key: cord-356364-ipi81ce3
authors: Ho, Bo-Lin; Cheng, Shu-Chun; Shi, Lin; Wang, Ting-Yun; Ho, Kuan-I; Chou, Chi-Yuan
title: Critical Assessment of the Important Residues Involved in the Dimerization and Catalysis of MERS Coronavirus Main Protease
date: 2015-12-14
journal: PLoS One
DOI: 10.1371/journal.pone.0144865
sha: 
doc_id: 356364
cord_uid: ipi81ce3

BACKGROUND: A highly pathogenic human coronavirus (CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), has emerged in Jeddah and other places in Saudi Arabia, and has quickly spread to European and Asian countries since September 2012. Up to the 1(st) October 2015 it has infected at least 1593 people with a global fatality rate of about 35%. Studies to understand the virus are necessary and urgent. In the present study, MERS-CoV main protease (M(pro)) is expressed; the dimerization of the protein and its relationship to catalysis are investigated. METHODS AND RESULTS: The crystal structure of MERS-CoV M(pro) indicates that it shares a similar scaffold to that of other coronaviral M(pro) and consists of chymotrypsin-like domains I and II and a helical domain III of five helices. Analytical ultracentrifugation analysis demonstrated that MERS-CoV M(pro) undergoes a monomer to dimer conversion in the presence of a peptide substrate. Glu169 is a key residue and plays a dual role in both dimerization and catalysis. The mutagenesis of other residues found on the dimerization interface indicate that dimerization of MERS-CoV M(pro) is required for its catalytic activity. One mutation, M298R, resulted in a stable dimer with a higher level of proteolytic activity than the wild-type enzyme. CONCLUSIONS: MERS-CoV M(pro) shows substrate-induced dimerization and potent proteolytic activity. A critical assessment of the residues important to these processes provides insights into the correlation between dimerization and catalysis within the coronaviral M(pro) family.

A highly pathogenic human coronavirus (CoV) 1 , Middle East respiratory syndrome coronavirus (MERS-CoV), emerged in Jeddah and other places in Saudi Arabia in September 2012 and purification, the codons of the thrombin cutting recognition sequence and a NdeI cutting site were removed and then inserted the codons of Leu-Arg-Leu-Lys-Gly-Gly into the above vector. The forward primer sequence for site-directed mutagenesis was 5'-CATCACAGCAGCGGCCT GCGTCTGAAAGGCGGCAGCGGTTTGGTGAAAATG-3' and the reverse primer was 5'-CATTTT CACCAAACCGCTGCCGCCTTTC AGACGCAGGCCGCTGCTGTGATG-3'. The reading frame of the final plasmid was confirmed by sequencing.

The expression vector was transformed into E. coli BL21 (DE3) cells (Novagen). Cultures were grown in 0.8 liters of LB medium at 37°C for 4 h, induced with 0.4 mM isopropyl-β-D -thiogalactopyranoside, and then incubated overnight at 20°C. After centrifuging at 6,000 x g at 4°C for 15 min, the cell pellets were resuspended in lysis buffer (20 mM Tris, pH 8.5, 250 mM NaCl, 5% glycerol, 0.2% Triton X-100, and 2 mM β-mercaptoethanol) and then lysed by sonication. The crude extract was then centrifuged at 12,000 x g at 4°C for 25 min to remove the insoluble pellet. Next the supernatant was incubated with 1-ml Ni-NTA beads at 4°C for 1 h and then loaded onto an empty column. After allowing the supernatant to flow through, the beads were washed with washing buffer (20 mM Tris, pH 8.5, 250 mM NaCl, 8 mM imidazole, and 2 mM β-mercaptoethanol). The SARS-CoV papain-like protease [12] (1 mg in 100 mM phosphate buffer (pH 6.5)) was then added and incubated for 3 h. The SARS-CoV papain-like protease digestion, which removed the 6 x His tag and Leu-Arg-Leu-Lys-Gly-Gly fragment, resulted in a native protein product with an authentic N-terminus. The digest was allowed to flow through and then loaded onto a S-100 gel-filtration column (GE Healthcare) equilibrated with running buffer (20 mM Tris, pH 8.5, 100 mM NaCl, and 2 mM dithiothreitol). The purity of the fractions collected was analyzed by SDS-PAGE and the protein was concentrated to 30 mg/ml by Amicon Ultra-4 10-kDa centrifugal filter (Millipore).

Crystals of the MERS-CoV M pro were obtained at 295 K by the sitting-drop vapor-diffusion method. The protein solution was set up at 5 mg/ml and the reservoir solution consisted of 0.1 M Tris, pH 8.4, 15% (w/v) PEG 4000 and 0.2 M sodium acetate. Clusters of needle crystals appeared in 2 days and were used for micro-seeding. Single cystals of rectangle shape and with dimensions of 0.3-0.5 mm were obtained in less than a week. All crystals were cryoprotected in the reservoir solution with 15% glycerol and were flash-cooled in liquid nitrogen.

Data collection, structure determination and refinement X-ray diffraction data were collected at 100 K on the SPXF beamline 13C1 at the National Synchrotron Radiation Research Center, Taiwan, ROC, using a ADSC Quantum-315r CCD detector (X-ray wavelength of 0.976 Å). The diffraction images were processed and scaled using the HKL-2000 package [23] . The structure was solved by the molecular replacement method by Phaser [24] using the structure of SARS-CoV M pro R298A mutant (PDB entry 4hi3; [25] ) as the search model. Manual rebuilding of the structure model was performed using Coot [26] . Structure refinement was carried out using REFMAC [27] . The data-processing and refinement has been deposited in the Protein Data Bank (PDB entry 5c3n).

The colorimetry-based peptide substrate, TSAVLQ-para-nitroanilide (TQ6-pNA) (purity 95-99% by HPLC; GL Biochem Ltd, Shanghai, China), was used to measure the proteolytic activity of MERS-CoV M pro and its mutants throughout the course of the study as described previously [25, 28] . This substrate is cleaved at the Gln-pNA bond to release free pNA, resulting in an increase in absorbance at 405 nm. The absorbance at 405 nm was continuously monitored using a Jasco V-550 UV/VIS spectrophotometer. The protease activity assay was performed in 10 mM phosphate (pH 7.6) at 30°C. The substrate stock solution was 1600 μM and the working concentrations were from 25 to 1200 μM. In the substrate titration assay, the concentration of MERS-CoV M pro and its mutants, V4R, T126S, E169A, M298R and T126S/M298R was 0.3, 0.4, 0.7, 1.2, 0.15 and 0.26 μM, respectively, while that of SARS-CoV M pro was 1.1 μM. Steady state enzyme kinetic parameters were obtained by fitting the initial velocity (ν 0 ) data to the Michaelis-Menten Eq (1)

where k cat is the catalytic constant, [E] is the enzyme concentration, [S] is the substrate concentration and K m is the Michaelis constant of the substrate. The program SigmaPlot (Systat Software, Inc., Richmond, CA) was used for the data analysis.

To assess the cooperativity effect, the kinetic parameters were obtained by fitting the initial velocities to the Hill Eq (2)

where K' is a constant that is related to the dissociation constant and h is the Hill constant.

AUC was performed on a XL-A analytical ultracentrifuge (Beckman Coulter) using an An-50 Ti rotor [11, 12, 25, [28] [29] [30] . The sedimentation velocity experiments were carried out using a double-sector epon charcoal-filled centerpiece at 20°C with a rotor speed of 42,000 rpm. Protein solutions of 0.05 to 0.5 mg/ml (330 μl) and reference (370 μl) solutions, both containing D 2 O, were loaded into the centerpiece. The absorbance at 280 nm was monitored in a continuous mode with a time interval of 300 s and a step size of 0.003 cm. Multiple scans at different time intervals were then fitted to a continuous c(s) distribution model using the SEDFIT program [31] . Additionally, the results with the various different protein concentrations were globally fitted to a monomer-dimer self-association model using the SEDPHAT program to calculate the dissociation constant (K d ) [32] .

To measure the substrate-induced dimerization, the active enzyme centrifugation (AEC) [33] was performed. Briefly, MERS-CoV M pro of 15 μl (1 mg/ml) was added into the small well of the band-forming centerpiece before the cell assembled. Then 330 μl of peptide substrate at 0, 200 and 400 μM in D 2 O were respectively loaded into the bulk sample sector space. At a rotor speed of 42,000 rpm, the protein solution flowed into the substrate-containing channel and form a protein band. It can be detected by absorbance at 250 nm. During the centrifugation, the sediment protein continuously met and cleaved the substrate, which can be detected by absorbance change at 405 nm. The dataset from the multiple scans at 250 nm at various time intervals were fitted to a continuous c(s) distribution model using the SEDFIT program [31] , while the first five scans (0-30 min) at 405 nm were used to derive the product concentration and then initial velocity values.

The protocol followed that of previous studies [28] with some modifications. Apparent dissociation constants and stoichiometry of the enzyme-ligand interactions were measured by a Thermal Activity Monitor 2277 from TA instruments (New Castle, DE). Calorimetric titrations of the peptide substrate TQ6-pNA (0.5 mM in a 250-μl syringe) and M pro (6 μM in a 4-ml ampoule) were carried out at 25°C in 10 mM phosphate buffer (pH 7.6). The peptides were titrated into the enzyme using a 10-μl aliquot for each injection with a time interval of 20 min. A control experiment in the absence of enzyme was performed in parallel to correct for the dilution of heat. The data obtained was then analyzed by integrating the heat effects normalized against the amount of injected protein using curve-fitting based on a 1:1 binding model. This involved the use of Digitam software (TA instruments, New Castle, DE).

As part of the present study, an expression vector was constructed and the BL21 (DE3) STAR (Invitrogen) strain of E. coli were used to express MERS-CoV M pro . Unlike SARS-CoV M pro [25, 28] , the MERS-CoV M pro with 6 x His-tag retained at the C-terminus cannot be expressed. Instead, the bacteria are able to express the M pro when there is a N-terminal 6 x His-tag fusion that can be removed during the purification. However, thrombin digestion leaves two extra residues (Gly-Ser) at the N-terminus of M pro , resulting in protein with no proteolytic activity (data not shown). Therefore we used SARS-CoV papain-like protease [12, 30, 34] , which is a highly active viral deubiquitinase and does not leave any residues at the N-terminus of M pro . After gel-filtration, the purity of authentic N-terminus M pro was about 99% (S2 Fig). The size of the MERS-CoV M pro was found to be close to 30 kDa, while any uncut protein was located at higher molecular weight position. The typical yield was about 10 mg after purification from 0.8 liter of E. coli culture.

The structure of the MERS-CoV M pro was determined at 3.0 Å resolution by X-ray crystallography (Table 1 and Fig 1A) . The crystal packing belonged to space group C222 1 , with unit-cell parameters a = 87.2, b = 94.0, c = 155.1 Å and α = β = γ = 90°. The final atomic model containing two M pro molecules in a crystallographic asymmetric unit agrees well with the crystallographic data and the expected values of geometric parameters (Table 1 ). There are no residues in the disallowed region of the Ramachandran plot, while 81.3% of the residues are in the most favored region.

The overall dimeric structure of M pro is similar to that of SARS-CoV M pro ; although a relative shift of 10°to 30°could be observed for the two domain III within the dimer (S3A Fig) . Indeed, the r.m.s. distance between equivalent Cα atoms of the domain I+II of the two structures is 0.9 Å, while that between the domain III of the two structures is 3.1 Å. Compared with the structures of the ligand-bound complex (PDB entry 4YLU) and C148A mutant (PDB entry 4WME) [14, 15] , the r. m. s. distance is 0.8 and 0.7 Å over 540 Cα atom pairs, respectively (S3B Fig) . This indicates that the dimeric structures show no significant difference; although the present structure is a free enzyme and the other two structures involve enzyme-ligand complexes and higher resolution. Besides, there is minor difference between the present structure and bat-CoV HKU4 M pro (PDB entry 2YNA), with 80% sequence identity, as the r. m. s. distance over 539 Cα atom pairs is 0.8 Å (S3B Fig). Interestingly, the dimerization interface situation with the MERS-CoV M pro was found to be different to that of SARS-CoV M pro where there are four amino acid pairs with intermolecular polar interactions (Ser1. . .Glu166, Arg4. . .Glu290, Ser123. . .Arg298 and Ser139. . .Gln299). There are only two pairs of intermolecular hydrogen bonds, Ser1. . .Glu169 and Ser142. . .Gln299 that are associated with the dimer surface of MERS-CoV M pro according to the current structure ( Fig 1B) . This led us to compare the dimerization and catalytic activity of the two types of M pro . In the present study, in addition to using the wild-type MERS-CoV M pro , we also mutated several residues at the dimerization interface in order to evaluate their role in dimerization and catalysis of MERS-CoV M pro (see below).

To compare catalysis between the two M pro , TQ6-pNA, a peptide substrate for SARS-CoV M pro [25, 28] , was used to measure the proteolytic activity. At first, the dependence of the initial Additional allowed region 13.6

Generously allowed region 5.2

Disallowed region 0 a The numbers in parentheses are for the highest-resolution shell.

where I hi is the integrated intensity of a given reflection and hI h i is the mean intensity of multiple corresponding symmetry-related reflections. velocity on enzyme concentration was analyzed and showed a nonlinear upward correlation (Fig 2A) . The pattern is similar to that of SARS-CoV M pro , as the monomeric M pro may not have catalytic activity [28] . However, MERS-CoV M pro displayed a sigmoid curve for its rate constant pattern at various substrate concentrations (Fig 2B, open circles) ; this contrast with SARS-CoV M pro , which exhibited a classical saturation curve (S4 Fig). The results were then fitted to the Hill equation (Eq 2) in order to evaluate the kinetic parameters ( Table 2 ). The k cat (2.33 s -1 ) of MERS-CoV M pro is close to that of SARS-CoV M pro (2.11 s -1 ), while the Hill constant was 1.8, suggesting a significant degree of positive cooperativity among the M pro protomers. The comparable activity levels of the two M pro in the present study is dissimilar to the results obtained during a recent study in which the activity of the MERS-CoV M pro was found to be 5-fold lower than that of SARS-CoV [14] . Using different substrates may cause the difference. Tomar et al. [14] used a longer peptide substrate with residues present at both P and P' Table 2 . site. However, in the present studies we used a peptide substrate that contains only P site residues. Besides, they utilized FRET substrate and could only be used at low substrate concentrations to prevent the inner-filter effect, while we are able to use higher substrate concentrations to capture the kinetic parameters.

The cooperativity phenomenon associated with the MERS-CoV M pro is similar to that of the SARS-CoV M pro R298A/L monomer mutants; these were found to show monomer to dimer conversion during catalysis [28] . As a result of the above, we investigated the quaternary structure of the M pro by AUC (Fig 3) . The cumulative spectra (Fig 3A) were analyzed using the continuous c(s) distribution model and the results suggested that MERS-CoV M pro is a monomer in phosphate buffer (S5 Fig) and this contrasts with a distribution of 30% monomer and 70% dimer in the presence of 600 μM TQ6-pNA ( Fig 3B) . We also measured the size distribution of M pro at various TQ6-pNA concentrations (S6 Fig). The results indicated that the sedimentation coefficient of the major species was shifted as the substrate dosage changed (S6B Fig). More substrate led to the major species moving close to the dimer position.

However, before the centrifugation, the enzyme had been mixed with the substrate and the catalysis began, resulting in a mixture of substrate and product with enzyme. It is unable to confirm that our observation is a substrate-induced or substrate/product-induced dimerization. To solve this, a modified AUC technique, AEC [33] , was utilized to detect the quaternary structure change in the absence and presence of substrate (Fig 4) . Here the enzyme solution was put into the small well of band-forming centerpiece and then flowed into the substratecontaining channel when the centrifugation began. During the centrifugation, the protein layer gradually sediment and continuously met peptide substrates. Not surprisingly, there was a broad distribution between the monomer and dimer species in the presence of 200 μM peptide substrate, while a major species shifted to the dimer in 400 μM substrate (Fig 4B) . It suggests that MERS-CoV M pro acts as a rapid self-associated and substrate-induced dimerization. Using different strategies, Tomar et al. [14] confirmed that inhibitor binding can also induce and maintain the dimerization of M pro . On the other hand, we measured the velocity of the product formation during the centrifugation; although the rate (0.017 μM/s) is 10-fold lower than that by the spectrometric assay (Fig 4B) . The values were derived from a global fit of the AUC data to a monomer-dimer self-association model by SEDPHAT [32] . The experiments for the assay were obtained at protein concentration of 1.5 to 30 μM. c The value was from our previous studies for comparison [28] .

doi:10.1371/journal.pone.0144865.t002 To quantitatively characterize the monomer-dimer equilibrium of M pro in the absence and presence of substrate, the AUC results at protein concentrations of 1.5, 6 and 15 μM were globally fitted to the monomer-dimer self-association model ( Table 2 ). The analysis indicated that the K d value of MERS-CoV M pro in the absence of substrate was 7.7 μM and this decreased 11-fold in the presence of substrate, which brings it close to the value for SARS-CoV M pro (1.7 μM; Table 2 ). Thus it can be concluded that, like the SARS-CoV M pro R298A mutant [25] , the presence of substrate is able to induce the dimerization of MERS-CoV M pro . In addition, although the K d values of wild-type SARS-CoV M pro without or with substrates show no significant difference (Table 2) , it was possible to detect substrate-induced dimerization at a protein concentration of 1 μM by AEC [33] .

Previous studies have demonstrated that a conserved residue, Glu166, plays a pivotal role in connecting the substrate binding site with the dimerization interface of SARS-CoV M pro [28] . Here the equivalent residue, Glu169, was mutated and its influence on MERS-CoV M pro evaluated ( Fig 1B) . Not surprisingly, compared to the wild-type enzyme, the activity (k cat ) of E169A showed a 6-fold decrease (Fig 2B, open diamonds and Table 2 ). Furthermore, AUC analysis suggested that this enzyme consisted of a single species close to monomeric form even in the presence of substrate (Fig 3E) . The K d values of the E169A mutant without substrate was 14 μM, which is 2-fold higher than that of the wild-type and this did not decrease in the presence of substrate ( Table 2 ). The results suggest that mutation of Glu169 is able to block substrate-induced dimerization and that this results in a decrease in enzyme activity. Unexpectedly, as well as the monomer, some octamer (6.3%) with a sedimentation coefficient of 4.9 S was observed in the presence of substrate (Fig 3E) . Previous studies have suggested that a super-active octamer of SARS-CoV M pro can be locked by 3D domain swapping [35] . In this study, the presence of the octamer form of the MERS-CoV M pro E169A mutant in the presence of substrate may explain why this mutant is not totally inactive. Taking the above as a whole, the dual role of the conserved Glu residue in catalysis and dimerization is consistent for both M pro .

Our results confirmed that there are fewer intermolecular polar interactions at the dimerization interface of MERS-CoV M pro and this results in the enzyme being in the monomer form in aqueous buffer; this contrasts with SARS-CoV M pro , which is mostly in the dimer form in similar circumstances due to the greater number of intermolecular interactions (Figs 1B and  3B ). Based on the sequence alignment, three residues in the dimerization interface vary in coronaviral M pro sequences (S1 Fig). In SARS-CoV M pro , residues Arg4, Ser123 and Arg298 are different to the equivalent ones in MERS-CoV M pro , which are Val4, Thr126 and Met298, respectively. Based on the above, three single mutants, V4R, T126S and M298R, were generated and their proteolytic activity and dimerization were assessed. Unexpectedly, both the V4R and the T126S mutant showed a higher K d for the dimer to monomer and a lower level of activity than wild-type M pro (Fig 2B and Table 2 ). K d values were decreased by 1.5-fold to 2.4-fold for the two mutants in the presence of substrate, which suggests reduced substrate-induced dimerization (Fig 3C and 3D) . Based on the current structure, residue Val4 showed a hydrophobic contact with another protomer's residue Gly141 (Fig 1B) . Mutation of valine to arginine may lose the contact. Furthermore, the side chain of residue Val131 of MERS-CoV M pro is hydrophobic while that of the equivalent residue, Cys128 of SARS-CoV M pro , is hydrophilic (Fig 1B) . Val131 is close to the Arg4 and will disfavor the electrostatic interaction of Arg4. . .Glu290 in MERS-CoV M pro . These variance may result in V4R failed to form a stable dimer. For the T126S mutant, after compared with the other two MERS-CoV M pro structures (PDB entry 4YLU and 4WME), we found that the side chain of Thr126 is free of rotation. It is able to make a hydrophobic interaction with the residue Tyr121, resulting in a 180°-rotation of the phenol ring, and lead to a hydrogen-bond with the backbone amide of Leu144 (Fig 1B) . It further results in the side chain of Leu144 toward another protomer's Ile300 and make a hydrophobic contact for the two protomers. Mutation of Thr126 to serine will lose this contact and may disfavor the dimerization.

By way of contrast, the M298R mutant resulted in a stable dimer form in phosphate buffer (Fig 3F) . The K d value for the mutant in the absence and presence of substrate were 1.1 and 0.7 μM, respectively, which are very close to those for SARS-CoV M pro (Table 2) . Furthermore, the stable dimer form showed higher proteolytic activity and the mutation transformed the enzymes rate constant pattern at various substrate concentrations into a classical saturation curve (Fig 2C, open triangles) . In addition, the K m of the M298R mutant is 5.8-fold lower than that of SARS-CoV M pro , which suggests a higher substrate binding affinity ( Table 2 ). It can be concluded that mutation of residue Met298 to arginine within the MERS-CoV M pro results in the stabilization of the dimer formation, which in turn gives rise to more efficient catalysis. Based on our structure, Arg298 is able to make a hydrogen bonding interaction with Thr126. Residue Thr126 can be replaced by serine because the T126S/M298R double mutant also shows similar dimerization characteristics ( Fig 3G) and saturated catalytic pattern to that of the M298R mutant (Fig 2C, open hexagons and Table 2 ). However, it can only be achieved in the presence of Arg298, not Met298.

The sigmoid nature of the curve describing the rate constant pattern at various substrate concentrations ( Fig 2B) means that it is not possible to obtain a K m value for this enzyme, which would allow us to evaluate the substrate binding affinity of the wild-type MERS-CoV M pro and its mutants; the exceptions being the M298R single mutant and the T126S/M298R double mutant (Fig 2) . To further delineate the binding of substrate to the enzyme, ITC was used to measure the K d for the substrate (or substrate/product)-enzyme complex and the binding stoichiometry (N) (Fig 5) . During the titration, the enzymatic hydrolysis might produce additional heat, resulting in higher ΔH. So we can only compared the N and K d of the wild-type M pro with those of E169A and M298R mutants. The three enzymes exhibited similar N (0.89 to 1.06) and K d (14.2 to 20.3 μM) . This suggested that the monomeric and dimeric M pro show quite the same substrate binding affinity. Such phenomenon is also found in monomeric and dimeric SARS-CoV M pro , whose N and K d for the same substrate were 0.97 to 1.05 and 29.9 to 33.8 μM, respectively [28] . With the K m ((k -1 +k cat )/k 1 ), k cat and K d (k -1 /k 1 ), we are able to calculate the k 1 and k -1 , the rate of the association and dissociation of the enzyme-substrate complex. The k 1 and k -1 for the M298R mutant and substrate is 0.049 s -1 μM -1 and 0.98 s -1 , while those for SARS-CoV M pro is 0.00246 s -1 μM -1 and 0.084 s -1 . The rate constants for M298R mutant showed 20-and 12-fold higher than those for SARS-CoV M pro . The more rapid association and relatively slower dissociation of enzyme-substrate complex may be used to explain why the catalytic efficiency (k cat /K m ) of the MERS-CoV M pro M298R mutant is higher than that of SARS-CoV M pro (Table 2) .

The crystal structure of authentic N-terminus MERS-CoV M pro was determined and this was found to involve a dimeric form with less intermolecular polar interactions. Biochemical and AUC studies indicated that MERS-CoV M pro shows almost the same proteolytic activity as SARS-CoV M pro ; although it is a monomer in aqueous buffer and displays substrate-induced dimerization (Fig 6) . A conserved residue, Glu169, plays an essential role in the substrateinduced dimerization of both MERS-CoV M pro and SARS-CoV M pro . Moreover, mutation of a residue in the dimerization interface, M298R, was found to result in a more stable dimer form in aqueous buffer that had higher enzyme activity; while other two mutations, V4R and T126S, showed the reverse effect. Critical assessment of the residues important to dimerization of and catalysis by MERS-CoV M pro provides valuable insights into the mechanism that controls the monomer-dimer switch of important and valuable enzyme. 

Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia

Is the discovery of the novel human betacoronavirus 2c EMC/2012 (HCoV-EMC) the beginning of another SARS-like pandemic?

Emerging human coronaviruses-disease potential and preparedness

In-vitro renal epithelial cell infection reveals a viral kidney tropism as a potential mechanism for acute renal failure during Middle East Respiratory Syndrome (MERS) Coronavirus infection

Hospital outbreak of Middle East respiratory syndrome coronavirus

Middle East respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: a comparative serological study

Close relative of human Middle East respiratory syndrome coronavirus in bat

Ecology, evolution and classification of bat coronaviruses in the aftermath of SARS

Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor

Assessing activity and inhibition of Middle East respiratory syndrome coronavirus papain-like and 3C-like proteases using luciferase-based biosensors

Structural and functional characterization of MERS coronavirus papain-like protease

Structural basis for catalysis and ubiquitin recognition by the severe acute respiratory syndrome coronavirus papain-like protease

Thiopurine analogs and mycophenolic acid synergistically inhibit the papain-like protease of Middle East respiratory syndrome coronavirus

Ligand-induced dimerization of MERS coronavirus nsp5 protease (3CLpro): implications for nsp5 regulation and the development of antivirals

Structures of the Middle East respiratory syndrome coronavirus 3C-like protease reveal insights into substrate specificity

The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor

Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs

Quaternary structure of the severe acute respiratory syndrome (SARS) coronavirus main protease

Mechanism of the maturation process of SARS-CoV 3CL protease

Structures of two coronavirus main proteases: implications for substrate binding and antiviral drug design

Biosynthesis, purification, and substrate specificity of severe acute respiratory syndrome coronavirus 3C-like proteinase

Prediction and biochemical analysis of putative cleavage sites of the 3C-like protease of Middle East respiratory syndrome coronavirus

Processing of X-ray diffraction data collected in oscillation mode

Phaser crystallographic software

Mechanism for controlling the monomerdimer conversion of SARS coronavirus main protease

Features and development of Coot

REFMAC5 for the refinement of macromolecular crystal structures

Mutation of Glu-166 blocks the substrate-induced dimerization of SARS coronavirus main protease

Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments

Differential domain structure stability of the severe acute respiratory syndrome coronavirus papain-like protease

Size-distribution analysis of macromolecules by sedimentation velocity ultracentrifugation and Lamm equation modeling

On the analysis of protein self-association by sedimentation velocity analytical ultracentrifugation

Applications of analytical ultracentrifugation to protein size-and-shape distribution and structure-and-function analyses

Thiopurine analogues inhibit papain-like protease of severe acute respiratory syndrome coronavirus

Three-dimensional domain swapping as a mechanism to lock the active conformation in a super-active octamer of SARS-CoV main protease

ESPript: analysis of multiple sequence alignments in Post-Script

This research was supported by grants from Ministry of Science and Technology, Taiwan (103-2320-B-010-025 and 104-2320-B-010-034) to CYC. We also thank NYMU for its financial

Conceived and designed the experiments: CYC. Performed the experiments: BLH SCC LS TYW KIH. Analyzed the data: BLH TYW. Contributed reagents/materials/analysis tools: SCC. Wrote the paper: CYC.