id	sid	tid	token	lemma	pos
cord-284501-5i0w74q4	1	1	key	key	NN
cord-284501-5i0w74q4	1	2	:	:	:
cord-284501-5i0w74q4	2	1	cord-284501	cord-284501	NNP
cord-284501-5i0w74q4	2	2	-	-	HYPH
cord-284501-5i0w74q4	2	3	5i0w74q4	5i0w74q4	CD
cord-284501-5i0w74q4	2	4	authors	author	NNS
cord-284501-5i0w74q4	2	5	:	:	:
cord-284501-5i0w74q4	2	6	Armesto	Armesto	NNP
cord-284501-5i0w74q4	2	7	,	,	,
cord-284501-5i0w74q4	2	8	Maria	Maria	NNP
cord-284501-5i0w74q4	2	9	;	;	:
cord-284501-5i0w74q4	2	10	Cavanagh	Cavanagh	NNP
cord-284501-5i0w74q4	2	11	,	,	,
cord-284501-5i0w74q4	2	12	Dave	Dave	NNP
cord-284501-5i0w74q4	2	13	;	;	:
cord-284501-5i0w74q4	2	14	Britton	Britton	NNP
cord-284501-5i0w74q4	2	15	,	,	,
cord-284501-5i0w74q4	3	1	Paul	Paul	NNP
cord-284501-5i0w74q4	3	2	title	title	NN
cord-284501-5i0w74q4	3	3	:	:	:
cord-284501-5i0w74q4	4	1	The	the	DT
cord-284501-5i0w74q4	4	2	Replicase	Replicase	NNP
cord-284501-5i0w74q4	4	3	Gene	Gene	NNP
cord-284501-5i0w74q4	4	4	of	of	IN
cord-284501-5i0w74q4	4	5	Avian	Avian	NNP
cord-284501-5i0w74q4	4	6	Coronavirus	Coronavirus	NNP
cord-284501-5i0w74q4	4	7	Infectious	Infectious	NNP
cord-284501-5i0w74q4	4	8	Bronchitis	Bronchitis	NNP
cord-284501-5i0w74q4	4	9	Virus	Virus	NNP
cord-284501-5i0w74q4	4	10	Is	be	VBZ
cord-284501-5i0w74q4	4	11	a	a	DT
cord-284501-5i0w74q4	4	12	Determinant	determinant	NN
cord-284501-5i0w74q4	4	13	of	of	IN
cord-284501-5i0w74q4	4	14	Pathogenicity	Pathogenicity	NNP
cord-284501-5i0w74q4	4	15	date	date	NN
cord-284501-5i0w74q4	4	16	:	:	:
cord-284501-5i0w74q4	4	17	2009	2009	CD
cord-284501-5i0w74q4	4	18	-	-	SYM
cord-284501-5i0w74q4	4	19	10	10	CD
cord-284501-5i0w74q4	4	20	-	-	HYPH
cord-284501-5i0w74q4	4	21	09	09	CD
cord-284501-5i0w74q4	4	22	journal	journal	NN
cord-284501-5i0w74q4	4	23	:	:	:
cord-284501-5i0w74q4	5	1	PLoS	PLoS	NNP
cord-284501-5i0w74q4	6	1	One	one	CD
cord-284501-5i0w74q4	6	2	DOI	doi	NN
cord-284501-5i0w74q4	6	3	:	:	:
cord-284501-5i0w74q4	6	4	10.1371	10.1371	CD
cord-284501-5i0w74q4	6	5	/	/	SYM
cord-284501-5i0w74q4	6	6	journal.pone.0007384	journal.pone.0007384	NNP
cord-284501-5i0w74q4	6	7	sha	sha	NNP
cord-284501-5i0w74q4	6	8	:	:	:
cord-284501-5i0w74q4	7	1	3041d890310a050dfc5725636a7b26a23b9d40aa	3041d890310a050dfc5725636a7b26a23b9d40aa	CD
cord-284501-5i0w74q4	7	2	doc_id	doc_id	CD
cord-284501-5i0w74q4	7	3	:	:	:
cord-284501-5i0w74q4	8	1	284501	284501	CD
cord-284501-5i0w74q4	8	2	cord_uid	cord_uid	NNS
cord-284501-5i0w74q4	8	3	:	:	:
cord-284501-5i0w74q4	9	1	5i0w74q4	5i0w74q4	CD
cord-284501-5i0w74q4	10	1	We	-PRON-	PRP
cord-284501-5i0w74q4	10	2	have	have	VBP
cord-284501-5i0w74q4	10	3	previously	previously	RB
cord-284501-5i0w74q4	10	4	demonstrated	demonstrate	VBN
cord-284501-5i0w74q4	10	5	that	that	IN
cord-284501-5i0w74q4	10	6	the	the	DT
cord-284501-5i0w74q4	10	7	replacement	replacement	NN
cord-284501-5i0w74q4	10	8	of	of	IN
cord-284501-5i0w74q4	10	9	the	the	DT
cord-284501-5i0w74q4	10	10	S	S	NNP
cord-284501-5i0w74q4	10	11	gene	gene	NN
cord-284501-5i0w74q4	10	12	from	from	IN
cord-284501-5i0w74q4	10	13	an	an	DT
cord-284501-5i0w74q4	10	14	avirulent	avirulent	NN
cord-284501-5i0w74q4	10	15	strain	strain	NN
cord-284501-5i0w74q4	10	16	(	(	-LRB-
cord-284501-5i0w74q4	10	17	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	10	18	)	)	-RRB-
cord-284501-5i0w74q4	10	19	of	of	IN
cord-284501-5i0w74q4	10	20	infectious	infectious	JJ
cord-284501-5i0w74q4	10	21	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	10	22	virus	virus	NN
cord-284501-5i0w74q4	10	23	(	(	-LRB-
cord-284501-5i0w74q4	10	24	IBV	IBV	NNP
cord-284501-5i0w74q4	10	25	)	)	-RRB-
cord-284501-5i0w74q4	10	26	with	with	IN
cord-284501-5i0w74q4	10	27	an	an	DT
cord-284501-5i0w74q4	10	28	S	S	NNP
cord-284501-5i0w74q4	10	29	gene	gene	NN
cord-284501-5i0w74q4	10	30	from	from	IN
cord-284501-5i0w74q4	10	31	a	a	DT
cord-284501-5i0w74q4	10	32	virulent	virulent	JJ
cord-284501-5i0w74q4	10	33	strain	strain	NN
cord-284501-5i0w74q4	10	34	(	(	-LRB-
cord-284501-5i0w74q4	10	35	M41	M41	NNP
cord-284501-5i0w74q4	10	36	)	)	-RRB-
cord-284501-5i0w74q4	10	37	resulted	result	VBD
cord-284501-5i0w74q4	10	38	in	in	IN
cord-284501-5i0w74q4	10	39	a	a	DT
cord-284501-5i0w74q4	10	40	recombinant	recombinant	JJ
cord-284501-5i0w74q4	10	41	virus	virus	NN
cord-284501-5i0w74q4	10	42	(	(	-LRB-
cord-284501-5i0w74q4	10	43	BeauR	BeauR	NNP
cord-284501-5i0w74q4	10	44	-	-	HYPH
cord-284501-5i0w74q4	10	45	M41(S	M41(S	NNP
cord-284501-5i0w74q4	10	46	)	)	-RRB-
cord-284501-5i0w74q4	10	47	)	)	-RRB-
cord-284501-5i0w74q4	10	48	with	with	IN
cord-284501-5i0w74q4	10	49	the	the	DT
cord-284501-5i0w74q4	10	50	in	in	FW
cord-284501-5i0w74q4	10	51	vitro	vitro	FW
cord-284501-5i0w74q4	10	52	cell	cell	NN
cord-284501-5i0w74q4	10	53	tropism	tropism	NN
cord-284501-5i0w74q4	10	54	of	of	IN
cord-284501-5i0w74q4	10	55	the	the	DT
cord-284501-5i0w74q4	10	56	virulent	virulent	JJ
cord-284501-5i0w74q4	10	57	virus	virus	NN
cord-284501-5i0w74q4	10	58	but	but	CC
cord-284501-5i0w74q4	10	59	that	that	DT
cord-284501-5i0w74q4	10	60	was	be	VBD
cord-284501-5i0w74q4	10	61	still	still	RB
cord-284501-5i0w74q4	10	62	avirulent	avirulent	JJ
cord-284501-5i0w74q4	10	63	.	.	.
cord-284501-5i0w74q4	11	1	In	in	IN
cord-284501-5i0w74q4	11	2	order	order	NN
cord-284501-5i0w74q4	11	3	to	to	TO
cord-284501-5i0w74q4	11	4	investigate	investigate	VB
cord-284501-5i0w74q4	11	5	whether	whether	IN
cord-284501-5i0w74q4	11	6	any	any	DT
cord-284501-5i0w74q4	11	7	of	of	IN
cord-284501-5i0w74q4	11	8	the	the	DT
cord-284501-5i0w74q4	11	9	other	other	JJ
cord-284501-5i0w74q4	11	10	structural	structural	JJ
cord-284501-5i0w74q4	11	11	or	or	CC
cord-284501-5i0w74q4	11	12	accessory	accessory	NN
cord-284501-5i0w74q4	11	13	genes	gene	NNS
cord-284501-5i0w74q4	11	14	played	play	VBD
cord-284501-5i0w74q4	11	15	a	a	DT
cord-284501-5i0w74q4	11	16	role	role	NN
cord-284501-5i0w74q4	11	17	in	in	IN
cord-284501-5i0w74q4	11	18	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	11	19	we	-PRON-	PRP
cord-284501-5i0w74q4	11	20	have	have	VBP
cord-284501-5i0w74q4	11	21	now	now	RB
cord-284501-5i0w74q4	11	22	replaced	replace	VBN
cord-284501-5i0w74q4	11	23	these	these	DT
cord-284501-5i0w74q4	11	24	from	from	IN
cord-284501-5i0w74q4	11	25	the	the	DT
cord-284501-5i0w74q4	11	26	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	11	27	strain	strain	NN
cord-284501-5i0w74q4	11	28	with	with	IN
cord-284501-5i0w74q4	11	29	those	those	DT
cord-284501-5i0w74q4	11	30	from	from	IN
cord-284501-5i0w74q4	11	31	M41	M41	NNP
cord-284501-5i0w74q4	11	32	.	.	.
cord-284501-5i0w74q4	12	1	The	the	DT
cord-284501-5i0w74q4	12	2	recombinant	recombinant	JJ
cord-284501-5i0w74q4	12	3	IBV	IBV	NNP
cord-284501-5i0w74q4	12	4	was	be	VBD
cord-284501-5i0w74q4	12	5	in	in	IN
cord-284501-5i0w74q4	12	6	effect	effect	NN
cord-284501-5i0w74q4	12	7	a	a	DT
cord-284501-5i0w74q4	12	8	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	12	9	virus	virus	NN
cord-284501-5i0w74q4	12	10	with	with	IN
cord-284501-5i0w74q4	12	11	the	the	DT
cord-284501-5i0w74q4	12	12	replicase	replicase	NN
cord-284501-5i0w74q4	12	13	gene	gene	NN
cord-284501-5i0w74q4	12	14	derived	derive	VBN
cord-284501-5i0w74q4	12	15	from	from	IN
cord-284501-5i0w74q4	12	16	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	12	17	and	and	CC
cord-284501-5i0w74q4	12	18	the	the	DT
cord-284501-5i0w74q4	12	19	rest	rest	NN
cord-284501-5i0w74q4	12	20	of	of	IN
cord-284501-5i0w74q4	12	21	the	the	DT
cord-284501-5i0w74q4	12	22	genome	genome	NN
cord-284501-5i0w74q4	12	23	from	from	IN
cord-284501-5i0w74q4	12	24	M41	M41	NNP
cord-284501-5i0w74q4	12	25	.	.	.
cord-284501-5i0w74q4	13	1	This	this	DT
cord-284501-5i0w74q4	13	2	demonstrated	demonstrate	VBD
cord-284501-5i0w74q4	13	3	that	that	IN
cord-284501-5i0w74q4	13	4	it	-PRON-	PRP
cord-284501-5i0w74q4	13	5	is	be	VBZ
cord-284501-5i0w74q4	13	6	possible	possible	JJ
cord-284501-5i0w74q4	13	7	to	to	TO
cord-284501-5i0w74q4	13	8	exchange	exchange	VB
cord-284501-5i0w74q4	13	9	a	a	DT
cord-284501-5i0w74q4	13	10	large	large	JJ
cord-284501-5i0w74q4	13	11	region	region	NN
cord-284501-5i0w74q4	13	12	of	of	IN
cord-284501-5i0w74q4	13	13	the	the	DT
cord-284501-5i0w74q4	13	14	IBV	IBV	NNP
cord-284501-5i0w74q4	13	15	genome	genome	NN
cord-284501-5i0w74q4	13	16	,	,	,
cord-284501-5i0w74q4	13	17	approximately	approximately	RB
cord-284501-5i0w74q4	13	18	8.4	8.4	CD
cord-284501-5i0w74q4	13	19	kb	kb	NNP
cord-284501-5i0w74q4	13	20	,	,	,
cord-284501-5i0w74q4	13	21	using	use	VBG
cord-284501-5i0w74q4	13	22	our	-PRON-	PRP$
cord-284501-5i0w74q4	13	23	transient	transient	JJ
cord-284501-5i0w74q4	13	24	dominant	dominant	JJ
cord-284501-5i0w74q4	13	25	selection	selection	NN
cord-284501-5i0w74q4	13	26	method	method	NN
cord-284501-5i0w74q4	13	27	.	.	.
cord-284501-5i0w74q4	14	1	Recovery	recovery	NN
cord-284501-5i0w74q4	14	2	of	of	IN
cord-284501-5i0w74q4	14	3	a	a	DT
cord-284501-5i0w74q4	14	4	viable	viable	JJ
cord-284501-5i0w74q4	14	5	recombinant	recombinant	JJ
cord-284501-5i0w74q4	14	6	IBV	IBV	NNP
cord-284501-5i0w74q4	14	7	also	also	RB
cord-284501-5i0w74q4	14	8	demonstrated	demonstrate	VBD
cord-284501-5i0w74q4	14	9	that	that	IN
cord-284501-5i0w74q4	14	10	it	-PRON-	PRP
cord-284501-5i0w74q4	14	11	is	be	VBZ
cord-284501-5i0w74q4	14	12	possible	possible	JJ
cord-284501-5i0w74q4	14	13	to	to	TO
cord-284501-5i0w74q4	14	14	interchange	interchange	VB
cord-284501-5i0w74q4	14	15	a	a	DT
cord-284501-5i0w74q4	14	16	complete	complete	JJ
cord-284501-5i0w74q4	14	17	replicase	replicase	NN
cord-284501-5i0w74q4	14	18	gene	gene	NN
cord-284501-5i0w74q4	14	19	as	as	IN
cord-284501-5i0w74q4	14	20	we	-PRON-	PRP
cord-284501-5i0w74q4	14	21	had	have	VBD
cord-284501-5i0w74q4	14	22	in	in	IN
cord-284501-5i0w74q4	14	23	effect	effect	NN
cord-284501-5i0w74q4	14	24	replaced	replace	VBN
cord-284501-5i0w74q4	14	25	the	the	DT
cord-284501-5i0w74q4	14	26	M41	m41	JJ
cord-284501-5i0w74q4	14	27	replicase	replicase	NN
cord-284501-5i0w74q4	14	28	gene	gene	NN
cord-284501-5i0w74q4	14	29	with	with	IN
cord-284501-5i0w74q4	14	30	the	the	DT
cord-284501-5i0w74q4	14	31	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	14	32	derived	derive	VBN
cord-284501-5i0w74q4	14	33	gene	gene	NN
cord-284501-5i0w74q4	14	34	.	.	.
cord-284501-5i0w74q4	15	1	Analysis	analysis	NN
cord-284501-5i0w74q4	15	2	of	of	IN
cord-284501-5i0w74q4	15	3	the	the	DT
cord-284501-5i0w74q4	15	4	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	15	5	virus	virus	NN
cord-284501-5i0w74q4	15	6	showed	show	VBD
cord-284501-5i0w74q4	15	7	that	that	IN
cord-284501-5i0w74q4	15	8	it	-PRON-	PRP
cord-284501-5i0w74q4	15	9	was	be	VBD
cord-284501-5i0w74q4	15	10	avirulent	avirulent	NN
cord-284501-5i0w74q4	15	11	indicating	indicate	VBG
cord-284501-5i0w74q4	15	12	that	that	IN
cord-284501-5i0w74q4	15	13	none	none	NN
cord-284501-5i0w74q4	15	14	of	of	IN
cord-284501-5i0w74q4	15	15	the	the	DT
cord-284501-5i0w74q4	15	16	structural	structural	JJ
cord-284501-5i0w74q4	15	17	or	or	CC
cord-284501-5i0w74q4	15	18	accessory	accessory	JJ
cord-284501-5i0w74q4	15	19	genes	gene	NNS
cord-284501-5i0w74q4	15	20	derived	derive	VBN
cord-284501-5i0w74q4	15	21	from	from	IN
cord-284501-5i0w74q4	15	22	a	a	DT
cord-284501-5i0w74q4	15	23	virulent	virulent	JJ
cord-284501-5i0w74q4	15	24	isolate	isolate	NN
cord-284501-5i0w74q4	15	25	of	of	IN
cord-284501-5i0w74q4	15	26	IBV	IBV	NNP
cord-284501-5i0w74q4	15	27	were	be	VBD
cord-284501-5i0w74q4	15	28	able	able	JJ
cord-284501-5i0w74q4	15	29	to	to	TO
cord-284501-5i0w74q4	15	30	restore	restore	VB
cord-284501-5i0w74q4	15	31	virulence	virulence	NN
cord-284501-5i0w74q4	15	32	and	and	CC
cord-284501-5i0w74q4	15	33	that	that	IN
cord-284501-5i0w74q4	15	34	therefore	therefore	RB
cord-284501-5i0w74q4	15	35	,	,	,
cord-284501-5i0w74q4	15	36	the	the	DT
cord-284501-5i0w74q4	15	37	loss	loss	NN
cord-284501-5i0w74q4	15	38	of	of	IN
cord-284501-5i0w74q4	15	39	virulence	virulence	NN
cord-284501-5i0w74q4	15	40	associated	associate	VBN
cord-284501-5i0w74q4	15	41	with	with	IN
cord-284501-5i0w74q4	15	42	the	the	DT
cord-284501-5i0w74q4	15	43	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	15	44	strain	strain	NN
cord-284501-5i0w74q4	15	45	resides	reside	VBZ
cord-284501-5i0w74q4	15	46	in	in	IN
cord-284501-5i0w74q4	15	47	the	the	DT
cord-284501-5i0w74q4	15	48	replicase	replicase	NN
cord-284501-5i0w74q4	15	49	gene	gene	NN
cord-284501-5i0w74q4	15	50	.	.	.
cord-284501-5i0w74q4	16	1	Avian	avian	JJ
cord-284501-5i0w74q4	16	2	infectious	infectious	JJ
cord-284501-5i0w74q4	16	3	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	16	4	virus	virus	NN
cord-284501-5i0w74q4	16	5	(	(	-LRB-
cord-284501-5i0w74q4	16	6	IBV	IBV	NNP
cord-284501-5i0w74q4	16	7	)	)	-RRB-
cord-284501-5i0w74q4	16	8	is	be	VBZ
cord-284501-5i0w74q4	16	9	a	a	DT
cord-284501-5i0w74q4	16	10	member	member	NN
cord-284501-5i0w74q4	16	11	of	of	IN
cord-284501-5i0w74q4	16	12	the	the	DT
cord-284501-5i0w74q4	16	13	genus	genus	JJ
cord-284501-5i0w74q4	16	14	Coronavirus	Coronavirus	NNP
cord-284501-5i0w74q4	16	15	,	,	,
cord-284501-5i0w74q4	16	16	family	family	NN
cord-284501-5i0w74q4	16	17	Coronaviridae	Coronaviridae	NNP
cord-284501-5i0w74q4	16	18	,	,	,
cord-284501-5i0w74q4	16	19	order	order	NN
cord-284501-5i0w74q4	16	20	Nidovirales	Nidovirales	NNP
cord-284501-5i0w74q4	16	21	[	[	-LRB-
cord-284501-5i0w74q4	16	22	1	1	CD
cord-284501-5i0w74q4	16	23	,	,	,
cord-284501-5i0w74q4	16	24	2	2	CD
cord-284501-5i0w74q4	16	25	]	]	-RRB-
cord-284501-5i0w74q4	16	26	.	.	.
cord-284501-5i0w74q4	17	1	Together	together	RB
cord-284501-5i0w74q4	17	2	with	with	IN
cord-284501-5i0w74q4	17	3	the	the	DT
cord-284501-5i0w74q4	17	4	genetically	genetically	RB
cord-284501-5i0w74q4	17	5	closely	closely	RB
cord-284501-5i0w74q4	17	6	related	relate	VBN
cord-284501-5i0w74q4	17	7	Turkey	Turkey	NNP
cord-284501-5i0w74q4	17	8	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	17	9	[	[	-LRB-
cord-284501-5i0w74q4	17	10	3	3	CD
cord-284501-5i0w74q4	17	11	]	]	-RRB-
cord-284501-5i0w74q4	17	12	[	[	-LRB-
cord-284501-5i0w74q4	17	13	4	4	CD
cord-284501-5i0w74q4	17	14	]	]	-RRB-
cord-284501-5i0w74q4	17	15	[	[	-LRB-
cord-284501-5i0w74q4	17	16	5	5	CD
cord-284501-5i0w74q4	17	17	]	]	-RRB-
cord-284501-5i0w74q4	17	18	[	[	-LRB-
cord-284501-5i0w74q4	17	19	6	6	CD
cord-284501-5i0w74q4	17	20	]	]	-RRB-
cord-284501-5i0w74q4	17	21	,	,	,
cord-284501-5i0w74q4	17	22	Pheasant	Pheasant	NNP
cord-284501-5i0w74q4	17	23	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	17	24	[	[	-LRB-
cord-284501-5i0w74q4	17	25	7	7	CD
cord-284501-5i0w74q4	17	26	]	]	-RRB-
cord-284501-5i0w74q4	17	27	,	,	,
cord-284501-5i0w74q4	17	28	and	and	CC
cord-284501-5i0w74q4	17	29	recently	recently	RB
cord-284501-5i0w74q4	17	30	identified	identify	VBN
cord-284501-5i0w74q4	17	31	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	17	32	from	from	IN
cord-284501-5i0w74q4	17	33	several	several	JJ
cord-284501-5i0w74q4	17	34	species	specie	NNS
cord-284501-5i0w74q4	17	35	of	of	IN
cord-284501-5i0w74q4	17	36	wild	wild	JJ
cord-284501-5i0w74q4	17	37	birds	bird	NNS
cord-284501-5i0w74q4	17	38	[	[	-LRB-
cord-284501-5i0w74q4	17	39	8	8	CD
cord-284501-5i0w74q4	17	40	,	,	,
cord-284501-5i0w74q4	17	41	9	9	CD
cord-284501-5i0w74q4	17	42	]	]	-RRB-
cord-284501-5i0w74q4	17	43	,	,	,
cord-284501-5i0w74q4	17	44	a	a	DT
cord-284501-5i0w74q4	17	45	beluga	beluga	NN
cord-284501-5i0w74q4	17	46	whale	whale	NN
cord-284501-5i0w74q4	17	47	[	[	-LRB-
cord-284501-5i0w74q4	17	48	10	10	CD
cord-284501-5i0w74q4	17	49	]	]	-RRB-
cord-284501-5i0w74q4	17	50	and	and	CC
cord-284501-5i0w74q4	17	51	an	an	DT
cord-284501-5i0w74q4	17	52	Asian	Asian	NNP
cord-284501-5i0w74q4	17	53	Leopard	Leopard	NNP
cord-284501-5i0w74q4	17	54	cat	cat	NN
cord-284501-5i0w74q4	17	55	[	[	-LRB-
cord-284501-5i0w74q4	17	56	11	11	CD
cord-284501-5i0w74q4	17	57	]	]	-RRB-
cord-284501-5i0w74q4	17	58	form	form	VBP
cord-284501-5i0w74q4	17	59	the	the	DT
cord-284501-5i0w74q4	17	60	Group	Group	NNP
cord-284501-5i0w74q4	17	61	3	3	CD
cord-284501-5i0w74q4	17	62	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	17	63	.	.	.
cord-284501-5i0w74q4	18	1	IBV	IBV	NNP
cord-284501-5i0w74q4	18	2	is	be	VBZ
cord-284501-5i0w74q4	18	3	a	a	DT
cord-284501-5i0w74q4	18	4	highly	highly	RB
cord-284501-5i0w74q4	18	5	infectious	infectious	JJ
cord-284501-5i0w74q4	18	6	pathogen	pathogen	NN
cord-284501-5i0w74q4	18	7	of	of	IN
cord-284501-5i0w74q4	18	8	domestic	domestic	JJ
cord-284501-5i0w74q4	18	9	fowl	fowl	NN
cord-284501-5i0w74q4	18	10	that	that	WDT
cord-284501-5i0w74q4	18	11	replicates	replicate	VBZ
cord-284501-5i0w74q4	18	12	primarily	primarily	RB
cord-284501-5i0w74q4	18	13	in	in	IN
cord-284501-5i0w74q4	18	14	the	the	DT
cord-284501-5i0w74q4	18	15	respiratory	respiratory	JJ
cord-284501-5i0w74q4	18	16	tract	tract	NN
cord-284501-5i0w74q4	18	17	but	but	CC
cord-284501-5i0w74q4	18	18	also	also	RB
cord-284501-5i0w74q4	18	19	in	in	IN
cord-284501-5i0w74q4	18	20	epithelial	epithelial	JJ
cord-284501-5i0w74q4	18	21	cells	cell	NNS
cord-284501-5i0w74q4	18	22	of	of	IN
cord-284501-5i0w74q4	18	23	other	other	JJ
cord-284501-5i0w74q4	18	24	organs	organ	NNS
cord-284501-5i0w74q4	18	25	,	,	,
cord-284501-5i0w74q4	18	26	including	include	VBG
cord-284501-5i0w74q4	18	27	the	the	DT
cord-284501-5i0w74q4	18	28	gut	gut	NN
cord-284501-5i0w74q4	18	29	,	,	,
cord-284501-5i0w74q4	18	30	kidney	kidney	NN
cord-284501-5i0w74q4	18	31	and	and	CC
cord-284501-5i0w74q4	18	32	oviduct	oviduct	NN
cord-284501-5i0w74q4	18	33	[	[	-LRB-
cord-284501-5i0w74q4	18	34	12	12	CD
cord-284501-5i0w74q4	18	35	]	]	-RRB-
cord-284501-5i0w74q4	18	36	[	[	-LRB-
cord-284501-5i0w74q4	18	37	13	13	CD
cord-284501-5i0w74q4	18	38	]	]	-RRB-
cord-284501-5i0w74q4	18	39	[	[	-LRB-
cord-284501-5i0w74q4	18	40	14	14	CD
cord-284501-5i0w74q4	18	41	]	]	-RRB-
cord-284501-5i0w74q4	18	42	,	,	,
cord-284501-5i0w74q4	18	43	and	and	CC
cord-284501-5i0w74q4	18	44	is	be	VBZ
cord-284501-5i0w74q4	18	45	the	the	DT
cord-284501-5i0w74q4	18	46	causative	causative	JJ
cord-284501-5i0w74q4	18	47	agent	agent	NN
cord-284501-5i0w74q4	18	48	of	of	IN
cord-284501-5i0w74q4	18	49	infectious	infectious	JJ
cord-284501-5i0w74q4	18	50	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	18	51	,	,	,
cord-284501-5i0w74q4	18	52	a	a	DT
cord-284501-5i0w74q4	18	53	disease	disease	NN
cord-284501-5i0w74q4	18	54	that	that	WDT
cord-284501-5i0w74q4	18	55	is	be	VBZ
cord-284501-5i0w74q4	18	56	responsible	responsible	JJ
cord-284501-5i0w74q4	18	57	for	for	IN
cord-284501-5i0w74q4	18	58	economic	economic	JJ
cord-284501-5i0w74q4	18	59	losses	loss	NNS
cord-284501-5i0w74q4	18	60	in	in	IN
cord-284501-5i0w74q4	18	61	the	the	DT
cord-284501-5i0w74q4	18	62	poultry	poultry	NN
cord-284501-5i0w74q4	18	63	industry	industry	NN
cord-284501-5i0w74q4	18	64	throughout	throughout	IN
cord-284501-5i0w74q4	18	65	the	the	DT
cord-284501-5i0w74q4	18	66	world	world	NN
cord-284501-5i0w74q4	18	67	[	[	-LRB-
cord-284501-5i0w74q4	18	68	15	15	CD
cord-284501-5i0w74q4	18	69	]	]	-RRB-
cord-284501-5i0w74q4	18	70	.	.	.
cord-284501-5i0w74q4	19	1	Coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	19	2	are	be	VBP
cord-284501-5i0w74q4	19	3	enveloped	envelop	VBN
cord-284501-5i0w74q4	19	4	viruses	virus	NNS
cord-284501-5i0w74q4	19	5	that	that	WDT
cord-284501-5i0w74q4	19	6	replicate	replicate	VBP
cord-284501-5i0w74q4	19	7	in	in	IN
cord-284501-5i0w74q4	19	8	the	the	DT
cord-284501-5i0w74q4	19	9	cell	cell	NN
cord-284501-5i0w74q4	19	10	cytoplasm	cytoplasm	NN
cord-284501-5i0w74q4	19	11	and	and	CC
cord-284501-5i0w74q4	19	12	contain	contain	VBP
cord-284501-5i0w74q4	19	13	a	a	DT
cord-284501-5i0w74q4	19	14	single	single	JJ
cord-284501-5i0w74q4	19	15	-	-	HYPH
cord-284501-5i0w74q4	19	16	stranded	stranded	JJ
cord-284501-5i0w74q4	19	17	,	,	,
cord-284501-5i0w74q4	19	18	positive	positive	JJ
cord-284501-5i0w74q4	19	19	-	-	HYPH
cord-284501-5i0w74q4	19	20	sense	sense	NN
cord-284501-5i0w74q4	19	21	RNA	RNA	NNP
cord-284501-5i0w74q4	19	22	genome	genome	NN
cord-284501-5i0w74q4	19	23	of	of	IN
cord-284501-5i0w74q4	19	24	28	28	CD
cord-284501-5i0w74q4	19	25	to	to	TO
cord-284501-5i0w74q4	19	26	32	32	CD
cord-284501-5i0w74q4	19	27	kb	kb	NNP
cord-284501-5i0w74q4	19	28	[	[	-LRB-
cord-284501-5i0w74q4	19	29	16	16	CD
cord-284501-5i0w74q4	19	30	]	]	-RRB-
cord-284501-5i0w74q4	19	31	.	.	.
cord-284501-5i0w74q4	20	1	IBV	IBV	NNP
cord-284501-5i0w74q4	20	2	has	have	VBZ
cord-284501-5i0w74q4	20	3	a	a	DT
cord-284501-5i0w74q4	20	4	27.6	27.6	CD
cord-284501-5i0w74q4	20	5	kb	kb	NNP
cord-284501-5i0w74q4	20	6	RNA	RNA	NNP
cord-284501-5i0w74q4	20	7	genome	genome	NN
cord-284501-5i0w74q4	20	8	and	and	CC
cord-284501-5i0w74q4	20	9	like	like	IN
cord-284501-5i0w74q4	20	10	all	all	DT
cord-284501-5i0w74q4	20	11	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	20	12	contains	contain	VBZ
cord-284501-5i0w74q4	20	13	the	the	DT
cord-284501-5i0w74q4	20	14	four	four	CD
cord-284501-5i0w74q4	20	15	structural	structural	JJ
cord-284501-5i0w74q4	20	16	proteins	protein	NNS
cord-284501-5i0w74q4	20	17	;	;	:
cord-284501-5i0w74q4	20	18	spike	spike	NN
cord-284501-5i0w74q4	20	19	glycoprotein	glycoprotein	NN
cord-284501-5i0w74q4	20	20	(	(	-LRB-
cord-284501-5i0w74q4	20	21	S	S	NNP
cord-284501-5i0w74q4	20	22	)	)	-RRB-
cord-284501-5i0w74q4	20	23	,	,	,
cord-284501-5i0w74q4	20	24	small	small	JJ
cord-284501-5i0w74q4	20	25	membrane	membrane	NN
cord-284501-5i0w74q4	20	26	protein	protein	NN
cord-284501-5i0w74q4	20	27	(	(	-LRB-
cord-284501-5i0w74q4	20	28	E	E	NNP
cord-284501-5i0w74q4	20	29	)	)	-RRB-
cord-284501-5i0w74q4	20	30	,	,	,
cord-284501-5i0w74q4	20	31	integral	integral	JJ
cord-284501-5i0w74q4	20	32	membrane	membrane	NN
cord-284501-5i0w74q4	20	33	protein	protein	NN
cord-284501-5i0w74q4	20	34	(	(	-LRB-
cord-284501-5i0w74q4	20	35	M	M	NNP
cord-284501-5i0w74q4	20	36	)	)	-RRB-
cord-284501-5i0w74q4	20	37	and	and	CC
cord-284501-5i0w74q4	20	38	nucleocapsid	nucleocapsid	NNP
cord-284501-5i0w74q4	20	39	protein	protein	NNP
cord-284501-5i0w74q4	20	40	(	(	-LRB-
cord-284501-5i0w74q4	20	41	N	N	NNP
cord-284501-5i0w74q4	20	42	)	)	-RRB-
cord-284501-5i0w74q4	20	43	which	which	WDT
cord-284501-5i0w74q4	20	44	interacts	interact	VBZ
cord-284501-5i0w74q4	20	45	with	with	IN
cord-284501-5i0w74q4	20	46	the	the	DT
cord-284501-5i0w74q4	20	47	genomic	genomic	JJ
cord-284501-5i0w74q4	20	48	RNA	rna	NN
cord-284501-5i0w74q4	20	49	.	.	.
cord-284501-5i0w74q4	21	1	All	all	DT
cord-284501-5i0w74q4	21	2	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	21	3	also	also	RB
cord-284501-5i0w74q4	21	4	encode	encode	VBP
cord-284501-5i0w74q4	21	5	a	a	DT
cord-284501-5i0w74q4	21	6	set	set	NN
cord-284501-5i0w74q4	21	7	of	of	IN
cord-284501-5i0w74q4	21	8	accessory	accessory	JJ
cord-284501-5i0w74q4	21	9	protein	protein	NN
cord-284501-5i0w74q4	21	10	genes	gene	NNS
cord-284501-5i0w74q4	21	11	of	of	IN
cord-284501-5i0w74q4	21	12	unknown	unknown	JJ
cord-284501-5i0w74q4	21	13	function	function	NN
cord-284501-5i0w74q4	21	14	that	that	WDT
cord-284501-5i0w74q4	21	15	are	be	VBP
cord-284501-5i0w74q4	21	16	not	not	RB
cord-284501-5i0w74q4	21	17	required	require	VBN
cord-284501-5i0w74q4	21	18	for	for	IN
cord-284501-5i0w74q4	21	19	replication	replication	NN
cord-284501-5i0w74q4	21	20	in	in	IN
cord-284501-5i0w74q4	21	21	vitro	vitro	FW
cord-284501-5i0w74q4	21	22	[	[	-LRB-
cord-284501-5i0w74q4	21	23	17	17	CD
cord-284501-5i0w74q4	21	24	]	]	-RRB-
cord-284501-5i0w74q4	21	25	[	[	-LRB-
cord-284501-5i0w74q4	21	26	18	18	CD
cord-284501-5i0w74q4	21	27	]	]	-RRB-
cord-284501-5i0w74q4	21	28	[	[	-LRB-
cord-284501-5i0w74q4	21	29	19	19	CD
cord-284501-5i0w74q4	21	30	]	]	-RRB-
cord-284501-5i0w74q4	21	31	[	[	-LRB-
cord-284501-5i0w74q4	21	32	20	20	CD
cord-284501-5i0w74q4	21	33	]	]	-RRB-
cord-284501-5i0w74q4	21	34	[	[	-LRB-
cord-284501-5i0w74q4	21	35	21	21	CD
cord-284501-5i0w74q4	21	36	]	]	-RRB-
cord-284501-5i0w74q4	21	37	[	[	-LRB-
cord-284501-5i0w74q4	21	38	22	22	CD
cord-284501-5i0w74q4	21	39	]	]	-RRB-
cord-284501-5i0w74q4	21	40	[	[	-LRB-
cord-284501-5i0w74q4	21	41	23	23	CD
cord-284501-5i0w74q4	21	42	]	]	-RRB-
cord-284501-5i0w74q4	21	43	,	,	,
cord-284501-5i0w74q4	21	44	but	but	CC
cord-284501-5i0w74q4	21	45	may	may	MD
cord-284501-5i0w74q4	21	46	play	play	VB
cord-284501-5i0w74q4	21	47	a	a	DT
cord-284501-5i0w74q4	21	48	role	role	NN
cord-284501-5i0w74q4	21	49	in	in	IN
cord-284501-5i0w74q4	21	50	pathogenesis	pathogenesis	NN
cord-284501-5i0w74q4	21	51	[	[	-LRB-
cord-284501-5i0w74q4	21	52	19	19	CD
cord-284501-5i0w74q4	21	53	,	,	,
cord-284501-5i0w74q4	21	54	22	22	CD
cord-284501-5i0w74q4	21	55	]	]	-RRB-
cord-284501-5i0w74q4	21	56	.	.	.
cord-284501-5i0w74q4	22	1	IBV	IBV	NNP
cord-284501-5i0w74q4	22	2	encodes	encode	VBZ
cord-284501-5i0w74q4	22	3	two	two	CD
cord-284501-5i0w74q4	22	4	accessory	accessory	JJ
cord-284501-5i0w74q4	22	5	genes	gene	NNS
cord-284501-5i0w74q4	22	6	,	,	,
cord-284501-5i0w74q4	22	7	genes	gene	NNS
cord-284501-5i0w74q4	22	8	3	3	CD
cord-284501-5i0w74q4	22	9	and	and	CC
cord-284501-5i0w74q4	22	10	5	5	CD
cord-284501-5i0w74q4	22	11	,	,	,
cord-284501-5i0w74q4	22	12	which	which	WDT
cord-284501-5i0w74q4	22	13	both	both	DT
cord-284501-5i0w74q4	22	14	express	express	VBP
cord-284501-5i0w74q4	22	15	two	two	CD
cord-284501-5i0w74q4	22	16	accessory	accessory	NN
cord-284501-5i0w74q4	22	17	proteins	protein	NNS
cord-284501-5i0w74q4	22	18	3a	3a	NNP
cord-284501-5i0w74q4	22	19	,	,	,
cord-284501-5i0w74q4	22	20	3b	3b	CD
cord-284501-5i0w74q4	22	21	and	and	CC
cord-284501-5i0w74q4	22	22	5a	5a	CD
cord-284501-5i0w74q4	22	23	,	,	,
cord-284501-5i0w74q4	22	24	5b	5b	NN
cord-284501-5i0w74q4	22	25	,	,	,
cord-284501-5i0w74q4	22	26	respectively	respectively	RB
cord-284501-5i0w74q4	22	27	.	.	.
cord-284501-5i0w74q4	23	1	In	in	IN
cord-284501-5i0w74q4	23	2	addition	addition	NN
cord-284501-5i0w74q4	23	3	to	to	IN
cord-284501-5i0w74q4	23	4	the	the	DT
cord-284501-5i0w74q4	23	5	structural	structural	JJ
cord-284501-5i0w74q4	23	6	and	and	CC
cord-284501-5i0w74q4	23	7	accessory	accessory	JJ
cord-284501-5i0w74q4	23	8	genes	gene	NNS
cord-284501-5i0w74q4	23	9	,	,	,
cord-284501-5i0w74q4	23	10	two	two	CD
cord-284501-5i0w74q4	23	11	-	-	HYPH
cord-284501-5i0w74q4	23	12	thirds	third	NNS
cord-284501-5i0w74q4	23	13	of	of	IN
cord-284501-5i0w74q4	23	14	a	a	DT
cord-284501-5i0w74q4	23	15	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	23	16	genome	genome	NN
cord-284501-5i0w74q4	23	17	comprises	comprise	VBZ
cord-284501-5i0w74q4	23	18	the	the	DT
cord-284501-5i0w74q4	23	19	replicase	replicase	NN
cord-284501-5i0w74q4	23	20	gene	gene	NN
cord-284501-5i0w74q4	23	21	,	,	,
cord-284501-5i0w74q4	23	22	which	which	WDT
cord-284501-5i0w74q4	23	23	expresses	express	VBZ
cord-284501-5i0w74q4	23	24	two	two	CD
cord-284501-5i0w74q4	23	25	polyproteins	polyprotein	NNS
cord-284501-5i0w74q4	23	26	,	,	,
cord-284501-5i0w74q4	23	27	pp1a	pp1a	NNP
cord-284501-5i0w74q4	23	28	and	and	CC
cord-284501-5i0w74q4	23	29	pp1ab	pp1ab	NNP
cord-284501-5i0w74q4	23	30	,	,	,
cord-284501-5i0w74q4	23	31	in	in	IN
cord-284501-5i0w74q4	23	32	which	which	WDT
cord-284501-5i0w74q4	23	33	pp1ab	pp1ab	NNP
cord-284501-5i0w74q4	23	34	is	be	VBZ
cord-284501-5i0w74q4	23	35	an	an	DT
cord-284501-5i0w74q4	23	36	extension	extension	NN
cord-284501-5i0w74q4	23	37	product	product	NN
cord-284501-5i0w74q4	23	38	of	of	IN
cord-284501-5i0w74q4	23	39	pp1a	pp1a	NNP
cord-284501-5i0w74q4	23	40	as	as	IN
cord-284501-5i0w74q4	23	41	a	a	DT
cord-284501-5i0w74q4	23	42	result	result	NN
cord-284501-5i0w74q4	23	43	of	of	IN
cord-284501-5i0w74q4	23	44	a	a	DT
cord-284501-5i0w74q4	23	45	-1	-1	JJ
cord-284501-5i0w74q4	23	46	ribosomal	ribosomal	JJ
cord-284501-5i0w74q4	23	47	shift	shift	NN
cord-284501-5i0w74q4	23	48	mechanism	mechanism	NN
cord-284501-5i0w74q4	23	49	.	.	.
cord-284501-5i0w74q4	24	1	The	the	DT
cord-284501-5i0w74q4	24	2	two	two	CD
cord-284501-5i0w74q4	24	3	polyproteins	polyprotein	NNS
cord-284501-5i0w74q4	24	4	are	be	VBP
cord-284501-5i0w74q4	24	5	cleaved	cleave	VBN
cord-284501-5i0w74q4	24	6	by	by	IN
cord-284501-5i0w74q4	24	7	two	two	CD
cord-284501-5i0w74q4	24	8	types	type	NNS
cord-284501-5i0w74q4	24	9	of	of	IN
cord-284501-5i0w74q4	24	10	virus	virus	NN
cord-284501-5i0w74q4	24	11	-	-	HYPH
cord-284501-5i0w74q4	24	12	encoded	encode	VBN
cord-284501-5i0w74q4	24	13	proteinases	proteinase	NNS
cord-284501-5i0w74q4	24	14	usually	usually	RB
cord-284501-5i0w74q4	24	15	resulting	result	VBG
cord-284501-5i0w74q4	24	16	in	in	IN
cord-284501-5i0w74q4	24	17	16	16	CD
cord-284501-5i0w74q4	24	18	non	non	JJ
cord-284501-5i0w74q4	24	19	-	-	JJ
cord-284501-5i0w74q4	24	20	structural	structural	JJ
cord-284501-5i0w74q4	24	21	proteins	protein	NNS
cord-284501-5i0w74q4	24	22	(	(	-LRB-
cord-284501-5i0w74q4	24	23	Nsp1	Nsp1	NNP
cord-284501-5i0w74q4	24	24	-	-	HYPH
cord-284501-5i0w74q4	24	25	16	16	CD
cord-284501-5i0w74q4	24	26	)	)	-RRB-
cord-284501-5i0w74q4	24	27	;	;	:
cord-284501-5i0w74q4	24	28	IBV	IBV	NNP
cord-284501-5i0w74q4	24	29	lacks	lack	VBZ
cord-284501-5i0w74q4	24	30	Nsp1	Nsp1	NNP
cord-284501-5i0w74q4	24	31	thereby	thereby	RB
cord-284501-5i0w74q4	24	32	encoding	encode	VBG
cord-284501-5i0w74q4	24	33	Nsp2-	Nsp2-	NNP
cord-284501-5i0w74q4	24	34	16	16	CD
cord-284501-5i0w74q4	24	35	.	.	.
cord-284501-5i0w74q4	25	1	We	-PRON-	PRP
cord-284501-5i0w74q4	25	2	have	have	VBP
cord-284501-5i0w74q4	25	3	previously	previously	RB
cord-284501-5i0w74q4	25	4	shown	show	VBN
cord-284501-5i0w74q4	25	5	that	that	IN
cord-284501-5i0w74q4	25	6	the	the	DT
cord-284501-5i0w74q4	25	7	IBV	IBV	NNP
cord-284501-5i0w74q4	25	8	accessory	accessory	NN
cord-284501-5i0w74q4	25	9	genes	gene	NNS
cord-284501-5i0w74q4	25	10	are	be	VBP
cord-284501-5i0w74q4	25	11	not	not	RB
cord-284501-5i0w74q4	25	12	required	require	VBN
cord-284501-5i0w74q4	25	13	for	for	IN
cord-284501-5i0w74q4	25	14	replication	replication	NN
cord-284501-5i0w74q4	25	15	in	in	IN
cord-284501-5i0w74q4	25	16	vitro	vitro	FW
cord-284501-5i0w74q4	25	17	[	[	-LRB-
cord-284501-5i0w74q4	25	18	17	17	CD
cord-284501-5i0w74q4	25	19	,	,	,
cord-284501-5i0w74q4	25	20	18	18	CD
cord-284501-5i0w74q4	25	21	]	]	-RRB-
cord-284501-5i0w74q4	25	22	;	;	:
cord-284501-5i0w74q4	25	23	however	however	RB
cord-284501-5i0w74q4	25	24	,	,	,
cord-284501-5i0w74q4	25	25	we	-PRON-	PRP
cord-284501-5i0w74q4	25	26	could	could	MD
cord-284501-5i0w74q4	25	27	not	not	RB
cord-284501-5i0w74q4	25	28	determine	determine	VB
cord-284501-5i0w74q4	25	29	any	any	DT
cord-284501-5i0w74q4	25	30	role	role	NN
cord-284501-5i0w74q4	25	31	of	of	IN
cord-284501-5i0w74q4	25	32	the	the	DT
cord-284501-5i0w74q4	25	33	IBV	IBV	NNP
cord-284501-5i0w74q4	25	34	accessory	accessory	NN
cord-284501-5i0w74q4	25	35	proteins	protein	NNS
cord-284501-5i0w74q4	25	36	in	in	IN
cord-284501-5i0w74q4	25	37	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	25	38	as	as	IN
cord-284501-5i0w74q4	25	39	our	-PRON-	PRP$
cord-284501-5i0w74q4	25	40	reverse	reverse	JJ
cord-284501-5i0w74q4	25	41	genetics	genetic	NNS
cord-284501-5i0w74q4	25	42	system	system	NN
cord-284501-5i0w74q4	25	43	is	be	VBZ
cord-284501-5i0w74q4	25	44	based	base	VBN
cord-284501-5i0w74q4	25	45	on	on	IN
cord-284501-5i0w74q4	25	46	the	the	DT
cord-284501-5i0w74q4	25	47	avirulent	avirulent	NN
cord-284501-5i0w74q4	25	48	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	25	49	strain	strain	NN
cord-284501-5i0w74q4	25	50	.	.	.
cord-284501-5i0w74q4	26	1	Replacement	replacement	NN
cord-284501-5i0w74q4	26	2	of	of	IN
cord-284501-5i0w74q4	26	3	the	the	DT
cord-284501-5i0w74q4	26	4	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	26	5	S	S	NNP
cord-284501-5i0w74q4	26	6	gene	gene	NN
cord-284501-5i0w74q4	26	7	with	with	IN
cord-284501-5i0w74q4	26	8	the	the	DT
cord-284501-5i0w74q4	26	9	corresponding	correspond	VBG
cord-284501-5i0w74q4	26	10	M41	M41	NNP
cord-284501-5i0w74q4	26	11	S	S	NNP
cord-284501-5i0w74q4	26	12	gene	gene	NN
cord-284501-5i0w74q4	26	13	sequence	sequence	NN
cord-284501-5i0w74q4	26	14	altered	alter	VBD
cord-284501-5i0w74q4	26	15	the	the	DT
cord-284501-5i0w74q4	26	16	tropism	tropism	NN
cord-284501-5i0w74q4	26	17	of	of	IN
cord-284501-5i0w74q4	26	18	the	the	DT
cord-284501-5i0w74q4	26	19	rIBV	ribv	NN
cord-284501-5i0w74q4	26	20	but	but	CC
cord-284501-5i0w74q4	26	21	did	do	VBD
cord-284501-5i0w74q4	26	22	not	not	RB
cord-284501-5i0w74q4	26	23	result	result	VB
cord-284501-5i0w74q4	26	24	in	in	IN
cord-284501-5i0w74q4	26	25	a	a	DT
cord-284501-5i0w74q4	26	26	change	change	NN
cord-284501-5i0w74q4	26	27	in	in	IN
cord-284501-5i0w74q4	26	28	virulence	virulence	NN
cord-284501-5i0w74q4	26	29	[	[	-LRB-
cord-284501-5i0w74q4	26	30	24	24	CD
cord-284501-5i0w74q4	26	31	]	]	-RRB-
cord-284501-5i0w74q4	26	32	[	[	-LRB-
cord-284501-5i0w74q4	26	33	25	25	CD
cord-284501-5i0w74q4	26	34	]	]	-RRB-
cord-284501-5i0w74q4	26	35	[	[	-LRB-
cord-284501-5i0w74q4	26	36	26	26	CD
cord-284501-5i0w74q4	26	37	]	]	-RRB-
cord-284501-5i0w74q4	26	38	.	.	.
cord-284501-5i0w74q4	27	1	This	this	DT
cord-284501-5i0w74q4	27	2	implied	imply	VBD
cord-284501-5i0w74q4	27	3	that	that	IN
cord-284501-5i0w74q4	27	4	although	although	IN
cord-284501-5i0w74q4	27	5	the	the	DT
cord-284501-5i0w74q4	27	6	IBV	IBV	NNP
cord-284501-5i0w74q4	27	7	S	S	NNP
cord-284501-5i0w74q4	27	8	gene	gene	NN
cord-284501-5i0w74q4	27	9	may	may	MD
cord-284501-5i0w74q4	27	10	play	play	VB
cord-284501-5i0w74q4	27	11	a	a	DT
cord-284501-5i0w74q4	27	12	role	role	NN
cord-284501-5i0w74q4	27	13	in	in	IN
cord-284501-5i0w74q4	27	14	virulence	virulence	NN
cord-284501-5i0w74q4	27	15	,	,	,
cord-284501-5i0w74q4	27	16	associated	associate	VBN
cord-284501-5i0w74q4	27	17	with	with	IN
cord-284501-5i0w74q4	27	18	tropism	tropism	NN
cord-284501-5i0w74q4	27	19	,	,	,
cord-284501-5i0w74q4	27	20	expression	expression	NN
cord-284501-5i0w74q4	27	21	of	of	IN
cord-284501-5i0w74q4	27	22	an	an	DT
cord-284501-5i0w74q4	27	23	S	S	NNP
cord-284501-5i0w74q4	27	24	gene	gene	NN
cord-284501-5i0w74q4	27	25	from	from	IN
cord-284501-5i0w74q4	27	26	a	a	DT
cord-284501-5i0w74q4	27	27	virulent	virulent	JJ
cord-284501-5i0w74q4	27	28	strain	strain	NN
cord-284501-5i0w74q4	27	29	alone	alone	RB
cord-284501-5i0w74q4	27	30	was	be	VBD
cord-284501-5i0w74q4	27	31	not	not	RB
cord-284501-5i0w74q4	27	32	sufficient	sufficient	JJ
cord-284501-5i0w74q4	27	33	to	to	TO
cord-284501-5i0w74q4	27	34	alter	alter	VB
cord-284501-5i0w74q4	27	35	the	the	DT
cord-284501-5i0w74q4	27	36	avirulent	avirulent	NN
cord-284501-5i0w74q4	27	37	phenotype	phenotype	NN
cord-284501-5i0w74q4	27	38	associated	associate	VBN
cord-284501-5i0w74q4	27	39	with	with	IN
cord-284501-5i0w74q4	27	40	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	27	41	.	.	.
cord-284501-5i0w74q4	28	1	Infectious	infectious	JJ
cord-284501-5i0w74q4	28	2	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	28	3	is	be	VBZ
cord-284501-5i0w74q4	28	4	mainly	mainly	RB
cord-284501-5i0w74q4	28	5	controlled	control	VBN
cord-284501-5i0w74q4	28	6	by	by	IN
cord-284501-5i0w74q4	28	7	the	the	DT
cord-284501-5i0w74q4	28	8	use	use	NN
cord-284501-5i0w74q4	28	9	of	of	IN
cord-284501-5i0w74q4	28	10	live	live	JJ
cord-284501-5i0w74q4	28	11	attenuated	attenuated	JJ
cord-284501-5i0w74q4	28	12	vaccines	vaccine	NNS
cord-284501-5i0w74q4	28	13	derived	derive	VBN
cord-284501-5i0w74q4	28	14	from	from	IN
cord-284501-5i0w74q4	28	15	virulent	virulent	JJ
cord-284501-5i0w74q4	28	16	viruses	virus	NNS
cord-284501-5i0w74q4	28	17	by	by	IN
cord-284501-5i0w74q4	28	18	multiple	multiple	JJ
cord-284501-5i0w74q4	28	19	serial	serial	JJ
cord-284501-5i0w74q4	28	20	passages	passage	NNS
cord-284501-5i0w74q4	28	21	,	,	,
cord-284501-5i0w74q4	28	22	usually	usually	RB
cord-284501-5i0w74q4	28	23	greater	great	JJR
cord-284501-5i0w74q4	28	24	than	than	IN
cord-284501-5i0w74q4	28	25	50	50	CD
cord-284501-5i0w74q4	28	26	passages	passage	NNS
cord-284501-5i0w74q4	28	27	,	,	,
cord-284501-5i0w74q4	28	28	in	in	IN
cord-284501-5i0w74q4	28	29	10	10	CD
cord-284501-5i0w74q4	28	30	-	-	HYPH
cord-284501-5i0w74q4	28	31	11-day	11-day	CD
cord-284501-5i0w74q4	28	32	-	-	HYPH
cord-284501-5i0w74q4	28	33	old	old	JJ
cord-284501-5i0w74q4	28	34	embryonated	embryonate	VBN
cord-284501-5i0w74q4	28	35	chicken	chicken	NN
cord-284501-5i0w74q4	28	36	eggs	egg	NNS
cord-284501-5i0w74q4	28	37	[	[	-LRB-
cord-284501-5i0w74q4	28	38	13	13	CD
cord-284501-5i0w74q4	28	39	,	,	,
cord-284501-5i0w74q4	28	40	[	[	-LRB-
cord-284501-5i0w74q4	28	41	27	27	CD
cord-284501-5i0w74q4	28	42	]	]	-RRB-
cord-284501-5i0w74q4	28	43	[	[	-LRB-
cord-284501-5i0w74q4	28	44	28	28	CD
cord-284501-5i0w74q4	28	45	]	]	-RRB-
cord-284501-5i0w74q4	28	46	[	[	-LRB-
cord-284501-5i0w74q4	28	47	29	29	CD
cord-284501-5i0w74q4	28	48	]	]	-RRB-
cord-284501-5i0w74q4	28	49	.	.	.
cord-284501-5i0w74q4	29	1	As	as	IN
cord-284501-5i0w74q4	29	2	a	a	DT
cord-284501-5i0w74q4	29	3	consequence	consequence	NN
cord-284501-5i0w74q4	29	4	of	of	IN
cord-284501-5i0w74q4	29	5	this	this	DT
cord-284501-5i0w74q4	29	6	process	process	NN
cord-284501-5i0w74q4	29	7	the	the	DT
cord-284501-5i0w74q4	29	8	virus	virus	NN
cord-284501-5i0w74q4	29	9	becomes	become	VBZ
cord-284501-5i0w74q4	29	10	more	more	RBR
cord-284501-5i0w74q4	29	11	adapted	adapt	VBN
cord-284501-5i0w74q4	29	12	for	for	IN
cord-284501-5i0w74q4	29	13	the	the	DT
cord-284501-5i0w74q4	29	14	embryo	embryo	NN
cord-284501-5i0w74q4	29	15	,	,	,
cord-284501-5i0w74q4	29	16	reflected	reflect	VBN
cord-284501-5i0w74q4	29	17	by	by	IN
cord-284501-5i0w74q4	29	18	more	more	RBR
cord-284501-5i0w74q4	29	19	efficient	efficient	JJ
cord-284501-5i0w74q4	29	20	replication	replication	NN
cord-284501-5i0w74q4	29	21	and	and	CC
cord-284501-5i0w74q4	29	22	higher	high	JJR
cord-284501-5i0w74q4	29	23	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	29	24	for	for	IN
cord-284501-5i0w74q4	29	25	the	the	DT
cord-284501-5i0w74q4	29	26	embryo	embryo	NN
cord-284501-5i0w74q4	29	27	,	,	,
cord-284501-5i0w74q4	29	28	with	with	IN
cord-284501-5i0w74q4	29	29	concomitant	concomitant	JJ
cord-284501-5i0w74q4	29	30	attenuation	attenuation	NN
cord-284501-5i0w74q4	29	31	for	for	IN
cord-284501-5i0w74q4	29	32	chickens	chicken	NNS
cord-284501-5i0w74q4	29	33	and	and	CC
cord-284501-5i0w74q4	29	34	in	in	IN
cord-284501-5i0w74q4	29	35	some	some	DT
cord-284501-5i0w74q4	29	36	cases	case	NNS
cord-284501-5i0w74q4	29	37	loss	loss	NN
cord-284501-5i0w74q4	29	38	of	of	IN
cord-284501-5i0w74q4	29	39	immunogenicity	immunogenicity	NN
cord-284501-5i0w74q4	29	40	.	.	.
cord-284501-5i0w74q4	30	1	However	however	RB
cord-284501-5i0w74q4	30	2	,	,	,
cord-284501-5i0w74q4	30	3	the	the	DT
cord-284501-5i0w74q4	30	4	mutations	mutation	NNS
cord-284501-5i0w74q4	30	5	associated	associate	VBN
cord-284501-5i0w74q4	30	6	with	with	IN
cord-284501-5i0w74q4	30	7	attenuation	attenuation	NN
cord-284501-5i0w74q4	30	8	of	of	IN
cord-284501-5i0w74q4	30	9	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	30	10	for	for	IN
cord-284501-5i0w74q4	30	11	the	the	DT
cord-284501-5i0w74q4	30	12	chicken	chicken	NN
cord-284501-5i0w74q4	30	13	are	be	VBP
cord-284501-5i0w74q4	30	14	unknown	unknown	JJ
cord-284501-5i0w74q4	30	15	and	and	CC
cord-284501-5i0w74q4	30	16	variable	variable	JJ
cord-284501-5i0w74q4	30	17	leading	lead	VBG
cord-284501-5i0w74q4	30	18	to	to	IN
cord-284501-5i0w74q4	30	19	differing	differ	VBG
cord-284501-5i0w74q4	30	20	efficacies	efficacy	NNS
cord-284501-5i0w74q4	30	21	associated	associate	VBN
cord-284501-5i0w74q4	30	22	with	with	IN
cord-284501-5i0w74q4	30	23	different	different	JJ
cord-284501-5i0w74q4	30	24	vaccines	vaccine	NNS
cord-284501-5i0w74q4	30	25	.	.	.
cord-284501-5i0w74q4	31	1	Our	-PRON-	PRP$
cord-284501-5i0w74q4	31	2	previous	previous	JJ
cord-284501-5i0w74q4	31	3	studies	study	NNS
cord-284501-5i0w74q4	31	4	have	have	VBP
cord-284501-5i0w74q4	31	5	shown	show	VBN
cord-284501-5i0w74q4	31	6	that	that	DT
cord-284501-5i0w74q4	31	7	replacement	replacement	NN
cord-284501-5i0w74q4	31	8	of	of	IN
cord-284501-5i0w74q4	31	9	the	the	DT
cord-284501-5i0w74q4	31	10	S	S	NNP
cord-284501-5i0w74q4	31	11	gene	gene	NN
cord-284501-5i0w74q4	31	12	from	from	IN
cord-284501-5i0w74q4	31	13	the	the	DT
cord-284501-5i0w74q4	31	14	avirulent	avirulent	NN
cord-284501-5i0w74q4	32	1	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	32	2	isolate	isolate	VBP
cord-284501-5i0w74q4	32	3	with	with	IN
cord-284501-5i0w74q4	32	4	that	that	DT
cord-284501-5i0w74q4	32	5	from	from	IN
cord-284501-5i0w74q4	32	6	a	a	DT
cord-284501-5i0w74q4	32	7	virulent	virulent	JJ
cord-284501-5i0w74q4	32	8	virus	virus	NN
cord-284501-5i0w74q4	32	9	(	(	-LRB-
cord-284501-5i0w74q4	32	10	M41	M41	NNP
cord-284501-5i0w74q4	32	11	)	)	-RRB-
cord-284501-5i0w74q4	32	12	did	do	VBD
cord-284501-5i0w74q4	32	13	not	not	RB
cord-284501-5i0w74q4	32	14	restore	restore	VB
cord-284501-5i0w74q4	32	15	virulence	virulence	NN
cord-284501-5i0w74q4	32	16	but	but	CC
cord-284501-5i0w74q4	32	17	did	do	VBD
cord-284501-5i0w74q4	32	18	alter	alter	VB
cord-284501-5i0w74q4	32	19	the	the	DT
cord-284501-5i0w74q4	32	20	tropism	tropism	NN
cord-284501-5i0w74q4	32	21	of	of	IN
cord-284501-5i0w74q4	32	22	the	the	DT
cord-284501-5i0w74q4	32	23	rIBV	ribv	NN
cord-284501-5i0w74q4	32	24	and	and	CC
cord-284501-5i0w74q4	32	25	restore	restore	VB
cord-284501-5i0w74q4	32	26	immunogenicity	immunogenicity	NN
cord-284501-5i0w74q4	32	27	for	for	IN
cord-284501-5i0w74q4	32	28	subsequent	subsequent	JJ
cord-284501-5i0w74q4	32	29	challenge	challenge	NN
cord-284501-5i0w74q4	32	30	with	with	IN
cord-284501-5i0w74q4	32	31	M41	M41	NNP
cord-284501-5i0w74q4	32	32	.	.	.
cord-284501-5i0w74q4	33	1	Previously	previously	RB
cord-284501-5i0w74q4	33	2	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	33	3	had	have	VBD
cord-284501-5i0w74q4	33	4	been	be	VBN
cord-284501-5i0w74q4	33	5	considered	consider	VBN
cord-284501-5i0w74q4	33	6	to	to	TO
cord-284501-5i0w74q4	33	7	be	be	VB
cord-284501-5i0w74q4	33	8	poorly	poorly	RB
cord-284501-5i0w74q4	33	9	immunogenic	immunogenic	JJ
cord-284501-5i0w74q4	33	10	and	and	CC
cord-284501-5i0w74q4	33	11	never	never	RB
cord-284501-5i0w74q4	33	12	used	use	VBN
cord-284501-5i0w74q4	33	13	as	as	IN
cord-284501-5i0w74q4	33	14	a	a	DT
cord-284501-5i0w74q4	33	15	vaccine	vaccine	NN
cord-284501-5i0w74q4	33	16	strain	strain	NN
cord-284501-5i0w74q4	33	17	[	[	-LRB-
cord-284501-5i0w74q4	33	18	30	30	CD
cord-284501-5i0w74q4	33	19	]	]	-RRB-
cord-284501-5i0w74q4	33	20	.	.	.
cord-284501-5i0w74q4	34	1	In	in	IN
cord-284501-5i0w74q4	34	2	this	this	DT
cord-284501-5i0w74q4	34	3	study	study	NN
cord-284501-5i0w74q4	34	4	,	,	,
cord-284501-5i0w74q4	34	5	we	-PRON-	PRP
cord-284501-5i0w74q4	34	6	describe	describe	VBP
cord-284501-5i0w74q4	34	7	the	the	DT
cord-284501-5i0w74q4	34	8	generation	generation	NN
cord-284501-5i0w74q4	34	9	of	of	IN
cord-284501-5i0w74q4	34	10	recombinant	recombinant	JJ
cord-284501-5i0w74q4	34	11	IBVs	ibv	NNS
cord-284501-5i0w74q4	34	12	that	that	WDT
cord-284501-5i0w74q4	34	13	consisted	consist	VBD
cord-284501-5i0w74q4	34	14	of	of	IN
cord-284501-5i0w74q4	34	15	the	the	DT
cord-284501-5i0w74q4	34	16	replicase	replicase	NN
cord-284501-5i0w74q4	34	17	gene	gene	NN
cord-284501-5i0w74q4	34	18	from	from	IN
cord-284501-5i0w74q4	34	19	the	the	DT
cord-284501-5i0w74q4	34	20	avirulent	avirulent	JJ
cord-284501-5i0w74q4	34	21	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	34	22	strain	strain	NN
cord-284501-5i0w74q4	34	23	and	and	CC
cord-284501-5i0w74q4	34	24	the	the	DT
cord-284501-5i0w74q4	34	25	structural	structural	JJ
cord-284501-5i0w74q4	34	26	and	and	CC
cord-284501-5i0w74q4	34	27	accessory	accessory	JJ
cord-284501-5i0w74q4	34	28	genes	gene	NNS
cord-284501-5i0w74q4	34	29	from	from	IN
cord-284501-5i0w74q4	34	30	the	the	DT
cord-284501-5i0w74q4	34	31	virulent	virulent	JJ
cord-284501-5i0w74q4	34	32	M41	m41	JJ
cord-284501-5i0w74q4	34	33	isolate	isolate	NN
cord-284501-5i0w74q4	34	34	of	of	IN
cord-284501-5i0w74q4	34	35	IBV	IBV	NNP
cord-284501-5i0w74q4	34	36	,	,	,
cord-284501-5i0w74q4	34	37	to	to	TO
cord-284501-5i0w74q4	34	38	determine	determine	VB
cord-284501-5i0w74q4	34	39	whether	whether	IN
cord-284501-5i0w74q4	34	40	the	the	DT
cord-284501-5i0w74q4	34	41	replicase	replicase	NN
cord-284501-5i0w74q4	34	42	or	or	CC
cord-284501-5i0w74q4	34	43	the	the	DT
cord-284501-5i0w74q4	34	44	combination	combination	NN
cord-284501-5i0w74q4	34	45	of	of	IN
cord-284501-5i0w74q4	34	46	the	the	DT
cord-284501-5i0w74q4	34	47	structural	structural	JJ
cord-284501-5i0w74q4	34	48	and	and	CC
cord-284501-5i0w74q4	34	49	accessory	accessory	JJ
cord-284501-5i0w74q4	34	50	genes	gene	NNS
cord-284501-5i0w74q4	34	51	of	of	IN
cord-284501-5i0w74q4	34	52	IBV	IBV	NNP
cord-284501-5i0w74q4	34	53	play	play	VBP
cord-284501-5i0w74q4	34	54	a	a	DT
cord-284501-5i0w74q4	34	55	role	role	NN
cord-284501-5i0w74q4	34	56	in	in	IN
cord-284501-5i0w74q4	34	57	pathogenesis	pathogenesis	NN
cord-284501-5i0w74q4	34	58	.	.	.
cord-284501-5i0w74q4	35	1	The	the	DT
cord-284501-5i0w74q4	35	2	growth	growth	NN
cord-284501-5i0w74q4	35	3	of	of	IN
cord-284501-5i0w74q4	35	4	IBV	IBV	NNP
cord-284501-5i0w74q4	35	5	in	in	IN
cord-284501-5i0w74q4	35	6	chick	chick	NN
cord-284501-5i0w74q4	35	7	kidney	kidney	NN
cord-284501-5i0w74q4	35	8	(	(	-LRB-
cord-284501-5i0w74q4	35	9	CK	CK	NNP
cord-284501-5i0w74q4	35	10	)	)	-RRB-
cord-284501-5i0w74q4	35	11	cells	cell	NNS
cord-284501-5i0w74q4	35	12	was	be	VBD
cord-284501-5i0w74q4	35	13	as	as	IN
cord-284501-5i0w74q4	35	14	described	describe	VBN
cord-284501-5i0w74q4	35	15	previously	previously	RB
cord-284501-5i0w74q4	35	16	[	[	-LRB-
cord-284501-5i0w74q4	35	17	31	31	CD
cord-284501-5i0w74q4	35	18	]	]	-RRB-
cord-284501-5i0w74q4	35	19	[	[	-LRB-
cord-284501-5i0w74q4	35	20	32	32	CD
cord-284501-5i0w74q4	35	21	]	]	-RRB-
cord-284501-5i0w74q4	35	22	[	[	-LRB-
cord-284501-5i0w74q4	35	23	33	33	CD
cord-284501-5i0w74q4	35	24	]	]	-RRB-
cord-284501-5i0w74q4	35	25	.	.	.
cord-284501-5i0w74q4	36	1	The	the	DT
cord-284501-5i0w74q4	36	2	IBV	IBV	NNP
cord-284501-5i0w74q4	36	3	isolates	isolate	NNS
cord-284501-5i0w74q4	36	4	used	use	VBN
cord-284501-5i0w74q4	36	5	were	be	VBD
cord-284501-5i0w74q4	36	6	:	:	:
cord-284501-5i0w74q4	36	7	(	(	-LRB-
cord-284501-5i0w74q4	36	8	1	1	LS
cord-284501-5i0w74q4	36	9	)	)	-RRB-
cord-284501-5i0w74q4	36	10	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	36	11	-	-	HYPH
cord-284501-5i0w74q4	36	12	CK	CK	NNP
cord-284501-5i0w74q4	36	13	(	(	-LRB-
cord-284501-5i0w74q4	36	14	Beau	Beau	NNP
cord-284501-5i0w74q4	36	15	-	-	HYPH
cord-284501-5i0w74q4	36	16	CK	CK	NNP
cord-284501-5i0w74q4	36	17	;	;	:
cord-284501-5i0w74q4	36	18	[	[	-LRB-
cord-284501-5i0w74q4	36	19	34	34	CD
cord-284501-5i0w74q4	36	20	]	]	-RRB-
cord-284501-5i0w74q4	36	21	)	)	-RRB-
cord-284501-5i0w74q4	36	22	,	,	,
cord-284501-5i0w74q4	36	23	a	a	DT
cord-284501-5i0w74q4	36	24	virus	virus	NN
cord-284501-5i0w74q4	36	25	adapted	adapt	VBN
cord-284501-5i0w74q4	36	26	for	for	IN
cord-284501-5i0w74q4	36	27	growth	growth	NN
cord-284501-5i0w74q4	36	28	in	in	IN
cord-284501-5i0w74q4	36	29	CK	CK	NNP
cord-284501-5i0w74q4	36	30	cells	cell	NNS
cord-284501-5i0w74q4	36	31	that	that	WDT
cord-284501-5i0w74q4	36	32	can	can	MD
cord-284501-5i0w74q4	36	33	grow	grow	VB
cord-284501-5i0w74q4	36	34	on	on	RP
cord-284501-5i0w74q4	36	35	but	but	CC
cord-284501-5i0w74q4	36	36	has	have	VBZ
cord-284501-5i0w74q4	36	37	not	not	RB
cord-284501-5i0w74q4	36	38	been	be	VBN
cord-284501-5i0w74q4	36	39	adapted	adapt	VBN
cord-284501-5i0w74q4	36	40	for	for	IN
cord-284501-5i0w74q4	36	41	growth	growth	NN
cord-284501-5i0w74q4	36	42	in	in	IN
cord-284501-5i0w74q4	36	43	Vero	Vero	NNP
cord-284501-5i0w74q4	36	44	cells	cell	NNS
cord-284501-5i0w74q4	36	45	,	,	,
cord-284501-5i0w74q4	36	46	an	an	DT
cord-284501-5i0w74q4	36	47	African	african	JJ
cord-284501-5i0w74q4	36	48	green	green	JJ
cord-284501-5i0w74q4	36	49	monkey	monkey	NN
cord-284501-5i0w74q4	36	50	cell	cell	NN
cord-284501-5i0w74q4	36	51	line	line	NN
cord-284501-5i0w74q4	36	52	;	;	,
cord-284501-5i0w74q4	36	53	(	(	-LRB-
cord-284501-5i0w74q4	36	54	2	2	LS
cord-284501-5i0w74q4	36	55	)	)	-RRB-
cord-284501-5i0w74q4	36	56	Beau	Beau	NNP
cord-284501-5i0w74q4	36	57	-	-	HYPH
cord-284501-5i0w74q4	36	58	R	R	NNP
cord-284501-5i0w74q4	36	59	,	,	,
cord-284501-5i0w74q4	36	60	a	a	DT
cord-284501-5i0w74q4	36	61	recombinant	recombinant	JJ
cord-284501-5i0w74q4	36	62	IBV	IBV	NNP
cord-284501-5i0w74q4	36	63	(	(	-LRB-
cord-284501-5i0w74q4	36	64	rIBV	ribv	NN
cord-284501-5i0w74q4	36	65	)	)	-RRB-
cord-284501-5i0w74q4	36	66	produced	produce	VBN
cord-284501-5i0w74q4	36	67	from	from	IN
cord-284501-5i0w74q4	36	68	a	a	DT
cord-284501-5i0w74q4	36	69	full	full	JJ
cord-284501-5i0w74q4	36	70	-	-	HYPH
cord-284501-5i0w74q4	36	71	length	length	NN
cord-284501-5i0w74q4	36	72	cDNA	cdna	NN
cord-284501-5i0w74q4	36	73	of	of	IN
cord-284501-5i0w74q4	36	74	Beau	Beau	NNP
cord-284501-5i0w74q4	36	75	-	-	HYPH
cord-284501-5i0w74q4	36	76	CK	CK	NNP
cord-284501-5i0w74q4	36	77	using	use	VBG
cord-284501-5i0w74q4	36	78	our	-PRON-	PRP$
cord-284501-5i0w74q4	36	79	IBV	IBV	NNP
cord-284501-5i0w74q4	36	80	reverse	reverse	JJ
cord-284501-5i0w74q4	36	81	genetics	genetics	NN
cord-284501-5i0w74q4	36	82	system	system	NN
cord-284501-5i0w74q4	36	83	[	[	-LRB-
cord-284501-5i0w74q4	36	84	35	35	CD
cord-284501-5i0w74q4	36	85	]	]	-RRB-
cord-284501-5i0w74q4	36	86	;	;	:
cord-284501-5i0w74q4	36	87	and	and	CC
cord-284501-5i0w74q4	36	88	(	(	-LRB-
cord-284501-5i0w74q4	36	89	3	3	LS
cord-284501-5i0w74q4	36	90	)	)	-RRB-
cord-284501-5i0w74q4	36	91	M41-CK	m41-ck	CD
cord-284501-5i0w74q4	36	92	,	,	,
cord-284501-5i0w74q4	36	93	an	an	DT
cord-284501-5i0w74q4	36	94	isolate	isolate	NN
cord-284501-5i0w74q4	36	95	derived	derive	VBN
cord-284501-5i0w74q4	36	96	from	from	IN
cord-284501-5i0w74q4	36	97	M41	M41	NNP
cord-284501-5i0w74q4	36	98	[	[	-LRB-
cord-284501-5i0w74q4	36	99	36	36	CD
cord-284501-5i0w74q4	36	100	]	]	-RRB-
cord-284501-5i0w74q4	36	101	following	follow	VBG
cord-284501-5i0w74q4	36	102	adaption	adaption	NN
cord-284501-5i0w74q4	36	103	to	to	IN
cord-284501-5i0w74q4	36	104	growth	growth	NN
cord-284501-5i0w74q4	36	105	on	on	IN
cord-284501-5i0w74q4	36	106	CK	CK	NNP
cord-284501-5i0w74q4	36	107	cells	cell	NNS
cord-284501-5i0w74q4	36	108	.	.	.
cord-284501-5i0w74q4	37	1	Both	both	DT
cord-284501-5i0w74q4	37	2	the	the	DT
cord-284501-5i0w74q4	37	3	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	37	4	and	and	CC
cord-284501-5i0w74q4	37	5	M41	m41	JJ
cord-284501-5i0w74q4	37	6	strains	strain	NNS
cord-284501-5i0w74q4	37	7	of	of	IN
cord-284501-5i0w74q4	37	8	IBV	IBV	NNP
cord-284501-5i0w74q4	37	9	belong	belong	VBP
cord-284501-5i0w74q4	37	10	to	to	IN
cord-284501-5i0w74q4	37	11	the	the	DT
cord-284501-5i0w74q4	37	12	same	same	JJ
cord-284501-5i0w74q4	37	13	,	,	,
cord-284501-5i0w74q4	37	14	Massachusetts	Massachusetts	NNP
cord-284501-5i0w74q4	37	15	,	,	,
cord-284501-5i0w74q4	37	16	serotype	serotype	NN
cord-284501-5i0w74q4	37	17	.	.	.
cord-284501-5i0w74q4	38	1	All	all	DT
cord-284501-5i0w74q4	38	2	IBV	IBV	NNP
cord-284501-5i0w74q4	38	3	strains	strain	NNS
cord-284501-5i0w74q4	38	4	were	be	VBD
cord-284501-5i0w74q4	38	5	titrated	titrate	VBN
cord-284501-5i0w74q4	38	6	in	in	IN
cord-284501-5i0w74q4	38	7	CK	CK	NNP
cord-284501-5i0w74q4	38	8	cells	cell	NNS
cord-284501-5i0w74q4	38	9	.	.	.
cord-284501-5i0w74q4	39	1	Vaccinia	vaccinia	NN
cord-284501-5i0w74q4	39	2	viruses	virus	NNS
cord-284501-5i0w74q4	39	3	were	be	VBD
cord-284501-5i0w74q4	39	4	grown	grow	VBN
cord-284501-5i0w74q4	39	5	and	and	CC
cord-284501-5i0w74q4	39	6	titrated	titrate	VBN
cord-284501-5i0w74q4	39	7	on	on	IN
cord-284501-5i0w74q4	39	8	Vero	Vero	NNP
cord-284501-5i0w74q4	39	9	cells	cell	NNS
cord-284501-5i0w74q4	39	10	and	and	CC
cord-284501-5i0w74q4	39	11	large	large	JJ
cord-284501-5i0w74q4	39	12	stocks	stock	NNS
cord-284501-5i0w74q4	39	13	for	for	IN
cord-284501-5i0w74q4	39	14	DNA	dna	NN
cord-284501-5i0w74q4	39	15	isolation	isolation	NN
cord-284501-5i0w74q4	39	16	were	be	VBD
cord-284501-5i0w74q4	39	17	grown	grow	VBN
cord-284501-5i0w74q4	39	18	in	in	IN
cord-284501-5i0w74q4	39	19	BHK-21	BHK-21	NNP
cord-284501-5i0w74q4	39	20	cells	cell	NNS
cord-284501-5i0w74q4	39	21	[	[	-LRB-
cord-284501-5i0w74q4	39	22	37	37	CD
cord-284501-5i0w74q4	39	23	]	]	-RRB-
cord-284501-5i0w74q4	39	24	.	.	.
cord-284501-5i0w74q4	40	1	All	all	DT
cord-284501-5i0w74q4	40	2	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	40	3	and	and	CC
cord-284501-5i0w74q4	40	4	amino	amino	NN
cord-284501-5i0w74q4	40	5	acid	acid	NN
cord-284501-5i0w74q4	40	6	residue	residue	NN
cord-284501-5i0w74q4	40	7	numbers	number	NNS
cord-284501-5i0w74q4	40	8	refer	refer	VBP
cord-284501-5i0w74q4	40	9	to	to	IN
cord-284501-5i0w74q4	40	10	the	the	DT
cord-284501-5i0w74q4	40	11	positions	position	NNS
cord-284501-5i0w74q4	40	12	in	in	IN
cord-284501-5i0w74q4	40	13	IBV	IBV	NNP
cord-284501-5i0w74q4	40	14	Beau	Beau	NNP
cord-284501-5i0w74q4	40	15	-	-	HYPH
cord-284501-5i0w74q4	40	16	R	R	NNP
cord-284501-5i0w74q4	40	17	[	[	-LRB-
cord-284501-5i0w74q4	40	18	35	35	CD
cord-284501-5i0w74q4	40	19	]	]	-RRB-
cord-284501-5i0w74q4	41	1	accession	accession	NN
cord-284501-5i0w74q4	41	2	N	N	NNP
cord-284501-5i0w74q4	41	3	o	o	NN
cord-284501-5i0w74q4	41	4	AJ311317	AJ311317	NNP
cord-284501-5i0w74q4	41	5	.	.	.
cord-284501-5i0w74q4	42	1	The	the	DT
cord-284501-5i0w74q4	42	2	region	region	NN
cord-284501-5i0w74q4	42	3	of	of	IN
cord-284501-5i0w74q4	42	4	the	the	DT
cord-284501-5i0w74q4	42	5	IBV	IBV	NNP
cord-284501-5i0w74q4	42	6	M41	M41	NNP
cord-284501-5i0w74q4	42	7	genome	genome	NN
cord-284501-5i0w74q4	42	8	corresponding	correspond	VBG
cord-284501-5i0w74q4	42	9	to	to	IN
cord-284501-5i0w74q4	42	10	the	the	DT
cord-284501-5i0w74q4	42	11	structural	structural	JJ
cord-284501-5i0w74q4	42	12	,	,	,
cord-284501-5i0w74q4	42	13	accessory	accessory	NN
cord-284501-5i0w74q4	42	14	genes	gene	NNS
cord-284501-5i0w74q4	42	15	and	and	CC
cord-284501-5i0w74q4	42	16	the	the	DT
cord-284501-5i0w74q4	42	17	39-UTR	39-utr	CD
cord-284501-5i0w74q4	42	18	was	be	VBD
cord-284501-5i0w74q4	42	19	ligated	ligate	VBN
cord-284501-5i0w74q4	42	20	onto	onto	IN
cord-284501-5i0w74q4	42	21	the	the	DT
cord-284501-5i0w74q4	42	22	last	last	JJ
cord-284501-5i0w74q4	42	23	1416	1416	CD
cord-284501-5i0w74q4	42	24	nt	nt	RB
cord-284501-5i0w74q4	42	25	of	of	IN
cord-284501-5i0w74q4	42	26	the	the	DT
cord-284501-5i0w74q4	42	27	Beau	Beau	NNP
cord-284501-5i0w74q4	42	28	-	-	HYPH
cord-284501-5i0w74q4	42	29	R	R	NNP
cord-284501-5i0w74q4	42	30	replicase	replicase	NN
cord-284501-5i0w74q4	42	31	gene	gene	NN
cord-284501-5i0w74q4	42	32	and	and	CC
cord-284501-5i0w74q4	42	33	inserted	insert	VBD
cord-284501-5i0w74q4	42	34	into	into	IN
cord-284501-5i0w74q4	42	35	HindIII	HindIII	NNS
cord-284501-5i0w74q4	42	36	and	and	CC
cord-284501-5i0w74q4	42	37	SalI	SalI	NNP
cord-284501-5i0w74q4	42	38	digested	digest	VBD
cord-284501-5i0w74q4	42	39	pGPT-	pgpt-	IN
cord-284501-5i0w74q4	43	1	NEB193	NEB193	NNP
cord-284501-5i0w74q4	44	1	[	[	-LRB-
cord-284501-5i0w74q4	44	2	25	25	CD
cord-284501-5i0w74q4	44	3	]	]	-RRB-
cord-284501-5i0w74q4	44	4	.	.	.
cord-284501-5i0w74q4	45	1	The	the	DT
cord-284501-5i0w74q4	45	2	resulting	result	VBG
cord-284501-5i0w74q4	45	3	plasmid	plasmid	NN
cord-284501-5i0w74q4	45	4	,	,	,
cord-284501-5i0w74q4	45	5	pGPT	pGPT	NNS
cord-284501-5i0w74q4	45	6	-	-	HYPH
cord-284501-5i0w74q4	45	7	BeauR	BeauR	NNP
cord-284501-5i0w74q4	45	8	-	-	HYPH
cord-284501-5i0w74q4	45	9	Rep	Rep	NNP
cord-284501-5i0w74q4	45	10	-	-	HYPH
cord-284501-5i0w74q4	45	11	M41-Struct-3UTR	M41-Struct-3UTR	NNP
cord-284501-5i0w74q4	45	12	,	,	,
cord-284501-5i0w74q4	45	13	consisted	consist	VBN
cord-284501-5i0w74q4	45	14	of	of	IN
cord-284501-5i0w74q4	45	15	the	the	DT
cord-284501-5i0w74q4	45	16	39-end	39-end	CD
cord-284501-5i0w74q4	45	17	of	of	IN
cord-284501-5i0w74q4	45	18	the	the	DT
cord-284501-5i0w74q4	45	19	replicase	replicase	NN
cord-284501-5i0w74q4	45	20	gene	gene	NN
cord-284501-5i0w74q4	45	21	of	of	IN
cord-284501-5i0w74q4	45	22	Beau	Beau	NNP
cord-284501-5i0w74q4	45	23	-	-	HYPH
cord-284501-5i0w74q4	45	24	R	R	NNP
cord-284501-5i0w74q4	45	25	,	,	,
cord-284501-5i0w74q4	45	26	and	and	CC
cord-284501-5i0w74q4	45	27	the	the	DT
cord-284501-5i0w74q4	45	28	region	region	NN
cord-284501-5i0w74q4	45	29	of	of	IN
cord-284501-5i0w74q4	45	30	the	the	DT
cord-284501-5i0w74q4	45	31	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	45	32	genome	genome	NN
cord-284501-5i0w74q4	45	33	encoding	encode	VBG
cord-284501-5i0w74q4	45	34	the	the	DT
cord-284501-5i0w74q4	45	35	structural	structural	JJ
cord-284501-5i0w74q4	45	36	and	and	CC
cord-284501-5i0w74q4	45	37	accessory	accessory	NN
cord-284501-5i0w74q4	45	38	genes	gene	NNS
cord-284501-5i0w74q4	45	39	terminated	terminate	VBN
cord-284501-5i0w74q4	45	40	by	by	IN
cord-284501-5i0w74q4	45	41	the	the	DT
cord-284501-5i0w74q4	45	42	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	45	43	derived	derive	VBN
cord-284501-5i0w74q4	45	44	39UTR	39utr	CD
cord-284501-5i0w74q4	45	45	(	(	-LRB-
cord-284501-5i0w74q4	45	46	Fig	fig	NN
cord-284501-5i0w74q4	45	47	.	.	.
cord-284501-5i0w74q4	45	48	1	1	CD
cord-284501-5i0w74q4	45	49	)	)	-RRB-
cord-284501-5i0w74q4	45	50	.	.	.
cord-284501-5i0w74q4	46	1	The	the	DT
cord-284501-5i0w74q4	46	2	IBV	IBV	NNP
cord-284501-5i0w74q4	46	3	cDNA	cdna	NN
cord-284501-5i0w74q4	46	4	within	within	IN
cord-284501-5i0w74q4	46	5	pGPT	pGPT	NNS
cord-284501-5i0w74q4	46	6	-	-	HYPH
cord-284501-5i0w74q4	46	7	BeauR	BeauR	NNP
cord-284501-5i0w74q4	46	8	-	-	HYPH
cord-284501-5i0w74q4	46	9	Rep	Rep	NNP
cord-284501-5i0w74q4	46	10	-	-	HYPH
cord-284501-5i0w74q4	46	11	M41-Struct-3UTR	M41-Struct-3UTR	NNP
cord-284501-5i0w74q4	46	12	was	be	VBD
cord-284501-5i0w74q4	46	13	introduced	introduce	VBN
cord-284501-5i0w74q4	46	14	,	,	,
cord-284501-5i0w74q4	46	15	by	by	IN
cord-284501-5i0w74q4	46	16	homologous	homologous	JJ
cord-284501-5i0w74q4	46	17	recombination	recombination	NN
cord-284501-5i0w74q4	46	18	using	use	VBG
cord-284501-5i0w74q4	46	19	the	the	DT
cord-284501-5i0w74q4	46	20	transient	transient	JJ
cord-284501-5i0w74q4	46	21	dominant	dominant	JJ
cord-284501-5i0w74q4	46	22	selection	selection	NN
cord-284501-5i0w74q4	46	23	(	(	-LRB-
cord-284501-5i0w74q4	46	24	TDS	TDS	NNP
cord-284501-5i0w74q4	46	25	)	)	-RRB-
cord-284501-5i0w74q4	46	26	(	(	-LRB-
cord-284501-5i0w74q4	46	27	[	[	-LRB-
cord-284501-5i0w74q4	46	28	25	25	CD
cord-284501-5i0w74q4	46	29	,	,	,
cord-284501-5i0w74q4	46	30	37	37	CD
cord-284501-5i0w74q4	46	31	]	]	-RRB-
cord-284501-5i0w74q4	46	32	)	)	-RRB-
cord-284501-5i0w74q4	46	33	,	,	,
cord-284501-5i0w74q4	46	34	into	into	IN
cord-284501-5i0w74q4	46	35	the	the	DT
cord-284501-5i0w74q4	46	36	IBV	IBV	NNP
cord-284501-5i0w74q4	46	37	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	46	38	cDNA	cdna	NN
cord-284501-5i0w74q4	46	39	within	within	IN
cord-284501-5i0w74q4	46	40	the	the	DT
cord-284501-5i0w74q4	46	41	vaccinia	vaccinia	NN
cord-284501-5i0w74q4	46	42	virus	virus	NN
cord-284501-5i0w74q4	46	43	genome	genome	NN
cord-284501-5i0w74q4	46	44	in	in	IN
cord-284501-5i0w74q4	46	45	rVV	rVV	NNP
cord-284501-5i0w74q4	46	46	-	-	HYPH
cord-284501-5i0w74q4	46	47	BeauR	BeauR	NNP
cord-284501-5i0w74q4	46	48	-	-	HYPH
cord-284501-5i0w74q4	46	49	Rep	Rep	NNP
cord-284501-5i0w74q4	46	50	-	-	HYPH
cord-284501-5i0w74q4	46	51	DStruct	DStruct	NNP
cord-284501-5i0w74q4	46	52	containing	contain	VBG
cord-284501-5i0w74q4	46	53	Beau	Beau	NNP
cord-284501-5i0w74q4	46	54	-	-	HYPH
cord-284501-5i0w74q4	46	55	R	r	NN
cord-284501-5i0w74q4	46	56	-	-	HYPH
cord-284501-5i0w74q4	46	57	derived	derive	VBN
cord-284501-5i0w74q4	46	58	sequence	sequence	NN
cord-284501-5i0w74q4	46	59	corresponding	correspond	VBG
cord-284501-5i0w74q4	46	60	to	to	IN
cord-284501-5i0w74q4	46	61	the	the	DT
cord-284501-5i0w74q4	46	62	replicase	replicase	NN
cord-284501-5i0w74q4	46	63	gene	gene	NN
cord-284501-5i0w74q4	46	64	followed	follow	VBN
cord-284501-5i0w74q4	46	65	by	by	IN
cord-284501-5i0w74q4	46	66	the	the	DT
cord-284501-5i0w74q4	46	67	first	first	JJ
cord-284501-5i0w74q4	46	68	376	376	CD
cord-284501-5i0w74q4	46	69	nt	nt	RB
cord-284501-5i0w74q4	46	70	of	of	IN
cord-284501-5i0w74q4	46	71	the	the	DT
cord-284501-5i0w74q4	46	72	S	S	NNP
cord-284501-5i0w74q4	46	73	gene	gene	NN
cord-284501-5i0w74q4	46	74	,	,	,
cord-284501-5i0w74q4	46	75	part	part	NN
cord-284501-5i0w74q4	46	76	of	of	IN
cord-284501-5i0w74q4	46	77	the	the	DT
cord-284501-5i0w74q4	46	78	N	n	CD
cord-284501-5i0w74q4	46	79	gene	gene	NN
cord-284501-5i0w74q4	46	80	and	and	CC
cord-284501-5i0w74q4	46	81	the	the	DT
cord-284501-5i0w74q4	46	82	39-UTR	39-utr	CD
cord-284501-5i0w74q4	47	1	(	(	-LRB-
cord-284501-5i0w74q4	47	2	Fig	Fig	NNP
cord-284501-5i0w74q4	47	3	.	.	NNP
cord-284501-5i0w74q4	47	4	1	1	CD
cord-284501-5i0w74q4	47	5	)	)	-RRB-
cord-284501-5i0w74q4	47	6	.	.	.
cord-284501-5i0w74q4	48	1	Briefly	briefly	RB
cord-284501-5i0w74q4	48	2	,	,	,
cord-284501-5i0w74q4	48	3	50	50	CD
cord-284501-5i0w74q4	48	4	%	%	NN
cord-284501-5i0w74q4	48	5	confluent	confluent	JJ
cord-284501-5i0w74q4	48	6	monolayers	monolayer	NNS
cord-284501-5i0w74q4	48	7	of	of	IN
cord-284501-5i0w74q4	48	8	vero	vero	NNP
cord-284501-5i0w74q4	48	9	cells	cell	NNS
cord-284501-5i0w74q4	48	10	were	be	VBD
cord-284501-5i0w74q4	48	11	infected	infect	VBN
cord-284501-5i0w74q4	48	12	with	with	IN
cord-284501-5i0w74q4	48	13	rVV	rvv	CD
cord-284501-5i0w74q4	48	14	-	-	HYPH
cord-284501-5i0w74q4	48	15	BeauR	BeauR	NNP
cord-284501-5i0w74q4	48	16	-	-	HYPH
cord-284501-5i0w74q4	48	17	Rep	Rep	NNP
cord-284501-5i0w74q4	48	18	-	-	HYPH
cord-284501-5i0w74q4	48	19	DStruct	DStruct	NNP
cord-284501-5i0w74q4	48	20	,	,	,
cord-284501-5i0w74q4	48	21	containing	contain	VBG
cord-284501-5i0w74q4	48	22	the	the	DT
cord-284501-5i0w74q4	48	23	Beau	Beau	NNP
cord-284501-5i0w74q4	48	24	-	-	HYPH
cord-284501-5i0w74q4	48	25	R	r	NN
cord-284501-5i0w74q4	48	26	cDNA	cdna	NN
cord-284501-5i0w74q4	48	27	sequence	sequence	NN
cord-284501-5i0w74q4	48	28	,	,	,
cord-284501-5i0w74q4	48	29	at	at	IN
cord-284501-5i0w74q4	48	30	a	a	DT
cord-284501-5i0w74q4	48	31	MOI	MOI	NNP
cord-284501-5i0w74q4	48	32	of	of	IN
cord-284501-5i0w74q4	48	33	0.2	0.2	CD
cord-284501-5i0w74q4	48	34	and	and	CC
cord-284501-5i0w74q4	48	35	transfected	transfecte	VBD
cord-284501-5i0w74q4	48	36	2	2	CD
cord-284501-5i0w74q4	48	37	h	h	NN
cord-284501-5i0w74q4	48	38	later	later	RB
cord-284501-5i0w74q4	48	39	with	with	IN
cord-284501-5i0w74q4	48	40	5	5	CD
cord-284501-5i0w74q4	48	41	mg	mg	NN
cord-284501-5i0w74q4	48	42	of	of	IN
cord-284501-5i0w74q4	48	43	pGPT	pgpt	NN
cord-284501-5i0w74q4	48	44	-	-	HYPH
cord-284501-5i0w74q4	48	45	BeauR	BeauR	NNP
cord-284501-5i0w74q4	48	46	-	-	HYPH
cord-284501-5i0w74q4	48	47	Rep	Rep	NNP
cord-284501-5i0w74q4	48	48	-	-	HYPH
cord-284501-5i0w74q4	48	49	M41-Struct-3UTR	M41-Struct-3UTR	NNP
cord-284501-5i0w74q4	48	50	in	in	IN
cord-284501-5i0w74q4	48	51	lipofectin	lipofectin	NN
cord-284501-5i0w74q4	48	52	(	(	-LRB-
cord-284501-5i0w74q4	48	53	Invitrogen	Invitrogen	NNP
cord-284501-5i0w74q4	48	54	)	)	-RRB-
cord-284501-5i0w74q4	48	55	.	.	.
cord-284501-5i0w74q4	49	1	Resultant	resultant	JJ
cord-284501-5i0w74q4	49	2	phenotypically	phenotypically	RB
cord-284501-5i0w74q4	49	3	GPT	gpt	NN
cord-284501-5i0w74q4	49	4	+	+	FW
cord-284501-5i0w74q4	49	5	rVVs	rvvs	FW
cord-284501-5i0w74q4	49	6	were	be	VBD
cord-284501-5i0w74q4	49	7	selected	select	VBN
cord-284501-5i0w74q4	49	8	by	by	IN
cord-284501-5i0w74q4	49	9	three	three	CD
cord-284501-5i0w74q4	49	10	rounds	round	NNS
cord-284501-5i0w74q4	49	11	of	of	IN
cord-284501-5i0w74q4	49	12	plaque	plaque	NN
cord-284501-5i0w74q4	49	13	purification	purification	NN
cord-284501-5i0w74q4	49	14	using	use	VBG
cord-284501-5i0w74q4	49	15	vero	vero	NNP
cord-284501-5i0w74q4	49	16	cells	cell	NNS
cord-284501-5i0w74q4	49	17	in	in	IN
cord-284501-5i0w74q4	49	18	the	the	DT
cord-284501-5i0w74q4	49	19	presence	presence	NN
cord-284501-5i0w74q4	49	20	of	of	IN
cord-284501-5i0w74q4	49	21	25	25	CD
cord-284501-5i0w74q4	49	22	mg	mg	NNP
cord-284501-5i0w74q4	49	23	/	/	SYM
cord-284501-5i0w74q4	49	24	ml	ml	NN
cord-284501-5i0w74q4	49	25	mycophenolic	mycophenolic	JJ
cord-284501-5i0w74q4	49	26	acid	acid	NN
cord-284501-5i0w74q4	49	27	(	(	-LRB-
cord-284501-5i0w74q4	49	28	MPA	MPA	NNP
cord-284501-5i0w74q4	49	29	)	)	-RRB-
cord-284501-5i0w74q4	49	30	,	,	,
cord-284501-5i0w74q4	49	31	250	250	CD
cord-284501-5i0w74q4	49	32	mg	mg	NNP
cord-284501-5i0w74q4	49	33	/	/	SYM
cord-284501-5i0w74q4	49	34	ml	ml	NN
cord-284501-5i0w74q4	49	35	xanthine	xanthine	NN
cord-284501-5i0w74q4	49	36	and	and	CC
cord-284501-5i0w74q4	50	1	15	15	CD
cord-284501-5i0w74q4	50	2	mg	mg	NNP
cord-284501-5i0w74q4	50	3	/	/	SYM
cord-284501-5i0w74q4	50	4	ml	ml	NNP
cord-284501-5i0w74q4	50	5	hypoxanthine	hypoxanthine	NNP
cord-284501-5i0w74q4	50	6	.	.	.
cord-284501-5i0w74q4	51	1	Randomly	randomly	RB
cord-284501-5i0w74q4	51	2	selected	select	VBN
cord-284501-5i0w74q4	51	3	MPA	MPA	NNP
cord-284501-5i0w74q4	51	4	resistant	resistant	JJ
cord-284501-5i0w74q4	51	5	rVVs	rvvs	FW
cord-284501-5i0w74q4	51	6	were	be	VBD
cord-284501-5i0w74q4	51	7	grown	grow	VBN
cord-284501-5i0w74q4	51	8	and	and	CC
cord-284501-5i0w74q4	51	9	plaque	plaque	NN
cord-284501-5i0w74q4	51	10	purified	purify	VBN
cord-284501-5i0w74q4	51	11	three	three	CD
cord-284501-5i0w74q4	51	12	times	time	NNS
cord-284501-5i0w74q4	51	13	using	use	VBG
cord-284501-5i0w74q4	51	14	vero	vero	NNP
cord-284501-5i0w74q4	51	15	cells	cell	NNS
cord-284501-5i0w74q4	51	16	in	in	IN
cord-284501-5i0w74q4	51	17	the	the	DT
cord-284501-5i0w74q4	51	18	absence	absence	NN
cord-284501-5i0w74q4	51	19	of	of	IN
cord-284501-5i0w74q4	51	20	selection	selection	NN
cord-284501-5i0w74q4	51	21	medium	medium	NN
cord-284501-5i0w74q4	51	22	.	.	.
cord-284501-5i0w74q4	52	1	This	this	DT
cord-284501-5i0w74q4	52	2	resulted	result	VBD
cord-284501-5i0w74q4	52	3	in	in	IN
cord-284501-5i0w74q4	52	4	a	a	DT
cord-284501-5i0w74q4	52	5	second	second	JJ
cord-284501-5i0w74q4	52	6	recombination	recombination	NN
cord-284501-5i0w74q4	52	7	event	event	NN
cord-284501-5i0w74q4	52	8	(	(	-LRB-
cord-284501-5i0w74q4	52	9	see	see	VB
cord-284501-5i0w74q4	52	10	Fig	Fig	NNP
cord-284501-5i0w74q4	52	11	.	.	NNP
cord-284501-5i0w74q4	52	12	1	1	CD
cord-284501-5i0w74q4	52	13	)	)	-RRB-
cord-284501-5i0w74q4	52	14	involving	involve	VBG
cord-284501-5i0w74q4	52	15	the	the	DT
cord-284501-5i0w74q4	52	16	loss	loss	NN
cord-284501-5i0w74q4	52	17	of	of	IN
cord-284501-5i0w74q4	52	18	the	the	DT
cord-284501-5i0w74q4	52	19	GPT	gpt	NN
cord-284501-5i0w74q4	52	20	gene	gene	NN
cord-284501-5i0w74q4	52	21	from	from	IN
cord-284501-5i0w74q4	52	22	the	the	DT
cord-284501-5i0w74q4	52	23	rVVs	rvvs	NN
cord-284501-5i0w74q4	52	24	,	,	,
cord-284501-5i0w74q4	52	25	and	and	CC
cord-284501-5i0w74q4	52	26	either	either	DT
cord-284501-5i0w74q4	52	27	generation	generation	NN
cord-284501-5i0w74q4	52	28	of	of	IN
cord-284501-5i0w74q4	52	29	an	an	DT
cord-284501-5i0w74q4	52	30	IBV	IBV	NNP
cord-284501-5i0w74q4	52	31	cDNA	cdna	NN
cord-284501-5i0w74q4	52	32	corresponding	correspond	VBG
cord-284501-5i0w74q4	52	33	to	to	IN
cord-284501-5i0w74q4	52	34	the	the	DT
cord-284501-5i0w74q4	52	35	sequence	sequence	NN
cord-284501-5i0w74q4	52	36	in	in	IN
cord-284501-5i0w74q4	52	37	rVV	rVV	NNP
cord-284501-5i0w74q4	52	38	-	-	HYPH
cord-284501-5i0w74q4	52	39	BeauR	BeauR	NNP
cord-284501-5i0w74q4	52	40	-	-	HYPH
cord-284501-5i0w74q4	52	41	Rep	Rep	NNP
cord-284501-5i0w74q4	52	42	-	-	HYPH
cord-284501-5i0w74q4	52	43	DStruct	DStruct	NNP
cord-284501-5i0w74q4	52	44	or	or	CC
cord-284501-5i0w74q4	52	45	a	a	DT
cord-284501-5i0w74q4	52	46	full	full	JJ
cord-284501-5i0w74q4	52	47	-	-	HYPH
cord-284501-5i0w74q4	52	48	length	length	NN
cord-284501-5i0w74q4	52	49	IBV	IBV	NNP
cord-284501-5i0w74q4	52	50	cDNA	cdna	NN
cord-284501-5i0w74q4	52	51	consisting	consist	VBG
cord-284501-5i0w74q4	52	52	of	of	IN
cord-284501-5i0w74q4	52	53	a	a	DT
cord-284501-5i0w74q4	52	54	Beau	Beau	NNP
cord-284501-5i0w74q4	52	55	-	-	HYPH
cord-284501-5i0w74q4	52	56	R	R	NNP
cord-284501-5i0w74q4	52	57	replicase	replicase	NN
cord-284501-5i0w74q4	52	58	gene	gene	NN
cord-284501-5i0w74q4	52	59	and	and	CC
cord-284501-5i0w74q4	52	60	the	the	DT
cord-284501-5i0w74q4	52	61	rest	rest	NN
cord-284501-5i0w74q4	52	62	of	of	IN
cord-284501-5i0w74q4	52	63	the	the	DT
cord-284501-5i0w74q4	52	64	IBV	IBV	NNP
cord-284501-5i0w74q4	52	65	genome	genome	NN
cord-284501-5i0w74q4	52	66	derived	derive	VBN
cord-284501-5i0w74q4	52	67	from	from	IN
cord-284501-5i0w74q4	52	68	IBV	IBV	NNP
cord-284501-5i0w74q4	52	69	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	52	70	within	within	IN
cord-284501-5i0w74q4	52	71	the	the	DT
cord-284501-5i0w74q4	52	72	VV	VV	NNP
cord-284501-5i0w74q4	52	73	genome	genome	NN
cord-284501-5i0w74q4	52	74	(	(	-LRB-
cord-284501-5i0w74q4	52	75	Fig	Fig	NNP
cord-284501-5i0w74q4	52	76	.	.	.
cord-284501-5i0w74q4	52	77	1	1	CD
cord-284501-5i0w74q4	52	78	)	)	-RRB-
cord-284501-5i0w74q4	52	79	.	.	.
cord-284501-5i0w74q4	53	1	PCR	PCR	NNP
cord-284501-5i0w74q4	53	2	was	be	VBD
cord-284501-5i0w74q4	53	3	used	use	VBN
cord-284501-5i0w74q4	53	4	to	to	TO
cord-284501-5i0w74q4	53	5	confirm	confirm	VB
cord-284501-5i0w74q4	53	6	the	the	DT
cord-284501-5i0w74q4	53	7	absence	absence	NN
cord-284501-5i0w74q4	53	8	of	of	IN
cord-284501-5i0w74q4	53	9	the	the	DT
cord-284501-5i0w74q4	53	10	GPT	gpt	NN
cord-284501-5i0w74q4	53	11	gene	gene	NN
cord-284501-5i0w74q4	53	12	in	in	IN
cord-284501-5i0w74q4	53	13	resulting	result	VBG
cord-284501-5i0w74q4	53	14	rVVs	rvvs	NN
cord-284501-5i0w74q4	53	15	,	,	,
cord-284501-5i0w74q4	53	16	which	which	WDT
cord-284501-5i0w74q4	53	17	were	be	VBD
cord-284501-5i0w74q4	53	18	further	further	RB
cord-284501-5i0w74q4	53	19	screened	screen	VBN
cord-284501-5i0w74q4	53	20	by	by	IN
cord-284501-5i0w74q4	53	21	PCR	PCR	NNP
cord-284501-5i0w74q4	53	22	amplification	amplification	NN
cord-284501-5i0w74q4	53	23	of	of	IN
cord-284501-5i0w74q4	53	24	the	the	DT
cord-284501-5i0w74q4	53	25	IBV	IBV	NNP
cord-284501-5i0w74q4	53	26	39-UTR	39-utr	CD
cord-284501-5i0w74q4	53	27	,	,	,
cord-284501-5i0w74q4	53	28	using	use	VBG
cord-284501-5i0w74q4	53	29	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	53	30	BG56	BG56	NNP
cord-284501-5i0w74q4	53	31	(	(	-LRB-
cord-284501-5i0w74q4	53	32	59	59	CD
cord-284501-5i0w74q4	53	33	-	-	SYM
cord-284501-5i0w74q4	53	34	26941	26941	CD
cord-284501-5i0w74q4	53	35	CAACAGCGCCCAAAGAAG	CAACAGCGCCCAAAGAAG	NNP
cord-284501-5i0w74q4	53	36	26958	26958	CD
cord-284501-5i0w74q4	53	37	)	)	-RRB-
cord-284501-5i0w74q4	53	38	and	and	CC
cord-284501-5i0w74q4	53	39	93/100	93/100	CD
cord-284501-5i0w74q4	53	40	(	(	-LRB-
cord-284501-5i0w74q4	53	41	59	59	CD
cord-284501-5i0w74q4	53	42	-	-	SYM
cord-284501-5i0w74q4	53	43	27607	27607	CD
cord-284501-5i0w74q4	53	44	GCTCTAACTCTATACTAGCCT	GCTCTAACTCTATACTAGCCT	NNP
cord-284501-5i0w74q4	53	45	27587	27587	CD
cord-284501-5i0w74q4	53	46	-39	-39	NNP
cord-284501-5i0w74q4	53	47	)	)	-RRB-
cord-284501-5i0w74q4	53	48	,	,	,
cord-284501-5i0w74q4	53	49	part	part	NN
cord-284501-5i0w74q4	53	50	of	of	IN
cord-284501-5i0w74q4	53	51	the	the	DT
cord-284501-5i0w74q4	53	52	replicase	replicase	NN
cord-284501-5i0w74q4	53	53	gene	gene	NN
cord-284501-5i0w74q4	53	54	,	,	,
cord-284501-5i0w74q4	53	55	using	use	VBG
cord-284501-5i0w74q4	53	56	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	53	57	BG40	BG40	NNP
cord-284501-5i0w74q4	53	58	(	(	-LRB-
cord-284501-5i0w74q4	53	59	59	59	CD
cord-284501-5i0w74q4	53	60	-	-	SYM
cord-284501-5i0w74q4	53	61	18941	18941	CD
cord-284501-5i0w74q4	53	62	ATC	ATC	NNP
cord-284501-5i0w74q4	53	63	-	-	HYPH
cord-284501-5i0w74q4	53	64	TAATTTGCTCGTTCA	TAATTTGCTCGTTCA	NNP
cord-284501-5i0w74q4	53	65	18958	18958	CD
cord-284501-5i0w74q4	54	1	-39	-39	NNP
cord-284501-5i0w74q4	55	1	and	and	CC
cord-284501-5i0w74q4	55	2	BG128	bg128	NN
cord-284501-5i0w74q4	56	1	(	(	-LRB-
cord-284501-5i0w74q4	56	2	59	59	CD
cord-284501-5i0w74q4	56	3	-	-	SYM
cord-284501-5i0w74q4	56	4	19720	19720	CD
cord-284501-5i0w74q4	56	5	CGCCAC	CGCCAC	NNP
cord-284501-5i0w74q4	56	6	-	-	HYPH
cord-284501-5i0w74q4	56	7	TCCTTTGTCGCTTC	TCCTTTGTCGCTTC	NNP
cord-284501-5i0w74q4	56	8	19739	19739	CD
cord-284501-5i0w74q4	57	1	-39	-39	NNP
cord-284501-5i0w74q4	57	2	,	,	,
cord-284501-5i0w74q4	57	3	and	and	CC
cord-284501-5i0w74q4	57	4	the	the	DT
cord-284501-5i0w74q4	57	5	junction	junction	NN
cord-284501-5i0w74q4	57	6	of	of	IN
cord-284501-5i0w74q4	57	7	the	the	DT
cord-284501-5i0w74q4	57	8	replicase	replicase	NN
cord-284501-5i0w74q4	57	9	and	and	CC
cord-284501-5i0w74q4	57	10	 	 	_SP
cord-284501-5i0w74q4	57	11	S	S	NNP
cord-284501-5i0w74q4	57	12	genes	gene	NNS
cord-284501-5i0w74q4	57	13	using	use	VBG
cord-284501-5i0w74q4	57	14	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	57	15	BG40	BG40	NNP
cord-284501-5i0w74q4	57	16	(	(	-LRB-
cord-284501-5i0w74q4	57	17	59	59	CD
cord-284501-5i0w74q4	57	18	-	-	SYM
cord-284501-5i0w74q4	57	19	18941	18941	CD
cord-284501-5i0w74q4	57	20	ATCTAATT	ATCTAATT	NNP
cord-284501-5i0w74q4	57	21	-	-	HYPH
cord-284501-5i0w74q4	57	22	TGCTCGTTCA	TGCTCGTTCA	NNP
cord-284501-5i0w74q4	57	23	18958	18958	CD
cord-284501-5i0w74q4	57	24	-39	-39	NNP
cord-284501-5i0w74q4	57	25	 	 	_SP
cord-284501-5i0w74q4	58	1	and	and	CC
cord-284501-5i0w74q4	58	2	 	 	_SP
cord-284501-5i0w74q4	58	3	BG134	BG134	NNP
cord-284501-5i0w74q4	58	4	(	(	-LRB-
cord-284501-5i0w74q4	58	5	59	59	CD
cord-284501-5i0w74q4	58	6	-	-	SYM
cord-284501-5i0w74q4	58	7	21398	21398	CD
cord-284501-5i0w74q4	58	8	AGCAATT	AGCAATT	NNP
cord-284501-5i0w74q4	58	9	-	-	HYPH
cord-284501-5i0w74q4	58	10	GAAACTGAAAGTG	GAAACTGAAAGTG	NNP
cord-284501-5i0w74q4	58	11	21417	21417	CD
cord-284501-5i0w74q4	59	1	-39	-39	NNP
cord-284501-5i0w74q4	59	2	.	.	.
cord-284501-5i0w74q4	60	1	Oligonucleotides	Oligonucleotides	NNP
cord-284501-5i0w74q4	60	2	BG-56	BG-56	NNP
cord-284501-5i0w74q4	60	3	and	and	CC
cord-284501-5i0w74q4	60	4	93/100	93/100	CD
cord-284501-5i0w74q4	60	5	were	be	VBD
cord-284501-5i0w74q4	60	6	used	use	VBN
cord-284501-5i0w74q4	60	7	to	to	TO
cord-284501-5i0w74q4	60	8	discriminate	discriminate	VB
cord-284501-5i0w74q4	60	9	between	between	IN
cord-284501-5i0w74q4	60	10	the	the	DT
cord-284501-5i0w74q4	60	11	39-UTRs	39-utrs	CD
cord-284501-5i0w74q4	60	12	from	from	IN
cord-284501-5i0w74q4	60	13	Beau	Beau	NNP
cord-284501-5i0w74q4	60	14	-	-	HYPH
cord-284501-5i0w74q4	60	15	R	R	NNP
cord-284501-5i0w74q4	60	16	and	and	CC
cord-284501-5i0w74q4	60	17	M41	m41	JJ
cord-284501-5i0w74q4	60	18	derived	derive	VBN
cord-284501-5i0w74q4	60	19	sequences	sequence	NNS
cord-284501-5i0w74q4	60	20	;	;	:
cord-284501-5i0w74q4	60	21	the	the	DT
cord-284501-5i0w74q4	60	22	39-UTR	39-utr	CD
cord-284501-5i0w74q4	60	23	from	from	IN
cord-284501-5i0w74q4	60	24	Beau	Beau	NNP
cord-284501-5i0w74q4	60	25	-	-	HYPH
cord-284501-5i0w74q4	60	26	R	R	NNP
cord-284501-5i0w74q4	60	27	results	result	NNS
cord-284501-5i0w74q4	60	28	in	in	IN
cord-284501-5i0w74q4	60	29	a	a	DT
cord-284501-5i0w74q4	60	30	667	667	CD
cord-284501-5i0w74q4	60	31	bp	bp	NNP
cord-284501-5i0w74q4	60	32	product	product	NN
cord-284501-5i0w74q4	60	33	but	but	CC
cord-284501-5i0w74q4	60	34	a	a	DT
cord-284501-5i0w74q4	60	35	483	483	CD
cord-284501-5i0w74q4	60	36	bp	bp	NNP
cord-284501-5i0w74q4	60	37	PCR	PCR	NNP
cord-284501-5i0w74q4	60	38	from	from	IN
cord-284501-5i0w74q4	60	39	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	60	40	,	,	,
cord-284501-5i0w74q4	60	41	due	due	IN
cord-284501-5i0w74q4	60	42	to	to	IN
cord-284501-5i0w74q4	60	43	a	a	DT
cord-284501-5i0w74q4	60	44	184	184	CD
cord-284501-5i0w74q4	60	45	nt	nt	RB
cord-284501-5i0w74q4	60	46	deletion	deletion	NN
cord-284501-5i0w74q4	60	47	in	in	IN
cord-284501-5i0w74q4	60	48	the	the	DT
cord-284501-5i0w74q4	60	49	M41	M41	NNP
cord-284501-5i0w74q4	60	50	39-UTR	39-utr	CD
cord-284501-5i0w74q4	60	51	.	.	.
cord-284501-5i0w74q4	61	1	A	a	DT
cord-284501-5i0w74q4	61	2	rVV	rvv	NN
cord-284501-5i0w74q4	61	3	,	,	,
cord-284501-5i0w74q4	61	4	rVV	rVV	NNP
cord-284501-5i0w74q4	61	5	-	-	HYPH
cord-284501-5i0w74q4	61	6	BeauR	BeauR	NNP
cord-284501-5i0w74q4	61	7	-	-	HYPH
cord-284501-5i0w74q4	61	8	Rep	Rep	NNP
cord-284501-5i0w74q4	61	9	-	-	HYPH
cord-284501-5i0w74q4	61	10	M41-Struct	M41-Struct	NNP
cord-284501-5i0w74q4	62	1	,	,	,
cord-284501-5i0w74q4	62	2	that	that	DT
cord-284501-5i0w74q4	62	3	contained	contain	VBD
cord-284501-5i0w74q4	62	4	a	a	DT
cord-284501-5i0w74q4	62	5	full	full	JJ
cord-284501-5i0w74q4	62	6	-	-	HYPH
cord-284501-5i0w74q4	62	7	length	length	NN
cord-284501-5i0w74q4	62	8	IBV	IBV	NNP
cord-284501-5i0w74q4	62	9	cDNA	cdna	NN
cord-284501-5i0w74q4	62	10	consisting	consisting	NN
cord-284501-5i0w74q4	62	11	of	of	IN
cord-284501-5i0w74q4	62	12	the	the	DT
cord-284501-5i0w74q4	62	13	replicase	replicase	NN
cord-284501-5i0w74q4	62	14	gene	gene	NN
cord-284501-5i0w74q4	62	15	from	from	IN
cord-284501-5i0w74q4	62	16	Beau	Beau	NNP
cord-284501-5i0w74q4	62	17	-	-	HYPH
cord-284501-5i0w74q4	62	18	R	R	NNP
cord-284501-5i0w74q4	62	19	and	and	CC
cord-284501-5i0w74q4	62	20	the	the	DT
cord-284501-5i0w74q4	62	21	rest	rest	NN
cord-284501-5i0w74q4	62	22	of	of	IN
cord-284501-5i0w74q4	62	23	the	the	DT
cord-284501-5i0w74q4	62	24	genome	genome	NN
cord-284501-5i0w74q4	62	25	derived	derive	VBN
cord-284501-5i0w74q4	62	26	from	from	IN
cord-284501-5i0w74q4	62	27	IBV	IBV	NNP
cord-284501-5i0w74q4	62	28	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	62	29	was	be	VBD
cord-284501-5i0w74q4	62	30	identified	identify	VBN
cord-284501-5i0w74q4	62	31	and	and	CC
cord-284501-5i0w74q4	62	32	used	use	VBN
cord-284501-5i0w74q4	62	33	for	for	IN
cord-284501-5i0w74q4	62	34	further	further	JJ
cord-284501-5i0w74q4	62	35	work	work	NN
cord-284501-5i0w74q4	62	36	.	.	.
cord-284501-5i0w74q4	63	1	Recombinant	recombinant	JJ
cord-284501-5i0w74q4	63	2	vaccinia	vaccinia	NN
cord-284501-5i0w74q4	63	3	virus	virus	NN
cord-284501-5i0w74q4	63	4	DNA	dna	NN
cord-284501-5i0w74q4	63	5	from	from	IN
cord-284501-5i0w74q4	63	6	rVV	rVV	NNP
cord-284501-5i0w74q4	63	7	-	-	HYPH
cord-284501-5i0w74q4	63	8	BeauR	BeauR	NNP
cord-284501-5i0w74q4	63	9	-	-	HYPH
cord-284501-5i0w74q4	63	10	Rep	Rep	NNP
cord-284501-5i0w74q4	63	11	-	-	HYPH
cord-284501-5i0w74q4	63	12	M41-Struct	M41-Struct	NNP
cord-284501-5i0w74q4	63	13	containing	contain	VBG
cord-284501-5i0w74q4	63	14	the	the	DT
cord-284501-5i0w74q4	63	15	BeauR	BeauR	NNP
cord-284501-5i0w74q4	63	16	-	-	HYPH
cord-284501-5i0w74q4	63	17	Rep	Rep	NNP
cord-284501-5i0w74q4	63	18	-	-	HYPH
cord-284501-5i0w74q4	63	19	M41-Struct	m41-struct	JJ
cord-284501-5i0w74q4	63	20	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	63	21	fulllength	fulllength	NN
cord-284501-5i0w74q4	63	22	IBV	IBV	NNP
cord-284501-5i0w74q4	63	23	cDNA	cdna	NN
cord-284501-5i0w74q4	63	24	was	be	VBD
cord-284501-5i0w74q4	63	25	purified	purify	VBN
cord-284501-5i0w74q4	63	26	and	and	CC
cord-284501-5i0w74q4	63	27	used	use	VBN
cord-284501-5i0w74q4	63	28	for	for	IN
cord-284501-5i0w74q4	63	29	the	the	DT
cord-284501-5i0w74q4	63	30	rescue	rescue	NN
cord-284501-5i0w74q4	63	31	of	of	IN
cord-284501-5i0w74q4	63	32	rIBVs	rIBVs	NNP
cord-284501-5i0w74q4	63	33	in	in	IN
cord-284501-5i0w74q4	63	34	CK	CK	NNP
cord-284501-5i0w74q4	63	35	cells	cell	NNS
cord-284501-5i0w74q4	63	36	using	use	VBG
cord-284501-5i0w74q4	63	37	rFPV	rFPV	NNS
cord-284501-5i0w74q4	63	38	/	/	SYM
cord-284501-5i0w74q4	63	39	T7	t7	NN
cord-284501-5i0w74q4	63	40	[	[	-LRB-
cord-284501-5i0w74q4	63	41	38	38	CD
cord-284501-5i0w74q4	63	42	]	]	-RRB-
cord-284501-5i0w74q4	63	43	for	for	IN
cord-284501-5i0w74q4	63	44	the	the	DT
cord-284501-5i0w74q4	63	45	generation	generation	NN
cord-284501-5i0w74q4	63	46	of	of	IN
cord-284501-5i0w74q4	63	47	infectious	infectious	JJ
cord-284501-5i0w74q4	63	48	IBV	IBV	NNP
cord-284501-5i0w74q4	63	49	RNA	RNA	NNP
cord-284501-5i0w74q4	63	50	(	(	-LRB-
cord-284501-5i0w74q4	63	51	[	[	-LRB-
cord-284501-5i0w74q4	63	52	25	25	CD
cord-284501-5i0w74q4	63	53	,	,	,
cord-284501-5i0w74q4	63	54	35	35	CD
cord-284501-5i0w74q4	63	55	,	,	,
cord-284501-5i0w74q4	63	56	37	37	CD
cord-284501-5i0w74q4	63	57	]	]	-RRB-
cord-284501-5i0w74q4	63	58	)	)	-RRB-
cord-284501-5i0w74q4	63	59	.	.	.
cord-284501-5i0w74q4	64	1	Resultant	resultant	JJ
cord-284501-5i0w74q4	64	2	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	64	3	rIBVs	rIBVs	NNP
cord-284501-5i0w74q4	64	4	were	be	VBD
cord-284501-5i0w74q4	64	5	passed	pass	VBN
cord-284501-5i0w74q4	64	6	three	three	CD
cord-284501-5i0w74q4	64	7	times	time	NNS
cord-284501-5i0w74q4	64	8	in	in	IN
cord-284501-5i0w74q4	64	9	CK	CK	NNP
cord-284501-5i0w74q4	64	10	cells	cell	NNS
cord-284501-5i0w74q4	64	11	before	before	IN
cord-284501-5i0w74q4	64	12	being	be	VBG
cord-284501-5i0w74q4	64	13	used	use	VBN
cord-284501-5i0w74q4	64	14	in	in	IN
cord-284501-5i0w74q4	64	15	subsequent	subsequent	JJ
cord-284501-5i0w74q4	64	16	experiments	experiment	NNS
cord-284501-5i0w74q4	64	17	.	.	.
cord-284501-5i0w74q4	65	1	Total	total	JJ
cord-284501-5i0w74q4	65	2	cellular	cellular	JJ
cord-284501-5i0w74q4	65	3	RNA	RNA	NNP
cord-284501-5i0w74q4	65	4	was	be	VBD
cord-284501-5i0w74q4	65	5	extracted	extract	VBN
cord-284501-5i0w74q4	65	6	from	from	IN
cord-284501-5i0w74q4	65	7	IBV	IBV	NNP
cord-284501-5i0w74q4	65	8	-	-	HYPH
cord-284501-5i0w74q4	65	9	infected	infect	VBN
cord-284501-5i0w74q4	65	10	CK	CK	NNP
cord-284501-5i0w74q4	65	11	cells	cell	NNS
cord-284501-5i0w74q4	65	12	using	use	VBG
cord-284501-5i0w74q4	65	13	the	the	DT
cord-284501-5i0w74q4	65	14	RNeasy	RNeasy	NNP
cord-284501-5i0w74q4	65	15	method	method	NN
cord-284501-5i0w74q4	65	16	(	(	-LRB-
cord-284501-5i0w74q4	65	17	Qiagen	Qiagen	NNP
cord-284501-5i0w74q4	65	18	)	)	-RRB-
cord-284501-5i0w74q4	65	19	and	and	CC
cord-284501-5i0w74q4	65	20	RT	RT	NNP
cord-284501-5i0w74q4	65	21	-	-	HYPH
cord-284501-5i0w74q4	65	22	PCR	PCR	NNP
cord-284501-5i0w74q4	65	23	(	(	-LRB-
cord-284501-5i0w74q4	65	24	Ready	Ready	NNP
cord-284501-5i0w74q4	65	25	-	-	HYPH
cord-284501-5i0w74q4	65	26	To	to	TO
cord-284501-5i0w74q4	65	27	-	-	HYPH
cord-284501-5i0w74q4	65	28	Go	go	VB
cord-284501-5i0w74q4	65	29	TM	TM	NNP
cord-284501-5i0w74q4	65	30	RT	RT	NNP
cord-284501-5i0w74q4	65	31	-	-	HYPH
cord-284501-5i0w74q4	65	32	PCR	PCR	NNP
cord-284501-5i0w74q4	65	33	beads	bead	NNS
cord-284501-5i0w74q4	65	34	)	)	-RRB-
cord-284501-5i0w74q4	65	35	for	for	IN
cord-284501-5i0w74q4	65	36	amplification	amplification	NN
cord-284501-5i0w74q4	65	37	of	of	IN
cord-284501-5i0w74q4	65	38	the	the	DT
cord-284501-5i0w74q4	65	39	39-UTR	39-utr	CD
cord-284501-5i0w74q4	65	40	of	of	IN
cord-284501-5i0w74q4	65	41	the	the	DT
cord-284501-5i0w74q4	65	42	rIBV	ribv	RBS
cord-284501-5i0w74q4	65	43	-	-	HYPH
cord-284501-5i0w74q4	65	44	derived	derive	VBN
cord-284501-5i0w74q4	65	45	RNA	RNA	NNP
cord-284501-5i0w74q4	65	46	,	,	,
cord-284501-5i0w74q4	65	47	using	use	VBG
cord-284501-5i0w74q4	65	48	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	65	49	BG	BG	NNP
cord-284501-5i0w74q4	65	50	56	56	CD
cord-284501-5i0w74q4	65	51	and	and	CC
cord-284501-5i0w74q4	65	52	93/100	93/100	CD
cord-284501-5i0w74q4	65	53	,	,	,
cord-284501-5i0w74q4	65	54	to	to	TO
cord-284501-5i0w74q4	65	55	confirm	confirm	VB
cord-284501-5i0w74q4	65	56	the	the	DT
cord-284501-5i0w74q4	65	57	identity	identity	NN
cord-284501-5i0w74q4	65	58	of	of	IN
cord-284501-5i0w74q4	65	59	the	the	DT
cord-284501-5i0w74q4	65	60	rIBV	ribv	NN
cord-284501-5i0w74q4	65	61	.	.	.
cord-284501-5i0w74q4	66	1	Confluent	confluent	NN
cord-284501-5i0w74q4	66	2	monolayers	monolayer	NNS
cord-284501-5i0w74q4	66	3	of	of	IN
cord-284501-5i0w74q4	66	4	CK	CK	NNP
cord-284501-5i0w74q4	66	5	cells	cell	NNS
cord-284501-5i0w74q4	66	6	in	in	IN
cord-284501-5i0w74q4	66	7	6-well	6-well	CD
cord-284501-5i0w74q4	66	8	plates	plate	NNS
cord-284501-5i0w74q4	66	9	were	be	VBD
cord-284501-5i0w74q4	66	10	infected	infect	VBN
cord-284501-5i0w74q4	66	11	with	with	IN
cord-284501-5i0w74q4	66	12	viruses	virus	NNS
cord-284501-5i0w74q4	66	13	at	at	IN
cord-284501-5i0w74q4	66	14	a	a	DT
cord-284501-5i0w74q4	66	15	MOI	moi	NN
cord-284501-5i0w74q4	66	16	of	of	IN
cord-284501-5i0w74q4	66	17	0.1	0.1	CD
cord-284501-5i0w74q4	66	18	PFU	pfu	NN
cord-284501-5i0w74q4	66	19	in	in	IN
cord-284501-5i0w74q4	66	20	triplicate	triplicate	NN
cord-284501-5i0w74q4	66	21	for	for	IN
cord-284501-5i0w74q4	66	22	each	each	DT
cord-284501-5i0w74q4	66	23	time	time	NN
cord-284501-5i0w74q4	66	24	point	point	NN
cord-284501-5i0w74q4	66	25	.	.	.
cord-284501-5i0w74q4	67	1	Following	follow	VBG
cord-284501-5i0w74q4	67	2	attachment	attachment	NN
cord-284501-5i0w74q4	67	3	,	,	,
cord-284501-5i0w74q4	67	4	for	for	IN
cord-284501-5i0w74q4	67	5	1	1	CD
cord-284501-5i0w74q4	67	6	h	h	NN
cord-284501-5i0w74q4	67	7	at	at	IN
cord-284501-5i0w74q4	67	8	37uC	37uc	CD
cord-284501-5i0w74q4	67	9	,	,	,
cord-284501-5i0w74q4	67	10	the	the	DT
cord-284501-5i0w74q4	67	11	cells	cell	NNS
cord-284501-5i0w74q4	67	12	were	be	VBD
cord-284501-5i0w74q4	67	13	washed	wash	VBN
cord-284501-5i0w74q4	67	14	twice	twice	RB
cord-284501-5i0w74q4	67	15	with	with	IN
cord-284501-5i0w74q4	67	16	phosphate	phosphate	NN
cord-284501-5i0w74q4	67	17	-	-	HYPH
cord-284501-5i0w74q4	67	18	buffered	buffer	VBN
cord-284501-5i0w74q4	67	19	saline	saline	NN
cord-284501-5i0w74q4	67	20	(	(	-LRB-
cord-284501-5i0w74q4	67	21	PBS	PBS	NNP
cord-284501-5i0w74q4	67	22	)	)	-RRB-
cord-284501-5i0w74q4	67	23	to	to	TO
cord-284501-5i0w74q4	67	24	remove	remove	VB
cord-284501-5i0w74q4	67	25	residual	residual	JJ
cord-284501-5i0w74q4	67	26	virus	virus	NN
cord-284501-5i0w74q4	67	27	and	and	CC
cord-284501-5i0w74q4	67	28	incubated	incubate	VBN
cord-284501-5i0w74q4	67	29	at	at	IN
cord-284501-5i0w74q4	67	30	37uC.	37uc.	CD
cord-284501-5i0w74q4	67	31	Samples	sample	NNS
cord-284501-5i0w74q4	67	32	of	of	IN
cord-284501-5i0w74q4	67	33	media	medium	NNS
cord-284501-5i0w74q4	67	34	were	be	VBD
cord-284501-5i0w74q4	67	35	collected	collect	VBN
cord-284501-5i0w74q4	67	36	at	at	IN
cord-284501-5i0w74q4	67	37	24	24	CD
cord-284501-5i0w74q4	67	38	,	,	,
cord-284501-5i0w74q4	67	39	48	48	CD
cord-284501-5i0w74q4	67	40	,	,	,
cord-284501-5i0w74q4	67	41	72	72	CD
cord-284501-5i0w74q4	67	42	and	and	CC
cord-284501-5i0w74q4	67	43	96	96	CD
cord-284501-5i0w74q4	67	44	h	h	NN
cord-284501-5i0w74q4	67	45	post	post	NN
cord-284501-5i0w74q4	67	46	-	-	NN
cord-284501-5i0w74q4	67	47	infection	infection	NN
cord-284501-5i0w74q4	67	48	and	and	CC
cord-284501-5i0w74q4	67	49	assayed	assay	VBN
cord-284501-5i0w74q4	67	50	in	in	IN
cord-284501-5i0w74q4	67	51	triplicate	triplicate	NN
cord-284501-5i0w74q4	67	52	for	for	IN
cord-284501-5i0w74q4	67	53	progeny	progeny	JJ
cord-284501-5i0w74q4	67	54	virus	virus	NN
cord-284501-5i0w74q4	67	55	by	by	IN
cord-284501-5i0w74q4	67	56	plaque	plaque	NN
cord-284501-5i0w74q4	67	57	assay	assay	NN
cord-284501-5i0w74q4	67	58	using	use	VBG
cord-284501-5i0w74q4	67	59	CK	CK	NNP
cord-284501-5i0w74q4	67	60	cells	cell	NNS
cord-284501-5i0w74q4	67	61	.	.	.
cord-284501-5i0w74q4	68	1	Chicken	chicken	NN
cord-284501-5i0w74q4	68	2	tracheal	tracheal	JJ
cord-284501-5i0w74q4	68	3	organ	organ	NN
cord-284501-5i0w74q4	68	4	cultures	culture	NNS
cord-284501-5i0w74q4	68	5	(	(	-LRB-
cord-284501-5i0w74q4	68	6	TOCs	TOCs	NNP
cord-284501-5i0w74q4	68	7	)	)	-RRB-
cord-284501-5i0w74q4	68	8	were	be	VBD
cord-284501-5i0w74q4	68	9	prepared	prepare	VBN
cord-284501-5i0w74q4	68	10	from	from	IN
cord-284501-5i0w74q4	68	11	19-day	19-day	CD
cord-284501-5i0w74q4	68	12	-	-	HYPH
cord-284501-5i0w74q4	68	13	old	old	JJ
cord-284501-5i0w74q4	68	14	specific	specific	JJ
cord-284501-5i0w74q4	68	15	pathogen	pathogen	NN
cord-284501-5i0w74q4	68	16	free	free	JJ
cord-284501-5i0w74q4	68	17	(	(	-LRB-
cord-284501-5i0w74q4	68	18	SPF	spf	NN
cord-284501-5i0w74q4	68	19	)	)	-RRB-
cord-284501-5i0w74q4	69	1	Rhode	Rhode	NNP
cord-284501-5i0w74q4	69	2	Island	Island	NNP
cord-284501-5i0w74q4	69	3	Red	Red	NNP
cord-284501-5i0w74q4	69	4	chicken	chicken	NN
cord-284501-5i0w74q4	69	5	embryos	embryo	NNS
cord-284501-5i0w74q4	69	6	[	[	-LRB-
cord-284501-5i0w74q4	69	7	39	39	CD
cord-284501-5i0w74q4	69	8	]	]	-RRB-
cord-284501-5i0w74q4	69	9	.	.	.
cord-284501-5i0w74q4	70	1	Groups	group	NNS
cord-284501-5i0w74q4	70	2	of	of	IN
cord-284501-5i0w74q4	70	3	five	five	CD
cord-284501-5i0w74q4	70	4	TOCs	toc	NNS
cord-284501-5i0w74q4	70	5	,	,	,
cord-284501-5i0w74q4	70	6	in	in	IN
cord-284501-5i0w74q4	70	7	triplicate	triplicate	NN
cord-284501-5i0w74q4	70	8	,	,	,
cord-284501-5i0w74q4	70	9	were	be	VBD
cord-284501-5i0w74q4	70	10	inoculated	inoculate	VBN
cord-284501-5i0w74q4	70	11	with	with	IN
cord-284501-5i0w74q4	70	12	0.5	0.5	CD
cord-284501-5i0w74q4	70	13	ml	ml	NNS
cord-284501-5i0w74q4	70	14	of	of	IN
cord-284501-5i0w74q4	70	15	medium	medium	NN
cord-284501-5i0w74q4	70	16	containing	contain	VBG
cord-284501-5i0w74q4	70	17	5.4610	5.4610	CD
cord-284501-5i0w74q4	70	18	4	4	CD
cord-284501-5i0w74q4	70	19	PFU	pfu	NN
cord-284501-5i0w74q4	70	20	/	/	SYM
cord-284501-5i0w74q4	70	21	ml	ml	NNS
cord-284501-5i0w74q4	70	22	of	of	IN
cord-284501-5i0w74q4	70	23	each	each	DT
cord-284501-5i0w74q4	70	24	virus	virus	NN
cord-284501-5i0w74q4	70	25	.	.	.
cord-284501-5i0w74q4	71	1	After	after	IN
cord-284501-5i0w74q4	71	2	incubation	incubation	NN
cord-284501-5i0w74q4	71	3	at	at	IN
cord-284501-5i0w74q4	71	4	37uC	37uc	CD
cord-284501-5i0w74q4	71	5	for	for	IN
cord-284501-5i0w74q4	71	6	1	1	CD
cord-284501-5i0w74q4	71	7	h	h	NN
cord-284501-5i0w74q4	71	8	,	,	,
cord-284501-5i0w74q4	71	9	the	the	DT
cord-284501-5i0w74q4	71	10	inoculum	inoculum	NN
cord-284501-5i0w74q4	71	11	was	be	VBD
cord-284501-5i0w74q4	71	12	removed	remove	VBN
cord-284501-5i0w74q4	71	13	and	and	CC
cord-284501-5i0w74q4	71	14	the	the	DT
cord-284501-5i0w74q4	71	15	TOCs	toc	NNS
cord-284501-5i0w74q4	71	16	were	be	VBD
cord-284501-5i0w74q4	71	17	washed	wash	VBN
cord-284501-5i0w74q4	71	18	three	three	CD
cord-284501-5i0w74q4	71	19	times	time	NNS
cord-284501-5i0w74q4	71	20	with	with	IN
cord-284501-5i0w74q4	71	21	PBS	PBS	NNP
cord-284501-5i0w74q4	71	22	,	,	,
cord-284501-5i0w74q4	71	23	1	1	CD
cord-284501-5i0w74q4	71	24	ml	ml	NNS
cord-284501-5i0w74q4	71	25	of	of	IN
cord-284501-5i0w74q4	71	26	medium	medium	NN
cord-284501-5i0w74q4	71	27	was	be	VBD
cord-284501-5i0w74q4	71	28	added	add	VBN
cord-284501-5i0w74q4	71	29	and	and	CC
cord-284501-5i0w74q4	71	30	the	the	DT
cord-284501-5i0w74q4	71	31	TOCs	toc	NNS
cord-284501-5i0w74q4	71	32	were	be	VBD
cord-284501-5i0w74q4	71	33	incubated	incubate	VBN
cord-284501-5i0w74q4	71	34	at	at	IN
cord-284501-5i0w74q4	71	35	37uC	37uc	CD
cord-284501-5i0w74q4	71	36	until	until	IN
cord-284501-5i0w74q4	71	37	the	the	DT
cord-284501-5i0w74q4	71	38	samples	sample	NNS
cord-284501-5i0w74q4	71	39	were	be	VBD
cord-284501-5i0w74q4	71	40	taken	take	VBN
cord-284501-5i0w74q4	71	41	.	.	.
cord-284501-5i0w74q4	72	1	At	at	IN
cord-284501-5i0w74q4	72	2	the	the	DT
cord-284501-5i0w74q4	72	3	selected	select	VBN
cord-284501-5i0w74q4	72	4	time	time	NN
cord-284501-5i0w74q4	72	5	points	point	NNS
cord-284501-5i0w74q4	72	6	medium	medium	NN
cord-284501-5i0w74q4	72	7	from	from	IN
cord-284501-5i0w74q4	72	8	the	the	DT
cord-284501-5i0w74q4	72	9	TOCs	toc	NNS
cord-284501-5i0w74q4	72	10	was	be	VBD
cord-284501-5i0w74q4	72	11	removed	remove	VBN
cord-284501-5i0w74q4	72	12	and	and	CC
cord-284501-5i0w74q4	72	13	analysed	analyse	VBN
cord-284501-5i0w74q4	72	14	for	for	IN
cord-284501-5i0w74q4	72	15	progeny	progeny	JJ
cord-284501-5i0w74q4	72	16	virus	virus	NN
cord-284501-5i0w74q4	72	17	by	by	IN
cord-284501-5i0w74q4	72	18	plaque	plaque	NN
cord-284501-5i0w74q4	72	19	titration	titration	NN
cord-284501-5i0w74q4	72	20	on	on	IN
cord-284501-5i0w74q4	72	21	CK	CK	NNP
cord-284501-5i0w74q4	72	22	cells	cell	NNS
cord-284501-5i0w74q4	72	23	.	.	.
cord-284501-5i0w74q4	73	1	All	all	DT
cord-284501-5i0w74q4	73	2	experiments	experiment	NNS
cord-284501-5i0w74q4	73	3	were	be	VBD
cord-284501-5i0w74q4	73	4	carried	carry	VBN
cord-284501-5i0w74q4	73	5	out	out	RP
cord-284501-5i0w74q4	73	6	in	in	IN
cord-284501-5i0w74q4	73	7	accordance	accordance	NN
cord-284501-5i0w74q4	73	8	with	with	IN
cord-284501-5i0w74q4	73	9	the	the	DT
cord-284501-5i0w74q4	73	10	UK	UK	NNP
cord-284501-5i0w74q4	73	11	Home	Home	NNP
cord-284501-5i0w74q4	73	12	Office	Office	NNP
cord-284501-5i0w74q4	73	13	guidelines	guideline	NNS
cord-284501-5i0w74q4	73	14	using	use	VBG
cord-284501-5i0w74q4	73	15	SPF	SPF	NNP
cord-284501-5i0w74q4	73	16	Rhode	Rhode	NNP
cord-284501-5i0w74q4	73	17	Island	Island	NNP
cord-284501-5i0w74q4	73	18	Red	Red	NNP
cord-284501-5i0w74q4	73	19	chickens	chicken	NNS
cord-284501-5i0w74q4	73	20	obtained	obtain	VBN
cord-284501-5i0w74q4	73	21	from	from	IN
cord-284501-5i0w74q4	73	22	the	the	DT
cord-284501-5i0w74q4	73	23	Poultry	Poultry	NNP
cord-284501-5i0w74q4	73	24	Production	Production	NNP
cord-284501-5i0w74q4	73	25	Unit	Unit	NNP
cord-284501-5i0w74q4	73	26	of	of	IN
cord-284501-5i0w74q4	73	27	the	the	DT
cord-284501-5i0w74q4	73	28	Institute	Institute	NNP
cord-284501-5i0w74q4	73	29	for	for	IN
cord-284501-5i0w74q4	73	30	Animal	Animal	NNP
cord-284501-5i0w74q4	73	31	health	health	NN
cord-284501-5i0w74q4	73	32	.	.	.
cord-284501-5i0w74q4	74	1	Four	four	CD
cord-284501-5i0w74q4	74	2	groups	group	NNS
cord-284501-5i0w74q4	74	3	(	(	-LRB-
cord-284501-5i0w74q4	74	4	n	n	NN
cord-284501-5i0w74q4	74	5	=	=	SYM
cord-284501-5i0w74q4	74	6	12	12	CD
cord-284501-5i0w74q4	74	7	)	)	-RRB-
cord-284501-5i0w74q4	74	8	of	of	IN
cord-284501-5i0w74q4	74	9	1-day	1-day	JJ
cord-284501-5i0w74q4	74	10	-	-	HYPH
cord-284501-5i0w74q4	74	11	old	old	JJ
cord-284501-5i0w74q4	74	12	SPF	SPF	NNP
cord-284501-5i0w74q4	74	13	Rhode	Rhode	NNP
cord-284501-5i0w74q4	74	14	Island	Island	NNP
cord-284501-5i0w74q4	74	15	Red	Red	NNP
cord-284501-5i0w74q4	74	16	chickens	chicken	NNS
cord-284501-5i0w74q4	74	17	were	be	VBD
cord-284501-5i0w74q4	74	18	inoculated	inoculate	VBN
cord-284501-5i0w74q4	74	19	via	via	IN
cord-284501-5i0w74q4	74	20	the	the	DT
cord-284501-5i0w74q4	74	21	conjunctival	conjunctival	NN
cord-284501-5i0w74q4	74	22	(	(	-LRB-
cord-284501-5i0w74q4	74	23	eye	eye	NN
cord-284501-5i0w74q4	74	24	drop	drop	NN
cord-284501-5i0w74q4	74	25	)	)	-RRB-
cord-284501-5i0w74q4	74	26	and	and	CC
cord-284501-5i0w74q4	74	27	intranasal	intranasal	NN
cord-284501-5i0w74q4	74	28	routes	route	NNS
cord-284501-5i0w74q4	74	29	with	with	IN
cord-284501-5i0w74q4	74	30	10	10	CD
cord-284501-5i0w74q4	74	31	6	6	CD
cord-284501-5i0w74q4	74	32	PFU	pfu	NN
cord-284501-5i0w74q4	74	33	/	/	SYM
cord-284501-5i0w74q4	74	34	ml	ml	NN
cord-284501-5i0w74q4	74	35	of	of	IN
cord-284501-5i0w74q4	74	36	each	each	DT
cord-284501-5i0w74q4	74	37	virus	virus	NN
cord-284501-5i0w74q4	74	38	in	in	IN
cord-284501-5i0w74q4	74	39	a	a	DT
cord-284501-5i0w74q4	74	40	total	total	NN
cord-284501-5i0w74q4	74	41	of	of	IN
cord-284501-5i0w74q4	74	42	0.1	0.1	CD
cord-284501-5i0w74q4	74	43	ml	ml	NN
cord-284501-5i0w74q4	74	44	serum	serum	NN
cord-284501-5i0w74q4	74	45	-	-	HYPH
cord-284501-5i0w74q4	74	46	free	free	JJ
cord-284501-5i0w74q4	74	47	BES	BES	NNP
cord-284501-5i0w74q4	74	48	(	(	-LRB-
cord-284501-5i0w74q4	74	49	N	N	NNP
cord-284501-5i0w74q4	74	50	,	,	,
cord-284501-5i0w74q4	74	51	N	n	CD
cord-284501-5i0w74q4	74	52	-	-	HYPH
cord-284501-5i0w74q4	74	53	Bis(2-hydroxyethyl)-2aminoethanesulphonic	bis(2-hydroxyethyl)-2aminoethanesulphonic	NN
cord-284501-5i0w74q4	74	54	acid	acid	NN
cord-284501-5i0w74q4	74	55	)	)	-RRB-
cord-284501-5i0w74q4	74	56	medium	medium	NN
cord-284501-5i0w74q4	74	57	.	.	.
cord-284501-5i0w74q4	75	1	The	the	DT
cord-284501-5i0w74q4	75	2	chickens	chicken	NNS
cord-284501-5i0w74q4	75	3	were	be	VBD
cord-284501-5i0w74q4	75	4	housed	house	VBN
cord-284501-5i0w74q4	75	5	in	in	IN
cord-284501-5i0w74q4	75	6	positive	positive	JJ
cord-284501-5i0w74q4	75	7	-	-	HYPH
cord-284501-5i0w74q4	75	8	pressure	pressure	NN
cord-284501-5i0w74q4	75	9	,	,	,
cord-284501-5i0w74q4	75	10	HEPA	HEPA	NNP
cord-284501-5i0w74q4	75	11	-	-	HYPH
cord-284501-5i0w74q4	75	12	filtered	filter	VBN
cord-284501-5i0w74q4	75	13	isolation	isolation	NN
cord-284501-5i0w74q4	75	14	rooms	room	NNS
cord-284501-5i0w74q4	75	15	,	,	,
cord-284501-5i0w74q4	75	16	and	and	CC
cord-284501-5i0w74q4	75	17	each	each	DT
cord-284501-5i0w74q4	75	18	group	group	NN
cord-284501-5i0w74q4	75	19	was	be	VBD
cord-284501-5i0w74q4	75	20	housed	house	VBN
cord-284501-5i0w74q4	75	21	in	in	IN
cord-284501-5i0w74q4	75	22	a	a	DT
cord-284501-5i0w74q4	75	23	separate	separate	JJ
cord-284501-5i0w74q4	75	24	room	room	NN
cord-284501-5i0w74q4	75	25	.	.	.
cord-284501-5i0w74q4	76	1	The	the	DT
cord-284501-5i0w74q4	76	2	birds	bird	NNS
cord-284501-5i0w74q4	76	3	in	in	IN
cord-284501-5i0w74q4	76	4	the	the	DT
cord-284501-5i0w74q4	76	5	mockinfected	mockinfected	JJ
cord-284501-5i0w74q4	76	6	group	group	NN
cord-284501-5i0w74q4	76	7	were	be	VBD
cord-284501-5i0w74q4	76	8	inoculated	inoculate	VBN
cord-284501-5i0w74q4	76	9	with	with	IN
cord-284501-5i0w74q4	76	10	serum	serum	NN
cord-284501-5i0w74q4	76	11	-	-	HYPH
cord-284501-5i0w74q4	76	12	free	free	JJ
cord-284501-5i0w74q4	76	13	BES	BES	NNP
cord-284501-5i0w74q4	76	14	medium	medium	NN
cord-284501-5i0w74q4	76	15	.	.	.
cord-284501-5i0w74q4	77	1	The	the	DT
cord-284501-5i0w74q4	77	2	IBV	IBV	NNP
cord-284501-5i0w74q4	77	3	-	-	HYPH
cord-284501-5i0w74q4	77	4	associated	associate	VBN
cord-284501-5i0w74q4	77	5	clinical	clinical	JJ
cord-284501-5i0w74q4	77	6	signs	sign	NNS
cord-284501-5i0w74q4	77	7	used	use	VBN
cord-284501-5i0w74q4	77	8	to	to	TO
cord-284501-5i0w74q4	77	9	determine	determine	VB
cord-284501-5i0w74q4	77	10	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	77	11	were	be	VBD
cord-284501-5i0w74q4	77	12	snicking	snick	VBG
cord-284501-5i0w74q4	77	13	,	,	,
cord-284501-5i0w74q4	77	14	tracheal	tracheal	JJ
cord-284501-5i0w74q4	77	15	rales	rale	NNS
cord-284501-5i0w74q4	77	16	(	(	-LRB-
cord-284501-5i0w74q4	77	17	a	a	DT
cord-284501-5i0w74q4	77	18	sound	sound	NN
cord-284501-5i0w74q4	77	19	emanating	emanate	VBG
cord-284501-5i0w74q4	77	20	from	from	IN
cord-284501-5i0w74q4	77	21	the	the	DT
cord-284501-5i0w74q4	77	22	bronchi	bronchi	NN
cord-284501-5i0w74q4	77	23	,	,	,
cord-284501-5i0w74q4	77	24	also	also	RB
cord-284501-5i0w74q4	77	25	detected	detect	VBN
cord-284501-5i0w74q4	77	26	by	by	IN
cord-284501-5i0w74q4	77	27	vibrations	vibration	NNS
cord-284501-5i0w74q4	77	28	when	when	WRB
cord-284501-5i0w74q4	77	29	holding	hold	VBG
cord-284501-5i0w74q4	77	30	a	a	DT
cord-284501-5i0w74q4	77	31	chick	chick	NN
cord-284501-5i0w74q4	77	32	)	)	-RRB-
cord-284501-5i0w74q4	77	33	,	,	,
cord-284501-5i0w74q4	77	34	wheezing	wheeze	VBG
cord-284501-5i0w74q4	77	35	(	(	-LRB-
cord-284501-5i0w74q4	77	36	dyspoena	dyspoena	NNP
cord-284501-5i0w74q4	77	37	)	)	-RRB-
cord-284501-5i0w74q4	77	38	,	,	,
cord-284501-5i0w74q4	77	39	nasal	nasal	NN
cord-284501-5i0w74q4	77	40	discharge	discharge	NN
cord-284501-5i0w74q4	77	41	,	,	,
cord-284501-5i0w74q4	77	42	watery	watery	JJ
cord-284501-5i0w74q4	77	43	eyes	eye	NNS
cord-284501-5i0w74q4	77	44	and	and	CC
cord-284501-5i0w74q4	77	45	ciliary	ciliary	NN
cord-284501-5i0w74q4	77	46	activity	activity	NN
cord-284501-5i0w74q4	77	47	of	of	IN
cord-284501-5i0w74q4	77	48	the	the	DT
cord-284501-5i0w74q4	77	49	trachea	trachea	NN
cord-284501-5i0w74q4	77	50	[	[	-LRB-
cord-284501-5i0w74q4	77	51	26	26	CD
cord-284501-5i0w74q4	77	52	]	]	-RRB-
cord-284501-5i0w74q4	77	53	.	.	.
cord-284501-5i0w74q4	78	1	Chicks	chick	NNS
cord-284501-5i0w74q4	78	2	were	be	VBD
cord-284501-5i0w74q4	78	3	observed	observe	VBN
cord-284501-5i0w74q4	78	4	daily	daily	RB
cord-284501-5i0w74q4	78	5	for	for	IN
cord-284501-5i0w74q4	78	6	clinical	clinical	JJ
cord-284501-5i0w74q4	78	7	signs	sign	NNS
cord-284501-5i0w74q4	78	8	;	;	:
cord-284501-5i0w74q4	78	9	snicks	snick	NNS
cord-284501-5i0w74q4	78	10	(	(	-LRB-
cord-284501-5i0w74q4	78	11	a	a	DT
cord-284501-5i0w74q4	78	12	sound	sound	NN
cord-284501-5i0w74q4	78	13	similar	similar	JJ
cord-284501-5i0w74q4	78	14	to	to	IN
cord-284501-5i0w74q4	78	15	a	a	DT
cord-284501-5i0w74q4	78	16	sneeze	sneeze	NN
cord-284501-5i0w74q4	78	17	)	)	-RRB-
cord-284501-5i0w74q4	78	18	were	be	VBD
cord-284501-5i0w74q4	78	19	counted	count	VBN
cord-284501-5i0w74q4	78	20	by	by	IN
cord-284501-5i0w74q4	78	21	two	two	CD
cord-284501-5i0w74q4	78	22	persons	person	NNS
cord-284501-5i0w74q4	78	23	over	over	IN
cord-284501-5i0w74q4	78	24	2	2	CD
cord-284501-5i0w74q4	78	25	minutes	minute	NNS
cord-284501-5i0w74q4	78	26	.	.	.
cord-284501-5i0w74q4	79	1	Birds	bird	NNS
cord-284501-5i0w74q4	79	2	were	be	VBD
cord-284501-5i0w74q4	79	3	checked	check	VBN
cord-284501-5i0w74q4	79	4	individually	individually	RB
cord-284501-5i0w74q4	79	5	for	for	IN
cord-284501-5i0w74q4	79	6	the	the	DT
cord-284501-5i0w74q4	79	7	presence	presence	NN
cord-284501-5i0w74q4	79	8	of	of	IN
cord-284501-5i0w74q4	79	9	tracheal	tracheal	JJ
cord-284501-5i0w74q4	79	10	rales	rale	NNS
cord-284501-5i0w74q4	79	11	,	,	,
cord-284501-5i0w74q4	79	12	nasal	nasal	NN
cord-284501-5i0w74q4	79	13	discharge	discharge	NN
cord-284501-5i0w74q4	79	14	,	,	,
cord-284501-5i0w74q4	79	15	watery	watery	JJ
cord-284501-5i0w74q4	79	16	eyes	eye	NNS
cord-284501-5i0w74q4	79	17	and	and	CC
cord-284501-5i0w74q4	79	18	wheezing	wheezing	NN
cord-284501-5i0w74q4	79	19	.	.	.
cord-284501-5i0w74q4	80	1	Tracheas	Tracheas	NNP
cord-284501-5i0w74q4	80	2	were	be	VBD
cord-284501-5i0w74q4	80	3	removed	remove	VBN
cord-284501-5i0w74q4	80	4	from	from	IN
cord-284501-5i0w74q4	80	5	three	three	CD
cord-284501-5i0w74q4	80	6	randomly	randomly	RB
cord-284501-5i0w74q4	80	7	selected	select	VBN
cord-284501-5i0w74q4	80	8	chickens	chicken	NNS
cord-284501-5i0w74q4	80	9	from	from	IN
cord-284501-5i0w74q4	80	10	each	each	DT
cord-284501-5i0w74q4	80	11	group	group	NN
cord-284501-5i0w74q4	80	12	at	at	IN
cord-284501-5i0w74q4	80	13	4	4	CD
cord-284501-5i0w74q4	80	14	and	and	CC
cord-284501-5i0w74q4	80	15	7	7	CD
cord-284501-5i0w74q4	80	16	days	day	NNS
cord-284501-5i0w74q4	80	17	post	post	NN
cord-284501-5i0w74q4	80	18	-	-	NN
cord-284501-5i0w74q4	80	19	inoculation	inoculation	NN
cord-284501-5i0w74q4	80	20	for	for	IN
cord-284501-5i0w74q4	80	21	assessment	assessment	NN
cord-284501-5i0w74q4	80	22	of	of	IN
cord-284501-5i0w74q4	80	23	ciliary	ciliary	NN
cord-284501-5i0w74q4	80	24	activity	activity	NN
cord-284501-5i0w74q4	80	25	.	.	.
cord-284501-5i0w74q4	81	1	Ten	ten	CD
cord-284501-5i0w74q4	81	2	1	1	CD
cord-284501-5i0w74q4	81	3	mm	mm	NN
cord-284501-5i0w74q4	81	4	sections	section	NNS
cord-284501-5i0w74q4	81	5	were	be	VBD
cord-284501-5i0w74q4	81	6	cut	cut	VBN
cord-284501-5i0w74q4	81	7	from	from	IN
cord-284501-5i0w74q4	81	8	three	three	CD
cord-284501-5i0w74q4	81	9	different	different	JJ
cord-284501-5i0w74q4	81	10	regions	region	NNS
cord-284501-5i0w74q4	81	11	of	of	IN
cord-284501-5i0w74q4	81	12	each	each	DT
cord-284501-5i0w74q4	81	13	trachea	trachea	NN
cord-284501-5i0w74q4	81	14	and	and	CC
cord-284501-5i0w74q4	81	15	the	the	DT
cord-284501-5i0w74q4	81	16	level	level	NN
cord-284501-5i0w74q4	81	17	of	of	IN
cord-284501-5i0w74q4	81	18	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	81	19	of	of	IN
cord-284501-5i0w74q4	81	20	each	each	DT
cord-284501-5i0w74q4	81	21	tracheal	tracheal	NN
cord-284501-5i0w74q4	81	22	section	section	NN
cord-284501-5i0w74q4	81	23	was	be	VBD
cord-284501-5i0w74q4	81	24	determined	determine	VBN
cord-284501-5i0w74q4	81	25	.	.	.
cord-284501-5i0w74q4	82	1	The	the	DT
cord-284501-5i0w74q4	82	2	remaining	remain	VBG
cord-284501-5i0w74q4	82	3	regions	region	NNS
cord-284501-5i0w74q4	82	4	of	of	IN
cord-284501-5i0w74q4	82	5	the	the	DT
cord-284501-5i0w74q4	82	6	tracheas	trachea	NNS
cord-284501-5i0w74q4	82	7	from	from	IN
cord-284501-5i0w74q4	82	8	the	the	DT
cord-284501-5i0w74q4	82	9	infected	infected	JJ
cord-284501-5i0w74q4	82	10	birds	bird	NNS
cord-284501-5i0w74q4	82	11	were	be	VBD
cord-284501-5i0w74q4	82	12	cut	cut	VBN
cord-284501-5i0w74q4	82	13	longitudinally	longitudinally	RB
cord-284501-5i0w74q4	82	14	and	and	CC
cord-284501-5i0w74q4	82	15	the	the	DT
cord-284501-5i0w74q4	82	16	epithelial	epithelial	JJ
cord-284501-5i0w74q4	82	17	cells	cell	NNS
cord-284501-5i0w74q4	82	18	scraped	scrape	VBN
cord-284501-5i0w74q4	82	19	from	from	IN
cord-284501-5i0w74q4	82	20	the	the	DT
cord-284501-5i0w74q4	82	21	tracheas	trachea	NNS
cord-284501-5i0w74q4	82	22	and	and	CC
cord-284501-5i0w74q4	82	23	transferred	transfer	VBN
cord-284501-5i0w74q4	82	24	to	to	IN
cord-284501-5i0w74q4	82	25	1	1	CD
cord-284501-5i0w74q4	82	26	ml	ml	NN
cord-284501-5i0w74q4	82	27	PBS	PBS	NNP
cord-284501-5i0w74q4	82	28	.	.	.
cord-284501-5i0w74q4	83	1	The	the	DT
cord-284501-5i0w74q4	83	2	samples	sample	NNS
cord-284501-5i0w74q4	83	3	were	be	VBD
cord-284501-5i0w74q4	83	4	analysed	analyse	VBN
cord-284501-5i0w74q4	83	5	for	for	IN
cord-284501-5i0w74q4	83	6	the	the	DT
cord-284501-5i0w74q4	83	7	presence	presence	NN
cord-284501-5i0w74q4	83	8	of	of	IN
cord-284501-5i0w74q4	83	9	viable	viable	JJ
cord-284501-5i0w74q4	83	10	IBV	IBV	NNP
cord-284501-5i0w74q4	83	11	by	by	IN
cord-284501-5i0w74q4	83	12	titration	titration	NN
cord-284501-5i0w74q4	83	13	in	in	IN
cord-284501-5i0w74q4	83	14	TOCs	toc	NNS
cord-284501-5i0w74q4	83	15	or	or	CC
cord-284501-5i0w74q4	83	16	used	use	VBN
cord-284501-5i0w74q4	83	17	for	for	IN
cord-284501-5i0w74q4	83	18	RNA	RNA	NNP
cord-284501-5i0w74q4	83	19	extraction	extraction	NN
cord-284501-5i0w74q4	83	20	using	use	VBG
cord-284501-5i0w74q4	83	21	the	the	DT
cord-284501-5i0w74q4	83	22	RNeasy	RNeasy	NNP
cord-284501-5i0w74q4	83	23	method	method	NN
cord-284501-5i0w74q4	83	24	and	and	CC
cord-284501-5i0w74q4	83	25	analysed	analyse	VBN
cord-284501-5i0w74q4	83	26	by	by	IN
cord-284501-5i0w74q4	83	27	RT-	RT-	NNS
cord-284501-5i0w74q4	84	1	The	the	DT
cord-284501-5i0w74q4	84	2	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	84	3	-	-	HYPH
cord-284501-5i0w74q4	84	4	derived	derive	VBN
cord-284501-5i0w74q4	84	5	cDNA	cdna	NN
cord-284501-5i0w74q4	84	6	,	,	,
cord-284501-5i0w74q4	84	7	representing	represent	VBG
cord-284501-5i0w74q4	84	8	the	the	DT
cord-284501-5i0w74q4	84	9	M41	m41	JJ
cord-284501-5i0w74q4	84	10	structural	structural	JJ
cord-284501-5i0w74q4	84	11	and	and	CC
cord-284501-5i0w74q4	84	12	accessory	accessory	NN
cord-284501-5i0w74q4	84	13	genes	gene	NNS
cord-284501-5i0w74q4	84	14	and	and	CC
cord-284501-5i0w74q4	84	15	the	the	DT
cord-284501-5i0w74q4	84	16	M41	M41	NNP
cord-284501-5i0w74q4	84	17	39-UTR	39-utr	CD
cord-284501-5i0w74q4	84	18	,	,	,
cord-284501-5i0w74q4	84	19	within	within	IN
cord-284501-5i0w74q4	84	20	pGPT	pGPT	NNS
cord-284501-5i0w74q4	84	21	-	-	HYPH
cord-284501-5i0w74q4	84	22	BeauR	BeauR	NNP
cord-284501-5i0w74q4	84	23	-	-	HYPH
cord-284501-5i0w74q4	84	24	Rep	Rep	NNP
cord-284501-5i0w74q4	84	25	-	-	HYPH
cord-284501-5i0w74q4	84	26	M41-Struct-3UTR	M41-Struct-3UTR	NNP
cord-284501-5i0w74q4	84	27	was	be	VBD
cord-284501-5i0w74q4	84	28	fused	fuse	VBN
cord-284501-5i0w74q4	84	29	to	to	IN
cord-284501-5i0w74q4	84	30	the	the	DT
cord-284501-5i0w74q4	84	31	Beau	Beau	NNP
cord-284501-5i0w74q4	84	32	-	-	HYPH
cord-284501-5i0w74q4	84	33	R	R	NNP
cord-284501-5i0w74q4	84	34	replicase	replicase	NN
cord-284501-5i0w74q4	84	35	gene	gene	NN
cord-284501-5i0w74q4	84	36	in	in	IN
cord-284501-5i0w74q4	84	37	the	the	DT
cord-284501-5i0w74q4	84	38	rVV	rVV	NNS
cord-284501-5i0w74q4	84	39	by	by	IN
cord-284501-5i0w74q4	84	40	a	a	DT
cord-284501-5i0w74q4	84	41	homologous	homologous	JJ
cord-284501-5i0w74q4	84	42	recombination	recombination	NN
cord-284501-5i0w74q4	84	43	event	event	NN
cord-284501-5i0w74q4	84	44	between	between	IN
cord-284501-5i0w74q4	84	45	the	the	DT
cord-284501-5i0w74q4	84	46	Beau	Beau	NNP
cord-284501-5i0w74q4	84	47	-	-	HYPH
cord-284501-5i0w74q4	84	48	R	R	NNP
cord-284501-5i0w74q4	84	49	replicase	replicase	NN
cord-284501-5i0w74q4	84	50	sequence	sequence	NN
cord-284501-5i0w74q4	84	51	common	common	JJ
cord-284501-5i0w74q4	84	52	to	to	IN
cord-284501-5i0w74q4	84	53	both	both	DT
cord-284501-5i0w74q4	84	54	constructs	construct	NNS
cord-284501-5i0w74q4	84	55	.	.	.
cord-284501-5i0w74q4	85	1	A	a	DT
cord-284501-5i0w74q4	85	2	potential	potential	JJ
cord-284501-5i0w74q4	85	3	rVV	rvv	NN
cord-284501-5i0w74q4	85	4	,	,	,
cord-284501-5i0w74q4	85	5	rVV	rVV	NNP
cord-284501-5i0w74q4	85	6	-	-	HYPH
cord-284501-5i0w74q4	85	7	BeauR	BeauR	NNP
cord-284501-5i0w74q4	85	8	-	-	HYPH
cord-284501-5i0w74q4	85	9	Rep	Rep	NNP
cord-284501-5i0w74q4	85	10	-	-	HYPH
cord-284501-5i0w74q4	85	11	M41-Struct	M41-Struct	NNP
cord-284501-5i0w74q4	85	12	,	,	,
cord-284501-5i0w74q4	85	13	containing	contain	VBG
cord-284501-5i0w74q4	85	14	a	a	DT
cord-284501-5i0w74q4	85	15	full	full	JJ
cord-284501-5i0w74q4	85	16	-	-	HYPH
cord-284501-5i0w74q4	85	17	length	length	NN
cord-284501-5i0w74q4	85	18	IBV	IBV	NNP
cord-284501-5i0w74q4	85	19	cDNA	cdna	NN
cord-284501-5i0w74q4	85	20	with	with	IN
cord-284501-5i0w74q4	85	21	the	the	DT
cord-284501-5i0w74q4	85	22	replicase	replicase	NN
cord-284501-5i0w74q4	85	23	gene	gene	NN
cord-284501-5i0w74q4	85	24	from	from	IN
cord-284501-5i0w74q4	85	25	Beau	Beau	NNP
cord-284501-5i0w74q4	85	26	-	-	HYPH
cord-284501-5i0w74q4	85	27	R	R	NNP
cord-284501-5i0w74q4	85	28	and	and	CC
cord-284501-5i0w74q4	85	29	the	the	DT
cord-284501-5i0w74q4	85	30	rest	rest	NN
cord-284501-5i0w74q4	85	31	of	of	IN
cord-284501-5i0w74q4	85	32	the	the	DT
cord-284501-5i0w74q4	85	33	genome	genome	NN
cord-284501-5i0w74q4	85	34	from	from	IN
cord-284501-5i0w74q4	85	35	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	85	36	was	be	VBD
cord-284501-5i0w74q4	85	37	isolated	isolate	VBN
cord-284501-5i0w74q4	85	38	following	follow	VBG
cord-284501-5i0w74q4	85	39	the	the	DT
cord-284501-5i0w74q4	85	40	TDS	TDS	NNP
cord-284501-5i0w74q4	85	41	process	process	NN
cord-284501-5i0w74q4	85	42	.	.	.
cord-284501-5i0w74q4	86	1	The	the	DT
cord-284501-5i0w74q4	86	2	complete	complete	JJ
cord-284501-5i0w74q4	86	3	plasmid	plasmid	NN
cord-284501-5i0w74q4	86	4	DNA	dna	NN
cord-284501-5i0w74q4	86	5	was	be	VBD
cord-284501-5i0w74q4	86	6	fused	fuse	VBN
cord-284501-5i0w74q4	86	7	to	to	IN
cord-284501-5i0w74q4	86	8	the	the	DT
cord-284501-5i0w74q4	86	9	truncated	truncated	JJ
cord-284501-5i0w74q4	86	10	Beau	Beau	NNP
cord-284501-5i0w74q4	86	11	-	-	HYPH
cord-284501-5i0w74q4	86	12	R	R	NNP
cord-284501-5i0w74q4	86	13	cDNA	cdna	NN
cord-284501-5i0w74q4	86	14	by	by	IN
cord-284501-5i0w74q4	86	15	a	a	DT
cord-284501-5i0w74q4	86	16	singlestep	singlestep	NN
cord-284501-5i0w74q4	86	17	homologous	homologous	JJ
cord-284501-5i0w74q4	86	18	recombination	recombination	NN
cord-284501-5i0w74q4	86	19	event	event	NN
cord-284501-5i0w74q4	86	20	;	;	:
cord-284501-5i0w74q4	86	21	via	via	IN
cord-284501-5i0w74q4	86	22	the	the	DT
cord-284501-5i0w74q4	86	23	Beau	Beau	NNP
cord-284501-5i0w74q4	86	24	-	-	HYPH
cord-284501-5i0w74q4	86	25	R	R	NNP
cord-284501-5i0w74q4	86	26	replicase	replicase	NN
cord-284501-5i0w74q4	86	27	sequence	sequence	NN
cord-284501-5i0w74q4	86	28	common	common	JJ
cord-284501-5i0w74q4	86	29	to	to	IN
cord-284501-5i0w74q4	86	30	both	both	DT
cord-284501-5i0w74q4	86	31	sequences	sequence	NNS
cord-284501-5i0w74q4	86	32	.	.	.
cord-284501-5i0w74q4	87	1	The	the	DT
cord-284501-5i0w74q4	87	2	initial	initial	JJ
cord-284501-5i0w74q4	87	3	resultant	resultant	NN
cord-284501-5i0w74q4	87	4	rVVs	rvvs	FW
cord-284501-5i0w74q4	87	5	had	have	VBD
cord-284501-5i0w74q4	87	6	a	a	DT
cord-284501-5i0w74q4	87	7	GPT	gpt	NN
cord-284501-5i0w74q4	87	8	+	+	CC
cord-284501-5i0w74q4	87	9	phenotype	phenotype	NN
cord-284501-5i0w74q4	87	10	allowing	allow	VBG
cord-284501-5i0w74q4	87	11	selection	selection	NN
cord-284501-5i0w74q4	87	12	in	in	IN
cord-284501-5i0w74q4	87	13	the	the	DT
cord-284501-5i0w74q4	87	14	presence	presence	NN
cord-284501-5i0w74q4	87	15	of	of	IN
cord-284501-5i0w74q4	87	16	mycophenolic	mycophenolic	NNP
cord-284501-5i0w74q4	87	17	acid	acid	NNP
cord-284501-5i0w74q4	87	18	.	.	.
cord-284501-5i0w74q4	88	1	Removal	removal	NN
cord-284501-5i0w74q4	88	2	of	of	IN
cord-284501-5i0w74q4	88	3	mycophenolic	mycophenolic	JJ
cord-284501-5i0w74q4	88	4	acid	acid	NN
cord-284501-5i0w74q4	88	5	resulted	result	VBD
cord-284501-5i0w74q4	88	6	in	in	IN
cord-284501-5i0w74q4	88	7	two	two	CD
cord-284501-5i0w74q4	88	8	types	type	NNS
cord-284501-5i0w74q4	88	9	of	of	IN
cord-284501-5i0w74q4	88	10	spontaneous	spontaneous	JJ
cord-284501-5i0w74q4	88	11	intramolecular	intramolecular	JJ
cord-284501-5i0w74q4	88	12	recombination	recombination	NN
cord-284501-5i0w74q4	88	13	events	event	NNS
cord-284501-5i0w74q4	88	14	,	,	,
cord-284501-5i0w74q4	88	15	due	due	IN
cord-284501-5i0w74q4	88	16	to	to	IN
cord-284501-5i0w74q4	88	17	the	the	DT
cord-284501-5i0w74q4	88	18	instability	instability	NN
cord-284501-5i0w74q4	88	19	of	of	IN
cord-284501-5i0w74q4	88	20	the	the	DT
cord-284501-5i0w74q4	88	21	IBV	IBV	NNP
cord-284501-5i0w74q4	88	22	cDNA	cdna	NN
cord-284501-5i0w74q4	88	23	with	with	IN
cord-284501-5i0w74q4	88	24	tandem	tandem	NN
cord-284501-5i0w74q4	88	25	repeats	repeat	NNS
cord-284501-5i0w74q4	88	26	of	of	IN
cord-284501-5i0w74q4	88	27	similar	similar	JJ
cord-284501-5i0w74q4	88	28	sequences	sequence	NNS
cord-284501-5i0w74q4	88	29	,	,	,
cord-284501-5i0w74q4	88	30	resulting	result	VBG
cord-284501-5i0w74q4	88	31	in	in	IN
cord-284501-5i0w74q4	88	32	either	either	DT
cord-284501-5i0w74q4	88	33	rVV	rvv	NN
cord-284501-5i0w74q4	88	34	-	-	HYPH
cord-284501-5i0w74q4	88	35	BeauR	BeauR	NNP
cord-284501-5i0w74q4	88	36	-	-	HYPH
cord-284501-5i0w74q4	88	37	Rep	Rep	NNP
cord-284501-5i0w74q4	88	38	-	-	HYPH
cord-284501-5i0w74q4	88	39	D	D	NNP
cord-284501-5i0w74q4	88	40	-	-	HYPH
cord-284501-5i0w74q4	88	41	Struct	struct	NN
cord-284501-5i0w74q4	88	42	(	(	-LRB-
cord-284501-5i0w74q4	88	43	no	no	DT
cord-284501-5i0w74q4	88	44	modification	modification	NN
cord-284501-5i0w74q4	88	45	)	)	-RRB-
cord-284501-5i0w74q4	88	46	or	or	CC
cord-284501-5i0w74q4	88	47	in	in	IN
cord-284501-5i0w74q4	88	48	rVV	rvv	JJ
cord-284501-5i0w74q4	88	49	-	-	HYPH
cord-284501-5i0w74q4	88	50	BeauR	BeauR	NNP
cord-284501-5i0w74q4	88	51	-	-	HYPH
cord-284501-5i0w74q4	88	52	Rep	Rep	NNP
cord-284501-5i0w74q4	88	53	-	-	HYPH
cord-284501-5i0w74q4	88	54	M41-Struct	M41-Struct	NNP
cord-284501-5i0w74q4	88	55	;	;	:
cord-284501-5i0w74q4	88	56	the	the	DT
cord-284501-5i0w74q4	88	57	desired	desire	VBN
cord-284501-5i0w74q4	88	58	rVV	rvv	NN
cord-284501-5i0w74q4	88	59	.	.	.
cord-284501-5i0w74q4	89	1	Both	both	DT
cord-284501-5i0w74q4	89	2	recombination	recombination	NN
cord-284501-5i0w74q4	89	3	events	event	NNS
cord-284501-5i0w74q4	89	4	resulted	result	VBD
cord-284501-5i0w74q4	89	5	in	in	IN
cord-284501-5i0w74q4	89	6	the	the	DT
cord-284501-5i0w74q4	89	7	loss	loss	NN
cord-284501-5i0w74q4	89	8	of	of	IN
cord-284501-5i0w74q4	89	9	the	the	DT
cord-284501-5i0w74q4	89	10	GPT	gpt	NN
cord-284501-5i0w74q4	89	11	gene	gene	NN
cord-284501-5i0w74q4	89	12	.	.	.
cord-284501-5i0w74q4	90	1	The	the	DT
cord-284501-5i0w74q4	90	2	IBV	IBV	NNP
cord-284501-5i0w74q4	90	3	genes	gene	NNS
cord-284501-5i0w74q4	90	4	representing	represent	VBG
cord-284501-5i0w74q4	90	5	the	the	DT
cord-284501-5i0w74q4	90	6	structural	structural	JJ
cord-284501-5i0w74q4	90	7	and	and	CC
cord-284501-5i0w74q4	90	8	accessory	accessory	JJ
cord-284501-5i0w74q4	90	9	genes	gene	NNS
cord-284501-5i0w74q4	90	10	are	be	VBP
cord-284501-5i0w74q4	90	11	shown	show	VBN
cord-284501-5i0w74q4	90	12	along	along	IN
cord-284501-5i0w74q4	90	13	with	with	IN
cord-284501-5i0w74q4	90	14	the	the	DT
cord-284501-5i0w74q4	90	15	39-UTRs	39-utrs	CD
cord-284501-5i0w74q4	90	16	and	and	CC
cord-284501-5i0w74q4	90	17	IGR	IGR	NNP
cord-284501-5i0w74q4	90	18	sequences	sequence	NNS
cord-284501-5i0w74q4	90	19	,	,	,
cord-284501-5i0w74q4	90	20	a	a	DT
cord-284501-5i0w74q4	90	21	potential	potential	JJ
cord-284501-5i0w74q4	90	22	recombination	recombination	NN
cord-284501-5i0w74q4	90	23	event	event	NN
cord-284501-5i0w74q4	90	24	is	be	VBZ
cord-284501-5i0w74q4	90	25	indicated	indicate	VBN
cord-284501-5i0w74q4	90	26	between	between	IN
cord-284501-5i0w74q4	90	27	the	the	DT
cord-284501-5i0w74q4	90	28	1416	1416	CD
cord-284501-5i0w74q4	90	29	nt	nt	RB
cord-284501-5i0w74q4	90	30	of	of	IN
cord-284501-5i0w74q4	90	31	the	the	DT
cord-284501-5i0w74q4	90	32	Beau	Beau	NNP
cord-284501-5i0w74q4	90	33	-	-	HYPH
cord-284501-5i0w74q4	90	34	R	R	NNP
cord-284501-5i0w74q4	90	35	replicase	replicase	NN
cord-284501-5i0w74q4	90	36	gene	gene	NN
cord-284501-5i0w74q4	90	37	sequence	sequence	NN
cord-284501-5i0w74q4	90	38	common	common	JJ
cord-284501-5i0w74q4	90	39	to	to	IN
cord-284501-5i0w74q4	90	40	both	both	DT
cord-284501-5i0w74q4	90	41	constructs	construct	NNS
cord-284501-5i0w74q4	90	42	.	.	.
cord-284501-5i0w74q4	91	1	doi:10.1371	doi:10.1371	NNP
cord-284501-5i0w74q4	91	2	/	/	SYM
cord-284501-5i0w74q4	91	3	journal.pone.0007384.g001	journal.pone.0007384.g001	NNP
cord-284501-5i0w74q4	91	4	PCR	PCR	NNP
cord-284501-5i0w74q4	91	5	using	use	VBG
cord-284501-5i0w74q4	91	6	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	91	7	BG56	BG56	NNP
cord-284501-5i0w74q4	91	8	and	and	CC
cord-284501-5i0w74q4	91	9	93/100	93/100	CD
cord-284501-5i0w74q4	91	10	to	to	TO
cord-284501-5i0w74q4	91	11	determine	determine	VB
cord-284501-5i0w74q4	91	12	the	the	DT
cord-284501-5i0w74q4	91	13	identity	identity	NN
cord-284501-5i0w74q4	91	14	of	of	IN
cord-284501-5i0w74q4	91	15	the	the	DT
cord-284501-5i0w74q4	91	16	39-UTR	39-utr	CD
cord-284501-5i0w74q4	91	17	.	.	.
cord-284501-5i0w74q4	92	1	Confluent	confluent	NN
cord-284501-5i0w74q4	92	2	monolayers	monolayer	NNS
cord-284501-5i0w74q4	92	3	of	of	IN
cord-284501-5i0w74q4	92	4	CK	CK	NNP
cord-284501-5i0w74q4	92	5	cells	cell	NNS
cord-284501-5i0w74q4	92	6	were	be	VBD
cord-284501-5i0w74q4	92	7	used	use	VBN
cord-284501-5i0w74q4	92	8	for	for	IN
cord-284501-5i0w74q4	92	9	serial	serial	JJ
cord-284501-5i0w74q4	92	10	passage	passage	NN
cord-284501-5i0w74q4	92	11	of	of	IN
cord-284501-5i0w74q4	92	12	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	92	13	-	-	HYPH
cord-284501-5i0w74q4	92	14	Rep	Rep	NNP
cord-284501-5i0w74q4	92	15	-	-	HYPH
cord-284501-5i0w74q4	92	16	M41-Struct	M41-Struct	NNP
cord-284501-5i0w74q4	92	17	25	25	CD
cord-284501-5i0w74q4	92	18	times	time	NNS
cord-284501-5i0w74q4	92	19	.	.	.
cord-284501-5i0w74q4	93	1	Briefly	briefly	RB
cord-284501-5i0w74q4	93	2	,	,	,
cord-284501-5i0w74q4	93	3	cells	cell	NNS
cord-284501-5i0w74q4	93	4	were	be	VBD
cord-284501-5i0w74q4	93	5	infected	infect	VBN
cord-284501-5i0w74q4	93	6	with	with	IN
cord-284501-5i0w74q4	93	7	the	the	DT
cord-284501-5i0w74q4	93	8	rIBV	rIBV	NNP
cord-284501-5i0w74q4	93	9	and	and	CC
cord-284501-5i0w74q4	93	10	24	24	CD
cord-284501-5i0w74q4	93	11	h	h	NN
cord-284501-5i0w74q4	93	12	post	post	NN
cord-284501-5i0w74q4	93	13	-	-	NN
cord-284501-5i0w74q4	93	14	infection	infection	JJ
cord-284501-5i0w74q4	93	15	medium	medium	NN
cord-284501-5i0w74q4	93	16	was	be	VBD
cord-284501-5i0w74q4	93	17	collected	collect	VBN
cord-284501-5i0w74q4	93	18	,	,	,
cord-284501-5i0w74q4	93	19	diluted	dilute	VBN
cord-284501-5i0w74q4	93	20	1:10	1:10	CD
cord-284501-5i0w74q4	93	21	and	and	CC
cord-284501-5i0w74q4	93	22	used	use	VBD
cord-284501-5i0w74q4	93	23	to	to	TO
cord-284501-5i0w74q4	93	24	infect	infect	VB
cord-284501-5i0w74q4	93	25	a	a	DT
cord-284501-5i0w74q4	93	26	new	new	JJ
cord-284501-5i0w74q4	93	27	monolayer	monolayer	NN
cord-284501-5i0w74q4	93	28	of	of	IN
cord-284501-5i0w74q4	93	29	CK	CK	NNP
cord-284501-5i0w74q4	93	30	cells	cell	NNS
cord-284501-5i0w74q4	93	31	.	.	.
cord-284501-5i0w74q4	94	1	This	this	DT
cord-284501-5i0w74q4	94	2	process	process	NN
cord-284501-5i0w74q4	94	3	was	be	VBD
cord-284501-5i0w74q4	94	4	repeated	repeat	VBN
cord-284501-5i0w74q4	94	5	until	until	IN
cord-284501-5i0w74q4	94	6	passage	passage	NN
cord-284501-5i0w74q4	94	7	25	25	CD
cord-284501-5i0w74q4	94	8	(	(	-LRB-
cord-284501-5i0w74q4	94	9	P	p	NN
cord-284501-5i0w74q4	94	10	25	25	CD
cord-284501-5i0w74q4	94	11	)	)	-RRB-
cord-284501-5i0w74q4	94	12	.	.	.
cord-284501-5i0w74q4	95	1	Total	Total	NNP
cord-284501-5i0w74q4	95	2	RNA	RNA	NNP
cord-284501-5i0w74q4	95	3	was	be	VBD
cord-284501-5i0w74q4	95	4	extracted	extract	VBN
cord-284501-5i0w74q4	95	5	from	from	IN
cord-284501-5i0w74q4	95	6	the	the	DT
cord-284501-5i0w74q4	95	7	P	p	NN
cord-284501-5i0w74q4	95	8	25	25	CD
cord-284501-5i0w74q4	95	9	infected	infect	VBN
cord-284501-5i0w74q4	95	10	CK	CK	NNP
cord-284501-5i0w74q4	95	11	cells	cell	NNS
cord-284501-5i0w74q4	95	12	and	and	CC
cord-284501-5i0w74q4	95	13	RT	RT	NNP
cord-284501-5i0w74q4	95	14	-	-	HYPH
cord-284501-5i0w74q4	95	15	PCR	PCR	NNP
cord-284501-5i0w74q4	95	16	was	be	VBD
cord-284501-5i0w74q4	95	17	used	use	VBN
cord-284501-5i0w74q4	95	18	to	to	TO
cord-284501-5i0w74q4	95	19	generate	generate	VB
cord-284501-5i0w74q4	95	20	a	a	DT
cord-284501-5i0w74q4	95	21	series	series	NN
cord-284501-5i0w74q4	95	22	of	of	IN
cord-284501-5i0w74q4	95	23	overlapping	overlap	VBG
cord-284501-5i0w74q4	95	24	PCR	PCR	NNP
cord-284501-5i0w74q4	95	25	products	product	NNS
cord-284501-5i0w74q4	95	26	covering	cover	VBG
cord-284501-5i0w74q4	95	27	the	the	DT
cord-284501-5i0w74q4	95	28	complete	complete	JJ
cord-284501-5i0w74q4	95	29	genome	genome	NN
cord-284501-5i0w74q4	95	30	of	of	IN
cord-284501-5i0w74q4	95	31	the	the	DT
cord-284501-5i0w74q4	95	32	P	P	NNP
cord-284501-5i0w74q4	95	33	25	25	CD
cord-284501-5i0w74q4	95	34	rIBV	ribv	NN
cord-284501-5i0w74q4	95	35	.	.	.
cord-284501-5i0w74q4	96	1	The	the	DT
cord-284501-5i0w74q4	96	2	RT	RT	NNP
cord-284501-5i0w74q4	96	3	-	-	HYPH
cord-284501-5i0w74q4	96	4	PCR	PCR	NNP
cord-284501-5i0w74q4	96	5	products	product	NNS
cord-284501-5i0w74q4	96	6	were	be	VBD
cord-284501-5i0w74q4	96	7	sequenced	sequence	VBN
cord-284501-5i0w74q4	96	8	using	use	VBG
cord-284501-5i0w74q4	96	9	a	a	DT
cord-284501-5i0w74q4	96	10	variety	variety	NN
cord-284501-5i0w74q4	96	11	of	of	IN
cord-284501-5i0w74q4	96	12	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	96	13	,	,	,
cord-284501-5i0w74q4	96	14	derived	derive	VBN
cord-284501-5i0w74q4	96	15	from	from	IN
cord-284501-5i0w74q4	96	16	the	the	DT
cord-284501-5i0w74q4	96	17	Beau	Beau	NNP
cord-284501-5i0w74q4	96	18	-	-	HYPH
cord-284501-5i0w74q4	96	19	CK	CK	NNP
cord-284501-5i0w74q4	96	20	sequence	sequence	NN
cord-284501-5i0w74q4	96	21	[	[	-LRB-
cord-284501-5i0w74q4	96	22	40	40	CD
cord-284501-5i0w74q4	96	23	]	]	-RRB-
cord-284501-5i0w74q4	96	24	.	.	.
cord-284501-5i0w74q4	97	1	Assembly	assembly	NN
cord-284501-5i0w74q4	97	2	of	of	IN
cord-284501-5i0w74q4	97	3	the	the	DT
cord-284501-5i0w74q4	97	4	sequences	sequence	NNS
cord-284501-5i0w74q4	97	5	was	be	VBD
cord-284501-5i0w74q4	97	6	performed	perform	VBN
cord-284501-5i0w74q4	97	7	using	use	VBG
cord-284501-5i0w74q4	97	8	Gap4	Gap4	NNP
cord-284501-5i0w74q4	97	9	of	of	IN
cord-284501-5i0w74q4	97	10	the	the	DT
cord-284501-5i0w74q4	97	11	Staden	Staden	NNP
cord-284501-5i0w74q4	97	12	Sequence	Sequence	NNP
cord-284501-5i0w74q4	97	13	Software	Software	NNP
cord-284501-5i0w74q4	97	14	Programs	Programs	NNP
cord-284501-5i0w74q4	97	15	[	[	-LRB-
cord-284501-5i0w74q4	97	16	41	41	CD
cord-284501-5i0w74q4	97	17	]	]	-RRB-
cord-284501-5i0w74q4	97	18	.	.	.
cord-284501-5i0w74q4	98	1	Generation	generation	NN
cord-284501-5i0w74q4	98	2	of	of	IN
cord-284501-5i0w74q4	98	3	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	98	4	rIBVs	rIBVs	NNP
cord-284501-5i0w74q4	98	5	with	with	IN
cord-284501-5i0w74q4	98	6	the	the	DT
cord-284501-5i0w74q4	98	7	replicase	replicase	NN
cord-284501-5i0w74q4	98	8	gene	gene	NN
cord-284501-5i0w74q4	98	9	from	from	IN
cord-284501-5i0w74q4	98	10	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	98	11	and	and	CC
cord-284501-5i0w74q4	98	12	the	the	DT
cord-284501-5i0w74q4	98	13	rest	rest	NN
cord-284501-5i0w74q4	98	14	of	of	IN
cord-284501-5i0w74q4	98	15	the	the	DT
cord-284501-5i0w74q4	98	16	genome	genome	NN
cord-284501-5i0w74q4	99	1	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	100	1	A	a	DT
cord-284501-5i0w74q4	100	2	full	full	JJ
cord-284501-5i0w74q4	100	3	-	-	HYPH
cord-284501-5i0w74q4	100	4	length	length	NN
cord-284501-5i0w74q4	100	5	IBV	IBV	NNP
cord-284501-5i0w74q4	100	6	-	-	HYPH
cord-284501-5i0w74q4	100	7	derived	derive	VBN
cord-284501-5i0w74q4	100	8	cDNA	cdna	NN
cord-284501-5i0w74q4	100	9	,	,	,
cord-284501-5i0w74q4	100	10	within	within	IN
cord-284501-5i0w74q4	100	11	the	the	DT
cord-284501-5i0w74q4	100	12	vaccinia	vaccinia	NN
cord-284501-5i0w74q4	100	13	virus	virus	NN
cord-284501-5i0w74q4	100	14	genome	genome	NN
cord-284501-5i0w74q4	100	15	,	,	,
cord-284501-5i0w74q4	100	16	was	be	VBD
cord-284501-5i0w74q4	100	17	generated	generate	VBN
cord-284501-5i0w74q4	100	18	by	by	IN
cord-284501-5i0w74q4	100	19	homologous	homologous	JJ
cord-284501-5i0w74q4	100	20	recombination	recombination	NN
cord-284501-5i0w74q4	100	21	using	use	VBG
cord-284501-5i0w74q4	100	22	the	the	DT
cord-284501-5i0w74q4	100	23	TDS	TDS	NNP
cord-284501-5i0w74q4	100	24	method	method	NN
cord-284501-5i0w74q4	100	25	and	and	CC
cord-284501-5i0w74q4	100	26	consisted	consist	VBD
cord-284501-5i0w74q4	100	27	of	of	IN
cord-284501-5i0w74q4	100	28	the	the	DT
cord-284501-5i0w74q4	100	29	replicase	replicase	NN
cord-284501-5i0w74q4	100	30	gene	gene	NN
cord-284501-5i0w74q4	100	31	from	from	IN
cord-284501-5i0w74q4	100	32	the	the	DT
cord-284501-5i0w74q4	100	33	apathogenic	apathogenic	JJ
cord-284501-5i0w74q4	100	34	IBV	IBV	NNP
cord-284501-5i0w74q4	100	35	strain	strain	VBP
cord-284501-5i0w74q4	100	36	Beau	Beau	NNP
cord-284501-5i0w74q4	100	37	-	-	HYPH
cord-284501-5i0w74q4	100	38	R	R	NNP
cord-284501-5i0w74q4	100	39	and	and	CC
cord-284501-5i0w74q4	100	40	the	the	DT
cord-284501-5i0w74q4	100	41	structural	structural	JJ
cord-284501-5i0w74q4	100	42	and	and	CC
cord-284501-5i0w74q4	100	43	accessory	accessory	JJ
cord-284501-5i0w74q4	100	44	genes	gene	NNS
cord-284501-5i0w74q4	100	45	plus	plus	CC
cord-284501-5i0w74q4	100	46	the	the	DT
cord-284501-5i0w74q4	100	47	39-UTR	39-utr	CD
cord-284501-5i0w74q4	100	48	from	from	IN
cord-284501-5i0w74q4	100	49	the	the	DT
cord-284501-5i0w74q4	100	50	pathogenic	pathogenic	JJ
cord-284501-5i0w74q4	100	51	M41	m41	JJ
cord-284501-5i0w74q4	100	52	strain	strain	NN
cord-284501-5i0w74q4	100	53	of	of	IN
cord-284501-5i0w74q4	100	54	IBV	IBV	NNP
cord-284501-5i0w74q4	100	55	.	.	.
cord-284501-5i0w74q4	101	1	This	this	DT
cord-284501-5i0w74q4	101	2	was	be	VBD
cord-284501-5i0w74q4	101	3	achieved	achieve	VBN
cord-284501-5i0w74q4	101	4	using	use	VBG
cord-284501-5i0w74q4	101	5	a	a	DT
cord-284501-5i0w74q4	101	6	Beau	Beau	NNP
cord-284501-5i0w74q4	101	7	-	-	HYPH
cord-284501-5i0w74q4	101	8	R	r	NN
cord-284501-5i0w74q4	101	9	-	-	HYPH
cord-284501-5i0w74q4	101	10	based	base	VBN
cord-284501-5i0w74q4	101	11	receiver	receiver	NN
cord-284501-5i0w74q4	101	12	sequence	sequence	NN
cord-284501-5i0w74q4	101	13	consisting	consist	VBG
cord-284501-5i0w74q4	101	14	of	of	IN
cord-284501-5i0w74q4	101	15	the	the	DT
cord-284501-5i0w74q4	101	16	complete	complete	JJ
cord-284501-5i0w74q4	101	17	replicase	replicase	NN
cord-284501-5i0w74q4	101	18	gene	gene	NN
cord-284501-5i0w74q4	101	19	,	,	,
cord-284501-5i0w74q4	101	20	followed	follow	VBN
cord-284501-5i0w74q4	101	21	by	by	IN
cord-284501-5i0w74q4	101	22	the	the	DT
cord-284501-5i0w74q4	101	23	first	first	JJ
cord-284501-5i0w74q4	101	24	376	376	CD
cord-284501-5i0w74q4	101	25	nt	nt	RB
cord-284501-5i0w74q4	101	26	of	of	IN
cord-284501-5i0w74q4	101	27	the	the	DT
cord-284501-5i0w74q4	101	28	S	S	NNP
cord-284501-5i0w74q4	101	29	gene	gene	NN
cord-284501-5i0w74q4	101	30	fused	fuse	VBD
cord-284501-5i0w74q4	101	31	to	to	IN
cord-284501-5i0w74q4	101	32	the	the	DT
cord-284501-5i0w74q4	101	33	N	n	CD
cord-284501-5i0w74q4	101	34	gene	gene	NN
cord-284501-5i0w74q4	101	35	and	and	CC
cord-284501-5i0w74q4	101	36	39-UTR	39-utr	CD
cord-284501-5i0w74q4	101	37	(	(	-LRB-
cord-284501-5i0w74q4	101	38	Fig	Fig	NNP
cord-284501-5i0w74q4	101	39	.	.	NNP
cord-284501-5i0w74q4	101	40	1	1	CD
cord-284501-5i0w74q4	101	41	)	)	-RRB-
cord-284501-5i0w74q4	101	42	.	.	.
cord-284501-5i0w74q4	102	1	The	the	DT
cord-284501-5i0w74q4	102	2	donor	donor	NN
cord-284501-5i0w74q4	102	3	sequence	sequence	NN
cord-284501-5i0w74q4	102	4	consisted	consist	VBD
cord-284501-5i0w74q4	102	5	of	of	IN
cord-284501-5i0w74q4	102	6	the	the	DT
cord-284501-5i0w74q4	102	7	last	last	JJ
cord-284501-5i0w74q4	102	8	1246	1246	CD
cord-284501-5i0w74q4	102	9	nt	nt	RB
cord-284501-5i0w74q4	102	10	of	of	IN
cord-284501-5i0w74q4	102	11	the	the	DT
cord-284501-5i0w74q4	102	12	Beau	Beau	NNP
cord-284501-5i0w74q4	102	13	-	-	HYPH
cord-284501-5i0w74q4	102	14	R	R	NNP
cord-284501-5i0w74q4	102	15	replicase	replicase	NN
cord-284501-5i0w74q4	102	16	gene	gene	NN
cord-284501-5i0w74q4	102	17	fused	fuse	VBN
cord-284501-5i0w74q4	102	18	to	to	IN
cord-284501-5i0w74q4	102	19	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	102	20	-	-	HYPH
cord-284501-5i0w74q4	102	21	derived	derive	VBN
cord-284501-5i0w74q4	102	22	cDNA	cdna	NN
cord-284501-5i0w74q4	102	23	from	from	IN
cord-284501-5i0w74q4	102	24	the	the	DT
cord-284501-5i0w74q4	102	25	S	S	NNP
cord-284501-5i0w74q4	102	26	gene	gene	NN
cord-284501-5i0w74q4	102	27	to	to	IN
cord-284501-5i0w74q4	102	28	the	the	DT
cord-284501-5i0w74q4	102	29	poly(A	poly(a	JJ
cord-284501-5i0w74q4	102	30	)	)	-RRB-
cord-284501-5i0w74q4	102	31	tail	tail	NN
cord-284501-5i0w74q4	102	32	(	(	-LRB-
cord-284501-5i0w74q4	102	33	Fig	Fig	NNP
cord-284501-5i0w74q4	102	34	.	.	.
cord-284501-5i0w74q4	102	35	1	1	CD
cord-284501-5i0w74q4	102	36	)	)	-RRB-
cord-284501-5i0w74q4	102	37	.	.	.
cord-284501-5i0w74q4	103	1	Following	follow	VBG
cord-284501-5i0w74q4	103	2	TDS	TDS	NNP
cord-284501-5i0w74q4	103	3	,	,	,
cord-284501-5i0w74q4	103	4	DNA	DNA	NNP
cord-284501-5i0w74q4	103	5	was	be	VBD
cord-284501-5i0w74q4	103	6	extracted	extract	VBN
cord-284501-5i0w74q4	103	7	from	from	IN
cord-284501-5i0w74q4	103	8	20	20	CD
cord-284501-5i0w74q4	103	9	rVVs	rvv	NNS
cord-284501-5i0w74q4	103	10	,	,	,
cord-284501-5i0w74q4	103	11	potentially	potentially	RB
cord-284501-5i0w74q4	103	12	containing	contain	VBG
cord-284501-5i0w74q4	103	13	the	the	DT
cord-284501-5i0w74q4	103	14	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	103	15	IBV	IBV	NNP
cord-284501-5i0w74q4	103	16	full	full	JJ
cord-284501-5i0w74q4	103	17	-	-	HYPH
cord-284501-5i0w74q4	103	18	length	length	NN
cord-284501-5i0w74q4	103	19	cDNA	cdna	NN
cord-284501-5i0w74q4	103	20	.	.	.
cord-284501-5i0w74q4	104	1	Analysis	analysis	NN
cord-284501-5i0w74q4	104	2	by	by	IN
cord-284501-5i0w74q4	104	3	PCR	PCR	NNP
cord-284501-5i0w74q4	104	4	,	,	,
cord-284501-5i0w74q4	104	5	using	use	VBG
cord-284501-5i0w74q4	104	6	GPT	gpt	NN
cord-284501-5i0w74q4	104	7	specific	specific	JJ
cord-284501-5i0w74q4	104	8	primers	primer	NNS
cord-284501-5i0w74q4	104	9	to	to	TO
cord-284501-5i0w74q4	104	10	confirm	confirm	VB
cord-284501-5i0w74q4	104	11	the	the	DT
cord-284501-5i0w74q4	104	12	loss	loss	NN
cord-284501-5i0w74q4	104	13	of	of	IN
cord-284501-5i0w74q4	104	14	the	the	DT
cord-284501-5i0w74q4	104	15	E.	E.	NNP
cord-284501-5i0w74q4	104	16	coli	coli	VBZ
cord-284501-5i0w74q4	104	17	GPT	GPT	NNP
cord-284501-5i0w74q4	104	18	gene	gene	NN
cord-284501-5i0w74q4	104	19	,	,	,
cord-284501-5i0w74q4	104	20	on	on	IN
cord-284501-5i0w74q4	104	21	six	six	CD
cord-284501-5i0w74q4	104	22	of	of	IN
cord-284501-5i0w74q4	104	23	the	the	DT
cord-284501-5i0w74q4	104	24	rVV	rVV	NNP
cord-284501-5i0w74q4	104	25	DNAs	DNAs	NNP
cord-284501-5i0w74q4	104	26	confirmed	confirm	VBD
cord-284501-5i0w74q4	104	27	the	the	DT
cord-284501-5i0w74q4	104	28	loss	loss	NN
cord-284501-5i0w74q4	104	29	of	of	IN
cord-284501-5i0w74q4	104	30	the	the	DT
cord-284501-5i0w74q4	104	31	GPT	gpt	NN
cord-284501-5i0w74q4	104	32	gene	gene	NN
cord-284501-5i0w74q4	104	33	following	follow	VBG
cord-284501-5i0w74q4	104	34	the	the	DT
cord-284501-5i0w74q4	104	35	second	second	JJ
cord-284501-5i0w74q4	104	36	TDS	TDS	NNP
cord-284501-5i0w74q4	104	37	recombination	recombination	NN
cord-284501-5i0w74q4	104	38	event	event	NN
cord-284501-5i0w74q4	104	39	(	(	-LRB-
cord-284501-5i0w74q4	104	40	Fig	Fig	NNP
cord-284501-5i0w74q4	104	41	.	.	.
cord-284501-5i0w74q4	104	42	1	1	CD
cord-284501-5i0w74q4	104	43	)	)	-RRB-
cord-284501-5i0w74q4	104	44	.	.	.
cord-284501-5i0w74q4	105	1	The	the	DT
cord-284501-5i0w74q4	105	2	IBV	IBV	NNP
cord-284501-5i0w74q4	105	3	cDNAs	cdna	VBZ
cord-284501-5i0w74q4	105	4	within	within	IN
cord-284501-5i0w74q4	105	5	these	these	DT
cord-284501-5i0w74q4	105	6	six	six	CD
cord-284501-5i0w74q4	105	7	rVV	rVV	NNS
cord-284501-5i0w74q4	105	8	DNAs	dna	NNS
cord-284501-5i0w74q4	105	9	were	be	VBD
cord-284501-5i0w74q4	105	10	analysed	analyse	VBN
cord-284501-5i0w74q4	105	11	(	(	-LRB-
cord-284501-5i0w74q4	105	12	1	1	CD
cord-284501-5i0w74q4	105	13	)	)	-RRB-
cord-284501-5i0w74q4	105	14	for	for	IN
cord-284501-5i0w74q4	105	15	the	the	DT
cord-284501-5i0w74q4	105	16	presence	presence	NN
cord-284501-5i0w74q4	105	17	of	of	IN
cord-284501-5i0w74q4	105	18	the	the	DT
cord-284501-5i0w74q4	105	19	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	105	20	-	-	HYPH
cord-284501-5i0w74q4	105	21	derived	derive	VBN
cord-284501-5i0w74q4	105	22	39-UTR	39-utr	CD
cord-284501-5i0w74q4	105	23	sequence	sequence	NN
cord-284501-5i0w74q4	105	24	,	,	,
cord-284501-5i0w74q4	105	25	which	which	WDT
cord-284501-5i0w74q4	105	26	is	be	VBZ
cord-284501-5i0w74q4	105	27	184	184	CD
cord-284501-5i0w74q4	105	28	nt	nt	RB
cord-284501-5i0w74q4	105	29	shorter	short	JJR
cord-284501-5i0w74q4	105	30	than	than	IN
cord-284501-5i0w74q4	105	31	the	the	DT
cord-284501-5i0w74q4	105	32	Beau	Beau	NNP
cord-284501-5i0w74q4	105	33	-	-	HYPH
cord-284501-5i0w74q4	105	34	R	R	NNP
cord-284501-5i0w74q4	105	35	39-UTR	39-utr	CD
cord-284501-5i0w74q4	105	36	[	[	-LRB-
cord-284501-5i0w74q4	105	37	42	42	CD
cord-284501-5i0w74q4	105	38	]	]	-RRB-
cord-284501-5i0w74q4	105	39	,	,	,
cord-284501-5i0w74q4	105	40	(	(	-LRB-
cord-284501-5i0w74q4	105	41	2	2	LS
cord-284501-5i0w74q4	105	42	)	)	-RRB-
cord-284501-5i0w74q4	105	43	the	the	DT
cord-284501-5i0w74q4	105	44	junction	junction	NN
cord-284501-5i0w74q4	105	45	between	between	IN
cord-284501-5i0w74q4	105	46	the	the	DT
cord-284501-5i0w74q4	105	47	replicase	replicase	NN
cord-284501-5i0w74q4	105	48	and	and	CC
cord-284501-5i0w74q4	105	49	S	S	NNP
cord-284501-5i0w74q4	105	50	gene	gene	NN
cord-284501-5i0w74q4	105	51	using	use	VBG
cord-284501-5i0w74q4	105	52	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	105	53	BG40	BG40	NNP
cord-284501-5i0w74q4	105	54	and	and	CC
cord-284501-5i0w74q4	105	55	BG134	BG134	NNP
cord-284501-5i0w74q4	106	1	and	and	CC
cord-284501-5i0w74q4	106	2	(	(	-LRB-
cord-284501-5i0w74q4	106	3	3	3	LS
cord-284501-5i0w74q4	106	4	)	)	-RRB-
cord-284501-5i0w74q4	106	5	for	for	IN
cord-284501-5i0w74q4	106	6	the	the	DT
cord-284501-5i0w74q4	106	7	presence	presence	NN
cord-284501-5i0w74q4	106	8	of	of	IN
cord-284501-5i0w74q4	106	9	the	the	DT
cord-284501-5i0w74q4	106	10	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	106	11	-	-	HYPH
cord-284501-5i0w74q4	106	12	derived	derive	VBN
cord-284501-5i0w74q4	106	13	M	M	NNP
cord-284501-5i0w74q4	106	14	gene	gene	NN
cord-284501-5i0w74q4	106	15	using	use	VBG
cord-284501-5i0w74q4	106	16	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	106	17	BG52	BG52	NNP
cord-284501-5i0w74q4	106	18	(	(	-LRB-
cord-284501-5i0w74q4	106	19	59	59	CD
cord-284501-5i0w74q4	106	20	-	-	SYM
cord-284501-5i0w74q4	106	21	24945	24945	CD
cord-284501-5i0w74q4	106	22	GAATGGTGTTCTT	GAATGGTGTTCTT	NNP
cord-284501-5i0w74q4	106	23	-	-	HYPH
cord-284501-5i0w74q4	106	24	TATTG	TATTG	NNP
cord-284501-5i0w74q4	106	25	24962	24962	CD
cord-284501-5i0w74q4	106	26	-39	-39	CD
cord-284501-5i0w74q4	106	27	)	)	-RRB-
cord-284501-5i0w74q4	107	1	and	and	CC
cord-284501-5i0w74q4	107	2	BG146	BG146	NNP
cord-284501-5i0w74q4	107	3	(	(	-LRB-
cord-284501-5i0w74q4	107	4	59	59	CD
cord-284501-5i0w74q4	107	5	-	-	SYM
cord-284501-5i0w74q4	107	6	25549	25549	CD
cord-284501-5i0w74q4	107	7	TCTAACACTC	TCTAACACTC	NNP
cord-284501-5i0w74q4	107	8	-	-	HYPH
cord-284501-5i0w74q4	107	9	TAAGTTGAG	TAAGTTGAG	NNP
cord-284501-5i0w74q4	107	10	25567	25567	CD
cord-284501-5i0w74q4	107	11	-39	-39	NNP
cord-284501-5i0w74q4	107	12	)	)	-RRB-
cord-284501-5i0w74q4	107	13	;	;	:
cord-284501-5i0w74q4	107	14	to	to	TO
cord-284501-5i0w74q4	107	15	confirm	confirm	VB
cord-284501-5i0w74q4	107	16	that	that	IN
cord-284501-5i0w74q4	107	17	the	the	DT
cord-284501-5i0w74q4	107	18	second	second	JJ
cord-284501-5i0w74q4	107	19	TDS	TDS	NNP
cord-284501-5i0w74q4	107	20	recombination	recombination	NN
cord-284501-5i0w74q4	107	21	event	event	NN
cord-284501-5i0w74q4	107	22	had	have	VBD
cord-284501-5i0w74q4	107	23	not	not	RB
cord-284501-5i0w74q4	107	24	resulted	result	VBN
cord-284501-5i0w74q4	107	25	in	in	IN
cord-284501-5i0w74q4	107	26	generation	generation	NN
cord-284501-5i0w74q4	107	27	of	of	IN
cord-284501-5i0w74q4	107	28	the	the	DT
cord-284501-5i0w74q4	107	29	starting	starting	NN
cord-284501-5i0w74q4	107	30	receiver	receiver	NN
cord-284501-5i0w74q4	107	31	sequence	sequence	NN
cord-284501-5i0w74q4	107	32	(	(	-LRB-
cord-284501-5i0w74q4	107	33	Fig	Fig	NNP
cord-284501-5i0w74q4	107	34	.	.	.
cord-284501-5i0w74q4	107	35	1	1	CD
cord-284501-5i0w74q4	107	36	)	)	-RRB-
cord-284501-5i0w74q4	107	37	.	.	.
cord-284501-5i0w74q4	108	1	Two	two	CD
cord-284501-5i0w74q4	108	2	rVVs	rvvs	XX
cord-284501-5i0w74q4	108	3	,	,	,
cord-284501-5i0w74q4	108	4	rVV	rVV	NNP
cord-284501-5i0w74q4	108	5	-	-	HYPH
cord-284501-5i0w74q4	108	6	BeauR	BeauR	NNP
cord-284501-5i0w74q4	108	7	-	-	HYPH
cord-284501-5i0w74q4	108	8	Rep	Rep	NNP
cord-284501-5i0w74q4	108	9	-	-	HYPH
cord-284501-5i0w74q4	108	10	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	108	11	and	and	CC
cord-284501-5i0w74q4	108	12	rVV	rvv	NN
cord-284501-5i0w74q4	108	13	-	-	HYPH
cord-284501-5i0w74q4	108	14	BeauR	BeauR	NNP
cord-284501-5i0w74q4	108	15	-	-	HYPH
cord-284501-5i0w74q4	108	16	Rep	Rep	NNP
cord-284501-5i0w74q4	108	17	-	-	HYPH
cord-284501-5i0w74q4	108	18	M41-Struct-12	M41-Struct-12	NNP
cord-284501-5i0w74q4	108	19	,	,	,
cord-284501-5i0w74q4	108	20	that	that	WDT
cord-284501-5i0w74q4	108	21	did	do	VBD
cord-284501-5i0w74q4	108	22	contain	contain	VB
cord-284501-5i0w74q4	108	23	the	the	DT
cord-284501-5i0w74q4	108	24	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	108	25	-	-	HYPH
cord-284501-5i0w74q4	108	26	derived	derive	VBN
cord-284501-5i0w74q4	108	27	39-UTR	39-utr	CD
cord-284501-5i0w74q4	108	28	and	and	CC
cord-284501-5i0w74q4	108	29	M	M	NNP
cord-284501-5i0w74q4	108	30	gene	gene	NN
cord-284501-5i0w74q4	108	31	were	be	VBD
cord-284501-5i0w74q4	108	32	further	further	RB
cord-284501-5i0w74q4	108	33	screened	screen	VBN
cord-284501-5i0w74q4	108	34	by	by	IN
cord-284501-5i0w74q4	108	35	spot	spot	NN
cord-284501-5i0w74q4	108	36	sequence	sequence	NN
cord-284501-5i0w74q4	108	37	analysis	analysis	NN
cord-284501-5i0w74q4	108	38	of	of	IN
cord-284501-5i0w74q4	108	39	the	the	DT
cord-284501-5i0w74q4	108	40	IBV	IBV	NNP
cord-284501-5i0w74q4	108	41	cDNA	cdna	NN
cord-284501-5i0w74q4	108	42	to	to	TO
cord-284501-5i0w74q4	108	43	confirm	confirm	VB
cord-284501-5i0w74q4	108	44	that	that	IN
cord-284501-5i0w74q4	108	45	the	the	DT
cord-284501-5i0w74q4	108	46	region	region	NN
cord-284501-5i0w74q4	108	47	downstream	downstream	RB
cord-284501-5i0w74q4	108	48	of	of	IN
cord-284501-5i0w74q4	108	49	the	the	DT
cord-284501-5i0w74q4	108	50	Beau	Beau	NNP
cord-284501-5i0w74q4	108	51	-	-	HYPH
cord-284501-5i0w74q4	108	52	R	R	NNP
cord-284501-5i0w74q4	108	53	replicase	replicase	NN
cord-284501-5i0w74q4	108	54	gene	gene	NN
cord-284501-5i0w74q4	108	55	had	have	VBD
cord-284501-5i0w74q4	108	56	been	be	VBN
cord-284501-5i0w74q4	108	57	replaced	replace	VBN
cord-284501-5i0w74q4	108	58	with	with	IN
cord-284501-5i0w74q4	108	59	the	the	DT
cord-284501-5i0w74q4	108	60	corresponding	corresponding	JJ
cord-284501-5i0w74q4	108	61	sequence	sequence	NN
cord-284501-5i0w74q4	108	62	from	from	IN
cord-284501-5i0w74q4	108	63	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	108	64	;	;	:
cord-284501-5i0w74q4	108	65	the	the	DT
cord-284501-5i0w74q4	108	66	sequences	sequence	NNS
cord-284501-5i0w74q4	108	67	were	be	VBD
cord-284501-5i0w74q4	108	68	as	as	IN
cord-284501-5i0w74q4	108	69	expected	expect	VBN
cord-284501-5i0w74q4	108	70	for	for	IN
cord-284501-5i0w74q4	108	71	the	the	DT
cord-284501-5i0w74q4	108	72	required	require	VBN
cord-284501-5i0w74q4	108	73	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	108	74	IBV	IBV	NNP
cord-284501-5i0w74q4	108	75	sequence	sequence	NN
cord-284501-5i0w74q4	108	76	.	.	.
cord-284501-5i0w74q4	109	1	Two	two	CD
cord-284501-5i0w74q4	109	2	infectious	infectious	JJ
cord-284501-5i0w74q4	109	3	rIBVs	ribvs	NN
cord-284501-5i0w74q4	109	4	,	,	,
cord-284501-5i0w74q4	109	5	rBeauR	rbeaur	NN
cord-284501-5i0w74q4	109	6	-	-	HYPH
cord-284501-5i0w74q4	109	7	Rep	Rep	NNP
cord-284501-5i0w74q4	109	8	-	-	HYPH
cord-284501-5i0w74q4	109	9	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	109	10	and	and	CC
cord-284501-5i0w74q4	109	11	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	109	12	-	-	HYPH
cord-284501-5i0w74q4	109	13	Rep	rep	NN
cord-284501-5i0w74q4	109	14	-	-	HYPH
cord-284501-5i0w74q4	109	15	M41-Struct-12	M41-Struct-12	NNP
cord-284501-5i0w74q4	109	16	,	,	,
cord-284501-5i0w74q4	109	17	were	be	VBD
cord-284501-5i0w74q4	109	18	recovered	recover	VBN
cord-284501-5i0w74q4	109	19	from	from	IN
cord-284501-5i0w74q4	109	20	DNA	DNA	NNP
cord-284501-5i0w74q4	109	21	extracted	extract	VBN
cord-284501-5i0w74q4	109	22	from	from	IN
cord-284501-5i0w74q4	109	23	rVV	rVV	NNP
cord-284501-5i0w74q4	109	24	-	-	HYPH
cord-284501-5i0w74q4	109	25	BeauR	BeauR	NNP
cord-284501-5i0w74q4	109	26	-	-	HYPH
cord-284501-5i0w74q4	109	27	Rep	Rep	NNP
cord-284501-5i0w74q4	109	28	-	-	HYPH
cord-284501-5i0w74q4	109	29	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	109	30	and	and	CC
cord-284501-5i0w74q4	109	31	rVV	rvv	NN
cord-284501-5i0w74q4	109	32	-	-	HYPH
cord-284501-5i0w74q4	109	33	BeauR	BeauR	NNP
cord-284501-5i0w74q4	109	34	-	-	HYPH
cord-284501-5i0w74q4	109	35	Rep	Rep	NNP
cord-284501-5i0w74q4	109	36	-	-	HYPH
cord-284501-5i0w74q4	109	37	M41-Struct-12	M41-Struct-12	NNP
cord-284501-5i0w74q4	109	38	,	,	,
cord-284501-5i0w74q4	109	39	respectively	respectively	RB
cord-284501-5i0w74q4	109	40	,	,	,
cord-284501-5i0w74q4	109	41	using	use	VBG
cord-284501-5i0w74q4	109	42	CK	CK	NNP
cord-284501-5i0w74q4	109	43	cells	cell	NNS
cord-284501-5i0w74q4	109	44	,	,	,
cord-284501-5i0w74q4	109	45	previously	previously	RB
cord-284501-5i0w74q4	109	46	infected	infect	VBN
cord-284501-5i0w74q4	109	47	with	with	IN
cord-284501-5i0w74q4	109	48	rFPV	rFPV	NNS
cord-284501-5i0w74q4	109	49	/	/	SYM
cord-284501-5i0w74q4	109	50	T7	T7	NNP
cord-284501-5i0w74q4	109	51	,	,	,
cord-284501-5i0w74q4	109	52	to	to	TO
cord-284501-5i0w74q4	109	53	provide	provide	VB
cord-284501-5i0w74q4	109	54	T7	T7	NNP
cord-284501-5i0w74q4	109	55	RNA	RNA	NNP
cord-284501-5i0w74q4	109	56	polymerase	polymerase	NN
cord-284501-5i0w74q4	109	57	,	,	,
cord-284501-5i0w74q4	109	58	and	and	CC
cord-284501-5i0w74q4	109	59	co	co	NNS
cord-284501-5i0w74q4	109	60	-	-	VBN
cord-284501-5i0w74q4	109	61	transfected	transfecte	VBN
cord-284501-5i0w74q4	109	62	with	with	IN
cord-284501-5i0w74q4	109	63	the	the	DT
cord-284501-5i0w74q4	109	64	rVV	rVV	NNP
cord-284501-5i0w74q4	109	65	DNA	DNA	NNP
cord-284501-5i0w74q4	109	66	and	and	CC
cord-284501-5i0w74q4	109	67	pCi	pCi	NNP
cord-284501-5i0w74q4	109	68	-	-	HYPH
cord-284501-5i0w74q4	109	69	Nuc	nuc	NN
cord-284501-5i0w74q4	109	70	[	[	-LRB-
cord-284501-5i0w74q4	109	71	35	35	CD
cord-284501-5i0w74q4	109	72	]	]	-RRB-
cord-284501-5i0w74q4	109	73	.	.	.
cord-284501-5i0w74q4	110	1	The	the	DT
cord-284501-5i0w74q4	110	2	transfected	transfecte	VBN
cord-284501-5i0w74q4	110	3	CK	CK	NNP
cord-284501-5i0w74q4	110	4	cells	cell	NNS
cord-284501-5i0w74q4	110	5	(	(	-LRB-
cord-284501-5i0w74q4	110	6	P	p	NN
cord-284501-5i0w74q4	110	7	0	0	CD
cord-284501-5i0w74q4	110	8	)	)	-RRB-
cord-284501-5i0w74q4	110	9	were	be	VBD
cord-284501-5i0w74q4	110	10	incubated	incubate	VBN
cord-284501-5i0w74q4	110	11	until	until	IN
cord-284501-5i0w74q4	110	12	they	-PRON-	PRP
cord-284501-5i0w74q4	110	13	showed	show	VBD
cord-284501-5i0w74q4	110	14	a	a	DT
cord-284501-5i0w74q4	110	15	cytopathic	cytopathic	JJ
cord-284501-5i0w74q4	110	16	effect	effect	NN
cord-284501-5i0w74q4	110	17	(	(	-LRB-
cord-284501-5i0w74q4	110	18	CPE	CPE	NNP
cord-284501-5i0w74q4	110	19	)	)	-RRB-
cord-284501-5i0w74q4	110	20	,	,	,
cord-284501-5i0w74q4	110	21	the	the	DT
cord-284501-5i0w74q4	110	22	medium	medium	NN
cord-284501-5i0w74q4	110	23	was	be	VBD
cord-284501-5i0w74q4	110	24	filtered	filter	VBN
cord-284501-5i0w74q4	110	25	to	to	TO
cord-284501-5i0w74q4	110	26	remove	remove	VB
cord-284501-5i0w74q4	110	27	any	any	DT
cord-284501-5i0w74q4	110	28	rFPV	rFPV	NNS
cord-284501-5i0w74q4	110	29	/	/	SYM
cord-284501-5i0w74q4	110	30	T7	t7	NN
cord-284501-5i0w74q4	110	31	and	and	CC
cord-284501-5i0w74q4	111	1	any	any	DT
cord-284501-5i0w74q4	111	2	potential	potential	JJ
cord-284501-5i0w74q4	111	3	rIBV	rIBV	VBD
cord-284501-5i0w74q4	111	4	passaged	passage	VBN
cord-284501-5i0w74q4	111	5	three	three	CD
cord-284501-5i0w74q4	111	6	times	time	NNS
cord-284501-5i0w74q4	111	7	more	more	JJR
cord-284501-5i0w74q4	111	8	on	on	IN
cord-284501-5i0w74q4	111	9	CK	CK	NNP
cord-284501-5i0w74q4	111	10	cells	cell	NNS
cord-284501-5i0w74q4	111	11	(	(	-LRB-
cord-284501-5i0w74q4	111	12	P	p	NN
cord-284501-5i0w74q4	111	13	3	3	CD
cord-284501-5i0w74q4	111	14	)	)	-RRB-
cord-284501-5i0w74q4	111	15	.	.	.
cord-284501-5i0w74q4	112	1	Total	Total	NNP
cord-284501-5i0w74q4	112	2	RNA	RNA	NNP
cord-284501-5i0w74q4	112	3	from	from	IN
cord-284501-5i0w74q4	112	4	the	the	DT
cord-284501-5i0w74q4	112	5	infected	infected	JJ
cord-284501-5i0w74q4	112	6	P	p	NN
cord-284501-5i0w74q4	112	7	3	3	CD
cord-284501-5i0w74q4	112	8	CK	CK	NNP
cord-284501-5i0w74q4	112	9	cells	cell	NNS
cord-284501-5i0w74q4	112	10	was	be	VBD
cord-284501-5i0w74q4	112	11	extracted	extract	VBN
cord-284501-5i0w74q4	112	12	and	and	CC
cord-284501-5i0w74q4	112	13	analysed	analyse	VBN
cord-284501-5i0w74q4	112	14	by	by	IN
cord-284501-5i0w74q4	112	15	RT	RT	NNP
cord-284501-5i0w74q4	112	16	-	-	HYPH
cord-284501-5i0w74q4	112	17	PCR	PCR	NNP
cord-284501-5i0w74q4	112	18	and	and	CC
cord-284501-5i0w74q4	112	19	spot	spot	NN
cord-284501-5i0w74q4	112	20	sequence	sequence	NN
cord-284501-5i0w74q4	112	21	analysis	analysis	NN
cord-284501-5i0w74q4	112	22	.	.	.
cord-284501-5i0w74q4	113	1	Sequence	sequence	NN
cord-284501-5i0w74q4	113	2	analysis	analysis	NN
cord-284501-5i0w74q4	113	3	showed	show	VBD
cord-284501-5i0w74q4	113	4	that	that	IN
cord-284501-5i0w74q4	113	5	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	113	6	-	-	HYPH
cord-284501-5i0w74q4	113	7	Rep	Rep	NNP
cord-284501-5i0w74q4	113	8	-	-	HYPH
cord-284501-5i0w74q4	113	9	M41-Struct-12	M41-Struct-12	NNP
cord-284501-5i0w74q4	113	10	contained	contain	VBD
cord-284501-5i0w74q4	113	11	an	an	DT
cord-284501-5i0w74q4	113	12	extra	extra	JJ
cord-284501-5i0w74q4	113	13	adenosine	adenosine	NN
cord-284501-5i0w74q4	113	14	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	113	15	at	at	IN
cord-284501-5i0w74q4	113	16	position	position	NN
cord-284501-5i0w74q4	113	17	25317	25317	CD
cord-284501-5i0w74q4	113	18	in	in	IN
cord-284501-5i0w74q4	113	19	a	a	DT
cord-284501-5i0w74q4	113	20	six	six	CD
cord-284501-5i0w74q4	113	21	base	base	NN
cord-284501-5i0w74q4	113	22	polyadenosine	polyadenosine	NN
cord-284501-5i0w74q4	113	23	repeat	repeat	NN
cord-284501-5i0w74q4	113	24	sequence	sequence	NN
cord-284501-5i0w74q4	113	25	within	within	IN
cord-284501-5i0w74q4	113	26	the	the	DT
cord-284501-5i0w74q4	113	27	M41	m41	JJ
cord-284501-5i0w74q4	113	28	intergenic	intergenic	JJ
cord-284501-5i0w74q4	113	29	region	region	NN
cord-284501-5i0w74q4	113	30	(	(	-LRB-
cord-284501-5i0w74q4	113	31	IGR	IGR	NNP
cord-284501-5i0w74q4	113	32	)	)	-RRB-
cord-284501-5i0w74q4	113	33	between	between	IN
cord-284501-5i0w74q4	113	34	the	the	DT
cord-284501-5i0w74q4	113	35	end	end	NN
cord-284501-5i0w74q4	113	36	of	of	IN
cord-284501-5i0w74q4	113	37	the	the	DT
cord-284501-5i0w74q4	113	38	M	M	NNP
cord-284501-5i0w74q4	113	39	gene	gene	NN
cord-284501-5i0w74q4	113	40	and	and	CC
cord-284501-5i0w74q4	113	41	start	start	NN
cord-284501-5i0w74q4	113	42	of	of	IN
cord-284501-5i0w74q4	113	43	gene	gene	NN
cord-284501-5i0w74q4	113	44	5	5	CD
cord-284501-5i0w74q4	113	45	.	.	.
cord-284501-5i0w74q4	114	1	Consequently	consequently	RB
cord-284501-5i0w74q4	114	2	only	only	RB
cord-284501-5i0w74q4	114	3	rBeauR	rbeaur	CD
cord-284501-5i0w74q4	114	4	-	-	HYPH
cord-284501-5i0w74q4	114	5	Rep	rep	NN
cord-284501-5i0w74q4	114	6	-	-	HYPH
cord-284501-5i0w74q4	114	7	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	114	8	from	from	IN
cord-284501-5i0w74q4	114	9	the	the	DT
cord-284501-5i0w74q4	114	10	P	p	NN
cord-284501-5i0w74q4	114	11	3	3	CD
cord-284501-5i0w74q4	114	12	CK	CK	NNP
cord-284501-5i0w74q4	114	13	cells	cell	NNS
cord-284501-5i0w74q4	114	14	was	be	VBD
cord-284501-5i0w74q4	114	15	titrated	titrate	VBN
cord-284501-5i0w74q4	114	16	in	in	IN
cord-284501-5i0w74q4	114	17	CK	CK	NNP
cord-284501-5i0w74q4	114	18	cells	cell	NNS
cord-284501-5i0w74q4	114	19	and	and	CC
cord-284501-5i0w74q4	114	20	used	use	VBN
cord-284501-5i0w74q4	114	21	for	for	IN
cord-284501-5i0w74q4	114	22	further	further	JJ
cord-284501-5i0w74q4	114	23	characterisation	characterisation	NN
cord-284501-5i0w74q4	114	24	.	.	.
cord-284501-5i0w74q4	115	1	Sequence	sequence	NN
cord-284501-5i0w74q4	115	2	analysis	analysis	NN
cord-284501-5i0w74q4	115	3	of	of	IN
cord-284501-5i0w74q4	115	4	the	the	DT
cord-284501-5i0w74q4	115	5	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	115	6	-	-	HYPH
cord-284501-5i0w74q4	115	7	derived	derive	VBN
cord-284501-5i0w74q4	115	8	sequence	sequence	NN
cord-284501-5i0w74q4	115	9	in	in	IN
cord-284501-5i0w74q4	115	10	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	115	11	-	-	HYPH
cord-284501-5i0w74q4	115	12	Rep	Rep	NNP
cord-284501-5i0w74q4	115	13	-	-	HYPH
cord-284501-5i0w74q4	115	14	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	115	15	revealed	reveal	VBD
cord-284501-5i0w74q4	115	16	three	three	CD
cord-284501-5i0w74q4	115	17	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	115	18	changes	change	NNS
cord-284501-5i0w74q4	115	19	when	when	WRB
cord-284501-5i0w74q4	115	20	compared	compare	VBN
cord-284501-5i0w74q4	115	21	to	to	IN
cord-284501-5i0w74q4	115	22	the	the	DT
cord-284501-5i0w74q4	115	23	sequence	sequence	NN
cord-284501-5i0w74q4	115	24	in	in	IN
cord-284501-5i0w74q4	115	25	rVV	rVV	NNP
cord-284501-5i0w74q4	115	26	-	-	HYPH
cord-284501-5i0w74q4	115	27	BeauR	BeauR	NNP
cord-284501-5i0w74q4	115	28	-	-	HYPH
cord-284501-5i0w74q4	115	29	Rep	Rep	NNP
cord-284501-5i0w74q4	115	30	-	-	HYPH
cord-284501-5i0w74q4	115	31	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	115	32	(	(	-LRB-
cord-284501-5i0w74q4	115	33	Table	table	NN
cord-284501-5i0w74q4	115	34	1	1	CD
cord-284501-5i0w74q4	115	35	)	)	-RRB-
cord-284501-5i0w74q4	115	36	.	.	.
cord-284501-5i0w74q4	116	1	The	the	DT
cord-284501-5i0w74q4	116	2	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	116	3	changes	change	NNS
cord-284501-5i0w74q4	116	4	resulted	result	VBD
cord-284501-5i0w74q4	116	5	in	in	IN
cord-284501-5i0w74q4	116	6	one	one	CD
cord-284501-5i0w74q4	116	7	amino	amino	NN
cord-284501-5i0w74q4	116	8	acid	acid	NN
cord-284501-5i0w74q4	116	9	change	change	NN
cord-284501-5i0w74q4	116	10	in	in	IN
cord-284501-5i0w74q4	116	11	the	the	DT
cord-284501-5i0w74q4	116	12	S	S	NNP
cord-284501-5i0w74q4	116	13	protein	protein	NN
cord-284501-5i0w74q4	116	14	,	,	,
cord-284501-5i0w74q4	116	15	the	the	DT
cord-284501-5i0w74q4	116	16	other	other	JJ
cord-284501-5i0w74q4	116	17	was	be	VBD
cord-284501-5i0w74q4	116	18	a	a	DT
cord-284501-5i0w74q4	116	19	silent	silent	JJ
cord-284501-5i0w74q4	116	20	mutation	mutation	NN
cord-284501-5i0w74q4	116	21	and	and	CC
cord-284501-5i0w74q4	116	22	a	a	DT
cord-284501-5i0w74q4	116	23	single	single	JJ
cord-284501-5i0w74q4	116	24	amino	amino	NN
cord-284501-5i0w74q4	116	25	acid	acid	NN
cord-284501-5i0w74q4	116	26	change	change	NN
cord-284501-5i0w74q4	116	27	in	in	IN
cord-284501-5i0w74q4	116	28	the	the	DT
cord-284501-5i0w74q4	116	29	N	n	CD
cord-284501-5i0w74q4	116	30	gene	gene	NN
cord-284501-5i0w74q4	116	31	.	.	.
cord-284501-5i0w74q4	117	1	Comparison	comparison	NN
cord-284501-5i0w74q4	117	2	of	of	IN
cord-284501-5i0w74q4	117	3	the	the	DT
cord-284501-5i0w74q4	117	4	sequence	sequence	NN
cord-284501-5i0w74q4	117	5	indicated	indicate	VBD
cord-284501-5i0w74q4	117	6	that	that	IN
cord-284501-5i0w74q4	117	7	the	the	DT
cord-284501-5i0w74q4	117	8	changes	change	NNS
cord-284501-5i0w74q4	117	9	arose	arise	VBD
cord-284501-5i0w74q4	117	10	during	during	IN
cord-284501-5i0w74q4	117	11	rescue	rescue	NN
cord-284501-5i0w74q4	117	12	or	or	CC
cord-284501-5i0w74q4	117	13	during	during	IN
cord-284501-5i0w74q4	117	14	the	the	DT
cord-284501-5i0w74q4	117	15	first	first	JJ
cord-284501-5i0w74q4	117	16	three	three	CD
cord-284501-5i0w74q4	117	17	passages	passage	NNS
cord-284501-5i0w74q4	117	18	of	of	IN
cord-284501-5i0w74q4	117	19	the	the	DT
cord-284501-5i0w74q4	117	20	rescued	rescue	VBN
cord-284501-5i0w74q4	117	21	viruses	virus	NNS
cord-284501-5i0w74q4	117	22	.	.	.
cord-284501-5i0w74q4	117	23	 	 	_SP
cord-284501-5i0w74q4	118	1	Twelve	twelve	CD
cord-284501-5i0w74q4	118	2	one	one	CD
cord-284501-5i0w74q4	118	3	-	-	HYPH
cord-284501-5i0w74q4	118	4	day	day	NN
cord-284501-5i0w74q4	118	5	-	-	HYPH
cord-284501-5i0w74q4	118	6	old	old	JJ
cord-284501-5i0w74q4	118	7	SPF	SPF	NNP
cord-284501-5i0w74q4	118	8	chickens	chicken	NNS
cord-284501-5i0w74q4	118	9	,	,	,
cord-284501-5i0w74q4	118	10	in	in	IN
cord-284501-5i0w74q4	118	11	four	four	CD
cord-284501-5i0w74q4	118	12	groups	group	NNS
cord-284501-5i0w74q4	118	13	,	,	,
cord-284501-5i0w74q4	118	14	were	be	VBD
cord-284501-5i0w74q4	118	15	inoculated	inoculate	VBN
cord-284501-5i0w74q4	118	16	with	with	IN
cord-284501-5i0w74q4	118	17	0.1	0.1	CD
cord-284501-5i0w74q4	118	18	ml	ml	NNS
cord-284501-5i0w74q4	118	19	of	of	IN
cord-284501-5i0w74q4	118	20	10	10	CD
cord-284501-5i0w74q4	118	21	6	6	CD
cord-284501-5i0w74q4	118	22	PFU	pfu	NN
cord-284501-5i0w74q4	118	23	/	/	SYM
cord-284501-5i0w74q4	118	24	ml	ml	NN
cord-284501-5i0w74q4	118	25	of	of	IN
cord-284501-5i0w74q4	119	1	rBeauR	rbeaur	LS
cord-284501-5i0w74q4	119	2	-	-	HYPH
cord-284501-5i0w74q4	119	3	Rep	Rep	NNP
cord-284501-5i0w74q4	119	4	-	-	HYPH
cord-284501-5i0w74q4	119	5	M41-	M41-	NNP
cord-284501-5i0w74q4	119	6	Struct-2	Struct-2	NNP
cord-284501-5i0w74q4	119	7	,	,	,
cord-284501-5i0w74q4	119	8	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	119	9	or	or	CC
cord-284501-5i0w74q4	119	10	Beau	Beau	NNP
cord-284501-5i0w74q4	119	11	-	-	HYPH
cord-284501-5i0w74q4	119	12	R	R	NNP
cord-284501-5i0w74q4	119	13	or	or	CC
cord-284501-5i0w74q4	119	14	using	use	VBG
cord-284501-5i0w74q4	119	15	0.1	0.1	CD
cord-284501-5i0w74q4	119	16	ml	ml	NN
cord-284501-5i0w74q4	119	17	serum	serum	NN
cord-284501-5i0w74q4	119	18	-	-	HYPH
cord-284501-5i0w74q4	119	19	free	free	JJ
cord-284501-5i0w74q4	119	20	medium	medium	NN
cord-284501-5i0w74q4	119	21	(	(	-LRB-
cord-284501-5i0w74q4	119	22	mock	mock	JJ
cord-284501-5i0w74q4	119	23	infection	infection	NN
cord-284501-5i0w74q4	119	24	)	)	-RRB-
cord-284501-5i0w74q4	119	25	by	by	IN
cord-284501-5i0w74q4	119	26	eye	eye	NN
cord-284501-5i0w74q4	119	27	-	-	HYPH
cord-284501-5i0w74q4	119	28	drop	drop	NN
cord-284501-5i0w74q4	119	29	and	and	CC
cord-284501-5i0w74q4	119	30	intranasally	intranasally	RB
cord-284501-5i0w74q4	119	31	.	.	.
cord-284501-5i0w74q4	120	1	The	the	DT
cord-284501-5i0w74q4	120	2	birds	bird	NNS
cord-284501-5i0w74q4	120	3	were	be	VBD
cord-284501-5i0w74q4	120	4	observed	observe	VBN
cord-284501-5i0w74q4	120	5	for	for	IN
cord-284501-5i0w74q4	120	6	clinical	clinical	JJ
cord-284501-5i0w74q4	120	7	signs	sign	NNS
cord-284501-5i0w74q4	120	8	up	up	IN
cord-284501-5i0w74q4	120	9	to	to	TO
cord-284501-5i0w74q4	120	10	11	11	CD
cord-284501-5i0w74q4	120	11	days	day	NNS
cord-284501-5i0w74q4	120	12	post	post	NN
cord-284501-5i0w74q4	120	13	-	-	NN
cord-284501-5i0w74q4	120	14	inoculation	inoculation	NN
cord-284501-5i0w74q4	120	15	.	.	.
cord-284501-5i0w74q4	121	1	At	at	IN
cord-284501-5i0w74q4	121	2	4	4	CD
cord-284501-5i0w74q4	121	3	and	and	CC
cord-284501-5i0w74q4	121	4	7	7	CD
cord-284501-5i0w74q4	121	5	days	day	NNS
cord-284501-5i0w74q4	121	6	post	post	NN
cord-284501-5i0w74q4	121	7	-	-	NN
cord-284501-5i0w74q4	121	8	infection	infection	NN
cord-284501-5i0w74q4	121	9	the	the	DT
cord-284501-5i0w74q4	121	10	tracheas	trachea	NNS
cord-284501-5i0w74q4	121	11	of	of	IN
cord-284501-5i0w74q4	121	12	three	three	CD
cord-284501-5i0w74q4	121	13	randomly	randomly	RB
cord-284501-5i0w74q4	121	14	selected	select	VBN
cord-284501-5i0w74q4	121	15	chickens	chicken	NNS
cord-284501-5i0w74q4	121	16	from	from	IN
cord-284501-5i0w74q4	121	17	each	each	DT
cord-284501-5i0w74q4	121	18	group	group	NN
cord-284501-5i0w74q4	121	19	were	be	VBD
cord-284501-5i0w74q4	121	20	examined	examine	VBN
cord-284501-5i0w74q4	121	21	for	for	IN
cord-284501-5i0w74q4	121	22	ciliary	ciliary	NN
cord-284501-5i0w74q4	121	23	activity	activity	NN
cord-284501-5i0w74q4	121	24	and	and	CC
cord-284501-5i0w74q4	121	25	presence	presence	NN
cord-284501-5i0w74q4	121	26	of	of	IN
cord-284501-5i0w74q4	121	27	IBV	IBV	NNP
cord-284501-5i0w74q4	121	28	.	.	.
cord-284501-5i0w74q4	122	1	Observations	observation	NNS
cord-284501-5i0w74q4	122	2	for	for	IN
cord-284501-5i0w74q4	122	3	clinical	clinical	JJ
cord-284501-5i0w74q4	122	4	signs	sign	NNS
cord-284501-5i0w74q4	122	5	,	,	,
cord-284501-5i0w74q4	122	6	snicking	snicking	NN
cord-284501-5i0w74q4	122	7	,	,	,
cord-284501-5i0w74q4	122	8	wheezing	wheezing	NN
cord-284501-5i0w74q4	122	9	and	and	CC
cord-284501-5i0w74q4	122	10	nasal	nasal	NN
cord-284501-5i0w74q4	122	11	discharge	discharge	NN
cord-284501-5i0w74q4	122	12	,	,	,
cord-284501-5i0w74q4	122	13	of	of	IN
cord-284501-5i0w74q4	122	14	an	an	DT
cord-284501-5i0w74q4	122	15	IBV	IBV	NNP
cord-284501-5i0w74q4	122	16	infection	infection	NN
cord-284501-5i0w74q4	122	17	were	be	VBD
cord-284501-5i0w74q4	122	18	carried	carry	VBN
cord-284501-5i0w74q4	122	19	out	out	RP
cord-284501-5i0w74q4	122	20	daily	daily	RB
cord-284501-5i0w74q4	122	21	on	on	IN
cord-284501-5i0w74q4	122	22	each	each	DT
cord-284501-5i0w74q4	122	23	group	group	NN
cord-284501-5i0w74q4	122	24	from	from	IN
cord-284501-5i0w74q4	122	25	three	three	CD
cord-284501-5i0w74q4	122	26	days	day	NNS
cord-284501-5i0w74q4	122	27	post	post	NN
cord-284501-5i0w74q4	122	28	-	-	NN
cord-284501-5i0w74q4	122	29	infection	infection	NN
cord-284501-5i0w74q4	122	30	.	.	.
cord-284501-5i0w74q4	123	1	Only	only	RB
cord-284501-5i0w74q4	123	2	chickens	chicken	NNS
cord-284501-5i0w74q4	123	3	inoculated	inoculate	VBN
cord-284501-5i0w74q4	123	4	with	with	IN
cord-284501-5i0w74q4	123	5	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	123	6	showed	show	VBD
cord-284501-5i0w74q4	123	7	any	any	DT
cord-284501-5i0w74q4	123	8	clinical	clinical	JJ
cord-284501-5i0w74q4	123	9	signs	sign	NNS
cord-284501-5i0w74q4	123	10	of	of	IN
cord-284501-5i0w74q4	123	11	an	an	DT
cord-284501-5i0w74q4	123	12	IBV	IBV	NNP
cord-284501-5i0w74q4	123	13	infection	infection	NN
cord-284501-5i0w74q4	123	14	.	.	.
cord-284501-5i0w74q4	124	1	As	as	IN
cord-284501-5i0w74q4	124	2	can	can	MD
cord-284501-5i0w74q4	124	3	be	be	VB
cord-284501-5i0w74q4	124	4	seen	see	VBN
cord-284501-5i0w74q4	124	5	from	from	IN
cord-284501-5i0w74q4	124	6	figure	figure	NN
cord-284501-5i0w74q4	124	7	3	3	CD
cord-284501-5i0w74q4	124	8	,	,	,
cord-284501-5i0w74q4	124	9	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	124	10	induced	induce	VBN
cord-284501-5i0w74q4	124	11	high	high	JJ
cord-284501-5i0w74q4	124	12	rates	rate	NNS
cord-284501-5i0w74q4	124	13	of	of	IN
cord-284501-5i0w74q4	124	14	snicking	snicking	NN
cord-284501-5i0w74q4	124	15	,	,	,
cord-284501-5i0w74q4	124	16	which	which	WDT
cord-284501-5i0w74q4	124	17	peaked	peak	VBD
cord-284501-5i0w74q4	124	18	by	by	IN
cord-284501-5i0w74q4	124	19	day	day	NN
cord-284501-5i0w74q4	124	20	5	5	CD
cord-284501-5i0w74q4	124	21	post	post	NN
cord-284501-5i0w74q4	124	22	-	-	NN
cord-284501-5i0w74q4	124	23	inoculation	inoculation	NN
cord-284501-5i0w74q4	124	24	,	,	,
cord-284501-5i0w74q4	124	25	whereas	whereas	IN
cord-284501-5i0w74q4	124	26	Beau	Beau	NNP
cord-284501-5i0w74q4	124	27	-	-	HYPH
cord-284501-5i0w74q4	124	28	R	R	NNP
cord-284501-5i0w74q4	124	29	and	and	CC
cord-284501-5i0w74q4	124	30	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	124	31	-	-	HYPH
cord-284501-5i0w74q4	124	32	Rep	Rep	NNP
cord-284501-5i0w74q4	124	33	-	-	HYPH
cord-284501-5i0w74q4	124	34	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	124	35	induced	induce	VBD
cord-284501-5i0w74q4	124	36	a	a	DT
cord-284501-5i0w74q4	124	37	much	much	RB
cord-284501-5i0w74q4	124	38	lower	low	JJR
cord-284501-5i0w74q4	124	39	rate	rate	NN
cord-284501-5i0w74q4	124	40	of	of	IN
cord-284501-5i0w74q4	124	41	snicking	snick	VBG
cord-284501-5i0w74q4	124	42	,	,	,
cord-284501-5i0w74q4	124	43	similar	similar	JJ
cord-284501-5i0w74q4	124	44	to	to	IN
cord-284501-5i0w74q4	124	45	those	those	DT
cord-284501-5i0w74q4	124	46	observed	observe	VBN
cord-284501-5i0w74q4	124	47	for	for	IN
cord-284501-5i0w74q4	124	48	the	the	DT
cord-284501-5i0w74q4	124	49	mockinoculated	mockinoculated	JJ
cord-284501-5i0w74q4	124	50	chickens	chicken	NNS
cord-284501-5i0w74q4	124	51	(	(	-LRB-
cord-284501-5i0w74q4	124	52	Fig	Fig	NNP
cord-284501-5i0w74q4	124	53	.	.	.
cord-284501-5i0w74q4	124	54	3A	3A	NNP
cord-284501-5i0w74q4	124	55	)	)	-RRB-
cord-284501-5i0w74q4	124	56	.	.	.
cord-284501-5i0w74q4	125	1	Similarly	similarly	RB
cord-284501-5i0w74q4	125	2	,	,	,
cord-284501-5i0w74q4	125	3	only	only	RB
cord-284501-5i0w74q4	125	4	chickens	chicken	NNS
cord-284501-5i0w74q4	125	5	(	(	-LRB-
cord-284501-5i0w74q4	125	6	11	11	CD
cord-284501-5i0w74q4	125	7	-	-	SYM
cord-284501-5i0w74q4	125	8	16	16	CD
cord-284501-5i0w74q4	125	9	%	%	NN
cord-284501-5i0w74q4	125	10	)	)	-RRB-
cord-284501-5i0w74q4	125	11	inoculated	inoculate	VBN
cord-284501-5i0w74q4	125	12	with	with	IN
cord-284501-5i0w74q4	125	13	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	125	14	showed	show	VBD
cord-284501-5i0w74q4	125	15	any	any	DT
cord-284501-5i0w74q4	125	16	nasal	nasal	NN
cord-284501-5i0w74q4	125	17	discharge	discharge	NN
cord-284501-5i0w74q4	125	18	three	three	CD
cord-284501-5i0w74q4	125	19	,	,	,
cord-284501-5i0w74q4	125	20	four	four	CD
cord-284501-5i0w74q4	125	21	and	and	CC
cord-284501-5i0w74q4	125	22	six	six	CD
cord-284501-5i0w74q4	125	23	days	day	NNS
cord-284501-5i0w74q4	125	24	post	post	NN
cord-284501-5i0w74q4	125	25	-	-	NN
cord-284501-5i0w74q4	125	26	inoculation	inoculation	JJ
cord-284501-5i0w74q4	125	27	(	(	-LRB-
cord-284501-5i0w74q4	125	28	Fig	fig	NN
cord-284501-5i0w74q4	125	29	.	.	.
cord-284501-5i0w74q4	125	30	3B	3B	NNP
cord-284501-5i0w74q4	125	31	)	)	-RRB-
cord-284501-5i0w74q4	125	32	.	.	.
cord-284501-5i0w74q4	126	1	Again	again	RB
cord-284501-5i0w74q4	126	2	,	,	,
cord-284501-5i0w74q4	126	3	wheezing	wheeze	VBG
cord-284501-5i0w74q4	126	4	was	be	VBD
cord-284501-5i0w74q4	126	5	only	only	RB
cord-284501-5i0w74q4	126	6	observed	observe	VBN
cord-284501-5i0w74q4	126	7	in	in	IN
cord-284501-5i0w74q4	126	8	chickens	chicken	NNS
cord-284501-5i0w74q4	126	9	inoculated	inoculate	VBN
cord-284501-5i0w74q4	126	10	with	with	IN
cord-284501-5i0w74q4	126	11	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	126	12	,	,	,
cord-284501-5i0w74q4	126	13	in	in	IN
cord-284501-5i0w74q4	126	14	which	which	WDT
cord-284501-5i0w74q4	126	15	90	90	CD
cord-284501-5i0w74q4	126	16	%	%	NN
cord-284501-5i0w74q4	126	17	of	of	IN
cord-284501-5i0w74q4	126	18	the	the	DT
cord-284501-5i0w74q4	126	19	infected	infected	JJ
cord-284501-5i0w74q4	126	20	chickens	chicken	NNS
cord-284501-5i0w74q4	126	21	demonstrated	demonstrate	VBD
cord-284501-5i0w74q4	126	22	wheezing	wheeze	VBG
cord-284501-5i0w74q4	126	23	by	by	IN
cord-284501-5i0w74q4	126	24	7	7	CD
cord-284501-5i0w74q4	126	25	days	day	NNS
cord-284501-5i0w74q4	126	26	postinoculation	postinoculation	NN
cord-284501-5i0w74q4	126	27	(	(	-LRB-
cord-284501-5i0w74q4	126	28	Fig	Fig	NNP
cord-284501-5i0w74q4	126	29	.	.	.
cord-284501-5i0w74q4	126	30	3C	3C	NNP
cord-284501-5i0w74q4	126	31	)	)	-RRB-
cord-284501-5i0w74q4	126	32	.	.	.
cord-284501-5i0w74q4	127	1	Analysis	analysis	NN
cord-284501-5i0w74q4	127	2	of	of	IN
cord-284501-5i0w74q4	127	3	the	the	DT
cord-284501-5i0w74q4	127	4	tracheas	trachea	NNS
cord-284501-5i0w74q4	127	5	isolated	isolate	VBN
cord-284501-5i0w74q4	127	6	from	from	IN
cord-284501-5i0w74q4	127	7	the	the	DT
cord-284501-5i0w74q4	127	8	chickens	chicken	NNS
cord-284501-5i0w74q4	127	9	showed	show	VBD
cord-284501-5i0w74q4	127	10	that	that	IN
cord-284501-5i0w74q4	127	11	the	the	DT
cord-284501-5i0w74q4	127	12	mock	mock	NN
cord-284501-5i0w74q4	127	13	,	,	,
cord-284501-5i0w74q4	127	14	Beau	Beau	NNP
cord-284501-5i0w74q4	127	15	-	-	HYPH
cord-284501-5i0w74q4	127	16	R	R	NNP
cord-284501-5i0w74q4	127	17	and	and	CC
cord-284501-5i0w74q4	127	18	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	127	19	-	-	HYPH
cord-284501-5i0w74q4	127	20	Rep	Rep	NNP
cord-284501-5i0w74q4	127	21	-	-	HYPH
cord-284501-5i0w74q4	127	22	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	127	23	infected	infected	JJ
cord-284501-5i0w74q4	127	24	chickens	chicken	NNS
cord-284501-5i0w74q4	127	25	had	have	VBD
cord-284501-5i0w74q4	127	26	.95	.95	CD
cord-284501-5i0w74q4	127	27	%	%	NN
cord-284501-5i0w74q4	127	28	ciliary	ciliary	NN
cord-284501-5i0w74q4	127	29	activity	activity	NN
cord-284501-5i0w74q4	127	30	whereas	whereas	IN
cord-284501-5i0w74q4	127	31	the	the	DT
cord-284501-5i0w74q4	127	32	chickens	chicken	NNS
cord-284501-5i0w74q4	127	33	inoculated	inoculate	VBN
cord-284501-5i0w74q4	127	34	with	with	IN
cord-284501-5i0w74q4	127	35	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	127	36	showed	show	VBD
cord-284501-5i0w74q4	127	37	0	0	CD
cord-284501-5i0w74q4	127	38	%	%	NN
cord-284501-5i0w74q4	127	39	ciliary	ciliary	NN
cord-284501-5i0w74q4	127	40	activity	activity	NN
cord-284501-5i0w74q4	127	41	(	(	-LRB-
cord-284501-5i0w74q4	127	42	100	100	CD
cord-284501-5i0w74q4	127	43	%	%	NN
cord-284501-5i0w74q4	127	44	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	127	45	;	;	:
cord-284501-5i0w74q4	127	46	Fig	Fig	NNP
cord-284501-5i0w74q4	127	47	.	.	.
cord-284501-5i0w74q4	127	48	3D	3D	NNP
cord-284501-5i0w74q4	127	49	)	)	-RRB-
cord-284501-5i0w74q4	127	50	.	.	.
cord-284501-5i0w74q4	128	1	In	in	IN
cord-284501-5i0w74q4	128	2	summary	summary	NN
cord-284501-5i0w74q4	128	3	,	,	,
cord-284501-5i0w74q4	128	4	our	-PRON-	PRP$
cord-284501-5i0w74q4	128	5	observations	observation	NNS
cord-284501-5i0w74q4	128	6	of	of	IN
cord-284501-5i0w74q4	128	7	the	the	DT
cord-284501-5i0w74q4	128	8	parameters	parameter	NNS
cord-284501-5i0w74q4	128	9	used	use	VBN
cord-284501-5i0w74q4	128	10	to	to	TO
cord-284501-5i0w74q4	128	11	assess	assess	VB
cord-284501-5i0w74q4	128	12	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	128	13	demonstrated	demonstrate	VBN
cord-284501-5i0w74q4	128	14	that	that	IN
cord-284501-5i0w74q4	128	15	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	128	16	-	-	HYPH
cord-284501-5i0w74q4	128	17	Rep	Rep	NNP
cord-284501-5i0w74q4	128	18	-	-	HYPH
cord-284501-5i0w74q4	128	19	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	128	20	was	be	VBD
cord-284501-5i0w74q4	128	21	not	not	RB
cord-284501-5i0w74q4	128	22	pathogenic	pathogenic	JJ
cord-284501-5i0w74q4	128	23	and	and	CC
cord-284501-5i0w74q4	128	24	that	that	IN
cord-284501-5i0w74q4	128	25	it	-PRON-	PRP
cord-284501-5i0w74q4	128	26	had	have	VBD
cord-284501-5i0w74q4	128	27	the	the	DT
cord-284501-5i0w74q4	128	28	characteristics	characteristic	NNS
cord-284501-5i0w74q4	128	29	associated	associate	VBN
cord-284501-5i0w74q4	128	30	with	with	IN
cord-284501-5i0w74q4	128	31	Beau	Beau	NNP
cord-284501-5i0w74q4	128	32	-	-	HYPH
cord-284501-5i0w74q4	128	33	R	R	NNP
cord-284501-5i0w74q4	128	34	rather	rather	RB
cord-284501-5i0w74q4	128	35	than	than	IN
cord-284501-5i0w74q4	128	36	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	128	37	.	.	.
cord-284501-5i0w74q4	129	1	In	in	IN
cord-284501-5i0w74q4	129	2	order	order	NN
cord-284501-5i0w74q4	129	3	to	to	TO
cord-284501-5i0w74q4	129	4	determine	determine	VB
cord-284501-5i0w74q4	129	5	whether	whether	IN
cord-284501-5i0w74q4	129	6	there	there	EX
cord-284501-5i0w74q4	129	7	was	be	VBD
cord-284501-5i0w74q4	129	8	any	any	DT
cord-284501-5i0w74q4	129	9	virus	virus	NN
cord-284501-5i0w74q4	129	10	in	in	IN
cord-284501-5i0w74q4	129	11	the	the	DT
cord-284501-5i0w74q4	129	12	tracheas	trachea	NNS
cord-284501-5i0w74q4	129	13	of	of	IN
cord-284501-5i0w74q4	129	14	the	the	DT
cord-284501-5i0w74q4	129	15	infected	infected	JJ
cord-284501-5i0w74q4	129	16	chickens	chicken	NNS
cord-284501-5i0w74q4	129	17	,	,	,
cord-284501-5i0w74q4	129	18	the	the	DT
cord-284501-5i0w74q4	129	19	epithelial	epithelial	JJ
cord-284501-5i0w74q4	129	20	cells	cell	NNS
cord-284501-5i0w74q4	129	21	were	be	VBD
cord-284501-5i0w74q4	129	22	scraped	scrape	VBN
cord-284501-5i0w74q4	129	23	from	from	IN
cord-284501-5i0w74q4	129	24	the	the	DT
cord-284501-5i0w74q4	129	25	tracheas	trachea	NNS
cord-284501-5i0w74q4	129	26	taken	take	VBN
cord-284501-5i0w74q4	129	27	from	from	IN
cord-284501-5i0w74q4	129	28	three	three	CD
cord-284501-5i0w74q4	129	29	chickens	chicken	NNS
cord-284501-5i0w74q4	129	30	from	from	IN
cord-284501-5i0w74q4	129	31	each	each	DT
cord-284501-5i0w74q4	129	32	group	group	NN
cord-284501-5i0w74q4	129	33	four	four	CD
cord-284501-5i0w74q4	129	34	days	day	NNS
cord-284501-5i0w74q4	129	35	post	post	NN
cord-284501-5i0w74q4	129	36	-	-	NN
cord-284501-5i0w74q4	129	37	infection	infection	NN
cord-284501-5i0w74q4	129	38	and	and	CC
cord-284501-5i0w74q4	129	39	any	any	DT
cord-284501-5i0w74q4	129	40	virus	virus	NN
cord-284501-5i0w74q4	129	41	present	present	NN
cord-284501-5i0w74q4	129	42	titrated	titrate	VBN
cord-284501-5i0w74q4	129	43	in	in	IN
cord-284501-5i0w74q4	129	44	TOCs	toc	NNS
cord-284501-5i0w74q4	129	45	.	.	.
cord-284501-5i0w74q4	130	1	The	the	DT
cord-284501-5i0w74q4	130	2	average	average	JJ
cord-284501-5i0w74q4	130	3	titre	titre	NN
cord-284501-5i0w74q4	130	4	of	of	IN
cord-284501-5i0w74q4	130	5	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	130	6	,	,	,
cord-284501-5i0w74q4	130	7	isolated	isolate	VBN
cord-284501-5i0w74q4	130	8	from	from	IN
cord-284501-5i0w74q4	130	9	the	the	DT
cord-284501-5i0w74q4	130	10	tracheas	trachea	NNS
cord-284501-5i0w74q4	130	11	of	of	IN
cord-284501-5i0w74q4	130	12	the	the	DT
cord-284501-5i0w74q4	130	13	three	three	CD
cord-284501-5i0w74q4	130	14	chickens	chicken	NNS
cord-284501-5i0w74q4	130	15	,	,	,
cord-284501-5i0w74q4	130	16	was	be	VBD
cord-284501-5i0w74q4	130	17	4.1	4.1	CD
cord-284501-5i0w74q4	130	18	log	log	NN
cord-284501-5i0w74q4	130	19	10	10	CD
cord-284501-5i0w74q4	130	20	CD	cd	NN
cord-284501-5i0w74q4	130	21	50	50	CD
cord-284501-5i0w74q4	131	1	/ml	/ml	.
cord-284501-5i0w74q4	132	1	,	,	,
cord-284501-5i0w74q4	132	2	in	in	IN
cord-284501-5i0w74q4	132	3	contrast	contrast	NN
cord-284501-5i0w74q4	132	4	no	no	DT
cord-284501-5i0w74q4	132	5	detectable	detectable	JJ
cord-284501-5i0w74q4	132	6	virus	virus	NN
cord-284501-5i0w74q4	132	7	was	be	VBD
cord-284501-5i0w74q4	132	8	isolated	isolate	VBN
cord-284501-5i0w74q4	132	9	from	from	IN
cord-284501-5i0w74q4	132	10	the	the	DT
cord-284501-5i0w74q4	132	11	tracheas	trachea	NNS
cord-284501-5i0w74q4	132	12	taken	take	VBN
cord-284501-5i0w74q4	132	13	from	from	IN
cord-284501-5i0w74q4	132	14	the	the	DT
cord-284501-5i0w74q4	132	15	chickens	chicken	NNS
cord-284501-5i0w74q4	132	16	infected	infect	VBN
cord-284501-5i0w74q4	132	17	with	with	IN
cord-284501-5i0w74q4	132	18	either	either	DT
cord-284501-5i0w74q4	132	19	Beau	Beau	NNP
cord-284501-5i0w74q4	132	20	-	-	HYPH
cord-284501-5i0w74q4	132	21	R	R	NNP
cord-284501-5i0w74q4	132	22	or	or	CC
cord-284501-5i0w74q4	132	23	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	132	24	-	-	HYPH
cord-284501-5i0w74q4	132	25	Rep	rep	NN
cord-284501-5i0w74q4	132	26	-	-	HYPH
cord-284501-5i0w74q4	132	27	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	132	28	.	.	.
cord-284501-5i0w74q4	133	1	This	this	DT
cord-284501-5i0w74q4	133	2	result	result	NN
cord-284501-5i0w74q4	133	3	indicated	indicate	VBD
cord-284501-5i0w74q4	133	4	that	that	IN
cord-284501-5i0w74q4	133	5	if	if	IN
cord-284501-5i0w74q4	133	6	any	any	DT
cord-284501-5i0w74q4	133	7	virus	virus	NN
cord-284501-5i0w74q4	133	8	was	be	VBD
cord-284501-5i0w74q4	133	9	present	present	JJ
cord-284501-5i0w74q4	133	10	in	in	IN
cord-284501-5i0w74q4	133	11	the	the	DT
cord-284501-5i0w74q4	133	12	tracheas	trachea	NNS
cord-284501-5i0w74q4	133	13	of	of	IN
cord-284501-5i0w74q4	133	14	the	the	DT
cord-284501-5i0w74q4	133	15	chickens	chicken	NNS
cord-284501-5i0w74q4	133	16	infected	infect	VBN
cord-284501-5i0w74q4	133	17	with	with	IN
cord-284501-5i0w74q4	133	18	Beau	Beau	NNP
cord-284501-5i0w74q4	133	19	-	-	HYPH
cord-284501-5i0w74q4	133	20	R	R	NNP
cord-284501-5i0w74q4	133	21	or	or	CC
cord-284501-5i0w74q4	133	22	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	133	23	-	-	HYPH
cord-284501-5i0w74q4	133	24	Rep	Rep	NNP
cord-284501-5i0w74q4	133	25	-	-	HYPH
cord-284501-5i0w74q4	133	26	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	133	27	the	the	DT
cord-284501-5i0w74q4	133	28	amounts	amount	NNS
cord-284501-5i0w74q4	133	29	present	present	JJ
cord-284501-5i0w74q4	133	30	were	be	VBD
cord-284501-5i0w74q4	133	31	at	at	IN
cord-284501-5i0w74q4	133	32	least	least	JJS
cord-284501-5i0w74q4	133	33	4	4	CD
cord-284501-5i0w74q4	133	34	log	log	VB
cord-284501-5i0w74q4	133	35	10	10	CD
cord-284501-5i0w74q4	133	36	CD	CD	NNP
cord-284501-5i0w74q4	133	37	50	50	CD
cord-284501-5i0w74q4	133	38	/ml	/ml	.
cord-284501-5i0w74q4	133	39	lower	low	JJR
cord-284501-5i0w74q4	133	40	than	than	IN
cord-284501-5i0w74q4	133	41	the	the	DT
cord-284501-5i0w74q4	133	42	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	133	43	detected	detect	VBD
cord-284501-5i0w74q4	133	44	from	from	IN
cord-284501-5i0w74q4	133	45	the	the	DT
cord-284501-5i0w74q4	133	46	tracheas	trachea	NNS
cord-284501-5i0w74q4	133	47	of	of	IN
cord-284501-5i0w74q4	133	48	the	the	DT
cord-284501-5i0w74q4	133	49	chickens	chicken	NNS
cord-284501-5i0w74q4	133	50	infected	infect	VBN
cord-284501-5i0w74q4	133	51	with	with	IN
cord-284501-5i0w74q4	133	52	M41-CK	m41-ck	CD
cord-284501-5i0w74q4	133	53	.	.	.
cord-284501-5i0w74q4	134	1	Analysis	analysis	NN
cord-284501-5i0w74q4	134	2	of	of	IN
cord-284501-5i0w74q4	134	3	the	the	DT
cord-284501-5i0w74q4	134	4	tracheal	tracheal	JJ
cord-284501-5i0w74q4	134	5	epithelial	epithelial	JJ
cord-284501-5i0w74q4	134	6	cells	cell	NNS
cord-284501-5i0w74q4	134	7	isolated	isolate	VBN
cord-284501-5i0w74q4	134	8	from	from	IN
cord-284501-5i0w74q4	134	9	the	the	DT
cord-284501-5i0w74q4	134	10	infected	infected	JJ
cord-284501-5i0w74q4	134	11	chickens	chicken	NNS
cord-284501-5i0w74q4	134	12	,	,	,
cord-284501-5i0w74q4	134	13	for	for	IN
cord-284501-5i0w74q4	134	14	the	the	DT
cord-284501-5i0w74q4	134	15	presence	presence	NN
cord-284501-5i0w74q4	134	16	of	of	IN
cord-284501-5i0w74q4	134	17	IBV	IBV	NNP
cord-284501-5i0w74q4	134	18	by	by	IN
cord-284501-5i0w74q4	134	19	titration	titration	NN
cord-284501-5i0w74q4	134	20	on	on	IN
cord-284501-5i0w74q4	134	21	TOCs	TOCs	NNP
cord-284501-5i0w74q4	134	22	,	,	,
cord-284501-5i0w74q4	134	23	had	have	VBD
cord-284501-5i0w74q4	134	24	indicated	indicate	VBN
cord-284501-5i0w74q4	134	25	that	that	IN
cord-284501-5i0w74q4	134	26	either	either	CC
cord-284501-5i0w74q4	134	27	there	there	EX
cord-284501-5i0w74q4	134	28	was	be	VBD
cord-284501-5i0w74q4	134	29	no	no	DT
cord-284501-5i0w74q4	134	30	Beau	Beau	NNP
cord-284501-5i0w74q4	134	31	-	-	HYPH
cord-284501-5i0w74q4	134	32	R	R	NNP
cord-284501-5i0w74q4	134	33	or	or	CC
cord-284501-5i0w74q4	134	34	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	134	35	-	-	HYPH
cord-284501-5i0w74q4	134	36	Rep	Rep	NNP
cord-284501-5i0w74q4	134	37	-	-	HYPH
cord-284501-5i0w74q4	134	38	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	134	39	present	present	NN
cord-284501-5i0w74q4	134	40	or	or	CC
cord-284501-5i0w74q4	134	41	that	that	IN
cord-284501-5i0w74q4	134	42	the	the	DT
cord-284501-5i0w74q4	134	43	levels	level	NNS
cord-284501-5i0w74q4	134	44	of	of	IN
cord-284501-5i0w74q4	134	45	both	both	DT
cord-284501-5i0w74q4	134	46	viruses	virus	NNS
cord-284501-5i0w74q4	134	47	were	be	VBD
cord-284501-5i0w74q4	134	48	below	below	IN
cord-284501-5i0w74q4	134	49	detection	detection	NN
cord-284501-5i0w74q4	134	50	.	.	.
cord-284501-5i0w74q4	135	1	Our	-PRON-	PRP$
cord-284501-5i0w74q4	135	2	previous	previous	JJ
cord-284501-5i0w74q4	135	3	results	result	NNS
cord-284501-5i0w74q4	135	4	had	have	VBD
cord-284501-5i0w74q4	135	5	shown	show	VBN
cord-284501-5i0w74q4	135	6	that	that	IN
cord-284501-5i0w74q4	135	7	Beau	Beau	NNP
cord-284501-5i0w74q4	135	8	-	-	HYPH
cord-284501-5i0w74q4	135	9	R	R	NNP
cord-284501-5i0w74q4	135	10	was	be	VBD
cord-284501-5i0w74q4	135	11	not	not	RB
cord-284501-5i0w74q4	135	12	reliably	reliably	RB
cord-284501-5i0w74q4	135	13	detected	detect	VBN
cord-284501-5i0w74q4	135	14	in	in	IN
cord-284501-5i0w74q4	135	15	the	the	DT
cord-284501-5i0w74q4	135	16	tracheas	trachea	NNS
cord-284501-5i0w74q4	135	17	of	of	IN
cord-284501-5i0w74q4	135	18	Beau	Beau	NNP
cord-284501-5i0w74q4	135	19	-	-	HYPH
cord-284501-5i0w74q4	135	20	R	R	NNP
cord-284501-5i0w74q4	135	21	in	in	IN
cord-284501-5i0w74q4	135	22	infected	infected	JJ
cord-284501-5i0w74q4	135	23	chickens	chicken	NNS
cord-284501-5i0w74q4	135	24	whereas	whereas	IN
cord-284501-5i0w74q4	135	25	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	135	26	is	be	VBZ
cord-284501-5i0w74q4	135	27	detectable	detectable	JJ
cord-284501-5i0w74q4	135	28	[	[	-LRB-
cord-284501-5i0w74q4	135	29	26	26	CD
cord-284501-5i0w74q4	135	30	,	,	,
cord-284501-5i0w74q4	135	31	43	43	CD
cord-284501-5i0w74q4	135	32	]	]	-RRB-
cord-284501-5i0w74q4	135	33	.	.	.
cord-284501-5i0w74q4	136	1	To	to	TO
cord-284501-5i0w74q4	136	2	check	check	VB
cord-284501-5i0w74q4	136	3	for	for	IN
cord-284501-5i0w74q4	136	4	the	the	DT
cord-284501-5i0w74q4	136	5	presence	presence	NN
cord-284501-5i0w74q4	136	6	of	of	IN
cord-284501-5i0w74q4	136	7	M41-CK-	M41-CK-	NNP
cord-284501-5i0w74q4	136	8	,	,	,
cord-284501-5i0w74q4	136	9	Beau	Beau	NNP
cord-284501-5i0w74q4	136	10	-	-	HYPH
cord-284501-5i0w74q4	136	11	R	R	NNP
cord-284501-5i0w74q4	136	12	-	-	HYPH
cord-284501-5i0w74q4	136	13	or	or	CC
cord-284501-5i0w74q4	136	14	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	136	15	-	-	HYPH
cord-284501-5i0w74q4	136	16	Rep	Rep	NNP
cord-284501-5i0w74q4	136	17	-	-	HYPH
cord-284501-5i0w74q4	136	18	M41-Struct-2-derived	M41-Struct-2-derived	NNP
cord-284501-5i0w74q4	136	19	RNA	RNA	NNP
cord-284501-5i0w74q4	136	20	in	in	IN
cord-284501-5i0w74q4	136	21	the	the	DT
cord-284501-5i0w74q4	136	22	tracheal	tracheal	JJ
cord-284501-5i0w74q4	136	23	epithelial	epithelial	JJ
cord-284501-5i0w74q4	136	24	cells	cell	NNS
cord-284501-5i0w74q4	136	25	from	from	IN
cord-284501-5i0w74q4	136	26	the	the	DT
cord-284501-5i0w74q4	136	27	infected	infected	JJ
cord-284501-5i0w74q4	136	28	chickens	chicken	NNS
cord-284501-5i0w74q4	136	29	,	,	,
cord-284501-5i0w74q4	136	30	total	total	JJ
cord-284501-5i0w74q4	136	31	RNA	RNA	NNP
cord-284501-5i0w74q4	136	32	was	be	VBD
cord-284501-5i0w74q4	136	33	isolated	isolate	VBN
cord-284501-5i0w74q4	136	34	from	from	IN
cord-284501-5i0w74q4	136	35	the	the	DT
cord-284501-5i0w74q4	136	36	epithelial	epithelial	JJ
cord-284501-5i0w74q4	136	37	cells	cell	NNS
cord-284501-5i0w74q4	136	38	and	and	CC
cord-284501-5i0w74q4	136	39	analysed	analyse	VBN
cord-284501-5i0w74q4	136	40	by	by	IN
cord-284501-5i0w74q4	136	41	RT	RT	NNP
cord-284501-5i0w74q4	136	42	-	-	HYPH
cord-284501-5i0w74q4	136	43	PCR	PCR	NNP
cord-284501-5i0w74q4	136	44	using	use	VBG
cord-284501-5i0w74q4	136	45	oligonucleotides	oligonucleotide	NNS
cord-284501-5i0w74q4	136	46	BG56	BG56	NNP
cord-284501-5i0w74q4	136	47	and	and	CC
cord-284501-5i0w74q4	136	48	93/100	93/100	CD
cord-284501-5i0w74q4	136	49	,	,	,
cord-284501-5i0w74q4	136	50	corresponding	correspond	VBG
cord-284501-5i0w74q4	136	51	to	to	IN
cord-284501-5i0w74q4	136	52	the	the	DT
cord-284501-5i0w74q4	136	53	39-UTR	39-utr	CD
cord-284501-5i0w74q4	136	54	of	of	IN
cord-284501-5i0w74q4	136	55	the	the	DT
cord-284501-5i0w74q4	136	56	IBV	IBV	NNP
cord-284501-5i0w74q4	136	57	genomes	genome	NNS
cord-284501-5i0w74q4	136	58	.	.	.
cord-284501-5i0w74q4	137	1	As	as	IN
cord-284501-5i0w74q4	137	2	can	can	MD
cord-284501-5i0w74q4	137	3	be	be	VB
cord-284501-5i0w74q4	137	4	seen	see	VBN
cord-284501-5i0w74q4	137	5	from	from	IN
cord-284501-5i0w74q4	137	6	Fig	Fig	NNP
cord-284501-5i0w74q4	137	7	.	.	.
cord-284501-5i0w74q4	138	1	4	4	LS
cord-284501-5i0w74q4	138	2	,	,	,
cord-284501-5i0w74q4	138	3	the	the	DT
cord-284501-5i0w74q4	138	4	tracheal	tracheal	JJ
cord-284501-5i0w74q4	138	5	epithelial	epithelial	JJ
cord-284501-5i0w74q4	138	6	cells	cell	NNS
cord-284501-5i0w74q4	138	7	isolated	isolate	VBN
cord-284501-5i0w74q4	138	8	from	from	IN
cord-284501-5i0w74q4	138	9	chickens	chicken	NNS
cord-284501-5i0w74q4	138	10	infected	infect	VBN
cord-284501-5i0w74q4	138	11	with	with	IN
cord-284501-5i0w74q4	138	12	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	138	13	were	be	VBD
cord-284501-5i0w74q4	138	14	positive	positive	JJ
cord-284501-5i0w74q4	138	15	for	for	IN
cord-284501-5i0w74q4	138	16	the	the	DT
cord-284501-5i0w74q4	138	17	presence	presence	NN
cord-284501-5i0w74q4	138	18	of	of	IN
cord-284501-5i0w74q4	138	19	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	138	20	-	-	HYPH
cord-284501-5i0w74q4	138	21	derived	derive	VBN
cord-284501-5i0w74q4	138	22	RNA	RNA	NNP
cord-284501-5i0w74q4	138	23	.	.	.
cord-284501-5i0w74q4	139	1	In	in	IN
cord-284501-5i0w74q4	139	2	contrast	contrast	NN
cord-284501-5i0w74q4	139	3	,	,	,
cord-284501-5i0w74q4	139	4	no	no	DT
cord-284501-5i0w74q4	139	5	IBV	IBV	NNP
cord-284501-5i0w74q4	139	6	-	-	HYPH
cord-284501-5i0w74q4	139	7	derived	derive	VBN
cord-284501-5i0w74q4	139	8	RNA	RNA	NNP
cord-284501-5i0w74q4	139	9	was	be	VBD
cord-284501-5i0w74q4	139	10	detected	detect	VBN
cord-284501-5i0w74q4	139	11	in	in	IN
cord-284501-5i0w74q4	139	12	the	the	DT
cord-284501-5i0w74q4	139	13	tracheal	tracheal	JJ
cord-284501-5i0w74q4	139	14	epithelial	epithelial	JJ
cord-284501-5i0w74q4	139	15	cells	cell	NNS
cord-284501-5i0w74q4	139	16	of	of	IN
cord-284501-5i0w74q4	139	17	chickens	chicken	NNS
cord-284501-5i0w74q4	139	18	infected	infect	VBN
cord-284501-5i0w74q4	139	19	with	with	IN
cord-284501-5i0w74q4	139	20	either	either	DT
cord-284501-5i0w74q4	139	21	Beau	Beau	NNP
cord-284501-5i0w74q4	139	22	-	-	HYPH
cord-284501-5i0w74q4	139	23	R	R	NNP
cord-284501-5i0w74q4	139	24	or	or	CC
cord-284501-5i0w74q4	139	25	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	139	26	-	-	HYPH
cord-284501-5i0w74q4	139	27	Rep	Rep	NNP
cord-284501-5i0w74q4	139	28	-	-	HYPH
cord-284501-5i0w74q4	139	29	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	139	30	supporting	support	VBG
cord-284501-5i0w74q4	139	31	our	-PRON-	PRP$
cord-284501-5i0w74q4	139	32	virus	virus	NN
cord-284501-5i0w74q4	139	33	isolation	isolation	NN
cord-284501-5i0w74q4	139	34	data	datum	NNS
cord-284501-5i0w74q4	139	35	.	.	.
cord-284501-5i0w74q4	140	1	Furthermore	furthermore	RB
cord-284501-5i0w74q4	140	2	,	,	,
cord-284501-5i0w74q4	140	3	sequence	sequence	NN
cord-284501-5i0w74q4	140	4	analysis	analysis	NN
cord-284501-5i0w74q4	140	5	of	of	IN
cord-284501-5i0w74q4	140	6	the	the	DT
cord-284501-5i0w74q4	140	7	IBV	IBV	NNP
cord-284501-5i0w74q4	140	8	-	-	HYPH
cord-284501-5i0w74q4	140	9	derived	derive	VBN
cord-284501-5i0w74q4	140	10	RT	RT	NNP
cord-284501-5i0w74q4	140	11	-	-	HYPH
cord-284501-5i0w74q4	140	12	PCR	PCR	NNP
cord-284501-5i0w74q4	140	13	product	product	NN
cord-284501-5i0w74q4	140	14	amplified	amplify	VBN
cord-284501-5i0w74q4	140	15	from	from	IN
cord-284501-5i0w74q4	140	16	the	the	DT
cord-284501-5i0w74q4	140	17	tracheal	tracheal	JJ
cord-284501-5i0w74q4	140	18	epithelial	epithelial	JJ
cord-284501-5i0w74q4	140	19	cells	cell	NNS
cord-284501-5i0w74q4	140	20	of	of	IN
cord-284501-5i0w74q4	140	21	chickens	chicken	NNS
cord-284501-5i0w74q4	140	22	infected	infect	VBN
cord-284501-5i0w74q4	140	23	with	with	IN
cord-284501-5i0w74q4	140	24	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	140	25	confirmed	confirm	VBD
cord-284501-5i0w74q4	140	26	that	that	IN
cord-284501-5i0w74q4	140	27	it	-PRON-	PRP
cord-284501-5i0w74q4	140	28	was	be	VBD
cord-284501-5i0w74q4	140	29	derived	derive	VBN
cord-284501-5i0w74q4	140	30	from	from	IN
cord-284501-5i0w74q4	140	31	IBV	IBV	NNP
cord-284501-5i0w74q4	140	32	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	140	33	.	.	.
cord-284501-5i0w74q4	141	1	This	this	DT
cord-284501-5i0w74q4	141	2	was	be	VBD
cord-284501-5i0w74q4	141	3	consistent	consistent	JJ
cord-284501-5i0w74q4	141	4	with	with	IN
cord-284501-5i0w74q4	141	5	previous	previous	JJ
cord-284501-5i0w74q4	141	6	results	result	NNS
cord-284501-5i0w74q4	141	7	suggesting	suggest	VBG
cord-284501-5i0w74q4	141	8	that	that	IN
cord-284501-5i0w74q4	141	9	Beau	Beau	NNP
cord-284501-5i0w74q4	141	10	-	-	HYPH
cord-284501-5i0w74q4	141	11	R	R	NNP
cord-284501-5i0w74q4	141	12	probably	probably	RB
cord-284501-5i0w74q4	141	13	does	do	VBZ
cord-284501-5i0w74q4	141	14	not	not	RB
cord-284501-5i0w74q4	141	15	reach	reach	VB
cord-284501-5i0w74q4	141	16	the	the	DT
cord-284501-5i0w74q4	141	17	tracheas	trachea	NNS
cord-284501-5i0w74q4	141	18	of	of	IN
cord-284501-5i0w74q4	141	19	chickens	chicken	NNS
cord-284501-5i0w74q4	141	20	infected	infect	VBN
cord-284501-5i0w74q4	141	21	by	by	IN
cord-284501-5i0w74q4	141	22	the	the	DT
cord-284501-5i0w74q4	141	23	eye	eye	NN
cord-284501-5i0w74q4	141	24	-	-	HYPH
cord-284501-5i0w74q4	141	25	drop	drop	NN
cord-284501-5i0w74q4	141	26	and	and	CC
cord-284501-5i0w74q4	141	27	intranasal	intranasal	NN
cord-284501-5i0w74q4	141	28	routes	route	NNS
cord-284501-5i0w74q4	141	29	and	and	CC
cord-284501-5i0w74q4	141	30	that	that	IN
cord-284501-5i0w74q4	141	31	similarly	similarly	RB
cord-284501-5i0w74q4	141	32	rBeauR	rBeauR	VBZ
cord-284501-5i0w74q4	141	33	-	-	HYPH
cord-284501-5i0w74q4	141	34	Rep	Rep	NNP
cord-284501-5i0w74q4	141	35	-	-	HYPH
cord-284501-5i0w74q4	141	36	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	141	37	did	do	VBD
cord-284501-5i0w74q4	141	38	not	not	RB
cord-284501-5i0w74q4	141	39	appear	appear	VB
cord-284501-5i0w74q4	141	40	to	to	TO
cord-284501-5i0w74q4	141	41	reach	reach	VB
cord-284501-5i0w74q4	141	42	the	the	DT
cord-284501-5i0w74q4	141	43	epithelial	epithelial	JJ
cord-284501-5i0w74q4	141	44	cells	cell	NNS
cord-284501-5i0w74q4	141	45	of	of	IN
cord-284501-5i0w74q4	141	46	the	the	DT
cord-284501-5i0w74q4	141	47	tracheas	trachea	NNS
cord-284501-5i0w74q4	141	48	of	of	IN
cord-284501-5i0w74q4	141	49	infected	infected	JJ
cord-284501-5i0w74q4	141	50	chickens	chicken	NNS
cord-284501-5i0w74q4	141	51	.	.	.
cord-284501-5i0w74q4	142	1	A	a	DT
cord-284501-5i0w74q4	142	2	rIBV	ribv	NN
cord-284501-5i0w74q4	142	3	,	,	,
cord-284501-5i0w74q4	142	4	BeauR	BeauR	NNP
cord-284501-5i0w74q4	142	5	-	-	HYPH
cord-284501-5i0w74q4	142	6	M41(S	M41(S	NNP
cord-284501-5i0w74q4	142	7	)	)	-RRB-
cord-284501-5i0w74q4	143	1	[	[	-LRB-
cord-284501-5i0w74q4	143	2	24	24	CD
cord-284501-5i0w74q4	143	3	]	]	-RRB-
cord-284501-5i0w74q4	143	4	,	,	,
cord-284501-5i0w74q4	143	5	which	which	WDT
cord-284501-5i0w74q4	143	6	consisted	consist	VBD
cord-284501-5i0w74q4	143	7	of	of	IN
cord-284501-5i0w74q4	143	8	the	the	DT
cord-284501-5i0w74q4	143	9	Beau	Beau	NNP
cord-284501-5i0w74q4	143	10	-	-	HYPH
cord-284501-5i0w74q4	143	11	R	R	NNP
cord-284501-5i0w74q4	143	12	genome	genome	NN
cord-284501-5i0w74q4	143	13	but	but	CC
cord-284501-5i0w74q4	143	14	with	with	IN
cord-284501-5i0w74q4	143	15	an	an	DT
cord-284501-5i0w74q4	143	16	M41-derived	M41-derived	NNP
cord-284501-5i0w74q4	143	17	S	S	NNP
cord-284501-5i0w74q4	143	18	gene	gene	NN
cord-284501-5i0w74q4	143	19	,	,	,
cord-284501-5i0w74q4	143	20	had	have	VBD
cord-284501-5i0w74q4	143	21	the	the	DT
cord-284501-5i0w74q4	143	22	tropism	tropism	NN
cord-284501-5i0w74q4	143	23	of	of	IN
cord-284501-5i0w74q4	143	24	M41	M41	NNP
cord-284501-5i0w74q4	143	25	in	in	IN
cord-284501-5i0w74q4	143	26	vitro	vitro	FW
cord-284501-5i0w74q4	144	1	but	but	CC
cord-284501-5i0w74q4	144	2	the	the	DT
cord-284501-5i0w74q4	144	3	characteristics	characteristic	NNS
cord-284501-5i0w74q4	144	4	of	of	IN
cord-284501-5i0w74q4	144	5	Beau	Beau	NNP
cord-284501-5i0w74q4	144	6	-	-	HYPH
cord-284501-5i0w74q4	144	7	R	R	NNP
cord-284501-5i0w74q4	144	8	in	in	IN
cord-284501-5i0w74q4	144	9	vivo	vivo	NN
cord-284501-5i0w74q4	144	10	indicating	indicate	VBG
cord-284501-5i0w74q4	144	11	,	,	,
cord-284501-5i0w74q4	144	12	together	together	RB
cord-284501-5i0w74q4	144	13	with	with	IN
cord-284501-5i0w74q4	144	14	our	-PRON-	PRP$
cord-284501-5i0w74q4	144	15	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	144	16	-	-	HYPH
cord-284501-5i0w74q4	144	17	Rep	Rep	NNP
cord-284501-5i0w74q4	144	18	-	-	HYPH
cord-284501-5i0w74q4	144	19	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	144	20	result	result	NN
cord-284501-5i0w74q4	144	21	,	,	,
cord-284501-5i0w74q4	144	22	that	that	IN
cord-284501-5i0w74q4	144	23	the	the	DT
cord-284501-5i0w74q4	144	24	inability	inability	NN
cord-284501-5i0w74q4	144	25	of	of	IN
cord-284501-5i0w74q4	144	26	Beau	Beau	NNP
cord-284501-5i0w74q4	144	27	-	-	HYPH
cord-284501-5i0w74q4	144	28	R	r	NN
cord-284501-5i0w74q4	144	29	-	-	HYPH
cord-284501-5i0w74q4	144	30	derived	derive	VBN
cord-284501-5i0w74q4	144	31	viruses	virus	NNS
cord-284501-5i0w74q4	144	32	to	to	TO
cord-284501-5i0w74q4	144	33	reach	reach	VB
cord-284501-5i0w74q4	144	34	the	the	DT
cord-284501-5i0w74q4	144	35	tracheas	trachea	NNS
cord-284501-5i0w74q4	144	36	of	of	IN
cord-284501-5i0w74q4	144	37	infected	infected	JJ
cord-284501-5i0w74q4	144	38	chickens	chicken	NNS
cord-284501-5i0w74q4	144	39	resides	reside	VBZ
cord-284501-5i0w74q4	144	40	within	within	IN
cord-284501-5i0w74q4	144	41	the	the	DT
cord-284501-5i0w74q4	144	42	replicase	replicase	NN
cord-284501-5i0w74q4	144	43	gene	gene	NN
cord-284501-5i0w74q4	144	44	.	.	.
cord-284501-5i0w74q4	145	1	Infection	infection	NN
cord-284501-5i0w74q4	145	2	of	of	IN
cord-284501-5i0w74q4	145	3	tracheal	tracheal	JJ
cord-284501-5i0w74q4	145	4	epithelial	epithelial	JJ
cord-284501-5i0w74q4	145	5	cells	cell	NNS
cord-284501-5i0w74q4	145	6	ex	ex	FW
cord-284501-5i0w74q4	145	7	vivo	vivo	NN
cord-284501-5i0w74q4	145	8	is	be	VBZ
cord-284501-5i0w74q4	145	9	a	a	DT
cord-284501-5i0w74q4	145	10	method	method	NN
cord-284501-5i0w74q4	145	11	of	of	IN
cord-284501-5i0w74q4	145	12	growing	grow	VBG
cord-284501-5i0w74q4	145	13	IBV	IBV	NNP
cord-284501-5i0w74q4	145	14	strains	strain	NNS
cord-284501-5i0w74q4	145	15	that	that	WDT
cord-284501-5i0w74q4	145	16	have	have	VBP
cord-284501-5i0w74q4	145	17	not	not	RB
cord-284501-5i0w74q4	145	18	been	be	VBN
cord-284501-5i0w74q4	145	19	adapted	adapt	VBN
cord-284501-5i0w74q4	145	20	for	for	IN
cord-284501-5i0w74q4	145	21	growth	growth	NN
cord-284501-5i0w74q4	145	22	either	either	CC
cord-284501-5i0w74q4	145	23	in	in	IN
cord-284501-5i0w74q4	145	24	embryonated	embryonate	VBN
cord-284501-5i0w74q4	145	25	eggs	egg	NNS
cord-284501-5i0w74q4	145	26	or	or	CC
cord-284501-5i0w74q4	145	27	primary	primary	JJ
cord-284501-5i0w74q4	145	28	cell	cell	NN
cord-284501-5i0w74q4	145	29	cultures	culture	NNS
cord-284501-5i0w74q4	145	30	and	and	CC
cord-284501-5i0w74q4	145	31	results	result	NNS
cord-284501-5i0w74q4	145	32	in	in	IN
cord-284501-5i0w74q4	145	33	cessation	cessation	NN
cord-284501-5i0w74q4	145	34	of	of	IN
cord-284501-5i0w74q4	145	35	ciliary	ciliary	NN
cord-284501-5i0w74q4	145	36	activity	activity	NN
cord-284501-5i0w74q4	145	37	(	(	-LRB-
cord-284501-5i0w74q4	145	38	ciliostasis	ciliostasis	NNP
cord-284501-5i0w74q4	145	39	)	)	-RRB-
cord-284501-5i0w74q4	145	40	of	of	IN
cord-284501-5i0w74q4	145	41	the	the	DT
cord-284501-5i0w74q4	145	42	epithelial	epithelial	JJ
cord-284501-5i0w74q4	145	43	cells	cell	NNS
cord-284501-5i0w74q4	145	44	.	.	.
cord-284501-5i0w74q4	146	1	Previous	previous	JJ
cord-284501-5i0w74q4	146	2	work	work	NN
cord-284501-5i0w74q4	146	3	demonstrated	demonstrate	VBD
cord-284501-5i0w74q4	146	4	that	that	IN
cord-284501-5i0w74q4	146	5	our	-PRON-	PRP$
cord-284501-5i0w74q4	146	6	rIBVs	rIBVs	NNP
cord-284501-5i0w74q4	146	7	,	,	,
cord-284501-5i0w74q4	146	8	Beau	Beau	NNP
cord-284501-5i0w74q4	146	9	-	-	HYPH
cord-284501-5i0w74q4	146	10	R	R	NNP
cord-284501-5i0w74q4	146	11	and	and	CC
cord-284501-5i0w74q4	146	12	BeauR	BeauR	NNP
cord-284501-5i0w74q4	146	13	-	-	HYPH
cord-284501-5i0w74q4	146	14	M41(S	M41(S	NNP
cord-284501-5i0w74q4	146	15	)	)	-RRB-
cord-284501-5i0w74q4	146	16	,	,	,
cord-284501-5i0w74q4	146	17	caused	cause	VBD
cord-284501-5i0w74q4	146	18	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	146	19	of	of	IN
cord-284501-5i0w74q4	146	20	infected	infected	JJ
cord-284501-5i0w74q4	146	21	TOCs	toc	NNS
cord-284501-5i0w74q4	146	22	with	with	IN
cord-284501-5i0w74q4	146	23	concomitant	concomitant	JJ
cord-284501-5i0w74q4	146	24	production	production	NN
cord-284501-5i0w74q4	146	25	of	of	IN
cord-284501-5i0w74q4	146	26	progeny	progeny	JJ
cord-284501-5i0w74q4	146	27	virus	virus	NN
cord-284501-5i0w74q4	146	28	[	[	-LRB-
cord-284501-5i0w74q4	146	29	26	26	CD
cord-284501-5i0w74q4	146	30	]	]	-RRB-
cord-284501-5i0w74q4	146	31	.	.	.
cord-284501-5i0w74q4	147	1	Analysis	analysis	NN
cord-284501-5i0w74q4	147	2	of	of	IN
cord-284501-5i0w74q4	147	3	tracheal	tracheal	JJ
cord-284501-5i0w74q4	147	4	epithelial	epithelial	JJ
cord-284501-5i0w74q4	147	5	cells	cell	NNS
cord-284501-5i0w74q4	147	6	from	from	IN
cord-284501-5i0w74q4	147	7	chickens	chicken	NNS
cord-284501-5i0w74q4	147	8	infected	infect	VBN
cord-284501-5i0w74q4	147	9	with	with	IN
cord-284501-5i0w74q4	147	10	rIBV	ribv	NN
cord-284501-5i0w74q4	147	11	-	-	HYPH
cord-284501-5i0w74q4	147	12	BeauR	BeauR	NNP
cord-284501-5i0w74q4	147	13	-	-	HYPH
cord-284501-5i0w74q4	147	14	Rep	Rep	NNP
cord-284501-5i0w74q4	147	15	-	-	HYPH
cord-284501-5i0w74q4	147	16	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	147	17	had	have	VBD
cord-284501-5i0w74q4	147	18	shown	show	VBN
cord-284501-5i0w74q4	147	19	that	that	IN
cord-284501-5i0w74q4	147	20	there	there	EX
cord-284501-5i0w74q4	147	21	was	be	VBD
cord-284501-5i0w74q4	147	22	no	no	DT
cord-284501-5i0w74q4	147	23	virus	virus	NN
cord-284501-5i0w74q4	147	24	present	present	JJ
cord-284501-5i0w74q4	147	25	.	.	.
cord-284501-5i0w74q4	148	1	Therefore	therefore	RB
cord-284501-5i0w74q4	148	2	,	,	,
cord-284501-5i0w74q4	148	3	we	-PRON-	PRP
cord-284501-5i0w74q4	148	4	decided	decide	VBD
cord-284501-5i0w74q4	148	5	to	to	TO
cord-284501-5i0w74q4	148	6	investigate	investigate	VB
cord-284501-5i0w74q4	148	7	the	the	DT
cord-284501-5i0w74q4	148	8	replication	replication	NN
cord-284501-5i0w74q4	148	9	of	of	IN
cord-284501-5i0w74q4	148	10	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	148	11	-	-	HYPH
cord-284501-5i0w74q4	148	12	Rep	Rep	NNP
cord-284501-5i0w74q4	148	13	-	-	HYPH
cord-284501-5i0w74q4	148	14	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	148	15	,	,	,
cord-284501-5i0w74q4	148	16	for	for	IN
cord-284501-5i0w74q4	148	17	comparison	comparison	NN
cord-284501-5i0w74q4	148	18	with	with	IN
cord-284501-5i0w74q4	148	19	Beau	Beau	NNP
cord-284501-5i0w74q4	148	20	-	-	HYPH
cord-284501-5i0w74q4	148	21	R	R	NNP
cord-284501-5i0w74q4	148	22	and	and	CC
cord-284501-5i0w74q4	148	23	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	148	24	,	,	,
cord-284501-5i0w74q4	148	25	ex	ex	NN
cord-284501-5i0w74q4	148	26	vivo	vivo	NN
cord-284501-5i0w74q4	148	27	in	in	IN
cord-284501-5i0w74q4	148	28	TOCs	toc	NNS
cord-284501-5i0w74q4	148	29	.	.	.
cord-284501-5i0w74q4	149	1	Progeny	progeny	NN
cord-284501-5i0w74q4	149	2	viruses	virus	NNS
cord-284501-5i0w74q4	149	3	in	in	IN
cord-284501-5i0w74q4	149	4	TOC	TOC	NNP
cord-284501-5i0w74q4	149	5	medium	medium	NN
cord-284501-5i0w74q4	149	6	taken	take	VBN
cord-284501-5i0w74q4	149	7	from	from	IN
cord-284501-5i0w74q4	149	8	each	each	DT
cord-284501-5i0w74q4	149	9	group	group	NN
cord-284501-5i0w74q4	149	10	of	of	IN
cord-284501-5i0w74q4	149	11	infected	infected	JJ
cord-284501-5i0w74q4	149	12	TOCs	toc	NNS
cord-284501-5i0w74q4	149	13	at	at	IN
cord-284501-5i0w74q4	149	14	the	the	DT
cord-284501-5i0w74q4	149	15	specific	specific	JJ
cord-284501-5i0w74q4	149	16	time	time	NN
cord-284501-5i0w74q4	149	17	points	point	NNS
cord-284501-5i0w74q4	149	18	were	be	VBD
cord-284501-5i0w74q4	149	19	titrated	titrate	VBN
cord-284501-5i0w74q4	149	20	by	by	IN
cord-284501-5i0w74q4	149	21	plaque	plaque	NN
cord-284501-5i0w74q4	149	22	assay	assay	NN
cord-284501-5i0w74q4	149	23	on	on	IN
cord-284501-5i0w74q4	149	24	CK	CK	NNP
cord-284501-5i0w74q4	149	25	cells	cell	NNS
cord-284501-5i0w74q4	149	26	to	to	TO
cord-284501-5i0w74q4	149	27	investigate	investigate	VB
cord-284501-5i0w74q4	149	28	the	the	DT
cord-284501-5i0w74q4	149	29	growth	growth	NN
cord-284501-5i0w74q4	149	30	kinetics	kinetic	NNS
cord-284501-5i0w74q4	149	31	of	of	IN
cord-284501-5i0w74q4	149	32	the	the	DT
cord-284501-5i0w74q4	149	33	three	three	CD
cord-284501-5i0w74q4	149	34	IBVs	ibv	NNS
cord-284501-5i0w74q4	149	35	in	in	IN
cord-284501-5i0w74q4	149	36	TOCs	toc	NNS
cord-284501-5i0w74q4	149	37	.	.	.
cord-284501-5i0w74q4	150	1	As	as	IN
cord-284501-5i0w74q4	150	2	can	can	MD
cord-284501-5i0w74q4	150	3	be	be	VB
cord-284501-5i0w74q4	150	4	seen	see	VBN
cord-284501-5i0w74q4	150	5	from	from	IN
cord-284501-5i0w74q4	150	6	Fig	Fig	NNP
cord-284501-5i0w74q4	150	7	.	.	.
cord-284501-5i0w74q4	151	1	5	5	LS
cord-284501-5i0w74q4	151	2	all	all	DT
cord-284501-5i0w74q4	151	3	three	three	CD
cord-284501-5i0w74q4	151	4	viruses	virus	NNS
cord-284501-5i0w74q4	151	5	replicated	replicate	VBN
cord-284501-5i0w74q4	151	6	in	in	IN
cord-284501-5i0w74q4	151	7	the	the	DT
cord-284501-5i0w74q4	151	8	TOCs	toc	NNS
cord-284501-5i0w74q4	151	9	.	.	.
cord-284501-5i0w74q4	152	1	Although	although	IN
cord-284501-5i0w74q4	152	2	the	the	DT
cord-284501-5i0w74q4	152	3	viruses	virus	NNS
cord-284501-5i0w74q4	152	4	reached	reach	VBD
cord-284501-5i0w74q4	152	5	maximum	maximum	JJ
cord-284501-5i0w74q4	152	6	titres	titre	NNS
cord-284501-5i0w74q4	152	7	by	by	IN
cord-284501-5i0w74q4	152	8	24	24	CD
cord-284501-5i0w74q4	152	9	h	h	NNP
cord-284501-5i0w74q4	152	10	postinfection	postinfection	NN
cord-284501-5i0w74q4	152	11	,	,	,
cord-284501-5i0w74q4	152	12	the	the	DT
cord-284501-5i0w74q4	152	13	titre	titre	NN
cord-284501-5i0w74q4	152	14	of	of	IN
cord-284501-5i0w74q4	152	15	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	152	16	-	-	HYPH
cord-284501-5i0w74q4	152	17	Rep	Rep	NNP
cord-284501-5i0w74q4	152	18	-	-	HYPH
cord-284501-5i0w74q4	152	19	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	152	20	was	be	VBD
cord-284501-5i0w74q4	152	21	between	between	IN
cord-284501-5i0w74q4	152	22	1	1	CD
cord-284501-5i0w74q4	152	23	-	-	SYM
cord-284501-5i0w74q4	152	24	2	2	CD
cord-284501-5i0w74q4	152	25	log	log	NN
cord-284501-5i0w74q4	152	26	10	10	CD
cord-284501-5i0w74q4	152	27	units	unit	NNS
cord-284501-5i0w74q4	152	28	lower	low	JJR
cord-284501-5i0w74q4	152	29	than	than	IN
cord-284501-5i0w74q4	152	30	the	the	DT
cord-284501-5i0w74q4	152	31	titres	titre	NNS
cord-284501-5i0w74q4	152	32	observed	observe	VBD
cord-284501-5i0w74q4	152	33	for	for	IN
cord-284501-5i0w74q4	152	34	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	152	35	and	and	CC
cord-284501-5i0w74q4	152	36	Beau	Beau	NNP
cord-284501-5i0w74q4	152	37	-	-	HYPH
cord-284501-5i0w74q4	152	38	R	R	NNP
cord-284501-5i0w74q4	152	39	,	,	,
cord-284501-5i0w74q4	152	40	respectively	respectively	RB
cord-284501-5i0w74q4	152	41	,	,	,
cord-284501-5i0w74q4	152	42	at	at	IN
cord-284501-5i0w74q4	152	43	this	this	DT
cord-284501-5i0w74q4	152	44	and	and	CC
cord-284501-5i0w74q4	152	45	most	most	RBS
cord-284501-5i0w74q4	152	46	later	later	JJ
cord-284501-5i0w74q4	152	47	time	time	NN
cord-284501-5i0w74q4	152	48	points	point	NNS
cord-284501-5i0w74q4	152	49	.	.	.
cord-284501-5i0w74q4	153	1	Interestingly	interestingly	RB
cord-284501-5i0w74q4	153	2	,	,	,
cord-284501-5i0w74q4	153	3	although	although	IN
cord-284501-5i0w74q4	153	4	rBeauR	rBeauR	NNS
cord-284501-5i0w74q4	153	5	-	-	HYPH
cord-284501-5i0w74q4	153	6	Rep	Rep	NNP
cord-284501-5i0w74q4	153	7	-	-	HYPH
cord-284501-5i0w74q4	153	8	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	153	9	replicated	replicate	VBD
cord-284501-5i0w74q4	153	10	and	and	CC
cord-284501-5i0w74q4	153	11	produced	produce	VBD
cord-284501-5i0w74q4	153	12	 	 	_SP
cord-284501-5i0w74q4	153	13	Following	follow	VBG
cord-284501-5i0w74q4	153	14	rescue	rescue	NN
cord-284501-5i0w74q4	153	15	of	of	IN
cord-284501-5i0w74q4	153	16	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	153	17	-	-	HYPH
cord-284501-5i0w74q4	153	18	Rep	Rep	NNP
cord-284501-5i0w74q4	153	19	-	-	HYPH
cord-284501-5i0w74q4	153	20	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	153	21	all	all	DT
cord-284501-5i0w74q4	153	22	growth	growth	NN
cord-284501-5i0w74q4	153	23	experiments	experiment	NNS
cord-284501-5i0w74q4	153	24	were	be	VBD
cord-284501-5i0w74q4	153	25	carried	carry	VBN
cord-284501-5i0w74q4	153	26	out	out	RP
cord-284501-5i0w74q4	153	27	using	use	VBG
cord-284501-5i0w74q4	153	28	virus	virus	NN
cord-284501-5i0w74q4	153	29	that	that	WDT
cord-284501-5i0w74q4	153	30	had	have	VBD
cord-284501-5i0w74q4	153	31	been	be	VBN
cord-284501-5i0w74q4	153	32	passaged	passage	VBN
cord-284501-5i0w74q4	153	33	three	three	CD
cord-284501-5i0w74q4	153	34	times	time	NNS
cord-284501-5i0w74q4	153	35	(	(	-LRB-
cord-284501-5i0w74q4	153	36	P	p	NN
cord-284501-5i0w74q4	153	37	3	3	CD
cord-284501-5i0w74q4	153	38	)	)	-RRB-
cord-284501-5i0w74q4	153	39	in	in	IN
cord-284501-5i0w74q4	153	40	CK	CK	NNP
cord-284501-5i0w74q4	153	41	cells	cell	NNS
cord-284501-5i0w74q4	153	42	.	.	.
cord-284501-5i0w74q4	154	1	We	-PRON-	PRP
cord-284501-5i0w74q4	154	2	routinely	routinely	RB
cord-284501-5i0w74q4	154	3	use	use	VBP
cord-284501-5i0w74q4	154	4	the	the	DT
cord-284501-5i0w74q4	154	5	P	p	NN
cord-284501-5i0w74q4	154	6	3	3	CD
cord-284501-5i0w74q4	154	7	-derived	-derive	VBD
cord-284501-5i0w74q4	154	8	rIBVs	ribvs	XX
cord-284501-5i0w74q4	155	1	so	so	IN
cord-284501-5i0w74q4	155	2	that	that	IN
cord-284501-5i0w74q4	155	3	there	there	EX
cord-284501-5i0w74q4	155	4	is	be	VBZ
cord-284501-5i0w74q4	155	5	a	a	DT
cord-284501-5i0w74q4	155	6	lower	low	JJR
cord-284501-5i0w74q4	155	7	probability	probability	NN
cord-284501-5i0w74q4	155	8	that	that	IN
cord-284501-5i0w74q4	155	9	changes	change	NNS
cord-284501-5i0w74q4	155	10	will	will	MD
cord-284501-5i0w74q4	155	11	have	have	VB
cord-284501-5i0w74q4	155	12	occurred	occur	VBN
cord-284501-5i0w74q4	155	13	within	within	IN
cord-284501-5i0w74q4	155	14	the	the	DT
cord-284501-5i0w74q4	155	15	virus	virus	NN
cord-284501-5i0w74q4	155	16	genome	genome	NN
cord-284501-5i0w74q4	155	17	,	,	,
cord-284501-5i0w74q4	155	18	as	as	IN
cord-284501-5i0w74q4	155	19	with	with	IN
cord-284501-5i0w74q4	155	20	other	other	JJ
cord-284501-5i0w74q4	155	21	positive	positive	JJ
cord-284501-5i0w74q4	155	22	strand	strand	NN
cord-284501-5i0w74q4	155	23	RNA	RNA	NNP
cord-284501-5i0w74q4	155	24	viruses	virus	NNS
cord-284501-5i0w74q4	155	25	multiple	multiple	JJ
cord-284501-5i0w74q4	155	26	passage	passage	NN
cord-284501-5i0w74q4	155	27	will	will	MD
cord-284501-5i0w74q4	155	28	result	result	VB
cord-284501-5i0w74q4	155	29	in	in	IN
cord-284501-5i0w74q4	155	30	changes	change	NNS
cord-284501-5i0w74q4	155	31	in	in	IN
cord-284501-5i0w74q4	155	32	both	both	DT
cord-284501-5i0w74q4	155	33	nucleotides	nucleotide	NNS
cord-284501-5i0w74q4	155	34	and	and	CC
cord-284501-5i0w74q4	155	35	amino	amino	JJ
cord-284501-5i0w74q4	155	36	acids	acid	NNS
cord-284501-5i0w74q4	155	37	;	;	:
cord-284501-5i0w74q4	156	1	for	for	IN
cord-284501-5i0w74q4	156	2	example	example	NN
cord-284501-5i0w74q4	156	3	the	the	DT
cord-284501-5i0w74q4	156	4	acquisition	acquisition	NN
cord-284501-5i0w74q4	156	5	of	of	IN
cord-284501-5i0w74q4	156	6	the	the	DT
cord-284501-5i0w74q4	156	7	extra	extra	JJ
cord-284501-5i0w74q4	156	8	adenosine	adenosine	NN
cord-284501-5i0w74q4	156	9	residue	residue	NN
cord-284501-5i0w74q4	156	10	in	in	IN
cord-284501-5i0w74q4	156	11	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	156	12	-	-	HYPH
cord-284501-5i0w74q4	156	13	Rep	rep	NN
cord-284501-5i0w74q4	156	14	-	-	HYPH
cord-284501-5i0w74q4	156	15	M41-Struct-12	M41-Struct-12	NNP
cord-284501-5i0w74q4	156	16	.	.	.
cord-284501-5i0w74q4	157	1	The	the	DT
cord-284501-5i0w74q4	157	2	rIBV	ribv	NN
cord-284501-5i0w74q4	157	3	,	,	,
cord-284501-5i0w74q4	157	4	rBeauR	rbeaur	NN
cord-284501-5i0w74q4	157	5	-	-	HYPH
cord-284501-5i0w74q4	157	6	Rep	Rep	NNP
cord-284501-5i0w74q4	157	7	-	-	HYPH
cord-284501-5i0w74q4	157	8	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	157	9	,	,	,
cord-284501-5i0w74q4	157	10	showed	show	VBD
cord-284501-5i0w74q4	157	11	slightly	slightly	RB
cord-284501-5i0w74q4	157	12	reduced	reduce	VBN
cord-284501-5i0w74q4	157	13	growth	growth	NN
cord-284501-5i0w74q4	157	14	properties	property	NNS
cord-284501-5i0w74q4	157	15	when	when	WRB
cord-284501-5i0w74q4	157	16	compared	compare	VBN
cord-284501-5i0w74q4	157	17	with	with	IN
cord-284501-5i0w74q4	157	18	both	both	DT
cord-284501-5i0w74q4	157	19	parental	parental	JJ
cord-284501-5i0w74q4	157	20	viruses	virus	NNS
cord-284501-5i0w74q4	157	21	,	,	,
cord-284501-5i0w74q4	157	22	Beau	Beau	NNP
cord-284501-5i0w74q4	157	23	-	-	HYPH
cord-284501-5i0w74q4	157	24	R	R	NNP
cord-284501-5i0w74q4	157	25	and	and	CC
cord-284501-5i0w74q4	157	26	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	157	27	.	.	.
cord-284501-5i0w74q4	158	1	Surprisingly	surprisingly	RB
cord-284501-5i0w74q4	158	2	,	,	,
cord-284501-5i0w74q4	158	3	although	although	IN
cord-284501-5i0w74q4	158	4	rBeauR	rBeauR	NNS
cord-284501-5i0w74q4	158	5	-	-	HYPH
cord-284501-5i0w74q4	158	6	Rep	Rep	NNP
cord-284501-5i0w74q4	158	7	-	-	HYPH
cord-284501-5i0w74q4	158	8	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	158	9	grew	grow	VBD
cord-284501-5i0w74q4	158	10	in	in	IN
cord-284501-5i0w74q4	158	11	TOCs	toc	NNS
cord-284501-5i0w74q4	158	12	it	-PRON-	PRP
cord-284501-5i0w74q4	158	13	did	do	VBD
cord-284501-5i0w74q4	158	14	not	not	RB
cord-284501-5i0w74q4	158	15	cause	cause	VB
cord-284501-5i0w74q4	158	16	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	158	17	,	,	,
cord-284501-5i0w74q4	158	18	which	which	WDT
cord-284501-5i0w74q4	158	19	is	be	VBZ
cord-284501-5i0w74q4	158	20	induced	induce	VBN
cord-284501-5i0w74q4	158	21	by	by	IN
cord-284501-5i0w74q4	158	22	both	both	DT
cord-284501-5i0w74q4	158	23	parental	parental	JJ
cord-284501-5i0w74q4	158	24	viruses	virus	NNS
cord-284501-5i0w74q4	158	25	.	.	.
cord-284501-5i0w74q4	159	1	Due	due	IN
cord-284501-5i0w74q4	159	2	to	to	IN
cord-284501-5i0w74q4	159	3	the	the	DT
cord-284501-5i0w74q4	159	4	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	159	5	nature	nature	NN
cord-284501-5i0w74q4	159	6	of	of	IN
cord-284501-5i0w74q4	159	7	the	the	DT
cord-284501-5i0w74q4	159	8	rIBV	ribv	NN
cord-284501-5i0w74q4	160	1	the	the	DT
cord-284501-5i0w74q4	160	2	59-UTR	59-utr	CD
cord-284501-5i0w74q4	160	3	,	,	,
cord-284501-5i0w74q4	160	4	including	include	VBG
cord-284501-5i0w74q4	160	5	the	the	DT
cord-284501-5i0w74q4	160	6	leader	leader	NN
cord-284501-5i0w74q4	160	7	sequence	sequence	NN
cord-284501-5i0w74q4	160	8	,	,	,
cord-284501-5i0w74q4	160	9	corresponds	correspond	VBZ
cord-284501-5i0w74q4	160	10	to	to	IN
cord-284501-5i0w74q4	160	11	Beau	Beau	NNP
cord-284501-5i0w74q4	160	12	-	-	HYPH
cord-284501-5i0w74q4	160	13	R	R	NNP
cord-284501-5i0w74q4	160	14	,	,	,
cord-284501-5i0w74q4	160	15	with	with	IN
cord-284501-5i0w74q4	160	16	the	the	DT
cord-284501-5i0w74q4	160	17	39-UTR	39-utr	CD
cord-284501-5i0w74q4	160	18	derived	derive	VBN
cord-284501-5i0w74q4	160	19	from	from	IN
cord-284501-5i0w74q4	160	20	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	160	21	.	.	.
cord-284501-5i0w74q4	161	1	There	there	EX
cord-284501-5i0w74q4	161	2	are	be	VBP
cord-284501-5i0w74q4	161	3	known	know	VBN
cord-284501-5i0w74q4	161	4	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	161	5	differences	difference	NNS
cord-284501-5i0w74q4	161	6	in	in	IN
cord-284501-5i0w74q4	161	7	these	these	DT
cord-284501-5i0w74q4	161	8	regions	region	NNS
cord-284501-5i0w74q4	161	9	of	of	IN
cord-284501-5i0w74q4	161	10	the	the	DT
cord-284501-5i0w74q4	161	11	IBV	IBV	NNP
cord-284501-5i0w74q4	161	12	genome	genome	NN
cord-284501-5i0w74q4	161	13	between	between	IN
cord-284501-5i0w74q4	161	14	the	the	DT
cord-284501-5i0w74q4	161	15	two	two	CD
cord-284501-5i0w74q4	161	16	viruses	virus	NNS
cord-284501-5i0w74q4	161	17	(	(	-LRB-
cord-284501-5i0w74q4	161	18	[	[	-LRB-
cord-284501-5i0w74q4	161	19	33	33	CD
cord-284501-5i0w74q4	161	20	,	,	,
cord-284501-5i0w74q4	161	21	42	42	CD
cord-284501-5i0w74q4	161	22	]	]	-RRB-
cord-284501-5i0w74q4	161	23	.	.	.
cord-284501-5i0w74q4	162	1	This	this	DT
cord-284501-5i0w74q4	162	2	introduces	introduce	VBZ
cord-284501-5i0w74q4	162	3	the	the	DT
cord-284501-5i0w74q4	162	4	possibility	possibility	NN
cord-284501-5i0w74q4	162	5	that	that	IN
cord-284501-5i0w74q4	162	6	if	if	IN
cord-284501-5i0w74q4	162	7	the	the	DT
cord-284501-5i0w74q4	162	8	two	two	CD
cord-284501-5i0w74q4	162	9	UTRs	utr	NNS
cord-284501-5i0w74q4	162	10	interact	interact	VBP
cord-284501-5i0w74q4	162	11	this	this	DT
cord-284501-5i0w74q4	162	12	could	could	MD
cord-284501-5i0w74q4	162	13	affect	affect	VB
cord-284501-5i0w74q4	162	14	the	the	DT
cord-284501-5i0w74q4	162	15	growth	growth	NN
cord-284501-5i0w74q4	162	16	properties	property	NNS
cord-284501-5i0w74q4	162	17	of	of	IN
cord-284501-5i0w74q4	162	18	the	the	DT
cord-284501-5i0w74q4	162	19	The	the	DT
cord-284501-5i0w74q4	162	20	growth	growth	NN
cord-284501-5i0w74q4	162	21	characteristics	characteristic	NNS
cord-284501-5i0w74q4	162	22	of	of	IN
cord-284501-5i0w74q4	162	23	rBeauR	rbeaur	NN
cord-284501-5i0w74q4	163	1	-Rep	-rep	LS
cord-284501-5i0w74q4	163	2	-	-	:
cord-284501-5i0w74q4	163	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	163	4	25	25	CD
cord-284501-5i0w74q4	163	5	were	be	VBD
cord-284501-5i0w74q4	163	6	initially	initially	RB
cord-284501-5i0w74q4	163	7	examined	examine	VBN
cord-284501-5i0w74q4	163	8	in	in	IN
cord-284501-5i0w74q4	163	9	CK	CK	NNP
cord-284501-5i0w74q4	163	10	cells	cell	NNS
cord-284501-5i0w74q4	163	11	and	and	CC
cord-284501-5i0w74q4	163	12	compared	compare	VBN
cord-284501-5i0w74q4	163	13	to	to	IN
cord-284501-5i0w74q4	163	14	rBeauR	rbeaur	ADD
cord-284501-5i0w74q4	164	1	-Rep	-rep	LS
cord-284501-5i0w74q4	164	2	-	-	:
cord-284501-5i0w74q4	164	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	164	4	3	3	CD
cord-284501-5i0w74q4	164	5	.	.	.
cord-284501-5i0w74q4	165	1	As	as	IN
cord-284501-5i0w74q4	165	2	can	can	MD
cord-284501-5i0w74q4	165	3	be	be	VB
cord-284501-5i0w74q4	165	4	seen	see	VBN
cord-284501-5i0w74q4	165	5	from	from	IN
cord-284501-5i0w74q4	165	6	Fig	Fig	NNP
cord-284501-5i0w74q4	165	7	.	.	.
cord-284501-5i0w74q4	166	1	6A	6a	CD
cord-284501-5i0w74q4	167	1	the	the	DT
cord-284501-5i0w74q4	167	2	peak	peak	NN
cord-284501-5i0w74q4	167	3	titre	titre	NN
cord-284501-5i0w74q4	167	4	of	of	IN
cord-284501-5i0w74q4	167	5	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	167	6	-	-	HYPH
cord-284501-5i0w74q4	167	7	Rep	Rep	NNP
cord-284501-5i0w74q4	167	8	-	-	HYPH
cord-284501-5i0w74q4	167	9	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	167	10	-P	-P	NNP
cord-284501-5i0w74q4	167	11	25	25	CD
cord-284501-5i0w74q4	167	12	was	be	VBD
cord-284501-5i0w74q4	167	13	higher	high	JJR
cord-284501-5i0w74q4	167	14	,	,	,
cord-284501-5i0w74q4	167	15	approximately	approximately	RB
cord-284501-5i0w74q4	167	16	0.5	0.5	CD
cord-284501-5i0w74q4	167	17	log	log	NN
cord-284501-5i0w74q4	167	18	10	10	CD
cord-284501-5i0w74q4	167	19	unit	unit	NN
cord-284501-5i0w74q4	167	20	,	,	,
cord-284501-5i0w74q4	167	21	than	than	IN
cord-284501-5i0w74q4	167	22	for	for	IN
cord-284501-5i0w74q4	167	23	rBeauR	rBeauR	NNS
cord-284501-5i0w74q4	168	1	-Rep	-rep	LS
cord-284501-5i0w74q4	168	2	-	-	HYPH
cord-284501-5i0w74q4	168	3	M41-Struct-2	m41-struct-2	NN
cord-284501-5i0w74q4	168	4	-P	-P	NNP
cord-284501-5i0w74q4	168	5	3	3	CD
cord-284501-5i0w74q4	168	6	at	at	IN
cord-284501-5i0w74q4	168	7	24	24	CD
cord-284501-5i0w74q4	168	8	h	h	NN
cord-284501-5i0w74q4	168	9	post	post	NN
cord-284501-5i0w74q4	168	10	-	-	NN
cord-284501-5i0w74q4	168	11	infection	infection	NN
cord-284501-5i0w74q4	168	12	and	and	CC
cord-284501-5i0w74q4	168	13	remained	remain	VBD
cord-284501-5i0w74q4	168	14	higher	high	JJR
cord-284501-5i0w74q4	168	15	throughout	throughout	IN
cord-284501-5i0w74q4	168	16	the	the	DT
cord-284501-5i0w74q4	168	17	time	time	NN
cord-284501-5i0w74q4	168	18	course	course	NN
cord-284501-5i0w74q4	168	19	.	.	.
cord-284501-5i0w74q4	169	1	Subsequently	subsequently	RB
cord-284501-5i0w74q4	169	2	,	,	,
cord-284501-5i0w74q4	169	3	the	the	DT
cord-284501-5i0w74q4	169	4	growth	growth	NN
cord-284501-5i0w74q4	169	5	properties	property	NNS
cord-284501-5i0w74q4	169	6	of	of	IN
cord-284501-5i0w74q4	169	7	rBeauR	rbeaur	CD
cord-284501-5i0w74q4	170	1	-Rep	-rep	LS
cord-284501-5i0w74q4	170	2	-	-	:
cord-284501-5i0w74q4	170	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	170	4	25	25	CD
cord-284501-5i0w74q4	170	5	were	be	VBD
cord-284501-5i0w74q4	170	6	then	then	RB
cord-284501-5i0w74q4	170	7	studied	study	VBN
cord-284501-5i0w74q4	170	8	in	in	IN
cord-284501-5i0w74q4	170	9	TOCs	toc	NNS
cord-284501-5i0w74q4	170	10	and	and	CC
cord-284501-5i0w74q4	170	11	as	as	IN
cord-284501-5i0w74q4	170	12	can	can	MD
cord-284501-5i0w74q4	170	13	be	be	VB
cord-284501-5i0w74q4	170	14	seen	see	VBN
cord-284501-5i0w74q4	170	15	from	from	IN
cord-284501-5i0w74q4	170	16	Fig	Fig	NNP
cord-284501-5i0w74q4	170	17	.	.	.
cord-284501-5i0w74q4	171	1	6B	6b	NN
cord-284501-5i0w74q4	171	2	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	172	1	-Rep	-rep	LS
cord-284501-5i0w74q4	172	2	-	-	:
cord-284501-5i0w74q4	172	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	172	4	25	25	CD
cord-284501-5i0w74q4	172	5	rIBV	rIBV	NNS
cord-284501-5i0w74q4	172	6	grew	grow	VBD
cord-284501-5i0w74q4	172	7	to	to	IN
cord-284501-5i0w74q4	172	8	a	a	DT
cord-284501-5i0w74q4	172	9	higher	high	JJR
cord-284501-5i0w74q4	172	10	titre	titre	NN
cord-284501-5i0w74q4	172	11	than	than	IN
cord-284501-5i0w74q4	172	12	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	173	1	-Rep	-rep	LS
cord-284501-5i0w74q4	173	2	-	-	:
cord-284501-5i0w74q4	173	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	173	4	3	3	CD
cord-284501-5i0w74q4	173	5	,	,	,
cord-284501-5i0w74q4	173	6	reaching	reach	VBG
cord-284501-5i0w74q4	173	7	a	a	DT
cord-284501-5i0w74q4	173	8	1	1	CD
cord-284501-5i0w74q4	173	9	log	log	NN
cord-284501-5i0w74q4	173	10	10	10	CD
cord-284501-5i0w74q4	173	11	unit	unit	NN
cord-284501-5i0w74q4	173	12	difference	difference	NN
cord-284501-5i0w74q4	173	13	by	by	IN
cord-284501-5i0w74q4	173	14	72	72	CD
cord-284501-5i0w74q4	173	15	h	h	NN
cord-284501-5i0w74q4	173	16	postinfection	postinfection	NN
cord-284501-5i0w74q4	173	17	,	,	,
cord-284501-5i0w74q4	173	18	although	although	IN
cord-284501-5i0w74q4	173	19	the	the	DT
cord-284501-5i0w74q4	173	20	two	two	CD
cord-284501-5i0w74q4	173	21	viruses	virus	NNS
cord-284501-5i0w74q4	173	22	had	have	VBD
cord-284501-5i0w74q4	173	23	a	a	DT
cord-284501-5i0w74q4	173	24	similar	similar	JJ
cord-284501-5i0w74q4	173	25	titre	titre	NN
cord-284501-5i0w74q4	173	26	by	by	IN
cord-284501-5i0w74q4	173	27	96	96	CD
cord-284501-5i0w74q4	173	28	h	h	NN
cord-284501-5i0w74q4	173	29	postinfection	postinfection	NN
cord-284501-5i0w74q4	173	30	.	.	.
cord-284501-5i0w74q4	174	1	However	however	RB
cord-284501-5i0w74q4	174	2	,	,	,
cord-284501-5i0w74q4	174	3	analysis	analysis	NN
cord-284501-5i0w74q4	174	4	of	of	IN
cord-284501-5i0w74q4	174	5	TOCs	toc	NNS
cord-284501-5i0w74q4	174	6	infected	infect	VBN
cord-284501-5i0w74q4	174	7	with	with	IN
cord-284501-5i0w74q4	174	8	rBeauR	rbeaur	NN
cord-284501-5i0w74q4	175	1	-Rep	-rep	LS
cord-284501-5i0w74q4	175	2	-	-	:
cord-284501-5i0w74q4	175	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	175	4	25	25	CD
cord-284501-5i0w74q4	175	5	also	also	RB
cord-284501-5i0w74q4	175	6	showed	show	VBD
cord-284501-5i0w74q4	175	7	that	that	IN
cord-284501-5i0w74q4	175	8	this	this	DT
cord-284501-5i0w74q4	175	9	virus	virus	NN
cord-284501-5i0w74q4	175	10	did	do	VBD
cord-284501-5i0w74q4	175	11	not	not	RB
cord-284501-5i0w74q4	175	12	cause	cause	VB
cord-284501-5i0w74q4	175	13	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	175	14	.	.	.
cord-284501-5i0w74q4	176	1	In	in	IN
cord-284501-5i0w74q4	176	2	order	order	NN
cord-284501-5i0w74q4	176	3	to	to	TO
cord-284501-5i0w74q4	176	4	determine	determine	VB
cord-284501-5i0w74q4	176	5	whether	whether	IN
cord-284501-5i0w74q4	176	6	any	any	DT
cord-284501-5i0w74q4	176	7	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	176	8	changes	change	NNS
cord-284501-5i0w74q4	176	9	may	may	MD
cord-284501-5i0w74q4	176	10	have	have	VB
cord-284501-5i0w74q4	176	11	been	be	VBN
cord-284501-5i0w74q4	176	12	responsible	responsible	JJ
cord-284501-5i0w74q4	176	13	for	for	IN
cord-284501-5i0w74q4	176	14	the	the	DT
cord-284501-5i0w74q4	176	15	observed	observed	JJ
cord-284501-5i0w74q4	176	16	phenotypic	phenotypic	JJ
cord-284501-5i0w74q4	176	17	changes	change	NNS
cord-284501-5i0w74q4	176	18	of	of	IN
cord-284501-5i0w74q4	176	19	the	the	DT
cord-284501-5i0w74q4	176	20	P	P	NNP
cord-284501-5i0w74q4	176	21	25	25	CD
cord-284501-5i0w74q4	176	22	rIBV	ribv	ADD
cord-284501-5i0w74q4	177	1	we	-PRON-	PRP
cord-284501-5i0w74q4	177	2	decided	decide	VBD
cord-284501-5i0w74q4	177	3	to	to	TO
cord-284501-5i0w74q4	177	4	initially	initially	RB
cord-284501-5i0w74q4	177	5	sequence	sequence	VB
cord-284501-5i0w74q4	177	6	the	the	DT
cord-284501-5i0w74q4	177	7	59-and	59-and	CD
cord-284501-5i0w74q4	177	8	39-UTRs	39-utrs	CD
cord-284501-5i0w74q4	177	9	of	of	IN
cord-284501-5i0w74q4	177	10	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	178	1	-Rep	-rep	LS
cord-284501-5i0w74q4	178	2	-	-	:
cord-284501-5i0w74q4	178	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	178	4	25	25	CD
cord-284501-5i0w74q4	178	5	for	for	IN
cord-284501-5i0w74q4	178	6	comparison	comparison	NN
cord-284501-5i0w74q4	178	7	to	to	IN
cord-284501-5i0w74q4	178	8	the	the	DT
cord-284501-5i0w74q4	178	9	corresponding	corresponding	JJ
cord-284501-5i0w74q4	178	10	sequences	sequence	NNS
cord-284501-5i0w74q4	178	11	of	of	IN
cord-284501-5i0w74q4	178	12	rBeauR	rbeaur	CD
cord-284501-5i0w74q4	179	1	-Rep	-rep	LS
cord-284501-5i0w74q4	179	2	-	-	:
cord-284501-5i0w74q4	179	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	179	4	3	3	CD
cord-284501-5i0w74q4	179	5	and	and	CC
cord-284501-5i0w74q4	179	6	the	the	DT
cord-284501-5i0w74q4	179	7	two	two	CD
cord-284501-5i0w74q4	179	8	parental	parental	JJ
cord-284501-5i0w74q4	179	9	viruses	virus	NNS
cord-284501-5i0w74q4	179	10	Beau	Beau	NNP
cord-284501-5i0w74q4	179	11	-	-	HYPH
cord-284501-5i0w74q4	179	12	R	R	NNP
cord-284501-5i0w74q4	179	13	and	and	CC
cord-284501-5i0w74q4	179	14	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	179	15	.	.	.
cord-284501-5i0w74q4	180	1	No	no	DT
cord-284501-5i0w74q4	180	2	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	180	3	changes	change	NNS
cord-284501-5i0w74q4	180	4	were	be	VBD
cord-284501-5i0w74q4	180	5	found	find	VBN
cord-284501-5i0w74q4	180	6	within	within	IN
cord-284501-5i0w74q4	180	7	the	the	DT
cord-284501-5i0w74q4	180	8	59-and	59-and	CD
cord-284501-5i0w74q4	180	9	39-UTR	39-utr	CD
cord-284501-5i0w74q4	180	10	sequences	sequence	NNS
cord-284501-5i0w74q4	180	11	of	of	IN
cord-284501-5i0w74q4	180	12	the	the	DT
cord-284501-5i0w74q4	180	13	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	180	14	-	-	HYPH
cord-284501-5i0w74q4	180	15	Rep	Rep	NNP
cord-284501-5i0w74q4	180	16	-	-	HYPH
cord-284501-5i0w74q4	180	17	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	180	18	25	25	CD
cord-284501-5i0w74q4	180	19	virus	virus	NN
cord-284501-5i0w74q4	180	20	indicating	indicate	VBG
cord-284501-5i0w74q4	180	21	that	that	IN
cord-284501-5i0w74q4	180	22	the	the	DT
cord-284501-5i0w74q4	180	23	change	change	NN
cord-284501-5i0w74q4	180	24	in	in	IN
cord-284501-5i0w74q4	180	25	growth	growth	NN
cord-284501-5i0w74q4	180	26	pattern	pattern	NN
cord-284501-5i0w74q4	180	27	was	be	VBD
cord-284501-5i0w74q4	180	28	not	not	RB
cord-284501-5i0w74q4	180	29	due	due	JJ
cord-284501-5i0w74q4	180	30	to	to	IN
cord-284501-5i0w74q4	180	31	one	one	CD
cord-284501-5i0w74q4	180	32	of	of	IN
cord-284501-5i0w74q4	180	33	the	the	DT
cord-284501-5i0w74q4	180	34	two	two	CD
cord-284501-5i0w74q4	180	35	UTRs	utr	NNS
cord-284501-5i0w74q4	180	36	changing	change	VBG
cord-284501-5i0w74q4	180	37	to	to	IN
cord-284501-5i0w74q4	180	38	the	the	DT
cord-284501-5i0w74q4	180	39	other	other	JJ
cord-284501-5i0w74q4	180	40	parental	parental	JJ
cord-284501-5i0w74q4	180	41	sequence	sequence	NN
cord-284501-5i0w74q4	180	42	.	.	.
cord-284501-5i0w74q4	181	1	As	as	IN
cord-284501-5i0w74q4	181	2	a	a	DT
cord-284501-5i0w74q4	181	3	result	result	NN
cord-284501-5i0w74q4	181	4	of	of	IN
cord-284501-5i0w74q4	181	5	this	this	DT
cord-284501-5i0w74q4	181	6	finding	finding	NN
cord-284501-5i0w74q4	181	7	we	-PRON-	PRP
cord-284501-5i0w74q4	181	8	sequenced	sequence	VBD
cord-284501-5i0w74q4	181	9	the	the	DT
cord-284501-5i0w74q4	181	10	complete	complete	JJ
cord-284501-5i0w74q4	181	11	rIBV	ribv	NN
cord-284501-5i0w74q4	181	12	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	181	13	-	-	HYPH
cord-284501-5i0w74q4	181	14	Rep	Rep	NNP
cord-284501-5i0w74q4	181	15	-	-	HYPH
cord-284501-5i0w74q4	181	16	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	181	17	25	25	CD
cord-284501-5i0w74q4	181	18	genomic	genomic	JJ
cord-284501-5i0w74q4	181	19	sequence	sequence	NN
cord-284501-5i0w74q4	181	20	and	and	CC
cord-284501-5i0w74q4	181	21	identified	identify	VBD
cord-284501-5i0w74q4	181	22	only	only	RB
cord-284501-5i0w74q4	181	23	three	three	CD
cord-284501-5i0w74q4	181	24	other	other	JJ
cord-284501-5i0w74q4	181	25	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	181	26	changes	change	NNS
cord-284501-5i0w74q4	181	27	(	(	-LRB-
cord-284501-5i0w74q4	181	28	Table	table	NN
cord-284501-5i0w74q4	181	29	1	1	CD
cord-284501-5i0w74q4	181	30	)	)	-RRB-
cord-284501-5i0w74q4	181	31	in	in	IN
cord-284501-5i0w74q4	181	32	addition	addition	NN
cord-284501-5i0w74q4	181	33	to	to	IN
cord-284501-5i0w74q4	181	34	those	those	DT
cord-284501-5i0w74q4	181	35	identified	identify	VBN
cord-284501-5i0w74q4	181	36	within	within	IN
cord-284501-5i0w74q4	181	37	rBeauR	rbeaur	ADD
cord-284501-5i0w74q4	182	1	-Rep	-rep	LS
cord-284501-5i0w74q4	182	2	-	-	:
cord-284501-5i0w74q4	182	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	182	4	3	3	CD
cord-284501-5i0w74q4	182	5	.	.	.
cord-284501-5i0w74q4	183	1	These	these	DT
cord-284501-5i0w74q4	183	2	new	new	JJ
cord-284501-5i0w74q4	183	3	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	183	4	differences	difference	NNS
cord-284501-5i0w74q4	183	5	corresponded	correspond	VBD
cord-284501-5i0w74q4	183	6	to	to	IN
cord-284501-5i0w74q4	183	7	a	a	DT
cord-284501-5i0w74q4	183	8	single	single	JJ
cord-284501-5i0w74q4	183	9	amino	amino	NN
cord-284501-5i0w74q4	183	10	acid	acid	NN
cord-284501-5i0w74q4	183	11	change	change	NN
cord-284501-5i0w74q4	183	12	in	in	IN
cord-284501-5i0w74q4	183	13	the	the	DT
cord-284501-5i0w74q4	183	14	S	S	NNP
cord-284501-5i0w74q4	183	15	gene	gene	NN
cord-284501-5i0w74q4	183	16	and	and	CC
cord-284501-5i0w74q4	183	17	two	two	CD
cord-284501-5i0w74q4	183	18	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	183	19	changes	change	NNS
cord-284501-5i0w74q4	183	20	within	within	IN
cord-284501-5i0w74q4	183	21	ORF	ORF	NNP
cord-284501-5i0w74q4	183	22	5b	5b	NN
cord-284501-5i0w74q4	183	23	of	of	IN
cord-284501-5i0w74q4	183	24	gene	gene	NN
cord-284501-5i0w74q4	183	25	5	5	CD
cord-284501-5i0w74q4	183	26	when	when	WRB
cord-284501-5i0w74q4	183	27	comparing	compare	VBG
cord-284501-5i0w74q4	183	28	the	the	DT
cord-284501-5i0w74q4	183	29	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	183	30	-	-	HYPH
cord-284501-5i0w74q4	183	31	derived	derive	VBN
cord-284501-5i0w74q4	183	32	sequences	sequence	NNS
cord-284501-5i0w74q4	183	33	within	within	IN
cord-284501-5i0w74q4	183	34	rBeauR	rbeaur	ADD
cord-284501-5i0w74q4	184	1	-Rep	-rep	LS
cord-284501-5i0w74q4	184	2	-	-	:
cord-284501-5i0w74q4	184	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	184	4	3	3	CD
cord-284501-5i0w74q4	184	5	and	and	CC
cord-284501-5i0w74q4	184	6	rIBV	ribv	NN
cord-284501-5i0w74q4	184	7	rBeauR	rBeauR	.
cord-284501-5i0w74q4	185	1	-Rep	-rep	LS
cord-284501-5i0w74q4	185	2	-	-	:
cord-284501-5i0w74q4	185	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	185	4	25	25	CD
cord-284501-5i0w74q4	185	5	sequences	sequence	NNS
cord-284501-5i0w74q4	185	6	;	;	:
cord-284501-5i0w74q4	185	7	indicating	indicate	VBG
cord-284501-5i0w74q4	185	8	that	that	IN
cord-284501-5i0w74q4	185	9	these	these	DT
cord-284501-5i0w74q4	185	10	changes	change	NNS
cord-284501-5i0w74q4	185	11	arose	arise	VBD
cord-284501-5i0w74q4	185	12	on	on	IN
cord-284501-5i0w74q4	185	13	further	further	JJ
cord-284501-5i0w74q4	185	14	passage	passage	NN
cord-284501-5i0w74q4	185	15	of	of	IN
cord-284501-5i0w74q4	185	16	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	186	1	-Rep	-rep	LS
cord-284501-5i0w74q4	186	2	-	-	:
cord-284501-5i0w74q4	186	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	186	4	3	3	CD
cord-284501-5i0w74q4	186	5	.	.	.
cord-284501-5i0w74q4	187	1	The	the	DT
cord-284501-5i0w74q4	187	2	two	two	CD
cord-284501-5i0w74q4	187	3	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	187	4	changes	change	NNS
cord-284501-5i0w74q4	187	5	within	within	IN
cord-284501-5i0w74q4	187	6	the	the	DT
cord-284501-5i0w74q4	187	7	ORF	ORF	NNP
cord-284501-5i0w74q4	187	8	5b	5b	NN
cord-284501-5i0w74q4	187	9	sequence	sequence	NN
cord-284501-5i0w74q4	187	10	,	,	,
cord-284501-5i0w74q4	187	11	nucleotides	nucleotide	NNS
cord-284501-5i0w74q4	187	12	25815	25815	CD
cord-284501-5i0w74q4	187	13	and	and	CC
cord-284501-5i0w74q4	187	14	25816	25816	CD
cord-284501-5i0w74q4	187	15	(	(	-LRB-
cord-284501-5i0w74q4	187	16	UURAA	UURAA	NNP
cord-284501-5i0w74q4	187	17	)	)	-RRB-
cord-284501-5i0w74q4	187	18	,	,	,
cord-284501-5i0w74q4	187	19	resulted	result	VBD
cord-284501-5i0w74q4	187	20	in	in	IN
cord-284501-5i0w74q4	187	21	the	the	DT
cord-284501-5i0w74q4	187	22	introduction	introduction	NN
cord-284501-5i0w74q4	187	23	of	of	IN
cord-284501-5i0w74q4	187	24	a	a	DT
cord-284501-5i0w74q4	187	25	premature	premature	JJ
cord-284501-5i0w74q4	187	26	stop	stop	NN
cord-284501-5i0w74q4	187	27	codon	codon	NN
cord-284501-5i0w74q4	187	28	in	in	IN
cord-284501-5i0w74q4	187	29	ORF	ORF	NNP
cord-284501-5i0w74q4	187	30	5b	5b	NN
cord-284501-5i0w74q4	187	31	and	and	CC
cord-284501-5i0w74q4	187	32	a	a	DT
cord-284501-5i0w74q4	187	33	modification	modification	NN
cord-284501-5i0w74q4	187	34	of	of	IN
cord-284501-5i0w74q4	187	35	the	the	DT
cord-284501-5i0w74q4	187	36	N	n	CD
cord-284501-5i0w74q4	187	37	gene	gene	NN
cord-284501-5i0w74q4	187	38	transcription	transcription	NN
cord-284501-5i0w74q4	187	39	regulatory	regulatory	JJ
cord-284501-5i0w74q4	187	40	sequence	sequence	NN
cord-284501-5i0w74q4	187	41	(	(	-LRB-
cord-284501-5i0w74q4	187	42	TRS	TRS	NNP
cord-284501-5i0w74q4	187	43	)	)	-RRB-
cord-284501-5i0w74q4	187	44	from	from	IN
cord-284501-5i0w74q4	187	45	UUCUUAA	UUCUUAA	NNP
cord-284501-5i0w74q4	187	46	-	-	HYPH
cord-284501-5i0w74q4	187	47	CAA	CAA	NNP
cord-284501-5i0w74q4	187	48	to	to	IN
cord-284501-5i0w74q4	187	49	AACUUAACAA	AACUUAACAA	NNP
cord-284501-5i0w74q4	187	50	,	,	,
cord-284501-5i0w74q4	187	51	the	the	DT
cord-284501-5i0w74q4	187	52	latter	latter	JJ
cord-284501-5i0w74q4	187	53	sequence	sequence	NN
cord-284501-5i0w74q4	187	54	being	be	VBG
cord-284501-5i0w74q4	187	55	the	the	DT
cord-284501-5i0w74q4	187	56	more	more	RBR
cord-284501-5i0w74q4	187	57	predominant	predominant	JJ
cord-284501-5i0w74q4	187	58	IBV	IBV	NNP
cord-284501-5i0w74q4	187	59	TRS	TRS	NNP
cord-284501-5i0w74q4	187	60	.	.	.
cord-284501-5i0w74q4	188	1	Sequence	sequence	NN
cord-284501-5i0w74q4	188	2	analysis	analysis	NN
cord-284501-5i0w74q4	188	3	of	of	IN
cord-284501-5i0w74q4	188	4	the	the	DT
cord-284501-5i0w74q4	188	5	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	188	6	-	-	HYPH
cord-284501-5i0w74q4	188	7	Rep	Rep	NNP
cord-284501-5i0w74q4	188	8	-	-	HYPH
cord-284501-5i0w74q4	188	9	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	188	10	viruses	virus	NNS
cord-284501-5i0w74q4	188	11	between	between	IN
cord-284501-5i0w74q4	188	12	passages	passage	NNS
cord-284501-5i0w74q4	188	13	P	P	NNP
cord-284501-5i0w74q4	188	14	3	3	CD
cord-284501-5i0w74q4	188	15	and	and	CC
cord-284501-5i0w74q4	188	16	P	p	NN
cord-284501-5i0w74q4	188	17	25	25	CD
cord-284501-5i0w74q4	189	1	(	(	-LRB-
cord-284501-5i0w74q4	189	2	Fig	Fig	NNP
cord-284501-5i0w74q4	189	3	.	.	.
cord-284501-5i0w74q4	190	1	7	7	LS
cord-284501-5i0w74q4	190	2	)	)	-RRB-
cord-284501-5i0w74q4	190	3	indicated	indicate	VBD
cord-284501-5i0w74q4	190	4	that	that	IN
cord-284501-5i0w74q4	190	5	at	at	IN
cord-284501-5i0w74q4	190	6	P	p	NN
cord-284501-5i0w74q4	190	7	5	5	CD
cord-284501-5i0w74q4	190	8	,	,	,
cord-284501-5i0w74q4	190	9	the	the	DT
cord-284501-5i0w74q4	190	10	AA	AA	NNP
cord-284501-5i0w74q4	190	11	mutation	mutation	NN
cord-284501-5i0w74q4	190	12	was	be	VBD
cord-284501-5i0w74q4	190	13	more	more	RBR
cord-284501-5i0w74q4	190	14	prominent	prominent	JJ
cord-284501-5i0w74q4	190	15	than	than	IN
cord-284501-5i0w74q4	190	16	the	the	DT
cord-284501-5i0w74q4	190	17	parental	parental	JJ
cord-284501-5i0w74q4	190	18	(	(	-LRB-
cord-284501-5i0w74q4	190	19	UU	UU	NNP
cord-284501-5i0w74q4	190	20	)	)	-RRB-
cord-284501-5i0w74q4	190	21	sequence	sequence	NN
cord-284501-5i0w74q4	190	22	and	and	CC
cord-284501-5i0w74q4	190	23	that	that	IN
cord-284501-5i0w74q4	190	24	in	in	IN
cord-284501-5i0w74q4	190	25	subsequent	subsequent	JJ
cord-284501-5i0w74q4	190	26	viruses	virus	NNS
cord-284501-5i0w74q4	190	27	,	,	,
cord-284501-5i0w74q4	190	28	derived	derive	VBN
cord-284501-5i0w74q4	190	29	from	from	IN
cord-284501-5i0w74q4	190	30	passages	passage	NNS
cord-284501-5i0w74q4	190	31	P	P	NNP
cord-284501-5i0w74q4	190	32	10	10	CD
cord-284501-5i0w74q4	190	33	,	,	,
cord-284501-5i0w74q4	190	34	P	p	NN
cord-284501-5i0w74q4	190	35	15	15	CD
cord-284501-5i0w74q4	190	36	,	,	,
cord-284501-5i0w74q4	190	37	P	p	NN
cord-284501-5i0w74q4	190	38	20	20	CD
cord-284501-5i0w74q4	190	39	and	and	CC
cord-284501-5i0w74q4	190	40	P	p	NN
cord-284501-5i0w74q4	190	41	25	25	CD
cord-284501-5i0w74q4	190	42	,	,	,
cord-284501-5i0w74q4	190	43	the	the	DT
cord-284501-5i0w74q4	190	44	original	original	JJ
cord-284501-5i0w74q4	190	45	parental	parental	JJ
cord-284501-5i0w74q4	190	46	sequence	sequence	NN
cord-284501-5i0w74q4	190	47	gradually	gradually	RB
cord-284501-5i0w74q4	190	48	decreased	decrease	VBD
cord-284501-5i0w74q4	190	49	and	and	CC
cord-284501-5i0w74q4	190	50	disappeared	disappear	VBD
cord-284501-5i0w74q4	190	51	from	from	IN
cord-284501-5i0w74q4	190	52	detection	detection	NN
cord-284501-5i0w74q4	190	53	.	.	.
cord-284501-5i0w74q4	190	54	 	 	_SP
cord-284501-5i0w74q4	191	1	Our	-PRON-	PRP$
cord-284501-5i0w74q4	191	2	previous	previous	JJ
cord-284501-5i0w74q4	191	3	work	work	NN
cord-284501-5i0w74q4	191	4	on	on	IN
cord-284501-5i0w74q4	191	5	the	the	DT
cord-284501-5i0w74q4	191	6	swapping	swapping	NN
cord-284501-5i0w74q4	191	7	of	of	IN
cord-284501-5i0w74q4	191	8	the	the	DT
cord-284501-5i0w74q4	191	9	S	S	NNP
cord-284501-5i0w74q4	191	10	gene	gene	NN
cord-284501-5i0w74q4	191	11	from	from	IN
cord-284501-5i0w74q4	191	12	the	the	DT
cord-284501-5i0w74q4	191	13	avirulent	avirulent	NN
cord-284501-5i0w74q4	191	14	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	191	15	(	(	-LRB-
cord-284501-5i0w74q4	191	16	Beau	Beau	NNP
cord-284501-5i0w74q4	191	17	-	-	HYPH
cord-284501-5i0w74q4	191	18	R	R	NNP
cord-284501-5i0w74q4	191	19	)	)	-RRB-
cord-284501-5i0w74q4	191	20	strain	strain	NN
cord-284501-5i0w74q4	191	21	of	of	IN
cord-284501-5i0w74q4	191	22	IBV	IBV	NNP
cord-284501-5i0w74q4	191	23	with	with	IN
cord-284501-5i0w74q4	191	24	an	an	DT
cord-284501-5i0w74q4	191	25	S	S	NNP
cord-284501-5i0w74q4	191	26	gene	gene	NN
cord-284501-5i0w74q4	191	27	derived	derive	VBN
cord-284501-5i0w74q4	191	28	from	from	IN
cord-284501-5i0w74q4	191	29	the	the	DT
cord-284501-5i0w74q4	191	30	pathogenic	pathogenic	JJ
cord-284501-5i0w74q4	191	31	M41-CK	m41-ck	CD
cord-284501-5i0w74q4	191	32	isolate	isolate	NN
cord-284501-5i0w74q4	191	33	of	of	IN
cord-284501-5i0w74q4	191	34	IBV	IBV	NNP
cord-284501-5i0w74q4	191	35	showed	show	VBD
cord-284501-5i0w74q4	191	36	that	that	IN
cord-284501-5i0w74q4	191	37	although	although	IN
cord-284501-5i0w74q4	191	38	the	the	DT
cord-284501-5i0w74q4	191	39	S	S	NNP
cord-284501-5i0w74q4	191	40	gene	gene	NN
cord-284501-5i0w74q4	191	41	was	be	VBD
cord-284501-5i0w74q4	191	42	responsible	responsible	JJ
cord-284501-5i0w74q4	191	43	for	for	IN
cord-284501-5i0w74q4	191	44	tropism	tropism	NN
cord-284501-5i0w74q4	191	45	it	-PRON-	PRP
cord-284501-5i0w74q4	191	46	was	be	VBD
cord-284501-5i0w74q4	191	47	not	not	RB
cord-284501-5i0w74q4	191	48	responsible	responsible	JJ
cord-284501-5i0w74q4	191	49	for	for	IN
cord-284501-5i0w74q4	191	50	virulence	virulence	NN
cord-284501-5i0w74q4	191	51	[	[	-LRB-
cord-284501-5i0w74q4	191	52	24	24	CD
cord-284501-5i0w74q4	191	53	]	]	-RRB-
cord-284501-5i0w74q4	191	54	[	[	-LRB-
cord-284501-5i0w74q4	191	55	25	25	CD
cord-284501-5i0w74q4	191	56	]	]	-RRB-
cord-284501-5i0w74q4	191	57	[	[	-LRB-
cord-284501-5i0w74q4	191	58	26	26	CD
cord-284501-5i0w74q4	191	59	]	]	-RRB-
cord-284501-5i0w74q4	191	60	.	.	.
cord-284501-5i0w74q4	192	1	Although	although	IN
cord-284501-5i0w74q4	192	2	our	-PRON-	PRP$
cord-284501-5i0w74q4	192	3	results	result	NNS
cord-284501-5i0w74q4	192	4	showed	show	VBD
cord-284501-5i0w74q4	192	5	swapping	swapping	NN
cord-284501-5i0w74q4	192	6	of	of	IN
cord-284501-5i0w74q4	192	7	the	the	DT
cord-284501-5i0w74q4	192	8	S	S	NNP
cord-284501-5i0w74q4	192	9	gene	gene	NN
cord-284501-5i0w74q4	192	10	did	do	VBD
cord-284501-5i0w74q4	192	11	not	not	RB
cord-284501-5i0w74q4	192	12	result	result	VB
cord-284501-5i0w74q4	192	13	in	in	IN
cord-284501-5i0w74q4	192	14	virulence	virulence	NN
cord-284501-5i0w74q4	192	15	we	-PRON-	PRP
cord-284501-5i0w74q4	192	16	could	could	MD
cord-284501-5i0w74q4	192	17	not	not	RB
cord-284501-5i0w74q4	192	18	rule	rule	VB
cord-284501-5i0w74q4	192	19	out	out	RP
cord-284501-5i0w74q4	192	20	the	the	DT
cord-284501-5i0w74q4	192	21	fact	fact	NN
cord-284501-5i0w74q4	192	22	that	that	IN
cord-284501-5i0w74q4	192	23	other	other	JJ
cord-284501-5i0w74q4	192	24	IBV	IBV	NNP
cord-284501-5i0w74q4	192	25	structural	structural	JJ
cord-284501-5i0w74q4	192	26	(	(	-LRB-
cord-284501-5i0w74q4	192	27	E	e	NN
cord-284501-5i0w74q4	192	28	,	,	,
cord-284501-5i0w74q4	192	29	M	M	NNP
cord-284501-5i0w74q4	192	30	and	and	CC
cord-284501-5i0w74q4	192	31	N	N	NNP
cord-284501-5i0w74q4	192	32	)	)	-RRB-
cord-284501-5i0w74q4	192	33	and	and	CC
cord-284501-5i0w74q4	192	34	accessory	accessory	NN
cord-284501-5i0w74q4	192	35	(	(	-LRB-
cord-284501-5i0w74q4	192	36	3a	3a	NNP
cord-284501-5i0w74q4	192	37	,	,	,
cord-284501-5i0w74q4	192	38	3b	3b	CD
cord-284501-5i0w74q4	192	39	,	,	,
cord-284501-5i0w74q4	192	40	5a	5a	CD
cord-284501-5i0w74q4	192	41	and	and	CC
cord-284501-5i0w74q4	192	42	5b	5b	CD
cord-284501-5i0w74q4	192	43	)	)	-RRB-
cord-284501-5i0w74q4	192	44	genes	gene	NNS
cord-284501-5i0w74q4	192	45	may	may	MD
cord-284501-5i0w74q4	192	46	also	also	RB
cord-284501-5i0w74q4	192	47	play	play	VB
cord-284501-5i0w74q4	192	48	a	a	DT
cord-284501-5i0w74q4	192	49	role	role	NN
cord-284501-5i0w74q4	192	50	and	and	CC
cord-284501-5i0w74q4	192	51	therefore	therefore	RB
cord-284501-5i0w74q4	192	52	be	be	VB
cord-284501-5i0w74q4	192	53	required	require	VBN
cord-284501-5i0w74q4	192	54	for	for	IN
cord-284501-5i0w74q4	192	55	the	the	DT
cord-284501-5i0w74q4	192	56	acquisition	acquisition	NN
cord-284501-5i0w74q4	192	57	of	of	IN
cord-284501-5i0w74q4	192	58	virulence	virulence	NN
cord-284501-5i0w74q4	192	59	.	.	.
cord-284501-5i0w74q4	193	1	We	-PRON-	PRP
cord-284501-5i0w74q4	193	2	therefore	therefore	RB
cord-284501-5i0w74q4	193	3	decided	decide	VBD
cord-284501-5i0w74q4	193	4	to	to	TO
cord-284501-5i0w74q4	193	5	exchange	exchange	VB
cord-284501-5i0w74q4	193	6	the	the	DT
cord-284501-5i0w74q4	193	7	region	region	NN
cord-284501-5i0w74q4	193	8	of	of	IN
cord-284501-5i0w74q4	193	9	the	the	DT
cord-284501-5i0w74q4	193	10	Beau	Beau	NNP
cord-284501-5i0w74q4	193	11	-	-	HYPH
cord-284501-5i0w74q4	193	12	R	R	NNP
cord-284501-5i0w74q4	193	13	genome	genome	NN
cord-284501-5i0w74q4	193	14	from	from	IN
cord-284501-5i0w74q4	193	15	the	the	DT
cord-284501-5i0w74q4	193	16	end	end	NN
cord-284501-5i0w74q4	193	17	of	of	IN
cord-284501-5i0w74q4	193	18	the	the	DT
cord-284501-5i0w74q4	193	19	replicase	replicase	NN
cord-284501-5i0w74q4	193	20	gene	gene	NN
cord-284501-5i0w74q4	193	21	to	to	IN
cord-284501-5i0w74q4	193	22	the	the	DT
cord-284501-5i0w74q4	193	23	poly(A	poly(a	JJ
cord-284501-5i0w74q4	193	24	)	)	-RRB-
cord-284501-5i0w74q4	193	25	tail	tail	VBP
cord-284501-5i0w74q4	193	26	with	with	IN
cord-284501-5i0w74q4	193	27	the	the	DT
cord-284501-5i0w74q4	193	28	corresponding	corresponding	JJ
cord-284501-5i0w74q4	193	29	sequence	sequence	NN
cord-284501-5i0w74q4	193	30	from	from	IN
cord-284501-5i0w74q4	193	31	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	193	32	to	to	TO
cord-284501-5i0w74q4	193	33	investigate	investigate	VB
cord-284501-5i0w74q4	193	34	whether	whether	IN
cord-284501-5i0w74q4	193	35	exchange	exchange	NN
cord-284501-5i0w74q4	193	36	of	of	IN
cord-284501-5i0w74q4	193	37	the	the	DT
cord-284501-5i0w74q4	193	38	structural	structural	JJ
cord-284501-5i0w74q4	193	39	and	and	CC
cord-284501-5i0w74q4	193	40	accessory	accessory	NN
cord-284501-5i0w74q4	193	41	genes	gene	NNS
cord-284501-5i0w74q4	193	42	was	be	VBD
cord-284501-5i0w74q4	193	43	sufficient	sufficient	JJ
cord-284501-5i0w74q4	193	44	to	to	TO
cord-284501-5i0w74q4	193	45	confer	confer	VB
cord-284501-5i0w74q4	193	46	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	193	47	to	to	IN
cord-284501-5i0w74q4	193	48	a	a	DT
cord-284501-5i0w74q4	193	49	resultant	resultant	JJ
cord-284501-5i0w74q4	193	50	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	193	51	rIBV	ribv	NN
cord-284501-5i0w74q4	193	52	,	,	,
cord-284501-5i0w74q4	193	53	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	193	54	-	-	HYPH
cord-284501-5i0w74q4	193	55	Rep	rep	NN
cord-284501-5i0w74q4	193	56	-	-	HYPH
cord-284501-5i0w74q4	193	57	M41-Struct	M41-Struct	NNP
cord-284501-5i0w74q4	193	58	.	.	.
cord-284501-5i0w74q4	194	1	Such	such	JJ
cord-284501-5i0w74q4	194	2	an	an	DT
cord-284501-5i0w74q4	194	3	approach	approach	NN
cord-284501-5i0w74q4	194	4	would	would	MD
cord-284501-5i0w74q4	194	5	also	also	RB
cord-284501-5i0w74q4	194	6	allow	allow	VB
cord-284501-5i0w74q4	194	7	us	-PRON-	PRP
cord-284501-5i0w74q4	194	8	to	to	TO
cord-284501-5i0w74q4	194	9	determine	determine	VB
cord-284501-5i0w74q4	194	10	whether	whether	IN
cord-284501-5i0w74q4	194	11	or	or	CC
cord-284501-5i0w74q4	194	12	not	not	RB
cord-284501-5i0w74q4	194	13	the	the	DT
cord-284501-5i0w74q4	194	14	replicase	replicase	NNP
cord-284501-5i0w74q4	194	15	gene	gene	NN
cord-284501-5i0w74q4	194	16	plays	play	VBZ
cord-284501-5i0w74q4	194	17	a	a	DT
cord-284501-5i0w74q4	194	18	role	role	NN
cord-284501-5i0w74q4	194	19	in	in	IN
cord-284501-5i0w74q4	194	20	the	the	DT
cord-284501-5i0w74q4	194	21	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	194	22	of	of	IN
cord-284501-5i0w74q4	194	23	IBV	IBV	NNP
cord-284501-5i0w74q4	194	24	.	.	.
cord-284501-5i0w74q4	195	1	IBV	IBV	NNP
cord-284501-5i0w74q4	195	2	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	195	3	is	be	VBZ
cord-284501-5i0w74q4	195	4	a	a	DT
cord-284501-5i0w74q4	195	5	well	well	RB
cord-284501-5i0w74q4	195	6	known	know	VBN
cord-284501-5i0w74q4	195	7	apathogenic	apathogenic	NN
cord-284501-5i0w74q4	195	8	lab	lab	NN
cord-284501-5i0w74q4	195	9	strain	strain	NN
cord-284501-5i0w74q4	195	10	of	of	IN
cord-284501-5i0w74q4	195	11	IBV	IBV	NNP
cord-284501-5i0w74q4	195	12	that	that	WDT
cord-284501-5i0w74q4	195	13	was	be	VBD
cord-284501-5i0w74q4	195	14	attenuated	attenuate	VBN
cord-284501-5i0w74q4	195	15	by	by	IN
cord-284501-5i0w74q4	195	16	multiple	multiple	JJ
cord-284501-5i0w74q4	195	17	,	,	,
cord-284501-5i0w74q4	195	18	several	several	JJ
cord-284501-5i0w74q4	195	19	hundred	hundred	CD
cord-284501-5i0w74q4	195	20	,	,	,
cord-284501-5i0w74q4	195	21	passages	passage	NNS
cord-284501-5i0w74q4	195	22	in	in	IN
cord-284501-5i0w74q4	195	23	11-day	11-day	CD
cord-284501-5i0w74q4	195	24	-	-	HYPH
cord-284501-5i0w74q4	195	25	old	old	JJ
cord-284501-5i0w74q4	195	26	embryonic	embryonic	JJ
cord-284501-5i0w74q4	195	27	chicks	chick	NNS
cord-284501-5i0w74q4	195	28	[	[	-LRB-
cord-284501-5i0w74q4	195	29	30	30	CD
cord-284501-5i0w74q4	195	30	]	]	-RRB-
cord-284501-5i0w74q4	195	31	,	,	,
cord-284501-5i0w74q4	195	32	therefore	therefore	RB
cord-284501-5i0w74q4	195	33	loss	loss	NN
cord-284501-5i0w74q4	195	34	of	of	IN
cord-284501-5i0w74q4	195	35	virulence	virulence	NN
cord-284501-5i0w74q4	195	36	could	could	MD
cord-284501-5i0w74q4	195	37	have	have	VB
cord-284501-5i0w74q4	195	38	resulted	result	VBN
cord-284501-5i0w74q4	195	39	in	in	IN
cord-284501-5i0w74q4	195	40	multiple	multiple	JJ
cord-284501-5i0w74q4	195	41	changes	change	NNS
cord-284501-5i0w74q4	195	42	throughout	throughout	IN
cord-284501-5i0w74q4	195	43	the	the	DT
cord-284501-5i0w74q4	195	44	genome	genome	NN
cord-284501-5i0w74q4	195	45	.	.	.
cord-284501-5i0w74q4	196	1	IBV	IBV	NNP
cord-284501-5i0w74q4	196	2	Beau	Beau	NNP
cord-284501-5i0w74q4	196	3	-	-	HYPH
cord-284501-5i0w74q4	196	4	R	R	NNP
cord-284501-5i0w74q4	196	5	is	be	VBZ
cord-284501-5i0w74q4	196	6	a	a	DT
cord-284501-5i0w74q4	196	7	molecular	molecular	JJ
cord-284501-5i0w74q4	196	8	clone	clone	NN
cord-284501-5i0w74q4	196	9	of	of	IN
cord-284501-5i0w74q4	196	10	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	196	11	-	-	HYPH
cord-284501-5i0w74q4	196	12	CK	CK	NNP
cord-284501-5i0w74q4	196	13	[	[	-LRB-
cord-284501-5i0w74q4	196	14	35	35	CD
cord-284501-5i0w74q4	196	15	]	]	-RRB-
cord-284501-5i0w74q4	196	16	)	)	-RRB-
cord-284501-5i0w74q4	196	17	that	that	WDT
cord-284501-5i0w74q4	196	18	is	be	VBZ
cord-284501-5i0w74q4	196	19	also	also	RB
cord-284501-5i0w74q4	196	20	avirulent	avirulent	JJ
cord-284501-5i0w74q4	196	21	in	in	IN
cord-284501-5i0w74q4	196	22	chickens	chicken	NNS
cord-284501-5i0w74q4	196	23	[	[	-LRB-
cord-284501-5i0w74q4	196	24	26	26	CD
cord-284501-5i0w74q4	196	25	]	]	-RRB-
cord-284501-5i0w74q4	196	26	.	.	.
cord-284501-5i0w74q4	197	1	The	the	DT
cord-284501-5i0w74q4	197	2	objective	objective	NN
cord-284501-5i0w74q4	197	3	of	of	IN
cord-284501-5i0w74q4	197	4	this	this	DT
cord-284501-5i0w74q4	197	5	study	study	NN
cord-284501-5i0w74q4	197	6	was	be	VBD
cord-284501-5i0w74q4	197	7	to	to	TO
cord-284501-5i0w74q4	197	8	determine	determine	VB
cord-284501-5i0w74q4	197	9	whether	whether	IN
cord-284501-5i0w74q4	197	10	replacing	replace	VBG
cord-284501-5i0w74q4	197	11	the	the	DT
cord-284501-5i0w74q4	197	12	Beau	Beau	NNP
cord-284501-5i0w74q4	197	13	-	-	HYPH
cord-284501-5i0w74q4	197	14	R	R	NNP
cord-284501-5i0w74q4	197	15	structural	structural	JJ
cord-284501-5i0w74q4	197	16	and	and	CC
cord-284501-5i0w74q4	197	17	accessory	accessory	JJ
cord-284501-5i0w74q4	197	18	genes	gene	NNS
cord-284501-5i0w74q4	197	19	with	with	IN
cord-284501-5i0w74q4	197	20	those	those	DT
cord-284501-5i0w74q4	197	21	from	from	IN
cord-284501-5i0w74q4	197	22	virulent	virulent	JJ
cord-284501-5i0w74q4	197	23	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	197	24	would	would	MD
cord-284501-5i0w74q4	197	25	result	result	VB
cord-284501-5i0w74q4	197	26	in	in	IN
cord-284501-5i0w74q4	197	27	a	a	DT
cord-284501-5i0w74q4	197	28	rIBV	ribv	NN
cord-284501-5i0w74q4	197	29	that	that	WDT
cord-284501-5i0w74q4	197	30	was	be	VBD
cord-284501-5i0w74q4	197	31	virulent	virulent	JJ
cord-284501-5i0w74q4	197	32	when	when	WRB
cord-284501-5i0w74q4	197	33	compared	compare	VBN
cord-284501-5i0w74q4	197	34	to	to	IN
cord-284501-5i0w74q4	198	1	Beau	Beau	NNP
cord-284501-5i0w74q4	198	2	-	-	HYPH
cord-284501-5i0w74q4	198	3	R.	R.	NNP
cord-284501-5i0w74q4	198	4	We	-PRON-	PRP
cord-284501-5i0w74q4	198	5	have	have	VBP
cord-284501-5i0w74q4	198	6	used	use	VBN
cord-284501-5i0w74q4	198	7	our	-PRON-	PRP$
cord-284501-5i0w74q4	198	8	IBV	IBV	NNP
cord-284501-5i0w74q4	198	9	reverse	reverse	JJ
cord-284501-5i0w74q4	198	10	genetics	genetics	NN
cord-284501-5i0w74q4	198	11	system	system	NN
cord-284501-5i0w74q4	198	12	[	[	-LRB-
cord-284501-5i0w74q4	198	13	24	24	CD
cord-284501-5i0w74q4	198	14	,	,	,
cord-284501-5i0w74q4	198	15	25	25	CD
cord-284501-5i0w74q4	198	16	,	,	,
cord-284501-5i0w74q4	198	17	35	35	CD
cord-284501-5i0w74q4	198	18	]	]	-RRB-
cord-284501-5i0w74q4	198	19	to	to	TO
cord-284501-5i0w74q4	198	20	produce	produce	VB
cord-284501-5i0w74q4	198	21	chimaeric	chimaeric	JJ
cord-284501-5i0w74q4	198	22	IBV	IBV	NNP
cord-284501-5i0w74q4	198	23	,	,	,
cord-284501-5i0w74q4	198	24	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	198	25	-	-	HYPH
cord-284501-5i0w74q4	198	26	Rep	rep	NN
cord-284501-5i0w74q4	198	27	-	-	HYPH
cord-284501-5i0w74q4	198	28	M41-Struct	M41-Struct	NNP
cord-284501-5i0w74q4	198	29	,	,	,
cord-284501-5i0w74q4	198	30	consisting	consist	VBG
cord-284501-5i0w74q4	198	31	of	of	IN
cord-284501-5i0w74q4	198	32	the	the	DT
cord-284501-5i0w74q4	198	33	replicase	replicase	NN
cord-284501-5i0w74q4	198	34	gene	gene	NN
cord-284501-5i0w74q4	198	35	from	from	IN
cord-284501-5i0w74q4	198	36	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	198	37	(	(	-LRB-
cord-284501-5i0w74q4	198	38	Beau	Beau	NNP
cord-284501-5i0w74q4	198	39	-	-	HYPH
cord-284501-5i0w74q4	198	40	R	R	NNP
cord-284501-5i0w74q4	198	41	)	)	-RRB-
cord-284501-5i0w74q4	198	42	and	and	CC
cord-284501-5i0w74q4	198	43	the	the	DT
cord-284501-5i0w74q4	198	44	S	S	NNP
cord-284501-5i0w74q4	198	45	,	,	,
cord-284501-5i0w74q4	198	46	3a	3a	NNP
cord-284501-5i0w74q4	198	47	,	,	,
cord-284501-5i0w74q4	198	48	3b	3b	NNP
cord-284501-5i0w74q4	198	49	,	,	,
cord-284501-5i0w74q4	198	50	E	E	NNP
cord-284501-5i0w74q4	198	51	,	,	,
cord-284501-5i0w74q4	198	52	M	M	NNP
cord-284501-5i0w74q4	198	53	,	,	,
cord-284501-5i0w74q4	198	54	5a	5a	CD
cord-284501-5i0w74q4	198	55	,	,	,
cord-284501-5i0w74q4	198	56	5b	5b	NN
cord-284501-5i0w74q4	198	57	,	,	,
cord-284501-5i0w74q4	198	58	N	n	CD
cord-284501-5i0w74q4	198	59	and	and	CC
cord-284501-5i0w74q4	198	60	the	the	DT
cord-284501-5i0w74q4	198	61	39-UTR	39-utr	CD
cord-284501-5i0w74q4	198	62	from	from	IN
cord-284501-5i0w74q4	198	63	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	198	64	.	.	.
cord-284501-5i0w74q4	199	1	The	the	DT
cord-284501-5i0w74q4	199	2	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	199	3	-	-	HYPH
cord-284501-5i0w74q4	199	4	derived	derive	VBN
cord-284501-5i0w74q4	199	5	structural	structural	JJ
cord-284501-5i0w74q4	199	6	and	and	CC
cord-284501-5i0w74q4	199	7	accessory	accessory	NN
cord-284501-5i0w74q4	199	8	gene	gene	NN
cord-284501-5i0w74q4	199	9	sequence	sequence	NN
cord-284501-5i0w74q4	199	10	was	be	VBD
cord-284501-5i0w74q4	199	11	fused	fuse	VBN
cord-284501-5i0w74q4	199	12	to	to	IN
cord-284501-5i0w74q4	199	13	the	the	DT
cord-284501-5i0w74q4	199	14	Beau	Beau	NNP
cord-284501-5i0w74q4	199	15	-	-	HYPH
cord-284501-5i0w74q4	199	16	R	R	NNP
cord-284501-5i0w74q4	199	17	replicase	replicase	NN
cord-284501-5i0w74q4	199	18	by	by	IN
cord-284501-5i0w74q4	199	19	homologous	homologous	JJ
cord-284501-5i0w74q4	199	20	recombination	recombination	NN
cord-284501-5i0w74q4	199	21	using	use	VBG
cord-284501-5i0w74q4	199	22	the	the	DT
cord-284501-5i0w74q4	199	23	TDS	TDS	NNP
cord-284501-5i0w74q4	199	24	method	method	NN
cord-284501-5i0w74q4	199	25	[	[	-LRB-
cord-284501-5i0w74q4	199	26	25	25	CD
cord-284501-5i0w74q4	199	27	,	,	,
cord-284501-5i0w74q4	199	28	37	37	CD
cord-284501-5i0w74q4	199	29	]	]	-RRB-
cord-284501-5i0w74q4	199	30	and	and	CC
cord-284501-5i0w74q4	199	31	rIBVs	rIBVs	NNP
cord-284501-5i0w74q4	199	32	were	be	VBD
cord-284501-5i0w74q4	199	33	rescued	rescue	VBN
cord-284501-5i0w74q4	199	34	in	in	IN
cord-284501-5i0w74q4	199	35	CKCs	ckc	NNS
cord-284501-5i0w74q4	199	36	.	.	.
cord-284501-5i0w74q4	200	1	The	the	DT
cord-284501-5i0w74q4	200	2	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	200	3	-	-	HYPH
cord-284501-5i0w74q4	200	4	derived	derive	VBN
cord-284501-5i0w74q4	200	5	region	region	NN
cord-284501-5i0w74q4	200	6	,	,	,
cord-284501-5i0w74q4	200	7	in	in	IN
cord-284501-5i0w74q4	200	8	addition	addition	NN
cord-284501-5i0w74q4	200	9	to	to	IN
cord-284501-5i0w74q4	200	10	the	the	DT
cord-284501-5i0w74q4	200	11	structural	structural	JJ
cord-284501-5i0w74q4	200	12	and	and	CC
cord-284501-5i0w74q4	200	13	accessory	accessory	JJ
cord-284501-5i0w74q4	200	14	genes	gene	NNS
cord-284501-5i0w74q4	200	15	in	in	IN
cord-284501-5i0w74q4	200	16	common	common	JJ
cord-284501-5i0w74q4	200	17	with	with	IN
cord-284501-5i0w74q4	200	18	Beau	Beau	NNP
cord-284501-5i0w74q4	200	19	-	-	HYPH
cord-284501-5i0w74q4	200	20	R	R	NNP
cord-284501-5i0w74q4	200	21	,	,	,
cord-284501-5i0w74q4	200	22	also	also	RB
cord-284501-5i0w74q4	200	23	contains	contain	VBZ
cord-284501-5i0w74q4	200	24	an	an	DT
cord-284501-5i0w74q4	200	25	untranslated	untranslated	JJ
cord-284501-5i0w74q4	200	26	region	region	NN
cord-284501-5i0w74q4	200	27	,	,	,
cord-284501-5i0w74q4	200	28	the	the	DT
cord-284501-5i0w74q4	200	29	intergenic	intergenic	JJ
cord-284501-5i0w74q4	200	30	untranslated	untranslated	JJ
cord-284501-5i0w74q4	200	31	region	region	NN
cord-284501-5i0w74q4	200	32	(	(	-LRB-
cord-284501-5i0w74q4	200	33	IGR	IGR	NNP
cord-284501-5i0w74q4	200	34	)	)	-RRB-
cord-284501-5i0w74q4	200	35	,	,	,
cord-284501-5i0w74q4	200	36	between	between	IN
cord-284501-5i0w74q4	200	37	the	the	DT
cord-284501-5i0w74q4	200	38	M	M	NNP
cord-284501-5i0w74q4	200	39	and	and	CC
cord-284501-5i0w74q4	200	40	gene	gene	NN
cord-284501-5i0w74q4	200	41	5	5	CD
cord-284501-5i0w74q4	200	42	,	,	,
cord-284501-5i0w74q4	200	43	which	which	WDT
cord-284501-5i0w74q4	200	44	is	be	VBZ
cord-284501-5i0w74q4	200	45	305	305	CD
cord-284501-5i0w74q4	200	46	nt	nt	RB
cord-284501-5i0w74q4	200	47	in	in	IN
cord-284501-5i0w74q4	200	48	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	200	49	and	and	CC
cord-284501-5i0w74q4	200	50	350	350	CD
cord-284501-5i0w74q4	200	51	nt	nt	NN
cord-284501-5i0w74q4	200	52	in	in	IN
cord-284501-5i0w74q4	200	53	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	200	54	.	.	.
cord-284501-5i0w74q4	201	1	The	the	DT
cord-284501-5i0w74q4	201	2	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	201	3	IGR	IGR	NNP
cord-284501-5i0w74q4	201	4	,	,	,
cord-284501-5i0w74q4	201	5	like	like	IN
cord-284501-5i0w74q4	201	6	some	some	DT
cord-284501-5i0w74q4	201	7	other	other	JJ
cord-284501-5i0w74q4	201	8	strains	strain	NNS
cord-284501-5i0w74q4	201	9	of	of	IN
cord-284501-5i0w74q4	201	10	IBV	IBV	NNP
cord-284501-5i0w74q4	201	11	,	,	,
cord-284501-5i0w74q4	201	12	contains	contain	VBZ
cord-284501-5i0w74q4	201	13	a	a	DT
cord-284501-5i0w74q4	201	14	potential	potential	JJ
cord-284501-5i0w74q4	201	15	open	open	JJ
cord-284501-5i0w74q4	201	16	reading	reading	NN
cord-284501-5i0w74q4	201	17	frame	frame	NN
cord-284501-5i0w74q4	201	18	(	(	-LRB-
cord-284501-5i0w74q4	201	19	ORF	ORF	NNP
cord-284501-5i0w74q4	201	20	)	)	-RRB-
cord-284501-5i0w74q4	201	21	of	of	IN
cord-284501-5i0w74q4	201	22	285	285	CD
cord-284501-5i0w74q4	201	23	nt	nt	RB
cord-284501-5i0w74q4	201	24	potentially	potentially	RB
cord-284501-5i0w74q4	201	25	encoding	encode	VBG
cord-284501-5i0w74q4	201	26	a	a	DT
cord-284501-5i0w74q4	201	27	94	94	CD
cord-284501-5i0w74q4	201	28	amino	amino	NN
cord-284501-5i0w74q4	201	29	acid	acid	NN
cord-284501-5i0w74q4	201	30	product	product	NN
cord-284501-5i0w74q4	201	31	of	of	IN
cord-284501-5i0w74q4	201	32	11	11	CD
cord-284501-5i0w74q4	201	33	kD	kd	ADD
cord-284501-5i0w74q4	201	34	with	with	IN
cord-284501-5i0w74q4	201	35	the	the	DT
cord-284501-5i0w74q4	201	36	initiation	initiation	NN
cord-284501-5i0w74q4	201	37	codon	codon	NN
cord-284501-5i0w74q4	201	38	immediately	immediately	RB
cord-284501-5i0w74q4	201	39	downstream	downstream	RB
cord-284501-5i0w74q4	201	40	of	of	IN
cord-284501-5i0w74q4	201	41	the	the	DT
cord-284501-5i0w74q4	201	42	M	M	NNP
cord-284501-5i0w74q4	201	43	gene	gene	NN
cord-284501-5i0w74q4	201	44	stop	stop	NN
cord-284501-5i0w74q4	201	45	codon	codon	NNP
cord-284501-5i0w74q4	201	46	.	.	.
cord-284501-5i0w74q4	202	1	A	a	DT
cord-284501-5i0w74q4	202	2	similar	similar	JJ
cord-284501-5i0w74q4	202	3	ORF	ORF	NNP
cord-284501-5i0w74q4	202	4	has	have	VBZ
cord-284501-5i0w74q4	202	5	been	be	VBN
cord-284501-5i0w74q4	202	6	identified	identify	VBN
cord-284501-5i0w74q4	202	7	at	at	IN
cord-284501-5i0w74q4	202	8	a	a	DT
cord-284501-5i0w74q4	202	9	similar	similar	JJ
cord-284501-5i0w74q4	202	10	position	position	NN
cord-284501-5i0w74q4	202	11	in	in	IN
cord-284501-5i0w74q4	202	12	the	the	DT
cord-284501-5i0w74q4	202	13	genome	genome	NN
cord-284501-5i0w74q4	202	14	of	of	IN
cord-284501-5i0w74q4	202	15	turkey	turkey	NN
cord-284501-5i0w74q4	202	16	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	202	17	(	(	-LRB-
cord-284501-5i0w74q4	202	18	TCoV	TCoV	NNP
cord-284501-5i0w74q4	202	19	)	)	-RRB-
cord-284501-5i0w74q4	202	20	[	[	-LRB-
cord-284501-5i0w74q4	202	21	5	5	CD
cord-284501-5i0w74q4	202	22	,	,	,
cord-284501-5i0w74q4	202	23	6	6	CD
cord-284501-5i0w74q4	202	24	]	]	-RRB-
cord-284501-5i0w74q4	202	25	,	,	,
cord-284501-5i0w74q4	202	26	the	the	DT
cord-284501-5i0w74q4	202	27	only	only	JJ
cord-284501-5i0w74q4	202	28	TRS	TRS	NNP
cord-284501-5i0w74q4	202	29	identified	identify	VBN
cord-284501-5i0w74q4	202	30	for	for	IN
cord-284501-5i0w74q4	202	31	TCoV	TCoV	NNP
cord-284501-5i0w74q4	202	32	is	be	VBZ
cord-284501-5i0w74q4	202	33	288	288	CD
cord-284501-5i0w74q4	202	34	nt	nt	RB
cord-284501-5i0w74q4	202	35	upstream	upstream	RB
cord-284501-5i0w74q4	202	36	of	of	IN
cord-284501-5i0w74q4	202	37	the	the	DT
cord-284501-5i0w74q4	202	38	potential	potential	JJ
cord-284501-5i0w74q4	202	39	ORF	ORF	NNP
cord-284501-5i0w74q4	202	40	,	,	,
cord-284501-5i0w74q4	202	41	within	within	IN
cord-284501-5i0w74q4	202	42	the	the	DT
cord-284501-5i0w74q4	202	43	M	M	NNP
cord-284501-5i0w74q4	202	44	gene	gene	NN
cord-284501-5i0w74q4	202	45	,	,	,
cord-284501-5i0w74q4	202	46	but	but	CC
cord-284501-5i0w74q4	202	47	with	with	IN
cord-284501-5i0w74q4	202	48	low	low	JJ
cord-284501-5i0w74q4	202	49	identity	identity	NN
cord-284501-5i0w74q4	202	50	to	to	IN
cord-284501-5i0w74q4	202	51	the	the	DT
cord-284501-5i0w74q4	202	52	TCoV	tcov	CD
cord-284501-5i0w74q4	202	53	canonical	canonical	JJ
cord-284501-5i0w74q4	202	54	TRS	TRS	NNP
cord-284501-5i0w74q4	202	55	.	.	.
cord-284501-5i0w74q4	203	1	No	no	DT
cord-284501-5i0w74q4	203	2	sg	sg	NNP
cord-284501-5i0w74q4	203	3	mRNA	mRNA	NNP
cord-284501-5i0w74q4	203	4	for	for	IN
cord-284501-5i0w74q4	203	5	this	this	DT
cord-284501-5i0w74q4	203	6	potential	potential	JJ
cord-284501-5i0w74q4	203	7	ORF	ORF	NNP
cord-284501-5i0w74q4	203	8	has	have	VBZ
cord-284501-5i0w74q4	203	9	been	be	VBN
cord-284501-5i0w74q4	203	10	identified	identify	VBN
cord-284501-5i0w74q4	203	11	in	in	IN
cord-284501-5i0w74q4	203	12	TCoV	TCoV	NNP
cord-284501-5i0w74q4	203	13	or	or	CC
cord-284501-5i0w74q4	203	14	IBV	IBV	NNP
cord-284501-5i0w74q4	203	15	,	,	,
cord-284501-5i0w74q4	203	16	including	include	VBG
cord-284501-5i0w74q4	203	17	M41-CK	m41-ck	CD
cord-284501-5i0w74q4	203	18	,	,	,
cord-284501-5i0w74q4	203	19	infected	infected	JJ
cord-284501-5i0w74q4	203	20	cells	cell	NNS
cord-284501-5i0w74q4	203	21	.	.	.
cord-284501-5i0w74q4	204	1	The	the	DT
cord-284501-5i0w74q4	204	2	lack	lack	NN
cord-284501-5i0w74q4	204	3	of	of	IN
cord-284501-5i0w74q4	204	4	a	a	DT
cord-284501-5i0w74q4	204	5	sg	sg	NNP
cord-284501-5i0w74q4	204	6	mRNA	mRNA	NNP
cord-284501-5i0w74q4	204	7	,	,	,
cord-284501-5i0w74q4	204	8	the	the	DT
cord-284501-5i0w74q4	204	9	long	long	JJ
cord-284501-5i0w74q4	204	10	distance	distance	NN
cord-284501-5i0w74q4	204	11	between	between	IN
cord-284501-5i0w74q4	204	12	the	the	DT
cord-284501-5i0w74q4	204	13	initiation	initiation	NN
cord-284501-5i0w74q4	204	14	codon	codon	NN
cord-284501-5i0w74q4	204	15	and	and	CC
cord-284501-5i0w74q4	204	16	a	a	DT
cord-284501-5i0w74q4	204	17	potential	potential	JJ
cord-284501-5i0w74q4	204	18	TRS	trs	NN
cord-284501-5i0w74q4	204	19	and	and	CC
cord-284501-5i0w74q4	204	20	the	the	DT
cord-284501-5i0w74q4	204	21	loss	loss	NN
cord-284501-5i0w74q4	204	22	of	of	IN
cord-284501-5i0w74q4	204	23	the	the	DT
cord-284501-5i0w74q4	204	24	potential	potential	JJ
cord-284501-5i0w74q4	204	25	ORF	ORF	NNP
cord-284501-5i0w74q4	204	26	,	,	,
cord-284501-5i0w74q4	204	27	as	as	IN
cord-284501-5i0w74q4	204	28	a	a	DT
cord-284501-5i0w74q4	204	29	result	result	NN
cord-284501-5i0w74q4	204	30	of	of	IN
cord-284501-5i0w74q4	204	31	several	several	JJ
cord-284501-5i0w74q4	204	32	deletions	deletion	NNS
cord-284501-5i0w74q4	204	33	,	,	,
cord-284501-5i0w74q4	204	34	in	in	IN
cord-284501-5i0w74q4	204	35	some	some	DT
cord-284501-5i0w74q4	204	36	strains	strain	NNS
cord-284501-5i0w74q4	204	37	of	of	IN
cord-284501-5i0w74q4	204	38	IBV	IBV	NNP
cord-284501-5i0w74q4	204	39	indicates	indicate	VBZ
cord-284501-5i0w74q4	204	40	that	that	IN
cord-284501-5i0w74q4	204	41	the	the	DT
cord-284501-5i0w74q4	204	42	ORF	ORF	NNP
cord-284501-5i0w74q4	204	43	is	be	VBZ
cord-284501-5i0w74q4	204	44	probably	probably	RB
cord-284501-5i0w74q4	204	45	a	a	DT
cord-284501-5i0w74q4	204	46	pseudogene	pseudogene	NN
cord-284501-5i0w74q4	204	47	.	.	.
cord-284501-5i0w74q4	205	1	Two	two	CD
cord-284501-5i0w74q4	205	2	rIBVs	ribv	NNS
cord-284501-5i0w74q4	205	3	,	,	,
cord-284501-5i0w74q4	205	4	rBeauR	rbeaur	NN
cord-284501-5i0w74q4	205	5	-	-	HYPH
cord-284501-5i0w74q4	205	6	Rep	Rep	NNP
cord-284501-5i0w74q4	205	7	-	-	HYPH
cord-284501-5i0w74q4	205	8	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	205	9	and	and	CC
cord-284501-5i0w74q4	205	10	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	205	11	-	-	HYPH
cord-284501-5i0w74q4	205	12	Rep	rep	NN
cord-284501-5i0w74q4	205	13	-	-	HYPH
cord-284501-5i0w74q4	205	14	M41-Struct-12	M41-Struct-12	NNP
cord-284501-5i0w74q4	205	15	,	,	,
cord-284501-5i0w74q4	205	16	were	be	VBD
cord-284501-5i0w74q4	205	17	rescued	rescue	VBN
cord-284501-5i0w74q4	205	18	from	from	IN
cord-284501-5i0w74q4	205	19	the	the	DT
cord-284501-5i0w74q4	205	20	rVVs	rvvs	NN
cord-284501-5i0w74q4	205	21	,	,	,
cord-284501-5i0w74q4	205	22	rVV	rVV	NNP
cord-284501-5i0w74q4	205	23	-	-	HYPH
cord-284501-5i0w74q4	205	24	BeauR	BeauR	NNP
cord-284501-5i0w74q4	205	25	-	-	HYPH
cord-284501-5i0w74q4	205	26	Rep	Rep	NNP
cord-284501-5i0w74q4	205	27	-	-	HYPH
cord-284501-5i0w74q4	205	28	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	205	29	and	and	CC
cord-284501-5i0w74q4	205	30	rVV	rvv	NN
cord-284501-5i0w74q4	205	31	-	-	HYPH
cord-284501-5i0w74q4	205	32	BeauR	BeauR	NNP
cord-284501-5i0w74q4	205	33	-	-	HYPH
cord-284501-5i0w74q4	205	34	Rep	Rep	NNP
cord-284501-5i0w74q4	205	35	-	-	HYPH
cord-284501-5i0w74q4	205	36	M41-Struct-12	M41-Struct-12	NNP
cord-284501-5i0w74q4	205	37	,	,	,
cord-284501-5i0w74q4	205	38	respectively	respectively	RB
cord-284501-5i0w74q4	205	39	,	,	,
cord-284501-5i0w74q4	205	40	and	and	CC
cord-284501-5i0w74q4	205	41	analysed	analyse	VBD
cord-284501-5i0w74q4	205	42	for	for	IN
cord-284501-5i0w74q4	205	43	the	the	DT
cord-284501-5i0w74q4	205	44	presence	presence	NN
cord-284501-5i0w74q4	205	45	of	of	IN
cord-284501-5i0w74q4	205	46	the	the	DT
cord-284501-5i0w74q4	205	47	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	205	48	-	-	HYPH
cord-284501-5i0w74q4	205	49	derived	derive	VBN
cord-284501-5i0w74q4	205	50	sequence	sequence	NN
cord-284501-5i0w74q4	205	51	.	.	.
cord-284501-5i0w74q4	206	1	Analysis	analysis	NN
cord-284501-5i0w74q4	206	2	of	of	IN
cord-284501-5i0w74q4	206	3	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	206	4	-	-	HYPH
cord-284501-5i0w74q4	206	5	Rep	Rep	NNP
cord-284501-5i0w74q4	206	6	-	-	HYPH
cord-284501-5i0w74q4	206	7	M41-Struct-12	M41-Struct-12	NNP
cord-284501-5i0w74q4	206	8	identified	identify	VBD
cord-284501-5i0w74q4	206	9	an	an	DT
cord-284501-5i0w74q4	206	10	extra	extra	JJ
cord-284501-5i0w74q4	206	11	adenosine	adenosine	NN
cord-284501-5i0w74q4	206	12	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	206	13	at	at	IN
cord-284501-5i0w74q4	206	14	position	position	NN
cord-284501-5i0w74q4	206	15	25317	25317	CD
cord-284501-5i0w74q4	206	16	in	in	IN
cord-284501-5i0w74q4	206	17	a	a	DT
cord-284501-5i0w74q4	206	18	six	six	CD
cord-284501-5i0w74q4	206	19	base	base	NN
cord-284501-5i0w74q4	206	20	polyadenosine	polyadenosine	NN
cord-284501-5i0w74q4	206	21	repeat	repeat	NN
cord-284501-5i0w74q4	206	22	sequence	sequence	NN
cord-284501-5i0w74q4	206	23	within	within	IN
cord-284501-5i0w74q4	206	24	the	the	DT
cord-284501-5i0w74q4	206	25	potential	potential	JJ
cord-284501-5i0w74q4	206	26	11.5	11.5	CD
cord-284501-5i0w74q4	206	27	kD	kd	JJ
cord-284501-5i0w74q4	206	28	ORF	ORF	NNP
cord-284501-5i0w74q4	206	29	in	in	IN
cord-284501-5i0w74q4	206	30	the	the	DT
cord-284501-5i0w74q4	206	31	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	206	32	IGR	IGR	NNP
cord-284501-5i0w74q4	206	33	,	,	,
cord-284501-5i0w74q4	206	34	which	which	WDT
cord-284501-5i0w74q4	206	35	had	have	VBD
cord-284501-5i0w74q4	206	36	the	the	DT
cord-284501-5i0w74q4	206	37	potential	potential	NN
cord-284501-5i0w74q4	206	38	for	for	IN
cord-284501-5i0w74q4	206	39	inactivating	inactivate	VBG
cord-284501-5i0w74q4	206	40	this	this	DT
cord-284501-5i0w74q4	206	41	potential	potential	JJ
cord-284501-5i0w74q4	206	42	gene	gene	NN
cord-284501-5i0w74q4	206	43	product	product	NN
cord-284501-5i0w74q4	206	44	.	.	.
cord-284501-5i0w74q4	207	1	To	to	TO
cord-284501-5i0w74q4	207	2	rule	rule	VB
cord-284501-5i0w74q4	207	3	out	out	RP
cord-284501-5i0w74q4	207	4	the	the	DT
cord-284501-5i0w74q4	207	5	possibility	possibility	NN
cord-284501-5i0w74q4	207	6	that	that	IN
cord-284501-5i0w74q4	207	7	the	the	DT
cord-284501-5i0w74q4	207	8	loss	loss	NN
cord-284501-5i0w74q4	207	9	of	of	IN
cord-284501-5i0w74q4	207	10	this	this	DT
cord-284501-5i0w74q4	207	11	potential	potential	JJ
cord-284501-5i0w74q4	207	12	gene	gene	NN
cord-284501-5i0w74q4	207	13	product	product	NN
cord-284501-5i0w74q4	207	14	could	could	MD
cord-284501-5i0w74q4	207	15	affect	affect	VB
cord-284501-5i0w74q4	207	16	any	any	DT
cord-284501-5i0w74q4	207	17	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	207	18	of	of	IN
cord-284501-5i0w74q4	207	19	this	this	DT
cord-284501-5i0w74q4	207	20	virus	virus	NN
cord-284501-5i0w74q4	207	21	we	-PRON-	PRP
cord-284501-5i0w74q4	207	22	decided	decide	VBD
cord-284501-5i0w74q4	207	23	to	to	TO
cord-284501-5i0w74q4	207	24	proceed	proceed	VB
cord-284501-5i0w74q4	207	25	with	with	IN
cord-284501-5i0w74q4	207	26	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	207	27	-	-	HYPH
cord-284501-5i0w74q4	207	28	Rep	Rep	NNP
cord-284501-5i0w74q4	207	29	-	-	HYPH
cord-284501-5i0w74q4	207	30	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	207	31	,	,	,
cord-284501-5i0w74q4	207	32	which	which	WDT
cord-284501-5i0w74q4	207	33	had	have	VBD
cord-284501-5i0w74q4	207	34	the	the	DT
cord-284501-5i0w74q4	207	35	correct	correct	JJ
cord-284501-5i0w74q4	207	36	sequence	sequence	NN
cord-284501-5i0w74q4	207	37	,	,	,
cord-284501-5i0w74q4	207	38	for	for	IN
cord-284501-5i0w74q4	207	39	subsequent	subsequent	JJ
cord-284501-5i0w74q4	207	40	experiments	experiment	NNS
cord-284501-5i0w74q4	207	41	.	.	.
cord-284501-5i0w74q4	208	1	We	-PRON-	PRP
cord-284501-5i0w74q4	208	2	have	have	VBP
cord-284501-5i0w74q4	208	3	characterised	characterise	VBN
cord-284501-5i0w74q4	208	4	rBeauR	rbeaur	XX
cord-284501-5i0w74q4	209	1	-Rep	-rep	LS
cord-284501-5i0w74q4	209	2	-	-	:
cord-284501-5i0w74q4	209	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	209	4	3	3	CD
cord-284501-5i0w74q4	209	5	in	in	IN
cord-284501-5i0w74q4	209	6	vitro	vitro	FW
cord-284501-5i0w74q4	209	7	,	,	,
cord-284501-5i0w74q4	209	8	ex	ex	NN
cord-284501-5i0w74q4	209	9	vivo	vivo	NN
cord-284501-5i0w74q4	209	10	and	and	CC
cord-284501-5i0w74q4	209	11	tested	test	VBD
cord-284501-5i0w74q4	209	12	its	-PRON-	PRP$
cord-284501-5i0w74q4	209	13	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	209	14	in	in	IN
cord-284501-5i0w74q4	209	15	vivo	vivo	NN
cord-284501-5i0w74q4	209	16	using	use	VBG
cord-284501-5i0w74q4	209	17	one	one	CD
cord-284501-5i0w74q4	209	18	-	-	HYPH
cord-284501-5i0w74q4	209	19	day	day	NN
cord-284501-5i0w74q4	209	20	-	-	HYPH
cord-284501-5i0w74q4	209	21	old	old	JJ
cord-284501-5i0w74q4	209	22	-	-	HYPH
cord-284501-5i0w74q4	209	23	chickens	chicken	NNS
cord-284501-5i0w74q4	209	24	.	.	.
cord-284501-5i0w74q4	210	1	The	the	DT
cord-284501-5i0w74q4	210	2	overall	overall	JJ
cord-284501-5i0w74q4	210	3	growth	growth	NN
cord-284501-5i0w74q4	210	4	pattern	pattern	NN
cord-284501-5i0w74q4	210	5	of	of	IN
cord-284501-5i0w74q4	210	6	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	210	7	-	-	HYPH
cord-284501-5i0w74q4	210	8	Rep	Rep	NNP
cord-284501-5i0w74q4	210	9	-	-	HYPH
cord-284501-5i0w74q4	210	10	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	210	11	in	in	IN
cord-284501-5i0w74q4	210	12	CKCs	ckc	NNS
cord-284501-5i0w74q4	210	13	was	be	VBD
cord-284501-5i0w74q4	210	14	more	more	RBR
cord-284501-5i0w74q4	210	15	similar	similar	JJ
cord-284501-5i0w74q4	210	16	to	to	IN
cord-284501-5i0w74q4	210	17	that	that	DT
cord-284501-5i0w74q4	210	18	of	of	IN
cord-284501-5i0w74q4	210	19	Beau	Beau	NNP
cord-284501-5i0w74q4	210	20	-	-	HYPH
cord-284501-5i0w74q4	210	21	R	R	NNP
cord-284501-5i0w74q4	210	22	(	(	-LRB-
cord-284501-5i0w74q4	210	23	Fig	fig	NN
cord-284501-5i0w74q4	210	24	.	.	NNP
cord-284501-5i0w74q4	210	25	2	2	LS
cord-284501-5i0w74q4	210	26	)	)	-RRB-
cord-284501-5i0w74q4	210	27	except	except	IN
cord-284501-5i0w74q4	210	28	it	-PRON-	PRP
cord-284501-5i0w74q4	210	29	grew	grow	VBD
cord-284501-5i0w74q4	210	30	to	to	IN
cord-284501-5i0w74q4	210	31	a	a	DT
cord-284501-5i0w74q4	210	32	titre	titre	NN
cord-284501-5i0w74q4	210	33	of	of	IN
cord-284501-5i0w74q4	210	34	about	about	RB
cord-284501-5i0w74q4	210	35	1	1	CD
cord-284501-5i0w74q4	210	36	log	log	VBP
cord-284501-5i0w74q4	210	37	10	10	CD
cord-284501-5i0w74q4	210	38	less	less	JJR
cord-284501-5i0w74q4	210	39	throughout	throughout	IN
cord-284501-5i0w74q4	210	40	the	the	DT
cord-284501-5i0w74q4	210	41	growth	growth	NN
cord-284501-5i0w74q4	210	42	cycle	cycle	NN
cord-284501-5i0w74q4	210	43	.	.	.
cord-284501-5i0w74q4	211	1	The	the	DT
cord-284501-5i0w74q4	211	2	main	main	JJ
cord-284501-5i0w74q4	211	3	objective	objective	NN
cord-284501-5i0w74q4	211	4	of	of	IN
cord-284501-5i0w74q4	211	5	this	this	DT
cord-284501-5i0w74q4	211	6	study	study	NN
cord-284501-5i0w74q4	211	7	was	be	VBD
cord-284501-5i0w74q4	211	8	to	to	TO
cord-284501-5i0w74q4	211	9	determine	determine	VB
cord-284501-5i0w74q4	211	10	whether	whether	IN
cord-284501-5i0w74q4	211	11	swapping	swapping	NN
cord-284501-5i0w74q4	211	12	of	of	IN
cord-284501-5i0w74q4	211	13	the	the	DT
cord-284501-5i0w74q4	211	14	structural	structural	JJ
cord-284501-5i0w74q4	211	15	and	and	CC
cord-284501-5i0w74q4	211	16	accessory	accessory	NN
cord-284501-5i0w74q4	211	17	genes	gene	NNS
cord-284501-5i0w74q4	211	18	would	would	MD
cord-284501-5i0w74q4	211	19	restore	restore	VB
cord-284501-5i0w74q4	211	20	virulence	virulence	NN
cord-284501-5i0w74q4	211	21	.	.	.
cord-284501-5i0w74q4	212	1	To	to	IN
cord-284501-5i0w74q4	212	2	this	this	DT
cord-284501-5i0w74q4	212	3	effect	effect	NN
cord-284501-5i0w74q4	212	4	we	-PRON-	PRP
cord-284501-5i0w74q4	212	5	used	use	VBD
cord-284501-5i0w74q4	212	6	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	212	7	-	-	HYPH
cord-284501-5i0w74q4	212	8	Rep	rep	NN
cord-284501-5i0w74q4	212	9	-	-	HYPH
cord-284501-5i0w74q4	212	10	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	212	11	to	to	TO
cord-284501-5i0w74q4	212	12	infect	infect	VB
cord-284501-5i0w74q4	212	13	one	one	CD
cord-284501-5i0w74q4	212	14	-	-	HYPH
cord-284501-5i0w74q4	212	15	day	day	NN
cord-284501-5i0w74q4	212	16	-	-	HYPH
cord-284501-5i0w74q4	212	17	old	old	JJ
cord-284501-5i0w74q4	212	18	chicks	chick	NNS
cord-284501-5i0w74q4	212	19	,	,	,
cord-284501-5i0w74q4	212	20	and	and	CC
cord-284501-5i0w74q4	212	21	used	use	VBD
cord-284501-5i0w74q4	212	22	clinical	clinical	JJ
cord-284501-5i0w74q4	212	23	signs	sign	NNS
cord-284501-5i0w74q4	212	24	and	and	CC
cord-284501-5i0w74q4	212	25	measurement	measurement	NN
cord-284501-5i0w74q4	212	26	of	of	IN
cord-284501-5i0w74q4	212	27	the	the	DT
cord-284501-5i0w74q4	212	28	ciliary	ciliary	NN
cord-284501-5i0w74q4	212	29	activity	activity	NN
cord-284501-5i0w74q4	212	30	of	of	IN
cord-284501-5i0w74q4	212	31	the	the	DT
cord-284501-5i0w74q4	212	32	epithelial	epithelial	JJ
cord-284501-5i0w74q4	212	33	cells	cell	NNS
cord-284501-5i0w74q4	212	34	lining	line	VBG
cord-284501-5i0w74q4	212	35	the	the	DT
cord-284501-5i0w74q4	212	36	trachea	trachea	NN
cord-284501-5i0w74q4	212	37	of	of	IN
cord-284501-5i0w74q4	212	38	the	the	DT
cord-284501-5i0w74q4	212	39	infected	infected	JJ
cord-284501-5i0w74q4	212	40	chickens	chicken	NNS
cord-284501-5i0w74q4	212	41	to	to	TO
cord-284501-5i0w74q4	212	42	assess	assess	VB
cord-284501-5i0w74q4	212	43	any	any	DT
cord-284501-5i0w74q4	212	44	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	212	45	associated	associate	VBN
cord-284501-5i0w74q4	212	46	with	with	IN
cord-284501-5i0w74q4	212	47	the	the	DT
cord-284501-5i0w74q4	212	48	virus	virus	NN
cord-284501-5i0w74q4	212	49	.	.	.
cord-284501-5i0w74q4	213	1	No	no	DT
cord-284501-5i0w74q4	213	2	clinical	clinical	JJ
cord-284501-5i0w74q4	213	3	signs	sign	NNS
cord-284501-5i0w74q4	213	4	,	,	,
cord-284501-5i0w74q4	213	5	snicking	snicking	NN
cord-284501-5i0w74q4	213	6	,	,	,
cord-284501-5i0w74q4	213	7	wheezing	wheezing	NN
cord-284501-5i0w74q4	213	8	and	and	CC
cord-284501-5i0w74q4	213	9	nasal	nasal	NN
cord-284501-5i0w74q4	213	10	discharge	discharge	NN
cord-284501-5i0w74q4	213	11	,	,	,
cord-284501-5i0w74q4	213	12	associated	associate	VBN
cord-284501-5i0w74q4	213	13	with	with	IN
cord-284501-5i0w74q4	213	14	an	an	DT
cord-284501-5i0w74q4	213	15	IBV	IBV	NNP
cord-284501-5i0w74q4	213	16	infection	infection	NN
cord-284501-5i0w74q4	213	17	were	be	VBD
cord-284501-5i0w74q4	213	18	observed	observe	VBN
cord-284501-5i0w74q4	213	19	in	in	IN
cord-284501-5i0w74q4	213	20	the	the	DT
cord-284501-5i0w74q4	213	21	chickens	chicken	NNS
cord-284501-5i0w74q4	213	22	infected	infect	VBN
cord-284501-5i0w74q4	213	23	with	with	IN
cord-284501-5i0w74q4	213	24	either	either	CC
cord-284501-5i0w74q4	213	25	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	213	26	-	-	HYPH
cord-284501-5i0w74q4	213	27	Rep	Rep	NNP
cord-284501-5i0w74q4	213	28	-	-	HYPH
cord-284501-5i0w74q4	213	29	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	213	30	or	or	CC
cord-284501-5i0w74q4	213	31	Beau	Beau	NNP
cord-284501-5i0w74q4	213	32	-	-	HYPH
cord-284501-5i0w74q4	213	33	R	R	NNP
cord-284501-5i0w74q4	213	34	;	;	:
cord-284501-5i0w74q4	213	35	the	the	DT
cord-284501-5i0w74q4	213	36	latter	latter	JJ
cord-284501-5i0w74q4	213	37	as	as	IN
cord-284501-5i0w74q4	213	38	in	in	IN
cord-284501-5i0w74q4	213	39	previous	previous	JJ
cord-284501-5i0w74q4	213	40	experiments	experiment	NNS
cord-284501-5i0w74q4	213	41	did	do	VBD
cord-284501-5i0w74q4	213	42	not	not	RB
cord-284501-5i0w74q4	213	43	show	show	VB
cord-284501-5i0w74q4	213	44	any	any	DT
cord-284501-5i0w74q4	213	45	clinical	clinical	JJ
cord-284501-5i0w74q4	213	46	signs	sign	NNS
cord-284501-5i0w74q4	213	47	[	[	-LRB-
cord-284501-5i0w74q4	213	48	26	26	CD
cord-284501-5i0w74q4	213	49	]	]	-RRB-
cord-284501-5i0w74q4	213	50	.	.	.
cord-284501-5i0w74q4	214	1	In	in	IN
cord-284501-5i0w74q4	214	2	contrast	contrast	NN
cord-284501-5i0w74q4	214	3	,	,	,
cord-284501-5i0w74q4	214	4	chickens	chicken	NNS
cord-284501-5i0w74q4	214	5	infected	infect	VBN
cord-284501-5i0w74q4	214	6	with	with	IN
cord-284501-5i0w74q4	214	7	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	214	8	did	do	VBD
cord-284501-5i0w74q4	214	9	show	show	VB
cord-284501-5i0w74q4	214	10	clinical	clinical	JJ
cord-284501-5i0w74q4	214	11	signs	sign	NNS
cord-284501-5i0w74q4	214	12	of	of	IN
cord-284501-5i0w74q4	214	13	an	an	DT
cord-284501-5i0w74q4	214	14	IBV	IBV	NNP
cord-284501-5i0w74q4	214	15	infection	infection	NN
cord-284501-5i0w74q4	214	16	(	(	-LRB-
cord-284501-5i0w74q4	214	17	Fig	fig	NN
cord-284501-5i0w74q4	214	18	.	.	.
cord-284501-5i0w74q4	214	19	3	3	CD
cord-284501-5i0w74q4	214	20	)	)	-RRB-
cord-284501-5i0w74q4	214	21	;	;	:
cord-284501-5i0w74q4	214	22	as	as	IN
cord-284501-5i0w74q4	214	23	shown	show	VBN
cord-284501-5i0w74q4	214	24	previously	previously	RB
cord-284501-5i0w74q4	214	25	[	[	-LRB-
cord-284501-5i0w74q4	214	26	26	26	CD
cord-284501-5i0w74q4	214	27	]	]	-RRB-
cord-284501-5i0w74q4	214	28	.	.	.
cord-284501-5i0w74q4	215	1	These	these	DT
cord-284501-5i0w74q4	215	2	observations	observation	NNS
cord-284501-5i0w74q4	215	3	demonstrated	demonstrate	VBD
cord-284501-5i0w74q4	215	4	that	that	IN
cord-284501-5i0w74q4	215	5	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	215	6	-	-	HYPH
cord-284501-5i0w74q4	215	7	Rep	Rep	NNP
cord-284501-5i0w74q4	215	8	-	-	HYPH
cord-284501-5i0w74q4	215	9	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	215	10	was	be	VBD
cord-284501-5i0w74q4	215	11	not	not	RB
cord-284501-5i0w74q4	215	12	pathogenic	pathogenic	JJ
cord-284501-5i0w74q4	215	13	indicating	indicate	VBG
cord-284501-5i0w74q4	215	14	that	that	IN
cord-284501-5i0w74q4	215	15	replacement	replacement	NN
cord-284501-5i0w74q4	215	16	of	of	IN
cord-284501-5i0w74q4	215	17	the	the	DT
cord-284501-5i0w74q4	215	18	structural	structural	JJ
cord-284501-5i0w74q4	215	19	and	and	CC
cord-284501-5i0w74q4	215	20	accessory	accessory	NN
cord-284501-5i0w74q4	215	21	genes	gene	NNS
cord-284501-5i0w74q4	215	22	did	do	VBD
cord-284501-5i0w74q4	215	23	not	not	RB
cord-284501-5i0w74q4	215	24	restore	restore	VB
cord-284501-5i0w74q4	215	25	virulence	virulence	NN
cord-284501-5i0w74q4	215	26	.	.	.
cord-284501-5i0w74q4	216	1	Analysis	analysis	NN
cord-284501-5i0w74q4	216	2	of	of	IN
cord-284501-5i0w74q4	216	3	epithelial	epithelial	JJ
cord-284501-5i0w74q4	216	4	cells	cell	NNS
cord-284501-5i0w74q4	216	5	,	,	,
cord-284501-5i0w74q4	216	6	removed	remove	VBN
cord-284501-5i0w74q4	216	7	from	from	IN
cord-284501-5i0w74q4	216	8	the	the	DT
cord-284501-5i0w74q4	216	9	tracheas	trachea	NNS
cord-284501-5i0w74q4	216	10	of	of	IN
cord-284501-5i0w74q4	216	11	the	the	DT
cord-284501-5i0w74q4	216	12	infected	infected	JJ
cord-284501-5i0w74q4	216	13	chickens	chicken	NNS
cord-284501-5i0w74q4	216	14	,	,	,
cord-284501-5i0w74q4	216	15	for	for	IN
cord-284501-5i0w74q4	216	16	the	the	DT
cord-284501-5i0w74q4	216	17	presence	presence	NN
cord-284501-5i0w74q4	216	18	of	of	IN
cord-284501-5i0w74q4	216	19	infectious	infectious	JJ
cord-284501-5i0w74q4	216	20	IBV	IBV	NNP
cord-284501-5i0w74q4	216	21	using	use	VBG
cord-284501-5i0w74q4	216	22	TOCs	TOCs	NNPS
cord-284501-5i0w74q4	216	23	failed	fail	VBD
cord-284501-5i0w74q4	216	24	to	to	TO
cord-284501-5i0w74q4	216	25	detect	detect	VB
cord-284501-5i0w74q4	216	26	virus	virus	NN
cord-284501-5i0w74q4	216	27	from	from	IN
cord-284501-5i0w74q4	216	28	chickens	chicken	NNS
cord-284501-5i0w74q4	216	29	infected	infect	VBN
cord-284501-5i0w74q4	216	30	with	with	IN
cord-284501-5i0w74q4	216	31	either	either	DT
cord-284501-5i0w74q4	216	32	Beau	Beau	NNP
cord-284501-5i0w74q4	216	33	-	-	HYPH
cord-284501-5i0w74q4	216	34	R	R	NNP
cord-284501-5i0w74q4	216	35	or	or	CC
cord-284501-5i0w74q4	216	36	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	216	37	-	-	HYPH
cord-284501-5i0w74q4	216	38	Rep	rep	NN
cord-284501-5i0w74q4	216	39	-	-	HYPH
cord-284501-5i0w74q4	216	40	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	216	41	.	.	.
cord-284501-5i0w74q4	217	1	In	in	IN
cord-284501-5i0w74q4	217	2	contrast	contrast	NN
cord-284501-5i0w74q4	217	3	,	,	,
cord-284501-5i0w74q4	217	4	epithelial	epithelial	JJ
cord-284501-5i0w74q4	217	5	cells	cell	NNS
cord-284501-5i0w74q4	217	6	from	from	IN
cord-284501-5i0w74q4	217	7	chickens	chicken	NNS
cord-284501-5i0w74q4	217	8	infected	infect	VBN
cord-284501-5i0w74q4	217	9	with	with	IN
cord-284501-5i0w74q4	217	10	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	217	11	showed	show	VBD
cord-284501-5i0w74q4	217	12	the	the	DT
cord-284501-5i0w74q4	217	13	presence	presence	NN
cord-284501-5i0w74q4	217	14	of	of	IN
cord-284501-5i0w74q4	217	15	virus	virus	NN
cord-284501-5i0w74q4	217	16	with	with	IN
cord-284501-5i0w74q4	217	17	a	a	DT
cord-284501-5i0w74q4	217	18	titre	titre	NN
cord-284501-5i0w74q4	217	19	of	of	IN
cord-284501-5i0w74q4	217	20	4	4	CD
cord-284501-5i0w74q4	217	21	log	log	VBP
cord-284501-5i0w74q4	217	22	10	10	CD
cord-284501-5i0w74q4	217	23	CD	CD	NNP
cord-284501-5i0w74q4	217	24	50	50	CD
cord-284501-5i0w74q4	217	25	in	in	IN
cord-284501-5i0w74q4	217	26	TOCs	TOCs	NNP
cord-284501-5i0w74q4	217	27	,	,	,
cord-284501-5i0w74q4	217	28	demonstrating	demonstrate	VBG
cord-284501-5i0w74q4	217	29	that	that	IN
cord-284501-5i0w74q4	217	30	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	217	31	was	be	VBD
cord-284501-5i0w74q4	217	32	present	present	JJ
cord-284501-5i0w74q4	217	33	in	in	IN
cord-284501-5i0w74q4	217	34	the	the	DT
cord-284501-5i0w74q4	217	35	tracheas	trachea	NNS
cord-284501-5i0w74q4	217	36	of	of	IN
cord-284501-5i0w74q4	217	37	the	the	DT
cord-284501-5i0w74q4	217	38	infected	infected	JJ
cord-284501-5i0w74q4	217	39	chickens	chicken	NNS
cord-284501-5i0w74q4	217	40	.	.	.
cord-284501-5i0w74q4	218	1	Analysis	analysis	NN
cord-284501-5i0w74q4	218	2	of	of	IN
cord-284501-5i0w74q4	218	3	the	the	DT
cord-284501-5i0w74q4	218	4	epithelial	epithelial	JJ
cord-284501-5i0w74q4	218	5	cells	cell	NNS
cord-284501-5i0w74q4	218	6	for	for	IN
cord-284501-5i0w74q4	218	7	the	the	DT
cord-284501-5i0w74q4	218	8	presence	presence	NN
cord-284501-5i0w74q4	218	9	of	of	IN
cord-284501-5i0w74q4	218	10	any	any	DT
cord-284501-5i0w74q4	218	11	IBV	IBV	NNP
cord-284501-5i0w74q4	218	12	-	-	HYPH
cord-284501-5i0w74q4	218	13	derived	derive	VBN
cord-284501-5i0w74q4	218	14	RNA	RNA	NNP
cord-284501-5i0w74q4	218	15	by	by	IN
cord-284501-5i0w74q4	218	16	RT	RT	NNP
cord-284501-5i0w74q4	218	17	-	-	HYPH
cord-284501-5i0w74q4	218	18	PCR	PCR	NNP
cord-284501-5i0w74q4	218	19	also	also	RB
cord-284501-5i0w74q4	218	20	indicated	indicate	VBD
cord-284501-5i0w74q4	218	21	that	that	IN
cord-284501-5i0w74q4	218	22	no	no	DT
cord-284501-5i0w74q4	218	23	Beau	Beau	NNP
cord-284501-5i0w74q4	218	24	-	-	HYPH
cord-284501-5i0w74q4	218	25	R	R	NNP
cord-284501-5i0w74q4	218	26	or	or	CC
cord-284501-5i0w74q4	218	27	rBeauR	rbeaur	JJ
cord-284501-5i0w74q4	218	28	-	-	HYPH
cord-284501-5i0w74q4	218	29	Rep	Rep	NNP
cord-284501-5i0w74q4	218	30	-	-	HYPH
cord-284501-5i0w74q4	218	31	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	218	32	was	be	VBD
cord-284501-5i0w74q4	218	33	present	present	JJ
cord-284501-5i0w74q4	218	34	or	or	CC
cord-284501-5i0w74q4	218	35	was	be	VBD
cord-284501-5i0w74q4	218	36	below	below	IN
cord-284501-5i0w74q4	218	37	detection	detection	NN
cord-284501-5i0w74q4	218	38	in	in	IN
cord-284501-5i0w74q4	218	39	the	the	DT
cord-284501-5i0w74q4	218	40	epithelial	epithelial	JJ
cord-284501-5i0w74q4	218	41	cells	cell	NNS
cord-284501-5i0w74q4	218	42	examined	examine	VBN
cord-284501-5i0w74q4	218	43	;	;	:
cord-284501-5i0w74q4	218	44	this	this	DT
cord-284501-5i0w74q4	218	45	was	be	VBD
cord-284501-5i0w74q4	218	46	in	in	IN
cord-284501-5i0w74q4	218	47	contrast	contrast	NN
cord-284501-5i0w74q4	218	48	to	to	IN
cord-284501-5i0w74q4	218	49	the	the	DT
cord-284501-5i0w74q4	218	50	cells	cell	NNS
cord-284501-5i0w74q4	218	51	examined	examine	VBN
cord-284501-5i0w74q4	218	52	from	from	IN
cord-284501-5i0w74q4	218	53	chickens	chicken	NNS
cord-284501-5i0w74q4	218	54	infected	infect	VBN
cord-284501-5i0w74q4	218	55	with	with	IN
cord-284501-5i0w74q4	218	56	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	218	57	,	,	,
cord-284501-5i0w74q4	218	58	in	in	IN
cord-284501-5i0w74q4	218	59	which	which	WDT
cord-284501-5i0w74q4	218	60	virus	virus	NN
cord-284501-5i0w74q4	218	61	-	-	HYPH
cord-284501-5i0w74q4	218	62	derived	derive	VBN
cord-284501-5i0w74q4	218	63	RNA	RNA	NNP
cord-284501-5i0w74q4	218	64	was	be	VBD
cord-284501-5i0w74q4	218	65	detected	detect	VBN
cord-284501-5i0w74q4	218	66	by	by	IN
cord-284501-5i0w74q4	218	67	RT	RT	NNP
cord-284501-5i0w74q4	218	68	-	-	HYPH
cord-284501-5i0w74q4	218	69	PCR	PCR	NNP
cord-284501-5i0w74q4	218	70	(	(	-LRB-
cord-284501-5i0w74q4	218	71	Fig	Fig	NNP
cord-284501-5i0w74q4	218	72	.	.	.
cord-284501-5i0w74q4	218	73	4	4	CD
cord-284501-5i0w74q4	218	74	)	)	-RRB-
cord-284501-5i0w74q4	218	75	.	.	.
cord-284501-5i0w74q4	219	1	Subsequent	subsequent	JJ
cord-284501-5i0w74q4	219	2	analysis	analysis	NN
cord-284501-5i0w74q4	219	3	of	of	IN
cord-284501-5i0w74q4	219	4	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	219	5	-	-	HYPH
cord-284501-5i0w74q4	219	6	Rep	Rep	NNP
cord-284501-5i0w74q4	219	7	-	-	HYPH
cord-284501-5i0w74q4	219	8	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	219	9	ex	ex	NN
cord-284501-5i0w74q4	219	10	vivo	vivo	NN
cord-284501-5i0w74q4	219	11	using	use	VBG
cord-284501-5i0w74q4	219	12	TOCs	TOCs	NNP
cord-284501-5i0w74q4	219	13	surprisingly	surprisingly	RB
cord-284501-5i0w74q4	219	14	showed	show	VBD
cord-284501-5i0w74q4	219	15	that	that	IN
cord-284501-5i0w74q4	219	16	the	the	DT
cord-284501-5i0w74q4	219	17	rIBV	ribv	NN
cord-284501-5i0w74q4	219	18	did	do	VBD
cord-284501-5i0w74q4	219	19	not	not	RB
cord-284501-5i0w74q4	219	20	cause	cause	VB
cord-284501-5i0w74q4	219	21	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	219	22	when	when	WRB
cord-284501-5i0w74q4	219	23	directly	directly	RB
cord-284501-5i0w74q4	219	24	used	use	VBN
cord-284501-5i0w74q4	219	25	to	to	TO
cord-284501-5i0w74q4	219	26	infect	infect	VB
cord-284501-5i0w74q4	219	27	TOCs	TOCs	NNP
cord-284501-5i0w74q4	219	28	,	,	,
cord-284501-5i0w74q4	219	29	in	in	IN
cord-284501-5i0w74q4	219	30	contrast	contrast	NN
cord-284501-5i0w74q4	219	31	to	to	IN
cord-284501-5i0w74q4	219	32	Beau	Beau	NNP
cord-284501-5i0w74q4	219	33	-	-	HYPH
cord-284501-5i0w74q4	219	34	R	R	NNP
cord-284501-5i0w74q4	219	35	and	and	CC
cord-284501-5i0w74q4	219	36	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	219	37	which	which	WDT
cord-284501-5i0w74q4	219	38	caused	cause	VBD
cord-284501-5i0w74q4	219	39	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	219	40	.	.	.
cord-284501-5i0w74q4	220	1	This	this	DT
cord-284501-5i0w74q4	220	2	observation	observation	NN
cord-284501-5i0w74q4	220	3	raised	raise	VBD
cord-284501-5i0w74q4	220	4	the	the	DT
cord-284501-5i0w74q4	220	5	possibility	possibility	NN
cord-284501-5i0w74q4	220	6	that	that	IN
cord-284501-5i0w74q4	220	7	the	the	DT
cord-284501-5i0w74q4	220	8	lack	lack	NN
cord-284501-5i0w74q4	220	9	of	of	IN
cord-284501-5i0w74q4	220	10	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	220	11	and	and	CC
cord-284501-5i0w74q4	220	12	detection	detection	NN
cord-284501-5i0w74q4	220	13	of	of	IN
cord-284501-5i0w74q4	220	14	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	220	15	-	-	HYPH
cord-284501-5i0w74q4	220	16	Rep	Rep	NNP
cord-284501-5i0w74q4	220	17	-	-	HYPH
cord-284501-5i0w74q4	220	18	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	220	19	in	in	IN
cord-284501-5i0w74q4	220	20	the	the	DT
cord-284501-5i0w74q4	220	21	tracheal	tracheal	JJ
cord-284501-5i0w74q4	220	22	epithelial	epithelial	JJ
cord-284501-5i0w74q4	220	23	cells	cell	NNS
cord-284501-5i0w74q4	220	24	of	of	IN
cord-284501-5i0w74q4	220	25	chickens	chicken	NNS
cord-284501-5i0w74q4	220	26	infected	infect	VBN
cord-284501-5i0w74q4	220	27	by	by	IN
cord-284501-5i0w74q4	220	28	the	the	DT
cord-284501-5i0w74q4	220	29	virus	virus	NN
cord-284501-5i0w74q4	220	30	using	use	VBG
cord-284501-5i0w74q4	220	31	TOCs	toc	NNS
cord-284501-5i0w74q4	220	32	for	for	IN
cord-284501-5i0w74q4	220	33	our	-PRON-	PRP$
cord-284501-5i0w74q4	220	34	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	220	35	experiments	experiment	NNS
cord-284501-5i0w74q4	220	36	may	may	MD
cord-284501-5i0w74q4	220	37	have	have	VB
cord-284501-5i0w74q4	220	38	been	be	VBN
cord-284501-5i0w74q4	220	39	interpreted	interpret	VBN
cord-284501-5i0w74q4	220	40	incorrectly	incorrectly	RB
cord-284501-5i0w74q4	220	41	as	as	IN
cord-284501-5i0w74q4	220	42	the	the	DT
cord-284501-5i0w74q4	220	43	read	read	NN
cord-284501-5i0w74q4	220	44	out	out	RP
cord-284501-5i0w74q4	220	45	for	for	IN
cord-284501-5i0w74q4	220	46	these	these	DT
cord-284501-5i0w74q4	220	47	tests	test	NNS
cord-284501-5i0w74q4	220	48	was	be	VBD
cord-284501-5i0w74q4	220	49	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	220	50	.	.	.
cord-284501-5i0w74q4	221	1	However	however	RB
cord-284501-5i0w74q4	221	2	,	,	,
cord-284501-5i0w74q4	221	3	it	-PRON-	PRP
cord-284501-5i0w74q4	221	4	should	should	MD
cord-284501-5i0w74q4	221	5	be	be	VB
cord-284501-5i0w74q4	221	6	noted	note	VBN
cord-284501-5i0w74q4	221	7	no	no	DT
cord-284501-5i0w74q4	221	8	clinical	clinical	JJ
cord-284501-5i0w74q4	221	9	signs	sign	NNS
cord-284501-5i0w74q4	221	10	were	be	VBD
cord-284501-5i0w74q4	221	11	observed	observe	VBN
cord-284501-5i0w74q4	221	12	nor	nor	CC
cord-284501-5i0w74q4	221	13	was	be	VBD
cord-284501-5i0w74q4	221	14	any	any	DT
cord-284501-5i0w74q4	221	15	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	221	16	-	-	HYPH
cord-284501-5i0w74q4	221	17	Rep	Rep	NNP
cord-284501-5i0w74q4	221	18	-	-	HYPH
cord-284501-5i0w74q4	221	19	M41-Struct-2-derived	M41-Struct-2-derived	NNP
cord-284501-5i0w74q4	221	20	RNA	RNA	NNP
cord-284501-5i0w74q4	221	21	detected	detect	VBD
cord-284501-5i0w74q4	221	22	.	.	.
cord-284501-5i0w74q4	222	1	Growth	growth	NN
cord-284501-5i0w74q4	222	2	analysis	analysis	NN
cord-284501-5i0w74q4	222	3	of	of	IN
cord-284501-5i0w74q4	222	4	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	222	5	-	-	HYPH
cord-284501-5i0w74q4	222	6	Rep	Rep	NNP
cord-284501-5i0w74q4	222	7	-	-	HYPH
cord-284501-5i0w74q4	222	8	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	222	9	in	in	IN
cord-284501-5i0w74q4	222	10	TOCs	toc	NNS
cord-284501-5i0w74q4	222	11	showed	show	VBD
cord-284501-5i0w74q4	222	12	that	that	IN
cord-284501-5i0w74q4	222	13	the	the	DT
cord-284501-5i0w74q4	222	14	lack	lack	NN
cord-284501-5i0w74q4	222	15	of	of	IN
cord-284501-5i0w74q4	222	16	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	222	17	observed	observe	VBN
cord-284501-5i0w74q4	222	18	with	with	IN
cord-284501-5i0w74q4	222	19	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	222	20	-	-	HYPH
cord-284501-5i0w74q4	222	21	Rep	Rep	NNP
cord-284501-5i0w74q4	222	22	-	-	HYPH
cord-284501-5i0w74q4	222	23	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	222	24	was	be	VBD
cord-284501-5i0w74q4	222	25	not	not	RB
cord-284501-5i0w74q4	222	26	due	due	JJ
cord-284501-5i0w74q4	222	27	to	to	IN
cord-284501-5i0w74q4	222	28	the	the	DT
cord-284501-5i0w74q4	222	29	inability	inability	NN
cord-284501-5i0w74q4	222	30	of	of	IN
cord-284501-5i0w74q4	222	31	the	the	DT
cord-284501-5i0w74q4	222	32	virus	virus	NN
cord-284501-5i0w74q4	222	33	to	to	TO
cord-284501-5i0w74q4	222	34	replicate	replicate	VB
cord-284501-5i0w74q4	222	35	in	in	IN
cord-284501-5i0w74q4	222	36	TOCs	toc	NNS
cord-284501-5i0w74q4	222	37	(	(	-LRB-
cord-284501-5i0w74q4	222	38	Fig	Fig	NNP
cord-284501-5i0w74q4	222	39	.	.	NNP
cord-284501-5i0w74q4	222	40	5	5	CD
cord-284501-5i0w74q4	222	41	)	)	-RRB-
cord-284501-5i0w74q4	222	42	.	.	.
cord-284501-5i0w74q4	223	1	The	the	DT
cord-284501-5i0w74q4	223	2	rIBV	rIBV	JJS
cord-284501-5i0w74q4	223	3	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	223	4	-	-	HYPH
cord-284501-5i0w74q4	223	5	Rep	Rep	NNP
cord-284501-5i0w74q4	223	6	-	-	HYPH
cord-284501-5i0w74q4	223	7	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	223	8	was	be	VBD
cord-284501-5i0w74q4	223	9	able	able	JJ
cord-284501-5i0w74q4	223	10	to	to	TO
cord-284501-5i0w74q4	223	11	replicate	replicate	VB
cord-284501-5i0w74q4	223	12	in	in	IN
cord-284501-5i0w74q4	223	13	TOCs	toc	NNS
cord-284501-5i0w74q4	223	14	,	,	,
cord-284501-5i0w74q4	223	15	though	though	IN
cord-284501-5i0w74q4	223	16	the	the	DT
cord-284501-5i0w74q4	223	17	amount	amount	NN
cord-284501-5i0w74q4	223	18	of	of	IN
cord-284501-5i0w74q4	223	19	virus	virus	NN
cord-284501-5i0w74q4	223	20	produced	produce	VBN
cord-284501-5i0w74q4	223	21	was	be	VBD
cord-284501-5i0w74q4	223	22	about	about	RB
cord-284501-5i0w74q4	223	23	1	1	CD
cord-284501-5i0w74q4	223	24	log	log	VBP
cord-284501-5i0w74q4	223	25	10	10	CD
cord-284501-5i0w74q4	223	26	less	less	JJR
cord-284501-5i0w74q4	223	27	than	than	IN
cord-284501-5i0w74q4	223	28	for	for	IN
cord-284501-5i0w74q4	223	29	the	the	DT
cord-284501-5i0w74q4	223	30	growth	growth	NN
cord-284501-5i0w74q4	223	31	of	of	IN
cord-284501-5i0w74q4	223	32	Beau	Beau	NNP
cord-284501-5i0w74q4	223	33	-	-	HYPH
cord-284501-5i0w74q4	223	34	R	R	NNP
cord-284501-5i0w74q4	223	35	and	and	CC
cord-284501-5i0w74q4	223	36	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	223	37	,	,	,
cord-284501-5i0w74q4	223	38	somewhat	somewhat	RB
cord-284501-5i0w74q4	223	39	analogous	analogous	JJ
cord-284501-5i0w74q4	223	40	to	to	IN
cord-284501-5i0w74q4	223	41	the	the	DT
cord-284501-5i0w74q4	223	42	growth	growth	NN
cord-284501-5i0w74q4	223	43	pattern	pattern	NN
cord-284501-5i0w74q4	223	44	observed	observe	VBN
cord-284501-5i0w74q4	223	45	for	for	IN
cord-284501-5i0w74q4	223	46	the	the	DT
cord-284501-5i0w74q4	223	47	virus	virus	NN
cord-284501-5i0w74q4	223	48	on	on	IN
cord-284501-5i0w74q4	223	49	CKCs	ckc	NNS
cord-284501-5i0w74q4	223	50	.	.	.
cord-284501-5i0w74q4	224	1	IBV	IBV	NNP
cord-284501-5i0w74q4	224	2	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	224	3	-	-	HYPH
cord-284501-5i0w74q4	224	4	Rep	Rep	NNP
cord-284501-5i0w74q4	224	5	-	-	HYPH
cord-284501-5i0w74q4	224	6	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	224	7	consisted	consist	VBD
cord-284501-5i0w74q4	224	8	of	of	IN
cord-284501-5i0w74q4	224	9	the	the	DT
cord-284501-5i0w74q4	224	10	Beau	Beau	NNP
cord-284501-5i0w74q4	224	11	-	-	HYPH
cord-284501-5i0w74q4	224	12	R	R	NNP
cord-284501-5i0w74q4	224	13	replicase	replicase	NN
cord-284501-5i0w74q4	224	14	and	and	CC
cord-284501-5i0w74q4	224	15	M41	m41	JJ
cord-284501-5i0w74q4	224	16	structural	structural	JJ
cord-284501-5i0w74q4	224	17	and	and	CC
cord-284501-5i0w74q4	224	18	accessory	accessory	JJ
cord-284501-5i0w74q4	224	19	genes	gene	NNS
cord-284501-5i0w74q4	224	20	and	and	CC
cord-284501-5i0w74q4	224	21	as	as	IN
cord-284501-5i0w74q4	224	22	a	a	DT
cord-284501-5i0w74q4	224	23	consequence	consequence	NN
cord-284501-5i0w74q4	224	24	had	have	VBD
cord-284501-5i0w74q4	224	25	a	a	DT
cord-284501-5i0w74q4	224	26	59-UTR	59-utr	CD
cord-284501-5i0w74q4	224	27	derived	derive	VBN
cord-284501-5i0w74q4	224	28	from	from	IN
cord-284501-5i0w74q4	224	29	Beau	Beau	NNP
cord-284501-5i0w74q4	224	30	-	-	HYPH
cord-284501-5i0w74q4	224	31	R	R	NNP
cord-284501-5i0w74q4	224	32	and	and	CC
cord-284501-5i0w74q4	224	33	a	a	DT
cord-284501-5i0w74q4	224	34	39-UTR	39-utr	CD
cord-284501-5i0w74q4	224	35	from	from	IN
cord-284501-5i0w74q4	224	36	M41	M41	NNP
cord-284501-5i0w74q4	224	37	.	.	.
cord-284501-5i0w74q4	225	1	There	there	EX
cord-284501-5i0w74q4	225	2	are	be	VBP
cord-284501-5i0w74q4	225	3	known	know	VBN
cord-284501-5i0w74q4	225	4	differences	difference	NNS
cord-284501-5i0w74q4	225	5	between	between	IN
cord-284501-5i0w74q4	225	6	IBV	IBV	NNP
cord-284501-5i0w74q4	225	7	39	39	CD
cord-284501-5i0w74q4	225	8	UTRs	utr	NNS
cord-284501-5i0w74q4	225	9	,	,	,
cord-284501-5i0w74q4	225	10	in	in	IN
cord-284501-5i0w74q4	225	11	fact	fact	NN
cord-284501-5i0w74q4	225	12	the	the	DT
cord-284501-5i0w74q4	225	13	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	225	14	39-UTR	39-utr	CD
cord-284501-5i0w74q4	225	15	is	be	VBZ
cord-284501-5i0w74q4	225	16	184	184	CD
cord-284501-5i0w74q4	225	17	nt	nt	RB
cord-284501-5i0w74q4	225	18	smaller	small	JJR
cord-284501-5i0w74q4	225	19	than	than	IN
cord-284501-5i0w74q4	225	20	the	the	DT
cord-284501-5i0w74q4	225	21	Beau	Beau	NNP
cord-284501-5i0w74q4	225	22	-	-	HYPH
cord-284501-5i0w74q4	225	23	R	R	NNP
cord-284501-5i0w74q4	225	24	39-UTR	39-utr	CD
cord-284501-5i0w74q4	225	25	,	,	,
cord-284501-5i0w74q4	225	26	the	the	DT
cord-284501-5i0w74q4	225	27	remaining	remain	VBG
cord-284501-5i0w74q4	225	28	part	part	NN
cord-284501-5i0w74q4	225	29	of	of	IN
cord-284501-5i0w74q4	225	30	the	the	DT
cord-284501-5i0w74q4	225	31	M41-CK	M41-CK	NNP
cord-284501-5i0w74q4	225	32	39-UTR	39-utr	CD
cord-284501-5i0w74q4	225	33	representing	represent	VBG
cord-284501-5i0w74q4	225	34	the	the	DT
cord-284501-5i0w74q4	225	35	conserved	conserve	VBN
cord-284501-5i0w74q4	225	36	region	region	NN
cord-284501-5i0w74q4	225	37	of	of	IN
cord-284501-5i0w74q4	225	38	the	the	DT
cord-284501-5i0w74q4	225	39	IBV	IBV	NNP
cord-284501-5i0w74q4	225	40	39-UTR	39-utr	CD
cord-284501-5i0w74q4	225	41	and	and	CC
cord-284501-5i0w74q4	225	42	contains	contain	VBZ
cord-284501-5i0w74q4	225	43	the	the	DT
cord-284501-5i0w74q4	225	44	predicted	predict	VBN
cord-284501-5i0w74q4	225	45	RNA	RNA	NNP
cord-284501-5i0w74q4	225	46	secondary	secondary	JJ
cord-284501-5i0w74q4	225	47	structures	structure	NNS
cord-284501-5i0w74q4	225	48	believed	believe	VBN
cord-284501-5i0w74q4	225	49	to	to	TO
cord-284501-5i0w74q4	225	50	be	be	VB
cord-284501-5i0w74q4	225	51	involved	involve	VBN
cord-284501-5i0w74q4	225	52	in	in	IN
cord-284501-5i0w74q4	225	53	replication	replication	NN
cord-284501-5i0w74q4	225	54	[	[	-LRB-
cord-284501-5i0w74q4	225	55	44	44	CD
cord-284501-5i0w74q4	225	56	]	]	-RRB-
cord-284501-5i0w74q4	225	57	.	.	.
cord-284501-5i0w74q4	226	1	There	there	EX
cord-284501-5i0w74q4	226	2	are	be	VBP
cord-284501-5i0w74q4	226	3	7	7	CD
cord-284501-5i0w74q4	226	4	and	and	CC
cord-284501-5i0w74q4	226	5	3	3	CD
cord-284501-5i0w74q4	226	6	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	226	7	differences	difference	NNS
cord-284501-5i0w74q4	226	8	between	between	IN
cord-284501-5i0w74q4	226	9	the	the	DT
cord-284501-5i0w74q4	226	10	59-and	59-and	CD
cord-284501-5i0w74q4	226	11	the	the	DT
cord-284501-5i0w74q4	226	12	conserved	conserve	VBN
cord-284501-5i0w74q4	226	13	region	region	NN
cord-284501-5i0w74q4	226	14	of	of	IN
cord-284501-5i0w74q4	226	15	the	the	DT
cord-284501-5i0w74q4	226	16	IBV	IBV	NNP
cord-284501-5i0w74q4	226	17	39-UTRs	39-UTRs	NNP
cord-284501-5i0w74q4	226	18	,	,	,
cord-284501-5i0w74q4	226	19	respectively	respectively	RB
cord-284501-5i0w74q4	226	20	,	,	,
cord-284501-5i0w74q4	226	21	of	of	IN
cord-284501-5i0w74q4	226	22	Beau	Beau	NNP
cord-284501-5i0w74q4	226	23	-	-	HYPH
cord-284501-5i0w74q4	226	24	R	R	NNP
cord-284501-5i0w74q4	226	25	and	and	CC
cord-284501-5i0w74q4	226	26	M41-CK	m41-ck	JJ
cord-284501-5i0w74q4	226	27	(	(	-LRB-
cord-284501-5i0w74q4	226	28	[	[	-LRB-
cord-284501-5i0w74q4	226	29	33	33	CD
cord-284501-5i0w74q4	226	30	,	,	,
cord-284501-5i0w74q4	226	31	42	42	CD
cord-284501-5i0w74q4	226	32	]	]	-RRB-
cord-284501-5i0w74q4	226	33	,	,	,
cord-284501-5i0w74q4	226	34	raising	raise	VBG
cord-284501-5i0w74q4	226	35	the	the	DT
cord-284501-5i0w74q4	226	36	possibility	possibility	NN
cord-284501-5i0w74q4	226	37	that	that	IN
cord-284501-5i0w74q4	226	38	if	if	IN
cord-284501-5i0w74q4	226	39	the	the	DT
cord-284501-5i0w74q4	226	40	two	two	CD
cord-284501-5i0w74q4	226	41	UTRs	utr	NNS
cord-284501-5i0w74q4	226	42	interact	interact	VBP
cord-284501-5i0w74q4	226	43	during	during	IN
cord-284501-5i0w74q4	226	44	replication	replication	NN
cord-284501-5i0w74q4	226	45	their	-PRON-	PRP$
cord-284501-5i0w74q4	226	46	heterologous	heterologous	JJ
cord-284501-5i0w74q4	226	47	nature	nature	NN
cord-284501-5i0w74q4	226	48	could	could	MD
cord-284501-5i0w74q4	226	49	be	be	VB
cord-284501-5i0w74q4	226	50	responsible	responsible	JJ
cord-284501-5i0w74q4	226	51	for	for	IN
cord-284501-5i0w74q4	226	52	the	the	DT
cord-284501-5i0w74q4	226	53	observed	observed	JJ
cord-284501-5i0w74q4	226	54	decrease	decrease	NN
cord-284501-5i0w74q4	226	55	in	in	IN
cord-284501-5i0w74q4	226	56	growth	growth	NN
cord-284501-5i0w74q4	226	57	for	for	IN
cord-284501-5i0w74q4	226	58	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	226	59	-	-	HYPH
cord-284501-5i0w74q4	226	60	Rep	Rep	NNP
cord-284501-5i0w74q4	226	61	-	-	HYPH
cord-284501-5i0w74q4	226	62	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	226	63	in	in	IN
cord-284501-5i0w74q4	226	64	both	both	DT
cord-284501-5i0w74q4	226	65	CKCs	ckc	NNS
cord-284501-5i0w74q4	226	66	and	and	CC
cord-284501-5i0w74q4	226	67	TOCs	toc	NNS
cord-284501-5i0w74q4	226	68	.	.	.
cord-284501-5i0w74q4	227	1	Impairment	impairment	NN
cord-284501-5i0w74q4	227	2	in	in	IN
cord-284501-5i0w74q4	227	3	growth	growth	NN
cord-284501-5i0w74q4	227	4	on	on	IN
cord-284501-5i0w74q4	227	5	TOCs	toc	NNS
cord-284501-5i0w74q4	227	6	may	may	MD
cord-284501-5i0w74q4	227	7	also	also	RB
cord-284501-5i0w74q4	227	8	have	have	VB
cord-284501-5i0w74q4	227	9	been	be	VBN
cord-284501-5i0w74q4	227	10	responsible	responsible	JJ
cord-284501-5i0w74q4	227	11	for	for	IN
cord-284501-5i0w74q4	227	12	the	the	DT
cord-284501-5i0w74q4	227	13	loss	loss	NN
cord-284501-5i0w74q4	227	14	of	of	IN
cord-284501-5i0w74q4	227	15	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	227	16	.	.	.
cord-284501-5i0w74q4	228	1	We	-PRON-	PRP
cord-284501-5i0w74q4	228	2	hypothesised	hypothesise	VBD
cord-284501-5i0w74q4	228	3	that	that	IN
cord-284501-5i0w74q4	228	4	an	an	DT
cord-284501-5i0w74q4	228	5	increase	increase	NN
cord-284501-5i0w74q4	228	6	in	in	IN
cord-284501-5i0w74q4	228	7	growth	growth	NN
cord-284501-5i0w74q4	228	8	would	would	MD
cord-284501-5i0w74q4	228	9	be	be	VB
cord-284501-5i0w74q4	228	10	a	a	DT
cord-284501-5i0w74q4	228	11	selective	selective	JJ
cord-284501-5i0w74q4	228	12	advantage	advantage	NN
cord-284501-5i0w74q4	228	13	to	to	IN
cord-284501-5i0w74q4	228	14	the	the	DT
cord-284501-5i0w74q4	228	15	virus	virus	NN
cord-284501-5i0w74q4	228	16	and	and	CC
cord-284501-5i0w74q4	228	17	therefore	therefore	RB
cord-284501-5i0w74q4	228	18	decided	decide	VBD
cord-284501-5i0w74q4	228	19	to	to	TO
cord-284501-5i0w74q4	228	20	serially	serially	RB
cord-284501-5i0w74q4	228	21	passage	passage	VB
cord-284501-5i0w74q4	228	22	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	228	23	-	-	HYPH
cord-284501-5i0w74q4	228	24	Rep	Rep	NNP
cord-284501-5i0w74q4	228	25	-	-	HYPH
cord-284501-5i0w74q4	228	26	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	228	27	25	25	CD
cord-284501-5i0w74q4	228	28	times	time	NNS
cord-284501-5i0w74q4	228	29	on	on	IN
cord-284501-5i0w74q4	228	30	CKCs	ckc	NNS
cord-284501-5i0w74q4	228	31	to	to	TO
cord-284501-5i0w74q4	228	32	see	see	VB
cord-284501-5i0w74q4	228	33	whether	whether	IN
cord-284501-5i0w74q4	228	34	any	any	DT
cord-284501-5i0w74q4	228	35	adaption	adaption	NN
cord-284501-5i0w74q4	228	36	could	could	MD
cord-284501-5i0w74q4	228	37	result	result	VB
cord-284501-5i0w74q4	228	38	in	in	IN
cord-284501-5i0w74q4	228	39	a	a	DT
cord-284501-5i0w74q4	228	40	higher	high	JJR
cord-284501-5i0w74q4	228	41	growth	growth	NN
cord-284501-5i0w74q4	228	42	rate	rate	NN
cord-284501-5i0w74q4	228	43	and	and	CC
cord-284501-5i0w74q4	228	44	a	a	DT
cord-284501-5i0w74q4	228	45	virus	virus	NN
cord-284501-5i0w74q4	228	46	that	that	WDT
cord-284501-5i0w74q4	228	47	could	could	MD
cord-284501-5i0w74q4	228	48	cause	cause	VB
cord-284501-5i0w74q4	228	49	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	228	50	in	in	IN
cord-284501-5i0w74q4	228	51	TOCs	TOCs	NNP
cord-284501-5i0w74q4	228	52	.	.	.
cord-284501-5i0w74q4	229	1	For	for	IN
cord-284501-5i0w74q4	229	2	example	example	NN
cord-284501-5i0w74q4	229	3	,	,	,
cord-284501-5i0w74q4	229	4	due	due	IN
cord-284501-5i0w74q4	229	5	to	to	IN
cord-284501-5i0w74q4	229	6	the	the	DT
cord-284501-5i0w74q4	229	7	very	very	RB
cord-284501-5i0w74q4	229	8	few	few	JJ
cord-284501-5i0w74q4	229	9	differences	difference	NNS
cord-284501-5i0w74q4	229	10	in	in	IN
cord-284501-5i0w74q4	229	11	the	the	DT
cord-284501-5i0w74q4	229	12	59-and	59-and	CD
cord-284501-5i0w74q4	229	13	39-UTRs	39-utrs	CD
cord-284501-5i0w74q4	229	14	,	,	,
cord-284501-5i0w74q4	229	15	between	between	IN
cord-284501-5i0w74q4	229	16	the	the	DT
cord-284501-5i0w74q4	229	17	two	two	CD
cord-284501-5i0w74q4	229	18	parental	parental	JJ
cord-284501-5i0w74q4	229	19	viruses	virus	NNS
cord-284501-5i0w74q4	229	20	,	,	,
cord-284501-5i0w74q4	229	21	a	a	DT
cord-284501-5i0w74q4	229	22	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	229	23	substitution	substitution	NN
cord-284501-5i0w74q4	229	24	in	in	IN
cord-284501-5i0w74q4	229	25	either	either	CC
cord-284501-5i0w74q4	229	26	UTR	UTR	NNP
cord-284501-5i0w74q4	229	27	that	that	WDT
cord-284501-5i0w74q4	229	28	may	may	MD
cord-284501-5i0w74q4	229	29	result	result	VB
cord-284501-5i0w74q4	229	30	in	in	IN
cord-284501-5i0w74q4	229	31	a	a	DT
cord-284501-5i0w74q4	229	32	more	more	RBR
cord-284501-5i0w74q4	229	33	homogenous	homogenous	JJ
cord-284501-5i0w74q4	229	34	interaction	interaction	NN
cord-284501-5i0w74q4	229	35	,	,	,
cord-284501-5i0w74q4	229	36	as	as	IN
cord-284501-5i0w74q4	229	37	seen	see	VBN
cord-284501-5i0w74q4	229	38	with	with	IN
cord-284501-5i0w74q4	229	39	either	either	CC
cord-284501-5i0w74q4	229	40	parental	parental	JJ
cord-284501-5i0w74q4	229	41	virus	virus	NN
cord-284501-5i0w74q4	229	42	,	,	,
cord-284501-5i0w74q4	229	43	may	may	MD
cord-284501-5i0w74q4	229	44	result	result	VB
cord-284501-5i0w74q4	229	45	in	in	IN
cord-284501-5i0w74q4	229	46	an	an	DT
cord-284501-5i0w74q4	229	47	increase	increase	NN
cord-284501-5i0w74q4	229	48	growth	growth	NN
cord-284501-5i0w74q4	229	49	rate	rate	NN
cord-284501-5i0w74q4	229	50	.	.	.
cord-284501-5i0w74q4	230	1	Analysis	analysis	NN
cord-284501-5i0w74q4	230	2	of	of	IN
cord-284501-5i0w74q4	230	3	the	the	DT
cord-284501-5i0w74q4	230	4	passaged	passage	VBN
cord-284501-5i0w74q4	230	5	virus	virus	NN
cord-284501-5i0w74q4	230	6	,	,	,
cord-284501-5i0w74q4	230	7	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	230	8	-	-	HYPH
cord-284501-5i0w74q4	230	9	Rep	Rep	NNP
cord-284501-5i0w74q4	230	10	-	-	HYPH
cord-284501-5i0w74q4	230	11	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	230	12	25	25	CD
cord-284501-5i0w74q4	230	13	,	,	,
cord-284501-5i0w74q4	230	14	on	on	IN
cord-284501-5i0w74q4	230	15	CKCs	ckc	NNS
cord-284501-5i0w74q4	230	16	and	and	CC
cord-284501-5i0w74q4	230	17	TOCs	TOCs	NNPS
cord-284501-5i0w74q4	230	18	showed	show	VBD
cord-284501-5i0w74q4	230	19	an	an	DT
cord-284501-5i0w74q4	230	20	altered	alter	VBN
cord-284501-5i0w74q4	230	21	growth	growth	NN
cord-284501-5i0w74q4	230	22	rate	rate	NN
cord-284501-5i0w74q4	230	23	in	in	IN
cord-284501-5i0w74q4	230	24	comparison	comparison	NN
cord-284501-5i0w74q4	230	25	to	to	IN
cord-284501-5i0w74q4	230	26	rBeauR	rbeaur	ADD
cord-284501-5i0w74q4	231	1	-Rep	-rep	LS
cord-284501-5i0w74q4	231	2	-	-	:
cord-284501-5i0w74q4	231	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	231	4	3	3	CD
cord-284501-5i0w74q4	232	1	(	(	-LRB-
cord-284501-5i0w74q4	232	2	Fig	Fig	NNP
cord-284501-5i0w74q4	232	3	.	.	.
cord-284501-5i0w74q4	232	4	6	6	CD
cord-284501-5i0w74q4	232	5	)	)	-RRB-
cord-284501-5i0w74q4	232	6	.	.	.
cord-284501-5i0w74q4	233	1	However	however	RB
cord-284501-5i0w74q4	233	2	,	,	,
cord-284501-5i0w74q4	233	3	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	234	1	-Rep	-rep	LS
cord-284501-5i0w74q4	234	2	-	-	:
cord-284501-5i0w74q4	234	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	234	4	25	25	CD
cord-284501-5i0w74q4	234	5	still	still	RB
cord-284501-5i0w74q4	234	6	did	do	VBD
cord-284501-5i0w74q4	234	7	not	not	RB
cord-284501-5i0w74q4	234	8	cause	cause	VB
cord-284501-5i0w74q4	234	9	ciliostasis	ciliostasis	NN
cord-284501-5i0w74q4	234	10	in	in	IN
cord-284501-5i0w74q4	234	11	TOCs	TOCs	NNP
cord-284501-5i0w74q4	234	12	.	.	.
cord-284501-5i0w74q4	235	1	Sequence	sequence	NN
cord-284501-5i0w74q4	235	2	analysis	analysis	NN
cord-284501-5i0w74q4	235	3	of	of	IN
cord-284501-5i0w74q4	235	4	the	the	DT
cord-284501-5i0w74q4	235	5	59-and	59-and	CD
cord-284501-5i0w74q4	235	6	39-UTRs	39-utrs	CD
cord-284501-5i0w74q4	235	7	of	of	IN
cord-284501-5i0w74q4	235	8	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	236	1	-Rep	-rep	LS
cord-284501-5i0w74q4	236	2	-	-	:
cord-284501-5i0w74q4	236	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	236	4	25	25	CD
cord-284501-5i0w74q4	236	5	showed	show	VBD
cord-284501-5i0w74q4	236	6	that	that	IN
cord-284501-5i0w74q4	236	7	there	there	EX
cord-284501-5i0w74q4	236	8	were	be	VBD
cord-284501-5i0w74q4	236	9	no	no	DT
cord-284501-5i0w74q4	236	10	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	236	11	substitutions	substitution	NNS
cord-284501-5i0w74q4	236	12	within	within	IN
cord-284501-5i0w74q4	236	13	these	these	DT
cord-284501-5i0w74q4	236	14	regions	region	NNS
cord-284501-5i0w74q4	236	15	when	when	WRB
cord-284501-5i0w74q4	236	16	compared	compare	VBN
cord-284501-5i0w74q4	236	17	to	to	IN
cord-284501-5i0w74q4	236	18	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	236	19	-	-	HYPH
cord-284501-5i0w74q4	236	20	Rep	Rep	NNP
cord-284501-5i0w74q4	236	21	-	-	HYPH
cord-284501-5i0w74q4	236	22	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	236	23	3	3	CD
cord-284501-5i0w74q4	236	24	,	,	,
cord-284501-5i0w74q4	236	25	indicating	indicate	VBG
cord-284501-5i0w74q4	236	26	that	that	IN
cord-284501-5i0w74q4	236	27	the	the	DT
cord-284501-5i0w74q4	236	28	change	change	NN
cord-284501-5i0w74q4	236	29	in	in	IN
cord-284501-5i0w74q4	236	30	the	the	DT
cord-284501-5i0w74q4	236	31	growth	growth	NN
cord-284501-5i0w74q4	236	32	characteristics	characteristic	NNS
cord-284501-5i0w74q4	236	33	was	be	VBD
cord-284501-5i0w74q4	236	34	not	not	RB
cord-284501-5i0w74q4	236	35	associated	associate	VBN
cord-284501-5i0w74q4	236	36	with	with	IN
cord-284501-5i0w74q4	236	37	changes	change	NNS
cord-284501-5i0w74q4	236	38	in	in	IN
cord-284501-5i0w74q4	236	39	the	the	DT
cord-284501-5i0w74q4	236	40	UTRs	utr	NNS
cord-284501-5i0w74q4	236	41	.	.	.
cord-284501-5i0w74q4	237	1	We	-PRON-	PRP
cord-284501-5i0w74q4	237	2	therefore	therefore	RB
cord-284501-5i0w74q4	237	3	sequenced	sequence	VBD
cord-284501-5i0w74q4	237	4	the	the	DT
cord-284501-5i0w74q4	237	5	entire	entire	JJ
cord-284501-5i0w74q4	237	6	genome	genome	NN
cord-284501-5i0w74q4	237	7	of	of	IN
cord-284501-5i0w74q4	237	8	rBeauR	rbeaur	NN
cord-284501-5i0w74q4	238	1	-Rep	-rep	LS
cord-284501-5i0w74q4	238	2	-	-	:
cord-284501-5i0w74q4	238	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	238	4	25	25	CD
cord-284501-5i0w74q4	238	5	for	for	IN
cord-284501-5i0w74q4	238	6	comparison	comparison	NN
cord-284501-5i0w74q4	238	7	with	with	IN
cord-284501-5i0w74q4	238	8	the	the	DT
cord-284501-5i0w74q4	238	9	sequence	sequence	NN
cord-284501-5i0w74q4	238	10	in	in	IN
cord-284501-5i0w74q4	238	11	rVV	rVV	NNP
cord-284501-5i0w74q4	238	12	-	-	HYPH
cord-284501-5i0w74q4	238	13	BeauR	BeauR	NNP
cord-284501-5i0w74q4	238	14	-	-	HYPH
cord-284501-5i0w74q4	238	15	Rep	Rep	NNP
cord-284501-5i0w74q4	238	16	-	-	HYPH
cord-284501-5i0w74q4	238	17	M41-Struct	M41-Struct	NNP
cord-284501-5i0w74q4	238	18	,	,	,
cord-284501-5i0w74q4	239	1	used	use	VBN
cord-284501-5i0w74q4	239	2	for	for	IN
cord-284501-5i0w74q4	239	3	generating	generate	VBG
cord-284501-5i0w74q4	239	4	rBeauR	rBeauR	.
cord-284501-5i0w74q4	240	1	-Rep	-rep	LS
cord-284501-5i0w74q4	240	2	-	-	:
cord-284501-5i0w74q4	240	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	240	4	3	3	CD
cord-284501-5i0w74q4	240	5	,	,	,
cord-284501-5i0w74q4	240	6	in	in	IN
cord-284501-5i0w74q4	240	7	order	order	NN
cord-284501-5i0w74q4	240	8	to	to	TO
cord-284501-5i0w74q4	240	9	identify	identify	VB
cord-284501-5i0w74q4	240	10	any	any	DT
cord-284501-5i0w74q4	240	11	potential	potential	JJ
cord-284501-5i0w74q4	240	12	changes	change	NNS
cord-284501-5i0w74q4	240	13	that	that	WDT
cord-284501-5i0w74q4	240	14	may	may	MD
cord-284501-5i0w74q4	240	15	have	have	VB
cord-284501-5i0w74q4	240	16	been	be	VBN
cord-284501-5i0w74q4	240	17	responsible	responsible	JJ
cord-284501-5i0w74q4	240	18	for	for	IN
cord-284501-5i0w74q4	240	19	the	the	DT
cord-284501-5i0w74q4	240	20	phenotypic	phenotypic	JJ
cord-284501-5i0w74q4	240	21	change	change	NN
cord-284501-5i0w74q4	240	22	in	in	IN
cord-284501-5i0w74q4	240	23	growth	growth	NN
cord-284501-5i0w74q4	240	24	.	.	.
cord-284501-5i0w74q4	241	1	We	-PRON-	PRP
cord-284501-5i0w74q4	241	2	identified	identify	VBD
cord-284501-5i0w74q4	241	3	three	three	CD
cord-284501-5i0w74q4	241	4	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	241	5	changes	change	NNS
cord-284501-5i0w74q4	241	6	between	between	IN
cord-284501-5i0w74q4	241	7	the	the	DT
cord-284501-5i0w74q4	241	8	P	p	NN
cord-284501-5i0w74q4	241	9	3	3	CD
cord-284501-5i0w74q4	241	10	and	and	CC
cord-284501-5i0w74q4	241	11	P	p	NN
cord-284501-5i0w74q4	241	12	25	25	CD
cord-284501-5i0w74q4	241	13	viruses	virus	NNS
cord-284501-5i0w74q4	241	14	,	,	,
cord-284501-5i0w74q4	241	15	one	one	CD
cord-284501-5i0w74q4	241	16	resulted	result	VBD
cord-284501-5i0w74q4	241	17	in	in	IN
cord-284501-5i0w74q4	241	18	an	an	DT
cord-284501-5i0w74q4	241	19	amino	amino	NN
cord-284501-5i0w74q4	241	20	acid	acid	NN
cord-284501-5i0w74q4	241	21	change	change	NN
cord-284501-5i0w74q4	241	22	,	,	,
cord-284501-5i0w74q4	241	23	PheRLeu	PheRLeu	NNP
cord-284501-5i0w74q4	241	24	,	,	,
cord-284501-5i0w74q4	241	25	in	in	IN
cord-284501-5i0w74q4	241	26	the	the	DT
cord-284501-5i0w74q4	241	27	S1	S1	NNP
cord-284501-5i0w74q4	241	28	region	region	NN
cord-284501-5i0w74q4	241	29	of	of	IN
cord-284501-5i0w74q4	241	30	the	the	DT
cord-284501-5i0w74q4	241	31	S	S	NNP
cord-284501-5i0w74q4	241	32	gene	gene	NN
cord-284501-5i0w74q4	241	33	and	and	CC
cord-284501-5i0w74q4	241	34	two	two	CD
cord-284501-5i0w74q4	241	35	adjacent	adjacent	JJ
cord-284501-5i0w74q4	241	36	nucleotides	nucleotide	NNS
cord-284501-5i0w74q4	241	37	in	in	IN
cord-284501-5i0w74q4	241	38	the	the	DT
cord-284501-5i0w74q4	241	39	ORF-5b	ORF-5b	NNP
cord-284501-5i0w74q4	241	40	sequence	sequence	NN
cord-284501-5i0w74q4	241	41	that	that	WDT
cord-284501-5i0w74q4	241	42	had	have	VBD
cord-284501-5i0w74q4	241	43	two	two	CD
cord-284501-5i0w74q4	241	44	potential	potential	JJ
cord-284501-5i0w74q4	241	45	effects	effect	NNS
cord-284501-5i0w74q4	241	46	,	,	,
cord-284501-5i0w74q4	241	47	(	(	-LRB-
cord-284501-5i0w74q4	241	48	1	1	LS
cord-284501-5i0w74q4	241	49	)	)	-RRB-
cord-284501-5i0w74q4	241	50	the	the	DT
cord-284501-5i0w74q4	241	51	introduction	introduction	NN
cord-284501-5i0w74q4	241	52	of	of	IN
cord-284501-5i0w74q4	241	53	a	a	DT
cord-284501-5i0w74q4	241	54	premature	premature	JJ
cord-284501-5i0w74q4	241	55	stop	stop	NN
cord-284501-5i0w74q4	241	56	codon	codon	NN
cord-284501-5i0w74q4	241	57	in	in	IN
cord-284501-5i0w74q4	241	58	ORF-5b	ORF-5b	NNP
cord-284501-5i0w74q4	242	1	and	and	CC
cord-284501-5i0w74q4	242	2	(	(	-LRB-
cord-284501-5i0w74q4	242	3	2	2	LS
cord-284501-5i0w74q4	242	4	)	)	-RRB-
cord-284501-5i0w74q4	242	5	modification	modification	NN
cord-284501-5i0w74q4	243	1	the	the	DT
cord-284501-5i0w74q4	243	2	N	N	NNP
cord-284501-5i0w74q4	243	3	gene	gene	NN
cord-284501-5i0w74q4	243	4	TRS	TRS	NNP
cord-284501-5i0w74q4	243	5	.	.	.
cord-284501-5i0w74q4	244	1	These	these	DT
cord-284501-5i0w74q4	244	2	observations	observation	NNS
cord-284501-5i0w74q4	244	3	indicate	indicate	VBP
cord-284501-5i0w74q4	244	4	that	that	IN
cord-284501-5i0w74q4	244	5	the	the	DT
cord-284501-5i0w74q4	244	6	increase	increase	NN
cord-284501-5i0w74q4	244	7	in	in	IN
cord-284501-5i0w74q4	244	8	growth	growth	NN
cord-284501-5i0w74q4	244	9	associated	associate	VBN
cord-284501-5i0w74q4	244	10	with	with	IN
cord-284501-5i0w74q4	244	11	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	245	1	-Rep	-rep	LS
cord-284501-5i0w74q4	245	2	-	-	:
cord-284501-5i0w74q4	245	3	M41-Struct-2-P	M41-Struct-2-P	NNP
cord-284501-5i0w74q4	245	4	25	25	CD
cord-284501-5i0w74q4	245	5	could	could	MD
cord-284501-5i0w74q4	245	6	have	have	VB
cord-284501-5i0w74q4	245	7	arisen	arise	VBN
cord-284501-5i0w74q4	245	8	from	from	IN
cord-284501-5i0w74q4	245	9	the	the	DT
cord-284501-5i0w74q4	245	10	amino	amino	NN
cord-284501-5i0w74q4	245	11	acid	acid	NN
cord-284501-5i0w74q4	245	12	change	change	NN
cord-284501-5i0w74q4	245	13	in	in	IN
cord-284501-5i0w74q4	245	14	the	the	DT
cord-284501-5i0w74q4	245	15	S	S	NNP
cord-284501-5i0w74q4	245	16	protein	protein	NN
cord-284501-5i0w74q4	245	17	,	,	,
cord-284501-5i0w74q4	245	18	the	the	DT
cord-284501-5i0w74q4	245	19	loss	loss	NN
cord-284501-5i0w74q4	245	20	of	of	IN
cord-284501-5i0w74q4	245	21	ORF-5b	ORF-5b	NNP
cord-284501-5i0w74q4	245	22	or	or	CC
cord-284501-5i0w74q4	245	23	a	a	DT
cord-284501-5i0w74q4	245	24	potential	potential	JJ
cord-284501-5i0w74q4	245	25	change	change	NN
cord-284501-5i0w74q4	245	26	in	in	IN
cord-284501-5i0w74q4	245	27	the	the	DT
cord-284501-5i0w74q4	245	28	expression	expression	NN
cord-284501-5i0w74q4	245	29	levels	level	NNS
cord-284501-5i0w74q4	245	30	of	of	IN
cord-284501-5i0w74q4	245	31	sg	sg	NNP
cord-284501-5i0w74q4	245	32	mRNA	mRNA	NNP
cord-284501-5i0w74q4	245	33	6	6	CD
cord-284501-5i0w74q4	245	34	,	,	,
cord-284501-5i0w74q4	245	35	which	which	WDT
cord-284501-5i0w74q4	245	36	is	be	VBZ
cord-284501-5i0w74q4	245	37	responsible	responsible	JJ
cord-284501-5i0w74q4	245	38	for	for	IN
cord-284501-5i0w74q4	245	39	the	the	DT
cord-284501-5i0w74q4	245	40	expression	expression	NN
cord-284501-5i0w74q4	245	41	of	of	IN
cord-284501-5i0w74q4	245	42	the	the	DT
cord-284501-5i0w74q4	245	43	N	N	NNP
cord-284501-5i0w74q4	245	44	protein	protein	NN
cord-284501-5i0w74q4	245	45	.	.	.
cord-284501-5i0w74q4	246	1	Overall	overall	RB
cord-284501-5i0w74q4	246	2	,	,	,
cord-284501-5i0w74q4	246	3	the	the	DT
cord-284501-5i0w74q4	246	4	main	main	JJ
cord-284501-5i0w74q4	246	5	conclusion	conclusion	NN
cord-284501-5i0w74q4	246	6	from	from	IN
cord-284501-5i0w74q4	246	7	our	-PRON-	PRP$
cord-284501-5i0w74q4	246	8	results	result	NNS
cord-284501-5i0w74q4	246	9	is	be	VBZ
cord-284501-5i0w74q4	246	10	the	the	DT
cord-284501-5i0w74q4	246	11	fact	fact	NN
cord-284501-5i0w74q4	246	12	that	that	IN
cord-284501-5i0w74q4	246	13	rBeauR	rBeauR	NNP
cord-284501-5i0w74q4	246	14	-	-	HYPH
cord-284501-5i0w74q4	246	15	Rep	Rep	NNP
cord-284501-5i0w74q4	246	16	-	-	HYPH
cord-284501-5i0w74q4	246	17	M41-Struct-2	M41-Struct-2	NNP
cord-284501-5i0w74q4	246	18	was	be	VBD
cord-284501-5i0w74q4	246	19	nonpathogenic	nonpathogenic	JJ
cord-284501-5i0w74q4	246	20	;	;	:
cord-284501-5i0w74q4	246	21	indicating	indicate	VBG
cord-284501-5i0w74q4	246	22	that	that	IN
cord-284501-5i0w74q4	246	23	the	the	DT
cord-284501-5i0w74q4	246	24	loss	loss	NN
cord-284501-5i0w74q4	246	25	of	of	IN
cord-284501-5i0w74q4	246	26	virulence	virulence	NN
cord-284501-5i0w74q4	246	27	associated	associate	VBN
cord-284501-5i0w74q4	246	28	with	with	IN
cord-284501-5i0w74q4	246	29	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	246	30	is	be	VBZ
cord-284501-5i0w74q4	246	31	not	not	RB
cord-284501-5i0w74q4	246	32	determined	determine	VBN
cord-284501-5i0w74q4	246	33	by	by	IN
cord-284501-5i0w74q4	246	34	the	the	DT
cord-284501-5i0w74q4	246	35	structural	structural	JJ
cord-284501-5i0w74q4	246	36	and	and	CC
cord-284501-5i0w74q4	246	37	the	the	DT
cord-284501-5i0w74q4	246	38	accessory	accessory	JJ
cord-284501-5i0w74q4	246	39	genes	gene	NNS
cord-284501-5i0w74q4	246	40	of	of	IN
cord-284501-5i0w74q4	246	41	IBV	IBV	NNP
cord-284501-5i0w74q4	246	42	but	but	CC
cord-284501-5i0w74q4	246	43	resides	reside	VBZ
cord-284501-5i0w74q4	246	44	within	within	IN
cord-284501-5i0w74q4	246	45	the	the	DT
cord-284501-5i0w74q4	246	46	replicase	replicase	NN
cord-284501-5i0w74q4	246	47	gene	gene	NN
cord-284501-5i0w74q4	246	48	.	.	.
cord-284501-5i0w74q4	247	1	Our	-PRON-	PRP$
cord-284501-5i0w74q4	247	2	results	result	NNS
cord-284501-5i0w74q4	247	3	demonstrating	demonstrate	VBG
cord-284501-5i0w74q4	247	4	that	that	IN
cord-284501-5i0w74q4	247	5	the	the	DT
cord-284501-5i0w74q4	247	6	IBV	IBV	NNP
cord-284501-5i0w74q4	247	7	replicase	replicase	NN
cord-284501-5i0w74q4	247	8	gene	gene	NN
cord-284501-5i0w74q4	247	9	is	be	VBZ
cord-284501-5i0w74q4	247	10	a	a	DT
cord-284501-5i0w74q4	247	11	determinant	determinant	NN
cord-284501-5i0w74q4	247	12	of	of	IN
cord-284501-5i0w74q4	247	13	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	247	14	differs	differ	VBZ
cord-284501-5i0w74q4	247	15	from	from	IN
cord-284501-5i0w74q4	247	16	the	the	DT
cord-284501-5i0w74q4	247	17	conclusion	conclusion	NN
cord-284501-5i0w74q4	247	18	by	by	IN
cord-284501-5i0w74q4	247	19	Navas	Navas	NNP
cord-284501-5i0w74q4	247	20	-	-	HYPH
cord-284501-5i0w74q4	247	21	Martin	Martin	NNP
cord-284501-5i0w74q4	247	22	et	et	NNP
cord-284501-5i0w74q4	247	23	al	al	NNP
cord-284501-5i0w74q4	247	24	.	.	.
cord-284501-5i0w74q4	248	1	[	[	-LRB-
cord-284501-5i0w74q4	248	2	45	45	CD
cord-284501-5i0w74q4	248	3	]	]	-RRB-
cord-284501-5i0w74q4	248	4	who	who	WP
cord-284501-5i0w74q4	248	5	reported	report	VBD
cord-284501-5i0w74q4	248	6	that	that	IN
cord-284501-5i0w74q4	248	7	the	the	DT
cord-284501-5i0w74q4	248	8	differences	difference	NNS
cord-284501-5i0w74q4	248	9	in	in	IN
cord-284501-5i0w74q4	248	10	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	248	11	between	between	IN
cord-284501-5i0w74q4	248	12	two	two	CD
cord-284501-5i0w74q4	248	13	strains	strain	NNS
cord-284501-5i0w74q4	248	14	of	of	IN
cord-284501-5i0w74q4	248	15	the	the	DT
cord-284501-5i0w74q4	248	16	murine	murine	JJ
cord-284501-5i0w74q4	248	17	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	248	18	mouse	mouse	NN
cord-284501-5i0w74q4	248	19	hepatitis	hepatitis	NN
cord-284501-5i0w74q4	248	20	virus	virus	NN
cord-284501-5i0w74q4	248	21	(	(	-LRB-
cord-284501-5i0w74q4	248	22	MHV	MHV	NNP
cord-284501-5i0w74q4	248	23	)	)	-RRB-
cord-284501-5i0w74q4	248	24	,	,	,
cord-284501-5i0w74q4	248	25	MHV	MHV	NNP
cord-284501-5i0w74q4	248	26	-	-	HYPH
cord-284501-5i0w74q4	248	27	JHM	JHM	NNP
cord-284501-5i0w74q4	248	28	and	and	CC
cord-284501-5i0w74q4	248	29	MHV	MHV	NNP
cord-284501-5i0w74q4	248	30	-	-	HYPH
cord-284501-5i0w74q4	248	31	A59	A59	NNP
cord-284501-5i0w74q4	248	32	,	,	,
cord-284501-5i0w74q4	248	33	mapped	map	VBN
cord-284501-5i0w74q4	248	34	to	to	IN
cord-284501-5i0w74q4	248	35	the	the	DT
cord-284501-5i0w74q4	248	36	MHV	MHV	NNP
cord-284501-5i0w74q4	248	37	genome	genome	NN
cord-284501-5i0w74q4	248	38	encoding	encode	VBG
cord-284501-5i0w74q4	248	39	the	the	DT
cord-284501-5i0w74q4	248	40	structural	structural	JJ
cord-284501-5i0w74q4	248	41	and	and	CC
cord-284501-5i0w74q4	248	42	accessory	accessory	NN
cord-284501-5i0w74q4	248	43	genes	gene	NNS
cord-284501-5i0w74q4	248	44	downstream	downstream	RB
cord-284501-5i0w74q4	248	45	of	of	IN
cord-284501-5i0w74q4	248	46	the	the	DT
cord-284501-5i0w74q4	248	47	haemagglutinin	haemagglutinin	JJ
cord-284501-5i0w74q4	248	48	esterase	esterase	NN
cord-284501-5i0w74q4	248	49	(	(	-LRB-
cord-284501-5i0w74q4	248	50	HE	he	NN
cord-284501-5i0w74q4	248	51	)	)	-RRB-
cord-284501-5i0w74q4	248	52	gene	gene	NN
cord-284501-5i0w74q4	248	53	.	.	.
cord-284501-5i0w74q4	249	1	The	the	DT
cord-284501-5i0w74q4	249	2	replicase	replicase	NN
cord-284501-5i0w74q4	249	3	gene	gene	NN
cord-284501-5i0w74q4	249	4	was	be	VBD
cord-284501-5i0w74q4	249	5	interchangeable	interchangeable	JJ
cord-284501-5i0w74q4	249	6	between	between	IN
cord-284501-5i0w74q4	249	7	the	the	DT
cord-284501-5i0w74q4	249	8	two	two	CD
cord-284501-5i0w74q4	249	9	virus	virus	NN
cord-284501-5i0w74q4	249	10	genomes	genome	NNS
cord-284501-5i0w74q4	249	11	but	but	CC
cord-284501-5i0w74q4	249	12	the	the	DT
cord-284501-5i0w74q4	249	13	differences	difference	NNS
cord-284501-5i0w74q4	249	14	in	in	IN
cord-284501-5i0w74q4	249	15	pathogenicities	pathogenicitie	NNS
cord-284501-5i0w74q4	249	16	associated	associate	VBN
cord-284501-5i0w74q4	249	17	with	with	IN
cord-284501-5i0w74q4	249	18	two	two	CD
cord-284501-5i0w74q4	249	19	viruses	virus	NNS
cord-284501-5i0w74q4	249	20	did	do	VBD
cord-284501-5i0w74q4	249	21	not	not	RB
cord-284501-5i0w74q4	249	22	appear	appear	VB
cord-284501-5i0w74q4	249	23	to	to	TO
cord-284501-5i0w74q4	249	24	correlate	correlate	VB
cord-284501-5i0w74q4	249	25	with	with	IN
cord-284501-5i0w74q4	249	26	the	the	DT
cord-284501-5i0w74q4	249	27	replicase	replicase	NN
cord-284501-5i0w74q4	249	28	genes	gene	NNS
cord-284501-5i0w74q4	249	29	of	of	IN
cord-284501-5i0w74q4	249	30	the	the	DT
cord-284501-5i0w74q4	249	31	rMHVs	rmhvs	CD
cord-284501-5i0w74q4	249	32	generated	generate	VBN
cord-284501-5i0w74q4	249	33	.	.	.
cord-284501-5i0w74q4	250	1	However	however	RB
cord-284501-5i0w74q4	250	2	,	,	,
cord-284501-5i0w74q4	250	3	a	a	DT
cord-284501-5i0w74q4	250	4	major	major	JJ
cord-284501-5i0w74q4	250	5	difference	difference	NN
cord-284501-5i0w74q4	250	6	between	between	IN
cord-284501-5i0w74q4	250	7	the	the	DT
cord-284501-5i0w74q4	250	8	two	two	CD
cord-284501-5i0w74q4	250	9	MHV	MHV	NNP
cord-284501-5i0w74q4	250	10	isolates	isolate	NNS
cord-284501-5i0w74q4	250	11	and	and	CC
cord-284501-5i0w74q4	250	12	the	the	DT
cord-284501-5i0w74q4	250	13	two	two	CD
cord-284501-5i0w74q4	250	14	IBV	IBV	NNP
cord-284501-5i0w74q4	250	15	viruses	virus	NNS
cord-284501-5i0w74q4	250	16	we	-PRON-	PRP
cord-284501-5i0w74q4	250	17	used	use	VBD
cord-284501-5i0w74q4	250	18	was	be	VBD
cord-284501-5i0w74q4	250	19	that	that	IN
cord-284501-5i0w74q4	250	20	the	the	DT
cord-284501-5i0w74q4	250	21	two	two	CD
cord-284501-5i0w74q4	250	22	MHVs	mhv	NNS
cord-284501-5i0w74q4	250	23	were	be	VBD
cord-284501-5i0w74q4	250	24	pathogenic	pathogenic	JJ
cord-284501-5i0w74q4	250	25	but	but	CC
cord-284501-5i0w74q4	250	26	demonstrated	demonstrate	VBD
cord-284501-5i0w74q4	250	27	different	different	JJ
cord-284501-5i0w74q4	250	28	pathogenicities	pathogenicitie	NNS
cord-284501-5i0w74q4	250	29	,	,	,
cord-284501-5i0w74q4	250	30	neurovirulence	neurovirulence	NNP
cord-284501-5i0w74q4	250	31	and	and	CC
cord-284501-5i0w74q4	250	32	hepatitis	hepatitis	NNP
cord-284501-5i0w74q4	250	33	,	,	,
cord-284501-5i0w74q4	250	34	respectively	respectively	RB
cord-284501-5i0w74q4	250	35	,	,	,
cord-284501-5i0w74q4	250	36	whereas	whereas	IN
cord-284501-5i0w74q4	250	37	the	the	DT
cord-284501-5i0w74q4	250	38	difference	difference	NN
cord-284501-5i0w74q4	250	39	between	between	IN
cord-284501-5i0w74q4	250	40	the	the	DT
cord-284501-5i0w74q4	250	41	two	two	CD
cord-284501-5i0w74q4	250	42	IBV	IBV	NNP
cord-284501-5i0w74q4	250	43	isolates	isolate	NNS
cord-284501-5i0w74q4	250	44	used	use	VBN
cord-284501-5i0w74q4	250	45	in	in	IN
cord-284501-5i0w74q4	250	46	this	this	DT
cord-284501-5i0w74q4	250	47	work	work	NN
cord-284501-5i0w74q4	250	48	was	be	VBD
cord-284501-5i0w74q4	250	49	that	that	IN
cord-284501-5i0w74q4	250	50	one	one	CD
cord-284501-5i0w74q4	250	51	causes	cause	VBZ
cord-284501-5i0w74q4	250	52	disease	disease	NN
cord-284501-5i0w74q4	250	53	and	and	CC
cord-284501-5i0w74q4	250	54	the	the	DT
cord-284501-5i0w74q4	250	55	other	other	JJ
cord-284501-5i0w74q4	250	56	does	do	VBZ
cord-284501-5i0w74q4	250	57	not	not	RB
cord-284501-5i0w74q4	250	58	.	.	.
cord-284501-5i0w74q4	251	1	It	-PRON-	PRP
cord-284501-5i0w74q4	251	2	is	be	VBZ
cord-284501-5i0w74q4	251	3	clear	clear	JJ
cord-284501-5i0w74q4	251	4	from	from	IN
cord-284501-5i0w74q4	251	5	the	the	DT
cord-284501-5i0w74q4	251	6	MHV	MHV	NNP
cord-284501-5i0w74q4	251	7	work	work	NN
cord-284501-5i0w74q4	251	8	that	that	WDT
cord-284501-5i0w74q4	251	9	both	both	DT
cord-284501-5i0w74q4	251	10	replicase	replicase	NN
cord-284501-5i0w74q4	251	11	sequences	sequence	NNS
cord-284501-5i0w74q4	251	12	are	be	VBP
cord-284501-5i0w74q4	251	13	of	of	IN
cord-284501-5i0w74q4	251	14	a	a	DT
cord-284501-5i0w74q4	251	15	'	'	``
cord-284501-5i0w74q4	251	16	'	'	``
cord-284501-5i0w74q4	251	17	virulent	virulent	JJ
cord-284501-5i0w74q4	251	18	'	'	''
cord-284501-5i0w74q4	251	19	'	'	''
cord-284501-5i0w74q4	251	20	phenotype	phenotype	NN
cord-284501-5i0w74q4	251	21	and	and	CC
cord-284501-5i0w74q4	251	22	that	that	IN
cord-284501-5i0w74q4	251	23	the	the	DT
cord-284501-5i0w74q4	251	24	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	251	25	phenotype	phenotype	NN
cord-284501-5i0w74q4	251	26	of	of	IN
cord-284501-5i0w74q4	251	27	the	the	DT
cord-284501-5i0w74q4	251	28	recombinant	recombinant	JJ
cord-284501-5i0w74q4	251	29	viruses	virus	NNS
cord-284501-5i0w74q4	251	30	is	be	VBZ
cord-284501-5i0w74q4	251	31	associated	associate	VBN
cord-284501-5i0w74q4	251	32	with	with	IN
cord-284501-5i0w74q4	251	33	the	the	DT
cord-284501-5i0w74q4	251	34	structural	structural	JJ
cord-284501-5i0w74q4	251	35	and	and	CC
cord-284501-5i0w74q4	251	36	accessory	accessory	JJ
cord-284501-5i0w74q4	251	37	genes	gene	NNS
cord-284501-5i0w74q4	251	38	.	.	.
cord-284501-5i0w74q4	252	1	In	in	IN
cord-284501-5i0w74q4	252	2	contrast	contrast	NN
cord-284501-5i0w74q4	252	3	our	-PRON-	PRP$
cord-284501-5i0w74q4	252	4	results	result	NNS
cord-284501-5i0w74q4	252	5	demonstrated	demonstrate	VBD
cord-284501-5i0w74q4	252	6	that	that	IN
cord-284501-5i0w74q4	252	7	loss	loss	NN
cord-284501-5i0w74q4	252	8	of	of	IN
cord-284501-5i0w74q4	252	9	virulence	virulence	NN
cord-284501-5i0w74q4	252	10	per	per	FW
cord-284501-5i0w74q4	252	11	se	se	FW
cord-284501-5i0w74q4	252	12	can	can	MD
cord-284501-5i0w74q4	252	13	be	be	VB
cord-284501-5i0w74q4	252	14	determined	determine	VBN
cord-284501-5i0w74q4	252	15	by	by	IN
cord-284501-5i0w74q4	252	16	some	some	DT
cord-284501-5i0w74q4	252	17	attenuating	attenuate	VBG
cord-284501-5i0w74q4	252	18	modification	modification	NN
cord-284501-5i0w74q4	252	19	to	to	IN
cord-284501-5i0w74q4	252	20	one	one	CD
cord-284501-5i0w74q4	252	21	or	or	CC
cord-284501-5i0w74q4	252	22	more	more	JJR
cord-284501-5i0w74q4	252	23	of	of	IN
cord-284501-5i0w74q4	252	24	the	the	DT
cord-284501-5i0w74q4	252	25	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	252	26	replicase	replicase	NN
cord-284501-5i0w74q4	252	27	components	component	NNS
cord-284501-5i0w74q4	252	28	.	.	.
cord-284501-5i0w74q4	253	1	Recent	recent	JJ
cord-284501-5i0w74q4	253	2	work	work	NN
cord-284501-5i0w74q4	253	3	involving	involve	VBG
cord-284501-5i0w74q4	253	4	the	the	DT
cord-284501-5i0w74q4	253	5	attenuation	attenuation	NN
cord-284501-5i0w74q4	253	6	of	of	IN
cord-284501-5i0w74q4	253	7	a	a	DT
cord-284501-5i0w74q4	253	8	nephropathogenic	nephropathogenic	JJ
cord-284501-5i0w74q4	253	9	strain	strain	NN
cord-284501-5i0w74q4	253	10	of	of	IN
cord-284501-5i0w74q4	253	11	IBV	IBV	NNP
cord-284501-5i0w74q4	253	12	by	by	IN
cord-284501-5i0w74q4	253	13	serial	serial	JJ
cord-284501-5i0w74q4	253	14	passage	passage	NN
cord-284501-5i0w74q4	253	15	in	in	IN
cord-284501-5i0w74q4	253	16	embryonated	embryonate	VBN
cord-284501-5i0w74q4	253	17	chicken	chicken	NN
cord-284501-5i0w74q4	253	18	eggs	egg	NNS
cord-284501-5i0w74q4	253	19	,	,	,
cord-284501-5i0w74q4	253	20	reported	report	VBD
cord-284501-5i0w74q4	253	21	that	that	IN
cord-284501-5i0w74q4	253	22	the	the	DT
cord-284501-5i0w74q4	253	23	virus	virus	NN
cord-284501-5i0w74q4	253	24	became	become	VBD
cord-284501-5i0w74q4	253	25	fully	fully	RB
cord-284501-5i0w74q4	253	26	attenuated	attenuate	VBN
cord-284501-5i0w74q4	253	27	by	by	IN
cord-284501-5i0w74q4	253	28	passage	passage	NN
cord-284501-5i0w74q4	253	29	P	p	NN
cord-284501-5i0w74q4	253	30	110	110	CD
cord-284501-5i0w74q4	253	31	[	[	-LRB-
cord-284501-5i0w74q4	253	32	46	46	CD
cord-284501-5i0w74q4	253	33	]	]	-RRB-
cord-284501-5i0w74q4	253	34	.	.	.
cord-284501-5i0w74q4	254	1	Sequence	sequence	NN
cord-284501-5i0w74q4	254	2	analysis	analysis	NN
cord-284501-5i0w74q4	254	3	of	of	IN
cord-284501-5i0w74q4	254	4	the	the	DT
cord-284501-5i0w74q4	254	5	39	39	CD
cord-284501-5i0w74q4	254	6	-	-	SYM
cord-284501-5i0w74q4	254	7	7	7	CD
cord-284501-5i0w74q4	254	8	kb	kb	NNP
cord-284501-5i0w74q4	254	9	(	(	-LRB-
cord-284501-5i0w74q4	254	10	S	S	NNP
cord-284501-5i0w74q4	254	11	gene	gene	NN
cord-284501-5i0w74q4	254	12	to	to	TO
cord-284501-5i0w74q4	254	13	poly(A	poly(a	VB
cord-284501-5i0w74q4	254	14	)	)	-RRB-
cord-284501-5i0w74q4	255	1	tail	tail	NNP
cord-284501-5i0w74q4	255	2	)	)	-RRB-
cord-284501-5i0w74q4	255	3	region	region	NN
cord-284501-5i0w74q4	255	4	of	of	IN
cord-284501-5i0w74q4	255	5	the	the	DT
cord-284501-5i0w74q4	255	6	genome	genome	NN
cord-284501-5i0w74q4	255	7	from	from	IN
cord-284501-5i0w74q4	255	8	the	the	DT
cord-284501-5i0w74q4	255	9	P	p	NN
cord-284501-5i0w74q4	255	10	110	110	CD
cord-284501-5i0w74q4	255	11	virus	virus	NN
cord-284501-5i0w74q4	255	12	identified	identify	VBD
cord-284501-5i0w74q4	255	13	several	several	JJ
cord-284501-5i0w74q4	255	14	amino	amino	NN
cord-284501-5i0w74q4	255	15	acid	acid	NN
cord-284501-5i0w74q4	255	16	substitutions	substitution	NNS
cord-284501-5i0w74q4	255	17	and	and	CC
cord-284501-5i0w74q4	255	18	a	a	DT
cord-284501-5i0w74q4	255	19	109	109	CD
cord-284501-5i0w74q4	255	20	nt	nt	RB
cord-284501-5i0w74q4	255	21	deletion	deletion	NN
cord-284501-5i0w74q4	255	22	within	within	IN
cord-284501-5i0w74q4	255	23	the	the	DT
cord-284501-5i0w74q4	255	24	39	39	CD
cord-284501-5i0w74q4	255	25	UTR	UTR	NNP
cord-284501-5i0w74q4	255	26	when	when	WRB
cord-284501-5i0w74q4	255	27	compared	compare	VBN
cord-284501-5i0w74q4	255	28	to	to	IN
cord-284501-5i0w74q4	255	29	P	p	NN
cord-284501-5i0w74q4	255	30	0	0	CD
cord-284501-5i0w74q4	255	31	virus	virus	NN
cord-284501-5i0w74q4	255	32	.	.	.
cord-284501-5i0w74q4	256	1	The	the	DT
cord-284501-5i0w74q4	256	2	authors	author	NNS
cord-284501-5i0w74q4	256	3	reported	report	VBD
cord-284501-5i0w74q4	256	4	that	that	IN
cord-284501-5i0w74q4	256	5	the	the	DT
cord-284501-5i0w74q4	256	6	changes	change	NNS
cord-284501-5i0w74q4	256	7	identified	identify	VBN
cord-284501-5i0w74q4	256	8	were	be	VBD
cord-284501-5i0w74q4	256	9	potentially	potentially	RB
cord-284501-5i0w74q4	256	10	responsible	responsible	JJ
cord-284501-5i0w74q4	256	11	for	for	IN
cord-284501-5i0w74q4	256	12	attenuation	attenuation	NN
cord-284501-5i0w74q4	256	13	;	;	:
cord-284501-5i0w74q4	256	14	they	-PRON-	PRP
cord-284501-5i0w74q4	256	15	did	do	VBD
cord-284501-5i0w74q4	256	16	not	not	RB
cord-284501-5i0w74q4	256	17	report	report	VB
cord-284501-5i0w74q4	256	18	any	any	DT
cord-284501-5i0w74q4	256	19	changes	change	NNS
cord-284501-5i0w74q4	256	20	within	within	IN
cord-284501-5i0w74q4	256	21	the	the	DT
cord-284501-5i0w74q4	256	22	replicase	replicase	NN
cord-284501-5i0w74q4	256	23	gene	gene	NN
cord-284501-5i0w74q4	256	24	of	of	IN
cord-284501-5i0w74q4	256	25	the	the	DT
cord-284501-5i0w74q4	256	26	P	p	NN
cord-284501-5i0w74q4	256	27	110	110	CD
cord-284501-5i0w74q4	256	28	virus	virus	NN
cord-284501-5i0w74q4	256	29	and	and	CC
cord-284501-5i0w74q4	256	30	indicated	indicate	VBD
cord-284501-5i0w74q4	256	31	that	that	IN
cord-284501-5i0w74q4	256	32	other	other	JJ
cord-284501-5i0w74q4	256	33	changes	change	NNS
cord-284501-5i0w74q4	256	34	,	,	,
cord-284501-5i0w74q4	256	35	apart	apart	RB
cord-284501-5i0w74q4	256	36	from	from	IN
cord-284501-5i0w74q4	256	37	those	those	DT
cord-284501-5i0w74q4	256	38	identified	identify	VBN
cord-284501-5i0w74q4	256	39	in	in	IN
cord-284501-5i0w74q4	256	40	the	the	DT
cord-284501-5i0w74q4	256	41	39	39	CD
cord-284501-5i0w74q4	256	42	-	-	SYM
cord-284501-5i0w74q4	256	43	7	7	CD
cord-284501-5i0w74q4	256	44	kb	kb	NNP
cord-284501-5i0w74q4	256	45	region	region	NN
cord-284501-5i0w74q4	256	46	,	,	,
cord-284501-5i0w74q4	256	47	within	within	IN
cord-284501-5i0w74q4	256	48	the	the	DT
cord-284501-5i0w74q4	256	49	genome	genome	NN
cord-284501-5i0w74q4	256	50	may	may	MD
cord-284501-5i0w74q4	256	51	also	also	RB
cord-284501-5i0w74q4	256	52	be	be	VB
cord-284501-5i0w74q4	256	53	involved	involve	VBN
cord-284501-5i0w74q4	256	54	in	in	IN
cord-284501-5i0w74q4	256	55	attenuation	attenuation	NN
cord-284501-5i0w74q4	256	56	.	.	.
cord-284501-5i0w74q4	257	1	Other	other	JJ
cord-284501-5i0w74q4	257	2	workers	worker	NNS
cord-284501-5i0w74q4	257	3	attenuated	attenuate	VBD
cord-284501-5i0w74q4	257	4	the	the	DT
cord-284501-5i0w74q4	257	5	virulent	virulent	JJ
cord-284501-5i0w74q4	257	6	Ark	Ark	NNP
cord-284501-5i0w74q4	257	7	DPI	DPI	NNP
cord-284501-5i0w74q4	257	8	11	11	CD
cord-284501-5i0w74q4	257	9	strain	strain	NN
cord-284501-5i0w74q4	257	10	of	of	IN
cord-284501-5i0w74q4	257	11	IBV	IBV	NNP
cord-284501-5i0w74q4	257	12	following	follow	VBG
cord-284501-5i0w74q4	257	13	101	101	CD
cord-284501-5i0w74q4	257	14	passages	passage	NNS
cord-284501-5i0w74q4	257	15	in	in	IN
cord-284501-5i0w74q4	257	16	embryonated	embryonate	VBN
cord-284501-5i0w74q4	257	17	eggs	egg	NNS
cord-284501-5i0w74q4	257	18	(	(	-LRB-
cord-284501-5i0w74q4	257	19	Ark	Ark	NNP
cord-284501-5i0w74q4	257	20	DPI	DPI	NNP
cord-284501-5i0w74q4	257	21	101	101	CD
cord-284501-5i0w74q4	257	22	)	)	-RRB-
cord-284501-5i0w74q4	257	23	and	and	CC
cord-284501-5i0w74q4	257	24	compared	compare	VBD
cord-284501-5i0w74q4	257	25	the	the	DT
cord-284501-5i0w74q4	257	26	complete	complete	JJ
cord-284501-5i0w74q4	257	27	genomes	genome	NNS
cord-284501-5i0w74q4	257	28	of	of	IN
cord-284501-5i0w74q4	257	29	both	both	DT
cord-284501-5i0w74q4	257	30	viruses	virus	NNS
cord-284501-5i0w74q4	257	31	;	;	:
cord-284501-5i0w74q4	257	32	identifying	identify	VBG
cord-284501-5i0w74q4	257	33	21	21	CD
cord-284501-5i0w74q4	257	34	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	257	35	changes	change	NNS
cord-284501-5i0w74q4	257	36	corresponding	correspond	VBG
cord-284501-5i0w74q4	257	37	to	to	IN
cord-284501-5i0w74q4	257	38	17	17	CD
cord-284501-5i0w74q4	257	39	amino	amino	NN
cord-284501-5i0w74q4	257	40	acid	acid	NN
cord-284501-5i0w74q4	257	41	changes	change	NNS
cord-284501-5i0w74q4	257	42	[	[	-LRB-
cord-284501-5i0w74q4	257	43	47	47	CD
cord-284501-5i0w74q4	257	44	]	]	-RRB-
cord-284501-5i0w74q4	257	45	.	.	.
cord-284501-5i0w74q4	258	1	The	the	DT
cord-284501-5i0w74q4	258	2	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	258	3	changes	change	NNS
cord-284501-5i0w74q4	258	4	resulted	result	VBD
cord-284501-5i0w74q4	258	5	in	in	IN
cord-284501-5i0w74q4	258	6	eight	eight	CD
cord-284501-5i0w74q4	258	7	amino	amino	NN
cord-284501-5i0w74q4	258	8	acid	acid	NN
cord-284501-5i0w74q4	258	9	changes	change	NNS
cord-284501-5i0w74q4	258	10	in	in	IN
cord-284501-5i0w74q4	258	11	Nsp2	Nsp2	NNP
cord-284501-5i0w74q4	258	12	(	(	-LRB-
cord-284501-5i0w74q4	258	13	1	1	CD
cord-284501-5i0w74q4	258	14	)	)	-RRB-
cord-284501-5i0w74q4	258	15	,	,	,
cord-284501-5i0w74q4	258	16	Nsp3	Nsp3	NNP
cord-284501-5i0w74q4	258	17	(	(	-LRB-
cord-284501-5i0w74q4	258	18	3	3	CD
cord-284501-5i0w74q4	258	19	)	)	-RRB-
cord-284501-5i0w74q4	258	20	,	,	,
cord-284501-5i0w74q4	258	21	Nsp6	Nsp6	NNP
cord-284501-5i0w74q4	258	22	(	(	-LRB-
cord-284501-5i0w74q4	258	23	2	2	CD
cord-284501-5i0w74q4	258	24	)	)	-RRB-
cord-284501-5i0w74q4	258	25	,	,	,
cord-284501-5i0w74q4	258	26	Nsp10	Nsp10	NNP
cord-284501-5i0w74q4	258	27	(	(	-LRB-
cord-284501-5i0w74q4	258	28	1	1	CD
cord-284501-5i0w74q4	258	29	)	)	-RRB-
cord-284501-5i0w74q4	258	30	and	and	CC
cord-284501-5i0w74q4	258	31	Nsp13	Nsp13	NNP
cord-284501-5i0w74q4	258	32	(	(	-LRB-
cord-284501-5i0w74q4	258	33	1	1	CD
cord-284501-5i0w74q4	258	34	)	)	-RRB-
cord-284501-5i0w74q4	258	35	of	of	IN
cord-284501-5i0w74q4	258	36	the	the	DT
cord-284501-5i0w74q4	258	37	replicase	replicase	NNP
cord-284501-5i0w74q4	258	38	protein	protein	NN
cord-284501-5i0w74q4	258	39	,	,	,
cord-284501-5i0w74q4	258	40	eight	eight	CD
cord-284501-5i0w74q4	258	41	amino	amino	NN
cord-284501-5i0w74q4	258	42	acid	acid	NN
cord-284501-5i0w74q4	258	43	changes	change	NNS
cord-284501-5i0w74q4	258	44	in	in	IN
cord-284501-5i0w74q4	258	45	the	the	DT
cord-284501-5i0w74q4	258	46	S	S	NNP
cord-284501-5i0w74q4	258	47	protein	protein	NN
cord-284501-5i0w74q4	258	48	and	and	CC
cord-284501-5i0w74q4	258	49	one	one	CD
cord-284501-5i0w74q4	258	50	amino	amino	NN
cord-284501-5i0w74q4	258	51	acid	acid	NN
cord-284501-5i0w74q4	258	52	in	in	IN
cord-284501-5i0w74q4	258	53	ORF	ORF	NNP
cord-284501-5i0w74q4	258	54	5a	5a	CD
cord-284501-5i0w74q4	258	55	and	and	CC
cord-284501-5i0w74q4	258	56	the	the	DT
cord-284501-5i0w74q4	258	57	N	n	CD
cord-284501-5i0w74q4	258	58	protein	protein	NN
cord-284501-5i0w74q4	258	59	.	.	.
cord-284501-5i0w74q4	259	1	The	the	DT
cord-284501-5i0w74q4	259	2	authors	author	NNS
cord-284501-5i0w74q4	259	3	were	be	VBD
cord-284501-5i0w74q4	259	4	unable	unable	JJ
cord-284501-5i0w74q4	259	5	to	to	TO
cord-284501-5i0w74q4	259	6	confirm	confirm	VB
cord-284501-5i0w74q4	259	7	which	which	WDT
cord-284501-5i0w74q4	259	8	amino	amino	NN
cord-284501-5i0w74q4	259	9	acid	acid	NN
cord-284501-5i0w74q4	259	10	changes	change	NNS
cord-284501-5i0w74q4	259	11	were	be	VBD
cord-284501-5i0w74q4	259	12	responsible	responsible	JJ
cord-284501-5i0w74q4	259	13	for	for	IN
cord-284501-5i0w74q4	259	14	loss	loss	NN
cord-284501-5i0w74q4	259	15	of	of	IN
cord-284501-5i0w74q4	259	16	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	259	17	.	.	.
cord-284501-5i0w74q4	260	1	Taking	take	VBG
cord-284501-5i0w74q4	260	2	into	into	IN
cord-284501-5i0w74q4	260	3	consideration	consideration	NN
cord-284501-5i0w74q4	260	4	our	-PRON-	PRP$
cord-284501-5i0w74q4	260	5	results	result	NNS
cord-284501-5i0w74q4	260	6	that	that	IN
cord-284501-5i0w74q4	260	7	loss	loss	NN
cord-284501-5i0w74q4	260	8	of	of	IN
cord-284501-5i0w74q4	260	9	virulence	virulence	NN
cord-284501-5i0w74q4	260	10	associated	associate	VBN
cord-284501-5i0w74q4	260	11	with	with	IN
cord-284501-5i0w74q4	260	12	the	the	DT
cord-284501-5i0w74q4	260	13	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	260	14	strain	strain	NN
cord-284501-5i0w74q4	260	15	resides	reside	VBZ
cord-284501-5i0w74q4	260	16	in	in	IN
cord-284501-5i0w74q4	260	17	the	the	DT
cord-284501-5i0w74q4	260	18	replicase	replicase	NN
cord-284501-5i0w74q4	260	19	and	and	CC
cord-284501-5i0w74q4	260	20	the	the	DT
cord-284501-5i0w74q4	260	21	results	result	NNS
cord-284501-5i0w74q4	260	22	of	of	IN
cord-284501-5i0w74q4	260	23	Ammayappan	Ammayappan	NNP
cord-284501-5i0w74q4	260	24	et	et	NNP
cord-284501-5i0w74q4	260	25	al	al	NNP
cord-284501-5i0w74q4	260	26	.	.	.
cord-284501-5i0w74q4	261	1	[	[	-LRB-
cord-284501-5i0w74q4	261	2	47	47	CD
cord-284501-5i0w74q4	261	3	]	]	-RRB-
cord-284501-5i0w74q4	261	4	,	,	,
cord-284501-5i0w74q4	261	5	it	-PRON-	PRP
cord-284501-5i0w74q4	261	6	is	be	VBZ
cord-284501-5i0w74q4	261	7	possible	possible	JJ
cord-284501-5i0w74q4	261	8	that	that	IN
cord-284501-5i0w74q4	261	9	very	very	RB
cord-284501-5i0w74q4	261	10	few	few	JJ
cord-284501-5i0w74q4	261	11	amino	amino	NN
cord-284501-5i0w74q4	261	12	acid	acid	NN
cord-284501-5i0w74q4	261	13	substitutions	substitution	NNS
cord-284501-5i0w74q4	261	14	within	within	IN
cord-284501-5i0w74q4	261	15	the	the	DT
cord-284501-5i0w74q4	261	16	replicase	replicase	NN
cord-284501-5i0w74q4	261	17	gene	gene	NN
cord-284501-5i0w74q4	261	18	can	can	MD
cord-284501-5i0w74q4	261	19	result	result	VB
cord-284501-5i0w74q4	261	20	in	in	IN
cord-284501-5i0w74q4	261	21	attenuation	attenuation	NN
cord-284501-5i0w74q4	261	22	following	follow	VBG
cord-284501-5i0w74q4	261	23	serial	serial	JJ
cord-284501-5i0w74q4	261	24	passage	passage	NN
cord-284501-5i0w74q4	261	25	in	in	IN
cord-284501-5i0w74q4	261	26	embryonated	embryonate	VBN
cord-284501-5i0w74q4	261	27	eggs	egg	NNS
cord-284501-5i0w74q4	261	28	.	.	.
cord-284501-5i0w74q4	262	1	The	the	DT
cord-284501-5i0w74q4	262	2	replicase	replicase	NN
cord-284501-5i0w74q4	262	3	gene	gene	NN
cord-284501-5i0w74q4	262	4	of	of	IN
cord-284501-5i0w74q4	262	5	IBV	IBV	NNP
cord-284501-5i0w74q4	262	6	encodes	encode	VBZ
cord-284501-5i0w74q4	262	7	15	15	CD
cord-284501-5i0w74q4	262	8	Nsps	Nsps	NNP
cord-284501-5i0w74q4	262	9	,	,	,
cord-284501-5i0w74q4	262	10	some	some	DT
cord-284501-5i0w74q4	262	11	of	of	IN
cord-284501-5i0w74q4	262	12	them	-PRON-	PRP
cord-284501-5i0w74q4	262	13	with	with	IN
cord-284501-5i0w74q4	262	14	known	know	VBN
cord-284501-5i0w74q4	262	15	enzymatic	enzymatic	JJ
cord-284501-5i0w74q4	262	16	functions	function	NNS
cord-284501-5i0w74q4	262	17	[	[	-LRB-
cord-284501-5i0w74q4	262	18	48	48	CD
cord-284501-5i0w74q4	262	19	]	]	-RRB-
cord-284501-5i0w74q4	262	20	.	.	.
cord-284501-5i0w74q4	263	1	How	how	WRB
cord-284501-5i0w74q4	263	2	these	these	DT
cord-284501-5i0w74q4	263	3	proteins	protein	NNS
cord-284501-5i0w74q4	263	4	function	function	VBP
cord-284501-5i0w74q4	263	5	in	in	IN
cord-284501-5i0w74q4	263	6	the	the	DT
cord-284501-5i0w74q4	263	7	context	context	NN
cord-284501-5i0w74q4	263	8	of	of	IN
cord-284501-5i0w74q4	263	9	pathogenesis	pathogenesis	NN
cord-284501-5i0w74q4	263	10	is	be	VBZ
cord-284501-5i0w74q4	263	11	still	still	RB
cord-284501-5i0w74q4	263	12	not	not	RB
cord-284501-5i0w74q4	263	13	well	well	RB
cord-284501-5i0w74q4	263	14	understood	understand	VBN
cord-284501-5i0w74q4	263	15	,	,	,
cord-284501-5i0w74q4	263	16	however	however	RB
cord-284501-5i0w74q4	263	17	,	,	,
cord-284501-5i0w74q4	263	18	some	some	DT
cord-284501-5i0w74q4	263	19	of	of	IN
cord-284501-5i0w74q4	263	20	the	the	DT
cord-284501-5i0w74q4	263	21	Nsps	Nsps	NNP
cord-284501-5i0w74q4	263	22	for	for	IN
cord-284501-5i0w74q4	263	23	other	other	JJ
cord-284501-5i0w74q4	263	24	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	263	25	have	have	VBP
cord-284501-5i0w74q4	263	26	been	be	VBN
cord-284501-5i0w74q4	263	27	linked	link	VBN
cord-284501-5i0w74q4	263	28	to	to	IN
cord-284501-5i0w74q4	263	29	loss	loss	NN
cord-284501-5i0w74q4	263	30	of	of	IN
cord-284501-5i0w74q4	263	31	virulence	virulence	NN
cord-284501-5i0w74q4	263	32	.	.	.
cord-284501-5i0w74q4	264	1	For	for	IN
cord-284501-5i0w74q4	264	2	example	example	NN
cord-284501-5i0w74q4	264	3	,	,	,
cord-284501-5i0w74q4	264	4	the	the	DT
cord-284501-5i0w74q4	264	5	loss	loss	NN
cord-284501-5i0w74q4	264	6	of	of	IN
cord-284501-5i0w74q4	264	7	Nsp1	Nsp1	NNP
cord-284501-5i0w74q4	264	8	from	from	IN
cord-284501-5i0w74q4	264	9	MHV	MHV	NNP
cord-284501-5i0w74q4	264	10	did	do	VBD
cord-284501-5i0w74q4	264	11	not	not	RB
cord-284501-5i0w74q4	264	12	affect	affect	VB
cord-284501-5i0w74q4	264	13	replication	replication	NN
cord-284501-5i0w74q4	264	14	in	in	IN
cord-284501-5i0w74q4	264	15	tissue	tissue	NN
cord-284501-5i0w74q4	264	16	culture	culture	NN
cord-284501-5i0w74q4	264	17	but	but	CC
cord-284501-5i0w74q4	264	18	severely	severely	RB
cord-284501-5i0w74q4	264	19	attenuated	attenuate	VBD
cord-284501-5i0w74q4	264	20	the	the	DT
cord-284501-5i0w74q4	264	21	rMHV	rmhv	NN
cord-284501-5i0w74q4	264	22	in	in	IN
cord-284501-5i0w74q4	264	23	vivo	vivo	NNP
cord-284501-5i0w74q4	264	24	[	[	-LRB-
cord-284501-5i0w74q4	264	25	49	49	CD
cord-284501-5i0w74q4	264	26	]	]	-RRB-
cord-284501-5i0w74q4	264	27	;	;	:
cord-284501-5i0w74q4	264	28	inactivation	inactivation	NN
cord-284501-5i0w74q4	264	29	of	of	IN
cord-284501-5i0w74q4	264	30	the	the	DT
cord-284501-5i0w74q4	264	31	MHV	MHV	NNP
cord-284501-5i0w74q4	264	32	ADP	ADP	NNP
cord-284501-5i0w74q4	264	33	-	-	HYPH
cord-284501-5i0w74q4	264	34	ribose-10phosphatase	ribose-10phosphatase	NN
cord-284501-5i0w74q4	264	35	activity	activity	NN
cord-284501-5i0w74q4	264	36	in	in	IN
cord-284501-5i0w74q4	264	37	Nsp3	Nsp3	NNS
cord-284501-5i0w74q4	264	38	caused	cause	VBD
cord-284501-5i0w74q4	264	39	a	a	DT
cord-284501-5i0w74q4	264	40	reduction	reduction	NN
cord-284501-5i0w74q4	264	41	in	in	IN
cord-284501-5i0w74q4	264	42	virus	virus	NN
cord-284501-5i0w74q4	264	43	replication	replication	NN
cord-284501-5i0w74q4	264	44	in	in	IN
cord-284501-5i0w74q4	264	45	the	the	DT
cord-284501-5i0w74q4	264	46	livers	liver	NNS
cord-284501-5i0w74q4	264	47	of	of	IN
cord-284501-5i0w74q4	264	48	infected	infected	JJ
cord-284501-5i0w74q4	264	49	mice	mouse	NNS
cord-284501-5i0w74q4	264	50	but	but	CC
cord-284501-5i0w74q4	264	51	did	do	VBD
cord-284501-5i0w74q4	264	52	not	not	RB
cord-284501-5i0w74q4	264	53	induce	induce	VB
cord-284501-5i0w74q4	264	54	liver	liver	NN
cord-284501-5i0w74q4	264	55	disease	disease	NN
cord-284501-5i0w74q4	264	56	[	[	-LRB-
cord-284501-5i0w74q4	264	57	50	50	CD
cord-284501-5i0w74q4	264	58	]	]	-RRB-
cord-284501-5i0w74q4	264	59	and	and	CC
cord-284501-5i0w74q4	264	60	a	a	DT
cord-284501-5i0w74q4	264	61	single	single	JJ
cord-284501-5i0w74q4	264	62	amino	amino	NN
cord-284501-5i0w74q4	264	63	acid	acid	NN
cord-284501-5i0w74q4	264	64	change	change	NN
cord-284501-5i0w74q4	264	65	in	in	IN
cord-284501-5i0w74q4	264	66	the	the	DT
cord-284501-5i0w74q4	264	67	MHV	MHV	NNP
cord-284501-5i0w74q4	265	1	Nsp14	Nsp14	NNP
cord-284501-5i0w74q4	265	2	did	do	VBD
cord-284501-5i0w74q4	265	3	not	not	RB
cord-284501-5i0w74q4	265	4	alter	alter	VB
cord-284501-5i0w74q4	265	5	the	the	DT
cord-284501-5i0w74q4	265	6	replication	replication	NN
cord-284501-5i0w74q4	265	7	of	of	IN
cord-284501-5i0w74q4	265	8	the	the	DT
cord-284501-5i0w74q4	265	9	rMHV	rmhv	NN
cord-284501-5i0w74q4	265	10	in	in	IN
cord-284501-5i0w74q4	265	11	tissue	tissue	NN
cord-284501-5i0w74q4	265	12	culture	culture	NN
cord-284501-5i0w74q4	265	13	but	but	CC
cord-284501-5i0w74q4	265	14	resulted	result	VBD
cord-284501-5i0w74q4	265	15	in	in	IN
cord-284501-5i0w74q4	265	16	attenuation	attenuation	NN
cord-284501-5i0w74q4	265	17	in	in	IN
cord-284501-5i0w74q4	265	18	mice	mouse	NNS
cord-284501-5i0w74q4	265	19	[	[	-LRB-
cord-284501-5i0w74q4	265	20	51	51	CD
cord-284501-5i0w74q4	265	21	]	]	-RRB-
cord-284501-5i0w74q4	265	22	.	.	.
cord-284501-5i0w74q4	266	1	Our	-PRON-	PRP$
cord-284501-5i0w74q4	266	2	previous	previous	JJ
cord-284501-5i0w74q4	266	3	spike	spike	NN
cord-284501-5i0w74q4	266	4	swapping	swapping	NN
cord-284501-5i0w74q4	266	5	results	result	NNS
cord-284501-5i0w74q4	266	6	demonstrated	demonstrate	VBD
cord-284501-5i0w74q4	266	7	that	that	IN
cord-284501-5i0w74q4	266	8	introduction	introduction	NN
cord-284501-5i0w74q4	266	9	of	of	IN
cord-284501-5i0w74q4	266	10	an	an	DT
cord-284501-5i0w74q4	266	11	S	S	NNP
cord-284501-5i0w74q4	266	12	protein	protein	NN
cord-284501-5i0w74q4	266	13	from	from	IN
cord-284501-5i0w74q4	266	14	a	a	DT
cord-284501-5i0w74q4	266	15	virulent	virulent	JJ
cord-284501-5i0w74q4	266	16	isolate	isolate	NN
cord-284501-5i0w74q4	266	17	of	of	IN
cord-284501-5i0w74q4	266	18	IBV	IBV	NNP
cord-284501-5i0w74q4	266	19	did	do	VBD
cord-284501-5i0w74q4	266	20	not	not	RB
cord-284501-5i0w74q4	266	21	confer	confer	VB
cord-284501-5i0w74q4	266	22	virulence	virulence	NN
cord-284501-5i0w74q4	266	23	on	on	IN
cord-284501-5i0w74q4	266	24	Beau	Beau	NNP
cord-284501-5i0w74q4	266	25	-	-	HYPH
cord-284501-5i0w74q4	266	26	R	R	NNP
cord-284501-5i0w74q4	266	27	indicating	indicate	VBG
cord-284501-5i0w74q4	266	28	that	that	DT
cord-284501-5i0w74q4	266	29	loss	loss	NN
cord-284501-5i0w74q4	266	30	of	of	IN
cord-284501-5i0w74q4	266	31	virulence	virulence	NN
cord-284501-5i0w74q4	266	32	was	be	VBD
cord-284501-5i0w74q4	266	33	not	not	RB
cord-284501-5i0w74q4	266	34	receptor	receptor	NN
cord-284501-5i0w74q4	266	35	-	-	HYPH
cord-284501-5i0w74q4	266	36	mediated	mediate	VBN
cord-284501-5i0w74q4	266	37	.	.	.
cord-284501-5i0w74q4	267	1	Results	result	NNS
cord-284501-5i0w74q4	267	2	from	from	IN
cord-284501-5i0w74q4	267	3	work	work	NN
cord-284501-5i0w74q4	267	4	described	describe	VBN
cord-284501-5i0w74q4	267	5	here	here	RB
cord-284501-5i0w74q4	267	6	has	have	VBZ
cord-284501-5i0w74q4	267	7	shown	show	VBN
cord-284501-5i0w74q4	267	8	that	that	IN
cord-284501-5i0w74q4	267	9	replacing	replace	VBG
cord-284501-5i0w74q4	267	10	all	all	PDT
cord-284501-5i0w74q4	267	11	the	the	DT
cord-284501-5i0w74q4	267	12	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	267	13	structural	structural	JJ
cord-284501-5i0w74q4	267	14	and	and	CC
cord-284501-5i0w74q4	267	15	accessory	accessory	NN
cord-284501-5i0w74q4	267	16	proteins	protein	NNS
cord-284501-5i0w74q4	267	17	with	with	IN
cord-284501-5i0w74q4	267	18	those	those	DT
cord-284501-5i0w74q4	267	19	from	from	IN
cord-284501-5i0w74q4	267	20	a	a	DT
cord-284501-5i0w74q4	267	21	virulent	virulent	JJ
cord-284501-5i0w74q4	267	22	isolate	isolate	NN
cord-284501-5i0w74q4	267	23	of	of	IN
cord-284501-5i0w74q4	267	24	IBV	IBV	NNP
cord-284501-5i0w74q4	267	25	did	do	VBD
cord-284501-5i0w74q4	267	26	not	not	RB
cord-284501-5i0w74q4	267	27	restore	restore	VB
cord-284501-5i0w74q4	267	28	virulence	virulence	NN
cord-284501-5i0w74q4	267	29	.	.	.
cord-284501-5i0w74q4	268	1	Generation	generation	NN
cord-284501-5i0w74q4	268	2	of	of	IN
cord-284501-5i0w74q4	268	3	the	the	DT
cord-284501-5i0w74q4	268	4	rIBV	ribv	WP
cord-284501-5i0w74q4	268	5	produced	produce	VBN
cord-284501-5i0w74q4	268	6	in	in	IN
cord-284501-5i0w74q4	268	7	this	this	DT
cord-284501-5i0w74q4	268	8	work	work	NN
cord-284501-5i0w74q4	268	9	can	can	MD
cord-284501-5i0w74q4	268	10	either	either	CC
cord-284501-5i0w74q4	268	11	be	be	VB
cord-284501-5i0w74q4	268	12	viewed	view	VBN
cord-284501-5i0w74q4	268	13	as	as	IN
cord-284501-5i0w74q4	268	14	replacing	replace	VBG
cord-284501-5i0w74q4	268	15	the	the	DT
cord-284501-5i0w74q4	268	16	structural	structural	JJ
cord-284501-5i0w74q4	268	17	and	and	CC
cord-284501-5i0w74q4	268	18	accessory	accessory	JJ
cord-284501-5i0w74q4	268	19	genes	gene	NNS
cord-284501-5i0w74q4	268	20	of	of	IN
cord-284501-5i0w74q4	268	21	an	an	DT
cord-284501-5i0w74q4	268	22	avirulent	avirulent	NN
cord-284501-5i0w74q4	268	23	virus	virus	NN
cord-284501-5i0w74q4	268	24	with	with	IN
cord-284501-5i0w74q4	268	25	those	those	DT
cord-284501-5i0w74q4	268	26	of	of	IN
cord-284501-5i0w74q4	268	27	a	a	DT
cord-284501-5i0w74q4	268	28	virulent	virulent	JJ
cord-284501-5i0w74q4	268	29	virus	virus	NN
cord-284501-5i0w74q4	268	30	or	or	CC
cord-284501-5i0w74q4	268	31	replacing	replace	VBG
cord-284501-5i0w74q4	268	32	the	the	DT
cord-284501-5i0w74q4	268	33	replicase	replicase	NN
cord-284501-5i0w74q4	268	34	gene	gene	NN
cord-284501-5i0w74q4	268	35	of	of	IN
cord-284501-5i0w74q4	268	36	a	a	DT
cord-284501-5i0w74q4	268	37	virulent	virulent	JJ
cord-284501-5i0w74q4	268	38	isolate	isolate	NN
cord-284501-5i0w74q4	268	39	(	(	-LRB-
cord-284501-5i0w74q4	268	40	M41-CK	m41-ck	NN
cord-284501-5i0w74q4	268	41	)	)	-RRB-
cord-284501-5i0w74q4	268	42	with	with	IN
cord-284501-5i0w74q4	268	43	one	one	CD
cord-284501-5i0w74q4	268	44	from	from	IN
cord-284501-5i0w74q4	268	45	an	an	DT
cord-284501-5i0w74q4	268	46	avirulent	avirulent	NN
cord-284501-5i0w74q4	268	47	virus	virus	NN
cord-284501-5i0w74q4	268	48	(	(	-LRB-
cord-284501-5i0w74q4	268	49	Beau	Beau	NNP
cord-284501-5i0w74q4	268	50	-	-	HYPH
cord-284501-5i0w74q4	268	51	R	R	NNP
cord-284501-5i0w74q4	268	52	)	)	-RRB-
cord-284501-5i0w74q4	268	53	.	.	.
cord-284501-5i0w74q4	269	1	In	in	IN
cord-284501-5i0w74q4	269	2	either	either	DT
cord-284501-5i0w74q4	269	3	scenario	scenario	NN
cord-284501-5i0w74q4	269	4	our	-PRON-	PRP$
cord-284501-5i0w74q4	269	5	results	result	NNS
cord-284501-5i0w74q4	269	6	indicate	indicate	VBP
cord-284501-5i0w74q4	269	7	that	that	IN
cord-284501-5i0w74q4	269	8	loss	loss	NN
cord-284501-5i0w74q4	269	9	of	of	IN
cord-284501-5i0w74q4	269	10	virulence	virulence	NN
cord-284501-5i0w74q4	269	11	associated	associate	VBN
cord-284501-5i0w74q4	269	12	with	with	IN
cord-284501-5i0w74q4	269	13	IBV	IBV	NNP
cord-284501-5i0w74q4	269	14	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	269	15	resides	reside	VBZ
cord-284501-5i0w74q4	269	16	within	within	IN
cord-284501-5i0w74q4	269	17	one	one	CD
cord-284501-5i0w74q4	269	18	or	or	CC
cord-284501-5i0w74q4	269	19	more	more	JJR
cord-284501-5i0w74q4	269	20	of	of	IN
cord-284501-5i0w74q4	269	21	the	the	DT
cord-284501-5i0w74q4	269	22	15	15	CD
cord-284501-5i0w74q4	269	23	IBV	IBV	NNP
cord-284501-5i0w74q4	269	24	replicase	replicase	NN
cord-284501-5i0w74q4	269	25	proteins	protein	NNS
cord-284501-5i0w74q4	269	26	comprising	comprise	VBG
cord-284501-5i0w74q4	269	27	the	the	DT
cord-284501-5i0w74q4	269	28	IBV	IBV	NNP
cord-284501-5i0w74q4	269	29	replicase	replicase	NN
cord-284501-5i0w74q4	269	30	gene	gene	NN
cord-284501-5i0w74q4	269	31	.	.	.
cord-284501-5i0w74q4	270	1	Virus	virus	NN
cord-284501-5i0w74q4	270	2	taxonomy	taxonomy	NN
cord-284501-5i0w74q4	270	3	Classification	classification	NN
cord-284501-5i0w74q4	270	4	and	and	CC
cord-284501-5i0w74q4	270	5	nomenclature	nomenclature	NN
cord-284501-5i0w74q4	270	6	of	of	IN
cord-284501-5i0w74q4	270	7	viruses	virus	NNS
cord-284501-5i0w74q4	271	1	A	a	DT
cord-284501-5i0w74q4	271	2	comparative	comparative	JJ
cord-284501-5i0w74q4	271	3	sequence	sequence	NN
cord-284501-5i0w74q4	271	4	analysis	analysis	NN
cord-284501-5i0w74q4	271	5	to	to	TO
cord-284501-5i0w74q4	271	6	revise	revise	VB
cord-284501-5i0w74q4	271	7	the	the	DT
cord-284501-5i0w74q4	271	8	current	current	JJ
cord-284501-5i0w74q4	271	9	taxonomy	taxonomy	NN
cord-284501-5i0w74q4	271	10	of	of	IN
cord-284501-5i0w74q4	271	11	the	the	DT
cord-284501-5i0w74q4	271	12	family	family	NN
cord-284501-5i0w74q4	271	13	Coronaviridae	Coronaviridae	NNP
cord-284501-5i0w74q4	271	14	Turkey	Turkey	NNP
cord-284501-5i0w74q4	271	15	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	271	16	is	be	VBZ
cord-284501-5i0w74q4	271	17	more	more	RBR
cord-284501-5i0w74q4	271	18	closely	closely	RB
cord-284501-5i0w74q4	271	19	related	related	JJ
cord-284501-5i0w74q4	271	20	to	to	IN
cord-284501-5i0w74q4	271	21	avian	avian	JJ
cord-284501-5i0w74q4	271	22	infectious	infectious	JJ
cord-284501-5i0w74q4	271	23	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	271	24	virus	virus	NN
cord-284501-5i0w74q4	271	25	than	than	IN
cord-284501-5i0w74q4	271	26	to	to	IN
cord-284501-5i0w74q4	271	27	mammalian	mammalian	JJ
cord-284501-5i0w74q4	271	28	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	271	29	:	:	:
cord-284501-5i0w74q4	271	30	a	a	DT
cord-284501-5i0w74q4	271	31	review	review	NN
cord-284501-5i0w74q4	271	32	Detection	detection	NN
cord-284501-5i0w74q4	271	33	of	of	IN
cord-284501-5i0w74q4	271	34	a	a	DT
cord-284501-5i0w74q4	271	35	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	271	36	from	from	IN
cord-284501-5i0w74q4	271	37	turkey	turkey	NN
cord-284501-5i0w74q4	271	38	poults	poult	NNS
cord-284501-5i0w74q4	271	39	in	in	IN
cord-284501-5i0w74q4	271	40	Europe	Europe	NNP
cord-284501-5i0w74q4	271	41	genetically	genetically	RB
cord-284501-5i0w74q4	271	42	related	relate	VBN
cord-284501-5i0w74q4	271	43	to	to	IN
cord-284501-5i0w74q4	271	44	infectious	infectious	JJ
cord-284501-5i0w74q4	271	45	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	271	46	virus	virus	NN
cord-284501-5i0w74q4	271	47	of	of	IN
cord-284501-5i0w74q4	271	48	chickens	chicken	NNS
cord-284501-5i0w74q4	271	49	Complete	complete	VBP
cord-284501-5i0w74q4	271	50	genomic	genomic	JJ
cord-284501-5i0w74q4	271	51	sequence	sequence	NN
cord-284501-5i0w74q4	271	52	of	of	IN
cord-284501-5i0w74q4	271	53	turkey	turkey	NN
cord-284501-5i0w74q4	271	54	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	271	55	Complete	complete	VB
cord-284501-5i0w74q4	271	56	nucleotide	nucleotide	JJ
cord-284501-5i0w74q4	271	57	sequence	sequence	NN
cord-284501-5i0w74q4	271	58	of	of	IN
cord-284501-5i0w74q4	271	59	polyprotein	polyprotein	JJ
cord-284501-5i0w74q4	271	60	gene	gene	NNP
cord-284501-5i0w74q4	271	61	1	1	CD
cord-284501-5i0w74q4	271	62	and	and	CC
cord-284501-5i0w74q4	271	63	genome	genome	NNP
cord-284501-5i0w74q4	271	64	organization	organization	NN
cord-284501-5i0w74q4	271	65	of	of	IN
cord-284501-5i0w74q4	271	66	turkey	turkey	NNP
cord-284501-5i0w74q4	271	67	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	271	68	Coronaviruses	Coronaviruses	NNPS
cord-284501-5i0w74q4	271	69	from	from	IN
cord-284501-5i0w74q4	271	70	pheasants	pheasant	NNS
cord-284501-5i0w74q4	271	71	(	(	-LRB-
cord-284501-5i0w74q4	271	72	Phasianus	Phasianus	NNP
cord-284501-5i0w74q4	271	73	colchicus	colchicus	NN
cord-284501-5i0w74q4	271	74	)	)	-RRB-
cord-284501-5i0w74q4	271	75	are	be	VBP
cord-284501-5i0w74q4	271	76	genetically	genetically	RB
cord-284501-5i0w74q4	271	77	closely	closely	RB
cord-284501-5i0w74q4	271	78	related	relate	VBN
cord-284501-5i0w74q4	271	79	to	to	IN
cord-284501-5i0w74q4	271	80	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	271	81	of	of	IN
cord-284501-5i0w74q4	271	82	domestic	domestic	JJ
cord-284501-5i0w74q4	271	83	fowl	fowl	NN
cord-284501-5i0w74q4	271	84	(	(	-LRB-
cord-284501-5i0w74q4	271	85	infectious	infectious	JJ
cord-284501-5i0w74q4	271	86	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	271	87	virus	virus	NN
cord-284501-5i0w74q4	271	88	)	)	-RRB-
cord-284501-5i0w74q4	271	89	and	and	CC
cord-284501-5i0w74q4	271	90	turkeys	turkey	NNS
cord-284501-5i0w74q4	271	91	Molecular	molecular	JJ
cord-284501-5i0w74q4	271	92	identification	identification	NN
cord-284501-5i0w74q4	271	93	and	and	CC
cord-284501-5i0w74q4	271	94	characterization	characterization	NN
cord-284501-5i0w74q4	271	95	of	of	IN
cord-284501-5i0w74q4	271	96	novel	novel	NN
cord-284501-5i0w74q4	271	97	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	271	98	infecting	infect	VBG
cord-284501-5i0w74q4	271	99	graylag	graylag	NNP
cord-284501-5i0w74q4	271	100	geese	goose	NNS
cord-284501-5i0w74q4	271	101	(	(	-LRB-
cord-284501-5i0w74q4	271	102	Anser	Anser	NNP
cord-284501-5i0w74q4	271	103	anser	anser	NNP
cord-284501-5i0w74q4	271	104	)	)	-RRB-
cord-284501-5i0w74q4	271	105	,	,	,
cord-284501-5i0w74q4	271	106	feral	feral	JJ
cord-284501-5i0w74q4	271	107	pigeons	pigeon	NNS
cord-284501-5i0w74q4	271	108	(	(	-LRB-
cord-284501-5i0w74q4	271	109	Columbia	Columbia	NNP
cord-284501-5i0w74q4	271	110	livia	livia	NNP
cord-284501-5i0w74q4	271	111	)	)	-RRB-
cord-284501-5i0w74q4	271	112	and	and	CC
cord-284501-5i0w74q4	271	113	mallards	mallard	NNS
cord-284501-5i0w74q4	271	114	(	(	-LRB-
cord-284501-5i0w74q4	271	115	Anas	Anas	NNP
cord-284501-5i0w74q4	271	116	platyrhynchos	platyrhynchos	NN
cord-284501-5i0w74q4	271	117	)	)	-RRB-
cord-284501-5i0w74q4	272	1	Comparative	comparative	JJ
cord-284501-5i0w74q4	272	2	analysis	analysis	NN
cord-284501-5i0w74q4	272	3	of	of	IN
cord-284501-5i0w74q4	272	4	complete	complete	JJ
cord-284501-5i0w74q4	272	5	genome	genome	NN
cord-284501-5i0w74q4	272	6	sequences	sequence	NNS
cord-284501-5i0w74q4	272	7	of	of	IN
cord-284501-5i0w74q4	272	8	three	three	CD
cord-284501-5i0w74q4	272	9	avian	avian	JJ
cord-284501-5i0w74q4	272	10	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	272	11	reveals	reveal	VBZ
cord-284501-5i0w74q4	272	12	a	a	DT
cord-284501-5i0w74q4	272	13	novel	novel	JJ
cord-284501-5i0w74q4	272	14	group	group	NN
cord-284501-5i0w74q4	272	15	3c	3c	CD
cord-284501-5i0w74q4	272	16	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	272	17	Identification	Identification	NNP
cord-284501-5i0w74q4	272	18	of	of	IN
cord-284501-5i0w74q4	272	19	a	a	DT
cord-284501-5i0w74q4	272	20	novel	novel	JJ
cord-284501-5i0w74q4	272	21	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	272	22	from	from	IN
cord-284501-5i0w74q4	272	23	a	a	DT
cord-284501-5i0w74q4	272	24	beluga	beluga	NN
cord-284501-5i0w74q4	272	25	whale	whale	NN
cord-284501-5i0w74q4	272	26	by	by	IN
cord-284501-5i0w74q4	272	27	using	use	VBG
cord-284501-5i0w74q4	272	28	a	a	DT
cord-284501-5i0w74q4	272	29	panviral	panviral	JJ
cord-284501-5i0w74q4	272	30	microarray	microarray	NN
cord-284501-5i0w74q4	272	31	Detection	detection	NN
cord-284501-5i0w74q4	272	32	of	of	IN
cord-284501-5i0w74q4	272	33	a	a	DT
cord-284501-5i0w74q4	272	34	novel	novel	NN
cord-284501-5i0w74q4	272	35	and	and	CC
cord-284501-5i0w74q4	272	36	highly	highly	RB
cord-284501-5i0w74q4	272	37	divergent	divergent	JJ
cord-284501-5i0w74q4	272	38	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	272	39	from	from	IN
cord-284501-5i0w74q4	272	40	asian	asian	JJ
cord-284501-5i0w74q4	272	41	leopard	leopard	NN
cord-284501-5i0w74q4	272	42	cats	cat	NNS
cord-284501-5i0w74q4	272	43	and	and	CC
cord-284501-5i0w74q4	272	44	Chinese	chinese	JJ
cord-284501-5i0w74q4	272	45	ferret	ferret	JJ
cord-284501-5i0w74q4	272	46	badgers	badger	NNS
cord-284501-5i0w74q4	272	47	in	in	IN
cord-284501-5i0w74q4	272	48	Southern	Southern	NNP
cord-284501-5i0w74q4	272	49	China	China	NNP
cord-284501-5i0w74q4	272	50	Infectious	infectious	JJ
cord-284501-5i0w74q4	272	51	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	272	52	Avian	avian	JJ
cord-284501-5i0w74q4	272	53	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	272	54	diseases	disease	NNS
cord-284501-5i0w74q4	272	55	and	and	CC
cord-284501-5i0w74q4	272	56	infectious	infectious	JJ
cord-284501-5i0w74q4	272	57	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	272	58	vaccine	vaccine	NN
cord-284501-5i0w74q4	272	59	development	development	NN
cord-284501-5i0w74q4	272	60	Coronavirus	Coronavirus	NNP
cord-284501-5i0w74q4	272	61	avian	avian	JJ
cord-284501-5i0w74q4	272	62	infectious	infectious	JJ
cord-284501-5i0w74q4	272	63	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	272	64	virus	virus	NN
cord-284501-5i0w74q4	272	65	Infectious	Infectious	NNP
cord-284501-5i0w74q4	272	66	Bronchitis	Bronchitis	NNP
cord-284501-5i0w74q4	272	67	Nidovirus	Nidovirus	NNP
cord-284501-5i0w74q4	272	68	genome	genome	NN
cord-284501-5i0w74q4	272	69	organization	organization	NN
cord-284501-5i0w74q4	272	70	and	and	CC
cord-284501-5i0w74q4	272	71	expression	expression	NN
cord-284501-5i0w74q4	272	72	mechanisms	mechanism	NNS
cord-284501-5i0w74q4	273	1	Gene	gene	NN
cord-284501-5i0w74q4	273	2	5	5	CD
cord-284501-5i0w74q4	273	3	of	of	IN
cord-284501-5i0w74q4	273	4	the	the	DT
cord-284501-5i0w74q4	273	5	avian	avian	JJ
cord-284501-5i0w74q4	273	6	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	273	7	infectious	infectious	JJ
cord-284501-5i0w74q4	273	8	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	273	9	virus	virus	NN
cord-284501-5i0w74q4	273	10	is	be	VBZ
cord-284501-5i0w74q4	273	11	not	not	RB
cord-284501-5i0w74q4	273	12	essential	essential	JJ
cord-284501-5i0w74q4	273	13	for	for	IN
cord-284501-5i0w74q4	273	14	replication	replication	NN
cord-284501-5i0w74q4	274	1	Neither	neither	CC
cord-284501-5i0w74q4	274	2	the	the	DT
cord-284501-5i0w74q4	274	3	RNA	RNA	NNP
cord-284501-5i0w74q4	274	4	nor	nor	CC
cord-284501-5i0w74q4	274	5	the	the	DT
cord-284501-5i0w74q4	274	6	proteins	protein	NNS
cord-284501-5i0w74q4	274	7	of	of	IN
cord-284501-5i0w74q4	274	8	open	open	JJ
cord-284501-5i0w74q4	274	9	reading	reading	NN
cord-284501-5i0w74q4	274	10	frames	frame	NNS
cord-284501-5i0w74q4	274	11	3a	3a	NNP
cord-284501-5i0w74q4	274	12	and	and	CC
cord-284501-5i0w74q4	274	13	3b	3b	CD
cord-284501-5i0w74q4	274	14	of	of	IN
cord-284501-5i0w74q4	274	15	the	the	DT
cord-284501-5i0w74q4	274	16	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	274	17	infectious	infectious	JJ
cord-284501-5i0w74q4	274	18	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	274	19	virus	virus	NN
cord-284501-5i0w74q4	274	20	are	be	VBP
cord-284501-5i0w74q4	274	21	essential	essential	JJ
cord-284501-5i0w74q4	274	22	for	for	IN
cord-284501-5i0w74q4	274	23	replication	replication	NN
cord-284501-5i0w74q4	274	24	Transmissible	transmissible	JJ
cord-284501-5i0w74q4	274	25	gastroenteritis	gastroenteritis	JJ
cord-284501-5i0w74q4	274	26	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	274	27	gene	gene	NN
cord-284501-5i0w74q4	274	28	7	7	CD
cord-284501-5i0w74q4	274	29	is	be	VBZ
cord-284501-5i0w74q4	274	30	not	not	RB
cord-284501-5i0w74q4	274	31	essential	essential	JJ
cord-284501-5i0w74q4	274	32	but	but	CC
cord-284501-5i0w74q4	274	33	influences	influence	NNS
cord-284501-5i0w74q4	274	34	in	in	IN
cord-284501-5i0w74q4	274	35	vivo	vivo	NN
cord-284501-5i0w74q4	274	36	virus	virus	NN
cord-284501-5i0w74q4	274	37	replication	replication	NN
cord-284501-5i0w74q4	274	38	and	and	CC
cord-284501-5i0w74q4	274	39	virulence	virulence	NN
cord-284501-5i0w74q4	274	40	Heterologous	Heterologous	NNP
cord-284501-5i0w74q4	274	41	gene	gene	NN
cord-284501-5i0w74q4	274	42	expression	expression	NN
cord-284501-5i0w74q4	274	43	from	from	IN
cord-284501-5i0w74q4	274	44	transmissible	transmissible	JJ
cord-284501-5i0w74q4	274	45	gastroenteritis	gastroenteritis	NN
cord-284501-5i0w74q4	274	46	virus	virus	NN
cord-284501-5i0w74q4	274	47	replicon	replicon	NN
cord-284501-5i0w74q4	274	48	particles	particle	NNS
cord-284501-5i0w74q4	274	49	Engineering	engineer	VBG
cord-284501-5i0w74q4	274	50	the	the	DT
cord-284501-5i0w74q4	274	51	transmissible	transmissible	JJ
cord-284501-5i0w74q4	274	52	gastroenteritis	gastroenteritis	NN
cord-284501-5i0w74q4	274	53	virus	virus	NN
cord-284501-5i0w74q4	274	54	genome	genome	NN
cord-284501-5i0w74q4	274	55	as	as	IN
cord-284501-5i0w74q4	274	56	an	an	DT
cord-284501-5i0w74q4	274	57	expression	expression	NN
cord-284501-5i0w74q4	274	58	vector	vector	NN
cord-284501-5i0w74q4	274	59	inducing	induce	VBG
cord-284501-5i0w74q4	274	60	lactogenic	lactogenic	JJ
cord-284501-5i0w74q4	274	61	immunity	immunity	NN
cord-284501-5i0w74q4	274	62	Live	live	RB
cord-284501-5i0w74q4	274	63	,	,	,
cord-284501-5i0w74q4	274	64	attenuated	attenuated	JJ
cord-284501-5i0w74q4	274	65	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	274	66	vaccines	vaccine	NNS
cord-284501-5i0w74q4	274	67	through	through	IN
cord-284501-5i0w74q4	274	68	the	the	DT
cord-284501-5i0w74q4	274	69	directed	direct	VBN
cord-284501-5i0w74q4	274	70	deletion	deletion	NN
cord-284501-5i0w74q4	274	71	of	of	IN
cord-284501-5i0w74q4	274	72	group	group	NN
cord-284501-5i0w74q4	274	73	-	-	HYPH
cord-284501-5i0w74q4	274	74	specific	specific	JJ
cord-284501-5i0w74q4	274	75	genes	gene	NNS
cord-284501-5i0w74q4	274	76	provide	provide	VBP
cord-284501-5i0w74q4	274	77	protection	protection	NN
cord-284501-5i0w74q4	274	78	against	against	IN
cord-284501-5i0w74q4	274	79	feline	feline	JJ
cord-284501-5i0w74q4	274	80	infectious	infectious	JJ
cord-284501-5i0w74q4	274	81	peritonitis	peritonitis	NN
cord-284501-5i0w74q4	274	82	Severe	severe	JJ
cord-284501-5i0w74q4	274	83	acute	acute	JJ
cord-284501-5i0w74q4	274	84	respiratory	respiratory	JJ
cord-284501-5i0w74q4	274	85	syndrome	syndrome	NN
cord-284501-5i0w74q4	274	86	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	274	87	group	group	NN
cord-284501-5i0w74q4	274	88	-	-	HYPH
cord-284501-5i0w74q4	274	89	specific	specific	JJ
cord-284501-5i0w74q4	274	90	open	open	JJ
cord-284501-5i0w74q4	274	91	reading	reading	NN
cord-284501-5i0w74q4	274	92	frames	frame	NNS
cord-284501-5i0w74q4	274	93	encode	encode	VB
cord-284501-5i0w74q4	274	94	nonessential	nonessential	JJ
cord-284501-5i0w74q4	274	95	functions	function	NNS
cord-284501-5i0w74q4	274	96	for	for	IN
cord-284501-5i0w74q4	274	97	replication	replication	NN
cord-284501-5i0w74q4	274	98	in	in	IN
cord-284501-5i0w74q4	274	99	cell	cell	NN
cord-284501-5i0w74q4	274	100	cultures	culture	NNS
cord-284501-5i0w74q4	274	101	and	and	CC
cord-284501-5i0w74q4	274	102	mice	mouse	NNS
cord-284501-5i0w74q4	274	103	Recombinant	recombinant	JJ
cord-284501-5i0w74q4	274	104	avian	avian	JJ
cord-284501-5i0w74q4	274	105	infectious	infectious	JJ
cord-284501-5i0w74q4	274	106	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	274	107	virus	virus	NN
cord-284501-5i0w74q4	274	108	expressing	express	VBG
cord-284501-5i0w74q4	274	109	a	a	DT
cord-284501-5i0w74q4	274	110	heterologous	heterologous	JJ
cord-284501-5i0w74q4	274	111	spike	spike	NN
cord-284501-5i0w74q4	274	112	gene	gene	NN
cord-284501-5i0w74q4	274	113	demonstrates	demonstrate	VBZ
cord-284501-5i0w74q4	274	114	that	that	IN
cord-284501-5i0w74q4	274	115	the	the	DT
cord-284501-5i0w74q4	274	116	spike	spike	NN
cord-284501-5i0w74q4	274	117	protein	protein	NN
cord-284501-5i0w74q4	274	118	is	be	VBZ
cord-284501-5i0w74q4	274	119	a	a	DT
cord-284501-5i0w74q4	274	120	determinant	determinant	NN
cord-284501-5i0w74q4	274	121	of	of	IN
cord-284501-5i0w74q4	274	122	cell	cell	NN
cord-284501-5i0w74q4	274	123	tropism	tropism	NN
cord-284501-5i0w74q4	274	124	Generation	generation	NN
cord-284501-5i0w74q4	274	125	of	of	IN
cord-284501-5i0w74q4	274	126	a	a	DT
cord-284501-5i0w74q4	274	127	recombinant	recombinant	JJ
cord-284501-5i0w74q4	274	128	avian	avian	JJ
cord-284501-5i0w74q4	274	129	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	274	130	infectious	infectious	JJ
cord-284501-5i0w74q4	274	131	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	274	132	virus	virus	NN
cord-284501-5i0w74q4	274	133	using	use	VBG
cord-284501-5i0w74q4	274	134	transient	transient	JJ
cord-284501-5i0w74q4	274	135	dominant	dominant	JJ
cord-284501-5i0w74q4	274	136	selection	selection	NN
cord-284501-5i0w74q4	275	1	Recombinant	recombinant	JJ
cord-284501-5i0w74q4	275	2	infectious	infectious	JJ
cord-284501-5i0w74q4	275	3	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	275	4	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	276	1	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	276	2	with	with	IN
cord-284501-5i0w74q4	276	3	the	the	DT
cord-284501-5i0w74q4	276	4	spike	spike	NN
cord-284501-5i0w74q4	276	5	protein	protein	NN
cord-284501-5i0w74q4	276	6	gene	gene	NN
cord-284501-5i0w74q4	276	7	of	of	IN
cord-284501-5i0w74q4	276	8	the	the	DT
cord-284501-5i0w74q4	276	9	pathogenic	pathogenic	JJ
cord-284501-5i0w74q4	276	10	M41	m41	JJ
cord-284501-5i0w74q4	276	11	strain	strain	NN
cord-284501-5i0w74q4	276	12	remains	remain	VBZ
cord-284501-5i0w74q4	276	13	attenuated	attenuated	JJ
cord-284501-5i0w74q4	276	14	but	but	CC
cord-284501-5i0w74q4	276	15	induces	induce	VBZ
cord-284501-5i0w74q4	276	16	protective	protective	JJ
cord-284501-5i0w74q4	276	17	immunity	immunity	NN
cord-284501-5i0w74q4	276	18	Effect	effect	NN
cord-284501-5i0w74q4	276	19	of	of	IN
cord-284501-5i0w74q4	276	20	serial	serial	JJ
cord-284501-5i0w74q4	276	21	embryo	embryo	NN
cord-284501-5i0w74q4	276	22	passage	passage	NN
cord-284501-5i0w74q4	276	23	of	of	IN
cord-284501-5i0w74q4	276	24	an	an	DT
cord-284501-5i0w74q4	276	25	Arkansas	Arkansas	NNP
cord-284501-5i0w74q4	276	26	-	-	HYPH
cord-284501-5i0w74q4	276	27	type	type	NN
cord-284501-5i0w74q4	276	28	avian	avian	JJ
cord-284501-5i0w74q4	276	29	infectious	infectious	JJ
cord-284501-5i0w74q4	276	30	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	276	31	virus	virus	NN
cord-284501-5i0w74q4	276	32	isolate	isolate	VBP
cord-284501-5i0w74q4	276	33	on	on	IN
cord-284501-5i0w74q4	276	34	clinical	clinical	JJ
cord-284501-5i0w74q4	276	35	response	response	NN
cord-284501-5i0w74q4	276	36	,	,	,
cord-284501-5i0w74q4	276	37	virus	virus	NN
cord-284501-5i0w74q4	276	38	recovery	recovery	NN
cord-284501-5i0w74q4	276	39	and	and	CC
cord-284501-5i0w74q4	276	40	immunity	immunity	NN
cord-284501-5i0w74q4	276	41	Attenuation	attenuation	NN
cord-284501-5i0w74q4	276	42	,	,	,
cord-284501-5i0w74q4	276	43	safety	safety	NN
cord-284501-5i0w74q4	276	44	and	and	CC
cord-284501-5i0w74q4	276	45	efficacy	efficacy	NN
cord-284501-5i0w74q4	276	46	of	of	IN
cord-284501-5i0w74q4	276	47	an	an	DT
cord-284501-5i0w74q4	276	48	infectious	infectious	JJ
cord-284501-5i0w74q4	276	49	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	276	50	virus	virus	NN
cord-284501-5i0w74q4	276	51	GA98	GA98	NNP
cord-284501-5i0w74q4	276	52	serotype	serotype	NN
cord-284501-5i0w74q4	276	53	vaccine	vaccine	NN
cord-284501-5i0w74q4	276	54	Development	development	NN
cord-284501-5i0w74q4	276	55	and	and	CC
cord-284501-5i0w74q4	276	56	use	use	NN
cord-284501-5i0w74q4	276	57	of	of	IN
cord-284501-5i0w74q4	276	58	the	the	DT
cord-284501-5i0w74q4	276	59	H	H	NNP
cord-284501-5i0w74q4	276	60	strain	strain	NN
cord-284501-5i0w74q4	276	61	of	of	IN
cord-284501-5i0w74q4	276	62	avian	avian	JJ
cord-284501-5i0w74q4	276	63	infectious	infectious	JJ
cord-284501-5i0w74q4	276	64	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	276	65	virus	virus	NN
cord-284501-5i0w74q4	276	66	from	from	IN
cord-284501-5i0w74q4	276	67	The	the	DT
cord-284501-5i0w74q4	276	68	Netherlands	Netherlands	NNP
cord-284501-5i0w74q4	276	69	as	as	IN
cord-284501-5i0w74q4	276	70	a	a	DT
cord-284501-5i0w74q4	276	71	vaccine	vaccine	NN
cord-284501-5i0w74q4	276	72	:	:	:
cord-284501-5i0w74q4	276	73	a	a	DT
cord-284501-5i0w74q4	276	74	review	review	NN
cord-284501-5i0w74q4	277	1	The	the	DT
cord-284501-5i0w74q4	277	2	pathogenesis	pathogenesis	NN
cord-284501-5i0w74q4	277	3	of	of	IN
cord-284501-5i0w74q4	277	4	virulent	virulent	JJ
cord-284501-5i0w74q4	277	5	and	and	CC
cord-284501-5i0w74q4	277	6	avirulent	avirulent	JJ
cord-284501-5i0w74q4	277	7	avian	avian	JJ
cord-284501-5i0w74q4	277	8	infectious	infectious	JJ
cord-284501-5i0w74q4	277	9	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	277	10	virus	virus	NN
cord-284501-5i0w74q4	277	11	Characterization	characterization	NN
cord-284501-5i0w74q4	277	12	of	of	IN
cord-284501-5i0w74q4	277	13	a	a	DT
cord-284501-5i0w74q4	277	14	replicating	replicate	VBG
cord-284501-5i0w74q4	277	15	and	and	CC
cord-284501-5i0w74q4	277	16	packaged	package	VBN
cord-284501-5i0w74q4	277	17	defective	defective	JJ
cord-284501-5i0w74q4	277	18	RNA	RNA	NNP
cord-284501-5i0w74q4	277	19	of	of	IN
cord-284501-5i0w74q4	277	20	avian	avian	JJ
cord-284501-5i0w74q4	277	21	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	277	22	infectious	infectious	JJ
cord-284501-5i0w74q4	277	23	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	277	24	virus	virus	NN
cord-284501-5i0w74q4	277	25	Replication	replication	NN
cord-284501-5i0w74q4	277	26	and	and	CC
cord-284501-5i0w74q4	277	27	packaging	packaging	NN
cord-284501-5i0w74q4	277	28	of	of	IN
cord-284501-5i0w74q4	277	29	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	277	30	infectious	infectious	JJ
cord-284501-5i0w74q4	277	31	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	277	32	virus	virus	NN
cord-284501-5i0w74q4	277	33	defective	defective	JJ
cord-284501-5i0w74q4	277	34	RNAs	rna	NNS
cord-284501-5i0w74q4	277	35	lacking	lack	VBG
cord-284501-5i0w74q4	277	36	a	a	DT
cord-284501-5i0w74q4	277	37	long	long	JJ
cord-284501-5i0w74q4	277	38	open	open	JJ
cord-284501-5i0w74q4	277	39	reading	reading	NN
cord-284501-5i0w74q4	277	40	frame	frame	NN
cord-284501-5i0w74q4	277	41	Leader	leader	NN
cord-284501-5i0w74q4	277	42	switching	switching	NN
cord-284501-5i0w74q4	277	43	occurs	occur	VBZ
cord-284501-5i0w74q4	277	44	during	during	IN
cord-284501-5i0w74q4	277	45	the	the	DT
cord-284501-5i0w74q4	277	46	rescue	rescue	NN
cord-284501-5i0w74q4	277	47	of	of	IN
cord-284501-5i0w74q4	277	48	defective	defective	JJ
cord-284501-5i0w74q4	277	49	RNAs	rna	NNS
cord-284501-5i0w74q4	277	50	by	by	IN
cord-284501-5i0w74q4	277	51	heterologous	heterologous	JJ
cord-284501-5i0w74q4	277	52	strains	strain	NNS
cord-284501-5i0w74q4	277	53	of	of	IN
cord-284501-5i0w74q4	277	54	the	the	DT
cord-284501-5i0w74q4	277	55	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	277	56	infectious	infectious	JJ
cord-284501-5i0w74q4	277	57	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	277	58	virus	virus	NN
cord-284501-5i0w74q4	277	59	Coronavirus	Coronavirus	NNP
cord-284501-5i0w74q4	277	60	IBV	IBV	NNP
cord-284501-5i0w74q4	277	61	:	:	:
cord-284501-5i0w74q4	277	62	partial	partial	JJ
cord-284501-5i0w74q4	277	63	amino	amino	NN
cord-284501-5i0w74q4	277	64	terminal	terminal	JJ
cord-284501-5i0w74q4	277	65	sequencing	sequencing	NN
cord-284501-5i0w74q4	277	66	of	of	IN
cord-284501-5i0w74q4	277	67	spike	spike	NN
cord-284501-5i0w74q4	277	68	polypeptide	polypeptide	NN
cord-284501-5i0w74q4	277	69	S2	S2	NNP
cord-284501-5i0w74q4	277	70	identifies	identify	VBZ
cord-284501-5i0w74q4	277	71	the	the	DT
cord-284501-5i0w74q4	277	72	sequence	sequence	NN
cord-284501-5i0w74q4	277	73	Arg	arg	NN
cord-284501-5i0w74q4	277	74	-	-	HYPH
cord-284501-5i0w74q4	277	75	Arg	arg	NN
cord-284501-5i0w74q4	277	76	-	-	HYPH
cord-284501-5i0w74q4	277	77	Phe	phe	NN
cord-284501-5i0w74q4	277	78	-	-	HYPH
cord-284501-5i0w74q4	277	79	Arg	arg	NN
cord-284501-5i0w74q4	277	80	-	-	HYPH
cord-284501-5i0w74q4	277	81	Arg	arg	NN
cord-284501-5i0w74q4	277	82	at	at	IN
cord-284501-5i0w74q4	277	83	the	the	DT
cord-284501-5i0w74q4	277	84	cleavage	cleavage	NN
cord-284501-5i0w74q4	277	85	site	site	NN
cord-284501-5i0w74q4	277	86	of	of	IN
cord-284501-5i0w74q4	277	87	the	the	DT
cord-284501-5i0w74q4	277	88	spike	spike	NN
cord-284501-5i0w74q4	277	89	precursor	precursor	NN
cord-284501-5i0w74q4	277	90	propolypeptide	propolypeptide	NN
cord-284501-5i0w74q4	277	91	of	of	IN
cord-284501-5i0w74q4	277	92	IBV	IBV	NNP
cord-284501-5i0w74q4	277	93	strains	strain	NNS
cord-284501-5i0w74q4	278	1	Beaudette	Beaudette	NNP
cord-284501-5i0w74q4	278	2	and	and	CC
cord-284501-5i0w74q4	278	3	M41	M41	NNP
cord-284501-5i0w74q4	278	4	Reverse	Reverse	NNP
cord-284501-5i0w74q4	278	5	genetics	genetics	NN
cord-284501-5i0w74q4	278	6	system	system	NN
cord-284501-5i0w74q4	278	7	for	for	IN
cord-284501-5i0w74q4	278	8	the	the	DT
cord-284501-5i0w74q4	278	9	avian	avian	JJ
cord-284501-5i0w74q4	278	10	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	278	11	infectious	infectious	JJ
cord-284501-5i0w74q4	278	12	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	278	13	virus	virus	NN
cord-284501-5i0w74q4	278	14	Taxonomic	taxonomic	JJ
cord-284501-5i0w74q4	278	15	studies	study	NNS
cord-284501-5i0w74q4	278	16	on	on	IN
cord-284501-5i0w74q4	278	17	strains	strain	NNS
cord-284501-5i0w74q4	278	18	of	of	IN
cord-284501-5i0w74q4	278	19	avian	avian	JJ
cord-284501-5i0w74q4	278	20	infectious	infectious	JJ
cord-284501-5i0w74q4	278	21	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	278	22	virus	virus	NN
cord-284501-5i0w74q4	278	23	using	use	VBG
cord-284501-5i0w74q4	278	24	neutralisation	neutralisation	NN
cord-284501-5i0w74q4	278	25	tests	test	NNS
cord-284501-5i0w74q4	278	26	in	in	IN
cord-284501-5i0w74q4	278	27	tracheal	tracheal	JJ
cord-284501-5i0w74q4	278	28	organ	organ	NN
cord-284501-5i0w74q4	278	29	cultures	culture	NNS
cord-284501-5i0w74q4	278	30	Transient	transient	JJ
cord-284501-5i0w74q4	278	31	dominant	dominant	JJ
cord-284501-5i0w74q4	278	32	selection	selection	NN
cord-284501-5i0w74q4	278	33	for	for	IN
cord-284501-5i0w74q4	278	34	the	the	DT
cord-284501-5i0w74q4	278	35	modification	modification	NN
cord-284501-5i0w74q4	278	36	and	and	CC
cord-284501-5i0w74q4	278	37	generation	generation	NN
cord-284501-5i0w74q4	278	38	of	of	IN
cord-284501-5i0w74q4	278	39	recombinant	recombinant	JJ
cord-284501-5i0w74q4	278	40	infectious	infectious	JJ
cord-284501-5i0w74q4	278	41	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	278	42	coronaviruses	coronaviruse	NNS
cord-284501-5i0w74q4	278	43	Expression	expression	NN
cord-284501-5i0w74q4	278	44	of	of	IN
cord-284501-5i0w74q4	278	45	bacteriophage	bacteriophage	NN
cord-284501-5i0w74q4	278	46	T7	T7	NNP
cord-284501-5i0w74q4	278	47	RNA	RNA	NNP
cord-284501-5i0w74q4	278	48	polymerase	polymerase	NN
cord-284501-5i0w74q4	278	49	in	in	IN
cord-284501-5i0w74q4	278	50	avian	avian	JJ
cord-284501-5i0w74q4	278	51	and	and	CC
cord-284501-5i0w74q4	278	52	mammalian	mammalian	JJ
cord-284501-5i0w74q4	278	53	cells	cell	NNS
cord-284501-5i0w74q4	278	54	by	by	IN
cord-284501-5i0w74q4	278	55	a	a	DT
cord-284501-5i0w74q4	278	56	recombinant	recombinant	JJ
cord-284501-5i0w74q4	278	57	fowlpox	fowlpox	NN
cord-284501-5i0w74q4	278	58	virus	virus	NN
cord-284501-5i0w74q4	279	1	The	the	DT
cord-284501-5i0w74q4	279	2	use	use	NN
cord-284501-5i0w74q4	279	3	of	of	IN
cord-284501-5i0w74q4	279	4	chicken	chicken	NN
cord-284501-5i0w74q4	279	5	tracheal	tracheal	NN
cord-284501-5i0w74q4	279	6	organ	organ	NN
cord-284501-5i0w74q4	279	7	cultures	culture	NNS
cord-284501-5i0w74q4	279	8	for	for	IN
cord-284501-5i0w74q4	279	9	the	the	DT
cord-284501-5i0w74q4	279	10	isolation	isolation	NN
cord-284501-5i0w74q4	279	11	and	and	CC
cord-284501-5i0w74q4	279	12	assay	assay	NN
cord-284501-5i0w74q4	279	13	of	of	IN
cord-284501-5i0w74q4	279	14	avian	avian	JJ
cord-284501-5i0w74q4	279	15	infectious	infectious	JJ
cord-284501-5i0w74q4	279	16	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	279	17	virus	virus	NN
cord-284501-5i0w74q4	279	18	Completion	completion	NN
cord-284501-5i0w74q4	279	19	of	of	IN
cord-284501-5i0w74q4	279	20	the	the	DT
cord-284501-5i0w74q4	279	21	sequence	sequence	NN
cord-284501-5i0w74q4	279	22	of	of	IN
cord-284501-5i0w74q4	279	23	the	the	DT
cord-284501-5i0w74q4	279	24	genome	genome	NN
cord-284501-5i0w74q4	279	25	of	of	IN
cord-284501-5i0w74q4	279	26	the	the	DT
cord-284501-5i0w74q4	279	27	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	279	28	avian	avian	JJ
cord-284501-5i0w74q4	279	29	infectious	infectious	JJ
cord-284501-5i0w74q4	279	30	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	279	31	virus	virus	NN
cord-284501-5i0w74q4	280	1	A	a	DT
cord-284501-5i0w74q4	280	2	new	new	JJ
cord-284501-5i0w74q4	280	3	DNA	dna	NN
cord-284501-5i0w74q4	280	4	sequence	sequence	NN
cord-284501-5i0w74q4	280	5	assembly	assembly	NN
cord-284501-5i0w74q4	280	6	program	program	NN
cord-284501-5i0w74q4	280	7	Sequences	Sequences	NNPS
cord-284501-5i0w74q4	280	8	of	of	IN
cord-284501-5i0w74q4	280	9	the	the	DT
cord-284501-5i0w74q4	280	10	nucleocapsid	nucleocapsid	NN
cord-284501-5i0w74q4	280	11	genes	gene	NNS
cord-284501-5i0w74q4	280	12	from	from	IN
cord-284501-5i0w74q4	280	13	two	two	CD
cord-284501-5i0w74q4	280	14	strains	strain	NNS
cord-284501-5i0w74q4	280	15	of	of	IN
cord-284501-5i0w74q4	280	16	avian	avian	JJ
cord-284501-5i0w74q4	280	17	infectious	infectious	JJ
cord-284501-5i0w74q4	280	18	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	280	19	virus	virus	NN
cord-284501-5i0w74q4	280	20	Open	Open	NNP
cord-284501-5i0w74q4	280	21	Reading	Reading	NNP
cord-284501-5i0w74q4	280	22	Frames	Frames	NNP
cord-284501-5i0w74q4	280	23	3a	3a	NNP
cord-284501-5i0w74q4	280	24	and	and	CC
cord-284501-5i0w74q4	280	25	3b	3b	CD
cord-284501-5i0w74q4	280	26	of	of	IN
cord-284501-5i0w74q4	280	27	Infectious	Infectious	NNP
cord-284501-5i0w74q4	280	28	bronchitis	bronchitis	NNP
cord-284501-5i0w74q4	280	29	virus	virus	NN
cord-284501-5i0w74q4	280	30	cis	cis	NNP
cord-284501-5i0w74q4	280	31	-	-	HYPH
cord-284501-5i0w74q4	280	32	Acting	Acting	NNP
cord-284501-5i0w74q4	280	33	Sequences	Sequences	NNPS
cord-284501-5i0w74q4	280	34	Required	require	VBN
cord-284501-5i0w74q4	280	35	for	for	IN
cord-284501-5i0w74q4	280	36	Coronavirus	Coronavirus	NNP
cord-284501-5i0w74q4	280	37	Infectious	Infectious	NNP
cord-284501-5i0w74q4	280	38	Bronchitis	Bronchitis	NNP
cord-284501-5i0w74q4	280	39	Virus	Virus	NNP
cord-284501-5i0w74q4	280	40	Defective	Defective	NNP
cord-284501-5i0w74q4	280	41	-	-	HYPH
cord-284501-5i0w74q4	280	42	RNA	RNA	NNP
cord-284501-5i0w74q4	280	43	Replication	Replication	NNP
cord-284501-5i0w74q4	280	44	and	and	CC
cord-284501-5i0w74q4	280	45	Packaging	Packaging	NNP
cord-284501-5i0w74q4	280	46	Replicase	Replicase	NNP
cord-284501-5i0w74q4	280	47	genes	gene	NNS
cord-284501-5i0w74q4	280	48	of	of	IN
cord-284501-5i0w74q4	280	49	murine	murine	JJ
cord-284501-5i0w74q4	280	50	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	280	51	strains	strain	VBZ
cord-284501-5i0w74q4	280	52	A59	A59	NNP
cord-284501-5i0w74q4	280	53	and	and	CC
cord-284501-5i0w74q4	280	54	JHM	JHM	NNP
cord-284501-5i0w74q4	280	55	are	be	VBP
cord-284501-5i0w74q4	280	56	interchangeable	interchangeable	JJ
cord-284501-5i0w74q4	280	57	:	:	:
cord-284501-5i0w74q4	280	58	differences	difference	NNS
cord-284501-5i0w74q4	280	59	in	in	IN
cord-284501-5i0w74q4	280	60	pathogenesis	pathogenesis	NN
cord-284501-5i0w74q4	280	61	map	map	NN
cord-284501-5i0w74q4	280	62	to	to	IN
cord-284501-5i0w74q4	280	63	the	the	DT
cord-284501-5i0w74q4	280	64	39	39	CD
cord-284501-5i0w74q4	280	65	one	one	CD
cord-284501-5i0w74q4	280	66	-	-	HYPH
cord-284501-5i0w74q4	280	67	third	third	NN
cord-284501-5i0w74q4	280	68	of	of	IN
cord-284501-5i0w74q4	280	69	the	the	DT
cord-284501-5i0w74q4	280	70	genome	genome	NN
cord-284501-5i0w74q4	280	71	Altered	alter	VBN
cord-284501-5i0w74q4	280	72	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	280	73	,	,	,
cord-284501-5i0w74q4	280	74	immunogenicity	immunogenicity	NN
cord-284501-5i0w74q4	280	75	,	,	,
cord-284501-5i0w74q4	280	76	tissue	tissue	NN
cord-284501-5i0w74q4	280	77	tropism	tropism	NN
cord-284501-5i0w74q4	280	78	and	and	CC
cord-284501-5i0w74q4	280	79	39	39	CD
cord-284501-5i0w74q4	280	80	-	-	SYM
cord-284501-5i0w74q4	280	81	7	7	CD
cord-284501-5i0w74q4	280	82	kb	kb	NNP
cord-284501-5i0w74q4	280	83	region	region	NN
cord-284501-5i0w74q4	280	84	sequence	sequence	NN
cord-284501-5i0w74q4	280	85	of	of	IN
cord-284501-5i0w74q4	280	86	an	an	DT
cord-284501-5i0w74q4	280	87	avian	avian	JJ
cord-284501-5i0w74q4	280	88	infectious	infectious	JJ
cord-284501-5i0w74q4	280	89	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	280	90	strain	strain	NN
cord-284501-5i0w74q4	280	91	after	after	IN
cord-284501-5i0w74q4	280	92	serial	serial	JJ
cord-284501-5i0w74q4	280	93	passage	passage	NN
cord-284501-5i0w74q4	280	94	in	in	IN
cord-284501-5i0w74q4	280	95	embryos	embryo	NNS
cord-284501-5i0w74q4	280	96	.	.	.
cord-284501-5i0w74q4	281	1	Vaccine	vaccine	NN
cord-284501-5i0w74q4	281	2	Identification	identification	NN
cord-284501-5i0w74q4	281	3	of	of	IN
cord-284501-5i0w74q4	281	4	sequence	sequence	NN
cord-284501-5i0w74q4	281	5	changes	change	NNS
cord-284501-5i0w74q4	281	6	responsible	responsible	JJ
cord-284501-5i0w74q4	281	7	for	for	IN
cord-284501-5i0w74q4	281	8	the	the	DT
cord-284501-5i0w74q4	281	9	attenuation	attenuation	NN
cord-284501-5i0w74q4	281	10	of	of	IN
cord-284501-5i0w74q4	281	11	avian	avian	JJ
cord-284501-5i0w74q4	281	12	infectious	infectious	JJ
cord-284501-5i0w74q4	281	13	bronchitis	bronchitis	NN
cord-284501-5i0w74q4	281	14	virus	virus	NN
cord-284501-5i0w74q4	281	15	strain	strain	VBP
cord-284501-5i0w74q4	281	16	Arkansas	Arkansas	NNP
cord-284501-5i0w74q4	281	17	DPI	DPI	NNP
cord-284501-5i0w74q4	281	18	Coronavirus	Coronavirus	NNP
cord-284501-5i0w74q4	281	19	replicative	replicative	JJ
cord-284501-5i0w74q4	281	20	proteins	protein	NNS
cord-284501-5i0w74q4	282	1	Coronavirus	Coronavirus	NNP
cord-284501-5i0w74q4	282	2	non	non	JJ
cord-284501-5i0w74q4	282	3	-	-	JJ
cord-284501-5i0w74q4	282	4	structural	structural	JJ
cord-284501-5i0w74q4	282	5	protein	protein	NN
cord-284501-5i0w74q4	282	6	1	1	CD
cord-284501-5i0w74q4	282	7	is	be	VBZ
cord-284501-5i0w74q4	282	8	a	a	DT
cord-284501-5i0w74q4	282	9	major	major	JJ
cord-284501-5i0w74q4	282	10	pathogenicity	pathogenicity	NN
cord-284501-5i0w74q4	282	11	factor	factor	NN
cord-284501-5i0w74q4	282	12	:	:	:
cord-284501-5i0w74q4	282	13	implications	implication	NNS
cord-284501-5i0w74q4	282	14	for	for	IN
cord-284501-5i0w74q4	282	15	the	the	DT
cord-284501-5i0w74q4	282	16	rational	rational	JJ
cord-284501-5i0w74q4	282	17	design	design	NN
cord-284501-5i0w74q4	282	18	of	of	IN
cord-284501-5i0w74q4	282	19	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	282	20	vaccines	vaccine	NNS
cord-284501-5i0w74q4	282	21	Mouse	Mouse	NNP
cord-284501-5i0w74q4	282	22	hepatitis	hepatitis	NN
cord-284501-5i0w74q4	282	23	virus	virus	NN
cord-284501-5i0w74q4	282	24	liver	liver	NN
cord-284501-5i0w74q4	282	25	pathology	pathology	NN
cord-284501-5i0w74q4	282	26	is	be	VBZ
cord-284501-5i0w74q4	282	27	dependent	dependent	JJ
cord-284501-5i0w74q4	282	28	on	on	IN
cord-284501-5i0w74q4	282	29	ADP	ADP	NNP
cord-284501-5i0w74q4	282	30	-	-	HYPH
cord-284501-5i0w74q4	282	31	ribose-10phosphatase	ribose-10phosphatase	NNP
cord-284501-5i0w74q4	282	32	,	,	,
cord-284501-5i0w74q4	282	33	a	a	DT
cord-284501-5i0w74q4	282	34	viral	viral	JJ
cord-284501-5i0w74q4	282	35	function	function	NN
cord-284501-5i0w74q4	282	36	conserved	conserve	VBN
cord-284501-5i0w74q4	282	37	in	in	IN
cord-284501-5i0w74q4	282	38	the	the	DT
cord-284501-5i0w74q4	282	39	alpha	alpha	NN
cord-284501-5i0w74q4	282	40	-	-	HYPH
cord-284501-5i0w74q4	282	41	like	like	JJ
cord-284501-5i0w74q4	282	42	supergroup	supergroup	NN
cord-284501-5i0w74q4	282	43	Singleamino	singleamino	NN
cord-284501-5i0w74q4	282	44	-	-	HYPH
cord-284501-5i0w74q4	282	45	acid	acid	JJ
cord-284501-5i0w74q4	282	46	substitutions	substitution	NNS
cord-284501-5i0w74q4	282	47	in	in	IN
cord-284501-5i0w74q4	282	48	open	open	JJ
cord-284501-5i0w74q4	282	49	reading	reading	NN
cord-284501-5i0w74q4	282	50	frame	frame	NN
cord-284501-5i0w74q4	283	1	(	(	-LRB-
cord-284501-5i0w74q4	283	2	ORF	ORF	NNP
cord-284501-5i0w74q4	283	3	)	)	-RRB-
cord-284501-5i0w74q4	284	1	1b	1b	LS
cord-284501-5i0w74q4	284	2	-	-	HYPH
cord-284501-5i0w74q4	284	3	nsp14	nsp14	NNP
cord-284501-5i0w74q4	284	4	and	and	CC
cord-284501-5i0w74q4	284	5	ORF	ORF	NNP
cord-284501-5i0w74q4	284	6	2a	2a	CD
cord-284501-5i0w74q4	284	7	proteins	protein	NNS
cord-284501-5i0w74q4	284	8	of	of	IN
cord-284501-5i0w74q4	284	9	the	the	DT
cord-284501-5i0w74q4	284	10	coronavirus	coronavirus	NN
cord-284501-5i0w74q4	284	11	mouse	mouse	NN
cord-284501-5i0w74q4	284	12	hepatitis	hepatitis	NN
cord-284501-5i0w74q4	284	13	virus	virus	NN
cord-284501-5i0w74q4	284	14	are	be	VBP
cord-284501-5i0w74q4	284	15	attenuating	attenuate	VBG
cord-284501-5i0w74q4	284	16	in	in	IN
cord-284501-5i0w74q4	284	17	mice	mouse	NNS
cord-284501-5i0w74q4	285	1	We	-PRON-	PRP
cord-284501-5i0w74q4	285	2	thank	thank	VBP
cord-284501-5i0w74q4	285	3	Drs	Drs	NNP
cord-284501-5i0w74q4	285	4	.	.	.
cord-284501-5i0w74q4	286	1	Francesca	Francesca	NNP
cord-284501-5i0w74q4	286	2	Culver	Culver	NNP
cord-284501-5i0w74q4	286	3	and	and	CC
cord-284501-5i0w74q4	286	4	Abu	Abu	NNP
cord-284501-5i0w74q4	286	5	-	-	HYPH
cord-284501-5i0w74q4	286	6	Bakr	Bakr	NNP
cord-284501-5i0w74q4	286	7	Abu	Abu	NNP
cord-284501-5i0w74q4	286	8	-	-	HYPH
cord-284501-5i0w74q4	286	9	Median	Median	NNP
cord-284501-5i0w74q4	286	10	for	for	IN
cord-284501-5i0w74q4	286	11	help	help	NN
cord-284501-5i0w74q4	286	12	with	with	IN
cord-284501-5i0w74q4	286	13	removal	removal	NN
cord-284501-5i0w74q4	286	14	,	,	,
cord-284501-5i0w74q4	286	15	processing	processing	NN
cord-284501-5i0w74q4	286	16	and	and	CC
cord-284501-5i0w74q4	286	17	extraction	extraction	NN
cord-284501-5i0w74q4	286	18	of	of	IN
cord-284501-5i0w74q4	286	19	RNA	RNA	NNP
cord-284501-5i0w74q4	286	20	from	from	IN
cord-284501-5i0w74q4	286	21	the	the	DT
cord-284501-5i0w74q4	286	22	tracheas	trachea	NNS
cord-284501-5i0w74q4	286	23	control	control	VBP
cord-284501-5i0w74q4	286	24	chickens	chicken	NNS
cord-284501-5i0w74q4	286	25	or	or	CC
cord-284501-5i0w74q4	286	26	chickens	chicken	NNS
cord-284501-5i0w74q4	286	27	infected	infect	VBN
cord-284501-5i0w74q4	286	28	with	with	IN
cord-284501-5i0w74q4	286	29	IBV	IBV	NNP
cord-284501-5i0w74q4	286	30	.	.	.
cord-284501-5i0w74q4	286	31	 	 	_SP