which is then self cleaved to form the viral proteins, including the three coat proteins, replicase, protease. Studies have been conducted on RTSV from Philippines. Correct information of sequence variability of viral isolates to check whether different geographical conditions like those present in India select for genotypically variable strain and to design for transgenic resistance strategy, information on RTSV from India is absolutely essential. The objective of this study was to clone RTSV isolates from India and compare the genetic diversity of Indian isolates from other Southeast Asian isolates and amongst each other. Also develop strategy to impair the attack of virus-complex on rice. The achieve this, complete genomes of two isolates from India were cloned by amplifying different genes by RT-PCR and subsequently cloned in TA vectors, followed by sequencing. Subsequently constructs containing CP1-3, antisense Replicase, sense Replicase and double stranded Replicase were cloned in plant transformation vector. These constructs were used to transform aromatic rice variety from Indian-Pusa Basmati (PB1). PCR analysis of the above plants was done to check the stable insertion of insert in the transgenics. Jatropha (Jatropha curcas) of the family Euphorbiaceae is being grown in India as a major commercial fuel (bio-diesel) crop. Jatropha is cultivated in 200 districts of 19 potential states of India. Unfortunately, the cultivation of Jatropha is limited by the severe mosaic disease. Recently, a severe mosaic disease with significant disease incidence was observed in 2006-2009 on J. curcas grown in experimental plots of NBRI and J. gossypifolia, a weed growing road side around Lucknow and Kathaupahadi, Madhya Pradesh. The disease consisted of the symptoms of severe mosaic, blistering, leaf distortion and stunting of whole plant and no fruit/seed production in severely affected plants. Symptomatology and whitefly population observed on them suggested the occurrence of Begomovirus infection. To detect the begomovirus infection, the total DNA from leaf samples of infected Jatropha plants was extracted and polymerase chain reaction (PCR) were performed using three sets of begomovirus genus specific (CPIT-I/CPIT-T, PALIv 1978/PARIc 496 and PALIv 722/PALIc 1960) primers and the expected size *800 bp, 1.2 kb and 1.2 kb amplicons were obtained which confirmed the begomovirus infection. Further to identify the begomovirus/es and investigate the genetic diversity among them exists if any, the *1.2 kb amplicons were cloned and sequenced. The sequence data were deposited in the GenBank database under accession nos.: GQ847545 and FJ346232 (from J. curcas) and EU727086 and FJ177030 (from J. gossypifolia). During BLAST analysis GQ847545 and FJ346232 shared highest 95% sequence identity with each other and 84-88%% with Sri Lankan cassava mosaic virus (AJ579307, AJ607394, AJ890225, AJ89 0229 and AJ890224) and Indian cassava mosaic virus from India (AY738105) therefore, designated as two strains of Jatropha mosaic India virus-Lucknow. BLAST analysis of EU727086 showed maximum 93% similarities with Croton yellow vein mosaic virus (AJ507777), 82% with Tomato leaf curl New Delhi virus (DQ629102) and 80-79% with Papaya leaf curl virus (AJ436992 and Y15934), therefore, identified as strain of Croton yellow vein mosaic virus. BLAST analysis of the virus isolate (FJ177030) showed highest 83% identities with Tomato leaf curl virus-Bangalore II (ToLCV-B II-U38239) and 82-81% with Tomato leaf curl Karnataka virus (ToL-CKV, AY754812, FJ514798), therefore, considered as new begomovirus species ''Jatropha yellow mosaic India virus''. The phylogenetic analysis of GQ847545 and FJ346232 (from J. curcas) and EU727086 and FJ177030 (from J. gossypifolia) was performed along with some selected isolates of begomovirus which showed [90% sequence identities during BLAST analysis. The isolate EU727086 showed closest relationship with Croton yellow vein mosaic virus while FJ177030 showed separate clustering of all the four begomovirus from Jatropha species. During phylogenetic analysis these isolates formed three separate clusters, therefore, they were considered as three distinct begomoviruses. The above data clearly show that some genetic diversity exists among the begomoviruses infecting Jatropha species in India. Bitter gourd (Momordica charantia L.) of the family Cucurbitaceae, also known as bitter melon is extensively cultivated in north eastern region of Uttar Pradesh, India. It is regarded as one of the world's major vegetable crops and has great economic importance. A severe yellow mosaic disease on bitter gourd (Momordica charantia) with a significant disease incidence was observed during the survey of different locations of Eastern UP, India in the year 2007. The whitefly (Bemisia tabaci) population was also observed in the vicinity. The characteristic disease symptoms and whitefly population indicated the possibility of begomovirus infection. Total DNA were isolated from infected as well as healthy leaf samples. Two primer pair (TLCV-CP and Roja's Primer) were used to study, which resulted *800 bp with TLCV-CP in 3/3 samples and *1.3 kb amplicons with Roja's primer in 3/4 samples. For further identification of the begomovirus, the PCR amplicons were cloned and sequenced (GenBank accession no. EU439260 and EU888908, respectively). The BLASTn search analysis of EU439260 indicated 99-95% identity with several isolates of Tomato leaf curl New Delhi virus (ToLCNDV). The phylogenetic analysis also showed closest relationships of the isolate (EU439260) with ToLCNDV isolates. Based on highest sequence identity and closed relationships with ToLCNDV the virus isolated from bitter gourd was considered as an isolate of Tomato leaf curl New Delhi virus. While, BLASTn search analysis of EU888908 isolate, shared highest 99-97% identites with Pepper leaf curl Bangladesh virus (PepLCBV) isolates. The phylogenetic analysis of the virus isolate with selected begomovirus isolates revealed a closest relationship with PepLCBV. These results confirmed the association of PepLCBV on bitter gourd. Study revealed the variability of viruses on bitter gourd in Eastern UP, India. Tobacco streak virus groundnut isolate was characterized biologically by taking six cultivars (JL24, TMV2, K6, K7, K9) and one pre-release culture (K1271) using seedlings of 7-84 days old under glasshouse conditions. There were clear differences were observed among cultivars tested regarding incubation period, percent seedling wilt and time taken to death of seedlings. K-7 was least susceptible among all the cultivars tested and it supported least virus titer (A 405 nm: 0.11-1.23). Both localized (necrotic lesions on leaf, veinal necrosis, leaf yellowing, wilting) and systemic (petiole necrosis, necrotic lesions on young leaves, death of top growing buds not only on main stem but also on all primaries (side shoots), followed by stem necrosis, stunted growth, axillary shoot proliferation with small leaves having general chlorosis, peg necrosis, pod necrosis, pod size reduction, wilt of plants) symptom were observed in all cultivars tested. Biological differentiation of TSV and GBNV was made by sap inoculation of both viruses separately using susceptible groundnut cultivar JL24 under glasshouse conditions. There were certain similarities and differences were observed between these viruses infecting groundnut. Seed infection of TSV ranged from 18.9 to 28.9% in seeds collected from naturally infected and sap inoculated groundnut cultivars/pre-releases (JL24, TMV2, K-6, K-7, K-9 and K-1271) belonging to spanish and virginia types. TSV was detected both in pod shell and seed testa from pod samples produced by sap inoculation under glasshouse conditions. However, seed transmission of TSV was not observed in groundnut. Coat protein (CP) gene of three groundnut TSV isolates (GN-AP-1-00; GN-AP2-04; GN-AP3-07) were sequenced and all the three isolates contained a single open reading frame (ORF) of 717 bp nucleotide and could potentially code for 238 amino acids (aa). CP gene of TSV isolates originating from different hosts shared high degree of sequence identity both at nucleotide (97.6-100%) and amino acid (95.7-100%) levels respectively. tones grown in an area of 3.83.430 ha (FAO STAT2007). In India papaya is grown in nearly 80,000 ha with an annual production of 7,00,000 tones (FAO STAT 2007) and occupies fourth place in the world. The crop is severely affected by a number of viruses. Papaya ring spot virus (PRSV-P) is the most important virus. The detection of virus infection in plants has traditionally involved either bioassay on indexing plants and or immunological methods (Hill 1981, Torrence and Jones 1981) . Use of nucleic acid probes has improved the detection and sensitivity of viruses. The most common non-radioactive probes are Biotynilated probes, which are very specific and sensitive. Papaya ring spot virus (PRSV-P) is a positive sense ssRNA virus belonging to the genus potyvirus Family potyviridae and transmitted by aphids. PRSV-P coat protein gene region was used as template cDNA for probe preparation. Dot-blot hybridization with the biotin labeled probe were performed for PRSV-P detection. The clarified sap of healthy and infected plants were serially diluted and spotted onto the nitrocellulose membrane, hybridized to biotin labeled probe. Biotin labeled RNA's are employed as probes, with a subsequent detection based on streptavidin-alkaline phosphatase conjugates. The sensitivity for viral detection of the biotin labeled probe was found to be sensitive than Enzyme Linked Immunosorbent Assay (ELISA). In recent years tospovirus is causing devastating damage to the yield of vegetables in India. It infects economically important crops viz., tomato, chilli, peppers, groundnut, watermelon and various legumes. Now it is emerging as severe disease in brinjal also. In order to monitor the natural occurrence and distribution of Tospovirus in vegetable, surveys were conducted in the predominant brinjal growing areas of Gujarat, Karnataka, Maharashtra and Andhra Pradesh during 2008-2010 incidence ranging from 5 to 10%, 0 to 80%, 1 to 40%, and 0 to 55.78% respectively. Samples collected from different places of India were found positive to PBNV in direct antigen coating-enzyme linked immunosorbent assay (DAC-ELISA). PBNV infected brinjal plants showed mosaic mottling of leaves with leaf distortion, longitudinal streaks on the stem and necrotic rings on leaves and fruits. Early infection led to severe stunting and abnormal fruiting. Biological and molecular characterization of PBNV-brinjal isolates were compared with other isolates and results are discussed. For identification of virus causing mosaic symptoms on soybean various host plants were tested. Plants species belonging to the different families viz. caricaceae, graminae, leguminosae, malvaceae and solanaceae were tested. The virus produced symptoms on diagnostic plant species like Chenopodium album, C. quinoa, Helianthus anus, Phaseolus vulgaris and Vigna ungiculata. Among tested families the leguminosae that were the host of virus included Arachis hypogea,

The virus causing mosaic symptoms in soybean is inactivated between 50 and 55°C and between dilution of 10 -4 to 10 -5 . All the inoculated plants of assay host showed the symptoms at 50°C but not at 55°C. Similarly local lesions produced at 10 -4 but not at 10 -5 . The virus in crude sap was infectious up to 72 h but not at 96 h at room temperature. However, the percentage infectivity decreased progressively as the aging of the sap was increased at room temperature. On the basis of reactions on diagnostic hosts

PVP-38 Identification and Characterization of Potyvirus Infected Chilli (Capsicul annum L

The virus under study caused mild mosaic and severe mottling symptom in leaves of infected plants. The dilution end point (DEP) of the virus was found to be 10 -3 to 10 -4 , Longevity in vitro (LIV) 1-3 days at room temperature (25°C), Thermal inactivation point (TIP) 50-55°C. Electron Microscopy of purified virus preparation revealed the presence of flexuous particle of size 780 nm long and 14 nm in width with characteristic cytoplasmic inclusions: pinwheels and scrolls. The virus was transmitted by sap and by aphid Myzus persicae. The host range study revealed that the host species were restricted to family Chenopodiaceae and Solanaceae. On the basis of above characteristic, the virus under study was identified as Potyvirus associated with mild mosaic and severe mottling symptom in Capsicum. Phytoplasma causing Grassy shoot disease and Sugarcane yellow leaf viruses are important pathogens of sugarcane. These pathogens are causing severe losses in sugarcane productivity. With a view to producing virus and phytoplasma free planting material of sugarcane, experiments were undertaken using infected varieties of sugarcane growing at the farms of Sugarcane Research Institute. Apical meristems measuring about 2 mm in length, were dissected out, surface sterilized and cultured on agar gelled Murashige and Skoog's (MS) medium containing growth regulators for shoot induction. The established shoot cultures were multiplied through repeated subcultures on fresh media at 10-12 days interval. Elimination of GSD and SCYLV was confirmed through molecular analysis of regenerated plants using specific primers of SCYLV and GSD. Results revealed that apical meristem culture technique is effective in eliminating the pathogens like SCYLV and Phytoplasma (GSD) from the infected clones. This is probably the first report on elimination of Grassy shoot disease in sugarcane through meristem culture. Papaya ringspot virus (PRSV), which causes the most widespread and devastating disease in papaya, isolates originating from different geographical regions in south India were collected and maintained on natural host papaya. The entire coat protein (CP) gene of Papaya ringspot virus-P biotype (PRSV-P) was amplified by reverse transcription-polymerase chain reaction (RT-PCR). The amplicon was inserted into pGEM-T vector by T-A cloning method, sequenced and sub cloned into a bacterial expression vector pRSET-A using directional cloning strategy. The PRSV coat protein was over expressed as fusion protein in E. coli. SDS-PAGE gel revealed that CP expressed as a *40 kDa protein. The recombinant coat protein (rCP) fused with 69 His-tag was purified from E. coli using Ni-NTA resin. The antigenicity of the fusion protein was determined by western blot analysis using antibodies raised against purified PRSV. The purified rCP was used as an antigen to produce high titer PRSV specific polyclonal antiserum. The resulting antiserum was used to develop an immunocapture reverse transcription-polymerase chain reaction (IC-RT-PCR) assay and compared its sensitivity levels with ELISA based assays for detection of PRSV isolates. IC-RT-PCR was shown to be the most sensitive test followed by dot-blot immunobinding assay (DBIA) and plate trapped ELISA.