key: cord- - hy qxa authors: dolgikh, s. title: covid- vs bcg universal immunization: statistical significance at six months of exposure date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: hy qxa with a time-adjusted dataset of covid- statistical data by reporting jurisdiction at the time point of six months after the local epidemics landfall we perform a statistical analysis of the significance of the correlation hypothesis between universal bcg immunization and milder covid- scenarios proposed in the earlier studies. with the data accumulated to date the statistical significance of the bcg immunization correlation hypothesis is evaluated both qualitatively and quantitatively with the conclusion that it has achieved a significant level of confidence. the conclusions of this research can be used in public policy as well as the rationale to investigate the nature and working of a potential broad immunity mechanism associated with an early-age bcg exposure. a possible correlation between the impact of covid- pandemics and universal immunization program against tuberculosis with bcg vaccine was proposed in [ ] and further investigated in a number of other works [ ] [ ] [ ] [ ] . in this research we compile and provide an analysis of a dataset of cases with different time of local arrival of the epidemics as defined in [ ] , adjusted and aligned at the time point of approximately six months after the first local exposure. the intent of this work was to analyze publicly available covid- epidemiological data by reporting national and subnational jurisdictions with respect to the hypothesized induced immunity population-scale protection resulting from a universal bcg vaccination policy (ubip), current or previous, and attempt both qualitative and quantitative analysis of the hypothesis of correlation between a current or previous ubip in the jurisdiction and a milder scenario of covid- epidemics; to verify the assumptions, results and conclusions of the earlier studies [ , , [ ] [ ] [ ] with a specific objective to determine, in a quantitative analysis, the constraints and confidence of the correlation and null hypotheses. the global covid- time zero time point (tz) was defined in [ ] as . . : along with the global time zero was defined local time zero point (ltz) indicating the time of arrival of the epidemics in the given locality. it can be sensibly defined as the date of the first confirmed case in the area. the impact of the epidemics was measured by covid- caused mortality per million capita in a reporting jurisdiction as a function of time: it is believed that this parameter can be a more current and accurate measure of the epidemiological impact than the number of cases that strongly depends on the testing practice, on the assumption that policies and protocols in the selected administration allow reasonably accurate identification of cause and reporting. evidently, as defined, the impact of the epidemics in a jurisdiction m(t) would be a function of the jurisdiction factors f, including demographics, geographical distribution, prosperity, social customs and traditions, lifestyle, public administration and epidemiological policy including records of universal immunization programs and not in the least, time. as the experience of the earlier period shows, the considerations of timing can be, in our view of critical importance for the correctness of the conclusions of the analysis. for that reason, an attention is given to comparing impacts relative to the time of the first exposure by using time-adjusted data at the same local time point in the development of the epidemics. throughout this work two related measures of the epidemiological impact will be used as well: relative impact mr(t) measured as a ratio of the impact recorded in the locality to the world's highest value (at the time of evaluation); and the impact expressed in logarithmic scale ml(t): at the time of this study, close to six months after the arrival to jurisdictions in the study, it is expected that the epidemics has the time to develop, and the numbers and relationships to have a more stable nature. we use qualitative methods such as case comparison, trend analysis and quantitative ones such evaluation of statistical parameters to analyze trends in development of the epidemiological situation across monitored jurisdictions with the intent to evaluate the significance of the correlation hypothesis between the impact of covid- epidemics and a record of universal bcg immunization. more specifically, the hypothesis that will be evaluated in the study is that of the early age induced broad population-wide protection effect against viral infections including covid- at a certain population-scale level (importantly to note, not necessarily a complete personal protection as in the case of regular vaccinations; and provided the immunization program was implemented consistently, with adequate quality and without significant interruptions). the hypothesis was proposed in [ ] based on the analysis of early statistical data and the earlier results in immunology suggesting a possibility of such link [ ] [ ] [ ] . to the best of our knowledge, the exact mechanism of such a protection in the immune system has yet to be determined and will be addressed elsewhere; however, a logical possibility that such an induced general immunity protection may have an influence on the epidemiological scenario via providing some level of population-wide mitigation of negative covid- impacts in our view, can be tested with the publicly available epidemiological data. to evaluate the statistical significance of the correlation hypothesis, we created groups of cases based on ubip record. this selection is blind based only on the factors of ubip policy for the jurisdiction irrespective of the current covid- impact statistics. under the null hypothesis, the cases in different groups should have no significant correlation to the outcomes and therefore, have similar distribution; whereas detecting a significant variation in the outcomes between groups can place constraints on the null hypothesis. the detailed method of evaluation of the statistical significance of the correlation hypothesis is described in section . a time-adjusted selected jurisdictions dataset was compiled from public sources with data of wave and wave [ ] cases adjusted by the time of first exposure to covid- . specifically, the dataset is comprised of the wave cases as of ~ tz + months and wave cases as of, approximately, tz + months, i.e. with approximately the same local exposure of six months. it is expected that by this stage, the epidemiological situation has developed to an expressed state in the analyzed jurisdictions. a number of criteria were applied to selecting the cases in the dataset to minimize the uncertainty factors due to vast variation of conditions among the reporting jurisdictions worldwide: . a reasonable expectation of the accuracy, consistency and timeliness of the reporting from the national public health administration; . a reasonable level of exposure to covid- , e.g. certain minimum number of reported cases and / or impact; . a compatible level of social development and specifically, certain minimum standard of public health administration with respect to universal policy administration including importantly, the quality and the coverage. the aim of these criteria is to reduce the uncertainty related to the quality of administration of mass public health policy even when such has been declared. categories of cases by the reported epidemiological impact were defined based on the logarithmic scale as follows: while the data for a number of smaller jurisdictions, with population under million was recorded in the dataset, they were not included in the statistical analysis due to higher probability of fluctuations related to unpredictable patterns of cluster development. . cc-by-nd . international license it is made available under a perpetuity. is the author/funder, who has granted medrxiv a license to display the preprint in (which was not certified by peer review) preprint the copyright holder for this this version posted september , . . https://doi.org/ . / . . . doi: medrxiv preprint bcg universal vaccination record is described by the following bands as defined in [ ] and summarized, with modifications and additions, in table : has a current ubip with some limitations or qualifications (such as a late start; inconsistencies in application practice, possible significant interruptions due to social factors and other) b had ubip in the past covering significant part of population (> %) b ; b ubip was offered for a limited time interval or specific groups; ubip practice inconsistent with the hypothesis of early age induced immunity protection for example, delivered at an older age c never had a universal bcg immunization program further notes and qualifications: . consistency and reliability of data reported by the national, regional and local health administrations. . alignment in the time of reporting may be an issue due to reporting practices of jurisdictions. . availability, consistency and reliability of historical data and statistics on the administration of immunization programs in the national, regional and so on, jurisdictions can be an issue. the case dataset can be found in the appendix. sources: [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] and others. in certain jurisdictions significant regional variability in administration of bcg vaccination can be noted, providing further information relevant to the correlation hypothesis. in the analyzed cases many social parameters, such as living standard, age distribution, social traditions and practices are similar that can be expected to exclude or mitigate the influence of such factors and provide ground for a more confident conclusions of the correlation analysis. adjusted to the same time of local exposure, the four cases of northern europe show strong correlation between covid- impact and the time of cessation of bcg uip (table ). these countries share similar levels of prosperity, lifestyle and traditions, climate that allows to eliminate many potential influencing factors. . cc-by-nd . international license it is made available under a perpetuity. is the author/funder, who has granted medrxiv a license to display the preprint in (which was not certified by peer review) preprint the copyright holder for this this version posted september , . a similar pattern can be seen in the cases of portugal (group a) and spain (group b ), with the relative impact, at the time, of . and . , respectively. these cases provide anecdotal but consistent over the period of four months [ , ] and clear support for the correlation hypothesis. in the group b, where a bcg immunization program existed but was ceased earlier, a strong correlation can be observed between the time of cessation of the ubip and the severity of covid- impact as shown in the diagram of fig. (the data is time adjusted to ltz + m): it can be pointed out that most of the cases in the analysis have similar factors of demographics, levels of prosperity and overall quality of public health administration with the trend of correlation between the time of cessation of ubip and the covid- impact can be observed clearly. the detailed data used in fig. is provided in table , appendix. . cc-by-nd . international license it is made available under a perpetuity. is the author/funder, who has granted medrxiv a license to display the preprint in (which was not certified by peer review) preprint the copyright holder for this this version posted september , . . https://doi.org/ . / . . . doi: medrxiv preprint several cases of rapid onset of covid- disease were reported in countries with a current bcg uip, including but probably not limited to, the following: brazil; mexico, india, south africa, russia, iran and possibly, others. without going into specific details of each case that can be done in another study, some general observations can be made here. as was commented previously [ ] , in the situations where universality and quality of administration of a ubip policy in the daily practice could not be ascertained, large group of population may remain without protection even with a declared universal policy. in cases where these vulnerable groups would happen to be more exposed to the infection, it is possible to see higher impact of the epidemics. the factors such as levels of poverty; quality and access to public healthcare; a record of prolonged social disorder, wars, economic collapse and similar could have compromised the administration of uip. most of the observed rapid onset cases in group a with a current ubip fall into one of these categories, though certainly a more detailed analysis of those cases is warranted. without a specific and detailed study of a jurisdiction it is not possible, in our view, to determine how essential and influential these factors can be and in this analysis we will limit ourselves to stating that given the generally available records for most if not all of such exceptions, they may not be found in a contradiction to the correlation hypothesis. delayed onset. an interesting observation that can be made about the cases in this group is ostensibly significantly delayed time from the first introduction to the onset of the epidemics. comparing the cases of the first wave in europe and far east one can observe the onset period of approximately . - months (from end of january to march , when the epidemics was in full development in the european jurisdictions) [ , ] . this can be contrasted to the development period of months and over in many cases discussed in this section: mexico, brazil, india, south africa, russia and possibly. whilst this observation at the time of writing does not have statistical significance, it can be seen as an indirect argument for the correlation hypothesis, as the possibility that the immunized part of the population delays the transmission of the epidemics to the unprotected groups. this hypothesis requires further analysis and will be addressed elsewhere. the hypothesis of induced early age immunity protection from the exposure to bcg proposed in [ ] based on a number of reports pointing at a possible association between early delivery of bcg vaccine and a broad immunity against several conditions [ ] [ ] ] . it is further supported by a study indicating a possible mechanism for increased production of immune cells in infants following vaccination with bcg [ , ] . in this section the statistical significance analysis conducted previously for the time period of ltz + months is repeated at the time point of six months after the first local . cc-by-nd . international license it is made available under a perpetuity. is the author/funder, who has granted medrxiv a license to display the preprint in (which was not certified by peer review) preprint the copyright holder for this this version posted september , . . https://doi.org/ . / . . . doi: medrxiv preprint exposure to the infection. the analysis is based on evaluation of statistical parameters such as mean and standard deviation of the epidemiological impact between groups of cases blindly selected based on the record of ubip as described in detail in [ ] . the null hypothesis in this case would dictate that immunization should carry no statistical significance for the epidemics impact, and therefore distributions in all of bcg group sample points (a, b, c) as defined above were described by a single distribution with, possibly, time-dependent parameters μ(t), σ(t) that can be estimated from the overall dataset. the basis for the analysis that follows is the observation of a strong disparity between the sample means in groups a and c as first reported in [ , , ] . under the null hypothesis, these cases should be treated as the difference between the means of randomly drawn samples of a given size, for which distribution parameters can be estimated with the sample-mean law. for further notes and explanations on the composition of the groups refer to the appendix. under the assumption of the null hypothesis all group samples would be drawn from the same distribution and the rule of sample means dictates that the means of the samples of groups a -c with the number of samples ng will be distributed with the same mean and a standard deviation as: . cc-by-nd . international license it is made available under a perpetuity. is the author/funder, who has granted medrxiv a license to display the preprint in (which was not certified by peer review) preprint the copyright holder for this this version posted september , . . https://doi.org/ . / . . . doi: medrxiv preprint where σ is the overall standard deviation of the dataset. from ( ) based on the size of each group, one can estimate sample mean standard deviations for the groups a -c samples. for the selected groups of cases, statistical parameters of the epidemiological impact distribution measured in logarithmic mortality per capita ml(case, t) were obtained from the dataset (the appendix) as shown in table . to satisfy the null hypothesis, the means of samples a -c would need to independently, satisfy the normal distribution laws with the same mean μs that can be assumed to be equal to the overall dataset mean and σg defined by ( ). then following the arguments outlined in [ ] one obtains: where the first term on the right is the probability of μa within the observed range below μs with a standard deviation σa and the second, similarly, of μc within the observed range above μs with a standard deviation σc. then from ( ) the p-value of the null hypothesis can be estimated as: ≤ ( < − . ) × ( > . ) ≈ . × − excluding the null hypothesis at a confidence level of at least − . the mean of the bsample was close to the dataset mean μs and for that reason did not contribute significantly to the p-value constraint. this result can be illustrated by a histogram of the epidemiological impact for cases in ubip groups a and c (fig. ) in the analysis above. is the author/funder, who has granted medrxiv a license to display the preprint in (which was not certified by peer review) preprint the copyright holder for this this version posted september , . . https://doi.org/ . / . . . doi: medrxiv preprint the trend of the groups a (red) and c (blue) to the different ends of the impact range (in logarithmic mortality per capita) can be seen clearly, supporting the results of the statistical significance analysis. to summarize the results of this section, if the group samples, selected blindly according to the record of ubip had no correlation with the epidemiological impact and therefore, considered as independent random samples under the null hypothesis, repeated observations of sample means as far apart as in the analyzed groups would lead to strong constraints on the p-value of the null hypothesis. with a time-adjusted dataset of epidemiological statistics for national and subnational jurisdictions at the time point of months after the first exposure statistical significance of the correlation hypothesis between the record of universal bcg vaccine immunization performed at birth or early infancy and milder covid- epidemiological scenario in the jurisdiction. the results of several qualitative observations sections . , . consistently point at a correlation between these factors. in addition to convincing, in our view, qualitative arguments in support of the correlation hypothesis, a statistical analysis of the correlation between ubip record and current epidemiological impact in section confirms statistical significance of the correlation hypothesis with a confidence of at least . . the result is consistent with the analysis of statistical significance at the time of exposure of months [ ] and increases the confidence in the overall conclusion because under the null hypothesis samples taken at different time intervals should be considered as independent as well. the findings of this research are in agreement with the earlier studies [ ] [ ] [ ] [ ] [ ] [ ] supporting the correlation hypothesis and in our view, provide a strong rationale for further research into possible mechanisms for such a broad induced protection with the potential of developing effective methods of long-term immunity against a broad range of diseases. it is hoped that time-adjusted datasets compiled in this work as the early observations obtained with it can be useful to other researchers in the field looking for effective approaches to understanding and eventually, effectively managing and controlling this and similar infectious diseases in the future. is the author/funder, who has granted medrxiv a license to display the preprint in (which was not certified by peer review) preprint the copyright holder for this this version posted september , . . the case of spain was placed in group c due to a very short duration of ubip (less than years overall) making it negligible for any hypothesized effect of population-wide protection. the same argument was applied to the case of quebec, canada. . the case of united kingdom placed in group c due to incompatibility of the ubip administration practice with the early age induced immunity hypothesis as it was administered at a school or early adolescence age [ ] . . canada, where no ubip was provided except for a short duration in the province of quebec [ ] was represented by the cases of ontario and quebec, with the highest population and epidemiological impact (two cases). . due to large population and high regional variation, united states was represented by three state cases california, florida, new york, and the overall statistics for the country (four cases). . the case of france where ubip was in place till was not included in any group due to uncertainty about the administration practice. sources provide inconsistent information about the age of administration, infancy or school age: "bcg was mandatory for school children between and " [ , ] indicating a possibility that in the least the practice was not consistent and the decision on the placement in the appropriate group could not be made without further detailed analysis. . cc-by-nd . international license it is made available under a perpetuity. is the author/funder, who has granted medrxiv a license to display the preprint in (which was not certified by peer review) preprint the copyright holder for this this version posted september , . . https://doi.org/ . / . . . doi: medrxiv preprint correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study further evidence of a possible correlation between the severity of covid- and bcg immunization is global bcg vaccination-induced trained immunity relevant to the progression of sars-cov- pandemic? mandated bacillus calmette-guérin (bcg) vaccination predicts flattened curves for the spread of bcg vaccination policy and protection against covid- covid- vs bcg: statistical significance analysis whole blood profiling of bacillus calmette-guérin-induced trained innate immunity in infants identifies epidermal growth factor, il- , plate-let-derived growth factor-ab/bb, and natural killer cell activation thirty years of bcg immunotherapy for non-muscle invasive bladder cancer: a success story with room for improvement potential effect of age of bcg vaccination on global paediatric tuberculosis mortality: a modelling study the bcg world atlas: a database of global bcg vaccination policies and practices canada covid- situation update new york city covid- updates the bcg vaccine: information and recommendations for use in australia, the department of health who immunization estimates bacillus calmette-guérin (bcg) vaccination patterns in the province of bcg vaccination-induced emergency granulopoiesis provides rapid protection from neonatal sepsis sex-based differences in susceptibility to severe acute respiratory syndrome coronavirus infection impact of bcg vaccination on incidence of tuberculosis disease in southern ireland key: cord- -m q dyfx authors: chaisemartin, cl'ement de; chaisemartin, luc de title: bcg vaccination in infancy does not protect against covid- . evidence from a natural experiment in sweden date: - - journal: nan doi: nan sha: doc_id: cord_uid: m q dyfx the bacille calmette-gu'erin (bcg) tuberculosis vaccine has immunity benefits against respiratory infections. accordingly, it has been hypothesized that it may have a protective effect against covid- . recent research found that countries with universal bacillus calmette-gu'erin (bcg) childhood vaccination policies tend to be less affected by the covid- pandemic. however, such ecological studies are biased by numerous confounders. instead, this paper takes advantage of a rare nationwide natural experiment that took place in sweden in , where discontinuation of newborns bcg vaccination led to a dramatic fall of the bcg coverage rate from % to % , thus allowing us to estimate the bcg's effect without all the biases associated with cross-country comparisons. numbers of covid- cases and hospitalizations were recorded for birth cohorts born just before and just after that change, representing , , and , , individuals, respectively. we used regression discontinuity to assess the effect of bcg vaccination on covid- related outcomes. this method used on such a large population allows for a high precision that would be hard to achieve using a classical randomized controlled trial. the odds ratio for covid- cases and covid- related hospitalizations were . (ci : [ . - . ]) and . (ci : [ . - . ]), respectively. we can thus reject with % confidence that universal bcg vaccination reduces the number of cases by more than % and the number of hospitalizations by more than %. while the effect of a recent vaccination must be evaluated, we provide strong evidence that receiving the bcg vaccine at birth does not have a protective effect against covid- . the bacille calmette-guérin (bcg) tuberculosis vaccine has immunity benefits against non-targeted pathogens , and in particular against respiratory infections caused by rna viruses like influenza . since sars-cov- is also a single-stranded rna virus, it has been hypothesized that differences in bcg vaccination coverage could explain the wide differences in disease burden observed between countries. a pioneering preprint paper by miller et al. found that countries with universal bacillus calmette-guérin (bcg) childhood vaccination policies tend to be less affected by the covid- pandemic, in terms of their number of cases and deaths . while unpublished, this study had a great impact and gave rise to many comments and follow-up studies (reviewed in ). some published studies were able to replicate this result , , but several authors underlined the important statistical flaws inherent to such ecological studies and concluded that randomized controlled trials (rct) were necessary to address the question , . as of june th , no less than randomized controlled trials (rcts) studying the protective effect of the bcg against covid- are already registered on https://clinicaltrials.gov/. however, none has a primary completion date earlier than october st , so these rcts' first results will not be known until at least five or six months. with the epidemic still on the rise worldwide, and in the absence of a sars-cov- vaccine, there is an urgent need to know if bcg non-specific effects could be harnessed as a substitute prophylactic treatment. regression discontinuity (rd) is a method designed by social scientists to assess the effect of an exposure on an outcome. it is deemed as reliable as rcts to tease out causality from correlation , and typically yields results similar to those obtained in rcts , . in this paper, we applied this method to a rare natural experiment that took place in sweden. sweden currently has the th highest ratio of covid- deaths per capita in the world. in april , it stopped its newborns bcg vaccination program, leading to a dramatic drop of the bcg vaccination rate from % to % for cohorts born just before and just after the change . we compared the number of covid- cases, hospitalizations, and deaths per capita, for cohorts born just before and just after april , representing , , and , , individuals, respectively. using rd, we were able to show that those cohorts do not have different numbers of covid- cases, hospitalizations or deaths per capita, with a high precision that would hardly be possible to reach with a rct design. regression discontinuity (rd) is a commonly-used method to measure the effect of a treatment on an outcome . it is applicable when only individuals that satisfy a strict criterion are eligible for a policy. then, rd amounts to comparing the outcome of interest among individuals just above and just below the eligibility threshold. in this study, rd will amount to comparing the number of covid- cases, hospitalizations, and deaths among individuals born just before and just after april st . the effect of universal bcg vaccination for individuals born around april st, was estimated using the stateof-the-art estimator for rd . the estimator amounts to comparing treated and control units, in a narrow window around april st . it uses linear regressions of the outcome on birth cohort to the left and to the right of the threshold, to predict the outcome of treated and untreated units at the threshold. then, the estimator is the difference between these two predicted values. the estimator and % confidence interval were computed using the rdrobust stata command, see . this study uses the number of covid- cases per inhabitants for quarterly birth cohorts born between q - and q - , the number of covid- hospitalizations per inhabitants for cohorts born between q - and q - , and the number of covid- deaths per inhabitants for groups of three yearly birth cohorts, from - - to - - . these variables were constructed using data compiled by the public health agency of sweden; see the supplementary table for details. in an rd design, the presence or absence of a treatment effect can be assessed visually, by drawing a scatter-plot with the variable determining eligibility on the x-axis, and the outcome variable on the y-axis. if one observes that the relationship between these two variables jumps discontinuously at the eligibility threshold, this is indicative of a treatment effect. accordingly, figure shows no discontinuity in the numbers of covid- cases per inhabitants for cohorts born just before and just after april . this suggests that universal bcg vaccination has no effect on the number of covid- cases per this visual analysis is confirmed by the statistical calculations. table inhabitants, there is only two data points to the right of the q - threshold. therefore, the rd estimator cannot be computed for that outcome. instead, we just compared the number of covid- deaths per inhabitants in the - - and - - ybcs using a standard t-test, even though this method does not account for the fact those two groups differ in age, contrary to the rd method. doing so, we find that the difference between the deaths per inhabitants of the two groups is not different from . table are intention-to-treat effects : not all swedish residents born just before april received the bcg vaccine at birth, and some of those born just after april received it. in particular, foreign-born residents account for • % of the swedish population born in as per statistics sweden's data, and they were not affected by the policy. among natives, the policy led to a drop of the vaccination rate from to % . assuming that the bcg vaccination rate of foreign-born residents is the same just before and just after april , a reasonable assumption as no other european country changed its bcg vaccination policy in , the policy led to a drop in the bcg vaccination rate of • (( - • )×( • - • )= • ). then, to convert the intention-to-treat effects in table into the effect of being vaccinated at birth, one needs to divide the intention-to-treat effects and their confidence intervals by • , the change in the bcg vaccination rate at birth induced by the reform in this study, we took advantage of a change in vaccination policy in sweden to investigate the link between bcg vaccination in infancy and covid- cases, hospitalizations and deaths, using a regression discontinuity approach. contrarily to most studies on the question, we compared covid- cases between two very similar groups of people from the same country. this allows us to get rid of all confounders linked to cross-countries comparisons, and of confounders like sex or socio-economics status that are often present in observational studies that do not rely on a quasi-experimental design, unlike ours. another strength of this study is its statistical precision. since we could gather nationwide data in a country where covid- rates are high, we are able to reject fairly small effects of the bcg vaccine. achieving a comparable statistical precision in an rct would require an unrealistically large sample. even with a covid- hospitalization rate of • %, as among the elderly swedish population, a randomized controlled trial that could reject bcg effects larger than % of the baseline hospitalization rate, as in our study, would require including around , participants. while previous studies mostly addressed differences in bcg vaccination policies but did not account for differences in actual bcg coverage, we work with two populations with well documented and very moreover, this study does not measure the covid- immunity benefit conferred by a recent bcg vaccination, as individuals born just before q - were vaccinated years ago. the rcts currently underway will tell if the protective effect of a recent bcg vaccination differs from the effect measured in this study. overall, this study shows bcg vaccination at birth does not have a strong protective effect against covid- . thus, it seems that bcg childhood vaccination policies cannot account for the differences in the severity of the pandemic across countries, as had been hypothesized by prior studies , , . this advocates for a strict adherence to who's recommendation of the vaccine to infants outside of clinical trials , and for restraint from starting new clinical trials on this question. the question is of particular importance for a vaccine whose lengthy production process regularly leads to worldwide shortages with dire consequences on children from country with high prevalence of tuberculosis . while rcts will complement this study by measuring the effect of a recent vaccination, this study comes much before results of the rcts will be made available, and with a greater precision. finally, it exemplifies the potential of leveraging past medical policies and statistical techniques designed in the social sciences to answer current medical questions. - - . , when vaccination at birth was discontinued, is represented by the red vertical line. the non-specific and sex-differential effects of vaccines relation between bcg coverage rate and covid- infection worldwide is bcg vaccination affecting the spread and severity of covid- ? demystifying bcg vaccine and covid- relationship regression discontinuity designs in economics empirical tests of the validity of the regression discontinuity design when does regression discontinuity design work? evidence from random election outcomes the impact of changing bcg coverage on tuberculosis incidence in swedish-born children between and regression discontinuity designs: a guide to practice robust nonparametric confidence intervals for regression-discontinuity designs robust data-driven inference in the regression-discontinuity design what is meant by intention to treat analysis? survey of published randomised controlled trials identification and estimation of local average treatment effects the bcg world atlas: a database of global bcg vaccination policies and practices duration of bcg protection against tuberculosis and change in effectiveness with time since vaccination in norway: a retrospective population-based cohort study some evidence of the efficacy of mass bcg vaccination bacille calmette-guérin (bcg) vaccination and covid- global shortages of bcg vaccine and tuberculous meningitis in children we are grateful to folkhälsomyndigheten, the public health agency of sweden, for providing the data used in this study and answering all our questions. we are also grateful to martin berlin, johanneshaushofer, jerker jonsson, ellen lundqvist, kyle meng, robert Östling, andrew oswald, moa rehn, and gonzalo vazquez-bare for their help. key: cord- -payjduek authors: muthuvelu, sobana; lim, kev shiau-chong; huang, ling-yin; chin, shi-tying; mohan, anand title: measles infection causing bacillus calmette-guérin reactivation: a case report date: - - journal: bmc pediatr doi: . /s - - -z sha: doc_id: cord_uid: payjduek background: reactivation of the bacillus calmette-guérin (bcg), manifesting as erythema, induration, ulceration or crust formation at a previous bcg inoculation site, is a common and highly specific feature of kawasaki disease (kd). we report the unusual finding of bcg reactivation in an infant with laboratory-confirmed measles. case presentation: a previously healthy -month old infant presented initially with fever, cough and coryza, and subsequently developed koplik’s spots followed by a typical morbilliform skin rash. there was significant contact history with a household relative who had recently been diagnosed with measles. on examination, a . cm area of erythema and induration was seen at the previous bcg inoculation site, in addition to the widespread maculopapular rash. no other clinical features of kd were present. measles virus was isolated from the throat swab and measles antibodies (igm) were present in the serum. the patient recovered completely with oral vitamin a and supportive therapy, and had normal echocardiography examination on follow up. conclusions: this case report highlights the rare finding of bcg reactivation in a child with confirmed measles infection, and suggests that this clinical manifestation may occasionally occur in children with infections or conditions other than kd. bacillus calmette-guérin (bcg) vaccine is used to prevent tuberculous meningitis, miliary tuberculosis and possibly other forms of tuberculosis, including pulmonary disease, in children [ , ] . it is included as part of the expanded programme on immunization in over countries worldwide, including malaysia [ ] . in malaysia, as in most countries where it is used, bcg vaccination is recommended universally for all infants at birth or shortly after birth. following intradermal inoculation of the attenuated mycobacterium bovis bcg strain at the deltoid region of the left arm, a small papule usually appears after weeks, gradually enlarges and typically ulcerates within - months, and slowly heals over the next few months to form the bcg scar [ ] . reactivation of the bcg, manifesting as erythema, induration, ulceration or crust formation at the bcg site months or years after inoculation, has been described as an important feature of kawasaki disease (kd) [ , ] . although not included in the diagnostic criteria of the disease, this clinical manifestation is reported in up to % of children with kd [ ] . in addition, the clinical finding of bcg reactivation is regarded to be highly specific for kd, as it is very rarely described in other febrile illnesses or infections. for example, in a study of febrile japanese children aged < years admitted over an month period with diagnoses other than kd, no bcg reactivations were observed [ ] . in contrast, data from a japanese nationwide epidemiologic survey showed that > % of children in this age group who were diagnosed with kd developed bcg reactivation [ ] . measles infection has not been reported to cause bcg reactivation. here, we present a case report of a -month old infant with laboratory-confirmed measles who presented with erythema and induration at the bcg inoculation site. a -month old boy was admitted to the paediatric ward of bintulu hospital in sarawak with a -day history of fever and day of rash. his past medical history had been unremarkable and he had been thriving well. he had received bcg vaccination (bcg-japan, tokyo strain) at birth, at the same hospital. according to his mother, a papule had developed at the inoculation site which had then healed completely to form a scar in the months prior to the admission. he had not received measles vaccination. his illness began abruptly with high fever, cough and coryza, for which he received symptomatic treatment as an outpatient at a private medical centre during the first days after disease-onset. on the third day, his condition worsened as he fed poorly and was noted to have reduced activity, with persistence of the fever. a detailed history was then taken and revealed that the child's uncle, who lives with the family and had never received measles vaccination, had been admitted to the same medical centre weeks earlier with a laboratory-confirmed diagnosis of measles. physical examination of the child revealed koplik's spots and he was then admitted to the medical centre. later that day, he developed a typical morbilliform rash which began behind the ears and neck, and spread to his face and trunk. the following day, he was referred to our hospital with a clinical diagnosis of measles. on admission, he looked unwell, was febrile (temperature . °c) but had normal vital signs (pulse rate /min, respiratory rate /min). he had an erythematous maculopapular rash involving mainly the face, neck and trunk, with some areas of confluence (fig. a) . in addition, a welldefined erythematous, indurated area measuring . cm in diameter was seen at the site of the bcg scar (fig. b) . no conjunctivitis, cervical node enlargement, mucosal changes or extremity changes (swelling/erythema of the hands or feet) were found. laboratory investigations revealed a mild anaemia (haemoglobin . g/dl) with normal white blood cell ( . x cells/l) and platelet counts ( x /l). both the c-reactive protein (< mg/dl) and the erythrocyte sedimentary rate ( mm/hour) were normal. other investigations including liver function tests (albumin g/l; aspartate aminotransferase u/l; alanine aminotransferase u/l) and urine microscopy were also normal. blood for bacterial culture was negative. a throat swab and urine sample for measles virus isolation, as well as serum for measles antibodies were sent to the regional laboratory. he was treated with oral vitamin a and intra-venous fluids. his condition began to improve on day of illness, with a resolution of the fever and improvement in feeding and activity. by the th day of illness, both the generalized rash as well as the bcg inoculation site erythema and induration appeared to be resolving, leaving some hyperpigmentation (fig. c, d) . he was then discharged home. follow-up revealed a healthy and thriving boy. no skin desquamation was noted. echocardiography at and weeks after discharge were normal. a review of the investigation results from the regional laboratory confirmed the diagnosis of measles, with measles virus isolated from the patient's throat swab and measles-specific antibodies (igm) present in the serum. isolation of measles virus from the throat swab was performed using vero/hslam cell lines. typical cytopathic effect was observed as formation of syncytia, which appeared as large multinucleated cells (giant cells). the cultures were then harvested and the presence of measles virus confirmed by an immunofluorescence assay (chemicon international, temecula, usa). measles-specific antibodies (igm) in the serum were detected by an indirect enzyme linked immuno-sorbent assay (elisa) using a commercially available test kit (siemens healthcare diagnostics products gmbh, marburg, germany). to the best of our knowledge, this is the first case report to describe bcg reactivation in a child with confirmed measles infection. a search of the pubmed/medline database using the key terms "bacillus calmette-guérin", "bacille calmette-guérin", "bcg" and "measles" revealed no reports of similar cases in the published literature. although the detection of bcg inoculation site erythema and induration did prompt a thorough investigation for kd in our patient, diagnostic criteria for the disease was not met. all clinical and laboratory findings were however consistent with the diagnosis of measles, and a complete and rapid recovery ensued with supportive therapy. the diagnosis of measles in the patient was confirmed by both measles virus isolation from the throat swab and also detection of measles-specific antibodies (igm) in the serum. having been exposed to an unvaccinated relative who had laboratory-confirmed measles, the patient, a -month old infant, then developed the classical manifestations and progressed through the typical natural history of measles infection, without developing any other complications. measles infection is caused by measles virus, a morbillivirus in the family paramyxoviridae [ ] . the disease remains an important childhood affliction, causing deaths globally in , despite the availability of an effective vaccine [ ] . in malaysia, measles vaccination is given to infants aged months. with a vaccination coverage of % in , the incidence of measles in malaysia was reported to be . per , population while the mortality rate from measles was . per , population [ ] . although the diagnosis is usually made based on the characteristic clinical manifestations, confirmation of measles infection may be obtained by detection of measles specific igm antibodies in the serum, and also through measles virus identification from throat-swab and urine specimens [ ] . other than fever, the rash and the bcg inoculation site erythema and induration, no other features of kd were present in the patient. the clinical symptoms and signs resolved without kd specific therapy, with no coronary artery complications detected on follow up. kd is an acute vasculitic syndrome of unknown etiology, occurring mainly in children [ ] . as there are no confirmatory tests, the diagnosis of kd is made based on the presence of fever lasting for days or more, and of principal clinical criteria that include conjunctivitis without exudates, cervical lymphadenopathy, polymorphous rash, changes in the lips or oral mucosa, and changes of the extremities [ ] . a major challenge in the diagnosis and management of kd, however, is the recognition that some infants present with only - clinical features, and therefore do not fulfill the diagnostic criteria. laboratory investigations may be of some use in this situation of incomplete kd [ ] . bcg reactivation has repeatedly been described as an important sign in incomplete kd, although it is not included in any of the diagnostic algorithms [ , ] . for example, in south korea, % of children aged < year who were diagnosed with incomplete kd had erythema, induration or crust formation at the bcg inoculation site [ ] . the unexpected finding of bcg reactivation in our patient correctly raised the concern of a possible diagnosis of incomplete kd. although echocardiography was not performed in the initial phase, no additional supporting clinical or laboratory criteria, other than mild anemia, were found. reassuringly, the rapid resolution of symptoms precluded any further concerns with regard to the need for kd therapy in the patient. apart from those to confirm the measles infection, no laboratory investigations were undertaken to determine if additional viral pathogens were present in the patient and contributed to the development of the bcg reactivation. human herpes virus infection has been reported in an infant with a viral exanthem presenting with bcg reactivation [ ] . in addition, various respiratory viruses including enterovirus, adenovirus, human rhinovirus and coronavirus have been isolated significantly more frequently in children with kd than in controls [ ] , although no direct association with bcg reactivation have been documented. as viral co-infections have been identified in children with measles [ ] , a more extensive virology work-up may have been warranted in our patient when the unusual finding of bcg reactivation was discovered. the mechanism leading to the bcg reactivation in our patient with measles is not known. one possible mechanism is the reactivation and multiplication of live but dormant mycobacterium bovis bcg bacilli that may have been present at the inoculation site, facilitated by immune suppression induced by measles infection. in one previous case report, a severely malnourished . year old boy developed ulceration of a healed bcg scar and possible disseminated bcg infection weeks after measles infection [ ] . acid-fast bacilli was detected from a swab of the bcg ulcer. this mechanism is, however, unlikely in our patient in view of the rapid onset and resolution of the bcg site erythema/induration with the appearance and resolution of the measles rash. immune suppression induced by measles would normally be expected to persist for a longer duration [ ] . in addition, the lack of malnutrition in the patient, the otherwise uncomplicated measles course, and the absence of secondary infections normally seen in severe immunosuppressed states further renders this mechanism unlikely. another possible mechanism for the bcg reactivation, which appears more probable, is an immune-mediated reaction. cross-reactivity between specific epitopes of mycobacterial and human heat shock proteins (hsp), in particular mycobacterial hsp and human homologue hsp , have been postulated as the cause of bcg reactivation in children with kawasaki disease [ , ] . hsp are ubiquitous molecules present in all organisms, including humans, and mediate important functions in protein folding, assembly and transport essential for cell survival [ ] . synthesis of hsp are increased during conditions of cellular stress, including infection, ischaemia and other physical stresses. in humans, increased production and serum concentrations of hsp, especially hsp , have been reported during viral infections, including measles [ , ] . as homology between hsp and mycobacterial antigens have been demonstrated [ ] , a similar cross-reactivity as thought to occur in children with kawasaki disease could possibly also explain the bcg reactivation in our patient. these mechanisms are especially intriguing as measles infections typically cause suppression of delayed type hypersensitivity and anergy to tuberculin [ ] . we report the rare finding of bcg reactivation in a child with confirmed measles infection. although bcg reactivation is known to be an extremely important and highly specific clinical manifestation of kd, this case suggests that bcg reactivation may also occur in other childhood diseases or infections. a thorough search for an infective aetiological agent may be indicated in children presenting with this clinical finding. abbreviations bcg: bacillus calmette-guérin; hsp: heat shock proteins; igm: immunoglobulin m; kd: kawasaki disease effect of bcg vaccination on childhood tuberculous meningitis and miliary tuberculosis worldwide: a meta-analysis and assessment of cost-effectiveness protection by bcg vaccine against tuberculosis: a systematic review of randomized controlled trials the bcg world atlas: a database of global bcg vaccination policies and practices other cutaneous bacterial infections revision of diagnostic guidelines for kawasaki disease (the th revised edition) reaction at the bacillus calmette-guerin inoculation site in patients with kawasaki disease erythema at bcg inoculation site in kawasaki disease patients. materia socio-medica kawasaki disease patients with redness or crust formation at the bacille calmette-guérin inoculation site measles: not just another viral exanthem world health organization. measles. in: media centre. fact sheets response to measles outbreaks in measles mortality reduction settings diagnosis, treatment, and long-term management of kawasaki disease bacillus calmette-guérin reactivation as a sign of incomplete kawasaki disease incomplete kawasaki disease: the usefulness of bcg reactivation as a diagnostic tool diagnosis of incomplete kawasaki disease in infants based on an inflammation at the bacille calmette-guérin inoculation site human herpes virus type can cause skin lesions at the bcg inoculation site similar to kawasaki disease viral infections associated with kawasaki disease viral coinfections among children with confirmed measles at hospitals in hanoi ulceration of a previously healed bcg scar in suspected disseminated bcg infection measles virus-induced suppression of immune responses heat shock protein as a predisposing and immunopotentiating factor in kawasaki disease t cells recognize an immunodominant epitope of heat shock protein in kawasaki disease role of heat shock proteins in protection from and pathogenesis of infectious diseases elevated serum heat-shock protein levels in patients with acute infection: use of an optimized enzyme-linked immunosorbent assay role for heat shock proteins in the immune response to measles virus infection homology of the -kilodalton antigens from mycobacterium leprae and mycobacterium bovis with the mycobacterium tuberculosis -kilodalton antigen and with the conserved heat shock protein of eucaryotes publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations we thank all our medical, nursing and laboratory colleagues involved in the diagnosis and care of this patient. we also thank w. nur afiza binti w. mohd. arifin for providing details of the virological methods conducted in the regional laboratory (national public health laboratory, malaysian ministry of health, sungai buloh, selangor, malaysia). authors' contributions sm, lyh, stc and am were involved in the clinical care of the patient. sm drafted the manuscript and kscl, lyh, stc and am provided critical review. all authors read and approved the final manuscript. not applicable.availability of data and materials all relevant data are included within the manuscript.ethics approval and consent to participate not applicable. written informed consent was obtained from the patient's parents for the publication of this case report and images. the authors declare that they have no competing interests. key: cord- -iodfgzjf authors: kaufmann, stefan h e; mcmichael, andrew j title: annulling a dangerous liaison: vaccination strategies against aids and tuberculosis date: - - journal: nat med doi: . /nm sha: doc_id: cord_uid: iodfgzjf human immunodeficiency virus (hiv) and mycobacterium tuberculosis annually cause million and million deaths, respectively. last year, , individuals, doubly infected with hiv and m. tuberculosis, died. since world war i, approximately million people have succumbed to these two infections—more total deaths than in all wars in the last , years. although the perceived threats of new infections such as sars, new variant creutzfeldt-jakob disease and anthrax are real, these outbreaks have caused less than , deaths globally, a death toll aids and tuberculosis exact every h. in , million people were infected with hiv, billion with m. tuberculosis, and million with both. last year, million and million were newly infected with hiv or m. tuberculosis, respectively, with million new double infections. better control measures are urgently needed. immunodeficiency. with new antiretroviral drugs, hiv infection can be controlled, but not eradicated. treatment, however, is expensive and less than % of individuals infected with hiv in developing countries have access to effective treatment. anti-hiv drugs target hiv reverse transcriptase, protease, integrase or the coiled coil domain of gp . used in combinations of three or more, they are very effective at treating hiv infection: patients with advanced aids have shown dramatic albeit incomplete recovery of cd + t cell counts and immune function, though sometimes the revitalized immune response causes severe problems by reacting to previously silent infecting pathogens. yet even when virus loads have become undetectable for several years, cessation of drugs results in rapid rebound of virus and return to the pretreatment levels . this implies that patients need to take these drugs for life. but because of serious side effects and expense, indefinite treatment is not possible for most of the world. drug resistance by virus mutation is well described and although triple therapy reduces the risk substantially, imperfect adherence to treatment regimes may result in selection of resistant virus. as is the case for tuberculosis, this could limit treatment options in the near future. transmission, however, can be reduced by 'safer sex' practices. such behavior changes may account for the reduction in prevalence of hiv- infection from > % to % in uganda over years . in south africa, more than % of the million inhabitants are infected with hiv and more than % suffer from active tuberculosis. in this country, more than half of all individuals with tuberculosis have concurrent hiv infection. immunodeficiency caused by hiv infection increases the risk of developing tuberculosis dramatically- % of double-infected individuals will develop active tuberculosis within a year of coinfection, as compared to the % lifelong risk in individuals infected with m. tuberculosis alone. despite the availability of effective chemotherapy to cure tuberculosis and the successful development of antiretroviral drugs that control hiv, vaccines provide the only realistic hope of effective prevention. tuberculosis most frequently develops in the lung (fig. ) . once tubercle bacilli have reached the lung alveoli, they are taken up by alveolar macrophages and probably dendritic cells (dcs) in the lung interstitium (fig. ) . m. tuberculosis is protected by a recalcitrant cell wall rich in waxes and other glycolipids , which is responsible for the unique staining characteristics of these microbes and contributes significantly to resistance against host defense. infected macrophages and dcs, therefore, do not destroy their bacterial prey and thus serve as a mobile habitat, transporting the microbes to the lung parenchyma and eventually to the draining lymph nodes , . infected macrophages attract monocytes and a lesion develops. dcs in the lymph nodes present mycobacterial antigens to t cells. at this early stage of infection, secreted proteins such as early secreted antigen for t cells (esat- ) and antigen (ag ) presumably serve as dominant antigens for cd + t cells, which accumulate in great numbers in lesions early after infection. at later stages of infection, cd + t cells also become stimulated . in addition, unconventional t cells are activated, including t cells expressing a γδ t cell receptor with specificity for small phosphorylated ligands and t cells with specificity for glycolipids, which are presented by major histocompatibility complex (mhc) class i-like molecules of the cd family [ ] [ ] [ ] [ ] . studies in nonhuman primates support a role for γδ t cells in protective immunity against tuberculosis . the cd -restricted t cells presumably evolved as a result of the evolutionary cross-talk between mycobacteria and the mammalian host, as they are specific for glycolipids abundant in mycobacteria but not found in other microbial pathogens . antigen-specific t cells induce the formation of a granuloma around infected macrophages, primarily composed of monocytederived macrophages (some of which transform into multinucleated giant cells), cd + t cells and an outer ring of cd + t cells. at later stages, the granuloma is surrounded by a fibrotic wall and lymphoid follicular structures develop in the vicinity, probably orchestrating the local immune response . (i) immediate eradication of m. tuberculosis by the pulmonary immune system. this alternative is rare to absent. (ii) infection transforms into tuberculosis. this frequently occurs in immunodeficient individuals, with the notable example of hiv infection increasing the risk of developing tuberculosis -fold. (iii) infection does not transform into disease because m. tuberculosis is contained inside granulomas. in the diseased individual, m. tuberculosis is no longer contained because caseation of the lesion results in dissemination and transmission of m. tuberculosis. after inhalation, m. tuberculosis is engulfed by alveolar macrophages and dcs. in draining lymph nodes, these cells present mycobacterial antigens to different t cell populations. antigen presentation probably involves cross-priming, allowing transfer of mycobacterial antigens from infected macrophages to dendritic cells. antigen-specific cd + t cells, cd + t cells, γδt cells and cd -restricted t cells participate in protection. most importantly, macrophages are activated by ifn-γ and tnf-α. in addition, t cells may kill mycobacteria present in macrophages by means of perforin and granulysin. in the granulomatous lesion, macrophages are activated by t lymphocytes through production of type i cytokines, notably interferon (ifn)-γ and tumor necrosis factor (tnf)-α . ifn-γ activates the capacity to control m. tuberculosis in macrophages , . moreover, ifn-γ and tnf-α are instrumental in walling off m. tuberculosis inside granulomatous lesions. the importance of these cytokines in the containment of mycobacteria is well illustrated by the observation that individuals with deficient ifn-γ signaling suffer from rapid onset of mycobacterial diseases, and that treatment with antibodies that neutralize tnf-α in individuals with rheumatoid arthritis reactivates tuberculosis in those with latent infection . the granuloma persists for years and efficiently contains tubercle bacilli as long as the individual remains immunocompetent. the granuloma deprives the arrested mycobacteria of oxygen and nutrients and as a direct consequence, the microbes survive, probably in a state of dormancy [ ] [ ] [ ] [ ] . the gene expression profile of m. tuberculosis is altered in response to the restricted growth conditions in the granulomatous lesion. it is highly probable that some of these dormancy-related gene products serve as the major antigens of dormant m. tuberculosis and hence represent promising candidate antigens for a postexposure vaccine aimed at preventing reactivation tuberculosis. the best-known dormancy antigen is the α-crystallin, a small heat-shock protein (hsp) also termed hspx . the mechanisms that determine latency and disease outbreak in tuberculosis remain elusive. although the risk of reactivation is understood to be determined by both host and microbial factors in addition to environmental components, virtually nothing is known about the responsible genes. increasing epidemiologic evidence that strains of the m. tuberculosis beijing/w genotype family, many of which are of the mdr type, are spreading throughout the world suggests that this family of m. tuberculosis evolved against the evolutionary pressure of bcg vaccination and chemotherapy , . a careful histologic analysis of lung autopsy material performed from cadavers more than years ago in zürich showed almost % m. tuberculosis infection in individuals over years of age, who had died of unrelated reasons . we can assume similarly high incidences nowadays for individuals living in tuberculosis 'hot spots' (e.g., prisons in some countries) and infection rates between % and % in areas with high m. tuberculosis incidences. how and why disease outbreak occurs after a period of latency are unclear , . increased risk of tuberculosis as a result of unique environmental and behavioral factors such as alcohol abuse or dietary iron overload emphasizes the importance of these components, but again provides little explanation of specific control mechanisms . a considerable proportion of individuals with tuberculosis develop disease within the first year after infection. moreover, superinfection as well as reinfection after successful tuberculosis chemotherapy have been described . it is probable that these individuals develop an insufficient immune response against natural infection with m. tuberculosis because of genetic host susceptibility, immune suppression by the pathogen or both. elucidation of the genetic mechanisms underlying susceptibility and protective immune mechanisms in resistant individuals that prevent disease outbreak in face of ongoing infection, as well as identification of the pathogen genes that promote transformation of latent infection into active tuberculosis, will facilitate rational design of a postexposure vaccine , , . of equal importance will be the careful analysis of the efficacy of bcg vaccination. bcg was found to protect against adult tuberculosis in the uk and against leprosy in malawi, but did not provide any protection in the world health organization trial in south india . overall, a % protective efficacy has been estimated for bcg . although environmental factors, notably frequent infection with atypical mycobacteria, probably have a role, contribution of genetic host factors should be assessed more carefully. it is possible that a small proportion of bcgvaccinated individuals develops a long-lasting immune response against tuberculosis, whereas the majority does not. because any new vaccine has to protect individuals who do not mount an appropriate immune response to natural infection with m. tuberculosis or to vaccination with bcg, the susceptible and resistant target populations and the criteria that distinguish them from each other need to be defined carefully. vaccination strategies against tuberculosis subunit vaccines given alone or in addition to bcg. new subunit vaccines against m. tuberculosis comprise antigen-adjuvant formulations, naked dna vaccine constructs or recombinant carriers expressing antigen ( table ) . they are mainly based on protein antigens. unfortunately, reliable rules for defining protective antigens for t cells do not exist. most vaccine antigens investigated thus far are early produced secreted antigens such as ag , a shared antigen with bcg, and esat- , which is an antigen unique to m. tuberculosis (fig. ) , . such antigens are probably adequate for pre-exposure vaccination. for individuals latently infected with m. tuberculosis, a postexposure vaccine composed of dormancyrelated antigens such as hspx seems more suitable (fig. ) [ ] [ ] [ ] . a recent screen has assessed the protective efficacy in mice of more than antigens that are differentially expressed in the proteomes of m. tuberculosis versus bcg . from these, only one antigen was identified that induced a robust protection similar to that of bcg, arguing against a unique role in protection of proteins exclusively present in the proteome of m. tuberculosis. although proteins will constitute the major antigens of subunit vaccines, glycolipid antigens can be included in these vaccine formulations. such glycolipids could serve both as antigen in the context of cd and as adjuvant for toll-like receptors (tlrs) . generally, subunit vaccines crucially depend on appropriate adjuvants that stimulate t helper type (t h ) immune responses by the different t cell populations required for protection against tuberculosis. naked dna constructs can stimulate cd + and cd + t cells. although they have proven their high immunogenicity in small-rodent animal models, human studies are thus far mostly disappointing. but new carrier systems such as polylactide glycolyde microparticles may facilitate application of naked dna vaccines in humans . recombinant bacterial and recombinant viral carriers expressing defined mycobacterial antigens have been constructed and their vaccine efficacy against tuberculosis have been determined in experimental animal models. these vectors induce potent cd + and cd + t h responses. the most advanced vaccine of this type is recombinant modified vaccinia virus ankara (r-mva) expressing ag , which has already entered phase clinical trials , . vaccination with mtb f protein in as a adjuvant or in the form of naked dna induces protective immunity in both mice and guinea pigs f-as a vaccine formulation has now entered a phase clinical trial in healthy m. tuberculosis-uninfected volunteers ( table ) . another protein-based vaccine comprising a fusion protein of esat- and ag in a mixture of oligodeoxynucleotides and a polycationic peptide (ic ) as an adjuvant has shown promising results in experimental animals and hence is aimed at entering a phase clinical trial later in ( table ) . generally heterologous prime-boost schemes are composed of a relatively simple first component (e.g., dna) that primes a focused immune response, and a second boost vaccine that induces an inflammatory response (e.g., using a recombinant virus) to magnify the initial response. to achieve a proper prime-boost effect, shared antigens are required for the subunit boost vaccination. in tuberculosis, however, heterologous prime-boost vaccination schemes starting with a bcg prime followed by a subunit boost are considered most promising, not only for scientific reasons but also because bcg vaccination of newborns cannot be given up prematurely. the recently discovered antigen rv is encoded in the bcg genome but is undetectable in its proteome . the increased protection seen in bcg-primed mice after boost vaccination with naked dna encoding rv indicates that this protein is an important antigen of m. tuberculosis that is suboptimally expressed in bcg. similarly, boost with mtb f in as a adjuvant increased protection induced by bcg prime . the r-mva expressing ag induced substantial protection both when given alone or as booster vaccination on top of bcg prime . a recent clinical phase trial showed that r-mva-ag induced ag -specific ifn-γ-secreting t cells ( table ) . more profound effects were observed in the bcg prime-r-mva-ag boost group, underlining the importance of heterologous prime-boost vaccination in the rational delineation of future tuberculosis vaccination strategies. vaccine efficacy data of mutant m. tuberculosis are still limited. during the early stage of infection, m. tuberculosis replicates actively. accordingly, m. tuberculosis knockout mutants, in which synthesis of essential amino acids is prohibited, will not grow in lungs of experimentally infected mice. typically, these are auxotrophic mutants that die of starvation in the absence of the required nutrients ( table ) , . a second group of m. tuberculosis knockout mutants show reduced growth in lungs of experimentally infected mice, but persist at a lower level than wild-type microorganisms. these mutations include deficient regulatory proteins, such as the phop/phoq two-component regulatory system and a variety of mutants with deficient lipid metabolism or transport , . although genes of this group include virulence factors, it is also possible that the gene products are needed for persistence rather than harming the host directly. m. tuberculosis knockout mutants deficient in genes expressed during dormancy replicate in the lungs of experimental mice in an unconstrained manner early after infection, but cease to grow at later stages because of their impaired dormancy gene program. one of the best described genes of this group is that which encodes isocitrate lyase . m. tuberculosis knockout mutants, which grow as well as wild-type microorganisms but induce weaker pathology, lack true virulence factors. some knockout mutants behave like wild-type m. tuberculosis in the lung but do not disseminate to other organs. the heparin-binding hemagglutinin adhesion molecule seems to participate in the dissemination of m. tuberculosis to extrapulmonary sites and hence qualifies as a member of this group . factors that facilitate dissemination to other tissues should be deleted in a viable vaccine in order to focus the response on the lymph nodes. a recently defined group of m. tuberculosis knockout mutants comprises strains that grow as well as wild-type microorganisms in normal mice, but do not persist in mouse knockout mutants with defined immunodeficiency . vaccine candidates based on m. tuberculosis knockout mutants will probably face strong objections against use in human clinical trials largely because of the genetic stability of the mutants. reversion is best prevented by having two independent chromosomal gene deletions. the advantage of m. tuberculosis knockout mutants is their profound stimulation of all t cell populations relevant to protective immunity. on the other hand, m. tuberculosis is known to impair the host immune response. therefore, it is probably not sufficient to reduce the virulence of m. tuberculosis knockout mutants. additional genetic modifications improving the immune response and reducing pathology will be required. although these vaccines will have a long way to go, a rationally designed m. tuberculosis mutant lacking a defined set of virulence genes in the long run could have great potential as a tuberculosis vaccine. as compared to m. tuberculosis, the current vaccine bcg lacks approximately genes that are clustered in regions of difference (rd) and are at least in part involved in pathogenicity and persistence. reintroduction of selected genes may increase immunogenicity, antigenicity or both of bcg without reverting it to a pathogen ( table ) . improved immunogenicity results in the stimulation of a profound immune response. antigenicity can be improved by introduction of additional antigens or by overexpression of antigens expressed at suboptimal level. pym et al. have introduced the entire rd region of m. tuberculosis into bcg, comprising at least genes . although it remains to be clarified whether the recombinant bcg (r-bcg) expressing rd genes is endowed with improved immunogenicity, antigenicity or both, it was claimed that this vaccine candidate provided slightly better protection than parental bcg in mice. not unexpectedly, however, this r-bcg candidate showed higher virulence in immunocompromised mice as compared to wild-type bcg. reintroduction of genes missing in bcg that do not confer virulence might increase vaccine efficacy of bcg without decreasing its safety. horwitz et al. introduced the gene encoding ag into bcg, an abundant secreted protein in m. tuberculosis . although the gene is also expressed in bcg, it was assumed that overexpression of this immunodominant antigen would increase protective immune responses. indeed, in guinea pigs, r-bcg expressing ag induced substantially higher protection than parental bcg against tuberculosis. this vaccine was at least as safe as bcg and has recently entered a phase clinical trial ( table ) . the r-bcg vaccine candidates with higher immunogenicity comprise strains that express human cytokines such as ifn-γ, ifn-α, interleukin (il)- , il- and granulocyte macrophage colony stimulating factor (gm-csf) [ ] [ ] [ ] . however, these cytokine-secreting r-bcg have yet to prove superior protection in animal models against tuberculosis, as they have not yet been compared to parental strains. another approach to improving immunogenicity of bcg takes advantage of the biological activity of listeriolysin (hly) . in its natural host, listeria monocytogenes, this cytolysin forms pores in the phagosomal membrane, promoting listerial egression into the cytosol . in the cytosol, listerial antigens are readily introduced into the mhc class i pathway, causing preferential stimulation of cd + t cells. compelling evidence suggests that bcg is insufficiently equipped for stimulating cd + t cells, whereas cd + t cell stimulation is satisfactory , the gene encoding hly was introduced into bcg to improve cd + t cell stimulation. indeed, such vaccine constructs induced better protection than parental bcg in mice (grode, l. et al; unpublished data). production of this vaccine under good manufacturing practices (gmp) conditions has been initiated and this candidate is aimed at entering a phase clinical trial in ( table ) . the use of subunit vaccines is based on the assumption that one or a few protective antigens and t cell clones will suffice for efficacious protection . in contrast, attenuated viable vaccines utilize the whole spectrum of expressed antigens to stimulate an optimal combination of t cell subtypes. genetically engineered viable vaccines are therefore best suited as replacements for bcg. despite previous reluctance, a recent expert group meeting has strongly advocated development of viable recombinant vaccines against tuberculosis because they are the most potent stimulators of protective immune responses that perform better than bcg in experimental animal models . as an essential requirement, any new viable vaccine should be at least as safe as bcg in immunocompetent and safer than bcg in immunocompromised individuals. cross-reactive immune responses against atypical mycobacteria might prematurely eradicate an improved r-bcg or attenuated recombinant m. tuberculosis and thereby impair efficacy of genetically engineered viable vaccines. although subunit vaccines are probably not affected by the preexisting cross-reactive immunity to environmental bacteria, generally immunity induced by subunit vaccines is short-lived. given the complementary strength of both types of new vaccine candidates, a heterologous prime-boost regimen comprising a prime with a viable vaccine candidate superior to bcg and a boost with a subunit vaccine candidate will probably be the most promising combination to ensure long-lasting efficacy. hiv is a member of the lentivirus subgroup of the retrovirus family, so named because of a long period of clinical latency after infection. its envelope is derived from cell membrane and expresses the glycoproteins gp (responsible for virus attachment to cells) and gp (responsible for membrane fusion). internally, matrix (gag p ) and capsid (gag p ) proteins enclose the viral rna. other viral proteins include the reverse transcriptase, protease, integrase and regulatory proteins nef, tat, rev, vif, vpr and vpu. the virus infects by attaching gp to the cd molecule and either the chemokine receptor ccr or cxcr present on t cells . gp mediates fusion and in the cytosol the rna is reverse transcribed and the preintegration complex moves to the nucleus, where the cdna is integrated as provirus into host dna in activated cells. gene expression is normally immediate; first regulatory and then structural proteins are made, regulated by tat and rev proteins. new virus particles bud from the surface of infected cells about h after infection. virus is shed for a further day or so before the cell dies . neutralizing antibodies eventually appear, although too late to prevent infection, and are easily evaded by viral mutation. t cell immunity seems to control the infection over several years but with a dynamic process of immune selection and escape occurring . cd + t cells are both deleted and functionally impaired early , with hiv-specific t cells preferentially infected and depleted . however, in some cells (e.g., long-lived memory t cells and macrophages), gene expression is delayed and the infection becomes latent. the progressive loss of cd + t cells leads to clinical immunodeficiency, which is manifested by opportunistic infections and, often, reactivation of tuberculosis. these infections rapidly cause death if untreated. hiv infects cd + t cells and monocytes and macrophages. the virus is cytopathic in activated t cells, but less so in macrophages, and not at all in latently infected cells with integrated provirus. these different forms of infection present problems for vaccines. those that stimulate and maintain high levels of neutralizing antibodies could prevent initial infection, but once that has occurred, it is almost impossible to eliminate hiv. under prolonged antiretroviral drug therapy, virus is eliminated from the activated t cells that express the enzymes targeted by the drugs, but not from cells in which virus turns over slowly or is latent . thus if an hiv vaccine does not prevent infection, it is unlikely to eliminate the virus but may be able to control the ongoing infection and prevent disease. there is no known protective immunity against hiv, in the sense that virus is never eradicated from those infected so that it is impossible to find people protected by previous infection, as is the case for many other viruses, such as measles, mumps and influenza. this poses serious problems for vaccine development, although it is not unique (epstein-barr virus is another such example). adult monkeys infected with attenuated siv (e.g., with deletions in nef) do not become sick, and are protected from challenge with pathogenic siv . this protection is probably, but not certainly, immunological . some highly hiv-exposed individuals resist hiv infection; others develop t cell responses to hiv but not serum antibodies, and their immunity depends on continuing exposure to the virus . this may represent immune resistance, although it is hard to prove. another clue may come from the rarity of superinfection in people infected with hiv who are repeatedly exposed to further infection. although there are elegant studies of superinfection , it is suspected that it is rare; if so, its rarity probably reflects immune protection. the spread of hiv- infection around the world in years has been alarming. the worst epidemics are in sub-saharan africa, where more than % of young adults are infected. mortality from hiv infection without drug treatment is close to %, although infected people usually survive from to years before developing aids. the introduction of effective antiretroviral drugs in high-income countries has reduced mortality without reducing infection. hiv is the most variable virus known. there are six major subtypes, a, bc, d, e, f and g, which are 'ancient' (in the hiv context of - years) and have distinct geographical distribution (fig. ) . the complexity is even greater because of recombinations between subtypes and within subtypes. each subtype differs by > % in amino-acid sequence, so that t cells specific for one subtype are unlikely to cross-react substantially with the others; each epitope of - amino acids will probably have two or more mutations, and this level of variability is known to adversely affect t cell recognition . although there are a few cross-reactive t cell epitopes, as well as conserved segments of hiv, it may be necessary to match any virus subtype with that of the circulating viruses in the population to be vaccinated. it is less certain that subtype-specific vaccines will be necessary for stimulating neutralizing antibodies, although sequence variability is known to be a major problem. a further complication is the variability within each subtype and within each individual. it is clear that both antibodies and cd + t cells are very effective at selecting virus escape mutants [ ] [ ] [ ] [ ] . as human leukocyte antigen (hla) type controls the epitopes recognized by t cells, it is not surprising that hla type influences virus sequence in individuals as a consequence of t cell-driven escape . however, the mutant virus may be less fit and the escape can offer advantages to the host. the constraints on the virus probably account for the overall conservation of virus sequence in primary infection, before the immune response evolves. therefore, vaccines that focus on conserved consensus sequences may have the best chance, at minimum selecting slightly less fit viruses during primary infection. a t cell vaccine that permits infection and induces selection of escape mutants could undermine vaccine effectiveness, as has been seen in macaques . but selection of less fit virus has also been observed in macaques in whom siv infection remains controlled, so this could favor the host . challenges. for hiv there are two major challenges: to find (i) immunogens that can stimulate broadly cross-reacting neutralizing antibodies and (ii) immunogens that stimulate high levels of persisting cd + and cd + t cells. both humoral and cellular immunity may be needed, but they require different types of immunogens; eventually vaccines could be mixed to achieve both (fig. ) . a prophylactic vaccine will be given months or years before exposure and, hopefully, prevent or ameliorate infection. an antibody-inducing vaccine could prevent infection , but as indicated above, a vaccine that stimulates t cell immunity cannot stop virus infecting cells. the latter vaccination might enable the host to suppress the infection for long periods and prevent disease. thus, macaques vaccinated to stimulate t cell immunity against siv became infected when challenged with virus, but had very low virus loads and experienced little effect on their health as compared to unvaccinated controls [ ] [ ] [ ] . because it is almost impossible to eliminate hiv infection, this may be the best that can be achieved. however, many chronic virus infections as well as latent m. tuberculosis infection are controlled effectively in the long term by cellular immunity without causing disease. hiv- does not cause disease in more than % of those infected in west africa , suggesting that the immune response and the virus are in balance in the infected but healthy individual. at present there is no realistic candidate hiv vaccine. it was thought that gp preparations would stimulate neutralizing antibodies, and they do against tissue culture-adapted hiv strains. however, all such vaccines have failed to neutralize primary virus isolates and one tested in two large efficacy trials failed to protect (nam, http://www.aidsmap.com/). now the aim is to design hiv envelope protein immunogens that will stimulate protective antibodies. unfortunately the dice are loaded against this: (i) the envelope is heavily glycosylated, making it largely nonimmunogenic; (ii) it is conformationally variable, so that the most sensitive site, the chemokine receptor binding site, is not exposed unless cd + has bound; (iii) the cd + binding site is deeply recessed and hard to access by antibodies; (iv) besides the carbohydrates, crucial parts of the gp surface are protected by hypervariable loops, which can and do vary by mutation at no cost to the virus, thereby escaping neutralizing antibodies , . real novelty in immunogen design is needed to get around these problems. as an alternative, much effort is being made to create vaccines that stimulate t cell immunity, particularly cd + t cells. in mice, several approaches comprising plasmid dna and various recombinant viruses and recombinant bacteria have given promising results [ ] [ ] [ ] . also particulate proteins and peptide-pulsed dcs can efficiently stimulate cd + t cells , . but these findings are not easily transferable to primates. dna vaccines stimulate only weak responses in humans and recombinant viruses give mixed results. the poxviruses (canary pox, the attenuated vaccinia virus (nyvac) and mva) induce weak primary responses , , possibly because the recombinant immunogen is swamped by more than poxvirus proteins. also, these viruses may be too attenuated, with little or no proliferation after infection. however, they may be better at boosting t cell responses that have already been primed (e.g., bcg; table ). the most promising results to date come from recombinant adenovirus , which has stimulated strong and sustained t cell responses, but its applicability is constrained by the high frequency of antibodies to this virus in most human populations. alternate candidates in trial include other strains of adenovirus, adeno-associated virus, alphaviruses and r-bcg as vectors for hiv. as for tuberculosis, heterologous prime-boost regimes offer enhanced t cell immune responses , and have been observed in macaques and humans . it seems that in humans, recombinant adenoviruses are good at both priming and boosting, whereas recombinant poxviruses such as mva are better at boosting than priming (mcmichael, a.j., goonetilleke, n., guimaeres-walker, a., dorrell, l., yan, h., hanke, t., unpublished data). vaccine-induced t cell responses should include both cd + and cd + t cells, even though the former are targets for the virus. cd + t cell help is important for optimal cd + t cell responses - -an issue of particular importance to hiv vaccine development because natural infection results in impaired cd + t cell immunity. protein immunogens typically elicit antibody responses and t helper cell responses, but the latter may be of the t h type, especially when alum is used as an adjuvant ; t h responses have little or no antiviral activity. live intracellular infections generally elicit t h responses and cd + t cell responses, hence the use of live attenuated vectors to mimic a virus infection. these deliver the required immunogen into the cytosol, from which it can enter the mhc class i antigen presentation pathway directly, or indirectly when the cell dies and virus protein is taken up by dcs for 'cross-priming' of cd + t cells [ ] [ ] [ ] [ ] . people who are homozygous for the δ variant of ccr do not express an intact chemokine receptor and are resistant to hiv infection . immune resistance is suspected for people who are highly exposed, yet uninfected. many generate cd + and/or cd + t cell responses, but without any serum antibody . it is not certain that the t cell responses are responsible for resistance. if they are, it is encouraging because the levels of t cell response seen in current vaccine trials could be sufficient. hiv enters the host through (usually genital) mucosa. hiv infects, or attaches to, mucosal langerhans cells first and then migrates to local lymphoid sites an hiv vaccine should stimulate b and t cell as well as mucosal and innate immunity. live attenuated hiv probably provokes all of these, but because it will set up a persistent infection, there are insoluble safety issues that render its use unlikely in humans. therefore, it may be necessary to build a set of vaccines to stimulate each component separately and administer them in combination. if control equivalent to that of chronic epstein-barr virus or cytomegalovirus or latent m. tuberculosis infection could be achieved for hiv, with reduced or negligible further transmission, it would represent a considerable advance. measuring the efficacy of the vaccine would be problematic, being dependent on reduced virus load at set point, the time at around months after primary infection when virus level stabilizes. the set-point level is inversely correlated with time of survival. only neutralizing antibodies, stimulated by vaccines, offer any real chance of sterile immunity and such vaccines are a long way off. a prophylactic vaccine for hiv is badly needed. unless current trials of vaginal microbicides are unexpectedly successful, there is no other way of controlling the infection and both antibody-and t cell-inducing vaccines need a total rethink. the most advanced of these vaccines is the merck recombinant adenovirus (ad ) vaccine that is about to enter clinical trials. but even if successful, a different vector will be needed to deal with the problem of pre-existing antibody immunity to ad . the merck trial may, however, indicate whether vaccines that stimulate t cell immunity offer any benefit, and that type of news is to be welcomed. could aids and tuberculosis vaccines be given together? probably, but this may be decades away. in parts of africa, bcg is given at birth. combining bcg with an aids vaccine, with a boost at puberty, may be feasible in the distant future. preclinical studies: tuberculosis and aids vaccine testing. most tuberculosis vaccine candidates have been tested in mice or guinea pigs. studies in mice take advantage of the in-depth knowledge of the mouse immune system, whereas guinea pigs have the advantage of developing a pathology that highly resembles human tuberculosis. these experimental animal studies form the starting point of the tedious pipeline leading to a new vaccine candidate . the us national institutes of health, through their preclinical tuberculosis screening program, and the european union, through its tbvac integrated project in the framework program , sponsor vaccine testing in experimental animals under standardized conditions. thus far, the two programs utilize different screening procedures, which need to be harmonized in order to achieve comparability of different vaccine candidates. however animal models cannot unequivocally predict the efficacy of a vaccine candidate against tuberculosis or hiv and immunogenicity results in mice often do not predict responses in humans. although nonhuman primate studies can be bypassed before phase and phase clinical trials, they may become necessary before embarking on phase trials. phase and phase clinical trials should also be exploited for determination of immunological correlates of protection (i.e., markers that unequivocally predict protective efficacy of a vaccine candidate). currently, ifn-γ produced by t cells with specificity for defined antigens is probably the best marker of protection for tuberculosis, but this is much less clear for hiv. in the most impressive vaccine protections studies, using attenuated siv as a vaccine it is not known what confers protection , and the ifn-γ elispot assay for t cells does not correlate with protection in vaccine-protected macaques . additional markers are required. the siv challenge model in macaques has been very useful for hiv vaccine development , but there are limitations. in these experiments, the virus challenge dose is always large, compared to repeated lowdose exposures in humans. in addition, the vaccine is nearly always homologous to the challenge virus, giving good chances of success that are unrealistic in humans. attempts are being made to introduce more representative challenges . finally the siv or siv-hiv hybrid (shiv) challenges may be slightly misleading; it seems easier to protect against the aggressive hybrid virus shiv . p compared to the less virulent siv mac . it is unclear which will be closer to an hiv exposure in humans. despite these problems, the existing data suggest vaccineinduced protection is possible. therapeutic vaccination for hiv is rarely discussed, but must be considered as recent studies in macaques and humans [ ] [ ] [ ] give it some credibility. in humans, therapeutic vaccination would probably be used to stimulate t cell responses in hiv-infected people whose virus was well controlled by antiretroviral drugs, with the aim of terminating antiretroviral therapy (art) once the t cell levels were boosted. the rationale is that t cells, particularly cd + t cells, are known to be effective in long-term control of the virus in the absence of drug treatment, but t cell responses decline in patients on effective art . when art is stopped, virus rebounds to pretreatment levels . if the t cell levels were already boosted, this might lead to lower virus levels at the new set point. at its best, this treatment could enable withdrawal of art for prolonged periods and offer new options in low-income countries in particular. patients whose virus was controlled in this way might also be less likely to transmit virus. clinical trials. the earliest vaccine trials are small and are concerned with vaccine safety and immunogenicity. then immunogenicity is optimized by finding the best vaccine dose and route of delivery. finally, the vaccine efficacy trials involve several thousand volunteers who are at high risk for infection. translation of vaccine candidates from bench science into clinical trials is relatively straightforward scientifically but complicated logistically and extremely expensive (box ). phase trials can be done in the country of origin of the vaccine, but increasingly good sites are being established in developing countries and several countries have hiv vaccine trial experience. in contrast, experience with tuberculosis vaccine trials is marginal and currently only a few phase trials have been initiated. two phase trials of vaxgen gp in , people showed clearly that the aids vaccine candidate offered no protection (e.g., reported at http://www.hivandhepatitis.com/ vaccines/ a.html). a phase b trial has now been proposed before . here, between , and , high-risk volunteers are given placebo or vaccine and all are followed for evidence of infection. once trial participants are infected, a detailed analysis of the relationship between infection and immunity is made. in the case of aids, virus load, subtype and t cell and humoral immune responses are determined and correlated and the degree of protection ascertained. it is arguable that such an approach might have obtained a result for the vaxgen trial in a shorter time at lower cost. it would be worthwhile to consider a similar strategy for tuberculosis vaccine efficacy trials. vaccine recipients for phase trials are volunteers who are at negligible risk of infection. nevertheless, they have to be counseled about the implications of testing, which adds some burden to all parties. it has proved relatively easy to recruit such volunteers in the uk and in kenya and uganda for aids vaccine testing. for efficacy trials, phase b and phase , it will be necessary to work with individuals with high risk for hiv infection. sex-worker cohorts are usually too small and follow up can be difficult. in a high-risk region in africa, the annual incidence may be - %, but the implementation of trials inevitably raises awareness and the best possible advice must be given to volunteers, particularly concerning condom use. therefore, it should be expected that incidence might decrease by half. this is important to realize in determining statistical powers before embarking on the trial. the population of high-risk volunteers is less well circumscribed for tuberculosis than for aids. there are major ethical issues in efficacy trials. double blinding and placebo controls are essential, but a difficult question is what to offer in terms of chemotherapy to trial participants in low-income countries such as africa. it is now generally agreed that the best possible (rather than best regional) therapy should be offered to all trial participants who become infected; the unresolved questions are for how long and when, given that drugs may not be required for - years. although it is desirable to insist on the highest safety standards for any vaccine candidate as defined by the fda and the emea it may be worthwhile to carefully assess whether risk-benefit relationships differ for countries with low or high tuberculosis or aids prevalence. side effects of new vaccine candidates may be tolerable for a vaccine that can prevent tuberculosis or aids mortality and morbidity in countries where incidences are skyrocketing, but not for countries with low tuberculosis or aids prevalence . hiv and tuberculosis vaccine trials will probably need multiple sites. a trial involving , volunteers with detailed prescreening, individual counseling and careful follow up will probably necessitate at least sites. although in theory such sites would have the infrastructure and could also conduct trials for both tuberculosis and hiv, it is unlikely that this would be possible at the same time because of high cost, a requirement for multiple vaccine groups and complicated data analysis. aids and tuberculosis rampage most freely in low-income countries where the total annual budget for public health is below us $ per capita [ ] [ ] [ ] [ ] . currently available therapeutic regimes exceed such budgets by several fold. similarly, vaccine development from the bench to the field consumes huge amounts of financial resources. consequently development of vaccines against tuberculosis and aids will be most successful as joint public-private enterprise with support from governmental and nongovernmental funding organizations and philanthropic foundations. such a consortium would be best equipped to bring forward vaccine development by a combination of 'push' and 'pull' programs. although support for preclinical research will be best directed by classical push programs, incentives should be made available for alternative approaches . the removal of roadblocks serves as a good example for a support strategy emphasizing innovation and not restrictive in the experimental approach. unconventional research areas, such as therapeutic hiv- and tuberculosis vaccination, could be further stimulated by pull programs rewarding a vaccine candidate that proves successful figure the major components of the immune response can be stimulated by different types of vaccine. inactivated vaccine t cell immunity innate immunity • intellectual property. for regulatory and manufacturing reasons, vaccines that go forward into trials must be protected as intellectual property. this ensures that sponsors, indemnifiers, gmp producers, etc. know what they are dealing with and that others will not be working unlicensed with the same product. • gmp production. preparation of a vaccine to 'good manufacturing practice' quality is essential for the regulators and ensures that each batch is identical and can be tracked. this is expensive (e.g., $ , - , for mva) and requires outsourcing. the manufacturer provides detailed documentation of processes and purity. • toxicity testing. this is required before submission to the us food and drug administration (fda) or the european medicines agency (emea). normally this requires acute toxicity and studies of distribution and persistence of vaccine at distant and critical sites after immunization. dose schedules should be the same as used for the trial, even though the animals are smaller and a detailed report is needed. • regulatory submission to the national or international authority (fda, emea, medicines and healthcare products regulatory agency, etc.). these follow standard procedures but require very detailed information including full protocols, standard operating procedures of assays, details of safety monitoring, definition of endpoints, statistical calculations, details of data handling. • ethical approval. this connects to regulatory submission. besides all protocols, details of informed consent, explanation to volunteers, details of volunteer recruiting and letters to family doctor explaining the trials are required. • other approvals may be needed from the gene therapy advisory committee (in the uk) and local and national safety committees for handling recombinant organisms. in preclinical studies. at the transition from the preclinical to the clinical phase, pull programs providing incentives for the market-ready final product would be most appropriate . these include tax reduction for vaccine production, secured future markets in developing countries, a tiered price system, and reduced interest rates or debt release by the world bank for vaccine purchase and distribution. in the absence of such incentives, even the best vaccine candidate may fail to reach the desired goal of unrestricted distribution in countries affected most by aids and tuberculosis. lack of financial incentive may provide some unique opportunities for vaccine development against aids and tuberculosis. notably, lowto-absent competition for financial profits can promote comparative clinical trials under the umbrella of governmental, nongovernmental or philanthropic organizations either alone or together with the aim first to select the most promising candidates, and second to proceed by 'learning by doing' (i.e., continuous vaccine improvement of candidates in iterative clinical trial processes). analysis of the immune responses of vaccine trial participants may provide new information that can be further explored in experimental animal models and help to define the next clinical trial step. strong efforts are required to harmonize vaccine trials and accompanying vaccine efficacy testing. it is rewarding that several major organizations including the us national institutes of health though their intramural and extramural programs, the bill and melinda gates foundation through aeras for tuberculosis and their vaccine enterprise for aids as well as the european union through their european & developing countries clinical trials partnerships program have committed themselves to bring vaccines against aids and tuberculosis from the bench to the field. vaccination strategies against these two diseases need to be integrated as soon as possible, considering the intimate interdependence of the two deadly pathogens and the consequences of their liaison. obviously, numerous hurdles need to be overcome. yet, even if only partially protective vaccines can be developed, return on investment will be enormous. this is not only true for the most impoverished countries, for which a rapid solution is vital, but also for industrialized countries, which may suffer significantly from global economic and social regressions and further weakening of unstable states. global tuberculosis control: surveillance, planning, financing (world health organization is the development of a new tuberculosis vaccine possible? die schutzimpfung gegen tuberkulose mit "bcg immune control of hiv- after early treatment of acute infection guidelines for using antiretroviral agents among hiv-infected adults and adolescents can population differences explain the contrasting results of the mwanza, rakai, and masaka hiv/sexually transmitted disease intervention trials?: a modeling study a waxy tale by mycobacterium tuberculosis intracelluar models of mycobacterium tuberculosis infection mycobacterium tuberculosis: the indigestible microbe cd t cells in tuberculosis cd and tuberculosis gamma/delta and other unconventional t lymphocytes: what do they see and what do they do? adaptive immune response of v gamma v delta (+) t cells during mycobacterial infections mycobacterial phosphatidylinositol mannoside is a natural antigen for cd d-restricted t cells human tuberculous granulomas induce peripheral lymphoid folliclelike structures to orchestrate local host defence in the lung how can immunology contribute to the control of tuberculosis? disseminated tuberculosis in interferon gamma gene-disrupted mice an essential role for interferon gamma in resistance to mycobacterium tuberculosis infection infliximab (chimeric anti-tumour necrosis factor alpha monoclonal antibody) versus placebo in rheumatoid arthritis patients receiving concomitant methotrexate: a randomised phase iii trial. attract study group the immunological aspects of latency in tuberculosis mycobacterium bovis bcg response regulator essential for hypoxic dormancy inhibition of respiration by nitric oxide induces a mycobacterium tuberculosis dormancy program regulation of the mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin global dissemination of the mycobacterium tuberculosis w-beijing family strains worldwide occurrence of beijing/w strains of mycobacterium tuberculosis: a systematic review localisation und ausheilung der tuberculose. archiv für pathologische anatomie und genetic dissection of immunity to mycobacteria: the human model genetics of susceptibility to human infectious disease iron and microbial infection exogenous reinfection as a cause of recurrent tuberculosis after curative treatment survival perspectives from the world's most successful pathogen, mycobacterium tuberculosis the bcg story -lessons from the past and implications for the future efficacy of bcg vaccine in the prevention of tuberculosis. metaanalysis of the published literature selecting the components for a safe and efficient tuberculosis subunit vaccine-recent progress and post-genomic insights immunogenicity and protective efficacy of a tuberculosis dna vaccine protection of mice with a tuberculosis subunit vaccine based on a fusion protein of antigen b and esat- application of mycobacterial proteomics to vaccine design: improved protection by mycobacterium bovis bcg prime-rv dna boost vaccination against tuberculosis novel vaccination strategies microparticles as vaccine adjuvants and delivery systems recombinant modified vaccinia virus ankara expressing antigen a boosts bcg-primed and naturally acquired antimycobacterial immunity in humans enhanced immunogenicity of cd (+) t-cell responses and protective efficacy of a dna-modified vaccinia virus ankara prime-boost vaccination regimen for murine tuberculosis differential immune responses and protective efficacy induced by components of a tuberculosis polyprotein vaccine, mtb f, delivered as naked dna or recombinant protein the protective effect of the mycobacterium bovis bcg vaccine is increased by coadministration with the mycobacterium tuberculosis -kilodalton fusion polyprotein mtb f in m. tuberculosis-infected guinea pigs auxotrophic vaccines for tuberculosis characterization of auxotrophic mutants of mycobacterium tuberculosis and their potential as vaccine candidates an essential role for phop in mycobacterium tuberculosis virulence complex lipid determine tissue specific replication of mycobacterium tuberculosis in mice persistence of mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase the heparin-binding haemagglutinin of m. tuberculosis is required for extrapulmonary dissemination identification of mycobacterium tuberculosis counterimmune (cim) mutants in immunodeficient mice by differential screening comparative genomics of bcg vaccines by whole-genome dna microarray recombinant bcg exporting esat- confers enhanced protection against tuberculosis recombinant bacillus calmette-guerin (bcg) vaccines expressing the mycobacterium tuberculosis -kda major secretory protein induce greater protective immunity against tuberculosis than conventional bcg vaccines in a highly susceptible animal model manipulation and potentiation of antimycobacterial immunity using recombinant bacille calmette-guerin strains that secrete cytokines bacille calmette-guerin (bcg)-associated inflammation and fibrosis: modulation by recombinant bcg expressing interferon-gamma (ifn-gamma) recombinant bacille calmette-guerin (bcg) expressing human interferon-alpha b demonstrates enhanced immunogenicity mycobacterium bovis bacille calmette-guerin strains secreting listeriolysin of listeria monocytogenes molecular determinants of listeria monocytogenes pathogenesis improved protection by recombinant bcg. microbes infect new live mycobacterial vaccines: the geneva consensus on essential steps towards clinical development recent advances in understanding the molecular mechanisms of hiv- entry and fusion: revisiting current targets and considering new options for therapeutic intervention hiv- dynamics in vivo: implications for therapy escape of human immunodeficiency virus from immune control hiv- viremia prevents the establishment of interleukin -producing hiv-specific memory cd + t cells endowed with proliferative capacity hiv preferentially infects hiv-specific cd + t cells the challenge of viral reservoirs in hiv- infection protective effects of a live attenuated siv vaccine with a deletion in the nef gene prospects for an aids vaccine cytotoxic t cell responses to multiple conserved hiv epitopes in hiv-resistant prostitutes in nairobi late seroconversion in hiv-resistant nairobi prostitutes despite preexisting hiv-specific cd + responses hiv- superinfection despite broad cd + t-cell responses containing replication of the primary virus timing the ancestor of the hiv- pandemic strains t cell cross-reactivity and conformational changes during tcr engagement hiv escape: there and back again envelope-constrained neutralization-sensitive hiv- after heterosexual transmission hiv and siv ctl escape: implications for vaccine design rapid evolution of the neutralizing antibody response to hiv type infection evidence of hiv- adaptation to hla-restricted immune responses at a population level eventual aids vaccine failure in a rhesus monkey by viral escape from cytotoxic t lymphocytes reversion of ctl escape-variant immunodeficiency viruses in vivo transfer of neutralizing igg to macaques h but not h after shiv infection confers sterilizing protection: implications for hiv- vaccine development control of a mucosal challenge and prevention of aids by a multiprotein dna/mva vaccine control of viremia and prevention of clinical aids in rhesus monkeys by cytokine-augmented dna vaccination replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity plasma viral load, cd cell percentage, hla and survival of hiv- , hiv- , and dually infected gambian patients hiv vaccine design and the neutralizing antibody problem the antigenic structure of the hiv gp envelope glycoprotein humoral and cell-mediated immune responses to live recombinant bcg-hiv vaccines vaccine developments a recombinant vector derived from the host range-restricted and highly attenuated mva strain of vaccinia virus stimulates protective immunity in mice to influenza virus priming of human immunodeficiency virus type (hiv- )-specific cd + t cell responses by dendritic cells loaded with hiv- proteins hiv vaccine strategies safety and immune responses to a dna-based human immunodeficiency virus (hiv) type i env/rev vaccine in hiv-infected recipients: follow-up data enhanced t-cell immunogenicity of plasmid dna vaccines boosted by recombinant modified vaccinia virus ankara in humans hla class i serotypes and cytotoxic t-lymphocyte responses among human immunodeficiency virus- -uninfected thai volunteers immunized with alvac-hiv in combination with monomeric gp or oligomeric gp protein boosting enhancement of mhc class i-restricted peptide-specific t cell induction by a dna prime/mva boost vaccination regime enhanced immunogenicity for cd + t cell induction and complete protective efficacy of malaria dna vaccination by boosting with modified vaccinia virus ankara cd + t cells are required for the maintenance, not programming, of memory cd + t cells after acute infection requirement for cd t cell help in generating functional cd t cell memory a conditioned dendritic cell can be a temporal bridge between a cd + t-helper and a t-killer cell reduced functional capacity of cd + t cells expanded by post-exposure vaccination of gamma-herpesvirusinfected cd -deficient mice in interleukin- -deficient mice, alum not only generates t helper responses equivalent to freund's complete adjuvant, but continues to induce t helper cytokine production cd + t cell cross-priming via transfer of proteasome substrates antigen bias in t cell cross-priming type i interferons promote cross-priming: more functions for old cytokines cross-priming of cd + t cells stimulated by virus-induced type i interferon homozygous defect in hiv- coreceptor accounts for resistance of some multiply-exposed individuals to hiv- infection the pathogenesis of sexual mucosal transmission and early stages of infection: obstacles and a narrow window of opportunity for prevention cd + t cell depletion during all stages of hiv disease occurs predominantly in the gastrointestinal tract tuberculosis and the tubercle bacillus interferon-gamma assays in the immunodiagnosis of tuberculosis: a systematic review mechanisms of protection induced by attenuated simian immunodeficiency virus repeated low-dose mucosal simian immunodeficiency virus sivmac challenge results in the same viral and immunological kinetics as high-dose challenge: a model for the evaluation of vaccine efficacy in nonhuman primates viremia control following antiretroviral treatment and therapeutic immunization during primary siv infection of macaques therapeutic dendritic-cell vaccine for chronic hiv- infection vaccination of macaques with long-standing sivmac infection lowers the viral set point after cessation of antiretroviral therapy decay kinetics of human immunodeficiency virus-specific effector cytotoxic t lymphocytes after combination antiretroviral therapy creating incentives for pharmaceutical research on neglected diseases world health organization. global atlas of infectious diseases report on the global aids epidemic world health organization. the world health report -changing history hiv- /aids and the control of other infectious diseases in africa methylation-dependent t cell immunity to mycobacterium tuberculosis heparin-binding hemagglutinin therapy of tuberculosis in mice by dna vaccination boosting vaccine for tuberculosis the authors declare that they have no competing financial interests. volume the sentence "in south africa, more than % of the million inhabitants are infected with hiv and more than % suffer from active tuberculosis" should read "more than . % suffer from active tuberculosis."in table two sentences in this article appeared incorrectly. on page , in the eighth paragraph, the third sentence should read "to the u -transplanted scid mice, mg of either sg/ , yn or vehicle was injected intravenously, and mg of either arac or normal saline was injected intraperitoneally on day of transplantation." on page , in the eighth paragraph, the fourth sentence should read "to nod-scid mice transplanted with patients' leukemic cells, mg of either sg/ or yn was injected intravenously, and mg of either arac or normal saline was injected intraperioneally on days and of transplantation." key: cord- -q jnkn authors: belizário, josé ernesto title: trained innate immunity, covid- therapeutic dilemma, and fake science date: - - journal: clinics (sao paulo) doi: . /clinics/ /e sha: doc_id: cord_uid: q jnkn nan when we get sick, our body's first line of defense, the immune cells, responds and stores a memory of the pathogen; this is called immunological memory ( ) . two types of functionally distinct memories have been described, i.e., innate memory (non-specific) and acquired memory (specific). there are two ways by which t and b cells form an acquired immunological memory. the first is based on genetic mechanisms that involve the recombination of membrane receptor genes (tcr) and selection of t cell clones capable of perfectly recognizing self and non-self antigens (e.g. proteins belonging to pathogens). the second, is based on the recombination of immunoglobulin genes (antibody genes) that recognize the proteins expressed by pathogens and the selection of memory b cell clones. memory b cells express membrane receptors (bcr)-or bound antibody molecules with high affinity-that recognize the pathogens in the event of a second infection. however, the big question is, ''how are antibodies produced against an infectious pathogen or vaccine?'' first, dendritic cells phagocytize and degrade the pathogen and present its pieces in the form of epitopes (protein fragments) to cd + t lymphocytes. then, helper cd + t cells communicate with lymphocytes b, which initiate the production of different classes of antibodies (humoral soluble response) against these epitopes. b lymphocyte clones die at the end of the infection and only few clones that contain the code (memory) for the synthesis of specific antibodies remain. another population of lymphocytes, called effector cd + t lymphocytes (cellular response), also recognizes pathogen-related antigens in infected cells. these cytotoxic lymphocytes attack the pathogens by releasing cytokines, toxins, and enzymes that lead to cell death via apoptosis and necroptosis. these cytotoxic lymphocytes also die at the end, and only a few clones survive. the survivors are programmed to become memory cd + t lymphocytes that would recognize the pathogen in the event of a second infection. how is memory in cd + t cells formed chemically? what we know is that cytosine and guanine (cpg)-rich regions in the promoters of genes encoding for various proteins, such as transcription factors, cytotoxic proteins, and cytokines involved in lymphocyte activation, undergo chemical modifications (methylation and demethylation, i.e., addition or removal of methyl groups). such modifications form a silencing or activating on/off switch for the transcription of immune response genes. histone proteins that bind dna molecules also undergo methylation and acetylation at their lysine and arginine residues. these types of chemical changes are referred to epigenetic and non-genetic (non-hereditary) modifications, as they do not cause any changes (mutations) in the dna molecule, nor are they transmitted to the next generation. therefore, children need to receive vaccines that protected their parents from pathogen, for example, the measles vaccine, to develop their own immune responses. bone marrow progenitor myeloid cells that give rise to blood leukocytes, such as neutrophils, monocytes, and natural killer cells (nks), are the innate cells participating in the non-specific innate response and trained immunity ( ) . studies have shown that monocytes and macrophages are ''educated or trained'' during the first infection, and thus they acquire the ability to fight more effectively in subsequent infections. monocytes are trained through stimulation with lipopolysaccharide (lps)-a gram-negative bacterial membrane protein-or beta-glucan, a component of the fungal cell wall. for example, the bacillus calmette-guérin (bcg) vaccine can increase the production of pro-inflammatory cytokines, such as tumor necrosis factor (tnf), interleukin- (il- ), and il- , up to times on second contact with the pathogen. this type of immunological memory or epigenetic programming to a pre-activated state allows the generation of a sustained and more effective non-specific response, even after years, although in the protocols of these studies, the innate immunity was evaluated after months ( ). biochemical analyses on chromatin showed that trained monocytes are characterized by an increase in histone acetylation, in particular h k ac and h k me as well as by an increase in the metabolism of glucose (glycolysis) and glutamine (glutaminolysis), and by high levels of fumarate, a metabolite of the tricarboxylic acid cycle or krebs cycle ( ) . it has also been observed that after the training of human monocytes with candida albicans (a human opportunistic pathogen) beta-glucan, the induced innate immunity protects not only against fungi, but also against bacteria, viruses, and parasites ( ) . in addition, the training of human monocytes by saccharomyces cerevisiae (another human opportunistic pathogen) chitin greatly increased their ability to eliminate microbes such as candida albicans, staphylococcus aureus (a gram-positive bacterium), and escherichia coli (a gram-negative bacterium) in comparison with untrained doi: . /clinics/ /e copyright & clinics -this is an open access article distributed under the terms of the creative commons license (http://creativecommons.org/licenses/by/ . /) which permits unrestricted use, distribution, and reproduction in any medium or format, provided the original work is properly cited. no potential conflict of interest was reported. human monocytes. more interesting, the non-specific effects of bcg vaccination improved the effects of low-efficiency vaccines, such as the vaccine against typhus-caused by salmonella typhi (www.clinicaltrials.gov, number nct )-or the influenza vaccine. this protective effect has been known for decades in many countries (e.g. in denmark and south africa) where the bcg vaccine is administered to babies a few days after birth. in these countries, there was a - % reduction in infant mortality associated with pneumonia and sepsis ( ) . however, to the best of our knowledge, none of the studies have determined if a similar phenomenon occurs in vaccinated babies in brazil. various clinical trials are underway to evaluate trained immunity through bcg vaccination in healthy volunteers under the coordination of dr. mihail netea (radboud university medical center, nijmegen, the netherlands). clinical trials brace (www.clinicaltrialgov, number nct ) and bcg-corona (www.clinicaltrial.gov, number nct ) are employing large cohorts of health professionals in the netherlands, denmark, germany, england, france, tanzania, uganda, colombia, and uruguay ( ). the objective is to demonstrate whether immunization with bcg vaccines produced using different strains and titers of the bacillus calmette-guérin-the vaccine against tuberculosis-can protect these professionals against sars-cov- infection ( ). a similar study will be carried out in brazil (www. clinicaltrial.gov, number nct ). dr. netea said that preliminary results showed that in a large number of human volunteer cohorts, the bcg vaccine induced trained immunity ( %; as stated in https://www.youtube.com/watch? v= w p pols). it is expected that the volunteers, if infected, will respond mildly or asymptomatically to the sars-cov- infection. the scientific basis for this hypothesis comes from studies undertaken on human volunteers previously immunized with the live bcg vaccine and then with the vaccine for the yellow fever virus that causes a hemorrhagic disease ( ) . it has also been verified through epidemiological and observational clinical studies that the number of deaths caused by coronaviruses in low-income countries, such as india and some countries in africa and the americas, are significantly lower than those in countries with medium and high levels of economic development, such as italy, belgium, holland, and the united states of america ( ) . despite the presence of evidences regarding the efficacy of bcg, the latter countries have not adopted the universal policy of mandatory immunization against tuberculosis ( ) . live or attenuated vaccines against measles and smallpox as well as the oral polio vaccine are also effective in inducing innate cross-protection against other unrelated viral infections. the hypothesis that all vaccinated children are protected or are less likely to develop severe symptoms of the sars-cov- has been contested by many investigators ( , ) . therefore, we need to wait for the results of the clinical trials that are currently underway. in brazil, epidemiological data on tuberculosis, published by the ministry of health on march , indicates that the incidence of the disease ( - cases/ thousand inhabitants) has not changed in the last years ( ). rio de janeiro, amazonas, pará, roraima, and acre are the states with a tuberculosis incidence higher than the national average. in addition, mortality is higher than the national average ( . deaths / thousand inhabitants) in rio de janeiro, amazonas, pernambuco, rio grande do sul, pará, maranhão, rio grande do norte, ceará, and acre. vaccination, although recommended by the who (world health organization) for vulnerable populations, is not routinely employed, and only newborns receive the vaccine in brazil. since , the butantan institute has stopped the production of oral bcg (live strain); now, it only produces the bcg vaccine formulated using the recombinant tuberculin protein. to our knowledge, there are no published articles or clinical evidences that show that bcg immunization protects against sars-cov- in brazil. is innate memory more effective against sars-cov- than acquired memory? could bcg vaccination be a more promising therapeutic alternative than chloroquine? these are the questions that need to be addressed. scientific knowledge is accepted or rejected based on measures of probabilities. how evidence is transformed into scientific knowledge depends on statistical methods that define whether certain types of interferences (errors, biases, or confounding factors)-that occur either randomly or systematically-are leading to relevant clinical outcomes in patient cohorts ( ) . chloroquine has been used in the prevention and treatment of malaria since ( ) . its clinical use in the treatment of rheumatoid arthritis and lupus erythematosus has been approved using pre-established protocols and doses based on the disease stage and the clinical conditions of the patient. the side effects of chloroquine, such as retinopathy and ventricular arrhythmia, are well-known, and are rarely reported by patients ( ) . chloroquine should not be used in the absence of any medical supervision in patients with diabetes and heart problems, neither in people over who-among other problems-may have reduced kidney function. therefore, any clinical study aimed at assessing the therapeutic effects of chloroquine should not include volunteers or patients having such comorbidities; therefore, these caveats should be included as a part of the trial protocol when establishing the inclusion and exclusion criteria. a previous study in a small patient cohort showed evidence that chloroquine could exhibit therapeutic effects in patients with covid- ( ) . the journal the lancet, in may , published the results of an observational, longitudinal, and retrospective clinical study based on medical records of covid- patient cohorts treated across countries and hospitals, with different technical capabilities and diverse drug protocols ( ) . the results suggested that chloroquine and hydroxychloroquine-and their combination with azithromycin-did not result in any clinical benefit; on the contrary, they worsened the condition of the patients. however, in these studies, patients with several comorbidities were evaluated, including those with cardiovascular disease (including congestive heart failure and history of heart failure arrhythmia), current or previous smoking history, history of hypertension, diabetes, or hyperlipidemia, or chronic obstructive pulmonary disease (copd). these trials also reported that % of the treated patients needed admission to an intensive care unit (icu) and assisted ventilation (severe case of the disease) against only % in the control group. the authors concluded that all underlying diseases (comorbidities)-considered as confounding factors-influenced the mortality rate; this was the most relevant outcome of the study. the secondary outcome of interest was related to ventricular arrhythmia. it was mentioned that, among the patients in the control group, a small population ( %, ) had a history of heart disease, whereas ( %) suffered from de novo ventricular arrhythmia, along with in-hospital treatment, and survived. of the patients in the treatment group, died. a large number of patients in the non-survival population ( %, patients) had a history of cardiovascular disease. these were the patients for whom chloroquine treatment was not recommended because of the high risk of suffering from adverse effects, such as the prolonged qt interval and arrhythmia. in this group, as expected, patients ( . %) suffered from de novo ventricular arrhythmia ( ) . whether this effect was observed before or during the treatment, was not specified by the authors. the episodes of de novo ventricular arrhythmia could be induced by several factors and clinical conditions; these include treatment with chloroquine, hydroxychloroquine, or a combination of chloroquine and azithromycin or that of hydroxychloroquine and azithromycin, and-finally-the pathology caused by sars-cov- (as it was observed in patients in the control group). i think that the study was not useful-or was partially useful-for assessing the cause and effect relationship of the medications because of the heterogeneity of the confounding factors. in fact, this paper was retracted a few days after its publication. therefore, further studies are required to assess the effect of the tested medicaments in patients only having covid- illness at the early phase, in which the drugs appear to exhibit the expected therapeutic benefits. the uncertainties and dilemmas regarding covid- and its treatment can be attributed to the fact that everything we know about this disease is still insufficient. there is no other way to prove the veracity of scientific findings without the replication of facts and experiences. clinical trials in humans must be guided by the practice standards, norms, and rules established in the international conference on harmonization / good clinical practices (ich/gcp), while following the ethical principles of the helsinki declaration, proclaimed in june (www.wma.net), and the hippocratic oath, the origin of the modern medical ethics. to develop evidence-based effective public health strategies, all clinical protocols must be based on evidence, which is defined as the link between excellent scientific research and good clinical practices. transparency in clinical trials begins with trial registration at the who international clinical trials registry platform (ictrp), clinicaltrials.gov; as detailed before, the brazilian clinical trials registry (rebec) is involved in this process in brazil ( ) . although scientists are widely trusted and feted for their discoveries, they are repeatedly required to reexamine their findings using new technological strategies and new knowledge. the randomized clinical study (rct) is a scientific innovation; a way to draw better conclusions about cause and effect of medications or clinical procedures in matched and paired cohort groups. a doubleblind randomized clinical study is another scientific innovation; a way to avoid the interference of patients and investigators on the results. in this context, the effects of the placebo (inert drug) must be tested, and the effectiveness of the drug/vaccine must be higher in the treatment group than that in the placebo group. surrogate markers and secondary endpoints are commonly used in clinical trials to anticipate absolute primary outcomes, which will result in beneficial or adverse effects in the patients. equally important are the adoption of new strategies to analyze the data and draw scientific conclusions. robust statistical methods and welldesigned experiments are the fundamental requirements for testing novel treatments and repurposing existing drugs. the studies in progress-to evaluate the therapeutic effects of bcg and chloroquine in covid- -need to continue to answer these important questions and to reinstate peoplé s trust in science. in the meantime, many lives may be lost. therefore, we must exercise caution as to what types of evidence we can accept and share, and the types of arguments and reasons to publish any fact on a social network. ' acknowledgments my thanks to my colleagues at the clinics hospital and medical school of the university of são paulo for insights and productive discussions, and to the financial support from conselho nacional de desenvolvimento científico e tecnológico (grants / and / - / - ). immunological memory defining trained immunity and its role in health and disease considering bcg vaccination to reduce the impact of covid- bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study the bcg world atlas: a database of global bcg vaccination policies and practices is bcg vaccination causally related to reduced covid- mortality? version sars-cov- rates in bcg-vaccinated and unvaccinated young adults boletim epidemiológico secretaria de vigilância em saúde -ministério da saúde número especial why clinical trial outcomes fail to translate into benefits for patients chloroquine analogues in drug discovery: new directions of uses, mechanisms of actions and toxic manifestations from malaria to multifarious diseases hydroxychloroquine and azithromycin as a treatment of covid- : results of an open-label non-randomized clinical trial retracted: hydroxychloroquine or chloroquine with or without a macrolide for treatment of covid- : a multinational registry analysis practical and conceptual issues of clinical trial registration for brazilian researchers key: cord- -rppsmirp authors: carroll, maria v.; sim, robert b.; bigi, fabiana; jäkel, anne; antrobus, robin; mitchell, daniel a. title: identification of four novel dc-sign ligands on mycobacterium bovis bcg date: - - journal: protein & cell doi: . /s - - - sha: doc_id: cord_uid: rppsmirp dendritic-cell-specific intercellular adhesion molecule- -grabbing non-integrin (dc-sign; cd ) has an important role in mediating adherence of mycobacteria species, including m. tuberculosis and m. bovis bcg to human dendritic cells and macrophages, in which these bacteria can survive intracellularly. dc-sign is a c-type lectin, and interactions with mycobacterial cells are believed to occur via mannosylated structures on the mycobacterial surface. recent studies suggest more varied modes of binding to multiple mycobacterial ligands. here we identify, by affinity chromatography and mass-spectrometry, four novel ligands of m. bovis bcg that bind to dc-sign. the novel ligands are chaperone protein dnak, kda chaperonin- (cpn . ), glyceraldehyde- phosphate dehydrogenase (gapdh) and lipoprotein lprg. other published work strongly suggests that these are on the cell surface. of these ligands, lprg appears to bind dc-sign via typical proteinglycan interactions, but dnak and cpn . binding do not show evidence of carbohydrate-dependent interactions. lprg was also identified as a ligand for dc-signr (l-sign; cd ) and the m. tuberculosis orthologue of lprg has been found previously to interact with human toll-like receptor . collectively, these findings offer new targets for combating mycobacterial adhesion and within-host survival, and reinforce the role of dcsign as an important host ligand in mycobacterial infection. tuberculosis is the world's most prevalent infectious disease affecting a third of the global human population. the causative agent of tuberculosis, mycobacterium tuberculosis, avoids the destructive capacity of the host immune system by residing inside the phagosome of host mononuclear phagocytes (armstrong and hart, ; clemens and horwitz, ; sturgill-koszycki et al., ) . many studies have shown that m. tuberculosis, m. paratuberculosis and m. bovis bcg can bind to dendritic-cell-specific intercellular adhesion molecule- -grabbing non-integrin (dc-sign/cd ) to promote entry into human dendritic cells (dcs) and alveolar macrophages maeda et al., ; tailleux et al., ; pitarque et al., ; appelmelk et al., ) . a recent study indicates that a mutation of dc-sign causing lower expression is protective against tuberculosisinduced lung cavitation (vannberg et al., ) . dc-sign is a kda type ii transmembrane protein that consists of a carbohydrate recognition domain, neck domain, transmembrane domain and cytoplasmic tail. it is expressed mainly on dcs and on selected macrophage populations including alveolar macrophages (geijtenbeek et al., a; lee et al., ; maeda et al., ) . dc-sign is a calcium-dependent lectin and has a high affinity for mannosylated surfaces, forming tetrameric complexes when binding to high mannose glycoproteins, such as hiv gp (geijtenbeek et al., b; feinberg et al., ; mitchell et al., ; appelmelk et al., ) . dc-sign has been shown to bind lipolysaccharide le x and mannose structures found on bacteria, such as helicobacter pylori, klebsiella pneumonia and m. tuberculosis geijtenbeek et al., ; tailleux et al., ; van kooyk and geijtenbeek, ) . using purified cell wall components from mycobacteria, dc-sign was shown to bind lipoarabinomannan (lam) structures from m. tuberculosis, m. bovis and m. bovis bcg, all of which express mannose-capped lam (manlam). however, lam purified from m. smegmatis did not bind dc-sign, since it expresses uncapped lam, so-called aralam. similarly, lam from m. avium bound poorly to dc-sign since it expresses single mannose residue attachments and thus presents lower mannoside density maeda et al., ) . manlam was therefore believed to be the major ligand on m. tuberculosis for binding to dc-sign (maeda et al., ; tailleux et al., ) . however, later studies showed that removal of the mannose-cap in experiments using whole bacteria did not appear to have a dramatic effect on dc-sign binding. the faster growing mycobacteria such as m. smegmatis or m. avium could also bind dc-sign despite not having the mannose caps, suggesting that other components in the mycobacterial cell wall were also binding dc-sign. mannosylated lipoproteins found on the cell surface of mycobacteria such as kda lipoprotein lpqh/rv and a kda lipoprotein were shown to contribute to the binding of dc-sign to the bacteria (pitarque et al., ; appelmelk et al., ) . these studies have revealed that the binding interaction of dc-sign to m. tuberculosis is more complicated than originally perceived, and suggests that there may be more potential dc-sign ligands present on m. tuberculosis. in this study we set out to demonstrate dc-sign binding to m. bovis bcg as a model organism for m. tuberculosis. we explored the binding characteristics of dc-sign to whole m. bovis bcg and also observed the binding characteristics of a closely related protein, dc-signr (dc-sign-related/l-sign/cd ) to the mycobacterium. dc-signr shares % amino acid sequence identity with dc-sign (soilleux et al., ) . using affinity chromatography, we purified and identified four novel dc-sign binding ligands of m. bovis bcg: chaperone protein dnak (dnak), kda chaperonin- (cpn . ), glyceraldehyde- phosphate dehydrogenase (gapdh) and lipoprotein lprg. we set out first to confirm the binding of dc-sign to whole m. bovis bcg, using lung surfactant protein a (sp-a) and bsa as positive and negative controls respectively. we also compared the binding of dc-sign to that of dc-signr. by flow cytometry, we found that the binding of dc-sign and dc-signr to whole m. bovis bcg is dose-dependent ( fig. ) , reaching a maximum at a protein input of about μg per × cells ( fig. a) . sp-a also binds dosedependently, while bsa does not bind. binding of dc-sign and dc-signr are predominantly ca + -dependent, as binding is reduced by~ % in the presence of edta ( fig. b ) compared with binding in mm cacl . binding of sp-a appears less dependent on ca + ions, as binding is reduced < % in edta. mannose ( mm) inhibits the binding of dc-sign and sp-a by less than %, while binding of dc-signr is reduced by about % (fig. b ). these findings are compatible with the view that dc-sign, dc-signr and sp-a are all likely to be binding to several bacterial ligands and the results with mannose and edta suggest more than one mode of binding. for dc-signr, the results are consistent with its binding mainly (~ %) via its calcium-dependent carbohydrate binding site. for dc-sign and sp-a, a much smaller proportion ( %- %) of binding may be mediated via these sites, and other binding occurs via ca + -independent sites, and also via ca + dependent sites that do not constitute the canonical carbohydrate binding site. similar diversity for modes of binding of sp-a to viable and apoptotic mammalian cells has been observed previously (jäkel et al., a, b, c) . to identify macromolecules on the mycobacterial cell surface to which dc-sign is binding, m. bovis bcg lysates were passed through a dc-sign affinity chromatography column. bound proteins were eluted with buffer containing edta. the eluted proteins were then concentrated and resolved by sds-page. from the gel (fig. ) four visible bands can be seen at , , and kda. as a control m. bovis bcg lysates were passed through a control column made of underivatised sepharose in the same way. no protein was detected in the eluted fractions of the control column, indicating no non-specific binding interactions (not shown). the , , and kda bands were cut from the gel and analyzed by maldi-tof tryptic peptide fingerprinting mass spectrometry, and database searches carried out against both ncibr and swissprot. the bands were identified as chaperone protein dnak, kda chaperonin (cpn . ), glyceraldehyde- -phosphate dehydrogenase (gadph) and lipoprotein lprg, respectively ( table ). all of these have the same protein sequence in m. tuberculosis as in m. bovis bcg (table ) . two other minor candidates, ctp synthase and atp synthase beta subunit (table ) were not considered further. dnak and cpn . are collectively known as heat shock proteins or chaperone proteins. cpn . generated the highest protein score, with nine peptide sequences matched. these peptide sequences cover . % of the protein sequence (table ). the protein ran at~ kda on a sds-page gel and was calculated to have a mass of , da from the amino acid sequence ( fig. and table ). the second highest protein score was for dnak. this protein band produced four matching peptides sequences which contribute . % sequence coverage. it ran at~ kda on sds-page and had a calculated mass from the amino acid sequence of , da ( fig. and table ) . toward the c-terminal of cpn . , there is one possible nlinked glycosylation site at n as (fig. ) . this potential n-linked glycosylation site occurs in one of the cpn . peptides identified during mass spectrometry. this indicates that the site was not occupied by an oligosaccharide otherwise the peptide molecular mass would have been affected and unidentifiable during analysis. the site may be partially occupied indicating that there may be another population of this protein with an n-linked glycan present at n . however, the form of this protein identified after capture by the affinity column was not glycosylated at this position, and it is therefore very unlikely that dc-sign binds to this ligand via its ca + -dependent lectin activity. similarly, no potential n-linked glycosylation sites for dnak were found ( fig. ) , suggesting that it also is not bound to dc-sign via nglycans. from the current literature it is unknown whether these proteins undergo any o-linked glycosylation, but use of in silico o-glycosylation prediction tools available at the expasy (expert protein analysis system) proteomics server (http://expasy.org/tools/; gasteiger et al., ) indicates no predicted o-glycosylation in either protein. a recent study (hickey et al., ) showed that dnak is located at the cell-surface of m. tuberculosis. there are no published data on the localization of cpn . , but a related protein, cpn . was also shown to be on the cell surface of m. tuberculosis, and has a role in the adherence of m. tuberculosis to macrophages (hickey et al., ). cpn . and cpn . show % amino acid sequence identity (kong et al., ) . hickey et al. ( ) showed that macrophages formed specific interactions with m. tuberculosis, which could be inhibited by pre-incubation with increasing concentrations of cpn . or by blocking surface localized cpn . with f(ab') antibody. this was supported by showing that purified cpn . could bind to the surface of macrophages. although dnak was also shown to be located at the mycobacterial cellsurface, hickey et al. ( ) could not show consistent binding via dnak to macrophages using antibodies to block the reaction. this may have been due to a lack of appropriate anti-dnak antibodies. in listeria monocytogenes, dnak has been shown to facilitate phagocytosis of the pathogen into macrophages (hanawa et al., ) . the same authors observed that wild type bacteria were endocytosed more than dnak knockouts. once inside the macrophage dnak was shown not to be essential for multiplication within the cell although it was necessary for cell entry. studies looking at the pathogenic role of the dnak and its co-chaperone dnaj, in salmonella enterica serovar typhimurium revealed that they are both essential for internalising the bacteria within epithelial cells and survival within macrophages (takaya et al., ) . cpn . and cpn . are potent immunomodulatory proteins in the host. cpn . has been shown to be a more potent activator of stimulatory proinflammatory cytokines (friedland et al., ; lewthwaite et al., ; hu et al., ) . despite chaperones being more commonly known as cytosolic proteins, many pathogenic bacteria express these proteins at the cell-surface possibly to promote attachment to host cells and mediate internalization. cpn proteins have been reported to demonstrate these functions in helicobacter pylori, clostridium difficile, hemophilus ducreyi and salmonella enterica serovar typhimurium (yamaguchi et al., ; frisk et al., ; hennequin et al., ) . here we demonstrate that cpn . can also interact with dc-sign and propose that this could aid the entry of mycobacterial cells into dc or macrophage. gapdh was also identified as one of four dc-sign binding ligands in this study. running at~ kda on sds-page (fig. ) , gapdh was identified with three peptide matches, covering . % of the protein sequence. the calculated mass of the protein is , da and two potential n-linked glycosylation sites are present in the sequence, n st and n as (table , fig. ). these two potential nlinked glycosylation sites may be occupied by carbohydrate structures required for dc-sign binding via its crd. this protein has significant homology to the gapdh enzymes indentified in group a streptococcus, enteropathogenic e. coli, and candida albicans (parker and bermudez, ) . gapdh is an important enzyme in both prokaryotic and eukaryotic metabolism that catalyzes a step of glycolysis, converting glyceraldehyde- -phosphate to glycerate , -bisphosphate. gapdh is more commonly recognized as a cytosolic enzyme found on the inner surface of the cell membrane. even though there is no apparent signal sequence or stretch of hydrophobic residues to indicate a transmembrane region (fig. ) , studies have reported that a kda protein homologous to gapdh is expressed on the outer cell membrane of hematopoietic cells (allen et al., ) and also on many microorganisms such as group a streptococcus, enteropathogenic e. coli, candida albicans, mycobacterium avium and schistosoma mansoni (goudot-crozel et al., ; pancholi and fischetti, ; kenny and finlay, ; gil-navarro et al., ; parker and bermudez, ) . m. avium expresses gapdh on its cell surface, whereupon gapdh can bind to human epidermal growth factor. in the presence of recombinant human epidermal growth factor the rate of growth of m. tuberculosis and m. avium is rapidly increased (parker and bermudez, ) . another dc-sign ligand purified by affinity chromatography was identified as lprg, a kda lipoprotein. lprg actually runs with an apparent molecular weight of kda on sds-page (fig. ) and was identified with only one peptide hit with a protein score of . , covering . % of the protein sequence. the calculated mass of the protein is , da (fig. ) . the identification of lprg was supported by western blot analysis. as shown in fig. , in eluted fractions de - , de - and de - from dc-sign affinity chromatography, a strong band can be seen representing lprg. lprg has two potential n-linked glycosylation sites, one of which (n pt) is unoccupied or only partially occupied since it lies in one of the peptides identified by mass spectrometry. the other site, n at may be occupied. ligand blot analysis (fig. ) of whole m. bovis bcg lysate incubated with either i-dc-sign or i-dc-signr revealed that dc-sign and dc-signr both bind the same protein at around kda, which corresponds to lprg in our sds-page system, and is the only ligand detected by this method. dc-sign and dc-signr binding to lprg can therefore still occur when the mycobacterial protein has been denatured by sds-page. this strongly suggests that lprg binds to dcsign predominantly or entirely via protein-carbohydrate interactions. in other studies looking at the importance of lprg in m. tuberculosis, knockout of the lprg operon was shown to attenuate m. tuberculosis, indicating that it has a prominent role in the pathogenic behavior of the bacterium (bigi et al., ) . furthermore, lprg has been identified as a ligand for tlr- on macrophages, and lprg-tlr- interactions lead to reduced mhc class ii presentation (gehring et al., ) . there is also growing evidence indicating that intracellular signaling via dc-sign modifies transduction pathways downstream from tlrs, driving immunosuppressive responses (gringhuis et al., (gringhuis et al., , . several other m. tuberculosis lipoproteins that are either glycosylated or presumed to be glycosylated also have been identified as key antigens with immunomodulatory functions (herrmann et al., ) . lpqh ( kda) was confirmed to have seven o-linked glycosylation sites (herrmann et al., ) . it has the same protein sequence in m. tuberculosis as in m. bovis bcg and was previously identified as a ligand for dc-sign (pitarque et al., ) possibly binding via glycans. we were unable accurately to detect lipoproteins below bovis bcg lysate in mm hepes, mm nacl, mm cacl ph . . the sepharose was placed in a column and washed and bound proteins were eluted with mm hepes, mm nacl, mm edta ph . . eluted fractions were concentrated with strataclean beads and prepared in reducing conditions for analysis by sds-page. concentrated eluates were run on %- % gradient gel. as a negative control, underivatised sepharose was incubated with the lysate in the same way (results not shown). ls, µl of m. bovis bcg lysate; rt, µl lysate proteins not bound to the column ("run-through"); de - , concentrated eluted fractions - from the dc-sign column. bands marked by black arrows were used for mass spectrometry analysis. results are representative of three independent experiments. kda in the affinity chromatography experiment shown in fig. due to limitations in the sds-page system used, but in fig. (ligand blotting) no band in the position of lpqh is seen. this suggests either that lprg is a much better ligand (more abundant or higher affinity) or that lpqh does not bind via glycans. lprg binds to both dc-sign and dc-signr. dc-signr is expressed in the liver, lymph nodes but has also been described in the lung (pöhlmann et al., ; jeffers et al., ) . in humans, both dcs and alveolar macrophages express dc-sign in the lungs. although dc-signr has a different expression pattern from dc-sign, it has similar binding properties to dc-sign (bashirova et al., ; mitchell et al., ; pöhlmann et al., ) . while dc-sign has been shown to mediate endocytosis and protein trafficking as a recycling receptor and the release of bound ligand at reduced ph, dc-signr does not endocytose nor demonstrate ph-sensitive ligand binding (guo et al., ) . dc-sign has been implicated as an important receptor in the establishment of m. tuberculosis infection. although many dc-sign ligands have been identified at the cell-surface of the mycobacterium, studies suggested that there were more ligands present that had not yet been identified. here, we have shown dc-sign binds to whole m. bovis bcg in both ca + -dependent and ca + -independent modes. we have identified four novel ligands for dc-sign. of these only one, lprg appears to bind predominantly via the glycan binding site. lprg is also a ligand for dc-signr. dendritic cells present in the lung migrate in order to prime t lymphocytes in the lymph nodes. it is believed that m. tuberculosis resides within the phagosome of the dc and exploits the migration thereby circulating within the host undetected (fenton and vermeulen, ; henderson et al., ; banchereau and steinman, ) . the discovery of new dc-sign binding ligands: dnak, cpn . , gapdh and lprg, may help further research into designing inhibitors to prevent interactions between dc-sign and m. tuberculosis with the aim of blocking uptake and intracellular survival of mycobacterial cells. liquid cultures of mycobacterium bovis bcg (pasteur strain) were grown as described previously (carroll et al., ) in middlebrook h liquid medium containing . % (v/v) glycerol, . % (v/v) tween- , and % (v/v) albumin-dextrose-catalase (adc, bd bbl prepared culture medium: becton dickinson, oxford, uk). fresh cultures were inoculated from ml glycerol stock of m. bovis bcg to generate a ml culture. the 'first passage' was grown for four to five days at °c in roller bottles at rpm until the bacteria had reached the exponential growth phase (od nm = . − . ). only the first passages of the strains were used for experimental work. m. bovis bcg cell cultures ( ml) were harvested at exponential phase and cells were washed three times in mm nacl, . mm kcl, . mm na hpo and . mm kh po , ph . (pbs). cells were resuspended in ml mm tris, mm nacl, . % triton x- , ph . in the presence of protease inhibitors (protease inhibitor cocktail, roche diagnostics, mannheim germany) and kept on ice for min. the cells were then ribolysed in ribolysing tubes containing lysing matrix b (mpbiomedicals, illkirch, france) for s at speed setting . in a ribolyser (fastprep fp ). lysate was placed on ice for min before being spun down. to reduce viscosity, mycobacterial lysate was incubated with μg/ml of rnase a (r sigma aldrich,poole uk) for min at °c. lysate buffer was adjusted to . mm cacl , . mm mgcl and incubated with μg/ml dnase ii (d , sigma aldrich) for min at °c. the lysate was then stored at − °c until needed. recombinant, tetrameric dc-sign and dc-signr (complete extracellular domains, lacking the transmembrane segment) were made and purified as described previously . these were used in either unmodified, biotinylated or radioiodinated form. biotinylation was performed using n-hydroxysuccinimide biotin (sigma-aldrich, poole, uk) at a molar ratio of : reagent : protein at ph . , °c for min. radioiodination was done as a standard iodogen-catalyzed reaction (krarup et al., ) with µg of protein in pbs and uci of na i (ge healthcare, uk, product ims- ). sp-a was purified from human alveolar proteinosis broncho-alveolar lavage fluid as described by jäkel et al. ( a) . m. bovis bcg ( × cells) were fixed in . % paraformaldehyde in pbs, mm cacl . cells were washed in µl mm hepes, mm nacl, mm cacl , ph . (assay buffer) and resuspended in µl of the same buffer. cells were incubated with , , , µg of biotinylated-dc-sign or biotinylated-dc-signr for h at room temperature in assay buffer. incubations were also carried out in the presence of mm mannose and mm edta as potential inhibitors figure . western blot confirmation of lprg binding to dc-sign-sepharose. sds-page of concentrated eluted fractions were transferred to a pvdf membrane and blocked. the membrane was incubated with rabbit anti-lprg antiserum, then washed and incubated with goat anti-rabbit-horseradish peroxidase (hrp)-conjugated antibody. the membrane was washed and exposed to enhanced chemiluminescence western blot detection reagents. the bands were visualized by exposing the membrane to xray film for a few seconds. results are representative of independent experiments. ls, lysate; rt, run-through; de - , eluted fractions from the dc-sign column; ge - , eluted fractions from the guard (underivatised sepharose) column. of binding to m. bovis bcg. cells were washed and incubated with : dilution of streptavidin-pe solution ( bd pharmingen, oxford, uk) for min in µl assay buffer and fixed in µl of . % paraformaldehyde in pbs, mm cacl . binding to the cells was measured by flow cytometry using a facscan instrument (becton dickinson immunocytometry systems, san jose, ca, usa). aquisition and processing of data from , cells per sample were carried out with the cellquest software (becton dickinson). surfactant protein-a (sp-a) was used as positive control (downing et al., ; pasula et al., ; weikert et al., ) and was detected using a biotinylated anti-sp-a monoclonal antibody (antibodyshop, gentofte, denmark); biotinylated bsa was used as a negative control for binding to m. bovis bcg. soluble recombinant dc-sign extracellular domain protein ( ml, mg/ml) in mm hepes, mm nacl, mm cacl , ph . was incubated with ml hydrated cnbr-activated sepharose (ge healthcare, chalfont st. giles, uk) for h at room temperature with rotation. the resin was washed twice in m nacl and then incubated in ml mm ethanolamine, ph . for h at room temperature with rotation. the resin was washed twice in m nacl and stored in mm hepes, mm nacl, mm edta, ph . . fifteen percent of the dc-sign supplied remained unbound, as assessed by measuring protein od in the supernatant after binding. capacity of the dc-sign-sepharose for capturing glycoprotein ligand was confirmed using a test solution containing µg of yeast invertase ( % oligomannose by mass) loaded onto the column in ml of mm hepes, mm nacl, mm cacl ph . (equilibration buffer) and eluted with mm hepes, mm nacl, mm edta ph . (eluting buffer). successful capture and elution of ligand was visualized by sds-page. the dc-sign-sepharose column was regenerated with mm hepes, m nacl, mm edta ph . (regeneration buffer). the column was then equilibrated with equilibration buffer. lysate treated with rnase and dnase was diluted with one volume of mm hepes, mm nacl, . mm cacl , ph . to obtain ml with a protein concentration of about mg/ml. as a control, a second column ( ml) was made from underivatised sepharose (guard column) and prepared in equilibration buffer. lysate ( ml) was added to the guard column and the beads were stirred at intervals during an incubation period of h at °c. the lysate was then run off and loaded onto the dc-sign column. beads were resuspended and incubated with the lysate as above. both columns were washed exhaustively with equilibration buffer. bound ligands were eluted with eluting buffer and . ml fractions collected. eluted proteins were detected by reading od , and positive fractions were pooled and the protein concentrated by binding to µl strataclean beads (stratagene, cedar creek, tx, usa) per ml of eluted fraction. beads were incubated with eluates on a rotary stirrer for h. beads were spun down and prepared for analysis by sds-page. sds-page was performed using the invitrogen nupage® system (invitrogen, cambridge, uk). samples were prepared as described by fairbanks et al. ( ) . a total of µl strataclean beads per concentrated fraction were prepared in reducing conditions for sds-page and loaded per well. sds-page was run with seeblue ® plus prestained standard (invitrogen) to facilitate band size estimation. protein bands were transferred to a polyvinylidene fluoride (pvdf) microporous membrane (millipore, billerica, massachusetts, usa) in mm tris-hcl, mm glycine, % (v/v) methanol, ph . (transfer buffer) for h using a semi-dry blotter (whatman international ltd. banbury, uk). the membrane was blocked with pbs, . % tween- , mg/ml bsa for h. the membrane was washed with pbs, . % tween- , . mm edta (washing buffer) and incubated with : dilution of rabbit anti-lprg antiserum (bigi et al., ) in pbs, mg/ml bsa for h at room temperature. the membrane was washed in washing buffer and incubated with : , dilution goat anti-rabbit-horseradish peroxidase-conjugated antibody (sigma aldrich, a ) in pbs, mg/ml bsa for h. the membrane was washed in washing buffer and exposed to enhanced chemiluminescence western blot detection reagents (ge healthcare) for detection. bands were detected by exposing the membrane to x-ray film. sds-page of reduced m. bovis bcg lysate was run and protein bands were transferred to a pvdf microporous membrane and blocked as above. the membrane was washed with mm hepes, figure . radiolabelled dc-sign and dc-signr binding to m. bovis bcg blot. sds-page of m. bovis bcg lysate was run and protein bandswere transferred to a pvdf membrane, blocked and incubated with ml of , dpm/ml of either i-dc-sign or i-dc-signr. the bands were then visualized by exposing the membrane to x-ray film for week. mm nacl, mm cacl , . % tween- ph . and incubated with ml of , dpm/ml of either i-dc-sign or i-dc-signr for h at room temperature. the membrane was washed with mm hepes, mm nacl, mm cacl , . % tween- ph . and bands were visualized by exposing the membrane to x-ray film in a lightproof cassette for week. protein bands from sds-page gels were stained with either safestain (invitrogen) or coomassie blue r- stain (fairbanks et al., ) and destained in % (v/v) acetic acid, % (v/v) ethanol. individual bands were excised and subjected to ms-ms analysis. mass spectrometric analysis was carried out using a q-tof (micromass, manchester, uk) coupled to a caplc (waters, milford, usa). in-gel trypsin digestion was carried out as described by shevchenko et al. ( ) . tryptic peptides were concentrated and desalted on a µm id/ mm c pre-column and resolved on a µm id/ cm c pepmap analytical column (lc packings, san francisco, ca, usa). peptides were eluted to the mass spectrometer using a min %- % (v/v) acetonitrile gradient containing . % (v/v) formic acid at a flow rate of nl/min. spectra were acquired in positive mode with a cone voltage of v and a capillary voltage of v. the ms to ms/ms switching was controlled in an automatic data-dependent fashion with a s survey scan followed by three s ms/ms scans of the most intense ions. precursor ions selected for ms/ms were excluded from further fragmentation for min. spectra were processed using proteinlynx global server . . and searched against the swissprot_ . and ncbinr_ databases using the mascot search engine (matrix science, london, uk). database searches were performed with the taxonomy restricted to mycobacteria. carbamidomethyl cysteine was set as a fixed modification and oxidised methionine as a potential variable modification. data was searched allowing . da error on all spectra and up to one missed tryptic cleavage site. identification of the -kda protein displaying a variable interaction with the erythroid cell membrane as glyceraldehyde- -phosphate dehydrogenase cutting edge: carbohydrate profiling identifies new pathogens that interact with dendritic cell-specific icam- -grabbing nonintegrin on dendritic cells the mannose cap of mycobacterial lipoarabinomannan does not dominate the mycobacterium-host interaction phagosome-lysosome interactions in cultured macrophages infected with virulent tubercle bacilli. reversal of the usual nonfusion pattern and observations on bacterial survival dendritic cells and the control of immunity a dendritic cell-specific intercellular adhesion molecule -grabbing nonintegrin (dc-sign)-related protein is highly expressed on human liver sinusoidal endothelial cells and promotes hiv- infection a novel kda lipoprotein antigen from mycobacterium bovis the knockout of the lprg-rv operon produces strong attenuation of mycobacterium tuberculosis multiple routes of complement activation by mycobacterium bovis bcg characterization of the mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited surfactant protein a promotes attachment of mycobacterium tuberculosis to alveolar macrophages during infection with human immunodeficiency virus electrophoretic analysis of the major polypeptides of the human erythrocyte membrane structural basis for selective recognition of oligosaccharides by dc-sign and dc-signr immunopathology of tuberculosis: roles of macrophages and monocytes mycobacterial -kd heat shock protein induces release of proinflammatory cytokines from human monocytic cells groel heat shock protein of haemophilus ducreyi: association with cell surface and capacity to bind to eukaryotic cells expasy: the proteomics server for in-depth protein knowledge and analysis mycobacterium tuberculosis lprg (rv c): a novel tlr- ligand that inhibits human macrophage class ii mhc antigen processing identification of dc-sign, a novel dendritic cell-specific icam- receptor that supports primary immune responses dc-sign, a dendritic cell-specific hiv- -binding protein that enhances transinfection of t cells mycobacteria target dc-sign to suppress dendritic cell function the glycolytic enzyme glyceraldehyde- -phosphate dehydrogenase of candida albicans is a surface antigen the major parasite surface antigen associated with human resistance to schistosomiasis is a -kd glyceraldehyde- p-dehydrogenase c-type lectin dc-sign modulates toll-like receptor signaling via raf- kinase-dependent acetylation of transcription factor nf-kappab carbohydrate-specific signaling through the dc-sign signalosome tailors immunity to mycobacterium tuberculosis, hiv- and helicobacter pylori structural basis for distinct ligand-binding and targeting properties of the receptors dc-sign and dc-signr the listeria monocytogenes dnak chaperone is required for stress tolerance and efficient phagocytosis with macrophages activation of human dendritic cells following infection with mycobacterium tuberculosis groel (hsp ) of clostridium difficile is involved in cell adherence analysis of post-translational modification of mycobacterial proteins using a cassette expression system mycobacterium tuberculosis cpn . and dnak are located on the bacterial surface, where cpn . facilitates efficient bacterial association with macrophages a mycobacterium tuberculosis mutant lacking the groel homologue cpn . is viable but fails to induce an inflammatory response in animal models of infection the human lung surfactant proteins a (sp-a) and d (sp-d) interact with apoptotic target cells by different binding mechanisms surfactant protein a (sp-a) binds to phosphatidylserine and competes with annexin v binding on late apoptotic cells surfacebound myeloperoxidase is a ligand for recognition of late apoptotic neutrophils by human lung surfactant proteins a and d cd l (l-sign) is a receptor for severe acute respiratory syndrome coronavirus protein secretion by enteropathogenic escherichia coli is essential for transducing signals to epithelial cells mycobacterium tuberculosis expresses two chaperonin- homologs simultaneous activation of complement and coagulation by mbl-associated serine protease cis expression of dc-sign allows for more efficient entry of human and simian immunodeficiency viruses via cd and a coreceptor mycobacterium tuberculosis chaperonin . is a more potent cytokine stimulator than chaperonin . (hsp ) and contains a cd -binding domain the cell surface receptor dc-sign discriminates between mycobacterium species through selective recognition of the mannose caps on lipoarabinomannan a novel mechanism of carbohydrate recognition by the c-type lectins dc-sign and dc-signr. subunit organization and binding to multivalent ligands a major surface protein on group a streptococci is a glyceraldehyde- -phosphate-dehydrogenase with multiple binding activity sequence and characterization of the glyceraldehyde- -phosphate dehydrogenase of mycobacterium avium: correlation with an epidermal growth factor binding protein surfactant protein a (sp-a) mediates attachment of mycobacterium tuberculosis to murine alveolar macrophages deciphering the molecular bases of mycobacterium tuberculosis binding to the lectin dc-sign reveals an underestimated complexity dc-signr, a dc-sign homologue expressed in endothelial cells, binds to human and simian immunodeficiency viruses and activates infection in trans in-gel digestion for mass spectrometric characterization of proteins and proteomes dc-sign; a related gene, dc-signr; and cd form a cluster on p mycobacterium-containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis dc-sign is the major mycobacterium tuberculosis receptor on human dendritic cells the dnak/dnaj chaperone machinery of salmonella enterica serovar typhimurium is essential for invasion of epithelial cells and survival within macrophages, leading to systemic infection dc-sign: escape mechanism for pathogens cd genetic polymorphism and tuberculosis disease sp-a enhances uptake of bacillus calmette-guérin by macrophages through a specific sp-a receptor flow cytometric analysis of the heat shock protein expressed on the cell surface of helicobacter pylori cpn . , kda chaperonin- ; dc, dendritic cell; dc-sign/cd , dendritic-cell-specific intercellular adhesion molecule- -grabbing non-integrin; gapdh, glyceraldehyde- -phosphate dehydrogenase key: cord- - qz aw authors: cheung, benny kw; yim, howard ch; lee, norris cm; lau, allan sy title: a novel anti-mycobacterial function of mitogen-activated protein kinase phosphatase- date: - - journal: bmc immunol doi: . / - - - sha: doc_id: cord_uid: qz aw background: mycobacterium tuberculosis (mtb) is a major cause of morbidity and mortality in the world. to combat against this pathogen, immune cells release cytokines including tumor necrosis factor-α (tnf-α), which is pivotal in the development of protective granulomas. our previous results showed that bacillus calmette guerin (bcg), a mycobacterium used as a model to investigate the immune response against mtb, stimulates the induction of tnf-α via mitogen-activated protein kinase (mapk) in human blood monocytes. since mapk phosphatase- (mkp- ) is known to regulate mapk activities, we examined whether mkp- plays a role in bcg-induced mapk activation and cytokine expression. results: primary human blood monocytes were treated with bcg and assayed for mkp- expression. our results demonstrated that following exposure to bcg, there was an increase in the expression of mkp- . additionally, the induction of mkp- was regulated by p mapk and extracellular signal-regulated kinase and (erk / ). surprisingly, when mkp- expression was blocked by its specific sirna, there was a significant decrease in the levels of phospho-mapk (p mapk and erk / ) and tnf-α inducible by bcg. conclusions: since tnf-α is pivotal in granuloma formation, the results indicated an unexpected positive function of mkp- against mycobacterial infection as opposed to its usual phosphatase activity. tuberculosis (tb) remains a major cause of morbidity and mortality in the world, especially in the developing countries [ ] . the disease is caused by mycobacterium tuberculosis (mtb) and approximately one third of the world's population has been infected by this pathogen. in a recent report, world health organization (who) estimated that there are . million new tb cases around the world in [ ] . in response to mtb infection, induction of cytokines by immune cells is an important defense mechanism. the infected macrophages secrete intercellular signaling factors, proinflammatory cytokines, to mediate the inflammatory response leading to the formation of granuloma and induction of t-cell mediated immunity [ ] . in order to understand tb pathogenesis, signaling pathways induced by mycobacteria have long been a subject of interest. mitogen activated protein kinases (mapks) including extracellular signal-regulated kinase and (erk / ), p mapk, and c-jun n-terminal kinase (jnk) have been implicated as important cellular signaling molecules activated by mycobacteria [ ] . previous reports have shown that p mapk and erk / are required in the induction of tnf-α expression in human monocytes infected with m. tuberculosis h rv [ ] . we have further revealed the significant role of mapks in the signal transduction events of mycobacterial activation of primary human blood monocytes (pbmo) leading to cytokine expressions via the interaction with pkr [ ] . however, the subsequent events as to how mapk is regulated and how such regulation affects cytokine production in response to mycobacteria remain to be elucidated. since mapks are activated by phosphorylation, dephosphorylation of mapks seems to be an efficient process to inactivate their activities. it can be achieved by specific protein kinase phosphatases which can remove the phosphate group from mapks. examples of these phosphatases include tyrosine phosphatases, serine/threonine phosphatases, and dual-specificity phosphatases (dusps). some dusps are also known as mapk phosphatases (mkps) [ ] [ ] [ ] . currently, there are at least mkps identified, while mkp- is the most studied member of the family. the regulatory role of mkp- on cytokine induction is best demonstrated by mkp- knockout (ko) macrophages in response to lipopolysaccharide (lps), a cell wall component of gram-negative bacteria. mkp- ko macrophages showed prolonged phosphorylation of p mapk and jnk as well as increased production of tnf-α in response to lps treatment [ ] . consistent with these results, another group further revealed that lps-treated mkp- ko bone marrow-derived macrophages show increased ap- dna-binding activity [ ] . also, they showed that lps-induced mkp- expression is dependent on myeloid differentiation factor (myd ) and tir domain-containing adaptor inducing ifn-β (trif) [ ] , thus demonstrating the role of mkp- in signal transduction. not only lps, other tlr inducers including cpg, peptidoglycan, poly ic, and pam cys can regulate cytokine expressions including tnf-α, il- via mkp- activities [ , ] . in these processes, mkp- serves to mitigate the undesirable effects of septic shock and maintain organ functions by restraining the inflammatory responses following bacterial infection. another example of mkp- function is the immune response to staphylococcus aureus (s. aureus), a gram positive bacteria. there are higher levels of cytokine production including tnf-α, il- , and mip- α in mkp- ko mice infected with s. aureus [ ] . also, the mice would have a rapid development of multiorgan dysfunction as well as faster mortality rate upon challenge with heat-killed s. aureus [ ] . taken together, these results suggest that mkp- protects the host from overactivation of the immune system in response to gram negative or gram positive bacteria. in the past, it was believed that different mkp/dusp family members have overlapping functions. however, the emergence of dusp turned the concept up side down [ ] . it was shown that dusp behaves differently and is opposite to the function as stated above. in dusp ko cells, they produced less inflammatory mediators, implying that dusp may play a role in mediating instead of limiting inflammation. for instances, when dusp ko macrophages were treated with lps, there were less tnf, il- , nitric oxide, il- -producing cells when compared to those of the wild type counterparts [ ] . when the dusp ko bone marrow-derived mast cells were first sensitized with immunoglobulin e (ige) receptor (fcεri) and then stimulated with dinitrophenol-heat stable antigen, they produced lower tnf mrna levels, diminished il- production, less phosphorylation of erk / , p mapk, and less transcriptional activities by elk and nfat-ap- [ ] . these unexpected positive regulations of immune cell functions by dusp have been hypothesized to be due to crosstalks between mapks [ ] . stimulation of ko mast cells and macrophages showed increases in phosphorylation of jnk. moreover, inhibition of jnk by small molecule inhibitors showed increases in phosphorylation of erk [ ] . the authors also showed that there were physical interactions of dusp with erk , dusp with jnk , as well as dusp and p mapk after stimulation of the cells with dinitrophenol-heat stable antigen. nevertheless, the details of the crosstalks between mapks and phosphatases need further investigation. thus, the mkp family plays a critical role in the regulation of immune responses. innate immune response protects the host from mtb infection by secretion of cytokines including tnf-α in immune cells. meanwhile, mapk is one of the critical proteins in the regulation of immunity and cytokine expression. since mapk is regulated by mkp- in response to lps and the activation of mapk is important in bcginduced cytokine expression, we hypothesize that mkp- plays a critical role in the immune regulation of bcg in human monocytes. we examined the involvement of mkp- in bcg-induced mapk activation and its consequent cytokine expression. here, we present evidences that mkp- plays an unexpected role in the regulation of cytokine induction by bcg through its control of mapk phosphorylation. it has been reported that many inducers including growth factors, lps, peptidoglycan, and dexamethasone can stimulate the expression of mkp- in human macrophages, microglia, mast cells or fibroblasts [ ] . to investigate the role of different tlr inducers in mkp- induction process in human blood monocytes, the level of mkp- mrna was measured by quantitative polymerase chain reaction (qpcr) method. pbmo were isolated from primary human blood mononuclear cells and stimulated with pam cys (tlr agonist), poly ic (tlr agonist), or lps (tlr agonist) for and hours. following exposure to pam cys or lps, there were significant inductions of mkp- mrna levels within hour of treatment ( figure a ). these effects on mkp- induction continued for hours post-treatment with pam cys ( figure a ). in contrast, poly ic did not induce mkp- ( figure a ). the results indicate that different inducers showed differential up-regulation of mkp- expression. lps has been extensively used to demonstrate the role of mkp- in immune response both in vivo and in vitro [ , ] . to establish a foundation for interpretation of subsequent experimental results, lps was used as a positive control for the induction of mkp- expression. to determine the levels of mkp- in response to lps, kinetics of mkp- transcription were determined by qpcr. there was a significant induction of mkp- mrna, which peaked as early as hour upon lps stimulation, and the levels gradually decreased over a course of hours. these results showed that lps induced mkp- expression (figure b) . next, to demonstrate the induction of specific phosphatases by bcg, kinetics of mkp- expression in pbmo was studied by using qpcr during bcg treatment. similar to the results produced by lps, upon the addition of bcg (moi = cfu/cell), there was a significant induction of mkp- mrna within hour of bcg treatment as determined by taqman probe specific for mkp- ( figure a ). the effects lasted for at least hours ( figure a ). to examine whether the changes of protein production were in parallel to that of the mrna levels, the protein levels of mkp- were measured by western blotting. in response to bcg, pbmo produced the mkp- protein as early as minutes after treatment. the protein levels were maintained for hours and dropped to basal levels at hours ( figure b ). the results demonstrated that there was mkp- induction in response to bcg activation in human monocytes. it has been shown that inhibition of p mapk either by specific inhibitor or sirna reduced the expression of mkp- in lps-or peptidoglycan-treated macrophages [ ] . to determine the mechanisms involved in the bcginduced mkp- expression, pbmo were pretreated with several inhibitors including pd (inhibitor for map kinase kinase [mek] or erk / ), sb (inhibitor for p mapk), sp (inhibitor for jnk), and cape (inhibitor for nf-κb) for hour. a range of concentrations of each inhibitor was used to test their optimal concentrations and effects on cell viability and kinase inhibitions. bcg was added afterwards and total rna was harvested. the results demonstrated that, with the inhibition of erk / and p mapk activities by their corresponding relatively specific inhibitors, mkp- expressions were significantly reduced ( figure ). in addition, using higher dose of sb , we showed that the inhibition is increased further (data not shown). on the contrary, pretreatment of the cells with cape and sp did not affect the induction of mkp- by bcg ( figure ). these results suggest that bcg-induced mkp- expression is dependent on both p mapk and erk / . throughout the above experiments, the primary goal was to examine the induction of mkp- by bcg in human monocytes. thus, to further examine the role of mkp- in bcg-induced signaling, transfection of sirna into pbmo was used to knockdown the activity of mkp- . to demonstrate that the mkp- sirna can indeed knockdown the target gene, pbmo were first transfected with control or mkp- sirna and then treated with bcg for hours. levels of mkp- mrna were measured by rt-pcr method. in figure a , bcg stimulated mkp- expression (lanes and ). in mkp- sirna transfected monocytes, induction of mkp- by bcg was significantly decreased (lanes and ). the results showed that the sirna does abrogate the levels of mkp- mrna. to further determine whether mkp- sirna affects bcginduced mkp- at protein levels, pbmo were treated as above and mkp- proteins were measured by western blotting. the results showed that bcg could induce mkp- proteins as usual for cells transfected with control sirna ( figure b , lanes - ). however, the levels of bcginduced mkp- protein expression were reduced in cells transfected with mkp- sirna ( figure b , lanes - ). together, the results suggest that mkp- sirna not only reduced the mkp- mrna in bcg treatment but also abrogated the bcg-induced mkp- protein. as stated in the literature [ ] , mkp- ko mice showed increased tnf-α production in response to lps. on the basis of the above mkp- sirna results, lps was then used as a control to demonstrate the effects of this mkp- sirna system. cytokine expression induced by lps in mkp- sirna transfected cells suggest that the sirna system is effective in knocking down the mkp- expression and mkp- acts as a negative regulator in lps-induced tnf-α expression. to investigate the effect of mkp- sirna on bcg-induced cytokine expression, the levels of tnf-α, il- and il- mrna were measured by qpcr method. pbmo were transfected with either control or mkp- sirna. following exposure to bcg with control sirna, there were significant inductions of tnf-α, il- and il- mrna levels for hours after treatment as previously reported ( [ ] and data not shown). next, the effects of mkp- sirna were examined on the cytokine expression induced by bcg. surprisingly, there was a significant abrogation of bcginduced tnf-α expression by mkp- sirna ( figure d ). with the knockdown of mkp- , the level of bcg-induced tnf-α was only % compared to that of the control cells, while bcg-induced il- and il- were unchanged in mkp- sirna transfected cells. the results revealed that mkp- plays a role in the induction of tnf-α expression upon bcg stimulation, which may be different from that of its conventional functions in which mkp- acts as a negative regulator in lps-induced signaling pathways [ ] . the unexpected observations in cytokine expression lead to the investigation on the effects of mkp- sirna on bcg-induced mapk activation. mkp- was found to have a preferential substrate binding to p mapk and jnk than erk / [ ] . the phosphorylation status of mapks was assessed in control or mkp- sirna transfected pbmo. western blotting results demonstrated that bcginduced both p mapk and erk / phosphorylation in minutes (data not shown) and peaked at minutes, and then returned to basal levels in cells treated with the control sirna ( figure ). similar to the results of cytokine expression, phosphorylation of both p mapk and erk / in response to bcg was decreased in monocytes transfected with mkp- sirna instead of the expected increase in phosphorylation ( figure ). the results suggest that mkp- knockdown would result in reduced mapk phosphorylation by bcg, implying that the reduced level of tnf-α production in bcg stimulated monocytes is due to reduced phosphorylation of mapks by mkp- sirna. this report presented evidences that a novel function of mkp- is uncovered in cytokine regulation in response to mycobacterial infection. bcg induces mkp- as a rapid response (figure ) . the induction mechanism of mkp- by bcg is dependent on both erk / and p mapk ( figure ). using sirna approach, the functions of mkp- can be examined in primary human monocytes. the results showed that the bcg-induced mapks activation as well as cytokine expression are downstream of mkp- ( figures d and ) . thus, mkp- is a critical signaling molecule that is involved in bcg-induced cytokine expression. previous reports have shown that mkp- induced by lps or peptidoglycan is dependent on p mapk [ ] . accordingly, bcg-induced mkp- can be inhibited by both p mapk and erk / inhibitors. interestingly, it has been shown that degradation of mkp- is reduced after erk / phosphorylation [ ] . it can be hypothesized that bcg-induced mkp- proteins can be stabilized by erk / and the detailed mechanisms involved require more exploration. also, since the inhibition of mkp- expression by both inhibitors (for p mapk and erk / ) was not complete, it is believed that other proteins may be involved in the bcg-induced mkp- expression. on the basis of the literature results on lps effects ( figure ), the original expectation for this project is that mkp- acts as a negative regulator. lps-stimulated mkp- ko peritoneal macrophages showed prolonged phosphorylation of p mapk and jnk as well as increased production of tnf-α [ ] . in doing so, lps-induced mkp- could bcg-induced mapk phosphorylation is decreased by mkp- sirna prevent prolonged tnf-α production as in sepsis which may lead to severe damage to the host. it was expected that bcg induces mkp- and its induction would correlate with the dephosphorylation of mapks including p mapk. by blocking the mkp- using sirna, it was expected to have increased p mapk phosphorylation and prolonged tnf-α production in response to bcg. nevertheless, our results shown here are diametrically opposite. one possibility for the unexpected results may be due to non-specific effects of transfection or sirna. however, this was not the case since there was a prolonged and increased tnf-α expression after the mkp- sirna-transfected monocytes were treated with lps (figure c ). there is now a new hypothesis to explain such paradoxical effects of mkp- in tnf-α regulation in which the phosphatase plays a role in positive regulation of tnf-α production in response to bcg as in the case of dusp [ ] . the structures of mkp- and dusp are similar, with which they both contain a mapk-interacting domain and a phosphatase catalytic site. by contrast, other dusp may have extra domains, e.g., pest [ ] . here, we postulate that the function of mkp- in bcg-induced signaling is similar to that of the dusp /pac . actually, the discovery of dusp has initially created some paradoxical questions. as described, dusp behaves differently from other mkp family members [ ] . in dusp ko macrophages treated with lps, they produced less inflammatory mediators including less tnf, il- , nitric oxide, and il- -producing cells, when compared to that of the wild type counterparts [ ] . indeed, the results of these published studies on dusp studies are quite similar to that of our reported results here. it is plausible that these unexpected positive regulations of immune cell functions by dusp were due to crosstalks between mapks [ ] . it was shown that there are interactions between jnk and erk / pathways [ ] . here, we showed that the sustained activation of jnk blocks erk activation ( figure ). in the dusp situation, stimulation of ko mast cells and macrophages shows increased phosphorylation of jnk, and inhibition of jnk by its own specific inhibitor restores phosphorylation of erk / [ ] . in the bcg-mkp- situation, there is an early phosphorylation of p mapk and erk / . therefore, it is possible that jnk may play a role in the crosstalk interaction of mapk. however, our preliminary data suggest that the level of phosphorylated jnk was not increased in pbmo mkp- plays a critical role in the regulation of cytokine expression upon mycobacterial infection figure mkp- plays a critical role in the regulation of cytokine expression upon mycobacterial infection. lps model was provided according to literature findings (left). in this scenario, lps activates mkp- , which in turn dephosphorylates and deactivates phospho-p mapk, resulting in less tnf-α induction. however, the situation in dhp-hsa activation of dusp is more complicated (middle), since the phosphatase activity causes subsequent inhibition of phospho-jnk which leads to the derepression of phospho-p mapk. consequently, the combined effects of this cascade results in more tnf-α expression. the unexpected antimycobacterial role of mkp- (right) may be explained by events similar to the dusp effects. in this case (right), there was an inhibition of unknown pathways or kinases downstream of mkp- , and the unknown factor in turn inhibits mapks activation leading to more tnf-α induction. the details and kinase targets are yet to be identified. transfected with mkp- sirna (data not shown). thus, the details of the crosstalk between mapks need further investigation. here, we present a model to summarize the results and to hypothesize the existence of an as yet unidentified intermediary factor or factors in the pathways downstream of mkp- effects in the bcg-induced signaling cascade. the unexpected antimycobacterial role of mkp- ( figure ) may be explained by events similar to the dusp effects. in this case, bcg induces mkp- expression while also activates mapks including p mapk and erk / . downstream of mkp- , there is an inhibition of unknown pathways or kinases. the unknown factor in turn inhibits mapks activation, which ultimately leads to more tnf-α induction ( figure ). in summary, mkp- plays a critical role in the regulation of cytokine expression upon mycobacterial infection. inhibition of unknown pathways or kinases downstream of mkp- , which in turn inhibits mapks activation, may be used to explain the novel function of mkp- in enhancing mapk activity and consequent tnf-α expression following bcg treatment ( figure ). taken together, the role of mapk crosstalks need further exploration. ( ) tnf-α, cycles (tm = °c), upstream, '-ggctccaggcggtgcttgttc- ', downstream, '-agacggcgatgcggctgatg- '. pcr products were analyzed on a % agarose gel with ethidium bromide and visualized under ultraviolet light. in order to check the size of the pcr products, kb plus dna lad-der™ (invitrogen, usa) was run along with the pcr products. to perform qpcr, the levels of mkp- , and tnf-α mrna as well as the reference gene gapdh (as internal control) were assayed by the gene-specific assays-on-demand reagent kits (applied biosystems, usa). all samples were run in duplicates or triplicates and with no template controls on an abi prism sequence detector. the analysis method of qpcr was the comparative cycle number to threshold (c t ) method as described in user bulletin no. of the abi prism sequence detection system. the number of c t of the targeted genes was normalized to that of gapdh in each sample (Δc t ). the c t value of the treated cells was compared with that of the untreated or mock-treated cells (ΔΔct). the relative gene expression of the targeted genes (fold induction) was calculated as -ΔΔct . total cellular proteins were extracted by lysing cells in lysis buffer containing % triton x- , . % np- , mm nacl, mm tris-hcl (ph . ), mm edta, mm egta (ph . ), % sds, . mg/ml pmsf, μg/ml aprotinin, mm sodium orthovanadate, μg/ml pepstatin, μg/ml leupeptin, and mm sodium fluoride for minutes. the homogenate was then boiled for minutes and stored at - °c until use. the concentrations of total protein in cell extracts were determined by bca™ protein assay kit (pierce, il, usa). western blot was done as described [ ] . equal amounts of protein were separated by % sds-page, electroblotted onto nitrocellulose membranes (schleicher & schuell), and followed by probing with specific antibod-ies for actin, mkp- (santa cruz biotech., usa), phospho-p mapk, phospho-erk / (cell signaling, usa). after three washes, the membranes were incubated with the corresponding secondary antibodies. the bands were detected using the enhanced chemiluminescence system (amersham pharmacia biotech) as per the manufacturer's instructions. transfection of sirna into human monocytes was done as described [ ] . mkp- sirna included (i) mkp -hss , aaacgcuucguauccuccuuugagg; (ii) mkp -hss , uuaugcccaaggcauccag-cauguc; and (iii) mkp -hss , ugaug-gagucuaugaagucaauggc. mkp- knockdown in pbmo was conducted by using mkp -hss only or a pool of the above three different mkp- stealth™ select rnai (ratio = : : , nm, invitrogen, usa). stealth™ rnai negative control duplex ( nm) was used as a control for sequence independent effects for the sirna transfection. transfection of monocytes was done by using jetpei™ dna transfection reagent (polyplus transfection, usa) according to the manufacturer's instructions. after transfecting the cells for h, the transfectants were treated with different inducers as described above. statistical analysis was performed by student's t test. differences were considered statistically significant when p values were less than . . bcg: bacillus calmette guerin; erk / : extracellular signal-regulated kinase and ; gapdh: gyceraldehyde- -phosphate dehydrogenase lps: lipopolysaccharide; mapk: mitogen-activated protein kinase; mkp: mapk phosphatase; moi: multiplicity of infection; mtb: mycobacterium tuberculosis; pbmo: human peripheral blood monocytes; pe: phycoerythrin; sapk/ jnk: stress-activated protein kinase/c-jun n-terminal kinase; si: short interference; tb: tuberculosis; tbs-t: trisbuffered saline-tween; tnf-α: tumor necrosis factor-α references . world health organization: global tuberculosis control -surveillance, planning, financing macrophage signalling upon mycobacterial infection: the map kinases lead the way role of mitogen-activated protein kinase pathways in the production of tumor necrosis factor-alpha, interleukin- , and monocyte chemotactic protein- by mycobacterium tuberculosis h rv-infected human monocytes a role for doublestranded rna-activated protein kinase pkr in mycobacterium-induced cytokine expression dusp meet immunology: dual specificity mapk phosphatases in control of the inflammatory response nelin ld: mapk phosphatases--regulating the immune response regulation of innate immune response by map kinase phosphatase- the role of mitogen-activated protein kinase phosphatase- in the response of alveolar macrophages to lipopolysaccharide: attenuation of proinflammatory cytokine biosynthesis via feedback control of p dynamic regulation of pro-and anti-inflammatory cytokines by mapk phosphatase (mkp- ) in innate immune responses the function of mitogen-activated protein kinase phosphatase- in peptidoglycan-stimulated macrophages knockout of mkp- enhances the host inflammatory responses to gram-positive bacteria positive regulation of immune cell function and inflammatory responses by phosphatase pac- feedback control of mkp- expression by p reduced map kinase phosphatase- degradation after p /p mapk-dependent phosphorylation cross-talk between jnk/sapk and erk/ mapk pathways: sustained activation of jnk blocks erk activation by mitogenic factors human monocytes: isolation, cultivation, and its application lau as: p mitogen-activated protein kinase-dependent hyperinduction of tumor necrosis factor alpha expression in response to avian influenza virus h n mechanisms for hiv tat upregulation of il- and other cytokine expression: kinase signaling and pkr-mediated immune response role for nonstructural protein of severe acute respiratory syndrome coronavirus in chemokine dysregulation hiv- transactivator protein induction of suppressor of cytokine signaling- contributes to dysregulation of ifn{gamma} signaling bkwc and ncml were involved in performing the experiments while all authors participated in the design of experiments, analyzed results, and wrote and approved the manuscript. key: cord- -g w v authors: gkentzi, despoina; karatza, ageliki; dimitriou, gabriel title: challenges for the pediatricians during the coronavirus disease pandemic start from the neonatal period date: - - journal: pediatr infect dis j doi: . /inf. sha: doc_id: cord_uid: g w v nan influenza-positive swab [ ( %) with influenza a, ( %) with influenza b]. cough seems less prevalent in covid- compared with other infected infants (table ) . while no deaths occurred in infants with covid- , infants infected with cov in pneumostudy died, of whom were co-infected with streptococcus pneumoniae. this report underscores the lack of major differences in the clinical features of severe acute respiratory syndrome coronavirus and other types of cov or influenza infections among infants despite limited clinical features reported. covid- infection does not seem more severe than other cov or influenza infections in this population, possibly as all infect angiotensin-converting enzyme receptors in the upper airways. as influenza, the contribution of infants to the spread covid- should be investigated. s. pneumoniae was codetected in the cov-infected infants who died in pneumo-study while bacterial co-detection was not reported by wei et al. infants in both studies , were hospitalized limiting selection bias but small sample sizes weakened statistical power. the incidence of covid- in infants less than -year-old is currently low, but studies are needed to describe the clinical features, prognosis and impact of infected infants on the covid- spread. *pneumonia study gabriel members: gláucia paranhos-baccalà, shally milan. this is actually the current situation in various pediatric departments throughout europe. we fully agree with the suggested management and approach, although the latter still poses major further logistical issues such as the availability of negative pressure rooms for all inpatients with suspected covid- infection pending virologic confirmation. moreover, negative respiratory samples are required to rule out severe acute respiratory syndrome coronavirus infection which means further inpatient stay and more resources needed. more data in the field are urgently required to guide the pediatricians further. apart though from the management of febrile children, pediatricians and the pediatric infectious diseases specialists will also have to face challenges with the infection during the neonatal period. undoubtedly close monitoring of at-risk neonates is essential in the neonatal wards, but there are issues where evidence-based guidance is needed. the first priority is identifying the timing of infection (antenatally, perinatally or postnatally) and confirming its presence. two recent reports from china suggest that in utero infection could be possible based on the measurement of igm levels in neonates shortly after birth but no further confirmation of this with a positive reverse transcriptase-polymerase chain reaction test. , therefore, although in utero transmission is possible, larger studies on infected women will bring further insight in the field. in the case of the in utero infected neonate, the timing of infection may have an impact on fetal development and possibly on long-term outcomes. we do not know as yet whether acquisition during first trimester of pregnancy is associated with birth defects and whether fetal infection is more likely in the advanced pregnancy stages following the patterns of other congenital infections. what we do know though is that antenatal infection with other coronaviruses (severe acute respiratory syndrome and middle east respiratory syndrome) is associated with possible miscarriage, intrauterine growth retardation prematurity and low birth weight. moreover, at present, we do not know how many molecular tests we need to perform and whether tests are enough to rule out neonatal infection given that serology is not always reliable, as observed with other congenital infections. in addition to that, uncertainty exists as to whether respiratory specimens are enough or blood, stool or urine samples would offer more accurate results. last but not least separation of an infected mother from her offspring and feeding options are issues for further consideration. some guidelines suggest complete separation of a covid- -positive mother and her baby for at least days or until viral shedding clears, during which time direct breast-feeding is not recommended. on the other hand, the centre for disease control and prevention and the royal college of obstetricians and gynecologists recommend breast-feeding with strict contact precautions based on the fact that so far there is no evidence that the virus can be transferred via breast milk. for those women who are too sick to breast-feed, the recommendation is breast milk expression and avoidance of any contact with the baby. in conclusion, the current pandemic poses several challenges to the pediatricians from the neonatal period throughout adolescence. evidence-based recommendations coronavirus infections in children including covid- novel coronavirus infection in hospitalized infants under year of age in china pneumonia gabriel network. multicenter casecontrol study protocol of pneumonia etiology in children: global approach to biological research, infectious diseases and epidemics in low-income countries (gabriel network) global approach to biological research, infectious diseases and epidemics in low-income countries (gabriel) network; global approach to biological research, infectious diseases and epidemics in low-income countries (gabriel) network. microorganisms associated with pneumonia in children < years of age in developing and emerging countries: the gabriel pneumonia multicenter, prospective, case-control study influenza in children sars-cov- infection in a pediatric department in milan: a logistic rather than a clinical emergency possible vertical transmission of sars-cov- from an infected mother to her newborn antibodies in infants born to mothers with covid- pneumonia coronavirus infections in children including covid- an overview of the epidemiology, clinical features, diagnosis, treatment and prevention options in children guidelines for pregnant women with suspected sars-cov- infection the authors have no funding or conflicts of interest to disclose. n.k. had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. n.k. contributed to the study concept and design; drafting of the article; critical revision of the article for important intellectual content. originated in china and has rapidly spread worldwide. currently, supportive therapy is the most effective treatment. vaccination is one of the best options for the prevention of infectious diseases. however, a vaccine, as well as a specific proven treatment, remains elusive.the bacillus calmette-guérin (bcg) vaccine is administered to more than one million children annually in countries with a high prevalence of tuberculosis. recently, researchers hypothesized that it might also combat covid- because of its broad ability to stimulate the immune system. this is based on the fact that countries without universal policies of bcg vaccination (ie, italy, the netherlands, and the united states) have been more severely affected compared with countries with universal and long-standing bcg policies. therefore, some researchers are investigating the vaccine's effectiveness against covid- . however, it should be emphasized that the causality is not yet proven; there is only one study predicting an association. generally, to clarify the causality between two variables, the bradford hill criteria is used. to show the causality between the bcg vaccine and the severity of covid- , we have to confirm the following bradford hill criteria: specificity, temporality, reversibility, and experiment. until the results of interventional studies are published, we cannot conclusively establish the utility of bcg against covid- .however, many people have misinterpreted this association as causation. this excessive expectation increases individual desire to be vaccinated with bcg. this will cause a big problem for japanese infants, who, owing to the shortage of bcg, may not get the necessary vaccination. producing adequate amounts of bcg to meet demands besides that for infant vaccination will take half a year because, at present, only the amount necessary for use in infants is manufactured. apprehension regarding bcg shortage led the japanese society for vaccinology to officially state that it does not recommend the use of bcg vaccine for the prevention of covid- . however, under the current japanese health care system, individuals willing to pay for individual vaccination cannot be prohibited from doing so. therefore, emphasizing the lack of evidence and the cooperation of japanese citizens is necessary. if infants in japan do not receive bcg vaccines, tuberculosis might spread. we must prevent this from happening by publicizing inadequate evidence of causality between the bcg and prevention of the covid- . we also need to highlight the concern that a shortage of bcg would exacerbate the tuberculosis crisis among the infants in japan. wayne state university detroit, michigan key: cord- - waejlwb authors: roy, soumya title: does the bacillus calmette–guérin vaccine provide protection from covid- ? date: - - journal: indian j med sci doi: . /ijms_ _ sha: doc_id: cord_uid: waejlwb objective: the novel coronavirus pandemic is ravaging throughout the world. it has infected more than . million people and killed more than , . frantic research is underway to find prevention and cure. of late, bacillus calmette–guérin (bcg) has been speculated as a possible protection from covid- . we sought to investigate the evidence behind the claim. material and methods: data were collected regarding the total number of covid- cases per million and total number of covid- deaths per million in various countries. the bcg vaccination policies of these countries were also obtained. results: it was seen that the countries with no universal bcg policy had a mean . (median ) cases per million and . deaths (median ) per million population. on the contrary, the countries with a universal bcg vaccination policy had a mean . (median ) cases per million and deaths (median ) per population. the difference is highly significant (p < . ). conclusion: the data strongly support the hypothesis that bcg may offer protection from covid- . heterologous protection offered by bcg through production of trained immunity, epigenetic reprogramming of monocytes, non-specific activation of nk cells, and increase of pro-inflammatory cytokines (particularly, tumor necrosis factor [tnf]-alpha and interleukin beta) production may be the mechanism behind its cross- protection against the novel coronavirus. data on the "total number of covid- cases per million population" and "total number of covid- deaths per million population" of different countries were obtained from an online source. [ ] data on the "bcg policy, " "incidence of tb/ , , population, " and the "income group according to world bank data" of these countries were obtained from another online source. countries with a total case fatality (on the date of the study) were included. [ ] the countries were divided into two groups: group a containing the countries "where universal bcg policy is in practice at present" and group b containing the countries "where universal bcg policy is not practiced at present. " we compared the "total number of covid- cases per million population" as well as the "total number of deaths per million population" between groups a and b to look for any statistical significance. subsequently, we divided the countries with "no universal bcg policy" into two groups: group c containing the countries where "universal bcg policy was previously present, but has now been stopped" and group d containing the countries where "universal bcg policy was never present. " the number of covid- cases per million population in group c and group d was compared to look for any statistically significant difference. similarly, the number of deaths per million was also compared between groups c and d. eventually, we grouped all the countries into two groups: the first group (group e) comprising "countries where incidence of tuberculosis is ≤ / , , , " i.e., countries with low incidence of tuberculosis and the second group (group f) comprising nations "where the incidence of tuberculosis is > / , , , " i.e. countries with higher incidence of tuberculosis). we compared the "total number of covid- cases per million population" as well as the "total number of deaths per million population" between groups e and f. the data in the two groups were tested for statistical significance using the mann-whitney u-test. an online software was used to analyze the data available at http://www. statskingdom.com/ median_mann_whitney.html. at the time of the study, countries had a total covid- deaths of ≥ . out of these, countries do not have a universal bcg vaccination policy at present, whereas countries have it. out of the countries with no universal bcg policy, countries are from high-income group and one country is from upper middle-income group. out of the countries with universal bcg vaccination, are from high income, are from upper middle, and are from lower middle-income group. the countries where universal bcg vaccination is not practiced have a mean covid- positive cases of . (standard deviation . ) per million population with a median of . the countries where universal bcg vaccination is practiced have a mean covid- positive cases of . (standard deviation . ) per million population with a median of . the difference is statistically significant (p < . ) [ figure a ]. the countries where universal bcg vaccination is not practiced have a mean covid- deaths of . (standard deviation . ) per million population with a median of . the countries where universal bcg vaccination is practiced have a mean covid- positive deaths of (standard deviation . ) per million population with a median of . the difference is statistically significant (p < . ) [ figure b ]. out of the countries with no universal bcg vaccinations policy, countries had universal bcg vaccination policy in the past but have stopped the practice at present (group c); five countries never had universal bcg (group d) and data were not available about one country (san marino). the difference in the "number of cases per million" between group c and group d was not statistically significant (p = . ). similarly, the difference in the "number of deaths per million" between groups c and d was also not statistically significant (p = . ). out of the countries included in the study, the incidence of tuberculosis is ≤ / , , population in countries (group e) and > / , , population in countries (group f). the difference between the "total number of cases per million population" in group e and group f was statistically significant (p < . ) [ figure c ]. besides, "the total number of deaths per million population" between groups e and f was also statistically significant (p < . ) [ figure d and table ]. the study shows that there are a significantly lower number of cases as well as deaths in countries where universal bcg policy is being practiced. hence, it can be possibly concluded that bcg vaccination provides a cross-protection against covid- . however, a detailed study into the epidemiological parameters of the countries which had universal bcg vaccination policy in the past (but have stopped universal bcg as of now) revealed enigmatic result. the earliest to stop universal bcg was sweden which stopped it in . [ ] it means that almost all people aged > years in sweden have received bcg vaccination in their childhood. in fact, most of these countries have stopped universal bcg vaccination around the s which means that most of the people aged around years or more (in these countries) have received bcg vaccination in their childhood. france is one of the last countries to have stopped universal bcg in the year . [ ] as such, every french citizen > years of age must have received bcg vaccination, but even then france ranks th in the total number of cases per million population (only after italy, spain, and the us). [ ] the study also shows that the "total number of cases" as well as "the total number of deaths" per million are significantly lower in countries with a high incidence of tuberculosis. it must be remembered that not all countries with a high incidence of tuberculosis are practicing universal vaccination (for example, ecuador has an incidence of / , , , but has no universal bcg policy) and not all countries with low incidence of tuberculosis have stopped giving universal bcg (for example, hungary, ireland, greece, etc.). [ ] in fact, no significant difference in covid- parameters was observed between countries where was never a universal bcg policy versus countries which have recently stopped universal bcg. surprisingly, covid- infection rates and death rates were significantly lower in countries with a higher incidence of tuberculosis, irrespective of whether universal bcg is given there or not. bcg provided heterologous or non-specific immunity against a host of non-mycobacterial disease conditions such as viral infections and sepsis. [ ] in a study in west africa, kristensen et al. found that bcg provided increased survival in children than could be attributed to the protection against only tuberculosis. [ ] bcg has been shown to induce t-cell-independent protection against secondary infections with candida albicans or schistosoma mansoni in mice. [ ] bcg is also known to produce non-specific protective effects through innate immunitydependent mechanisms in malignancies such as bladder cancer, melanoma, leukemia, and lymphoma. [ ] kleinnijenhuis found that bcg induces epigenetic reprogramming of monocytes, thereby resulting in an increase of proinflammatory cytokines (particularly, tnf-alpha and interleukin- beta) production in response to non-related pathogens. they concluded that bcg produces sustained changes in immune system, leading to a non-specific response to infections both at the level of innate trained immunity and heterologous th /th responses. [ ] bcg also causes the activation of nk cells, leading to increased production of proinflammatory cytokine in response to mycobacteria and other unrelated pathogens. it has previously been shown that bcg provides non-specific protection against c. albicans in mice at least partially through nk cells. bcg produces an increase in inflammatory mediators from monocytes in healthy volunteers, which correlated with parallel changes in a histone modification associated with gene activation. hence, these non-specific (or heterologous) effects show that bcg induces trained immunity that protects against unrelated pathogens. whether other mycobacterial infections (for example, latent or subclinical tuberculosis) provide any cross-protection against covid- or other unrelated infections are a matter of conjecture. the medical literature is excessively scanty in that regard. however, tarancon et al. found that mtbvac, genetically modified form of m. tuberculosis, is able to produce trained immunity. [ ] baldridge et al. showed that during an infection with mycobacterium avium, there is an increased proliferation of long-term repopulating hematopoietic stem cells, a response that requires increased interferon-gamma (ifnγ) signaling. [ ] khader et al. noted that innate immune cells, namely, myeloid cells and nk cells undergo functional adaptation (trained immunity) after infection (with m. tuberculosis) or vaccination with bcg. [ ] besides, it is well known that various infections like malaria can also induce a state of hyperresponsiveness that is functionally equivalent to the induction of trained immunity. for example, herpesvirus latency increases resistance to the bacterial pathogens listeria monocytogenes and yersinia pestis by increased production of ifnγ and systemic activation of macrophages. [ ] limitations the health-care system, covid- testing rate, and age profile of the populations of the different countries may be confounding factors. the strain of bcg used in each country was not taken to consideration. different countries may be at different stage of the pandemic at the time of writing the article. hence, the infection and death rates may increase in some countries in future. from the study, it is concluded that cross-protection against covid- by the bcg vaccination is a very strong possibility and hence it must be properly explored through randomized controlled trials. besides, a prevalence of mycobacterial infections (either by bcg or by latent/subclinical/clinical tuberculosis) may also possibly contribute to some protection against covid- . patient's consent not required as the patient's identity is not disclosed or compromised. nil. there are no conflicts of interest. covid- coronavirus pandemic can an old vaccine stop the new coronavirus? the new york times non-specific effects of bcg vaccine on viral infections routine vaccinations and child survival: follow up study in trained immunity: a program of innate immune memory in health and disease long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity new live attenuated tuberculosis vaccine mtbvac induces trained immunity and confers protection against experimental lethal pneumonia quiescent haematopoietic stem cells are activated by ifngamma in response to chronic infection targeting innate immunity for tuberculosis vaccination key: cord- -dquztf l authors: schoenmakers, anne; mieras, liesbeth; budiawan, teky; van brakel, wim h title: the state of affairs in post-exposure leprosy prevention: a descriptive meta-analysis on immuno- and chemo-prophylaxis date: - - journal: res rep trop med doi: . /rrtm.s sha: doc_id: cord_uid: dquztf l objective: annually, over , people are diagnosed with leprosy, also called hansen’s disease. this number has been relatively stable over the past years. progress has been made in the fields of chemoprophylaxis and immunoprophylaxis to prevent leprosy, with a primary focus on close contacts of patients. in this descriptive meta-analysis, we summarize the evidence and identify knowledge gaps regarding post-exposure prophylaxis against leprosy. methods: a systematic literature search according to the preferred reporting items for systematic reviews and meta-analyses (prisma) methodology was conducted by searching the medical scientific databases cochrane, embase, pubmed/medline, research gate, scopus and web of science on jan. , , using a combination of synonyms for index terms in four languages: “leprosy” and “population” or “contacts” and “prevention” or “prophylaxis.” subsequently, infolep.org and google scholar were searched and the "snowball method" was used to retrieve other potentially relevant literature. the found articles were screened for eligibility using predetermined inclusion and exclusion criteria. results: after deduplication, , articles were screened, and articles were included in this descriptive meta-analysis. immunoprophylaxis by bacillus calmette-guérin (bcg) vaccination is known to provide protection against leprosy. the protection it offers is higher in household contacts of leprosy patients compared with the general population and is seen to decline over time. contact follow-up screening is important in the first period after bcg administration, as a substantial number of new leprosy patients presents three months post-vaccination. evidence for the benefit of re-vaccination is conflicting. the world health organization (who) included bcg in its guidelines for the diagnosis, treatment and prevention of leprosy by stating that bcg at birth should be maintained in at least all leprosy high-burden regions. literature shows that several vaccination interventions with other immunoprophylactic agents demonstrate similar or slightly less efficacy in leprosy risk reduction compared with bcg. however, most of these studies do not exclusively focus on post-exposure prophylaxis. two vaccines are considered future candidates for leprosy prophylaxis: mycobacterium indicus pranii (mip) and lepvax. for chemoprophylaxis, trials were performed with dapsone/acedapsone, rifampicin, and rom, a combination of rifampicin, ofloxacin, and minocycline. single-dose rifampicin is favored as post-exposure prophylaxis, abbreviated as sdr-pep. it demonstrated a protective effect of % in the first two years after administration to contacts of leprosy patients. it is inexpensive, and adverse events are rare. the risk of sdr-pep inducing rifampicin resistance is considered negligible, but continuous monitoring in accordance with who policies should be encouraged. the integration of contact screening and sdr-pep administration into different leprosy control programs was found to be feasible and well accepted. since , sdr-pep is included in the who guidelines for the diagnosis, treatment and prevention of leprosy. conclusion: progress has been made in the areas of chemoprophylaxis and immunoprophylaxis to prevent leprosy in contacts of patients. investing in vaccine studies, like lepvax and mip, and increasing harmonization between tuberculosis (tb) and leprosy research groups is important. sdr-pep is promising as a chemoprophylactic agent, and further implementation should be promoted. more chemoprophylaxis research is needed on: enhanced medication regimens; interventions in varying (epidemiological) settings, including focal mass drug administration (fmda); specific approaches per contact type; combinations with screening variations and field-friendly rapid tests, if available in the future; community and health staff education; ongoing antibiotic resistance surveillance; and administering chemoprophylaxis with sdr-pep prior to bcg administration. additionally, both leprosy prophylactic drug registration nationally and prophylactic drug availability globally at low or no cost are important for the implementation and further upscaling of preventive measures against leprosy, such as sdr-pep and new vaccines. leprosy is a communicable disease caused by mycobacterium leprae (m. leprae). it can result in disabilities, disfigurements, blindness, and internal organ problems. it is estimated that million to million people are living with leprosy-related disabilities, which cause severe socioeconomic consequences, including stigma and poverty. [ ] [ ] [ ] leprosy is one of the oldest diseases known to mankind and was once endemic on all continents. today, the disease exists primarily in resource-poor countries with often warmer climates and it is considered a neglected tropical disease (ntd). , , , in , the world health organization (who) reported a total of , new leprosy patients worldwide, a number that has been relatively stable in the past decade. m. leprae was discovered, as the first bacterium that caused disease in people, by the norwegian doctor armauer hansen in . , almost years after hansen's discovery, modern science still has not succeeded in growing the bacterium in vitro; it grows in humans, in nine-banded armadillos, and in immunecompromised mice. , , both people and nine-banded armadillos are able to transmit m. leprae to humans. the infection mechanism of leprosy is not fully understood, but it is generally thought to spread via the respiratory route. , the average incubation time of the disease is years, but it can take up to years before symptoms appear. during this period, a leprosy patient is contagious. ongoing transmission is implied by the fact that almost % of global new leprosy cases are children. whether colonization with m. leprae leads to infection and disease depends on the host's resistance and genetics, as well as environmental factors. up to % of people exposed to m. leprae do not develop the disease. as mentioned, most people who do develop the disease live in resource-poor settings; poor living conditions (eg, insufficient food availability, pollution, lacking health care systems and secondary chronic psychological stress) can negatively affect immune function. , , for transmission, prolonged contact with an untreated patient is considered necessary. the genetic and physical distance to a leprosy patient are independently associated with the risk of developing clinical disease. hence, the risk for developing leprosy is increased not only in household contacts, but also in neighbors and social contacts. , in the late s, the antibiotic dapsone was the first breakthrough in leprosy treatment. the duration of treatment often lasted a lifetime, which challenged compliance and fostered dapsone resistance in the s. when clofazimine and rifampicin were discovered in the s and s, these drugs were combined with dapsone, later labeled as multidrug therapy (mdt). mdt has been provided free of charge since via who. within a few days after starting mdt, patients are no longer considered to be contagious. the first focus on leprosy prevention started shortly after the discovery of m. leprae. compulsory isolation for persons affected by leprosy, mainly in leprosy colonies, was internationally promoted from the th century onward as one of the few existing prevention methods. , healthy-appearing children were frequently seperated from their parents with clinical leprosy. at the international leprosy congress in japan, isolation was finally labeled as outdated and inhumane, also because dapsone as a treatment option became available. , when mdt was introduced, it was expected that early detection and prompt treatment would break the transmission chain of m. leprae. however, the incidence decline was slower than anticipated. , this implies that there could be an accumulation of people with leprosy in communities who remain undiagnosed and/or untreated. these "missing millions" contribute to further transmission of the disease. consequently, in the global leprosy strategy - , who determined that early case detection and targeted active case finding among highrisk groups are key to control leprosy and avert disabilities. at the same time, intensified populationbased approaches for case detection are no longer considered cost-effective in all contexts. , , the risk of leprosy exposure in general populations is usually low, and, as stated, geographically closer contacts of patients are more likely to develop the disease. [ ] [ ] [ ] therefore, more targeted prevention methods were considered necessary to stop transmission. over the past years, progress has been made in the fields of chemoprophylaxis and immunoprophylaxis to prevent leprosy, with a primary focus on close contacts of patients. in this article, we present a descriptive metaanalysis on leprosy post-exposure prophylaxis. the aim of this review is to summarize the evidence on post-exposure prophylaxis for leprosy and to identify knowledge gaps and topics for future studies. a descriptive meta-analysis method was chosen. a systematic literature search was conducted using six electronic medical databases: cochrane, embase, pubmed/ medline, research gate, scopus, and web of science (table ). the search was performed using a combination of synonyms of the following index terms: "leprosy" and "population" or "contacts" and "prevention" or "prophylaxis," with a query translated in english, french, spanish, and portuguese. when possible, the search was limited to the title/abstract search fields in the search engines. medical subject headings (mesh) terms were added to the search query if available. in addition, an article search via infolep.org and google scholar was performed. infolep is the international knowledge center for information resources on leprosy. their online database also includes "grey litrature", such as meeting reports and theses. bibliographies of the relevant articles were screened for additional articles missing in the existing yield ("snowball method"). the articles were deduplicated, and consequently, a content review was performed, first in titles and abstracts and second in full texts. uncertainties in the selection were discussed with a second researcher until consensus was reached. regarding inclusion criteria, all human studies as well as meeting reports, expert opinions, editorials, and other relevant articles were included if methods for postexposure chemoprophylaxis and post-exposure immunoprophylaxis or vaccines against leprosy were discussed. exclusion criteria were as follow: (a) studies in languages other than english, french, spanish, or portuguese; (b) studies for which no full text was available; (c) studies that focused predominantly on leprosy treatment instead of prevention; (d) studies that focused solely on primary prevention interventions (eg, primary vaccination in newborns); (e) studies that solely assessed immunological status changes after vaccination without assessing clinical infection; (f) study protocol descriptions or preliminary reports of clinical trial data that were later similarly described in more complete publications; and (g) articles in which no new information was discovered (data-saturation). every step in the search phase was documented according to the preferred reporting items for systematic reviews and meta-analyses (prisma) literature review methodology. after the search, a data and text mining process was performed. the authors, year of publication, and study characteristics (ie, study design, population, period, geographic area, intervention type, results) were extracted the search in the six medical literature databases on january , (table ) and the additional search via infolep.org, google scholar and articles' bibliographies resulted in , articles after deduplication ( figure ). a total of articles included relevant information for this descriptive review on leprosy post-exposure prophylaxis. the bacillus calmette-guérin (bcg) vaccine is a live attenuated vaccine prepared from a strain of mycobacterium bovis, derived from a tuberculous cow. , the first bcg vaccine, originally developed against tuberculosis (tb), was produced by albert calmette and camille guérin in at the pasteur institute. , the influence of bcg on the lepromin reaction, described by josé fernández in , indicated that bcg might also provide leprosy protection. , currently, over substrains of bcg are being manufactured. approximately million newborns each year receive the bcg vaccine, mainly as primary protection against tb. bcg is contraindicated in immunocompromised persons and pregnant women. about % of the people who receive the bcg vaccine experience a reaction at the injection site, often leaving a superficial scar. , the protective effect against leprosy of bcg, usually given as primary tb prevention to newborns, varies widely in different countries. [ ] [ ] [ ] observational studies demonstrated a larger protective effect against leprosy, possibly caused by the shorter follow-up periods, compared with experimental trials ( % versus %). long follow-up periods are needed because of the long incubation period of leprosy. the meta-analysis of merle et al in stated that primary bcg vaccination in newborns is effective in reducing the risk of leprosy by % ( % ci . the over-all protection of bcg vaccination against leprosy in this analysis ranged from % to %. similarly to tb, the protection by bcg against leprosy is most evident in children. , who's guidelines for the diagnosis, treatment and prevention state that bcg at birth should therefore be maintained in at least all leprosy high-burden regions. the heterogeneity in the protective effect is thought to have multiple causes, including the use of different bcg vaccine strains and batches; varying study populations (eg, immunogenic characteristics, age groups); different time periods and follow-up schedules; varying geographical settings regarding environmental mycobacteria variations and m. tuberculosis; differences in leprosy burden; variations in clinical experience of health staff; and discrepancies in study methodology. , , , , , [ ] [ ] [ ] [ ] additionally, the protective effect of bcg in leprosy may decrease over time. when focusing on bcg as a post-exposure immunoprophylactic agent for leprosy contacts, the number of studies is relatively limited. , [ ] [ ] [ ] [ ] [ ] [ ] in , stanley et al described a randomized controlled trial in which , ugandan children, who were contacts of leprosy patients, were included between and (table ) . the children did not show clinical symptoms and scored negative or weakly positive at the tuberculin test. one group received bcg vaccination; the control group was not vaccinated. the children were monitored for up to four times, over an average period of eight years. in the bcg vaccinated group, children developed leprosy; in the control group, developed the disease. the protective effect against leprosy was % ( % ci - ) and did not depend upon vaccination age, gender, or grades of physical contact and genetic relationship with a patient. a small decline in protection seemed to appear at eight years follow-up, with a leprosy incidence reduction of %. lwin et al published a randomized controlled trial performed in myanmar (burma) in (table ) . a group of , children aged - years received bcg; , ( . %) of these children were household contacts of leprosy patients. the control group counted , children, including , ( . %) household contacts. the inclusion period ranged from to . annual follow-up assessments were performed until - . the overall protective effect of bcg was . % ( % ci - ). the leprosy incidence in the vaccinated group was . % for females and . % for males, compared to . % and . % for controls, respectively. a higher protective effect was found in younger children. bcg protection showed to be independent of the initial tuberculin status. a protective effect of . % was seen in contacts of lepromatous/borderline patients, of . % in contacts of patients with other leprosy forms, and of . % among non-contacts. weaknesses in this study are that two strains with varying bacillary count were used, resulting in varying protection rates. in addition, the described total number of contacts in this study was relatively low, and the number of follow-up moments varied ( - times) . furthermore, non-contacts may have become contacts during follow-up. in brazil in , düppre et al published a cohort study on the effectiveness of bcg vaccination among contacts of , leprosy patients between and ( table ). of the , leprosy patient contacts who received bcg vaccination, , people already had a bcg scar, suggesting previous vaccination. the unvaccinated group counted , contacts, of whom , already had a bcg scar. the protection against leprosy from the bcg post-exposure vaccination was found to be % ( % ci - ). for those without a primary scar, protection reached % ( % ci - ); for those with a primary scar, protection was % ( % ci . it was stated that bcg protection in contacts was not substantially affected by previous bcg vaccination. the study strongly supported the routine bcg vaccination of leprosy contacts regardless of previous vaccination. remarkably, during the first - months, new leprosy cases- vaccinated ( without a primary bcg scar) and seven unvaccinated-were detected. tuberculoid forms predominated. of these new cases, ( %) had a multibacillary leprosy index case in their family. however, misclassification of contact type may have led to residual confounding. furthermore, this study stated that no solid reason exists to doubt the disease classification data and bcg exposure, while this is debatable when examining other studies. , , moreover, this study assumed that the contacts who did not return after the initial examination were healthy, which may not always have been the case. merle et al found that bcg efficacy in studies focusing on household contacts was significantly higher compared with studies targeting the general population ( % and %, respectively). but it was mentioned that the risk of misclassification of cases and controls should be considered given the long incubation time of leprosy. included studies were found to be heterogeneous, caused by eg, varying study designs and some study groups receiving multiple doses of bcg. studies including bcg revaccination only or studies that did not (also) estimate the efficacy of one post-exposure dose of the bcg vaccine were not included in this metaanalysis. literature states that several vaccination interventions show similar or slightly less efficacy in reducing the risk of leprosy compared to bcg, but few studies focus primarily on post-exposure prophylaxis. sharma et al performed a double-blind trial on the mw vaccine in india in the s that did include household contacts of leprosy patients. when contacts only were vaccinated, the mw vaccine showed a protective efficacy of . % at the end of the -year follow-up period, % at years, and . % at years follow-up. when both patients and contacts received the mw vaccine, the observed protective efficacy was % at years, % at years, and % at years, with significance found at the first two survey moments (p < . ) and in a lesser degree at the third survey moment (p < . ). however, this study stated that early post-vaccination cases detected within year of administering the vaccine were not included in the analysis, as these vaccine recipients were thought to be harboring the infection. this is a major limitation and makes the results of this trial difficult to interpret. truoc et al published a study on bcg alone, bcg plus killed mycobacterium vaccae (m. vaccae or mv), and killed mv alone. the study included young people, - years old, living in close contact with leprosy patients in in ho chi minh city, vietnam. at least twice a year, signs of leprosy were routinely sought. the study was non-randomized, and intervention allocation in this study was also doubtful: for example, children who did not attend the initial examination moment were chosen as the control group. , over the entire years, of ( . %) unvaccinated controls and of ( . %) vaccinated children developed leprosy (p < . ), showing a protective effect of . % without significant differences among the three vaccines. the small sample size and uncertainties in scar-reading could potentially further have influenced the outcome of this study. , , promising vaccines at the moment, besides bcg, two vaccines are considered potential candidates for leprosy prophylaxis: the mw vaccine, developed in india, and lepvax, developed in the united states. [ ] [ ] [ ] [ ] [ ] because of the described positive protective efficacy of mw, this cultivable, non-pathogenic mycobacterium was selected for further development. it has been sequenced and is now named mycobacterium indicus pranii (mip) to avoid confusion with m. tuberculosis-w. , mip expedites bacterial clearance and shortens the recovery time in leprosy patients. [ ] [ ] [ ] furthermore, the addition of mip vaccine as an immunomodulator to mdt in leprosy patients leads to speedier attainment of slit-skin smear test negativity, and it seems to have a positive effect on leprosy reactions from six months onwards. , the mip vaccine has received approval from both the drugs controller general of india and the american food and drug administration (afda) and is now being manufactured as immuvac/cadi- by cadila pharmaceuticals. it also seems effective in other conditions, such as tb and warts. in , the american leprosy missions (alm) partnered with the infectious disease research institute (idri) in seattle to start a leprosy vaccine development trajectory. lepvax was developed to provide both effective preexposure and post-exposure prophylaxis against m. leprae infection. it was shown to be safe. a decrease and/or delay of neuropathy caused by m. leprae in nine-banded armadillos was also observed, making lepvax promising as immunotherapy. in august , the vaccine was approved by the afda. lepvax testing in humans is ongoing. when dapsone was the sole treatment of choice for leprosy, people sought ways to protect contacts of leprosy patients. the idea to introduce post-exposure prophylaxis (pep) was based on the hypothesis that close contacts of leprosy patients have already been infected by m. leprae by the time the patient is diagnosed and that post-exposure chemoprophylaxis would prevent the contacts from developing the clinical disease. the first reports on chemoprophylaxis trials, using dapsone, in india and seoul were published in the s. [ ] [ ] [ ] these first results suggested that weekly or biweekly doses of dapsone given to contacts of leprosy patients for a longer duration (months to years) had a protective effect against leprosy. in subsequent years, this was confirmed by additional studies in other contexts. [ ] [ ] [ ] [ ] [ ] [ ] in the s, several studies were published on the use of diacetyldapsone (dadds) or acedapsone, a long-acting repository sulphone given by injection. the administration intervals of approximately weeks added to the operational feasibility; also, no toxicity was found. [ ] [ ] [ ] neelan et al found that even a short duration of chemoprophylactic treatment with acedapsone through a series of three injections provided protection after four years of followup. smith and smith conducted a meta-analysis in to quantify the efficacy of dapsone chemoprophylaxis against leprosy. they concluded that chemoprophylaxis is an effective method to reduce the leprosy incidence. they also stated that it is more cost-effective in household contacts than when administered to entire communities. they advised more research on simple, single-dose regimens. this could improve compliance and feasibility in more remote settings. in , a workshop on leprosy prevention with international experts was held in the federated states of micronesia. during this workshop, studies were presented introducing new regimens comprising rifampicin alone or rifampicin combined with ofloxacin and minocycline (rom). an important improvement of these new regimens was that they were given either as a singledose or were repeated once, as compared to dapsone that was given repeatedly for several years. the first experience with rifampicin as chemoprophylaxis was gained in in french polynesia on the south marquesas islands, involving the screening of , inhabitants and administering mg/kg single dose rifampicin (sdr) to , inhabitants ( . %) ( table ) and also south marquesan "emigrants" with their families. , during the four-year follow-up, a decrease in the new case detection rate of % was observed. against a background of an already declining incidence after mdt introduction, the intervention's efficacy was estimated to be %. in addition, experiences were reported with sdr or the regimen rom as chemoprophylaxis, aiming at a decrease in the new case detection rate in the federated states of micronesia, kiribati, and the republic of the marshall islands. [ ] [ ] [ ] [ ] [ ] [ ] no serious side effects were recorded. some concerns about the complexity of the intervention and the costs involved in chemoprophylaxis against leprosy were discussed. , a plea was made for a simple regimen to target high-risk groups, maximizing the costbenefit ratio. it was also acknowledged that more operational research was needed to better define the populations that could benefit the most. in the years after the workshop, more publications provided evidence on the effect of chemoprophylaxis, but it was also recognized that the studies were not placebo controlled and/or could not distinguish between the effect of the chemoprophylaxis and the effect of intensified case detection interventions. , cuba, a low endemic country, was alone in starting early with nationwide implementation of sdr-pep in . the colep study moet et al conducted a large cluster-randomized controlled trial in bangladesh, the colep study, to determine the effectiveness of sdr in preventing leprosy in close contacts of leprosy patients (table ) . the study focused on household contacts, neighbors, and social contacts, because these contacts were identified as most at risk. approximately , contacts received sdr, while another , received placebo. exclusion criteria were as follow: age < years, pregnancy, liver or renal disease, signs or symptoms of leprosy or tb and previous rifampicin intake, refusal, or contacts who were residing only temporarily in that area. the study showed that sdr given to contacts of new leprosy patients reduced their risk of developing clinical leprosy by % ( % ci . the effect was more pronounced in more distant contacts and less in blood-related family. as part of the colep study, the cost-effectiveness of using sdr to prevent leprosy was assessed to be good at all contact levels. the incremental cost-effectiveness ratio (icer) was us$ per one prevented leprosy patient. overall, rifampicin administration to screened contacts of leprosy patients was shown to be affordable and feasible. , an additional post hoc finding during the colep study was that rifampicin given to contacts who have had a childhood bcg vaccination, had a protective effect of % ( % ci - ). in another colep substudy, the acceptability of sdr was assessed among healthy community members. all study participants expressed that they would be willing to take chemoprophylaxis, even after it was explained that full protection against leprosy was not guaranteed. however, many participants also expressed that they would not like to share information on their disease status with neighbors and social contacts if they would have leprosy. in follow-up of the colep study another workshop on the use of chemoprophylaxis against leprosy was held in , in the netherlands. here, the preliminary colep data were presented as well as results from another controlled trial using rifampicin in two repeated doses on a group of five islands in the flores sea in indonesia (table ) . , this trial showed similar results to the colep study, with a risk reduction of about % on the island where the total population was screened and received two dosages of rifampicin when eligible. , preliminary data of a randomized controlled chemoprophylaxis trial in india, the results of which were never individually published, were presented by declercq in this workshop. sdr given to household contacts was compared with placebo and showed a % risk reduction after - years follow-up. during the workshop, concerns were raised regarding the risk of inducing antibiotic resistance when using rifampicin on a large scale. ji addressed these concerns with the argument that resistance is very unlikely to emerge because sdr is proven not to select resistant mutants, as shown in publications on multibacillary patients who relapse after sdr treatment. , experts agreed that the use of a single dose as chemoprophylaxis was to be preferred, that powerful bactericidal activity was a necessity, and that adverse events risk should be minimal. several drugs in the rifamycin and quinolone group were considered suitable candidates for leprosy chemoprophylaxis, though the experts agreed that clinical trials were needed to provide evidence of their effectiveness and that drug prices should be considered. the following requirements were formulated for operational research programs: (a) screening of contacts for signs and symptoms of leprosy and tb; (b) provision of chemoprophylaxis under direct supervision; (c) a recording and reporting system; (d) training of health workers; (e) proper information for people receiving chemoprophylaxis; and (f) a system for antibiotic resistance monitoring. in , an updated meta-analysis of randomized controlled trials of leprosy chemoprophylaxis was published by reveiz et al. they confirmed the review by smith and smith, concluding that the use of rifampicin and acedapsone/ dapsone as chemoprophylaxis can help reduce leprosy incidence and that post-exposure chemoprophylaxis should become embedded in leprosy control programs. , in the same year, the who south-east asia regional office addressed the need for further research, based on an information consultation in the united kingdom. in , the technical commission of the international federation of anti-leprosy associations (ilep) published a review of leprosy research evidence ( - ) and implications for current policy and practice. they strongly recommended additional research on chemoprophylaxis implementation to evaluate acceptability, cost-effectiveness, feasibility, and ethical issues concerning disease disclosure and new regimens. after cuba, sdr chemoprophylaxis against leprosy was introduced in morocco in , another low-endemic country. there, leprosy detection declined over the years, showing an annual percentage reduction in leprosy detection rate of to better understand the long-term effects of chemoprophylaxis on leprosy, several modeling studies have been performed using the mathematical simcolep model developed by erasmus mc. using this model, fisher et al demonstrated that leprosy incidence would be substantially reduced in a context similar to the colep study location (bangladesh) by a combination of childhood bcg and chemoprophylaxis for screened household contacts. de matos et al predicted a declining new case detection rate in para state in brazil, combining contract screening with chemoprophylaxis. mathematical modeling by gilkison et al for kiribati, a high leprosy burden pacific island, also suggested that leprosy incidence can decrease when using an intensive chemoprophylaxis approach. the model predicted the best results for the intensive chemoprophylaxis approach that combined a household contact approach with more than one round of mass sdr in consecutive years rather than every second year. an expert meeting on chemoprophylaxis against leprosy in in switzerland re-emphasized the importance of operational research on sdr-pep. some lessons learned from a pilot project implementing sdr-pep in sampang district, indonesia, were presented by dandel. he stated that sdr-pep implementation requires: (a) ongoing support and supervision; (b) strong local ownership; (c) continuous motivation of healthcare workers; and (d) adequate loose rifampicin supply routes. stakeholders received the intervention positively. it was also seen as an opportunity to present health education, but stigma caused index patients to hesitate in disclosing their disease status to people outside their household. nevertheless, an average of contacts per index patient were included in the first year (budiawan, unpublished report). during the expert meeting, mahotarn presented results of another randomized, placebo-controlled trial with sdr conducted in thailand with a similar set-up as the colep study. , after years, the relative risk in the rifampicin group was . when compared with controls. this was similar to the difference observed in the colep trial, though not statistically significant (p = . ) because the study was not powered to detect risk reductions below %. , the expert meeting identified several important factors for the success of interventions that target contacts of leprosy patients (table ) . the meeting stated that high-endemic pockets would most likely benefit more from a mass drug administration (mda) or "blanket" approach than the contactbased strategy. in such settings, the entire community may be considered contacts. the experts recognized that pep implementation against leprosy should not be limited to high-endemic settings because low-endemic areas are likely to show a high clustering level. richardus et al found that when the endemicity of leprosy declines, a gradually higher proportion of new patients is found amongst the contacts of known cases. this aligns with field observations in west java, where leprosy endemicity varies; in the lowendemic districts, the proportion of new cases detected through contact screening is relatively high (budiawan, unpublished report). the need for more research on the feasibility of implementing sdr-pep, including its cost-effectiveness and acceptability in different geographical and sociocultural environments, was recognized. this and the urge to learn how to operationalize this innovative intervention led to the development of the lpep program. in , a multicountry research project was developed involving ministries of health, international non-governmental organizations (ngos), scientific institutes, leprosy experts, and a donor (table ) . , the lpep program, as operational study, aimed to accelerate the uptake of evidence on sdr-pep effectiveness by gathering data on the impact and feasibility of implementing sdr-pep as part of routine leprosy control. the program was implemented in highendemic areas in india, brazil, indonesia, myanmar, nepal, tanzania, and sri lanka. cambodia was also inlcuded, but followed a different study protocol. , before implementation, an expert meeting was convened to address concerns regarding the risk of inducing rifampicin resistance in tb. the experts concluded that sdr given to contacts of leprosy patients, in the absence of symptoms of active tb, poses a negligible risk of generating resistance in m. tuberculosis in individuals and populations. two years into the lpep program, the integration of contact screening and sdr-pep administration into different leprosy control programs had proved to be feasible and well accepted by all stakeholders. the program was reported to have invigorated leprosy control. after three years, approximately , contacts of recently diagnosed leprosy patients had been screened. only % were not eligible for sdr-pep, because of young age (< years or < years, depending on the country), liver or renal disease, signs and symptoms of leprosy or tb, pregnancy, known allergy to rifampicin, rifampicin use in the past years, or refusal (< %) . sdr-pep was found to be safe; adverse events were very rarely reported (richardus et al, full article under publication). mathematical modeling predicted that implementing sdr-pep could potentially accelerate the reduction of new cases and, therefore, could potentially accelerate the cessation of m. leprae transmission (blok et al, under publication) . it is also estimated to be cost-effective when assessing sdr-pep in the indian health system (us$ , per new leprosy case averted). demonstrating the operational feasibility of integrating sdr-pep into leprosy programs on such a large scale in multiple settings has contributed to who recommending sdr-pep in its guidelines for the diagnosis, treatment and prevention of leprosy. as part of the lpep program, two specific approaches for implementing sdr-pep were piloted. one was a blanket approach in lingat village on selaru island, a remote highendemic village in indonesia. the blanket approach involved total population screening in (n = ). during two visits in consecutive years, , inhabitants were screened ( %), and , ( %) received sdr-pep. during these visits, new leprosy patients were diagnosed with leprosy ( , / , ). during the third visit, new leprosy cases in , screened persons ( / , ) were detected. the other approach made use of "drives" and was implemented in cambodia, a low-endemic country. the drives in cambodia were carried out by a mobile team with leprosy experts who screened the contacts of all patients diagnosed in the previous years, and administered sdr-pep. in the first four operational districts, contacts of index patients were traced and screened, ( %) received sdr-pep, and four new leprosy patients were identified ( / , ). both the blanket approach and the drive approach required sufficient resources and thorough logistic preparation, but were operationally feasible. regular monitoring is required to identify the long-term impact. an lpep substudy in india, indonesia, and nepal assessed how the intervention changed the perception of main stakeholders regarding leprosy. the lpep program was perceived positively, though more research was recommended on providing accurate and understandable health information to contacts, and on approaches that do not require disclosure of the index patient. the lpep program also had a positive effect on people's knowledge regarding leprosy (mieras et al, unpublished report). another side study was an acceptability study carried out in india. the results of this study aligned with the results of the main study and the perception study, illustrating that contact screening and sdr-pep distribution in dadra and nagar haveli, india, were well accepted by the stakeholders. , [ ] [ ] [ ] the lessons learned from the lpep program led to a recommended minimal set of data required to monitor contact tracing activities and sdr-pep administration for leprosy control in a routine setting. based on the experiences gained from the lpep program, an sdr-pep toolkit was developed to support national leprosy program managers concerned with the practical aspects of implementing sdr-pep, such as advocacy, training, and reporting and recording. in , gillini et al collected information to determine the extent of leprosy post-exposure immuno-and chemoprophylaxis in countries around the world as national policy. a total of countries responded, representing % of the total reported global leprosy burden. nationwide routine implementation of sdr-pep was reported by only a few countries with a low burden, such as cuba ( ), morocco ( ), and samoa ( ). since sdr-pep is addressed in the who guidelines for the diagnosis, treatment and prevention of leprosy, more countries are implementing sdr-pep in their national leprosy control programs. for example, in india and indonesia, the ministries of health adopted sdr-pep as a main strategy in leprosy prevention in and , respectively. , , this year, who is expected to publish a technical guidance document whith a description of the steps that could be taken for the implementation of both contact tracing and postexposure prophylaxis (who, under publication). the availability of preventive measures contributed to a new momentum to work toward stopping the transmission of leprosy. lwin et al concluded that bcg vaccination alone is not likely to be the solution for leprosy control. as described, schuring et al performed a secondary analysis on the colep trial. the individual protective effect of bcg % ( % ci - ) and sdr-pep % ( % ci - ) demonstrated a combined protective effect of % ( % ci - ). after the findings of the colep trial, a single-center, cluster-randomized controlled trial (maltalep) was conducted to determine whether possible excess cases in the first year after immunoprophylaxis (with bcg) could be prevented with chemoprophylaxis (with sdr) without affecting bcg's protective effect. , in the intervention group (n = , ), bcg vaccination was followed by sdr after - weeks. controls (n = , ) received only bcg. the combined preventive outcome was expected to be long-lasting and better than the effect of solely bcg or sdr-pep. however, it was found that one third of all new leprosy cases among contacts had appeared - weeks after bcg vaccination, before sdr-pep was administered. this made it impossible to determine whether excess cases in the first year after immunoprophylaxis (with bcg) could be prevented with sdr-pep without affecting the protective effect of bcg. this increase of cases after immunoprophylaxis administration in the first year is consistent with other studies. , , [ ] [ ] [ ] therefore, richardus et al concluded that bcg vaccination followed by sdr as a routine intervention is not recommended in leprosy control. in a time in which a new infectious disease, coronavirus disease (covid- ), dominates the news, it is important to also keep paying attention to one of the oldest diseases known to mankind. today, leprosy still has devastating outcomes, mainly affecting the most marginalized. preventive methods are needed to stop the transmission of this disease. globally, bcg vaccination is mainly used as the primary tb prevention method in newborns. as stated, in its guidelines for the diagnosis, treatment and prevention of leprosy, who recommends only that bcg at birth should be maintained in at least all leprosy high-burden regions. nevertheless, since the early s, the brazilian ministry of health has recommended intradermal bcg for household contacts of leprosy patients. , contacts with no or one primary scar receive bcg; contacts with two bcg scars do not receive another bcg dosage. , however, scar reading is not fully reliable, and scar formation does not always occur. , for example, - % of bcg vaccinated individuals do not develop a scar. in infants vaccinated below the age of month, which is common when bcg vaccination is routinely given to newborns (eg, in brazil), fewer than % have a recognizable scar at the age of . furthermore, the evidence regarding the effectiveness of bcg revaccination is conflicting, because of the wide variation in study outcomes. , , , , , , when assessing other immunoprophylactic agents, bcg plus heat-killed m. leprae was found not to have an additional effect in leprosy prevention when compared with bcg alone. , , even if bcg plus heat-killed m. leprae provided additional protection, further development of a vaccine containing killed m. leprae is challenging because mass production would need to occur in armadillos or in immune-compromised mice. studies on the icrc and m. vaccae vaccines were limited, rarely focused on solely post-exposure prophylaxis, and were often of debatable quality. it is therefore not entirely clear if these two immunoprophylactic agents should be fully ruled out when trying to prevent leprosy transmission. more research is also needed on newly developed vaccines like lepvax as well as on the vaccine mip (mw). furthermore, the introduction of new tb vaccines, possibly replacing bcg, could have a serious impact on leprosy. the number of vaccine studies is much greater in the tb world, consistent with the incidence numbers, compared with the leprosy research field. despite the possibility of cross-protection between the two diseases, the potential impact on leprosy by tb vaccine candidates is rarely considered in tb research. , only two recombinant subunit tb vaccines (id /gla-se and id / gla-se) have also been laboratory tested for their potential use against leprosy. , more integration and harmonization between the tb and leprosy vaccine research groups would therefore be valuable. additionally, after the administration of bcg and other immunoprophylactic agents for leprosy prevention, a relative increase in the number of new (paucibacillary) leprosy patients is seen in the first follow-up year. , , [ ] [ ] [ ] a possible explanation for this is that bcg is catalyzing the existing anti-mycobacterial immunity in people infected with m. leprae, resulting in the clinical appearance of tuberculoid leprosy after bcg vaccination. , gormus and meyers described the reasoning for the doses chosen in trials with integral mycobacterial vaccines as arbitrary. they argue that dosages may be too high, resulting in the protection of some, but also resulting in increased susceptibility to leprosy in other individuals shortly after vaccination. an individual's prior exposure to environmental mycobacteria may also affect the outcome of mycobacterial vaccines. additional research with varying dosages and in different target groups would be recommended. richardus et al concluded that bcg vaccination followed by sdr as a routine intervention is not recommended in leprosy control. the maltalep study was challenged in finding significance because of insufficient statistical power. , a well-powered study focusing on the reversed-maltalep order (first sdr administration, followed by bcg) would therefore be of great value. considering the above results, contact screening followup is especially important in the first period after bcg administration, as a relatively large number of new patients presents three months post-vaccination. , , [ ] [ ] [ ] this may also count for other immunoprophylactic agents. as discussed, many immunoprophylaxis studies lacked power. more well-designed, sufficiently powered and long-lasting (regarding the leprosy incubation period) studies in this field are therefore suggested. but, given the evidence for the effectiveness of sdr-pep and the who guidelines for its use, the ethics of testing new post-exposure immunoprophylactic approaches for leprosy prevention without combining them with chemoprophylaxis in both the intervention and control group needs to be discussed. , , , , chemoprophylaxis the promising findings of the colep study, the systematic reviews, and the workshop recommendation on additional, operational research were not immediately pursued. this was partly because the use of sdr-pep has been criticized. [ ] [ ] [ ] [ ] concerns have been raised about the fact that it does not provide long-term protection like immunoprophylaxis, and that the colep study revealed that it provides an overall risk reduction of % and only % in blood-related household contacts, though the latter finding was not significant (p = . ) because the study was not powered for subgroup analysis. , , however, the effect seen in all contact subgroups trended with the overall risk reduction of %. other criticism concerned the logistics and cost-effectiveness of the intervention. though, studies have demonstrated that both contact examination and sdr-pep implementation are cost-effective. , , rodrigues, lockwood, krishnamurthy and penna also argued that contact screening and sdr-pep administration raise ethical problems because the disclosure of the index-patients' diagnosis to their contacts is required. , however, the lpep program results in brazil illustrated that it is possible to distribute sdr-pep without disclosing the identity of the index case by solely saying: "there is leprosy in your area, and that is why we offer people preventive treatment against leprosy" (ignotti, unpublished report). the lpep program successfully addressed several concerns by demonstrating the feasibility and acceptability of making prevention, in the form of contact screening and sdr-pep administration, part of leprosy control. embedding the approach in existing leprosy services invigorated the leprosy program. two additional systematic reviews of quantitative and qualitative data and a meta-analysis in and confirmed the effectiveness of sdr as pep and the general acceptance of the approach. , preventive chemotherapy has become part of leprosy control. this is needed, since the incidence has been more or less stable at around , in the past years. several high-burden countries (eg, india and indonesia) have embedded sdr-pep into routine leprosy control nationwide. , , subsequent to the publication of the latest who guidelines that recommend implementing sdr-pep, many other countries are following suit. recent modeling studies at erasmus mc rotterdam have estimated that a large-scale roll-out of sdr-pep may reduce the incidence of leprosy by % in - years (taal et al, under publication). in a strategy to halt leprosy transmission, a possible leprosy endgame strategy was described comprising contact screening and chemoprophylaxis. additionally, the leprosy research initiative (lri) and the global partnership for zero leprosy (gpzl) described research priorities related to pep. , , this included the need to seek more effective regimens, especially for household and blood-related contacts. investments in continued (operational) research are needed to discover the most feasible and acceptable approaches to integrate sdr-pep into leprosy control programs in different contexts. da cunha et al recommended that if sdr-pep was implemented in brazil, it should start on a small scale, generating new evidence from the brazilian context. several post-exposure chemoprophylactic studies against leprosy are ongoing. the pep lep project in ethiopia, tanzania, and mozambique compares the feasibility of a health center-based contact approach to acommunity skin camp-based approach regarding integrated skin screening and sdr-pep administration (schoenmakers et al, under publication). in the skin camp group, disclosing the disease status of an (index) leprosy patient is not expected to be necessary. other initiatives are working on an improved regimen as chemoprophylaxis for leprosy. an enhanced antibiotic regimen is being tested in the pep++project, conducted in india, brazil, and indonesia, comprising three standard weight-adjusted single doses of rifampicin plus clarithromycin, given at four weekly intervals. the effectiveness of pep++ still has to be established but is promising as a regimen. the expert meeting on defining an enhanced pep regimen for leprosy discussed other options for improving pep, including the use of more potent and/or longer-acting antibiotics, such as bedaquiline, rifapentine, oxazolidinone, and nitro-dihydro-imidazo-oxazoles. these antibiotics were excluded at the time because they were not yet registered in the countries included in the pep++ study (india, brazil, indonesia) or because no experience was gained with these drugs in leprosy treatment. clarithromycin was chosen after moxifloxacin was deemed unsuitable for prophylactic interventions because of the potential side-effects (publication expected). in the meantime, who has widely pushed the licensing of selected antibiotics because of their potential as second-line treatment in multidrug-resistant tb (mdr-tb), so there is ample opportunity to research their efficacy in preventive chemotherapy for leprosy. the advantages of higher dosages of rifampicin as chemoprophylaxis are currently being investigated by the people project. ortuno-gutierrez et al have published the protocol of this study which is conducted on the comoros and on madagascar. , instead of the mg/kg rifampicin dose which was used in the colep study and the lpep program, a double dose of mg/kg is used in the people project. the study will use an anti-pgl-i test in one of its arms, in which the sdr double dose will be administered only to contacts who test positive for the anti-pgl-i test. improved understanding of leprosy transmission routes will facilitate the design of targeted interventions that complement early case detection and prophylaxis. when a fieldfriendly diagnostic (rapid) test becomes available-especially a test indicating who is infected with m. leprae, incubating and transmitting leprosy before signs or symptoms occur-targeted chemoprophylaxis for leprosy in certain groups, such as household members, would be an option. , , such a test would allow a more tailored approach at the individual level (personalized medicine), which may increase efficacy of pep for blood-related household and other high-risk contacts. the gpzl pep research agenda includes the question: "which type of pep intervention fits best with which epidemiological setting?", which requires more operational research. in very high-endemic hotspot or cluster areas, a total population screening and sdr-pep administration may be the best approach. , however, when screening entire populations is neither feasible nor affordable, focal mass drug administration (fmda) may be a reasonable alternative. the fmda approach would target the population who are not included in a contact-based pep approach and would be implemented alongside contact-based pep. the effectiveness and feasibility of such an approach first needs to be tested in a randomized controlled trial. variations on screening, such as self-screening or self-referred screening only, need to be evaluated. an additional benefit of fmda would be that it is especially suitable in areas where stigma prevents patients from disclosing their disease status. questions concerning disease concealment for index patients, optimal contact and community education (eg, regarding the fact that chemoprophylaxis is not % effective), and the quality of leprosy screening by health workers need to be addressed in future research projects. another important topic is antibiotic resistance. even though the risk of inducing rifampicin resistance in m. tuberculosis is considered negligible, regular sampling and molecular monitoring for mutations associated with rifampicin resistance in m. tuberculosis and in m. leprae as recommended by who are encouraged in areas with a high rate of primary mdr-tb and among recipients of sdr-pep who develop leprosy. , , additionally, loose rifampicin that can be used as sdr-pep for leprosy prevention is urgently needed and should be made available on a global scale to facilitate further sdr-pep implementation. rifampicin is relatively cheap, and its cost-effectiveness was assessed to be good in the colep study, and also in india, based on the simcolep model and the lpep program. , through the stop tb partnership/global drug facility, dosages of mg rifampicin cost us$ . , and dosages of mg cost around us$ . but sdr-pep still requires an initial investment from national leprosy control programs in often resource-poor settings, especially when sdr-pep administration is-as recommended-combined with screening and active case-finding activities. , free provision, similar to mdt, would be beneficial on a global scale. additionally, registration of the new indication (post-exposure prophylaxis in leprosy) of loose rifampicin in more national registers of authorized medicines should be initiated by ministries of health in leprosy endemic countries. furthermore, logistical structures and (national) registration systems, for contacts of leprosy patients and pep pharmaceutical stock, sould be set up. as mentioned, taal et al have estimated the number of persons that need to be treated with sdr-pep using the simcolep model (taal et al, under publication) . the model not only predicts the number of people who need to be treated with sdr-pep to achieve a % reduction in new leprosy case detection at a global level, but it also estimates how many people need chemoprophylaxis with rifampicin for a % leprosy case reduction. predictions per country will also be published. this model and the other available evidence make clear that the implementation of evidence-based preventive interventions against leprosy, like sdr-pep, in national programs needs to be encouraged to facilitate a large-scale roll-out of pep. this will help prevent those at risk from developing leprosy and will be a vital step to stop further transmission of this ancient disease. last, but not least, it will prevent more people from having to live with leprosy and its physical, psychological, and socioeconomic consequences. leprosy: review of the epidemiological, clinical, and etiopathogenic aspects -part a strategy to halt leprosy transmission world health organization. leprosy -key facts neglected diseases of poverty leprosy: an overview of pathophysiology current status of neglected tropical diseases (ntds) in the philippines moving towards a leprosy-free world leprosy: the disease leprosy in the armadillo: new model for biomedical research application of the thymectomized-irradiated mouse to the detection of persisting mycobacterium leprae the global campaign to eliminate leprosy physical distance, genetic relationship, age, and leprosy classification are independent risk factors for leprosy in contacts of patients with leprosy patient contact is the major determinant in incident leprosy: implications for future control social distance and spatial distance are not the same, observations on the use of gis in leprosy epidemiology prophylaxis and exclusion: compulsory isolation of hansen's disease patients in são paulo editorials -first congress of the international leprosy association. fourth international leprosy conference elimination of leprosy as a public health problem: progress and prospects the future incidence of leprosy: a scenario analysis chemoprophylaxis against leprosy: expectations and methodology of a trial the missing millions: a threat to the elimination of leprosy accelerating towards a leprosy-free world. world health organization leprosy control -international textbook of leprosy leprosy post-exposure prophylaxis (lpep) programme: study protocol for evaluating the feasibility and impact on case detection rates of contact tracing and single dose rifampicin basri s descriptive analysis and text analysis in systematic literature review: a review of master data management infolep. international knowledge center for information resources on leprosy | infolep preferred reporting items for systematic reviews and meta-analyses: the prisma statement history of bcg vaccine world health organization. bcg vaccine: who position paper whole genome sequence analysis of mycobacterium bovis bacillus calmette-guérin (bcg) tokyo : a comparative study of bcg vaccine substrains bacillus calmette-guérin (bcg) vaccine: a global assessment of demand and supply balance. vaccine vaccination against leprosy leprosy and tuberculosis: antagonistic diseases. a m a arch dermatology bcg and adverse events in the context of leprosy the role of bcg in prevention of leprosy: a meta-analysis protective effect of bacillus calmette guerin (bcg) against leprosy: a population-based case-control study in nagpur bcg vaccination and leprosy protection: review of current evidence and status of bcg in leprosy control effectiveness of bacillus calmette guerin (bcg) vaccination in the prevention of leprosy: a population-based case-control study in yavatmal district long lasting bcg protection against leprosy the effect of bcg vaccination upon the occurrence of leprosy in nursery children bcg vaccination in leprosy bcg vaccination of children against leprosy: fourteen-year findings of the trial in burma the combined effect of chemoprophylaxis with single dose rifampicin and immunoprophylaxis with bcg to prevent leprosy in contacts of newly diagnosed leprosy cases: a cluster randomized controlled trial (maltalep study) leprosy: diagnostic and control challenges for a worldwide disease leprosy epidemiology in a cohort of household contacts in rio de janeiro ( - ). cadernos de saúde pública bcg vaccination of children against leprosy in uganda: final results effectiveness of bcg vaccination among leprosy contacts: a cohort study combination chemoprophylaxis and immunoprophylaxis in reducing the incidence of leprosy immunoprophylactic effects of the anti-leprosy mw vaccine in household contacts of leprosy patients: clinical field trials with a follow up of - years comparative leprosy vaccine trial in south india world health organization. guidelines for the diagnosis, treatment and prevention of leprosy vaccination in leprosy. observations and interpretations randomised controlled trial of single bcg, repeated bcg, or combined bcg and killed mycobacterium leprae vaccine for prevention of leprosy and tuberculosis in malawi. karonga prevention trial group vaccination against leprosy at ben san leprosy centre vaccines for leprosy and tuberculosis: opportunities for shared research, development, and application lepvax, a defined subunit vaccine that provides effective pre-exposure and post-exposure prophylaxis of m. leprae infection addition of mycobacterium indicus pranii (mip) vaccine as an immunotherapeutic with standard chemotherapy in borderline leprosy: a double blind study to assess clinical improvement (a preliminary report) review of global leprosy vaccine development second coming: the re-emergence and modernization of immunotherapy by vaccines as a component of leprosy control making of a highly useful multipurpose vaccine the use of the name mycobacterium w for the leprosy immunotherapeutic bacillus creates confusion with m. tuberculosis-w (beijing strain): a suggestion clinical and histopathological evaluation of the effect of addition of immunotherapy with mw vaccine to standard chemotherapy in borderline leprosy addition of immunotherapy to chemotherapy in pediatric borderline leprosy: a clinical evaluation international federation of anti-leprosy associations. the leprosy vaccine prophylactic value of dapsone in leprosy chemoprophylaxis of leprosy contacts with d.d. s dds prophylaxis against leprosy four years' experience with dapsone as prophylaxis against leprosy chemoprophylaxis among contacts of non-lepromatous leprosy long-term effects of chemoprophylaxis among contacts of lepromatous cases. results of a . years follow-up antileprosy measures in bombay, india: an analysis of years' work prevention and early detection of leprosy in children management of household contacts of leprosy patients repository acedapsone in leprosy chemoprophylaxis and treatment experience with acedapsone (dadds) in the therapeutic trial in new guinea and the chemoprophylactic trial in micronesia chemoprophylaxis against leprosy with acedapsone limited duration acedapsone prophylaxis in leprosy chemoprophylaxis is effective in the prevention of leprosy in endemic countries: a systematic review and meta-analysis. milep study group. mucosal immunology of leprosy workshop on the prevention of leprosy, pohnpei, federated states of micronesia implementation of chemoprophylaxis of leprosy in the southern marquesas with a single dose of mg per kg rifampin chemoprophylaxis of leprosy with a single dose of mg per kg rifampin in the southern marquesas; results after four years monitoring the effects of preventive therapy in the federated states of micronesia elimination of leprosy in the federated states of micronesia by intensive case finding, treatment with who/mdt and administration of chemoprophylaxis implementation of chemoprophylaxis in chuuk state, federated states of micronesia implementation of chemoprophylaxis in pohnpei state, federated states of micronesia population screening and mass chemoprophylaxis in kiribati population screening and chemoprophylaxis for household contacts of leprosy patients in the republic of the marshall islands drugs and regimens for preventive therapy against tuberculosis, disseminated mycobacterium avium complex infection and leprosy the future of leprosy elimination rationale for the preventive treatment of leprosy chemoprophylaxis of leprosy in the southern marquesas with a single mg/kg dose of rifampicin. results after years leprosy chemoprophylaxis in micronesia eficacia de la rifampicina como profiláctico en contactos de primer orden de lepra a study on transmission and a trial of chemoprophylaxis in contacts of leprosy patients: design, methodology and recruitment findings of colep effectiveness of single dose rifampicin in preventing leprosy in close contacts of patients with newly diagnosed leprosy: cluster randomised controlled trial cost-effectiveness of a chemoprophylactic intervention with single dose rifampicin in contacts of new leprosy patients protective effect of the combination bcg vaccination and rifampicin prophylaxis in leprosy prevention acceptability of chemoprophylaxis for household contacts of leprosy patients in bangladesh: a qualitative study report of the workshop on the use of chemoprophylaxis in the control of leprosy held in amsterdam, the netherlands on prevention of leprosy using rifampicin as chemoprophylaxis chemoprophylaxis in contacts of patients with leprosy: systematic review and meta-analysis monitoring grade- disability rate and applicability of chemoprophylaxis in leprosy control: report of the information consultation review of leprosy research evidence ( - ) and implications for current policy and practice trend analysis of leprosy in morocco between and : evidence on the single dose rifampicin chemoprophylaxis the long term effect of current and new interventions on the new case detection of leprosy: a modeling study leprosy new case detection trends and the future effect of preventive interventions in pará state, brazil: a modelling study predicting the impact of household contact and mass chemoprophylaxis on future new leprosy cases in south tarawa, kiribati: a modelling study role of contact tracing and prevention strategies in the interruption of leprosy transmission close contacts with leprosy in newly diagnosed leprosy patients in a high and low endemic area: comparison between bangladesh and thailand chemoprophylaxis: sufficient evidence for starting implementation pilots negligible risk of inducing resistance in mycobacterium tuberculosis with single-dose rifampicin as post-exposure prophylaxis for leprosy the leprosy post-exposure prophylaxis (lpep) programme: update and interim analysis abstracts of oral presentations - feasibility and impact of leprosy post-exposure prophylaxis: evidence from lpep, a multi-country, -year implementation research program leprosy post-exposure prophylaxis in the indian health system: a cost-effectiveness analysis an innovative approach to screening and chemoprophylaxis among contacts of leprosy patients in low endemic settings: experiences from cambodia a single dose of rifampicin to prevent leprosy: qualitative analysis of perceptions of persons affected, contacts, community members and health professionals towards chemoprophylaxis and the impact on their attitudes in india, nepal and indonesia acceptability of contact screening and single dose rifampicin as chemoprophylaxis for leprosy in dadra and nagar haveli leprosy post-exposure prophylaxis with single-dose rifampicin: toolkit for implementation minimal essential data to document contact tracing and single dose rifampicin (sdr) for leprosy control in routine settings: a practical guide global practices in regard to implementation of preventive measures for leprosy peraturan menteri kesehatan republik indonesia, nomor tahun tentang penanggulangan kusta evidence, opportunity, ethics, and the allure of zero leprosy reply to: single-dose rifampicin and bcg to prevent leprosy effectiveness of single-dose rifampicin after bcg vaccination to prevent leprosy in close contacts of patients with newly diagnosed leprosy: a cluster randomized controlled trial clinical manifestations of leprosy after bcg vaccination: an observational study in bangladesh bcg vaccine and leprosy household contacts: protective effect and probability to becoming sick during follow-up under-explored experimental topics related to integral mycobacterial vaccines for leprosy risk and protective factors for leprosy development determined by epidemiological surveillance of household contacts portaria n o . ,de de outubro de . diretrizes para vigilância, atenção e controle da hansenías e bcg scars in northern malawi: sensitivity and repeatability of scar reading, and factors affecting scar size risk and protective factors for leprosy development determined by epidemiological surveillance of household contacts bcg revaccination does not protect against leprosy in the brazilian amazon: a cluster randomised trial protection against m. leprae infection by the id /gla-se and id /gla-se vaccines developed for tuberculosis protocol, rationale and design of people (post exposure prophylaxis for leprosy in the comoros and madagascar): a cluster randomized trial on effectiveness of different modalities of implementation of post-exposure prophylaxis of leprosy contacts leprosy chemoprophylaxis: what's the need? leprosy now: epidemiology, progress, challenges, and research gaps reply to the role of contact tracing and prevention strategies in the interruption of leprosy transmission -chemoprophylaxis: a call for more research single-dose rifampicin chemoprophylaxis protects those who need it least and is not a cost-effective intervention cost-effectiveness analysis of three leprosy case detection methods in northern nigeria effectiveness of rifampicin chemoprophylaxis in preventing leprosy in patient contacts chemoprophylaxis for contacts of leprosy patients: a systematic review and meta-analysis national health portal of india tm of h and fwg of i. leprosy. prevention reviewing research priorities of the leprosy research initiative (lri): a stakeholder's consultation global partnership for zero leprosy research agenda working group subgroup on post-exposure prophylaxis chemoprophylaxis to control leprosy and the perspective of its implementation in brazil: a primer for non-epidemiologists [quimioprofilaxia para prevenção de hanseníase e sua implantação no brasil: uma explicação introdutória para não epidemiologistas an enhanced regimen as post-exposure chemoprophylaxis for leprosy: pep++ quinolone-and fluoroquinolonecontaining medicinal products prevention of transmission of leprosy: the current scenario world leprosy day : how forward respecting the past? workshop explores how to scale up pep and advance research | global partnership for zero leprosy. global partnership for zero leprosy world health organization. a guide for surveillance of antimicrobial resistance in leprosy: update. who medicines catalog -global drug facility (gdf) research and reports in tropical medicine is an international, peerreviewed, open access journal publishing original research, case reports, editorials, reviews and commentaries on all areas of tropical medicine, including: diseases and medicine in tropical regions; entomology; epidemiology; health economics issues; infectious disease; laboratory science and new technology in tropical medicine;parasitology; public health medicine/health care policy in tropical regions; and microbiology. the manuscript management system is completely online and includes a very quick and fair peer-review system. visit http://www.dovepress.com/testimonials.php to read real quotes from published authors.submit your manuscript here: http://www.dovepress.com/research-and-reports-in-tropical-medicine-journal key: cord- -ckh uke authors: elenga, narcisse title: the imperative of early treatment for children with covid- infection date: - - journal: indian pediatr doi: . /s - - - sha: doc_id: cord_uid: ckh uke nan ? these drugs (which are already widely used in pediatrics in other indications) certainly have side effects that are of concern, but their use in a hospital environment shall allow these side effects to be monitored and ensure greater safety for the patient [ ] . in the absence of specific antiviral treatments, pediatricians need more virological, epidemiological, and clinical data to better treat and manage covid- infections. it should be kept in mind that children, even when asymptomatic, may be a potential cause of spread and transmission of the disease in their communities [ ] . in light of this, barrier precaution needs to be rigorously applied within families in order to protect the elderly. acute respiratory syndrome coronavirus (sars-cov- ) infection is uncommon in children [ ] , with greater morbidity and mortality in adults and elderly. a number of hypotheses may explain the low susceptibility of children to covid- virus [ ] viz, (i) immaturity and limited function of angiotensin-converting enzyme (ace ) receptors in children, as undifferentiated cells that express low levels of ace are not readily infected by sars-cov; (ii) the immature innate immune system in young children results in less inflammation and consequently fewer symptoms; and, (iii) possible crossreactivity of antibodies against other viruses (influenza, adenovirus, respiratory syncytial virus etc.) with the sars-cov- , which could provide partial protection. as covid- infection is not universally mild in children [ ] , it is important that they are protected as a vulnerable population, as still there is limited data on the risk factors for severe infection in children. the long-term effects on the lungs of covid- in children are not known, even for those with moderate symptoms. in patients hospitalized in french pediatric units in recent weeks, the chest computed tomography (ct) scans have often been pathological, even in children with limited respiratory sign with associated decline in lung function (unpublished data). in light of this, should not all children with moderate to severe respiratory volume __ on critical appraisal of the non-peer reviewed preprint evidence, at the relationship between bcg and covid- is being proven by looking at correlation/ association among two data set (bcg vaccine coverage and covid- ), without acknowledging the confounders. the variables like the difference in testing strategies, reporting bias, demographics, nation's ability to respond to the pandemic, prevalence of co-morbidities, and different stages of the pandemic across various countries might have a significant impact on these associations/correlations and must be interpreted carefully. therefore, at this stage, this association should be considered as a hypothesis only and should be tested through appropriately designed studies. though the epidemiological association between bcg and covid- is striking, it does not prove causal relationship unless tested in well-designed clinical trials. also, we should not forget that the nses of the bcg vaccine has not been well-studied in human beings and their clinical relevance is unknown [ , ] . therefore, in the absence of evidence, the bcg vaccination for the prevention of covid- cannot be recommended. the results of the ongoing rcts shall guide us further. efforts for developing vaccines for novel coronavirus disease (covid- ) are ongoing, but it is unlikely to be available in the immediate future [ ] . in the absence of specific therapy, the researchers are exploring other potential preventive and therapeutic options. recently, there has been a buzz about the protective effect of bacille calmette-guérin (bcg) vaccine in covid- . based on epidemiological correlations, many unpublished preprints hypothesized that the bcg vaccine may offer protection against covid- . it gained so much popularity that within days three randomized controlled trials (rcts) got registered, and many more are in the pipeline [ ] . to make an informed decision, we must understand the mechanism of action of bcg, and appraise the robustness of the evidence. the basis of the possible use of the bcg vaccine against covid- lies in its non-specific effects (nses) over the immune system [ ] . the nses of bcg are mainly mediated by potentiating innate immune response through epigenetic mechanisms.these epigenetic changes within the innate cells act as de novo enhancers to boost the immune response against a secondary challenge [ ] [ ] [ ] . this enhancing response is popularly known as 'trained immunity' and is very characteristic of bcg. this trained immunity also offers protection against a variety of pathogens (salmonella, shigella, malaria, respiratory viruses, etc.) other than mycobacterium tuberculosis, and forms the basis of its use in bladder cancer, melanoma etc. however, this non-specific effect is mostly short-lived and wanes soon after the primary bcg stimulus is cleared from the body. by virtue of the nses, bcg vaccine has shown to decrease all-cause mortality in children. though a few observational studies suggest that the nses may last till adulthood, but the overall evidence is still inadequate and is of low quality [ , , ] . coronavirus disease (covid- ) in children -what we know so far and what we do not. indian pediatr infection control in stand-alone out patients and small nursing homes in the setting of covid government of india. novel coronavirus disease (covid- ): guidelines on rational use of personal protective equipment epidemiological characteristics of pediatric patients with coronavirus disease in china insight into covid coronavirus vaccines: light at the end of the tunnel. indian pediatr bacille calmette-guérin (bcg) vaccination and covid- novel coronavirus sars-cov- hydroxychloroquine in systemic lupus erythematosus (sle) presumed asymptomatic carrier transmission of covid- key: cord- -wjab y g authors: copland, alastair; sparrow, adam; hart, peter; diogo, gil reynolds; paul, mathew; azuma, miyuki; reljic, rajko title: bacillus calmette-guérin induces pd-l expression on antigen-presenting cells via autocrine and paracrine interleukin-stat circuits date: - - journal: sci rep doi: . /s - - - sha: doc_id: cord_uid: wjab y g bacillus calmette-guérin (bcg) is the only licensed vaccine for tuberculosis (tb), and is also used as an immunotherapy for bladder cancer and other malignancies due to its immunostimulatory properties. mycobacteria spp., however, are well known for their numerous immune evasion mechanisms that limit the true potential of their therapeutic use. one such major mechanism is the induction of programmed death ligand- (pd-l ), which mitigates adaptive immune responses. here, we sought to unravel the molecular pathways behind pd-l up-regulation on antigen-presenting cells (apcs) by bcg. we found that infection of apcs with bcg induced pd-l up-regulation, but that this did not depend on direct infection, suggesting a soluble mediator for this effect. bcg induced potent quantities of il- and il- , and the downstream transcription factor stat was hyper-phosphorylated. intracellular analyses revealed that levels of pd-l molecules were associated with the stat phosphorylation state, suggesting a causal link. neutralisation of the il- or il- cytokine receptors dampened stat phosphorylation and bcg-mediated up-regulation of pd-l on apcs. pharmacological inhibition of stat achieved the same effect, confirming an autocrine-paracrine cytokine loop as a mechanism for bcg-mediated up-regulation of pd-l . finally, an in vivo immunisation model showed that bcg vaccination under pd-l blockade could enhance antigen-specific memory cd t-cell responses. these novel findings could lead to refinement of bcg as both a vaccine for infectious disease and as a cancer immunotherapy. the correct balance of immune effector and regulatory responses depends on a number of molecular interactions between the antigen-presenting cell (apc) and t-cell. a key interaction for immunological tolerance is between the receptors programmed death-ligand (pd-l ) and programmed death- (pd- ). apc expression of pd-l leads to binding of this molecule to pd- on t-cells, resulting in activation of the tyrosine phosphatase shp- and dephosphorylation of critical kinases involved in t-cell receptor (tcr) signalling. blockade of this interaction diminishes treg frequencies , enhances th and th effector cell frequencies and increases cytokine production both in vitro and in vivo . the pd-l :pd- interaction has thus been targeted in immunological situations that feature restricted antigen presentation, t-cell anergy and immune tolerance as detrimental characteristicsnamely chronic infectious diseases and malignancies. in the latter scenario, clinical trials have demonstrated the remarkable efficacy of drugs developed to target these receptors, with up to % clinical response rates in some refractory cancers . worldwide, tuberculosis (tb) is the leading cause of death due to infectious disease. the only vaccine available is bacillus calmette-guérin (bcg), which shows only modest protection in adults and alarmingly low efficacy in developing countries, where tb mortality is highest. bcg (like its pathogenic relative, m. tuberculosis) can impede antigen presentation in vivo , , which is believed to contribute to the relatively low efficacy of the vaccine in humans. while mycobacteria-induced pd-l expression has been postulated as a major mechanism driving impaired antigen presentation , , it is currently not fully understood (i) the molecular mechanisms underpinning bcg-mediated pd-l up-regulation, and (ii) the immunological consequences of blocking this pathway during bcg immunisation. for over years, bcg has been employed as a front-line immunotherapy for bladder cancer , and has been used since the late s for malignant melanoma . although the mechanism of action remains to be completely elucidated, it is believed that the bacteria trigger an inflammatory response that leads to immune cell infiltration of the tumour site, thus facilitating immune-mediated clearance . this is likely to be mediated by innate (i.e. toll-like receptor) signalling, providing scope for improvement by concomitant engagement of the adaptive immune responses, which are known to be suppressed by pd-l . here, we show for the first time that bcg can induce the up-regulation of pd-l on both macrophages and dendritic cells (dcs) via autocrine/paracrine secretion of stat -activating cytokines, chiefly il- and il- . blockade of the pd-l receptor in vivo during bcg immunisation led to superior cd t-cell responses to recall antigen, thus highlighting the potential utility of this pathway in clinical settings. these findings provide new targets for improving bcg as both a tb vaccine and cancer immunotherapy. ethics. all bacteria. bcg strain pasteur was a kind gift from professor juraj ivanyi (king's college, london) and was grown according to previous reports , using standard microbiological techniques. bcg expressing green fluorescent protein (gfp; also from the ivanyi laboratory) was grown in identical conditions, but under selective media and agar containing μg/ml hygromycin b (sigma-aldrich). mice and immunisations. female c bl/ mice ( to weeks old) were obtained from charles river laboratories, uk. mice were administered mg of pd-l -blocking antibody mih or the rat igg a isotype control mac (kind gifts from professor anne cooke, university of cambridge) via the intraperitoneal (i.p.) route (day - ). twenty-four hours later (day ), mice received × cfu bcg subcutaneously (s.c.). mice then received booster immunisations of mih or mac ( mg per dose) on days , and . to confirm receptor blockade, mice were administered mg mih or mac via the i.p. route, followed by euthanasia at h, and immediate ex vivo staining of the splenocytes. cells were stained with a reported competing fluorochrome-conjugated α-pd-l clone ( f. g ) , which binds to the same epitope as mih , to test for successful receptor blockade (fig. ) . as an additional control for specificity, pd-l was also stained after mih or mac treatments. bone marrow-derived dcs were obtained as previously described . cells were > % cd c + by flow cytometry. dcs were stimulated in complete rpmi (rpmi- containing % fcs, mm l-glutamine, and μm β-mercaptoethanol ± u/ml penicillin/streptomycin -all from sigma-aldrich). for experiments involving macrophages, the cell line j . was used, and cells were grown and stimulated in complete dmem (same recipe as rpmi -sigma-aldrich). for bcg infections, bacteria were washed in complete media without antibiotics, and then apcs were inoculated at the designated moi. cells were cultured in a % co humidified incubator at °c. in some experiments, e. coli-derived lipopolysaccharide (lps; sigma-aldrich) was used at ng/ml. cytokines (peprotech, uk) were www.nature.com/scientificreports www.nature.com/scientificreports/ diluted in complete rpmi before administration. interleukin blocking antibodies (purchased from biolegend, uk) were pre-cultured with the cells for h before stimulation. stattic (tocris bioscience, uk) was diluted in dmso (sigma-aldrich) and cells were treated for h before infection. ex vivo immunogenicity assays. spleens were aseptically removed from euthanised mice, mechanically homogenised and treated with ack lysis buffer. cells were then counted and seeded at . × per well in complete rpmi, followed by treatment with μg/ml brefeldin a (sigma-aldrich). cells were stimulated with μg/ml ag b/acr (lionex, germany) or ppd (nibsc, uk) with μg/ml α-cd (biolegend) for hours before staining for flow cytometry. pma/ionomycin treatment ( ng/ml and μg/ml, respectively -sigma-aldrich) was used as a positive control and for staining boundaries (data not shown). for lymph node analysis, inguinal lymph nodes were excised from euthanised mice on the indicated day, followed by mechanical disruption, counting and immediate flow cytometric analysis. flow cytometry. in most experiments, cells were first washed in pbs and then incubated with : viability dye (efluor fixable viability dye; ebioscience) under fc receptor blockade ( : trustain; biolegend) for - minutes. cells were then washed in flow cytometry buffer (pbs (invitrogen) containing . % bsa and . % sodium azide -both from sigma-aldrich) and stained with the appropriate pre-titrated flow cytometry antibodies for m at °c. cells were sometimes fixed using biolegend fixative buffer before being acquired on a bd facscanto ii instrument and analysed using flowjo software. for assessing phosphorylated residues, cells were instead mildly fixed with fixative buffer for m at °c, and then permeabilised with a commercial methanol buffer (true-phos buffer -biolegend) for hour before staining, as described elsewhere . for intracellular cytokine staining, cells were fixed with fixative buffer, followed by permeabilisation with flow cytometry buffer containing . % saponin (sigma-aldrich). compensation was performed using ebioscience ultracomp enzyme-linked immunosorbent assay. cytokine levels in supernatants were measured using ebioscience ready-set-go elisa kits, according to the manufacturer's instructions. plates were read at nm on a tecan plate reader. prism software, using averaged technical replicates where possible. each statistical test and post-test is detailed in the relevant figure legends. a p value less than . was considered significant. dcs and macrophages are critical for the initiation of adaptive immunity. bcg can induce the up-regulation of pd-l expression on pulmonary dcs in mice , however it is unclear whether the same holds true for macrophages. dcs and macrophages were therefore infected with bcg over a range of multiplicities of infection (moi) and across two time-points ( h and h); surface expression of pd-l was assessed by flow cytometry. as shown in fig. a , the positive control lipopolysaccharide (lps) was able to significantly increase pd-l expression on both cell types (p < . ), with a striking > fold increase in macrophages at h. upon infection with bcg, both apc types expressed high levels of pd-l compared to the unstimulated control at h and h (p < . ), and a dose trend was observed for increasing moi in macrophages at h. next, a transgenic strain of bcg that expresses green fluorescent protein (gfp) was used to determine whether the up-regulation of pd-l depended on direct interaction between apcs and the bacteria. cells were gated by gfp fluorescence into gfp neg (i.e. "bystander") and gfp pos (i.e. infected) populations. these were then tested for pd-l expression. as anticipated, gfp pos infected cells displayed increased expression of pd-l that was proportionate to the infectious dose (fig. b) . surprisingly, however, gfp neg bystander cells also exhibited similar dose-dependent increases in pd-l expression to gfp pos cells, which was significantly up-regulated compared to the uninfected control at the highest moi (p < . ), and approximately % that of directly infected cells. in support of these observations, . µm filtration of bcg infection supernatants, when applied to new cells, was able to up-regulate pd-l ( supplementary fig. ). as expected, control supernatants from uninfected cells did not affect pd-l expression. these data strongly suggested that a soluble, secreted factor in culture was driving pd-l up-regulation by bcg. interestingly, bcg was able to up-regulate other members of the b family (cd , cd , pd-l ) to a certain degree, but with a pattern of skewed up-regulation of pd-l compared to cd (supplementary fig. ). bcg induces il- and il- production in tandem with stat phosphorylation. the murine pd-l gene (cd ) is under the control of complex regulatory networks and can be induced by a number of inflammatory cytokines or tlr ligands . many of these control mechanisms are cell type-specific. since mycobacteria are adept at driving stat activation , and since stat is capable of binding to the pd-l promoter in tolerogenic dcs , we hypothesised that this signalling pathway was mediating the observed effects of infection. dcs and macrophages were infected for h and intracellular flow cytometry was used to determine the levels of stat tyrosine residue phosphorylation. as can be observed in fig. a , bcg was able to hyper-phosphorylate the stat transcription factor compared to unstimulated cells (p < . ). notably, there was a trend for increased phosphorylation when comparing bcg to the positive control lps. we next hypothesised that apcs were producing stat -activating cytokines. stat can be activated weakly by il- and il- , www.nature.com/scientificreports www.nature.com/scientificreports/ but strongly by prototypical myeloid-type cytokines such as il- and il- . apcs were therefore infected with bcg (or stimulated with lps) for - h and levels of il- and il- were measured by elisa. bcg was found to induce potent quantities of il- in both dcs and macrophages at a range of moi ( fig. b ; p < . bcg vs unstimulated cells). bcg elicited il- in both cell types. strikingly, with regards to il- production, bcg greatly surpassed the ability of lps at moi = , with over -fold concentrations of this cytokine compared to the positive control. with the hypothesis that bcg was inducing stat -activating cytokines to up-regulate pd-l , we treated dcs and macrophages with different concentrations of il- and il- and measured pd-l up-regulation by flow cytometry. in dcs (fig. a) , il- played a dominant role in the up-regulation of pd-l expression compared to il- . when both cytokines were used in combination, there was only a marginal increase above the levels of pd-l expression conferred by il- . in macrophages, by contrast, il- and il- behaved similarly in terms of receptor up-regulation, and there was a combinatorial effect that was clearly evident at pg/ml. for both cell types, there was a dose-dependent effect, with pg/ml of any cytokine (or combination) being superior to pg/ml in up-regulating pd-l expression. next, macrophages were infected with bcg for h and cells were then permeabilised as before and co-stained for p-stat and pd-l . cells were then divided into pd-l lo and pd-l hi populations and then www.nature.com/scientificreports www.nature.com/scientificreports/ levels of p-stat were quantified. as shown in fig. b , pd-l lo cells exhibited significantly lower levels of stat phosphorylation compared to their pd-l hi counterparts (p < . ), with a doubling of fluorescence intensity in some experiments. taken together, these data suggested that bcg was utilising interleukin signalling pathways in order to up-regulate expression of pd-l . we next questioned whether direct intervention in the interleukin-stat axis could revert the up-regulation of pd-l by bcg. to this end, we employed a combination of monoclonal antibodies (mabs) that are known to block the il- and il- cytokine receptors, alongside the pharmacological inhibitor 'stattic': a well-characterised and highly specific small-molecule inhibitor of stat transcriptional activity . to test whether neutralising the biological activities of endogenous cytokines could reduce the increase in pd-l expression caused by bcg, cells were first pre-incubated under il- r (mab d a ) or il- r (mab b . a) blockade, or a combination of both, for h. isotype controls served as controls for non-specific activity. cells were then infected with bcg and after h, pd-l expression was determined (fig. a) . both il- and il- blockade significantly reduced pd-l expression (p < . ) compared to the isotype control baseline. as expected, the combination of blocking both receptors led to the greatest reduction in pd-l fluorescence (~ - %; p < . vs isotype control). in keeping with the hypothesised role of stat in bcg-induced pd-l expression, blockade of both receptors also led to a large reduction in stat phosphorylation, as shown in fig. b (bcg + isotype mfi: ; bcg + dual blockade mfi: ). to confirm that stat was mediating the up-regulation of pd-l expression by bcg, cells were then pre-treated with stattic or a vehicle control for hours before infection with a low dose of bacteria (fig. c) . lps served as a positive control, since it can induce pd-l expression via this pathway . after hours, the cells treated with μm stattic and infected with bcg showed a dramatically reduced expression level of pd-l compared to those treated with a vehicle control (p < . ), with an near- % reduction in pd-l expression. similar results were observed for lps. strikingly, resting cells treated with stattic actually increased pd-l expression compared to the vehicle control, although this was a non-significant trend with high variation. collectively, these data proved that bcg could modulate pd-l expression by interleukin-stat signalling circuits. proof-of-principle in vivo immunogenicity assay was next performed in order to establish that targeting the pd-l receptor during bcg immunisation could lead to increased t-cell function. a cytokine panel spanning www.nature.com/scientificreports www.nature.com/scientificreports/ several hallmark th /th cytokines (ifn-γ, il- , il- a, tnf-α) was used to determine t-cell reactogenicity in a vaccination model with recall mycobacterial antigens (fig. a) . first, the up-regulation of pd-l in vivo was determined by sub-cutaneous immunisation with bcg followed by characterisation of pd-l expression in the draining lymph nodes (supplementary fig. ) . it was found that bcg was able to up-regulate pd-l in mhc class ii high cd c + dcs, but unable to do the same in t-cells, confirming a specific effect in apcs. next, mice were treated with mg of the pd-l blocking antibody mih via the intraperitoneal route, followed by immunisation with subcutaneous bcg. mice were then given follow-up booster immunisations to maintain the pd-l blockade. an isotype control was used at the same concentration to control for non-specific effects. on day , splenocytes from immunised mice were then pulsed with either immunodominant and latency-associated antigens (ag b and acr, respectively) or a mixture of protein antigens (ppd). as shown in fig. b , there was a general trend for an increase in antigen-specific cytokine production in cd t-cells. under pd-l blockade, bcg induced significantly more ifn-γ in response to ag b/acr and ppd (ifn-γ: p < . ), compared to the isotype control. tnf-α production was also increased in response to ag b/acr (p < . ). regarding il- and il- a, there were non-significant increases caused by pd-l blockade under both antigen recall conditions. turning our attention to the cd t-cell compartment (fig. c) , we found that bcg was much poorer at inducing antigen-specific cytokine responses, as has been observed previously by others . with the exception of il- after ag b/acr pulsing (p < . ), splenocytes from mice that received bcg + isotype control were unable to produce more cytokines than splenocytes from mock-immunised mice. only two cytokines were found to be increased by pd-l blockade beyond the pbs control group in response to ag b/acr but not ppd: ifn-γ (p < . ) and tnf-α (p < . ), however these effects were marginal. thus we concluded that pd-l blockade can effectively boost cd -dependent t-cell immunity, with only marginal effects on boosting cd t-cell responses. it is long-recognised that bacteria (and indeed other pathogens) belonging to genetically distinct phyla are capable of modulating the repertoire of co-stimulatory and co-inhibitory molecules expressed on the apc surface , thus affirming the critical importance of said receptors in the directing of adaptive immune responses. mycobacteria represent an example of immune evasion par excellence due to their ancient history of co-evolution with mammalian immune systems ; indeed, virtually all pathogenic mycobacteria are obligate parasites, requiring intracellular www.nature.com/scientificreports www.nature.com/scientificreports/ resources in order to thrive and propagate. it is therefore not surprising that they are biologically equipped to effectively counter adaptive immune responses that would lead to their own clearance. a centrally important molecule in the control of t-cell immunity is pd-l . mice infected with mycobacteria harbour pulmonary dcs that express high levels of pd-l and restrict antigen presentation to cd t-cells , and pd-l blockade in blood and lung lavage from tb patients can enhance responses to mtb antigens, as seen by greater cytokine production and t-cell proliferation , . furthermore, pd-l blockade is able to rescue these cells from functional exhaustion, as demonstrated by the reversal of t-cell apoptosis . for bladder cancer, the tumour surface is reportedly decorated with high levels of pd-l molecules, and the tumour-infiltrating b-and t-cells express high levels of both pd-l and pd- , . the utilisation of bcg as a prophylactic (tb) or therapeutic (malignancy) treatment for these diseases, combined with a strategy to mitigate the effects of pd-l , could provide a strong advantage for the efficacy of bcg. in this study, for the first time, it was shown that bcg drives up-regulation of pd-l expression on apcs by autocrine/paracrine cytokine circuits that lead to stat phosphorylation and up-regulation of this co-inhibitory receptor (illustrated in fig. ) . it has been known for some time that bcg is a strong inducer of these cytokines via rudimentary tlr signalling, however it was not known that they were driving pd-l expression in a biphasic response. the observation that inhibition of stat did not lead to a decrease in pd-l expression in resting cells-indeed, there was instead a non-significant increase in expression-is consistent with the notion that the pd-l gene promoter requires distinct transcriptional apparatus during the steady-state and during active infection. this is in accord with the fact that dcs and macrophages displayed moderate levels of constitutive pd-l expression in the absence of any appreciable cytokine levels . physiologically, this is undoubtedly to prevent spontaneous activation of the adaptive immune system. using the mab mih , we were able to neutralise most of the pd-l receptor in vivo and augment the quantities of cytokine produced by cd t-cells in response to recall antigen in a proof-of-principle experiment. it is interesting to note that pd-l blockade in vivo did not greatly boost the antigen-specific cd t-cell responses beyond that of the mock-immunised control group. bcg is widely known to only minimally induce cytotoxic t-cell responses, with a strong bias towards cd responses . this may be due to so-called cd 'decoy antigens' , such as tb . , that serve to divert responses away from immunogenic epitopes for cytotoxic t-cells . whether the enhancement of cd t-cell immunogenicity in the absence of strong cd t-cell immunogenicity leads to better vaccine (i.e. in the case of tb) or immunotherapeutic (i.e. in the case of a carcinoma) outcomes warrants testing in disease-specific animal models. www.nature.com/scientificreports www.nature.com/scientificreports/ stat -activating cytokines, (ii) il- /il- cytokine receptors, (iii) the stat transcription factor and (iv) the pd-l receptor itself. stat presents a highly appealing therapeutic target other than its role in pd-l expression due to the fact that is a pleiotropic master controller of general tolerance in apcs. stat can suppress autophagy , nitric oxide production , il- production , and co-stimulatory molecule expression . given our new findings, targeting this pathway during vaccination with bcg (for tb or malignancy) could reap multiple therapeutic benefits. in conclusion, we have revealed novel molecular insights into how bcg up-regulates pd-l on apcs, allowing for improved immunogenicity to specific antigens, but also more intricate understanding of fundamental host-pathogen interactions. future work will focus on exploring this pathway in specific disease models that rely on bcg as a treatment, with the aim of bolstering immunological parameters, and ultimately, treatment efficacy. pd-l regulates the development, maintenance, and function of induced regulatory t cells interactions between pd- and pd-l promote tolerance by blocking the tcr-induced stop signal interference with pd-l /pd- co-stimulation during antigen presentation enhances the multifunctionality of antigenspecific t cells pd- blockade with nivolumab in relapsed or refractory hodgkin's lymphoma mycobacterium bovis bcg decreases mhc-ii expression in vivo on murine lung macrophages and dendritic cells during aerosol infection bcg vaccine mediated reduction in the mhc-ii expression of macrophages and dendritic cells is reversed by activation of toll-like receptors and enhanced expression of pd-l and ifn-gamma on dendritic cells is associated with bcg-induced th inhibition mycobacteria-responsive sonic hedgehog signaling mediates programmed death-ligand -and prostaglandin e -induced regulatory t cell expansion bcg immunotherapy of bladder cancer: years on bcg immunotherapy of malignant melanoma: summary of a seven-year experience bacillus calmette-guerin immunotherapy for urothelial carcinoma of the bladder mucosal delivery of fusion proteins with bacillus subtilis spores enhances protection against tuberculosis by bacillus calmette-guerin preferential contribution of b -h to programmed death- -mediated regulation of hapten-specific allergic inflammatory responses type diabetes development requires both cd + and cd + t cells and can be reversed by non-depleting antibodies targeting both t cell populations the programmed death- ligand :b - pathway restrains diabetogenic effector t cells in vivo synovial regulatory t cells occupy a discrete tcr niche in human arthritis and require local signals to stabilize foxp protein expression intrinsic and extrinsic control of expression of the immunoregulatory molecule pd-l in epithelial cells and squamous cell carcinoma arginine usage in mycobacteria-infected macrophages depends on autocrine-paracrine cytokine signaling pd-l expression on tolerogenic apcs is controlled by stat- stattic: a small-molecule inhibitor of stat activation and dimerization expression of pd-l and pd-l on human macrophages is up-regulated by hiv- and differentially modulated by il- systemic bcg immunization induces persistent lung mucosal multifunctional cd t(em) cells which expand following virulent mycobacterial challenge manipulation of costimulatory molecules by intracellular pathogens: veni, vidi, vici!! plos pathog , e host-pathogen coevolution in human tuberculosis dendritic cells in chronic mycobacterial granulomas restrict local anti-bacterial t cell response in a murine model pd- /pd-l pathway inhibits m.tb-specific cd (+) t-cell functions and phagocytosis of macrophages in active tuberculosis programmed death- (+) t cells inhibit effector t cells at the pathological site of miliary tuberculosis inhibiting the programmed death pathway rescues mycobacterium tuberculosisspecific interferon gamma-producing t cells from apoptosis in patients with pulmonary tuberculosis a review on the evolution of pd- /pd-l immunotherapy for bladder cancer: the future is now a review of the pd- /pd-l checkpoint in bladder cancer: from mediator of immune escape to target for treatment pd-l and pd-l are differentially regulated by th and th cells mycobacterium tuberculosis-specific cd + and cd + t cells differ in their capacity to recognize infected macrophages quantitative comparison of the efficiency of antibodies against s and s subunit of sars coronavirus spike protein in virus neutralization and blocking of receptor binding: implications for the functional roles of s subunit constitutive activation of stat by the src and jak tyrosine kinases participates in growth regulation of human breast carcinoma cells tlr-mediated stat and erk activation controls il- secretion by human b cells cytoplasmic stat represses autophagy by inhibiting pkr activity stat represses nitric oxide synthesis in human macrophages upon mycobacterium tuberculosis infection il- -independent stat activation by toxoplasma gondii mediates suppression of il- and tnf-alpha in host macrophages latency-associated protein acr impairs dendritic cell maturation and functionality: a possible mechanism of immune evasion by mycobacterium tuberculosis we would like to thank professor anne cooke (university of cambridge) for kindly providing the mih antibody and for helpful suggestions regarding the in vivo experiments. we would also like to thank dr david bending (university of birmingham) for advice regarding the manuscript. this work was funded by an e.u. horizon grant as part of the eliciting mucosal immunity in tuberculosis (emi-tb) consortium project. a.c. conceived the work, performed majority of experiments and co-wrote the manuscript; p.h., a.s. and g.r.d. helped with flow cytometry assays and in vivo pd-l blockade experiment; m.j.p. helped with statistical analysis; m.a. provided the anti-pd-l antibody and critically reviewed the manuscript; r.r. conceived and supported the work and co-wrote the manuscript. supplementary information accompanies this paper at https://doi.org/ . /s - - - . publisher's note: springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.open access this article is licensed under a creative commons attribution . international license, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made. the images or other third party material in this article are included in the article's creative commons license, unless indicated otherwise in a credit line to the material. if material is not included in the article's creative commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. to view a copy of this license, visit http://creativecommons.org/licenses/by/ . /. key: cord- - n pz authors: shet, anita; ray, debashree; malavige, neelika; santosham, mathuram; bar-zeev, naor title: differential covid- -attributable mortality and bcg vaccine use in countries date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: n pz while mortality attributable to covid- has devastated global health systems and economies, striking regional differences have been observed. the bacille calmette guerin (bcg) vaccine has previously been shown to have non-specific protective effects on infections, as well as long-term efficacy against tuberculosis. using publicly available data we built a simple log-linear regression model to assess the association of bcg use and covid- -attributable mortality per million population after adjusting for confounders including country economic status (gdp per capita), and proportion of elderly among the population. the timing of country entry into the pandemic epidemiological trajectory was aligned by plotting time since the th reported case. countries with economies classified as lower-middle-income, upper-middle-income and high-income countries (lmic, umic, hic) had median crude covid- log-mortality of . (interquartile range (iqr) . , . ), . (iqr . , . ) and . (iqr . , . ), respectively. covid- -attributable mortality among bcg-using countries was . times lower [ % ci . - . ] than in non bcg-using countries. notwithstanding limitations due to testing constraints in lmics, case ascertainment bias and a plausible rise of cases as countries progress along the epidemiological trajectory, these analyses provide intriguing observations that urgently warrant mobilization of resources for prospective randomized interventional studies and institution of systematic disease surveillance, particularly in lmics. novel sars-cov continues to wreak global havoc. mortality is of greatest concern directly influencing national response and policy. early reports from hubei province in china reported a case fatality rate (cfr) of % , which with widening surveillance, rapidly decreased to below % , . as new epidemics began in other countries, early testing strategies focused only on severe cases or contacts of known cases and those with known international travel, leading to positively biased cfr estimates. a high cfr of . % reported in italy was attributed to a greater proportion of the elderly in the population and a stringent testing strategy restricted to severe disease cases . with concurrent outbreaks occurring globally, marked discrepancies in cfr became increasingly apparent. in east asian countries (vietnam, thailand, and philippines), early rises in case incidence have not been followed by similarly sharp cfr increases. cfr estimation is sensitive to testing strategies, initiation of distancing measures, access to healthcare and population age structure. we surmised that since susceptibility to covid- infection extends to the entire population, crude national covid- -specific mortality within the country-specific population would be an informative outcome indicator to study differences in mortality patterns amongst countries, in addition to a priori defined potential exposure variables including bcg vaccine use in national immunization schedules. among vaccination strategies worldwide, bacille calmette guérin (bcg) vaccine has the widest use and is accompanied by a strong safety profile. it is given in infancy for prevention of severe forms of tuberculosis. epidemiological and randomized trial evidence suggest a protective effect of bcg on infant mortality via nonspecific heterologous protection against other infections possibly through innate immune epigenetic mechanisms , . bcg lowers experimental viremia in adult human volunteers through upregulation of interleukins such as il- β . in a randomized placebo-controlled trial in indonesia, bcg given monthly consecutively for months significantly reduced incidence of acute upper respiratory infections among individuals aged > years . in a trial among native americans, bcg vaccination given during childhood showed efficacy in preventing tuberculosis up to years after vaccination, indicating the durability of its protection . demonstration that exposure to bcg vaccination can ameliorate severe covid- disease and lower mortality could rationalize a therapeutic or preventive strategy that can have immediately deployable global impact. therefore, using existing publicly available data we examined at the ecological level whether country-level covid- mortality was associated with bcg use in national immunization schedules. . cc-by-nd . international license it is made available under a author/funder, who has granted medrxiv a license to display the preprint in perpetuity. is the (which was not peer-reviewed) the copyright holder for this preprint . https://doi.org/ . / . . . doi: medrxiv preprint national covid- -attributable death counts as reported on march from the johns hopkins coronavirus resource center , for the top countries reporting highest case events were used to calculate crude covid- -attributable mortality per million population. population and economic data from (gross domestic product (gdp), and high, middle or low-income status) were derived from the world bank population data and open data repository . in order to mitigate the bias centered around the differential epidemic time curves experienced by the different countries, we calculated days from the th covid- -positive case to align the countries on a more comparable time curve. we included data on bcg vaccine inclusion in national immunization schedules from the bcg world atlas . to evaluate the effect of bcg vaccine on mortality attributable to covid- , we built a simple log-linear regression model using crude covid- -attributable mortality data per million population for each country as outcome, bcg vaccine inclusion in the national immunization schedule as exposure, and adjusted for the effects of the following variables on mortality: country-specific gdp per capita, the percentage of population years and above, and the relative position of each country on the epidemic timeline (days since th case reported as of march ). the shapiro-wilk normality test confirmed that the log-transformed covid- -specific mortality was normally distributed. as china, a bcg-using country with a large population and a relatively concentrated death count in a single province can conceivably demonstrate an artifically lowered mortality and skew these results towards bcg use, we did a sensitivity analysis by running our model with the same covariate adjustments but without china. all data were analysed using the r environment for statistical computing (r core team ) . the median crude covid- mortality per million population among countries with economies classified as low-middle-income, upper-midle-income and high-income countries (lmic, umic, hic) were . (interquartile range (iqr) . , . ), . (iqr . , . ) and . (iqr . , . ), respectively (fig. ) . characteristics of bcg using and non-bcg using countries with respect to the variables considered are shown in supplementary table s . in the log-linear regression adjusted for per capita gdp, age, and time since th case, covid- -attributable mortality among bcg-using countries was . times lower [ % confidence . cc-by-nd . international license it is made available under a author/funder, who has granted medrxiv a license to display the preprint in perpetuity. is the (which was not peer-reviewed) the copyright holder for this preprint the direct association between covid- -attributable mortality and country-level economic status observed in this analysis is starkly counterintuitive. prior global disease burden assessments have suggested that deaths from acute respiratory illness are typically higher in low-income settings due to multiple socio-demographic and economic risk factors , . among observed covid- -attributable risk factors for disease severity and death, age over years has been identified as a significant factor , , while it is inferred that lmics which typically have a younger population structure would potentially experience fewer overall deaths. another potential confounder was the time lag in deaths following detection of cases. we selected countries with at least reported cases and adjusted for time since this sentinel event. after adjusting for country economic status, proportion of older population and aligning the epidemic trajectories of the highest hit countries, the intriguing observation of a significant association between bcg use and lower covid- -attributable mortality remained discernable. recent non-peer reviewed work reported a similar negative association between bcg use and covid- mortality . unlike our report, their findings did not account for potential confounding effects of income status, age structure of the population or timing of the epidemic, and included only bcg non-using countries, making reliable inference challenging. currently, bcg vaccine is being considered for clinical trials in different settings to test its ability to . cc-by-nd . international license it is made available under a author/funder, who has granted medrxiv a license to display the preprint in perpetuity. is the (which was not peer-reviewed) the copyright holder for this preprint . https://doi.org/ . / . . . doi: medrxiv preprint mitigate infection effects or protect healthcare workers and the elderly population against the sars-cov- disease . several other determinants related to host, viral and environmental factors may be ascribed to these mortality differences. prevalence of comorbidities such as diabetes, cardiovascular disease, chronic respiratory disease and cancer are rising in lmics, and in some settings have overtaken hic. in non-insulin dependant diabetes mellitus prevalence among adults was reported to be % in asian countries and % in europe . the world health organization estimates higher cardiovascular disease risk in asian regions than in european and north american regions . since we had no access to comprehensive nationally representative comorbidity data, the contribution of disease comorbidity as a population level risk factor for covid- -attributable mortality remains unclear. genetic risk factors associated with susceptibility to sars-cov- (in ccl , mannose binding lectin, cxcl /ip- or ace receptor) are currently under evaluation, and as more evidence accumulates, the role played by these factors may become evident , . variations in sars-cov receptor binding domain of the spike protein or nucleocapsid protein could alter disease severity , , although this is more likely to occur in an endemic setting rather than during a pandemic. temperature and relative humidity may be inversely associated with viral transmissibility. but the association has been modest and inconsistent , . early disease models that used assumptions based on cfrs from china and italy predicted higher mortality in lmics, which led to countries adopting severe lockdown measures . ongoing containment measures are critical for infection transmission mitigation. these measures should be balanced against predicted increases in non-covid- mortality arising directly from economic shutdowns and distancing measures. severe trade restrictions and lowered productivity can increase poverty and food insecurity globally . major and prolonged disruptions in crucial health service delivery such as immunization programs or access to emergency obstetric and newborn care can result in a direct increase in preventable deaths, as occurred during and after ebolavirus epidemics . balancing transmission mitigation against sustaining basic health and nutrition access is a difficult but urgent task. the limitations in our analyses are important to consider. deaths lag behind symptomatic infection by - weeks, and when compared with concurrent incidence cases may underestimate the cfr, although this is less likely to influence cumulative crude mortality . health system preparedness of each country and the institution of control measures such as social distancing and lockdowns can also determine the cases and mortality numbers. our data are not meant to falsely reassure countries that their use of bcg may lead to lower mortality. indeed, our analysis is ecological, does not take into account present bcg coverage, nor timing of bcg . cc-by-nd . international license it is made available under a author/funder, who has granted medrxiv a license to display the preprint in perpetuity. is the (which was not peer-reviewed) the copyright holder for this preprint . https://doi.org/ . / . . . doi: medrxiv preprint vaccine introduction into national schedules, and is not based on a randomized comparison. by far the most important source of unmeasured confounding in our analysis relates to differential testing and reporting. limited laboratory surveillance availability and access to facility-based care is common in countries using bcg. substantial case underascertainment or under-reporting of deaths can magnify any association between mortality and bcg use. in exponential functions, small iterations in time result in substantial changes in outcome. our findings need to be interpreted with caution; given vulnerable health systems and high levels of comorbidities in lmics, if an exponential rise of cases followed by deaths were to occur in ensuing weeks, this would alter the epidemiological predictions in this report. despite all these caveats, the inverse relationship between country economic status and covid- -attributable mortality, and the strong ecological association with bcg vaccination are intriguing. the findings warrant deeper epidemiological scrutiny and prospective evaluation in individually randomized trials. importantly the findings in this report illustrate the pivotal role that continuous systematic laboratory surveillance will have in improving our understanding of the pandemic, particularly in lmics. such data lead to informed policy making that are beneficial to health and economic outcomes. clinical features of patients infected with novel coronavirus in wuhan epidemiologic and clinical characteristics of novel coronavirus infections involving patients outside wuhan, china characteristics of and important lessons from the coronavirus disease (covid- ) outbreak in china: summary of a report of cases from the chinese center for disease control and prevention case-fatality rate and characteristics of patients dying in relation to covid- in italy nonspecific effects of vaccines and the reduction of mortality in children non-specific effects of bcg vaccine on viral infections. clinical microbiology and infection bacille calmette-guerin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity the efficacy of bacillus calmette-guerin vaccinations for the prevention of acute upper respiratory tract infection in the elderly long-term efficacy of bcg vaccine in american indians and alaska natives: a -year follow-up study coronavirus covid- global cases by the center for systems science and engineering an interactive web-based dashboard to track covid- in real time. the lancet infectious diseases. . . world bank population and open data repository a database of global bcg vaccination policies and practices, mcgill university and public health agency of canada r: a language and environment for statistical computing. r foundation for statistical computing risk factors for mortality from acute lower respiratory infections (alri) in children under five years of age in low and middleincome countries: a systematic review and meta-analysis of observational studies chronic respiratory diseases global mortality trends, treatment guidelines, life style modifications, and air pollution: preliminary analysis covid- ) -united states correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study international diabetes federation world health organization cardiovascular disease risk charts: revised models to estimate risk in global regions. the lancet global health functional polymorphisms of the ccl and mbl genes cumulatively increase susceptibility to severe acute respiratory syndrome coronavirus infection comparative genetic analysis of the novel coronavirus ( -ncov/sars-cov- ) receptor ace in different populations the proximal origin of sars-cov- . nature medicine genetic diversity and evolution of sars-cov- . infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases high temperature and high humidity reduce the transmission of covid- preliminary evidence that higher temperatures are associated with lower incidence of covid- , for cases reported globally up to th the effect of control strategies to reduce social mixing on outcomes of the covid- epidemic in wuhan, china: a modelling study how much will global poverty increase because of covid- ? effects of the west africa ebola virus disease on health-care utilization -a systematic review real estimates of mortality following covid- infection. the lancet infectious diseases non bcg-using countries bcg-using countries key: cord- - h yi i authors: kumar, sudeep title: live-attenuated bacterial vectors for delivery of mucosal vaccines, dna vaccines, and cancer immunotherapy date: - - journal: pharmaceuticals from microbes doi: . / - - - - _ sha: doc_id: cord_uid: h yi i vaccines save millions of lives each year from various life-threatening infectious diseases, and there are more than vaccines currently licensed for human use worldwide. moreover, in recent decades immunotherapy has become the mainstream therapy, which highlights the tremendous potential of immune response mediators, including vaccines for prevention and treatment of various forms of cancer. however, despite the tremendous advances in microbiology and immunology, there are several vaccine preventable diseases which still lack effective vaccines. classically, weakened forms (attenuated) of pathogenic microbes were used as vaccines. although the attenuated microbes induce effective immune response, a significant risk of reversion to pathogenic forms remains. while in the twenty-first century, with the advent of genetic engineering, microbes can be tailored with desired properties. in this review, i have focused on the use of genetically modified bacteria for the delivery of vaccine antigens. more specifically, the live-attenuated bacteria, derived from pathogenic bacteria, possess many features that make them highly suitable vectors for the delivery of vaccine antigens. bacteria can theoretically express any heterologous gene or can deliver mammalian expression vectors harboring vaccine antigens (dna vaccines). these properties of live-attenuated microbes are being harnessed to make vaccines against several infectious and noninfectious diseases. in this regard, i have described the desired features of live-attenuated bacterial vectors and the mechanisms of immune responses manifested by live-attenuated bacterial vectors. interestingly anaerobic bacteria are naturally attracted to tumors, which make them suitable vehicles to deliver tumor-associated antigens thus i have discussed important studies investigating the role of bacterial vectors in immunotherapy. finally, i have provided important discussion on novel approaches for improvement and tailoring of live-attenuated bacterial vectors for the generation of desired immune responses. vaccines provide protection against numerous life-threatening infectious diseases, by activating the adaptive immunity against specific pathogen-derived antigens. since the introduction of active immunization, several vaccines have been licensed for human use. these include some subunit vaccines, which are preferred for their superior safety profile. however, their success is limited by their poor immunogenicity, as multiple booster immunizations and adjuvants are required to achieve an adequate level of protective immunity. moreover, a subunit vaccine is only applicable for pathogens where a well-defined protective antigen has been discovered. subunit vaccines are also limited in their ability to induce cell-mediated immunity. in contrast, the live-attenuated/live-inactivated vaccines exhibit superior immunogenicity and induce humoral as well as cell-mediated immunity. although attenuated viruses and bacteria are both utilized as vaccine vectors, this review will focus only on attenuated bacterial vaccine vectors. bacteria harbor natural adjuvants in the form of pathogen-associated molecular patterns (pamps) (fig. . ) . pamps, which are recognized by components of the innate immune system including tolllike receptors (tlrs), facilitate the release of pro-inflammatory mediators and recruitment of antigen-presenting cells ( fig. . ) . furthermore, even after attenuation, a limited degree of proliferation and dissemination capacity is retained in the attenuated pathogens. overall, these factors contribute to the superior immunogenicity of live-attenuated bacteria, which consequently elicit a robust and durable immunity against the cognate antigens. with the advent of molecular biology and genetics, it is feasible to effectively excise or insert desired genes into bacteria. bacterial vectors can be engineered to express and deliver heterologous proteins, such as antigens or therapeutic proteins, in mammalian hosts. moreover, by genetic manipulation, bacterial vectors can be engineered with properties including reduced virulence, high immunogenicity, properties which are desirable in a vaccine vector. thus far, a variety of liveattenuated bacterial vectors including mycobacterium bovis strain bacillus calmette-guérin (bcg), salmonella spp., listeria monocytogenes (lm), vibrio cholerae, escherichia coli, and shigella spp. have been utilized for the delivery of heterologous proteins into mammalian hosts as vaccine antigens or therapeutic proteins. such bacteria are called, live-attenuated bacterial vectors (labvs). vaccines elicit distinct immune responses depending on the route of immunization. mucosal immunization induces strong systemic as well as mucosal immune ( ) is complemented with a functional copy of asd gene, inserted into the plasmid ( ); this feature ensures antibiotic-free maintenance of plasmids. the plasmid ( ) also carries genes encoding antigenic proteins. various pathogen-associated molecular patterns including flagellin ( ), lipopolysaccharide ( ), lipoprotein ( ), and peptidoglycan ( ) facilitate the interaction with and signal the activation of antigen-presenting cells, while the additional appendages like autotransporters ( ) facilitate surface display of antigens response, whereas parenteral immunization induces potent systemic but a poor mucosal immune response. since birth, mucosal surfaces of the human body are constantly challenged with agents of the external environment that are either completely harmless (food ingredients and nonpathogenic microbes) or pathogenic (pathogenic microbes). thus, in order to restrict pathogenic insults at mucosal surfaces, mucosa-associated lymphoid tissues (malt) are organized. in fact, malt constitutes the largest immune system of the human body. the oral route is the most favored route for mucosal immunization over other mucosal routes including nasal, activation of antigen-presenting cells by live-attenuated bacterial vectors leads to adaptive immune response: various pathogen-associated molecular patterns present in the liveattenuated bacterial vectors interact with toll-like receptors expressed on the surface or in endosomal membranes. the signaling initiated by this interaction leads to the activation of antigenpresenting cells. activated antigen-presenting cells express costimulatory molecules cd , cd , and cd as well as enhance expression of mhc-ii. costimulatory molecules are required to deliver the essential second signal for t-cell activation, while the first signal is received via tcr-mhc-peptide interaction. importantly, ccr expressed by activated apcs help migration to draining lymph node. moreover, the type of cytokines directs the fate of t-cell polarization to th , th , or th . cytosolic delivery of antigens gives rise to ctl response vaginal, and rectal. upon oral administration, antigens travel through the gastrointestinal tract and reach the mucosal inductive sites called peyer's patches. peyer's patches are lined with specialized epithelial cells called m cells which serve as a point of entry into the lamina propria. in the lamina propria, dendritic cells take up the antigens and migrate to the draining lymph nodes where they present the antigens to t cells. a specialized feature of dendritic cells from peyer's patches and mesenteric lymph nodes is that they induce gut-homing receptors α /β and ccr on t and b cells. this feature is not found in the dendritic cells from cervical lymph nodes and spleen. thereby, t and b cells primed at the mucosal sites are destined to migrate to mucosal tissues (pasetti et al. ) (fig. . ). live-attenuated microbes exhibit superior ability to deliver vaccine antigens to the mucosal immune system, as many of them are derived from natural mucosal pathogens, including salmonella spp., lm, e. coli, v. cholerae, and shigella spp. this review explores the current knowledge about the labv application in the delivery of vaccine antigens (to the mucosal immune system), dna vaccine, and immunotherapy. mechanism of immune responses elicited by labv-based vaccines, the recent advances, and future perspectives have been discussed. mucosal immune response elicited by live-attenuated bacterial vectors: mucosal inductive sites including gut-associated lymphoid tissues and nasal-associated lymphoid tissues facilitate sampling of antigens through m cells. m cells allow the passage of bacteria through the mucosal epithelium, where they are taken up by antigen-presenting cells including dcs and macrophages. apcs undergo activation upon interaction with live-attenuated bacterial vectors, and the associated antigens are presented to t cells in the lymphoid follicles or the draining lymph nodes. activated t cells help b cells differentiate into iga-producing plasma cells. the secreted iga provide effective protection against mucosal pathogens. the t and b cells primed at mucosal sites migrate back to mucosal sites where they perform their effector functions nonpathogenic commensals including the lactic acid bacteria and bacillus subtilis as well as the attenuated versions of the pathogenic bacteria including salmonella spp., e. coli, shigella spp., lm, and v. cholerae have been utilized as labvs. while the commensal microbes are generally regarded as safe or food grade, the virulence of the pathogenic microbes needs to be significantly attenuated before they can be considered safe to deliver vaccine antigens into humans ( fig. . ) . generally, plasmids are employed for the expression of heterologous antigens in labvs. plasmids can be easily manipulated in e. coli (a universal tool for genetic engineering) and subsequently introduced into the desired bacterial strains. shuttle vectors (plasmids) carry genetic elements for replication in e. coli and promoter elements for gene expression in other bacterial or mammalian cells. thus, mammalian expression vectors can be first manipulated and propagated in e. coli and then delivered via labvs to mammalian cells, where the desired antigens are expressed ( fig. . ). in early days, attenuation of the pathogenic microbes was achieved by in vitro cultivation for several generations, followed by the evaluation of virulence in successive generations. the classic example is bcg, where albert calmette and camille guerin, by culturing a virulent strain of m. bovis for more than serial passages in vitro (between and ) , generated the attenuated strain bcg. bcg is still the only vaccine available for prevention against tuberculosis. subsequent genetic analysis revealed that bcg lack multiple virulence factors associated with m. bovis (zheng et al. ) . similarly, the search for vaccines against typhoid fever led to the generation of attenuated live vaccine strains of salmonella. salmonella enterica serotype typhi (st) strain ty a (st-ty a) was generated by chemical mutagenesis of wild-type st strain ty . the st-ty a is considerably attenuated which is now licensed for humans use as an oral vaccine (wang et al. ). however, the strain exhibits low immunogenicity, as - doses are required to achieve adequate levels of protection. with the advances in microbial genetics and genetic engineering techniques, it has now become routine to identify and inactivate virulence genes. interestingly, various auxotrophic mutant salmonella strains, which lack the ability to synthesize aromatic amino acids, were found to be avirulent (hoiseth and stocker ) . it is known that in salmonella, the gene products of aroa, aroc, and arod are required for the biosynthesis of aromatic amino acids, as well as several essential vitamins. hoiseth and stocker note that these factors are not found in mammalian hosts in sufficient amount; thus salmonella aroa mutants cannot proliferate in mammalian hosts (hoiseth and stocker ) . harnessing this knowledge, various salmonella enterica serovar typhi (st) or typhimurium (stm) have been created, with mutations in aroa (dalla pozza et al. ; roberts et al. ; arnold et al. ) , aroc (khan et al. ; capozzo et al. ) , arod (capozzo et al. ; sevil domènech et al. ) , or aroad (strugnell et al. ; roberts et al. ) . notably, the st strain cvd which carries aroc and arod mutations exhibits residual virulence in humans (wang et al. ) , while other investigators have also targeted genes in nucleotide biosynthesis pathways for creating attenuated salmonella. wang et al. engineered a salmonella strain with a mutation in guaba operon, which interferes in the guanine nucleotide biosynthesis. the resultant strain, called cvd , exhibits safety profile comparable to that of the typhoid vaccine strain st-ty a. importantly, st-ty a, cvd- -htra (harboring mutations at aroc, arod, and htra), and cvd all exhibit a high level of immunogenicity (wang et al. ) . not surprisingly, st strains with guaba mutations have been widely utilized as labv (pasetti et al. (pasetti et al. , wang et al. ) . another approach of attenuation of salmonella is to introduce mutations in cya (adenylate cyclase) and crp (cyclic amp) receptor genes. these proteins are transcriptional regulators of many important genes. although camp is found in mammalian cells, their concentrations in gastrointestinal tissues are below the requirement of salmonella. thus cya and crp mutants show reduced virulence (tacket et al. ; chen and schifferli ; wyszyńska et al. ; ferreira oliveira et al. ) . mutations in the two-component regulatory system phop/phoq, which controls more than virulence genes involved in resistance to antimicrobial peptides, nutrient scavenging, and lipid a modifications, significantly decrease salmonella virulence (raupach and kaufmann ) . salmonella strains with phop/phoq mutations have been used in a number of studies as labv (angelakopoulos and hohmann ; kotton et al. ; galen et al. ; wang et al. ) . rpos is an alternate sigma factor that regulates resistance under stress induced during gastrointestinal infection such as ph, nutrient starvation, change in osmolarity, and temperature. st-ty a contains multiple mutations including rpos (wang et al. ) . ssav is a component of salmonella type iii secretion system, which is required for secretion of spi- genes (essential for growth in macrophages). the st strain zh which contains aroc and ssav mutations is highly attenuated and immunogenic in humans (hindle et al. ) . tacket et al. generated mutations in htra gene, which encodes a heat shock protein. the resultant strain was avirulent because of reduced ability to survive and replicate in host tissues (tacket et al. ) . htra mutant salmonella strains have been used in multiple studies as labvs (galen et al. ; roberts et al. ; pasetti et al. ; capozzo et al. ; fraillery et al. ) . similarly, for attenuation of lm, multiple virulence factors have been targeted. acta which encodes for a surface protein required for actin polymerization in host cells and helps in intracellular migration has been a prominent target for lm attenuation. together with the mutation in internalin b (inlb), the acta mutation renders lm unable to infect hepatocytes; thus these strains are highly attenuated . phospholipase-c b (plcb) is required for efficient escape from phagosomal vacuoles. plcb mutants are thus attenuated due to defect in escape from secondary vacuoles (peters et al. ; starks et al. ; stevens et al. ; johnson et al. ; jia et al. ; liang et al. ) . cell wall biosynthesis genes specifically dal (alanine racemase) and dat (d-amino acid aminotransferase) have been mutated in several attenuated lm vaccine vectors (friedman et al. ; verch et al. ; jiang et al. ; im et al. ) . the double mutant of lm requires d-alanine for cell wall biosynthesis and is highly attenuated. recently mclaughlin et al. demonstrated that deletion of lm fur-regulated virulence factor a (frva) results in attenuation in murine models of infection, due to the inability of iron homeostasis (mclaughlin et al. ) . attenuated strains of shigella are also being used as labv. noriega et al. (noriega et al. ) generated guaba mutant of shigella cvd , which is highly attenuated in animals and is widely used as labv. other approaches of mutations include sc , with deletions on icsa (mediate intra-and intercellular spread) and iuca (aerobactin); this strain is highly attenuated and immunogenic (ranallo et al. ). introduction of heterologous genes into bacterial vectors is facilitated by plasmids. plasmids are extrachromosomal circular dna, which are introduced into bacteria by a process called transformation. generally, bacteria maintain the plasmids utilizing antibiotic resistance mechanism. during in vitro growth, antibiotic selection pressure ensures stable plasmid maintenance; however, in the in vivo conditions, the lack of antibiotic selection pressure plasmid-less bacteria outgrows plasmid-bearing bacteria. moreover, the use of antibiotic markers are also discouraged, due to the risk of horizontal gene transfer to other microbes with pathogenic potential (lin et al. ; mignon et al. ) . novel antibiotic-free approaches of plasmid maintenance have been devised to mitigate these concerns. one such approach, known as the balanced lethal system, utilizes mutation in an essential gene in the bacterial chromosome, while the plasmid carries the functional copy of the same gene, thereby ensuring its maintenance by the bacteria (fig. . ). galen et al. generated a balanced lethal system for stm based on mutation in asd gene. asd encodes aspartate semialdehyde dehydrogenase, an enzyme required in the biosynthesis pathway of dap (diaminopimelic acid), which is an essential component of bacterial cell wall. dap is needed for growth and maintenance of asd mutants. a copy of asd gene is inserted into the plasmid; thus asd-deficient bacteria are forced to maintain the plasmid in order to survive in dap-deprived conditions, such as in the mammalian tissues. the resultant salmonella typhimurium (stm)-based balanced lethal system exhibits high degree of plasmid stability. this system also exhibits stable expression of the associated heterologous genes (galán et al. ). balanced lethal system has been most widely used in various labvs including st (tacket et al. ) , stm (kang et al. ) , and s. flexneri (zheng et al. ) . similarly, thymidine auxotrophy has also been utilized in st (bumann et al. ) , stm (mignon et al. ) , and lactic acid bacteria (bermúdez-humarán et al. ) for balanced lethal system approach of plasmid maintenance. glutamine auxotroph v. cholerae complemented with glna gene is another example of the balanced lethal system utilized for antibiotic-free plasmid maintenance (ryan et al. ). various mucosal pathogens and nonpathogenic food grade microbes have been extensively utilized for labv development. salmonella infect via orogastric route and enter the intestinal lamina propria by transcytosis via m cells, which are present in the mucosal inductive sites (peyer's patches). in the lamina propria, salmonella is taken up by various phagocytes including neutrophils, macrophages, and dendritic cells. the infected phagocytes then carry salmonella to various organs including the liver and spleen via blood or to the mesenteric lymph nodes via lymph. the virulence factors, clustered in salmonella pathogenicity islands (spi- and spi- ), facilitate invasion, survival, and proliferation in the intracellular spaces of macrophages (pham and mcsorley ) . salmonella possess a variety of pathogen-associated molecular patterns (pamps) including lipoprotein, lipopolysaccharide (lps), flagellin (flic), and cpg. these pamps are recognized by host pattern recognition receptors (prrs) including tlr ( / ) (lipoproteins), tlr (lps), tlr (flic), or tlr (cpg). activation of these prrs leads to the expression and secretion of cytokines such as tnfα, il β, il , il , il , il- , and il- (broz et al. ). these pro-inflammatory factors recruit neutrophils, macrophages, and dendritic cells. on the other hand, upon interaction with salmonella lps and flagellin, dendritic cells increase the expression of ccr , cd , cd , and cd . these mature dendritic cells with enhanced capability to process and present antigens can migrate to t-cell areas and initiate adaptive immune responses to cognate antigens. studies suggest that salmonella induces humoral as well as cd + -, cd + -, and th -dependent cellmediated immune responses (pham and mcsorley (angelakopoulos and hohmann ) , l. monocytogenes (igwe et al. ) , pseudomonas aeruginosa (bumann et al. ) , streptococcus pneumoniae , and yersinia pestis . while antigen-specific th responses are generated against some parasitic pathogens including leishmania mexicana (gonzález et al. ) , schistosoma japonicum (chen et al. ) , and taenia solium (ding et al. ) , mucosal igg and iga are generated against giardia lamblia (abdul-wahid and faubert ) and cryptosporidium parvum (benitez et al. ) by st-and stm-based labvs carrying related antigens. besides salmonella, listeria is the most extensively studied bacteria as labv. similar to salmonella, listeria infection begins with orogastric infection. lm moves across gastrointestinal epithelial barrier by first attaching to and invading epithelial cells. adhesion and internalization require lm protein ami and internalin a (inla), respectively. once in the lamina propria lm rapidly spreads systemically. lm primarily targets liver with the help of fibronectin binding protein (fbpa). fbpa recognizes fibronectin on the surface of hepatocytes, and at this point another molecule, called internalin (inlb), facilitates lm internalization. on the other hand, phagocytes specifically macrophages and monocytes recognize lipoteichoic acid via scavenger receptors. after the phagocytosis lm escapes phagocytic vesicles by synergistic activities of listeriolysin o (llo) and two phospholipase c (plca and plcb). another virulence factor is acta, which has actin polymerization activity and helps lm migrate from cell to cell (liang et al. ) . lm expresses various tlr agonists including peptidoglycan, flagellin, and bacterial dna, which induces pro-inflammatory cytokines including tnfα, ifnγ, il β, and il . lm-induced cell death results in secretion of il , which helps in recruitment of neutrophils. il helps in induction of ifnγ by nk cells and cd + t cells. lm can also induce type-i ifns (ifnαand ifnβ), which is desirable as antiviral immunity. evidences suggest that lm induces both cd + and cd + t-cell-mediated immune response (zenewicz and shen ; liang et al. ) . lm-carrying viral antigens such as hiv/siv-gag (frankel et al. ; friedman et al. ; im et al. ) , hpv-e (jia et al. ) , and lcmv-np - (tvinnereim et al. ) induces ctl immune response. lm-based labv also induces neutralizing antibody against hiv-gp . however, there are limited reports on lm as labv against bacterial and parasitic pathogens. in one study, lm-carrying coxiella burnetii antigen t ss (epitopes) induced cd + t-cell immune response (xiong et al. ) . in another study lm-carrying francisella tularensis antigen iglc induced ifnγ producing cd + and cd + t-cell-mediated immune response. bcg, an attenuated m. bovis, has also exhibited potential as labv. following immunization, bcg interacts with phagocytes such as macrophage, dendritic cells, and neutrophils. various prrs of macrophages involved in interaction with bcg include cr , tlr ( / ) and tlr- . however, dendritic cells utilize a different set of phagocytic receptors including cr , cr , dc-sign (cd ), and dec . infected dendritic cells upregulate expression of mhc-ii and costimulatory markers cd , cd , cd , and cd which are involved in activation of adaptive immune response (moliva et al. ) . bcg is known to induce humoral as well as t-cell-mediated immune response (abomoelak et al. ) . the t-cell responses induced by bcg include polyfunctional cd + t cells that secret tnf, il- , and ifnγ (moliva et al. ) . bcg expressing il and two m. tuberculosis (mtb) antigens (secreting antigen ag b and culture filtrate antigen cfp ) induce antigen-specific th -type immune response including ifnγ-producing cells and igg a (chen et al. ) . antigen-specific humoral immune response is induced by bcg expressing a hepatitis-b surface antigen (rezende et al. ) . bcg-induced cd + t cells also secrete ifnγ (moliva et al. ) . in a mouse model, bcg carrying mtb antigen (ag b) exhibit antigen-specific th immune response (hatano et al. ) . pertussis toxin subunit s expressed by bcg induces ifnγ producing cd + t cells which completely protects against lethal bordetella pertussis challenge (nascimento et al. ) . furthermore, in a mouse model of an intracellular pathogen lm, bcg expressing lm antigen p induced cd + and cd + t-celldependent protection (grode et al. ) . studies have demonstrated that bcg induces long-lived mycobacteria-specific memory b cells. moreover, following bcg immunization, hosts secrete robust mtb-specific serum antibodies including igg isotypes igg , igg , and igg . however, it is not known if specific mucosal iga is induced by bcg (moliva et al. ) . s. flexneri infection occurs through orogastric route. once in the colon, s. flexneri crosses epithelial layer through highly endocytic m cells. s. flexneri then adhere to and infect colonic epithelium through the basolateral surface. colonic epithelial cells engulf s. flexneri by macropinocytosis, and through the activity of ipab and ipac, they are released from macropinocytic vacuoles to the cytosol (mellouk and enninga ) . s. flexneri invasion causes activation of innate immune system and release of a variety of cytokines including il- , tnf-α, il , tgf-β, and il- (fernandez and sansonetti ; jennison and verma ) . though shigella has the capacity of cell-to-cell translocation, its infection is limited to lamina propria of the intestine, and it doesn't migrate to other organs (maurelli and sansonetti ) . in the lamina propria s. flexneri is phagocytosed by macrophages and dendritic cells. infected macrophages undergo apoptosis, which leads to the release of proinflammatory cytokine il , il , and ifnγ (fernandez and sansonetti ) . s flexneri induces both systemic and mucosal antibody response including igm, igg, and secretory iga (jennison and verma ) . s. flexneri a with guaba mutation (cvd ) has limited invasiveness, and proliferative capacity. attenuated s. flexneri expressing etec antigens cfa-i, ltb, cs , cs , and cs induce antigenspecific serum igg and mucosal iga (koprowski et al. ; barry et al. ; strain et al. ; ranallo et al. ; zheng et al. ) . food grade bacteria including b. subtilis and lactobacillus lactis are considered important candidates for labv, due to their superior safety profile. upon oral administration, b. subtilis spores can safely transit through the stomach, germinate, and proliferate in the upper intestine and finally undergo re-sporulation in the colon (cutting et al. ). nevertheless, the mechanism of immune response in response to b. subtilis delivered antigens is not fully understood. antigens delivered by b. subtilis have been shown to induce humoral as well as th -mediated immune response (cutting et al. ). b. subtilis has been used as labv for various bacterial and parasitic pathogens including pathogenic e. coli, h. pylori, mtb, clonorchis sinensis, and s. japonicum. b. subtilis induces systemic igg (amuguni and tzipori ; zhou et al. ) , mucosal iga (amuguni and tzipori ; zhou et al. ) , and th /th (sibley et al. ; stasilojc et al. ) immune response against cognate antigens. the lactic acid bacteria are among the microbes, which occur physiologically in animal digestive tracts and like other natural microflora through their metabolites and interaction with macrophages can stimulate cytokine production. peptidoglycan of the lactic acid bacteria induces secretion of il , il , and tnf, by monocytes (bermúdez-humarán et al. ; szatraj et al. ) . unlike attenuated strains of otherwise pathogenic microbes used as labv, b. subtilis and l. lactis do not invade through the gut mucosa and serve mainly as protein (antigen) factories, which supply vaccine antigens to gut-associated lymphoid tissue (galt). protective antigens of pathogenic viruses h n (ha) and h n (ha) expressed by l. lactis induce mucosal antibodies. l. lactis expressing bacterial antigens campylobacter jejuni (cjad) (kobierecka et al. ) , clostridium difficile (tcda) (yang et al. ) , clostridium perfringens (epsilon toxoid) (alimolaei et al. ) , h. pylori (omp , hpaa, cag , and ureaseb) (kim et al. ; gu et al. ; zhang et al. b) , and v. cholerae (wzm) (zamri et al. ) also induce mucosal antibodies. in preclinical models, dna vaccines have proven to confer protective immunity against a variety of infectious agents including hiv, herpes simplex virus (hsv), plasmodium spp., and mtb (schoen et al. ). an attractive feature of dna vaccine is that it can induce humoral as well as cell-mediated immune response. while antibodies alone can protect against many pathogens and toxins, cell-mediated immunity is required for protection against intracellular pathogens and cancer. the dna vaccines in the form of eukaryotic expression plasmids are delivered either by intramuscular injection of naked dna, intradermal bombardment using dna coated on gold particles with help of a gene gun, or electroporation following needle injection. however, most of these methods induce only moderate levels of protection in animal models and fail to show efficacy in clinical trials (schoen et al. ). in recent years many bacterial vectors have been utilized to deliver plasmids into the host cells (schoen et al. ). as many attenuated strains are being developed for delivery of vaccine antigens, similar strains can also be utilized to deliver plasmids as dna vaccines. attenuated strains of gut pathogens including st, stm, or l. monocytogenes are of particular importance, as they colonize and infect mucosal epithelial cells. as discussed above, listeria infection begins at gastrointestinal tract, and after invasion through intestinal mucosa, listeria migrate through blood vessels and lymph to other organs. listeria can infect a wide array of cell types including intestinal epithelial cells, hepatocytes, dendritic cells, and macrophages. listeria escape phagocytic vesicles and multiply in cytosol where they release the plasmids. listeriolysin o helps listeria lyse and escapes the phagosomal vacuoles (liang et al. ). miki et al. engineered a self-destructing lm-based vaccine delivering a eukaryotic expression plasmid encoding mtb antigens ag a/ag b and mpb/ mpt . the vaccine induced protective immune response against mtb in a mouse model (miki et al. ) . salmonella also infects via gastrointestinal tract, and after crossing epithelial barrier through m cells, salmonella is taken up by macrophages (pham and mcsorley ) . salmonella has the capability of surviving and replicating in phagocytic vacuoles (pham and mcsorley ) . however, through unknown mechanisms, they can release plasmid dna into the cytosol (schoen et al. ) . salmonella strains expressing listeriolysin o have been shown to escape the phagosome vesicles to the cytosol, thus making gene transfer by salmonella more efficient (schoen et al. ). hiv- t-cell epitopes in the form of eukaryotic expression plasmid delivered by attenuated stm induced ctl as well as antibody immune response (karpenko et al. ) . another study targeting an s. pneumoniae protective antigen psaa and pspa delivered by stm induced mucosal iga against both antigens. thus immunized mice were protected against nasopharyngeal colonization by s. pneumoniae (zhang et al. ) . pathogenic parasites trichinella spiralis and trypanosoma cruzi have also been targeted for stm-mediated dna vaccination. yang et al. constructed a dna vaccine against t. spiralis using antigen ts and stm as the delivery vehicle. mice immunized orally with this vaccine induced antigen-specific mucosal iga which correlated with protection against t. spiralis larval challenge. salmonella-delivered t. spiralis dna vaccine induced a th -/ th -type immunity and il , il , and il cytokines (yang et al. ) . in another study, matos et al. using stm delivered t. cruzi antigens (tc- ) into mice via the oral route. immunized mice elicited specific antibodies with higher igg a/igg ratio, suggesting a th bias. the vaccinated group also induced strong cell-mediated immunity and mucosal iga (matos et al. ). most bacteria used as dna delivery vehicles were designed to disintegrate after infecting host cells. if the bacterial dna vaccine vectors are destroyed in the phagolysosomes, before reaching the cell cytoplasm, it will lead to inefficient delivery of the plasmid. to circumvent this problem various approaches have been devised. one such approach takes advantage of phage lysin to disintegrate ∆aroa-lm after reaching host cell cytosol. the inclusion of phage lysin significantly improved bactofection (bacteria-mediated delivery of plasmid dna into mammalian cells) efficiency in phagocytic as well as non-phagocytic cells (pilgrim et al. ) . recently, kong et al. developed a universal dna vaccine delivery platform, which includes several modalities for enhanced delivery and immune response to cognate antigens. the attenuated stm includes the capability to escape the phagosomal compartment to the cytosol of the host cells, before phagolysosomal degradation (kong et al. ) . sifa proteins direct salmonella-induced filament formation when salmonella is contained in the endosomal vacuoles, and the deletion of sifa gene results in the release of salmonella into the cytosol. hence, mutation of sifa gene in salmonella plasmid carriers allowed successful transfer of plasmid dna into the cytosol of the host cells (kong et al. ) . kong et al. also incorporated elements that guide the plasmid into the nucleus. transcription factors such as nf-κb and ap bind to plasmids carrying nf-κb and ap binding sequences and transport them to the nucleus where the desired antigens are transcribed (kong et al. ) . salmonella induces apoptosis/pyroptosis in infected cells that diminishes the overall transfection efficiency. deletion of tlpa and ssel genes significantly reduces apoptosis in host cells (kong et al. ) . moreover, salmonella degradation is delayed due to the regulated expression of the salmonella lysis program. this allows a limited number of replication and invasiveness, thereby ensuring optimal delivery of plasmids. an influenza antigen (ha) delivered by this platform induced enhanced ha-specific igg, which correlated with protection against influenza virus challenge (kong et al. ). a nineteenth-century physician, william b. coley, for the first time observed regression of malignant tumor in one of his patients after a bacterial infection. coley went on to develop the first bacterial therapy against cancer using killed gram-positive bacteria streptococci and a gram-negative bacteria serratia marcescens. this mixture called "coley's toxins" when injected into patients suffering from various forms of cancer resulted in partial to complete regression. in cases of soft tissue sarcoma, long-term disease-free survival was achieved in approximately % of the patients. nevertheless, despite the remarkable success of "coley's toxins," with the advent of chemotherapy and radiotherapy, this line of investigation was prematurely abandoned (bickels et al. ) . however, in recent years this approach is regaining attention. in fact, bcg is currently being used as immunotherapy for bladder cancer and exhibits superiority over epirubicin and ifnα b, mitomycin, and epirubicin alone (fuge et al. ) . since the first report of bcg's use in cancer treatment in , preclinical and clinical investigations of bcg have also been reported for other forms of cancer. mice preimmunized with bcg exhibited slower tumor growth compared to control (zheng et al. (zheng et al. ) . bacteria, specifically anaerobes, exhibit natural tropism toward solid tumors. this phenomenon, although poorly understood, is theorized that certain characteristics of tumor microenvironment facilitate this phenomenon. the deeper pockets of tumors, which are devoid of new blood vessels, are poorly oxygenated and show limited accessibility to chemotherapeutic drugs (lee ; lin et al. ) . forbes et al. demonstrated that stm accumulate at a rate of -fold more compared to other organs including the liver, spleen, lung, heart, and skin (forbes et al. ) . using an in vitro model, kasinkas and forbes demonstrated that stm exhibits chemotaxis. depending on the availability of specific receptors (tsr, tar, and trg), stm were differentially attracted to corresponding chemoattractants expressed in the tumor microenvironment (serine, aspartate, and ribose/glucose), while the wildtype strains accumulate around necrotic zones inside tumors (kasinskas and forbes ) . moreover, various immunosuppressive mechanisms manifested by the tumor microenvironment also support the proliferation of microbes (lin et al. ) . distinct tumor-homing property of microbes, including lm and salmonella, has been harnessed to deliver various tumor therapeutic modalities, including therapeutic vaccine antigens, dna vaccines, and anticancer drugs. various tumor-associated antigens (taas) have been targeted for therapeutic vaccines using labv as delivery vehicles. psa (prostate-specific antigen) is secreted by prostate epithelial cells and is overexpressed in malignant prostate cells. attenuated lm expressing psa (lm-llo-psa) antigen was tested as therapeutic vaccine in mouse tumor models expressing human psa. immunization with lm-llo-psa completely regressed tumors in five out of eight mice and induced psa-specific cellular immune response. immunization of lm-llo-psa significantly increased infiltration of psa-specific cd + t cells in tumors and decrease in cd /cd /foxp + t reg cells (wallecha et al. ). her /neu is overexpressed in about - % of breast cancers and is a potential target for immunotherapy. shahabi et al. engineered an lm-based vaccine incorporating her /neu as antigen (adxs - ). adxs - elicited her specific cd + t cells. the vaccine caused a significant delay in the formation of mammary tumors, and % of mice were tumor-free till weeks of the experiment, whereas all sham-treated mice developed tumors and succumbed to the disease. this vaccine also resulted in significant increase in tumor-infiltrating cd + t cells and a decrease in the intratumoral foxp + t reg cells (shahabi et al. ) . p. aeruginosa can also deliver heterologous antigens using its type iii secretion system. in an experimental model of b-cell melanoma expressing ovalbumin (ova), chauchet et al. demonstrated antitumor efficacy of p. aeruginosa-based vaccine expressing ova. p. aeruginosa induced a long-lasting and polyfunctional cd + t-cell immune response against the cognate antigen, wherein antigen-specific cd + t cells expressed ifnγ, tnfα, and il simultaneously. these cd + t cells also showed enhanced tumor infiltration property and a greater ratio between effector versus regulatory t cells (chauchet et al. ) . recently mei et al. utilized a composite approach of dna vaccine and bacterial surface expression to achieve cd + and cd + t-cell-mediated immunity targeted to a tumor-associated antigen. the salmonella-based vaccine included aida-i autotransporter-melan a (a murine melanoma antigen) fusion protein and a dna vaccine element encoding two murine melanoma epitopes (mei et al. ). high levels of antigen synthesis by multicopy plasmids exert metabolic burden to labv, which results in hyperattenuation, low colonization, loss of viability, and most importantly poor immunogenicity. various strategies have been adapted to circumvent this problem including the use of low-copy plasmid, use of in vivo inducible promoters (ivip), and use of arabinose-inducible promoters (loessner et al. ). among the first promoters introduced in labv is p nir b, which is activated under anaerobic conditions. p pag c and p ssa g are macrophage-inducible promoters from salmonella. dunstan directly compared the immunogenicity of antigens upon expression of antigens regulated by p nir b and p pag c and found significantly higher antibody response with p pag c compared to p nir b (dunstan et al. ). arnold et al. achieved differential antigen expression in vivo using in vivo inducible promoters p pag c, comprising variable ribosomal binding site (rbs). by this approach, strains with a high level of expression of heterologous protein exhibited low level of colonization, while a moderate amount of expression resulted in a significantly improved infection rate in mesenteric lymph nodes. a very low level of in vivo inducible antigen expression resulted in unhampered infectivity compared to the parent strain. immunogenicity was dependent on the rate of infection, as well as the level of antigen expression. notably, the best immune response was achieved with moderate level of antigen expression and infectivity, while high antigenexpressing strain resulted in little to no immune response. on the other hand, a moderate level of immune response was generated with high infectivity and low antigen expression (arnold et al. ). wang et al. developed a regulated delayed antigen synthesis system, consisting of laci repressor to repress transcription from p trc during in vitro cultivation. the arabinose-regulated promoter p bad drives laci expression in vitro in medium supplemented with arabinose. upon immunization and lack of external arabinose supplementation, p trc is derepressed, leading to the synthesis of antigens. the regulated delayed antigen synthesis system induced equivalent levels of antibody and protection to that of p pag c-controlled antigen synthesis and better than that of p ssa g-controlled antigen synthesis ). upon oral immunization, labv must withstand acidic environment of the stomach for successful colonization. enteric pathogens including e. coli, l. monocytogenes, shigella spp., and l. lactis can tolerate extreme acidic ph (below ph . ) because they possess the most potent acid resistance (ar) system known as gdar (glutamatedependent acid resistance) pathway. attenuated strains of st and stm have limited acid tolerance and exhibit moderate immunogenicity (dharmasena et al. a lps plays important role in survival and infectivity of bacteria. however, it is also involved in toxicity to the host. various attempts at the use of lps o-antigen mutants of stm resulted in poor attachment and intestinal invasion and survival following oral immunization. by regulated expression of lps o-antigen components such that they are expressed in vitro and at the time of immunization, but soon after colonization their synthesis is stopped, it is expected to achieve maximal infectivity and minimal toxicity . kong et al. engineered a salmonella strain where lps o-antigen synthesis genes rfc and rfah are kept under the control of the promoter arac-p bad , which is tightly regulated by arabinose. this strain is highly attenuated nevertheless exhibits superior immunogenicity (kong et al. . another approach of detoxification of salmonella lps included removal of -phosphate group from lipid a of lps. kong et al. introduced many methods employed for attenuation, although make the labv strains less pathogenic and safe to administer at high doses, it often renders them poorly immunogenic due to their inability to circumvent physicochemical defense of the host. moreover, inability of penetration through mucosal barrier also makes them poorly immunogenic. to circumvent this problem, curtiss et al. generated a regulated delayed attenuation system (rdas), which retains full virulence till the passage through gastrointestinal tract and infection of epithelial cells. in the modified rdas strains, salmonella virulence genes fur, phop/q, rpos, and crp are expressed under the control of arac-p bad promoter. arabinose concentration in human tissues is very less. thus, in vitro these strains express all the virulence genes in medium supplemented with arabinose, whereas in vivo under the arabinose deprivation, many virulence genes are suppressed, resulting in attenuation of salmonella. this approach results in high immunogenicity combined with tolerance at high doses (curtiss rd et al. ). in order to evoke cd + t-cell (ctl) response, antigens need to be delivered into the cytoplasm of host cell. various approaches are in use to accomplish the cytosolic delivery of antigens including the use of a type iii secretion system that can directly deliver vaccine antigens into the host cell cytoplasm and use of a-hemolysin (hlya) secretion system of e. coli which is fully active in salmonella (gentschev et al. ) . on the other hand, escape from endocytic vacuoles is also a feasible approach. unlike lm, st and stm do not reach cytoplasm of infected cells and elicit cd + t-cell response more effectively compared to cd + t-cell response to cognate antigens. chen et al. used secretion signal of a type iii secretion system salmonella outer protein e (sope) and hlya (secretion signal) to deliver s. japonicum antigen sj -lhd-gst. the salmonella vaccine constructs carrying sj lhd-gst fused to hlya (secretion signal) or sope effectively expressed and delivered antigens into cytoplasm of murine macrophages in vitro. this vaccine construct induced sj -lhd-gst-specific th type response and protected against s. japonicum infection (chen et al. ). gentschev et al. reported that two listerial antigens delivered by stm using hlya (secretion signal) generated protection against listeria infection (gentschev et al. ) . simultaneous delivery of two listerial antigens (llo and p ) by stm using yersinia outer protein e (yope) as a carrier molecule for salmonella type iii secretion system developed llo-and p -specific t cells and protection against murine listeriosis (igwe et al. ) . sope-mediated delivery of listerial antigen p generated cd + t-cell-mediated protection against listeria infection (berchtold et al. ). what makes bacteria an excellent vaccine delivery vehicle is their natural ability to induce potent and long-lasting immune response. labvs possess the capacity to induce humoral as well as cell-mediated immune response. while the humoral immune response includes serum igg and mucosal igg and iga, the cell-mediated immunity is characterized by th -, th -, and th -type cd + t cells and cd + ctls. iga and il have been specifically implicated in mucosal protection against various mucosal pathogens. the cell-mediated immunity is required for intracellular pathogens. it should be noted that subunit vaccines have a poor capacity to evoke mucosal as well as cell-mediated immunity. labvs have also shown the capacity to overcome immunosuppressive nature of various forms of tumors. these characteristic of labvs, together with their tumor-tropic capacity, makes them a highly suitable vector for cancer immunotherapeutic vaccines. in the past two decades, tremendous progress has been made regarding labv-mediated delivery of vaccine antigens for prevention of a variety of viral, bacterial, and parasitic diseases. recent advances have further improved the safety and immunogenicity profile of several labv platforms. the new-generation labvs can withstand harsh physicochemical conditions of gastrointestinal tract, exhibit regulated attenuation, regulated antigen expression, and targeted antigen delivery. labvs have exhibited effectiveness in various preclinical and preliminary clinical trials (table . ). however, a limited number of clinical trials have been conducted to date using labvs, due to potential safety concerns. further optimization would result in a versatile, safe, and highly immunogenic vaccine delivery platforms. ding et al. ( ) mucosal delivery of a transmission-blocking dna vaccine encoding giardia lamblia cwp by salmonella typhimurium bactofection vehicle a listeria monocytogenes-based vaccine that secretes sand fly salivary protein ljm confers longterm protection against vector-transmitted leishmania major humoral and cellular immune responses in mice immunized with recombinant mycobacterium bovis bacillus calmette-guérin producing a pertussis toxin-tetanus toxin hybrid protein oral immunization of mice against clostridium perfringens epsilon toxin with a lactobacillus casei vector vaccine expressing epsilon toxoid kinetics of the mucosal antibody secreting cell response and evidence of specific lymphocyte migration to the lung after oral immunisation with attenuated s. enterica var. typhimurium expression of fibronectin binding protein a (fnbpa) from staphylococcus aureus at the cell surface of lactococcus lactis improves its immunomodulatory properties when used as protein delivery vector bacillus subtilis: a temperature resistant and needle free delivery system of immunogens sublingually administered bacillus subtilis cells expressing tetanus toxin c fragment induce protective systemic and mucosal antibodies against tetanus toxin in mice pilot study of phop/phoq-deleted salmonella enterica serovar typhimurium expressing helicobacter pylori urease in adult volunteers enhanced immunogenicity in the murine airway mucosa with an attenuated salmonella live vaccine expressing oprf-opri from pseudomonas aeruginosa protective cellular responses elicited by vaccination with influenza nucleoprotein delivered by a live recombinant attenuated salmonella vaccine lactococcus lactis-expressing listeriolysin o (llo) provides protection and specific cd (+) t cells against listeria monocytogenes in the murine infection model construction of attenuated salmonella typhimurium strain expressing helicobacter pylori conservative region of adhesin antigen and its immunogenicity immune responses elicited against multiple enterotoxigenic escherichia coli fimbriae and mutant lt expressed in attenuated shigella vaccine strains oral immunization with attenuated salmonella enterica serovar typhimurium encoding cryptosporidium parvum cp and cp antigens induces a specific immune response in mice superior protective immunity against murine listeriosis by combined vaccination with cpg dna and recombinant salmonella enterica serovar typhimurium lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and dna vaccines coley's toxin: historical perspective a clinically relevant, syngeneic model of spontaneous, highly metastatic b mouse melanoma evaluation of psn, hmur and a modified lcrv protein delivered to mice by live attenuated salmonella as a vaccine against bubonic and pneumonic yersinia pestis challenge listeriabased cancer vaccines that segregate immunogenicity from toxicity innate immune response to salmonella typhimurium, a model enteric pathogen systemic, nasal and oral live vaccines against pseudomonas aeruginosa: a clinical trial of immunogenicity in lower airways of human volunteers attenuated escherichia coli strains expressing the colonization factor antigen i (cfa/i) and a detoxified heat-labile enterotoxin (lthk ) enhance clearance of etec from the lungs of mice and protect mice from intestinal etec colonization and lt-induced f mucosally delivered salmonella live vector vaccines elicit potent immune responses against a foreign antigen in neonatal mice born to naive and immune mothers.pdf poly-functional and long-lasting anticancer immune response elicited by a safe attenuated pseudomonas aeruginosa vector for antigens delivery construction, characterization, and immunogenicity of an attenuated salmonella enterica serovar typhimurium pgte vaccine expressing fimbriae with integrated viral epitopes from the spic promoter comparison of a fimbrial versus an autotransporter display system for viral epitopes on an attenuated salmonella vaccine vector a recombinant live attenuated strain of vibrio cholerae induces immunity against tetanus toxin and bordetella pertussis tracheal colonization factor oral delivery of the sj lhd-gst antigen by salmonella typhimurium type iii secretion system protects against schistosoma japonicum infection in mice recombinant bacille calmette???guerin coexpressing ag b, cfp , and interleukin- elicits effective protection against mycobacterium tuberculosis recombinant salmonella bacteria vectoring hiv/aids vaccines salmonella enterica serovar typhimurium strains with regulated delayed attenuation in vivo oral vaccine delivery by recombinant spore probiotics construction and characterisation of salmonella typhimurium aroa simultaneously expressing the five pertussis toxin subunits stable expression of shigella sonnei form i o-polysaccharide genes recombineered into the chromosome of live salmonella oral vaccine vector ty a development of an acid-resistant salmonella typhi ty a attenuated vector for improved oral vaccine delivery stable expression of shigella dysenteriae serotype o-antigen genes integrated into the chromosome of live salmonella oral vaccine vector ty a oral vaccination of balb/c mice with salmonella enterica serovar typhimurium expressing pseudomonas aeruginosa o antigen promotes increased survival in an acute fatal pneumonia model immune responses to a recombinant attenuated salmonella typhimurium strain expressing a taenia solium oncosphere antigen tsol use of in vivo-regulated promoters to deliver antigens from attenuated salmonella enterica var. typhimurium shigella interaction with intestinal epithelial cells determines the innate immune response in shigellosis oral immunization with attenuated salmonella vaccine expressing escherichia coli o : h intimin gamma triggers both systemic and mucosal humoral immunity in mice sparse initial entrapment of systemically injected salmonella typhimurium leads to heterogeneous accumulation within tumors salmonella enterica serovar tphi ty a expressing human papillomavirus type l as a potential live vaccine against cervical cancer and typhoid fever induction of cell-mediated immune responses to human immunodeficiency virus type gag protein by using listeria monocytogenes as a live vaccine vector a phase i, dose-escalation trial in adults of three recombinant attenuated salmonella typhi vaccine vectors producing streptococcus pneumoniae surface protein antigen pspa induction of human immunodeficiency virus (hiv)-specific cd t-cell responses by listeria monocytogenes and a hyperattenuated listeria strain engineered to express hiv antigens cloning and characterization of the asd gene of salmonella typhimurium: use in stable maintenance of recombinant plasmids in salmonella vaccine strains optimization of plasmid maintenance in the attenuated live vector vaccine strain salmonella typhi cvd -htra adaptation of the endogenous salmonella enterica serovar typhi clya-encoded hemolysin for antigen export enhances the immunogenicity of anthrax protective antigen domain expressed by the attenuated live-vector vaccine strain cvd -htra salmonella enterica serovar typhi live vector vaccines finally come of age a new generation of stable, nonantibiotic, low-copy-number plasmids improves immune responses to foreign antigens salmonella enterica serovar typhi live vectors a bivalent typhoid live vector vaccine expressing both chromosome-and plasmid-encoded yersinia pestis antigens fully protects against murine lethal pulmonary plague infection development of antigen-delivery systems, based on the escherichia coli hemolysin secretion pathway simultaneous expression of cfa/i and cs colonization factor antigens of enterotoxigenic escherichia coli by Δaroc, Δarod salmonella typhi vaccine strain cvd immunogenicity of a salmonella typhi cvd candidate vaccine strain expressing the major surface protein gp of leishmania mexicana mexicana a combination of recombinant bcg expressing pneumococcal proteins induces cellular and humoral immune responses and protects against pneumococcal colonization and sepsis. clin vaccine immunol cvi cell-mediated immunity induced by recombinant mycobacterium bovis bacille calmette-guérin strains against an intracellular bacterial pathogen: importance of antigen secretion or membrane-targeted antigen display as lipoprotein for vaccine efficacy oral vaccination of mice against helicobacter pylori with recombinant lactococcus lactis expressing urease subunit b an influenza ha and m e based vaccine delivered by a novel attenuated salmonella mutant protects mice against homologous h n infection stable expression of lentiviral antigens by quality-controlled recombinant mycobacterium bovis bcg vectors recombinant mycobacterium bovis bacillus calmette-guérin expressing ag b-il- fusion protein enhances il- a-producing innate γδ t cells characterization of salmonella enterica derivatives harboring defined aroc and salmonella pathogenicity island type iii secretion system (ssav) mutations by immunization of healthy volunteers aromatic-dependent salmonella typhimurium are non-virulent and effective as live vaccines concomitant cytosolic delivery of two immunodominant listerial antigens by salmonella enterica serovar typhimurium confers superior protection against murine listeriosis an attenuated listeria monocytogenes vector primes more potent simian immunodeficiency virusspecific mucosal immunity than dna vaccines in mice expression of a porphyromonas gingivalis hemagglutinin on the surface of a salmonella vaccine vector -giardin based live heterologous vaccine protects against giardia lamblia infection in a murine model shigella flexneri infection: pathogenesis and vaccine development prophylactic and therapeutic efficacy of an attenuated listeria monocytogenes-based vaccine delivering hpv e in a mouse model live attenuated listeria monocytogenes expressing hiv gag: immunogenicity in rhesus monkeys oral vaccine of lactococcus lactis harbouring pandemic h n haemagglutinin and nisp anchor fusion protein elevates anti-ha siga levels in mice attenuated listeria monocytogenes vaccine vectors expressing influenza a nucleoprotein: preclinical evaluation and oral inoculation of volunteers immune responses to recombinant pneumococcal pspa antigen delivered by live attenuated salmonella enterica serovar typhimurium vaccine comparative analysis using a mouse model of the immunogenicity of artificial vlp and attenuated salmonella strain carrying a dna-vaccine encoding hiv- polyepitope ctl-immunogen salmonella typhimurium lacking ribose chemoreceptors localize in tumor quiescence and induce apoptosis salmonella typhi and s. typhimurium derivatives harbouring deletions in aromatic biosynthesis and salmonella pathogenicity island- (spi- ) genes as vaccines and vectors expression of helicobacter pylori cag gene in lactococcus lactis mg and its oral administration to induce systemic anti-cag immune response in mice oral administration of lactococcus lactis expressing helicobacter pylori cag -ct protein induces systemic anti-cag immune response in mice comparison between immunization routes of live attenuated salmonella typhimurium strains expressing bcsp , omp b, and sod of brucella abortus in murine model cell wall anchoring of the campylobacter antigens to lactococcus lactis regulated delayed expression of rfah in an attenuated salmonella enterica serovar typhimurium a vaccine enhances immunogenicity of outer membrane proteins and a heterologous antigen regulated delayed expression of rfc enhances the immunogenicity and protective efficacy of a heterologous antigen delivered by live attenuated salmonella enterica vaccines salmonella synthesizing -monophosphorylated lipopolysaccharide exhibits low endotoxic activity while retaining its immunogenicity turning self-destructing salmonella into a universal dna vaccine delivery platform attenuated shigella flexneri a vaccine strain cvd expressing colonization factor antigen i and mutant heat-labile enterotoxin of enterotoxigenic escherichia coli safety and immunogenicity of attenuated salmonella enterica serovar typhimurium delivering an hiv- gag antigen via the salmonella type iii secretion system autodisplay: development of an efficacious system for surface display of antigenic determinants in salmonella vaccine strains prime-boost vaccination with heterologous live vectors encoding siv gag and multimeric hiv- gp protein: efficacy against repeated mucosal r clade c shiv challenges brucella lipopolysaccharide reinforced salmonella delivering brucella immunogens protects mice against virulent challenge engineering bacteria toward tumor targeting for cancer treatment: current state and perspectives immunogenicity of self-adjuvanticity oral vaccine candidate based on use of bacillus subtilis spore displaying schistosoma japonicum kda gst protein oral immunization with recombinant lactococcus lactis delivering a multi-epitope antigen ctb-ue attenuates helicobacter pylori infection in mice live attenuated salmonella displaying hiv- e epitope on fimbriae: systemic and mucosal immune responses in balb/c mice by mucosal administration listeria monocytogenes: a promising vehicle for neonatal vaccination live-attenuated bacterial vectors: tools for vaccine and therapeutic agent delivery construction and characterization of recombinant attenuated salmonella typhimurium expressing the baba /urei fusion gene of helicobacter pylori remote control of tumour-targeted salmonella enterica serovar typhimurium by the use of l-arabinose as inducer of bacterial gene expression in vivo type ivb pilus operon promoter controlling expression of the severe acute respiratory syndrome-associated coronavirus nucleocapsid gene in salmonella enterica serovar typhi elicits full immune response by intranasal vaccination a fusogenic peptide expressed on the surface of salmonella enterica elicits ctl responses to a dengue virus epitope preclinical development of bcg.hiva auxo.int, harboring an integrative expression vector, for a hiv-tb pediatric vaccine. enhancement of stability and specific hiv- t-cell immunity protection in a gerbil model of amebiasis by oral immunization with salmonella expressing the galactose/n-acetyl d-galactosamine inhibitable lectin of entamoeba histolytica mucosal vaccine made from live, recombinant lactococcus lactis protects mice against pharyngeal infection with streptococcus pyogenes tc aminoterminal-domain dna carried by attenuated salmonella enterica serovar typhimurium induces protection against a trypanosoma cruzi lethal challenge genetic determinants of shigella pathogenicity a mutant in the listeria monocytogenes furregulated virulence locus (frva) induces cellular immunity and confers protection against listeriosis in mice combining dna vaccine and aida- in attenuated salmonella activates tumor-specific cd + and cd + t-cell responses cytosolic access of intracellular bacterial pathogens: the shigella paradigm antibiotic-free selection in biotherapeutics: now and forever induction of protective cellular immunity against mycobacterium tuberculosis by recombinant attenuated selfdestructing listeria monocytogenes strains harboring eukaryotic expression plasmids for antigen complex and mpb/mpt immune responses to bacillus calmette-guerin vaccination: why do they fail to protect against mycobacterium tuberculosis? front immunol neonatal immunization with a single dose of recombinant bcg expressing subunit s from pertussis toxin induces complete protection against bordetella pertussis intracerebral challenge construction of an unmarked recombinant bcg expressing a pertussis antigen by auxotrophic complementation: protection against bordetella pertussis challenge in neonates engineered deltaguab-a deltavirg shigella flexneri a strain cvd : construction, safety, immunogenicity, and potential efficacy as a mucosal vaccine novel use of anaerobically induced promoter, dmsa, for controlled expression of fragment c of tetanus toxin in live attenuated salmonella enterica serovar typhi strain cvd -htra attenuated deltaguaba salmonella typhi vaccine strain cvd as a live vector utilizing prokaryotic or eukaryotic expression systems to deliver foreign antigens and elicit immune responses a comparison of immunogenicity and in vivo distribution of salmonella enterica serovar typhi and typhimurium live vector vaccines delivered by mucosal routes in the murine model salmonella enterica serovar typhi live vector vaccines delivered intranasally elicit regional and systemic specific cd + major histocompatibility class i-restricted cytotoxic t lymphocytes immunology of gut mucosal vaccines effect of expression level on immune responses to recombinant oral salmonella enterica serovar typhimurium vaccines oral delivery of a novel attenuated salmonella vaccine expressing influenza a virus proteins protects mice against h n and h n viral infection tailoring host immune responses to listeria by manipulation of virulence genes -the interface between innate and acquired immunity protective host immune responses to salmonella infection bactofection of mammalian cells by listeria monocytogenes: improvement and mechanism of dna delivery mucosally delivered salmonella typhi expressing the yersinia pestis f antigen elicits mucosal and systemic immunity early in life and primes the neonatal immune system for a vigorous anamnestic response to parenteral f boost construction and characterization of bivalent shigella flexneri a vaccine strains sc (pcfai) and sc (pcfai/ ltb) that express antigens from enterotoxigenic escherichia coli bacterial virulence, proinflammatory cytokines and host immunity: how to choose the appropriate salmonella vaccine strain? systemic immunity and mucosal immunity are induced against human immunodeficiency virus gag protein in mice by a new hyperattenuated strain of listeria monocytogenes safety and immunogenicity in neonatal mice of a hyperattenuated listeria vaccine directed against human immunodeficiency virus humoral response and genetic stability of recombinant bcg expressing hepatitis b surface antigens comparison of abilities of salmonella enterica serovar typhimurium aroa arod and aroa htra mutants to act as live vectors intranasal vaccination in mice with an attenuated salmonella enterica serovar htr a expressing cp of cryptosporidium: impact of malnutrition with preservation of cytokine secretion salmonella enterica serovar typhimurium vaccine strains expressing a nontoxic shigalike toxin derivative induce partial protective immunity to the toxin expressed by enterohemorrhagic escherichia coli protective immunity against clostridium difficile toxin a induced by oral immunization with a live, attenuated vibrio cholerae vector strain in vivo expression and immunoadjuvancy of a mutant of heat-labile enterotoxin of escherichia coli in vaccine and vector strains of vibrio cholerae development of a ??glna balanced lethal plasmid system for expression of heterologous antigens by attenuated vaccine vector strains of vibrio cholerae enteral immunization with attenuated recombinant listeria monocytogenes as a live vaccine vector: organ-dependent dynamics of cd t lymphocytes reactive to a leishmania major tracer epitope bacteria as dna vaccine carriers for genetic immunization a live attenuated listeria monocytogenes vaccine vector expressing siv gag is safe and immunogenic in macaques and can be administered repeatedly heterologous prime-boost immunizations with different salmonella serovars for enhanced antigen-specific cd t-cell induction development of a live and highly attenuated listeria monocytogenes-based vaccine for the treatment of her /neuoverexpressing cancers in human live recombinant salmonella typhi vaccines constructed to investigate the role of rpos in eliciting immunity to a heterologous antigen recombinant bacillus subtilis spores expressing mpt evaluated as a vaccine against tuberculosis in the murine model construction and screening of attenuated ??phop/q salmonella typhimurium vectored plague vaccine candidates effect of intragastric and intraperitoneal immunisation with attenuated and wild-type lackexpressing listeria monocytogenes on control of murine leishmania major infection salmonella vaccines secreting measles virus epitopes induce protective immune responses against measles virus encephalitis listeria monocytogenes as a vaccine vector: virulence attenuation or existing antivector immunity does not diminish therapeutic efficacy recombinant bacillus subtilis spores elicit th /th -polarized immune response in a murine model of helicobacter pylori vaccination oral immunization with recombinant listeria monocytogenes controls virus load after vaginal challenge with feline immunodeficiency virus genetic characterization and immunogenicity of coli surface antigen from enterotoxigenic escherichia coli when it is expressed in a shigella live-vector strain characterization of a salmonella typhimurium aro vaccine strain expressing the p. antigen of bordetella pertussis evaluation of yadc protein delivered by live attenuated salmonella as a vaccine against plague lactic acid bacteria -promising vaccine vectors: possibilities, limitations, doubts comparison of the safety and immunogenicity of daroc darod and & cya acrp salmonella typhi strains in adult volunteers safety and immunogenicity in humans of an attenuated salmonella typhi vaccine vector strain expressing plasmid-encoded hepatitis b antigens stabilized by the asd-balanced lethal vector system phase clinical trial of attenuated salmonella enterica serovar typhi oral live vector vaccine cvd -htrain u.s. volunteers surface expression of helicobacter pylori hpaa adhesion antigen on vibrio cholerae, enhanced by co-expressed enterotoxigenic escherichia coli fimbrial antigens fine-tuning synthesis of yersinia pestis lcrv from runaway-like replication balanced-lethal plasmid in a salmonella enterica serovar typhimurium vaccine induces protection against a lethal y. pestis challenge in mice cd + -t-cell response to secreted and nonsecreted antigens delivered by recombinant listeria monocytogenes during secondary infection improving mycobacterium bovis bacillus calmette-guèrin as a vaccine delivery vector for viral antigens by incorporation of glycolipid activators of nkt cells listeria monocytogenes-based antibiotic resistance gene-free antigen delivery system applicable to other bacterial vectors and dna vaccines construction and characterization of an attenuated listeria monocytogenes strain for clinical use in cancer immunotherapy construction, genotypic and phenotypic characterization, and immunogenicity of attenuated Δ guaba salmonella enterica serovar typhi s an attenuated salmonella-vectored vaccine elicits protective immunity against mycobacterium tuberculosis salmonella vaccine vectors displaying delayed antigen synthesis in vivo to enhance immunogenicity comparison of a regulated delayed antigen synthesis system with in vivo-inducible promoters for antigen delivery by live attenuated salmonella vaccines new technologies in developing recombinant attenuated salmonella vaccine vectors oral immunization of chickens with avirulent salmonella vaccine strain carrying c. jejuni dz/ cjaa gene elicits specific humoral immune response associated with protection against challenge with wild-type campylobacter pspa family fusion proteins delivered by attenuated salmonella enterica serovar typhimurium extend and enhance protection against streptococcus pneumoniae identification of coxiella burnetii cd + t-cell epitopes and delivery by attenuated listeria monocytogenes as a vaccine vector in a c bl/ mouse model construction of a recombinant attenuated salmonella typhimurium dna vaccine carrying helicobacter pylori hpaa oral vaccination with ts dna vaccine delivered by attenuated salmonella typhimurium elicits a protective immune response against trichinella spiralis larval challenge the protective effect of recombinant lactococcus lactis oral vaccine on a clostridium difficile-infected animal model oral delivery of bacillus subtilis spore expressing enolase of clonorchis sinensis in rat model: induce systemic and local mucosal immune responses and has no side effect on liver function oral vaccination with lactococcus lactis expressing the vibrio cholerae wzm protein to enhance mucosal and systemic immunity innate and adaptive immune responses to listeria monocytogenes: a short overview enhanced protection against nasopharyngeal carriage of streptococcus pneumoniae elicited by oral multiantigen dna vaccines delivered in attenuated salmonella typhimurium construction of an oral vaccine for transmissible gastroenteritis virus based on the tgev n gene expressed in an attenuated salmonella typhimurium vector construction of a recombinant lactococcus lactis strain expressing a fusion protein of omp and hpaa from helicobacter pylori for oral vaccine development construction of a novel shigella live-vector strain co-expressing cs and ltb/stm of enterotoxigenic e.coli applications of bacillus calmette-guerin and recombinant bacillus calmette-guerin in vaccine development and tumor immunotherapy expression of helicobacter pylori urease b on the surface of bacillus subtilis spores delivery of heterologous protein antigens via hemolysin or autotransporter systems by an attenuated ler mutant of rabbit enteropathogenic escherichia coli key: cord- -xtsnlu f authors: drago-serrano, maria elisa; campos-rodríguez, rafael; carrero, julio césar; de la garza, mireya title: lactoferrin: balancing ups and downs of inflammation due to microbial infections date: - - journal: int j mol sci doi: . /ijms sha: doc_id: cord_uid: xtsnlu f lactoferrin (lf) is a glycoprotein of the primary innate immune-defense system of mammals present in milk and other mucosal secretions. this protein of the transferrin family has broad antimicrobial properties by depriving pathogens from iron, or disrupting their plasma membranes through its highly cationic charge. noteworthy, lf also exhibits immunomodulatory activities performing up- and down-regulation of innate and adaptive immune cells, contributing to the homeostasis in mucosal surfaces exposed to myriad of microbial agents, such as the gastrointestinal and respiratory tracts. although the inflammatory process is essential for the control of invasive infectious agents, the development of an exacerbated or chronic inflammation results in tissue damage with life-threatening consequences. in this review, we highlight recent findings in in vitro and in vivo models of the gut, lung, oral cavity, mammary gland, and liver infections that provide experimental evidence supporting the therapeutic role of human and bovine lf in promoting some parameters of inflammation and protecting against the deleterious effects of bacterial, viral, fungal and protozoan-associated inflammation. thus, this new knowledge of lf immunomodulation paves the way to more effective design of treatments that include native or synthetic lf derivatives, which may be useful to reduce immune-mediated tissue damage in infectious diseases. lactoferrin (lf) is a conserved iron-binding mammalian glycoprotein with antimicrobial activity, present in secretions that recover mucosal sites regarded as portals of entry and/or invasion of pathogenic agents [ ] . antimicrobial activity has been mostly characterized in lf of bovine and human origin isolated from milk [ , ] . mechanisms underlying the antimicrobial action of lf result from both direct (microbiostatic and/or microbicidal) and indirect (immunomodulatory) effects [ ] [ ] [ ] . at present, the therapeutic and prophylactic treatments for microbial infections that ameliorate both the antibiotic multiresistance and the inflammatory response have prompted the searching of agents that display both antimicrobial and modulatory properties such as lf. this review is focused on the modulatory impact of lf on the inflammatory response induced by infectious microorganisms, mainly in the lf was initially named lactotransferrin, due to being a milk glycoprotein that chelates iron. this protein belongs to the transferrin family, which includes the avian egg ovotransferrin (ovotf) and the mammalian serum and lymph transferrin (tf), but differs from other members of the family in its higher affinity for iron. lf is synthesized by the mammary gland and then it is abundant in colostrum and milk, through which it has been suggested to participate in the initial protection in newborns [ ] [ ] [ ] [ ] [ ] [ ] . regarding the content, human mature milk is highly enriched in lf ( . mg/ml) in comparison with bovine milk ( . mg/ml) [ ] [ ] [ ] . the amino acid sequences of both proteins exhibits approximately % identity [ , ] . lf is also present in many fluids and exocrine secretions, such as tears, saliva, and mucosal surfaces of the respiratory, urinary-reproductive and intestinal tracts; in these sites, lf contributes to the primary innate-immune defense system of mammals that exerts antimicrobial activity against an extensive variety of pathogens [ , , [ ] [ ] [ ] [ ] [ ] . lf is also synthesized during the natural cellular development of promyelocytes to myelocytes, and was early recognized as an important component of the secondary granules of polymorphonuclear (pmn) neutrophils [ , ] . these cells store lf ( - μg/ neutrophils) and release it at the sites of infection, which are acidic due to the activity of pathogens [ , , , ] . in plasma, lf derives from neutrophils and its concentration is very low ( . - μg/ml) [ ] ; nevertheless, in patients with sepsis the degranulation of activated neutrophils leads to secretion of significant levels of lf (~ . mg/ml) into the bloodstream [ ] . neutrophils also release lf in feces whose concentrations markedly increase during inflammatory processes such as inflammatory bowel disease (ibd), ulcerative colitis and crohn's disease, due to the response against pathogenic bacteria [ ] . lf was initially named lactotransferrin, due to being a milk glycoprotein that chelates iron. this protein belongs to the transferrin family, which includes the avian egg ovotransferrin (ovotf) and the mammalian serum and lymph transferrin (tf), but differs from other members of the family in its higher affinity for iron. lf is synthesized by the mammary gland and then it is abundant in colostrum and milk, through which it has been suggested to participate in the initial protection in newborns [ ] [ ] [ ] [ ] [ ] [ ] . regarding the content, human mature milk is highly enriched in lf ( . mg/ml) in comparison with bovine milk ( . mg/ml) [ ] [ ] [ ] . the amino acid sequences of both proteins exhibits approximately % identity [ , ] . lf is also present in many fluids and exocrine secretions, such as tears, saliva, and mucosal surfaces of the respiratory, urinary-reproductive and intestinal tracts; in these sites, lf contributes to the primary innate-immune defense system of mammals that exerts antimicrobial activity against an extensive variety of pathogens [ , , [ ] [ ] [ ] [ ] [ ] . lf is also synthesized during the natural cellular development of promyelocytes to myelocytes, and was early recognized as an important component of the secondary granules of polymorphonuclear (pmn) neutrophils [ , ] . these cells store lf ( - µg/ neutrophils) and release it at the sites of infection, which are acidic due to the activity of pathogens [ , , , ] . in plasma, lf derives from neutrophils and its concentration is very low ( . - µg/ml) [ ] ; nevertheless, in patients with sepsis the degranulation of activated neutrophils leads to secretion of significant levels of lf (~ . mg/ml) into the bloodstream [ ] . neutrophils also release lf in feces whose concentrations markedly increase during inflammatory processes such as inflammatory bowel disease (ibd), ulcerative colitis and crohn's disease, due to the response against pathogenic bacteria [ ] . physiologically, lf can be found as a fully iron-loaded (holo-lf) or iron-free protein (apo-lf) [ , [ ] [ ] [ ] . the holo-lf is conformationally more rigid and is more resistant to denaturation and proteolysis than the apo-lf, but instead, apo-lf is generally more effective against bacteria than holo-lf [ , [ ] [ ] [ ] [ ] . in this regard, it has been reported that holo-lf can be utilized as an iron source by several groups of microorganisms [ , [ ] [ ] [ ] . however, this is not always the case because studies on intestinal epithelial-barrier function and mucosal inflammation carried out in a caco- cells model and macrophages activated with lipopolysaccharide (lps) showed that both lf forms effectively inhibited the pro-inflammatory response. nevertheless, apo-lf was more effective in downregulating inflammation, probably due to its ability to bind and neutralize lps, as well as to neutralize microbial-derived antigens, thereby potentially reducing their pro-inflammatory effect [ ] . much evidence exists of the successful experimental use of lf from different origins (human, bovine, porcine, caprine, camelid, and buffalo) against the growth of diverse pathogens. as mentioned above, most results indicate that lf from different origins can exert bacteriostatic effects due to its iron-chelating activity, but it can also be bactericidal due to its interaction with lps and porins in gram-negative bacteria, or with teichoic acids in gram-positive bacteria. these interactions lead to membrane damage and bacterial death [ , [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . moreover, the antimicrobial activity of lf is also highly dependent on its cationic properties, because the addition of positive charges to lf via amidation enhances its antibacterial and antiviral properties and, in contrast, the addition of negative charges by acylation abolishes them [ ] . as mentioned, lf displays antiviral properties against common virus infections. these antiviral properties are related to its ability to block the cellular attachment or replication of virus by inducing type i interferons (α/β) with antiviral action [ ] . thus, lf from diverse mammals shows a potent activity against replication of human immunodeficiency virus, cytomegalovirus, and hepatitis c virus [ , ] . less information exists about the microbicidal action of lf against fungi and protozoa [ ] [ ] [ ] [ ] . very important is the finding that lf synergizes with antibiotics and drugs, and even with other proteins of the innate immune system such as lysozyme and natural secretory iga (siga) antibodies, potentiating the antimicrobial effect [ ] [ ] [ ] [ ] [ ] [ ] [ ] . the largest external source of lf is milk consumption. when consumed, lf can be enzymatically cleaved by pepsin in the stomach and by trypsin in the small intestine. in adults, whereas hlf is completely degraded, about % of blf resists proteolytic digestion mediated by pepsin [ ] . noteworthy to mention is that digestive tract of babies and infants has a relatively high ph and secretes low levels of pepsin, which allows for the innocuous transit of hlf and blf into epithelial cells, which can be extremely important at this stage of life [ , ] . nevertheless, native hlf derived from pancreatic juices and neutrophils is discharged into exocrine secretions of mucosal surfaces in adults, and thus it acts protecting those sites from invaders. in addition, diverse biological activities of lf including the facilitation of iron absorption, modulation of mucosal immunity and stimulation of mucosal differentiation result of its interaction with lf receptors (lfrs) expressed in the gastrointestinal cells [ , ] . one reason why lf can be used as a pharmaceutical is because its activity is maintained in some of its component peptides after being cleaved by proteolytic enzymes, e.g., the peptides derived from the n terminus of lf by pepsin, so-called lactoferricins (lfcins), lack the iron-chelating activity, and are characterized by their strong cationic charge. remarkably, lfcins often show a higher microbicidal activity than the parental lf as well as synergistically act with drugs and antibiotics against microbes [ , , ] . moreover, several lfcins have been synthesized and experimented against microbes [ ] . on the other hand, synthetic lfcin - , lactoferrampin (lfampin - ), and a fusion peptide of both called lfchimera, have been successfully assayed against multiresistant bacteria, and also against bacteria that typically form biofilms [ , ] . this synthetic lfchimera has also been shown to be effective against parasitic protozoa [ ] [ ] [ ] . another synthetic lfchimera prepared by the fusion between lfcin - and lfampin - , was effective against pseudomonas aeruginosa by down-regulating pyocyanin, elastase and biofilm formation [ ] . the presence of lf in secretions and its various mechanisms of action allow this glycoprotein to combat all types of microbes that colonize mucosae in the different bodily regions. however, depending on the site, microbes can be exposed to different concentrations of lf, to complexes of lf with other proteins, or to diverse levels of lf derivatives [ ] . at the same time, lf can help against the inflammatory process produced by strong immune reaction in infections. therefore, all findings on lf activities suggest that lf and lfcins can be of potential use as antimicrobial and anti-inflammatory compounds, either alone or as adjuncts to conventional antibiotics and drugs. in this sense, lf is one of the most studied proteins since the commercial point of view, being highly appreciated as a nutraceutical in some countries, promoted as a supplement in diarrheic diseases, cancer, increasing immunity, improvement of memory, and several other conditions. human lf has been cloned in different vectors and expressed as recombinant (r-hlf) overall in eukaryotic systems which can glycosylate it, such as yeasts and fungi [ , ] ; however, the best product is obtained from transgenic cows and plants [ ] [ ] [ ] . interestingly, r-hlf expressed in the cow mammary gland, enhanced systematic and intestinal immune responses in piglets used as a model of infants [ ] . in addition, when the meat from the progeny of hlf transgenic cows was analyzed, no abnormalities of its nutrient composition were found [ ] . thus, the wide use of lf in human health care is promissory. next, we will review the effects of lf as an anti-inflammatory protein in a number of infectious diseases in which it has been studied, mainly of gastrointestinal and respiratory tracts. inflammatory response is elicited by germ-line encoded pattern-recognition receptors (prrs) expressed in many cell types that interact with their ligands from exogenous or endogenous origin, namely pathogen-associated molecular patterns (pamps), or danger-associated molecular patterns (damps), respectively. some prrs comprise a large family of receptors such as toll-like receptors (tlrs) [ ] [ ] [ ] . upon ligand binding, tlrs lead to signaling pathways resulting in the activation and translocation of the nuclear factor (nf)-κb to the nucleus. nf-κb modulates the expression of pro-inflammatory cytokines such as interleukin (il)- , il- , type-i interferon (ifn-α, and ifn-β), tumor necrosis factor (tnf) α, as well as chemoattractant cytokines (chemokines). another class of prrs includes nod-like receptors (nlrs), some of which, such as nlrp , nlrp and nlrp , function as sensors or adaptors forming the "inflammasomes" [ ] . activation of inflammasomes by pamps and/or damps induces signal pathways resulting in the activation of caspase- that cleaves the inactive pro-forms of cytokines (il- , and il- ) to generate their active forms. besides to generate active pro-inflammatory cytokines, some inflammasomes regulate cell death in response to microbial and endogenous danger signals [ ] [ ] [ ] [ ] . although lf displays direct microbiostatic and/or microbicidal activities, indirect antimicrobial mechanisms have also been ascribed to its capability of modulating a wide array of humoral and cellular components of the innate and adaptive immunity [ , ] . immunomodulatory role of lf is due, in part, to its interactions with cell surface receptors that favor either elicitation of signal pathways, or lf translocation into nucleus and gene targeting [ ] [ ] [ ] . a summary of the modulatory effects of lf on inflammation due to microbial infections is shown in table . gastrointestinal infections blf treatment of cultured cells infected with e. coli lf and biopsies from patients with crohn's disease ↓il- , ↓il- and ↓tnfα mrna expression [ ] blf treatment of intestinal cell cultures infected with e. coli lf isolated from crohn's disease patients ↑ferroportin (fpn) in infected cells suggesting that blf action on inflammatory response in epithelial cells involves the iron homeostasis [ ] blf-nanoparticles (blf-nano) administration to balb/c mice infected with s. enterica serovar typhimurium ↑tnf α, ↑interferon (ifn) β and ↑ifniii levels (proinflammatory cytokines) [ ] blf administration to c h/hej mice infected with entamoeba histolytica (e. histolytica) ↑il- (th ), ↑il- , ↑iga ↓damage and ↓inflammation [ ] blf treatment to balb/c mice infected with helicobacter pylori (h. pylori) ↓gastric colonization and ↓inflammation (histopathology score) [ ] blf treatment of rotavirus infection children ↔ifnγ, ↔il- and ↔rotavirus incidence in children whether fed or unfed with blf [ ] gut-related systemic infections (sepsis) ↓lung infection, ↑ifnγ, ↑il- in spleen cell cultures, ↓tnfα and ↓il- β correlated with ↓lung pathology. ↑lymphocytic recall response towards bcg [ , ] recombinant human lf mixed with bcg vaccine in mice infected with m. tuberculosis early↑ and late↓ of pro-inflammatory cytokines that correlated with the ↓lung pathology [ ] blf effect in enhancing bcg vaccine by oral route in mice infected with m. tuberculosis ↓colony forming units (cfu) and ↓inflammation in the lungs, ↑ifnγ producing t cd and cd cells and ↑il- lymphocytes [ ] blf effects on cystic fibrosis and bronchial ib - cell cultures infected with burkholderia cenocepacia (b. cenocepacia) ↓il- β (pro-inflammatory cytokine), ↓il- (anti-inflammatory cytokine) [ ] blf administration to a murine model of lung injury by lps ↓bronchioalveolar leukocytes, ↓tnf-α, ↓myeloperoxidase (mpo) activity, ↑il- , ↓lung edema and inflammation [ ] blf administration to a murine model of respiratory syncytial virus infection ↔viral loads and ↔lung inflammation [ , ] blf administration to a murine model of influenza ↔viral load and ↔ifnγ, il- and il- in the lungs [ ] other mucosal and systemic sites blf effects on mammary gland in cows with staphylococcous aureus (s. aureus) mastitis ↓bacterial load, ↑c levels, ↓tnfα mrna expression via nuclear factor κb (nfκb) inhibition, ↑curation, ↑proinflammatory cytokines is correlated with ↑peptides derived from blf-elastase proteolysis [ ] [ ] [ ] [ ] blf effects on oral candidiasis in immunosuppressed mice infected with candida albicans (c. albicans) blf blocked the suppressive effects of candidiasis in polymorphonuclear (pmn) neutrophils; ↑ifnγ and tnfα production in cervical lymph nodes [ ] blf effects on hamsters with amoebic liver abscess by e. histolytica no damage or inflammation in the liver [ ] human lf (hlf) effects on balb/c mice infected with listeria monocytogenes (l. monocytogenes) ↓bacterial load and ↓necrotic foci in the liver, ↔necrotic foci in the spleen, ↓tnfα, il- β and ifnγ mrna [ ] hlf and peptide-hlf derivatives administration to c h/tif mice infected with e. coli o k uropathogenic strain ↓bacterial load in the bladder and kidneys, ↓leukocyte in urine, ↓urinary il- levels at h and systemic il- levels at h post-infection [ ] hlf expressing transgenic mice infected with s. aureus ↓bacterial growth, ↓septicemia, ↓mortality than congenic litter mates. ↑th polarization in the spleen, given that: ↑tnfα and ↑ifnγ, ↓il- and ↓il- upon stimulation ex vivo with exotoxin toxic shock syndrome toxin- compared with congenic controls [ ] ↓ decrease; ↑ increase; ↔ no changes. throughout the gastrointestinal tract, lf is present as an iron-binding multifunctional glycoprotein regarded as a natural compound able to inhibit the pathogens growth. lf is also able to up-and down-modulate both humoral and cellular components of immunity involved in the regulation of the inflammatory response having a key role in maintaining gut homeostasis [ ] . balance of homeostasis results from the tight regulation of several events, since too little inflammation disrupts the process of tissue repairing and remodeling, whereas too much inflammation entails collateral impact by causing tissue damage with life-threatening consequences [ ] . mucosal compartment of the small intestine is a scenario where takes place a physiologic inflammatory response orchestrated by innate and adaptive mechanisms mediated by intestinal epithelial cells and by a wide array of immunocompetent cells at lamina propria, such as dendritic cells, macrophages and tγδ lymphocytes, all with a key role in maintaining the gut homeostasis and combating infections [ ] . however, in some infectious clinical conditions of the large intestine, such as ibd, inflammation has a double-edged sword role by either enabling or inhibiting cancer development and progression [ , ] . as it was commented before, antimicrobial activity of blf against a wide array of pathogens has been profusely evidenced. in contrast, data about the regulatory role of blf on the parameters of gut inflammation caused by enteropathogenic microorganisms have been provided by a limited number of articles. findings from in vitro and in vivo models of infection show that blf displays up-and down-modulatory effects on pro-inflammatory th cytokine profile. the role of blf on the resolution of infections by modulating mediators of inflammation has been documented in models of infection caused by several strains of enteropathogenic bacteria [ ] [ ] [ ] [ ] [ ] , and parasites [ ] . additionally, it has been found that lf promotes the development of bifidobacterium, one of the major genera of bacteria of the colon flora used as probiotics, in a manner independent of the iron saturation level of lf [ , ] . this effect is believed to help maintaining the gut homeostasis. regarding to the gastric inflammation, the treatment with blf or hlf as single agents or in combination with antimicrobial drugs, was found to favor eradication of bacteria and to protect against gastritis caused by helicobacter pylori or helicobacter felis, as described in murine models [ , ] . however, other human and murine trials did not support this finding, and even more, bacterial growth and gastric inflammation seemed to be enhanced by blf or hlf administration [ , ] . these controversial data may reflect experimental or clinical settings of lf treatment. interestingly, lf as a single component failed to eradicate the h. pylori infection but in combination with triple esomeprazole, clarithromycin and amoxicillin therapy and with probiotics, favored the resolution of infection and ameliorated the inflammatory response more effectively than in combination with two-antibiotic treatment, as described in experimental mice treated with r-hlf from transgenic goats, and also in trails of patients treated with native blf. interestingly, r-hlf not only inhibited the growth of h. pylori, but also suppressed the expression of two of its major virulence factors [ , ] . on the other hand, several studies have demonstrated the effect of lf on modulating inflammation in the small intestine. for example, the anti-inflammatory activities of both r-hlf and native blf have been tested in models of bacterial infection by shigella flexneri in rabbits [ ] , and salmonella enterica serovar typhimurium in susceptible balb/c mice [ ] . unlike with lf-untreated animals, macroscopic and microscopic observations evidenced that both lf treatments favored the resolution of infection and protected mice from tissue damage caused by the intestinal inflammation [ , ] . mechanisms accounting for the anti-inflammatory role of blf may result, in part, from the elicitation of siga response with a key role in luminal clearance of pathogens and in down-modulation of intestinal inflammation [ , , , , ] . although lf may modulate inflammation by inhibiting the growth of pathogens through the iron chelating ability of apo-lf, the iron-free form of lf used in most studies, assays based on the murine typhoid model showed that pharmaceutical formulation of iron-saturated blf (holo-blf) enclosed in nanocapsules displayed both antimicrobial activity and modulatory properties on the inflammation. the latter was evidenced by up-and down-modulation of cytokines involved in innate and adaptive immune responses as well on hematopoietic cytokines, with a key role in the generation of both granulocyte (pmn neutrophils) or agranulocyte (monocytes/macrophages) phagocytes [ ] . thus, iron-loaded blf nanocapsules seem to evoke the convergence of innate and adaptive immune responses of pro-and anti-inflammatory cytokines resulting in the protection toward typhoid infection and concomitant intestinal inflammation. down-modulatory effects of blf on pro-inflammatory cytokines has also been documented in cultures of caco- monolayer cells infected with recombinant escherichia coli invasive strain harboring inv gene from yersinia pestis; this strain is able to accomplish invasion but not intracellular multiplication within epithelial cells [ ] . in this model, apo-blf as well as holo-blf decreased levels of il- elicited by non-invasive e. coli wild type strain, and il- , il- and tnfα by e. coli invasive. in addition, both apo-and holo-blf inhibited an il- increased response caused by e. coli invasive strain, but levels of this cytokine remained elevated. these findings suggested that the effect of blf toward inflammatory mediators was iron-independent and that constant high il- levels provided protection by inducing recruitment of phagocytes to combat the infection [ ] . in the large intestine, the regulatory impact of blf toward inflammatory response has been described in in vitro models of infection by adherent invasive e. coli (aiec) strains with a presumable role in the pathogenesis of crohn's disease. this disease, along with ulcerative colitis, are two clinical entities of ibd characterized by an abnormal response to commensal bacteria colonizing the intestinal lumen [ , ] . aiec lf strain is found in lesions of inflamed colon tissue in children suffering crohn's disease with a preponderant th pro-inflammatory response [ ] . findings in the model of infection by aiec lf indicated that blf inhibited the bacterial invasion and the pro-inflammatory cytokine response of tnfα, il- and il- in epithelial monolayers and in cultures from colonic biopsies from patients with crohn's disease, suggesting a potential therapeutic role for blf as antibacterial and anti-inflammatory agent [ ] . up-modulatory effects of blf on inflammatory cytokines in response to bacterial infections have been found in assays of infection with aiec lf in caco- monolayers stimulated with ifn-γ to mimic the preponderant response of th associated cytokines found in crohn's disease patients [ ] . data from these assays showed that in unstimulated infected cells, blf inhibited both bacterial invasion and survival, while in infected cells primed with ifn-γ, blf increased il- production whereas counteracted the inhibitory effect of aiec infection on ferroportin protein expression. ferroportin is an iron exporter protein regulated by the inflammation that determines the survival of intracellular pathogens by reducing the intracellular iron levels. apparent conflicting data described in the infection model with aiec lf strain regarding the anti-inflammatory [ ] versus pro-inflammatory [ ] role of blf seem to evidence two sides of the same coin, i.e., the ability of blf to up-and down-modulate the inflammatory response and iron availability resulting in the resolution of infection. in parasitic infections of the large intestine, we previously developed a model of intracecal infection by the protozoan entamoeba histolytica in susceptible c h/hej mice (a strain with a spontaneous mutation in the tlr gene) to simulate the intestinal infection caused by this parasite in humans [ ] . in this model, the oral therapeutic administration of blf resolved the intestinal infection with amoebae at high efficiency, effect that was shown to be associated to an increased local expression of il- and il- and the elicitation of siga in cecum [ ] , as happened with the salmonella infection. both il- and il- are th interleukins involved in the up-regulation of siga and il- , and also is a secondary inflammatory cytokine that exhibits pro-and anti-inflammatory properties [ , ] . thus, oral blf administration led to the anti-inflammatory response of mediators such as th cytokines and iga that collaborate in the protection against the parasite and maintenance of homeostasis with protective impact on tissue integrity. on the other hand, in experimental assays conducted in mice infected with enterovirus, blf treatment displayed protective action resulting from hampering the viral interaction with host cells [ ] . however, in vitro assays indicated that blf did not exhibit any suppressive activity against rotavirus [ ] . in addition, assessment of rotavirus infection incidence in children, either treated or not with blf, showed that blf neither prevented the viral infection nor had an effect on the levels of ifn-γ or il- as markers of pro-and anti-inflammatory interleukins, respectively [ ] . thus, therapeutic action of blf by itself on viral enteritis is unclear; however, assays in suckling rats showed that administration of whey protein concentrate containing blf as well as other bioactive components, favored the resolution of acute gastroenteritis caused by rotavirus infection [ ] . this result suggests a synergic effect from the bulk rather than each single bioactive component that provided protection to enterovirus. sepsis is a life-threatening syndrome that results by the harmful effects of inflammatory response associated to gut systemic infections [ , , ] . as in the case of infectious intestinal diseases, assessment of inflammatory parameters regulated by blf in response to systemic infections have been analyzed in a limited number of infection models, induced by e. coli strains administered by enteral or parenteral routes [ , , ] . in most cases, models mimic sepsis conditions found in human systemic infections by invasive enteropathogenic bacteria in immunocompetent hosts, or by microbiota members causing opportunistic nosocomial infections in neonatal or adult patients underwent solely parenteral nutrition, post-surgery antibiotic treatment, or immunosuppression, among other conditions [ , ] . therapeutic action of blf and the synthetic peptide lfchimera was tested in balb/c mice infected by intragastric route with enterohemorrhagic e. coli (ehec); the latter is a food borne pathogen causing mild diarrhea, hemorrhagic colitis and, in some patients, hemolytic uremic syndrome characterized by anemia, thrombocytopenia and kidney injury [ ] . in infected mice that underwent both lf and lfchimera treatments, fecal bacterial output and kidney colonization were found reduced, while lfchimera significantly decreased mortality rate. histological analysis in hematoxylin-eosin stained tissue slices to assess the inflammatory response reveled that both lf and lfchimera treatments decreased kidneys damage in comparison with mice without blf treatments that showed tubular necrosis, glomerular injury and intratubular hyaline cast. furthermore, in vivo and in vitro assays have documented the role of r-hlf against gut-related systemic infection by e. coli strain ec causing meningitis in orogastrically infected neonatal rats [ ] . this model mimics clinical observations in neonates which evidence that parenteral feeding as sole route of nutrition is a risk factor of sepsis, resulting from translocation of microbiota members, e.g., gram-negative enterobacteria, from intestinal tract to systemic organs via bloodstream, with potentially fatal consequences. treatment with r-hlf decreased the clinical sepsis illness and bacterial loads in the kidney and blood while in vitro assays in macrophage cultures showed that levels of nitric oxide, tnfα and nf-κb expression elicited by lps were even higher following the addition of r-hlf. these findings suggest that protective action of r-hlf resulted from an optimal activation of macrophages via pro-inflammatory cytokine elicitation to enhance their bacterial killing activity [ ] . effect of blf against sepsis caused by e. coli and staphylococcus aureus has been demonstrated in cyclophosphamide immunosuppressed mice, as a model to mimic immunosuppressive therapy for autoimmune and neoplastic diseases. antisepsis action of blf evidenced by the reduction of bacterial load in the spleen and liver was associated with a rise of circulating leukocytes induced by the elicitation of il- in the spleen as well as peritoneal macrophages in immunosuppressed mice treated with blf [ ] . studies in mice systemically infected with e. coli evidenced that blf enhanced the killing activity and recruitment of neutrophils [ , , ] . action of blf against e. coli sepsis resulted from the elicitation of il- involved in the production of acute phase proteins, as well as from the amelioration on tnfα levels increased in response to the infection [ ] . since high levels of circulating pro-inflammatory cytokines such as tnfα have lethal consequence, the results described above suggest that the ability of blf to control the tnfα increase may underlie its protective action to sepsis, as found in in vitro and in vivo assays [ , ] . clinical trials have confirmed the potential application of blf to prevent nosocomial sepsis and necrotizing enterocolitis of premature neonates, diseases that were associated with the up-modulation of t regulatory cells (foxp + cd +, and cd hi) involved in the control of intestinal immune response against pathogens, strengthening the essential role of blf in the control of the intestinal homeostasis [ ] . pro-and anti-inflammatory properties of lf in bacterial infections have been ascribed to its ability to act as a lps-binding protein (lbp). modulatory effects of either hlf or blf, including derived lfcins, on parameters associated with inflammation, has been evidenced in models of intestinal and systemic-related endotoxemia induced by lps (also known as endotoxin) from gram-negative enterobacteria [ , ] . these experimental models are intended to assess the impact of lf at intestinal and systemic levels on inflammatory markers elicited by lps that affect the gut barrier, bacterial translocation, diarrhea, tissue damage and endotoxic shock, among others [ , [ ] [ ] [ ] [ ] . in some cases, experimental assays with lps administration encompass the use of zymosan, d-galactosamine (d-galn) or carrageenan to increase the sensibility of animals toward the toxic effects of low lps doses [ , ] . porcine lf (plf) bioactive derivatives such as plf peptide (lfp ) have been proved to confer protection in mice against lps damage to colon, associated with its down-modulatory action on pro-inflammatory cytokines tnfα, il- and ifnγ. lfp elicited the expression of tight junction proteins involved in the regulation of intestinal permeability, i.e., zonula occludens- , occludin and claudin- , as well as decreased colonic apoptosis [ , [ ] [ ] [ ] [ ] [ ] [ ] . protective action of hlf on the gut barrier function against the lps-induced intestinal damage has also been described for hlf in in vitro cultures of caco- cells and jejune segments of mice underwent lps-endotoxemia [ , ] . iron status of blf had no impact on parameters of the gut barrier function, as documented in caco- cell cultures incubated with murine (j a. ) macrophages; however, apo-blf displayed stronger neutralizing effects than holo-blf against the pro-inflammatory cytokine generation in response to lps and thermally inactivated e. coli cm antigens, suggesting that iron content may determine the protective role of lf toward the inflammation caused by gut endotoxemia and/or sepsis [ ] . at intestinal level, neutralizing activity of blf or hlf has been tested in models of endotoxemia in mice induced by the intraperitoneal administration of lps [ , ] . other models of lps neutralization by blf include enterogenic endotoxemia in rats injected with carrageenan by intraperitoneal route, and also infection with e. coli in rats treated with nebacetin by intraduodenal via to enable the lps release [ ] . in the model of mice endotoxemia, intraperitoneal administration of hlf provided protection against deleterious effects of lps on the intestinal integrity [ ] . moreover, blf administered by intraperitoneal route in mice attenuated the lps-induced diarrhea by decreasing the production of pro-inflammatory mediators with powerful diarrheagenic activity, i.e., prostaglandin e (pge) by enterocytes in the small intestine and nitric oxide in plasma [ ] . in the enterogenic endotoxemia model in rats, blf decreased the endotoxic activity of lps, as measured in plasma on a dose-dependent manner, and also decreased the bacterial loads in the mesenteric lymph nodes [ ] . some experimental assays in neonatal mice indicated that feeding with blf and/or bifidobacteria decreased the intestinal levels of lps without changes in cell populations producing tnfα, ifnγ and il- in peyer's patches [ ] . at the systemic level, the neutralizing activity of hlf-derived lf peptide has been tested in models of endotoxemia in mice, induced by intravenous administration of lps and d-galn. in this assays, lf exhibited protective activity against lethal intravenous lps challenge by decreasing circulating levels of tnfα [ , ] . the dual action of lf on circulating tnfα seems to underlie its protective role, since down-modulation of tnfα provided protection against the deleterious impact of endotoxemia, whereas the modulatory role of lf in the control of tnfα elicitation is critical for eradication of gut-related systemic infections [ , , ] . in another example, blf displayed prophylactic action against lethal shock occurring upon intravenous injection of lps in germ-free piglets; this is a valuable model to study the primary toxicity of endotoxin portion of lps, i.e., lipid a, rather than the secondary toxicity of o and r polysaccharide portions [ ] . in cultures of monocytes from lps-treated piglets, blf inhibited the interaction of lps with cd , an antigen surface marker expressed by mononuclear phagocytes. priming of these phagocytic cells by lps via cd ligation, resulted in the elicitation of powerful pro-inflammatory cytokines including tnfα, il- and il- with lethal outcome for host in endotoxemic conditions [ ] . moreover, oral administration of blf prior to an intravenous lps challenge in piglets provided protection against the mortality caused by lps-induced hypothermia [ ] . like blf, protective activity against hypothermia has been described with hlf in mice underwent lps-endotoxemia [ ] . effect of blf on lps-neutralization and e. coli bacteremia has been explored in lps toxicity susceptible c h/hecr mice carrying a defective tlr- gene as well as in cba mice resistant to lps [ , ] . unlike its protective activity in cba mice, blf failed to confer protection against endotoxemia and e. coli bacteremia in c h/hecr mice due to its inability to ameliorate the elicitation of tnf-α and ifnγ, and to prevent il- decrease. thus, an unbalanced cytokine response may be responsible of the high susceptibility to lps endotoxemia in c h/hecr mice [ ] . differential impact of concurrent, prophylactic, and therapeutic effects of intraperitoneal administration of hlf on endotoxemia were analyzed in mice by intravenous administration of lps [ ] . in the concurrent scheme, hlf administered prior to the lps challenge decreased the serum levels of tnfα, nitric oxide, il- and il- . in the prophylactic and therapeutic protocols, hlf significantly down-modulated serum tnfα and nitric oxide, but no significant fluctuations were seen in the levels of il- and il- . in a mice model of hepatitis induced by intraperitoneal co-administration of lps and zymosan, orally administered blf decreased the serum aspartate aminotransferase activity (a marker of liver inflammation), and increased in the small intestine the production of il- , an anti-inflammatory cytokine with a role in the amelioration of inflammatory response [ , ] . the findings indicate that the up-modulation of il- levels by blf seems to provide therapeutic action in the small intestine induced by lps-zymosan in this model of hepatitis. treatment with r-hlf has also been analyzed in the same mice models of induced hepatitis [ ] . in the experimental scenario, r-hlf provided protection against hepatitis development as determined by the decrease in alanine transaminase activity as the marker of liver damage, which was associated with down-modulation of serum tnfα levels. moreover, the protective effect of r-hlf was not found in mice pre-treated with gadolinium chloride that destroys kupffer cells, suggesting that these cells are the source of tnfα and the targets of r-hlf [ ] . the mechanisms of lf action on the inflammatory response have been analyzed in regarding to the ability of lf to interact with lps and block its interaction with tlr in in vitro cultures of intestinal cell lines and murine peritoneal or cell line macrophages [ , , [ ] [ ] [ ] [ ] [ ] . these assays have evidenced that lf down-or up-modulates lps-mediated inflammatory response via dependent or independent tlr /nf-κb signal pathway. down-modulatory impact on lps-mediated inflammation was found in assays of intestinal porcine epithelial cell line (ipec- ) treated with the plf-derivative peptide lfp , effect that resulted from its ability to inhibit myd /nf-κb and myd /mapk signaling pathways [ , ] . similarly, in human monocyte cell lines (thp- and mono mac ), hlf also displayed down-modulatory activity on lps-associated cytokine response by blocking the binding of nf-κb to the tnfα promoter [ ] . assays in cultures of human peripheral blood mononuclear cells showed that blf displayed an anti-inflammatory response by driving the differentiation of lps-treated monocytes toward dendritic cells with low capacity of both differentiation and elicitation of th response by counteracting the tlr mediated activation signals [ ] . on the other hand, up-modulatory impact of lf on inflammatory effects of lps was documented in assays of raw . macrophage cell line and peritoneal macrophages, indicating that blf, in the form of complex with lps, enhanced cytokine response of tnfα, il- and il- via tlr -nf-κb signal pathway [ ] . however, another study suggests that the up-modulatory effect of lf on lps-mediated inflammation may involve pathways other than tlr signaling. thus, assays on raw . macrophage cell line treated with lps showed that elicitation of il- levels by blf was tlr -independent [ ] . therefore, lf displayed a dual role on the lps-mediated response of pro-inflammatory cytokines that encompasses alternative routes of tlr signalization. other presumable mechanism of lps-mediated inflammation includes the ability of lf to control the expression of iron-regulating proteins as found in thp- monocyte/macrophage cultures; in these cells, lf prevented the lps-induced decreased of ferroportin by reducing the il- levels [ ] . as we mentioned before, ferroportin is an iron binding protein involved in the control of iron levels during inflammatory response. in summary, the findings described above provide the experimental evidence that support the protective role of lf against the deleterious effects of lps-induced pro-inflammatory cytokine response on the gut-barrier function, diarrhea, bacterial translocation, and tissue damage. having in mind the antimicrobial and lps-binding protein activities of lf, its application either alone or in combination with probiotics, or as an adjunctive compound of antibiotics, may represent a very promising strategy for the treatment and prevention of sepsis and endotoxic shock. the human respiratory tract (rt) is responsible for the mobilization of millions of liters of gases throughout life. delivery of life-requiring oxygen to the systemic circulation and organs implies the potential incorporation of countless particles, toxicants and microbes, which are countered by local innate and adaptive immune responses that avoid their entry into the lung tissue and circulation and protect the lung structure and function [ ] . infections in the rt are very frequent in the population and represent a considerable cause of worldwide morbidity and mortality [ ] . infections of the upper rt such as common cold, laryngitis, pharyngitis, epiglottitis, otitis and sinusitis are typically caused by virus, bacteria, and, at less extension, by fungi. as an example, the common cold is a viral disease considered as the most frequent infection in humans, which can be caused by rhinoviruses, coronavirus, parainfluenza and adenovirus, and less frequently by respiratory syncytial virus and enterovirus. however, the influenza virus, a common cause of seasonal flu, can simultaneously affect other parts of the rt, including the lower tract. infections of the lower rt are mainly caused by bacteria, but also by virus, fungi and even parasites. they include bronchitis, pneumonia and pulmonary abscesses, among others. tuberculosis, caused by the bacterium mycobacterium tuberculosis, is among the most prevalent infections in the lower rt, causing mainly pneumonia, but also affecting other organs [ ] . all rt infections are accompanied with an inflammatory process whose intensity depends on many variables, including the type of pathogen and its virulence, the inoculum, the affected tissue, the host immunological status and whether the infection is acute or chronic. although the inflammatory process is essential for the control of invasive infectious agents, the development of an exacerbated or chronic inflammation results in alterations of the respiratory capacity due to the lung tissue damage, including edema, increased airway resistance and mucus production, such as in the infection with influenza virus [ ] . understanding how inflammation alters the respiratory system is indispensable for the development of better therapeutic interventions to support breathing and lung plasticity as a clinical treatment. in this regard, evidence of the modulation of rt inflammation by blf associated to certain microbes has been reported using several in vitro and in vivo models. moreover, lf is considered the second most important antimicrobial and anti-inflammatory peptide after lysozyme in the upper rt [ ] . tuberculosis is by far the most studied in vivo model of microbial pulmonary infection. this bacterial infection affecting nearly a third of the world's population and having a rate for new infections of approximately . % per year [ ] , is targeted by the bacillus calmette-guerin (bcg) vaccine, the most widely used vaccine in the world which has remained almost unchanged since [ ] . a study carried out in showed that a single subcutaneous immunization of mice with a mix of bcg and blf emulsified with freund's adjuvant, followed by a challenge with m. tuberculosis in aerosol, resulted in decreased mycobacterial loads in the lungs and spleen [ ] . splenocyte proliferative response to heat-killed bcg showed increased il- and ifnγ production. in a subsequent study by the same group, it was showed that blf admixed to the bcg vaccine, in incomplete freund's adjuvant or pbs, increased mice protection against a m. tuberculosis challenge when compared with mice that received bcg alone [ ] . in addition, there was a significant reduction of lung bacterial load associated to increased production of ifnγ and il- by splenocytes, as mentioned before; in this study, blf addition to the vaccine also resulted in a clear reduction in lung pathology, concomitant with down-regulation of pro-inflammatory mediators tnfα or il- β, suggesting that the main action of lf to enhance the bcg vaccine relied on its immunomodulatory properties reducing the immune-related tissue pathology, in part, by modulating macrophages and dendritic cells ability to present antigens and stimulate t-cells [ ] . noteworthy, the lymphocytic recall response towards bcg antigens two months after infection was higher in the mice that received lf as adjuvant, suggesting that lf improved the specific t-cell th response as determined by the increase in infγ production [ ] . the potential of r-hlf to reduce the m. tuberculosis tissue damage and pulmonary histopathology was also demonstrated in ulterior studies of the same group. they showed that r-hlf produced in the yeast pichia pastoris expression system with a glycosylation pattern similar to its natural human neutrophil counterpart, in contrast to the non-glycosylated r-hlf, was able to improve the efficacy of the bcg vaccine in protecting against the challenge with m. tuberculosis in aerosol, as manifested primarily in a significant reduction in the associated pulmonary pathology [ ] . in this case, the mycobacterial loads in the lung and spleen were not significantly reduced in the bcg-r-hlf group compared with the controls treated with bcg alone, but rather, the protection was associated with changes in the pathological manifestation of the lung disease; this was probably due to the notable immunomodulatory function of the granulocytic lf used in this study, when compared with the lf form from secretions, which is more microbicidal [ ] . recently, a r-hlf expressed in chinese hamster ovary (cho) cells was also used in the mixture with the bcg vaccine, showing a slight decrease over the time in the lung pathology after aerosol challenge with m. tuberculosis, which correlated with an initial increase in the secretion of inflammatory cytokines followed by their posterior decrease [ ] . the efficacy of blf in enhancing the bcg vaccine action was more recently analyzed using a more amenable route of administration. in this study, mice that received drinking water containing . % blf at day or post-infection had lower colony forming units (cfu) and lower inflammation in the lungs, with increased numbers of ifnγ producing t cd and cd cells and il- producing lymphocytes when compared with animals vaccinated with bcg alone [ ] . noteworthy, blf did not affect the in vitro replication of m. tuberculosis but instead enhanced the killing of bacteria by macrophages in a nitric oxide dependent way [ ] . these studies using the models of pulmonary infection with m. tuberculosis suggest that lf promotes certain up-regulation of pro-inflammatory response, while down-regulating overall tissue immunopathology. the role of lf in the inflammation in other pulmonary infections has been less addressed. homeostatic effect of blf on inflammation was reported in in vitro cultures of cystic fibrosis (cf) bronchial cells (ib - ) infected with burkholderia cenocepacia, a gram-negative opportunistic bacterium that recurrently infects patients with cf forming biofilms and is usually highly resistant to currently available broad-spectrum antibiotics. thus, even though the addition of blf did not reduce the rates of bacterial invasion, it decreased the release of pro-inflammatory il- β, while augmented the secretion of anti-inflammatory il- , suggesting a role for blf in protecting cf bronchial infected cells from the inflammation-associated damage [ ] . noteworthy, this study correlated with a previous one addressed on sputum samples from patients with cf which showed an inverse association between the levels of lf in the secretions and the inflammation burden [ ] . another study showed that the decrease of lf levels in patients with cf was due to its cleavage by the increased cathepsin activity in pseudomonas aeruginosa-positive sputum samples, another biofilm-forming opportunistic pathogen of these patients. a similar result with lf and tf undergoing proteolysis was previously reported in bronchioalveolar lavage of p. aeruginosa infected cf patients [ ] . these results suggest that the proteolytic cleavage of lf in patients with cf can contribute to b. cenocepacia and p. aeruginosa-associated lung damage, and that infection-associated lung damage can be improved by the exogenous therapeutic administration of lf, due to its potent immunomodulatory properties. similar protective effect of blf has been found in a murine model of lung injury induced by intraperitoneally administered lps [ ] . in this study, the intraperitoneal injection of blf ( mg/mouse) h before (prophylactic effect) or h after (therapeutic effect) lps challenge, were associated with significant reduction of the total number of leukocytes in bronchioalveolar lavage samples, increased il- , and decreased tnfα concentrations and myeloperoxidase activity [ ] . these changes paralleled attenuation of lung edema and inflammatory infiltration, suggesting a protective role of blf by avoiding the damage caused by the lps-induced acute inflammatory response. however, the protective role of lf based on the regulation of inflammation is not observed in all cases of rt infections. there are several viral infection models where the immunomodulatory effect of lf has not been documented. thus, although lf has in vitro antiviral activity against the respiratory syncytial virus (rsv) [ ] , as well as an immunomodulatory effect reducing the release of il- by hep- cells infected with rsv [ ] , the oral or intraperitoneal administration of different doses ( to mg/animal/day) of blf to mice from h before until h post-rsv infection did not have any effect on viral loads, pulmonary airflow resistance or obstruction, degree or type of pulmonary inflammation and serum t cellular responses, evaluated on day post-rsv infection [ ] . similar result was observed in a study carried out in mice treated by intranasal route with blf on days - , and evaluated on day post-rsv infection [ ] . another example is a mouse model of influenza infection, where the daily oral administration of . mg of blf from h before infection, did not have any effect on viral load and concentration of ifnγ, il- and il- cytokines evaluated at six days post-infection, when compared with untreated infected mice [ ] . the reason for the lack of blf protecting effect in these viral infection mice models is unknown, but possible explanations could be related to timing, dosing, and route of blf administration. in contrast, oral blf and curcumin supplementation to children with recurrent viral rt infections resulted in immune modulation by modifying the lymphocyte population and cytokine responses that reduce the rate of infections [ ] . a recent study aimed to determine the effect of three months supplementation with blf-fortified formula on respiratory tract infections and diarrhea in chinese weaned infants ( - months age), showed similar results, with a reduction in the incidence rate of respiratory-related illnesses when compared with a placebo group [ ] . moreover, a study in patients with chronic rhinosinusitis has established an association between the genetic deficiency of lf synthesis in the upper rt and the increased susceptibility of certain individuals to bacterial colonization, biofilm development, and recalcitrant sinus disease [ ] . this new knowledge of lf immunomodulation paves the way to more general design of t cell-dependent vaccines that incorporate naturally occurring granulocytic components, which may be useful in infectious diseases to reduce immune-mediated tissue damage. the role of blf on inflammatory response associated to infection has been described in other mucosal sites, such as the mammary gland of cows suffering staphylococcal mastitis [ ] . assessment of mammary gland secretions showed that, in sick cows, intramammary infusion of blf decreased the numbers of staphylococci and increased c levels, whereas in healthy animals blf infusion increased the numbers of pmn leukocytes expressing cd b, an integrin when complexed with cd (cr ) acts as receptor for the ic b complement fragment [ ] . according to these findings, up-modulatory effect of blf on pro-inflammatory components of innate immunity may underlie its therapeutic action toward mastitis; in fact, alternative approaches have also been tested to decrease the deleterious effect of inflammation on tissue integrity. combination of blf and antibiotics was found to be effective to control the staphylococcal mastitis and to attenuate the mrna expression of tnfα via the inhibition of nf-κb activation [ ] . thus, this approach may contribute to decrease the effects of inflammation on tissue damage and also to reduce the antibiotic dosage for the eradication of staphylococcal infection by multiresistant strains. inflammatory response in staphylococcal mastitis seems to be correlated with the elicitation of peptides derived from blf-elastase proteolysis that display low concanavalin a and low iron-binding affinities, as well as antibacterial properties, but induce the expression of pro-inflammatory cytokines il- and tnfα leading to neutrophil infiltration [ , ] . like staphylococcal mastitis, elicitation of low cona affinity lf-peptide derivatives in parotid saliva was correlated with the severity of symptoms of periodontitis patients [ ] . in oral cavity, the modulatory action of blf on infection-associated inflammatory response has been documented in mice infected with candida albicans [ ] . experimental settings of oral candidiasis in immunosuppressed mice showed that oral administration of blf displayed therapeutic effect by inhibiting the suppressive effects of infection on inflammatory parameters of innate response, such as circulating pmn neutrophils and cervical lymph-node cells; moreover, generation of ifnγ and tnfα was found increased in cervical lymph-nodes cultures primed with heat-killed c. albicans from blf-treated mice [ ] . according to in vitro assays testing full length blf and blf-derived peptides, therapeutic effect of parental blf relies on the n-terminal portion associated with its ability to up-modulate the killing action of pmn neutrophils by increasing the superoxide generation, protein kinase c, p mapk activity, and the expression of p phox [ ] . these findings suggest that, in the murine model of candidiasis, the up-modulatory effect of blf on parameters of inflammation provides protection to c. albicans infection. data from in vivo and in vitro assays support the role of blf and hlf in up-and down-modulation of inflammatory response to extra-intestinal infections, such as hepatic amoebiasis [ ] , listeriosis [ , ] , urinary tract infections [ ] , legionellosis [ ] , and staphylococcal septicemia [ ] . in experimental amoebic liver abscess in hamsters, blf treatment by gavage had protective action against the hepatic lesions by e. histolytica and favored the normalization of the liver function [ ] . having in mind its intrinsic anti-inflammatory and therapeutic action, as well as its low toxicity, the use of blf as adjunct of conventional drugs such as metronidazole, may contribute to decrease the drug dosage in the treatment of amoebiasis and even decrease the drug resistance of the parasite. in vitro experiments on listeria monocytogenes infection in ifnγ primed thp cell cultures indicated that blf displayed a protective action against cell death by necrosis, whereas bovine lfcin b diverted the death cell from necrosis to apoptosis [ ] . findings indicated a protective role of blf and lfcin b by reducing the inflammatory response associated to necrosis caused by the intracellular infection of the pathogenic bacteria in macrophages, and favored the anti-inflammatory conditions of cell death by apoptosis on these cells. data from studies of infection with l. monocytogenes in mice indicate that treatment with hlf displayed significant effects on one main organ target of this pathogen in regards to bacterial colonization, necrosis, and mrna expression of pro-inflammatory cytokines tnfα, il- β and ifnγ [ ] . although the majority of the experimental data on lf properties has been obtained with blf, some experimental studies indicate that hlf displays even more potent antibacterial and anti-inflammatory action. murine model of infection of urinary bladder with the uropathogenic e. coli o k strain showed that perorally administered hlf decreased the bacterial load in the kidneys and urinary bladder as well as the inflammatory response, as evidenced by reduced il- levels in urine at h post-infection, and in plasma, at h post-infection [ ] . thus, hlf administered by peroral route provides therapeutic action against infection and inflammation in remote sites such as the urinary tract. in vitro assays of legionella pneumophila infection in cultures of monocytes from healthy volunteers indicated that unlike holo-hlf that promoted the bacterial growing, apo-hlf inhibited the intracellular multiplication of the pathogen in both inactivated and ifnγ activated monocytes [ ] . these findings suggest a synergy between the antibacterial effect of iron-free human lactoferrin and the stimulating killer effects of the pro-inflammatory cytokine ifnγ on infected cells, leading to conditions for control of bacterial multiplication inside cells. a model of s. aureus infection in hlf-transgenic mice showed the pivotal role of hlf in the elicitation of a th profile of cytokines, which determined the resolution of systemic infection. polarization of the immune response to the th profile in hlf-transgenic mice was evidenced by up-modulation of tnfα and ifnγ levels and down-modulation of th cytokines il- and il- in culture supernatants of spleen cells [ ] . in summary, the studies mentioned above show that lf and its derivative peptides display bimodal effects that provide conditions for the up-and down-regulation of inflammation leading to the resolution of extra-intestinal infections. the biotechnological development of formulations of lf as nanoparticles for potential clinical use, in addition to lf-hydrolysate, and native lf alone or in combination with probiotics, may have application for the control of infections and inflammation [ , , , , , ] . evidence from the basic studies in animals of experimentation about the prophylactic and therapeutic activity of lf as antimicrobial and modulatory agent on inflammatory response, have promoted this glycoprotein from the innate immune system as a focus of interest for the biotechnological development of nanoparticle-based formulations for potential clinical use. in addition, lf-hydrolysate, and native lf alone or in combination with antibiotics and probiotics, may have potential application in the control of neonatal infections, and in inflammation. more studies are necessary to support the generalized practical application of lf, mainly in the control of inflammation associated to infections. the authors thank to the mexican council of science and technology (conacyt) for the supporting grants (mireya de la garza) and (julio césar carrero). julio césar carrero also thanks to programa de apoyo a proyectos de investigación e innovación tecnológica (papiit-unam) for grant no. in and to the institutional program "nuatei" for financial support. thanks also to carlos villasana and luisa samaniego-barrón for their technical assistance and pavel petrosyan for the english editing of the manuscript. the authors declare no conflict of interest. lactoferrin: a multifunctional glycoprotein lactoferrin from milk: nutraceutical and pharmacological properties overview of lactoferrin as a natural immune modulator lactoferrin-a multifunctional protein with antimicrobial properties immunomodulatory effects of lactoferrin on antigen presenting cells nanocapsules loaded with iron-saturated bovine lactoferrin have antimicrobial therapeutic potential and maintain calcium, zinc and iron metabolism the isolation of a red protein from milk preparation and properties of lactosiderophilin (lactotransferrin) of human milk a structural framework for understanding the multifunctional character of lactoferrin relative molecular mass, isoelectric point, iron-binding properties and uptake by the liver occurrence, structure, biochemical properties and technological characteristics of lactoferrin metal-combining properties of human lactoferrin (red milk protein). . the involvement of bicarbonate in the reaction proteins of iron metabolism the physiology of lactoferrin lactoferrin in milk from different species an iron-binding protein common to many external secretions lactoferrin and host defence: an overview of its immuno-modulating and anti-inflammatory properties biological role of lactoferrin lactoferrin concentration during involution of the bovine mammary gland concentrations of lactoferrin and iron in human milk at different stages of lactation concentration of lactoferrin and transferrin throughout lactation in cow's colostrum and milk molecular evolution of the transferrin family and associated receptors swiss-prot database the significance of iron in infection the involvement of lactoferrin in the hyposideremia of acute inflammation lactoferrin: a general review antimicrobial properties of lactoferrin the therapeutic potential of lactoferrin lactoferrin content of peripheral blood cells lactoferrin biosynthesis during granulocytopoiesis lactoferrin turnover in man lactoferrin, an iron-binding protein in neutrophilic leukocytes crohn's disease activity assessed by fecal calprotectin and lactoferrin: correlation with crohn's disease activity index and endoscopic findings structure of human lactoferrin at . -a resolution three-dimensional structure of diferric bovine lactoferrin at . a resolution heterogeneity of bovine lactotransferrin glycans the effects of differences in pspa alleles and capsular types on the resistance of streptococcus pneumoniae to killing by apolactoferrin bactericidal activity of human lactoferrin: differentiation from the stasis of iron deprivation in vivo and in vitro effects of lactoferrin on yersinia pseudotuberculosis antibacterial activity of lactoferrin and a pepsin-derived lactoferrin peptide fragment human hololactoferrin: endocytosis and use as an iron source by the parasite entamoeba histolytica iron-saturated lactoferrin and pathogenic protozoa: could this protein be an iron source for their parasitic style of life? ability of neisseria gonorrhoeae, neisseria meningitidis, and commensal neisseria species to obtain iron from lactoferrin the impact of lactoferrin with different levels of metal saturation on the intestinal epithelial barrier function and mucosal inflammation lactoferrin: mechanism of action, clinical significance and therapeutic relevance une protéine multifonctionnelle molecular structure and biological function elucidation of the antistaphylococcal action of lactoferrin and lysozyme in vivo antimicrobial and antiviral activity of components in bovine milk and colostrum involved in non-specific defence lactoferrin is a lipid a-binding protein lactoferrin inhibits the endotoxin interaction with cd by competition with the lipopolysaccharide-binding protein two outer membrane proteins are bovine lactoferrin-binding proteins in mannheimia haemolytica a in vitro studies of the digestion of caprine whey proteins by human gastric and duodenal juice and the effects on selected microorganisms antibacterial and antiviral activity of camel milk protective proteins comparison of the effects of acylation and amidation on the antimicrobial and antiviral properties of lactoferrin lactoferrin for prevention of common viral infections antiviral effects of plasma and milk proteins: lactoferrin shows potent activity against both human immunodeficiency virus and human cytomegalovirus replication in vitro effectiveness of human, camel, bovine and sheep lactoferrin on the hepatitis c virus cellular infectivity: comparison study lactoferrin: a protein of the innate immune system capable of killing parasitic protozoa twenty-five years of research on bovine lactoferrin applications microbicidal action of lactoferrin and lactoferricin and their synergistic effect with metronidazole in entamoeba histolytica effect of bovine lactoferrin in a therapeutic hamster model of hepatic amoebiasis bactericidal synergy of lysostaphin in combination with antimicrobial peptides synergy and antagonism between iron chelators and antifungal drugs in cryptococcus effector mechanisms of iga amoebicidal activity of milk, apo-lactoferrin, slga and lysozyme enhancement of the activity of novobiocin against escherichia coli by lactoferrin effect of bovine apo-lactoferrin on the growth and virulence of actinobacillus pleuropneumoniae antifungal activities of natural and synthetic iron chelators alone and in combination with azole and polyene antibiotics against aspergillus fumigatus gastric digestion of bovine lactoferrin in vivo in adults characterization of mammalian receptors for lactoferrin bioactive proteins/peptides and functional properties evaluation of synergistic activity of bovine lactoferricin with antibiotics in corneal infection effects of bovine lactoferrin hydrolysate on the in vitro antimicrobial susceptibility of escherichia coli strains isolated from baby pigs structural features governing the activity of lactoferricin-derived peptides that act in synergy with antibiotics against pseudomonas aeruginosa in vitro and in vivo bactericidal activity of lfchimera is stronger and less sensitive to ionic strength than its constituent lactoferricin and lactoferrampin peptides bactericidal effect of bovine lactoferrin, lfcin, lfampin and lfchimera on antibiotic-resistant staphylococcus aureus and escherichia coli microbicidal effect of the lactoferrin peptides lactoferricin - , lactoferrampin - , and lactoferrin chimera on the parasite entamoeba histolytica reduction of the infectivity of toxoplasma gondii and eimeria stiedai sporozoites by treatment with bovine lactoferricin parasiticidal effect of synthetic bovine lactoferrin peptides on the enteric parasite giardia intestinalis lactoferrin-derived peptides and lactoferricin chimera inhibit virulence factor production and biofilm formation in pseudomonas aeruginosa perspectives on interactions between lactoferrin and bacteria expression of cloned human lactoferrin in baby-hamster kidney cells research progress in physicochemical characteristics of lactoferrin and its recombinant expression systems expression, characterization, and biologic activity of recombinant human lactoferrin in rice recombinant human milk proteins plant-based biopharming of recombinant human lactoferrin supplementation transgenic cow's milk containing recombinant human lactoferrin enhances systematic and intestinal immune responses in piglets nutritional composition analysis of meat from human lactoferrin transgenic bulls mechanisms and pathways of innate immune activation and regulation in health and cancer innate immunity gone awry: linking microbial infections to chronic inflammation and cancer recognition of bacterial pathogens and mucosal immunity converging roles of caspases in inflammasome activation, cell death and innate immunity interactions of lactoferrin with cells involved in immune functionthis paper is one of a selection of papers published in this special issue bovine lactoferrin can be taken up by the human intestinal lactoferrin receptor and exert bioactivities the n domain of human lactoferrin is required for internalization by caco- cells and targeting to the nucleus mammalian lactoferrin receptors: structure and function lactoferrin protects rabbits from shigella flexneri-induced inflammatory enteritis effect of bovine lactoferrin in salmonella ser. typhimurium infection in mice lactoferrin downregulates pro-inflammatory cytokines upexpressed in intestinal epithelial cells infected with invasive or noninvasive escherichia coli strains lactoferrin prevents invasion and inflammatory response following e. coli strain lf infection in experimental model of crohn's disease. dig. liver dis lactoferrin differently modulates the inflammatory response in epithelial models mimicking human inflammatory and infectious diseases oral lactoferrin treatment resolves amoebic intracecal infection in c h/hej mice inhibition of helicobacter pylori infection by bovine milk glycoconjugates in a balb/ca mouse model effects of lactoferrin-containing formula in the prevention of enterovirus and rotavirus infection and impact on serum cytokine levels: a randomized trial protective effects of lactoferrin chimera and bovine lactoferrin in a mouse model of enterohaemorrhagic escherichia coli o :h infection protective effects of lactoferrin in escherichia coli-induced bacteremia in mice: relationship to reduced serum tnf α level and increased turnover of neutrophils enhanced clearance of escherichia coli and staphylococcus aureus in mice treated with cyclophosphamide and lactoferrin differential effects of prophylactic, concurrent and therapeutic lactoferrin treatment on lps-induced inflammatory responses in mice neutralization of endotoxin in vitro and in vivo by a human lactoferrin-derived peptide lactoferrin augments bcg vaccine efficacy to generate t helper response and subsequent protection against challenge with virulent mycobacterium tuberculosis lactoferrin enhanced efficacy of the bcg vaccine to generate host protective responses against challenge with virulent mycobacterium tuberculosis cho expressed recombinant human lactoferrin as an adjuvant for bcg influence of oral lactoferrin on mycobacterium tuberculosis induced immunopathology lactoferrin decreases inflammatory response by cystic fibrosis bronchial cells invaded with burkholderia cenocepacia iron-modulated biofilm lactoferrin protects against lipopolysaccharide-induced acute lung injury in mice lack of effect of bovine lactoferrin in respiratory syncytial virus replication and clinical disease severity in the mouse model lactoferrin reverses respiratory abnormalities in respiratory syncytial virus (rsv) infection of mice effects of orally administered bovine lactoferrin and lactoperoxidase on influenza virus infection in mice effects of bovine lactoferrin by the intramammary infusion in cows with staphylococcal mastitis during the early non-lactating period effect of combination therapy with lactoferrin and antibiotics against staphylococcal mastitis on drying cows small molecule lactoferrin with an inflammatory effect but no apparent antibacterial activity in mastitic mammary gland secretion inflammatory effect of cleaved bovine lactoferrin by elastase on staphylococcal mastitis effect of orally administered bovine lactoferrin on the immune response in the oral candidiasis murine model potential antimicrobial effects of human lactoferrin against oral infection with listeria monocytogenes in mice human lactoferrin and peptides derived from a surface-exposed helical region reduce experimental escherichia coli urinary tract infection in mice enhanced th response to staphylococcus aureus infection in human lactoferrin-transgenic mice intestinal inflammation and colorectal cancer: a double-edged sword? ability of lactoferrin to promote the growth of bifidobacterium spp. in vitro is independent of receptor binding capacity and iron saturation level effect of lactoferrin on helicobacter felis induced gastritis lactoferrin and desferrioxamine are ineffective in the treatment of helicobacter pylori infection and may enhance h. pylori growth and gastric inflammation in mice human recombinant lactoferrin is ineffective in the treatment of human helicobacter pylori infection recombinant human lactoferrin enhances the efficacy of triple therapy in mice infected with helicobacter pylori multi-faceted functions of secretory iga at mucosal surfaces. front. immunol. , , lactoferrin increases both resistance to salmonella typhimurium infection and the production of antibodies in mice characterization of adherent-invasive escherichia coli isolated from pediatric patients with inflammatory bowel disease protection against murine intestinal amoebiasis induced by oral immunization with the kda antigen of entamoeba histolytica and cholera toxin transcriptional regulation of the mucosal iga system cytokines in sepsis: potent immunoregulators and potential therapeutic targets-an updated view lactoferrin inhibits enterovirus infection by binding to vp protein and host cells inhibitory effects of human and bovine milk constituents on rotavirus infections supplementing suckling rats with whey protein concentrate modulates the immune response and ameliorates rat rotavirus-induced diarrhea sepsis: current dogma and new perspectives the blessings and curses of intestinal inflammation lactoferrin protects neonatal rats from gut-related systemic infection lactoferrin can protect mice against a lethal dose of escherichia coli in experimental infection in vivo antibacterial system generated by lactoferrin in mice in vivo is primarily a killing system oral lactoferrin to prevent nosocomial sepsis and necrotizing enterocolitis of premature neonates and effect on t-regulatory cells lactoferrin-lipopolysaccharide (lps) binding as key to antibacterial and antiendotoxic effects reciprocal interactions between lactoferrin and bacterial endotoxins and their role in the regulation of the immune response bovine lactoferrin protects lipopolysaccharide-induced diarrhea modulating nitric oxide and prostaglandin e in mice. can bovine lactoferrin ingestion protects against inflammation via il- induction in the small intestine of mice with hepatitis treatment of enterogenic endotoxinemia with lactoferrin in rats lactoferrin protects gut mucosal integrity during endotoxemia induced by lipopolysaccharide in mice porcine lactoferrin-derived peptide lfp- protects intestinal barrier by maintaining tight junction complex and modulating inflammatory response lfp- , a porcine lactoferrin peptide, ameliorates lps-induced inflammation via the myd /nf-κb and myd /mapk signaling pathways protective effects of lactoferrin against intestinal mucosal damage induced by lipopolysaccharide in human intestinal caco- cells in vivo effects of bifidobacteria and lactoferrin on gut endotoxin concentration and mucosal immunity in balb/c mice the protective effects of lactoferrin feeding against endotoxin lethal shock in germfree piglets gastrointestinal and hepatic mechanisms limiting entry and dissemination of lipopolysaccharide into the systemic circulation variations in susceptibility to proteoglycan-induced arthritis and spondylitis among c h substrains of mice: evidence of genetically acquired resistance to autoimmune disease lethality in lps-induced endotoxemia in c h/hecr mice is associated with prevalence of proinflammatory cytokines: lack of protective action of lactoferrin bovine lactoferrin induces interleukin- production in a hepatitis mouse model and human intestinal myofibroblasts lactoferrin protects against development of hepatitis caused by sensitization of kupffer cells by lipopolysaccharide lactoferrin prevents lps-induced decrease of the iron exporter ferroportin in human monocytes/macrophages bovine lactoferrin counteracts toll-like receptor mediated activation signals in antigen presenting cells lactoferrin works as a new lps-binding protein in inflammatory activation of macrophages lactoferrin activates macrophages via tlr -dependent and -independent signaling pathways mattsby-baltzer, i. lactoferrin down-regulates the lps-induced cytokine production in monocytic cells via nf-κb respiratory epithelial cells orchestrate pulmonary innate immunity infecciones respiratorias. in temas de bacteriología y virología médica; oficina del libro fefmur the inflammatory response triggered by influenza virus: a two edged sword the effects of corticosteroid on tissue lactoferrin in patients with nasal polyposis global epidemiology of tuberculosis bcg-different strains, different vaccines? influence of bovine lactoferrin on expression of presentation molecules on bcg-infected bone marrow derived macrophages a novel recombinant human lactoferrin augments the bcg vaccine and protects alveolar integrity upon infection with mycobacterium tuberculosis in mice loss of microbicidal activity and increased formation of biofilm due to decreased lactoferrin activity in patients with cystic fibrosis transferrin and lactoferrin undergo proteolytic cleavage in the pseudomonas aeruginosa-infected lungs of patients with cystic fibrosis effect of compounds with antibacterial activities in human milk on respiratory syncytial virus and cytomegalovirus in vitro lactoferrin and surfactant protein a exhibit distinct binding specificity to f protein and differently modulate respiratory syncytial virus infection immune modulation by lactoferrin and curcumin in children with recurrent respiratory infections effect of bovine lactoferrin from iron-fortified formulas on diarrhea and respiratory tract infections of weaned infants in a randomized controlled trial reduced levels of lactoferrin in biofilm-associated chronic rhinosinusitis cleaved inflammatory lactoferrin peptides in parotid saliva of periodontitis patients a novel bovine lactoferrin peptide, fkcrrwqwrm, suppresses candida cell growth and activates neutrophils apoptotic death of listeria monocytogenes-infected human macrophages induced by lactoferricin b, a bovine lactoferrin-derived peptide lactoferrin inhibits or promotes legionella pneumophila intracellular multiplication in nonactivated and interferon γ-activated human monocytes depending upon its degree of iron saturation. iron-lactoferrin and nonphysiologic iron chelates reverse mon biological activity of lactoferrin-functionalized biomimetic hydroxyapatite nanocrystals anti-inflammatory mechanisms of bioactive milk proteins in the intestine of newborns key: cord- -leu hygk authors: gallagher, j.; watson, c.; ledwidge, m. title: association of bacille calmette-guerin (bcg), adult pneumococcal and adult seasonal influenza vaccines with covid- adjusted mortality rates in level european countries date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: leu hygk introduction non-specific effects of vaccines have gained increasing interest during the covid- pandemic. in particular, population use of bcg vaccine has been associated with improved outcomes. this study sought to determine the association of population use of bcg, adult pneumococcal and adult seasonal influenza vaccination with covid- mortality when adjusted for a number of confounding variables. methods: using publicly available data, mortality adjusted for the timeframe of crisis, population size and population characteristics was calculated. the primary analysis was the relationship between each of the day and day standardised mortality rates and bcg, adult pneumococcal and influenza vaccination scores using unadjusted measures and with adjustment for population structure and case fatality rates. secondary analyses were measures of case increases and mortality increases from day to day for each of the relative vaccination scores. finally, we also analysed the peak z score reflecting increases in total mortality from historical averages reported by euromomo (euromomo.eu), results: following adjustment for the effects of population size, median age, population density, the proportion of population living in an urban setting, life-expectancy, the elderly dependency ratio (or proportion over years), net migration, days from day to lockdown and case-fatality rate, only bcg vaccination score remained significantly associated with covid- mortality at day . in the best fit model, bcg vaccination score was associated with a % reduction in log( ) mortality per million population (or . reduction [ % ci . to . ]), following adjustment for population size, median age, density, urbanization, elderly dependency ratio, days to lockdown, yearly migration and case fatality rate. conclusion bcg vaccine was associated with reduced mortality rates in level countries while adult pneumococcal and adult seasonal influenza vaccines were not when adjusted for a number of confounding variables. a number of trials are ongoing to determine if bcg is protective against severe covid- infection. using publicly available mortality data from the john's hopkins coronavirus research centre and demographic information presented on worldometers.info, we constructed curves of cumulative mortality adjusted for timeframe of crisis and population size, as previously described in a rapid response to an editorial on sars-cov- testing and comparative international mortality rates [ a] . in order to standardise the timeframe, we designated the baseline (day ) as the day that mortality rates exceeded per million population. we calculated the day and day mortality rate per million population for each of the following level european countries austria, belgium, czechia, denmark, estonia, finland, france, germany, greece, hungary, iceland, ireland, italy, lithuania, luxembourg, netherlands, norway, poland, portugal, slovakia, slovenia, spain, sweden, switzerland, united kingdom. we also obtained recent data on population structure including population size, the median age (years), population density (persons/km ), the proportion of population living in an urban setting, life-expectancy (years), the elderly dependency ratio (proportion of people over years divided by the proportion aged - ) and net migration (expressed per million population). in multivariable modelling we also included the case fatality rate on day to account for differences in testing rates, testing strategy and case definition as well as the relative number of days between baseline (day ) and lockdown. in order to standardise the estimation of the proportion of the population covered with bcg vaccination, we generated a bcg vaccination score by dividing the median life expectancy by the total number of years that bcg vaccination was available and recommended for all children. we adjusted this calculation by multiplying with a measure of vaccination programme efficacy, using the most recent vaccination coverage rate for either bcg or universal childhood vaccination rates as appropriate. in the case of two countries that do not routinely recommend bcg vaccination and where few details were available (iceland, luxembourg) we used referenced estimates of the total population covered by bcg vaccination. similarly, for pneumococcal vaccination, we generated a pneumococcal vaccination score by estimating the proportion of older people covered by pneumococcal vaccination over the past decade using a variety of referenced sources in circumstances where uptake is considered relatively low in most european countries, despite recommendations for their use in over s and vulnerable populations. finally, we created an influenza vaccination score as the proportion of older adults with seasonal influenza vaccination from most recent sources provided by the european centre for disease control and other referenced reports. the primary analysis of our report was the relationship between each of the day and day standardised mortality rates and bcg, pneumococcal and influenza vaccination scores using unadjusted measures and with adjustment for population structure and case fatality rates. secondary analyses were measures of case increases and mortality increases from day to day for each of the relative vaccination scores. finally, we also analysed the peak z score reflecting increases in total mortality from historical averages reported by euromomo (euromomo.eu), a european mortality monitoring activity, aiming to detect and measure excess deaths related to seasonal influenza, pandemics and other public health threats, supported by the european centre for disease prevention and control (ecdc) and the world health organization (who). primary and secondary outcomes were analysed using generalized linear modeling with a poisson outcome distribution for adjusted mortality rates. analyses were performed both with and without adjustment for the effects of population size, the median age, population density, the proportion of population living in an urban setting, life-expectancy, the elderly dependency ratio (or proportion over years), net migration, days from day to lockdown and case-fatality rate. variables such as day and day mortality rates, case fatality rates, population size, population density and life expectancy, were not normally distributed across the countries and were log-transformed before inclusion in the generalized linear model. nominal statistical significance was set at p< . with bonferroni correction for the pairwise correlations involved in the primary analyses (three vaccination scores linked to day mortality rates), meaning a p value of . / = . was considered statistically significant. descriptive data are presented as either mean ± sd or median ( th: th percentile) for normally and non-normally distributed continuous variables, respectively. frequencies and percentages (in parentheses) summarize categorical variables. graphs were presented using graphpad prism v and statistical analysis was performed using the r statistical software package (version . . , - - , copyright the r foundation). the population structure of the countries are presented in table . the date of exceeding sars-cov- death per million population, date of lockdown and cases, deaths and case fatality rates (cfr) on days and are presented in table . . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . the unadjusted linear regression between log of deaths per million on day versus bcg, pneumococcal and influenza vaccination scores are presented in figure a -c. following adjustment for the effects of population size, median age, population density, the proportion of population living in an urban setting, life-expectancy, the elderly dependency ratio (or proportion over years), net migration, days from day to lockdown and case-fatality rate, bcg vaccination score remained significantly associated with covid mortality at day . in the best fit model, bcg vaccination score was associated with a % reduction in log ( ) similarly, as shown in figure a . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . studies suggesting that countries providing universal bcg vaccine coverage have decreased mortality with covid ( - ) have been the source of wide media interest. however, there have been significant concerns about confounding factors and the lack of randomised controlled data to determine if there is a true causation between bcg vaccination and reduced mortality with covid ( ). while this ecological study may be the first to evaluate bcg vaccination in models with standardisation of mortality rates for timeframe of the outbreak as well as population size, as well as incorporating extensive covariate adjustment related to population structure, the major limitation is that it demonstrates correlation but cannot definitively assign causation. there may be many other confounding variables, which could account for the relationship between bcg vaccination and mortality. furthermore, it is well accepted that differences in recording mortality between countries have been reported which may affect numbers. finally, the bcg vaccination score is an estimate of the population coverage with bcg and may not accurately reflect the true population vaccination. conversely, the extensive covariate adjustment as well as differential relationship between bcg and influenza/pneumococcal vaccination scores, may support the hypothesis that bcg vaccination is associated with protection from the severest consequences of covid . there is a persistent relationship between bcg vaccination and a variety of mortality and morbidity measures, including peak standardised z-scores reported for the pandemic. the present study builds on a growing body of evidence that bcg vaccination may be associated with decreased illness severity unrelated to mycobacterium infection. many have been epidemiological studies looking at overall mortality rates . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint but others have looked at specific unrelated causes such as parasites ( ) , fungi ( ) and bacteria ( ) in humans and animals. a recent systematic review concluded that there is evidence with low to moderate risk of bias that bcg vaccination prevents respiratory infections (pneumonia and influenza) in children and the elderly( ) a number of trials are ongoing at present to elucidate the role of bcg in preventing severe covid with three reported in clinicaltrials.gov ( ) ( ) ( ) . to date, the nature of non-specific effects with bcg has not been fully elucidated, yet there are a number of possible mechanisms of causation to explain the correlations described in our study. vaccines with non-specific effects would induce reprogramming of the innate immune responses, a mechanism that clearly differs from the adaptive immunity induced by the antigen-specific responses to the vaccine. also, since bcg is generally administered to children, any putative innate immune cell "priming" following bcg would, necessarily, be retained many years following vaccination, suggesting an epigenetic link. interestingly, bcg vaccination has been shown to cause epigenetic changes in innate immune cells via histone- -lysine- (h k ) methylation [ ] , which can can augment human ifn and isg responses to non-mycobacterium and even fungal infections. therefore, the bcg "primed" innate immune system could counter the sars-like coronavirus early ifn and isg suppression, providing a more robust initial innate immune response to limit replication of sars-cov- virus. [ ] interestingly the search for a vaccine to manage the sars-cov- pandemic is a global healthcare priority because of high transmissibility and covid mortality rates. however, following a small, non-human primate . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted june , . . study of the oxford rna vaccine, the world's largest producer of vaccines is in negotiation to dedicate its production capacity to this developmental vaccine for sars-cov- . [ , ] however, this could limit normal childhood vaccination programmes despite risks of using novel technology platforms to treat the novel sars-cov- virus. while we await the results of prospective, randomised, controlled clinical studies on novel vaccines specific for sars-cov- , recent clinical progress with known drugs such as remdesivir highlight the potential of repurposing known therapies to combat covid- ( ) . the present study suggests that ongoing, prospective clinical studies to determine if bcg vaccination reduces the severity of covid- in vulnerable patients could provide important information on the potential for innate immune priming with bcg as an adjunct to other clinical strategies for protection against the worst consequences of sars-cov . the association of bcg and reduced mortality from covid- was seen even after standardising mortality between level european countries and adjusting for confounding variables relating to population structure. a similar association was not seen with adult influenza and pneumococcal vaccination. the results of prospective clinical studies on bcg vaccination as an adjunct to usual care in the setting of covid- are awaited. abbreviations: bcg bacille calmette-guérin vaccination coverate rate pneumococcal vaccination; influenza, influenza; uk united kingdom using dpt / as proxy for national childhood vcr; no data available, replaced with average of reported data for countries vaccine coverage of pre-school age children in france in bcg vaccination reported mandatory from to referencing "tuberkulosevaksinasjon -veileder for helsepersonell european centre for disease prevention and control. seasonal influenza vaccination and antiviral use in eu/eea member states -overview of vaccine recommendations for - and vaccination coverage rates for - and - influenza seasons the effect of oral polio vaccine at birth on infant mortality: a randomized trial non-specific effects of standard measles vaccine at . and months of age on childhood mortality: randomised controlled trial heterologous) protection of neonatal bcg vaccination against hospitalization due to respiratory infection and sepsis non-specific effect of vaccines: immediate protection against respiratory syncytial virus infection by a live attenuated influenza vaccine the vaccine trialist group. a role for streptococcus pneumoniae in virusassociated pneumonia correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study connecting bcg vaccination and covid- : additional data association of bcg vaccination policy with prevalence and mortality of covid- differential covid- -attributable mortality and bcg vaccine use in countries bacille calmette-guérin (bcg) vaccination and covid- scientific brief bcg vaccination is associated with reduced malaria prevalence in children under the age of years in sub-saharan africa the role of bcg/ppd-activated macrophages in resistance against systemic candidiasis in mice bacille calmette-guerin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes does bcg vaccination protect against acute respiratory infections and covid ? a rapid review of current evidence does bcg vaccination protect against acute respiratory infections and covid- ? a rapid review of current evidence reducing health care workers absenteeism in covid- pandemic through bcg vaccine (bcg-corona) bcg vaccination to protect healthcare workers against covid- (brace) bcg vaccine for health care workers as defense against covid (badas) remdesivir for the treatment of covid- -preliminary report no funding was received for this study key: cord- -li b e authors: dolgikh, s. title: covid- epidemiological factor analysis: identifying principal factors with machine learning date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: li b e based on a subset of covid- wave cases at a time point near tz+ m (april, ), we perform an analysis of the influencing factors for the epidemics impacts with several different statistical methods. the consistent conclusion of the analysis with the available data is that apart from the policy and management quality, being the dominant factor, the most influential factors among the considered were current or recent universal bcg immunization and the prevalence of smoking. a possible link between the effects of covid- pandemics such as the rate of spread and the severity of cases; and a universal immunization program against tuberculosis with bcg vaccine (uip, hereinafter) was suggested in [ ] and further investigated in [ ] . here we provide a factor analysis based on the available data for the first group of countries that encountered the epidemics (wave ) by applying several commonly used factor-ranking methods. the intent of the work is to repeat similar analysis at several different points in the time series of cases that would allow to make a confident conclusion about the epidemiological and social factors with strong influence on the course of the epidemics. the zero time of the start of the global covid- pandemics was defined in [ ] as: = . . a number of known factors are expected to have strong influence on the course of the epidemics in the national jurisdictions was identified as: the time of the introduction; demographics; social, tradition, lifestyle; the level of economic and social development; the quality and efficiency of the healthcare system and the quality of policy making and execution. the purpose of the analysis is to develop and verify the methods that would allow to identify the main factors, different and in addition to the known ones, that have significant influence on the course and the impact of the epidemics based on the available data. in the first iteration of the analysis we will use only the cases of the first wave that had sufficient time to develop; of those was selected a subset of cases satisfying these conditions: ) the countries in the set are of a similar development level, thus excluding the influence of the level of prosperity and development; and ) certain level of confidence can be expected from the published data. this selection resulted in the list of cases (table ) , including one provincial jurisdiction in canada (ontario) and a city in the usa (new york city). the time point at which the data was collected was . . i.e. approximately tz + m i.e. approximately months of development for the wave group of countries. the selection eliminated or significantly reduced the influence of several of the known factors mentioned above, namely: the time of arrival, the level of prosperity and development, and to a considerable degree, demographics (although one related factor, the median age was used in the analysis). there was no easy way to eliminate the influence of the policy and quality of execution of epidemics management that in its turn includes a number of factors such as: general epidemics preparedness, effective deployment and management plans, sufficient resources, informed and trained personnel and so on; so it is assumed to be controlled by the policy factor that was assigned manually based on available information. an essential caveat here is that such an assignment would likely itself imply some level of correlation with the observed outcomes, however at the short time of preparation of this analysis it was the best option available. further studies will be able to produce more objective policy evaluation criteria and methods. . consistency and reliability of data reported by the national, regional and local health administrations. . alignment in the time of reporting may be an issue due to reporting practices of jurisdictions. in addition to already mentioned policy, the factors considered in this analysis were the following: bcg immunization level: defined in the range - . , with representing band a [ ] (i.e. a current universal bcg immunization program) and . no uip (band c). the values in between were assigned in proportion to the time lag between the cessation of uip and the tz. also, some corrections were made for the cases where immunization was administered at an older age or only within a single age cohort i.e. a time span of around years. . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint smoking prevalence: in the range - . , defined as the rate of smoking in percent in the population. where a significant gender difference existed in the population with respect to this factor, the higher value was taken as it's expected to have a greater influence on the outcome. population density: the total population / sq.km, divided by ; we recognize that in some cases such with very large area averaging population over the area may lead to less consistent results; a more detailed analysis with more precisely defined geographic boundaries of the cases is intended for a future study. age demographics: median age, divided by . we used several statistical methods in the factor influence analysis to evaluate the consistency of the obtained conclusions. . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . the following methods were used in the analysis: . calculation of correlation between the resulting effect (mv) and the factor . linear regression by one and multiple factors, with evaluation of error . evaluation of feature influence with random forest regression [ ] . evaluation of feature importance with selectkbest, a feature ranking method, in sklearn python library [ ] . method calculates the correlation coefficient between the outcome (mv) and the factor in consideration. an absolute value closer to indicates stronger correlation between the resulting effect and the factor. method produces the best fit linear approximation of the resulting effect series with a total deviation (error) from the trend. comparing the error for different combinations of factors can show which of the factors are most effective in modeling the resulting effect. methods and provide a ranking of features with the highest influence on the resulting effect. in this section the results are presented for single and multi-factor influence analysis as well as a brief discussion of the obtained results. in table presented correlation and single factor evaluation and ranking results: as can be seen, all methods yielded consistent results with the same rating of the evaluated factors. apart from the policy factor for which as already discussed, a strong correlation can be expected, the strongest influence factor for this dataset were the bcg . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint immunization, with a strong positive correlation value of . and the smoking prevalence, . . the latter can be expected to be a factor of significance in the epidemics due to already established link with a number of conditions, including respiratory [ ] ; as a standalone factor it did not show a strong correlation with the outcome, however it can have some influence as a secondary factor as discussed in section . . one could have expected a stronger negative correlation for the age demographics, however the result can be explained by a competition of factors of higher susceptibility of the older population group supporting the positive correlation, vs. higher social contact of the younger one stimulating the spread of the infection and thus, acting in the opposite direction and resulting in a lower than expected overall correlation. in this section we evaluated the effects of the combination of factors with the highest significance: policy, bcg exposure and smoking with the linear regression method. the combination of factors was calculated as a sum of factor values (in the cases with very low population density, a correction was added to account for a slower rate of spread as follows: canada, australia: . ; finland, ontario, usa: . ; adding the correction does not change the outcome of the analysis essentially). the results are presented in table . as can be see seen, the combination of three factors: policy, bcg immunization and smoking has the highest correlation and the lowest linear regression error for the resulting effect. the results also confirm bcg exposure as the second most influential factor among the considered. indeed, the highest drop in the correlation after removing a factor from the sum is seen for the policy ( . %) and the lowest, smoking ( . %). removing bcg factor results in a reduction of . %. figure shows . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint several outlier cases with a higher than the trend impact clearly seen in the plot on the right can be analyzed in more depth in a future study. interesting observations on the influence of smoking can be derived from a number of specific cases on the role of smoking as a secondary factor in the impact of covid- . while may not be sufficient for a statistically confident conclusion, it can provide some directions and rationale for further studies. all countries in this group have similar values of most known factors, including the alignment in time of the onset, the policy and bcg immunization levels (all countries are in group a). the results clearly show that countries with higher smoking prevalence: south korea and japan have high impact of the epidemics than those with lower rates (taiwan, singapore). granted, statistical fluctuations are likely in such a data and a confident conclusion can be reached after tracking this trend over a period of time. a similar pattern can be seen with wave countries in south america. neighboring countries, with similar known factors such as: ecuador -peru, chile -argentina but with significantly different smoking rates also show significant difference in covid- impact. the analysis of influencing factors and observations obtained on its basis can be useful in understanding the causes impacting the development of the epidemics and possibly developing effective responses and policies on its basis. these early results offer more arguments in support of the hypothesis of some form of bcg immunization protection effect against covid- , providing a rationale for further studies of the possible link. we also report the significance of smoking as a secondary factor, consistently confirmed by several methods used in the analysis. . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint the reported results should not be taken as the definitive statement of a dependence between the investigated factors and the resulting effect, but rather as a demonstration of an approach and methods that over a time would allow to reach a confident conclusion. correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study further evidence of a possible correlation between the severity of covid- and bcg immunization the bcg world atlas: a database of global bcg vaccination policies and practices plos medicine • canada covid- situation update nyc covid- updates cdc covid- advice nhs covid- advice randomforestregressor.html?highlight=random% forest#sklearn.ensemble.randomforestregressor . selectkbest feature ranking and selection key: cord- -b s stvz authors: guimarães, luísa eça; baker, britain; perricone, carlo; shoenfeld, yehuda title: vaccines, adjuvants and autoimmunity date: - - journal: pharmacological research doi: . /j.phrs. . . sha: doc_id: cord_uid: b s stvz abstract vaccines and autoimmunity are linked fields. vaccine efficacy is based on whether host immune response against an antigen can elicit a memory t-cell response over time. although the described side effects thus far have been mostly transient and acute, vaccines are able to elicit the immune system towards an autoimmune reaction. the diagnosis of a definite autoimmune disease and the occurrence of fatal outcome post-vaccination have been less frequently reported. since vaccines are given to previously healthy hosts, who may have never developed the disease had they not been immunized, adverse events should be carefully accessed and evaluated even if they represent a limited number of occurrences. in this review of the literature, there is evidence of vaccine-induced autoimmunity and adjuvant-induced autoimmunity in both experimental models as well as human patients. adjuvants and infectious agents may exert their immune-enhancing effects through various functional activities, encompassed by the adjuvant effect. these mechanisms are shared by different conditions triggered by adjuvants leading to the autoimmune/inflammatory syndrome induced by adjuvants (asia syndrome). in conclusion, there are several case reports of autoimmune diseases following vaccines, however, due to the limited number of cases, the different classifications of symptoms and the long latency period of the diseases, every attempt for an epidemiological study has so far failed to deliver a connection. despite this, efforts to unveil the connection between the triggering of the immune system by adjuvants and the development of autoimmune conditions should be undertaken. vaccinomics is a field that may bring to light novel customized, personalized treatment approaches in the future. vaccines have been a preventive treatment option available for over years. they have been proven to be effective in preventing infections that previously had high morbidity and mortality. an example of this is the eradication of small pox, which was mainly attributed to successful vaccination programs. preventing a high burden disease has since proven to be a cost effective measure and, as such, vaccines have become a part of multiple national health programs. these promising results led to the development of more and more vaccines and to the study of its applicability in other fields such as cancer prevention and treatment. vaccines are drugs administered to healthy individuals, and much like other drugs, vaccines are associated with adverse events. usually the described adverse events are transient and acute, but may rarely present with hypersensitivity and induction of autoimmunity that may be severe and fatal. these adverse events play an important role in the life of the vaccinated patients. immune mediated diseases arise from various different sources; these include environmental, genetic, hormonal and immune defects. the combination of these defects can be described as the mosaic of autoimmunity [ ] . patient background can be used as a clue to determine the response that may be elicited following drug administration. it has been proven that infectious agents may elicit an autoimmune disease in a prone subject through various mechanisms, including, but not limited to, molecular mimicry, epitope spreading and polyclonal activation [ ] . scientific findings suggest that autoimmunity may be triggered by vaccine adjuvants, of which aluminum compounds (aluminum hydroxide and phosphate) have been the most studied and the most widely used. adjuvants are molecules, which, in combination with antigens, enhance immunological response. this enables an easier and more effective recognition of "non self", which in turn permits the triggering of adaptive and innate immune responses [ ] . recently a new syndrome was described: "autoimmune/inflammatory syndrome induced by adjuvants" (asia). this embodies a spectrum of reactions, which are usually mild but may also be severe. these reactions are attributed to adjuvant stimulation, which can include chronic exposure to silicone, tetramethylpentadecane, pristane, aluminum, infectious components and other adjuvants. all of these environmental factors have been found to induce autoimmunity and inflammatory manifestations by themselves both in animal models and in humans. the mechanisms of this disease will be described in further detail [ ] . this review will focus on general mechanism of vaccines, adjuvant-induced autoimmunity, and on vaccines and the specific autoimmune diseases that they may trigger. adjuvants approved to date for human vaccines are: aluminum, mf in some viral vaccines, mpl, as , as b and as a against viral and parasitic infections, virosomes for hepatitis b virus (hbv), human papilloma virus (hpv), hepatitis a virus (hav), and cholera toxin for cholera. adjuvants may be composed of several different compounds. currently, oil based adjuvants, virosomes, toll-like receptors (tlrs) related adjuvants, mpl, adjuvants made of unmethylated cpg dinucleotides and tuftsin have all been described. it is of great interest the understanding of the mechanisms related to the adjuvant effect, as well as to aluminum salts. aluminum acts through multiple pathways, which do not depend solely on tlrs signaling. each of these pathways leads to an enhanced host immune response [ ] . there are many oil based adjuvants. one is incomplete freund adjuvant (ifa), which contains water in oil emulsion. another is complete freund adjuvant (cfa), which is the same as ifa, except that it also contains killed mycobacteria in addition to water in oil emulsion. usually, cfa is used for primary vaccination and ifa for boosting. recent oil based adjuvants that have been developed are mf (novartis ® ), as (glaxosmithkline ® ), advax tm which are based on inulin compounds (vaxine tm pty) and qs- /iscoms, which are immune stimulating complexes composed of cholesterol and phospholipid with or without antigen (table ) . virosomes are adjuvants that contain a membrane-bound hemagglutinin and neuraminidase obtained from the influenza virus. both components facilitate the uptake into antigen presenting cells (apc) and mimic the natural immune response [ ] . leucocyte membranes have membrane bound pattern recognition receptors (prrs) called tlrs, which are responsible for detecting most (although certainly not all) antigen-mediated infections. their activation leads to adaptive immune responses. for this reason, many adjuvants that are used today are directed to prrs. these adjuvants are called tlrs related adjuvants [ ] . mpl is a series of 'monophosphoryl lipid a obtained from the purification of a modified lipopolysaccharide (lps) of salmonella minnesota. bacterial deoxyribonucleic acid (dna) is immunostimulatory due to unmethylated cpg dinucleotides. vertebrate dna has relatively low amounts of unmethylated cpg compared to bacterial dna. the adjuvant effect of cpg is enhanced when conjugated to protein antigens. this adjuvant is being tested in vaccines directed at infectious agents, allergens and tumor cells [ ] [ ] [ ] . another type of adjuvant is tuftsin. tuftsin is an auto adjuvant, which is a natural self-immunostimulating tetrapeptide (thr-lys-pro-arg). this tetrapeptide is a fraction of the igg heavy chain molecule produced by enzymatic cleavage in the spleen [ ] . its functions include: binding to receptors on neutrophils and macrophages to stimulate their phagocytic activity, increasing tumor necrosis factor alpha (tnf␣) release from human kupffer cells enhancing secretion of il by activating macrophages, activation of macrophages expressing nitric oxide (no) synthase to produce no and enhancement of murine natural cell mediated cytotoxicity in vitro [ ] [ ] [ ] . in summary, it is an adjuvant with minor side effects with a promising effect in restoring innate immune mediated response. adjuvants may exert their immune enhancing effects according to five immune functional activities: . translocation of antigens to the lymph nodes where they can be recognized by t cells. . antigen protection enabling longer exposure. . enhanced local reaction at the injection site. . induction of the release of inflammatory cytokines. . interaction with prrs, specifically tlrs [ ] . a adjuvant effect the term "adjuvant effect" refers to the co-administration of an antigen with a microbial specific factor to enhance an antigenspecific immune response in vivo. the microbial components of adjuvants activate apcs to produce pro-inflammatory cytokines ("non-specific" signal ) and to up-regulate molecules essential for antigen presentation. these molecules include major histocompatibility complex (mhc) class ii (antigen-specific signal ) and b - / . these innate immune events allow a more effective presentation to the adaptive immune system, resulting in an augmented activation and clonal expansion of t cells [ ] . in accordance to this effect, if self-antigens are used, an autoimmune response can be elicited [ ] . it has been shown that auto-reactive t-cells that surpass tolerance mechanisms can be triggered by exogenous adjuvants to become auto-aggressive [ ] . infectious agents are able to naturally generate their adjuvant effect and can induce autoimmunity [ ] . an example of this is the causality between viral infection and myocarditis. half the cases of myocarditis are preceded by an acute viral infection. infectious myocarditis in humans can be reproduced in experimental murine models of myocarditis [ ] . it has also been shown that the autoimmune reaction elicited by an infectious agent can be effective in treating cancer. an example of this is that bladder administration of bcg (bacille calmette-guérin) has been shown to be effective against superficial bladder cancer development [ ] . it can be inferred that the adjuvant effect can be used against specific tumor derived molecules, so that these molecules can be recognized as "non self". prr-pamp (pattern recognition receptor-pathogen-associated molecular patterns) interactions activate the apcs to promote antigen-specific lymphocytic responses [ ] . the definition of pamps has now broadened, in that the recognized structures do not need to be pathogens. thus the concept of "microbe-associated molecular patterns" (mamps) and of "danger/damage-associated molecular patterns" (damps) were defined based on the notion that the endogenous host molecules signal danger or damage to the immune system [ ] . tlrs are single-transmembrane prrs localized on cell surface and endosomal membranes. from all the prrs, these are the most studied. tlrs play a crucial role in innate immune response to "non self" and are biosensors of tissue damage. the interaction between the four known tlrs adapters: myd , tirap/mal, tram and trif, in tlr signaling, shape the innate immune response. besides prrs the innate immune system also detects proteolytic enzymes generated during infection [ ] . merging the response to different prrs signaling may be the pathway for developing customized responses to different aggressions [ ] . b experimental models of adjuvants many animals have been used in experimental models of adjuvant-related autoimmune conditions [ ] . these include primates, salmons, rabbits and swine; however, the most common are murine models. murine models include autoimmune prone strains, models of autoimmune disease and autoimmune resistant strains ( table ). an interesting model is that described by lujan et al. the authors described that a commercial sheep, inoculated repetitively with aluminum-containing adjuvants vaccinations, developed an acute neurological episode with low response to external stimuli and acute meningoencephalitis few days after immunization. an excitatory phase, followed by weakness, extreme cachexia, tetraplegia and death appeared. this was suggested to be part of the spectrum of asia syndrome. moreover, the biopsy of the nervous tissue of experimental animals indicated the presence of alum [ ] . c toxicity of aluminum adjuvants aluminum nanoparticles have both a unique capacity of surpassing the blood brain barrier (bbb) and of eliciting immune inflammatory responses. these are probably the reasons why aluminums' most sensitive target is the brain, and also why documented side effects are mostly neurologic or neuropsychiatric [ , ] . aluminum is present in nature, not only as a vaccine adjuvant, but also in food, water and cosmetics. it has been described as a neurotoxin because even when a relatively small amount of aluminium reaches the brain [ ] , is can act as a genotoxin [ ] , a prooxidant [ ] , it can be proinflammatory [ ] , act as an immunotoxin [ ] and also as an endocrine disruptor [ ] . aluminum interferes with many essential cellular processes. memory, concentration, speech deficits, impaired psychomotor control, reduced seizure tolerance and altered behaviour are manifestations of aluminium neurotoxicity. moreover, alzheimer's [ ] , amyotrophic lateral sclerosis, parkinsonism dementia [ ] , multiple sclerosis [ ] , and neurological impairments in children have been linked to aluminum neurotoxicity [ ] . brain susceptibility to aluminum compounds is possibly due to the brain's high metabolic requirement, to the fact that it possesses a large area of biological membranes and to the relatively low concentration of antioxidants [ ] . aluminum adjuvants exert their immunostimulatory effect through many different pathways that activate both the innate and adaptive immune systems. one of the most significant is the activation of the nlrp inflammasome pathway [ ] . nlpr activation has been shown to trigger type diabetes. by using nlpr knockout mice it has been demonstrated that the absence of inflammasome components leads to a better maintenance of glucose homeostasis and higher insulin sensitivity [ ] . on the other hand, activation of the inflammasome and its downstream components: pro-inflammatory cytokines il- ␤ and il- are strongly implicated in the development of several central nervous system (cns) disorders [ ] . the vast majority of people are consuming higher amounts of aluminum through dietary and parenteral intake than what expert authorities consider safe. upper limits set by us food and drug administrations (fda) for aluminum in vaccines are set at no more than g/dose. these values were not based on toxicity studies, but on the minimum amount needed for aluminum to exert its effect as an adjuvant [ ] . the quantities of aluminum to which infants, in their first year of age are exposed, have been considered safe by the fda. however the scientific basis for this recommendation does not take into account aluminum persistence in the body. the concern about aluminum in dietary intake has been reinforced by the food and agriculture (fao) who expert committee, which lowered the provisional tolerable weekly intake of aluminum from mg/kg/bw ( mg/week, for an average kg human) to mg/kg/bw ( mg/week) [ ] . the amount of dietary intake of aluminum has risen in urban societies to up to mg/day considering the widespread use of processed convenience foods. however, only about . % of dietary aluminum is absorbed into systemic circulation and most of it is thereafter eliminated through the kidneys [ ] . absorption of aluminum by the skin from ointments and cosmetics containing aluminum has been shown. moreover, the presence of aluminum in breast tissue was associated with breast cancer [ ] . aluminum compounds persist for up to - years post vaccination in human body. this fact, combined with repeated exposure, may account for a hyper activation of the immune system and subsequent chronic inflammation [ ] . the clinical and experimental evidence collected so far identify at least three main risks associated with aluminum in vaccines: . it can persist in the body. . it can trigger pathological immunological responses. . it can pass through the bbb into the cns where it can trigger immuno-inflammatory processes, resulting in brain inflammation and long-term neural dysfunction. there is a link between allergies and autoimmunity since both are the result of an abnormal immune response [ , ] . metals such as mercury, aluminum, nickel and gold are known to induce immunotoxic effects in humans. the immunologic effects of these metals include immunomodulation, allergies and autoimmunity. they may act either as immunosuppressants or as immune adjuvants. metals bind firmly to cells and proteins and thus have the ability to modify autologous epitopes (hapetenization). t-cells then recognize the proteins as foreign and trigger an autoimmune response [ ] . hypersensitivity caused by metals may be referred to as type iv delayed hypersensitivity. the reaction is considered delayed because the first symptoms appear - h after exposure, because it is mostly t-cell mediated and the gold standard for diagnosis of delayed type hypersensitivity is patch testing [ ] . in mercury-sensitized patients, even mercury concentrations within the normal range might provoke neuroallergic reactions in the brain [ ] . identifying metal sensitivity and removal of the sensitizing metals, such as dental amalgam, have been proved successful by showing symptom improvement in patients with previous autoimmune diseases. these diseases included fibromyalgia, autoimmune thyroid diseases and orofacial granulomatosis [ ] [ ] [ ] [ ] (table ). the timeline regarding the field of vaccinology has been divided in two generations, the first regarding the administration of inactivated pathogens in whole or live attenuated forms (e.g., bacillus calmette guerin (bcg), plague, pertussis, polio, rabies, and small- pox) and the second regarding vaccines assembled from purified microbial cell components, also referred as subunit vaccines (e.g., polysaccharides, or protein antigens) [ ] . this latter approach there are obstacles to conventional vaccine development methods such as non-cultivable in vitro pathogens (e.g., hepatitis c, papilloma virus types and , and mycobacterium leprae), antigen hypervariability (e.g., serogroup b meningococcus, gonococcus, malaria), opportunistic pathogens (e.g., staphylococcus aureus) and rapid evolving pathogens such as human immunodeficiency virus (hiv) [ ] . vaccine research gained a new perspective as the genomics field emerged over the last decades. bacterial genomes have been sequenced and analyzed making it possible to choose the best candidate vaccine antigens by using the concept of reverse vaccinology [ ] . the main known factors influencing the observed heterogeneity for immune responses induced by vaccines are gender, age, ethnicity, co-morbidity, immune system, and genetic background. the interaction between genetic and environmental components will dictate the response to vaccines. studying the vaccine and the host will enable the development of customized treatment options. the combination of genetics, epidemiology and genomics in vaccine design has been denominated "vaccinomics" [ ] . the importance of genetic influence is supported by twins and siblings studies, which show familial aggregation. this suggests that genomics is crucial in inter-individual variations in vaccine immune responses [ ] . both human leukocyte antigen (hla) and non-hla gene markers have been identified as markers for immune response to vaccines. multiple studies have shown connections between hla gene polymorphisms and non-responsiveness to the hbv vaccine [ ] . hla region is divided in three sub regions: class i is associated with the induction and maintenance of cell-mediated immune response, class ii is associated with presentation of exogenous antigens to helper t cd + cells and class iii, where immune non hla related genes are located. normal human tissue has at least hla antigens, and although new recombinant haplotypes may occur, it is inherited mostly intact from progenitors [ ] . hla allelic differences are associated with different responses to vaccines, either by hyper or hypo responsiveness. we can infer that a similar response may be associated with different safety in relation to the development of autoimmune reactions to vaccines, particularly in the patients with genetic predisposition to an enhanced response to vaccine inoculation [ ] . furthermore, patients that share the same hla, for instance siblings, have been diagnosed with asia following similar environmental stimuli [ , ] . autoantibodies help to diagnose certain autoimmune diseases, however, they can also be found in healthy individuals. thus, autoimmune diseases cannot be diagnosed based solely on antibody detection [ ] . inoculation of vaccines triggers autoimmune responses that result in the development of autoantibodies. many studies have been carried out in animals, healthy subjects and patients with autoimmune diseases to understand if this development is of clinical significance [ ] [ ] [ ] [ ] . a difference in eliciting the production of autoantibodies in healthy humans has been observed between adjuvanted and non-adjuvanted influenza vaccines [ ] . the annual influenza vaccine has been the most heavily researched vaccine, along with hpv and pneumococcal vaccines as far as their relationship with patients who have previously been diagnosed with an autoimmune disease [ ] [ ] [ ] . autoantibody induction after hpv vaccination was also shown in adolescent girls with systemic lupus erythematosus (sle) [ ] . although induction of autoantibodies was proven following vaccine administration, there have been no proven relation with disease diagnosis in either of the specific groups studied so far [ , ] . it has been widely demonstrated that autoantibodies can develop years before the manifestation of a full-blown autoimmune disease [ ] . moreover, the development of a specific autoantibody is also genetically determined, and the link between genetic, autoantibodies and vaccines may become an even more intriguing area of research [ ] . silicones are synthetic polymers that can be used as fluids, emulsions, resins and elastomers making them useful in diverse fields. they were thought to be biologically inert substances and were incorporated in a multitude of medical devices such as joint implants, artificial heart valves, catheters, drains and shunts. of all the silicone-containing products, the most famous are most likely breast implants. silicon is one of the substances suspected to induce asia [ ] . it is currently believed that exposure alone is not enough to trigger the disease but that it requires the presence of additional risk factors (e.g., genetic susceptibility, other environmental factors) [ ] . silicone exerts local tissue reactions. some of these reactions are considered para-physiological, such as capsular tissue formation around an implant. other reactions are viewed as abnormal, like when capsular contractures and allergic reactions to silicone or platinum (catalyst used in silicone polymerization found in minute concentrations in implants) occur [ ] . cutaneous exposure to silicone with cosmetics or baby bottles could potentially sensitize patients [ ] . there is also a systemic component of silicone exposure related to diffusion of silicone through the elastomer envelope, commonly termed "bleeding". it may arouse systemic effects as it degrades and fragments in tissue, it can also spread throughout the body and lead to the development of cancer or autoimmune phenomena [ ] . patients with ruptured implants complain more frequently of pain and chronic fatigue when compared to patients with intact implants [ ] . anti-silicone antibodies were found to be present in human sera more frequently in patients who have undergone silicone breast implants, however, their pathological significance remains uncertain [ ] . the same was seen for other antibodies such as autoantibodies directed against dsdna, ssdna, ssb/la, silicone and collagen ii, which were found to be present in increased levels in patients after exposure to silicone [ ] . it has also been shown that the formation of autoantibodies is directly related to implant duration. several autoimmune diseases have been linked to silicone exposure including rheumatoid arthritis (ra), systemic lupus erythematosus (sle), polymyositis, systemic sclerosis (ssc) and fibromyalgia. although asia symptoms may arise years after the onset of exposure to silicone implants [ ] , most of the follow-up periods are short and concluding evidence is yet to come regarding this causality. there have been published case reports, epidemiologic and research studies that suggest a connection between several vaccines and certain autoimmune conditions, notwithstanding that, overall the benefits of vaccination outweigh the risks. thrombocytopenia has been reported as the main adverse event following mmr vaccine. after mmr vaccine the onset of immune thrombocytopenic purpura (itp) usually occurred within weeks at a risk rate of : , - , mmr vaccine doses, while the incidence of itp following infections is : for measles and : for rubella [ ] . as the risk of thrombocytopenia is higher in patients who experience natural infection with measles, mumps or rubella than in those receiving the vaccine, vaccination is encouraged. arthralgia complaints have also been reported and they may present as transient arthralgia, acute arthritis and rarely chronic arthritis [ ] . some risk factors have been found to be associated with the development of arthritis in vaccinated patients such as: female gender, older age, prior seronegativity and specific hla alleles [ ] . yf vaccine is only advisable to people in, or going to endemic areas. the risk of developing yf vaccine-associated neurologic disease (yel-and) is inversely proportional to age [ ] . this is why children aged < months cannot be vaccinated and < months, except during epidemics [ ] . vaccination is not advisable to people > years because of possible higher risk of severe adverse effects (saes) even though the incidence remains low [ ] . besides being a vaccine for mycobacterium tuberculosis (tb), the bcg has proved effective as immunotherapy for bladder cancer. although the mechanism is yet to be fully understood, it is thought that bcg binds to fibronectin forming complexes that enable the recognition as "non-self" by the innate immune response of th cells. ultimately the pathways result in the apoptosis of tumor cells [ ] . because of its effect in treating non-muscle-invasive urothelial carcinoma, as well as superficial bladder tumors, it was expected that bcg could play a role in treating other types of cancer, despite data having not corroborated this hypothesis so far. adverse events vary according to the site and method of administration. intradermal administration of bcg has been reported to elicit arthritis [ ] , dermatomyositis [ ] and takayasu's arteritis (ta) [ ] among others. intravesical treatment for bladder cancer can cause reactive arthritis (rea) [ ] . the risk relies on a systemic reaction composed of an early infective phase (pcr positive and response to anti-tb treatment) and a late hypersensitivity reaction [ ] . hbv is a dna virus of the hepadnaviridae family, responsible for acute and chronic liver disease. hbv vaccines are considered the first efficient vaccines against a major human cancer. hbv vaccines have reduced the risk of developing chronic infection and they also have proved to reduce the incidence of liver cancer in children [ ] . the vaccine has been associated mainly with autoimmune neuromuscular disorders. they include, but are not limited to: optic neuritis, guillain-barre syndrome (gbs), myelitis and multiple sclerosis (ms), systemic lupus erythematosus (sle), arthritis, vasculitis, antiphospholipid syndrome (aps) and myopathy [ ] . hbv vaccine is the most common immunization associated with acute myelitis. there are studies that indicate that the pathogenicity behind such vaccine and autoimmunity might be based on cross-reactivity between hbv antigen (hbsag) epitopes, yeast antigens, as well as other adjuvants contained in the vaccine itself [ ] . up to % of cervical cancer deaths, occur in developing countries that lack the ability to fully implement the papanicolau (pap) screening programs. hpv poses a special challenge in vaccine safety. hpv is necessary for the development of cervical cancer. however, most women infected with hpv will not develop the disease since % of infections will resolve within a year and up to % within years without specific treatment. over the course of decades, cancer may result in a small proportion of the remaining infected women. death rate from cervical cancer in - year old girls is zero and long-term benefits are yet to be proven. in this specific case, short term risks to healthy subjects can prove to pose a heavier burden than cervical cancer [ ] . there are at least types of hpv strains, of which have been pathologically associated with cancer. two vaccines, gardasil tm and cervarix tm , are commercially available against hpv. both contain the l capsid proteins of several hpv strains as antigens. gardasil tm contains serotypes , , , . these antigens are combined with aluminum (al) hydroxyphosphate sulphate as an adjuvant. cervarix tm contains a combination of the oil-based adjuvant monophosphoryl lipid a (mpl) and al hydroxide (aso ) as adjuvant and is directed at strains and [ ] . there have been several reports of post-licensure adverse events, some of which have even been fatal [ ] . compared to other vaccines, an unusually high proportion of adverse drug reactions has been reported associated with hpv vaccines [ ] . in , australia reported an annual adr rate of . / , , the highest since . this increase was almost entirely due to adrs reported following the commencement of the national hpv vaccination program for females aged - years in april ( out of a total of adrs records). the numbers only decreased after the cessation of the catch-up schedule. although the percentage of convulsions attributable to the hpv vaccine decreased, the overall report remained comparable between and ( % and % respectively). these reports do not prove the association, but show that there is a higher frequency of adrs related to hpv vaccines reported worldwide, and that they fit a consistent pattern (i.e., nervous system-related disorders rank the highest in frequency) that deserves further investigation [ ] [ ] [ ] . indeed, several autoimmune diseases have been linked to hpv immunization. examples include gbs, ms, acute disseminated encephalomyelitis (adem), transverse myelitis (tm), postural orthostatic tachycardia syndrome (pots), sle, primary ovarian failure (pof), pancreatitis, vasculitis, immune thrombocytopenic purpura (itp) and autoimmune hepatitis (ah) [ ] . influenza is an acute viral infection that affects the respiratory tract and is caused by influenza type a-c viruses of the orthomyxoviridae family [ ] . h n mortality rates in the outbreak showed high risk in those aged years and older, presence of chronic diseases and delayed admission. risk of infection was lower in those who had been vaccinated for seasonal influenza with / trivalent inactivated vaccine [ ] . studies have demonstrated that influenza vaccine is safe and immunogenic in patients with sle or rheumatoid arthritis (ra), diminishing the risk of respiratory infections [ ] . it has been shown that adjuvanted vaccine had more local reactions but did not increase systemic adverse reactions [ ] . molecular mimicry has been suggested as a mechanism to explain an autoimmune response following influenza vaccination. however, a causal relationship between influenza vaccines and induction of autoimmune diseases remains unproved [ ] . diseases or symptoms reported after influenza vaccination include mostly neurological syndromes such as gbs [ref] . nonetheless, influenza vaccines should be recommended for patients with ms, because influenza infection is associated with increased risk of exacerbations. that being said, influenza vaccinations showed increased risk of autoimmune responses suggestive of asia [ ] , vasculitis [ ] and aps [ ] among others. meningococcal disease is caused by neisseria meningitidis. one of the following five serogroups causes almost every invasive disease: a-c, y, and w- . vaccines available so far for its prevention encompass either pure polysaccharide vaccines that use purified bacterial capsular polysaccharides as antigens, or protein/polysaccharide conjugate vaccines, which use the polysaccharide molecule plus diphtheria or tetanus toxoid as tcell-stimulating antigens. n. meningitidis serogroup b (menb) menb glycoconjugate vaccines are not immunogenic and hence, vaccine design has focused on sub-capsular antigens [ ] . menb capsular polysaccharide is composed of a linear homopolymer of ␣( → ) n-acetyl-neuroaminic acid (polysialic acid; psa). menb psa and psa found on neural cell adhesion molecules are structurally identical. as a result of this, it has been proposed that infection with menb or vaccination with psa may be associated with subsequent autoimmune or neurological disease [ ] . no evidence of increased autoimmunity was found to be associated with meningococcal serogroup b infection [ ] . regarding vaccination, the inoculation does not cause autoimmune diseases but may unmask autoimmune phenomena in genetically predisposed individuals. local reactions are more frequent in individuals vaccinated with quadrivalent meningococcal conjugate vaccines compared to plain polysaccharide vaccines. the intramuscular administration of the conjugate vaccine (versus subcutaneous for that of polysaccharide) may, in part, explain the higher reactivity [ ] . diseases previously associated with meningococcal vaccines are gbs [ ] , henoch-schönlein purpura (hsp) [ ] and bullous pemphigoid (bp) [ ] . streptococcus pneumoniae (pneumococcus) is the main cause of bacterial community-acquired pneumonia and meningitis in western countries, as well as the cause of more than , children deaths in developing countries [ , ] . there are three anti-pneumococcal vaccines commercially available. two of these are conjugated to a protein carrier (pcv and pcv ) and one is not conjugated (ppv ). ppv was licensed in and consists of the capsular polysaccharides of twentythree different streptococcus pneumoniae serotypes ( - , b, f, , n, v, a, a, f, , b, f, c, f, a, , f, f, and f). it does not elicit immunological memory because the immune response it triggers is t-cell independent. it is usually administered to the elderly (above years), as it is believed to be less effective in children. pcv is composed of the most frequent serotypes , b, v, , c, f, and f. pcv is directed at serotypes , - , a, b, f, v, , c, a, f, and f. contrary to ppv both pcv and pcv have an aluminum adjuvant in their composition that elicits a t-cell mediated response [ ] . ever since vaccines were introduced in the healthcare system, prevalence, fatality and admissions for invasive pneumococcal disease have decreased significantly [ ] . vaccine adverse events vary depending on whether the vaccine is adjuvanted or not. in a non adjuvanted vaccine, local reactions are present in % of people vaccinated intra muscularly and in % of those immunized sub-cutaneously [ ] . in conjugated vaccines, this percentage rises to % [ ] . systemic reactions such as fever, irritability, decreased appetite and sleep disturbances occur in - % of recipients of pcv or ppv. symptoms like arthralgia, arthritis, myalgia, paresthesia and fatigue are more frequent in patients post ppv. this may be related to the fact that the vaccines are administered to different age groups. autoimmune risk following ppv vaccine is very low. only case reports were found after ppv vaccine. six of these referred to reactivation of a previous autoimmune disorder. studies directed to access vaccine safety in subjects with autoimmune diseases showed immunization was safe [ , ] . tetanus toxoid (tt) is a potent exotoxin produced by the bacteria clostridium tetani. the toxin has a predominant effect on inhibitory neurons, inhibiting release of ␥-aminobutiric acid (gaba). when spinal inhibitory interneurons are affected the symptoms appear [ ] . the vaccine against c. tetani contains deactivated tetanus toxoid plus an adjuvant (usually aluminium hydroxide). the most studied and prevalent disease associated with tt is antiphospholipid syndrome (aps), but cns complications have also been reported such as optic neuritis, acute myelitis and encephalomyelitis [ ] . in mice, the immune response to tt depends on genetic background and to the specific adjuvant used for immunization. naive balb/c mice, immunized with tt, developed antibodies directed to tt, dsdna and ␤ gpi and were extremely sick [ ] . aps is an autoimmune disease characterized by the occurrence of thrombotic events. patients suffering from this condition have recurrent fetal loss, thromboembolic phenomena, thrombocytopenia as well as neurological, cardiac and dermatological involvement [ ] . the serological marker of aps is the presence of antiphospholipid antibodies (apl), which bind negatively charged phospholipids, platelets and endothelial cells mainly through the plasma protein beta- -glycoprotein-i (b gpi). the presence of igg and igm anti-cardiolipin antibodies (acl) and lupus anticoagulant is associated with thrombosis in patients with aps [ ] . ␤ gpi was identified as the most important antigen in aps. ␤ gpi has several properties in vitro which define it as an anticoagulant (e.g., inhibition of prothrombinase activity, adenosine diphosphate-induced platelet aggregation, platelet factor ix production) [ ] . passive transfer of anti-␤ gpi antibodies induce experimental aps in naïve mice and thrombus formation in ex vivo model [ ] . evidence suggests that the molecular mimicry mechanism between ␤ gpi and tt is one of the possible causes for aps. besides tt, aps has also been reported following hbv and influenza virus vaccination, although data are scarce [ , ] . sle is a multisystem autoimmune disease characterized by the production of a variety of autoantibodies. igg isotype antibodies to double-stranded dna (dsdna) are thought to be diagnostic markers and their presence correlates with disease pathogenesis. several factors including genetic, hormonal, environmental and immune defects are involved in the induction of autoantibodies in this disease [ ] . post vaccination manifestations of sle or lupus like syndrome have been reported and range from autoantibody induction to full blown clinical disease. reports have been published associating sle to hbv, mmr, dtp, hpv, influenza, bcg, pneumococcal and small pox vaccinations [ ] . vaccination in sle diagnosed patients is associated with disease exacerbation and decreased antibody response, which may be due to the underlying disease and the frequent use of immunosuppressive drugs [ ] . a temporal link between sle and hbv vaccination is the only relation that has been demonstrated [ ] . several studies have demonstrated an increased prevalence of hpv in individuals with lupus compared to the general population, which has increased awareness for the need to vaccinate this high-risk population [ ] . to do so, the association between immunization with hpv vaccines and sle like symptoms, as well as the higher incidence of flares in known lupus patients must be taken into account. vasculitis is the name given to a group of autoimmune mediated diseases, which involve blood vessels of different types and sizes. they can be categorized according to several disease features indluding: the type of vessel affected, organ distribution, genetic predisposition and clinical manifestation [ ] . so far, cases of large vessel vasculitis have been detected. this includes cases of giant cell arteritis (gca) following influenza vaccination, cases of takayasu disease (td), and one case of large cell arteritis involving subclavian and renal arteries following hbv vaccines. two of these patients had previous received the diagnosis of ankylosing spondylitis and polymyalgia rheumatica (pmr)-like illness [ ] . one case of polyarteritis nodosa (pan) following the administration of tetanus and bcg vaccine is described. all other cases of pan in adults follow the administration of hbv vaccine [ ] [ ] [ ] . case reports of medium vessels vasculitis -both polyarteritis nodosa and kawasaki disease (kd) -have also been published in pediatric patients. kd has been described one day after the second dose of hbv vaccine and following yellow fever vaccine [ , ] . two cases of pediatric patients with pan have been reported two months after receiving the hbv vaccine [ , ] . eosinophilic granulomatosis with polyangiitis (egpa) after tetanus vaccination [ ] and following hbv vaccine [ ] have been reported. there are also cases of microscopic polyangiitis (mpa) and cases of granulomatosis with polyangiitis (gpa) following influenza vaccines in the literature [ , ] . henoch schönlein purpura (hsp) is the most common vasculitis of childhood. it is generally benign and self-limited. it is mediated by iga immune complex deposition in various tissues as well as in small-sized blood vessels. genetic risk factors play an important role in the pathogenesis of the disease: it is associated with hla-drb* , and . hsp was associated with seasonal influenza, influenza a (h n ), pneumococcal and meningococcal disease, hepatitis a virus (hav), hbv, anti-human papilloma virus (hpv) vaccines, and following multiple combinations of vaccines, such as typhoid, cholera and yellow fever [ , [ ] [ ] [ ] . leukocytoclastic vasculitis has been associated with several vaccines, including influenza vaccine [ ] , hav vaccine [ ] , hbv vaccine [ ] , pneumococcal vaccine [ ] , varicella [ ] , rubella, smallpox [ ] and the anthrax vaccine [ ] . dermal vasculitis with pan uveitis has also been described following mmr vaccine [ ] . ra is the most prevalent chronic inflammatory arthritis affecting the synovial membrane of multiple diarthrodial joints. although its etiology has not been completely clarified, deregulation of the immune system is evident with a preponderance of inflammatory cytokines and immune cells within the joints. ra has an estimated heritability of %, leaving a substantial proportion of risk to environmental factors. immunizations have previously been proposed as potential environmental triggers for ra. in the norfolk arthritis register database, of the first patients reported receiving a tetanus vaccination within weeks prior to the onset of arthritis. similarly, a transient rise in rf titer was recorded in out of military recruits - weeks after receiving concomitant immunization against tetanus, typhoid, paratyphoid, mumps, diphtheria, polio and smallpox. however, only showed a persistent elevation in titer and none developed arthritis [ ] . several mechanisms have been proposed to explain the putative association between vaccination and the initiation of ra, the most prominent of which are molecular mimicry and non-specific immune system activation [ ] . vaccines who have been associated with ra include rubella vaccine in which reactive arthritis occurs in % of recipients. controlled studies failed to show persistent arthritis or arthralgia in these patients [ ] . patients following hbv vaccine showed an increase of arthritis in a vaers study, but this was not seen in a large retrospective epidemiological study [ ] . data so far suggest that vaccines carry an insignificant role in the pathogenesis of ra. several mechanisms are being studied to produce vaccines mainly targeting inflammatory cytokines as "antigens" such as tnf, aiming to induce high titers of endogenous neutralizing anticytokine antibodies with the goal of breaking natural th tolerance to auto antigens. other cytokines, namely il- il- , mif, rantes, il- , mcp- are also being tested [ ] . another vaccine related therapy uses autologous t cell lines to induce a specific immune response by the host's t cells directed against the autoimmune (vaccine) t cells [ ] . this strategy has been successful in mouse models and has shown encouraging results in a small pilot study of ra patients, where patients showed a clinical response, defined by acr improvement criteria [ ] . uctd is a clinical condition characterized by signs, symptoms and laboratory tests suggestive of a systemic autoimmune disease but that does not fulfill the criteria for any defined connective tissue disease (ctd). such patients with clinical manifestations suggestive of systemic connective tissue disease but not fulfilling any existing criteria are quite frequent: - % of the patients initially asking for a rheumatologic evaluation may at least temporarily be diagnosed as affected by 'undefined' or 'undifferentiated' connective tissue disease. comparing studies on these diseases is unfeasible because of the inexistence of defined criteria for diagnosis [ ] . within years of follow-up, patients usually evolve to defined ctds, which include sle, systemic sclerosis (ssc), primary sjögren's syndrome (pss), mixed connective tissue disease (mctd), systemic vasculitis, poly-dermatomyositis (pm/dm) and ra. maintaining an undefined profile for years makes evolving into ctds less probable and the diagnosis of "stable uctd" reliable [ ] . disease etiology is a concern and it has been associated with vitamin d deficiency and silicone implants, both of which lead to an imbalance in proinflammatory and anti-inflammatory cytokines [ ] . vaccines have also been associated with this disease, namely the hbv vaccine [ ] . etiopathogenesis of uctd is unknown and it has been suggested it might fall on asia spectrum since symptomatic similarities are striking and uctd etiopathogenesis has been associated with adjuvants [ ] . aa is an autoimmune disease, characterized by one or more well demarcated oval and round non-cicatricial patches of hair loss. the disease may affect any hair bearing part of the body and has a great impact on a patient's self-esteem and quality of life. depending on ethnicity and location, aa is the most prevalent skin disease. aa prevalence varies and is estimated to be between . - . % in the united states and . % in singapore [ , ] . as with any other autoimmune disease, the development of aa encompasses genetic and environmental factors. environmental factors associated with aa development are emotional and/or physical stress, infections and vaccines [ ] . secondary syphilis is one of the most well studied examples, however epstein barr virus [ ] and herpes zoster [ ] infections have also been related to the development of the disease. as far as vaccines go, hbv vaccine has been associated with aa development. in one study of patients, developed aa after vaccination with hbv vaccine. of those patients, were rechallenged, and the reappearance of disease was witnessed [ ] . in mice this association failed to be established [ ] . one case of aa was witnessed following tetanus toxoid, as well as two case reports following hpv and mmr vaccine [ ] [ ] [ ] . itp is an autoimmune disease defined by a platelet count of less than platelets/l without overlapping diseases. it can present with or without anti-platelet-antibodies. thrombocytopenia is relatively common and the overall probability of developing itp was , % in a cohort of patients. it was also found that % of patients developed an overlapping aid other than itp [ ] . the etiology of the disease is yet to be fully understood but it has been detected following infectious diseases, such as helicobacter pylori, hepatitis c virus (hcv), novel influenza a infection, rotavirus infection and human immunodeficiency virus (hiv) [ ] . itp onset has also been reported, although rarely, as a severe adverse event following vaccine administration. this was more often observed after measles-mumps-rubella (mmr), hepatitis a and b, diphtheria-tetanus-acellular pertussis (dtap), and varicella vaccinations [ ] . molecular mimicry has been suggested as a possible mechanism for the development of itp, namely following helicobacter pylori infection. its eradication has been shown to increase platelet count and diminish the levels of anti-caga antibody in a subset of h. pylori infected subjects with itp [ ] . these data point towards a beneficial role of h. pylori eradication in chronic itp. two cases of itp following anti-rabies vaccine have been reported and one after hpv vaccine. reactivation of itp was reported two weeks after a tick-borne encephalitis vaccination [ ] . the most consistent association with itp is with the mmr vaccine [ ] . however, it should be emphasized that the number of cases are fewer than expected without vaccination. t d is due to antigen specific reactions against insulin producing beta cells of the pancreas. much like other autoimmune diseases, t d results from a combination of genetic, environmental, hormonal and immunological factors. environmental factors such as pathogens, diet, toxins, stress and vaccines are believed to be involved in the beginning of the autoimmune process [ ] . although the mechanisms by which viral infections cause autoimmune diabetes have not been fully clarified, there is some evidence to suggest a role for natural infections in the pathogenesis of t d mellitus in susceptible individuals [ ] . it has been hypothesized that vaccination could trigger t d in susceptible individuals. although post-vaccination t d may be biologically plausible, cumulative evidence has not supported an increased risk of t d following any vaccine [ ] . several experimental data have suggested that, depending on the timing, vaccination might exert a protecting or aggravating effect on the occurrence of diabetes [ ] . a study suggests that haemophillus influenza type b vaccine might be a risk factor in the induction of islet cell and anti-gad antibodies measured at one year of age [ ] but there are previous studies that show no association between hib and t d [ ] . in a cohort of american military officers diagnosed with t d, there was no association found between vaccination and t d diagnosis [ ] . available data about a relation between the mumps vaccine and t d are still incomplete and their interpretation is difficult because of miscellaneous confounding factors associated with the development of t d [ ] . association between hemagglutinin neuraminidase (h n ) vaccines and t d is so far unproven [ ] . in humans, it has been hypothesized that early-age bcg vaccination is associated with the risk of t d. the few studies conducted to date provided no consistent evidence of an association. there are, however, studies showing a possible temporary boost of the immune function after vaccination [ ] . studies also show that among bcg-vaccinated children who test positive for islet autoantibodies, there is a higher cumulative risk of t d [ ] . in animal experiments it has been observed that bcg seems to have a protective effect against diabetes, however researchers have yet to translate this benefit to humans [ ] . in all, studies results do not support any strong association between vaccination and t d. narcolepsy is a sleep disorder described as excessive sleepiness with abnormal sleep pattern characterized by uncontrollable rapid eye movement (rem) events which occur at any time during the day. these event and may or may not be accompanied by a loss of muscle tone (cataplexy) [ ] . a plethora of data indicates that narcolepsy is caused by the lack of orexin (also known as hypocretin), an important neurotransmitter, which is involved in the regulation of the sleep cycle. in narcolepsy patients, a loss of orexin producing neurons in the hypothalamus and low levels of orexin in the cerebrospinal fluid (csf) has been reported [ ] . narcolepsy has been shown to have an autoimmune background. antibodies against tribbles (trib ) have been found in these patients, which may be related to the pathogenesis of disease. an experimental model of narcolepsy in mice has been made by passive transfer of total igg from narcolepsy patients into the animal's brains through intra ventricular injection [ ] . environmental factors like influenza a virus and streptococcal infections have been associated with disease onset. interestingly, fever by itself without the diagnosis of an infectious etiology was found to be a risk factor for narcolepsy [ ] . several groups have studied and found an increase in the incidence of narcolepsy diagnosis following the introduction of influenza vaccination, specifically, aso -adjuvanted pandemrix tm vaccine. this association was shown in finland especially in [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] year-olds, but also in case reports from other countries [ ] . other studies failed to find an association. the actual infection with h n has been associated with disease development in china, however no such relationship has been noted in europe [ ] . the above-mentioned associations are specifically related to the aso -adjuvanted pandemrix tm vaccine. the same association has not been reported for other h n adjuvanted or non-adjuvanted vaccines. the major difference between the aso and the mf adjuvants is the presence of the ␣-tocopherol. ␣-tocopherol is unique in that it can achieve the highest and longest antibody response by producing an enhanced antigenspecific adaptive immune response. in vitro it was shown that ␣-tocopherol could increase the production of orexin as well as increase the proteosome activity. this increased production of orexin fragments may facilitate antigen presentation to mhc class ii, thus triggering an autoimmune process [ ] . all these data together support the relationship between the h n pandemrix tm vaccine and the development of narcolepsy. gluten induced enteropathy, gluten sensitive enteropathy, or more commonly called celiac disease (cd) is a life-long autoimmune condition mainly of the gastrointestinal tract, specifically affecting the small intestine. the abnormal immune response crates autoantigens which are directed towards tissue transglutaminase (ttg). the two main autoantibodies and the most widespread serological markers to screen for the disease are anti ttg and anti endomysium. two additional auto-antibodies, namely: anti deaminated gliadin peptide and anti-neoepitope ttg were found recently to be reliable for cd screening as well [ ] . cd is an autoimmune disease induced by well-known nutritional environmental factors. the non-dietary ones are less studied and established. several infectious disease have been linked to its development, the so-called infectome [ ] . a clear cause-effect relation is yet to be established for most of the pathogens associated with cd. what has been shown, however, is that in countries with low economic status, inferior hygiene conditions and higher infectious load, cd prevalence is lower [ ] . an epidemiologic relationship was established in between rotavirus infection and cd. data showed that in genetically predisposed individuals, rotavirus infection was related to childhood cd development [ ] . in subsequent research studies, a celiac peptide was recognized and proved to share homology with rotavirus major neutralizing protein vp and with the cd autoantigen ttg. the antibodies directed against the viral protein vp were shown to predict the onset of cd and induce typical features of cd in the intestinal epithelial cell-line t [ ] . it has also been suggested that rotavirus vaccine alters b and t behavior, as the percentage of b-cells was higher in the vaccinated infants [ ] . rotavirus vaccine as an inducer of cd is still in discussion and warrants further study. pmr is an autoimmune inflammatory rheumatic disease characterized by raised inflammatory markers with pain and morning stiffness of shoulders and pelvic girdles and synovitis of proximal joints and extra-articular synovial structures. its diagnosis is clinical and it is typically a disease of the elderly occurring mainly in subjects above . etiopathogenesis of pmr remains unknown, but genetic and environmental factors play a role [ ] . a close temporal relationship has been ascertained concerning epidemics of mycoplasma pneumoniae, chlamydia pneumonia, parvovirus b and peaks of cases of pmr and giant cell arteritis, however this is not clearly proven [ ] . cases of pmr following vaccination have rarely been reported. however, it is believed that post vaccination pmr may be underreported due to its symptomatic similarities with the transient effects of vaccines, namely: arthralgia, myalgia and low-grade fever. this leads to failure in establishing a chronological relationship when the disease is diagnosed. most of the reported cases are associated with seasonal influenza vaccine (inf-v). often, the time interval between vaccine administration and symptoms onset varies from one day, to three months. three cases were reported with associated giant cell arthritis. a case report of relapsing pmr after four years of remission following tetanus vaccination has also been reported [ , ] . acute disseminated encephalomyelitis (adem) is an inflammatory demyelinating disease of the central nervous system (cns). adem is usually poly-symptomatic with encephalopathy (i.e., behavioral change or altered level of consciousness). it affects mostly children and young adults and has higher prevalence in males. its incidence is . - . per per year [ ] . although there is no concrete evidence of a clear pathogenic association, adem has been associated with immunization or previous viral infection. post-vaccination adem accounts for only - percent of all cases, while post-infectious adem accounts for percent of all cases of adem [ ] . the hypothesis that better describes these associations is molecular mimicry. t-cells targeting human herpesvirus- (hhv- ), coronavirus, influenza virus and epstein-barr virus (ebv) have been shown to cross-react with myelin basic protein (mbp) antigens. anti-mbp t-cells were detected in patients following vaccination with simple rabies vaccine [ ] [ ] [ ] . in a post experimental therapy for alzheimer's disease with a vaccine that contained aggregates of synthetic a␤ fragments of amyloid precursor protein, adem was shown to develop in mice [ ] . the experimental model of ms, eae mice, may be induced with injection of a␤ , but only when the latter is administered together with the complete freund's adjuvant [ ] . this observation points to the importance and central role of the adjuvants in induction of adem and autoimmunity in general [ ] . the overall incidence of post vaccination adem is estimated to be . - . per and a higher risk has been reported following immunization against measles. other vaccines accountable for post-vaccination adem include vaccines against the varicella zoster, the rubella, the smallpox and the influenza viruses [ ] . surprisingly, certain vaccines such as anti-tetanus vaccine were shown to have a negative correlation with adem (statistically significant decreased risk) [ ] . hbv immunization has been studied as a possible cause for adem but was later associated with clinically isolated syndrome (cis) (a first time occurring demyelinating episode that may, or not develop to ms) and complete conversion to ms [ ] . as far as case reports are concerned, adem was associated with vaccination with influenza, hepatitis a and b, mmr, hpv and tetanus [ , , ] . bullous dermatoses are characterized by the presence of blisters and autoantibodies against structural components of the skin: desmosomal proteins (in pemphigus), adhesion molecules of the dermal-epidermal junction (in pemphigoid diseases), and epidermal/ tissue transglutaminase (in dermatitis herpetiformis). the most frequent autoimmune bullous diseases are bullous pemphigoid (bp) and pemphigus vulgaris (pv). bp is more frequently observed in the elderly, while the age of onset of pv is between and years. neither of the diseases have any gender preference [ ] . bp and pv etiology is, so far, poorly understood. both diseases have been associated with various environmental factors, which include emotional and/or physical stress, infections and vaccinations [ ] . genetic predisposition has also been studied with overexpression of certain hla class ii alleles. these include hla-dqb * , drb * , drb * , and dqb * . these alleles have been found to be more prevalent in bp patients than in the general population [ ] . pv is associated with certain hla class ii loci such as hla-dr and hladr alleles (drb * and drb * , which is prevalent in ashkenazi jews, iranian and sardinian patients). other loci include drb * (common among japanese and italian patients) and two dqb alleles (dqb * and dqb * ), which are strongly associated with pv. bp and pv patients' sera were found to have significantly higher prevalence of antibodies to hepatitis b virus, hepatitis c virus, helicobacter pylori, toxoplasma gondii and cytomegalovirus [ ] . as far as vaccination is concerned, bp developed in patients following influenza, diphtheria, tetanus, pertussis, hepatitis b, bcg, polio and herpes zoster vaccines [ , , ] furthermore, reactivation of bp following influenza vaccination was reported in one case report [ ] . new onset pv was associated with: influenza vaccine, hepatitis b vaccine, anthrax vaccine, typhoid booster and rabies vaccination. in addition, exacerbation of pv after vaccination was also reported following influenza vaccine and tetanus vaccine [ ] . iim compose a group of skeletal muscles diseases in which myositis without a recognized cause occurs. iim is usually subdivided in entities: dermatomyositis (dm), polymyositis (pm), inclusion body myositis (sibm) non-specific myositis (nsm) and immune mediated necrotizing myopathy (iam) [ ] . iim prevalence is around . × − cases, with a bimodal age of distribution that peaks in childhood and again between and years. dm is the most common inflammatory myopathy while pm is the least frequent. despite exhibiting similar clinical symptoms, the subsets of iim exhibit significant immunopathological variation. dm begins with the activation of the complement and formation of membrane attack complexes (mac). in pm and sibm the fundamental process is related to cd + t cells mediated cytotoxicity [ ] . it is unclear what breaks the tolerance and drives the immune response to induce iim. so far, dm, pm and sibm have been linked to vaccination. several cases have been reported in the literature associating different vaccines with the development of idiopathic inflammatory myopathies. cases of iim had been reported to vaers database up to june . out of these cases, were classified as pm, as dm and an only one as a sibm. dm has been reported after almost any vaccine, however only a few studies have attempted to clarify the possible relationship between dm and vaccination. pm is a frequent misdiagnosed disorder. some reports have associated previous immunization, especially hepatitis b vaccine with pm [ ] . despite being recently differentiated from other iim, sibm has already been related to hbv vaccine [ ] . some vaccines associated with myositis are mmr vaccine, smallpox vac-cine, poliomyelitis (ipv), diphtheria and tetanus toxoid, influenza, hpv and bcg [ ] . fms is an entity that is related to the inability of the cns to modulate pain. the conditioned pain modulation process in the cns appears to be compromised among many fms patients, which might explain the enhanced pain sensation experienced by these patients [ ] . the etiology of fms is yet to be unveiled. genetic predisposition, physical trauma (particularly to the cervical spine), emotional stress (to various stressors) as well as a variety of infections have been linked with fms. vaccines have been associated with the triggering of fms namely rubella and lyme disease vaccines [ ] . there are several reports of fibromyalgia-like disease after vaccination, specifically hpv (martinez-lavin journal of clinical rheumatology ). the medical community and regulatory agencies should be aware of these possible adverse effects aiming at defining their magnitude. chronic fatigue syndrome (cfs) is a disease characterized by disabling fatigue, headaches, concentration difficulties and memory deficits ( %). other symptoms such as sore throat ( %), tender lymph nodes ( %), skeletal muscle pain and feverishness ( %), sleep disruption ( %), psychiatric problems ( %) and rapid pulse ( %) are often observed. it more frequently affects women and has a prevalence of . - . % [ ] . although disease etiology is still unknown, there are several pathogens, such as epstein-barr virus (ebv), which have been associated with cfs. patients often have higher titers of igm to the ebv viral capsid antigen. cytomegalovirus and human herpes virus antibodies were also detected more often in cfs patients, although other reports failed to replicate these results. parvovirus b infection has also been suggested as a trigger to cfs [ ] [ ] [ ] . vaccine inoculation has also been appointed as a probable cause. vaccinations against rubella, q fever and hepatitis b were found to be associated with higher risk of developing cfs while meningococcal vaccine, poliovirus and influenza vaccine were not. surprisingly, staphylococcus toxoid vaccine appeared to have a protective effect [ , , ] . defined in by shoenfeld and agmon-levin asia syndrome is characterized by hyperactive immune response to adjuvants [ ] . as previously stated, asia incorporates four known medical conditions: siliconosis, gws, mmf, and post-vaccination phenomena [ ] . recently, the sick building syndrome (sbs) was proposed as a candidate for the asia spectrum [ ] . all of these diseases satisfy several criteria for fms and seid [ ] . a macrophagic myofasciitis (mmf) mmf has been described as an emerging condition of unknown cause characterized by a pathognomonic lesion in muscle biopsy mixing large macrophages with submicron to micron-sized agglomerates of nanocrystals in their cytoplasm and lymphocytic infiltrates. these lesions were related to aluminum deposits in muscle following immunization with aluminum containing vaccines [ ] . mmf lesion is now universally recognized as indicative of a long-lasting persistence of aluminum adjuvant at the site of prior intramuscular immunization. the long-lasting mmf lesion should be considered as a biomarker of aluminum bio persistence in a given individual. patients with mmf have higher reported myalgia with incidence being up to %. its etiology is not clear but genuine muscle weakness is rare and the diagnosis of fibromyalgia is also rare. higher prevalence of chronic fatigue syndrome (cfs) in patients with mmf has been reported as well. cognitive impairment has been associated with mmf: in one series of mmf patients, up to % had attention and memory complaints and neuropsychological tests were abnormal in % [ ] . b gulf war syndrome (gws) gws is a clinical entity specifically related to a certain time and place in history. it was described among veterans of the military conflict occurring in - in the persian gulf. the syndrome is characterized by chronic fatigue, musculoskeletal symptoms, malaise and cognitive impairment. it clinically overlaps with post traumatic stress disorder (ptsd), fms, cfs and other functional disorders [ ] . the unique conditions that have been associated so far with disease development are the exposure to extreme climate in the persian gulf, exposure to various chemicals (pesticides, depleted uranium), stress provoked by prolonged waiting without actual combat and the intense exposure to vaccinations of the soldiers for fear of biological weaponry [ ] . comparing gulf war veterans and veterans of the bosnian conflict, multiple vaccinations administered to servicemen in the gulf war was identified as a unique exposure [ ] . the mechanism through which vaccination exposure may lead to the development of functional symptoms is not completely understood. the possibility that a shift from th to th type reactions could be of pathogenic significance was raised and is supported by an increased frequency of allergic reactions, low natural killer cell activity and low levels of interferon ␥ and il- in these patients [ ] . one study with gws patients showed a connection between anti-squalene antibodies and symptoms development. this was refuted by a larger study that found no association between antisqualene antibodies and chronic multi-symptom illness [ ] . c asia registry a registry is a collection of data related to patients with the same specific characteristic. it is often the first approach in the study of an area of inquiry. in rare diseases, registries are often the way to get a sufficiently sized sample of patients which can be used either for epidemiological or research purposes. asia syndrome may be underreported because of unawareness and failure to connect the syndrome with the exposure. this registry was created to fully understand the clinical aspects of disease and compare patients from all over the world in order to have fully validated criteria for disease diagnosis and also to define demographic and environmental history of disease. the asia syndrome registry website can be found on the following link: https://ontocrf.costisa.com/en/web/asia. only cases reported by physicians are accepted. to make an informed decision in medicine, there is always a need to weigh the pros and cons. ards may play an important role in deciding whether vaccination is or is not appropriate to a patient. in these cases, patients are immunosuppressed on account of their diagnosis and even more so if they are under specific immunomodelatory medication [ ] . if the efficacy of vaccination is reduced, there is a potential for development of disease flares following vaccination. in the case of live vaccines, its inoculation may even be enough to trigger disease in the host. for these specific reasons, live vaccines are generally contraindicated in patients receiving immunosuppressant medication. there is a need for screening and treatment of latent tuberculosis infection (ltbi) before starting anti-tnf-alpha therapy. the same is true for vaccination. preferably, even recommended vaccination (see table ) should be administered before the initiation of disease-modifying anti-rheumatic drugs (dmards) because these may reduce vaccine efficacy [ ] . immunosuppression equals high risk of infection and lower vaccine efficacy. taking into account safety concerns and efficacy, the eular recommendations for immunizations in aiird patients are: • assess vaccination status in initial investigation. • administer vaccines in a stable disease phase. • live attenuated vaccines are to be avoided especially if immunosuppressive agents are being administered. bcg is not recommended. • administer vaccines ideally before starting dmards and anti-tnf␣ agents. • influenza and -valent polysaccharide pneumococcal vaccination is recommended. • tetanus toxoid vaccination is recommended following recommendations of general population, in case of major and/or contaminated wounds in patients receiving rituximab in the previous weeks tetanus ig is indicated. • hpv and herpes zoster should be considered. • in hyposplenic/asplenic patients, influenza, pneumococcal, haemophilus influenza b and meningococcal c are advisable. • hepatitis a and b is recommended in patients at risk. • travel patients should be immunized according to general population guidelines except for live attenuated vaccines, which are to be avoided [ ] . vaccines have many beneficial effects in combating infectious diseases and preventing mortality and morbidity. they have also proved to be effective cancer treatments by immunomodulation, as demonstrated by the intravesical administration of bcg to treat superficial bladder cancer [ ] . vaccines are however, linked to autoimmunity. beneficial outcomes, like the adjuvant effect are based on immunity triggering and enhanced immunity mechanisms. these same responses account for autoimmunity exertion. vaccines induce the production of autoantibodies, but their pathologic effect is yet to be unveiled. although vaccines are widely considered safe, there are subjects with predispositions to whom vaccines pose a bigger threat. an example is the fact that animal models with autoimmune predispositions develop autoimmune disease following adjuvant exposure. as many as % of recipients of aluminum containing adjuvants may be sensitized to future exposure [ ] . silicon-induced inflammatory fibro proliferative response is irrefutable and well documented. the presence of anti-silicone antibodies and silicone-associated autoimmune phenomena seems very plausible. asia syndrome and aluminum safety studies show that the use of aluminum containing "placebo" in control groups in vaccine safety studies should be carefully evaluated. new studies must be performed using a proper placebo to adequately test vaccine safety. another evident failure in vaccine safety studies are the short-term periods which are evaluated. continued immune system activation has been observed to be a potential mechanism of disease. a disease which is poorly understood so far. vaccine recommendations should be reassessed frequently in different subsets of the population. this does not invalidate the need for vaccines, however, the lower the possibility of exerting adverse events, the easier it will be for the potential benefits to outweigh the risks. vaccinomics represents a major breakthrough in vaccine development and can lead to the development of targeted vaccines to peptides most likely to be immunogenic [ ] . a predictable response to vaccine can be achieved by differentiating the host variability. this can be achieved namely in genetics and pathogen variability. developing a vaccine accordingly will lead to increased specificity in treatment and leave less room for adverse events. by using immunomodulation, vaccinomics can also give rise to novel therapies for autoimmune diseases. there are several reports of cases of autoimmunity diseases following vaccines but despite in vitro positive results and due to both the limited number of cases and the long latency period of the diseases, every attempt for an epidemiological study has failed to deliver a connection. classification as asia syndrome, in detriment of classic specific autoimmune diseases, could be the key to finding effective preventative therapeutic strategies. it will enable the study of bigger patient clusters with earlier diagnoses. future studies that could help clarify the association between vaccinations, adjuvants and autoimmunity should ideally have a different design, more long-term data and should include autoimmune phenomena as well as large-scale epidemiological studies of autoimmune diseases. the mosaic of autoimmunity infections and autoimmunity-friends or foes? autoimmune/inflammatory syndrome induced by adjuvants (asia) : unveiling the pathogenic, clinical and diagnostic aspects asia-autoimmune/inflammatory syndrome induced by adjuvants adjuvants and autoimmunity adjuvant activity of immunopotentiating reconstituted influenza virosomes (irivs) interfaces questions and possibilities in toll-like receptor signalling immunotherapy with a ragweed-toll-like receptor agonist vaccine for allergic rhinitis immunotherapeutic strategies for the treatment of malignant melanoma does pegylated interferon alpha- b confer additional benefit in the adjuvant treatment of high-risk melanoma? tuftsin on the -year anniversary of victor najjar's discovery tuftsin a naturally occurring immunopotentiating factor. i. in vitro enhancement of murine natural cell-mediated cytotoxicity tuftsin and tuftsin conjugates potentiate immunogenic processes: effects and possible mechanisms the novel adjuvant ic strongly improves influenza vaccine-specific cellular and humoral immune responses in young adult and aged mice improving vaccine delivery using novel adjuvant systems prototype alzheimer's disease epitope vaccine induced strong th -type anti-abeta antibody response with alum to quil a adjuvant switch cpg oligodeoxynucleotides trigger protective and curative th responses in lethal murine leishmaniasis tuftsin-azt conjugate: potential macrophage targeting for aids therapy enhanced immune response induced by a potential influenza a vaccine based on branched m e polypeptides linked to tuftsin construction of a synthetic immunogen: use of the natural immunomodulator polytuftsin in malaria vaccines against resa antigen of plasmodium falciparum stimulating effect of tuftsin and its analogues on the defective monocyte chemotaxis in systemic lupus erythematosus immunological concepts of vaccine adjuvant activity recent advances in the discovery and delivery of vaccine adjuvants using eae to better understand principles of immune function and autoimmune pathology toll pathway-dependent blockade of cd + cd + t cell-mediated suppression by dendritic cells viruses as adjuvants for autoimmunity: evidence from coxsackievirus-induced myocarditis pathogenesis of myocarditis and dilated cardiomyopathy bacillus calmette-guerin immunotherapy of superficial bladder cancer pattern recognition receptors and control of adaptive immunity how dying cells alert the immune system to danger role of protease-activated receptors in inflammatory responses, innate and adaptive immunity novel signaling interactions between proteinase-activated receptor and toll-like receptors in vitro and in vivo autoimmune (auto-inflammatory) syndrome induced by adjuvants (asia)-animal models as a proof of concept the endogenous adjuvant squalene can induce a chronic t-cell-mediated arthritis in rats percutaneous exposure of adjuvant oil causes arthritis in da rats exacerbation of collagen-induced arthritis in rats by rat cytomegalovirus is antigen-specific comparative study of adjuvant induced arthritis in susceptible and resistant strains of rats. i. effect of cyclophosphamide aloh -adjuvanted vaccine-induced macrophagic myofasciitis in rats is influenced by the genetic background induction of plasma cell tumours in balb-c mice with , , , -tetramethylpentadecane (pristane) paraffin oil injection in the body: an obsolete and destructive procedure induction of lupus autoantibodies by adjuvants adjuvant immunization induces high levels of pathogenic antiphospholipid antibodies in genetically prone mice: another facet of the asia syndrome induction of the asia syndrome in nzb/nzwf mice after injection of complete freund's adjuvant (cfa) manifestations of systemic autoimmunity in vaccinated salmon comparison of three adjuvants used to produce polyclonal antibodies to veterinary drugs comparison of tissue reactions produced by haemophilus pleuropneumoniae vaccines made with six different adjuvants in swine delayed acquisition of neonatal reflexes in newborn primates receiving a thimerosal-containing hepatitis b vaccine: influence of gestational age and birth weight autoimmune/autoinflammatory syndrome induced by adjuvants (asia syndrome) in commercial sheep slow ccl -dependent translocation of biopersistent particles from muscle to brain aluminum hydroxide injections lead to motor deficits and motor neuron degeneration nanomolar aluminum induces pro-inflammatory and pro-apoptotic gene expression in human brain cells in primary culture the pro-oxidant activity of aluminum regulatory role of zinc during aluminium-induced altered carbohydrate metabolism in rat brain aluminum and alzheimer's disease: after a century of controversy, is there a plausible link? exposure to aluminium and the subsequent development of a disorder with features of alzheimer's disease elevated urinary excretion of aluminium and iron in multiple sclerosis aluminum-induced entropy in biological systems: implications for neurological disease the immunobiology of aluminium adjuvants: how do they really work? fatty acid-induced nlrp -asc inflammasome activation interferes with insulin signaling inflammasome signaling at the heart of central nervous system pathology summary and conclusions of the sixty-seventh meeting of the joint fao/who expert committee on food additives if exposure to aluminium in antiperspirants presents health risks, its content should be reduced macrophagic myofasciitis lesions assess long-term persistence of vaccine-derived aluminium hydroxide in muscle structural basis of metal hypersensitivity diagnosis and treatment of metal-induced side-effects mercury and multiple sclerosis the beneficial effect of amalgam replacement on health in patients with autoimmunity metal-induced inflammation triggers fibromyalgia in metal-allergic patients the role of environmental factors in autoimmune thyroiditis orofacial granulomatosis associated with hypersensitivity to dental amalgam, oral surg nephrotic syndrome due to ammoniated mercury endemic clustering of multiple sclerosis in time and place mercury exposure and antinuclear antibodies among females of reproductive age in the united states: nhanes, environ. health perspect gold nephropathy: serologic data suggesting an immune complex disease nickel-induced allergy and contact dermatitis: does it induce autoimmunity and cutaneous sclerosis? an experimental study in brown norway rats aluminum in the central nervous system (cns): toxicity in humans and animals, vaccine adjuvants, and autoimmunity six revolutions in vaccinology from pasteur to genomics: progress and challenges in infectious diseases systems vaccinology vaccinomics, adversomics, and the immune response network theory: individualized vaccinology in the st century studies of twins in vaccinology vaccinomics current findings, challenges and novel approaches for vaccine development the hla genomic loci map: expression, interaction, diversity and disease the link between genetic variation and variability in vaccine responses: systematic review and meta-analyses development of polyarthritis after insertion of silicone breast implants followed by remission after implant removal in hla-identical sisters bearing rheumatoid arthritis susceptibility genes autoimmune/auto-inflammatory syndrome induced by adjuvants (asia) after quadrivalent human papillomavirus vaccination in colombians: a call for personalised medicine anticardiolipin and anti-beta( ) glycoprotein i antibodies in sera of apparently healthy children at regular preventive visits autoimmunity and hepatitis a vaccine in children bacterial induction of autoantibodies to beta -glycoprotein-i accounts for the infectious etiology of antiphospholipid syndrome vaccination-induced systemic autoimmunity in farmed atlantic salmon autoimmune response following annual influenza vaccination in apparently healthy adults high non-specific t lymphocyte response to the adjuvanted h n vaccine in comparison with the h n /h n /b-brisbane vaccine without adjuvant short and long-term effects of pandemic unadjuvanted influenza a(h n ) pdm vaccine on clinical manifestations and autoantibody profile in primary sjögren's syndrome pneumococcal vaccination of patients with systemic lupus erythematosus: effects on generation of autoantibodies immunogenicity and safety of a quadrivalent human papillomavirus vaccine in patients with systemic lupus erythematosus: a case-control study safety and immunogenicity of the quadrivalent hpv vaccine in female systemic lupus erythematosus patients aged to years anti-phospholipid antibodies following vaccination with recombinant hepatitis b vaccine development of autoantibodies before the clinical onset of systemic lupus erythematosus genetics and autoantibodies silicone and autoimmunity platinum in the environment: frequency of reactions to platinum-group elements in patients with dermatitis and urticaria silicone and scleroderma revisited rupture of silicone gel breast implants and symptoms of pain and fatigue the association between silicone implants and both antibodies and autoimmune diseases a comparison of autoantibody production in asymptomatic and symptomatic women with silicone breast implants silicone implant incompatibility syndrome (siis): a frequent cause of asia (shoenfeld's syndrome) management of chronic childhood immune thrombocytopenic purpura: aieop consensus guidelines rubella-associated arthritis. i. comparative study of joint manifestations associated with natural rubella infection and ra / rubella immunisation risk of chronic arthropathy among women after rubella vaccination. vaccine safety datalink team efficacy and duration of immunity after yellow fever vaccination: systematic review on the need for a booster every years risk of yellow fever vaccine-associated viscerotropic disease among the elderly: a systematic review bacillus calmette-guérin immunotherapy for genitourinary cancer arthritis after bcg vaccine in a healthy woman dermatomyositis after b.c.g. vaccination aetiopathogenesis of takayas's arteritis and bcg vaccination: the missing link? reactive arthritis induced by intravesical bcg therapy for bladder cancer: our clinical experience and systematic review of the literature systemic granulomatosis and hypercalcaemia following intravesical bacillus calmette-guérin immunotherapy universal hepatitis b vaccination in taiwan and the incidence of hepatocellular carcinoma in children. taiwan childhood hepatoma study group vaccines and autoimmunity hepatitis b vaccination and undifferentiated connective tissue disease: another brick in the wall of the autoimmune/inflammatory syndrome induced by adjuvants (asia) adverse reactions to human papillomavirus (hpv) vaccines sustained efficacy and immunogenicity of the hpv- / as -adjuvanted vaccine up to . years in young adult women detection of human papillomavirus l gene dna fragments in postmortem blood and spleen after gardasilreg. vaccination-a case report human papillomavirus (hpv) vaccine policy and evidence-based medicine: are they at odds? annual report: surveillance of adverse events following immunisation in australia annual report: surveillance of adverse events following immunisation in australia influenza vaccine and autoimmunity infection and death from influenza a h n virus in mexico: a retrospective analysis altered response to a(h n ) pnd vaccination in pregnant women: a single blinded randomized controlled trial adverse events following immunization with vaccines containing adjuvants antineutrophil cytoplasmic antibody vasculitis associated with influenza vaccination hughes syndrome) met the autoimmune/inflammatory syndrome induced by adjuvants (asia) meningococcal group b vaccines comparative long-term adverse effects elicited by invasive group b and c meningococcal infections immune response, antibody persistence, and safety of a single dose of the quadrivalent meningococcal serogroups a, c, w- , and y tetanus toxoid conjugate vaccine in adolescents and adults: results of an open, randomised, controlled study vaccines and guillain-barré syndrome henoch-schölein purpura and polysaccharide meningococcal vaccine infantile bullous pemphigoid developing after hexavalent, meningococcal and pneumococcal vaccinations the risk of sequelae due to pneumococcal meningitis in high-income countries: a systematic review and meta-analysis burden of disease caused by streptococcus pneumoniae in children younger than years: global estimates fda. pneumococcal -valent conjugate vaccine (diphtheria crm protein) prevnar ® decline in invasive pneumococcal disease after the introduction of protein-polysaccharide conjugate vaccine comparative reactogenicity and immunogenicity of valent pneumococcal vaccine administered by intramuscular or subcutaneous injection in elderly adults safety and immunogenicity of a -valent pneumococcal conjugate vaccine pneumococcal polysaccharide vaccination in rheumatoid arthritis patients receiving tocilizumab therapy eular recommendations for vaccination in adult patients with autoimmune inflammatory rheumatic diseases tetanus a review of the literature optic neuritis and myelitis after booster tetanus toxoid vaccination antiphospholipid syndrome: clinical and immunologic manifestations and patterns of disease expression in a cohort of patients crystal structure of human beta -glycoprotein i: implications for phospholipid binding and the antiphospholipid syndrome induction of anti-phospholipid syndrome in naive mice with mouse lupus monoclonal and human polyclonal anti-cardiolipin antibodies characterization of antiphospholipid antibodies in chronic hepatitis b infection influenza vaccination and the production of anti-phospholipid antibodies in patients with systemic lupus erythematosus unraveling the soul of autoimmune diseases: pathogenesis, diagnosis and treatment adding dowels to the puzzle vaccines and autoimmune diseases of the adult effect of belimumab on vaccine antigen antibodies to influenza, pneumococcal, and tetanus vaccines in patients with systemic lupus erythematosus in the bliss- trial ten cases of systemic lupus erythematosus related to hepatitis b vaccine prevalence of cervical human papillomavirus infection in women with systemic lupus erythematosus revised international chapel hill consensus conference nomenclature of vasculitides large artery vasculitis following recombinant hepatitis b vaccination: cases etiology and precipitating factors of necrotizing angiitis with respiratory manifestations. case reports cutaneous polyarteritis nodosa in a child following hepatitis b vaccination systemic polyarteritis nodosa following hepatitis b vaccination kawasaki disease in an infant following immunisation with hepatitis b vaccine yellow fever vaccination and kawasaki disease churg-strauss vasculitis with brain involvement following hepatitis b vaccination anca-associated vasculitis following influenza vaccination: causal association or mere coincidence? influenza vaccination in anca-associated vasculitis henoch-schönlein purpura after hepatitis a vaccination henoch-schönlein purpura following influenza a h n vaccination henoch-schönlein purpura following influenza vaccinations during the pandemic of influenza a (h n ) leukocytoclastic vasculitis after influenza vaccination vasculitis related to hepatitis a vaccination hypersensitivity vasculitis after hepatitis b vaccination leukocytoclastic vasculitis after pneumococcal vaccination allergic reaction to varicella vaccine vasculitides associated with infections, immunization, and antimicrobial drugs lymphocytic vasculitis associated with the anthrax vaccine: case report and review of anthrax vaccination panuveitis and dermal vasculitis following mmr vaccination can immunisation trigger rheumatoid arthritis? risk of rheumatoid arthritis following vaccination with tetanus, influenza and hepatitis b vaccines among persons - years of age anti-cytokine vaccination in autoimmune diseases exploiting t. cell crosstalk as a vaccination strategy for rheumatoid arthritis vaccination with selected synovial t cells in rheumatoid arthritis undifferentiated ctd a wide spectrum of autoimmune diseases analysis of the evolution of uctd to defined ctd after a long term follow-up undifferentiated connective tissue disease after silicone-gel testicular implantation connective tissue disease following hepatitis b vaccination prevalence of alopecia areata in the first national health and nutrition examination survey tracing environmental markers of autoimmunity: introducing the infectome onset of alopecia areata after epstein-barr virus infectious mononucleosis hair loss after varicella zoster virus infection hair loss after routine immunizations recombinant human hepatitis b vaccine initiating alopecia areata: testing the hypothesis using the c h/hej mouse model alopecia universalis in an adult after routine tetanus toxoid vaccine telogen effluvium following bivalent human papillomavirus vaccine administration: a report of two cases acute-onset madarosis following mmr vaccination long-term outcome of otherwise healthy individuals with incidentally discovered borderline thrombocytopenia immune thrombocytopenic purpura (itp) associated with vaccinations: a review of reported cases epidemiology of paediatric immune thrombocytopenia in the general practice research database effect of eradication of helicobacter pylori in children with chronic immune thrombocytopenia: a prospective, controlled, multicenter study, pediatr immune thrombocytopaenic purpura: an autoimmune cross-link between infections and vaccines vaccination may be associated with autoimmune diseases viral infections and molecular mimicry in type diabetes childhood immunizations and type diabetes: summary of an institute for vaccine safety workshop. the institute for vaccine safety diabetes workshop panel stimulation of the developing immune system can prevent autoimmunity vaccinations may induce diabetes-related autoantibodies in one-year-old children lack of association between receipt of conjugate haemophilus influenzae type b vaccine (hboc) in infancy and risk of type (juvenile onset) diabetes: long term follow-up of the hboc efficacy trial cohort vaccination and risk of type diabetes mellitus in active component u. s. military difficulties in assessing the relationship, if any, between mumps vaccination and diabetes mellitus in childhood, pubmed,ncbi neurological and autoimmune disorders after vaccination against pandemic influenza a (h n ) with a monovalent adjuvanted vaccine: population based cohort study in bacille calmette-guérin vaccination and incidence of iddm in montreal, canada neonatal bacille calmette-guerin vaccination and type diabetes bacille calmette-guérin/dnahsp prime-boost is protective against diabetes in non-obese diabetic mice but not in the streptozotocin model of type diabetes narcolepsy: autoimmunity, effector t cell activation due to infection, or t cell independent, major histocompatibility complex class ii induced neuronal loss? passive transfer of narcolepsy: anti-trib autoantibody positive patient igg causes hypothalamic orexin neuron loss and sleep attacks in mice is narcolepsy a classical autoimmune disease? the pandemrix-narcolepsy tragedy: how it started and what we know today a novel algorithm for the diagnosis of celiac disease and a comprehensive review of celiac disease diagnostics infections may have a protective role in the etiopathogenesis of celiac disease rotavirus infection frequency and risk of celiac disease autoimmunity in early childhood: a longitudinal study a subset of anti-rotavirus antibodies directed against the viral protein vp predicts the onset of celiac disease and induces typical features of the disease in the intestinal epithelial cell line t influence of early environmental factors on lymphocyte subsets and gut microbiota in infants at risk of celiac disease; the proficel study cervical human papillomavirus infection in mexican women with systemic lupus erythematosus or rheumatoid arthritis giant cell arteritis and polymyalgia rheumatica after influenza vaccination: report of cases and review of the literature postvaccine vasculitis: a report of three cases clinical study of childhood acute disseminated encephalomyelitis, multiple sclerosis, and acute transverse myelitis in fukuoka prefecture inflammatory/post-infectious encephalomyelitis high level of cross-reactivity in influenza virus hemagglutinin-specific cd + t-cell response: implications for the initiation of autoimmune response in multiple sclerosis cross-reactivity with myelin basic protein and human herpesvirus- in multiple sclerosis myelin basic protein-reactive autoantibodies in the serum and cerebrospinal fluid of multiple sclerosis patients are characterized by low-affinity interactions tauopathy-like abnormalities and neurologic deficits in mice immunized with neuronal tau protein acute/relapsing experimental autoimmune encephalomyelitis: induction of long lasting, antigen-specific tolerance by syngeneic bone marrow transplantation autoimmune/inflammatory syndrome induced by adjuvants (shoenfeld's syndrome): clinical and immunological spectrum post-vaccination encephalomyelitis: literature review and illustrative case vaccinations and risk of central nervous system demyelinating diseases in adults acute disseminated encephalomyelitis cohort study: prognostic factors for relapse neuromyelitis optica following human papillomavirus vaccination hbv vaccine and dermatomyositis: is there an association? autoimmune blistering diseases of the skin pemphigus: etiology, pathogenesis, and inducing or triggering factors: facts and controversies does influenza vaccination induce bullous pemphigoid? a report of four cases bullous pemphigoid after herpes zoster vaccine administration: association or coincidence? reactivation of bullous pemphigoid after influenza vaccination pathophysiology of autoimmune polyneuropathies a review on the association between inflammatory myopathies and vaccination fibromyalgia and overlapping disorders: the unifying concept of central sensitivity syndromes etiology of fibromyalgia: the possible role of infection and vaccination infection and vaccination in chronic fatigue syndrome: myth or reality? review part : human herpesvirus- in central nervous system diseases pathogenesis of parvovirus b infection: host gene variability, and possible means and effects of virus persistence effects of staphylococcus toxoid vaccine on pain and fatigue in patients with fibromyalgia/chronic fatigue syndrome vaccination as teenagers against meningococcal disease and the risk of the chronic fatigue syndrome the sick building syndrome as a part of the autoimmune (auto-inflammatory) syndrome induced by adjuvants selective elevation of circulating ccl /mcp levels in patients with longstanding post-vaccinal macrophagic myofasciitis and asia cognitive functioning in gulf war illness health of uk servicemen who served in persian gulf war gulf war syndrome: is it due to a systemic shift in cytokine balance towards a th profile antibodies to squalene in us navy persian gulf war veterans with chronic multisymptom illness vaccination in adult patients with auto-immune inflammatory rheumatic diseases: a systematic literature review for the european league against rheumatism evidence-based recommendations for vaccination in adult patients with auto-immune inflammatory rheuma eular recommendations for vaccination in paediatric patients with rheumatic diseases vaccination against yellow fever among patients on immunosuppressors with diagnoses of rheumatic diseases updated consensus statement on the use of rituximab in patients with rheumatoid arthritis safety and efficacy of meningococcal c vaccination in juvenile idiopathic arthritis unexpectedly high incidence of persistent itching nodules and delayed hypersensitivity to aluminium in children after the use of adsorbed vaccines from a single manufacturer key: cord- -xnfdjriz authors: meenakshisundaram, ramachandran; senthilkumaran, subramanian; thirumalaikolundusubramanian, ponniah title: protective effects of vaccinations and endemic infections on covid- : a hypothesis date: - - journal: med hypotheses doi: . /j.mehy. . sha: doc_id: cord_uid: xnfdjriz nan severe acute respiratory distress syndrome (sars) -coronavirus (cov) infection is in the pandemic state with inter-country variations in the occurrence and case fatality. we believe that the low occurrence/fatality of covid- may be due to the existing vaccination status and endemicity of other infections which might have enhanced their immune system to face the challenges of covid- . we would like to highlight on possible reasons and the extended evolutionary synthesis (ees) to support our views. a few vaccines including bacille calmette-guerin (bcg) vaccination offer nonspecific immune effect ( )and this trained immunity gives protection against several other pathogens ( , ) and reduces viremia, it's virulence, sepsis and mortality ( , ) . so, a clinical trial has been initiated to ascertain the above fact ( ) . interestingly, bcg produces persistent conformational changes in innate and adaptive immune cells and increases interleukin- b secretion, which enhances anti-microbial immunity ( ) ( ) ( ) . also, antibodies generated against live attenuated measles vaccine provide neutralising effect on sars-cov and also induce antibodies against sars-cov antigen ( ) . since bcg and measles vaccines may provide some non-specific protection against covid- , these may be considered at least for the susceptible population before the development covid- specific vaccine. countries with a high prevalence of infections with dengue, chikungunya, malaria etc., have a low occurrence of covid- makes one to hypothesize that endemic infections may protect through interferon which retard subsequent illness/disease through viral interference ( , ) . this viral interference happens via multifactorial manners such as immune response, cellular response, rna interference and defective interfering particles or genomes of the host ( ) . the concept of cross-protection offered by previous herpetic infections against vaccinia lesions ( ) was first brought to light by edward jenner two centuries ago. previous experimental studies have revealed that beta coronaviruses are capable of inducing immune responses against one another by way of generating neutralizing antibodies which cross-react against other sars-cov viruses ( , ) . based on the above, we believe that the above principles may apply for the less occurrence of covid- in regions where other viral infections are prevalent. overall the organisms and individuals based on previous exposure to vaccines and infections come from the environment, internal sensors, memorized experience, and genome prefer to develop pathways in a goal-directed manner and improve the behavioural traits and phenotypic variability so as to protect and survive from infectious agents. all these are considered under ees by pigliucci and müller( ) and ees brings out the hidden morphogenetic capabilities and protect the organisms/cells. cross immunity though helps, the questions to be considered are: "will crossimmunity enhance career status for covid- and make the disease endemic or contribute to mutations of viruses and hamper vaccine research/vaccination against covid- ?", "will the low levels of cross-immunity produced from the other beta coronaviruses make sars-cov- to die out, and/ or will it contribute to a resurgence of the same after a few years ( ) ?". further studies are warranted to answer the above. till then, we accept that nature and science strengthen the immune system through repeated infections and vaccinations respectively, and prepares living organisms to face the challenges of existing, emerging and re-emerging infections. during this process, infectious agents may mutate, and attack the living organisms differently. all are aware that we can't fight against nature, but live in a symbiotic/harmonious manner with other infectious agents as much as possible with and/ or without vaccinations. thus, the successful one survives and life propagates forever. considering bcg vaccination to reduce the impact of covid- connecting bcg vaccination and covid- : additional data. medrxiv correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study. medrxiv non-specific effects of bcg vaccine on viral infections routine vaccinations and child survival: follow up study in reducing health care workers absenteeism in covid- pandemic through bcg vaccine (bcg-corona) bcg vaccination may be protective against covid- trained immunity: a program of innate immune memory in health and disease long-term in vitro and in vivo effects of gamma-irradiated bcg on innate and adaptive immunity induction of neutralising antibodies and cellular immune responses against sars coronavirus by recombinant measles viruses investigating viral interference between influenza a virus and human respiratory syncytial virus in a ferret model of infection evidence for viral interference and cross-reactive protective immunity between influenza b virus lineages viral interference and persistence in mosquito-borne flaviviruses on the effects of cutaneous eruptions an outbreak of human coronavirus oc infection and serological cross-reactivity with sars coronavirus cross-reactive antibodies in convalescent sars patients' sera against the emerging novel human coronavirus emc ( ) by both immunofluorescent and neutralizing antibody tests elements of an extended evolutionary synthesis projecting the transmission dynamics of sars-cov- through the postpandemic period key: cord- -ty wbtkv authors: chugh, tulsi title: timelines of covid- vaccines date: - - journal: curr med res pract doi: . /j.cmrp. . . sha: doc_id: cord_uid: ty wbtkv nan potential conflicts of interest: the author has nothing to disclose keywords: coronavirus, covid- , vaccine, sars-cov- world health organisation discussed the "top threats to human health in ," and developed a strategic plan to meet the challenges. among the communicable diseases. emerging and re-emerging viral pathogens causing global pandemic with devastating results were emphasised. severe acute respiratory syndrome coronavirus- (sars-cov- ) has caused a pandemic of coronavirus disease - (covid- ) with global public health and economic crisis. there is an urgent need for diagnostic and therapeutic countermeasures and rapid development of a vaccine for prevention and control of this formidable disease. since the who notification of first case of this disease on st dec, and a complete genome sequence of the virus on jan , , global attempts to produce a suitable vaccine are ongoing in scores of laboratories. most of the coroviruses in humans including covid- are derived from bats and there is a variable similarity between them. the whole genome sequence of covid - has about % similarity to that of mers-cov. the novel virus is a single strand rna which attaches to the human cell using through angiotensin converting enzyme (ace- ) receptors like middle east respiratory syndrome (mers) and severe acute respiratory syndrome (sars). there is a continuing evolution of this virus globally including the ones seen in eastern india. the geographic distribution, and severity of disease and risk of subsequent waves caused by these genomic variants is currently unknown. phases of vaccine development. , various phases of vaccine development are: preclinical trials are done in suitable animals for safely and efficacy by challenge studies. clinical studies are made in phase: phase i: vaccines are given to a limited number of human volunteers with emphasis on safety and also to monitor the immune response. phase ii: this is done by vaccine administration to a few hundred volunteers of various age groups to further study safety and efficacy. phase iii: it is done by giving vaccine to thousands of volunteers to monitor protection and safety. phase iv: it is post-marketing surveillance for protection and any adverse events. finally the data is analysed and evaluated for submission to regulatory authorities for approval. the whole process may take several years. however, in an emergency situation as now, it can be compressed by simultaneous phase to trials and scientific collaboration in various institutions. around vaccine candidates are under active development and are in human clinical trials. virus vaccine candidates: . inactivated virus vaccines: virus may be inactivated by treatment with heat or a chemical but viral surface proteins a left actue. however, it may not be potent immunogenic and repeat doses may be required. example: salk vaccine. . live -attenuated vaccine: virus is modified so that it is immunogenic but a virulent (sabin poleo vaccine). . non-replicating viral vector vaccines: genes of viral proteins are identified and put into a harmless carrier virus to be delivered into the host cell which make the viral protein and stimulate immune system of the host. university of oxford with astrazeneca are using this approach. . replicating viral vector vaccines: the harmless viral vector may multiply in the host, produce copies of vaccine proteins and produce protective antibodies. used for ebola vaccine. . rna vaccine: rna codes for the spike protein on the surface of covid- . rna vaccine stimulates immune system to produce protective antibodies against viral s protein. carries genetic instruction to host cells to produce rna which in true stimulates immune system to produce antibodies. the actual viral protein is injected and immune system produces corresponding protective antibodies. novavax is using this approach. repurposed vaccine , , , bacillus calmette-guerin (bcg) vaccine is a live attenuated vaccine against tuberculosis. it is the most used vaccine used in the world and ~ %. children in india are vaccinated at birth. various epidemiological studies show that it significantly reduces disseminated tuberculosis and its mortality in infants. this is due to protection by bcg against unrelated respiratory pathogens and neonatal sepsis. bcg activates innate cells which engulf and kill virus. (trained immunity). another related organism, mycobacterium vaccae also has protective action in mouse model and humans against tuberculosis when used for immunotherapy. bcg enhances innate immunity and may reduce viral load of covid- and may reduce cytokine storm. bcg has a general boosting effect. some ecological studies do suggest a "link between prior bcg vaccine and recorded cases of covid- ". however, more studies are required. professor david levine from university of california, berkeley states that there is a "shred of evidence" from studies in spain and italy that bcg may protect against covid- . timeline of vaccines , , as frantic efforts are being made to have the vaccines at the earliest. it is expected that we may have these in place by early next year. however, there are several logistical and policy dilemmas: affordability, fair distribution in various countries, priority of professional individuals, dosage, vaccine hesitancy, repeat doses, and prohibitive cost. the author has nothing to disclose covid- : a comprehensive review of a formidable foe and the road ahead pandemic preparedness: developing vaccines and therapeutic antibodies for covid- the early landscape of covid- vaccine development in the uk and rest of the world bcg-induced trained immunity: can it offer protection against covid- ? bcg vaccination enhances the immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized, placebocontrolled pilot study improved immunotherapy for pulmonary tuberculosis with mycobacterium vaccae effects of mycobacterial vaccae vaccine in a mouse model of tuberculosis: protective action and differentially expressed genes mutations in sars-cov- viral rna identified in eastern india: possible implications for the ongoing outbreak in india and impact on viral structure and host susceptibility spike mutation pipeline reveals the emergence of a more transmissible form of sars-cov- . biorxiv sars-cov- rates in bcg-vaccinated and unvaccinated young adults key: cord- - kus mz authors: aziz, asma binte; dembinski, jennifer l.; jahan, yasmin title: debate on bacille calmette-guérin vaccination against covid- : is it worth performing clinical trials? date: - - journal: biosaf health doi: . /j.bsheal. . . sha: doc_id: cord_uid: kus mz the non-specific beneficial effects of bacille calmette-guérin (bcg) vaccination suggest that this vaccine might play a role in protecting individuals against severe coronavirus disease (covid- ).several studies propose that bcg vaccination may increase the body's immunity, thereby preventing respiratory infections caused by other respiratory pathogens. as the number of deaths due to covid- is increasing rapidly and there is no specific treatment available to date, scientists are evaluating the effectiveness of already approved drugs as therapies against covid- , and the results were found to vary widely: from no significant effect being observed to a reduction in the time taken for clinical improvement. this study thus aims to evaluate whether it is worth performing clinical trials to examine the effects of the bcg vaccine on covid- . we herein emphasize the need to conduct phase iii randomized controlled trials with an adequate sample size and quality to investigate the effects of the bcg vaccine on covid- . in the event that bcg vaccination provides non-specific protection against covid- , administering it could be helpful in controlling the transmission of covid- and other infectious diseases during future pandemics. j o u r n a l p r e -p r o o f vaccination [ ] . therefore, these non-specific beneficial effects of bcg vaccination suggest that the vaccine could play a role in protecting individuals against severe coronavirus disease (covid- ) caused by severe acute respiratory syndrome coronavirus (sars-cov- ) [ ] . in march , the world health organization declared covid- a pandemic as it had spread to more than countries and territories. the existing healthcare systems of even some of the most developed countries failed to control the disease. although the sars-cov- virus mostly causes fever and cough in affected individuals, it can lead to fatal respiratory symptoms in severe cases. further, no approved treatment for covid- is available to date. the number of deaths from covid- continues to increase rapidly, prompting scientists to discover an easy curative or preventive intervention that can have an instant global impact by saving thousands of lives. evaluating the effectiveness of already approved drugs as therapies against covid- is one of the strategies currently employed in this regard. the results published vary widely and range from no significant effects being observed to results indicating a reduction in time for clinical improvement [ ] . therefore, this manuscript aims to evaluate whether performing clinical trials to examine the efficacy of bcg vaccination against covid- is worthwhile. once researchers observed higher frequencies of cases of and mortalities from covid- in certain countries than in others [ ] , a debate on the efficacy of the bcg vaccine sparked. scientists then compared data from countries with and without mandatory bcg vaccination policies in their routine immunization programs in an attempt to account for this difference. in a paper published in jama, hamiel et al. analyzed data from israel, where bcg vaccination was part of routine immunization until . the results of the analysis did not support the theory that bcg vaccination in childhood had a protective effect against covid- in adulthood. however, the investigators of the study did not reach any conclusion about the association between bcg vaccination status and the severity of covid- due to few number of severe cases [ ] . moreover, researchers also noticed a trend of slower transmission of the virus in countries with a national vaccination policy that requires bcg vaccination [ ] . another study found that the incidence and mortality rates were significantly lower among residents of countries with current universal bcg vaccination policies than in residents of countries without or with discontinued bcg vaccination policies [ ] . nevertheless, it is unclear whether bcg vaccination can decrease covid- incidence. additionally, although these results show interesting trends, they are j o u r n a l p r e -p r o o f prone to significant bias because of the presence of confounders such as unknown vaccination status [ ] and inconsistences in testing rates and reporting between countries [ ] . therefore, it is difficult to draw any conclusion about the efficacy of the bcg vaccine against covid- without conducting further controlled clinical trials. a controlled study to evaluate the efficacy of bcg vaccination in protecting against covid- is warranted for several reasons, the most important of which is the non-specific b. bcg vaccination has been found to decrease the risk of pneumonia in people aged > years who have comorbidities, and it was also found to significantly prevent acute upper respiratory tract infections [ ] ; c. bcg vaccination shows enhanced immunogenicity in response to the a(h n ) strain of the pandemic trivalent influenza vaccine but not to the a(h n ) and a(h n ) vaccine strains, for unknown reasons [ ] d. bcg vaccination has reduced viremia following yellow fever infection, which is correlated with il- b production [ ] . these findings suggest that as the bcg vaccine exerts non-specific effects on cytokine responses following infection by some unrelated viral pathogens, it may be able to increase the body's immunity, resulting in the prevention of respiratory infections caused by other pathogens. finally, in addition to the phase iii trials that are currently underway, more rcts with adequate sample size and quality could be conducted to investigate the effects of bcg vaccination against covid- . given the limited production of the bcg vaccine, scientists could also consider initiating studies using new tb vaccine candidates that are in phase ii of clinical trials and have been shown to confer an immunity similar to that conferred by the traditional bcg vaccine [ ] . in the event that any of those vaccines provide non-specific protection, they may be used to bridge the gap before a covid- -specific vaccine is developed, which could be a significant means to control the transmission of covid- and similar infectious diseases during future pandemics. history of bcg vaccine trained immunity-based vaccines: a new paradigm for the development of broad-spectrum anti-infectious formulations trained immunity: a tool for reducing susceptibility to and the severity of sars-cov- infection long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity considering bcg vaccination to reduce the impact of covid- . the lancet remdesivir in adults with severe covid- : a randomised, double-blind, placebo-controlled, multicentre trial sars-cov- rates in bcg-vaccinated and unvaccinated young adults. jama, e . advance online publication covid- : what treatments are being investigated exercising caution in correlating covid- incidence and mortality rates with bcg vaccination policies due to variable rates of sars cov- testing is bcg vaccination causally related to reduced covid- mortality? non-specific effects of bcg vaccine on viral infections. clinical microbiology and infection : the official publication of the european society of clinical microbiology and infectious diseases the efficacy of bacillus calmette-guerin vaccinations for the prevention of acute upper respiratory tract infection in the elderly bcg vaccination enhances the immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized, placebo-controlled pilot study bcg vaccination protects against experimental viral infection in humans through the induction of new live attenuated tuberculosis vaccine mtbvac journal pre-proof j o u r n a l p r e -p r o o f none the authors declare that there are no conflicts of interest. key: cord- - sm r v authors: kuratani, n. title: association of national bacille calmette-guerin vaccination policy with covid- epidemiology: an ecological study in countries date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: sm r v a possible association between national bacille calmette-guerin (bcg) vaccination policy and lower covid- incidence has been suggested in some preprint papers. using publicly accessible databases, i explored associations of national bcg vaccination policy with covid- epidemiology in countries. data collection was conducted from april to may , . i compared countries that have a current universal bcg vaccination policy (bcg countries), with countries that currently lack such a policy (non-bcg countries). the mixed effect model revealed national bcg policy decreases in the country-specific risk of death by covid- , correspond to odds ratio of . ( % confidence intervals . - . , p = x - ). in bcg countries, the case increase rate was attenuated marginally by . % ( % ci . to . , p= . ) as compared with those of the non-bcg countries. although the protective mechanism of bcg vaccination against covid- remains unknown, further laboratory and clinical research should be warranted. . cc-by-nc . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint abstract a possible association between national bacille calmette-guérin (bcg) vaccination policy and lower covid- incidence has been suggested in some preprint papers. using publicly accessible databases, i explored associations of national bcg vaccination policy with covid- epidemiology in countries. data collection was conducted from april to may , . i compared countries that have a current universal bcg vaccination policy (bcg countries), with countries that currently lack such a policy (non-bcg countries). the mixed effect model revealed national bcg policy decreases in the country-specific risk of death by covid- , correspond to odds ratio of . ( % confidence interval . - . , p= × − ). in bcg countries, the case increase rate was attenuated marginally by . % ( % confidence interval . to . , p= . ) as compared with those of the non-bcg countries. although the protective mechanism of bcg vaccination against covid- remains unknown, further laboratory and clinical research should be warranted. . cc-by-nc . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . a possible association between national bacille calmette-guérin (bcg) vaccination policy and lower covid- incidence has been suggested in some preprint papers. , , given the seriousness of the worldwide covid- pandemic and the lack of an effective mitigation strategy, the protective effect of bcg on covid- epidemic is a matter of great interest. although an ecological study can be confounded by various biases and an ecological fallacy is always concern to understand the results, the findings can provide the evidence to conduct further prospective clinical researches. i examined the association between national bcg vaccination policy and the case fatality rate of covid- in countries. i also explored the relationship between bcg vaccination policy and the speed of covid- increase within the countries. data for the analysis were extracted from publicly accessible databases on websites. data collection was conducted from april to may , . inclusion criteria of the countries analyzed were: ) defined by the world bank as an upper-income or upper-middle-income country, and ) country for which the necessary data were available. countries with less than confirmed cases were excluded from the analysis. i compared countries that have a current universal bcg vaccination policy (bcg countries), with countries that currently lack such a policy (non-bcg countries). i focused two outcome measures to evaluate the impact of national bcg policy on covid- epidemiology. in this study, the case fatality rate (cfr) was defined as the proportion of reported number of deaths due to covid- compared to the total confirmed cases on april , . the cfrs of the countries were stratified by bcg policy and were combined by fixed or random effects models to estimate the pooled cfr with % . cc-by-nc . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint confidence intervals ( % ci). a mixed effect logistic regression model was constructed to calculate a country-specific odds ratio for the effect of national bcg policy on the cfr. i did all analyses in r (version . . , "metaprop" for the cfr pooling, "lme " for mixed effect model, "geepack" for gee). i considered p values of less than . to be significant. a total of countries (bcg countries: n= ; non-bcg countries: n= ) met for the inclusion criteria for this study. the total number of deaths in the countries was , (on april , ) and this accounted for . % of world covid- mortalities to that date. as figure illustrates, there were significant heterogeneities in the cfr among the countries analyzed. the pooled cfr stratified by national bcg policy was significantly lower mortality in the bcg countries than in the non-bcg countries (figure ) . the mixed effect model revealed national bcg policy decreases in the country-specific risk of death correspond to odds ratio of . ( % ci . - . , p= × − ). . cc-by-nc . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint figure shows the case number trajectories for newly diagnosed patients in the first weeks of the epidemic in countries. assuming "independence" correlation structure, the gee modeling showed significant time effect and time-by-group interaction. the coefficients of the gee model can be translated so that the marginal mean rate ratio of the case increase in the non-bcg countries was . ( % ci . to . , p= × − ) every week in initial weeks. in bcg countries, the case increase rate was attenuated marginally by . % ( % ci . to . , p= . ) as compared with those of the non-bcg countries. my analysis indicates that countries with national mandatory bcg vaccination policies have lower reported covid- mortality than those without such policies. also, countries with current mandatory bcg policies show slower spread of covid- infection than those without such policies. although the protective mechanism of bcg vaccination against covid- remains unknown, further laboratory and clinical research should be warranted. . cc-by-nc . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint bcg vaccination may be protective against covid- correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study relationship between covid- death toll doubling time and national bcg vaccination policy coronavirus covid- global cases the world bank country classification by income fiscal year. accessed the world bcg atlas it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review)the copyright holder for this preprint this version posted may , . . cc-by-nc . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint key: cord- -cv th hd authors: moorlag, simone j.c.f.m.; van deuren, rosanne c.; van werkhoven, cornelis h.; jaeger, martin; debisarun, priya; taks, esther; mourits, vera p.; koeken, valerie a.c.m.; de bree, l. charlotte j.; doesschate, thijs ten; cleophas, maartje c.; smeekens, sanne; oosting, marije; van de veerdonk, frank l.; joosten, leo a.b.; oever, jaap ten; van der meer, jos w.m.; curtis, nigel; aaby, peter; stabell-benn, christine; giamarellos-bourboulis, evangelos j.; bonten, marc; van crevel, reinout; netea, mihai g. title: safety and covid- symptoms in individuals recently vaccinated with bcg: a retrospective cohort study date: - - journal: cell rep med doi: . /j.xcrm. . sha: doc_id: cord_uid: cv th hd summary bacille calmette-guérin (bcg) induces long-term boosting of innate immunity, termed trained immunity, and decreases susceptibility to respiratory tract infections. bcg vaccination trials for reducing sars-cov- infection are underway, but concerns have been raised regarding the potential harm of strong innate immune responses. to investigate the safety of bcg vaccination, we retrospectively assessed coronavirus disease (covid- ) and related symptoms in three cohorts of healthy volunteers who either received bcg in the last five years or not. bcg vaccination is not associated with increased incidence of symptoms during the covid- outbreak in the netherlands. our data suggest that bcg vaccination might be associated with a decrease in the incidence of sickness during the covid- pandemic (aor . , p < . ), and lower incidence of extreme fatigue. in conclusion, recent bcg vaccination is safe and large randomized trials are needed to reveal if bcg reduces the incidence and/or severity of sars-cov- infection. it is expected that the infection will remain endemic in the population for years to come, with regular outbreaks when quarantine measures are relaxed and in the winter seasons. vaccination would be the most optimal tool for infection prevention. although more than different initiatives around the world are trying to develop a disease-specific vaccine, it is likely that at least . - years will be needed to produce an effective vaccine. other measures to contain the infection are therefore urgently needed. table s for an overview of survey questions figure a ). importantly, none of the bcg-vaccinated (or control) individuals reported admission to hospital, suggesting that bcg vaccination is not associated with increased risk of hospitalization during the sars-cov- pandemic in this population ( figure b ). serological surveys in the netherlands show that between . netherlands, resulting in significant regional differences in the number of covid- cases . the large majority of the individuals that participated in this study are either residents of the similar to the incidence of reported sickness, the incidence of reporting at least one symptom was significantly lower in the bcg-vaccinated group as compared to the control group after adjusting for confounders (aor . , p < . , model fit p = . ) ( figure e , figure s ). the most common reported symptoms were rhinorrhea and sore throat, followed by cough figure a ). in line with these findings, no differences were observed in circulating cytokines for any of the symptoms ( figure b and figure s ). to assess whether the ability to build a trained immunity response following bcg induced tnf-α n = ). the incidence of self-reported sickness ( figure b ) as well as the incidence of symptoms ( figure c and d, figure s ) was not significantly different between responders and non-responders, indicating that a strong trained immunity profile is not associated with increased sickness or severity of symptoms during the covid- pandemic. in the present study we investigated whether a recent bcg vaccination is safe during the protection against covid- has also raised the concern that the strengthened cytokine university. individuals that participated in the fg study also participated later in the bcg study and received a bcg vaccination. these participants were therefore considered bcg participants in this study. as participants from the fg cohort were included approximately years ago, a lower response rate might be expected compared to the more was assessed (figure - ) . questionnaire data was exported from castor and analyzed in r version . . , using dplyr, tidyr, tidyverse and reshape for data inspection and transformation, ggplot and ggpubr for visualizations including statistics and rcompanion for more in-depth statistical analyses. chi- square tests were used for comparisons of categorical demographic characteristics (table ) (e.g. sex, age, bmi). finally, differences in distribution of bcg-vaccinated and bcg-non- givitcalibrationbelt-plot using the package givitir (see figure s ). statistics cytokine production and circulating mediators a multitude of evidence shows that both age and sex can influence circulating cytokines . in clinical features of patients infected with novel coronavirus in wuhan coronavirus disease (covid- ): situation report - trained immunity: a program of innate immune memory in health and disease randomized trial of bcg vaccination at birth to low-birth-weight children: beneficial nonspecific effects in the neonatal period? small randomized trial among low-birth-weight children receiving bacillus calmette-guerin vaccination at first health center contact association of bcg, dtp, and measles containing vaccines with childhood mortality: systematic review early bcg-denmark and neonatal mortality among infants weighing < g: a randomized controlled trial acute lower respiratory tract infections and respiratory syncytial virus in infants in guinea-bissau: a beneficial effect of bcg vaccination for girls community based case-control study the efficacy of bacillus calmette-guerin vaccinations for the prevention of acute upper respiratory tract infection in the elderly bcg vaccination protects against experimental viral infection in humans through the induction of considering bcg vaccination to reduce the impact of covid- the pathogenesis and treatment of the `cytokine storm' in covid- protecting health-care workers from subclinical coronavirus infection epidemiology of and risk factors for coronavirus infection in health care workers: a living rapid review current information about covid- illness, disease, and sickness absence: an empirical test of differences between concepts of ill health immunometabolic pathways in bcg-induced trained immunity autophagy controls bcg-induced trained immunity and the response to intravesical bcg therapy for bladder cancer covid- : a model correlating bcg vaccination to protection from mortality implicates trained immunity. medrxiv trained immunity: a tool for reducing susceptibility to and the severity of sars- cov- infection bcg-induced trained immunity: can it offer protection against covid- ? nonspecific protection of mice against influenza virus infection by local or systemic immunization with bacille calmette-guerin effects of immunostimulants on resistance of newborn mice to herpes simplex type infection bcg vaccination in humans elicits trained immunity via the mycobacterial growth inhibition is associated with trained innate immunity defining trained immunity and its role in health and disease correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study differential covid- -attributable mortality and bcg vaccine use in countries. medrxiv association of bcg vaccination policy with prevalence and mortality of covid- . medrxiv universal bcg vaccination and protection against covid- : critique of an ecological study clinical course and risk factors for mortality of adult inpatients with covid- in wuhan, china: a retrospective cohort study pathological findings of covid- associated with acute respiratory distress syndrome. the lancet respiratory medicine effective treatment of severe covid- patients with tocilizumab complex immune dysregulation in covid- patients with severe respiratory failure sars-cov- rates in bcg-vaccinated and unvaccinated homogenous -plex pea immunoassay exhibiting high sensitivity, specificity, and excellent scalability a functional genomics approach to understand variation in key: cord- - ku cmwj authors: hajjo, rima; tropsha, alexander title: a systems biology workflow for drug and vaccine repurposing: identifying small-molecule bcg mimics to reduce or prevent covid- mortality date: - - journal: pharm res doi: . /s - - - sha: doc_id: cord_uid: ku cmwj purpose: coronavirus disease (covid- ) is expected to continue to cause worldwide fatalities until the world population develops ‘herd immunity’, or until a vaccine is developed and used as a prevention. meanwhile, there is an urgent need to identify alternative means of antiviral defense. bacillus calmette–guérin (bcg) vaccine that has been recognized for its off-target beneficial effects on the immune system can be exploited to boast immunity and protect from emerging novel viruses. methods: we developed and employed a systems biology workflow capable of identifying small-molecule antiviral drugs and vaccines that can boast immunity and affect a wide variety of viral disease pathways to protect from the fatal consequences of emerging viruses. results: our analysis demonstrates that bcg vaccine affects the production and maturation of naïve t cells resulting in enhanced, long-lasting trained innate immune responses that can provide protection against novel viruses. we have identified small-molecule bcg mimics, including antiviral drugs such as raltegravir and lopinavir as high confidence hits. strikingly, our top hits emetine and lopinavir were independently validated by recent experimental findings that these compounds inhibit the growth of sars-cov- in vitro. conclusions: our results provide systems biology support for using bcg and small-molecule bcg mimics as putative vaccine and drug candidates against emergent viruses including sars-cov- . electronic supplementary material: the online version of this article ( . /s - - - ) contains supplementary material, which is available to authorized users. few months after the declaration of covid- pandemic by the world health organization (who), the disease-causing virus is still sweeping the globe, causing more fatalities, failing health care systems, and resulting in severe economic losses. currently there are no approved drugs to treat covid- , and new vaccine development is expected to take at least - months ( , ), with growing fears of possible failure associated with changes in viral antigenic determinants ( ) or shortlived immunity ( ) . additionally, the highly specific virusneutralizing antibodies in recovered patients may be short lived and ineffective in preventing the disease caused by the emerging variable strains of the virus ( ) . with these uncertainties regarding an eminent specific sars-cov- vaccine, there is a need to search for current alternatives, such as agents that can stimulate or emulate the unique capabilities of our innate immune system. recent immuno-oncology success stories indicate that the best cancer-fighting strategies results from unleashing the patients' immune power ( ) ( ) ( ) ( ) . there is an increased awareness that harnessing innate immune responses, opens up new possibilities for long-term, multifaceted tumor control ( , ) and infectious disease prevention ( ) ( ) ( ) . therefore, next generation antiviral vaccines should be capable of boosting innate immune responses to tackle a wide range of novel pathogens very early after exposure, as single treatments or adjuvants to traditional vaccines targeting the adaptive immune system. accumulating evidence from the biomedical literature indicates that sars-cov-mediated pathology, a very similar pathology to sars-cov- , was mainly caused by ineffective innate immune responses, associated with a severe reduction in the number of t cells in the blood ( ) . recent evidence indicated that sars-cov- and mycobacterium tuberculosis (mtb) share unique similarities in terms of the host protein interaction partners, and both pathogens infect lung tissues ( ) . on the other hand, old 'polypharmacological' vaccines, such as the bcg vaccine for tuberculosis (tb), has shown promising therapeutic effects for a wide range of infectious and non-infectious diseases including bladder cancer ( ) ( ) ( ) . studies showed that bcg's polypharmacological effects were not limited to memory t cell immunity, but promoted strong, beneficial, and long-lasting effects on innate immunity. the who also recognized these beneficial 'offtarget' effects of bcg, calling for a further investigation to repurpose this vaccine for other orphan life-threatening diseases ( ) . indeed, there are multiple clinical trials testing bcg for conditions other than tb including studies for covid- as reported on clinicaltrials.gov ( ) . additionally, few recent peer-reviewed reports have pointed to an epidemiological relationship between bcg and covid- without providing substantial evidence ( ) ( ) ( ) ( ) . one should expect that the results of the randomized clinical trials (rcts) will help establish the value of the bcg vaccine as a treatment or prophylactic against the disease. herein, we describe a unique drug and vaccine repurposing workflow, and list high confidence proteins and pharmacological classes of compounds, that work as bcg mimics at the system level by inducing beneficial long lasting trained immune response. we also propose that bcg mimics can be used as alternatives to bcg in protecting from covid- and other emergent infectious diseases. we have developed and applied a systems biology workflow to study the bcg network pharmacology and prioritize smallmolecule bcg mimics and antivirals. this workflow is based on our original chemocentric informatics workflow described thoroughly in a previous report ( ) . our current workflow ( fig. ) incorporates three major components: ( ) a module for mining and prioritizing gene signatures representative of a condition or a biological state; ( ) a network-mining module to identify genetic perturbations that induce gene expression profiles that are highly enriched with the genes constituting the condition gene signature; and ( ) a pathway enrichment module to understand the biological processes involved in the mechanism of action of bcg and highly correlated genetic perturbagens. a consensus gene signature for bcg vaccine was derived from gene expression profiles in peripheral blood mononuclear cells (pbmcs) in response to a bcg challenge test reported by matsumiya et al ( ) , gse dataset on ncbi gene expression omnibus (geo) ( ) . we used the data collected from whole blood samples taken from healthy human subjects enrolled in phase trial (clinical trials registration: nct ). for the purposes of this study we used the gene expression profiles generated from two human subject groups included in the above trial: group (bcg naive), and group (bcg vaccinated; median time since vaccination, years). to study network pharmacology and query the connectivity map, we developed a consensus gene signature using genes that showed significant differential gene expression in response to a bcg challenge test (stimulated) in comparison with controls (unstimulated) on days and in both groups and . a systematic search, for nearest neighbor (nn) genes/proteins of the upregulated and downregulated genes in bcg's gene signature, was conducted in cytoscape ( ) version . . using the string ( ) protein query application. all retrieved protein-protein interactions (ppis), including both physical and functional interactions were retrieved from widely used and reliable databases such as mint ( ) , hprd ( ), bind ( ) , dip ( ), biogrid ( ) , kegg ( ), reactome ( ), ecocyc ( ) , nci-nature pathway interaction database ( ) , and gene ontology (go) ( ) protein complexes. network building tools in cytoscape version . . were used to generate ppi networks for bcg-cgs. enrichment analysis was conducted in cytoscape ( ) and metacore to identify pathways and biological processes associated with bcg-cgs and cmap genetic connections. the significance of the enrichment was determined by the hypergeometric test ( ) . all terms from the ontology were ranked based on their calculated p values. ontology terms with p values less than the p value threshold . are defined as statistically significant and therefore relevant to the studied list of genes. all terms from the ontology were ranked according to their calculated p values. the cmap ( , ) is a chemogenomics database that catalogs . million profiles of transcriptional responses of human cells to chemical and genetic perturbations. currently, there are , perturbagens ( , small molecules, and genetic perturbagens) producing , expression signatures in human cell lines: pc , vcap, a , a , ha e, hcc , ht , mcf , hepg . this database of cellular signatures has been produced using the l platform ( ) ; a high-throughput gene expression assay that measures the mrna transcript abundance of "landmark" genes from human cells. causal reasoning ( ) analysis identifies genes and proteins of a 'topological significance' in order to make decisions whether these genes/proteins are eligible for targeting in the studied phenotype. in this study, we applied causal reasoning to identify molecular regulators that most likely directly cause the observed expression changes in transcriptional profiles in response to bcg. in this approach, changes in gene expression in both directions as well as the effect of edges in the network are taken into account. for each node (i.e., gene) in the causal reasoning network, observed changes in expression are matched with the expected changes inferred from the network structure given the hypothesis that the observed gene expression is decreased or increased due to its activity. each node has an outgoing activation or inhibition effects on other objects in the knowledge database, and a key hub with a predicted increase in activity shows increased expression for those genes that the hub is known to activate, and it shows decreased expression for genes it is known to inhibit. each predicted key hub has a prediction p value which is produced as a result of a binomial test used to assess the probability of making a given number of supportive data out of all defined differentially expressed genes (degs) in the examined data. it is noteworthy that causal reasoning examines both direct neighbors of differentially expressed genes, and remote (several steps away) regulators. all causal reasoning predictions were performed in key pathway advisor from clarivate analytics, using the pollard method ( ). gplots ( ) v . . . was used for plotting enhanced heatmaps for transcriptional data (e.g., heatmap representing bcg-cgs in fig. ). heat maps were generated using the heatmap. function included in this package. to study the bcg polypharmacology and potential beneficial effects of this vaccine in preventing the fatal consequences of covid- , we have devised and implemented a 'network biology' workflow ( fig. ) to interrogate the hypothesis that bcg vaccination may protect from covid- fatalities. this workflow is based on our drug repurposing chemocentric informatics workflow which has been validated previously for small-molecule drug repurposing ( ) . the current workflow is tweaked towards vaccine repurposing by employing novel bioinformatic approaches to computationally model and connect molecular networks in an effort to understand the underlying 'network' biology of vaccines, and pinpoint the regulatory genes and proteins responsible for causing the observed beneficial multitherapeutic effects. although we are not the first group to use network biology approaches to study the transcriptional changes of vaccines, to our knowledge, this is the first study that uses these approaches both to support vaccine repurposing, specifically for covid- , as well as identify putative small molecule drugs that can mimic the vaccine effects. our workflow starts with the prioritization of a gene signature to study the bcg network pharmacology. first, we derived a consensus gene signature (cgs) for bcg based on geo's dataset gse ( ) . details on bcg-cgs signature are found in table s (supporting information). twenty-two differentially-expressed genes across all experiments ( groups × time points discussed in methods) formed bcg's consensus gene signature (bcg-cgs) shown in fig. a . all genes in bcg-cgs were used as seed nodes to build a protein-protein interaction network for signature genes (fig. b ). interactions were extracted from string database, and high confidence interactions included physical interactions (e.g., binding), functional interactions (e.g., activation, inhibition, catalysis), or gene co-expression. two types of networks were generated: ) high-confidence 'core' network restricted to bcg signature genes as network nodes and high confidence (≥ . ) interactions as network edges, and ) mediumconfidence interaction network obtained from expanding the core network by additional nodes (fig. ). enrichment analysis results performed in cytoscape, using string's protein-protein interactions, indicated that bcg-cgs is enriched in inflammatory cytokines and immune response modulators (fig. b) . some signature genes are also involved in the negative control of important viral processes (e.g., (fcn , tnf and ccl ), and others are involved in the response to viral infections (e.g., ifng, rnase , il and tnf). the complete lists of enriched pathways are included in tables s and s (supporting information). we identified key hubs using the causal reasoning method, which seeks to identify molecular regulators that can directly cause the observed transcriptional changes in response to bcg vaccination. key regulators can be transcriptional factors and proteins with potentially altered activity that explains the transcriptional changes. top five statistically significant inhibited key hubs included hey , dsipi (gilz), jagged , hand and mir- - - p, whereas top five statistically significant activated key hubs were phf , tafii , glutaredoxin, runx and notch (nicd). top causal key hubs are shown in table i and all identified key hubs are included in table s (supporting information) . in order to identify experimentally validated upstream regulators that cause transcriptional changes similar to those induced by bcg, we queried the connectivity map (cmap) ( ) database of the broad institute with bcg-cgs and identified proteins and small-molecule drugs that have strong connectivity scores with bcg (fig. ) . the cmap approach enabled us to compare bcg-cgs with 'experimentally' predefined signatures of therapeutic compounds and genetic perturbations (i.e., over expression or knockdown) included in the cmap and ranked according to a connectivity scores (ranging from + to − ), representing relative similarity to bcg-cgs. the connectivity score itself is derived using a nonparametric, rankbased, pattern-matching strategy based on t he kolmogorov-smirnov statistics ( ) . all instances in the database are then ranked according to their connectivity scores with bcg-cgs; those at the top (+) are most strongly correlated to the query signature and looked at as bcg mimics, and those at the bottom (−) are most strongly anticorrelated and can reverse bcg's gene signature. our analysis identified three highly enriched classes of genetic knockdown (kd) perturbagens and one pharmacological class of drugs that have positive connectivity scores in alveolar a cells (i.e., caused similar transcriptional changes to those induced by bcg in alveolar a cells). these hits can be considered as bcg mimics capable of inducing transcriptional changes similar to those caused by the bcg vaccine. therefore, we suggest that bcg mimics can be used as alternatives to bcg vaccination to promote long-lasting b a beneficial effects on immune cells. the three enriched protein classes are: protein phosphatases (with best positive connection for ppp c kd), histone deacetylases (with best positive connection for hdac kd followed by hdac kd), and mediator complex proteins (with best positive connection for med kd followed by med kd). additionally, protein kinase c (pkc) activators were enriched as a drug class; and top three pkc activators with highest cmap connectivity scores to bcg-cgs were prostratin, phorbol- -myristate- -acetate, and ingenol. it is evident that all of the above four classes of proteins share one common feature: they participate in the transcriptional and metabolic regulation of immune cells in response to environmental cues including responses to pathogens ( ) ( ) ( ) ( ) . all top-scoring pkc activators from the cmap, are also known to have antiviral effects or affect t cell activation ( ) ( ) ( ) ( ) ( ) . remarkably, analyzing top ten cmap positive connections with bcg-cgs obtained from nine cell lines indicated that two compounds are approved antiviral drugs: raltegravir (top rd positive connection, an hiv integrase inhibitor) and lopinavir (top th positive connection, an hiv protease inhibitor). more interestingly, emetine (top th positive connection) and lopinavir were recently validated to inhibit sars-cov- replication in vitro ( ) . we also found evidence in the biomedical literature indicating that mst- ( ), narciclasine ( ) and verrucarin-a ( ) possess antiviral activities. all cmap hits are provided in tables s and s (sup porting information). initial reports from clinical studies evaluating the use of lopinavir in covid- patients showed that the unbound lopinavir concentrations in the lungs were calculated to be subtherapeutic against sars-cov- ( , ) . another study found that the unbound drug concentrations of lopinavir are far from reaching the ec of sars-cov- ( . μg/ml), although they clearly suffice to inhibit hiv- ( ) . the authors mentioned fig. high-confidence expanded network for bcg-cgs. nodes are color-coded using a split pie chart coloring scheme indicating pathway/gene set contribution to each node from the top most enriched pathways/gene lists. core network is composed of genes in the bcg-cgs that are not singletons. step expansion, added additional nodes (i.e., genes) to the core network. step expansion, added another nodes for the first expansion. step expansion, added another nodes to the second expansion. expansions were performed to see which pathways remained most statistically significant, and therefore are considered high confidence pathways. that approximately -to -fold higher concentrations than those found in covid- patients treated with lopinavir-ritonavir, are required to reach the assumed ec at trough levels, making effective treatment of covid- with lopinavir and ritonavir at the currently used doses unlikely ( ) . in order to prioritize high confidence bcg genetic mimics, we integrated hypotheses derived independently from the cmap with those predicted by causal reasoning, and accepted common hits only (i.e., cmap positive connections with bcg-cgs that are also predicted as beneficial drug targets by causal reasoning). this analysis resulted in high confidence common hits reported in table s (supporting information) . we tested whether bcg-cgs, cmap positive connections, or predicted key hubs will have any impact on covid- by identifying overlaps with sars-cov- interactome, i.e., human proteins that were experimentally validated to interact with sars-cov- and extracted from two recent reports ( , ) . this analysis (fig. a ) validated protein hits to have physical links to sars-cov- . the three proteins are transcribed by brd , prkaca and sirt ; they all were positive connections from the cmap, predicted as statistically † predicted activity of the key hub by causal reasoning is denoted byif the hub is inhibited, and denoted by + if the hub is activated ‡ correct/total network predictions: correct for the genes in the dataset predicted correctly; total for the total number of genes in the causal reasoning network § calculation distance: using causal reasoning one-step key hubs are defined as statistically significant transcriptional factors that are associated with experimental differential expressed genes regulation. two-step and three-step key hubs are distant key hubs that regulate one-step transcriptional factors *p-value calcualted for the polynomial test ( ) : significant key hubs, and were also validated as sars-cov- interacting proteins ( ) . additionally, high-confidence cmap positive connections, were validated to make physical interactions with sars-cov- proteins. these proteins are: psen , pabpc , hmox , cit, plat, igf r, ripk , ndufs , ndufa , ggh, neu , scarb , csnk b, f rl . and two positive connections, mark and mark , were reported to have interactions with corona viruses ( ) . predicted causal key hubs, sigmar and gnb , were also validated to have physical links to sars-cov- ( ) , and a third key hub ppia was known as a human protein interacting with proteins from corona viruses ( ) . additionally, we mined the biomedical literature to identify evidence for linking bcg small molecule mimics with sars-cov- , corona viruses or viral infections in general. we found that two out of ten top positive compound connections (emetine and lopinavir), were recently validated to inhibit sars-cov- replication in vitro ( ) . other compounds we found to inhibit the growth of corona viruses, or had general antiviral activities (table ii) . previous peer-reviewed reports indicated that bcg's nonspecific effects on the immune system, can reduce all-cause child mortality ( ) , protect individuals from numerous viral infections ( ) ( ) ( ) ( ) ( ) , and it can even enhance the efficiency of some viral vaccines ( ) ( ) ( ) . recently, several peer-reviewed studies have pointed to a striking correlation between universal bcg vaccination policies and reduced covid- mortality ( ) . however, most epidemiological studies identified this correlation without acknowledging other important study confounders like social, economic, and demographic differences between countries. lately, escobar et al. mitigated multiple confounding factors for the first time and still observed several significant associations between bcg vaccination and reduced covid- deaths ( ) . the authors of this study highlighted the need for mechanistic studies behind the effect of bcg vaccination on covid- , and for clinical evaluation of the effectiveness of bcg vaccination to protect from severe covid- . earlier studies suggested that the documented beneficial off-target effects of bcg in protecting from non-tb infections, including perhaps covid- , involve a potentiation of innate immune responses through epigenetic mechanisms ( ) ( ) ( ) . to our knowledge, we report here on the first study providing a mechanistic insight to explain the relationships between bcg and covid- at the molecular and systems biology levels as well as extend this insight toward proposing several bcg mimetics among known drugs as candidates for repurposing against the disease. our results indicate that bcg-cgs, key regulatory hubs and bcg-mimics identified from the cmap enrich common biological pathways important for key viral processes such as rna synthesis and processing, virus-host interactions, positive regulation of viral genome replication, and they are also important for the immune response mounted against the virus. supporting evidence from the biomedical literature confirms that bcg has many beneficial 'off-target' effects that can protect humans from emerging novel pathogens by boasting their innate immune responses ( ) . our studies suggest that bcg promotes a wide-range of transcriptional and metabolic changes, including beneficial gene commensalism, that have been shown to reduce mortality and morbidity from non-tb infectious diseases ( , ) . we show that bcg can produce these protective 'off target' effects mainly by increasing the production of thymus-generated short-lived undifferentiated cd + cells known as naive t cells (th ), and triggering their differentiation into the long-lived mature naive t cells (mnts), such as cd + and cd + t cells ( ) . interestingly, a very recent study published in science ( ) showed that many unexposed patients ( - %) carry selective and cross-reactive sars-cov- t cell epitopes protecting patients against severe infection. another recent study in cell ( ) reported similar observation of strong sars-cov- selective memory t cell immunity (reminiscent of the functional patterns observed after successful vaccine immunizations) in patients with asymptomatic or mild infections. although these studies make no connection to any previous bcg vaccination as a source of selective epitopes, we observe that these observations are consistent with our mechanistic hypothesis concerning the protective effect of bcg against covid- . these conclusions are supported by the enrichment results produced using the 'compare experiment' algorithm in metacore from clarivate analytics, which looks for significant coordinated gene expression effects across all experiments to test whether the pathway is being up-or down-regulated in a manner that is unlikely to be accounted for by random chance. the top enriched pathway map, with upregulated genes in response to bcg, is 'immune response t cell subsets: secreted signals' (fig. b) . a recent study showing that sars-cov- reshapes central cellular pathways, such as translation, splicing, carbon metabolism and nucleic acid metabolism ( ), provides further support for this observation. naturally, bioinformatics techniques relying on gene expression, pathway over-representation and network biology have some limitations and biases: ) results are impacted by the user-selected cut-off thresholds used to determine significant genes, which could make the results userdependent ( ) ; ) all components in the pathway are given equal weights without paying attention to the nature of the interactions between the different components ( ) ; ) there are underlying assumptions that pathways are independent of each other, contrary to the fact that pathways cross-talk and overlap ( ); ) assuming independence between genes may result in false positive predictions of highly enriched genes or gene sets ( ); ) these methods are incapable of modeling an organism's biology as a dynamic system, and cannot predict changes in the system due genetic mutations or environmental changes ( ); ) most pathway knowledge databases are built by curating experiments performed in different cell types at different time points under different conditions, so they are missing condition-and cell-specific information ( ) . in order to mitigate some of the aforementioned limitations, we used a consensus gene signature since it is more stable than other gene expression signatures, we paired overrepresentation pathway analysis with causal reasoning to b a fig. (a) a venn diagram showing overlaps between bcg genetic mimics and key hubs with sars-cov- and corona viruses interactomes. (b) top "pathway map" with the highest level of enrichment by genes in bcg-cgs. this map is generated using metacore from clarivate analytics. red thermometers indicate genes overexpressed in response to bcg treatment, and the hight of the red bars is representative of the differential gene expression level (i.e., log values of the fold change). the numbers under the thermometers - refer to the experiment number: ) gene expression on day in response to bcg vaccination to a bcg-naïve population on day ; ) gene expression on day in response to bcg re-vaccination to a previously vaccinated population; ) gene expression on day in response to bcg vaccination to a bcg-naïve population; ) gene expression on day in response to bcg revaccination to a previously vaccinated population, and ) positive connections from the connectivity map, and the red bar in the thermometer number represents presence of the gene only. predict protein activities based on the nature of interactions between upregulated or downregulated genes, and we also integrated results from several bioinformatics methods such as causal reasoning and cmap predictions to prioritize common hypotheses. a recent publication ( ) in lancet has questioned whether bcg's effects can last for a long time. our top enriched pathway map (fig. b) indicates that bcg's effects can be longlasting if the effects were exerted on thymus-generated th cells, which can occur to a greater extent very early in life before reaching thymic involution by puberty ( ) . this pathway map indicates that bcg is capable of affecting both the numbers and the types of produced innate immune cells, as well as their maturation to long-lived memory t cells (i.e., what is known as trained immunity). this is very significant in the context of bcg's protective effects from sars-cov- and other emergent novel viruses where the individual's ability to eradicate such viruses is dictated by the number and diversity of naive t cell reservoir ( , ) . our analysis suggest that bcg may protect individuals from novel pathogens by priming their trained immunity to fight such pathogens, including sars-cov- . supporting evidence for this hypothesis is found in the literature ( ) indicating that the protective effects of the bcg against tb, can last from to years after vaccination ( , ) , with longer lasting effects when the vaccine is administered during the first year of life ( , ) . a recent study indicated that "school-aged bcg vaccination offered moderate protection against tuberculosis for at least years, which is much longer than previously thought" ( , ) . another year follow-up study, showed that bcg vaccine efficacy persisted for to years after a single dose of bcg ( ) . of special interest is a recent study that showed that mucosal vaccination resulted in an increased frequency of antigenspecific lung tissue-resident cd + t cells that provide longterm immunity ( ) . these studies serve as additional evidence from the literature supporting our claim that a single dose of an 'effective' bcg vaccination to infants can have a very long duration of protection against pathogens including sars-cov- . our findings provided systems biology support for using bcg to protect from the severe consequences of covid- . bcg is currently on who's list of essential medicines; it is considered one of the safest and most effective medicines unknown †score refer to the cmap score. it represents the level of similarity between transcriptional effects induced by bcg and each of the compounds ‡ validation refers to the presence of any supporting evidence from the biomedical literature that the predicted bcg mimics have any antiviral activities. antiviral means there is evidence that the compound is used as or has antiviral activity; sars-cov- means that the compound should antiviral activity against sars-cov- ; corona viruses means that the compound showed antiviral activity against corona viruses other than sars-cov- § covid- ct: there is evidence that the compound is being tested in clinical trials for covid- . there are studies found for ruxolitinib in covid- on clinicaltrials.gov. needed in a health system. there is also evidence indicating that bcg can improve the response to vaccines directed against viral infections ( , ( ) ( ) ( ) , which may prove useful when sars-cov- -specific vaccines become available. therefore, we suggest that administering the bcg vaccine to all newborns may protect them from the infection by sars-cov- and other emerging pathogens. since this is an approved vaccine for tb, it can directly enter phase iii testing for the protection from covid- caused fatalities. however, we caution that running these experiments during an active covid- outbreak, might expose participants to aggravated immune responses if they contract covid- during the study. we also advise that clinical study design takes into account several factors that are known to affect the performance of bcg vaccine, such as: the age of the participants, geographies, ethnicities, route of administration and the mycobacterium strain used in the vaccine. it is equally important to run experimental validation studies, to evaluate the effects of bcg mimics, in preventing covid- or for treating urological cancers. our results provide systems biology support for using bcg and small-molecule bcg mimics as putative vaccine and drug candidates against emergent viruses including sars-cov- . of course, any practical actions to repurpose this vaccine as a means of protection against sars-cov- , or other novel viruses, should be preceded by the successful in vitro and animal experimentation. we also caution that previous studies showed that the protective effects of bcg were found to be weaker when the vaccine was given after the first year of life and particularly after puberty ( ). research at al-zaytoonah university of jordan grant - / / . at acknowledges partial support from nih grant ot tr . we thank clarivate analytics for providing access to metacore, a specialized pathway and functional genomics analysis product. reference to commercial products or services does not constitute their endorsement. r. hajjo generated the idea, designed the workflow, generated content, performed data analysis and wrote the manuscript. a. tropsha was engaged in the critical discussion of the study design, recommended some studies, and edited the manuscript. developing covid- vaccines at pandemic speed from covid- research to vaccine application: why might it take months not years and what are the wider lessons? health research policy and systems vaccination against coronaviruses in domestic animals [internet]. vaccine deployment of convalescent plasma for the prevention and treatment of covid- the history and advances in cancer immunotherapy: understanding the characteristics of tumor-infiltrating immune cells and their therapeutic implications springer nature novel cancer immunotherapy agents with survival benefit: recent successes and next steps advances in cancer immunotherapy -latest trends immuno-oncology combinations: raising the tail of the survival curve harnessing innate immunity in cancer therapy targeting innate immunity to enhance the efficacy of radiation therapy targeting innate immunity for antiviral therapy through small molecule agonists of the rlr pathway antiviral innate immunity pathways innate immunity to influenza virus: implications for future therapy. expert review of clinical immunology t cell-mediated immune response to respiratory coronaviruses a sars-cov- protein interaction map reveals targets for drug repurposing bcg-induced cross-protection and development of trained immunity: implication for vaccine design the mechanism of action of bcg therapy for bladder cancer-a current perspective autophagy controls bcg-induced trained immunity and the response to intravesical bcg therapy for bladder cancer bcg vaccines report on bcg vaccine use for protection against mycobacterial infections including tuberculosis, leprosy, and other nontuberculous mycobacteria (ntm) infections prepared by the sage working group on bcg vaccines and who secretariat. . . search of: bcg | covid- -list results -clinicaltrials.gov [internet bcg vaccine protection from severe coronavirus disease (covid- ) is global bcg vaccination-induced trained immunity relevant to the progression of sars-cov- pandemic? is bcg vaccination affecting the spread and severity of covid- ? allergy bcg vaccination induced protection from covid- chemocentric informatics approach to drug discovery: identification and experimental validation of selective estrogen receptor modulators as ligands of -hydroxytryptamine- receptors and as potential cognition enhancers gene expression and cytokine profile correlate with mycobacterial growth in a a next generation connectivity map: l platform and the first , , profiles nonparametric statistical methods protein phosphatase is an essential positive regulator for treg development, function, and protective gut immunity phosphatase pp negatively regulates type i ifn production and antiviral innate immunity by dephosphorylating and deactivating tbk mediator complex interaction partners organize the transcriptional network that defines neural stem cells histone deacetylase function in cd + t cells the effect of ingenol-b on the suppressive capacity of elite suppressor hiv-specific cd + t cells prostratin as a new therapeutic agent targeting hiv viral reservoirs. drug news and perspectives. drug news perspect effects of prostratin on cyclin ti/p-tefb function and the gene expression profile in primary resting cd + t cells lipopolysaccharide and phorbol -myristate -acetate both impair monocyte differentiation, relating cellular function to virus susceptibility lrr and pyd domains-containing protein inflammasome is activated and inhibited by berberine via toll-like receptor / myeloid differentiation primary response gene /nuclear factor-κb pathway, in phorbol -myristate -acetate-induced macrophage remdesivir, lopinavir, emetine, and homoharringtonine inhibit sars-cov- replication in vitro herpes simplex virus virucidal activity of mst- and epigallocatechin gallate antiviral (rna) activity of selected amaryllidaceae isoquinoline constituents and synthesis of related substances antiviral activity of brefeldin a and verrucarin a why lopinavir and hydroxychloroquine do not work on covid- -sciencedaily effect of systemic inflammatory response to sars-cov- on lopinavir and hydroxychloroquine plasma concentrations pharmacokinetics of lopinavir and ritonavir in patients hospitalized with coronavirus disease (covid- ) american college of physicians master regulator analysis of the sars-cov- /human interactome a sars-cov- -human protein-protein interaction map reveals drug targets and potential drug-repurposing. biorxiv vaccination and all-cause child mortality from to : global evidence from the demographic and health surveys adjuvant effect of bacille calmette-guérin on hepatitis b vaccine immunogenicity in the preterm and term newborn. frontiers in immunology repeated bcg vaccination is more effective than a single dose in preventing diabetes in non-obese diabetic (nod) mice. undefined non-specific effects of vaccines illustrated through the bcg example: from observations to demonstrations benefits of bcg-induced metabolic switch from oxidative phosphorylation to aerobic glycolysis in autoimmune and nervous system diseases bcg-induced protection: effects on innate immune memory bcg vaccination enhances the immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized, placebo-controlled pilot study non-specific effect of bacille calmette-guérin vaccine on the immune response to routine immunisations influence of mycobacterium bovis bacillus calmette-guérin on antibody and cytokine responses to human neonatal vaccination the american association of immunologists report on bcg vaccine use for protection against mycobacterial infections including tuberculosis, leprosy, and other nontuberculous mycobacteria (ntm) infections prepared by the sage working group on bcg vaccines and who secretariat nonspecific effects of bcg vaccine on viral infections bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity. cell host and microbe bacille calmette-guérin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes long-term efficacy of bcg vaccine in american indians and alaska natives: a -year follow-up study selective and cross-reactive sars-cov- t cell epitopes in unexposed humans robust t cell immunity in convalescent individuals with asymptomatic or mild covid- using the gene ontology for microarray data mining: a comparison of methods and application to age effects in human prefrontal cortex ten years of pathway analysis: current approaches and outstanding challenges network biology: understanding the cell's functional organization. nature reviews | genetics gene set analysis: challenges, opportunities, and future research covid- vaccination clinical trials should consider multiple doses of bcg thymus size and agerelated thymic involution: early programming, sexual dimorphism, progenitors and stroma thymic and postthymic regulation of naïve cd + t-cell lineage fates in humans and mice models mechanisms shaping the naïve t cell repertoire in the elderly -thymic involution or peripheral homeostatic proliferation? experimental gerontology the duration of protection of school-aged bcg vaccination in england: a population-based case-control study duration of bcg protection against tuberculosis and change in effectiveness with time since vaccination in norway: a retrospective population-based cohort study. the lancet infectious diseases delaying bcg vaccination from birth to weeks of age may result in an enhanced memory cd t cell response enhanced protection conferred by mucosal bcg vaccination associates with presence of antigenspecific lung tissue-resident pd- + klrg − cd + t cells gene expression and cytokine profile correlate with mycobacterial growth in a human bcg challenge model. the journal of infectious diseases cytoscape: a software environment for integrated models of biomolecular interaction networks string v : protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets mint: the molecular interaction database human protein reference database as a discovery resource for proteomics bind: the biomolecular interaction network database dip: the database of interacting proteins the biogrid interaction database: update kegg for linking genomes to life and the environment ecocyc: a comprehensive database resource for escherichia coli the nci-nature pathway interaction database: a cell signaling resource the gene ontology (go) database and informatics resource functional analysis of omics data and small molecule compounds in an integrated "knowledge-based" platform the connectivity map: using gene-expression signatures to connect small molecules, genes, and disease. ny).: science causal reasoning on biological networks: interpreting transcriptional changes a computational model to define the molecular causes of type diabetes mellitus new pharmacological strategies to fight enveloped viruses a screen of fda-approved drugs for inhibitors of zika virus infection antiviral activity of brefeldin a and verrucarin a middle east respiratory syndrome and severe acute respiratory syndrome: current therapeutic options and potential targets for novel therapies novel activities of safe-in-human broadspectrum antiviral agents brefeldin a and cytochalasin b reduce dengue virus replication in cell cultures but do not protect mice against viral challenge emetine inhibits zika and ebola virus infections through two molecular mechanisms: inhibiting viral replication and decreasing viral entry the natural compound homoharringtonine presents broad antiviral activity in vitro and in vivo publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations key: cord- -hboc xcz authors: roncati, luca; vadalà, maria; corazzari, veronica; palmieri, beniamino title: covid- vaccine and boosted immunity: nothing ad interim to do? date: - - journal: vaccine doi: . /j.vaccine. . . sha: doc_id: cord_uid: hboc xcz summary today, coronavirus disease (covid- ) is a global public health emergency and vaccination measures to counter its diffusion are deemed necessary. severe acute respiratory syndrome coronavirus (sars-cov- ), the etiological agent of the disease, unleashes a t-helper immune response in those patients requiring intensive care. here, we illustrate the immunological mechanism to train the immune system towards a more effective and less symptomatic t-helper (th ) immune response, thanks to a subcutaneous vaccine containing lysates of corynebacterium parvum (synonym for propionibacterium acnes), a gram-positive bacterium able to evoke a strong th response. in the - years of last century, an experimental wave of immunological studies attempted to fight cancer by exploiting live or killed bacteria, among which the most investigated were the bacillus calmette-guérin (bcg), an attenuated strain of mycobacterium bovis, and corynebacterium parvum (c. parvum), later renamed propionibacterium acnes and then cutibacterium acnes [ , ] . administered percutaneously or into the neoplastic mass, they proved able to induce the tumor lysis at some extent, and to delay or arrest the cancer growth through the innate immunity potentiation [ , ] . bcg gained approval since and is currently the standard of care for patients with nonmuscle-invasive bladder cancer by means of mucosal instillation, besides to be registered as an antituberculosis intradermal vaccination [ , ] . as of march , bcg vaccine is furthermore in phase iii or iv trials to prevent coronavirus disease (covid- ) among healthcare workers in the netherlands, australia, usa, germany, france, denmark, colombia, mexico, egypt, and south africa [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . additional trials in the netherlands, germany, greece, and india are evaluating whether bcg vaccine provides protection against covid- in the elderly and in middle age [ ] [ ] [ ] [ ] ; besides, randomized trials on volunteers over years to test bcg vaccine in this context has been launched in brazil and canada [ , ] . c. parvum is an aerotolerant anaerobic rod-shaped gram-positive bacterium largely commensal and part of the skin flora present on most healthy adults, but also associated to sarcoidosis and juvenile acne, hence its taxonomic renaming [ ] . after an initial registration like immunoadjuvant and immunomodulator, c. parvum was added to the chemotherapy protocol for colon cancer by repeated injections in the form of formalin-killed freezedried vaccine preparation (coparvax ® , wellcome research laboratories, beckenham, uk); however, it was discarded because no partial remission, overall survival or significant benefits were achieved in the treated cohorts of patients [ ] . at that time, one of us (prof. palmieri) had the chance to perform a clinical pilot trial with c. parvum administration into subcutaneous and lymph nodal metastases from lungs, thyroid and breast malignancies, noting local shrinking and colliquative effect in - hours, accompanied by mild symptoms and occasional febrile peaks. in a few cases, very rapid regressions of concomitant herpes infections involving the head, the thorax and the genitals were incidentally observed. by searching on the english biomedical literature, several studies from the past fully support the c. parvum antiviral power on man and animal against, for example, influenza virus, hepatitis b, rabies, encephalomyocarditis virus, herpes zoster and human papilloma virus [ ] [ ] [ ] [ ] [ ] [ ] . in addition, a scientific evidence of c. parvum vaccine protection against a coronavirus (mouse hepatitis virus type ), dating back to murine model by schindler and colleagues, is also reported [ ] . always working on a murine model, teixeira and collaborators proved in that c. parvum enhances the immunogenicity of the hivbr vaccine, a vaccine against epitopes of the human immunodeficiency virus, subtype b [ ] . in the same year, hsu and coworkers discovered short rna sequences from c. parvum similar to ebola virus micrornas, capable to protect the human host by influencing the thrombospondin expression, a multifunctional protein which plays also an initiating role towards cell-mediated immunity in the skin [ ] . palmieri dropped out his clinical trial on bacterial immune stimulation against cancer in , but he followed up with anecdotical compassionate treatments of severe herpes, and others heavy viral infections, such as influenza, mumps, varicella and measles, by subcutaneous injections of c. parvum cultured and killed in our microbiological lab, after signing an informed consent out of a total of patients, males and females, aged between and years (mean age years). during our evolving experience, we modified the subdermal injection formula ( x phenol-killed bacteria in ml saline), adding high molecular weight hyaluronic acid as slow delivery system, having found aspecific virucide properties of this non-sulphated glycosaminoglycan, notoriously able to bind the cluster of differentiation (cd ) receptors present on the surface of activated leukocytes [ , ] . the (t h ), classically directed against extracellular non-phagocytosable pathogens (e.g. helminths), whose main effectors are eosinophils, basophils, mastocytes and b cells (humoral immunity) [ ] . in spite of this, severe sars-cov- infections are associated with marked t c lymphopenia [ ] . during our researches on covid- , we have disclosed that the immune system is forced to mount in critically ill patients a t h response, the only one still mountable in the attempt to counteract the viral load, rather than a t h response, which would keep the infection under control by means of macrophages and t c cells [ , ] . moreover, for the first time in worldwide literature, we have provide evidence that a life-threatening escalation from t h immune response to type hypersensitivity (immune complex disease) in covid- vasculitis takes place, and that the inflamed smooth muscle cells of blood vessels concur to the «cytokine storm» via interleukin (il)- [ ] . therefore, we have proposed that an effective vaccination strategy should be able to prevent or limit the systemic imbalance of t h cytokines [ ] , inducing a protective t h response to be exploited against sars-cov- (fig. ) . among the t h cytokines, there are il- , il- , il- , il- , il- , il- and il- , while il- , il- , interferon-γ (ifn-γ) and tumor necrosis factor-α (tnf-α) are the master t h cytokines [ ] . many researches have ascertained that c. parvum subcutaneous injection is able to induce a strong t h response favoring the production of il- , il- , ifn-γ and tnf-α, in practice as bcg works, and that the characteristic allergic t h response can be counterbalanced by c. parvum vaccination [ ] [ ] [ ] [ ] [ ] [ ] [ ] ; besides, it has been found a natural killers (nk) and dendritic cells activator [ ] [ ] [ ] . in cioffi and colleagues reported that c. parvum protects splenectomized sprague dawley rats from respiratory challenge with streptococcus pneumoniae, without alter the number or activity of lavageable alveolar macrophages, and they hypothesized that c. parvum protection is more likely due to an increased clearance of blood-borne bacteria by the expanded and enhanced reticuloendothelial system [ ] . if we transfer this murine model to man, a t h cytokines release syndrome from activated pulmonary macrophages after c. parvum lysate subcutaneous injection, such as to aggravate a possible superimposed covid- , appears somewhat unlikely. therefore, our long-standing experience lays the foundation to revalue c. parvum lysate as a further surrogate vaccine against covid- , safer and more manageable than an attenuated living bacillus like bcg, in the attempt to prevent or mitigate the cumbersome pandemic morbidity and mortality. the accurate preparation of the lysate is a crucial time to avoid opportunistic bone implant-associated infections or acute septic polyarthritis, whose a single case has been described in after c. parvum instillation for malignant pleural effusion; an episode of prolonged fever from immune system hyperactivation has also been reported [ ] [ ] [ ] . previous efforts to develop subunit vaccines against the most lethal human coronaviruses, for instance the severe acute respiratory syndrome none. the authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. fig. . illustrative scheme of our vaccination rationale: following sars-cov- entry (point ), the immune system is forced to mount a t h response in those patients requiring intensive care, at the expense of a more effective and less symptomatic t h response, compromised by the viral load (point ). through c. parvum vaccine (point ), it is theoretically possible to train and calibrate the immune system towards a t h response (point ), able to prevent covid- or to keep the disease under control in a paucisymptomatic or asymptomatic way thanks to activated reticuloendothelial system, nk, t c and dendritic cells. immunotherapy of cancer corynebacterium parvum versus bcg adjuvant immunotherapy in human malignant melanoma innate, antigen-independent role for t cells in the activation of the immune system by propionibacterium acnes licensed bacille calmette-guérin (bcg) formulations differ markedly in bacterial viability, rna content and innate immune activation world health organization. bcg vaccines: who position paper thirty years of bcg immunotherapy for non-muscle invasive bladder cancer: a success story with room for improvement reducing health care workers absenteeism in covid- pandemic through bcg vaccine (bcg-corona). clinicaltrials.gov identifier: nct bcg vaccination to protect healthcare workers against covid- (brace). clinicaltrials.gov identifier: nct bcg vaccine for health care workers as defense against covid- (badas). clinicaltrials.gov identifier: nct study to assess vpm in reducing healthcare professionals' absenteeism in covid- pandemic. clinicaltrials.gov identifier: nct efficacy of bcg vaccination in the prevention of covid via the strengthening of innate immunity in health care workers using bcg vaccine to protect health care workers in the covid- pandemic. clinicaltrials.gov identifier: nct performance evaluation of bcg vaccination in healthcare personnel to reduce the severity of sars-cov- infection prevention, efficacy, and safety of bcg vaccine in covid- among healthcare workers. clinicaltrials.gov identifier: nct application of bcg vaccine for immune-prophylaxis among egyptian healthcare workers during the pandemic of covid- . clinicaltrials.gov identifier: nct bcg vaccination for healthcare workers in covid- pandemic reducing covid- related hospital admission in elderly by bcg vaccination. clinicaltrials.gov identifier: nct study to assess vpm in reducing hospital admissions and/or severe respiratory infectious diseases in elderly in covid- pandemic bacillus calmette-guérin vaccination to prevent covid- (activateii). clinicaltrials.gov identifier: nct bcg vaccine in reducing morbidity and mortality in elderly individuals in covid- hotspots. clinicaltrials.gov identifier: nct covid- : bcg as therapeutic vaccine, transmission limitation, and immunoglobulin enhancement (battle). clinicaltrials.gov identifier: nct efficacy and safety of vpm in reducing sars-cov- (covid- ) infection rate and severity (cobra). clinicaltrials.gov identifier: nct the long-standing history of corynebacterium parvum, immunity, and viruses parvum clinical protocols: prototypes and summary results in u.s. trials with wellcome coparvax protection of mice against influenza virus infection: enhancement of nonspecific cellular responses by corynebacterium parvum the effect of intradermal administration of corynebacterium parvum on the immune response to hepatitis bs antigen increased interleukin- associated with low il- concentration correlated with greater survival rates in mice infected by rabies virus vaccinated against it and immunomodulated with p. acnes role of interferon, antibodies and macrophages in the protective effect of corynebacterium parvum on encephalomyocarditis virusinduced disease in mice immunomodulating and antiviral therapy in herpes zoster treatment of common warts with the immune stimulant propionium bacterium parvum protection of mice against mouse hepatitis virus by corynebacterium parvum propionibacterium acnes enhances the immunogenicity of hivbr human immunodeficiency virus- vaccine on revealing the gene targets of ebola virus micrornas involved in the human skin microbiome in vitro evaluation of antiviral and virucidal activity of a high molecular weight hyaluronic acid cd is the principal cell surface receptor for hyaluronate renin-angiotensin system: the unexpected flaw inside the human immune system revealed by sars-cov- type /type immunity in infectious diseases lymphopenia is associated with severe coronavirus disease (covid- ) infections: a systemic review and meta-analysis signals of th immune response from covid- patients requiring intensive care the «moonlighting protein» able to explain the th immune lockdown in severe covid- type hypersensitivity in covid- vasculitis what about the original antigenic sin of the humans versus sars-cov- ? propionibacterium acnes promotes th and th /th responses in acne patients th and th immune responses to viable propionibacterium acnes in patients with sarcoidosis intratumoral injection of propionibacterium acnes suppresses malignant melanoma by enhancing th immune responses mis , a nontoxic microparticle adjuvant derived from propionibacterium acnes comprising immunostimulatory muramyl dipeptide and bacterial dna promotes cross-priming and th immunity propionibacterium acnes vaccination induces regulatory t cells and th immune responses and improves mouse atopic dermatitis innate, antigen-independent role for t cells in the activation of the immune system by propionibacterium acnes bcg-induced trained immunity: can it offer protection against covid- ? modulatory effect of killed propionibacterium acnes and its purified soluble polysaccharide on peritoneal exudate cells from c bl/ mice: major nkt cell recruitment and increased cytotoxicity a randomized prospective clinical trial of adjuvant c. parvum immunotherapy in patients with clinically localized melanoma (stage i): prognostic factors analysis and preliminary results of immunotherapy interferon production and lymphocyte stimulation in human leucocyte cultures stimulated by corynebacterium parvum the quantity and function of pulmonary alveolar macrophages after splenectomy and corynebacterium parvum interaction of cutibacterium acnes with human bone marrow derived mesenchymal stem cells: a step toward understanding bone implant-associated infection development acute polyarthritis following the use of corynebacterium parvum vaccine (coparvax) for malignant pleural effusion prolonged fever after pleural instillation of corynebacterium parvum (coparvax) key: cord- - cfhjuxi authors: vergkizi, souzan; nikolakakis, ioannis title: bacillus calmette–guérin (bcg) vaccine generates immunoregulatory cells in the cervical lymph nodes in guinea pigs injected intra dermally date: - - journal: vaccine doi: . /j.vaccine. . . sha: doc_id: cord_uid: cfhjuxi this work demonstrates the presence of immune regulatory cells in the cervical lymph nodes draining bacillus calmette-guérin (bcg) vaccinated site on the dorsum of the ear in guinea pigs. it is shown that whole cervical lymph node cells did not proliferate in vitro in the presence of soluble mycobacterial antigens (ppd or leprosin) despite being responsive to whole mycobacteria. besides, t cells from these lymph nodes separated as a non-adherent fraction on a nylon wool column, proliferated to ppd in the presence of autologous antigen presenting cells. interestingly, addition of as low as % nylon wool adherent cells to these, sharply decreased the proliferation by %. looking into what cells in the adherent fraction suppressed the proliferation, it was found that neither the t cell nor the macrophage enriched cell fractions of this population individually showed suppressive effect, indicating that their co-presence was necessary for the suppression. since bcg induced granulomas resolve much faster than granulomas induced by other mycobacteria such as mycobacterium leprae the present experimental findings add to the existing evidence that intradermal bcg vaccination influences subsequent immune responses in the host and may further stress upon its beneficial role seen in covid- patients. regulatory cells play an important role in the control of immune responses. under optimal conditions, immunocompetent cells help, amplify or suppress the activity of other cells so that any foreign material or invading pathogen are eradicated with minimum damage to the host. lapses of such regulation could lead to excess detriment to the body or susceptibility of the host to the invader. normally, under average conditions of antigenic stimulation, the immunostimulatory and suppressor activities are in equilibrium. what conditions decide which of the two mechanisms should choose to occur depends on the host and the occurring infection and are still under investigation. furthermore, it is now generally accepted that the immune response is a collaborative result involving different populations and subpopulations of cells [ ] . helper function to humoral and cellular immunity has been ascribed to subpopulations of t cells, macrophages, dendritic cells and even b cells [ ] . on the other hand, suppression of the two types of immunity has been thought to be regulated by mainly regulatory t cells (former suppressor t cells), certain populations of monocytes/macrophages and b cells [ ] [ ] [ ] . in a number of diseases that are associated with low cell mediated immunity, t regulatory (suppressor) cells play an important role, either on their own or in combination with other cells [ ] [ ] [ ] . macrophages may be either stimulatory or inhibitory in immunological reactions and exhibit both pathogenic and protective roles [ ] [ ] [ ] [ ] . they not only present antigens to mainly t and b cells but also secrete several cytokines which direct the responses of other immunoregulatory cells. the three major functions of macrophages include degradation of non-self or foreign material including apoptotic or necrotic cells, initiation and enhancement of the immunological activation of lymphocytes and, mediation of suppression [ , ] . macrophages may cause suppression either by helping the generation of other suppressor cells [ , ] or, by releasing immune suppressive factors such as prostaglandins [ , ] and immunoregulatory cytokines such as interleukin- these factors in turn, cause the limitation of extensive tissue damage by diminishing the production of inflammatory mediators that cause specific and unspecific immune reactions [ ] . b cells may also cause suppression under certain immunological conditions. involvement of b suppressor cells was demonstrated in delayed type hypersensitivity responses to antigens such as ovalbumin, , -dinitro- -fluorobenzene and keyhole limpet haemocyanin among others [ ] [ ] [ ] . they may act through a negative feedback by specific antibodies or through the induction of suppressor t cells [ ] . their involvement in autoimmune diseases such as multiple sclerosis through memory cell function has also been stressed [ ] . the granulomas induced by bcg are very different from those induced by mycobacterium leprae (m. leprae) in the guinea pig and have been extensively studied for their immune responsive effects. bcg induces an 'immunological' epithelioid cell granuloma that shows containment, successful killing and degradation. here the mononuclear phagocyte series take the form of epithelioid cells with extensive rough endoplasmic reticulum. on the other hand, m. leprae forms a 'non-immunological' macrophage-type granuloma that shows absence of organization of cells with failure to completely degrade. there is no evidence of epithelioid cell formation but the presence of undifferentiated macrophages that remain loaded with mycobacteria [ ] . the bcg vaccine has been used for nearly a century now for protection against tuberculosis but, it also protects against leprosy at a varying magnitude [ ] . recent interest in bcg was triggered because of its relation to the reduction in the severity and the mortality rate of covid- patients that were vaccinated [ ] [ ] [ ] [ ] [ ] and, this has been associated with trained immunity [ , ] . according to some reports bcg may be an option to enhance immunity of at-risk populations such as the elderly and healthcare workers for covid- disease [ ] [ ] [ ] . the objective of this work was to investigate the immune regulatory mechanism responsible for the induction of an 'immunological' type granuloma in the draining lymph node after bcg vaccination in guinea pigs and their early resolution in contrast to that observed with another mycobacterium, m. leprae. outbred dunkin hartley strain of guinea pigs of either sex were from david hall, newchurch, staffs uk. they were fed on rgp pelleted diet (c.f. dixon and sons, ware, herts) supplemented with cabbage and hay. protocols covering the use of animals were followed strictly according to the legislation for animal research of 'the animal (scientific procedures) act, uk . concanavalin a (con a, pharmacia fine chemicals, sweden) was dissolved in phosphate buffered saline at a concentration of . mg/ml, filter sterilized and stored in aliquots at À °c until use. ppd (tuberculin purified protein derivative, central veterinary laboratory, weybridge, uk) À mg/ml was dialyzed against volumes of pbs at °c for h. it was filter sterilized and stored in aliquots of . ml at À °c. leprosin, a soluble extract of m. leprae was obtained from the clinical research center, harrow, london. live bacillus calmette-guérin (bcg, pasteur strain) was obtained from the pasteur institute (paris). in cell cultures, it was used as such, heat killed ( °c for min) or cobalt irradiated at megarads (co-irr). the m. leprae used was always cobalt irradiated ( megarads) because of legal restrictions on the use of the live form due to its pathogenicity in man. guinea pigs weighing about g were injected intradermally on the dorsum of the ear with  bcg, a live attenuated vaccine or  co-irr m. leprae in . ml saline. autologous peritoneal exudate cells were used as antigen presenting accessory cells. animals were injected intraperitoneally with ml paraffin oil and on the fourth day the washing from the peritoneal cavity was collected and immediately centrifuged at g for min to remove the oil, washed twice with plain culture medium and suspended in complete medium ( viable cells/ ml) for further use. the draining post auricular (pa) and cervical (cer) lymph nodes were collected weeks after immunization in the case of bcg (unless otherwise stated) and after weeks in the case of m. leprae. hematoxylin and eosin staining of histological sections and electron microscopy of the lymph nodes were done as described by narayanan et al. [ ] . they were cut into small pieces in hank's balanced salt solution (hbss), gently teased to release the cells and the suspension of cells was passed through a steel wire mesh to remove the cell debris. cells thus obtained were washed three times with hbss at g and re-suspended ( .  viable cells per ml) in complete medium (rpmi- supplemented with % fetal calf serum, iu/ml penicillin, lg/ml streptomycin, mm l-glutamine and mm sodium pyruvate).  of these cells in ll were cultured in -well round-bottom plates with lg/ml ppd, lg/ml leprosin for h or lg/ml con a for h at °c in the presence of % co . lci h thymidine (amersham international) was added h before harvesting and the uptake was estimated using liquid scintillation counter (packard, berks uk) [ , ] . cells were also cultured in the presence of live bcg, heat-killed bcg or co-irr bcg for five days, pulsed with thymidine and harvested as above. all cell cultures were done in quadruplicates. the results are expressed as stimulation index (t/c) defined as counts/min of h thymidine uptake by proliferated cells divided by the counts/min of unstimulated cells. thus, t/c expresses the extent of proliferation of sensitized t cells relative to nonsensitized, unstimulated cells when cultured with antigen or mitogen. additionally, indomethacin was added in the cell culture to check whether the bcg induced suppression was prostaglandin mediated. indomethacin (sigma uk) was dissolved in ethanol at a concentration of mg/ml, the solution was diluted with excess pbs to lg/ml and filter sterilized. when required, lg/ml of indomethacin was added to cell cultures. to identify which fraction of the cell population of the cervical lymph node was responsible for the observed lack of proliferation, the total cells were separated into adherent and non-adherent fractions using a nylon wool (nw) column, a rapid, single step and cost effective procedure for the separation of high viability t cells that flow out in the non-adherent fraction, from heterogeneous mononuclear cell preparations [ , , ] . briefly, cells in ml complete medium were incubated for min in the nw column that was pre-incubated for h with % fetal calf serum. the nw non-adherent cells that are enriched in t cells were eluted with % fetal calf serum, washed and suspended in complete medium. subsequently, the adherent cells were released by teasing the nylon wool and eluting them out. the non-adherent and adherent cells were suspended separately at concentration  viable cells/ml in complete medium for further use. the non-adherent and adherent cell populations were mixed at ratios of : , : , : , and : in cell culture plates to make a total of  cells per well in ll complete medium. these were cultured in quadruplicates in the presence of lg/ml ppd as the antigen and  irradiated ( rads) autologous pecs as the antigen presenting cells (section . ). cell phenotypes present in the nw adherent fraction of the cervical lymph node cells from bcg injected guinea pigs were identified after staining them with respective antibodies.  nw adherent cells were incubated for min in ll of the following anti guinea pig cell monoclonal antibodies [ , ] : msgp , pan t marker antibodies; ct , putative t suppressor cell marker antibodies (free university amsterdam); msgpm, anti-macrophage antibodies; ct (b cell marker). the cells were washed with pbs and incubated for min with fluorescein isothiocyanate labeled anti mouse igm or igg (dilution : , sigma, uk) and the number of positive cells was estimated on a flow cytometer (facs- , becton-dickinson, rutherford, n.j., usa). to elucidate the relative involvement of either t cells or macrophages (isolated in the nw adherent fraction of the cervical lymph node) in the suppression of cell proliferation, enriched fractions of each of the two populations were prepared by depleting the other using immunomagnetic separation. -  cells from the adherent fraction were incubated with . ml of msgpm or msgp for min, washed and incubated with magnetic beads coated with sheep anti mouse igg (for msgpm) or anti mouse igm (for msgp ) (dynal, oslo, norway), for min at °c. the number of beads added was - per positively labeled cells (section . ). the suspension was diluted - times with hank's balanced salt solution containing % fetal calf serum and placed on a cobaltsamarium magnet (magnetic development, swindon, wilts, uk) that attracted the rosetted cells to the sides of the tube (fig. ) . the unrosetted cells were decanted off and the process was repeated. therefore, cells in the decanted fraction contained either the t cell enriched or the macrophage enriched fraction which were subsequently added separately to the non-adherent t cells ( .  cells adherent cells plus .  cells non-adherent cells). the final cell mixtures were cultured in quadruplicates with lg/ml ppd in the presence of  irradiated pecs as antigen presenting cells (section . ). the effects of injected bcg and m leprae on the stimulation index (t/c) measured in the post auricular and cervical lymph node cell preparations cultured with ppd, leprosin, concavalin a, or bcg: live, heat killed or co-irr were compared using student's t-test for means comparison. since the bcg and m. leprae were injected to different animals the independent samples t-test was applied. depending on the result of the equality of variances levene's test the appropriate degrees of freedom were used. differences in the t/c means were considered significant at the p < . level. the measurements are represented as means ± sd. all statistical analyses were conducted using spss statistical software (ibm inc., chicago, il, usa, version . , ). for non-linear model fitting and graphical presentations sigmaplot for windows . (systat software inc. san jose, california, us) was used. in fig. , granulomas in the draining post auricular lymph nodes formed after injection of live bcg or co-irradiated m. leprae on the dorsum ear are shown. histological sections stained with hematoxylin & eosin showed maximum infiltration at weeks for bcg and at weeks for m. leprae. at these times, the draining cervical lymph nodes showed no granuloma formation but extensive lymphoproliferation. fig. a shows a section of a distinct bcg draining granuloma in the post auricular lymph node consisting of large cells with epithelioid cell morphology surrounded by lymphocytes and fibroblasts. no acid-fast bacilli were detected. fig. b shows an enlarged image of an epithelioid cell in the bcg granuloma with characteristic large nuclei, prominent nucleoli and swollen stacked rough endoplasmic reticulum (arrows). fig. c shows a histological section of an m leprae granuloma. the majority of infiltrating cells are phagocytic macrophages. fig. d shows an enlarged image of a macrophage with extensive vacuolation and degraded, undigested remains of m. leprae (arrow). the above findings were in accordance with the results of previous works [ , ] . fig. b corresponding bar plots are shown in the presence of a non-specific mitogen con a. from fig. a it appears that except for pa lymph node cells with ppd, t/c is much lower for animals injected with bcg than m. leprae (compare bars b with d in both groups and a with c in the second). in other words, the cells from bcg injected animals responded to a lesser extent to specific antigens compared with m. leprae. this is particularly obvious for the responses of the cervical lymph nodes cells. the differences were also confirmed by statistical analysis (table ) . except for the pa cells with ppd, the responses of bcg and m leprae injected animals were significantly different for pa with leprosin (p = . ), for cer with ppd (p = . ) and for cer with leprosin (p = . ). on the other hand, in the presence of con a (graph b), the cells from the bcg injected animals proliferated extensively (y-axis scale in b is x larger than in a), indicating that otherwise the cells were active and responsive. furthermore, addition of lg/ml indomethacin did not enhance vaccine xxx (xxxx) xxx the response of the bcg cervical lymph node cells to ppd (first group, lower of the two stacked bars in b), signifying that the suppression was not prostaglandins mediated. the comparatively elevated responses of m. leprae draining lymph nodes to mycobacterial antigens may be an outcome of the excessive inflammatory infiltration observed in vivo and was not further analyzed due to reasons explained below. also, the lower response of these lymph nodes to con a has been addressed by gupta et al. [ ] . to further examine whether the response of bcg injected animals to antigens changes with harvesting time, the stimulation index (t/c) at two and five weeks after bcg injection ( ) to guinea pigs was compared and the results are presented in table . it can be seen that pa lymph node cells responded to ppd both at two and five weeks after injection (t/c from . to . , and from . to . respectively) and the responses at the two harvesting times were not statistically different (t-test, p = . ). additionally, the data in table show that the responses of the cervical lymph node cells both after two and five weeks remained low (from . to . , and from . to . ) and not significantly different (t-test, p = . ). following the unresponsiveness of bcg induced cervical lymph nodes to soluble mycobacterial antigens, it was thought worthwhile to check the response of lymph node cells of bcg and m. leprae injected animals to whole bcg organisms. differently processed whole bcg bacteria ( ) (live, heat killed or co-irr) were used, representing three different states. the results of the cell proliferative responses expressed as stimulation indices (t/c) are presented in fig. . in each group, the first two bars (a, b) correspond to bcg and the last two (c, d) to m. leprae induced lymph node cells. it is seen that for the bcg injected animals the cells from pa and the cer lymph nodes gave t/c between and , i.e. they responded - times more than the starting population. this is in contrast to the previously observed unresponsiveness to soluble antigens (fig. ) , signifying the presence in the lymph nodes of cells reactive to whole bcg. no significant differences are seen in fig. between the responses of bcg draining pa and cer lymph nodes (compare bars a and b in each group). regarding the response from m. leprae injection, with the exception of pa lymph nodes to heat killed mycobacteria, t/c ranged between . (live, bar c) and . (live, bar d) indicating greater overall proliferation than bcg. statistical analysis (t-test) was conducted to identify significant differences between the t/c of pa or cer lymph node cells for bcg and m. leprae injected animals with live, heat killed and co-irr bcg mycobacteria. the results in table show that bcg induced significantly lower response in the cer lymph nodes than m. leprae (p = . ) as it was also the case with the response to soluble mycobacterial antigens (fig. ) . however, bcg induced higher pa lymph node responses compared to m. leprae in the heat killed form (fig. ) bars a and c in the second group) (p = . ) which contradicts the results on soluble antigens, indicating different table statistical analysis (means comparison, t-test) of the effects of bcg and m. leprae injected in the ear on the stimulation index (t/c) of post auricular and cervical lymph node cells in the presence of ppd or leprosin. proliferative responses expressed as stimulation index (t/c, mean ± sd) from the post auricular and cervical lymph node cells of guinea pigs to ppd, two and five weeks after injection with bcg. responses of bcg and m. leprae draining lymph nodes to the heatkilled form of bcg mycobacteria. particularly, this may be due to the inability of proper digestion and presentation in culture in vitro. more studies on m. leprae induced granulomas were not further pursued because of dearth of supply of this mycobacterium. to elucidate which cells of the bcg draining cervical lymph node caused suppression of proliferation and lowering of the stimulation index (t/c) described above, they were separated into two fractions, the nylon wool (nw) adherent and the nw nonadherent. then, the two fractions were mixed at different ratios and the t/c with ppd was determined using pecs as accessory antigen presenting cells. the results are presented in fig. where it can be seen that the non-adherent cells proliferated up to a t/c of when cultured without the adherent, but with increasing proportion (x) of adherent cells the index decreased exponentially. the relationship is described by eq. ( ) with excellent fitting of the data as indicated by the value of the coefficient of determination (r = . ). t=c ¼ : þ : e ðÀ : xÞ ð Þ the sudden drop of proliferation reaching t/c of about at only % proportion of adherent cells, ==signifies their important role in suppression. to further demonstrate the strong abrogative effect of the adherent cells an experiment was conducted using of .  non-adherent cells, the same number as that in the % mixture (point c'), but in the absence of adherent cells (b'). as it can be seen from the dotted line in fig. , the t/c obtained was . , which is about . times higher than the t/c of . obtained with the same number .  non-adherent cells but mixed with equal number of adherent (point c'). this result clearly signifies the strong suppressive effect of the nw adherent fraction of the bcg draining cervical lymph nodes cells. to elaborate the cell phenotypes that were present in the nw adherent fraction of the bcg induced cervical lymph nodes they were labeled with monoclonal antibodies specific for major cell populations found in the guinea pig lymph nodes. these included msgp (pan, total t cells); ct (t suppressor cells); msgpm (macrophages); msgp (b cells). the proportions of the cell phenotypes in the nw adherent fraction of cells from the cervical lymph node are presented in table . the majority were macrophages (total . %) and b cells (total . %) followed by t lymphocytes (totals . %) which consisted mostly of the suppressor lineage ( %), as they labelled with ct , a putative suppressor cell marker. the % difference of the total ( %) from % can be ascribed to a small population of immature or other cells that did not stain with any of the antibodies. it can be noticed that all pan t cells consisted of suppressor/cytotoxic subtype. differences in the percentages of msgp /ct among animals may be ascribed to inter-subject variation. table statistical analysis (means comparison, t-test) of the effects of bcg and m. leprae injection on the stimulation index (t/c) of post auricular and cervical lymph node cells in the presence of live, heat killed or co-irr bcg. levene's test 'student's' t-test since the results of the phenotypic analysis showed that the nw adherent population of cells from bcg stimulated cervical lymph nodes consisted of t cells ( . %) and macrophages ( . %), it was of interest to further look into their role in suppression. for this purpose, enriched cell populations of (i) t cell enriched and (ii) macrophage enriched were prepared from the adherent fraction by immunobead enrichment (section . ). these were added to the non-adherent ( : ratio) in the final cultures. thus, the total number of cells in the resulting cultures was .  enriched adherent (either t cell enriched or macrophages enriched), .  non-adherent,  pecs and ppd ( lg/ml). in fig. are presented the proliferative responses expressed as counts/min of non-adherent cells alone, non-adherent cells with the t cell enriched fraction from the adherent population and non-adherent cells with the macrophage enriched fraction from the adherent population. although there is large inter-subject variability, in out of the five experimental animals, it is seen that when the t cells or macrophages were present individually in the culture, the proliferative response was enhanced. this is more pronounced with the macrophages enriched culture. therefore, t cells or macrophages individually increased proliferation, whereas their co-existence in the nw adherent fraction caused immunosuppression as shown by the reduction of the stimulation index in fig. . in , narayanan et al demonstrated that intradermal injection of mycobacteria in the ear of guinea pigs caused the formation of granulomas in the draining pa lymph nodes while the cer lymph nodes showed no granuloma but extensive blastogenesis. the bcg draining granulomas were analogous to tuberculoid (immunological) leprosy lesions and the m. leprae draining granulomas analogous to lepromatous (non-immunological) leprosy lesions [ ] . therefore, these became excellent models for studying mycobacteria induced granuloma formation and immune responses in an animal model that was not possible in patients. the present study showed that contrary to m. leprae injected guinea pigs, cells from the cervical lymph nodes draining bcg induced granuloma did not respond in vitro to soluble mycobacterial antigens, ppd and leprosin, though they responded to whole bcg organisms. the observed suppression was neither due to prostaglandins (addition of indomethacin did not increase the stimulation index (t/c), fig. ) nor early harvesting of cells from the lymph nodes. interestingly, these cervical lymph nodes did contain ppd reactive t cells as was confirmed when the latter were cultured with the antigen in the presence of autologous accessory antigen presenting cells. additionally, neither the adherent macrophage fraction nor the adherent t cell fraction individually suppressed the response of the t cells, signifying that their synergistic action was required. in humans, bcg vaccination provides long-term imprinting of suppressor t regulatory phenotypes with low inflammation [ ] . similarly, suppressor macrophages have also been demonstrated in a number of studies involving mycobacteria and other intracellular pathogens [ , ] . their mode of suppression may be through direct contact with lymphocytes or by releasing suppressive mediators [ , ] . it has also been demonstrated that macrophages and t cells may act together in concert to induce suppression of other cell functions [ ] [ ] [ ] [ ] . in the present investigation, the in vitro suppression observed in the cervical lymph node cells was not due to classical tolerance to the antigen, because cells from the adjacent pa lymph nodes showed marked responses. therefore, an immune-controlling regulatory mechanism must operate in the cervical lymph nodes of guinea pigs injected with bcg but not with m. leprae. and, this must boost the early resolution at weeks post injection along with progressive replacement of the infiltrated areas by fibrosis and decrease in the lymph nodes weight, signs indicating recovery. similar self-contained lesions are observed in healthy human controls after bcg vaccination and, tuberculoid but not lepromatous leprosy where the lesions are of 'infiltrating' type and wide spread. it has therefore been implied that the suppressor activity in certain infections such as tuberculoid leprosy was generated as part of well-regulated immune response [ ] . thus, it is likely that the suppressor cells in the bcg induced cervical lymph nodes, as seen in this study, participate in the early resolving of the granulomas by controlling excessive proliferation or inflammation. the immune system is inherently a ''double-edged sword" and must be tightly regulated [ ] . bcg vaccination offers heterologous protection against unrelated pathogens through altered responses to subsequent stimuli, termed ''trained immunity" [ ] . even though it is not clear to what extent guinea pigs can be infected by sars-cov and sars-cov [ , ] sars-cov- has been found to be immunogenic in these animals [ ] [ ] [ ] . this has sparked interest in the use of bcg vaccine for potential new therapeutic uses and treatment of autoimmune diseases [ ] . in the case of the current covid- pandemic, in countries where bcg vaccination is obligatory, number of deaths due to infection, was reduced [ , ] . through an experimental model, the present work provides evidence for an induced regulatory mechanism and highlights the role of bcg in the regulation of a granuloma by the induction of immune suppressor cells. finally, we show experimentally, the generation of an immunoregulatory mechanism that controls and resolves a granulomatous lymph node condition induced by bcg vaccination. further characterization of the cell populations involved should be fascinating although it is practically beyond the immediate scope of this investigation. in this study, we show that two important cell populations namely, regulator (suppressor) t cells and macrophages function together in a process that lead to the 'immunological' character and early resolution of a granuloma in guinea pigs vaccinated intra dermally with bcg. for comparison purposes, results from a 'nonimmunological' granuloma induced in the same manner by another mycobacterium m. leprae are also presented. s.v. contributed the in vivo and in vitro experiments, interpretation of data and writing of the manuscript. i.n. contributed statistical analysis, interpretation of data and writing of the manuscript. the authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. training the trainable cells of the immune system and beyond antigen processing and presentation to t cells monocyte-mediated regulation of cellular immunity in humans: loss of suppressor activity with ageing a suppressor b lymphocyte inhibiting il- consumption in spleen cell cultures from mycobacterium bovis bcg-infected mice cd + regulatory t cells, and not cd + t cells, dominate suppressive phenotype and function after in vitro live mycobacterium bovis-bcg activation of human cells suppressor adherent cells in human hodgkin's disease. an immunodepleting and immunosuppressive disorder the resurrection of t cell-mediated suppression requirement for histocompatible macrophages and lymphocytes antigen-presenting function of alveolar macrophages: uptake and presentation of listeria monocytogenes alveolar macrophages. ii. inhibition of lymphocyte proliferation by purified macrophages from rat lung atvb distinguished scientist award: how costimulatory and coinhibitory pathways shape atherosclerosis exploring the full spectrum of macrophage activation how dying cells alert the immune system to danger aberrant immunoregulatory control of b lymphocyte function in lepromatous leprosy characteristics of suppressor macrophages induced by mycobacterial and protozoal infections in relation to alternatively activated m macrophages lymphokine regulation of activated (g ) lymphocytes. i. prostaglandin e -induced inhibition of interleukin production macrophages in tissue repair, regeneration, and fibrosis il- family of cytokines b-cell suppression of delayed hypersensitivity reactions immune suppression with supraoptimal doses of antigen in contact sensitivity: i. demonstration of suppressor cells and their sensitivity to cyclophosphamide b-cell-mediated regulation of delayedtype hypersensitivity activation of suppressor t cells by autologous lymphoblastoid cells: a mechanism for feedback regulation of immunoglobulin synthesis learning from other autoimmunities to understand targeting of b cells to control multiple sclerosis comparison of mycobacterial granulomas guinea-pig lymph nodes bcg vaccination and leprosy protection: review of current evidence and status of bcg in leprosy control mandated bacillus calmette-guérin (bcg) vaccination predicts flattened curves for the spread of could bcg vaccination induce protective trained immunity for sars-cov- ? correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study bacillus calmette-guérin vaccine, antimalarial, age and gender relation to covid- spread and mortality bcg-induced cross-protection and development of trained immunity: implication for vaccine design pathophysiology of covid- : why children fare better than adults? netea mihai g. safety and covid- symptoms in individuals recently vaccinated with bcg: a retrospective cohort study significantly improved covid- outcomes in countries with higher bcg vaccination coverage. a multivariable analysis vaccines experimental mycobacterial granulomas in guinea pig lymph nodes: ultrastructural observations accessory cell function of cells of the mononuclear phagocyte system isolated from mycobacterial granulomas accessory cell function of dendritic cells from lymph nodes containing <i>mycobacterium leprae</i> induced granulomas separation of lymphoid cells on nylon wool columns phenotypic analysis of guinea pig langerhans cells with antibodies directed against leucocyte surface antigens macrophage specific antigen is expressed by resting microglia in the cns but not by langerhans cells in the skin the origin, morphology, and function of epithelioid cells regulatory t-cells at the interface between human host and pathogens in infectious diseases and vaccination presence of a macrophage-mediated suppressor cell mechanism during cell-mediated immune response in experimental visceral leishmaniasis immunology and immunopathology of african trypanosomiasis immunosuppression effected by macrophage surfaces regulation of the immune response by prostaglandins the evolution of immunosuppressive cell populations in experimental mycobacterial infection evidence for two distinct populations of suppressor cells in the spleens of mycobacterium bovis bcg-sensitized mice mechanisms of action of mycobacterium bovis bcginduced suppressor cells in mitogen-induced blastogenesis regulatory role of fcr+ and fcrmonocyte subsets in mycobacterium leprae-induced lymphoproliferative response in vitro evidence for the presence of m. leprae reactive t lymphocytes in patients with lepromatous leprosy an integrated view of suppressor t cell subsets in immunoregulation bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity bcg as a case study for precision vaccine development: lessons from vaccine heterogeneity, trained immunity, and immune ontogeny pathology of guinea pigs experimentally infected with a novel reovirus and coronavirus isolated from sars patients comparison of sars-cov- spike protein binding to human, pet, farm animals, and putative intermediate hosts ace and ace receptors development of an inactivated vaccine candidate, bbibp-corv, with potent protection against sarscov- immunogenicity of a dna vaccine candidate for covid- part of this article is from the phd thesis of dr s. vergkizi conducted at the royal college of surgeons of the university of london. the work was funded by the british leprosy relief association (lepra) and is dedicated to late prof john l. turk and late dr jill curtis, stalwarts in mycobacterial research of that time. key: cord- -c cu vrp authors: wallis, christopher j.d.; novara, giacomo; marandino, laura; bex, axel; kamat, ashish m.; karnes, r. jeffrey; morgan, todd m.; mottet, nicolas; gillessen, silke; bossi, alberto; roupret, morgan; powles, thomas; necchi, andrea; catto, james w.f.; klaassen, zachary title: risks from deferring treatment for genitourinary cancers: a collaborative review to aid triage and management during the covid- pandemic date: - - journal: eur urol doi: . /j.eururo. . . sha: doc_id: cord_uid: c cu vrp context: the coronavirus disease (covid- ) pandemic is leading to delays in the treatment of many urologic cancers. objective: to provide a contemporary picture of the risks from delayed treatment for urologic cancers to assist with triage. evidence acquisition: a collaborative review using literature published as of april , . evidence synthesis: patients with low-grade non–muscle-invasive bladder cancer are unlikely to suffer from a – -month delay. patients with muscle-invasive bladder cancer are at risk of disease progression, with radical cystectomy delays beyond wk from diagnosis or completion of neoadjuvant chemotherapy. prioritization of these patients for surgery or management with radiochemotherapy is encouraged. active surveillance should be used for low-risk prostate cancer (pca). treatment of most patients with intermediate- and high-risk pca can be deferred – mo without change in outcomes. the same may be true for cancers with the highest risk of progression. with radiotherapy, neoadjuvant androgen deprivation therapy (adt) is the standard of care. for surgery, although the added value of neoadjuvant adt is questionable, it may be considered if a patient is interested in such an approach. intervention may be safely deferred for t /t renal masses, while locally advanced renal tumors (≥t ) should be treated expeditiously. patients with metastatic renal cancer may consider vascular endothelial growth factor targeted therapy over immunotherapy. risks for delay in the treatment of upper tract urothelial cancer depend on grade and stage. for patients with high-grade disease, delays of wk in nephroureterectomy are not associated with adverse survival outcomes. expert guidance recommends expedient local treatment of testis cancer. in penile cancer, adverse outcomes have been observed with delays of ≥ mo before inguinal lymphadenectomy. limitations include a paucity of data and methodologic variations for many cancers. conclusions: patients and clinicians should consider the oncologic risk of delayed cancer intervention versus the risks of covid- to the patient, treating health care professionals, and the health care system. patient summary: the coronavirus disease pandemic has led to delays in the treatment of patients with urologic malignancies. based on a review of the literature, patients with high-grade urothelial carcinoma, advanced kidney cancer, testicular cancer, and penile cancer should be prioritized for treatment during these challenging times. the rapid spread of coronavirus disease , caused by the a novel betacoronavirus known as severe acute respiratory syndrome coronavirus- (sars-cov- ), throughout the world has had dramatic effects on individuals and health care systems far beyond those infected with sars-cov- [ ] . the heavy demand for resources, exacerbated by limited excess health system capacity, means that health care systems have become quickly overwhelmed and hospitals have become sources for virus transmission. in response, professional bodies have recommended reprioritizing surgical cases [ ] depending on the risks of covid- to individual patients and health care workers caring for patients potentially infected with sars-cov- , and the need to conserve health care resources along with the risk from delaying cancer care. a severe sars-cov- phenotype is seen more commonly in men and older, more comorbid patients [ ] . these characteristics are common in many patients with urologic malignancies. baseline characteristics among patients admitted to the intensive care unit j o u r n a l p r e -p r o o f (icu) in the lombardy region, italy, showed that the median age was yr (interquartile range [iqr] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] , % were male, % had more than one comorbidity, % required ventilator support, and the mortality rate was %, with a large proportion requiring ongoing icu-level care at the time of data cut-off [ ] . work from china further demonstrated that patients with cancer had a higher incidence of covid- than expected in the general population and had more severe manifestation of the disease, with a significantly higher proportion requiring invasive ventilation in the icu or dying [ ] . recent data suggest that approximately % of asymptomatic covid- -positive patients may die after an elective operation [ ] . to better inform decision making regarding deferring treatment of urologic cancers at this time, we undertook a collaborative review of the available data on the association between treatment delays and important oncologic outcomes including survival in patients with urologic cancers. to rapidly provide information, a formal systematic review was not undertaken. instead, a scoping narrative review was performed. following agreement on manuscript structure, a literature review was performed by teams based on clinical specialty (urologic oncology, radiation oncology, and medical oncology). to this end, pubmed was searched from inception until april , to identify studies examining the association between delays in treatment and clinical outcomes, including upstaging, recurrence, and mortality for patients with bladder cancer (bc; both muscle-invasive and non-muscle-invasive disease), prostate cancer (pca), kidney cancer, upper tract urothelial cancer, germ cell tumors, and penile cancer. where available, we relied on previously published systematic reviews and metaanalyses, supplemented by a narrative review of key studies and those published since the systematic review. the available data were qualitatively synthesized and presented, stratified by tumor site and urologic versus medical oncology intervention. in the absence of high-quality literature evidence, an expert opinion was given by the authors for this review. following agreement on manuscript structure, the authors drafted relevant sections of this narrative review according to their expertise. the resulting manuscript was critically revised by all authors. the final manuscript represents the consensus of the authors. according to estimates, there were new cases of bc and deaths worldwide in [ ] . among these cases, about % are estimated to be ta/tis at initial presentation, % stage i, % stage ii, % stage iii, and % stage iv disease in the usa [ ] . most cases are in men, and the average age of onset is over yr. with regard to mortality risk from covid- , % of patients with bc have one comorbidity (such as hypertension, cardiovascular, or pulmonary), % have two or more comorbidities, and the risks of dying from bc or from a competing diseases are similar at yr after diagnosis [ , ] . low-grade non-muscle-invasive bladder cancer (nmibc) is relatively an indolent disease. long-term bc-specific mortality rates are around - % [ ] , and active surveillance j o u r n a l p r e -p r o o f (as) for recurrent low-and intermediate-risk nmibcs is an important management option [ ] . guidelines suggest discharge after or mo if the patient is recurrence free [ , ] symptoms, such as the onset of visible hematuria, should be re-evaluated (eg, with cytology and either radiologic imaging or clinic cystoscopy) to assess their disease status. for high-grade nmibc, progression to muscle invasion/metastases occurs in - % and - % of patients may die from bc [ , ] . primary treatments include bacillus calmette-guérin (bcg) immunotherapy and radical cystectomy (rc) [ ] . early re-resection reveals muscle invasion in up to % of initial pta and % of pt tumors [ ] . the risks of progression in patients whose re-resection contains no tumor are lower (at around % every yr [ , ] ). given limited surgical capacity during the covid- pandemic and a lack of prospective data showing superiority of either approach, in our view, bcg is the preferred choice for most patients who have had their tumors visually resected. the use of re-resection should be individualized according to covid- risk (local incidence and patient risk factors), bc risk, and initial turbt features (eg, can be omitted if there are pta and muscle in the first specimen). there are suggestions that bcg may enhance antibody response to sars-cov- j o u r n a l p r e -p r o o f [ , ] . rc should be considered in patients at low risk of covid- mortality and with highrisk disease features, for example, presence of high-grade pt plus tis, or tumors with lympho(vascular) invasion, variant histology (eg, micropapillary disease), residual grade /highgrade urothelial carcinoma on re-resection, or pt stage [ ] [ ] [ ] . with respect to bcg therapy, while maintenance full-dose bcg is superior to alternatives, most benefit appears to come from the induction and first maintenance doses (so-called + ) [ ] . as such, it appears reasonable in times of high sars-cov- prevalence to discontinue subsequent maintenance bcg instillations in persons at risk of covid- , who have responded to induction ( ) and first maintenance (+ ) bcg. if the covid- pandemic subsides, we recommend continuation of to mo of maintenance therapy. with regard to starting bcg, progression rate and re-resection data suggest that if bcg is deferred for - mo, restarting with a cystoscopy  re-resection may be most suitable. in patients who undergo rc for bcg-unresponsive nmibc, with or without further intravesical therapy, the delay caused by an additional (unsuccessful) course of intravesical therapy did not result in differences in -yr overall survival (os) or cancer-specific survival (css) despite a median delay of . yr [ ] . finally, due to covid- pandemic, especially in geographic areas where the infection is causing a health care emergency, physicians should be aware of the potential risk of stage migration due to simplification of diagnostic procedures such as turbt. it is possible that urologists may opt for simpler minimally invasive procedures such as cystoscopy and biopsy, or even noninvasive procedures such as radiologic imaging prior to defining the therapeutic workup. we urge caution and highlight the importance of the turbt specifically in these highrisk patients [ ] . in patients with high-grade nmibc, induction bcg and one course of maintenance therapy ( + ) should be offered as first-line therapy. re-resection may be deferred in lower-risk cases (eg, pta), but should not be abandoned in higher-stage (pt ) or higher-risk disease, especially if no muscle was present in the initial resection. the decision to start bcg immediately or defer it (following a repeat resection) depends on the risk of infection with sars-cov- and an unfavorable course of covid- , bladder tumor risk, and health care capacity. rc should be offered for higher-risk tumors, if hospital capacity allows and if patient comorbidities do not put them at a higher postoperative risk. maintenance bcg after the first -mo booster series may be omitted until risks of covid- become lower. the effect of delays in surgical intervention has been explored thoroughly in muscleinvasive bladder cancer (mibc). a recent systematic review ( studies) and a meta-analysis ( studies) provide a contemporary picture of these data [ ] . there was considerable variation in the nature of the delay investigated: from the diagnosis to rc ( studies), from turbt to rc (seven studies), from first clinic visit to rc (or radiotherapy; one study), from referral to first treatment (one study), and from neoadjuvant chemotherapy (nac) to rc (four studies). assessing the delay between bc diagnosis and survival, four of nine studies assessing the question found a significant association between delay from diagnosis to rc and survival. russell and colleagues [ ] meta-analyzed the available studies assessing this question. in three studies with data that could be pooled, the authors found an increased risk of death for patients operationalizing delay as the interval between turbt and rc, four of six studies assessing this question found an association with survival. utilizing a cubic spline to model the nonlinear relationship, kulkarni and colleagues [ ] found that the risk of death began to rise, beginning at d between turbt and rc. in this case, russell et al [ ] meta-analyzed five studies and found a nonsignificant pooled effect estimate of . ( % ci . - . ) for os, with significant between-study heterogeneity (i = %). finally, five studies assessed the question of whether the time duration between completion of nac and rc was associated with survival outcomes. two studies demonstrated that prolonged time between nac and rc was associated with adverse survival outcomes, and an additional study demonstrated that delays were associated with upstaging. boeri et al [ ] found that patients who had > wk between the last cycle of nac and rc had significantly worse cancer-specific mortality ( yr free rate: . % at  wk vs . % at > wk) and overall mortality ( yr free rate: . % at  wk vs . % at > wk). chu et al [ ] found similar results, while three other analyses failed to support these results. specifically, if we look at the data relevant to the context of the current covid- pandemic, audenet and colleagues [ ] found that delays of > wk in nac were associated with an increased risk of upstaging, but no harm in delays up to mo from diagnosis to rc, assuming that nac was administered in the meantime. in this case, a meta-analysis of three studies with data suitable for pooling failed to demonstrate a significant association between delays from the termination of nac to rc with survival (hr . , % ci . - . ; i = %) [ ] . lin-brande et al [ ] examined outcomes for patients with variant histology undergoing rc. the authors dichotomized surgical delays using thresholds of , , and wk. on multivariable analysis, for patients with variant histology, no significant difference in os was apparent when "early" versus "late" surgery was dichotomized at wk (hr . , % ci . - . ) or wk (hr . , % ci . - . ), but significant differences were apparent when delayed surgery was defined as surgery beyond wk following diagnosis (hr . , % ci . - . ). taken together, these data suggest that prolonged delays (exceeding d) between diagnosis/turbt and rc are associated with worse survival, with the caveat that the data are mixed and pooled results demonstrate considerable heterogeneity. the european association of urology (eau) guidelines advise to maintain the delay below the wk threshold [ ] . further, when nac is employed, impact of delays in rc no longer appear to be significant. an analysis of funnel plots indicates that there is a publication bias toward studies that demonstrate worse survival associated with delays, suggesting that this finding may be exaggerated in the literature [ ] . previous studies also reported shorter survival in patients who experienced a delay in definitive surgery, while they received nac [ ] . this potential risk for patients receiving preoperative chemotherapy may be exacerbated during the covid- pandemic due to the predicted higher frequency of treatment-related side effects in patients developing an infection during treatment, as anticipated by chinese authors [ , ] . there are no positive adjuvant studies for os. this therapy should be avoided during the pandemic as the risks of chemotherapy increase the risk-benefit ratio further [ ] . additionally, radiotherapy (trimodal therapy with radiosensitizing chemotherapy) could be considered an alternative based on individual hospital and patient factors [ ] . adjuvant therapy has no role. the use and choice of systemic therapies in patients with new bc metastases should be individualized according to symptoms, risk of infection with sars-cov- , and unfavorable course of covid- , and likely prognosis. cytotoxic chemotherapy remains the treatment of choice for the majority of patients with advanced or metastatic bc. a regime comprising cisplatin and gemcitabine with granulocyte colony-stimulating factor, rather than methotrexate, vinblastine, doxorubicin/adriamycin, and cisplatin (mvac), should be considered, given the higher likelihood of neutropenia in patients receiving mvac [ ] , which may be dangerous during the covid- pandemic. in patients with previously untreated programmed death ligand- (pd-l )-positive locally advanced and metastatic urothelial carcinoma, immune-checkpoint inhibitors may be more attractive than cytotoxic chemotherapy due to a reduced likelihood of immunosuppression [ ] . however, immune-checkpoint blockade is associated with potentially serious side effects, including those requiring icu-level resources and need for high-dose glucocorticoids [ ] , which may be in short supply in the current environment. anecdotally, we have noted that both patients and health care professionals seem nervous about starting or pursuing immune therapy due to the belief that serious pulmonary complications from covid- may be due to excessive inflammatory response caused by checkpoint inhibition. there are few data to support this view, and so an individualized approach is recommended. our consensus is that first-line treatment should be commenced when possible for metastatic urothelial carcinoma and should not be stopped without justification (table ) [ ] . immunotherapy rather than chemotherapy may be given preferentially to patients with pd-l positive tumors. during the covid- pandemic, risks and benefits of systemic therapy should be considered on an individual level, taking into account disease characteristics (ie, pd-l positivity), tumor load and dynamics, patient performance status, geographical covid- burden, and hospital resources. palliative chemotherapy should be deferred at this time. pca is the commonest noncutaneous male malignancy in the western world [ ] . according to estimates, there were new cases of pca and deaths worldwide in [ ] . at diagnosis, % of the patients are estimated to present localized disease, % regional disease, and % metastatic disease in the usa [ ] . with regard to the current pandemic, pca is more common in men at risk of adverse outcomes from covid- . for example, the incidence of pca increases with age and in black men [ ] , and > % of affected men have one or more comorbidities [ ] . for the vast majority of men, it will be more prudent j o u r n a l p r e -p r o o f to perform pca investigations, including imaging or biopsy, when the risks from covid- are lower. urologists have recognized for many years that definitive intervention (radical prostatectomy [rp] or radiotherapy) may be delayed for long durations (years and potentially indefinitely) for patients with low-risk pca, as as is very rarely associated with adverse clinical outcomes in this population [ ] [ ] [ ] . however, metastasis-free survival (mfs) and pca-specific survival are significantly worse for patients with gleason + disease undergoing as compared with those with gleason + disease [ ] . thus, it appears that for men with intermediate-risk disease (and presumably also for those with high-risk disease), there is risk to a surveillance strategy. in our literature review, two relevant review articles were identified: one was a narrative review [ ] and the other a systematic review [ ] . the narrative review of bourgade and colleagues [ ] concluded that the heterogeneous nature of pca meant that generalizable conclusions could not be drawn, in routine care, on the basis of three cited studies. van den bergh and colleagues [ ] provided a more comprehensive systematic review including studies, of which assessed patients treated with rp, three studies assessed patients treated with radiotherapy, and one study assessed patients treated with either modality. as should be the preferred management strategy for patients with low-risk pca. patients considering focal therapy may safely defer treatment until the pandemic is over. while van den bergh and colleagues [ ] [ ] found no significant differences in pathologic findings (positive surgical margins, extraprostatic extension, seminal vesicle invasion, or lymph node involvement) or use of adjuvant therapy between patients who received surgery within mo and those who received surgery - mo following diagnosis, when stratified by biopsy gleason grade group (ggg). similarly, there were no differences in -or -yr biochemical recurrence-free survival (rfs) or j o u r n a l p r e -p r o o f -, -, or -yr mfs between patients receiving earlier surgery and those who had delayed treatment, when stratified by biopsy ggg. delays up to mo from diagnosis were not associated with adverse pathologic findings (gleason upgrading, extraprostatic extension, seminal vesicle invasion, positive surgical margins, or lymph node involvement) [ , ] or pca-specific mortality [ ] , across risk strata and including patients with intermediate-risk localized disease, high-risk localized disease, and high-risk locally advanced disease [ ] . fossati and colleagues [ ] examined even longer durations of delay between diagnosis and surgery. among patients treated with rp at san raffaele hospital in milan, the authors used nonparametric curve fitting models to assess the relationship between the time from diagnosis to surgery and oncologic outcomes, including biochemical recurrence and clinical recurrence. the median time from diagnosis to surgery was . mo. among all patients, the authors identified a significant association between the time to surgery and risk of biochemical recurrence (hr . , p = . ) and clinical recurrence (hr . , p = . ), although this relationship was nonlinear. utilizing nonparametric curve fitting, the authors identified that the risk of biochemical recurrence increased significantly with delays of > mo. in sensitivity analyses, this effect was seen only in patients with high-risk disease. among patients with highrisk disease, an increased risk of biochemical recurrence was seen with presurgical delays exceeding mo. however, others have found that safe delays may be considerably shorter. berg et al [ ] found that among their cohort (which was much less contemporary), the risk of adverse pathologic findings increased beyond d for patients with intermediate-risk disease and d for patients with high-risk disease. meunier and colleagues [ ] found that there was an j o u r n a l p r e -p r o o f increased risk with delays of > and d for patients with gleason + disease and gleason  disease, respectively. while zanaty et al [ ] found no significant association between the time to surgery and pathologic outcomes, regardless of preoperative risk stratification, they found a significant increase in the risk of biochemical recurrence for patients with high-risk disease who waited longer than d. finally, a recent analysis from the mayo clinic suggested that patients with high-risk disease who waited for > mo without neoadjuvant androgen deprivation therapy (adt) had an increased risk of biochemical recurrence, although they did not assess shorter time intervals [ ] . the analyses presented thus far have examined patients who received no therapy during the delay to definitive local treatment. however, neoadjuvant adt may offer an option to temporize patients at particularly high risk of progression during forecasted delays. in a cochrane systematic review and meta-analysis of randomized or quasirandomized clinical trials, kumar and colleagues [ ] found that, while there was a marginal benefit in terms of disease recurrence (or . , % ci . - . ), there was no benefit or harm to neoadjuvant adt compared with immediate rp in terms of pca-specific survival (or . , % ci . - . ) or os (or . , % ci . - . ) for patients with localized and locally advanced pca. while neoadjuvant adt has not been adopted routinely on the basis of a failure to improve survival outcomes compared with early definitive treatment, in the current environment, these data may be viewed in another manner: namely, that neoadjuvant adt may offer the ability to defer definitive intervention safely without compromising long-term outcomes. in the post-rp setting, based on recently presented, but unpublished, evidence from raves [ ] and radicals [ ] trials, early salvage is a preferable option as compared with immediate, adjuvant irradiation when needed. for patients with intermediate-and high-risk disease, delays of - mo appear not to be associated with adverse pathologic outcomes, biochemical recurrence, or survival outcomes. some data suggest that these intervals may be longer (up to mo in patients with high-risk disease [ ] ). neoadjuvant adt prior to radiotherapy is the standard of care usually for - mo. it might be prolonged much longer for those at particularly high risk of progression or recurrence if radiotherapy has to be delayed until after peak health care resource utilization associated with covid- . for surgery, although added value of neoadjuvant adt is questionable, it might also be considered if a patient is interested in such an approach. while the majority of the literature assessing delays in the treatment of pca has assessed patients undergoing rp, van den bergh et al [ ] identified four studies assessing patients treated with radiotherapy. notably, none of these included patients receiving brachytherapy. while three of these studies reported no significant difference in biochemical rfs, mfs, css, or os, nguyen et al [ ] found that treatment delays, particularly those exceeding . mo, were associated with worse biochemical control in patients with high-risk disease. there is no biologic rationale to suggest that treatment delays should differentially affect patients opting for radiotherapy, rather than rp, in the treatment of localized pca. thus, it is likely safe to delay treatment for - mo for these patients. in circumstances where treatment is offered, covid- -related risks differ somewhat for patients receiving surgery and radiotherapy. whereas surgery entails short hospitalization j o u r n a l p r e -p r o o f with the use of operating room resources, radiotherapy requires multiple outpatient visits. it is unclear which will contribute a greater patient-and system-level covid- -related risk. where radiotherapy is planned to be administered, a recent cochrane database systematic review and meta-analysis of studies including patients demonstrated that for those with intermediate-and high-risk pca, hypofractionation is associated with equivalent oncologic outcomes (mfs, disease-specific survival, and os), as well as functional outcomes [ ] . use of an ultrahypofractionated schedule (five to seven fractions) is both in line with clinical guidelines [ ] and a way to reduce resource utilization and individual patient exposure [ ] . utilization of a longer period of neoadjuvant adt may allow for resolution of the current limitations in health care resources before the planned initiation of radiotherapy. a recent paper by zaorsky et al [ ] introduced the concept of a remote visits, avoidance, deferment, and shortening of radiotherapy (rads) framework to determine the appropriate management for patients with pca in the covid- pandemic. men starting radiotherapy can safely defer treatment for - mo. hypofractionation (either moderate, - fractions over . - wk [ ] , or extreme, five to seven fractions-an stereotactic body radiotherapy approach) may decrease health care burden and patient sars-cov- exposure. neoadjuvant adt allows safe deferral of radiotherapy until resolution of the current covid- -related health care resource pressures. the treatment of both metastatic hormone-sensitive pca (mhspc) and castrationresistant pca (mcrpc) over the past decade has evolved to provide several treatment options for these patients. debate continues as to the proper sequencing of these agents, specifically regarding chemotherapy and androgen-receptor (ar) targeted therapies. in the current landscape of the covid- pandemic, there is a paucity of data with regard to treatment delays in the metastatic setting; thus, the following recommendations are based on expert opinion. first, frontline treatment should be commenced where possible and oral ar targeted therapies should be prioritized over chemotherapy (table ) [ ] . although there is a proven survival benefit for docetaxel in the mhspc [ ] [ ] [ ] and mcrpc [ ] setting, the associated side effects (ie, neutropenia) that may require hospitalization should be avoided at this time. second, in patients requiring second-and third-line therapy, ar targeted therapies that have not been used previously should be prioritized. third, for patients currently on chemotherapy, it may be prudent to minimize the number of chemotherapy cycles and/or prolonging the cycle length. patients with metastatic pca should commence treatment, prioritizing ar targeted therapies over chemotherapy. glucocorticoid use should be minimized and patients should be considered for longer-duration adt injections. on a global scale, renal cell carcinoma (rcc) represents the sixth and th most diagnosed cancer in men and women, and accounts for % and % of all cancers in males and females, respectively. for both sexes, incidence rates increased in the uk by . - . % annually, while they decreased or stabilized in other northern european countries [ ] . at presentation, % of patients are estimated to have localized disease, % regional disease, and % metastatic disease in the usa [ ] . although declining, primary metastatic rcc still represents a significant fraction of the cases at the time of diagnosis and mortality rates remain stable despite the introduction of new systemic therapies [ ] . patients at an increased risk of covid- are comparable with the kidney cancer population, more likely males, hypertensive patients, and patients with more than one comorbidity [ ] . we identified a single narrative review [ ] but no systematic reviews assessing delays in treatment of kidney cancer. the following is a narrative summation of the primary literature identified. as with low-risk pca, numerous studies have demonstrated that small renal masses (srms) may be observed safely on an as protocol [ , ] . among patients treated at fox chase cancer center, mcintosh et al [ ] found a median initial linear growth rate of . mm/yr (iqr - ), which was not associated with os. the cumulative incidence of delayed intervention was % at yr, % at yr, % at yr, % at yr, and % at yr. importantly, delayed intervention was also not associated with os (hr . authors from the university of michigan have also assessed the effect of delayed resection (at least mo from presentation) after initial as for srms [ ] . in this study, patients underwent early resection and ( %) underwent delayed resection. the median time to resection was d (iqr - ) in the early intervention group and d (iqr - ) in the delayed intervention group. importantly, there was no difference in adverse final pathology (grade - , papillary type , sarcomatoid histology, angiomyolipoma with epithelioid features, or stage pt ) comparing those who underwent early versus late intervention. taken together, there are robust data supporting as for masses < cm, even up to yr after initial diagnosis, without age restriction [ , ] . while biopsy is often useful in the management suggesting that delays of months to years are unlikely to affect the resectability of these tumors. unfortunately, the small number of patients with ct disease precludes meaningful conclusions regarding these patients. in a retrospective review of patients undergoing partial or radical nephrectomy for relatively large kidney tumors (mean tumor size of .  . cm; . % pt b and . % pt ), stec et al [ ] found that the mean time from initial visit to surgery was . disease, delays of - mo do not appear to affect outcomes adversely. we were unable to identify any study assessing the impact of delayed surgical intervention among patients with locally advanced kidney cancer; thus, the impact of delayed intervention is essentially unknown. however, several large institutional studies have described timing of preoperative imaging for assessing renal vein/inferior vena cava (ivc) thrombus, which may guide urgency of surgical timing. while woodruff et al [ ] recommended the longest interval between imaging (computed tomography [ct]/magnetic resonance imaging) and surgery being no longer than d, studies from the mayo clinic and berlin, germany, report a median interval from imaging to resection of and d, respectively [ , ] . the data are scant regarding the safety of delaying surgery in patients with ct renal masses, in particular those with renal vein or ivc tumor thrombus involvement. these patients should be prioritized for surgical intervention, given the locally advanced nature of their disease, unknown j o u r n a l p r e -p r o o f risk of delayed resection, and potential for significant symptomatic complications including bleeding and ivc occlusion. the immediate surgery or surgery after sunitinib malate in treating patients with metastatic kidney cancer (surtime [nct ]) trial randomized patients to immediate cytoreductive nephrectomy (cn) followed by sunitinib or sunitinib followed by cn followed by two courses of adjuvant sunitinib. while significantly underpowered due to poor accrual, the trial reported a -wk progression-free rate of % in the immediate cn arm and % in the deferred cn arm (p = . ) [ ] . intention-to-treat analysis of the secondary outcome of os demonstrated significantly longer survival among patients in the delayed cn arm (median . mo) than in the immediate cn arm (median . mo; hr . , % ci . - . ). further, the carmena trial, which enrolled mostly poor-risk patients, was a noninferiority trial and used sunitinib, demonstrated no survival benefit from the addition of cn to systemic therapy in asymptomatic patients with metastatic kidney cancer [ ] . thus, cn should be avoided during the pandemic with delayed surgery, in keeping with the surtime approach, considered as an alternative to immediate nephrectomy in those who need surgery. in the current landscape, upfront systemic therapy should be prioritized over cn in asymptomatic patients with metastatic kidney cancer. nephrectomy should be reserved for symptomatic patients. j o u r n a l p r e -p r o o f in patients with locally advanced or metastatic rcc, the decision to start systemic therapy and the selection of agents depend on symptoms, patient comorbidities, and tumor risk stratification. apart from imperative indications due to the covid- pandemic, the notion of deliberate treatment delays in selected patients with metastatic rcc, particularly those with international metastatic rcc database consortium (imdc) good-risk disease, has previously been assessed in a number of studies, including two narrative reviews [ , ] , two prospective studies [ , ] , six retrospective studies [ ] [ ] [ ] [ ] [ ] [ ] , and a further three abstracts of retrospective studies. in each, the majority of patients initiated treatment at disease progression. in the largest prospective study of this approach to date, rini et al [ ] [ ] found that a delay of > wk in the initiation of systemic therapy did not significantly affect the cancer-specific outcomes. finally, the survival implications of delayed initiation of targeted therapy have also been investigated at the population level using the national cancer database (ncdb) data [ ] . time to initiation of targeted therapy was defined as "early" (within mo), "moderately delayed" ( - mo), "delayed" ( - mo), and "late" (> mo). on multivariable logistic regression analyses, delayed treatment initiation was not independently associated with worse os. there is no consensus as to the optimal therapeutic agent(s) to use during the covid- pandemic; thus, it is advisable to follow the eau guidelines, which provide first-, second-, and third-line options based on imdc favorable-versus intermediate/poor-risk disease [ ] . depending on the outcome prioritized (pfs, os, or toxicity), different agents may appear preferable [ , ] . while checkpoint inhibitor-based regimes have demonstrated os advantages compared with sunitinib, in the context of the current pandemic, it is worth considering that these came at the cost of more severe treatment-related adverse events (traes) [ ] , including those that may require hospitalization. among the n + i patients in checkmate who had immune-mediated traes, % received high-dose glucocorticoids [ ] . thus, although vascular endothelial growth factor (vegf) targeted therapy is associated with inferior os compared with immunotherapy, in the context of the covid- pandemic, these agents may be considered given their decreased risk of severe toxicity. patients with treatment-naïve favorable-and intermediate-risk disease who are asymptomatic or minimally symptomatic with limited disease burden may be considered for as until disease progression during the covid- pandemic. for poor-risk patients and those requiring treatment, there is no consensus regarding the optimal first-line therapy; however, vegf targeted therapy is less likely to require toxicity-related hospitalization and/or glucocorticoids than immunotherapy regimens. as with kidney cancer, we identified only a single narrative review [ ] and thus based our conclusions on the available primary literature. the management of upper tract urothelial carcinoma (utuc) is typically directed by a combination of disease grade (low vs high) and patient comorbidity. numerous studies have demonstrated that a period of endoscopic management of low-grade utuc is safe [ ] . the impact of delayed radical nephroureterectomy (rnu) for those requiring a more aggressive intervention is less clear. four studies were identified that assessed the impact of delaying rnu for diagnostic ureteroscopy  biopsy. in patients eventually undergoing rnu, single-center studies have shown that delays in surgery due to ureteroscopy beforehand did not affect survival in cohorts of patients with predominately low-grade disease (high grade comprising approximately one-third of cohort) or mixed disease characteristics (high grade comprising approximately % of cohort), although undergoing two ureteroscopic treatments prior to rnu was associated with an increased risk of intravesical recurrence in patients with predominately high-grade disease (high grade comprising approximately % of cohort) [ ] . subsequently, a study from the french collaborative national database on upper urinary tract urothelial carcinoma evaluated the j o u r n a l p r e -p r o o f influence of ureteroscopy prior to rnu on css, rfs, and mfs [ ] . as expected, time from diagnosis to rnu was longer among patients undergoing ureteroscopy ( . vs . d, p = . ). however, there were no differences in -yr css, rfs, or mfs, even in a subset of patients with confirmed muscle-invasive disease. not specifically assessing delays due to ureteroscopy, two institutional studies have assessed the impact of delayed rnu on pathologic and survival outcomes, both using a -mo first, where utuc exists in a solitary renal unit, intervention should be considered j o u r n a l p r e -p r o o f expeditiously, even in the case of low-grade disease, to protect long-term renal function. second, accurate grading and staging are much more difficult in utuc than in urothelial carcinoma of the bladder [ , ] . patients with suspected utuc may be initially investigated with urine cytology and ct urogram, forgoing diagnostic ureteroscopy unless there is considerable diagnostic uncertainty. patients with low-grade utuc are often managed with nephron-sparing approaches and thus are likely to have minimal to no risk with a surgical delay. in patients with high-grade disease, delays of up to wk may not be associated with changes in survival, despite worse pathologic outcomes. according to estimates, there were new cases of testicular cancer and deaths worldwide in [ ] . among those cases, % are estimated to have localized disease, % regional disease, and % metastatic disease in the usa [ ] . limited data, and no systematic reviews, were identified with respect to delays in treatment, including both orchiectomy and retroperitoneal lymph node dissection (rplnd), for testis cancer. urologic oncology dogma has been that testis masses should be treated with radical orchiectomy as soon as possible. in the ncdb, macleod et al [ ] found that most patients underwent orchiectomy within several days of diagnosis, with the highest quartile of delay corresponding to a -d delay. thus, they defined a delayed orchiectomy as the th percentile j o u r n a l p r e -p r o o f ( d from presentation) . however, the authors did not assess whether delays in orchiectomy were associated with pathologic or survival outcomes. in patients with clinical stage i germ cell tumors (gcts), as, rather than adjuvant therapy, is a standard of care [ ] [ ] [ ] . although there are no randomized trials comparing these approaches, the available data suggest no difference in survival [ ] . we were unable to identify any studies that assessed the effect of delayed rplnd for metastatic gcts. surgery is rarely indicated for patients with metastatic seminoma, and in the current environment, only imperative indications should be considered. for patients with nonseminomatous germ cell tumors (nsgcts), chemotherapy is typically the preferred initial approach. historically, nsgct patients with postchemotherapy masses < cm are observed; however, the impact of delaying postchemotherapy rplnd for masses larger than cm is unknown. for patients with advanced gcts, data are limited. however, the association between timely delivery of standard chemotherapy and the probability of cure is well recognized [ ] . according to estimates, there were new cases of penile cancer and deaths worldwide in [ ] . no systematic or narrative reviews, and little primary literature, assessing the effect of delays in management of penile cancer were identified, likely due to its rarity. no studies assessing delays between initial presentation/diagnosis and primary penectomy (partial, total, or radical) were identified. however, delays between initial appearance of a penile lesion and first medical consultation are common due, in part, to social stigma. de rose et al [ ] found that this interval averaged d among patients with penile cancer. the eau guidelines recommend modified inguinal lymphadenectomy or dynamic sentinel-node biopsy for all patients with intermediate-or high-risk tumors and nonpalpable nodes [ ] , given the risk for micrometastatic disease [ ] . among patients, those who received early inguinal lymphadenectomy (median time to surgery . mo, range - mo) had significantly lower -yr cancer-specific mortality than those who underwent delayed intervention (median time to surgery mo, range - mo; -ysr css % vs %; p = . ) [ ] . in the largest study to date, the group at the moffitt cancer center assessed the impact of early (< mo, n = ) and delayed ( mo, n = ) lymphadenectomy on regional recurrence and disease-free survival (dfs) [ ] . over a median follow-up of mo, early lymphadenectomy resulted in improved -yr rfs ( . % vs . %; hr . , % ci . - . ) and -yr dfs ( . % vs . %), compared with those in men undergoing delayed lymphadenectomy. for these reasons, and considering the ineffectiveness of chemotherapy in this tumor type, the use of perioperative systemic therapy in lymphadenectomy candidates should be carefully considered case by case after multidisciplinary discussion. we were unable to identify studies assessing the risk of delayed intervention of the primary penile carcinoma; however, given the rarity of this malignancy, symptomatology, and high risk for metastatic progression, it seems reasonable to avoid delays in primary surgical treatment. additionally, inguinal lymphadenectomy for men with clinicopathologic indications should occur within mo of treating the primary lesion. clinical trials represent a key platform of comprehensive cancer centers and may provide unique therapeutic options in patients with aggressive malignancies with limited standard therapies. these opportunities may still be provided to patients during the covid- outbreak, but likely require thorough evaluation on a case-by-case basis [ ] . considerations should be made as to whether clinical investigators and supporting staff are able to comply safely with the trial requirements and guarantee patients' compliance. j o u r n a l p r e -p r o o f furthermore, a patient's ability and risk to travel for therapy during a time of rigorous social distancing and household quarantine must be considered. in an attempt to offer optimal therapeutic options with inclusion in clinical trials, investigators should carefully evaluate the risks of adding extra delays in treatment initiation due to administrative issues or bureaucratic constraint related to covid- pandemic and extra visits requiring travel associated with a higher risk of infection in this mostly vulnerable population. early evidence from china has suggested that investigators who continue to enroll to clinical trials during the covid- pandemic should expect frequent protocol violations, with an average deviation of  d [ ] . while acknowledging the significant psychologic burden associated with a cancer diagnosis, likely magnified by delays in treatment, physicians who treat cancer patients must be good stewards of limited health care resources, particularly in the time of a pandemic. as a result, it is important to prioritize the timely care of patients for whom delays are most likely to result in adverse outcomes, also taking into account the patient's age, comorbidities, symptoms, and life expectancy. this review aims to assist with case triage and patient counseling by summarizing the available data on outcomes of delays in treatment for patients with urologic cancers. author contributions: zachary klaassen had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. clinical characteristics of coronavirus disease in china considerations in the triage of urologic surgeries during the covid- pandemic severe outcomes among patients with coronavirus disease (covid- )-united states baseline characteristics and outcomes of patients infected with sars-cov- admitted to icus of the lombardy region cancer patients in sars-cov- infection: a nationwide analysis in china clinical characteristics and outcomes of patients undergoing surgeries during the incubation period of covid- infection epidemiology of bladder cancer: a systematic review and contemporary update of risk factors cancer treatment and survivorship statistics effects of age and comorbidity on treatment and survival of patients with muscle-invasive bladder cancer competing mortality in patients diagnosed with bladder cancer: evidence of undertreatment in the elderly and female patients non-invasive urothelial neoplasms: according to the most recent who classification expectant management of small, recurrent, noninvasive papillary bladder tumors bladder cancer: diagnosis and management of bladder cancer risk-adapted management of low-grade bladder tumours: recommendations from the international bladder cancer group (ibcg) treatment strategy for newly diagnosed t high-grade bladder urothelial carcinoma: new insights and updated recommendations comparative outcomes of primary, recurrent, and progressive high-risk non-muscle-invasive bladder cancer european association of urology guidelines on nonmuscle-invasive bladder cancer (tat and carcinoma in situ)- update repeat transurethral resection in non-muscleinvasive bladder cancer: a systematic review long-term outcomes from re-resection for high-risk non-muscle-invasive bladder cancer: a potential to rationalize use recurrence, progression and cancer-specific mortality according to stage at re-tur in t g bladder cancer patients treated with bcg: not as bad as previously thought covid- and bacillus calmette-guérin (bcg): what is the link? bcg vaccination enhances the immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized, placebo-controlled pilot study predicting recurrence and progression in individual patients with stage ta t bladder cancer using eortc risk tables: a combined analysis of patients from seven eortc trials prognostic factors and risk groups in t g non-muscleinvasive bladder cancer patients initially treated with bacillus calmette-guerin: results of a retrospective multicenter study of patients what is the prognostic and clinical importance of urothelial and nonurothelial histological variants of bladder cancer in predicting oncological outcomes in patients with muscle-invasive and metastatic bladder cancer? a european association of urology muscle invasive and metastatic bladder cancer guidelines panel systematic review society for immunotherapy of cancer consensus statement on immunotherapy for the treatment of bladder carcinoma the timing of radical cystectomy for bacillus calmette-guerin failure: comparison of outcomes and risk factors for prognosis transurethral resection of bladder tumour: the neglected procedure in the technology race in bladder cancer a systematic review and meta-analysis of delay in radical cystectomy and the effect on survival in bladder cancer patients longer wait times increase overall mortality in patients with bladder cancer delaying radical cystectomy after neoadjuvant chemotherapy for muscle-invasive bladder cancer is associated with adverse survival outcomes delays in radical cystectomy for muscle-invasive bladder cancer a delay  weeks to neoadjuvant chemotherapy before radical cystectomy increases the risk of upstaging assessing the impact of time to cystectomy for variant histology of urothelial bladder cancer updated eau guidelines on muscle-invasive and metastatic bladder cancer clinical characteristics of covid- -infected cancer patients: a retrospective case study in three hospitals within wuhan, china effectiveness of adjuvant chemotherapy for locally advanced bladder cancer radiotherapy with or without chemotherapy in muscleinvasive bladder cancer efficacy and safety of dose-dense chemotherapy in urothelial carcinoma clinical outcome after progressing to frontline and second-line anti-pd- /pd-l in advanced urothelial cancer adverse event profile for immunotherapy agents compared with chemotherapy in solid organ tumors: a systematic review and meta-analysis of randomized clinical trials advice regarding systemic therapy in patients with urological cancers during the covid- pandemic cancer statistics cancer statistics, co-morbidities in a retrospective cohort of prostate cancer patients feasibility study: watchful waiting for localized low to intermediate grade prostate carcinoma with selective delayed intervention based on prostate specific antigen, histological and/or clinical progression -year outcomes after monitoring, surgery, or radiotherapy for localized prostate cancer ten-year mortality, disease progression, and treatmentrelated side effects in men with localised prostate cancer from the protect randomised controlled trial according to treatment received active surveillance for intermediate risk prostate cancer: survival outcomes in the sunnybrook experience impact of the length of time between diagnosis and surgical removal of urologic neoplasms on survival timing of curative treatment for prostate cancer: a systematic review evaluating the impact of length of time from diagnosis to surgery in patients with unfavourable intermediate-risk to very-high-risk clinically localised prostate cancer the effect of time from biopsy to radical prostatectomy on adverse pathologic outcomes is time from diagnosis to radical prostatectomy associated with oncological outcomes? evaluating the effect of time from prostate cancer diagnosis to radical prostatectomy on cancer control: can surgery be postponed safely? delay from biopsy to radical prostatectomy influences the rate of adverse pathologic outcomes does the delay from prostate biopsy to radical prostatectomy influence the risk of biochemical recurrence? does surgical delay for radical prostatectomy affect biochemical recurrence? a retrospective analysis from a canadian cohort impact of time from biopsy to surgery on complications, functional and oncologic outcomes following radical prostatectomy neo-adjuvant and adjuvant hormone therapy for localised and locally advanced prostate cancer a phase iii multi-centre randomised trial comparing adjuvant versus early salvage radiotherapy following radical prostatectomy: results of the trog . and anzup "raves" trial timing of radiotherapy (rt) after radical prostatectomy (rp): first results from the radicals rt randomised controlled trial (rct) the impact of a delay in initiating radiation therapy on prostate-specific antigen outcome for patients with clinically localized prostate carcinoma hypofractionation for clinically localized prostate cancer hypofractionated radiation therapy for localized prostate cancer: an astro, asco, and aua evidence-based guideline prostate cancer radiotherapy recommendations in response to covid- duration of androgen suppression before radiotherapy for localized prostate cancer: radiation therapy oncology group randomized clinical trial short-term neoadjuvant androgen deprivation and radiotherapy for locally advanced prostate cancer: -year data from the trog . randomised trial conventional versus hypofractionated high-dose intensity-modulated radiotherapy for prostate cancer: -year outcomes of the randomised, noninferiority, phase chhip trial chemohormonal therapy in metastatic hormonesensitive prostate cancer addition of docetaxel, zoledronic acid, or both to firstline long-term hormone therapy in prostate cancer (stampede): survival results from an adaptive, multiarm, multistage, platform randomised controlled trial comparison of abiraterone acetate and docetaxel with androgen deprivation therapy in high-risk and metastatic hormone-naive prostate cancer: a systematic review and network meta-analysis docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer incidence and mortality of kidney cancer: temporal patterns and global trends in countries active surveillance for localized renal masses: tumor growth, delayed intervention rates, and > -yr clinical outcomes five-year analysis of a multi-institutional prospective clinical trial of delayed intervention and surveillance for small renal masses: the dissrm registry effect of delayed resection after initial surveillance and tumor growth rate on final surgical pathology in patients with small renal masses (srms) surveillance of small renal masses in young patients: a viable option in the appropriate candidate the effect of delaying nephrectomy on oncologic outcomes in patients with renal tumors greater than cm growth kinetics and short-term outcomes of ct b and ct renal masses under active surveillance waiting time from initial urological consultation to nephrectomy for renal cell carcinoma-does it affect survival? the perioperative management of an inferior vena caval tumor thrombus in patients with renal cell carcinoma clinical and radiographic predictors of the need for inferior vena cava resection during nephrectomy for patients with renal cell carcinoma and caval tumour thrombus renal cell carcinoma with venous extension: prediction of inferior vena cava wall invasion by mri comparison of immediate vs deferred cytoreductive nephrectomy in patients with synchronous metastatic renal cell carcinoma receiving sunitinib: the surtime randomized clinical trial sunitinib alone or after nephrectomy in metastatic renalcell carcinoma is observation a valid strategy in metastatic renal cell carcinoma? the role of active surveillance and cytoreductive nephrectomy in metastatic renal cell carcinoma debulking nephrectomy followed by a "watch and wait" approach in metastatic renal cell carcinoma active surveillance in metastatic renal-cell carcinoma: a prospective, phase trial observation as a treatment strategy for advanced renal cell carcinoma-a call for prospective validation first experience of active surveillance before systemic target therapy in patients with metastatic renal cell carcinoma active surveillance for metastatic or recurrent renal cell carcinoma observation after cytoreductive nephrectomy in patients with synchronous not completely resected metastases of renal cell carcinoma incidence and outcomes of delayed targeted therapy after cytoreductive nephrectomy for metastatic renal-cell carcinoma: a nationwide cancer registry study the effect of a treatment delay on outcome in metastatic renal cell carcinoma european association of urology guidelines on renal cell carcinoma: the update first-line treatment of metastatic renal cell carcinoma: a systematic review and network meta-analysis first-line systemic therapy for metastatic renal cell carcinoma: a systematic review and network meta-analysis nivolumab plus ipilimumab versus sunitinib in advanced renal-cell carcinoma european association of urology guidelines on upper urinary tract urothelial carcinoma: update correlation between the timing of diagnostic ureteroscopy and intravesical recurrence in upper tract urothelial cancer the oncologic impact of a delay between diagnosis and radical nephroureterectomy due to diagnostic ureteroscopy in upper urinary tract urothelial carcinomas: results from a large collaborative database a delay in radical nephroureterectomy can lead to upstaging upper tract urothelial carcinoma: impact of time to surgery utility and diagnostic accuracy of ureteroscopic biopsy in upper tract urothelial carcinoma clinical staging of upper urinary tract urothelial carcinoma for t staging: review and pictorial essay disparities in access and regionalization of care in testicular cancer optimal management of high-risk stage i nonseminomatous germ cell tumor: surveillance is the preferred option conditional risk of relapse in surveillance for clinical stage i testicular cancer non-risk-adapted surveillance for stage i testicular cancer: critical review and summary contemporary assessment of long-term survival rates in patients with stage i nonseminoma germ-cell tumor of the testis: populationbased comparison between surveillance and active treatment after initial orchiectomy dose-response and dose-survival advantage for high versus low-dose cisplatin combined with vinblastine and bleomycin in disseminated testicular cancer. a southwest oncology group study risk factors for the delay in the diagnosis of penile lesions: results from a single center in italy eau guidelines on penile cancer: update dynamic sentinel node biopsy in penile cancer: initial experiences at a swedish referral centre impact of delay in inguinal lymph node dissection in patients with carcinoma of penis delay to inguinal lymph node dissection greater than months predicts poorer recurrence-free survival for patients with penile cancer the shifting landscape of genitourinary oncology at the time of covid- pandemic: how italian oncologists react. results from a national survey the surgical volume, safety, drug administration and clinical trials during covid- : single center j o u r n a l p r e -p r o o f j o u r n a l p r e -p r o o f f palliative ctx was tested with a specific number of cycles. the risk associated with stopping before this has not been assessed, nor the principles of delaying chemotherapy. there are subgroups of prostate and urothelial cancer patients for whom continuing ctx to the full number of cycles may be associated with more risk than benefit. patients will need to participate in this discussion.g assuming similar efficacy between the regimens.j o u r n a l p r e -p r o o f key: cord- - meen h authors: miller, aaron; reandelar, mac josh; fasciglione, kimberly; roumenova, violeta; li, yan; otazu, gonzalo h title: correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: meen h covid- has spread to most countries in the world. puzzlingly, the impact of the disease is different in different countries. these differences are attributed to differences in cultural norms, mitigation efforts, and health infrastructure. here we propose that national differences in covid- impact could be partially explained by the different national policies respect to bacillus calmette-guerin (bcg) childhood vaccination. bcg vaccination has been reported to offer broad protection to respiratory infections. we compared large number of countries bcg vaccination policies with the morbidity and mortality for covid- . we found that countries without universal policies of bcg vaccination (italy, nederland, usa) have been more severely affected compared to countries with universal and long-standing bcg policies. countries that have a late start of universal bcg policy (iran, ) had high mortality, consistent with the idea that bcg protects the vaccinated elderly population. we also found that bcg vaccination also reduced the number of reported covid- cases in a country. the combination of reduced morbidity and mortality makes bcg vaccination a potential new tool in the fight against covid- . the covid- pandemic originated in china and it has quickly spread over all continents affecting most countries in the world. however, there are some striking differences on how covid- is behaving in different countries. for instance, in italy there has been strong curtailing of social interactions and covid- mortality is still high. in contrast, japan had some of the earlier cases, but the mortality is low despite not having adopted some the more restrictive social isolation measurements. these puzzling differences have been adjudicated to different cultural norms as well as differences in medical care standards. here we propose an alternative explanation: that the country-by-country difference in covid- morbidity and mortality can be partially explained by national policies on bacillus calmette-guérin (bcg) vaccination. bcg is a live attenuated strain derived from an isolate of mycobacterium bovis used widely across the world as a vaccine for tuberculosis (tb), with many nations, including japan and china, having a universal bcg vaccination policy in newborns . other countries such as spain, france, and switzerland, have discontinued their universal vaccine policies due to comparatively low risk for developing m. bovis infections as well as the proven variable effectiveness in preventing adult tb; countries such as the united states, italy, and the netherlands, have yet to adopt universal vaccine policies for similar reasons. several vaccines including the bcg vaccination have been shown to produce positive "heterologous" or non-specific immune effects leading to improved response against other nonmycobacterial pathogens. for instance, bcg vaccinated mice infected with the vaccinia virus were protected by increased ifn-y production from cd + cells . this phenomenon was named 'trained immunity' and is proposed to be caused by metabolic and epigenetic changes leading to promotion of genetic regions encoding for pro-inflammatory cytokines . bcg vaccination significantly increases the secretion of pro-inflammatory cytokines, specifically il- b, which has been shown to play a vital role in antiviral immunity . additionally, a study in guinea-bissau found that children vaccinated with bcg were observed to have a % reduction in overall mortality, which was attributed to the vaccine's effect on reducing respiratory infections and sepsis. given our current understanding of the bcg vaccine's nonspecific immunotherapeutic mechanisms and by analyzing current epidemiological data, this investigation aims to identify a possible correlation between the existence of universal bcg vaccine policies and the morbidity and mortality associated to covid- infections all over the world. we collected the bcg vaccination policies across countries from the bcg world atlas , available form http://www.bcgatlas.org/. we complemented the database in respect to dates of initiation of bcg vaccination. the additional references are in the adjunct table. data of covid- cases and death per country were obtained from https://google.org/crisisresponse/covid -map on the morning (est) of march st , . data were analyzed using matlab scripts. initially, we compared countries that never had in place a universal bcg vaccination policy (italy, usa, lebanon, nederland, and belgium), with countries that have a current universal bcg vaccination policy. we included only countries with more than million inhabitants. the mortality rate might be influenced by multiple factors including a country's standard of medical care. in order to account for that, we classified countries according to their gni per capita in using the world bank data (https://datahelpdesk.worldbank.org/knowledgebase/articles/ -worldbank-country-and-lending-groups). countries were divided in three categories: low income (l) with an annual income of , dollars or less, lower middle income with an income between , and , dollars, and middle high and high income countries, which included countries with annual incomes over , dollars. in order to determine if bcg vaccination was protective for covid- infections, we used the number of deaths per million inhabitants per country attributed to covid- (see attached table) . most of the countries with low-income levels ( / ) reported zero deaths attributed to covid- and have universal bcg policies in place consistent with a protective role of bcg vaccination. however, this might be because of underreporting and we have excluded them from the analysis. middle high and high-income countries that have a current universal bcg policy ( countries) had . ± . (mean±s.e.m) deaths per million people (see figure ). in contrast, middle high and high income countries that never had a universal bcg policy ( countries) had a larger mortality rate, with . ± . deaths per million people. this difference between countries was highly significant (p= . e- , wilcoxon rank sum test). middle high and high-income countries that have a universal bcg policy have some variability in the mortality rate. covid- has increased lethality with age . we wondered if countries that established a universal bcg policy earlier would have a reduced mortality rate, as older people that are more severely affected by covid- would be protected. we analyzed the data from countries where we had access to the start of the universal bcg vaccination policy. there was a positive significant correlation (ρ= . , p= . , linear correlation) between the year of the . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted march , . . establishment of universal bcg vaccination and the mortality rate, consistent with the idea that the earlier that a policy was established, the larger fraction of the elderly population would be protected (see figure , left panel). for instance, iran has a current universal bcg vaccination policy but it just started in , and has an elevated mortality with . deaths per million inhabitants. in contrast, japan started its universal bcg policy in and has around times less deaths per million people, with . deaths. brazil started universal vaccination in and also has an even lower mortality rate of . deaths per million inhabitants. as the numbers of tuberculosis cases dropped in the late th century, several middle high and high-income countries in europe dropped the universal bcg policy between years and . we hypothesized that although these countries do not have a universal current vaccination policy, they would also show a trend where the earlier they started their universal policy, the larger fraction of the elderly population would be covered, and the lower the death rate per million people. we analyzed countries that dropped their universal bcg policy. there was also a positive significant correlation (ρ= . , p= . , linear correlation) between the year of the establishment of universal bcg vaccination and the mortality rate (see figure , right panel). for instance, spain started their universal policy in and lasted until ( years) and has a high mortality rate ( . deaths per million inhabitants). in contrast, denmark started their policy in and ended in ( years) and has almost times less deaths per million inhabitants with . deaths. we have found evidence that bcg vaccination is correlated with reduced mortality rates produced by covid- . mortality rates are a robust measure that has less dependence to the levels of covid- testing. however, mortality rates per country relate to both the number of cases present in a country as well as the dead probability for individual cases. we wondered if bcg vaccination would also affect the spread of disease with the caveat that the number of reported covid- cases is going to depend strongly on the number of tests performed per country. the countries with low-income levels ( ) reported few number of cases of covid- per million inhabitants: . ± . . however, the issue of underreporting might be more critical for estimating the number of cases and we have excluded the low income countries from further analysis. middle high and high-income countries that have a current universal bcg policy ( countries) had . ± . (mean±s.e.m) cases per million inhabitants (see figure ). consistent with a role of bcg in slowing spread of covid- , middle high and high income countries that never had a universal bcg policy ( countries) had about times the number of cases per million inhabitants, with . ± . . this difference between countries was significant (p= . , wilcoxon rank sum test), suggesting that broad bcg vaccination along with other measures could slow the spread of covid- . we also wondered if the middle high and high-income countries that have current universal vaccination policies ( countries) would show a relationship between the number of cases and the year that the universal vaccination started. interestingly, there was no significant correlation (r= . , p= . ) between the year that vaccination started and the total number of covid- cases, suggesting that early vaccination of the elderly population was not a factor in reducing the number of cases (see figure ). we have shown epidemiological evidence indicating that some of the differences in morbidity and mortality produced by covid- across countries might be partially explained by a country's bcg . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted march , . . vaccination policy. italy, where the covid mortality is very high, never implemented universal bcg vaccination. on the other hand, japan had one of the early cases of covid- but it has maintained a low mortality rate despite not implementing the most strict forms of social isolation . japan have been implementing bcg vaccination since . iran had also been heavily hit by covid- and it started its universal bcg vaccination policy only in potentially leaving anybody over years old unprotected. why did covid- spread in china despite having a universal bcg policy since the 's? during the cultural revolution ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) , tuberculosis prevention and treatment agencies were disbanded and weakened . we speculate that this could have created a pool of potential hosts that would be affected by and spread covid- . currently, however, the situation in china seems to be improving. our data suggests that bcg vaccination seem to significantly reduce mortality associated with covid- . we also found that the earlier that a country established a bcg vaccination policy, the stronger the reduction in their number of deaths per million inhabitants, consistent with the idea that protecting the elderly population might be crucial in reducing mortality. however, there is still not proof that bcg inoculation at old age would boost defenses in elderly humans, but it seems to do so in guinea pigs against m. tuberculosis . bcg vaccination has been shown to produce broad protection against viral infections and sepsis , raising the possibility that the protective effect of bcg might be not directly related to actions on covid- but on associated co-occurring infections or sepsis. however, we also found that bcg vaccination was correlated with a reduction in the number of covid- reported infections in a country suggesting that bcg might confer some protection specifically against covid- . the broad use of the bcg vaccine across a population could reduce the number of carriers, and combined with other measures could act to slow down or stop the spread of covid- . different countries use different bcg vaccination schedules , as well as different strains of the bacteria . we have not divided the data depending on the strain used to determine which strains are better at stopping spread of infection, as well as reducing mortality in the elderly population. as each country used the same strain for the whole population, difference in strains for different purposes should be gathered in randomized control trials with different subjects from the same population tested with different strains. usa and other countries like italy without a universal vaccination policy but with high fraction of immigrants from countries with different universal bcg policies and using different strains offer the possibility to perform epidemiological studies to determine vaccination schedules and strains that would optimize protection against covid- . the correlation between the beginning of universal bcg vaccination and the protection against covid- suggests that bcg might confer long-lasting protection against the current strain of coronavirus. however, randomized controlled trials using bcg are required to determine how fast an immune response develops that protects against covid- . bcg is generally innocuous with the main side effect the development of inflammation at the site of injection. however, bcg is contraindicated in immune compromised people as well as pregnant women , so care should be taken when applying these possible intervention for covid- . . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted march , . . higher death rates were presented in countries that never implemented a universal bcg vaccination policy. . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted march , . . . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted march , . . https://doi.org/ . / . . . doi: medrxiv preprint figure : higher number of covid- cases were presented in countries that never implemented a universal bcg vaccination policy. . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted march , . . https://doi.org/ . / . . . doi: medrxiv preprint . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted march , . . https://doi.org/ . / . . . doi: medrxiv preprint cd t-cell-mediated heterologous immunity between mycobacteria and poxviruses trained immunity: a program of innate immune memory in health and disease. science ( -. ) long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity routine vaccinations and child survival: follow up study in the bcg world atlas: a database of global bcg vaccination policies and practices articles clinical course and risk factors for mortality of adult inpatients with covid- in wuhan , china : a retrospective cohort study japan was expecting a coronavirus explosion development and expectation of tuberculosis service system in china influence of advanced age on mycobacterium bovis bcg vaccination in guinea pigs aerogenically infected with mycobacterium tuberculosis non-specific effects of bcg vaccine on viral infections commonly administered bcg strains including an evolutionarily early strain and evolutionarily late strains of disparate genealogy induce comparable protective immunity against tuberculosis fact sheets | infection control & prevention | fact sheet -bcg vaccine | tb | cdc key: cord- -d ult u authors: pasco, samuel t.; anguita, juan title: lessons from bacillus calmette-guérin: harnessing trained immunity for vaccine development date: - - journal: cells doi: . /cells sha: doc_id: cord_uid: d ult u vaccine design traditionally focuses on inducing adaptive immune responses against a sole target pathogen. considering that many microbes evade innate immune mechanisms to initiate infection, and in light of the discovery of epigenetically mediated innate immune training, the paradigm of vaccine design has the potential to change. the bacillus calmette-guérin (bcg) vaccine induces some level of protection against mycobacterium tuberculosis (mtb) while stimulating trained immunity that correlates with lower mortality and increased protection against unrelated pathogens. this review will explore bcg-induced trained immunity, including the required pathways to establish this phenotype. additionally, potential methods to improve or expand bcg trained immunity effects through alternative vaccine delivery and formulation methods will be discussed. finally, advances in new anti-mtb vaccines, other antimicrobial uses for bcg, and “innate memory-based vaccines” will be examined. vaccine strategies typically aim to generate and subsequently preserve an antigen-specific, band/or t-cell-mediated immune response against the targeted pathogens. however, studies focused on live attenuated vaccines like the bacillus calmette-guérin (bcg), measles vaccine, oral polio vaccine (opv), and smallpox vaccine have described beneficial nonspecific effects that induce reduction in the overall mortality associated with infection [ ] . nonspecific effects mediated by the adaptive immune system have been described and include: cross-reactive t-cell receptors and/or antibodies, potentiation of classical cell-mediated immunity through increased general cytokine signaling, and bystander activation of memory components through a specific cytokine milieu [ ] . in contrast, the observed phenomena suggest mechanisms in adaptive-independent innate immune memory. these enhanced responses, known as trained immunity, involve epigenetic rewiring of innate immune cells that result in long-term adaptation and facilitate amplified responses to stimuli [ ] . complex stimuli, like bcg, and simple pathogen-associated molecular patterns (pamps), like β-glucan, can both produce trained immunity effects that persist days and months after in vitro and in vivo administration, respectively. the discovery of trained immunity opens up the possibility of designing vaccines that, at least in part, stimulate and prime innate cells to enhance their response against the target and other pathogens. this review will explore the nonspecific effects of bcg and its effects on the innate immune system. specifically, we will describe innate mechanisms of bcg-induced protection that produce trained immunity in monocytes and macrophages. we will also explore potential strategies for bcg to enhance innate memory responses through its formulation and delivery, especially to mucosal tissues. finally, we will extrapolate beyond bcg to explore other vaccine strategies that target and induce trained immunity. decreased the frequency of general infection that was most beneficial against respiratory infections of probable viral origin [ ] . trained innate immunity is characterized by enhanced cytokine production following in vitro stimulation with unrelated pathogens and non-specific stimuli. an experimental model established a protocol for human primary monocytes, where training stimuli are incubated with cells for h, rested for up to seven days, and re-stimulated with unrelated stimuli (figure ) [ ] . pbmcs trained with live bcg produced high levels of interleukin (il)- and tumor necrosis factor (tnf), and increased reactive oxygen species (ros) production and metabolic shifts dependent on training and resting time. inactivated bcg induces trained immunity, though at a lower magnitude than live bcg [ ] . increased il- production following in vitro bcg training and lipopolysaccharide (lps) stimulation occurs in both neonate and adult monocytes [ ] . naive monocytes are stimulated with bcg, then rested for several days. phagosomal digestion of bcg causes the release of muramyl dipeptide (mdp), as well as a metabolic shift towards glycolysis through the protein kinase b (akt)/mammalian target of rapamycin (mtor) pathway. mdp binds nucleotide-binding oligomerization domain-containing protein (nod ) to induce epigenetic histone alterations, which are interconnected with the metabolic changes. epigenetic modifications result in increased access to the promoter regions of genes related to inflammatory pathways, such as cytokine and pattern recognition receptors (prrs). trained monocytes express higher levels of prrs and produce increased levels of cytokines following stimulation with heterologous pathogens or pathogenassociated molecular patterns (pamps). innate immune cells from bcg-vaccinated subjects have enhanced responses upon restimulation, particularly with pamps and heterologous pathogens. however, these effects do not appear immediately, as whole blood from newborns vaccinated within a week of birth contained higher il- concentrations and produced fewer cytokines and chemokines following stimulation with different toll-like receptor (tlr) agonists and heterologous pathogens than unvaccinated blood [ ] . trained immunity effects likely take more than a week to take effect, as stimulation with tlr agonists of whole blood from low birth weight infants four months post vaccination did increase production of il- β, il- , tnf, and ifnγ [ ] . similarly, at the same time point, healthy infants' whole blood stimulated with heat killed heterologous pathogens, and other pamps demonstrated increased production of cytokines and chemokines and suppressed production of six cytokines, figure . mechanisms of in vitro bacillus calmette-guérin (bcg) training. naive monocytes are stimulated with bcg, then rested for several days. phagosomal digestion of bcg causes the release of muramyl dipeptide (mdp), as well as a metabolic shift towards glycolysis through the protein kinase b (akt)/mammalian target of rapamycin (mtor) pathway. mdp binds nucleotide-binding oligomerization domain-containing protein (nod ) to induce epigenetic histone alterations, which are interconnected with the metabolic changes. epigenetic modifications result in increased access to the promoter regions of genes related to inflammatory pathways, such as cytokine and pattern recognition receptors (prrs). trained monocytes express higher levels of prrs and produce increased levels of cytokines following stimulation with heterologous pathogens or pathogen-associated molecular patterns (pamps). innate immune cells from bcg-vaccinated subjects have enhanced responses upon re-stimulation, particularly with pamps and heterologous pathogens. however, these effects do not appear immediately, as whole blood from newborns vaccinated within a week of birth contained higher il- concentrations and produced fewer cytokines and chemokines following stimulation with different toll-like receptor (tlr) agonists and heterologous pathogens than unvaccinated blood [ ] . trained immunity effects likely take more than a week to take effect, as stimulation with tlr agonists of whole blood from low birth weight infants four months post vaccination did increase production of il- β, il- , tnf, and ifnγ [ ] . similarly, at the same time point, healthy infants' whole blood stimulated with heat killed heterologous pathogens, and other pamps demonstrated increased production of cytokines and chemokines and suppressed production of six cytokines, with distinct responses to each stimulus [ ] . mrna transcription and secretion of il- β and tnf from pbmcs of vaccinated adult volunteers increased following heterologous stimulation, up to three months post vaccination [ ] . pbmcs from volunteers vaccinated with gamma-irradiated bcg (γbcg) only demonstrated increased cytokine production in response to mtb antigens, with no significant trained immunity effects observed after two weeks and three months [ ] . bcg vaccination in adults over induced trained immunity, with larger effects seen in those with a positive igra at baseline [ ] . increased tnf and il- secretion following pathogen stimulus returned to baseline after one year, except for lps-induced tnf and il- β [ ] . additionally, monocyte-derived macrophages isolated three weeks post bcg vaccination from a subset of subjects, deemed "responders", demonstrated enhanced containment of virulent mtb replication [ ] . furthermore, stimulation of pbmcs from both vaccinated and unvaccinated early clearers produced more cytokines following heterologous bacterial stimulation [ ] . bcg immunization in humans outside the context of preventing mtb has demonstrated altered immune responses when administered with other pathogens, in both vaccination and challenge experiments. bcg inoculation to naive volunteers before vaccination with attenuated yellow fever virus (yfv) resulted in lower viremia, without affecting anti-yfv humoral responses, demonstrating that its effects only modulate the anti-yfv innate response [ ] . interestingly, while pbmcs from vaccinated individuals released more cytokines following ex vivo stimulation, unvaccinated individuals had higher systemic cytokine levels. bcg can improve adaptive responses, as bcg administration before vaccination against the h n pandemic influenza strain improved antibody responses against the virus [ ] . bcg-naive volunteers challenged with plasmodium falciparum developed overall higher parasitemia and earlier symptoms, though a subgroup had earlier monocyte activation and lower parasitemia [ ] . however, in an experimental endotoxemia immunoparalysis trial, γbcg did not confer protection in vivo nor altered leukocyte responses ex vivo [ ] . following standard intradermal inoculation, resident epidermal macrophages are the first immune cells to encounter bcg. before recruiting other immune cells, these macrophages phagocytose the bacilli and bind mycobacterial pamps through pattern recognition receptors (prrs), including complement receptor , tlr , and tlr [ , ] . one week post vaccination, blister cell infiltrates demonstrated high frequencies of neutrophils, monocytes, and lymphocytes with low frequencies of dendritic and natural killer cells ( figure ) [ ] . furthermore, live bcg can persist at the inoculation site up to four weeks post vaccination. seven days after vaccination in a mouse model, the lungs contained higher percentages of extravasated cd b + f / + monocytes and cd b + cd + cells, demonstrating an increased load of phagocytic cells [ ] . interestingly, in humans, vaccination reduces expression of cd b and human leukocyte antigen, dr isotype (hla-dr) in cd + /cd + alveolar macrophages both after two weeks and three months [ ] . unfortunately, trained immunity effects could not be observed in these macrophages, due to activation following sputum collection. intradermal bcg vaccination and establishment of trained immunity in vivo. lyophilized bcg bacilli reconstituted in saline is administered by intradermal injection. neutrophils, monocytes, and lymphocytes are the predominant cells that infiltrate the vaccination site, where live bcg can persist for up to four weeks. a yet uncharacterized signal (potentially mdp) causes a change in the hematopoietic stem cells of the patient's bone marrow, which induces a transcriptional shift resulting in increased myelopoiesis. as early as two weeks following inoculation, monocytes have a trained immunity phenotype with sustained epigenetic changes that last up to a year. while mycobacterial pamps bind to many host prrs, the induction of bcg-induced trained immunity depends on the key cytosolic prr nucleotide-binding oligomerization domain-containing protein (nod ). stimulation of macrophages deficient in nod with bcg did not result in increased cytokine production following heterologous stimulation, demonstrating the critical importance of this signaling pathway in establishing trained immunity [ ] . similarly, γbcg stimulation of monocytes from patients with a different homozygous nod mutation also resulted in a decreased induction of trained immunity [ ] . nod binds muramyl dipeptide (mdp), the minimal structural component of peptidoglycan necessary for biological action, which is released following lysosomal digestion of bacteria or intracellular bacterial growth [ ] . while bcg vaccination causes an increase in circulating mdp concentration, the baseline mdp concentration strongly and positively correlates with il- β, il- , and tnf production following nonspecific stimulation of pbmcs three months post vaccination [ ] . additionally, mdp concentration did not affect the specific ifnγ-mediated antimycobacterial response, demonstrating that the adaptive response relies on separate mechanisms than trained immunity. interestingly, bcg vaccination in nod-deficient mice seven days prior to challenge, regardless of inoculation route, induced similar immunity to wild-type mice, as measured by mycobacterial loads [ ] , thus showing that its role primarily pertains to initiating memory. bcg vaccination causes changes to the cellular metabolic pathways, in both in vitro training assays and in vaccinated subjects. in vitro, bcg training induces elevated glucose consumption, lactate release, oxygen consumption rates, and glutamine metabolite concentrations, which result from increased phosphorylation of akt, mammalian target of rapamycin (mtor), and other downstream effector proteins [ ] . additionally, inhibition of glycolytic metabolism, glutamine metabolism, and the downstream signaling molecules prevented the training effects. furthermore, ex vivo pbmc stimulation from bcg-vaccinated subjects and unvaccinated subjects treated with metformin, an mtor inhibitor, demonstrated increased lactate concentrations in the supernatants figure . intradermal bcg vaccination and establishment of trained immunity in vivo. lyophilized bcg bacilli reconstituted in saline is administered by intradermal injection. neutrophils, monocytes, and lymphocytes are the predominant cells that infiltrate the vaccination site, where live bcg can persist for up to four weeks. a yet uncharacterized signal (potentially mdp) causes a change in the hematopoietic stem cells of the patient's bone marrow, which induces a transcriptional shift resulting in increased myelopoiesis. as early as two weeks following inoculation, monocytes have a trained immunity phenotype with sustained epigenetic changes that last up to a year. while mycobacterial pamps bind to many host prrs, the induction of bcg-induced trained immunity depends on the key cytosolic prr nucleotide-binding oligomerization domain-containing protein (nod ). stimulation of macrophages deficient in nod with bcg did not result in increased cytokine production following heterologous stimulation, demonstrating the critical importance of this signaling pathway in establishing trained immunity [ ] . similarly, γbcg stimulation of monocytes from patients with a different homozygous nod mutation also resulted in a decreased induction of trained immunity [ ] . nod binds muramyl dipeptide (mdp), the minimal structural component of peptidoglycan necessary for biological action, which is released following lysosomal digestion of bacteria or intracellular bacterial growth [ ] . while bcg vaccination causes an increase in circulating mdp concentration, the baseline mdp concentration strongly and positively correlates with il- β, il- , and tnf production following nonspecific stimulation of pbmcs three months post vaccination [ ] . additionally, mdp concentration did not affect the specific ifnγ-mediated antimycobacterial response, demonstrating that the adaptive response relies on separate mechanisms than trained immunity. interestingly, bcg vaccination in nod-deficient mice seven days prior to challenge, regardless of inoculation route, induced similar immunity to wild-type mice, as measured by mycobacterial loads [ ] , thus showing that its role primarily pertains to initiating memory. bcg vaccination causes changes to the cellular metabolic pathways, in both in vitro training assays and in vaccinated subjects. in vitro, bcg training induces elevated glucose consumption, lactate release, oxygen consumption rates, and glutamine metabolite concentrations, which result from increased phosphorylation of akt, mammalian target of rapamycin (mtor), and other downstream effector proteins [ ] . additionally, inhibition of glycolytic metabolism, glutamine metabolism, and the downstream signaling molecules prevented the training effects. furthermore, ex vivo pbmc stimulation from bcg-vaccinated subjects and unvaccinated subjects treated with metformin, an mtor inhibitor, demonstrated increased lactate concentrations in the supernatants and inhibited bcg-induced trained immunity respectively, thus confirming in vivo the in vitro observations. bcg-induced training causes epigenetic histone modifications that remodel chromatin, and the resulting transformational changes allow differential gene expression for a more robust response. in vitro, bcg training induced trimethylation increase at histone h lysine (h k ), an activator marker, and decrease at histone h lysine (h k ), a repressor marker, of promoters for tnf, il- , mtor, and enzymes for glycolysis and glutaminolysis [ ] . additionally, mrna expression from mtor and metabolic enzymes subsequently increased, but chemical inhibition of these proteins abrogated training effects, demonstrating the interconnectivity between metabolic and epigenetic changes. γbcg-trained pbmcs also upregulated the h k position at tnf and il- promoters, though not as robustly as live bcg [ ] . in vitro training in the presence of all trans-retinoic acid, which increases expression of the inhibitory histone methyltransferase suv h responsible for h k trimethylation, demonstrated dose-dependent repression of cytokine promoter regions [ ] . inhibiting histone methyltransferase activity, but not demethylase activity, during in vitro bcg training prevented enhanced cytokine responses following nonspecific stimulation [ ] . bcg responders had distinct methylation patterns at three weeks, and four and eight months post vaccination, which were tied to immune pathways such as "innate immune response" and "leukocyte activation" [ ] . vaccination increased the accessibility of several genes associated with inflammatory processes while decreasing accessibility of genes related to lymphoid development and anti-inflammatory processes [ ] . pbmcs from vaccinated subjects demonstrated increased h k trimethylation at promoters for il- , tnf, and tlr [ ] . vaccination also induces acetylation at histone h lysine promoters and regulators for inflammatory, cytokine, g protein-coupled receptor, and protein kinase genes [ ] . in addition to enhanced cytokine responses to heterologous stimulation, circulating monocytes express higher levels of prrs. pbmcs from vaccinated subjects express increased levels of tlr and cd b three months post bcg [ ] . cd and cd were persistently increased throughout a year follow-up, while tlr and mannose receptor expression increased one year post vaccination [ ] . effects of trained immunity can last up to a year, even though monocytes have a - day half-life [ ] , indicating that changes could be made in progenitor cells. intravenously delivered bcg can sustainably reprogram murine hematopoietic stem and progenitor cells (hspcs) in the bone marrow (bm) to enhance myelopoiesis, and the resulting epigenetically modified macrophages and monocytes provided protection against mtb in vitro and in vivo, respectively [ ] . a groundbreaking study demonstrated similar changes in human bm following bcg vaccination in healthy naive subjects, where the upregulated transcriptional shift towards myelopoiesis and subsequent increased cytokine production from pbmcs following nonspecific stimulation was confirmed [ ] . specifically, the epigenetic modifications in hspcs guarantee continued modification for circulating monocytes days after vaccination ( figure ) . furthermore, the identification of the hepatic nuclear factor family of transcription factors as master regulators of trained immunity induction in hspcs provides mechanistic insight of the process. it remains to be seen by what mechanism these bm changes occur and for how long these changes last, though mdp likely plays a role in establishing trained immunity in these cells. while bcg has been used for almost years, it does not confer complete protection against mtb. new strategies should be explored to address the many factors that could enhance the uniformity and effects of bcg. for example, more than different strains of bcg exist, but considerable variability in mycobacterial viability, rna content, and activation of cytokine responses exist, likely contributing to the vaccine's inconsistent effects [ ] . additionally, intradermal administration of bcg has well-documented limitations in its ability to protect against disease. one factor that could contribute to these limited effects, particularly in areas of low vaccine efficacy, is exposure to non-mtb environmental mycobacteria. intradermally vaccinated mice chronically exposed to oral m. avium produced more t regulatory cells and immunosuppressive il- while decreasing ifnγ production [ ] . therefore, exploring different inoculation routes and vaccine composition could provide improvements to the protective effects. intravenous delivery of bcg has been explored. potential benefits include more direct vaccine delivery to the pulmonary tissues where natural infection begins as well as to the bm where hpscs reside. intravenous bcg delivery to nonhuman primates (nhps) resulted in increased ifnγ production and cd + t-cell frequencies while reducing pathology and improving survival compared to other vaccination methods [ ] . nhps demonstrated thorough protection against mtb challenge following intravenous bcg administration [ ] . specifically, intravenous delivery resulted in major increases in antigen-responsive adaptive cells in the bronchoalveolar lavage (bal), lung lymph nodes, lung parenchymal tissues, blood, and spleen. however, there was no evidence of trained immunity, as pbmcs from both intradermally and intravenously vaccinated nhps stimulated with non-mtb antigens failed to produce increased levels of tnf, il- β, or il- . this represents puzzling results inconsistent with murine and intradermal human studies. however, as of this publication, no studies have explicitly established bcg-induced trained immunity effects in nhps. mucosal immunization with bcg has been investigated. the total mucosal surface area is about times larger than skin, and vaccination at the sites of pathogen invasion could generate a protective immunological response [ ] . while oral bcg was the initial delivery method almost a century ago, oral vaccines generally must survive the acidic environment of the stomach and run the risk of generating tolerance without an adjuvant [ ] . that said, comparing intradermal and oral delivery in humans, oral bcg induced stronger mucosal responses, as measured by mtb-specific bronchoalveolar lavage (bal) t-cells and secretory immunoglobulin a (iga), though intradermal bcg resulted in stronger systemic th responses [ ] . these results also demonstrate that mucosal vaccination at one site can produce a response at a distal mucosal surface. respiratory delivery of bcg would result in mucosal vaccination at the infection site, allowing tissue-resident immune cells more direct access to the vaccine antigens. imprinting protective effects on lung innate cells to respond better to an mtb encounter could help phagocytic cells resist mtb-directed immunosuppression [ ] . studies have explored airway delivery of bcg (such as through aerosol, intratracheal, or pulmonary vaccination). aerosol bcg vaccination in young calves induces a trained immunity phenotype in circulating pbmcs, as demonstrated by increased cytokine production after pamp stimulation [ ] . however, this phenotype did not appear in alveolar macrophages, potentially due to the immunosuppressive nature of these cells. in nhps, pulmonary vaccination followed by repeated mtb exposure reduced lung pathology [ ] . nhps that received an intratracheal bcg boost after intradermal bcg vaccination also reduced pulmonary disease [ ] . aerosol bcg vaccination in mice conferred protection against mtb challenge through increased ifnγ levels and t-cell recruitment into the lung, even in the presence of environmental mycobacteria [ ] . furthermore, trained immunity is affected by the timing of bcg administration. in clinical trials in guinea-bissau, bcg immunization to low-weight infants administered between november and january, during peak malaria infections, both beneficially reduced all-cause neonatal mortality and resulted in stronger responses to heterologous stimulation in whole blood assays, suggesting that there may be seasonal considerations for bcg immunization [ ] . trained immunity effects, as well as specific adaptive responses, were stronger when bcg was administered to adult volunteers in the early morning versus later in the morning, while evening vaccination produced almost no enhancement in specific and nonspecific effects [ ] . the efficacy of bcg and other vaccines may be affected by the administration schedule, as simultaneous bcg and oral polio vaccine (opv) vaccination in infants reduced in vitro cytokine responses at weeks and in vivo responses to mtb-purified protein derivative at two months [ ] . tetanus-diphtheria-pertussis-inactivated polio vaccine-induced immunosuppression in adult volunteers was rescued by bcg administration concurrently or after three months [ ] . chemical alteration of the bcg vaccine could enhance innate responses and help establish trained immunity, through selective nutrient culturing or chemical treatment. bcg cultured in a phosphate-deficient media resulted in increased expression of glycoprotein adhesins that facilitated macrophage phagocytosis [ ] . alveolar lining fluid (alf), which mtb passes through upon infection, alters bcg immunogenicity, as mice subcutaneously vaccinated with alf-treated bcg demonstrated reduced mtb burden and lung inflammation [ ] . bcg itself may be too pathogenic for pulmonary inoculation, but removing inflammatory lipids by petroleum ether treatment prior to murine aerosol vaccination demonstrated improved protection against infection and reduced inflammation in the lung [ ] . interestingly, in vitro macrophage stimulation with the delipidated bcg resulted in reduced mycobacterial uptake, intracellular growth, and cytokine production compared to standard bcg. these effects could be further enhanced if bacilli were delivered with phagocytosis-promoting compounds or adjuvants. chitosan, the second most abundant natural biopolymer found in some microbial cell walls and exoskeletons of crustaceans and insects, can accumulate in and activate phagocytic cells such as macrophages [ ] . novel bcg-loaded chitosan vaccine formulations doubled cellular uptake in vitro and, when delivered intranasally, increased murine th responses compared to subcutaneous inoculation [ ] . many approved vaccines in clinical use contain adjuvants to help stimulate and guide the protective immune response. chitosan-based nanoparticles containing tlr agonist poly(i:c) administered with bcg to murine bmdms in vitro synergistically increased the bcg-induced responses -fold towards a pro-inflammatory phenotype, including an increase in cytokine and nitric oxide (no) production [ ] . moreover, due to its critical importance in establishing trained immunity effects, the addition of mdp or other nod agonists as an adjuvant to bcg's formulation could potentially strengthen or even guarantee the inception of nonspecific effects. enhancing and utilizing bcg's trained immunity effects in future vaccines against mtb should be a priority and utilizing recombinant technologies to enhance bcg immunogenicity or reduce mtb pathogenicity presents a unique opportunity to enhance anti-mtb candidates. a recombinant bcg with overexpression of mtb di-adenylate cyclase, which produces bacterial secondary messenger cyclic di-amp, demonstrated comparable protection to bcg-immunized mice, while cellular analyses demonstrated increased il- production following mtb challenge and higher expression of h k trimethylation than bcg [ ] . live-attenuated m. tuberculosis vaccine candidate (mtbvac), the first genetically modified, live attenuated vaccine based on mtb which has demonstrated safety and efficacy in initial clinical trials, induces trained immunity effects in vitro through shifts in metabolism and epigenetic changes at proinflammatory promoters, and can protect subcutaneously vaccinated mice from lethal intranasal doses of streptococcus pneumoniae [ ] . furthermore, vaccination with ruti, a liposomal formulation containing cellular fragments of mtb bacilli cultured to mimic an intra-granulomatous latency environment that has demonstrated poly-antigenic responses in clinical trials of patients with ltbi, caused a shift in murine monocyte phenotype associated with enhanced mycobacterial growth inhibition assay (mgia) responses [ ] . mobilizing trained immunity effects could improve other vaccines by using bcg as a primer, adjuvant, or vector. murine rectal administration of bcg prior to subcutaneous vaccination with autoclaved leishmania major, an intra-macrophage parasite, resulted in higher no production associated with peritoneal macrophage no synthase induction, both four and eight weeks after challenge infection [ ] . administration of both bcg and hepatitis b (hbv) vaccine to young mice enhanced anti-hbv antibody titers [ ] . interestingly, this study also provided evidence of synergistic il- β production following in vitro bcg and hbv stimulation of human preterm, term, and adult whole blood. while recombinant bcg vaccines have been explored with promising results for viral, bacterial, and parasitic pathogens, it is unclear whether the cross-protective effects of the wild-type are present, with no evidence of heterologous effects against distinct pathogens [ ] . harnessing bcg for nonspecific protection against viral infections, particularly during pandemics, could confer protection until appropriate therapeutic interventions become available. due to its beneficial nonspecific effects, it has recently been proposed to use bcg to protect against novel sars-cov- infection while a specific vaccine is being developed [ ] . as of this publication, at least seven clinical trials are active or recruiting subjects for placebo-controlled studies in healthcare workers or the elderly (clinicaltrials.gov: nct , nct , nct , nct , nct , nct , nct ). it is not yet clear how trained immunity could affect sars-cov- infection, but in responses to a digital survey from a cohort of individuals vaccinated with bcg within the past five years, significantly fewer vaccinated subjects self-reported sickness than control subjects [ ] . additionally, an epidemiological analysis of european countries demonstrated a powerful significant correlation between bcg index (a quantifiable estimate of universal bcg administration) and covid- mortality, whereby every % increase in bcg index associated with a . % decrease in mortality [ ] . bcg has demonstrated beneficial effects against influenza, another virus with pandemic potential. bcg immunization in immunized mice conferred significant protection against intranasal influenza challenge, with intranasal vaccination stronger than the intraperitoneal route [ ] . although intravenous murine bcg delivery prompted trained immunity effects but did not significantly protect against experimental h n influenza [ ] , pulmonary aerosol bcg delivery before lethal h n influenza challenge completely protected mice by increasing the capacity of alveolar phagocytes to clear apoptotic cells, thus protecting from influenza-induced pneumonia [ ] . designing vaccines and other future therapeutics that intentionally harness innate nonspecific effects would be a promising strategy to not only improve current treatments, but also to create new options to address increasingly resistant pathogens. bcg fails by relying on adaptive responses that play little to no role in the preliminary steps of mtb infection; but, by focusing on innate responses, better vaccines could be designed that offer better protection. such treatments could be considered "trained immunity-based vaccines" (tibv), anti-infectious vaccines containing trained immunity inducers and pathogen antigens effective versus the target and heterologous pathogens [ ] . a respiratory or other mucosal tibv could produce a sterilizing immunity that prevents the development of an active infection or the establishment of latent colonization (figure ) [ ] . these responses would predictably still generate an adaptive response which would complement or even enhance innate responses. cells , , x of sui and colleagues [ ] developed a mucosal human immunodeficiency virus vaccine that fits many of the tibv criteria, which was delivered intracolorectally to nhps and contains both a modified vaccinia ankara-simian immunodeficiency virus and a peptide vaccine, with il- , tlr / , tlr , and tlr agonists as adjuvants. while the vaccine did confer significant protection against simian-human immunodeficiency virus (shiv) intrarectal challenge, humoral and t-cell responses alone did not correlate with protection. instead, along with a vaccine-induced alteration in gut microbiome, an influx of myeloid cells to colorectal mucosa, which produced increased tnf and il- upon ex vivo stimulation with shiv, correlated with protection [ ] . these results demonstrate that mucosal trained immunity can be induced by a vaccine and can confer protection. however, this study did not explore nonspecific effects of the mucosal monocytes, which could solidify this vaccine's status as a tibv. designing mucosal tibvs should focus on a "whole-of-mucosa" approach that considers the immunomodulatory properties of non-immune cellular components, as many mechanisms could be exploited for enhanced vaccine performance. epithelial cells can develop trained immunity, as demonstrated when primary epithelial cells (pecs) treated with pseudomonas aeruginosa flagellin increased inflammatory responses to live, unrelated stimuli as a result of epigenetic modifications [ ] . pecs stimulated by mtb-infected monocytes or alveolar macrophages express antimycobacterial peptides and defensins and promote neutrophil influx [ ] . bcg-stimulated pecs increased cxcl production and neutrophil influx, with increased il- production when proinflammatory cytokines ifnγ and il- a were administered with bcg [ ] . additionally, mtb can adapt to infection in alveolar epithelial cells, where they undergo phenotypic transformation to become more invasive and replicative, and therefore could be targeted [ ] . the immunoprotective capacity of non-immune mucosal components demonstrates their importance and should be taken into consideration when designing mucosal vaccines. sui and colleagues [ ] developed a mucosal human immunodeficiency virus vaccine that fits many of the tibv criteria, which was delivered intracolorectally to nhps and contains both a modified vaccinia ankara-simian immunodeficiency virus and a peptide vaccine, with il- , tlr / , tlr , and tlr agonists as adjuvants. while the vaccine did confer significant protection against simian-human immunodeficiency virus (shiv) intrarectal challenge, humoral and t-cell responses alone did not correlate with protection. instead, along with a vaccine-induced alteration in gut microbiome, an influx of myeloid cells to colorectal mucosa, which produced increased tnf and il- upon ex vivo stimulation with shiv, correlated with protection [ ] . these results demonstrate that mucosal trained immunity can be induced by a vaccine and can confer protection. however, this study did not explore nonspecific effects of the mucosal monocytes, which could solidify this vaccine's status as a tibv. designing mucosal tibvs should focus on a "whole-of-mucosa" approach that considers the immunomodulatory properties of non-immune cellular components, as many mechanisms could be exploited for enhanced vaccine performance. epithelial cells can develop trained immunity, as demonstrated when primary epithelial cells (pecs) treated with pseudomonas aeruginosa flagellin increased inflammatory responses to live, unrelated stimuli as a result of epigenetic modifications [ ] . pecs stimulated by mtb-infected monocytes or alveolar macrophages express antimycobacterial peptides and defensins and promote neutrophil influx [ ] . bcg-stimulated pecs increased cxcl production and neutrophil influx, with increased il- production when proinflammatory cytokines ifnγ and il- a were administered with bcg [ ] . additionally, mtb can adapt to infection in alveolar epithelial cells, where they undergo phenotypic transformation to become more invasive and replicative, and therefore could be targeted [ ] . the immunoprotective capacity of non-immune mucosal components demonstrates their importance and should be taken into consideration when designing mucosal vaccines. some clinically available vaccines and other immunomodulatory therapies containing lysates of polybacterial formulations could be considered mucosal tibvs, as they modulate and maintain innate immune responses and confer protection against nonspecific pathogens at mucosal sites, such as the respiratory and urogenital tracts [ ] . % of patients taking three months of sublingual bacterial preparation mv , consisting of four common inactivated uropathogens for recurrent urinary tract infections, were protected from relapse infections, while every patient prescribed six months of prophylactic antibiotics experienced relapses [ ] . patients with chronic, recurrent respiratory infections have lower surface expression levels of tlr and cd on their circulating monocytes, but oral administration of respivax, a formulation of six respiratory pathogens, restores these levels to match the healthy controls [ ] , demonstrating trained immunity-like effects. in vitro stimulation with polyvalent bacterial lysate, prepared with six common respiratory pathogens, induced dose-dependent production of no in murine alveolar macrophages and increased transcription of pro-inflammatory chemokines and cytokines, no synthase, and antimicrobial peptides in human epithelial cells [ ] . patients with chronic bronchitis have reduced alveolar macrophage activity regardless of smoking history, and treatment with broncho-vaxom (om- ), an oral capsule containing eight strains of bacterial extracts, significantly increased macrophage activity in the bal, due to stimulation by ifnγ [ , ] . in vitro stimulation with the om- trained murine macrophages for intracellular killing of parasitic leishmania enriettii [ ] . orally administered om- protected mice from aerosol h n influenza and intraperitoneal salmonella typhimurium infections. in conclusion, the bcg vaccine's demonstrated ability to establish trained immunity presents the opportunity to develop other vaccines that elicit similar responses. research on the critical intracellular mechanisms of bcg-induced innate memory will help guide future anti-mtb therapeutics to harness these beneficial nonspecific effects. optimizing bcg should focus on vaccine formulation and delivery, particularly to mucosal sites, both of which could profoundly improve protection against mtb and potentially other pathogens. in order to harness trained immunity effects for future vaccine candidates, researchers should consider designing mucosal tibvs that prime both immune and non-immune cellular components for prophylactic vaccination and therapeutic treatment. this approach represents an avenue to address challenging bacterial infections beyond mtb as a new strategy against antimicrobial resistance and challenging emerging infections. non-specific effects of vaccines: current evidence and potential implications non-specific effects of vaccines illustrated through the bcg example: from observations to demonstrations defining trained immunity and its role in health and disease targeting innate immunity for tuberculosis vaccination an oral vaccine against tuberculosis-review global tuberculosis report new tuberculosis vaccine strategies: taking aim at un-natural immunity the mycobacterium tuberculosis capsule: a cell structure with key implications in pathogenesis prevention of m. tuberculosis infection with h :ic vaccine or bcg revaccination trained innate immunity and resistance to mycobacterium tuberculosis infection early clearance of mycobacterium tuberculosis: the infect case contact cohort study in indonesia mycobacterial growth inhibition is associated with trained innate immunity association of bcg, dtp, and measles containing vaccines with childhood mortality: systematic review neonatal bcg vaccination and child survival in tb-exposed and tb-unexposed children: a prospective cohort study randomized trial of bcg vaccination at birth to low-birth-weight children: beneficial nonspecific effects in the neonatal period? activate: randomized clinical trial of bcg vaccination against infection in the elderly in vitroexperimental model of trained innate immunity in human primary monocytes long-term in vitro and in vivo effects of γ-irradiated bcg on innate and adaptive immunity monocytes from neonates and adults have a similar capacity to adapt their cytokine production after previous exposure to bcg and β-glucan neonatal bcg vaccination influences cytokine responses to toll-like receptor ligands and heterologous antigens heterologous immunological effects of early bcg vaccination in cells low-birth-weight infants in guinea-bissau: a randomized-controlled trial whole blood profiling of bacillus calmette-guérin-induced trained innate immunity in infants identifies epidermal growth factor, il- , platelet-derived growth factor-ab/bb, and natural killer cell activation. front bacille calmette-guerin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes bcg vaccination induces trained innate immunity in adults over years of age: a randomized trial in guinea-bissau long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity anti-mycobacterial activity correlates with altered dna methylation pattern in immune cells from bcg-vaccinated subjects early clearance of mycobacterium tuberculosis is associated with increased innate immune responses bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity bcg-vaccination enhances immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized placebo-controlled pilot study outcomes of controlled human malaria infection after bcg vaccination gamma-irradiated bacille calmette-guérin vaccination does not modulate the innate immune response during experimental human endotoxemia in adult males immune responses to bacillus calmette-guérin vaccination: why do they fail to protect against mycobacterium tuberculosis? front a human challenge model for mycobacterium tuberculosis using mycobacterium bovis bacille calmette-guérin characterizing the bcg induced macrophage and neutrophil mechanisms for defense against mycobacterium tuberculosis. front the effect of bcg vaccination on alveolar macrophages obtained from induced sputum from healthy volunteers host recognition of bacterial muramyl dipeptide mediated through nod bcg-induced trained immunity in healthy individuals: the effect of plasma muramyl dipeptide concentrations vitamin a induces inhibitory histone methylation modifications and down-regulates trained immunity in human monocytes bcg vaccination in humans elicits trained immunity via the hematopoietic progenitor compartment bcg educates hematopoietic stem cells to generate protective innate immunity against licensed bacille calmette-guérin (bcg) formulations differ markedly in bacterial viability, rna content and innate immune activation oral tolerance to environmental mycobacteria interferes with intradermal, but not pulmonary, immunization against tuberculosis alternative bcg delivery strategies improve protection against mycobacterium tuberculosis in non-human primates: protection associated with mycobacterial antigen-specific cd effector memory t-cell populations prevention of tuberculosis in macaques after intravenous bcg immunization new biological insights in the immunomodulatory effects of mucosal polybacterial vaccines in clinical practice mucosal delivery of tuberculosis vaccines: a review of current approaches and challenges po and id bcg vaccination in humans induce distinct mucosal and systemic immune responses and cd + t cell transcriptomal molecular signatures aerosol vaccination with bacille calmette-guerin induces a trained innate immune phenotype in calves prevention of tuberculosis infection and disease by local bcg in repeatedly exposed rhesus macaques seasonal variation in the non-specific effects of bcg vaccination on neonatal mortality: three randomised controlled trials in guinea-bissau circadian rhythm influences induction of trained immunity by bcg vaccination oral polio vaccine influences the immune response to bcg vaccination. a natural experiment interacting, nonspecific, immunological effects of bacille calmette-guérin and tetanus-diphtheria-pertussis inactivated polio vaccinations: an explorative, randomized trial phosphate starvation enhances phagocytosis of mycobacterium bovis/bcg by macrophages exposure to human alveolar lining fluid enhances mycobacterium bovis bcg vaccine efficacy against mycobacterium tuberculosis infection in a cd + t-cell-dependent manner selective delipidation of mycobacterium bovis bcg enables direct pulmonary vaccination and enhances protection against mycobacterium tuberculosis chitosan-based systems for the delivery of vaccine antigens bcg-loaded chitosan microparticles: interaction with macrophages and preliminaryin vivostudies poly(i:c)-encapsulating nanoparticles enhance innate immune responses to the tuberculosis vaccine bacille calmette-guérin (bcg) via synergistic activation of innate immune receptors recombinant bcg with bacterial signaling molecule cyclic di-amp as endogenous adjuvant induces elevated immune responses after mycobacterium tuberculosis infection new live attenuated tuberculosis vaccine mtbvac induces trained immunity and confers protection against experimental lethal pneumonia ruti vaccination enhances inhibition of mycobacterial growth ex vivo and induces a shift of monocyte phenotype in mice co-administration of rectal bcg and autoclaved leishmania major induce protection in susceptible balb/c mice adjuvant effect of bacille calmette-guérin on hepatitis b vaccine immunogenicity in the preterm and term newborn bcg-induced cross-protection and development of trained immunity: implication for vaccine design safety and covid- symptoms in individuals recently vaccinated with bcg: a retrospective cohort study. cell rep barillas-mury, c. bcg vaccine protection from severe coronavirus disease (covid- ) nonspecific protection of mice against influenza virus infection by local or systemic immunization with bacille calmette-guerin bacillus calmette-guérin-induced trained immunity is not protective for experimental influenza a/anhui/ / (h n ) infection in mice boosting efferocytosis in alveolar space using bcg vaccine to protect host against influenza pneumonia trained immunity-based vaccines: a new paradigm for the development of broad-spectrum anti-infectious formulations mucosal vaccine efficacy against intrarectal shiv is independent of anti-env antibody response respiratory epithelial cells can remember infection: a proof of concept study innate activation of human primary epithelial cells broadens the host response to mycobacterium tuberculosis in the airways innate immune responses after airway epithelial stimulation with mycobacterium bovis bacille-calmette guérin mycobacterium tuberculosis primary infection and dissemination: a critical role for comparison of sublingual therapeutic vaccine with antibiotics for the prophylaxis of recurrent urinary tract infections polybacterial immunomodulator respivax restores the inductive function of innate immunity in patients with recurrent respiratory infections intranasal administration of a polyvalent bacterial lysate induces self-restricted inflammation in the lungs and a th /th memory signature effects of a bacterial extract on local immunity of the lung in patients with chronic bronchitis local immunity in patients with chronic bronchitis and the effects of a bacterial extract stimulation by a bacterial extract (broncho-vaxom) of the metabolic and functional activities of murine macrophages the art work was created with biorender.com. the authors declare no conflict of interest. the funders had no role in the writing of the manuscript, or in the content of the review. key: cord- -ez fx p authors: de chaisemartin, c.; de chaisemartin, l. title: bcg vaccination in infancy does not protect against covid- . evidence from a natural experiment in sweden. date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: ez fx p background the bacille calmette-guerin (bcg) tuberculosis vaccine has immunity benefits against respiratory infections. accordingly, it has been hypothesized that it may have a protective effect against covid- . recent research found that countries with universal bcg childhood vaccination policies tend to be less affected by the covid- pandemic. however, such ecological studies are biased by numerous confounders. instead, this paper takes advantage of a rare nationwide natural experiment that took place in sweden in , where discontinuation of newborns bcg vaccination led to a dramatic fall of the bcg coverage rate from % to % , thus allowing us to estimate the bcg's effect without all the biases associated with cross-country comparisons. methods numbers of covid- cases and hospitalizations were recorded for birth cohorts born just before and just after that change, representing , , and , , individuals, respectively. we used regression discontinuity to assess the effect of bcg vaccination on covid- related outcomes. this method used on such a large population allows for a high precision that would be hard to achieve using a classical randomized controlled trial. results the odds ratio for covid- cases and covid- related hospitalizations were . (ci : [ . - . ]) and . (ci : [ . - . ]), respectively. we can thus reject with % confidence that universal bcg vaccination reduces the number of cases by more than % and the number of hospitalizations by more than % conclusions while the effect of a recent vaccination must be evaluated, we provide strong evidence that receiving the bcg vaccine at birth does not have a protective effect against covid- . the bacille calmette-guérin (bcg) tuberculosis vaccine has immunity benefits against non-targeted pathogens , and in particular against respiratory infections caused by rna viruses like influenza . since sars-cov- is also a single-stranded rna virus, it has been hypothesized that differences in bcg vaccination coverage could explain the wide differences in disease burden observed between countries. a pioneering preprint paper by miller et al. found that countries with universal bacillus calmette-guérin (bcg) childhood vaccination policies tend to be less affected by the covid- pandemic, in terms of their number of cases and deaths . while unpublished, this study had a great impact and gave rise to many comments and follow-up studies (reviewed in ). some published studies were able to replicate this result , , but several authors underlined the important statistical flaws inherent to such ecological studies and concluded that randomized controlled trials (rct) were necessary to address the question , . as of june th , no less than randomized controlled trials (rcts) studying the protective effect of the bcg against covid- are already registered on https://clinicaltrials.gov/. however, none has a primary completion date earlier than october st , so these rcts' first results will not be known until at least five or six months. with the epidemic still on the rise worldwide, and in the absence of a sars-cov- vaccine, there is an urgent need to know if bcg non-specific effects could be harnessed as a substitute prophylactic treatment. regression discontinuity (rd) is a method designed by social scientists to assess the effect of an exposure on an outcome. it is deemed as reliable as rcts to tease out causality from correlation , and typically yields results similar to those obtained in rcts , . in this paper, we applied this method to a rare natural experiment that took place in sweden. sweden currently has the th highest ratio of covid- deaths per capita in the world. in april , it stopped its newborns bcg vaccination program, leading to a dramatic drop of the bcg vaccination rate from % to % for cohorts born just before and just after the all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint change . we compared the number of covid- cases, hospitalizations, and deaths per capita, for cohorts born just before and just after april , representing , , and , , individuals, respectively. using rd, we were able to show that those cohorts do not have different numbers of covid- cases, hospitalizations or deaths per capita, with a high precision that would hardly be possible to reach with a rct design. regression discontinuity (rd) is a commonly-used method to measure the effect of a treatment on an outcome . it is applicable when only individuals that satisfy a strict criterion are eligible for a policy. then, rd amounts to comparing the outcome of interest among individuals just above and just below the eligibility threshold. in this study, rd will amount to comparing the number of covid- cases, hospitalizations, and deaths among individuals born just before and just after april st . the effect all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint of universal bcg vaccination for individuals born around april st, was estimated using the stateof-the-art estimator for rd . the estimator amounts to comparing treated and control units, in a narrow window around april st . it uses linear regressions of the outcome on birth cohort to the left and to the right of the threshold, to predict the outcome of treated and untreated units at the threshold. then, the estimator is the difference between these two predicted values. the estimator and % confidence interval were computed using the rdrobust stata command, see . this study uses the number of covid- cases per inhabitants for quarterly birth cohorts born between q - and q - , the number of covid- hospitalizations per inhabitants for cohorts born between q - and q - , and the number of covid- deaths per inhabitants for groups of three yearly birth cohorts, from - - to - - . these variables were constructed using data compiled by the public health agency of sweden; see the supplementary table for details. in an rd design, the presence or absence of a treatment effect can be assessed visually, by drawing a scatter-plot with the variable determining eligibility on the x-axis, and the outcome variable on the y-axis. if one observes that the relationship between these two variables jumps discontinuously at the eligibility threshold, this is indicative of a treatment effect. accordingly, figure shows no discontinuity in the numbers of covid- cases per inhabitants for cohorts born just before and just after april . this suggests that universal bcg vaccination has no effect on the number of covid- cases per inhabitants for individuals born in . figures and show that similar conclusions apply when one looks at the number of covid- hospitalizations per inhabitants and at the number of covid- deaths per inhabitants. the number of deaths per inhabitants is several orders of magnitudes all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint higher for older than for younger cohorts, so figure only presents those numbers for cohorts born after to keep the graph legible. this visual analysis is confirmed by the statistical calculations. table inhabitants, there is only two data points to the right of the q - threshold. therefore, the rd estimator cannot be computed for that outcome. instead, we just compared the number of covid- deaths per inhabitants in the - - and - - ybcs using a standard t-test, even though this method does not account for the fact those two groups differ in age, contrary to the rd method. doing so, we find that the difference between the deaths per inhabitants of the two groups is not different from . table are intention-to-treat effects : not all swedish residents born just before april received the bcg vaccine at birth, and some of those born just after april received it. in particular, foreign-born residents account for • % of the swedish population born in as per statistics sweden's data, and they were not affected by the policy. among natives, the policy led to a drop of the vaccination rate from to % . assuming that the bcg vaccination rate of foreign-born residents is the same just before and just after april , a reasonable assumption as no other european country changed its bcg vaccination policy in , the policy led to a drop in the bcg vaccination rate all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . table into the effect of being vaccinated at birth, one needs to divide the intention-to-treat effects and their confidence intervals by • , the change in the bcg vaccination rate at birth induced by the reform all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . in this study, we took advantage of a change in vaccination policy in sweden to investigate the link between bcg vaccination in infancy and covid- cases, hospitalizations and deaths, using a regression discontinuity approach. contrarily to most studies on the question, we compared covid- cases between two very similar groups of people from the same country. this allows us to get rid of all confounders linked to cross-countries comparisons, and of confounders like sex or socio-economics status that are often present in observational studies that do not rely on a quasi-experimental design, unlike ours. another strength of this study is its statistical precision. since we could gather nationwide data in a country where covid- rates are high, we are able to reject fairly small effects of the bcg vaccine. achieving a comparable statistical precision in an rct would require an unrealistically large sample. even with a covid- hospitalization rate of • %, as among the elderly swedish population, a randomized controlled trial that could reject bcg effects larger than % of the baseline hospitalization rate, as in our study, would require including around , participants. while previous studies mostly addressed differences in bcg vaccination policies but did not account for differences in actual bcg coverage, we work with two populations with well documented and very . prior to that, sweden had already eliminated its revaccination program at years of age in . sweden also stopped its revaccination all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . moreover, this study does not measure the covid- immunity benefit conferred by a recent bcg vaccination, as individuals born just before q - were vaccinated years ago. the rcts currently all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint underway will tell if the protective effect of a recent bcg vaccination differs from the effect measured in this study. overall, this study shows bcg vaccination at birth does not have a strong protective effect against covid- . thus, it seems that bcg childhood vaccination policies cannot account for the differences in the severity of the pandemic across countries, as had been hypothesized by prior studies , , . this advocates for a strict adherence to who's recommendation of the vaccine to infants outside of clinical trials , and for restraint from starting new clinical trials on this question. the question is of particular importance for a vaccine whose lengthy production process regularly leads to worldwide shortages with dire consequences on children from country with high prevalence of tuberculosis . while rcts will complement this study by measuring the effect of a recent vaccination, this study comes much before results of the rcts will be made available, and with a greater precision. finally, it exemplifies the potential of leveraging past medical policies and statistical techniques designed in the social sciences to answer current medical questions. ( ), and the % confidence interval of this effect is shown in column ( ) all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . - - to birth cohorts - - . , when vaccination at birth was discontinued, is represented by the red vertical line. all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint notes: some qbcs after q - had less than hospitalizations, so folkhälsomyndigheten could not provide their number of hospitalizations due to confidentiality issues. the swedish population per qbc is not publicly available, while the population per ybc is. rather than just dividing the ybc's population by four to recover each qbc's population, we account for the fact that sweden exhibits a little bit of quarterly birth seasonality. from to , • %, • %, • %, and • % of births respectively happened during q , q , q , and q . to infer a qbc's population, we multiply the population of the corresponding ybc by the proportion this quarter accounts for in the births that took place that year in sweden. not all swedish inhabitants were born in sweden, so this computation implicitly assumes that quarterly birth seasonality is the same in sweden as in the countries foreign-born-sweden-residents immigrated from. foreign-born individuals only account for % of the to ybc swedish population, and quarterly birth seasonality is weak in most countries, so this assumption should not strongly affect the results. all rights reserved. no reuse allowed without permission. (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint the non-specific and sex-differential effects of vaccines non-specific effects of bcg vaccine on viral infections relation between bcg coverage rate and covid- infection worldwide is bcg vaccination affecting the spread and severity of covid- ? demystifying bcg vaccine and covid- relationship regression discontinuity designs in economics empirical tests of the validity of the regression discontinuity design when does regression discontinuity design work? evidence from random election outcomes the impact of changing bcg coverage on tuberculosis incidence in swedish-born children between and regression discontinuity designs: a guide to practice robust nonparametric confidence intervals for regression-discontinuity designs robust data-driven inference in the regression-discontinuity design what is meant by intention to treat analysis? survey of published randomised controlled trials identification and estimation of local average treatment effects the bcg world atlas: a database of global bcg vaccination policies and practices some evidence of the efficacy of mass bcg vaccination bacille calmette-guérin (bcg) vaccination and covid- global shortages of bcg vaccine and tuberculous meningitis in children we are grateful to folkhälsomyndigheten, the public health agency of sweden, for providing the data used in this study and answering all our questions. we are also grateful to martin berlin, johanneshaushofer, jerker jonsson, ellen lundqvist, kyle meng, robert Östling, andrew oswald, moa rehn, and gonzalo vazquez-bare for their help.all rights reserved. no reuse allowed without permission.(which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity.the copyright holder for this preprint this version posted june , . . key: cord- -fpmd nzf authors: ventura, l.; vitali, m.; romano spica, v. title: bcg vaccination and socioeconomic variables vs covid- global features: clearing up a controversial issue date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: fpmd nzf background: the covid- pandemic is characterized by extreme variability in the outcome distribution and mortality rates across different countries. some recent studies suggested an inverse correlation with bcg vaccination at population level, while others denied this hypothesis. in order to address this controversial issue, we performed a strict epidemiological study collecting data available on a global scale, considering additional variables such as cultural-political factors and adherence to other vaccination coverages. methods: data on countries, accounting for about % of covid- cases and deaths globally, were from john's hopkins coronavirus resource center, world bank, international monetary fund, united nations, human freedom report, and bcg atlas. statistical models used were ordinary least squares, tobit and fractional probit, implemented on stata/mp software. results: based on our results, countries where bcg vaccination is or has been mandated in the last decades have seen a drastic reduction in covid- diffusion (- % on average) and mortality (- % on average), even controlling for relative wealth of countries and their governmental health expenditure. a significant contribution to this reduction (respectively - % and - % on average) was also associated to the outbreak onset during summer, suggesting a possible influence of seasonality. other variables turned out to be associated, though to a lesser extent. conclusions: relying on a very large dataset and a wide array of control variables, our study confirms a strong and robust association between covid- diffusion and mortality with bcg vaccination and a set socio-economic factors, opening new perspectives for clinical speculations and public health policies. since the novel coronavirus sars-cov- was initially detected in wuhan, china, in december ( ) more than two million cases of covid- have been confirmed worldwide with a death toll about , by april , as reported by who (https://www.who.int/docs/defaultsource/coronaviruse/situation-reports/ -sitrep- -covid- b cccd f b f bff a ed.pdf?sfvrsn=ebe _ ). one of the puzzles associated to the outspread of this pandemic is the extreme geographic ( ) and ethnical ( ) variability of its outcomes, both in terms of contagion and mortality with inevitable economic implications ( ). we have witnessed an increased variance in fatality rates as more countries were hit by the virus, generating a clustering of countries in terms of incidence and mortality rates (mr), both across and within affected continents. in europe, for example, the case fatality rate (cfr) is below or around %, such as portugal, ireland, norway and finland, respectively with . %, . %, . %, . %, but much higher with rates hovering around and above % in countries such as / ( ), last updated in in the online version (http://www.bcgatlas.org/index.php). data about human freedom comes from the human freedom report by the fraser institute (https://www.cato.org/sites/cato.org/files/human-freedom-index-files/human-freedom-index- -revised.pdf). data from a total of countries, out of the that reported cases of covid , accounting for about % of both confirmed cases and deaths, have been used. the countries in the analysis, listed in supplementary appendix, have been chosen in view of the availability of observations relative to covariates. the set of dependent and independent variables is reported in table . in particular, we used confirmed cases per million inhabitants as a proxy for the intensity of contagion; the number of cases days earlier as a proxy for the stage of the diffusion of the virus; population in the largest city as a proxy for density and the degree of urbanization; life expectancy at birth as a comprehensive health indicator, and as a proxy for the share of aged people in the population; the latitude to define both the season as of april th (above or below the equatorial line) and tropical countries (those countries whose latitude as defined by the corresponding variable in the world development indicators lies in between the two tropics). as for bcg vaccination policy, two alternative continuous measures were constructed, and used for robustness checks: the bcg coverage, as reported in national surveys in various years, and the years of absence of mandated vaccination, until . coverage rates for different vaccines (b hepatitis, measles and dpt) were also used, to disambiguate the effects of bcg from those of a more general vaccination policy. among the variables proxying for economic ties with china, where the epidemic first appeared, we include imports from china, and the levels of inward and outward foreign direct investment (fdi) relative to china. finally, to proxy for the compliance with the lockdown measures implemented by the various governments, we use the index of human freedom (hfi), . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint / a weighted average of distinct indicators ( for the personal freedom subindex and for the economic freedom subindex), each one ranging from to , with representing the most freedom. the hfi ranges therefore from to , in increasing order of freedom (https://www.cato.org/sites/cato.org/files/human-freedom-index-files/human-freedom-index- -revised.pdf). we used gross domestic product (gdp) per capita, and private and general government health expenditure to proxy for countries' level of development (general and of their health system) and for the countries' testing capability (more income and a richer health system should be positively correlated to more covid- testing). to model our dependent variables, we used both ordinary least squared, as a reference estimator, and nonlinear estimation methods. in particular tobit regressions, estimating both the impacts of covariates on the probability of a country reporting more than cases as of april th , and their effect on relative diffusion, was our preferred estimation method. the reported coefficients in the tobit regression represent the marginal effects of the explanatory variables on the outcome variable, after accounting for the inclusion of countries in the high incidence group. the second and third outcome variables, i.e. cfrs and mrs, were first modelled by ordinary least squares to obtain benchmark estimations, and then by probit fractional regression methods to account for the fractional nature of the dependent variables ( ). when the dependent variable is a fraction, as with cfrs and mrs, using log-odds transformation or tobit regressions with lower and upper limits set to and may yield biased results ( , ). therefore, fractional regressions will be our preferred estimation method for fatality and mortality rates. . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint / for consistency and comparison purposes all models included the same set of explanatory variables. moreover, ordinary least squares and fractional regressions also account for heteroskedasticity, by using robust variance-covariance estimators. all statistical analyses have been performed by using stata/mp for windows. table reports the regression results for relative incidence (reported cases over total population) obtained by ols, tobit without controlling for other vaccines and tobit controlling for other vaccines. for both ols and tobit, the estimated coefficients represent the marginal effect of the covariates on the outcome variable. table shows large and strongly significant effects for per capita gross domestic product and human freedom index (positive) and for the summer season and bcg vaccination (negative), even controlling for more vaccinations. table contains estimated coefficients, with corresponding standard errors and marginal effects, for cfr and mrs fractional regressions. this table reveals large and strongly significant effects for health expenditure and tropical position (positive) and for summer season and, above all, bcg vaccination (negative), even controlling for more vaccinations. table contains the results of a robustness analysis on relative incidence, where alternative measures for bcg have been used as explanatory variables instead of the bcg dummy. table contains the results of the same robustness analysis performed on the cfrs and mrs. both tables and confirm the results obtained with the previous regressions. all regressions feature the same set of explanatory variables, listed in the data section, but tables only report statistically significant coefficients, as well as their respective significance ( %, %, or %). . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint / to the best of our knowledge, this is the first study assessing the impact of bcg vaccination on the diffusion and mortality of covid- at the global level by controlling for a comprehensive set of social, economic, geographic and demographic variables. this allows to greatly reduce the risk of spurious correlations among variables and confers high statistical robustness to the results which are therefore more amenable to causal interpretation. from the second and third column in table , containing the statistically significant tobit coefficients of relative incidence, we observe that the number of positive cases days earlier has a very significant and sizeable positive coefficient, capturing the different stage of the epidemic across countries (a larger number of cases implies a higher probability of contagion). among the demographic variables, population in the largest city has a very sizeable, positive and statistically significant coefficient, indicating that high urban density fosters the epidemic. other demographic variables do not reach statistical significance, possibly in view of high variability in data. lastly, the percentage of immigrant over total population is negatively correlated with the extent of the epidemic, but with a non statistically significant coefficient. its sign, however, might be read in the light of the impact of bcg vaccine, as explained below. or it might be read as resulting from the lower probability of those immigrant communities being tested, as suggested by borjas ( ). among geographical variables, the dummy for summer (countries below equatorial line) is negative, large, and highly statistically significant. this strongly reinforces results in ozdemir and colleagues ( ) , finding that the mean of cases per population ratio was higher in the northern hemisphere. the magnitude of the coefficient is really large, and indicates that countries in the southern hemisphere have, on average and all else equal, over cases per million less (against . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint / a mean value of confirmed cases per million inhabitants of about ). seasonality is a key question for describing the trend of pandemic and predicting future transmission dynamics ( ). among the economic and health policy variables, gdp has a large and highly significant coefficient in all specifications, which corresponds to our a priori expectations, in view of the maintained hypothesis of a positive correlation between income and number of tests performed. in other words, including the per capita gdp variable allows to control for different testing policies implemented across countries. domestic private health expenditure also features a positive coefficient, which can most likely be explained in the same way. the main and well taken criticism, addressed by curtis and colleagues ( ) in our study we avoid this problem by explicitly accounting for the relative wealth of countries and of their respective health systems, thus netting out the relationship between income and testing policies, and by using a large dataset including quite a few high income countries where bcg vaccine is also mandatory (japan, as a notable example). closer economic ties to china exert an ambiguous effect. on the one hand, imports from china have a negative and statistically significant effect on the extent of the epidemic, most likely because countries closer to china were affected to a limited extent. on the other, fdi from china have a positive, but limited effect, and might derive from the more frequent personal contacts . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint / between chinese and western businessmen, around the start of the crisis. anyway, if ties with china might have explained the diffusion of the epidemic at earlier stages, they no longer seem to do so. the hfi has a strong and significant impact on the incidence of the epidemic, suggesting that in freer countries lockdown measures were milder, and that compliance might have been lower in such countries. most importantly, the bcg dummy variable has a strong and negative impact in the tobit specifications. this finding corroborates in a more comprehensive and robust framework those presented in some recent contributions ( - ) and arguing in favor of a correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- . another study by dayal and gupta ( ) obtains similar conclusions, comparing cfr's of countries where bcg re-vaccination is adopted vs. those countries where vaccination is practiced only once in lifetime. as the significance of bcg might be spurious, driven by the correlation with other vaccinations, the third column in table in fact, the most important effect on cfrs and mrs, as for relative incidence, is exerted by the bcg variable, which is associated to a strongly significant reduction of cfr and mr by, respectively, - . percentage points (both with and without additional vaccination controls) and - . (- . with additional vaccination controls) percentage points. to get a relative idea of the magnitude of these estimates, let us just notice that the mean values of cfrs and mrs in the estimation sample are, respectively, . % and . %. anecdotal evidence, especially in europe, seems largely consistent with the large explanatory power of bcg on cfrs and mrs. we mentioned the wide and puzzling differences in cfrs and mrs between contiguous countries, such as portugal and spain, ireland and uk, norway/finland and sweden. in all those pairs of countries, the first has mandatory bcg vaccination or had it until recent times, the second has not. . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint last but not least, the hfi turns out to have a negative and significant effect on the cfr. this, however, might only be due to the results reported above, i.e. the positive effect of hfi on the number of reported cases, which is the denominator of cfr. as a further control of the robustness of these results, more checks have been performed by replacing the bcg dummy with two different continuous variables related to this vaccination policy. one is bcg coverage, as reported in national surveys. another is the number of years of missing vaccination, until . unfortunately, data on coverage were available for a more limited number of countries, but even so the results seem noteworthy. table contains the results of two tobit regressions of the relative number of cases, by using the alternative bcg variables. table reports the results of fractional regressions on both cfrs and mrs, using the two alternative bcg variables. tables and show a strong and negative impact, of magnitude comparable to that obtained for the bcg variable in the previous analyses, for the bcg coverage variable. missing years of vaccination also feature a coefficient with the expected positive sign, but only significant in the case of relative incidence and cfrs. our study, by integrating a wide set of controls, attenuates if not eliminates altogether the effects of possible confounding factors affecting previous studies on bcg and covid- . the nonlinear, probabilistic methods used in the analyses confer additional statistical robustness to the results. this way, we are able to confirm a robust and large effect of bcg vaccination on covid- diffusion and mortality, and to uncover other noteworthy and potentially relevant statistical relationships. in this wider context, the association between bcg vaccination and covid- diffusion and mortality is fully addressed by a comprehensive epidemiological perspective, that can support novel hypothesis as well as clinical or experimental studies in the field. . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . https://www.thelancet.com/action/showpdf?pii=s - % % - . . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . a novel coronavirus from patients with pneumonia in china emergence of a novel coronavirus, severe acute respiratory syndrome coronavirus : biology and therapeutic options racial health disparities and covid- -caution and context combating covid- : health equity matters an interactive web-based dashboard to track covid- in real time considering bcg vaccination to reduce the impact of covid- we deeply thank charles yuji horioka and yoko niimi for discussions, key insights, comments, and crucial information about the main topic of this paper. useful advice and help from maria ventura and lory marika margarucci is also gratefully acknowledged. key: cord- - u e q authors: nan title: selected abstracts from the th j project meeting, antalya, turkey, march - , date: - - journal: j clin immunol doi: . /s - - - sha: doc_id: cord_uid: u e q nan hans d. ochs the identification of single gene defects involving genes that play crucial roles in adaptive or innate immunity is not only important for confirming a pid diagnosis, but may contribute to optimal therapy, and contribute to genetic counseling, carrier identification and pre-natal diagnosis. to accomplish this, the diagnostician has to consider the inheritance of these disorders: x-linked, autosomal recessive, autosomal dominant and the type of mutation: loss of function, hypomorphic, dominant negative or gain of function. conventional techniques to screen for single gene mutations include flow cytometry to measure disease-specific expression of proteins (cell surface, cytoplasmic or nuclear) or to analyze relevant signaling pathways (e.g. stat b phosphorylation via the il- r; pstat via the il- receptor); and sanger sequencing of mrna or genomic dna using dye-terminator sequencing. next generation sequencing ("by synthesis") has been refined, and is being used increasingly to study families with multiple affected members with an atypical pid phenotype, or to explore consanguineous families with one member affected. whole exome sequencing requires less data analysis, compared with whole genome sequencing, but may miss intronic or regulatory elements. the challenge of whole exome/genome sequencing is to confirm that the multiple variants identified by these techniques are causative for the clinical phenotype of the study patient. however, with increasing experience, next generation sequencing will become a standard procedure for the identification of genetic defects responsible for inherited diseases, including pid. stephen jolles immunodeficiency centre for wales, university hospital of wales, cardiff, uk. immunoglobulin (ig)-replacement therapy represents the mainstay of treatment for patients with primary antibody deficiency and is administered either intravenously (ivig) or subcutaneously (scig). recent developments using a high-purity recombinant human hyaluronidase have allowed the longer term repeated use of this enzyme to facilitate the delivery of immunoglobulin and other molecules including antibiotics, local anesthetics, insulin, morphine and fluid replacement into the subcutaneous space. hyaluronidase facilitated scig (fscig) has helped overcome the limitations on the volume which can be delivered into the subcutaneous tissues by enabling dispersion of scig and its absorption into lymphatics. the rate of facilitated scig infusion is equivalent to that of ivig, and the volume administered at a single site can be greater than ml, an enormous increase over conventional scig, at - ml. the use of fscig avoids many of the systemic side effects of ivig, and has higher bioavailability than scig. over three years of safety data are now available for this approach though longer term safety data and information on anti-hylauronidase antibodies and their relevance will be required. fscig could aid several areas of patient management in both primary antibody deficiency and immunomodulatory indications. key factors influencing how it will be used in future are long-term safety data and cost-benefit analysis. date after the cd deficiency was firstly described in a turkish girl in . the patients with cd deficiency had normal b-cell differentiation in bone marrow, normal absolute number of b cells in peripheral blood and normal bcr repertoire. also, the patients had normal stimulation via the bcr, normal proliferation response upon antigen stimulation but reduced memory-b-cell compartment in peripheral blood. the cd deficiency leads to hypogammaglobulinemia and impaired antigen-specific humoral immune responses after vaccination. we had described thirty carriers in relatives of our two patients with cd deficieny and also showed that the mfi value of cd and cd expressions were lower in the carriers than in controls. during the last five years, it was also showed that the mutations of the other coreceptors of b cells such as cd and cd caused antibody deficiency. in conclusion, the description of cd deficiency reminds the importance of the molecules on b cells and contribute to identify new genetic defects (cd , cd ), and it was showed that coreceptors could affect the expressions and the functions of each other. ege university faculty of medicine, dept of pediatric immunology, izmir, turkey ig class switch recombination deficiencies are rare pids ( : , births) with normal or elevated serum igm and low igg, iga and ige levels, defective or normal somatic hypermutation, defective t/b cooperation ( %), intrinsic b cell defect ( %), susceptibility to bacterial infections begining from the first year of age (impaired b cell immunity) and lack of germinal centres in secondary lymphoid organs. we present a cd l defective case with clinical findings such as recurrent otitis media, recurrent upper and lower respiratory tract infections, sinusitis, arthritis, relapsing polychondritis , ebv-associated cervical lymphoproliferation, cmv infection, bronchiectasis, liver and spleen enlargement, multiple nodules in the liver, chronic diarrhea due to persistent cryptosporidium parvum, fungal pneumoniae, osteoporosis, and schwannoma. this case is remarkable with low igm levels and normal cd l ezpression on activated t cells although he had a novel mutation in cd l gene (a novel missense mutation in cd lg (c. c t), leading to an a. a. change from histidine to tyrosine at position (h y) at the start of the extracellular domain). in addition, we present two cases with cd deficiency with normal cd expression on b cells.both of these cases had homozygous-cd -mutation leading to a longer protein due to deletion of stop-codon. in conclusion; cd molecules although non-functional in b cells, may be normally expressed on cell surface. these cd molecules are unable to trigger signal, because cd l + il activation leads to complete lack of proliferation. evaluation of cd or cd l expression by flow cytometry may lead false results. study of cd l + cytokine (or cd + cytokine)induced b cell proliferation appears as a useful tool for these diagnosis. institute for immunology and physiology (ub ras). yekaterinburg, russia regional children clinical hospital № , yekaterinburg, russia the ural regional center of clinical immunology, which based on children clinical hospital number one (№ ) in yekaterinburg, observe patients from different territories of ural region and neighboring areas. it consists of laboratory department, consultative department, vaccination and treatment rooms, beds and boxes in special departments in the regional children hospital. the close collaboration with j-project started in . this is an example of such collaboration. in patient a. an international consilium was diagnosed a progressive neurodegenerative disease as a manifestation of primary immunodeficiency: x-linked agammaglobulinemia with b-cell deficiency. mri results: unspecified leukodystrophya rapidly progressive multifocal brain lesions with demyelinating, generalized cerebral atrophy, iii degree, signs of periventricular leukomalacia in the anterior horns of the lateral ventricles. the brain biopsy was recommended in order to clarify the nature of the defeat of the pathological process and define the role of the immune mechanisms of its development (held in the neurosurgical department with subsequent histological and immunohistochemical studies). histological and immunohistochemical study of the brain tissue of the right frontal lobe: a signs of productive meningoencephalitis in brain tissue with vasculitis, perivascular and focally moderate diffuse infiltration of mononuclear (accumulation of mononuclear cd rb+, vimentin+), most of which are cd + lymphocytes with granules of granzymeb. around -dystrophy and necrobiosis neurons, intracellular edema, small focuses of gliosis -there are isolated myeloid cells (myeloperoxidase +) and plasma cells with cytoplasmic expression of immunoglobulin light chains lambda and kappa; cells and the extracellular matrix of brain tissue expressing cd antigen and s protein. virological and bacteriological studies of brain tissue and liquor: connection of progressive degenerative changes and infectious process weren't obtained verified acknowledgments of an infectious or autoimmune process has not been received. search for a genesis of cytotoxic process in the brain continues. center for chronic immunodeficiency, university medical center freiburg and university of freiburg, germany the essential role for igg replacement therapy (iggrt) for common variable immunodeficiency (cvid) has been demonstrated in many studies and metaanalyses. while patients with "infection only" reach a nearly normal life expectancy -though still not quality -under iggrt, cvid patients with additional manifestations like inflammatory lung, bowel or liver disease, lymphoproliferative and/or autoimmune disease often require additional immunosuppressive treatment. there is little consensus on the form of immunosuppressive regimen, once steroids have failed, with possibly the one exception of rituximab treatment for autoimmune cytopenia. additional studies are essential to guide therapeutic algorithms. some of these patients suffer from late onset combined immunodeficiency (locid). as in classic forms of combined immunodeficiency, iggrt can be only a part of the treatment strategy, which needs to additionally address the cellular immunodeficiency of the patients. therefore a retrospective survey was performed on patients diagnosed with cvid who underwent hematopoietic stem cell transplantation. the results of this study are currently in revision. in summary, iggrt is the baseline therapy for cvid but does not address sufficiently the immune dysregulation in a subgroup of patients. better predictive markers have to be identified for the selection of patients for additional, potentially even definite forms of treatment in order to prevent the morbidity and mortality associated with these secondary manifestations of cvid. the first department of primary immunodeficiencies in russia was established on the basis of the institute of immunology in , when patients with pid were registered. currently, patients with pid are followed in the department of immunopathology in adults. % of pid adult patients have pid with immunoglobulin deficiency. analysis of this group of adult patients showed that the diagnosis of pid, on average has a delay of - years from the first symptoms. in % of cases, there is an infectious clinical phenotype, % -combined infectiouslymphoproliferative phenotype, % -infectious and enteropathy. the study of immunophenotyping of b-lymphocytes for the degree of maturation in this group of patients was begun. patients are currently included in this study. patients showed complete absence of b-lymphocytes, -the reduction of b-cells, patients of those have a normal amount switched memory b cells (mbc), people -a decrease amount of switched mbc. persons of the group with decreased amount of switched mbc had an expansion of transitional mbc. at present, a clear link of immunophenotypes with specific clinical phenotypes in not found, but this may be due to small sample of patients at the moment, the investigation continues. for the treatment of this category of patients only intravenous immunoglobulins are available in russia. we use drugs in various concentration of russian and foreign production. the availability of immunoglobulins for the adult patients unfortunately is not sufficient in russia, so the recommended pretransfusion level of igg is not achieved in about % of patients. our work presents the experiences of our center with the subcutaneous form of immunoglobulin therapy (scig). we have patients on such therapy. the youngest child is months old. the largest group consists of cvid patients, next-xla patients. we also substitute children diagnosed with the dgs and accompanying hypogammaglobulinemia and some children with subclasses deficiency as well as secondary hypogammaglobulinemia. in most cases we start therapy with intravenous preparates, but there have been some children to whom we proposed the subcutaneous form at the initial stage of the therapy. the main factors which made us change the mode of the drug application were adverse reactions to ivig, poor vein access and the parents`wish. the administration of scig is very rarely complicated by severe adverse reactions (the risk of their incidence amounts to about . %). even patients with serious side effects to previous immunoglobulin therapy and/or blood transfusion can be safely treated with scig. the most common side effects are local reactions but their incidence decreases during following substitutions. we can observe swelling, redness, induration, soreness. but we should remember that more severe side effects are also possible, for example: the first cvid patient presented with fever, weakness, difficulties in breathing during the following infusions. changing the brand of the drug turned out to be a sufficient method of getting rid of side effects. the second patient, also with cvid, suffered from nausea, headache, meningismus. we changed the drug brand, slowed down the infusion rate and introduced premedication with an antihistaminic drug. the third patienta girl with dgs and hypogammaglobulinemia, after having been operated on for hypoplastic left heart syndrome, responded to infusions with high fever, muscle and joint pain, skin changes (erythrodermia). we introduced premedication, changed the drug brand and slowed the infusion rate, yet without any positive effects. in two patients we observed adverse reactions after preparates at a concentration of twenty percent. there were: weakness, chills, fever, headache, and very intense pain in the place of injection. during the subcutaneous treatment of xla patients, we observe significant reduction in the number of infections and days of school absence. despite that, all our patients with xla suffer from chronic sinusitis. similar results occurred in cvid patients, but the severity of infections was the same. the use of scig results in more stable and higher igg through levels especially in xla patients. in our practice, we had only a few cases in which iv form appeared to be better than sc one. in the case of two boys with higm syndrome, we observed recurrent enthesitis of the first patient and progression of lung fibrosis of the other. ivig was better to control platelets levels in the girl with cvid and thrombocytopenia. it has also occurred that parents refuse to allow us to start subcutaneous therapy, giving two main reasons: they feel safer under frequent doctor`s control and they are afraid of making mistakes in procedures. as for the youngest children (below )their fear of needle is independent of its size, which is the third reason. in conclusion, we would like to emphasize that education programmes implemented by doctors and nurses are essential to make this form of therapy easier, safer and more satisfying for patients and their parents. despite intensive investigation into the nature of cvid, the exact molecular defect(s) and pathogenesis of disease remain unknown. our aim was to evaluate the role of t cells in the mechanisms of cvid development. additionally the impact of some innate and adaptive immunity related genes (hla, cytokine gene polymorphism, mbl genes) was investigated. based on previously observed by us constellation of shared immunogenetic profiles a comparison of t-cell phenotype of cvid patients, and elderly/young healthy individuals was performed. ten patients with cvid were enrolled ( male, female; average age - , years) presented mainly with pulmonary infections, followed by bronchoectasis and splenomegaly. our study demonstrated multiple t-and b-cell abnormalities in cvid patients such as: decreased cd +, increased cd + t cells and low cd /cd ratio, loss of naïve and early differentiated t cells, expansion of terminal effectors (cd + cd ra + cd l-) t cells, memory/effectors (cd + cd -cd -) and terminally differentiated (cd + cd +) t cells. excessive t-cell activation reflecting the prevalence of activated t cell phenotype was also detected, due perhaps to an antigen-driven process. the very low numbers of circulating mature (cd + cd +) and class-switched memory (igm-igd-cd +) b cells were pathognomic for our patients and could be used as an additional diagnostic criteria in the national guidelines. furthermore high level of nonclass switched (igm + igd + cd +) b memory cells and suppressed nk cell count was observed. decreased responsiveness to polyclonal stimuli via cd and cd pathway correlated with the loss of cd expression which was more pronounced in the treatmentnaïve cvid patients. these findings were further discussed in the context of the similarities that exist along with markers for immune senescence (lack of cd or expression of cd ). increased frequency of ifn-γ polymorphisms associated with low expression level found could indicate genetically predisposition to high activation of th lymphocytes in cvid and consequently support the concept of impaired th -type responses. in conclusion our study provided new insight into the pathogenesis of cvid. this work was partially granted by medical university sofia, grant# bcg vaccination at birth is the constant element of vaccination programmes in poland. high reactogenic bcg danish vaccine has been replaced in , by bcg moreau vaccine. frequency of disseminated bcg infection, in children with primary immunodeficiencies after bcg moreau vaccine manufactured by biomed, poland were estimated. one thousand five hundred sixty three cases of primary immunodeficiencies were diagnosed in the department of immunology, children's memorial health institute in warsaw between - . among patients with t cell predominant deficiency, group high risk of bcg infection, scid was recognized in children. mendelian susceptibility to mycobactarial diseases (msmd) was detected in four patients: ifgr deficiency and il deficiency -equally in two patients, and nemo -in one. in the group of primary immunodeficiencies regarded to be less prone to mycobacterium infections, cgd was diagnosed in , hies in patients, and xl-higm in patients. disseminated bcg infection was recognized in scid patients, of them died, because of bcg diseases. all patients with msmd developed bcg infection, one with il- deficiency died. during nearly -year-follow-up, no case of tuberculosis or disseminated bcg infection have been diagnosed among cgd , hies and xl-higm patients. early anti -tb drug prophylaxis and usage of wide range of antibiotics in therapy is crucial for cleaning of bcg infection. peter Čižnár ; julia horáková ; peter Švec ; ivana boďová ; sabina Šufliarska ; linda libai veghová ;, marieta hricová st pediatric department, comenius university medical faculty, children`s university hospital, bratislava, slovakia. transplantation unit, department of pediatric haematology and oncology, children`s university hospital, bratislava, slovakia. objectives: severe combined immunodeficiency (scid) is a group of disorders due to more than genetic defects, characterized by increased susceptibility to severe infections and early life death. the diagnosis is supported by the demonstration of low absolute t lymphocyte count variably associated with numerical defects of b and nk cells. patients are very heterogeneous regarding clinical course, immune parameters and clinical outcome. bcg (bacillus calmette-guerin) vaccine, a life attenuated vaccine was the part of slovak immunization program, administered at birth until . a comparison of clinical course of bcg exposed (bcg+) and non-exposed (bcg-) scid patients in slovakia in period of past years are given. results: incidence rate of diagnosed and treated scid in slovakia was calculated to : . , meaning , cases per year. in total cases represent ada patients, il rg deficiencies, case of complete del q and in cases genetic defect was not found by analysis of rag / , il rg, artemis, il ra, jak and ada genes. all patients were confirmed absent trec (t-cell receptor excision circles) copies in a retrospective neonatal guthrie card analysis. seven out of these patients underwent hsct, in the hsc source was a mud. favorite outcome was achieved in of them. half of our patients have been exposed to a live bcg vaccine during neonatal period. patients vaccinated with bcg faced severe complications and organ damage due to generalized skin and organ abscess formation, requiring prolonged (up to months) hospital care and complex antibiotic therapy with more than four types of anti-mycobacterium drugs, for more than years. average length of hospital care for bcg exposed patient was , months vs. , months in non-exposed group (p < , ). no statistical difference was found between the time of recognized first symptoms, and time of diagnosis in bcg + and bcg-group. the clinical presentation of non-bcg vaccinated patient differs in the initial symptoms when failure to thrive and pneumonia at months was the most common finding. post-transplantational recovery in bcg-group was less complicated. conclusions: two major improvements for the outcome for scid patients in slovakia have occurred in past years. early life vaccination for tuberculosis has been retreated and improvements in diagnostics for severe t cell defects have been made, including flow cytometry phenotyping and genetic testing within the middle european countries cooperation, the j-project. bcg and late diagnosis prolongs time for hospital care, immune reconstitution and carries severe complications, consequently it increase the costs of health care and decrease the quality of patients' life. the perspective of newborn screening for scid would be the next major step in improving the outcome of scid patients. ahmed aziz bousfiha ; leïla jeddane ; nahla erwa ; monika esser ; shereen m. reda in africa, primary immunodeficiencies are still largely undiagnosed, with no cases reported in of countries. though the african society for immunodeficiencies (asid) already organized international meetings and training schools, their impact outside the hosting country is still insufficient. at this time, only a few pid patients are reported in africa (less than patients), the majority of whom are in north africa and south africa. so, asid propose the a-project, a training program based on the j-project. some issues prevent effective training for pid in africa: diversity of languages, only a few are initiated to pid, lack of resources for travel expenses, difficulty to access to care and shading by the hiv pandemic. a-project is designed as a one-day training by an african pid expert in a small group of motivated caregivers. this project is adapted to the african context, as it only requests minimum funding and can reach more people. each a-project will be co-organized by asid and a local committee, and shall lead to some commitments to be realized by locals, in particular the establishment of a registry, a network between physicians and scientists and creation of a patient association. moreover, each a-project will be done in the medical language used in the country (english, french or portuguese). the first a-project was already done in benin, and five more are already planned for . our goal is to reach all countries where no patient were reported in years. this clinical program will raise pid awareness in africa and can potentially discover new aspects of the immunity. till very recently primary immunodeficiency diseases (pids) were not being frequently recognized in india. however, the scenario has changed over the last years or so. the indian society for primary immune deficiency (ispid) was founded in - . over the last years the ispid has organized international conferences (at new delhi and mumbai), national conferences (at chandigarh and varanasi) and continuing medical education programmes (at new delhi and lucknow). these meetings have served to act as catalysts for the cause of pids and have resulted in increasing the awareness about these conditions amongst paediatricians and physicians in our country. several centres now have the clinical skills and the technical wherewithal to perform laboratory investigations for these patients. the repertoire of tests includes nephelometery, elisa based tests and flow cytometry. facilities for molecular diagnosis of pids are also being developed at some of these centres. a lot more, however, needs to be done. the clinical phenotype of several pids in india is likely to be different from that in the west . further, the type of infections in these patients is also likely to be different. this is because of the differences in the micro-and macro-environment to which these patients exposed in developing countries. these differences have been well brought in the recent publication on chronic granulomatous disease from our centre . further, the genetic background of the indian population is diverse and several new mutations are likely to be identified amongst these patients. the indian council of medical research has taken up the lead in this regard and is proposing to set up centres for advanced research (cars) in pids - each at the post graduate institute of medical education and research, chandigarh and the institute of immunohematology, mumbai. the foundation for primary immunodeficiency (fpid), usa has also been closely involved in these efforts and has helped facilitate the development of these cars. the field of pid research in india is wide open and we are likely to witness new and exciting scientific developments in the coming years. references: . gupta s, madkaikar m, singh s, sehgal s. primary immunodeficiencies in india: a perspective. annals of the new york academy of sciences ; : - . the prevention of pid's complications, the improvement of the health care of patients with pid, the creation of the registry of the patients with pid, the implementation of the finance regulations for detection and treatment of patients with pid diseases in public health facilities, the training and professional development of medical professionals in this field. objective: to improve the detection and diagnosis of pid diseases and the life quality of patients with pid in the republic of kazakhstan. undertaken activities for realization of the project: . professor. l. marodi visited kazakhstan in october and the meeting was held in ministry of health of the republic of kazakhstan, presentations were given at the international conference held in national research center for maternal and child health, the negotiations with heads of the national medical holding' clinics and scientific center of pediatrics and pediatric surgery were held. international islamic university, kuantan pahang, malaysia. two hundred and sixty three ( ) suspected pid (primary immunodeficiencies) cases were referred to clinical immunologist led clinics in malaysia from - . patients referred were from all states of malaysia and seen at the institute of pediatric, hospital kuala lumpur and university associated hospitals in north and central peninsular malaysia the initial pid patients were seen by - pediatric immunologist between - followed by another , beginning in followed by the other in . there were ( . %) patients with at least abnormality on the immune prameter recorded and regarded as probable pid. however ( . %) were recorded as pid based on existing criteria. (who scientific committee , iuis scientific committee, primary immunodeficiency disease. ) our population were mainly children, % below years and % below year. only were above years. pid were classified as; predominant antibody deficiencies %, combined immunodeficiencies . %, other cellular immunodeficiencies . %, phagogocytic defect . %, immunodeficiency associated lymphoproliferative disorders %. our data differed from most classification where predominant antibody deficiency is most frequent as high as %, (steihm, ) . of the specific pid recorded, x linked a gammaglobulinemia (xla) , hyper igm syndrome (higm) , common variable immunodeficiencis (cvid ), selective iga deficiencies severe combined immunodeficiencies (scid) , di george syndrome (dgs) ,chronic granlomatous disease (cgd) , hyper immunoglobulin e syndrome (hige ) , primary cd deficiencies , ataxia telangiectassi % malaysia comprises of multi ethnic groups with a population of . million in . pid amongst them showed, malays at . %, chinese %, indians . % and others . % whilst the male predominate over female at a ratio of . : . family history of affected sibling or in first degree relative, or early death with suspected infant dying of infection was positive in . % which is higher than in most reports eg egypt . % (reeda ). this could be due to high consanguinity in the population. alternatively the symptomatic sibling of affected patients is more likely to be referred to the clinical immunologist. scid records the most varied organism from the positive microbiological isolate viz bacteria , fungus , virus , parasite . chromobacterium violaceum was seen in cgd patients in which deteriorated with eventual death. as in many national registries diagnostic delays remains prominent. in our series the mean diagnostic delay was o . ± . years. in comparison thailand stands at . ± . years, while france, a median of . years. malaysia remains committed to provide better diagnostic services and improved care of the pid patients through research collaboration with foreign partners with a drive for creating subspecialty training. patient groups aligned to ipopi is now closer to its formation with the creation of its protem committee ensuring that patients' interest will always be guarded aknowledgement. the authors thank all who had contributed directly or indirectly, especially medical officers, nurses, consultant pediatricians especially dr kamarul azhar, institut of pediatrics hkl, laboratory scientists especially dr shanaz murad of the imr kuala lumpur university of manchester, uk although the concept of grouping mendelian disorders associated with an upregulation of type i interferon (ifn) has not been previously recognised in the medical literature, our past and current work argues that this concept has scientific validity and clinical utility. i will discuss the possibility that such conditions can usefully be considered to represent a novel set of inborn errors of immunity, and that the recognition of diseases as type i interferonopathies will have significance for the development of targeted therapies, as well as informing our understanding of viral and retroelement biology, and the pathogenesis of some forms of autoimmunity. classic kaposi sarcoma (ks) is exceedingly rare in children from the mediterranean basin, despite the high prevalence of hhv- infection in this region. we hypothesized that rare single-gene inborn errors of immunity to hhv- might underlie classic ks in childhood. we report here autosomal recessive ox deficiency in an otherwise healthy adult with childhood-onset classic ks. ox is a costimulatory receptor expressed on activated t cells. its ligand is expressed on various cell types, including endothelial cells. the mutant ox protein was poorly expressed on the cell surface and failed to bind ox ligand, resulting in complete functional ox deficiency. the ox -deficient patient had a low proportion of effector memory cd + t cells in the peripheral blood, consistent with impaired cd + t-cell responses to recall antigens in vitro. the proportion of effector memory cd + t cells was less diminished. the proportion of circulating memory b cells was low, but the antibody response in vivo was intact, including to a vaccine boost. together, these findings suggest that human ox is important for cd + t-cell memory, but redundant for immunity to most common pathogens, with the notable and surprising exception of hhv- . the chronic mucocutaneous candidiasis disease (cmcd) is characterized by persistent or recurrent infection of skin, nails, oral, or genital mucosae with candida albicans. il- -mediated immunity has been concerned in host defense against candida on body surfaces. we have investigated nine patients with chronic mucocutaneous candidiasis disease (cmcd) and signal transducer and activators of transcription (stat ) mutations. the novel c. c > a (n k) and c. a > g (q r) mutations in the coiled-coil domain (ccd) and the c. c > t (t m) mutation in the dna-binding domain (dbd) of stat are gain-of-function (gof) for γ-activated factor (gaf)-dependent cellular responses to stat . low proportion of il- a-and il- -producing t cells, lower levels of intracellular il- a and il- by t cells and impaired candidainduced secretion of il- a and il- by leukocytes from cmc patients compared to that in healthy controls were found. the c. c > t (r w) mutation affecting the ccd and the c. c > t (t m) mutation affecting the dbd of stat and resulted in gain-ofphosphorylation and gof. these mutant alleles enhanced the cellular responses to cytokines via stat signalling pathway. these data provide further insight into the mechanism of host defense against candida. heterozygous gain-of-function stat mutation is known as a major etiology of chronic mucocutaneus candidiasis. gof mutation affecting the stat coiled-coil domen (d g) was initially discovered in -year boy with cmc. gof mutation of dna-binding domen (t m) was found in the second our patient with cmc. both patients have early manifestation of recurrent or persistent infections of the skin, mucous membranes, and nails with candida albicans. they also have skin infections with dermatophytes. patient presented from the first months of age with severe recurrent sinopulmonary infections. recurrent pneumonia and chronic bronchitis complicated by bronchiectasis, which resulted in cor pulmonale and congestive heart failure. patient suffered from recurrent hsv infection, recurrent aphthous stomatitis, has several episodes of bacterial skin infections. he also has chronic bronchitis and several episodes of pneumonia, but does not have bronchiectasis. both boys developed esophageal stricture, patient necessitating nissen fundoplication in the age of years. the patients have mild autoimmune features: uveitis (p ) and alopecia (p ). immunological investigation revealed different impairment of immune system: more severe, similar to combined immunodeficiency in p , which declines with age. the p does not have changes in lymphocyte number and immunoglobulin's, but impaired antibody production to pneumococcal antigens. western blotting performed with nuclear extracts of lymphocytes of both patients showed stronger stat phosphorylation after stimulation with cytokines ifnγ, ifnα, il- . mononuclear blood cells from both patients released much smaller amounts of il- a and il- than candida-exposed cells from healthy control. stat activation triggers transcription of interleukin (il)- which is crucial for mounting protective immune responses against fungi. several mutations affecting the stat /il- pathway have been reported, resulting in selective susceptibility to fungal (candida) infection, a hallmark of chronic mucocutaneous candidiasis (cmc). in patients with autosomal-dominant (ad)-cmc we previously reported defective th responses and identified an underlying gain-of-function (gof) stat mutation leading to hyperphosphorylation of stat . how this affects stat or leads to decreased il- remains to be determined. in patients with ad-cmc, we assessed how gof-stat mutations affect stat activation, dna-binding, gene expression, cytokine production and the effect of epigenetic modification. we show that stimulation of stat in the presence of gof-stat mutations leads to significantly reduced transcription of stat -inducible genes (rorc/il- / il- /il- /c-fos/socs /c-myc). this was not due to impaired stat phosphorylation, altered nuclear translocation nor sequestration of stat into stat /stat heterodimers. dna binding to a stat-consensus binding site construct (hsie) was intact but binding to an endogenous stat dna target was impaired. the reduced stat -dependent gene transcription could be normalized by inhibiting stat activation by fludarabine or enhancing acetylation with histone deacetylase (hdac) inhibitors trichostatin a or itf . silencing hdac , hda and hdac indicated an important role for hdac . impaired stat -dependent gene transcription likely underlies decreased th- cytokine production, susceptibility to fungal infections and other pathology seen in ad-cmc patients and could be a new target for defining novel therapeutic approaches for this potentially lethal disease. autoimmune features have been long thought as association with immunodeficiency disorders, but are now viewed as a crucial component of some diseases attributed to the breakdown of self tolerance or defects of immune regulators. it had been previously established that a single gene defect of the foxp gene (foxp in humans) caused widespread autoimmunity in both humans and mice. the clinical syndromes observed in both scurfy mice and humans suffering from ipex are similar to those observed in experimental models in which treg are selectively depleted. in , three groups demonstrated that these diseases were indeed the result of a regulatory cell deficiency. around one third of the patients with clinical manifestation closely resembling ipex syndrome, foxp is not mutated, these patients are referred to as ipex like. here we present a case; a female patient years with multiple autoimmune manifestations; dm, coeliac disease and ulcerative colitis with marked decrease in the percent of cd + cd + foxp + cells. as she has a siblings suffering from dm; the whole family was investigated. the father and the mother had % cd + cd + foxp + cells. background: hids is an autosomal recessive disease, first recognized as a separated entity at . in patients with hids, the activity of mevalonate kinase is reduced to - % of normal levels. hids is caused by mutations in the mevalonate kinase gene (mvk), located on the long arm of chromosome ( q ). it is manifested by cyclic attacks of fever initiated usually during first year of age. the frequency and severity of attacks tend to decrease later in life. materials and method: a retrospective analysis of medical history , clinical course and laboratory findings of two albanian children with periodic fever , diagnosed with hyper igd syndrome. results: case presentation : an -year-old boy admitted to the hospital because of periodic fever spikes, which occurred every - weeks and lasted - days, presented since the first year of life and coincided with the beginning of immunization. he had a tonsillectomy and adenoidectomy at the age of . the fever attacks were associated with chills, malaise, and abdominal pain without gastrointestinal signs. between attacks the patient was free of symptoms. from his family history, recurrent febrile episodes during childhood were reported to his father. physical examination showed normal findings, except for a cervical lymphadenopathy. laboratory: marked increase of erythrocyte sedimentation rate and crp. wbc-ranged from . to /mm . , high asto. serum igd was repeated several times and was always elevated (mean value: serum igd iu/ml). the mutation v i is found from the genetic examination done for gene mutations in chromosome ( q ). he repeated attacks after initial treatment with corticosteroid ,than is suggested. the second case was a four-year-old girl hospitalized five times because of prolonged fever, and diagnosed as pneumonia, tonsillitis, acute otitis media and sinusitis, treated by antibiotics. her laboratory findings were not remarkable except for increased acute inflammatory responses. serum amyloid a (saa) μg/l ( μg/l) and igd was extremely high . iu/ml. genetic examination for two mutations were negative, but reduced mevalonate kinase activity in white blood cells was demonstrated in more thorough investigations. treatment regime: colchicine conclusions: auto inflammatory syndromes always pose diagnostic and therapeutic challenges to the clinicians. the clinical description of the diversity of periodic fever syndromes is helpful in the assessment and management of these patients. although hids is predominantly identified in populations from northern european areas, it has to be considered in children with periodic fever. anastasiia bondarenko ; liudmyla chernyshova ; iryna sychova shupik national medical academy of postgraduate education, kiev, ukraine. dniepropetrovsk regional children's hospital, dniepropetrovsk, ukraine. background. aspergillus is an actual pathogen in chronic granulomatous disease responsible for about % of all infections. in - % lungs are involved and in % -cns. case. we report a case of combined loci in -years old female patient with ar cgd. the child was born from iii pregnancy, ii delivery on th week of gestation with body mass g. she received bcg vaccination at -th day of birth. at months the local inflammation in site of bcg with regional lymphadenitis developed which was treated with isoniazid for months. then bilateral purulent cervical lymphadenitis developed at , and months treated with wide spectrum antibiotics. culture from pus was negative. pcr for mycobacterium tuberculosis complex was negative. at months systemic infection without loci occurred with fever, lymphadenopathy, hepatosplenomegaly, loss of weight, progressive anemia, inflammatory changes in blood for almost months. bacteriological cultures were negative. treatment with wide spectrum antibiotics was insufficient for months. disseminated bcg infection was suspected and -compound amb treatment was started ex juvantibus with positive effect: the fever has stopped, the sizes of lymph nodes, liver and spleen have decreased, the weight of a body normalized. the child suffered from recurrent pyogenic infections, underwent disseminated salmonellosis. at the age of years blood samples were tested at the laboratory of human genetics of infectious diseases, inserm (paris, france). an absence of p phox protein expression detected by western blot conferring a complete defect in cyba due to compound of geterozigous mutations in q . at years primary tuberculosis complex of right upper lobe (mbt -) was diagnosed. at the age of during the unexplained fever multiple formations were identified in the liver, biopsy showed caseosis suspected the mycobacterial nature of lesions but mbt (-). at the age of years because of shade in the left upper lobe and ineffective standard antibiotic treatment the tuberculosis again was suspected. due to ineffective antimycobacterial treatment for months multi drug resistant tubercullosis was considered. anti-tb drugs ii line was appointed without clinical response. fever persisted. mri of brain revealed mass lesion in the left parietal lobe. because of suspected tumor the brain biopsy was done and the pus was obtained. microbiological studies revealed aspergillus fumigatus. at the same time subcutaneous tumor-like infiltrate х mm appeared on chest in a proection of lung lesions. the pus was obtained during thoracentesis. result of microbiological studies: aspergillus fumigatus. drainage of abscesses and intravenous voriconazolum led to dramatic clinical improvement and normalization of blood parameters. conclusion. features of our case is spread lesions of aspergillosis with relatively slow progression of infection. high incidence of tuberculosis in ukraine leads to a high suspicion regarding this infection. diagnosis of tb is mainly based on instrumental studies. radiological and histological differential diagnosis between tuberculosis and other infections with granulomas in cgd is difficult. high suspicion of tuberculosis led to late diagnosis of aspergillosis. great north children's hospital, newcastle upon tyne hospitals nhs foundation trust, and primary immunodeficiency group, institute of cellular medicine, newcastle university, newcastle upon tyne, uk even following the introduction of biologic disease modifying antirheumatic drugs (dmards), a small number of children suffering from severe, refractory autoimmune (ai), rheumatic and/or autoinflammatory disorders will not get into clinical remission (cr) and will potentially further suffer from multiple side-effects of combined and long-term immunosuppressive and anti-inflammatory therapies, in particular severe infections (marodi l, casanova jl. jaci ; abinun m. ped health ). whilst autologous t cell depleted hsct following the immunosuppressive conditioning regimen achieved complete clinical remission in majority of children with severe juvenile idiopathic arthritis (jia) (de kleer im et al. ann rheum dis ) , infection-related mortality remains significant (abinun m et al. mol immunol ) . therefore, following the success of allogeneic hsct in treating children with immunodysregulation, polyendocrinopathy, enteropathy, x-linked (ipex) syndrome (nademi z et al. bmt ) , we treated further children with different severe ai (alps, autoimmune lymphoproliferative syndrome (n = ); complex ai disorder (n = )), rheumatological (jsle, juvenile systemic lupus erythematosus (n = ); jia (n = )) and autoinflammatory disorders (mkd, mevalonic kinase deficiency/ traps, tnf-receptor associated periodic fever syndrome (n = ); eoc, early onset colitis (n = )). overall, of the children are alive (follow up - years), in complete and (complex ai disorder) in partial cr, original disease (alps) relapsed in , and children died ( each with alps and eoc). children had significant, but transient acute (grade - ) and chronic (limited) graft vs. host disease (gvhd), experienced multiple virus reactivation(s), and remarkably we saw significant secondary ai diseases post-hsct (transient nephritic syndrome (n = ) and cytopaenias (n = ); psoriasis, n = ; and thyroid disorders (grave's thyrotoxicosis and hypothyroidism), n = ). our data add to the positive experience and evidence acquired over the last - years (daikeler t et al. bmt ; snowden ja et al. bjh ) to propose the allogeneic hsct as a viable treatment option for the small group of children suffering from severe autoimmune disorders. the wiskott-aldrich syndrome (was) is an x-linked primary immune deficiency disorder characterized by thrombocytopenia, microthrombocytopenia, recurrent, mostly respiratory tract infections, eczema and increased risk of autoimmune disorders and malignancies. was is caused by mutations in the wasp gene which encodes wasp, a -amino acid protein. wasp plays a critical role in actin cytoskeleton organization, signalling and different functions of immune cells. we present here the results of genetic analysis of patients with was from eleven eastern and central european (ece) countries, turkey, iran and azerbaijan. clinical and laboratory information of affected males and carrier females from was families were collected. the wasp gene was sequenced from genomic dna of patients with was, as well as their family members to identify carriers. in this large cohort, we identified unique mutations including novel sequence variants. the mutations were scattered throughout the wasp gene and included single base pair changes ( missense and nonsense mutations), small insertions, deletions, and splice site defects. this study was financially supported by the tÜbİtak project s and bap project tda- - . background: chronic granulomatous disease (cgd) is a rare primary immunodeficiency disorder of phagocytes. resulting in impaired killing of bacteria and fungi. a mutation in one of the four genes encoding the components p phox , p phox , p phox and p phox of the leukocyte nadph oxidase leads to autosomal recessive (ar)-cgd. a mutation in the cybb gene encoding gp phox leads to x-linked recessive cgd. methods: we report here the results of genetically and functionally characterized patients with cgd from turkish families in turkey. results: most of the families ( %) have an ar genotype (% p phox , % p phox and % p phox ) and % have an x-linked genotype. patients with a , a and x phenotypes with oxidase null activity (dhr stimulation index of ≤ . ) were found in patients. however, in p phox deficient cases and in other ar cases with high residual oxidase activity (dhr stimulation index ≥ ) were found in patients. conclusions: residual oxidase activity is similarly lack in the x , a and a phenotype except ar cases with missense mutation. in our cohort, the percentage of ar-cgd was different from european and usa registries (in comparison with % , % and % of p phox , p phox and p phox deficient ar-cgd cases, respectively) with the higher percentage of patients with p phox ( %) and p phox -deficent ( %) phenotypes, and the lower percentage of patients with p phox -deficient ( %) phenotype. the basic difference in our results from those reported is the higher percentage of patients with ar-cgd (% ), which was lower than in the european and usa registries, probably because of the higher prevalence of consanguineous marriage in turkey. introduction: schnitzler syndrome is an autoinflammatory disorder of unknown etiology. at least some of its clinical presentation is mediated through an activation of inflammasome and release of il- , as was repeatedly demonstrated by a prominent therapeutic effect of il- blockade. recent reports bring an evidence of an important role of mitochondria in inflammasome activation and in a pathogenesis of autoinflammatory diseases. we have therefore investigated mitochondrial function and structure in patients with schnitzler syndrome. materials and methods: activity and amount of oxidative phosphorylation complexes (oxphos) were analysed by spectrophotometry, histochemistry and imunoelectrophoretic methods in fibroblast cell lines derived from skin biopsies of three adult male patients with schnitzler syndrome. ultrastructure of mitochondria, mitochondrial network and reactive oxygen species (ros) were analysed by fluorescent and electron microscopy. results: the activities and amount of oxphos complexes i, iii and iv were decreased in patients with schnitzler syndrome. interindividual differences in the degree of impairment (from severe to moderate) in analyzed mitochondrial parameters were found. content of ros, previously suggested as main inducers of inflammasome, were not significantly increased in cells with schnitzler syndrome. we, however, did find consistent and prominent changes in mitochondrial structure of all three patients. disturbed mitochondrial network and mainly abnormal, partially swelling mitochondria with unusual and sparse cristae were characteristic for all patients. we did further notice marked accumulation of neutral lipids in all tested fibroblasts. conclusion: severe structural damage of mitochondria associated with milder functional changes represented a consistent feature found in all tested schnitzler syndrome patients. along with progress in basic and clinical immunology worldwide, the knowledge and activities in the field of primary immunodeficiencies (pids) have developed during last two decades. in , a group of junior doctors and students joined seniors in this filed to establish iranian primary immunodeficiency registry (ipidr). several national and international research projects have been done so far which led to lots of publications, while improving the diagnosis of patients with pids, construction of iranian primary immunodeficiency association (ipia), and establishment of research center for immunodeficiencies were other activities which lead to better management of the patients. organizing annual meeting on clinical immunology and immunodeficiencies, celebrating pi week annually and active participation in the international congresses were all helped in to increase knowledge of physicians in the country. the overall activities in the field of pids led to an increased trend in recognition of more patients in the recent years, which was associated with decreased delay in diagnosis. based on recent report of the registry, published recently in the j clin immunol, more than new patients with pid, in addition to previously reported patients, were presented. predominantly antibody deficiencies were the most common form of disease, followed by combined immunodeficiencies, congenital defects of phagocytes, and other well-defined syndromes with immunodeficiency. the rapid progress in identification and registration of the patients with pids is important not only as of epidemiological aspect, but also as of timely diagnosis and appropriate treatment of the patients. the j project physician education and clinical research collaboration program was launched in in eastern and central europe (ece). in less than years, it has achieved remarkable success. this project aims to increase knowledge in the field of primary immunodeficiency disorders (pid), and to improve the diagnosis and treatment of patients worldwide, particularly in countries with limited economic resources, which currently report fewer such patients than expected. in most ece countries, gene sequencing, which can provide a definitive diagnosis of pid, still remains unavailable. by contrast, such technology is used elsewhere to detect the more than pid-causing genes that have been discovered in the last three decades. thus, pid awareness programs like the j project remain critically important, to improve diagnostic facilities and treatment and to promote clinical research collaboration. this paper highlights the achievements of the j project and the spread of its concepts and spirit to the countries of western asia. primary immunodeficiencis (pid ) are rare genetically determined diseases , occurring with an incidence of per inhabitants. it is heterogeneous group of disorders, from quite commonly found and usually asymptomatic iga deficiency ( in ), to a very rare diseases such as chediak -higashi ( in inhabitants). in , within the framework of a government research project no. pbz-kbn- /p / -" development , improvement and implementation of highly specialized diagnostic procedures for immune-mediated diseases", a network of cooperating national centers for diagnosis and treatment of pid, named polish working group on primary immunodeficiencies (pgr pno) was founded. as a result of joint efforts of the group as well as an implementation of three eu grants [euro-pid -nas qlrt - - ( - , euro-policy -pid sp -ct- - , euro-gene -scan ( , )] the number of centers actively working in the diagnosis and treatment of primary immunodeficiencies increased. up todate pgr pno includes pediatric centers , and since - centers for adults. development and dissemination of new diagnostic and therapeutic standards contributed significantly to the increase in detection pid. with early diagnosis of the disease -the implementation of appropriate treatment, including gamma globulin replacement therapy together with quality of life has improved. in spite of all efforts recognition of pid in poland is very rare and currently is . to , what is almost times smaller than in europe (www.esid.org). at the moment, a nationwide registry of children and adults with pid consists of patients. in september pgr -pno summarized in the annual report the current status of the substitution therapy with intravenous and subcutaneous immunoglobulin therapy in children and adults with pid in poland. on the basis of available information, half of all patients ( children and adults) were diagnosed to have antibody deficiency. these data are similar to the register of a european database esid , where the percentage of patients with pid with a predominance of antibody deficiency is more than % (www.esid.org) development and dissemination of new diagnostic and therapeutic standards as well as a national cooperation contribute significantly to the increased detection of pid. early diagnosis of the disease is followed by earlier implementation of appropriate treatment, including gammaglobulin replacement therapy together with improvement of quality of life. mutations of was were identified in was boys and in heterozygote mothers. frequently genetic damages occur in , , , exones and , intrones: deletions ( ), splice-site mutation ( ), missens ( ), insertions ( ). deletions and insertions lead to stop-codon in cases. nbs patients were homozygous for del mutation and oneheterozygote for del had delt x-cgd: deletions ( ) and nonsens ( ) mutations in different exons of cybb were observed most often. in families was performed prenatal diagnosis: x-scid- , higm - , xla- , was- , nbs- , a-t- , cgd- , xlp- , dnalig - . healthy children - . recurrent severe complicated infections developed in % of pid patients. antibody deficiencies: bacterial infections - %, enteroviral - %, tuberculosis cases, atypical mycobacteriosis - case. combined pid: bacterial infections - %, fungal - %, viral - %, opportunistic (pneumocystis jiroveci) - %, mycobacterial - % ( -complication of bcg vaccination, -tuberculosis or atypical mycobacteriosis). cgd: bacterial - % (staph.aureus, e.coli, b.cepatia, salmonella spp., klebsiella spp.), mycobacterial - % ( % bcg origin, % -tuberculosis), aspergilosis - % immune disregulation syndromes (xlp [ ] and alps [ ]): bacterial infections - %, viral - % (ebv). autoimmune violations were observed in % of all pid cases: % of combined pid, % of antibody deficiencies, % of other well defined syndromes, % of autoimmune syndromes. cytopenias developed in %, vasculitisin %, ulcer colitisin %, arthritisin %. oncology diseases developed in % of patients: mainly in nbs, a-t, was and cvid: t-and b-leukemia's, lymphomas, solid cancer. the study of primary immunodeficiency is a unique model for studying the molecular basis of immunity. question about intravital pid verification is still relevant. a regional center of clinical immunology was established in at the regional children's clinical hospital № , yekaterinburg. the regional clinical hospital № joined the center in . institute of immunology and physiology, ural branch of the russian academy of sciences carries scientific management of the center. the centre works closely with foreign counterparts in the international project j project and it has been one of the centers of jmf since . over years we formed a regional register of patients with primary immunodeficiency, comprising patients: children and adults. analysis of the regional register allows to investigate the causes of deaths in patients with pid. infectious syndrome mortality -sepsis, generalized mycobacterial infection - patients, proliferative process - patients, dominate the mortality structure. creation of specialized immunological centers permit to raise the educational level of the medical staff, precisely identify nosological forms of pid among different groups of patients, to prevent the birth of children with pid, increase the length and quality of life such patients and take part in the collaboration with international experience in the pid. introduction: the aim of this retrospective study is to determine the frequency, and demographic, clinical and laboratory features of adult cvid patients referred to our clinic. materials and methods: we retrospectively evaluated adult patients ( female (% , ), male (% , ); aged to years: median years) who were diagnosed as cvid according to esid and pagid criteria during a year period (january -march ). results: the median current age of patients was , and the median cvid diagnosis age was , years. the diagnostic delay in patients with cvid was , years (median). cvid patients presented lower levels of igm ( patients, , %), iga ( patients, , %) and igg ( patients, , %). according to lymphocyte lmunophenotypes of cvid patients, cd ( patients, , %), cd ( patients, %) and cd /cd ( patients, %) values were observed the most lower ones. discussion: we found that both of the patients with bronchiectasis showed lower levels of immünoglobulins and lower imunophenotypes of b cell than the others that do not have bronchiectasis. in our patients cd , cd and cd /cd values have got enough priority to be mentioned about an immun deficiency. in conclusion, despite recent improvements in diagnostic tools, the diagnosis of mild or moderate cvid is often delayed. however, it seems that the diagnosis of cvid is delayed especially in adulthood on account of the fact that the lack of awareness of these illnesses among the medical professionals all over the world. primary immunodeficiency disease is important in turkey because of the high rate of consanguineous marriage. the lack of awereness about immunodeficiency can cause late-diagnosis and severe complications. the objective of this study was to assess pid awereness before and after clinical immunogy education among medical students. one hundred and thirty-two questionnaires with items ( ) were distributed to seventh somestre medical students and ( %) completed questionnaires were evaluated before (first) and after (second) their education about clinical immunology courses for hours. questionnaire scores (qs) were detected as total correct answers. the mean of the first qs was . ± . and second qs was ± . (p < . ). there was no statistically difference in gender ( m and f). of questions, there were related with pid directly. the correct responses rate less than % before education were of questions. all participants corrected their responses after education. the best improvement was detected in the responses of the clinical signs related with pid. it was remarkable that the participants have known the family history related with pid excellent before education. the majority of the participants ( %) believed that a lymphocyte count of /mm was related to immunodeficiency. nbt and ch test were not found to be related with pid before education. it is also important to increase the awareness of pid among the physicians during their education in medical school and more comprehensive education in pid appears to be useful for medical students. chronic granulomatous disease (cgd) is a rare primary immunodeficiency with mutations in nadph oxidase enzyme complex which causes failure of phagocytic cells to produce superoxide and subsequent intracellular killing of microorganisms. we retrospectively analysed medical records of patients diagnosed with cgd in the last years from immunological diagnostic centres from central and eastern european countries (estonia, poland, belarus, ukraine, czech republic, slovakia, hungary, serbia and slovenia) and russia. genetic sequencing from patients' dna was performed in genetic centres in ljubljana, belarus and netherlands for mutations in known genes involved in cgd pathogenesis: cybb, cyba, ncf , ncf . we included patients with cgd in our cohort, were female. the mean age at presentation of the disease was months and at diagnosis , years. lymphadenitis ( %), dermatitis ( %), enteritis ( %), pulmonary infections ( %), liver abscesses ( %) and septicaemia ( %) were the most common clinical presentation. complications of bcg vaccination ( %) were the most common presenting infection. in total , years of followup in our cohort, the patients suffered different severe infectious episodes ( . per year). respiratory ( %), lymph node ( %) and gastrointestinal tract ( %) infections represented the most prevalent severe infections. we identified different mutations out of genes tested. in patients we identified different mutations in cybb gene, unrelated patients had the same mutation in cyba gene and in patients had typical deletion in ncf gene. in our cohort we observed high incidence of bcg infections as a presenting symptom. apart from high bcg infections patients included in our study had similar frequencies of infections and infecting microorganisms as patients described in previous series. objectives: the aim of this study is to determine the carrier rate in healthy controls from central european and balkan region. methods: we screened more than healthy subjects from countries in the region. exon and was pcr amplified and subsequently sequenced with abi prism genetic analyzer. results: heterozygous mutations were found in % of apparently healthy hungarians, % of slovenians, % of bosnians, % of serbians and in % of apparently healthy macedonians. mutations found in hungarian population were as follows: v a ( ), k r ( ). mutations found in slovenian population were: v a ( ), k r ( ) and e q ( ). mutations found in bosnian population were: v a ( ), k r ( ) and f c ( ). mutations found in serbian population were: e q ( ), k r ( ). mutations found in macedonian population were as follows: e q ( ), k r ( ) and m v ( ). conclusion: we found higher than expected carrier rate in screened populations, from % to %. it is interesting to note that more than half ( %) of detected carriers in all analyzed populations has k r mutation. progress in the field of primary immunodeficiencies (pids) is reflected in national pid registries. data from slovenian pid registry were analyzed. patients' data were collected retrospectively before and prospectively afterward. patients were classified according to international classification and updated regularly. data of patients with different pids were analyzed. interestingly, complement deficiencies are the most common, accounting for % of all entries. second most common are antibody deficiencies with %, followed by well-defined syndromes ( %), immune dysregulation ( %), neutrophil defects ( %), combined deficiencies ( %), autoinflammatory disorders ( %) and defects of innate immunity ( %). prevalence of diagnosed pids in slovenia has changed in the last years; less complement deficiencies and more antibody deficiencies were diagnosed in comparison to previous decades. the number of new pid cases has been gradually increasing, a more prominent increase has been noted in the last years. the prevalence increased most for combined immunodeficiencies, cvid and autoinflammatory disorders. the spectrum of pid entities has also widened in the last decade. three patients with scid were diagnosed and successfully treated in the last three years (incidence - : . births). high prevalence of complement deficiencies reflects early implementation of good complement diagnostic facilities and awareness among infectologists. this group of patients was prospectively collected from . combined immunodeficiencies, cvid and autoinflammatory syndromes were all probably underdiagnosed before due to lack of awareness among physicians. distribution of pid groups is more consistent with esid registry in the last five years. identification and successful treatment of scid patients in the last years is an important quality marker. bulgarian association for clinical immunology was set up in aiming to get together all specialists working in the field of clinical immunology. one of the important objectives of the association was to raise the public awareness and attract attention of specialists, national health system, government and other related societies in order to improve the diagnosis and access to treatment for children and adults with pid. efforts of immunologists led to the following results: . consensus on the diagnosis and treatment of the basic pid groups was created by the pid national working group that was established in , and specific guidelines were disseminated as well. register for pid patients has been set up in bulgaria that allowed the collection of data on the incidence and prevalence of pid and the negative effect of these conditions on the population. . educational program to improve the qualification of the physicians and provide available resources to general practitioners and raise the public awareness were introduced. collaboration with patient's organizations was developed. . treatment of pid patients has been fully covered by the public health system since march . all these steps made it possible to advance the diagnosis and management of pid in our country. pediatric pid patients care -single center experience g. petrova; p. perenovska; s. mihailova; e. naumova umhat "alexandrovska", sofia, bulgaria j-project in bulgaria started in and up to now we have elaborated programme with diagnostic criteria, well equipped laboratory, established some mutual connections with foreign colleagues, held regional meetings, conferences; created clinical standards for treatment and ensured an immunoglobulin treatment and replacement therapy. here are examples of some of the problems we face: . seven-years old boy with hypogamaglobulinaemia (normal number b-ly with abnormal function). ivig had some initial effect, but lately we noted very fast deceleration in the overall health status with possible need of lung transplantation. the case is posing a question what more could we do, could we have prevented this rapid worsening. . ten-month old girl with scid with severe bcg infection after first vaccination, referred relatively late to our center, but successfully transplanted. the case is posing a question about timing of bcg vaccination and of referral to specialized center. . nine-years old girl with unidentified immune deficiency, normal immunological follow up but clinical course as an immune deficiency with very favorable effect of ivig according the parents. the case is posing the question should we stop or should we continue ivig, despite failing to find immunological defect, based on the good clinical response. unfortunately pids are not very well recognized and sometimes the patients are referred late. sometimes poverty and lack of knowledge of patients leads to miscalculation and neglecting of their conditions by themselves, or refusal for specific tests for clarifying the diagnosis. background: although rare, primary immune deficiencies (pid) are manifested with high rate infections as well as with autoimmune and malignant disorders that are treated hardly and inefficiently. pid are not only immunological problem; they require close collaboration between immunologists, pediatricians, ent, lung and gut specialists, dermatologists, hematologists, oncologists, patients and administration. the aim of this study was to summarize the activity on registration and replacement therapy of pid patients in plovdiv region at the university hospital "st. george"-plovdiv for year ( . - . ). methodology: children with pid of humoral immunity hospitalized at the clinic of pediatrics, and adults with hereditary angioedema (hae) were included in the study using immunological and other lab tests, clinical follow up and treatment: iv and sc ig for children with pid and c esterase inhibitor (ruconest, berinert) for hae patients. results: three national workshops and a national conference on pid were hosted and organized in plovdiv since . well established university hospital immunological laboratory, detecting serum immunogloblins, blood lymphocyte populations and subpopulations and complement proteins; clinic of pediatric and genetic diseases and an information center for rare diseases and orphan drugs function in plovdiv. an expert center for diagnosis and treatment of pid was created at the university hospital. it is a team of two competent pediatricians, an immunologist and an allergist. the targets are hospitalized pid children, outpatient pid children and hae adults. the center introduced regular replacement therapy with iv and sc iv and c inhibitor, reimbursed by the national insurance. together with icrdod the experts provide education for patients and parents how to perform sc ig application as well as consultations of patients and relatives about pid.since march indicated reimbursed replacement therapy with iv ig -octagam, started regularly in hospitalized pid children with bruton hypogammaglobulinemia, cvid, omenn syndrome or igg id. these patients, aged form to years, had to hospitalizations for one year. four outpatient children with omenn syndrome or igg subclass deficiency were subjected to sc ig -gammanorm, and hae type outpatients had good response for replacement c inhibitor therapy as follows: conestat alfa (ruconest)in hae adults ( iu/ml weekly), and berinert ( u/kg b.w. weekley)in hae adult patients. conclusions: the expert pid center in plovdiv university hospital provides competent diagnosis, therapy, education and consultations for pediatric and adult pid patients from plovdiv region. the recent introduction of reimbursed replacement therapy for pid patients (hospitalized or outpatients) allows regular immunological and clinical follow up of the diseases. background: intravenous immunoglobulins (ivigs) are scarce biological products used in a broad variety of disorders. tolerance to infusions is usually good but adverse events, including some serious ones, have been reported. methodology: a cohort study aimed for detection of adverse events that occur during and following intravenous immunoglobulin (ivig) infusions at cairo university children hospitals [patients were recruited at neonatal intensive care units (nicu), pediatric intensive care units (picu), general and specialized inpatient wards ] over a time period of six months, from april through september, . the study included transfusions for different disease conditions in patients.three maltose-stabilized intravenous immunoglobulin products were administered to patients. assessments were done before, during and after the infusions. results: there were symptoms and laboratory changes of adverse events during ivig transfusions, with some patients experiencing more than one adverse reaction. adverse events were noted to occur most frequently within to h from onset of ivig infusion (n = , . %). first hour after infusion onset was the most common timing for symptoms of adverse reactions (n = , . %). patient characteristics of those with adverse reactions: adverse reactions occurred in . % of the infusions (n = ) with the majority belonging to the - years old age group (n = , . %), with variable diagnostic categories. ten patients observed during infusions ( . %) had one or more risk factors for complications, while patients observed during infusions ( . %) had no risk factors. the commonest risk factor was administration of nephrotoxic drugs (n = , . %), followed by presence of a suspected autoimmune disorder (n = , . %) and preexisting renal insufficiency (n = , . %). using regression analysis, the predicting variables for each complication were noted .for example ,fever and chills were related to infusion rate and dose whereas the predicting variables for pallor were infusion rate and presence of existing risk factors. conclusions: clinicians should be aware of the high need for special monitoring while infusing ivig to patients with primary immunodeficiency disorders, autoimmune hematological disorders and sepsis. certain diagnosis of a primary immunodeficiency disorders (pid) is most confirmedly performed by investigation of a gene defect, allowing genetic counseling and screening. molecular diagnosis helps both parents and index pid patient by carrier detection and pre-implantation testing for selecting appropriate reproductive decisions. furthermore, for confirmation of diagnosis and establishment of the inheritance pattern genetic analysis is necessary. this survey in all pid cohorts should be considered for long-term planning such as bone marrow transplantation of a pid infant at birth. the result of this testing also is important for screening of newborns and for those in specific family or ethnic groups. the prevalence of pids has been estimated to be more than / worldwide. based on the total population of iran reported in ( , , ), the expected prevalence of pids in iran would be more than , individuals. however, because of the high rate of consanguineous marriages in iran and an increased risk for development of disorders with an autosomal recessive pattern of inheritance, this prediction is likely to be an underestimation. to date, clinically diagnosed patients of pids have been reported in iran, and a definite diagnosis, defined by mutation analysis, was made in individuals. as a result, . % of the expected pid patients have been identified, and among these, . % have been diagnosed at a molecular level. the proportion of genetically definite diagnosis varied between . and % in the different disease categories. this wide spectrum might be due to unknown underlying genetic defects or modifying genes, especially in patients with predominantly antibody deficiency. on the other hand, the latter patients also had the lowest percentage of clinically diagnosed cases. croatia is a small country with inhabitants . according to expected prevalence of pids we expected approximately four hundred patients with pid. for the past few years university hospital center zagreb is the reporting center for esid registry. it is also the national center for diagnosis and treatment of pids, including haematopoietic stem cell transplantation. current pid database is running manually, with the exception of patients reported to esid registry. most of them are of pediatric age, reffered to the hospital from all over the country. the pids patients are classified according to international classification ( iuis-international union of immunological societies ). there are pids patients included in the database at the moment. the majority of them have antibody deficiency. combined immunodeficiency and well defined syndromes appear in equal distribution. other types of pids are reported in small numbers. although no consanguinity was reported, we noticed the geografic distribution of severe combined immunodeficiency patients (scid) mostly in regions, istra and podravina. it can be explained with genetic isolation. the establishment of national online pid registry is in process. the aim is to improve the diagnosis od pid specially in adult patients, who are not included in present database, with exception of the patients diagnosed in childhood. primary immunodeficiency disorders are underdiagnosed in croatia, specially in adults. establishing national pid registry will improve the physicians awareness of pids, which is particularly important for adult patients. we expected the number of diagnosed pid patients will rise. this will give the opportunity to make progress in diagnosis and treatment, and the opportunity for further epidemiological and clinical studies. another patients have well defined immunodeficiency syndromes from which: are with di george anomaly; with wiskott-aldrich syndrome; with ataxia-teleangiectasia; with hyper ige syndrome; with schimke syndrome and are with nijmegen breakage syndrome. in early nineties, two ( ) of our patients had chronic mucocutaneus candidiasis. patients are registered as x-linked scid and with xlinked lymphoproliferative syndrome (xlp). patient has chronic granulomatous disease; have severe congenital neutropenia and have hereditary angioedema. patients are with whim syndrome. patients are with anti-inflammatory disorders: has hyper ig d syndrome (hids) and have familial mediterranean fever. the j-project realization in the republic of kazakhstan allows to update the pid problem, to raise the availability of early diagnosis of pid, to improve the life quality of patients with pid by providing substitution therapy and as a result, the infant mortality and disability rate has been reduced. common variable immunodeficiency (cvid) is the most common primary immunodeficiency (pid) characterised by impaired immunglobulin production and immune dysregulation. chronic and recurrent infections and its results are typical manifestation of this disease. in addition there is a higher risk of autoimmune disorders, lymphoproliferative or granulomatous diseases and malignancies. successful management of cvid patients is based on prevention and consistent therapy of infections with sufficient immunoglobulin replacement and/or antibiotics, prevention and active screening of cvid related complications. in our study we analysed data of patients gained from medical records. these data were also input into czech pid registry and pid registry organized by esid (european organisation for immunodeficiency). we aimed at the period before diagnosis-onset of the symptoms and their characters and the course of the disease-effect of therapy, occurence of the related complications. finally, we compared our data with similar performed studies. chronic and recurrent upper and lower respiratory infections were the most frequent first manifestation of our cvid patients, but developed chronic lung disease or autoimmune disorder as well. in all patients the intravenous or subcutaneous imunoglobulin replacement therapy, eventually combined therapy with antibiotic prophylaxis, was initiated. beside chronic lung disease the most common complications were autoimmunity disorders, especially autoimmune thyroiditis, evans syndrome, trombocytopenia (itp), autoimmune hemolytic anemia (aiha). on the contrary we revealed patients with insuline dependent (type ) diabetes mellitus and cvid. only few case reports have been published with such association. successful management of cvid patients is based on a prevention and a consistent treatment of infections with sufficient immunoglobulin replcement and/or antibiotic therapy, a prevention and an active screening of cvid related complications. such approach can significantly improve the prognosis of cvid patients and the quality of their life. laura zilinskaite ; ieva bajoriuniene , ; raimundas sakalauskas ; brigita sitkauskiene , department of pulmonology and immunology, lithuanian university of health sciences, kaunas, lithuania. background. primary immunodeficiency (pid) is considered to be a rare disease. despite that it is thought that six million people may be living with a pid worldwide. in the hospital of lithuanian university of health sciences (hluhs) patients with suspected immune disorders have been diagnosed and treated since . we aimed to review the structure of pid diagnosed and treated in hluhs during the last five years. methods. data about patients with pid consulted in the hluhs was collected from the department of medical statistics. case histories of these patients were revised and patients' data was collected: onset of symptoms, type and duration of disorder, type of treatment. all patients with pid were divided into several groups according to the classification of international union of immunological societies primary immunodeficiency diseases classification committee ( ). results. there were patients with pid diagnosed in the centre. antibody deficiency was diagnosed for patients: -bruton's disease, common variable immunodeficiency (cvid) and selective immunoglobulin (ig) a deficiency. complement deficiencies were diagnosed for patients: -c esterase inhibitor deficiency and -c deficiency. another well-defined syndrome with immunodeficiency was found in six patients. the most prevalent symptom in patients with predominant igg deficiency was recurrent pneumonias which occurred at the age . ± . yrs. the mean time between the onset of symptoms and confirmation of the diagnosis was . ± . yrs. thirteen patients are on the replacement therapy with intravenous immunoglobulin. these patients had - infections/year before the treatment initiation and only - infections/year during the treatment. •pid center has successful sideproject as regional charitable public organization of invalids "society of patients with primary immunodeficiency diseases in st. petersburg" solovushka (nightingale) "". web site for patients (www.opidspb.ru) was opened due to mutual efforts of pid center staff and patients. pid center laboratory is based on spb pasteur institute central clinical diagnostics laboratory and laboratory of molecular immunology and seroepidemiology. main groups of tests perform for pid patients are: general clinical assays; flow cytometry ( -color assay on facs canto ii); humoral factors assays (ig levels, igg subclasses, post-vaccination igg levels, etc.); burst-test on flow cytometer; genetic analysis of btk, rag , rag ,was, cybb genes. despite of relatively short story of spb pid center it has a variety of completely diagnosted and successfully cured cases of pid including agammaglobulinemia with b-cell in identical siblings, wiskott-aldrich syndrome, chronic granulomatous disease (cgd), etc. introduction: the primary immunodeficiency diseases are a group of disorders caused by basic defects in immune function that are intrinsic to, or inherent in, the cells and proteins of the immune system. there are more than primary immunodeficiency diseases.. laboratory studies are necessary to determine the presence of a primary immunodeficiency diseases. the standard screening tests for antibody deficiency starts with measurement of immunoglobulin levels in the blood serum. these consist of igg, iga and igm levels. the results must be compared to agematched controls. additional studies used to evaluate patients with antibody deficiencies include measuring the different types of lymphocytes in the blood by marking those cells with molecules that can identify the different types. a commonly used test is called flow cytometry that can identify b-cells and t cells present in the circulation. methods: in in our laboratory of immunology is created the sector of examination for the pid and we measure the immunoglobulin levels with a beckman coulter immage immunochemistry system fully automated rate turbidometry and rate nephelometry method. we have determine the aged-matched levels of immunoglobulins in our laboratory. we have install also a new flow cytometer of beckman coulter company and we can determine the b cells by cd marker and t cell with cd , cd and cd marker. this examinations has been of great help in diagnosis of primary immunodeficiencies. results: in years - from the examination of children aged from - years old reported in our laboratory for immunological examination from the pediatric department of uhc mother teresa in tirana we have selected cases with disorders regarding the primary immune deficiencies. we have cases ( cases reported in - and new cases ) with nul b cell in cytoflorometry (b cd cell = %). the level of immunoglobulins was indetectable for igg , iga and igm in the moment of diagnosis. they were boys and the age at diagnosis was and years and actually they are and years treated with ivig. we have classified them as bruton (xla). we have case with low cd b-cell in circulation but only in of them we have done the immunoglobulin level. the low level of cd b cell is accompanied with different kind of hypoglobulinemies: common variable immunodeficiency cvid, with isolated iga deficiency, with igg deficiency and with both igg + igm deficiency. the immunoglobulins disorders : we have classified them according the antibody deficiencies (tab ) and we noted that the most frequent one is the deficiency of iga ( / or . % -from which iga isolated, accompanied with low igm and with low igg ) with average age at diagnosis . years old. in children in the first years of live aged from . to years old we found case with transient hypogammaglobulinemia of infancy. according this survey we can report our cases of primary immunodefiecies in uhc mother teresa of tirana with different classification conclusion: the finding are to be completed with other cases in albania and it is necessary to do the national register for pid in order to estimate exactly the prevalence of this disorders in our country. nyíregyháza-debrecen, hungary the stat mutation was confirmed in as the cause of autosomal dominant hyper-ige syndrome (ad-hies). the disease, which also mentioned in the literature as job's syndrome, is a rare primary immunodeficiency. this disease can be characterized by the following classic triad: recurrent purulent skin infections, cold abscessus which are formed in the ground of chronic ekcematoid dermatitis, pneumatocele, formation causing pneumonia and extremely high ige level. dental training interdependency as well as bone and connective tissue disorders frequently occur in the nonimmunological symptoms as multi-systemic disease. the stat protein has an important role in the area of wound healing, immunity, tumor and neovascularization. we would like to show this in case of -years old kitti whom the perinatal medical history was eventless. there is a frequent hospitalization in kitti's case history since her infancy. due to the age of three months because of serious exsiccotoxicosis, months old bilateral bronchopneumonia and pleurisy required icu care. bronchoscopy was made because of recurrent pneumonia, which excluded the bronchial malformation. lately rather otitis, mastoiditis and airway obstructive symptoms dominated the clinical picture. from serum immunoglobulins-igg is very low, whereas high levels of igewas indicated. on this basis, the diagnosis of job's syndrome was up, which is a negative stat mutations as the molecular genetic test performed demonstrated. the disease has a great clinical importance, since the risk of emergence of serious and often life-threatining complications are high. because of the prevention of disseminated infections, the early detection and the appropriate treatment are essential. in default of causal therapy, the treatment primarily concern to prevention of infections, or their aggressive antibiotic therapy. calcium and vitamin d and as well as histamine on the case of itchy skin symptoms are reccurrended to use. laboratory of molecular immunogenetics, human genetics institute, cnrs and university montpellier , montpellier, france. we performed clinical, immunological and genetic studies of hyper-ige syndrome (hies) patients from hungarian, lebanese, one russian, one polish, and one swedish families with autosomal dominant (ad) or sporadic forms of the disease to reveal cross-ethnicity of recurrent and novel mutations in the signal transducer and activator of transcription- gene (stat ). four patients from hungarian families, and one russian, and one swedish patient carried the heterozygous r w germline mutation at the dna-binding site of stat . the recurrent v m mutation affecting the src homology (sh ) domain was detected in one lebanese and one polish family, and the v del deletion located in the dna-binding domain was unveiled in another lebanese family. a novel h y mutation affecting the dna-binding site of stat in three hungarian patients from a gypsy family was also found. the segregation of this mutation with hies, restriction fragment length polymorphism analysis of stat from patients and controls and the negligible production upon il- stimulation of monocyte chemotactic protein- by the patient's blood mononuclear cells suggested that the h y mutation was disease-causing. these data suggest, that dominant negative mutations of the dna-binding and sh domains of stat cause ad and sporadic cases of hies in different ethnic groups with r w as the predominant mutation found in of the families. functional and genetic data support that the novel h y mutation may result in the loss of function of stat and leads to the hies phenotype. published in molecular immunology. : - . males with an expressed mutation in the sap (signaling lymphocyte activating molecule [slam]-associed protein) gene have an x-linked syndrome characterized by an increased vulnerability to infection with epstein-barr virus (ebv). we evaluated two related male patients with fatal infectious mononucleosis (fim) and mutation in the sap gene. sequence analysis revealed hemizygous g to a transition at nucleotide position in exon in one of the patients, and heterozygosity for this mutation in the genomic dna from his mother and maternal grandmother. this mutation resulted in asparagine instead of glycine in the sequence of the sap protein at amino acid position . to analyse the effect of this missense mutation on protein function cdna was generated by site-directed mutagenesis and cloned in pcmv-flag vector. we found that the mutant sap (sap/g d) protein was defective in protein folding as manifested by the reduced half-life compared to that of wild type sap. furthermore, the sap/g d protein was defective in binding to its philological ligands slam and b . these results suggest that defects in protein folding and ligand binding collectively contribute to the loss of function of the sap protein in patients carrying g d mutation. dedicator of cytokinesis (dock ) deficiency is an innate error of adaptive immunity characterized by recurrent viral, bacterial and fungal infections, very high serum ige concentration and a progressive deterioration of t-and b cell-mediated immunity. traditional sanger sequencing may fail to identify mutations in dock , due to overlapping large deletions in heterozygous patients. we studied the genetic and immunological features of two sisters ( and years of age) born to healthy hungarian parents. mutational analysis of genomic dna and cdna from the patients and parents by a combination of pcr and bidirectional targeted sequencing failed to identify the mutation. however, a multiple ligation-dependent probe amplification (mlpa) assay revealed two previously unknown large deletions, del - exons and del - exons, of dock in both patients. the children's mother was heterozygous for the del - exons mutation, whereas the father carried the del - exons deletion. immunoblot analysis showed an absence of dock protein from the peripheral blood lymphocytes of both patients. these data suggest that the new compound heterozygous del - exons and del - exons mutations result in a loss of dock protein function and a typical dock deficiency phenotype. our findings suggest that traditional sequencing technology may give misleading results in such cases and that mlpa may be indispensible for the definition of the large deletions frequently observed in patients with dock deficiency. we describe here a patient with invasive cryptococcus laurentii infection and the x-linked form of hyper-igm syndrome (x-higm). c.laurentii is an extremely rare human pathogen. this fungus was previously considered saprophytic and non-pathogenic to humans, but it has been isolated as the etiologic agent of skin infection, keratitis, endophthalmitis, lung abscess, peritonitis, meningitis, and fungemia. most affected individuals had a compromised immune system because of leukemia, cancer, diabetes mellitus, aids, or prematurity. repeated isolation of c.laurentii from the oropharynx of an immunocompromised patient has also been docu- the wiskott-aldrich syndrome (was) is an x-linked recessive immune deficiency disorder characterized by thrombocytopenia, small platelet size, eczema, recurrent infections, and increased risk of autoimmune disorders and malignancies. was is caused by mutations in the wasp gene which encodes wasp, a -amino acid protein. wasp plays a critical role in actin cytoskeleton organization and signalling, and functions of immune cells. we present here the results of genetic analysis of patients with was from eleven eastern and central european (ece) countries and turkey. clinical and haematological information of affected males and carrier females from was families were collected. the wasp gene was sequenced from genomic dna of patients with was, as well as their family members to identify carriers. in this large cohort, we identified unique mutations including novel sequence variants. the mutations were scattered throughout the wasp gene and included single base pair changes ( missense and nonsense mutations), small insertions, deletions, and splice site defects. genetic counselling and prenatal diagnosis were applied in four affected families. introduction: mhc-class ii deficiency is an autosomal recessively inherited combined immunodeficiency disorder characterized by less than % expression of hla-dr on b cells or monocytes. it is caused by mutation of genes (ciita, rfxank, rfx , rfxap) regulating transcription factors which controls expression of mhc-class-ii molecules on cell surface. mhc-class ii molecules are expressed on thymic epithelial cells, antigen presenting cells (b lymphocytes, dendritic cells, monocytes and macrophages) and activated t cells. these molecules are of critical importance to immunity, cd + t cell development, antibody production, tolerance induction and inlammatory response. consequently, patients present with clinical findings related to combined immunodeficiency during infancy. material and methods: medical records of thirteen patients with mhc-class ii deficiency, followed-up in ankara university, medical school, division of pediatric immunology/allergy from to , were evaluated retrospectively. findings: during study period, male and female patients were diagnosed with mhc-class ii deficiency. age of diagnosis were between months and years of age. consanguinity were present in eleven out of thirteen patients. most frequent clinical findings during initial diagnosis were failure to thrive, pneumonia and oral moniliasis. lymphopenia was absent in all of the patients, however, low serum igg level was present in all of them. except for the yo female patient with a positive family history and whose hla-dr expression was , %, hla-dr expression was % in the rest of the patients. eight patients underwent hematopoietic stem cell transplantation (hsct). two patients were lost soon after hsct due to complications and three patients died of opportunistic infections. four patients died of severe opportunistic infections without underwent hsct. results: mhc-class ii deficiency is a combined immunodeficiency and not considered a rare disease in our country. to date, only known treatment is hsct. since it has poor prognosis, hsct should be performed before development of chronic viral infections and sequelae related to infections in patients who have hla-matched sibling. fatih celmeli ; giancarlo la marca ; ines santisteban ; michael s. hershfield purine nucleoside phosphorylase deficiency (pnp deficiency) is a rare autosomal recessively inherited type of immunodeficiency. pnp deficiency constitutes about to percent of all combined immunodeficiencies. it is characterized by progressive combined immunodeficiency and neurologic findings which includes ataxia, developmental delay, and spasticity. the immunodeficiency is progressive, with normal immune functions at birth, but severe t cell deficiency with variable b cell functions presented by the age of years . the only curative treatment is the hematopoietic stem cell transplantation (hsct). here, we present a year-old girl with recurrent respiratory tract infections, short stature and spastic paraplegia. immunological, biochemically and genetics investigation revealed pnp deficiency with a t mutation in pnp gene. case report: a years-old girl was referred to our pediatric immunology clinic for recurrent sinopulmonary infections since year of age. she was full term neonate and her parents were not consanguineous. she had a history of prolonged and resistant bronchopneumonia, and an attack of generalized chickenpox complicated with pneumonia. she had also severe zona infection resolved with ulceration in cornea, one year ago. she has been suffering from frequent infections like chronic sinusitis, oral moniliasis, recurrent pneumonia and sclerosing cholangitis. she has also nonprogressive cerebral palsy, spastic paraplegia, behavioral problems and limited motor and mental retardation. there was no family history of recurrent infections or immunological disorders. on her physical examination, there was failure to thrive, (her weight and height < rd p) oral moniliasis, bilateral crepitus ralls, and splenomegaly. she has also marked spasticity with brisk reflexes in lower extremities. laboratory tests revealed lymphopenia: hemoglobin g/dl and platelets /mm wbc /mm , absolute lymphocyte /mm . the laboratory results are shown in the table. lymphocyte proliferation is lower than normal limits in response to pha stimulation (wst assay). ppd response and hiv was negative. antihbs, and antihav were negative despite vaccination. uric acid level , mg/dl. direct coombs was negative, thyroid autoantibodies were within normal limits. genetic analysis revealed homozygous missense mutation (c. g > a), which causes the a t amino acid substitution in pnp gene, in exon , which has previously been reported. additionally, a homozygous g/a polymorphic site in ivs has been detected (c. + g (ivs + g)). discussion: pnp deficiency is caused by mutations in the pnp gene at q . . this gene encodes the protein purine nucleoside phosphorylase, one of the enzymes involved in the purine salvage pathway. adenosine deaminase (ada) deaminates adenosine to yield inosine, which is then converted to hypoxanthine by pnp. pnp also converts guanosine to guanine. a number of metabolites are elevated in the plasma and urine in pnp deficiency, including deoxyguanosine and deoxyinosine. there is an intracellular accumulation of their deoxy triphosphate compounds, particularly deoxyguanosine triphosphate (dgtp). the latter is toxic to t cells, a property similar to deoxyadenosine triphosphate in adenosine deaminase deficiency. in this report, we demonstrate the clinical characteristic of the patient with late diagnosis of pnp deficiency. pnp mutations likely lead to an intense alteration of the enzyme activity which in turn, cause severe and early onset of the clinical findings. however, in our case, the clinical onset of the disease is quite late (after years) which can be explained by the residual activity of the pnp. in conclusion patients with pnp deficiency can be late onset. additionally, late diagnosis of this patient can cause severe comorbidity which limits the chance of bone marrow transplantation. di george syndrome, a disorder caused by a defect in chromosome ( q . deletion), results in the poor development of several body systems. clinical features include congenital heart defects, hypoparathyroidism and thymic hypoplasia or aplasia leading to t-cell immunodeficiency. the aim of our study is to screen and determine the incidence of di george syndrome within only one tube of blood in children with congenital heart anomalies in our population. children who were found to have a cardiac defect during routine visits in pediatric cardiology and neonatalogy departments were included into the study. cases with known genetic syndromes and newborns younger than gestational weeks of age and small for gestational age (birth weight < gr) were excluded. a total of patients were included. there were ( %) males and ( %) females. age ranged between - months ( . ± . months). parental consanguinity was % (n = ) in the study group. the majority of patients diagnosed after murmur was heard during the routine physical examination (n = , %). five patients ( %) diagnosed antenatally. remaining clinical signs on admission were as follows; respiratory distress (n = , %), tachycardia (n = , %) and central cyanosis (n = , %). echocardiagorafic examinations revealed ventricular septal defect (vsd) (n = ), tetralogy of fallot (tof) (n = ), vsd-asd (n = ), aortic coarctation (n = ), double outlet right venticle (dorv) (n = ), transposition of the great arteries (n = ), truncus arteriosus (n = ) and pulmonary atresia (n = ). pulmonary stenosis, endocardial cushion defects, total pulmonary venous return anomaly and hypoplastic left heart were the other defects. q . deletion was ascertained in ( . %) patients; these patients were diagnosed to have tof ( . %), truncus arteriosus ( . %), dorv ( . %), vsd ( . %) and vsd-asd ( . %). preliminary results of the study showed that the frequency of q . deletion is % in patients with known cardiac defects. single tube of blood is enough for flow cytometric and genetic analyses. further studies involving higher number of patients is mandatory to give sufficient information about the exact incidence of the disease. di george syndrome -where do we stand now? małgorzata pac; małgorzata skomska; ewa bernatowska department of immunology, the children's memorial health institute, warsaw, poland di george syndrome (dgs) classically comprises t-cell deficiency (due to thymic hypoplasia), hypoparathyroidism, cardiac malformations,and facial abnormalities. deletions of the long arm of chromosome at position q. are most commonly associated with dgs. syndrome is also found associated with other genetic abnormalities ( p deletions, char ge), certain teratogenic influences (retinoid acid, foetal alcoholic syndrome, maternal diabetes). the dgs phenotype is very heterogenous with variable expression of the different features including the immunodeficiency. the initial treatment emphasis is to control the hypoparathyroidism. correction of congenital heart defects (if present) is usually needed. the best treatment of the immune defects of dgs is still controversial. both hsct and transplant with fetal thymus are the option for complete dgs (cdgs). long term survival after hsct has been reported, though at a lower rate ( - %) compared to survival after hsct for scid. survival in the subgroup receiving matched sibling donor transplants was better at over %. the use of post natal human thymus was pioneered by markert at duke university and has become established as the treatment of choice for cdgs, with the result of out of treated patients survived ( %). more recently this approach has also been used in london, at gosh. . under care of cmhi there are patients fulfilling esid criteria, girls ( . %) and boys ( . %), age / - y.o. in % of them q deletion in locus d s was found. the vast majority children were diagnosed as partial dgs. none of them had significant hypogammaglobulinemia and no regular ivig therapy or antibiotic prophylaxis were required.. the mean number and percentage of cd , cd and cd lymphocytes as well as lymphoproliferative answer to pha and cd in dgs patients were slightly diminished. in many improvement of cellular immunity was observed with age. about % presented with congenital heart disease, requiring surgery, while almost % had the symptoms of hypocalcemia and hypoparathyroidism, next % -speech and learning difficulties. one child was diagnosed as cdgs. scid is a rare, inherited condition, is caused by numerous molecular defects that lead to severe compromise in the number and function of t cells, b cells, and occasionally natural killer cells. seventeen patents with scid were registered during the period from till in the children's clinical university hospital. medical charts of these patients have been reviewed. there were boys and girls. positive family history was in families. mean age at the onset of symptoms and scid diagnosis was . ± . and . ± . months, respectively. pneumonia ( %), candidacies ( %), bcg infection ( %), diarrhea ( %) were the most important infections. anemia and relative lymphopenia were in % cases , growth retardation, hypotrophy had % children . pathogens such as candida albicans ( ), mycobacterium tuberculosis complex ( ), cmv ( ) and others have been identified. totally patients died.two girls are alive ( and months post-transplant). autopsy was done in patients. we saw different changes in thymus and lymphatic nodes. artemis deficiency (n = ), t-b-scid (n = ), t-b + scid (n = ), γc deficiency (n = mutation r w in γ-chain of receptor for il- ), unspecified scid (n = ) were detected. conclusion: generalized bcg infection had % of our scid patients. (incidence of tb is still high . / population in latvia and newborns obligatory are vaccinated on the second to fifth day of life). due to possibility of absence for pid routine genetic identification in only few scid forms were identified precisely. children's hospital, university of freiburg, freiburg, germany. purpose: ipex (immunodysregulation, polyendocrinopathy, enteropathy, x-linked) is a rare x-linked recessive life-threatening disorder characterized by autoimmunity and early death. pulmonary complication related with ipex has not elucidated exactly. here, we report i.e. patients, of which died from severe pulmonary disease. methods: clinical data and laboratory findings included autoantibodies, immunoglobulin levels as well as number of t, b and nk cells were evaluated. foxp expression was performed by flow cytometry. genomic dna was isolated and all exons and exon-intron boundaries of the foxp gene were sequenced by sanger sequencing. results: patient i (pi) presented with nephrotic syndrome at years of age and then developed autoimmune hepatitis without eczema, enteropathy or high ige and died at years of age due to acute respiratory distress syndrome (ards). two cousins of pi had the same hypomorphic splice site mutation leading to normal foxp protein expression and suppressive capacity. however, they exhibited typical symptoms such as eczema, diabetes and enteropathy with eosinophilia at early age (pii, piii) and were transplanted in infancy. one of them had severe respiratory distress right after birth (piii). patient iv from another family presented with chronic diarrhea without autoimmune manifestations and died due to ards. conclusion: lung disease related to ipex syndrome has not been reported before and this entity could be a critical factor in disease outcome. severe combined immunodeficiencies (scids) are a group of primary immunodeficiencies that comprise a number of monogenic disorders characterized by a block in t cell differentiation with or without impairment of b cell and natural killer (nk) cells. without early diagnosis and treatment most children die in the first year of life. a lack or very low number of t-cell receptor excision circle (trec) detected by realtime quantitative polymerase chain reaction assay (qpcr) is consistent with t-cell lymphopenia and has repeatedly demonstrated clinical validity in population based newborn screening for scid. however, the impact of population screening will be less in communities with high consanguinity and family history of scid, in which targeted screening may be more appropriate. here, we screened high risk neonates and infants (with one or more of the following: clinical presentation and/or family history suggestive of pid, failure to thrive otherwise unexplained, lymphopenia) at cairo university hospitals. their full history and clinical examination were recorded. immunoglobulin profile and immunophenotyping of peripheral lymphocytes were performed as confirmatory tests. sixteen classical scid cases were detected, as well as another scid variants (omenn syndrome and major histocompatibility complex class ii deficiency) (totally . % of all subjects screened). the rate of consanguinity in this group was . %. secondary causes of low trecs, other than scid, in our series included: bacterial septicemia ( preterm, full-term), prematurity ( cases), one preterm with omphalocele and facial dysmorphism, one preterm with congenital adrenal hyperplasia, one full term with microvillus inclusion disease, and one full term with idiopathic tcell lymphopenia. this demonstrates that in populations with high consanguinity rates, as in egypt, targeted (non-population based) trecs assay may provide a more efficient screening strategy. case : a is a years old female, st kid of non consanguineous marriage presented with fever for months. one week after the onset of the fever red patches appeared on the face, hands, abdomen, ll. mother sought medical advice and received antibiotics, antipyretics and oral steroids for about one month with no signs of improvements regarding fever. one week later the mother noticed pallor and sought medical advice and the baby was admitted to local hospital and received one bag of blood. and then she was referred to our hospital (zagazig university hospital) where she developed acute pallor again which needed recurrent blood transfusions. dark colored urine occurred in frequent attacks with abdominal enlargement and pain, and interestingly upto this time, no improvement regarding fever, bone pain or pallor. on examination she was underbuilt (all parameters are under rd centile), pallor, tinge of jaundice, generalized skin pigmentation, generalized lymphadenopathy, nd degree clubbing and hsm investigations: cbc (pancytopenia with reticulocytopenia) -lft (increased ast with indirect hyperbilirubinemia)-kft (normal)-ldh (highly elevated u/l)-esr ( ) -fibrinogen ( . gm/ l)serum triglycerides ( . mg/dl)-ebv-vcm igm positive and igg negative -c ( . normal) -rf and ana(-ve) -serum ferritin ( ng/ml) -cd is low -bone marrow biobsy revealed dysplastic changes -l.n. biopsy revealed non specific inflammatory changes. treatment: hlh protocol with no sct prognosis: patient passed initial phase with complete resolution and waiting for bmt case : m is months old boy, nd kid of non consanguineous marriage (the st is healthy years old female) presented with fever and difficult breathing since the age of months. the fever was of gradual onset stationary course and not responding to treatment with antipyretics and antibiotics. one week later the mother noticed abdominal enlargement with red rash over the abdomen that was associated with pallor but there was no evidence of bleeding from any site, no change in the color of urine, no jaundice, no ecchymosis, no joint swelling then he is referred to our hospital (zagazig university hospital). this boy is delivered by nvd at term with no evidence of any problem either during pregnancy or delivery, he is exclusively breast fed and vaccinated as scheduled. examination: his weight was kg, length cm, and head circumference cm all are average for age, he was pale with no jaundice or cyanosis he had hsm and other systemic examination was quite well. children with pid usually are admitting to the hospitals and intensive care units of infants' pathology regional children clinical hospital № , but at a later date, in serious condition, after the development of clinical manifestations in the form of severe generalized infectious disease, or various complications including hematological. the screening technology approves children to be diagnosed in newborn period and to be observing by immunologist and hematologist for the next preventative therapy and bone marrow transplantation or hematopoietic stem cell transplantation. costs for the differential diagnosis and verification of the diagnosis before the manifestation and complications development of pid - usd. costs for the differential diagnosis and verification of diagnosis after manifestation and complications development of pid would be usd in months. economic loss prevention in pid - usd. economic loss prevention in t -lymphopenia - usd. we also should include into account the contribution to the state's economy, which will later be obtained, due to the presence of a healthy member of society. at is an autosomal recessive multisystem disorder characterized by progressive cerebellar ataxia, telangiectasia and increased susceptibility to infections and malignancies, particularly lymphomas and leukemia. laboratory immune investigations typically show decreased peripheral tcells, particularly of naïve t cells, with abnormal in vitro response to mitogens. most at patients have decreased serum iga and igg subclass concentrations. while about % of patients with at show raised serum igm concentrations during the course of the disease, it is unusual to find a high level of igm at onset. as cerebellar ataxia and oculocutaneous telangiectasia are not present at very young age, these patients are often erroneously diagnosed as hyper igm syndrome (higm). to prevent mistaking a-t patients for higm it is proposed to add dna repair disorders as a possible cause of higm. . diagnosis of at, suggested by elevated alfa-feto-protein and increased sensitivity of patients' cells to irradiation, can be confirmed by identifying a mutation in the atm gene.we report female case of at that with diagnosis of hyper igm received ivig but later they had manifestation of ataxia in the course of their disease and then had telangiectasia of conjunctiva. first case was a yrs girl that was suffered from itp and granulomatosis lesion of skin associated with hyper igm before at diagnosis. second case was a years old girl with microcephaly, sever ftt , neurodevelopmental delay , abnormal faces and hypo and hyperpigmentation lesions and anemia. with respect to these manifestation and increased afp ,nijmegan breakage syndrome was suggested. third case was suffered from hyperigm before a t diagnosis for years. we present a patient with a dock deficiency. mutations in the dedicator of cytokinesis gene (dock ) cause a combined primary immunodeficiency syndrome that is characterized by elevated serum ige levels, depressed igm levels, eosinophilia, sinopulmonary infections, cutaneous viral infections, and lymphopenia. onset of the disease was observed at -month of age with severe eczema and recurrent respiratory infections (pneumonia, bronchitis, otitis). at years of age neuroblastoma was diagnosed. from the age of years he started with severe skin infection , subsequently recurrent mucocutaneous aspergillosis was established based on skin biopsy and bacteriological studies. immunological investigations revealed persistent leukocytosis, hypereosinophilia, low level of igm and increased ige up to iu/ml. so hyper ige syndrome was diagnosed and genetically confirmed when a large deletion of the dock -gene was identified. stem cell transplantation was performed in when the patient was y.o. one year later progressive multifocal leukoencephalopathy secondary to infection by polyomavirus jc was diagnosed. but after immunosuppressive therapy with cyclosporine awas suspended our patient's condition improved: the load of polyomavirus jc on plasma showed a decrease; mri brain was essentially stable ; immunological tests showed an initial improvement of subpopulations and proliferative response to mitogens; donor chimerism % stable. Özdemir Öner ; bozdoğan sıla department of pediatrics, division of allergy/immunology, sakarya university, medical faculty, adapazarı, türkiye. background: bronchiolitis and infantile asthma are the most frequent causes for typical wheezing signs in infants. however, when a physician comes across patients with recurrent wheezing are resistant to β -agonist and anti-cholinergic therapy, known as atypical wheezing cases; he should investigate for hypogammaglobulinemia in these patients. aim: here, three cases are reported to make pediatricians aware of hypogammaglobulinemia, which is one of the reasons causing recurrent and persistent wheezing attacks during infancy and beyond. case presentations: case : month-old girl presented to us with complaining of coughing and persistent wheezing. she has been having wheezing and breathing difficulty for the last months after she got upper respiratory tract infection. her symptoms persisted even though she was using religiously nebulized salbutamol + budesonid therapy. before this episode, she had had other wheezing attacks in her past medical history beginning from months of age. in her family history, her father has asthma. physical examination revealed her breathing difficulty. ronchi as well as rales were heard on the auscultation of her lungs. at the fourth day of admission, she was given ivig mg/kg/dose. later, her symptoms did improve and not recur for the last months. laboratory findings showed normal routine biochemistry, complete blood count and sedimentation rate. chest x-ray showed normal findings. echography was normal. ph-metry for reflux investigation was normal. sweat test was normal. in the serological evaluation: low igg level for his age ( mg/dl) was detected at two different times. igg subgroups, igm ( mg/ dl), iga ( mg/dl) and ige ( ) levels were within normal. case : -month-old girl came to our outpatient clinic with complaints of coughing and wheezing. at months of age, she had urinary and upper respiratory tract infections. despite antibiotic therapy, wheezing persisted for months and wheezing severity increased and it did not respond to β -agonist therapy. thereafter, she was admitted to the hospital for days and symptoms resolved. however, she came back to hospital due to recurrence of her symptoms in days. in her family history, grandmother and her cousins have asthma. physical examination showed breathing difficulty. ronchi as well as rales were heard on her lungs. although salbutamol, ipratropium, antibiotherapy (clarithromycin) and anti-reflux therapies were given, her symptoms did not improve for weeks. at the th day of admission, she was given ivig mg/kg/dose. later, her respiratory system symptoms did not recur for the last several months. once she was evaluated for persistent wheezing attacks during admission, biochemistry, cbc, esr were normal. chest x-ray and echography were normal. in serological evaluation: low igg level for his age ( mg/dl) was detected at two different times. igg subgroups, igm ( mg/dl), iga ( mg/dl) and ige (< ) levels were normal. case : month-old boy was brought to us complaints of having frequent lower respiratory tract infections (bronchiolitis). he was experiencing recurrent wheezing attacks almost every other week for the last months. in past medical history, he was diagnosed with trisomy and hypothyroidism at the months of age. he went thru an operation for atrio-venticular septal defect. physical exam revealed dyspnea, tachypnea and wheezing. crackles were heard on the chest auscultation. abdominal, cardio-vascular and the rest of the examination were normal. when he was evaluated for frequent wheezing attacks in our outpatient clinic, routine biochemistry, cbc and esr were normal. chest x-ray showed normal findings. in serological evaluation: low igg level for his age ( mg/dl) was detected twice. igg subgroups, igm, iga and ige levels were within normal. he was given ivig mg/kg/dose. for the last three months, he did not have any lower respiratory tract infection. conclusion: the awareness of immunodeficiency among pediatricians has been greatly improved. recurrent respiratory tract infections are major infections in these patients. thi is a relatively common condition associated with infant hypogammaglobulinemia. in patients with recurrent and/or persistent wheezing symptoms during infancy and beyond, especially resistant to therapy, hypogammaglobulinemia should be excluded from possible diagnoses. background: the acquisition of new food allergy after transplantation or transplant-acquired food allergy (tafa) is usually reported in adults and rarely in children. tafa is described mainly after liver, but also after small bowel/intestinal, lung and heart transplantations. in different studies, the male/female ratio is equal. literature data suggest that children with tafa typically present within the first year after surgery and they are typically allergic to multiple foods. aim: tafa is generally characterized with allergy to multiple foods and increased level of total and/or spesific ige. here, a patient although who had normal total. ige and specific ige test results, he developed reaction to skin prick test for cow's milk is presented and his clinical presentation will be discussed. case presentation: month-old-boy came to our allergy clinic with complaints of vomiting after drinking cow's milk and skin rush on the area where contact ed with chocolate. in his past medical histroy, left lateral segment of liver (donor was his mother) was transplanted to him when he was at months. the liver donor was not recorded as having a history of allergic disease. methylprednisolone and tacrolimus immunosuppression were used after the transplantation, and tacrolimus therapy was continued for prophylaxis of chronic rejection. when he was at months, family fed the patient with cow's milk but hours later he began to vomit. he vomited five times in two hours. then, he developed constipation. rectal irrigation was used. then oral intake stopped for two days. he was thought to be having food protein induced enterocolitis. his vomiting complaints repeated after intake of formula and baby food which include grain. so he fed with special formula including short-chain peptides and free aminoacids and his symptoms improved. past medical history: extrahepatic biliary atresia was diagnosed at weeks age with conjugated hyperbilirubinemia (according to scintigraphy and biopsy results). family history: his father has penicillin allergy and his aunt has asthma. at our outpatient clinic: height and weight were within normal percentiles. physical examination reevaled normal examination findings. laboratory findings: wbc was . /mm , with % neutrophils, % eosinophils and % lymphocytes. his hemoglobin was . g/ dl , platelet count was . /mm . total ige : < and immunocap specific ige against milk, grain and other classsic foods was < . . skin prick test results: saline: x mm, histamine x mm, fresh cow's milk: x mm, other food allergens (peanut, egg, fish, soybean, wheat): x mm. conclusion: our patient seemed to have cow's milk allergy related to liver transplantation. laboratory investigations and clinical presentation of the patient did not look like typical ige-mediated food allergy, which is expected in tafa. patient history: years old male patient, the first pneumonia at the age of followed by times pneumonia attacks/year, otitis media and sinusitis. hospitalization due to respiratory insufficiency caused by bronchiolitis obliterans and diagnosed with hypogammaglobulinemia at the age of . no consanguinity. patient findings at diagnosis ( / ) had hepatospenomegaly, bilaterally cervical, supraclavicular axillar lap, osteoporosis, bronchiolitis obliterans organizing pneumonia, hyper igm, lower igg, iga, ige, low b-cell. no response to tetanus toxoid. İsohemagglutinin antib was ¼. cd ,cd l, aid, taci, baffr, icos gene mutation were negative. protein electrophoresis revealed polyclonal igm increase, immunofixation was no clonality. lymph node biopsy result was available paracortical expantion . cd (+) t and cd were positive. b lymphocyte distribution were normal. malignancy ruled out. no giant germinal centers. evaluation of bone marrow aspiration/ biopsy were abnormal localization of megakaryocytes, dismegakaryopoiesis, blasts in normal range. lymphocyte ratio % mostly consisting of cd + cells, cd + cells were rare, plasma cell ratio was %, amyloid negative. progression of patient, igm level and spnenomegaly were increased and patient had respiratory failure. splenectomy could not be done due to respiratory failure. than patient was treated with rituximab ( mg/kg/week). after rituximab therapy, lymph nodes and splenomegaly were ( cm), regressed and igm level decreased (from mg/dl to mg/dl), increased effort capacity. after month after rituximab therapy splenomegaly and igm level were progressed. splenoctomy was performed. pathological evaluation of the spleen malignancy ruled out. current igm level is mg/dl. conclusion: the most convinient scenerio for this patient would be a csr defect of unknown etiology presented as cvid. the recent litarature revealed genetic defects of some molecules operating in dna repair pathways such as msh , msh , msh , msh , mlh , rad , rad , nbs leading to csr abnormality and impaired antibody maturation. cvid is characterized by hypogammaglobulinemia, recurrent respiratory and gastrointestinal bacterial infections. good's syndrome(gs) is a thymoma-related immunodeficiency and characterized by hypogammaglobulinemia, decreased b cell and variable deficiencies in cell-mediated immunity. case: a -year old male patient presented with a palpable anterior chest wall mass. in , he was diagnosed with rheumatoid arthritis. laboratory showed hypogammaglobulinemia and all autoantibodies were negative. cd + , cd + , cd + cells were < %. bone marrow(bm) examination demonstrated low cd + b-lymphocyte and increase in cd + t cells. tuberculin skin test was positive. t-cell proliferative response was normal. immunizations with h.influenzae type-b and tetanus toxoid revealed no response. anti-b titer was low. taci, btk and icos mutattions were negative. ultrasonography showed hepatosplenomegaly. mild edema, mononuclear cell infiltration (suggested the early stages of extrahepatic biliary obstruction) were detected on liver biopsy. in the medical history, he had reported chronic sinusitis, otitis and bronchitis dating back to rd decade of life. at age , he underwent surgery for thymoma. in follow-up, the computed tomography showed soft tissue mass on the anterior chest wall and pathology was thymoma. discussion: frequent respiratory infections with encapsulated pathogens beginning at the age of , lack of opportunistic pathogen infections, presence of hepatosplenomegaly and rheumatoid arthritis, bm examination findings and successful management of infections with ivig therapy all indicated a diagnosis of cvid. the coexistence of cvid and thymoma has been reported in the literature. introduction: common variable immunodeficiency (cvid) is a primary immunodeficiency disorder characterized by impaired b cell differentiation with defective immunoglobulin production. it has heterogeneous clinical manifestations including recurrent infections, chronic lung disease, autoimmune disorders, gastrointestinal disease, and susceptibility to lymphoma. patients with this disorder have evidence of immune dysregulation leading to autoimmunity. autoimmune cytopenias are a more common presenting disorder in children and may be the initial manifestation of the disease. we want to present a patient presenting with autoimmunue hemolytic anemia and finally diagnosed as cvid. case: a years old, previously healthy female patient applied to emergency clinic with complaint of paleness, light headedness and yellow discoloration of her scleras. her history was not compatible with blood loss. she denied having melena, hemotochezia or hematuria. her mensturation history was also normal. her hemoglobin level was . gr/dl, reticulocyte count was % . , complete blood count was otherwise normal. direct coombs was (+++). for the differential diagnosis of immune hemolytic anemia, viral serology, ana and anti-dsdna were studied, but the results were normal. igg, igm and iga levels were lower than normal normal for her age. other causes of hypogammaglobulinemia were excluded. blood group was arh (+), blood isohemagglutinin were anti a(-) and anti b (-/ +). lymphocyte subsets were also studided. as the patient has reduced immunoglobulin levels with normal lymphocyte subset analysis, she presented after puberty and other defined immunodeficiency states were excluded, she was diagnosed as cvid and monthly immunoglobulin replacement therapy was planned. she had aseptic meningitis after her first ivig transfusion. the ivig preparation was changed with another trade and she did not have any problem during the following treatments. it has been one year since she was diagnosed and she did not have any other medical problems. conclusion: the diagnosis of cvid requires decreased igg, igm and iga levels are also reduced but are less valuable for diagnosis. ige level is checked to exclude other disorders. igg subclass determinations are indicated if antibody titers are decreased but immunoglobulin levels are near normal. hypogammaglobulinemia secondary to other disorders should be excluded. autoimmune conditions can be the presenting signs/symptoms in cvid. autoimmune hematologic disorders may precede, present at the time of diagnosis or develope during the course of cvid in approximately one-half of the patients with autoimmune problems. selective immunoglobuline deficiency is an uncommon dysgamaglobulinemia, in which immunoglobuline levels except igm level are normal. it can be primary or secondary to cancer, autoimmune diseases, gastrointestinal system diseases and immunosuppressive therapy. patients can be asymptomatic or have recurrent infections, asthma, angioedema, autoimmune diseases, celiac disease and bronchiectasis. allergic diatheses are the second commonest presentation of selective igm deficiency. in this presentation, we report a case with asthma and angioedema who has selective immunoglobuline m deficiency. a year old male patient who has been diagnosed with asthma for years with a well controlled asthma for years presented with labial angioedema. he had labial angioedema daily without antihistamines. he did not have any suspected food or drug allergy. he did not have family history of angioedema. physical examination was normal under antihistamine therapy. laboratory evaluation revealed a . % percentage of eosinophils. absolute lymphocyte count was , absolute neutrophil count was cells/mm . immunoglobuline e value was ng/ml, levels of immunoglobuline g and a were within normal limits for age. immunoglobulin m value was . mg/dl ( - ). anti a was / , anti b was ½ positive, antihbs was above mlu/ml. lymphocyte subsets were normal. because of the continuous usage of antihistamines, prick tests could not be done. levels of d was . , d was . ku a /l. thyroid functions, antitpo, c , c and c esterase inhibitor values were normal. antinuclear antibodies and antitransglutaminase lga was negative. immunoglobuline m value of his father was normal, immunoglobulin m value of his brother was . mg/dl ( - ). selective immunoglobuline deficiency is a rarely seen dysgamaglobulinemia. it was reported in children with asthma, but it was not reported in children with angioedema. it can have value in the clinical evaluation of patients with angioedema. cukurova university, department of pediatric allergy and immunology, adana, turkey a patient who is at age of years at present and who has been followed up at the our clinic with xla diagnosis presented with pain in his ankles and wrists and swelling of his right knee. he also was suffering from skin tightening of the lower extremities. his physical examination revealed arthitis of the right knee and sclerotic changes were detected in the skin. skin biopsy was performed and it revealed morphea (localized scleroderma). after the diagnosis of morphea and arthritis, ivig gm/kg and nsaid were applied. following the treatment skin findings and arthritis resolved, however approximately two months later liver enzymes were detected to be high in his routine control. liver biopsy performed to clarify the aetiology of elevated liver enzymes was reported as autoimmune hepatitis. in addition to ivig gm/kg, budenofalk mg/day was started. after months of treatment, his liver enzymes normalized. currently he is being treated with ivig monthly and ursofalk daily. patients with xla typically present with recurrent bacterial infections and it might be associated with some autoimmune diseases. there are not any reports indicating an associaton of autoimmune hepatitis and scleroderma with xla. bruton agammaglobulinemia is an inherited immunodeficiency disease caused by mutations in the gene coding for bruton tyrosine kinase (btk). the median age at the diagnosis of the antibody deficiency is about . years in turkey. here, we report a case of bruton disease presenting with recurrent cervical abscess at two months old infant. a -months-old boy was firstly hospitalized for the treatment of the right cervical abscess at days old. after the recurrence of swelling on the cervical area, the patient was referred to the admitted to hospital secondly. there was no consanguinity between parents and, his family history was unremarkable except four of the mother's cousins, died because of unknown etiology in infancy. on his physical examination, his weight, height andhead circumference were normal range by age. there were no visible tonsils. there was a palpable, mobile x cm mass on right upper cervical area. the molecular analysis of the causal gene for bruton's tyrosine kinase (btk gene) revealed the mutation in exon . this mutation g. delg (c. + del) leads to the changes of amino acid order in the protein with the subsequent changes in activity of btk (at the level of dna: substitution of glutamic acid (p.glu *) causes non-sense mutation leading to the formation of stop codon with premature end of dna transcription to cause stop codon. after initiating the intravenous immunoglobulin with antibiotics, the cervical mass was getting smaller in a short period, and had not observed again. neutropenia was improved within the months. this case is an important example to diagnose bruton disease in early life. it demonstrates that maintaining a high level of clinical suspicion is essential for the diagnosis of bruton disease in a child with recurrent cervical masses. elif azarsiz; neslihan edeer karaca; guzide aksu; necil kutukculer ege university faculty of medicine, department of pediatric immunology, izmir, turkey transient hypogammaglobulinemia of infancy (thi) is characterized by recurrent infections and reduced serum immunoglobulin levels. typically, thi patients recover spontaneously, mostly within - months of age, but sometimes recovery may be delayed until - years. the use of intravenous immunoglobulin (ivig) as an alternative to antibiotic prophylaxis remains contraversial also in symptomatic patients. some authors believe that ivig therapy may cause a delay in the maturation of the humoral immune system because of the interference from passively transfered antibodies. the aim of this study was to investigate the effect of ivig replacement on recovery from immunodeficiency in these patients. patients ( %) received ivig therapy while patients ( . %) showed spontaneous normalization without ivig. the percentages of patients who had more than six times the number of febrile infections in a year decreased from % to % in the group receiving ivig treatment. at admission, before being recruited to ivig therapy, serum immunoglobulin g (igg) levels and anti-hemophilus b (hib) antibody titers were found to be significantly low in cases who were selected for replacement. the percentages of patients who did not have protective levels of anti-hib, anti-rubella or anti-rubeola-igg were also significantly high in ivig cases. there was no statistically significant difference in the age at which igg levels normalized between both groups. patients in the ivig group and non-ivig group reached normal igg levels at the age of . ± . and . ± . months, respectively. in conclusion, ivig infusions do not cause a delay in the maturation of the immune system in thi patients. the very low and non-protective specific antibody responses against previously applied vaccines are important factors to consider when selecting patients for ivig therapy. zoltán ellenes-jakabffy ; ibolya kovács ; mihaela bătăneanţ ; maria cucuruz ; margit Şerban ; lászló maródi department of pediatrics, clinical city hospital oradea, romania. objective: to study the amplitude of the chronic inflammatory phenomena: atopic and autoimmune diseases, as well as their associations in pediatric sigad patients and to study the sigad patients' family history ( st degree relatives) for pids (primary immunodeficiencies). methods: retrospective analysis of the clinical and laboratory records of pediatric sigad patients diagnosed between and at the departments for pediatric immunology of the medical universities of debrecen (hungary), oradea and timişoara (romania). results: out of patients, we found out ( %) with atopic diseases, mostly with respiratory localizations (asthma and allergic rhinitis), ( , %) patients with autoimmune diseases (jia, psoriasis, celiac disease, thyroiditis etc.) and other patients without clinical symptoms of autoimmunity but constantly elevated autoantibody levels. there were patients with coexistent atopic and autoimmune diseases. regarding the family history, we identified families with multiple cases of pids : with multiple sigad, with sigad and cvid, with sigad and higms (hyper igm syndrome). conclusions: the chronic inflammatory phenomena are present in the majority of the studied sigad patients: symptomatic atopic diseases in %, symptomatic autoimmune diseases in , %, that means a cumulative %. there are comorbid associations within the atopic and autoimmune disease groups and also between the two groups. sigad is the most common primary immunodeficiency. it's prevalence is / - / . aim was to assess the prevalence of co-morbidity in patients with sigad in latvian pediatric population and the analysis of some immunological abnormalities in these patients. the study included patients - years old. medical charts have been reviewed. into account were taken the data, which were made at time of diagnosis. patients were divided into groups: st -patients with allergic disease, nd -patients with autoimmune diseases, rd -patients with infectious diseases, th -asymptomatic patients or patients with sigad unrelated diseases. patients with multiple co-morbidities of various disease groups were not placed in any of these groups. each patient group was divided by age: - years, - years - years. results. . % were boys and . % girls. sigad in . % of the cases were diagnosed before years of age (inclusive). % of the patients had co-morbidities: allergic ( %), autoimmune ( . %) or infectious diseases ( . %). patients - years old: children with infectious and autoimmune diseases have . times greater igg than healthy children or children with allergic diseases (p < , ); children with autoimmune diseases has . times more cd cells than children with allergic diseases (p < , ).; children with infectious diseases have . times lower absolute number of cd cells than children with autoimmune diseases (p < , ); patients - years old: children with infectious diseases have . times more absolute number cd cells than children with allergic diseases (p < , ). patients - years old: children with autoimmune disease have . times higher cd /cd index than children with infectious diseases (p < , ) karakina m. l. , , , tuzankina i. a. , , vlasova e. v. introduction: antiepileptic drugs are known to cause immunosupression in some cases. levetiracetam is an anticonvulsant medication used to treat epilepsy in the posttraumatic seizures. we report a rare case of hypogammaglobulinemia and b cell aplasia associated with levetiracetam treatment. case report: a -year-old female was operated for pituitary tumor with transnasal surgery and required second operation for postoperative rhinorrhea. after operation, menengitis developed and antibiotic treatment was administrated. however, there was a poor response to this treatment after one month and craniotomy was performed due to the diagnosis of "shimic menengitis". her seizures occurred as a postoperative complication and levetiracetam was initiated. after the -month follow-up, the findings of menengitis could not be controlled with antibiotherapy. she was referred to our immunology department for chronic menengitis with fever, headache and high cerebrospinal white blood cell count. results: in her clinical evaluation, it was learned that she had previously healthy. laboratory examination showed that decreased levels of igg mg/dl (normal: - ) and iga mg/dl (n: - ). peripheral blood flow cytometric analysis revealed the absence of b cells (cd + b cells; < %). t cell subsets and natural killer cell numbers were normal. neutrophil function, chemotaxis, phagocytosis and oxidative burst activity were found to be normal. isohemaglutinin titer, levels of pneumococal and tetanus specific igg antibodies were also normal. antiepileptic drug was discontinued after epileptic seizure was controlled. b cells gradually increased three weeks later and returned to normal within two months (cd + b cells: . %). conclusion: patients requiring levetiracetam should have serum immunoglobulins measured and lymphocyte subsets analysis performed if they experience recurrent or persistent infections. mustafa gulec ; fevzi demirel ; ugur musabak ; ozgur kartal ; sait yesillik ; abdullah baysan ; ergun ucar ; osman sener gulhane medical school, division of immunology allergic diseases, ankara, turkey. gulhane medical school, department of chest diseases, ankara, turkey. introduction: common variable immune deficiency (cvid) may present with several clinical manifestations involved in different organs and tissues in adults. we present a case with a history of chronic cough for more than twenty years and further diagnosed as cvid. case: a -year-old male who works in a chemistry lab admitted to our clinic with a history of frequent upper respiratory tract infections for more than years. he also had intermittent diarrhea symptoms and his respiratory symptoms have been worsened since . he had been hospitalized due to pneumonia and empyema several times. he had undergone left lower lobectomy due to bronchiectasis in . he had been admitted to intensive care unit due to worsening of his medical condition. he was further diagnosed with cvid and ivig treatment was initiated. he is currently under remission with monthly ivig treatment and without any respiratory or gastrointestinal symptoms. discussion and conclusion: cvid is a clinical disorder in which the humoral part of the immune system is affected. most frequent presenting symptoms belong to respiratory, gastrointestinal systems and skin. however, due to the organ specific physical examination and lack of awareness, the diagnosis is frequently overlooked. in our case, frequent upper respiratory infection, loss of weight, diarrhea, bronchiectasis and empyema with unknown etiology are the most informative clinical signs. medical history is the most important part of patient evaluation. immunoglobulin replacement therapy is a basic treatment in primary immunoglobulin deficiency disorders. immunoglobulin substitution can be given intravenously (ivig) or subcutaneously (scig) for patients with antibody deficiency. both of these treatments are effective in prevention and cure of infections, although differences in advers events profile and patients' quality of life can be seen. the authors describe here their experiences in switching patients from ivig treatment to scig and a few years observation of scig therapy of patients with antibody deficiencies. sirje velbri , mirja varik tallinn children's hospital, tallinn, estonia. north-estonian regional hospital, tallinn, estonia. j clin immunol ( ) : - antibody deficiencies are the most common group of primary immunodeficiencies. the main hallmark of antibody deficiencies are recurrent infections but the patients have also higher risk of autoimmune and allergic diseases. we analysed retrospectively the frequency and character of autoimmune diseases in patients ( children and adult patients) with primary antibody deficiencies. there were ana-lysed patients with xla, patients with cvid, patients with selective iga deficiency, pa-tients with iga/igg subclass deficiency and patients with isolated igg subclass deficiency. autoimmune diseases were found in patients ( , %) besides in children ( %) and in adult patients ( %). in two boys with xla there was not found autoimmune diseases but in patients with other forms of antibody deficiencies in - % of cases. autoiimmune diseases were found more often in iga/igg subclass defi-ciency ( %) than in other forms of antibody deficiencies ( - %). the spectrum of auto-immune diseases differed in adults and child-ren and in different forms of antibody de-ficiencies. immune thrombocytopenia was found in adult patients with cvid or igg subclass deficien-cy, autoimmune connective tissue disorders in iga and iga/igg subclass deficiency. in children there was found mainly thyroiditis, diabetes i type and juvenile arthritis. rostov state medical university. research institute of clinical immunology, rostov-on-don, russia. primary immunodeficiency (pi) is currently one of most important genetically determined immunological clinical pathology which is hard to manage . among different types of pis almost % of cases occurs due to a deficiency in antibodies production. injections of immunoglobulin are current standard in the management of pi. however this treatment is expensive, often is hard for patients, and frequently has limited effectiveness. substitution of immune proteins frequently is inefficient for treatment of severe infectious conditions in pi patients. we investigated maturation, activation and differentiation of immune t-cells in the dynamics of ivig replacement therapy. we observed patients with with cvid ( ) and xla ( people) over a year of regular replacement therapy. we have found that recovery of the humoral component does not affect the maturation and the differentiation of t-cells, but can reestablish activation and regulatory properties. these changes are more evident among patients with cvid, which immuneregulatory and functional potential reestablish faster. obviously, the effects tlymphocytes increase the effectiveness of replacement therapy in patients with xla, cvid common variable immunodeficiency (cvid) is one of the most frequent symptomatic primary immunodeficiencies. the diagnosis is based on significantly decreased levels of immunoglobulins, with poor or absent response to vaccines and by excluding other defined causes of hypogammaglobulinaemia. as suboptimal antibody production is mainly due to b cell defects, therefore, we aimed to study lymphocyte subgroups of cvid patients and to compare the patterns with the clinical presentation in these patients. six adult patients with cvid diagnosis were studied. lymphocyte subpopulations were determined by flow cytometry. for b-cells subgroups cd , cd , igm and igd reagents w e r e u s e d . a l l l y m p h o c y t e s w e r e g a t e d f o r f i n d i n g cd + cd + memory b cells and from this population switched (cd + cd + igd -igm -) and non-switched (cd + cd + igd + igm + ) memory b cells were counted. all patients had normal levels of total lymphocyte count and absolute counts of cd + , cd + and cd + /cd + cells were also normal in all patients. only one patient showed low levels of cd + cells levels. according to paris classification scheme the patients could divided into two subgroups: mb and mb . although almost all our cvid patients had normal number of total b cells, most of them showed reduced number of memory b cells and/or switched memory b cells. all of our patients had very low or absent level of class-switched memory b cells, therefore can be possible associated with a higher risk of granulomatous disease and splenomegaly. detailed investigation of b-cell phenotypes can better characterise cvid patients and can provide more information about possible clinical outcome. background: common variable immunodeficiency (cvid) is one of the most frequent symptomatic primary immunodeficiencies, often related to spectrum of infectious and autoimmune diseases. in cvid patients wide spectrum of gastrointestinal disorders, including infections, are frequently seen. inflammatory bowel disease, helicobacter pylori infection, giardia lamblia infection, campylobacter or salmonella infection have been reported. however, abnormal liver function test and liver disease are found in approximately % of cvid patients. case history: a -year old female patient was admitted to infectious disease department due to recurrent pneumonia and purulent rhinosinusitis. blood analysis confirmed panhypogammaglobulinaemia with impaired responses to vaccinations, elevated liver function tests and anti-hcv positivity, interpreted as old and passed infection. due to cvid intravenous immunoglobulin substitution was started. however, liver function tests remained elevated and with hcv-rna analysis high hepatitis c viral load was detected. chronic hepatitis c virus infection was diagnosed and treatment with peginterferon α- a and ribavirin was started. conclusion: our case emphasizes the need for hcv-rna and hbv-dna analysis in patients with hypogammaglobulinaemia, as the serological detection is impaired and prognosis for chronic hepatitis in immunodeficiency patients is poor. outpaitent clinic of clinical immunology and allergology, east tallinn central hospital, tallinn, estonia background: primary antibody deficiencies are the most frequent primary immunodeficiencies. recurrent respiratory tract infections may result in permanent lung damage in - % of patients, most commonly presenting with the development of bronchiectasis. we aimed to evaluate the lung function and radiographic pulmonary changes in our patients with primary antibody deficiency. material and methods: we reviewed the records of adult patients with a confirmed diagnosis of primary antibody deficiency at our clinic. patients were included in this analysis in whom ct scan was performed during the last months, comprising patients with cvid and two with igg subclass deficiency (median age years; range - years; % females). all patients were on regular immunoglobulin replacement and one of the patients was on prophylactic antibiotic at the time of analysis. mean trough levels of igg were calculated based on the results measured during the last months prior to ct scan. the spirometry was performed according to published protocols. results: all patients demonstrated normal spirometry data based on fev and fvc. two patients had slightly lower mmef rates, however, the changes were not associated with higher rate of infection nor changes in ct scan. none of our patients had bronchiectasis or atelectasis. among parenchymal changes fibrotic lines were most frequently detected. in two patients ground glass due to fibrosis was noted. mean immunoglobulin trough levels in our patients were between . - . g/l, with the median of mean trough levels of all our patients . g/l. when comparing the trough levels to lung function and ct scan results, no significant associations were seen. conclusion: no remarkable changes in lung function or chest ct scan in our patients with primary antibody deficiency were noted. as regular immunoglobulin replacement therapy could have prevented the development of permanent lung damage. rationale: patients with primary immunodeficiencies (pi) (n = ) were treated subcutaneously (sc) with immunoglobulin g (ig) preceded by recombinant human hyaluronidase (ighy) at or week intervals based on their previous intravenous ig (igiv) dose. we report data for a subset of patients aged ≥ years from the final efficacy, safety and tolerability data of a pivotal phase trial of ighy. methods: patients received igiv for months at prestudy doses and frequencies. subsequently, ig % was administered sc, at % of the weekly equivalent of the iv dose, following rhuph infused through the same sc needle at a dose of u/g igg. after a ramp up from a -to a -or -week dose interval, patients received ighy every weeks for months. the primary efficacy endpoint was the mean rate of validated acute serious bacterial infections (sbis) per patient-year during the efficacy period. results: fifty-nine patients received ighy infusions; . % were completed without administration changes due to tolerability concerns or adverse events (aes). median infusion sites/month was . . the temporally associated systemic ae rate was . /infusion (ighy) vs. . /infusion (igiv). the local adverse drug reaction rate was . /infusion. the annual sbi rate was . and . /patientyear for all infections. conclusion: in adults with pi, ighy was effective in preventing infections. the majority of patients received full -to -weekly doses of ig using a single sc site with good local and systemic tolerability. rationale: in a pivotal phase trial of facilitated-subcutaneous (sc) infusion of human immunoglobulin g (igg), %, and recombinant human hyaluronidase (rhuph ) (ighy) in patients with pi, rhuph permitted most patients to have a single-site infusion (every - -week igg dosing) with bioavailability and infusion rates comparable to intravenously administered igg (igiv). we report the final analysis of the long-term extension of the initial phase study, with a duration of up to years of treatment with ighy plus additional follow-up. methods: sixty-six patients who completed the initial phase study enrolled in the extension study. patients continued their pre-study ighy dose/frequency every - weeks. after months, some patients switched to -week dosing to evaluate effects of shorter ighy interval on trough igg levels. from the final analysis, tolerability and safety after up to years of treatment were evaluated. the ighy part of the extension study was followed by a - week observation period during which patients received igg % administered iv, or sc weekly without rhuph . results: in the extension study, patients were treated with ighy and discontinued prior to safety follow-up. following discontinuation of rhuph , patients switched to follow-up. no patients withdrew due to ighy-related reactions (adrs). no serious adrs related to ighy were reported. the maximum ighy exposure for the initial and extension studies combined was years (total exposure = . patient-years; n = ighy infusions); during this time, there were no clinically observable long-term changes in the skin or sc tissue. the rate of temporally related systemic adverse events (aes), excluding infections, was . / infusion. the rate of all local aes was . /infusion. of the ighy infusions administered in the extension study, . % had no administration changes (rate reduction, interruption or discontinuation) due to tolerability concerns or adverse events. the annual rate of all infections under ighy treatment was . /patient-year. reducing the dosing interval from to weeks (same monthly dose) resulted in a % increase in trough igg levels. thirteen patients had at least non-neutralizing anti-rhuph antibody titer of ≥ : with no associated aes; no patients had neutralizing anti-rhuph antibodies. conclusions: in the extension study, ighy was well tolerated and effective, with no serious adrs for treatment periods up to years. over a maximum -year ighy exposure (for an individual patient) in the initial phase and extension studies combined, no long-term changes in skin or sc tissue were observed. the rates of infections and adverse reactions were stable or decreased over the course of the two studies, suggesting no increased risk with continued exposure to ighy. rationale: we report interim analysis of safety, tolerability and pharmacokinetics (pk) of igsc % in patients with primary immunodeficiencies (pi) aged ≥ years in europe. methods: epoch : igsc % or intravenous ig % (igiv) administered at pre-study doses every months. epoch : igsc % administered time per week for months at epoch doses. serum igg trough levels are maintained at > g/l. the primary endpoint is validated acute serious bacterial infection (sbi) rate. results: at the interim analysis in october , patients started the study. during igsc % treatment (n = ), acute sbi episode (pneumonia, moderate in severity) was reported. the infection rate per patientyear was . (igsc %). there were no serious adverse events considered related to any treatment. the rate of local adverse drug reactions (adrs) was . /infusion and all were mild in severity; no severe systemic adrs were reported with igsc %. of igsc % infusions, only . % required slowing or interrupting the administration rate. mean serum igg trough levels were . g/l (igsc %, n = ), . g/l (igiv -week interval, n = ) and . g/l (ivig -week interval, n = ). conclusion: igsc % provided an effective and well-tolerated therapy, with no dose adjustments needed from pre-study ig dose. this study is ongoing to confirm results over months. it is well known, that intravenous immunoglobulin (ivig) is the main therapeutic modality in b-cell primary immunodeficiencies (pid), it decreases mortality and morbidity in these patients dramatically. yet, it is also well known that all ivig products are very expensive, especially considering life-time use and almost normal life expectancy in these patients, if treated correctly. irregular treatment and problems with insurance/state coverage of ivig in some countries stems from this. goal: the goal of our study was to compare medical and other costs, related to the disease in patients with humoral pids with or without ivig treatment. patients: patient with b-cell deficiencies ( % x-linked agammaglobulinemia, all genetically confirmed, % common variable immunodeficiency). the age of patients varied from to years. methods: we analyzed medical and other disease-related costs during years preceding the diagnosis (without ivig therapy) retrospectively and during years on regular ivig therapy. the costs included those incurred by the state (hospitalization, home visits, emergency calls) and by the parents (costs of drugs, private consults, etc). the state costs caused by parents missing work were also considered. for standardization purpose for calculation we used the prices for the end of . results: the patients analyzed fell into different categories: . the st group -( % of patients studied) -patients with several severe infections before therapy, some chronic conditions as a result of those. age of diagnosis varied from years to years (with average time to diagnosis years). in this group costs of ivig treatment were , times higher than before the diagnosis (fig. ). nd group( % of all). patients with late diagnosis (average time to diagnosis years), who had multiple severe infections before the ivig treatment and acquired serious chronic lung complications due to it. in this group the costs before the treatment were higher, than on ivig treatment. . very early diagnosis -within the first year of life (mostly because of preceding family history) ( %). the comparative analysis was not possible, but it was noted that these patients had no history of serious infections before of while on ivig therapy. the only additional costs, besides ivig, were related to bad venous access, requiring occasionally day in-patient hospitalization for ivig infusion. as expected, in all groups, the number of infectious episodes, the number of hospitalizations (fig. ) and doctor visits (fig. ) after beginning of regular ivig treatment dropped dramatically. we also followed patients with xla, who did not receive ivig therapy because of social aspects. both patients died from severe infections. we evaluated this fact in economical prospective: in russia one worker, who works continuously and retires at years of age brings about mln roubles into the state budget (when costs for schooling and routine medical care are subtracted). if one supposes that an xla patient have been diagnosed very early in life, did not form complications prior to therapy and was on regular ivig therapy for life, this sum equals to years on ivig. conclusions: regular ivig therapy not only leads to reduction of infectious episodes, hospitalizations, and as a result improved quality of life. in some cases it even brings down the disease-related costs, incurred by the medical system and the family, and is economically advantageous for the state. introduction: replacement of immunoglobulins is a standard therapy for patients with primary immunodeficiency disease (pidd) characterized by primary antibody deficiency (pad). this poster represents our clinical experiences of initiation of home-based treatment with subcutaneous immunoglobulin (scig) with the patients diagnosed with primary variable immunodeficiency (cvid). case report: the patient (age ) has been treated at our immuno-allergy outpatient clinic since with the diagnosis of hypogammaglobulinemia (igg, iga, igm) with normal b cell count, withsusp. cvid. with the repeated administration of intramuscular and intravenous immunoglobulins (ivig, imig) repeatedly occurred serious adverse reactions, which resulted in discontinuation of the replacement therapy. in february the health condition of the patient worsened due to recurrent bacterial respiratory infections. there was a progressive decrease of serum concentrations of immunoglobulins (igg , g/l, igm , g/l, iga , g/l). the patient was admitted to the intensive care unit of the st internal department, university hospital bratislava, for a subcutaneous immunoglobulin replacement trial. despite serious adverse reactions with previous administration of several types of immunoglobulins, there have not occurred any clinically relevant side effects. conclusion: compared with im or iv formulations and administration, for selected patients, scig is better tolerated, clinically efficacious, safe, and appreciated by the patients. background: common variable immunodeficiency (cvid) is primary immunodeficiency (pid) classically viewed as antibody deficit. although, cvid is considerd to be a humoral immunodeficiency, approximately % of cvid patients have low t-cell counts or abnormal tcell function. despite adequate immunoglobulin replacement patient morbidity and mortality is variable and a number of complications are not those typically seen in pure antibody pid e.g. xla. so, t-cell rather than b-cell phenotype could determine outcome in patients with cvid. many patients with cvid have clinical history suggestive of allergic respiratory disease, but prevalence of asthma and role of atopy have not been well established. apart from recurrent infections and their sequelae, cvid patients suffer from other disease-related complications in up to % of the cases. about % have onset before the age of years. aims: ) to present one more case of tadolescent with cvid and allergic asthma, ) emphasise ultimate need of collaborative network of primary immunodeficiency centers. case report: parents of , y boy were sure that "something was wrong" with their son and were seaking for problem solution for many years. since age , child had frequent respiratory infections. adenoidectomy and tonsillectomy were performed at age . sinuitis was diagnosed several times. boy was complaining of fatique for a long time. last several years, his main problems were fever (max c) usually lasting days till weeks, accompanying running nose, coughing, conjunctival problems; intermittently headache (lasting for a few hours till all day). oral aphtae were present almost every two weeks. he was incompletely vaccinated (bcg, and once diteper). morbilli and varicellae infections passed without complications. in jan he was diagnosed as allergic asthma in sarajevo (allergy to pollen, soya, nuts and antibiotics ("ceclor" and "pancef"). in february was admitted at children's hospital sarajevo for suspected primary mmunodeficiency. he had slightly lower levels of igg and iga (twice measured), normal ige and decreased number of t helper ly. due to suspected pid, boy was checked up in two nearest regional pid centers : hypogammaglobulinemia was confirmed (igg , , iga , , igm , , as well as deficiency of igg , igg and igg ). flow cytometry showed slightly raised concentration of lymphocites b (cd ), slightly raised number of nondifferentiated b cells. cvid was suspected but not proved. in july child visited center for primary immunodeficiencies in munchen, germany, were he was diagnosed ad probable cvid on the basis of hypogammaglobulinemia, lower levels od switch memory b cells, normal number of t-cells, positive antibodies to vaccinations and overcome infection (morbilli, varicellae). allergic asthma was additionaly confirmed in specialised pediatric pulmology hospital in germany (abnormal spirometry, normal ige, positive skin prick test, abnormal fractional exaled nitric oxid test, incipient brochiectasies due to asthma confirmed by high -resolution lung ct scan). low human immunoglobulin replacement was started ( mg/kgbw) as well as antiasthmatic therapy (inhalatory steroids, antihistaminics). excellent therapeutical response were achieved : after one , y follow up, we can confirm patient has excellent general condition, no subjective symptoms, no tiredness, no severe infections. conclusion: diagnosing cvid is challenging task and quite often could be "per aspera ad astra". there is ultimate need of collaborative work of primary immunodeficiency network aimed of diagnosing patients on time. cvid patients with history suggestive of allergic asthma, are negativne on traditional tests, additional test designed to identify allergic asthma might be conducted. common variable immune deficiency (cvid) is a heterogeneous syndrome characterized by hypogammaglobulinemia, recurrent infections, immune disregularity (autoimmunity, autoinflamation) and propensity to malignancies. in the us report, . % of cvid patients had a lymphoid malignancy, and cancers of other sorts developed in % of patients. it is not clear why cvid patients have higher risk of malignancy but chronic antigenic stimulation, chronic inflammation and increased chromosomal radiosensitivity may be the cause. cvid patients with higher igm level, reduced or absent b cell numbers, cd t cells lower than and pli phenotype have higher prevalence of malignancy. allergy and clinical immunology department of rasool e akram hospital has registered cvid patients. mean age of the onset of cvid symptoms was . years. mean diagnosis age was . years with mean diagnostic delay of years. mean follow up time was years (minimum . -maximum y). malignancy occurred in the follow up of patients ( %). one patient had two different malignancies (breast cancer and gi adenocarcinoma). malignancy risk per case was %. hodgkin's lymphoma was the most common type ( % of cancers common variable immune deficiency is a heterogeneous syndrome characterized by hypogammaglobulinemia , recurrent infections , auto immunity and auto-inflammation . more than % of cvid patients have auto immune complications and among them, auto immune cytopenia is the most common. cvid patients with higher igm levelhigher low b cellslower t reg levelslower cd /cd ratio and lower class switched memory b cells have higher prevalence of autoimmunity. allergy and clinical immunology department of this hospital has registered cvid patients. mean age of onset of cvid symptoms was . years. mean diagnosis age was . years with mean diagnostic delay of years. mean follow up time was years (minimum . maximum y). autoimmunity was detected in cases ( %) and cases ( %) had more than one autoimmunity. autoimmunity was the first symptom of cvid in percent of cases. autoimmune disorders should be considered in the follow up of cvid patients. igg is major immunoglobulin and classified subgroups as igg , igg , igg and igg . igg and igg subclasses are rich in antibodies aganist proteins such as the toxins produced by the diphtheria and tetanus, as well as antibodies aganist viral proteins. recurrent ear infections, sinusitis, bronchitis and pneumonia are common in ig g subclass deficiency. ig g is the major subclass of ig g. igg subclass deficiency is very rare. chronic eosinophilic pneumonia is one of the eosinophilic lung disease and is seen rarely. in the presence of peripheral eosinophilia and radiological pulmonary infiltrates diseases suspected. when increase in the number of eosinophils in bronchoalveolar lavage fluids and/or presence of eosinophils in lung tissue diagnosis is confirmed. according to different recording systems chronic eosinophilic pneumonia is % - of the interstitial lung disase. there is not any criteria for diagnosis but also diagnoses is confirmed with suspected findings. symptoms inludes that: )in the presence of respiratory symptoms for two weeks long )eosinophilia at alveolar lavage and\or peripheral blood ( bal fluid cytological examination > % , blood > /mm ) )radiological imaging of the lung peripheral infiltration )exclusion of the other causes of eosinophlic lung disease there is eosinophilia over /mm nearly all patients. one of third or half of patients have diagnosed as asthma. disease begin with systemic symptoms such as night sweats, weight loss, anorexia and pulmoner symptoms such as cough, shortness of breath, wheezing. patients have restrictive or obstructive findings in pft. one of third patients, especially with history of asthma, have obstruction in pft. İn the pathologic biopsy findings include; thickening of alveolar walls and accumolation of eosinophils and lymphocytes. long time used corticosteroids treatment is recomended. relaps is common when treatment is discontinued. we present the patient who has ig g deficiency, chronic eosinophlia and % eosinophils in bronchoalveolar lavage fluid. the patient improved long time used oral steroid then inhaled steroids. this was presented in terms of clinical association. case: a years old female patient who were followed due to asthma in the other center for two years, although use of combination inhaled fluticasone and salmeterol, patient was admitted with cough and sputum production. in thorax ct there were, bronchiectasis at right lower lobe, pneumonic consolidation in the right lower lobe and ground glass opacities. we detected as igg mg/dl ( - mg/dl), iga mg/dl ( - mg/dl), igm mg/dl ( - mg/dl), ige . mg/dl, igg mg/dl ( - mg/dl), igg mg/dl ( - mg/dl), igg mg/dl( - mg/dl), igg mg/dl ( - mg/dl). because eosinophilia ( cells) and symptoms continued, bronchoscopy was performed. left main bronchus was normal, right bronchus were seen dilated. purulent secretion was aspirated on rigt bronchus with flexible bronchoscopy ..in cytological examination % eosinophils was detected in bal. bronchoalveolar lavage cultures was negative. the patient was diagnosed chronic eosinophilic pneumonia and mg/ kg oral steroid was began. ivig was given up to patient; because of frequently recurrent sinopulmonary infection and patient had igg subclass deficiency. in the third month of oral steroid therapy physical examination findings and pft were improved and started inhaled steroid. conclusion: immunodeficiencies often can be seen alone. although, the pathogenesis of immundeficiencies with lung disease is not well understood and associated with interstitial lung disease. therefore, investigations must be include bronchoscopy and bronchoalveolar lavage. scid is a congenital heterogeneous group of diseases characterized by severe impairment of t,b, nk cell development and function. the hematopoietic stem cell transplanted patients with scid in the time period from to were evaluated. male/female ratio is / . median follow-up time is years ( months- years). parental consanguinity ratio was , %. mean age of onset of the symptoms was ± , months. most common clinical findings on admission were; pneumonia ( , %), moniliasis ( , %), diarrhea ( , %), dermatitis ( . %). classification according to t, b, and nk cell counts; (figure ). molecular genetic defects were determined in patients (figure ) are given. there is no difference between age groups according to occurrence of acute and chronic gvhd. death ratio increases with the increasing age. acute and chronic gvhd and number of deaths were significantly higher in peripheral stem cell transplanted patients. there is no statistically significant difference in occurrence of acute/chronic gvhd between b-and b + scid, who had been hla idantically transplanted from family donor. both groups have similar ratios of ivig treatment need after hsct. there is no statistically significant difference in occurrence of acute/ chronic gvhd between nk-and nk + scid, who had been hla idantically transplanted from family donor. both groups have similar ratios of ivig treatment need after hsct. death ratio was similar in groups. bcg dissemination in bcg vaccinated patients is significantly higher in the nk + group. the rate of complications due to severe infections is high and increases with age in patients with scid. hsct is curative, should be considered as early as possible. trec analysis for neonatal screening will give chance for early diagnosis and treatment of the patients. the hyper-ige syndromes are rare pids and are characterized by atopic dermatitis, skin abscesses recurrent pneumonias, elevated serum ige levels and sometimes mucocutaneous candidiasis. we have been evaluating and following up a group of patients with features suggestive for autosomal recessive hyper ige syndrome (ar-hies). homozygous dock mutations were identified in several of these patients. however, two siblings from a consanguineous family in this group of patients showed homozygous block in chromosome p . in homozygosity mapping which includes stk gene. sanger sequencing was performed for stk deficiency and showed a novel c. - delgata mutation in stk gene causing a premature stop codon. clinical manifestations of stk deficiency, also known as a macrophage stimulating (mst ) deficiency, stk deficiency comprise recurrent and severe viral skin infections including molluscum contagiosum and warts, fungal and bacterial infections and autoimmunity which are also the features of ar-hies. our patients's main features include autoimmune cytopenias (aiha and itp), cutaneous viral (molluscum contagiosum and mild perioral herpetic lesion), mild atopic dermatitis, seborrheic dermatitis, lymphopenia (particularly cd lymphopenia), and intermittent mild neutropenia. serum ige level was mildly high in these patients. our results indicates that patients that show clinical phenotype of ar-hies needs to be also evaluated for stk deficiency. determination of the underlying defect and reporting the patients are required for the description of the phenotypic spectrum of pids and the frequency of these diseases as well as for genetic counselling. mendelian susceptibility to mycobacterial disease (msmd) is a rare entity. patients with msmd have susceptibility to salmonella and some other intracellular microorganisms in addition to weakly pathogenic mycobacterial species. il- rβ deficiency, most common form of msmd, is caused by mutations in the il rb gene. patients who have symptoms suggestive for msmd or history of sibling death due to bcgosis were evaluated. the expression of the il- rb was detected in patients and family members by monoclonal antibodies on the lymphocyte surface by flow cytometry after the lymphocytes were stimulated in vitro with pha. mutation analyses was done by sanger sequencing. all index cases were presented either with bcg or salmonella infection. two patients, though they were bcg vaccinated had no clinical symptom, six presented with the symptoms of salmonella infections, two developed leukocytoclastic vasculitis, candidiasis was the accompanying feature in seven. recurrent leishmaniasis that necessitated subcutaneous interferon-γ and prophylactic amphotericine b therapy was present in a patient. in all patients the percentage of lymphocytes with il rβ expression was found to be less than % . prophylactic antimycrobial treatment and in severe and resistant infectious episodes if-γ therapy, should be given. many patients have associated mucocutaneous candidiasis. the prognosis is good unless the patient admits at the later stages of bcg infection. the results of our patients showed that the analysis of the surface expression of il rβ on activated lymphocytes is an effective diagnostic method which can also be used in screening of the patients with probable msmd. ataxia-telangiectasia (a-t) results from the loss of ataxia-telangiectasia mutated gene (atm) function and is a heterogeneous, multisystemic disease and characterized by accelerated telomere loss, genomic instability, progressive neurological degeneration, immunodeficiency, premature ageing and increased neoplasia incidence. even in classic a-t with ataxia and telangiectasia, the onset of clinical symptoms and the rate of progression are variable. here, we report two siblings was diagnosed as a-t with severe and early hypogamaglobulinemia, decreased cd , increased cd ro, no ataxia and telangiectasia, purulent otitis and hemophagocytosis that harbor a rare frameshift mutation of atm gene. Özdemir Öner ; bozdoğan sıla department of pediatrics, division of allergy/immunology, sakarya university, medical faculty, adapazarı, türkiye. department of pediatrics, sakarya university, medical faculty, adapazarı, türkiye. background: the acquisition of new food allergy after transplantation or transplant-acquired food allergy (tafa) is usually reported in adults and rarely in children. tafa is described mainly after liver, but also after small bowel/intestinal, lung and heart transplantations. in different studies, the male/female ratio is equal. literature data suggest that children with tafa typically present within the first year after surgery and they are typically allergic to multiple foods. aim: tafa is generally characterized with allergy to multiple foods and increased level of total and/or spesific ige. here, a patient although who had normal total. ige and specific ige test results, he developed reaction to skin prick test for cow's milk is presented and his clinical presentation will be discussed. case presentation: month-old-boy came to our allergy clinic with complaints of vomiting after drinking cow's milk and skin rush on the area where contact ed with chocolate. in his past medical histroy, left lateral segment of liver (donor was his mother) was transplanted to him when he was at months. the liver donor was not recorded as having a history of allergic disease. methylprednisolone and tacrolimus immunosuppression were used after the transplantation, and tacrolimus therapy was continued for prophylaxis of chronic rejection. when he was at months, family fed the patient with cow's milk but hours later he began to vomit. he vomited five times in two hours. then, he developed constipation. rectal irrigation was used. then oral intake stopped for two days. he was thought to be having food protein induced enterocolitis. his vomiting complaints repeated after intake of formula and baby food which include grain. so he fed with special formula including short-chain peptides and free aminoacids and his symptoms improved. past medical history: extrahepatic biliary atresia was diagnosed at weeks age with conjugated hyperbilirubinemia (according to scintigraphy and biopsy results). family history: his father has penicillin allergy and his aunt has asthma. at our outpatient clinic: height and weight were within normal percentiles. physical examination reevaled normal examination findings. laboratory findings: wbc was . /mm , with % neutrophils, % eosinophils and % lymphocytes. his hemoglobin was . g/ dl, platelet count was . /mm . background: except for antibody deficiency and complement defects, hematopoietic stem cell transplantation (hsct) is the single best curative treatment defined for primary immunodeficiency (pid) so far. in the current study, we aimed to assess the role of pid type, donor type and clinical status on hsct success rates. materials and methods: we retrospectively reviewed the records of a total of hscts procedures performed in patients diagnosed with pid between and , in ankara university pediatric allergy and immunology department. results: of the patients, had severe combined immunodeficiency (scid) and had non-scid. the survival rates following hsct, in both scid and non-scid patients were %. when classified according to the source of donor, patients who had a hla-matched sibling donor (msd) in the scid group had . % survival rate post transplantation, those who had a matched related donor (mrd) had . % and those who received a haploidentical donor had . % survival rates. in the non-scid group there were patients with haploidentical transplants ( omenn syndrome and mhc class ii deficiency) and all patients died. we assessed several potential risk factors associated with survival in scid patients. patients diagnosed over months of age with a pre-existing pulmonary infection, requiring intensive care and/or mechanical ventilation had significantly lower survival rates. conclusion: hsct is the best curative treatment for pid. our results demonstrated that hsct performed from matched family donors or even haploidentical parents is a lifesaving treatment in various types of pid's, especially in scid. introduction: in case of donor availability allogeneic hematopoietic stem cell transplantation (hsct) can be regarded as a definitive therapy for a variety of primary immunodeficiency syndromes (pids), including severe combined immunodeficiency (scid) and non-scid pids. study period: we retrospectively reviewed the hospital records of consecutive children with pid, who had allogeneic hsct in the last years, between january and january . our median follow-up time is , years ( months - , years) patients and methods: the median age of children at hsct was , months ( , months- years). boys/ girls diagnoses were based on anamnestic data, clinical findings, and immunological and genetic analysis. conditioning regimens included busulphan + cyclophosphamide, busulphan + cyclophosphamide + atg, fludarabine + melphalan or fludarabine + anti-cd in b-, t-, nk-scid cases conditioning was not used. indications for transplantation: patients' diagnoses were severe combined immunodeficiency (n = ), wiskott-aldrich syndrome (was, n = ), chronic granulomatous disease (cgd, n = ), xlinked lymphoproliferative disease (xlp, n = ), whim-syndrome (n = ), hyper igm syndrome (cd ligand deficiency, n = ), leukocyte adhesion deficiency (lad, n = ), dock mutation (n = ) transplantations: hscts for children were performed. patients were retransplanted ( pt once, pt twice, pt times), because of rejections. at the first hscts in / cases sibling bone marrow, / sibling peripheral blood, / sibling cord blood, / unrelated cord blood, / unrelated bone marrow, / unrelated peripheral blood, / haploidentical donors were used median cd count was , x /kg ( , x - , x /kg) patients engrafted on median ± day (anc > , g/l) acute gvhd occured in / cases ( pathomorphological findes: distortion of the structure of lymph nodes due to enlargement of paracortical zones and follicules was found in all patients. presumed atypical cells (makrolymphoblastes and berezovsky-sternberg-reed cells), were detected in patients overwise during follow-up for - years in these patients revealed no specific infectious and malignansy. accumulation of proliferating dn cells (a lot of mitoses) was characteristic fiture in lymph nodes and spleen of alps patients. setting of plasma cells in follicular zones in the lymph nodes was reveald in cases, and eosinophilesin , pronounced immunoblast proliferation in , sinus histiocytosisin . multiple hyperplastic follicles, extended sinuses with many phagocytizing macrophages, lymphocytic infiltration was revealed by histological examination of the spleen in all cases. immunohistochemistry findes: t-and b-cells proliferation (ki- expression), atypical location of lymphocyte populations, settings of plasma cells in all lymph node zones. in paracortical zones was found cd +, cd +, cd + cd -, cd + cd -cells in patients, cd +, cd + cells in patient; and in restricted follicular zones -cd +, cd +, hla-dr + cells in patients, cd +, cd + and cd + in patients. the presentation of a case of kimura disease in a patient with was. the was was diagnosed in year months, based on infectious syndrome, atopic dermatitis, hematological syndrome -skin hemorrhages and thrombocytopenia - * /l. after he performed often sars. regularly received ivig at mg/kg, antibiotic therapy with a positive effect -infectious syndrome stopped, controlled hemorrhagic syndrome. since there was a herpes virus infection with frequent exacerbations on the face. patient received acyclovir, valacyclovir, famvir with a temporary effect. in . on the left side of the face -periorbital region, eyelids, malar region appeared the site of soft tissue hyperproliferation - cm in diameter with a thickness of - cm, with moderate moist, painful on palpation, the left eye was closed, the lid margin ciliated dramatically thickened, deformed. in october-november was admitted in diagnostic department, massive antibiotic, antimycotic, antiviral therapy, ivig therapy. the histological study showed the angiolimphoid hyperplasia with eosinophilia without immunomorphological signs of malignant tumor growth. based on histological, immunohistochemical studies of the skin, these clinical and laboratory findings, diagnosis: mass lesion of the left face -kimura disease. patient helded courses of chemotherapy with positive dynamics: mass lesion decreased, erosive surfaces disappeared and now receives romiplostimum, acyclovir, biseptolum, ivig . g/kg time per month. under the observation there is a family k., which is unique in the deletion variants of the same region q. . and the presence of an adult patient with the di george syndrome. clinical manifestations of the syndrome in family members is differ. methods: clinical, laboratory, instrumental and genetic ( dna was isolated using a kit «qiaamp dna mini kit» and dna from dried blood spots was isolated using a commercial kit "dna-sorb-b». mlpaanalysis set salsa mlpa probemix p -b digeorge, genetic analyzer applied biosystems ). mother ( years), had few incidents of pneumonia before years. she was diagnosed ullrich-turner syndrome at age years. all childbirths by caesarean section. she has not any laboratory and instrumental findings of immunodeficiency, endocrinopathy, cardiac and thyroid abnormalities. she has deletion in the starting area of the di george region (lcr -a), including genes cltcl , hira, cdc , cldn , gp bb, tbx , txnrd , dgcr . father ( years), healthy, current smoker. the dna microstructural violations in di george region haven't been identified. son was from i pregnancy, heart defect was set prenatally, marked growth retardation. childbirth at weeks. he had unstable reduced cell parameters and hypogammaglobulinemia, the size reduction of the thymus and congenital heart disease: truncus arteriosus, dc b stage by lang. after days of life operated for congenital heart disease. during the surgical intervention the thymus wasn't found in a typical place. the postoperative period was complicated by sepsis, heart and respiratory failure. received ivig, antibiotic and antifungal therapy. he suffered from sars, severe course, the degree of respiratory failure ( months) -death. in mlpa-dna defined microdeletion disorders starting region di george (lcr -a) -from the -year-old dry blood sample (postmortem study a year old boy with bleeding, eczema and recurrent pyogenic infection was admitted to our department. the child who received treatment in hematology accidentally a few times, but has not had the effect of treatment . laboratory parameters -cd -cells- % ( ), cd -cells - % ( ), cd -cells - % ( ), cd -cells - % ( ), cd / -cells - % ( ), cd / cd - . , hla-dr- , nbt- . igg- . q /l, iga- . q / l, igm - . q / l, ige- u / ml. hb- g / l, erythrocytes- . x / l, leukosytes - . x / l, neutrophils- %, lymphocytes - % ( ), eosinophils- %, monocytes- %, metamielosytes:- %, plateletsrare was observed.normal bone marrow cells, the separation of platelets from meqakariosyt has become weak. the advantage of erythroid unordered have been observed. bone marrow puncture the mielokariosytes - . x / l, meqakariosytes - . x / l, blasts- . %, myelosytes - . %, metamyelosytes - . %, seqments - . % neutrophils-% . , eosinophils- . %, lymphocytes- . %, monocytes- . % erythroblasts- . %, pronormoblasts- . %, normoblasts- . % meqakariosytes - . %, plasmatic cells- . %.his younger brother with eczema, pyogenic infections (furunculosis) was admitted to our department. cd - % ( ) ataxia telangiectasia (a-t), is a genetic disorder caused by the homozygous mutation of the atm gene and, frequently associates with variable degrees of cellular and humoral immunodeficiency. however, the immune defects in patients with a-t are not well characterized. to our knowledge, there is no work on major lymphocyte subpopulations and recent thymic emigrants of a-t patients comparing to age-matched healthy controls. according to esid criteria, patients diagnosed as a-t and agematched healthy children were assigned to the study. both patients and healthy controls were grouped as - , - , - years and older than years. using flow cytometer, major lymphocyte subpopulations and cd + cd ra + cd + recent thymic emigrants (rte) were determined as per cent and absolute cell numbers and compared. no significant differences regarding all lymphocyte subpopulations were observed between age groups of a-t. comparing to the healthy controls, there were a decrease (in t cells, effector memory t cells, b cells, naïve b cells, switched b cells and rte) and there were an increase (in active t cells, naïve t cells and nonswitched b cells) in the absolute number and percent of some cell populations in the a-t group. findings of this study showed effector functions in some cell lymphocyte populations were decreased and could be thought that bone marrow of patients should be tried to increase the cells numbers. however, the study has an important limitation about patient and healthy population. ataxia-telangiectasia (a-t) results from the loss of ataxia-telangiectasia mutated gene (atm) function and is a heterogeneous, multisystemic disease and characterized by accelerated telomere loss, genomic instability, progressive neurological degeneration, immunodeficiency, premature ageing and increased neoplasia incidence. even in classic a-t with ataxia and telangiectasia, the onset of clinical symptoms and the rate of progression are variable. here, we report two siblings was diagnosed as a-t with severe and early hypogamaglobulinemia, decreased cd , increased cd ro, no ataxia and telangiectasia, purulent otitis and hemophagocytosis that harbor a rare frameshift mutation of atm gene. nijmegen breakage syndrome(nbs) is a rare autosomal recessive disease usually presenting at birth with microcephaly. here we present a case of nbs diagnosed at the age of twenty seven who admitted to our outpatient clinic with malaise, loss of appetite, weight loss and dyspnea on effort . she was hospitalized in another centre years before because of pneumonia, pancytopenia, generalized lymphadenopathy, hepatosplenomegaly and hypogammaglobulinemia (very low igg and iga) where she couldn't have any definite diagnosis. her past medical history was remarkable for primary amenorrhea and basal cell carcinoma excision from preaericular region when she was . she had no severe infection history before except frequent upper respiratory tract infections. her parents were consanginous and she had a brother died at months of age. microcephaly together with short stature, multiple palpable lymphadenopathies , splenomegaly and absent secondary sexual characteristics were prominent features in physical examination. direct fluorescence sequencing of the nbn gene showed a homozygous mutation in exon (c. _ delacaaa) which confirmed the diagnosis of nbs in our patient. nbs is mostly diagnosed in childhood. the delay in diagnosis was partly due to the lack of severe infections in her past medical history until she was . another factor that lead to the delay is that it is an unknown disease among physicians in turkey. the longest known survival is years in a patient who had no clinical features of nbs other than primary amenorrhea. as a result, our patient is one of the oldest patients reported in the literature presenting nearly all of the classical features of the disease and carrying the most common pathologic mutation. wiscott-aldrich syndrome (was) is a rare x-linked recessive immunodeficiency disorder characterized by thrombocytopenia, small platelets, eczama, recurrent infections and an increased risk of autoimunity and malignancy. the gene responsible for was is located in chromosome xp . -p - , which consists of exons, and encodes a -amino acid protein. in this study, we aimed to screen was gene mutations and analyze the effects of determined mutations in boys with non-classical was phenotype. ivs + g > a gene alteration in intron of was gene was identified in case , previously. so, rna isolation and then cdna synthesized was carried out. in case , after amplification of exons of was gene by pcr, the amplicons were sequenced. in this patient, g > c alteration was detected in the first base of intron . afterwards, cdna synthesized for detecting the splicing effect. based on the gel image results, cdna found to be base pairs smaller than the normal in case . in case , g > c alteration was detected in the first base of intron and then we determined multiple splicing products. two different splicing mutations (ivs + g > a and ivs + g > c) were detected in two cases with non-classical phenotype. ivs + g > a splicing mutation was stated in the literature, previously, but ivs + g > c mutation was first time identified in this study. whim is rare (< / ), heterozygous, autosomal dominantly inherited pid, caused by mutations in the gene encoding for the chemokine receptor cxcr , mapped on q locus. the altered cxcr / cxcl interaction impairs cellular homeostasis and trafficking, resulting in immunological dysfunctions with abnormal retention of mature neutrophils in the bone marrow (myelokathexis) and consecutive severe neutropenia, variable degree of lymphopenia and hypogammaglobulinemia. whim patients suffer from recurrent bacterial infections since early childhood and later on manifest a specific susceptibility to hpv infections with developing widespread warts. because of rarity of the disease, heterogeneity in clinical presentation and usually incomplete phenotype, the diagnosis is often delayed and whim syndrome is not suspected. a year old boy who is suffering from recurrent bacterial infections, often complicated with bronchopneumonia, with severe neutropenia, but also, with lower level of lymphocytes and still, normal serum immunoglobulin level is presented. he has no developed warts; neither his parents nor relatives have warts. at the age of years was unveiled the diseasecausing mutation in the cxcr gene (c. c > t; p.r x; heterozygote). severe congenital neutropenia accompanied with lymphopenia and findings of mature neutrophils in bone marrow, might be an easy approach for getting closer to the clinical diagnosis of whim syndrome. early identification is important for clinical and therapeutic management, allowing a more comprehensive follow-up and administration of appropriate therapy. we report two cases of congenital heart disease (tetralogia fallot and interruption aortic arch) with confirmed microdeletion chromosome q . by karyotype and fluorescence in situ hybridization analysis (fish). children underwent surgical correction of congenital heart defects with good postoperative outcome, although were complex. the phenotype of these patients can be extremely variable, frequently leading to clinical confusion, diagnostic delay, excess morbidity, early mortality. identification of these patients is essential for their adequate management and genetic counseling. a multidisciplinary approach is fundamental to ensure that the patient will be able to attain his or her maximal potential. the underlying cause of the juvenile periodentitis is not well understood but is now thought to be related to an abnormal immune system and to invading bacteria in the cementum of the teeth. instead painful fissures and recurrent pyogenic infections of the skin seem to be the most common medical complications. however, a number of pls patients with abscesses or pseudotumors of the liver have been described. there have been reports of pls patients with other stigmata such as growth retardation, non-symptomatic intracranial calcifications and mental retardation furthermore, coinheritance of pls and albinism type has been reported. case presentation: a yr old girl admitted to our hospital with chief compliant of skin lesions since early months of birth. in the past medical history; she had skin abscess and failure to thrive. on admission she had erythematous, shiny skin with generalized dry scaly predominantly palmoplantar hyperkeratosis and loss of teeth except four or five molar teeth. she informed that she had malformed teeth since childhood which fell off one by one. she had also poor oral hygiene non-pitting edema on lower extremities. no hepatosplenomegaly detected. family history was negative. she investigated for probable immune-deficiency with regard to skin lesions, history of skin abscess and ftt the lab finding are as following: cbc diff = normal ,crp = neg, esr = , ast = , alt = , alph = , alb = . , total pr = . , urea = , cr = . igg = , igm = , iga = , ige = . , cd = %, cd = %, cd = %, cd = %, cd = %, cd = % conclusion: according to nearly normal lab values and presenting signs such as: generalized pyogenic periodentitis, palmoplantar hyper keratosis and negative family history were attributed to a very rare autosomal recessive disorder with ectodermal dysplasia known as papillon-lefevresyndrome manifesting with palmoplantar hyperkeratosis and severe early onset of destructive periodontal leading to pre-mature loss of both primary and permanent dentitions. nijmegen breakage syndrome (nbs) is a rare autosomal recessive syndrome of chromosomal instability mainly characterized by microcephaly at birth, combined immunodeficiency and predisposition to malignancies. the disease is caused by mutations in the nbs gene, which encodes nibrin, a component of the hmre -rad -p complex involved in cellular response to dna doublestrand breaks. the aim of the present case report was to discuss two siblings with immunologically and clinically different phenotypes of disease presentation and to make an attempt to explain possible genotype-phenotype relation. the two patients and their non-consanguineous parents were clinically, laboratory and genetically investigated. for mother and father we observed no clinical presentation and no immunological abnormalities. sibling no. ( years old boy) had no history of recurrent infections and no deviation in immunological tests. sibling no. . ( month old girl) had recurrent infections since birth and iga, igg and igg deficiency as well as t-and b-cells deficiency. cytogenetic analysis revealed variable percent of spontaneous chromosomal instability which was more severe (in % of chromosomes analyzed) in sibling no. . additionally we sequenced bi-directionally ( amplicons) the dna samples from all family members to survey the germline genetic variation in the nbs gene. the del (exon ) was detected in both siblings in homozygous and in both parents in heterozygous feature. in order to explain different clinical and immunological presentation of two siblings the rest of the nbs exones were analyzed for genetic heterogeneity. no additional changes were observed. in conclusion patients with the same nbs genotype may show different phenotypes. other gene/epigenetic factors seem to play a role in phenotype modulation. omenn syndrome [mendelian inheritance (omim )] is an autosomal recessive form characterized by the presence of fatal generalized severe erythroderma, lymphoadenopathy, eosinophilia and profound immunodeficiency. objective: we studied clinical and immunological presentation of the disease manifestation and frequency c. - delaa (p.k vfs ) in rag gene among eastern slavs population. results: we collected clinical and immunological data of patients ( from belarus, -ukraine, -russia) females, males. age of omenn syndrome manifestation varied from st day of life to yr month. age of diagnosis - days to year months. in patients had classical immunological phenotype t(+/-)b-nk+, pt had tlowb + nk + with cd + tcrgd + expansion. in pts had mutation in rag gene, in had c. - delaa (p.k vfs ) in one or two alleles. at present moment in pts are alive, were transplanted, pt is prepared to bmt. conclusion: this study demonstrates that the most popular genetic abnormalities in eastern slavs children with omenn syndrome is c. - delaa (p.k vfs ) in rag gene. this information may be useful for rapid diagnostic of omenn syndrome in laboratories used sscp (single strand conformation polymorphism) before sequencing. under examination the patient particularly bright phenotype attracted attention: microcephaly, "birdlike" facial features (sloping forehead, nape, hypoplasia of brow ridges, broad nasal bridge and protruding midface, hypoplasia of the mandible). in addition, besides specific anomaly of the facial bones we noted: big ears, sparse hair and clinodactyly of the fifth fingers. clinical and immunological characteristics: the feature of the case is pancytopenia syndrome we have diagnosed at the early stages of observation and which is continued throughout the period of observation. erc - . - . x /l hb - - g/l leuk - . - . x /l neu - - % ( - cells/mcl) plt - - x /l data of immunological examination: iga - , g / l igm - , g / l igg - , g / l (other results of immunological examination are without features) the deep insufficiency of antibody production in our patient was the cause of serious, recurrent, and subsequently chronic bacterial sinopulmonary infections after years old. the results of clinical laboratory and immunological examination without significant features: erc - , - , x /l hb - - g/l leuk - , - , x /l neu - - % ( - cells/ mcl) plt - x /l iga - , g/l - . g / l igm - , g/l - . g / l igg - , g/l - . g / l (other results of immunological examination are without features) the x-linked chronic granulomatous disease (cgd) is a primary phagocytic cell deficiency characterized by severe bacterial and fungal infections of various organs. we report of a years of a male patient with xlinked cgd who presented with recurrent hepatic abscesses as the sole manifestation of the disease. phagocytic and bactericidal activities of granulocytes were studied by using microbiological assays. generation of superoxide anion by blood granulocytes was measured by the ferricytochrome c reduction test. cgd is an immunodeficiency caused by mutations in genes encoding subunits of the nadph oxidase complex. normally, assembly of the nadph oxidase complex in phagosomes of phagocytic cells leads to a "respiratory burst" essential for the clearance of microorganisms. cgd patients lack this mechanism, which results in life-threatening infections and granuloma formations. the leading cause of death are pneumonia and pulmonary abscess, septicemia and brain abscess. in neurogical manifestations various pathogens have been involved including aspergillus spp., s. prolificans, a. infectoria, salmonella and staphylococcus spp. there are only some several reports on fungal brain and spinal cord infection, aspergillus abscess resembling brain tumor, meningitis due to streptococcus and candida spp. in the past years we treated children with cgd. we present the infectological challenge of an x-linked cgd patient with brain abscess. in spite of our effort we were unable to identify its causative pathogen. empiric therapy sometimes resembles polypragmasia in cgd. to decrease mortality and morbidity from fungal infections in cgd the prophylactic use of itraconazole or voriconazole is widely recommended. a relatively new azole, posaconazole is active in pulmonary and cerebral fungal manifestations , indeed may be effective against fungi with inherent resistance to ampb or voriconazole. there was no etiological diagnosis in our case that did not respond to conventional antifungal and antibacterial treatment. based upon the findings and literature data we presume the causative agent might be some kind of moulds. we suppose the use of echinocandin and posaconazole as salvage ("prophylactic") therapy has resulted significant regression of the brain abscess. the diagnosis of chronic granulomatous disease (cgd) was verified in children during the past few years in the department of clinical immunology of regional children's hospital of chelyabinsk (russia). in our opinionin casesthe diagnosis was establishedearly enough. michael w. transferred to the neonatal pathology unit of our clinic at the age of days with vesiculopustules. take into consideration our own experience of observing children with this form of primary immunodeficiency in previous years, the child was conducted immunological examination, in particular, the test of restoration nitroblue tetrazolium by superoxide anionformed when oxygen explodes in leukocyte (nitro blau tetrasolium -nbt-test). this decision is caused by the fact that previously observed children with chronic granulomatous disease, had vesiculopustules in % at birth. the survey has revealed a complete lack of production of reactive oxygen species by neutrophils in the evaluation of nbt-test, which allowed us to suggest the diagnosis of cgd. the baby was banned vaccination against tuberculosis, and after reliever vesiculopustules the boy was discharged home. however, at the age of month the baby suffered from glandular abscess and right-segmental pneumonia. in cbc there is expressed anemia (hb g/l, erythrocytes - . x /l), leukocytosis ( x /l), accelerated esr ( - mm/h). at the age of months in the university of debrecen, medical and health science center debrecen, hungary, molecular genetic studywas conducted by prof. dr. laszlo marodi. it was revealed a mutation in c. g > a in exon of gene cybb (encoding subunit gp -phox), after that the diagnosis of cgd was finally verified. it was assigned a basic preventive antimicrobial therapy by trimethoprimsulfamethoxazole, and itraconazoleto prevent fungal infections. despite this since months the child has repeatedly and consistently suffered from bilateral groin lymphadenitis during the year, acute hematogenous osteomyelitis of the left ulna, pneumonias, purulent mesadenitis, endoperitonitis. the fact that the child aged months was diagnosed sepsisis evidence of the severity of infectious complications. clinical and biochemical blood tests were distinguished by consistently high levels of esr and the presence of leukocytosis, and also severe anemia. now the child is years months, he is undergoing treatment at the department of clinical immunology, russian children's clinical hospital (moscow) after bone marrow transplantation. case history № , christina n. from the early history we know that the girl's newborn period was uneventful. she was vaccinated against tuberculosis in the nursing home (no reaction). it was noted the formation of abscesses after vaccination against whooping cough, diphtheria and tetanus in and . months. in years months she suffered from mezootit. for the first time the girl came under our observation in the children's hospital in chelyabinsk (russia) at the age of years with right segmental pneumonia, complicated by the destruction. after further examination it was diagnosed tuberculosis of intrathoracic lymph nodes to the right with upper lobe bronchopulmonary defeat. to take into consideration given above, it was conducted immunological test that revealed a complete lack of production of reactive oxygen species by neutrophils in the evaluation of nbt-test. on the basis of the history, clinical manifestations and results of immunological examination chronic granulomatous disease was diagnosed. after fourmonth period treatment a recovery came from tuberculosis and child was transferred to outpatient monitoring. in years in this family a second daughter was born -arina n. taking into account revealed immunodeficiency of her sister, the child was not vaccinated against tuberculosis on our recommendations. a six-month-old child was conducted immunological examination, which, like her older sister, also shows a complete lack of production of reactive oxygen species by neutrophils in the evaluation of nbt-test. during the molecular genetic studies of both sisters it was identified identical mutation c. - del gt gene ncf (encoding subunit p phox). now the older girl is and her sister is years old. observing them in the dynamics neither of them do not show any life-threatening infections. thus, the recovery test of nitrobluetetrazolium by superoxide anion formed when oxygen explodes in leukocyte (nitro blau tetrasolium -nbt-test) is a fairly reliable method of early diagnosis of chronic granulomatous disease. chronic granolomatous disease (cgd) is due to defective phagocyte superoxide production leading to impaired microbial killing. it is comprised of a group of five genotypes with a common phenotype, chracterized by recurrent severe bacterial and fungal infections and tissue granuloma formation. patients with cgd often present with pneumonia, liver abscess, skin infections, lymphadenitis, osteomyelitis. a five month old boy was referred to pediatric infection unit by lymphadenitis. on the medical history, he had taken antibiotic therapy for lymphadenopathy when he was months old. the abnormal eye movement was noticed by the family and on the eye examination peripheric chorioretinal hypopigmented lesions were determined when he was months old. İn his labratory examination, viral serology were negative. his parents were not consanguineous. his mother's brother had died at years old. he had history of skin infections and osteomyelitis. his grandmother had been diagnosed as having tuberculosis lymphadenitis one year ago. on his physical examination, his growth was normal, patological findings were horizontal nistagmus, / degree systolic murmur, fistulized lymph tissue on the left submandibuler region. on the laboratory findings; he had anemia and neutropenia. immunglobulin levels and lymphocyte subtypes were normal. his respiratory burst activity was very low. chronic granulamatous disease was thougth in the patient by the clinical and laboratory findings. İt was detected gp phox mutation in the genetical analysis. he was diagnosed as having x-linked cgd. antibiotic prophylaxis (tmpsmx, flucanazol) and interferon gamma were started. he is months old now and he is on the list of match unrelated donor screening. patiens who has history of lympadenitis, skin infections and chorioretinal findings should be evaulated for the x-cgd. leucocyte adhesion deficiencies (lads) are rare autosomal recessive inherited disorders. three different forms of lads have been described so far. in lad-i, the most common leucocyte adhesion deficiency, the function of β integrin cd is lost. . while one of the first signs of the disease consist in delayed separation of the umblical cord, severe infections already start early during infancy. another feature of lad-i includes impaired wound healing. therefore, mortality during infancy is high. a fifty day old boy was referred to the hospital due to diarrhea and leukocytosis. the patient was delivered following an uncomplicated full term pregnancy. the parents were first degree cousins. father's brother and mother's uncle had died during infancy period. his umblical cord had separated on the th day. patient had applied because of diarrhea by starting in the first days of life and leukocytosis was detected ( . / mm ). on the physical examination, his body weight was gr ( th to th percentile) and his height was cm ( th percentile). there was a granuloma on the umbliculus. other systems were normal. in the laboratory examination, leukocyte count was high, immunoglobulins, respiratory burst activity, gaita analysing and culture were normal. in the lymphocyte subtype analysing, cd + b cells ratio was mildly low. cd , cd a, cd b, cd c levels were found to be very low. in the genetic analysing, it was detected two deleterious mutations in the itgb gene. patient had been diagnosed as lad- . he treated by antibiotics and then started prophylactic antibiotherapy. family screened for tissue match. his older sister was found full matched. he was referred to transplantation unit. it was applied bone marrow transplantation when he was months old. presence of delayed umblical cord separation and leucocytosis should be considered in the diagnosis of lad but these patients might have different symptoms such as diarrea. mendelian susceptibility to mycobacterial disease (msmd) is a rare entity. patients with msmd have susceptibility to salmonella and some other intracellular microorganisms in addition to weakly pathogenic mycobacterial species. il- rβ deficiency, most common form of msmd, is caused by mutations in the il rb gene. patients who have symptoms suggestive for msmd or history of sibling death due to bcgosis were evaluated. the expression of the il- rb was detected in patients and family members by monoclonal antibodies on the lymphocyte surface by flow cytometry after the lymphocytes were stimulated in vitro with pha. mutation analyses was done by sanger sequencing. all index cases were presented either with bcg or salmonella infection. two patients, though they were bcg vaccinated had no clinical symptom, six presented with the symptoms of salmonella infections, two developed leukocytoclastic vasculitis, candidiasis was the accompanying feature in seven. recurrent leishmaniasis that necessitated subcutaneous interferon-γ and prophylactic amphotericine b therapy was present in a patient. in all patients the percentage of lymphocytes with il rβ expression was found to be less than % . prophylactic antimycrobial treatment and in severe and resistant infectious episodes if-γ therapy, should be given. many patients have associated mucocutaneous candidiasis. the prognosis is good unless the patient admits at the later stages of bcg infection. the results of our patients showed that the analysis of the surface expression of il rβ on activated lymphocytes is an effective diagnostic method which can also be used in screening of the patients with probable msmd. introduction: mendelian susceptibility to mycobacterial disease (msmd, online mendelian inheritance inman ) is a rare immunodeficiency characterized by predisposition to infections caused by weakly virulent mycobacteria, such as mycobacterium bovis bacille calmette-gue´rin (bcg), environmental nontuberculous mycobacteria (ntm), and salmonella strains in otherwise healthy individuals. il- rb deficiency is the most common form of msmd and is characterized by childhoodonset mycobacteriosis with frequent recurrence. it has been found that patients with il- rb deficiencies are also prone to developing infections with nontyphoidal salmonella species with bacteremia and lymphadenopathy. here we present a girl with recurrent cutaneous leukocytoclastic vasculitis (clv) with salmonella enteritidis due to il- rb deficiency. case report: a four year old girl that had been diagnosed serologically with recurrent salmonella infections, associated with lymphadenopathy and skin eruption was admitted as having henoch-schönlein purpura. she had been vaccinated with bcg and developed left axillary lymphadenitis which spontaneously drained and had recurrent oral monilia plaque. edema and purpuric eruptions were present on the upper and lower extremities and the abdomen.multiple mobile, painful,enlarged submandibular lymph nodes of about x cm in diameter were palpable. skin biopsy showed a dense inflammatory site with eosinophils, neutrophils and fibrin in the upper dermis and dermal vessel wall,compatible with leukocytoclastic vasculitis. serological studies to assess diagnostic markers for vasculitis and infectious agents were all negative. immune work-up were unremarkable other than hypergammaglobulinemia. salmonella enteritidis was identified in blood culture. she responded dramatically to ceftriaxone treatment within a few days and lesions cleared completely. extended immunological and molecular genetic examination of the patient was carried out for il- /ifn-γ pathway defects. on the facs analysis of t cells for cell surface expression of the cytokine receptor chains, she did not express any il- rβ . discussion: in thepresent report, we describe a child with clv with salmonella enteritidis due to il- rb defi-ciency.in a large cohort of patients with il- rb deficiency, ntm, m. tuberculosis, disseminated bcg infection after inoculation with the vaccine, and salmonella infection have been described. sporadic cases with other infectious agents have also been reported. salmonella infections reported in these patients were due to extraintestinal, or septicemic, recurring infections caused by nontyphoidal salmonella species. only two il- rb -deficient patients have been identified with vasculitis due to salmonella strains; both came from turkey, where consanguineous marriages are common. kutukculer and colleagues reported the first case of s. enteritidis-associated clv. sanal and colleagues reported a clv case associated with group d salmonella infection. leukocytoclastic vasculitis is an immune complex mediated disease predominantly involving small vessels of the skin and can be associated with drugs or can be found as a component of other disease, such as infections, connective tissue disorders, and malignancies. infectious agents can cause vasculitis directly or clinically mimic primary vasculitis .multiple infectious agents have been suspected as triggering or contributory factors in the vasculitic process . several factors contribute to the primary vasculitis related to infections: a type or immune-complex reaction, cell-mediated hypersensitivity, abnormal immune regulation, and direct endothelial cell invasion by infectious agents. in our case, extensive evaluation was performed to determine the underlying vasculitis process. clinical and laboratory examinations revealed no association between vasculitis and other infections or an underlying connective tissue disease or medication. she responded well to ceftriaxone treatment, and clinical manifestations gradually resolved within a few days, providing strong evidence that improvement of the vasculitic lesions was due to elimination of the salmonella with antibiotics conclusion: our patient has one of the exceptional forms of il- rb deficiency, with recurrent clv due to salmonella enteritidis. although common presentations for salmonella infection in individuals with il- rb deficiency are lymphadenopathy and bacteremia, it can be present clinically as clv. some infections such as salmonella may be responsible for different types of vasculitis even though they are not common . in this respect, clinicians should be aware of possible infectious causes of vasculitis, and children presenting with unusual recurrent infections caused by non typhoidal salmonella, bcg, or ntm should be investigated for ifn-γ ⁄ il- pathway defects. gülez n.; genel f. dr. behcet uz children hospital allergy-immunology department, izmir, turkiye the complement system is an important part of the innate immune defense and also plays a major role in shaping the adaptive immune response. these functions are required for a good defense against infections, especially bacteria. the c deficiency is a rare disease that is associated with recurrent neisserial infections, especially meningits caused by n. meningitidis. the patient, a seven years old girl was admitted to hospital with high fever and diffuse, purple-coloured skin lesions. her symptoms gave the diagnosise meningococcal meningitis. she had also earlier been diagnosed with the same disease when she was years old. a sister to the patient had died from meningitis at years of age. she has also one older and one younger sister. there is no consanguinity between her parents. the laboratory analyses of the classical pathway measured as complement hemolytic activity (ch ) and c concentration revealed no activity and absence of c , respectively. analysis of serum from her younger sister showed the same results, while her older sister's ch and c levels were found normal. thus, our patient and her younger sister were diagnosed with hereditary c deficiency. the genetic analyses have not been completed yet. we here report the third and fourth cases of c deficiency in turkish patients. interferon-g receptor- (ifngr ) deficiency is caused by mutations in ifn-γ receptor- gene and is characterized mainly by susceptibility to mycobacterial disease. we report a boy with complete recessive ifngr deficiency, afflicted by recurrent mycobacterial diseases with m. bovis, m tuberculosis, m. avium intracellulare and m.fortuitum. genetic analysis showed a homozygous mutation ( inst) in ifngr gene leading to complete ifngr deficiency. in addition, he had atypical mycobacterial skin lesions caused by m.avium intracellulare and he developed scrotal and lower limb lymphedema secondary to compression of large and fixed inguinal lymphadenopathies. to our knowledge, the patient is the first case with interleukin- /interferon − γ pathway defect and severe lymphedema. defects in the il- / ifn − γ pathway must be considered in patients with disseminated or recurrent mycobacterial infections and in patients with severe viral infections, especially in countries where bcg vaccination is part of the national health programme. it must be kept in mind that these patients may develop granuloma-like skin lesions and severe lymphedema. hsct must be applied at the earliest time before developing organ damages. t lymphocyte/nk cells. restricted defective molecules in the circuit and recently discovered cybb responsible for autophagocytic vacuole and proteolysis have been identified in around % of patients with the mendelian susceptibility to the mycobacterial disease (msmd) phenotype. primary defects in oxidase activity in chronic granulomatous disease (cgd) lead to severe, life-threatening infections. the role of phagocytic respiratory burst in host defense against mycobacterium tuberculosis was controversial. previous studied showed that the critical role at reactive oxidants is to serve as intracellular signals for activation of microbicidal enzymes, rather than excretions a microbicidal effect perse.the role of phagocytic respiratory burst in host defense against m. tb is further supported by recent studies discovered immunological defects secondarily affecting phagocyte respiratory burst function and resulting in primary immunodeficiencies with varied phenotypes, including susceptibilities to pyogenic or mycobacterial infections. the patients with severe pid's like scid have broader diverse infections susceptibility and mycobacterial infections as well, however, common variable immunodeficiency (cvid) mostly characterized by a deficiency of immunoglobulins and recurrent sinopulmonary infections. method: we overview the clinical rate of mycobacterial disease in our pid cases and evaluate the complex cases. results: two hundred pid cases were evaluate between - in our clinic, among % of them which diagnosed as msmd nearly all presented with mycobacterial infection. % diagnosed as cgd and interestingly % of them have been experienced mycobacterial disease sometimes in their life, as disseminated bcg or late onset complications of bcg including osteomyelitis or mtb once or more than one episode through their life. also we have presented a cvid patient with disseminated tb and granulomatouse hepatitis, tb arthritis , peritonitis and a patient with lad and nontubercolouse mycobacterial infectiouse abcesses of her skin. conclusion: pid cases like cgd, msmd or cvid which are living in area's with high prevalence of mycobacterial infection could have quiet different presentations and the study of these complex cases has provided essential insights into the functioning of the immune system. despite the conventional view we have confirmed that the generation of rois by phagocytic respiratory burst may play a role in the defense of the host against m. tuberculosis by clinical evidence. goran ristic, srdjan pasic, bojana slavkovic division of clinical immunology, mother and child health care institute of serbia, belgrade chronic granulomatous disease (cgd) is a rare disease caused by mutation in any of the five components of the nicotinamide adenine dinucleotide phosphate (nadph) oxidase in phagocytes, resulting in recurrent, life-threatening bacterial and fungal infections of the affected individuals. our proband male patient presented at age of years with bilateral pneumonia and positive serology for aspergillus sp. the phorbol myristate acetate (pma) stimulated nitroblue tetrazolium (nbt) test showed no reduction ( %) in our patient and partial reduction ( %) in his mother. analysis of the cybb gene showed a deletion of nucleotide g (c. delg) exon causing frame shift mutation and early termination of translation (p.val serfs). this mutation was not previously described. at the moment of diagnosis, his mother was already pregnant, th week of gestation. fetal ultrasound showed that she was carrying a male fetus. the fetal blood sample, obtained by the percutaneous umbilical cord blood sampling, showed male karyotype and the pma stimulated nbt test showed % reduction. there were no complication during pregnancy or delivery and a healthy boy was born. the proband patient underwent allogenic hsct, his sister was the identical sibling donor. in the cases where the family-specific mutations are unknown, partial or complete gene deletions can be recognized by multiplex ligase-dependent probe amplification (mlpa) or array comparative genomic hybridization ( features of the patients with ar-hies dock- deficient and non-dock- deficient group are given in the table . all patients with dock- deficiency presented with cutaneous viral infections or early onset and severe atopic dermatitis. many have also food allergy and/or asthma. neurological complications and malignancy were seen in % and % respectively. sixty seven percent of patients had low t; %, low cd levels; %, high ige. the latter features were shared between patients with or without dock- deficiency, except atopic dermatitis which was mild when present in patients without dock- deficiency and ige levels were only mildly high or normal. we identified stk and coronin a deficiency in two siblings each among the patients who showed overlapping features with ar-hies and do not have dock- deficiency. our results showed that patients with dock deficiency have early onset and more remarkable eczema, food allergy, asthma, more marked eosinophilia, higher ige, low igm levels and development of malignancy. these features may be helpful in differentiation dock patients from patients without dock- deficiency. it seems routine lymphocyte subset study results are not helpful for this differentiation. alişan yıldıran , stephan borte murat elli , tunç fışgın ondokuz mayıs university, school of medicine, samsun-turkiye immunodeficiency center leipzig (idcl) at klinikum st. georg ggmbh, leipzig-germany hsct might be curative for some pids. our immunology and transplantation center was newly established. we retrospectively reviewed all children with pid who diagnosed and received hsct at ondokuz mayıs university or somewhere between june and december . twenty-two patients were identified. four of them were referred to us for hsct from other centers. the median age was months ( month- yr) at hsct. patients' diagnoses were scid (n = ), chs (n = ), leukocyte adhesion deficiency (n= ), mhc class ii deficiency (n= ), chronic granulomatous syndrome (n = ), hlh (n = ), was (n = ) and omenn's syndrome (n = ). seven patients received hla-matched related hsct; twelve haploidentical hsct and two matched unrelated hsct. one scid patient died just after her diagnosis. two patients developed bcgosis secondary to reactivation of pretransplant vaccination. one of them died due to hemophagocytic bone marrow aplasia, and the other has recovered. five patients had graft failure; two of them received no conditioning regimens because of general health status and the other because of cmv infection. at a median follow up of months (range - ), patients are alive, with overall survival of %. we conclude that; our clinic undertakes an important duty in our region for pid patients. also, different pid's could be seen in our region. nerological complication patient (epilepsy, brain infarct) outcome died (one with post -bmt comp., with malignancy all alive department of pediatrics and adolescent medicine department of allergology, rheumatology and clinical immunology, university children's hospital, university medical centre, ljubljana, slovenia. developed.there is no severe life-threatening complications development. we describe here a patient with invasive cryptococcus laurentii infection and the x-linked form of hyper-igm syndrome (x-higm). c.laurentii is an extremely rare human pathogen. this fungus was previously considered saprophytic and non-pathogenic to humans, but it has been isolated as the etiologic agent of skin infection, keratitis, endophthalmitis, lung abscess, peritonitis, meningitis, and fungemia. most affected individuals had a compromised immune system because of leukemia, cancer, diabetes mellitus, aids, or prematurity. repeated isolation of c.laurentii from the oropharynx of an immunocompromised patient has also been documented. invasive c.laurentii infection has not been reported in patients with any form of primary immunodeficiency disorder emphasizing the true rarity of disease due to this fungus. two groups have recently reported that dectin- deficiency due to the mutation of clec a or premature termination of the dectin- signal transduction molecule card may predispose patients to chronic mucocutaneous candidiasis (cmc). we studied the frequency of clec a mutation in healthy individuals, patients with the hyper-ige syndrome (hies), and patients with autoimmune polyendocrine syndrome type (aps- ), all aged between to years. genomic dna was isolated from peripheral blood. monocytes and monocyte-derived dendritic cells (mddcs) were used to study the phenotypic expression of dectin- . clec a gene was sequenced with the big dye terminator cycle sequencing kit. mononuclear cells (mcs) were isolated from heparin-treated venous blood. mdccs were obtained by culturing monocytes isolated by immunomagnetic cell separation assay. receptor expression was assessed by flow cytometry. secretion of il- a by mcs stimulated with killed c. albicans blastoconidia was assessed by elisa. we report here on healthy individuals with homozygous (one year-old man) or heterozygous ( men and women) tyr x mutation in the dectin- gene but no signs of cmc. dectin- levels on monocytes and mddcs were negligible in the homozygous man and the heterozygous individuals displayed intermediate levels of dectin- , between those of the homozygous man and the wild-type controls. markedly lower levels of il- a production were observed in the cells of the man with the homozygous mutation than in the control cells. levels of production of this cytokine were intermediate in heterozygotes. the frequency of tyr x heterozygous individuals was % among healthy donors and % in patients with hies and % in patients with aps . importantly, the year-old hies girl with heterozygous tyr x mutations has never had mucocutaneous candidiasis. we suggest that dectin- receptor-mediated immunity is redundant for host defense against cmc, possibly due to the involvement of multiple lectin receptors in the recognition and uptake of candida. chronic mucocutaneous candidiasis (cmc) is a heterogenous group with recurrent chronic candida infections spesifically involving nails, skin and oropharynx. several immunodeficiencies as dock- deficiency, severe combined immune deficiency, autoimmune polyglandular syndrome type (apeced), il- rβ and il- p deficiencies, card , stat- and stat- can cause cmc. we report here a years old boy, born to consaginous parents with onicomycosis, moniliasis, recurrent pneumonia, recurrent herpetic lesions, autoimmune thyroiditis and trombocytopenia. last admission was due to generalized tonic-clonic convulsion and mycotic aneurism on middle cerebral artery was detected. flow cytometry revealed cd lymphopenia, immunoglobulin values were in normal range. polymorphism on exon for aire gene (t/c heterozygot g g) and heterozygot stat mutation (c. > a; q h) were detected. various stat gof mutations (affecting the coiled-coin domain or the dna-binding domain) have been systematically associated with susceptibility to cmc. autoimmune manifestations associated with stat- mutations have been attributed to increased type interferon. the aneurism formation is not elucidated whether it's due to candida infection or vascular damage directly affected by stat- mutation. purpose: chronic granulomatous disease (cgd) is a rare genetic disease of phagocytic system. affected patients commonly present with bacterial infections associated with pneumonia, abscesses and lymphadenitis. in this study, we investigated the clinical and laboratory findings of our cgd patients. materials and methods: the demographic data (age at diagnosis, initial presenting symptoms, family history, follow-up period), mutation analysis, therapy options, complications, radiological findings and prognosis were evaluated retrospectively. results: among cgd patients, autosomal recessive form was detected in of them. the age at onset was statistically lower in x' linked cgd patients than ar form ( . ± . mo vs . ± . mo; p = . ).respiratory tract infections (sinusitis, otitis, pneumonia) and recurrent abscesses were more commonly seen at onset. microbiological culture revealed a. fumigates from lung biopsy in one patient and s.marcescens from blood specimen in other ones. bcgitis was observed in one patient and five patients received anti-tb therapy. non-infectious complications were granulomatous uveitis, recurrent pericardial effusion, skin granuloma, noduler formation in lung and brain area. conclusion: due to high rate of consanguinity, autosomal recessive inheritance was observed highly in our patient cohort. since, patients with cgd are susceptible to tuberculosis and bcg complications; initiation of tuberculosis prophylaxis is advisable in countries where bcg is still administrated at birth. key words: chronic granulomatous disease, consanguinity, bcg. acquired immunodeficiency research center, isfahan university of medical sciences, isfahan, iranbackground: defects of the immune system in primary immunodeficient diseases (pids) predispose individuals to recurrent infections. complex genetic components for susceptibility to mycobacterial disease have been suggested. natural human immunity to the mycobacteria group, including mycobacterium tuberculosis(mtb), bacille calmette-guérin (bcg) or nontuberculous mycobacteria (ntm) relies on the functional il- / -ifn-γ integrity of macrophages (monocyte/dendritic cell) connecting to key: cord- -kn ghlv authors: de chaisemartin, clément; de chaisemartin, luc title: bcg vaccination in infancy does not protect against covid- . evidence from a natural experiment in sweden date: - - journal: clin infect dis doi: . /cid/ciaa sha: doc_id: cord_uid: kn ghlv background: the bacille calmette-guérin (bcg) tuberculosis vaccine has immunity benefits against respiratory infections. accordingly, it has been hypothesized to have a protective effect against covid- . recent research found that countries with universal bcg childhood vaccination policies tend to be less affected by the covid- pandemic. however, such ecological studies are biased by numerous confounders. instead, this paper takes advantage of a rare nationwide natural experiment that took place in sweden in , where discontinuation of newborns bcg vaccination led to a dramatic fall of the bcg coverage rate, thus allowing us to estimate the bcg’s effect without the biases associated with cross-country comparisons. methods: numbers of covid- cases and hospitalizations were recorded for birth cohorts born just before and just after , representing , , and , , individuals, respectively. we used regression discontinuity to assess the effect of bcg vaccination on covid- related outcomes. this method used on such a large population allows for a high precision that would be hard to achieve using a randomized controlled trial. results: the odds ratio for covid- cases and covid- related hospitalizations were · (ci : [ · - · ]) and · (ci : [ · - · ]), allowing us to reject fairly modest effects of universal bcg vaccination. we can reject with % confidence that universal bcg vaccination reduces the number of cases by % and the number of hospitalizations by %. conclusions: while the effect of a recent vaccination must be evaluated, we provide strong evidence that receiving the bcg vaccine at birth does not have a protective effect against covid- among middle-aged individuals. the bacille calmette-guérin (bcg) vaccine is an attenuated live vaccine that has been proven effective against tuberculosis, in particular its severe manifestations like meningeal and miliary tuberculosis [ ] . besides its specific effects, the vaccine has immunity benefits against non-targeted pathogens [ ] , and in particular against respiratory infections caused by rna viruses like influenza [ ] . these effects are thought to be mediated mostly by "trained immunity", a recently described mechanism of epigenetic reprogramming of innate immune cells [ ] . while this mechanism is still under investigation, most studies show that these effects tend to wane after to years [ , ] . since sars-cov- is also a single-stranded rna virus, it has been hypothesized that differences in bcg vaccination coverage could explain the wide differences in disease burden observed between countries. a pioneering preprint paper by miller et al. found that countries with universal bacillus calmette-guérin (bcg) childhood vaccination policies tend to be less affected by the covid- pandemic, in terms of their number of cases and deaths [ ] . while unpublished, this study had a great impact and gave rise to many comments and follow-up studies (reviewed in [ ] ). some published studies were able to replicate this result [ ] [ ] [ ] , but several authors underlined the important statistical flaws inherent to such ecological studies and concluded that randomized controlled trials (rct) were necessary to address the question [ , ] . as of june th , no less than randomized controlled trials (rcts) studying the protective effect of the bcg against covid- are already registered on https://clinicaltrials.gov/. however, none has a primary completion date earlier than october st , so these rcts' first results will not be known until at least five or six months. with the epidemic still on the rise worldwide, and in the absence of a sars-cov- vaccine, there is an urgent need to know if bcg non-specific effects could be harnessed as a substitute prophylactic treatment. regression discontinuity (rd) is a method designed by social scientists to assess the effect of an exposure on an outcome. it is deemed as reliable as rcts to tease out causality from correlation [ ] , a c c e p t e d m a n u s c r i p t and typically yields results similar to those obtained in rcts [ , ] . in this paper, we applied this method to a rare natural experiment that took place in sweden. sweden currently has the th highest ratio of covid- deaths per capita in the world. in april , it stopped its newborns bcg vaccination program, leading to a dramatic drop of the bcg vaccination rate from % to % for cohorts born just before and just after the change [ ] . we compared the number of covid- cases and hospitalizations per capita, for cohorts born just before and just after april , representing , , and , , individuals, respectively. using rd, we were able to show that those cohorts do not have different numbers of covid- cases and hospitalizations per capita, with a high precision that would hardly be possible to reach with a rct design. regression discontinuity (rd) is a commonly-used method to measure the effect of a treatment on an outcome [ ] . it is applicable when only individuals that satisfy a strict criterion are eligible for a policy. then, rd amounts to comparing the outcome of interest among individuals just above and just below the eligibility threshold. in this study, rd will amount to comparing the number of covid- cases, hospitalizations, and deaths among individuals born just before and just after april st . the effect of universal bcg vaccination for individuals born around april st, was estimated using the state-of-the-art estimator for rd [ ] . the estimator amounts to comparing treated and control units, in a narrow window around april st . it uses linear regressions of the outcome on birth cohort to the left and to the right of the threshold, to predict the outcome of treated and untreated units at the threshold. then, the estimator is the difference between these two predicted values. the estimator and % confidence interval were computed using the rdrobust stata command, see [ ] . the rd estimator in [ ] assumes that the variable determining exposure is continuous, but it has also been used when that variable is discrete but takes a large number of values. our analysis is at the quarter-of-birth level, so the variable determining exposure to bcg vaccination is not continuous, but it takes a large number of values. for instance, we observe cases/ inhabitants for qbcs. the validity of the rd estimator is usually assessed by testing if observations to the left and to the right of the threshold have similar characteristics [ ] . in the supplementary table a c c e p t e d m a n u s c r i p t finally, because we observe deaths for groups of consecutive ybcs till , there are only two data points after for that variable ( - and - ) , so the rd method cannot be used. in the supplemental materials, we merely use a t-test to compare the death rates in the - and - ybcs. this method is less robust than the rd method we use for cases and hospitalizations, as it does not account for the fact that the average age of the treated and control groups differs by years. this study uses the number of covid- cases per inhabitants for quarterly birth cohorts born table for details. in an rd design, the presence or absence of a treatment effect can be assessed visually, by drawing a scatter-plot with the variable determining eligibility on the x-axis, and the outcome variable on the y-axis. if one observes that the relationship between these two variables jumps discontinuously at the eligibility threshold, this is indicative of a treatment effect. accordingly, figure shows no discontinuity in the numbers of covid- cases per inhabitants for cohorts born just before and just after april . this suggests that universal bcg vaccination has no effect on the number the effects in table are intention-to-treat effects [ ] , as the vaccination coverage pre- was around %, and after the change in policy, about % of the population was still vaccinated. taking into account foreign-born residents ( · % of the swedish population born in ), which were not affected by the policy, the policy led to a drop of the vaccination rate of . %. to convert the intention-to-treat effects in table into the effect of being vaccinated at birth, one needs to divide the intention-to-treat effects and their confidence intervals by · [ ] . in odds ratios, the in this study, we took advantage of a change in vaccination policy in sweden to investigate the link between bcg vaccination in infancy and covid- cases, hospitalizations and deaths, using a regression discontinuity approach. contrarily to most studies on the question, we compared covid- cases between two very similar groups of people from the same country. this allows us to get rid of all confounders linked to crosscountries comparisons, and of confounders like sex or socio-economics status that are often present in observational studies that do not rely on a quasi-experimental design, unlike ours. another strength of this study is its statistical precision. since we could gather nationwide data in a country where covid- rates are high, we are able to reject fairly small effects of the bcg vaccine. achieving a comparable statistical precision in an rct would require an unrealistically large sample. even with a covid- hospitalization rate of · %, as among the elderly swedish population, a randomized controlled trial that could reject bcg effects larger than % of the baseline hospitalization rate, as in our study, would require including around , participants. while previous studies mostly addressed differences in bcg vaccination policies but did not account for differences in actual bcg coverage, we work with two populations with well documented and very different vaccination rates. the termination of the universal bcg vaccination program in sweden had dramatic effects on the bcg coverage rate. based on nationwide reports on the vaccination status of children below sent to the national bacteriological laboratory in , % of children born in got vaccinated, against % of those born in , and less than % of those born between and [ ] . among children born in , most of the vaccinated children were born in the first quarter of the year, when the universal vaccination policy was still in place [ ] . prior to that, sweden had already eliminated its revaccination program at years of age in . sweden also stopped its revaccination program at years of age in , four years before the cohort turned years old. finally, sweden stopped its vaccination program for conscripts m a n u s c r i p t in , long before the cohort would do its military service [ ] . overall, children born before april st benefited from a bcg vaccination policy at birth, while children born after that did not benefit from any bcg vaccination policy. this being said, there is a number of limitations to this work that one has to bear in mind. as in many other countries, folkhälsomyndigheten's cases count probably underestimates the true number of cases, because it only includes cases confirmed by a laboratory test. its deaths count probably underestimates the true number of covid- deaths as well, as it only includes deaths where a covid- diagnosis has been confirmed during the past days. however, these limitations are common to all studies on this question and are unlikely to affect much the results. moreover, cases confirmed by a laboratory test are arguably the more severe ones, given that our data covers a time period where testing resources were scarce in sweden, as in many other countries. our computation of the change of the vaccination rate induced by the policy relies on the assumption that the bcg vaccination rate of foreign-born residents is the same just before and just after april . however, this is a reasonable assumption, since no other european country changed its bcg vaccination policy in . furthermore, rd estimates only apply to units close to the eligibility threshold. for instance, this study estimates the effect of universal bcg vaccination for individuals born around april st , who are in their mid-forties during the covid- pandemic, and cannot be generalized to the entire population. it seems reasonable, however, to speculate that our findings hold true for older people since most studies assessing the long-term heterologous effects of the bcg show they tend to fade rather than increase over time [ , ] . two studies argue that bcg vaccination at birth could have larger effects against covid- on older individuals, those most at risk during the pandemic, than on middle-aged individuals [ , ] . based on the literature, we estimate that this is very unlikely to be the case. a c c e p t e d m a n u s c r i p t moreover, this study does not measure the covid- immunity benefit conferred by a recent bcg vaccination, as individuals born just before q - were vaccinated years ago. the rcts currently underway will tell if the protective effect of a recent bcg vaccination differs from the effect measured in this study. overall, this study shows bcg vaccination at birth does not have a strong protective effect against covid- , at least in middle-aged individuals. thus, it seems that bcg childhood vaccination policies cannot account for the differences in the severity of the pandemic across countries, as had been hypothesized by prior studies [ , , ] . this advocates for a strict adherence to who's recommendation of the vaccine to infants outside of clinical trials [ ] , and for restraint from starting new clinical trials on this question. the former point is of particular importance for a vaccine whose lengthy production process regularly leads to worldwide shortages with dire consequences on children from country with high prevalence of tuberculosis [ ] . while rcts will complement this study by measuring the effect of a recent vaccination, this study comes much before results of the rcts will be made available, and with a greater precision. it exemplifies the potential of leveraging past medical policies and statistical techniques designed in the social sciences to answer current medical questions. ( ), and its % confidence interval is shown in column ( ). the effects and their % confidence interval were computed using the rdrobust stata command, using linear polynomials on both sides of the threshold, and the robust confidence intervals reported by the command. the rdrobust command first selects observations within a narrow bandwidth around the threshold, using the bandwidth proposed in [ ] . then, linear regressions of the outcome on birth cohort are run to the left and to the right of the threshold, to predict the outcome of treated and untreated units at the threshold. finally, the estimator is the difference between these two predicted values. the number of quarters of birth used in the last two steps of the estimation is shown in column ( ). protection by bcg vaccine against tuberculosis: a systematic review of randomized controlled trials the non-specific and sex-differential effects of vaccines non-specific effects of bcg vaccine on viral infections targeting innate immunity for tuberculosis vaccination the duration of protection of school-aged bcg vaccination in england: a population-based case-control study duration of bcg protection against tuberculosis and change in effectiveness with time since vaccination in norway: a retrospective population-based cohort study correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study stop playing with data: there is no sound evidence that bacille calmette-guérin may avoid sars-cov- infection (for now) relation between bcg coverage rate and covid- infection worldwide is bcg vaccination affecting the spread and severity of covid- bcg vaccine protection from severe coronavirus disease (covid- ) demystifying bcg vaccine and covid- relationship regression discontinuity designs in economics empirical tests of the validity of the regression discontinuity design. annales d'Économie et de when does regression discontinuity design work? evidence from random election outcomes the impact of changing bcg coverage on tuberculosis incidence in swedish-born children between and regression discontinuity designs: a guide to practice robust nonparametric confidence intervals for regression-discontinuity designs robust data-driven inference in the regression-discontinuity design what is meant by intention to treat analysis? survey of published randomised controlled trials identification and estimation of local average treatment effects the bcg world atlas: a database of global bcg vaccination policies and practices some evidence of the efficacy of mass bcg vaccination bacille calmette-guérin (bcg) vaccination and covid- global shortages of bcg vaccine and tuberculous meningitis in children key: cord- - usxeo a authors: riksen, niels p.; netea, mihai g. title: immunometabolic control of trained immunity date: - - journal: mol aspects med doi: . /j.mam. . sha: doc_id: cord_uid: usxeo a innate immune cells can adopt long-term inflammatory phenotypes following brief encounters with exogenous (microbial) or endogenous stimuli. this phenomenon is named trained immunity and can improve host defense against (recurrent) infections. in contrast, trained immunity can also be maladaptive in the context of chronic inflammatory disorders, such as atherosclerosis. key to future therapeutic exploitation of this mechanism is thorough knowledge of the mechanisms driving trained immunity, which can be used as pharmacological targets. these mechanisms include profound changes in intracellular metabolism, which are closely intertwined with epigenetic reprogramming at the level of histone modifications. glycolysis, glutamine replenishment of the tricarboxylic acid cycle with accumulation of fumarate, and the mevalonate pathway have all been identified as critical pathways for trained immunity in monocytes and macrophages. in this review, we provide a state-of-the-art overview of how these metabolic pathways interact with epigenetic programs to develop trained immunity. pharmacological modulation of the immune system has taken central stage in the prevention and treatment of a wide variety of diseases. vaccination strategies exploit the immunological memory of the adaptive immune system to prevent infectious diseases. in patients with severe infections, host directed therapy aimed at modulating the immune system is a promising emerging approach . immunosuppressive drugs are the cornerstone of the treatment of patients with auto-immune or auto-inflammatory diseases, such as rheumatoid arthritis, psoriasis, and inflammatory bowel disease. also in patients with atherosclerotic cardiovascular diseases, which are characterized by a chronic low-grade inflammation of the arterial wall, immunomodulating drugs such as canakinumab and colchicine are effective in reducing future cardiovascular events (ridker et al., ; tardif et al., ) . modulating immune system function is not trivial and is often associated with unwanted side effects, such as an increased risk of infections in the case of immunosuppressive drugs. to allow the development of more specific immunomodulatory drugs with less side effects, a deeper understanding of immune cell function in physiological and pathophysiological conditions is warranted. in the past ten years, it has been discovered that innate immune cells, such as monocytes, macrophages, and natural killer cells, can also build an immunological memory, in a process which has been termed trained immunity . key intracellular processes that regulate trained immunity include remodeling of intracellular metabolic pathways as well as epigenetic reprogramming. accumulating evidence points to an important role for trained immunity in a broad spectrum of (patho)physiological conditions . therefore, it has recently been proposed that specific pathways that drive trained immunity offer exciting novel pharmacological targets to modulate immune cell function (mulder et al., ) . the aim of the present review is to provide a state-of-the-art overview of the role of immunometabolism in trained immunity. we will first describe the triggers and functional effects of trained immunity in the context of various clinical situations. subsequently, we will describe in detail how changes in glycolysis, the tricarboxylic acid cycle (tca cycle) and glutaminolysis, oxidative phosphorylation, fatty acid synthesis, and cholesterol biosynthesis contribute to innate immune memory and how these pathways interact with epigenetic programs. finally, we will describe how we can use the knowledge of these mechanisms to ultimately exploit trained immunity to improve patient care. in the traditional immunological dogma, immune memory is restricted to the adaptive immune system in which t-lymphocytes can develop a life-long specific immunological memory by somatic rearrangement of gene elements. this is challenged however by the observations that also plants and non-vertebrate species, which lack adaptive immunity, are able to mount resistance to recurrent infections (netea, quintin, and van der meer, ) . only in the last decade, our lab and others have shown that indeed monocytes are also able to build a long-term pro-inflammatory phenotype after primary stimulation, i.e. a de facto immune memory (kleinnijenhuis et al., ; quintin et al., ) . in the classical experimental design to investigate trained immunity in vitro, isolated human primary monocytes are exposed for h to a microorganism or a microbial ligand; subsequently the cells are washed and rested in culture medium for days, after which they are restimulated for h with unrelated stimuli, such as toll-like receptor agonists: the boosting of cytokine production compared to cells not exposed to the training agent is calculated as a marker of trained immunity . it appeared that cytokine production capacity is profoundly augmented after h exposure to various micro-organisms or microbial products, including bacille calmette-guérin (bcg), candida albicans, and its cell wall component β-glucan. this observation could be corroborated in humans in vivo by showing enhanced cytokine production capacity of isolated monocytes up to one year after bcg-vaccination of healthy individuals . the remarkable evolutionary conservation of trained immunity is probably related to its strong protective effect in the setting of recurrent infections, which has been demonstrated in multiple animal models. in t/b cell-defective rag -deficient mice, a nonlethal dose of live c. albicans improves survival rate following subsequent exposure to systemic candidiasis . also, in severe combined immunodeficiency mice that lack t and b cells, bcg vaccination completely prevents mortality by an otherwise lethal c. albicans infection (kleinnijenhuis et al., ) . that trained immunity is able to protect the host against future infections is also suggested in human in vivo infection models: first, viremic load following yellow fever vaccination (which is a live attenuated virus) was significantly reduced by bcg vaccination days earlier in healthy subjects ; secondly, bcg vaccination alters the clinical and immunological response to experimental malaria infection in healthy subjects (walk et al., ) . given these experimental findings, trained immunity is a plausible explanation for the clinical observation that in newborns, bcg vaccination potently protects against a wide range of severe infections, not only against tuberculosis (benn et al., ) . studies on the use of the bcg vaccine with the sole aim to exploit these beneficial heterologous effects of trained immunity in the clinical setting have been greatly accelerated by the recent pandemic caused by the severe acute respiratory syndrome coronavirus- (sars-cov- ): several randomized clinical trials are currently being performed aiming to prevent coronavirus disease in subjects with increased risk, such as healthcare workers or elderly curtis et al., ) . contrasting the benefits of trained immunity in the setting of infectious threats, it might actually be detrimental in non-infectious chronic inflammatory diseases in which innate immune cells themselves contribute to tissue injury, e.g. rheumatoid arthritis or atherosclerosis (bekkering et al., ) . also, trained immunity might be one of the mechanisms to explain the well-known association between infectious diseases and cardiovascular disease (leentjens et al., ) . in vitro, various endogenous compounds that are known to accelerate the process of atherosclerosis, induce trained immunity in isolated human monocytes. these factors include oxidized low-density lipoprotein (oxldl) (bekkering et al., ) , lipoprotein (a) (van der valk et al., ) , and the adrenal hormones aldosterone (van der heijden et al., ) and adrenaline and noradrenaline . feeding atherosclerosis prone ldl-receptor deficient mice a western type diet for a period of four weeks induces profound inflammatory reprogramming of circulating innate immune cells, which persists despite switching diet back to chow diet (christ et al., ) . the relevance of these experimental findings is highlighted by the observation that isolated monocytes from patients with established severe coronary atherosclerosis have a trained immune phenotype, in terms of an augmented cytokine production capacity ex vivo (bekkering, van den munckhof et al., ) . this also holds true for patients with an increased risk for atherosclerotic cardiovascular disease due to elevated ldl-cholesterol levels (patients with familial hypercholesterolemia), in whom the augmented cytokine production capacity could not be restored by three months of ldl-cholesterol lowering with statin treatment (bekkering et al., ) . similar findings have been obtained in patients with elevated lipoprotein (a) levels, and patients with pheochromocytoma, who are exposed to repetitive bouts of adrenal catecholamine release (van der valk et al., ; . in these latter patients, the increased cytokine production capacity persisted for one month following surgical removal of the catecholamine-producing tumor, emphasizing the memory aspect of this phenotype. the observation that the enhanced cytokine production capacity that defines trained immunity persists for at least several months in humans in vivoi.e. much longer than the half-life of circulating monocytesprompted researchers to focus on the myeloid progenitor cells in the bone marrow niche. indeed, in murine models, stimuli that induce trained immunity in circulating monocytes, including western type diet feeding, bcg vaccination, or administration of β-glucan, were found to trigger a persistent inflammatory reprogramming of myeloid progenitor cells in the bone marrow (christ et al., ; mitroulis et al., ) . in healthy subjects, bcg vaccination also induced an inflammatory functional and transcriptional reprogramming of hematopoietic stem and progenitor cells, measured days after vaccination (cirovic et al., ) . to allow optimal future exploitation of the mechanism of trained immunity as pharmacological target, it is critical to be fully informed about the pathways that drive, maintain, and modulate innate immune memory. the two major processes that regulate this memory are epigenetic and metabolic reprogramming. although these processes are regulated by separate sets of epigenetic and metabolic enzymes, there are close bilateral interactions connecting changes in metabolic pathways to epigenetic alterations and vice versa (fig. ). we will first briefly touch upon the essential epigenetic alterations in trained cells, followed by an extensive overview of the various metabolic changes and how these two processes interact. gene transcription is regulated by the binding of transcription factors and rna polymerase at gene promoters that are proximal to the transcription start site and distal regulatory elements called enhancers. accessibility of the dna to transcription factors and other transcriptional machinery at these regulatory regions is essential for gene expression. three processes can regulate gene transcription without alterations of the dna sequence, including dna methylation, modifications of histone proteins, and the effects of non-coding rnas. several research papers have now described an essential regulatory role of histone modifications in innate immune memory . also, recently a role for a specific long non-coding rna molecule umlilo in trained immunity was reported (fanucchi et al., ) , while the role of dna methylation has only been suggested in one study in bcg-vaccinated subjects (verma et al., ) . histone lysine residues can be enzymatically modified by the addition of methyl groups or acetyl groups which regulate the accessibility of the promoter and enhancer regions for the transcriptional machinery. some histone modifications, such as trimethylation of lysine at histone (h k me ), mark active promoters, while h k me marks distal regulatory elements (enhancers). histone acetyl modifications are generally associated with an open active chromatin, e.g. h k ac, which marks active promoters and enhancers . importantly, these histone modifications are written and erased by specific epigenetic enzymes (including histone methyltransferases and demethylases, histone acetylases and deacetylases), which makes them potentially modifiable by drugs targeting these enzymes. stimulation of innate immune cells is accompanied by the rapid deposition of these chromatin marks and changes in the dna methylation status, which leads to the unfolding of the chromatin and facilitates transcription and expression of proinflammatory factors. importantly, in the context of trained immunity, these histone modifications are only partially removed after cessation of the training stimulus, resulting in a persistent enrichment of promoters of these cytokines with h k me and of enhancers with h k me . this allows quicker and enhanced recruitment of transcription factors and gene expression after secondary challenge with another stimulus. for detailed information about the dynamics and regulation of this epigenetic reprogramming, we refer to previous papers by our group van der heijden et al., ) . thus far, only two specific epigenetic enzymes have been characterized that regulate the epigenetic remodeling of training. first, the kdm family of histone demethylases, which are responsible for demethylation of h k appears critical for trained immunity: β-glucan training of monocytes resulted in decreased biological activity of kdm demethylases on day after training, which was regulated by changes in intracellular fumarate, which will be discussed later . more recently, the lysine methyltransferase set , which writes h k me marks, was identified as key enzyme necessary for β-glucan-induced trained immunity in vitro and in vivo . just like all other cells, innate immune cells require several metabolic pathways to execute their diverse roles and respond to changing micro-environments; the most important pathways include glycolysis, the tricarboxylic acid (tca) cycle and oxidative phosphorylation (oxphos), the pentose phosphate pathway, fatty acid oxidation, fatty acid synthesis and amino acid metabolism. these pathways provide energy in the form of atp, but they also regulate biosynthesis and proliferation by providing essential macromolecular building blocks, and they regulate redox signaling and intercellular signaling. by doing so, they not only follow metabolic demands of the cells and nutrient availability, but are able to dictate cellular function themselves, which is recently discussed in detail in excellent review papers . in particular, metabolic pathways can regulate epigenetic programs by providing intermediate metabolites that can either serve as substrates for epigenetic enzymes (e.g. acetylcoa is the major substrate for histone acetyltransferases) or as co-activators or co-repressors of epigenetic writers or erasers (e.g. the [nad + ]/[nadh] ratio as activator of the sirt histone deacetylase, fumarate as inhibitor of the kdm family of histone demethylases, and α-ketoglutarate as cofactor for the histone demethylase jmjd , reviewed in (van der heijden et al., )). many of these pathways also serve important functions in the development of innate immune memory, which we will discuss in detail in the next sections. to elucidate which metabolic pathways are differentially expressed in trained immunity, arts et al. recently performed rna-sequencing and full intracellular metabolome assessment at different time points in β-glucan trained primary human isolated monocytes . after h of exposure to β-glucan, the rna expression patterns of metabolic enzymes differed from control monocytes, with the largest difference observed after days. similarly, metabolome data showed that at early time points ( h and h after stimulation), only small differences existed between the trained and control cells, whereas at day , the intracellular metabolome of β-glucan-trained cells was clearly different. altogether, these data indicate that major transcriptional changes associated with metabolic pathways occur at an early timepoint after β-glucan exposure, which precede the metabolic phenotype observed in fully differentiated β-glucan-trained macrophages on day (arts et al., ). integration of the fig. . schematic overview of the intracellular mechanisms operating in monocytes/macrophages to build trained immunity. depicted are the extracellular exogenous and endogenous triggers, the various metabolic pathways that are activated with their most important metabolites, and the bidirectional interaction with epigenetic enzymes in the nucleus. transcriptome and metabolome data revealed an upregulation of several metabolic pathways in β-glucan-trained macrophages, including glycolysis, the pentose phosphate pathway, glutamine metabolism, fatty acid synthesis, and cholesterol metabolism. in addition, several intermediary metabolites of the tca cycle and glutaminolysis were enriched. glycolysis is one of the major metabolic pathways in all cell types to provide energy and building blocks for essential biosynthetic pathways. it involves the conversion of glucose to pyruvate in the cytosolic compartment, which can either by shuttled into the tca cycle or fermented to lactate. the latter reaction commonly occurs in hypoxic situations in which oxphos is switched off, but can also occur in normoxia, which is called aerobic glycolysis. although glycolysis is much less efficient in atp production than oxphos, it is the major pathway for energy production in proliferating cells, e.g. tumor cells, which was already described by otto warburg, ( ) . hence, the aerobic glycolysis that is typical of tumor cells has been named the warburg effect. the same glycolytic preference holds true for activated immune cells, including lps-activated m -macrophages and dendritic cells, activated effector t cells, and activated natural killer cells. the benefits of switching preferentially to glycolysis are explained by ) the possibility for rapid induction of glycolytic enzymes in situations of acute need of rapid energy production, such as inflammation ) the conversion of nad + to nadh, which is an important co-factor for many enzymes, and ) the diversion of intermediate products into biosynthetic pathways . in the latter regard, glucose- -phosphate fuels the pentose phosphate pathway for the production of ribose for nucleotides, -phosphoglycerol into the serine biosynthetic pathway, and pyruvate into the tca cycle to provide citrate. several lines of evidence point towards a key role for glycolytic metabolism in the development of trained immunity in response to the exposure to β-glucan and bcg cheng et al., ) : first, there is an upregulation of mrna expression of glycolytic enzymes six days after exposure to the training stimulus . second, trained macrophages show increased lactate production, a higher glucose consumption, and an increased nad + to nadh ratio, both during the first h of exposure as well as on day in the trained macrophage . third, glucose flux analyses with nuclear magnetic resonance (nmr) with radiolabeled c-glucose indeed showed increased incorporation of c into lactate during the h of restimulation with lps. in addition, incorporation of the c-labels was also increased in ribosyl- which is suggestive of an induction of the pentose phosphate pathway . for both β-glucan and bcg, upregulation of glycolysis is secondary to activation of the akt -mtor -hif α pathway. pharmacological inhibition of this pathway, or of glycolysis with -deoxyglucose indeed abolishes the augmentation of cytokine production capacity cheng et al., ) . finally, additional proof for a role of glycolysis in trained immunity stems from the observations that in cohorts of healthy subjects, single nucleotide polymorphisms (snps) in key glycolytic enzymes are associated with the induction of cytokine production capacity by training of the cells ex vivo; this was reported for snps in hexokinase (hk ) and phosphofructokinase, platelet (pfkp) for training with bcg . in vivo, bcg vaccination induced a trained immune phenotype in isolated peripheral blood mononuclear cells, which was associated with a higher expression of hk and pfkp. also for training with oxldl, an increased glycolytic activity is essential for the development of the trained immune phenotype: oxldltrained macrophages are characterized by an increased extracellular acidification rate using seahorse technology, and pharmacological inhibition of glycolysis (either by -dg or by inhibition of the inducible pfk- /fbpase isozyme -phosphofructo- -kinase/fructose- , -biphosphatase (pfkfb )) prevents trained immunity . in addition, genetic variation in genes encoding pfkfb and pfkp were associated with the potentiation of tnf-α and il- production upon training with oxldl ex vivo . we recently reported that endogenous adrenal products that are associated with hypertension and atherosclerotic cardiovascular disease, including aldosterone and adrenaline/noradrenaline also induce innate immune memory in human isolated primary monocytes . remarkable, aldosterone-induced trained immunity was not associated with changes in ecar and ocr using seahorse technology. for the catecholamines, however, adaptations in these metabolic pathways strongly associated with the effects on cytokine production capacity: the immediate immunosuppressive effect of h exposure to adrenaline/noradrenaline was associated with reductions in ecar and ocr, whereas the augmented cytokine production capacity that developed six days later was associated with increased glycolysis and oxphos (van der heijden et al., ). there is a close bilateral relationship between the upregulation of glycolytic metabolism and epigenetic reprogramming. glycolysis is essential for the induction of cytokine production capacity which is mediated by enrichment of the promoters of these genes by activating histone modifications, including h k me cheng et al., ) . one mechanism that links glycolytic activation to epigenetic reprogramming is the dependency of the sirtuin family of histone deacytelases (hdacs) on the intracellular nad + concentration (anderson et al., ) . indeed, the nad+/nadp ratio is increased in trained macrophages and the induction of cytokine production capacity by β-glucan is blunted by co-administration of the hdac inhibitor resveratrol . conversely, the increased expression of glycolytic enzymes is mediated by activating histone modifications itself, and co-administration of epigenetic inhibitors, such as the nonspecific methyltransferase inhibitor methylthioadenosine or the set methyltransferase inhibitor cyproheptadine, prevents the upregulation of glycolysis by β-glucan on day , whereas it does not affect the lactate production in the first h of exposure to β-glucan . interestingly, oxldl-trained macrophages are characterized by an enrichment of h k me on the promoters of pfkfb and hk , which is attenuated by pharmacological inhibition of glycolysis, pointing to a self-perpetuating epigenetic activation of glycolysis . as mentioned before, one of the benefits of glycolytic activation for proliferating or inflammatory cells is that it feeds into the pentose phosphate pathway, which is important for the production of amino acid precursors and nucleotides, necessary for cellular growth and proliferation. in addition, activation of the ppp generates nadph, which is needed for the production of reactive oxygen species important to combat micro-organisms . both transcriptomic analyses as well as flux studies with c-labeled glucose point to an activation of the oxidative branch of the ppp in macrophages trained with bcg or β-glucan arts et al., ) . however, pharmacological blockade of this branch of the ppp did not interfere with trained immunity development in vitro showing that the ppp is dispensable for trained immunity . it is logical to assume though that the ppp is essential for persistence of trained immunity in vivo by its involvement in the proliferation of myeloid progenitor cells, but this has not been investigated. in resting or anti-inflammatory immune cells, such as the prototypical anti-inflammatory il- /il- polarized m -macrophages and treg cells, the tca cycle (also known as citric acid cycle or krebs cycle) and subsequent oxphos act as the single most important and highly efficient pathway for atp synthesis . the tca cycle and oxphos provide a highly efficient mechanism in which glycolysis-derived pyruvate or fatty acids are used for the generation of the high-transfer-potential electron carriers nicotinamide dinucleotide (nadh) and flavin adenine dinucleotide (fadh ). these redox metabolites subsequently feed electrons into the electron transport chain (etc) to support oxphos finally resulting in the generation of atp by atp synthase (complex v of the etc). importantly, when needed, the tca cycle can serve other goals for proper cell function other than energy production. when innate immune cells, such as monocytes, are stimulated by growth signals or inflammatory stimuli, e.g. lipopolysaccharide, the tca cycle shifts function to provide intermediary metabolites for biosynthetic pathways, including the production of amino acids and lipids, which is termed cataplerosis. the efflux of intermediates for biosynthesis requires replenishment of the tca cycle by nutrients in a process called anaplerosis. in the setting of inflammatory stimulation of macrophages (e.g. by lps), this functional shift involves accumulation of citrate and succinate by the transcriptional repression of isocitrate dehydrogenase (idh), and inhibition of succinate dehydrogenase (sdh) function, respectively (ryan and o'neill, ) . in this situation, citrate is transported from the mitochondrial matrix into the cytoplasm and converted into acetyl-coa, which can be used for acetylation by acetyltransferases, or fuels synthesis of fatty acids and cholesterol, which are important for the formation of prostaglandins and lipid rafts. succinate further fuels inflammatory activation by various mechanisms including interleuking- β synthesis by stabilization of hypoxia-inducible factor (hif)- α (ryan and o'neill, ) . several recent papers have investigated the role of tca cycle and oxphos in trained immunity. in general, these studies revealed that the tca cycle remains function for atp production by oxphos, while at the same time it provides intermediate metabolites that modulate inflammatory function by regulating activity of epigenetic enzymes. analyses of cellular oxygen consumption of in vitro trained human primary macrophages, either with a low dose of β-glucan (of μg/ml), bcg, oxldl, or the catecholamines adrenaline and noradrenaline, all revealed an augmented basal and maximum oxygen consumption rate on day before restimulation of the cells . in contrast, a high concentration of β-glucan of μg/ml, which also potently induce a trained immune response in terms of augmentation of cytokine production capacity, induced a classical warburg effect with an increased glycolysis but repression of oxphos . the mechanism of this dose-dependency requires further investigation. an additional argument suggesting a role for oxphos in trained immunity is the finding that in a cohort of healthy subjects, genetic variation in nadh:ubiquinone oxidoreductase (complex i of mitochondrial electron transport chain) is associated with augmentation of il- production in ex vivo β-glucan trained cells . similar associations were described for genetic variation in idh and sdh, the genes previously described to mediate the repurposing of the tca cycle in lps-stimulated macrophages . finally, co-administration of the atp synthase inhibitor oligomycin during lps-restimulation in β-glucan trained cells prevents the increased cytokine production , suggesting that oxphos-derived energy production is required for the trained immune phenotype. inhibition of oxphos with oligomycin during training with bcg, however, did not interfere with the induction of cytokine production capacity . co-administration of metformin with β-glucan or with oxldl prevents the development of a trained macrophage phenotype. metformin inhibits complex i of the respiratory chain which suppresses atp production (el-mir et al., ) . however, the effect of metformin on trained immunity can also be explained by its inhibition of mtor through activation of adenosine triphosphate dependent protein kinase (ampk) . full metabolic assessment of β-glucan-trained macrophages revealed an upregulation of the tca cycle metabolites succinate, fumarate, and malate, and also of -hydroxy-glutarate, which is derived from glutaminolysis . the observation that pharmacological inhibition of the conversion of glutamine into glutamate prevented trained immunity, confirmed that replenishment of the tca cycle by glutaminolysis is essential for trained immunity. interestingly, exposing monocytes to fumarate, but not succinate or malate, for h recapitulated the trained macrophage phenotype in terms of augmented cytokine production capacity. this was accompanied by an enrichment of h k me on the promoters of the cytokine genes, due to a direct inhibitory effect of fumarate on the kdm family of histone demethylases, which are responsible for demethylation of h k . this effect could partly be restored by the addition of α-ketoglutarate. another metabolite from the tca cycle that appears to be important in modulating trained immunity is itaconate. itaconate is synthesized from the decarboxylation of cis-aconitate in the tca cycle by the enzyme immune-responsive gene (irg ) (michelucci et al., ) . itaconate has long been known to have strong antimicrobial properties, and more recently has been described as a natural endogenous break on inflammation in innate immune cells, which contributes to the resolution of inflammation (hooftman and o'neill, ) . briefly, during lps stimulation in macrophages, itaconate inhibits inflammatory responses, notably il- β production, by various independent mechanisms, including inhibition of sdb, and activation of the master antioxidant transcription factor nuclear factor erythroid -related factor (nfe l or nrf ) (mills et al., ) . in addition, itaconate can increase the expression of activating transcription factor (atf ), which is a negative regulator of nf-κb zeta (iκbζ), a transcription factor that regulates secondary transcriptional responses to tlr activation, including the release of il- (bambouskova et al., ) . in a recent paper, domínguez-andrés et al. investigated the role of itaconate in innate immune tolerance and training (dominguez-andres et al., ) . they underscored the potent anti-inflammatory effects of itaconate in macrophages by showing that lps exposure, which induces immune cell tolerance, leads to a rapid increase of itaconate by upregulation of the expression of irg . itaconate subsequently increases succinate levels by the inhibition of sdh. importantly, co-administration of β-glucan and lps prevented this upregulation of irg expression, and training with β-glucan was associated with a long-lasting inhibition of irg expression as secondary exposure to lps only minimally increased irg expression. these results fit the previous observation that β-glucan prevents and reverts lps-induced tolerance . itaconate itself also modulates trained immunity by its inhibitory effect on sdh: in the context of β-glucan-induced trained immunity, the addition of exogenous itaconate (dimethylitaconate) prevents the development of the hyperresponsive trained immune phenotype by preventing the accumulation of fumarate. in summary, while itaconate inhibits the induction of trained immunity, β-glucan-induced trained immunity can revert lps-induced immunoparalysis by inhibiting activation of the irg -itaconate-sdh axis. so, tca cycle intermediates can impact on cell function by modulating epigenetic enzymes. at the same time, epigenetic processes can regulate metabolic functions of monocytes and macrophages. keating et al. recently described a critical role for the methyltransferase set in the adaptations of the tca cycle function and oxphos that occur in β-glucan trained cells . they validated that in β-glucan trained macrophages, on day the intracellular concentrations of the tca cycle metabolites succinate, fumarate, malate, oxaloacetate, and citrate were higher than in non-trained control cells . this increase was prevented for succinate, fumarate, and malate by co-incubation of β-glucan with the set inhibitor cyproheptadine (cph). this co-incited with an augmented expression of the enzymes succinate-coa ligase gdp/adp-forming subunit alpha (suclg ), the b subunit of succinate dehydrogenase (sdhb), fumarate hydratase (fh), malate dehydrogenase (mdh ) and citrate synthase (cs) mrna expression, which was prevented by cph for sdhb, fh, and mdh . this enhanced expression was regulated by set dependent enrichment of h k me at distal enhancers that form regulatory domains with mdh and sdhb . setd deficient mice were used to validate the effect of β-glucan training on tca cycle enzymes in bone marrow progenitor cells and it was shown that mrna expression of mdh and sdhb, but not fh or suclg was increased by β-glucan in wild-type mice, but not in the setd deficient mice . in the cytosol, citric acid-derived acetyl-coa can enter the cholesterol biosynthesis pathway, which is controlled mainly by the enzyme hydroxy- -methylglutaryl coa reductase. this pathway is important for the inflammatory function of immune cells for various reasons. first, cholesterol determines the structural integrity and fluidity of the cellular membranes and compartmentalization of the membrane in lipid rafts, which are important for inflammatory signal transduction pathways. in addition, isoprenoid intermediates of the cholesterol synthesis pathway can modify the function of multiple proteins by a process called prenylation which can modify the function of these proteins, many of which are involved in inflammatory processes. in the context of atherosclerosis, it has been established that cholesterol accumulation in myeloid progenitor cells in the bone marrow promotes myelopoiesis and leads to an acceleration of atherosclerosis (yvan-charvet et al. tall and yvan-charvet, ) . analysis of the transcriptome and metabolome of β-glucan trained macrophages revealed, in addition to glycolysis, the ppp, and glutamine metabolism, also an upregulation of cholesterol and fatty acid synthesis pathways bekkering et al., ) . pharmacological inhibition of -hydroxy- -methylglutaryl coa reductase with statins prevented trained immunity by β-glucan and oxldl in vitro and also in an in vivo model of β-glucan-induced trained immunity in mice. importantly, pharmacological inhibition of -fluoromevalonate, which catalyzes the conversion of mevalonate- -pp into isopentyl-pp augmented cytokine production capacity in the in vitro trained immunity model . this finding excludes a role for protein prenylation as well as cholesterol synthesis in trained immunity and points to a role for intracellular accumulation of mevalonate. indeed, exposure of human monocytes for h to mevalonate induced a similar trained immune phenotype with enhanced cytokine production, accompanied by an activation of glycolysis and an enrichment of h k me on cytokine gene promoters. additional pharmacological experiments revealed that mevalonate induced trained immunity by activation of the insulin-like growth factor- receptor pathway and subsequent activation of mtor and glycolysis . the importance of the mevalonate synthesis pathway for trained immunity is further highlighted by the finding that rna sequencing of hematopoietic stem cells from mice seven days after β-glucan administration showed an enrichment of the cholesterol biosynthesis pathway and especially the mevalonate pathway (mitroulis et al., ) . in addition to the cholesterol synthesis pathway, citrate-derived acetyl-coa can also fuel fatty acid synthesis, which positively regulates the generation and function of pro-inflammatory immune cells of both the innate and adaptive immune systems . several studies have reported that inflammatory stimuli such as lps trigger an increase in fatty acid synthesis in macrophages. the relevance of this pathway for the development of atherosclerosis is illustrated by the observation that in atherosclerosis-prone apoe − /− mice, macrophage-targeted deletion of fasn (the gene that encodes fatty acid synthase) reduces atherosclerotic plaque formation and foam cell formation (schneider et al., ) . β-glucan trained macrophages show an upregulation of the fatty acid synthase pathway, but pharmacological inhibition of this pathway during the h exposure to β-glucan did not interfere with trained immunity . fatty acid synthesis also appears to be essential for trained immunity induced by aldosterone . as mentioned before, brief exposure of human monocytes to aldosterone also enhances cytokine production capacity after restimulation with lps and the tlr ligand pam cys, and this was not associated with activation of glycolysis or oxidative phosphorylation. four hours after restimulation with pam cys however, the aldosterone-trained cells showed an upregulation of various genes that are central to the fatty acid synthesis pathway, fatty acid elongation, and the formation of very long chain fatty acids, compared to vehicle-exposed cells. furthermore, these genes showed enrichment of h k me on their respective promoters. preincubation of the aldosterone-trained cells with the fatty acid synthesis inhibitor cerulenin before the restimulation with pam cys completely abolished the augmentation of cytokine production capacity . the fatty acid oxidation (fao) pathways occurs in the mitochondrial matrix and allows for the conversion of fatty acids, after transport from the cytosol via carnitine palmitoyl transferase , into acetyl-coa, nadh, and fadh , which are further used in the tca cycle for energy production. fao also importantly regulate immune cell function, being the primary source of energy production used by anti-inflammatory il- /il- activated ('m ') macrophages (van den bossche, o'neill, and menon, ; huang et al., ) . lps/ifnγ activated ('m ') macrophages on the other hand down-regulate fao, favoring glycolytic metabolism for their energy demands. fao has not yet been studied in the context of trained immunity. the studies summarized above have provided a detailed mechanistic framework on how monocytes and macrophages can build an immunological memory and how trained monocytes can persist for months in vivo despite their short circulating half-life. within the cells, activation of various metabolic pathways and repurposing of intermediate metabolites strongly interact with epigenetic enzymes to mold a chromatin landscape that facilitates persistent hyperresponsiveness to a subsequent stimulation. similar processes occur in myeloid progenitors in the bone marrow ensuring persistence of circulating trained monocytes for months after a transient trigger for training, such as an infection. since accumulating evidence points to an important role for trained immunity in the host defense against infectious threats as well as in the pathophysiology of non-infectious chronic inflammatory diseases, the intracellular machinery that regulates training offers exciting novel pharmacological targets. the potential clinical relevance of trained immunity has been expanded further by recent observations that ) other cell types are also able to build trained immunity-like memory (hamada et al., ; and ) trained immunity might also contribute to additional clinical conditions . with regard to the first series of observations, trained immunity has also been shown to occur in natural killer cells (nk cells) gamliel et al., ) , and dendritic cells (hole et al., ) . interestingly, memory responses resembling innate immune memory, and making use of overlapping epigenetic and metabolic mechanisms, can also occur in non-immune cells, including stromal cells and epithelial cells. as such, endothelial cells and vascular smooth muscle cells also show hyperinflammatory responses following brief exposure to glucose or oxldl (el-osta et al., ; schnack et al., ) . epithelial stem cells also maintain chromosomal accessibility at key stress response genes that are activated by a primary danger stimulus (naik et al., ) . similarly, cerebral microglia cells can build a long-term pro-inflammatory phenotype by epigenetic programs that can last for at least six months after peripherally applied inflammatory stimuli (wendeln et al., ) . this identification of multiple cell types in the literature that are able to build inflammatory memory has gone hand in hand with an expansion of the clinical scenarios in which trained immunity might be involved, including atherosclerosis (riksen, ) , neurogenerative diseases including cerebral small vessel disease (wendeln et al., ; noz et al., ) , and organ transplant rejection (braza et al., ) . as such, the metabolic and epigenetic machinery that regulates the immunological memory in the various cell types offers an exciting and extensive array of novel targets for pharmacological strategies, which have recently been described by mulder et al., ( ) . boosting trained immunity, e.g. by bcg vaccination, can improve protection against infections in susceptible populations. in addition, boosting trained immunity might reverse immune paralysis in patients with severe infections; indeed, in isolated human monocytes, β-glucan can reverse the lps-induced tolerance and ex vivo β-glucan treatment of monocytes from volunteers with experimental endotoxemia re-instates their capacity for cytokine production . finally, promoting trained immunity could be developed as an additional strategy in malignant diseases (fig. ) . in contrast, drugs that interfere with trained immunity could be beneficial in patients with chronic inflammatory diseases, including atherosclerosis, auto-immune disorders, and organ rejection after transplantation. several existing drugs target one of the metabolic pathways that drive trained immunity. statins inhibit -hydroxy- -methylglutaryl coa reductase and prevent trained immunity induction by β-glucan and oxldl in vitro . in contrast, statins are not able to revert the trained immune phenotype in monocytes once this has been established: monocytes isolated from patients with an increased cardiovascular risk due to hypercholesterolemia have an augmented cytokine production capacity that is driven by epigenetic reprogramming and this trained phenotype persisted despite cholesterol lowering with statins during three months (bekkering et al., ) . the antihyperglycemic drug metformin inhibits the mtor pathway by activating adenosine monophosphate activated protein kinase (ampk). given the key role for mtor in the glycolytic activation necessary for training, it is not surprising that metformin can prevent trained immunity, both by β-glucan as well as by oxldl . this mechanism could theoretically contribute to the anti-atherosclerotic effects of metformin in clinical trials. interfering with the metabolic processes that are involved in the regulation of trained immunity is challenging, mainly because these processes are general processes that are used by all cell types for survival and function. specificity for trained immune processes can be increased by pharmacokinetic strategies that improve the delivery of the pharmaceutical compound to the specific cell type in which trained immunity contributes to disease pathophysiology, e.g. the macrophages in atherosclerotic plaques. this is possible with the use of nanobiologicals, e.g. recombinant high-density lipoprotein (hdl) particles which specifically target macrophages (mulder et al., ) . previous studies have shown that these hdl particles loaded with drugs that interfere with trained immunity, including statins can suppress atherosclerotic plaque inflammation (tang et al., ) (duivenvoorden et al., ) . also, in a mouse model of transplantation, a short-term mtor-specific hdl-nanobiological treatment averted macrophage aerobic glycolysis and the epigenetic modifications underlying inflammatory cytokine production and improved graft survival (braza et al., ) . yet another way to prevent side effects and toxicity is to only partly inhibit metabolic pathways that are upregulated in trained immunity. in isolated human monocytes inhibition of the inducible glycolytic enzyme pfkfb ( -phosphofructo- -kinase/fructose- , -bisphosphatase ) with the small-molecule po ( -[ -pyridinyl]- -[ -pyridinyl]- -propen- -one) prevents oxldl-induced trained immunity in vitro . interestingly, -po only partially inhibits glycolysis and systemic treatment of atherosclerosis prone mice with -po significantly reduces atherosclerotic lesion development (perrotta et al., ) . this is due to the fact that inhibiting endothelial cell glycolysis limits intraplaque neovascularization, but it cannot be excluded that this treatment strategy also prevented trained immunity in innate immune cells. a final strategy that can potentially limit side effects of interfering with trained immunity metabolic pathways is to exploit the memory aspect trained immunity. a pharmacological intervention that prevents trained immunity needs to be given during only the short period that the trained immunity is switched on, e. g. during acute infections, immediately after myocardial infarction, or after organ transplantation), which does not interfere with future plasticity of the innate immune system. in conclusion, we foresee that the rapidly expanding knowledge about the intracellular metabolic and epigenetic processes that modulate trained immunity will stimulate the development of novel pharmacological compounds for patients in various clinical settings. targeted delivery of these compounds to the specific trained cells in a time-and site-specific manner is needed to limit side unwanted side effects and increase the therapeutic index. fig. . schematic representation of the various cell types that are able to build trained immunity or comparable inflammatory memory characteristics, including monocytes, macrophages, myeloid progenitor cells, nk cells, dendritic cells, microglia, endothelial cells, and vascular smooth muscle cells. trained immunity can either improve host defense against infections or cancer, or be maladaptive in situations of chronic inflammation. therefore, suppression of trained immunity might be beneficial in situations of chronic inflammatory diseases, such as atherosclerosis, or transplant rejection. on the other hand, boosting trained immunity might improve host defense against infections and might be beneficial in patients with cancer. . npr is recipient of a grant of the era-cvd joint transnational call , which is supported by the dutch heart foundation (jtc , project memory); t ). metabolic control by sirtuins and other enzymes that sense nad(+), nadh, or their ratio immunometabolic pathways in bcg-induced trained immunity glutaminolysis and fumarate accumulation integrate immunometabolic and epigenetic programs in trained immunity bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity electrophilic properties of itaconate and derivatives regulate the ikappabzeta-atf inflammatory axis metabolic induction of trained immunity through the mevalonate pathway in vitro experimental model of trained innate immunity in human primary monocytes trained innate immunity and atherosclerosis oxidized low-density lipoprotein induces long-term proinflammatory cytokine production and foam cell formation via epigenetic reprogramming of monocytes treatment with statins does not revert trained immunity in patients with familial hypercholesterolemia innate immune cell activation and epigenetic remodeling in symptomatic and asymptomatic atherosclerosis in humans in vivo a small jab -a big effect: nonspecific immunomodulation by vaccines inhibiting inflammation with myeloid cell-specific nanobiologics promotes organ transplant acceptance mtor-and hif- alpha-mediated aerobic glycolysis as metabolic basis for trained immunity western diet triggers nlrp -dependent innate immune reprogramming human bacille calmette-guérin vaccination elicits trained immunity via the hematopoietic progenitor compartment considering bcg vaccination to reduce the impact of covid- the itaconate pathway is a central regulatory node linking innate immune tolerance and trained immunity a statin-loaded reconstituted high-density lipoprotein nanoparticle inhibits atherosclerotic plaque inflammation dimethylbiguanide inhibits cell respiration via an indirect effect targeted on the respiratory chain complex i transient high glucose causes persistent epigenetic changes and altered gene expression during subsequent normoglycemia immune genes are primed for robust transcription by proximal long noncoding rnas located in nuclear compartments trained memory of human uterine nk cells enhances their function in subsequent pregnancies trained immunity carried by nonimmune cells induction of memory-like dendritic cell responses in vivo the immunomodulatory potential of the metabolite itaconate cell-intrinsic lysosomal lipolysis is essential for alternative activation of macrophages bcg educates hematopoietic stem cells to generate protective innate immunity against tuberculosis host-directed therapies for bacterial and viral infections rewiring of glucose metabolism defines trained immunity induced by oxidized low-density lipoprotein the set lysine methyltransferase regulates plasticity in oxidative phosphorylation necessary for trained immunity induced by beta-glucan long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity bacille calmette-guerin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes bcg-induced trained immunity in nk cells: role for non-specific protection to infection trained innate immunity as a novel mechanism linking infection and the development of atherosclerosis immune-responsive gene protein links metabolism to immunity by catalyzing itaconic acid production itaconate is an anti-inflammatory metabolite that activates nrf via alkylation of keap modulation of myelopoiesis progenitors is an integral component of trained immunity therapeutic targeting of trained immunity inflammatory memory sensitizes skin epithelial stem cells to tissue damage defining trained immunity and its role in health and disease trained immunity: a tool for reducing susceptibility to and the severity of sars-cov- infection trained immunity: a memory for innate host defense beta-glucan reverses the epigenetic state of lps-induced immunological tolerance trained immunity characteristics are associated with progressive cerebral small vessel disease a guide to immunometabolism for immunologists partial inhibition of glycolysis reduces atherogenesis independent of intraplaque neovascularization in mice candida albicans infection affords protection against reinfection via functional reprogramming of monocytes antiinflammatory therapy with canakinumab for atherosclerotic disease trained immunity and atherosclerotic cardiovascular disease krebs cycle reborn in macrophage immunometabolism epigenetic programming of monocyte-to-macrophage differentiation and trained innate immunity mechanisms of trained innate immunity in oxldl primed human coronary smooth muscle cells macrophage fatty-acid synthase deficiency decreases dietinduced atherosclerosis cholesterol, inflammation and innate immunity inhibiting macrophage proliferation suppresses atherosclerotic plaque inflammation efficacy and safety of low-dose colchicine after myocardial infarction macrophage immunometabolism: where are we (going)? catecholamines induce trained immunity in monocytes in vitro and in vivo aldosterone induces trained immunity: the role of fatty acid synthesis epigenetics and trained immunity oxidized phospholipids on lipoprotein(a) elicit arterial wall inflammation and an inflammatory monocyte response in humans anti-mycobacterial activity correlates with altered dna methylation pattern in immune cells from bcg-vaccinated subjects on the origin of cancer cells innate immune memory in the brain shapes neurological disease hallmarks atp-binding cassette transporters and hdl suppress hematopoietic stem cell proliferation increased inflammatory gene expression in abc transporter-deficient macrophages: free cholesterol accumulation, increased signaling via toll-like receptors, and neutrophil infiltration of atherosclerotic lesions key: cord- - z avb authors: kuroda, naoto title: demand for bcg vaccine due to unproven claims of its role in preventing covid- is causing shortages of vaccines for infants in japan date: - - journal: pediatr infect dis j doi: . /inf. sha: doc_id: cord_uid: z avb nan apart though from the management of febrile children, pediatricians and the pediatric infectious diseases specialists will also have to face challenges with the infection during the neonatal period. undoubtedly close monitoring of at-risk neonates is essential in the neonatal wards, but there are issues where evidence-based guidance is needed. the first priority is identifying the timing of infection (antenatally, perinatally or postnatally) and confirming its presence. two recent reports from china suggest that in utero infection could be possible based on the measurement of igm levels in neonates shortly after birth but no further confirmation of this with a positive reverse transcriptase-polymerase chain reaction test. , therefore, although in utero transmission is possible, larger studies on infected women will bring further insight in the field. in the case of the in utero infected neonate, the timing of infection may have an impact on fetal development and possibly on long-term outcomes. we do not know as yet whether acquisition during first trimester of pregnancy is associated with birth defects and whether fetal infection is more likely in the advanced pregnancy stages following the patterns of other congenital infections. what we do know though is that antenatal infection with other coronaviruses (severe acute respiratory syndrome and middle east respiratory syndrome) is associated with possible miscarriage, intrauterine growth retardation prematurity and low birth weight. moreover, at present, we do not know how many molecular tests we need to perform and whether tests are enough to rule out neonatal infection given that serology is not always reliable, as observed with other congenital infections. in addition to that, uncertainty exists as to whether respiratory specimens are enough or blood, stool or urine samples would offer more accurate results. last but not least separation of an infected mother from her offspring and feeding options are issues for further consideration. some guidelines suggest complete separation of a covid- -positive mother and her baby for at least days or until viral shedding clears, during which time direct breast-feeding is not recommended. on the other hand, the centre for disease control and prevention and the royal college of obstetricians and gynecologists recommend breast-feeding with strict contact precautions based on the fact that so far there is no evidence that the virus can be transferred via breast milk. for those women who are too sick to breast-feed, the recommendation is breast milk expression and avoidance of any contact with the baby. in conclusion, the current pandemic poses several challenges to the pediatricians from the neonatal period throughout adolescence. evidence-based recommendations the authors have no funding or conflicts of interest to disclose. n.k. had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. n.k. contributed to the study concept and design; drafting of the article; critical revision of the article for important intellectual content. originated in china and has rapidly spread worldwide. currently, supportive therapy is the most effective treatment. vaccination is one of the best options for the prevention of infectious diseases. however, a vaccine, as well as a specific proven treatment, remains elusive. the bacillus calmette-guérin (bcg) vaccine is administered to more than one million children annually in countries with a high prevalence of tuberculosis. recently, researchers hypothesized that it might also combat covid- because of its broad ability to stimulate the immune system. this is based on the fact that countries without universal policies of bcg vaccination (ie, italy, the netherlands, and the united states) have been more severely affected compared with countries with universal and long-standing bcg policies. therefore, some researchers are investigating the vaccine's effectiveness against covid- . however, it should be emphasized that the causality is not yet proven; there is only one study predicting an association. generally, to clarify the causality between two variables, the bradford hill criteria is used. to show the causality between the bcg vaccine and the severity of covid- , we have to confirm the following bradford hill criteria: specificity, temporality, reversibility, and experiment. until the results of interventional studies are published, we cannot conclusively establish the utility of bcg against covid- . however, many people have misinterpreted this association as causation. this excessive expectation increases individual desire to be vaccinated with bcg. this will cause a big problem for japanese infants, who, owing to the shortage of bcg, may not get the necessary vaccination. producing adequate amounts of bcg to meet demands besides that for infant vaccination will take half a year because, at present, only the amount necessary for use in infants is manufactured. apprehension regarding bcg shortage led the japanese society for vaccinology to officially state that it does not recommend the use of bcg vaccine for the prevention of covid- . however, under the current japanese health care system, individuals willing to pay for individual vaccination cannot be prohibited from doing so. therefore, emphasizing the lack of evidence and the cooperation of japanese citizens is necessary. if infants in japan do not receive bcg vaccines, tuberculosis might spread. we must prevent this from happening by publicizing inadequate evidence of causality between the bcg and prevention of the covid- . we also need to highlight the concern that a shortage of bcg would exacerbate the tuberculosis crisis among the infants in japan. a t the end of december , the coronavirus disease (covid- ) epidemic started in china and then expanded worldwide. thereafter, many clinical studies have been reported, but most of them concerned the chinese people. clinical data regarding the italian pediatric population are still lacking. in february , the covid- pandemic flared up across italy, the first cluster started in south-lombardy, which is still the most affected area. caused about , deaths, including more than doctors, so far (april ). based on this background, we analyzed the data concerning all pediatric patients with covid- ( - years old) admitted to the san matteo hospital of pavia until april . the province of pavia (about , residents) belongs to lombardy region and is the catchment-area of this hub hospital. patients were stratified in subgroups according to the severity of the disease, classified as requiring home isolation, admission to low-intensity care, sub-intensive care unit or intensive care unit (icu). we also considered the data of all patients with covid- living in lombardy, evaluating the same classification adding the death rates. table shows the demographic and clinical data. as of today (april ), children had covid- diagnosis based on clinical data and positive swab (rt-pcr analysis). there was a slight predominance of males ( . %), the median age was years. five children required the home isolation as the symptoms were very mild; were admitted at the hospital: ( %) required low-intensity care, ( . %) subintensive care and ( . %) icu admission. analyzing the data concerning the whole lombardy population, . % of patients with covid- had home isolation, . % required low-medium-intensity care, . % icu admission, and . % died. therefore, there is, presently, convincing evidence that covid- causes a mild-moderate disease in childhood. consistently, no child has died so far in italy. indeed, disease severity, namely intensity of requested care and mortality rate, progressively increased with age. these findings could be interpreted as reassuring for the pediatric age and young adulthood. on the other hand, covid- may seriously affect elderly people, requiring an outstanding care concentration. these outcomes were consistent with the literature data. , several hypotheses were envisaged, including the different frequency of angiotensin converting enzyme (ace ) expression on pneumocytes, which is higher in the elderly and male. ace is the receptor for coronavirus, thus overexpression promotes infection. hypertension, chronic respiratory diseases, cancer and metabolic disorders were also reported frequent comorbidity, common in older subjects. , however, no conclusive factors have been defined still now. on the other hand, children seem to be protected thanks to some probable mechanisms. children have usually fewer comorbidity, ace is under-expressed and do not smoke (smoking is associated with increased expression of ace ), have a large thymic repertoire and sustained innate immunity, more t and b regulatory lymphocytes than adults, and received a wide vaccination program. as a result, children could have a more protective immune response than adults. therefore, the current data confirm the good prognosis in children. an ongoing study is investigating more detailed risk factors in this population. sars-cov- infection in a pediatric department in milan: a logistic rather than a clinical emergency possible vertical transmission of sars-cov- from an infected mother to her newborn antibodies in infants born to mothers with covid- pneumonia coronavirus infections in children including covid- an overview of the epidemiology, clinical features, diagnosis, treatment and prevention options in children guidelines for pregnant women with suspected sars-cov- infection can a century-old tb vaccine steel the immune system against the new coronavirus? correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study immune boost against the corona virus [max-planck-gesellschaft web site the environment and disease: association or causation opinion about effectiveness of bcg vaccine against covid- [the japanese society for vaccinology web site the early phase of the covid- outbreak in lombardy risk factors associated with acute respiratory distress syndrome and death in patients with coronavirus disease comorbidity and its impact on patients with covid- in china: a nationwide analysis organ-protective effect of angiotensin-converting enzyme and its effect on the prognosis of covid- renin-angiotensin-aldosterone system inhibitors in patients with covid- table . demographic and covid- data in lombardy region and pediatric patients with covid- + living in pavia district lombardy region total population age (years)* males (%) % home isolation, n (%) %) pavia district total population pediatric population, ≤ years, n (% total population) *figures represent median values and figures in squared parentheses represent first and third quartiles. covid- , coronavirus disease ; icu, intensive care unit. figures in round parentheses represent percentages the authors have no funding or conflicts of interest to disclose.ilaria brambilla, phd,* riccardo castagnoli, phd,* silvia caimmi, md,* giorgio ciprandi, md, † gian luigi marseglia, md* key: cord- -hzshnq b authors: raham, t. f. title: impact of duration of cessation of mass bcg vaccination programs on covid - mortality date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: hzshnq b back ground: bcg have heterogeneous immunity to certain pathogens other than mycobacterium tuberculosis effect. at early times during covid- pandemic heterogeneous immunity towards (sars-cov- ), was hypothesized and statistical correlation between of bcg vaccination practices and covid- mortality variances among countries was statistically proved . these studies was criticized because of low evidence of such studies and possible confounding factors. for that reason this study was designed to look for impact of duration of cessation of bcg programs on covid- mortality looking for the hypotheses by different design and looking forward to support previous studies. methods: total number of studied group is countries which has stopped bcg vaccination programs. through applying stem-leaf plot for exploring data screening behavior concerning covid- mortality for obsolescence duration of cessation of mass bcg vaccination programs, as well as (nonlinear regression of compound model) for predicted shape behavior for that group. results: slope value shows highly significant effectiveness of obsolescence of cessation of mass bcg vaccination programs on covid - mortality at p-value< . . obsolescence of duration of cessation of mass bcg vaccination programs has strongly negatively associated with covid- mortality in countries which stopped bcg vaccination programs. conclusion: the longer the cessation duration of bcg programs, the higher the covid- mortality is, and vice versa. epidemiological and immunologic studies have shown reductions in morbidity and mortality following bcg immunizations in third world countries, suggesting that bcg may have some role in heterologous immunity to other pathogens the biological substrate of these effects is mediated partly by heterologous effects on adaptive immunity, but also on the potentiation of innate immune responses through 'trained immunity . the term heterologous immunity refers to the immunity that can develop to one pathogen after a host has had exposure to non-identical pathogens bcg vaccination significantly increases the secretion of pro-inflammatory cytokines, such as il- β and il- , which has been shown to play a vital role in antiviral immunity a rapid review and who brief on april evaluate the current evidence about the protective effects of bcg vaccine against acute respiratory infections and covid- . although some have significant correlation brief states "who does not recommend bcg vaccination for the prevention of covid- "claiming that evidence is not strong enough yet. although heterogeneous immunity is not effective as homologous immunity to a specific pathogen which will usually develop a very strong resistance to re-infection with the same pathogen ,interests in heterogeneous protection is of great concern in sars-cov- infection as far as there is no available vaccine for covid - yet. criticized studies hypothesized this theory and share the design of testing the bcg vaccination practices against morbidity and moratlity . by testing the duration of cessation of bcg vaccination against covid- mortality in this work , we are looking for the link by different design. the hypothesis in this study is the waning effect of vaccination as far as, the heterogeneous immunity waned with time . so the primary aim of this study is supporting for previous studies through handling the question of immunity that's bcg thought to be produced against (sars-. cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted august , . . https://doi.org/ . / . . . doi: medrxiv preprint cov- ) by different way that is the cessation duration of bcg programs in countries which stopped bcg vaccinations programs. data regarding time of bcg cessation versus covid- mortality is subjected to be tested. information on past bcg vaccination and cessation dates were collected from countries by data abstracted from published papers, reports, and available government policy documents retrieved through literature searches on pubmed and via the world wide web furthermore, we used immunization data available from the who-unicef estimates of bcg coverage site: https://apps.who.int/immunization_monitoring/globalsummary/timeseries/tswuc of national immunization coverage, and who unicef review overagebcg.html at site immunization surveillance, assesment and monitoring data and - https://www.who.int/immunization/monitoring_surveillance/data/afg.pdf : it was not appropriate or possible to involve patients or the public in this work given that we used general practice level summated data and related publically published mortality statistics and national bcg protocols. obsolescence of cessation of mass country . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted august , . in addition to that, stem-leaf plot was used for exploring data screening behavior concerning covid- mortality with obsolescence of cessation of mass bcg vaccination in countries previously given the bcg vaccine which are redistributed in three groups intervals. all statistical operations were performed through using the ready-made statistical package spss, version . linear model whose equation is y = b + (b * t). model whose equation is y = b + (b * ln (t)). . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted august , . . https://doi.org/ . / . . . doi: medrxiv preprint inverse model whose equation is y = b + (b / t). model whose equation is y = b + (b * t) + (b * t** ). model whose equation is y = b * (t**b ) or ln (y) = ln (b ) + (b * ln(t)). model whose equation is y = b * (b **t) or ln(y) = ln(b ) + (ln(b ) * t). model whose equation is y = e**(b + (b /t)) or ln(y) = b + (b /t). model whose equation is y = / ( /u + (b * (b **t))) or ln( /y- /u)= ln (b ) + (ln(b )*t) exponential model whose equation is y = e**(b + (b * t)) or ln(y) = b + (b * t). model whose equation is y = b * (e**(b * t)) or ln(y) = ln(b ) + (b * t). them. in addition to that, the observations that increased in more than three degree of standard values from the two sides would be assigned by a star and known as an outlier value. . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted august , . . https://doi.org/ . / . . . doi: medrxiv preprint is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted august , . . be an expected on covid - mortality/million with the peak effectiveness of using vaccine at the earliest possible period, and rather than no significant pvalue > . was accounted, since probability level of significance simply stating not achieved. is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted august , . . https://doi.org/ . / . . . doi: medrxiv preprint results reflect statistical correlation between bcg duration of obsolesce of cessation (when cessation time is diminished or degenerated) and covid- mortality and being strongly negatively associated (fig. , fig. , table ) . this association reflects the shorter cessation period of bcg vaccination the lesser covid- mortality and vice versa. looking for duration of cessation of bcg vaccination program as factor is a new idea up to my knowledge to be tested in relation to covid- mortality supporting the hypotheses of effectiveness of bcg vaccinations programs in prevention of covid- mortality. previous studies regarding bcg effectiveness where criticized by possibility of significant bias from many confounders . possible confounders : differences in national demographics and disease burden, testing rates for covid- virus infections, and the stage of the pandemic in each country . in this study although above confounders cannot excluded but the design of the study is different from other studies . the influence of time proved in this study is of concern since previously criticized studies prove significant associations results with practices, results of this study and previous studies consolidate each other through different study designs . in one study done before there was a positive significant correlation (ρ= . , p= . , linear correlation) between the year of the establishment of universal bcg vaccination and the mortality rate. this study did not assess the impact of cessation but the time of establishment of vaccination programs and includes both groups of countries which continue and not continue the vaccination programs ,although the design is different again her, but similar finding consolidates evidence to each other . another more recent study shows highly significant negative association between prevalence of tb and covid- mortality which furtherly support such hypothesis regarding heterogeneous immunity of mycobacterium through latent tb infections which it's prevalence is proportional to tb prevalence . highly significant association in this study support the hypotheses already raised about beneficial effect of vaccination and hence impact of its cessation. the theoretical background for this association is protection role of heterogeneous immunity produced by bcg vaccine. as far as the duration of cessation of vaccination in this study have impact on mortality , its results might reflects the waning effect of heterogeneous immunity but still this finding should be confirmed by control clinical studies and immunological studies. for such clinical studies we need more time to wait to see such studies and this give importance to do such studies in this time. while this study states that duration of cessation of bcg programs have impact on covid- mortality / million populations inhabitant explains more possible factor in variances in covid- . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted august , . . https://doi.org/ . / . . . doi: medrxiv preprint mortality through different countries in one hand and strengthen the evidence for early intervention at this critical time in another hand. conclusion: duration of cessation of bcg vaccination have significant effect on mortality due to covid- and this study supports the evidence of effect of bcg vaccination in prevention of covid - mortality. recommendations: decisions on bcg vaccination program cessation might be en reconsidered. ethical permission is not necessary as this study analyzed publically published data and patients were not involved. there is no conflict of interest. there is no funding received. is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted august , . . https://doi.org/ . / . . . doi: medrxiv preprint beneficial non-targeted effects of bcg--ethical implications for the coming introduction of new tb vaccines routine vaccinations and child survival: follow up study in bcg-induced protection: effects on innate immune memory bacille calmette-guerin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity the role of bcg/ppd-activated macrophages in resistance against systemic candidiasis in mice bcg-induced trained immunity in nk cells: role for nonspecific protection to infection a rapid review of current evidence centre for evidence correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study bacille calmette-guérin (bcg) vaccination and covid- .scientific brief technology college, baghdad-iraq, for his assistance and supported in data analysis, interpretations of finding results, and revise and display the paper. key: cord- -sa k o authors: takahashi, harutaka title: role of latent tuberculosis infections in reduced covid- mortality: evidence from an instrumental variable method analysis date: - - journal: med hypotheses doi: . /j.mehy. . sha: doc_id: cord_uid: sa k o since the outbreak of the coronavirus disease (covid- ) pandemic, there has been significant interest in the potential protective effect of the bacillus calmette-guerin (bcg) vaccine against covid- mortality. this effect has been attributed to innate immune responses induced by bcg vaccination. however, these studies ignore an important fact: according to world health organization estimates, about a quarter of the world's population may have latent tuberculosis infection (ltbi), a condition in which there is no evidence of clinically active tuberculosis but persistent immune responses are stimulated by mycobacterium tuberculosis antigens. thus, both ltbi and bcg induce lifelong immunity and may provide immunological protection against covid- . in this study, the relationship between ltbi and reduced covid- mortality was analyzed using the instrumental variable method. the results showed with robust statistical support that ltbi was also associated with reduced covid- mortality. since the outbreak of the coronavirus disease (covid- ) pandemic, significant attention has been focused on the relationship between bacillus calmette-guerin (bcg) vaccination and covid- mortality. in particular, there is interest in whether bcg vaccination is associated with a reduction in covid- -associated mortality. bcg is the most widespread vaccine against tuberculosis (tb) and also elicits non-specific effects and innate immune memory against non-mycobacterial diseases. a survey of key unpublished and published data regarding the association between bcg vaccination and covid- mortality was conducted, and concluded that there was a lack of evidence to support a protective effect of bcg against covid- [ ] . however, such studies ignore the important fact that about one-quarter of the world's population may have latent tb infection (ltbi), a condition in which there is no evidence of clinically active tb but persistent immune responses are stimulated by mycobacterium tuberculosis antigens. the regional data shown in table illustrate that the number of ltbis far surpasses the number of active tb infections. the number of lbt infections clearly surpasses that of tb infections. ltbi also induces lifelong innate immune immunity [ ] , [ ] and may confer an immunological protective effect against covid- . many countries with a relatively high incidence of tb infection, including japan, require bcg vaccination during early childhood. most citizens of these countries also have ltbi, which is highly immunoprotective because of elicited innate immune responses. in fact, tb infection leads to ltbi in %- % of cases, while %- % of individuals develop active tb disease [ ] . therefore, the number of tb infections per hundred thousand individuals can be used as a proxy for the number of ltbis. furthermore, m. tuberculosis infection via bcg vaccination can enhance innate immunity. therefore, citizens of countries with high prevalence of tb infection (high tb burden countries) together with high bcg vaccination rates are considered to have enhanced innate immunity compared with the citizens of lower tb burden countries. this high level of natural immunity is thought to be responsible for the lower covid- mortality rate. the aim of this study was to test the hypothesis that ltbi is associated with reduced covid- mortality. the instrumental variable (iv) method was used to assess causality. all data used in the analysis are publicly available and are described in the appendix. much discussion has centered around the strong correlation between bcg and covid- mortality. however, correlation does not imply causation, and can sometimes instead reflect spurious relationships. regression analysis, particularly the iv method, is a statistical method that addresses this problem to assess causality. care must be taken in using covid- mortality as a dependent variable [ ] . this is because covid- mortality is conditionally observed in potentially infected individuals, and can only be detected by testing of symptomatic or asymptomatic individuals. therefore, the case fatality rate (cfr), defined as the ratio of the number of covid- deaths per million people to the number of covid- infections per million people, is typically used. as explained above, the logarithm of the number of tb infections per , individuals (lntb ) can be used as a proxy variable for ltbis. for this regression analysis to be statistically accurate, the explanatory variable x must first be correlated with the error term u (i.e., the covariance of x and u must be zero). this condition clearly does not hold in general: besides ltbi, many other co-occurring factors, such as cultural norms, mitigation efforts, health infrastructure, and urban concentration, may influence this relationship [ ] . therefore, it is possible that x is correlated with such factors excluded in the regression equation, and that x and the error term may be correlated. this would be an example of a "spurious regression". to overcome such a problem, the iv method can be used. an iv is a variable that is strongly correlated with the explanatory variable x but is not correlated or only weakly correlated with the error term. the ivs used here were as follows. four diagnostic tests were performed to assess whether the estimates were statistically relevant. one test was concerned with the explanatory variables and the other three were concerned with the ivs. the wu-hausman test assesses the endogeneity of the explanatory variables. if the null hypothesis is rejected, one can simply use the standard ordinary least squares regression instead of using the iv. the first test of an instrument is sargan's exogenous test, which assesses whether the right number of ivs are selected and confirms that they are sufficiently uncorrelated with the error term. finally, it is necessary to perform a "weak iv test" to check if the selected ivs are strongly correlated with the explanatory variables. the instrumental variables used here were bcgindex, region and pop . two models were estimated using the iv method: one with three instruments and the other with two instrument (bcgindex and region). most of the countries with low income levels (annual per capita income less than $ usd) reported zero deaths attributed to covid- [ ] . to avoid underreporting bias in these countries, they were excluded. the total number of countries analyzed was thus . the results are shown in table . the estimates of the generalized moment method (gmm), which is often used as an alternative to the iv method, are also reported. for the diagnostic tests of the two estimation models, sargan's exogenous test indicated that the selected ivs met the exogenous property. the results of the weak iv test indicated that the ivs were sufficiently and strongly correlated with the explanatory variables. therefore, all the estimation results presented here were statistically robust. all the coefficients of lntb were approximately - . , indicating a negative association between ltbi and covid- mortality. thus, these results lend statistical support to the hypothesis that ltbi can protect against covid- mortality. because these estimation models were linear-log type, the estimated coefficient of - does bcg vaccination protect against acute respiratory infections and covid- ? a rapid review of current evidence tb prevalence correlation to covid- mortality trained immunity from mycobacterium spp. exposure or bcg vaccination and covid- outcomes is mycobacterium tuberculosis infection life long? the global burden of latent tuberculosis infection: a reestimation using mathematical modeling is there evidence that bcg vaccination has non-specific protective effects for covid- infections or is it an illusion created by lack of testing? doi correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study bauer ( ) appearent difference in fatalities between central europe and east asia due to sars-cov- and covid- : four hypotheses for possible explanation data appendix  number of covid- infections and deaths per million people as of  number of tb infections per the bcg index variable was created to represent the total number of years since during which bcg vaccination was mandated in a country's immunization schedule. for example, japan made bcg vaccination mandatory in and continues to do so today, so japan's bcg index is . france introduced bcg vaccination in and discontinued it in  ratio of the population over years old i would like to thank masayuki miyasaka at osaka university for helpful suggestions on the issue and edanz group (https://en-author-services.edanzgroup.com/ac) for editing a draft of this manuscript. this work received no specific funding. the author declares no conflict of interest. i would like to thank masayuki miyasaka at osaka university for helpful suggestions on the issue and edanz group (https://en-author-services.edanzgroup.com/ac) for editing a draft of this manuscript. this work received no specific funding. the author declares no conflict of interest. key: cord- - hxgcds authors: vargas, p.; allende, s.; vogel, e. e.; kobe, s. title: rapid characterization of the propagation of covid- in different countries date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: hxgcds background covid- has spread rapidly, and there are still many characteristics of this new disease to be unveiled. we propose a simple method to calculate a figure of merit fc to provide an early characterization of the disease status in country c. methods we use mathematical tools to adjust a gaussian function to the daily increase of infected patients. maximum value and full width half maximum of the gaussian are characteristics of the development of the development of the pandemic in each country. these parameters are supplemented by the testing volume and the mortality rate to produce just one characterizing parameter: fc. in addition, the stability of the gaussian fits was calculated within an entire week towards the end of the study period. seventeen different countries were fully considered, while others are considered when discussing particular properties. data employed is publically available. findings fitted gaussian functions render effective information about the development of covid- . the number of critical days vary between (south korea) and (mexico). fc varies between (australia) and (mexico). the epidemic appears stabilized in some countries and unstable in others. some large countries are experiencing fast development of the propagation of the disease with high fc. a correlation between low (high) values of the mortality rate (and to some extent fc) and the presence (absence) of bcg vaccination is exposed. interpretation the adjustment of a gaussian to daily data of covid- in each country reveals the different propagation dynamics, properly characterized by the parameters proposed here. testing plays a clear role to control the spread of the disease. mortality rate spans more than one order of magnitude and is somewhat related to permanent massive bcg vaccination. the figure of merit, fc, introduced here spans more than orders of magnitude which makes it a useful indicator to quickly find out the status of the pandemics in each territory. geography plays a role: low population density and isolated countries can be efficient in controlling the spread of the disease. we use mathematical tools to adjust a gaussian function to the daily increase of infected patients. maximum value and full width half maximum of the gaussian are characteristics of the development of the development of the pandemic in each country. these parameters are supplemented by the testing volume and the mortality rate to produce just one characterizing parameter: fc. in addition, the stability of the gaussian fits was calculated within an entire week towards the end of the study period. seventeen different countries were fully considered, while others are considered when discussing particular properties. data employed is publically available. fitted gaussian functions render effective information about the development of covid- . the number of critical days vary between (south korea) and (mexico) . fc varies between (australia) and (mexico) . the epidemic appears stabilized in some countries and unstable in others. some large countries are experiencing fast development of the propagation of the disease with high fc. a correlation between low (high) values of the mortality rate (and to some extent fc) and the presence (absence) of bcg vaccination is exposed. the adjustment of a gaussian to daily data of covid- in each country reveals the different propagation dynamics, properly characterized by the parameters proposed here. testing plays a clear role to control the spread of the disease. mortality rate spans more than one order of magnitude and is somewhat related to permanent massive bcg vaccination. the figure of merit, fc, introduced here spans more than orders of magnitude which makes it a useful indicator to quickly find out the status of the pandemics in each territory. geography plays a role: low population density and isolated countries can be efficient in controlling the spread of the disease. there are several models that explain the evolution of a pandemic, generally based on the initial proposal of kermack and mckendrick (kermack and mckendrick, ) , with additional improvements and variations through the years. such analyses are more suitable for a posteriori discussions to prevent future outbreaks of the same or similar diseases. more recent approaches have considered the effect of quarantine, social distancing and even local heuristic behaviors to help in the control of the more recent sars outbreak (glasser et al., ) . with the current rapid spread of the new coronavirus covid- , indicators are needed that can promptly guide to better decision-making. at the moment we write this article there is no vaccine against this virus and is out of control in several places in the world. moreover, new outbreaks or "a second wave" or even virus mutations are still possible so authorities need easy information to help in rapid decisions as to decide upon the best strategy for the territory, population density, habits, season of the year among several considerations. it is clear that there is no universal way of controlling the disease but learning from countries that have been successful in stopping the propagation of the disease can help to adapt local measures that are appropriate to the local population. this is the spirit of this paper: we propose a way to produce indicators or parameters that might help in this direction. instead of providing an exhaustive mathematical analysis of the functions involved, we propose a direct and easy-to-use empirical approach to the evolution of pandemics in order to report on the characteristics of the disease in each territory. over time, this can guide authorities in seeking timely corrections to available measures and over borders collaborations. we are aware of the cascade of material presently published on covid- . our search did not yield any results from documents published along the line we propose here. there are several public databases handling live statistics for covid- . the johns hopkins university (jhu, ) has provided a very helpful one, with interactive maps. another source with more emphasis on graphical analysis is provided by worldometers (worldometers, ). we will use the data continuously updated by the latter because of its tabulation and functional analysis, which is consistent with the idea of the present study. the population of each country will also be obtained from there and is given in the second column of table i table i . summary of data used in this paper and parameters reported here. column : country; column : population in thousand inhabitants; column : number of applied covid- tests; column : test density (ratio between the last two columns); column : accumulated number of positive tests; column : accumulated number of deaths; column : percentage of mortality (based on the ration of the two previous columns); column : bcg vaccination status; column : maximum of fitting gaussian; column : fwhm of the fitting gaussian; column : figure of merit proposed in this paper. data from https://www.worldometers.info/: columns , , , and extracted on may , ; gaussian fits with data up to april , , except for brazil fitted up to april , due to instabilities of later data. from worldometers we extract the daily number of accumulated contagions. this function will be referred to as nc(t) for country c, where t is the time measured in days; the latest nc values are listed in the fifth column of table i . thus the number of daily cases for any day t´ in the sequence is directly given by dc(t´)=nc(t´)nc(t´ ). it has been argued that the available data are not homogeneous because countries have their own testing and diagnostic systems, leaving a different number of unaccounted infected patients. we will correct this fact by taking into consideration the testing rate for each country (tc, fourth column in table i ): number of accumulated tests for country c (uc, third column in table i ) over the population. consideration will be also paid to the mortality rate mc (expressed as a percentage, seventh column in table i ) relating the total number of deaths (dc, sixth column in table i ) to the total number of cases nc (fifth column). we will extract data from worldometers for different countries. for homogeneity all these data were those available on april , . seventeen countries reflecting different continents, sizes, and reactions to covid- will be included in the study. for reasons of space and time, we have left out several important regions and the entire continent of africa. however, the simple methodology will allow readers to make their own calculations for other countries. the idea is precisely to show that the approach we propose below is capable of distinguishing different realities at the intermediate stages. these countries are listed in the first column of table i . the n(t) function (accumulated number of cases for any country) grows slowly at first but soon explodes into an exponential-like behavior (convex curve). after a few days, the reaction of society imposes limitations to the spread of the virus, and growth moderates to a point where n(t) becomes approximately linear: it has reached the turning or inflection point. if the measures taken by the authority are effective, this linear period ends soon, so that the growth rate of n(t) decreases even more and n(t) tends to flatten out (concave curve), asymptotically approaching its saturation value n(t=∞), denoted by nc for country c. one example can be observed in the lower panel of fig. . the shape of this curve can be described mathematically by a sigmoid sc(t), given by: where tc marks the turning point for country c, and coefficient ac is related to the slope of the sigmoid of country c at the turning point. the derivative of this function, d(sc(t))/dt, represents the daily cases obtained from de sigmoid whose mathematical expression can be approximately described by a gaussian function gc(t) which can be adjusted by a least square fit to the actual daily cases dc(t) for country c: where ac=acnc/ and c corresponds to the standard deviation, which is related to ac by the condition: an example of this curve can be found in the upper panel of fig. . the amplitude ac of the gaussian is important since it tells what is the expected number of infected people in the days of maximum crisis, a fraction of which will be demanding specialized hospital treatment. these values are given in column of table i . another parameter characterizing the gaussian function is the full width half maximum (fwhm) designated by c linked to c by the simple relationship: . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint Γ = √ = . . [ ] we shall use this parameter (measured in days) to characterize the duration of the critical period of the disease, which has implications on the economy of country c. values of c are listed in the tenth column of table i . we can define a figure of merit fc for any country c by combining previously defined ac and c with other relevant parameters. the former will be normalized with respect to the population of the country pc. one additional parameter is the normalized covid- tests tc(t) which can be defined by the ratio of the total number of tests uc(t) performed in country c up to time t, over its population pc: higher tc(t) values ensure better response to control de spread of the disease. another important indicator is the mortality rate mc(t) of country c, defined as the percentage of deaths dc(t) with respect to the total number of positively diagnosed cases nc(t), namely: where  is the average delay between the diagnosis and the death of a fatal patient. it is easy to find out the phase delay of the death curve to the diagnosis curve for any country, and we have found that although this varies a bit among countries it remains close to - days. it we use the latter value to evaluate the mortality of germany we get . %; if  is ignored (= ) the value is . %. for the purposes of the tabulation of this parameter, we will ignore , which will have a negligible effect when comparing among countries in later stages of the pandemic, since all countries will be affected by similar corrections. lower mc(t) values point to better handling of the infected patients. fc(t) or figure of merit can be defined as: where low values of fc(t) point to better performance in handling the critical period of the disease. this figure of merit does not mean any a priori judgment on the public health strategy followed by each country. it only represents the situation of a snapshot taken at a time t which can evolve in different ways from there on. however, a low fc(t) value can indicate that hospital facilities are expected to be enough, and/or tests are available in proportion to the population, and/or the mortality rate is low, and/or the expected duration of the crisis is short. values of fc(t) are given orderly in the last column of table i. to go beyond this static image, we propose to analyze a week (usual human cyclic unit) during this study for a dynamical testing of the gaussian fit. then we calculated the "instantaneous" fwhm values for each country c(t) for the days ending on april , . this will be an indication of the trend of c both in its time derivative and in its standard deviation: large values of the latter could mean unstable status in the control of the epidemic. the bacillus calmette-guérin (bcg) vaccine has been inoculated for decades worldwide. however, this has not been applied evenly to different countries. it has recently been proposed that populations on which this vaccine was massively administered at early ages are better able to resist the consequences of covd- . two registered protocols for clinical trials to study the effects of bcg vaccination have been proposed (nct , ; nct , ) the world health organization released a scientific report on april , , clarifying that this has not been clinically . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . https://doi.org/ . / . . . doi: medrxiv preprint established and warning against vaccination in an attempt to stop the pandemic (who, ). nevertheless, independent research is beginning to confirm some correlation between previous bcg vaccination and covid- mitigation (shet et al., ) . to contribute to this discussion, parameters in table i will be compared with the existence of vaccination for each country as indicated in column eight of this table. data for bcg vaccination were obtained from a world atlas on the subject (zwerling et al., ) . we have chosen the case of south korea to illustrate the method. this is presented in fig. , where the graphical parameters included in table i and in the previous algebra are presented. table i (and others not fully considered here, but used as reference in the discussions). a mosaic tracing gaussian functions for . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . fig. for different stages of the gaussian fit: / , / , / , and / respectively. obviously the quality of the information extracted from this procedure relies on the stage of this process. moreover, local outbreaks or a general new wave can modify this description, which is nothing but a snapshot taken on april , . we complemented this static analysis with dynamic calculations for the last week ( days) ending on april , which is day , going back to april , which is day - . each of these settings means a complete set of parameters. we focus here on the daily fwhm values for each country, namely γc(t). fig. plots the weekly average <γc> for all countries in table i , with error bars obtained from the corresponding standard deviations. the inset shows the function γc(t) for five selected countries, with australia already stabilized and the other tending to larger values of γc(t); the case of brazil is quite different reflecting great dispersion and oscillations of the reported data. despite fluctuations in the daily cases of covid- , it is possible in general to adjust a gaussian function to high density sets of data pointing to a possible mathematical description of the evolution of the pandemic in different countries, as shown in figs. and . the error bars obtained from a week in fig. indicate the stability of the data for different countries. table i orders the countries according to increasing values of fc. however, this is intended just to provide a rapid indication of the status of the country at the moment this snapshot was taken (april , ). the analysis should continue to correlate this figure of merit with other relevant parameters. it is clear that testing plays a crucial role is the prevention of any epidemic and it is also the case for covid- . thus, uc(t) appears directly in the denominator of eq. ( ) and indirectly in the mortality rate mc(t). this is the main reason to bring brazil and mexico to the end of the table, but the relatively large gaussian parameters also contribute to their high fc values. the eighth column of table i reports on the country's policy regarding mass vaccination for bcg (tuberculosis): "yes" means that vaccination has been permanently imposed in this country for decades; "no" means that mass bcg inoculation was never imposed; the year indicates when mass bcg inoculation was stopped in this country. as it can be seen, countries with permanent bcg vaccination tend to have low fc values, while countries where vaccination was never present or stopped a long time ago tend to have high values for the figure of merit proposed here. norway and switzerland have similar normalized . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . testing tc ( . , . ) but a large difference in their fc values: . and . respectively. it is clear that the main difference relays in the value of ac, namely under similar conditions these two european countries present very different contagion propagation. what makes the difference? norway has maintained massive bcg vaccination while switzerland stopped it in . a similar comparison can be performed between chile and the netherlands with similar population and normalized testing, the former with massive bcg vaccination while the latter never had it. this is also evident when comparing neighboring countries with similar culture and ethnic composition: norway (yes for bcg vaccination) has better fc than sweden (no for bcg vaccination; not in table i ); the same comparison holds for portugal (not in table i ) and spain. a special situation is found for uk: vaccination was started decades after it had been in effect in continental europe and it was also stopped after most european countries did. however, the net effect in number of years without vaccination for the presently living population is similar to other european countries. however, the most dramatic example of a small country with no permanent bcg vaccination is ecuador, the only one in south america unprotected from tuberculosis. our attempts to include it in the present study failed due to the low quality of the data: dc(t) looks like a sequence of random numbers rather than the description of a phenomenon obeying natural laws. very recently, government officials in quito acknowledged that there was large numbers of unaccounted contagions and deaths (the guardian, ). usa has the higher fc value among the countries that never had massive bcg vaccination; however, usa receives large amount of immigrants from countries where bcg vaccine is given to babies and kids, so most of the immigrants have it. the other three countries without permanent bcg vaccination occupy places at the bottom of table i . the only country with permanent bcg vaccination found in the lower places of table i is iran, which has a poor testing density and high mortality rate. although bcg inoculation does not immunize against covid- it helps to control the expansion of the disease to some extent. obviously, it is not enough: brazil and mexico have massive bcg vaccination, but other conditions have to be fulfilled in order to cope with the virus expansion. let us have a look to the upper part of the table, with fc under . what are the common features of these countries: testing density tc over . ; mortality rates mc under . ; permanent or partial bcg vaccination; good or partial control of the daily contagions as appreciated from the gaussian fits. at this moment there is nothing to be done with respect to bcg. however, testing can be increased, medical facilities can be increased according to the reality of each country and social restrictions can be imposed to help to control the disease. the right combination of these ingredients and other regional parameters need to be evaluated locally. in addition, we also examined the dynamic behavior of the data over one week to find out if the gaussian adjustments γc(t) are already stabilized. this is shown by the error bars in fig. ; recent trends are seen from graphs such as those included in the inset of this figure. the abscissa carries the countries in increasing order of the error bars. although the average widths of the gaussians are scattered around days, the daily oscillations themselves can be huge. brazil is a case on its own: the huge oscillations shown in fig. continued in the following days to the point that after april was impossible to fit a gaussian any more. that is the reason ac and c for brazil in table i had to be calculated on april to have some crude approximation for these parameters. in a sense, the huge error bar for brazil in fig. was an announcement of the upcoming instability regime to come. mexico and to a lower extent chile and belgium can fall in this oscillatory regime if no appropriate measures are taken soon. which is the optimal way to control covid- ? there are two possible scenarios: a) with a vaccine against this virus, b) without such vaccine. at the moment this is a bet although there are promising news revealing progress in the development of the vaccine. let us discuss both alternatives. a) in this case the optimal situation is a short critical period affecting the economy (small Γc), a low value of the demand of medical facilities (small ac), which combine to a low value of the figure of merit fc. in addition, small error bars on the stabilized gaussian functions ensure stability of this evaluation. evidently, this requires strong measures over vast extensions of the territory to keep these indicators low all the times; the measures that lead to control the disease cannot be entirely relaxed. in the meanwhile the vaccine is produced in large quantities to inoculate all the population. australia, south korea, israel, and norway (on three different continents) have proven that this optimization is feasible. b) without vaccine we must assume that many people will be infected sooner or later, and nc will represent a substantial portion of the population. in . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted june , . . this scenario, the only possible strategy is to try to keep ac under the medical capabilities of the country upon diluting the infected cases in time meaning a large value of Γc. from the countries listed in table i , spain, italy, belgium, united kingdom and netherlands present high values for the parameters considered here in coincidence with what is known as we finish writing this paper. at the moment brazil and mexico present unpredictable scenarios. countries of small population size seem to contain covid- in a more efficient way. however, this is not a rule of thumb. switzerland, the netherlands and belgium in spite of having populations under million people, their indicators are similar to others in their neighboring countries. thus, geography also plays a role and isolated countries like australia and south korea seem to have taken advantage of this fact. large countries without bcg massive vaccination seem to be the places where covid- is harder to control. from those included in table i we should mention usa, spain, italy, and uk. of course usa stands out due to its large population (with a large portion of elderly people), diversity, and commuting networks. to get another point of view on this issue, we consider the three countries with the highest fc values in table i , looking for the number of days it took in each case to go from to contagions. after linear interpolations the results are the following: uk . days, italy . days and spain . days, with countries ordered by decreasing population. this evidences the fast surge that occurred in italy: in a few days the numbers of contagions skyrocketed. in addition we can pay attention to the date the number of accumulated cases overcame , people in these countries: march in italy, march in spain, and march in uk. the propagation of covid- has been from east to west and later from north to south in the americas. eventually, this explains the large error bars for the south american countries in fig. . in this moment most of the countries in south america are on the apex of their respective fitting gaussians, showing the strong oscillations other countries have previously experienced (see fig. ) . we also tried to include argentina in the present study, but the data structure is rather strange, showing days without information. its test density is only . , similar to brazil. this is just to mention that data quality is very uneven making it difficult to analyze just one indicator so it is necessary to combine several of them. the method presented here provides a quick way to estimate the impact of covid- in different countries and territories. daily new cases can be adjusted using a gaussian function whose fwhm (Γc) measures the duration of the critical part of the epidemic having effects mainly on the economy. the height of the gaussian ac measures the possible response to the maximum demand of medical facilities. previous parameters can be combined with the testing density and the mortality rate to produce a figure of merit fc with a range of values spanning over orders of magnitude, providing an easy quick test for the status of the pandemic in a territory allowing to for comparisons and early detection of tendencies. an analysis based on a week of continuous data allows to find standard deviations that indicate whether the gaussian describing each country is stabilized. countries with stabilized gaussian functions and relatively low values of fc show a more manageable evolution of the disease. generally speaking, these countries have reported ongoing mass vaccination with bcg, a relationship that should be further investigated. small isolated countries seem to be in better conditions to impose measures that effectively stop the spread of covid- . controlling the spread of the pandemic up to the turning point (tc) seems to be possible everywhere; beyond this point progress is hard for most of the countries as revealed by the difficulty in stabilizing the gaussian curves adjusting to the progression of the daily cases. however, some countries have succeeded to get over this curve, reporting a number of daily cases of less than % the maximum of the gaussian (ac), which evolves in the form of a very slow decay. without a vaccine against covid- our only way to stop it is a global response to contain the virus, isolate it and let it die. this requires common efforts, based on rapid indicators easy to obtain at present times. our work aims to that purpose and we believe that our parameter fc, eventually complemented with indicators coming from other studies, provides information to make progress in this . cc-by-nc-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted june , . . all these efforts depend on the data quality; unfortunately at present, not all the data are reliable references glasser et mckendrick contribution to the mathematical theory of epidemics proc bcg vaccination to protect healthcare workers against covid- (brace) reducing health care workers absenteeism in covid- pandemic through bcg vaccine differential covid- -attributable mortality and bcg vaccine use in countries key: cord- - wt rn a authors: gursel, mayda; gursel, ihsan title: is global bcg vaccination‐induced trained immunity relevant to the progression of sars‐cov‐ pandemic? date: - - journal: allergy doi: . /all. sha: doc_id: cord_uid: wt rn a nan in january, who director general tedros adhanom ghebreyesus said his "greatest concern" was covid- spreading in countries with fragile health systems. although countries like india, philippines,thailand, and nepal have reported their first confirmed cases of the sars-cov- virus in january, widespread community spread have not been reported. contrary to such justified expectations/predictions, on march , who declared europe as the epicenter of the pandemic. even though we are still in the midst of the coronavirus pandemic, the disproportionately smaller number of cases reported from disadvantaged/low income countries remains puzzling. we hypothesize that general bcg vaccination policies adopted by different countries might have impacted the transmission patterns and/or covid- associated morbidity and mortality. vaccines provide protection to a particular pathogen by inducing effector mechanisms directed to that pathogen. however, certain attenuated vaccines like the bacillus calmette-guerin (bcg), can also protect against unrelated pathogens, some of which cause acute respiratory tract infections ,s -s . the underlying mechanism for the bcg vaccinationinduced non-specific protection is thought to be mediated via the induction of innate immune memory, or "trained immunity, as was first proposed by netea and collaborators. trainedimmunity inducing agents reprogramme bone marrow hematopietic stem cells and multipotent progenitors through epigenetic and metabolic changes, resulting in a more robust response in differentiated innate immune cells, following encounter with a pathogen s -s . of interest, in a randomized placebo-controlled human study, bcg vaccination was demonstrated to induce epigenetic reprograming in monocytes, conferring protection against experimental infection with an attenuated yellow fever virus vaccine strain. based on these observations, we hypothesized that countries who continue bcg immunization programs would contain the spread of this new coronavirus better than those that did not have or have ceased their national bcg vaccination programs. to check the validity of this hypothesis, we compared the number of cases and deaths per million people from all countries with at least ( march) or cases ( this article is protected by copyright. all rights reserved table ). cases/million in countries with a national bcg vaccination programme were statistically significantly lower than those that did not have/ceased their national bcg vaccination programs (p< . ). we also compared the number of deaths per million. results showed that covid- associated deaths relative to the size of the population were significantly lower in countries with a national bcg vaccination programme than those without bcg vaccination (p< . and p< . for march and , march, respectively). to correct for different stages of the spread of disease, we downloaded the data showing the total confirmed deaths since the th death from our world in data web site (https://ourworldindata.org/grapher/covidconfirmed-deaths-since- th-death). instead of the th death as day , we chose the th death as day . the total deaths on th or th days after the th death were divided by the population of each country to obtain deaths/million. all countries that had data on these days were included and the comparison between the bcg vaccinated and unvaccinated populations were made (figure c). using this "disease stage normalized" data, there was still a highly significant difference between countries that adhered to national bcg vaccination policy versus those that had ceases/never had a national programme ( figure c ). if bcg vaccination has a general non-specific protective effect against spread of sars-cov- or covid- -associated morbidity and mortality, then bcg re-vaccination of populations offer a viable alternative of partial protection until a specific vaccine is available. the duration of bcg-induced trained immunity or how different vaccine strains compare in terms of longevity of induced innate memory is not known. work by netea et al show that the "trained immunity status" is maintained for at least a year (the maximum time point they measured) s . bcg-induced protection against tuberculosis lasts for approximately years and wanes thereafter s . if one assumes that bcg-induced non-specific protective effect also lasts for years and gradually wanes, then there should be a difference between countries that have stopped bcg vaccination earlier versus later. to assess this possibility, we analysed data from european countries that have ceased their national bcg vaccination programmes (supplementary table ). according to this, countries (norway, this article is protected by copyright. all rights reserved this article is protected by copyright. all rights reserved methoxymycolate-producing early strains are more potent immunostimulating agents than the late strains. mycolic acids can condition macrophages to produce higher levels of ifn-γ, myeloperoxidase and tnf-α upon renewed exposure to innate triggers. accordingly, mycolic acids constitute an important group of ligands capable of inducing trained immunity. methoxymycolic acids are inflammatory and can activate macrophages, whereas, ketomycolic acids promote anti-inflammatory, alternatively activated macrophages. since the persistence and immunostimulatory properties of bcg strains differ, their potential to induce trained immunity in vaccinated individuals could also vary. when we analyzed available data on bcg vaccine strains used in different countries routine vaccinations and child survival: follow up study in trained immunity: a memory for innate host defense bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity genome plasticity of bcg and impact on vaccine efficacy a point mutation mycobacterium bovis bcg strains obtained after comparable studies of immunostimulating activities in vitro among mycobacterium bovis bacillus calmette-guérin (bcg) substrains molecular structure of the mycobacterium tuberculosis virulence factor, mycolic acid, determines the elicited inflammatory pattern mapping the global use of different bcg vaccine strains the bcg world atlas: a database of global bcg vaccination policies and practices conflict of interest statement: dr. gursel has nothing to disclose. dr. gursel has nothing to disclose this article is protected by copyright. all rights reserved key: cord- - o mcur authors: fritschi, nora; curtis, nigel; ritz, nicole title: bacille calmette guérin (bcg) and new tb vaccines: specific, cross-mycobacterial and off-target effects date: - - journal: paediatr respir rev doi: . /j.prrv. . . sha: doc_id: cord_uid: o mcur the bacille calmette guérin (bcg) vaccine was developed over a century ago and has become one of the most used vaccines without undergoing a modern vaccine development life cycle. despite this, the vaccine has protected many millions from severe and disseminated forms of tuberculosis (tb). in addition, bcg has cross-mycobacterial effects against non-tuberculous mycobacteria and off-target (also called non-specific or heterologous) effects against other infections and diseases. more recently, bcg’s effects on innate immunity suggest it might improve the immune response against viral respiratory infections including sars-cov- . new tb vaccines, developed over the last years, show promise, particularly in prevention of progression to disease from tb infection in young adults. the role of bcg in the context of new tb vaccines remains uncertain as most participants included in trials have been previously bcg immunised. bcg replacement vaccines are in efficacy trials and these may also have off-target effects. the reader will be able to against other diseases. in the following decades a reduction in all-cause mortality was found in a number of controlled trials in the us, uk, canada, india and papua new guinea, and more recently in observational and randomised controlled studies mainly in bissau. a who commissioned systematic review, which analysed studies available up until , concluded that bcg reduced all-cause mortality by % ( % confidence interval: − % to %) in clinical trials. since then, two further randomised controlled trials have been published. the first one, in guinea-bissau, showed a reduction in mortality in the first days of life by % ( % confidence interval: − % to %), which decreased to % at and months of age. the second trial, done in intensive care units in india, showed no significant change in reduction of mortality in the first days of life of % ( % confidence interval: − % to %) in the bcg-immunised infants. it has been proposed that the difference in the results from guinea-bissau and india might be attributable to the use of different vaccine strains (bcg-denmark in guinea-bissau and bcg-russia in india). in addition, the infants in india were of lower birth weight (< grams compared with < grams in guinea-bissau) and potentially sicker as they were in an intensive care unit. the studies on reduction in infant mortality by bcg triggered studies on its protective effect against respiratory tract infections, these being one of the most common causes of mortality immunisation. similarly, for guardian-reported infections at -and -month telephone interviews, there was no influence of bcg on the frequency of fever, pneumonia or cold episodes. interestingly, in a post hoc subset analysis of infants whose mothers had received bcg, there was a % ( % confidence interval: % to %) reduction in infections in the first three months of life in the unadjusted hazard ration analysis . a randomised study in south african adolescents investigating a novel tb vaccine (h :ic ) also included a bcg revaccination arm. lower respiratory tract infections were rare in all groups over the months follow-up period and there was no difference between bcg-revaccinated and non- revaccinated individuals. however, there was a reduction in upper respiratory tract infections in bcg-immunised individuals compared with those who received the new tb vaccine or placebo ( . %, . %, and . % respectively). animal studies suggest that bcg has protective effects against viruses including influenza, herpes simplex, hepatitis b and japanese encephalitis. studies in humans that have investigated prevention of viral diseases associated with bcg immunisation are rare. an interesting randomised placebo-controlled study in healthy male adults (not previously bcg immunised) compared the immune response to a yellow fever immunisation as a "viral challenge model" one month after bcg immunisation. viremia is usually detectable after yellow fever immunisation in the first few days. the study showed a difference on day after yellow fever immunisation with higher viral loads in the non-bcg-immunised adults compared to the bcg-immunised adults but this was not the case when viral loads were compared on day and . they also investigated in-vitro cytokine expression after bcg immunisation and showed that with some stimulants and cytokines this was increased in the bcg-immunised group. further, monocytes from bcg-immunised individuals responded (transcriptionally) differently to a secondary in-vitro stimulus and suggesting that bcg- immunisation induces trained immunity in innate immune cells through epigenetic changes. innate immune responses have been shown to be important in both specific and off-target effects of bcg. , in the light of the evidence for off-target effects on viral respiratory tract infections, it is therefore not surprising that bcg-immunisation has been proposed as a potential prophylaxis against the novel severe acute respiratory syndrome coronavirus- (sars-cov- ). it is hypothesised that induction of a trained immunity by bcg immunisation may reduce severity of coronavirus disease (covid- ) and randomised controlled trials are underway in several countries worldwide to assess whether bcg immunisation reduces the incidence and severity of covid- in healthcare workers. , however, although bcg immunisation is generally safe in children and adults, it is also possible that up-regulation of innate immunity by bcg immunisation will exacerbate covid- and therefore bcg immunisation for covid- should only be given within clinical trials. , cautious interpretation is also needed for pre-publication released ecological studies suggesting that countries with longstanding and universal bcg immunisation policy have reduced mortality and numbers of covid- cases. , . such ecological studies are prone to significant bias from many confounders, including differences in national demographics and disease burden, different definitions used for covid- (confirmed cases only versus inclusion of presumed cases), testing rates for sars-cov- , and the stage of the pandemic in each country. , in addition, the current expert opinion is that bcg vaccine given many years earlier is unlikely to protect against covid- as trained immunity induced by bcg might not be long-lasting and is likely abrogated by other vaccines. these and several other ecological studies should therefore be interpreted with caution as bcg is -including during the covid- pandemic -essential for the prevention of tb in infants and young children. it therefore should not be used for the prevention of covid- before solid evidence for its effectiveness for this indication is available. today the bcg vaccine is universally administered as an intradermal injection, but the original bcg was given orally. in brazil, the bcg-moreau strain was used as an oral vaccine until . in addition, animals studies done almost years ago, showed superior protection when intravenous and aerosol application were used compared with intradermal administration. recent data from a study in macaques compared tb prevention after intradermal, intravenous and aerosol bcg immunisation (given via a paediatric mask attached to a pari eflow nebuliser). the study had a complex design with several bcg administration routes: low-dose and high-dose intradermal, intravenous, aerosol and a combination of aerosol and intradermal. to compare the effects of intravenous and intradermal administration, only the high-dose intradermal and the intravenous groups should be compared as these received x colony forming units (cfu) of bcg-denmark. intravenous bcg administration resulted in a higher frequency of specific cd and cd t cells in blood and parenchymal lung tissue compared with the two other routes of immunisation. after the challenge with m. tuberculosis erdman to months after bcg immunisation, macaques that had received intravenous bcg showed superior protection the vaccine is also being tested in trials in several other settings in adults for prevention of disease and recurrence, and also for its off-target effects on bladder cancer. petroff sa, branch a. bacillus calemette-guérin (b.c.g.). animal experimentation and prophylactic immunization of children intradermal vaccination by bcg virus tuberculosis vaccines protective effect of bcg against tuberculous meningitis and miliary tuberculosis: a meta-analysis. international journal of epidemiology long-term efficacy of bcg vaccine in american indians and alaska natives: a -year follow-up study effect of bcg vaccination on childhood tuberculous meningitis and miliary tuberculosis worldwide: a meta-analysis and assessment of cost-effectiveness the efficacy of bacillus calmette-guérin vaccination of newborns and infants in the prevention of tuberculosis: meta-analyses of the published literature effect of bcg vaccination against mycobacterium tuberculosis infection in children: systematic review and meta- analysis bcg vaccination and leprosy protection: review of current evidence and status of bcg in leprosy control does bcg vaccination protect against nontuberculous mycobacterial infection? a systematic review and meta-analysis mycobacterial infections after bacille calmette-guérin coverage drop: a nationwide, population-based retrospective study atypical mycobacteria in extrapulmonary disease among children. incidence in sweden from to , related to changing bcg-vaccination coverage. tuber lung dis randomized clinical multicenter trial bcg vaccination at birth and early childhood hospitalisation: a randomised clinical multicentre trial nonspecific effect of bcg vaccination at birth on early childhood infections: a randomized, clinical multicenter trial bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity the contribution of non- conventional t cells and nk cells in the mycobacterial-specific ifngamma response in bacille calmette-guerin (bcg)-immunized infants bcg-induced trained immunity in nk cells: role for non-specific protection to infection considering bcg vaccination to reduce the impact of covid- a comparative analysis of polyfunctional t cells and secreted cytokines induced by bacille calmette-guerin immunisation in children and adults mandated bacillus calmette- bcg) vaccination predicts flattened curves for the spread of covid- stop playing with data: there is no sound evidence that bacille calmette-guérin may avoid sars-cov- infection (for now) sars-cov- rates in bcg-vaccinated and unvaccinated young adults bacille calmette-guérin (bcg) vaccine and the covid- pandemic: responsible stewardship is needed bcg vaccination enhances the immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized, placebo-controlled pilot study non-specific effect of bacille calmette-guerin vaccine on the immune response to routine immunisations influence of mycobacterium bovis bacillus calmette-guerin on antibody and cytokine responses to human neonatal vaccination the influence of neonatal bacille bcg) immunisation on heterologous vaccine responses in infants bacille calmette-guerin (bcg) vaccination at birth and antibody responses to childhood vaccines. a randomised clinical trial bcg: a vaccine with multiple faces does neonatal bcg vaccination prevent allergic disease in later life? infants born in australia to mothers from countries with a high prevalence of tuberculosis: to bcg or not to bcg? paediatric tuberculosis network european trials g. current status of bacille calmette guerin (bcg) immunisation in europe -a ptbnet survey and review of current guidelines bacille calmette-guérin shortage on immunisation practice and policies in europe - a paediatric tuberculosis network european trials group (ptbnet) survey world health organization to bcg or not to bcg? preventing travel-associated tuberculosis in children mapping the global use of different bcg vaccine strains genomic expression catalogue of a global collection of bcg vaccine strains show evidence for highly diverged metabolic and cell-wall adaptations bcg -different strains, different vaccines? the lancet infectious diseases bacille calmette-guérin vaccine strain modulates the ontogeny of both mycobacterial-specific and heterologous t cell immunity to vaccination in infants early vaccination with bcg-denmark or bcg-japan versus bcg-russia to healthy newborns in guinea-bissau: a randomized controlled trial the potential impact of bcg vaccine supply shortages on global paediatric tuberculosis mortality systematic review protocol on bacillus calmette-guerin (bcg) revaccination and protection against tuberculosis bcg) revaccination: is it beneficial for tuberculosis control? open access scientific reports moreau rio de janeiro: an oral vaccine against tuberculosis--review protection of monkeys against airborne tuberculosis by aerosol vaccination with bacillus calmette-guerin. am rev respir dis prevention of tuberculosis in macaques after intravenous bcg immunization alternative bcg delivery strategies improve protection against mycobacterium tuberculosis in non-human primates: protection associated with mycobacterial antigen-specific cd effector memory t-cell populations kaufmann she. vaccination against tuberculosis: revamping bcg by molecular genetics guided by immunology safety and efficacy of mva a, a new tuberculosis vaccine, in infants previously vaccinated with bcg: a randomised, placebo-controlled phase b trial mva a vaccine to enhance bcg for preventing tuberculosis prevention of tuberculosis in rhesus macaques by a cytomegalovirus-based vaccine live-attenuated mycobacterium tuberculosis vaccine mtbvac versus bcg in adults and neonates: a randomised controlled, double-blind dose-escalation trial. the lancet respiratory medicine safety and immunogenicity of the recombinant mycobacterium bovis bcg vaccine vpm in hiv-unexposed newborn infants in south africa figure : summary of the specific, cross-mycobacterial and off-target effects of bcg relevant to children only vaccines that are in (or registered for) phase ii or iii trials are included. the colours around vaccines denote trials that have shown improved protection (green), no improvement (orange) h :ic : fusion protein of antigens b and tb . with ic adjuvant h :ic : fusion protein of antigens b, esat- and rv c with ic adjuvant m /as e: fusion protein of antigen a and a with as e adjuvant mva : modified vaccinia ankara a tb/flu- l: influenza a vectored vaccine expressing the antigens a and esat- mtbvac: live attenuated m. tuberculosis strain (euro-american lineage ) with deletion mutations in the virulence genes phop and fadd vpm c: live attenduated m. bovis bcg-prague (rbcgΔurec:hly) dar- : heat-killed, fragmented m. tuberculosis cultured under stress conditions mip: heat-killed mycobacterium indicus pranii a non-pathogenic, non-tuberculous mycobacterium approved in india as a leprosy vaccine heat-killed mycobacterium vaccae a non-pathogenic, non-tuberculous mycobacterium key: cord- - mim yl authors: kumar gupta, pramod title: new disease old vaccine: is recombinant bcg vaccine an answer for covid- ? date: - - journal: cell immunol doi: . /j.cellimm. . sha: doc_id: cord_uid: mim yl mycobacterium bovis bcg, a live attenuated tuberculosis vaccine offers protection against disseminated tb in children. bcg exhibits heterologous protective effects against unrelated infections and reduces infant mortality due to non-mycobacterial infections. recent reports have suggested that bcg vaccination might have protective effects against covid- , however it is highly unlikely that bcg vaccine in its current form can offer complete protection against sars-cov- infection due to the lack of specific immunity. nonetheless, recombinant bcg strains expressing antigens of sars-cov- may offer protection against covid- due to the activation of innate as well as specific adaptive immune response. further proven safety records of bcg in humans, its adjuvant activity and low cost manufacturing makes it a frontrunner in the vaccine development to stop this pandemic. in this review we discuss about the heterologous effects of bcg, induction of trained immunity and its implication in development of a potential vaccine against covid- pandemic. reported globally (https://covid .who.int/). before covid- , human coronaviruses (covs) have the ongoing covid- pandemic has spread over countries and territories till date. remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus ( -ncov) in vitro a genomic perspective on the origin and emergence of sars-cov- , cell the epidemiology and pathogenesis of coronavirus disease (covid- ) outbreak a pneumonia outbreak associated with a new coronavirus of probable bat origin sars-cov- vaccines: status report origin and evolution of pathogenic coronaviruses a new coronavirus associated with human respiratory disease in china sars and mers: recent insights into emerging coronaviruses characterization of the receptor- binding domain (rbd) of novel coronavirus: implication for development of rbd protein as a viral attachment inhibitor and vaccine structure, function, and antigenicity of the sars-cov- spike glycoprotein a sequence homology and bioinformatic approach can predict candidate targets for immune responses to sars-cov- , cell host & microbe non-specific effects of bcg vaccine on viral infections, clinical microbiology and infection : the official publication of the european society of clinical microbiology and infectious diseases bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity nonspecific effects of vaccines and the reduction of mortality in children bcg-induced cross-protection and development of trained immunity: implication for vaccine design bcg vaccination scar associated with better childhood survival in guinea-bissau, randomized trial of bcg vaccination at birth to low-birth-weight children: beneficial nonspecific effects in the neonatal period? small randomized trial among low-birth-weight children receiving bacillus calmette-guérin vaccination at first health center contact acute lower respiratory tract infections and respiratory syncytial virus in infants in guinea- bissau: a beneficial effect of bcg vaccination for girls community based case-control study, vaccine can intravesical bacillus calmette-guerin reduce recurrence in patients with superficial bladder cancer? a meta-analysis of randomized trials bcg vaccination enhances the immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized, placebo-controlled pilot study prevention of elderly pneumonia by pneumococcal, influenza and bcg vaccinations], nihon ronen igakkai zasshi the efficacy of bacillus calmette-guerin vaccinations for the prevention of acute upper respiratory tract infection in the elderly prevention of m. tuberculosis infection with h :ic vaccine or bcg revaccination trained immunity: a tool for reducing susceptibility to and the severity cov- infection correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study, medrxiv bcg-induced trained immunity in nk cells: role for non-specific protection to infection bacille calmette-guérin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes trained immunity: a program of innate immune memory in health and disease defining trained immunity and its role in health and disease chromatin contributions to the regulation of innate immunity, annual review of immunology identification and characterization of enhancers controlling the inflammatory gene expression program in macrophages chromatin modifications and their function regulation of t cell differentiation and function by epigenetic modification enzymes long-term in vitro and in vivo effects of gamma-irradiated bcg on innate and adaptive immunity trained immunity: consequences for the heterologous effects of bcg vaccination trained immunity and local innate immune memory in the lung immunometabolic pathways in bcg-induced trained immunity netea, mtor-and hif- α-mediated aerobic glycolysis as metabolic basis for trained immunity glutaminolysis and fumarate accumulation integrate immunometabolic and epigenetic programs in trained immunity metabolic induction of trained immunity through the modulation of myelopoiesis progenitors is an integral component of trained immunity hematopoietic progenitor cells as integrative hubs for adaptation to and fine-tuning of inflammation bcg educates hematopoietic stem cells to generate protective innate immunity against tuberculosis harnessing the beneficial heterologous effects of vaccination cd t-cell-mediated heterologous immunity between mycobacteria and poxviruses long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity immunomodulatory effects of bcg in patients with recurrent respiratory papillomatosis, folia medica applications of bacillus calmette-guerin and recombinant bacillus calmette-guerin in vaccine development and tumor immunotherapy, expert review of vaccines cell-mediated immunity induced by recombinant <em>mycobacterium bovis</em> bacille calmette-guérin strains against an intracellular bacterial pathogen: importance of antigen secretion or membrane-targeted antigen display as lipoprotein for vaccine efficacy recombinant bcg Δurec hly+ induces superior protection over parental bcg by stimulating a balanced combination of type and type cytokine responses the recombinant bcg Δurec::hly vaccine targets the aim inflammasome to induce autophagy and inflammation oral recombinant mycobacterium bovis bacillus calmette-guerin expressing hiv- antigens as a freeze-dried vaccine induces long-term, hiv-specific mucosal and systemic immunity robust immunity to an auxotrophic mycobacterium bovis bcg-vlp prime-boost hiv vaccine candidate in a nonhuman primate model a novel hepatitis c virus vaccine approach using recombinant bacillus calmette-guerin expressing multi-epitope antigen, archives of virology recombinant bcg vaccines reduce pneumovirus-caused airway pathology by inducing protective humoral immunity, front immunol a recombinant bacille calmette-guerin construct expressing the plasmodium falciparum circumsporozoite protein enhances dendritic cell activation and primes for circumsporozoite-specific memory cells in balb/c mice, vaccine immune response induced by recombinant mycobacterium bovis bcg expressing rop gene of toxoplasma gondii plasmidic versus insertional cloning of heterologous genes in <em>mycobacterium bovis</em> bcg: impact on vivo antigen persistence and immune responses recombinant chadox is safe, stable, and elicits hiv- -specific t-cell responses in balb/c mice, frontiers in immunology conflict of interest disclosure: author has no conflict of interest to disclose intramural funding by department of atomic energy, india  acknowledgments: i acknowledge department of atomic energy  covid- , the global pandemic has infected more than . million people causing more than . lac deaths worldwide dry cough, breathing difficulties (dyspnoea), headache and pneumonia are the common symptoms  tuberculosis vaccine bcg exhibits beneficial heterologous effects  recombinant bcg vaccine expressing s protein may be a potential vaccine candidate key: cord- -ud vz zu authors: raham, t. f. title: malaria endemicity influence on covid - mortality: new evidence added to bcg and tb prevalence date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: ud vz zu background: regarding sars-cov- it is well known that a substantial percentage of adult population cannot get infected if exposed to this novel coronavirus. several studies give primary indication of the possible role of preexisting immunity whether cross immunity or not. possible role of latent tb and bcg have been already suggested to create innate cross heterogeneous immunity. possible role of malaria is suggested in this paper possibly by same mechanism of protection. material and methods: malarious countries are enrolled in this study. hierarchical multiple regression type of analyses is used for data analyses. tb prevalence/ , population standardized to bcg coverage rates is taken as direct factor in the test. malaria incidence / population is considered as intermediate factor and the outcome is covid- mortality/ million (m) population. results: the results show with robust statistical support that standerized tb prevalence to bcg coverage is significantly associated with reduced covid- mortality and malaria incidence have an additional highly significant effect in reducing covid- mortality. conclusions: malaria and standardized tb prevalence are statistical significant factors predicting covid- mortality in negative associations. microorganisms infecting mammalian hosts may modulate long lasting protective heterologous cross-immunological reactions once exposed to heterologous agonists in the future , , . in , netea et al proposed the term "trained immunity" to describe this ability of innate immune cells to nonspecifically adapting, protecting and remembering primary stimulation . bcg bcg through attenuated strain of mycobacterium bovis was used to produce heterogeneous immunity against mycobacterium tuberculosis , another species within the genus mycobacterium. bcg was blamed to lead to incomplete and often varying degree of protection against tb disease . on the other hand, studies have been done over the past few decades show that certain adaptations connected with innate immune cells (monocyte/macrophages, nk (natural killer) cells are responsible for nonspecific effects of vaccination beyond its target , .these studies show that vaccination with bcg induces an improved innate immune response against microorganisms other than mycobacterium,which include bacteria such as staphylococcus aureus, fungi such as candida albicans and viruses such as the yellow fever virus , , . there are evident roles of bcg in reduction of neonatal sepsis and respiratory infection reduction , , . its role in childhood mortality reduction is known since , , . furthermore bcg-vaccination was associated with diminished morbidity and mortality rates associated with malaria , unclassified fever, preventing, sepsis and leprosy , , , , , . in spite of that, many countries discontinue bcg vaccinations or limited its use to high risk groups because great achievements in reduction of tb prevalence rates in these countries. tb tuberculosis (tb) is one of the major causes of illness and death in many countries and constitute a significant public health problem worldwide. tb disease is one of the top causes of death accounted to estimated million people in .about one-quarter of the world's population has latent tb which leads - % lifetime risk of falling ill with tb , . mycobacterium tuberculosis antigen stimulation without any clinically active disease . the lifetime risk of reactivation of tb is estimated to be around - % . the who recommends tailored latent tuberculosis infection management based on tuberculosis burden and resource availability . treatment of active disease is by far the major intervention in this regard worldwide, while diagnosis and treatment of ltbi are hindered by the cost implications of testing, lack of a consensus on the tests recommended, and side effects of treatment . treatment of ltbi in low prevalence (high to upper-middle-income) countries like usa and many europian countries is feasible (in spite of prolonged adaptive immunological response to mycobacterium antigen) , as elimination of this reservoir of infection will reduce the burden of tb disease. however, the scenario in high prevalence countries like many countries in asia and africa is quite the opposite where, reinfection due to contact with active cases rather than reactivation contributes to a high disease burden malaria infection can be asymptomatic, or, more accurately, "subclinical," because subtle symptoms and chronic health effects may occur but not lead to clinical diagnosis and treatment . in similar way for tb control program , malaria elimination require ( eradicating both clinically symptomatic as well as these "silent" infections malaria also was founded to clear s. pneumonia much more efficiently in coinfected model heterogenous immunological response also exists among different malaria species. as far as sars-cov- is known that a substantial percentage of adult population cannot get infected if exposed to this novel coronavirus . several studies suggest a possible role of preexisting immunity whether cross immunity or not (antibodies/t cells, etc.) as a factor explaining such diversity . all rights reserved. no reuse allowed without permission. preprint (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this this version posted september , . . https://doi.org/ . / . . . doi: medrxiv preprint previous studies on latent tb association with reduction of covid- mortality did not give explanation for high mortality in certain countries like south africa where covid- mortality/m population is at the study time while tb prevalence/ population is very high ( ). furthermore these studies do not explain low covid- mortality /m population in countries like in togo ( ), benin( ) and mali ( ) which have relatively low tb prevalence while covid- mortality is ( ),( ) and ( ) respectively. our study background hypothesis stands on possible heterogeneous immunity generated by malaria in addition to possible heterogeneous immunity generated by tb. this study will test covid- mortality in malarious countries against malaria incidence and tb prevalence calibrated by bcg coverage to look for statistical associations and significances. up to our knowledge this is the first work examine the effect of malaria and bcg coverage on covid- mortality . all rights reserved. no reuse allowed without permission. preprint (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this this version posted september , . total number of malarious countries and territories enrolled in this study is . all of these countries have current bcg vaccination programs but differ vaccination coverage. hierarchical regression of composite -multiple linear model, is used for data analyses. the direct factor of reducing the mortality rates with reference to covid- is the standardized tb/ , population by bcg vaccination coverage percentage in through dividing the factor of tb/ , population rates by the factor of bcg vaccination coverage in , while the indirect effect that reduce the mortality rates, named as intermediate factor which is "the malaria incidence for / population ". we investigate the validity of the assumptions of studied model that adopts the results of quantitative measurements. table no. ( ) shows the results of the multiple linear model fitness test resulted from the regression analysis of variance. preprint (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this this version posted september , . preprint (which was not certified by peer review) is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this this version posted september , . . https://doi.org/ . / . . . doi: medrxiv preprint meaningful linear regression tested in two tailed alternative statistical hypothesis of studied factor playing effective role for reducing "covid- death / m. population" as a function of the previous factor. slope value estimated indicates that with increasing one unit of the studied factor, a negative influence on unit of the rates function factor occurred, and estimated as (- . ). this decrement recorded significant influence at p< . . other sources of variations are not included in model, i.e. "constant term in regression equation" shows that non assignable factors which are not included in regression equation, ought to be informative, since estimation about ( ) cases of " covid- mortality / m." expected initially without effectiveness of the restriction of studied factor. back to the results of the table no. ( ) , and regarding to composite regression estimate's factors (i.e. the standardized tb/ by bcg vaccination coverage as direct effect, and malaria incidence for / population as indirect effect) results shows a meaningful composite linear regression tested in two tailed alternative statistical hypothesis of studied factor is playing effective role for reducing "covid- death / m." rates as a function of the previous factors. slope value concerning the that the first factor's estimate indicates that with increasing one unit of the studied first factor, a negative influence on unit of the rates function factor would occur, and estimated as (- . ). the decrement recorded significant influence at p< . , while with presence of indirect effect by the second factor, slope value indicates that with increasing one unit of that factor, a negative influence on unit of the rates function factor would occur, and estimated as (- . ). the decrement recorded has highly significant influence at p< . . ohers source of variations are not included in composite regression model, i.e. "constant term " ought to be informative, since estimated that about ( ) cases of "covid - mortality / m." expected initially without effectiveness of the restriction of studied factors. in this study the prevalence of mycobacterium spp. (including bcg vaccine) exposure of the populations is negatively associated with covid- deaths per million populations this supports the three for mentioned studies , , . tb prevalence standardization for bcg coverage is very important factor regarding studying countries currently implementing bcg programs. coverage in such studies reflects the degree of benefits added to the factor (latent tb prevalence) the coverage do and that's what we do in this study. likewise the influence of time duration of cessation of bcg vaccination program is a factor in determining covid- mortality in countries ceased implementing this vaccine and that's what we did in one of our previous studies. malaria which possibly induce immunological response similar to tb as we suggest in one way or another is significantly associated with reduction in covid- mortality in this study. this finding is the first to be reported up to our knowledge. this association although needs confirmatory immunological and clinical control studies to establish causation. furthermore, this finding can explain the variances in covid- mortality among different countries much deeper than tb and bcg alone. bcg vaccination status for countries being of concern earlier before latent tb becomes of concern but previous early studies were conflicting and were criticized because of possible confounding factors. in our study her all countries are implementing national bcg programs but tb countries' prevalence / , population were standardized by bcg coverage rates. recommendations: malaria, tb prevalence and bcg coverage rates are possible factors in covid- mortality should looked for deeply for possible causation to current pandemic mortalities. ethical permission is not necessary as this study analyzed publically published data and patients were not involved. there is no conflict of interest. communities on the myanmar-china border malera consultative group on drugs. a research agenda for malaria eradication: drugs asymptomatic" malaria: a chronic and debilitating infection that should be treated the silent threat: asymptomatic parasitemia and malaria transmission prevalence of malaria and tb coinfection at a national tuberculosis treatment centre in uganda mycobacterium-induced potentiation of type immune responses and protection against malaria are host specific host defenses in murine malaria: immunological characteristics of a protracted state of immunity to plasmodium yoelii cd t-cell subsets in malaria: th /th revisited host responses to malaria and bacterial co--infections outpatient upper respiratory tract viral infections in children with malaria symptoms in western kenya influenza and malaria coinfection among young children in western kenya suppression of plasmodium falciparum infections during concomitant measles or influenza but not during pertussis covid- data dives: preexisting immunity to sars-cov- is a thing key: cord- -kn v qmz authors: aksu, kurtuluş; naziroğlu, tuğba; Özkan, pınar title: factors determining covid‐ pneumonia severity in a country with routine bcg vaccination date: - - journal: clin exp immunol doi: . /cei. sha: doc_id: cord_uid: kn v qmz background: the impact of countries' bacillus calmette‐guérin (bcg) vaccination policies on the course of coronavirus disease (covid‐ ) outbreak is a curiosity. in this study, the relationship between bcg vaccination status and severity of covid‐ pneumonia and the factors affecting disease severity were investigated. methods: a retrospective cross‐sectional study was conducted between march‐june in patients diagnosed with covid‐ pneumonia, confirmed by severe acute respiratory syndrome coronavirus‐ polymerase chain reaction positivity in a nasopharyngeal sample and pulmonary infiltrates in computed chest tomography, in a state hospital in istanbul, turkey. sociodemographic features, body mass index, smoking status, concomitant diseases, income rates, and bcg vaccination status of subjects were analyzed. results: study population consisted of adults with covid‐ pneumonia (mean age, . years [standard deviation, . years]; ( . %) male). while the rate of cases vaccinated with bcg is lower ( . % vs . %; p=. ), the mean age ( . ± . years vs . ± . years; p <. ), diabetes ( . % vs . %; p=. ) and low income ( . % vs . % p<. ) are higher in patients with severe disease compared to those with mild disease. according to multivariate analysis increasing age (odds ratio [or], . ; % confidence interval [ci], . – . ; p<. ) and low income (or, . ; % ci, . – . ; p =. ) are associated with severe disease in covid‐ pneumonia. conclusion: this study reveals that bcg vaccination is not associated with disease severity in covid‐ pneumonia. age and low income are the main determinants of severe covid‐ pneumonia. the epidemic caused by the severe acute respiratory syndrome coronavirus- (sars-cov- ) in wuhan, china in december was identified in february by world health organization (who) as corona virus disease (covid- ). , sars-cov- infection may appear asymptomatic or may present as mild upper respiratory tract disease, however viral pneumonia may also lead to respiratory failure. while the treatment research against coronavirus pandemic continues all over the world, the group of patients with high probability of severe disease is tried to be determined. covid- mortality and morbidity rates differ disproportionately between countries to the level of measures and restrictions taken by them. it is possible that the sociocultural or lifestyle differences of citizens and the differences in the health policies of countries make surprising differences in covid- epidemiology in different countries. accordingly, factors underlying the severe epidemic in some countries are tried to be clarified. it has recently been suggested that countries' bacillus calmette-guérin (bcg) vaccination policies can affect the epidemiology of this hypothesis is mainly based on the fact that countries such as italy, who do not have a bcg-vaccination policy, are severely affected by the covid- outbreak despite implementing high-level of social isolation measures, whereas countries with immunization policy, such as japan, were slightly affected by the outbreak, even though they did not take high level of measures. in the present study, the severity of covid- pneumonia in bcg vaccinated and unvaccinated people is compared and factors associated with the severity of the disease is investigated in a country that has been running national bcg vaccination program for nearly years. this article is protected by copyright. all rights reserved this retrospective cross-sectional study was conducted in subjects who were diagnosed with covid- pneumonia based on positive sars-cov- polymerase chain reaction result in combined nasal-throat swab sample and pulmonary infiltrates in computed chest tomography in a state hospital in istanbul, turkey between march and june, . study population was grouped according to severity of covid- pneumonia according to turkish ministry of health covid- guide; ) subjects with severe clinical condition with tachypnea (≥ / minute), oxygen saturation below % breathing room air together with bilateral diffuse pulmonary infiltrates and hospitalized, ) subjects with mild clinical condition followed up on an outpatient basis. sociodemographic characteristics, body-mass index, smoking history, comorbid diseases, and symptoms were recorded from the patients' files. subjects earning minimum wage (monthly income approximately less than u.s. dollar) were defined as low income. bcg vaccination history was determined based on subjects' self-declaration together with observation of vaccine scar by consultant pulmonologist. main outcome of the study is comparison of bcg-vaccination status between severe and mild subjects with covid- pneumonia. secondly, sociodemographic and clinical factors that are determinant for severe covid- pneumonia are evaluated. continuous variables were expressed as mean ± standard deviation (sd) and categorical variables were expressed as numbers (percentages). for comparisons independent student's t-test and χ test were used for continuous and categorical variables, respectively. binomial logistic regression was performed to assess association between disease severity and study parameters. all statistical tests were two-sided and a p value <. was considered statistically significant. the analyses were performed using statistical package for the social sciences® version . the study was approved by kartal dr. lütfi kırdar education and research hospital ethics comittee ( may, - / / / ). this article is protected by copyright. all rights reserved pneumonia in a state hospital in istanbul, turkey. among study population ( . %) subjects had mild pneumonia whereas ( . %) had severe pneumonia. the number of patients vaccinated with bcg was ( . %). sociodemographic, smoke-related, and comorbidities of subjects are summarized in table . comparison of characteristics of bcg-vaccinated andunvaccinated covid- pneumonia patients revealed that, mean age and low income rate were significantly higher in bcg-unvaccinated subjects compared to bcg-vaccinated subjects. severe disease rate was significantly higher in bcg-unvaccinated subjects compared to bcg-vaccinated subjects ( . % vs . %; p= . ) ( table ). mean age, rate of diabetes, low-income and bcgvaccination status were the parameters differed significantly between mild and severe covid- pneumonia patients ( table ). the effects of age, gender, income, bcg-vaccination status, smoking, diabetes and hypertension on the likelihood of severe covid- pneumonia were examined by binary logistic regression analysis. according to the hosmer and lemeshow test, the intended model was found significant by including independent variables in the initial model in which the constant term was included (x = . , p = . ). as a result of the analysis, . % of patients with mild covid- pneumonia and . % of patients with severe covid- pneumonia were accurately estimated. in total, the predictive power of the model was found to be . %. when independent variables are included in the analysis, nagelkerke r value explains . % of the change in disease severity. in the model where the dependent variable is covid- pneumonia severity odds ratio values and significance levels are given in table . the analysis revealed that increased age and low-income independently predict severe disease among covid- pneumonia patients. on the contrary, bcg-vaccination status is not associated with severity of covid- pneumonia. in this study conducted in patients with covid- pneumonia characteristics of subjects with severe and mild disease were investigated. according to the study results, bcg vaccination status is not related to clinical condition in covid- pneumonia, whereas, increasing age and lowincome are the factors associated with severe covid- pneumonia. this article is protected by copyright. all rights reserved bcg vaccine, a live attenuated bacterial vaccine derived from mycobacterium bovis, is recommended in countries with a high incidence of tuberculosis. beyond immunisation against tuberculosis, bcg vaccine provides improved immune response against some viral pathogens including respiratory syncytial virus, influenza a virus and herpes simplex virus type . these nonspecific immune effects, known as trained immunity, occur via epigenetic reprogramming of monocytes and production of il- β, tnf and il- during subsequent viral infection. observational studies on clinical reflection of the immunopathogenesis of bcg vaccine report that bcg vaccination and presence of a bcg scar among infants reduce the risk of respiratory tract infections. , countries' vaccination policies gained importance during the covid- pandemic. analyses of the relationship between countries' bcg vaccination databases and their covid- statistics suggest that bcg vaccination significantly reduces covid- mortality rates, and that the earlier a country establishes a bcg vaccination policy, the lower covid- deaths per million inhabitants. national bcg vaccination policies are also thought to be related to flattened covid- growth curves. , another report which analyzed data of countries and territories have shown that bcg-vaccination policy was associated with lower covid- morbidity and mortality rates, but not with case-fatality rate. high median age, low per capita gross domestic production adjusted to purchasing power and high per capita health expenditure were found to be related to higher morbidity and mortality rates in covid- . in turkey, national bcgimmunisation programme has been implemented since for control of tuberculosis. bcg vaccination rates reached . % in . , the study population consisted of bcg-vaccinated and -unvaccinated covid- pneumonia cases in order to compare the severity of the disease in the two groups. bcg-vaccinated andunvaccinated groups were similar in terms of body-mass index, gender distribution, smoking status and presence of diabetes and hypertension. however they were significantly different in terms of age and income; such as, bcg-unvaccinated group was significantly older compared to bcg-vaccinated group and nearly all subjects in bcg-unvaccinated group were low-income. a possible explanation for low income of people without bcg vaccination is people migrating from rural to urban areas in search of employment and earn living. as the major outcome of the study, in severe covid- pneumonia patients, the rate of cases not vaccinated with bcg was significantly higher than in patients with mild covid- pneumonia. however, the most this article is protected by copyright. all rights reserved important confounding factor in the study was the uneven distribution of income between the unvaccinated group and the vaccinated group. accordingly, logistic analysis revealed that increasing age and low income level were predictive of severe disease, whereas bcg vaccination status is not related to the severity of covid- pneumonia. this is the first study to evaluate severity of clinical condition with bcg-vaccination status in population characteristics of countries such as population density, median age, and urban population and mainly sars-cov- test rates are major confounders that may lead to misjudgement of bcg vaccination policy is beneficial. according to a report published very recently, there was no statistically significant difference in the sars-cov- positive test results between the bcg-vaccinated group and the non-vaccinated group. also in brazil, which has been carrying out the bcg vaccination program since , the morbidity and mortality rates of covid- disease have reached today's distressing levels, also questions any protective role of bcg vaccination in the covid- outbreak. second most important finding of the present study is that increasing age and low-income are the predictors of severe disease in covid- pneumonia. age is reported as main risk factor for disease severity and mortality in covid- since the beginning of the outbreak. [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] the relationship between low-income and serious covid- emerged mainly after news that lowincome minority residents were most affected, from the usa, especially new york city. according to various reports from different states non-hispanic black patients were disproportionately hospitalized with diagnosis of covid- . however, the absence of any difference in intensive care unit admission and mortality rates in black patients suggests that the distinction in sars-cov- infection rates is due to socioeconomic inequalities rather than racial and ethnic differences. , in line with previous reports on the importance of socioeconomic inequalities in covid- , in the present study, low income was an independent predictor of severe disease. most prevalent comorbidities reported in serious or critically ill subjects with covid- are diabetes mellitus, chronic lung disease and cardiovascular disease. [ ] [ ] [ ] , the percentage of this article is protected by copyright. all rights reserved covid- cases with at least one underlying health condition was higher among those hospitalized compared to non-hospitalized. yet, data from countries may vary for different reasons, like health policies implemented in the countries, proportion of elderly population, prevalance of concomitant diseases and whether or not comorbidities are under control. prompt measures taken by turkish government early in the epidemic may be the reason why comorbid disease rates were not an independent predictor of severe covid- pneumonia in the present study. because immediately after the first covid- case was detected in turkey, people with chronic illness were considered on leave in public and private sector. the major strength of the present study is that severity of covid- pneumonia is assessed in bcg vaccinated and unvaccinated inhabitants of the same country, which implements national bcg vaccination policy. another strength of the study is that all patients are evaluated in a single center, providing homogeneity in clinical evaluation of patients. main limitation of the study is the relatively low number of subjects. however, since bcg vaccine is administered regularly in the country, the number of individuals who have not been vaccinated is limited in the country. secondly, data on clinical follow-up of patients, such as clinical recovery time, admission to the intensive care unit, and mortality rate were not evaluated because they were outside the scope of the study. data are expressed as n (%), unless otherwise stated. sd standard deviation. this article is protected by copyright. all rights reserved data are expressed as n (%), unless otherwise stated. bcg bacillus calmette-guerinn. †statistical analysis could not be performed due to a small number of subjects. the novel coronavirus originating in wuhan, china: challenges for global health governance short term outcome and risk factors for adverse clinical outcomes in adults with severe acute respiratory syndrome (sars) epidemiological and clinical characteristics of cases of novel coronavirus pneumonia in wuhan, china: a descriptive study correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study summary of the who position paper on bcg vaccines: who position paper -february bcg-induced trained immunity: can it offer protection against covid- ? acute lower respiratory tract infections and respiratory syncytial virus in infants in guinea-bissau: a beneficial effect of bcg vaccination for girls community based case-control study accepted article this article is protected by copyright. all rights reserved prevention of m. tuberculosis infection with h :ic vaccine or bcg revaccination mandated bacillus calmetteguérin (bcg) vaccination predicts flattened curves for the spread of epidemiological determinants of acute respiratory syndrome coronavirus- disease pandemic and the role of the bacille vaccine in reducing morbidity and mortality the influence of bcg immunisation on tuberculin reactivity and booster effect in adults in a country with a high prevalence of tuberculosis exercising caution in correlating covid- incidence and mortality rates with bcg vaccination policies due to variable rates of sars cov- testing sars-cov- rates in bcg-vaccinated and unvaccinated young adults characteristics of and important lessons from the coronavirus disease (covid- ) outbreak in china chinese center for disease control and prevention preliminary estimates of the prevalence of selected underlying health conditions among patients with coronavirus disease -united states accepted article coronavirus disease : retrospective study case-fatality rate and characteristics of patients dying in relation to covid- in italy clinical characteristics of hospitalized patients with novel coronavirus-infected pneumonia in wuhan, china epidemiological and clinical characteristics of cases of novel coronavirus pneumonia in wuhan, china: a descriptive study estimates of the severity of coronavirus disease : a model-based analysis severe outcomes among patients with coronavirus disease (covid- ) -united states characteristics and clinical outcomes of adult patients hospitalized with covid- -georgia hospitalization rates and characteristics of patients hospitalized with laboratory-confirmed coronavirus disease -covid-net, states accepted article acknowledgements: ka and tn had full access to all of the data in the study and takes key: cord- -liwvhuzj authors: brooks, nathan a.; narayan, vikram; hegarty, paul k.; zafirakis, helen; han, xiang‐yang; kamat, ashish m. title: the role of the urologist, bcg vaccine administration, and sars‐cov‐ : an overview date: - - journal: bjui compass doi: . /bco . sha: doc_id: cord_uid: liwvhuzj objectives: to summarize the available literature regarding bacillus calmette‐guerin (bcg) administration, severe acute respiratory syndrome conoravirus‐ (sars‐cov‐ ), and the resulting clinical condition coronavirus disease (covid‐ ) in light of recent epidemiologic work suggesting decreased infection severity in bcg immunized populations while highlighting the potential role of the urologist in clinical trials and ongoing research efforts. materials and methods: we reviewed the available literature regarding covid‐ and bcg vaccination. specifically, the epidemiologic evidence for decreased covid‐ morbidity in countries with bcg vaccination programs, current clinical trials for bcg vaccination to protect against covid‐ , potential mechanisms and rationale for this protection, and the role of the urologist and urology clinic in providing support and/or leading ongoing efforts. results: epidemiologic evidence suggests that the crude case fatality rates are lower for countries with bcg vaccination compared to those without such programs. four prospective, randomized clinical trials for bcg vaccination were identified including nct (badas), nct (brace), nct (bcg‐corona), and nct . bcg administration may contribute to innate and adaptive immune priming with several opportunities for translational research. conclusions: the urologist’s expertise with bcg and the infrastructure of urologic clinics may afford several opportunities for collaboration and leadership to evaluate and understand the potential role of bcg in the current covid‐ pandemic. likely, residual infection. not only has the morbidity of this disease stressed patients, families, and underprepared healthcare systems, but it also has the potential to enact long-term, fundamental change in daily life for billions of people. the observed morbidity of covid- will be further magnified in vulnerable populations: namely the elderly, patients with cancer undergoing treatment, patients of low socioeconomic status with poor access to care and chronic conditions, as well as in countries in which health system preparedness is lacking and where the economic impacts might be devasting. [ ] [ ] [ ] [ ] successful management of this pandemic requires: containment, therapies to reduce clinical morbidity and mortality, and ultimately, vaccination to prevent infection. currently, multiple therapeutic agents are being evaluated to lessen the clinical morbidity of covid- with varying degrees of success. these include anti-malarial medications, antiviral medications, and convalescent serum harvested from patients recovered from the infection. the rational development of a vaccine is of paramount importance. new vaccine development, however, will take time, trial, and error and must be developed and distributed on a global scale. [ ] [ ] [ ] the bacillus calmette-guerin (bcg) vaccine has been administered for the prevention of tuberculosis (tb) in many countries worldwide to almost four billion persons since its first human use was described in . the bcg vaccine provides protection from tb infection in - % of recipients and has demonstrated relative safety with a rate of serious adverse events approaching zero. in both animal and human studies, bcg vaccination provides a non-specific benefit to the immune system, relative protection against, and reduced mortality from infections by other microbes (bacteria and viruses) which may occur by epigenetic reprogramming and induction of trained immunity. , bacillus calmette-guerin is a well-known medication to urologists as it is administered intravesically as therapy for many patients with non-muscle invasive bladder cancer (nmibc). emerging evidence suggests that bcg vaccination might reduce the rate of infection and mitigate the rate of mortality in countries with bcg vaccination programs. herein, we review the current literature regarding bcg vaccination and covid- , currently enrolling clinical trials, and the potential to leverage the expertise of the urologist and the urology clinic in supporting these trials. clinical trials have shown that bcg immunotherapy prevents cancer recurrence, progression, reduces the need for cystectomy, and prolongs survival for patients with nmibc. for intravesical therapy, the schedule of bcg treatment comprises an induction course ( weekly treatments) and a maintenance courses of three instillations spaced one week apart, at and months after induction and then every months thereafter, for a total of seven sets of maintenance. thus, a complete treatment of induction and maintenance adds up to instillations over years. since bcg is a live, attenuated mycobacterium, it must be handled appropriately. urologic clinics, pharmacists, and nurses are familiar with the safe preparation, handling, and disposal of bcg. over % of treated patients have no significant toxicity, however, serious and even fatal toxicity can occur if bcg is not administered appropriately. because of the sheer number of installations per patients, urologists are experienced in caring for patients with complications of bcg instillation and, should such complications occur with bcg vaccination, may be uniquely positioned to manage such complications. the swog prime trial evaluating priming patients with subcutaneous bcg weeks prior to intravesical bcg is ongoing. this trial was somewhat prescient since, while urologists do not routinely perform bcg vaccination, trial sites will have additional expertise with vaccine administration. there are reasonable concerns about allocation of bcg for covid- given the shortages of both the intravesical and vaccination formulations worldwide. , when kamat and colleagues were designing the badas study in early march, they reached out to the bladder cancer patient community and bladder cancer advocacy network (bcan), for input and support for diversion of some of the drug (bcg) to the study. as always, the patients and bcan were altruistic and supportive. additionally, some consider bcg as a class i-ii pathogen and it is recommended that it be reconstituted in a certified biological cabinet and used within hours per the manufacturer's label. recently, we presented evidence for tice® bcg (merck, kenilworth, nj) that bcg organisms remain viable for at least hours after reconstitution when stored on ice and in the absence of light. additional support for a longer duration of viability was demonstrated for at least hours, and guidance from the world health organization (who) on administration of bcg vaccination for tb suggests that the vaccine may be administered up to hours after reconstitution. such considerations are important as one vial of bcg is used for one patient with bladder cancer but can be used to inoculate individuals for vaccination (which is / th the dose, based on cfu). in order to deliver doses from one vial within hours, . vaccines would need to be administered every minute. for clinical trials, extending bcg reconstitution time may be important to ensure that vaccine is not wasted in times of shortage for either bladder cancer patients or tb vaccination. members of our group recently also described differences in the observed crude case fatality rates (cfr) of covid- between countries with active bcg vaccination programs for tuberculosis when compared to those that do not routinely vaccinate. starting from data extrapolated from march , , the daily incidence of covid- was . /million in countries with a bcg vaccination program compared to nearly . /million in countries without such a program (table ). there was considerable observational overlap between the countries without an active bcg vaccination program and those that are most affected by covid- in europe, with cfr estimates around . % in countries with a bcg vaccination program compared to . % in those without. these analyses may in part be explained by numerous confounding factors, including heterogeneity, likely lower testing rates within these countries, the lack of a confirmation of true bcg vaccination status among those affected, and an underestimation of asymptomatic cases, but highlight the need for further study. the world health organization (who) acknowledges the potential bias of the aforementioned ecological study and recommends studying the potential impact of bcg on covid- in clinical trials, such as the badas trial (www.bcgba das.org), rather than simply recommending bcg vaccination to all, as is being done in some countries. given bcg supply shortages for both intravesical and vaccine formulations, the who additionally cautions that overuse of the bcg vaccine for covid- prevention without additional, prospective data may prove harmful. evidence supports the immunomodulatory potential of bcg administration. neonatal bcg vaccination has been associated with a % reduction in neonatal mortality in developing nations, with vaccinated infants having fewer cases of respiratory infections and sepsis. arts and colleagues were able to demonstrate additional heterologous benefits of bcg vaccination by performing a randomized controlled study in which healthy dutch men received either placebo or bcg (denmark strain), following which all participants received yellow fever vaccination after days. participants who had received bcg vaccination were found to have a reduction in yellow fever viremia. furthermore, in this study, when the participants were bcg vaccinated and then later challenged with yellow fever virus, they had decreased "cytokine storm," -ifna, ifng, il ra, il , and tnf all decreased. this would be expected because it is well known that bcg stimulates a th response; whereas, yellow fever (and most likely covid- ) stimulates at th response. tipping the response one way or the other usually mitigates the other response, so it is not surprising that a th stimulant reduces a th response. this is particularly of in- vaccine strain compared to placebo-treated participants, with increased production of ifn-y and il- . the reasons for this variability in response mechanisms governing these findings are not known. (nct ). the ultimate goal of all these studies is to inform the decision to use bcg as a vaccine for all individuals at high risk of exposure, for example, healthcare workers, law enforcement, food delivery and supply workers, the elderly, nursing home residents etc. indeed, this is being proposed in many parts of the world already; however, we believe that sound studies are needed before such blanket recommendations can be made. virus-specific memory t cells are crucial in broad and long-term protection against sars-cov infection and this has been clearly documented in several animal models. structural antigens of sars-cov act as a major antigen for both humoral and cellular immunity. these studies, thus, suggest a potential mechanistic rationale for protective effect of bcg against the cytokine storm induced by covid- infections, which will be studied in the ongoing trials. bacillus calmette-guerin is currently administered by several routes including: intravesically, sub-dermally, directly injected into certain tumors, intra-nasally, pharyngeally or as an inhalation spray directly into the lungs. there presents an opportunity to re-purpose intravesical bcg for use as a potential protective agent against sars-cov- . in addition to consideration for intradermal injection, inhalation or nebulization may be considered as, similarly to the bladder, this may allow bcg to act directly the upper and lower respiratory system affected by sars-cov- . a potential inhalational form of bcg has already been developed and bcg may induce pulmonary mucosal immune responses at the point of entry of the pathogen. the safety of the aerosolized bcg vaccine is well established without reported side effects. many opportunities exist for the urologist and urology infrastructure to contribute to translational and basic scientific correlates to further the understanding of bcg vaccination in preventing covid- . several animal models focusing on sars-cov- have previously been described. viral replication has been reported in mice, hamsters, cats, civets, and primates, however, recreation of human disease in these models without viral passage to produce animaladapted variants has proven difficult. for sars-cov- , research efforts have identified that viral replication occurs in the respiratory tract of ferrets and cats when directly inoculated with virus. infection and rapid transmission of sars-cov- has been demonstrated in ferrets. utilizing bcg vaccination in emerging animal models may help to better understand the rate of generation of immunity, the mechanism of possible immunity and/or disease severity reduction, and the optimal dose of bcg to administer on a timescale allowing for more rapid understanding and deployment with the caveat that animals models do not fully recapitulate human disease pathogenesis. for translational efforts, the urologist and urology facilities may play a pivotal role in bcg reconstitution and administration including opportunities to play a pivotal role on, or in leading the research team. the administration of the bcg vaccine, both for bladder cancer and for the prevention of tb, is safe and has been utilized in over four billion people. there is an association between bcg vaccination and decreased childhood lung-related mortality as well as improved vaccination efficacy for yellow fever and some influenza strains. while the exact mechanism of action is non-specific, im- this research project was supported by the wayne b. duddlesten professorship and the maria floyd research award to dr. kamat. an interactive web-based dashboard to track covid- in real time how will country-based mitigation measures influence the course of the covid- epidemic? positive rt-pcr test results in discharged covid- patients. reinfection or residual? the psychological distress and coping styles in the early stages of the coronavirus disease (covid- ) epidemic in the general mainland chinese population: a web-based survey preparedness and vulnerability of african countries against importations of covid- : a modelling study bearing the brunt of covid- : older people in low and middle income countries the global macroeconomic impacts of covid- : seven scenarios cancer patients in sars-cov- infection: a nationwide analysis in china research and development on therapeutic agents and vaccines for covid- and related human coronavirus diseases a systematic review on the efficacy and safety of chloroquine for the treatment of covid- a trial of lopinavir-ritonavir in adults hospitalized with severe covid- the convalescent sera option for containing covid- news feature: avoiding pitfalls in the pursuit of a covid- vaccine developing covid- vaccines at pandemic speed immune responses in covid- and potential vaccines: lessons learned from sars and mers epidemic ensuring global access to covid- vaccines development of the mycobacterium bovis bcg vaccine: review of the historical and biochemical evidence for a genealogical tree effect of bcg vaccination against mycobacterium tuberculosis infection in children: systematic review and meta-analysis bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity covid- and bacillus calmette-guérin: what is the link? intravesical bacillus calmette-guerin reduces the risk of progression in patients with superficial bladder cancer: a meta-analysis of the published results of randomized clinical trials optimal bcg treatment of superficial bladder cancer as defined by american trials background and update for s "a phase iii randomized trial to evaluate the influence of bcg strain differences and t cell priming with intradermal bcg before intravesical therapy for bcg-naïve high-grade non-muscle-invasive bladder cancer covid- and bacillus calmette-guérin: what is the link? manufacturing and the market: rationalizing the shortage of bacillus calmette-guérin bcg shortage: reassessing the clinical viability of bacillus calmette-guerin (bcg) after reconstitution. american society of stability of reconstituted freeze-dried bacille calmette-guérin used for intravesical immunotherapy for bladder cancer world health organization. temperature sensitivity of vaccines the potential impact of bcg vaccine supply shortages on global paediatric tuberculosis mortality bacille calmette-guérin (bcg) vaccination and covid- : scientific brief randomized trial of bcg vaccination at birth to low-birth-weght cildren: beneficial nnspecific efects in the nonatal priod? bcg vaccination enhances the immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized, placebo-controlled pilot study virusspecific memory cd t cells provide substantial protection from lethal severe acute respiratory syndrome coronavirus infection screening and identification of t helper and linear immunodominant antibody-binding epitopes in spike domain and membrane protein of feline infectious peritonitis virus recombinant receptor-binding domain of sars-cov spike protein expressed in mammalian, insect and e. coli cells elicits potent neutralizing antibody and protective immunity multiple organ infection and the pathogenesis of sars memory t cell responses targeting the sars coronavirus persist up to years post-infection bcg immunotherapy of bladder cancer: years on bacillus calmette-guerin (bcg) immunotherapy for bladder cancer: current understanding and perspectives on engineered bcg vaccine evolution and clinical significance of the t cell proliferative and cytokine response directed against the fibronectin binding antigen complex of bacillus calmette-guerin during intravesical treatment of superficial bladder cancer the mechanism of action of bcg therapy for bladder cancer-a current perspective bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity mucosal delivery of tuberculosis vaccines: a review of current approaches and challenges aerogenic bcg vaccination against tuberculosis in animal and human subjects a decade after sars: strategies for controlling emerging coronaviruses susceptibility of ferrets, cats, dogs, and other domesticated animals to sarscoronavirus infection and rapid transmission of sars-cov- in ferrets covid- vaccination clinical trials should consider multiple doses of bcg vaccines for covid- : perspectives, prospects, and challenges based on candidate sars, mers, and animal coronavirus vaccines key: cord- -xb alubj authors: samaddar, arghadip; gadepalli, ravisekhar; nag, vijaya lakshmi; misra, sanjeev title: the enigma of low covid- fatality rate in india date: - - journal: front genet doi: . /fgene. . sha: doc_id: cord_uid: xb alubj coronavirus disease (covid- ), an acute onset pneumonia caused by a novel betacoronavirus severe acute respiratory syndrome coronavirus (sars-cov- ) has rapidly evolved into a pandemic. though its origin has been linked to the wuhan city of china’s hubei province in december , recent reports claim that the original animal-to-human transmission of the virus probably happened sometime between september and october in guangdong province, rather than hubei. as of july , , india has reported a case positivity rate of . % and a fatality rate of . %, which are among the lowest in the world. also, the severity of the disease is much less among indians as evidenced by the low rate of icu admission ( . %) and the need for mechanical ventilation ( . %). as per the world health organization (who) situation report on july , , india has one of the lowest deaths per , population ( . deaths against a global average of . ). several factors related to the pathogen, host and environment might have some role in reducing the susceptibility of indians to covid- . these include some ongoing mutations that can alter the virulence of the circulating sars-cov- strains, host factors like innate immunity, genetic diversity in immune responses, epigenetic factors, genetic polymorphisms of ace receptors, micro rnas and universal bcg vaccination, and environmental factors like high temperature and humidity which may alter the viability and transmissibility of the strain. this perspective -highlights the potential factors that might be responsible for the observed low covid- fatality rate in indian population. it puts forward several hypotheses which can be a ground for future studies determining individual and population susceptibility to covid- and thus, may offer a new dimension to our current understanding of the disease. in december , an outbreak of fatal pneumonia, the coronavirus disease , caused by a novel betacoronavirus, severe acute respiratory syndrome coronavirus (sars-cov- ) was reported from the wuhan city of china's hubei province. the outbreak was declared as a public health emergency of international concern by the world health organization (who) on january , and a global pandemic on march , . , though its origin has been linked to hubei province, recent phylogenetic analysis claims that the original animal-tohuman transmission of the virus probably happened some to months before december in guangdong province, rather than hubei (forster et al., ) . as of july , , the disease has affected more than . million people across countries and territories with , deaths. a difference in the case fatality rates (cfr) was observed across countries, possibly due to demographic variations, differences in the virus strains in circulation and the nature of containment measures implemented. the fatality rates in the united states, united kingdom, italy, france, and spain have surpassed that of china by manifolds. india, the second most populous country in the world, with a population of . billion people, had documented the first case of covid- on january , , the same day as italy (kaushik et al., ) . as of july , , india has reported a total of , cases and , deaths which reflects a milder trajectory with lower case positivity ( . %) and fatality ( . %) rates compared to the global figures. the traditional model for any infectious disease consists of a triad of the causative agent, the host, and an environment in which the agent and host are brought together, causing the disease to occur in the host. little is known regarding the origin of sars-cov- . there have been speculations that the virus got transmitted to humans from bats or pangolins, but conclusive evidence regarding the same is lacking. genomic sequence data indicate that sars-cov- has . % sequence homology with a bat coronavirus ratg (zheng, ) , and % homology with a pangolin coronavirus (zhang et al., ) . besides, it also shares . % identity with sars-cov (zheng, ) . a recent study suggests that pangolins are the natural reservoirs of sars-cov- -like coronavirus, with the pangolin-cov having a more closely related s protein to that of sars-cov- (zhang et al., ) . it is unclear how the animal-to-human transmission occurred and whether the virus acquired greater pathogenic potential and transmissibility after having entered the human host. more studies need to be focussed in this aspect for better understanding of the pathogenicity. the pandemic has made a considerable impact on health-care infrastructure worldwide, with medical facilities struggling to cope-up with the increased demands for life-saving medicines, ventilators and personal protective equipments. world health organization (who) emergency committee. statement on the second meeting of the international health regulations ( ) emergency committee regarding the outbreak of novel coronavirus ( -ncov). geneva: who; january . available from: https://www.who.int/news-room/detail/ - - -statement-on-the-second-meeting-of-the-international-healthregulations-( )-emergency-committee-regarding-the-outbreak-of-novelcoronavirus-( -ncov) (accessed may , ). world health organization (who) emergency committee. who director-general's opening remarks at the media briefing on covid- - march . geneva: who; march . available from: https: //www.who.int/dg/speeches/detail/who-director-general-s-opening-remarks-atthe-media-briefing-on-covid- --- -march- (accessed may , ). world health organization (who). coronavirus disease (covid- ): situation report, . geneva: who; july . available from: https: //www.who.int/emergencies/diseases/novel-coronavirus- /situation-reports/ (accessed july , ). despite the catastrophic consequences of this pandemic on several affluent nations, its impact on indian population seems to be much lower both in terms of severity as well as cfr. of the total , active cases of covid- till july , in india, . % required icu admission, . % required ventilator support and . % required supplemental oxygen, all of which point toward a less severe disease among indians. so what is that "x" factor apparently safeguarding the indian population from the wrath of this pandemic? this perspective provides an insight into the potential factors that might be responsible for the observed low covid- severity and fatality rate in indian population and illuminates the areas of future research which may help in understanding the disease process more vividly. how do the indian sars-cov- strains differ from the strains elsewhere? earlier, six genera of coronaviruses were known to cause human disease, of which four (α-cov- e and nl , and β-cov-hku and oc ) are responsible for mild respiratory infections, mostly in pediatric age group while two (sars-cov and middle east respiratory syndrome coronavirus [mers cov]) are associated with severe outbreaks . sars-cov- is a positive sense single-stranded rna virus harboring two major genes, open reading frame a (orf a) and orf b, which together encode non-structural proteins (nsp -nsp ). these nsps are organized to form a replication-transcription complex (rtc) that is involved in transcription and replication. nsp and nsp encode for papain-like protease (plp) and chymotrypsin-like protease ( cl), respectively, which help in peptide cleaving and host innate immune antagonism. nsp and nsp encode for rna-dependent rna polymerase (rdrp) and rna helicase, respectively. the structural genes encode four structural proteins: spike (s), envelope (e), membrane (m), and nucleocapsid (n), and several accessory proteins (astuti and ysrafil, ) . molecular characterization of sars-cov- strains based on whole-genome sequencing revealed clustering of the prototype wuhan strain belonging to the o clade (mn . /sars-cov- /human/chn/wuhan-hu- / ), indicating that the virus might have originated in china and eventually spread worldwide fan et al., ) . the indian sars-cov- strains, unlike the strains elsewhere, are more closely related to bat-cov ratg ( % homology) than pangolin cov ( . % homology). however, the receptor binding domain (rbd) of s protein of indian sars-cov- strains are more closely related to pangolin-cov (zhang et al., ) . a recent study from national institute of cholera and enteric diseases, west bengal, india analyzed the genome type clusters of indian sars-cov- isolates and observed a monophyletic clade of the virus co-existing with the prototype wuhan strain (clade o) and clustering along with the indian isolates, suggesting introduction of the virus in india from several countries. | phylogenetics clades of sars-cov- with their order of evolution and the defining mutation(s) (biswas and majumder, ) . defining mutation(s) phylogenetic analysis of sars-cov- genomes demonstrated two major lineages, l (leucine) and s (serine), based on single nucleotide polymorphisms (snps) at positions , (orf ab: t c) and , (orf : c t, s l). the l lineage carries a significantly higher number of derived mutations than s lineage, indicating that these two lineages might have different rates of transmission and replication. also, the l lineage has been described to be more aggressive and contagious than s lineage. in india, the l lineage is more prevalent ( . %) than s lineage ( . %) (banerjee et al., ) , with reports claiming higher fatality rates at places where the l type is dominant as in the indian state of gujarat (cfr = . %, the highest in india). , these observations indicate that strain difference has some impact on virulence and pathogenesis. scientists from the national institute of biomedical genomics, india, performed phylodynamic analyses and examined the temporal and spatial evolution of the virus in sar-cov- sequences deposited in global initiative on sharing all influenza data (gisaid) from countries and observed that at least distinct clades (a a, a , a a, a , a , a , b, b , b , and b ) of the virus have originated from the ancestral clade o ( table ) . though initially, the ancestral type was most frequent in all countries due to return of travelers from china, it has gradually been replaced by other types with clade a a (having non-synonymous d g mutation in the s /s furin cleavage site of s protein) being the most dominant type in india and also, globally (biswas and majumder, ) . phylogenetic analysis has revealed significant regional variation in frequencies of different clades across countries. for example, in the united states, clade b is predominant in washington d.c. and west coast, while in new york and east coast, clade a a is the modal type (biswas and majumder, ; brufsky, ). an analysis of viral sequences submitted to gisaid from india revealed the existence of four clades: ancestral clade o ( . %) and derived clades a a ( . %), a ( . %), and b ( . %). all individuals available from: https://www.indiatoday.in/india/story/wuhan-s-l-strainmay-be-behind-gujarat-s-high-death-rate-experts- - - - (accessed may , ). available from: https://www.mohfw.gov.in/ (accessed july , ). infected with a had travel history to iran, while those with a a had no history of international travel. thus, a temporal decline in the diversity of sars-cov- clades has been observed globally, which may affect transmission and pathogenicity. a mutational analysis showed co-circulation of two groups (major and minor) of the mutated virus in india. the "major group" ( . %) represents a a clade that harbors four co-existing snps: c>t ( utr), c>t (f f, nsp ), c>t (p l, rdrp/nsp ) and a>g (d g, s glycoprotein). the "minor group" ( . %) consists of strains showing five distinct mutations: c>t (a v, rdrp/nsp ), c>t (y y, s), c>t (p l, n), c>a (t k, nsp ) and g>t (l f, nsp ). all these mutations, except g>t (l f, nsp ) are unique to indian sars-cov- strains (guan et al., ; mercatelli and giorgi, ; wang et al., ) . mutations a>g (q r), g>t (g v) and c>t (d d) in s gene and missense mutations q r and g v in s protein have been observed exclusively in indian strains, which might alter the protein function and thus, affect virulence and pathogenicity (banerjee et al., ) . researchers from translational bioinformatics group at international center for genetic engineering and biotechnology (icgeb) in collaboration with the department of biochemistry, jamia hamdard, new delhi, india, performed an integrated mutational analysis of sars-cov- genomes from different geographical locations, including india, italy, united states, nepal and wuhan, and observed a novel mutation in s protein (a v, c>t) of the indian strain, which was absent in other strains (sardar et al., ) . a triple site mutation - ggg>aac has been observed at / region of the n gene that might alter the phosphorylation of serine residue of n protein and interfere with its function, thus reducing the pathogenicity of the strain (ayub, ) . besides, some indian strains have displayed unique mutations in the nsp gene at positions c>a (s r), c>t (p l) and a>g (k k) (banerjee et al., ) . the rna-dependent rna polymerase (rdrp)/nsp protein is an integral component of the viral replication machinery and any mutation in this protein might interfere with viral replication and cause accumulation of novel mutations. in indian sars-cov- strains, two mutations: c>t (p l) and c>t (a v) in rdrp gene have been documented which might have altered the secondary structure of rdrp and resulted in simultaneous emergence of major and minor groups of the virus with characteristic co-evolving mutations (banerjee et al., ) . a study from university of bologna, italy, analyzed , sars-cov- genomic sequences in comparison with the reference wuhan genome and revealed a low mutation rate of the virus, with an average of . mutations per sample with respect to the reference strain. according to the study, snps are the most common mutational events observed worldwide as well as in asia. the most common mutation observed in asia is g t, causing a snp at position of thensp . several other mutations like orf :l s (china) and orf a:g v (hong kong) have also been documented, with a regional variation in the type and nature of such events (mercatelli and giorgi, ) . a comparative genomic analysis of sars-cov- genomes from countries revealed the presence of singleton mutations in countries with united states accounting for the highest number of mutations ( % of total mutations). the mutations g v (in orf a), l s (in orf ) and s f (in orf ab) exist in all continents except africa. also, the genome variability is most prominent in america, australia and new zealand (laamarti et al., ) . figure depicts the geographic and genomic distribution of sars-cov- mutations. such genomic diversity may give rise to new clades with variations in transcription and replication rates, which in turn may affect virulence and transmissibility. studies combining genomic details with demographic and epidemiological data are essential to identify any ongoing mutation and its impact on virulence and severity of the disease across populations. a comparative analysis of the immune phenotypes in indian and american newborns revealed that indian infants had a higher proportion of dendritic cells, monocytes, natural killer (nk) cells, memory cd + t cells, and naïve b cells, compared to american infants (rathore et al., ) . such variations in immune systems can be attributed to heritable and nonheritable influences. heritable factors have germline inheritance and have a minor influence on inter-individual and population variation in immune responses (brodin et al., ; brodin and davis, ) . a population-based cohort study (immvar project) involving subjects of african-american, east asian and european ancestry analyzed the variability in functional responses of t-cells and dendritic cells by gene profiling and concluded that heritable factors accounted for only % of the overall variation in gene expression (de jager et al., ) . non-heritable factors include environmental influences, such as infections and vaccines, stochastic epigenetic changes arising from imperfect replication machinery, and symbiotic and pathogenic microbes. non-heritable influences are the major factors determining immune variation (brodin et al., ; brodin and davis, ) . brodin et al. ( ) analyzed various immunological parameters, such as cell population frequencies, cytokine responses, and serum proteins in healthy twins and found that majority of these determinants are dominated by non-heritable influences, indicating that the human immune system is very much shaped by the environment and the variety of microbes that an individual encounters in their lifetime, besides these factors, india has an overwhelming burden of tuberculosis, malaria and hiv, much higher than the developed countries. due to such endemicity, indians are constantly subjected to pathogen-assault, giving rise to a more proactive cell-mediated immune system, than the western population. also, chloroquine and hydroxychloroquine, the two most revered drugs in the context of covid- treatment, have been extensively used at community level in india for the prevention and treatment of malaria. given the immunomodulatory and antiviral properties of these drugs, their widespread usage might have contributed to defense against sars-cov- . second, the epigenetic factors like environment and food habits might have some role in boosting immunity. several kinds of herbs and spices like turmeric, cloves, ginger, mustard, saffron, cardamom, and garlic are essential ingredients of the indian cuisine. these spices are rich in bioactive compounds and phytochemicals which possess medicinal properties (sengupta et al., ) . turmeric (indian saffron), a product of curcuma longa, is a rhizomatous herbaceous perennial plant belonging to the ginger family that is routinely used in indian households as a culinary spice and as a component in religious ceremonies. it has also been used as a traditional medicine over centuries. curcumin, the bioactive compound in turmeric has been recognized for its potent antioxidant, anti-inflammatory, antimutagenic, antimicrobial, and anticancer properties. it has demonstrated antiviral activity against a wide range of viruses including human immunodeficiency virus and , influenza virus (h n , pr , and h n ), herpes simplex virus (hsv) and , coxsackievirus, hepatitis b and c viruses, human papillomavirus (hpv) types and , japanese encephalitis virus, and human t cell lymphotropic virus type (moghadamtousi et al., ) . similarly, ginger, another rhizomatous spice used routinely in indian foods contains several bioactive phenolic and terpene compounds that have demonstrated antiviral activity against human respiratory syncytial virus (blocks viral attachment and internalization) (mao et al., ) . garlic (allium sativum), a popular condiment used in indian foods, has been shown to possess antiviral activity against hsv- and - , parainfluenza virus type , and human rhinovirus type (lee et al., ) . capsaicin, an active component of chili peppers, acts as an agonist at vanilloid receptor of dendritic cells and enhances the antiviral activity of cd + cytotoxic t-cells by increasing mhc class i-restricted viral antigen presentation in dendritic cells (weber et al., ) . it has been shown to inhibit influenza a virus replication in cell cultures in a dose dependent manner (marois et al., ) . even, studies from china have highlighted the possible therapeutic role of traditional chinese medicines in the treatment of covid- . thus, considering the multi-pharmacological activity of the active components in indian spices, it is possible that they might have some role in defense against sars-cov- . third, the indian population possesses a high genetic diversity in the immune response genes, collectively referred to as human leukocyte antigen (hla) complex, much more extensive than the caucasian population and this is attributed to the high microbial load to which the indians are exposed during life (mehra, ) . the hla complex serves to induce and regulate immune responses. it helps in distinguishing self antigens from non-self foreign proteins. the foreign antigens can be recognized by the t-cells only if they are presented in association with hla proteins. more the number of hla allotypes expressed on the cell surface, broader the range of foreign antigens they can recognize and present to the t-cells. thus, individuals with heterozygous hla alleles possess the ability to present a broader repertoire of antigenic peptides to the immune cells as compared to homozygotes (mosaad, ) . according to a study at all india institute of medical sciences, new delhi, india, several novel hla alleles (hla-a * ) and unique haplotypes (hla-a -b -dr ) have been observed in the indian population, which are not known to occur in other ethnic groups (mehra, ) . whether such differences have any influence on the severity of sars-cov- infection need to be investigated. recently, nguyen et al. ( ) evaluated the role of cross-protective immunity in covid- and reported that individuals with hla-b * : allele are particularly vulnerable to the disease due to expression of low levels of sars-cov- binding peptides, while those with hla-b * : possess an enhanced capacity to present highly conserved sars-cov- peptides that are shared among common human coronaviruses, indicating its potential to elicit crossprotective t-cell based immunity. therefore, genetic diversity of hla alleles can be an important factor in determining the susceptibility to sars-cov- infection. fourth, allelic variation in angiotensin converting enzyme (ace ) receptor can be an important factor determining the susceptibility to sars-cov- infection. cell culture assays and molecular superimposition studies indicate that sars-cov- spike (s) protein has got high affinity for human ace receptors and utilizes the same for gaining entry into the target cells. ace receptors are widely distributed in body tissues, the highest expression being observed in type ii alveolar epithelial cells (hussain et al., ) . recent studies suggest a correlation between the level of ace expression on cell membrane and viral infectivity, which in turn governs disease severity and clinical outcomes (jia et al., ) . hussain et al. ( ) reported that certain allelic variants of ace (s p and e g) demonstrates low binding affinity for the viral spike protein and may thus confer resistance to sars-cov- infection. a study by calcagnile et al. ( ) found that two snps-s p (common in africans) and k r (common in europeans) can potentially affect the interaction between ace and sars-cov- spike glycoprotein. while the former decreases ace affinity for the spike protein and lowers the susceptibility, the latter increases the receptor affinity and predisposes to more severe disease. hence, genetic polymorphisms of ace receptors might be an important factor in determining the susceptibility to sars-cov- . fifth, the micrornas (mirnas) might play a crucial role in defense against sars-cov- . mirnas are small non-coding rnas that are thought to regulate gene expression and cell differentiation, and have the ability to inhibit viral replication in a sequence-specific manner. considering their unique mechanism of action, mirnas have become attractive candidates as diagnostic biomarkers and therapeutic targets (correia et al., ) . several studies have highlighted the potential role of mirnas in the regulation of antiviral defense against h n influenza, hiv- , hsv- , hpv, enterovirus- , hepatitis b and c, and dengue viruses (barbu et al., ) . a recent study by translational bioinformatics group at icgeb and department of biochemistry, jamia hamdard, new delhi, india, revealed that nine host mirnas can potentially target sars-cov- . these are hsa-let- a, hsa-mir , hsa-mir a- p, hsa-mir , hsa-mir , hsa-mir b, hsa-mir , hsa-mir - and hsa-mir . interestingly, a single unique mirna, hsa-mir- b, has been found to be specifically targeting the indian sars-cov- genome, which has not been detected elsewhere. it has been hypothesized that hsa-mir- b has a specific role in defense against sars-cov- in indian population that harbors this unique sequence (sardar et al., ) . these findings indicate a possible link between host mirnas and the disease severity as well as treatment outcomes. sixth, the indians have a higher percentage of nature killer (nk) cells, compared to other ethnic groups (rathore et al., ) . it has been postulated that the development, tolerance and activation of nk cells are regulated by the killer cell immunoglobulin-like receptors (kir) present on their surface. these receptors interact with hla class i expressed by target cells and regulate cytolytic activity (campbell and purdy, ) . while most kirs are inhibitory and tend to suppress nk cell function, activating receptors (kir ds - , kir ds ) are upregulated in viral infections and host cell aberrations. all activating kirs (except kir ds ) are encoded by b haplotype (hiby et al., ) . it has been observed that b haplotypes are more prevalent in non-caucasian populations such as australia aborigines and asian indians than in caucasian populations, and such populations are likely to be under high selection pressure from infectious diseases, much more than other ethnic groups. kir genes display extraordinary level of polymorphism and diversity among different populations because of which there may be significant differences in ligand affinity or signal transduction. populationbased analysis of kir genes reveal that kir ds , an activating kir, has high frequencies (> %) in australia aborigines and indian population, but low frequencies in other ethnic groups (middleton and gonzelez, ) . according to rajalingam et al. ( ) , the indians might have acquired activating kir genes through a process of natural selection that enabled them to survive epidemics during their pre-historic migrations from africa. thus, it is possible that the diversity in kir gene complex occurred as a result of natural selection by pathogens so as to offer a survival benefit. such diversification might be a reason for the indian population to respond differently to sars-cov- . seventh, live attenuated vaccines like bacillus calmette-guérin (bcg) and mumps, measles, rubella (mmr) commonly administered during childhood, have been found to confer nonspecific protection against unrelated lethal infections by inducing "trained" non-specific innate immune cells for more efficient host response against wide range of pathogens (fidel and noverr, ) . the bcg vaccine, given universally to indian babies at birth for protection against tuberculosis, might confer some protection against sars-cov- , possibly through activation of t-cell mediated immune response. bcg has no direct antiviral action, but it may act as an immunopotentiator (tsiang et al., ) . studies have demonstrated the ability of bcg vaccine in reducing viraemia associated with yellow fever vaccine (arts et al., ) , and decreasing the severity of encephalomyocarditis virus infection in mice (floc'h and werner, ) . researchers from new york institute of technology correlated global covid- transmission with bcg vaccine coverage data and observed that countries with a policy for universal bcg vaccination have lower number of covid- cases than those without such policy, such as the united states and italy (miller et al., ) . japan, where universal bcg vaccination policy is in place since , has maintained a low fatality rate, despite an early spike in covid- cases. iran, one of the countries badly hit by this pandemic, started universal bcg vaccination only in , potentially leaving anyone above years of age unprotected. however, according to who, such comparisons are prone to significant bias from many confounders, including variations in demographics and disease burden, covid- testing rates and the stage of the pandemic in each country. two randomized controlled trials, bcg-corona (nct ) and brace (nct ) trials are underway, evaluating the efficacy of bcg vaccine in reducing the viral load and/or sequelae associated with covid- . one limitation of bcg vaccination is seroconversion, which is the basis for diagnosis of tb in several countries. therefore, mmr, another live attenuated vaccine, might be a potential option for inducing beneficial non-specific effects in human populations and thus provide protection against the catastrophic sequelae of covid- . a strong correlation has been observed between individuals in geographical locations who received mmr vaccine and reduced covid- death rates (gold, ) . interestingly, despite children being highly susceptibility to flu, very few children have been affected during the ongoing covid- pandemic. also, there has been a striking difference in the covid- mortality rates between children and adults. one explanation is that children are protected owing to their recent and more frequent exposures to live attenuated vaccines (bcg, mmr, chickenpox and rotavirus) which can induce the trained myeloid-derived suppressor cells and thus limit disease severity (fidel and noverr, ) . though conclusive evidence on this ground is lacking at the moment, considering the positive correlation between the use of live attenuated vaccines and lower covid- severity and death rates, hopes remain high for a possible protective action of these vaccines against sars-cov- . india is a vast country with varied weather conditions. the western part of the country is known for hot dry summers with temperatures exceeding • c, while the himalayan belt in the northern part records temperatures as low as − • c. previous studies have shown the impact of weather variables on the transmission dynamics of diseases like influenza and sars. transmission of influenza is facilitated in the presence of cold and/or dry air. a sharp rise in influenza virus activity in northern europe during - was correlated with low temperature and low ultraviolet (uv) radiation indices. based on these facts, it was assumed that covid- transmission might decrease or even disappear with the rise in ambient temperature and uv radiation during the summer months. however, a study by yao et al. ( ) incorporating meteorological data and basic reproduction number (r ) of the virus from chinese cities revealed that high temperature, humidity and uv radiation has no significant impact on cumulative incidence rate and transmission of sars-cov- . infact, countries like iran and australia continued to have rapid disease transmission and exponential rise in the number of cases despite high temperature and humidity, indicating that the inverse relationship between ambient temperature and covid- transmission lacks rationality. studies have shown that an interplay between macrodomain (mac) and papain-like protease (plp ) domain of coronavirus nsp impacts viral replication, host innate immune antagonism and virulence. strains harboring mutations in these two domains are more rapidly degraded at non-permissive temperatures ( • c and • c) than the wild-type strains (deng et al., ) , indicating that higher temperatures may lower the virulence and pathogenicity of temperature-sensitive sars-cov- mutants. the covid- fatality rate in india is among the lowest in the world ( . % against a global average of . %). also, the disease has been observed to be less severe among indians with a significantly higher recovery rate ( . % versus a global average of . %) and doubling time ( . days) as compared to the populations elsewhere. , , strict lockdown measures implemented nationwide for more than two months might have kept the transmission and deaths in check. this must have contributed significantly to the much desired flattening of the epidemic curve. there are speculations that india's predominantly young population as compared to the western world (with a higher proportion of elderly people), and the presence of a less virulent strain of the virus in circulation are helping keep fatalities low in india. however, there are no evidences in support of these claims. in fact, phylogenetic analysis has revealed that four clades of the virus: o (ancestral clade from china), b (from china), a (from iran) and a a (from iran, europe, and other countries) are in circulation in india with a a being the dominant type (biswas and majumder, ) . there are reports that the official death counts are much lower as compared to the actual death toll. on april , , china revised the death toll to with a % spike in fatality figures. such discrepancies may arise because the official count considers only the hospital deaths, while majority of the deaths still happen at home. also, death due to covid- may not be reported in presence of other comorbidities. tracking deaths is far more reliable than cases, which are significantly affected by testing bias. roughly, % of the covid- patients are asymptomatic who hardly get tested and serve as potential source for transmission of infection. in a densely populated country like india, mass screening of population for covid- is not feasible. so there are chances that india might be missing some deaths and not diagnosing every case correctly. however, considering the magnitude of the pandemic, india has ramped-up the testing capacity with nearly , samples being screened and over , active cases being detected daily. still, the fatality rate in indian cases is low and none has got a definite answer for that. while this apparent protection among indians is largely attributed to non-heritable influences as discussed earlier, a safe and effective vaccine against sars-cov- can reduce disease severity, control transmission, and prevent future infections across all populations. vaccines function by inducing both arms of the adaptive immune response: humoral immunity (producing neutralizing antibodies that prevent virus attachment) and cell-mediated immunity (activating antigen presenting cells, t-cells, and nk cells that recognize and kill virus-infected cells) (mukherjee, ) . there are currently ten vaccines undergoing clinical trials against covid- based on several technologies, such as, live attenuated, inactivated, mrna, dna, viral vector, and peptide subunit based platforms (mullard, ) . a strong global vaccination program with equitable distribution of promising vaccine candidates to all affected regions is needed to tackle the pandemic. this perspective puts forward several hypotheses which may explain individual and population susceptibility to covid- which in turn, may help prioritize vaccination in high risk individuals and groups, and thus reduce morbidity and mortality across populations. whether the above factors generate sufficient evidence to provide satisfactory explanation for their apparent protective effects on indian population during covid- pandemic, will be clear as the situation unfolds further. the original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author. as and rg: conceptualization, data curation, and methodology. as, rg, and vn: supervision. as, rg, vn, and sm: validation, and visualization. as and rg: writing -original draft. as, rg, vn, and sm: writing -review and editing. all authors contributed to the article and approved the submitted version. bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity severe acute respiratory syndrome coronavirus (sars-cov- ): an overview of viral structure and host response reporting two sars-cov- strains based on a unique trinucleotide-bloc mutation and their potential pathogenic difference the novel coronavirus enigma: phylogeny and mutation analyses of sars-cov- viruses circulating in india during early . biorxiv microrna involvement in signaling pathways during viral infection. front analysis of rna sequences of sars-cov- collected from countries reveals selective sweep of one virus type human immune system variation variation in the human immune system is largely driven by non-heritable influences distinct viral clades of sars-cov- : implications for modeling of viral spread ace polymorphisms and individual susceptibility to sars-cov- infection: insights from an in silico study. biorxiv structure/function of human killer cell immunoglobulin-like receptors: lessons from polymorphisms, evolution, crystal structures and mutations clinical and immunological features of severe and moderate coronavirus disease circulating micrornas as potential biomarkers of infectious disease immvar project: insights and design considerations for future studies of "healthy" immune variation analysis of coronavirus temperature-sensitive mutants reveals an interplay between the macrodomain and papain-like protease impacting replication and pathogenesis epidemiology of coronavirus disease in gansu province, china, . emerg could an unrelated live attenuated vaccine serve as a preventive measure to dampen septic inflammation associated with covid- infection? mbio increased resistance to virus infections of mice inoculated with bcg (bacillus calmette-guérin) phylogenetic network analysis of sars-cov- genomes mmr vaccine appears to confer strong protection from covid- : few deaths from sars-cov- in highly vaccinated populations. researchgate the genomic variation landscape of globally-circulating clades of sars-cov- defines a genetic barcoding scheme. biorxiv distribution of killer cell immunoglobulin-like receptors (kir) and their hla-c ligands in two iranian populations structural variations in human ace may influence its binding with sars-cov- spike protein ace receptor expression and severe acute respiratory syndrome coronavirus infection depend on differentiation of human airway epithelia large scale genomic analysis of sars-cov- genomes reveals a clonal geo-distribution and a rich genetic variations of hotspots mutations. biorxiv vanilloid receptor agonists, capsaicin and resiniferatoxin, enhance mhc class i-restricted viral antigen presentation in virus-infected dendritic cells analysis of factors associated with disease outcomes in hospitalized patients with novel coronavirus disease bioactive compounds and bioactivities of ginger inhibition of influenza virus replication by targeting broad host cell pathway defining genetic architecture of the populations in the indian subcontinent: impact of human leukocyte antigen diversity studies geographic and genomic distribution of sars-cov- mutations the extensive polymorphism of kir genes correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study. medrxiv a review on antibacterial, antiviral, and antifungal activity of curcumin clinical role of human leukocyte antigen in health and disease global efforts on vaccines for covid- : since, sooner or later, we all will catch the coronavirus covid- vaccine development pipeline gears up human leukocyte antigen susceptibility map for severe acute respiratory syndrome coronavirus distinct diversity of kir genes in three southern indian populations: comparison with world populations revealed a link between kir gene content and pre-historic human migrations differences in multiple immune parameters between indian and u.s. infants comparative analyses of sar-cov genomes from different geographical locations and other coronavirus family genomes reveal unique features potentially consequential to hostvirus interaction and pathogenesis. biorxiv indian food ingredients and cancer prevention -an experimental evaluation of anticarcinogenic effects of garlic in rat colon. asian pac bcg modulation of delayed type hypersensitivity, humoral response and acquired resistance after rabies vaccination the role of phylogenetic analysis in clarifying the infection source of a covid- patient in vitro virucidal effects of allium sativum (garlic) extract and compounds covid- : a new challenge for human beings traditional chinese medicine in the treatment of patients infected with -new coronavirus (sars-cov- ): a review and perspective no association of covid- transmission with temperature or uv radiation in chinese cities probable pangolin origin of sars-cov- associated with the covid- outbreak sars-cov- : an emerging coronavirus that causes a global threat the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.copyright © samaddar, gadepalli, nag and misra. this is an open-access article distributed under the terms of the creative commons attribution license (cc by). the use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. no use, distribution or reproduction is permitted which does not comply with these terms. key: cord- - g a s z authors: shih, hsin-i.; wu, chi-jung; tu, yi-fang; chi, chia-yu title: fighting covid- : a quick review of diagnoses, therapies, and vaccines date: - - journal: biomed j doi: . /j.bj. . . sha: doc_id: cord_uid: g a s z the covid- pandemic caused by a novel coronavirus, sars-cov- , has infected more than . million individuals and resulted in over , deaths globally. the rapid spread of the virus and the precipitously increasing numbers of cases necessitate the urgent development of accurate diagnostic methods, effective treatments, and vaccines. here, we review the progress of developing diagnostic methods, therapies, and vaccines for sars-cov- with a focus on current clinical trials and their challenges. for diagnosis, nucleic acid amplification tests remain the mainstay diagnostics for laboratory confirmation of sars-cov- infection, while serological antibody tests are used to aid contact tracing, epidemiological, and vaccine evaluation studies. viral isolation is not recommended for routine diagnostic procedures due to safety concerns. currently, no single effective drug or specific vaccine is available against sars-cov- . some candidate drugs targeting different levels and stages of human responses against covid- such as cell membrane fusion, rna-dependent rna polymerase, viral protease inhibitor, interleukin blocker, and convalescent plasma may improve the clinical outcomes of critical covid- patients. other supportive care measures for critical patients are still necessary. advances in genetic sequencing and other technological developments have sped up the establishment of a variety of vaccine platforms. accordingly, numerous vaccines are under development. vaccine candidates against sars-cov- are mainly based upon the viral spike protein due to its vital role in viral infectivity, and most of these candidates have recently moved into clinical trials. before the efficacy of such vaccines in humans is demonstrated, strong international coordination and collaboration among studies, pharmaceutical companies, regulators, and governments are needed to limit further damage due the emerging sars-cov- virus. severe acute respiratory syndrome coronavirus (sars-cov- ), which emerged in wuhan, china in late , has rapidly spread throughout china and globally. although belonging to the same family, sars-cov- has different clinical and epidemiological characteristics from sars-cov and middle east respiratory syndrome coronavirus (mers-cov). its high transmissibility resembles that observed for pandemic influenza viruses; however, tools for diagnosis, treatment, and vaccines still need tremendous work to achieve the levels needed to respond to a pandemic flu. although other measures designed to respond to and control a pandemic such as surveillance, quarantine, and social distancing work efficiently to flatten the curve at a major cost to the economy, the development and deployment of effective tests, drugs, and vaccines to protect lives and limit disease spread are still urgent. emergency use authorizations (eua) expedite the availability of drugs to prevent serious or life-threatening diseases or conditions when there are no adequate, approved, and available alternatives. for many drugs that are already marketed for other conditions, off-label use can increase access for patients who need them. currently, thousands of clinical trials are ongoing to test clinical outcomes. adequate clinical trials will soon confirm or refute the usefulness of several candidate drugs and vaccines in treating and preventing covid- . here, we review the state of diagnostic tests, initial clinical experience on accessible drugs and convalescent plasma administered to patients with covid- , and updated information on vaccine development against covid- . for covid- patients, fever and cough are the two most common symptoms, and some patients might also suffer from sputum production, sore throat, headache, myalgia/arthralgia, rhinorrhea, and diarrhea [ ] . shortness of breath and dyspnea occur in cases that have progressed to pneumonia. of note, a substantial proportion of patients reported olfactory and gustatory disorders, and thus sudden anosmia or ageusia may represent a clinical screening tool to identify covid-patients [ ] . most patients had normal or decreased leukocyte count, lymphopenia, and elevated c-reactive protein, and some also had thrombocytopenia and elevated d-dimer, lactate dehydrogenase, and alanine aminotransferase [ ] . in patients with pneumonia, ground-glass opacity is the typical radiological finding on chest computed tomography (ct) scan, and it may be obscure on chest x-ray; in patients with severe pneumonia, local or bilateral patchy consolidation has also been seen on ct images [ ] . however, these clinical, laboratory, and imaging findings are nonspecific and cannot differentiate covid- from other viral respiratory infections; viral diagnostic methods specific for sars-cov- should be applied for disease confirmation. the current standard diagnostics for covid- are based on detection of the sars-cov- rna by nucleic acid amplification tests (naats), usually through real-time reverse transcription polymerase chain reaction (rt-pcr) with conformation by sequence analysis when necessary [ ] . reverse transcription loop-mediated isothermal amplification (lamp) assays also appear to be a simple and sensitive diagnostic tool without a requirement high-level facilities and instruments [ ] . samples recommended for testing are those from the lower respiratory tract, including sputum, bronchoalveolar lavage (bal), and endotracheal aspirates when possible [ ] . sputum, nasopharyngeal swab (np), and oropharyngeal swabs (op) are the most common sample types taken from patients with mild to moderate illness. if both np and op are collected, they can be placed in the same tube and tested simultaneously to save reagents [ , ] . in general, bal showed the highest positive rates, followed by sputum, np, and op in order of decreasing sensitivity [ ] [ ] [ ] . throat gargling samples are an alternative specimen, although they are less sensitive than sputum [ ] . the laboratory confirmation of cases in regions without covid- virus circulation requires detection of two different genetic targets of the covid- viral genome, while in regions with established covid- virus circulation, confirmation through detection of a single genetic target is considered sufficient [ , ] . many national laboratories have established and published their diagnostic protocols, which are summarized on the world health organization (who) website [ ] . for example, the charité protocol from germany recommended detecting the e (envelope) gene for screening, followed by confirmation of e gene-positive samples through detection of the rna-dependent rna polymerase (rdrp) gene, where the e assay is specific for all sars-cov related viruses (i.e., sars-cov, sars-cov- , and bat-derived sars-related cov) and the rdrp assay using the p probe only detects sars-cov- [ ] . pharyngeal virus shedding is very high during the first week of symptoms, and viral rna shedding from sputum persists even after resolution of symptoms and seroconversion [ , ] . in a study with most samples (> %) taken from the lower respiratory tract, the median duration of rna detection was days (interquartile range, - days) after illness onset, and independent risk factors for prolonged sars-cov- rna shedding (> days) included male sex, delayed hospital admission, and invasive mechanical ventilation [ ] . however, viral rna does not equate to a live virus, and more data are needed to realize whether viral rna load correlates with infectivity [ ] . it has also been noted that a negative naat result does not mean that covid- is absent, since several factors can lead to false-negative results. these factors include inappropriate sample collection or transportation, sample collection at time when the patient was not shedding sufficient virus, and technical reasons [ , ] . periodically sequencing the evolving viruses is also suggested to monitor any mutations in the regions targeted by the assays that might affect test performance [ , ] . moreover, the presence of a non-sars-cov- pathogen does not preclude the possibility of covid- ; approximately one-fifth of specimens positive for sars-cov- were positive for one or more additional common respiratory viruses [ ] . virus isolation is essential to obtain isolates for characterization and to support the development of antivirals and vaccines. however, although sars-cov- can be cultured in selected cell lines, such as vero cells and llc-mk cells, in a biosafety level- laboratory (bsl- ), viral isolation is not recommended as a routine diagnostic procedure due to biosafety concerns and time constraints [ , , ] . studies have indicated that infectious virus can be readily isolated during the first week of symptoms, with sputum having a higher culture yield than np or op; however, infectious virus could not be isolated from samples taken days after onset despite ongoing high viral load detected by rt-pcr [ ] . it appears that virus isolation success depends on viral load, as culture failed to yield virus when samples contained < copies per ml or per sample [ ] . further studies elucidating the duration of culture-positivity would provide a rationale for proposing strategies of isolation of infected patients. serological antibody detection is the other broad category of tests to diagnose covid- , and this method detects igm, igg, or total antibodies (typically in the blood) against sars-cov- . techniques used for antibody detection include virus neutralization assay, enzyme-linked immunosorbent assay (elisa), immunochromatographic assay, chemiluminescent immunoassay, etc. [ , [ ] [ ] [ ] [ ] . most tests are designed to capture antibodies, which recognize the nucleocapsid (n) protein and the s subunit and receptor biding domain (rbd) of spike (s) proteins, as n and s proteins are the two major coronavirus immunogens [ , ] . rbd-specific monoclonal antibodies derived from two b cell clones of one covid- patient have demonstrated impressive binding and neutralizing activity against live sars-cov- [ ] . of importance, these serologic tests should not cross-react with other seasonal coronaviruses. nevertheless, the use of antibody tests is limited to settings of acute illness because it takes time for hosts to mount an adequate immune response [ ] . studies indicate that the majority of patients have seroconversion weeks after symptom onset [ , , ] . less than % of patients had detectable antibodies within week of onset, but this percentage rapidly increased to . % (igm) and . % (igg) days after onset, with the median seroconversion time of and days, respectively [ ] . igm began to decline weeks after symptom onset, while igg remained at high levels after weeks [ , ] . based on the time course of seroconversion, serological tests could be used as complementary tools to identify patients presenting late in their illness [ ] . as mentioned earlier, seroconversion has not usually been followed by a rapid decline in viral rna load [ ] . serological tests may also aid in (i) contact tracing, (ii) assessment of prior infection and immunity to sars-cov- (if there is protective immunity), (iii) determining the extent of the pandemic with seroprevalence data, and (iv) vaccine evaluation studies [ , ] . to date, it is not known whether antibodies elicited by sars-cov- provide protective immunity against reinfection and how long the protective immunity lasts. a rhesus macaque study does suggest protective immunity after recovery from primary infection, since reinfection did not occur in convalescent monkeys rechallenged with the same dose of sars-cov- strains [ ] . further studies are necessary to elucidate the situation in humans. rapid antigen-detection methods using immunoassays targeted at n or s proteins are under development, although with the same challenge of low sensitivity observed in influenza virus antigen tests. to date, a number of laboratory-developed assays and commercially available kits (mostly naats and serological antibody tests) have been granted an eua by the us food and drug administration (fda), which greatly strengthens the diagnostic capability of frontline clinical laboratories [ ] . currently, there are no drugs or other therapies approved by the us fda to treat covid- . the major clinical treatment and management approaches emphasize the importance of life supportive care and relief of complications. oxygen-based therapy has been applied when patients experience dyspnea, and advanced sepsis management has been warranted for patients who progressed to severe sepsis and acute respiratory distress syndrome. no existing antiviral drugs have sufficient evidence that they efficaciously treat covid- pneumonia. some drugs have been selected to treat covid- pneumonia patients ( table ) ; most of these drugs were designed for other purpose such as ebola, influenza, parasites, human immunodeficiency virus (hiv) infections, and immune therapy for some autoimmune and inflammatory diseases. clinical trials have been conducted in which potential antiviral therapy targets were tested, such as blocking viral entry to human cells, inhibiting viral enzymes that were responsible for genome replication. others focus on the human immune system to boost the innate response and inhibit the inflammatory process to relieve rapid progressed acute lung injuries. global, large-scale, randomized clinical trials are still ongoing to test the safety and clinical outcomes of these drugs. here, we summarize the mechanisms of potential therapeutic options that may combat the emerging sars-cov- ( figure) . chloroquine/hydroxychloroquine chloroquine and hydroxychloroquine have a long-standing history in the prevention and treatment of malaria and the treatment of chronic inflammatory diseases such as systemic lupus erythematosus and rheumatoid arthritis. chloroquine and hydroxychloroquine block viral entry into cells by inhibiting the glycosylation of host receptors, proteolytic processing, and endosomal acidification. immunomodulatory effects through attenuation of cytokine production and inhibition of autophagy and lysosomal activity in host cells have also been reported [ , ] . the experiences of the us, china, and europe have indicated clinical effects of chloroquine and hydroxychloroquine in the early phase but limited effects in the late phase [ ] . an earlier study demonstrated that hydroxychloroquine was significantly associated with viral load reduction/disappearance in covid- patients and its effect was strengthened by azithromycin [ ] . in addition, a recent meta-analysis indicated hydroxychloroquine alone, or in combination with azithromycin had benefits in positive-to-negative conversion of sars-cov- and reduction of progression rate though being associated with higher mortality [ ] . nevertheless, an us study which evaluated hospitalized patients with covid- in metropolitan new york showed no significant difference in in-hospital mortality among patients treated with hydroxychloroquine, azithromycin, both, and neither of them [ ] . safety data and data from larger, randomized, placebo-controlled trials with longer follow-up are urgently needed. hydroxychloroquine can prolong the pr, qrs and qtc intervals, especially in patients with underlying risk factors or use in combination with other qt-prolonging drugs; cautious monitoring of ecg changes during treatment is important. chloroquine and hydroxychloroquine are substrates of cyp c and cyp a ; therefore, co-administration with moderate and strong cyp c and cyp a inhibitors may result in increased plasma concentrations of hydroxychloroquine. experiences and interim guidelines for clinical management of sars-cov- infection in taiwan advised that early administration of hydroxychloroquine may be considered to be given for days after thoroughly evaluating potential risks/benefits and ethical issues [ ] . lopinavir, an hiv type aspartate protease inhibitor, has in vitro inhibitory activity against sars-cov [ ] . ritonavir is combined with lopinavir to increase its plasma half-life through the inhibition of cytochrome p . an open-label study published in suggested, by comparison with a control group that received only ribavirin, that the addition of lopinavir-ritonavir ( mg and mg, respectively) to ribavirin reduced the risk of adverse clinical outcomes (acute respiratory distress syndrome or death) and viral load among patients with sars [ ] . lopinavir also has activity, both in vitro [ ] and in an animal model [ ] , against mers-cov, and case reports have suggested that the combination of lopinavir-ritonavir with ribavirin and interferon alfa resulted in virologic clearance and survival [ ] . a randomized controlled trial enrolled covid- patient with dyspnea and desaturation in china and suggested that treatment with lopinavirritonavir was similar to standard care in the time to clinical improvement. gastrointestinal adverse events were more common in the lopinavir-ritonavir group, but serious adverse events were more common in the standard-care group. lopinavir-ritonavir treatment was stopped early because of adverse events such as nausea, diarrhea and hepatotoxicity [ ] . additionally, as a cyp a inhibitor, significant drug-drug interactions have been reported before. ivermectin is an fda-approved broad spectrum anti-parasitic agent. it was identified as an inhibitor in vitro and has been demonstrated to limit infection by a broad spectrum of rna viruses such as dengue virus (denv), west nile virus, venezuelan equine encephalitis virus, and influenza by binding to inhibitors of importin α/β-mediated transports of proteins and rna during infection. in the phase iii clinical trial in thailand in - against denv infection with a single daily oral dose, ivermectin was observed to be safe and resulted in a significant reduction in serum levels of viral ns protein, but no change in viremia or clinical benefit was observed [ ] . ivermectin has been shown to reduce viral rna up to , -fold after h of infection with sars-cov- [ ] . this drug is extensively metabolized in human liver microsomes by cyp a . for patients with liver function abnormality, drug effects and interactions should be closely monitored during treatment. remdesivir remdesivir, a nucleotide analogue prodrug that inhibits rdrp, results in premature termination of the viral rna chain and consequently halts replication of the viral genome. it has shown broad spectrum activity against members of several virus families, including filoviruses (e.g., ebola) and coronaviruses (e.g., sars-cov and mers-cov), and has shown prophylactic and therapeutic efficacy in nonclinical models of these coronaviruses [ ] [ ] [ ] . remdesivir in vitro testing has also shown that remdesivir has activity against sars-cov- [ ] . a compassionate-use study reported % oxygen improvement and % overall mortality. a total of patients ( %) reported adverse events during follow-up. the most common adverse events were increased hepatic enzymes, diarrhea, rash, renal impairment, and hypotension, and some of the patients discontinued remdesivir treatment prematurely. higher improvement rate in chest imaging in the favipiravir arm ( . % versus %) [ ] . another multicentered randomized clinical study also suggested that the day clinical recovery rate increased in the favipiravir treatment group, along with shorter defervescence time and cough in patients with hypertension and/or diabetes [ ] . although few adverse effects were reported during treatment, potential drug and drug interactions should be kept in mind because favipiravir undergoes metabolism in the liver by aldehyde oxidase and xanthine oxidase to produce an inactive oxidative metabolite and is excreted by the kidney [ ] . no hepatic or kidney adjustments are recommended at this time, but initiation is not recommended in patients with an estimated glomerular filtration rate less than ml/min. the humoral immune response mediated by antibodies is crucial for preventing viral infections. therefore, the development of specific surface epitope-targeting neutralizing antibodies is a more long-term, albeit more specific, approach to target covid- [ ] . sars-cov- -specific neutralizing antibodies (nab) have been detected in patients from day - after the onset of the disease and remained thereafter. the titers of nab among these patients correlated with the spike-binding antibodies targeting the s , rbd, and s regions. studies in china indicated that one or two doses of ml of convalescent plasma derived from recently recovered donors with neutralizing antibody titers above : were well tolerated and could significantly increase or maintain the neutralizing antibodies at a high level; this outcome leads to disappearance of viremia, improvement of clinical symptoms, and absorption of lung lesions in radiological examination when administered, in addition to supportive care and antiviral agents such as lopinavir/ritonavir and favipiravir. the donors must be symptom-free for at least days, have a negative sars-cov- pcr test after recovery to provide abo-compatible and test negative plasma for major blood-borne diseases at the time of blood donation. known general reactions such as transfusion-associated circulatory overload and transfusion-associated acute lung injury in patients with already severe lung damage still exist and need to be closely monitored [ ] [ ] [ ] [ ] . evidence suggests that cytokine release syndrome (crs) might play a major role in severe covid- [ , ] . inflammatory cytokines and chemokines, including il- , il- β, induced protein and monocyte chemoattractant protein- , are significantly elevated in covid- patients, especially in severe patients with life-threatening multiple organ dysfunction. in covid- patients with elevated inflammatory cytokines, postmortem pathology has revealed tissue necrosis and interstitial macrophage and monocyte infiltrations in the lung, heart, and gastrointestinal mucosa [ ] . moreover, severe lymphopenia with hyperactivated proinflammatory t cells [ ] and decreased regulatory t cells [ ] is commonly seen in critically ill patients, suggesting dysregulated immune responses. tocilizumab is a recombinant humanized monoclonal anti-il- receptor antibody. it binds both soluble and membrane-bound il- r to inhibit il- -mediated cis-and trans-signaling [ ] . given the efficacy of tocilizumab in crs and the pivotal role of il- in covid- , clinical use should consider evaluation of patients with the following criteria: (i) h score, a diagnostic score for hlh, to discriminate patients with crs; (ii) chinese guidelines for covid- grade patients into mild, moderate, severe, and critical by vital signs, radiographic findings, and complications; (iii) il- measurement, as il- levels are significantly elevated in covid- patients, especially in icu patients [ ] . crp, an acute-phase inflammatory protein synthesized by il- -dependent hepatic biosynthesis, is a reliable marker of il- bioactivity and is used to predict crs severity and monitor il- blockade efficacy. most studies suggested that elevated crp levels are associated with severe covid- [ , , ] . clinicians should add antivirals and cautiously evaluate the possibility of secondary infection thereafter [ ] . adverse hepatic effects have been reported previously, and clinicians should consider discontinuation of drug in cases of marked elevation of liver enzymes and hyperbilirubinemia. other drug-drug interactions should be monitored because tocilizumab interferes with the serum concentration of cyp a substrates. arbidol hydrochloride (umifenovir) umifenovir targets the s protein/ace interaction and inhibits membrane fusion of the viral envelope [ ] . the agent is currently approved in russia and china for the treatment and prophylaxis of influenza and is being tested in some clinical trials treating covid- based on in vitro data suggesting activity against sars [ ] . the current dose of mg orally every hours for influenza is being studied for covid- treatment [ ] . limited clinical experience with umifenovir for covid- in china in a nonrandomized study of patients with covid- showed that treatment with umifenovir for a median duration of days was associated with lower mortality rates ( % [ / ] vs % [ / ] ) and higher discharge rates compared with patients who did not receive the agent [ ] . another randomized chinese study compared umifenovir (arbidol) ( mg* /day) and favipiravir ( mg* /first day followed by mg* /day) and indicated that favipiravir, compared to umifenovir, did not significantly improve the clinically recovery rate at day [ ] . camostat mesylate is an inhibitor of the cellular serine protease tmprss [ ] , which is used by sars-cov- for s protein priming [ ] . it was developed to treat chronic pancreatitis ( mg daily in three divided doses) and reflux esophagitis ( mg daily in three divided doses after each meal). sars-cov- is surrounded by an envelope composed of a lipid bilayer and envelope proteins. sars-cov- initiates human cell entry after the s protein present on the envelope binds to a cell membrane receptor called ace . the s protein is cleaved into two subunits, s and s , by a human cell-derived protease, which is thought to be furin. s then binds to its receptor, ace . the other fragment, s , is cleaved by tmprss , a human cell surface serine protease, resulting in membrane fusion. both ace and tmprss are therefore thought to be essential in airway cells for sars-cov- infection. an in vitro study found that nafamostat and camostat suppressed sars-cov- s protein-initiated fusion in ft cells (derived from the human fetal kidney) ectopically expressing ace and tmprss . nafamostat, a new developed iv form drug, was found to inhibit sars-cov- s protein-initiated fusion at a concentration less than one-tenth of that needed by camostat. adverse effects included mild gastrointestinal upset, dizziness, skin rash, thrombocytopenia, and elevated liver enzymes [ ] . vaccination probably offers the best option for blocking infectious disease circulation. table ) ; they are further discussed in the following section. platform mrna-based vaccines comprise mrna that encodes a protein antigen. conventional mrna-based vaccines encode the antigen of interest and contain ′ and ′ untranslated regions, whereas the virally derived, self-amplifying rnas encode not only the antigen but also the viral replication machinery that enables intracellular rna amplification and abundant protein expression [ ] . recent mrna vaccine designs have improved the stability and protein translation efficiency for enhanced innate and adaptive immunogenicity [ ] . delivery of the mrna vaccine has been optimized by use of lipid nanoparticles for intramuscular or intradermal administration [ ] . additionally, unlike conventional vaccines, which are made from either inactivated pathogens or the small subunit of live pathogens, no infectious virus needs to be handled for mrna vaccines. therefore, testing is relatively safe, efficient, cost effective, and rapid. an mrna vaccine for covid- , mrna- , was the first to advance to a phase i clinical trial in the us, which is currently recruiting healthy volunteers aged between to years to assess the safety, reactogenicity, and immunogenicity. dna vaccines, another type of nucleic acid-based vaccines, consist of plasmid-dna encoding one or several antigens that will be expressed in host cells. dna vaccines can be produced rapidly and at low cost. however, the need for specific delivery systems to achieve good immunogenicity and possible genomic integration and persistence in host cells is a remaining concern [ ] . dna generation of an inactivated whole-virus (iwv) vaccine is the quickest approach for vaccine production following a new outbreak. such vaccines have successfully been developed for influenza virus and enterovirus [ , ] . iwv vaccines are usually made by exposure of a virulent virus to chemical or physical agents, e.g., formaldehyde or gamma irradiation, to destroy infectivity while retaining immunogenicity. the need to use large amounts of antigen to elicit an adequate antibody response and the possibility of causing th -bias hypersensitivity are major concerns for iwv vaccines [ ] . one inactivated vaccine candidate that displayed good cross-neutralization to different covid- strains has received approval for testing in human trials [ ] . viral vector vaccines are also potential tools for vaccine development. these vaccines can specifically deliver genes to target cells, enhance immunogenicity without an adjuvant, and induce a robust cytotoxic t cell response to eliminate virus-infected cells. although the results of viral vector-based vaccines have been encouraging in animal models, some obstacles need to be overcome before use in humans. these obstacles include genetic stability, ability to evade pre-existing immunity, and genotoxicity. adenovirus serotype (ad ) is the most widely used vector because this vector can be easily produced and has high levels of transgene expression and a broad range of viral tropism [ ] . the ability to enhance mucosal immunity through targeting epithelial cells of the upper respiratory tract and gut, two main sites that express high levels of the ace receptor for sars-cov- , makes ad an advantageous viral vector against covid- . recombinant ad vector-based vaccines have been examined in clinical trials against infectious diseases [ , ] . the work for covid- has been accelerated based on the experiences of previous trials. a candidate vaccine known as ad -ncov, which encodes a full-length s protein of sars-cov- , is the first demonstrated to be safe for humans and to proceed to a phase ii clinical trial in china. another viral vector vaccine, chadox ncov- , is composed of a nonreplicating chimpanzee adenovirus vector and genetic sequence of s protein. the vector represents an attractive alternative to the human adenoviral vector due to its good safety profile and lack of pre-existing immunity in human population [ ] . the vaccine candidate has entered a phase i/ii clinical trial. lentivirus vector (lv) systems represent an attractive technology for vaccine development. in addition to their ability to effectively deliver genes or antigens of interest into cells and to generate humoral and cellular mediated immune response against the encoded transgenes [ ] , lvs can transduce antigen presenting cells (apcs), the main cell types mediating the immune response, at high efficiencies with little to no cytotoxicity [ ] . through up or downregulation of immune modulatory genes in apcs by lvs, the genetically modified apcs may potentially activate a strong protective immunity against infections [ ] . two vaccine candidates, covid- /aapc vaccine and lv-smenp-dc vaccine, which were made by modifying artificial apcs and dendritic cells with lvs expressing multiple viral genes and immune modulatory genes, act as 'trojan horses' against sars-cov- virus. clinical trials are currently underway to evaluate their safety and immune reactivity. bifidobacterium is one of the domestic, nonpathogenic anaerobic bacteria found in the intestine of humans. these organisms are believed to have health-promoting properties for their host, including increasing the immune response and protecting the host against viral infection [ ] . as vaccine vectors, they offer several advantages including low cost, low resistance to antibiotics, noninvasive administration, and high safety levels. the most attractive feature is that bifidobacterium tends to elicit high levels of mucosal antibodies against the expressed foreign antigen following uptake via the mucosal immune system [ ] . some strains of bifidobacterium have been used as a delivery vector for the development of vaccines against hepatitis c virus and enterovirus [ , ] . the bactrl-spike vaccine candidate contains live bifidobacterium longum, which contains synthetic plasmid dna encoding the s protein of sars-cov- . the ongoing trial is designed to evaluate the safety and tolerability of orally delivered bactrl-spike vaccine in healthy adults. antibody-dependent enhancement (ade) is a condition in which subneutralizing or nonneutralizing antibodies are produced following primary infection or vaccination, and they enhance the infectivity of subsequent infections [ ] . ade modulates the immune response and elicits sustained inflammation, lymphopenia, and/or cytokine storm [ ] . ade has been observed for a variety of viruses, most notably flaviviruses (e.g., dnev) [ ] . ade also occurs in sars-cov infection [ , ] . diluted anti-sera against sars-cov promotes sars-cov infection, and this enhancement is significantly mediated by anti-s protein antibodies [ , ] . similarly, vaccination with recombinant s protein of sars-cov elicits both neutralizing and ade-inducing igg antibodies [ ] . as described above, many potential vaccine candidates against sars-cov- have focused on the full-length s protein. attributed to the taxonomic and structural similarities between sars-cov and sars-cov- , ade is a critical issue that should be considered seriously during the practical application of sars-cov- vaccines. three approaches have been suggested to mitigate the adverse effects of ade. the first one is shielding the nonneutralizing epitopes of the s proteins by glycosylation. the second approach is immunofocusing, which aims to direct the adaptive immune responses to target only the critical neutralizing epitope to elicit a more robust protective immunity. supporting evidence for the latter is that a vaccine candidate based on the shorter rbd induced higher neutralizing activity than based the full-length s protein [ , ] . the third approach is eliminating epitope sequences that mediate enhancement of infection. protein sequences responsible for ade have been identified at s − of the sars-cov s protein [ ] , a region that is also conserved in sars-cov- [ ] . thus, vaccines against covid- could be engineered to minimize ade via elimination of the epitope. bacillus calmette-guérin (bcg), the most commonly administered vaccine worldwide, contains a live attenuated strain of mycobacterium bovis to protect against tuberculosis (tb). universal vaccination at birth with a single dose of bcg is recommended in many countries where tb is highly endemic or where there is high risk of exposure to tb, such as japan, china, and taiwan. other countries, such as spain, france, and switzerland, have discontinued their universal vaccine policies because of the declining incidence of tb infection and the proven variable effectiveness in preventing adult tb. countries such as the united states, italy, and the netherlands have yet to adopt universal vaccine policies [ ] . although developed to prevent severe forms of tuberculosis in children, bcg vaccination has been shown to induce heterologous or nonspecific immune effects against nonmycobacterial pathogens, a phenomenon termed 'trained immunity'. trained immunity refers to the ability of innate immune memory to mount an enhanced subsequent response to diverse microbes [ ] . favorable effects of bcg have been observed in mouse and human studies for distinct viral pathogens [ , ] . epidemiological studies have also linked bcg vaccination to the reduction in all-cause mortality in neonates and respiratory infections in elderly [ , ] . nod -and mtor-mediated changes in the epigenetic landscape of immune cells is proposed to underly such protection to increase the secretion of pro-inflammatory cytokines, particularly il- β, and enhance anti-viral immunity [ , ] . recent preprint studies suggested significant associations of bcg vaccination with prevalence, progression of disease, and mortality due to covid- [ , ] . the authors indicated that countries without universal policies for bcg vaccination have been more severely affected compared to countries with routine use of the vaccine in neonates. the national immunization program in taiwan has included neonatal bcg vaccination since , and the coverage rate has remained at % since [ ] . as of may , , a cumulative total of covid- cases were confirmed in taiwan with a case fatality rate was of . %. the low morbidity and mortality rate are attributed to the government's quick response, border control, case identification, containment, and resource allocation to protect public health [ ] . it is not known whether bcg vaccination plays a protective role against covid- infection in taiwan. in addition to bcg, live attenuated influenza vaccine has been shown to promote nk cellmediated heterologous immunity [ ] . previous studies also suggest that the heterologous beneficial effects of bcg vaccination may vary by bcg formulation, age, and route of administration [ , ] . although these vaccines may bridge the gap until a vaccine specifically for sars-cov- is available, their protective effects and clinical relevance need to be further characterized. clinical trials have been initiated to study the effects of bcg vaccination given to healthcare workers who are at the frontline of the covid- pandemic ( table ) . before the evidence is available, the who is not likely to recommend bcg vaccination for the prevention of covid- [ ] . in the face of a pandemic, the rapid development, production, and deployment of diagnostic tools, drugs and vaccines are critical. scientific advancements since the sars and mers pandemics have accelerated our understanding of the epidemiology, pathogenesis, and diagnosis of sars-cov- , as well as the development of therapies to treat viral infection. rigorous and adequate clinical trials for drug safety and effectiveness in randomized, controlled trials remain fundamental measures to protect the public from drugs that are ineffective, unsafe, or both. some available candidate drugs targeting different levels of human responses to covid- , such as cell membrane fusion, rna-dependent rna polymerase, viral protease inhibitor, il- blocker and convalescent plasma, may improve the clinical outcomes of critical covid- patients. as no effective treatment against sars-cov- is currently available, the best action is to develop vaccines to prevent the infection. some potential vaccine candidates have progressed to phase i and ii clinical trials, but a year and a half are likely to pass before an effective vaccine is vetted through trials and is ready for marketing for humans. therefore, considerable efforts should be given to limit or hinder the spread of the virus. in addition, pandemics will generate simultaneous demand for drugs and vaccines around the world. the elderly and those with underlying diseases or chronic comorbidities are at greater risk of severe disease or mortality. clinical and serologic studies will be needed to confirm which populations remain at the highest risk once effective treatments or vaccines are available. strong international coordination and collaboration among studies, pharmaceutical companies, regulators, and governments are needed to ensure that promising therapies or vaccines can be manufactured and supplied successfully. the first wave of this pandemic has created devastating social, economic, and political threats. it is time for us to work together, share experiences, and move forward to fight covid- . although this virus persists, there is light at the end of the tunnel. the authors declare that there are no competing interests. clinical characteristics of novel coronavirus infection in china olfactory and gustatory dysfunctions as a clinical presentation of mild-to-moderate forms of the coronavirus disease (covid- ): a multicenter european study laboratory testing for coronavirus disease (covid- ) in suspected human cases, interium guidance rapid and visual detection of novel coronavirus (sars-cov- ) by a reverse transcription loop-mediated isothermal amplification assay pan american health organization and world health organization. laboratory guidelines for the detection and diagnosis of covid- virus infection report from the american society for microbiology covid- international summit sars-cov- viral load in upper respiratory specimens of infected patients detection of sars-cov- in different types of clinical specimens prolonged virus shedding even after seroconversion in a patient with covid- the sars-cov- receptor-binding domain elicits a potent neutralizing response without antibody-dependent enhancement virological assessment of hospitalized patients with covid- factors associated with prolonged viral rna shedding in patients with covid- rates of co-infection between sars-cov- and other respiratory pathogens serological immunochromatographic approach in diagnosis with sars-cov- infected covid- patients severe acute respiratory syndrome coronavirus -specific antibody responses in coronavirus disease patients antibody responses to sars-cov- in patients of novel coronavirus disease profile of specific antibodies to sars-cov- : the first report potent human neutralizing antibodies elicited by sars-cov- infection evaluation of nucleocapsid and spike protein-based elisas for detecting antibodies against sars-cov- reinfection could not occur in sars-cov- infected rhesus macaques diagnostic testing for severe acute respiratory syndrome-related coronavirus- : a narrative review covid- : a recommendation to examine the effect of hydroxychloroquine in preventing infection and progression new insights on the antiviral effects of chloroquine against coronavirus: what to expect for covid- ? lymphopenia predicts disease severity of covid- : a descriptive and predictive study hydroxychloroquine and azithromycin as a treatment of covid- : results of an open-label non-randomized clinical trial systematic review and meta-analysis of the effectiveness and safety of hydroxychloroquine in covid- association of treatment with hydroxychloroquine or azithromycin with in-hospital mortality in patients with covid- in new york state interim guidelines for clinical management of sars-cov- infection role of lopinavir/ritonavir in the treatment of sars: initial virological and clinical findings screening of an fda-approved compound library identifies four small-molecule inhibitors of middle east respiratory syndrome coronavirus replication in cell culture treatment with lopinavir/ritonavir or interferon-beta b improves outcome of mers-cov infection in a nonhuman primate model of common marmoset combination therapy with lopinavir/ritonavir, ribavirin and interferon-alpha for middle east respiratory syndrome a trial of lopinavir-ritonavir in adults hospitalized with severe covid- efficacy and safety of ivermectin against dengue infection: a phase iii, randomized, double-blind, placebo-controlled trial the fda-approved drug ivermectin inhibits the replication of sars-cov- in vitro comparative therapeutic efficacy of remdesivir and combination lopinavir, ritonavir, and interferon beta against mers-cov remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus ( -ncov) in vitro prophylactic and therapeutic remdesivir (gs- ) treatment in the rhesus macaque model of mers-cov infection experimental treatment with favipiravir for covid- : an open-label control study favipiravir versus arbidol for covid- : a randomized clinical trial ebola virus infection: review of the pharmacokinetic and pharmacodynamic properties of drugs considered for testing in human efficacy trials perspectives on therapeutic neutralizing antibodies against the novel coronavirus sars-cov- deployment of convalescent plasma for the prevention and treatment of covid- effectiveness of convalescent plasma therapy in severe covid- patients treatment of critically ill patients with covid- with convalescent plasma favipiravir versus arbidol for covid- : a randomized clinical trial plcgamma /tmem dependent pathway in myeloid cells modulates the pathogenesis of cytokine storm syndrome pathological findings of covid- associated with acute respiratory distress syndrome dysregulation of immune response in patients with covid- in wuhan, china fda approval summary: tocilizumab for treatment of chimeric antigen receptor t cell-induced severe or life-threatening cytokine release syndrome effectiveness of convalescent plasma therapy in severe covid- patients diagnostic utility of clinical laboratory data determinations for patients with the severe covid- can we use interleukin- (il- ) blockade for coronavirus disease (covid- )-induced cytokine release syndrome (crs)? tocilizumab treatment in covid- : a single center experience structural basis of influenza virus fusion inhibition by the antiviral drug arbidol antiviral activity of arbidol and its derivatives against the pathogen of severe acute respiratory syndrome in the cell cultures borneol and poly (ethylene glycol) dual modified bsa nanoparticles as an itraconazole vehicle for brain targeting antimicrobial properties of benzalkonium chloride derived polymerizable deep eutectic solvent simultaneous treatment of human bronchial epithelial cells with serine and cysteine protease inhibitors prevents severe acute respiratory syndrome coronavirus entry cell entry depends on ace and tmprss and is blocked by a clinically proven protease inhibitor mrna vaccines -a new era in vaccinology new vaccine technologies to a dna vaccine induces sars coronavirus neutralization and protective immunity in mice safety and immunogenicity of an anti-middle east respiratory syndrome coronavirus dna vaccine: a phase , open-label, single-arm, dose-escalation trial inactivated whole virus influenza a (h n ) vaccine formaldehyde-inactivated whole-virus vaccine protects a murine model of enterovirus encephalomyelitis against disease immunization with inactivated middle east respiratory syndrome coronavirus vaccine leads to lung immunopathology on challenge with live virus rapid development of an inactivated vaccine for sars-cov- . biorxiv developments in viral vector-based vaccines efficacy trial of a dna/rad hiv- preventive vaccine a human type adenovirus-based tuberculosis vaccine induces robust t cell responses in humans despite preexisting anti-adenovirus immunity a novel chimpanzee adenovirus vector with low human seroprevalence: improved systems for vector derivation and comparative immunogenicity integrase defective lentiviral vector as a vaccine platform for delivering influenza antigens alteration of t cell immunity by lentiviral transduction of human monocyte-derived dendritic cells feeding of bifidobacterium bifidum and streptococcus thermophilus to infants in hospital for prevention of diarrhoea and shedding of rotavirus lactobacilli and bifidobacteria enhance mucosal b cell responses and differentially modulate systemic antibody responses to an oral human rotavirus vaccine in a neonatal gnotobiotic pig disease model oral administration of genetically modified bifidobacterium displaying hcv-ns multi-epitope fusion protein could induce an hcv-ns -specific systemic immune response in mice oral immunization of mice using bifidobacterium longum expressing vp protein from enterovirus antibody-dependent enhancement of ebola virus infection by immunity to dengue virus: a tale of original antigenic sin and tropical cytokine storms antibody-dependent enhancement of severe dengue disease in humans evasion of antibody neutralization in emerging severe acute respiratory syndrome coronaviruses antibody-dependent infection of human macrophages by severe acute respiratory syndrome coronavirus immunodominant sars coronavirus epitopes in humans elicited both enhancing and neutralizing effects on infection in non-human primates an effective cancer vaccine modality: lentiviral modification of dendritic cells expressing multiple cancer-specific antigens the bcg world atlas: a database of global bcg vaccination policies and practices trained immunity: a program of innate immune memory in health and disease bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity non-specific effects of bcg vaccine on viral infections heterologous immunological effects of early bcg vaccination in low-birth-weight infants in guinea-bissau: a randomized-controlled trial the efficacy of bacillus calmette-guerin vaccinations for the prevention of acute upper respiratory tract infection in the elderly long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study association of bcg vaccination policy with prevalence and mortality of covid- tokyo- bcg vaccination complications response to covid- in taiwan: big data analytics, new technology, and proactive testing influenza vaccination generates cytokine-induced memory-like nk cells: impact of human cytomegalovirus infection bacille calmette-guerin vaccine strain modulates the ontogeny of both mycobacterial-specific and heterologous t cell immunity to vaccination in infants antibodies against trimeric s glycoprotein protect hamsters against sars-cov challenge despite their capacity to mediate fcgammarii-dependent entry into b cells in vitro key: cord- -uya j u authors: bodova, k.; boza, v.; brejova, b.; kollar, r.; mikusova, k.; vinar, t. title: time-adjusted analysis shows weak associations between bcg vaccination policy and covid- disease progression date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: uya j u in this study, we ascertain the associations between bcg vaccination policies and progression of covid- through analysis of various time-adjusted indicators either directly extracted from the incidence and death reports, or estimated as parameters of disease progression models. we observe weak correlation between bcg vaccination status and indicators related to disease reproduction characteristics. we did not find any associations with case fatality rates (cfr), but the differences in cfr estimates are at present likely dominated by differences in testing and case reporting between countries. the reports on a possible use of the well-established and widely used bcg vaccine as a protection against covid- (de vrieze, ) raised a lot of interest and media coverage. currently, four clinical trials have been designed to evaluate the potential of bcg for protection against the sars-cov- infection in health-care workers (bonten, ; khattab, ; curtis, ; cirillo and dinardo, ) . these studies are driven by the so called non-specific effects of bcg vaccine on viral infections, observed in animal models, as well as in humans, although the molecular basis of this phenomenon is not completely understood (moorlag et al., ) . the associations between bcg vaccination policy and covid- disease progression have also been a subject to controversy in data analysis, with some studies claiming significant effects on the number of cases and case fatality rates (miller et al., ; berg et al., ) , while others criticizing weaknesses of those studies and claiming no statistically significant differences (szigeti et al., ; hensel et al., ; fukui et al., ; singh, ) . while correcting for many covariate factors (such as population size, population age distribution, etc.), most of these studies, however, failed to correct for the differences in time progression of the epidemics in each country. covid- epidemic usually starts from relatively few imported cases and spreads quickly through exponential growth with high reproduction numbers. at unchecked growth rates, a significant percentage of the country population would be infected before the disease would subside. however, this growth rate only continues until effective measures, such as lockouts or social distancing policies, are introduced, changing the dynamics of the epidemics substantially, with infection rates rarely reaching a significant percentage of the whole population in the first wave flaxman et al. ( ) . in this study, we have estimated a variety of indicators characteristic for different stages of covid- epidemics, also adjusting for time since the beginning of the epidemics in each country, and found that several key indicators show weak, but statistically significant, associations with bcg vaccination status. figure : comparison of estimated reproduction numbers r (left) and r + (right) between countries with and without the universal bcg vaccination policy. to compare the covid- disease progression between countries with recent universal bcg vaccination policy and those without, several parameters derived from the case and death reports in each country were selected. the parameters reflect early-stage disease spread characteristics (when they are likely not yet affected by social distancing policies), early-stage case fatality rates (before potential effects from overwhelmed health care system), and progression of the disease after the changes characteristic for social distancing policies take effect. estimates of early stage r are lower in countries with recent bcg vaccination policies. the reproduction number r, the average number of secondary cases of disease caused by a single infected individual, has been estimated using epiestim package (cori et al., ) , based on -day windows, the first estimate starting on the day when cumulative number of reported cases have been reached (r ), the second estimate starting on th day afterwards (r + ). in many countries, this time period would not reflect the effects of social distancing policies, but would also somewhat avoid the initial period when the case reporting is likely to be unreliable. in both cases, the countries with recent bcg vaccination policies show lower r estimates ( figure ) and these shifts were statistically significant (mann whitney u-test, p = . for r and p = . for r + ). we have also examined the number of days between and reported cases (c ), and reported cases (c ), and reported deaths (d ), and and reported deaths (d ). these time periods reflect r in various early stages of the epidemic, longer periods meaning slower spread of the disease. note, that c numbers are likely unreliable (due to initial problems in establishing testing and reporting policies in each country), and there are only few countries that reached reported deaths before our data set cutoff. also note that if we assume a constant case fatality rate within a specific time period (typically - days) and a specific country, and also assume exponential growth in cases within this time period, the numbers d and d do not actually reflect the death rate, but instead only depend on the underlying value of r. death reports are likely more accurate than case reports, which are much more affected by testing and reporting policies in each country. on average, all of these time periods are slightly longer in countries with recent universal bcg policies, with statistically significant results for d (mann-whitney u-test, p = . ). no differences in case fatality rates. we have estimated case fatality rates on days when and cumulative deaths were first reached in each country (cfr and cfr respectively), and also used cmmid methodology (nishiura et al., ; russel et al., ) to correct for estimation of active cases (ccfr and ccfr ) . while some small shifts were observed between countries with and without recent universal bcg vaccination policies (see supplementary material), these shifts are not statistically significant. significant differences in the coefficients of the vazquez model. one of the difficulties in modelling and predicting the extent of the coronavirus spreading in a population is the divergence of the observed data (the number of confirmed active cases in individual countries) from the trends expected from the traditional sir type models. ziff and ziff ( ) have recently observed that deaths in china do not follow the typical epidemiological curve and instead of an exponential growth they follow a combined polynomial growth with exponential decay (pged). polynomial growth has been also confirmed for multiple other countries (merrin, ) and even though the initial spread in many countries is approximately exponential, it is followed by a steady polynomial growth and in a longer run by an exponential decay (komarova and wodarz, ) . for a possible explanation of the transition from exponential to polynomial growth, it is natural to look into self-imposed or government-imposed social distancing measures. these measures transform the structure of virus transmitting contact networks in a population, possibly to small-world network structures or even fractal networks. in contrast to small-world networks, social networks under standard conditions contain a significant fraction of nodes with high number of connections (that correspond to potential superspreaders). interestingly, polynomial growth of the number of infections in time in well connected scale-free networks emerges naturally as a consequence of infection initially reaching the highly connected nodes and their neighbors, while their isolation or recovery significantly reduces the interconnectivity of the residual network (szabó, ) . theoretical study of the infection spread in scale-free networks by vazquez ( ) leads to an explicit formula for the number of infected individuals in time in a form of pged. the formula contains three key parameters: p -the coefficient of the polynomial growth (not necessary an integer), τ -the rate of decay of the exponential tail ( /τ is an analogue to the rate of removal of individuals from the infected class to inactive recovered class in the traditional sir-type models), and a -the constant prefactor (scaling the total population). based on the value of these parameters, it is straightforward to determine nmax, the number of infected at the peak of the epidemic, which is independent of the choice of the reference time for the start of the infection. these parameters were obtained by the best fit on the linear scale to the data in each of the considered countries/regions. interestingly, we have found that the parameters τ and nmax significantly differ between countries split into two groups-with and without recent universal bcg vaccination policies ( figure ). the τ parameter shifts to the higher values, signifying higher recovery rate in the countries with recent universal bcg vaccination policies (mann-whitney u-test p = . ). in addition, these countries have generally lower numbers of infected cases at the peak of the epidemic (nmax) corrected for underreporting (mann-whitney u-test p = . ). east and west germany. the case of germany is interesting, since the country has been split into east and west germany in and reunited in . in east germany, the policies regarding bcg vaccination followed eastern bloc practices, with universal vaccination policy in place between and . in west germany, the vaccination has been introduced in , but in it was discontinued in favor of vaccinating high risk groups only. [the information has been reconstructed from the notes in bcg atlas, however we were not able to confirm this from other sources.] in the present crisis, the whole germany follows similar practices in case reporting and treatment of the disease. interestingly, east germany exhibits much lower estimates of r than west germany at the corresponding phases of the epidemic (r = . , r + = . in east germany vs. r = . , r + = . in west germany; see also figure ). also, the death rate from covid- seems to be significantly lower in east germany, even when correcting for differences in age distribution (table ). while some of the previous studies have observed associations between bcg vaccination policy and spread of covid- (miller et al., ; berg et al., ) , others criticized their work and showed . cc-by . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . ( ). most of these studies have used indicators that were quite straightforward, such as the number of reported cases per million inhabitants on a particular date. here, we have instead chosen a variety of indicators that reflect characteristics of various phases of the epidemics in each country, and moreover, these indicators were implicitly or explicitly adjusted according to the time from the beginning of the epidemic in each country. in fact, we hypothesize that such time adjustment is one of the key factors in such an analysis considering what we know about the spread of covid- . in our data, we have observed several statistically significant associations, and we conclude that there is an association between bcg vaccination policy and spread of covid- . however, whether this association is causal or is merely an observed correlation due to some other common factor, is impossible to say. moreover, most observed shifts in various coefficients are rather small and while the universal bcg vaccination policy may have had a positive impact in some of the countries, the observed impact clearly cannot replace effective policies such as lockdowns and social distancing measures which currently constitute the most effective weapon against the epidemic. at best, the existence of universal bcg vaccination policy may have provided a few days time for governments to effectively institute such policies. one of the interesting observations is that we did not find any correlation between bcg vaccination policy and cfr. while this may suggest a hypothesis that bcg vaccination may help to limit spread, but may not be effective against difficult progression of the disease in susceptible individuals, we would . cc-by . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . reproduction numbers r were estimated using seven day windows using smoothed incidence numbers. be careful to draw such conclusions. this is because the estimates of cfr are clearly unreliable at this point of time, with many countries showing cfr estimates well over %. likely, huge differences between countries do not reflect real differences in outcomes of the disease, but rather discrepancies in the amount and effectiveness of testing, with many light or asymptomatic cases remaining undetected. in fact, such a conclusion is partly supported by the evidence from east/west germany, where we can assume consistent reporting of cases and outcomes, and where differences in cfr seem to be consistent with historical differences in bcg vaccination policies, even after correcting for differences in the age distribution of the population. obtaining case and death reports. the information on reported cases, deaths, and recoveries related to covid- assembled by john hopkins university center for system science and engineering (dong et al., ) has been downloaded from humanitarian data exchange (humanitarian data exchange, ) on april , . the data set covers reports from countries from january , until april , . for further analysis, only countries with at least reported cumulative deaths have been retained. we also used the data set for germany maintained by robert koch institute, containing reported cases, deaths, and recoveries split geographically and into age groups; the data set was downloaded through arcgis (robert koch-institut and bundesamt für kartographie und geodäsie, ). for our analysis, the data were split geographically into east germany (brandeburg, mecklenburg-vorpommern, sachsen, sachsen-anhalt, thüringen, and berlin) and west germany (schleswig-holstein, hamburg, niedersachsen, bremen, nordrhein-westfalen, hessen, rheinland-pfalz, baden-württemberg, bayern, and saarland). bcg status of individual countries. for countries included in the study, we have assembled information from the bcg world atlas (zwerling et al., ) and from the who-unicef estimates of bcg coverage (world health organization, ) (see supplementary materials). based on this information, the countries were divided into positive bcg status (the countries with current universal bcg vaccination policy and countries with past universal policies discontinued after or with recent reports of high vaccination coverage from who) and negative bcg status (the countries without universal bcg . cc-by . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . vaccination policy and those that discontinued universal bcg policies and did not satisfy the above conditions). estimation and extraction of indicators. the indicators were extracted from the time series data sets using simple scripts, as outlined in the results (see supplementary material for tables). all of the indicators are computed in time that is relative to a particular milestone, i.e. reaching a particular cumulative number of case reports or death reports. in this way, compared indicators are synchronized at a particular stage of the epidemic. since the number of cases and deaths is highly dependent on the stage of the epidemic, using such synchronized indicators is a key in our analysis. case fatality rate indicators cfr and cfr were computed on the days when the cumulative number of reported deaths surpassed and respectively; the cumulative number of deaths was divided by the cumulative number of reported cases days prior to that date. as alternative indicators for case fatality rates, denoted as ccfr and ccfr , we have used methodology established by the centre for the mathematical modelling of infectious diseases (nishiura et al., ; russel et al., ) , systematically compensating for confirmation-to-death delay using lognormal distribution with mean delay of days and a standard deviation of . days (linton et al., ) . regardless of the method, the main problem with cfr indicators is inconsistent reporting on the number of cases in different countries, as this depends highly on testing strategy, reporting methodology, as well as testing capacities of individual countries. thus, cfr estimates are likely dominated by these factors. we are not aware of any simple method that could overcome this problem at this point of time. note that indicators d (time from death reports to death reports) and d (time from death reports to death reports), even though based on the numbers of reported deaths, are unlikely to reflect cfr, but instead simply serve as more stable estimates reflecting the underlying reproductive number r. this is because if we assume exponential growth phase and a constant cfr over this period of time, the cfr coefficient will cancel out in the computation of the expected number of days to reach -fold increase in the number of deaths. indicators r and r + were computed using epiestim r package (cori et al., ) . this method is based on bayesian inference, modelling new infections as a poisson process with rate governed by the instantaneous reproduction number and the number and total infectiousness of infected individuals at the current time interval. the instantaneous reproduction number has a gamma-distributed prior and during the inference is assumed to be constant within each seven-day sliding window to yield an estimate at the end of the window. the infectiousness is approximated by the distribution of the serial interval, which is defined as the time between the onset of symptoms of a case and the onset of symptoms of secondary cases infected by the primary case. following previous work (churches, ) , we have set the distribution of serial intervals as a discrete gamma distribution with mean of days and standard deviation of . days. here, we concentrated on monitoring early stages of the epidemic in each country, when such simple exponential growth model is relatively accurate representation of the spread of the disease. moreover, the estimated values are used mostly in the non-parametric mann-whitney test, which only considers their relative ordering, not exact values. to avoid initial uncertainty in the reproductive number estimates due to small numbers of case reports, and to adjust for the differences in the start date of epidemics in each country, the seven-day interval for the first estimate (r ) starts on the day when cases have been reported and the second estimate (r + ) is taken days later. the case incidence numbers have been smoothed over a window of days in order to account for differences in testing procedures on different days of the week (i.e. no or little testing over the weekend in many countries). such smoothing will not affect the parameters of exponential growth models. it has been verified that confidence intervals at chosen points of time are not unproportionally large. application of vazquez model. the number of infected individuals in the vazquez model (vazquez, ; ziff and ziff, ) has the form where a, p, and τ are parameters and t = (units are days) corresponds to the first day of an infection. in practice, the available data does not report the number of infected individuals in the population due to . cc-by . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . limited testing availability and potential testing errors. therefore we use the total number of active cases (confirmed -recovered -deaths) as a proxy for the total number of infected individuals. in countries with sufficient testing, we assume that the identified active cases represent a constant fraction of the total active cases and the formula for n(t) differs only in the constant factor a. we used a nonlinear least squares method to infer the parameters in the above relationship from the data. however, instead of directly fitting the parameters a, p, and τ , we used an equivalent formulation n(t) = nmax · t tmax p · e p( −t/tmax) , with parameters nmax (the maximal number of active cases during the infection), p (the power of the polynomial growth term), and tmax = p * τ (the time when the peak is reached). for consistency, we have truncated the data to reduce the impact of testing irregularities during the initial onset of epidemic. therefore we start the data from the day when a certain number of active cases n a was reached. the threshold n a was chosen in proportion to the population in the country to reduce effects of randomness in reporting and to account for the spreading potential. italy served as the reference with a threshold of cases (threshold chosen was always at least ). mandated bacillus calmette-guérin (bcg) vaccination predicts flattened curves for the spread of covid- reducing health care workers absenteeism in covid- pandemic through bcg vaccine (bcg-corona) covid- epidemiology with r. r views, an r community blog edited by rstudio bcg vaccine for health care workers as defense against covid (badas) a new framework and software to estimate time-varying reproduction numbers during epidemics bcg vaccination to protect healthcare workers against covid- (brace) can a century-old tb vaccine steel the immune system against the new coronavirus? science an interactive web-based dashboard to track covid- in real time report : estimating the number of infections and the impact of non-pharmaceutical interventions on covid- in european countries does tb vaccination reduce covid- infection?: no evidence from a regression discontinuity analysis exercising caution in correlating covid- incidence and mortality rates with bcg vaccination policies due to variable rates of sars cov- testing johns hopkins university novel coronavirus (covid- ) cases data application of bcg vaccine for immune-prophylaxis among egyptian healthcare workers during the pandemic of covid- patterns of the covid epidemic spread around the world: exponential vs power laws incubation period and other epidemiological characteristics of novel coronavirus infections with right truncation: a statistical analysis of publicly available case data differences in power-law growth over time and indicators of covid- pandemic progression worldwide correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study non-specific effects of bcg vaccine on viral infections early epidemiological assessment of the virulence of emerging infectious diseases: a case study of an influenza pandemic csv mit den aktuellen covid- infektionen pro tag (zeitreihe) using a delay-adjusted case fatality ratio to estimate under-reporting. available at the centre for mathematical modelling of infectious diseases repository bcg vaccines may not reduce covid- mortality rates propagation and mitigation of epidemics in a scale-free network bcg protects against covid- ? a word of caution polynomial growth in branching processes with diverging reproductive number who-unicef estimates of bcg coverage fractal kinetics of covid- pandemic the bcg world atlas: a database of global bcg vaccination policies and practices key: cord- - xen nlm authors: joy, melvin; malavika, b.; asirvatham, edwin sam; sudarsanam, thambu david; jeyaseelan, l. title: is bcg associated with reduced incidence of covid- ? a meta-regression of global data from countries date: - - journal: clin epidemiol glob health doi: . /j.cegh. . . sha: doc_id: cord_uid: xen nlm background: global research is running towards to find a vaccine to stop the threat of the covid- . the bacillus calmette–guérin (bcg) vaccine that prevents severe forms of tuberculosis is getting more attention in this scenario. the objective of our study was to determine the association between bcg vaccine coverage and incidence of covid- at a national-level across the globe. methods: the data of countries were included in the study. meta-regression was done to estimate the difference in the incidence of covid- cases between countries with bcg vaccination coverage. bcg coverage was categorized as ≤ %, > % and no vaccination. the analyses were carried out by adjusting for factors such as population density, income group, latitude, and percentage of the total population under age groups – and above years of each country. results: the countries that had ≤ % coverage of bcg vaccine reported . ( % ci: − . to − . ) less covid- infections per , population as compared to countries that reported no coverage. those that had > % coverage reported . ( % ci: − . to − . ) less infections per , population compared to those with no bcg countries. conclusion: our analysis suggests that bcg is associated with reduced covid- infections if the bcg vaccine coverage is over %. the region-wise analyses also suggested similar findings, except the middle east and north african region. there is evidence that the bcg (bacillus calmette guerin) vaccine has been associated with beneficial, non-specific effects on the immune system. studies suggest that the bcg vaccine induces the innate immune response which might reduce viraemia after exposure, leading to less severe covid- and more rapid recovery. a randomized control trial suggests that bcg vaccine reduces mortality, attributable to protection against respiratory infections, as well as neonatal sepsis. data on bcg vaccination status when analysed at a national-level along with incident cases of covid- , can give us an ecological idea of a possible protective effect, if any. the objective of our study was to determine the association between bcg vaccine coverage and incidence of covid- at a national-level across the globe. country level data on covid- confirmed cases were obtained from european center for disease control & prevention (ecdc). data on bcg vaccination coverage was obtained from the who global health observatory. the data related to other covariates were obtained from united nations, department of economic and social affairs database. we included countries that reported official data on bcg vaccination coverage (%) and covid- confirmed cases until may , . meta-regression was done to estimate the difference in the incidence of covid- cases between countries with bcg vaccination coverage. bcg coverage was categorized as ≤ %, > % and no vaccination. we adjusted for population density, income group, latitude, and percentage of the total population under age groups - and above https://doi.org/ . /j.cegh. . . received july ; received in revised form august ; accepted august years. the regression coefficients were presented in terms of number of cases per population with % confidence interval by inverse variance method with random effect model, using the dersimonian-laird estimator for τ . statistical analyses were performed using stata software, version . (statacorp llc). of the countries for whom bcg vaccination coverage data is available, ( . %) did not use bcg, . % had a coverage of ≤ % and % had > % coverage ( table ). the countries that had ≤ % coverage of bcg vaccine reported . ( % ci: − . to − . ) less covid- infections per , population as compared to countries that reported no coverage (p < . ). those that had > % coverage reported . ( % ci: − . to − . ) less infections per , population compared to those with no bcg countries (p < . ). irrespective of the level of coverage, the east asia and pacific region countries reported less infections per , population, as compared to countries without bcg vaccination strategy. europe and central asian countries that had > % coverage, had . ( % ci: − . to − . ) less infections per , population compared to no coverage (p < . ). the latin america and caribbean countries that had > % coverage reported . ( % ci: − . to . ) per , less infections as compared to countries with no coverage. the middle east and north african countries, however, showed that those with > % bcg coverage had a higher number of infections as compared to no coverage. high-income countries, with > % coverage, had . ( % ci: − . to − . ) less number of infections per , population (p < . ) as compared to no coverage. randomized trials of bcg vaccine prophylaxis against covid- would be ideal. the who clinical trials portal reveals such ongoing trials (nct , nct , euctr - - -gr, irct n and nl ). till these trial results are available, our meta-regression of country level data will give policy makers some idea of potential benefit of bcg vaccination in preventing covid- . our analysis suggests that bcg is associated with reduced covid- infections if the bcg vaccine coverage is over %. the region-wise analyses also suggested similar findings, except the middle east and north african region. a large cohort from this region found no protective effect. the spread of covid- in the middle east region is particularly alarming as these countries have continuously been considered as a hotspot for infectious diseases. the countries in this region are having larger number of international travelers every year for tourism, business, and pilgrimage. this population by genetics has higher prevalence for diabetes and hypertension that are risk factors for covid- disease. concluding that bcg protects an individual against covid- may be an ecological fallacy. but this study adds impetus for us to carefully study the data from the ongoing bcg trials for making any policy and programmatic decisions. this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. not required. none of the authors have conflicts of interest to report. considering bcg vaccination to reduce the impact of covid- bcg-induced trained immunity: can it offer protection against covid- ? randomized trial of bcg vaccination at birth to lowbirth-weight children: beneficial nonspecific effects in the neonatal period? european centre for disease prevention and control world health organization. global health observatory united nations, department of economics and social affairs, population division sars-cov- rates in bcg-vaccinated and unvaccinated young adults emerging and reemerging diseases in the world health organization (who) eastern mediterranean region-progress, challenges, and who initiatives. front public health coronavirus disease (covid- ) in the middle east: a call for a unified response. front public health key: cord- -hw swbt authors: o’neill, luke a. j.; netea, mihai g. title: bcg-induced trained immunity: can it offer protection against covid- ? date: - - journal: nat rev immunol doi: . /s - - -y sha: doc_id: cord_uid: hw swbt bacillus calmette–guérin (bcg) vaccination has been reported to decrease susceptibility to respiratory tract infections, an effect proposed to be mediated by the general long-term boosting of innate immune mechanisms, also termed trained immunity. here, we discuss the non-specific beneficial effects of bcg against viral infections and whether this vaccine may afford protection to covid- . covid- is a new form of respiratory tract infection that can be complicated by severe pneumonia and acute respiratory distress syndrome (ards). it is caused by a newly identified viral pathogen named on february as severe acute respiratory syndrome coronavirus (sars-cov- ). most individuals infected with sars-cov- remain asymptomatic or develop a mild-to-moderate disease that is mainly characterized by upper respiratory tract symptoms. however, a significant minority of patients progress to severe pneumonia with ards, respiratory insufficiency and even death, particularly older patients . at the time of writing, sars-cov- has killed more than , people, with over million infected, and has given rise to a global economic shutdown, which is predicted to lead to a depression more serious than the great depression of the s. while aggressive containment measures have been initiated by many parts of the world, the number of cases is still rising, with europe and the united states now being the hot spots of the pandemic, but with an increasing number of cases in developing countries, stoking fears of a severe global health crisis. it is expected that the infection will remain entrenched in the population in the years to come, with regular outbreaks when quarantine measures are relaxed, or during winter when spread might be more common. only an effective vaccine can curb the spread of the virus but that is expected to take at least - months to develop. in the meantime, other measures for preventing the spread of the virus are urgently needed. the bcg vaccine may well be a bridge to a specific covid- vaccine. bacillus calmette-guérin (bcg) is a live attenuated vaccine that was developed against tuberculosis at the beginning of the th century at the institut pasteur in paris. since then, it has been the most used vaccine in the world, with around million children vaccinated every year. interestingly, however, soon after its introduction in europe in the s, epidemiological studies reported that bcg vaccination strongly reduced infant mortality, and this could not be explained by a reduction in tuberculosis alone (reviewed previously ). later on, similar studies in other locations, including randomized controlled trials, showed an up to % reduction of mortality induced by bcg in young infants . this reduction in childhood mortality by bcg appeared to be due to the protection against unrelated infectious agents and especially respiratory tract infections and neonatal sepsis. although the authors did not discriminate between bacterial and viral infections in these studies, it is well known that viral pathogens are the main cause of respi ratory tract infections in children. this hypothesis was strengthened by a study in guinea-bissau showing that bcg reduced the incidence of respiratory syncytial virus infection . a similar protective effect of bcg on respiratory tract infections was found in older indivi duals in indonesia , and a clinical trial performed in japan demonstrated protection against pneumonia in tuberculin-negative older individuals . last, a recent study in adolescents in south africa also reported a % reduction of respiratory tract infections by bcg vaccination . figure a illustrates the range of viral infections that bcg vaccination has been shown to protect against. these clinical trials have been complemented by experimental studies trying to decipher the mechanisms through which bcg induces these protective effects. spencer et al. showed that bcg reduced viral titres of influenza a virus in mice, an effect dependent on macrophages. bcg vaccination also protected from herpes simplex virus type (hsv ) in a controlled infection model with newborn mice , while subcutaneous administration of muramyl dipeptide (mdp), a component of the mycobacterial cell wall, protected against vaccinia virus and hsv infections in mice . this effect was mediated by peritoneal macrophages bacillus calmette-guérin (bcg) vaccination has been reported to decrease susceptibility to respiratory tract infections, an effect proposed to be mediated by the general long-term boosting of innate immune mechanisms, also termed trained immunity. here, we discuss the non-specific beneficial effects of bcg against viral infections and whether this vaccine may afford protection to covid- . of host defence. in line with this, a recent murine study showed that intravenous bcg delivery led to increased cytokine production by both splenocytes and peritoneal macrophages upon ex vivo restimulation with various unrelated pathogens. the cellular and molecular mechanisms responsible for these beneficial effects of bcg against viral infection have been studied in detail only in the last decade . bcg vaccination of healthy human volunteers results in enhanced production of pro-inflammatory cytokines, such as il- β, tumour necrosis factor (tnf) and il- , when monocytes from these individuals are stimulated ex vivo with unrelated pathogens . interestingly, these effects are accompanied by transcriptional, epigenetic and metabolic reprogramming of the myeloid cells in the bcg-vaccinated individuals. the epigenetic changes are manifested as chemical modifications (methylation and acetylation) of the histone, resulting in enhanced chromatin accessibility, easier transcription of genes important for antimicrobial responses and improved cell function . in addition, metabolic reprogramming leads to selective accumulation or depletion of certain metabolites that regulate this process, owing to their function as cofactors for several classes of enzymes that mediate the epigenetic changes (fig. b) . the long-term changes seen in innate immune cell phenotypes after bcg vaccination amount to a de facto induction of innate immune memory, which has been termed trained immunity. it has been hypothesized that induction of trained immunity is at least partly the mechanism through which bcg vaccination induces its beneficial effects. the idea here is that bcg leads to epigenetically trained populations of monocytes and/or natural killer cells, which most likely reside in the bone marrow. upon challenge with pathogen-associated molecular patterns (pamps; which could be from bacteria or viruses) these innate immune cells then show an enhanced response, promoting host defence. this might explain why a vaccine for tuberculosis leads to protection against multiple pathogens. in a recent study in healthy human volunteers, it has been shown that bcg vaccination reduces viraemia in response to the yellow fever vaccine (which is a live attenuated vaccine). this response is associated with epigenetic changes in monocytes that correlate with improved antiviral responses . taken together, these findings suggest that the induction of trained immunity by bcg vaccination results in significant protection against multiple viral infections. on the basis of these data, it has been hypothesized that bcg vaccination might be a potent preventive measure against sars-cov- infection and/or may reduce covid- disease severity. ecological studies have suggested that countries and regions that mandate bcg vaccination for the population have a lower number of infections and a reduced mortality from covid- (ref. ). while these data could indeed suggest a protective effect of bcg vacci nation, such studies cannot provide definitive proof of causality, owing to several inherent biases. these include differences in, one, demographic and genetic structure of the populations in different locations; two, differences in the non-pharmaceutical interventions being adopted in different locations (such as quarantine or social distancing); three, differences in diagnosing and reporting covid- cases; and, four, differences in the positions on the epidemic curve of each location. notwithstanding these issues, the link to bcg and covid- from these studies is intriguing. it is not known whether older people would maintain a pool of trained monocytes many years after bcg vacci nation. a possible explanation is that children who have been vaccinated with bcg are less susceptible to infection with sars-cov- and so there is less spread of the virus bcg vaccination epigenetic reprogramming of monocytes will it protect against severe acute respiratory syndrome coronavirus (sars-cov- )? b | trained immunity leading to enhanced innate immune responses to different pathogens after a vaccination is mediated by metabolic and epigenetic rewiring in innate immune cells, which leads to increased gene transcription and improved host defence. c | trained immunity as a tool for enhancing population immunity during a pandemic ahead of the availability of a specific vaccine. tnf, tumour necrosis factor. to older populations, although this would need to be demonstrated. because of these important limitations, randomized controlled trials are needed to provide the highest quality proof for the hypothesis that bcg vaccination may protect against covid- . given the immediate threat of the sars-cov- pandemic, trials should be designed and started as pragmatic studies with feasible primary end points that can be performed rapidly and that could provide results in a short period. it is reasonable to propose that these are first initiated in populations at high risk of infection or with a high risk of mortality, such as hospital staff working in close contact with patients with covid- or older individuals. indeed, trials assessing the efficacy of bcg vaccination in these categories of individuals are currently being performed in the netherlands, australia and greece, while other trials are being planned in the united states, uk, denmark, france, uruguay, tanzania, uganda and south africa. this is a remarkable turn of events and reflects the seriousness of covid- for global health. one important aspect relates to the boosting of the innate immune response by bcg. might this be deleterious, considering the fact that an exaggerated cytokine response has been associated with complications in patients with covid- (ref. )? we would argue that in healthy individuals vaccinated with bcg, in which innate antimicrobial mechanisms would be boosted by trained immunity, this is most likely to lead to inhibited viral replication, decreased viral loads and subsequently less inflammation and symptoms. this hypothesis is supported by the decrease in viraemia seen following yellow fever vaccination of individuals who were previously vaccinated with bcg . by contrast, an initial defective antiviral response in some individuals at high risk (for example, older individuals) can result in high viral loads, stimulation of an inefficient systemic inflammation and severe disease. breaking the loop of systemic inflammation could have beneficial effects in these patients. we thus propose that induction of trained immunity by bcg could provide protection against covid- , but this hypothesis needs to be tested in rigorous randomized clinical trials. the use of approaches to induce trained immunity for protection against covid- may not be restricted to bcg: indeed, there is speculation that oral polio vaccine might protect against non-related viral infections, and the new recombinant bcg-based vaccine vpm may have similar effects and is also being considered for clinical trials. one could finally envisage using trained immunity as an important tool against emerging pathogens. bcg (or other stimuli that induce trained immunity) could be rapidly tested and eventually used at the beginning of a pandemic, bridging the - year period until a specific vaccine can be developed (fig. c) . indeed, although it is likely we will have a vaccine for sars-cov- within this time frame, it is not guaranteed. this prospect therefore carries particular force currently, where there is a desperately urgent need to develop strategies to restrain sars-cov- and limit the pandemic, which has put one-third of the earth's population under quarantine. clinical features of patients infected with novel coronavirus in wuhan the non-specific effects of vaccines randomized trial of bcg vaccination at birth to low-birth-weight children: beneficial nonspecific effects in the neonatal period? acute lower respiratory tract infections and respiratory syncytial virus in infants in guinea-bissau: a beneficial effect of bcg vaccination for girls community based case-control study the efficacy of bacillus calmette-guerin vaccinations for the prevention of acute upper respiratory tract infection in the elderly prevention of elderly pneumonia by pneumococcal, influenza and bcg vaccinations prevention of m. tuberculosis infection with h :ic vaccine or bcg revaccination nonspecific protection of mice against influenza virus infection by local or systemic immunization with bacille calmette-guerin effects of immunostimulants on resistance of newborn mice to herpes simplex type infection enhancement of non-specific resistance to viral infection by muramyldipeptide and its analogs non-specific effects of bcg vaccine on viral infections bacille calmette-guerin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes trained immunity: a program of innate immune memory in health and disease bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity is global bcg vaccination-induced trained immunity relevant to the progression of sars-cov- pandemic? covid- : consider cytokine storm syndromes and immunosuppression the authors contributed equally to all aspects of the article. the authors declare no competing interests. key: cord- -duhyb authors: urashima, mitsuyoshi; otani, katharina; hasegawa, yasutaka; akutsu, taisuke title: bcg vaccination and mortality of covid- across countries: an ecological study date: - - journal: int j environ res public health doi: . /ijerph sha: doc_id: cord_uid: duhyb ecological studies have suggested fewer covid- morbidities and mortalities in bacillus calmette–guérin (bcg)-vaccinated countries than bcg-non-vaccinated countries. however, these studies obtained data during the early phase of the pandemic and did not adjust for potential confounders, including pcr-test numbers per population (pcr-tests). currently—more than four months after declaration of the pandemic—the bcg-hypothesis needs reexamining. an ecological study was conducted by obtaining data of factors in countries, including bcg vaccine coverage (%), using morbidity and mortality as outcomes, obtained from open resources. ‘urban population (%)’ and ‘insufficient physical activity (%)’ in each country was positively associated with morbidity, but not mortality, after adjustment for pcr-tests. on the other hand, recent bcg vaccine coverage (%) was negatively associated with mortality, but not morbidity, even with adjustment for percentage of the population ≥ years of age, morbidity, pcr-tests and other factors. the results of this study generated a hypothesis that a national bcg vaccination program seems to be associated with reduced mortality of covid- , although this needs to be further examined and proved by randomized clinical trials. currently, more than four months since declaration of the coronavirus disease (covid- ) as a pandemic by the world health organization (who) on march th, , more than million people have been infected with the virus and more than half a million have died worldwide. marked differences in covid- mortalities have been observed in different countries. for example, the mortality per million population is till now several tens of times or even higher in western countries, e.g., belgium ( ), the united kingdom (uk, ), the united states of america (usa, ) and germany ( ), than in asian countries, e.g., india ( ) , japan ( ) and china ( ), as of july . this is quite the opposite of what was reported during the - influenza pandemic, the so called spanish flu, in which the population mortality was over -fold higher, with excess death rates observed in low-income countries, such as india, than in high-income countries, such as those in the west [ ] . higher morbidities and mortalities may be explained by easy access to diagnostic polymerase chain reaction tests (pcr-tests) for severe acute respiratory syndrome coronavirus (sars-cov- ) in these western countries. in contrast, they may be underestimated in middle-and low-income countries due to low capacities of pcr-testing and poor access to health care. alternatively, there is growing concern that racial and ethnic minority, as well as socioeconomic and biological factors may influence the high morbidity and mortality. a retrospective study of integrated health care systems suggested that black race compared with white race, increasing age, male sex, having a greater burden of comorbidities, type of public insurance, residence in a low-income area and obesity were associated with increased odds of hospital admission [ ] . on the other hand risk of in-hospital mortality increased only in aged patients and was not associated with the black race, sex, comorbidities, obesity and other factors after multivariate adjustment [ ] ; this phenomenon was also confirmed in other races, i.e., asians and hispanics, compared with the white race [ , ] . moreover, since covid- is an infectious disease that spreads mainly through the droplet route by close contact in dense human societies, metropolitan areas, such as new york city in the usa [ ] and lombardy in italy [ ] , paris in france [ ] , sao paulo in brazil [ ] , and so on, have tended to be regional epicenters. however, associations between population dynamics, e.g., population size, density, migrants and urbanization and the morbidity/mortality of covid- have not yet been well examined. in addition to the factors listed above, several scientists proposed a hypothesis [ ] [ ] [ ] [ ] that bacillus calmette-guérin (bcg) vaccination has preventive effects not only against tuberculosis, i.e., the target disease of the vaccine, but also other non-specific infectious diseases, i.e., off-target diseases such as covid- , through epigenetic mechanisms [ ] [ ] [ ] . in fact, ecological studies have suggested that both covid- morbidities and mortalities were less in bcg-vaccinated countries than in bcg-non-vaccinated countries [ ] [ ] [ ] . however, because these studies only obtained data during the early phase of the pandemic, by which time the disease load had escalated in western countries, but not yet escalated in low-and middle-income countries where bcg is given at birth and did not adjust for any potential confounders, including pcr-test number per million population, the bcg-hypothesis needs to be reexamined now, more than four months after declaration of the pandemic, since the number of pcr-confirmed covid- cases are still growing in many countries. we therefore aimed to explore whether recent bcg vaccine coverage is associated with covid- morbidity and/or mortality rates, using linear regression models to explore associations between the two continuous random variables adjusted for a variety of potential confounders, such as median age and body mass index (bmi) in individual countries through this ecological study. institutional review board approval for this work was not sought due to the use of publicly available data obtained from open resources. this ecological study compared population data of each country. all data were obtained from open resources: information on total number of cases, total number of deaths and number of pcr-tests performed per million population were obtained from 'coronavirus update' [ ] , data regarding population dynamics were obtained from 'world population clock' [ ] , socioeconomic covariates were obtained from 'the united nations database' [ ] , bcg vaccine coverage data were obtained from 'the bcg world atlas' [ ] and 'the global health observatory' on the who homepage [ ] and other health related data were from the same who site [ ] . definitions of each of the covariates are described in the supplement. only countries that had data of both total deaths and bcg vaccine coverage were included for analyses in this study. the outcomes evaluated in this study were covid- morbidity, i.e., total covid- cases per million population and covid- mortality, i.e., total covid- -related deaths per million population, in each country, obtained from 'worldometer covid- data' on july th, [ ] . data on the total number of pcr-tests performed per million population were simultaneously obtained from the same 'worldometer covid- data' website. pcr-test positivity was simply calculated as the total covid- case number divided by the total number of pcr-tests performed in each country. recent bcg vaccine coverage was defined as the percentage of the vaccinated population among one-year-olds in each country (world health data platform, the world health observatory, bcg-immunization coverage estimates) [ ] . for countries that have already stopped a national bcg vaccine immunization program [ ] , which includes a significant number of countries, their bcg vaccine coverage rate was counted as zero percent in this study. the covariates evaluated in this study, the definitions of which are described in the supplement (table s ) , included: ( ) population (n); ( ) yearly change in population (%); ( ) net change in population (n); ( ) population density (n/km ); ( ) land area (km ); ( ) net number of migrants (n); ( ) fertility rate (n); ( ) median age (years); ( ) urban population percentage (%); ( ) world share (%); ( ) population between age to years (%); ( ) population ≥ years of age (%); ( ) population ≥ years of age (%); ( ) gross domestic product (gdp) (million us dollars); ( ) gdp per capita (us dollars); ( ) total unemployment rate (%); ( ) male unemployment rate (%); ( ) female unemployment rate (%); ( ) total labor force participation rate (%); ( ) male labor force participation rate (%); ( ) female labor force participation rate (%); ( ) annual incidence of tuberculosis per , population (n); ( ) international health regulation (ihr) score (%); ( ) universal health coverage (uhc) index; ( ) hospital beds (n) per , population; ( ) medical doctors (n) per , population; ( ) nursing midwifery (n) per , population; ( ) licensed qualified anesthesiologists who usually cover management of intensive care units actively working (n) per , population; ( ) total expenditure on health as a percentage of gdp (%); ( ) population with household expenditures on health greater than % of total household expenditure or income (%); ( ) prevalence of high blood pressure (systolic ≥ or diastolic ≥ mmhg) (%); ( ) prevalence of elevated fasting blood glucose levels (≥ . mmol/l or on anti-diabetic medication); ( ) prevalence of elevated total cholesterol levels (≥ . mmol/l) (%); ( ) mean bmi (body weight [kg]/height [m ]); ( ) prevalence of obesity among adults, bmi ≥ kg/m (%); ( ) prevalence of 'overweight' people among adults, bmi ≥ kg/m (%); ( ) alcohol drinking, total per capita (≥ years of age) consumption (in liters of pure alcohol over a calendar year); ( ) prevalence of smoking any tobacco product among males aged ≥ years (%); ( ) prevalence of smoking any tobacco product among females aged ≥ years (%); ( ) prevalence of insufficient physical activity among adults aged ≥ years (%); ( ) estimated population-based prevalence of depression (%); ( ) neonatal mortality rate (n per live births); ( ) infantile mortality rate (n per live births); ( ) under-five mortality rate (probability of dying by the age of years per live births); ( ) mortality rate for - -year-olds (probability of dying per children aged - years); ( ) adult mortality rate (probability of dying between and years of age per population); ( ) probability of dying between age and exact age years from any of the following causes: cardiovascular disease, cancer, diabetes or chronic respiratory disease; ( ) life expectancy at birth (years); ( ) life expectancy at age years (years); ( ) healthy life expectancy (hale) at birth (years); ( ) hale at age years (years); ( ) death due to chronic obstructive pulmonary disease (%); ( ) death due to ischemic heart disease (%); ( ) death due to lower respiratory infections (%); ( ) death due to stroke (%); ( ) death due to tracheal, bronchial and lung cancers (%); ( ) total of ( ) to ( ) as ambient and household air pollution-attributable death rate (n per , population); and ( ) annual mean concentration of particulate matter less than . microns in diameter (pm . ) [µg/m ] in urban areas; and ( ) coverage rate with the first dose of a measles-containing-vaccine (mcv ) among one-year-olds (%) as well as ( ) recent bcg coverage and ( ) pcr-tests number. for preprocessed data, outcomes, i.e., morbidity and mortality per million population were transformed to the common logarithm (log ) to adjust for normality of the distribution, which was verified by means of kurtosis tests. when the number of total deaths was zero, these were changed to . per million population, because zero cannot be transformed to the common logarithm. variance inflation factor (vif) was used to detect the presence of multicollinearity. only one variable among biologically similar variables, e.g., 'median age (years)', '≥ years of age (%)' and '≥ years of age', was selected to maximize adjusted r in the multi-linear regression models to avoid the influence of collinearity. if the variance inflation factor (vif) of certain covariates was more than , then the covariates were avoided in multivariate analyses because of a collinearity issue. multiple linear regression models were used to screen potential risk or preventive factors associated with morbidity by adjusting for pcr-test numbers transformed to the common logarithm (log ) and those associated with mortality were screened by adjusting for pcr-test numbers and morbidity per million population. considering type i error due to a multiple testing, the significance level of alfa was set as p < . . then, all the screened factors were assessed in a multi-linear regression model to determine significant factors with p < . as the cutoff point. each model was evaluated by adjusted r as a coefficient of determination. pearson's correlation coefficient for variables with normal distributions or spearman's rank correlation for variables with non-normal distributions, represented as rho, was used to quantify the strengths of associations between morbidity, mortality and significant factors determined by the final models, as: absolute value of rho ≥ . : very strong; rho ≥ . : strong; . > rho ≥ . : moderate; and rho < . : weak associations. data were analyzed using stata version . software (statacorp lp, college station, tx, usa). a total of countries that had data of both total covid- deaths and bcg vaccine coverage were included for analyses in this study. the countries with highest and lowest covid- morbidities (table ) and mortalities (table ) , as well as their pcr-test rate per million population are shown below. marked differences in morbidities and mortalities were observed among these countries, ranging from (papua new guinea) to , (qatar) and from (vietnam, etc.) to (belgium), respectively. six and thirteen countries that do not have a bcg national vaccine program at present (indicated with bold and mark " ") were included in the countries with the highest covid- morbidity and mortality, respectively. histograms of morbidities and mortalities were drawn as normal density plots ( figure ). although the histograms of morbidity and mortality were skewed to the right, they followed a normal distribution by transformation with the common logarithm (log ). first, associations represented by rho and vif between morbidity (n = ), mortality (n = ) and pcr-tests (n = ) are shown ( figure a ). these three variables were predicted to have very strong and positive associations with each other. however, vifs were less than among these three factors. multicollinearity is considered to be present when the vif is higher than to [ ] . thus, any variable with a vif < . was considered for inclusion in multiple linear regression analyses. considering the number of pcr-tests per million population may exhibit associations with morbidity, adjustment was performed for the pcr-test number in every analysis when screening for the risk factors of covid- morbidity per million population ( figure b ). considering morbidities and the number of pcr-tests per million population may exhibit associations with mortality, adjustment was performed for the morbidity and pcr-test number in every analysis when screening for the risk factors of covid- mortality per million population ( figure c ). first, associations represented by rho and vif between morbidity (n = ), mortality (n = ) and pcr-tests (n = ) are shown (figure a ). these three variables were predicted to have very strong and positive associations with each other. however, vifs were less than among these three factors. multicollinearity is considered to be present when the vif is higher than to [ ] . thus, any variable with a vif < . was considered for inclusion in multiple linear regression analyses. considering the number of pcr-tests per million population may exhibit associations with morbidity, adjustment was performed for the pcr-test number in every analysis when screening for the risk factors of covid- morbidity per million population ( figure b ). considering morbidities and the number of pcr-tests per million population may exhibit associations with mortality, adjustment was performed for the morbidity and pcr-test number in every analysis when screening for the risk factors of covid- mortality per million population ( figure c ). associations between morbidity, mortality and pcr-tests. either pearson's correlation coefficient or spearman's rank correlation was applied to calculate rho; (b) associations between morbidity and risk factors were adjusted for pcr-tests per million population (log ); (c) associations between mortality and risk factors were adjusted for morbidity (log ) and pcr-tests (log ) per million population. since fewer pcr-tests may underestimate morbidity and mortality, the association between mortality as the outcome and morbidity as the exposure was adjusted for number of pcr-tests performed (table ). in this multiple regression analysis, higher morbidity was associated with higher mortality, whereas more pcr-tests were associated with lower mortality. evaluation of the association between pcr-test positivity and mortality, shown as a scatter plot, indicated a very strong association between them (rho = . ) (figure ). countries with higher pcr- associations between morbidity, mortality and pcr-tests. either pearson's correlation coefficient or spearman's rank correlation was applied to calculate rho; (b) associations between morbidity and risk factors were adjusted for pcr-tests per million population (log ); (c) associations between mortality and risk factors were adjusted for morbidity (log ) and pcr-tests (log ) per million population. since fewer pcr-tests may underestimate morbidity and mortality, the association between mortality as the outcome and morbidity as the exposure was adjusted for number of pcr-tests performed (table ). in this multiple regression analysis, higher morbidity was associated with higher mortality, whereas more pcr-tests were associated with lower mortality. evaluation of the association between pcr-test positivity and mortality, shown as a scatter plot, indicated a very strong association between them (rho = . ) (figure ). countries with higher pcr-positivity rates tended to have higher mortality rates. pcr-test positivity rates of countries where no deaths due to covid- were observed were less than . %. minimum positivity and no deaths were observed in vietnam. among the covariates, plus bcg vaccine coverage and pcr-testing rate, i.e., a total of factors, 'urban population' and 'insufficient physical activity' were significantly (p < . ) associated with morbidity after adjustment for pcr-test rate (table ). next, these two significant factors were used in a multi-linear regression model to eliminate confounding ( table ) . as a result, 'urban population' (p = . ) and 'insufficient physical activity' (p = . ) remained significant factors associated with covid- morbidity, even after adjustment for pcr-tests. the adjusted r was . . among the covariates, plus bcg vaccine coverage and pcr-testing rate, i.e., a total of factors, 'urban population' and 'insufficient physical activity' were significantly (p < . ) associated with morbidity after adjustment for pcr-test rate (table ). next, these two significant factors were used in a multi-linear regression model to eliminate confounding ( table ) . as a result, 'urban population' (p = . ) and 'insufficient physical activity' (p = . ) remained significant factors associated with covid- morbidity, even after adjustment for pcr-tests. the adjusted r was . . the association between 'urban population' and morbidity, demonstrated below as a scatter plot, showed a very strong association (rho = . ) (figure ) . the association between 'urban population' and morbidity, demonstrated below as a scatter plot, showed a very strong association (rho = . ) (figure ). rates. covid- -related morbidity rates per million population on july , were transformed to the common logarithm (log ) in the graph. since the variable of 'urban population' showed a nonnormal distribution, spearman's rank correlation was applied to calculate rho, to quantify the strength of the association. countries that had never had or that had stopped a national program of bcg vaccination are indicated in red, while countries that currently follow a national bcg vaccine program are indicated in black. selected country names are shown using three-letter country codes. the association between 'insufficient physical activity' and morbidity, demonstrated below as a scatter plot, also showed a very strong association (rho = . ) ( figure ). rates. covid- -related morbidity rates per million population on july were transformed to the common logarithm (log ) in the graph. since the variable of 'urban population' showed a non-normal distribution, spearman's rank correlation was applied to calculate rho, to quantify the strength of the association. countries that had never had or that had stopped a national program of bcg vaccination are indicated in red, while countries that currently follow a national bcg vaccine program are indicated in black. selected country names are shown using three-letter country codes. the association between 'insufficient physical activity' and morbidity, demonstrated below as a scatter plot, also showed a very strong association (rho = . ) ( figure ). covid- -related morbidity rates per million population on july th were transformed to the common logarithm (log ) in the graph. countries that had never had or that had stopped a national program of bcg vaccination are indicated in red, while countries that currently follow a national bcg vaccine program are indicated in black. selected country's name was shown using three-letter country codes. covid- -related morbidity rates per million population on july th were transformed to the common logarithm (log ) in the graph. countries that had never had or that had stopped a national program of bcg vaccination are indicated in red, while countries that currently follow a national bcg vaccine program are indicated in black. selected country's name was shown using three-letter country codes. among the covariates evaluated, plus bcg vaccine coverage, adjusted for morbidity and pcr-tests, age-related factors, i.e., median age, ≥ years of age (%) and ≥ years of age (%), were significantly (p < . ) associated with mortality (table ). since these three age-related factors had collinearity for mortality, '≥ years of age' was selected to maximize adjusted r of the multi-linear regression models. moreover, 'bcg vaccine coverage', 'elevated total cholesterol levels' and 'life expectancy at years of age', were also significant (p < . ) factors associated with mortality. next, these significant factors were used in a multi-linear regression model to eliminate confounding ( table ) . as a result, '≥ years of age' (p < . ) and 'bcg vaccine coverage' (p = . ) remained significant factors associated with covid- mortality, even after adjustment for morbidity and pcr-tests. the adjusted r was . . among the covariates evaluated, plus bcg vaccine coverage, adjusted for morbidity and pcr-tests, age-related factors, i.e., median age, ≥ years of age (%) and ≥ years of age (%), were significantly (p < . ) associated with mortality (table ). since these three age-related factors had collinearity for mortality, '≥ years of age' was selected to maximize adjusted r of the multi-linear regression models. moreover, 'bcg vaccine coverage', 'elevated total cholesterol levels' and 'life expectancy at years of age', were also significant (p < . ) factors associated with mortality. next, these significant factors were used in a multi-linear regression model to eliminate confounding ( table ) . as a result, '≥ years of age' (p < . ) and 'bcg vaccine coverage' (p = . ) remained significant factors associated with covid- mortality, even after adjustment for morbidity and pcr-tests. the adjusted r was . . evaluation of the association between 'median age' and mortality, demonstrated as a scatter plot, showed a very strong association between these two variables (rho = . ) ( figure ). countries with a larger population ≥ years of age (%) showed a tendency toward a higher mortality rate. finally, evaluation of the association between 'bcg vaccine coverage' and mortality, demonstrated as a scatter plot, indicated a moderately negative association (rho = − . ) (figure ) . countries with higher bcg vaccine coverage showed a tendency toward lower mortality. additionally, covid- mortality rates did not have significant associations with bcg strain, e.g., tokyo . moreover, there were no significant associations between mortality and either the year of stopping or introducing a national bcg vaccine program (data not shown). evaluation of the association between 'median age' and mortality, demonstrated as a scatter figure . scatter plot showing the association between ≥ years of age (%) of the population and mortality rate. mortalities per million population on july , transformed to the common logarithm (log ) are presented in the graph. since the variable of 'percentage of population ≥ years of age (%)' showed a non-normal distribution, spearman's rank correlation was applied to calculate rho, to quantify the strength of the association. countries that had never had or that had stopped their national bcg vaccine program are indicated in red, while countries that currently follow a national bcg vaccine program are indicated in black. selected country names are shown using three-letter country codes. finally, evaluation of the association between 'bcg vaccine coverage' and mortality, demonstrated as a scatter plot, indicated a moderately negative association (rho = - . ) (figure ) . countries with higher bcg vaccine coverage showed a tendency toward lower mortality. additionally, covid- mortality rates did not have significant associations with bcg strain, e.g., tokyo . moreover, there were no significant associations between mortality and either the year of stopping or introducing a national bcg vaccine program (data not shown). figure . scatter plot showing the association between ≥ years of age (%) of the population and mortality rate. mortalities per million population on july transformed to the common logarithm (log ) are presented in the graph. since the variable of 'percentage of population ≥ years of age (%)' showed a non-normal distribution, spearman's rank correlation was applied to calculate rho, to quantify the strength of the association. countries that had never had or that had stopped their national bcg vaccine program are indicated in red, while countries that currently follow a national bcg vaccine program are indicated in black. selected country names are shown using three-letter country codes. among the variety of parameters abstracted from open resources, 'bcg vaccine coverage' had a significant association with covid- mortality, even after adjusting for morbidity, pcr-tests, age, universal health coverage, numbers of medical doctors, elevated total cholesterol and healthy life expectancy. on the other hand, bcg vaccination was not associated with covid- morbidity. the mortalities per million population on july are transformed to the common logarithm (log ) in the graph. since the variable of 'bcg vaccine coverage' showed a non-normal distribution, spearman's rank correlation was applied to calculate rho, to quantify the strength of the association. selected country names are shown using three-letter country codes. among the variety of parameters abstracted from open resources, 'bcg vaccine coverage' had a significant association with covid- mortality, even after adjusting for morbidity, pcr-tests, age, universal health coverage, numbers of medical doctors, elevated total cholesterol and healthy life expectancy. on the other hand, bcg vaccination was not associated with covid- morbidity. the main results of this study are consistent with a very recent article demonstrating that every % increase in the bcg index was associated with a % reduction in covid- mortality [ ] . moreover, a retrospective cohort study suggested that bcg-vaccinated individuals were less likely to require hospital admission during the disease course [ ] . in contrast to bcg, coverage of the measles vaccine, which is also considered to induce heterologous protection against infections through long-term boosting of innate immune responses [ ] , showed no association with the morbidity and mortality of covid- , which was also consistent with a very recent article showing a significant low risk of covid- mortality in countries with higher bcg vaccine coverage, but not with measles vaccine coverage [ ] . moreover, sars-cov- is a single-stranded positive-sense rna virus and the bcg vaccine has been shown in controlled trials to reduce the severity of infections by other viruses with such a structure [ ] . for example, the bcg vaccine reduced yellow fever vaccine viremia by % in volunteers in the netherlands [ ] . however, some countries with a current national bcg vaccination policy have high mortality rates. plausible reasons for this discrepancy may be: ( ) low coverage of bcg vaccination in these countries (% coverage-mortality per million population), e.g., ireland ( %- ); portugal ( %- ); and greece ( %- ): ( ) late introduction of bcg vaccine program (year of introduction-mortality per million population), e.g., iran, ( - ): ( ) oral delivery of the bcg vaccine, e.g., brazil retained oral delivery of the vaccine until : ( ) uk administered the vaccine to older children ( to years of age) and ( ) connection with endemic country by land, e.g., mexico, panama, peru and chile. higher morbidity, but fewer pcr-tests, were associated with higher mortality. moreover, higher pcr-test positivity was associated with higher mortality, which was consistent with the report by hisaka et al. [ ] . expanding application of pcr-tests not only to typical symptomatic cases, but also to mild or asymptomatic cases and to those who had close contact with patients, may decrease the pcr-test positivity rate. thus, enhancing the capacity of pcr-testing may enable identification of cases, so that appropriate measures can be taken to prevent them spreading sars-cov- to others at home, at their work place or at events of mass gatherings. in this study, the covariate of 'urban population' and 'insufficient physical inactivity' had a strong and positive association with morbidity, but not with mortality. people living in urban areas tend to have close contact with a greater number of people per day than those in rural areas, independent of age. a report on patients with covid- in new york city found that obesity, which may strongly depend on the balance between physical activity and diet, was one of the clinical features leading to hospital admission [ ] . on the other hand, older age was associated with higher mortality, which is consistent with previous articles [ ] [ ] [ ] . from this study, the risk factors for morbidity seem to be different from those associated with mortality, suggesting that factors related to susceptibility may be different from those related to disease severity. there are several limitations to this study. first, although we selected covariates in this study, we did not evaluate range and timing of non-pharmaceutical interventions, e.g., school closures, workplace closures, cancellation of public events, restrictions on public gatherings, stay-at-home restrictions, restrictions on internal movement, international travel controls, etc., all of which would also have had significant effects on covid- -related morbidity and mortality. therefore, the present study results are burdened with an extreme error. second, the study design was ecological. therefore, the outcome of this work should be considered highly limited, with a potential risk of high bias. consequently, only the hypothesis that bcg vaccination mitigates covid- mortality can be proposed here; cohort or case-control studies and randomized clinical trials, similar to the bcg-corona study [ ] , are required to test this hypothesis. third, the covid- pandemic is still ongoing, although we have confirmed the results using the latest data. however, the results may be different a few months from now. fourth, it is clear that an extremely large number of covariates, i.e., , were selected for the limited number of countries. this sample size could allow use of a maximum of covariates in multiple regression analysis. therefore, significant (p < . ) variables were at first screened after adjustment for pcr-tests and morbidity (table ) . then, multivariable linear regression using the screened variables were performed after adjustment for pcr-tests and morbidity (table for morbidity and table for mortality). fifth, mortality in each country should be compared with excess deaths whether these two do not make a big difference. sixth, the definition of covid- cases may differ by country, e.g., including pcr confirmed, but asymptomatic cases and pneumonia cases with negative pcr-tests. seventh, there were still residual confounders even after adjustment for pcr-tests. our results suggest the hypothesis that greater bcg vaccine coverage may reduce the risk of deaths due to covid- , which needs to be further studied by observational studies and confirmed by randomized clinical trials. estimation of potential global pandemic influenza mortality on the basis of vital registry data from the - pandemic: a quantitative analysis hospitalization and mortality among black patients and white patients with covid- socioeconomic deprivation, and hospitalization for covid- in english participants of a national biobank covid- by race and ethnicity: a national cohort study of million united states veterans and the northwell covid- research consortium. presenting characteristics, comorbidities, and outcomes among patients hospitalized with covid- in the new york city area critical care utilization for the covid- outbreak in lombardy, italy: early experience and forecast during an emergency response covid- epidemic in the seine-saint-denis department of greater paris: one month and three waves for a tsunami forecasting covid- dynamics in brazil: a data driven approach trained immunity: a program of innate immune memory in health and disease bcg as a game-changer to prevent the infection and severity of covid- pandemic? bcg vaccine and covid- : implications for infection prophylaxis and cancer immunotherapy national policies for paediatric universal bcg vaccination were associated with decreased mortality due to covid- considering bcg vaccination to reduce the impact of covid- trained immunity: a tool for reducing susceptibility to and the severity of sars-cov- infection bcg-induced trained immunity: can it offer protection against covid- ? is bcg vaccination affecting the spread and severity of covid- ? allergy is global bcg vaccination-induced trained immunity relevant to the progression of sars-cov- pandemic? is bcg vaccination causally related to reduced covid- mortality? coronavirus update world population clock a world of information the global health observatory multicollinearity and misleading statistical results barillas-mury, c. bcg vaccine protection from severe coronavirus disease (covid- ) bacillus calmette-guérin vaccination and clinical characteristics and outcomes of covid- in rhode island, united states: a cohort study significantly improved covid- outcomes in countries with higher bcg vaccination coverage: a multivariable analysis bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity global comparison of changes in the number of test-positive cases and deaths by coronavirus infection (covid- ) in the world obesity and risk of covid- : analysis of uk biobank bcg-corona study team: two randomized controlled trials of bacillus calmette-guérin vaccination to reduce absenteeism among health care workers and hospital admission by elderly persons during the covid- pandemic: a structured summary of the study protocols for two randomised controlled trials the authors thank the personnel who created the excellent open resources. we also thank haruka wada for data management at the division of molecular epidemiology, jikei university school of medicine. the authors declare no conflict of interest. key: cord- - rdcwrh authors: tamás, fazekas; tibor, szarvas; anita, csizmarik; boris, hadaschik; péter, nyirády title: covid- research: promising tracks leading to uro-oncology date: - - journal: int urol nephrol doi: . /s - - - sha: doc_id: cord_uid: rdcwrh nan since the report of the first cases of pneumonia of unknown cause by the who at the close of , the sars- coronavirus (sars-cov- ) and its related disease covid- has spread rapidly all over the globe. according to the online database of the johns hopkins university (jhu) by april th, , , infections, , deaths and , recoveries had been confirmed worldwide [ , ] . the pandemic placed a great burden on health care systems and forced them to change the way they operate. to free up the intensive care capacities, several governments decided to defer most interventions (surgeries) in non-life-threatening conditions, as well as all elective hospital patient visits. in urological practice, the number of elderly patients with multiple comorbidities is overrepresented, among whom oncologic patients in particular face the greatest risks from covid- . against this background, it is crucial to weight the possible harms caused by delaying therapies against the risk posed by a possible coronavirus infection. this consideration may be difficult in specific cases of clinical decisionmaking. generally, it is recommended to perform curative oncologic surgical interventions only in high-risk cancers without any delay [ ] . in case of immuno-and chemotherapy administration, immunosuppressant, neutropenic effects should always be taken into consideration, as these may lead to higher susceptibility to coronavirus infection, with a higher rate of life-threatening complications. furthermore, we should mention the risk caused by steroids administered with anti-tumor drugs. in addition to these rather general considerations, there are some aspects of covid- more specific for urologists. first of all, we would like to underline the potential protective effect of bacillus calmette guerin (bcg) vaccination against covid- [ ] . there has already been evidence showing that the bcg vaccine not only provides protection against tuberculosis, but also has a so-called heterologous immunomodulatory effect, which results in protection against various viral infections as well [ ] [ ] [ ] . its exact mechanism is not yet fully understood, but involves the activation of both heterologous lymphocytes and the trained immune system resulting in lower rates of neonatal sepsis and respiratory tract infections [ , ] . protection of bcg vaccination against viral infections has also been described for herpes and influenza viruses [ ] . in this context, a recent study aimed to compare the epidemiological data of covid- in countries with ongoing bcg vaccination programs with data from regions where no such program exist [ ] . the authors found significantly lower incidence and mortality rates in countries with ongoing bcg vaccination [ ] . certainly, the temporal and geographical differences in the course of virus spread, various testing capacities and reporting of death by or with sars-cov- can bias results. on the other hand, data from numerous countries have been included in the study potentially reducing the above effect. differences in prevalence and mortality may be particularly interesting when comparing portugal and spain, where geographical proximity provides a better opportunity for comparison. based on the data provided by worldometer and jhu as of april th, the incidence of sars-cov- infection is /million people in spain and /million in portugal [ , ] . the case-fatality ratio is . % in spain and . % in portugal, respectively [ ] . portugal is among those countries which have an ongoing bcg vaccination program, while spain's was canceled in [ ] . based on these findings, the murdoch children's research institute in australia and the radboud university in the netherland have launched prospective clinical trials enrolling health care workers, to assess whether bcg vaccination protects against sars-cov- infection or reduces its severity [ , ] . although the scientific data suggest a beneficial effect of bcg vaccination against sars-cov- infection and covid- severity, who has recently reported that the currently available (april th) evidence is not enough to recommend bcg vaccination for the prevention of covid- [ ] . local bcg chemo instillation has been widely used in uro-oncologic practice since [ ] . current guidelines recommend the use of bcg instillation for treatment of non-muscle invasive bladder cancer (t high grade) or carcinoma in situ (cis), to prevent progression and postpone radical surgical intervention [ ] . the exact mechanism of the anti-tumor effect of local bcg instillation is not fully understood, but available data suggest that t h -mediated immune reaction plays a crucial role in the procedure. during the complex process of immune response, antigens are presented by mhc-ii molecules resulting in activation and recruitment of granulocytes, macrophages, nk cells, cd + and cd + t-cells [ , , ] . immune-mediated cytotoxicity is derived mainly by nk cells, cd + lymphocytes, macrophages and granulocytes, while the whole process is coordinated by cytokines il- , il- , il- , il- , il- , tnf-alpha and ifn-gamma among others [ , , ] . the reaction results in local infiltration of leukocytes in the bladder wall; however, there is evidence that bcg instillation may also induce systemic immunomodulatory effects [ , ] . keeping all these factors in mind, one may raise the question whether intravesically administered bcg protects against covid- or reduces the virus' rate of fatal outcomes? a recent study showed, that similar to sars-cov, sars-cov- needs the simultaneous presence of angiotensin converting enzyme (ace ) and transmembrane serine protease (tmprss ) on the host cell's membrane to enter it [ ] . the first step of this process is the attachment of covid- to its receptor, ace [ ] . then during the priming, the spike protein of the virus is cleaved by tmprss , after which it is able to enter the host cell [ ] . we have to add, that covid- can use other proteases called cathepsin b and l (catb/l) for priming, but according to the literature, tmprss is critical for viral entry into the primary target cells and viral spread in the host [ ] . in line with this, camostat mesylate a clinically approved serine protease inhibitor cut the rate of viral entry into lung cells [ ] . tmprss is known to be dispensable for organ function and homeostasis and is, therefore, a potential target of anti-viral therapy [ , ] . zhou et al. found the therapeutic effect of camostat against sars-cov to be promising in an in vivo model, hence it can be potentially effective in case of sars-cov- infection as well [ ] . accordingly, a prospective clinical testing has just been started (nct ). tmprss is most predominantly expressed in prostatic tissue followed by the pancreas and lung epithelium [ ] [ ] [ ] . therefore, most of our current knowledge on tmprss is originating from prostate cancer research. the regulation of the gene is modulated by androgen, moreover it is overexpressed in prostate cancer (pca) compared to normal prostate epithelium and is associated with tumor differentiation [ ] [ ] [ ] . it is also known that in more than % of pca cases tmprss is affected by somatic rearrangement with erg resulting in a tmprss :erg gene fusion [ ] [ ] [ ] [ ] [ ] [ ] . according to its androgen-dependent regulation, androgen deprivation results in lower levels of tmprss and also tmprss :erg gene expression which is restored in castration-resistant pca [ ] . all these considerations raise some interesting questions: ( ) is androgen deprivation therapy able to downregulate tmprss in lung epithelial cells, and if so is it able to affect the susceptibility and/or severity of covid- infection? ( ) is the known male predominance of sars-cov- infection/covid- severity related to the androgen-dependent regulation of tmprss gene? ( ) does individual variability of tmprss expression (e.g. caused by polymorphism) have any impact on sars-cov- infection/ covid- severity? without a doubt, the world is facing the greatest healthcare crisis of this young century to date. in the rush for a cure, governments have raised tremendous funds in attempt to address the situation. at the same time, the scientific world is cooperating and sharing its resources to expand our knowledge of the virus. the emergence and spread of sars-cov- have highlighted the importance of both basic and clinical research. clinicians from different fields can not only help the fight against covid- on the bedside, but also provide valuable data for research. as we have shown above, the field of uro-oncology offers potential for further investigation. an interactive web-based dashboard to track covid- in real time covid- dashboard by the center for systems science and engineering (csse) at johns hopkins university (jhu) (accessed: th of april european association urology guidelines office rapid reaction group: an organisation-wide collaborative effort to adapt the european association of urology guidelines recommendations to the coronavirus disease era bcg vaccination may be protective against covid- the humoral immune response to bcg vaccination. immunol front heterologous effects of infant bcg vaccination: potential mechanisms of immunity nonspecific effects of vaccines illustrated through the bcg example : from observations to demonstrations nonspecific effects of bcg vaccine on viral infections the bcg world atlas nd edition bcg vaccination to reduce the impact of covid- in australian healthcare workers following coronavirus exposure (brace) trial bacille calmette-guérin (bcg) vaccination and covid- (accessed: th of april) intracavitary bacillus calmette-guerin in the treatment of superficial bladder tumors european association of urology guidelines on non-muscle-invasive bladder cancer (tat and carcinoma in situ) - update the mechanism of action of bcg therapy for bladder cancer-a current perspective immune response following intravesical bacillus calmette-guerin instillations in superficial bladder cancer: a review systemic immune response after intravesical instillation of bacille calmette-guérin (bcg) for superficial bladder cancer sars-cov- cell entry depends on ace and tmprss and is blocked by a clinically proven protease inhibitor protease inhibitors targeting coronavirus and filovirus entry influenza and sars-coronavirus activating proteases tmprss and hat are expressed at multiple sites in human respiratory and gastrointestinal tracts prostate-localized and androgen-regulated expression of the membrane-bound serine protease tmprss the androgen-regulated type ii serine protease tmprss is differentially expressed and mislocalized in prostate adenocarcinoma catalytic cleavage of the androgen-regulated tmprss protease results in its secretion by prostate and prostate cancer epithelia reactivation of androgen receptor regulated tmprss :erg gene expression in castration resistant prostate cancer tmprss and covid- : serendipity or opportunity for intervention? cancer discov the tmprss gene encoding transmembrane serine protease is overexpressed in a majority of prostate cancer patients: detection of mutated tmprss form in a case of aggressive disease molecular subtypes and perspectives of targeted therapies in prostate cancer current state of erg as biomarker in prostatic adenocarcinoma androgen receptor cag repeat polymorphism and risk of tmprss :erg-positive prostate cancer key: cord- - hnh authors: leeson, cale e.; ismail, asmaa; hashad, mohamed m.; elmansy, hazem; shahrour, walid; prowse, owen; kotb, ahmed title: systematic review: safety of intravesical therapy for bladder cancer in the era of covid- date: - - journal: sn compr clin med doi: . /s - - - sha: doc_id: cord_uid: hnh a novel coronavirus has emerged in late capable of causing a severe respiratory disease known as covid- . its pathogenesis appears to be the initiation of an immune response and resulting cytokine storm that damages the healthy lung tissue of the host. some epidemiological studies found bacillus calmette-guérin (bcg) vaccine can help to decrease morbidity and mortality of the viral infection. we aim to review and summarize what is known about covid- and the current implications of intravesical bcg with regard to the disease. in december , a novel coronavirus, now officially known as severe acute respiratory syndrome coronavirus (sars-cov- ), emerged in china and is capable of causing the infectious disease called coronavirus disease . [ ] since then, the world health organization has declared a global pandemic, with , , global cases of covid- , resulting in , deaths as of april , . [ ] the clinical manifestations of covid- are varied, ranging from mild symptoms such as fever, dyspnea and cough to more severe complications in the case of acute respiratory distress syndrome (ards), septic shock and death. pathogenesis of the disease likely involves initiation of an immune response, resulting in the production of cytokines in a "cytokine storm" that damages healthy lung tissue of the host. [ ] future clinical trials are being arranged to determine if bacillus calmette-guérin (bcg), an attenuated version of mycobacterium bovis and vaccine against tuberculosis, has the ability to upregulate the immune system against the novel coronavirus. [ ] furthermore, bcg immunotherapy is often utilized in the field of urology for the treatment of bladder cancer. it is not yet determined if intravesical therapy will have a positive or negative effect on the immune system in bladder cancer patients with covid- . bladder cancer is a common urologic condition, with urothelial carcinoma comprising the largest proportion of cases ( %). [ ] in addition, % of new bladder cancer cases will be non-muscle invasive bladder cancer (nmibc), typically treated with a high-quality transurethral resection of the bladder tumour (turbt), followed by either intravesical chemotherapy or immunotherapy. [ ] [ ] [ ] compared with other intravesical therapies, bcg is the only agent associated with a decreased cancer progression risk compared with turbt alone but is associated with a higher risk of adverse events. [ ] the mechanism of action of bcg is still relatively unclear but may involve an upregulation of the immune system characterized by induced expression of cytokines in the urine and bladder tissue. [ ] intravesical bcg treatment in immunocompromised patients remains a relative contraindication in some guidelines , while its role in the treatment of acute immunological disorders remains uncertain. in this review, we aim to summarize what is known about the immunologic mechanisms of covid- , the current recommendations, mechanisms of action and adverse effects of intravesical bcg in bladder cancer and determine if this article is part of the topical collection on covid- * ahmed kotb drahmedfali@gmail.com intravesical bcg is safe in patients that are suspected or confirmed to have covid- . in addition, implications for bcg immunotherapy in the treatment of viruses and immunological disorders will be explored. our article followed prisma checklist. this review article is irb exempt as we did not include any data from our patients. a comprehensive search of pubmed was performed for available literature on the effect of covid- on immune response, as well as current intravesical management of bladder cancer. we reviewed relevant articles focusing on the mechanism of action of intravesical bcg and chemotherapy, including systemic outcomes and side effects from intravesical treatment, and its safety and efficacy in immunocompromised patients or those with acute immunological disorders. search terms included "sars-cov- " or "covid- " combined with "immune response", "intravesical bcg" combined with "bladder cancer", "urothelial carcinoma", "adverse events", "side effects", "mechanism of action", "immunocompromised" and "immunological disease". references from review articles and guidelines were also evaluated for articles that may have been missed. standard electronic search methods using pubmed database and google scholar were employed. there were no limits set on publication date, though literature within the last decade was prioritized to formulate a narrative review. all searches were performed using standard search techniques with the exclusion of editorials and letters. forty-five references were of relevance to our work. no study did actually look for the direct correlation between covid- and intravesical bcg but were correlating with different diseases that were of relevance. we avoided guidelines inclusion into our manuscript as guidelines during that stressful time were mainly looking at decreasing patients travel to hospital mainly to decrease their exposure to infection rather than for the actual risk benefit ratio of bcg itself. sars-cov- infection has been described in three stages: an asymptomatic incubation period up to days (stage i), a nonsevere symptomatic period with the presence of the virus (stage ii) and a severe respiratory symptomatic stage with high viral load (stage iii). [ , ] stages i and ii require a specific adaptive immune response in healthy hosts to eliminate the virus and prevent progression to stage iii; thus, strategies to boost immune responses may play a role in the early stages of covid- . [ ] when this immune response is impaired, the virus will propagate and result in massive destruction of hostaffected tissues. [ ] if the disease progresses to stage iii, the severe respiratory phase, lymphocytopenia and high levels of pro-inflammatory cytokines have been observed, suggesting a "cytokine storm" plays a major role in the pathogenesis of covid- . [ , [ ] [ ] [ ] [ ] [ ] [ ] . interestingly, a review by d'antiga [ ] of the current and past coronavirus outbreaks found that immunosuppressed patients are not at increased risk for more severe pulmonary disease compared with the general population and concluded there is no reason to postpone life-saving treatments such as transplantation or chemotherapy for cancer. this may be related to the implications of the host immune system response leading to tissue damage in healthy patients that advance to the severe stage of covid- , whereas those who are immunocompromised may have a weakened response that could be protective. therefore, the pathogenesis of covid- appears to be heavily related to a cytokine storm resulting in inflammatory damage of host lung tissue and has the potential to result in ards and death, especially in older patients with comorbidities. to help guide future implications for intravesical treatment in covid- and immunological disorders, it is crucial to review our understanding of the mechanisms of action for bcg intravesical therapy. as previously discussed, there are two branches of intravesical therapy for the treatment of bladder cancer: chemotherapy and immunotherapy. overall, immunotherapy acts with the patient's immune system to upregulate and encourage destruction of cancer cells. in general, our understanding of the mechanisms of action for intravesical immunotherapy with bcg is still unclear. it is thought that the instillation of intravesical bcg results in a large local immune response by induced expression of cytokines in the urine and bladder tissue. [ ] bcg first attaches to the urothelium via fibronectin and integrins and is then internalized by urothelial cells and captured by the initial innate immune response. [ ] it is then that antigen presentation and cytokine release results in the upregulation of major histocompatibility complex (mhc) ii, il- , il- and granulocytemacrophage colony-stimulating factor (gm-csf). [ ] this stimulates local recruitment of immune cells such as granulocytes, cd and cd t cells, natural killer (nk) cells and macrophages that produce th- cytokines. [ ] according to prescott et al., [ ] the antitumor activity of bcg in bladder cancer appears to be a local phenomenon confined to the site of administration. in another study, peripheral blood mononuclear cells (pbmc), urine and serum were obtained from patients with superficial carcinoma at various times during the course of bcg instillation, and found an increase in systemic immune activity. [ ] further research is required to determine the precise mechanisms of action of bcg and advance our current knowledge of the immunological processes involved. with knowledge of the recent sars-cov- pandemic, and the risk for severe complications such as ards, it is necessary to review the side effects of intravesical treatment in an attempt to determine its safety in covid- and immunocompromised patients. one major drawback of intravesical bcg is that it is associated with more side effects when compared with intravesical chemotherapy, though more serious adverse outcomes are encountered in less than % of patients. [ ] though still debated, pulmonary complications appear to be of two categories: hypersensitivity reactions and mycobacterial pneumonia. an interstitial pattern on chest radiography, lymphocytosis on bronchial alveolar lavage (bal) and absence of granulomas on lung biopsy, as well as negative sputum and tissue cultures, are indicative of hypersensitivity response. [ ] mycobacterial pneumonia is characterized by biopsies revealing granulomata and radiographic evidence of consolidation, although testing for acid-fast bacteria (afb) may be negative. [ ] a large analysis of patients treated with intravesical bcg revealed . % of patients developed life-threatening bcg sepsis, and . % developed granulomatous pneumonitis. [ ] with regard to other intravesical therapy, mmc has little systemic absorption due to low molecular weight, and chemical cystitis is common. [ ] intravesical bcg is generally considered to be a relative contraindication and used with caution in immunocompromised patients based on current guidelines. however, there have been few studies that have examined the use of intravesical bcg in bladder cancer patients that are concurrently immunosuppressed. in addition to concerns of disseminated infection in immunocompromised patients, bcg is dependent on an effective immune response to exert its mechanism of action in the case of bladder cancer. this has raised concerns that even if instillation is safe in the immunocompromised population, treatment may be ineffective. herr and dalbagni [ ] discovered that bcg therapy was safe in immunocompromised patients with high-risk bladder tumours and may achieve similar results to non-immunosuppressed patients. however, the sample size was small, and generalization was cautioned. a retrospective chart review of immunosuppressed patients (e.g. concurrent lymphoma, chronic lymphocytic leukemia or on corticosteroid therapy) receiving intravesical bcg concluded that the side effects profile associated with bcg therapy in these patients was comparable with those in patients with no evidence of immunosuppression. [ ] additionally, a number of studies have demonstrated safe use in transplant patients, [ , ] and in patients with concurrent human immunodeficiency virus (hiv) infection. [ ] therefore, the use of intravesical bcg may be feasible in patients that are concurrently immunocompromised, but larger trials are required for definitive answers. though immunosuppressed patients with covid- are not at increased risk for more severe pulmonary disease compared with the general population [ ] , intravesical bcg should be used on a case by case basis in this population until definitive outcomes are determined with further studies. with the possibility that bcg may exhibit a systemic immune response, future research may be warranted regarding the use of bcg in the fight against viruses such as sars-cov- and various immunological disorders. there has been promising research in recent years exploring the use of bcg against viruses and other immunological disorders with which to build from and guide future studies. additionally, new clinical trials are being planned to explore the efficacy of boosting immune responses with bcg in the fight against covid- . [ ] recently, a study published in by gofrit et al. [ ] followed patients for year after their diagnosis with bladder cancer. during follow-up, patients developed alzheimer's disease (ad), a condition in which the immune system is a major contributor to pathogenesis. of the patients who developed ad, ( . %) were treated with intravesical bcg, while ( . %) did not receive bcg therapy. it was determined that patients treated with intravesical bcg manifested more than -fold less risk for ad than those not treated with intravesical bcg. in the field of virology, bcg vaccination was shown to protect against a non-related viral infection in an experimental model of human yellow fever virus, and it was discovered that the il- pathway is essential for an efficient induction of trained immunity in humans, which may have important implications for vaccination and the pathogenesis of autoinflammatory diseases. [ ] finally, bcg vaccination impacts the immune response to subsequent infections, resulting in reduced morbidity and mortality, and may protect against various dna and rna viruses, including herpes and influenza viruses. [ ] in these unprecedented times of the sars-cov- pandemic, bcg may offer the potential to boost the immune system in the critical early stages of covid- . the recent and ongoing sars-cov- pandemic is a rapidly evolving situation, with many questions remaining unanswered. the pathophysiology of covid- -related ards and death appears to be heavily related to a cytokine storm resulting in inflammatory damage of host lung tissue. strategies to boost the immune system in the early stages of the disease may help in preventing it from progressing to a more severe respiratory stage. compared with other intravesical therapies, bcg appears to have a higher risk of severe respiratory complications such as ards, and its concurrent use in patients with covid- should be carefully monitored. additionally, these side effects are rare and preventable with proper administration. although there is no current strong evidence, intravesical bcg may be boosting the immune system and may be playing a role towards decreasing morbidity and mortality of covid- . following disease control, multicentric studies should aim to retrospectively look for the correlation between intravesical bcg and development of covid- . novel coronavirus (covid- ) outbreak: a review of the current literature world health organization coronavirus disease (covid- ): what we know can a century-old tb vaccine steel the immune system against the new coronavirus cua guidelines on the management of non-muscle invasive bladder cancer diagnosis and treatment of non-muscle invasive bladder cancer: aua/suo guideline eau guidelines on non-muscle-invasive urothelial carcinoma of the bladder: update intravesical therapy for the treatment of nonmuscle invasive bladder cancer: a systematic review and meta-analysis immune mechanisms in bacillus calmette-guerin immunotherapy for superficial bladder cancer covid- infection: the perspectives on immune responses immune responses in covid- and potential vaccines: lessons learned from sars and mers epidemic clinical features of patients infected with novel coronavirus in wuhan risk factors associated with acute respiratory distress syndrome and death in patients with coronavirus disease pneumonia in wuhan, china clinical characteristics of coronavirus disease in china di napoli r. features, evaluation and treatment coronavirus (covid- ). instatpearls [internet] coronaviruses and immunosuppressed patients. the facts during the third epidemic the use of intravesical bcg in urothelial carcinoma of the bladder. ecancermedicalscience mechanisms of action of intravesical bacille calmette-guerin: local immune mechanisms systemic immune response after intravesical instillation of bacille calmette-guerin (bcg) for superficial bladder cancer intravesical bcg therapy as cause of miliary pulmonary tuberculosis incidence and treatment of complications of bacillus calmette-guerin intravesical therapy in superficial bladder cancer complications of intravesical therapy for urothelial cancer of the bladder intravesical bacille c almette-g uérin (bcg) in immunologically compromised patients with bladder cancer safety and efficacy of intravesical bacillus calmette-guerin instillations in steroid treated and immunocompromised patients intravesical bacillus calmette-gueÈrin for the treatment of superficial bladder cancer in renal transplant patients management of bladder cancer following solid organ transplantation hiv-associated bladder cancer: a case series evaluating difficulties in diagnosis and management bacillus calmette-guérin (bcg) therapy lowers the incidence of alzheimer's disease in bladder cancer patients bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity non-specific effects of bcg vaccine on viral infections publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations conflict of interest the authors declare that they have no conflicts of interest. key: cord- - x szmjc authors: warnakulasuriya, saman title: protecting dental manpower from covid‐ infection date: - - journal: oral dis doi: . /odi. sha: doc_id: cord_uid: x szmjc world health organization declared on march, covid as a pandemic infection that has spread rapidly across the globe. covid- currently has no known treatment or a vaccine. oral health professionals are at risk of developing covid infection as they come into close contact with patients and accompanying relatives who may be carrying the virus. since january , and by the end of april this year, more than medical doctors in italy and over national health service workers in the uk have died in the covid- crisis. while the transmission of covid via human ex-haled droplets and direct contact is clear, the potential for aerosol transmission is a significant risk particularly for dental practices. the objective of this brief review is to highlight ways how dental manpower could protect from the spread of disease. knowledge of these symptoms would help the dental surgery staff to triage patients when it comes to spotting covid- -infected persons. a history of international travel was important but following lockdown of airports is now irrelevant. patient recognition is complicated as these symptoms are initially mild and begin gradually. some infected people may only have very mild symptoms, and some might not even show symptoms at all. as a result, asymptomatic transmission is likely. though infection in children from covid- is less common, with only a "handful of deaths" reported so far, a mysterious new coronavirus-related rare condition among young children is also reported. the presentation of a sick child with a persistent red rash covering arms and legs, dry, cracked lips, lumps on tongue or a red, erythematous tongue has suggested a link between the kawasakilike disease and coronavirus. also referred to as paediatric multisystem inflammatory syndrome in children doesn't show the hallmarks of coronavirus; it presents with symptoms similar to kawasaki disease and toxic shock syndrome. of significance is that some adult patients may present in a dental practice reporting of loss of taste. in a case series of patients hospitalised in italy, the authors reported taste disorders in % of cases (dysgeusia . % and ageusia . %) and mixed taste and olfactory disorders in another % of patients (giacomelli et al., ) . a young child may be brought in with a red tongue as a primary symptom of covid- . in most cases, individuals are usually considered infectious while they have symptoms; how infectious individuals are, depends on the severity of their symptoms and stage of their illness. however, it is now widely recognised of possible infectivity prior to the onset of symptoms. virus shedding, as detected in the mouth or nose, could be present prior to onset of symptoms. a pcr test can determine whether the tested person is infected with sars-cov- and considered to be able to transmit the disease (a positive test) or is negative for the virus. patients seeking emergency care could be assessed by telephone and/or video in order to triage the patients' initial complaint. many patients with oral problems can be managed with advice and treatment with analgesia and antibiotics. a follow-up telephone/video review within - days should be arranged for reassurance. however, a patient may need a dental visit for an emergency extraction, incision and drainage of a dental abscess, or for urgent visual oral examination for symptoms suspicious of oral cancer (e.g. a non-healing oral ulcer). when planning emergency treatment, the dentists should avoid or minimise operations that can produce droplets or aerosols (meng, hua, & bian, ) . management of dental emergencies during covid- lockdown is beyond the scope of this publication and dentists would find guidelines circulated by nhs education for scotland useful (www.sdcep.org.uk). oral diseases have a significant interplay with systemic health especially among the elderly (jin et al., ) . when managing the elderly, who may be in self-isolation during the covid outbreak a consultation with the patient's gp would be desirable before prescribing over the phone. to minimise spread and protect staff, initial risk assessment for covid status where possible should take place by phone, before making an appointment to visit the surgery. when booking emergency dental appointments, having a checklist of covid- symptoms at the reception may help to inform the dentist about symptomatic patients, to postpone non-urgent therapies and to direct such patients to hospital centres equipped for handling infected subjects and their relatives, living together. patients may be reluctant to discuss symptoms related to oral cancer and may postpone visiting a dentist during the coronavirus outbreak. arduino, conrotto, and broccoletti, ( ) in this journal have recently highlighted the issue of missed diagnoses of oral cancer that may later present in advanced stages. care should be taken not to miss oral malignancies due to surgery closures. according to current evidence, covid- virus is primarily transmitted between people through respiratory droplets and contact routes. dental surgery environments and procedures convey higher risks of transmission. an oral examination can generate an aerosol. aerosol generating procedures (agp) present risk of aerosolised transmission and high-speed drilling and ultrasonic scalers are particularly considered agps. other agps include extractions, incision and drainage of a dental abscess. coronaviruses can survive on surfaces (inanimate objects) and can remain viable for - days, dependent on the surface type, worst being plastics. fortunately, the infectivity decreases with time. dental patients could have a strong urge to spit after a procedure. covid- has been found in infected saliva ; patient spitting could enhance the spread of the covid- within the dental premises. the same precautions should apply for all patients regardless of case status (positive, carrier or negative) during the period of sustained covid- transmission. hand hygiene should be practised and extended to exposed forearms. it is important to carry out hand hygiene after each patient contact. the appropriate use of personal protective equipment (ppe) will protect the dentist and staff from contamination in most circumstances. the ppe to be used in dental practices should be in line with the national recommendations given by the government chief dental officer or the professional organisation to which the dentist may belong to. for undertaking any direct patient care, dentists and dental surgery assistants and other oral health professionals are advised to wear, disposable gloves, aprons, eye protection and face shields where there is a risk of saliva, blood, other body fluids, secretions or excretions splashing into the face and eyes. sessional use of some ppe, other than hand gloves, may be rational. challacombe, kirk-bayley, sunkaraneni, and combes ( ) propose the use of ml of povidone iodine (pvp-i) . % solution -an effective virucide-applied as a mouth rinse for all patients (in those without contraindications to its use eg. history of allergy to pvp, thyroid disease etc) requiring dental treatment during the current covid- pandemic, just prior to treatment. decontamination of equipment and the care environment must be performed after each patient and should be carried out as per practice protocols. decontamination of all areas of the practice including the toilets can effectively limit the concentration of sars-cov- rna in aerosols (liu et al., ) . it is generally advisable to avoid the use of fans that re-circulate the air. all non-essential items including toys, books and magazines should be removed from reception and waiting areas. careful and thorough decontamination practice of laboratory items (e.g. impressions, prostheses) remains the responsibility of dental practices before any such items are dispatched to dental laboratories, in order to prevent all types of cross-infection. . using european data, hegarty, sfakianos, giannarini, dinardo, and kamat ( ) and global data miller et al. ( ) have shown considerable overlap with the map of countries with and without a national programme of bcg vaccination and the incidence of covid- infection. they speculate that countries with bcg vaccination programmes have far fewer coronavirus cases (by a factor ), compared to where bcg programmes are no longer deployed. for example, italy, where the covid- mortality is very high, never implemented universal bcg vaccination. portugal which had an effective bcg vaccination policy demonstrated a low incidence of covid- and fewer deaths, than neighbouring spain. bcg vaccination has shown to stimulate the innate immune system to develop "memory," termed trained immunity, which helps to eliminate various non-mycobacterium infections including influenza (covián et al., ) . in view of bcg vaccine's heterologous beneficial effect against non-tuberculosis infections (miller et al., ) , the question has been raised "whether bcg may enhance one's immunity against a lot of pharma companies are working on vaccines and the development of those vaccines are at various stages. on rd april, who announced that seven vaccines have now been approved for human testing through clinical trials (world health organization, ) . of the seven, are being tested in china, one in the uk, two in usa and one in germany. the university of oxford has taken the lead with a double-blind rct testing their chadox ncov- vaccine, which uses an adenovirus vaccine vector and the sars-cov- spike protein. the trial vaccine is being tested on close to , healthy volunteers and using a vaccine against meningococcus as a control. a timeframe for vaccine development of to month is needed but it is believed that an effective candidate may be announced sooner. equal distribution of the vaccine around the world would remain a challenge. ppe, sanitization of protective apparel is recommended. proper use and disinfection of all areas of the practice including the toilets can effectively limit the concentration of sars-cov- rna in aerosols (liu et al., ) . relatives or friends accompanying patients to a dental practice should be restricted to essential visitors only, such as parents of paediatric patients. at patient reception areas, distancing measures should be carried out-ensuring a distance of two metres is kept. dentists should keep up to date with and have regard to the latest advice from government, the health service and the chief medical (dental) officer. the position may change daily and therefore it is important to check that advice regularly. https://orcid. org/ - - - the outbreak of novel coronavirus disease (covid- ) caused a worrying delay in the diagnosis of oral cancer in north-west italy: the turin metropolitan area experience povidone iodine bcg-induced cross-protection and development of trained immunity: implication for vaccine design self-reported olfactory and taste disorders in sars-cov- patients: a cross-sectional study covid- and bacillus calmette-guérin: what is the link? global burden of oral diseases: emerging concepts, management and interplay with systemic health aerodynamic analysis of sars-cov- in two wuhan hospitals coronavirus disease (covid- ): emerging and future challenges for dental and oral medicine correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study consistent detection of novel coronavirus in saliva clinical features of covid- draft landscape of covid- candidate vaccines - the bcg world atlas: a database of global bcg vaccination policies and practices the bcg world atlas: a new, open-access resource for clinicians and researchers how to cite this article: warnakulasuriya s. protecting dental manpower from covid- infection key: cord- -msjurww authors: ouanes, y.; bibi, m.; baradai, n.; boukhris, m.; chaker, k.; kacem, a.; hedhli, h.; mrad deli, k.; sellami, a.; ben rhouma, s.; nouira, y. title: does bcg protect against sars-cov- infection ?: elements of proof. date: - - journal: nan doi: . / . . . sha: doc_id: cord_uid: msjurww background : there are several factors explaining the difference in the spread of sars-cov- infection including the bcg vaccination. this fact is supported by the concept of beneficial non specific effect of this live vaccine associated to its interaction with the immune system. our study aims to identify the correlation between the universal bcg vaccination policy and the mortality attributed to covid- . methods : we conducted an epidemiological study in which we collected covid- pandemic data of april th, from the web site worldometers.info . the exclusion criteria for our study were a number of inhabitants less than one million, low-income countries according to the world bank classification, a total number of infection cases less than and countries that have performed less than one hundred tests per million inhabitants. results : countries that never had universal bcg vaccination policy have a higher mortality (correlated to performed diagnostic tests) attributed to sars-cov- infection (p< . ). we found that the year of introduction of vaccination influenced significantly the mortality. countries that started immunization policy before had more favorable results (p= . ). for countries that started the bcg vaccination after , countries with current policies have lower mortality attributed to sars-cov- infection than countries that have stopped immunization (p= . ). conclusions : countries that have a bcg vaccination policy have a lower mortality attributed to sars-cov- infection. the populations of countries that applied this immunization before are more protected even if this universal policy has been interrupted. there are several factors explaining the difference in the spread of sars-cov- infection including the bcg vaccination. this fact is supported by the concept of beneficial non specific effect of this live vaccine associated to its interaction with the immune system. our study aims to identify the correlation between the universal bcg vaccination policy and the mortality attributed to covid- . we conducted an epidemiological study in which we collected covid- pandemic data of april th , from the web site worldometers.info . the exclusion criteria for our study were a number of inhabitants less than one million, low-income countries according to the world bank classification, a total number of infection cases less than and countries that have performed less than one hundred tests per million inhabitants. countries that never had universal bcg vaccination policy have a higher mortality (correlated to performed diagnostic tests) attributed to sars-cov- infection (p< . ). we found that the year of introduction of vaccination influenced significantly the mortality. countries that started immunization policy before had more favorable results (p= . ). for countries that started the bcg vaccination after , countries with current policies have lower mortality attributed to sars-cov- infection than countries that have stopped immunization (p= . ). countries that have a bcg vaccination policy have a lower mortality attributed to sars-cov- infection. the populations of countries that applied this immunization before are more protected even if this universal policy has been interrupted. . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . covid- has spread around the world, however, its impact varies from one country to another. indeed, there is a significant difference even between comparable countries in terms of health system and containment measures. this finding is certainly attributed to a multitude of intricate factors including the variability of individual immune system reaction to this infection. recent epidemiological studies have developed the concept of beneficial non specific effect of live vaccines. this means that it may have effects on infections not targeted by the vaccine. observationl studies found that bacillus calmette guerin (bcg) vaccination is associated with reduced non specific mortality and better survival . other immunological studies demonstrated that bcg can induce trained innate immuniy. otherwise, urologists know well that bcg is an attenuated mycobacterium developed as a vaccine for tuberculosis that has demonstrated antitumor activity in several different cancers including bladder cancer. these concordant elements, in favor of the non specific immunotherapeutic mechanism of the bcg vaccine, led us to make the assumption that the covid- mortality can be partially explained by the vaccination policies of countries around the world. based on these observations, we hypothesized that countries which have an early start of universal bcg vaccination policy would have a reduced morbidity and mortality attributed to sars-cov- infection. . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . we collected data concerning the global bcg vaccination policies and practices across countries from the second edition of the bcg world atlas. covid- pandemic informations of april th , were obtained from the web site worldometers.info . the mortality may be influenced by a country's standards of the health system. for this reason, we classified countries using the gross national income per capita in according to the worls bank data. the exclusion criteria of our study were the following : a number of inhabitants less than one million, low-income countries according to the world bank classification, a total number of infection cases less than and countries that have performed less than one hundred tests per million inhabitants. we classified the countries according to the world bank classification into groups because we think that the mortality may be influenced by the standard of medical care. group (a) includes lower middle income countries that have universal bcg vaccination policy. group (b) includes upper middle and high income countries that have a current universal bcg vaccination policy. group (c) includes upper middle and high income countries that had universal bcg vaccination policy but which has been stopped. group (d) includes countries that never had universal bcg vaccination policy. for a better comparison between countries we have defined the index rd which is equal to deaths attributed to sars-cov- infection per million inhabitants (d) divided by the number of diagnostic tests per million inhabitants (t) multiplied by which gives the following mathematical formula rd = d / t x . two groups were identified according to their index rd: high risk group with a rd index over . (median of rd) and low risk group with a rd index below this value. to study the evolution of mortality over time we applied a kaplan-meier survival analysis. it was used to measure the fraction of patients living for a certain amount of time after applying the bcg vaccination therapy. . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . upper middle and high income countries that never had universal bcg vaccination policy have a significant higher rd index ( . for group d vs . for group a, . for group b and . for group c ; p< . ). (fig. ) at this level of our study, we concluded that countries which applied a universal bcg vaccination policy had a lower mortality attributed to covid- . this fact led us to wonder if the duration of this vaccination policy was a determining factor given that advanced age is a risk factor for sars-cov- infection. according to the figure , countries which have a current bcg vaccination policy that lasted for at least years had better results. in the next part of our study, we analyzed the effect of bcg according to the year of introduction of vccination. as shown in figure , it seems that the older this vaccination, the better. after , upper middle and high income countries that have a current universal bcg vaccination policy (group b) have a better cumulated survival than upper middle and high income countries that had universal bcg vaccination policy but which has been stopped (group c). . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . in the last part of our study, we compared the countries whose populations were vaccinated with bcg relatively to this threshold year ( ). it should be noted that all the countries in the group a applied a vaccination policy before . (fig. ) for upper middle and high income countries that have a current universal bcg vaccination policy for countries that started bcg vaccination before , there is no significant difference between countries that have an ongoing policy and those that stopped vaccination (p= . ). for countries which started the bcg vaccination after , countries with current policies have a better rd index than countries that have stopped immunization (group b : rd= . ; group c : rd= . ; p= . ). the different impact of sars-cov- infection from one country to another is certainly due to a combination of factors. the situation in italy is quite edifying with high morbidity and mortality, while it seems under control in other countries with a similar economic and health systems. furthermore, containment measures have been taken all over the world every few days. we think that what differentiates a group of individuals from another is the immune system's response to this pathogen. hence the importance of vaccination to deal with infections. it has been thought that the role . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint of a vaccine was to protect from a specific disease. however, numerous immunological studies have concluded that a vaccine can have a non specific protective effect. at the beginning of the th century, calmette already noted that children vaccinated with bcg had a lower mortality rate . since then may have been born the principle of non specific effects of bcg vaccine. bcg was used in the s in clinical studies as a non specific immunotherapy for multiple malignant neoplasms. while severeal reports have show its efficiency in the treatments of melanoma and leukaemia, others were controversial making bcg use limited in such settings. nonethless, bcg has continued to be used for non-muscle-invasive bladder cancer since its first use in . , indeed, we currently know the mechanism of action of intravesical instillations of bcg and it seems that it is attributed to a local immune response characterized by induced expression of cytokines in the urine and bladder wall and by an influx of granulocytes and mononuclear and dendritic cells. faced with this set of elements, we hypothesized that bcg vaccination could have a protective effect against sars-cov- infection. initially, we found that upper middle and high income countries that never had universal bcg vaccination policy (group d) have a significant higher mortality rate. in order to reduce the bias due to diagnostic tests, we applied the rd index which is equal to deaths attributed to sars-cov- infection per million inhabitants (d) divided by the number of diagnostic tests per million inhabitants (t) multiplied by (rd = d / t x ). so we found the same observation as the first graph with a significant higher rd in middle and high income countries that never had universal bcg vaccination policy (group d). we concluded that bcg vaccination was a protective factor against sars-cov- infection. recent studies concerning covid- showed that advanced age represents an independent risk factor for this infection. , for this reason, we tried to establish whether the age of vaccination was a protective factor, especially for the older adults. we hypothesized that the older the vaccination, the better. therefore, we investigated the impact of the year of bcg vaccination introduction in each country. . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . we concluded that upper middle and high income countries that have a current universal bcg vaccination policy (group b) have a better cumulated survival than upper middle and high income countries that had universal bcg vaccination policy but which has been stopped (group c) after . we noticed that countries which applied a universal bcg vaccination policy before are protected against sars-cov- infection even if immunization ceased a few decades later. on the other hand, countries which applied a late vaccination policy (after ) and continue immunization are better protected than those that have stopped it. we therefore concluded that was a pivotal year. we conducted a comparative analysis which confirmed these findings. regarding the countries that started bcg vaccination before , there was no significant difference between countries that have an ongoing vaccination policy and those that stopped it (p= . ) few decades later. whereas countries which started the bcg vaccination after and those with current policies have a better rd index than countries that have stopped immunization (group b : rd= . ; group c : rd= . ; p= . ). our explanation is that the older adults are the main target of the sars-cov- infection and bcg vaccination is therefore a protective factor for the population currently aged or over. indeed, this finding corroborates the results of other studies which have concluded that the efficacy of bcg is generally maintained up to years after vaccination carried out during childhood. our study provided some elemnts of proof that universal bcg vaccination interfers favorably with covid- . however, a randomized controlled trial is required to confirm this finding and determine the necessary duration that the immune system needs to develop protection against sars-cov- infection. or results revealed that countries that never had universal bcg vaccination policy have a higher mortality (correlated to performed diagnostic tests) attributed to sars-cov- infection. we also highlighted that bcg vaccination was a protective factor against this disease. . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review) the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint developing the concept of beneficial non specific effect of live vaccines with epidemiological studies intracavitary bacillus calmette guerin in the treatment of superficial bladder tumors the bcg world atlas: a database of global bcg vaccination policies and practices world health organization. global civil registration and vital statistics: scaling up investment plan b public .pdf?sequence= &isallowed=y. accessed estimating the asymptomatic proportion of coronavirus disease (covid- ) cases on board the diamond princess cruise ship non-specific immunotherapy with b.c.g. in superficial bladder cancer: an overview non-specific effects of bcg vaccine on viral infections intravesical treatments of bladder cancer: review risk factors of fatal outcome in hospitalized subjects with coronavirus disease from a nationwide analysis in china estimating clinical severity of covid- from the transmission dynamics in wuhan, china long-term efficacy of bcg vaccine in americans indians and alaska natives figure : mortality correlated to diagnostic tests (index rd) attributed to sars-cov- infection in the four groups.. cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. (which was not certified by peer review)the copyright holder for this preprint this version posted may , . . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint figure : comparison of countries which applied a bcg vaccination policy before or after .. cc-by-nd . international license it is made available under a is the author/funder, who has granted medrxiv a license to display the preprint in perpetuity. the copyright holder for this preprint this version posted may , . . https://doi.org/ . / . . . doi: medrxiv preprint key: cord- -b uz sj authors: klinger, danielle; blass, ido; rappoport, nadav; linial, michal title: significantly improved covid- outcomes in countries with higher bcg vaccination coverage: a multivariable analysis date: - - journal: vaccines (basel) doi: . /vaccines sha: doc_id: cord_uid: b uz sj the covid- pandemic that started in china has spread within months to the entire globe. we tested the hypothesis that the vaccination against tuberculosis by bacille calmette–guérin vaccine (bcg) correlates with a better outcome for covid- patients. our analysis covers countries complying with predetermined thresholds on the population size and number of deaths per million (dpm). we found a strong negative correlation between the years of bcg administration and the dpm along with the progress of the pandemic, corroborated by permutation tests. the results from multivariable regression tests with economic, demographic, health-related, and pandemic restriction-related quantitative properties, substantiate the dominant contribution of bcg years to the covid- outcomes. the analysis of countries according to an age-group partition reveals that the strongest correlation is attributed to the coverage in bcg vaccination of the young population ( – years). furthermore, a strong correlation and statistical significance are associated with the degree of bcg coverage for the most recent years, but no association was observed in these years for other broadly used vaccination protocols for measles and rubella. we propose that bcg immunization coverage, especially among the most recently vaccinated population, contribute to attenuation of the spread and severity of the covid- pandemic. covid- has spread within months to countries across the globe. the country-specific reports that are compiled daily by the world health organization (who) and made publicly available, provide statistical information on the number of tests performed, the number of confirmed cases, deaths and the cumulative state of patients hospitalized in serious and critical conditions [ ] . along with the spread of the pandemic, most countries imposed a policy of social distancing and other regulation to mitigate covid- [ , ] . despite the intense effort, key epidemiological parameters are still missing [ ] [ ] [ ] [ ] [ ] [ ] . with , reported deaths and a world average of deaths per million (dpm, june th, ), the death toll remains the most reliable measure for monitoring the spread and progression of the disease across countries [ ] . while some european countries such as belgium and the uk the dpm is > , other infected countries (e.g., hungary, norway) are closer to the world information regarding covid- outcomes was extracted daily between january and may from the worldometers website [ ] using a crawler written in python software version . (https://www.python.org/downloads/release/python- ) [ ] . demographic measures of countries were extracted from the worldometers website on april [ ] . information regarding the share of population > years and economic development indicators were extracted from the world bank data [ ] . information on educational management and school closure, as a measure of the quarantine status of the country, was extracted from the unesco institute of statistics dataset [ ] . prevalence of chronic diseases (e.g., obesity, type diabetes) and the death rate from cardiovascular disorders were extracted from our world in data (ourworldindata.org) website. table s provides the source for this country-related information. information regarding past and present bcg administration practices in every country was extracted from the bcg world atlas [ ] . two vaccination status groups were considered: (i) countries that had either a current or past national mandatory vaccination policy ( in total), (ii) countries that have only administered bcg vaccinations to specific groups at risk ( in total). in the latter group, only a negligible fraction of the population is bcg vaccinated [ ] . in addition, the estimates for bcg, measles and rubella vaccination coverage between years and were extracted from the annual who reports [ ] . for additional resources used to establish the years of mandatory bcg administration see table s . countries were normalized by accounting for their population size (per m, pm). the normalized covid- outcomes that were considered are death (dpm), positively validated cases (cases per million (cpm)), hospitalization with serious and critical conditions (spm) and recovered (rpm). accounting for the varying stages of the pandemic in each country, we define a unified aligned key date of a country as the first date when dpm reached for the first time the dpm value of . or higher. the following analysis was conducted across changing dates following the key aligned date (at a range of - days). in binary or categorized tests, we applied the ranked wilcoxon test. for the continuous data, we applied linear regression. the regression fit and the calculated statistical significance (p-value) for the covid- vaccines , , of outcomes are reported. we tested the correlations between outcomes and years of bcg administration using pearson's correlation, and reported the analytic p-values as well as permutation tests' p-values. correlation robustness test was performed using repeating sub-sampling times % of countries. we report the high fraction of tests where correlations were significant (p-value < . ). a correlation between the bcg by age groups was determined by partitioning the population of each country into three groups: (i) years and younger; (ii) to years; (iii) years and older. from the age partition and the bcg coverage within each age group, a value that measures the percentage of the population weighted by the share of the age group with bcg is calculated. all analyses were conducted in r software version . . (https://cran.r-project.org/bin/windows/base/old/ . . /) [ ] . further details on the statistical approach and the data processing are available in text s . in order to increase the robustness of the analysis, countries were included in the selected cohort if their population size was > m, and they met the criteria of ≥ deaths per m population on april . altogether, there are countries with population size > m. among them, complied with both thresholds, covering . % of the world population. a regional partition of these countries is shown in figure . for detailed information on the countries included in the analyses, see table s . [ ] . further details on the statistical approach and the data processing are available in text s . in order to increase the robustness of the analysis, countries were included in the selected cohort if their population size was > m, and they met the criteria of ≥ deaths per m population on april . altogether, there are countries with population size > m. among them, complied with both thresholds, covering . % of the world population. a regional partition of these countries is shown in figure . for detailed information on the countries included in the analyses, see table s . first, we analyze covid- outcomes as the difference in deaths or cases per million (dpm and cpm, respectively). thus, the analysis was performed days following two different alignments of key dates (defined by dpm ≥ . and dpm ≥ ). figure shows strong and significant correlations between covid- outcomes and the number of years of bcg administration. we observed a strong negative correlation with dpm outcome with r = − . (p-value = . ) and − . (p-value = . ) when aligned at dpm threshold of . and , respectively (figure a, b) . similarly, for the cpm as covid- outcome, we observed a similar trend with r = − . (p-value = . ) and − . (p-value = . ) when aligned at dpm of ≥ . and dpm ≥ , respectively (figure c, d) . to test the generality of our observations we repeated the analysis at a broad range of time points along with the progress of the disease, starting from the th-day post alignment and showing the trends in -day intervals ( to days, figure ). for this analysis, we tested the outcomes of covid- confirmed serious/critical cases (spm) and the number of recovered (rpm), in addition to the dpm and cpm. the results of the dpm and spm show a highly significant association for all time first, we analyze covid- outcomes as the difference in deaths or cases per million (dpm and cpm, respectively). thus, the analysis was performed days following two different alignments of key dates (defined by dpm ≥ . and dpm ≥ ). figure shows strong and significant correlations between covid- outcomes and the number of years of bcg administration. we observed a strong negative correlation with dpm outcome with r = − . (p-value = . ) and − . (p-value = . ) when aligned at dpm threshold of . and , respectively (figure a points, corroborated by the robust results obtained from performing permutation tests for each time interval for all tested outcomes (table s ). an additional test for robustness was performed by repeating the correlation tests on % random subsamples of countries. we found that / of the dpm-and spm-examined dates presented significant results in more than % of random tests (table s ). correlations of years of bcg administration with dpm = . (a) and dpm = (b). correlation with cases per million (cpm) diff. at days when the key date was defined as cpm = . (c) and cpm = (d). dpm diff. and cpm diff. are calculated by the differences in the numbers from the measured date to alignment date. shaded areas represent the % confidence intervals. countries differ in many quantitative measurements like population size, gross domestic product (gdp), lifespan, median age and more. to control for some of the potential confounding factors, we included numerous demographic values for a multivariable linear regression. the analysis included demographic, economic, pandemic restriction-related and health-related dpm diff. and cpm diff. are calculated by the differences in the numbers from the measured date to alignment date. shaded areas represent the % confidence intervals. to test the generality of our observations we repeated the analysis at a broad range of time points along with the progress of the disease, starting from the th-day post alignment and showing the trends in -day intervals ( to days, figure ). for this analysis, we tested the outcomes of covid- confirmed serious/critical cases (spm) and the number of recovered (rpm), in addition to the dpm and cpm. the results of the dpm and spm show a highly significant association for all time points, corroborated by the robust results obtained from performing permutation tests for each time interval for all tested outcomes (table s ). an additional test for robustness was performed by repeating the correlation tests on % random subsamples of countries. we found that / of the dpm-and spm-examined dates presented significant results in more than % of random tests (table s ) . susceptible to a higher percentage of deaths [ , ] . in accordance with covid- age-associated risk, in the multivariable analysis the median age was associated with a strong positive coefficient. in addition, cancer percentage is also significant, and may reflect a confounding factor for lifespan and the rarity of cancer occurrence in the young population. the combined contribution of gender, chronic disease prevalence, and economy to the spread and fatality of covid- was already reported [ ] , and will not be further discussed. ( ) that were still at an earlier phase of the pandemic at the alignment date failed to provide information. dpm, cpm, spm and rpm stand for the number per million for death, validated cases, serious and critical conditions and recovered, respectively. for further details, see table s . due to the varying effect of each age group on the viral spread in the population, we next investigated the relevance of age groups to the observation showing that years of bcg administration are strongly correlated with better covid- outcomes. epidemiological studies from covid- positive cases in shenzhen china confirm the importance of the young group age in the spread of the disease [ ] . specifically, children ( - years) were considered fundamental in the chain of ( ) that were still at an earlier phase of the pandemic at the alignment date failed to provide information. dpm, cpm, spm and rpm stand for the number per million for death, validated cases, serious and critical conditions and recovered, respectively. for further details, see table s . countries differ in many quantitative measurements like population size, gross domestic product (gdp), lifespan, median age and more. to control for some of the potential confounding factors, we included numerous demographic values for a multivariable linear regression. the analysis included demographic, economic, pandemic restriction-related and health-related country-based variables. the results show that the number of bcg administration years ranks consistently within the top two most significant coefficients and is within the top coefficients with the larger effect (as measured by the normalized beta coefficient, out of coefficients) ( figure ). the results are consistent among the different times observed (for further analysis see table s ). notably, a strong positive beta coefficient value is associated with the median age. this may be due to the fact that countries with a higher median age, a parameter reflective of the lifespan and the demographic bulges [ ] , have a higher fraction of older residents. since a substantially higher risk of death is associated with infected older populations, countries with a higher median age are naturally susceptible to a higher percentage of deaths [ , ] . in accordance with covid- age-associated risk, in the multivariable analysis the median age was associated with a strong positive coefficient. in addition, cancer percentage is also significant, and may reflect a confounding factor for lifespan and the rarity of cancer occurrence in the young population. the combined contribution of gender, chronic disease prevalence, and economy to the spread and fatality of covid- was already reported [ ] , and will not be further discussed. significance with r = − . , p-value = . × − (figure a) , and the correlation with the age group of - years (at days) is also significant with r = − . , with a weaker significance (p-value = . , figure b ). both correlations remain significant throughout a -day period post alignment. remarkably, for the old age group (> years), at all the time-frames tested, the correlation was negligible and insignificant ( figure c ). notably, the age composition varies across countries. to examine the robustness of the results, we performed the same correlation analysis while not accounting for the actual fraction occupied by each of the age groups. the results ( days post alignment date) are very similar to those obtained by weighting the fraction of the different age groups. specifically, the correlation for the young age group is r = − . , p-value = × − ; middle age group is r = − . , p-value = . and the old age group is r = − . , p-value = . . we further tested the statistical significance for the other outcomes (spm, cpm and rpm), by age group according to population share, along different time points. figure d - f show the dominant contribution of the young age group to the negative correlation at - days post-alignment. notably, the outcome of recovered per million (rpm) has a significant negative correlation only among the young group. the drop in rpm significance from to days is consistent with the epidemiological survey reporting on the long-time gap until recovery [ ] . the middle age group (figure b,e) is mostly insignificant and shows a borderline significance for the dpm and spm as outcomes. all observations regarding the elderly (figure c ,f) are insignificant. we due to the varying effect of each age group on the viral spread in the population, we next investigated the relevance of age groups to the observation showing that years of bcg administration are strongly correlated with better covid- outcomes. epidemiological studies from covid- -positive cases in shenzhen china confirm the importance of the young group age in the spread of the disease [ ] . specifically, children ( - years) were considered fundamental in the chain of transmission [ ] . figure shows the correlation of total years of bcg administration with dpm difference according to the country-based age composition. the population in each country was partitioned to young (< years of age), working-class ( - years) and old (> years). the correlation with the young age group (tested at days post-alignment key dates) shows the highest significance with r = − . , p-value = . × − (figure a) , and the correlation with the age group of - years (at days) is also significant with r = − . , with a weaker significance (p-value = . , figure b ). both correlations remain significant throughout a -day period post alignment. remarkably, for the old age group (> years), at all the time-frames tested, the correlation was negligible and insignificant ( figure c) . notably, the age composition varies across countries. to examine the robustness of the results, we performed the same correlation analysis while not accounting for the actual fraction occupied by each of the age groups. the results ( days post alignment date) are very similar to those obtained by weighting the fraction of the different age groups. specifically, the correlation for the young age group is r = − . , p-value = × − ; middle age group is r = − . , p-value = . and the old age group is r = − . , p-value = . . we further tested the statistical significance for the other outcomes (spm, cpm and rpm), by age group according to population share, along different time points. figure d post-alignment. notably, the outcome of recovered per million (rpm) has a significant negative correlation only among the young group. the drop in rpm significance from to days is consistent with the epidemiological survey reporting on the long-time gap until recovery [ ] . the middle age group (figure b,e) is mostly insignificant and shows a borderline significance for the dpm and spm as outcomes. all observations regarding the elderly (figure c ,f) are insignificant. we conclude that the elderly group does not contribute to the strong correlation with bcg administration. conclude that the elderly group does not contribute to the strong correlation with bcg administration. the pronounced signal in the young age group led us to investigate whether recent immunization may have a positive effect on the outcome. we divided the countries into three disjoined groups representing their vaccination policies over the past years, disregarding the population share of the - age group in each country: (i) countries with mandatory immunization policies over the past years; (ii) countries with mandatory immunization policies, which were applied for less than . years within the past years; (iii) countries with no mandatory immunization policies over the past years (figure a) . applying a test with dpm outcome, yielded highly significant results across all tested post-alignment ( - days) dates, establishing that countries with bcg immunization policies over the past years have a significantly lower rate of dpm with respect with countries in group (iii). figure . bcg coverage with respect to the dpm difference among three age groups. all correlations (a-c) and statistical significance (d-f) were measured following the dpm ≥ . alignment key date. relative bcg coverage is partitioned to three age groups, weighted by population share: (a) young ( - years), (b) middle age ( - years) and (c) old age group (> years). notice that data points in panels a-c were slightly moved horizontally to help distinguish overlapping symbols. the histogram (d-f) shows the statistical significance of the correlation of bcg years of administration for the different covid- outcomes according to the age groups marked as: young (d) middle age (e) and elderly (f). days from the key alignment date are colored from light to dark purple ( to days). the statistical significance is shown as −log (p-value), the dashed red line indicates p-value of . . asterisk represents the outcome with a positive correlation. all results with a positive correlation, marked by asterisks (*), are insignificant. the significant result in the young age group raised the question of whether other immunizations might have a significant effect. to this end, we tested covid- outcome and the globally used immunization against measles and rubella. we divided the countries into two groups representing their vaccination coverage over the past years (as provided by the who): (i) countries figure . bcg coverage with respect to the dpm difference among three age groups. all correlations (a-c) and statistical significance (d-f) were measured following the dpm ≥ . alignment key date. relative bcg coverage is partitioned to three age groups, weighted by population share: (a) young ( - years), (b) middle age ( - years) and (c) old age group (> years). notice that data points in panels a-c were slightly moved horizontally to help distinguish overlapping symbols. the histogram (d-f) shows the statistical significance of the correlation of bcg years of administration for the different covid- outcomes according to the age groups marked as: young (d) middle age (e) and elderly (f). days from the key alignment date are colored from light to dark purple ( to days). the statistical significance is shown as −log (p-value), the dashed red line indicates p-value of . . asterisk represents the outcome with a positive correlation. all results with a positive correlation, marked by asterisks (*), are insignificant. the pronounced signal in the young age group led us to investigate whether recent immunization may have a positive effect on the outcome. we divided the countries into three disjoined groups representing their vaccination policies over the past years, disregarding the population share of the - age group in each country: (i) countries with mandatory immunization policies over the past years; (ii) countries with mandatory immunization policies, which were applied for less than . years within the past years; (iii) countries with no mandatory immunization policies over the past years (figure a) . applying a test with dpm outcome, yielded highly significant results across all tested post-alignment ( - days) dates, establishing that countries with bcg immunization policies over the past years have a significantly lower rate of dpm with respect with countries in group (iii). coverage of mcv (measles containing vaccine) is high in recent years, with an average of % in , as provided by the who, the mcv coverage from shows substantial variation (e.g., . % in india, . % in italy, . % in algeria, . % in belgium) [ ] . applying the wilcoxon test, yielded insignificant results at all tested dates ( - days post alignment). opposite to the bcg results, we found no correlation between the degree of measles and rubella vaccination coverage and covid- outcomes (figure b,c) . all data needed to evaluate the conclusions in the paper are present in the paper and in the supplemental materials. an online tool for displaying the analytical results is available at: https://covi.shinyapps.io/covid /. it is a useful analytical webtool for single variant statistics, correlations, multivariable analyses and more. the user-friendly platform allows the changing of parameters by setting a threshold on population size, the time along the pandemic progression, selecting predetermined outcomes as a reference date for the alignment and changing the thresholds for alignment date. the code and data are available at: https://github.com/nadavrap/covid . additional data and support related to this study may be requested from the authors. the significantly strong correlation between the bcg vaccination and better outcomes for covid- is shown across many countries, covering the majority of the world population ( figure and table s ). the findings are based on an unbiased view of all countries that comply with predetermined thresholds for dpm and population size (see materials and methods). the strong negative correlation between the bcg administration years and dpm was sustained at a range of time-points from the aligned-date (figure ) . for testing the stability of the dpm correlation, we repeated the analysis for additional covid- outcomes. we consider the number of the significant result in the young age group raised the question of whether other immunizations might have a significant effect. to this end, we tested covid- outcome and the globally used immunization against measles and rubella. we divided the countries into two groups representing their vaccination coverage over the past years (as provided by the who): (i) countries with above median coverage; (ii) countries with below median coverage. while the world overall coverage of mcv (measles containing vaccine) is high in recent years, with an average of % in , as provided by the who, the mcv coverage from shows substantial variation (e.g., . % in india, . % in italy, . % in algeria, . % in belgium) [ ] . applying the wilcoxon test, yielded insignificant results at all tested dates ( - days post alignment). opposite to the bcg results, we found no correlation between the degree of measles and rubella vaccination coverage and covid- outcomes (figure b,c) . all data needed to evaluate the conclusions in the paper are present in the paper and in the supplemental materials. an online tool for displaying the analytical results is available at: https://covi.shinyapps.io/covid /. it is a useful analytical webtool for single variant statistics, correlations, multivariable analyses and more. the user-friendly platform allows the changing of parameters by setting a threshold on population size, the time along the pandemic progression, selecting predetermined outcomes as a reference date for the alignment and changing the thresholds for alignment date. the code and data are available at: https://github.com/nadavrap/covid . additional data and support related to this study may be requested from the authors. the significantly strong correlation between the bcg vaccination and better outcomes for covid- is shown across many countries, covering the majority of the world population ( figure and table s ). the findings are based on an unbiased view of all countries that comply with predetermined thresholds for dpm and population size (see materials and methods). the strong negative correlation between the bcg administration years and dpm was sustained at a range of time-points from the aligned-date (figure ) . for testing the stability of the dpm correlation, we repeated the analysis for additional covid- outcomes. we consider the number of hospitalized people (at a specific date) which were indicated by a serious or critical condition (spm). this measurement is strongly dependent on the health care capacity and the actual phase of the pandemic. using the spm rather than the dpm as a measure shows that the trend of the bcg administration year remains stable and significant ( figure ). as expected, the negative correlation to covid- validated positive cases (cpm) is weaker relative to dpm. cpm is likely to reflect the capacity of different countries to carry out reliable molecular tests (pcr-based) or clinical tests (lung ct pathology) [ ] , and the national policy for targeted testing [ ] . we observed no significant correlation for the country-level number of recovered (rpm). we attribute it to the non-standardized definition for covid- recovery [ ] , the time delay for confirmed recovery [ ] . altogether, rpm is the least reliable outcome as the pandemic peak ranges greatly among countries. our multivariable analysis highlights the strength of combining a broad range of country-based quantitative observations. among the analyzed variables are the economic measures [ ] , health system capacity (e.g., doctors per people), population composition, exposure to infectious diseases (e.g., prevalence of tb), pandemic restriction-related measures (i.e., school closure dates), major comorbidities (e.g., cancer, diabetes) and habits (e.g., smoking by sex). many of these measures are correlated and may reflect confounding factors. most importantly, the multivariable analysis validated the importance and statistical significance of bcg immunization years given all other variables (figure ). policy toward quarantine, enforcement of isolation regulation (e.g., closure of cultural events, public transportation) were implemented at a country-based time point. for example, we included the number of days of closing the educational facilities relative to country alignment date as a variable in the analysis. it was used as a proxy for the level of the constraints imposed along the pandemic progression [ ] . while it is expected to have a strong impact on covid- spread [ , ] , this variable did not contribute to rejecting the hypothesis, and had a minimal impact on the multivariable analysis ( figure ) . the exact date of bcg administration within each country, combined with the actual immunization coverage (provided by the who) and the population structure, allowed us to explicitly test the effect over time of the bcg immunization. specifically, partitioning the population to young group, middle-age group and elderly confirmed that the strongest signal towards covid- outcome is associated with young (< years, figure ) and slightly also to the middle age group ( - years). however, the elderly (> years) that are at the highest risk for covid- mortality do not correlate with bcg higher coverage. the implication of our observation for covid- epidemiology and pandemic dynamics is evident [ ] . our results suggest that in countries where the young population is vaccinated by bcg, a maximal protection is provided to the whole population. in countries where the young and middle-aged population groups were vaccinated, a significantly lower number of cases and deaths in the total population were observed ( figure ) . universally, the dpm among young people is very low ( . % for < years) [ ] . therefore, the main contribution of the young age is with regards to the impact on the chain of infection [ , , ] . children and young adults (tested for ages - years) tend to make more social contacts than adults and hence are likely to contribute more to transmission than adults [ , ] . the middle-age group ( - years) overlaps with the group that is specified by an extensive cross-generation social interaction [ , ] . thus, the higher bcg coverage of the young and middle-aged groups is associated with the attenuation of overall infection rate. the lack of correlation between bcg coverage for the elderly (> years) and covid- outcomes is in accord with the negligible impact of this population on viral transmission to the community [ , ] . several reports proposed that bcg-vaccinated populations are resistant to viruses, and in particular toward sars-cov- [ ] . despite the broad usage of bcg for almost a century, and the underlying mode of action, the indirect long-term effect of bcg on the immune system remains enigmatic [ ] [ ] [ ] . it is postulated that the positive effect of bcg immunization on covid- outcomes is achieved by an improved systemic immunity which applies to the most recently vaccinated group. accordingly, the younger age group that was recently vaccinated is likely to benefit from an immunological protection whereas the older age group (that was vaccinated by bcg over years ago) are unlikely to display bcg-driven immune protection. we found no correlation between the degree of measles and rubella vaccination coverage and covid- outcomes (figure ) . these immunizations were shown to have some reduced susceptibility to viral infection [ ] . there are several limitations that need to be addressed in supporting our main findings and the conclusions from this study. the first difficulty stems from the fact that countries vary greatly by their area, population density and age structure that can mask the apparent bcg protective effect [ ] . moreover, difference in culture and habits (e.g., religious gathering, social distancing, smoking), economy, demography and the capacity of the health system often cannot be easily generalized. in addition, our results may potentially be driven by a small number of influential countries. to address some of these inherent difficulties, we duplicated the analyses for countries that were bounded by population size (> m and < m). we observed no effect on the main findings as shown in figures s and s . moreover, an analysis that relies on covid- static information is likely to suffer from unstable findings due to unpredicting trends on the pandemic dynamic [ , ] . by altering the threshold for the alignment date, we confirmed the robustness of the results (figure ) . in addition, we tested for significance using sub-sampling tests. when randomly sampling % of the countries (with repeated tests), we found the / of the dpm-and spm-examined dates presented significant results in more than % of random tests (table s ). the underlying mechanism by which bcg exerts its beneficial effect on infectious diseases is not fully resolved [ , ] . recent evidence highlights the importance of reprograming of the innate system [ ] and enhancing the response of heterologous t helper cells [ ] . overall, the efficacy of bcg against tb is expected to cover approximately years [ ] . thus, the strong statistical significance value for bcg being most effective for a recently immunized population argues that the active immunization phase rather than a residual non-specific protection from early-life events is associated with a better covid- outcome [ , ] . knowledge on the long-lasting effects of bcg on the immune system is essential for designing in-vivo experiments and ultimately effective vaccines. some of the reported inconsistency with respect to the bcg-induced immune response was attributed to differences in the bcg strains, manufacturing methodology, and route of administration [ ] . several in-vitro assays showed that different sources of bcg are associated with a range of clinical efficacies [ ] . moreover, an improved protection for tb in rhesus macaques was reported for bcg that was admitted by repeated pulmonary mucosal delivery rather than by the default injection protocol [ ] . we propose that future clinical trials for testing the impact of bcg on covid- should consider the strain origin and the modes of bcg immunization. our results cannot exclude the possibility that a "pre-trained" state of immunity by bcg immunization exerts its positive effect, thus improving covid- outcome at a population level. the finding that shows a strong and robust association of bcg coverage in the young age group with improved covid- outcomes in the whole population calls for ongoing monitoring of the evolution of the pandemic world-wide. to this end, we developed a user-friendly platform with the capacity to change any of the dynamic parameters according to the pandemic progression. we conclude that the inverse correlation with bcg administration years, the impact of a recent vaccination, and the validated role of the young population in the spread of covid- calls for revisiting the global and national bcg immunization policy [ , , ] . a growing number of clinical trials for testing the efficacy of bcg vaccination have been initiated. in one such trial, bcg was admitted once a month for consecutive months in the elderly ( - years old) to test the prevention of acute upper respiratory tract infection. the results show significant prevention of infection in parallel to an improved response of t-helper cells [ ] . several on-going randomized controlled clinical trials cover different populations and several bcg strains. in one trial (named badas, usa), participates will be introduced to the bcg tice strain, while in a larger trial (called brace, australia) there will be over k healthcare workers tested by the danish strain . the goals in all these clinical trials are to determine if bcg vaccination reduces the incidence and severity of the covid- pandemic [ , ] . while the who does not recommend bcg vaccination for prevention of covid- , we anticipate that the results of the bcg immunization clinical trials will provide guidelines for better controlling covid- spread and severity. without derogating from the importance of the results of clinical trials on the individual level, our opinion is that they will not necessarily directly affect country-wise epidemiological decisions. the reason is that minor results in clinical trials (such as %) do not have the same effect at the individual level, in comparison with the population level-where even minor reductions in viral transmission can have major impact in terms of the pandemic's spread, population morbidity and mortality toll. supplementary materials: the following are available online at http://www.mdpi.com/ - x/ / / /s , figure s : correlation of bcg years of admission and covid- outcomes for countries bounded by a population size of > m, figure s : results from a multivariable analysis for countries bounded by a population size of > m, table s : variable resources across countries and populations, table s : additional resources on bcg administration years by country, table s : country cohort of countries used in the study, table s : correlations and p-values of regression of years of bcg administrations and different outcomes including permutation tests, table s : multivariable results at numerous time points for bcg years of admission, table s : sub-sampling of countries for years of bcg administration and covid- outcome, text s : this includes supplementary methods and resources used in this study. reported estimates of bcg coverage; world health organization demographic science aids in understanding the spread and fatality rates of covid- covid- and community mitigation strategies in a pandemic real-time estimation of the risk of death from novel coronavirus (covid- ) infection: inference using exported cases unique epidemiological and clinical features of the emerging novel coronavirus pneumonia (covid- ) implicate special control measures how will country-based mitigation measures influence the course of the covid- epidemic? clinical predictors of mortality due to covid- based on an analysis of data of patients from wuhan, china presumed asymptomatic carrier transmission of covid- risk assessment of novel coronavirus covid- outbreaks outside china why daily death tolls have become unusually important in understanding the coronavirus pandemic case-fatality rate and characteristics of patients dying in relation to covid- in italy preparedness and vulnerability of african countries against importations of covid- : a modelling study the potential for a more effective tb vaccine relationship between bacille calmette-guerin (bcg) strains and the efficacy of bcg vaccine in the prevention of tuberculosis global epidemiology of tuberculosis the impact of migration on tuberculosis epidemiology and control in high-income countries: a review non-specific effects of bcg vaccine on viral infections published online at worldmeters.info, dover centrum voor wiskunde en informatica (cwi) the bcg world atlas: a database of global bcg vaccination policies and practices population ages and above (% of total population) transition to online education in schools during a sars-cov- coronavirus (covid- ) pandemic in georgia r: a language and environment for statistical computing; r foundation for statistical computing clinical characteristics of deceased patients with coronavirus disease : retrospective study estimating clinical severity of covid- from the transmission dynamics in wuhan, china epidemiology and transmission of covid- in cases and of their close contacts in shenzhen, china: a retrospective cohort study covid- in children: the link in the transmission chain epidemiological parameters of coronavirus disease : a pooled analysis of publicly reported individual data of cases from seven countries correlation of chest ct and rt-pcr testing in coronavirus disease (covid- ) in china: a report of cases countries test tactics in 'war' against covid- characteristics of and important lessons from the coronavirus disease (covid- ) outbreak in china: summary of a report of cases from the chinese center for disease control and prevention managing covid- in low-and middle-income countries school closure and management practices during coronavirus outbreaks including covid- : a rapid systematic review association of public health interventions with the epidemiology of the covid- outbreak in wuhan, china age-dependent effects in the transmission and control of covid- epidemics clinical and epidemiological features of children with coronavirus disease (covid- ) in zhejiang, china: an observational cohort study what are the underlying transmission patterns of covid- outbreak? -an age-specific social contact characterization transmission potential and severity of covid- in south korea is global bcg vaccination coverage relevant to the progression of sars-cov- pandemic? med. hypotheses bcg: its impact on tuberculosis and relevance to autoimmune disease heterologous effects of infant bcg vaccination: potential mechanisms of immunity is the prevalence of wheeze in children altered by neonatal bcg vaccination? intralesional immunotherapy for the treatment of warts: a network meta-analysis the spread of covid- and the bcg vaccine: a natural experiment in reunified germany time-adjusted analysis shows weak associations between bcg vaccination policy and covid- disease progression bcg-induced trained immunity: can it offer protection against covid- ? bcg-induced protection: effects on innate immune memory what have we learnt about bcg vaccination in the last years? front bcg educates hematopoietic stem cells to generate protective innate immunity against tuberculosis long-lasting effects of bcg vaccination on both heterologous th /th responses and innate trained immunity bcg and vole bacillus vaccines in the prevention of tuberculosis in adolescence and early adult life routine childhood immunization may protect against covid- characteristics of peripheral lymphocyte subset alteration in covid- pneumonia the humoral immune response to bcg vaccination bcg as a case study for precision vaccine development: lessons from vaccine heterogeneity, trained immunity, and immune ontogeny prevention of tuberculosis infection and disease by local bcg in repeatedly exposed rhesus macaques the efficacy of bacillus calmette-guerin vaccinations for the prevention of acute upper respiratory tract infection in the elderly can a century-old tb vaccine steel the immune system against the new coronavirus covid- vaccination clinical trials should consider multiple doses of bcg. die pharm. , , . © by the authors we thank the biomedical community for valuable comments for the original version in medrxiv. we thank herve bercovier for his comments and for sharing with us the fascinating history of the bcg. we thank nati linial and the linial's lab for suggestions and fruitful discussions. the authors declare no conflict of interest. key: cord- -qa grviy authors: nasereddin, adeeb; dinur-schejter, yael; shadur, bella; zaidman, irina; even-or, ehud; averbuch, diana; shamriz, oded; tal, yuval; shaag, avraham; warnatz, klaus; elpeleg, orly; stepensky, polina title: bacillus calmette–guerin (bcg) vaccine-associated complications in immunodeficient patients following stem cell transplantation date: - - journal: j clin immunol doi: . /s - - - sha: doc_id: cord_uid: qa grviy purpose: bacillus calmette–guerin (bcg) is a live attenuated vaccine with the potential of causing severe iatrogenic complications in patients with primary immunodeficiency diseases (pid) before and after hematopoietic stem cell transplantation (hsct). we aim to investigate risk factors of post-hsct bcg-related complications in pid patients. methods: a retrospective analysis of pediatric pid patients who had received the bcg vaccine and underwent hsct at hadassah-hebrew university medical center, between and . results: we found / ( . %) patients who developed post-hsct bcg-related complications. the most significant risk factor for developing bcg-related complications was t cell deficiency ( . % of the non-complicated vs . % of the bcgitis and % of the bcgosis groups had t cell lymphopenia, p = . ). none of the chronic granulomatous patients developed bcg-related manifestation post-transplant. among t cell–deficient patients, lower nk ( vs cells/μl, p = . ) cell counts and nk-scid were risk factors for ongoing post-hsct bcgosis, as was pretransplant disseminated bcgosis ( . % of patients with bcgosis vs none of the non-bcgosis patients, p = . ). immune reconstitution inflammatory syndrome (iris) was observed in / patients with omenn syndrome. prophylactic antimycobacterial treatment was not proven effective. conclusion: bcg vaccination can cause significant morbidity and mortality in the post-transplant t cell–deficient patient, especially in the presence of pre-transplant disease. taking a detailed medical history prior to administering, the bcg vaccine is crucial for prevention of this complication. mycobacterium tuberculosis (mtb) is a significant worldwide health threat [ ] . bacillus calmette-guerin (bcg) vaccine has been used widely since to prevent tuberculosis (tb) [ , ] , and a large proportion of the world's population is vaccinated with bcg soon after birth. nevertheless, the estimated prevalence of bcg side effects is : and : , for localized and disseminated complications, respectively [ ] . bcg-related complications can be subdivided into local (vaccine area) or regional (adjacent lymph-node) vaccine-related complications referred to as bcgitis, versus distant (affecting one site) or disseminated (affecting > site and/or blood) bcg infection, referred to as bcgosis [ , ] . either pattern can be a manifestation of an ongoing infection or can represent an immune reconstitution inflammatory syndrome (iris). since bcg is a live attenuated vaccine, complication rates are significantly increased in immunodeficient individuals [ , [ ] [ ] [ ] [ ] [ ] [ ] , especially so in patients with t cell defects, mendelian susceptibility to mycobacterial disease (msmd), or chronic granulomatous disease (cgd) [ ] [ ] [ ] ] , reflecting the main mechanisms of defense against mycobacteria. for t cell defects, this susceptibly is related to the inability to produce an effective th response [ ] . msmd patients suffer from defects in the interleukin (il)- /il- /interferon (ifn) γ circuit [ ] and cgd, caused by defects in the nadph oxidase complex, adversely affect the macrophage's and neutrophil's ability to kill phagocytosed bacilli [ , ] . severe combined immunodeficiency (scid) is the most common diagnosis among bcg-complicated primary immunodeficiency (pid) patients [ , ] ( - % of bcg-vaccinated scid patients), with the highest mortality rate ( . %) [ ] . lower t cell counts, younger age at vaccination [ ] , and natural killer (nk)-scid [ ] are risk factors for bcg-related complications. little is known about the prevalence and risks for bcgrelated complications in the post-transplant setting. in this study, we summarize our experience with bcg vaccinerelated complications in pid patients in the posthematopoietic stem cell transplantation (hsct) period. this study was conducted at hadassah hebrew university medical center in jerusalem. we retrospectively collected data from pediatric patients with inborn phagocytic or t cell defects who underwent hsct between january and december , after having received the bcg vaccine. patients were divided into combined (t cell mediated) and phagocytic defects based on the international union of immunological societies (iuis) classification of pids [ ] . scid was defined in t cell-deficient patients, who presented in the first year of life and had cd counts < cells/μl [ ] . pt without available pre-hsct cd count, but with il rg mutation and a classical scid phenotype, was also considered a scid patient. all patients had received their vaccines within the first week of life, as per the russian and palestinian schedules. a total of of patients had been vaccinated in the palestinian authority with the bcg danish- strain. four patients (p , p , p , and p ) had received the moscow- strain in russia. prophylactic antimycobacterial treatment was given as per our protocol, which varied over time. since , patients with severe t cell deficiency and a history of bcg vaccine were given triple therapy (isoniazid, rifampin, and ethambutol), while rifampin was substituted during hsct with ciprofloxacin to avoid drug interactions. treatment of symptomatic bcg complications was tailored per patient. in general, antimycobacterial treatment was intensified, and in cases of lack of improvement under such a regimen, along with signs of hyperinflammation (fever, increase in inflammatory markers) steroid treatment was added. we recorded baseline patient characteristics, timing, and nature of bcg complications, prophylactic and treatment regimens, immunological work up, transplant characteristics, and outcome. graft-versus-host disease (gvhd) grading was based on the glucksberg grading [ ] . genetic diagnosis was made via whole exome sequencing (wes) in patients and confirmed by sanger sequencing as described elsewhere [ ] . for patients who were of the same kindred, diagnosis was done via wes in the index case and confirmed in family members by sanger sequencing. patients - were diagnosed via a cgd genetic panel. bcg-related complications were diagnosed based on clinical assessment of the treating physicians, supplemented with microbiology and pathology results whenever available. complications were categorized as "infectious" when pre-transplant symptomatic disease further disseminated in the context of increased immune suppression, or disease manifestation emerged in the context of reduced immune function, or "inflammatory" when symptoms appeared for the first time shortly (within days) after engraftment. in cases without symptomatic pre-transplant bcgosis, in which symptoms appeared prior to engraftment, it was impossible to discern worsening infection in the context of immune suppression from inflammatory reaction of donor t-cells, and therefore, we deemed these cases as "undetermined." bcgitis was defined as local and/or the regional lymph node bcg infection, while bcgosis was defined as distant/disseminated disease [ ] . statistical analysis was conducted with the ibm_spss statistics . version (ibm inc., armonk, ny). cumulative survival curve was calculated using xlstat . . version. fisher exact test was used for categorical variables. mann-withney u test and the kruskal-wallis h tests were used for and groups of independent numerical variables, respectively. kaplan-meier method was used for survival analysis. all statistical analyses conducted a -tailed test with a confidence level of %. this study was approved by hadassah's institutional review board. thirty-six pediatric patients who underwent hsct for phagocytic and t cell defects in hadassah medical center between and , and had received the bcg vaccine prior to transplant, were included in this study (table ) . fifteen ( . %) developed post-transplant bcg-related complications: patients ( %) had bcgitis, while patients ( %) had bcgosis. twenty-four patients were transplanted for t cell defects, while had phagocytic defects. genetic diagnoses are detailed in tables and . baseline diagnoses significantly differed between complication groups: while only . % of the bcg-uncomplicated patients had a t cell deficiency, . % of the bcgitis and all bcgosis patients had a t cell defect (table ) . this difference in baseline immune defect accounts for non-complicated patients' older age at the time of transplant compared with patients with bcgitis or bcgosis ( . versus . and . months old, respectively, p = . ), as well as the increased use of prophylactic antimycobacterial treatment in this group, considering our institutional protocol ( . % in the bcgosis group vs . % and . % in the bcgitis and non-complication groups, respectively, p = . ). pre-transplantation bcgosis was a predictor for post-transplant disseminated disease ( % and . % cumulative incidence of post-transplant bcgosis among patients with and without pre-transplant disease, respectively, p = . fig. ). transplant variables are detailed in tables and . donor, graft source and dose, conditioning regimen, and gvhd prophylaxis did not differ between groups. all transplants in this cohort were first transplants, and none of the patients required a second procedure. considering their increased rate of bcg-related complications, we analyzed t cell-deficient patients separately (table ). on a pooled analysis of bcgosis patients compared with non-complicated and bcgitis patients, those with bcgosis were younger at the time of transplant (mean age . vs . months, p = . ) and were more likely to have suffered from bcgosis prior to transplantation ( . % of the bcgosis group vs none of the non-bcgosis group, p = . ). nk-cell counts prior to transplantation in bcgosis patients were significantly lower compared with the non-bcgosis group ( vs cells/μl, p = . ). in order to delineate other risk factors, t celldeficient patients without a pre-hsct history of bcg infection were analyzed separately: those who developed bcgosis had lower pre-hsct cd ( vs cells/ μl, p = . ) and nk-cell counts ( vs cells/μl, p = . ), but also a shorter diagnosis to transplant interval (mean time . vs . months, p = . ) (fig. ) . among eight asymptomatic t cell-deficient patients receiving antimycobacterial prophylaxis prior to transplantation, % developed post-transplant bcgosis versus twothirteenths ( . %) of untreated patients (p = . ). prophylactic regimens did not differ between patients who developed bcgosis and those who did not (mean number of younger age at transplantation and a shorter diagnosis to transplant interval, observed in t cell-deficient patients who developed post-hsct bcgosis, are potential markers for a more severe baseline condition. we therefore analyzed the neutrophil count did not fall below cells/mm c extent of infection was defined as local (injection site) reaction, regional (regional ln, ipsilateral to vaccine site), distant (any single site beyond local/regional), and disseminated (involvement of more than one distant site and/or blood/bone marrow involvement) ( ) a. acute, aiha autoimmune hemolytic anemia, table ) . four patients presented with infectious complications: pt , pt , and pt had severe bcgosis prior to transplantation, and their infection disseminated further during transplantrelated immunosuppression. both pt and pt had viable bacilli in pathology or microbiological specimens (table ) . while pt 's duodenal biopsy revealed chronic mild inflammation without granulomas, pt 's initial biopsies revealed granulomas which were absent in subsequent biopsies, suggesting a declining immune function [ ] . in another patient (pt ), deteriorating immune function following a decline in donor chimerism had uncovered a bcg infection, as evident by positive gastric aspirate cultures and granulomas with acidfast bacteria (afb) on lymph-node (ln) biopsy. eight patients presented with inflammatory complications ( table ). these were characterized by initial local/regional disease on average day + . (range - days) post-hsct, followed by further dissemination in patients. another patients (pt , pt , pt ) without pre-transplant disease had developed symptoms prior to engraftment; thus, it was impossible to differentiate donor cell allo-reactivity from unmasked previously asymptomatic infection in the context of immune suppression in these cases. five patients demonstrated a switch from positive to sterile cultures following antimycobacterial treatment: while of these patients (pt , pt , pt , and pt ) had evidence of granulomatous inflammation, suggestive of iris [ ] , pt exhibited a switch from a mononuclear infiltrate with positive ziehl-neelsen (zn) stain on an early skin specimen, into a foamy histiocytic infiltrate with multinucleated giant cells on a subsequent specimen. these changes are suggestive of a transition from active infection to iris following engraftment [ ] . of patients receiving dli, only one (pt ) suffered further worsening of her skin bcgosis days following dli. mean follow-up was . months (range - months) and did not differ significantly between groups ( . , . , and . months for non-complicated, bcgitis and bcgosis groups, respectively, p = . ). patients with bcgosis had significantly lower donor chimerism on day + compared with non-bcgosis patients ( (table ) . overall survival (os) in our cohort was . % ( / patients) and was comparable between t cell-deficient and phagocytic defect patients ( . % and . %, p = . ). in t celldeficient patients, os did not significantly differ among complication groups (os = . %, % and . % in the non-complicated, bcgitis and bcgosis respectively, p = . ; fig. ). however, none of the t cell-deficient patients with a history of pre-hsct bcgosis survived transplant, whereas survival rate without such history was . % ( fig. ; p < . ). all three patients with t cell defects who suffered of pretransplant bcgosis died in the post-transplant period ( table ) (table ). in this retrospective observational study, we compare pid patients with bcg vaccine-related post-hsct complications to bcg-vaccinated patients without such complications. patients with t cell deficiencies were at an increased risk of developing bcg-related complications compared with phagocytic defect patients. indeed, post-hsct, bcg-related complications have been reported in t cell deficiencies [ , [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] but have not so far been described in phagocytic defects. despite the well-known association between cgd and bcg [ , , , ] , none of our bcg-vaccinated cgd patients, including a patient with pre-transplant bcgosis, developed post-hsct complications. these findings, in agreement with previous reports [ , ] , point to the central role of t cells in control of chronic mycobacterial infection and in mycobacterial-related iris [ ] . history of pre-transplant disease is a major risk factor for post-hsct bcgosis ( fig. ; table ) as well as mortality (fig. ) . in a review of the literature, / ( . %) scid patients with pre-transplant bcgosis died in the posttransplant period [ , - , , , , , ] . increased mortality of pre-hsct symptomatic patients was not found to be affected by antimycobacterial treatment [ ] . post-transplant treatment with anti-il and abatacept for prevention of inflammatory complications was recently reported in a small cohort [ ] as both effective and safe. these results warrant further validation in larger, prospective studies. among t cell-deficient patients who had no pre-transplant bcgosis, lower baseline cd counts were found to be a risk factor for post-transplant bcgosis (fig. ) . poor t cell function was previously described as a risk factor for both bcg infection [ , ] and future iris [ ] . lower nk-cell counts were found both in the t cell deficiency cohort, and in scid patients specifically, and indeed, half of the patients in our scid cohort who developed bcgosis had nk-scid. this is compatible with a recent report [ ] , which identified a fold higher number of nk negative scid patients compared with nk positive scid patients among the patients with bcg-related complications. nk cells have a role in control of mycobacterial infection, through the secretion of ifn-γ and tnfα as well as via direct contact [ , ] . various mechanisms have been ascribed to post-transplant bcg-related complications [ ] . these can generally be divided into worsening of infection in the context of intensified immune suppression, versus increased inflammation in the context of an improved immune function. iris, defined as the restoration of an immune response against pathogenspecific antigens resulting in immunopathology, requires a functional immune system as a pre-requisite for diagnosis [ ] . features in our cohort consistent with iris included close association with engraftment and granuloma formation [ , ] , regardless of bacilli vitality. features consistent with an infectious-driven process included active pre-transplant infection, poor immune reconstitution, and viable bacilli [ ] . nevertheless, distinguishing a predominant infectious process from an inflammatory reaction is challenging [ ] , since both mechanisms co-exist in the same patient during immune reconstitution. gantzer et al. [ ] demonstrated a switch from a diffuse histiocytic granuloma-negative infiltration with positive afb to a cd -rich, af negative, granulomatous inflammation, as immunity was restored. biopsy results can be helpful in distinguishing iris-related lesions from infectious worsening. three of five patients in our cohort who presented with omenn syndrome developed iris. while there is not enough data to establish omenn syndrome as a risk factor for post-hsct bcg-related complications, it is possible that the switch from a th milieu in omenn syndrome [ ] , known to inhibit mycobacterial immune response [ ] , to a th milieu in the post-hsct period increased the risk of developing iris. certainly, a shift from a th to th / th predominance is known to occur in multiple settings associated with iris [ , , ] . there is no consensus regarding prophylactic treatment in pid patients [ ] . in a previous retrospective analysis [ ] , only % of scid patients receiving secondary prophylaxis developed bcg-related complications. however, prophylactic treatment did not improve os. in our hands, post-exposure prophylaxis did not mitigate the risk for developing bcgosis. nevertheless, as prospective controlled studies are lacking, we continue recommending a triple prophylactic regimen for profoundly t cell-deficient patients who have received the bcg vaccine. another point to consider in prospective studies is the use of prophylaxis against inflammatory complications, as suggested in a recent report [ ] . there are currently no guidelines for treatment of post-hsct bcg disease, and diverse regimens have been used [ , - , - , , , , , , ] . treatment modalities other than anti-microbials include steroids [ , , , , ] , surgical treatment, [ , , , , ] ifnγ, [ ] and anti-il and anti-il- r antagonists [ ] . our treatment protocol includes a triple regimen until clinical and radiological resolution of disease, as well as immune reconstitution. a recent report [ ] eases safety concerns regarding anti-inflammatory treatment for iris on immune reconstitution. however, further studies are needed to better define the efficacy, safety, and need of such treatments in the post-transplant settings. finally, the who recommends avoiding bcg vaccination for immunodeficient infants [ ] . these guidelines, however justified, are difficult to implement, due to immunization timing. furthermore, neonatal screening does not encompass the wide range of bcg-associated pids and is currently not available in the countries with the highest burden of mycobacterial disease. recommendations to postpone vaccination in at risk infants [ ] [ ] [ ] must be weighed against the global health impact of bcg vaccination. recently, the covid- epidemic has stimulated new interest in the bcg vaccine for its possible non-specific protective effects through trained innate immunity, though evidence of efficacy of bcg vaccination against covid- is lacking [ , ] . thus, while vaccine delay across all populations is neither practical nor advisable, we recommend that the possibility of pid should be considered prior to vaccination, especially in areas with a high prevalence of consanguinity. bcg vaccination causes significant morbidity and mortality in pid patients, especially during post-transplantation immune reconstitution. disseminated mycobacterial infection after hsct is observed mainly in profound t cell deficiencies despite appropriate antibiotic treatment, with increased risk in nk-scid. pre-transplant infection is a significant negative prognostic factor. taking a detailed medical and family history prior to administering the bcg vaccine is crucial and possibly lifesaving. finally, there is a need for consensus guidelines for the prophylaxis and treatment of bcg disease in pid patients both prior to and following hsct. bcg vaccines: their mechanisms of attenuation and impact on safety and protective efficacy bcg vaccination in patients with severe combined immunodeficiency: complications, risks, and vaccination policies bacille calmette-guerin vaccine-induced disease in hivinfected and hiv-uninfected children clinical characteristics and immunogenetics of bcgosis/bcgitis in chinese children: a year follow-up study primary immunodeficiency diseases and bacillus calmette-guérin (bcg)-vaccine-derived complications: a systematic review bacillus calmette-guérin (bcg) complications associated with primary immunodeficiency diseases disseminated bacillus calmette-guérin (bcg) infections in infants with immunodeficiency immunologic aspects of patients with disseminated bacille calmette-guerin disease in north-west of iran immune defects in active mycobacterial diseases in patients with primary immunodeficiency diseases (pids) life-threatening infections due to live-attenuated vaccines: early manifestations of inborn errors of immunity revisiting human il- rβ deficiency: a survey of patients from countries mycobacterial disease in patients with chronic granulomatous disease: a retrospective analysis of cases international union of immunological societies: primary immunodeficiency diseases committee report on inborn errors of immunity defining combined immunodeficiency clinical manifestations of graft-versus-host disease in human recipients of marrow from hl-a-matched sibling donors deep intronic mis-splicing mutation in jak gene underlies t-b+nk-severe combined immunodeficiency phenotype severe cutaneous bacillus calmette-guérin infection in immunocompromised children: the relevance of skin biopsy successful treatment of bcg-related immune reconstitution inflammatory syndrome following ex vivo t-cell-depleted haploidentical hematopoietic stem cell transplantation: a case report primary immunodeficiency diseases and bacillus calmette-guérin (bcg)-vaccine-derived complications: a systematic review an unconditioned bone marrow transplantation in a child with purine nucleoside phosphorylase deficiency and its unique complication hematopoietic stem cell transplantation for children with primary immunodeficiency diseases: single center experience in jordan successful handling of disseminated bcg disease in a child with severe combined immunodeficiency disseminated bacillus calmette-guérin infection and immunodeficiency successful bone marrow transplantation and treatment of bcg infection in two patients with severe combined immunodeficiency an intensive approach to the treatment of disseminated bcg infection in a scid patient bcg-related inflammatory syndromes in severe combined immunodeficiency after tcrαβ+/cd + depleted hsct successful unrelated mismatched cord blood transplantation in an infant with severe combined immunodeficiency and mycobacterium bovis bacillus calmette-guèrin disease disseminated bcg infection following bone marrow transplantation for x-linked severe combined immunodeficiency disseminated bcg infection in severe combined immunodeficiency presenting with severe anaemia and associated with gross hypersplenism after bone marrow transplantation expansion of γδt cells in an infant with severe combined immunodeficiency syndrome after disseminated bcg infection and bone marrow transplantation molecular diagnosis of severe combined immunodeficiencyidentification of il rg, jak , il r, dclre c, rag , and rag mutations in a cohort of chinese and southeast asian children successful management of cutaneous bcg dissemination in a child affected by scid and receiving allogeneic hematopoietic stem cell transplant successful second bone marrow transplantation in omenn's syndrome after bone marrow aplasia: a case report hemophagocytic bone marrow aplasia with plasma cells in a rag -deficient scid case after a nonconditioned transplantation from a fully matched sibling bacillus calmette-guerin infection in nadph oxidase deficiency: defective mycobacterial sequestration and granuloma formation successful unrelated cord blood stem cell transplantation in an x-linked chronic granulomatous disease patient with disseminated bcg-induced infection immune responses to bacillus calmette-guérin vaccination: why do they fail to protect against mycobacterium tuberculosis? front immunol severe combined immunodeficiency in brazil: management, prognosis, and bcg-associated complications immune reconstitution inflammatory syndrome: a reappraisal universita cattolica del sacro cuore natural killer cells, glutathione, cytokines, and innate immunity against mycobacterium tuberculosis a prospective study of the immune reconstitution inflammatory syndrome (iris) in hiv-infected children from high prevalence countries immune reconstitution inflammatory syndrome in non-hiv immunocompromised patients immune reconstitution reactions in human immunodeficiency virus-negative patients: report of a case and review of the literature omenn syndrome: inflammation in leaky severe combined immunodeficiency opportunistic infection-associated immune reconstitution syndrome in transplant recipients inflammatory bcg adenitis associated with immune reconstitution following allogeneic haematopoietic stem cell transplant in infancy disseminated bcg infection in severe combined immunodeficiency world health organization. bcg vaccine: who position paper immune reconstitution inflammatory syndrome due to mycobacterium bovis bacillus calmette-guerin in infants receiving highly active antiretroviral therapy: a call for universal perinatal rapid hiv testing prior to administration of bcg immunization of neonates bacille calmette-guerin complications in newly described primary immunodeficiency diseases bacille calmette-guérin (bcg) vaccination and covid- scientific brief sars-cov- rates in bcg-vaccinated and unvaccinated young adults publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations acknowledgments we thank our patients and their families, and our departmental nursing and administrative staff for their tireless commitment to patient care. particularly, we thank mrs. maram shweiki for her tireless work which enables optimal patient care. we also thank professor zeev rotstein, director of the hadassah medical center, for his support of the department and our patients.authors' contributions all authors have read and approved this manuscript. yael dinur schejter, adeeb nasereddin, and bella shadur gathered the data, treated the patients, and wrote the manuscript. oded shamriz, yuval tal, irina zaidman, ehud evenor, and diana averbuch gathered data and treated patients. klaus warnatz assisted in writing, assembly, and editing. avraham shaag and orly elpeleg provide the genetic diagnosis and segregation studies. polina stepensky treated the patients, designed, and supervised the study.funding adeeb nasereddin received "award for excellence " from allergists for israel organization. bella shadur's position is supported by the australian government research training program scholarship and by hadassah australia. this work was supported by the deutsche forschungsgemeinschaft (discovery and evaluation of new combined immunodeficiency disease entities (decide); grant dfg wa / - ) and the era-neterare consortium euro-cid. conflict of interest the authors declare that they have no conflict of interest. key: cord- - fz authors: kleen, thomas-oliver; galdon, alicia a.; macdonald, andrew s.; dalgleish, angus g. title: mitigating coronavirus induced dysfunctional immunity for at-risk populations in covid- : trained immunity, bcg and “new old friends” date: - - journal: front immunol doi: . /fimmu. . sha: doc_id: cord_uid: fz the novel, highly contagious coronavirus sars-cov- spreads rapidly throughout the world, leading to a deadly pandemic of a predominantly respiratory illness called covid- . safe and effective anti-sars-cov- vaccines are urgently needed. however, emerging immunological observations show hallmarks of significant immunopathological characteristics and dysfunctional immune responses in patients with covid- . combined with existing knowledge about immune responses to other closely related and highly pathogenic coronaviruses, this could forebode significant challenges for vaccine development, including the risk of vaccine failure. animal data from earlier coronavirus vaccine efforts indicate that elderly people, most at risk from severe covid- disease, could be especially at risk from immunopathologic responses to novel coronavirus vaccines. bacterial “new old friends” such as bacille calmette-guérin (bcg) or mycobacterium obuense have the ability to elevate basal systemic levels of type cytokines and immune cells, correlating with increased protection against diverse and unrelated infectious agents, called “trained immunity.” here we describe dysfunctional immune responses induced by coronaviruses, representing potentially difficult to overcome obstacles to safe, effective vaccine development for covid- , and outline how trained immunity could help protect high risk populations through immunomodulation with bcg and other “new old friends.” in recent months, a novel severe acute respiratory syndrome (sars) coronavirus (cov), sars-cov- , which causes covid- , has spread rapidly throughout the world ( ) . as of july , , more than million infections and over , covid- related deaths have been confirmed worldwide. based on a chronic lack of adequate testing capabilities in many countries worldwide, including large industrialized nations like the united states, a large amount of undiagnosed infection and mortality from covid- must be assumed. the unprecedented pandemic seriously challenges the world's health care systems and available hospital capacities to treat seriously ill patients. these challenges are amplified by frequent sars-cov- infection of healthcare workers (hcw), leading to hospital-acquired infection of hcw and patients, and significant mortality within that group ( ) . other high-risk groups of infection include the elderly, with age-related immunosenescence and "inflammaging" having been suggested as a mechanism responsible for lowered immunological competence and the high mortality of the elderly in the current covid- pandemic ( ) . age-related risks are a particular issue in assisted care facilities and individuals with serious, non-covid underlying health conditions like cardiovascular disease, chronic kidney disease, diabetes, chronic respiratory disease, immunosuppression, and cancer ( , ) . in the case of cancer, many malignancies require active treatment, making isolation -even social distancing -impossible, based on the need to commute to the hospital regularly to receive treatments. therefore, there is an urgent need to protect individuals aged years and older with co-morbidities. throughout the public discourse, there has been little attention given to the observations that these populations are historically the same populations that are most unlikely to develop efficient and protective immune responses to standard respiratory viruses. consequently, this is likely to be the same case for sars-cov- . indeed, for these populations, other more potent vaccines, compared to the general population, are required, e.g., "high dose" influenza shots for the elderly. nevertheless, those more potent vaccines often still result in less than ideal outcomes in these vulnerable populations ( ) . in order to avoid the need for achieving herd immunity by infection or mass vaccinations before safely reopening societies and economies, a priority would be immunizing the most at-risk populations first. there is a justified concern that suboptimal vaccine efficacy for at-risk populations and the elderly could place the goal of not having to achieve herd immunity first in jeopardy. at the same time, a non-efficacious vaccine for at-risk populations could increase the probability of second and subsequent waves of infection in these populations ( ) . worldwide availability of safe, effective, prophylactic vaccines is likely the only approach that will ultimately control this deadly pandemic. however, such vaccines may not be available until early next year, even in the most optimistic scenarios ( ) . despite numerous efforts, no vaccine, proven safe and effective in humans, has ever been developed against any coronavirus ( , ) . questions about the potential lack of sufficient vaccine efficacy in elderly populations have not yet been widely discussed. therefore, strategies to prevent covid- morbidity and mortality in high risk groups are desperately needed in order to safeguard the most vulnerable individuals, as well as maintaining continuous patient care and functioning hospital systems. both humans and animals are susceptible to disease caused by covs. three highly pathogenic covs are known, sars-cov, middle east respiratory syndrome (mers)-cov and sars-cov- . all three are now known to efficiently infect and replicate in the lower respiratory tract, frequently causing substantial immunopathology, acute lung injury (ali), acute respiratory distress syndrome (ards), and fatal pneumonia, resulting in high morbidity and mortality ( ) . sars-cov and sars-cov- are both members of the betacoronavirus genus and share more than % of their genetic code ( ) . however, it is noteworthy that sars-cov- is closest related to the bat coronavirus ratg , with % genetic similarity compared to all known genetic coronavirus sequences ( ) . four additional, circulating but low pathogenic human coronaviruses (hcov) are known and will not be reviewed here, but preexposure to them could impact the immune response to sars-cov- in patients ( ) . all four, hcov- e, hcov-oc , hcov-nl , and hcov-hku , display a winter seasonality, causing comparatively mild to moderate upper respiratory illnesses and only occasionally, bronchiolitis and pneumonia symptoms ( , ) . all hcovs share a minimum of four, genome encoded, major structural proteins: the spike (s) glycoprotein, nucleocapsid (n) protein, membrane protein (m), and the envelope protein (e), all of which are required to produce a structurally complete viral particle ( ) . the pandemic, which originally emerged from wuhan, china, has been characterized by a rapidly increasing morbidity and mortality rate associated with older age, beginning around age years ( ) . multiple aspects of immunity can be influenced by ageing, prompting scrutiny of which components of the immune response might be responsible for higher mortality in older people ( ) . in general, an early and robust innate immune response to viral infections permits more rapid and effective viral clearance and may even prevent symptomatic infection or diminish the severity of the infection ( ) . no correlates of protection have yet been formally established for the recently emerged sars-cov- . however, mouse model data from studies with the first sars-cov that emerged in , suggested a delayed innate immune response during infection is linked to a more severe course, with immunopathology in the lungs and high mortality ( ) . initial observational studies suggest that a failure of antiviral immunity, including depleted natural killer (nk) cells, at an early stage in covid- , may lead to severe clinical course and an inability to recover from infection ( ) . in addition, it has previously been shown that the sars-cov macrodomain suppresses the innate immune response during infection, whereas an early strong innate immune response can protect mice from lethal disease and prevent detrimental downstream effects on the immune system ( ) . on the other hand, in later stages of infection, it appears that a dysregulated immune system, including excessive inflammatory responses by innate cells in the lungs, and selective immunosuppression of the adaptive immune system, can be detrimental for the host ( , ) . acute lung injury caused by viruses like respiratory syncytial virus, influenza a virus and sars-cov have been described previously ( , , ) . aberrant expression of the antiviral cytokine type i interferon (ifn), interferon stimulated genes, and other inflammatory cytokines, were observed in patients with severe sars-cov disease compared to healthy individuals, providing evidence that sars-cov is partly an innate dysregulated immune disease ( , ) . the innate immune system recognizes pathogen-associated molecular patterns (pamps) of viral or bacterial intruders via pattern recognition receptors (prrs). toll-like receptors (tlrs), a family of type i transmembrane prrs that consists of related, transmembrane proteins, play a central role in the initiation of inflammatory responses against pathogens, including the secretion of cytokines and chemokines. tlr is known to sense lipopolysaccharide (lps) from gram-negative bacteria, but, based on its additional function as sensor for damage-associated molecular patterns (damps), tlr has been suggested to play a central role in the induction of damaging inflammatory responses during several acute viral infections ( ) . in addition, oxidized phospholipids (oxpls), damps which lead to ali in patients infected with sars-cov, also accumulate in lungs of patients infected with sars-cov- and activate monocyte-derived macrophages through tlr ( , ) . interfering with innate cell activation by tlr in response to ligands such as oxpls may therefore help prevent thrombotic complications, recently identified as a major factor in mortality of covid- patients ( ) ( ) ( ) . endothelial cell activation, infection and dysfunction has been implicated in severe covid- by altering vessel barrier integrity, promoting a pro-coagulative state, inducing vascular inflammation, endotheliitis, and mediating inflammatory cell infiltration. the proposed mechanism is disruption of vascular integrity and endothelial cell death, which leads to exposure of the thrombogenic basement membrane and results in the activation of the clotting cascade ( ) . altered platelet gene expression and functional responses in patients infected with sars-cov- may additionally contribute to observed hemostatic abnormalities like disseminated intravascular coagulopathy ( ) . neutrophils are an important component of the general response to infection in the respiratory system and capable of recognizing viruses via viral pamps ( ) . in the context of potentially excessive neutrophil activation in late stage covid- disease, neutrophil extracellular traps (nets) in the lungs can drive severe pathologies by accumulation of mucus in the airways of patients, contributing to ards ( ) . more importantly, nets have been proposed to contribute to organ damage and mortality, since excess net formation can trigger a cascade of inflammatory reactions that destroys surrounding tissues and facilitates atherosclerosis, aortic aneurysms, as well as thrombosis, including microthrombosis, in the vascular system, with devastating effects on organ function ( ) . macrophages are key innate immune cells in any infection setting ( , ) . they are highly flexible innate cells that can, simplistically, be functionally and phenotypically divided into pro-inflammatory "m " macrophages (capable producers of inflammatory cytokines and mediators, that kill infectious organisms, virus-infected cells, or tumor cells) and more regulatory "m " macrophages (that are important for wound healing and parasite infections) ( , ) . both activation states are needed for a "balanced" immune response, although the m /m paradigm of macrophage activation is an over-simplistic definition of these complex and diverse innate cells ( , ) . during ageing and chronic inflammatory diseases, macrophages may switch to a more m -like phenotype ( , ) . importantly, nearly all identified high-risk factors for severe covid- disease, like cardiovascular disease, diabetes, age, chronic obstructive pulmonary disease, and smoking, generally share a shift from more m to more m phenotype and function ( ) . classical activation of m macrophages is induced by lps/ifnγ exposure, while alternately activated m macrophages are stimulated by il- , il- , il- and glucocorticoids ( ) . the activation of innate immune cells such as macrophages can be heavily influenced by the character of the t cell response and, in particular, the cytokines produced by t cells during infection ( ) . sars-cov replication has previously been shown in human peripheral monocytes and macrophages, with varying efficacy. importantly, the infection efficiency was shown to be donor dependent, with % infection in some and less than % in others ( ) . in adults, vγ vδ cells are the dominant γδ t cell population, however, in elderly individuals the variability increases ( , ). an analysis of t cell repertoires in hcw who survived sars-cov infection during the outbreak revealed that an innate-like subpopulation of effector memory t cells, γδ-t cells, specifically vγ vδ t cells, were selectively expanded approximately months after the onset of disease ( ) . importantly, no such expansion of non-innate αβ t cells was detected at the same time point. furthermore, expansion of the vγ vδ t cell population was associated with higher anti-cov igg titers, and in vitro experiments demonstrated that vγ vδ t cells display an ifn-γ -dependent ability to directly kill cov infected target cells. therefore, innate-like vγ vδ t cells may play a protective role during sars-cov and other cov infections. a recent study analyzed the number and activation status of vγ vδ t cells in hospitalized patients with covid- . they found significantly lower levels of vγ vδ t cells than that of matched healthy control and concluded that this could indicate that elderly with lower frequencies of vγ vδ t cells constitute a sars-cov- vulnerable population or that the vγ vδ t cells in these patients have migrated to the lungs to kill sars-cov- infected cells ( ) . sars-cov infection leads to lymphopenia and strongly reduced peripheral t cell levels, with low cd + and cd + t cell counts associated with adverse outcome, and a rapid and dramatic restoration of peripheral t cell subsets in the periphery of recovering patients ( ) ( ) ( ) . in addition, sars-cov can infect and replicate within pbmcs of sars-cov patients, with viral replication appearing to be self-limiting but leading to leukopenia or lymphopenia ( ) ( ) ( ) . patients with clinical symptoms of severe covid- also commonly present with lymphopenia, including dramatically reduced numbers of nk cells, cd + t cells, cd + t cells and b cells, which has not been observed in mild cases ( ) ( ) ( ) ( ) . further studies have shown exhaustion markers like nkg a on cytotoxic lymphocytes, including nk cells and cd + t cells, are upregulated in patients with covid- , and that for recovered patients, numbers of nk cells, cd + t cells, cd + t cells, and b cells normalize, along with markers of exhaustion on cytotoxic lymphocytes ( , ) . reduced functional diversity and increased t cell exhaustion in peripheral blood could predict severe progression in covid- patients, supporting the role of functional t cells in controlling covid- ( ) . importantly, it was recently shown that a patient with mild to moderate covid- symptoms had a broad-based robust immune response across different immune cell types, which was associated with rapid recovery ( ) . this observational study identified the presence of activated cd + t cells, cd + t cells, and follicular helper t cells in the blood, along with increased antibody-secreting cells and igm and igg antibodies. the study did not investigate the neutralization capabilities of the observed antibodies. cell-mediated type immune responses are therefore theorized to be a major component necessary to overcome covid- infection ( ). this is further supported by a study that screened for the presence of sars-specific t cells in a cohort of three sars-cov-recovered individuals, where cd + t cell responses targeting the sars-cov membrane and nucleocapsid proteins were found to persist up to years post-infection ( ) . characterization of sars-cov-specific memory t cells from recovered individuals years after infection indicated that the majority of memory cd + t cells produced ifn-γ, whereas memory cd + t cells produced ifn-γ, il- , or tnf-α ( ). multiple other independent studies established that sars-cov specific memory cd + and cd + t cells persisted for up to years after infection ( ) ( ) ( ) . s protein-derived epitopes of sars-cov elicited recall cd + t cell secretion of ifn-γ as well as intracellular production of ifn-γ, tnf-α, perforin, and granzyme a from recovered patients over -year post infection, indicating that sars-cov infection can induce strong and longlasting cytotoxic t lymphocyte (ctl)-mediated immunity in patients ( , ) . high frequencies of cd + tc -type t cells, reactive against mers-cov, were observed in a large proportion of patients with severe and moderate mers at acute stage before detection of humoral and cd + t cell responses. another report emphasizing the importance of t cells demonstrated that years after the sars outbreak, sars-cov-recovered patients still maintained long-lasting memory t cells reactive to the n protein of sars-cov, which notably exhibited robust cross-reactivity to the n protein of sars-cov- ( ) . a recent study showed predominant th responses in convalescing covid- cases, with little to no th responses. it demonstrated sars-cov- specific cd + t cells in % of covid- convalescent patients, with the majority of responses against s protein, correlating with the magnitude of anti-sars-cov- igg and iga titers, but as well responses against m and n proteins in all patients, accounting for - % of the total cd + responses. the same study found sars-cov- specific cd + cells against s and m proteins in about % of patients, and interestingly, t cell reactivity to sars-cov- epitopes was also detected in nonexposed individuals, likely cross-reactive from previous, seasonal hcov infections ( ) . however, at the convalescent phase, the magnitude of the cd + t cell response was not increased further. although it seems clear that robust inflammatory and ctl responses are required to clear the invading virus, when excessive, they can also lead to lung tissue destruction and pneumonia ( ) . early pathological findings of covid- patients with ards, showed not only reduced counts of peripheral cd + and cd + t cells, but that remaining t cells were found in a hyperactivated state, with high proportions of hla-dr and cd double-positive fractions ( ) . it is noteworthy here that, in patients hospitalized with avian h n , survival reflected an early, but transient, prevalence of highly activated cd +cd +hla-dr+pd- + t cells, but prolonged cd +hla-dr+pd + coexpression predicted fatal outcomes ( ) . cd + t cells in patients that died of h n were non-functional, as reflected by a lack of ifnγ production, but displayed high and continued expression of the cd +hla-dr+ activation markers, together with the inhibitory pd- immune checkpoint receptor. similar studies in ebola, dengue, and pandemic h n have also mentioned the presence of these "non-survival" peripheral lymphocyte populations, with high and prolonged frequency of activated cd +cd +hla-dr+ cells ( ) ( ) ( ) . we hypothesize that, as suggested for h n disease ( ), in covid- patients this could also be associated with defective t cell activation and a lack of relevant t cell receptor (tcr) specificities. it is known that infection with human immunodeficiency virus (hiv) induces broad lymphocyte activation, with an increase in t cell activation markers such as cd ( ) . several studies have shown that such increased cd + expression on cd + t cells is a strong predictive marker for disease progression in hiv- infection ( ) . not only does the cd +cd + t cell count predict progression of hiv disease to aids and death, but it is also independently predictive for evaluation of high plasma virus load and low cd + t cell counts ( ) . in early hiv infection, during onset of viremia, cd +cd +hla-dr+ t cells correlate inversely with viral set point. however, hyperacute hiv infection leads these cells to be short-lived effector cells that do not persist, characterized by marked apoptosis, upregulation of cd and failure to upregulate the il- receptor cd ( ) . strikingly, in a recent study in covid- patients, considerable proportions of peripheral cd + and cd + t cells co-expressed cd and hla-dr, but those cells could not be re-activated with peptide pools of the s protein in vitro, supporting the notion of sars-cov- specific refractory t cells and/or different specificities ( ) . no data about the pd- status of t cells was provided. the same remarkable study showed that, while the majority of s-reactive cd + t cells from covid- patients co-expressed cd and hla-dr, s-reactive cd + t cells from healthy donors, proposed to be cross reactive to other hcovs, only expressed cd and hla-dr at very low frequencies and coexpression was not observed. in cancer therapy models, depleting "dysfunctional" cd +cd hipd- + cells enhanced therapeutic outcomes, and patients who did not respond to immunotherapy showed more cd +cd hipd- + in tumor and blood compared to responders ( ) . the potential significance of levels and timing of prolonged expression of cd , hla-dr, and pd- on dysregulated t cells and the utility of cd +cd +hla-dr+pd- + t cells as a prognostic marker could be important and should be investigated in more detail. these could serve as indicators of sars-cov- immunosuppression, exhaustion and immune evasion, predicting divergent disease outcomes. the suggestion that a dysfunctional immune response is at the heart of covid- pathology is further supported by the recent finding that, compared to patients with moderate disease, significantly reduced frequencies of cd + t cells, as well as diminished frequencies of cd + and cd + t cell subsets with activated differentiated memory/effector phenotype and migratory capacity, are found in peripheral circulation of patients with severe covid- ( ) . antibody responses elicited by coronaviruses, including sars, have been described as comparatively short lived and inconsistent ( , ) . studies with human volunteers that were infected with a seasonal coronavirus hcov- e showed that individuals could get infected and display symptoms, including lymphocytopenia, regardless of preexisting antibodies ( ) . one study showed that six years post infection, sars-cov specific igg was undetectable in of former patients, and no sars-cov specific memory b cell responses could be detected in any of the patients ( ) . another study revealed that sars-cov antibodies could be seen up to months after infection ( ) . interestingly, longevity of mers-cov antibody response correlated with disease severity. in one study, patients with severe mers-associated pneumonia had a persistent antibody response detected for about months after infection, while patients with infection limited to the upper respiratory tract or who had no clinical signs had no detectable mers-cov antibody response ( ) . in another report, the more severe the illness, the greater the antibody response, including igm, igg, and neutralizing ab (nabs). patients in the convalescent phase, with mild or asymptomatic disease, rarely developed antibody responses ( ) . a strong antibody response developed in most mers patients only after - weeks of illness, but the antibody responses were not correlated with the elimination of the virus from the body ( , ) . this was confirmed in two more studies that showed mers infections are frequently characterized by low nabs, despite patient recovery ( , ( ) ( ) ( ) . it is noteworthy that this was also recently shown for covid- patients, where seroconversion has been observed in mild to moderate cases after - days, but, despite covid- antibodies arising at that time, no rapid decline of viral loads was observed, as would be expected with highly effective and neutralizing antibodies ( ) . since anti-sars-cov antibody responses are short-lived in patients who have recovered from sars, there are early indications that antibodies, and especially nabs, may not be the predominant mechanism necessary for effective viral clearance and for infected individuals to overcome a covid- infection ( , ( ) ( ) ( ) . this is further reinforced by the first longitudinal study in covid- patients, which showed that some individuals who have recovered and displayed a strong nab response shortly after infection, had titers fall as much as -fold, and in some cases back to baseline within months ( ) . the authors speculated that the observed transient nab response could be a feature shared by both a sars-cov- infection that causes low disease severity, and the circulating seasonal coronaviruses. other recent data supports the notion of an unclear role of abs, by reporting short duration of ab and nab titers after sars-cov- infection. compared with responses of patients with symptoms, asymptomatic individuals (arguably with the more effective immune response), had weaker ab responses to infection, with a reduction of igg levels already occurring in the early convalescent phase ( ); viral load and duration of infection are likely to be factors. remarkably, in this study, % of asymptomatic patients had undetectable levels of protective antibodies two to three months after infection, compared to % of the symptomatic patients with covid- . an even more notable finding, further indicating a limited role for abs in overcoming sars-cov- infection, is that intrafamilial exposure to sars-cov- induces a cellular immune response without seroconversion ( ) . of the different proteins that characterize coronaviruses, the s protein is an important determinant of virulence, tissue tropism and host range ( ) . trimers of s form the characteristic large spikes on the coronavirus envelope and both sars-cov and sars-cov- use the protein angiotensin converting enzyme (ace- ) as primary receptor for docking and infecting human host cells. priming of the virus s protein by host cell proteases is essential for entry. when sars-cov- docks to the cell via the ace- receptor, the host transmembrane serine protease (tmprss ) is responsible for cell entry ( ) ( ) ( ) . tmprss also aids the mers-cov to penetrate the cell ( ), but its primary receptor for entry is dipeptidyl peptidase (dpp ) ( ) . virus s glycoproteins are postulated to elicit an immune response in humans that could protect against future infection ( , ) . many vaccine approaches against covid- that are currently in development are focusing primarily on the generation of antibody responses against the sars-cov- s protein ( ) . however, despite the great urgency for making an effective vaccine against covid- available, this approach must be undertaken with great caution. several sars-cov vaccines that initially induced antibodies and short-term protection in mouse models of sars-cov led to dysfunctional or type helper t cell (th )-type immunopathology on challenge, with prominent eosinophil infiltration in the lungs, suggesting hypersensitivity to sars-cov components was induced ( ) . several other independent studies with animal models used to develop vaccine candidates against sars-cov exposed signs of lethal vaccine failure based on induction of cell-mediated type enhanced immunopathology, with associated eosinophilic infiltrates causing severe pneumonia, especially in aged mice. a vaccine based on sars-cov s protein protected against viral challenge when young mice were vaccinated, but it failed to efficiently protect older mice ( ) . another study indicated poor vaccine performance as well as th -based eosinophilic immune pathology in the lungs that was shown to be caused by alum adjuvanted and unadjuvanted sars-cov vaccines in aged animals ( ) . all this requires that particular attention be given to the strongly increased mortality rate already evident in older sars-cov- patients and patients with comorbidities. sars-cov has been shown to dysregulate the immune response in sars patients by biased activation of a th response, which can counter-regulate the type response that normally attacks bacteria and viruses ( ) . there was a significant increase in th cytokines il- , il- and il- during acute infection in fatal sars cases, once again indicating that the character of cellular immune response induced by any covid- vaccine will be critical in determining whether it will succeed ( , ) . four earlier vaccines against mers-cov- have been tested in rhesus macaques (rm), but no reports of efficacy of a single-dose mers-cov vaccine in non-human primates (nhps) had been made until a recent study reported that rm seroconverted after a single intramuscular vaccination with the experimental chadox mers vaccine ( ) . the study showed that vaccinated animals developed a neutralizing antibody response, were protected against respiratory injury and pneumonia, and showed reduced viral load in lung tissue and reduced disease severity. in addition, a phase trial in healthy individuals aged - years has been conducted, with no adverse safety signal reported ( ) . neither study has provided data in either aged animals or elderly humans. most relevant in this context are early sars-cov- vaccine trial data. a phase / study in adults aged to years of a covid- rna vaccine candidate (bnt b ), utilizing mrna that encodes trimerized sars-cov- spike glycoprotein, showed the generation of nab titers days after the first injection and one week after the second dose ( ). it is not yet known what kind of immune response the vaccine will elicit in older people or long-term. an additional mrna nano-particle based vaccine candidate (mrna- ) has been reported to induce both potent nabs and cd + t cell responses and to protect against sars-cov- infection in the lungs and noses of a mouse model, without evidence of immunopathology ( ) . importantly, it showed spike peptide-reactive cd + and cd + t cells producing ifn-γ, il- , and tnf, which would be encouraging if corroborated in ongoing phase clinical trials and phase efficacy evaluation of the same vaccine candidate. another advanced sars-cov- vaccine candidate in phase clinical studies is adenovirus-vectored vaccine chadox ncov- , which has been reported to prevent sars-cov- pneumonia in rm and not to be th dominated, determined by igg subclass and cytokine expression profiling ( ) . notably, no evidence of immune-enhanced disease following viral challenge twenty-eight days after vaccination was observed in the respective animals. the levels of abs produced by the vaccine in these rm were lower than many ab responses in humans infected with sars-cov- . while the vaccine protected rm from severe infection, they became infected with evident active virus replication, which does not rule out the potential of maintained ability to transmit virus. despite the inherent challenges of adopting new routes of routine vaccine administration during an ongoing pandemic, recent evidence would encourage consideration of intranasal administration, inhalation or other vaccine strategies that directly target the mucosal surfaces of the airways, because of distinct functional responses by respective tissue-resident memory t cells ( ) . it was shown, for example, in a mouse model, that conserved epitopes shared by sars-cov and mers-cov could induce airway memory cd + t cells producing ifn-γ which were phenotypically and functionally different from lung-derived cells and crucial for protection against both covs. it is particularly noteworthy in this study that intranasal (but not subcutaneous) vaccination protected mice from pathogenic human covs, and that protection required ifn-γ and was depended on early induction of robust innate and virus-specific cd + t cells ( ) . sars-cov- has shown replication, not only in human peripheral monocytes and macrophages, but also to directly infect t lymphocytes during primary infection through s proteinmediated membrane fusion, likely contributing to the severe lymphocytopenia that is a diagnostic indicator common in covid- patients ( , , ) . sars-cov has also been shown to infect dendritic cells (dc), the central coordinators of the immune response, leading to impaired dc maturation and their high expression of the pro-apoptotic protein trail ( ) . instead of facilitating lymphocyte activation and expansion in numbers, this likely induces lymphocyte death and represents another mechanism of immune escape and intensification of the immunocompromised state of sars-cov patients ( ) . similar mechanisms could contribute to lymphopenia and dysfunctional immune responses observed in severe covid- patients. in the elderly, immune evasion by sars-cov- is probably made worse due to the reduced number and function of antigen presenting cells (apcs) ( ) . multiple studies have been performed in mouse models describing the importance of type cd + and cd + t cells in sars-cov ( , ) , with one study establishing that virus-specific memory cd + t cells provided substantial protection from lethal closely related sars-cov infection in a mouse model, emphasizing the importance of a cell-based type immune response for survival of sars infections ( ) . the majority of the many current vaccine strategies against sars-cov- rely on unadjuvanted or selfadjuvanted vaccines (e.g., rna and dna vaccines), or type immune response promoting vaccines (e.g., alum adjuvanted, or unadjuvanted peptide or protein based vaccines) ( , , ) . rather than promoting type immunity, such approaches are likely to mostly lead to induction of type responses which, as previously discussed, are unlikely to be effective against sars-cov- ( ). existing cov antibodies have, in the case of host challenge with the same virus, enhanced viral load and disease severity in feline coronavirus or feline infectious peritonitis virus (fipv) infections. this phenomenon is known as antibody-dependent enhancement (ade) of viral infection ( , ) . in fipv infection ade can be induced by the presence of sub-neutralizing levels of anti-fipv spike antibodies ( ) . unlike in dengue virus infections, ade in feline coronavirus infection is caused by re-infection with the identical serotype virus ( ) . it should be noted that mice, often used for preclinical safety evaluation of vaccines, lack fcγriia, the main fcγr on human cells linked to ade induction ( , ) . increasing viral entry into permissive cells and/or triggering excessive production of pro-inflammatory cytokines has made ade a significant concern with several viruses, including the closely related sars-cov ( , ) . concerns have also been raised that anti-sars-cov- non-neutralizing antibodies, or even declining nab titers over time, could lead to ade and enhanced disease after such vaccinations, antibody-based drug therapies, or treatment with convalescent plasma from recovered patients ( , ) . however, none of the early clinical trial results of the most advanced vaccine candidates described above have reported signs of ade ( ) . demonstration of a lack of ade induction of different experimental vaccines against sars-cov- in nhps and humans will remain critical for other vaccines advancing through the pipeline. one recent example of the need for continued vigilance is a study using chinese macaques indicating cause for concern by showing that vaccine-induced, s-specific immunity in the form of anti-spike igg resulted in severe ali by skewing macrophage responses during subsequent, acute infection with closely related sars-cov ( ) . given all of the above, it is likely that successful vaccines against covid- will require appropriate dc activation, leading to induction of a multifaceted and long-lived type immune response that includes memory cd + th cells, cd + ctls, and nabs. most importantly, they will need to be effectively induced and sustained in older individuals without generating type responses or ade. it may remain a challenge to achieve this formidable goal and more creative approaches to vaccination may be required, but early data from pre-clinical and clinical trials of sars-cov- vaccines seem encouraging that they will provide some protection. direct comparisons in the literature of clinical observations in covid- patients with il- induced "cytokine storm" or cytokine release syndrome (crs) should be made with caution ( , , ) . for example, cytokine levels during hyperinflammation in covid- are multiple orders of magnitude lower than has been observed during cancer treatments by adoptive cell transfer of autologous t cells modified with chimeric antigen receptors (car-t cell therapy), a classical example for crs ( , ) . although, crs is normally treated with extensive use of steroids, the clinical evidence does not support corticosteroid treatment for covid- induced lung injury and interfered with clearance ( ) . in sars and mers, corticosteroid use did not improve patient mortality and also resulted in delayed viral clearance ( ) . it should be noted that a recent preprint of a randomizedcontrolled trial observed that therapy with dexamethasone lead to a significant reduction of death in ventilated patients, as well as for patients on supplemental oxygen, while no benefit was shown in mild cases ( ) . a recent review of corticosteroid use in the management of covid- revealed a mixed picture from five available studies. in four retrospective studies and one quasi-prospective study, three studies indicated a benefit, while the other two studies showed no benefit, and one sub-study even suggested significant harm in critical cases ( ) . based on success in hematological and oncology settings, several il- antagonists (tocilizumab, sarilumab as well as siltuximab) have been utilized as emergency interventions in covid- patients with ards and hypotension, although so far with mixed results ( ) . il- is an indispensable cytokine that initiates innate defence after pathogen invasion or tissue damage by stimulating acute phase reactions, immune responses, hematopoiesis, and activation of numerous internal organs to prepare for host defence ( ) . therefore, il- and other cytokines like tumor necrosis factor (tnf)-α are indispensable during functional activation of monocytes, macrophages and dcs before or early during covid- disease, as they are in diseases caused by other respiratory viruses ( ) . however, in later disease stages increasing immune dysregulation and t cell apoptosis, macrophages and il- may accelerate immune imbalance ( ) . preventing and treating coronavirus infections will likely need a multiphasic approach to prophylaxis and therapy, especially in vulnerable populations. it will be important to use the right tools at the right time to avoid unintended and potentially counterproductive consequences. the right set of immunomodulators would likely be able to prepare and boost innate immune defences to either ensure appropriate, effective responses to infection and/or guide the development of suitable, protective immunity in response to potentially suboptimal adjuvanted first generation vaccines. antiviral treatments or combinations of them will be most useful during early infection, while a different set of immunomodulators may be needed in late stage and severe disease, where a dysregulated antiviral response can cause deadly collateral damage. some microbes have existed throughout human history, with evidence of their presence in hunter-gatherer societies, shaping the evolution of the human immune system ( ) . some of these microbes, branded as "old friends" or "old infections, " are thought to be so intricately involved in this process that they are required for human immunity to develop and function properly ( , ) . examples of such microbes are harmless mycobacteria that are present in the environment and used to be prevalent in water and food, where they were postulated to have a "training" impact on the human immune system ( ) . in addition, "paleolithic" strains of mycobacterium tuberculosis (mtb) that were less pathogenic than modern strains could have contributed to this process ( ) . environmental mycobacteria can provoke type responses, as has been shown in mouse models and human cell-based in vitro studies for heat killed mycobacterium obuense, nctc (imm- ) and mycobacterium vaccae, nctc (imm- ) ( ) ( ) ( ) ( ) . this is also the case for the attenuated strain of mycobacterium bovis, bcg ( ) . however, modern, urban societies are often missing frequent exposure to environmental bacteria such as m. obuense and m. vaccae -they literally have lost touch with their "old friends" and may need "new old friends, " to support type immune responses. remarkably, several observational studies have recently proposed that countries with active bcg vaccination in place had fewer confirmed covid- cases and related deaths ( ) ( ) ( ) . these observational studies should be appraised with caution, since there are many confounding factors in interpreting such correlative data in the context during the covid- pandemic ( ) . there is no peerreviewed data yet, or a clear scientific hypothesis about the proposed mechanism of action, to explain how decades later a single bcg vaccination could provide long lasting, heterologous protection against a viral disease. in contrast, there are evidence-based arguments, acutely relevant to the covd- pandemic, regarding how bcg or type immune inducing environmental mycobacteria could provide protection against severe covid- in the form of the trained immunity hypothesis. contact with specific microbial stimuli can induce long-lasting epigenetic changes in innate immune cells, which not only results in an enhanced response to a second challenge by the same microbe, but also to unrelated microbial insults ( ) . referred to as "trained" immunity or innate immune memory, this process was originally shown for the bcg vaccine ( , ) . this concept may help explain previous observations that, after infection or vaccination, prototypical innate immune cells like monocytes, macrophages and nk cells undergo longterm changes in their functional programs, promoting host resistance against a wide spectrum of pathogens, including fungi, bacteria and viruses ( ) . trained immunity is thought to be responsible for the observation in clinical studies that childhood vaccination with bcg correlates with protection against - % of infections with any known pathogen, including viruses ( , ) . additionally, a reduction in childhood mortality, unrelated to the prevention of tuberculosis (tb), has been observed ( ) . similar positive effects have been shown for bcg vaccinations in adults, including improving responses to influenza vaccination ( ) . a study in guinea-bissau showed that bcg reduced the incidence of respiratory syncytial virus infection ( ) . importantly for the at-risk populations for severe covid- , it was shown that bcg had a similar protective effect on respiratory tract infections in older individuals in indonesia ( ) . in addition, a clinical trial performed in older individuals in japan established protection against pneumonia after pneumococcal, influenza and bcg vaccinations ( ) . further confirmation of this effect has been demonstrated in a randomized controlled trial in which bcg vaccination protected against experimental infection of a yellow fever virus ( ) . in summary, bcg vaccination has been shown to protect against a range of viral infections ( ) . related to this, when vaccination against smallpox was introduced around years ago, positive side-effects such as protection against measles, scarlet fever and whooping cough, among others, were noticed ( ) . monocytes from healthy human volunteers were stimulated ex vivo with unrelated pathogens and displayed enhanced proinflammatory cytokine production of il- β, tnf and il- after bcg vaccination ( ) . experimental studies in mice have delineated that some of the mechanisms by which bcg induces these protective effects. for example, in mice, reduced viral titers of influenza a virus rely on macrophages ( ) . subcutaneous administration in mice of muramyl dipeptide (mdp), part of the mycobacterial cell wall, protected against vaccinia virus and herpes simplex virus type (hsv ) infections ( ) . newborn mice could be protected with bcg from infection by hsv ( ) . more recently, other inducers of trained immunity have also been identified, including β-glucan, which has been shown to induce protective trained immunity in human monocytes and against mtb infection in mice ( ) . the combination of these observations and others led to the proposal of the development of trained immunity-based vaccines (tibv). tibvs aim to induce a pre-activated or "poised" activation state in innate immune cells. in this way they are, unlike conventional vaccines, theoretically able to stimulate much broader immune responses that are not focused on just one specific pathogen ( ) . this capacity of tibvs to promote responses beyond their nominal antigens may be particularly useful when conventional vaccines are not available, or when multiple co-infections and/or recurrent infections arise in susceptible individuals at the same time, as is the case in the current pandemic covid- health emergency. at least six different countries, including the netherlands and australia, have initiated clinical trials with the intent of investigating bcg vaccination as tibv to protect hcw from symptomatic or serious covid- infections ( , , ) . in general, bcg is regarded a safe vaccine in young and healthy individuals. however, as is the case with any vaccines containing live attenuated organisms, there is a possibility of adverse events, such as disseminated bcg disease, in the elderly and immunocompromised. for this reason, in cancer patients, who represent a high-risk group for severe covid- infection, bcg is contraindicated in several countries highly impacted by the pandemic, including the united states and canada ( , ) . as a result, populations likely to benefit most from the potential of tibvs and at the highest risk of a severe covid- disease (e.g., cancer patients, frail elderly, or other people with impaired immune systems), cannot be included in bcg vaccination strategies. despite the potential promise for mitigation of the covid- pandemic, a major obstacle to its quick, rational deployment is the fact that the bcg vaccine comprises of a number of genetically distinct substrains ( ) . these have subsequently been shown to have different immunological properties, such as variable virulence and efficacy as a tuberculosis vaccine in mice ( ) . this substrain diversity may also help explain some inconsistencies following bcg use, such as variable th or th induction and side-effects ( ) . in clinical use, no evidence was found that vaccination efficacy against tb was associated with a specific bcg strain; however, a th or th bias was not investigated in that study ( ) . it has also been shown that the immune response can be directed from th to mixed th /th , depending on the dose of bcg used ( ) . bacille calmette-guérin is not routinely injected more than once, but an earlier study showed that, of six patients who were given a second inoculation of the bcg vaccine, three showed persistent cutaneous granulomas ( ) . a recent clinical study also observed evidence of a protective effect against persistent mtb infection after bcg revaccination ( ) ; although repeat treatment with bcg has been used in the past in oncology as an adjuvant to boost cell-based cancer vaccines ( ) . imm- is a preparation of heat killed, whole cell, m. obuense national collection of type cultures (nctc) , one of over named species within the genus mycobacterium, and an "old friend." m. obuense is a rapidly dividing mycobacterium that normally grows as an environmental saprophyte ( ) . since imm- is a heat killed preparation, treatment is not associated with the potential side-effects of delivering live or attenuated organisms ( ) . moreover, one can speculate that imm- , by virtue of its potent type inducing ability, will counter-regulate type responses, helping to explain the encouraging clinical results to date in melanoma and pancreatic cancer ( , ) . an open label, phase study of imm- in combination with checkpoint inhibitor therapy nivolumab is currently underway in patients with advanced melanoma in the united kingdom ( ) . the total number of patients exposed to imm- across clinical trials and compassionate programs without any unexpected adverse events has been over . the mode of action of imm- is in the process of being elucidated, but it has been shown to be a multifaceted modulator of both innate and adaptive arms of the immune system ( ) . experiments with mouse and human immune cells have shown that imm- is very effective in inducing cytokine expression by innate immune cells, including m polarization and enhanced antigen presentation by dcs, leading to a typical type -biased immune response (figures , ) ( , ) . systemic activation of, and ifnγ production by, multiple immune cell types ( ) , including innate immune cells like nk cells, t cells expressing gamma/delta receptors (γδ-t cells) and natural killer t (nkt) cells ( , ) (figure ) , is based in part on the promotion and activation of cd + th , and cd + ctls, with increased production of the cytokine ifn-γ in in vitro and in vivo ( ) ( ) ( ) ( ) ( ) . it is also possible that, in this setting, imm- may act to train monocytes for enhanced m function (figure ) . nk, γδ-t, nkt, th cells, and ctls, are well-known to play crucial roles in anti-viral and anti-tumor responses that can kill infected or tumor cells. this diverse mechanism of action of imm- , the safe promotion of a broad, systemic innate and adaptive type immune response, may provide a rationale for considering its use against sars-cov- . interestingly, bcg has been shown to promote activation of vγ vδ t cells, the major subset of γδ t cell pool in human peripheral blood with a previously proposed protective role against sars-cov (see above) ( ) . vδ t cells are exactly the cell-subtype that has been shown to also be activated by imm- stimulation, in some experiments showing a stronger ability to do so than bcg ( ) . γδ t cells normally only represent a minor subset in peripheral blood, but can rapidly proliferate following infection with certain pathogens, expanding from % to over % of circulating t cells within a week ( , ) . , , [ ] [ ] [ ] [ ] [ ] . imm- activated dendritic cells (dc) directly promote the proliferation of cd + cytotoxic t-lymphocytes (ctl) and type- polarised cd + t cells, whereas innate-like cells including natural killer (nk), nkt and γδ t cells can be activated either by direct interaction with imm- or indirectly via recognition of dc secreted cytokines ( , ) . this local dc activation eventually leads to a systemic increase in immune cells secreting anti-viral interferon (ifn)-γ, perforin and granzyme b ( , ) . th, helper t cell. tnf, tumour necrosis factor. frontiers in immunology | www.frontiersin.org figure | bcg and environmental mycobacteria promote m macrophages and are likely to induce trained immunity. (a) treatment with mycobacterial immunomodulators induce polarization of m macrophages along with "trained" inflammatory monocytes with enhanced m function, which can result in enhanced viral clearance ( ) ( ) ( ) ) . (b) during innate immune training, innate cells undergo long-term cellular reprogramming. unlike classical antigen-specific responses seen with adaptive immunity, this reprogramming results in increased capacity to respond to secondary challenges from a variety of pathogens and forms the basis of trained-immunity based vaccines ( ) ( ) ( ) ) . it is noteworthy that a large majority of vδ t cells co-express vγ in humans, and were shown to be important to overcome sars-cov infection ( , ) . in addition to th cells, ctls and γδ t cells, nk and nkt cells also play key protective roles during viral infection ( , ) , and the potential importance of improving the nk cell and ctl response at the early stage of sars-cov- infection has already been highlighted ( ) . under the umbrella of trained immunity, broad protection could be achieved by systemically increasing the non-specific effector response of innate immune cells (e.g., macrophages, nk, nkt, and γδ t cells) while also enhancing dc activation and ability to promote adaptive t cell (e.g. th and ctl) and b cell responses to both specific and nonrelated (bystander) antigens, all of which have been shown for imm- (figure ) ( , ) . several studies have shown that the effects of imm- are in part mediated by tlr / , and to a lesser extent, tlr / ( , ) . tlr has been shown to directly trigger th effector functions in mice ( ) . subsequently, it was shown that imm- activates human mincle reporter cell lines ( , ) . it is noteworthy that mincle can suppress tlr activation ( ) and tlr has been proposed to have a central role in the initiation of damaging inflammatory responses during different acute viral infections ( ) . in contrast to bcg, imm- does not activate tlr ( , , ) . in a similar manner, mincle suppresses th immune responses, which as well have been suggested in coronavirus immunopathology and vaccine-induced immune enhancement ( , ) . it was only recently discovered that activation of the mincle receptor is a key activation pathway for complete freund's adjuvant (cfa), the "gold standard" adjuvant for eliciting cell-mediated immunity (cmi) in research models ( ) ( ) ( ) . effective and enhanced viral and tumor antigen crosspresentation requires tlr or tlr activation of human dcs ( ) . mouse cd α+ dcs express tlr and tlr , in addition to the tlr family and tlr , whereas the only relevant corresponding cross-presenting human cd + dcs in lymph nodes exclusively express the tlr family and tlr ( , ) . importantly, analysis of the susceptibility of primary human dc subsets to viral infections has shown that figure | bcg and "new old friends" have potential utility for prevention of severe covid- in a number of ways. bacille calmette-guérin (bcg) and other mycobacterial immunomodulators initiate robust type immune responses and innate immune training, leading to tissue type immune cell infiltration and elevated basal systemic type inflammation ( - , - , - ) . this allows for potential alteration of disease trajectory through prevention of viral establishment, enhanced viral killing or as a vaccine adjuvant to enhance immunity. cd + dcs have an innate resistance to infection by a broad range of enveloped viruses, including hiv and influenza virus. in contrast, cd c+ dcs are susceptible to infection, which enables viral antigen production, but impairs their immune function and survival. this has led to the conclusion that inclusion of tlr or tlr agonists would be the most direct mechanism to enable enhanced viral and tumor antigen crosspresentation, likely necessary for effective cancer immunotherapy ( ) and viral clearance ( ) . interestingly, previous work has suggested that vaccine-induced eosinophil immunopathology in the lungs after sars-cov infection could be avoided with the use of tlr agonists as adjuvants ( ) . however, use of tlr agonists may have to be viewed with caution in the context of covid- , based on observations of harmful contributions of tlr to influenza a virus-induced acute pneumonia in mice. in that scenario, tlr -influenza a virus interaction critically contributed to the debilitating effects of a detrimental host inflammatory response ( ) . further, it has been shown that tlr signaling induces tlr up-regulation in alveolar macrophages during ali, and that tlr and tlr in macrophages are an important determinant in ali ( ) , and that there is an association between respiratory syncytial virus tlr -mediated immune responses and chronic obstructive pulmonary disease exacerbation frequency ( ) . tlr activation of macrophages leads to m polarization, and a shift from m into m macrophages ( ) . in addition, it has been shown that tlr activation of macrophages can impair activity of m -like macrophages ( ) . imm- activates tlr and not tlr and leads to m macrophage polarization (figure ) ( , ) . the combined characteristics of imm- have led to the approval by health canada of a randomized, phase trial of immunization with imm- , versus observation, for the prevention of severe respiratory and covid- related infections in cancer patients at increased risk of exposure ( ) . in this review, we have presented an overview of current knowledge of the innate, adaptive and dysfunctional immune responses to sars-cov- , in relation to other closely related coronaviruses. we have outlined the responses that may be required for successful vaccine development against covid- , while highlighting potential risks during this development, especially for the elderly. early clinical data look promising, but continued studies of human and nhp immune response to different sars-cov- vaccines in the pipeline are required to mitigate potential dangers of well-intended, but potentially flawed, vaccines that are being expedited to large parts of highrisk populations around the globe. in addition, the potential utility of "new old friends" as tibvs like bcg or heat killed environmental bacteria such as imm- , that act as multitargeted, systemic immunomodulators of the innate and adaptive immune system have been described. studies to show bcg's and imm- 's potential utility for the prevention of severe covid- are underway or planned, with the potential to change immune status and alter disease trajectory in multiple ways (figure ) : (i) as prophylaxis, with enhanced innate memory and increased basal systemic type immunity preventing viral establishment; (ii) as a treatment for patients in early stages of disease, with increased local and systemic type inflammation enhancing killing of virally infected host cells; (iii) as an adjuvant for future covid- vaccines. thus, bcg and imm- have the potential to be rapidly deployed to address the covid- emergency and the challenge posed by the current lack of effective treatments and vaccines, leading to a high unmet medical need. with other routes of vaccine and therapy development likely to take many months or years to develop, or even reformulate, the help of "new old friends" such as bcg and imm- may be precisely what we need in the current pandemic crisis. t-ok and ad conceived the idea for the review and wrote the manuscript, with constructive input from am and ag. ag prepared display items under the supervision of am. all authors approved the final version of the manuscript. t-ok receives a salary from immodulon therapeutics ltd. ag is a recipient of an mrc (uk) npif ph.d. studentship, which is part funded by immodulon therapeutics ltd. am receives laboratory support by grants or studentships from the mrc, the bbsrc, the epsrc, immodulon therapeutics ltd., and mccir core. ad received grant support from the icvi program grant - and ldnpharma project grant - . the proximal origin of sars-cov- death from covid- of health care workers in china understanding how we age: insights into inflammaging patients with cancer appear more vulnerable to sars-cov- : a multicenter study during the covid- outbreak global, regional, and national estimates of the population at increased risk of severe covid- due to underlying health conditions in : a modelling study relative and absolute effectiveness of high-dose and standard-dose influenza vaccine against influenza-related hospitalization among older adults-united states is innate immunity our best weapon for flattening the curve? the covid- vaccine development landscape how the sars vaccine effort can learn from hiv-speeding towards the future, learning from the past immunization with sars coronavirus vaccines leads to pulmonary immunopathology on challenge with the sars virus pathogenic human coronavirus infections: causes and consequences of cytokine storm and immunopathology coronaviridae study group of the international committee on taxonomy of viruses the species severe acute respiratory syndrome-related coronavirus: classifying -ncov and naming it sars-cov- a pneumonia outbreak associated with a new coronavirus of probable bat origin presence of sars-cov- reactive t cells in covid- patients and healthy donors. medrxiv coronaviruses: an overview of their replication and pathogenesis recently discovered human coronaviruses the molecular biology of coronaviruses estimates of the severity of coronavirus disease : a model-based analysis can an effective sars-cov- vaccine be developed for the older population? nk cells in host responses to viral infections dysregulated type i interferon and inflammatory monocyte-macrophage responses cause lethal pneumonia in sars-cov-infected mice functional exhaustion of antiviral lymphocytes in covid- patients the conserved coronavirus macrodomain promotes virulence and suppresses the innate immune response during severe acute respiratory syndrome coronavirus infection covid- cytokine storm: the interplay between inflammation and coagulation covid- : consider cytokine storm syndromes and immunosuppression new fronts emerge in the influenza cytokine storm the human immune response to respiratory syncytial virus infection interferon-mediated immunopathological events are associated with atypical innate and adaptive immune responses in patients with severe acute respiratory syndrome sars coronavirus pathogenesis: host innate immune responses and viral antagonism of interferon toll-like receptor in acute viral infection: too much of a good thing identification of oxidative stress and toll-like receptor signaling as a key pathway of acute lung injury pathological inflammation in patients with covid- : a key role for monocytes and macrophages anticoagulation in covid- incidence of thrombotic complications in critically ill icu patients with covid- damp-driven metabolic adaptation covid- : the vasculature unleashed platelet gene expression and function in covid- patients a role for neutrophils in viral respiratory disease. front immunol targeting potential drivers of covid- : neutrophil extracellular traps role of macrophages in natural resistance to virus infections macrophages and natural resistance to virus infections alternative activation of macrophages: mechanism and functions m means kill; m means heal macrophage activation and polarization: nomenclature and experimental guidelines macrophage polarization: different gene signatures in m (lps+) vs. classically and m (lps-) vs. alternatively activated macrophages age-related m /m phenotype changes in circulating monocytes from healthy/unhealthy individuals ageing and the immune system: focus on macrophages abnormal m /m macrophage phenotype profiles in the small airway wall and lumen in smokers and chronic obstructive pulmonary disease (copd). sci rep macrophages: their role, activation and polarization in pulmonary diseases m macrophages induced by prostaglandin e and il- from cervical carcinoma are switched to activated m macrophages by cd + th cells sars-coronavirus replication in human peripheral monocytes/macrophages human γδ t-cell receptor repertoire is shaped by influenza viruses, age and tissue compartmentalisation the human vδ + t-cell compartment comprises distinct innate-like vγ + and adaptive vγ -subsets antisevere acute respiratory syndrome coronavirus immune responses: the role played by v gamma v delta t cells more bricks in the wall against sars-cov- infection: involvement of γ δ t cells expression of lymphocytes and lymphocyte subsets in patients with severe acute respiratory syndrome significant changes of peripheral t lymphocyte subsets in patients with severe acute respiratory syndrome haematological manifestations in patients with severe acute respiratory syndrome: retrospective analysis sars-coronavirus replicates in mononuclear cells of peripheral blood (pbmcs) from sars patients identification of severe acute respiratory syndrome in canada a cluster of cases of severe acute respiratory syndrome in hong kong reduction and functional exhaustion of t cells in patients with coronavirus disease (covid- ) dysregulation of immune response in patients with covid- in wuhan, china immunopathological characteristics of coronavirus disease cases in guangzhou, china. medrxiv lymphopenia predicts disease severity of covid- : a descriptive and predictive study restoration of leukomonocyte counts is associated with viral clearance in covid- hospitalized patients. medrxiv elevated exhaustion levels and reduced functional diversity of t cells in peripheral blood may predict severe progression in covid- patients breadth of concomitant immune responses prior to patient recovery: a case report of non-severe covid- the trinity of covid- : immunity, inflammation and intervention characterization of sars-cov-specific memory t cells from recovered individuals years after infection human memory t cell responses to sars-cov e protein long-lived memory t lymphocyte responses against sars coronavirus nucleocapsid protein in sars-recovered patients longlived effector/central memory t-cell responses to severe acute respiratory syndrome coronavirus (sars-cov) s antigen in recovered sars patients response of memory cd + t cells to severe acute respiratory syndrome (sars) coronavirus in recovered sars patients and healthy individuals understanding the t cell immune response in sars coronavirus infection different pattern of pre-existing sars-cov- specific t cell immunity in sars-recovered and uninfected individuals. biorxiv targets of t cell responses to sars-cov- coronavirus in humans with covid- disease and unexposed individuals immune responses to middle east respiratory syndrome coronavirus during the acute and convalescent phases of human infection pathological findings of covid- associated with acute respiratory distress syndrome clonally diverse cd (+)hla-dr(+)cd (+) t cells persist during fatal h n disease characterization of human cd t cell responses in dengue virusinfected patients from india severe pandemic h n infection is associated with transient nk and t deficiency and aberrant cd responses human ebola virus infection results in substantial immune activation cd + lymphocyte percent: a useful immunological marker for monitoring hiv- -infected patients cd expression in cd + t cells predicts virological failure in hiv type -infected children receiving antiretroviral therapy elevated cd antigen expression on cd + t cells is a stronger marker for the risk of chronic hiv disease progression to aids and death in the multicenter aids cohort study than cd + cell count, soluble immune activation markers, or combinations of hla-dr and cd expression magnitude and kinetics of cd + t cell activation during hyperacute hiv infection impact viral set point pd- blockade in subprimed cd cells induces dysfunctional pd- (+)cd (hi) cells and anti-pd- resistance a possible role of immunopathogenesis in covid- progression. medrxiv the time course of the immune response to experimental coronavirus infection of man human cd (+) memory t-lymphocyte responses to sars coronavirus infection lack of peripheral memory b cell responses in recovered patients with severe acute respiratory syndrome: a six-year follow-up study antibody response and disease severity in healthcare worker mers survivors viral shedding and antibody response in patients with middle east respiratory syndrome coronavirus infection kinetics of serologic responses to mers coronavirus infection in humans th -and th -cell commitment during infectious disease: asymmetry in divergent pathways transmission of mers-coronavirus in household contacts presence of middle east respiratory syndrome coronavirus antibodies in saudi arabia: a nationwide, cross-sectional, serological study virological assessment of hospitalized patients with covid- severe acute respiratory syndrome-associated coronavirus vaccines formulated with delta inulin adjuvants provide enhanced protection while ameliorating lung eosinophilic immunopathology virus-specific memory cd t cells provide substantial protection from lethal severe acute respiratory syndrome coronavirus infection neutralizing antibody responses to sars-cov- in a covid- recovered patient cohort and their implications. medrxiv longitudinal evaluation and decline of antibody responses in sars-cov- infection. medrxiv clinical and immunological assessment of asymptomatic sars-cov- infections intrafamilial exposure to sars-cov- induces cellular immune response without seroconversion. medrxiv recombination, reservoirs, and the modular spike: mechanisms of coronavirus cross-species transmission the spike protein of sars-cova target for vaccine and therapeutic development sars-cov- cell entry depends on ace and tmprss and is blocked by a clinically proven protease inhibitor structure of sars coronavirus spike receptor-binding domain complexed with receptor the tetraspanin cd facilitates mers-coronavirus entry by scaffolding host cell receptors and proteases dipeptidyl peptidase is a functional receptor for the emerging human coronavirus-emc the race for coronavirus vaccines: a graphical guide vaccine efficacy in senescent mice challenged with recombinant sars-cov bearing epidemic and zoonotic spike variants severe acute respiratory syndrome coronavirus vaccine provides incomplete protection in mice and induces increased eosinophilic proinflammatory pulmonary response upon challenge t cell responses to whole sars coronavirus in humans a single dose of chadox mers provides protective immunity in rhesus macaques safety and immunogenicity of a candidate middle east respiratory syndrome coronavirus viral-vectored vaccine: a dose-escalation, open-label, non-randomised, uncontrolled, phase trial phase / study to describe the safety and immunogenicity of a covid- rna vaccine candidate (bnt b ) in adults to years of age: interim report. medrxiv sars-cov- mrna vaccine development enabled by prototype pathogen preparedness. biorxiv chadox ncov- vaccination prevents sars-cov- pneumonia in rhesus macaques. biorxiv tissue-resident memory t cell reactivation by diverse antigenpresenting cells imparts distinct functional responses airway memory cd + t cells mediate protective immunity against emerging respiratory coronaviruses antibodydependent enhancement occurs upon re-infection with the identical serotype virus in feline infectious peritonitis virus infection toll-like receptors, chemokine receptors and death receptor ligands responses in sars coronavirus infected human monocyte derived dendritic cells role of dendritic cells in sars coronavirus infection age-related increases in pgd( ) expression impair respiratory dc migration, resulting in diminished t cell responses upon respiratory virus infection in mice a mouse-adapted sars-coronavirus causes disease and mortality in balb/c mice t cell responses are required for protection from clinical disease and for virus clearance in severe acute respiratory syndrome coronavirus-infected mice aluminium hydroxide adjuvant initiates strong antigen-specific th responses in the absence of il- -or il- -mediated signaling alum boosts th -type antibody responses to whole-inactivated virus influenza vaccine in mice but does not confer superior protection the potential danger of suboptimal antibody responses in covid- antibody-dependent enhancement of viral infection: molecular mechanisms and in vivo implications a study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies human fcgammarii cytoplasmic domains differentially influence antibody-mediated dengue virus infection fc receptors are major mediators of antibody based inflammation in autoimmunity neutralizing antibody response and sars severity retracted article: sars-cov- infects t lymphocytes through its spike protein-mediated membrane fusion anti-spike igg causes severe acute lung injury by skewing macrophage responses during acute sars-cov infection is covid- receiving ade from other coronaviruses? microbes infect cytokine release syndrome in severe covid- clinical predictors of mortality due to covid- based on an analysis of data of patients from wuhan, china current concepts in the diagnosis and management of cytokine release syndrome identification of predictive biomarkers for cytokine release syndrome after chimeric antigen receptor t-cell therapy for acute lymphoblastic leukemia clinical evidence does not support corticosteroid treatment for -ncov lung injury effect of dexamethasone in hospitalized patients with covid- : preliminary report. medrxiv role of corticosteroid in the management of covid- : a systemic review and a clinician's perspective jury still out on il- drugs in covid- following preliminary trial results il- : from its discovery to clinical applications immunity to respiratory viruses clinical course and outcomes of critically ill patients with sars-cov- pneumonia in wuhan, china: a single-centered, retrospective, observational study out-of-africa migration and neolithic coexpansion of mycobacterium tuberculosis with modern humans microbial 'old friends' , immunoregulation and stress resilience origins of major human infectious diseases mycobacteria and their world treatment with imm- induces protective cd + t cell responses in clinically relevant models of pancreatic cancer mycobacteria activate gammadelta t-cell anti-tumour responses via cytokines from type myeloid dendritic cells: a mechanism of action for cancer immunotherapy defining the immunomodulatory effects of imm- : a promising, novel co-therapy for cancer dendritic cells recruited to the lung shortly after intranasal delivery of mycobacterium bovis bcg drive the primary immune response towards a type cytokine production connecting bcg vaccination and covid- : additional data. medrxiv bcg vaccination may be protective against covid- correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study. medrxiv exercising caution in correlating covid- incidence and mortality rates with bcg vaccination policies due to variable rates of sars cov- testing. medrxiv induction of innate immune memory: the role of cellular metabolism bacille calmette-guerin induces nod -dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes trained immunity: a program of innate immune memory in health and disease the non-specific effects of vaccines randomized trial of bcg vaccination at birth to low-birth-weight children: beneficial nonspecific effects in the neonatal period? association of bcg, dtp, and measles containing vaccines with childhood mortality: systematic review bcg vaccination enhances the immunogenicity of subsequent influenza vaccination in healthy volunteers: a randomized, placebo-controlled pilot study acute lower respiratory tract infections and respiratory syncytial virus in infants in guinea-bissau: a beneficial effect of bcg vaccination for girls community based case-control study the efficacy of bacillus calmette-guerin vaccinations for the prevention of acute upper respiratory tract infection in the elderly bcg vaccination protects against experimental viral infection in humans through the induction of cytokines associated with trained immunity bcg-induced trained immunity: can it offer protection against covid- ? taking advantage of the positive side-effects of smallpox vaccination nonspecific protection of mice against influenza virus infection by local or systemic immunization with bacille calmette-guerin enhancement of non-specific resistance to viral infection by muramyldipeptide and its analogs effects of immunostimulants on resistance of newborn mice to herpes simplex type infection β-glucan induces protective trained immunity against mycobacterium tuberculosis infection: a key role for il- trained immunity-based vaccines: a new paradigm for the development of broad-spectrum anti-infectious formulations clinicaltrials.gov bcg vaccination to protect healthcare workers against covid- (brace): clinicaltrials.gov identifier: nct . ( ). available online at reducing health care workers absenteeism in covid- pandemic through bcg vaccine government of canada immunization of immunocompromised persons: canadian immunization guide mucosal-local, usp drug information for the healthcare professional oncolology drug information bcg-different strains, different vaccines? variable virulence and efficacy of bcg vaccine strains in mice and correlation with genome polymorphisms dendritic cells derived from bcg-infected precursors induce th -like immune response protection by bcg vaccine against tuberculosis: a systematic review of randomized controlled trials mycobacterial dose defines the th /th nature of the immune response independently of whether immunization is administered by the intravenous, subcutaneous, or intradermal route ineffectiveness and toxicity of bcg vaccine for the prevention of recurrent genital herpes prevention of m. tuberculosis infection with h :ic vaccine or bcg revaccination bcg immunotherapy of malignant melanoma: summary of a sevenyear experience mycobacterium obuense, a rapidly growing scotochromogenic mycobacterium capable of forming a black product from p-aminosalicylate and salicylate randomised, open-label, phase ii study of gemcitabine with and without imm- for advanced pancreatic cancer enhanced effect of checkpoint inhibitors when given after or together with imm- : significant responses in four advanced melanoma patients with no additional major toxicity clinicaltrials.gov a study of imm- in combination with checkpoint inhibitor therapy in advanced melanoma: clinicaltrials.gov identifier: nct immunomodulatory effects of heat-killed mycobacterium obuense on human blood dendritic cells analysis of the immunomodulatory properties of two heat-killed mycobacterial preparations in a human whole blood model the effects of combination treatment of imm- , a heat-killed whole cell preparation of mycobacterium obuense (nctc ) with checkpoint inhibitors in pre-clinical models the impact of mycobacterium obuense (nctc ) on innate and adaptive immunity the effect of imm- , a heat-killed whole cell preparation of mycobacterium obuense (nctc ) on dendritic cells and the adaptive immune response central memory vgamma vdelta t lymphocytes primed and expanded by bacillus calmette-guerin-infected dendritic cells kill mycobacterial-infected monocytes antiviral reactivities of gammadelta t cells antibacterial effect of human v gamma v delta t cells in vivo molecular analysis of human gamma/delta+ clones from thymus and peripheral blood macrophages: damage control suppression of nk cells and regulatory t lymphocytes in cats naturally infected with feline infectious peritonitis virus cutting edge: tlr directly triggers th effector functions immunization with imm- vs observation for prevention of respiratory and severe covid- related infections in cancer patients at increased risk of exposure mincle suppresses toll-like receptor activation tlr and tlr serve distinct roles in the host immune response against mycobacterium bovis bcg the potential role of th immune responses in coronavirus immunopathology and vaccine-induced immune enhancement fonsecaea pedrosoi-induced th -cell differentiation in mice is fostered by dectin- and suppressed by mincle recognition the cellular transfer of cutaneous hypersensitivity to tuberculin experiments on transfer of cutaneous sensitivity to simple compounds sensing lipids with mincle: structure and function adjuvant for vaccine immunotherapy of cancer-focusing on toll-like receptor and agonists for safely enhancing antitumor immunity bdca- )+ dendritic cells (dcs) represent a unique myeloid dc subset that cross-presents necrotic cell antigens molecular mechanisms of tlr -mediated antigen cross-presentation in dendritic cells effects of toll-like receptor stimulation on eosinophilic infiltration in lungs of balb/c mice immunized with uv-inactivated severe acute respiratory syndrome-related coronavirus vaccine detrimental contribution of the toll-like receptor (tlr) to influenza a virus-induced acute pneumonia tlr signaling induces tlr up-regulation in alveolar macrophages during acute lung injury association of respiratory syncytial virus toll-like receptor -mediated immune response with copd exacerbation frequency tlr /tlr signaling blocks the suppression of monocytic myeloid-derived suppressor cell by promoting its differentiation into m -type macrophage tlr stimulation impairs anti-inflammatory activity of m -like macrophages, generating a chimeric m /m phenotype novel immunomodulators and their combinations require a broad, adaptive clinical biomarker strategy the authors thank b. trease, mediscribe consulting ltd., for technical editing. t-ok is an employee of immodulon therapeutics ltd. am is a member of the scientific advisory board for immodulon therapeutics ltd. ag is a recipient of an mrc (uk) npif phd studentship, which is part funded by immodulon therapeutics ltd. ad is a member of the scientific advisory board for immodulon therapeutics ltd.copyright © kleen, galdon, macdonald and dalgleish. this is an open-access article distributed under the terms of the creative commons attribution license (cc by). the use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. no use, distribution or reproduction is permitted which does not comply with these terms. key: cord- -nc v s authors: margolin, emmanuel; burgers, wendy a.; sturrock, edward d.; mendelson, marc; chapman, rosamund; douglass, nicola; williamson, anna-lise; rybicki, edward p. title: prospects for sars-cov- diagnostics, therapeutics and vaccines in africa date: - - journal: nat rev microbiol doi: . /s - - - sha: doc_id: cord_uid: nc v s the emergence of severe acute respiratory syndrome coronavirus (sars-cov- ) has resulted in a global pandemic, prompting unprecedented efforts to contain the virus. many developed countries have implemented widespread testing and have rapidly mobilized research programmes to develop vaccines and therapeutics. however, these approaches may be impractical in africa, where the infrastructure for testing is poorly developed and owing to the limited manufacturing capacity to produce pharmaceuticals. furthermore, a large burden of hiv- and tuberculosis in africa could exacerbate the severity of infection and may affect vaccine immunogenicity. this review discusses global efforts to develop diagnostics, therapeutics and vaccines, with these considerations in mind. we also highlight vaccine and diagnostic production platforms that are being developed in africa and that could be translated into clinical development through appropriate partnerships for manufacture. coronaviruses are ubiquitous rna viruses that are responsible for endemic infections in humans and other animals, and sporadic outbreaks of potentially fatal respiratory disease in humans. four human coronaviruses, namely hcov- e, hcov-oc , hcov-nl and hcov-hku , circulate in the human population, causing the common cold, with some causing potentially life-threatening disease in infants, young children, older individuals and individuals who are immunocompromised . in the recent past, two additional coronaviruses have crossed the species barrier from other animals to infect humans. these are severe acute respiratory syndrome coronavirus (sars-cov) and middle east respiratory syndrome coronavirus (mers-cov), which emerged in and , respectively , . in december , a novel betacoronavirus, subsequently named sars-cov- , was implicated in an outbreak of respiratory disease in wuhan, china . the first cases to be reported presented as atypical pneumonia and were traced to the huanan seafood wholesale market, although cases without any association with the market, and predating the putative index cases, were subsequently recognized. following these first reports, community transmission rapidly ensued, culminating in a global pandemic , . the virus is speculated to have originated in bats and possibly to have passed through another host before infecting humans, but an intermediate host or intermediate hosts have yet to be defined. this remains the subject of considerable debate, and recent work suggests that the host receptor-binding motif of sars-cov- was acquired through recombination with a pangolin coronavirus [ ] [ ] [ ] , but further work is needed to establish the origin of the virus. infection with sars-cov- in humans manifests as coronavirus disease- (covid- ) , a spectrum of disease that ranges from asymptomatic infection to acute respiratory distress syndrome with multisystem involvement. older individuals and individuals with co-morbidities are at greatest risk . in individuals who are symptomatic, fever and cough are most commonly reported, although sore throat, shortness of breath, fatigue, anosmia, dysgeusia and gastrointestinal involvement are also frequently observed , . extrapulmonary manifestations of covid- are being increasingly recognized. among adults with preexisting diabetes mellitus, diabetic ketoacidosis may be a common complication and is associated with a poor prognosis , . according to the international diabetes federation, africa has an estimated . million adults aged between and years living with diabetes and is the region with the highest proportion of undiagnosed diabetes . neurological and neuropsychiatric complications have also been recognized as presenting or complicating factors . children generally have a milder course of disease and are more likely to be asymptomatic, although recent reports have described hyperinflammatory shock in children who were previously asymptomatic that seems similar to kawasaki disease [ ] [ ] [ ] . further studies are required to determine the prevalence of this phenomenon and to define the immunological the first documented cases in a disease outbreak. a rare condition associated with inflammation in blood vessels that most commonly presents in children under years of age. drivers of the illness. however, the contrasting presentation of covid- in children and adults suggests that the immune responses of children and adults to sars-cov- may be different. the virus continued to spread globally, prompting the implementation of radical travel restrictions and social distancing measures . at the time of writing this article, the virus has resulted in over million confirmed infections and has claimed the lives of over , people . as of august , there have been over . million confirmed cases of covid- in africa, with , deaths reported (africa cdc) there is concern that the pandemic may pose an even greater risk to countries in africa owing to their weak health-care infrastructure, large burden of co-infections, including hiv- and tuberculosis, and ongoing outbreaks of emerging and re-emerging infections such as ebola virus (democratic republic of congo) and lassa haemorrhagic fever (nigeria) that will divert much-needed resources away from the fight against covid- (ref. ) ( fig. ). differences in global population demographics and health status are also likely to affect the severity of the pandemic in different regions and are a major concern in africa ( fig. ). in addition to the health-care infrastructure, the general infrastructure throughout africa is also highly variable, and thus access to appropriate medical care is an important determinant of covid- disease outcome. the number of hospital beds in a population of , individuals varies from as low as in mali to in libya. however, libya is an exception for the region, and many central and west african countries are at the lower end of this range and generally report fewer than beds per , individuals. this is in stark contrast to other developed countries such as germany and the usa, where and . beds per , individuals are available, respectively. a similar trend is also seen for the number of doctors per , individuals. in more than african countries, less than doctor is available (per , individuals), whereas germany and the usa report and doctors (per , individuals), respectively . concerns have been raised regarding the impact of the pandemic on other diseases and access to essential medicines . for example, according to a newspaper article, the ministry of health in zimbabwe reported a % increase in malaria infections compared with (ref. ). many african countries lack the capacity to implement widespread testing, including the identification of asymptomatic and mild infections that are major drivers of the pandemic . although it is difficult to determine the number of tests conducted in many africa countries, the publicly available data clearly highlight the limited testing capacity on the continent. south africa is currently conducting the largest number of tests per , individuals ( . / , individuals), whereas many other countries, including ethiopia, nigeria, zimbabwe, tunisia, senegal and rwanda, perform fewer than . tests/ , individuals. this is markedly less than in the usa ( . / , individuals), the uk ( . / , individuals), italy ( . / , individuals) or germany ( . / , individuals) . similar infrastructure limitations constrain the development of prophylactic vaccines and therapeutic interventions, which results in a concerning reliance on developed countries. another important consideration in the response to the pandemic in africa will be to limit the impact of the virus on vulnerable economies where prolonged lockdowns may not be feasible. the first case of covid- in africa was reported in egypt on february ; subsequently, infections - ) pandemic. this is worsened by the high burden of infectious diseases, which may worsen disease outcome and compete for the available resources. a further challenge is the dire economic consequences of prolonged lockdowns in countries with weak economies. www.nature.com/nrmicro have been documented in other african countries, with south africa reporting the highest number of cases . interestingly, in spite of the obvious challenges in combatting the growing pandemic, african countries have observed a delay in the exponential growth trajectory that has been described by countries in the developed world . this may be partly attributable to lower testing capacity in the region and the impact of implementing lockdowns in the early phase of the pandemic. the warmer climate has also been proposed to influence the spread of covid- , which could explain the delayed pandemic in africa compared with the rest of the world, although this is largely speculative (box ). the transition into winter in southern africa has been accompanied by an increase in sars-cov- infections, further complicated by seasonal influenza and limited influenza vaccine availability. in this review, we discuss the global efforts to develop diagnostic tests and therapeutic options to treat covid- , as well as the vaccine platforms for immunization, with a focus on the opportunities and challenges for africa. the diagnosis of sars-cov- poses a major challenge owing to the prevalence of asymptomatic infections, pre-symptomatic infections with high viral loads in the upper airways (probably at peak infectivity) and the range of non-specific symptoms that manifest in individuals who are symptomatic , . widespread testing is therefore critical to identify infected individuals who are asymptomatic, pre-symptomatic and symptomatic, and to enable contact tracing and isolation . whereas this has been highly successful in countries such as germany and south korea, it is not generally possible in most african countries where the infrastructure is weak. indeed, in countries such as south africa, where widespread community testing was attempted, this has resulted in a very large backlog of tests and delays of weeks for returning test results, which are then rendered meaningless for quarantining of cases and containment . in many african countries, testing is only available for severe cases of presumed covid- , and self-isolation is recommended for less severe cases. therefore, reported cases and true prevalence do not equate. accordingly, the capacity provided by academic laboratories and pharmaceutical companies is being leveraged to increase testing capacity further, as has been necessary even in developed countries . diagnosis of acute infection is by pcr with reverse transcription of respiratory tract specimens, which is generally performed in central laboratories with specialized equipment . scale-up of testing is a major challenge for countries in africa, owing to laboratory infrastructure, costs and availability of test reagents that are largely imported and currently stretched global supply chains. a recently launched, continent-wide initiative, population demographics and prevalence of known co-morbidities for each of the six world health organization regions. although africa reports a lower average age compared with other regions, the burden of infectious disease is disproportionately high. both hiv and tuberculosis are associated with an increase in coronavirus disease- (covid- ) disease severity, and their prevalence in africa will increase the risk of fatal infection for a large number of people. there is also a large proportion of individuals in africa with raised blood pressure, which is a known risk factor for severe disease. other known co-morbidities, including raised cholesterol, raised glucose and obesity, are less prevalent in africa compared with the other reported regions. raised blood pressure (systolic blood pressure ≥ mm/hg or diastolic blood pressure ≥ mmhg), raised fasting blood glucose levels (≥ mmol/l or taking medication), raised total cholesterol levels (≥ mmol/l) and body mass index (bmi) > are reflected as age-standardized estimates. all data shown reflect the latest available data from the world health data platform (global health observatory). the number of people living with hiv- /aids (in millions) reflects the population of individuals who were infected in , tuberculosis cases shown reflect the number of incident cases in and malaria cases reflect the estimated number of cases in . nature reviews | microbiology the africa medical supplies platform, seeks to leverage collective purchasing for procurement of testing supplies, personal protective equipment, medical equipment and even, potentially, future vaccines . in addition, repurposing of rapid, automated molecular diagnostics platforms such as genexpert® (cepheid), which is widely used for the diagnosis of tuberculosis in south africa, has the potential to decentralize and accelerate testing in certain countries, including using mobile testing centres, although test kits are also in limited supply. however, this has to be understood in the light of the potential for unintended consequences on the management of tuberculosis, with fewer diagnostic platforms being available as a result of increased sars-cov- testing. testing for tuberculosis in south africa has reportedly decreased by % during the lockdown period and, concurrently, the weekly average of microbiologically confirmed tuberculosis cases decreased by % (ref. ). recently, a rapid method of heating samples prior to quantitative pcr with reverse transcription has shown promise to improve the turnaround time for testing and bypasses the need to order rna extraction reagents or kits . furthermore, a rapid crispr-cas -based test has also been developed to diagnose infection from respiratory sample-derived rna . the test yields a result within h and is less reliant on sophisticated laboratory infrastructure and test reagents that are in limited supply. implementing this test in africa could be a useful way of expanding the current testing capacity and could offer a faster turnaround time for high-priority cases. serology-based testing approaches have been proposed, but the delay between infection and the development of detectable antibodies (within days) renders this approach impractical for the diagnosis of acute infection , . nonetheless, these tests are critical for seroprevalence studies and to identify appropriate donors for convalescent sera, and potentially for the isolation of monoclonal antibodies that can be developed as therapeutics. serology studies are also crucial for understanding the longevity of the antibody response after infection, with the key caveat that it is not known whether humoral responses are a correlate of immunity against the virus. in addition, preliminary data suggest that not all individuals who are infected may seroconvert , and early evidence is emerging that antibody levels may wane rapidly during the convalescent phase . several serological assays have already been developed, and binding antibodies against the spike and nucleocapsid proteins are both indicative of past sars-cov- infection , . many of these assays are also commercially available, but their specificity and sensitivities seem to be variable . a major outstanding question is which antigen, or region of the antigen, is most appropriate for serology testing. most assays have favoured the spike glycoprotein for the detection of an immune response against the virus, although it is worth noting that the nucleocapsid is the most abundant viral antigen . recent work has suggested that the receptor-binding domain alone may be sufficient to detect antibody responses to sars-cov- , and given that it is not conserved between coronaviruses, its use may limit cross-reactivity arising from other coronavirus infections . nonetheless, a nucleocapsid-based elisa (enzyme-linked immunosorbent assay) may be the easiest to implement in an african context as the antigen could easily be produced locally at low cost. nucleocapsid could be produced in escherichia coli, pichia pastoris or even in plants, as has been reported for the nucleocapsid proteins of three bunyaviruses, two of which were used successfully in validated assays [ ] [ ] [ ] . moreover, the biovac institute in south africa has the capacity for bacterial fermentation and the required infrastructure for downstream processing, and a new plant-based production facility (cape bio pharms) is currently generating s protein derivatives as reagents. although the spike glycoprotein is heavily glycosylated and needs to be expressed in a more complex expression host to ensure appropriate post-translational modifications, both mammalian cells and plants would be suitable to produce both spike and nucleocapsid, and novel approaches to enhance recombinant glycoprotein production in plants have also been developed in south africa . given the optimistic development timeline of - months before any vaccines could be available for widespread use, it is clear that these efforts will not box | potential impact of climate on sars-cov- dissemination the comparatively low incidence of coronavirus disease- (covid- ) in africa has raised the possibility that climate could influence the spread of severe acute respiratory syndrome coronavirus (sars-cov- ). there is some circumstantial evidence describing a possible association between higher temperatures and lower severity of covid- to support this hypothesis; however, outbreaks in malaysia, hong kong, australia and south africa seem to be inconsistent with this theory as large numbers of infections have been reported despite higher temperatures [ ] [ ] [ ] . the influence of climate could potentially account for the severity of the pandemic in central china and northern italy, where winter may have been particularly conducive to the spread of the virus . these cold conditions are reminiscent of the environment in which sars-cov first emerged in china in november (ref. ). although these observations are compelling, it is noteworthy that many of these studies have yet to undergo formal peer review, and the accuracy of species distribution models is constrained by variability in global testing capacity . for example, infections in many african countries are expected to be an underestimate that reflects the lower number of tests conducted. it is also acknowledged that numerous other variables could influence the spread of the virus and may confound interpretations of the impact of climate. these variables may include variation in population density and age distribution, timely lockdown measures, adherence to social distancing protocols or even childhood vaccination with mycobacterium bovis bacille calmette-guérin as examples . the impact of differing behaviour, with increased social mixing, in the winter months also cannot be discounted . as with many respiratory pathogens, both middle east respiratory syndrome (mers-cov) and sars-cov exhibit decreased viability in the laboratory following exposure to increasing temperature and humidity , . similar observations have also been reported for influenza virus and respiratory syncytial virus, for which the incidence of infection is highest under cold and dry conditions, which results in seasonal cycles of infection , . a similar seasonality has also been observed for other endemic human coronaviruses, which led to the speculation that sars-cov- may also conform to a seasonal cycle of infection . however, although all four endemic human coronaviruses (hcov- e, hcov-oc , hcov-nl and hcov-hku ) exhibit a marked winter seasonality , the pathogenic human coronaviruses (mers-cov and sars-cov) do not conform to such a defined infection cycle. for example, mers-cov generally occurs mostly during summer months in the middle east despite temperatures often exceeding °c . by contrast, the highest incidence of sars-cov was reported during the winter months, although the outbreak continued to spread throughout spring in hong kong , . therefore, more research is needed to define the impact of climate on the spread of sars-cov- . a diagnostic test that measures the presence of antibodies in blood to determine exposure to pathogens or to diagnosis autoimmune diseases. sera obtained from individuals who have recovered from an infectious disease and contain antibodies against the pathogen. www.nature.com/nrmicro affect the first wave of the pandemic . more importantly, the lack of manufacturing capacity in africa and the global demand for immunization against the virus will further delay the availability of vaccines in the region. repurposing existing drugs presents a feasible short-term strategy to manage the pandemic, especially given that some of the drug candidates are already available and have an established safety profile in humans . these drugs would face lower regulatory barriers for approval and, in addition to being used for treating active infections, may have potential to be used as prophylactics for individuals at high risk, such as health-care workers or those who have been in contact with documented cases of infection. currently, two treatments have been shown to have an effect on the outcome of covid- . the broad-spectrum antiviral drug remdesivir has been shown to shorten the recovery time in adults admitted to hospital with severe covid- in a publication of preliminary results from a double-blind, randomized, placebo-controlled trial in the usa . however, remdesivir did not reduce mortality. by contrast, initial data from the recent recovery trial in the uk suggest that daily oral or intravenous doses of dexamethasone ( mg for days) reduced mortality by one-fifth in hospitalized patients with proven covid- requiring oxygen therapy, and that mortality was reduced by one-third in patients who needed mechanical ventilation . it had no effect on patients hospitalized with covid- who were not requiring oxygen. the reductions in mortality were seen in patients whose symptoms started > days before receipt of the drug. the fact that a commonly used corticosteroid could reduce mortality in this trial is promising, as numerous other corticosteroids such as prednisolone and hydrocortisone (which were options in the recovery trial in pregnant women) are equally available, and some of them are manufactured in africa, which means that access may be less of an issue than for other more novel medicines. more commonly available medicines have been, and some continue to be, used in investigational treatments for covid- . the commonly available antimalarials chloroquine and hydroxychloroquine were among the first to be investigated. initial studies were small and underpowered, and some combined hydroxychloroquine with azithromycin and some proved highly controversial in relation to their conduct, leading to retraction . one of the arms of the recovery trial included hydroxychloroquine, and on june the independent data monitoring committee review of the data concluded that there was no beneficial effect of hydroxychloroquine in patients hospitalized with covid- (ref. ). shortly after, the world health organization (who) announced that recruitment for the hydroxychloroquine arm of the solidarity trial was being stopped , . all experimental treatments should either be introduced into properly conducted clinical trials or, if a country decides to use such a medicine outside a trial, then it should be controlled according to the who's monitored emergency use of unregistered interventions (meuri) framework, whereby it can be ethically appropriate to offer individuals investigational interventions on an emergency basis, in the context of an outbreak characterized by high mortality . large-scale adaptive studies such as the recovery and solidarity trials continue, and such trials will reduce the time taken for randomized clinical trials . several african countries, including south africa, burkina faso and senegal, are in the process of joining the solidarity study. similarly, small studies are ongoing in several countries, looking at the utility of convalescent plasma from patients who recently recovered from covid- as potential prophylaxis or treatment . the need for randomized control trials using this treatment modality has been stressed . unlike other investigational medicines, convalescent plasma can be readily produced, even in low and middle-income countries, through the national blood transfusion service, making it an attractive option for study. however, scaling production for use is the rate-limiting step for this intervention. preliminary studies identified monoclonal antibodies with the ability to neutralize sars-cov- , which may also be important candidates for both treatment and prophylaxis, although similar issues with manufacture are a challenge , . there is increasing recognition that pathophysiology of severe covid- includes an appreciable component of hyperactivation of inflammatory responses, manifesting as a cytokine storm and secondary haemophagocytic lymphocytic histiocytosis. in addition to the findings relating to dexamethasone detailed above, various immune-modulating drugs have been proposed as treatment options for covid- . the il- inhibitors tocilizumab (actemra; roche) and sarilumab (kevzara; sanofi and regeneron), which are used to treat arthritis, are already being used in patients with covid- (nct ) . their mechanism of action involves the prevention and the inhibition of the overactive inflammatory responses in the lungs. both drugs have entered phase iii clinical trials for sars-cov- . a late-stage clinical trial with another il- inhibitor, siltuximab (sylvant; eusa), started in italy in mid-march (nct ). anti-inflammatory drugs used in combination with an antiviral drug such as remdesivir may increase the potential of the drug to improve disease outcome . genentech has recently initiated a phase iii trial (remdecta) to study the efficacy and safety of tocilizumab and remdesivir in patients hospitalized with severe covid- pneumonia (nct ). additionally, the covacta study (nct ) will evaluate tocilizumab and standard of care versus standard of care alone in a similar cohort . patients who have chronic medical conditions may be at higher risk for serious illness from covid- , including those with pulmonary fibrosis . the antifibrotic drug pirfenidone (genentech) has already entered a study to evaluate its efficacy and safety (nct ). recombinant angiotensin-converting enzyme (ace ; apn ) that lacks the transmembrane region of the protein was developed by apeiron biologics for the treatment of acute lung injury and pulmonary artery hypertension. the soluble ace has the potential to reduce lung injury by activating the anti-fibrotic and a disproportionately large cytokine response that promotes inflammation and is harmful to the host. nature reviews | microbiology anti-inflammatory angiotensin ( - )-mas receptor axis of the renin-angiotensin-aldosterone system, and by acting as a decoy and preventing infection by binding to the sars-cov- virus and inactivating it. apn is being tested in a phase i trial in china, and approval has been secured to carry out phase ii trials in austria, germany and denmark (nct ). currently, there are no targeted therapies for covid- . however, numerous drug discovery programmes are in progress, and a recent study reported a structure-based drug design strategy, as well as virtual and high-throughput screening to identify lead compounds that bind to the main protease of the virus (m pro ; also known as cl pro ) . the active site of the protease is highly conserved among coronaviruses, making a strong case for pursuing an m pro -targeting drug. the organoselenium drug ebselen, which is an anti-inflammatory and antioxidant, showed high affinity for m pro and showed promising antiviral activity (concentration that gives half-maximal response ec = . μm). thus, the presented approach may greatly accelerate the discovery of drug leads with potential in the clinic. the drug discovery and development centre (h d) based at the university of cape town is the only fully integrated drug discovery centre in africa that has taken a drug into a phase ii clinical trial. the centre has very strong collaborations with the pharmaceutical industry and mmv, a leading product development partnership, as well as the infrastructure and expertise to find potential therapies against covid- . h d has assembled chemical libraries for its malaria and tuberculosis projects that could be screened to identify possible drug leads against sars-cov- ; however, this will require additional resources and funding because the centre is contractually focused on antimalarial and anti-tuberculosis drug development. the infrastructure for large-scale, high-volume vaccine manufacturing is largely absent in africa, and the rapidly escalating covid- pandemic highlights the urgent need for capital investment in the region to lessen reliance on developed countries. the few facilities that are available are specialized, and are not well-suited to produce vaccines for sars-cov- (table ) . it is also anticipated that it would take a minimum of months to build a suitable manufacturing plant under ideal conditions, and therefore to contribute to the global covid- vaccine initiative, african developers will need to outsource large-scale manufacturing in the short term. the african vaccine manufacturing initiative, which aims to develop local manufacturing capacity in africa, has established a working group and is actively engaged with key stakeholders to meet the local need for a vaccine. innovative biotech (nigeria) has already partnered with medigen (usa) and merck (germany) to apply their insect cell production platform to producing virus-like particles with the intention of initiating a clinical trial in nigeria. similarly, the ethiopian public health institute (ephi) is planning to partner with techinvention (india) to produce the sars-cov- spike protein in a yeast-based fermentation system, although limited details are available (personal communication, s. agwale, ceo of innovative biotech). last, biovac (south africa) has modern facilities at a modest scale and has initiated a feasibility study for a large-scale facility with an annual minimum production capacity of million vaccine doses for covid- and future pandemic vaccines, as well as vaccines for routine immunization use (personal communication, p. tippoo, head of science and innovation, biovac). given the global demand for a covid- vaccine, it is likely that even when a suitable candidate is approved for human use, there will be a considerable delay before it is available in africa. this is not unprecedentedduring the h n influenza pandemic, a global shortage of influenza vaccines resulted in limited supplies being provided for countries in the region, and, in fact, the vaccines only became generally available after (ref. ). this unfortunate, but entirely plausible, scenario may necessitate prioritizing high-risk groups, such as health-care workers and older individuals, to receive the first sars-cov- vaccines to reach africa. more than vaccine candidates are currently in preclinical development around the world, and vaccines are already being tested in clinical trials , (table ) . these vaccines are mostly focused on eliciting immunity against the spike glycoprotein, although other viral antigens may also have a role in vaccine-mediated protection (box ). the speed of clinical deployment of these vaccines is unprecedented, but there are concerns regarding the longevity of immune responses and the potential although the rapid progress to clinical testing is encouraging, it is still too early to determine whether they will confer immunity against sars-cov- infection or whether they will ameliorate the disease course following infection. the only peer-reviewed report of a sars-cov- vaccine in clinical trial to date is for cansino biologics' ad -ncov vaccine, which recently completed phase i testing. encouragingly, the vaccine elicited both binding antibodies and antigen-specific t cells, although, disappointingly, only % of volunteers developed neutralizing antibodies in the low ( × viral particles) and medium ( × viral particles) dose regimens. however, % of the high-dose group ( . × viral particles) developed neutralizing antibodies. perhaps unsurprisingly, the high-dose group also reported a higher incidence of adverse effects following vaccination and only the low and intermediate doses will be pursued in phase ii trials . despite the absence of suitable facilities for current good manufacturing practice (cgmp)-compliant vaccine or therapeutics manufacturing in most of africa, considerable expertise in preclinical vaccine development is also available in academic institutes, and vaccines could be manufactured on contract for clinical trials as was the case for the south african aids vaccine initiative . accordingly, groups at the university of cape town (south africa), the national research centre (egypt) and the kenya aids vaccine initiative (kavi) have all confirmed that early-stage research on sars-cov- vaccine development is underway -although further details have not been disclosed . important considerations for these vaccines will be the cost, their safety in individuals who box | sars-cov- virus structure and targets for vaccine development severe acute respiratory syndrome coronavirus (sars-cov- ) comprises pleomorphic virions, ranging from to nm in diameter, with prominent glycoprotein spike proteins projecting from the virus surface . the virion also contains the membrane, envelope and nucleocapsid proteins, which encapsulate the viral genome and accessory proteins (see the figure, left). the spike protein is a glycosylated type fusion protein that mediates infection by binding the host membrane-anchored angiotensin-converting enzyme (ace ) . the glycoprotein is organized into extracellular (s ) and membrane-spanning (s ) subunits, which mediate receptor binding and membrane fusion, respectively (not shown). binding of the spike protein to ace results in a conformational change that enables the dissociation of the s subunit and the insertion of the fusion peptide into the host membrane . the spike glycoprotein is the primary target of vaccine development, based on the premise that neutralizing antibodies against spike will prevent viral entry into susceptible cells (see the figure, right). this is supported by preclinical immunogenicity studies, for the related middle east respiratory syndrome coronavirus (mers-cov) and sars-cov, for which immunization with spike-based vaccines elicited protective antibody responses , . more recently, neutralizing antibodies against the sars-cov- spike have been reported in natural infection; these are readily elicited and frequently target the receptor-binding domain in s (ref. ). the potential role of cell-mediated immunity in coronavirus vaccines generally has not been as well explored. it is reasonable to expect that cellular immune responses would contribute to viral clearance and ameliorate the severity of the disease, as well as support the development of antibody responses. accordingly, robust and durable cellular responses have been observed against the spike, membrane, envelope and nucleocapsid proteins in patients who recovered from sars coronavirus infection [ ] [ ] [ ] . ultimately, both cell-mediated and humoral responses are desirable in a vaccine, especially given the observation that cellular responses are longer lived than antibodies following infection with sars coronaviruses , . mhc, major histocompatibility complex. humoral immunity: • neutralizing antibodies prevent interaction of spike with ace • antibody effector functions can contribute to viral clearance • b cell memory for durable immunity genetic immunization with plasmid dna is perhaps the easiest vaccine modality to develop for clinical trials as the manufacturing process is well established, the incumbent costs are low compared with other platforms and multiple clinical trials have shown their safety. technological advances have also substantially reduced the time from identifying the viral sequence to initiating immunizations in humans . accordingly, dna vaccines have been advanced into the clinic in response to several emerging pathogens, including mers-cov, and inovio pharmaceuticals (usa) have already completed recruiting participants to initiate a phase i trial with a candidate dna vaccine against sars-cov- (nct ) . recent preclinical data demonstrated that the vaccine elicited neutralizing antibodies in both mice and guinea pigs, and an unrelated study reported that immunization with a dna vaccine protected against viral challenge in macaques , . genetic immunization is well-suited to clinical development for africa, and candidate vaccines could be manufactured to cgmp standards using one of the contract manufacturers offering this service. however, there are no licensed human vaccines based on this platform, and the current delivery methods are not suitable for large-scale immunization. host-restricted viral vectors are another promising vector platform for immunization in africa . replication-deficient chimpanzee adenovirus-based vaccines have shown promise for several emerging viruses, and given their simian origin, they circumvent concerns for vector-specific immunity as was observed when using human adenoviral vectors for immunization . a single dose of a mers-cov- vaccine using this platform was reported to elicit protective immunity in non-human primates . more recently, a single immunization with chadox encoding the sars-cov- spike protected against pneumonia and lowered viral loads in both bronchoalveolar lavage and respiratory tract samples in macaques following challenge . this effect was observed in the absence of high titres of neutralizing antibodies and the impact of the vaccine was to ameliorate severe disease rather than to prevent infection. although it is disappointing that the vaccine did not confer sterilizing immunity in monkeys, it is noteworthy that the monkeys only received a single immunization and that the inoculum used for challenge was high. it should be noted that the high-challenge inoculum was conceived to determine whether immunization resulted in vaccine-mediated enhancement of infection, and that there was no evidence to suggest that this would be a concern . this is the vaccine being pursued by the university of oxford in collaboration with astrazeneca that is now in phase ii testing. a clinical trial for this vaccine has recently been initiated in johannesburg (south africa), and this is the first vaccine for sars-cov- to be tested in africa. the manufacturing cost of chadox would be far less than for a subunit vaccine and, moreover, no adjuvant is needed for immunization. poxvirus-based vectors are similarly attractive: they elicit strong humoral and cellular immune responses, can be manufactured at low cost and are stable in the absence of a sustained cold chain , . in addition, they can accommodate larger genetic insertions, which could be exploited to encode multiple sars-cov- genes (such as the spike, nucleocapsid, membrane and envelope antigens) and could potentially produce virus-like particles. suitable examples of candidate poxvirus vectors include the attenuated orthopoxviruses modified vaccinia ankara (mva) and nyvac , the avipoxviruses canarypox virus (alvac) and fowlpox virus (fwpv) , and the capripoxvirus lumpy skin disease virus (lsdv) . mva is the most widely explored of these vectors. having been attenuated by more than passages in chick embryo fibroblast cells, mva has a well established safety record, including in individuals who are immunocompromised, and has recently been approved as a vaccine against smallpox , . nyvac was engineered by the purposeful deletion of genes involved in host range and pathogenicity; it causes no disseminated disease in immunodeficient mice, like mva, and is unable to replicate in humans . several mva-vectored vaccines of particular relevance to africa have shown promise in clinical trials, usually in prime-boost regimens together with other vectors such as dna or adenovirus. these include vaccines against hiv- (ref. ), mycobacterium tuberculosis and box | immunological challenges for sars-cov- vaccine development two concerns have been raised that could undermine the vaccines against severe acute respiratory syndrome coronavirus (sars-cov- ) in clinical testing: the longevity of immunity, and the potential for adverse effects following sars-cov- infection in immunized volunteers. the durability of antibody responses has implications for vaccine development, as immunization may need to induce stronger immunity than natural infection. this concern is partly due to observations of waning neutralizing antibody titres after sars coronavirus infection, and a lack of knowledge regarding the potential for sars-cov- re-infection [ ] [ ] [ ] . encouragingly, preliminary data suggest that rhesus macaques may be resistant to challenge with sars-cov- after clearing the primary infection . the duration of this protection remains unclear, as do the correlates of immunity. low neutralizing antibody titres were recently reported in % of patients who recovered from mild infection with sars-cov- , which suggests that cellular responses may have an important role in viral clearance. however, it is plausible that neutralizing antibody titres correlate with disease severity and merely reflect the extent of antigenic stimulation . another concern is vaccine-induced enhancement of infection. this can manifest as either antibody-dependent enhancement or cell-mediated inflammatory responses that result in pathology following exposure to the virus. accordingly, type t helper cell-mediated lung pathology with eosinophilic infiltrates has been observed in vaccinated and challenged animals for both middle east respiratory syndrome coronavirus (mers-cov) and sars-cov [ ] [ ] [ ] . the potential impact of antibodydependent enhancement in the context of coronavirus vaccines has not been as well defined, although the phenomenon has been described for a monoclonal antibody targeting the mers coronavirus spike glycoprotein . preliminary data suggest that antibody-dependent enhancement may account for the severity of covid- in some cases, where previous exposure to other coronaviruses may have elicited responses that enhanced infection, although this remains to be determined . www.nature.com/nrmicro ebola virus . lsd, a notifiable disease of cattle worldwide, is prevalent in most african countries, and the live-attenuated neethling vaccine strain is widely used to control the disease on the continent . lsdv is being developed both as a multivalent cattle vaccine vector , and as a host-restricted hiv- vaccine vector . it has been shown to have no adverse effects in immunodeficient mice, and although this vector could not be used in countries free of lsdv, it has potential as a human vaccine in sub-saharan africa . together with mva and nyvac, the avipoxvirus vectors alvac (attenuated canarypox virus) and fwpv are probably more realistic targets for rapid clinical development, as they have also undergone testing in humans, and alvac is already licensed for several veterinary applications plant-based vaccine protein production is an emerging technology that is well-suited to resource-limited areas given the capacity of the system for rapidly scalable production, the low manufacturing costs and the less sophisticated infrastructure requirements than mammalian expression systems . the platform is well established to produce diverse classes of recombinant proteins, and recent advances in expression technologies and molecular engineering have also enabled improvements in glycoprotein production in plants , . encouragingly, a preliminary pilot study suggests that these appro aches can be applied to produce the sars-cov- spike in nicotiana benthamiana plants, warranting further testing of the recombinant antigen in preclinical vaccine immunogenicity models . three leading plant biotechnology companies, medicago inc. (canada), ibio inc. (usa) and kentucky bioprocessing inc. (usa), have already announced the successful production of candidate virus-like particle vaccines against sars-cov- . although plant-based manufacturing of recombinant protein antigens may be the most suitable solution for africa, it may also pose a challenge for manufacturing. the major advantages of plant-based vaccine production for sars-cov- in africa are the lower costs and the potential for rapid production scale-up to accommodate the large demand for a vaccine. this is best demonstrated in the context of influenza vaccine development, as a fully formulated virus-like particle vaccine was produced within weeks following release of the viral sequence . this rapid development timeline supported the production of million doses of the vaccine within month . however, despite the costs to establish a gmp-compliant plant-based manufacturing facility being considerably less than those for the equivalent mammalian platform (for example, us$ - million versus us$ - million, respectively), they are not insignificant, and the capital investment required has been prohibitive for africa . furthermore, there are few suitable contract manufacturing organizations worldwide, and these are already invested in their own sars-cov- vaccine development programmes. several recent preliminary data have suggested a possible correlation between bacille calmette-guérin (bcg) vaccination and lower prevalence and mortality due to covid- (refs [ ] [ ] [ ] [ ] ). the bcg vaccine is one of the most widely used vaccines worldwide and has been used to vaccinate against tuberculosis for nearly years. the vaccine comprises a live, attenuated form of mycobacterium bovis, which provides protection against disseminated forms of tuberculosis in infants but gives variable protection against pulmonary tuberculosis in adults , . non-specific cross-protection against other pathogens, including those causing respiratory tract infections, has also been documented . this effect may be attributable to altered expression of host cytokines and pattern-recognition receptors, as well as the reprogramming of different cellular metabolic pathways that, in turn, increases the innate immune response to other pathogens , . however, potential correlation between bcg vaccination and covid- severity should be interpreted with caution. first, it is unlikely that bcg vaccination at birth will still provide non-specific cross-protection against viral pathogens in older individuals. second, the correlation could be influenced by numerous unknown confounding factors, including variation in testing between countries, which leads to differences in the recorded case numbers; differences in average population age, ethnic and genetic backgrounds; the stage of the pandemic in each country; and different approaches to mitigating the spread of the disease in different countries. numerous clinical trials are presently underway to determine whether bcg vaccination reduces the incidence and severity of covid- in health-care workers and older individuals (supplementary table) . a trial has also started in egypt (nct ), where disease severity and mortality in patients with covid- will be compared between those with positive and negative tuberculin tests. in brazil, the bcg vaccine will be given to patients with covid- as a therapeutic vaccine to evaluate the impact on the rate of elimination of sars-cov- , the clinical evolution of covid- and the seroconversion rate and titres of anti-sars-cov- antibodies. as the bcg vaccine has been administered to most neonates in south africa and france until recently, these trials will also investigate the effect of revaccination with the bcg vaccine. in addition, a new modified version of bcg, namely vpm , which expresses listeriolysin instead of urease c, will be tested in health-care workers and older individuals in germany . securing a reliable supply of bcg vaccine doses could be a challenge in africa if re-immunization shows promise, as there is limited manufacturing capacity for the vaccine on the continent. historically, shortages of the vaccines were documented in % of countries on the continent between and (ref. ). this was largely due tuberculosis diagnostic tests that involve the intradermal injection of bacterial antigens to determine whether the recipient mounts an immune response at the site of injection. nature reviews | microbiology to lack of supply, but the limited availability of financing, procurement shortcomings and ineffective vaccine management also contributed to the shortage. the low price for a bcg vaccine and limited investment has also reduced the incentive for manufacturers to redesign and improve production processes in the region. from to , the -tokyo bcg strain was produced at the state vaccine institute in cape town, south africa; however, this was discontinued as the cost of importing the vaccine was lower than that of local manufacture. the potential impact of co-infections africa shoulders a considerable burden of co-infections. although hiv- and tuberculosis may be the most important infections when considering potentially enhanced covid- disease severity, the high incidence of malaria and helminth infections as well as multiple ongoing outbreaks of ebola virus disease, lassa fever, cholera, measles, yellow fever, hepatitis e and chikungunya virus all represent infections with unknown interactions with sars-cov- . the high prevalence of hiv- and tuberculosis in sub-saharan africa presents an important but largely unknown challenge for the continent with regard to covid- . the urgent question that needs answering is whether individuals with hiv- , or those with past or current tuberculosis, have a higher risk of infection or greater morbidity and mortality from covid- . of the . million people living with hiv- globally, . million live in sub-saharan africa, and it is estimated that % are accessing antiretroviral therapy and % are virally suppressed . although individuals who are immunocompetent with well-controlled hiv- infections may be at no greater risk for covid- , there remains a considerable number of individuals with low cd counts and uncontrolled hiv- viraemia who may be at risk of severe disease. to date, there have been two published reports of concurrent covid- and hiv- infection , . although the cohort was an extremely limited group of patients predominantly established on antiretroviral therapy, the pattern of clinical disease did not differ from that observed in the general population, but more research is needed to confirm this result. the severity of other respiratory infections concomitant with hiv- may provide some clues: although the immunopathogenesis of sars-cov- is probably distinct in several aspects from influenza viruses, there are some shared clinical features. hiv- infection is associated with a greater susceptibility to influenza virus infection, increased severity of influenza-related disease and poorer prognosis in patients who are severely immunocompromised . a large south african study observed an eightfold higher incidence of influenza virus infection and a fourfold greater risk of death in the case of hiv- co-infection . paradoxically, there is also evidence that lower inflammatory responses in individuals who are immunocompetent and infected with hiv- may lead to milder influenza-related disease . in addition to altering the clinical course of disease, hiv- infections may result in poorer antibody responses that may lead to prolonged viral shedding, thereby influencing disease transmission . tuberculosis, a disease that causes chronic lung damage, may also present a challenge in the covid- era. there were approximately . million new cases of tuberculosis in africa in (ref. ). in a south african study of patients who were hospitalized for severe respiratory illness, those with influenza virus infection together with laboratory-confirmed tuberculosis had a . -fold greater risk of death . hiv- largely drives the tuberculosis epidemic in sub-saharan africa, and the 'triple-hit' of hiv- , tuberculosis and sars-cov- infection is consequently of considerable concern. a preliminary study suggests that hiv- infection increases the risk of mortality from covid- by . -fold, and this increased risk seemed to be independent of suppressed hiv- viral load due to antiretroviral therapy. individuals with current tuberculosis had a . -fold greater risk of death . these figures represent a modest increased risk compared with older age and co-morbidities such as diabetes in the same population, which suggests that hiv- and tuberculosis may not be considered major risk factors for covid- . although this would be considered good news, further studies are awaited to confirm these initial observations. the two main potential issues for using sars-cov- vaccines in individuals infected with hiv- are safety and efficacy. however, potential safety issues are likely to be restricted to use of certain vaccine modalities, such as live-attenuated or replicating vaccines, in individuals who are highly immunosuppressed. when considering vaccine efficacy, the magnitude and durability of immunity in individuals infected with hiv- for both vaccination against and natural infection with sars-cov- is unknown. to date, there are no reports describing immune responses to sars-cov- in individuals infected with hiv- . it is possible that individuals with hiv- may have incomplete immune reconstitution and impaired immunity that may influence vaccine safety and efficacy, even if they are receiving antiretroviral therapy, owing to persistent immune activation and incomplete recovery of t cell and b cell immunity , . suboptimal neutralizing antibody responses have been described following immunization against influenza virus or other pathogens in individuals infected with hiv- (ref. ). weaker antibody responses and lower influenza virus-specific memory b cell responses in individuals infected with hiv- were directly related to cd counts . it will be important to test candidate vaccines for their ability to generate immune responses in a range of high-risk groups, including patients with hiv- . several strategies may improve the magnitude and durability of vaccine responses in individuals infected with hiv- , such as higher doses, booster immunizations and/or the use of adjuvants . substantive data on the clinical and immunological interaction of hiv- , tuberculosis and covid- will emerge from africa in time for improved strategies to guide clinical management of patients who are co-infected and the vaccine regimens. finally, an important additional point to note is the indirect effects of covid- on health in africa within the setting of a high burden of infectious diseases. the who estimates that the disruption in vaccination due to www.nature.com/nrmicro disruption in supply could put million infants at risk of contracting vaccine-preventable diseases . several countries have reported reduced uptake of tuberculosis testing, and patients failing to collect tuberculosis medication or antiretroviral therapy owing to overwhelmed health-care systems, lockdown interventions and public fear of contracting covid- (ref. ). mitigating these interruptions in prevention, diagnosis and treatment, and ensuring that essential health services continue, will ultimately lower the overall impact of the covid- pandemic in africa. the ongoing covid- pandemic presents an unprecedented global humanitarian and medical challenge. although this has prompted unparalleled progress in the development of vaccines and therapeutics in many countries, it has also highlighted the vulnerability of resource-limited countries in africa. not only do these countries have limited testing capacity but the infrastructure to manufacture tests, vaccines and therapeutic drugs is largely absent, and few clinical trials are underway on the continent to combat sars-cov- . clearly, there is an urgent need for capacity development and the available resources should focus on solutions that are specific to the needs of the continent. for example, there is an urgent need to inexpensively manufacture viral antigens for serological testing: this will determine the seroprevalence of the virus where pcr-based testing is not available for mild infections. therapeutics development should focus on repurposing existing drugs, or using convalescent plasma that can rapidly be used to treat infection and could be prioritized for individuals who are at high risk. appropriate manufacturing partnerships need to be established to produce vaccines that could be tested and licensed on the continent, to limit reliance on global initiatives that may be overwhelmed by the global demand for a vaccine. in fact, this may present an opportunity for governments to finally invest in much-needed cgmp-compliant vaccine manufacturing facilities. although the situation is unquestionably dire, africa has an important role in the global fight against covid- , and the resilience and resourcefulness of the people are not to be underestimated. published online xx xx xxxx epidemiology, genetic recombination, and pathogenesis of coronaviruses identification of a novel coronavirus in patients with severe acute respiratory syndrome isolation of a novel coronavirus from a man with pneumonia in saudi arabia a novel coronavirus from patients with pneumonia in china epidemiological and clinical characteristics of cases of novel coronavirus pneumonia in wuhan, china: a descriptive study an interactive web-based dashboard to track covid- in real time a pneumonia outbreak associated with a new coronavirus of probable bat origin probable pangolin origin of sars-cov- associated with the covid- outbreak emergence of sars-cov- through recombination and strong purifying selection clinical course and outcomes of critically ill patients with sars-cov- pneumonia in wuhan, china: a single-centered, retrospective, observational study clinical characteristics of coronavirus disease in china covid- infection may cause ketosis and ketoacidosis diabetic ketoacidosis in covid- : unique concerns and considerations neurological and neuropsychiatric complications of covid- in patients: a uk-wide surveillance study hyperinflammatory shock in children during covid- pandemic kawasaki-like disease: emerging complication during the covid- pandemic sars-cov- infection in children the effect of travel restrictions on the spread of the novel coronavirus (covid- ) outbreak looming threat of covid- infection in africa: act collectively, and fast hospital beds (per population covid- : keep essential malaria services going during pandemic, urges who zimbabwe under strain as malaria cases surge during covid- fight substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (sars-cov ) coronavirus (covid- ) testing. global change data lab covid- in europe: the italian lesson feasibility of controlling covid- outbreaks by isolation of cases and contacts south africa's coronavirus testing strategy is broken and not fit for purpose: it's time for a change let africa into the market for covid- diagnostics detection of novel coronavirus ( -ncov) by real-time rt-pcr african countries unite to create 'one stop shop' to lower cost of covid- tests and ppe covid- lockdowns in low-and middle-income countries: success against covid- at the price of greater costs an alternative workflow for molecular detection of sars-cov- -escape from the na extraction kit-shortage crispr-cas -based detection of sars-cov- antibody responses to sars-cov- in patients with covid- antibody tests for identification of current and past infection with sars-cov- dynamics of igg seroconversion and pathophysiology of covid- infections rapid decay of anti-sars-cov- antibodies in persons with mild covid- sars-cov- seroconversion in humans: a detailed protocol for a serological assay, antigen production, and test setup severe acute respiratory syndrome coronavirus -specific antibody responses in coronavirus disease patients evaluation of nine commercial sars-cov- immunoassays developing antibody tests for sars-cov- the receptor binding domain of the viral spike protein is an immunodominant and highly specific target of antibodies in sars-cov- patients plant-produced crimean-congo haemorrhagic fever virus nucleoprotein for use in indirect elisa expression of rift valley fever virus n-protein in nicotiana benthamiana for use as a diagnostic antigen the expression of sars-cov m gene in p. pastoris and the diagnostic utility of the expression product co-expression of human calreticulin significantly improves the production of hiv gp and other viral glycoproteins in plants vaccines: status report a sars-cov- protein interaction map reveals targets for drug repurposing remdesivir for the treatment of covid- -preliminary report dexamethasone in hospitalized patients with covid- -preliminary report hydroxychloroquine and azithromycin as a treatment of covid- : results of an open-label non-randomized clinical trial retraction-hydroxychloroquine or chloroquine with or without a macrolide for treatment of covid- : a multinational registry analysis no clinical benefit from use of hydroxychloroquine in hospitalised patients with covid- . nuffield department of population health solidarity" clinical trial for covid- treatments hydroxychloroquine use against sars-cov- infection in non-human primates world health organization guidance for managing ethical issues in infectious disease outbreaks race to find covid- treatments accelerates effectiveness of convalescent plasma therapy in severe covid- patients deployment of convalescent plasma for the prevention and treatment of covid- neutralizing antibody responses to sars-cov- in a covid- recovered patient cohort and their implications human neutralizing antibodies elicited by sars-cov- infection effective treatment of severe covid- patients with tocilizumab covid- : combining antiviral and anti-inflammatory treatments phase iii trial to study combination of genentech's actemra, gilead's remdesivir versus severe covid- pulmonary fibrosis and covid- : the potential role for antifibrotic therapy structure of m pro from covid- virus and discovery of its inhibitors setting up a platform for plant-based influenza virus vaccine production in south africa the covid- vaccine development landscape covid- vaccine development pipeline gears up safety, tolerability, and immunogenicity of a recombinant adenovirus type- vectored covid- vaccine: a dose-escalation, open-label, non-randomised, first-in-human trial subtype c gp vaccine boosts immune responses primed by the south african aids vaccine initiative dna-c and mva-c hiv vaccines after more than a -year gap african nations missing from coronavirus trials novel vaccine technologies: essential components of an adequate response to emerging viral diseases new vaccine technologies to combat outbreak situations immunogenicity of a dna vaccine candidate for covid- dna vaccine protection against sars-cov- in rhesus macaques the evolution of poxvirus vaccines chimpanzee adenoviral vectors as vaccines for outbreak pathogens a single dose of chadox mers provides protective immunity in rhesus macaques chadox ncov- vaccine prevents sars-cov- pneumonia in rhesus macaques vaccinia-based vaccines to biothreat and emerging viruses the smallpox vaccination strain mva: marker, genetic structure, experience gained with the parenteral vaccination and behavior in organisms with a debilitated defence mechanism the poxvirus vectors mva and nyvac as gene delivery systems for vaccination against infectious diseases and cancer applications of canarypox (alvac) vectors in human and veterinary vaccination fowlpox virus as a recombinant vaccine vector for use in mammals and poultry immunogenicity of a recombinant lumpy skin disease virus (neethling vaccine strain) expressing the rabies virus glycoprotein in cattle vaccination against pox diseases under immunosuppressive conditions phase efficacy trial of modified vaccinia ankara as a vaccine against smallpox nyvac: a highly attenuated strain of vaccinia virus aiming for protective t cell responses: a focus on the first generation conserved-region hiv consv vaccines in preventive and therapeutic clinical trials a phase iia trial of the new tuberculosis vaccine, mva a, in hiv-and/or mycobacterium tuberculosis-infected adults safety and immunogenicity of a -dose heterologous vaccine regimen with ad .zebov and mva-bn-filo ebola vaccines: -month data from a phase randomized clinical trial in nairobi, kenya review: capripoxvirus diseases: current status and opportunities for control evaluation of lumpy skin disease virus, a capripoxvirus, as a replication-deficient vaccine vector a novel candidate hiv vaccine vector based on the replication deficient capripoxvirus, lumpy skin disease virus (lsdv) development and registration of recombinant veterinary vaccines. the example of the canarypox vector platform molecular pharming for low and middle income countries when plant virology met agrobacterium: the rise of the deconstructed clones calreticulin co-expression supports high level production of a recombinant sars-cov- spike mimetic in nicotiana benthamiana the production of hemagglutininbased virus-like particles in plants: a rapid, efficient and safe response to pandemic influenza darpa's blue angel -pentagon prepares millions of vaccines against future global flu correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study connecting bcg vaccination and covid- : additional data differential covid- -attributable mortality and bcg vaccine use in countries association of bcg vaccination policy with prevalence and mortality of covid- systematic review and meta-analysis of the current evidence on the duration of protection by bacillus calmette-guérin vaccination against tuberculosis the efficacy of bacillus calmette-guérin vaccination of newborns and infants in the prevention of tuberculosis: meta-analyses of the published literature non-specific effects of bcg vaccine on viral infections bcg-induced cross-protection and development of trained immunity: implication for vaccine design safety and immunogenicity of the recombinant mycobacterium bovis bcg vaccine vpm in hiv-unexposed newborn infants in south africa bacillus calmette-guérin (bcg) vaccine: a global assessment of demand and supply balance outbreaks and emergencies bulletin covid- in patients with hiv: clinical case series co-infection of sars-cov- and hiv in a patient in wuhan city impact of hiv on the severity of influenza severe influenza-associated respiratory infection in high hiv prevalence setting influenza viral shedding in a prospective cohort of hiv-infected and uninfected children and adults in provinces of south africa who. global tuberculosis report the impact of influenza and tuberculosis interaction on mortality among individuals aged ≥ years hospitalized with severe www.nature.com/nrmicro respiratory illness in south africa hiv and risk of covid- death: a population cohort study from the western cape province, south africa effect of antiretroviral therapy on the memory and activation profiles of b cells in hiv-infected african women residual t cell activation and skewed cd + t cell memory differentiation despite antiretroviral therapy-induced hiv suppression immunization for hiv-positive individuals compromised b cell responses to influenza vaccination in hiv-infected individuals vaccination in hiv-infected adults at least million children under one at risk of diseases such as diphtheria, measles and polio as covid- disrupts routine vaccination efforts, warn gavi, who and unicef potential impact of the covid- pandemic on hiv, tuberculosis, and malaria in low-income and middle-income countries: a modelling study evidence that higher temperatures are associated with lower incidence of covid- in pandemic state, cumulative cases reported up to distribution of the sars-cov- pandemic and its monthly forecast based on seasonal climate patterns role of meteorological temperature and relative humidity in the coronavirus as a possible cause of severe acute respiratory syndrome species distribution models are inappropriate for covid- spatial modeling cannot currently differentiate sars-cov- coronavirus and human distributions on the basis of climate in the united states seasonality of respiratory viral infections stability of middle east respiratory syndrome coronavirus (mers-cov) under different environmental conditions the effects of temperature and relative humidity on the viability of the sars coronavirus absolute humidity and the seasonal onset of influenza in the continental united states epidemic dynamics of respiratory syncytial virus in current and future climates epidemiology and clinical presentations of the four human coronaviruses e, hku , nl , and oc detected over years using a novel multiplex real-time pcr method epidemiological, demographic, and clinical characteristics of cases of middle east respiratory syndrome coronavirus disease from saudi arabia: a descriptive study molecular evolution of the sars coronavirus during the course of the sars epidemic in china epidemiology, transmission dynamics and control of sars: the - epidemic cryo-em structure of the -ncov spike in the prefusion conformation tectonic conformational changes of a coronavirus spike glycoprotein promote membrane fusion a dna vaccine induces sars coronavirus neutralization and protective immunity in mice evaluation of candidate vaccine approaches for mers-cov persistent memory cd + and cd + t cell responses in recovered severe acute respiratory syndrome (sars) patients to sars coronavirus m antigen human memory t cell responses to sars-cov e protein long-lived memory t lymphocyte responses against sars coronavirus nucleocapsid protein in sars-recovered patients the host immune response in respiratory virus infection: balancing virus clearance and immunopathology virus-specific memory cd t cells provide substantial protection from lethal severe acute respiratory syndrome coronavirus infection disappearance of antibodies to sars-associated coronavirus after recovery two-year prospective study of the humoral immune response of patients with severe acute respiratory syndrome positive rt-pcr test results in patients recovered from covid- primary exposure to sars-cov- protects against reinfection in rhesus macaques immunization with sars coronavirus vaccines leads to pulmonary immunopathology on challenge with the sars virus immunization with inactivated middle east respiratory syndrome coronavirus vaccine leads to lung immunopathology on challenge with live virus a double-inactivated severe acute respiratory syndrome coronavirus vaccine provides incomplete protection in mice and induces increased eosinophilic proinflammatory pulmonary response upon challenge molecular mechanism for antibodydependent enhancement of coronavirus entry medical countermeasures analysis of -ncov and vaccine risks for antibody-dependent enhancement (ade) the authors acknowledge support from the south african medical research council with funds received from the south african department of science and technology, core funding from the wellcome trust ( /z/ /z) and funding from the south african research chairs initiative of the department of science and technology and national research foundation (grant number ). the authors contributed equally to all aspects of the article. the authors declare no competing interests. nature reviews microbiology thanks m. baylis, g. dougan, s. jiang and l. f. p. ng for their contribution to the peer review of this work. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. supplementary information is available for this paper at https://doi.org/ . /s - - - . key: cord- - z lhet authors: meena, jitendra; yadav, arushi; kumar, jogender title: bcg vaccination policy and protection against covid- date: - - journal: indian j pediatr doi: . /s - - - sha: doc_id: cord_uid: z lhet nan to the editor: wide disparity in disease burden and mortality in covid- among countries is intriguing. bcg vaccine is thought to be one of the factors attributing to this discrepancy. to explore this hypothesis, we assessed the correlation of covid- burden at three different time points ( april, april, and may ) with year-wise bcg coverage among the countries with universal bcg vaccination policy over past four decades . relevant data were extracted and analyzed using spss [ , ] . out of countries for which data on bcg vaccination and covid- was available, we excluded countries (< cases as on may , ). thirteen ( . %) countries didn't have a universal bcg vaccination policy at any time from to . among the countries with universal bcg vaccination policy (n- ), a weak but positive correlation (spearmen rho- . - . , p < . ) was observed between covid- cases and deaths per million population and bcg vaccination coverage rates (supplementary table ). there was no significant correlation between case-fatality rate and bcg coverage at any of the abovementioned time points. we further explored the relationship by adjusting for covariates (age > y, cardiovascular disease death rate, diabetes, gdp per capita, beds per thousand population, and the number of tests done per million population) and didn't find any consistent and significant relationship between bcg vaccination rates and covid- burden. these results suggest against any meaningful relationship between country's bcg vaccination coverage and covid- burden. preprint studies have reported a negative association between bcg and covid- [ ] . however, these associations are spurious as they chose bcg vaccination as a dichotomous variable (yes/no, counted yes even if the coverage is - % and vaccination was stopped - decades back) and didn't adjust for potential confounders [ ] . the association between covid- and bcg vaccine is postulated due to the non-specific effects (nse) inherent to the vaccine. however, these nse's may not last beyond - y [ ] . a recent study failed to show the protective effect of bcg over covid- [ ] . we acknowledge that these results are based on epidemiological data and have inherent biases, therefore, well-designed clinical trials are needed to test this hypothesis. existing epidemiological evidence didn't recommend using bcg against covid- in routine clinical practice. coronavirus disease (covid- ) situation reports. available at world health organization. bcg immunization coverage estimates by country. global health observatory data repository stop playing with data: there is no sound evidence that bacille calmette-guérin may avoid sars-cov- infection (for now) demystifying bcg vaccine and covid- relationship sars-cov- rates in bcg-vaccinated and unvaccinated young adults publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations conflict of interest none. key: cord- -sjcanw authors: leung, andrea s; tran, vanessa; wu, zuowei; yu, xuping; alexander, david c; gao, george fu; zhu, baoli; liu, jun title: novel genome polymorphisms in bcg vaccine strains and impact on efficacy date: - - journal: bmc genomics doi: . / - - - sha: doc_id: cord_uid: sjcanw bacille calmette-guérin (bcg) is an attenuated strain of mycobacterium bovis currently used as a vaccine against tuberculosis. global distribution and propagation of bcg has contributed to the in vitro evolution of the vaccine strain and is thought to partially account for the different outcomes of bcg vaccine trials. previous efforts by several molecular techniques effectively identified large sequence polymorphisms among bcg daughter strains, but lacked the resolution to identify smaller changes. in this study, we have used a nimblegen tiling array for whole genome comparison of bcg strains. using this approach, in tandem with dna resequencing, we have identified six novel large sequence polymorphisms including four deletions and two duplications in specific bcg strains. moreover, we have uncovered various polymorphisms in the phop-phor locus. importantly, these polymorphisms affect genes encoding established virulence factors including cell wall complex lipids, esx secretion systems, and the phop-phor two-component system. our study demonstrates that major virulence factors are different among bcg strains, which provide molecular mechanisms for important vaccine phenotypes including adverse effect profile, tuberculin reactivity and protective efficacy. these findings have important implications for the development of a new generation of vaccines. bacille calmette-guérin (bcg) is an attenuated strain of mycobacterium bovis and is the only available vaccine against tuberculosis (tb). since , bcg vaccination has been included in the world health organization (who) expanded program on immunization. it is estimated that more than billion individuals have been immunized with bcg and over million doses of bcg are administered annually. multiple studies have confirmed that bcg is generally safe and can protect children against disseminated disease, including tuberculosis meningitis [ , ] . bcg also provides cross-protection against leprosy [ ] . however, the success of bcg against pulmonary tb in adults is still debated, since randomized clini-cal trials have reported protection efficacy ranging from - % [ , ] . several hypotheses for the variation in observed efficacy have been proposed [ ] [ ] [ ] [ ] . one explanation concerns the heterogeneity of the bcg strains [ ] . the original bcg was derived from a virulent strain of m. bovis isolated from a cow. from through , this isolate was subjected to passages on glycerinated potato bile medium, which generated an attenuated strain termed bcg [ ] . distribution and widespread use of bcg started around and was accompanied by changes in the manufacturing process in production facilities. for instance, while bcg in sweden was transferred without interruption from bile potato to bile potato medium in accordance with calmette's original practice [ ] , bcg production in denmark involved alternating rounds of growth on potato bile medium and sauton broth until when it was grown exclusively in sauton medium [ ] . prior to the establishment of seed stocks in the s, bcg was passaged continuously, and the changes in media and transfer schedules contributed to the "in vitro evolution" of bcg [ ] . it is estimated that as many as production substrains have been used at one time or another in various parts of the world [ ] , including the four major bcg vaccines in current use (bcg-pasteur, -danish, -glaxo, and -japan) [ ] . the relative protective efficacy of bcg substrains is currently unknown [ , ] . anecdotal reports have long indicated that bcg substrains exhibit phenotypic differences in growth characteristics, biochemical activities, ability to protect against challenge with mycobacterium tuberculosis (m. tb), and residual virulence [ ] . over the past decade, numerous groups have sought to identify the genomic changes responsible for these phenotypes. the earliest whole genome comparisons confirmed that bcg was indeed related to, but distinct from m. tb and m. bovis [ ] [ ] [ ] . subsequent analyses of multiple vaccine strains have uncovered extensive genome diversity including both deletions and duplications in bcg substrains [ , [ ] [ ] [ ] . the phylogeny established by these molecular methods is consistent with the historical records of bcg dissemination [ , , ] . for example, bcg strains acquired after exhibit the rd deletion, while nrd is only deleted in strains obtained after . other genomic changes are exclusive to individual daughter strains, and are associated with vaccine production at specific locations [ , ] . a number of molecular techniques have been used to investigate genomic polymorphisms in bcg strains. early efforts using subtractive hybridization [ ] and spotted oligonucleotide arrays [ , , ] effectively identified large sequence polymorphisms, but lacked the resolution to identify smaller changes. more recently, complete genome sequencing has enabled high-resolution analysis of bcg-pasteur p [ ] , but sequences for other bcg lineages have yet to be determined. to identify potential genomic polymorphisms in other bcg substrains, we have employed a tiling array platform developed by nim-blegen systems. this dna microarray-based comparative genome sequencing technique allows high resolution detections of sequence polymorphisms [ ] [ ] [ ] . using this technique, in tandem with dna resequencing, we have identified a number of novel genomic polymorphisms in bcg strains. importantly, these polymorphisms affect genes that are known virulence factors and are expected to have a major impact on the immunogenicity and efficacy of individual vaccine strains. we have used nimblegen tiling arrays to analyze the genomic variability of bcg strains, including bcg-russia, -japan, -moreau, -sweden, -birkhaug, -china, -prague, -glaxo, -danish, -tice, -phipps, -frappier and -pasteur. all of these strains, except bcg-china, have previously been subjected to genomic analysis by other methods [ , , , , ] . the complete genome sequence of bcg-pasteur p is available [ ] . the same bcg-pasteur strain was included in the analysis to serve as an internal control for our experiments in addition to validating the nimblegen technique. in each experiment, genomic dna from m. tb h rv [ ] acted as the common referent. a total of deletions were identified. twenty-five of these have been described previously [ , , , , ] . thirteen more represent transposons (e.g., is ) present in the referent strain (m. tb h rv), but absent from the m. bovis and bcg lineages [ , , ] . six duplications were identified, four (du , du -i, -ii, -iii) of which have been described previously [ , ] . these results confirm the validity of our approach, and the utility of tiling arrays for comparative genomics. a total of novel deletions and duplications were identified in our analysis. these novel deletions and duplications are described below. two deletions specific to bcg-moreau were identified. the first is a bp deletion ( table ) that eliminates the distal end of fadd (rv /bcg ) and the start of ppsa (rv /bcg ). these genes are part of the genetic locus required for the biosynthesis of phthiocerol dimycocerosates (pdims) and phenolic glycolipids (pgls) [ ] , two cell wall lipids known to be important for the virulence of m. tb and m. bovis [ ] [ ] [ ] . in previous work, we demonstrated that bcg-moreau does not pro-duce pdims or pgls [ ] , which is now explained by the fadd -ppsa deletion identified in the current study. the second novel polymorphism in bcg-moreau is an bp deletion within rv c/bcg c (table ) . although intact in other bcg substrains, this region overlaps with a . -kb deletion (termed rdpan) found in some m. bovis strains [ ] , including the sequenced strain, af / [ ] . the rv c/bcg c gene encodes a membrane transport protein and is part of the esx- type vii secretion system [ ] . the role of the esx- system in virulence is unknown considering its variable presence among clinical m. bovis isolates from both france and england [ ] . however, loss of the rv c membrane transporter likely eliminates the secretion of esat- -and cfp- -like antigens [ ] and influences the immunogenicity of the vaccine strain. two novel deletions were identified in bcg-sweden and bcg-birkhaug. these polymorphisms are identical between the two bcg strains, which is consistent with their genealogy [ ] . the first deletion comprises bp and disrupts the promoter and translational start site of whib (rv /bcg ) [see additional file ]. the other is a bp deletion within trcr (rv c/ bcg c) ( table ). both genes encode transcriptional regulators known to impact virulence. whib belongs to a family of seven m. tb transcriptional regulatory proteins that contain iron-sulfur clusters and are predicted to regulate gene expression in response to environmental stimuli [ ] . whib responds to oxygen and nitric oxide, and is important for regulation of carbon metabolism [ ] . the deletion of whib in m. bovis attenuates in vivo growth in guinea pigs [ ] . trcr is the response regulator of the trcr-trcs two-component system. deletion of trcs from m. tb generates a hypervirulent phenotype such that the strain exhibits increased lethality in scid mice [ ] . although the genomic profiles of bcg-birkhaug and bcg-sweden are similar, we have also found that bcg-birkhaug is distinguished by a strain-specific duplication, named du-birkhaug. this spans the origin of replication and is analogous to the du duplication in bcg-pasteur [ , ] (fig. a) . however, the borders of the du-birkhaug are different. whereas du encompasses . kb from rv to pknb/rv , du-birkhaug spans a slightly different region, from trxb/rv to roda/ rv c. most of the genes in these regions are involved with dna replication and cell division. unlike du , du-birkhaug also appears to be in a genomic location distant to its original copy. initial pcr-based attempts to characterize the boundaries of this duplication assumed that the second copy was nearby failed to detect a product (data not shown). as such, the genome location of du-birkhaug remains unknown. our analysis also revealed a novel duplication in the genome of bcg-tice termed du-tice. it comprises a kb duplication that encompasses rv -rv (fig. b ). the precise boundaries and location of this duplication were determined using primers at the junction (fig. c) . interestingly, du-tice encodes the esx- secretion system [ , ] . this includes several conserved membrane transporters (rv , rv , rv , and rv ), a membrane associated atpase (rv ), a set of pe/ppe genes (rv -rv ) and the esat- and cfp- family proteins (esxm and esxn) [ ] . esx- is absent from the genome of the fast-growing, non-pathogenic m. smegmatis, but present in both the m. avium complex and m. marinum. the role of esx- in virulence has been demonstrated in m. marinum [ , ] . it has been suggested that the esx clusters evolved via gene duplication [ ] and du-tice offers the first snapshot of such an event. to our knowledge, we have conducted the first genomic analysis of bcg-china, which is a descendant of bcg-danish obtained from the statens serum institut around . consistently, bcg-china exhibits the du -iii duplication and deletion of rd (data not shown), which is similar to other bcg-danish derivatives, including bcg-prague (obtained in from passage ) [ ] , the coordinates correspond to the genome of m. tb h rv. the two deletions and du-tice were confirmed by pcr application and dna sequencing. novel duplications identified in bcg-birkhaug and bcg-tice by nimblegen tiling array figure novel duplications identified in bcg-birkhaug and bcg-tice by nimblegen tiling array. sections of the ratio plot are shown. the ratio of the reference (m. tb h rv) probe intensity (cy ) was divided by the test (bcg strain) probe intensity (cy ). reference probes and test probes that do not span a mutation should represent full-length perfect match hybridization, and thus should have similar intensities, with a reference/test ratio near . if the test genome contains an amplification event (increased copy number when compared to the reference), then the reference/test ratio will shift below . (a) novel duplication (du-birkhaug) identified in bcg-birkhaug, which is analogous to the du-pasteur (du ) but has different borders. the same genomic region of bcg-sweden, which is closely related to bcg-birkhaug, is shown for comparison. (b) novel duplication (du-tice) identified in bcg-tice. three other bcg strains belonging to the same group (du -iv) are shown for comparison. (c) the precise border of du-tice is mapped by pcr amplification using primers specific to the junction. the two copies are immediately adjacent to each other and overlap by bp. bcg-glaxo (obtained in , from passage ) and bcg-danish (lyophilized in , from passage ) [ ] . however, bcg-china and -prague do not contain the previously described deletion of rv , which is characteristic of bcg-glaxo and -danish. as such, the rv deletion must have occurred between and . coincidentally, this period corresponds to the replacement of potato bile medium by sauton medium for bcg production in denmark [ ] . the phop-phor system is one of the two-component systems found in the m. tb genome [ ] . the phor protein is a transmembrane histidine kinase that transmits signals from the environment by autophosphorylation. the phosphoryl group is then transferred to phop, a response regulator that regulates the expression of multiple genes [ ] . recently, several studies have demonstrated that the phop-phor system, particularly phop, plays an essential role in m. tb virulence [ , [ ] [ ] [ ] . a single point mutation (s l) in the dna binding region of phop partially accounts for the attenuation of the h ra strain of m. tb [ ] . furthermore, a phop mutant of m. tb was found to be more attenuated than bcg-pasteur in scid mice infections [ ] . our nimblegen analysis revealed some weak signals in the phop-phor region (not shown), which prompted us to resequence these genes. the dna fragment containing the promoter region of phop, the orfs of phop and phor, and the intergenic region was pcr amplified from each bcg strain and determined by dna sequencing. our sequence analysis revealed a number of polymorphisms in the phop-phor locus in various bcg strains compared to the genome sequence of m. bovis. the three early bcg substrains, bcg-russia, -japan, and -moreau, contain an identical is ( , bp) insertion at nucleotide of the m. tb genome, which is bp upstream of the start codon of phop (fig. ) . this is element is identical to many other copies of is found in various locations in the m. tb genome. it is flanked by a -bp direct repeat (gaa) on both sides and is in an inverse orientation of phop-phor (fig. ) . the presence of an is element in the promoter region of phop in bcg-russia, -japan, and -moreau has been described previously, but its insertion site and orientation were not determined until now [ ] . although not present in m. tb h rv or m. bovis af / , an is insertion in the phop promoter was found in a clinical strain of m. bovis termed b strain, which was responsible for a severe nosocomial outbreak of multidrug resistant tb in humans in spain [ , ] . however, unlike the three bcg strains, the is insertion in the m. bovis b strain is located at bp upstream of the start codon of phop and is in the same orientation as phop-phor [ ] . the potential effect of is is insertion in the phop promoter in bcg-russia, -moreau, and -japan on phop expression is described in the 'discussion' section. three other novel phop-phor polymorphisms that likely impact their functions were also uncovered by our sequencing analysis. an identical, -bp deletion within the orf of phor was uncovered in bcg-sweden and bcg-birkhaug (accggactggg, nucleotides from to , m. tb genome coordinates). this deletion changes the amino acid sequence of residues (residues to ) in the c-terminal of phor. this polymorphism is different than the previously described bp deletion within phor present in bcg-danish and bcg-glaxo, which affects residues - [ ] . bcg-frappier also contains a single nucleotide deletion (a at , m. tb genome coordinates), causing a frame-shift mutation that affect residues - of phor. together, these results indicate that besides bcg-danish and bcg-glaxo, bcg-sweden, -birkhaug, and -frappier also contain a defective phor gene. a single nucleotide insertion within the orf of phop was uncovered in bcg-prague (g, between nucleotides and , m. tb genome coordinates) [see additional file ]. this frame shift mutation changes the c-terminal sequence (residues - ) of phop, which is the dna binding domain (residues - ) [ ] [ ] [ ] . as such, bcg-prague is a natural phop mutant. single point mutations in phop or phor are also found in various bcg strains and are summarized in table . in contrast, sequences of the phop-phor locus of bcg-phipps, -tice, and -pasteur are identical to the published sequence of bcg-pasteur and m. bovis [ , ] . the loss of the rd -encoded esx- protein secretion system during - contributes to the attenuation of bcg ( [ ] , see also fig. ) . however, because reintroduction of esx- into bcg does not restore full virulence, other genetic lesions are also involved [ ] . as such, some strains are more virulent than others in animal models of infection [ ] and also exhibit differential ability to induce adverse reactions (reactogenicity) following vaccination in neonates [ ] . our current work begins to provide some explanation for these observed differences (fig. ) . consistent with a previous study [ ] , we find that the earliest distributed bcg strains, bcg-russia, -japan, and -moreau, all contain a second copy of is that is inserted in the promoter region of phop. a similar, albeit distinct, insertion of is in the phop promoter was also found in a virulent strain called m. bovis b strain [ ] . the presence of is , which is in the same orientation as phop, increases the expression of phop and (the resulting [ ] . bcg-danish and -glaxo contains a bp deletion within phor, which was described previously [ ] . nd: polymorphisms not detected. na: no affect. increase in virulence) was thought to be responsible for the outbreak of m. bovis b strain in humans [ ] . similarly, the expression level of phop was found to be higher in bcg-japan than in bcg-pasteur [ ] . however, in bcg-japan, -russia, and -moreau, the is is in the inverse orientation of phop (fig. ). as such, how is upregulates phop expression in bcg is not immediately apparent and likely involves a different mechanism. one possibility is the elimination of phop autoregulation. it was shown that phop protein, albeit from h ra, binds to three -bp direct repeats within the phop promoter sequence and represses its own expression [ ] . in bcg, is is inserted between the phop binding sites and the start codon of phop, which could impair the repression by phop and subsequently increase phop expression. alternatively, an unidentified promoter sequence within is in the same orientation of phop could drive the expression of phop. the presence of the second copy of is in these early bcg strains also suggests that the original bcg isolated in might have been derived from a highly virulent m. bovis strain containing the same is element. this is was subsequently lost in other bcg strains (fig. ) and is not present in most clinical strains of m. bovis and m. tb isolated in modern times [ , ] . given the important role of phop in m. tb virulence, higher expression of phop could explain why bcg-russia is generally considered more virulent than other bcg strains [ ] . however, in the other early strains, bcg-moreau and bcg-japan, the loss of lipid virulence factors pdims and pgls appears to have a more pronounced effect on virulence. consequently, these two strains, together with bcg-glaxo, which also lacks pdims and pgls, and as we have described previously, are more attenuated and less reactogenic than other bcg strains [ ] . the deletion of fadd -ppsa described here provides a genetic mechanism for the defective pdim/pgl biosynthesis in bcg-moreau. however, this region is intact in bcg-japan and bcg-glaxo, indicating that other mechanisms may also lead to the pdim/pgl defect. bcg-sweden was obtained from the institut pasteur in while konrad birkhaug acquired the strain that bears his name around [ ] . previous studies indicated that these strains differ from other early bcg strains (i.e., bcg-russia, -japan, -moreau) only by the loss of the is element described above. our current work reveals three novel deletions shared by bcg-sweden and bcg-birkhaug (fig. ) , which distinguish them from other early strains. two deletions affect the regulatory proteins whib and trcr, and have different impacts on virulence. the whib gene appears to be important for virulence. the m. bovis whib mutant is attenuated for growth in guinea pigs but not in mice [ ] . conversely, the trcrs two-component system has a negative impact on virulence. deletion of trcs from m. tb generates a hypervirulent phenotype in scid mice [ ] . bcg-sweden was used in sweden from until and was then replaced by bcg-danish because of the high frequency of osteitis associated with the former strain [ ] . the deletion of trcr may contribute to the reactogenicity of bcg-sweden. figure refined genealogy of bcg vaccines. the genealogy is modified from a previous model [ ] . genetic markers identified in this work are highlighted. the other deletion found in bcg-sweden and bcg-birkhaug affects the phor gene of the phop-phor two-component system. remarkably, three other late bcg strains, bcg-danish, -glaxo, and -frappier also contain a defective phor gene. together a total of five bcg strains are natural phor mutants. however, three distinct mutations are found among these five strains, which correspond to their genealogy (fig. ) . the role of phor in virulence is less understood than for phop. among its many functions, phop is required for the biosynthesis of trehalose-containing cell wall lipids [ , , ] . contrastingly, phor does not seem to be required for this function [ ] . nevertheless, the fact that the phor mutation has been acquired by different groups of bcg strains by three independent events and genetic mechanisms suggests that there was a common selective pressure and an important role for this gene during the in vitro evolution of bcg. another bcg strain that contains a major mutation in the phop-phor system is bcg-prague. a single nucleotide insertion in the orf of phop changes the c-terminal sequence, which contains the dna binding domain of phop [ ] [ ] [ ] . as such, bcg-prague is a natural phop mutant and likely to be more attenuated than other bcg strains. this is consistent with the study by lagranderie et al., which showed in mice models of infection that bcg-prague exhibited more attenuated phenotypes compared to three other bcg strains (bcg-russia, -pasteur, and -glaxo) [ ] . compared to other bcg strains, including bcg-russia, -moreau, -japan, -sweden, -danish, -glaxo, and -pasteur that have been analyzed in the current study, bcg-prague consistently exhibited the weakest ability to induce delayed type hypersensitivity to tuberculin in children [ ] or in guinea pig models [ ] . because of the traditional presumption that tuberculin reactivity is associated with vaccine potency, bcg-prague, which was used in czechoslovakia between - and appeared to be effective, was replaced by bcg-russia in [ ] . an immediate increase of bcg-induced osteitis cases was observed in czechoslovakia following the switch of bcg-prague to bcg-russia [ ] . the phop mutation detected in the current study may explain the weak tuberculin sensitivity induced by bcg-prague. it was recently shown that a phop mutant of m. tb was more attenuated than bcg-pasteur and confers an equivalent protection in mice against m. tb challenge. in the guinea pig model, the m. tb phop mutant showed superior protection to bcg-pasteur against a high dose challenge with m. tb [ ] . consequently, the m. tb phop mutant is now being evaluated as a vaccine candidate to replace bcg [ ] . since bcg-pasteur contains an intact phop gene, and in light of our finding, it would be worthy to compare the m. tb phop mutant with bcg-prague in terms of safety and protective efficacy. the novel duplication uncovered in bcg-tice (du-tice) may have an impact on its residual virulence and immunogenicity. du-tice contains the entire esx- secretion system, which is one of the five type vii secretion systems found in the m. tb complex [ ] . importantly, besides the rd -encoded esx- , esx- is the only other esx system that has been shown to be involved in virulence thus far [ ] . esx- is conserved in other pathogenic mycobacteria and reported to facilitate the cell-to-cell spread of m. marinum in infected macrophages, a function shared by esx- [ ] . however, esx- does not complement the loss of virulence caused by esx- deletion, suggesting that they play distinct roles in virulence [ ] . horwitz and co-workers have used bcg-tice as the host strain to overexpress antigen b. this resulted in a recombinant strain termed rbcg that exhibits superior protective efficacy over bcg-tice and is currently being evaluated as a vaccine candidate in human clinical trials [ ] [ ] [ ] [ ] [ ] . the rbcg tice strain also showed significantly stronger immune response and better protection against m. tb challenge than the rbcg strain based on bcg-connaught [ ] . the duplication of esx- in bcg-tice, which could increase the residual virulence and immunogenicity, may partially account for the benefit associated with rbcg tice. our current work has uncovered six large sequence polymorphisms not described previously, including two deletions exclusive to bcg-moreau, two deletions shared by bcg-sweden and bcg-birkhaug, as well as the du-birkhaug and du-tice duplications. moreover, we have uncovered a number of polymorphisms in the phop-phor locus in various bcg strains. remarkably, these polymorphisms affect genes that are well known to have major impact on the virulence of m. tb or m. bovis. these include genes involved in the biosynthesis of lipid virulence factors pdims/pgls, genes that encode the esx family type vii secretion system, and the phop-phor two-component regulatory system. [ ] . in addition, a mutant of m. bovis deficient in pdims/pgls is being considered as a vaccine to protect wildlife against bovine tuberculosis [ ] . our previous study [ ] and current work provide direct evidence that bcg vaccine strains are different in major virulence factors, and likely have different vaccination properties including safety, immunogenicity, and efficacy. since new vaccine candidates are evaluated for their vaccination properties relative to bcg, the appropriate choice of bcg strain for these studies is critical. furthermore, because it is likely that bcg will continue to play a role in tuberculosis control by being included in forthcoming clinical trials, as either a primer to be boosted by new components (e.g. subunit or dna vaccine) or as an integral component (e.g. recombinant bcg) of new vaccines, greater attention must be given to the benefits that a particular strain may -or may notoffer. the mycobacterial strains used in this study were: mutation mapping microarrays were designed with nim-blegen algorithms that select a -mer oligonucleotide every bases on each strand of the reference genome sequence (genbank accession al ) [ ] . all probes were synthesized in parallel on a four-array set using a digital light processor™ (texas instruments, plano texas) and photoprotected by phosphoramidite chemis-try (maskless array synthesis) (nimblegen systems, madison wi) in a random probe layout [ , ] . labeled genomic dna was hybridized to arrays in the nimblegen hybridization buffer at °c for hr using a maui hybridization system (biomicro systems, inc. salt lake city, utah). labeled genomic dna ( μg) from the reference strain m. tb h rv and from each bcg strain were co-hybridized to each array. arrays were washed with nimblegen wash buffer, and were then spun dry in a microarray high-speed centrifuge (telechem international, inc., sunnyvale, ca) and stored until scanned. microarrays were scanned at μm resolution using the genepix ® b scanner (axon instruments, union city ca), and pixel intensities were extracted using nimbles-can™ v . software (nimblegen). probes that spanned potential mutations were identified by nimblegen software. probe sequences corresponding to all possible candidate mutation sites were selected for resequencing. the strategy that was used to automatically generate the sequencing array is similar to that described previously [ ] . briefly, probes per base position were analyzed, per genome strand. these probes contain all possible alleles at a centrally located position. the length, melting temperature and mismatch position of each probe were optimized. when target dna is hybridized to these arrays the perfectly matched probe will hybridize more strongly than the three corresponding mismatched probes for each strand. the differential signal intensity between the perfectly matched probe and mismatched probes allows the base to be determined precisely. these resequencing arrays were synthesized, hybridized with labeled genomic dna from each bcg strain and scanned as above. sequence base assignments were made using a machinelearning algorithm [ ] . putative mutation-containing dna segments were pcr amplified and verified by capillary sequencing [see additional file ]. the microarray data has been deposited in the center for information biology gene expression database (cibex; http:// cibex.nig.ac.jp), with the accession number of cbx . asl, vt, zw, and xy performed the experiments and participated in data analysis. dca participated in data analysis and co-authored the manuscript. gfg oversaw the experiments. bz oversaw the experiments and participated in data analysis. jl oversaw the experiments, analyzed the data, and wrote the manuscript. the efficacy of bacillus calmette-guerin vaccination of newborns and infants in the prevention of tuberculosis: meta-analyses of the published literature effect of bcg vaccination on childhood tuberculous meningitis and miliary tuberculosis worldwide: a meta-analysis and assessment of cost-effectiveness protective effect of bacillus calmette guerin (bcg) vaccine in the prevention of leprosy: a meta-analysis preventing tuberculosis with bacillus calmette-guerin vaccine: a meta-analysis of the literature efficacy of bcg vaccine in the prevention of tuberculosis. meta-analysis of the published literature bcg-different strains, different vaccines? lancet infect dis failure of the mycobacterium bovis bcg vaccine: some species of environmental mycobacteria block multiplication of bcg and induction of protective immunity to tuberculosis field trials of tuberculosis vaccines: how could we have done them better? control clin trials differential effects of prior exposure to environmental mycobacteria on vaccination with mycobacterium bovis bcg or a recombinant bcg strain expressing rd antigens the 'experimental stable' of the bcg vaccine: safety, efficacy, proof, and standards the swedish strain of bcg changes in bcg strains report on a who consultation on the characterisation of bcg strains relationship between bacille calmette-guerin (bcg) strains and the efficacy of bcg vaccine in the prevention of tuberculosis effect of freeze-drying on the colony morphology of various daughter strains of bcg use of a mycobacterium tuberculosis h rv bacterial artificial chromosome library for genome mapping, sequencing, and comparative genomics molecular analysis of genetic differences between mycobacterium bovis bcg and virulent m. bovis physical mapping of mycobacterium bovis bcg pasteur reveals differences from the genome map of mycobacterium tuberculosis h rv and from m. bovis. microbiology comparative genomics of bcg vaccines by wholegenome dna microarray comparative genomics uncovers large tandem chromosomal duplications in mycobacterium bovis bcg pasteur the in vitro evolution of bcg vaccines a historical and molecular phylogeny of bcg strains genome plasticity of bcg and impact on vaccine efficacy detection of deleted genomic dna using a semiautomated computational analysis of genechip data control of m. tuberculosis esat- secretion and specific t cell recognition by phop identification of a nitroimidazo-oxazine-specific protein involved in pa- resistance in mycobacterium tuberculosis tracking the evolution of the sars coronavirus using high-throughput, high-density resequencing arrays deciphering the biology of mycobacterium tuberculosis from the complete genome sequence the complete genome sequence of mycobacterium bovis the dimycocerosate ester polyketide virulence factors of mycobacteria complex lipid determines tissue-specific replication of mycobacterium tuberculosis in mice transposon mutagenesis of mb at the ppe -nrp locus in mycobacterium bovis disrupts phthiocerol dimycocerosate (pdim) and glycosylphenol-pdim biosynthesis, producing an avirulent strain with vaccine properties at least equal to those of m. bovis bcg a glycolipid of hypervirulent tuberculosis strains that inhibits the innate immune response differential productions of lipid virulence factors among bcg vaccine strains and implications on bcg safety a novel polymorphic genetic locus in members of the mycobacterium tuberculosis complex type vii secretionmycobacteria show the way differential gene expression in response to exposure to antimycobacterial agents and other stress conditions among seven mycobacterium tuberculosis whib-like genes mycobacterium tuberculosis whib responds to o and nitric oxide via its [ fe- s] cluster and is essential for nutrient starvation survival mycobacterium tuberculosis whib interacts with rpov to affect host survival but is dispensable for in vivo growth deletion of two-component regulatory systems increases the virulence of mycobacterium tuberculosis bitter w: a specific secretion system mediates ppe transport in pathogenic mycobacteria evolution and expansion of the mycobacterium tuberculosis pe and ppe multigene families and their association with the duplication of the esat- (esx) gene cluster regions some biological, biochemical and morphological changes and their correlations in selected bcg vaccine strains development of the mycobacterium bovis bcg vaccine: review of the historical and biochemical evidence for a genealogical tree mutation in the transcriptional regulator phop contributes to avirulence of mycobacterium tuberculosis h ra strain the live mycobacterium tuberculosis phop mutant strain is more attenuated than bcg and confers protective immunity against tuberculosis in mice and guinea pigs the mycobacterium tuberculosis phopr two-component system regulates genes essential for virulence and complex lipid biosynthesis use of gene probes based on the insertion sequence is to differentiate between bcg vaccine strains is mediates increased transcription of the phop virulence gene in a multidrug-resistant clinical isolate responsible for tuberculosis outbreaks high rate of tuberculosis reinfection during a nosocomial outbreak of multidrug-resistant tuberculosis caused by mycobacterium bovis strain b transcriptional autoregulation by mycobacterium tuberculosis phop involves recognition of novel direct repeat sequences in the regulatory region of the promoter phop-phop interaction at adjacent phop binding sites is influenced by protein phosphorylation structure of the dna-binding domain of the response regulator phop from mycobacterium tuberculosis mycobacterial virulence and specialized secretion: same story, different ending recombinant bcg exporting esat- confers enhanced protection against tuberculosis comparison of immune responses of mice immunized with five different mycobacterium bovis bcg vaccine strains quality control of bcg vaccine by who: a review of factors that may influence vaccine effectiveness and safety mapping of is insertion sites in mycobacterium bovis isolates in relation to adaptation from the animal to human host bcg complications. estimates of the risks among vaccinated subjects and statistical analysis of their main characteristics a point mutation in the two-component regulator phop-phor accounts for the absence of polyketide-derived acyltrehaloses but not that of phthiocerol dimycocerosates in mycobacterium tuberculosis h ra the virulence-associated two-component phop-phor system controls the biosynthesis of polyketide-derived lipids in mycobacterium tuberculosis tuberculin sensitivity and skin lesions in children after vaccination with different bcg strains tuberculin sensitivity in guinea-pigs after vaccination with varying doses of bcg of different strains second iuatld study on complications induced by intradermal bcg-vaccination live tuberculosis vaccines based on phop mutants: a step towards clinical trials protective immunity against tuberculosis induced by vaccination with major extracellular proteins of mycobacterium tuberculosis recombinant bacillus calmette-guerin (bcg) vaccines expressing the mycobacterium tuberculosis -kda major secretory protein induce greater protective immunity against tuberculosis than conventional bcg vaccines in a highly susceptible animal model a new vaccine against tuberculosis affords greater survival after challenge than the current vaccine in the guinea pig model of pulmonary tuberculosis enhancing the protective efficacy of mycobacterium bovis bcg vaccination against tuberculosis by boosting with the mycobacterium tuberculosis major secretory protein maslesa-galic s: a novel live recombinant mycobacterial vaccine against bovine tuberculosis more potent than bcg advances in tuberculosis vaccine strategies a new attenuated mycobacterium bovis vaccine protects brushtail possums (trichosurus vulpecula) against experimental tuberculosis infection gene expression analysis using oligonucleotide arrays produced by maskless photolithography light-directed '--> ' synthesis of complex oligonucleotide microarrays a self-tuning method for one-chip snp identification this work was supported by an award from the national natural science foundation of china (nsfc) (to jl), and research grants from canadian institutes of health research (cihr) (mop- and mop- to jl), and a grant (z ) from beijing municipal science and technology commission to (bz). key: cord- - uhabgsr authors: weng, c-h.; saal, a.; butt, w. w-w.; bica, n.; fisher, j. q.; tao, j.; chan, p. a. title: bacillus calmette–guérin vaccination and clinical characteristics and outcomes of covid- in rhode island, united states: a cohort study date: - - journal: epidemiol infect doi: . /s sha: doc_id: cord_uid: uhabgsr coronavirus disease (covid- ) has resulted in a global pandemic, and there is limited data on effective therapies. bacillus calmette–guérin (bcg) vaccine, a live-attenuated strain derived from an isolate of mycobacterium bovis and originally designed to prevent tuberculosis, has shown some efficacy against infection with unrelated pathogens. in this study, we reviewed consecutive adult patients (≥ years old) with covid- at a major federally qualified health centre in rhode island, united states from march to april . median age was . years (interquartile range, . – . ), % were male and . % were latino/hispanics. eighty-two ( . %) patients had bcg vaccination. individuals with bcg vaccination were less likely to require hospital admission during the disease course ( . % vs. . %, p = . ). this association remained unchanged after adjusting for demographics and comorbidities (p = . ) using multivariate regression analysis. the finding from our study suggests the potential of bcg in preventing more severe covid- . severe acute respiratory syndrome coronavirus (sars-cov- ) is the cause of coronavirus disease (covid- ) and has resulted in a global pandemic. there is limited data on effective therapies. the bacillus calmette-guérin (bcg) vaccine, a live-attenuated strain derived from an isolate of mycobacterium bovis and originally designed to prevent tuberculosis, has shown some efficacy against infection with unrelated pathogens [ ] . a recent study suggested deaths due to covid- were significantly lower in bcg-vaccinated countries when compared with bcg-non-vaccinated countries [ ] . it is important for future prevention efforts to investigate this potential effect to see if bcg vaccine confers protection against more severe covid- . to determine if bcg vaccination provided protection from covid- , we reviewed a predominately latino/hispanic population receiving care at the major federally qualified health centre (fqhc) in providence, rhode island, united states. ninety per cent of households in this fqhc were under the % federal poverty level (fpl) and resided in providence. between march and april , data on ( . %) out of consecutive adult patients (≥ years old) who were sars-cov- positive were available and patients were reviewed through days. we characterised patients by demographics, immunisation status, symptoms during disease course, hospitalisation and comorbid disease. the above information was self-reported and through medical record review. bcg vaccination status was determined by review of clinical charts. all the patients with mild symptoms were advised to isolate at home. patients experiencing severe symptoms were referred to the hospitals in the same geographic areas by our triage team and clinicians using standard protocols. the clinicians in the emergency rooms were unaware of the patients' bcg status. patients were admitted if they showed significant hypoxia which may have required more aggressive oxygen support or if they presented with signs of haemodynamic instability. we report numbers (percentages) for binary/categorical variables and medians (interquartile ranges, iqr) for continuous variables. χ tests and wilcoxon rank-sum tests were applied to compare the statistical significances. a multivariate regression model adjusting age, sex, ethnicity, cigarette smoking history and comorbidities was applied to examine the outcome. all analyses were run using stata . (statacorp, college station, tx, usa). the providence community health centers review committee approved the project. among the patients, ( . %) had bcg vaccination. median age was . years (iqr, . - . ). the bcg-vaccinated population was on average years older than the non-bcg-vaccinated population (median age . vs. . years, respectively, p = . ). thirty per cent were male and . % were latino/hispanics (table ). compared to those without bcg vaccination, patients with bcg vaccination were more likely to experience myalgia during the disease course ( . % vs. . %, p = . ). there were no significant differences between the two groups in experiencing cough ( . %), shortness of breath ( . %), nasal congestion/rhinorrhoea ( . %), fever ( . %), headache ( . %), sore throat ( . %), vomiting/diarrhoea ( . %) or loss of smell/taste ( . %). compared to a large case series from china [ ] , our overall patient population experienced symptoms at a percentage similar to a recent study from washington state, united states [ ] , with more patients experiencing myalgia, headache and loss of smell/taste. the difference could reflect geographic variation or differential reporting. covid- patients with bcg vaccination were less likely to be hospitalised during the disease course ( . % vs. . %, p = . ). this association remained unchanged after adjusting for demographics and comorbidities (p = . ) using multivariate regression analysis. one patient without bcg vaccination died. the comorbidities between the two groups showed no significant differences in chronic diseases including hypertension ( . %), diabetes ( . %), chronic kidney disease ( . %) and being immunocompromised ( . %). a higher percentage of patients without bcg had a history of chronic obstructive pulmonary disease (copd)/asthma, however, a recent study found the history of copd was not associated with the risk of hospitalisation among covid- patients [ ] . among those who were hospitalised, none had a history of cigarette smoking and there was no significant difference between the two groups in copd/asthma (p = . ). comparing the comorbidities among the hospitalised patients between the non-bcg-and bcg-vaccinated patients, no statistical differences were found in hypertension ( . % vs. % respectively, p = . ), diabetes ( . % vs. . %, p = . ), copd/asthma ( . % vs. , p = . ), morbid obesity ( . % vs. . %, p = . ), chronic kidney disease ( . % vs. , p = . ), none of the hospitalised patients had histories of liver cirrhosis or were immunocompromised. in this study, patients with bcg vaccination were more likely to experience myalgia and less likely to require hospital admission. myalgias may be related to the release of inflammatory mediators, such as interleukins (ils) [ ] . bcg is known to elicit non-specific immune effects through the induction of the innate immune responses and the enhanced production of il- β [ ] . this may present as myalgias and help the body fight the infection. recent ecological studies comparing countries with and without universal bcg vaccination policies found that bcg vaccination appears to significantly reduce mortality associated with covid- [ ] and mandatory bcg vaccination was associated with a flattening of the curve in the spread of covid- [ ] . these studies suggest a long-lasting protection conferred by childhood bcg vaccination against covid- . this duration of protection may persist for several years, as one study examining bcg vaccine protection against tuberculosis found a − -year duration of protection [ ] . a recent population-based study examining the cohort of israeli adults aged − years found that the bcg vaccine may not reduce the likelihood of acquiring sars-cov- (difference, . %; % ci − . % to . %; p = . ) [ ] . however, the lower hospitalisation rate among bcg-vaccinated patients from our prospective cohort study suggests the potential of bcg in preventing more severe covid- among those who acquired sars-cov- . limitations to this study included a small sample size, short study time frame, unknown bcg strain each patient received, unknown bcg booster status, a preponderance of female patients, and a predominately latino/hispanic population. future studies are needed to explore the efficacy of bcg vaccination in preventing covid- disease progression. concept and design: weng, saal, chan. acquisition, analysis, or interpretation of data: all authors. drafting of the manuscript: weng, chan. critical revision of the manuscript for important intellectual content: weng, butt, chan administrative, technical, or material support: weng, saal. supervision: weng, chan. financial support. this research received no specific grant from any funding agency non-specific effects of bcg vaccine on viral infections is bcg vaccination effecting the spread and severity of covid- ? allergy clinical characteristics of coronavirus disease in china symptom screening at illness onset of health care personnel with sars-cov- infection in king county factors associated with hospital admission and critical illness among people with coronavirus disease in new york city: prospective cohort study immune system involvement in specific pain conditions correlation between universal bcg vaccination policy and reduced morbidity and mortality for covid- : an epidemiological study mandated bacillus calmette-guérin (bcg) vaccination predicts flattened curves for the spread of covid- long-term efficacy of bcg vaccine in american indians and alaska natives: a -year follow-up study sars-cov- rates in bcg-vaccinated and unvaccinated young adults acknowledgements. special thanks to ms. diane chaca for coordinating patient care.author contributions. ethical standards. the study was approved by the providence community health centers review committee. the authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national and institutional committees on human experimentation and with the helsinki declaration of , as revised in .data availability statement. the data that support the findings of this study are available on request from the corresponding author, c-h w. the data are not publicly available due to their containing information that could compromise the privacy of research participants.