id	sid	tid	token	lemma	pos
cord-002369-shk4n8f6	1	1	key	key	JJ
cord-002369-shk4n8f6	1	2	:	:	:
cord-002369-shk4n8f6	1	3	cord-002369-shk4n8f6	cord-002369-shk4n8f6	JJ
cord-002369-shk4n8f6	1	4	authors	author	NNS
cord-002369-shk4n8f6	1	5	:	:	:
cord-002369-shk4n8f6	1	6	Fahmy	Fahmy	NNP
cord-002369-shk4n8f6	1	7	,	,	,
cord-002369-shk4n8f6	1	8	Ahmed	Ahmed	NNP
cord-002369-shk4n8f6	1	9	M.	M.	NNP
cord-002369-shk4n8f6	1	10	;	;	:
cord-002369-shk4n8f6	1	11	Labonté	Labonté	NNP
cord-002369-shk4n8f6	1	12	,	,	,
cord-002369-shk4n8f6	1	13	Patrick	Patrick	NNP
cord-002369-shk4n8f6	2	1	title	title	NN
cord-002369-shk4n8f6	2	2	:	:	:
cord-002369-shk4n8f6	3	1	The	the	DT
cord-002369-shk4n8f6	3	2	autophagy	autophagy	NN
cord-002369-shk4n8f6	3	3	elongation	elongation	NN
cord-002369-shk4n8f6	3	4	complex	complex	NN
cord-002369-shk4n8f6	3	5	(	(	-LRB-
cord-002369-shk4n8f6	3	6	ATG5	ATG5	NNP
cord-002369-shk4n8f6	3	7	-	-	HYPH
cord-002369-shk4n8f6	3	8	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	3	9	)	)	-RRB-
cord-002369-shk4n8f6	3	10	positively	positively	RB
cord-002369-shk4n8f6	3	11	regulates	regulate	VBZ
cord-002369-shk4n8f6	3	12	HCV	HCV	NNP
cord-002369-shk4n8f6	3	13	replication	replication	NN
cord-002369-shk4n8f6	3	14	and	and	CC
cord-002369-shk4n8f6	3	15	is	be	VBZ
cord-002369-shk4n8f6	3	16	required	require	VBN
cord-002369-shk4n8f6	3	17	for	for	IN
cord-002369-shk4n8f6	3	18	wild	wild	JJ
cord-002369-shk4n8f6	3	19	-	-	HYPH
cord-002369-shk4n8f6	3	20	type	type	NN
cord-002369-shk4n8f6	3	21	membranous	membranous	JJ
cord-002369-shk4n8f6	3	22	web	web	NN
cord-002369-shk4n8f6	3	23	formation	formation	NN
cord-002369-shk4n8f6	3	24	date	date	NN
cord-002369-shk4n8f6	3	25	:	:	:
cord-002369-shk4n8f6	3	26	2017	2017	CD
cord-002369-shk4n8f6	3	27	-	-	HYPH
cord-002369-shk4n8f6	3	28	01	01	CD
cord-002369-shk4n8f6	3	29	-	-	HYPH
cord-002369-shk4n8f6	3	30	09	09	CD
cord-002369-shk4n8f6	3	31	journal	journal	NN
cord-002369-shk4n8f6	3	32	:	:	:
cord-002369-shk4n8f6	4	1	Sci	Sci	NNP
cord-002369-shk4n8f6	4	2	Rep	Rep	NNP
cord-002369-shk4n8f6	4	3	DOI	DOI	NNP
cord-002369-shk4n8f6	4	4	:	:	:
cord-002369-shk4n8f6	5	1	10.1038	10.1038	CD
cord-002369-shk4n8f6	5	2	/	/	SYM
cord-002369-shk4n8f6	5	3	srep40351	srep40351	CD
cord-002369-shk4n8f6	5	4	sha	sha	NNP
cord-002369-shk4n8f6	5	5	:	:	:
cord-002369-shk4n8f6	5	6	f7f482ba4aaa3ef0d620d9aad8c9635f88806d8e	f7f482ba4aaa3ef0d620d9aad8c9635f88806d8e	NNPS
cord-002369-shk4n8f6	5	7	doc_id	doc_id	CD
cord-002369-shk4n8f6	5	8	:	:	:
cord-002369-shk4n8f6	5	9	2369	2369	CD
cord-002369-shk4n8f6	5	10	cord_uid	cord_uid	NNS
cord-002369-shk4n8f6	5	11	:	:	:
cord-002369-shk4n8f6	6	1	shk4n8f6	shk4n8f6	JJ
cord-002369-shk4n8f6	6	2	Hepatitis	Hepatitis	NNP
cord-002369-shk4n8f6	6	3	C	C	NNP
cord-002369-shk4n8f6	6	4	virus	virus	NN
cord-002369-shk4n8f6	6	5	(	(	-LRB-
cord-002369-shk4n8f6	6	6	HCV	HCV	NNP
cord-002369-shk4n8f6	6	7	)	)	-RRB-
cord-002369-shk4n8f6	6	8	infection	infection	NN
cord-002369-shk4n8f6	6	9	induces	induce	VBZ
cord-002369-shk4n8f6	6	10	intracellular	intracellular	JJ
cord-002369-shk4n8f6	6	11	membrane	membrane	NN
cord-002369-shk4n8f6	6	12	rearrangements	rearrangement	NNS
cord-002369-shk4n8f6	6	13	,	,	,
cord-002369-shk4n8f6	6	14	thus	thus	RB
cord-002369-shk4n8f6	6	15	forming	form	VBG
cord-002369-shk4n8f6	6	16	a	a	DT
cord-002369-shk4n8f6	6	17	membranous	membranous	JJ
cord-002369-shk4n8f6	6	18	web	web	NN
cord-002369-shk4n8f6	6	19	(	(	-LRB-
cord-002369-shk4n8f6	6	20	MW	MW	NNP
cord-002369-shk4n8f6	6	21	)	)	-RRB-
cord-002369-shk4n8f6	6	22	in	in	IN
cord-002369-shk4n8f6	6	23	which	which	WDT
cord-002369-shk4n8f6	6	24	HCV	HCV	NNP
cord-002369-shk4n8f6	6	25	replication	replication	NN
cord-002369-shk4n8f6	6	26	and	and	CC
cord-002369-shk4n8f6	6	27	assembly	assembly	NN
cord-002369-shk4n8f6	6	28	occur	occur	VBP
cord-002369-shk4n8f6	6	29	.	.	.
cord-002369-shk4n8f6	7	1	The	the	DT
cord-002369-shk4n8f6	7	2	HCV	HCV	NNP
cord-002369-shk4n8f6	7	3	-	-	HYPH
cord-002369-shk4n8f6	7	4	induced	induce	VBN
cord-002369-shk4n8f6	7	5	MW	MW	NNP
cord-002369-shk4n8f6	7	6	is	be	VBZ
cord-002369-shk4n8f6	7	7	primarily	primarily	RB
cord-002369-shk4n8f6	7	8	composed	compose	VBN
cord-002369-shk4n8f6	7	9	of	of	IN
cord-002369-shk4n8f6	7	10	double	double	JJ
cord-002369-shk4n8f6	7	11	membrane	membrane	NN
cord-002369-shk4n8f6	7	12	vesicles	vesicle	NNS
cord-002369-shk4n8f6	7	13	(	(	-LRB-
cord-002369-shk4n8f6	7	14	DMVs	dmv	NNS
cord-002369-shk4n8f6	7	15	)	)	-RRB-
cord-002369-shk4n8f6	7	16	transfused	transfuse	VBN
cord-002369-shk4n8f6	7	17	by	by	IN
cord-002369-shk4n8f6	7	18	multi	multi	JJ
cord-002369-shk4n8f6	7	19	-	-	JJ
cord-002369-shk4n8f6	7	20	membrane	membrane	JJ
cord-002369-shk4n8f6	7	21	vesicles	vesicle	NNS
cord-002369-shk4n8f6	7	22	.	.	.
cord-002369-shk4n8f6	8	1	The	the	DT
cord-002369-shk4n8f6	8	2	autophagy	autophagy	NN
cord-002369-shk4n8f6	8	3	machinery	machinery	NN
cord-002369-shk4n8f6	8	4	has	have	VBZ
cord-002369-shk4n8f6	8	5	been	be	VBN
cord-002369-shk4n8f6	8	6	proposed	propose	VBN
cord-002369-shk4n8f6	8	7	to	to	TO
cord-002369-shk4n8f6	8	8	participate	participate	VB
cord-002369-shk4n8f6	8	9	in	in	IN
cord-002369-shk4n8f6	8	10	the	the	DT
cord-002369-shk4n8f6	8	11	formation	formation	NN
cord-002369-shk4n8f6	8	12	of	of	IN
cord-002369-shk4n8f6	8	13	such	such	JJ
cord-002369-shk4n8f6	8	14	vesicles	vesicle	NNS
cord-002369-shk4n8f6	8	15	.	.	.
cord-002369-shk4n8f6	9	1	However	however	RB
cord-002369-shk4n8f6	9	2	,	,	,
cord-002369-shk4n8f6	9	3	no	no	DT
cord-002369-shk4n8f6	9	4	clear	clear	JJ
cord-002369-shk4n8f6	9	5	evidence	evidence	NN
cord-002369-shk4n8f6	9	6	has	have	VBZ
cord-002369-shk4n8f6	9	7	been	be	VBN
cord-002369-shk4n8f6	9	8	found	find	VBN
cord-002369-shk4n8f6	9	9	linking	link	VBG
cord-002369-shk4n8f6	9	10	autophagy	autophagy	NN
cord-002369-shk4n8f6	9	11	to	to	IN
cord-002369-shk4n8f6	9	12	the	the	DT
cord-002369-shk4n8f6	9	13	formation	formation	NN
cord-002369-shk4n8f6	9	14	of	of	IN
cord-002369-shk4n8f6	9	15	these	these	DT
cord-002369-shk4n8f6	9	16	DMVs	dmv	NNS
cord-002369-shk4n8f6	9	17	.	.	.
cord-002369-shk4n8f6	10	1	In	in	IN
cord-002369-shk4n8f6	10	2	this	this	DT
cord-002369-shk4n8f6	10	3	study	study	NN
cord-002369-shk4n8f6	10	4	,	,	,
cord-002369-shk4n8f6	10	5	we	-PRON-	PRP
cord-002369-shk4n8f6	10	6	evaluated	evaluate	VBD
cord-002369-shk4n8f6	10	7	the	the	DT
cord-002369-shk4n8f6	10	8	role	role	NN
cord-002369-shk4n8f6	10	9	of	of	IN
cord-002369-shk4n8f6	10	10	the	the	DT
cord-002369-shk4n8f6	10	11	autophagy	autophagy	NN
cord-002369-shk4n8f6	10	12	elongation	elongation	NN
cord-002369-shk4n8f6	10	13	complex	complex	NN
cord-002369-shk4n8f6	10	14	(	(	-LRB-
cord-002369-shk4n8f6	10	15	ATG5	ATG5	NNP
cord-002369-shk4n8f6	10	16	-	-	HYPH
cord-002369-shk4n8f6	10	17	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	10	18	)	)	-RRB-
cord-002369-shk4n8f6	10	19	in	in	IN
cord-002369-shk4n8f6	10	20	HCV	HCV	NNP
cord-002369-shk4n8f6	10	21	replication	replication	NN
cord-002369-shk4n8f6	10	22	and	and	CC
cord-002369-shk4n8f6	10	23	MW	MW	NNP
cord-002369-shk4n8f6	10	24	formation	formation	NN
cord-002369-shk4n8f6	10	25	.	.	.
cord-002369-shk4n8f6	11	1	Using	use	VBG
cord-002369-shk4n8f6	11	2	a	a	DT
cord-002369-shk4n8f6	11	3	dominant	dominant	JJ
cord-002369-shk4n8f6	11	4	negative	negative	JJ
cord-002369-shk4n8f6	11	5	form	form	NN
cord-002369-shk4n8f6	11	6	of	of	IN
cord-002369-shk4n8f6	11	7	ATG12	ATG12	NNP
cord-002369-shk4n8f6	11	8	and	and	CC
cord-002369-shk4n8f6	11	9	an	an	DT
cord-002369-shk4n8f6	11	10	siRNA	siRNA	NNP
cord-002369-shk4n8f6	11	11	approach	approach	NN
cord-002369-shk4n8f6	11	12	,	,	,
cord-002369-shk4n8f6	11	13	we	-PRON-	PRP
cord-002369-shk4n8f6	11	14	demonstrated	demonstrate	VBD
cord-002369-shk4n8f6	11	15	that	that	IN
cord-002369-shk4n8f6	11	16	the	the	DT
cord-002369-shk4n8f6	11	17	ATG5	ATG5	NNP
cord-002369-shk4n8f6	11	18	-	-	HYPH
cord-002369-shk4n8f6	11	19	12	12	CD
cord-002369-shk4n8f6	11	20	conjugate	conjugate	NN
cord-002369-shk4n8f6	11	21	,	,	,
cord-002369-shk4n8f6	11	22	but	but	CC
cord-002369-shk4n8f6	11	23	not	not	RB
cord-002369-shk4n8f6	11	24	LC3-II	lc3-ii	NN
cord-002369-shk4n8f6	11	25	formation	formation	NN
cord-002369-shk4n8f6	11	26	,	,	,
cord-002369-shk4n8f6	11	27	is	be	VBZ
cord-002369-shk4n8f6	11	28	crucial	crucial	JJ
cord-002369-shk4n8f6	11	29	for	for	IN
cord-002369-shk4n8f6	11	30	efficient	efficient	JJ
cord-002369-shk4n8f6	11	31	viral	viral	JJ
cord-002369-shk4n8f6	11	32	replication	replication	NN
cord-002369-shk4n8f6	11	33	.	.	.
cord-002369-shk4n8f6	12	1	Furthermore	furthermore	RB
cord-002369-shk4n8f6	12	2	,	,	,
cord-002369-shk4n8f6	12	3	purification	purification	NN
cord-002369-shk4n8f6	12	4	of	of	IN
cord-002369-shk4n8f6	12	5	HCV	HCV	NNP
cord-002369-shk4n8f6	12	6	MW	MW	NNP
cord-002369-shk4n8f6	12	7	revealed	reveal	VBD
cord-002369-shk4n8f6	12	8	the	the	DT
cord-002369-shk4n8f6	12	9	presence	presence	NN
cord-002369-shk4n8f6	12	10	of	of	IN
cord-002369-shk4n8f6	12	11	ATG5	ATG5	NNP
cord-002369-shk4n8f6	12	12	-	-	HYPH
cord-002369-shk4n8f6	12	13	12	12	CD
cord-002369-shk4n8f6	12	14	and	and	CC
cord-002369-shk4n8f6	12	15	ATG16L1	ATG16L1	NNS
cord-002369-shk4n8f6	12	16	along	along	IN
cord-002369-shk4n8f6	12	17	with	with	IN
cord-002369-shk4n8f6	12	18	HCV	HCV	NNP
cord-002369-shk4n8f6	12	19	nonstructural	nonstructural	JJ
cord-002369-shk4n8f6	12	20	proteins	protein	NNS
cord-002369-shk4n8f6	12	21	.	.	.
cord-002369-shk4n8f6	13	1	Interestingly	interestingly	RB
cord-002369-shk4n8f6	13	2	,	,	,
cord-002369-shk4n8f6	13	3	LC3	LC3	NNP
cord-002369-shk4n8f6	13	4	was	be	VBD
cord-002369-shk4n8f6	13	5	not	not	RB
cord-002369-shk4n8f6	13	6	recruited	recruit	VBN
cord-002369-shk4n8f6	13	7	along	along	IN
cord-002369-shk4n8f6	13	8	with	with	IN
cord-002369-shk4n8f6	13	9	the	the	DT
cord-002369-shk4n8f6	13	10	elongation	elongation	NN
cord-002369-shk4n8f6	13	11	complex	complex	JJ
cord-002369-shk4n8f6	13	12	to	to	IN
cord-002369-shk4n8f6	13	13	the	the	DT
cord-002369-shk4n8f6	13	14	site	site	NN
cord-002369-shk4n8f6	13	15	of	of	IN
cord-002369-shk4n8f6	13	16	viral	viral	JJ
cord-002369-shk4n8f6	13	17	replication	replication	NN
cord-002369-shk4n8f6	13	18	.	.	.
cord-002369-shk4n8f6	14	1	Finally	finally	RB
cord-002369-shk4n8f6	14	2	,	,	,
cord-002369-shk4n8f6	14	3	inhibition	inhibition	NN
cord-002369-shk4n8f6	14	4	of	of	IN
cord-002369-shk4n8f6	14	5	the	the	DT
cord-002369-shk4n8f6	14	6	elongation	elongation	NN
cord-002369-shk4n8f6	14	7	complex	complex	NN
cord-002369-shk4n8f6	14	8	,	,	,
cord-002369-shk4n8f6	14	9	but	but	CC
cord-002369-shk4n8f6	14	10	not	not	RB
cord-002369-shk4n8f6	14	11	LC3	lc3	JJ
cord-002369-shk4n8f6	14	12	,	,	,
cord-002369-shk4n8f6	14	13	greatly	greatly	RB
cord-002369-shk4n8f6	14	14	impaired	impair	VBD
cord-002369-shk4n8f6	14	15	the	the	DT
cord-002369-shk4n8f6	14	16	formation	formation	NN
cord-002369-shk4n8f6	14	17	of	of	IN
cord-002369-shk4n8f6	14	18	the	the	DT
cord-002369-shk4n8f6	14	19	wild	wild	JJ
cord-002369-shk4n8f6	14	20	-	-	HYPH
cord-002369-shk4n8f6	14	21	type	type	NN
cord-002369-shk4n8f6	14	22	MW	mw	NN
cord-002369-shk4n8f6	14	23	phenotype	phenotype	NN
cord-002369-shk4n8f6	14	24	.	.	.
cord-002369-shk4n8f6	15	1	To	to	IN
cord-002369-shk4n8f6	15	2	our	-PRON-	PRP$
cord-002369-shk4n8f6	15	3	knowledge	knowledge	NN
cord-002369-shk4n8f6	15	4	,	,	,
cord-002369-shk4n8f6	15	5	this	this	DT
cord-002369-shk4n8f6	15	6	study	study	NN
cord-002369-shk4n8f6	15	7	provides	provide	VBZ
cord-002369-shk4n8f6	15	8	the	the	DT
cord-002369-shk4n8f6	15	9	first	first	JJ
cord-002369-shk4n8f6	15	10	evidence	evidence	NN
cord-002369-shk4n8f6	15	11	of	of	IN
cord-002369-shk4n8f6	15	12	the	the	DT
cord-002369-shk4n8f6	15	13	involvement	involvement	NN
cord-002369-shk4n8f6	15	14	of	of	IN
cord-002369-shk4n8f6	15	15	autophagy	autophagy	NN
cord-002369-shk4n8f6	15	16	proteins	protein	NNS
cord-002369-shk4n8f6	15	17	in	in	IN
cord-002369-shk4n8f6	15	18	the	the	DT
cord-002369-shk4n8f6	15	19	formation	formation	NN
cord-002369-shk4n8f6	15	20	of	of	IN
cord-002369-shk4n8f6	15	21	wild	wild	JJ
cord-002369-shk4n8f6	15	22	-	-	HYPH
cord-002369-shk4n8f6	15	23	type	type	NN
cord-002369-shk4n8f6	15	24	MWs	mw	NNS
cord-002369-shk4n8f6	15	25	.	.	.
cord-002369-shk4n8f6	16	1	Hepatitis	Hepatitis	NNP
cord-002369-shk4n8f6	16	2	C	C	NNP
cord-002369-shk4n8f6	16	3	virus	virus	NN
cord-002369-shk4n8f6	16	4	(	(	-LRB-
cord-002369-shk4n8f6	16	5	HCV	HCV	NNP
cord-002369-shk4n8f6	16	6	)	)	-RRB-
cord-002369-shk4n8f6	16	7	infection	infection	NN
cord-002369-shk4n8f6	16	8	is	be	VBZ
cord-002369-shk4n8f6	16	9	a	a	DT
cord-002369-shk4n8f6	16	10	leading	leading	JJ
cord-002369-shk4n8f6	16	11	cause	cause	NN
cord-002369-shk4n8f6	16	12	of	of	IN
cord-002369-shk4n8f6	16	13	liver	liver	NN
cord-002369-shk4n8f6	16	14	diseases	disease	NNS
cord-002369-shk4n8f6	16	15	,	,	,
cord-002369-shk4n8f6	16	16	including	include	VBG
cord-002369-shk4n8f6	16	17	cirrhosis	cirrhosis	NN
cord-002369-shk4n8f6	16	18	and	and	CC
cord-002369-shk4n8f6	16	19	hepatocellular	hepatocellular	JJ
cord-002369-shk4n8f6	16	20	carcinoma	carcinoma	NN
cord-002369-shk4n8f6	16	21	.	.	.
cord-002369-shk4n8f6	17	1	HCV	HCV	NNP
cord-002369-shk4n8f6	17	2	,	,	,
cord-002369-shk4n8f6	17	3	a	a	DT
cord-002369-shk4n8f6	17	4	member	member	NN
cord-002369-shk4n8f6	17	5	of	of	IN
cord-002369-shk4n8f6	17	6	the	the	DT
cord-002369-shk4n8f6	17	7	Flaviviridae	Flaviviridae	NNP
cord-002369-shk4n8f6	17	8	family	family	NN
cord-002369-shk4n8f6	17	9	,	,	,
cord-002369-shk4n8f6	17	10	is	be	VBZ
cord-002369-shk4n8f6	17	11	a	a	DT
cord-002369-shk4n8f6	17	12	Hepacivirus	Hepacivirus	NNP
cord-002369-shk4n8f6	17	13	with	with	IN
cord-002369-shk4n8f6	17	14	a	a	DT
cord-002369-shk4n8f6	17	15	positive	positive	JJ
cord-002369-shk4n8f6	17	16	-	-	HYPH
cord-002369-shk4n8f6	17	17	strand	strand	NN
cord-002369-shk4n8f6	17	18	RNA	RNA	NNP
cord-002369-shk4n8f6	17	19	genome	genome	NN
cord-002369-shk4n8f6	17	20	1	1	CD
cord-002369-shk4n8f6	17	21	.	.	.
cord-002369-shk4n8f6	18	1	The	the	DT
cord-002369-shk4n8f6	18	2	virus	virus	NN
cord-002369-shk4n8f6	18	3	replicates	replicate	VBZ
cord-002369-shk4n8f6	18	4	exclusively	exclusively	RB
cord-002369-shk4n8f6	18	5	in	in	IN
cord-002369-shk4n8f6	18	6	the	the	DT
cord-002369-shk4n8f6	18	7	cytoplasm	cytoplasm	NN
cord-002369-shk4n8f6	18	8	of	of	IN
cord-002369-shk4n8f6	18	9	the	the	DT
cord-002369-shk4n8f6	18	10	host	host	NN
cord-002369-shk4n8f6	18	11	cell	cell	NN
cord-002369-shk4n8f6	18	12	.	.	.
cord-002369-shk4n8f6	19	1	After	after	IN
cord-002369-shk4n8f6	19	2	cell	cell	NN
cord-002369-shk4n8f6	19	3	entry	entry	NN
cord-002369-shk4n8f6	19	4	,	,	,
cord-002369-shk4n8f6	19	5	the	the	DT
cord-002369-shk4n8f6	19	6	9.6	9.6	CD
cord-002369-shk4n8f6	19	7	kb	kb	NNP
cord-002369-shk4n8f6	19	8	HCV	HCV	NNP
cord-002369-shk4n8f6	19	9	genome	genome	NN
cord-002369-shk4n8f6	19	10	is	be	VBZ
cord-002369-shk4n8f6	19	11	released	release	VBN
cord-002369-shk4n8f6	19	12	and	and	CC
cord-002369-shk4n8f6	19	13	translated	translate	VBN
cord-002369-shk4n8f6	19	14	at	at	IN
cord-002369-shk4n8f6	19	15	the	the	DT
cord-002369-shk4n8f6	19	16	rough	rough	JJ
cord-002369-shk4n8f6	19	17	endoplasmic	endoplasmic	NN
cord-002369-shk4n8f6	19	18	reticulum	reticulum	NN
cord-002369-shk4n8f6	19	19	(	(	-LRB-
cord-002369-shk4n8f6	19	20	rER	rER	NNP
cord-002369-shk4n8f6	19	21	)	)	-RRB-
cord-002369-shk4n8f6	19	22	into	into	IN
cord-002369-shk4n8f6	19	23	a	a	DT
cord-002369-shk4n8f6	19	24	single	single	JJ
cord-002369-shk4n8f6	19	25	polyprotein	polyprotein	NN
cord-002369-shk4n8f6	19	26	.	.	.
cord-002369-shk4n8f6	20	1	This	this	DT
cord-002369-shk4n8f6	20	2	translated	translate	VBN
cord-002369-shk4n8f6	20	3	polyprotein	polyprotein	NN
cord-002369-shk4n8f6	20	4	is	be	VBZ
cord-002369-shk4n8f6	20	5	then	then	RB
cord-002369-shk4n8f6	20	6	proteolytically	proteolytically	RB
cord-002369-shk4n8f6	20	7	processed	process	VBN
cord-002369-shk4n8f6	20	8	by	by	IN
cord-002369-shk4n8f6	20	9	cellular	cellular	JJ
cord-002369-shk4n8f6	20	10	and	and	CC
cord-002369-shk4n8f6	20	11	viral	viral	JJ
cord-002369-shk4n8f6	20	12	proteases	protease	NNS
cord-002369-shk4n8f6	20	13	into	into	IN
cord-002369-shk4n8f6	20	14	10	10	CD
cord-002369-shk4n8f6	20	15	distinct	distinct	JJ
cord-002369-shk4n8f6	20	16	proteins	protein	NNS
cord-002369-shk4n8f6	20	17	consisting	consist	VBG
cord-002369-shk4n8f6	20	18	of	of	IN
cord-002369-shk4n8f6	20	19	structural	structural	JJ
cord-002369-shk4n8f6	20	20	(	(	-LRB-
cord-002369-shk4n8f6	20	21	core	core	NN
cord-002369-shk4n8f6	20	22	,	,	,
cord-002369-shk4n8f6	20	23	E1	E1	NNP
cord-002369-shk4n8f6	20	24	,	,	,
cord-002369-shk4n8f6	20	25	and	and	CC
cord-002369-shk4n8f6	20	26	E2	E2	NNP
cord-002369-shk4n8f6	20	27	)	)	-RRB-
cord-002369-shk4n8f6	20	28	and	and	CC
cord-002369-shk4n8f6	20	29	nonstructural	nonstructural	JJ
cord-002369-shk4n8f6	20	30	(	(	-LRB-
cord-002369-shk4n8f6	20	31	p7	p7	RB
cord-002369-shk4n8f6	20	32	,	,	,
cord-002369-shk4n8f6	20	33	NS2	NS2	NNP
cord-002369-shk4n8f6	20	34	,	,	,
cord-002369-shk4n8f6	20	35	NS3	ns3	RB
cord-002369-shk4n8f6	20	36	,	,	,
cord-002369-shk4n8f6	20	37	NS4A	NS4A	NNP
cord-002369-shk4n8f6	20	38	,	,	,
cord-002369-shk4n8f6	20	39	NS4B	NS4B	NNP
cord-002369-shk4n8f6	20	40	,	,	,
cord-002369-shk4n8f6	20	41	NS5A	NS5A	NNP
cord-002369-shk4n8f6	20	42	,	,	,
cord-002369-shk4n8f6	20	43	and	and	CC
cord-002369-shk4n8f6	20	44	NS5B	NS5B	NNP
cord-002369-shk4n8f6	20	45	)	)	-RRB-
cord-002369-shk4n8f6	20	46	proteins	protein	NNS
cord-002369-shk4n8f6	20	47	2	2	CD
cord-002369-shk4n8f6	20	48	.	.	.
cord-002369-shk4n8f6	21	1	The	the	DT
cord-002369-shk4n8f6	21	2	expression	expression	NN
cord-002369-shk4n8f6	21	3	of	of	IN
cord-002369-shk4n8f6	21	4	HCV	HCV	NNP
cord-002369-shk4n8f6	21	5	proteins	protein	NNS
cord-002369-shk4n8f6	21	6	results	result	NNS
cord-002369-shk4n8f6	21	7	in	in	IN
cord-002369-shk4n8f6	21	8	the	the	DT
cord-002369-shk4n8f6	21	9	induction	induction	NN
cord-002369-shk4n8f6	21	10	of	of	IN
cord-002369-shk4n8f6	21	11	a	a	DT
cord-002369-shk4n8f6	21	12	major	major	JJ
cord-002369-shk4n8f6	21	13	rearrangement	rearrangement	NN
cord-002369-shk4n8f6	21	14	of	of	IN
cord-002369-shk4n8f6	21	15	host	host	NN
cord-002369-shk4n8f6	21	16	cell	cell	NN
cord-002369-shk4n8f6	21	17	membranes	membrane	NNS
cord-002369-shk4n8f6	21	18	,	,	,
cord-002369-shk4n8f6	21	19	thus	thus	RB
cord-002369-shk4n8f6	21	20	leading	lead	VBG
cord-002369-shk4n8f6	21	21	to	to	IN
cord-002369-shk4n8f6	21	22	the	the	DT
cord-002369-shk4n8f6	21	23	formation	formation	NN
cord-002369-shk4n8f6	21	24	of	of	IN
cord-002369-shk4n8f6	21	25	a	a	DT
cord-002369-shk4n8f6	21	26	complex	complex	JJ
cord-002369-shk4n8f6	21	27	membranous	membranous	JJ
cord-002369-shk4n8f6	21	28	compartment	compartment	NN
cord-002369-shk4n8f6	21	29	termed	term	VBD
cord-002369-shk4n8f6	21	30	the	the	DT
cord-002369-shk4n8f6	21	31	membranous	membranous	JJ
cord-002369-shk4n8f6	21	32	web	web	NN
cord-002369-shk4n8f6	21	33	(	(	-LRB-
cord-002369-shk4n8f6	21	34	MW	MW	NNP
cord-002369-shk4n8f6	21	35	)	)	-RRB-
cord-002369-shk4n8f6	21	36	,	,	,
cord-002369-shk4n8f6	21	37	which	which	WDT
cord-002369-shk4n8f6	21	38	favors	favor	VBZ
cord-002369-shk4n8f6	21	39	viral	viral	JJ
cord-002369-shk4n8f6	21	40	RNA	RNA	NNP
cord-002369-shk4n8f6	21	41	replication	replication	NN
cord-002369-shk4n8f6	21	42	and	and	CC
cord-002369-shk4n8f6	21	43	assembly	assembly	NN
cord-002369-shk4n8f6	21	44	3	3	CD
cord-002369-shk4n8f6	21	45	,	,	,
cord-002369-shk4n8f6	21	46	4	4	CD
cord-002369-shk4n8f6	21	47	.	.	.
cord-002369-shk4n8f6	22	1	This	this	DT
cord-002369-shk4n8f6	22	2	massive	massive	JJ
cord-002369-shk4n8f6	22	3	remodeling	remodeling	NN
cord-002369-shk4n8f6	22	4	of	of	IN
cord-002369-shk4n8f6	22	5	the	the	DT
cord-002369-shk4n8f6	22	6	host	host	NN
cord-002369-shk4n8f6	22	7	cell	cell	NN
cord-002369-shk4n8f6	22	8	membrane	membrane	NN
cord-002369-shk4n8f6	22	9	network	network	NN
cord-002369-shk4n8f6	22	10	is	be	VBZ
cord-002369-shk4n8f6	22	11	associated	associate	VBN
cord-002369-shk4n8f6	22	12	with	with	IN
cord-002369-shk4n8f6	22	13	all	all	DT
cord-002369-shk4n8f6	22	14	positive	positive	JJ
cord-002369-shk4n8f6	22	15	-	-	HYPH
cord-002369-shk4n8f6	22	16	strand	strand	NN
cord-002369-shk4n8f6	22	17	RNA	RNA	NNP
cord-002369-shk4n8f6	22	18	viruses	virus	NNS
cord-002369-shk4n8f6	22	19	and	and	CC
cord-002369-shk4n8f6	22	20	is	be	VBZ
cord-002369-shk4n8f6	22	21	typically	typically	RB
cord-002369-shk4n8f6	22	22	characterized	characterize	VBN
cord-002369-shk4n8f6	22	23	by	by	IN
cord-002369-shk4n8f6	22	24	the	the	DT
cord-002369-shk4n8f6	22	25	generation	generation	NN
cord-002369-shk4n8f6	22	26	of	of	IN
cord-002369-shk4n8f6	22	27	either	either	CC
cord-002369-shk4n8f6	22	28	convoluted	convoluted	JJ
cord-002369-shk4n8f6	22	29	membranes	membrane	NNS
cord-002369-shk4n8f6	22	30	or	or	CC
cord-002369-shk4n8f6	22	31	double	double	JJ
cord-002369-shk4n8f6	22	32	membrane	membrane	NN
cord-002369-shk4n8f6	22	33	vesicles	vesicle	NNS
cord-002369-shk4n8f6	22	34	(	(	-LRB-
cord-002369-shk4n8f6	22	35	DMVs	dmv	NNS
cord-002369-shk4n8f6	22	36	)	)	-RRB-
cord-002369-shk4n8f6	22	37	[	[	-LRB-
cord-002369-shk4n8f6	22	38	5	5	CD
cord-002369-shk4n8f6	22	39	]	]	-RRB-
cord-002369-shk4n8f6	22	40	[	[	-LRB-
cord-002369-shk4n8f6	22	41	6	6	CD
cord-002369-shk4n8f6	22	42	]	]	-RRB-
cord-002369-shk4n8f6	22	43	[	[	-LRB-
cord-002369-shk4n8f6	22	44	7	7	CD
cord-002369-shk4n8f6	22	45	]	]	-RRB-
cord-002369-shk4n8f6	22	46	[	[	-LRB-
cord-002369-shk4n8f6	22	47	8	8	CD
cord-002369-shk4n8f6	22	48	]	]	-RRB-
cord-002369-shk4n8f6	22	49	.	.	.
cord-002369-shk4n8f6	23	1	Importantly	importantly	RB
cord-002369-shk4n8f6	23	2	,	,	,
cord-002369-shk4n8f6	23	3	the	the	DT
cord-002369-shk4n8f6	23	4	HCV	HCV	NNP
cord-002369-shk4n8f6	23	5	-	-	HYPH
cord-002369-shk4n8f6	23	6	induced	induce	VBN
cord-002369-shk4n8f6	23	7	MW	MW	NNP
cord-002369-shk4n8f6	23	8	is	be	VBZ
cord-002369-shk4n8f6	23	9	primarily	primarily	RB
cord-002369-shk4n8f6	23	10	composed	compose	VBN
cord-002369-shk4n8f6	23	11	of	of	IN
cord-002369-shk4n8f6	23	12	DMVs	dmv	NNS
cord-002369-shk4n8f6	23	13	thus	thus	RB
cord-002369-shk4n8f6	23	14	suggesting	suggest	VBG
cord-002369-shk4n8f6	23	15	that	that	IN
cord-002369-shk4n8f6	23	16	autophagy	autophagy	NN
cord-002369-shk4n8f6	23	17	plays	play	VBZ
cord-002369-shk4n8f6	23	18	a	a	DT
cord-002369-shk4n8f6	23	19	role	role	NN
cord-002369-shk4n8f6	23	20	in	in	IN
cord-002369-shk4n8f6	23	21	the	the	DT
cord-002369-shk4n8f6	23	22	construction	construction	NN
cord-002369-shk4n8f6	23	23	of	of	IN
cord-002369-shk4n8f6	23	24	the	the	DT
cord-002369-shk4n8f6	23	25	HCV	HCV	NNP
cord-002369-shk4n8f6	23	26	replication	replication	NN
cord-002369-shk4n8f6	23	27	scaffold	scaffold	NN
cord-002369-shk4n8f6	23	28	7,9	7,9	CD
cord-002369-shk4n8f6	23	29	.	.	.
cord-002369-shk4n8f6	24	1	Macroautophagy	Macroautophagy	NNP
cord-002369-shk4n8f6	24	2	,	,	,
cord-002369-shk4n8f6	24	3	referred	refer	VBD
cord-002369-shk4n8f6	24	4	to	to	TO
cord-002369-shk4n8f6	24	5	hereafter	hereafter	VB
cord-002369-shk4n8f6	24	6	as	as	IN
cord-002369-shk4n8f6	24	7	autophagy	autophagy	NN
cord-002369-shk4n8f6	24	8	,	,	,
cord-002369-shk4n8f6	24	9	is	be	VBZ
cord-002369-shk4n8f6	24	10	a	a	DT
cord-002369-shk4n8f6	24	11	catabolic	catabolic	JJ
cord-002369-shk4n8f6	24	12	pathway	pathway	NN
cord-002369-shk4n8f6	24	13	that	that	WDT
cord-002369-shk4n8f6	24	14	degrades	degrade	VBZ
cord-002369-shk4n8f6	24	15	proteins	protein	NNS
cord-002369-shk4n8f6	24	16	and	and	CC
cord-002369-shk4n8f6	24	17	organelles	organelle	NNS
cord-002369-shk4n8f6	24	18	,	,	,
cord-002369-shk4n8f6	24	19	thereby	thereby	RB
cord-002369-shk4n8f6	24	20	maintaining	maintain	VBG
cord-002369-shk4n8f6	24	21	cell	cell	NN
cord-002369-shk4n8f6	24	22	homeostasis	homeostasis	NN
cord-002369-shk4n8f6	24	23	and	and	CC
cord-002369-shk4n8f6	24	24	directing	direct	VBG
cord-002369-shk4n8f6	24	25	cell	cell	NN
cord-002369-shk4n8f6	24	26	fate	fate	NN
cord-002369-shk4n8f6	24	27	.	.	.
cord-002369-shk4n8f6	25	1	During	during	IN
cord-002369-shk4n8f6	25	2	cellular	cellular	JJ
cord-002369-shk4n8f6	25	3	stress	stress	NN
cord-002369-shk4n8f6	25	4	such	such	JJ
cord-002369-shk4n8f6	25	5	as	as	IN
cord-002369-shk4n8f6	25	6	amino	amino	NN
cord-002369-shk4n8f6	25	7	acid	acid	NN
cord-002369-shk4n8f6	25	8	starvation	starvation	NN
cord-002369-shk4n8f6	25	9	,	,	,
cord-002369-shk4n8f6	25	10	autophagy	autophagy	NN
cord-002369-shk4n8f6	25	11	is	be	VBZ
cord-002369-shk4n8f6	25	12	triggered	trigger	VBN
cord-002369-shk4n8f6	25	13	,	,	,
cord-002369-shk4n8f6	25	14	thereby	thereby	RB
cord-002369-shk4n8f6	25	15	forming	form	VBG
cord-002369-shk4n8f6	25	16	an	an	DT
cord-002369-shk4n8f6	25	17	organelle	organelle	NN
cord-002369-shk4n8f6	25	18	called	call	VBN
cord-002369-shk4n8f6	25	19	the	the	DT
cord-002369-shk4n8f6	25	20	autophagosome	autophagosome	NNP
cord-002369-shk4n8f6	25	21	.	.	.
cord-002369-shk4n8f6	26	1	The	the	DT
cord-002369-shk4n8f6	26	2	de	de	FW
cord-002369-shk4n8f6	26	3	novo	novo	NN
cord-002369-shk4n8f6	26	4	formation	formation	NN
cord-002369-shk4n8f6	26	5	of	of	IN
cord-002369-shk4n8f6	26	6	the	the	DT
cord-002369-shk4n8f6	26	7	autophagosome	autophagosome	NN
cord-002369-shk4n8f6	26	8	begins	begin	VBZ
cord-002369-shk4n8f6	26	9	by	by	IN
cord-002369-shk4n8f6	26	10	initiation	initiation	NN
cord-002369-shk4n8f6	26	11	of	of	IN
cord-002369-shk4n8f6	26	12	the	the	DT
cord-002369-shk4n8f6	26	13	growth	growth	NN
cord-002369-shk4n8f6	26	14	of	of	IN
cord-002369-shk4n8f6	26	15	a	a	DT
cord-002369-shk4n8f6	26	16	double	double	JJ
cord-002369-shk4n8f6	26	17	-	-	HYPH
cord-002369-shk4n8f6	26	18	membraned	membraned	JJ
cord-002369-shk4n8f6	26	19	phagophore	phagophore	NN
cord-002369-shk4n8f6	26	20	that	that	IN
cord-002369-shk4n8f6	26	21	,	,	,
cord-002369-shk4n8f6	26	22	by	by	IN
cord-002369-shk4n8f6	26	23	closing	close	VBG
cord-002369-shk4n8f6	26	24	,	,	,
cord-002369-shk4n8f6	26	25	sequesters	sequester	VBZ
cord-002369-shk4n8f6	26	26	cytoplasmic	cytoplasmic	JJ
cord-002369-shk4n8f6	26	27	contents	content	NNS
cord-002369-shk4n8f6	26	28	.	.	.
cord-002369-shk4n8f6	27	1	The	the	DT
cord-002369-shk4n8f6	27	2	autophagosome	autophagosome	NN
cord-002369-shk4n8f6	27	3	then	then	RB
cord-002369-shk4n8f6	27	4	fuses	fuse	VBZ
cord-002369-shk4n8f6	27	5	with	with	IN
cord-002369-shk4n8f6	27	6	the	the	DT
cord-002369-shk4n8f6	27	7	lysosome	lysosome	NN
cord-002369-shk4n8f6	27	8	,	,	,
cord-002369-shk4n8f6	27	9	thus	thus	RB
cord-002369-shk4n8f6	27	10	allowing	allow	VBG
cord-002369-shk4n8f6	27	11	the	the	DT
cord-002369-shk4n8f6	27	12	degradation	degradation	NN
cord-002369-shk4n8f6	27	13	of	of	IN
cord-002369-shk4n8f6	27	14	the	the	DT
cord-002369-shk4n8f6	27	15	intra	intra	JJ
cord-002369-shk4n8f6	27	16	-	-	JJ
cord-002369-shk4n8f6	27	17	autophagosomal	autophagosomal	JJ
cord-002369-shk4n8f6	27	18	cargo	cargo	NN
cord-002369-shk4n8f6	27	19	by	by	IN
cord-002369-shk4n8f6	27	20	the	the	DT
cord-002369-shk4n8f6	27	21	action	action	NN
cord-002369-shk4n8f6	27	22	of	of	IN
cord-002369-shk4n8f6	27	23	lysosomal	lysosomal	JJ
cord-002369-shk4n8f6	27	24	enzymes	enzyme	NNS
cord-002369-shk4n8f6	27	25	and	and	CC
cord-002369-shk4n8f6	27	26	the	the	DT
cord-002369-shk4n8f6	27	27	release	release	NN
cord-002369-shk4n8f6	27	28	of	of	IN
cord-002369-shk4n8f6	27	29	free	free	JJ
cord-002369-shk4n8f6	27	30	amino	amino	NN
cord-002369-shk4n8f6	27	31	acids	acid	NNS
cord-002369-shk4n8f6	27	32	and	and	CC
cord-002369-shk4n8f6	27	33	other	other	JJ
cord-002369-shk4n8f6	27	34	products	product	NNS
cord-002369-shk4n8f6	27	35	.	.	.
cord-002369-shk4n8f6	28	1	This	this	DT
cord-002369-shk4n8f6	28	2	process	process	NN
cord-002369-shk4n8f6	28	3	is	be	VBZ
cord-002369-shk4n8f6	28	4	orchestrated	orchestrate	VBN
cord-002369-shk4n8f6	28	5	by	by	IN
cord-002369-shk4n8f6	28	6	more	more	JJR
cord-002369-shk4n8f6	28	7	than	than	IN
cord-002369-shk4n8f6	28	8	30	30	CD
cord-002369-shk4n8f6	28	9	autophagy	autophagy	NN
cord-002369-shk4n8f6	28	10	-	-	HYPH
cord-002369-shk4n8f6	28	11	related	relate	VBN
cord-002369-shk4n8f6	28	12	gene	gene	NN
cord-002369-shk4n8f6	28	13	(	(	-LRB-
cord-002369-shk4n8f6	28	14	ATG	ATG	NNP
cord-002369-shk4n8f6	28	15	)	)	-RRB-
cord-002369-shk4n8f6	28	16	proteins	protein	NNS
cord-002369-shk4n8f6	28	17	and	and	CC
cord-002369-shk4n8f6	28	18	other	other	JJ
cord-002369-shk4n8f6	28	19	autophagy	autophagy	NN
cord-002369-shk4n8f6	28	20	-	-	HYPH
cord-002369-shk4n8f6	28	21	linked	link	VBN
cord-002369-shk4n8f6	28	22	proteins	protein	NNS
cord-002369-shk4n8f6	28	23	10	10	CD
cord-002369-shk4n8f6	28	24	.	.	.
cord-002369-shk4n8f6	29	1	HCV	HCV	NNP
cord-002369-shk4n8f6	29	2	does	do	VBZ
cord-002369-shk4n8f6	29	3	not	not	RB
cord-002369-shk4n8f6	29	4	perturb	perturb	VB
cord-002369-shk4n8f6	29	5	formation	formation	NN
cord-002369-shk4n8f6	29	6	of	of	IN
cord-002369-shk4n8f6	29	7	the	the	DT
cord-002369-shk4n8f6	29	8	ATG5	ATG5	NNP
cord-002369-shk4n8f6	29	9	-	-	HYPH
cord-002369-shk4n8f6	29	10	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	29	11	complex	complex	NN
cord-002369-shk4n8f6	29	12	.	.	.
cord-002369-shk4n8f6	30	1	ATG5	atg5	JJ
cord-002369-shk4n8f6	30	2	forms	form	VBZ
cord-002369-shk4n8f6	30	3	a	a	DT
cord-002369-shk4n8f6	30	4	conjugate	conjugate	NN
cord-002369-shk4n8f6	30	5	with	with	IN
cord-002369-shk4n8f6	30	6	ATG12	ATG12	NNP
cord-002369-shk4n8f6	30	7	,	,	,
cord-002369-shk4n8f6	30	8	but	but	CC
cord-002369-shk4n8f6	30	9	the	the	DT
cord-002369-shk4n8f6	30	10	monomeric	monomeric	JJ
cord-002369-shk4n8f6	30	11	forms	form	NNS
cord-002369-shk4n8f6	30	12	of	of	IN
cord-002369-shk4n8f6	30	13	these	these	DT
cord-002369-shk4n8f6	30	14	two	two	CD
cord-002369-shk4n8f6	30	15	proteins	protein	NNS
cord-002369-shk4n8f6	30	16	have	have	VBP
cord-002369-shk4n8f6	30	17	been	be	VBN
cord-002369-shk4n8f6	30	18	shown	show	VBN
cord-002369-shk4n8f6	30	19	to	to	TO
cord-002369-shk4n8f6	30	20	be	be	VB
cord-002369-shk4n8f6	30	21	nearly	nearly	RB
cord-002369-shk4n8f6	30	22	undetectable	undetectable	JJ
cord-002369-shk4n8f6	30	23	under	under	IN
cord-002369-shk4n8f6	30	24	normal	normal	JJ
cord-002369-shk4n8f6	30	25	conditions	condition	NNS
cord-002369-shk4n8f6	30	26	35	35	CD
cord-002369-shk4n8f6	30	27	.	.	.
cord-002369-shk4n8f6	31	1	We	-PRON-	PRP
cord-002369-shk4n8f6	31	2	first	first	RB
cord-002369-shk4n8f6	31	3	tested	test	VBD
cord-002369-shk4n8f6	31	4	whether	whether	IN
cord-002369-shk4n8f6	31	5	this	this	DT
cord-002369-shk4n8f6	31	6	conjugation	conjugation	NN
cord-002369-shk4n8f6	31	7	occurs	occur	VBZ
cord-002369-shk4n8f6	31	8	in	in	IN
cord-002369-shk4n8f6	31	9	HCV	HCV	NNP
cord-002369-shk4n8f6	31	10	-	-	HYPH
cord-002369-shk4n8f6	31	11	infected	infect	VBN
cord-002369-shk4n8f6	31	12	cells	cell	NNS
cord-002369-shk4n8f6	31	13	.	.	.
cord-002369-shk4n8f6	32	1	The	the	DT
cord-002369-shk4n8f6	32	2	assessment	assessment	NN
cord-002369-shk4n8f6	32	3	of	of	IN
cord-002369-shk4n8f6	32	4	the	the	DT
cord-002369-shk4n8f6	32	5	ATG5	ATG5	NNP
cord-002369-shk4n8f6	32	6	protein	protein	NN
cord-002369-shk4n8f6	32	7	by	by	IN
cord-002369-shk4n8f6	32	8	western	western	JJ
cord-002369-shk4n8f6	32	9	blotting	blotting	NN
cord-002369-shk4n8f6	32	10	showed	show	VBD
cord-002369-shk4n8f6	32	11	that	that	IN
cord-002369-shk4n8f6	32	12	monomeric	monomeric	JJ
cord-002369-shk4n8f6	32	13	ATG5	ATG5	NNP
cord-002369-shk4n8f6	32	14	(	(	-LRB-
cord-002369-shk4n8f6	32	15	32	32	CD
cord-002369-shk4n8f6	32	16	kDa	kDa	NNS
cord-002369-shk4n8f6	32	17	)	)	-RRB-
cord-002369-shk4n8f6	32	18	was	be	VBD
cord-002369-shk4n8f6	32	19	undetectable	undetectable	JJ
cord-002369-shk4n8f6	32	20	in	in	IN
cord-002369-shk4n8f6	32	21	both	both	CC
cord-002369-shk4n8f6	32	22	infected	infected	JJ
cord-002369-shk4n8f6	32	23	and	and	CC
cord-002369-shk4n8f6	32	24	uninfected	uninfected	JJ
cord-002369-shk4n8f6	32	25	cells	cell	NNS
cord-002369-shk4n8f6	32	26	.	.	.
cord-002369-shk4n8f6	33	1	ATG5	ATG5	NNP
cord-002369-shk4n8f6	33	2	was	be	VBD
cord-002369-shk4n8f6	33	3	detected	detect	VBN
cord-002369-shk4n8f6	33	4	only	only	RB
cord-002369-shk4n8f6	33	5	in	in	IN
cord-002369-shk4n8f6	33	6	the	the	DT
cord-002369-shk4n8f6	33	7	ATG5	ATG5	NNP
cord-002369-shk4n8f6	33	8	-	-	HYPH
cord-002369-shk4n8f6	33	9	12-conjugated	12-conjugated	CD
cord-002369-shk4n8f6	33	10	form	form	NN
cord-002369-shk4n8f6	33	11	(	(	-LRB-
cord-002369-shk4n8f6	33	12	55	55	CD
cord-002369-shk4n8f6	33	13	kDa	kDa	NNS
cord-002369-shk4n8f6	33	14	)	)	-RRB-
cord-002369-shk4n8f6	34	1	(	(	-LRB-
cord-002369-shk4n8f6	34	2	Fig	Fig	NNP
cord-002369-shk4n8f6	34	3	.	.	.
cord-002369-shk4n8f6	34	4	1A	1a	NN
cord-002369-shk4n8f6	34	5	)	)	-RRB-
cord-002369-shk4n8f6	34	6	.	.	.
cord-002369-shk4n8f6	35	1	Infection	infection	NN
cord-002369-shk4n8f6	35	2	with	with	IN
cord-002369-shk4n8f6	35	3	HCV	HCV	NNP
cord-002369-shk4n8f6	35	4	JFH1	JFH1	NNP
cord-002369-shk4n8f6	35	5	strain	strain	NN
cord-002369-shk4n8f6	35	6	was	be	VBD
cord-002369-shk4n8f6	35	7	confirmed	confirm	VBN
cord-002369-shk4n8f6	35	8	by	by	IN
cord-002369-shk4n8f6	35	9	detecting	detect	VBG
cord-002369-shk4n8f6	35	10	HCV	HCV	NNP
cord-002369-shk4n8f6	35	11	NS3	NS3	NNP
cord-002369-shk4n8f6	35	12	protein	protein	NN
cord-002369-shk4n8f6	35	13	using	use	VBG
cord-002369-shk4n8f6	35	14	anti	anti	JJ
cord-002369-shk4n8f6	35	15	-	-	JJ
cord-002369-shk4n8f6	35	16	NS3	ns3	JJ
cord-002369-shk4n8f6	35	17	antibody	antibody	NN
cord-002369-shk4n8f6	35	18	(	(	-LRB-
cord-002369-shk4n8f6	35	19	Fig	Fig	NNP
cord-002369-shk4n8f6	35	20	.	.	.
cord-002369-shk4n8f6	35	21	1A	1a	NN
cord-002369-shk4n8f6	35	22	)	)	-RRB-
cord-002369-shk4n8f6	35	23	.	.	.
cord-002369-shk4n8f6	36	1	The	the	DT
cord-002369-shk4n8f6	36	2	difficulty	difficulty	NN
cord-002369-shk4n8f6	36	3	in	in	IN
cord-002369-shk4n8f6	36	4	detecting	detect	VBG
cord-002369-shk4n8f6	36	5	unconjugated	unconjugated	JJ
cord-002369-shk4n8f6	36	6	ATG5	ATG5	NNP
cord-002369-shk4n8f6	36	7	suggested	suggest	VBD
cord-002369-shk4n8f6	36	8	that	that	IN
cord-002369-shk4n8f6	36	9	the	the	DT
cord-002369-shk4n8f6	36	10	majority	majority	NN
cord-002369-shk4n8f6	36	11	of	of	IN
cord-002369-shk4n8f6	36	12	the	the	DT
cord-002369-shk4n8f6	36	13	ATG5	ATG5	NNP
cord-002369-shk4n8f6	36	14	is	be	VBZ
cord-002369-shk4n8f6	36	15	readily	readily	RB
cord-002369-shk4n8f6	36	16	conjugated	conjugate	VBN
cord-002369-shk4n8f6	36	17	to	to	IN
cord-002369-shk4n8f6	36	18	ATG12	ATG12	NNP
cord-002369-shk4n8f6	36	19	in	in	IN
cord-002369-shk4n8f6	36	20	Huh7	Huh7	NNP
cord-002369-shk4n8f6	36	21	cells	cell	NNS
cord-002369-shk4n8f6	36	22	,	,	,
cord-002369-shk4n8f6	36	23	as	as	IN
cord-002369-shk4n8f6	36	24	has	have	VBZ
cord-002369-shk4n8f6	36	25	previously	previously	RB
cord-002369-shk4n8f6	36	26	been	be	VBN
cord-002369-shk4n8f6	36	27	reported	report	VBN
cord-002369-shk4n8f6	36	28	for	for	IN
cord-002369-shk4n8f6	36	29	other	other	JJ
cord-002369-shk4n8f6	36	30	cell	cell	NN
cord-002369-shk4n8f6	36	31	types	type	NNS
cord-002369-shk4n8f6	36	32	36	36	CD
cord-002369-shk4n8f6	36	33	.	.	.
cord-002369-shk4n8f6	37	1	In	in	IN
cord-002369-shk4n8f6	37	2	addition	addition	NN
cord-002369-shk4n8f6	37	3	,	,	,
cord-002369-shk4n8f6	37	4	HCV	HCV	NNP
cord-002369-shk4n8f6	37	5	infection	infection	NN
cord-002369-shk4n8f6	37	6	did	do	VBD
cord-002369-shk4n8f6	37	7	not	not	RB
cord-002369-shk4n8f6	37	8	inhibit	inhibit	VB
cord-002369-shk4n8f6	37	9	this	this	DT
cord-002369-shk4n8f6	37	10	conjugation	conjugation	NN
cord-002369-shk4n8f6	37	11	.	.	.
cord-002369-shk4n8f6	38	1	Furthermore	furthermore	RB
cord-002369-shk4n8f6	38	2	,	,	,
cord-002369-shk4n8f6	38	3	HCV	HCV	NNP
cord-002369-shk4n8f6	38	4	infection	infection	NN
cord-002369-shk4n8f6	38	5	induced	induce	VBD
cord-002369-shk4n8f6	38	6	LC3-II	LC3-II	NNP
cord-002369-shk4n8f6	38	7	accumulation	accumulation	NN
cord-002369-shk4n8f6	38	8	(	(	-LRB-
cord-002369-shk4n8f6	38	9	Fig	Fig	NNP
cord-002369-shk4n8f6	38	10	.	.	.
cord-002369-shk4n8f6	38	11	1A	1a	NN
cord-002369-shk4n8f6	38	12	)	)	-RRB-
cord-002369-shk4n8f6	38	13	.	.	.
cord-002369-shk4n8f6	39	1	This	this	DT
cord-002369-shk4n8f6	39	2	result	result	NN
cord-002369-shk4n8f6	39	3	confirms	confirm	VBZ
cord-002369-shk4n8f6	39	4	the	the	DT
cord-002369-shk4n8f6	39	5	capability	capability	NN
cord-002369-shk4n8f6	39	6	of	of	IN
cord-002369-shk4n8f6	39	7	HCV	HCV	NNP
cord-002369-shk4n8f6	39	8	to	to	TO
cord-002369-shk4n8f6	39	9	modulate	modulate	VB
cord-002369-shk4n8f6	39	10	autophagy	autophagy	NN
cord-002369-shk4n8f6	39	11	,	,	,
cord-002369-shk4n8f6	39	12	as	as	IN
cord-002369-shk4n8f6	39	13	has	have	VBZ
cord-002369-shk4n8f6	39	14	previously	previously	RB
cord-002369-shk4n8f6	39	15	been	be	VBN
cord-002369-shk4n8f6	39	16	reported	report	VBN
cord-002369-shk4n8f6	39	17	by	by	IN
cord-002369-shk4n8f6	39	18	several	several	JJ
cord-002369-shk4n8f6	39	19	groups	group	NNS
cord-002369-shk4n8f6	39	20	9	9	CD
cord-002369-shk4n8f6	39	21	,	,	,
cord-002369-shk4n8f6	39	22	18	18	CD
cord-002369-shk4n8f6	39	23	,	,	,
cord-002369-shk4n8f6	39	24	19	19	CD
cord-002369-shk4n8f6	39	25	.	.	.
cord-002369-shk4n8f6	40	1	After	after	IN
cord-002369-shk4n8f6	40	2	ATG5	ATG5	NNP
cord-002369-shk4n8f6	40	3	is	be	VBZ
cord-002369-shk4n8f6	40	4	conjugated	conjugate	VBN
cord-002369-shk4n8f6	40	5	to	to	IN
cord-002369-shk4n8f6	40	6	ATG12	ATG12	NNP
cord-002369-shk4n8f6	40	7	,	,	,
cord-002369-shk4n8f6	40	8	it	-PRON-	PRP
cord-002369-shk4n8f6	40	9	forms	form	VBZ
cord-002369-shk4n8f6	40	10	a	a	DT
cord-002369-shk4n8f6	40	11	multimeric	multimeric	JJ
cord-002369-shk4n8f6	40	12	complex	complex	NN
cord-002369-shk4n8f6	40	13	by	by	IN
cord-002369-shk4n8f6	40	14	associating	associate	VBG
cord-002369-shk4n8f6	40	15	with	with	IN
cord-002369-shk4n8f6	40	16	ATG16L1	ATG16L1	NNS
cord-002369-shk4n8f6	40	17	.	.	.
cord-002369-shk4n8f6	41	1	To	to	TO
cord-002369-shk4n8f6	41	2	test	test	VB
cord-002369-shk4n8f6	41	3	whether	whether	IN
cord-002369-shk4n8f6	41	4	this	this	DT
cord-002369-shk4n8f6	41	5	complex	complex	JJ
cord-002369-shk4n8f6	41	6	forms	form	NNS
cord-002369-shk4n8f6	41	7	in	in	IN
cord-002369-shk4n8f6	41	8	HCV	HCV	NNP
cord-002369-shk4n8f6	41	9	-	-	HYPH
cord-002369-shk4n8f6	41	10	infected	infect	VBN
cord-002369-shk4n8f6	41	11	cells	cell	NNS
cord-002369-shk4n8f6	41	12	,	,	,
cord-002369-shk4n8f6	41	13	we	-PRON-	PRP
cord-002369-shk4n8f6	41	14	overexpressed	overexpresse	VBD
cord-002369-shk4n8f6	41	15	ATG12-Flag	ATG12-Flag	NNP
cord-002369-shk4n8f6	41	16	in	in	IN
cord-002369-shk4n8f6	41	17	infected	infected	JJ
cord-002369-shk4n8f6	41	18	and	and	CC
cord-002369-shk4n8f6	41	19	uninfected	uninfected	JJ
cord-002369-shk4n8f6	41	20	cells	cell	NNS
cord-002369-shk4n8f6	41	21	.	.	.
cord-002369-shk4n8f6	42	1	Using	use	VBG
cord-002369-shk4n8f6	42	2	co	co	NN
cord-002369-shk4n8f6	42	3	-	-	NN
cord-002369-shk4n8f6	42	4	immunoprecipitation	immunoprecipitation	JJ
cord-002369-shk4n8f6	42	5	with	with	IN
cord-002369-shk4n8f6	42	6	an	an	DT
cord-002369-shk4n8f6	42	7	anti	anti	JJ
cord-002369-shk4n8f6	42	8	-	-	JJ
cord-002369-shk4n8f6	42	9	flag	flag	JJ
cord-002369-shk4n8f6	42	10	monoclonal	monoclonal	JJ
cord-002369-shk4n8f6	42	11	antibody	antibody	NN
cord-002369-shk4n8f6	42	12	,	,	,
cord-002369-shk4n8f6	42	13	we	-PRON-	PRP
cord-002369-shk4n8f6	42	14	detected	detect	VBD
cord-002369-shk4n8f6	42	15	the	the	DT
cord-002369-shk4n8f6	42	16	ATG5	ATG5	NNP
cord-002369-shk4n8f6	42	17	-	-	HYPH
cord-002369-shk4n8f6	42	18	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	42	19	complex	complex	NN
cord-002369-shk4n8f6	42	20	under	under	IN
cord-002369-shk4n8f6	42	21	both	both	DT
cord-002369-shk4n8f6	42	22	conditions	condition	NNS
cord-002369-shk4n8f6	42	23	(	(	-LRB-
cord-002369-shk4n8f6	42	24	Fig	Fig	NNP
cord-002369-shk4n8f6	42	25	.	.	.
cord-002369-shk4n8f6	42	26	1B	1b	CD
cord-002369-shk4n8f6	42	27	)	)	-RRB-
cord-002369-shk4n8f6	42	28	.	.	.
cord-002369-shk4n8f6	43	1	Whereas	whereas	IN
cord-002369-shk4n8f6	43	2	ATG5	ATG5	NNP
cord-002369-shk4n8f6	43	3	-	-	HYPH
cord-002369-shk4n8f6	43	4	12	12	CD
cord-002369-shk4n8f6	43	5	associates	associate	NNS
cord-002369-shk4n8f6	43	6	spontaneously	spontaneously	RB
cord-002369-shk4n8f6	43	7	with	with	IN
cord-002369-shk4n8f6	43	8	ATG16L1	ATG16L1	NNP
cord-002369-shk4n8f6	43	9	37,38	37,38	CD
cord-002369-shk4n8f6	43	10	,	,	,
cord-002369-shk4n8f6	43	11	our	-PRON-	PRP$
cord-002369-shk4n8f6	43	12	results	result	NNS
cord-002369-shk4n8f6	43	13	indicated	indicate	VBD
cord-002369-shk4n8f6	43	14	that	that	IN
cord-002369-shk4n8f6	43	15	HCV	HCV	NNP
cord-002369-shk4n8f6	43	16	infection	infection	NN
cord-002369-shk4n8f6	43	17	did	do	VBD
cord-002369-shk4n8f6	43	18	not	not	RB
cord-002369-shk4n8f6	43	19	disturb	disturb	VB
cord-002369-shk4n8f6	43	20	the	the	DT
cord-002369-shk4n8f6	43	21	formation	formation	NN
cord-002369-shk4n8f6	43	22	of	of	IN
cord-002369-shk4n8f6	43	23	the	the	DT
cord-002369-shk4n8f6	43	24	ATG5	ATG5	NNP
cord-002369-shk4n8f6	43	25	-	-	HYPH
cord-002369-shk4n8f6	43	26	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	43	27	complex	complex	NN
cord-002369-shk4n8f6	43	28	.	.	.
cord-002369-shk4n8f6	44	1	To	to	TO
cord-002369-shk4n8f6	44	2	test	test	VB
cord-002369-shk4n8f6	44	3	whether	whether	IN
cord-002369-shk4n8f6	44	4	the	the	DT
cord-002369-shk4n8f6	44	5	decoupling	decoupling	NN
cord-002369-shk4n8f6	44	6	of	of	IN
cord-002369-shk4n8f6	44	7	the	the	DT
cord-002369-shk4n8f6	44	8	ATG5	ATG5	NNP
cord-002369-shk4n8f6	44	9	-	-	HYPH
cord-002369-shk4n8f6	44	10	12	12	CD
cord-002369-shk4n8f6	44	11	conjugate	conjugate	NN
cord-002369-shk4n8f6	44	12	influences	influence	NNS
cord-002369-shk4n8f6	44	13	HCV	HCV	NNP
cord-002369-shk4n8f6	44	14	replication	replication	NN
cord-002369-shk4n8f6	44	15	,	,	,
cord-002369-shk4n8f6	44	16	we	-PRON-	PRP
cord-002369-shk4n8f6	44	17	overexpressed	overexpresse	VBD
cord-002369-shk4n8f6	44	18	the	the	DT
cord-002369-shk4n8f6	44	19	dominant	dominant	JJ
cord-002369-shk4n8f6	44	20	-	-	HYPH
cord-002369-shk4n8f6	44	21	negative	negative	JJ
cord-002369-shk4n8f6	44	22	form	form	NN
cord-002369-shk4n8f6	44	23	of	of	IN
cord-002369-shk4n8f6	44	24	ATG12	ATG12	NNP
cord-002369-shk4n8f6	44	25	(	(	-LRB-
cord-002369-shk4n8f6	44	26	ATG12DN	ATG12DN	NNP
cord-002369-shk4n8f6	44	27	)	)	-RRB-
cord-002369-shk4n8f6	44	28	in	in	IN
cord-002369-shk4n8f6	44	29	HCV	HCV	NNP
cord-002369-shk4n8f6	44	30	-	-	HYPH
cord-002369-shk4n8f6	44	31	infected	infect	VBN
cord-002369-shk4n8f6	44	32	Huh7	Huh7	NNP
cord-002369-shk4n8f6	44	33	cells	cell	NNS
cord-002369-shk4n8f6	44	34	.	.	.
cord-002369-shk4n8f6	45	1	This	this	DT
cord-002369-shk4n8f6	45	2	mutated	mutate	VBN
cord-002369-shk4n8f6	45	3	form	form	NN
cord-002369-shk4n8f6	45	4	of	of	IN
cord-002369-shk4n8f6	45	5	the	the	DT
cord-002369-shk4n8f6	45	6	ATG12	ATG12	NNP
cord-002369-shk4n8f6	45	7	protein	protein	NN
cord-002369-shk4n8f6	45	8	lacks	lack	VBZ
cord-002369-shk4n8f6	45	9	the	the	DT
cord-002369-shk4n8f6	45	10	C	c	NN
cord-002369-shk4n8f6	45	11	-	-	HYPH
cord-002369-shk4n8f6	45	12	terminal	terminal	NN
cord-002369-shk4n8f6	45	13	glycine	glycine	NN
cord-002369-shk4n8f6	45	14	,	,	,
cord-002369-shk4n8f6	45	15	which	which	WDT
cord-002369-shk4n8f6	45	16	is	be	VBZ
cord-002369-shk4n8f6	45	17	crucial	crucial	JJ
cord-002369-shk4n8f6	45	18	for	for	IN
cord-002369-shk4n8f6	45	19	conjugation	conjugation	NN
cord-002369-shk4n8f6	45	20	with	with	IN
cord-002369-shk4n8f6	45	21	ATG5	ATG5	NNP
cord-002369-shk4n8f6	45	22	39	39	CD
cord-002369-shk4n8f6	45	23	.	.	.
cord-002369-shk4n8f6	46	1	Interestingly	interestingly	RB
cord-002369-shk4n8f6	46	2	,	,	,
cord-002369-shk4n8f6	46	3	the	the	DT
cord-002369-shk4n8f6	46	4	overexpression	overexpression	NN
cord-002369-shk4n8f6	46	5	of	of	IN
cord-002369-shk4n8f6	46	6	this	this	DT
cord-002369-shk4n8f6	46	7	conjugation	conjugation	NN
cord-002369-shk4n8f6	46	8	-	-	HYPH
cord-002369-shk4n8f6	46	9	defective	defective	JJ
cord-002369-shk4n8f6	46	10	mutant	mutant	NN
cord-002369-shk4n8f6	46	11	had	have	VBD
cord-002369-shk4n8f6	46	12	an	an	DT
cord-002369-shk4n8f6	46	13	adverse	adverse	JJ
cord-002369-shk4n8f6	46	14	effect	effect	NN
cord-002369-shk4n8f6	46	15	on	on	IN
cord-002369-shk4n8f6	46	16	HCV	HCV	NNP
cord-002369-shk4n8f6	46	17	lifecycle	lifecycle	NN
cord-002369-shk4n8f6	46	18	,	,	,
cord-002369-shk4n8f6	46	19	as	as	IN
cord-002369-shk4n8f6	46	20	indicated	indicate	VBN
cord-002369-shk4n8f6	46	21	by	by	IN
cord-002369-shk4n8f6	46	22	a	a	DT
cord-002369-shk4n8f6	46	23	decrease	decrease	NN
cord-002369-shk4n8f6	46	24	in	in	IN
cord-002369-shk4n8f6	46	25	the	the	DT
cord-002369-shk4n8f6	46	26	NS3	ns3	RB
cord-002369-shk4n8f6	46	27	protein	protein	NN
cord-002369-shk4n8f6	46	28	(	(	-LRB-
cord-002369-shk4n8f6	46	29	Fig	Fig	NNP
cord-002369-shk4n8f6	46	30	.	.	.
cord-002369-shk4n8f6	46	31	1C	1C	NNP
cord-002369-shk4n8f6	46	32	)	)	-RRB-
cord-002369-shk4n8f6	46	33	,	,	,
cord-002369-shk4n8f6	46	34	as	as	RB
cord-002369-shk4n8f6	46	35	well	well	RB
cord-002369-shk4n8f6	46	36	as	as	IN
cord-002369-shk4n8f6	46	37	the	the	DT
cord-002369-shk4n8f6	46	38	viral	viral	JJ
cord-002369-shk4n8f6	46	39	RNA	RNA	NNP
cord-002369-shk4n8f6	46	40	level	level	NN
cord-002369-shk4n8f6	46	41	(	(	-LRB-
cord-002369-shk4n8f6	46	42	Fig	Fig	NNP
cord-002369-shk4n8f6	46	43	.	.	.
cord-002369-shk4n8f6	46	44	1D	1D	NNP
cord-002369-shk4n8f6	46	45	)	)	-RRB-
cord-002369-shk4n8f6	46	46	,	,	,
cord-002369-shk4n8f6	46	47	as	as	IN
cord-002369-shk4n8f6	46	48	compared	compare	VBN
cord-002369-shk4n8f6	46	49	with	with	IN
cord-002369-shk4n8f6	46	50	the	the	DT
cord-002369-shk4n8f6	46	51	levels	level	NNS
cord-002369-shk4n8f6	46	52	in	in	IN
cord-002369-shk4n8f6	46	53	mock	mock	NN
cord-002369-shk4n8f6	46	54	-	-	HYPH
cord-002369-shk4n8f6	46	55	treated	treat	VBN
cord-002369-shk4n8f6	46	56	cells	cell	NNS
cord-002369-shk4n8f6	46	57	.	.	.
cord-002369-shk4n8f6	47	1	The	the	DT
cord-002369-shk4n8f6	47	2	specificity	specificity	NN
cord-002369-shk4n8f6	47	3	of	of	IN
cord-002369-shk4n8f6	47	4	the	the	DT
cord-002369-shk4n8f6	47	5	effect	effect	NN
cord-002369-shk4n8f6	47	6	of	of	IN
cord-002369-shk4n8f6	47	7	ATG12DN	atg12dn	JJ
cord-002369-shk4n8f6	47	8	overexpression	overexpression	NN
cord-002369-shk4n8f6	47	9	was	be	VBD
cord-002369-shk4n8f6	47	10	assessed	assess	VBN
cord-002369-shk4n8f6	47	11	by	by	IN
cord-002369-shk4n8f6	47	12	trans	trans	NN
cord-002369-shk4n8f6	47	13	-	-	NN
cord-002369-shk4n8f6	47	14	complementation	complementation	NN
cord-002369-shk4n8f6	47	15	with	with	IN
cord-002369-shk4n8f6	47	16	wild	wild	JJ
cord-002369-shk4n8f6	47	17	-	-	HYPH
cord-002369-shk4n8f6	47	18	type	type	NN
cord-002369-shk4n8f6	47	19	ATG12	ATG12	NNP
cord-002369-shk4n8f6	47	20	.	.	.
cord-002369-shk4n8f6	48	1	As	as	IN
cord-002369-shk4n8f6	48	2	expected	expect	VBN
cord-002369-shk4n8f6	48	3	,	,	,
cord-002369-shk4n8f6	48	4	trans	trans	NN
cord-002369-shk4n8f6	48	5	-	-	NN
cord-002369-shk4n8f6	48	6	complementation	complementation	NN
cord-002369-shk4n8f6	48	7	with	with	IN
cord-002369-shk4n8f6	48	8	ATG12	ATG12	NNP
cord-002369-shk4n8f6	48	9	restored	restore	VBD
cord-002369-shk4n8f6	48	10	the	the	DT
cord-002369-shk4n8f6	48	11	normal	normal	JJ
cord-002369-shk4n8f6	48	12	level	level	NN
cord-002369-shk4n8f6	48	13	of	of	IN
cord-002369-shk4n8f6	48	14	replication	replication	NN
cord-002369-shk4n8f6	48	15	(	(	-LRB-
cord-002369-shk4n8f6	48	16	Fig	Fig	NNP
cord-002369-shk4n8f6	48	17	.	.	.
cord-002369-shk4n8f6	48	18	1C	1C	NNP
cord-002369-shk4n8f6	48	19	,	,	,
cord-002369-shk4n8f6	48	20	D	D	NNP
cord-002369-shk4n8f6	48	21	)	)	-RRB-
cord-002369-shk4n8f6	48	22	.	.	.
cord-002369-shk4n8f6	49	1	Altogether	altogether	RB
cord-002369-shk4n8f6	49	2	,	,	,
cord-002369-shk4n8f6	49	3	these	these	DT
cord-002369-shk4n8f6	49	4	results	result	NNS
cord-002369-shk4n8f6	49	5	suggest	suggest	VBP
cord-002369-shk4n8f6	49	6	that	that	IN
cord-002369-shk4n8f6	49	7	the	the	DT
cord-002369-shk4n8f6	49	8	ATG5	ATG5	NNP
cord-002369-shk4n8f6	49	9	-	-	HYPH
cord-002369-shk4n8f6	49	10	12	12	CD
cord-002369-shk4n8f6	49	11	conjugate	conjugate	NN
cord-002369-shk4n8f6	49	12	,	,	,
cord-002369-shk4n8f6	49	13	rather	rather	RB
cord-002369-shk4n8f6	49	14	than	than	IN
cord-002369-shk4n8f6	49	15	the	the	DT
cord-002369-shk4n8f6	49	16	monomeric	monomeric	JJ
cord-002369-shk4n8f6	49	17	form	form	NN
cord-002369-shk4n8f6	49	18	of	of	IN
cord-002369-shk4n8f6	49	19	the	the	DT
cord-002369-shk4n8f6	49	20	ATG5	ATG5	NNP
cord-002369-shk4n8f6	49	21	and	and	CC
cord-002369-shk4n8f6	49	22	ATG12	ATG12	NNP
cord-002369-shk4n8f6	49	23	proteins	protein	NNS
cord-002369-shk4n8f6	49	24	,	,	,
cord-002369-shk4n8f6	49	25	acts	act	VBZ
cord-002369-shk4n8f6	49	26	as	as	IN
cord-002369-shk4n8f6	49	27	an	an	DT
cord-002369-shk4n8f6	49	28	HCV	HCV	NNP
cord-002369-shk4n8f6	49	29	proviral	proviral	JJ
cord-002369-shk4n8f6	49	30	factor	factor	NN
cord-002369-shk4n8f6	49	31	.	.	.
cord-002369-shk4n8f6	50	1	The	the	DT
cord-002369-shk4n8f6	50	2	ATG5	ATG5	NNP
cord-002369-shk4n8f6	50	3	-	-	HYPH
cord-002369-shk4n8f6	50	4	12	12	CD
cord-002369-shk4n8f6	50	5	conjugate	conjugate	NN
cord-002369-shk4n8f6	50	6	is	be	VBZ
cord-002369-shk4n8f6	50	7	involved	involve	VBN
cord-002369-shk4n8f6	50	8	in	in	IN
cord-002369-shk4n8f6	50	9	the	the	DT
cord-002369-shk4n8f6	50	10	HCV	HCV	NNP
cord-002369-shk4n8f6	50	11	lifecycle	lifecycle	NN
cord-002369-shk4n8f6	50	12	at	at	IN
cord-002369-shk4n8f6	50	13	a	a	DT
cord-002369-shk4n8f6	50	14	post	post	JJ
cord-002369-shk4n8f6	50	15	-	-	JJ
cord-002369-shk4n8f6	50	16	translational	translational	JJ
cord-002369-shk4n8f6	50	17	step	step	NN
cord-002369-shk4n8f6	50	18	.	.	.
cord-002369-shk4n8f6	51	1	The	the	DT
cord-002369-shk4n8f6	51	2	conjugation	conjugation	NN
cord-002369-shk4n8f6	51	3	of	of	IN
cord-002369-shk4n8f6	51	4	ATG12	ATG12	NNP
cord-002369-shk4n8f6	51	5	to	to	IN
cord-002369-shk4n8f6	51	6	lysine	lysine	NN
cord-002369-shk4n8f6	51	7	130	130	CD
cord-002369-shk4n8f6	51	8	of	of	IN
cord-002369-shk4n8f6	51	9	ATG5	ATG5	NNP
cord-002369-shk4n8f6	51	10	is	be	VBZ
cord-002369-shk4n8f6	51	11	mediated	mediate	VBN
cord-002369-shk4n8f6	51	12	by	by	IN
cord-002369-shk4n8f6	51	13	ATG7	ATG7	NNP
cord-002369-shk4n8f6	51	14	,	,	,
cord-002369-shk4n8f6	51	15	an	an	DT
cord-002369-shk4n8f6	51	16	E1-like	E1-like	NNP
cord-002369-shk4n8f6	51	17	enzyme	enzyme	NN
cord-002369-shk4n8f6	51	18	,	,	,
cord-002369-shk4n8f6	51	19	thus	thus	RB
cord-002369-shk4n8f6	51	20	allowing	allow	VBG
cord-002369-shk4n8f6	51	21	the	the	DT
cord-002369-shk4n8f6	51	22	formation	formation	NN
cord-002369-shk4n8f6	51	23	of	of	IN
cord-002369-shk4n8f6	51	24	the	the	DT
cord-002369-shk4n8f6	51	25	ATG5	ATG5	NNP
cord-002369-shk4n8f6	51	26	-	-	HYPH
cord-002369-shk4n8f6	51	27	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	51	28	complex	complex	NN
cord-002369-shk4n8f6	51	29	.	.	.
cord-002369-shk4n8f6	52	1	A	a	DT
cord-002369-shk4n8f6	52	2	fraction	fraction	NN
cord-002369-shk4n8f6	52	3	of	of	IN
cord-002369-shk4n8f6	52	4	the	the	DT
cord-002369-shk4n8f6	52	5	ATG5	ATG5	NNP
cord-002369-shk4n8f6	52	6	-	-	HYPH
cord-002369-shk4n8f6	52	7	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	52	8	complex	complex	NN
cord-002369-shk4n8f6	52	9	localizes	localize	VBZ
cord-002369-shk4n8f6	52	10	to	to	IN
cord-002369-shk4n8f6	52	11	the	the	DT
cord-002369-shk4n8f6	52	12	isolation	isolation	NN
cord-002369-shk4n8f6	52	13	membrane	membrane	NN
cord-002369-shk4n8f6	52	14	,	,	,
cord-002369-shk4n8f6	52	15	where	where	WRB
cord-002369-shk4n8f6	52	16	it	-PRON-	PRP
cord-002369-shk4n8f6	52	17	facilitates	facilitate	VBZ
cord-002369-shk4n8f6	52	18	LC3	lc3	JJ
cord-002369-shk4n8f6	52	19	lipidation	lipidation	NN
cord-002369-shk4n8f6	52	20	.	.	.
cord-002369-shk4n8f6	53	1	Another	another	DT
cord-002369-shk4n8f6	53	2	role	role	NN
cord-002369-shk4n8f6	53	3	of	of	IN
cord-002369-shk4n8f6	53	4	ATG7	ATG7	NNP
cord-002369-shk4n8f6	53	5	,	,	,
cord-002369-shk4n8f6	53	6	along	along	IN
cord-002369-shk4n8f6	53	7	with	with	IN
cord-002369-shk4n8f6	53	8	ATG3	ATG3	NNP
cord-002369-shk4n8f6	53	9	,	,	,
cord-002369-shk4n8f6	53	10	an	an	DT
cord-002369-shk4n8f6	53	11	E2-like	e2-like	IN
cord-002369-shk4n8f6	53	12	enzyme	enzyme	NN
cord-002369-shk4n8f6	53	13	,	,	,
cord-002369-shk4n8f6	53	14	is	be	VBZ
cord-002369-shk4n8f6	53	15	to	to	TO
cord-002369-shk4n8f6	53	16	activate	activate	VB
cord-002369-shk4n8f6	53	17	LC3	LC3	NNP
cord-002369-shk4n8f6	53	18	after	after	IN
cord-002369-shk4n8f6	53	19	its	-PRON-	PRP$
cord-002369-shk4n8f6	53	20	processing	processing	NN
cord-002369-shk4n8f6	53	21	at	at	IN
cord-002369-shk4n8f6	53	22	the	the	DT
cord-002369-shk4n8f6	53	23	C	C	NNP
cord-002369-shk4n8f6	53	24	-	-	HYPH
cord-002369-shk4n8f6	53	25	terminus	terminus	NN
cord-002369-shk4n8f6	53	26	by	by	IN
cord-002369-shk4n8f6	53	27	ATG4B	atg4b	CD
cord-002369-shk4n8f6	53	28	,	,	,
cord-002369-shk4n8f6	53	29	thus	thus	RB
cord-002369-shk4n8f6	53	30	allowing	allow	VBG
cord-002369-shk4n8f6	53	31	its	-PRON-	PRP$
cord-002369-shk4n8f6	53	32	conjugation	conjugation	NN
cord-002369-shk4n8f6	53	33	to	to	IN
cord-002369-shk4n8f6	53	34	the	the	DT
cord-002369-shk4n8f6	53	35	amino	amino	NN
cord-002369-shk4n8f6	53	36	group	group	NN
cord-002369-shk4n8f6	53	37	of	of	IN
cord-002369-shk4n8f6	53	38	phosphatidylethanolamine	phosphatidylethanolamine	NNP
cord-002369-shk4n8f6	53	39	(	(	-LRB-
cord-002369-shk4n8f6	53	40	PE	PE	NNP
cord-002369-shk4n8f6	53	41	)	)	-RRB-
cord-002369-shk4n8f6	53	42	and	and	CC
cord-002369-shk4n8f6	53	43	formation	formation	NN
cord-002369-shk4n8f6	53	44	of	of	IN
cord-002369-shk4n8f6	53	45	the	the	DT
cord-002369-shk4n8f6	53	46	membrane	membrane	NN
cord-002369-shk4n8f6	53	47	-	-	HYPH
cord-002369-shk4n8f6	53	48	associated	associate	VBN
cord-002369-shk4n8f6	53	49	LC3-II	lc3-ii	NN
cord-002369-shk4n8f6	53	50	,	,	,
cord-002369-shk4n8f6	53	51	which	which	WDT
cord-002369-shk4n8f6	53	52	assists	assist	VBZ
cord-002369-shk4n8f6	53	53	in	in	IN
cord-002369-shk4n8f6	53	54	the	the	DT
cord-002369-shk4n8f6	53	55	expansion	expansion	NN
cord-002369-shk4n8f6	53	56	and	and	CC
cord-002369-shk4n8f6	53	57	closure	closure	NN
cord-002369-shk4n8f6	53	58	of	of	IN
cord-002369-shk4n8f6	53	59	the	the	DT
cord-002369-shk4n8f6	53	60	autophagosome	autophagosome	JJ
cord-002369-shk4n8f6	53	61	40	40	CD
cord-002369-shk4n8f6	53	62	,	,	,
cord-002369-shk4n8f6	53	63	41	41	CD
cord-002369-shk4n8f6	53	64	.	.	.
cord-002369-shk4n8f6	54	1	Therefore	therefore	RB
cord-002369-shk4n8f6	54	2	,	,	,
cord-002369-shk4n8f6	54	3	silencing	silence	VBG
cord-002369-shk4n8f6	54	4	of	of	IN
cord-002369-shk4n8f6	54	5	ATG7	ATG7	NNP
cord-002369-shk4n8f6	54	6	allows	allow	VBZ
cord-002369-shk4n8f6	54	7	the	the	DT
cord-002369-shk4n8f6	54	8	inhibition	inhibition	NN
cord-002369-shk4n8f6	54	9	of	of	IN
cord-002369-shk4n8f6	54	10	LC3-II	lc3-ii	NN
cord-002369-shk4n8f6	54	11	and	and	CC
cord-002369-shk4n8f6	54	12	ATG5	ATG5	NNP
cord-002369-shk4n8f6	54	13	-	-	HYPH
cord-002369-shk4n8f6	54	14	12	12	CD
cord-002369-shk4n8f6	54	15	conjugation	conjugation	NN
cord-002369-shk4n8f6	54	16	(	(	-LRB-
cord-002369-shk4n8f6	54	17	Fig	Fig	NNP
cord-002369-shk4n8f6	54	18	.	.	.
cord-002369-shk4n8f6	54	19	2B	2b	CD
cord-002369-shk4n8f6	54	20	)	)	-RRB-
cord-002369-shk4n8f6	54	21	.	.	.
cord-002369-shk4n8f6	55	1	Thus	thus	RB
cord-002369-shk4n8f6	55	2	,	,	,
cord-002369-shk4n8f6	55	3	by	by	IN
cord-002369-shk4n8f6	55	4	silencing	silence	VBG
cord-002369-shk4n8f6	55	5	LC3	lc3	NN
cord-002369-shk4n8f6	55	6	,	,	,
cord-002369-shk4n8f6	55	7	ATG7	ATG7	NNP
cord-002369-shk4n8f6	55	8	or	or	CC
cord-002369-shk4n8f6	55	9	ATG12	ATG12	NNP
cord-002369-shk4n8f6	55	10	,	,	,
cord-002369-shk4n8f6	55	11	we	-PRON-	PRP
cord-002369-shk4n8f6	55	12	were	be	VBD
cord-002369-shk4n8f6	55	13	able	able	JJ
cord-002369-shk4n8f6	55	14	to	to	TO
cord-002369-shk4n8f6	55	15	analyze	analyze	VB
cord-002369-shk4n8f6	55	16	the	the	DT
cord-002369-shk4n8f6	55	17	independent	independent	JJ
cord-002369-shk4n8f6	55	18	contributions	contribution	NNS
cord-002369-shk4n8f6	55	19	of	of	IN
cord-002369-shk4n8f6	55	20	the	the	DT
cord-002369-shk4n8f6	55	21	two	two	CD
cord-002369-shk4n8f6	55	22	autophagy	autophagy	NN
cord-002369-shk4n8f6	55	23	conjugation	conjugation	NN
cord-002369-shk4n8f6	55	24	systems	system	NNS
cord-002369-shk4n8f6	55	25	in	in	IN
cord-002369-shk4n8f6	55	26	the	the	DT
cord-002369-shk4n8f6	55	27	HCV	HCV	NNP
cord-002369-shk4n8f6	55	28	lifecycle	lifecycle	NN
cord-002369-shk4n8f6	55	29	.	.	.
cord-002369-shk4n8f6	56	1	For	for	IN
cord-002369-shk4n8f6	56	2	this	this	DT
cord-002369-shk4n8f6	56	3	purpose	purpose	NN
cord-002369-shk4n8f6	56	4	,	,	,
cord-002369-shk4n8f6	56	5	we	-PRON-	PRP
cord-002369-shk4n8f6	56	6	first	first	RB
cord-002369-shk4n8f6	56	7	determined	determine	VBD
cord-002369-shk4n8f6	56	8	the	the	DT
cord-002369-shk4n8f6	56	9	efficiency	efficiency	NN
cord-002369-shk4n8f6	56	10	of	of	IN
cord-002369-shk4n8f6	56	11	the	the	DT
cord-002369-shk4n8f6	56	12	selected	select	VBN
cord-002369-shk4n8f6	56	13	siRNA	siRNA	NNP
cord-002369-shk4n8f6	56	14	to	to	TO
cord-002369-shk4n8f6	56	15	knock	knock	VB
cord-002369-shk4n8f6	56	16	down	down	RP
cord-002369-shk4n8f6	56	17	their	-PRON-	PRP$
cord-002369-shk4n8f6	56	18	respective	respective	JJ
cord-002369-shk4n8f6	56	19	targets	target	NNS
cord-002369-shk4n8f6	56	20	(	(	-LRB-
cord-002369-shk4n8f6	56	21	Fig	Fig	NNP
cord-002369-shk4n8f6	56	22	.	.	.
cord-002369-shk4n8f6	56	23	2A	2a	CD
cord-002369-shk4n8f6	56	24	,	,	,
cord-002369-shk4n8f6	56	25	B	B	NNP
cord-002369-shk4n8f6	56	26	,	,	,
cord-002369-shk4n8f6	56	27	C	C	NNP
cord-002369-shk4n8f6	56	28	)	)	-RRB-
cord-002369-shk4n8f6	56	29	.	.	.
cord-002369-shk4n8f6	57	1	We	-PRON-	PRP
cord-002369-shk4n8f6	57	2	then	then	RB
cord-002369-shk4n8f6	57	3	analyzed	analyze	VBD
cord-002369-shk4n8f6	57	4	the	the	DT
cord-002369-shk4n8f6	57	5	effects	effect	NNS
cord-002369-shk4n8f6	57	6	of	of	IN
cord-002369-shk4n8f6	57	7	the	the	DT
cord-002369-shk4n8f6	57	8	silencing	silencing	NN
cord-002369-shk4n8f6	57	9	of	of	IN
cord-002369-shk4n8f6	57	10	ATG12	ATG12	NNP
cord-002369-shk4n8f6	57	11	,	,	,
cord-002369-shk4n8f6	57	12	LC3	lc3	NN
cord-002369-shk4n8f6	57	13	or	or	CC
cord-002369-shk4n8f6	57	14	ATG7	ATG7	NNP
cord-002369-shk4n8f6	57	15	on	on	IN
cord-002369-shk4n8f6	57	16	HCV	HCV	NNP
cord-002369-shk4n8f6	57	17	entry	entry	NN
cord-002369-shk4n8f6	57	18	,	,	,
cord-002369-shk4n8f6	57	19	viral	viral	JJ
cord-002369-shk4n8f6	57	20	RNA	RNA	NNP
cord-002369-shk4n8f6	57	21	translation	translation	NN
cord-002369-shk4n8f6	57	22	/	/	SYM
cord-002369-shk4n8f6	57	23	replication	replication	NN
cord-002369-shk4n8f6	57	24	and	and	CC
cord-002369-shk4n8f6	57	25	virion	virion	NN
cord-002369-shk4n8f6	57	26	maturation	maturation	NN
cord-002369-shk4n8f6	57	27	and	and	CC
cord-002369-shk4n8f6	57	28	secretion	secretion	NN
cord-002369-shk4n8f6	57	29	.	.	.
cord-002369-shk4n8f6	58	1	As	as	IN
cord-002369-shk4n8f6	58	2	shown	show	VBN
cord-002369-shk4n8f6	58	3	in	in	IN
cord-002369-shk4n8f6	58	4	Fig	Fig	NNP
cord-002369-shk4n8f6	58	5	.	.	.
cord-002369-shk4n8f6	59	1	2D	2D	NNP
cord-002369-shk4n8f6	59	2	,	,	,
cord-002369-shk4n8f6	59	3	Huh7	Huh7	NNP
cord-002369-shk4n8f6	59	4	infection	infection	NN
cord-002369-shk4n8f6	59	5	by	by	IN
cord-002369-shk4n8f6	59	6	HCVpp	HCVpp	NNP
cord-002369-shk4n8f6	59	7	was	be	VBD
cord-002369-shk4n8f6	59	8	not	not	RB
cord-002369-shk4n8f6	59	9	altered	alter	VBN
cord-002369-shk4n8f6	59	10	in	in	IN
cord-002369-shk4n8f6	59	11	cells	cell	NNS
cord-002369-shk4n8f6	59	12	treated	treat	VBN
cord-002369-shk4n8f6	59	13	with	with	IN
cord-002369-shk4n8f6	59	14	siRNA	siRNA	NNP
cord-002369-shk4n8f6	59	15	against	against	IN
cord-002369-shk4n8f6	59	16	LC3	LC3	NNP
cord-002369-shk4n8f6	59	17	,	,	,
cord-002369-shk4n8f6	59	18	ATG7	ATG7	NNP
cord-002369-shk4n8f6	59	19	or	or	CC
cord-002369-shk4n8f6	59	20	ATG12	ATG12	NNP
cord-002369-shk4n8f6	59	21	,	,	,
cord-002369-shk4n8f6	59	22	thus	thus	RB
cord-002369-shk4n8f6	59	23	suggesting	suggest	VBG
cord-002369-shk4n8f6	59	24	that	that	IN
cord-002369-shk4n8f6	59	25	neither	neither	CC
cord-002369-shk4n8f6	59	26	LC3	lc3	NN
cord-002369-shk4n8f6	59	27	nor	nor	CC
cord-002369-shk4n8f6	59	28	the	the	DT
cord-002369-shk4n8f6	59	29	ATG5	ATG5	NNP
cord-002369-shk4n8f6	59	30	-	-	HYPH
cord-002369-shk4n8f6	59	31	12	12	CD
cord-002369-shk4n8f6	59	32	conjugate	conjugate	NN
cord-002369-shk4n8f6	59	33	is	be	VBZ
cord-002369-shk4n8f6	59	34	involved	involve	VBN
cord-002369-shk4n8f6	59	35	in	in	IN
cord-002369-shk4n8f6	59	36	viral	viral	JJ
cord-002369-shk4n8f6	59	37	entry	entry	NN
cord-002369-shk4n8f6	59	38	.	.	.
cord-002369-shk4n8f6	60	1	Previously	previously	RB
cord-002369-shk4n8f6	60	2	,	,	,
cord-002369-shk4n8f6	60	3	Dreux	Dreux	NNP
cord-002369-shk4n8f6	60	4	and	and	CC
cord-002369-shk4n8f6	60	5	colleagues	colleague	NNS
cord-002369-shk4n8f6	60	6	have	have	VBP
cord-002369-shk4n8f6	60	7	reported	report	VBN
cord-002369-shk4n8f6	60	8	that	that	IN
cord-002369-shk4n8f6	60	9	HCV	HCV	NNP
cord-002369-shk4n8f6	60	10	RNA	RNA	NNP
cord-002369-shk4n8f6	60	11	translation	translation	NN
cord-002369-shk4n8f6	60	12	is	be	VBZ
cord-002369-shk4n8f6	60	13	affected	affect	VBN
cord-002369-shk4n8f6	60	14	by	by	IN
cord-002369-shk4n8f6	60	15	inhibition	inhibition	NN
cord-002369-shk4n8f6	60	16	of	of	IN
cord-002369-shk4n8f6	60	17	LC3	LC3	NNP
cord-002369-shk4n8f6	60	18	conjugation	conjugation	NN
cord-002369-shk4n8f6	60	19	using	use	VBG
cord-002369-shk4n8f6	60	20	siRNA	siRNA	NNP
cord-002369-shk4n8f6	60	21	against	against	IN
cord-002369-shk4n8f6	60	22	ATG4B.	ATG4B.	NNP
cord-002369-shk4n8f6	61	1	In	in	IN
cord-002369-shk4n8f6	61	2	that	that	DT
cord-002369-shk4n8f6	61	3	report	report	NN
cord-002369-shk4n8f6	61	4	,	,	,
cord-002369-shk4n8f6	61	5	the	the	DT
cord-002369-shk4n8f6	61	6	authors	author	NNS
cord-002369-shk4n8f6	61	7	followed	follow	VBD
cord-002369-shk4n8f6	61	8	the	the	DT
cord-002369-shk4n8f6	61	9	luciferase	luciferase	NN
cord-002369-shk4n8f6	61	10	activity	activity	NN
cord-002369-shk4n8f6	61	11	expressed	express	VBN
cord-002369-shk4n8f6	61	12	from	from	IN
cord-002369-shk4n8f6	61	13	a	a	DT
cord-002369-shk4n8f6	61	14	replication	replication	NN
cord-002369-shk4n8f6	61	15	-	-	HYPH
cord-002369-shk4n8f6	61	16	defective	defective	JJ
cord-002369-shk4n8f6	61	17	subgenomic	subgenomic	JJ
cord-002369-shk4n8f6	61	18	replicon	replicon	NNP
cord-002369-shk4n8f6	61	19	RLuc	RLuc	NNP
cord-002369-shk4n8f6	61	20	/	/	SYM
cord-002369-shk4n8f6	61	21	SGR	SGR	NNP
cord-002369-shk4n8f6	61	22	harboring	harbor	VBG
cord-002369-shk4n8f6	61	23	an	an	DT
cord-002369-shk4n8f6	61	24	inactivation	inactivation	NN
cord-002369-shk4n8f6	61	25	mutation	mutation	NN
cord-002369-shk4n8f6	61	26	(	(	-LRB-
cord-002369-shk4n8f6	61	27	GDD	GDD	NNP
cord-002369-shk4n8f6	61	28	to	to	IN
cord-002369-shk4n8f6	61	29	GND	GND	NNP
cord-002369-shk4n8f6	61	30	)	)	-RRB-
cord-002369-shk4n8f6	61	31	at	at	IN
cord-002369-shk4n8f6	61	32	the	the	DT
cord-002369-shk4n8f6	61	33	active	active	JJ
cord-002369-shk4n8f6	61	34	site	site	NN
cord-002369-shk4n8f6	61	35	of	of	IN
cord-002369-shk4n8f6	61	36	the	the	DT
cord-002369-shk4n8f6	61	37	HCV	HCV	NNP
cord-002369-shk4n8f6	61	38	polymerase	polymerase	NN
cord-002369-shk4n8f6	62	1	NS5B	NS5B	NNPS
cord-002369-shk4n8f6	63	1	(	(	-LRB-
cord-002369-shk4n8f6	63	2	RLuc	RLuc	NNP
cord-002369-shk4n8f6	63	3	/	/	SYM
cord-002369-shk4n8f6	63	4	SGR	SGR	NNP
cord-002369-shk4n8f6	63	5	-	-	HYPH
cord-002369-shk4n8f6	63	6	GND	GND	NNP
cord-002369-shk4n8f6	63	7	)	)	-RRB-
cord-002369-shk4n8f6	63	8	31	31	CD
cord-002369-shk4n8f6	63	9	.	.	.
cord-002369-shk4n8f6	64	1	Using	use	VBG
cord-002369-shk4n8f6	64	2	a	a	DT
cord-002369-shk4n8f6	64	3	similar	similar	JJ
cord-002369-shk4n8f6	64	4	approach	approach	NN
cord-002369-shk4n8f6	64	5	,	,	,
cord-002369-shk4n8f6	64	6	we	-PRON-	PRP
cord-002369-shk4n8f6	64	7	evaluated	evaluate	VBD
cord-002369-shk4n8f6	64	8	the	the	DT
cord-002369-shk4n8f6	64	9	effects	effect	NNS
cord-002369-shk4n8f6	64	10	of	of	IN
cord-002369-shk4n8f6	64	11	LC3	lc3	NN
cord-002369-shk4n8f6	64	12	,	,	,
cord-002369-shk4n8f6	64	13	ATG7	ATG7	NNP
cord-002369-shk4n8f6	64	14	and	and	CC
cord-002369-shk4n8f6	64	15	ATG12	ATG12	NNP
cord-002369-shk4n8f6	64	16	silencing	silence	VBG
cord-002369-shk4n8f6	64	17	on	on	IN
cord-002369-shk4n8f6	64	18	viral	viral	JJ
cord-002369-shk4n8f6	64	19	RNA	RNA	NNP
cord-002369-shk4n8f6	64	20	translation	translation	NN
cord-002369-shk4n8f6	64	21	and/or	and/or	CC
cord-002369-shk4n8f6	64	22	replication	replication	NN
cord-002369-shk4n8f6	64	23	.	.	.
cord-002369-shk4n8f6	65	1	We	-PRON-	PRP
cord-002369-shk4n8f6	65	2	used	use	VBD
cord-002369-shk4n8f6	65	3	full	full	JJ
cord-002369-shk4n8f6	65	4	-	-	HYPH
cord-002369-shk4n8f6	65	5	length	length	NN
cord-002369-shk4n8f6	65	6	HCV	HCV	NNP
cord-002369-shk4n8f6	65	7	JFH1	JFH1	NNP
cord-002369-shk4n8f6	65	8	RNA	RNA	NNP
cord-002369-shk4n8f6	65	9	with	with	IN
cord-002369-shk4n8f6	65	10	a	a	DT
cord-002369-shk4n8f6	65	11	firefly	firefly	NN
cord-002369-shk4n8f6	65	12	luciferase	luciferase	NN
cord-002369-shk4n8f6	65	13	reporter	reporter	NN
cord-002369-shk4n8f6	65	14	containing	contain	VBG
cord-002369-shk4n8f6	65	15	the	the	DT
cord-002369-shk4n8f6	65	16	GND	GND	NNP
cord-002369-shk4n8f6	65	17	mutation	mutation	NN
cord-002369-shk4n8f6	65	18	in	in	IN
cord-002369-shk4n8f6	65	19	the	the	DT
cord-002369-shk4n8f6	65	20	active	active	JJ
cord-002369-shk4n8f6	65	21	site	site	NN
cord-002369-shk4n8f6	65	22	of	of	IN
cord-002369-shk4n8f6	65	23	NS5B	NS5B	NNP
cord-002369-shk4n8f6	66	1	(	(	-LRB-
cord-002369-shk4n8f6	66	2	JFH1	JFH1	NNP
cord-002369-shk4n8f6	66	3	/	/	SYM
cord-002369-shk4n8f6	66	4	Fluc	Fluc	NNP
cord-002369-shk4n8f6	66	5	-	-	HYPH
cord-002369-shk4n8f6	66	6	GND	GND	NNP
cord-002369-shk4n8f6	66	7	)	)	-RRB-
cord-002369-shk4n8f6	66	8	and	and	CC
cord-002369-shk4n8f6	66	9	then	then	RB
cord-002369-shk4n8f6	66	10	analyzed	analyze	VBD
cord-002369-shk4n8f6	66	11	the	the	DT
cord-002369-shk4n8f6	66	12	Fluc	Fluc	NNP
cord-002369-shk4n8f6	66	13	activity	activity	NN
cord-002369-shk4n8f6	66	14	expressed	express	VBN
cord-002369-shk4n8f6	66	15	from	from	IN
cord-002369-shk4n8f6	66	16	the	the	DT
cord-002369-shk4n8f6	66	17	HCV	HCV	NNP
cord-002369-shk4n8f6	66	18	internal	internal	JJ
cord-002369-shk4n8f6	66	19	ribosomal	ribosomal	NN
cord-002369-shk4n8f6	66	20	entry	entry	NN
cord-002369-shk4n8f6	66	21	site	site	NN
cord-002369-shk4n8f6	66	22	(	(	-LRB-
cord-002369-shk4n8f6	66	23	IRES	IRES	NNP
cord-002369-shk4n8f6	66	24	)	)	-RRB-
cord-002369-shk4n8f6	66	25	.	.	.
cord-002369-shk4n8f6	67	1	A	a	DT
cord-002369-shk4n8f6	67	2	significant	significant	JJ
cord-002369-shk4n8f6	67	3	decrease	decrease	NN
cord-002369-shk4n8f6	67	4	in	in	IN
cord-002369-shk4n8f6	67	5	luciferase	luciferase	NN
cord-002369-shk4n8f6	67	6	activity	activity	NN
cord-002369-shk4n8f6	67	7	(	(	-LRB-
cord-002369-shk4n8f6	67	8	>	>	NFP
cord-002369-shk4n8f6	67	9	80	80	CD
cord-002369-shk4n8f6	67	10	%	%	NN
cord-002369-shk4n8f6	67	11	)	)	-RRB-
cord-002369-shk4n8f6	67	12	was	be	VBD
cord-002369-shk4n8f6	67	13	observed	observe	VBN
cord-002369-shk4n8f6	67	14	in	in	IN
cord-002369-shk4n8f6	67	15	JFH1	JFH1	NNP
cord-002369-shk4n8f6	67	16	/	/	SYM
cord-002369-shk4n8f6	67	17	Fluc	Fluc	NNP
cord-002369-shk4n8f6	67	18	-	-	HYPH
cord-002369-shk4n8f6	67	19	GND	GND	NNP
cord-002369-shk4n8f6	67	20	-	-	HYPH
cord-002369-shk4n8f6	67	21	transfected	transfecte	VBN
cord-002369-shk4n8f6	67	22	cells	cell	NNS
cord-002369-shk4n8f6	67	23	pretreated	pretreate	VBN
cord-002369-shk4n8f6	67	24	with	with	IN
cord-002369-shk4n8f6	67	25	siLC3	siLC3	NNP
cord-002369-shk4n8f6	67	26	(	(	-LRB-
cord-002369-shk4n8f6	67	27	Fig	Fig	NNP
cord-002369-shk4n8f6	67	28	.	.	.
cord-002369-shk4n8f6	67	29	2E	2E	NNP
cord-002369-shk4n8f6	67	30	)	)	-RRB-
cord-002369-shk4n8f6	67	31	.	.	.
cord-002369-shk4n8f6	68	1	Silencing	silencing	NN
cord-002369-shk4n8f6	68	2	of	of	IN
cord-002369-shk4n8f6	68	3	ATG7	ATG7	NNP
cord-002369-shk4n8f6	68	4	,	,	,
cord-002369-shk4n8f6	68	5	which	which	WDT
cord-002369-shk4n8f6	68	6	inhibits	inhibit	VBZ
cord-002369-shk4n8f6	68	7	LC3-II	lc3-ii	NN
cord-002369-shk4n8f6	68	8	formation	formation	NN
cord-002369-shk4n8f6	68	9	as	as	RB
cord-002369-shk4n8f6	68	10	well	well	RB
cord-002369-shk4n8f6	68	11	as	as	IN
cord-002369-shk4n8f6	68	12	ATG5	ATG5	NNP
cord-002369-shk4n8f6	68	13	-	-	HYPH
cord-002369-shk4n8f6	68	14	12	12	CD
cord-002369-shk4n8f6	68	15	conjugation	conjugation	NN
cord-002369-shk4n8f6	68	16	,	,	,
cord-002369-shk4n8f6	68	17	decreased	decrease	VBD
cord-002369-shk4n8f6	68	18	viral	viral	JJ
cord-002369-shk4n8f6	68	19	translation	translation	NN
cord-002369-shk4n8f6	68	20	by	by	IN
cord-002369-shk4n8f6	68	21	50	50	CD
cord-002369-shk4n8f6	68	22	%	%	NN
cord-002369-shk4n8f6	68	23	.	.	.
cord-002369-shk4n8f6	69	1	This	this	DT
cord-002369-shk4n8f6	69	2	effect	effect	NN
cord-002369-shk4n8f6	69	3	probably	probably	RB
cord-002369-shk4n8f6	69	4	occurred	occur	VBD
cord-002369-shk4n8f6	69	5	through	through	IN
cord-002369-shk4n8f6	69	6	the	the	DT
cord-002369-shk4n8f6	69	7	inhibition	inhibition	NN
cord-002369-shk4n8f6	69	8	of	of	IN
cord-002369-shk4n8f6	69	9	LC3-II	lc3-ii	NN
cord-002369-shk4n8f6	69	10	conjugation	conjugation	NN
cord-002369-shk4n8f6	69	11	,	,	,
cord-002369-shk4n8f6	69	12	because	because	IN
cord-002369-shk4n8f6	69	13	silencing	silencing	NN
cord-002369-shk4n8f6	69	14	of	of	IN
cord-002369-shk4n8f6	69	15	ATG12	atg12	JJ
cord-002369-shk4n8f6	69	16	expression	expression	NN
cord-002369-shk4n8f6	69	17	was	be	VBD
cord-002369-shk4n8f6	69	18	much	much	RB
cord-002369-shk4n8f6	69	19	less	less	RBR
cord-002369-shk4n8f6	69	20	efficient	efficient	JJ
cord-002369-shk4n8f6	69	21	than	than	IN
cord-002369-shk4n8f6	69	22	LC3	lc3	JJ
cord-002369-shk4n8f6	69	23	silencing	silencing	NN
cord-002369-shk4n8f6	69	24	at	at	IN
cord-002369-shk4n8f6	69	25	inhibiting	inhibit	VBG
cord-002369-shk4n8f6	69	26	viral	viral	JJ
cord-002369-shk4n8f6	69	27	RNA	RNA	NNP
cord-002369-shk4n8f6	69	28	translation	translation	NN
cord-002369-shk4n8f6	69	29	(	(	-LRB-
cord-002369-shk4n8f6	69	30	Fig	Fig	NNP
cord-002369-shk4n8f6	69	31	.	.	.
cord-002369-shk4n8f6	69	32	2E	2E	NNP
cord-002369-shk4n8f6	69	33	)	)	-RRB-
cord-002369-shk4n8f6	69	34	.	.	.
cord-002369-shk4n8f6	70	1	In	in	IN
cord-002369-shk4n8f6	70	2	contrast	contrast	NN
cord-002369-shk4n8f6	70	3	,	,	,
cord-002369-shk4n8f6	70	4	silencing	silence	VBG
cord-002369-shk4n8f6	70	5	of	of	IN
cord-002369-shk4n8f6	70	6	ATG12	ATG12	NNP
cord-002369-shk4n8f6	70	7	severely	severely	RB
cord-002369-shk4n8f6	70	8	affected	affect	VBD
cord-002369-shk4n8f6	70	9	the	the	DT
cord-002369-shk4n8f6	70	10	luciferase	luciferase	NN
cord-002369-shk4n8f6	70	11	activity	activity	NN
cord-002369-shk4n8f6	70	12	of	of	IN
cord-002369-shk4n8f6	70	13	a	a	DT
cord-002369-shk4n8f6	70	14	replication	replication	NN
cord-002369-shk4n8f6	70	15	competent	competent	JJ
cord-002369-shk4n8f6	70	16	JFH1	JFH1	NNP
cord-002369-shk4n8f6	70	17	/	/	SYM
cord-002369-shk4n8f6	70	18	Fluc	Fluc	NNP
cord-002369-shk4n8f6	70	19	wild	wild	JJ
cord-002369-shk4n8f6	70	20	-	-	HYPH
cord-002369-shk4n8f6	70	21	type	type	NN
cord-002369-shk4n8f6	70	22	virus	virus	NN
cord-002369-shk4n8f6	70	23	.	.	.
cord-002369-shk4n8f6	71	1	The	the	DT
cord-002369-shk4n8f6	71	2	effect	effect	NN
cord-002369-shk4n8f6	71	3	on	on	IN
cord-002369-shk4n8f6	71	4	replication	replication	NN
cord-002369-shk4n8f6	71	5	was	be	VBD
cord-002369-shk4n8f6	71	6	not	not	RB
cord-002369-shk4n8f6	71	7	due	due	JJ
cord-002369-shk4n8f6	71	8	to	to	IN
cord-002369-shk4n8f6	71	9	the	the	DT
cord-002369-shk4n8f6	71	10	toxicity	toxicity	NN
cord-002369-shk4n8f6	71	11	of	of	IN
cord-002369-shk4n8f6	71	12	siRNA	siRNA	NNP
cord-002369-shk4n8f6	71	13	treatment	treatment	NN
cord-002369-shk4n8f6	71	14	(	(	-LRB-
cord-002369-shk4n8f6	71	15	Fig	Fig	NNP
cord-002369-shk4n8f6	71	16	.	.	.
cord-002369-shk4n8f6	71	17	S1	S1	NNP
cord-002369-shk4n8f6	71	18	)	)	-RRB-
cord-002369-shk4n8f6	71	19	,	,	,
cord-002369-shk4n8f6	71	20	thus	thus	RB
cord-002369-shk4n8f6	71	21	suggesting	suggest	VBG
cord-002369-shk4n8f6	71	22	that	that	IN
cord-002369-shk4n8f6	71	23	the	the	DT
cord-002369-shk4n8f6	71	24	ATG5	ATG5	NNP
cord-002369-shk4n8f6	71	25	-	-	HYPH
cord-002369-shk4n8f6	71	26	12	12	CD
cord-002369-shk4n8f6	71	27	conjugate	conjugate	NN
cord-002369-shk4n8f6	71	28	is	be	VBZ
cord-002369-shk4n8f6	71	29	involved	involve	VBN
cord-002369-shk4n8f6	71	30	in	in	IN
cord-002369-shk4n8f6	71	31	an	an	DT
cord-002369-shk4n8f6	71	32	HCV	HCV	NNP
cord-002369-shk4n8f6	71	33	lifecycle	lifecycle	NN
cord-002369-shk4n8f6	71	34	step(s	step(s	NNP
cord-002369-shk4n8f6	71	35	)	)	-RRB-
cord-002369-shk4n8f6	71	36	beyond	beyond	IN
cord-002369-shk4n8f6	71	37	entry	entry	NN
cord-002369-shk4n8f6	71	38	and	and	CC
cord-002369-shk4n8f6	71	39	RNA	RNA	NNP
cord-002369-shk4n8f6	71	40	translation	translation	NN
cord-002369-shk4n8f6	72	1	(	(	-LRB-
cord-002369-shk4n8f6	72	2	Fig	Fig	NNP
cord-002369-shk4n8f6	72	3	.	.	.
cord-002369-shk4n8f6	72	4	2E	2E	NNP
cord-002369-shk4n8f6	72	5	)	)	-RRB-
cord-002369-shk4n8f6	72	6	,	,	,
cord-002369-shk4n8f6	72	7	whereas	whereas	IN
cord-002369-shk4n8f6	72	8	LC3	lc3	JJ
cord-002369-shk4n8f6	72	9	expression	expression	NN
cord-002369-shk4n8f6	72	10	and/or	and/or	CC
cord-002369-shk4n8f6	72	11	conjugation	conjugation	NN
cord-002369-shk4n8f6	72	12	is	be	VBZ
cord-002369-shk4n8f6	72	13	primarily	primarily	RB
cord-002369-shk4n8f6	72	14	important	important	JJ
cord-002369-shk4n8f6	72	15	for	for	IN
cord-002369-shk4n8f6	72	16	viral	viral	JJ
cord-002369-shk4n8f6	72	17	translation	translation	NN
cord-002369-shk4n8f6	72	18	,	,	,
cord-002369-shk4n8f6	72	19	as	as	IN
cord-002369-shk4n8f6	72	20	previously	previously	RB
cord-002369-shk4n8f6	72	21	suggested	suggest	VBN
cord-002369-shk4n8f6	72	22	31	31	CD
cord-002369-shk4n8f6	72	23	.	.	.
cord-002369-shk4n8f6	73	1	assessed	assess	VBN
cord-002369-shk4n8f6	73	2	by	by	IN
cord-002369-shk4n8f6	73	3	western	western	JJ
cord-002369-shk4n8f6	73	4	blotting	blotting	NN
cord-002369-shk4n8f6	73	5	in	in	IN
cord-002369-shk4n8f6	73	6	mock	mock	JJ
cord-002369-shk4n8f6	73	7	(	(	-LRB-
cord-002369-shk4n8f6	73	8	UI	UI	NNP
cord-002369-shk4n8f6	73	9	)	)	-RRB-
cord-002369-shk4n8f6	73	10	or	or	CC
cord-002369-shk4n8f6	73	11	Huh7	Huh7	NNP
cord-002369-shk4n8f6	73	12	cells	cell	NNS
cord-002369-shk4n8f6	73	13	infected	infect	VBN
cord-002369-shk4n8f6	73	14	at	at	IN
cord-002369-shk4n8f6	73	15	more	more	JJR
cord-002369-shk4n8f6	73	16	than	than	IN
cord-002369-shk4n8f6	73	17	90	90	CD
cord-002369-shk4n8f6	73	18	%	%	NN
cord-002369-shk4n8f6	73	19	with	with	IN
cord-002369-shk4n8f6	73	20	JFH1	JFH1	NNP
cord-002369-shk4n8f6	73	21	using	use	VBG
cord-002369-shk4n8f6	73	22	specific	specific	JJ
cord-002369-shk4n8f6	73	23	anti	anti	JJ
cord-002369-shk4n8f6	73	24	-	-	JJ
cord-002369-shk4n8f6	73	25	ATG5	atg5	JJ
cord-002369-shk4n8f6	73	26	antibody	antibody	NN
cord-002369-shk4n8f6	73	27	.	.	.
cord-002369-shk4n8f6	74	1	HCV	HCV	NNP
cord-002369-shk4n8f6	74	2	infection	infection	NN
cord-002369-shk4n8f6	74	3	and	and	CC
cord-002369-shk4n8f6	74	4	LC3	lc3	NN
cord-002369-shk4n8f6	74	5	lipidation	lipidation	NN
cord-002369-shk4n8f6	74	6	were	be	VBD
cord-002369-shk4n8f6	74	7	detected	detect	VBN
cord-002369-shk4n8f6	74	8	using	use	VBG
cord-002369-shk4n8f6	74	9	anti	anti	JJ
cord-002369-shk4n8f6	74	10	-	-	JJ
cord-002369-shk4n8f6	74	11	NS3	ns3	JJ
cord-002369-shk4n8f6	74	12	and	and	CC
cord-002369-shk4n8f6	74	13	anti	anti	JJ
cord-002369-shk4n8f6	74	14	-	-	JJ
cord-002369-shk4n8f6	74	15	LC3	lc3	JJ
cord-002369-shk4n8f6	74	16	antibodies	antibody	NNS
cord-002369-shk4n8f6	74	17	,	,	,
cord-002369-shk4n8f6	74	18	respectively	respectively	RB
cord-002369-shk4n8f6	74	19	.	.	.
cord-002369-shk4n8f6	75	1	β	β	LS
cord-002369-shk4n8f6	75	2	-actin	-actin	NNP
cord-002369-shk4n8f6	75	3	represents	represent	VBZ
cord-002369-shk4n8f6	75	4	loading	loading	NN
cord-002369-shk4n8f6	75	5	control	control	NN
cord-002369-shk4n8f6	75	6	.	.	.
cord-002369-shk4n8f6	76	1	(	(	-LRB-
cord-002369-shk4n8f6	76	2	B	b	NN
cord-002369-shk4n8f6	76	3	)	)	-RRB-
cord-002369-shk4n8f6	76	4	Uninfected	uninfected	JJ
cord-002369-shk4n8f6	76	5	or	or	CC
cord-002369-shk4n8f6	76	6	JFH1-infected	JFH1-infected	NNP
cord-002369-shk4n8f6	76	7	Huh7	Huh7	NNP
cord-002369-shk4n8f6	76	8	cells	cell	NNS
cord-002369-shk4n8f6	76	9	at	at	IN
cord-002369-shk4n8f6	76	10	more	more	JJR
cord-002369-shk4n8f6	76	11	than	than	IN
cord-002369-shk4n8f6	76	12	90	90	CD
cord-002369-shk4n8f6	76	13	%	%	NN
cord-002369-shk4n8f6	76	14	were	be	VBD
cord-002369-shk4n8f6	76	15	transiently	transiently	RB
cord-002369-shk4n8f6	76	16	transfected	transfecte	VBN
cord-002369-shk4n8f6	76	17	with	with	IN
cord-002369-shk4n8f6	76	18	a	a	DT
cord-002369-shk4n8f6	76	19	plasmid	plasmid	NN
cord-002369-shk4n8f6	76	20	encoding	encoding	NN
cord-002369-shk4n8f6	76	21	for	for	IN
cord-002369-shk4n8f6	76	22	Flag	Flag	NNP
cord-002369-shk4n8f6	76	23	-	-	HYPH
cord-002369-shk4n8f6	76	24	ATG12	ATG12	NNP
cord-002369-shk4n8f6	76	25	protein	protein	NN
cord-002369-shk4n8f6	76	26	.	.	.
cord-002369-shk4n8f6	77	1	Two	two	CD
cord-002369-shk4n8f6	77	2	days	day	NNS
cord-002369-shk4n8f6	77	3	later	later	RB
cord-002369-shk4n8f6	77	4	,	,	,
cord-002369-shk4n8f6	77	5	cells	cell	NNS
cord-002369-shk4n8f6	77	6	were	be	VBD
cord-002369-shk4n8f6	77	7	lysed	lyse	VBN
cord-002369-shk4n8f6	77	8	and	and	CC
cord-002369-shk4n8f6	77	9	ATG12	ATG12	NNP
cord-002369-shk4n8f6	77	10	was	be	VBD
cord-002369-shk4n8f6	77	11	immunoprecipitated	immunoprecipitate	VBN
cord-002369-shk4n8f6	77	12	using	use	VBG
cord-002369-shk4n8f6	77	13	anti	anti	JJ
cord-002369-shk4n8f6	77	14	-	-	JJ
cord-002369-shk4n8f6	77	15	Flag	flag	JJ
cord-002369-shk4n8f6	77	16	antibody	antibody	NN
cord-002369-shk4n8f6	77	17	or	or	CC
cord-002369-shk4n8f6	77	18	IgG	igg	NN
cord-002369-shk4n8f6	77	19	as	as	IN
cord-002369-shk4n8f6	77	20	a	a	DT
cord-002369-shk4n8f6	77	21	control	control	NN
cord-002369-shk4n8f6	77	22	followed	follow	VBN
cord-002369-shk4n8f6	77	23	by	by	IN
cord-002369-shk4n8f6	77	24	western	western	JJ
cord-002369-shk4n8f6	77	25	blot	blot	NN
cord-002369-shk4n8f6	77	26	analysis	analysis	NN
cord-002369-shk4n8f6	77	27	using	use	VBG
cord-002369-shk4n8f6	77	28	anti	anti	JJ
cord-002369-shk4n8f6	77	29	-	-	JJ
cord-002369-shk4n8f6	77	30	Flag	flag	JJ
cord-002369-shk4n8f6	77	31	and	and	CC
cord-002369-shk4n8f6	77	32	anti	anti	NNS
cord-002369-shk4n8f6	77	33	-	-	JJ
cord-002369-shk4n8f6	77	34	ATG16L1	atg16l1	JJ
cord-002369-shk4n8f6	77	35	.	.	.
cord-002369-shk4n8f6	78	1	(	(	-LRB-
cord-002369-shk4n8f6	78	2	C	C	NNP
cord-002369-shk4n8f6	78	3	)	)	-RRB-
cord-002369-shk4n8f6	78	4	Huh7	huh7	NN
cord-002369-shk4n8f6	78	5	cells	cell	NNS
cord-002369-shk4n8f6	78	6	were	be	VBD
cord-002369-shk4n8f6	78	7	infected	infect	VBN
cord-002369-shk4n8f6	78	8	with	with	IN
cord-002369-shk4n8f6	78	9	JFH1	JFH1	NNP
cord-002369-shk4n8f6	78	10	(	(	-LRB-
cord-002369-shk4n8f6	78	11	>	>	NFP
cord-002369-shk4n8f6	78	12	90	90	CD
cord-002369-shk4n8f6	78	13	%	%	NN
cord-002369-shk4n8f6	78	14	infected	infected	JJ
cord-002369-shk4n8f6	78	15	)	)	-RRB-
cord-002369-shk4n8f6	78	16	before	before	IN
cord-002369-shk4n8f6	78	17	being	be	VBG
cord-002369-shk4n8f6	78	18	transfected	transfecte	VBN
cord-002369-shk4n8f6	78	19	with	with	IN
cord-002369-shk4n8f6	78	20	control	control	NN
cord-002369-shk4n8f6	78	21	(	(	-LRB-
cord-002369-shk4n8f6	78	22	mock	mock	NNP
cord-002369-shk4n8f6	78	23	)	)	-RRB-
cord-002369-shk4n8f6	78	24	,	,	,
cord-002369-shk4n8f6	78	25	Flag	Flag	NNP
cord-002369-shk4n8f6	78	26	-	-	HYPH
cord-002369-shk4n8f6	78	27	ATG12	ATG12	NNP
cord-002369-shk4n8f6	78	28	,	,	,
cord-002369-shk4n8f6	78	29	GFP	GFP	NNP
cord-002369-shk4n8f6	78	30	-	-	HYPH
cord-002369-shk4n8f6	78	31	ATG5	ATG5	NNP
cord-002369-shk4n8f6	78	32	,	,	,
cord-002369-shk4n8f6	78	33	Flag	flag	NN
cord-002369-shk4n8f6	78	34	-	-	HYPH
cord-002369-shk4n8f6	78	35	ATG12DN	ATG12DN	NNP
cord-002369-shk4n8f6	78	36	or	or	CC
cord-002369-shk4n8f6	78	37	Flag	Flag	NNP
cord-002369-shk4n8f6	78	38	-	-	HYPH
cord-002369-shk4n8f6	78	39	ATG12	ATG12	NNP
cord-002369-shk4n8f6	78	40	and	and	CC
cord-002369-shk4n8f6	78	41	Flag	Flag	NNP
cord-002369-shk4n8f6	78	42	-	-	HYPH
cord-002369-shk4n8f6	78	43	ATG12DN	atg12dn	JJ
cord-002369-shk4n8f6	78	44	encoding	encoding	NN
cord-002369-shk4n8f6	78	45	plasmids	plasmid	NNS
cord-002369-shk4n8f6	78	46	.	.	.
cord-002369-shk4n8f6	79	1	Cell	cell	NN
cord-002369-shk4n8f6	79	2	lysates	lysate	NNS
cord-002369-shk4n8f6	79	3	were	be	VBD
cord-002369-shk4n8f6	79	4	analyzed	analyze	VBN
cord-002369-shk4n8f6	79	5	for	for	IN
cord-002369-shk4n8f6	79	6	HCV	HCV	NNP
cord-002369-shk4n8f6	79	7	NS3	NS3	NNP
cord-002369-shk4n8f6	79	8	,	,	,
cord-002369-shk4n8f6	79	9	ATG5	ATG5	NNP
cord-002369-shk4n8f6	79	10	and	and	CC
cord-002369-shk4n8f6	79	11	ATG12	ATG12	NNP
cord-002369-shk4n8f6	79	12	protein	protein	NN
cord-002369-shk4n8f6	79	13	expressions	expression	NNS
cord-002369-shk4n8f6	79	14	at	at	IN
cord-002369-shk4n8f6	79	15	72	72	CD
cord-002369-shk4n8f6	79	16	h	h	NN
cord-002369-shk4n8f6	79	17	post	post	NN
cord-002369-shk4n8f6	79	18	-	-	NN
cord-002369-shk4n8f6	79	19	transfection	transfection	JJ
cord-002369-shk4n8f6	79	20	by	by	IN
cord-002369-shk4n8f6	79	21	western	western	JJ
cord-002369-shk4n8f6	79	22	blotting	blotting	NN
cord-002369-shk4n8f6	79	23	.	.	.
cord-002369-shk4n8f6	80	1	(	(	-LRB-
cord-002369-shk4n8f6	80	2	D	D	NNP
cord-002369-shk4n8f6	80	3	)	)	-RRB-
cord-002369-shk4n8f6	80	4	JFH1-infected	jfh1-infecte	VBN
cord-002369-shk4n8f6	80	5	cells	cell	NNS
cord-002369-shk4n8f6	80	6	at	at	IN
cord-002369-shk4n8f6	80	7	more	more	JJR
cord-002369-shk4n8f6	80	8	than	than	IN
cord-002369-shk4n8f6	80	9	90	90	CD
cord-002369-shk4n8f6	80	10	%	%	NN
cord-002369-shk4n8f6	80	11	were	be	VBD
cord-002369-shk4n8f6	80	12	transfected	transfecte	VBN
cord-002369-shk4n8f6	80	13	with	with	IN
cord-002369-shk4n8f6	80	14	control	control	NN
cord-002369-shk4n8f6	80	15	plasmid	plasmid	NN
cord-002369-shk4n8f6	80	16	(	(	-LRB-
cord-002369-shk4n8f6	80	17	mock	mock	NNP
cord-002369-shk4n8f6	80	18	)	)	-RRB-
cord-002369-shk4n8f6	80	19	,	,	,
cord-002369-shk4n8f6	80	20	Flag	flag	NN
cord-002369-shk4n8f6	80	21	-	-	HYPH
cord-002369-shk4n8f6	80	22	ATG12DN	ATG12DN	NNP
cord-002369-shk4n8f6	80	23	or	or	CC
cord-002369-shk4n8f6	80	24	Flag	Flag	NNP
cord-002369-shk4n8f6	80	25	-	-	HYPH
cord-002369-shk4n8f6	80	26	ATG12	ATG12	NNP
cord-002369-shk4n8f6	80	27	and	and	CC
cord-002369-shk4n8f6	80	28	Flag	Flag	NNP
cord-002369-shk4n8f6	80	29	-	-	HYPH
cord-002369-shk4n8f6	80	30	ATG12DN	ATG12DN	NNP
cord-002369-shk4n8f6	80	31	.	.	.
cord-002369-shk4n8f6	81	1	Two	two	CD
cord-002369-shk4n8f6	81	2	days	day	NNS
cord-002369-shk4n8f6	81	3	later	later	RB
cord-002369-shk4n8f6	81	4	,	,	,
cord-002369-shk4n8f6	81	5	intracellular	intracellular	JJ
cord-002369-shk4n8f6	81	6	HCV	HCV	NNP
cord-002369-shk4n8f6	81	7	RNA	RNA	NNP
cord-002369-shk4n8f6	81	8	was	be	VBD
cord-002369-shk4n8f6	81	9	quantified	quantify	VBN
cord-002369-shk4n8f6	81	10	by	by	IN
cord-002369-shk4n8f6	81	11	RT	RT	NNP
cord-002369-shk4n8f6	81	12	-	-	HYPH
cord-002369-shk4n8f6	81	13	qPCR	qPCR	NNP
cord-002369-shk4n8f6	81	14	.	.	.
cord-002369-shk4n8f6	82	1	Data	datum	NNS
cord-002369-shk4n8f6	82	2	were	be	VBD
cord-002369-shk4n8f6	82	3	collected	collect	VBN
cord-002369-shk4n8f6	82	4	from	from	IN
cord-002369-shk4n8f6	82	5	three	three	CD
cord-002369-shk4n8f6	82	6	independent	independent	JJ
cord-002369-shk4n8f6	82	7	experiments	experiment	NNS
cord-002369-shk4n8f6	82	8	(	(	-LRB-
cord-002369-shk4n8f6	82	9	n	n	NN
cord-002369-shk4n8f6	82	10	=	=	SYM
cord-002369-shk4n8f6	82	11	3	3	CD
cord-002369-shk4n8f6	82	12	)	)	-RRB-
cord-002369-shk4n8f6	82	13	.	.	.
cord-002369-shk4n8f6	83	1	(	(	-LRB-
cord-002369-shk4n8f6	83	2	*	*	NFP
cord-002369-shk4n8f6	83	3	*	*	NFP
cord-002369-shk4n8f6	83	4	P	p	NN
cord-002369-shk4n8f6	83	5	=	=	SYM
cord-002369-shk4n8f6	83	6	0.005	0.005	CD
cord-002369-shk4n8f6	83	7	,	,	,
cord-002369-shk4n8f6	83	8	NS	NS	NNP
cord-002369-shk4n8f6	83	9	,	,	,
cord-002369-shk4n8f6	83	10	None	none	NN
cord-002369-shk4n8f6	83	11	-	-	HYPH
cord-002369-shk4n8f6	83	12	significant	significant	JJ
cord-002369-shk4n8f6	83	13	.	.	.
cord-002369-shk4n8f6	84	1	Statistical	statistical	JJ
cord-002369-shk4n8f6	84	2	analysis	analysis	NN
cord-002369-shk4n8f6	84	3	was	be	VBD
cord-002369-shk4n8f6	84	4	performed	perform	VBN
cord-002369-shk4n8f6	84	5	by	by	IN
cord-002369-shk4n8f6	84	6	using	use	VBG
cord-002369-shk4n8f6	84	7	One	one	CD
cord-002369-shk4n8f6	84	8	-	-	HYPH
cord-002369-shk4n8f6	84	9	way	way	NN
cord-002369-shk4n8f6	84	10	ANOVA	ANOVA	NNP
cord-002369-shk4n8f6	84	11	)	)	-RRB-
cord-002369-shk4n8f6	84	12	.	.	.
cord-002369-shk4n8f6	85	1	Scientific	Scientific	NNP
cord-002369-shk4n8f6	85	2	RepoRts	RepoRts	NNP
cord-002369-shk4n8f6	85	3	|	|	.
cord-002369-shk4n8f6	86	1	7:40351	7:40351	CD
cord-002369-shk4n8f6	86	2	|	|	NNP
cord-002369-shk4n8f6	87	1	DOI	DOI	NNP
cord-002369-shk4n8f6	87	2	:	:	:
cord-002369-shk4n8f6	88	1	10.1038	10.1038	CD
cord-002369-shk4n8f6	88	2	/	/	SYM
cord-002369-shk4n8f6	88	3	srep40351	srep40351	CD
cord-002369-shk4n8f6	89	1	The	the	DT
cord-002369-shk4n8f6	89	2	ATG5	ATG5	NNP
cord-002369-shk4n8f6	89	3	-	-	HYPH
cord-002369-shk4n8f6	89	4	12	12	CD
cord-002369-shk4n8f6	89	5	conjugate	conjugate	NN
cord-002369-shk4n8f6	89	6	positively	positively	RB
cord-002369-shk4n8f6	89	7	regulates	regulate	VBZ
cord-002369-shk4n8f6	89	8	HCV	HCV	NNP
cord-002369-shk4n8f6	89	9	RNA	RNA	NNP
cord-002369-shk4n8f6	89	10	replication	replication	NN
cord-002369-shk4n8f6	89	11	in	in	IN
cord-002369-shk4n8f6	89	12	an	an	DT
cord-002369-shk4n8f6	89	13	LC3-independent	lc3-independent	NN
cord-002369-shk4n8f6	89	14	manner	manner	NN
cord-002369-shk4n8f6	89	15	.	.	.
cord-002369-shk4n8f6	90	1	To	to	TO
cord-002369-shk4n8f6	90	2	determine	determine	VB
cord-002369-shk4n8f6	90	3	whether	whether	IN
cord-002369-shk4n8f6	90	4	LC3	lc3	NN
cord-002369-shk4n8f6	90	5	or	or	CC
cord-002369-shk4n8f6	90	6	the	the	DT
cord-002369-shk4n8f6	90	7	ATG5	ATG5	NNP
cord-002369-shk4n8f6	90	8	-	-	HYPH
cord-002369-shk4n8f6	90	9	12	12	CD
cord-002369-shk4n8f6	90	10	conjugate	conjugate	NN
cord-002369-shk4n8f6	90	11	modulates	modulate	VBZ
cord-002369-shk4n8f6	90	12	HCV	HCV	NNP
cord-002369-shk4n8f6	90	13	RNA	RNA	NNP
cord-002369-shk4n8f6	90	14	replication	replication	NN
cord-002369-shk4n8f6	90	15	,	,	,
cord-002369-shk4n8f6	90	16	we	-PRON-	PRP
cord-002369-shk4n8f6	90	17	analyzed	analyze	VBD
cord-002369-shk4n8f6	90	18	the	the	DT
cord-002369-shk4n8f6	90	19	effects	effect	NNS
cord-002369-shk4n8f6	90	20	of	of	IN
cord-002369-shk4n8f6	90	21	silencing	silence	VBG
cord-002369-shk4n8f6	90	22	these	these	DT
cord-002369-shk4n8f6	90	23	autophagy	autophagy	NN
cord-002369-shk4n8f6	90	24	genes	gene	NNS
cord-002369-shk4n8f6	90	25	on	on	IN
cord-002369-shk4n8f6	90	26	viral	viral	JJ
cord-002369-shk4n8f6	90	27	RNA	RNA	NNP
cord-002369-shk4n8f6	90	28	replication	replication	NN
cord-002369-shk4n8f6	90	29	in	in	IN
cord-002369-shk4n8f6	90	30	Huh7	Huh7	NNP
cord-002369-shk4n8f6	90	31	cells	cell	NNS
cord-002369-shk4n8f6	90	32	stably	stably	RB
cord-002369-shk4n8f6	90	33	expressing	express	VBG
cord-002369-shk4n8f6	90	34	the	the	DT
cord-002369-shk4n8f6	90	35	JFH1	JFH1	NNP
cord-002369-shk4n8f6	90	36	subgenomic	subgenomic	NNP
cord-002369-shk4n8f6	90	37	replicon	replicon	NNP
cord-002369-shk4n8f6	90	38	(	(	-LRB-
cord-002369-shk4n8f6	90	39	SGR	SGR	NNP
cord-002369-shk4n8f6	90	40	)	)	-RRB-
cord-002369-shk4n8f6	90	41	.	.	.
cord-002369-shk4n8f6	91	1	Using	use	VBG
cord-002369-shk4n8f6	91	2	these	these	DT
cord-002369-shk4n8f6	91	3	specific	specific	JJ
cord-002369-shk4n8f6	91	4	cells	cell	NNS
cord-002369-shk4n8f6	91	5	,	,	,
cord-002369-shk4n8f6	91	6	which	which	WDT
cord-002369-shk4n8f6	91	7	are	be	VBP
cord-002369-shk4n8f6	91	8	capable	capable	JJ
cord-002369-shk4n8f6	91	9	of	of	IN
cord-002369-shk4n8f6	91	10	only	only	RB
cord-002369-shk4n8f6	91	11	intracellular	intracellular	JJ
cord-002369-shk4n8f6	91	12	HCV	HCV	NNP
cord-002369-shk4n8f6	91	13	RNA	RNA	NNP
cord-002369-shk4n8f6	91	14	replication	replication	NN
cord-002369-shk4n8f6	91	15	and	and	CC
cord-002369-shk4n8f6	91	16	lacked	lack	VBD
cord-002369-shk4n8f6	91	17	the	the	DT
cord-002369-shk4n8f6	91	18	capacity	capacity	NN
cord-002369-shk4n8f6	91	19	to	to	TO
cord-002369-shk4n8f6	91	20	produce	produce	VB
cord-002369-shk4n8f6	91	21	infectious	infectious	JJ
cord-002369-shk4n8f6	91	22	viral	viral	JJ
cord-002369-shk4n8f6	91	23	particles	particle	NNS
cord-002369-shk4n8f6	91	24	,	,	,
cord-002369-shk4n8f6	91	25	allowed	allow	VBD
cord-002369-shk4n8f6	91	26	us	-PRON-	PRP
cord-002369-shk4n8f6	91	27	to	to	TO
cord-002369-shk4n8f6	91	28	study	study	VB
cord-002369-shk4n8f6	91	29	HCV	HCV	NNP
cord-002369-shk4n8f6	91	30	RNA	RNA	NNP
cord-002369-shk4n8f6	91	31	replication	replication	NN
cord-002369-shk4n8f6	91	32	independently	independently	RB
cord-002369-shk4n8f6	91	33	of	of	IN
cord-002369-shk4n8f6	91	34	viral	viral	JJ
cord-002369-shk4n8f6	91	35	entry	entry	NN
cord-002369-shk4n8f6	91	36	and	and	CC
cord-002369-shk4n8f6	91	37	egress	egress	NN
cord-002369-shk4n8f6	91	38	.	.	.
cord-002369-shk4n8f6	92	1	Again	again	RB
cord-002369-shk4n8f6	92	2	,	,	,
cord-002369-shk4n8f6	92	3	silencing	silence	VBG
cord-002369-shk4n8f6	92	4	of	of	IN
cord-002369-shk4n8f6	92	5	ATG12	ATG12	NNP
cord-002369-shk4n8f6	92	6	but	but	CC
cord-002369-shk4n8f6	92	7	not	not	RB
cord-002369-shk4n8f6	92	8	LC3	LC3	NNP
cord-002369-shk4n8f6	92	9	efficiently	efficiently	RB
cord-002369-shk4n8f6	92	10	inhibited	inhibit	VBD
cord-002369-shk4n8f6	92	11	RNA	RNA	NNP
cord-002369-shk4n8f6	92	12	replication	replication	NN
cord-002369-shk4n8f6	92	13	,	,	,
cord-002369-shk4n8f6	92	14	thus	thus	RB
cord-002369-shk4n8f6	92	15	supporting	support	VBG
cord-002369-shk4n8f6	92	16	the	the	DT
cord-002369-shk4n8f6	92	17	role	role	NN
cord-002369-shk4n8f6	92	18	of	of	IN
cord-002369-shk4n8f6	92	19	the	the	DT
cord-002369-shk4n8f6	92	20	ATG5	ATG5	NNP
cord-002369-shk4n8f6	92	21	-	-	HYPH
cord-002369-shk4n8f6	92	22	12	12	CD
cord-002369-shk4n8f6	92	23	conjugate	conjugate	NN
cord-002369-shk4n8f6	92	24	in	in	IN
cord-002369-shk4n8f6	92	25	viral	viral	JJ
cord-002369-shk4n8f6	92	26	replication	replication	NN
cord-002369-shk4n8f6	92	27	and	and	CC
cord-002369-shk4n8f6	92	28	ruling	rule	VBG
cord-002369-shk4n8f6	92	29	out	out	RP
cord-002369-shk4n8f6	92	30	the	the	DT
cord-002369-shk4n8f6	92	31	possibility	possibility	NN
cord-002369-shk4n8f6	92	32	that	that	IN
cord-002369-shk4n8f6	92	33	LC3	LC3	NNP
cord-002369-shk4n8f6	92	34	participates	participate	VBZ
cord-002369-shk4n8f6	92	35	in	in	IN
cord-002369-shk4n8f6	92	36	viral	viral	JJ
cord-002369-shk4n8f6	92	37	replication	replication	NN
cord-002369-shk4n8f6	92	38	(	(	-LRB-
cord-002369-shk4n8f6	92	39	Fig	Fig	NNP
cord-002369-shk4n8f6	92	40	.	.	.
cord-002369-shk4n8f6	92	41	3A	3A	NNP
cord-002369-shk4n8f6	92	42	,	,	,
cord-002369-shk4n8f6	92	43	B	B	NNP
cord-002369-shk4n8f6	92	44	)	)	-RRB-
cord-002369-shk4n8f6	92	45	.	.	.
cord-002369-shk4n8f6	93	1	Because	because	IN
cord-002369-shk4n8f6	93	2	silencing	silencing	NN
cord-002369-shk4n8f6	93	3	of	of	IN
cord-002369-shk4n8f6	93	4	LC3	lc3	JJ
cord-002369-shk4n8f6	93	5	expression	expression	NN
cord-002369-shk4n8f6	93	6	led	lead	VBD
cord-002369-shk4n8f6	93	7	to	to	IN
cord-002369-shk4n8f6	93	8	a	a	DT
cord-002369-shk4n8f6	93	9	clear	clear	JJ
cord-002369-shk4n8f6	93	10	inhibition	inhibition	NN
cord-002369-shk4n8f6	93	11	of	of	IN
cord-002369-shk4n8f6	93	12	HCV	HCV	NNP
cord-002369-shk4n8f6	93	13	RNA	RNA	NNP
cord-002369-shk4n8f6	93	14	translation	translation	NN
cord-002369-shk4n8f6	93	15	after	after	IN
cord-002369-shk4n8f6	93	16	electroporation	electroporation	NN
cord-002369-shk4n8f6	93	17	of	of	IN
cord-002369-shk4n8f6	93	18	the	the	DT
cord-002369-shk4n8f6	93	19	viral	viral	JJ
cord-002369-shk4n8f6	93	20	RNA	RNA	NNP
cord-002369-shk4n8f6	93	21	but	but	CC
cord-002369-shk4n8f6	93	22	did	do	VBD
cord-002369-shk4n8f6	93	23	not	not	RB
cord-002369-shk4n8f6	93	24	significantly	significantly	RB
cord-002369-shk4n8f6	93	25	affect	affect	VB
cord-002369-shk4n8f6	93	26	replication	replication	NN
cord-002369-shk4n8f6	93	27	in	in	IN
cord-002369-shk4n8f6	93	28	JFH1-SGR	JFH1-SGR	NNP
cord-002369-shk4n8f6	93	29	cells	cell	NNS
cord-002369-shk4n8f6	93	30	,	,	,
cord-002369-shk4n8f6	93	31	we	-PRON-	PRP
cord-002369-shk4n8f6	93	32	sought	seek	VBD
cord-002369-shk4n8f6	93	33	to	to	TO
cord-002369-shk4n8f6	93	34	compare	compare	VB
cord-002369-shk4n8f6	93	35	the	the	DT
cord-002369-shk4n8f6	93	36	effect	effect	NN
cord-002369-shk4n8f6	93	37	of	of	IN
cord-002369-shk4n8f6	93	38	siRNA	siRNA	NNP
cord-002369-shk4n8f6	93	39	treatment	treatment	NN
cord-002369-shk4n8f6	93	40	before	before	RB
cord-002369-shk4n8f6	93	41	and	and	CC
cord-002369-shk4n8f6	93	42	after	after	IN
cord-002369-shk4n8f6	93	43	infection	infection	NN
cord-002369-shk4n8f6	93	44	with	with	IN
cord-002369-shk4n8f6	93	45	HCVcc	HCVcc	NNP
cord-002369-shk4n8f6	93	46	JFH1	JFH1	NNP
cord-002369-shk4n8f6	93	47	(	(	-LRB-
cord-002369-shk4n8f6	93	48	Fig	Fig	NNP
cord-002369-shk4n8f6	93	49	.	.	.
cord-002369-shk4n8f6	93	50	3C	3C	NNP
cord-002369-shk4n8f6	93	51	)	)	-RRB-
cord-002369-shk4n8f6	93	52	.	.	.
cord-002369-shk4n8f6	94	1	The	the	DT
cord-002369-shk4n8f6	94	2	results	result	NNS
cord-002369-shk4n8f6	94	3	clearly	clearly	RB
cord-002369-shk4n8f6	94	4	demonstrated	demonstrate	VBD
cord-002369-shk4n8f6	94	5	that	that	IN
cord-002369-shk4n8f6	94	6	siLC3	siLC3	NNP
cord-002369-shk4n8f6	94	7	inhibited	inhibit	VBN
cord-002369-shk4n8f6	94	8	HCV	HCV	NNP
cord-002369-shk4n8f6	94	9	only	only	RB
cord-002369-shk4n8f6	94	10	when	when	WRB
cord-002369-shk4n8f6	94	11	it	-PRON-	PRP
cord-002369-shk4n8f6	94	12	was	be	VBD
cord-002369-shk4n8f6	94	13	transfected	transfecte	VBN
cord-002369-shk4n8f6	94	14	before	before	IN
cord-002369-shk4n8f6	94	15	infection	infection	NN
cord-002369-shk4n8f6	94	16	,	,	,
cord-002369-shk4n8f6	94	17	whereas	whereas	IN
cord-002369-shk4n8f6	94	18	siATG7	siATG7	NNP
cord-002369-shk4n8f6	94	19	was	be	VBD
cord-002369-shk4n8f6	94	20	effective	effective	JJ
cord-002369-shk4n8f6	94	21	when	when	WRB
cord-002369-shk4n8f6	94	22	it	-PRON-	PRP
cord-002369-shk4n8f6	94	23	was	be	VBD
cord-002369-shk4n8f6	94	24	transfected	transfecte	VBN
cord-002369-shk4n8f6	94	25	before	before	IN
cord-002369-shk4n8f6	94	26	or	or	CC
cord-002369-shk4n8f6	94	27	after	after	IN
cord-002369-shk4n8f6	94	28	infection	infection	NN
cord-002369-shk4n8f6	94	29	.	.	.
cord-002369-shk4n8f6	95	1	These	these	DT
cord-002369-shk4n8f6	95	2	results	result	NNS
cord-002369-shk4n8f6	95	3	suggest	suggest	VBP
cord-002369-shk4n8f6	95	4	that	that	IN
cord-002369-shk4n8f6	95	5	LC3	LC3	NNP
cord-002369-shk4n8f6	95	6	is	be	VBZ
cord-002369-shk4n8f6	95	7	important	important	JJ
cord-002369-shk4n8f6	95	8	early	early	RB
cord-002369-shk4n8f6	95	9	in	in	IN
cord-002369-shk4n8f6	95	10	infection	infection	NN
cord-002369-shk4n8f6	95	11	and	and	CC
cord-002369-shk4n8f6	95	12	primarily	primarily	RB
cord-002369-shk4n8f6	95	13	for	for	IN
cord-002369-shk4n8f6	95	14	initial	initial	JJ
cord-002369-shk4n8f6	95	15	HCV	HCV	NNP
cord-002369-shk4n8f6	95	16	RNA	RNA	NNP
cord-002369-shk4n8f6	95	17	translation	translation	NN
cord-002369-shk4n8f6	95	18	,	,	,
cord-002369-shk4n8f6	95	19	as	as	IN
cord-002369-shk4n8f6	95	20	has	have	VBZ
cord-002369-shk4n8f6	95	21	previously	previously	RB
cord-002369-shk4n8f6	95	22	been	be	VBN
cord-002369-shk4n8f6	95	23	reported	report	VBN
cord-002369-shk4n8f6	95	24	31	31	CD
cord-002369-shk4n8f6	95	25	.	.	.
cord-002369-shk4n8f6	96	1	Finally	finally	RB
cord-002369-shk4n8f6	96	2	,	,	,
cord-002369-shk4n8f6	96	3	we	-PRON-	PRP
cord-002369-shk4n8f6	96	4	evaluated	evaluate	VBD
cord-002369-shk4n8f6	96	5	the	the	DT
cord-002369-shk4n8f6	96	6	effects	effect	NNS
cord-002369-shk4n8f6	96	7	of	of	IN
cord-002369-shk4n8f6	96	8	siRNA	siRNA	NNP
cord-002369-shk4n8f6	96	9	treatment	treatment	NN
cord-002369-shk4n8f6	96	10	on	on	IN
cord-002369-shk4n8f6	96	11	intracellular	intracellular	JJ
cord-002369-shk4n8f6	96	12	and	and	CC
cord-002369-shk4n8f6	96	13	extracellular	extracellular	JJ
cord-002369-shk4n8f6	96	14	HCV	HCV	NNP
cord-002369-shk4n8f6	96	15	infectious	infectious	JJ
cord-002369-shk4n8f6	96	16	particle	particle	NN
cord-002369-shk4n8f6	96	17	production	production	NN
cord-002369-shk4n8f6	96	18	in	in	IN
cord-002369-shk4n8f6	96	19	JFH1-infected	JFH1-infected	NNP
cord-002369-shk4n8f6	96	20	cells	cell	NNS
cord-002369-shk4n8f6	96	21	(	(	-LRB-
cord-002369-shk4n8f6	96	22	Fig	Fig	NNP
cord-002369-shk4n8f6	96	23	.	.	.
cord-002369-shk4n8f6	96	24	3D	3D	NNP
cord-002369-shk4n8f6	96	25	)	)	-RRB-
cord-002369-shk4n8f6	96	26	.	.	.
cord-002369-shk4n8f6	97	1	These	these	DT
cord-002369-shk4n8f6	97	2	results	result	NNS
cord-002369-shk4n8f6	97	3	suggested	suggest	VBD
cord-002369-shk4n8f6	97	4	that	that	IN
cord-002369-shk4n8f6	97	5	HCV	HCV	NNP
cord-002369-shk4n8f6	97	6	maturation	maturation	NN
cord-002369-shk4n8f6	97	7	and	and	CC
cord-002369-shk4n8f6	97	8	secretion	secretion	NN
cord-002369-shk4n8f6	97	9	was	be	VBD
cord-002369-shk4n8f6	97	10	not	not	RB
cord-002369-shk4n8f6	97	11	significantly	significantly	RB
cord-002369-shk4n8f6	97	12	affected	affect	VBN
cord-002369-shk4n8f6	97	13	by	by	IN
cord-002369-shk4n8f6	97	14	siRNA	siRNA	NNP
cord-002369-shk4n8f6	97	15	treatment	treatment	NN
cord-002369-shk4n8f6	97	16	.	.	.
cord-002369-shk4n8f6	98	1	Although	although	IN
cord-002369-shk4n8f6	98	2	silencing	silence	VBG
cord-002369-shk4n8f6	98	3	ATG12	ATG12	NNP
cord-002369-shk4n8f6	98	4	led	lead	VBD
cord-002369-shk4n8f6	98	5	to	to	IN
cord-002369-shk4n8f6	98	6	a	a	DT
cord-002369-shk4n8f6	98	7	significant	significant	JJ
cord-002369-shk4n8f6	98	8	decrease	decrease	NN
cord-002369-shk4n8f6	98	9	in	in	IN
cord-002369-shk4n8f6	98	10	HCV	HCV	NNP
cord-002369-shk4n8f6	98	11	particle	particle	NN
cord-002369-shk4n8f6	98	12	formation	formation	NN
cord-002369-shk4n8f6	98	13	,	,	,
cord-002369-shk4n8f6	98	14	this	this	DT
cord-002369-shk4n8f6	98	15	effect	effect	NN
cord-002369-shk4n8f6	98	16	was	be	VBD
cord-002369-shk4n8f6	98	17	attributed	attribute	VBN
cord-002369-shk4n8f6	98	18	to	to	IN
cord-002369-shk4n8f6	98	19	a	a	DT
cord-002369-shk4n8f6	98	20	severe	severe	JJ
cord-002369-shk4n8f6	98	21	reduction	reduction	NN
cord-002369-shk4n8f6	98	22	in	in	IN
cord-002369-shk4n8f6	98	23	viral	viral	JJ
cord-002369-shk4n8f6	98	24	replication	replication	NN
cord-002369-shk4n8f6	98	25	.	.	.
cord-002369-shk4n8f6	99	1	Collectively	collectively	RB
cord-002369-shk4n8f6	99	2	,	,	,
cord-002369-shk4n8f6	99	3	ATG12	ATG12	NNP
cord-002369-shk4n8f6	99	4	silencing	silencing	NN
cord-002369-shk4n8f6	99	5	and	and	CC
cord-002369-shk4n8f6	99	6	to	to	IN
cord-002369-shk4n8f6	99	7	a	a	DT
cord-002369-shk4n8f6	99	8	lesser	less	JJR
cord-002369-shk4n8f6	99	9	extent	extent	NN
cord-002369-shk4n8f6	99	10	ATG7	ATG7	NNP
cord-002369-shk4n8f6	99	11	but	but	CC
cord-002369-shk4n8f6	99	12	not	not	RB
cord-002369-shk4n8f6	99	13	LC3	lc3	JJ
cord-002369-shk4n8f6	99	14	,	,	,
cord-002369-shk4n8f6	99	15	impaired	impair	VBN
cord-002369-shk4n8f6	99	16	viral	viral	JJ
cord-002369-shk4n8f6	99	17	replication	replication	NN
cord-002369-shk4n8f6	99	18	.	.	.
cord-002369-shk4n8f6	100	1	ATG5	ATG5	NNP
cord-002369-shk4n8f6	100	2	-	-	HYPH
cord-002369-shk4n8f6	100	3	12	12	CD
cord-002369-shk4n8f6	100	4	and	and	CC
cord-002369-shk4n8f6	100	5	ATG16L1	ATG16L1	NNS
cord-002369-shk4n8f6	100	6	are	be	VBP
cord-002369-shk4n8f6	100	7	associated	associate	VBN
cord-002369-shk4n8f6	100	8	with	with	IN
cord-002369-shk4n8f6	100	9	purified	purify	VBN
cord-002369-shk4n8f6	100	10	MW	MW	NNP
cord-002369-shk4n8f6	100	11	extract	extract	NN
cord-002369-shk4n8f6	100	12	.	.	.
cord-002369-shk4n8f6	101	1	In	in	IN
cord-002369-shk4n8f6	101	2	a	a	DT
cord-002369-shk4n8f6	101	3	previous	previous	JJ
cord-002369-shk4n8f6	101	4	study	study	NN
cord-002369-shk4n8f6	101	5	from	from	IN
cord-002369-shk4n8f6	101	6	our	-PRON-	PRP$
cord-002369-shk4n8f6	101	7	lab	lab	NN
cord-002369-shk4n8f6	101	8	,	,	,
cord-002369-shk4n8f6	101	9	we	-PRON-	PRP
cord-002369-shk4n8f6	101	10	have	have	VBP
cord-002369-shk4n8f6	101	11	shown	show	VBN
cord-002369-shk4n8f6	101	12	that	that	IN
cord-002369-shk4n8f6	101	13	ATG5	ATG5	NNP
cord-002369-shk4n8f6	101	14	interacts	interact	VBZ
cord-002369-shk4n8f6	101	15	with	with	IN
cord-002369-shk4n8f6	101	16	the	the	DT
cord-002369-shk4n8f6	101	17	HCV	HCV	NNP
cord-002369-shk4n8f6	101	18	polymerase	polymerase	NN
cord-002369-shk4n8f6	101	19	(	(	-LRB-
cord-002369-shk4n8f6	101	20	NS5B	NS5B	NNP
cord-002369-shk4n8f6	101	21	)	)	-RRB-
cord-002369-shk4n8f6	101	22	and	and	CC
cord-002369-shk4n8f6	101	23	co	co	NNS
cord-002369-shk4n8f6	101	24	-	-	NN
cord-002369-shk4n8f6	101	25	localizes	localize	VBZ
cord-002369-shk4n8f6	101	26	with	with	IN
cord-002369-shk4n8f6	101	27	the	the	DT
cord-002369-shk4n8f6	101	28	MW	MW	NNP
cord-002369-shk4n8f6	101	29	associated	associate	VBD
cord-002369-shk4n8f6	101	30	protein	protein	NN
cord-002369-shk4n8f6	101	31	NS4B	NS4B	NNP
cord-002369-shk4n8f6	101	32	34	34	CD
cord-002369-shk4n8f6	101	33	.	.	.
cord-002369-shk4n8f6	102	1	The	the	DT
cord-002369-shk4n8f6	102	2	major	major	JJ
cord-002369-shk4n8f6	102	3	limitation	limitation	NN
cord-002369-shk4n8f6	102	4	in	in	IN
cord-002369-shk4n8f6	102	5	our	-PRON-	PRP$
cord-002369-shk4n8f6	102	6	ability	ability	NN
cord-002369-shk4n8f6	102	7	to	to	TO
cord-002369-shk4n8f6	102	8	investigate	investigate	VB
cord-002369-shk4n8f6	102	9	the	the	DT
cord-002369-shk4n8f6	102	10	composition	composition	NN
cord-002369-shk4n8f6	102	11	of	of	IN
cord-002369-shk4n8f6	102	12	the	the	DT
cord-002369-shk4n8f6	102	13	MW	MW	NNP
cord-002369-shk4n8f6	102	14	has	have	VBZ
cord-002369-shk4n8f6	102	15	recently	recently	RB
cord-002369-shk4n8f6	102	16	been	be	VBN
cord-002369-shk4n8f6	102	17	resolved	resolve	VBN
cord-002369-shk4n8f6	102	18	by	by	IN
cord-002369-shk4n8f6	102	19	Dr.	Dr.	NNP
cord-002369-shk4n8f6	102	20	Ralf	Ralf	NNP
cord-002369-shk4n8f6	102	21	Bartenschlager	Bartenschlager	NNP
cord-002369-shk4n8f6	102	22	's	's	POS
cord-002369-shk4n8f6	102	23	group	group	NN
cord-002369-shk4n8f6	102	24	,	,	,
cord-002369-shk4n8f6	102	25	which	which	WDT
cord-002369-shk4n8f6	102	26	has	have	VBZ
cord-002369-shk4n8f6	102	27	developed	develop	VBN
cord-002369-shk4n8f6	102	28	a	a	DT
cord-002369-shk4n8f6	102	29	method	method	NN
cord-002369-shk4n8f6	102	30	to	to	TO
cord-002369-shk4n8f6	102	31	purify	purify	VB
cord-002369-shk4n8f6	102	32	the	the	DT
cord-002369-shk4n8f6	102	33	HCV	HCV	NNP
cord-002369-shk4n8f6	102	34	MW	MW	NNP
cord-002369-shk4n8f6	102	35	by	by	IN
cord-002369-shk4n8f6	102	36	using	use	VBG
cord-002369-shk4n8f6	102	37	HCV	HCV	NNP
cord-002369-shk4n8f6	102	38	replicon	replicon	NN
cord-002369-shk4n8f6	102	39	cells	cell	NNS
cord-002369-shk4n8f6	102	40	harboring	harbor	VBG
cord-002369-shk4n8f6	102	41	an	an	DT
cord-002369-shk4n8f6	102	42	HA	HA	NNP
cord-002369-shk4n8f6	102	43	-	-	HYPH
cord-002369-shk4n8f6	102	44	tag	tag	NN
cord-002369-shk4n8f6	102	45	NS4B	NS4B	NNP
cord-002369-shk4n8f6	102	46	(	(	-LRB-
cord-002369-shk4n8f6	102	47	NS4B	NS4B	NNP
cord-002369-shk4n8f6	102	48	-	-	HYPH
cord-002369-shk4n8f6	102	49	HA	HA	NNP
cord-002369-shk4n8f6	102	50	)	)	-RRB-
cord-002369-shk4n8f6	102	51	42	42	CD
cord-002369-shk4n8f6	102	52	.	.	.
cord-002369-shk4n8f6	103	1	This	this	DT
cord-002369-shk4n8f6	103	2	method	method	NN
cord-002369-shk4n8f6	103	3	allowed	allow	VBD
cord-002369-shk4n8f6	103	4	us	-PRON-	PRP
cord-002369-shk4n8f6	103	5	to	to	TO
cord-002369-shk4n8f6	103	6	evaluate	evaluate	VB
cord-002369-shk4n8f6	103	7	the	the	DT
cord-002369-shk4n8f6	103	8	presence	presence	NN
cord-002369-shk4n8f6	103	9	of	of	IN
cord-002369-shk4n8f6	103	10	the	the	DT
cord-002369-shk4n8f6	103	11	autophagy	autophagy	NN
cord-002369-shk4n8f6	103	12	elongation	elongation	NN
cord-002369-shk4n8f6	103	13	complex	complex	JJ
cord-002369-shk4n8f6	103	14	proteins	protein	NNS
cord-002369-shk4n8f6	103	15	in	in	IN
cord-002369-shk4n8f6	103	16	purified	purify	VBN
cord-002369-shk4n8f6	103	17	MW	MW	NNP
cord-002369-shk4n8f6	103	18	extract	extract	NN
cord-002369-shk4n8f6	103	19	.	.	.
cord-002369-shk4n8f6	104	1	Through	through	IN
cord-002369-shk4n8f6	104	2	this	this	DT
cord-002369-shk4n8f6	104	3	protocol	protocol	NN
cord-002369-shk4n8f6	104	4	,	,	,
cord-002369-shk4n8f6	104	5	after	after	IN
cord-002369-shk4n8f6	104	6	membrane	membrane	NN
cord-002369-shk4n8f6	104	7	enrichment	enrichment	NN
cord-002369-shk4n8f6	104	8	from	from	IN
cord-002369-shk4n8f6	104	9	a	a	DT
cord-002369-shk4n8f6	104	10	discontinuous	discontinuous	JJ
cord-002369-shk4n8f6	104	11	sucrose	sucrose	NN
cord-002369-shk4n8f6	104	12	gradient	gradient	NN
cord-002369-shk4n8f6	104	13	via	via	IN
cord-002369-shk4n8f6	104	14	ultracentrifugation	ultracentrifugation	NN
cord-002369-shk4n8f6	104	15	,	,	,
cord-002369-shk4n8f6	104	16	we	-PRON-	PRP
cord-002369-shk4n8f6	104	17	pooled	pool	VBD
cord-002369-shk4n8f6	104	18	fractions	fraction	NNS
cord-002369-shk4n8f6	104	19	that	that	WDT
cord-002369-shk4n8f6	104	20	were	be	VBD
cord-002369-shk4n8f6	104	21	rich	rich	JJ
cord-002369-shk4n8f6	104	22	in	in	IN
cord-002369-shk4n8f6	104	23	viral	viral	JJ
cord-002369-shk4n8f6	104	24	nonstructural	nonstructural	JJ
cord-002369-shk4n8f6	104	25	proteins	protein	NNS
cord-002369-shk4n8f6	104	26	(	(	-LRB-
cord-002369-shk4n8f6	104	27	fraction	fraction	NN
cord-002369-shk4n8f6	104	28	3	3	CD
cord-002369-shk4n8f6	104	29	to	to	IN
cord-002369-shk4n8f6	104	30	7	7	CD
cord-002369-shk4n8f6	104	31	)	)	-RRB-
cord-002369-shk4n8f6	104	32	but	but	CC
cord-002369-shk4n8f6	104	33	mostly	mostly	RB
cord-002369-shk4n8f6	104	34	devoid	devoid	JJ
cord-002369-shk4n8f6	104	35	of	of	IN
cord-002369-shk4n8f6	104	36	soluble	soluble	JJ
cord-002369-shk4n8f6	104	37	proteins	protein	NNS
cord-002369-shk4n8f6	104	38	(	(	-LRB-
cord-002369-shk4n8f6	104	39	GAPDH	GAPDH	NNP
cord-002369-shk4n8f6	104	40	or	or	CC
cord-002369-shk4n8f6	104	41	LC3I	LC3I	NNP
cord-002369-shk4n8f6	104	42	,	,	,
cord-002369-shk4n8f6	104	43	fractions	fraction	NNS
cord-002369-shk4n8f6	104	44	8	8	CD
cord-002369-shk4n8f6	104	45	-	-	SYM
cord-002369-shk4n8f6	104	46	10	10	CD
cord-002369-shk4n8f6	104	47	)	)	-RRB-
cord-002369-shk4n8f6	105	1	(	(	-LRB-
cord-002369-shk4n8f6	105	2	Fig	Fig	NNP
cord-002369-shk4n8f6	105	3	.	.	.
cord-002369-shk4n8f6	105	4	4A	4a	CD
cord-002369-shk4n8f6	105	5	)	)	-RRB-
cord-002369-shk4n8f6	105	6	.	.	.
cord-002369-shk4n8f6	106	1	The	the	DT
cord-002369-shk4n8f6	106	2	MW	MW	NNP
cord-002369-shk4n8f6	106	3	vesicles	vesicle	NNS
cord-002369-shk4n8f6	106	4	were	be	VBD
cord-002369-shk4n8f6	106	5	then	then	RB
cord-002369-shk4n8f6	106	6	pulled	pull	VBN
cord-002369-shk4n8f6	106	7	down	down	RP
cord-002369-shk4n8f6	106	8	from	from	IN
cord-002369-shk4n8f6	106	9	pooled	pool	VBN
cord-002369-shk4n8f6	106	10	fractions	fraction	NNS
cord-002369-shk4n8f6	106	11	by	by	IN
cord-002369-shk4n8f6	106	12	using	use	VBG
cord-002369-shk4n8f6	106	13	a	a	DT
cord-002369-shk4n8f6	106	14	specific	specific	JJ
cord-002369-shk4n8f6	106	15	antibody	antibody	NN
cord-002369-shk4n8f6	106	16	against	against	IN
cord-002369-shk4n8f6	106	17	the	the	DT
cord-002369-shk4n8f6	106	18	HA	HA	NNP
cord-002369-shk4n8f6	106	19	-	-	HYPH
cord-002369-shk4n8f6	106	20	tag	tag	NN
cord-002369-shk4n8f6	106	21	of	of	IN
cord-002369-shk4n8f6	106	22	the	the	DT
cord-002369-shk4n8f6	106	23	HCV	HCV	NNP
cord-002369-shk4n8f6	106	24	NS4B	NS4B	NNP
cord-002369-shk4n8f6	106	25	protein	protein	NN
cord-002369-shk4n8f6	106	26	.	.	.
cord-002369-shk4n8f6	107	1	Subsequently	subsequently	RB
cord-002369-shk4n8f6	107	2	,	,	,
cord-002369-shk4n8f6	107	3	the	the	DT
cord-002369-shk4n8f6	107	4	MW	mw	NN
cord-002369-shk4n8f6	107	5	-	-	HYPH
cord-002369-shk4n8f6	107	6	enriched	enrich	VBN
cord-002369-shk4n8f6	107	7	extract	extract	NN
cord-002369-shk4n8f6	107	8	was	be	VBD
cord-002369-shk4n8f6	107	9	used	use	VBN
cord-002369-shk4n8f6	107	10	for	for	IN
cord-002369-shk4n8f6	107	11	either	either	DT
cord-002369-shk4n8f6	107	12	western	western	JJ
cord-002369-shk4n8f6	107	13	blot	blot	NN
cord-002369-shk4n8f6	107	14	analysis	analysis	NN
cord-002369-shk4n8f6	107	15	or	or	CC
cord-002369-shk4n8f6	107	16	vesicle	vesicle	NN
cord-002369-shk4n8f6	107	17	visualization	visualization	NN
cord-002369-shk4n8f6	107	18	by	by	IN
cord-002369-shk4n8f6	107	19	transmission	transmission	NN
cord-002369-shk4n8f6	107	20	electron	electron	NN
cord-002369-shk4n8f6	107	21	microscopy	microscopy	NN
cord-002369-shk4n8f6	107	22	(	(	-LRB-
cord-002369-shk4n8f6	107	23	TEM	TEM	NNP
cord-002369-shk4n8f6	107	24	)	)	-RRB-
cord-002369-shk4n8f6	107	25	.	.	.
cord-002369-shk4n8f6	108	1	As	as	IN
cord-002369-shk4n8f6	108	2	expected	expect	VBN
cord-002369-shk4n8f6	108	3	,	,	,
cord-002369-shk4n8f6	108	4	HCV	HCV	NNP
cord-002369-shk4n8f6	108	5	NS4B	NS4B	NNP
cord-002369-shk4n8f6	108	6	HA	HA	NNP
cord-002369-shk4n8f6	108	7	,	,	,
cord-002369-shk4n8f6	108	8	NS3	ns3	RB
cord-002369-shk4n8f6	108	9	and	and	CC
cord-002369-shk4n8f6	108	10	NS5A	NS5A	NNS
cord-002369-shk4n8f6	108	11	were	be	VBD
cord-002369-shk4n8f6	108	12	readily	readily	RB
cord-002369-shk4n8f6	108	13	detectable	detectable	JJ
cord-002369-shk4n8f6	108	14	in	in	IN
cord-002369-shk4n8f6	108	15	the	the	DT
cord-002369-shk4n8f6	108	16	purified	purify	VBN
cord-002369-shk4n8f6	108	17	extract	extract	NN
cord-002369-shk4n8f6	108	18	from	from	IN
cord-002369-shk4n8f6	108	19	NS4B	NS4B	NNP
cord-002369-shk4n8f6	108	20	HA	HA	NNP
cord-002369-shk4n8f6	108	21	replicon	replicon	NN
cord-002369-shk4n8f6	108	22	cells	cell	NNS
cord-002369-shk4n8f6	108	23	but	but	CC
cord-002369-shk4n8f6	108	24	not	not	RB
cord-002369-shk4n8f6	108	25	that	that	IN
cord-002369-shk4n8f6	108	26	from	from	IN
cord-002369-shk4n8f6	108	27	control	control	NN
cord-002369-shk4n8f6	108	28	untagged	untagged	JJ
cord-002369-shk4n8f6	109	1	NS4B	NS4B	NNP
cord-002369-shk4n8f6	109	2	replicon	replicon	NN
cord-002369-shk4n8f6	109	3	cells	cell	NNS
cord-002369-shk4n8f6	109	4	(	(	-LRB-
cord-002369-shk4n8f6	109	5	Fig	Fig	NNP
cord-002369-shk4n8f6	109	6	.	.	.
cord-002369-shk4n8f6	109	7	4B	4b	CD
cord-002369-shk4n8f6	109	8	)	)	-RRB-
cord-002369-shk4n8f6	109	9	.	.	.
cord-002369-shk4n8f6	110	1	The	the	DT
cord-002369-shk4n8f6	110	2	autophagy	autophagy	NN
cord-002369-shk4n8f6	110	3	elongation	elongation	NN
cord-002369-shk4n8f6	110	4	complex	complex	JJ
cord-002369-shk4n8f6	110	5	proteins	protein	NNS
cord-002369-shk4n8f6	110	6	(	(	-LRB-
cord-002369-shk4n8f6	110	7	ATG5	ATG5	NNP
cord-002369-shk4n8f6	110	8	-	-	HYPH
cord-002369-shk4n8f6	110	9	12	12	CD
cord-002369-shk4n8f6	110	10	and	and	CC
cord-002369-shk4n8f6	110	11	ATG16L1	ATG16L1	NNS
cord-002369-shk4n8f6	110	12	)	)	-RRB-
cord-002369-shk4n8f6	110	13	were	be	VBD
cord-002369-shk4n8f6	110	14	also	also	RB
cord-002369-shk4n8f6	110	15	detected	detect	VBN
cord-002369-shk4n8f6	110	16	in	in	IN
cord-002369-shk4n8f6	110	17	the	the	DT
cord-002369-shk4n8f6	110	18	purified	purify	VBN
cord-002369-shk4n8f6	110	19	MW	mw	NN
cord-002369-shk4n8f6	110	20	from	from	IN
cord-002369-shk4n8f6	110	21	NS4B	NS4B	NNP
cord-002369-shk4n8f6	110	22	HA	HA	NNP
cord-002369-shk4n8f6	110	23	replicon	replicon	NN
cord-002369-shk4n8f6	110	24	cells	cell	NNS
cord-002369-shk4n8f6	110	25	,	,	,
cord-002369-shk4n8f6	110	26	but	but	CC
cord-002369-shk4n8f6	110	27	not	not	RB
cord-002369-shk4n8f6	110	28	in	in	IN
cord-002369-shk4n8f6	110	29	the	the	DT
cord-002369-shk4n8f6	110	30	control	control	NN
cord-002369-shk4n8f6	110	31	extract	extract	NN
cord-002369-shk4n8f6	110	32	,	,	,
cord-002369-shk4n8f6	110	33	thus	thus	RB
cord-002369-shk4n8f6	110	34	indicating	indicate	VBG
cord-002369-shk4n8f6	110	35	that	that	IN
cord-002369-shk4n8f6	110	36	the	the	DT
cord-002369-shk4n8f6	110	37	elongation	elongation	NN
cord-002369-shk4n8f6	110	38	complex	complex	NN
cord-002369-shk4n8f6	110	39	is	be	VBZ
cord-002369-shk4n8f6	110	40	indeed	indeed	RB
cord-002369-shk4n8f6	110	41	present	present	JJ
cord-002369-shk4n8f6	110	42	at	at	IN
cord-002369-shk4n8f6	110	43	the	the	DT
cord-002369-shk4n8f6	110	44	HCV	HCV	NNP
cord-002369-shk4n8f6	110	45	replication	replication	NN
cord-002369-shk4n8f6	110	46	site	site	NN
cord-002369-shk4n8f6	110	47	.	.	.
cord-002369-shk4n8f6	111	1	In	in	IN
cord-002369-shk4n8f6	111	2	contrast	contrast	NN
cord-002369-shk4n8f6	111	3	,	,	,
cord-002369-shk4n8f6	111	4	we	-PRON-	PRP
cord-002369-shk4n8f6	111	5	were	be	VBD
cord-002369-shk4n8f6	111	6	unable	unable	JJ
cord-002369-shk4n8f6	111	7	to	to	TO
cord-002369-shk4n8f6	111	8	detect	detect	VB
cord-002369-shk4n8f6	111	9	LC3II	LC3II	NNPS
cord-002369-shk4n8f6	111	10	in	in	IN
cord-002369-shk4n8f6	111	11	the	the	DT
cord-002369-shk4n8f6	111	12	purified	purify	VBN
cord-002369-shk4n8f6	111	13	MW	mw	NN
cord-002369-shk4n8f6	111	14	(	(	-LRB-
cord-002369-shk4n8f6	111	15	Fig	fig	NN
cord-002369-shk4n8f6	111	16	.	.	.
cord-002369-shk4n8f6	111	17	4B	4B	NNP
cord-002369-shk4n8f6	111	18	)	)	-RRB-
cord-002369-shk4n8f6	111	19	,	,	,
cord-002369-shk4n8f6	111	20	thereby	thereby	RB
cord-002369-shk4n8f6	111	21	suggesting	suggest	VBG
cord-002369-shk4n8f6	111	22	that	that	IN
cord-002369-shk4n8f6	111	23	LC3	LC3	NNP
cord-002369-shk4n8f6	111	24	is	be	VBZ
cord-002369-shk4n8f6	111	25	not	not	RB
cord-002369-shk4n8f6	111	26	recruited	recruit	VBN
cord-002369-shk4n8f6	111	27	with	with	IN
cord-002369-shk4n8f6	111	28	the	the	DT
cord-002369-shk4n8f6	111	29	autophagy	autophagy	NN
cord-002369-shk4n8f6	111	30	elongation	elongation	NN
cord-002369-shk4n8f6	111	31	complex	complex	JJ
cord-002369-shk4n8f6	111	32	to	to	IN
cord-002369-shk4n8f6	111	33	the	the	DT
cord-002369-shk4n8f6	111	34	MW	MW	NNP
cord-002369-shk4n8f6	111	35	.	.	.
cord-002369-shk4n8f6	112	1	We	-PRON-	PRP
cord-002369-shk4n8f6	112	2	then	then	RB
cord-002369-shk4n8f6	112	3	examined	examine	VBD
cord-002369-shk4n8f6	112	4	the	the	DT
cord-002369-shk4n8f6	112	5	morphology	morphology	NN
cord-002369-shk4n8f6	112	6	of	of	IN
cord-002369-shk4n8f6	112	7	purified	purify	VBN
cord-002369-shk4n8f6	112	8	membranes	membrane	NNS
cord-002369-shk4n8f6	112	9	and	and	CC
cord-002369-shk4n8f6	112	10	compared	compare	VBD
cord-002369-shk4n8f6	112	11	them	-PRON-	PRP
cord-002369-shk4n8f6	112	12	with	with	IN
cord-002369-shk4n8f6	112	13	ER	ER	NNP
cord-002369-shk4n8f6	112	14	membranes	membrane	NNS
cord-002369-shk4n8f6	112	15	purified	purify	VBN
cord-002369-shk4n8f6	112	16	from	from	IN
cord-002369-shk4n8f6	112	17	a	a	DT
cord-002369-shk4n8f6	112	18	cell	cell	NN
cord-002369-shk4n8f6	112	19	line	line	NN
cord-002369-shk4n8f6	112	20	expressing	express	VBG
cord-002369-shk4n8f6	112	21	HA	HA	NNP
cord-002369-shk4n8f6	112	22	-	-	HYPH
cord-002369-shk4n8f6	112	23	tagged	tag	VBN
cord-002369-shk4n8f6	112	24	Calnexin	Calnexin	NNP
cord-002369-shk4n8f6	112	25	,	,	,
cord-002369-shk4n8f6	112	26	as	as	IN
cord-002369-shk4n8f6	112	27	previously	previously	RB
cord-002369-shk4n8f6	112	28	described	describe	VBN
cord-002369-shk4n8f6	112	29	42	42	CD
cord-002369-shk4n8f6	112	30	.	.	.
cord-002369-shk4n8f6	113	1	The	the	DT
cord-002369-shk4n8f6	113	2	results	result	NNS
cord-002369-shk4n8f6	113	3	showed	show	VBD
cord-002369-shk4n8f6	113	4	that	that	IN
cord-002369-shk4n8f6	113	5	almost	almost	RB
cord-002369-shk4n8f6	113	6	90	90	CD
cord-002369-shk4n8f6	113	7	%	%	NN
cord-002369-shk4n8f6	113	8	of	of	IN
cord-002369-shk4n8f6	113	9	the	the	DT
cord-002369-shk4n8f6	113	10	NS4B	NS4B	NNP
cord-002369-shk4n8f6	113	11	HA	HA	NNP
cord-002369-shk4n8f6	113	12	purified	purify	VBN
cord-002369-shk4n8f6	113	13	membranes	membrane	NNS
cord-002369-shk4n8f6	113	14	were	be	VBD
cord-002369-shk4n8f6	113	15	spherical	spherical	JJ
cord-002369-shk4n8f6	113	16	vesicles	vesicle	NNS
cord-002369-shk4n8f6	113	17	as	as	IN
cord-002369-shk4n8f6	113	18	compared	compare	VBN
cord-002369-shk4n8f6	113	19	with	with	IN
cord-002369-shk4n8f6	113	20	CLNXN	CLNXN	NNP
cord-002369-shk4n8f6	113	21	HA	HA	NNP
cord-002369-shk4n8f6	113	22	purified	purify	VBN
cord-002369-shk4n8f6	113	23	material	material	NN
cord-002369-shk4n8f6	113	24	,	,	,
cord-002369-shk4n8f6	113	25	in	in	IN
cord-002369-shk4n8f6	113	26	which	which	WDT
cord-002369-shk4n8f6	113	27	the	the	DT
cord-002369-shk4n8f6	113	28	majority	majority	NN
cord-002369-shk4n8f6	113	29	of	of	IN
cord-002369-shk4n8f6	113	30	membranes	membrane	NNS
cord-002369-shk4n8f6	113	31	were	be	VBD
cord-002369-shk4n8f6	113	32	composed	compose	VBN
cord-002369-shk4n8f6	113	33	of	of	IN
cord-002369-shk4n8f6	113	34	partially	partially	RB
cord-002369-shk4n8f6	113	35	collapsed	collapse	VBN
cord-002369-shk4n8f6	113	36	large	large	JJ
cord-002369-shk4n8f6	113	37	membranes	membrane	NNS
cord-002369-shk4n8f6	113	38	(	(	-LRB-
cord-002369-shk4n8f6	113	39	Fig	Fig	NNP
cord-002369-shk4n8f6	113	40	.	.	.
cord-002369-shk4n8f6	113	41	5A	5a	NN
cord-002369-shk4n8f6	113	42	,	,	,
cord-002369-shk4n8f6	113	43	B	b	NN
cord-002369-shk4n8f6	113	44	)	)	-RRB-
cord-002369-shk4n8f6	113	45	.	.	.
cord-002369-shk4n8f6	114	1	Our	-PRON-	PRP$
cord-002369-shk4n8f6	114	2	results	result	NNS
cord-002369-shk4n8f6	114	3	are	be	VBP
cord-002369-shk4n8f6	114	4	in	in	IN
cord-002369-shk4n8f6	114	5	agreement	agreement	NN
cord-002369-shk4n8f6	114	6	with	with	IN
cord-002369-shk4n8f6	114	7	those	those	DT
cord-002369-shk4n8f6	114	8	of	of	IN
cord-002369-shk4n8f6	114	9	Paul	Paul	NNP
cord-002369-shk4n8f6	114	10	and	and	CC
cord-002369-shk4n8f6	114	11	colleagues	colleague	NNS
cord-002369-shk4n8f6	114	12	,	,	,
cord-002369-shk4n8f6	114	13	who	who	WP
cord-002369-shk4n8f6	114	14	have	have	VBP
cord-002369-shk4n8f6	114	15	demonstrated	demonstrate	VBN
cord-002369-shk4n8f6	114	16	that	that	IN
cord-002369-shk4n8f6	114	17	most	most	JJS
cord-002369-shk4n8f6	114	18	of	of	IN
cord-002369-shk4n8f6	114	19	the	the	DT
cord-002369-shk4n8f6	114	20	purified	purify	VBN
cord-002369-shk4n8f6	114	21	ER	ER	NNP
cord-002369-shk4n8f6	114	22	membranes	membrane	NNS
cord-002369-shk4n8f6	114	23	are	be	VBP
cord-002369-shk4n8f6	114	24	composed	compose	VBN
cord-002369-shk4n8f6	114	25	of	of	IN
cord-002369-shk4n8f6	114	26	elongated	elongated	JJ
cord-002369-shk4n8f6	114	27	structures	structure	NNS
cord-002369-shk4n8f6	114	28	,	,	,
cord-002369-shk4n8f6	114	29	as	as	IN
cord-002369-shk4n8f6	114	30	opposed	oppose	VBN
cord-002369-shk4n8f6	114	31	to	to	IN
cord-002369-shk4n8f6	114	32	the	the	DT
cord-002369-shk4n8f6	114	33	spherical	spherical	JJ
cord-002369-shk4n8f6	114	34	vesicles	vesicle	NNS
cord-002369-shk4n8f6	114	35	found	find	VBN
cord-002369-shk4n8f6	114	36	in	in	IN
cord-002369-shk4n8f6	114	37	MW	MW	NNP
cord-002369-shk4n8f6	114	38	extracts	extract	VBZ
cord-002369-shk4n8f6	114	39	42	42	CD
cord-002369-shk4n8f6	114	40	.	.	.
cord-002369-shk4n8f6	115	1	Finally	finally	RB
cord-002369-shk4n8f6	115	2	,	,	,
cord-002369-shk4n8f6	115	3	the	the	DT
cord-002369-shk4n8f6	115	4	specificity	specificity	NN
cord-002369-shk4n8f6	115	5	of	of	IN
cord-002369-shk4n8f6	115	6	the	the	DT
cord-002369-shk4n8f6	115	7	pull	pull	NN
cord-002369-shk4n8f6	115	8	-	-	HYPH
cord-002369-shk4n8f6	115	9	down	down	NN
cord-002369-shk4n8f6	115	10	using	use	VBG
cord-002369-shk4n8f6	115	11	HA	HA	NNP
cord-002369-shk4n8f6	115	12	-	-	HYPH
cord-002369-shk4n8f6	115	13	beads	bead	NNS
cord-002369-shk4n8f6	115	14	was	be	VBD
cord-002369-shk4n8f6	115	15	confirmed	confirm	VBN
cord-002369-shk4n8f6	115	16	by	by	IN
cord-002369-shk4n8f6	115	17	using	use	VBG
cord-002369-shk4n8f6	115	18	extracts	extract	NNS
cord-002369-shk4n8f6	115	19	from	from	IN
cord-002369-shk4n8f6	115	20	untagged	untagged	JJ
cord-002369-shk4n8f6	115	21	SGR	SGR	NNP
cord-002369-shk4n8f6	115	22	cells	cell	NNS
cord-002369-shk4n8f6	115	23	(	(	-LRB-
cord-002369-shk4n8f6	115	24	Fig	Fig	NNP
cord-002369-shk4n8f6	115	25	.	.	.
cord-002369-shk4n8f6	115	26	5C	5c	CD
cord-002369-shk4n8f6	115	27	)	)	-RRB-
cord-002369-shk4n8f6	115	28	.	.	.
cord-002369-shk4n8f6	116	1	Altogether	altogether	RB
cord-002369-shk4n8f6	116	2	,	,	,
cord-002369-shk4n8f6	116	3	these	these	DT
cord-002369-shk4n8f6	116	4	results	result	NNS
cord-002369-shk4n8f6	116	5	indicate	indicate	VBP
cord-002369-shk4n8f6	116	6	that	that	IN
cord-002369-shk4n8f6	116	7	at	at	IN
cord-002369-shk4n8f6	116	8	least	least	JJS
cord-002369-shk4n8f6	116	9	a	a	DT
cord-002369-shk4n8f6	116	10	fraction	fraction	NN
cord-002369-shk4n8f6	116	11	of	of	IN
cord-002369-shk4n8f6	116	12	the	the	DT
cord-002369-shk4n8f6	116	13	autophagy	autophagy	NN
cord-002369-shk4n8f6	116	14	elongation	elongation	NN
cord-002369-shk4n8f6	116	15	complex	complex	NN
cord-002369-shk4n8f6	116	16	is	be	VBZ
cord-002369-shk4n8f6	116	17	localized	localize	VBN
cord-002369-shk4n8f6	116	18	in	in	IN
cord-002369-shk4n8f6	116	19	the	the	DT
cord-002369-shk4n8f6	116	20	virus	virus	NN
cord-002369-shk4n8f6	116	21	-	-	HYPH
cord-002369-shk4n8f6	116	22	induced	induce	VBN
cord-002369-shk4n8f6	116	23	MW	MW	NNP
cord-002369-shk4n8f6	116	24	compartments	compartment	NNS
cord-002369-shk4n8f6	116	25	.	.	.
cord-002369-shk4n8f6	117	1	Silencing	silencing	NN
cord-002369-shk4n8f6	117	2	of	of	IN
cord-002369-shk4n8f6	117	3	ATG12	ATG12	NNP
cord-002369-shk4n8f6	117	4	or	or	CC
cord-002369-shk4n8f6	117	5	ATG7	ATG7	NNP
cord-002369-shk4n8f6	117	6	,	,	,
cord-002369-shk4n8f6	117	7	but	but	CC
cord-002369-shk4n8f6	117	8	not	not	RB
cord-002369-shk4n8f6	117	9	LC3	LC3	NNP
cord-002369-shk4n8f6	117	10	,	,	,
cord-002369-shk4n8f6	117	11	alters	alter	VBZ
cord-002369-shk4n8f6	117	12	the	the	DT
cord-002369-shk4n8f6	117	13	phenotype	phenotype	NN
cord-002369-shk4n8f6	117	14	of	of	IN
cord-002369-shk4n8f6	117	15	the	the	DT
cord-002369-shk4n8f6	117	16	MW	MW	NNP
cord-002369-shk4n8f6	117	17	.	.	.
cord-002369-shk4n8f6	118	1	To	to	TO
cord-002369-shk4n8f6	118	2	evaluate	evaluate	VB
cord-002369-shk4n8f6	118	3	the	the	DT
cord-002369-shk4n8f6	118	4	putative	putative	JJ
cord-002369-shk4n8f6	118	5	role	role	NN
cord-002369-shk4n8f6	118	6	of	of	IN
cord-002369-shk4n8f6	118	7	host	host	NN
cord-002369-shk4n8f6	118	8	cell	cell	NN
cord-002369-shk4n8f6	118	9	proteins	protein	NNS
cord-002369-shk4n8f6	118	10	in	in	IN
cord-002369-shk4n8f6	118	11	MW	MW	NNP
cord-002369-shk4n8f6	118	12	formation	formation	NN
cord-002369-shk4n8f6	118	13	,	,	,
cord-002369-shk4n8f6	118	14	Reiss	Reiss	NNP
cord-002369-shk4n8f6	118	15	and	and	CC
cord-002369-shk4n8f6	118	16	colleagues	colleague	NNS
cord-002369-shk4n8f6	118	17	have	have	VBP
cord-002369-shk4n8f6	118	18	established	establish	VBN
cord-002369-shk4n8f6	118	19	a	a	DT
cord-002369-shk4n8f6	118	20	T7-polymerase	t7-polymerase	NN
cord-002369-shk4n8f6	118	21	-	-	HYPH
cord-002369-shk4n8f6	118	22	based	base	VBN
cord-002369-shk4n8f6	118	23	Specific	specific	JJ
cord-002369-shk4n8f6	118	24	antibodies	antibody	NNS
cord-002369-shk4n8f6	118	25	were	be	VBD
cord-002369-shk4n8f6	118	26	used	use	VBN
cord-002369-shk4n8f6	118	27	to	to	TO
cord-002369-shk4n8f6	118	28	detect	detect	VB
cord-002369-shk4n8f6	118	29	NS3	ns3	RB
cord-002369-shk4n8f6	118	30	,	,	,
cord-002369-shk4n8f6	118	31	NS4B	NS4B	NNP
cord-002369-shk4n8f6	118	32	HA	HA	NNP
cord-002369-shk4n8f6	118	33	,	,	,
cord-002369-shk4n8f6	118	34	NS5A	NS5A	NNP
cord-002369-shk4n8f6	118	35	,	,	,
cord-002369-shk4n8f6	118	36	LC3	LC3	NNP
cord-002369-shk4n8f6	118	37	and	and	CC
cord-002369-shk4n8f6	118	38	GAPDH	GAPDH	NNP
cord-002369-shk4n8f6	118	39	as	as	IN
cord-002369-shk4n8f6	118	40	indicated	indicate	VBN
cord-002369-shk4n8f6	118	41	on	on	IN
cord-002369-shk4n8f6	118	42	the	the	DT
cord-002369-shk4n8f6	118	43	left	left	NN
cord-002369-shk4n8f6	118	44	.	.	.
cord-002369-shk4n8f6	119	1	Fractions	fraction	NNS
cord-002369-shk4n8f6	119	2	containing	contain	VBG
cord-002369-shk4n8f6	119	3	membrane	membrane	NN
cord-002369-shk4n8f6	119	4	-	-	HYPH
cord-002369-shk4n8f6	119	5	associated	associate	VBN
cord-002369-shk4n8f6	119	6	proteins	protein	NNS
cord-002369-shk4n8f6	119	7	(	(	-LRB-
cord-002369-shk4n8f6	119	8	boxed	box	VBN
cord-002369-shk4n8f6	119	9	in	in	IN
cord-002369-shk4n8f6	119	10	red	red	JJ
cord-002369-shk4n8f6	119	11	)	)	-RRB-
cord-002369-shk4n8f6	119	12	were	be	VBD
cord-002369-shk4n8f6	119	13	pooled	pool	VBN
cord-002369-shk4n8f6	119	14	for	for	IN
cord-002369-shk4n8f6	119	15	affinity	affinity	NN
cord-002369-shk4n8f6	119	16	capture	capture	NN
cord-002369-shk4n8f6	119	17	immunoprecipitation	immunoprecipitation	NN
cord-002369-shk4n8f6	119	18	.	.	.
cord-002369-shk4n8f6	120	1	The	the	DT
cord-002369-shk4n8f6	120	2	density	density	NN
cord-002369-shk4n8f6	120	3	of	of	IN
cord-002369-shk4n8f6	120	4	the	the	DT
cord-002369-shk4n8f6	120	5	different	different	JJ
cord-002369-shk4n8f6	120	6	fractions	fraction	NNS
cord-002369-shk4n8f6	120	7	is	be	VBZ
cord-002369-shk4n8f6	120	8	shown	show	VBN
cord-002369-shk4n8f6	120	9	in	in	IN
cord-002369-shk4n8f6	120	10	the	the	DT
cord-002369-shk4n8f6	120	11	lower	low	JJR
cord-002369-shk4n8f6	120	12	panel	panel	NN
cord-002369-shk4n8f6	120	13	.	.	.
cord-002369-shk4n8f6	121	1	TCL	TCL	NNP
cord-002369-shk4n8f6	121	2	,	,	,
cord-002369-shk4n8f6	121	3	total	total	JJ
cord-002369-shk4n8f6	121	4	cell	cell	NN
cord-002369-shk4n8f6	121	5	lysate	lysate	NN
cord-002369-shk4n8f6	121	6	.	.	.
cord-002369-shk4n8f6	122	1	(	(	-LRB-
cord-002369-shk4n8f6	122	2	B	b	NN
cord-002369-shk4n8f6	122	3	)	)	-RRB-
cord-002369-shk4n8f6	122	4	HA	HA	NNP
cord-002369-shk4n8f6	122	5	-	-	HYPH
cord-002369-shk4n8f6	122	6	specific	specific	JJ
cord-002369-shk4n8f6	122	7	affinitycaptured	affinitycaptured	JJ
cord-002369-shk4n8f6	122	8	protein	protein	NN
cord-002369-shk4n8f6	122	9	content	content	NN
cord-002369-shk4n8f6	122	10	from	from	IN
cord-002369-shk4n8f6	122	11	pooled	pool	VBN
cord-002369-shk4n8f6	122	12	fraction	fraction	NN
cord-002369-shk4n8f6	122	13	in	in	IN
cord-002369-shk4n8f6	122	14	(	(	-LRB-
cord-002369-shk4n8f6	122	15	A	a	NN
cord-002369-shk4n8f6	122	16	)	)	-RRB-
cord-002369-shk4n8f6	122	17	was	be	VBD
cord-002369-shk4n8f6	122	18	analyzed	analyze	VBN
cord-002369-shk4n8f6	122	19	by	by	IN
cord-002369-shk4n8f6	122	20	western	western	JJ
cord-002369-shk4n8f6	122	21	blotting	blotting	NN
cord-002369-shk4n8f6	122	22	to	to	TO
cord-002369-shk4n8f6	122	23	detect	detect	VB
cord-002369-shk4n8f6	122	24	viral	viral	JJ
cord-002369-shk4n8f6	122	25	NS3	ns3	RB
cord-002369-shk4n8f6	122	26	,	,	,
cord-002369-shk4n8f6	123	1	NS4B	NS4B	NNP
cord-002369-shk4n8f6	123	2	,	,	,
cord-002369-shk4n8f6	123	3	NS5A	NS5A	NNP
cord-002369-shk4n8f6	123	4	and	and	CC
cord-002369-shk4n8f6	123	5	autophagy	autophagy	NN
cord-002369-shk4n8f6	123	6	elongation	elongation	NN
cord-002369-shk4n8f6	123	7	complex	complex	JJ
cord-002369-shk4n8f6	124	1	ATG5	ATG5	NNP
cord-002369-shk4n8f6	124	2	-	-	HYPH
cord-002369-shk4n8f6	124	3	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	124	4	by	by	IN
cord-002369-shk4n8f6	124	5	using	use	VBG
cord-002369-shk4n8f6	124	6	specific	specific	JJ
cord-002369-shk4n8f6	124	7	antibodies	antibody	NNS
cord-002369-shk4n8f6	124	8	.	.	.
cord-002369-shk4n8f6	125	1	Pooled	pool	VBN
cord-002369-shk4n8f6	125	2	fractions	fraction	NNS
cord-002369-shk4n8f6	125	3	from	from	IN
cord-002369-shk4n8f6	125	4	SGR	SGR	NNP
cord-002369-shk4n8f6	125	5	cell	cell	NN
cord-002369-shk4n8f6	125	6	lysate	lysate	NN
cord-002369-shk4n8f6	125	7	was	be	VBD
cord-002369-shk4n8f6	125	8	used	use	VBN
cord-002369-shk4n8f6	125	9	to	to	TO
cord-002369-shk4n8f6	125	10	demonstrate	demonstrate	VB
cord-002369-shk4n8f6	125	11	pull	pull	VB
cord-002369-shk4n8f6	125	12	-	-	HYPH
cord-002369-shk4n8f6	125	13	down	down	RP
cord-002369-shk4n8f6	125	14	specificity	specificity	NN
cord-002369-shk4n8f6	125	15	.	.	.
cord-002369-shk4n8f6	126	1	HCV	HCV	NNP
cord-002369-shk4n8f6	126	2	RNA	RNA	NNP
cord-002369-shk4n8f6	126	3	synthesis	synthesis	NN
cord-002369-shk4n8f6	126	4	system	system	NN
cord-002369-shk4n8f6	126	5	in	in	IN
cord-002369-shk4n8f6	126	6	which	which	WDT
cord-002369-shk4n8f6	126	7	continuous	continuous	JJ
cord-002369-shk4n8f6	126	8	production	production	NN
cord-002369-shk4n8f6	126	9	of	of	IN
cord-002369-shk4n8f6	126	10	HCV	HCV	NNP
cord-002369-shk4n8f6	126	11	polyproteins	polyprotein	NNS
cord-002369-shk4n8f6	126	12	persists	persist	VBZ
cord-002369-shk4n8f6	126	13	even	even	RB
cord-002369-shk4n8f6	126	14	when	when	WRB
cord-002369-shk4n8f6	126	15	HCV	HCV	NNP
cord-002369-shk4n8f6	126	16	replication	replication	NN
cord-002369-shk4n8f6	126	17	is	be	VBZ
cord-002369-shk4n8f6	126	18	abrogated	abrogate	VBN
cord-002369-shk4n8f6	126	19	43	43	CD
cord-002369-shk4n8f6	126	20	.	.	.
cord-002369-shk4n8f6	127	1	This	this	DT
cord-002369-shk4n8f6	127	2	system	system	NN
cord-002369-shk4n8f6	127	3	is	be	VBZ
cord-002369-shk4n8f6	127	4	particularly	particularly	RB
cord-002369-shk4n8f6	127	5	useful	useful	JJ
cord-002369-shk4n8f6	127	6	to	to	TO
cord-002369-shk4n8f6	127	7	evaluate	evaluate	VB
cord-002369-shk4n8f6	127	8	the	the	DT
cord-002369-shk4n8f6	127	9	formation	formation	NN
cord-002369-shk4n8f6	127	10	of	of	IN
cord-002369-shk4n8f6	127	11	the	the	DT
cord-002369-shk4n8f6	127	12	MW	MW	NNP
cord-002369-shk4n8f6	127	13	while	while	IN
cord-002369-shk4n8f6	127	14	targeting	target	VBG
cord-002369-shk4n8f6	127	15	host	host	NN
cord-002369-shk4n8f6	127	16	cell	cell	NN
cord-002369-shk4n8f6	127	17	proteins	protein	NNS
cord-002369-shk4n8f6	127	18	in	in	IN
cord-002369-shk4n8f6	127	19	the	the	DT
cord-002369-shk4n8f6	127	20	absence	absence	NN
cord-002369-shk4n8f6	127	21	of	of	IN
cord-002369-shk4n8f6	127	22	HCV	HCV	NNP
cord-002369-shk4n8f6	127	23	RNA	RNA	NNP
cord-002369-shk4n8f6	127	24	replication	replication	NN
cord-002369-shk4n8f6	127	25	.	.	.
cord-002369-shk4n8f6	128	1	With	with	IN
cord-002369-shk4n8f6	128	2	this	this	DT
cord-002369-shk4n8f6	128	3	system	system	NN
cord-002369-shk4n8f6	128	4	,	,	,
cord-002369-shk4n8f6	128	5	it	-PRON-	PRP
cord-002369-shk4n8f6	128	6	has	have	VBZ
cord-002369-shk4n8f6	128	7	been	be	VBN
cord-002369-shk4n8f6	128	8	shown	show	VBN
cord-002369-shk4n8f6	128	9	that	that	IN
cord-002369-shk4n8f6	128	10	alterations	alteration	NNS
cord-002369-shk4n8f6	128	11	in	in	IN
cord-002369-shk4n8f6	128	12	MW	mw	NN
cord-002369-shk4n8f6	128	13	formation	formation	NN
cord-002369-shk4n8f6	128	14	result	result	NN
cord-002369-shk4n8f6	128	15	in	in	IN
cord-002369-shk4n8f6	128	16	a	a	DT
cord-002369-shk4n8f6	128	17	clustered	clustered	JJ
cord-002369-shk4n8f6	128	18	phenotype	phenotype	NN
cord-002369-shk4n8f6	128	19	of	of	IN
cord-002369-shk4n8f6	128	20	HCV	HCV	NNP
cord-002369-shk4n8f6	128	21	nonstructural	nonstructural	JJ
cord-002369-shk4n8f6	128	22	proteins	protein	NNS
cord-002369-shk4n8f6	128	23	43	43	CD
cord-002369-shk4n8f6	128	24	,	,	,
cord-002369-shk4n8f6	128	25	44	44	CD
cord-002369-shk4n8f6	128	26	.	.	.
cord-002369-shk4n8f6	129	1	Thus	thus	RB
cord-002369-shk4n8f6	129	2	,	,	,
cord-002369-shk4n8f6	129	3	using	use	VBG
cord-002369-shk4n8f6	129	4	the	the	DT
cord-002369-shk4n8f6	129	5	same	same	JJ
cord-002369-shk4n8f6	129	6	system	system	NN
cord-002369-shk4n8f6	129	7	(	(	-LRB-
cord-002369-shk4n8f6	129	8	obtained	obtain	VBN
cord-002369-shk4n8f6	129	9	from	from	IN
cord-002369-shk4n8f6	129	10	Dr.	Dr.	NNP
cord-002369-shk4n8f6	129	11	Volker	Volker	NNP
cord-002369-shk4n8f6	129	12	Lohmann	Lohmann	NNP
cord-002369-shk4n8f6	129	13	)	)	-RRB-
cord-002369-shk4n8f6	129	14	,	,	,
cord-002369-shk4n8f6	129	15	we	-PRON-	PRP
cord-002369-shk4n8f6	129	16	analyzed	analyze	VBD
cord-002369-shk4n8f6	129	17	MW	MW	NNP
cord-002369-shk4n8f6	129	18	formation	formation	NN
cord-002369-shk4n8f6	129	19	indirectly	indirectly	RB
cord-002369-shk4n8f6	129	20	by	by	IN
cord-002369-shk4n8f6	129	21	monitoring	monitor	VBG
cord-002369-shk4n8f6	129	22	viral	viral	JJ
cord-002369-shk4n8f6	129	23	protein	protein	NN
cord-002369-shk4n8f6	129	24	localization	localization	NN
cord-002369-shk4n8f6	129	25	after	after	IN
cord-002369-shk4n8f6	129	26	treatment	treatment	NN
cord-002369-shk4n8f6	129	27	with	with	IN
cord-002369-shk4n8f6	129	28	siLC3	siLC3	NNP
cord-002369-shk4n8f6	129	29	,	,	,
cord-002369-shk4n8f6	129	30	siATG7	siATG7	NNP
cord-002369-shk4n8f6	129	31	and	and	CC
cord-002369-shk4n8f6	129	32	siATG12	siATG12	NNP
cord-002369-shk4n8f6	129	33	.	.	.
cord-002369-shk4n8f6	130	1	Under	under	IN
cord-002369-shk4n8f6	130	2	normal	normal	JJ
cord-002369-shk4n8f6	130	3	conditions	condition	NNS
cord-002369-shk4n8f6	130	4	,	,	,
cord-002369-shk4n8f6	130	5	the	the	DT
cord-002369-shk4n8f6	130	6	NS3	ns3	NN
cord-002369-shk4n8f6	130	7	and	and	CC
cord-002369-shk4n8f6	130	8	NS5A	NS5A	NNP
cord-002369-shk4n8f6	130	9	cellular	cellular	JJ
cord-002369-shk4n8f6	130	10	distribution	distribution	NN
cord-002369-shk4n8f6	130	11	appeared	appear	VBD
cord-002369-shk4n8f6	130	12	as	as	IN
cord-002369-shk4n8f6	130	13	small	small	JJ
cord-002369-shk4n8f6	130	14	punctate	punctate	NN
cord-002369-shk4n8f6	130	15	structures	structure	NNS
cord-002369-shk4n8f6	130	16	that	that	WDT
cord-002369-shk4n8f6	130	17	appeared	appear	VBD
cord-002369-shk4n8f6	130	18	to	to	TO
cord-002369-shk4n8f6	130	19	be	be	VB
cord-002369-shk4n8f6	130	20	membrane	membrane	NN
cord-002369-shk4n8f6	130	21	associated	associate	VBN
cord-002369-shk4n8f6	130	22	(	(	-LRB-
cord-002369-shk4n8f6	131	1	Fig	fig	NN
cord-002369-shk4n8f6	131	2	.	.	.
cord-002369-shk4n8f6	131	3	6A	6a	NN
cord-002369-shk4n8f6	131	4	,	,	,
cord-002369-shk4n8f6	131	5	B	B	NNP
cord-002369-shk4n8f6	131	6	)	)	-RRB-
cord-002369-shk4n8f6	131	7	.	.	.
cord-002369-shk4n8f6	132	1	Treatment	treatment	NN
cord-002369-shk4n8f6	132	2	with	with	IN
cord-002369-shk4n8f6	132	3	siLC3	siLC3	NNP
cord-002369-shk4n8f6	132	4	did	do	VBD
cord-002369-shk4n8f6	132	5	not	not	RB
cord-002369-shk4n8f6	132	6	alter	alter	VB
cord-002369-shk4n8f6	132	7	the	the	DT
cord-002369-shk4n8f6	132	8	cellular	cellular	JJ
cord-002369-shk4n8f6	132	9	distribution	distribution	NN
cord-002369-shk4n8f6	132	10	of	of	IN
cord-002369-shk4n8f6	132	11	the	the	DT
cord-002369-shk4n8f6	132	12	viral	viral	JJ
cord-002369-shk4n8f6	132	13	proteins	protein	NNS
cord-002369-shk4n8f6	132	14	,	,	,
cord-002369-shk4n8f6	132	15	as	as	IN
cord-002369-shk4n8f6	132	16	observed	observe	VBN
cord-002369-shk4n8f6	132	17	by	by	IN
cord-002369-shk4n8f6	132	18	confocal	confocal	JJ
cord-002369-shk4n8f6	132	19	microscopy	microscopy	NNS
cord-002369-shk4n8f6	133	1	(	(	-LRB-
cord-002369-shk4n8f6	133	2	Fig	Fig	NNP
cord-002369-shk4n8f6	133	3	.	.	.
cord-002369-shk4n8f6	133	4	6A	6a	CD
cord-002369-shk4n8f6	133	5	-	-	HYPH
cord-002369-shk4n8f6	133	6	C	C	NNP
cord-002369-shk4n8f6	133	7	)	)	-RRB-
cord-002369-shk4n8f6	133	8	.	.	.
cord-002369-shk4n8f6	134	1	Strikingly	strikingly	RB
cord-002369-shk4n8f6	134	2	,	,	,
cord-002369-shk4n8f6	134	3	silencing	silence	VBG
cord-002369-shk4n8f6	134	4	of	of	IN
cord-002369-shk4n8f6	134	5	ATG7	ATG7	NNP
cord-002369-shk4n8f6	134	6	or	or	CC
cord-002369-shk4n8f6	134	7	ATG12	ATG12	NNP
cord-002369-shk4n8f6	134	8	resulted	result	VBD
cord-002369-shk4n8f6	134	9	in	in	IN
cord-002369-shk4n8f6	134	10	the	the	DT
cord-002369-shk4n8f6	134	11	formation	formation	NN
cord-002369-shk4n8f6	134	12	of	of	IN
cord-002369-shk4n8f6	134	13	larger	large	JJR
cord-002369-shk4n8f6	134	14	protein	protein	NN
cord-002369-shk4n8f6	134	15	clusters	cluster	NNS
cord-002369-shk4n8f6	134	16	in	in	IN
cord-002369-shk4n8f6	134	17	most	most	JJS
cord-002369-shk4n8f6	134	18	of	of	IN
cord-002369-shk4n8f6	134	19	the	the	DT
cord-002369-shk4n8f6	134	20	transfected	transfecte	VBN
cord-002369-shk4n8f6	134	21	cells	cell	NNS
cord-002369-shk4n8f6	134	22	(	(	-LRB-
cord-002369-shk4n8f6	134	23	Fig	fig	NN
cord-002369-shk4n8f6	134	24	.	.	.
cord-002369-shk4n8f6	134	25	6A	6a	CD
cord-002369-shk4n8f6	134	26	-	-	HYPH
cord-002369-shk4n8f6	134	27	C	C	NNP
cord-002369-shk4n8f6	134	28	)	)	-RRB-
cord-002369-shk4n8f6	134	29	.	.	.
cord-002369-shk4n8f6	135	1	This	this	DT
cord-002369-shk4n8f6	135	2	effect	effect	NN
cord-002369-shk4n8f6	135	3	was	be	VBD
cord-002369-shk4n8f6	135	4	not	not	RB
cord-002369-shk4n8f6	135	5	due	due	JJ
cord-002369-shk4n8f6	135	6	to	to	IN
cord-002369-shk4n8f6	135	7	decreased	decrease	VBD
cord-002369-shk4n8f6	135	8	HCV	HCV	NNP
cord-002369-shk4n8f6	135	9	protein	protein	NN
cord-002369-shk4n8f6	135	10	expression	expression	NN
cord-002369-shk4n8f6	135	11	level	level	NN
cord-002369-shk4n8f6	135	12	(	(	-LRB-
cord-002369-shk4n8f6	135	13	Fig	Fig	NNP
cord-002369-shk4n8f6	135	14	.	.	.
cord-002369-shk4n8f6	135	15	6D	6D	NNP
cord-002369-shk4n8f6	135	16	)	)	-RRB-
cord-002369-shk4n8f6	135	17	,	,	,
cord-002369-shk4n8f6	135	18	thus	thus	RB
cord-002369-shk4n8f6	135	19	suggesting	suggest	VBG
cord-002369-shk4n8f6	135	20	that	that	IN
cord-002369-shk4n8f6	135	21	the	the	DT
cord-002369-shk4n8f6	135	22	ATG5	ATG5	NNP
cord-002369-shk4n8f6	135	23	-	-	HYPH
cord-002369-shk4n8f6	135	24	12	12	CD
cord-002369-shk4n8f6	135	25	conjugate	conjugate	NN
cord-002369-shk4n8f6	135	26	,	,	,
cord-002369-shk4n8f6	135	27	but	but	CC
cord-002369-shk4n8f6	135	28	not	not	RB
cord-002369-shk4n8f6	135	29	LC3	LC3	NNP
cord-002369-shk4n8f6	135	30	,	,	,
cord-002369-shk4n8f6	135	31	is	be	VBZ
cord-002369-shk4n8f6	135	32	required	require	VBN
cord-002369-shk4n8f6	135	33	to	to	TO
cord-002369-shk4n8f6	135	34	obtain	obtain	VB
cord-002369-shk4n8f6	135	35	a	a	DT
cord-002369-shk4n8f6	135	36	wild	wild	JJ
cord-002369-shk4n8f6	135	37	-	-	HYPH
cord-002369-shk4n8f6	135	38	type	type	NN
cord-002369-shk4n8f6	135	39	MW	mw	NN
cord-002369-shk4n8f6	135	40	phenotype	phenotype	NN
cord-002369-shk4n8f6	135	41	.	.	.
cord-002369-shk4n8f6	136	1	Silencing	silencing	NN
cord-002369-shk4n8f6	136	2	of	of	IN
cord-002369-shk4n8f6	136	3	ATG12	ATG12	NNP
cord-002369-shk4n8f6	136	4	or	or	CC
cord-002369-shk4n8f6	136	5	ATG7	ATG7	NNP
cord-002369-shk4n8f6	136	6	,	,	,
cord-002369-shk4n8f6	136	7	but	but	CC
cord-002369-shk4n8f6	136	8	not	not	RB
cord-002369-shk4n8f6	136	9	LC3	lc3	JJ
cord-002369-shk4n8f6	136	10	,	,	,
cord-002369-shk4n8f6	136	11	modifies	modify	VBZ
cord-002369-shk4n8f6	136	12	MW	MW	NNP
cord-002369-shk4n8f6	136	13	morphology	morphology	NN
cord-002369-shk4n8f6	136	14	.	.	.
cord-002369-shk4n8f6	137	1	Next	next	RB
cord-002369-shk4n8f6	137	2	,	,	,
cord-002369-shk4n8f6	137	3	using	use	VBG
cord-002369-shk4n8f6	137	4	TEM	tem	NN
cord-002369-shk4n8f6	137	5	,	,	,
cord-002369-shk4n8f6	137	6	we	-PRON-	PRP
cord-002369-shk4n8f6	137	7	analyzed	analyze	VBD
cord-002369-shk4n8f6	137	8	MW	MW	NNP
cord-002369-shk4n8f6	137	9	morphology	morphology	NN
cord-002369-shk4n8f6	137	10	after	after	IN
cord-002369-shk4n8f6	137	11	treatment	treatment	NN
cord-002369-shk4n8f6	137	12	with	with	IN
cord-002369-shk4n8f6	137	13	siLC3	siLC3	NNP
cord-002369-shk4n8f6	137	14	,	,	,
cord-002369-shk4n8f6	137	15	siATG7	siATG7	NNP
cord-002369-shk4n8f6	137	16	or	or	CC
cord-002369-shk4n8f6	137	17	siATG12	siATG12	NNP
cord-002369-shk4n8f6	137	18	.	.	.
cord-002369-shk4n8f6	138	1	Expression	expression	NN
cord-002369-shk4n8f6	138	2	of	of	IN
cord-002369-shk4n8f6	138	3	pTM	pTM	NNP
cord-002369-shk4n8f6	138	4	-	-	HYPH
cord-002369-shk4n8f6	138	5	NS3	ns3	NN
cord-002369-shk4n8f6	138	6	-	-	HYPH
cord-002369-shk4n8f6	138	7	5B	5b	NN
cord-002369-shk4n8f6	138	8	in	in	IN
cord-002369-shk4n8f6	138	9	cells	cell	NNS
cord-002369-shk4n8f6	138	10	treated	treat	VBN
cord-002369-shk4n8f6	138	11	with	with	IN
cord-002369-shk4n8f6	138	12	siCTL	siCTL	NNS
cord-002369-shk4n8f6	138	13	induced	induce	VBN
cord-002369-shk4n8f6	138	14	heterogeneous	heterogeneous	JJ
cord-002369-shk4n8f6	138	15	membrane	membrane	NN
cord-002369-shk4n8f6	138	16	alterations	alteration	NNS
cord-002369-shk4n8f6	138	17	composed	compose	VBN
cord-002369-shk4n8f6	138	18	of	of	IN
cord-002369-shk4n8f6	138	19	DMVs	dmv	NNS
cord-002369-shk4n8f6	138	20	of	of	IN
cord-002369-shk4n8f6	138	21	an	an	DT
cord-002369-shk4n8f6	138	22	average	average	JJ
cord-002369-shk4n8f6	138	23	size	size	NN
cord-002369-shk4n8f6	138	24	of	of	IN
cord-002369-shk4n8f6	138	25	200	200	CD
cord-002369-shk4n8f6	138	26	nm	nm	NN
cord-002369-shk4n8f6	138	27	interspersed	intersperse	VBN
cord-002369-shk4n8f6	138	28	by	by	IN
cord-002369-shk4n8f6	138	29	multi	multi	JJ
cord-002369-shk4n8f6	138	30	-	-	JJ
cord-002369-shk4n8f6	138	31	membrane	membrane	JJ
cord-002369-shk4n8f6	138	32	vesicles	vesicle	NNS
cord-002369-shk4n8f6	138	33	(	(	-LRB-
cord-002369-shk4n8f6	138	34	MMVs	mmv	NNS
cord-002369-shk4n8f6	138	35	)	)	-RRB-
cord-002369-shk4n8f6	138	36	that	that	WDT
cord-002369-shk4n8f6	138	37	were	be	VBD
cord-002369-shk4n8f6	138	38	distributed	distribute	VBN
cord-002369-shk4n8f6	138	39	throughout	throughout	IN
cord-002369-shk4n8f6	138	40	the	the	DT
cord-002369-shk4n8f6	138	41	cytoplasm	cytoplasm	NN
cord-002369-shk4n8f6	138	42	(	(	-LRB-
cord-002369-shk4n8f6	138	43	Fig	Fig	NNP
cord-002369-shk4n8f6	138	44	.	.	.
cord-002369-shk4n8f6	138	45	7A	7a	NN
cord-002369-shk4n8f6	138	46	,	,	,
cord-002369-shk4n8f6	138	47	B	b	NN
cord-002369-shk4n8f6	138	48	)	)	-RRB-
cord-002369-shk4n8f6	138	49	and	and	CC
cord-002369-shk4n8f6	138	50	that	that	DT
cord-002369-shk4n8f6	138	51	were	be	VBD
cord-002369-shk4n8f6	138	52	not	not	RB
cord-002369-shk4n8f6	138	53	seen	see	VBN
cord-002369-shk4n8f6	138	54	in	in	IN
cord-002369-shk4n8f6	138	55	negative	negative	JJ
cord-002369-shk4n8f6	138	56	cells	cell	NNS
cord-002369-shk4n8f6	138	57	(	(	-LRB-
cord-002369-shk4n8f6	138	58	Fig	Fig	NNP
cord-002369-shk4n8f6	138	59	.	.	.
cord-002369-shk4n8f6	138	60	7E	7E	NNP
cord-002369-shk4n8f6	138	61	)	)	-RRB-
cord-002369-shk4n8f6	138	62	.	.	.
cord-002369-shk4n8f6	139	1	Silencing	silencing	NN
cord-002369-shk4n8f6	139	2	of	of	IN
cord-002369-shk4n8f6	139	3	ATG7	ATG7	NNP
cord-002369-shk4n8f6	139	4	resulted	result	VBD
cord-002369-shk4n8f6	139	5	in	in	IN
cord-002369-shk4n8f6	139	6	more	more	RBR
cord-002369-shk4n8f6	139	7	homogenous	homogenous	JJ
cord-002369-shk4n8f6	139	8	DMVs	dmv	NNS
cord-002369-shk4n8f6	139	9	with	with	IN
cord-002369-shk4n8f6	139	10	a	a	DT
cord-002369-shk4n8f6	139	11	markedly	markedly	RB
cord-002369-shk4n8f6	139	12	decreased	decrease	VBN
cord-002369-shk4n8f6	139	13	average	average	JJ
cord-002369-shk4n8f6	139	14	size	size	NN
cord-002369-shk4n8f6	139	15	(	(	-LRB-
cord-002369-shk4n8f6	139	16	90	90	CD
cord-002369-shk4n8f6	139	17	nm	nm	NN
cord-002369-shk4n8f6	139	18	)	)	-RRB-
cord-002369-shk4n8f6	139	19	and	and	CC
cord-002369-shk4n8f6	139	20	led	lead	VBD
cord-002369-shk4n8f6	139	21	to	to	IN
cord-002369-shk4n8f6	139	22	the	the	DT
cord-002369-shk4n8f6	139	23	disappearance	disappearance	NN
cord-002369-shk4n8f6	139	24	of	of	IN
cord-002369-shk4n8f6	139	25	MMVs	mmv	NNS
cord-002369-shk4n8f6	140	1	(	(	-LRB-
cord-002369-shk4n8f6	140	2	Fig	Fig	NNP
cord-002369-shk4n8f6	140	3	.	.	.
cord-002369-shk4n8f6	140	4	7A	7a	NN
cord-002369-shk4n8f6	140	5	,	,	,
cord-002369-shk4n8f6	140	6	B	b	NN
cord-002369-shk4n8f6	140	7	,	,	,
cord-002369-shk4n8f6	140	8	D	D	NNP
cord-002369-shk4n8f6	140	9	)	)	-RRB-
cord-002369-shk4n8f6	140	10	.	.	.
cord-002369-shk4n8f6	141	1	Silencing	silencing	NN
cord-002369-shk4n8f6	141	2	of	of	IN
cord-002369-shk4n8f6	141	3	ATG12	ATG12	NNP
cord-002369-shk4n8f6	141	4	led	lead	VBD
cord-002369-shk4n8f6	141	5	to	to	IN
cord-002369-shk4n8f6	141	6	a	a	DT
cord-002369-shk4n8f6	141	7	similar	similar	JJ
cord-002369-shk4n8f6	141	8	effect	effect	NN
cord-002369-shk4n8f6	141	9	but	but	CC
cord-002369-shk4n8f6	141	10	with	with	IN
cord-002369-shk4n8f6	141	11	a	a	DT
cord-002369-shk4n8f6	141	12	much	much	RB
cord-002369-shk4n8f6	141	13	lower	low	JJR
cord-002369-shk4n8f6	141	14	abundance	abundance	NN
cord-002369-shk4n8f6	141	15	of	of	IN
cord-002369-shk4n8f6	141	16	DMVs	dmv	NNS
cord-002369-shk4n8f6	141	17	(	(	-LRB-
cord-002369-shk4n8f6	141	18	Fig	Fig	NNP
cord-002369-shk4n8f6	141	19	.	.	.
cord-002369-shk4n8f6	141	20	7C	7C	NNP
cord-002369-shk4n8f6	141	21	)	)	-RRB-
cord-002369-shk4n8f6	141	22	.	.	.
cord-002369-shk4n8f6	142	1	However	however	RB
cord-002369-shk4n8f6	142	2	,	,	,
cord-002369-shk4n8f6	142	3	silencing	silencing	NN
cord-002369-shk4n8f6	142	4	of	of	IN
cord-002369-shk4n8f6	142	5	LC3	LC3	NNP
cord-002369-shk4n8f6	142	6	had	have	VBD
cord-002369-shk4n8f6	142	7	no	no	DT
cord-002369-shk4n8f6	142	8	effect	effect	NN
cord-002369-shk4n8f6	142	9	on	on	IN
cord-002369-shk4n8f6	142	10	the	the	DT
cord-002369-shk4n8f6	142	11	DMV	DMV	NNP
cord-002369-shk4n8f6	142	12	size	size	NN
cord-002369-shk4n8f6	142	13	(	(	-LRB-
cord-002369-shk4n8f6	142	14	average	average	JJ
cord-002369-shk4n8f6	142	15	diameter	diameter	NN
cord-002369-shk4n8f6	142	16	200	200	CD
cord-002369-shk4n8f6	142	17	nm	nm	NN
cord-002369-shk4n8f6	142	18	)	)	-RRB-
cord-002369-shk4n8f6	142	19	(	(	-LRB-
cord-002369-shk4n8f6	142	20	Fig	Fig	NNP
cord-002369-shk4n8f6	142	21	.	.	.
cord-002369-shk4n8f6	142	22	7B	7B	NNP
cord-002369-shk4n8f6	142	23	)	)	-RRB-
cord-002369-shk4n8f6	142	24	or	or	CC
cord-002369-shk4n8f6	142	25	on	on	IN
cord-002369-shk4n8f6	142	26	the	the	DT
cord-002369-shk4n8f6	142	27	vesicle	vesicle	NN
cord-002369-shk4n8f6	142	28	types	type	NNS
cord-002369-shk4n8f6	142	29	in	in	IN
cord-002369-shk4n8f6	142	30	which	which	WDT
cord-002369-shk4n8f6	142	31	both	both	DT
cord-002369-shk4n8f6	142	32	DMVs	dmv	NNS
cord-002369-shk4n8f6	142	33	and	and	CC
cord-002369-shk4n8f6	142	34	MMVs	mmv	NNS
cord-002369-shk4n8f6	142	35	coexist	coexist	VBP
cord-002369-shk4n8f6	142	36	(	(	-LRB-
cord-002369-shk4n8f6	142	37	Fig	Fig	NNP
cord-002369-shk4n8f6	142	38	.	.	.
cord-002369-shk4n8f6	142	39	7C	7C	NNP
cord-002369-shk4n8f6	142	40	,	,	,
cord-002369-shk4n8f6	142	41	D	D	NNP
cord-002369-shk4n8f6	142	42	)	)	-RRB-
cord-002369-shk4n8f6	142	43	.	.	.
cord-002369-shk4n8f6	143	1	Thus	thus	RB
cord-002369-shk4n8f6	143	2	,	,	,
cord-002369-shk4n8f6	143	3	a	a	DT
cord-002369-shk4n8f6	143	4	similar	similar	JJ
cord-002369-shk4n8f6	143	5	morphology	morphology	NN
cord-002369-shk4n8f6	143	6	of	of	IN
cord-002369-shk4n8f6	143	7	membrane	membrane	NN
cord-002369-shk4n8f6	143	8	alterations	alteration	NNS
cord-002369-shk4n8f6	143	9	was	be	VBD
cord-002369-shk4n8f6	143	10	observed	observe	VBN
cord-002369-shk4n8f6	143	11	in	in	IN
cord-002369-shk4n8f6	143	12	siCTL	siCTL	NNS
cord-002369-shk4n8f6	143	13	-	-	HYPH
cord-002369-shk4n8f6	143	14	treated	treat	VBN
cord-002369-shk4n8f6	143	15	cells	cell	NNS
cord-002369-shk4n8f6	143	16	(	(	-LRB-
cord-002369-shk4n8f6	143	17	Fig	Fig	NNP
cord-002369-shk4n8f6	143	18	.	.	.
cord-002369-shk4n8f6	143	19	7A	7a	NN
cord-002369-shk4n8f6	143	20	,	,	,
cord-002369-shk4n8f6	143	21	B	B	NNP
cord-002369-shk4n8f6	143	22	)	)	-RRB-
cord-002369-shk4n8f6	143	23	.	.	.
cord-002369-shk4n8f6	144	1	These	these	DT
cord-002369-shk4n8f6	144	2	results	result	NNS
cord-002369-shk4n8f6	144	3	strongly	strongly	RB
cord-002369-shk4n8f6	144	4	suggest	suggest	VBP
cord-002369-shk4n8f6	144	5	that	that	IN
cord-002369-shk4n8f6	144	6	the	the	DT
cord-002369-shk4n8f6	144	7	ATG5	ATG5	NNP
cord-002369-shk4n8f6	144	8	-	-	HYPH
cord-002369-shk4n8f6	144	9	12	12	CD
cord-002369-shk4n8f6	144	10	conjugate	conjugate	NN
cord-002369-shk4n8f6	144	11	is	be	VBZ
cord-002369-shk4n8f6	144	12	crucial	crucial	JJ
cord-002369-shk4n8f6	144	13	for	for	IN
cord-002369-shk4n8f6	144	14	the	the	DT
cord-002369-shk4n8f6	144	15	formation	formation	NN
cord-002369-shk4n8f6	144	16	of	of	IN
cord-002369-shk4n8f6	144	17	a	a	DT
cord-002369-shk4n8f6	144	18	typical	typical	JJ
cord-002369-shk4n8f6	144	19	HCV	HCV	NNP
cord-002369-shk4n8f6	144	20	-	-	HYPH
cord-002369-shk4n8f6	144	21	induced	induce	VBN
cord-002369-shk4n8f6	144	22	MW	MW	NNP
cord-002369-shk4n8f6	144	23	architecture	architecture	NN
cord-002369-shk4n8f6	144	24	.	.	.
cord-002369-shk4n8f6	145	1	In	in	IN
cord-002369-shk4n8f6	145	2	the	the	DT
cord-002369-shk4n8f6	145	3	present	present	JJ
cord-002369-shk4n8f6	145	4	study	study	NN
cord-002369-shk4n8f6	145	5	,	,	,
cord-002369-shk4n8f6	145	6	we	-PRON-	PRP
cord-002369-shk4n8f6	145	7	demonstrated	demonstrate	VBD
cord-002369-shk4n8f6	145	8	the	the	DT
cord-002369-shk4n8f6	145	9	requirement	requirement	NN
cord-002369-shk4n8f6	145	10	of	of	IN
cord-002369-shk4n8f6	145	11	the	the	DT
cord-002369-shk4n8f6	145	12	ATG5	ATG5	NNP
cord-002369-shk4n8f6	145	13	-	-	HYPH
cord-002369-shk4n8f6	145	14	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	145	15	complex	complex	NN
cord-002369-shk4n8f6	145	16	for	for	IN
cord-002369-shk4n8f6	145	17	the	the	DT
cord-002369-shk4n8f6	145	18	completion	completion	NN
cord-002369-shk4n8f6	145	19	of	of	IN
cord-002369-shk4n8f6	145	20	the	the	DT
cord-002369-shk4n8f6	145	21	HCV	HCV	NNP
cord-002369-shk4n8f6	145	22	lifecycle	lifecycle	NN
cord-002369-shk4n8f6	145	23	.	.	.
cord-002369-shk4n8f6	146	1	HCV	HCV	NNP
cord-002369-shk4n8f6	146	2	infection	infection	NN
cord-002369-shk4n8f6	146	3	does	do	VBZ
cord-002369-shk4n8f6	146	4	not	not	RB
cord-002369-shk4n8f6	146	5	hamper	hamper	VB
cord-002369-shk4n8f6	146	6	ATG12	ATG12	NNP
cord-002369-shk4n8f6	146	7	conjugation	conjugation	NN
cord-002369-shk4n8f6	146	8	to	to	IN
cord-002369-shk4n8f6	146	9	ATG5	ATG5	NNP
cord-002369-shk4n8f6	146	10	or	or	CC
cord-002369-shk4n8f6	146	11	the	the	DT
cord-002369-shk4n8f6	146	12	formation	formation	NN
cord-002369-shk4n8f6	146	13	of	of	IN
cord-002369-shk4n8f6	146	14	the	the	DT
cord-002369-shk4n8f6	146	15	multimeric	multimeric	NNP
cord-002369-shk4n8f6	146	16	complex	complex	NN
cord-002369-shk4n8f6	147	1	ATG5	ATG5	NNP
cord-002369-shk4n8f6	147	2	-	-	HYPH
cord-002369-shk4n8f6	147	3	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	148	1	(	(	-LRB-
cord-002369-shk4n8f6	148	2	Fig	Fig	NNP
cord-002369-shk4n8f6	148	3	.	.	.
cord-002369-shk4n8f6	149	1	1A	1a	LS
cord-002369-shk4n8f6	149	2	,	,	,
cord-002369-shk4n8f6	149	3	B	B	NNP
cord-002369-shk4n8f6	149	4	)	)	-RRB-
cord-002369-shk4n8f6	149	5	.	.	.
cord-002369-shk4n8f6	150	1	In	in	IN
cord-002369-shk4n8f6	150	2	contrast	contrast	NN
cord-002369-shk4n8f6	150	3	,	,	,
cord-002369-shk4n8f6	150	4	the	the	DT
cord-002369-shk4n8f6	150	5	conjugation	conjugation	NN
cord-002369-shk4n8f6	150	6	of	of	IN
cord-002369-shk4n8f6	150	7	ATG12	ATG12	NNP
cord-002369-shk4n8f6	150	8	to	to	IN
cord-002369-shk4n8f6	150	9	ATG5	ATG5	NNP
cord-002369-shk4n8f6	150	10	is	be	VBZ
cord-002369-shk4n8f6	150	11	crucial	crucial	JJ
cord-002369-shk4n8f6	150	12	for	for	IN
cord-002369-shk4n8f6	150	13	the	the	DT
cord-002369-shk4n8f6	150	14	HCV	HCV	NNP
cord-002369-shk4n8f6	150	15	lifecycle	lifecycle	NN
cord-002369-shk4n8f6	150	16	.	.	.
cord-002369-shk4n8f6	151	1	More	more	RBR
cord-002369-shk4n8f6	151	2	specifically	specifically	RB
cord-002369-shk4n8f6	151	3	,	,	,
cord-002369-shk4n8f6	151	4	our	-PRON-	PRP$
cord-002369-shk4n8f6	151	5	study	study	NN
cord-002369-shk4n8f6	151	6	suggests	suggest	VBZ
cord-002369-shk4n8f6	151	7	a	a	DT
cord-002369-shk4n8f6	151	8	role	role	NN
cord-002369-shk4n8f6	151	9	of	of	IN
cord-002369-shk4n8f6	151	10	the	the	DT
cord-002369-shk4n8f6	151	11	ATG5	ATG5	NNP
cord-002369-shk4n8f6	151	12	-	-	HYPH
cord-002369-shk4n8f6	151	13	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	151	14	complex	complex	NN
cord-002369-shk4n8f6	151	15	in	in	IN
cord-002369-shk4n8f6	151	16	HCV	HCV	NNP
cord-002369-shk4n8f6	151	17	genome	genome	NN
cord-002369-shk4n8f6	151	18	replication	replication	NN
cord-002369-shk4n8f6	151	19	and	and	CC
cord-002369-shk4n8f6	151	20	the	the	DT
cord-002369-shk4n8f6	151	21	formation	formation	NN
cord-002369-shk4n8f6	151	22	of	of	IN
cord-002369-shk4n8f6	151	23	the	the	DT
cord-002369-shk4n8f6	151	24	MW	MW	NNP
cord-002369-shk4n8f6	151	25	.	.	.
cord-002369-shk4n8f6	152	1	The	the	DT
cord-002369-shk4n8f6	152	2	involvement	involvement	NN
cord-002369-shk4n8f6	152	3	of	of	IN
cord-002369-shk4n8f6	152	4	the	the	DT
cord-002369-shk4n8f6	152	5	autophagy	autophagy	NN
cord-002369-shk4n8f6	152	6	elongation	elongation	NN
cord-002369-shk4n8f6	152	7	complex	complex	JJ
cord-002369-shk4n8f6	152	8	in	in	IN
cord-002369-shk4n8f6	152	9	the	the	DT
cord-002369-shk4n8f6	152	10	HCV	HCV	NNP
cord-002369-shk4n8f6	152	11	replication	replication	NN
cord-002369-shk4n8f6	152	12	step	step	NN
cord-002369-shk4n8f6	152	13	was	be	VBD
cord-002369-shk4n8f6	152	14	investigated	investigate	VBN
cord-002369-shk4n8f6	152	15	by	by	IN
cord-002369-shk4n8f6	152	16	using	use	VBG
cord-002369-shk4n8f6	152	17	siRNA	siRNA	NNP
cord-002369-shk4n8f6	152	18	targeting	target	VBG
cord-002369-shk4n8f6	152	19	of	of	IN
cord-002369-shk4n8f6	152	20	ATG7	ATG7	NNP
cord-002369-shk4n8f6	152	21	,	,	,
cord-002369-shk4n8f6	152	22	ATG12	ATG12	NNP
cord-002369-shk4n8f6	152	23	or	or	CC
cord-002369-shk4n8f6	152	24	LC3	LC3	NNP
cord-002369-shk4n8f6	152	25	.	.	.
cord-002369-shk4n8f6	153	1	Because	because	IN
cord-002369-shk4n8f6	153	2	the	the	DT
cord-002369-shk4n8f6	153	3	silencing	silencing	NN
cord-002369-shk4n8f6	153	4	of	of	IN
cord-002369-shk4n8f6	153	5	ATG7	ATG7	NNP
cord-002369-shk4n8f6	153	6	is	be	VBZ
cord-002369-shk4n8f6	153	7	known	know	VBN
cord-002369-shk4n8f6	153	8	to	to	TO
cord-002369-shk4n8f6	153	9	inhibit	inhibit	VB
cord-002369-shk4n8f6	153	10	the	the	DT
cord-002369-shk4n8f6	153	11	conjugation	conjugation	NN
cord-002369-shk4n8f6	153	12	of	of	IN
cord-002369-shk4n8f6	153	13	both	both	DT
cord-002369-shk4n8f6	153	14	LC3	lc3	JJ
cord-002369-shk4n8f6	153	15	and	and	CC
cord-002369-shk4n8f6	153	16	ATG5	ATG5	NNP
cord-002369-shk4n8f6	153	17	,	,	,
cord-002369-shk4n8f6	153	18	we	-PRON-	PRP
cord-002369-shk4n8f6	153	19	were	be	VBD
cord-002369-shk4n8f6	153	20	able	able	JJ
cord-002369-shk4n8f6	153	21	to	to	TO
cord-002369-shk4n8f6	153	22	address	address	VB
cord-002369-shk4n8f6	153	23	the	the	DT
cord-002369-shk4n8f6	153	24	importance	importance	NN
cord-002369-shk4n8f6	153	25	of	of	IN
cord-002369-shk4n8f6	153	26	these	these	DT
cord-002369-shk4n8f6	153	27	two	two	CD
cord-002369-shk4n8f6	153	28	conjugation	conjugation	NN
cord-002369-shk4n8f6	153	29	systems	system	NNS
cord-002369-shk4n8f6	153	30	in	in	IN
cord-002369-shk4n8f6	153	31	HCV	HCV	NNP
cord-002369-shk4n8f6	153	32	replication	replication	NN
cord-002369-shk4n8f6	153	33	.	.	.
cord-002369-shk4n8f6	154	1	Indeed	indeed	RB
cord-002369-shk4n8f6	154	2	,	,	,
cord-002369-shk4n8f6	154	3	the	the	DT
cord-002369-shk4n8f6	154	4	ATG5	ATG5	NNP
cord-002369-shk4n8f6	154	5	-	-	HYPH
cord-002369-shk4n8f6	154	6	12	12	CD
cord-002369-shk4n8f6	154	7	conjugate	conjugate	NN
cord-002369-shk4n8f6	154	8	acted	act	VBN
cord-002369-shk4n8f6	154	9	as	as	IN
cord-002369-shk4n8f6	154	10	a	a	DT
cord-002369-shk4n8f6	154	11	proviral	proviral	JJ
cord-002369-shk4n8f6	154	12	factor	factor	NN
cord-002369-shk4n8f6	154	13	at	at	IN
cord-002369-shk4n8f6	154	14	a	a	DT
cord-002369-shk4n8f6	154	15	step	step	NN
cord-002369-shk4n8f6	154	16	beyond	beyond	IN
cord-002369-shk4n8f6	154	17	entry	entry	NN
cord-002369-shk4n8f6	154	18	and	and	CC
cord-002369-shk4n8f6	154	19	RNA	RNA	NNP
cord-002369-shk4n8f6	154	20	translation	translation	NN
cord-002369-shk4n8f6	154	21	but	but	CC
cord-002369-shk4n8f6	154	22	before	before	IN
cord-002369-shk4n8f6	154	23	virion	virion	NN
cord-002369-shk4n8f6	154	24	maturation	maturation	NN
cord-002369-shk4n8f6	154	25	and	and	CC
cord-002369-shk4n8f6	154	26	secretion	secretion	NN
cord-002369-shk4n8f6	154	27	,	,	,
cord-002369-shk4n8f6	154	28	as	as	IN
cord-002369-shk4n8f6	154	29	depicted	depict	VBN
cord-002369-shk4n8f6	154	30	in	in	IN
cord-002369-shk4n8f6	154	31	Figs	Figs	NNP
cord-002369-shk4n8f6	154	32	2	2	CD
cord-002369-shk4n8f6	154	33	and	and	CC
cord-002369-shk4n8f6	154	34	3	3	CD
cord-002369-shk4n8f6	154	35	.	.	.
cord-002369-shk4n8f6	155	1	We	-PRON-	PRP
cord-002369-shk4n8f6	155	2	also	also	RB
cord-002369-shk4n8f6	155	3	observed	observe	VBD
cord-002369-shk4n8f6	155	4	that	that	IN
cord-002369-shk4n8f6	155	5	silencing	silencing	NN
cord-002369-shk4n8f6	155	6	of	of	IN
cord-002369-shk4n8f6	155	7	LC3	LC3	NNP
cord-002369-shk4n8f6	155	8	interfered	interfere	VBD
cord-002369-shk4n8f6	155	9	with	with	IN
cord-002369-shk4n8f6	155	10	HCV	HCV	NNP
cord-002369-shk4n8f6	155	11	RNA	RNA	NNP
cord-002369-shk4n8f6	155	12	translation	translation	NN
cord-002369-shk4n8f6	155	13	after	after	IN
cord-002369-shk4n8f6	155	14	electroporation	electroporation	NN
cord-002369-shk4n8f6	155	15	of	of	IN
cord-002369-shk4n8f6	155	16	replication	replication	NN
cord-002369-shk4n8f6	155	17	-	-	HYPH
cord-002369-shk4n8f6	155	18	defective	defective	JJ
cord-002369-shk4n8f6	155	19	replicon	replicon	NN
cord-002369-shk4n8f6	155	20	(	(	-LRB-
cord-002369-shk4n8f6	155	21	Fig	Fig	NNP
cord-002369-shk4n8f6	155	22	.	.	.
cord-002369-shk4n8f6	155	23	2E	2E	NNP
cord-002369-shk4n8f6	155	24	)	)	-RRB-
cord-002369-shk4n8f6	155	25	.	.	.
cord-002369-shk4n8f6	156	1	These	these	DT
cord-002369-shk4n8f6	156	2	results	result	NNS
cord-002369-shk4n8f6	156	3	are	be	VBP
cord-002369-shk4n8f6	156	4	consistent	consistent	JJ
cord-002369-shk4n8f6	156	5	with	with	IN
cord-002369-shk4n8f6	156	6	those	those	DT
cord-002369-shk4n8f6	156	7	of	of	IN
cord-002369-shk4n8f6	156	8	Dreux	Dreux	NNP
cord-002369-shk4n8f6	156	9	and	and	CC
cord-002369-shk4n8f6	156	10	colleagues	colleague	NNS
cord-002369-shk4n8f6	156	11	,	,	,
cord-002369-shk4n8f6	156	12	who	who	WP
cord-002369-shk4n8f6	156	13	have	have	VBP
cord-002369-shk4n8f6	156	14	found	find	VBN
cord-002369-shk4n8f6	156	15	a	a	DT
cord-002369-shk4n8f6	156	16	defect	defect	NN
cord-002369-shk4n8f6	156	17	in	in	IN
cord-002369-shk4n8f6	156	18	viral	viral	JJ
cord-002369-shk4n8f6	156	19	RNA	RNA	NNP
cord-002369-shk4n8f6	156	20	translation	translation	NN
cord-002369-shk4n8f6	156	21	after	after	IN
cord-002369-shk4n8f6	156	22	silencing	silence	VBG
cord-002369-shk4n8f6	156	23	of	of	IN
cord-002369-shk4n8f6	156	24	Beclin-1	Beclin-1	NNP
cord-002369-shk4n8f6	156	25	or	or	CC
cord-002369-shk4n8f6	156	26	ATG4B	atg4b	CD
cord-002369-shk4n8f6	156	27	,	,	,
cord-002369-shk4n8f6	156	28	thus	thus	RB
cord-002369-shk4n8f6	156	29	leading	lead	VBG
cord-002369-shk4n8f6	156	30	to	to	IN
cord-002369-shk4n8f6	156	31	inhibition	inhibition	NN
cord-002369-shk4n8f6	156	32	of	of	IN
cord-002369-shk4n8f6	156	33	LC3-II	LC3-II	NNP
cord-002369-shk4n8f6	156	34	formation	formation	NN
cord-002369-shk4n8f6	156	35	31	31	CD
cord-002369-shk4n8f6	156	36	.	.	.
cord-002369-shk4n8f6	157	1	Silencing	silencing	NN
cord-002369-shk4n8f6	157	2	of	of	IN
cord-002369-shk4n8f6	157	3	ATG12	ATG12	NNP
cord-002369-shk4n8f6	157	4	had	have	VBD
cord-002369-shk4n8f6	157	5	little	little	JJ
cord-002369-shk4n8f6	157	6	effect	effect	NN
cord-002369-shk4n8f6	157	7	on	on	IN
cord-002369-shk4n8f6	157	8	replication	replication	NN
cord-002369-shk4n8f6	157	9	-	-	HYPH
cord-002369-shk4n8f6	157	10	deficient	deficient	JJ
cord-002369-shk4n8f6	157	11	virus	virus	NN
cord-002369-shk4n8f6	157	12	but	but	CC
cord-002369-shk4n8f6	157	13	was	be	VBD
cord-002369-shk4n8f6	157	14	detrimental	detrimental	JJ
cord-002369-shk4n8f6	157	15	to	to	IN
cord-002369-shk4n8f6	157	16	the	the	DT
cord-002369-shk4n8f6	157	17	replication	replication	NN
cord-002369-shk4n8f6	157	18	of	of	IN
cord-002369-shk4n8f6	157	19	the	the	DT
cord-002369-shk4n8f6	157	20	JFH1	JFH1	NNP
cord-002369-shk4n8f6	157	21	/	/	SYM
cord-002369-shk4n8f6	157	22	Fluc	Fluc	NNP
cord-002369-shk4n8f6	157	23	virus	virus	NN
cord-002369-shk4n8f6	157	24	,	,	,
cord-002369-shk4n8f6	157	25	thus	thus	RB
cord-002369-shk4n8f6	157	26	indicating	indicate	VBG
cord-002369-shk4n8f6	157	27	that	that	IN
cord-002369-shk4n8f6	157	28	its	-PRON-	PRP$
cord-002369-shk4n8f6	157	29	primary	primary	JJ
cord-002369-shk4n8f6	157	30	target	target	NN
cord-002369-shk4n8f6	157	31	is	be	VBZ
cord-002369-shk4n8f6	157	32	beyond	beyond	IN
cord-002369-shk4n8f6	157	33	the	the	DT
cord-002369-shk4n8f6	157	34	translation	translation	NN
cord-002369-shk4n8f6	157	35	step	step	NN
cord-002369-shk4n8f6	157	36	(	(	-LRB-
cord-002369-shk4n8f6	157	37	Fig	Fig	NNP
cord-002369-shk4n8f6	157	38	.	.	.
cord-002369-shk4n8f6	157	39	2E	2E	NNP
cord-002369-shk4n8f6	157	40	)	)	-RRB-
cord-002369-shk4n8f6	157	41	.	.	.
cord-002369-shk4n8f6	158	1	This	this	DT
cord-002369-shk4n8f6	158	2	result	result	NN
cord-002369-shk4n8f6	158	3	was	be	VBD
cord-002369-shk4n8f6	158	4	further	further	RB
cord-002369-shk4n8f6	158	5	confirmed	confirm	VBN
cord-002369-shk4n8f6	158	6	in	in	IN
cord-002369-shk4n8f6	158	7	cells	cell	NNS
cord-002369-shk4n8f6	158	8	stably	stably	RB
cord-002369-shk4n8f6	158	9	expressing	express	VBG
cord-002369-shk4n8f6	158	10	the	the	DT
cord-002369-shk4n8f6	158	11	JFH1	JFH1	NNP
cord-002369-shk4n8f6	158	12	subgenomic	subgenomic	NNP
cord-002369-shk4n8f6	158	13	replicon	replicon	NNP
cord-002369-shk4n8f6	158	14	,	,	,
cord-002369-shk4n8f6	158	15	in	in	IN
cord-002369-shk4n8f6	158	16	which	which	WDT
cord-002369-shk4n8f6	158	17	silencing	silencing	NN
cord-002369-shk4n8f6	158	18	of	of	IN
cord-002369-shk4n8f6	158	19	ATG7	ATG7	NNP
cord-002369-shk4n8f6	158	20	or	or	CC
cord-002369-shk4n8f6	158	21	ATG12	ATG12	NNP
cord-002369-shk4n8f6	158	22	,	,	,
cord-002369-shk4n8f6	158	23	but	but	CC
cord-002369-shk4n8f6	158	24	not	not	RB
cord-002369-shk4n8f6	158	25	LC3	lc3	JJ
cord-002369-shk4n8f6	158	26	,	,	,
cord-002369-shk4n8f6	158	27	significantly	significantly	RB
cord-002369-shk4n8f6	158	28	inhibited	inhibit	VBD
cord-002369-shk4n8f6	158	29	HCV	HCV	NNP
cord-002369-shk4n8f6	158	30	replication	replication	NN
cord-002369-shk4n8f6	158	31	(	(	-LRB-
cord-002369-shk4n8f6	159	1	Fig	Fig	NNP
cord-002369-shk4n8f6	159	2	.	.	.
cord-002369-shk4n8f6	159	3	3A	3A	NNP
cord-002369-shk4n8f6	159	4	,	,	,
cord-002369-shk4n8f6	159	5	B	B	NNP
cord-002369-shk4n8f6	159	6	)	)	-RRB-
cord-002369-shk4n8f6	159	7	.	.	.
cord-002369-shk4n8f6	160	1	Silencing	silencing	NN
cord-002369-shk4n8f6	160	2	of	of	IN
cord-002369-shk4n8f6	160	3	LC3	lc3	NN
cord-002369-shk4n8f6	160	4	impeded	impede	VBD
cord-002369-shk4n8f6	160	5	HCV	HCV	NNP
cord-002369-shk4n8f6	160	6	only	only	RB
cord-002369-shk4n8f6	160	7	when	when	WRB
cord-002369-shk4n8f6	160	8	performed	perform	VBN
cord-002369-shk4n8f6	160	9	before	before	IN
cord-002369-shk4n8f6	160	10	infection	infection	NN
cord-002369-shk4n8f6	160	11	,	,	,
cord-002369-shk4n8f6	160	12	thus	thus	RB
cord-002369-shk4n8f6	160	13	suggesting	suggest	VBG
cord-002369-shk4n8f6	160	14	that	that	IN
cord-002369-shk4n8f6	160	15	the	the	DT
cord-002369-shk4n8f6	160	16	ATG5	ATG5	NNP
cord-002369-shk4n8f6	160	17	-	-	HYPH
cord-002369-shk4n8f6	160	18	12	12	CD
cord-002369-shk4n8f6	160	19	conjugate	conjugate	NN
cord-002369-shk4n8f6	160	20	,	,	,
cord-002369-shk4n8f6	160	21	but	but	CC
cord-002369-shk4n8f6	160	22	not	not	RB
cord-002369-shk4n8f6	160	23	LC3	LC3	NNP
cord-002369-shk4n8f6	160	24	,	,	,
cord-002369-shk4n8f6	160	25	is	be	VBZ
cord-002369-shk4n8f6	160	26	important	important	JJ
cord-002369-shk4n8f6	160	27	in	in	IN
cord-002369-shk4n8f6	160	28	viral	viral	JJ
cord-002369-shk4n8f6	160	29	replication	replication	NN
cord-002369-shk4n8f6	160	30	after	after	IN
cord-002369-shk4n8f6	160	31	the	the	DT
cord-002369-shk4n8f6	160	32	establishment	establishment	NN
cord-002369-shk4n8f6	160	33	of	of	IN
cord-002369-shk4n8f6	160	34	infection	infection	NN
cord-002369-shk4n8f6	161	1	(	(	-LRB-
cord-002369-shk4n8f6	161	2	Fig	Fig	NNP
cord-002369-shk4n8f6	161	3	.	.	.
cord-002369-shk4n8f6	161	4	3C	3C	NNP
cord-002369-shk4n8f6	161	5	)	)	-RRB-
cord-002369-shk4n8f6	161	6	.	.	.
cord-002369-shk4n8f6	162	1	In	in	IN
cord-002369-shk4n8f6	162	2	addition	addition	NN
cord-002369-shk4n8f6	162	3	,	,	,
cord-002369-shk4n8f6	162	4	the	the	DT
cord-002369-shk4n8f6	162	5	co	co	NN
cord-002369-shk4n8f6	162	6	-	-	NN
cord-002369-shk4n8f6	162	7	purification	purification	NN
cord-002369-shk4n8f6	162	8	of	of	IN
cord-002369-shk4n8f6	162	9	the	the	DT
cord-002369-shk4n8f6	162	10	elongation	elongation	NN
cord-002369-shk4n8f6	162	11	complex	complex	JJ
cord-002369-shk4n8f6	162	12	proteins	protein	NNS
cord-002369-shk4n8f6	162	13	with	with	IN
cord-002369-shk4n8f6	162	14	the	the	DT
cord-002369-shk4n8f6	162	15	MW	MW	NNP
cord-002369-shk4n8f6	162	16	suggested	suggest	VBD
cord-002369-shk4n8f6	162	17	that	that	IN
cord-002369-shk4n8f6	162	18	the	the	DT
cord-002369-shk4n8f6	162	19	ATG5-NS5B	ATG5-NS5B	NNP
cord-002369-shk4n8f6	162	20	interaction	interaction	NN
cord-002369-shk4n8f6	162	21	previously	previously	RB
cord-002369-shk4n8f6	162	22	described	describe	VBN
cord-002369-shk4n8f6	162	23	by	by	IN
cord-002369-shk4n8f6	162	24	our	-PRON-	PRP$
cord-002369-shk4n8f6	162	25	laboratory	laboratory	NN
cord-002369-shk4n8f6	162	26	34	34	CD
cord-002369-shk4n8f6	162	27	might	may	MD
cord-002369-shk4n8f6	162	28	actually	actually	RB
cord-002369-shk4n8f6	162	29	participate	participate	VB
cord-002369-shk4n8f6	162	30	in	in	IN
cord-002369-shk4n8f6	162	31	targeting	targeting	NN
cord-002369-shk4n8f6	162	32	of	of	IN
cord-002369-shk4n8f6	162	33	the	the	DT
cord-002369-shk4n8f6	162	34	elongation	elongation	NN
cord-002369-shk4n8f6	162	35	complex	complex	JJ
cord-002369-shk4n8f6	162	36	to	to	IN
cord-002369-shk4n8f6	162	37	the	the	DT
cord-002369-shk4n8f6	162	38	MW	MW	NNP
cord-002369-shk4n8f6	163	1	and/or	and/or	CC
cord-002369-shk4n8f6	163	2	in	in	IN
cord-002369-shk4n8f6	163	3	supplying	supply	VBG
cord-002369-shk4n8f6	163	4	of	of	IN
cord-002369-shk4n8f6	163	5	autophagic	autophagic	JJ
cord-002369-shk4n8f6	163	6	isolation	isolation	NN
cord-002369-shk4n8f6	163	7	membranes	membrane	NNS
cord-002369-shk4n8f6	163	8	for	for	IN
cord-002369-shk4n8f6	163	9	the	the	DT
cord-002369-shk4n8f6	163	10	formation	formation	NN
cord-002369-shk4n8f6	163	11	of	of	IN
cord-002369-shk4n8f6	163	12	the	the	DT
cord-002369-shk4n8f6	163	13	virus	virus	NN
cord-002369-shk4n8f6	163	14	-	-	HYPH
cord-002369-shk4n8f6	163	15	induced	induce	VBN
cord-002369-shk4n8f6	163	16	vesicles	vesicle	NNS
cord-002369-shk4n8f6	163	17	.	.	.
cord-002369-shk4n8f6	164	1	In	in	IN
cord-002369-shk4n8f6	164	2	canonical	canonical	JJ
cord-002369-shk4n8f6	164	3	autophagy	autophagy	NN
cord-002369-shk4n8f6	164	4	,	,	,
cord-002369-shk4n8f6	164	5	the	the	DT
cord-002369-shk4n8f6	164	6	ATG5	ATG5	NNP
cord-002369-shk4n8f6	164	7	-	-	HYPH
cord-002369-shk4n8f6	164	8	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	164	9	complex	complex	NN
cord-002369-shk4n8f6	164	10	is	be	VBZ
cord-002369-shk4n8f6	164	11	recruited	recruit	VBN
cord-002369-shk4n8f6	164	12	to	to	IN
cord-002369-shk4n8f6	164	13	the	the	DT
cord-002369-shk4n8f6	164	14	isolation	isolation	NN
cord-002369-shk4n8f6	164	15	membrane	membrane	NN
cord-002369-shk4n8f6	164	16	prior	prior	RB
cord-002369-shk4n8f6	164	17	to	to	IN
cord-002369-shk4n8f6	164	18	LC3	LC3	NNP
cord-002369-shk4n8f6	164	19	and	and	CC
cord-002369-shk4n8f6	164	20	is	be	VBZ
cord-002369-shk4n8f6	164	21	released	release	VBN
cord-002369-shk4n8f6	164	22	just	just	RB
cord-002369-shk4n8f6	164	23	before	before	IN
cord-002369-shk4n8f6	164	24	the	the	DT
cord-002369-shk4n8f6	164	25	completion	completion	NN
cord-002369-shk4n8f6	164	26	of	of	IN
cord-002369-shk4n8f6	164	27	autophagosomes	autophagosomes	NNP
cord-002369-shk4n8f6	164	28	.	.	.
cord-002369-shk4n8f6	165	1	The	the	DT
cord-002369-shk4n8f6	165	2	absence	absence	NN
cord-002369-shk4n8f6	165	3	of	of	IN
cord-002369-shk4n8f6	165	4	LC3	lc3	NN
cord-002369-shk4n8f6	165	5	in	in	IN
cord-002369-shk4n8f6	165	6	the	the	DT
cord-002369-shk4n8f6	165	7	purified	purify	VBN
cord-002369-shk4n8f6	165	8	MW	MW	NNP
cord-002369-shk4n8f6	165	9	suggests	suggest	VBZ
cord-002369-shk4n8f6	165	10	that	that	IN
cord-002369-shk4n8f6	165	11	HCV	HCV	NNP
cord-002369-shk4n8f6	165	12	either	either	RB
cord-002369-shk4n8f6	165	13	hijacks	hijack	VBZ
cord-002369-shk4n8f6	165	14	ATG5	ATG5	NNP
cord-002369-shk4n8f6	165	15	-	-	HYPH
cord-002369-shk4n8f6	165	16	12/16L1-positive	12/16l1-positive	CD
cord-002369-shk4n8f6	165	17	LC3-negative	lc3-negative	JJ
cord-002369-shk4n8f6	165	18	isolation	isolation	NN
cord-002369-shk4n8f6	165	19	membranes	membrane	NNS
cord-002369-shk4n8f6	165	20	or	or	CC
cord-002369-shk4n8f6	165	21	initiates	initiate	VBZ
cord-002369-shk4n8f6	165	22	the	the	DT
cord-002369-shk4n8f6	165	23	de	de	FW
cord-002369-shk4n8f6	165	24	novo	novo	NNP
cord-002369-shk4n8f6	165	25	formation	formation	NN
cord-002369-shk4n8f6	165	26	of	of	IN
cord-002369-shk4n8f6	165	27	the	the	DT
cord-002369-shk4n8f6	165	28	isolation	isolation	NN
cord-002369-shk4n8f6	165	29	membrane	membrane	NN
cord-002369-shk4n8f6	165	30	at	at	IN
cord-002369-shk4n8f6	165	31	the	the	DT
cord-002369-shk4n8f6	165	32	MW	MW	NNP
cord-002369-shk4n8f6	165	33	rather	rather	RB
cord-002369-shk4n8f6	165	34	than	than	IN
cord-002369-shk4n8f6	165	35	utilizing	utilize	VBG
cord-002369-shk4n8f6	165	36	LC3-positive	lc3-positive	JJ
cord-002369-shk4n8f6	165	37	autophagosomes	autophagosome	NNS
cord-002369-shk4n8f6	165	38	for	for	IN
cord-002369-shk4n8f6	165	39	the	the	DT
cord-002369-shk4n8f6	165	40	formation	formation	NN
cord-002369-shk4n8f6	165	41	of	of	IN
cord-002369-shk4n8f6	165	42	DMVs	dmv	NNS
cord-002369-shk4n8f6	165	43	within	within	IN
cord-002369-shk4n8f6	165	44	the	the	DT
cord-002369-shk4n8f6	165	45	MW	MW	NNP
cord-002369-shk4n8f6	165	46	(	(	-LRB-
cord-002369-shk4n8f6	165	47	Fig	Fig	NNP
cord-002369-shk4n8f6	165	48	.	.	.
cord-002369-shk4n8f6	165	49	4	4	CD
cord-002369-shk4n8f6	165	50	)	)	-RRB-
cord-002369-shk4n8f6	165	51	.	.	.
cord-002369-shk4n8f6	166	1	Interestingly	interestingly	RB
cord-002369-shk4n8f6	166	2	,	,	,
cord-002369-shk4n8f6	166	3	the	the	DT
cord-002369-shk4n8f6	166	4	recruitment	recruitment	NN
cord-002369-shk4n8f6	166	5	of	of	IN
cord-002369-shk4n8f6	166	6	the	the	DT
cord-002369-shk4n8f6	166	7	elongation	elongation	NN
cord-002369-shk4n8f6	166	8	complex	complex	JJ
cord-002369-shk4n8f6	166	9	to	to	IN
cord-002369-shk4n8f6	166	10	the	the	DT
cord-002369-shk4n8f6	166	11	MW	MW	NNP
cord-002369-shk4n8f6	166	12	was	be	VBD
cord-002369-shk4n8f6	166	13	not	not	RB
cord-002369-shk4n8f6	166	14	accompanied	accompany	VBN
cord-002369-shk4n8f6	166	15	by	by	IN
cord-002369-shk4n8f6	166	16	LC3	LC3	NNP
cord-002369-shk4n8f6	166	17	lipidation	lipidation	NN
cord-002369-shk4n8f6	166	18	or	or	CC
cord-002369-shk4n8f6	166	19	its	-PRON-	PRP$
cord-002369-shk4n8f6	166	20	relocation	relocation	NN
cord-002369-shk4n8f6	166	21	at	at	IN
cord-002369-shk4n8f6	166	22	that	that	DT
cord-002369-shk4n8f6	166	23	site	site	NN
cord-002369-shk4n8f6	166	24	.	.	.
cord-002369-shk4n8f6	167	1	Recently	recently	RB
cord-002369-shk4n8f6	167	2	,	,	,
cord-002369-shk4n8f6	167	3	it	-PRON-	PRP
cord-002369-shk4n8f6	167	4	has	have	VBZ
cord-002369-shk4n8f6	167	5	been	be	VBN
cord-002369-shk4n8f6	167	6	demonstrated	demonstrate	VBN
cord-002369-shk4n8f6	167	7	that	that	IN
cord-002369-shk4n8f6	167	8	the	the	DT
cord-002369-shk4n8f6	167	9	ATG5	ATG5	NNP
cord-002369-shk4n8f6	167	10	-	-	HYPH
cord-002369-shk4n8f6	167	11	12/16L1	12/16l1	CD
cord-002369-shk4n8f6	167	12	complex	complex	NN
cord-002369-shk4n8f6	167	13	has	have	VBZ
cord-002369-shk4n8f6	167	14	a	a	DT
cord-002369-shk4n8f6	167	15	membrane	membrane	NN
cord-002369-shk4n8f6	167	16	-	-	HYPH
cord-002369-shk4n8f6	167	17	tethering	tether	VBG
cord-002369-shk4n8f6	167	18	activity	activity	NN
cord-002369-shk4n8f6	167	19	that	that	WDT
cord-002369-shk4n8f6	167	20	is	be	VBZ
cord-002369-shk4n8f6	167	21	independent	independent	JJ
cord-002369-shk4n8f6	167	22	of	of	IN
cord-002369-shk4n8f6	167	23	LC3	LC3	NNP
cord-002369-shk4n8f6	167	24	45	45	CD
cord-002369-shk4n8f6	167	25	,	,	,
cord-002369-shk4n8f6	167	26	46	46	CD
cord-002369-shk4n8f6	167	27	.	.	.
cord-002369-shk4n8f6	168	1	This	this	DT
cord-002369-shk4n8f6	168	2	finding	finding	NN
cord-002369-shk4n8f6	168	3	highlights	highlight	VBZ
cord-002369-shk4n8f6	168	4	the	the	DT
cord-002369-shk4n8f6	168	5	possibility	possibility	NN
cord-002369-shk4n8f6	168	6	that	that	IN
cord-002369-shk4n8f6	168	7	in	in	IN
cord-002369-shk4n8f6	168	8	HCV	HCV	NNP
cord-002369-shk4n8f6	168	9	infected	infect	VBN
cord-002369-shk4n8f6	168	10	cells	cell	NNS
cord-002369-shk4n8f6	168	11	the	the	DT
cord-002369-shk4n8f6	168	12	major	major	JJ
cord-002369-shk4n8f6	168	13	role	role	NN
cord-002369-shk4n8f6	168	14	of	of	IN
cord-002369-shk4n8f6	168	15	the	the	DT
cord-002369-shk4n8f6	168	16	elongation	elongation	NN
cord-002369-shk4n8f6	168	17	complex	complex	NN
cord-002369-shk4n8f6	168	18	is	be	VBZ
cord-002369-shk4n8f6	168	19	to	to	TO
cord-002369-shk4n8f6	168	20	tether	tether	VB
cord-002369-shk4n8f6	168	21	vesicles	vesicle	NNS
cord-002369-shk4n8f6	168	22	during	during	IN
cord-002369-shk4n8f6	168	23	MW	MW	NNP
cord-002369-shk4n8f6	168	24	formation	formation	NN
cord-002369-shk4n8f6	168	25	.	.	.
cord-002369-shk4n8f6	169	1	Concomitantly	concomitantly	RB
cord-002369-shk4n8f6	169	2	,	,	,
cord-002369-shk4n8f6	169	3	it	-PRON-	PRP
cord-002369-shk4n8f6	169	4	has	have	VBZ
cord-002369-shk4n8f6	169	5	been	be	VBN
cord-002369-shk4n8f6	169	6	reported	report	VBN
cord-002369-shk4n8f6	169	7	that	that	IN
cord-002369-shk4n8f6	169	8	some	some	DT
cord-002369-shk4n8f6	169	9	ATG	ATG	NNP
cord-002369-shk4n8f6	169	10	proteins	protein	NNS
cord-002369-shk4n8f6	169	11	,	,	,
cord-002369-shk4n8f6	169	12	including	include	VBG
cord-002369-shk4n8f6	169	13	ATG16L1	ATG16L1	NNS
cord-002369-shk4n8f6	169	14	,	,	,
cord-002369-shk4n8f6	169	15	can	can	MD
cord-002369-shk4n8f6	169	16	traffic	traffic	VB
cord-002369-shk4n8f6	169	17	in	in	IN
cord-002369-shk4n8f6	169	18	LC3-free	LC3-free	NNP
cord-002369-shk4n8f6	169	19	vesicle	vesicle	NN
cord-002369-shk4n8f6	169	20	-	-	HYPH
cord-002369-shk4n8f6	169	21	like	like	JJ
cord-002369-shk4n8f6	169	22	structures	structure	NNS
cord-002369-shk4n8f6	169	23	to	to	IN
cord-002369-shk4n8f6	169	24	the	the	DT
cord-002369-shk4n8f6	169	25	site	site	NN
cord-002369-shk4n8f6	169	26	where	where	WRB
cord-002369-shk4n8f6	169	27	they	-PRON-	PRP
cord-002369-shk4n8f6	169	28	probably	probably	RB
cord-002369-shk4n8f6	169	29	act	act	VBP
cord-002369-shk4n8f6	169	30	to	to	TO
cord-002369-shk4n8f6	169	31	generate	generate	VB
cord-002369-shk4n8f6	169	32	de	de	FW
cord-002369-shk4n8f6	169	33	novo	novo	NN
cord-002369-shk4n8f6	169	34	isolation	isolation	NN
cord-002369-shk4n8f6	169	35	membranes	membrane	NNS
cord-002369-shk4n8f6	169	36	47	47	CD
cord-002369-shk4n8f6	169	37	.	.	.
cord-002369-shk4n8f6	170	1	This	this	DT
cord-002369-shk4n8f6	170	2	finding	finding	NN
cord-002369-shk4n8f6	170	3	also	also	RB
cord-002369-shk4n8f6	170	4	raises	raise	VBZ
cord-002369-shk4n8f6	170	5	the	the	DT
cord-002369-shk4n8f6	170	6	possibility	possibility	NN
cord-002369-shk4n8f6	170	7	that	that	IN
cord-002369-shk4n8f6	170	8	HCV	HCV	NNP
cord-002369-shk4n8f6	170	9	may	may	MD
cord-002369-shk4n8f6	170	10	recruit	recruit	VB
cord-002369-shk4n8f6	170	11	similar	similar	JJ
cord-002369-shk4n8f6	170	12	structures	structure	NNS
cord-002369-shk4n8f6	170	13	that	that	WDT
cord-002369-shk4n8f6	170	14	aid	aid	VBP
cord-002369-shk4n8f6	170	15	in	in	IN
cord-002369-shk4n8f6	170	16	the	the	DT
cord-002369-shk4n8f6	170	17	formation	formation	NN
cord-002369-shk4n8f6	170	18	of	of	IN
cord-002369-shk4n8f6	170	19	the	the	DT
cord-002369-shk4n8f6	170	20	MW	MW	NNP
cord-002369-shk4n8f6	170	21	.	.	.
cord-002369-shk4n8f6	171	1	Recently	recently	RB
cord-002369-shk4n8f6	171	2	,	,	,
cord-002369-shk4n8f6	171	3	Reiss	Reiss	NNP
cord-002369-shk4n8f6	171	4	and	and	CC
cord-002369-shk4n8f6	171	5	colleagues	colleague	NNS
cord-002369-shk4n8f6	171	6	have	have	VBP
cord-002369-shk4n8f6	171	7	developed	develop	VBN
cord-002369-shk4n8f6	171	8	a	a	DT
cord-002369-shk4n8f6	171	9	system	system	NN
cord-002369-shk4n8f6	171	10	to	to	TO
cord-002369-shk4n8f6	171	11	evaluate	evaluate	VB
cord-002369-shk4n8f6	171	12	the	the	DT
cord-002369-shk4n8f6	171	13	importance	importance	NN
cord-002369-shk4n8f6	171	14	of	of	IN
cord-002369-shk4n8f6	171	15	host	host	NN
cord-002369-shk4n8f6	171	16	factors	factor	NNS
cord-002369-shk4n8f6	171	17	in	in	IN
cord-002369-shk4n8f6	171	18	membranous	membranous	JJ
cord-002369-shk4n8f6	171	19	web	web	NN
cord-002369-shk4n8f6	171	20	formation	formation	NN
cord-002369-shk4n8f6	171	21	43	43	CD
cord-002369-shk4n8f6	171	22	.	.	.
cord-002369-shk4n8f6	172	1	Using	use	VBG
cord-002369-shk4n8f6	172	2	this	this	DT
cord-002369-shk4n8f6	172	3	system	system	NN
cord-002369-shk4n8f6	172	4	,	,	,
cord-002369-shk4n8f6	172	5	we	-PRON-	PRP
cord-002369-shk4n8f6	172	6	demonstrated	demonstrate	VBD
cord-002369-shk4n8f6	172	7	that	that	IN
cord-002369-shk4n8f6	172	8	ATG7	ATG7	NNP
cord-002369-shk4n8f6	172	9	as	as	RB
cord-002369-shk4n8f6	172	10	well	well	RB
cord-002369-shk4n8f6	172	11	as	as	IN
cord-002369-shk4n8f6	172	12	ATG12	atg12	JJ
cord-002369-shk4n8f6	172	13	expression	expression	NN
cord-002369-shk4n8f6	172	14	,	,	,
cord-002369-shk4n8f6	172	15	but	but	CC
cord-002369-shk4n8f6	172	16	not	not	RB
cord-002369-shk4n8f6	172	17	LC3	lc3	JJ
cord-002369-shk4n8f6	172	18	,	,	,
cord-002369-shk4n8f6	172	19	are	be	VBP
cord-002369-shk4n8f6	172	20	important	important	JJ
cord-002369-shk4n8f6	172	21	to	to	TO
cord-002369-shk4n8f6	172	22	obtain	obtain	VB
cord-002369-shk4n8f6	172	23	a	a	DT
cord-002369-shk4n8f6	172	24	wild	wild	JJ
cord-002369-shk4n8f6	172	25	-	-	HYPH
cord-002369-shk4n8f6	172	26	type	type	NN
cord-002369-shk4n8f6	172	27	MW	mw	NN
cord-002369-shk4n8f6	172	28	phenotype	phenotype	NN
cord-002369-shk4n8f6	172	29	,	,	,
cord-002369-shk4n8f6	172	30	as	as	IN
cord-002369-shk4n8f6	172	31	observed	observe	VBN
cord-002369-shk4n8f6	172	32	using	use	VBG
cord-002369-shk4n8f6	172	33	confocal	confocal	JJ
cord-002369-shk4n8f6	172	34	microscopy	microscopy	NNS
cord-002369-shk4n8f6	172	35	(	(	-LRB-
cord-002369-shk4n8f6	172	36	Fig	Fig	NNP
cord-002369-shk4n8f6	172	37	.	.	.
cord-002369-shk4n8f6	172	38	6	6	CD
cord-002369-shk4n8f6	172	39	)	)	-RRB-
cord-002369-shk4n8f6	172	40	.	.	.
cord-002369-shk4n8f6	173	1	Furthermore	furthermore	RB
cord-002369-shk4n8f6	173	2	,	,	,
cord-002369-shk4n8f6	173	3	the	the	DT
cord-002369-shk4n8f6	173	4	morphology	morphology	NN
cord-002369-shk4n8f6	173	5	of	of	IN
cord-002369-shk4n8f6	173	6	the	the	DT
cord-002369-shk4n8f6	173	7	HCV	HCV	NNP
cord-002369-shk4n8f6	173	8	-	-	HYPH
cord-002369-shk4n8f6	173	9	induced	induce	VBN
cord-002369-shk4n8f6	173	10	vesicles	vesicle	NNS
cord-002369-shk4n8f6	173	11	was	be	VBD
cord-002369-shk4n8f6	173	12	severely	severely	RB
cord-002369-shk4n8f6	173	13	altered	alter	VBN
cord-002369-shk4n8f6	173	14	after	after	IN
cord-002369-shk4n8f6	173	15	silencing	silence	VBG
cord-002369-shk4n8f6	173	16	of	of	IN
cord-002369-shk4n8f6	173	17	ATG7	ATG7	NNP
cord-002369-shk4n8f6	173	18	or	or	CC
cord-002369-shk4n8f6	173	19	ATG12	ATG12	NNP
cord-002369-shk4n8f6	173	20	,	,	,
cord-002369-shk4n8f6	173	21	but	but	CC
cord-002369-shk4n8f6	173	22	not	not	RB
cord-002369-shk4n8f6	173	23	LC3	lc3	JJ
cord-002369-shk4n8f6	173	24	.	.	.
cord-002369-shk4n8f6	174	1	Notably	notably	RB
cord-002369-shk4n8f6	174	2	,	,	,
cord-002369-shk4n8f6	174	3	knocking	knock	VBG
cord-002369-shk4n8f6	174	4	down	down	RP
cord-002369-shk4n8f6	174	5	ATG12	ATG12	NNP
cord-002369-shk4n8f6	174	6	decreased	decrease	VBD
cord-002369-shk4n8f6	174	7	the	the	DT
cord-002369-shk4n8f6	174	8	size	size	NN
cord-002369-shk4n8f6	174	9	and	and	CC
cord-002369-shk4n8f6	174	10	the	the	DT
cord-002369-shk4n8f6	174	11	number	number	NN
cord-002369-shk4n8f6	174	12	of	of	IN
cord-002369-shk4n8f6	174	13	DMVs	dmv	NNS
cord-002369-shk4n8f6	174	14	,	,	,
cord-002369-shk4n8f6	174	15	whereas	whereas	IN
cord-002369-shk4n8f6	174	16	silencing	silencing	NN
cord-002369-shk4n8f6	174	17	of	of	IN
cord-002369-shk4n8f6	174	18	ATG7	ATG7	NNP
cord-002369-shk4n8f6	174	19	mainly	mainly	RB
cord-002369-shk4n8f6	174	20	affected	affect	VBD
cord-002369-shk4n8f6	174	21	their	-PRON-	PRP$
cord-002369-shk4n8f6	174	22	size	size	NN
cord-002369-shk4n8f6	174	23	(	(	-LRB-
cord-002369-shk4n8f6	174	24	Fig	Fig	NNP
cord-002369-shk4n8f6	174	25	.	.	NNP
cord-002369-shk4n8f6	174	26	7	7	CD
cord-002369-shk4n8f6	174	27	)	)	-RRB-
cord-002369-shk4n8f6	174	28	.	.	.
cord-002369-shk4n8f6	175	1	At	at	IN
cord-002369-shk4n8f6	175	2	the	the	DT
cord-002369-shk4n8f6	175	3	moment	moment	NN
cord-002369-shk4n8f6	175	4	,	,	,
cord-002369-shk4n8f6	175	5	it	-PRON-	PRP
cord-002369-shk4n8f6	175	6	remains	remain	VBZ
cord-002369-shk4n8f6	175	7	unknown	unknown	JJ
cord-002369-shk4n8f6	175	8	whether	whether	IN
cord-002369-shk4n8f6	175	9	the	the	DT
cord-002369-shk4n8f6	175	10	altered	altered	JJ
cord-002369-shk4n8f6	175	11	MW	MW	NNP
cord-002369-shk4n8f6	175	12	is	be	VBZ
cord-002369-shk4n8f6	175	13	HCV	HCV	NNP
cord-002369-shk4n8f6	175	14	-	-	HYPH
cord-002369-shk4n8f6	175	15	replication	replication	NN
cord-002369-shk4n8f6	175	16	competent	competent	JJ
cord-002369-shk4n8f6	175	17	.	.	.
cord-002369-shk4n8f6	176	1	However	however	RB
cord-002369-shk4n8f6	176	2	,	,	,
cord-002369-shk4n8f6	176	3	the	the	DT
cord-002369-shk4n8f6	176	4	importance	importance	NN
cord-002369-shk4n8f6	176	5	of	of	IN
cord-002369-shk4n8f6	176	6	the	the	DT
cord-002369-shk4n8f6	176	7	ATG5	ATG5	NNP
cord-002369-shk4n8f6	176	8	-	-	HYPH
cord-002369-shk4n8f6	176	9	12	12	CD
cord-002369-shk4n8f6	176	10	conjugate	conjugate	NN
cord-002369-shk4n8f6	176	11	in	in	IN
cord-002369-shk4n8f6	176	12	HCV	HCV	NNP
cord-002369-shk4n8f6	176	13	RNA	RNA	NNP
cord-002369-shk4n8f6	176	14	replication	replication	NN
cord-002369-shk4n8f6	176	15	suggests	suggest	VBZ
cord-002369-shk4n8f6	176	16	that	that	IN
cord-002369-shk4n8f6	176	17	the	the	DT
cord-002369-shk4n8f6	176	18	autophagy	autophagy	NN
cord-002369-shk4n8f6	176	19	elongation	elongation	NN
cord-002369-shk4n8f6	176	20	complex	complex	NN
cord-002369-shk4n8f6	176	21	inhibits	inhibit	VBZ
cord-002369-shk4n8f6	176	22	HCV	HCV	NNP
cord-002369-shk4n8f6	176	23	replication	replication	NN
cord-002369-shk4n8f6	176	24	through	through	IN
cord-002369-shk4n8f6	176	25	destabilization	destabilization	NN
cord-002369-shk4n8f6	176	26	of	of	IN
cord-002369-shk4n8f6	176	27	the	the	DT
cord-002369-shk4n8f6	176	28	viral	viral	JJ
cord-002369-shk4n8f6	176	29	replication	replication	NN
cord-002369-shk4n8f6	176	30	factories	factory	NNS
cord-002369-shk4n8f6	176	31	present	present	JJ
cord-002369-shk4n8f6	176	32	within	within	IN
cord-002369-shk4n8f6	176	33	the	the	DT
cord-002369-shk4n8f6	176	34	MW	MW	NNP
cord-002369-shk4n8f6	176	35	.	.	.
cord-002369-shk4n8f6	177	1	In	in	IN
cord-002369-shk4n8f6	177	2	summary	summary	NN
cord-002369-shk4n8f6	177	3	,	,	,
cord-002369-shk4n8f6	177	4	recruitment	recruitment	NN
cord-002369-shk4n8f6	177	5	of	of	IN
cord-002369-shk4n8f6	177	6	the	the	DT
cord-002369-shk4n8f6	177	7	autophagy	autophagy	NN
cord-002369-shk4n8f6	177	8	elongation	elongation	NN
cord-002369-shk4n8f6	177	9	complex	complex	JJ
cord-002369-shk4n8f6	177	10	to	to	IN
cord-002369-shk4n8f6	177	11	the	the	DT
cord-002369-shk4n8f6	177	12	MW	MW	NNP
cord-002369-shk4n8f6	177	13	,	,	,
cord-002369-shk4n8f6	177	14	which	which	WDT
cord-002369-shk4n8f6	177	15	is	be	VBZ
cord-002369-shk4n8f6	177	16	normally	normally	RB
cord-002369-shk4n8f6	177	17	involved	involve	VBN
cord-002369-shk4n8f6	177	18	in	in	IN
cord-002369-shk4n8f6	177	19	DMV	DMV	NNP
cord-002369-shk4n8f6	177	20	formation	formation	NN
cord-002369-shk4n8f6	177	21	,	,	,
cord-002369-shk4n8f6	177	22	promotes	promote	VBZ
cord-002369-shk4n8f6	177	23	viral	viral	JJ
cord-002369-shk4n8f6	177	24	replication	replication	NN
cord-002369-shk4n8f6	177	25	and	and	CC
cord-002369-shk4n8f6	177	26	maintains	maintain	VBZ
cord-002369-shk4n8f6	177	27	proper	proper	JJ
cord-002369-shk4n8f6	177	28	formation	formation	NN
cord-002369-shk4n8f6	177	29	of	of	IN
cord-002369-shk4n8f6	177	30	the	the	DT
cord-002369-shk4n8f6	177	31	wild	wild	JJ
cord-002369-shk4n8f6	177	32	type	type	NN
cord-002369-shk4n8f6	177	33	MW	mw	NN
cord-002369-shk4n8f6	177	34	.	.	.
cord-002369-shk4n8f6	178	1	Cell	cell	NN
cord-002369-shk4n8f6	178	2	culture	culture	NN
cord-002369-shk4n8f6	178	3	and	and	CC
cord-002369-shk4n8f6	178	4	reagents	reagent	NNS
cord-002369-shk4n8f6	178	5	.	.	.
cord-002369-shk4n8f6	179	1	Huh7	Huh7	NNP
cord-002369-shk4n8f6	179	2	and	and	CC
cord-002369-shk4n8f6	179	3	Huh7-Lunet	Huh7-Lunet	NNP
cord-002369-shk4n8f6	179	4	cells	cell	NNS
cord-002369-shk4n8f6	179	5	stably	stably	RB
cord-002369-shk4n8f6	179	6	expressing	express	VBG
cord-002369-shk4n8f6	179	7	Calnexin	Calnexin	NNP
cord-002369-shk4n8f6	179	8	or	or	CC
cord-002369-shk4n8f6	179	9	NS4B	NS4B	NNP
cord-002369-shk4n8f6	179	10	-	-	HYPH
cord-002369-shk4n8f6	179	11	HA	HA	NNP
cord-002369-shk4n8f6	179	12	replicon	replicon	NN
cord-002369-shk4n8f6	179	13	were	be	VBD
cord-002369-shk4n8f6	179	14	obtained	obtain	VBN
cord-002369-shk4n8f6	179	15	from	from	IN
cord-002369-shk4n8f6	179	16	Dr	Dr	NNP
cord-002369-shk4n8f6	179	17	Ralf	Ralf	NNP
cord-002369-shk4n8f6	179	18	Bartenschlager	Bartenschlager	NNP
cord-002369-shk4n8f6	179	19	.	.	.
cord-002369-shk4n8f6	180	1	Huh7-Lunet	huh7-lunet	NN
cord-002369-shk4n8f6	180	2	cells	cell	NNS
cord-002369-shk4n8f6	180	3	stably	stably	RB
cord-002369-shk4n8f6	180	4	expressing	express	VBG
cord-002369-shk4n8f6	180	5	the	the	DT
cord-002369-shk4n8f6	180	6	T7	t7	NN
cord-002369-shk4n8f6	180	7	polymerase	polymerase	NN
cord-002369-shk4n8f6	180	8	(	(	-LRB-
cord-002369-shk4n8f6	180	9	Huh7-Lunet	Huh7-Lunet	NNP
cord-002369-shk4n8f6	180	10	-	-	HYPH
cord-002369-shk4n8f6	180	11	T7	T7	NNP
cord-002369-shk4n8f6	180	12	)	)	-RRB-
cord-002369-shk4n8f6	180	13	was	be	VBD
cord-002369-shk4n8f6	180	14	obtained	obtain	VBN
cord-002369-shk4n8f6	180	15	from	from	IN
cord-002369-shk4n8f6	180	16	Dr.	Dr.	NNP
cord-002369-shk4n8f6	180	17	Volker	Volker	NNP
cord-002369-shk4n8f6	180	18	Lohmann	Lohmann	NNP
cord-002369-shk4n8f6	180	19	,	,	,
cord-002369-shk4n8f6	180	20	and	and	CC
cord-002369-shk4n8f6	180	21	the	the	DT
cord-002369-shk4n8f6	180	22	Huh7.5	Huh7.5	NNP
cord-002369-shk4n8f6	180	23	cell	cell	NN
cord-002369-shk4n8f6	180	24	line	line	NN
cord-002369-shk4n8f6	180	25	was	be	VBD
cord-002369-shk4n8f6	180	26	obtained	obtain	VBN
cord-002369-shk4n8f6	180	27	from	from	IN
cord-002369-shk4n8f6	180	28	Dr.	Dr.	NNP
cord-002369-shk4n8f6	180	29	Charles	Charles	NNP
cord-002369-shk4n8f6	180	30	Rice	Rice	NNP
cord-002369-shk4n8f6	180	31	.	.	.
cord-002369-shk4n8f6	181	1	All	all	DT
cord-002369-shk4n8f6	181	2	Huh7-derived	Huh7-derived	NNP
cord-002369-shk4n8f6	181	3	cell	cell	NN
cord-002369-shk4n8f6	181	4	lines	line	NNS
cord-002369-shk4n8f6	181	5	were	be	VBD
cord-002369-shk4n8f6	181	6	cultured	culture	VBN
cord-002369-shk4n8f6	181	7	in	in	IN
cord-002369-shk4n8f6	181	8	Dulbecco	Dulbecco	NNP
cord-002369-shk4n8f6	181	9	's	's	POS
cord-002369-shk4n8f6	181	10	modified	modify	VBN
cord-002369-shk4n8f6	181	11	Eagle	Eagle	NNP
cord-002369-shk4n8f6	181	12	's	's	POS
cord-002369-shk4n8f6	181	13	medium	medium	NN
cord-002369-shk4n8f6	181	14	(	(	-LRB-
cord-002369-shk4n8f6	181	15	DMEM	DMEM	NNP
cord-002369-shk4n8f6	181	16	;	;	:
cord-002369-shk4n8f6	181	17	Gibco	Gibco	NNP
cord-002369-shk4n8f6	181	18	)	)	-RRB-
cord-002369-shk4n8f6	181	19	supplemented	supplement	VBD
cord-002369-shk4n8f6	181	20	with	with	IN
cord-002369-shk4n8f6	181	21	10	10	CD
cord-002369-shk4n8f6	181	22	%	%	NN
cord-002369-shk4n8f6	181	23	v	v	NN
cord-002369-shk4n8f6	181	24	/	/	SYM
cord-002369-shk4n8f6	181	25	v	v	IN
cord-002369-shk4n8f6	181	26	fetal	fetal	JJ
cord-002369-shk4n8f6	181	27	bovine	bovine	JJ
cord-002369-shk4n8f6	181	28	serum	serum	NN
cord-002369-shk4n8f6	181	29	(	(	-LRB-
cord-002369-shk4n8f6	181	30	FBS	FBS	NNP
cord-002369-shk4n8f6	181	31	)	)	-RRB-
cord-002369-shk4n8f6	181	32	(	(	-LRB-
cord-002369-shk4n8f6	181	33	Multicell	Multicell	NNP
cord-002369-shk4n8f6	181	34	)	)	-RRB-
cord-002369-shk4n8f6	181	35	,	,	,
cord-002369-shk4n8f6	181	36	100	100	CD
cord-002369-shk4n8f6	181	37	U	u	NN
cord-002369-shk4n8f6	181	38	/	/	SYM
cord-002369-shk4n8f6	181	39	ml	ml	NN
cord-002369-shk4n8f6	181	40	penicillin	penicillin	NN
cord-002369-shk4n8f6	181	41	,	,	,
cord-002369-shk4n8f6	181	42	100	100	CD
cord-002369-shk4n8f6	181	43	μ	μ	NN
cord-002369-shk4n8f6	181	44	g	g	NN
cord-002369-shk4n8f6	181	45	/	/	SYM
cord-002369-shk4n8f6	181	46	ml	ml	NN
cord-002369-shk4n8f6	181	47	streptomycin	streptomycin	NN
cord-002369-shk4n8f6	181	48	,	,	,
cord-002369-shk4n8f6	181	49	and	and	CC
cord-002369-shk4n8f6	181	50	2	2	CD
cord-002369-shk4n8f6	181	51	mM	mm	CD
cord-002369-shk4n8f6	181	52	L	l	NN
cord-002369-shk4n8f6	181	53	-	-	HYPH
cord-002369-shk4n8f6	181	54	glutamine	glutamine	NN
cord-002369-shk4n8f6	181	55	(	(	-LRB-
cord-002369-shk4n8f6	181	56	Gibco	Gibco	NNP
cord-002369-shk4n8f6	181	57	)	)	-RRB-
cord-002369-shk4n8f6	181	58	at	at	IN
cord-002369-shk4n8f6	181	59	37	37	CD
cord-002369-shk4n8f6	181	60	°	°	NN
cord-002369-shk4n8f6	181	61	C	c	NN
cord-002369-shk4n8f6	181	62	,	,	,
cord-002369-shk4n8f6	181	63	5	5	CD
cord-002369-shk4n8f6	181	64	%	%	NN
cord-002369-shk4n8f6	181	65	CO	co	NN
cord-002369-shk4n8f6	181	66	2	2	CD
cord-002369-shk4n8f6	181	67	,	,	,
cord-002369-shk4n8f6	181	68	in	in	IN
cord-002369-shk4n8f6	181	69	a	a	DT
cord-002369-shk4n8f6	181	70	humidified	humidify	VBN
cord-002369-shk4n8f6	181	71	incubator	incubator	NN
cord-002369-shk4n8f6	181	72	.	.	.
cord-002369-shk4n8f6	182	1	Cell	cell	NN
cord-002369-shk4n8f6	182	2	lines	line	NNS
cord-002369-shk4n8f6	182	3	harboring	harbor	VBG
cord-002369-shk4n8f6	182	4	the	the	DT
cord-002369-shk4n8f6	182	5	wild	wild	JJ
cord-002369-shk4n8f6	182	6	-	-	HYPH
cord-002369-shk4n8f6	182	7	type	type	NN
cord-002369-shk4n8f6	182	8	replicon	replicon	NN
cord-002369-shk4n8f6	182	9	or	or	CC
cord-002369-shk4n8f6	182	10	NS4B	NS4B	NNP
cord-002369-shk4n8f6	182	11	HA	HA	NNP
cord-002369-shk4n8f6	182	12	were	be	VBD
cord-002369-shk4n8f6	182	13	maintained	maintain	VBN
cord-002369-shk4n8f6	182	14	in	in	IN
cord-002369-shk4n8f6	182	15	medium	medium	NN
cord-002369-shk4n8f6	182	16	supplemented	supplement	VBN
cord-002369-shk4n8f6	182	17	with	with	IN
cord-002369-shk4n8f6	182	18	G418	G418	NNS
cord-002369-shk4n8f6	182	19	(	(	-LRB-
cord-002369-shk4n8f6	182	20	Gibco	Gibco	NNP
cord-002369-shk4n8f6	182	21	)	)	-RRB-
cord-002369-shk4n8f6	182	22	at	at	IN
cord-002369-shk4n8f6	182	23	a	a	DT
cord-002369-shk4n8f6	182	24	final	final	JJ
cord-002369-shk4n8f6	182	25	concentration	concentration	NN
cord-002369-shk4n8f6	182	26	of	of	IN
cord-002369-shk4n8f6	182	27	500	500	CD
cord-002369-shk4n8f6	182	28	μ	μ	NN
cord-002369-shk4n8f6	182	29	g	g	NN
cord-002369-shk4n8f6	182	30	/	/	SYM
cord-002369-shk4n8f6	182	31	ml	ml	NN
cord-002369-shk4n8f6	182	32	.	.	NNP
cord-002369-shk4n8f6	182	33	Huh7-Lunet	Huh7-Lunet	NNP
cord-002369-shk4n8f6	182	34	-	-	HYPH
cord-002369-shk4n8f6	182	35	T7	T7	NNP
cord-002369-shk4n8f6	182	36	and	and	CC
cord-002369-shk4n8f6	182	37	Huh7-Lunet	Huh7-Lunet	NNP
cord-002369-shk4n8f6	182	38	cells	cell	NNS
cord-002369-shk4n8f6	182	39	stably	stably	RB
cord-002369-shk4n8f6	182	40	expressing	express	VBG
cord-002369-shk4n8f6	182	41	calnexin	calnexin	NNP
cord-002369-shk4n8f6	182	42	were	be	VBD
cord-002369-shk4n8f6	182	43	cultured	culture	VBN
cord-002369-shk4n8f6	182	44	in	in	IN
cord-002369-shk4n8f6	182	45	the	the	DT
cord-002369-shk4n8f6	182	46	presence	presence	NN
cord-002369-shk4n8f6	182	47	of	of	IN
cord-002369-shk4n8f6	182	48	10	10	CD
cord-002369-shk4n8f6	182	49	μ	μ	NN
cord-002369-shk4n8f6	182	50	g	g	NN
cord-002369-shk4n8f6	182	51	/	/	SYM
cord-002369-shk4n8f6	182	52	ml	ml	NN
cord-002369-shk4n8f6	182	53	blasticidin	blasticidin	NNP
cord-002369-shk4n8f6	182	54	(	(	-LRB-
cord-002369-shk4n8f6	182	55	In	in	IN
cord-002369-shk4n8f6	182	56	vivo	vivo	NNP
cord-002369-shk4n8f6	182	57	Gen	Gen	NNP
cord-002369-shk4n8f6	182	58	)	)	-RRB-
cord-002369-shk4n8f6	182	59	.	.	.
cord-002369-shk4n8f6	183	1	Plasmids	plasmid	NNS
cord-002369-shk4n8f6	183	2	and	and	CC
cord-002369-shk4n8f6	183	3	antibodies	antibody	NNS
cord-002369-shk4n8f6	183	4	.	.	.
cord-002369-shk4n8f6	184	1	The	the	DT
cord-002369-shk4n8f6	184	2	hATG5	hatg5	NN
cord-002369-shk4n8f6	184	3	and	and	CC
cord-002369-shk4n8f6	184	4	hATG16L1	hatg16l1	NN
cord-002369-shk4n8f6	184	5	sequences	sequence	NNS
cord-002369-shk4n8f6	184	6	were	be	VBD
cord-002369-shk4n8f6	184	7	cloned	clone	VBN
cord-002369-shk4n8f6	184	8	into	into	IN
cord-002369-shk4n8f6	184	9	the	the	DT
cord-002369-shk4n8f6	184	10	peGFP	pegfp	CD
cord-002369-shk4n8f6	184	11	-	-	HYPH
cord-002369-shk4n8f6	184	12	C1	c1	NN
cord-002369-shk4n8f6	184	13	plasmid	plasmid	NN
cord-002369-shk4n8f6	184	14	(	(	-LRB-
cord-002369-shk4n8f6	184	15	Clontech	Clontech	NNP
cord-002369-shk4n8f6	184	16	)	)	-RRB-
cord-002369-shk4n8f6	184	17	,	,	,
cord-002369-shk4n8f6	184	18	thus	thus	RB
cord-002369-shk4n8f6	184	19	forming	form	VBG
cord-002369-shk4n8f6	184	20	pGFP	pGFP	NNP
cord-002369-shk4n8f6	184	21	-	-	HYPH
cord-002369-shk4n8f6	184	22	ATG5	ATG5	NNP
cord-002369-shk4n8f6	184	23	and	and	CC
cord-002369-shk4n8f6	184	24	pGFP	pgfp	NN
cord-002369-shk4n8f6	184	25	-	-	HYPH
cord-002369-shk4n8f6	184	26	ATG16L1	ATG16L1	NNS
cord-002369-shk4n8f6	184	27	,	,	,
cord-002369-shk4n8f6	184	28	respectively	respectively	RB
cord-002369-shk4n8f6	184	29	.	.	.
cord-002369-shk4n8f6	185	1	The	the	DT
cord-002369-shk4n8f6	185	2	Flag	Flag	NNP
cord-002369-shk4n8f6	185	3	-	-	HYPH
cord-002369-shk4n8f6	185	4	tagged	tagged	NNP
cord-002369-shk4n8f6	185	5	ATG12	ATG12	NNP
cord-002369-shk4n8f6	185	6	(	(	-LRB-
cord-002369-shk4n8f6	185	7	pATG12	pATG12	NNP
cord-002369-shk4n8f6	185	8	)	)	-RRB-
cord-002369-shk4n8f6	185	9	and	and	CC
cord-002369-shk4n8f6	185	10	its	-PRON-	PRP$
cord-002369-shk4n8f6	185	11	dominant	dominant	JJ
cord-002369-shk4n8f6	185	12	-	-	HYPH
cord-002369-shk4n8f6	185	13	negative	negative	JJ
cord-002369-shk4n8f6	185	14	derivative	derivative	NN
cord-002369-shk4n8f6	185	15	pATG12Δ	patg12δ	NN
cord-002369-shk4n8f6	185	16	G140	g140	CC
cord-002369-shk4n8f6	185	17	(	(	-LRB-
cord-002369-shk4n8f6	185	18	ATG12DN	ATG12DN	NNP
cord-002369-shk4n8f6	185	19	)	)	-RRB-
cord-002369-shk4n8f6	185	20	constructs	construct	NNS
cord-002369-shk4n8f6	185	21	were	be	VBD
cord-002369-shk4n8f6	185	22	kindly	kindly	RB
cord-002369-shk4n8f6	185	23	provided	provide	VBN
cord-002369-shk4n8f6	185	24	by	by	IN
cord-002369-shk4n8f6	185	25	Dr.	Dr.	NNP
cord-002369-shk4n8f6	185	26	Adi	Adi	NNP
cord-002369-shk4n8f6	185	27	Kimchi	Kimchi	NNP
cord-002369-shk4n8f6	185	28	39	39	CD
cord-002369-shk4n8f6	185	29	.	.	.
cord-002369-shk4n8f6	186	1	The	the	DT
cord-002369-shk4n8f6	186	2	PTM	PTM	NNP
cord-002369-shk4n8f6	186	3	vector	vector	NN
cord-002369-shk4n8f6	186	4	for	for	IN
cord-002369-shk4n8f6	186	5	the	the	DT
cord-002369-shk4n8f6	186	6	expression	expression	NN
cord-002369-shk4n8f6	186	7	of	of	IN
cord-002369-shk4n8f6	186	8	HCV	HCV	NNP
cord-002369-shk4n8f6	186	9	nonstructural	nonstructural	JJ
cord-002369-shk4n8f6	186	10	proteins	protein	NNS
cord-002369-shk4n8f6	186	11	NS3	ns3	RB
cord-002369-shk4n8f6	186	12	to	to	IN
cord-002369-shk4n8f6	186	13	5B	5b	NN
cord-002369-shk4n8f6	186	14	(	(	-LRB-
cord-002369-shk4n8f6	186	15	pTM	pTM	NNP
cord-002369-shk4n8f6	186	16	-	-	HYPH
cord-002369-shk4n8f6	186	17	NS3	ns3	NN
cord-002369-shk4n8f6	186	18	-	-	HYPH
cord-002369-shk4n8f6	186	19	5B	5b	NN
cord-002369-shk4n8f6	186	20	)	)	-RRB-
cord-002369-shk4n8f6	186	21	was	be	VBD
cord-002369-shk4n8f6	186	22	kindly	kindly	RB
cord-002369-shk4n8f6	186	23	provided	provide	VBN
cord-002369-shk4n8f6	186	24	by	by	IN
cord-002369-shk4n8f6	186	25	Dr.	Dr.	NNP
cord-002369-shk4n8f6	186	26	Volker	Volker	NNP
cord-002369-shk4n8f6	186	27	Lohmann	Lohmann	NNP
cord-002369-shk4n8f6	186	28	.	.	.
cord-002369-shk4n8f6	187	1	Rabbit	rabbit	NN
cord-002369-shk4n8f6	187	2	polyclonal	polyclonal	JJ
cord-002369-shk4n8f6	187	3	anti	anti	JJ
cord-002369-shk4n8f6	187	4	-	-	JJ
cord-002369-shk4n8f6	187	5	LC3	lc3	JJ
cord-002369-shk4n8f6	188	1	,	,	,
cord-002369-shk4n8f6	188	2	rabbit	rabbit	NN
cord-002369-shk4n8f6	188	3	polyclonal	polyclonal	JJ
cord-002369-shk4n8f6	188	4	anti	anti	NNP
cord-002369-shk4n8f6	188	5	-	-	NNP
cord-002369-shk4n8f6	188	6	ATG5	atg5	JJ
cord-002369-shk4n8f6	189	1	,	,	,
cord-002369-shk4n8f6	189	2	mouse	mouse	NN
cord-002369-shk4n8f6	189	3	monoclonal	monoclonal	JJ
cord-002369-shk4n8f6	189	4	anti	anti	NNP
cord-002369-shk4n8f6	189	5	-	-	JJ
cord-002369-shk4n8f6	189	6	Flag	flag	JJ
cord-002369-shk4n8f6	190	1	,	,	,
cord-002369-shk4n8f6	190	2	and	and	CC
cord-002369-shk4n8f6	190	3	mouse	mouse	VB
cord-002369-shk4n8f6	190	4	monoclonal	monoclonal	JJ
cord-002369-shk4n8f6	190	5	anti	anti	NNP
cord-002369-shk4n8f6	190	6	-	-	JJ
cord-002369-shk4n8f6	190	7	β	β	JJ
cord-002369-shk4n8f6	190	8	-actin	-actin	NNP
cord-002369-shk4n8f6	190	9	antibodies	antibody	NNS
cord-002369-shk4n8f6	190	10	were	be	VBD
cord-002369-shk4n8f6	190	11	purchased	purchase	VBN
cord-002369-shk4n8f6	190	12	from	from	IN
cord-002369-shk4n8f6	190	13	Sigma	Sigma	NNP
cord-002369-shk4n8f6	190	14	Aldrich	Aldrich	NNP
cord-002369-shk4n8f6	190	15	.	.	.
cord-002369-shk4n8f6	191	1	Rabbit	rabbit	NN
cord-002369-shk4n8f6	191	2	polyclonal	polyclonal	JJ
cord-002369-shk4n8f6	191	3	anti	anti	JJ
cord-002369-shk4n8f6	191	4	-	-	JJ
cord-002369-shk4n8f6	191	5	ATG12	atg12	JJ
cord-002369-shk4n8f6	192	1	and	and	CC
cord-002369-shk4n8f6	192	2	anti	anti	JJ
cord-002369-shk4n8f6	192	3	-	-	NNP
cord-002369-shk4n8f6	192	4	ATG7	ATG7	NNP
cord-002369-shk4n8f6	192	5	were	be	VBD
cord-002369-shk4n8f6	192	6	purchased	purchase	VBN
cord-002369-shk4n8f6	192	7	from	from	IN
cord-002369-shk4n8f6	192	8	Cell	cell	NN
cord-002369-shk4n8f6	192	9	Signaling	Signaling	NNP
cord-002369-shk4n8f6	192	10	.	.	.
cord-002369-shk4n8f6	193	1	Rabbit	rabbit	NN
cord-002369-shk4n8f6	193	2	polyclonal	polyclonal	JJ
cord-002369-shk4n8f6	193	3	anti	anti	JJ
cord-002369-shk4n8f6	193	4	-	-	JJ
cord-002369-shk4n8f6	193	5	ATG16L1	atg16l1	JJ
cord-002369-shk4n8f6	193	6	antibody	antibody	NN
cord-002369-shk4n8f6	193	7	was	be	VBD
cord-002369-shk4n8f6	193	8	purchased	purchase	VBN
cord-002369-shk4n8f6	193	9	from	from	IN
cord-002369-shk4n8f6	193	10	MBL	MBL	NNP
cord-002369-shk4n8f6	193	11	.	.	.
cord-002369-shk4n8f6	194	1	Mouse	mouse	NN
cord-002369-shk4n8f6	194	2	monoclonal	monoclonal	JJ
cord-002369-shk4n8f6	194	3	anti	anti	NN
cord-002369-shk4n8f6	194	4	-	-	NN
cord-002369-shk4n8f6	194	5	HA	HA	NNP
cord-002369-shk4n8f6	194	6	was	be	VBD
cord-002369-shk4n8f6	194	7	purchased	purchase	VBN
cord-002369-shk4n8f6	194	8	from	from	IN
cord-002369-shk4n8f6	194	9	Roche	Roche	NNP
cord-002369-shk4n8f6	194	10	.	.	.
cord-002369-shk4n8f6	195	1	Mouse	mouse	NN
cord-002369-shk4n8f6	195	2	monoclonal	monoclonal	JJ
cord-002369-shk4n8f6	195	3	anti	anti	NN
cord-002369-shk4n8f6	195	4	-	-	JJ
cord-002369-shk4n8f6	195	5	NS3	ns3	JJ
cord-002369-shk4n8f6	195	6	and	and	CC
cord-002369-shk4n8f6	195	7	anti	anti	NNS
cord-002369-shk4n8f6	195	8	-	-	JJ
cord-002369-shk4n8f6	195	9	NS5A	ns5a	JJ
cord-002369-shk4n8f6	195	10	antibodies	antibody	NNS
cord-002369-shk4n8f6	195	11	were	be	VBD
cord-002369-shk4n8f6	195	12	purchased	purchase	VBN
cord-002369-shk4n8f6	195	13	from	from	IN
cord-002369-shk4n8f6	195	14	BioFront	BioFront	NNP
cord-002369-shk4n8f6	195	15	.	.	.
cord-002369-shk4n8f6	196	1	Rabbit	rabbit	NN
cord-002369-shk4n8f6	196	2	polyclonal	polyclonal	JJ
cord-002369-shk4n8f6	196	3	anti	anti	NN
cord-002369-shk4n8f6	196	4	-	-	NN
cord-002369-shk4n8f6	196	5	NS3	ns3	RB
cord-002369-shk4n8f6	197	1	and	and	CC
cord-002369-shk4n8f6	197	2	NS5A	NS5A	NNP
cord-002369-shk4n8f6	197	3	were	be	VBD
cord-002369-shk4n8f6	197	4	obtained	obtain	VBN
cord-002369-shk4n8f6	197	5	from	from	IN
cord-002369-shk4n8f6	197	6	Dr.	Dr.	NNP
cord-002369-shk4n8f6	197	7	Olivier	Olivier	NNP
cord-002369-shk4n8f6	197	8	Nicolas	Nicolas	NNP
cord-002369-shk4n8f6	197	9	.	.	.
cord-002369-shk4n8f6	198	1	Rabbit	Rabbit	NNP
cord-002369-shk4n8f6	198	2	polyclonal	polyclonal	NN
cord-002369-shk4n8f6	199	1	anti	anti	JJ
cord-002369-shk4n8f6	199	2	-	-	JJ
cord-002369-shk4n8f6	199	3	NS4B	ns4b	JJ
cord-002369-shk4n8f6	199	4	and	and	CC
cord-002369-shk4n8f6	199	5	anti	anti	JJ
cord-002369-shk4n8f6	199	6	-	-	JJ
cord-002369-shk4n8f6	199	7	NS5B	ns5b	JJ
cord-002369-shk4n8f6	199	8	antibodies	antibody	NNS
cord-002369-shk4n8f6	199	9	were	be	VBD
cord-002369-shk4n8f6	199	10	kindly	kindly	RB
cord-002369-shk4n8f6	199	11	provided	provide	VBN
cord-002369-shk4n8f6	199	12	by	by	IN
cord-002369-shk4n8f6	199	13	Drs	Drs	NNP
cord-002369-shk4n8f6	199	14	.	.	.
cord-002369-shk4n8f6	200	1	Kouacou	Kouacou	NNP
cord-002369-shk4n8f6	200	2	Konan	Konan	NNP
cord-002369-shk4n8f6	200	3	and	and	CC
cord-002369-shk4n8f6	200	4	Takaji	Takaji	NNP
cord-002369-shk4n8f6	200	5	Wakita	Wakita	NNP
cord-002369-shk4n8f6	200	6	,	,	,
cord-002369-shk4n8f6	200	7	respectively	respectively	RB
cord-002369-shk4n8f6	200	8	.	.	.
cord-002369-shk4n8f6	201	1	Mouse	mouse	NN
cord-002369-shk4n8f6	201	2	monoclonal	monoclonal	JJ
cord-002369-shk4n8f6	201	3	anti	anti	JJ
cord-002369-shk4n8f6	201	4	-	-	JJ
cord-002369-shk4n8f6	201	5	GAPDH	GAPDH	NNP
cord-002369-shk4n8f6	201	6	was	be	VBD
cord-002369-shk4n8f6	201	7	purchased	purchase	VBN
cord-002369-shk4n8f6	201	8	from	from	IN
cord-002369-shk4n8f6	201	9	Santa	Santa	NNP
cord-002369-shk4n8f6	201	10	Cruz	Cruz	NNP
cord-002369-shk4n8f6	201	11	.	.	.
cord-002369-shk4n8f6	202	1	The	the	DT
cord-002369-shk4n8f6	202	2	cell	cell	NN
cord-002369-shk4n8f6	202	3	culture	culture	NN
cord-002369-shk4n8f6	202	4	-	-	HYPH
cord-002369-shk4n8f6	202	5	derived	derive	VBN
cord-002369-shk4n8f6	202	6	HCV	HCV	NNP
cord-002369-shk4n8f6	202	7	(	(	-LRB-
cord-002369-shk4n8f6	202	8	HCVcc	HCVcc	NNP
cord-002369-shk4n8f6	202	9	)	)	-RRB-
cord-002369-shk4n8f6	202	10	JFH1	JFH1	NNP
cord-002369-shk4n8f6	202	11	virus	virus	NN
cord-002369-shk4n8f6	202	12	was	be	VBD
cord-002369-shk4n8f6	202	13	generated	generate	VBN
cord-002369-shk4n8f6	202	14	in	in	IN
cord-002369-shk4n8f6	202	15	Huh7	Huh7	NNP
cord-002369-shk4n8f6	202	16	cells	cell	NNS
cord-002369-shk4n8f6	202	17	by	by	IN
cord-002369-shk4n8f6	202	18	transfection	transfection	NN
cord-002369-shk4n8f6	202	19	of	of	IN
cord-002369-shk4n8f6	202	20	in	in	IN
cord-002369-shk4n8f6	202	21	vitro	vitro	FW
cord-002369-shk4n8f6	202	22	-	-	HYPH
cord-002369-shk4n8f6	202	23	transcribed	transcribe	VBN
cord-002369-shk4n8f6	202	24	full	full	JJ
cord-002369-shk4n8f6	202	25	-	-	HYPH
cord-002369-shk4n8f6	202	26	length	length	NN
cord-002369-shk4n8f6	202	27	JFH1	JFH1	NNP
cord-002369-shk4n8f6	202	28	RNA	RNA	NNP
cord-002369-shk4n8f6	202	29	(	(	-LRB-
cord-002369-shk4n8f6	202	30	MEGAscript	MEGAscript	NNP
cord-002369-shk4n8f6	202	31	,	,	,
cord-002369-shk4n8f6	202	32	Ambion	Ambion	NNP
cord-002369-shk4n8f6	202	33	)	)	-RRB-
cord-002369-shk4n8f6	202	34	.	.	.
cord-002369-shk4n8f6	203	1	Viral	viral	JJ
cord-002369-shk4n8f6	203	2	stocks	stock	NNS
cord-002369-shk4n8f6	203	3	were	be	VBD
cord-002369-shk4n8f6	203	4	produced	produce	VBN
cord-002369-shk4n8f6	203	5	by	by	IN
cord-002369-shk4n8f6	203	6	infection	infection	NN
cord-002369-shk4n8f6	203	7	of	of	IN
cord-002369-shk4n8f6	203	8	Huh7	Huh7	NNP
cord-002369-shk4n8f6	203	9	cells	cell	NNS
cord-002369-shk4n8f6	203	10	at	at	IN
cord-002369-shk4n8f6	203	11	a	a	DT
cord-002369-shk4n8f6	203	12	multiplicity	multiplicity	NN
cord-002369-shk4n8f6	203	13	of	of	IN
cord-002369-shk4n8f6	203	14	infection	infection	NN
cord-002369-shk4n8f6	203	15	(	(	-LRB-
cord-002369-shk4n8f6	203	16	MOI	MOI	NNP
cord-002369-shk4n8f6	203	17	)	)	-RRB-
cord-002369-shk4n8f6	203	18	of	of	IN
cord-002369-shk4n8f6	203	19	0.01	0.01	CD
cord-002369-shk4n8f6	203	20	,	,	,
cord-002369-shk4n8f6	203	21	as	as	IN
cord-002369-shk4n8f6	203	22	described	describe	VBN
cord-002369-shk4n8f6	203	23	previously	previously	RB
cord-002369-shk4n8f6	203	24	48	48	CD
cord-002369-shk4n8f6	203	25	.	.	.
cord-002369-shk4n8f6	204	1	A	a	DT
cord-002369-shk4n8f6	204	2	replicative	replicative	JJ
cord-002369-shk4n8f6	204	3	bicistronic	bicistronic	NN
cord-002369-shk4n8f6	204	4	JFH1-based	JFH1-based	NNP
cord-002369-shk4n8f6	205	1	full	full	JJ
cord-002369-shk4n8f6	205	2	-	-	HYPH
cord-002369-shk4n8f6	205	3	genome	genome	NN
cord-002369-shk4n8f6	205	4	construct	construct	NN
cord-002369-shk4n8f6	205	5	expressing	express	VBG
cord-002369-shk4n8f6	205	6	Firefly	Firefly	NNP
cord-002369-shk4n8f6	205	7	luciferase	luciferase	NN
cord-002369-shk4n8f6	205	8	(	(	-LRB-
cord-002369-shk4n8f6	205	9	pJFH1	pjfh1	NN
cord-002369-shk4n8f6	205	10	/	/	SYM
cord-002369-shk4n8f6	205	11	Fluc	Fluc	NNP
cord-002369-shk4n8f6	205	12	)	)	-RRB-
cord-002369-shk4n8f6	205	13	and	and	CC
cord-002369-shk4n8f6	205	14	a	a	DT
cord-002369-shk4n8f6	205	15	clone	clone	NN
cord-002369-shk4n8f6	205	16	with	with	IN
cord-002369-shk4n8f6	205	17	a	a	DT
cord-002369-shk4n8f6	205	18	mutation	mutation	NN
cord-002369-shk4n8f6	205	19	in	in	IN
cord-002369-shk4n8f6	205	20	the	the	DT
cord-002369-shk4n8f6	205	21	viral	viral	JJ
cord-002369-shk4n8f6	205	22	polymerase	polymerase	NN
cord-002369-shk4n8f6	205	23	(	(	-LRB-
cord-002369-shk4n8f6	205	24	GDD	GDD	NNP
cord-002369-shk4n8f6	205	25	-	-	HYPH
cord-002369-shk4n8f6	205	26	to	to	IN
cord-002369-shk4n8f6	205	27	-	-	HYPH
cord-002369-shk4n8f6	205	28	GND	GND	NNP
cord-002369-shk4n8f6	205	29	)	)	-RRB-
cord-002369-shk4n8f6	205	30	(	(	-LRB-
cord-002369-shk4n8f6	205	31	pJFH1	pjfh1	NN
cord-002369-shk4n8f6	205	32	/	/	SYM
cord-002369-shk4n8f6	205	33	Fluc	Fluc	NNP
cord-002369-shk4n8f6	205	34	-	-	HYPH
cord-002369-shk4n8f6	205	35	GND	GND	NNP
cord-002369-shk4n8f6	205	36	)	)	-RRB-
cord-002369-shk4n8f6	205	37	were	be	VBD
cord-002369-shk4n8f6	205	38	generated	generate	VBN
cord-002369-shk4n8f6	205	39	as	as	IN
cord-002369-shk4n8f6	205	40	previously	previously	RB
cord-002369-shk4n8f6	205	41	described	describe	VBN
cord-002369-shk4n8f6	205	42	49	49	CD
cord-002369-shk4n8f6	205	43	.	.	.
cord-002369-shk4n8f6	206	1	To	to	TO
cord-002369-shk4n8f6	206	2	reach	reach	VB
cord-002369-shk4n8f6	206	3	90	90	CD
cord-002369-shk4n8f6	206	4	%	%	NN
cord-002369-shk4n8f6	206	5	infected	infected	JJ
cord-002369-shk4n8f6	206	6	cells	cell	NNS
cord-002369-shk4n8f6	206	7	,	,	,
cord-002369-shk4n8f6	206	8	Huh7	huh7	NN
cord-002369-shk4n8f6	206	9	cells	cell	NNS
cord-002369-shk4n8f6	206	10	were	be	VBD
cord-002369-shk4n8f6	206	11	infected	infect	VBN
cord-002369-shk4n8f6	206	12	at	at	IN
cord-002369-shk4n8f6	206	13	an	an	DT
cord-002369-shk4n8f6	206	14	MOI	MOI	NNP
cord-002369-shk4n8f6	206	15	of	of	IN
cord-002369-shk4n8f6	206	16	0.01	0.01	CD
cord-002369-shk4n8f6	206	17	,	,	,
cord-002369-shk4n8f6	206	18	passaged	passage	VBN
cord-002369-shk4n8f6	206	19	for	for	IN
cord-002369-shk4n8f6	206	20	7	7	CD
cord-002369-shk4n8f6	206	21	days	day	NNS
cord-002369-shk4n8f6	206	22	and	and	CC
cord-002369-shk4n8f6	206	23	then	then	RB
cord-002369-shk4n8f6	206	24	analyzed	analyze	VBN
cord-002369-shk4n8f6	206	25	by	by	IN
cord-002369-shk4n8f6	206	26	immunofluorescence	immunofluorescence	NN
cord-002369-shk4n8f6	206	27	using	use	VBG
cord-002369-shk4n8f6	206	28	an	an	DT
cord-002369-shk4n8f6	206	29	anti	anti	JJ
cord-002369-shk4n8f6	206	30	-	-	JJ
cord-002369-shk4n8f6	206	31	NS5A	ns5a	JJ
cord-002369-shk4n8f6	206	32	antibody	antibody	NN
cord-002369-shk4n8f6	206	33	.	.	.
cord-002369-shk4n8f6	207	1	Western	western	JJ
cord-002369-shk4n8f6	207	2	blot	blot	NN
cord-002369-shk4n8f6	207	3	analysis	analysis	NN
cord-002369-shk4n8f6	207	4	.	.	.
cord-002369-shk4n8f6	208	1	Cells	cell	NNS
cord-002369-shk4n8f6	208	2	were	be	VBD
cord-002369-shk4n8f6	208	3	lysed	lyse	VBN
cord-002369-shk4n8f6	208	4	in	in	IN
cord-002369-shk4n8f6	208	5	300	300	CD
cord-002369-shk4n8f6	208	6	μ	μ	NN
cord-002369-shk4n8f6	208	7	l	l	NN
cord-002369-shk4n8f6	208	8	of	of	IN
cord-002369-shk4n8f6	208	9	lysis	lysis	NN
cord-002369-shk4n8f6	208	10	buffer	buffer	NN
cord-002369-shk4n8f6	208	11	[	[	-LRB-
cord-002369-shk4n8f6	208	12	25	25	CD
cord-002369-shk4n8f6	208	13	mM	mm	CD
cord-002369-shk4n8f6	208	14	Tris	Tris	NNP
cord-002369-shk4n8f6	208	15	-	-	HYPH
cord-002369-shk4n8f6	208	16	HCl	HCl	NNP
cord-002369-shk4n8f6	208	17	,	,	,
cord-002369-shk4n8f6	208	18	150	150	CD
cord-002369-shk4n8f6	208	19	mM	mm	CD
cord-002369-shk4n8f6	208	20	NaCl	nacl	NN
cord-002369-shk4n8f6	208	21	,	,	,
cord-002369-shk4n8f6	208	22	1	1	CD
cord-002369-shk4n8f6	208	23	mM	mm	CD
cord-002369-shk4n8f6	208	24	EDTA	EDTA	NNP
cord-002369-shk4n8f6	208	25	,	,	,
cord-002369-shk4n8f6	208	26	1	1	CD
cord-002369-shk4n8f6	208	27	%	%	NN
cord-002369-shk4n8f6	208	28	NP40	NP40	NNP
cord-002369-shk4n8f6	208	29	,	,	,
cord-002369-shk4n8f6	208	30	Complete	complete	JJ
cord-002369-shk4n8f6	208	31	protease	protease	NN
cord-002369-shk4n8f6	208	32	inhibitor	inhibitor	NN
cord-002369-shk4n8f6	208	33	(	(	-LRB-
cord-002369-shk4n8f6	208	34	Roche	Roche	NNP
cord-002369-shk4n8f6	208	35	)	)	-RRB-
cord-002369-shk4n8f6	208	36	]	]	-RRB-
cord-002369-shk4n8f6	208	37	.	.	.
cord-002369-shk4n8f6	209	1	The	the	DT
cord-002369-shk4n8f6	209	2	lysates	lysate	NNS
cord-002369-shk4n8f6	209	3	were	be	VBD
cord-002369-shk4n8f6	209	4	normalized	normalize	VBN
cord-002369-shk4n8f6	209	5	for	for	IN
cord-002369-shk4n8f6	209	6	total	total	JJ
cord-002369-shk4n8f6	209	7	protein	protein	NN
cord-002369-shk4n8f6	209	8	content	content	NN
cord-002369-shk4n8f6	209	9	using	use	VBG
cord-002369-shk4n8f6	209	10	the	the	DT
cord-002369-shk4n8f6	209	11	BCA	BCA	NNP
cord-002369-shk4n8f6	209	12	protein	protein	NN
cord-002369-shk4n8f6	209	13	assay	assay	NN
cord-002369-shk4n8f6	209	14	kit	kit	NN
cord-002369-shk4n8f6	209	15	(	(	-LRB-
cord-002369-shk4n8f6	209	16	Pierce	Pierce	NNP
cord-002369-shk4n8f6	209	17	)	)	-RRB-
cord-002369-shk4n8f6	209	18	.	.	.
cord-002369-shk4n8f6	210	1	The	the	DT
cord-002369-shk4n8f6	210	2	proteins	protein	NNS
cord-002369-shk4n8f6	210	3	were	be	VBD
cord-002369-shk4n8f6	210	4	then	then	RB
cord-002369-shk4n8f6	210	5	resolved	resolve	VBN
cord-002369-shk4n8f6	210	6	by	by	IN
cord-002369-shk4n8f6	210	7	SDS	SDS	NNP
cord-002369-shk4n8f6	210	8	-	-	HYPH
cord-002369-shk4n8f6	210	9	PAGE	PAGE	NNP
cord-002369-shk4n8f6	210	10	,	,	,
cord-002369-shk4n8f6	210	11	transferred	transfer	VBN
cord-002369-shk4n8f6	210	12	to	to	IN
cord-002369-shk4n8f6	210	13	polyvinylidene	polyvinylidene	NN
cord-002369-shk4n8f6	210	14	fluoride	fluoride	NN
cord-002369-shk4n8f6	210	15	(	(	-LRB-
cord-002369-shk4n8f6	210	16	PVDF	PVDF	NNP
cord-002369-shk4n8f6	210	17	)	)	-RRB-
cord-002369-shk4n8f6	210	18	membranes	membrane	NNS
cord-002369-shk4n8f6	210	19	(	(	-LRB-
cord-002369-shk4n8f6	210	20	Bio	Bio	NNP
cord-002369-shk4n8f6	210	21	-	-	HYPH
cord-002369-shk4n8f6	210	22	Rad	Rad	NNP
cord-002369-shk4n8f6	210	23	)	)	-RRB-
cord-002369-shk4n8f6	210	24	,	,	,
cord-002369-shk4n8f6	210	25	blocked	block	VBN
cord-002369-shk4n8f6	210	26	for	for	IN
cord-002369-shk4n8f6	210	27	30	30	CD
cord-002369-shk4n8f6	210	28	min	min	NN
cord-002369-shk4n8f6	210	29	at	at	IN
cord-002369-shk4n8f6	210	30	room	room	NN
cord-002369-shk4n8f6	210	31	temperature	temperature	NN
cord-002369-shk4n8f6	210	32	(	(	-LRB-
cord-002369-shk4n8f6	210	33	RT	RT	NNP
cord-002369-shk4n8f6	210	34	)	)	-RRB-
cord-002369-shk4n8f6	210	35	with	with	IN
cord-002369-shk4n8f6	210	36	PBS-5	PBS-5	NNP
cord-002369-shk4n8f6	210	37	%	%	NN
cord-002369-shk4n8f6	210	38	milk	milk	NN
cord-002369-shk4n8f6	210	39	,	,	,
cord-002369-shk4n8f6	210	40	and	and	CC
cord-002369-shk4n8f6	210	41	then	then	RB
cord-002369-shk4n8f6	210	42	incubated	incubate	VBN
cord-002369-shk4n8f6	210	43	overnight	overnight	RB
cord-002369-shk4n8f6	210	44	at	at	IN
cord-002369-shk4n8f6	210	45	4	4	CD
cord-002369-shk4n8f6	210	46	°	°	NN
cord-002369-shk4n8f6	210	47	C	c	NN
cord-002369-shk4n8f6	210	48	with	with	IN
cord-002369-shk4n8f6	210	49	primary	primary	JJ
cord-002369-shk4n8f6	210	50	antibody	antibody	NN
cord-002369-shk4n8f6	210	51	in	in	IN
cord-002369-shk4n8f6	210	52	PBS-2	PBS-2	NNP
cord-002369-shk4n8f6	210	53	%	%	NN
cord-002369-shk4n8f6	210	54	BSA	BSA	NNP
cord-002369-shk4n8f6	210	55	.	.	.
cord-002369-shk4n8f6	211	1	After	after	IN
cord-002369-shk4n8f6	211	2	being	be	VBG
cord-002369-shk4n8f6	211	3	washed	wash	VBN
cord-002369-shk4n8f6	211	4	with	with	IN
cord-002369-shk4n8f6	211	5	0.4	0.4	CD
cord-002369-shk4n8f6	211	6	%	%	NN
cord-002369-shk4n8f6	211	7	Tween	Tween	NNP
cord-002369-shk4n8f6	211	8	20	20	CD
cord-002369-shk4n8f6	211	9	in	in	IN
cord-002369-shk4n8f6	211	10	PBS	PBS	NNP
cord-002369-shk4n8f6	211	11	(	(	-LRB-
cord-002369-shk4n8f6	211	12	PBST	PBST	NNP
cord-002369-shk4n8f6	211	13	)	)	-RRB-
cord-002369-shk4n8f6	211	14	,	,	,
cord-002369-shk4n8f6	211	15	the	the	DT
cord-002369-shk4n8f6	211	16	membranes	membrane	NNS
cord-002369-shk4n8f6	211	17	were	be	VBD
cord-002369-shk4n8f6	211	18	incubated	incubate	VBN
cord-002369-shk4n8f6	211	19	for	for	IN
cord-002369-shk4n8f6	211	20	1	1	CD
cord-002369-shk4n8f6	211	21	h	h	NN
cord-002369-shk4n8f6	211	22	at	at	IN
cord-002369-shk4n8f6	211	23	RT	RT	NNP
cord-002369-shk4n8f6	211	24	with	with	IN
cord-002369-shk4n8f6	211	25	a	a	DT
cord-002369-shk4n8f6	211	26	goat	goat	NN
cord-002369-shk4n8f6	211	27	-	-	HYPH
cord-002369-shk4n8f6	211	28	anti	anti	JJ
cord-002369-shk4n8f6	211	29	-	-	JJ
cord-002369-shk4n8f6	211	30	rabbit	rabbit	JJ
cord-002369-shk4n8f6	211	31	or	or	CC
cord-002369-shk4n8f6	211	32	goat	goat	NN
cord-002369-shk4n8f6	211	33	-	-	HYPH
cord-002369-shk4n8f6	211	34	anti	anti	JJ
cord-002369-shk4n8f6	211	35	-	-	JJ
cord-002369-shk4n8f6	211	36	mouse	mouse	JJ
cord-002369-shk4n8f6	211	37	IgG	igg	NN
cord-002369-shk4n8f6	211	38	conjugated	conjugate	VBN
cord-002369-shk4n8f6	211	39	to	to	IN
cord-002369-shk4n8f6	211	40	horseradish	horseradish	NN
cord-002369-shk4n8f6	211	41	peroxidase	peroxidase	NN
cord-002369-shk4n8f6	211	42	in	in	IN
cord-002369-shk4n8f6	211	43	PBS-5	PBS-5	NNP
cord-002369-shk4n8f6	211	44	%	%	NN
cord-002369-shk4n8f6	211	45	milk	milk	NN
cord-002369-shk4n8f6	211	46	.	.	.
cord-002369-shk4n8f6	212	1	Protein	protein	NN
cord-002369-shk4n8f6	212	2	bands	band	NNS
cord-002369-shk4n8f6	212	3	were	be	VBD
cord-002369-shk4n8f6	212	4	visualized	visualize	VBN
cord-002369-shk4n8f6	212	5	with	with	IN
cord-002369-shk4n8f6	212	6	either	either	CC
cord-002369-shk4n8f6	212	7	the	the	DT
cord-002369-shk4n8f6	212	8	Clarity	clarity	NN
cord-002369-shk4n8f6	212	9	western	western	JJ
cord-002369-shk4n8f6	212	10	ECL	ECL	NNP
cord-002369-shk4n8f6	212	11	(	(	-LRB-
cord-002369-shk4n8f6	212	12	Bio	Bio	NNP
cord-002369-shk4n8f6	212	13	-	-	HYPH
cord-002369-shk4n8f6	212	14	Rad	Rad	NNP
cord-002369-shk4n8f6	212	15	)	)	-RRB-
cord-002369-shk4n8f6	212	16	or	or	CC
cord-002369-shk4n8f6	212	17	Femto	Femto	NNP
cord-002369-shk4n8f6	212	18	chemiluminescence	chemiluminescence	NN
cord-002369-shk4n8f6	212	19	substrates	substrate	NNS
cord-002369-shk4n8f6	212	20	(	(	-LRB-
cord-002369-shk4n8f6	212	21	Pierce	Pierce	NNP
cord-002369-shk4n8f6	212	22	)	)	-RRB-
cord-002369-shk4n8f6	212	23	.	.	.
cord-002369-shk4n8f6	213	1	Purification	purification	NN
cord-002369-shk4n8f6	213	2	of	of	IN
cord-002369-shk4n8f6	213	3	HCV	HCV	NNP
cord-002369-shk4n8f6	213	4	-	-	HYPH
cord-002369-shk4n8f6	213	5	induced	induce	VBN
cord-002369-shk4n8f6	213	6	MW	MW	NNP
cord-002369-shk4n8f6	213	7	.	.	.
cord-002369-shk4n8f6	214	1	HCV	HCV	NNP
cord-002369-shk4n8f6	214	2	-	-	HYPH
cord-002369-shk4n8f6	214	3	remodeled	remodel	VBN
cord-002369-shk4n8f6	214	4	membrane	membrane	NN
cord-002369-shk4n8f6	214	5	purification	purification	NN
cord-002369-shk4n8f6	214	6	was	be	VBD
cord-002369-shk4n8f6	214	7	performed	perform	VBN
cord-002369-shk4n8f6	214	8	using	use	VBG
cord-002369-shk4n8f6	214	9	a	a	DT
cord-002369-shk4n8f6	214	10	method	method	NN
cord-002369-shk4n8f6	214	11	adopted	adopt	VBN
cord-002369-shk4n8f6	214	12	from	from	IN
cord-002369-shk4n8f6	214	13	a	a	DT
cord-002369-shk4n8f6	214	14	previously	previously	RB
cord-002369-shk4n8f6	214	15	described	describe	VBN
cord-002369-shk4n8f6	214	16	protocol	protocol	NN
cord-002369-shk4n8f6	214	17	42	42	CD
cord-002369-shk4n8f6	214	18	.	.	.
cord-002369-shk4n8f6	215	1	Briefly	briefly	RB
cord-002369-shk4n8f6	215	2	,	,	,
cord-002369-shk4n8f6	215	3	7.5	7.5	CD
cord-002369-shk4n8f6	215	4	×	×	NN
cord-002369-shk4n8f6	215	5	10	10	CD
cord-002369-shk4n8f6	215	6	7	7	CD
cord-002369-shk4n8f6	215	7	Huh7-Lunet	Huh7-Lunet	NNP
cord-002369-shk4n8f6	215	8	cells	cell	NNS
cord-002369-shk4n8f6	215	9	harboring	harbor	VBG
cord-002369-shk4n8f6	215	10	either	either	CC
cord-002369-shk4n8f6	215	11	wild	wild	JJ
cord-002369-shk4n8f6	215	12	-	-	HYPH
cord-002369-shk4n8f6	215	13	type	type	NN
cord-002369-shk4n8f6	215	14	or	or	CC
cord-002369-shk4n8f6	215	15	HA	ha	NN
cord-002369-shk4n8f6	215	16	-	-	HYPH
cord-002369-shk4n8f6	215	17	tagged	tag	VBN
cord-002369-shk4n8f6	215	18	NS4B	NS4B	NNP
cord-002369-shk4n8f6	215	19	replicons	replicon	NNS
cord-002369-shk4n8f6	215	20	or	or	CC
cord-002369-shk4n8f6	215	21	control	control	NN
cord-002369-shk4n8f6	215	22	cells	cell	NNS
cord-002369-shk4n8f6	215	23	stably	stably	RB
cord-002369-shk4n8f6	215	24	overexpressing	overexpresse	VBG
cord-002369-shk4n8f6	215	25	CANX	CANX	NNP
cord-002369-shk4n8f6	215	26	HA	HA	NNP
cord-002369-shk4n8f6	215	27	were	be	VBD
cord-002369-shk4n8f6	215	28	washed	wash	VBN
cord-002369-shk4n8f6	215	29	,	,	,
cord-002369-shk4n8f6	215	30	scraped	scrape	VBN
cord-002369-shk4n8f6	215	31	and	and	CC
cord-002369-shk4n8f6	215	32	then	then	RB
cord-002369-shk4n8f6	215	33	resuspended	resuspend	VBD
cord-002369-shk4n8f6	215	34	in	in	IN
cord-002369-shk4n8f6	215	35	500	500	CD
cord-002369-shk4n8f6	215	36	μ	μ	NN
cord-002369-shk4n8f6	215	37	l	l	NN
cord-002369-shk4n8f6	215	38	of	of	IN
cord-002369-shk4n8f6	215	39	hypotonic	hypotonic	JJ
cord-002369-shk4n8f6	215	40	buffer	buffer	NN
cord-002369-shk4n8f6	215	41	and	and	CC
cord-002369-shk4n8f6	215	42	incubated	incubate	VBN
cord-002369-shk4n8f6	215	43	on	on	IN
cord-002369-shk4n8f6	215	44	ice	ice	NN
cord-002369-shk4n8f6	215	45	for	for	IN
cord-002369-shk4n8f6	215	46	30	30	CD
cord-002369-shk4n8f6	215	47	min	min	NN
cord-002369-shk4n8f6	215	48	.	.	.
cord-002369-shk4n8f6	216	1	The	the	DT
cord-002369-shk4n8f6	216	2	cells	cell	NNS
cord-002369-shk4n8f6	216	3	were	be	VBD
cord-002369-shk4n8f6	216	4	lysed	lyse	VBN
cord-002369-shk4n8f6	216	5	with	with	IN
cord-002369-shk4n8f6	216	6	50	50	CD
cord-002369-shk4n8f6	216	7	strokes	stroke	NNS
cord-002369-shk4n8f6	216	8	with	with	IN
cord-002369-shk4n8f6	216	9	a	a	DT
cord-002369-shk4n8f6	216	10	Dounce	Dounce	NNP
cord-002369-shk4n8f6	216	11	homogenizer	homogenizer	NN
cord-002369-shk4n8f6	216	12	.	.	.
cord-002369-shk4n8f6	217	1	The	the	DT
cord-002369-shk4n8f6	217	2	lysates	lysate	NNS
cord-002369-shk4n8f6	217	3	were	be	VBD
cord-002369-shk4n8f6	217	4	centrifuged	centrifuge	VBN
cord-002369-shk4n8f6	217	5	at	at	IN
cord-002369-shk4n8f6	217	6	800×	800×	CD
cord-002369-shk4n8f6	217	7	g	g	NN
cord-002369-shk4n8f6	217	8	for	for	IN
cord-002369-shk4n8f6	217	9	10	10	CD
cord-002369-shk4n8f6	217	10	min	min	NN
cord-002369-shk4n8f6	217	11	at	at	IN
cord-002369-shk4n8f6	217	12	4	4	CD
cord-002369-shk4n8f6	217	13	°	°	NN
cord-002369-shk4n8f6	217	14	C	c	NN
cord-002369-shk4n8f6	217	15	.	.	.
cord-002369-shk4n8f6	218	1	Supernatants	supernatant	NNS
cord-002369-shk4n8f6	218	2	were	be	VBD
cord-002369-shk4n8f6	218	3	collected	collect	VBN
cord-002369-shk4n8f6	218	4	and	and	CC
cord-002369-shk4n8f6	218	5	layered	layer	VBN
cord-002369-shk4n8f6	218	6	on	on	IN
cord-002369-shk4n8f6	218	7	top	top	NN
cord-002369-shk4n8f6	218	8	of	of	IN
cord-002369-shk4n8f6	218	9	a	a	DT
cord-002369-shk4n8f6	218	10	discontinuous	discontinuous	JJ
cord-002369-shk4n8f6	218	11	sucrose	sucrose	NN
cord-002369-shk4n8f6	218	12	gradient	gradient	NN
cord-002369-shk4n8f6	218	13	(	(	-LRB-
cord-002369-shk4n8f6	218	14	70	70	CD
cord-002369-shk4n8f6	218	15	%	%	NN
cord-002369-shk4n8f6	218	16	to	to	TO
cord-002369-shk4n8f6	218	17	30	30	CD
cord-002369-shk4n8f6	218	18	%	%	NN
cord-002369-shk4n8f6	218	19	)	)	-RRB-
cord-002369-shk4n8f6	218	20	and	and	CC
cord-002369-shk4n8f6	218	21	centrifuged	centrifuge	VBN
cord-002369-shk4n8f6	218	22	at	at	IN
cord-002369-shk4n8f6	218	23	130,000×	130,000×	CD
cord-002369-shk4n8f6	218	24	g	g	NN
cord-002369-shk4n8f6	218	25	for	for	IN
cord-002369-shk4n8f6	218	26	4	4	CD
cord-002369-shk4n8f6	218	27	h	h	NN
cord-002369-shk4n8f6	218	28	at	at	IN
cord-002369-shk4n8f6	218	29	4	4	CD
cord-002369-shk4n8f6	218	30	°	°	NN
cord-002369-shk4n8f6	218	31	C	c	NN
cord-002369-shk4n8f6	218	32	using	use	VBG
cord-002369-shk4n8f6	218	33	an	an	DT
cord-002369-shk4n8f6	218	34	SW60i	sw60i	JJ
cord-002369-shk4n8f6	218	35	rotor	rotor	NN
cord-002369-shk4n8f6	218	36	(	(	-LRB-
cord-002369-shk4n8f6	218	37	Beckman	Beckman	NNP
cord-002369-shk4n8f6	218	38	Coulter	Coulter	NNP
cord-002369-shk4n8f6	218	39	)	)	-RRB-
cord-002369-shk4n8f6	218	40	.	.	.
cord-002369-shk4n8f6	219	1	Ten	ten	CD
cord-002369-shk4n8f6	219	2	fractions	fraction	NNS
cord-002369-shk4n8f6	219	3	were	be	VBD
cord-002369-shk4n8f6	219	4	collected	collect	VBN
cord-002369-shk4n8f6	219	5	from	from	IN
cord-002369-shk4n8f6	219	6	the	the	DT
cord-002369-shk4n8f6	219	7	bottom	bottom	NN
cord-002369-shk4n8f6	219	8	(	(	-LRB-
cord-002369-shk4n8f6	219	9	300	300	CD
cord-002369-shk4n8f6	219	10	μ	μ	NN
cord-002369-shk4n8f6	219	11	l	l	NN
cord-002369-shk4n8f6	219	12	each	each	DT
cord-002369-shk4n8f6	219	13	)	)	-RRB-
cord-002369-shk4n8f6	219	14	and	and	CC
cord-002369-shk4n8f6	219	15	analyzed	analyze	VBN
cord-002369-shk4n8f6	219	16	for	for	IN
cord-002369-shk4n8f6	219	17	protein	protein	NN
cord-002369-shk4n8f6	219	18	content	content	NN
cord-002369-shk4n8f6	219	19	.	.	.
cord-002369-shk4n8f6	220	1	For	for	IN
cord-002369-shk4n8f6	220	2	HA	HA	NNP
cord-002369-shk4n8f6	220	3	affinity	affinity	NN
cord-002369-shk4n8f6	220	4	capture	capture	NN
cord-002369-shk4n8f6	220	5	,	,	,
cord-002369-shk4n8f6	220	6	fractions	fraction	NNS
cord-002369-shk4n8f6	220	7	3	3	CD
cord-002369-shk4n8f6	220	8	to	to	TO
cord-002369-shk4n8f6	220	9	7	7	CD
cord-002369-shk4n8f6	220	10	were	be	VBD
cord-002369-shk4n8f6	220	11	pooled	pool	VBN
cord-002369-shk4n8f6	220	12	,	,	,
cord-002369-shk4n8f6	220	13	and	and	CC
cord-002369-shk4n8f6	220	14	then	then	RB
cord-002369-shk4n8f6	220	15	an	an	DT
cord-002369-shk4n8f6	220	16	equal	equal	JJ
cord-002369-shk4n8f6	220	17	amount	amount	NN
cord-002369-shk4n8f6	220	18	of	of	IN
cord-002369-shk4n8f6	220	19	protein	protein	NN
cord-002369-shk4n8f6	220	20	contained	contain	VBN
cord-002369-shk4n8f6	220	21	in	in	IN
cord-002369-shk4n8f6	220	22	pooled	pool	VBN
cord-002369-shk4n8f6	220	23	fractions	fraction	NNS
cord-002369-shk4n8f6	220	24	was	be	VBD
cord-002369-shk4n8f6	220	25	equilibrated	equilibrate	VBN
cord-002369-shk4n8f6	220	26	to	to	IN
cord-002369-shk4n8f6	220	27	150	150	CD
cord-002369-shk4n8f6	220	28	mM	mm	CD
cord-002369-shk4n8f6	220	29	NaCl	nacl	NN
cord-002369-shk4n8f6	220	30	.	.	.
cord-002369-shk4n8f6	221	1	Incubation	incubation	NN
cord-002369-shk4n8f6	221	2	with	with	IN
cord-002369-shk4n8f6	221	3	HA	HA	NNP
cord-002369-shk4n8f6	221	4	-	-	HYPH
cord-002369-shk4n8f6	221	5	agarose	agarose	VBN
cord-002369-shk4n8f6	221	6	beads	bead	NNS
cord-002369-shk4n8f6	221	7	(	(	-LRB-
cord-002369-shk4n8f6	221	8	Sigma	Sigma	NNP
cord-002369-shk4n8f6	221	9	-	-	HYPH
cord-002369-shk4n8f6	221	10	Aldrich	Aldrich	NNP
cord-002369-shk4n8f6	221	11	)	)	-RRB-
cord-002369-shk4n8f6	221	12	was	be	VBD
cord-002369-shk4n8f6	221	13	performed	perform	VBN
cord-002369-shk4n8f6	221	14	as	as	IN
cord-002369-shk4n8f6	221	15	previously	previously	RB
cord-002369-shk4n8f6	221	16	described	describe	VBN
cord-002369-shk4n8f6	221	17	42	42	CD
cord-002369-shk4n8f6	221	18	.	.	.
cord-002369-shk4n8f6	222	1	Membrane	membrane	NN
cord-002369-shk4n8f6	222	2	visualization	visualization	NN
cord-002369-shk4n8f6	222	3	by	by	IN
cord-002369-shk4n8f6	222	4	transmission	transmission	NN
cord-002369-shk4n8f6	222	5	electron	electron	NN
cord-002369-shk4n8f6	222	6	microscopy	microscopy	NN
cord-002369-shk4n8f6	222	7	.	.	.
cord-002369-shk4n8f6	223	1	To	to	TO
cord-002369-shk4n8f6	223	2	examine	examine	VB
cord-002369-shk4n8f6	223	3	purified	purify	VBN
cord-002369-shk4n8f6	223	4	membranes	membrane	NNS
cord-002369-shk4n8f6	223	5	,	,	,
cord-002369-shk4n8f6	223	6	50	50	CD
cord-002369-shk4n8f6	223	7	μ	μ	NN
cord-002369-shk4n8f6	223	8	l	l	NN
cord-002369-shk4n8f6	223	9	of	of	IN
cord-002369-shk4n8f6	223	10	eluted	eluted	NNP
cord-002369-shk4n8f6	223	11	material	material	NN
cord-002369-shk4n8f6	223	12	was	be	VBD
cord-002369-shk4n8f6	223	13	centrifuged	centrifuge	VBN
cord-002369-shk4n8f6	223	14	at	at	IN
cord-002369-shk4n8f6	223	15	10	10	CD
cord-002369-shk4n8f6	223	16	p.s.i	p.s.i	NN
cord-002369-shk4n8f6	223	17	.	.	.
cord-002369-shk4n8f6	223	18	on	on	IN
cord-002369-shk4n8f6	223	19	a	a	DT
cord-002369-shk4n8f6	223	20	copper	copper	NN
cord-002369-shk4n8f6	223	21	grid	grid	NN
cord-002369-shk4n8f6	223	22	for	for	IN
cord-002369-shk4n8f6	223	23	5	5	CD
cord-002369-shk4n8f6	223	24	min	min	NN
cord-002369-shk4n8f6	223	25	at	at	IN
cord-002369-shk4n8f6	223	26	RT	RT	NNP
cord-002369-shk4n8f6	223	27	in	in	IN
cord-002369-shk4n8f6	223	28	an	an	DT
cord-002369-shk4n8f6	223	29	Airfuge	Airfuge	NNP
cord-002369-shk4n8f6	223	30	(	(	-LRB-
cord-002369-shk4n8f6	223	31	Beckman	Beckman	NNP
cord-002369-shk4n8f6	223	32	)	)	-RRB-
cord-002369-shk4n8f6	223	33	.	.	.
cord-002369-shk4n8f6	224	1	Structures	structure	NNS
cord-002369-shk4n8f6	224	2	were	be	VBD
cord-002369-shk4n8f6	224	3	negatively	negatively	RB
cord-002369-shk4n8f6	224	4	stained	stain	VBN
cord-002369-shk4n8f6	224	5	using	use	VBG
cord-002369-shk4n8f6	224	6	2	2	CD
cord-002369-shk4n8f6	224	7	%	%	NN
cord-002369-shk4n8f6	224	8	aqueous	aqueous	JJ
cord-002369-shk4n8f6	224	9	uranyl	uranyl	NN
cord-002369-shk4n8f6	224	10	acetate	acetate	NN
cord-002369-shk4n8f6	224	11	for	for	IN
cord-002369-shk4n8f6	224	12	30	30	CD
cord-002369-shk4n8f6	224	13	sec	sec	NNS
cord-002369-shk4n8f6	224	14	and	and	CC
cord-002369-shk4n8f6	224	15	examined	examine	VBD
cord-002369-shk4n8f6	224	16	with	with	IN
cord-002369-shk4n8f6	224	17	an	an	DT
cord-002369-shk4n8f6	224	18	H-7100	H-7100	NNS
cord-002369-shk4n8f6	224	19	(	(	-LRB-
cord-002369-shk4n8f6	224	20	Hitachi	Hitachi	NNP
cord-002369-shk4n8f6	224	21	)	)	-RRB-
cord-002369-shk4n8f6	224	22	transmission	transmission	NN
cord-002369-shk4n8f6	224	23	electron	electron	NN
cord-002369-shk4n8f6	224	24	microscope	microscope	NN
cord-002369-shk4n8f6	224	25	.	.	.
cord-002369-shk4n8f6	225	1	Quantification	quantification	NN
cord-002369-shk4n8f6	225	2	of	of	IN
cord-002369-shk4n8f6	225	3	HCV	HCV	NNP
cord-002369-shk4n8f6	225	4	RNA	RNA	NNP
cord-002369-shk4n8f6	225	5	by	by	IN
cord-002369-shk4n8f6	225	6	RT	RT	NNP
cord-002369-shk4n8f6	225	7	-	-	HYPH
cord-002369-shk4n8f6	225	8	qPCR	qPCR	NNP
cord-002369-shk4n8f6	225	9	.	.	.
cord-002369-shk4n8f6	226	1	Isolated	Isolated	NNP
cord-002369-shk4n8f6	226	2	RNA	RNA	NNP
cord-002369-shk4n8f6	226	3	was	be	VBD
cord-002369-shk4n8f6	226	4	reverse	reverse	NN
cord-002369-shk4n8f6	226	5	transcribed	transcribe	VBN
cord-002369-shk4n8f6	226	6	with	with	IN
cord-002369-shk4n8f6	226	7	M	M	NNP
cord-002369-shk4n8f6	226	8	-	-	HYPH
cord-002369-shk4n8f6	226	9	MLV	MLV	NNP
cord-002369-shk4n8f6	226	10	(	(	-LRB-
cord-002369-shk4n8f6	226	11	Invitrogen	Invitrogen	NNP
cord-002369-shk4n8f6	226	12	)	)	-RRB-
cord-002369-shk4n8f6	226	13	.	.	.
cord-002369-shk4n8f6	227	1	The	the	DT
cord-002369-shk4n8f6	227	2	generated	generate	VBN
cord-002369-shk4n8f6	227	3	cDNA	cdna	NN
cord-002369-shk4n8f6	227	4	was	be	VBD
cord-002369-shk4n8f6	227	5	used	use	VBN
cord-002369-shk4n8f6	227	6	for	for	IN
cord-002369-shk4n8f6	227	7	qPCR	qpcr	FW
cord-002369-shk4n8f6	227	8	using	use	VBG
cord-002369-shk4n8f6	227	9	Taqman	Taqman	NNP
cord-002369-shk4n8f6	227	10	probes	probe	NNS
cord-002369-shk4n8f6	227	11	,	,	,
cord-002369-shk4n8f6	227	12	as	as	IN
cord-002369-shk4n8f6	227	13	previously	previously	RB
cord-002369-shk4n8f6	227	14	described	describe	VBN
cord-002369-shk4n8f6	227	15	50	50	CD
cord-002369-shk4n8f6	227	16	.	.	.
cord-002369-shk4n8f6	228	1	Results	result	NNS
cord-002369-shk4n8f6	228	2	were	be	VBD
cord-002369-shk4n8f6	228	3	analyzed	analyze	VBN
cord-002369-shk4n8f6	228	4	using	use	VBG
cord-002369-shk4n8f6	228	5	the	the	DT
cord-002369-shk4n8f6	228	6	comparative	comparative	JJ
cord-002369-shk4n8f6	228	7	Δ	Δ	NNP
cord-002369-shk4n8f6	228	8	Ct	Ct	NNP
cord-002369-shk4n8f6	228	9	method	method	NN
cord-002369-shk4n8f6	228	10	.	.	.
cord-002369-shk4n8f6	229	1	Small	small	JJ
cord-002369-shk4n8f6	229	2	interfering	interfere	VBG
cord-002369-shk4n8f6	229	3	RNA	RNA	NNP
cord-002369-shk4n8f6	229	4	(	(	-LRB-
cord-002369-shk4n8f6	229	5	siRNA	siRNA	NNP
cord-002369-shk4n8f6	229	6	)	)	-RRB-
cord-002369-shk4n8f6	229	7	transfection	transfection	NN
cord-002369-shk4n8f6	229	8	.	.	.
cord-002369-shk4n8f6	230	1	Huh7	huh7	NN
cord-002369-shk4n8f6	230	2	cells	cell	NNS
cord-002369-shk4n8f6	230	3	were	be	VBD
cord-002369-shk4n8f6	230	4	reverse	reverse	JJ
cord-002369-shk4n8f6	230	5	transfected	transfecte	VBN
cord-002369-shk4n8f6	230	6	in	in	IN
cord-002369-shk4n8f6	230	7	a	a	DT
cord-002369-shk4n8f6	230	8	24-well	24-well	CD
cord-002369-shk4n8f6	230	9	plate	plate	NN
cord-002369-shk4n8f6	230	10	with	with	IN
cord-002369-shk4n8f6	230	11	siRNA	siRNA	NNP
cord-002369-shk4n8f6	230	12	(	(	-LRB-
cord-002369-shk4n8f6	230	13	25	25	CD
cord-002369-shk4n8f6	230	14	nM	nm	CD
cord-002369-shk4n8f6	230	15	final	final	JJ
cord-002369-shk4n8f6	230	16	concentration	concentration	NN
cord-002369-shk4n8f6	230	17	)	)	-RRB-
cord-002369-shk4n8f6	230	18	using	use	VBG
cord-002369-shk4n8f6	230	19	Lipofectamine	Lipofectamine	NNP
cord-002369-shk4n8f6	230	20	RNAiMAX	rnaimax	NN
cord-002369-shk4n8f6	230	21	reagent	reagent	NN
cord-002369-shk4n8f6	230	22	(	(	-LRB-
cord-002369-shk4n8f6	230	23	Life	Life	NNP
cord-002369-shk4n8f6	230	24	Technologies	Technologies	NNPS
cord-002369-shk4n8f6	230	25	)	)	-RRB-
cord-002369-shk4n8f6	230	26	according	accord	VBG
cord-002369-shk4n8f6	230	27	to	to	IN
cord-002369-shk4n8f6	230	28	the	the	DT
cord-002369-shk4n8f6	230	29	manufacturer	manufacturer	NN
cord-002369-shk4n8f6	230	30	's	's	POS
cord-002369-shk4n8f6	230	31	protocol	protocol	NN
cord-002369-shk4n8f6	230	32	.	.	.
cord-002369-shk4n8f6	231	1	Huh7	huh7	NN
cord-002369-shk4n8f6	231	2	cells	cell	NNS
cord-002369-shk4n8f6	231	3	were	be	VBD
cord-002369-shk4n8f6	231	4	transfected	transfecte	VBN
cord-002369-shk4n8f6	231	5	with	with	IN
cord-002369-shk4n8f6	231	6	siRNA	siRNA	NNP
cord-002369-shk4n8f6	231	7	to	to	IN
cord-002369-shk4n8f6	231	8	GFP	GFP	NNP
cord-002369-shk4n8f6	231	9	,	,	,
cord-002369-shk4n8f6	231	10	LC3B	LC3B	NNP
cord-002369-shk4n8f6	231	11	siRNA	siRNA	NNP
cord-002369-shk4n8f6	231	12	(	(	-LRB-
cord-002369-shk4n8f6	231	13	UACCUGUAUACGUUAGUGAAAUU	UACCUGUAUACGUUAGUGAAAUU	NNP
cord-002369-shk4n8f6	231	14	)	)	-RRB-
cord-002369-shk4n8f6	231	15	or	or	CC
cord-002369-shk4n8f6	231	16	with	with	IN
cord-002369-shk4n8f6	231	17	an	an	DT
cord-002369-shk4n8f6	231	18	ON	ON	NNP
cord-002369-shk4n8f6	231	19	-	-	HYPH
cord-002369-shk4n8f6	231	20	TARGETplus	targetplus	NN
cord-002369-shk4n8f6	231	21	human	human	NN
cord-002369-shk4n8f6	231	22	ATG7	ATG7	NNP
cord-002369-shk4n8f6	231	23	siRNA	siRNA	NNP
cord-002369-shk4n8f6	231	24	-	-	HYPH
cord-002369-shk4n8f6	231	25	SMART	smart	JJ
cord-002369-shk4n8f6	231	26	pool	pool	NN
cord-002369-shk4n8f6	231	27	(	(	-LRB-
cord-002369-shk4n8f6	231	28	catalog	catalog	NN
cord-002369-shk4n8f6	231	29	no	no	UH
cord-002369-shk4n8f6	231	30	.	.	.
cord-002369-shk4n8f6	232	1	L-020112	L-020112	NNP
cord-002369-shk4n8f6	232	2	-	-	HYPH
cord-002369-shk4n8f6	232	3	00	00	CD
cord-002369-shk4n8f6	232	4	-	-	HYPH
cord-002369-shk4n8f6	232	5	0005	0005	CD
cord-002369-shk4n8f6	232	6	)	)	-RRB-
cord-002369-shk4n8f6	232	7	.	.	.
cord-002369-shk4n8f6	233	1	To	to	TO
cord-002369-shk4n8f6	233	2	study	study	VB
cord-002369-shk4n8f6	233	3	the	the	DT
cord-002369-shk4n8f6	233	4	onset	onset	NN
cord-002369-shk4n8f6	233	5	of	of	IN
cord-002369-shk4n8f6	233	6	replication	replication	NN
cord-002369-shk4n8f6	233	7	,	,	,
cord-002369-shk4n8f6	233	8	Huh7.5	huh7.5	NN
cord-002369-shk4n8f6	233	9	cells	cell	NNS
cord-002369-shk4n8f6	233	10	were	be	VBD
cord-002369-shk4n8f6	233	11	reverse	reverse	JJ
cord-002369-shk4n8f6	233	12	transfected	transfecte	VBN
cord-002369-shk4n8f6	233	13	with	with	IN
cord-002369-shk4n8f6	233	14	siRNA	siRNA	NNP
cord-002369-shk4n8f6	233	15	,	,	,
cord-002369-shk4n8f6	233	16	as	as	IN
cord-002369-shk4n8f6	233	17	described	describe	VBN
cord-002369-shk4n8f6	233	18	above	above	RB
cord-002369-shk4n8f6	233	19	,	,	,
cord-002369-shk4n8f6	233	20	in	in	IN
cord-002369-shk4n8f6	233	21	6-well	6-well	CD
cord-002369-shk4n8f6	233	22	plates	plate	NNS
cord-002369-shk4n8f6	233	23	.	.	.
cord-002369-shk4n8f6	234	1	Forty	forty	CD
cord-002369-shk4n8f6	234	2	-	-	HYPH
cord-002369-shk4n8f6	234	3	eight	eight	CD
cord-002369-shk4n8f6	234	4	hours	hour	NNS
cord-002369-shk4n8f6	234	5	later	later	RB
cord-002369-shk4n8f6	234	6	,	,	,
cord-002369-shk4n8f6	234	7	the	the	DT
cord-002369-shk4n8f6	234	8	cells	cell	NNS
cord-002369-shk4n8f6	234	9	were	be	VBD
cord-002369-shk4n8f6	234	10	trypsinized	trypsinize	VBN
cord-002369-shk4n8f6	234	11	,	,	,
cord-002369-shk4n8f6	234	12	washed	wash	VBN
cord-002369-shk4n8f6	234	13	twice	twice	RB
cord-002369-shk4n8f6	234	14	with	with	IN
cord-002369-shk4n8f6	234	15	cold	cold	JJ
cord-002369-shk4n8f6	234	16	PBS	PBS	NNP
cord-002369-shk4n8f6	234	17	,	,	,
cord-002369-shk4n8f6	234	18	resuspended	resuspend	VBD
cord-002369-shk4n8f6	234	19	in	in	IN
cord-002369-shk4n8f6	234	20	100	100	CD
cord-002369-shk4n8f6	234	21	μ	μ	NN
cord-002369-shk4n8f6	234	22	l	l	NN
cord-002369-shk4n8f6	234	23	of	of	IN
cord-002369-shk4n8f6	234	24	cold	cold	JJ
cord-002369-shk4n8f6	234	25	Ingenio	Ingenio	NNP
cord-002369-shk4n8f6	234	26	electroporation	electroporation	NN
cord-002369-shk4n8f6	234	27	solution	solution	NN
cord-002369-shk4n8f6	234	28	(	(	-LRB-
cord-002369-shk4n8f6	234	29	Mirus	Mirus	NNP
cord-002369-shk4n8f6	234	30	)	)	-RRB-
cord-002369-shk4n8f6	234	31	and	and	CC
cord-002369-shk4n8f6	234	32	then	then	RB
cord-002369-shk4n8f6	234	33	electroporated	electroporate	VBD
cord-002369-shk4n8f6	234	34	with	with	IN
cord-002369-shk4n8f6	234	35	5	5	CD
cord-002369-shk4n8f6	234	36	μg	μg	NNS
cord-002369-shk4n8f6	234	37	of	of	IN
cord-002369-shk4n8f6	234	38	in	in	FW
cord-002369-shk4n8f6	234	39	vitro	vitro	FW
cord-002369-shk4n8f6	234	40	-	-	HYPH
cord-002369-shk4n8f6	234	41	transcribed	transcribe	VBN
cord-002369-shk4n8f6	234	42	viral	viral	JJ
cord-002369-shk4n8f6	234	43	RNA	RNA	NNP
cord-002369-shk4n8f6	234	44	(	(	-LRB-
cord-002369-shk4n8f6	234	45	JFH1	JFH1	NNP
cord-002369-shk4n8f6	234	46	/	/	SYM
cord-002369-shk4n8f6	234	47	Fluc	Fluc	NNP
cord-002369-shk4n8f6	234	48	or	or	CC
cord-002369-shk4n8f6	234	49	JFH1	JFH1	NNP
cord-002369-shk4n8f6	234	50	/	/	SYM
cord-002369-shk4n8f6	234	51	Fluc	Fluc	NNP
cord-002369-shk4n8f6	234	52	-	-	HYPH
cord-002369-shk4n8f6	234	53	GND	GND	NNP
cord-002369-shk4n8f6	234	54	)	)	-RRB-
cord-002369-shk4n8f6	235	1	in	in	IN
cord-002369-shk4n8f6	235	2	2	2	CD
cord-002369-shk4n8f6	235	3	mm	mm	NN
cord-002369-shk4n8f6	235	4	gap	gap	NN
cord-002369-shk4n8f6	235	5	electroporation	electroporation	NN
cord-002369-shk4n8f6	235	6	cuvettes	cuvette	NNS
cord-002369-shk4n8f6	235	7	by	by	IN
cord-002369-shk4n8f6	235	8	using	use	VBG
cord-002369-shk4n8f6	235	9	a	a	DT
cord-002369-shk4n8f6	235	10	BTX	BTX	NNP
cord-002369-shk4n8f6	235	11	Harvard	Harvard	NNP
cord-002369-shk4n8f6	235	12	Apparatus	Apparatus	NNP
cord-002369-shk4n8f6	235	13	with	with	IN
cord-002369-shk4n8f6	235	14	the	the	DT
cord-002369-shk4n8f6	235	15	following	follow	VBG
cord-002369-shk4n8f6	235	16	settings	setting	NNS
cord-002369-shk4n8f6	235	17	:	:	:
cord-002369-shk4n8f6	235	18	820	820	CD
cord-002369-shk4n8f6	235	19	V	v	NN
cord-002369-shk4n8f6	235	20	,	,	,
cord-002369-shk4n8f6	235	21	99	99	CD
cord-002369-shk4n8f6	235	22	μ	μ	NN
cord-002369-shk4n8f6	235	23	S	S	NNP
cord-002369-shk4n8f6	235	24	,	,	,
cord-002369-shk4n8f6	235	25	4	4	CD
cord-002369-shk4n8f6	235	26	pulses	pulse	NNS
cord-002369-shk4n8f6	235	27	,	,	,
cord-002369-shk4n8f6	235	28	1.1	1.1	CD
cord-002369-shk4n8f6	235	29	s	s	POS
cord-002369-shk4n8f6	235	30	interval	interval	NN
cord-002369-shk4n8f6	235	31	.	.	.
cord-002369-shk4n8f6	236	1	The	the	DT
cord-002369-shk4n8f6	236	2	cells	cell	NNS
cord-002369-shk4n8f6	236	3	were	be	VBD
cord-002369-shk4n8f6	236	4	then	then	RB
cord-002369-shk4n8f6	236	5	resuspended	resuspend	VBN
cord-002369-shk4n8f6	236	6	in	in	IN
cord-002369-shk4n8f6	236	7	DMEM-10	DMEM-10	NNP
cord-002369-shk4n8f6	236	8	%	%	NN
cord-002369-shk4n8f6	236	9	FBS	FBS	NNP
cord-002369-shk4n8f6	236	10	and	and	CC
cord-002369-shk4n8f6	236	11	seeded	seed	VBN
cord-002369-shk4n8f6	236	12	in	in	IN
cord-002369-shk4n8f6	236	13	96-well	96-well	CD
cord-002369-shk4n8f6	236	14	plates	plate	NNS
cord-002369-shk4n8f6	236	15	and	and	CC
cord-002369-shk4n8f6	236	16	further	further	RB
cord-002369-shk4n8f6	236	17	cultured	cultured	JJ
cord-002369-shk4n8f6	236	18	for	for	IN
cord-002369-shk4n8f6	236	19	24	24	CD
cord-002369-shk4n8f6	236	20	h.	h.	NN
cord-002369-shk4n8f6	237	1	The	the	DT
cord-002369-shk4n8f6	237	2	cells	cell	NNS
cord-002369-shk4n8f6	237	3	were	be	VBD
cord-002369-shk4n8f6	237	4	then	then	RB
cord-002369-shk4n8f6	237	5	lysed	lyse	VBN
cord-002369-shk4n8f6	237	6	in	in	IN
cord-002369-shk4n8f6	237	7	20	20	CD
cord-002369-shk4n8f6	237	8	μ	μ	NN
cord-002369-shk4n8f6	237	9	l	l	NN
cord-002369-shk4n8f6	237	10	luciferase	luciferase	NN
cord-002369-shk4n8f6	237	11	lysis	lysis	NN
cord-002369-shk4n8f6	237	12	buffer	buffer	NN
cord-002369-shk4n8f6	237	13	(	(	-LRB-
cord-002369-shk4n8f6	237	14	RLB	RLB	NNP
cord-002369-shk4n8f6	237	15	)	)	-RRB-
cord-002369-shk4n8f6	237	16	and	and	CC
cord-002369-shk4n8f6	237	17	stored	store	VBN
cord-002369-shk4n8f6	237	18	at	at	IN
cord-002369-shk4n8f6	237	19	−	−	CD
cord-002369-shk4n8f6	237	20	80	80	CD
cord-002369-shk4n8f6	237	21	°	°	NN
cord-002369-shk4n8f6	237	22	C	c	NN
cord-002369-shk4n8f6	237	23	until	until	IN
cord-002369-shk4n8f6	237	24	measurement	measurement	NN
cord-002369-shk4n8f6	237	25	of	of	IN
cord-002369-shk4n8f6	237	26	luciferase	luciferase	JJ
cord-002369-shk4n8f6	237	27	activity	activity	NN
cord-002369-shk4n8f6	237	28	.	.	.
cord-002369-shk4n8f6	238	1	For	for	IN
cord-002369-shk4n8f6	238	2	the	the	DT
cord-002369-shk4n8f6	238	3	determination	determination	NN
cord-002369-shk4n8f6	238	4	of	of	IN
cord-002369-shk4n8f6	238	5	intra	intra	NNP
cord-002369-shk4n8f6	238	6	-	-	JJ
cord-002369-shk4n8f6	238	7	and	and	CC
cord-002369-shk4n8f6	238	8	extracellular	extracellular	JJ
cord-002369-shk4n8f6	238	9	virus	virus	NN
cord-002369-shk4n8f6	238	10	titers	titer	NNS
cord-002369-shk4n8f6	238	11	,	,	,
cord-002369-shk4n8f6	238	12	JFH1-infected	JFH1-infected	NNP
cord-002369-shk4n8f6	238	13	Huh7	Huh7	NNP
cord-002369-shk4n8f6	238	14	cells	cell	NNS
cord-002369-shk4n8f6	238	15	were	be	VBD
cord-002369-shk4n8f6	238	16	reverse	reverse	JJ
cord-002369-shk4n8f6	238	17	transfected	transfecte	VBN
cord-002369-shk4n8f6	238	18	with	with	IN
cord-002369-shk4n8f6	238	19	siRNA	siRNA	NNP
cord-002369-shk4n8f6	238	20	in	in	IN
cord-002369-shk4n8f6	238	21	6-well	6-well	CD
cord-002369-shk4n8f6	238	22	plates	plate	NNS
cord-002369-shk4n8f6	238	23	.	.	.
cord-002369-shk4n8f6	239	1	Two	two	CD
cord-002369-shk4n8f6	239	2	days	day	NNS
cord-002369-shk4n8f6	239	3	later	later	RB
cord-002369-shk4n8f6	239	4	,	,	,
cord-002369-shk4n8f6	239	5	the	the	DT
cord-002369-shk4n8f6	239	6	cells	cell	NNS
cord-002369-shk4n8f6	239	7	were	be	VBD
cord-002369-shk4n8f6	239	8	washed	wash	VBN
cord-002369-shk4n8f6	239	9	three	three	CD
cord-002369-shk4n8f6	239	10	times	time	NNS
cord-002369-shk4n8f6	239	11	with	with	IN
cord-002369-shk4n8f6	239	12	PBS	PBS	NNP
cord-002369-shk4n8f6	239	13	and	and	CC
cord-002369-shk4n8f6	239	14	supplemented	supplement	VBN
cord-002369-shk4n8f6	239	15	with	with	IN
cord-002369-shk4n8f6	239	16	fresh	fresh	JJ
cord-002369-shk4n8f6	239	17	DMEM	DMEM	NNP
cord-002369-shk4n8f6	239	18	.	.	.
cord-002369-shk4n8f6	240	1	After	after	IN
cord-002369-shk4n8f6	240	2	24	24	CD
cord-002369-shk4n8f6	240	3	h	h	NN
cord-002369-shk4n8f6	240	4	,	,	,
cord-002369-shk4n8f6	240	5	cells	cell	NNS
cord-002369-shk4n8f6	240	6	and	and	CC
cord-002369-shk4n8f6	240	7	supernatants	supernatant	NNS
cord-002369-shk4n8f6	240	8	were	be	VBD
cord-002369-shk4n8f6	240	9	harvested	harvest	VBN
cord-002369-shk4n8f6	240	10	.	.	.
cord-002369-shk4n8f6	241	1	The	the	DT
cord-002369-shk4n8f6	241	2	cells	cell	NNS
cord-002369-shk4n8f6	241	3	were	be	VBD
cord-002369-shk4n8f6	241	4	washed	wash	VBN
cord-002369-shk4n8f6	241	5	twice	twice	RB
cord-002369-shk4n8f6	241	6	with	with	IN
cord-002369-shk4n8f6	241	7	PBS	PBS	NNP
cord-002369-shk4n8f6	241	8	,	,	,
cord-002369-shk4n8f6	241	9	trypsinized	trypsinize	VBN
cord-002369-shk4n8f6	241	10	,	,	,
cord-002369-shk4n8f6	241	11	resuspended	resuspend	VBD
cord-002369-shk4n8f6	241	12	in	in	IN
cord-002369-shk4n8f6	241	13	1	1	CD
cord-002369-shk4n8f6	241	14	ml	ml	NN
cord-002369-shk4n8f6	241	15	culture	culture	NN
cord-002369-shk4n8f6	241	16	medium	medium	NN
cord-002369-shk4n8f6	241	17	and	and	CC
cord-002369-shk4n8f6	241	18	subjected	subject	VBN
cord-002369-shk4n8f6	241	19	to	to	IN
cord-002369-shk4n8f6	241	20	3	3	CD
cord-002369-shk4n8f6	241	21	rapid	rapid	JJ
cord-002369-shk4n8f6	241	22	freeze	freeze	NN
cord-002369-shk4n8f6	241	23	-	-	HYPH
cord-002369-shk4n8f6	241	24	thaw	thaw	VB
cord-002369-shk4n8f6	241	25	cycles	cycle	NNS
cord-002369-shk4n8f6	241	26	in	in	IN
cord-002369-shk4n8f6	241	27	a	a	DT
cord-002369-shk4n8f6	241	28	dry	dry	JJ
cord-002369-shk4n8f6	241	29	ice	ice	NN
cord-002369-shk4n8f6	241	30	/	/	SYM
cord-002369-shk4n8f6	241	31	ethanol	ethanol	NN
cord-002369-shk4n8f6	241	32	bath	bath	NN
cord-002369-shk4n8f6	241	33	and	and	CC
cord-002369-shk4n8f6	241	34	37	37	CD
cord-002369-shk4n8f6	241	35	°	°	NN
cord-002369-shk4n8f6	241	36	C	c	NN
cord-002369-shk4n8f6	241	37	water	water	NN
cord-002369-shk4n8f6	241	38	bath	bath	NN
cord-002369-shk4n8f6	241	39	,	,	,
cord-002369-shk4n8f6	241	40	respectively	respectively	RB
cord-002369-shk4n8f6	241	41	.	.	.
cord-002369-shk4n8f6	242	1	Cell	cell	NN
cord-002369-shk4n8f6	242	2	debris	debris	NN
cord-002369-shk4n8f6	242	3	was	be	VBD
cord-002369-shk4n8f6	242	4	removed	remove	VBN
cord-002369-shk4n8f6	242	5	by	by	IN
cord-002369-shk4n8f6	242	6	centrifugation	centrifugation	NN
cord-002369-shk4n8f6	242	7	at	at	IN
cord-002369-shk4n8f6	242	8	10,000	10,000	CD
cord-002369-shk4n8f6	242	9	rpm	rpm	NN
cord-002369-shk4n8f6	242	10	for	for	IN
cord-002369-shk4n8f6	242	11	3	3	CD
cord-002369-shk4n8f6	242	12	minutes	minute	NNS
cord-002369-shk4n8f6	242	13	.	.	.
cord-002369-shk4n8f6	243	1	Samples	sample	NNS
cord-002369-shk4n8f6	243	2	were	be	VBD
cord-002369-shk4n8f6	243	3	analyzed	analyze	VBN
cord-002369-shk4n8f6	243	4	using	use	VBG
cord-002369-shk4n8f6	243	5	a	a	DT
cord-002369-shk4n8f6	243	6	limiting	limit	VBG
cord-002369-shk4n8f6	243	7	dilution	dilution	NN
cord-002369-shk4n8f6	243	8	assay	assay	NN
cord-002369-shk4n8f6	243	9	.	.	.
cord-002369-shk4n8f6	244	1	Production	production	NN
cord-002369-shk4n8f6	244	2	of	of	IN
cord-002369-shk4n8f6	244	3	HCVpp	HCVpp	NNP
cord-002369-shk4n8f6	244	4	and	and	CC
cord-002369-shk4n8f6	244	5	cell	cell	NN
cord-002369-shk4n8f6	244	6	entry	entry	NN
cord-002369-shk4n8f6	244	7	assay	assay	NN
cord-002369-shk4n8f6	244	8	.	.	.
cord-002369-shk4n8f6	245	1	Viral	viral	JJ
cord-002369-shk4n8f6	245	2	pseudotyped	pseudotyped	NNS
cord-002369-shk4n8f6	245	3	particles	particle	NNS
cord-002369-shk4n8f6	245	4	harboring	harbor	VBG
cord-002369-shk4n8f6	245	5	the	the	DT
cord-002369-shk4n8f6	245	6	HCV	HCV	NNP
cord-002369-shk4n8f6	245	7	glycoproteins	glycoprotein	NNS
cord-002369-shk4n8f6	245	8	(	(	-LRB-
cord-002369-shk4n8f6	245	9	HCVpp	hcvpp	NN
cord-002369-shk4n8f6	245	10	)	)	-RRB-
cord-002369-shk4n8f6	245	11	were	be	VBD
cord-002369-shk4n8f6	245	12	produced	produce	VBN
cord-002369-shk4n8f6	245	13	by	by	IN
cord-002369-shk4n8f6	245	14	transfection	transfection	NN
cord-002369-shk4n8f6	245	15	in	in	IN
cord-002369-shk4n8f6	245	16	Hek-293	Hek-293	NNP
cord-002369-shk4n8f6	245	17	T	T	NNP
cord-002369-shk4n8f6	245	18	cells	cell	NNS
cord-002369-shk4n8f6	245	19	of	of	IN
cord-002369-shk4n8f6	245	20	vectors	vector	NNS
cord-002369-shk4n8f6	245	21	encoding	encode	VBG
cord-002369-shk4n8f6	245	22	viral	viral	JJ
cord-002369-shk4n8f6	245	23	glycoproteins	glycoprotein	NNS
cord-002369-shk4n8f6	245	24	,	,	,
cord-002369-shk4n8f6	245	25	packaging	packaging	NN
cord-002369-shk4n8f6	245	26	proteins	protein	NNS
cord-002369-shk4n8f6	245	27	and	and	CC
cord-002369-shk4n8f6	245	28	a	a	DT
cord-002369-shk4n8f6	245	29	Luciferase	Luciferase	NNP
cord-002369-shk4n8f6	245	30	marker	marker	NN
cord-002369-shk4n8f6	245	31	.	.	.
cord-002369-shk4n8f6	246	1	After	after	IN
cord-002369-shk4n8f6	246	2	48	48	CD
cord-002369-shk4n8f6	246	3	h	h	NN
cord-002369-shk4n8f6	246	4	,	,	,
cord-002369-shk4n8f6	246	5	viral	viral	JJ
cord-002369-shk4n8f6	246	6	pseudoparticle	pseudoparticle	NNP
cord-002369-shk4n8f6	246	7	supernatants	supernatant	NNS
cord-002369-shk4n8f6	246	8	were	be	VBD
cord-002369-shk4n8f6	246	9	harvested	harvest	VBN
cord-002369-shk4n8f6	246	10	and	and	CC
cord-002369-shk4n8f6	246	11	filtered	filter	VBN
cord-002369-shk4n8f6	246	12	through	through	IN
cord-002369-shk4n8f6	246	13	45-μ	45-μ	CD
cord-002369-shk4n8f6	246	14	M	M	NNP
cord-002369-shk4n8f6	246	15	filters	filter	NNS
cord-002369-shk4n8f6	246	16	to	to	TO
cord-002369-shk4n8f6	246	17	remove	remove	VB
cord-002369-shk4n8f6	246	18	the	the	DT
cord-002369-shk4n8f6	246	19	cell	cell	NN
cord-002369-shk4n8f6	246	20	debris	debris	NN
cord-002369-shk4n8f6	246	21	.	.	.
cord-002369-shk4n8f6	247	1	For	for	IN
cord-002369-shk4n8f6	247	2	the	the	DT
cord-002369-shk4n8f6	247	3	entry	entry	NN
cord-002369-shk4n8f6	247	4	assay	assay	NN
cord-002369-shk4n8f6	247	5	,	,	,
cord-002369-shk4n8f6	247	6	Huh7.5	huh7.5	NN
cord-002369-shk4n8f6	247	7	cells	cell	NNS
cord-002369-shk4n8f6	247	8	were	be	VBD
cord-002369-shk4n8f6	247	9	reverse	reverse	JJ
cord-002369-shk4n8f6	247	10	transfected	transfecte	VBN
cord-002369-shk4n8f6	247	11	with	with	IN
cord-002369-shk4n8f6	247	12	siRNA	siRNA	NNP
cord-002369-shk4n8f6	247	13	in	in	IN
cord-002369-shk4n8f6	247	14	96-well	96-well	CD
cord-002369-shk4n8f6	247	15	plates	plate	NNS
cord-002369-shk4n8f6	247	16	.	.	.
cord-002369-shk4n8f6	248	1	After	after	IN
cord-002369-shk4n8f6	248	2	48	48	CD
cord-002369-shk4n8f6	248	3	h	h	NN
cord-002369-shk4n8f6	248	4	,	,	,
cord-002369-shk4n8f6	248	5	the	the	DT
cord-002369-shk4n8f6	248	6	cells	cell	NNS
cord-002369-shk4n8f6	248	7	were	be	VBD
cord-002369-shk4n8f6	248	8	infected	infect	VBN
cord-002369-shk4n8f6	248	9	with	with	IN
cord-002369-shk4n8f6	248	10	50	50	CD
cord-002369-shk4n8f6	248	11	μ	μ	NN
cord-002369-shk4n8f6	248	12	l	l	NN
cord-002369-shk4n8f6	248	13	HCVpp	HCVpp	NNP
cord-002369-shk4n8f6	248	14	containing	contain	VBG
cord-002369-shk4n8f6	248	15	supernatant	supernatant	JJ
cord-002369-shk4n8f6	248	16	.	.	.
cord-002369-shk4n8f6	249	1	Forty	forty	CD
cord-002369-shk4n8f6	249	2	-	-	HYPH
cord-002369-shk4n8f6	249	3	eight	eight	CD
cord-002369-shk4n8f6	249	4	hours	hour	NNS
cord-002369-shk4n8f6	249	5	post	post	NN
cord-002369-shk4n8f6	249	6	-	-	NN
cord-002369-shk4n8f6	249	7	infection	infection	NN
cord-002369-shk4n8f6	249	8	,	,	,
cord-002369-shk4n8f6	249	9	the	the	DT
cord-002369-shk4n8f6	249	10	cells	cell	NNS
cord-002369-shk4n8f6	249	11	were	be	VBD
cord-002369-shk4n8f6	249	12	washed	wash	VBN
cord-002369-shk4n8f6	249	13	three	three	CD
cord-002369-shk4n8f6	249	14	times	time	NNS
cord-002369-shk4n8f6	249	15	with	with	IN
cord-002369-shk4n8f6	249	16	PBS	PBS	NNP
cord-002369-shk4n8f6	249	17	,	,	,
cord-002369-shk4n8f6	249	18	lysed	lyse	VBN
cord-002369-shk4n8f6	249	19	in	in	IN
cord-002369-shk4n8f6	249	20	20	20	CD
cord-002369-shk4n8f6	249	21	μ	μ	NN
cord-002369-shk4n8f6	249	22	l	l	NN
cord-002369-shk4n8f6	249	23	luciferase	luciferase	NN
cord-002369-shk4n8f6	249	24	lysis	lysis	NN
cord-002369-shk4n8f6	249	25	buffer	buffer	NN
cord-002369-shk4n8f6	249	26	(	(	-LRB-
cord-002369-shk4n8f6	249	27	RLB	RLB	NNP
cord-002369-shk4n8f6	249	28	)	)	-RRB-
cord-002369-shk4n8f6	249	29	and	and	CC
cord-002369-shk4n8f6	249	30	stored	store	VBN
cord-002369-shk4n8f6	249	31	at	at	IN
cord-002369-shk4n8f6	249	32	−	−	CD
cord-002369-shk4n8f6	249	33	80	80	CD
cord-002369-shk4n8f6	249	34	°	°	NN
cord-002369-shk4n8f6	249	35	C	c	NN
cord-002369-shk4n8f6	249	36	until	until	IN
cord-002369-shk4n8f6	249	37	measurement	measurement	NN
cord-002369-shk4n8f6	249	38	of	of	IN
cord-002369-shk4n8f6	249	39	luciferase	luciferase	JJ
cord-002369-shk4n8f6	249	40	activity	activity	NN
cord-002369-shk4n8f6	249	41	.	.	.
cord-002369-shk4n8f6	250	1	Luciferase	luciferase	NN
cord-002369-shk4n8f6	250	2	assay	assay	NN
cord-002369-shk4n8f6	250	3	.	.	.
cord-002369-shk4n8f6	251	1	Cell	cell	NN
cord-002369-shk4n8f6	251	2	lysates	lysate	NNS
cord-002369-shk4n8f6	251	3	were	be	VBD
cord-002369-shk4n8f6	251	4	prepared	prepare	VBN
cord-002369-shk4n8f6	251	5	with	with	IN
cord-002369-shk4n8f6	251	6	Reporter	reporter	NN
cord-002369-shk4n8f6	251	7	Lysis	lysis	NN
cord-002369-shk4n8f6	251	8	Buffer	buffer	NN
cord-002369-shk4n8f6	251	9	(	(	-LRB-
cord-002369-shk4n8f6	251	10	RLB	rlb	NN
cord-002369-shk4n8f6	251	11	)	)	-RRB-
cord-002369-shk4n8f6	251	12	(	(	-LRB-
cord-002369-shk4n8f6	251	13	Promega	Promega	NNP
cord-002369-shk4n8f6	251	14	)	)	-RRB-
cord-002369-shk4n8f6	251	15	,	,	,
cord-002369-shk4n8f6	251	16	and	and	CC
cord-002369-shk4n8f6	251	17	luciferase	luciferase	NN
cord-002369-shk4n8f6	251	18	activity	activity	NN
cord-002369-shk4n8f6	251	19	was	be	VBD
cord-002369-shk4n8f6	251	20	measured	measure	VBN
cord-002369-shk4n8f6	251	21	with	with	IN
cord-002369-shk4n8f6	251	22	a	a	DT
cord-002369-shk4n8f6	251	23	luciferase	luciferase	NN
cord-002369-shk4n8f6	251	24	assay	assay	NN
cord-002369-shk4n8f6	251	25	system	system	NN
cord-002369-shk4n8f6	251	26	(	(	-LRB-
cord-002369-shk4n8f6	251	27	Promega	Promega	NNP
cord-002369-shk4n8f6	251	28	)	)	-RRB-
cord-002369-shk4n8f6	251	29	,	,	,
cord-002369-shk4n8f6	251	30	per	per	IN
cord-002369-shk4n8f6	251	31	the	the	DT
cord-002369-shk4n8f6	251	32	manufacturer	manufacturer	NN
cord-002369-shk4n8f6	251	33	's	's	POS
cord-002369-shk4n8f6	251	34	protocol	protocol	NN
cord-002369-shk4n8f6	251	35	.	.	.
cord-002369-shk4n8f6	252	1	For	for	IN
cord-002369-shk4n8f6	252	2	the	the	DT
cord-002369-shk4n8f6	252	3	immunofluorescence	immunofluorescence	NN
cord-002369-shk4n8f6	252	4	experiment	experiment	NN
cord-002369-shk4n8f6	252	5	,	,	,
cord-002369-shk4n8f6	252	6	Huh7-Lunet	Huh7-Lunet	NNP
cord-002369-shk4n8f6	252	7	-	-	HYPH
cord-002369-shk4n8f6	252	8	T7	t7	NN
cord-002369-shk4n8f6	252	9	cells	cell	NNS
cord-002369-shk4n8f6	252	10	were	be	VBD
cord-002369-shk4n8f6	252	11	reverse	reverse	RB
cord-002369-shk4n8f6	252	12	transfected	transfecte	VBN
cord-002369-shk4n8f6	252	13	with	with	IN
cord-002369-shk4n8f6	252	14	siRNA	siRNA	NNP
cord-002369-shk4n8f6	252	15	as	as	IN
cord-002369-shk4n8f6	252	16	previously	previously	RB
cord-002369-shk4n8f6	252	17	described	describe	VBN
cord-002369-shk4n8f6	252	18	43	43	CD
cord-002369-shk4n8f6	252	19	.	.	.
cord-002369-shk4n8f6	253	1	Forty	forty	CD
cord-002369-shk4n8f6	253	2	-	-	HYPH
cord-002369-shk4n8f6	253	3	eight	eight	CD
cord-002369-shk4n8f6	253	4	hours	hour	NNS
cord-002369-shk4n8f6	253	5	later	later	RB
cord-002369-shk4n8f6	253	6	,	,	,
cord-002369-shk4n8f6	253	7	a	a	DT
cord-002369-shk4n8f6	253	8	second	second	JJ
cord-002369-shk4n8f6	253	9	round	round	NN
cord-002369-shk4n8f6	253	10	of	of	IN
cord-002369-shk4n8f6	253	11	transfection	transfection	NN
cord-002369-shk4n8f6	253	12	with	with	IN
cord-002369-shk4n8f6	253	13	siRNA	siRNA	NNP
cord-002369-shk4n8f6	253	14	was	be	VBD
cord-002369-shk4n8f6	253	15	performed	perform	VBN
cord-002369-shk4n8f6	253	16	.	.	.
cord-002369-shk4n8f6	254	1	After	after	IN
cord-002369-shk4n8f6	254	2	48	48	CD
cord-002369-shk4n8f6	254	3	h	h	NN
cord-002369-shk4n8f6	254	4	,	,	,
cord-002369-shk4n8f6	254	5	cells	cell	NNS
cord-002369-shk4n8f6	254	6	were	be	VBD
cord-002369-shk4n8f6	254	7	transfected	transfecte	VBN
cord-002369-shk4n8f6	254	8	with	with	IN
cord-002369-shk4n8f6	254	9	pTM	pTM	NNP
cord-002369-shk4n8f6	254	10	-	-	HYPH
cord-002369-shk4n8f6	254	11	NS3	ns3	RB
cord-002369-shk4n8f6	254	12	-	-	HYPH
cord-002369-shk4n8f6	254	13	5B	5b	NN
cord-002369-shk4n8f6	254	14	using	use	VBG
cord-002369-shk4n8f6	254	15	Lipofectamine	Lipofectamine	NNP
cord-002369-shk4n8f6	254	16	3000	3000	CD
cord-002369-shk4n8f6	254	17	(	(	-LRB-
cord-002369-shk4n8f6	254	18	Invitrogen	Invitrogen	NNP
cord-002369-shk4n8f6	254	19	)	)	-RRB-
cord-002369-shk4n8f6	254	20	.	.	.
cord-002369-shk4n8f6	255	1	The	the	DT
cord-002369-shk4n8f6	255	2	coverslips	coverslip	NNS
cord-002369-shk4n8f6	255	3	were	be	VBD
cord-002369-shk4n8f6	255	4	then	then	RB
cord-002369-shk4n8f6	255	5	fixed	fix	VBN
cord-002369-shk4n8f6	255	6	with	with	IN
cord-002369-shk4n8f6	255	7	4	4	CD
cord-002369-shk4n8f6	255	8	%	%	NN
cord-002369-shk4n8f6	255	9	formaldehyde	formaldehyde	NN
cord-002369-shk4n8f6	255	10	in	in	IN
cord-002369-shk4n8f6	255	11	PBS	PBS	NNP
cord-002369-shk4n8f6	255	12	for	for	IN
cord-002369-shk4n8f6	255	13	10	10	CD
cord-002369-shk4n8f6	255	14	min	min	NN
cord-002369-shk4n8f6	255	15	,	,	,
cord-002369-shk4n8f6	255	16	washed	wash	VBN
cord-002369-shk4n8f6	255	17	in	in	IN
cord-002369-shk4n8f6	255	18	PBS	PBS	NNP
cord-002369-shk4n8f6	255	19	and	and	CC
cord-002369-shk4n8f6	255	20	incubated	incubate	VBN
cord-002369-shk4n8f6	255	21	in	in	IN
cord-002369-shk4n8f6	255	22	blocking	block	VBG
cord-002369-shk4n8f6	255	23	buffer	buffer	NN
cord-002369-shk4n8f6	255	24	(	(	-LRB-
cord-002369-shk4n8f6	255	25	PBS	PBS	NNP
cord-002369-shk4n8f6	255	26	,	,	,
cord-002369-shk4n8f6	255	27	3	3	CD
cord-002369-shk4n8f6	255	28	%	%	NN
cord-002369-shk4n8f6	255	29	bovine	bovine	JJ
cord-002369-shk4n8f6	255	30	serum	serum	NN
cord-002369-shk4n8f6	255	31	albumin	albumin	NN
cord-002369-shk4n8f6	255	32	,	,	,
cord-002369-shk4n8f6	255	33	10	10	CD
cord-002369-shk4n8f6	255	34	%	%	NN
cord-002369-shk4n8f6	255	35	FBS	FBS	NNP
cord-002369-shk4n8f6	255	36	,	,	,
cord-002369-shk4n8f6	255	37	0.1	0.1	CD
cord-002369-shk4n8f6	255	38	%	%	NN
cord-002369-shk4n8f6	255	39	Triton	Triton	NNP
cord-002369-shk4n8f6	255	40	X-100	x-100	NN
cord-002369-shk4n8f6	255	41	)	)	-RRB-
cord-002369-shk4n8f6	255	42	for	for	IN
cord-002369-shk4n8f6	255	43	30	30	CD
cord-002369-shk4n8f6	255	44	min	min	NN
cord-002369-shk4n8f6	255	45	at	at	IN
cord-002369-shk4n8f6	255	46	RT	RT	NNP
cord-002369-shk4n8f6	255	47	.	.	.
cord-002369-shk4n8f6	256	1	After	after	IN
cord-002369-shk4n8f6	256	2	being	be	VBG
cord-002369-shk4n8f6	256	3	washed	wash	VBN
cord-002369-shk4n8f6	256	4	three	three	CD
cord-002369-shk4n8f6	256	5	times	time	NNS
cord-002369-shk4n8f6	256	6	with	with	IN
cord-002369-shk4n8f6	256	7	PBS	PBS	NNP
cord-002369-shk4n8f6	256	8	,	,	,
cord-002369-shk4n8f6	256	9	the	the	DT
cord-002369-shk4n8f6	256	10	coverslips	coverslip	NNS
cord-002369-shk4n8f6	256	11	were	be	VBD
cord-002369-shk4n8f6	256	12	incubated	incubate	VBN
cord-002369-shk4n8f6	256	13	with	with	IN
cord-002369-shk4n8f6	256	14	primary	primary	JJ
cord-002369-shk4n8f6	256	15	antibody	antibody	NN
cord-002369-shk4n8f6	256	16	in	in	IN
cord-002369-shk4n8f6	256	17	blocking	block	VBG
cord-002369-shk4n8f6	256	18	buffer	buffer	NN
cord-002369-shk4n8f6	256	19	for	for	IN
cord-002369-shk4n8f6	256	20	1	1	CD
cord-002369-shk4n8f6	256	21	h	h	NN
cord-002369-shk4n8f6	256	22	at	at	IN
cord-002369-shk4n8f6	256	23	RT	RT	NNP
cord-002369-shk4n8f6	256	24	.	.	.
cord-002369-shk4n8f6	257	1	Then	then	RB
cord-002369-shk4n8f6	257	2	,	,	,
cord-002369-shk4n8f6	257	3	the	the	DT
cord-002369-shk4n8f6	257	4	coverslips	coverslip	NNS
cord-002369-shk4n8f6	257	5	were	be	VBD
cord-002369-shk4n8f6	257	6	washed	wash	VBN
cord-002369-shk4n8f6	257	7	with	with	IN
cord-002369-shk4n8f6	257	8	PBS	PBS	NNP
cord-002369-shk4n8f6	257	9	and	and	CC
cord-002369-shk4n8f6	257	10	incubated	incubate	VBN
cord-002369-shk4n8f6	257	11	with	with	IN
cord-002369-shk4n8f6	257	12	either	either	CC
cord-002369-shk4n8f6	257	13	Alexa	Alexa	NNP
cord-002369-shk4n8f6	257	14	Fluor	Fluor	NNP
cord-002369-shk4n8f6	257	15	™	™	NN
cord-002369-shk4n8f6	257	16	-(488	-(488	NNS
cord-002369-shk4n8f6	257	17	or	or	CC
cord-002369-shk4n8f6	257	18	568	568	CD
cord-002369-shk4n8f6	257	19	)	)	-RRB-
cord-002369-shk4n8f6	258	1	goat	goat	NNP
cord-002369-shk4n8f6	258	2	anti	anti	NNP
cord-002369-shk4n8f6	258	3	-	-	JJ
cord-002369-shk4n8f6	258	4	mouse	mouse	JJ
cord-002369-shk4n8f6	258	5	IgG	igg	NN
cord-002369-shk4n8f6	258	6	or	or	CC
cord-002369-shk4n8f6	258	7	Alexa	Alexa	NNP
cord-002369-shk4n8f6	258	8	Fluor	Fluor	NNP
cord-002369-shk4n8f6	258	9	™	™	NN
cord-002369-shk4n8f6	258	10	-(488	-(488	NNS
cord-002369-shk4n8f6	258	11	or	or	CC
cord-002369-shk4n8f6	258	12	568	568	CD
cord-002369-shk4n8f6	258	13	)	)	-RRB-
cord-002369-shk4n8f6	259	1	goat	goat	NNP
cord-002369-shk4n8f6	259	2	anti	anti	JJ
cord-002369-shk4n8f6	259	3	-	-	JJ
cord-002369-shk4n8f6	259	4	rabbit	rabbit	JJ
cord-002369-shk4n8f6	259	5	IgG	igg	NN
cord-002369-shk4n8f6	259	6	(	(	-LRB-
cord-002369-shk4n8f6	259	7	Invitrogen	Invitrogen	NNP
cord-002369-shk4n8f6	259	8	)	)	-RRB-
cord-002369-shk4n8f6	259	9	for	for	IN
cord-002369-shk4n8f6	259	10	1	1	CD
cord-002369-shk4n8f6	259	11	h	h	NN
cord-002369-shk4n8f6	259	12	at	at	IN
cord-002369-shk4n8f6	259	13	RT	RT	NNP
cord-002369-shk4n8f6	259	14	.	.	.
cord-002369-shk4n8f6	260	1	After	after	IN
cord-002369-shk4n8f6	260	2	being	be	VBG
cord-002369-shk4n8f6	260	3	washed	wash	VBN
cord-002369-shk4n8f6	260	4	,	,	,
cord-002369-shk4n8f6	260	5	the	the	DT
cord-002369-shk4n8f6	260	6	coverslips	coverslip	NNS
cord-002369-shk4n8f6	260	7	were	be	VBD
cord-002369-shk4n8f6	260	8	mounted	mount	VBN
cord-002369-shk4n8f6	260	9	on	on	IN
cord-002369-shk4n8f6	260	10	glass	glass	NN
cord-002369-shk4n8f6	260	11	slides	slide	NNS
cord-002369-shk4n8f6	260	12	with	with	IN
cord-002369-shk4n8f6	260	13	Prolong	Prolong	NNP
cord-002369-shk4n8f6	260	14	™	™	NN
cord-002369-shk4n8f6	260	15	.	.	.
cord-002369-shk4n8f6	261	1	Antifade	Antifade	NNP
cord-002369-shk4n8f6	261	2	(	(	-LRB-
cord-002369-shk4n8f6	261	3	Invitrogen	Invitrogen	NNP
cord-002369-shk4n8f6	261	4	)	)	-RRB-
cord-002369-shk4n8f6	261	5	and	and	CC
cord-002369-shk4n8f6	261	6	examined	examine	VBD
cord-002369-shk4n8f6	261	7	with	with	IN
cord-002369-shk4n8f6	261	8	a	a	DT
cord-002369-shk4n8f6	261	9	laser	laser	NN
cord-002369-shk4n8f6	261	10	scanning	scanning	NN
cord-002369-shk4n8f6	261	11	confocal	confocal	JJ
cord-002369-shk4n8f6	261	12	Zeiss	Zeiss	NNP
cord-002369-shk4n8f6	261	13	LSM	LSM	NNP
cord-002369-shk4n8f6	261	14	780	780	CD
cord-002369-shk4n8f6	261	15	.	.	.
cord-002369-shk4n8f6	262	1	For	for	IN
cord-002369-shk4n8f6	262	2	TEM	tem	NN
cord-002369-shk4n8f6	262	3	analysis	analysis	NN
cord-002369-shk4n8f6	262	4	,	,	,
cord-002369-shk4n8f6	262	5	a	a	DT
cord-002369-shk4n8f6	262	6	similar	similar	JJ
cord-002369-shk4n8f6	262	7	setup	setup	NN
cord-002369-shk4n8f6	262	8	was	be	VBD
cord-002369-shk4n8f6	262	9	used	use	VBN
cord-002369-shk4n8f6	262	10	,	,	,
cord-002369-shk4n8f6	262	11	except	except	IN
cord-002369-shk4n8f6	262	12	that	that	DT
cord-002369-shk4n8f6	262	13	after	after	IN
cord-002369-shk4n8f6	262	14	transfection	transfection	NN
cord-002369-shk4n8f6	262	15	with	with	IN
cord-002369-shk4n8f6	262	16	pTM	pTM	NNP
cord-002369-shk4n8f6	262	17	-	-	HYPH
cord-002369-shk4n8f6	262	18	NS3	ns3	NN
cord-002369-shk4n8f6	262	19	-	-	HYPH
cord-002369-shk4n8f6	262	20	5B	5b	NN
cord-002369-shk4n8f6	262	21	,	,	,
cord-002369-shk4n8f6	262	22	the	the	DT
cord-002369-shk4n8f6	262	23	cells	cell	NNS
cord-002369-shk4n8f6	262	24	were	be	VBD
cord-002369-shk4n8f6	262	25	trypsinized	trypsinize	VBN
cord-002369-shk4n8f6	262	26	and	and	CC
cord-002369-shk4n8f6	262	27	seeded	seed	VBN
cord-002369-shk4n8f6	262	28	into	into	IN
cord-002369-shk4n8f6	262	29	lab	lab	NN
cord-002369-shk4n8f6	262	30	-	-	HYPH
cord-002369-shk4n8f6	262	31	tek	tek	NN
cord-002369-shk4n8f6	262	32	chamber	chamber	NN
cord-002369-shk4n8f6	262	33	slides	slide	NNS
cord-002369-shk4n8f6	262	34	(	(	-LRB-
cord-002369-shk4n8f6	262	35	Thermo	Thermo	NNP
cord-002369-shk4n8f6	262	36	Fisher	Fisher	NNP
cord-002369-shk4n8f6	262	37	)	)	-RRB-
cord-002369-shk4n8f6	262	38	.	.	.
cord-002369-shk4n8f6	263	1	After	after	IN
cord-002369-shk4n8f6	263	2	24	24	CD
cord-002369-shk4n8f6	263	3	h	h	NN
cord-002369-shk4n8f6	263	4	,	,	,
cord-002369-shk4n8f6	263	5	the	the	DT
cord-002369-shk4n8f6	263	6	monolayer	monolayer	NN
cord-002369-shk4n8f6	263	7	of	of	IN
cord-002369-shk4n8f6	263	8	cells	cell	NNS
cord-002369-shk4n8f6	263	9	was	be	VBD
cord-002369-shk4n8f6	263	10	washed	wash	VBN
cord-002369-shk4n8f6	263	11	with	with	IN
cord-002369-shk4n8f6	263	12	PBS	PBS	NNP
cord-002369-shk4n8f6	263	13	,	,	,
cord-002369-shk4n8f6	263	14	fixed	fix	VBN
cord-002369-shk4n8f6	263	15	with	with	IN
cord-002369-shk4n8f6	263	16	2.5	2.5	CD
cord-002369-shk4n8f6	263	17	%	%	NN
cord-002369-shk4n8f6	263	18	glutaraldehyde	glutaraldehyde	NN
cord-002369-shk4n8f6	263	19	(	(	-LRB-
cord-002369-shk4n8f6	263	20	Electron	Electron	NNP
cord-002369-shk4n8f6	263	21	Microscopy	Microscopy	NNP
cord-002369-shk4n8f6	263	22	Science	Science	NNP
cord-002369-shk4n8f6	263	23	)	)	-RRB-
cord-002369-shk4n8f6	263	24	and	and	CC
cord-002369-shk4n8f6	263	25	incubated	incubate	VBN
cord-002369-shk4n8f6	263	26	overnight	overnight	RB
cord-002369-shk4n8f6	263	27	at	at	IN
cord-002369-shk4n8f6	263	28	4	4	CD
cord-002369-shk4n8f6	263	29	°	°	NN
cord-002369-shk4n8f6	263	30	C	c	NN
cord-002369-shk4n8f6	263	31	.	.	.
cord-002369-shk4n8f6	264	1	The	the	DT
cord-002369-shk4n8f6	264	2	cells	cell	NNS
cord-002369-shk4n8f6	264	3	were	be	VBD
cord-002369-shk4n8f6	264	4	then	then	RB
cord-002369-shk4n8f6	264	5	washed	wash	VBN
cord-002369-shk4n8f6	264	6	in	in	IN
cord-002369-shk4n8f6	264	7	0.1	0.1	CD
cord-002369-shk4n8f6	264	8	M	m	NN
cord-002369-shk4n8f6	264	9	cacodylate	cacodylate	NN
cord-002369-shk4n8f6	264	10	(	(	-LRB-
cord-002369-shk4n8f6	264	11	Electron	Electron	NNP
cord-002369-shk4n8f6	264	12	Microscopy	Microscopy	NNP
cord-002369-shk4n8f6	264	13	Science	Science	NNP
cord-002369-shk4n8f6	264	14	)	)	-RRB-
cord-002369-shk4n8f6	264	15	and	and	CC
cord-002369-shk4n8f6	264	16	incubated	incubate	VBN
cord-002369-shk4n8f6	264	17	in	in	IN
cord-002369-shk4n8f6	264	18	1	1	CD
cord-002369-shk4n8f6	264	19	%	%	NN
cord-002369-shk4n8f6	264	20	osmium	osmium	NN
cord-002369-shk4n8f6	264	21	tetroxide	tetroxide	NN
cord-002369-shk4n8f6	264	22	(	(	-LRB-
cord-002369-shk4n8f6	264	23	Mecalab	Mecalab	NNP
cord-002369-shk4n8f6	264	24	)	)	-RRB-
cord-002369-shk4n8f6	264	25	for	for	IN
cord-002369-shk4n8f6	264	26	1	1	CD
cord-002369-shk4n8f6	264	27	h	h	NN
cord-002369-shk4n8f6	264	28	at	at	IN
cord-002369-shk4n8f6	264	29	4	4	CD
cord-002369-shk4n8f6	264	30	°	°	NN
cord-002369-shk4n8f6	264	31	C	c	NN
cord-002369-shk4n8f6	264	32	.	.	.
cord-002369-shk4n8f6	265	1	The	the	DT
cord-002369-shk4n8f6	265	2	cells	cell	NNS
cord-002369-shk4n8f6	265	3	were	be	VBD
cord-002369-shk4n8f6	265	4	dehydrated	dehydrate	VBN
cord-002369-shk4n8f6	265	5	in	in	IN
cord-002369-shk4n8f6	265	6	a	a	DT
cord-002369-shk4n8f6	265	7	graded	grade	VBN
cord-002369-shk4n8f6	265	8	series	series	NN
cord-002369-shk4n8f6	265	9	of	of	IN
cord-002369-shk4n8f6	265	10	ethanol	ethanol	NN
cord-002369-shk4n8f6	265	11	/	/	SYM
cord-002369-shk4n8f6	265	12	deionized	deionize	VBN
cord-002369-shk4n8f6	265	13	water	water	NN
cord-002369-shk4n8f6	265	14	solutions	solution	NNS
cord-002369-shk4n8f6	265	15	(	(	-LRB-
cord-002369-shk4n8f6	265	16	from	from	IN
cord-002369-shk4n8f6	265	17	50	50	CD
cord-002369-shk4n8f6	265	18	%	%	NN
cord-002369-shk4n8f6	265	19	to	to	TO
cord-002369-shk4n8f6	265	20	100	100	CD
cord-002369-shk4n8f6	265	21	%	%	NN
cord-002369-shk4n8f6	265	22	)	)	-RRB-
cord-002369-shk4n8f6	265	23	.	.	.
cord-002369-shk4n8f6	266	1	The	the	DT
cord-002369-shk4n8f6	266	2	cells	cell	NNS
cord-002369-shk4n8f6	266	3	were	be	VBD
cord-002369-shk4n8f6	266	4	then	then	RB
cord-002369-shk4n8f6	266	5	infiltrated	infiltrate	VBN
cord-002369-shk4n8f6	266	6	with	with	IN
cord-002369-shk4n8f6	266	7	a	a	DT
cord-002369-shk4n8f6	266	8	1:1	1:1	CD
cord-002369-shk4n8f6	266	9	and	and	CC
cord-002369-shk4n8f6	266	10	3:1	3:1	CD
cord-002369-shk4n8f6	266	11	Epon	Epon	NNP
cord-002369-shk4n8f6	266	12	812	812	CD
cord-002369-shk4n8f6	266	13	for	for	IN
cord-002369-shk4n8f6	266	14	1	1	CD
cord-002369-shk4n8f6	266	15	h	h	NN
cord-002369-shk4n8f6	266	16	for	for	IN
cord-002369-shk4n8f6	266	17	embedding	embed	VBG
cord-002369-shk4n8f6	266	18	and	and	CC
cord-002369-shk4n8f6	266	19	polymerized	polymerize	VBN
cord-002369-shk4n8f6	266	20	overnight	overnight	RB
cord-002369-shk4n8f6	266	21	in	in	IN
cord-002369-shk4n8f6	266	22	an	an	DT
cord-002369-shk4n8f6	266	23	oven	oven	NN
cord-002369-shk4n8f6	266	24	at	at	IN
cord-002369-shk4n8f6	266	25	60	60	CD
cord-002369-shk4n8f6	266	26	°	°	NN
cord-002369-shk4n8f6	266	27	C	c	NN
cord-002369-shk4n8f6	266	28	.	.	.
cord-002369-shk4n8f6	267	1	The	the	DT
cord-002369-shk4n8f6	267	2	polymerized	polymerize	VBN
cord-002369-shk4n8f6	267	3	blocks	block	NNS
cord-002369-shk4n8f6	267	4	were	be	VBD
cord-002369-shk4n8f6	267	5	trimmed	trim	VBN
cord-002369-shk4n8f6	267	6	,	,	,
cord-002369-shk4n8f6	267	7	and	and	CC
cord-002369-shk4n8f6	267	8	100	100	CD
cord-002369-shk4n8f6	267	9	nm	nm	NN
cord-002369-shk4n8f6	267	10	ultrathin	ultrathin	JJ
cord-002369-shk4n8f6	267	11	sections	section	NNS
cord-002369-shk4n8f6	267	12	cut	cut	VBN
cord-002369-shk4n8f6	267	13	with	with	IN
cord-002369-shk4n8f6	267	14	an	an	DT
cord-002369-shk4n8f6	267	15	UltraCut	UltraCut	NNP
cord-002369-shk4n8f6	267	16	E	e	NN
cord-002369-shk4n8f6	267	17	ultramicrotome	ultramicrotome	NN
cord-002369-shk4n8f6	267	18	(	(	-LRB-
cord-002369-shk4n8f6	267	19	Reichert	Reichert	NNP
cord-002369-shk4n8f6	267	20	Jung	Jung	NNP
cord-002369-shk4n8f6	267	21	)	)	-RRB-
cord-002369-shk4n8f6	267	22	and	and	CC
cord-002369-shk4n8f6	267	23	transferred	transfer	VBD
cord-002369-shk4n8f6	267	24	onto	onto	IN
cord-002369-shk4n8f6	267	25	200-mesh	200-mesh	CD
cord-002369-shk4n8f6	267	26	copper	copper	NN
cord-002369-shk4n8f6	267	27	grids	grid	NNS
cord-002369-shk4n8f6	267	28	(	(	-LRB-
cord-002369-shk4n8f6	267	29	Electron	Electron	NNP
cord-002369-shk4n8f6	267	30	Microscopy	Microscopy	NNP
cord-002369-shk4n8f6	267	31	Science	Science	NNP
cord-002369-shk4n8f6	267	32	)	)	-RRB-
cord-002369-shk4n8f6	267	33	with	with	IN
cord-002369-shk4n8f6	267	34	formvar	formvar	NNP
cord-002369-shk4n8f6	267	35	support	support	NNP
cord-002369-shk4n8f6	267	36	film	film	NN
cord-002369-shk4n8f6	267	37	.	.	.
cord-002369-shk4n8f6	268	1	The	the	DT
cord-002369-shk4n8f6	268	2	sections	section	NNS
cord-002369-shk4n8f6	268	3	were	be	VBD
cord-002369-shk4n8f6	268	4	stained	stain	VBN
cord-002369-shk4n8f6	268	5	with	with	IN
cord-002369-shk4n8f6	268	6	4	4	CD
cord-002369-shk4n8f6	268	7	%	%	NN
cord-002369-shk4n8f6	268	8	uranyl	uranyl	NN
cord-002369-shk4n8f6	268	9	acetate	acetate	NN
cord-002369-shk4n8f6	268	10	(	(	-LRB-
cord-002369-shk4n8f6	268	11	Electron	Electron	NNP
cord-002369-shk4n8f6	268	12	Microscopy	Microscopy	NNP
cord-002369-shk4n8f6	268	13	Science	Science	NNP
cord-002369-shk4n8f6	268	14	)	)	-RRB-
cord-002369-shk4n8f6	268	15	for	for	IN
cord-002369-shk4n8f6	268	16	8	8	CD
cord-002369-shk4n8f6	268	17	min	min	NN
cord-002369-shk4n8f6	268	18	,	,	,
cord-002369-shk4n8f6	268	19	then	then	RB
cord-002369-shk4n8f6	268	20	with	with	IN
cord-002369-shk4n8f6	268	21	lead	lead	JJ
cord-002369-shk4n8f6	268	22	citrate	citrate	NNP
cord-002369-shk4n8f6	268	23	for	for	IN
cord-002369-shk4n8f6	268	24	5	5	CD
cord-002369-shk4n8f6	268	25	min	min	NN
cord-002369-shk4n8f6	268	26	(	(	-LRB-
cord-002369-shk4n8f6	268	27	Fisher	Fisher	NNP
cord-002369-shk4n8f6	268	28	scientific	scientific	JJ
cord-002369-shk4n8f6	268	29	)	)	-RRB-
cord-002369-shk4n8f6	268	30	.	.	.
cord-002369-shk4n8f6	269	1	The	the	DT
cord-002369-shk4n8f6	269	2	cells	cell	NNS
cord-002369-shk4n8f6	269	3	were	be	VBD
cord-002369-shk4n8f6	269	4	imaged	image	VBN
cord-002369-shk4n8f6	269	5	with	with	IN
cord-002369-shk4n8f6	269	6	an	an	DT
cord-002369-shk4n8f6	269	7	FEI	FEI	NNP
cord-002369-shk4n8f6	269	8	Tecnai	Tecnai	NNP
cord-002369-shk4n8f6	269	9	12	12	CD
cord-002369-shk4n8f6	269	10	transmission	transmission	NN
cord-002369-shk4n8f6	269	11	electron	electron	NN
cord-002369-shk4n8f6	269	12	microscope	microscope	NN
cord-002369-shk4n8f6	269	13	(	(	-LRB-
cord-002369-shk4n8f6	269	14	FEI	FEI	NNP
cord-002369-shk4n8f6	269	15	company	company	NN
cord-002369-shk4n8f6	269	16	)	)	-RRB-
cord-002369-shk4n8f6	269	17	operating	operate	VBG
cord-002369-shk4n8f6	269	18	at	at	IN
cord-002369-shk4n8f6	269	19	an	an	DT
cord-002369-shk4n8f6	269	20	accelerating	accelerate	VBG
cord-002369-shk4n8f6	269	21	voltage	voltage	NN
cord-002369-shk4n8f6	269	22	of	of	IN
cord-002369-shk4n8f6	269	23	120	120	CD
cord-002369-shk4n8f6	269	24	kV	kV	NNS
cord-002369-shk4n8f6	269	25	and	and	CC
cord-002369-shk4n8f6	269	26	equipped	equip	VBN
cord-002369-shk4n8f6	269	27	with	with	IN
cord-002369-shk4n8f6	269	28	an	an	DT
cord-002369-shk4n8f6	269	29	AMT	AMT	NNP
cord-002369-shk4n8f6	269	30	XR80C	xr80c	NN
cord-002369-shk4n8f6	269	31	CCD	ccd	NN
cord-002369-shk4n8f6	269	32	camera	camera	NN
cord-002369-shk4n8f6	269	33	.	.	.
cord-002369-shk4n8f6	270	1	Vesicle	Vesicle	NNP
cord-002369-shk4n8f6	270	2	size	size	NN
cord-002369-shk4n8f6	270	3	was	be	VBD
cord-002369-shk4n8f6	270	4	measured	measure	VBN
cord-002369-shk4n8f6	270	5	using	use	VBG
cord-002369-shk4n8f6	270	6	Image	Image	NNP
cord-002369-shk4n8f6	270	7	J	J	NNP
cord-002369-shk4n8f6	270	8	(	(	-LRB-
cord-002369-shk4n8f6	270	9	NIH	NIH	NNP
cord-002369-shk4n8f6	270	10	)	)	-RRB-
cord-002369-shk4n8f6	270	11	.	.	.
cord-002369-shk4n8f6	271	1	Cell	cell	NN
cord-002369-shk4n8f6	271	2	viability	viability	NN
cord-002369-shk4n8f6	271	3	assay	assay	NN
cord-002369-shk4n8f6	271	4	.	.	.
cord-002369-shk4n8f6	272	1	Cells	cell	NNS
cord-002369-shk4n8f6	272	2	were	be	VBD
cord-002369-shk4n8f6	272	3	reverse	reverse	RB
cord-002369-shk4n8f6	272	4	transfected	transfecte	VBN
cord-002369-shk4n8f6	272	5	with	with	IN
cord-002369-shk4n8f6	272	6	different	different	JJ
cord-002369-shk4n8f6	272	7	siRNAs	sirna	NNS
cord-002369-shk4n8f6	272	8	used	use	VBN
cord-002369-shk4n8f6	272	9	in	in	IN
cord-002369-shk4n8f6	272	10	this	this	DT
cord-002369-shk4n8f6	272	11	study	study	NN
cord-002369-shk4n8f6	272	12	in	in	IN
cord-002369-shk4n8f6	272	13	a	a	DT
cord-002369-shk4n8f6	272	14	96-well	96-well	CD
cord-002369-shk4n8f6	272	15	plate	plate	NN
cord-002369-shk4n8f6	272	16	for	for	IN
cord-002369-shk4n8f6	272	17	48	48	CD
cord-002369-shk4n8f6	272	18	h.	h.	NNP
cord-002369-shk4n8f6	272	19	Cell	Cell	NNP
cord-002369-shk4n8f6	272	20	viability	viability	NN
cord-002369-shk4n8f6	272	21	was	be	VBD
cord-002369-shk4n8f6	272	22	then	then	RB
cord-002369-shk4n8f6	272	23	assayed	assay	VBN
cord-002369-shk4n8f6	272	24	using	use	VBG
cord-002369-shk4n8f6	272	25	the	the	DT
cord-002369-shk4n8f6	272	26	CellTiter	CellTiter	NNP
cord-002369-shk4n8f6	272	27	96	96	CD
cord-002369-shk4n8f6	272	28	®	®	JJS
cord-002369-shk4n8f6	272	29	AQueous	AQueous	NNP
cord-002369-shk4n8f6	272	30	Non	Non	NNP
cord-002369-shk4n8f6	272	31	-	-	NNP
cord-002369-shk4n8f6	272	32	Radioactive	radioactive	JJ
cord-002369-shk4n8f6	272	33	Cell	Cell	NNP
cord-002369-shk4n8f6	272	34	Proliferation	Proliferation	NNP
cord-002369-shk4n8f6	272	35	Assay	Assay	NNP
cord-002369-shk4n8f6	272	36	reagent	reagent	NN
cord-002369-shk4n8f6	272	37	(	(	-LRB-
cord-002369-shk4n8f6	272	38	Promega	Promega	NNP
cord-002369-shk4n8f6	272	39	)	)	-RRB-
cord-002369-shk4n8f6	272	40	.	.	.
cord-002369-shk4n8f6	273	1	The	the	DT
cord-002369-shk4n8f6	273	2	results	result	NNS
cord-002369-shk4n8f6	273	3	shown	show	VBN
cord-002369-shk4n8f6	273	4	represent	represent	VBP
cord-002369-shk4n8f6	273	5	the	the	DT
cord-002369-shk4n8f6	273	6	mean	mean	NN
cord-002369-shk4n8f6	273	7	of	of	IN
cord-002369-shk4n8f6	273	8	at	at	RB
cord-002369-shk4n8f6	273	9	least	least	RBS
cord-002369-shk4n8f6	273	10	three	three	CD
cord-002369-shk4n8f6	273	11	independent	independent	JJ
cord-002369-shk4n8f6	273	12	experiments	experiment	NNS
cord-002369-shk4n8f6	273	13	.	.	.
cord-002369-shk4n8f6	274	1	Student's	Student's	NNP
cord-002369-shk4n8f6	274	2	-	-	HYPH
cord-002369-shk4n8f6	274	3	t	t	NN
cord-002369-shk4n8f6	274	4	-	-	HYPH
cord-002369-shk4n8f6	274	5	test	test	NN
cord-002369-shk4n8f6	274	6	and	and	CC
cord-002369-shk4n8f6	274	7	one	one	CD
cord-002369-shk4n8f6	274	8	-	-	HYPH
cord-002369-shk4n8f6	274	9	way	way	NN
cord-002369-shk4n8f6	274	10	ANOVA	anova	NN
cord-002369-shk4n8f6	274	11	with	with	IN
cord-002369-shk4n8f6	274	12	Dunnett	Dunnett	NNP
cord-002369-shk4n8f6	274	13	's	's	POS
cord-002369-shk4n8f6	274	14	post	post	JJ
cord-002369-shk4n8f6	274	15	-	-	JJ
cord-002369-shk4n8f6	274	16	test	test	JJ
cord-002369-shk4n8f6	274	17	(	(	-LRB-
cord-002369-shk4n8f6	274	18	as	as	RB
cord-002369-shk4n8f6	274	19	indicated	indicate	VBN
cord-002369-shk4n8f6	274	20	in	in	IN
cord-002369-shk4n8f6	274	21	the	the	DT
cord-002369-shk4n8f6	274	22	figure	figure	NN
cord-002369-shk4n8f6	274	23	legends	legend	NNS
cord-002369-shk4n8f6	274	24	)	)	-RRB-
cord-002369-shk4n8f6	274	25	were	be	VBD
cord-002369-shk4n8f6	274	26	performed	perform	VBN
cord-002369-shk4n8f6	274	27	using	use	VBG
cord-002369-shk4n8f6	274	28	GraphPad	GraphPad	NNP
cord-002369-shk4n8f6	274	29	Prism	Prism	NNP
cord-002369-shk4n8f6	274	30	5	5	CD
cord-002369-shk4n8f6	274	31	.	.	.
cord-002369-shk4n8f6	275	1	P	p	NN
cord-002369-shk4n8f6	275	2	-	-	HYPH
cord-002369-shk4n8f6	275	3	values	value	NNS
cord-002369-shk4n8f6	275	4	below	below	IN
cord-002369-shk4n8f6	275	5	0.05	0.05	CD
cord-002369-shk4n8f6	275	6	were	be	VBD
cord-002369-shk4n8f6	275	7	considered	consider	VBN
cord-002369-shk4n8f6	275	8	statistically	statistically	RB
cord-002369-shk4n8f6	275	9	significant	significant	JJ
cord-002369-shk4n8f6	275	10	.	.	.
cord-002369-shk4n8f6	276	1	Development	development	NN
cord-002369-shk4n8f6	276	2	of	of	IN
cord-002369-shk4n8f6	276	3	novel	novel	JJ
cord-002369-shk4n8f6	276	4	treatments	treatment	NNS
cord-002369-shk4n8f6	276	5	for	for	IN
cord-002369-shk4n8f6	276	6	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	276	7	C	C	NNP
cord-002369-shk4n8f6	276	8	Replication	Replication	NNP
cord-002369-shk4n8f6	276	9	of	of	IN
cord-002369-shk4n8f6	276	10	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	276	11	C	C	NNP
cord-002369-shk4n8f6	276	12	virus	virus	NN
cord-002369-shk4n8f6	276	13	Identification	identification	NN
cord-002369-shk4n8f6	276	14	of	of	IN
cord-002369-shk4n8f6	276	15	the	the	DT
cord-002369-shk4n8f6	276	16	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	276	17	C	C	NNP
cord-002369-shk4n8f6	276	18	virus	virus	NN
cord-002369-shk4n8f6	276	19	RNA	RNA	NNP
cord-002369-shk4n8f6	276	20	replication	replication	NN
cord-002369-shk4n8f6	276	21	complex	complex	NN
cord-002369-shk4n8f6	276	22	in	in	IN
cord-002369-shk4n8f6	276	23	Huh-7	Huh-7	NNP
cord-002369-shk4n8f6	276	24	cells	cell	NNS
cord-002369-shk4n8f6	276	25	harboring	harbor	VBG
cord-002369-shk4n8f6	276	26	subgenomic	subgenomic	NNP
cord-002369-shk4n8f6	276	27	replicons	replicons	NNPS
cord-002369-shk4n8f6	276	28	Expression	Expression	NNP
cord-002369-shk4n8f6	276	29	of	of	IN
cord-002369-shk4n8f6	276	30	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	276	31	C	C	NNP
cord-002369-shk4n8f6	276	32	virus	virus	NN
cord-002369-shk4n8f6	276	33	proteins	protein	NNS
cord-002369-shk4n8f6	276	34	induces	induce	VBZ
cord-002369-shk4n8f6	276	35	distinct	distinct	JJ
cord-002369-shk4n8f6	276	36	membrane	membrane	NN
cord-002369-shk4n8f6	276	37	alterations	alteration	NNS
cord-002369-shk4n8f6	276	38	including	include	VBG
cord-002369-shk4n8f6	276	39	a	a	DT
cord-002369-shk4n8f6	276	40	candidate	candidate	NN
cord-002369-shk4n8f6	276	41	viral	viral	JJ
cord-002369-shk4n8f6	276	42	replication	replication	NN
cord-002369-shk4n8f6	276	43	complex	complex	JJ
cord-002369-shk4n8f6	276	44	SARS	SARS	NNP
cord-002369-shk4n8f6	276	45	-	-	HYPH
cord-002369-shk4n8f6	276	46	coronavirus	coronavirus	NN
cord-002369-shk4n8f6	276	47	replication	replication	NN
cord-002369-shk4n8f6	276	48	is	be	VBZ
cord-002369-shk4n8f6	276	49	supported	support	VBN
cord-002369-shk4n8f6	276	50	by	by	IN
cord-002369-shk4n8f6	276	51	a	a	DT
cord-002369-shk4n8f6	276	52	reticulovesicular	reticulovesicular	JJ
cord-002369-shk4n8f6	276	53	network	network	NN
cord-002369-shk4n8f6	276	54	of	of	IN
cord-002369-shk4n8f6	276	55	modified	modify	VBN
cord-002369-shk4n8f6	276	56	endoplasmic	endoplasmic	NN
cord-002369-shk4n8f6	276	57	reticulum	reticulum	NN
cord-002369-shk4n8f6	276	58	MERS	MERS	NNP
cord-002369-shk4n8f6	276	59	-	-	HYPH
cord-002369-shk4n8f6	276	60	coronavirus	coronavirus	NN
cord-002369-shk4n8f6	276	61	replication	replication	NN
cord-002369-shk4n8f6	276	62	induces	induce	VBZ
cord-002369-shk4n8f6	276	63	severe	severe	JJ
cord-002369-shk4n8f6	276	64	in	in	IN
cord-002369-shk4n8f6	276	65	vitro	vitro	FW
cord-002369-shk4n8f6	276	66	cytopathology	cytopathology	NN
cord-002369-shk4n8f6	276	67	and	and	CC
cord-002369-shk4n8f6	276	68	is	be	VBZ
cord-002369-shk4n8f6	276	69	strongly	strongly	RB
cord-002369-shk4n8f6	276	70	inhibited	inhibit	VBN
cord-002369-shk4n8f6	276	71	by	by	IN
cord-002369-shk4n8f6	276	72	cyclosporin	cyclosporin	NN
cord-002369-shk4n8f6	276	73	A	a	NN
cord-002369-shk4n8f6	276	74	or	or	CC
cord-002369-shk4n8f6	276	75	interferon	interferon	NN
cord-002369-shk4n8f6	276	76	-	-	HYPH
cord-002369-shk4n8f6	276	77	α	α	NN
cord-002369-shk4n8f6	276	78	treatment	treatment	NN
cord-002369-shk4n8f6	276	79	Three	three	CD
cord-002369-shk4n8f6	276	80	-	-	HYPH
cord-002369-shk4n8f6	276	81	dimensional	dimensional	JJ
cord-002369-shk4n8f6	276	82	architecture	architecture	NN
cord-002369-shk4n8f6	276	83	and	and	CC
cord-002369-shk4n8f6	276	84	biogenesis	biogenesis	NN
cord-002369-shk4n8f6	276	85	of	of	IN
cord-002369-shk4n8f6	276	86	membrane	membrane	NN
cord-002369-shk4n8f6	276	87	structures	structure	NNS
cord-002369-shk4n8f6	276	88	associated	associate	VBN
cord-002369-shk4n8f6	276	89	with	with	IN
cord-002369-shk4n8f6	276	90	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	276	91	C	C	NNP
cord-002369-shk4n8f6	276	92	virus	virus	NN
cord-002369-shk4n8f6	276	93	replication	replication	NN
cord-002369-shk4n8f6	276	94	Qualitative	qualitative	JJ
cord-002369-shk4n8f6	276	95	and	and	CC
cord-002369-shk4n8f6	276	96	quantitative	quantitative	JJ
cord-002369-shk4n8f6	276	97	ultrastructural	ultrastructural	JJ
cord-002369-shk4n8f6	276	98	analysis	analysis	NN
cord-002369-shk4n8f6	276	99	of	of	IN
cord-002369-shk4n8f6	276	100	the	the	DT
cord-002369-shk4n8f6	276	101	membrane	membrane	NN
cord-002369-shk4n8f6	276	102	rearrangements	rearrangement	NNS
cord-002369-shk4n8f6	276	103	induced	induce	VBN
cord-002369-shk4n8f6	276	104	by	by	IN
cord-002369-shk4n8f6	276	105	coronavirus	coronavirus	NN
cord-002369-shk4n8f6	276	106	Replication	replication	NN
cord-002369-shk4n8f6	276	107	of	of	IN
cord-002369-shk4n8f6	276	108	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	276	109	C	C	NNP
cord-002369-shk4n8f6	276	110	virus	virus	NN
cord-002369-shk4n8f6	276	111	RNA	RNA	NNP
cord-002369-shk4n8f6	276	112	on	on	IN
cord-002369-shk4n8f6	276	113	autophagosomal	autophagosomal	NNP
cord-002369-shk4n8f6	276	114	membranes	membrane	NNS
cord-002369-shk4n8f6	276	115	Autophagy	Autophagy	NNP
cord-002369-shk4n8f6	276	116	in	in	IN
cord-002369-shk4n8f6	276	117	immunity	immunity	NN
cord-002369-shk4n8f6	276	118	and	and	CC
cord-002369-shk4n8f6	276	119	inflammation	inflammation	NN
cord-002369-shk4n8f6	277	1	The	the	DT
cord-002369-shk4n8f6	277	2	Atg16L	Atg16L	NNP
cord-002369-shk4n8f6	277	3	complex	complex	NN
cord-002369-shk4n8f6	277	4	specifies	specify	VBZ
cord-002369-shk4n8f6	277	5	the	the	DT
cord-002369-shk4n8f6	277	6	site	site	NN
cord-002369-shk4n8f6	277	7	of	of	IN
cord-002369-shk4n8f6	277	8	LC3	LC3	NNP
cord-002369-shk4n8f6	277	9	lipidation	lipidation	NN
cord-002369-shk4n8f6	277	10	for	for	IN
cord-002369-shk4n8f6	277	11	membrane	membrane	NN
cord-002369-shk4n8f6	277	12	biogenesis	biogenesis	NN
cord-002369-shk4n8f6	277	13	in	in	IN
cord-002369-shk4n8f6	277	14	autophagy	autophagy	NN
cord-002369-shk4n8f6	277	15	Subversion	subversion	NN
cord-002369-shk4n8f6	277	16	of	of	IN
cord-002369-shk4n8f6	277	17	cellular	cellular	JJ
cord-002369-shk4n8f6	277	18	autophagosomal	autophagosomal	NN
cord-002369-shk4n8f6	277	19	machinery	machinery	NN
cord-002369-shk4n8f6	277	20	by	by	IN
cord-002369-shk4n8f6	277	21	RNA	RNA	NNP
cord-002369-shk4n8f6	277	22	viruses	virus	NNS
cord-002369-shk4n8f6	278	1	Autophagy	Autophagy	NNP
cord-002369-shk4n8f6	278	2	is	be	VBZ
cord-002369-shk4n8f6	278	3	involved	involve	VBN
cord-002369-shk4n8f6	278	4	in	in	IN
cord-002369-shk4n8f6	278	5	the	the	DT
cord-002369-shk4n8f6	278	6	early	early	JJ
cord-002369-shk4n8f6	278	7	step	step	NN
cord-002369-shk4n8f6	278	8	of	of	IN
cord-002369-shk4n8f6	278	9	Japanese	japanese	JJ
cord-002369-shk4n8f6	278	10	encephalitis	encephalitis	RB
cord-002369-shk4n8f6	278	11	virus	virus	NN
cord-002369-shk4n8f6	278	12	infection	infection	NN
cord-002369-shk4n8f6	279	1	Flavivirus	Flavivirus	NNP
cord-002369-shk4n8f6	280	1	NS4A	ns4a	RB
cord-002369-shk4n8f6	280	2	-	-	HYPH
cord-002369-shk4n8f6	280	3	induced	induce	VBN
cord-002369-shk4n8f6	280	4	autophagy	autophagy	NN
cord-002369-shk4n8f6	280	5	protects	protect	VBZ
cord-002369-shk4n8f6	280	6	cells	cell	NNS
cord-002369-shk4n8f6	280	7	against	against	IN
cord-002369-shk4n8f6	280	8	death	death	NN
cord-002369-shk4n8f6	280	9	and	and	CC
cord-002369-shk4n8f6	280	10	enhances	enhance	VBZ
cord-002369-shk4n8f6	280	11	virus	virus	NN
cord-002369-shk4n8f6	280	12	replication	replication	NN
cord-002369-shk4n8f6	280	13	Dengue	dengue	NN
cord-002369-shk4n8f6	280	14	virus	virus	NN
cord-002369-shk4n8f6	280	15	-	-	HYPH
cord-002369-shk4n8f6	280	16	induced	induce	VBN
cord-002369-shk4n8f6	280	17	autophagy	autophagy	NN
cord-002369-shk4n8f6	280	18	regulates	regulate	VBZ
cord-002369-shk4n8f6	280	19	lipid	lipid	NN
cord-002369-shk4n8f6	280	20	metabolism	metabolism	NN
cord-002369-shk4n8f6	281	1	Autophagy	Autophagy	NNP
cord-002369-shk4n8f6	281	2	sustains	sustain	VBZ
cord-002369-shk4n8f6	281	3	the	the	DT
cord-002369-shk4n8f6	281	4	replication	replication	NN
cord-002369-shk4n8f6	281	5	of	of	IN
cord-002369-shk4n8f6	281	6	porcine	porcine	JJ
cord-002369-shk4n8f6	281	7	reproductive	reproductive	JJ
cord-002369-shk4n8f6	281	8	and	and	CC
cord-002369-shk4n8f6	281	9	respiratory	respiratory	JJ
cord-002369-shk4n8f6	281	10	virus	virus	NN
cord-002369-shk4n8f6	281	11	in	in	IN
cord-002369-shk4n8f6	281	12	host	host	NN
cord-002369-shk4n8f6	281	13	cells	cell	NNS
cord-002369-shk4n8f6	282	1	HCV	HCV	NNP
cord-002369-shk4n8f6	282	2	induces	induce	VBZ
cord-002369-shk4n8f6	282	3	the	the	DT
cord-002369-shk4n8f6	282	4	expression	expression	NN
cord-002369-shk4n8f6	282	5	of	of	IN
cord-002369-shk4n8f6	282	6	Rubicon	Rubicon	NNP
cord-002369-shk4n8f6	282	7	and	and	CC
cord-002369-shk4n8f6	282	8	UVRAG	UVRAG	NNP
cord-002369-shk4n8f6	282	9	to	to	TO
cord-002369-shk4n8f6	282	10	temporally	temporally	RB
cord-002369-shk4n8f6	282	11	regulate	regulate	VB
cord-002369-shk4n8f6	282	12	the	the	DT
cord-002369-shk4n8f6	282	13	maturation	maturation	NN
cord-002369-shk4n8f6	282	14	of	of	IN
cord-002369-shk4n8f6	282	15	autophagosomes	autophagosome	NNS
cord-002369-shk4n8f6	282	16	and	and	CC
cord-002369-shk4n8f6	282	17	viral	viral	JJ
cord-002369-shk4n8f6	282	18	replication	replication	NN
cord-002369-shk4n8f6	282	19	Hepatitis	Hepatitis	NNP
cord-002369-shk4n8f6	282	20	C	C	NNP
cord-002369-shk4n8f6	282	21	virus	virus	NN
cord-002369-shk4n8f6	283	1	inhibits	inhibit	VBZ
cord-002369-shk4n8f6	283	2	AKT	akt	NN
cord-002369-shk4n8f6	283	3	-	-	HYPH
cord-002369-shk4n8f6	283	4	tuberous	tuberous	JJ
cord-002369-shk4n8f6	283	5	sclerosis	sclerosis	NN
cord-002369-shk4n8f6	283	6	complex	complex	NN
cord-002369-shk4n8f6	283	7	(	(	-LRB-
cord-002369-shk4n8f6	283	8	TSC	TSC	NNP
cord-002369-shk4n8f6	283	9	)	)	-RRB-
cord-002369-shk4n8f6	283	10	,	,	.
cord-002369-shk4n8f6	284	1	the	the	DT
cord-002369-shk4n8f6	284	2	mechanistic	mechanistic	JJ
cord-002369-shk4n8f6	284	3	target	target	NN
cord-002369-shk4n8f6	284	4	of	of	IN
cord-002369-shk4n8f6	284	5	rapamycin	rapamycin	NNS
cord-002369-shk4n8f6	284	6	(	(	-LRB-
cord-002369-shk4n8f6	284	7	MTOR	MTOR	NNP
cord-002369-shk4n8f6	284	8	)	)	-RRB-
cord-002369-shk4n8f6	284	9	pathway	pathway	NN
cord-002369-shk4n8f6	284	10	,	,	,
cord-002369-shk4n8f6	284	11	through	through	IN
cord-002369-shk4n8f6	284	12	endoplasmic	endoplasmic	NN
cord-002369-shk4n8f6	284	13	reticulum	reticulum	NN
cord-002369-shk4n8f6	284	14	stress	stress	NN
cord-002369-shk4n8f6	284	15	to	to	TO
cord-002369-shk4n8f6	284	16	induce	induce	VB
cord-002369-shk4n8f6	284	17	autophagy	autophagy	NN
cord-002369-shk4n8f6	284	18	Hepatitis	Hepatitis	NNP
cord-002369-shk4n8f6	284	19	C	C	NNP
cord-002369-shk4n8f6	284	20	virus	virus	NN
cord-002369-shk4n8f6	284	21	genotype	genotype	NN
cord-002369-shk4n8f6	284	22	1a	1a	CD
cord-002369-shk4n8f6	284	23	growth	growth	NN
cord-002369-shk4n8f6	284	24	and	and	CC
cord-002369-shk4n8f6	284	25	induction	induction	NN
cord-002369-shk4n8f6	284	26	of	of	IN
cord-002369-shk4n8f6	284	27	autophagy	autophagy	NN
cord-002369-shk4n8f6	284	28	Persistent	persistent	JJ
cord-002369-shk4n8f6	284	29	expression	expression	NN
cord-002369-shk4n8f6	284	30	of	of	IN
cord-002369-shk4n8f6	284	31	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	284	32	C	C	NNP
cord-002369-shk4n8f6	284	33	virus	virus	NN
cord-002369-shk4n8f6	284	34	non	non	JJ
cord-002369-shk4n8f6	284	35	-	-	JJ
cord-002369-shk4n8f6	284	36	structural	structural	JJ
cord-002369-shk4n8f6	284	37	proteins	protein	NNS
cord-002369-shk4n8f6	284	38	leads	lead	VBZ
cord-002369-shk4n8f6	284	39	to	to	IN
cord-002369-shk4n8f6	284	40	increased	increase	VBN
cord-002369-shk4n8f6	284	41	autophagy	autophagy	NN
cord-002369-shk4n8f6	284	42	and	and	CC
cord-002369-shk4n8f6	284	43	mitochondrial	mitochondrial	JJ
cord-002369-shk4n8f6	284	44	injury	injury	NN
cord-002369-shk4n8f6	284	45	in	in	IN
cord-002369-shk4n8f6	284	46	human	human	JJ
cord-002369-shk4n8f6	284	47	hepatoma	hepatoma	NNP
cord-002369-shk4n8f6	284	48	cells	cell	VBZ
cord-002369-shk4n8f6	284	49	Changes	change	NNS
cord-002369-shk4n8f6	284	50	in	in	IN
cord-002369-shk4n8f6	284	51	autophagic	autophagic	JJ
cord-002369-shk4n8f6	284	52	response	response	NN
cord-002369-shk4n8f6	284	53	in	in	IN
cord-002369-shk4n8f6	284	54	patients	patient	NNS
cord-002369-shk4n8f6	284	55	with	with	IN
cord-002369-shk4n8f6	284	56	chronic	chronic	JJ
cord-002369-shk4n8f6	284	57	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	284	58	C	c	NN
cord-002369-shk4n8f6	284	59	virus	virus	NN
cord-002369-shk4n8f6	284	60	infection	infection	NN
cord-002369-shk4n8f6	284	61	Hepatitis	Hepatitis	NNP
cord-002369-shk4n8f6	284	62	C	C	NNP
cord-002369-shk4n8f6	284	63	virus	virus	NN
cord-002369-shk4n8f6	284	64	induces	induce	VBZ
cord-002369-shk4n8f6	284	65	the	the	DT
cord-002369-shk4n8f6	284	66	mitochondrial	mitochondrial	JJ
cord-002369-shk4n8f6	284	67	translocation	translocation	NN
cord-002369-shk4n8f6	284	68	of	of	IN
cord-002369-shk4n8f6	284	69	Parkin	Parkin	NNP
cord-002369-shk4n8f6	284	70	and	and	CC
cord-002369-shk4n8f6	284	71	subsequent	subsequent	JJ
cord-002369-shk4n8f6	284	72	mitophagy	mitophagy	NN
cord-002369-shk4n8f6	284	73	Induction	Induction	NNP
cord-002369-shk4n8f6	284	74	of	of	IN
cord-002369-shk4n8f6	284	75	incomplete	incomplete	JJ
cord-002369-shk4n8f6	284	76	autophagic	autophagic	NN
cord-002369-shk4n8f6	284	77	response	response	NN
cord-002369-shk4n8f6	284	78	by	by	IN
cord-002369-shk4n8f6	284	79	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	284	80	C	C	NNP
cord-002369-shk4n8f6	284	81	virus	virus	NN
cord-002369-shk4n8f6	284	82	via	via	IN
cord-002369-shk4n8f6	284	83	the	the	DT
cord-002369-shk4n8f6	284	84	unfolded	unfolded	JJ
cord-002369-shk4n8f6	284	85	protein	protein	NN
cord-002369-shk4n8f6	284	86	response	response	NN
cord-002369-shk4n8f6	284	87	Activation	activation	NN
cord-002369-shk4n8f6	284	88	of	of	IN
cord-002369-shk4n8f6	284	89	the	the	DT
cord-002369-shk4n8f6	284	90	unfolded	unfolded	JJ
cord-002369-shk4n8f6	284	91	protein	protein	NN
cord-002369-shk4n8f6	284	92	response	response	NN
cord-002369-shk4n8f6	284	93	and	and	CC
cord-002369-shk4n8f6	284	94	autophagy	autophagy	NN
cord-002369-shk4n8f6	284	95	after	after	IN
cord-002369-shk4n8f6	284	96	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	284	97	C	C	NNP
cord-002369-shk4n8f6	284	98	virus	virus	NN
cord-002369-shk4n8f6	284	99	infection	infection	NN
cord-002369-shk4n8f6	284	100	suppresses	suppress	VBZ
cord-002369-shk4n8f6	284	101	innate	innate	JJ
cord-002369-shk4n8f6	284	102	antiviral	antiviral	JJ
cord-002369-shk4n8f6	284	103	immunity	immunity	NN
cord-002369-shk4n8f6	284	104	in	in	IN
cord-002369-shk4n8f6	284	105	vitro	vitro	FW
cord-002369-shk4n8f6	284	106	HCV	HCV	NNP
cord-002369-shk4n8f6	284	107	infection	infection	NN
cord-002369-shk4n8f6	285	1	selectively	selectively	RB
cord-002369-shk4n8f6	285	2	impairs	impair	VBZ
cord-002369-shk4n8f6	285	3	type	type	NN
cord-002369-shk4n8f6	285	4	I	-PRON-	PRP
cord-002369-shk4n8f6	285	5	but	but	CC
cord-002369-shk4n8f6	285	6	not	not	RB
cord-002369-shk4n8f6	285	7	type	type	NN
cord-002369-shk4n8f6	285	8	III	III	NNP
cord-002369-shk4n8f6	285	9	IFN	IFN	NNP
cord-002369-shk4n8f6	285	10	signaling	signal	VBG
cord-002369-shk4n8f6	285	11	Hepatitis	Hepatitis	NNP
cord-002369-shk4n8f6	285	12	C	C	NNP
cord-002369-shk4n8f6	285	13	virus	virus	NN
cord-002369-shk4n8f6	285	14	core	core	NN
cord-002369-shk4n8f6	285	15	protein	protein	NN
cord-002369-shk4n8f6	285	16	activates	activate	VBZ
cord-002369-shk4n8f6	285	17	autophagy	autophagy	NN
cord-002369-shk4n8f6	285	18	through	through	IN
cord-002369-shk4n8f6	285	19	EIF2AK3	EIF2AK3	NNP
cord-002369-shk4n8f6	285	20	and	and	CC
cord-002369-shk4n8f6	285	21	ATF6	ATF6	NNP
cord-002369-shk4n8f6	285	22	UPR	UPR	NNP
cord-002369-shk4n8f6	285	23	pathway	pathway	NN
cord-002369-shk4n8f6	285	24	-	-	HYPH
cord-002369-shk4n8f6	285	25	mediated	mediate	VBN
cord-002369-shk4n8f6	285	26	MAP1LC3B	map1lc3b	NN
cord-002369-shk4n8f6	285	27	and	and	CC
cord-002369-shk4n8f6	285	28	ATG12	atg12	JJ
cord-002369-shk4n8f6	285	29	expression	expression	NN
cord-002369-shk4n8f6	286	1	Hepatitis	Hepatitis	NNP
cord-002369-shk4n8f6	286	2	C	C	NNP
cord-002369-shk4n8f6	286	3	virus	virus	NN
cord-002369-shk4n8f6	286	4	-	-	HYPH
cord-002369-shk4n8f6	286	5	induced	induce	VBN
cord-002369-shk4n8f6	286	6	autophagy	autophagy	NN
cord-002369-shk4n8f6	286	7	is	be	VBZ
cord-002369-shk4n8f6	286	8	independent	independent	JJ
cord-002369-shk4n8f6	286	9	of	of	IN
cord-002369-shk4n8f6	286	10	the	the	DT
cord-002369-shk4n8f6	286	11	unfolded	unfolded	JJ
cord-002369-shk4n8f6	286	12	protein	protein	NN
cord-002369-shk4n8f6	286	13	response	response	NN
cord-002369-shk4n8f6	286	14	IRGM	IRGM	NNP
cord-002369-shk4n8f6	286	15	is	be	VBZ
cord-002369-shk4n8f6	286	16	a	a	DT
cord-002369-shk4n8f6	286	17	common	common	JJ
cord-002369-shk4n8f6	286	18	target	target	NN
cord-002369-shk4n8f6	286	19	of	of	IN
cord-002369-shk4n8f6	286	20	RNA	RNA	NNP
cord-002369-shk4n8f6	286	21	viruses	virus	NNS
cord-002369-shk4n8f6	286	22	that	that	WDT
cord-002369-shk4n8f6	286	23	subvert	subvert	VBP
cord-002369-shk4n8f6	286	24	the	the	DT
cord-002369-shk4n8f6	286	25	autophagy	autophagy	NN
cord-002369-shk4n8f6	286	26	network	network	NN
cord-002369-shk4n8f6	286	27	Knockdown	Knockdown	NNP
cord-002369-shk4n8f6	286	28	of	of	IN
cord-002369-shk4n8f6	286	29	autophagy	autophagy	NN
cord-002369-shk4n8f6	286	30	enhances	enhance	VBZ
cord-002369-shk4n8f6	286	31	the	the	DT
cord-002369-shk4n8f6	286	32	innate	innate	JJ
cord-002369-shk4n8f6	286	33	immune	immune	JJ
cord-002369-shk4n8f6	286	34	response	response	NN
cord-002369-shk4n8f6	286	35	in	in	IN
cord-002369-shk4n8f6	286	36	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	286	37	C	C	NNP
cord-002369-shk4n8f6	286	38	virus	virus	NN
cord-002369-shk4n8f6	286	39	-	-	HYPH
cord-002369-shk4n8f6	286	40	infected	infect	VBN
cord-002369-shk4n8f6	286	41	hepatocytes	hepatocyte	NNS
cord-002369-shk4n8f6	287	1	The	the	DT
cord-002369-shk4n8f6	287	2	autophagy	autophagy	NN
cord-002369-shk4n8f6	287	3	machinery	machinery	NN
cord-002369-shk4n8f6	287	4	is	be	VBZ
cord-002369-shk4n8f6	287	5	required	require	VBN
cord-002369-shk4n8f6	287	6	to	to	TO
cord-002369-shk4n8f6	287	7	initiate	initiate	VB
cord-002369-shk4n8f6	287	8	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	287	9	C	C	NNP
cord-002369-shk4n8f6	287	10	virus	virus	NN
cord-002369-shk4n8f6	287	11	replication	replication	NN
cord-002369-shk4n8f6	287	12	Knockdown	Knockdown	NNP
cord-002369-shk4n8f6	287	13	of	of	IN
cord-002369-shk4n8f6	287	14	autophagy	autophagy	NN
cord-002369-shk4n8f6	287	15	-	-	HYPH
cord-002369-shk4n8f6	287	16	related	relate	VBN
cord-002369-shk4n8f6	287	17	gene	gene	NN
cord-002369-shk4n8f6	287	18	decreases	decrease	VBZ
cord-002369-shk4n8f6	287	19	the	the	DT
cord-002369-shk4n8f6	287	20	production	production	NN
cord-002369-shk4n8f6	287	21	of	of	IN
cord-002369-shk4n8f6	287	22	infectious	infectious	JJ
cord-002369-shk4n8f6	287	23	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	287	24	C	c	NN
cord-002369-shk4n8f6	287	25	virus	virus	NN
cord-002369-shk4n8f6	287	26	particles	particle	VBZ
cord-002369-shk4n8f6	287	27	Dissection	dissection	NN
cord-002369-shk4n8f6	287	28	of	of	IN
cord-002369-shk4n8f6	287	29	autophagosome	autophagosome	JJ
cord-002369-shk4n8f6	287	30	formation	formation	NN
cord-002369-shk4n8f6	287	31	using	use	VBG
cord-002369-shk4n8f6	287	32	Apg5-deficient	Apg5-deficient	NNP
cord-002369-shk4n8f6	287	33	mouse	mouse	NN
cord-002369-shk4n8f6	287	34	embryonic	embryonic	JJ
cord-002369-shk4n8f6	287	35	stem	stem	NN
cord-002369-shk4n8f6	287	36	cells	cell	NNS
cord-002369-shk4n8f6	287	37	Autophagy	Autophagy	NNP
cord-002369-shk4n8f6	287	38	protein	protein	NN
cord-002369-shk4n8f6	287	39	ATG5	ATG5	NNP
cord-002369-shk4n8f6	287	40	interacts	interact	VBZ
cord-002369-shk4n8f6	287	41	transiently	transiently	RB
cord-002369-shk4n8f6	287	42	with	with	IN
cord-002369-shk4n8f6	287	43	the	the	DT
cord-002369-shk4n8f6	287	44	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	287	45	C	C	NNP
cord-002369-shk4n8f6	287	46	virus	virus	NN
cord-002369-shk4n8f6	287	47	RNA	rna	NN
cord-002369-shk4n8f6	287	48	polymerase	polymerase	NN
cord-002369-shk4n8f6	287	49	(	(	-LRB-
cord-002369-shk4n8f6	287	50	NS5B	ns5b	UH
cord-002369-shk4n8f6	287	51	)	)	-RRB-
cord-002369-shk4n8f6	287	52	early	early	RB
cord-002369-shk4n8f6	287	53	during	during	IN
cord-002369-shk4n8f6	287	54	infection	infection	NN
cord-002369-shk4n8f6	287	55	Mouse	Mouse	NNP
cord-002369-shk4n8f6	287	56	Apg16L	Apg16L	NNP
cord-002369-shk4n8f6	287	57	,	,	,
cord-002369-shk4n8f6	287	58	a	a	DT
cord-002369-shk4n8f6	287	59	novel	novel	NN
cord-002369-shk4n8f6	287	60	WD	WD	NNP
cord-002369-shk4n8f6	287	61	-	-	HYPH
cord-002369-shk4n8f6	287	62	repeat	repeat	NN
cord-002369-shk4n8f6	287	63	protein	protein	NN
cord-002369-shk4n8f6	287	64	,	,	,
cord-002369-shk4n8f6	287	65	targets	target	NNS
cord-002369-shk4n8f6	287	66	to	to	IN
cord-002369-shk4n8f6	287	67	the	the	DT
cord-002369-shk4n8f6	287	68	autophagic	autophagic	JJ
cord-002369-shk4n8f6	287	69	isolation	isolation	NN
cord-002369-shk4n8f6	287	70	membrane	membrane	NN
cord-002369-shk4n8f6	287	71	with	with	IN
cord-002369-shk4n8f6	287	72	the	the	DT
cord-002369-shk4n8f6	287	73	Apg12-Apg5	Apg12-Apg5	NNP
cord-002369-shk4n8f6	287	74	conjugate	conjugate	NN
cord-002369-shk4n8f6	287	75	Generation	generation	NN
cord-002369-shk4n8f6	287	76	of	of	IN
cord-002369-shk4n8f6	287	77	cell	cell	NN
cord-002369-shk4n8f6	287	78	lines	line	NNS
cord-002369-shk4n8f6	287	79	with	with	IN
cord-002369-shk4n8f6	287	80	tetracycline	tetracycline	NN
cord-002369-shk4n8f6	287	81	-	-	HYPH
cord-002369-shk4n8f6	287	82	regulated	regulate	VBN
cord-002369-shk4n8f6	287	83	autophagy	autophagy	NN
cord-002369-shk4n8f6	287	84	and	and	CC
cord-002369-shk4n8f6	287	85	a	a	DT
cord-002369-shk4n8f6	287	86	role	role	NN
cord-002369-shk4n8f6	287	87	for	for	IN
cord-002369-shk4n8f6	287	88	autophagy	autophagy	NN
cord-002369-shk4n8f6	287	89	in	in	IN
cord-002369-shk4n8f6	287	90	controlling	control	VBG
cord-002369-shk4n8f6	287	91	cell	cell	NN
cord-002369-shk4n8f6	287	92	size	size	NN
cord-002369-shk4n8f6	287	93	Molecular	molecular	JJ
cord-002369-shk4n8f6	287	94	mechanism	mechanism	NN
cord-002369-shk4n8f6	287	95	of	of	IN
cord-002369-shk4n8f6	287	96	autophagic	autophagic	NNP
cord-002369-shk4n8f6	287	97	membrane	membrane	NN
cord-002369-shk4n8f6	287	98	-	-	HYPH
cord-002369-shk4n8f6	287	99	scaffold	scaffold	NN
cord-002369-shk4n8f6	287	100	assembly	assembly	NN
cord-002369-shk4n8f6	287	101	and	and	CC
cord-002369-shk4n8f6	287	102	disassembly	disassembly	NNP
cord-002369-shk4n8f6	287	103	Formation	Formation	NNP
cord-002369-shk4n8f6	287	104	of	of	IN
cord-002369-shk4n8f6	287	105	the	the	DT
cord-002369-shk4n8f6	287	106	approximately	approximately	RB
cord-002369-shk4n8f6	287	107	350-kDa	350-kda	CD
cord-002369-shk4n8f6	287	108	Apg12-Apg5.Apg16	Apg12-Apg5.Apg16	NNP
cord-002369-shk4n8f6	287	109	multimeric	multimeric	NNP
cord-002369-shk4n8f6	287	110	complex	complex	NN
cord-002369-shk4n8f6	287	111	,	,	,
cord-002369-shk4n8f6	287	112	mediated	mediate	VBN
cord-002369-shk4n8f6	287	113	by	by	IN
cord-002369-shk4n8f6	287	114	Apg16	Apg16	NNP
cord-002369-shk4n8f6	287	115	oligomerization	oligomerization	NN
cord-002369-shk4n8f6	287	116	,	,	,
cord-002369-shk4n8f6	287	117	is	be	VBZ
cord-002369-shk4n8f6	287	118	essential	essential	JJ
cord-002369-shk4n8f6	287	119	for	for	IN
cord-002369-shk4n8f6	287	120	autophagy	autophagy	NN
cord-002369-shk4n8f6	287	121	in	in	IN
cord-002369-shk4n8f6	287	122	yeast	yeast	NN
cord-002369-shk4n8f6	288	1	The	the	DT
cord-002369-shk4n8f6	288	2	autophagy	autophagy	NN
cord-002369-shk4n8f6	288	3	protein	protein	NN
cord-002369-shk4n8f6	288	4	Atg12	Atg12	NNP
cord-002369-shk4n8f6	288	5	associates	associate	NNS
cord-002369-shk4n8f6	288	6	with	with	IN
cord-002369-shk4n8f6	288	7	antiapoptotic	antiapoptotic	NNP
cord-002369-shk4n8f6	288	8	Bcl-2	Bcl-2	NNP
cord-002369-shk4n8f6	288	9	family	family	NN
cord-002369-shk4n8f6	288	10	members	member	NNS
cord-002369-shk4n8f6	288	11	to	to	TO
cord-002369-shk4n8f6	288	12	promote	promote	VB
cord-002369-shk4n8f6	288	13	mitochondrial	mitochondrial	JJ
cord-002369-shk4n8f6	288	14	apoptosis	apoptosis	NN
cord-002369-shk4n8f6	288	15	Methods	method	NNS
cord-002369-shk4n8f6	288	16	in	in	IN
cord-002369-shk4n8f6	288	17	mammalian	mammalian	JJ
cord-002369-shk4n8f6	288	18	autophagy	autophagy	NN
cord-002369-shk4n8f6	288	19	research	research	NN
cord-002369-shk4n8f6	288	20	Characterization	characterization	NN
cord-002369-shk4n8f6	288	21	of	of	IN
cord-002369-shk4n8f6	288	22	autophagosome	autophagosome	JJ
cord-002369-shk4n8f6	288	23	formation	formation	NN
cord-002369-shk4n8f6	288	24	site	site	NN
cord-002369-shk4n8f6	288	25	by	by	IN
cord-002369-shk4n8f6	288	26	a	a	DT
cord-002369-shk4n8f6	288	27	hierarchical	hierarchical	JJ
cord-002369-shk4n8f6	288	28	analysis	analysis	NN
cord-002369-shk4n8f6	288	29	of	of	IN
cord-002369-shk4n8f6	288	30	mammalian	mammalian	JJ
cord-002369-shk4n8f6	288	31	Atg	Atg	NNP
cord-002369-shk4n8f6	288	32	proteins	protein	NNS
cord-002369-shk4n8f6	288	33	Morphological	morphological	JJ
cord-002369-shk4n8f6	288	34	and	and	CC
cord-002369-shk4n8f6	288	35	biochemical	biochemical	JJ
cord-002369-shk4n8f6	288	36	characterization	characterization	NN
cord-002369-shk4n8f6	288	37	of	of	IN
cord-002369-shk4n8f6	288	38	the	the	DT
cord-002369-shk4n8f6	288	39	membranous	membranous	JJ
cord-002369-shk4n8f6	288	40	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	288	41	C	C	NNP
cord-002369-shk4n8f6	288	42	virus	virus	NN
cord-002369-shk4n8f6	288	43	replication	replication	NN
cord-002369-shk4n8f6	288	44	compartment	compartment	NN
cord-002369-shk4n8f6	288	45	Recruitment	Recruitment	NNP
cord-002369-shk4n8f6	288	46	and	and	CC
cord-002369-shk4n8f6	288	47	activation	activation	NN
cord-002369-shk4n8f6	288	48	of	of	IN
cord-002369-shk4n8f6	288	49	a	a	DT
cord-002369-shk4n8f6	288	50	lipid	lipid	NN
cord-002369-shk4n8f6	288	51	kinase	kinase	NN
cord-002369-shk4n8f6	288	52	by	by	IN
cord-002369-shk4n8f6	288	53	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	288	54	C	C	NNP
cord-002369-shk4n8f6	288	55	virus	virus	NN
cord-002369-shk4n8f6	289	1	NS5A	NS5A	NNP
cord-002369-shk4n8f6	289	2	is	be	VBZ
cord-002369-shk4n8f6	289	3	essential	essential	JJ
cord-002369-shk4n8f6	289	4	for	for	IN
cord-002369-shk4n8f6	289	5	integrity	integrity	NN
cord-002369-shk4n8f6	289	6	of	of	IN
cord-002369-shk4n8f6	289	7	the	the	DT
cord-002369-shk4n8f6	289	8	membranous	membranous	JJ
cord-002369-shk4n8f6	289	9	replication	replication	NN
cord-002369-shk4n8f6	289	10	compartment	compartment	NN
cord-002369-shk4n8f6	290	1	The	the	DT
cord-002369-shk4n8f6	290	2	lipid	lipid	NN
cord-002369-shk4n8f6	290	3	kinase	kinase	NN
cord-002369-shk4n8f6	290	4	phosphatidylinositol-4	phosphatidylinositol-4	NNP
cord-002369-shk4n8f6	290	5	kinase	kinase	NN
cord-002369-shk4n8f6	290	6	III	iii	CD
cord-002369-shk4n8f6	290	7	alpha	alpha	NN
cord-002369-shk4n8f6	290	8	regulates	regulate	VBZ
cord-002369-shk4n8f6	290	9	the	the	DT
cord-002369-shk4n8f6	290	10	phosphorylation	phosphorylation	NN
cord-002369-shk4n8f6	290	11	status	status	NN
cord-002369-shk4n8f6	290	12	of	of	IN
cord-002369-shk4n8f6	290	13	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	290	14	C	C	NNP
cord-002369-shk4n8f6	290	15	virus	virus	NN
cord-002369-shk4n8f6	291	1	NS5A	NS5A	NNP
cord-002369-shk4n8f6	292	1	Dissecting	dissect	VBG
cord-002369-shk4n8f6	292	2	the	the	DT
cord-002369-shk4n8f6	292	3	role	role	NN
cord-002369-shk4n8f6	292	4	of	of	IN
cord-002369-shk4n8f6	292	5	the	the	DT
cord-002369-shk4n8f6	292	6	Atg12-Atg5-Atg16	Atg12-Atg5-Atg16	NNP
cord-002369-shk4n8f6	292	7	complex	complex	NN
cord-002369-shk4n8f6	292	8	during	during	IN
cord-002369-shk4n8f6	292	9	autophagosome	autophagosome	JJ
cord-002369-shk4n8f6	292	10	formation	formation	NN
cord-002369-shk4n8f6	292	11	Mechanism	mechanism	NN
cord-002369-shk4n8f6	292	12	and	and	CC
cord-002369-shk4n8f6	292	13	functions	function	NNS
cord-002369-shk4n8f6	292	14	of	of	IN
cord-002369-shk4n8f6	292	15	membrane	membrane	NN
cord-002369-shk4n8f6	292	16	binding	bind	VBG
cord-002369-shk4n8f6	292	17	by	by	IN
cord-002369-shk4n8f6	292	18	the	the	DT
cord-002369-shk4n8f6	292	19	Atg5-Atg12	Atg5-Atg12	NNP
cord-002369-shk4n8f6	292	20	/	/	SYM
cord-002369-shk4n8f6	292	21	Atg16	Atg16	NNP
cord-002369-shk4n8f6	292	22	complex	complex	NN
cord-002369-shk4n8f6	292	23	during	during	IN
cord-002369-shk4n8f6	292	24	autophagosome	autophagosome	JJ
cord-002369-shk4n8f6	292	25	formation	formation	NN
cord-002369-shk4n8f6	292	26	Structures	structure	NNS
cord-002369-shk4n8f6	292	27	containing	contain	VBG
cord-002369-shk4n8f6	292	28	Atg9A	atg9a	NN
cord-002369-shk4n8f6	292	29	and	and	CC
cord-002369-shk4n8f6	292	30	the	the	DT
cord-002369-shk4n8f6	292	31	ULK1	ULK1	NNP
cord-002369-shk4n8f6	292	32	complex	complex	NN
cord-002369-shk4n8f6	293	1	independently	independently	RB
cord-002369-shk4n8f6	293	2	target	target	VB
cord-002369-shk4n8f6	293	3	depolarized	depolarize	VBN
cord-002369-shk4n8f6	293	4	mitochondria	mitochondrion	NNS
cord-002369-shk4n8f6	293	5	at	at	IN
cord-002369-shk4n8f6	293	6	initial	initial	JJ
cord-002369-shk4n8f6	293	7	stages	stage	NNS
cord-002369-shk4n8f6	293	8	of	of	IN
cord-002369-shk4n8f6	293	9	Parkin	Parkin	NNP
cord-002369-shk4n8f6	293	10	-	-	HYPH
cord-002369-shk4n8f6	293	11	mediated	mediate	VBN
cord-002369-shk4n8f6	293	12	mitophagy	mitophagy	NN
cord-002369-shk4n8f6	293	13	Novel	Novel	NNP
cord-002369-shk4n8f6	293	14	HCV	HCV	NNP
cord-002369-shk4n8f6	293	15	replication	replication	NN
cord-002369-shk4n8f6	293	16	mouse	mouse	NN
cord-002369-shk4n8f6	293	17	model	model	NN
cord-002369-shk4n8f6	293	18	using	use	VBG
cord-002369-shk4n8f6	293	19	human	human	JJ
cord-002369-shk4n8f6	293	20	hepatocellular	hepatocellular	JJ
cord-002369-shk4n8f6	293	21	carcinoma	carcinoma	NN
cord-002369-shk4n8f6	293	22	xenografts	xenograft	NNS
cord-002369-shk4n8f6	294	1	SKI-1	SKI-1	NNS
cord-002369-shk4n8f6	294	2	/	/	SYM
cord-002369-shk4n8f6	294	3	S1P	s1p	NN
cord-002369-shk4n8f6	294	4	inhibitor	inhibitor	NN
cord-002369-shk4n8f6	294	5	PF-429242	PF-429242	NNP
cord-002369-shk4n8f6	294	6	impairs	impair	VBZ
cord-002369-shk4n8f6	294	7	the	the	DT
cord-002369-shk4n8f6	294	8	onset	onset	NN
cord-002369-shk4n8f6	294	9	of	of	IN
cord-002369-shk4n8f6	294	10	HCV	HCV	NNP
cord-002369-shk4n8f6	294	11	infection	infection	NN
cord-002369-shk4n8f6	294	12	SKI-1	SKI-1	NNP
cord-002369-shk4n8f6	294	13	/	/	SYM
cord-002369-shk4n8f6	294	14	S1P	s1p	NN
cord-002369-shk4n8f6	294	15	inhibition	inhibition	NN
cord-002369-shk4n8f6	294	16	:	:	:
cord-002369-shk4n8f6	294	17	a	a	DT
cord-002369-shk4n8f6	294	18	promising	promise	VBG
cord-002369-shk4n8f6	294	19	surrogate	surrogate	NN
cord-002369-shk4n8f6	294	20	to	to	IN
cord-002369-shk4n8f6	294	21	statins	statin	NNS
cord-002369-shk4n8f6	294	22	to	to	TO
cord-002369-shk4n8f6	294	23	block	block	VB
cord-002369-shk4n8f6	294	24	hepatitis	hepatitis	NN
cord-002369-shk4n8f6	294	25	C	c	NN
cord-002369-shk4n8f6	294	26	virus	virus	NN
cord-002369-shk4n8f6	294	27	replication	replication	NN
cord-002369-shk4n8f6	295	1	We	-PRON-	PRP
cord-002369-shk4n8f6	295	2	thank	thank	VBP
cord-002369-shk4n8f6	295	3	Dr.	Dr.	NNP
cord-002369-shk4n8f6	295	4	Takaji	Takaji	NNP
cord-002369-shk4n8f6	295	5	Wakita	Wakita	NNP
cord-002369-shk4n8f6	295	6	for	for	IN
cord-002369-shk4n8f6	295	7	providing	provide	VBG
cord-002369-shk4n8f6	295	8	the	the	DT
cord-002369-shk4n8f6	295	9	HCV	HCV	NNP
cord-002369-shk4n8f6	295	10	JFH-1	JFH-1	NNP
cord-002369-shk4n8f6	295	11	and	and	CC
cord-002369-shk4n8f6	295	12	the	the	DT
cord-002369-shk4n8f6	295	13	anti	anti	JJ
cord-002369-shk4n8f6	295	14	-	-	JJ
cord-002369-shk4n8f6	295	15	NS5B	ns5b	JJ
cord-002369-shk4n8f6	295	16	antibody	antibody	NN
cord-002369-shk4n8f6	295	17	.	.	.
cord-002369-shk4n8f6	296	1	The	the	DT
cord-002369-shk4n8f6	296	2	Huh7-Lunet	Huh7-Lunet	NNP
cord-002369-shk4n8f6	296	3	,	,	,
cord-002369-shk4n8f6	296	4	NS4B	NS4B	NNP
cord-002369-shk4n8f6	296	5	HAreplication	HAreplication	NNP
cord-002369-shk4n8f6	296	6	and	and	CC
cord-002369-shk4n8f6	296	7	CANX	CANX	NNP
cord-002369-shk4n8f6	296	8	HA	HA	NNP
cord-002369-shk4n8f6	296	9	cells	cell	NNS
cord-002369-shk4n8f6	296	10	were	be	VBD
cord-002369-shk4n8f6	296	11	generously	generously	RB
cord-002369-shk4n8f6	296	12	provided	provide	VBN
cord-002369-shk4n8f6	296	13	by	by	IN
cord-002369-shk4n8f6	296	14	Dr.	Dr.	NNP
cord-002369-shk4n8f6	296	15	Ralf	Ralf	NNP
cord-002369-shk4n8f6	296	16	Bartenschlager	Bartenschlager	NNP
cord-002369-shk4n8f6	296	17	.	.	.
cord-002369-shk4n8f6	297	1	The	the	DT
cord-002369-shk4n8f6	297	2	Huh7-Lunet	Huh7-Lunet	NNP
cord-002369-shk4n8f6	297	3	-	-	HYPH
cord-002369-shk4n8f6	297	4	T7	t7	NN
cord-002369-shk4n8f6	297	5	cells	cell	NNS
cord-002369-shk4n8f6	297	6	and	and	CC
cord-002369-shk4n8f6	297	7	the	the	DT
cord-002369-shk4n8f6	297	8	pTM	pTM	NNP
cord-002369-shk4n8f6	297	9	-	-	HYPH
cord-002369-shk4n8f6	297	10	NS3	ns3	RB
cord-002369-shk4n8f6	297	11	-	-	HYPH
cord-002369-shk4n8f6	297	12	5B	5b	NN
cord-002369-shk4n8f6	297	13	vector	vector	NN
cord-002369-shk4n8f6	297	14	were	be	VBD
cord-002369-shk4n8f6	297	15	provided	provide	VBN
cord-002369-shk4n8f6	297	16	by	by	IN
cord-002369-shk4n8f6	297	17	Dr.	Dr.	NNP
cord-002369-shk4n8f6	297	18	Volker	Volker	NNP
cord-002369-shk4n8f6	297	19	Lohmann	Lohmann	NNP
cord-002369-shk4n8f6	297	20	.	.	.
cord-002369-shk4n8f6	298	1	We	-PRON-	PRP
cord-002369-shk4n8f6	298	2	are	be	VBP
cord-002369-shk4n8f6	298	3	also	also	RB
cord-002369-shk4n8f6	298	4	grateful	grateful	JJ
cord-002369-shk4n8f6	298	5	to	to	IN
cord-002369-shk4n8f6	298	6	Dr.	Dr.	NNP
cord-002369-shk4n8f6	298	7	Kouacou	Kouacou	NNP
cord-002369-shk4n8f6	298	8	Konan	Konan	NNP
cord-002369-shk4n8f6	298	9	for	for	IN
cord-002369-shk4n8f6	298	10	providing	provide	VBG
cord-002369-shk4n8f6	298	11	the	the	DT
cord-002369-shk4n8f6	298	12	anti	anti	JJ
cord-002369-shk4n8f6	298	13	-	-	JJ
cord-002369-shk4n8f6	298	14	NS4B	ns4b	JJ
cord-002369-shk4n8f6	298	15	antibody	antibody	NN
cord-002369-shk4n8f6	298	16	and	and	CC
cord-002369-shk4n8f6	298	17	Dr.	Dr.	NNP
cord-002369-shk4n8f6	298	18	Adi	Adi	NNP
cord-002369-shk4n8f6	298	19	Kimchi	Kimchi	NNP
cord-002369-shk4n8f6	298	20	for	for	IN
cord-002369-shk4n8f6	298	21	providing	provide	VBG
cord-002369-shk4n8f6	298	22	the	the	DT
cord-002369-shk4n8f6	298	23	ATG12	ATG12	NNP
cord-002369-shk4n8f6	298	24	and	and	CC
cord-002369-shk4n8f6	298	25	ATG12Δ	ATG12Δ	NNP
cord-002369-shk4n8f6	298	26	G140	G140	NNP
cord-002369-shk4n8f6	298	27	plasmids	plasmid	NNS
cord-002369-shk4n8f6	298	28	.	.	.
cord-002369-shk4n8f6	299	1	We	-PRON-	PRP
cord-002369-shk4n8f6	299	2	also	also	RB
cord-002369-shk4n8f6	299	3	thank	thank	VBP
cord-002369-shk4n8f6	299	4	Dr.	Dr.	NNP
cord-002369-shk4n8f6	299	5	Hojatollah	Hojatollah	NNP
cord-002369-shk4n8f6	299	6	Vali	Vali	NNP
cord-002369-shk4n8f6	299	7	and	and	CC
cord-002369-shk4n8f6	299	8	his	-PRON-	PRP$
cord-002369-shk4n8f6	299	9	group	group	NN
cord-002369-shk4n8f6	299	10	for	for	IN
cord-002369-shk4n8f6	299	11	performing	perform	VBG
cord-002369-shk4n8f6	299	12	TEM	TEM	NNP
cord-002369-shk4n8f6	299	13	with	with	IN
cord-002369-shk4n8f6	299	14	AF	AF	NNP
cord-002369-shk4n8f6	299	15	.	.	.
cord-002369-shk4n8f6	300	1	In	in	IN
cord-002369-shk4n8f6	300	2	addition	addition	NN
cord-002369-shk4n8f6	300	3	,	,	,
cord-002369-shk4n8f6	300	4	we	-PRON-	PRP
cord-002369-shk4n8f6	300	5	thank	thank	VBP
cord-002369-shk4n8f6	300	6	David	David	NNP
cord-002369-shk4n8f6	300	7	Paul	Paul	NNP
cord-002369-shk4n8f6	300	8	,	,	,
cord-002369-shk4n8f6	300	9	Jessy	Jessy	NNP
cord-002369-shk4n8f6	300	10	Tremblay	Tremblay	NNP
cord-002369-shk4n8f6	300	11	and	and	CC
cord-002369-shk4n8f6	300	12	Micheline	Micheline	NNP
cord-002369-shk4n8f6	300	13	Letarte	Letarte	NNP
cord-002369-shk4n8f6	300	14	for	for	IN
cord-002369-shk4n8f6	300	15	technical	technical	JJ
cord-002369-shk4n8f6	300	16	assistance	assistance	NN
cord-002369-shk4n8f6	300	17	.	.	.
cord-002369-shk4n8f6	301	1	This	this	DT
cord-002369-shk4n8f6	301	2	work	work	NN
cord-002369-shk4n8f6	301	3	was	be	VBD
cord-002369-shk4n8f6	301	4	supported	support	VBN
cord-002369-shk4n8f6	301	5	by	by	IN
cord-002369-shk4n8f6	301	6	a	a	DT
cord-002369-shk4n8f6	301	7	research	research	NN
cord-002369-shk4n8f6	301	8	grant	grant	NN
cord-002369-shk4n8f6	301	9	from	from	IN
cord-002369-shk4n8f6	301	10	the	the	DT
cord-002369-shk4n8f6	301	11	NSERC	NSERC	NNP
cord-002369-shk4n8f6	301	12	of	of	IN
cord-002369-shk4n8f6	301	13	Canada	Canada	NNP
cord-002369-shk4n8f6	301	14	.	.	.
cord-002369-shk4n8f6	302	1	AF	AF	NNP
cord-002369-shk4n8f6	302	2	received	receive	VBD
cord-002369-shk4n8f6	302	3	fellowships	fellowship	NNS
cord-002369-shk4n8f6	302	4	from	from	IN
cord-002369-shk4n8f6	302	5	the	the	DT
cord-002369-shk4n8f6	302	6	NCRTP	NCRTP	NNP
cord-002369-shk4n8f6	302	7	-	-	HYPH
cord-002369-shk4n8f6	302	8	HepC.	HepC.	NNP
cord-002369-shk4n8f6	302	9	A.F.	A.F.	NNP
cord-002369-shk4n8f6	302	10	and	and	CC
cord-002369-shk4n8f6	302	11	P.L.	P.L.	NNP
cord-002369-shk4n8f6	302	12	designed	design	VBD
cord-002369-shk4n8f6	302	13	the	the	DT
cord-002369-shk4n8f6	302	14	study	study	NN
cord-002369-shk4n8f6	302	15	.	.	.
cord-002369-shk4n8f6	303	1	A.F.	A.F.	NNP
cord-002369-shk4n8f6	303	2	performed	perform	VBD
cord-002369-shk4n8f6	303	3	the	the	DT
cord-002369-shk4n8f6	303	4	experiments	experiment	NNS
cord-002369-shk4n8f6	303	5	.	.	.
cord-002369-shk4n8f6	304	1	A.F.	A.F.	NNP
cord-002369-shk4n8f6	304	2	and	and	CC
cord-002369-shk4n8f6	304	3	P.L.	P.L.	NNP
cord-002369-shk4n8f6	304	4	analyzed	analyze	VBD
cord-002369-shk4n8f6	304	5	the	the	DT
cord-002369-shk4n8f6	304	6	data	datum	NNS
cord-002369-shk4n8f6	304	7	and	and	CC
cord-002369-shk4n8f6	304	8	wrote	write	VBD
cord-002369-shk4n8f6	304	9	the	the	DT
cord-002369-shk4n8f6	304	10	manuscript	manuscript	NN
cord-002369-shk4n8f6	304	11	.	.	.
cord-002369-shk4n8f6	305	1	Supplementary	supplementary	JJ
cord-002369-shk4n8f6	305	2	information	information	NN
cord-002369-shk4n8f6	305	3	accompanies	accompany	VBZ
cord-002369-shk4n8f6	305	4	this	this	DT
cord-002369-shk4n8f6	305	5	paper	paper	NN
cord-002369-shk4n8f6	305	6	at	at	IN
cord-002369-shk4n8f6	305	7	http://www.nature.com/srep	http://www.nature.com/srep	NNP
cord-002369-shk4n8f6	305	8	 	 	_SP