key: cord- - ftjqev authors: xu, yinlan; zheng, jiangang; sun, panpan; guo, jianhua; zheng, xiaozhong; sun, yaogui; fan, kuohai; yin, wei; li, hongquan; sun, na title: cepharanthine and curcumin inhibited mitochondrial apoptosis induced by pcv date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: ftjqev background: porcine circovirus type (pcv ) is an immunosuppressive pathogen with high prevalence rate in pig farms. it has caused serious economic losses to the global pig industry. due to the rapid mutation of pcv strain and co-infection of different genotypes, vaccination could not eradicate the infection of pcv . it is necessary to screen and develop effective new compounds and explore their anti-apoptotic mechanism. the natural compounds were purchased, with a clear plant origin, chemical structure and content and specific biological activities. results: the maximum no-cytotoxic concentration (mntc) and % cytotoxic concentration (cc( )) of tested compounds were obtained by the cytopathologic effect (cpe) assay and ( -( , -dimethyithiazol- -yl)- , -diphenyltetrazolium bromide (mtt) method in pk- cells. the results of qpcr and western blot showed that, compared with the pcv infected group, the expression of cap in paeonol ( . mg/ml and . mg/ml), cepharanthine ( . mg/ml, . mg/ml and . mg/ml) and curcumin ( . mg/ml, . mg/ml and . mg/ml) treated groups were significantly lowered in a dose-dependent manner. the results of annexin v-fitc/pi, jc- , western blot and ros analysis showed that the expression of cleaved caspase- and bax were up-regulated bcl- was down-regulated in cepharanthine or curcumin treated groups, while ros and mmp value were decreased at different degrees and the apoptosis rate was reduced. in this study, ribavirin was used as a positive control. conclusions: paeonol, cepharanthine and curcumin have significant antiviral effect. and the pcv -induced mitochondrial apoptosis was mainly remitted by cepharanthine and curcumin. pcv is a dna virus, which is an important pathogen causing high infection rate and immunosuppression in pigs [ ] . the diseases caused by pcv mainly include postweaning multisystemic wasting syndrome (pmws), porcine dermatitis and nephropathy syndrome (pdns), porcine proliferative and necrotizing pneumonia (pnp), etc., which have caused serious economic losses to the global pig industry for about years [ ] . the capsid protein (cap) encoded by the orf -encoded gene of pcv is a major viral structural protein and an immunogen involving viral replication of pcv [ ] . studies have shown that pcv could induce apoptosis and decrease spleen lymphocytes in immune organs of balb/c mice and pigs [ , ] and apoptosis can be induced through endoplasmic reticulum (er) apoptosis, mitochondrial apoptosis, reactive oxygen species (ros) regulation, etc. [ ] [ ] [ ] [ ] . it has been reported that vaccination could not eradicate the infection of pcv , due to the rapid mutation of pcv strain and co-infection of different genotypes, etc. [ , ] . therefore, it is needed to control infection. chinese herbal medicine has the characteristics of high efficiency, low toxicity and low residue. it can improve the immunity, possess anti-stress and anti-virus ability. a variety of natural compounds or their active ingredients have been used to enhance host immune, prevent and treat viral diseases, such as coronavirus diseases [ ] , hepatitis b (hb) [ ] , infectious bronchitis [ ] , african swine fever (asf) [ ] , influenza [ ] and other viral diseases. however, the research on the anti-pcv action of natural compounds and its mechanism has also become a hotspot. in our previous studies, dozens of natural compounds were screened for their antiviral activity, such as chlorogenic acid [ ] , ligustrazine hydrochloride [ ] , scutellarin [ , ] , dipotassium glycyrrhizinate [ , , ] , sodium tanshinone iia sulfonate [ , ] , tea seed saponins [ ] and matrine [ , , ] . among them, only scutellarin or matrine had anti-pcv effect [ , ] . therefore, in this study, from many natural compounds with clear chemical structure, traditional medicine plant source and specific biological activity, compounds with antiviral potential were selected and tested in the model of pcv infected pk- cell to screen anti-pcv compounds in vitro. furthermore, the potential antiviral mechanism of compounds was explored and explained from the perspectives of apoptosis, mitochondrial membrane potential (mmp) and ros. it provides a theoretical basis for the development of a safely, efficiently new compound with anti-pcv effect. compared with the normal group of normal cells, the results showed that (see additional file ), the degree of cytopathological change were also different after the treatment of different compounds and different concentrations of the same compound. due to the low solubility, the maximum solubility concentration (msc) of . mg/ml formononetin, . mg/ml icariine and . mg/ ml astragaloside were used to treat the cells, respectively and no change in cell morphology was observed. the mntc is the same as msc. the compounds except formononetin, icariine and astragaloside showed different cytopathic changes (see additional file ) and mntc values (table ) . dose-response curves of the tested compounds ( fig. ) and cc value (table ) were generated by graphpad prism . analysis after calculating the cr value. the curves were "s" type, showing a dose-dependent relationship. as the concentration of the compound increased, more cells with change in morphology the was observed. to explore the anti-pcv effect of compounds, the expression levels of cap was detected by qpcr and western blot. the results of qpcr showed that, compared to cell control group, the pcv copy numbers were significantly increased (p < . ), compared to pcv infected group, the pcv copy numbers were significantly decreased in these compound treated with formononetin at . , icariine at . , paeonol at . , . and . mg/ml, cepharanthine at . , . and . mg/ml, curcumin at . , . and . mg/ml, curcumol at . and syringin at . and . mg/ml (p < . ) (fig. a) . based on the results by qpcr, dose-dependent paeonol, cepharanthine and curcumin were selected for western blot. the results showed that the expression level of cap protein treated with the three compounds respectively were significantly lower than pcv infected group (p < . ), except the . mg/ml of paeonol group ( fig. b ) (for original and unedited blots see additional file ). therefore, the cepharanthine and curcumin were selected for the subsequent anti-apoptotic test. to evaluate the anti-apoptosis effect of cepharanthine or curcumin, samples were analyzed after being treated with annexin v/pi by flow cytometer. the results showed that compared to the pcv -infected group, the cell apoptosis rates were significantly decreased in the group treated with cepharanthine, curcumin or ribavirin, demonstrating a dose-dependent response except the group of . mg/ml paeonol (p < . ) ( fig. a and b). our results indicated that cepharanthine, curcumin or ribavirin could significantly inhibit pcv induced apoptosis (p < . ). to evaluate the anti-apoptosis mechanism of cepharanthine or curcumin, samples were analyzed after being treated with jc- kit by flow cytometer. the results showed that compared to the pcv -infected group, the mmp value were significantly decreased in the group treated with cepharanthine, curcumin and ribavirin, demonstrating a dose-dependent response (p < . ) ( fig. a and b) . the results indicated that cepharanthine, curcumin or ribavirin could significantly inhibit pcv induced apoptosis via mitochondrial pathway (p < . ). to evaluate the mechanism of inhibition of pcv induced mitochondrial apoptosis by cepharanthine or curcumin, samples were analyzed by western blot and flow cytometer. the results of western blot showed that compared with the pcv -infected group, the expression of pro-apoptin cleaved caspase- and bax was significantly decreased while the expression of antiapoptotic protein bcl- was significantly increased in the treatment group of cepharanthine, curcumin or ribavirin ( fig. a -h) (the original and unedited blots see additional file ). the results of flow cytometer after being stained with ros kit demonstrated that the value of ros in the curcumin-treated group showed strongly downward trend in a dose-dependent manner, compared with the pcv control group ( fig. i and j) . however, only the group of treated with . mg/ml of cepharanthine could significantly reduce the amount of ros (p < . ). the results demonstrated that cepharanthine or curcumin inhibited the pcv induced increase in mmp through the caspase family and bcl- family mechanisms. curcumin inhibited pcv -induced mitochondrial apoptosis by reducing ros, however, ros reduction is not the main pathway for cepharanthine and ribavrin to inhibit pcv induced mitochondrial apoptosis. pcv is the main pathogen causing porcine circovirus associated diseases (pcvad). in this study, natural compounds with defined chemical structures, useful clinical effect and from medicinal plants were selected. after the primary screening, three compounds with antiviral effect, paeonol, cepharanthine and curcumin were further studied. the anti-apoptotic mechanism of these two compounds was investigated by evaluating the level of key apoptins, mmp and ros in the cellular mitochondrial pathway. ribavirin has a broad antiviral activity and was used as a positive control. cepharanthine is a natural alkaloid extracted from the roots of the stephania japonica, which has antiinflammatory [ ] , anti-hepatitis b virus [ ] , herpes simplex type- virus (hsv- ) [ ] and etc. curcumin is an active ingredient extracted from the rhizome of some plants of the zingiberaceae and araceae. medical research shows that curcumin has low toxicity, little adverse reactions and multiple therapeutic effects, such as anti-inflammatory [ ] , anti-oxidative [ ] , anti-h n influenza virus [ ] , dengue virus [ ] , hepatitis c virus [ ] and so on. found that pcv induced mitochondrial apoptosis of pcv infected pk- cells and t cells by increasing the activities of caspase- and caspase- and accelerating the release of cytochrome c (cyto c) from mitochondria to cytoplasm [ ] ; after pcv infected raw . cells, stress-related molecules such as ros production and no secretion were significantly increased [ ] ; previous studies have shown that pcv infection promotes the accumulation of ros, which in turn inhibits the replication of pcv through the nf-κb pathway [ ] . therefore, we hypothesized that the experimental compounds could inhibit the mitochondrial apoptosis of pk- cells induced by pcv infection via acting on mitochondrial membrane potential. mitochondria have a central role in cell apoptosis. the loss of mmp is the marker of mitochondrial apoptosis, the changes of mmp are caused by bcl- family, caspase family and miochondrial permeability transition pore (mptp) [ ] . cleaved caspase- is the main executive protein of apoptosis. there are many members of the bcl- family, among which bax is the main pro-apoptotic protein and bcl- is the main antiapoptotic protein. the opening and closing of mptp is influenced by ros, ca + , adp, oxidative stress, high ph value and other apoptotic factors [ ] . in this study, at first, the cell apoptosis and change of mmp were detected by flow cytometry after annexin v/pi double staining and jc- assay. the results indicated that cepharanthine, curcumin or ribavirin could significantly inhibit pcv -induced apoptosis via mitochondrial pathway. to further evaluate the mechanism of cepharanthine or curcumin inhibiting mitochondrial apoptosis, the apoptins of caspase family and bcl- family were analyzed by western blot, the values of ros were analyzed by flow cytometry after ros kit staining. the results showed that compared with cell control group, the expression levels of cleaved caspase- and bax were upregulated, and the expression of bcl- was downregulated, the ros values are increased. this result is consistent with the previous reports [ , , ] . compared with pcv -infected group, the expression levels of to summarize, our study revealed that paeonol, cepharanthine and curcumin have significant antiviral effect, and cepharanthine and curcumin could inhibit pcv induced mitochondrial apoptosis by through change the mmp (fig. ) . the study provides a base line for further studies on the anti-pcv effect and anti-apoptosis mechanism of cepharanthine and curcumin in experimental animal models infected with pcv , and may be applied in clinical treatment as anti-virus compounds eventually. pcv-free pig kidney endothelial cell line (pk- ) was preserved in our laboratory. cells were cultured and passed in dulbecco's modified eagle's medium (dmem, hyclone, usa) containing % fetal calf serum (fbs, bi, israel) ( % dmem) and maintenance in dmem containing % fbs ( % dmem). the strain of pcv -sh (genbank: ay . ) was gifted by professor jiang ping of nanjing agricultural university. virus was replicated and harvest in pk- cells infected with pcv . the titer of . tcid / ml was determined by indirect immunofluorescence (ifa). antibodies against cap were purchased from biorbyt llc. (california, britain) cleaved caspase- , bcl- and bax were purchased from abcam (cambridge, usa); gapdh and horseradish peroxidase (hrp)-conjugated secondary antibodies were purchased from wuhan sanying biology technology co., ltd. (wu han, china). ribavirin, the positive control drug, was purchased from beijing solarbio technology co., ltd; syringin was purchased from nanjing puyi biotechnology co., ltd; glycyrrhizin aid was purchased from dosf biotechnology co., ltd; other tested compounds, such as curcumol, paeonol, oxymatrine, caffeic acid, formononetin, cepharanthine, apigenin, psoralen, lcariine, curcumin and astragaloside were purchased from national institutes for food and drug control. compounds information and chemical structure were respectively listed table and fig. . the viability of pk- cell was assessed with mtt. . × cells/ml of cells were seeded into -well plates and incubated until % confluency was reached. the tested compounds were added with two-fold serial diluted and cultured for another h and cell control group was established. four repeated wells were set up for each concentration with μl per well. the cytopathic condition of cells was observed every day and photographed. the compounds and dissolution methods are shown in table . then μl mtt ( mg/ml in pbs) was added to each well and incubated at °c for h. μl of dmso (solarbio, beijing) was added and incubated for min after removing the culture medium. the optical density (od) were measured at nm using a microplate spectrophotometer (spectra max m , molecular devices, usa). cytopathic ratio (cr) was calculated based on cr = [(od control -od test)/ od] × . then mntc and cc on pk- cells were calculated using graphpad prism™ . (inc. california, usa). the anti-pcv effect of compounds in pk- cell was determined by real time quantitative pcr (qpcr). when cell confluency rate of -well plate reached %, . tcid of pcv was incubated for h and discarded the supernatant. mntc of every test compound was in two-fold serial dilution with % dmem into gradients and added to -well plates ( μl/well) ( table ) . meanwhile, the cell control group, pcv -infected group and ribavirin positive control group were applied and incubated for h with % co at °c. dna was extracted according to the instruction of dna extraction kit (tiangen, beijing, china) and the dna concentration was measured using a nucleic acid concentration analyzer (nanodrop technologies, wilmington, de, usa). the copy number of the cap gene was detected by qpcr. the primers ′ tac att tcc agc agt ttg and 'ctc ccg cca tac cat aa were used for the amplification of bp fragment. the anti-pcv effect and anti-apoptotic mechanism of the compound was detected by western blot. when cell confluency of -well plate reached %, . tcid of pcv was incubated for h and discarded the supernatant. paeonol, cepharaanthine and curcumin were added in turn, ml/well. the cell control group, pcv infected group and ribavirin positive control group were applied and incubated for h. total cell protein was extracted and protein concentration was determined using the bca protein assay kit (beyotime biotechnology, jiangsu, china). the protein samples were separated by sds-page, then transferred to the pvdf membrane. the levels of pcv cap protein and apoptin were fig. the pcv -induced mitochondrial apoptosis was mainly remitted by cepharanthine and curcumin. the "red arrow" represents the promoting effect and the red "t-shape" indicates the inhibiting effect. the pcv replication is inhibited by cepharanthine and curcumin, selected from natural compounds, through mitochondrial apoptosis pathway detected using an eecl western blot detection kit (cwbio inc., beijing, china) and chemiluminescence imaging system (bio-rad, california, usa). the anti-apoptotic effect of cepharaanthine and curcumin were detected by annexin v/pi. cells in -well plate were incubated with . tcid of pcv for h and discarded the supernatant, then cepharaanthine and curcumin were added, the cell control group, pcv infected group and ribavirin positive control group were applied and incubated for h. samples were collected, centrifugated and treated using annexin v/pi kit (keygen biotech, nanjing, china), then analyzed by flow cytometry (bd biosciences, usa). mitochondrial membrane potential (mmp) of cells was detected by jc- . cells in the -well plate were incubated with . tcid of pcv for h and discarded the supernatant, then cepharaanthine and curcumin were added. after h incubation, cells were stained with jc- using a commercial kit (beyotime biotechnology, jangsu, china) treated and analyzed by flow cytometry (bd biosciences, usa). the amount of reactive oxygen species (ros) was measured by flow cytometry. cells in the -well plate were incubated with . tcid of pcv for h and discarded the supernatant, cepharaanthine and curcumin were added and incubated for h. cells were treated with ros assay kit and the changes of ros were detected by flow cytometer. cc was calculated using nonlinear regression and the results of "log (inhibitor) vs. response-variable slope" were analyzed using graphpad prism. the gray intensity of protein bolts was analyzed by image j (national institutes of health, usa). data generated were analyzed using "bonferroni: compare all pairs of columns" in the graphpad prism™ . software for one-way anova implemented (graphpad software, inc. california, usa), and were expressed as the mean ± standard error of the mean (sem) of at least repeated experiments. different letters (a, b, c, d, etc.) indicate statistically significant difference to other groups (p< . ). supplementary information accompanies this paper at https://doi.org/ . /s - - - . porcine circovirus- and concurrent infections in the field spread like a wildfire-the omnipresence of porcine circovirus type (pcv ) and its ever-expanding association with diseases in pigs open reading frame of porcine circovirus type encodes a major capsid protein porcine circovirus type (pcv ) causes apoptosis in experimentally inoculated balb/c mice pcv induces apoptosis and modulates calcium homeostasis in piglet lymphocytes in vitro porcine circovirus deploys perk pathway and grp for its enhanced replication in pk- cells porcine circovirus type induces orf -independent mitochondrial apoptosis via perk activation and elevation of cytosolic calcium activation of the phosphatidylinositol -kinase/ akt signaling pathway during porcine circovirus type infection facilitates cell survival and viral replication regulatory role of ask in porcine circovirus type -induced apoptosis porcine circovirus type in china: an update on and insights to its prevalaence and control efficacy and future prospects of commercially available and experimental vaccines against porcine circovirus type (pcv ) glycyrrhizin, an active component of liquorice roots, and replication of sarsassociated coronavirus effect of oxymatrine on the replication cycle of hepatitis b virus in vitro sambucus nigra extracts inhibit infectious bronchitis virus at an early point during replication apigenin inhibits african swine fever virus infectionin vitro pregnane steroids from a gorgonian coral subergorgia suberosa with antiflu virus effects in vitro screening for compounds derived from traditional chinese medicines with antiviral activities against porcine reproductive and respiratory syndrome virus antiviral effects of the constituents derived from chinese herb medicines on infectious bursal disease virus antiviral activities of natural compounds derived from traditional chinese medicines against porcine circovirus type (pcv ) in vitro antiviral activity and underlying molecular mechanisms of dipotassium glycyrrhetate against porcine reproductive and respiratory syndrome virus screening compounds of chinese medicinal herbs anti-marek's disease virus effects of sodium tanshinone iia sulfonate against marek's disease virus in experimentally infected chickens in vitro evaluation of antiviral activity of tea seed saponins against porcine reproductive and respiratory syndrome virus antiviral activity and underlying molecular mechanisms of matrine against porcine reproductive and respiratory syndrome virus in vitro matrine displayed antiviral activity in porcine alveolar macrophages coinfected by porcine reproductive and respiratory syndrome virus and porcine circovirus type the effects of biscoclaurine alkaloid cepharanthine on mammalian cells: implications for cancer, shock, and inflammatory diseases in vitro activity of cepharanthine hydrochloride against clinical wild-type and lamivudine-resistant hepatitis bvirus isolates inhibition of human immunodeficiency virus type replication by combination of transcription inhibitor k- and other antiretroviral agents in acutely and chronically infected cells pulmonary administration of a water-soluble curcumin complex reduces severity of acute lung injury inhibition of curcumin on influenza a virus infection and influenzal pneumonia, via, oxidative stress, tlr / , p /jnk mapk and nf-κb pathways synergistic effects of thymoquinone and curcumin on immune response and anti-viral activity against avian influenza virus (h n ) in turkeys inhibitory effects of curcumin on dengue virus type -infected cellsin vitro curcumin inhibits hepatitis c virus replication via suppressing the akt-srebp- pathway caspase-dependent apoptosis induction via viral protein orf of porcine circovirus binding to mitochondrial adenine nucleotide translocase effect of total flavonoids of spatholobus suberectus dunn on pcv induced oxidative stress in raw . cells. bmc complement reactive oxygen species regulate the replication of porcine circovirus type via nf-κb pathway parvovirus minute virus of mice induces a dna damage response that facilitates viral replication effect of sophora subprosrate polysaccharide on oxidative stress induced by pcv infection in raw . cells publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations we thank prof. jiang (nanjing agricultural university) for his assistance in the pcv . authors' contributions yx, jz, ns and hl designed all the experiments. yx and jz performed the mtt experiments, qpcr and western blot assays. ys, kf, and wy performed the flow cytometer assays. yx, ps, ns, xz and jg wrote the manuscript. all authors read and approved the final manuscript. this work was supported by national key research and development program (grant no. yfd ). the funding body had a role in the design of the study, collection, analysis, and interpretation of data or in the writing of this manuscript. the datasets used and analysed during the current study are available from the corresponding author on reasonable request. the experiment was performed in according to the experiment operational guideline of shanxi province, china. not applicable. all authors declared no competing conflict of interest.author details key: cord- -txh t u authors: li, yu-an; chen, yunyun; du, yuan zhao; guo, weiwei; chu, dianfeng; fan, juan; wang, xiaobo; bellefleur, matthew; wang, shifeng; shi, huoying title: live-attenuated salmonella enterica serotype choleraesuis vaccine with regulated delayed fur mutation confer protection against streptococcus suis in mice date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: txh t u background: recombinant salmonella enterica serotype choleraesuis (s. choleraesuis) vaccine vector could be used to deliver heterologous antigens to prevent and control pig diseases. we have previously shown that a live-attenuated s. choleraesuis vaccine candidate strain rsc (Δp(crp )::tt arac p(bad)crp Δpmi- Δrela ::arac p(bad)laci tt Δasda , Δ, deletion, tt, terminator) delivering saoa, a conserved surface protein in most of s. suis serotypes, provided excellent protection against s. suis challenge, but occasionally lead to morbidity (enteritidis) in vaccinated mice (approximately in every mice). thus, alternated attenuation method was sought to reduce the reactogenicity of strain rsc . herein, we described another recombinant attenuated s. choleraesuis vector, rsc (Δp(fur ):: tt arac p(bad)fur Δpmi- Δrela :: arac p(bad)laci tt Δasda ) with regulated delayed fur mutation to avoid inducing disease symptoms while exhibiting a high degree of immunogenicity. results: the strain rsc strain with the Δp(fur )::tt arac p(bad)fur mutation induced less production of inflammatory cytokines than strain rsc with the Δp(crp )::tt arac p(bad)crp mutation in mice. when delivering the same ps-saoa plasmid, the intraperitoneal ld( ) of rsc was . times higher than that of rsc in -week-old balb/c mice. rsc with either ps-saoa or pya was cleared from spleen and liver tissues days earlier than rsc with same vectors after oral inoculation. the strain rsc synthesizing saoa induced high titers of anti-saoa antibodies in both systemic (igg in serum) and mucosal (iga in vaginal washes) sites, as well as increased level of il- , the facilitator of th -type t cell immune response in mice. the recombinant vaccine rsc (ps-saoa) conferred high percentage of protection against s. suis or s. choleraesuis challenge in balb/c mice. conclusions: the live-attenuated salmonella enterica serotype choleraesuis vaccine rsc (ps-saoa) with regulated delayed fur mutation provides a foundation for the development of a safe and effective vaccine against s. choleraesuis and s. suis. streptococcus suis is a pandemic pathogen responsible for a wide range of invasive diseases such as pneumonia, meningitis and bacteraemia in both humans and pigs [ , ] . s. suis type (ss ) is the most frequently and virulent isolated from both humans and pigs among all serotypes reported to date [ , ] . the surface-anchored protein (sao) is a highly conserved membrane-anchored protein and proved to be a immunogenic vaccine candidate [ ] . however, sao formulated with emulsigen-plus® provides only partial protection to mice against ss infection [ ] . in our previous study, a recombinant attenuated salmonella enterica serotype choleraesuis vaccine strain rsc carrying saoa gene, provided full protection to mice against ss challenge [ ] . from the above, an effective delivery system such as live salmonella enterica serotype choleraesuis play a crucial role to the effectiveness of sao. the use of intracellular salmonella enterica as a vehicle to deliver heterologous protective antigens against pathogens is an attractive strategy. curtiss et al. developed the rdas (regulated delayed attenuated strategies), which enable live salmonella vaccine effectively colonize lymphoid tissues during the invasion stage because of its wild-type aggressiveness and then be full attenuated by silencing the virulence factor, while stimulate both strong cellular and humoral immunity in the immunized mice [ ] . several ways were used to implement this strategy (rdas). one way is the reverse synthesis of lipopolysaccharide o-antigen by pmi mutation [ ] . another way is to replace the upstream regulatory and promoter sequences of virulence genes with a tightly regulated arac p bad activator-promoter [ ] . this strategy has been successfully used for s. typhimurium and s. typhi [ ] [ ] [ ] . with this strategy, we construct a regulated delayed s. choleraesuis vaccine strain rsc with Δp crp ::tt arac p bad crp and pmi mutations [ ] . rsc delivering s. suis antigens were effective to induce protective immunity against ss in mice, but it occasionally caused enteritidis. we sought to improve our s. choleraesuis candidate vector vaccine by using alternative mutation or introducing new mutation to decreasing its potential to induce enteritidis and enhance immunogenicity. fur is an important regulatory protein in salmonella. in the presence of iron, fur acts as a repressor of iron-controlled genes and mounts an adaptive acid tolerance response [ ] . synthesis of fur in a vaccine strain during growth confers acid tolerance and maintains iron homeostasis. a decrease of fur synthesis in salmonella leads to acid sensitivity and iron acquisition [ ] . curtiss et al. reported that a s. typhimurium strain with an arabinose regulated delayed fur mutation is highly immunogenic [ ] . in these consideration, an arabinose regulated delayed fur mutation (Δp fur :: tt arac p bad fur) was introduced into a s. choleraesuis vaccine strain with multiple preexist mutations (Δpmi- Δrela ::arac p bad laci tt Δasda ) to generate strain rsc . a plasmid ps-saoa [ ] , encoding saoa from ss , was transformed into this strain. we evaluated the virulence, immunogenicity and protection against challenge with virulent ss or s. choleraesuis c - . fur is a ferric uptake regulator that is involved not only in iron metabolism, uptake, and transport, but also invasion and survival of s. typhimurium in the hosts [ ] [ ] [ ] . the absence of fur attenuates s. typhimurium [ , ] . to improve the safety and increase the immunogenicity of s. choleraesuis vector, a new strain, rsc , was generated with an arabinose regulated fur, Δp fur :: tt arac p bad fur (fig. a) . the phenotypes of the mutations Δp fur ::tt arac p bad fur and Δrela::arac p bad laci tt were confirmed by western blot analysis (fig. b) . the level of fur synthesis decreased with arabinose dilution (fig. b) . the presence of mutation Δrela::arac p bad laci tt in rsc (ps-saoa) were confirmed by the increased synthesis of saoa (fig. b) due to the derepression of p trc promoter on plasmid in rsc , which resulted from reduced laci production whose production was controlled by arabinose. the pmi gene encodes phosphomannose isomerase that interconverts fructose- -phosphate and mannose- -phosphatein in salmonella [ ] . because mannose is required for o-antigen synthesis, the Δpmi mutation enables the strain rsc to display a smooth lps pattern in nutrient broth in the presence of mannose and a rough pattern in the absence of mannose (fig. c) . the Δasda mutation enables the strain rsc to have an obligate requirement for dap [ ] , which can be complemented with a vector harboring the asd gene then eliminates the need for antibiotic resistance genes for plasmid maintenance [ ] . the growth rates of rsc with dap, rsc (ps-saoa), and rsc (pya ) were similar (fig. d) . rsc could grow only with dap (fig. d) . antigen synthesis and plasmid stability in s. choleraesuis rsc stable maintenance of plasmids and the production of heterologous antigens are critical to ensure efficacy of recombinant live vaccines. the saoa protein is a highly conserved surface protective antigen among s. suis serotypes [ , ] . using live attenuated s. choleraesuis vector delivering saoa antigen from s. suis will allow to develop a bivalent vaccine against both s. choleraesuis and s. suis. the stabilities of ps-saoa and pya in rsc were evaluated by continuous culturing for generations. the stabilities of both asd + plasmids, ps-saoa and pya , were % in rsc (data not shown). all rsc colonies examined ( clones/generation) by endonuclease digestion possessed the asd + plasmid ps-saoa or pya . the -kda saoa protein was detected in cells obtained from both the first and th generations of rsc (ps-saoa) (data not shown), indicating the stability of plasmid and stable synthesis of saoa. the production levels of saoa in various subcellular fractions from ps-saoa-carrying strains, rsc , rsc , and rsc , were determined ( fig. a-b) . rsc is a derivative of c [ , ] , a licensed live s. choleraesuis vaccine attenuated by chemical methods in china, with an asda mutation. the results showed that the level of the saoa protein produced in the cytoplasm fig. diagram of chromosomal mutation and phenotypes of the s. choleraesuis vaccine strain rsc . (a) schematic map of Δp fur ::tt arac p bad fur deletion -insertion mutation; (b) regulated decreased synthesis of fur (Δp fur ::tt arac p bad fur) and regulated delayed synthesis of saoa in rsc (ps-saoa) with the Δrela::arac p bad laci tt mutation. the rsc (ps-saoa) strain was grown in nb with arabinose (lane ) when od reach . and then diluted at a : ratio into fresh nb without arabinose. the process continued for times (lane - ); each lane was loaded around . × cfu cells. synthesis of fur and saoa were detected by western blot using corresponding antiserum. m: protein marker; (c) lps profile of Δpmi mutation in rsc in nb grown with or without . % mannose. lanes: , wild type c - ; , c ; , rsc with mannose; , rsc without mannose; (d) growth curves of rsc with and without dap, rsc (pya ) or rsc (ps-saoa) in lb were measured with a spectrophotometer (od ) at the indicated time intervals by strain rsc (ps-saoa) was significantly lower than strain rsc (ps-saoa) ( fig. b ; #, p < . ), but significantly higher in supernatant when compared with rsc (ps-saoa) and rsc (ps-saoa) ( fig. b ; **, p < . ). the saoa protein produced in the periplasm fraction of rsc (ps-saoa) was significantly higher than strain rsc (ps-saoa) ( fig. a-b) . to evaluate the virulence of strains with mutations Δp fur :: tt arac p bad fur or Δp crp ::tt arac p bad crp, the ld values of rsc and rsc were tested in -week-old balb/c mice, which represents young mice. rsc was used as an attenuation control. all strains carried the expression plasmid ps-saoa. , and rsc (ps-saoa) by using image j software (image j pmid ). the assay was repeated times. *p < . , **p < . . #,p < . , ##,p < . , for rsc (ps-saoa) compared to rsc (ps-saoa) the results revealed that the ld s of rsc (ps-saoa), rsc (ps-saoa), and rsc (ps-saoa) were at least cfu by oral inoculation; whereas, the ld of wild-type c - was . × cfu (table ) . following intraperitoneal infection, the ld of rsc (ps-saoa) was . -fold higher than that of rsc (ps-saoa) and . -fold higher than that of rsc (ps-saoa) in mice. these results indicated that the virulence of rsc (ps-saoa) harboring Δp fur :: tt arac p bad fur was significantly lower than that of rsc (ps-saoa) harboringΔp crp ::tt arac p bad crp by intraperitoneal route in young mice. tissue distribution of s. choleraesuis strains in balb/c mice fur and crp are important regulatory proteins in salmonella. inactivation of the fur and crp genes, attenuates the organism [ , ] . to quantitatively the colonization of the s. choleraesuis strains containing regulated delayed fur or crp mutations, -week-old balb/c mice were orally inoculated with rsc (pya ), rsc (pya ), rsc (pya ), rsc (ps-saoa), rsc (ps-saoa), rsc (ps-saoa), or wildtype c - ( fig. a-f ). the mice inoculated with wildtype s. choleraesuis c - died - days after inoculation, whereas the mice infected orally with vaccine strains rsc , rsc , rsc containing either plasmid ps-saoa or pya survived. the bacteria titers of wild-type strain c - in peyer's patches, spleen, and liver were significantly higher than those of vaccine strains rsc , rsc , rsc containing either plasmid ps-saoa or pya at days after inoculation ( fig. a-c) . the titers of bacteria in peyer's patches were similar for strains rsc (pya ), rsc (ps-saoa), rsc (pya ), and rsc (ps-saoa) at - days post-inoculation (fig. a) . at d, d, d, d and d, the numbers of rsc (ps-saoa) were significantly higher than those of attenuated vaccine strains rsc (ps-saoa). same for two control vector, the numbers of rsc (pya ) were significantly higher than those of attenuated vaccine strains rsc (p ya ) and there was no significant difference with same strain with expression or control vector. respectively (p < . ; fig. a ). these results indicating that the colonization abilities of strains rsc (ps-saoa) and rsc (pya ) in peyer's patches were higher than that of rsc with either pya or ps-saoa. in spleen, the titers of rsc (pya ) and rsc (ps-saoa) were similar to those of vaccine strains rsc (pya ) and rsc (ps-saoa) at , , , days after inoculation (fig. b ). the titers of strains rsc (pya ) and rsc (ps-saoa) were significantly higher than those of rsc (pya ), rsc (ps-saoa), rsc (pya ), and rsc (ps-saoa), at , , , and days, respectively (fig. b ). in liver, the titers of rsc (pya ) and rsc (ps-saoa) were similar to those of vaccine strains rsc (pya ) and rsc (ps-saoa) at , , , days after inoculation (fig. c ). at d, d, d, d and d post-inoculation, the titers of rsc (ps-saoa) were significantly lower than those of rsc (ps-saoa), same for two control vector, the numbers of rsc (pya ) were significantly lower than those of strains rsc (pya ).respectively(p < . ; fig. c ), whereas the strain rsc (pya ) was the fastest to be cleared in liver (fig. c) . these results indicated that the Δp fur :: tt arac p bad fur mutation impaired the colonization in the liver of s. choleraesuis vaccine strains. in a summary, the Δp fur :: tt arac p bad fur mutation reduced the colonization ability of s. choleraesuis vaccine strains in mice spleen and liver but not in the peyer's patches. antibody responses in mice immunized with s. all of the mice immunized with strains containing ps-saoa developed anti-saoa antibodies (fig. a ). rsc (ps-saoa) induced significantly higher anti-saoa igg titer than did rsc (ps-saoa) weeks after the immunization in week-old mice ( fig. a ; *, p < . ). although the anti-saoa igg titer of rsc (ps-saoa) were slightly higher than that of rsc (ps-saoa) weeks after immunization, they were not significantly different (fig. a ). compared to mice immunized with rsc (ps-saoa), higher serum igg titers against saoa were detected in mice immunized with both rsc (ps-saoa) and rsc (ps-saoa) at weeks and weeks postimmunization (fig. a , *, p < . , **, p < . ). after boosting, higher titers of anti-saoa igg were observed rsc (ps-saoa) Δasda in a live attenuated s. choleraesuis vaccine strain c > . × . × **, ## rsc (ps-saoa) Δp fur ::tt arac p bad fur Δpmi- Δrela ::arac p bad laci tt Δasda in c - > . × ** . × **, ## rsc (ps-saoa) Δp crp ::tt arac p bad crp Δpmi- Δrela ::arac p bad laci tt Δasda in c - > . × ** . × ** ** , p < . , compared with c - ; ## , p < . , compared with rsc (ps-saoa) in mice immunized with all three strains containing ps-saoa ( fig. a , #, p < . ). all three attenuated recombinant salmonella strains induced significant omp titers after the first immunization in mice (fig. b) . a significant boosting of serum antibody responses to omps was observed after the second immunization, ( fig. b ; #, p < . ). mucosal iga anti-saoa responses were detected at week in mice immunized with all three attenuated strains containing ps-saoa. rsc (ps-saoa) induced lower titers of anti-saoa iga than rsc (ps-saoa) or rsc (ps-saoa) did in mice (fig. c , *, p < . , **, p < . ). anti-saoa iga levels detected in the rsc (ps-saoa) immunized group were significantly higher than those induced in the rsc (ps-saoa) immunized group at and weeks after the immunization (fig. c , *, p < . , **, p < . ). these results indicated that strain rsc (ps-saoa) harboring Δp fur :: tt arac p bad fur elicited a stronger immune response than strain rsc (ps-saoa) harboring Δp crp ::tt arac p bad crp did, especially elicit a stronger mucosal immune response. to further evaluate the effect of the Δp fur :: tt arac p bad fur and Δp crp ::tt arac p bad crp mutations in a strain with multiple preexist mutations on th /th immune responses, the levels of ifn-γ and il- in the spleen tissues of mice days and days after booster immunization were measured. the results showed that the titers of ifn-γ and il- induced in mice immunized with rsc , and rsc with either pya or ps-saoa were significantly higher than those induced in mice inoculated by strain rsc with either pya or ps-saoa at both and days after booster (fig. a , b; *, p < . ,**, p < . ). although rsc (ps-saoa) induced a slightly higher level of ifn-γ in mice than rsc (ps-saoa) did, no significant difference was observed in -week-old mice at both and days after booster (fig. a-c) . however, rsc (pya ) elicited a higher level of ifn-γ than rsc (pya ) did at fig. colonization of salmonella choleraesuis rsc in balb/c mice at diferent time points. mice were orally inoculated with . ± . × cfu of the indicated strains. the numbers of bacteria loads in the peyer's patches (a), spleen (b) and liver (c) of mice at d, d, d, d and d after inoculation were plotted. bars represent the arithmetic mean ± standard deviations from two separate experiments each with mice per group. *, p < . ; **, p < . , for rsc compared to rsc or to rsc with either pya or ps-saoa; #, p < . , ##, p < . , for rsc compared to rsc or to rsc with either pya or ps-saoa; $$, p < . , for c - compared to rsc , rsc and rsc with either pya or ps-saoa, as indicated. the data were collected from two independent experiments the inflammatory properties of intestinal tissue were investigated in mice after immuned vaccine strains and wild type strain, c - .the expression of cytokine genes, tnfα, il- β, il- and il- , were assessed by quantitative real -time pcr in gut tissue samples at h and h postinfection. all strains with mutation Δp fur ::tt arac p bad fur showed significantly lower transcription levels of cytokine genes il- β, il- , il- and tnfα than the wild -type strain, c - at both h and h postinfection (fig. a -d,*, p < . , **, p < . ). the c - with mutation Δp fur ::tt arac p bad fur induced significantly lower transcription levels of cytokine genes il- β, il- ,il- and tnfα than the same strain with Δp crp ::tt arac p bad crp mutation at both h and h postinfection ( fig. c and d, &, p < . , &&, p < . ). at h postinfection, strain rsc (ps-saoa) showed significantly lower transcription levels of cytokine genes il- β, il- , il- and tnfα than strain rsc (ps-saoa) (fig. a) , a similar trend was seen with il- β, il- , il- and tnfα at h, although the differences were not significant for il- and tnfα (fig. b ,#, p < . , ##, p < . ). these results suggest that the addition of the Δp fur ::tt arac p bad fur mutations could decreased the inflammatory potential of strains rsc (ps-saoa). comparison of the protective immunity induced by s. to evaluate the protective immunity conferred by rsc (ps-saoa), the mice in each immunized group were challenged orally with × ld of the virulent s. choleraesuis c - strain or × ld of the virulent ss strain at days post-boost immunization. after challenge with c - , the results revealed % protection in mice immunized with either strain rsc (ps-saoa) or strain rsc (ps-saoa), suggesting full protection. mice immunized with the rsc (ps-saoa) strains resulted in % survival. in contrast, all the mice in the pbs group succumbed to the challenge after days. there were no significant difference between the groups immunized with rsc (ps-saoa) and rsc (ps-saoa), though both displayed significantly higher levels of protection than the group immunized with rsc (ps-saoa) (fig. a) . after the ss challenge, immunization with the rsc (ps-saoa), rsc (ps-saoa) and rsc (ps-saoa) strains resulted in % survival, % survival and . % survival with the lethal ss challenge, respectively. in contrast, all the mice in the pbs group succumbed to the challenge after days. the ultimate goal of an engineered live vaccine strain relies on achieving the proper balance between immunogenicity and attenuation [ , ] . achieving that goal will restrict unacceptable reactogenicity to avoid overexcitation of inflammatory responses, but sufficient metabolic activity should be maintained to enable the live vaccine to reach deep lymphatic tissues and induce protective immunity [ ] . the development of bacterial vaccine relies on a combination of defined mutations [ , ] . in order to enhancing the immunogenicity of vaccine strains or to disarm them, multiple independent defined mutations were introduced into salmonella to generate new recombinant attenuated vaccine strains [ , , ] . by coalescent proper mutations, vaccine strains can be befittingly designed to avoid unacceptable reactogenicity and enhanced immunogenicity [ ] . our previous live attenuated s. choleraesuis vaccine vector rsc occasionally caused enteritidis in mice [ ] . one (see figure on previous page.) fig. antibody responses in ten mice. serum igg responses to saoa (a), s. choleraesuis omps (b) and vaginal wash iga responses to saoa (c) were measured by elisa at weeks and . each triangle represents one mouse. error bars represent variation between mice. significant differences were indicated. *, p < . ; ** p < . , for salmonella carrying ps-saoa compared to each other; #, p < . ; ##, p < . , for the titers of antibody at weeks after immunization were compared to those at weeks after immunization. no immune responses were detected to antigen tested in mice immunized with pbs or in pre-immune sera from vaccinated mice (reciprocal titer < : ). the assay was performed in duplicate and repeated at least times of the ways to address this problem is by incorporating a sopb mutation [ , ] . in this paper, another way to improve the s. choleraesuis vector was reported. fur is an important regulatory proteins of salmonella, which has been implicated in the acid tolerance response since fur mutants are acid sensitive and cause altered expression of several acid shock proteins [ , ] . a s. typhimurium strain with an arabinose regulated fur mutation is adequately attenuated and highly immunogenic [ , ] . however, s. typhimurium belong to group b, while s. choleraesuis group c. whether the Δp fur ::tt arac p bad fur mutation that results in the proper balance between attenuation and immunogenicity of s. typhimurium is also appropriate for attenuated s. choleraesuis vaccine has not been reported previously. we corroborated the s. choleraesuis strain rsc (Δp fur ::tt arac p bad fur Δpmi Δrela::arac p bad laci tt Δasda) displayed a regulated decrease of fur production in the absence of arabinose. in a previous publication, s. typhimurium strain with a single Δp fur ::tt arac p bad fur mutation has shown higher virulent than s. typhimurium with a single Δp crp ::tt arac p bad crp mutation by an oral immunization. unlike report from curtiss et al. in s. typhimurium [ ] , our studies did not showed that the Δp fur ::tt arac p bad fur mutation has higher virulent than Δp crp ::tt arac p bad crp mutation in s. choleraesuis. in fact,the ld of rsc (ps-saoa) was -fold higher than rsc (ps-saoa) for -weeksold mice with intraperitoneal injection. this result suggest that the Δp fur ::tt arac p bad fur mutation does different attenuation with s. choleraesuis or s. typhimurium,which may due to its complex role as a transcriptional activator of virulence in different strains [ ] . the Δp fur ::tt arac p bad fur mutation can modify the iron regulated outer membrane protein, then strain with Δp fur ::tt arac p bad fur induced lower inflammation than the isogenic strain with Δp crp ::tt arac p bad crp mutation or wild type strain in mice. theses results suggest that the s. choleraesuis with Δp fur ::tt arac p bad fur mutation exhibits a lower tendency to trigger excessive inflammation while attenuated sufficiently. through the oral vaccination route, a vaccine strain will endure the challenges of acid, bile, and antimicrobial cytokines levels in ten mice immunized with the s. choleraesuis vaccines. ifn-γ (a) and il- (b) in spleens d after the booster dose were assayed with an eilsa kit. a pbs control were also included. (c) the ratio of ifn-γ to il- . the significant differences between groups of each strain was indicated. the assay was performed in duplicate and repeated at least times. *, p < . ; ** p < . , for strains rsc , rsc , rsc with either pya or ps-saoa compared each other; #, p < . ; ##, p < . , for the strains rsc , rsc , rsc with ps-saoa compared to these strains with pya respectively at d and d post immunization peptides existing in the gastrointestinal tract. once inside peyer's patch, it will face macrophagocytes and t cells during the process transferring to deep lymphatic tissues [ ] . fur is essential to salmonella for accessorial an adaptive acid tolerance response [ ] . although both rsc and rsc had similar levels of peyer's patch colonization by oral immunization,we observed that the rsc was cleared more rapidly than the rsc in deeper lymphatic tissues, spleen, and liver of mice. these results suggest that strain rsc was more attenuated than rsc in deep lymphoid tissue, which maybe due to an increase in acid sensitivity cause by loss of fur makes the cell more susceptible to killing by macrophages. both rsc and rsc induced higher levels of iga, igg, ifn-γ, and il responses with great colonization compared to strain rsc with less colonization in mice. in general, the live salmonella vaccines with rdas display superior colonization level in lymphoid tissues during the invasion stage, leading to enhanced protection by effectively colonizing lymphoid tissues [ , ] . however, there are do exist high levels of colonization but low immunogenicity. a strain with the regulated delayed rfc mutation exhibits superior colonization and yet does not fig. induction of inflammatory cytokines at h and h post-infection in ten mice immunized with different salmonella strains. analysis of rna transcript levels by qpcr showed that all mutant strains induced less inflammatory cytokine production than the wild-type strain c - at both h (a and c) and h (b and d) post-infection. &, p < . , c - Δp fur tt arac p bad fur compared to c - ; #, p < . , ##, p < . , rsc (ps-saoa) compared to rsc (ps-saoa); *, p < . , **, p < . , strains with Δp fur tt arac p bad fur mutation compared to c - stimulate higher heterologous protection than a Δrfc strain without rdas [ ] . thus, in addition to colonization level, other determining factors may exist to induce the enhanced protection achieved by regulated delayed attenuation. from the above, selecting the proper mutation is critical for vaccine development with rdas. this study confirmed above statement. although the colonization of rsc (ps-saoa) in mice was less than that of rsc (ps-saoa), rsc (ps-saoa) stimulated stronger serum igg and mucosal iga responses than the rsc (ps-saoa). this phenomenon suggests that strain with regulated delayed fur mutation may stimulate stronger antibody response with fewer bacteria than strain with regulated delayed crp mutation. both rsc and rsc aroused a th cellmediated response, as ostensived by the significant up-regulation of imprint th cytokines, ifn-γ, the stimulator of th -type t cell immune response. it could partially be that the intracellular characteristics of salmonella enterica cause them to be detected on the surface of apc through mhc-i molecules. this result is consistent with previous studies with s. typhi [ ] . strain rsc induced higher th cell-mediated response than strain rsc , as aroused by the significant up-regulation of imprint th cytokines, il- and greater humoral responses than rsc in mice. this phenomenon may be related to the secreting of heterologous antigen. the more heterologous antigens were secreted during infection, the more likely to trigger an il- -dominant response [ ] . we found a larger secretion of the saoa from rsc , which could be presented by mhc-ii molecules. an additional factor may be due to an increase in acid sensitivity cause by loss of fur makes the rsc more susceptible to killing by macrophages, thus weakening rsc 's ability to survive in macrophages. the presence of s. suis-specific iga serves to promptly deliver the antigen to peyer's patch dendritic cells or phagocytes and also promptly excite the adaptive immunity during secondary exposure [ ] . generally speaking, the more attenuated the vaccine strain is, the lower its immunogenicity is [ , ] , while, the more attenuated rsc strain induced significantly higher iga and igg antibody responses to saoa than the rsc at weeks after the initial immunization in juvenile mice. this may be the result of a equilibrium between attenuation and the ability to participation immune components and activate a controlled over-inflammatory response by the finely crafted strain [ ] . the results presented herein highlight that strain rsc (ps-saoa) with regulated delayed fur mutation has retained vaccine efficacy and adequate immunogenicity whilst being safer than previous strain rsc (ps-saoa). furthermore, the inclusion of the Δp fur ::ttar-acp bad fur mutation may be able to decrease inflammation caused by live-attenuated salmonella enterica serotype choleraesuis vaccine, which has been an imperfection for other live-attenuated salmonella enterica serotype choleraesuis vaccine which transformed from wild type virulent strain. both s. choleraesuis and s. suis are major swine pathogens. currently, there exist license live vaccines against s. choleraesuis for swine, including entersol® salmonella t/c and sc- manufactured by boehringer ingelheim and arugs sc/st, respectively [ ] . however, there is no licensed vaccine against s. suis. preventing the diseases caused by ss in swine with a combined vaccine is a long-sought goal. our results have shown the strains rsc (ps-saoa) with regulated delayed fur mutation could confer higher protection against challenges with lethal doses of ss or fig. protection in mice.groups of mice were orally immunized twice at -weeks intervals with indicated strains. half of the mice were challenged orally with ×ld of c - and the other half were intraperitoneally injected with ×ld of ss at weeks after the nd immunization s. choleraesuis c - . thus, the use of attenuated s. choleraesuis to develop a vaccine against s. suis will have the great potential to ease the burden of both pathogens. the regulated delayed fur mutation in the novel vaccine rsc resulted in a well-safety, highly immunogenic, and effective vaccine in mice, this study has paved the way for testing in piglets. our findings will aid the optimal of a s. choleraesuis vaccine vector capable of eliciting a suitable immune response against other pathogens. three-week-old female balb/c mice were purchased from animal center of yangzhou university, and kept week before inoculation. all animal experiments were authorized by the jiangsu administrative committee for laboratory animals (permission number syxk-su- - ) and accorded to the jiangsu laboratory animal welfare and ethics guidelines of the jiangsu administrative committee of laboratory animals. all surgery was performed under anesthesia intraperitoneally injected with sodium pentobarbital, mg per kilogram mouse weight. all the animals were humanely euthanized after the study by inhalation of co ,while injection with sodium pentobarbital, mg per kilogram mouse weight, and all efforts were made to minimize suffering. the strains, plasmids, used in this study are described in table . c , an approved live s. choleraesuis vaccine strain attenuated by thallium compound in china, was used as an attenuation control [ ] . the genetic characterization of this strain has been reported [ ] . s. suis serotype (ss , cvcc ) and s. choleraesuis c - (cvcc ) were purchased from china institute of veterinary drug control. plasmid pya is an asd + vector with a p trc promoter. the asd gene from salmonella was used as a unique plasmid marker to be used in asd mutants to constitute a balanced-lethal system [ ] . lb medium [ ] ,nutrient broth (nb) and macconkey agar (difco) were used for phenotype characterization. when required, media were supplemented with , -diaminopimelic acid (dap; μg/ml), chloramphenicol (cm; μg/ml),l-arabinose ( . % wt/ vol), d-mannose ( . % wt/vol) or sucrose ( % wt/vol). the empty plasmid vector pya and expression vector ps-saoa were described on previous studies [ ] . the saoa gene is under the control of the p trc promoter ( table ). s. choleraesuis vaccine vector strain rsc harboring plasmid ps-saoa (expression vector) or pya (control vector) were grown in lb broth with both . % arabinose and . % mannose. selenite broth was used for enrichment of s. choleraesuis from mice tissues. strains were prepared as previously described [ , , , ] . bacterial growth was monitored with a spectrophotometer at od and by direct plating for colony counts. four mutations Δp fur ::tt arac p bad fur, Δpmi, Δrela::arac p bad laci tt, and Δasda were introduced into s. choleraesuis c - by conjugation with e. coli χ harboring aforementioned suicide vectors as previously described [ ] . the suicide vectors used are listed in table and fig. a . to construct mutation Δp fur ::tt arac p bad fur, a -bp tt arac p bad cassette were used to replace the -bp promoter sequence of the fur gene to achieve arabinose-regulated fur synthesis (fig. a) . the arac p bad cassette contains a transcription terminator (tt) sequence to prevent arac transcription reading through adjoining genes. plasmid for Δp fur ::tt arac p bad fur were confirmed by dna sequencing. all the primers used have been reported [ ] . all mutations were confirmed by colony pcr using homologous primers [ ] . the Δasda mutation was verified by growth with or without dap in lb broth [ , ] . lipopolysaccharide (lps) profiles were examined by silver staining in % sodium dodecyl sulfatepolyacrylamide (sds) gel for the Δpmi mutation [ , ] . the Δp fur ::tt arac p bad fur deletion-insertion mutation was verified by reduced production of fur protein as arabinose concentrations decreased with the increased bacterial growth by western blot using anti-fur antiserum [ ] . the production of saoa was verified by western blot using anti-saoa antiserum, respectively [ , , , ,] . to evaluate the subcellular localization of synthesized saoa in the live attenuated s. choleraesuis vaccine, cultures were grown in nb to an od of . and centrifuged at , ×g for min to collect supernatant and pellet. the culture supernatant was saved for later analysis of the bacterial secreted proteins. periplasmic fractions were prepared using the lysozyme-osmotic shock method as previously described [ , ] . equal volumes of supernatant,periplasmic, cytoplasmic samples were separated by sds-page. proteins were then transferred to polyvinylidene fluoride membrane for western blot analysis using anti-saoa antiserum [ ] . the gel band were analyzed with imagej software (nih) [ ] . his-tagged saoa fusion protein and salmonella outer membrane proteins (somps) were prepared as previous studies [ ] . three-week-old female balb/c mice were obtained from animal center of yangzhou university. mice were fasting for h before inoculation. recombination s. choleraesuis vector strains were cultured in lb broth with d- . % mannose and . % l-arabinose for h at °c as standing cultures. the cultures were diluted : in the same media and cultured at °c to an od of . . bacteria were collected by centrifugation at , ×g for min at room temperature and resuspended in pbs to densities suitable for the inoculation. serial dilutions of the s. choleraesuis strains were plated onto lb agar supplemented with . % d-mannose and . % l-arabinose to measure the actual densities. groups of five mice were inoculated with different doses in μl (oral immunization) or μl (intraperitoneal immunization). the mice were observed for weeks for death. the ld s were calculated according the method of reed and muench [ ] . a colonization assay for recombination s. choleraesuis vector strains was performed as described previously [ , ] . three-week-old female balb/c mice were divided into groups with mice in each group. each mouse asd + ; pbr ori, p trc promoter, β-lactamase signal sequence-based periplasmic secretion plasmid [ ] ps-saoa pya with saoa, p trc promoter [ ] pet a expression vector, t promoter; km r novagen suicide vector pre sacb mobrp r k oriv orit cm r [ ] pdms tet r sacb mobrp r k oriv orit [ ] pya Δp crp ::tt arac p bad crp, pre [ ] pya Δpmi- , pdms [ ] ps Δrela ::arac p bad laci tt, pre [ ] ps Δp fur ::tt arac p bad fur this study pya Δasda , pre [ ] was orally inoculated with ± . × cfu of s. choleraesuis strains. peyer's patches, spleen, and liver of the mice were collected on days , , , and postinoculated. the densities of bacteria in the tissues were determined using the method reported in previous studies [ , , , ] . the assay was performed twice, and the data were similar and pooled for analysis. bacteria were grown and collected as above. serial dilutions of the s. choleraesuis vaccine strains were plated onto lb agar supplemented with . % d-mannose and . % l-arabinose to determine the actual dose. threeweek-old female balb/c mice were orally inoculated with ± . × cfu of s. choleraesuis vaccine strains containing either ps-saoa or pya . mice were boosted inoculated with the same dose of the same strain after weeks. about μl of whole blood was collected by tail vein weeks after primary inoculation and weeks after boosting. serum was separated from the whole-blood samples and stored at − °c. vaginalwash samples in mice were collected at the indicated time and stored at − °c [ , , , ] . this experiment was performed in triplicate with each group receiving a similar dose of the vaccine strains. three-week-old female balb/c mice were divided into groups with mice in each group. groups of mice were orally inoculated with ± . × cfu of salmonella strains. spleen and intestinum tenue of the mice were collected at h and h postinfection. the tissues were frozen with liquid nitrogen and then transferred to − °c. serum igg antibody production against s. choleraesuis outer membrane proteins (omps) and ss saoa,and vaginal-wash iga antibody production against saoa in mice were evaluated by enzyme-linked immunosorbent assay (elisa) [ ] . cytokines in tissues were analyzed by sandwich elisa using commercial kits (bd biosciences) according to manufacturer's instructions. the results from the two experiments were pooled for statistical analysis. for rna isolation, gut tissues were homogenized and suspended in trizol® (thermo fisher scientific,usa). tubes were vortexed for min to disrupt the tissues. chloroform was added to trizol® -treated samples and the samples centrifuged at ×g for min. the aqueous phase was separated out, and the rna precipitated using precooled isopropanol. for quantitative realtime pcr, μg of rna was then reverse transcribed to cdna. the primers were designed using primer blast (ncbi net) and synthesized by tsingke biological technology co., ltd. the sequences of the primers are listed in table . each sample were amplified using fast real -time pcr instrument (abi,us) using fast sybr green master mix (thermo -fisher scientific). the results were using internal reference gapdh as control for normalization, and the ^-ΔΔct method was used to estimate the relative expression level of the mrnas of target genes. challenge with s. suis serotype (ss ) and s. twenty mice in each group were challenged with ss by intraperitoneal (i.p.) injection with . × cfu of ss in μl pbs at weeks after primary immunization. the % lethal dose (ld ) of ss in balb/c mice was . × cfu. another twenty mice in each group were challenged orally with . × cfu of c - in μl pbs. the ld of c - in -week-old balb/c mice was . × cfu. challenged mice were monitored for death daily for days [ , , , ] . statistical analyses on elisa were presented as the geometric means and standard deviations for all assays. a mann-whitney u test (graphpad software, inc.) was applied to contrasting the distribution of the s. choleraesuis in tissues of mice. the kaplan-meier method (spss software) was used for obtain the survival fractions following i.p. challenge of immunized mice. a p value of . was considered statistically significant. the immunoglobulin m-degrading enzyme of streptococcus suis, ides suis, is a highly protective antigen against serotype the protective protein sao (surface antigen one) is not a critical virulence factor for streptococcus suis serotype identification of a surface protein of streptococcus suis and evaluation of its immunogenic and protective capacity in pigs immunization with recombinant sao protein confers protection against streptococcus suis infection salmonella enterica serovar choleraesuis vector delivering saoa antigen confers protection against streptococcus suis serotypes and in mice and pigs salmonella enterica serovar typhimurium strains with regulated delayed attenuation in vivo mutations at rfc or pmi attenuate salmonella typhimurium virulence for mice evaluation of new generation salmonella enterica serovar typhimurium vaccines with regulated delayed attenuation to induce immune responses against pspa live attenuated salmonella enterica serovar choleraesuis vaccine vector displaying regulated delayed attenuation and regulated delayed antigen synthesis to confer protection against streptococcus suis in mice role of the acid tolerance response in virulence of salmonella typhimurium fur regulon of salmonella typhimurium: identification of new iron-regulated genes transcriptional regulation by ferric uptake regulator (fur) in pathogenic bacteria the iron-sensing fur regulator controls expression timing and levels of salmonella pathogenicity island genes in the course of environmental acidification cloning and characterization of the asd gene of salmonella typhimurium: use in stable maintenance of recombinant plasmids in salmonella vaccine strains construction of an asd+ expressioncloning vector: stable maintenance and high level expression of cloned genes in a salmonella vaccine strain subcutaneous vaccination with attenuated salmonella enterica serovar choleraesuis c expressing recombinant filamentous hemagglutinin and pertactin antigens protects mice against fatal infections with both s. enterica serovar choleraesuis and bordetella bronchiseptica characterization and immunogenicity of salmonella typhimurium sl and uk- Δcrp and Δcdt deletion mutants improved tolerability of a salmonella enterica serovar typhimurium live-attenuated vaccine strain achieved by balancing inflammatory potential with immunogenicity construction of recombinant attenuated salmonella enterica serovar typhimurium vaccine vector strains for safety in newborn and infant mice a sopb deletion mutation enhances the immunogenicity and protective efficacy of a heterologous antigen delivered by live attenuated salmonella enterica vaccines spi defective mutants of salmonella enterica induce cross-protective immunity in chickens against challenge with serovars typhimurium and enteritidis effect of salmonella typhimurium ferric uptake regulator (fur) mutations on iron-and ph-regulated protein synthesis live recombinant salmonella typhi vaccines constructed to investigate the role of rpos in eliciting immunity to a heterologous antigen the delicate balance in genetically engineering live vaccines regulated delayed expression of rfc enhances the immunogenicity and protective efficacy of a heterologous antigen delivered by live attenuated salmonella enterica vaccines mucosal iga and ifn-γ+ cd t cell immunity are important in the efficacy of live salmonella enteria serovar choleraesuis vaccines regulated delayed attenuation enhances the immunogenicity and protection provided by recombinant, salmonella, enterica, serovar typhimurium vaccines expressing serovar choleraesuis o-polysaccharides a sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels an efficient and reproducible procedure for the formation of spheroplasts from variously grown escherichia coli transduction-mediated transfer of unmarked deletion and point mutations through use of counterselectable suicide vectors salmonella vaccine vectors displaying delayed antigen synthesis in vivo to enhance immunogenicity morphological heterogeneity among salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels immune responses to recombinant pneumococcal pspa antigen delivered by live attenuated salmonella enterica serovar typhimurium vaccine the imagej ecosystem: an open platform for biomedical image analysis chromosomal aberrations associated with mutations to bacteriophage resistance in escherichia coli th dominance in the immune response to live salmonella typhimurium requires bacterial invasiveness but not persistence publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations the authors thank to roy curtiss, iii for kindly providing χ , pre , pya , and the antibody of fur. availability of data and materials all data generated or analysed during this study will be available from the corresponding author on reasonable request. none of the authors of this manuscript have any competing or financial interests. key: cord- -ro wm kf authors: yang, yifei; shi, ruihan; she, ruiping; mao, jingjing; zhao, yue; du, fang; liu, can; liu, jianchai; cheng, minheng; zhu, rining; li, wei; wang, xiaoyang; soomro, majid hussain title: fatal disease associated with swine hepatitis e virus and porcine circovirus co-infection in four weaned pigs in china date: - - journal: bmc vet res doi: . /s - - -z sha: doc_id: cord_uid: ro wm kf background: in recent decades, porcine circovirus (pcv ) infection has been recognized as the causative agent of postweaning multisystemic wasting syndrome, and has become a threat to the swine industry. hepatitis e virus (hev) is another high prevalent pathogen in swine in many regions of the world. pcv and hev are both highly prevalent in pig farms in china. case presentation: in this study, we characterized the hev and pcv co-infection in – month-old piglets, based on pathogen identification and the pathological changes observed, in hebei province, china. the pathological changes were severe, and general hyperemia, hemorrhage, inflammatory cell infiltration, and necrosis were evident in the tissues of dead swine. pcr was used to identify the pathogen and we tested for eight viruses (hev, porcine reproductive and respiratory syndrome virus, pcv , classical swine fever virus, porcine epidemic diarrhea virus, transmissible gastroenteritis coronavirus, porcine parvovirus and pseudorabies virus) that are prevalent in chinese pig farms. the livers, kidneys, spleens, and other organs of the necropsied swine were positive for hev and/or pcv . immunohistochemical staining showed hev- and pcv -antigen-positive signals in the livers, kidneys, lungs, lymph nodes, and intestine. conclusion: hev and pcv co-infection in piglets was detected in four out of seven dead pigs from two pig farms in hebei, china, producing severe pathological changes. the natural co-infection of hev and pcv in pigs in china has rarely been reported. we speculate that co-infection with pcv and hev may bring some negative effect on pig production and recommend that more attention should be paid to this phenomenon. the rapid development of the pig industry in china accompanies with outbreaks of epidemic diseases in recent years. hepatitis e virus (hev) has been identified on pig farms in many regions of the world, including china [ ] [ ] [ ] . hev seropositivity rates of . % and % have been reported in pig herds of large-scale and family-scale farms in china, respectively [ ] . increasing evidence indicates that hev can infect both humans and animal [ ] . to date, most studies of hev based on prevalence surveys, and research into hev-associated mortality during natural infection was limited. mao et al. reported that co-infection with hev and porcine reproductive and respiratory syndrome virus (prrsv) could lead to high mortality in swine [ ] , and they speculated that co-infection with hev and other pathogens could cause serious disease. it has been demonstrated that hev and porcine circovirus (pcv ) could cause infectious hepatitis, but swine naturally co-infected with hev and pcv in china has rarely been reported [ , , ] . pcv infection occurs in many countries and poses a considerable threat to the swine industry [ ] . although the recently research showed that infection of pcv could be effectively reduced by utilizing pcv vaccine [ ] , prevention of pcv in the pig production should be paid more attention. in the present study, pathogen identification and the observation of pathological changes demonstrated a natural co-infection with hev and pcv in the swine on two pig farms in hebei province, china. this discovery may provide a new perspective for clinical research. medical history and clinical symptoms from november to december , an outbreak of an unknown disease occurred at two small-scale pig farms ( pigs in farm a and pigs in farm b), operating for a short time in hebei province, china. all of the piglets fed in both pig farm a and b were aged - months. pig farm a reported the deaths of piglets (mortality rate was . %), and pig farm b the deaths of pigs (mortality rate was . %). the affected animals on both farms presented with symptoms of fever, dyspnea, diarrhea, and anorexia. in pig farm a, the veterinary administrated timicosin and doxycycline to treat the pigs. and in pig farm b, florfenicol was administrated. however, the swine did not respond to antibiotic treatment. necropsies were performed on seven dead piglets: three from farm a (pigs , , and ) and four from farm b (pigs , , , and ). the tissues examined included the liver, spleen, lung, kidney, heart, intestine, and lymph nodes. all tissues used for histological examination were fixed in . % (w/v) glutaraldehyde-polyoxymethylene solution for h. the fixed tissues were routinely processed, embedded in paraffin, sectioned ( μm thickness), and stained with hematoxylin and eosin. portions of the liver, spleen, kidney, brain and lung tissues were used for pathogen detection and stored at − °c until required. seven dead piglets were necropsied and diagnosed. scattered hemorrhagic spots were observed on the surface of the skin ( figure a ). the right ventricle was dilated so that the ratio of the transverse/longitudinal diameters was increased ( figure b) . hyperemia, hemorrhage, and necrosis were present in large local areas of the lung ( figure c ). a transparent gelatinous exudate was observed in the trachea ( figure d ). the liver was enlarged and the surface was a dark red color ( figure e ). it was difficult to strip the kidney capsule, and all the kidneys showed varying degrees of enlargement ( figure f ). the lymph nodes and spleens were swollen to varying degrees ( figure g , h). hemorrhage and infarction were observed in the spleen ( figure h ). the mesenteric lymph nodes were enlarged and hyperemic ( figure i ). the pathological changes in various tissues were determined with microscopy. the lesions observed in the lung, liver, heart, kidney, lymph node, spleen and intestinal tract tissues were similar in all the pigs necropsied. the heart lesions were characterized as viral myocarditis (figure a ). the epicardium was predominantly infiltrated by lymphocytes, with a small number of neutrophils ( figure b ). granular myocardial degeneration, edema, and lymphocyte and neutrophil infiltration in the myocardium were observed ( figure c) . a hepatic examination revealed features characteristic of hepatitis in a number of liver samples, including congestion, vacuolization, and necrosis, ( figure e ). lymphocyte and neutrophil infiltration, particularly in the portal area, was clearly observed ( figure f ). examination of the lungs demonstrated large areas of hyperemia, hemorrhage, and lymphocyte and neutrophil infiltration, with very little normal histological structure. the bronchioles contained exfoliated alveolar epithelial cells and pink liquid exudate ( figure g ,h). enlargement of the glomerulus and focal lymphocyte infiltration were observed in the kidneys. the renal tubule epithelial cells showed granular degeneration and necrosis, and congestion and hemorrhage were present in the kidneys. the renal tubule epithelial cells shed off from the basilar membrane. the glomerulus contained albuminoid droplets of exudate ( figure i ,j). the organs of immune system were severely underdeveloped, and malformed splenic white pulp was responsible for the reduced numbers of lymphocytes ( figure d ). poorly developed lymph nodes were also evident. the majority of capillaries were expanded and hyperemia was present. the lymphoid nodules were smaller than normal, resulting from fibrosis, necrosis, and lymphocyte depletion ( figure k , l). examination of the intestine revealed necrosis, and coagulation of the intestinal villi. the submucosal layer was exposed due to the loss of mucosal layer. epithelial cell shedding and secretion from the intestinal glands into the gut cavity were increased ( figure m , n). the main pathological changes observed in the various organs of the seven necropsied pigs are summarized in table . pcr was used to detect any viruses in the liver, lung, spleen, brain and kidney samples (table ). viral pathogens responsible for suspicious diseases in swine were investigated: hev, pcv , classical swine fever virus . other tissues were also tested using pcr. the liver, spleen, kidney, lung, and brain of pig no. , , , , and were positive for hev rna and these tissues were pcv dna positive in pig no. , , , , , and . the co-infection rate for hev and pcv was . % ( / ). the livers, lungs, kidneys, and spleens of the necropsied pigs were negative for pedv, tgev, csfv, prrsv, prv, and ppv. immunohistochemical (ihc) staining confirmed the presence of hev and pcv antigens in several tissues and organs. hev antigen was detected in the livers, kidneys, lung, intestine and lymph nodes of all five hev-positive swine (pig no. , , , , ). granular or diffuse positive staining was seen in the hepatic sinusoid and the cytoplasm of hepatocytes ( figure a ). the nuclei and cytoplasm of the renal tubular epithelial cells ( figure b ) and lung cells ( figure c ) were positive for hev antigen. the staining for hev antigen in the lymph nodes was intense in the lymphocytes and macrophages ( figure d ). the staining for hev antigen in the intestinal tissue was intense in the lamina propria and gut-associated lymphoid tissue ( figure e ). the negative control is shown in figure . hev antigen was negative in the two hev rna negative swine (pig no. and ). the lungs, livers, kidneys, lymph nodes, and intestine were tested for pcv antigen with ihc staining. the tissue distribution of the pcv antigen was similar in all pcv dna positive pigs (pig no. , , , , , ). in the liver, pcv antigen was detected within the hepatocytes and küpffer cells ( figure a ); in the kidneys, the positive signals were in the tubular epithelial cells ( figure b) ; and for the lungs, pcv -antigen positive signals were in the alveolar and septal macrophages, and fibroblast-like cells in the lamina propria of the airways ( figure c ). pcv antigen was intense in the lymphocytes and macrophages in the lymph nodes ( figure d ), and the mucous layer and lamina propria of the intestine ( figure e ). the negative control is shown in figure . pcv antigen was negative in the pcv dna negative pig (pig no. ). hepatitis e virus infections are a major cause of acute hepatitis in developing countries, and because of the zoonotic transmission of hev, they are also an emerging health problem in industrialized countries. swine are considered to be a major reservoir of the hev transmitted to humans [ , ] . four main genotypes have been identified in hev. genotypes and have only been found in humans, whereas genotypes and have been recovered from both humans and pigs [ ] . smith et al. recently proposed a taxonomic scheme, which divided the family hepeviridae into the genera orthohepevirus (all mammalian and avian hepatitis e virus (hev) isolates) and piscihepevirus (cutthroat trout virus) [ ] . the livers of pigs naturally infected or intravenously inoculated with hev display focal lymphocytic infiltration and swollen, vacuolated hepatocytes [ ] . the livers of the seven pigs investigated in the present study had significant lymphocytic infiltration in the portal area, and large localized areas of fibrosis, necrosis, and vacuolization. ihc staining showed that the orf protein of hev was distributed across multiple organs, particularly in the liver and kidneys. this result was not unexpected because the liver is the target organ of hev, and the kidney plays an integral role in maintaining extracellular fluid homeostasis. the previous study also demonstrates that hev has been found in liver and kidney after experimental infection in domestic pigs [ ] . a pcr assay specific for hev orf confirmed that the pigs were hev positive. isolates chn-hb-hd-l , chn-hb-hd-l , hb-l , chn-hb-hd-l , and chn-hb-hd-l were shown to belong to genotype , the most prevalent hev genotype in china. according to smith et al. [ ] , the hev strains isolated in our case were classified to orthohepevirus a. pcv is the primary causative agent of pmws which was first described in canada in [ ] . in recent years, pmws has become a serious economic problem for the swine industry in china. according to the data from a prevalence survey, more than . % of piglet stool samples were pcv positive [ ] . the disease predominantly affects pigs between and weeks of age and is characterized by growth retardation, diarrhea, dyspnea, jaundice, and enlargement of the inguinal lymph nodes. in our study, infected swine aged - months displayed clinical symptoms consistent with previous reports of the disease [ ] . in this study, the clinical and pathological changes observed were consistent with typical pcv infection. hemorrhage, hyperemia, edema, necrosis, and lymphocyte infiltration were observed in all organs, most notably the lungs. histological changes consistent with lobar pneumonia were also evident in the lungs, and normal lung histology was rarely seen. the alveolar walls were thickened, with substantial lymphocyte, erythrocyte, and exudate infiltration. exfoliated alveolar epithelial cells and pink liquid exudate were observed within the bronchioles. pcv has a small, nonenveloped icosahedral virion, and a single-stranded circular dna genome, , - , nt in length. the genome has two major orfs encoded in the antisense direction [ ] . isolates hbhd-l , hbhd-l , hbhd-l , hbhd-l , hbhd-l , and hbhd-l recovered in this study were closely related to the genotype pcv d strains hnf (kj ), sd-zb (kj ), wsec (kj ), gxyq (kj ), tdbs (kj ) (figure ) . the genotype pcv d represented a novel genotype and a shift from pcv a to pcv b as the predominant genotype in china in recent years [ ] . a genetic analysis, combined with the observed pathological changes, indicated that the pcv isolates detected in this study were probably high prevalent in china [ ] . ihc staining of tissues for the orf protein of pcv revealed that the antigen was observed in the lungs, liver, lymph node, intestine and kidneys, further evidence of pcv infection. further pathological changes typical of pcv infection were observed in this study. significant immune-system- organ dysplasia was apparent, with the characteristic histopathological findings of lymphoid depletion and histiocytic replacement in the lymphoid tissues. combined with the positive pcv orf signals in lymph node in ihc, these results suggest that the systemic immune function of these pigs had been disrupted. ihc staining for hev and pcv antigens revealed a diffuse labeling pattern in the intestine, with the greatest reactivity observed in the cytoplasm of cells in the mucous layer and lamina propria. this observation is consistent with the viral invasion pathways. the transmission of hev occurs via the fecal-oral route, so hev may invade the animal through the intestinal mucous layer, with infection progressing to the lamina propria. we have investigated the mucosal immunity in the intestines of rabbits [ ] and gerbils (data not shown) experimentally infected with hev, and both studies demonstrated a strong hev orf positive signals in intestinal. in the present study, naturally infected swine exhibited significant necrosis of the intestinal epithelial cells and also showed hev orf positive signals in intestine. therefore, hev invasion of the intestine may proceed rapidly and widely, consistent with the diffuse labeling pattern observed in the intestine in this study. we also tested for other suspicious pathogens in this study. according to the medical history, the sick piglets failed to respond to antibiotic treatment (timicosin and doxycycline in pig farm a, and florfenicol in pig farm b), indicating that bacterial infection was unlikely. prrsv, csfv, pedv, tgev, prv, and ppv are high prevalent in swine in china and across the globe. although infections with these viruses may present with similar clinical symptoms, including fever, diarrhea, depressed, and decrease of feed intake. pcr confirmed that all seven pigs were negative for these viruses. presence of signs and lesions such as lymphoid depletions, hepatitis, nephritis, etc. resemble the microscopic characteristic of pmws. nevertheless, no typical microscopic lesions such as granulomatous inflammation or intracytoplasmic inclusion bodies were observed in lymphoid tissue, liver, spleen, and other tissues [ ] . the mortality associated with pcv infection is generally around % (range %- %), but can reach % [ ] . in our case, seven pigs were detected and the pathogens had been identified. however, the true reason for the high mortality in the whole pig farm a and b still need more exploring. the occurrence of this disease may not be only a matter of pmws caused by pcv infection. the previous study showed swine hev infection can be a significant factor to the development of hepatitis regardless of the pmws status [ ] . in addition, j. ellis [ ] claimed that the severity of hepatic lesions in pcv- infected pigs may be enhanced by co-infection with swine hepatitis e virus. it may indicate that the significance of hev is hardly negligent. further investigation about the mechanistic basis for the pathogenesis of the clinical syndrome that associated with pcv and hev coinfection needs to be conducted. hev infection in humans and animals is common, but the natural occurrence of hev and pcv co-infection in pigs in china, reported here, has rarely been seen. the experimental infection of domestic pigs with hev did not cause death [ ] . therefore, the hev-infected swine observed in this study requires further investigation. based on these results, we believe that considerable attention should be directed towards co-infections of hev and pcv in swine. according to the comparison of histopathological changes between these cases in table , no specific characteristics are demonstrated, which is really thoughtprovoking. it is very significant to explore the reasons for the similar pathological changes in the hev and/or pcv infected pigs. in order to reveal the mechanism for the similar pathological changes in the hev and/or pcv infected pigs, further tests about hev and pcv co-infection, single hev infection and single pcv infection in pigs have been in the planning. we hope to reveal the mechanism of the similar pathological changes and also discover the similarity and differences between the natural cases and the experimental infected pigs. to our best knowledge, theses following reasons are speculated to explain the similar pathological changes: a) the individual differences in pigs. different pigs may have different reaction to the attack of the viruses; b) pig no. may once have been infected with pcv and then pcv were neutralized by the antibody. but lesions in the tissues hadn't recovered when it died; c) hev is rna virus without envelope. it may have degraded in tissues in pig no. and before testing. d) the complicate in natural infected cases. in conclusion, co-infection of hev and pcv were identified in four out of seven dead weaned pigs from two pig farms in china. severe pathological changes and high mortality were observed in the infected animals. our results indicate that co-infection with hev and pcv may bring some negative effect on the swine industry in china, and this phenomenon requires further investigation. what's more, further research is required to demonstrate the role of co-infection of hev and pcv in swine and whether these two viruses exert a synergistic effect. written informed consent was obtained from the owners of the two farms for the publication of this report and any accompanying images. according to the gross and histopathological lesions, eight suspected viruses were detected. total rna and dna were extracted from liver, lung, kidney, brain, and spleen specimens using the ultrapure™ rna kit and the general allgen kit (cwbio, beijing, china), according to the manufacturers' instructions. the extracted rna prevalence of hepatitis e virus in swine fed on kitchen residue detection of hepatitis e virus (hev) in italian pigs displaying different pathological lesions a novel virus in swine is closely related to the human hepatitis e virus prevalence of hepatitis e virus in swine under different breeding environment and abattoir in beijing, china phylogenetic analysis of global hepatitis e virus sequences: genetic diversity, subtypes and zoonosis one case of swine hepatitis e virus and porcine reproductive and respiratory syndrome virus co-infection in weaned pigs nucleotide sequence of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs association of hepatitis e virus (hev) and postweaning multisystemic wasting syndrome (pmws) with lesions of hepatitis in pigs porcine circoviruses: a review commercial pcv a-based vaccines are effective in protecting naturally pcv b-infected finisher pigs against experimental challenge with a mutant pcv prevalence and transmission of hepatitis e virus in domestic swine populations in different european countries molecular virology of hepatitis e virus consensus proposals for classification of the family hepeviridae comparative pathogenesis of infection of pigs with hepatitis e viruses recovered from a pig and a human evidence of extrahepatic sites of replication of the hepatitis e virus in a swine model isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome complete genome sequence of a highly prevalent porcine circovirus isolated from piglet stool samples in china detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome porcine circovirus type (pcv ): genetic variation and newly emerging genotypes in china genetic variation analysis of chinese strains of porcine circovirus type detection and localization of rabbit hepatitis e virus and antigen in systemic tissues from experimentally intraperitoneally infected rabbits postweaning multisystemic wasting syndrome: a review of aetiology, diagnosis and pathology porcine circovirus type and porcine circovirus-associated disease porcine circovirus- and concurrent infections in the field experimental hepatitis e infection in domestic pigs molecular variation in the nucleoprotein gene (orf ) of the porcine reproductive and respiratory syndrome virus (prrsv) multiplex pcr for detection and typing of porcine circoviruses genetic diversity of the envelope glycoprotein e of classical swine fever virus: recent isolates branched away from historical and vaccine strains a multiplex rt-pcr assay for rapid and differential diagnosis of four porcine diarrhea associated viruses in field samples from pig farms in east china from to development of multiplex pcr for simultaneous detection of six swine dna and rna viruses we thank dr. liu jue (beijing municipal key laboratory for the prevention and control of infectious diseases in livestock and poultry, beijing, china) for kindly supplying the anti-pcv orf antibody for the study. this work was supported by the national natural science foundation of china (grant nos. , ). the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. the authors declare that they have no competing interests.authors' contributions yy, rshi, and rshe designed the study. yy and rshi wrote article. yy, rshi, fd, rn, wl, mc, xw, and mhs performed the laboratory experiments. yy, rshi, cl, jm, yz, and jl analyzed and interpreted the data. all authors have read, commented upon, and approved the final article. key: cord- - ljgxnhf authors: lin, chao-nan; lin, wei-hao; hung, li-ning; wang, sheng-yuan; chiou, ming-tang title: comparison of viremia of type ii porcine reproductive and respiratory syndrome virus in naturally infected pigs by zip nucleic acid probe-based real-time pcr date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: ljgxnhf background: porcine reproductive and respiratory syndrome virus (prrsv) is a rna virus with high genetic variation. this virus causes significant economic losses in most pig-producing countries. the clinical presentation of prrsv ranges from asymptomatic to devastating. in this study, we developed a sensitive and specific zip nucleic acid probe-based real-time pcr assay to evaluate the viremia of natural prrsv-infected pigs in taiwan. serum samples were collected from pigs aged – weeks. these include clinically healthy pigs and symptomatic pigs were confirmed to have porcine respiratory disease complex (prdc). results: viremia was quantified in of the ( . %) clinically healthy pigs and in of the ( . %) prdc cases. viremias were significantly more common in pigs with prdc compared with the clinically healthy pigs (p < . ). these results suggest that a high viral load is a major feature of prrsv-affected pigs. conclusions: zna probe-based real-time pcr can be a useful tool to diagnose symptomatic and asymptomatic prrsv-infected pigs. the presence of this marker in a sample of animals with high prrsv loads (> ( . ) prrsv genomes/μl of serum) seems to indicate that it correlates with the presence of prdc in pigs. porcine reproductive and respiratory syndrome (prrs) causes significant economic losses in most pig-producing countries [ ] . the causative agent, the prrs virus (prrsv), was identified in the early s [ ] . prrsv is an enveloped, positive-strand rna virus with a genome of approximately kb, and it belongs to family arteriviridae and order nidovirales [ ] . a remarkable amount of genetic variation has been observed among the prrsvs isolates worldwide, particularly in nsp [ ] [ ] [ ] [ ] , orf [ ] [ ] [ ] [ ] [ ] [ ] [ ] and the nucleocapsid (the orf product) [ , , , ] . the genetic characteristics of the prrsv strains clearly indicate the existence of two major genotypes, the european type (eu genotype, type ) and the north american type (na genotype, type ) [ ] . during prrsv infection, clinical disease is detectable in all of ages of pigs but is usually observed in nursery-grown pigs [ ] . the clinical presentation of prrsv can range from asymptomatic to devastating, with symptoms such as listlessness, emaciation, hyperpnea, dyspnea, chemosis, abortion, stillbirth and a reduction in semen quality [ ] . however, infection with prrsv predominantly exists at a subclinical level, participating as a cofactor in porcine respiratory disease complex (prdc) and porcine circovirus associated disease (pcvad) [ ] . prrsv can be detected using molecular methods from nasal fluid, salivary, serum and tonsil specimens from naturally infected pigs [ ] . however, because prrsv is common within the swine population, no quantitative real-time pcr assays have been described using the serum samples of both symptomatic and asymptomatic prrsv-infected pigs. the diagnosis of prrsv infection has relied on probebased real-time pcr [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] , sybr green-based pcr [ , [ ] [ ] [ ] , rt-pcr [ ] , virus isolation [ ] , immunohistochemistry [ ] and serological methods [ ] . zip nucleic acids (zna) are oligonucleotide-oligocation conjugates with multiple cationic spermine moieties attached to the nucleic acid oligomer [ ] . the melting temperature of a hybridized zna is easily predictable and increases linearly with the length of the oligocation [ ] . zna were shown to enable specific and sensitive reactions when used as a primer for pcr and reverse transcription [ ] . the present study describes a sensitive method for detecting type prrsv using real-time fluorescent quantitative pcr with zna probes. zna probe-based real-time pcr amplification and the limit of detection tenfold serial plasmid dilutions ( to copies/μl) were tested and used to construct the standard curve by plotting the logarithm of the plasmid copy number against the measured quantification cycles (cq) values. the generated standard curve covered a linear range of six orders of magnitude of the standard plasmid dna. the linear correlation (r ) between the cq and the logarithm of the plasmid copy number was . (slope = − . ) (figure ). to assess the limit of detection of the assay, to copies/μl of standard plasmid dna per reaction were tested in replicates. at more than copies, % of the replicates were positive, and at copies, ( %) of the replicates were positive (table ) . reproducibility and specificity of the zna probe-based real-time pcr the coefficient of variation of the mean cq values in the within-run and between-run for standard plasmid dna precision experiments ranged from . to . % and from . to . %, respectively ( table ). the cv values in the within-run and between-run for clinical specimens that spanned the whole ranged from . to . % and from . to . %, respectively (table ) . we analyzed other swine viruses to test the specificity of the zna probebased real-time pcr. no specific amplifications were detected for any of these samples (data not shown). the assay was tested on serum from both healthy and prdc pigs. as determined by zna probe-based real-time pcr, ( . %) of the prdc pigs and ( . %) of the asymptomatic pigs were positive (table ). using a chi-square test, the correlation between prrsv and prdc was calculated. among the pigs that were analyzed, a positive result for prrsv appeared to be highly significantly correlated with the presence of prdc (p < . ). in addition, the prrsv load was significantly higher (p < . ) in the prdc pigs (ranging from . to . log prrsv genome/μl, median . log ) compared to that in the asymptomatic pigs (ranging from . to . log prrsv genome/μl, median . log ) ( figure ) ( table ). these data indicated that the levels of viral load correlated with the severity of the clinical presentation of the prrsv-infected pigs. the molecular diagnosis of prrsv infection has relied on probe-based real-time pcr [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] and sybr greenbased pcr [ , [ ] [ ] [ ] . this study first describes a new zna probe-based real-time pcr for prrsv and evaluates this method as a diagnostic tool for prrsv infection. this assay was sensitive, specific and reliable for the amplification of prrsv cdna, with a reproducible limit of detection of approximately copies of target dna per reaction. both the intra-and inter-assay cvs for standard plasmid dna and clinical specimens were satisfactorily low. a novel type of modified oligonucleotides known as zna was recently developed as a method for the clinical diagnosis of pathogens, such as the hepatitis b virus [ ] . znas are able to discriminate between complementary sequence that are a perfect match and those that are mismatched by a single base pair [ ] . znas are particularly efficient at low magnesium concentrations, low primer concentrations and high annealing temperatures [ ] . zna probes provide broad flexibility with respect to experimental design and represent an effective alternative to minor groove binder-dna and locked nucleic acid probes [ ] . the viral load is an indicator of active infection, virushost interaction and disease progression [ ] . the asymptomatic pigs are believed to serve as important reservoirs for the transmission of prrsv to uninfected pigs [ ] . seventeen point eight percent ( / ) of the asymptomatic pigs were positive in this study. similar findings ( . %, / ) were reported in a study that employed traditional rt-pcr in china [ ] . however, this is first study to report the viral load using serum samples in asymptomatic prrsv-infected pigs using zna probebased real-time pcr. four asymptomatic prrsv-infected pigs were detected at levels as high as log viral copies/ μl ( figure ). this result may be explained by differences in the susceptibility to prrsv infection. the present study also reinforces a the previous suggestion that prrsv is one of the major viral agent for prdc [ , ] . prrsv viraemia was detected in . % ( / ) of the prdc pigs, ranging from . to . log prrsv genome/μl (mean . ± . log , median . log ). in contrast to the symptomatic pigs, the viraemia of the asymptomatic pigs ranged from . to . log prrsv genome/μl (mean . ± . log , median . log ). moreover, based on the present results, it can be concluded that when pigs are infected with prrsv, the amount of prrsv in serum samples is significantly higher in prdc pigs. similar reports had been made for another major viral zna probe-based real-time pcr can be a useful tool to diagnose asymptomatic prrsv-infected pigs. the presence of high prrsv loads in a sample of animals (> . prrsv genomes/μl of serum) is correlated to the presence of prdc in pigs. serum samples were collected from pigs from middle and southern taiwan from to . these animals included healthy pigs and symptomatic pigs (aged from to weeks old) that showed a clinical history of prdc, such as listlessness, emaciation, hyperpnea or dyspnea. rna extraction and reverse transcription were performed according to the procedures outlined in chomczynski [ ] and lin [ ] , respectively. this study protocol was approved by the animal care and use committee of the national pingtung university of science and technology. a conserved region of the m gene (the orf product) was identified in nucleotide sequences from asian (n = ), european (n = ), and american (n = ) available from genbank, which were aligned using the clustal w method and the megalign program (dnastar, madison, wi). a -bp region was amplified from the orf gene of prrsv using the primer pair prrsv-m f &-m r (table ) . a dna fragment of the orf gene was amplified from the prrsv vaccine (ingelvac® prrs mlv, boehringer ingelheim) using conventional pcr. the pcr products were cloned using the t&a cloning kit (yeastern biotech co., ltd., taipei, taiwan) and sequenced. the prrsv plasmids were purified using a plasmid miniprep purification kit (gmbiolab co., ltd., taichung, taiwan) and quantified by measuring the od using a spectrophotometer (hitachi u , dallas, tx, usa). a standard curve was generated using -fold dilutions ( - copies/μl) of the standard plasmid dna. zna probe-based real-time pcr to detect prrsv the zna probe-based real-time pcr assays were performed using the lightcycler nano (roche diagnostics, mannheim, germany). each μl reaction mixture contained . μm concentrations of the forward and reverse primers and μl of the cdna. the thermocycling conditions consisted of min at °c and cycles of sec at °c, sec at °c and sec at °c. each run included serial -fold dilutions of the standard plasmid dna as a positive control and to construction the standard curve. a negative control that was missing the dna template was included to detect any cross-contamination. reproducibility and specificity of zna probe-based real-time pcr the intra-(within-run) and inter-(between runs) assay reproducibility were evaluated using -fold serial dilutions of the standard plasmid dna (from - copies per figure absolute copy number per microliter of prrsv in serum from prdc and clinically asymptomatic pigs. the serum of prdc (n = ) and asymptomatic pigs (n = ) was analyzed using zna probe-based real-time pcr. the mean percentages (long horizontal lines) of the prrsv load in the prdc and asymptomatic pigs were compared. error bars show sd. the prrsv load was significantly higher (p < . ) in the pigs with prdc compared with the asymptomatic pigs, as assessed by unpaired, -tailed student's t-tests. reaction), tested in triplicate on three different days. the coefficients of variation of the absolute copy number obtained from each dilution were calculated. the reproducibility of the method was also evaluated by repeatedly testing the clinical samples, as previously described [ ] . the specificity of the zna probe-based real-time pcr assay was assessed by testing nucleic acid extracts of porcine classical swine fever, porcine circovirus type , porcine parvovirus and porcine pseudorabies virus. student's t-test was used to compare the viral loads between the various clinical symptom groups. the correlation between prrsv and prdc was evaluated using the chi-square test with yate's correction. p values < . and < . were considered significant and highly significant, respectively. porcine reproductive and respiratory syndrome virus (porcine arterivirus) genetic variation and pathogenicity of highly virulent porcine reproductive and respiratory syndrome virus emerging in china molecular variation analysis of porcine reproductive and respiratory syndrome virus in china the genomic diversity of chinese porcine reproductive and respiratory syndrome virus isolates from to analysis of molecular variation of porcine reproductive and respiratory syndrome virus in central china from genetic variation analysis of porcine reproductive and respiratory syndrome virus isolated in china from to based on orf genetic diversity of the orf gene of porcine reproductive and respiratory syndrome virus isolates in china from molecular epidemiology of prrsv: a phylogenetic perspective polymorphic genetic characterization of the orf gene of porcine reproductive and respiratory syndrome virus (prrsv) in china pathogenesis of porcine reproductive and respiratory syndrome virus real-time pcr for quantitation of porcine reproductive and respiratory syndrome virus and porcine circovirus type in naturally-infected and challenged pigs detection of u.s., lelystad, and european-like porcine reproductive and respiratory syndrome viruses and relative quantitation in boar semen and serum samples by real-time pcr simultaneous detection of north american and european porcine reproductive and respiratory syndrome virus using real-time quantitative reverse transcriptase-pcr the use of endogenous and exogenous reference rnas for qualitative and quantitative detection of prrsv in porcine semen optimization of a sampling system for recovery and detection of airborne porcine reproductive and respiratory syndrome virus and swine influenza virus simultaneous detection of classical swine fever virus and north american genotype porcine reproductive and respiratory syndrome virus using a duplex real-time rt-pcr rapid detection and strain identification of porcine reproductive and respiratory syndrome virus (prrsv) by real-time rt-pcr rapid detection of a highly virulent chinese-type isolate of porcine reproductive and respiratory syndrome virus by real-time reverse transcriptase pcr development of a onestep real-time quantitative pcr assay based on primer-probe energy transfer for the detection of porcine reproductive and respiratory syndrome virus rapid differential detection of classical and highly pathogenic north american porcine reproductive and respiratory syndrome virus in china by a duplex real-time rt-pcr porcine reproductive and respiratory syndrome virus (prrsv) influences infection dynamics of porcine circovirus type (pcv ) subtypes pcv a and pcv b by prolonging pcv viremia and shedding simple and rapid detection of the porcine reproductive and respiratory syndrome virus from pig whole blood using filter paper simultaneous detection and genotyping of porcine reproductive and respiratory syndrome virus (prrsv) by real-time rt-pcr and amplicon melting curve analysis using sybr green the development of a rapid sybr one step real-time rt-pcr for detection of porcine reproductive and respiratory syndrome virus zip nucleic acids: new high affinity oligonucleotides as potent primers for pcr and reverse transcription zip nucleic acids are potent hydrolysis probes for quantitative pcr detection of hbv resistance to lamivudine in patients with chronic hepatitis b using zip nucleic acid probes in kerman, southeast of iran nitsche a: real-time pcr in virology detection of asymptomatic antigenemia in pigs infected by porcine reproductive and respiratory syndrome virus (prrsv) by a novel capture immunoassay with monoclonal antibodies against the nucleocapsid protein of prrsv three cases of porcine respiratory disease complex associated with porcine circovirus type infection study of infectious agents involved in porcine respiratory disease complex in taiwan quantitation of porcine circovirus type isolated from serum/plasma and tissue samples of healthy pigs and pigs with postweaning multisystemic wasting syndrome using a taqman-based real-time pcr comparison of porcine circovirus type load in serum quantified by a real time pcr in postweaning multisystemic wasting syndrome and porcine dermatitis and nephropathy syndrome naturally affected pigs quantification of porcine circovirus type (pcv ) dna in serum and tonsillar, nasal, tracheo-bronchial, urinary and faecal swabs of pigs with and without postweaning multisystemic wasting syndrome single-step method of rna isolation by acid guanidinium thiocyanate-phenol-chloroform extraction genetic diversity and correlation with feline infectious peritonitis of feline coronavirus type i and ii: a -year study in taiwan a real-time pcr assay for rapid detection and quantitation of canine parvovirus type in the feces of dogs submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution the authors declare that they have no competing interests.authors' contributions cnl designed the zna probe, analyzed the experiments data and wrote the manuscript. whl participated sample collection and performed the zna probe-based real-time pcr. lnh contributed to the rna extraction and reverse transcription. syw performed serum sample separation and arranged the data for statistical analysis. mtc managed the study, provided materials and reagents, contributed to the interpretation of the data and co-wrote the manuscript. all of the authors read and approved the final manuscript.author details key: cord- -wgseqk t authors: liu, chang; liu, yunchao; feng, hua; zhao, baolei; chen, yumei; huang, huimin; wang, pan; deng, ruiguang; zhang, gaiping title: pcv cap proteins fused with calreticulin expressed into polymers in escherichia coli with high immunogenicity in mice date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: wgseqk t background: porcine circovirus type (pcv ) is the main causative agent of porcine circovirus diseases (pcvds) which causes huge yearly economic losses in the swine industry. capsid protein (cap) is the major structural protein of pcv that can induce a protective immune response. therefore, developing a novel and safe subunit vaccine against pcv infection is needed. results: in this study, the cap gene was bound to the truncated calreticulin (crt) ( – aa/ – aa) at the n/c terminal, and then the crt-cap fusion genes were expressed in escherichia coli (e.coli). the size-exclusion chromatography and dynamic light scattering (dls) data showed that the purified recombinant crt-cap fusion protein (rp f) existed in the form of polymers. immunization with rp f stimulated high levels of pcv specific antibody and neutralization antibody in mice, which were almost identical to those induced by the commercial subunit and inactivated vaccines. the lymphocyte proliferation and cytokine secretion were also detected in rp f immunized mice. according to the results of pcv -challenge experiment, the virus loads significantly decreased in mice immunized with rp f. the data obtained in the current study revealed that rp f had the potential to be a subunit vaccine candidate against pcv in the future. conclusions: we have successfully expressed cap-crt fusion proteins in e.coli and optimized rp f could form into immunogenic polymers. mice immunized with rp f efficiently induced humoral and part of cellular immune responses and decreased the virus content against pcv -challenge, which suggested that rf p could be a potential subunit vaccine candidate. porcine circovirus (pcv) is a circular single-stranded dna virus belonging to the family circoviridae [ ] . there are three major genotypes of pcv, namely pcv , pcv , and pcv . pcv is nonpathogenic [ ] , and pcv is associated with several diseases, collectively named as porcine circovirus associated disease (pcvad), which causes reproductive failure and huge economic losses all over the world [ ] . pcv is a recently identified circovirus that induces cardiac pathology and multi-systemic inflammation [ ] . in april , a new circovirus with a distinct relationship to other circoviruses was found in hunan province, china and designated as pcv (doi: https://doi.org/ . /tbed. ). at present, at least five commercial vaccines have been licensed, including the circovac® vaccine (merial), ingelvac circo-flex® (boehringer ingelheim), circumvent® (intervet/ merck), porcilis® pcv (schering-plough/merck), as well as fostera™ pcv (pfizer animal health inc.) [ ] . it has been reported that all the commercial vaccines were able to reduce clinical symptoms and improve reproduction to some extent in pcv positive farms, while they failed to eradicate this virus from farms [ , ] . as pcv infection may initiate immunosuppression and also cause subsequent failure of the immune response in pigs [ ] , thus, a more effective vaccine should be developed to prevent pcv infections in swine herds. the balb/c mouse is one of the animal models, as it has a clear background and frees from external interference, it is the most extensively used in pcv inactivated or subunit vaccine researches [ , ] . the genome of pcv consists of two major open reading frames (orfs): orf and orf . orf encodes two viral replication-associated proteins, rep and rep' [ ] ; orf encodes a capsid protein (cap), which is the primary immunogenic protein of pcv . cap contains critical epitopes for inducing a protective immune response, so it has been used as the target for vaccine development [ ] . the cap protein has been expressed in multiple protein expression systems (e.g., insects, mammalian, yeast, and e. coli cells) [ , ] in vitro, whereas only baculovirus insect expression system generates two commercially available pcv vaccines [ ] . however, low yield and high cost still exist for large scale preparation. compared with insect expression, escherichia coli (e.coli) is an efficient prokaryotic expression system as many significant benefits in terms of low cost, ease-of-use and scale preparation. generally, immunogenic protein with high-molecularweight can induce stronger immune response than lowmolecular-weight protein [ ] . calreticulin (crt) is a highly conserved endoplasmic reticulum luminal ca +binding protein and found to be involved in cellular processes (e.g., calcium storage and chaperone function) [ ] . numerous studies primarily focused on its roles in protein folding and polymerization [ , ] . recombinant truncated crt in polymers, as compared with monomers, can induce higher level of immune response [ ] . furthermore, crt fused foreign proteins also formed into polymers and showed excellent immunogenicity of the foreign proteins [ ] . in the present study, high-yield cap-crt fusion protein was expressed in e.coli, and the recombinant protein, rp f could form into immunogenic polymers. mice immunized with rp f efficiently mounted humoral and cellular immune responses, and decrease the infection rate against pcv -challenge, suggesting that rf p could be a potential subunit vaccine candidate. the cap-crt fusion proteins (rp c, rc p, rp f and rf p) were successfully expressed in e. coli, whereas all of them led to inclusion bodies (ibs) at °c ( the purified rf p by ni-nta was eluted from the superdex pg ( / ) gel filtration column. the target protein was presented as the first and highest peak, which beyond the detection limit of the column, suggesting that rf p could form high-molecular-weight polymers ( the third peak also recognized anti-his mabs, revealing that only a small fraction of rf p might exist in the form of monomer (fig. b, c lane ) . to examine the morphology of high-molecular-weight polymers, the purified rf p was analyzed under a tem. the observed result revealed that rf p was assembled into a spheroidal particle with a diameter of nm, whereas the size distribution of the particles was not exactly the same, as shown in fig. a , suggesting that there might be some incompletely assembled protein fragments. the dls result indicated that the average hydrodynamic diameter of rf p was about nm (fig. b) . the sizes of rf p particles observed using the two methods were not consistent, probably attributed to the hydration radius detected by dls was larger than the theoretical or real value. the results of the antigenic analysis showed that rf p could recognize clinical positive serum and anti-pcv mabs a , which indicated that rf p had the similar characters as intact particle (fig. ) . compared with clinical positive serum, the mabs a showed a relative weaker ability to recognize rf p (fig. b) . however, the rf p exhibited a high background interference of clinical negative serum, which probably associated with the complexity of the field sample (fig. a ). indirect elisa was performed to evaluate pcv -specific humoral immune response induced by rf p in mice. figure a shows that compared with the pbs group, pcv -specific antibodies appeared at dpi in all groups and increased with the advancement of the immune process. the antibody levels of mly and blg groups were overall higher than those of rf ph and rf pl groups before virus challenging, but the contrary phenomenon happened after that. during the entire immune process, the levels of rf ph group were higher than those of the rf pl group, whereas there was no significant difference between them. no antibody was produced in the pbs group before the challenge, and the antibody level increased immediately at days after challenge and reached peak at days. whether the antibodies generated by immunized mice could neutralize the virus, na was adopted to further detect the pcv -specific humoral immune response. the results indicated that all immune groups produced neutralizing antibodies except the pbs group, which were consistent with the results of indirect elisa. the na titers of rf ph groups were higher compared with those of mly and blg at and dpi (fig. b) . after the challenge, na titers in the pbs group increased rapidly and reached : at weeks. besides, the na level in other immune groups decreased at dpi ( week after challenge); it returned to the level of pre-challenge at dpi and remained unchanged until the completion of the test. three mice in each group were sacrificed to isolate lymphocyte for lymphocyte proliferation and cytokine and anti-his mabs (c) by elisa, and the results are expressed as mean od value ± sem, the statistical significance differences between each group was analyzed by two-way anova statistical analysis, *p < . , **p < . , ***p < . , ns represented not significant quantification through pcv strain df- stimulation. the lymphocyte proliferative responses were detected in all immunized groups aside from the mock group. the sis of rf ph, mly and blg groups were significantly higher than that of the pbs group (p < . ), and there was no significance between the four immunized groups (p > . ) (fig. f) . the results suggested that cytokine levels were slightly higher in all the immune groups than the mock group, whereas there was no regular correlations and significant difference in the values (fig. a-e) . pcv dna extracted from different tissues of all experimental groups post-challenge was quantified using realtime fluorescent quantitative pcr. figure suggested that excepted kidneys, the pbs group showed a significantly higher viral load than the other groups. the amounts of virus in the spleens and lungs of the immunized groups were lower than that in the pbs group (p < . ), and it showed no difference between the immunized groups (fig. c, d) . the rf p groups exhibited the highest viral loads in the livers (fig. b) , but the date are shown as mean ± sem, statistical differences between each group was measured by one-way anova, *p < . , **p < . , ***p < . , ns represented not significant lowest in the hearts (fig. a) . there was no difference among all groups in the kidneys (fig. e) . all the results revealed that mice immunized with rf p could effectively reduce viral loads in organs against the pcv challenge. pcv , an agent of pcvds, acts as a vital economical viral pathogen affecting the global swine industry. vaccination has been demonstrated as a feasible means to control pcvad. in this study, the cap-crt fusion proteins which could form into high immunogenic polymers were first produced in e. coli. though there are multiple protein expression systems for protein expression in vitro, each system exhibits features and advantages, it also has limitations such as low yield and high cost which hinder the development of the recombinant protein into a truly useful vaccine. meanwhile, e. coli prokaryotic expression system has been extensively adopted for recombinant protein production in laboratories and industry for its simplicity, rapid growth rate and relatively low cost. studies on cap proteins focus on their abilities to selfassemble into virus-like particles (vlps) and thus exert immune effects as an entire virus, which also prove that large molecular particles have stronger immune effects than monomer proteins [ ] . however, the expression of recombinant proteins in e.coli often results in insoluble and/or nonfunctional ibs which may due to rapid synthesis and lack of post translational modification. crt has been shown to be able to self-assemble effectively and acts as a chaperone to help dissolve and form the correct structure [ ] . three fourths design of cap-crt fusion proteins formed into ibs, only the rf p transformed into soluble macromolecular particles in vitro by optimizing the expression conditions. however, the observations of tem and dls revealed that the particle radius was not the same, probably attributed to the dls of hydrated radius larger than the theoretical or actual size. besides, compared with other vlps reports, the rf p did not form vlps. the balb/c mouse is one of the animal models, as it has a clear background and frees from external interference, it is the most extensively used in pcv inactivated or subunit vaccine researches [ , ] . though mice may not be an ideal animal model to resemble pcv infection as observed for pigs, pcv can infect and replicate in some mouse strains including balb/c mouse when used with the appropriate inoculating dose and administered route. in the present study, the balb/c mouse model was used to assess the immunogenicity and protective capabilities of an experimental vaccine based on the recombinant cap-crt fusion protein expressed in e.coli. the cap-crt fusion protein (rf p) induced production of pcv -specific elisa antibodies and neutralization antibody against pcv were detected, the pcv -specific elisa antibodies were positively correlated with the fig. protection from pcv strain df- challenge in mice. all of the mice were challenged with μl of . tcid /ml of the pcv strain df- at dpi and examined for days. spleens were isolated and the genomes were extracted to measure the content of pcv using quantitative real-time pcr. date are shown as mean ± sem, statistical differences between each group was measured by one-way anova, *p < . , **p < . , ***p < . , ns represented not significant neutralization antibodies, which was consistent as described in zhu [ ] . the specific antibody levels of protein groups were lower than those of commercial vaccine groups before virus challenge, but it went opposite after the virus challenge. the neutralizing antibody levels of protein groups were slightly lower than commercial vaccine groups during the immune process. both the protein and the commercial vaccine groups induced only part of the cellular immune response. under the stimulation of pcv , t lymphocytes proliferated significantly, whereas various cytokines were irregularly secreted. pcv infections mainly induce fetal and neonatal mortality, and the level of viruses in the tissues of pcv infected mice is a good indicator of the antiviral effects of any vaccine, and it primarily occurred in the lymphoid tissue and spleen [ ] . after the challenge test, the viral loads in the spleens of mice in the protein and commercial inactivated vaccine group were significantly lower than those in the mock group. it was also slightly effective in the organs of the heart, liver and lung, which was not completely consistent with wang's research, pcv mainly deposited in the lungs [ ] . the humoral immune response showed no significant difference between protein groups and commercial vaccine groups. overall, the humoral and cellular immune levels of rf p groups were similar to the two types of commercial vaccine groups, and the aggregate performance of rf p was closer to blg subunit vaccine. our results clearly verified that the cap-crt fusion protein (rf p) elicited humoral and part of cell mediated immune responses comparable to commercial inactivated and subunit vaccines, and protected mice against epidemic pcv strain df- challenge. to sum up, this paper first describes that the pcv cap protein fused with truncated calreticulin (rf p) could be soluble expressed into immunogenically polymers in e. coli. vaccination of mice elicited humoral and part of cellular immune responses comparable to the commercial inactivated and subunit vaccines, and significantly reduced the viral loads in tissues subsequent to a viral challenge. besides, the immune effect of cap-crt fusion protein requires further verifications in pigs as the natural hosts of pcv . the rf p can potentially develop a subunit vaccine against pcv infection. pk- cells (atcc™ ccl- ) were cultured in dulbecco's modified eagle medium (dmem; gibco) containing % fetal bovine serum (fbs, hyclone), iu/ml penicillin and mg/l streptomycin (invivogen, france) at °c in a % co atmosphere. pcv strain df- (genbank accession number: jn ) was grown in pk- cells and utilized for virus neutralization assay (na) and experimental challenge. thirty female balb/c mice of weeks old weighing - g were chosen arbitrarily and purchased from the experimental animal center of zhengzhou university. the experimental mice were randomly separated into five groups and given days to acclimate the housing environmental conditions (temperature: ± °c, humidity: ± %, lighting: h light/dark cycle). the mice were allowed free access to clean water and food. the animal experiments were carried out according to the animal experiment committee of henan academy of agricultural sciences (approval number syxk - ). all animals received humane care in compliance with good animal practice according to the animal ethics procedures and guidelines of china. all sections of this report adhere to the arrive guidelines for reporting animal research [ ] . as shown in fig. a , complete cap gene of pcv (gen-bank accession no. ay ) was fused with the truncated calreticulin ( - aa/ - aa) (genbank accession no. eu ) at n/c terminal using × ggggs or × ggggs linker. all these four recombinant fragments, named rp c/rc p/rp f/rf p, were synthesized after codon optimization by genscript. all the plasmids were inserted into pet- a in bamhi and xhoi sites and then transformed into e. coli bl (de ) competent cells, respectively. all the positive clones were cultured in luria-bertani (lb) medium containing mg/l kanamycin and induced for protein expression with . mm iptg at °c for h. the parameters of protein expression were optimized according to iptg concentrations ( . mm, . mm), induction temperature and time ( °c for h, °c for h). protein expression was verified by sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds-page). the optimal harvest cells were suspended in lysis buffer ( mm pb, mm nacl, % (w/v) glycerol, % (w/v) triton x- , mm edta, mm dtt, ph . ) and then lysed by sonication ( cycles of s on/ s off, amp %)). after centrifugation, the precipitation was removed and the supernatant of rf p was purified by ni-nta affinity chromatography. after washing the ni-nta column (invitrogen, usa) with wash buffer ( mm pb, mm nacl, mm imidazole, ph . ), rf p was eluted with elution buffer ( mm pb, mm nacl, mm imidazole, ph . ). protein fractions were analyzed by sds-page. the purified rf p was enriched and analyzed by sizeexclusion chromatography with superdex prep grade (pg) ( / ) gel filtration column (ge healthcare, usa). the samples were eluted using lysis buffer at a flow rate of ml/min and detected at nm wavelength. the collected fractions were identified by sds-page and western blot and then quantified using bca protein assay kit (tiangen, china) . the purified rf p was observed under a transmission electron microscopy (tem) using the negative staining method and dynamic light scattering (dls) according to the previous study [ ] . indirect enzyme-linked immunosorbent assay (elisa) was performed to test the antigenicity of rf p with swine clinical positive/negative serum and mouse anti-pcv monoclonal antibodies (mabs) a (abcam, usa). the elisa procedure was operated as routine. thirty female balb/c mice were randomly divided into groups (n = ). the mice were inoculated subcutaneously with μg and μg of rf p as group rf ph and group rf pl, respectively; μl of commercial inactivated circovac® vaccine (merial), subunit vaccine ingelvac circoflex® (boehringer ingelheim) and pbs were classified as positive and negative controls, named as group mly, blg and pbs, respectively. the rf p was diluted in μl of pbs and then emulsified with μl of complete freund's adjuvant for the first immunization, and subsequently with μl of incomplete freund's adjuvant for booster at an interval of weeks. at days after the first immunization, mice from each group were sacrificed for both lymphocyte proliferation assay and cytokine production. in order to reduce the pain of mice to the greatest extent, cervical dislocation was chosen to kill them. it is the fastest method to make the spinal cord and brain spinal cord disconnected, so that the central nervous system instantly lost control of the whole body, which is in line with the requirements of animal welfare. the rest alive mice received μl of . (tcid )/ml pcv strain df- , and they were monitored for the following days. next, the mice were sacrificed for pcv content in different organs. blood samples were collected from the tail veins each week. the serum samples taken at each point post immunization were monitored for specific antibodies using porcine circovirus type elisa antibody test kit (keqian, china). operation steps followed the manufacturer's instructions. the abilities of all serum samples to neutralize the pcv strain df- were assessed using virus na. in brief, μl sera pretreated at °c for min were diluted in a serial two-fold way from : to : and mixed with an equal volume of virus ( tcid ) at °c for h. the serum-virus complex was transferred into confluent pk- cells in each well and then incubated at °c for h. since no visible cytopathic effect was verified, immunoperoxidase monolayer assay (ipma) was performed to ascertain the presence of the virus [ ] . virus neutralization titer was expressed as the highest dilution as log na in which no higher than % reduction of virus replication was detected as compared with the virus control. spleens of mice from each group were removed at days post inoculation (dpi). the spleen lymphocytes were isolated by lydroxypropylmethyl cellulose (solarbio, china) and then resuspended in rpmi medium containing % fbs. lymphocyte proliferation assay was performed by cell counting kit- assay (beyotime biotechnology, china) as previously described [ ] . t lymphocyte proliferation was represented as the stimulation index (si), the ratio of the mean reading of stimulated wells to unstimulated ones. the supernatants from the spleen lymphocytes employed in the proliferation assay were removed and adopted to analyze cytokines. the assays were performed using commercially available mice ifn-γ, il- , il- , tnf-ɑ and gm-csf elisa kits (uscn life science, china) following the manufacturer's instructions. pcv dna from different organs (heart, liver, spleen, lung and kidney) of all groups at days post-challenge was quantified by real-time fluorescent quantitative pcr as previously described [ ] . the viral load was calculated according to the standard curve plotting ct values against different dilutions of a standard plasmid. graphpad prism version . (usa) analysis of variance (anova) was performed. the data is expressed as the mean ± sem. statistical significance was found by two-way or one-way anova at*p < . , **p < . , ***p < . ; ns represents no statistical significance. all the experimenters were not blinded to any stage of the experiment. supplementary information accompanies this paper at https://doi.org/ . /s - - - . additional file . porcine circoviruses: a review studies on epidemiology and pathogenicity of porcine circovirus porcine circovirus type associated disease: update on current terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies detection of a novel circovirus pcv in pigs with cardiac and multi-systemic inflammation commercial porcine circovirus type vaccines: efficacy and clinical application ten years of pcv vaccines and vaccination: is eradication a possibility? can porcine circovirus type (pcv ) infection be eradicated by mass vaccination? vet microbiol porcine circovirus type (pcv ): pathogenesis and interaction with the immune system enhanced protective immune response to pcv subunit vaccine by co-administration of recombinant porcine ifn-gamma in mice genetic and immunogenicity analysis of porcine circovirus type strains isolated in central china identification of the essential and non-essential transcription units for protein synthesis, dna replication and infectious virus production of porcine circovirus type open reading frame of porcine circovirus type encodes a major capsid protein construction and immunogenicity of recombinant swinepox virus expressing capsid protein of pcv immunogenicity and immunoprotection of porcine circovirus type (pcv ) cap protein displayed by lactococcus lactis calreticulin attenuated microwave radiation-induced human microvascular endothelial cell injury through promoting actin acetylation and polymerization calreticulin: one protein, one gene, many functions functional analysis of recombinant calreticulin fragment - : implications for immunobiological activities of calreticulin in health and disease self-oligomerization is essential for enhanced immunological activities of soluble recombinant calreticulin calreticulin as a hydrophilic chimeric molecular adjuvant enhances igg responses to the spike protein of severe acute respiratory syndrome coronavirus production of escherichia coli-based virus-like particle vaccine against porcine circovirus type challenge in piglets: structure characterization and protective efficacy validation calreticulin inhibits prion protein prp-( - ) aggregation in vitro baculovirus expression of the nterminus of porcine heat shock protein gp improves the immunogenicity of recombinant pcv capsid protein distribution of porcine circovirus cap antigen in the lymphoid tissue of pigs affected by postweaning multisystemic wasting syndrome improving bioscience research reporting: the arrive guidelines for reporting animal research nanoparticle orientationally displayed antigen epitopes improve neutralizing antibody level in a model of porcine circovirus type porcine parvovirus capsid protein expressed in escherichia coli selfassembles into virus-like particles with high immunogenicity in mice and guinea pigs differentiation of pcv and pcv by a multiplex real-time pcr assay publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations we thank dr. yinbiao wang at xinxiang medical college for english writing help. we thank dr. shujun chai at henan academy of agricultural sciences for providing high-level quality of animal care. we thank dr. hongying chen, and mr. guanpeng guo for their assistance in obtaining the pcv isolates df- from the henan agricultural university. additional file . the datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. the animal experiments were carried out and approved by the animal experiment committee of henan academy of agricultural sciences (approval number syxk - ). all animals received humane care in compliance with good animal practice according to the animal ethics procedures and guidelines of china. not applicable. the authors declare that they have no competing interests. key: cord- - ic in i authors: hu, xiaoliang; li, nannan; tian, zhige; yin, xin; qu, liandong; qu, juanjuan title: molecular characterization and phylogenetic analysis of transmissible gastroenteritis virus hx strain isolated from china date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: ic in i background: porcine transmissible gastroenteritis virus (tgev) is the major etiological agent of viral enteritis and severe diarrhea in suckling piglets. in china, tgev has caused great economic losses, but its role in epidemic diarrhea is unclear. this study aims to reveal the etiological role of tgev in piglet diarrhea via molecular characterization and phylogenetic analysis. results: a tgev-hx strain was isolated from china, and its complete genome was amplified, cloned, and sequenced. sequence analysis indicated that it was conserved in the ′ and ′-non-translated regions, and there were no insertions or deletions in nonstructural genes, such as orf a, orf b, orf a, orf b, and orf , as well as in genes encoding structural proteins, such as the envelope (e), membrane (m), and nucleoprotein (n) proteins. furthermore, the phylogenetic analysis indicated that the tgev-hx strain was more similar to the tgev purdue cluster than to the miller cluster. conclusions: the present study described the isolation and genetic characterization of a tgev-hx strain. the detailed analysis of the genetic variation of tgevs in china provides essential information for further understanding the evolution of tgevs. transmissible gastroenteritis virus (tgev) is the etiological agent of transmissible gastroenteritis (tge), and it can cause viral enteritis and severe diarrhea with high morbidity in pigs of all ages, as well as high mortality in suckling piglets [ ] . it occurs at swine-raising farms and results in significant economic losses [ , ] . tgev is an enveloped virus belonging to the coronaviridae (cov) family and the nidovirales order. it possesses a large . -kb single-stranded, positive-sense rna genome. about two-thirds of the entire rna comprises open reading frames (orfs) a and b, encoding rna replicase. the ′ one-third of the genome comprises genes encoding structural and non-structural proteins [ , ] . the genes of tgev are arranged in the order of ′-rep-s- a- b-e-m-n-orf - ′. the spike (s) gene of tgev encodes an approximately , -amino acid protein, with a molecular weight ranging from - kda without glycosylation and - kda after glycosylation. functionally, the s glycoprotein is the major target of neutralizing antibodies, and it is also related to host cell tropism [ ] , interaction with its cellular receptor, pathogenicity, fusion, and hemagglutination activity [ ] [ ] [ ] . orf encodes a small hydrophobic protein (hp) during viral replication. the intracellular localization of the hp suggests that it may play an important role in the process of membrane integrity during viral replication and/or virion assembly [ , ] . in this report, we isolated a tgev-hx strain of tgev from the feces of piglets in heilongjiang province in china. to better understand the molecular characteristics of this isolate, its complete genome sequence was obtained, and a phylogenetic tree was constructed based on the complete orf sequence of the s gene. the results provide molecular and phylogenetic information for a chinese isolate of tgev, which may assist in elucidating the genetic evolution of tgev in china. pigs used in this study were approved by the institutional animal care and use committee (iacuc) of the harbin veterinary research institute (hvri), the chinese academy of agricultural sciences. no animals were sacrificed specifically for this study. feces samples were collected at the farm. five fecal samples were collected from piglets with diarrhea in a suburb of harbin, the capital of heilongjiang province, p. r. china. as both tgev and pedv can cause diarrhea, two pairs of specific primers (tgev-nf; tgev-nr; pedv-nf, pedv-nr) were employed to identify the kinds of viruses in the above samples (table ). pcrs were conducted as below, and the cycling parameters for the pcr included °c for min, followed by cycles of °c for . min, °c for . min, and °c for min, and a final extension at °c for min. then, pcrpositive viral samples were inoculated into pk- cells, which were grown as a monolayer in dulbecco's modified eagle medium (dmem) (gibco, grand island, ny, usa) containing % fetal calf serum (gibco, grand island, ny, usa) and % co in air. viruses were passaged three times and were harvested by three cycles of freezing and thawing. cellular debris was removed by low speed centrifugation at , × g (eppendorf, hamburg, germany) for min, and the supernatant was aliquoted and stored at − °c. viral titers were determined using the reed-muench method [ ] . extraction of viral rna, reverse transcribed-polymerase chain reaction (rt-pcr) and complete genome sequencing viral rna was extracted from pk- cells infected with tgev-hx using the trizol reagent (invitrogen, carlsbad, ca, usa). cdna was generated by adding μl of rna to the following components: μl of × reverse transcription buffer, μl of dntps mixture ( . mm), . μl of rnase inhibitor, μl of random primer ( μm), . μl ( u) of amv reverse transcriptase, and μl of sterile water. the components were gently mixed in an eppendorf tube and incubated at room temperature for min, then transferred to a water incubator at °c for h prior to storage at − °c . the resulting cdna was amplified by pcr using la taq dna polymerase (takara, tokyo, japan). ten pairs of primers were designed based on conserved regions of tgev strain h (table ). pcrs were conducted in a total of volume of μl containing μl of × buffer, μl of dntps mixture ( . mm), μl of cdna, μl of forward primer ( μm), μl of reverse primer ( μm), u of la taq polymerase (takara, tokyo, japan), and μl of sterile water. the cycling parameters for the pcr included °c for min, followed by cycles of °c for min, °c for min and °c for min, and a final extension at °c for min. two primers (p-f, p-r) were employed to confirm the ′ and ′ ends of the viral genome by rapid amplification of cdna ends (race) using the race cdna amplification kit (invitrogen, carlsbad, ca, usa). the pcr products were run on agarose gels, and correctly sized amplicons were observed. then, the pcr products were purified using the axygen gel extraction kit (axygen, usa) and cloned into pmd -t (takara, tokyo, japan). three to five independent clones of each tgev amplicon were sequenced. the dna was sequenced using an abi xl sanger-based genetic analyzer (applied biosystems, waltham, ma, usda). pk- cells infected with tgev were harvested by freezing and thawing three times. one ml of cell culture was centrifuged for min at × g. the supernatant was transferred into a new microfuge tube and centrifuged for min at , × g. then, the pellet was negatively stained with % phosphotungstic acid and analyzed on a transmission electron microscope (h- , hitachi, tokyo, japan) [ ] . sequence data were assembled and analyzed using clustal x software ( . ) and dnastar. to determine the relationship between the tgev representative isolates and the hx strain, phylogenetic trees based on the s gene were constructed using molecular evolutionary genetics analysis (mega) software (version . ) using the neighbor-joining (nj) method. bootstrap values were estimated for , replicates. the sequences of the tgev reference strains were obtained from genbank, and the details are summarized in table . the sequences obtained in this study were assembled and submitted to genbank under the accession number kc . the pcr results confirmed that one of five samples was tgev-positive, designated tgev-hx; the other four samples were tgev-negative and all five samples were pedv-negative ( figure a ). after three passages, cytopathic effects (cpe) were found in the pk- cells, as evidenced by the cells rounding up and enlarging, the formation of syncytia, and the detachment of cells into the medium (figure b and c) . the median tissue culture infective dose (tcid ) of tgev-hx ( . / . ml) was measured using the reed-muench method. when observed by electron microscopy, the virus displayed a circular shape, and the surface projections were petal-shaped, with a diameter ranging from to nm, which is similar in size to known tgevs ( figure d ). the full-length genome sequence of the tgev-hx strain was deduced by combining the sequences of overlapping cdna fragments. the genome sequence of the tgev-hx strain was , nucleotides (nt) long, including the poly a tail. the ′ portion of the genome contained a -nt non-translated region (ntr), and orf a ( - , ) and orf b ( , the replicase genes were composed of orf a and orf b, which contained a -nt common region (nt , - , ) and a "slippery site" ( ′-uuuaaac- ′, nt , - , ). the orf a gene of tgev-hx was predicted to encode a protein of , amino acids (aa), while orf b was predicted to encode a , -aa protein. nucleotide sequence analysis indicated that there were no deletions or insertions in the orf ab region of the miller and purdue tgev strains. orf a and orf b of tgev-hx were predicted to encode -aa and -aa proteins, respectively. no deletions or insertions were found in the orf a or orf b genes of tgev-hx. the orf gene of tgev-hx was predicted to encode a -aa protein, which contained the common pp c-binding motif ′-rviflvi- ′ [ ] . no deletions or insertions were found in orf of tgev-hx. the nucleotide sequence of the s gene of tgev-hx was , nt in length, encoding a predicted protein of , aa. a -nt deletion was found in the s gene at nt , - , of the tgev-hx, sc-y, and wh- strains, which caused the s protein to be two amino acids shorter than those of the purdue, miller , ts, h and h strains (figure a) . amino acid of the purdue, miller , and ts strains was s, while in the tgev-hx, sc-y, wh- , h , and h strains, it was a ( figure b) . amino acids , , , , , , , , , , and , of tgev-hx were identical to those of strains sc-y and wh- , but different from those of strains ts, h , and h . sequence analysis revealed no deletions or insertions in the e and n genes of any of the tgevs. the predicted e, m, and n proteins were -, -, and -aa long, respectively (table ) . to investigate the homology of tgev-hx to other tgevs, the nucleotide and predicted amino acid sequences of the nonstructural and structural protein coding genes were compared ( table ). the results suggested that tgev-hx showed higher identity to strains sc-y, wh- , and purdue, and less identity to ts, miller , and h . phylogenetic analysis of the complete s gene showed that tgev strains could be divided into two groups ( figure ) . the tgev-hx strain had a close relationship with the purdue strain and is more distant evolutionarily from the miller strains group and strain isu- . as an enteropathogenic coronavirus, tgev is the major cause of viral enteritis and diarrhea in neonatal pigs, resulting in significant economic losses. currently, tgev occurs sporadically in parts of europe, north america, and asia. the fact that wild and domestic carnivores (foxes, dogs, cats, and possibly minks) seroconvert to tgev indicates that they are potential subclinical carriers of tgev. [ ] . in summation, tgev has become a new challenge for the pig farming industry. as few tgev genome sequences have been published, little is known about tgev evolution. the results of this study will provide necessary information for further understanding the evolution of tgev. a complete sequence analysis indicated that no deletions or insertions were found in the ′-and ′-ntr regions of tgev-hx, suggesting that its replication and transcription mechanism was not changed. a -nt (nt , - , ) deletion in the s gene was found in the tgev-hx, sc-y, and wh- strains, but not in the purdue, miller , ts, h , and h strains. it was showed that this deletion was observed in the attenuated purdue strains pur -c and pur -mad, and it was considered to play a role in viral attenuation [ ] . competition studies using monoclonal antibodies led to the prediction of at least four main antigenic sites, designated a, b, c, and d [ , ] . the a and b sites (aa - ) have been mapped, and they serve as the major antigenic sites, including the binding site for the viruses host receptor, aminopeptidase n (apn). single amino acid changes in the s protein can greatly impact its antigenicity [ ] . the serine to alanine mutation at amino acid may have a significant influence in receptor binding or neutralizing antibody interactions [ ] . five chinese strains, tgev-hx, sc-y, wh- , h , and h , ha and alanine residue at this position, while the purdue, miller , and ts strains had a serine residue, which suggested that the antigenicity of the s protein of the five chinese strains may be changed. furthermore, amino acids , , , , , , , , , , and , of tgev-hx were identical to those of strains sc-y and wh- , but different from those of strains ts, h , and h . the nucleotide and amino acid sequence homology analysis of the structural proteins and non-structural proteins indicated that tgev-hx was highly similar to the wh- , sc-y, and purdue strains, and had a lower sequence similarity to the miller , ts, h , and h strains. the phylogenetic analysis showed that tgev-hx was closely related to the sc-y, wh- , and purdue strains, which belonged to the purdue cluster, while the miller , ts, h , and h strains belonged to the miller cluster, which was consistent with the results of the homology comparison. the data obtained in this study indicated that hx had different ancestors than the early chinese strain h , and it might be derived from the same ancestor as the sc-y, wh- , and purdue strains. the present study provides the complete genome sequence of a tgev-hx strain from china. by comparing the s gene and protein with those of other tgev strains, we have gained a further understanding of the genetic structure, diversity, and evolution of the tgev-hx strain. our next work is to evaluate the characteristics of mutations in the s gene using a reverse genetic approach in animal experiments. development of protection against coronavirus induced diseases development of protection against coronavirus induced diseases genetic analysis of porcine respiratory coronavirus, an attenuated variant of transmissible gastroenteritis virus virus taxonomy: classification and nomenclature of viruses sequence comparison of porcine respiratory coronavirus isolates reveals heterogeneity in the s, , and - genes point mutations in the s protein connect the sialic acid binding activity with the enteropathogenicity of transmissible gastroenteritis coronavirus two amino acid changes at the n-terminus of transmissible gastroenteritis coronavirus spike protein result in the loss of enteric tropism four major antigenic sites of the coronavirus transmissible gastroenteritis virus are located on the amino-terminal half of spike glycoprotein s targeted recombination demonstrates that the spike gene of transmissible gastroenteritis coronavirus is a determinant of its enteric tropism and virulence transmissible gastroenteritis coronavirus gene is not essential but influences in vivo virus replication and virulence the -kda hydrophobic protein encoded at the ′ end of the porcine transmissible gastroenteritis coronavirus genome is membrane-associated a simple method of estimating fifty percent endpoints genetic characterization of a new insect flavivirus isolated from culex pipiens mosquito in japan coronavirus gene counteracts host defenses and modulates virus virulence transmissible gastroenteritis virus and porcine respiratory coronavirus complete genome sequence of transmissible gastroenteritis coronavirus pur -mad clone and evolution of the purdue virus cluster major receptor-binding and neutralization determinants are located within the same domain of the transmissible gastroenteritis virus (coronavirus) spike protein antigenic structure of transmissible gastroenteritis virus. i. properties of monoclonal antibodies directed against virion proteins submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution abbreviations tgev: transmissible gastroenteritis virus; cov: coronaviridae; orf: open reading frames; s: spike; hp: hydrophobic protein. the authors declare that they have no competing interests.authors' contributions hxl participated in the study design and collection of samples, conducted all laboratory and statistical analyses, participated in the interpretation of analyses, and drafted the manuscript. lnn, yx, and tzg participated in the study, provided oversight of the laboratory analysis, participated in interpretation of analyses, and helped to draft and critically revise the manuscript. qjj and qld participated in the study design and in the interpretation of analyses, and helped to draft and critically revise the manuscript. all authors have read and approved the final manuscript. key: cord- -gvhjwqe authors: nöremark, maria; frössling, jenny; lewerin, susanna sternberg title: a survey of visitors on swedish livestock farms with reference to the spread of animal diseases date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: gvhjwqe background: in addition to livestock movements, other between-farm contacts such as visitors may contribute to the spread of contagious animal diseases. knowledge about such contacts is essential for contingency planning. preventive measures, risk-based surveillance and contact tracing may be facilitated if the frequency and type of between-farm contacts can be assessed for different types of farms. the aim of this study was to investigate the frequency and types of visitors on farms with cloven-hoofed animals in sweden and to analyse whether there were differences in the number of visitors attributable to region, season, and type of herd. data were collected from swedish farmers through contact-logs covering two-week periods during four different seasons. results: in total, ( %) farmers filled in the contact log for at least one period and the data represent , days. the average number of professional and non-professional visitors per day was . and . , respectively. whereas the number of professional visitors seemed to increase with increasing herd size, this relation was not seen for non-professional visits. the mean numbers of visitors per day were highest in the summer and in the farm category ‘small mixed farm’. reports of the visitors’ degree of contact with the animals showed that veterinarians, ai-technicians, animal transporters and neighbours were often in direct contact with the animals or entered the stables and . % of the repairmen were also in direct contact with animals, which was unexpected. in a multivariable analysis, species, herd size and season were significantly associated with the number of professional visitors as well as the number of visitors in direct contact with the animals. conclusion: in conclusion there was a large variation between farms in the number and type of contacts. the number of visitors that may be more likely to spread diseases between farms was associated with animal species and herd size. contagious livestock diseases have a negative impact on production and farm economy as well as animal welfare. moreover, several of the diseases in livestock are zoonotic and affect human health. there are thus major reasons to prevent and control these diseases, both endemic and exotic diseases. in infectious disease prevention and control, an important key is to understand the contact patterns and thus potential routes of spread between livestock farms within a country. because one of the most important routes of spread is direct contact between live animals, livestock movements are often registered in central databases [ ] . however, many diseases, e.g. foot-and mouth disease, classical swine fever, bovine viral diarrhoea and aujezsky's disease, can also spread via indirect contacts, such as farm visitors, transports or shared equipment [ ] . in contrast to data on livestock trade, these indirect contacts are seldom registered centrally. assessments of the type and frequency of contacts such as visitors can be used in contingency planning as an indication of what can be expected regarding number of contacts during an outbreak. this information can be relevant for assessing potential spread and when designing forms for contact tracing. the identification of farm characteristics associated with more frequent contacts can also be useful input for prioritizations in contact-tracing and in the design of risk-based surveillance activities. the risk of disease spread via visitors can be minimized by preventive biosecurity measures such as use of clean protective clothing and boots (preferably provided by the farmer), cleaning of equipment used on the farm and hand wash [ ] [ ] [ ] [ ] . however, from a previous study in sweden it is clear that farmers perceive the risk of disease introduction as low and are not always motivated to apply biosecurity routines [ ] . it has also been shown that there was large variation in the biosecurity routines applied by different types of professional visitors [ ] . in order to increase awareness among farmers and veterinarians, as well as other visitors, specific information campaigns related to disease prevention and control can be performed. in such activities, knowledge about the average number and type of visitors in different types of farms can be very useful, as it enables targeting of high risk farm categories and visitors. this knowledge is also important when risks for disease spread through indirect contacts and possible contact patterns are communicated. furthermore, the expected number of contacts is often needed as input data in mathematical modelling of disease outbreaks and for the highly contagious diseases the indirect contacts are also relevant [ , ] . such modelling can in turn be used to approximate the extent of an outbreak and to assess possible effects of different disease control interventions. the aim of this study was to investigate the frequency and types of visitors as potential indirect contacts between farms with cloven-hoofed animals in sweden and to analyse whether there were differences in the number of visitors attributable to region, season, and farm characteristics such as herd size or species present on the farm. this study was based on data collected through a mailed contact log that was sent to swedish livestock farmers in and . the participants were asked to register visitors and other farm contacts daily during four twoweek periods, throughout the different seasons of the year. in total, the contact log was sent out on five occasions, covering all four seasons, i.e. july , november , february , april , and july . the reason for the fifth round sent out in summer was to ensure that data was obtained across seasons also for these farmers who joined the study in the nd round. the data collection was done in parallel with a questionnaire dealing with on-farm biosecurity routines [ ] , i.e. farmers were asked to respond to both the biosecurity questionnaire and to document contacts in the contact logs. data from the biosecurity questionnaire regarding animal species present on the farm and herd size were also used in this study. the selection process is described in detail in the cited paper. in summary, a stratified random sample of farmers was selected in five different regions, from the very south to the north of sweden to capture different geographical density and different predominant production. from each region, approximately cattle farmers and pig farmers with different production systems were selected, as well as sheep farmers and goat farmers (not all regions had this many farmers), resulting in a total of farmers. the basis for the sample was the official register of animal holdings at the swedish board of agriculture. the sample size was a compromise between (i) having enough data to analyse, (ii) expected return rate, (iii) time limitations for data entry, and (iv) number of holdings in the regions. the contact log forms were sent by mail approximately ten days before the start of the period of data collection. each time an accompanying letter was enclosed, in the first round it described the background of the study and on consecutive occasions it reminded participants of the purpose of the study and encouraged continued participation. farmers were informed that their replies would be treated anonymously and for each round an instruction on how to fill in the log was included. a response envelope (free of charge) was included and a lottery ticket was enclosed as a sign of gratitude. the study was prospective and participants were asked to record data on a daily basis for the defined period. to avoid retrospective data collection and potential recall bias reminders were therefore not sent. however, unless farmers declined participation, we continued to send contact log forms for the remaining periods if they had responded to at least one previous period. the contact log forms were prospective and designed as a table of the different types of contacts and with one page per day (an english translation of the contact log is available as e-supplementary additional file ). the different types of contacts specified were transports, professional visitors, other visitors, livestock, dead-stock, shared equipment and farmers' own visits to other farms. farmers were asked to indicate the number of visitors of each type and their level of contact, i.e. if the visitor was in direct contact with the livestock, entered the stable or stayed outside the stable, and if they were livestock owners. before submission to the participants, the contact log was tested on a reference group of veterinarians specialised in disease control and thereafter on six farmers. the animal species of interest in this study were cattle, pigs, sheep and goats. in , there were approximately , agricultural enterprises with cattle in sweden and of these, had cattle for milk production [ ] . the average cattle herd size was cattle (or dairy cows, suckler cows). furthermore, there were , companies with pigs. the average pig herd size was sows and piglets and pigs for fattening. moreover, there were , agricultural enterprises with sheep and of these, one third had < ewes and only % had > ewes [ ] . in total, there were approximately , goats in the whole country. however, information on the number of holdings with goats was not available in the official statistics. for all species, the population is concentrated to the southern parts of the country. since , the number of pig herds and dairy cattle herds has decreased and the average size of herds has increased [ ] . the contact logs were entered into a microsoft office access database by single entry. in the editing of the data, some assumptions were made. in the instructions farmers were asked to use integers when registering the number of contacts and when editing the data "x" or "yes" were constantly interpreted as " ", unless other information indicated that another integer should be used. furthermore, the data were scrutinised after entry and whenever there were indications of typing errors, data were checked and corrected. for herds where data were available for two summer periods, the first was kept in the dataset while the second was dropped. the parallel questionnaire on biosecurity routines [ ] included questions on herd size and species present on the farm, and these data were also used in this study. the categories of species were cattle, swine, sheep or goats, and mixed. a herd was considered mixed if animals of more than one of the other categories were present. for herd size, three classes were created; hobby, medium and large. the aim of the classification was to create groups reflecting different levels of production intensity. this was based on the number of animals on the holding reported in the questionnaire, and the limits were set using the rather rough assumptions that hobby farmers do not earn their living from their livestock production and that large farms will in general need employed staff were used. for cattle and pig farmers, herd sizes < cattle and < pigs, respectively (corresponding to farms below the th percentile) were classified as hobby and > cattle and > pigs, respectively as large (above the th percentile). for sheep and goats, < animals were classified as hobby (below the th percentile), and > animals as large (above the . th percentile). locations of the herd were denoted according to the nomenclature of territorial units for statistics level which divides sweden into eight regions [ ] . five of these regions were represented in the study; Övre norrland, Östra mellansverige, småland med öarna, sydsverige and västsverige. in the statistical analysis, visitors were categorised into either professional or non-professional: veterinarians, ai technicians, inspectors, transporters, hoof trimmers, repairmen etc. were considered professional visitors, while e.g. visitors on field trips, neighbours and customers in farm shops or bed & breakfast enterprises were considered non-professional visitors. descriptive statistics were obtained for the different types of visitors and levels of contact, by species category, herd size, region and season. furthermore, the proportion of visitors reported to have livestock of their own was calculated. considering their expected high influence on the risk of disease spread, special attention was given to the number of professional visitors and the number of visitors with direct contacts with the animals. these two outcomes were further investigated using regression models where possible associations between number of visitors per twoweek period and different explanatory variables were analysed. the potential explanatory variables investigated were; species, herd size, region and season. associations between outcomes and explanatory variables were first investigated by univariable regression. the outcome variables also contained an excess of zeroes and zero-inflated negative binomial regression was therefore chosen. in this type of model, a binary (here logistic) model and a negative binomial model are fit simultaneously to capture both the probability of zero counts and the probability of nonzero counts [ ] . because farmers contributed with several observations (i.e. one observation per season), robust standard errors were applied with clustering on herd level. potential variables were tested in both the logistic and the negative binomial parts of the model in a stepwise process using backward elimination. the limit for keeping the variable in the model was set to p < . . biologically relevant interactions between the remaining variables were tested and interaction terms were kept if significant at the . level. the fit of the final models was examined by comparing the observed and predicted values for the different covariate patterns. data was entered and stored in microsoft office access (microsoft co., redmond, washington, usa), and analysed using stata statistical software: release . (statacorp. , college station, texas, usa). out of the selected farmers, ( %) responded to the contact log on at least one occasion. the numbers of responses per period were as follows: summer ' n = , autumn ' n = , winter ' n = , spring ' n = and summer ' n = . the number of farmers that sent in one, two, three, four or five contact logs was , , , and respectively. after data cleaning, the responses represent a total of approximately , two-week periods ( , days) . the number of responding farmers and response rate by different categories of registered species on the holding and by region is shown in table . reasons for non-response were given by % of non-responders [ ] . the most important reason for non-response among these farmers was "ceased animal production" ( %). notably, one reason given by a few farmers was "having too many visits to keep track of". according to the replies, herds ( . %) had no visitors at all during any of the two-week periods. there were herds ( . %) that did not have any professional visitors and herds ( . %) that did not have any nonprofessional visitors. on average, the number of visitors per day was . (range - ). the mean number of professional visitors was . (median ; range - ) and the mean number of non-professional visitors per day was . (median ; range - ). the numbers of professional visitors, non-professional visitors and visitors in direct or indirect contact with animals are given by category of species and herd size in figure a the descriptive statistics indicated differences between daily mean numbers of visitors related to herd size (figure a-b) . whereas the number of professional visitors seemed to increase with herd size, this relation was not seen for non-professional visits. moreover, there were differences related to species present on the farm. for example, veterinary visits in cattle herds seemed to increase with herd size but this tendency was not obvious for pig herds or for sheep herds. the highest mean number ( . ) of non-professional visitors per day was found in the category 'small mixed farm'. when seasons were compared, the average number of visitors was higher in summer. this difference was most obvious as regards non-professional visitors in mixed herds and herds with sheep or goat ( figure ). farmers registered information on the animal ownership of the non-professional visitor for % of reported visits ( occasions). however, they often indicated this with an "x" or "yes" instead of the actual number of visitors having livestock and these data were therefore analysed on occasion and type of visitor. the results are shown in table . the largest proportion of visitors reported to own livestock was found in the neighbour category. the locations within the farm where visitors were reported to enter are shown in table . as expected, veterinarians and ai-technicians were often in direct contact with animals. animal transporters were also often in direct contact with the animals ( . %). among deadstock collectors, on the other hand, few were in contact with animals ( . %) or entered the stables ( . %). notably, . % of the repairmen were in direct contact with animals and neighbours were in direct contact or entered the stables at . % of their visits. in the final models, the number of professional visitors, as well as the number of visitors in direct contact with animals were significantly associated with species, herd size and season (tables and ). for both of the outcomes, species and herd size were included in the negative binomial part of the model (representing counts of visitors) while species, herd size and season were included in the logistic part of the model (representing the probability of no visits at all). although an interaction between herd size and species was found, the models were not stable with this interaction term (i.e. resulted in extreme incidence risk ratios and confidence intervals) and it was therefore excluded from the final models. the geographical differences seen in the univariable analyses were not observed when other risk factors were accounted for. for both professional visitors and visitors in direct contact with animals, visits were more likely in large herds compared to small and medium herds. from herds reporting these types of visits, there were also more visitors in herds with cattle, compared to other species. however, the numbers of visitors in direct contact (i.e. including both professional and non-professional) were higher in hobby farms compared to large and medium sized farms. in addition, total contact-log response rates disaggregated by farm types according to species and by regions. *selection was based on species and region. reported species was not always consistent with species registered on farm. these respondents had not used the coded response letter and their selection strata could therefore not be identified. professional visits were less likely in summer compared to spring and autumn. in general, one of the most important routes of disease spread is considered to be live animal trade, and animal movements between swedish herds have recently been described [ ] [ ] [ ] . however, for some highly contagious diseases, indirect contacts are also a potential route of disease transmission. introduction of animals from other herds can to some extent be avoided by limiting the purchases of animals and instead relying on within-farm recruitment. professionals visiting the farm, on the other hand, can seldom be totally avoided. the non-professional visits could in theory be avoided, but benefits from having children and urban people visit farms in order to enable better understanding of agricultural production would then be lost. studies to investigate these types of contacts have been done in other countries [ ] [ ] [ ] [ ] [ ] , however, information on indirect contacts between swedish farms has been missing. the results presented here therefore contribute substantially to the knowledge of what can be expected when it comes to between herd contacts. based on the replies, there was a large difference in the number of visitors per farm, and substantial variation within categories of farms was observed. in general however, species and herd size were significantly associated with the number of professional visits and this is an expected finding. depending on the type of production, different professionals will be needed and with many animals the frequency of the visits will increase. for example, if the herd is large, the probability of one animal in the herd needing veterinary care will increase compared to if the number of animals is low. the contact pattern observed for veterinary visits can also be explained by other underlying structures. for example, provided that they fulfil requirements of education and regularly veterinary visits, swedish pig farmers are generally allowed to keep certain drugs (e.g. antibiotics) on their farm and perform first line treatment of individual animals themselves. this was at the time of the study not possible for cattle owners, and this is one explanation why the veterinary visits to pig farms did not increase with herd size to the same extent as visits to cattle farms. another example of factors that can influence frequency of visitors is the production cycle on the farm, which will affect how often animal transporters collect animals on the farm. in comparison, the non-professional visitors did not follow the same pattern as the professional ones. from a contingency planning and information perspective, one important finding was that a number of hobby farms with mixed species had large numbers of non-professional visits. from previous studies it was clear that hobby farmers often had low biosecurity [ ] . this category of farmers has also been shown to be overrepresented among farmers who were unaware of an ongoing outbreak [ ] . although non-professional visitors may not be as important for disease spread as the professionals, who tend to visit one farm after the other, it is clear that low biosecurity and unawareness in combination with large number of contacts may present a high risk. even if only a small proportion of these visitors are in contact with other farms, the actual number may be significant when the total number of visitors is high. with hundreds of visitors per week, tracing of contacts during outbreaks may also be extremely time consuming and difficult. thus, information about preventive biosecurity measures is crucial in such farms. not all visitors pose equal risk, and focus could be on hygiene measures related to visitors in direct contact with animals and especially if they are livestock owners. new legislation coming into force in sweden in september establishes the famers' responsibility for biosecurity related to farm visits [ ] . as part of implementing the new rules, these results provide important information when communicating the risk of disease transmission through visitors to farmers. further, the findings are relevant for strategies on how to come into contact with visitors in case of a disease outbreak. the study has identified that the number of people that would need to be reached can be very high and that many of them may not be part of the farming community, i.e. they will probably not be reached through the farmers' press or information sent to farmers. from the results, the importance of asking the farmer at an early stage of contact tracing if they have many visitors e.g. due to hosting fields trips or having construction workers or repairmen at the farm, has been highlighted. another important finding is the proportion of visitors of different categories that was reported to be in direct contact with the animals or to enter the stable. these findings also need to be seen in light of previous findings, where use of protective clothing was examined [ ] . for example, salesmen and repairmen were reported to have poor use of protective clothing, and many farmers did not require such usage, whereas this study found that that one fourth of the salesmen entered the stables and almost nine percent of the repairmen were in direct contact with animals. many visitors within these categories of professionals may not have an education related to animal husbandry and there is a risk that they do not realise their potential role in spreading disease. these results should be considered in the design of preventive biosecurity programmes or information campaigns during disease outbreaks where it is important not to forget this category of visitors. there is a need to communicate, both to the farmer and to the visitors, the risk of disease spread through indirect contact. these results have therefore been forwarded to the swedish animal health services and the swedish dairy association which are currently working on a new farm biosecurity programme. it is often assumed that farms in the northern parts of sweden pose a lower risk of disease introduction as they have fewer contacts. this study demonstrates that farm characteristics were more important than geographical region and that when implementing control measures region should not be considered a primary factor. from previous outbreak investigations, it is known that it may be difficult for farmers to recall detailed information of events such as farm visits. farmers have also been surprised when they have realised the actual number of contacts they have had. making a single assessment at one point in time can thus lead to underestimation of the amounts of contacts. in order to avoid recall bias and underestimation of contacts, the choice was a prospective contact log. although the aim was to make data registration as simple as possible, participation in the study was a considerable workload for the farmers. in spite of this, % of the invited farmers chose to participate in the study. there were farmers that only responded to one period, we did not investigate the reasons for this and can only speculate why. some might have found the questionnaire too burdensome, and since there is a rapid structural change in swedish agriculture with decreasing farms it is probable that some of them quit farming during the study period. there were also farmers that responded in the start and the end of the study period but missed one or two periods in the middle. although other information would have been interesting to include in the contact log, we tried to minimise the amount of data to be collected by the farmer and did not ask about duration of contact, biosecurity routines applied during the specific visit, origin or destination of the contact. data on distances are planned to be collected in a future study focusing on the routes travelled by professionals. compared to similar studies in switzerland and new zealand, in which farmers were also asked to register contacts during two or three week periods, the response rate in this study lies between the two ( % and %). however in the new zealand study the participants were recruited through telephone calls [ , ] and the response rate was even higher ( % when non-eligible farms had been excluded) in a corresponding dutch study where farmers were recruited by letters and telephone calls from their local veterinarians [ ] . in recent european studies in uk and belgium, data collection was based on estimates made at one point of time and farmers were not asked to register contacts continuously, and response rates are therefore not directly comparable [ , ] . as already concluded by ribbens et al. [ ] , the result of these studies are not straight forward to compare either, because they focus on different groups of farmers and because the methods for data collection have differed between countries. however some findings are worth mentioning. the large variation between farms in number of contacts and association with herd size was also observed in belgium, california, new zealand and the united kingdom [ , , , ] . in the belgian study it was observed that professional visits more often entered the stable compared to non-professionals [ ] , and when removing milk trucks (which were not relevant in the belgian study focusing on pigs) from the swedish data the proportion of professionals entering stables was clearly higher compared to non-professionals also in sweden. in some parts, the study from the netherlands registered level of contact in a comparable way, and similar findings were seen with veterinarians, ai-technicians and temporary employees among the visitors most often in direct contact with animals. however, other categories differed between the two countries, e.g. animal obstetricians which occurred in the dutch study do not exist in sweden, and hoof-trimmers did not occur in the dutch data [ ] . this example illustrates both the constraints in comparing results from studies with different designs, and also the need for collecting country specific data. because half of the non-responders who explained their non-response said that they did no longer have livestock, the response rate among farmers that in fact had livestock on their farm was even higher. a few nonresponders explained that their high number of contacts was the reason why they could not participate in the study. this is unfortunate because from a disease prevention perspective, farms with many contacts are of special interest. it is noteworthy that one of these farmers indicated that the farm had around thousand visits each week, due to on-farm sales. thus, it is possible that the average number of visits reported in this study was underestimated. another possible reason for underestimation is that farmers, in spite of the prospective study-design, forgot to fill in all visits. this was observed in a dutch study were comparative data were available to check the registrations [ ] . there was no simple way to identify differences between responders and non-responders. it can be speculated that farmers who were more interested in biosecurity and disease prevention were more likely to agree to participate in the study. if so, it is possible that the number of non-professional visits, i.e. the category of visitors that a farmer can limit, was higher than reported. however, professional contacts are needed to keep the farm running, regardless of the farmer's attitude towards responding to questionnaires. the results from this study reflect the large variability among farms and contribute to the understanding of the frequency and nature of indirect contacts between swedish livestock holdings. the large number of nonprofessional visits in some farms, the fact that mixedspecies hobby farms (potentially with low biosecurity and outbreak awareness) often had many visitors and the proportion of salesmen and repairmen entering the farm stables, are all important observations. the expected findings, such as number of visitors being related to species and herd size, are also of value as this has not been documented before in sweden. the study results will constitute useful background information in the planning of risk-based surveillance, risk communication, biosecurity information campaigns, as well as in outbreak management and preparedness, and as input in ongoing work on modelling of disease spread where the distributions on actual numbers of contacts can be used to simulate contact patterns relevant for different types of swedish livestock farms. there was a large variation in number of farm visitors, both professionals and non-professionals. the number of visitors that may be more likely to spread diseases between herds was associated with animal species and herd size of the farm, however the non-professional visitors did not show the same association with herd-size and there were small mixed farms with high numbers of non-professional visitors. there were expected findings with e.g. veterinarians and ai-technicians often in direct contact with animals, but also unexpected findings with e.g. more repairmen than expected being in direct contact with animals. additional file : the contact log (in english) is available in as an additional file. establishing a system for the identification and registration of bovine animals veterinary medicine a textbook of the diseases of cattle, sheep, pigs, goats and horses the relationship between antibody status to bovine corona virus and bovine respiratory syncytial virus and disease incidence, reproduction and herd characteristics in dairy herds risk factors for seropositivity to bovine coronavirus and bovine respiratory syncytial virus in dairy herds probability of and risk factors for introduction of infectious diseases into dutch spf dairy farms: a cohort study risk factors for introduction of bhv into bhv -free dutch dairy farms: a case-control study application of routines that contribute to on-farm biosecurity as reported by swedish livestock farmers a simulation model for the potential spread of foot-and-mouth disease in the castile and leon region of spain interspread plus: a spatial and stochastic simulation model of disease in animal populations jordbruksverket: yearbook of agricultural statistics including food statistics jordbruksverket: yearbook of agricultural statistics including food statistics regulation (ec) no / of the european parliament and of the council of may on the establishment of a common classification of territorial units for statistics (nuts) veterinary epidemiologic research nd edition network analysis of cattle and pig movements in sweden: measures relevant for disease control and risk based surveillance spatial and temporal investigations of reported movements, births and deaths of cattle and pigs in sweden spatio-temporal evaluation of cattle trade in sweden: description of a grid network visualization technique direct and indirect contacts between cattle farms in north-west england type and frequency of contacts between belgian pig herds quantification of contacts between dutch farms to assess the potential risk of foot-and-mouth disease spread a survey to investigate movements off sheep and cattle farms in new zealand, with reference to the potential transmission of foot-and-mouth disease direct and indirect contact rates among beef, dairy, goat, sheep, and swine herds in three california counties, with reference to control of potential foot-and-mouth disease transmission sternberg lewerin s: disease awareness, information retrieval and change in biosecurity routines among pig farmers in association with the first prrs outbreak in sweden jordbruksverket: statens jordbruksverks föreskrifter och allmänna råd om förebyggande och särskilda åtgärder avseende hygien m.m. för att förhindra spridning av zoonoser och andra smittämnen quantification of contacts between pig farms to assess the potential risk of classical swine fever transmission. in systems for the prevention and control of infectious diseases in pigs a survey of visitors on swedish livestock farms with reference to the spread of animal diseases the authors are grateful to ann lindberg and ivar vågsholm for contributing to the design of the study, and to irene svensson for data entry. in addition, the authors wish to thank all farmers that participated in the study. the project was funded by the swedish emergency management agency. the swedish board of agriculture provided information on registered farmers in sweden. the authors declare that they have no competing interests.authors' contributions mn and ssl designed the study, mn collected the data and edited the database, mn and jf performed the statistical analysis and drafted the manuscript, and all authors critically revised the manuscript. all authors read and approved the final manuscript. key: cord- -zminzrov authors: wang, xueyu; xu, xin; hu, wen; zuo, kejing; li, zhili; kan, yunchao; yao, lunguang; ji, jun; bi, yingzuo title: visual detection of porcine epidemic diarrhea virus using a novel reverse transcription polymerase spiral reaction method date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: zminzrov background: porcine epidemic diarrhea virus (pedv) is a major etiological agent of porcine epidemic diarrhea around the world. point-of-care testing in the field is lacking owing to the requirement for a simple, robust field applicable test that does not require professional laboratory equipment. the aim of this study was to establish a novel reverse transcription polymerase spiral reaction (rt-psr) assay for the rapid detection of porcine epidemic diarrhea virus (pedv). for the assay, a specific rt-psr primer pair was designed against a conserved region in pedv orf . results: the rt-psr was optimized, and pedv could be detected after a min incubation at °c, in addition to the min required for reverse transcription. no cross-reaction with other porcine infectious viruses was observed. this new method for pedv detection was times more sensitive than the conventional reverse transcription-polymerase chain reaction (rt-pcr) assay. the positive rates for clinical samples using the new rt-psr assay and the conventional rt-pcr assay were . % ( / ) and . % ( / ), respectively. in the rt-psr assay, the addition of a mixture of dyes allowed a positive reaction to be directly observed by the naked eye. conclusions: these results indicate that this rt-psr assay is capable of accurately detecting pedv, and has the advantages of high specificity and sensitivity for the detection of pedv. porcine epidemic diarrhea (ped) is a highly contagious swine enteritis accompanied by vomiting, watery diarrhea, dehydration, and other symptoms [ ] . ped is caused by the porcine epidemic diarrhea virus (pedv), which belongs to the order nidovirales and the family coronaviridae [ ] . pedv infections are more frequent in the winter [ ] , and although pedv can infect swine of all ages, it causes the most serious harm to suckling piglets. since the discovery of ped in england in , the disease has expanded to many countries in europe and asia, especially china and south korea, which has caused huge economic losses [ ] . in china, pedv is widely distributed, and outbreaks have a strong negative impact on the swine industry, in part due to the acute onset and fast spread of the virus,the incidence rate in piglets can be very prevalent [ ] [ ] [ ] . the methods currently used to diagnose ped in clinical samples are mainly divided into two types: ) immunological methods including immunochromatography and enzyme-linked immunosorbent assay (elisa) [ , ] , and ) molecular biology assays including conventional reverse transcription-polymerase chain reaction (rt-pcr), reverse transcription quantitative pcr (rt-qpcr), multiplex pcr, and reverse transcription loop-mediated isothermal amplification (rt-lamp) [ ] [ ] [ ] [ ] . although immunological methods are generally low cost and easy to perform, they have several disadvantages, including inconclusive results and the long time required to perform the assays. to decrease the time required for pedv detection, pcr-related methods focused on the amplification of viral nucleic acids have been developed, which have been shown to be more efficient, highly sensitive and specific, even at different stages of the disease, when compared to immunological diagnostic methods. however, these molecular diagnostic methods cannot be widely used because of their complex operation, time-consuming nature, and the requirement for expensive instrumentation. detection methods based on isothermal amplification of nucleic acids, which can rapidly synthesize large amounts of dna without any specific requirements for precision instruments, have been widely used. the polymerase spiral reaction (psr) [ ] is a novel nucleic acid isothermal amplification method that has the advantages of simplicity, rapidity, accuracy, and low cost when compared to conventional pcr. in addition, less primer is required, and primer design is simpler than for loop-mediated isothermal amplification (lamp). due to the high efficiency of amplification, product formation is accompanied by high levels of pyrophosphate ion by-product, leading to a change in ph. therefore, a ph-sensitive dye can be used to detect the product of the reaction with the naked eye [ ] . psr detection methods have been used for numerous human and veterinary pathogens [ ] [ ] [ ] [ ] . therefore, we evaluated clinical samples using the newly developed rt-psr method to determine the method's utility for early detection of pedv. optimum reaction temperature and time for the diagnosis of pedv by rt-psr electrophoretograms showed no obvious difference in the gradient bands produced at temperatures ranging from °c to °c; however, the bands were slightly more obvious at °c. with increasing reaction time, the bands become more visible, and reached a peak at min. therefore, the optimum temperature and time for detecting pedv by rt-psr was °c and min, respectively. the rt-psr assay for pedv detection was optimized as follows: reverse transcription at °c for min and spiral amplification at °c for min. samples were serially diluted tenfold ( − , − , − , − , − , and − ) and were used in both the rt-psr and conventional pcr assays for pedv detection, and the results are shown in fig. at the − dilution, conventional pcr yielded the clear bands. however, at dilutions below − , there was no obvious band (fig. c) . the results in fig. a demonstrated that when the concentration was − , the psr produced a clear ladder banding pattern; however, there were no obvious bands when the concentration was below − . therefore, the rt-psr assay is more sensitive than the conventional rt-pcr assay. based on the results of this experiment, the rt-psr method can be used to detect pedv, and with the addition of a colorimetric dye, positive clinical samples containing amplified product were orange-yellow, while negative samples were purple under natural light. thus, confirmation of a positive result can be visually confirmed with the naked eye (fig. b) . the specificity of the rt-psr method was tested using selected reference swine viruses. figure a shows that only the reaction containing pedv yielded an obvious ladder, which demonstrates that the rt-psr assay specifically detected pedv, and no other tested viral pathogen was detected. figure b shows the corresponding reactions containing a ph indicator dye. the product was digested with ecor i, and the results are shown in fig. c . based on the primer design, digestion of the amplified pedv product with ecor i should yield three main bands of , , and bp. the results of the experiment are in good agreement with these fig. sensitivity of the rt-psr and rt-pcr assays for the detection of pedv. ten-fold serial dilutions of pedv rna were subjected to the rt-psr and rt-pcr assays and analyzed. lane m, bases pair (bp) marker dl . lanes - , dilutions of pedv rna ( , − , − , − , − , − , and − ). a agarose gel electrophoresis demonstrating the sensitivity of the rt-psr assay. b colorimetric analysis demonstrating the sensitivity of the rt-psr assay. c agarose gel electrophoresis demonstrating the sensitivity of the rt-pcr assay theoretical values, thus verifying the identity of the amplification products. this further confirms that the rt-psr method is highly accurate for pedv detection at the molecular level. the results of the rt-psr and conventional pcr assays for clinical isolates detection are shown in table , the positive rates for the rt-psr and conventional rt-pcr methods were . % ( / ) and . % ( / ), respectively. the rt-pcr-negative samples were confirmed the presence of pedv by virus isolation. the rt-psr and rt-pcr assay for detecting pedv possessed an analytical specificity of % ( false negative) and . % ( false negative), respectively. these results demonstrate that conventional pcr is not adequately sensitive to detect pedv in samples with low viral loads or the psr assay is less affected by potential inhibitors within the samples. moreover, the efficiency of the developed detection method is not affected by co-infection. based on the above results, the accuracy of the rt-psr method is well suited for the detection of early viral infections. pedv, a predominant cause of acute enteric infection in swine, leads to severe dehydrating diarrhea and economic losses in the swine industry worldwide. in recent years, the incidence rates of various infectious diseases in swine have been rapidly increasing, and co-infection with pedv and a variety of other porcine diseases is becoming more and more common [ ] . moreover, the cure rate for pedv is significantly higher in the early stage of infection than in the late stage of infection. therefore, it is necessary to establish a rapid, sensitive, and specific method for detecting pedv early in primary veterinary clinics, which would be a major breakthrough for this disease. at present, numerous established laboratory diagnostic techniques are used to identify pedv. kim [ ] compared pedv detection using rt-pcr, immunohistochemistry, and in situ hybridization; zhou [ ] developed and evaluated three assays, including conventional rt-pcr, sybr green i real-time rt-pcr, and taqman real-time rt-pcr assays. their results indicated that the taqman real-time rt-pcr could be a useful tool for clinical diagnosis, epidemiological surveys, and outbreak investigations of pedv. in addition, although rt-pcr detected pedv more frequently than serological techniques, when only tissues are submitted, immunohistochemistry and in situ hybridization would be useful methods for the detection of pedv antigen and nucleic acids. a comprehensive analysis showed that although immunological techniques can rapidly and quantitatively detect pedv in samples, molecular technologies have become more popular for their superior specificity and sensitivity. by combining current research and technological progress, we developed a more suitable molecular-based assay for the detection of pedv for early diagnosis. because of the difficulties in clinical diagnosis, the low accuracy of serological diagnosis, and the complicated operation of diagnosis via viral isolation methods, psr technology has been widely used for the differential diagnosis of animal epidemics, such as canine parvovirus (cpv- ) [ ] , african swine fever virus (asfv) [ ] , and bovine herpesvirus (bhv- ) [ ] . psr not only has the advantages of traditional pcr, as it can also detect pathogenic genes efficiently and specifically, it also has a shorter detection time, is easier to perform, and uses less reagents, when compared to traditional pcr. specific nucleic acids can be amplified by the psr method under isothermal conditions, without the need for template pre-denaturation, or sacrificing amplification efficiency. in a positive reaction, the large amount of products, and white pyrophosphoric acid precipitates make a positive result easy to detect. in this experiment, by using the pedv orf sequence in genbank, a highly conserved region of the sequence was analyzed and selected for primer design, and a fast, simple, and accurate pedv rt-psr method was successfully developed for the detection of pedv. it offers many advantages compared to conventional pcr, and the most obvious advantage of this assay is that it is sensitive for pedv. rt-psr is more accurate than rt-pcr for the detection of clinical samples, and its sensitivity is about times higher than that of conventional pcr. further analysis of the rt-psr-positive samples that were not detected by rt-pcr by viral isolation and identification confirmed the presence of pedv. we speculated that, for such samples, the viral load may be low or it may have been collected early in the course of the infection. besides limiting by viral load, psr assay is less affected by potential inhibitors within the samples, which indicated that rna extraction of from samples could be omitted [ ] . so far, extraction of nucleic acid from clinical samples was consumedly increased the time and cost for diagnosis on farm or in typical veterinary clinics. therefore, nucleic acid adsorption or other simple strategy needed study and evaluate for application of rt-psr assay. in addition, by using the developed rt-psr detection method, pedv can be amplified across a wide range of temperatures from °c to °c; therefore, it can be performed in a water bath. in addition, expensive electrophoresis equipment and gel imaging systems are required to analyze the results of conventional pcr, which increases the detection costs. in contrast, using the psr method established in this study, a positive result can be directly determined by the naked eye when mixed dyes are added before the reaction, which do not affect the amplification efficiency, nor agarose gel electrophoresis. these advantages facilitate the rapid detection of pedv. through the aforementioned experiments and analyses, we concluded that the developed rt-psr method offers multiple advantages compared to conventional pcr, including shorter time and higher sensitivity. the popularization of this technology for pedv detection will be an important development in the study of ped in china, which should be beneficial for the prevention and treatment of pedv in the swine industry. tissue samples were collected from pigs died from diarrhea symptoms on farms, the small intestine was immersed in phosphate-buffered saline (pbs), washed several times to eliminate residual blood, and then placed in a centrifuge tube and stored at − °c until use. the experimental procedure for virus isolation is in african green monkey kidney (vero) cells according to reference [ ] . the isolates were determined by more propagation until apparent cytopathic effects appeared. classical swine fever virus (csfv), porcine reproductive and respiratory syndrome virus (prrsv), transmissible gastroenteritis virus (tgev), porcine circovirus type (pcv ), porcine parvovirus (ppv), pseudorabies virus (prv), and the clinical samples suspected of pedv described above included in this study were stored in the china-uk-nynu-rres joint laboratory of insect biology, nanyang normal university. prior to rna extraction, frozen small intestine samples (~ mg) were homogenized in liquid nitrogen. then, total rna was extracted by using a commercial extraction kit (easypure viral dna/rna kit; transgen biotechnology, inc., beijing, china) according to the manufacturer's instructions. the rna was dissolved in depc-treated water for cdna synthesis. the extracted rnas were suspended in μl of elution buffer and stored at − °c until use. using the published pedv sequences in genbank (ncbi), the conserved genes of the virus were analyzed, specific primer pairs were designed for the rt-psr and rt-pcr reaction based on a conserved region of the orf gene using primer premier . software. a pair of primer (p and p ) for rt-pcr were also designed. the obtained primers included a forward and reverse primer (table ) , the ′ sequences of the psr-s and psr-s primers were obtained from a botanical gene to avoid nonspecific reactions with pedv. the rt-psr products with repeat target sequences displayed multiple banding patterns were produced due to different spiral amplification stages by the aid of simultaneous bst dna polymerase extension at ′ end and strand displacement at ′ end. [ ] . based on our previous experimental data, the rt-psr reaction was performed in a volume of μl, containing primers for reverse transcription and the initial amplification ( . mm each psr- and psr- ), the forward and reverse primers for the psr reaction ( . mm each psr-s and psr-s ), dntps ( . mm), u of amv reverse transcriptase (new england biolabs, hitchin, uk), u of bst dna polymerase (new england biolabs), mm (nh ) so , mm kcl, . % v/v tween- , dye mix ( . mm phenol red and . mm cresol red), μl of template rna, and nuclease free water to μl. the reaction mixture was covered with mineral oil to prevent aerosol cross contamination. psr-amplified products were observed by the naked eye and analyzed by % agarose gel electrophoresis. determination of the optimum temperature and time for the rt-psr assay total pedv rna was used as the template in this reaction. after reverse transcription at °c for min. the psr was conducted at various temperatures ( °c, °c, °c, °c, °c, °c, and °c) to determine the optimum reaction temperature. then, the optimum time for rt-psr was evaluated at , , , and min. the analytical sensitivity of the rt-psr was determined by its ability to detect a low concentration of pedv and therefore expressed as a concentration (ng/assay) [ ] . ten-fold serial dilutions of pedv total rna in nuclease free water (diluted from − to − ; minimum concentration, . ng/ml) were used to calculate the sensitivity of the newly developed rt-psr assay and compare it to that of the rt-pcr assay. the products were analyzed by separation via electrophoresis on a % agarose gel and directly visualized with a colorimetric ph indicator dye. to determine the specificity of the rt-psr assay, rna or dna samples from different porcine viruses, including csfv, prrsv, tgev, prv, pcv , and ppv were tested in the assay, and ddh o was used as a negative control. all viruses, except pedv, are reference swine viruses. the specificity of the pedv rt-psr assay was further evaluated by enzyme digestion of amplified products. the primers were designed with ecor i restriction sites, and digestion of the amplified products should yield fragments of the expected sizes by agarose gel electrophoresis. the text shown in italics in psr-s and psr-s is the central sequence, which is the same in psr- and psr- , respectively, and the bold text is the ecor i restriction site a the primer position is based on the sequence of the hen/my/ strain, genbank accession number: ku porcine epidemic diarrhea virus: an emerging and re-emerging epizootic swine virus an apparently new syndrome of porcine epidemic diarrhoea genetic properties of endemic chinese porcine epidemic diarrhea virus strains isolated since comparative proteome analysis of porcine jejunum tissues in response to a virulent strain of porcine epidemic diarrhea virus and its attenuated strain complete genome sequence of porcine epidemic diarrhea virus strain aj isolated from a suckling piglet with acute diarrhea in china isolation and characterization of a variant porcine epidemic diarrhea virus in china complete genome sequence of porcine epidemic diarrhea virus from an outbreak in a vaccinated farm in shandong an elisa optimized for porcine epidemic diarrhoea virus detection in faeces a novel diagnostic approach to detecting porcine epidemic diarrhea virus: the lateral immunochromatography assay direct and rapid detection of porcine epidemic diarrhea virus by rt-pcr multiplex real-time rt-pcr for the simultaneous detection and quantification of transmissible gastroenteritis virus and porcine epidemic diarrhea virus development of reverse transcription loop-mediated isothermal amplification for rapid detection of porcine epidemic diarrhea virus a novel duplex taqman probe-based real-time rt-qpcr for detecting and differentiating classical and variant porcine epidemic diarrhea viruses polymerase spiral reaction (psr): a novel isothermal nucleic acid amplification method visual detection of isothermal nucleic acid amplification using ph-sensitive dyes rapid detection of pseudomonas aeruginosa targeting the toxa gene in intensive care unit patients from beijing rapid detection of candida albicans by polymerase spiral reaction assay in clinical blood samples polymerase spiral reaction (psr): a novel, visual isothermal amplification method for detection of canine parvovirus genomic dna polymerase cross-linking spiral reaction (pclsr) for detection of african swine fever virus (asfv) in pigs and wild boars porcine epidemic diarrhea virus infection: etiology, epidemiology, pathogenesis and immunoprophylaxis comparison of reverse transcription polymerase chain reaction, immunohistochemistry, and in situ hybridization for the detection of porcine epidemic diarrhea virus in pigs comparison and evaluation of conventional rt-pcr, sybr green i and taqman real-time rt-pcr assays for the detection of porcine epidemic diarrhea virus novel polymerase spiral reaction (psr) for rapid visual detection of bovine herpesvirus genomic dna from aborted bovine fetus and semen tolerance of loop-mediated isothermal amplification to a culture medium and biological substances isolation, molecular characterization and an artificial infection model for a variant porcine epidemic diarrhea virus strain from jiangsu province sensitivity" and "specificity" reconsidered: the meaning of these terms in analytical and diagnostic settings not applicable. the datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. the newly developed rt-psr assay was further evaluated using clinical samples obtained from pigs with diarrhea located in jiangxi, jiangsu, hunan, hubei, and anhui, china. both the new rt-psr and conventional rt-pcr assays were performed to determine the positive rate compared with virus isolation. the analytical specificity of the assays was calculated using the following definition for specificity as the percentage of false negative samples/ the number of true positive samples [ ] . all products of rt-psr were visualized after separation by electrophoresis on a % agarose gel. the other prevalent porcine viruses were also investigated. the autopsy protocols for dead pigs were conducted in accordance with the recommendations of the guide for the care and use of laboratory animals of the national institutes of health. the approval of using animals during the process of this study was obtained from south china agricultural university committee for animal experiments (approved id: syxk- - ). not applicable. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. key: cord- - e t authors: gloster, john; ebert, katja; gubbins, simon; bashiruddin, john; paton, david j title: normal variation in thermal radiated temperature in cattle: implications for foot-and-mouth disease detection date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: e t background: thermal imagers have been used in a number of disciplines to record animal surface temperatures and as a result detect temperature distributions and abnormalities requiring a particular course of action. some work, with animals infected with foot-and-mouth disease virus, has suggested that the technique might be used to identify animals in the early stages of disease. in this study, images of healthy cattle have been taken over an extended period to determine hoof and especially coronary band temperatures (a common site for the development of fmd lesions) and eye temperatures (as a surrogate for core body temperature) and to examine how these vary with time and ambient conditions. results: the results showed that under uk conditions an animal's hoof temperature varied from °c to °c and was primarily influenced by the ambient temperature and the animal's activity immediately prior to measurement. eye temperatures were not affected by ambient temperature and are a useful indicator of core body temperature. conclusions: given the variation in temperature of the hooves of normal animals under various environmental conditions the use of a single threshold hoof temperature will be at best a modest predictive indicator of early fmd, even if ambient temperature is factored into the evaluation. foot-and-mouth disease (fmd) is a highly infectious viral disease of cloven-hoofed animals, both domestic and wild. the disease is caused by a small rna virus, which is nm in diameter and exists as seven serotypes. the disease is characterised by fever, and blisters in the mouth, on the feet and on the teats and these rupture and are associated with slobbering and lameness. adult animals may suffer weight loss and milk production can decline significantly. though most animals eventually recover from fmd, the disease can lead to myocarditis and death, especially in newborn animals [ ] . fmd is found regularly in parts of south america, africa, the middle east and other parts of asia and periodically spreads to affect normally disease free countries. it is a significant impediment to trade in livestock and their products as countries with the disease face restrictions for exporting to disease free regions. moreover, the disease is difficult and costly to control and eradicate. the royal society [ ] estimated that during the epidemic in the uk, in which some six million animals were culled, the losses to agriculture and the food chain were £ . billion and some £ . billion was paid by the uk government in compensation for slaughtered animals and clean-up costs. losses were also experienced in tourism and business directly affected by tourism; it has been estimated these were between £ . and £ . billion [ ] . two other epidemics highlight the global impact of the disease; the first a major epidemic in argentina in and the second in japan during ; in the first two thousand five hundred and nineteen herds were infected [ ] and in the second two hundred and fifty (office international des épizooties-world organisation for animal health, . follow-up report early identification of animals infected with fmd virus is vital if disease outbreaks are to be rapidly diagnosed and controlled. thorough screening to identify signs of fmd is time consuming and labour intensive since it requires the capture and restraint of suspect animals for clinical examination. this can be particularly difficult in some situations, for example where animals are at pasture, are difficult to handle or are present in very large numbers. animals with fmd often develop a fever with temperatures in excess of °c and vesicular lesions around the coronary band, in and around the mouth and on the mammary gland. the vesicular lesions are associated with local inflammation giving rise to an increase in skin temperature which can be detected by palpation [ ] . on their own, these temperature changes are not pathognomonic for fmd but can be used to select animals that warrant closer examination to detect more definitive signs and/or enable sampling for confirmatory testing. infrared thermography (irt) can be used to measure the heat emitted from a surface and to display and store an image and associated data. the technique has been used by the medical profession over recent years across a range of human conditions, to identify local inflammations or pyrexia [ ] and in the detection of fever associated with sars and avian influenza [ ] . irt has also been used by those involved with animal disease [ ] [ ] [ ] . workers at the pirbright laboratory of the institute for animal health (iah-pirbright) and at the plum island animal disease center (piadc), usa have reported that irt can be used to measure the temperatures of animals that need to be checked for possible onset of fmd [ ] [ ] [ ] . these workers studied groups of animals with experimentally-induced fmd and measured temperatures (primarily around the coronary band) as disease progressed. it was found that increases in temperature associated with fmd could be detected, sometimes prior to the development of visible lesions. unpublished work by the current authors involving five cattle, five sheep and five pigs infected with the asia strain of fmdv discovered that it was easy to measure the feet temperatures of the animals and established that there was potential for using the technique in the field. cattle feet temperatures ranged from . °c to . °c, with the highest value being recorded the day before foot lesions were visible, but at the same time as the first lesion on the tongue. prior to the first appearance of lesions temperatures were below °c. to optimise interpretation of temperature measurements and to demonstrate the reliability of the technique to differentiate between infected and healthy livestock requires further irt data from uninfected animals, kept at different ambient temperatures and under different husbandry conditions. this shortcoming is addressed here by irt measurements and analysis from healthy cattle. the experimental period was divided into two phases. the first phase was designed to make observations under different irt/animal configurations and environmental conditions, the second to examine the changes in an animal's hoof temperature over a daily cycle of activity. in the first phase, five separate sets of temperature data were taken over a period of five months using a tir imager manufactured by fluke (temperature range - °c to °c, accuracy +/- °c, operated at a distance of to m, emissivity . ). two groups of nine and ten cattle initially aged and months old respectively, were housed in small groups in pens in an open barn at the institute for animal health farm at compton, newbury; one half of each pen had a concrete floor and the other a slightly raised straw filled area. each animal in turn was restrained either by hand or in an animal crush and four irt measurements were taken of each of the animal's feet from different aspects (front, back, lateral and medial) and a measurement was also taken of the left eye (see figure for an example). these two sites were selected because, as mentioned above, researchers working on fmd had detected an increase in temperature around the coronary band and it is hypothesised that temperatures around the eye provide a non-invasive indicator of an animal's core temperature. other sites commonly affected by fmd lesions such as the mouth and udder are less accessible and/or only applicable to lactating animals. to investigate the link between eye temperature and body temperature each animal's rectal temperature was taken at the same time as the thermal images using a digital thermometer. the irt images were taken twice within ten minutes from each animal to evaluate repeatability of the measurements and correct for minor variations in the angle of the imager to the animal. ambient temperatures were measured with a fisher scientific model fb digital thermometer. care was taken throughout the experiment when handling the cattle, as it was appreciated that even the simple act of gathering animals can cause an increase in stress which in turn may result in an increase in the animal's temperature. as it was not practical to measure changes in an animal's hoof temperature over an extended period of activity using an irt imager, a second temperature measuring device was used for this purpose (ibutton data loggers, type ds g, temperature range - °c to °c, accuracy +/- °c, data recording rate every second or every two seconds, manufactured by embedded data systems). the ibuttons were strapped to the animals' hooves as shown in figure . to compare the results of irt and ibuttons, hoof temperatures were measured for two cattle. tir images were taken either immediately prior to ibutton attachment, simultaneously with attachment, but for another foot, or immediately after the ibutton was removed. identical readings from the two instruments were not expected as both devices measure temperature in different ways (tir -radiative and ibutton-thermal contact). however, it was anticipated that similar trends could be detected using both sensors. the final phase of the work was to investigate changes of hoof temperature as a function of activity. these were established using ibuttons and a video security camera (solidex day night domecam varifocal lens combined with a solidex channel dvr) placed above the pen holding two of the cattle (chosen for ease of visual recognition). ibuttons were attached to the two hind feet of the cattle and data recorded at a frequency of once or twice per minute for a period of approximately twenty hours. air temperatures were recorded using an ibutton suspended in free air close to the animal pen. the experiment was done twice. tir images were processed using smart view software (v . . . ), supplied by fluke. for each image, an area of approximately cm above and below the coronary band was selected and the maximum temperature within this area (see figure ) was recorded and transcribed to an excel spreadsheet for subsequent statistical analysis. additionally, an area at least cm above the hoof was selected to determine whether a ratio between hoof and more proximal leg surface temperature could help compensate for hoof temperature changes caused by ambient temperature changes. an area of approximately cm around the eye was selected for analysis and the hottest temperature within this area, including the eye itself, was recorded (see figure ). for comparing ibuttons and irt, the area covered by the attached ibutton was selected and the average temperature within this area recorded and further analysed in an excel spreadsheet. ibutton data was analysed with tempit software supplied by signatrol (version . . ) and the data transferred to the master excel spreadsheet. to determine the animal's movements the security camera images were replayed and activity allocated into one of four categories (lying down, standing on deep straw, standing on concrete and outside of the holding pen). the date and time for each change in activity category was recorded for comparison with the ibutton data. two separate analyses of the data were carried out to assess: (i) the repeatability of thermal image measurements taken sequentially within a ten minute interval; and (ii) the potential for defining a threshold temperature above which cattle would be considered abnormal based on irt. the repeatability of thermography was assessed by computing the difference in temperature as measured by corresponding images (i.e. for the same hoof with the same aspect on the same day) for each animal and determining whether the median differed significantly (p < . ) from zero using a wilcoxon signed rank test. the potential for defining a threshold temperature to identify unhealthy cattle based on irt was examined using a bayesian hierarchical model, which incorporates between-animal variation and facilitates predictions outside the data which allow for parameter uncertainty. in this approach, the observed hoof temperature (t jk ) for the jth observation on animal k was described by, jk is the expected hoof temperature, σ e is the error variance, the b (k) i s are parameters and x ijk is the value of the ith factor (e.g. hoof, aspect or ambient temperature) for the jth observation on animal k. betweenanimal variation was modelled by assuming that the parameters for each animal are drawn from higherorder distributions, such that, non-informative priors were used for the higher-order parameters: diffuse normal distributions for the μ b is and diffuse gamma distributions for the σ b is. parameters in the model were estimated using markov chain-monte carlo methods implemented in winbugs [ ] . two chains of , iterations were run for each model, with the first , iterations discarded to allow for burn-in of the chain. each chain was then thinned by sampling every tenth iteration to reduce autocorrelation amongst the samples. the fits of different models were compared using the deviance information criterion (dic) [ ] . posterior predictions for the expected hoof temperature as a function of ambient temperature were generated by sampling from the joint posterior density for the higher-order parameters. a range of percentiles of the resulting distribution were used to define thresholds for identifying abnormal animals and the specificity of a classification scheme based on these thresholds (essentially the proportion of animals below the threshold) was assessed. in the first phase of the experiment, between july and november , around two thousand three hundred thermal images of cattle hooves were taken. during these experiments, ambient temperatures ranged from °c to . °c and general weather conditions from a warm summer's day through to cold and damp winter conditions. hoof temperatures measured by irt ranged from approximately °c to °c (figure a ) and depended markedly on ambient temperature (figures d & ) . furthermore, the variability in hoof temperatures was greatest at lower ambient temperatures (figure d ). the median range in hoof temperatures for individual animals on a given day was approximately °c, but in some cases it was > °c (figure ). this range often reflected one hoof or side being markedly warmer than the other (for example, animals , , and ), but sometimes there was no clear explanation for the difference (for example, animals and ). differences in hoof temperature between corresponding images recorded on the same day were typically small ( figure b ) and did not differ significantly (p > . ) from zero for (out of ) animals. for six animals (animals , , , , and ), the median difference in repeated observations was significantly (p < . ) different from zero, though the median difference in each case was only a fraction of a degree (range: - . °c to . °c). eye temperature measured by irt provided a reasonable proxy measure for body temperature, with eye temperatures approximately °c lower than rectal temperature ( figure c) and not significantly affected by ambient temperature (p > . ). an adequate model to describe the hoof temperature data included ambient temperature (°c), hoof (coded as: front-left, front-right, hind-left and hind-right) and camera aspect (coded as: front, lateral, medial and rear) ( table ) ; removing any of these terms from the model significantly worsened model fit (full model: dic = . ; removing ambient temperature: dic = . ; removing hoof: dic = . ; removing aspect: dic = . ). adding extra terms to the model improved the model fit, often markedly so; for example, a quadratic term for ambient temperature (dic = . ) or eye temperature as a normalising factor (dic = . ). however, this was at the expense of the resulting model being poor as a predictive tool, because the variance for the higher-order parameters needed to be so large to incorporate the observed differences amongst animals. accordingly, the adequate model was used in subsequent analyses. the analysis indicated that there was variation in temperature amongst hooves on the same animal, but these differences were not systematic between animals, as evidenced by means for the hoof parameters which do not differ significantly from zero, but which have a high standard deviation (table ) . camera aspect did influence hoof temperature measurement, with images taken from the lateral, medial or rear aspect being around °c lower than those taken from a front aspect (table ) . however, ambient temperature had the greatest impact on hoof temperature (figures d & ; table ). by sampling from the joint posterior density for the higher-order model parameters (and integrating out the effects of hoof and camera aspect) it was possible to generate predictions for hoof temperature as a function of ambient temperature. the th, th and th percentiles for these predictions were then used to define thresholds by which to identify healthy cattle, with a further refinement that the maximum threshold temperature was set equal to the mean rectal temperature for the animals ( . °c) (figure a ; table ). the specificity of a classification scheme based on these thresholds was investigated. for a threshold based on the th percentile, the predicted specificity was low, especially at ambient temperatures below °c (< % specificity, figure b ). the specificity was improved by setting a threshold based on the th or th percentile with specificity > % predicted above temperatures of °c and °c respectively (figure c, d) . a simple comparison between the tir and three ibuttons, on a shaded uniform temperature carpet tiled floor revealed that both instruments recorded similar temperatures with the tir being warmer than the ibutton by . to . °c (ibutton no./tir /ibutton: / . / . ; / . / . ; / . / . ; / . / . ; . / . °c). it was also established that the ibuttons, given a sudden temperature change of °c took fifteen minutes to reach equilibrium. table presents the results from the comparison between the ibutton and tir for two animals on two separate days. the data show that temperature measured by the ibutton approximately fifteen minutes after attachment and just before removal relates well to the average temperatures measured by the tir . the ibutton temperatures were consistently warmer than the average temperature measured by tir (average temperature differences . , . , . and . °c). this trend was observed for all data collected during the comparison of the ibutton and tir . the ibutton as well as the tir record sudden temperature changes equally well as seen on one occasion where the average temperatures for all feet for one animal measured by the tir were . / . / . and . °c before ibutton attachment; whereas after the removal of the ibutton average temperatures for all legs measured by the tir were only very slightly raised ( . - . °c) apart for one foot where the temperature was raised by . °c. the ibutton recorded °c and °c for three out of the four legs at fifteen minutes after attachment and before removal, but recorded temperatures of °c after fifteen minutes and . °c before removal for the leg with the raised temperature (data not shown). the extended measurement period using both the ibutton and security surveillance camera showed that the animals' hoof temperatures varied by as much as °c depending upon a combination of activity and ambient air temperature. a typical analysis is given at figure where it can be seen that when the animal was standing on the concrete temperatures were much lower than when it was lying down in the straw with its feet tucked under its body. this effect was consistent in each of the animals whose temperatures were measured. maximum temperatures of °c were recorded and this was very close to the animal's rectal temperature. to detect inflammatory conditions such as fmd affecting cattle feet, irt needs to be able to identify abnormal surface temperature elevations. this raises the challenge of being able to distinguish such elevations from the spectrum of variability found in uninfected animals. similar challenges affect the use of the technique in screening human subjects, for instance for pyrexia at airports [ ] . two approaches can be envisaged for fmd. first, irt could prove very useful if a threshold temperature were to be established above which a foot temperature triggers a suspicion of an inflammatory condition. this approach has been suggested by rainwater-lovett [ ] . however, the current study shows that this technique may be too simplistic in its approach as an animal's hoof temperature is significantly affected by ambient temperature and posture/activity. thermal image data reported by bashiruddin [ ] from fmdv-infected cattle were compared with the thresholds shown in table to determine if these thresholds could provide a basis for early stages of fmd infection to be detected. at the ambient isolation facility temperature of~ °c, table suggests that hoof temperatures of . °c ( th percentile), . °c ( th percentile) and . °c ( th percentile) would indicate an elevated temperature indicative of infection. however, of the five animals which became infected, only one showed a temperature above °c (two hooves) and this was when vesicular lesions were visible. although definitive conclusions will require study of greater numbers of infected animals, these results suggest that the threshold temperatures determined in the present study will result in a low sensitivity, unless specificity is reduced. an alternative approach is for the operator to use irt to identify hot-spots. these are identified as either part or all of a hoof that is hotter than the surrounding skin or hotter than other feet. in this approach, it is relative rather than absolute temperatures that matter. previous studies [ , ] have demonstrated that areas of raised temperature on an animal's hoof can be detected. to investigate this approach, a "blind test" was conducted using forty four thermal images from six cattle either before infection or in the early stages of fmd [ ] . one of the authors was invited to categorise the images as "not a concern", "unlikely to be infected", "possibly infected", "suspicious" or "highly suspicious". once an animal displayed clinical signs evident upon close physical examination, it was considered infected and it was excluded from further analysis the day afterwards, since temperatures of the feet often decline within a day or two of the formation of vesicles even if ruptured lesions remain evident. the results from this pilot revealed a % sensitivity ( out of images) and % specificity (scoring possibly infected and above as positive) ( out of images) or % sensitivity ( out of images) and % specificity (scoring suspicious and above as positive) ( out of images). whilst these results are encouraging, further work using images collected from a larger number of infected animals is needed before a conclusion can be reached concerning the merits of this approach. this study has been completed under ideal field conditions. the situation in the field is likely to be less favourable. for example the animal's feet may be wet, covered in grass, muddy or covered in faeces. these variables need to be studied in more detail before irt can be used with confidence to detect fmd in the field. other parts of the body affected by inflammation in fmd, such as the mouth are not readily visualised by an infrared camera, whilst changes in the udder are limited in application to female dairy breeds. the use of irt eye measurements seems a promising method to measure body temperature and therefore merits further evaluation in animals affected with fmd and other pyrexic conditions. if irt technology is to be useful in the field it has to be both technically capable of distinguishing between infected and non infected animals and be a cost effective diagnostic tool. in the field two scenarios are likely; the first where animals are housed or can be easily corralled and are readily accessible at close range and the second where they are at pasture and less easy to gather. in the first instance the current cost of an irt camera will be in the range £ - k but in the second, where the equipment is required to operate at longer ranges, it is likely that a more powerful telephoto lens would be required. the cost of this significantly increases the price of the equipment possibly up to £ k. the study has identified that an animal's hoof temperature is influenced by its activity prior to the point at which thermal screening is performed. consequently, a period of acclimatisation is required prior to an image being taken. this is particularly the case if the animal has been lying down with its feet tucked under its body. the work has shown that irt images of an animal's eye temperature may be a useful proxy for core temperature and could be used to detect pyrexia as an indicator for selecting animals for closer examination. this conclusion supports the observation by dunbar [ ] who compared high quality thermograms of the eye (n = ) to body temperature and found them not to be different (p = . ). however, further work is required with animals infected with fmdv to confirm this. the pathogenesis and diagnosis of foot-and-mouth disease royal society inquiry commissioned by the uk government into infectious diseases in livestock economic costs of the foot-and-mouth disease outbreak in the united kingdom control of foot-and-mouth disease epidemic in argentina thermal imaging in surgery mass screening of suspected febrile patients with remote-sensing infrared thermography: alarm temperature and optimal distance a review of the role of thermography in the management of equine lameness thermography in the diagnosis of inflammatory processes in the horse the use of infrared thermography as an early indicator of bovine respiratory disease complex in calves user of infrared thermography to detect thermographic changes in mule deer (odocoileus hemionus) experimentally infected with foot-and-mouth disease preliminary study of the use of thermal imaging to assess surface temperatures during footand-mouth disease virus infection in cattle, sheep and pigs. eufmd conference proceedings detection of footand-mouth disease virus infected cattle using infrared thermography winbugs-a bayseian modelling framework: concepts, structure and extensibility bayesian measures of model complexity and fit (with discussion) normal variation in thermal radiated temperature in cattle: implications for foot-and-mouth disease detection authors' contributions jg and djp were responsible for study design. jg, ke, djp and jb were responsible for the field work, ke for thermography data analysis and sg for statistical analysis and modelling. djp was responsible for conducting the "blind test". all authors read and approved the final manuscript. the authors declare that they have no competing interests. key: cord- -qrht tq authors: burimuah, vitus; sylverken, augustina; owusu, michael; el-duah, philip; yeboah, richmond; lamptey, jones; frimpong, yaw oppong; agbenyega, olivia; folitse, raphael; emikpe, ben; tasiame, william; owiredu, eddie-williams; oppong, samuel; antwi, christopher; adu-sarkodie, yaw; drosten, christian title: molecular-based cross-species evaluation of bovine coronavirus infection in cattle, sheep and goats in ghana date: - - journal: bmc vet res doi: . /s - - -x sha: doc_id: cord_uid: qrht tq background: apart from the huge worldwide economic losses often occasioned by bovine coronavirus (bcov) to the livestock industry, particularly with respect to cattle rearing, continuous surveillance of the virus in cattle and small ruminants is essential in monitoring variations in the virus that could enhance host switching. in this study, we collected rectal swabs from a total of , cattle, sheep and goats. bcov detection was based on reverse transcriptase polymerase chain reaction. sanger sequencing of the partial rna-dependent rna polymerase (rdrp) region for postive samples were done and nucleotide sequences were compared with homologous sequences from the genbank. results: the study reports a bcov prevalence of . %, consisting of positive cases; goats and cattle. less than % of all the animals sampled showed clinical signs such as diarrhea and respiratory distress except for high temperature which occurred in > of the animals. however, none of the bcov positive animals manifested any clinical signs of the infection at the time of sample collection. bayesian majority-rule cladogram comparing partial and full length bcov rdrp genes obtained in the study to data from the genbank revealed that the sequences obtained from this study formed one large monophyletic group with those from different species and countries. the goat sequences were similar to each other and clustered within the same clade. no major variations were thus observed between our isolates and those from elsewhere. conclusions: given that ghana predominantly practices the extensive and semi-intensive systems of animal rearing, our study highlights the potential for spillover of bcov to small ruminants in settings with mixed husbandry and limited separation between species. conclusions: given that ghana predominantly practices the extensive and semi-intensive systems of animal rearing, our study highlights the potential for spillover of bcov to small ruminants in settings with mixed husbandry and limited separation between species. keywords: bovine coronavirus, cattle, sheep, goat, cross-species infection background bovine coronavirus (bcov) belongs to the genus betacoronavirus within the coronaviridae family [ ] [ ] [ ] . it is an enveloped, single-stranded and positive-sense rna virus with a genome size of kb, encoding five main structural proteins: the nucleocapsid, the hemagglutinin esterase, the membrane, the spike (s), and the envelope proteins [ ] . bcov has been implicated in severe diarrhea in neonatal calves, winter dysentery in adult cattle and has been associated with respiratory infections in calves and feedlot cattle [ , ] . transmission is primarily through respiratory or fecal-oral routes [ ] , infecting the respiratory (nasal, tracheal, and lung) and intestinal (villi and crypts of the ileum and colon) epithelial cells [ ] . although infection with bcov has a low mortality, it generally presents with a high morbidity among cattle of all ages [ ] . outbreaks characteristically occur in autumn and winter, when the virus is most active [ , ] . substantial economic toll can be exerted by bcov infection when a large herd are infected, resulting in drastic reduction in milk yield [ , ] . in many developing countries where different animals live in close proximity, there is the possibility of interspecies transmission of zoonotic diseases. a few studies have reported the detection of bcov in small ruminants [ ] [ ] [ ] [ ] [ ] . despite the health and economic significance of bcov in livestock, only limited studies have been conducted to evaluate bcov infection in livestock in ghana to date. we have recently reported a high seroprevalence, crossspecies infection and serological determinants of bcov in cattle, sheep and goats in ghana [ ] . in this study, we employed a molecular-based detection method to investigate the presence of bcovs in rectal samples of cattle, sheep and goats from four major regions in ghana. we also characterized, for the first time, the occurrence and the molecular phylogeny of the bcovs within the selected regions. the prevalence of bcov molecular detection of bcov was based on the use of the rna-dependent rna polymerase (rdrp) gene. the prevalence of bcov in the entire animal population was . % ( / , ) ( figs. and a) . out of the positive cases, were goats whereas was cattle (fig. b ). based on stratification by the sampling regions, the three bcov positive goats were from the upper east region while the bcov positive cattle was from the volta region (fig. c) . sequencing was performed on the partial rdrp region of the four bovine coronavirus isolates. the three goat sequences were identical to each other and were . % similar to the cattle sequence based on percentage sequence identity. there were three nucleotide substitutions between the goat sequences in comparison to the cattle sequence. comparing all sequences to a reference bovine coronavirus sequence from genbank (accession number: nc_ ) showed nucleotide substitutions at positions c > t and , t > a for the goat samples, and at , g > t, , c > t, , t > c and , g > a for the cattle sample. figure shows a cladogram constructed for all four bovine coronaviruses identified in goats and cattle. sequences obtained from this study formed one large monophyletic group with those from different species and countries. the goat sequences were similar to each other and clustered within the same clade. hence, no major variations were observed with our isolates and those from elsewhere. all sequences were submitted to ncbi and were assigned accession numbers mt to mt . in a prior study, we reported a high seroprevalence, cross-species infection and serological determinants of bcov in cattle, sheep and goats in ghana [ ] . we found the seroprevalence to be higher in cattle, followed by goats and sheep. for cattle, seroprevalence was significantly higher on larger farms and in the northern region of ghana, where the climate is relatively dry. in this study, we sought to investigate the presence of bcovs in rectal samples of cattle, sheep and goats from four major regions in ghana using molecular-based detection method. we also aimed to characterize the molecular phylogeny of the bcovs within the selected regions. this is the first report on molecular detection and phylogenetic analysis of bcov infection in both cattle and small ruminants in ghana. the molecular prevalence of bcov was . %. among the positive cases, . % were samples obtained from the upper east region whereas . % was from the volta region. greater accra and northern regions did not record positive cases. strikingly, upon stratification by animal type, three out of the four bcov positive cases were goats whereas one was cattle. no case was recorded in sheep. the prevalence of bcov in this study is lower compared to previous studies. a study by lojkić et al. in croatia ( ) found of the analyzed fecal and three nasal samples ( %) to be positive for bcov by rt-pcr [ ] . another study by kumar et al. in india reported . % ( / ) prevalence of bcov in cattle [ ] . the higher prevalence in these studies could be due to the fact that they considered only cattle that were symptomatic, presenting with diarrhea. this potentiates the likelihood of obtaining samples that are positive for bcov compared to large-scale randomized screening used in this study. studies by lathrop et al. [ ] , cho et al. [ ] , and hasoksuz et al. [ ] also reported a similarly high prevalence of bcov in the usa. other factors that could account for the lower prevalence in this study are the disparities in geographical location and timing of sampling relative to viral shedding. of note, bcov persists longer in lower temperatures and therefore is able to remain active in the environment all year round in temperate regions compared to the tropical region. additionally, differences in animal management systems between developing countries such as ghana and the developed countries could account for the differences in prevalence rates. smith et al. indicated that farm management systems have a significant influence on bcov infection rate [ ] . in ghana, the extensive and semi-intensive systems are largely practiced in cattle, sheep, and goats rearing. on the other hand, the feedlot system of management is a commonly practiced system in most developed countries. this system is a variant of intensive farming practice where animals are confined throughout the year. such relatively close confinement could enhance the transmissibility of bcov infection within herds or flocks, thus increasing the detection fig. bayesian majority-rule cladogram comparing partial and full length bcov rdrp obtained in the study to those from different species and countries rate of the virus. furthermore, bcov infection is generally self-limiting [ ] . viral shedding is transient and is known to last for only about days. given that sampling of this study was randomized, with almost all the animals included being asymptomatic, it is possible that sampling was done at a time when viral shedding had terminated. in ghana and many developing countries, different animals live in proximity to one another. there is thus the need to investigate cross-species infection because the close and sustained interaction between different animals poses an increased risk of spillover of communicable diseases between animals. however, globally, there are only a few studies evaluating the prevalence of bcov in non-cattle livestock [ ] [ ] [ ] [ ] [ ] . the presence of bcov in three goats out of the four bcov positive cases, thus, indicates a possible active infection and provides update information of spillover of bcov from cattle to small ruminants in ghana. it is instructive to state that in ghana, mixed farming (livestock) is what is largely practiced by farmers and this predispose animals to crossspecies infections. the higher prevalence of bcov observed in goats compared to cattle is interesting, especially when the number of cattle samples were higher than goat samples and the fact that bcov show tropism for cattle. this can be explained by the role of proximity in the spread of bcov. all the three bcov positive goats were from one farm in the upper east region (northern ghana) while the bcov positive cattle was from the volta region (southern ghana). additionally, these farms had mixed species. it is important to note that none of the animals which tested positive for bcov showed clinical signs at the time of sample collection. comparison of the nucleotide sequences obtained in this study with sequence data contained in the national center for biotechnology information (ncbi) genbank revealed no major differences. three of the four bovine coronavirus isolated were found in goats and one from cattle. sequences obtained from the goats (ghana goat - ) were similar to each other and clustered within the same clade. likewise, the sequence obtained from cattle (ghana cattle) was also similar to those from other countries. hence, no major variations were observed with our isolates and those from elsewhere. however, this finding corroborates our previous deposition of the possible interspecies transmission of bcov from cattle and wildlife to small ruminants [ ] . of note, given the relatively higher prevalence of bcov in goats compared to cattle, it will be important for future studies to consider sequence analysis of regions other than the highly conserved rdrp. this would be beneficial for phylogenetic analysis of bcov strains found in goats. given that ghana predominantly practice the extensive and semi-intensive systems of animal rearing, our study highlights the potential for spillover of bcov to small ruminants in settings with mixed husbandry and limited separation between species. this was a cross-sectional study conducted from january to december in ghana. animals included in this study consist of goats, sheep and , cattle from five different districts in ghana. a simple twostage cluster sampling technique was used as previously described [ ] . the districts included were north tongu in volta, bongo district in the upper east, ada west in greater accra and savelugu and wale wale in northern region. the number of farms and animal species from the four regions are shown in table . rectal swabs were collected from each animal using sterile swab sticks. the swabs were placed in pre-labeled cryotubes (sarstadt, nümbrecht, germany) containing a viral rna stabilization solution, rnalater (applied biosystems, foster city, ca, usa). samples were then transported to the kumasi centre for collaborative research (kccr) for storage at - °c prior to laboratory analysis. data and sample collection was done on the owners' farms and in their presence, after which animals were released back to the owners. less than % of all the animals sampled showed clinical signs such as diarrhea and animals f f f f f f f f f f f f cattle sheep goat grand total , f: farms; the three livestock from various households close to each other were pooled together to form a single farm respiratory distress except for high temperature which occurred in > of the animals [ ] . prior to rna extraction and subsequent laboratory analysis, rectal samples were thawed at room temperature and vortexed. this was followed by centrifugation at g for - min before aliquoting µl into new sterile tubes. testing of faecal swabs from cattle, sheep, and goats using rt-pcr viral rna extraction viral rna was extracted from all , samples using the spin protocol of the qiaamp viral rna mini kit (qiagen, hilden, germany) following the manufacturer's instruction. the rna was eluted in µl of buffer ave (pre-warmed at o c). the eluted rna was stored at - o c until they were tested for bcov using real-time polymerase chain reaction (rt-pcr). detection of bovine cov rna was carried out using one- step rt-pcr kit (qiagen, hilden, germany) and hcov-oc primers. the following thermal protocol was used: reverse transcription at °c for min, taq polymerase inactivation at °c for min, cycles of °c for secs, and °c for secs. amplification results were acquired at °c. the total volume of the qiagen one-step master mix was µl per sample comprised of rnasefree water ( . µl); onestep x buffer ( µl); dntp ( µl); forward primer ( µl); reverse primer ( µl); oc probe ( . µl); enzyme mix ( µl) and the µl of the rna template. the oligonucleotide sequences of the forward and reverse primers used for the amplification were cgatga ggctattccgactaggt and ccttcctgagcctt caatatagtaacc respectively, and the probe sequence used was tccgcctggcacggtactccct as previously described [ ] . all rna extracts were tested for host dna to determine successful nucleic acid purification prior to use in pcr testing. all bovine coronavirus positive samples were confirmed by means of -step reverse transcription-heminested pcr, using primers cov a-f (cttatgggttgggattatcc) and cov a-r (taataacagacaacgccatcatc) for the first round and the inner primers cov a-rnest a (ccat catcactcagaatcatca) and cov a-rnest b (ccat catcagaaagaatcatca) as previously described [ ] . this generated a -base pair amplicon from the rnadependent rna polymerase (rdrp) gene (additional file : original uncroppped gel image). the detection and sequence analysis were based on the rdrp region because it is a highly conserved region which will facilate broad detection capability across the betacoronavirus clade a. the pcr products were then prepared for sanger sequencing by mixing µl of the product with µl of exosap-it™ (thermo fisher, ma, usa) and incubated at o c for minutes. after this, the mixture was incubated at o c for minutes and then stored at o c until use. a volume of µl of each of these cleaned products was then pipetted into tubes and µl of rnase-free water added to each tube. a volume of µl of the forward primer was added to one tube and the same volume of nested reverse primers to the other tube to give a µl total volume per tube. sanger sequencing was done by seqlab gmbh, gÖttingen germany. all obtained sequences from seqlab were compared to sequences deposited on genbank via the blast algorithm and were aligned together with reference sequences from the genbank. a cladogram was constructed using bayesian inference which compared the partial bcov rdrp sequence obtained from this study to those from different species and countries. categorical data were presented as frequencies (percentages). analysis of sequence data was done using the online blast tool (http://blast.ncbi.nlm.nih.gov/blast.cgi) to identify homologous strains. construction of the phylogenetic tree was done by bayesian inference using mrbayes [ ] plugin in geneious prime (http:// www.geneious.com). graphical presentation was performed using graphpad prism version . (graphpad software, inc., la jolla, california usa). abbreviations bcov: bovine coronavirus; rdrp: rna-dependent rna polymerase; rt-pcr: reverse transcriptase polymerase chain reaction; ncbi: national center for biotechnology information the structure and functions of coronavirus genomic ′ and ′ ends bovine coronavirus in naturally and experimentally exposed calves; viral shedding and the potential for transmission distant relatives of severe acute respiratory syndrome coronavirus and close relatives of human coronavirus e in bats the molecular biology of coronaviruses bovine coronavirus associated syndromes. veterinary clinics: food animal practice a novel coronavirus associated with severe acute respiratory syndrome bovine coronavirus dual enteric and respiratory tropisms of winter dysentery bovine coronavirus in calves detection and molecular characterisation of bovine corona and toroviruses from croatian cattle detection and characterization of bovine coronaviruses in fecal specimens of adult cattle with diarrhea during the warmer seasons respiratory disease associated with bovine coronavirus infection in cattle herds in southern italy experimental reproduction of winter dysentery in lactating cows using bcv-comparison with bcv infection in milk-fed calves bovine respiratory coronavirus. veterinary clinics: food animal practice first report of bovine rotavirus and bovine coronavirus seroprevalance in goats in turkey. vet glasnik role of enteric pathogens in enteritis in lambs, goat kids and children and their zoonotic importance serum antibodies to bovine coronavirus in swedish sheep intestinal coronavirus-like particles in sheep with diarrhoea rotavirus and coronavirus associated diarrhoea in domestic animals sero-prevalence, cross-species infection and serological determinants of prevalence of bovine coronavirus in cattle, sheep and goats in ghana detection of bovine coronavirus in calf diarrheic samples by indirect antigen capture elisa and rt-pcr association between infection of the respiratory tract attributable to bovine coronavirus and health and growth performance of cattle in feedlots evaluation of concurrent shedding of bovine coronavirus via the respiratory tract and enteric route in feedlot cattle detection of respiratory and enteric shedding of bovine coronaviruses in cattle in an ohio feedlot epidemiologic herd-level assessment of causative agents and risk factors for winter dysentery in dairy cattle diagnosis and epidemiology of bovine coronavirus in swedish neonatal dairy and beef calves. th international congress of veterinary virology frequent detection of human coronaviruses in clinical specimens from patients with respiratory tract infection by use of a novel real-time reverse-transcriptase polymerase chain reaction. the journal of infectious diseases the differential clinical impact of human coronavirus species in children with cystic fibrosis. the journal of infectious diseases mrbayes: bayesian inference of phylogenetic trees the authors are grateful to the veterinary service directorates of upper east, northern, greater accra and volta regions of ghana, former graduate students on bat ii project, kumasi center for collaborative research, knust and all who actively participated in the study. authors' contributions cd, yas, as and mo designed the study, supervised the research and laboratory analysis, drafted and revised the manuscript. vb was involved in the collection of data, laboratory analysis, drafting and revision of the manuscript. ped, ry, jl, yof, oa, be, wt, so and ca were involved in the collection of data and laboratory analysis. ewo and ped was involved in the data analysis and interpretation, drafting and revision of the manuscript. rf was involved in the drafting and revision of the manuscript. all authors read and approved the final manuscript. this work was supported by deutsche forschungsgemeinschaft under a grant to yas. and cd (dr / − ). the funding body had no role in the design of the study, sample collection, statistical analysis and interpretation and writing of the manuscript. the datasets generated and/or analysed during the current study are accessible from figshare repository: https://doi.org/ . /m .figshare. .v . the sequence data are available at the national center for biotechnology information (ncbi) (genbank accession numbers: mt - ).ethics approval and consent to participate this study was approved by the wildlife division of the ghana forestry commission (approval number: ao ). written informed consent was obtained from all owners whose animals were used in the study. not applicable. the authors declare that they have no competing interests. key: cord- -o kffjw authors: shi, xibao; zhang, xiaozhuan; chang, yongzhe; jiang, bo; deng, ruiguang; wang, aiping; zhang, gaiping title: nonstructural protein (nsp ) of porcine reproductive and respiratory syndrome virus (prrsv) promotes prrsv infection in marc- cells date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: o kffjw background: porcine reproductive and respiratory syndrome virus (prrsv) induces one of most important devastating disease of swine worldwide, and the current methods poorly control it. previous studies have indicated that the nonstructural protein (nsp ) of prrsv may be an important protein for the immune escape of prrsv. results: here, we firstly explored the effect of over-expression of nsp on prrsv infection and found that over-expression of nsp enhanced the prrsv titers while the small interfering rna (sirnas) specifically targeting nsp could reduce the prrsv titers in marc- cells. conclusion: in conclusion, prrsv nsp promotes prrsv infection in marc- cells and sirnas targeting nsp may be a potential therapeutic strategy to control prrsv in future. background prrsv, a positive sense and single-stranded rna virus, is a member of family arteriviridae [ ] . since it was emerged in the united states in and in europe in , prrsv has rapidly spread in the swine producing regions and became one of the most important devastating diseases of swine worldwide. it can cause severe reproductive failure in sows and respiratory distress in young growing pigs [ ] . infection with prrsv also made pigs easy to secondary infection by other pathogens [ ] . up to date, since there is no efficient method or drugs against prrsv, it is very important and urgent to develop the effective therapeutic strategies to control prrs. the prrsv genome has nine open reading frames (orfs) composed of orf a, orf b, orf a, orf b, and orf - . orf a and orf b could produce nonstructural proteins (nsp α, nsp β, nsp etc.) [ ] [ ] [ ] [ ] . previous studies have shown that the nsp of equine arteritis virus(eav), which is another member of family arteriviridae, may play a key role in viral rna synthesis and additional functions in the viral life cycle [ ] . other and our previous work also demonstrated that prrsv nsp inhibited the host innate immune responses such as the transcription of type i interferon [ ] , the rnai innate immune response [ ] and the nlr family pyrin domain-containing (nlrp )-mediated production of il- β [ ] , which indicated that prrsv nsp may play an important role in prrsv infection. so the purpose of present study is to explore the effect of over-expression of nsp on prrsv infection and whether the sirnas targeting the prrsv nsp could influence prrsv infection. marc- cells, derived from a monkey fibroblast cell line ma- [ ] , and t cells were grown in dulbecco's modified eagle medium (gibco) plus % heatinactivated fetal bovine serum (hyclone). prrsv strain bj- was a kind gift from prof. hanchun yang (china agricultural university). the pcdna . -gfp-nsp plasmid was constructed by sub-cloning from the plasmid pcdna . -flag-nsp [ ] to pcdna . -gfp [ ] using the restriction endonuclease hind iii and ecori. the plasmids pcdna . -flag, pcdna . -flag-nsp and pcdna . -flag-nsp h a have been described in our previous work [ ] . all newly-prepared plasmids were confirmed correctly by dna sequencing. transient transfection was carried out by using lipofectamine (invitrogen). cells cultured in -well plates were transfected with the indicated expression plasmid or control vector ( ng/well) in triplicate. and h (h) later, the cells were infected with prrsv at a multiplicity of infection (moi) of . , and then the cells were lysed by freezing and thawing three times after h infection. the supernatants were collected by centrifugation, and the viral titers were detected by % tissue culture infected dose (tcid ) assay using the method of reed-muench in the marc- cells. the t cells were cultured in -well plates and transfected with pcdna . -gfp-nsp or pcdna . -gfp and nsp sirna ( nm) or control sirna ( nm) in triplicate, and h later, the cells were lysed with lysing buffer ( % nonidet p- , . % sodium deoxycholate, . % sds, mm tris-hcl (ph . ), mm nacl, mm edta, mm na vo , mm naf and a protease inhibitor cocktail). the detailed procedure for immunoblots has been described in our previous work [ ] . briefly, the proteins were separated by % sds-page and transferred to polyvinylidene difluoride (pvdf) membranes (millipore company, boston, massachusetts, usa), and then the pvdf membranes were incubated with anti-gfp (clontech) or anti-actin (cell signaling technology) antibodies. subsequently the membranes were incubated with appropriate secondary antibodies and were tested by an ecl detection system (cell signaling technology, boston, usa). cells cultured in -well plates were transfected with the indicated sirna in triplicate ( nm/well) (chemical synthesis by bioneer) (table. ). and h later, the cells were infected with prrsv strain bj- at an moi of . , and h later, the cells were lysed by freezing and thawing three times. the supernatants were collected by centrifugation, and the viral titers were detected by tcid using the method of reed-muench in the marc- cells. marc- cells cultured in -well plates were transfected in triplicate with nsp -sirnas/control sirna and plasmid pcdna . -gfp-nsp ( ng/well) or pcdna . -gfp ( ng/well). and h later, the cells were infected with prrsv at an moi of . , and h later, the cellular rna was extracted with trizol (invitrogen). m-mlv reverse transcriptase was used for the primescript™ rt reagent kit with gdna eraser (takara, dalian, china). quantitative real-time rt-pcr (qrt-pcr) was performed using sybr® premix ex taq™ (takara, dalian, china) and was tested by the first real-time pcr system (applied biosystems, foster city, ca, usa). glyceraldehyde- -phosphate dehydrogenase (gapdh) was used as an internal control. the −ΔΔct -method was used to analyze the relative amount of target gene expression. marc- cells transfected with the nsp sirna ( nm) or control sirna ( nm) and the plasmid pcdna . -gfp-nsp ( ng/well) or pcdna . -gfp ( ng/well), and h later, the cells were infected by prrsv at an moi of . , the cells were frozen and thawed in three cycles and collected after h infection. then the viral titers were determined by tcid assay using the method of reed-muench in the cells of marc- . statistical analyses were performed by student's t-test, and the differences were considered as statistical significance when p < . . firstly, we successfully constructed the expression plasmid of pcdna . -gfp-nsp (gfp-nsp ) and the western blot in fig. a confirmed the successful expression of gfp-nsp (fig. ) . secondly, the marc- cells were cultured in -well plates overnight, and then the cells were transfected with the expression plasmid pcdna . -gfp-nsp or the control plasmid pcdna . -gfp. the results in fig. b showed that the prrsv titers from the marc- cells transfected with pcdna . -gfp-nsp were about one point six times to that from marc- cells transfected with control plasmid, while the rna levels of prrsv from the marc- cells transfected with pcdna . -gfp-nsp were three times to that from marc- cells transfected with control plasmid (fig. c) . now that over-expression of nsp could enhance prrsv titers, it was reasonable to design sirnas targeting nsp to investigate whether the sirnas could reduce prrsv titers. the sequences of the sirna special for nsp and the control sirna were listed in table . t cells (fig. a) or marc- cells (fig. b ) grown in -well plates were co-transfected with the nsp sirna ( nm/well) or control sirna and the plasmid gfp-nsp ( ng/well). and h later, the cells in five random fields were analyzed by fluorescence microscopy ( ×) and only one of them was shown in fig. . the results in fig. showed that all of the three sirnas targeting nsp could inhibit the expression of gfp-nsp and didn't influence on the expression of gfp. finally, we selected two sirnas (sirna and sirna ) targeting nsp to determine whether sir-nas targeting nsp could reduce prrsv titers in marc- cell. the western blots results in fig. a confirmed that sirna and sirna could efficiently reduce the nsp expression in t cells (fig. a) . the results in fig. b and c showed that sirnas targeting nucleic acid sequence of nsp could significantly reduce viral titers of prrsv (fig. b) and reduce rna levels of prrsv (fig. c) . the endoribonuclease activity of nsp was important for nsp to enhance the prrsv titers our previous work has shown that the endoribonuclease activity of nsp was important for nsp to inhibit the transcription of ifn-β [ ] and the secretion of il- β [ ] . so next we investigated whether the endoribonuclease activity of nsp was important for nsp to promote the prrsv infection. nedialkova et al. showed that his- , his- , and lys- were the catalytic centers, and mutating one of the three amino acids could abolish its enzyme activity. the results in fig. showed that inactivating the endoribonuclease activity made nsp not promote the prrsv infection. nsp was a multi-functional protein. both our and other previous studies have shown that prrsv nsp is an interferon antagonist [ , ] and that nsp plays an important role in viral rna synthesis and in the viral life cycle [ ] . our recent work also demonstrated that prrsv nsp inhibited the rnai innate immune response [ ] and nlrp -mediated production of il- β [ ] . while our present work showed that over expression of prrsv nsp could enhance the titers of prrsv (fig. ) , so our present work gave a directly evidence that nsp was an important viral component for upregulating the prrsv titers. identification of and targeting viral important components is useful for developing viral vaccine and controlling the virus. for example, both the nonstructural protein of influenza virus and the nonstructural protein of mouse hepatitis virus (mhv) were important for the viral virulence respectively, and both the modified live-viral vaccines that deletion of nonstructural protein resulted in complete protection against challenge with influenza virus infection and mhv infection respectively [ ] [ ] [ ] . rna interference (rnai) is an exciting method to silence viral genes. inhibition of specific genes by sirna has proven to be a potential therapeutic strategy against viral infection [ ] , especially for the positive single stranded rna viruses since their genomes function as both the mrna and the replication template [ , ] . up to date, rnai has been used against several viruses such as hepatitis b virus, foot-and-mouth disease virus, dengue virus and so on [ ] [ ] [ ] . in this work, we also explore whether the sirna, which targeted the nucleic acid sequence of nsp , influenced the titers of prrsv, the endoribonuclease activity of nsp was important for nsp to enhance the prrsv titers. marc- cells cultured in -well plate were transfected with pcdna . -flag-nsp (nsp ) ( ng/well), pcdna . -flag-nsp h a (nsp h a) ( ng/ well) or pcdna . -flag (con). and h later, the cells were infected with prrsv at an moi of . or mock infected, and h later, the cells were lysed by freezing and thawing three times in three cycles, then the viral titers were measured by tcid . data represented means of three replicates, and experiments were repeated three times. error bars represented the standard deviations. *: p < . compared with the results in control. moi, multiplicity of infection and the results showed that sirna targeting nsp significantly reduced the titers of prrsv (fig. ) . a recent improved live prrsv vaccine has indicated that the orf a and orf b were the virulence determinants of prrsv [ ] . in addition, our recent work also show that rnai innate immune response was an antiviral response to prrsv and prrsv inhibited this response by prrsv nsp α and nsp , which indicated that targeting nsp would be useful for rnai innate immunity against prrsv [ ] . so it is reasonable to propose that our present results gave a new clue for generating the new prrsv vaccine by targeting prrsv nsp . in conclusion, our present study has shown that nsp was an important viral component for up-regulating the titers of prrsv and that sirnas directly targeting nsp could inhibit prrsv infection, which indicated that prrsv nsp may be an interesting target for controlling prrsv in future. abbreviations eav, equine arteritis virus; gapdh, glyceraldehyde- -phosphate dehydrogenase; gfp-nsp , pcdna . -gfp-nsp ; mhv, mouse hepatitis virus; moi, multiplicity of infection; nlrp , nlr family pyrin domain-containing ; nsp , nonstructural protein ; orf, open reading frame; prrsv, porcine reproductive and respiratory syndrome virus ; pvdf, polyvinylidene difluoride; qrt-pcr, quantitative real-time rt-pcr; rnai, rna interference; sirna, small interfering rna; tcid , % tissue culture infected dose nidovirales: a new order comprising coronaviridae and arteriviridae general overview of prrsv: a perspective from the united states the challenge of prrs immunology equine arteritis virus is not a togavirus but belongs to the coronaviruslike superfamily identification of two auto-cleavage products of nonstructural protein (nsp ) in porcine reproductive and respiratory syndrome virus infected cells: nsp function as interferon antagonist processing and evolution of the n-terminal region of the arterivirus replicase orf a protein: identification of two papainlike cysteine proteases endoribonuclease activities of porcine reproductive and respiratory syndrome virus nsp was essential for nsp to inhibit ifn-beta induction site-directed mutagenesis of the nidovirus replicative endoribonuclease nendou exerts pleiotropic effects on the arterivirus life cycle porcine reproductive and respiratory syndrome virus (prrsv) inhibits rna-mediated gene silencing by targeting ago- the endoribonuclease activity essential for the nonstructural protein of porcine reproductive and respiratory syndrome virus to inhibit nlrp inflammasomemediated il- beta induction enhanced replication of porcine reproductive and respiratory syndrome (prrs) virus in a homogeneous subpopulation of ma- cell line the zinc-finger domain was essential for porcine reproductive and respiratory syndrome virus nonstructural protein- alpha to inhibit the production of interferon-beta dynamic balance of pstat and pstat in c bl/ mice infected with lethal or nonlethal plasmodium yoelii porcine reproductive and respiratory syndrome virus nonstructural protein beta modulates host innate immune response by antagonizing irf activation vaccination of pigs against swine influenza viruses by using an ns -truncated modified live-virus vaccine a novel type of influenza vaccine: safety and immunogenicity of replication-deficient influenza virus created by deletion of the interferon antagonist ns coronavirus non-structural protein is a major pathogenicity factor: implications for the rational design of coronavirus vaccines rna interference: the story of gene silencing in plants and humans administration of e and ns sirnas inhibit chikungunya virus replication in vitro and protects mice infected with the virus rnai: antiviral therapy against dengue virus targeted delivery of sirna against hepatitis b virus by pres peptide molecular ligand inhibition of foot-and-mouth disease virus replication by small interfering rna attenuation of porcine reproductive and respiratory syndrome virus strain mn using chimeric construction with vaccine sequence we would like to thank prof. hanchun yang for providing prrsv strain bj- . availability of data and materials all datasets are available in the main manuscript. authors' contributions sx, zx, zg designed the study, sx, zx and cy performed the experiments and wrote the paper, and wa, jb and dr performed statistical analysis. all authors read and approved the final manuscript. the authors declare that they have no competing interests. our present work does not contain any individual persons' data, so it is not applicable.ethics approval and consent to participate our present work didn't use animals.• we accept pre-submission inquiries • our selector tool helps you to find the most relevant journal submit your next manuscript to biomed central and we will help you at every step: key: cord- -lwirkob authors: yan, liping; hu, jianhua; lei, jing; shi, zhiyu; xiao, qian; bi, zhenwei; yao, lu; li, yuan; chen, yuqing; fang, an; li, hui; song, suquan; liao, min; zhou, jiyong title: novel protein chip for the detection of antibodies against infectious bronchitis virus date: - - journal: bmc vet res doi: . /s - - -x sha: doc_id: cord_uid: lwirkob background: infectious bronchitis (ib) caused by the ib virus (ibv) can cause acute damage to chickens around the world. therefore, rapid diagnosis and immune status determination are critical for controlling ibv outbreaks. enzyme-linked immunosorbent assays (elisas) have been widely used in the detection of ibv antibodies in the early infection and continuous infection of ib because they are more sensitive and quicker than other diagnostic methods. results: we have developed two indirect microarray methods to detect antibodies against ibv: a chemiluminescent immunoassay test (cit) and a rapid diagnostic test (rdt). ibv nonstructural protein (nsp ) was expressed, purified from escherichia coli, and used to spot the initiator integrated poly(dimethylsiloxane), which can provide a near “zero” background for serological assays. compared with the idexx ibv ab test kit, cit and rdt have a sensitivity and specificity of at least . % and . %, respectively. no cross-reaction was detected with antibodies against avian influenza virus subtypes (h , h , and h ), newcastle disease virus, marek’s disease virus, infectious bursal disease virus, and chicken anemia virus. the coefficients of variation of the reproducibility of the intra- and inter-assays for cit ranged from . to . %. the reproducibility of rdt was consistent with the original results. the application of the ibv nsp protein microarray showed that the positive rate of the cit was . %, that of the nsp elisa was . %, and that of the rdt was . %. furthermore, the rdt, which was visible to the naked eye, could be completed within min. our results indicated that compared with nsp elisa, the cit was more sensitive, and the rdt had similar positive rates but was faster. furthermore, the two proposed methods were specific and stable. conclusions: two microarray assays, which were rapid, specific, sensitive, and relatively simple, were developed for the detection of an antibody against ibv. these methods can be of great value for the surveillance of pathogens and monitoring the efficiency of vaccination. infectious bronchitis (ib) is an acute, highly contagious, and economically important respiratory disease in chickens; it is caused by the ib virus (ibv), which is a significant respiratory pathogen that causes considerable economic losses in the commercial poultry industry worldwide [ ] . the ibv genome is a single-stranded, positive-sense rna that is . kb in size [ ] . it encodes four major structural proteins, namely, glycosylated spike protein (s), membrane protein (m), phosphorylated nucleoprotein (n), and envelope protein (e) [ ] , and nonstructural proteins (nsp -nsp ). generally, nonstructural proteins are present in infected cells but not in the virus, and they only play a role in the process of virus infection and replication [ ] . chickens immunized with an inactivated vaccine will produce no antibodies or low levels of antibodies against viral nonstructural proteins. thus, nonstructural proteins have the potential application in differentiating natural infection from inactivated vaccine immunity [ ] . ib diagnosis is complicated due to the continual emergence of new serotypes [ ] and the difficulty in differentiating ib from other upper respiratory diseases [ ] . virus isolation is regarded as the gold standard for the diagnosis of ibv infection, but it is time-consuming and costly [ ] . the agar gel precipitation test is used in ibv antibody detection; however, this method has low sensitivity. hemagglutination inhibition (hi) assays are suitable for the rapid diagnosis of ib, which requires a series of methods to treat the antigen; however, the hi titer is not related to protection. the virus neutralization test correlates with protection and has the highest specificity among ib diagnostic methods, but it is tedious and laborious [ ] . compared with these methods, enzyme-linked immunosorbent assay (elisa) has been widely used for testing ibv early infection and continuous infection, and this technique can be used for both antigenic and antibody detection. the immunogenicity of the coating antigen is one of the crucial factors when performing an elisa test for antibody detection. an inactivated whole virus is the most commonly used coating antigen in commercial diagnosis kits for ibv diagnosis. recombinant antigenic protein expressed using prokaryotic, yeast, or baculovirus systems has been widely used in preparing specific coating antigens for elisa kits [ ] [ ] [ ] [ ] . elisas based on purified recombinant protein may have higher specificity and sensitivity as the target antigen is immune-dominant and devoid of any nonspecific immune responses [ ] . elisas based on whole virus particles as well as recombinant s (spike protein subunit) and n proteins (nucleoproteins) can provide a rapid and large-scale detection method for ibv infection. however, few ibv detection methods have been developed based on nonstructural proteins (nsps). our laboratory has established an nsp elisa to detect ibv infection [ ] . the nsp antibodies detected are likely to be non-neutralizing and exist in lower numbers than the ones generated by other proteins. based on previous studies, we developed a rapid, highly sensitive protein microarray and a visible detection method to detect ibv nsp antibodies for epidemiological investigation and antibody level monitoring. initiator integrated poly(dimethylsiloxane) (ipdms) membrane ( in this study, clinical serum samples were collected from a chicken farm. forty-two negative sera were obtained from different ages of specific-pathogen-free (spf) chickens raised in spf isolators in zhejiang university. three-month-old spf chickens, which were purchased from shennong company (zhejiang, china) and reared in spf isolators, were used to prepare negative serum and positive serum. we prepared standard positive serum samples from chickens infected with h , h , and h avian influenza virus (aiv); newcastle disease virus (ndv); ibv; infectious bursal disease virus (ibdv); and chicken anemia virus (cav). a microarray was prepared in a , -grade clean room. proteins were first dissolved with % acetonitrile solution (v/v, in milli-q water) to mg/ml stock solution and then diluted into the optimized concentration ( μg/ml) with printing buffer ( . m phosphate buffer, . % glycerin, . % triton x- , and . % mannitol) for further printing. ipdms membranes were first activated with . m edc and . m nhs mixtures for min, rinsed with milli-q water, and immediately used for printing. to determine the optimal antigen concentration, the protein was diluted with . m phosphate buffer to different concentrations. each dilution of protein was printed on ipdms using a protein microarray (scienion, germany). once the antigen concentration was determined, the optimized concentration of nsp was achieved by dilution with printing buffer and printed on ipdms for subsequent experiments in triplicate. the protein microarray was prepared using the smartarrayer contact printer (capitalbio, china) with approximately . nl of printing solution for each sample. each subarray had a positive control with chicken-igy at a concentration of . mg/ml and negative control with printing buffer. the procedure for the cit is shown in fig. . serum samples were first diluted with serum-dilution buffer ( % bovine serum albumin, % casein, . % sucrose, . % polyvinylpyrrolidone, . % tween in . m phosphate-buffered saline, ph = . ). in total, μl of the diluted serum samples was then added into each protein microarray and incubated for min on a shaker (thermo fischer, usa) at rpm and °c. microarrays incubated with serum-dilution buffer were used as negative controls. each microarray was then rinsed thrice with washing buffer and incubated with μl of mg/ml hrp-igg diluted : , in peroxidase conjugate stabilizer/diluent for another min on the shaker ( rpm, °c), followed by the same washing steps described above. a total of μl of the chemiluminescent substrate was added to the microarray, and images were taken at a wavelength of nm with the amersham imager (ge, usa). chemiluminescent signals were acquired using genepix pro . software, and the signal-to-noise ratio (snr) was calculated. the purified recombinant nsp was printed on the ipdms membrane to form a microarray with a concentration of . , . , . , and . mg/ml. subsequently, the serum samples were added to microplates at the following dilutions: : , : , : , : , : , : , : , and : . to identify the optimal time of exposure, the images were taken at an exposure time of s, min, min, min, and min. to determine the cit threshold, a total of serum samples, including positive samples and negative samples, identified by the idexx ibv ab test kit were tested according to the optimal working conditions. results were then compared with those obtained using the idexx ibv ab test kit. finally, receiver operating characteristic (roc) curve analysis was conducted to determine the accuracy of the ibv protein microarray test. the specificity of the cit was evaluated by detecting the positive sera against aiv (h , h , and h ), ndv, mdv, ibdv, and cav. the evaluation of the cit reproducibility within and between runs was carried out as described by jacobson [ ] . thirteen field serum samples (nine idexx positive samples and four idexx negative samples) were selected for the reproducibility experiments. for intra-assay reproducibility, three replicates of each serum sample were analyzed within the same plate. for inter-assay reproducibility, three replicates of each sample were run in different plates. the mean snr, standard deviation (sd), and coefficient of variation (cv) were then calculated. the procedure of the rdt is also shown in fig. . serum was first diluted : with serum-dilution buffer, and μl of the diluted serum sample was added into each protein microarray and incubated for min on a shaker ( rpm, °c). the microarray incubated with serum-dilution buffer was used as a negative control. the microarray was then rinsed thrice with washing buffer and incubated with μl of mg/ml hrp-igg diluted : in peroxidase conjugate stabilizer/diluent for another min on a shaker ( rpm, °c), followed by the same washing steps described above. a total of μl of tmb was added to the microarray and incubated for min in the dark; then, the results were observed. to confirm the concentration of the nsp protein in the rdt, the purified recombinant nsp was printed on an ipdms membrane to form a microarray with concentrations of . , . , . , and . mg/ml. the specificity of the rdt was evaluated by detecting the positive sera against aiv (h , h , and h ), ndv, mdv, ibdv, and cav. the sensitivity experiments of the rdt were conducted by detecting the ibv positive serum with different titers. then, the results were observed, and the detection limit was determined. to further evaluate the cit and rdt, clinical serum samples were detected by the cit, rdt, and nsp elisa antibody test kit [ ] . subsequently, the positive rate of each method was determined. step , the prepared chip was rinsed thrice with pbst; step , μl of diluted serum was added and incubated on a constant temperature oscillator and then washed with pbst thrice; step , μl of goat anti-chicken igy conjugated to hrp was added, and the plate was incubated on a constant temperature oscillator and washed with pbst thrice; step , for chemiluminescence, μl of chemiluminescent substrate was added to each well, and images were taken at a wavelength of nm with amersham imager ; step , for rdt, μl of tmb was added to each well and incubated for min in a dark place; then, the results were observed chemiluminescent signals were acquired using gene-pix, and the snr was calculated as follows: snr = (signal intensity − background)/background. graph-pad prism and microsoft excel were used for the statistical analysis of all data, including the determination of the threshold and the calculation of the snr value, means, sds, and cvs. the roc curve was obtained using graphpad prism . sensitivity and specificity were calculated according to the following formulas: sensitivity = true positive/(true positive + false negative) × %; specificity = true negatives/(false positives + true negatives) × %. the area under the curve (auc) was used to validate the diagnostic application of the cit. the area under the roc curve quantifies the overall ability of the test to discriminate between those individuals with the disease and those without the disease. a truly useless test (one no better at identifying true positives than flipping a coin) has an auc of . , whereas a perfect test (one that has zero false positives and zero false negatives) has an auc of . for the cit, the optimal antigen concentration was . mg/ml (fig. a, b) , and the dilution for the serum samples was : (fig. c, d) , on the assumption that the snr between the positive and the negative sera was the highest. the dilution of the hrp-conjugated goat anti-chicken antibody was defined as : , . when the exposure time was more than min, the snr of the negative serum rose rapidly; thus, we set the exposure time to min (fig. ) . roc analysis showed that the ibv nsp microarray had high selectivity (p < . ) between the positive and the negative samples, and the auc was . (fig. a) . based on the roc analysis of the ibv nsp microarray, the snr value of the idexx-negative serum samples varied from a minimum of . to a maximum of . , whereas the snr value of the idexx-positive serum samples was from a minimum of . to a maximum of . (fig. b) . a threshold snr value of for ibv nsp microarray was found to provide optimal results, with a (table ) . thus, the samples with snr < were considered negative, whereas those with snr ≥ were considered positive. the specificity of the cit was evaluated by detecting the cross-reactivity of the antibodies against aiv (h , h , and h ), ndv, mdv, ibdv, and cav. the snrs of all sera from the previously mentioned viruses were all below the threshold of . these data revealed that no cross-reactivity occurred between the ibv gst-fused nsp antigen and antibodies against other avian viruses. this result demonstrated that the antigen has a high specificity. the reproducibility of the cit detection was determined by comparing the snr value of each clinical serum sample from the below tests. the within-plate cvs of nine positive and four negative serum samples tested ranged from . to . % (table ) , whereas the between-run cvs of these serum samples ranged from . to . % (table ). these results showed that the cit detection results were reproducible and had low and acceptable variation. one hundred and forty-four clinical serum samples ( samples were positive for antibodies against ibv, and samples were negative as confirmed by the idexx ibv ab test kit) were subjected to visual rapid detection following the procedure described above. the data showed that serum samples were positive for antibodies against ibv, and samples were negative, similar to the results of the idexx ibv ab test kit with the nsp concentration of . mg/ml (table ). if ibv antibodies exist in the serum, the spot with the ibv antigen turns blue, thereby allowing us to determine the concentration of nsp as . mg/ml. the specificity of the rdt was evaluated by detecting the cross-reactivity of antibodies against aiv (h , h , and h ), ndv, mdv, ibdv, and cav. the specific experiments of the rdt showed that no cross-reaction fig. a distribution of the snrs of the idexx-positive (n = ) and idexx-negative (n = ) serum samples of the clinical sera obtained from the ibv protein microarray. the threshold was defined as . the diagnostic sensitivity and specificity of the assay were greater than %. b roc curve obtained with graphpad prism software with positive (n = ) and negative (n = ) samples. the auc was . , indicating that the ibv protein microarray is a reliable test occurred between the ibv gst-fused nsp antigen and the antibodies against other avian viruses. the sensitivity experiments demonstrated that when the positive serum was diluted : , the spot still turned blue (fig. ) . (table ). most serological assays, including the idexx elisa kit, use viral particles of ibv as an antigen for the detection of antibodies against ibv. however, the preparation of purified virions for use as an antigen is time-consuming and expensive. in the present study, recombinant nonstructural proteins expressed in escherichia coli antigen-based protein microarray was evaluated for the first time in the serological diagnosis of ib [ ] . protein microarrays have high sensitivity and good reproducibility in quantitative and qualitative assays, and they are a valuable asset when analyzing complex biological samples [ ] . in clinical sample testing, many factors, including time, cost, accuracy, sensitivity, and throughput, determine the performance and usefulness of an immunoassay. in this study, a new solidly supported material, ipdms membrane, which has a near "zero" background for identification, was used. it achieved high sensitivity in detecting antibodies in serum [ ] . these unique features of ipdms not only simplify data analysis but also reduce nonspecific interactions [ ] . elisa detection has been widely used in the detection of ibv antibodies in early infection and continuous infection of ib and vaccine-immune, and no diagnosis method is more sensitive and quicker than elisa. in this study, two microarray methods (cit and rdt) were established. except for the method of the observation, the reaction processes of the two methods are akin to the detection process of elisa. however, unlike elisa, the established methods only require ng of antigen coating on each spot, and the amount of hrp-igg required for each reaction well is only ng. the antigen and hrp-igg used in both methods were less than those used in elisa, thereby reducing the cost of detection. in addition, the cit can detect antibodies against ibv nsp quantitatively and is more sensitive than the ibv nsp elisa kit. the rdt was developed to detect antibodies against ibv visually, and the results can be obtained within min with great sensitivity and specificity. compared with elisa, rdt has a shorter detection time and better detection efficiency. in this study, we only used one antigen of ibv for testing and verification. in the future, we will apply antigens of different diseases to ipdms to achieve high-throughput test results. for the establishment of the ibv nsp protein chip, we first optimized the procedure and determined the cit threshold as with the idexx ibv antibody detection kit. with the threshold of , the cit showed high sensitivity ( . %), specificity ( %), and accuracy ( . %) in the antibody detection of the samples compared with those of other thresholds ( table ). the rdt demonstrated a high success rate compared with the commercial idexx ibv ab test kit, suggesting that the rdt is a reliable assay for the detection of ibv infection. clinical serum samples were also subjected to rapid detection. furthermore, the rdt has higher sensitivity than the commercial idexx ibv ab test kit. it is also simpler and faster than elisa methods. to further evaluate ibv nsp protein chip, clinical serum samples were detected by the ibv nsp protein chip and the nsp elisa antibody test kit. the positive rates of the cit, nsp elisa, and rdt were . %, . %, and . %, respectively. compared with nsp elisa, the cit was more sensitive, and the rdt had similar positive rates but was faster. protein chips are a high-throughput monitoring system that monitors the interaction among protein molecules through the interaction between a target molecule and a capture molecule. although protein chips have been produced in the context of proteomics research, its application is not limited to proteomics alone. with the development of protein chip technology, researchers have gradually applied this technology to other fields, such as food inspection, disease diagnosis, drug screening, agriculture, forestry, animal husbandry, and forensic science. at present, this technology is rarely studied and applied in veterinary medicine. high throughput is an [ , ] and enable their use for determining antibody responses to infectious diseases [ ] . in the future, we will print recombinant antigenic proteins of different avian viruses to achieve high-throughput detection results with the same serum. the nsp protein chips were developed for the detection of antibodies against ibv. these assays are comparable to the commercial idexx ibv ab test kit in terms of sensitivity and specificity. the rdt can generate results within min and may be a suitable alternative to screen for the presence of ibv in chickens. raw data is available from the corresponding author on reasonable request. authors' contributions lpy, jhh, and jl performed the experiments, interpreted the results, and drafted the manuscript. lpy, zys, and qx analyzed the data. zwb, ly, yl, yqc, af, and hl collected the clinical samples. sqs and ml analyzed the data and revised the manuscript. lpy and jyz designed the study, analyzed the data, and revised the manuscript. all authors reviewed the results and approved the final version of the manuscript. this study was performed in accordance with the recommendations in the guide for the care and use of laboratory animals of the ministry of health, china. the protocol of the current study was reviewed and approved by the institutional animal care and use committee of nanjing agricultural university (approval no. syxk - ). written informed consent to use clinical serum samples, which were collected from a chicken farm, were obtained from the owner of the animals. all efforts were made to minimize animal suffering during sample collection. not applicable vaccination against infectious bronchitis virus: a continuous challenge completion of the sequence of the genome of the coronavirus avian infectious bronchitis virus the molecular biology of coronaviruses development and application of nsp -elisa for the detection of antibody to infectious bronchitis virus the longevity of anti nsp antibodies and the sensitivity of a abc elisa -a years follow up of repeatedly vaccinated dairy cattle infected by foot and mouth disease virus an emerging recombinant cluster of nephropathogenic strains of avian infectious bronchitis virus in korea fine level epitope mapping and conservation analysis of two novel linear b-cell epitopes of the avian infectious bronchitis coronavirus nucleocapsid protein antigenic variation in strains of avian infectious bronchitis virus. archiv fur die gesamte virusforschung evaluation of four enzyme linked immunosorbent assays for the detection of antibodies to infectious bursal disease in chickens development and application of a saccharomyces cerevisiae-expressed nucleocapsid protein-based enzyme-linked immunosorbent assay for detection of antibodies against infectious bronchitis virus evaluation of a nucleoprotein-based enzyme-linked immunosorbent assay for the detection of antibodies against infectious bronchitis virus identification, expression and antigenic analysis of recombinant hemagglutinin proteins of canine distemper virus application of purified recombinant antigenic spike fragments to the diagnosis of avian infectious bronchitis virus infection recombinant lipl antigen-based single serum dilution elisa for detection of canine leptospirosis validation of serological assays for diagnosis of infectious diseases overview of protein microarrays integrated poly(dimethysiloxane) with an intrinsic nonfouling property approaching "absolute" zero background in immunoassays initiator integrated poly(dimethysiloxane)-based microarray as a tool for revealing the relationship between nonspecific interactions and irreproducibility the analysis of doxorubicin resistance in human breast cancer cells using antibody microarrays protein microarrays: potentials and limitations antigen microarrays for serodiagnosis of infectious diseases the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. key: cord- -qdfrjvu authors: pomorska-mól, małgorzata; markowska-daniel, iwona; kwit, krzysztof; stępniewska, katarzyna; pejsak, zygmunt title: c-reactive protein, haptoglobin, serum amyloid a and pig major acute phase protein response in pigs simultaneously infected with h n swine influenza virus and pasteurella multocida date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: qdfrjvu background: swine influenza (si) is an acute respiratory disease caused by swine influenza virus (siv). swine influenza is generally characterized by acute onset of fever and respiratory symptoms. the most frequent complications of influenza are secondary bacterial pneumonia. the objective of this work was to study the acute phase proteins (app) responses after coinfection of piglets with h n swine influenza virus (swh n ) and pasteurella multocida (pm) in order to identify whether the individual app response correlate with disease severity and whether app could be used as markers of the health status of coinfected pigs. results: in all coinfected pigs clinical sings, including fever, coughing and dyspnea, were seen. viral shedding was observed from to dpi. the mean level of antibodies against pm dermonecrotoxin in infected piglets increase significantly from dpi. anti-swh n antibodies in the serum were detected from dpi. the concentration of c-reactive protein (crp) increased significantly at dpi as compared to control pigs, and remained significantly higher to dpi. level of serum amyloid a (saa) was significantly higher from to dpi. haptoglobin (hp) was significantly elevated from dpi to the end of study, while pig major acute phase protein (pig-map) from to dpi. the concentrations of crp, hp and saa significantly increased before specific antibodies were detected. positive correlations were found between serum concentration of hp and saa and lung scores, and between clinical score and concentrations of pig-map and saa. conclusions: the results of current study confirmed that monitoring of app may revealed ongoing infection, and in this way may be useful in selecting clinically healthy pigs (i.e. before integration into an uninfected herd). present results corroborated our previous findings that saa could be a potentially useful indicator in experimental infection studies (e.g. vaccine efficiency investigations) or as a marker for disease severity, because of correlation observed between its concentration in serum and disease severity (lung scores, clinical scores). the acute phase response is an unspecific systemic reaction of the organism that occurs after infection or inflammation [ ] [ ] [ ] [ ] . this reaction includes changes in the concentrations of some plasma proteins called acute phase proteins (apps) [ , ] . changes of app concentration in pigs serum have been extensively investigated during last years - but, to the best of our knowledge, no studies related to the app behavior following influenza virus and pasteurella multocida (pm) coinfection has been reported. respiratory diseases in pigs are often considered as multifactorial problems caused by various pathogens (viral and bacterial) in combination. the most common infectious agent responsible for respiratory infection in pigs are: swine influenza virus (siv), porcine reproductive and respiratory syndrome virus (prrsv), pasteurella multocida (pm), actinobacillus pleuropneumoniae, mycoplasma hyopneumoniae [ , ] . these pathogens may act together to increase the severity and duration of the disease. in pigs, as well as in humans, bacterial pneumonia secondary to influenza is often observed [ ] and siv is an important contributor to the porcine respiratory disease complex (prdc). the bacterial pathogens associated with prdc are classified as primary or secondary pathogens, and pm plays a key role as a secondary invader [ ] . up to now the kinetics of acute phase response after experimental infection of pigs with siv or pm alone have been investigated [ , , , ] . exposure to multiple pathogens may result in different kinetics of app response, as compare to monoinfection with siv or pm. in this study the immune and c-reactive protein (crp), haptoglobin (hp), serum amyloid a (saa) or/ and pig major acute phase protein (pig-map) responses after simultaneous co-infection with common porcine pathogens: siv (h n subtype) and pm were evaluated in piglets. the correlation between concentration of investigated app in serum and severity of infection (clinical score, lung score, turbinate score) were also studied, to estimate the utility of app measurement in the evaluation of pigs health status. in all coinfected pigs clinical sings including fever, coughing, nasal discharge, dyspnea and anorexia were observed. in all infected animals the rectal temperature increased over °c (figure ). clinical score ranged between and . in the control pigs no clinical signs of any disease were seen. in all inoculated pigs necropsied at dpi atrophy of turbinates was observed (mean ts = . ± . , range ( . - . ) ( figure ). in pigs euthanized at or dpi no clear macroscopic changes in the turbinates were observed. postmortem examination revealed also macroscopic lesions in the lungs of / infected pigs. the mean lung score was % ± . % (range - %) ( figure ). there were no significant differences between lung score observed at different days post inoculation. in coinfected pigs, the overall number of leukocytes increased significantly during study and ranged from . × /l at dpi to . × /l at dpi (p< . ). in control pigs total number of leukocytes ranged from . × /l to . × /l. the number of lymphocytes remained relatively stable, while the number of granulocytes increased significantly from . × /l at dpi to . × /l at dpi (p< . ) and then decreased to . at dpi ( figure a ). the mean percentages of lymphocytes were the lowest at and dpi, and reached . % and . % respectively, while on day the percentage of lymphocyte reached over % figure rectal temperature of pigs coinfected with swine influenza subtype h n virus and pasteurella multocida. ( figure b ). in control piglets the mean concentration as well as percentage of lymphocytes remained stable and ranged from . × /l to . × /l and from % to %, respectively. in infected pigs a significant increase in the percentage of granulocytes was observed from to and dpi (from . % to almost %) (p< . ). additionally, a significant increase of mean concentration of medium-sized (mid) cells, from . at dpi to . × /l, (represented mainly by monocytes) was observed at dpi (p< . ). humoral immune response to swh n and pasteurella multocida dnt all infected pigs exhibited specific antibodies against hemagglutinin from dpi; the hi titre ranged from to ( figure a ). sera from control pigs had no antibody titres (< hi titre). the mean level of anti-dnt ab started to increase significantly from dpi in infected pigs as compared to controls, and tended to increase till the end of study ( dpi) ( figure b ). real-time rt-pcr assay, used to confirm the presence of siv in the nasal swabs revealed positive results from all infected pigs between and dpi. at dpi positive results were found only in out of infected pigs. in the nasal swabs taken before inoculation no siv genetic material was found. in all infected pigs, euthanized at and dpi, the presence of siv was confirmed for the trachea as well as middle lobes of the lungs. in three piglets, the occurrence of siv was also confirmed for apical and accessory lobes. no viral rna was found in diaphragmatic lobes. no viral rna was detected in lungs on day post inoculation the results of the bacterial isolation, identification of pm genes encoding dnt with the use of the pcr technique, and results of the real-time rt-pcr assay, used to confirm the presence of siv in samples taken from infected pigs, are given in table . in the nasal swabs taken before inoculation, no dnt producing pm were found (bacteriological examination and pcr test). with the use of standard bacteriological method the presence of pm was confirmed in out of swabs, while with the use of pcr in out of swabs, taken after coinfection. in control pigs no genetic material of toxigenic pm and swh n were found at any time points. all investigated app increased significantly after coinfection, with mean maximum concentration from day to figure ). in the control pigs levels of investigated app remained relatively constant. prior to inoculation, experimental pigs had crp serum concentration below μg/ml (mean . ± . ). twenty four hour after coinfection the mean concentration of crp reached . ± . μg/ml. significant difference, as compared to control animals, were seen between and dpi (p< . ). the maximum mean level was observed at dpi and reached . ± . μg/ml (over -fold increase). starting from dpi after coinoculation, the mean concentrations of crp did not differ significantly from that observed in the control pigs (p ≥ . ). preinoculation individual levels of hp were found to be below . mg/ml. the highest individual level after coinfection reached . mg/ml (at dpi). in all coinfected pigs the significant changes in the concentration of hp were observed during study. the mean concentration of hp had increased by h after coinoculation and from that time-point were significantly higher as compared to control pigs (p< . ). the highest mean concentrations of hp were observed at dpi. the mean peak level was over -fold higher, as compared to the mean preinoculation concentration. significant increase of saa after coinfection, as compared to the control pigs, was observed only at and dpi (p< . ). during first h after inoculation the increases of saa concentration was not significant as compared to control pigs (p> . ). the mean peak level reached . ± . μg/ml, this was almost -fold higher compared to day -level. from dpi the saa concentration had decreased and did not differ from those observed in control animals. preinoculation levels of pig-map were found to be below . mg/ml (mean . mg/ml ± . ). concentration of pig-map increased significantly h after coinfection (p< . ) and remained significantly elevated till dpi. the highest pig-map concentrations in particular pigs were detected between to dpi. the maximum mean concentration of pig-map, observed at dpi in coinfected piglets, was almost times higher as compared to day -level. from dpi the pig-map concentrations had decreased and did not differ significantly between control and infected pigs. significant positive correlations were found between maximal concentration of hp and saa and lung scores (respectively r = . and r = . , p< . ). positive correlation was also observed between maximum concentration of pig-map in serum and turbinate score (r = . , p< . ) and between clinical score and pig-map and saa maximal concentrations in the serum (r = . and r = . , p< . , respectively). swine influenza is generally characterized by acute onset of fever and respiratory symptoms [ ] . the most frequent complications of influenza are secondary bacterial pneumonia. pasteurella multocida is believed as a major bacterial agent that complicates swine influenza virus infections, and still remains the most common respiratory bacterium isolated in cases of prdc [ , ] . pasteurella multocida is considered to be an opportunistic invader that could be cleared from the lungs of normal pigs [ ] , but siv-induced damage to the respiratory tract (loss of cilia, extrusion of mucus, exudation, necrosis and metaplasia of airway epithelium) reduced ability to clear the infection [ , ] . previous study conducted on turkey revealed that in birds infected with avian influenza virus (aiv), the numbers of pm in their respiratory tracts increased to a greater extent than in birds which had not been infected with the aiv [ ] . until now there have been no reports published on the kinetics of acute-phase response after coinfection of pigs with siv and pm, even though this coinfection is often found in the field conditions [ ] . only reports dealing with analyses of app response in pigs monoinfected with pm or siv have been published to date [ , , , , ] . after intranasal simultaneous coinfection of pigs with swh n and pm various kinetics of responses could be recognized within the app tested. the concentration of crp increased significantly at dpi as compared to control pigs, and remained significantly higher to dpi. level of saa was significantly induced from to dpi. haptoglobin was significantly elevated from dpi to the end of study, while pig-map from to dpi. the concentrations of crp, hp and saa significantly increased before specific antibodies were detected. the significant increase in the concentration of crp, hp, saa and pig-map have been also found previously in pigs infected with pm only (the same strain and similar dose of pm was used) [ ] . however, in pm monoinfection the concentration of crp was higher, as compared to control pigs, only at dpi. the mean maximum concentration of crp in pm-infected pigs was lower than in coinfected piglets ( . μg/ml and . μg/ml, respectively). in piglets infected with siv (the same strain and similar titre of virus) the mean maximum concentration of crp reached only μg/ml [ ] . changes in hp concentrations in present study were similar to those observed previously in pm-infected pigs [ ] , but after coinfection with siv the response were more protracted. the mean maximal concentrations were similar. in contrast in only siv-infected pigs the level of hp in serum increased significantly only at and dpi and reached considerably lower value (mean maximum concentration . mg/ml) [ ] . serum amyloid a response in coinfected pigs was observed earlier than in pm-infected ones, but later than in siv infected piglets [ , ] . mean maximum concentration of saa in serum were higher in coinfected piglets, as compared to pm monoinfected animals ( μg/ml and μg/ml, respectively). in only siv infected piglets the maximum level reached only . μg/ml [ ] . the response of pig-map in coinfected piglets were similar to those observed by us previously after single infection with pm [ ] , but totally different (much intensive) from those observed after siv infection [ , ] . generally, in pm and swh n coinfected pigs, the app response was observed earlier than in pm-infected, and the mean induction levels of most app were higher table number of infected pigs (number with positive results/total number of pigs) from which the siv and/or toxigenic pasteurella multocida (pm) were reisolated and/ or identified with the use of pcr at various days after coinfection in co-infected animals (except pig-map). in comparison to siv-infection, the app response was much stronger and more protracted in coinfected pigs. interactions among multiple pathogens in pigs appear to generate a more severe or chronic outcome than is observed with individual pathogens by themselves [ , ] . pulmonary lesions observed in present study were more severe when compared to singly infected animals [ , ] . it seems that siv and pm co-infection contributes to exacerbate of pulmonary lesions. there are several mechanism reported by which siv infection predisposes to secondary bacterial infection, which include: impairment of respiratory epithelial barrier, increase host expression of receptors for bacteria leading to enhance colonization, modification of host immune responses (i.e. impairing of alveolar macrophage phagocytic function) [ ] [ ] [ ] [ ] . earlier response of the most app after infection with siv or swh n + pm, as compared to pm-mono infection, could be a result of shorter incubation period with regard to siv-infections and the earliest induction of pro-inflammatory cytokines, especially il- , which are known to be a major regulator of app production by hepatocytes [ ] . as it have been found by barbé et al. [ ] , during siv infection il- concentration in piglets' serum peaked from to h post infection. at later time-points post infection, the concentration of this cytokine was either > -fold lower or at the limit of detection. the serum levels of other cytokines stimulating production of app by hepatocytes (il- , tnf-α) were under the limit of detection. rapid disappearance of il- from serum could also explain a fast drop in app concentrations during to the preinoculation levels in only siv infected piglets [ ] . studies conducted on mice reveled that after pm infection concentration of cytokines involved in regulation of app production by hepatocytes increased at later time-points post infection [ ] . the pig-map (mg/ml) dpi swh n +pm control figure concentrations of crp, hp, saa and pig-map in serum of pigs before and at various time points after intranasal coinfection with swine influenza virus (h n ) and pasteurella multocida (mean ± sd). *p < . significant increase, as compared to control animals. concentration of il- peaked at h post pm infection of mice and remained elevated for the longer period of time (at least to h post infection) [ ] . in the study by francisco et al. [ ] , a slight correlation between hp concentration in serum and extent of turbinate atrophy was found after infection with pm. our results did not confirm this finding, but we found the significant positive correlation between maximum serum pig-map concentration and degree of turbinate atrophy (turbinate score). it should be mentioned that the timing of sampling must be taken into consideration as it may be critical in showing a precise correlation, as was reported previously by francisco et al. [ ] . moreover, we found positive relationships between maximal concentration of hp and saa in serum and lung scores. the significant positive correlation found between maximum concentrations of saa in serum and lung scores were also reported previously in pigs infected with h n swine influenza virus [ ] . similarly, positive correlation between hp and saa concentration in pigs' serum at the day of necropsy and changes in the lungs were reported after pm infection [ ] . furthermore, the positive association between concentration of saa and clinical score were found in present study. the positive correlation between clinical course and hp concentration in pigs serum was also previously reported by grau-roma et al. [ ] in pigs with postweaning multisystemic wasting syndrome. the results of our study confirmed that monitoring of app may revealed ongoing infection, and in this way may be useful in selecting clinically healthy pigs i.e. before integration into an uninfected herd. the highest concentrations of all investigated app were observed from to dpi, before specific antibodies in serum were present. exposure to multiple pathogens resulted in the strongest crp, hp and saa response as compared to mono-infection with siv or pm [ , ] . additional studies need to be done in order to confirm these findings with regard to other coinfections. present result also confirm our previous findings that saa could be a potentially useful indicator in experimental infection studies (e.g. vaccine efficiency investigations) or as a marker for disease severity, because of correlation observed between its concentration in serum and disease severity (lung scores, clinical scores). fourteen -week-old piglets of the france hybrides fh line were sourced from high health status herd. the herd was seronegative to porcine reproductive and respiratory syndrome virus and pseudorabies virus. no evidence of pleuropneumonia, streptococcosis and atrophic rhinitis was recorded based on clinical, serological and pathological examinations. prior to the start of the study all of the piglets were shown to be both influenza a virus and antibody (subtypes h n , h n , h n ) negative by matrix (m) gene real time rt-pcr and haemagglutination inhibition assay (hi), respectively. animals were also tested for serum antibodies against dermonecrotic toxin (anti-dnt ab) produced by pm and nasal swabs from all piglets were evaluated for the presence of toxigenic pm according to procedures described below. all piglets were shown to be anti-dnt ab negative and no genetic material of toxigenic pm was found. during the experiment, piglets were housed at the bsl animal facility in two independent units; one for the control and one for the infected pigs. animal use and handling protocols were approved by local ethical commission. swine influenza virus a/sw/poland/kpr / (subtype h n ) (hereafter referred to as swh n ), which had been isolated from a pig with swine influenza, was used for the experimental infection. the stock used for inoculation represented the third passage in spf embrionated chicken eggs. the virus titer was evaluated in madin-darby canine kidney (mdck) cells. a dnt producing pm isolate, which originated from a pig with the clinical form of progressive atrophic rhinitis, was cultured on blood agar at °c for h. a suspension of this culture to . mcfarland turbidity (which corresponds with approximately . × colony forming units (cfu)/ml) was prepared in pbs. a plate count was also performed to quantify the accurate number of viable bacteria (final result . × cfu/ml). on day , ten piglets were inoculated with swh n and pm. inoculations of . tcid of swh n and × cfu of toxigenic pm in ml of phosphate-buffered saline (pbs) were given intranasally ( ml for each nostril). four mock-inoculated pigs (with pbs) served as control pigs. in order to examine the events taking place at the early stages of infection two infected and one control piglet were euthanized on days and after infection. the remaining pigs were euthanized and necropsied at dpi. rectal temperatures were assessed daily and clinical signs of disease were recorded. pigs were observed and scored for the respiratory signs as follows: respiratory rate: -normal, slightly elevated, moderately elevated, slight abdominal breathing, clearly elevated, distinct abdominal breathing; nasal discharge absent, present; coughing absent, present; sneezing absent, present. all scores per topic are accumulated for a total clinical score of each individual pig ( - ). fever was recorded when the rectal temperature was ≥ °c. blood samples were collected on − , (inoculation), , , , , and dpi. nasal swabs were taken at − , , , , , and dpi. complete necropsy was done on each animal, with special emphasis on the respiratory tract. samples from lung (all lobes separately) were collected for viral rna and bacterial dna extraction. the snouts were sectioned at the upper first premolar tooth at necropsy. the lesions in the left and right turbinates and septum were scored as , , and as was described previously [ ] . normal turbinates were graded as . slight but obvious atrophy was graded as . moderate atrophy of not less than half of the turbinates was graded at . severe atrophy of the dorsal and ventral scrolls was graded as . the three scores (from left and right turbinates and septum) were then added together and divided by , to determine final visual turbinate scores (ts) for each pig, ranging from to . lungs were assessed according to the scheme described by christensen et al. [ ] . if no changes were found in the lobe, it was scored as %. changes in the right lung were scored as follows: apical lobe %, cardiac lobe %, diaphragmatic lobe % (all together %). changes observed in the left lung were scored as: apical lobe %, cardiac lobe %, diaphragmatic lobe %. changes in intermediate lobe was scored as %. all recorded scores were then added together, to determine final visual lung score for each pig, ranging from to %. the general swine influenza a real time rt-pcr method was used for detection of siv in swabs and tissues, as described previously [ ] . samples with ct value < were considered to be m gene positive, samples having ct value to with sigmoidal/logarithmic appearance were considered to be weak positive, samples with ct value > were considered to be negative. the standard bacteriological methods were used for detection of pm in the nasal swabs and lung samples, as described previously [ ] . for pm isolation collected samples were streaked onto agar containing % horse blood and incubated for h at °c in . % co atmosphere. strains with characteristic colony morphology were identified by api e tests (biomerieux, france). additionally, for detection of genes encoding dnt, the pcr test was performed according to the previously described procedure [ ] . whole blood samples were analyzed for different leukocyte proportions and concentrations on a abacus junior vet hematology analyzer (diatron, hungary). proportions of lymphocytes, monocytes and granulocytes were calculated as a percentage of leukocyte concentration. anti-dnt ab were measured using a commercial elisa test (pmt elisa, oxoid, hampshire, uk) according to the manufacturer's specification. antibodies against sivs were measured using a haemaglutinin inhibition assay (hi) assay, performed according to the standard procedure, using . % chicken erythrocytes and ha units of strains swh n virus. before inoculation, to check the immune status of the piglets, the hi assay were also performed with h n and h n subtypes. all sera were tested in serial twofold dilutions, starting at : . for estimates of the prevalence of antibodies, titres ≥ were considered positive. for determination of app commercial elisas were used according to the manufacturer's recommendation (pig c-reactive protein elisa and pig haptoglobin elisa from life diagnostics, inc., usa; pigmap kit elisa from pigchamp pro europa s.a, spain; phase serum amyloid a assay from tridelta development ltd county kildare, ireland). serum samples were tested in duplicate. prior to analyses samples were diluted as follows: : for crp, : for hp, : for saa and : for pig-map. the obtained data were subjected to the w. shapiro-wilk test for normality and the levene's test for equality of variances. the nonparametric friedman test was used to compare observations repeated on the same subjects. comparisons between infected and control groups at each time point were assessed using the mann-whitney u test. for analysis of correlation the spearman rank correlation test was used. for all analyses, p < . was considered significant. all calculations were performed with statistica . (statsoft). the porcine acute phase response to infection with actinobacillus pleuropneumoniae. haptoglobin, c-reactive protein, major acute phase protein and serum amyloid a protein are sensitive indicators of infection pig-major acute phase protein and haptoglobin serum concentrations correlate with pcv viremia and the clinical course of postweaning multisystemic wasting syndrome kinetics of the response of four positive acute phase proteins in pigs experimentally infected with toxigenic pasteurella multocida acute phase proteins response during subclinical infection of pigs with h n swine influenza virus current research on acute phase proteins in veterinary diagnosis: an overview coinfection of pigs with porcine respirator coronavirus and bordetella bronchiseptica first case of the isolation of the h n swine influenza virus in poland influenza virus coinfection with bordetella bronchiseptica enhances bacterial colonization and host responses exacerbating pulmonary lesions. microb pathogen contribution of pasteurella multocida to the porcine respiratory disease complex serum haptoglobin concentration in growing swine after intranasal challenge with bordetella bronchiseptica and toxigenic pasteurella multocida type d cytokines and acute phase proteins associated with acute swine influenza infection in pigs diseases of swine polymicrobial respiratory disease in pigs the epidemiology and evolution of influenza viruses in pigs a quantitative measurement of the effect of avian influenza virus on the ability of turkeys to eliminate pasteurella multocida from the respiratory tract immune and acute phase response in pigs experimentally infected with h n swine influenza virus influenza virus-induced immune complexes suppress alveolar macrophage phagocytosis respiratory viruses augment the adhesion of bacterial pathogens to respiratory epithelium in a viral species-and cell typedependent manner lung alterations in guinea-pigs infected with influenza virus sustained desensitization to bacterial toll-like receptor ligands after resolution of respiratory influenza infection hepatic acute phase proteins -regulation by il- and il- -type cytokines involving stat and its crosstalk with nf-κb-dependent signaling cytokine profiles, apoptosis and pathology of experimental pasteurella multocida serotype a infection in mice the quantitation of turbinate atrophy in pigs to measure the severity of induced atrophic rhinitis diseases of the respiratory system real time reverse transcription (rrt)-polymerase chain reaction (pcr) methods for detection of pandemic (h n ) influenza virus and european swine influenza a virus infections in pigs detection of pasteurella multocida and bordetella bronchiseptica, etiological agents of atrophic rhinitis, by means of pcr tests analytical verification of a multiplex pcr for identification of bordetella bronchiseptica and pasteurella multocida from swine submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution the authors wish to thank barbara frącek and monika grzesiak for excellent technical assistance. this work was supported by project n n founded by polish ministry of science and higher education. the authors declare that they have no competing interests.authors' contributions mpm designed the experiments and analyzed the experimental data and performed statistical analysis. kk and mpm performed the experiments (inoculation, necropsy clinical examination), prepared the serum and tissue samples, laboratory examination. ks helped to perform the experiments (bacteriology). mpm, imd and zp prepared the manuscript and supervised the experiment. all authors have read and approved the final manuscript. key: cord- - b wtim authors: borriello, giorgia; lucibelli, maria g; pesciaroli, michele; carullo, maria r; graziani, caterina; ammendola, serena; battistoni, andrea; ercolini, danilo; pasquali, paolo; galiero, giorgio title: diversity of salmonella spp. serovars isolated from the intestines of water buffalo calves with gastroenteritis date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: b wtim background: salmonellosis in water buffalo (bubalus bubalis) calves is a widespread disease characterized by severe gastrointestinal lesions, profuse diarrhea and severe dehydration, occasionally exhibiting a systemic course. several salmonella serovars seem to be able to infect water buffalo, but salmonella isolates collected from this animal species have been poorly characterized. in the present study, the prevalence of salmonella spp. in water buffalo calves affected by lethal gastroenteritis was assessed, and a polyphasic characterization of isolated strains of s. typhimurium was performed. results: the microbiological analysis of the intestinal contents obtained from water buffalo calves affected by lethal gastroenteritis exhibited a significant prevalence of salmonella spp. ( %), characterized by different serovars, most frequently typhimurium ( %), muenster ( %), and give ( %). the s. typhimurium isolates were all associated with enterocolitis characterized by severe damage of the intestine, and only sporadically isolated with another possible causative agent responsible for gastroenteritis, such as cryptosporidium spp., rotavirus or clostridium perfringens. other salmonella isolates were mostly isolated from minor intestinal lesions, and often ( % of cases) isolated with other microorganisms, mainly toxinogenic escherichia coli ( %), cryptosporidium spp. ( %) and rotavirus ( %). the s. typhimurium strains were characterized by phage typing and further genotyped by polymerase chain reaction (pcr) detection of virulence genes. the isolates exhibited nine different phage types and different genetic profiles. three monophasic s. typhimurium (b: , :i:-) isolates were also found and characterized, displaying three different phage types and three different virulotypes. the molecular characterization was extended to the s. muenster and s. give isolates collected, indicating the existence of different virulotypes also within these serovars. three representative strains of s. typhimurium were tested in vivo in a mouse model of mixed infection. the most pathogenic strain was characterized by a high number of virulence factors and the presence of the locus agfa, coding for a thin aggregative fimbria. conclusions: these results provide evidence that salmonella is frequently associated with gastroenteritis in water buffalo calves, particularly s. typhimurium. moreover, the variety in the number and distribution of different virulence markers among the collected s. typhimurium strains suggests that within this serovar there are different pathotypes potentially responsible for different clinical syndromes. salmonella spp. found in water buffalo (bubalus bubalis) herds are a matter of concern since they are responsible for serious economic losses in livestock and are a zoonotic agent responsible for foodborne illness [ ] . as for bovine calves, salmonella-induced diseases in water buffalo calves are characterized by severe gastrointestinal lesions, profuse diarrhea, and severe dehydration [ ] . acute salmonellosis generally induces diarrhea, mucous at first, later becoming bloody and fibrinous, often containing epithelial casts. ingestion is the main route of infection, although it can also occur through the mucosa of the upper respiratory tract and conjunctiva. the major source of infection in the herd is represented by asymptomatic older animals shedding heavy loads of bacteria through feces. other sources of infection are contaminated forages and water, as well as rodents, wild winged animals, insects and man [ , ] . the disease can also cause sudden death without symptoms. occasionally, the infection is systemic, affecting joints, lungs and/or the central nervous system (cns) [ ] . moreover, several salmonella serovars seem to be able to infect water buffalo, mainly affecting - week old calves, even though reports on salmonellosis in b. bubalis are scarce [ , ] . water buffalo calves are more frequently affected by gastroenteritis than bovine calves, with mortality rates as high as % in water buffalo species vs. % in bovine [ , ] . this difference might be due to a greater susceptibility of water buffalo to gastroenteric pathogens, although it also may reflect the lack of appropriate management practices for this animal species. therefore, water buffalo represents a suitable model to study causative agents of gastroenteritis. in water buffalo, s. enterica serovar typhimurium can induce a variety of clinical syndromes with different anatomopathological lesions [ , ] . the severity of the disease can depend on several factors, including host-pathogen interactions, which is highly influenced by the route of infection, the infectious dose, natural or acquired host resistance factors, and the possible presence of other pathogens. moreover, specific salmonella virulence factors, frequently located on salmonella pathogenicity islands (spis), prophage regions or virulence plasmids, play a key role in the pathogenesis of the gastroenteritis [ ] . the current study investigated the intestinal contents collected from water buffalo calves affected by gastroenteritis with lethal outcome to: (i) evaluate the prevalence of salmonella spp., and (ii) perform a polyphasic characterization of the collected isolates of s. typhimurium. salmonella spp. were isolated from % of the intestinal contents collected from water buffalo calves affected by gastroenteritis with lethal outcome. positive samples were detected in subjects bred in of farms (interherd prevalence, %). the s. enterica serovars most frequently isolated were typhimurium (n= ), muenster (n= ) and give (n= ). other recovered serovars were: derby (n= ), bovismorbificans (n= ), newport (n= ), monophasic s. typhimurium (b: , :i:-; n= ), blockley (n= ), meleagridis (n= ), umbilo (n= ), altona (n= ), anatum (n= ), bredeney (n= ), enterica (−;i; , ; n= ), gaminara (n= ), haardt (n= ), hadar (n= ), infantis (n= ), isangi (n= ), kottbus (n= ), london (n= ), muenchen (n= ), and s.ii: ;z; , (n= ). phage-typing of the s. typhimurium and monophasic typhimurium strains (table ) indicated a variable distribution of phage types among strains with nine different phage types of typhimurium strains, and three different phage types out of three monophasic typhimurium strains. this study reports a significant prevalence of salmonella spp. ( %) in diarrheic water buffalo calves, that are more relevant than those reported in previous studies ( and . %) [ , ] . moreover, in contrast with bovine species where salmonellosis results primarily associated with serovars dublin and typhimurium [ ] , the extremely variable distribution of the observed serovars confirms the absence of a serovar specifically adapted to water buffalo, as previously suggested [ ] . these data provide therefore evidence that salmonella, particularly s. typhimurium, can be potentially considered an important pathogen for this animal species. the definitive phage type (dt ), which has often been associated with multiple-antibiotic-resistant strains with ascertained zoonotic potential and, in many countries, has increased over the past two decades [ ] , does not seem to be widely spread in water buffalo. three monophasic s. typhimurium (b: , :i:-) isolates were also found that are s. typhimurium lacking phase two flagellar antigens that have a rapid emergence and dissemination in food animals, companion animals, and humans. more significantly, the public health risk posed by these emerging monophasic s. typhimurium strains is considered comparable to that of other epidemic s. typhimurium [ ] . the diagnostic investigation indicated that non-typhimurium salmonella isolates were detected with at least another potential pathogen in % of cases ( figure a ). in % of cases salmonella was linked with pathogenic escherichia coli that were characterized for the presence of virulence factors. other frequent associations were found with cryptosporidium spp. ( %) and rotavirus ( %) ( figure a) . remarkably, s. typhimurium was never associated with pathogenic e. coli, while it was isolated sporadically with clostridium perfringens (strain # ), rotavirus (strain # ), and cryptosporidium spp. (strain # ) ( figure b) . the presence of more pathogens in the same subject might suggest that, as for other animal species [ ] , diarrhea in water buffalo calves can be characterized by a multifactorial etiology. data from necroscopic examinations of tissues indicated that the lesions caused by s. typhimurium were characterized by severe damage of the intestine, ranging from congestive to necrotic-ulcerative enterocolitis. in particular, the strains isolated from animals exhibiting the most severe lesions were # , # , # , and # . among these strains, the two dt strains were also found, thus supporting the pathogenic role of this phage type. the other salmonella serovars were instead isolated from subjects exhibiting a variety of different lesions, mostly minor lesions confined to the jejunum, and often ( % of cases) associated with other pathogens. similarly, the monophasic s. typhimurium strains were detected either with rotavirus (strain # ) or st-positive e. coli (strains # and # ). these data confirm the pathogenic potential of the serovar typhimurium for water buffalo calves. on the other hand, the scarcity of observed lesions and the frequent presence of more than one microorganism in the same subject hamper a clear understanding of the potential pathogenic role of the non-typhimurium salmonella serovars included in this study. s. typhimurium and monophasic s. typhimurium strains were further characterized by the molecular detection of genes coding for virulence factors. the genetic characterization (table ) included five loci (avra, ssaq, mgtc, siid, and sopb) located on spi - , respectively [ ] , eight loci (gipa, gtgb, sope, sodc , gtge, gogb, ssph , and ssph ) of prophage origin [ ] [ ] [ ] [ ] [ ] , the gene spvc, located on a virulence plasmid [ ] , and nine genes (stfe, safc, csga, ipfd, bcfc, stbd, pefa, fima, and agfa) coding for bacterial fimbriae, involved in surface adhesion and gut colonization [ ] . as a positive control for the pcr assay, amplification of the chromosomal gene inva was carried out for each strain. all the s. typhimurium and monophasic typhimurium isolates displayed the presence of avra, ssaq, mgtc, siid, sopb, ssph , stfe, ipfd, bcfc, stbd, and fima genes, and the absence of the sope gene. other loci were variably distributed among the strains, with frequency values ranging from - % (table ) . on the basis of the presence or absence of the loci included in the study, the strains of s. typhimurium were subdivided into different genotypes (table ) ; however, the isolates with identical genotype displayed different phage types suggesting the presence of different strains. interestingly, the three monophasic s. typhimurium strains exhibited three different genotypes (table ) . the following loci: inva, ssph , stfe, ipfd, bcfc, stbd, fima, avra, ssaq, mgtc, siid, sopb were present in all the strains; the sope gene was not found in any of these strains. b nt = not typeable. the loci-genetic characterization was also extended to the s. muenster and s. give isolates to investigate their pathogenic potential because of their large presence in water buffalo calves. in addition they have already been reported to cause saepticemic salmonellosis in cattle and calves [ , ] . the molecular results (table ) indicated that the loci inva, safc, bcfc, fima and ssaq were present in all the strains, the genes gipa, gogb, ssph , sodc , gtge, spvc, stfe, ipfd and pefa were not found in any of these isolates, while the remaining loci were variably distributed, with frequency values ranging from - %. in particular, the prophage genes were scarcely present ( loci in the muenster serovar, locus in the give serovar), the plasmidic spvc locus was absent in all the analyzed isolates, while the fimbrial genes and the spi - genetic markers were discretely represented ( loci for the former genes in both serovars, and loci for the latter genes in the serovar muenster and give, respectively). moreover, the molecular profiles allowed to identify different genotypes out of the s. muenster isolates, and different genotypes out of the s. give isolates (table ) . our data confirm the high variability of the typhimurium serovar [ , ] , mostly related to virulence factors, and highlight the high discriminating potential of the genotyping technique performed. our data also suggest that monophasic typhimurium strains are likely to possess a similarly high degree of genetic variability, particularly linked to virulence markers. moreover, the presence of virulence markers in the isolated strains of monophasic s. typhimurium, s. muenster and s. give could further support their pathogenic potential. the products of the genes included in the virulotyping assay performed here are known to be important during different stages of infection (table ) . however, the distribution of these factors among the tested strains highlights the complexity and the variety of potential mechanisms used by salmonella to induce disease in the host. the avra, ssaq, mgtc, siid, and sopb genes are genetic markers for the presence of the spi - in all s. typhimurium strains tested, although their presence does not necessarily implicate the presence of the entire spi. spis are clusters of genes on the chromosome, likely to be horizontally acquired, and variably associated with enhanced invasion and intracellular survival within both phagocytic and non-phagocytic cells. in particular, spi- has been largely associated with the ability to produce enteritis [ ] . the s. typhimurium strains included in this study all displayed the presence of the investigated spi markers. interestingly, these loci appeared widely distributed also among the serovars muenster and give. the sope gene is known to favor the entry of salmonella into host cells and its presence has been correlated with disease in humans [ ] and with the epidemic potential of s. typhimurium strains in cattle [ ] . this gene was absent in all the s. typhimurium strains included in the present study, while was present in all the s. muenster strains analyzed. the pefa (plasmid encoded fimbria), agfa (aggregative fimbria a) and spvc (salmonella plasmid of virulence gene c) genes are all located on plasmids [ ] . five s. typhimurium isolates tested in the current study possessed both pefa and spvc, two isolates were positive for only spvc, and three isolates were positive for only agfa (table ) . these results confirm the presence of more than one virulence plasmid among s. typhimurium strains isolated from diarrheic water buffalo calves, and suggest horizontal exchange of virulence factors. however, the loci pefa and spvc were absent in all the monophasic s. typhimurium, s. muenster and s. give strains tested. prophage genes are known to account for most of the variability of closely-related s. typhimurium strains. moreover, lysogenic bacteriophages promote changes in the composition of genomic dna often altering the phenotype of the host [ , ] . the prophage virulence genes included in this study exhibited a variable distribution among the isolates tested, thus suggesting synergistic and/or redundant effects of these loci on the pathogenicity of salmonella, likely contributing to the actgcgaaagatgccacaga phenotypic variability of this pathogen. these loci were mostly present in s. typhimurium and monophasic s. typhimurium rather than in s. muenster and s. give isolates. fimbrial genes appeared widely distributed among all the serovars tested, particularly in s. typhimurium strains, with frequency values ≥ %, except for the plasmid-borne pefa and agfa genes (with frequency values of % and %, respectively). these data are consistent with the essential functions of adhesion factors for the attachment and internalization processes that occur during pathogenesis. to better characterize in vivo virulence, three strains representative of all s. typhimurium isolates were chosen to perform mixed infections in mice. animal experiments included the two strains exhibiting the highest and the lowest number of virulence factors (strains # and # , respectively), and strain # , carrying the same virulotype as strain # , but that does not harbor the agfa locus (table ). in the competition assay, strain # outcompeted both strains # and # (ci . ; p< . , and ci . ; p< . , respectively). these results were confirmed in a gastrointestinal mouse model of infection, which better resembles the clinical form of salmonellosis in livestock. using oral inoculation, in the competition assay, again strain # outcompeted both strains # and # (ci . ; p< . , and ci . ; p< . , respectively). our data indicate that among those strains included in the experiment, strain # was the most virulent in mice. these competition assays in mice suggest a key role of the agfa gene coding for a thin aggregative fimbria involved in the colonization of host intestinal epithelial cells by attachment to glycoprotein or glycolipid receptors on epithelial cell surfaces. indeed, the strain which was more virulent in in vivo experiments was characterized by a high number of virulence factors and by the presence of the agfa locus. moreover, it was isolated from one of the subjects with necrotic-ulcerative enterocolitis. the presence of this type of fimbria has been reported in clinical human and animal isolates of salmonella + + ----+ --- -+ -------- -+ -------- - freq. a the following loci: inva, safc, bcfc, fima and ssaq were present in all the strains; the genes gipa, gogb, ssph , sodc , gtge, spvc, stfe, ipfd and pefa were not found in any of these strains. [ , ] . the data presented here suggest that agfa might increase bacterial pathogenicity. nevertheless, we cannot reject the hypothesis that the mouse model chosen for in vivo experiments could have influenced the virulence phenotype of the tested strains originally isolated from water buffalo calves. therefore, future studies will be necessary to exclude the possibility that the phenotypic differences observed among the tested salmonellae are dependent on the animal model or on other virulence factors not included in this study. however, in vivo experiments carried out in mouse models represent a good preliminary source of information on the expression of traits associated with pathogenicity of salmonella in mammalian species. this study showed a significant ( %) prevalence of salmonella spp. in water buffalo calves affected by gastroenteritis with lethal outcome. however, our results did not indicate the existence of a salmonella serovar specifically adapted to water buffalo and highlighted that s. typhimurium is the most frequently found serovar. the molecular and phenotypic characterization of the s. typhimurium isolates provided evidence that within this serovar there are different pathotypes potentially responsible for different clinical syndromes, therefore requiring prophylaxis protocols including the use of specific vaccines for the effective control of salmonellosis in water buffalo calves and possible contamination of the food chain. this study was carried out in the campania region, southern italy, during - , using samples taken from water buffalo calves bred in different farms. the animals were aged between - weeks old and were all affected by gastroenteritis with lethal outcome. during necropsy, the intestinal lesions were evaluated and the intestinal content of the involved sections was collected and tested for the presence of salmonella spp. in addition, the presence of e. coli, eimeria spp., cryptosporidium spp., giardia spp., coronavirus, rotavirus, and c. perfringens were also determined to investigate their association with salmonella spp. the isolation of salmonella spp. was performed according to iso : [ ] . the isolated salmonella spp. were serotyped according to the kaufmann-white scheme [ ] . phage-typing of the isolated s. typhimurium strains was performed by the italian national reference centre for salmonellosis (istituto zooprofilattico sperimentale delle venezie). the presence of rotavirus and coronavirus was detected by polymerase chain reaction (pcr) amplification [ , ] . cryptosporidium spp. and giardia spp. antigens were detected by chromatographic immunoassay (oxoid, basingstoke, uk). the presence of eimeria spp. was examined by flotation technique using saturated saline [ ] . e. coli and c. perfringens were isolated according to the protocol reported by quinn et al. [ ] . e. coli hemolytic activity was evaluated by growing colonies on blood agar base, while virulence factors (lt-heat-labile toxin, st-heatstable toxin, stx -shiga toxin , stx -shiga-toxin , eaeintimin, cnf-cytotoxic necrotizing factor, and cdt-cytolethal distending toxin) were detected by molecular assays, as previously reported [ ] [ ] [ ] . bacterial dna was extracted from ml of overnight cultures using chelex resin (biorad, hercules, ca) and used as the template for the pcr detection of genes listed in table , as described previously [ ] [ ] [ ] [ ] [ ] [ ] ] . the primers used to amplify the genes ssph , ssph , ssaq, sopb, siid, stfe, safc, csga, ipfd, bcfc, stbd, and fima were designed using the primer software (version . . ; http:// frodo.wi.mit.edu/), and pcr was performed in a final volume of μl containing hotstar taq master mix (qiagen, valencia, ca) ×, . μm each primer and μl of extracted dna. the thermal profile included an initial denaturation step at °c for min, followed by cycles at °c for s, °c for s, and °c for min, and a final extension step at °c for min. amplification products were visualized under ultraviolet (uv) light after electrophoresis on % agarose gels and staining with sybrsafe (invitrogen, carlsbad, ca). groups of five age matched ( - weeks old) female balb/c mice used in this study were purchased from charles river (calco, italy). three strains (s. typhimurium # , s. typhimurium # , s. typhimurium # ), representative of the genotypically characterized s. typhimurium isolates, were selected for an in vivo analysis of virulence by using the competitive index (ci) resulting from mixed infections [ ] . in particular, two strains were selected that exhibited the highest and lowest number of virulence factors (strains # and # , respectively), and strain # , carrying the same virulotype as strain # , but without the locus agfa (table ) . bacteria were grown overnight at °c in brain heart infusion medium (oxoid, basingstoke, uk), washed, and diluted in sterile saline. cultures were alternatively combined in a mixture of equivalent numbers ( : ratio) of two of the three selected strains (input). mice were inoculated intraperitoneally (ip) with a dose of × bacteria or received mg of streptomycin orally ( μl of sterile solution or sterile saline) h prior of being intragastrically administered with × bacteria. the number of colony-forming units (cfu) contained in the inocula were confirmed by plating serial dilutions and counting colony growth. at (ip) or (os) days after infection, mice were sacrificed, spleens were aseptically removed, and bacteria were counted by plating serial dilutions (output). the ratio of two strains in the input and in the output was evaluated by picking and transferring colonies on selective plates. antibiotics used were streptomycin and sulfonamide, for which strain and strains or were naturally resistant. the ci was calculated using the formula: ci = output (strain a/strain b)/inoculum (strain a/strain b). statistical differences between outputs and inputs were determined by student's t test. all animal handling and sampling procedures were performed under the conditions of the local ethics committee meeting the requirements of italian legislation. fao regional office for europe inter-regional cooperative research network on buffalo veterinary microbiology and microbial disease infectious diseases pathophysiology of diarrhea in calves pathogenesis of bacterial infections in animals studies on enteritis in buffalo calves scientific opinion on monitoring and assessment of the public health risk of "salmonella typhimurium-like" strains virulotyping and antimicrobial resistance typing of salmonella enterica serovars relevant to human health in europe characterization of salmonella enterica serovar typhimurium strains of veterinary origin by molecular typing methods variability in occurrence of multiple prophage genes in salmonella typhimurium strains isolated in slovack republic transposition of the heat-stable toxin asta gene into a gifsy- -related prophage of salmonella enterica serovar abortusovis rapid identification of salmonella serovars in feces by specific detection of virulence genes, inva and spvc, by an enrichment broth culture-multiplex pcr combination assay human salmonella clinical isolates distinct from those of animal origin salmonella muenster infection in a dairy herd outbreak of salmonella give in the province of quebec frequency and polymorphism of sope in isolates of salmonella enterica belonging to the ten most prevalent serotypes in england and wales isolation of a temperate bacteriophage encoding the type iii effector protein sope from an epidemic salmonella typhimurium strain elucidation of antimicrobial susceptibility profiles and genotyping of salmonella enterica isolates from clinical cases of salmonellosis in new mexico in dna-based diagnostic tests for salmonella species targeting agfa, the structural gene for thin, aggregative fimbriae characterization of salmonella isolates from captive lizards annex d "detection of salmonella spp. in animal feces and in environmental samples from primary production stage who collaborating centre for reference and research on salmonella phylogenetic analysis of a highly conserved region of the polymerase gene from coronaviruses and development of a consensus polymerase chain reaction assay real-time reverse transcription-pcr for detection of rotavirus and adenovirus as causative agents of acute viral gastroenteritis in children internal parasites in laboratory procedures for veterinary technicians production of cytolethal distending toxins by pathogenic escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (type iv) single multiplex pcr assay to identify simultaneously the six categories of diarrheagenic escherichia coli associated with enteric infections shiga-toxin producing e. coli (stec) and necrotoxigenic e. coli (ntec) isolated from diarrhoeic mediterranean water buffalo calves (bubalus bubalis) use of mixed infections with salmonella strains to study virulence genes and their interactions in vivo submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution the authors declare that they have no competing interests.authors' contributions gb carried out the molecular genetic studies and drafted the manuscript. mgl contributed to the molecular analysis and the isolation and phenotypic characterization of the strains. mp designed and interpreted the results of the in vivo assays. mrc carried out the isolation and phenotypic characterization of the strains. cg participated in the design of the in vivo assays and performed the statistical analysis. sa and ab carried out the in vivo assays and participated in the phenotypic characterization of the strains. de contributed to the design of the molecular assays, the interpretation of the genotyping results and critical preparation of part of the manuscript. pp participated in the conception, design, and coordination of the study. gg conceived the study, and participated in its design and coordination, and helped to draft the manuscript. all authors read and approved the final manuscript. key: cord- -wzgjwa z authors: giacometti, federica; magarotto, jacopo; serraino, andrea; piva, silvia title: highly suspected cases of salmonellosis in two cats fed with a commercial raw meat-based diet: health risks to animals and zoonotic implications date: - - journal: bmc vet res doi: . /s - - -z sha: doc_id: cord_uid: wzgjwa z background: feeding raw meat-based diets (rmbd) to companion animals raises public health concerns for both animals and humans. while considerable attention has been paid to bacterial contamination of commercial pet food, few literature studies have investigated foodborne disease in companion animals. salmonellosis is reported to be infrequent in cats but no known data or studies estimating feline salmonellosis are available or large-scale epidemiological studies assessing salmonella risk factors. case presentation: two highly suspected cases of salmonellosis in two cats fed with a commercial frozen poultry rmbd are presented, for the first time from the same household. the clinical presentation, diagnostics, treatment and follow-up are reported and the zoonotic implications are discussed. conclusions: this case highlights the health risks posed to both animals and owners by feeding rmbd to pets, and suggests that these risks should be considered by veterinary practitioners. non-typhoidal salmonella spp. are important human and animal pathogens worldwide. most human salmonellosis cases are foodborne. however infections are also reported through direct or indirect animal contact in homes, veterinary clinics, zoological gardens, farms or other public, professional or private settings [ ] . incidents of human salmonellosis in europe (eu) are relatively common (eu notification rate of . cases per , ) and most are attributed to the consumption of contaminated foods ( %) but fairly high percentages are linked to environmental sources ( %) and even to direct animal contact ( %) [ ] . likewise, pets are also susceptible to salmonella infection, but no known data or studies estimating salmonellosis cases in pets are available. of the primary enteropathogenic bacteria, salmonella spp. is found in the feline intestinal tract [ ] [ ] [ ] ; salmonellosis is uncommon in cats, often, favoured by host immunosuppression [ ] . cats are primarily infected subclinically, but gastrointestinal disease manifested as enterocolitis and endotoxemia can occur and is initially associated with fever, malaise, and anorexia followed by vomiting, abdominal pain, and diarrhoea [ ] . abortion, stillbirth, meningoencephalitis, respiratory distress and conjunctivitis have also been described [ , ] ; the disease manifestations range from mild self-limited diarrhoea to potential and fatal gastroenteritis and septicaemia [ ] . salmonella prevalence among cats is variable and similar in diarrhoeic and non-diarrhoeic cats, with shedding rates from to . % in diarrhoeic cats and from to % in non-diarrhoeic cats [ , [ ] [ ] [ ] . however, higher prevalence rates are found in stray or shelter dogs/cats and in dogs fed with raw food diets with the odds of shedding salmonella estimated to be times greater for dogs fed with raw food diets than those given commercial diets [ ] [ ] [ ] [ ] . feeding raw diets to domestic cats is becoming increasingly popular and today there are many options for owners who wish to change their feeding practices. recipes for home-made raw food diets are widely available and commercial frozen food diets are also sold at some pet stores and veterinary clinics. the main ingredients of these products are raw meat, mainly poultry and beef, vegetables, grains and fruits [ ] . as these diets do not undergo any type of heat processing or sterilization, existing bacteria and parasites can be present at the time of consumption [ ] so both commercial and home-made raw meat-based diets (rmbd) are at risk of contamination with pathogens including salmonella spp. [ , ] . salmonella spp. are transmitted directly or indirectly by the faecal-oral route [ ] . sources of infection with salmonella spp. for indoor cats include the ingestion of raw meat and some processed food, while outdoor cats are at risk from scavenging and hunting rodents and birds, exposure to reptiles and environmental contamination [ , , , ] . however, large-scale epidemiological studies assessing salmonella spp. and their risk factors are lacking with only one report to date describing two cases of feline salmonellosis in a multicat household fed with a home-made contaminated beef rmbd [ ] . this report describes two highly suspected cases of feline salmonellosis in two cats from the same household fed with rmbd and identifies a likely source of the salmonella cases. in january , an -year-old neutered female indoor domestic cat, sphynx breed, was evaluated at a private veterinary clinic for gastrointestinal signs, namely anorexia with recent weight loss, vomiting and diarrhoea. the signs had began days earlier with lethargy/weakness and malaise; the cat had a history of gastrointestinal and hepatic problems. for most of the cat's adult life, her body weight had been consistent at approximately kg. the cat was housed with one other cat, her daughter, which reported no signs. at the first visit, the owner reported giving the animals the same diet, namely homemade and commercial dry pet food. on physical examination, the cat weighed . kg, the rectal temperature was . °c, pulse rate was beats/min, and respiratory rate was breaths/min; abnormalities on physical examination included fluidsplashing sounds in the abdomen, about % dehydration, left retromandibular lymph node enlargement, and the oral examination showed gingivitis, plaque and halitosis. the cat appeared otherwise normal. faecal examination showed a mucoid and bloody diarrhoea and the faecal flotation test and snap faecal enzyme-linked immunosorbent assay (elisa) giardia test (snap giardia test, idexx laboratories, maine, usa) were negative. a complete geriatric haemobiochemical profile was sent to idexx laboratory; results of the cell blood count (cbc), venous haemogas analysis, serum biochemical analysis and assessment of serum total thyroxine concentration were within reference intervals except for leukocytes ( . g/l, reference interval, - g/l), absolute segmented neutrophils ( , /ul, reference intervals - , /ul), absolute monocytes ( /ul reference intervals - /ul); alt ( u//l, reference interval, < u/l), ast ( u/l, reference intervals < u/l) serum albumin concentration ( g/l, reference intervals - g/l), calcium ( . mmol/l, reference interval, . - . mmol/l), and folate ( . ng/ml, reference interval . - . ng/ml). a diagnosis of generic enteritis, hepatopathy with probable intestinal infection, was made. the cat was hospitalized for days and treated intravenously with: fluid therapy (ringer's acetate), metronidazole antibiotic ( mg/kg bid -deflamon mg/ ml), enrofloxacin antibiotic ( mg/kg sid -baytril mg/ml), s-adenosylmethionine ( mg/kg sid -samyr mg/ ml). the cat was fed with a gastrointestinal diet (prescription diet i/d feline, hill's) and lactobacillus (florentero, candioli pharma), and treated with milbemycin oxime and praziquantel (milbemax®, novartis). four days after case number was seen for the first time, a -year-old female cat from the same household was referred to the same veterinary clinic for the same signs previously reported for case number , days of vomiting and diarrhoea and day of anorexia, but milder than case . for most of the cat's adult life, her body weight had been approximately kg. during the clinical visit and considering the anamnesis of case number , the veterinarian suspected the same infection. investigating the infection and the possible sources of contamination more deeply, the owner specified that the homemade food given to both animals was a frozen commercial poultry rmbd bought on the internet. on physical examination, the cat weighed . kg, the rectal temperature was . °c, pulse rate was beats/min, and respiratory rate was breaths/min; abnormalities included only about % dehydration. faecal examination showed a mucoid diarrhoea and the faecal flotation test was negative. clinicopathologic findings (procyte idexx, catalyst idexx), cbc and restricted serum biochemical analysis were within reference intervals except for leukocytes ( . k/ul, reference interval, . - . k/ul), absolute segmented neutrophils ( . k/ul, reference intervals . - . k/ul), absolute monocytes ( . k/ul reference intervals . - . k/ul); alt ( u//l, reference interval, < u/l), ast ( u/l, reference intervals < u/l) and ggt ( u/l, reference intervals - u/l). based on the information acquired during anamnesis of the second case and the fact that both cats had received the same raw food diet, fresh faeces of case number were collected and sent to idexx laboratories for a real-time pcr assay evaluating a panel of enteropathogens (feline diarrhoea realpcr™ panel) including feline panleukopenia virus, feline coronavirus, tritrichomonas foetus, giardia sp., toxoplasma gondii, cryptosporidium sp., salmonella sp. and the detection of clostridium perfringens toxin a gene (cpa) and clostridium perfringens enterotoxin gene (cpe). the pcr assays detected salmonella sp. and , , copies/g of cpa were quantified; no other enteropathogens were detected. the cat was hospitalized for days and treated as reported for case number . at the time of writing, a diagnosis of inflammatory bowel disease was made for case number and the cat reports several daily episodes of diarrhoea, whereas case number is healthy and never showed any recurrence of gastrointestinal signs. on the basis of the salmonella sp. and c. perfringens positive faeces, the owner of the two cats was advised by the veterinarian to discontinue the practice of feeding raw meat-based diets and the commercial poultry rmbd was suspected as a possible source of infection. the owner submitted specimens of both diets, namely commercial prepared bowl of frozen poultry rmbd and commercial dry pet food, to the experimental institutes for zooprophylaxis in veneto for bacteriological culture: the diets were analyzed for the detection of salmonella sp. with real-time pcr (iq-check® salmonella, bio-rad) validated by afnor (brd / - / ) and also using the official international organization for standardization (iso) cultural methods, iso : / cor : , and using the iso : for the count of c. perfringens. the rmbd results disclosed the presence of salmonella spp. dna by real-time pcr and the isolation of salmonella spp., that was serotyped as salmonella typhimurium group b , ,( ), :i: , , whereas c. perfringens was counted as < colony forming units (cfu)/g. salmonella spp. was not detected by real-time pcr in the commercial dry pet food, and c. perfringens was counted as < cfu/g. diarrhoea is common in domestic cats, occurring as a result of gastrointestinal disease (including dietary causes, gastrointestinal infection, inflammation or neoplasia) or extra-intestinal disease, and the diagnosis can be frustrating for clinicians and owners alike [ ] . the traditional diagnosis of feline salmonellosis is based on the isolation of salmonella spp. in conjunction with clinical signs and assessment of the potential risk factors because the isolation of salmonella from cats alone can be insufficient [ ] . in this report, the culture results of rmbd, the clinical signs of the two cats, the detection of salmonella spp. dna in cat number and the exclusion of other potential aetiological agents (with the exception of c. perfringens toxin a gene detection) suggest this is a case of salmonellosis. in relation to the c. perfringens toxin a gene detected in the faeces of case number , c. perfringens biotype a is the most common genotype in dogs and cats and part of the normal canine intestinal microflora [ ] . its role as an enteropathogen is not fully understood and it is suspected to be associated with anything from mild, selflimiting diarrhoea to rapidly fatal necrohaemorrhagic enteritis. most studies indicate this as a primary enteropathogen but some authors suggest it could act as an opportunistic agent in dogs and cats [ ] . disruption of the normal microbiota, such as a sudden change to a high protein diet, or enteric infection by other pathogens, like parvovirus, are considered predisposing factors in dogs [ , ] . diagnosis of c. perfringens type a associated diarrhoea in companion animals is challenging because the clinical signs cannot be differentiated from enteritis caused by other enteropathogens. recent studies correlating the presence of cpe in feces with diarrhoea in dogs suggest that the detection of this toxin in stool samples could be useful to diagnose c. perfringens type a-associated diarrhoea. however, no study has confirmed the role of the c. perfringens enterotoxin in dogs and both enterotoxin and isolates positive for the cpe gene can be found in healthy dogs, so these methods could suggest that c. perfringens is involved, but they are not confirmatory [ ] . similar observations are reported to explain the results from the ideex available for case no. . the notes linked to cpa and cpe laboratory results highlight that the presence of the dna of the c. perfringens alpha toxin over , copies/g could be implicated in the clinical signs but, in case of cpe copies under the limit or absent, as in our case, it is unlikely that cpa is the cause of diarrhoea and definitely not cpe. all these aspects led us to speculate that a co-infection was responsible. it is important to note that unlike studies in dogs, no association has been found between diarrhoea and detection of the enterotoxin in stool samples or detection of cpe in c. perfringens strains isolated from cats. hence, the diagnosis should be based only on the isolation of c. perfringens (positive or negative for cpe) in conjunction with the absence of other enteropathogens [ ] . the detection of salmonella spp. dna in case number faeces and the isolation of salmonella in the commercial rmbd support the hypothesis of a salmonella infection caused by the consumption of contaminated rmbd. however, no cultural examinations were performed in faeces of the two cats to avoid isolates from animals and feed being characterized by a discriminative typing method, therefore representing a major limitation of our findings. considering that the sources of salmonella exposure are dependent on whether cats are indoor or outdoor pets [ ] and that both cats were households pets with no contact with other animals or the outside environment, the most likely source of exposure is consumption of food contaminated with salmonella. in this context, veterinary practitioners should be trained and encouraged on the need for faecal culture in case of positive pcr findings in order to optimize the identification and management of enteropathogenic bacteria in companion animals [ ] . in recent years, rbmd has become an increasingly popular trend in unconventional pet food [ ] even if raw meat is frequently contaminated with salmonella [ ] thereby posing health risks to both animals and owners. a recent canadian study estimated salmonella prevalence in canine rmbd at approximately % with a higher prevalence in raw food diets containing chicken compared with other meat types [ ] . several salmonella-related recalls of raw foods have been reported in recent years, including frozen cat food in the usa [ ] , in contrast with the decreased salmonella prevalence in dry feeds [ ] . raw food is well-known to pose a substantial risk of infectious disease to the pet, the pet's environment and the humans in the household, but there are no data on the number of dogs and cats that have become ill after eating contaminated food, or the percentage of pet owners who feed commercial or prepared rmbds [ ] . to date, only one report associated the infection with raw diet and the infection was fatal in cats [ ] . raw food diets for companion animals could represent a potential pet-associated source of salmonella spp. in humans. several reports in the literature have documented salmonella spp. transmission from cats to humans by household and occupational contact [ ] but no confirmed cases of human salmonellosis have been associated with raw food diets [ ] . in any case, owners who decide to feed animals with rmbd should take strict precautions to avoid direct or indirect transmission, also considering the close relationship that most owners have with their pets. this report suggests that rmbd should be fed to pets with caution as they could lead to infection, especially in animals with impaired host immune defences. veterinary practitioners should educate pet owners about the zoonotic risks although the risk to human health remains unquantified. abbreviations cpa: clostridium perfringens toxin a gene; cpe: clostridium perfringens enterotoxin gene (cpe).; rmbd: raw meat-based diets we acknowledge dvm fabris and the cats' owner mr. greco who kindly shared documents and cases. funding was provided by the department of veterinary medical sciences, university of bologna, italy to a. serraino. the data supporting our findings are contained within the manuscript. authors' contributions fg, as and sp coordinated the case report and reviewed the literature; jm conducted the cases; all authors contributed to writing the manuscript and read and approved the final manuscript. in both admitted cases the owner gave his informed consent to participate in the study. in both admitted cases the owner gave his informed consent for publication. the authors declare that they have no competing interests. animal contact as a source of human non-typhoidal salmonellosis scientific opinion of the panel on biological hazards on a request from the european commission on a quantitative microbiological risk assessment on salmonella in meat: source attribution for human salmonellosis from meat enteropathogen co-infection in uk cats with diarrhoea prevalence of potentially pathogenic enteric organisms in clinically healthy kittens in the uk prevalence of enteric zoonotic organisms in cats pneumonia associated with salmonella spp. infection in a cat receiving cyclosporine enteropathogenic bacteria in dogs and cats: diagnosis, epidemiology, treatment, and control salmonella infections in dogs and cats septicemic salmonellosis in two cats fed a raw-meat diet prevalence of enteric zoonotic agents in cats less than year old in central new york state enteropathogens identified in cats entering a florida animal shelter with normal feces or diarrhea prevalence of selected bacterial and parasitic agents in feces from diarrheic and healthy control cats from northern california bacterial zoonoses transmitted by household pets: state-of-the-art and future perspectives for targeted research and policy actions evaluation of the risks of shedding salmonellae and other potential pathogens by therapy dogs fed raw diets in ontario and alberta the risk of salmonellae shedding by dogs fed salmonella-contaminated commercial raw food diets raw food diets in companion animals: a critical review human health implications of salmonella-contaminated natural pet treats and raw pet food current knowledge about the risks and benefits of raw meat-based diets for dogs and cats isolation of avian strains of salmonella enterica serovar typhimurium from cats with enteric disease in the united kingdom clostridium perfringens: a review of enteric diseases in dogs, cats and wild animals enteric clostridium perfringens infection associated with parvoviral enteritis in dogs: cases ( - ) evaluation of pet-related management factors and the risk of salmonella spp. carriage in pet dogs from volunteer households in ontario the occurrence and antimicrobial susceptibility of salmonellae isolated from commercially available canine raw food diets in three canadian cities investigation of listeria, salmonella, and toxigenic escherichia coli in various pet foods • we accept pre-submission inquiries • our selector tool helps you to find the most relevant journal submit your next manuscript to biomed central and we will help you at every step: key: cord- - yik yc authors: lojkić, ivana; krešić, nina; Šimić, ivana; bedeković, tomislav title: detection and molecular characterisation of bovine corona and toroviruses from croatian cattle date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: yik yc background: bovine coronavirus (bcov) together with bovine torovirus (btov), both members of the coronaviridae family, order nidovirales are the most common viral enteric pathogens. although studied separately, their joint occurrence and the molecular diversity in cattle in croatia have not been investigated. methods: a survey is carried out on fecal samples from diarrheic young and adult cattle during the -year period from i) one large dairy herd, ii) four small herds and iii) three nasal and paired fecal samples from calves with symptoms of respiratory disease. samples were submitted to rt-pcr and sequencing for bcov nucleocapsid gene, bcov spike gene and btov spike gene. results: bcov was detected in . % of fecal samples from symptomatic cattle and three nasal and paired fecal samples from calves with respiratory symptoms. btov was detected in . % of fecal samples from symptomatic cattle and a fecal sample from calves with respiratory symptoms. molecular characterisation of those viruses revealed some nucleotide and aminoacid differences in relation to reference strains. conclusions: btov should be regarded as a relevant pathogen for cattle that plays a synergistic role in mixed enteric infections. diarrhea is an important disease affecting cattle worldwide. together with the bovine rotavirus (brov), bovine coronavirus (bcov) and bovine torovirus (btov), both members of the coronaviridae family, order nidovirales [ ] are the most common viral enteric pathogens. they both cause diarrhea and respiratory-tract infections in calves as well as in adult cattle [ ] [ ] [ ] [ ] . coronaviridae members are enveloped viruses with non-segmented positive-sense single stranded rna genome [ ] . these viruses share the same basic genome organization and similar replication strategies. however, there are marked differences in genome size, host range, and virion architecture [ , ] and there is no antigenic relationship between these two viruses. the virions of corona and toroviruses contain four and five structural proteins, respectively: the spike (s), the membrane (m), the haemagglutinin-esterase (he) protein, the nucleocapsid (n) protein and the small envelope (e) protein [ ] . the latter is not present in toroviruses. another specificity of some coronaviruses is the internal nucleocapsid orf coding for i protein [ ] . variations in host range and tissue tropism of coronaviruses are attributed to the spike (s) glycoprotein [ ] . this protein is cleaved by an intracellular protease into two functional domains [ ] . the peripheral s subunit is responsible for virus binding to host-cell receptors [ ] , induction of neutralizing antibodies [ ] , and haemagglutination activity [ ] . the s sequence is variable, mutations in this region have been associated with altered antigenicity and virus pathogenicity [ ] and this region has been exploited as a target to study the molecular epidemiology of bcov infection [ , ] . the sequence of the s subunit is more conserved and this subunit is responsible for cell membrane fusion activity [ ] . bcov infection has a high morbidity but a low mortality and is found worldwide among cattle of all ages [ ] . outbreaks typically occur in autumn and winter [ , ] . economic losses can be heavy due to a marked reduction in milk yield [ , ] . btov, formerly called breda virus, was originally isolated from diarrheic calves in breda, iowa, in . until today, btov was described in diarrhoeic calves in various countries [ , , [ ] [ ] [ ] [ ] [ ] ] . the faecal prevalence of btov in calf diarrhea ranges from . % in south korea [ ] to . % in southern ontario, canada [ ] . there are no available published data about the viral agents that are involved in calf diarrhea, although reports of the farmers complaining in calf diarhhea are very often. in this work we investigated fecal samples of cattle from one large dairy herd and from four small farms during the -year period. we also characterised nasal and paired fecal samples from calves with symptoms of respiratory disease. so for the first time, the occurrence and the molecular phylogeny of bcovs and btovs in selected herds from croatia are assessed. this statement confirms that sampling for the purpose of this research was performed as non experimental clinical work with respecting the rules of veterinary profession. all samples were collected by veterinarian nina krešić, license number . sampling was performed strictly on the owner request. this statement is an annex to ethical committee permission of veterinary faculty university of zagreb; number: - - / - - . fecal samples from diarrheic animals were collected from march to may . samples originated from calves and adult cattle from one large dairy herd (designated as "b") in eastern croatia (n = ) and four small family farms in central croatia (designated as "k"), all mixed dairy-beef production (n = ). three nasal swabs were collected in in east croatia from calves showing respiratory symptoms (designated as "d"). a paired pooled fecal sample was taken from the same calves. all sampled cattle were showing clinical signs of enteric infection except those designated as d -d where respiratory signs were present. fecal samples were diluted : in minimal essential medium (ph . ; life technologies, usa) with addition of % antibiotic antimycotic solution (sigma-aldrich). suspensions were centrifuged at , g for min at °c and only the supernatants were used in the assays. all fecal samples were also tested by rt-pcr for rotavirus-a [ ] . nasal samples were tested by pcr/rt-pcr for bovine herpes virus type (bhv- ) [ ] , bovine respiratory syncytial virus (brsv) [ ] , bovine parainfluenza virus type (bpiv- ) (in-house method) and bovine viral diarrhea virus (bvdv) [ ] . viral rna was extracted from samples using qiaamp®-viral rna (qiagen, hilden, germany), according to manufacturer's instructions. cdna synthesis were performed with moloney-murine leukaemia virus reverse transcriptase (m-mlv rt) (invitrogen, usa) and random primers ( ng/ll) (invitrogen) in a ul final reaction volume. the cdna of each sample was screened for the bcov, btov and brov-a genome using the primers described in table . pcr reactions were performed using gotaq™ green master mix (promega, usa), according to manufacturer instructions. a total of samples were chosen for sequencing; all samples were sequenced for partial bcov n and s gene, and five of these samples were sequenced for btov s gene as well. eight samples were from large dairy farm in eastern croatia (b / , b / , b / , b / , b / , b / , b / , b / ); four samples were from small family farms in central croatia (k / , k / , k / , k / ), and four from calves with respiratory symptoms (d -d f). amplified pcr products were purified using exosap (usb, staufen, germany) and direct sequenced using the pcr primers in both directions by macrogen inc. (seoul, korea). nucleotide sequences generated in this study have been submitted to genbank and were assigned the following accession numbers as listed in table . sequences were aligned and compared to previously published bcov n, bcov s and btov s sequences, respectively. sequence identities of nucleotides as well as estimation of the evolutionary divergence between sequences were analyzed using bioedit and mega [ ] software, respectively. the neighbour-joining (nj) trees were obtained using mega program with the evolutionary model set to tamura-nei + gamma for spike gene analysis and kimura- parametar for n gene. estimation of best-fit model by hierarchical likelihood ratio tests (hlrts) and approximate akaike information criterion (aic) was performed with jmodeltest v. . . . [ ] . reliabilities of phylogenetic relationships were evaluated using nonparametric bootstrap analysis with replicates for nj analysis. bootstrap values exceeding were considered well supported. the (table ) . samples were chosen to cover three-year period. comparative analysis of the bcov n sequences (nucleotides (nt) - ; n protein amino acid (aa) - ; i protein aa showed that all croatian strains obtained in - shared a high identity both at the nt level ( - %) and at the deduced n protein aa level ( . - %). sequences from eight samples from large dairy farm designated as "b" in the eastern region were mutually % identical and most similar to italian strain / - bubalus (eu ) and irish rvlc (kf ) ( , %). fecal samples designated as "k" and fecal and nasal samples "d" were more similar to human enteric isolates ok- - and (fj ) ( . - . %) but phylogenetically clustered with other croatian strains and to italian / - and irish rvlc (fig. a) . the bcov strains obtained from respiratory and enteric disease did not show any consistent nucleotide differences in the sequenced n region. the bcov strains obtained from respiratory disease showed two aa differences in the sequenced s region: ( ser-ile, ile-val). comparative analysis of the nt bcov s sequence (nt - ; aa - ) showed that all croatian strains shared a high identity both at the nt level ( . - %) and at the deduced aa level ( . - %). "k" sequences were identical . - %, "b" - % and "d" . - %. our isolates were most similar to danish strain den - (kf ) ( . - . %) and italian strains bubalus / - , / -tn and / ( . - . %) and were phylogenetically clustered with them (fig. b) . on aa level, our isolate k were % identical to danish den - (kf ). analysis of the nt btov s sequence (nt - ; aa - ) showed . - . % identity between our strains at the nt level and . - . % at the deduced aa level (except for the strain b / that were more divergent). croatian btov strains "b" did not show any consistent nt or aa differences in the sequenced s region. they were most similar to japanese na- (ab ) ( . - . %) and were phylogenetically clustered with them (fig. ) . isolate d f, obtained from the feces of calf with respiratory symptoms were most identical to japanese aichi ( . %) and european b ( %). this is the first report on the detection of torovirus infection in cattle, as well as molecular characterization of bcovs and btovs in croatia. we determined the partial n and s gene sequences of bcov and partial s gene sequences of btov from i) one large dairy herd during -year period ("b"), ii) four small family farms ("k") and iii) paired fecal and nasal samples from calves entered into feedlot ("d"). bcov vaccination is not practiced in croatia. all croatian bcov n and s gene sequences are clustered together and with sequences from italy, denmark and sweden, separately from the cluster with respiratory strains and the reference strain mebus (fig. ) . in this cluster they were further grouped geographically as "b", "k" or "d" subgroup. the similar clustering is obtained when aa sequences for n and i proteins were analysed (data nor shown). all sequences from the same subgroup were mutually identical when n gene was analysed. more diversity is recognized when s gene was analysed, but sequences from large dairy herd ("b") were still - % identical. this lead to the conclusion that the same bcov strain circulated for extended period of time within one herd. in our investigation, we covered the s region from aa - which covers the previously reported hypervariable region (aa - ) [ , ] but not the s cleavage site (aa - ). samples obtained from small family farms ("k") showed less mutual identity on s ( . - %) compared with those that came from the same herd ("b"). the bcov strains obtained from respiratory disease showed two aa differences in the sequenced s region: ( ser -ile, ile -val), but compared to paired fecal sample, no aa differences and only two nt differences were found. previous researchers demonstrated that some bcov strains isolated from the respiratory tract had different biological, antigenic [ ] [ ] [ ] and genetic [ , ] properties compared with enteric bcov strains, whereas others did not detect any consistent differences [ , ] and some suggested that the same strains of bcov cause natural outbreaks of respiratory and enteric disease [ , , , ] . our findings, although based on a minimal data are in agreement with the latter fact; there were no differences between respiratory/fecal sample pair. still, the identified change in amino acid could affect the aa polarity (hydrophilic to hydrophobic). regarding the herd designated as "d", outbreak of respiratory disease followed soon after entry into a feedlot. those calves were also rt-pcr positive to brsv but negative to bhv- , bpiv- and bvdv. therefore, it was a typical scenario of bovine respiratory complex (brc) as a consequence of stress from transport and change in husbandry. the percentage of btov infections in the present study ( [ ] . still, conclusions based on these frequencies are not reliable because this study was not originally planned as an epidemiological study. according to previous study [ ] , btov alone has been shown to act as a primary enteric pathogen in cattle. in our study, btov was found only in co-infection with bcov and brv-a ( table ) . it is noteworthy to say that co-infection with brov-a had not influence on bcov and btov sequence diversity. despite the fact that btov causes diarrhea and respiratory infections in cattle of all ages [ ] our isolates from respiratory disease were negative. this also means that respiratory btov infection cannot be excluded if more samples has been analysed. croatian btovs showed moderate to high degree of nucleotide ( . - . %) and amino acid identity ( . - . %). comparison of our sequences with one available btov s gene sequence from europe (aj ) and four sequences from japan showed high degree of sequence identity ( . - . %) between our strains from large dairy farm ("b") and japanese strain na- (ab ). on contrary, sequence from feces of calves with respiratory symptoms were more similar to european strain b (aj ) ( %), and japanese strain aichi ( . %). phylogenetic analysis revealed that our sequences of btov s gene from symptomatic animals are more closely related to sequences from japan than to the breda strain and european strain (fig. ) . still, fecal isolate from herd with respiratory disease clustered with european and other japanese strains and was more related to breda (fig. ) . despite relatively small number of samples investigated, we can clearly conclude that bcovs and btovs (together with rotaviruses) are common enteric pathogens of cattle of all ages and production categories in croatian herds. required steps in herd management should include raising awareness of the adequate and timely colostrum intake by the calf as well as vaccination of the cows with one of the commercially available vaccine before calving. although on minimal data, we have proved that the same bcov strain circulated for extended period of time within one herd but different strains circulated in different herds. molecular characterisation of those viruses revealed some nt and aa differences in relation to reference strains, but generally, croatian sequences are clustered with other, mainly european btov and bcov isolate sequences. nidovirales: a new order comprising coronaviridae and arteriviridae association between infection of the respiratory tract attributable to bovine coronavirus and health and growth performance of cattle in feedlots isolation of respiratory bovine coronavirus, other cytocidal viruses, and pasteurella spp. from cattle involved in two natural outbreaks of shipping fever first detection and molecular diversity of brazilian bovine torovirus (btov) strains from young and adult cattle association of enteric shedding of bovine torovirus (breda virus) and other enteropathogens with diarrhea in veal calves bovine coronavirus infection the genome organization of the nidovirales: similarities and differences between arteri-, toro-, and coronaviruses the molecular biology of coronaviruses the nucleocapsid protein gene of bovine coronavirus is bicistronic coronavirus spike proteins in viral entry and pathogenesis localization of neutralizing epitopes and the receptor-binding site within the amino-terminal amino acids of the murine coronavirus spike protein a single amino acid change within antigenic domain ii of the spike protein of bovine coronavirus confers resistance to virus neutralization the s protein of bovine coronavirus is a hemagglutinin recognizing -o-acetylated sialic acid as a receptor determinant two amino acid changes at the n-terminus of transmissible gastroenteritis coronavirus spike protein result in the loss of enteric tropism detection and isolation of winter dysentery bovine coronavirus circulated in korea during - molecular epidemiology of bovine coronavirus on the basis of comparative analyses of the s gene the s subunit of the spike glycoprotein of bovine coronavirus mediates membrane fusion in insect cells detection and characterization of bovine coronaviruses in fecal specimens of adult cattle with diarrhea during the warmer seasons respiratory disease associated with bovine coronavirus infection in cattle herds in southern italy experimental reproduction of winter dysentery in lactating cows using bcov -comparison with bcov infection in milk-fed calves bovine respiratory coronavirus the significance of bredavirus as a diarrhea agent in calf herds in lower saxony detection of bovine torovirus in fecal specimens of calves with diarrhea from ontario farms torovirus detection in faecal specimens of calves and pigs in hungary: short communication phylogenetic and evolutionary relationships among torovirus field variants: evidence for multiple intertypic recombination events molecular epidemiology of bovine toroviruses circulating in south korea epidemiological analysis of bovine torovirus in japan evaluation of a human group a rotavirus assay for on-site detection of bovine rotavirus detection of bovine herpesvirus type in blood from naturally infected cattle by using a sensitive pcr that discriminates between wild-type virus and virus lacking glycoprotein restriction enzyme analysis of rt-pcr amplicons as a rapid method for detection of genetic diversity among bovine respiratory syncytial virus isolates genetic typing of croatian bovine viral diarrhea virus isolates. vet arhiv mega : molecular evolutionary genetics analysis version . phylogenetic model averaging comparative sequence analysis of a polymorphic region of the spike glycoprotein s subunit of enteric bovine coronavirus isolates analysis of the s spike (peplomer) glycoprotein of bovine coronavirus synthesized in insect cells antigenic variation among bovine enteric coronaviruses (becv) and bovine respiratory coronaviruses (brcv) detected using monoclonal antibodies isolation of bovine respiratory coronaviruses from feedlot cattle and comparison of their biological and antigenic properties with bovine enteric coronaviruses antibody responses to respiratory coronavirus infections of cattle during shipping fever pathogenesis nucleotide and predicted amino acid sequences of all genes encoded by the ' genomic portion ( . kb) of respiratory bovine coronaviruses and comparisons among respiratory and enteric coronaviruses bovine coronaviruses associated with enteric and respiratory diseases in canadian dairy cattle display different reactivities to anti-he monoclonal antibodies and distinct amino acid changes in their he, s and ns . protein studies on the relationship between coronaviruses from the intestinal and respiratory tracts of calves comparison of the s genes and the biological properties of respiratory and enteropathogenic bovine coronaviruses failure to spread bovine virus diarrhoea virus infection from primarily infected calves despite concurrent infection with bovine coronavirus tracing the transmission of bovine coronavirus infections in cattle herds based on s gene diversity characterization of epidemic diarrhea outbreaks associated with bovine torovirus in adult cows experimental inoculation of adult dairy cows with bovine coronavirus and detection of coronavirus in feces by rt-pcr submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution this research was supported by grant no. - - from the ministry of science, education and sports, republic of croatia. the authors declare that they have no competing interests.authors' contributions il and nk conceived the study, designed the experiments, performed all the experiments, analyzed the data and drafted the manuscript. iŠ participated in writing the manuscript. tb helped in study design, study implementation and manuscript revision. all the authors have read and approved the final manuscript. key: cord- -u vme c authors: eussen, björn g.m.; schaveling, jaap; dragt, maria j.; blomme, robert jan title: stimulating collaboration between human and veterinary health care professionals date: - - journal: bmc vet res doi: . /s - - -x sha: doc_id: cord_uid: u vme c background: despite the need to control outbreaks of (emerging) zoonotic diseases and the need for added value in comparative/translational medicine, jointly addressed in the one health approach [one health initiative (n.d.a). about the one health initiative. http://www.onehealthinitiative.com/about.php. accessed september ], collaboration between human and veterinary health care professionals is limited. this study focuses on the social dilemma experienced by health care professionals and ways in which an interdisciplinary approach could be developed. results: based on gaertner and dovidio’s common ingroup identity model, a number of questionnaires were designed and tested; with progress, the relation between collaboration and common goal was assessed, mediated by decategorization, recategorization, mutual differentiation and knowledge sharing. this study confirms the common ingroup identity model stating that common goals stimulate collaboration. decategorization and mutual differentiation proved to be significant in this relationship; recategorization and knowledge sharing mediate this relation. conclusions: it can be concluded that the common ingroup identity model theory helps us to understand how health care professionals perceive the one health initiative and how they can intervene in this process. in the one health approach, professional associations could adopt a facilitating role. to control outbreaks of (emerging) diseases at an early stage, effective collaboration between human and veterinary healthcare professionals is essential [ ] . however, to date, collaboration has taken place only on a very limited scale [ ] [ ] [ ] [ ] [ ] [ ] . for this reason, one health, an interdisciplinary approach addressing the connections between health care for humans, animals and the environment and focused on the elements biomedical research, enhanced public health efficacy, an expanded scientific knowledge base and improved medical educational and clinical care in which human and veterinary healthcare and other stakeholders work together [ ] , is placed high on the agendas of organizations such as the who, the european commission's directorate-general for health and consumers, usa centers for disease control and prevention [cdcp] and worldbank [ , [ ] [ ] [ ] . because more than three-quarters of all the infections seen in humans originate in animals [ ] , there is great and widespread interest in the effective collaboration between human and veterinary healthcare professionals as a means to halt outbreaks of infections at an early stage. the outbreak of severe acute respiratory syndrome (sars), for instance, which was not even known to be an animal-transmitted infection when it first occurred, is estimated to have caused a loss of as much as us$ billion in terms of gross domestic product (gdp) worldwide [ ] . other examples include the recent outbreaks of avian influenza and q fever in the netherlands, which have shown that serious outbreaks can have major consequences for human and animal health [ ] . areas where close cooperation would be fruitful because they share the same goals include combatting and controlling zoonoses and emerging zoonoses; here, the interdependence of the two fields requires an integrated approach. in efforts to reach mutual goals, an interdisciplinary exchange of knowledge between the two professional groups can lead to a sharing of domainspecific expertise and experience, thus enabling experts to identify possible zoonotic infections and to fight them with the help of appropriate control measures at earlier stages [ ] . another advantage of collaboration between these two groups of healthcare professionals, besides the more adequate fight against infectious diseases, is the exchange of knowledge on the treatment of diseases [ ] leading to major healthcare cost savings [ , ] and to new scientific insights [ ] . in order to better understand the mental motivation of health care professionals with respect to the one health approach, this study used psychosocial concepts such as social dilemma, (group) identification and category thinking. collaboration can be defined as "any action which is intended to benefit others, regardless of whether the actor also benefits in the process" [ ] . however, collaboration can also fail to take place: in human and veterinary healthcare, cooperation between professionals can fail to materialize because there is a social dilemma, for instance. to illustrate, there are situations in which a noncooperative course of action is (at times) tempting for each individual in that it yields superior (often short-term) outcomes for the individual himself or herself [ ] . for example, it is commonly accepted that professionals have a constant and permanent responsibility for their patients, who expect care and action in the short term. a healthcare professional may therefore view collaboration, which may (at times) exceed or influence his own day-to-day operations, as not sufficiently important, at least for the short term. but if everyone pursues this non-cooperative course of action, then everyone will ultimately be worse off (often in the longer term) than would have been the case if everyone had collaborated. collaboration between human and veterinary healthcare professionals can be characterized as a social dilemma. it is often thought that a lack of time is the main reason why healthcare professionals feel they have so little psychological room for greater collaboration. fleuren, wieferink and paulussen [ ] , however, show that healthcare professionals actually have other reasons than time; what lies at the heart of their limited cooperation is a lack of clarity as to why collaboration should be organized in the first place. the individuals concerned do not always have a sufficiently well-defined idea of the benefits offered by increased contact and collaboration, even though collaboration is highly desirable both for the sector itself and for society as a whole [ ] . in this regard and in any event, the (long-term) awareness of sharing a common goal is of crucial importance. collaboration is stimulated if the (perceived) benefits outweigh the individual arguments or circumstances of the healthcare professionals concerned. this type of calculation, or dilemma, can lead to cooperation 'for the public good'. considering its objectives, one health can be seen as a public good dilemma, because "public good dilemmas require individuals to make an active contribution to establish or maintain a collective good, such as building a local bridge or joining a social movement" [ ] . however, in terms of making room for the bigger collective goal alongside their responsibilities related to the day-to-day care of their own patients, human and veterinary healthcare professionals often see insufficient added value [ ] , even though a greater awareness of the added value associated with collaboration would ultimately result in improved care [ , , ] . greater awareness of the added value brought about by collaboration on the part of healthcare professionals is consistent with the social desire for more intensive collaboration between human and veterinary healthcare [ , [ ] [ ] [ ] ] . these two groups of healthcare professionals speak the same 'language' and should therefore be able to understand each other well [ ] . despite the fact that, broadly speaking, both groups followed similar training programmes [ , ] and perform similar clinical procedures, there is hardly any exchange of knowledge and experience [ ] . in addition, a clear focus on common goals is lacking, and collaboration between human and veterinary healthcare professionals remains limited at present [ , , ] . so far, collaboration has only taken place in a limited number of research areas and only occasionally during outbreaks of emerging diseases [ , ] . closer examinations have revealed that the limited scale of collaboration is due, among other things, to mutual prejudices [ ] and psychological barriers between the parties concerned [ ] . such mutual judgements and prejudices may disrupt the development of collaboration, but research into these phenomena has so far remained very limited. the present study is aimed to help fill that gap. in order to gain a better understanding of what stimulates cooperation among healthcare professionals, we used the common ingroup identity model developed by gaertner and dovidio [ ] . this theory provides insight into the relationship between individual perceptions and behaviours towards groups and lists possible causes which may influence these. according to the common ingroup identity model, sharing a common goal affects the degree of collaboration, but this relationship is also influenced by the perception of this degree and the means of categorization [ , ] . the common ingroup identity model [ ] focuses on the individual's perception with regard to the group. in essence, the model states that members who see themselves as belonging to a larger, common whole consciously classify themselves within that larger whole, as a result of which prejudices between groups or communities decrease. according to gaertner and dovidio, collaboration is influenced by characteristics (in this study qualified as the common goal) which play a role in the individual perception of the situation: does the individual perceive the existence of a single overarching group, several groups or subgroups, or no group at all? if individuals feel that they belong to a group, in this case 'healthcare' , this will lead to more positive thoughts, feelings and behaviours among the individuals in the groups concerned [ ] . as explained above, when group members see themselves as part of a larger whole and when they classify themselves within this structure, prejudice between groups or communities is reduced. according to kramer and brewer [ ] , people within a group or an overarching whole are prepared to share communal resources and other supplies, but they will develop resistance if these have to be shared with others outside the group. still, a change occurs if these outsiders can be placed within a perceived larger whole. the realization that there is in fact a larger whole means that the positive thoughts, feelings and behaviours (such as the sharing of resources and information) which would normally be reserved for the individual's own familiar group are extended to members of other communities who also belong to the larger overarching whole. common endeavour and classifying thus go hand in hand, leading to feelings of 'us' rather than feelings of 'us versus them'. in other words, it depends on how an individual sees his group or subgroup within a larger whole [ ] . using the common ingroup identity model, we quantitatively assessed healthcare group interrelationships in order to gain insight into the contributions towards cooperation that can be made by means of a common goal for healthcare professionals formulated via their perception of group formation. in the past, the common ingroup identity model was researched primarily in experimental studies, with a main focus on perceived group formation [ ] . a limitation of the model is that the duration of the effect of an intervention is unclear, as is the reduction of bias [ ] . the current study will not only indicate whether the common ingroup identity model is useful for the respective groups of healthcare professionals, but it will also quantitatively assess the relationships between the common goal and collaboration in combination with associated mediating factors. in this way, the study will contribute to further theoretical development in terms of validation as well as to the quantitative usefulness of the common ingroup identity model. it will also examine whether the exchange of knowledge is an additional trigger for collaboration once healthcare professionals have become aware of the common goal. in the social dilemma referred to earlier, where there is insufficient awareness of the possible advantages of collaboration, and in this case human and veterinary collaboration, crucial factors include the reasons why healthcare professionals place themselves in a particular category and identify with their 'own' professional group [ , , ] . it is 'natural' for people to engage in social categorization: the brain is hard-wired to think in terms of categories, and categories form the basis for standard judgements and prejudices [ ] . the advantages of social categorization are that individuals know where they stand and what is expected of them, and that a group or community contributes to a feeling of (social) well-being [ ] . the same is true of human and veterinary healthcare professionals, although a certain distance is maintained between them [ , ] . after all, what is qualified by the terms 'human' and 'animal' is placed in different categories. this is illustrated by the dichotomy between the two professional groups, established on the basis of typical activities, with 'human patient' being contrasted with 'animal patient' , and hence on the basis of categorybased thinking [ ] . still, mutual contact alone does not lead to productivity or better joint results; for good results, interdependence is necessary [ , ] . if individuals perceive a common goal, in this case 'improving care through one health' , then according to the common ingroup identity theory this can be expected to lead to more positive thoughts, feelings and behaviours between individuals in the groups concerned [ ] , because there will then be more perceived interdependence between the two groups. according to the common ingroup identity theory, the awareness of a larger whole or a common ingroup, in this case a joint responsibility for improving care, will lead to the extension of positive thoughts, feelings and behaviours (such as the sharing of resources and information) that were traditionally reserved for the individual's own familiar group to members of other communities who also belong to the larger overarching whole. in the case of common goals and interests, a clear interdependence can be seen: after all, the aim is to achieve a result which requires contributions from both groups. in their model, gaertner and dovidio [ ] describe a common goal in terms of 'interdependence'. in this respect, collaboration between human and veterinary healthcare professionals is the result of addressing common goals and interests [ , , , , ] . this is in line with the social interdependence theory which argues that interdependence results from a common goal [ ] [ ] [ ] [ ] [ ] . mutatis mutandis, this altruistic goal was recently incorporated in the one health initiative ( ) . this means that one health, as a common goal, can be expected to lead to greater collaboration. this brings us to our first hypothesis: one health as a common goal has a positive effect on collaboration between human and veterinary healthcare professionals. the process of classifying concerns the individual's perception of the connection betweenin this casetwo groups of healthcare professionals: how an individual sees his group or subgroup within a larger whole and whether the individual perceives the existence of a single overarching group, multiple groups or subgroups, or no group at all [ ] . as described earlier, one health can affect how people see themselves as part of a larger, common whole and how they classify themselves within that larger whole. the common ingroup identity theory distinguishes the following types of perception and reclassification: recategorization, decategorization and mutual differentiation [ ] . these types are elaborated below. perceived commonality and perceived common goals (overlap between groups and a stronger feeling of 'us' rather than 'us and them' , recategorization) result in greater collaboration [ , ] . that being said, the feeling of 'us' is not by definition limited to a single group: a person can possess multiple identities because he or she can be a member of multiple groups [ ] . this means that in addition to classifying themselves in the veterinarians' group, veterinarians could also classify themselves in the (overarching) group of healthcare providers [ ] . we speak of recategorization when an overarching identity is perceived in which old groups are represented as a whole or in a new form, for example as a subgroup. via the formation of a subgroup, collaboration between the two groups of healthcare professionals is further enhanced, for instance through awareness of a common goal. this brings us to our second hypothesis: the positive relation between common goal and collaboration is mediated by the partial effect of recategorization. according to gaertner and dovidio [ ] , a common goal causes perceptions to be reclassified into changed perceptions, thus leading to greater collaboration. it may be expected that if healthcare professionals become aware of a common goal, there will be room to recognize the overlap with the other group of healthcare professionals. this type of development is also known as decategorization. if a certain situation is perceived as a form of decategorization, the emotional group connections become less important, so that there will be room for individuals to recognize shared identities. in turn, this will lead individuals to have more extensive contacts with other individuals, as a result of which prejudices will decrease and positive attitudes towards people in a different group can be developed [ ] . this brings us to our third hypothesis: the positive relation between common goal and collaboration is mediated by the partial effect of decategorization. brown and wade [ ] and molleman, broekhuis, stoffels and jaspers [ ] conclude that if one wishes to stimulate collaboration, both groups must be able to retain their old identity. it is possible for the two groups to collaborate, but the researchers believe it is important that both groups continue to operate separately and that both fulfil a complementary role within the framework of their common goal. such a structure, with interdependence and individual space for each group, will ultimately reduce prejudice and tension on either side [ , , ] . this perceived commonality can then lead to greater collaboration [ , , ] . a thorough understanding of interdependence and common endeavour has a psychological effect on interaction, interrelationships and collaboration: it leads to recognition, stimulation and interaction [ ] . in the case of mutual differentiation as a social categorization perception, there is appreciation of the knowledge and expertise on the part of the other professional group. according to gaertner and dovidio [ ] , 'there is a winwin situation which produces positive feelings and stereotyping towards the other group, while the individual's own group can define its own profile'. in the case of recategorization and mutual differentiation, it is important in both cases that the original identity is not abandoned when collaboration takes place. both groups will then be able to retain some autonomy within a common whole and they will not stray too far into each other's territory [ ] . where the common goal (in casu one health) is perceived as collaboration by mutual differentiation, a special focus lies on the importance of each of the groups with respect to their different qualities and expertise. hewstone and brown [ ] state that collaboration should be focused on complementary knowledge and expertise. collaboration will be triggered by paying attention to each other's knowledge and expertise, as a function of the clarity of a common goal. this brings us to our fourth hypothesis: the positive relation between common goal and collaboration is mediated by the partial effect of mutual differentiation. ives, torrey and gordon [ ] argue that having a clear common interest leads to situations in which an exchange of knowledge can take place. in addition to what follows from the common ingroup identity model, it can be assumed that knowledge sharing leads to collaboration because individuals can use each other's expertise [ ] [ ] [ ] . knowledge sharing between teams and groups improves performance and effectiveness [ ] [ ] [ ] . added value can be achieved by having professionals from different backgrounds learning and working together, thanks to the possibilities offered in terms of exchanges, the integration of knowledge and innovation. advantages are particularly associated with the sharing of implicit knowledge and new insights [ ] . collaboration is promoted by knowledge transfer through informal or small-scale processes and lateral, social contacts [ , ] . kramer and brewer [ ] showed that individuals were particularly inclined to share knowledge with others within their own group, but also that they can be more reticent with more distant contacts. in that case, and especially in the case of one health, it is important to address perceived distance; when others are perceived as less distant, they will have fewer reservations to collaborate within the framework of one health. finally, holmes [ ] demonstrates a positive connection between (continuing) knowledge sharing and mutual ties, trust within a group and collaboration [ , , ] . this brings us to our fifth hypothesis: the positive relation between common goal and collaboration is mediated by the partial effect of knowledge sharing. our study sample consisted of respondents. by means of a digital newsletter from the professional organizationsthe royal dutch veterinary association (knmvd) and the royal dutch medical association (knmg)human and veterinary healthcare professionals were invited on a one-off basis to complete the questionnaire. the questionnaire was sent to , human and veterinary healthcare professionals. in addition to these professional associations, human and veterinary healthcare professionals were contacted via social media such as linkedin and twitter. a total of healthcare professionals responded, of whom completed the survey in full. of the respondents, ( %) were human healthcare professionals; ( %) were veterinary healthcare professionals. the low response rate demonstrated by the group of human healthcare professionals could be explained by their limited interest in the one health topic [ ] . an illustration of this can be found in the difference in attention paid to the topic in the professional body's journals. during the last five years, one health was mentioned only nine times in the weekly dutch journal of human healthcare professionals; in contrast, every monthly issue of the veterinary journal elaborated on the topic. of all our respondents, % were female. the average age of the respondents was , and respondents had been working in the profession for an average of approximately years. % of respondents were still active in clinical practice and % were working outside clinical practice. of the healthcare professionals, respondents ( %) had completed their studies in utrecht. % of respondents had studied abroad, and of these more than % had studied in belgium. of the respondents, ( %) were members of the professional association, over % regularly read a professional journal in their own field, and fewer than % regularly read a professional journal in another field. of the human healthcare professionals, % had a specialization listed in the dutch healthcare professions register (big). in the veterinary sector, the respondents included domestic animal veterinarians, equine veterinarians, farm veterinarians and special animal veterinarians. these general figures tally with the figures obtained from the professional associations; there are no indications of bias. the variables were measured with a series of questions that had been compiled from various existing validated questionnaires. many original items were adapted to the specific situation of human and veterinary healthcare professionals in order to ensure that the items were meaningful to them. the questionnaire took approximately min to complete. apart from a number of open questions (related to age or the number of working years), all items were based on a likert scale ( - ) and can be interpreted as continuous variables, thus following the fundamental ordinary least square (ols) principles. the sevenpoint scale was used to obtain greater dispersion and hence more nuance in the data [ ] . table reports the general descriptives of the variables (mean, sd, alpha and correlations). the dependent variable, collaboration, was based on bock, zmud, kim and lee [ ] with a construct reliability score of . , to which the one-item question on the perceived degree of overlap formulated by schubert and otten [ ] was added (the osio -overlap of self ingroup and outgroup). an example of an item is 'i collaborate when the opportunity arises'. common goal was based on fisman and laupland [ ] and kahn [ ] and has a construct reliability score of . . participants were asked the following: "thinking of possible collaboration between physicians and veterinarians, to what extent do you agree with the following statements?". an example of an item is 'i think more could be done to stimulate innovation in healthcare'. recategorization was measured with questions based on edmondson [ ] with a construct reliability of . . an example of an item is 'in the collaboration between physicians and veterinarians in general, it is possible to raise problems and difficult subjects in the collaboration'. decategorization was measured with a combination of items based on the instruments developed by doosje, ellemers and spears [ ] and shamir, zakay, breinin and popper [ ] . an example of an item is 'in the collaboration between physicians and veterinarians in general, it is considered important to make a lasting contribution to the collaboration'. mutual differentiation was measured with questions based on berendsen, benneker, groenier, schuling, grol and meyboom-de jong [ ] with a construct reliability of . . an example of an item is 'in the collaboration between physicians and veterinarians in general, there is appreciation of the expertise of the other professional group and a readiness to pursue contact on it'. knowledge sharing was based on connolly and kellaway's study [ ] with a construct reliability of . . an example of an item is 'in the collaboration between physicians and veterinarians in general, i am prepared to share specific professional knowledge (expertise) with the other professional group'. the study sample consisted of respondents. this size is acceptable in view of the rule of thumb provided by barclay, higgins and thompson [ ] , which suggests using ten times the maximum number of paths aiming at any construct in the outer model (this is not applicable as no formative constructs were used) and the inner model. all construct variables (collaboration, common goal, recategorization, decategorization, mutual differentiation, and knowledge sharing) are reflective constructs. for the outer model evaluation, internal consistency reliability and convergent validity were examined. the construct reliability scores ranged between . and . , which was acceptable [ ] , and for the convergent validity the average variance extracted (aves) of the constructs was also good [ ] ; this is included in table . secondly, indicator reliability was examined and all factor loadings were found to be higher than . and as such acceptable [ ] . the construct and the factor loadings proved to be satisfactory for use in the analysis, although it can be said that the coefficients of the determinants are lowand that they are negligible in the case of mutual differentiation and decategorization for collaboration. finally, discriminant validity was checked, comparing the aves of the constructs with the inter-construct correlations [ ] . additionally, cross-loadings were checked. evidence was found to exclude three items from mutual differentiation due to cross-factor loadings. partial least squares path modelling (pls-sem) was conducted with smartpls version . [ ] . for the partial least square algorithm, the path weighting scheme was used, and the maximum number of iterations was set to . as stop criterion, ^- was used. a uniform value of was used as an initial value for each of the outer weights [ ] . table shows the correlations between de different variables. reliability and convergent validity of the measurement model was also confirmed by computing standardized loadings for indicators ( table ) and bootstrap t-statistics for their significance [ ] , see table . for this bootstrapping, subsamples were used with a bias-corrected bootstrap testing for a two-tailed significance of %. the coefficient of determination was found to be moderate for collaboration (r = . ). the effect size of common goal on collaboration (f = . ), recategorization on collaboration (f = . ) and knowledge sharing on collaboration (f = . ) can be considered small [ ] . the effect sizes of decategorization on collaboration (f = . ) and mutual differentiation on collaboration (f = . ) were negligible. to obtain the q values as an indicator of the model's predictive relevance, the blindfolding procedure was used, resulting in small predictive relevance for collaboration (q = . ), knowledge sharing (q = . ), and mutual differentiation (q = . ). the effect size for the predictive relevance of common goal on collaboration was very small (q = . ), as was knowledge sharing on collaboration (q = . ). finally, the procedures outlined by preacher and hayes [ ] were followed to examine multiple mediation effects. with the help of multiple mediation models, it is possible to observe not only the direct effect of common goal on collaboration, but also the mediation effects. the mediation effects are a b = . (through recategorization), a b = . (through decategorization), a b = . (through mutual differentiation), and a b = . (through knowledge sharing). figure was designed based on the calculated mediation effects. all paths show a significant relation. this makes the common ingroup identity model an effective model to provide a plausible explanation why human and veterinary healthcare professionals do or do not collaborate. having a common goal, like one health, leads to collaboration via recategorization. this mediating relation is also present for knowledge sharing. however, for decategorization and mutual differentiation, there is a significant relation with common goal and with collaboration; decategorization and mutual differentiation have a direct relation with collaboration that is not a mediating relation. the pls analysis confirms that a common goal promotes collaboration. hypothesis is therefore accepted. bootstrapping the indirect effects of common goal on collaboration, we found that recategorization ( , ) and knowledge sharing ( , ) are significant mediators, thus supporting hypotheses and . the specific indirect effect through knowledge sharing is larger than through recategorization (effect recategorization is significantly smaller; see contrasts) [ ] . significant relations were found between common goal via decategorization with collaboration and for mutual differentiation with collaboration. no evidence was found to support hypotheses (mediating effect of decategorization) and (mediating effect of mutual differentiation). nevertheless, the results indicate an intervening effect for decategorization and mutual differentiation, resulting in a satisfactory explanation why human and veterinary healthcare professionals do or do not collaborate. all four elements (recategorization, decategorization, mutual differentiation and knowledge sharing) are relevant; recategorization and knowledge sharing are mediating variables. common goal proved to be an important factor for promoting collaboration between human and veterinary healthcare professionals. this relationship is partly explained by the mediating role of recategorizing and knowledge sharing, but also partly by the intervening having a common goal (in casu one health) produces altered perceptions in the form of an overarching identity. upon recognizing their interdependence, human and veterinary healthcare professionals will initiate collaboration [ ] . collaboration, if there is a common goal, must therefore be seen to a greater extent as interdependence, as described earlier by mohr and spekman [ ] , in which there is still scope to retain individual identity, as argued by brown and wade [ ] and molleman et al. [ ] . in the case of recategorization, there is scope to retain individual identity since an overarching identity is created. gaertner and dovidio [ ] showed that a common goal leads to a reduction of prejudice and resistance between groups (thus influencing the perception of the situation), which in turn has an influence on collaboration. the current findings point in the same direction. this study shows that in addition to recategorization, knowledge sharing also has a mediating role with respect to the influence of a common goal (one health) on cooperation. findings indicate that one health stimulates knowledge sharing and in this way enhances collaboration between human and veterinary healthcare professionals. it may therefore be concluded that knowledge sharing is a promoting factor for human and veterinary healthcare professionals to use each other's expertise [ ] [ ] [ ] . the healthcare professionals have different backgrounds, but they improve their performance and make it more effective by learning from each other and by collaborating [ ] [ ] [ ] . one health is an important initiative to generate and promote knowledge sharing. this study has shown that knowledge sharing is in fact stimulated if the common goal of one health is perceived as an invitation to work together on the basis of mutual interdependence. seen in this way, continuous knowledge sharing will ultimately improve the ties and the forms of collaboration between the two groups of healthcare professionals [ ] . this study has also shown that decategorization has a significant effect in the relation between common goal and collaboration, although this is not a mediating but an intervening effect. our analyses show that this path, which has also been described by gaertner and dovidio [ ] , also applies to the human and veterinary healthcare professionals. many healthcare professionals will be of the opinion that decategorization is not sufficiently concrete; they will therefore give it little importance, which might explain why we did not find a mediating effect. this study has also revealed that mutual differentiation expresses a significant relation between common goal and collaboration. however, as with decategorization, there is no mediating effect between collaboration and common goal for mutual differentiation. it may therefore be concluded that mutual differentiation helps to explain the collaboration between human and veterinary healthcare professionals. a possible explanation for the fact that no mediating effect was found for mutual differentiation may be limited insight in each other's sectors and expertise, and any untapped added value still to be discovered [ ] . the current study's findings indicate that in order to achieve greater collaboration between human and veterinary healthcare professionals, it is first and foremost necessary to define a common goal. that being said, the concept of one health is not yet sufficiently 'alive' in the heads of healthcare professionals. most of these professionals will probably not have a clear idea of how to interpret it, particularly in their own practice. having a clear common goal will likely help them overcome the social dilemma that healthcare professionals face. after all, these professionals will only be triggered to work together once the common goal is shaped and starts to come alive, as is also argued by ives, torrey and gordon [ ] . these researchers state that having a clear idea of the goal stimulates knowledge sharing. the social dilemma among healthcare professionals referred to earlier [ ] is thus overcome, and the added value of interaction becomes clear to them. a common goal (as investigated in this study) only comes into existence as a result of this concreteness, and this will trigger the mechanisms required to create an overarching identity [ ] . furthermore, it is of importance for both groups of healthcare professionals to know each other and to realize that they have a shared responsibility, not only in terms of combatting infectious diseases, but also in terms of providing optimum care for patients. this insight is expected to facilitate cooperation between the groups of healthcare professionals [ ] . the notion that there are differences between the two groups does not necessarily imply that there is no, or could not be any, collaboration between them [ ] . on the other hand, a word of caution is needed here: we have to be careful not to facilitate or create too much interference concerning the other professionals' fields, because this could result in resistance [ ] . professional associations can play a facilitating role in creating a common goal, promoting recognition and fostering awareness with respect to common responsibilities. knowledge sharing could be shaped, for example, by including articles from the other field in the professional journals of both professional groups. as respondents in the current study reported, fewer than % read a professional journal related to the other sector. the mutual inclusion of each other's articles could be a first step in creating a relatively simple form of knowledge transfer. in addition to the publication of articles in each other's professional journals, professional associations could offer joint interdisciplinary training programmes and refresher courses. it has become increasingly clear that greater awareness of the added value of the common goal results in more extensive cooperation [ , , ] . this awareness reveals not only what both groups of healthcare professionals have in common, but also that human and veterinary healthcare professionals have more in common than they themselves realize. this insight will lower the current psychological barriers between the two groups of healthcare professionals, resulting in more extensive collaboration between them [ ] . this awareness among both groups of healthcare professionals could be further improved via the communications issued by their professional groups. as the current study was a cross-sectional study, it has certain limitations concerning long-term effects or relations. in order to gain a deeper insight into possible causes and consequences, longitudinal research is needed. one health is an interdisciplinary approach and less concrete for healthcare professionals. to stimulate collaboration on the basis of the arguments presented in the current study's introduction, additional and more detailed research is necessary: although one health has been studied as an overarching concept, individual elements have been somewhat neglected. beyond that, we recommend more qualitative research on this subject. this is needed to obtain greater insight not only into 'physicians' and veterinarians' thoughts and feelings, but also into the overlaps between the two groups. in addition, an international study is needed to compare the different worlds. for instance, to the best of our knowledge, in the western world veterinarians generally are greater all-rounders than physicians, but in the developing countries we see that physicians are also allrounders; one would expect that the psychological barrier will be lower between these health care professionals. we expect this to have an influence on their cooperation. to the best of our knowledge, this study is the first research project in which the common ingroup identity model is quantitatively researched with the help of questionnaires. it is recommended that further research be conducted into this model with a view to using it in more quantitative analyses. collaboration between healthcare professionals -the one health approach -can be further investigated by focusing on other characteristics that influence the collaboration between the two groups. possible options are stereotyping and social value orientation. the healthcare sector, and specifically the interaction between the human and veterinary fields, offers untapped potential, such as the development of treatments which could improve the healthcare as a whole. every study that analyzes the interaction between the two fields and addresses the healthcare professional's social dilemma will be of immense value to society and can possibly give indications how to improve the quality of life. this study has shown that the common ingroup identity model helps to explain why human and veterinary healthcare professionals do or do not collaborate. stimulating the interdependency perception, which can be reached with a clear common goal like the one health approach, could increase collaboration between these health care professionals. report of the who/fao/oie joint consultation on emerging zoonotic diseases the 'one health' paradigm: time for infectious diseases clinicians to take note? confronting zoonoses, linking human and veterinary medicine zoonoses. infectious diseases transmissible from animals to humans from "two medicines" to "one health" and beyond about the one health initiative west nile virus outbreak -lessons for public health preparedness people, pathogens and our planet -volume : towards a one health approach for controlling zoonotic diseases. washington d.c: the international bank for reconstruction and development/world bank towards one health: interim lessons from the global program on avian and human pandemic influenza learning from sars: preparing for the next disease outbreak: workshop summary is dit een uitbraak? social dilemmas: understanding human cooperation determinants of innovation within health care organizations literature review and delphi study the one health-perspective global population health and well-being in the st century reducing intergroup bias: the common ingroup identity model primair hyperaldosteronisme (ziekte van conn)". speech for zoobiquitycongres the common ingroup identity model: recategorization and the reduction of intergroup bias effects of group identity on resource utilization in a simulated commons dilemma feeling like a group after a natural disaster: common ingroup identity and relations with outgroup victims among majority and minority young children changing interracial evaluations, affective reactions, and behaviour: the effects of a common group identity the nature of prejudice effects of cooperative and individualistic learning on prospective elementary teachers' music achievement and attitudes an educational psychology success story: social interdependence theory and cooperative learning a dynamic theory of personality resolving social conflicts a theory of cooperation and competition cooperation and trust: some theoretical notes perception of out-group homogeneity and levels of social categorization: memory for the subordinate attributes of in-group and out-group members rediscovering the social group differentiation between social groups. studies in the social psychology of intergroup relations superordinate goals and intergroup behaviour: the effect of role ambiguity and status on intergroup attitudes and task performance how health care complexity leads to cooperation and affects the autonomy of health care professionals achieving step-family harmony: an intergroup relations approach revisiting the contact hypothesis: the induction of a common ingroup identity perceiving persons as a group: categorization and intergroup relations contact is not enough: an intergroup perspective on the "contact hypothesis knowledge sharing is a human behavior. knowledge management classic and contemporary work social and cognitive factors driving teamwork in collaborative learning environments team learning beliefs and behaviors work groups, structural diversity, and knowledge sharing in a global organization knowledge transfer in intraorganizational networks: effects of network position and absorptive capacity on business unit innovation and performance ceo leadership, top team trust and the combination and exchange of information trust in management and knowledge sharing: the mediating effects of fear and knowledge documentation empowering leadership in management teams: effects on knowledge sharing, efficacy, and team performance cooperation and competition in relationships between competitors in business networks social structure of "coopetition" within a multiunit organization: coordination, competition, and intraorganizational knowledge sharing trust and the appraisal process in close relationships an empirical examination of the influence of organizational culture on knowledge management practices do data characteristics change according to the number of scale points used behavioral intention formation knowledge sharing: examining roles of extrinsic motivators, socialpsychological forces, and organizational climate overlap of self, ingroup, and outgroup: pictorial measures of self-categorization psychological safety and learning behavior in work teams perceived variability as a function of group status and identification correlates of charismatic leader behavior in military units: subordinates' attitudes, unit characteristics, superiors' appraisals of leader performance doc vragenlijst -een instrument om de waardering van huisartsen en specialisten over hun onderlinge samenwerking te meten predictors of employees' perceptions of knowledge sharing cultures the partial least squares (pls) approach to causal modeling: personal computer adaptation and use as an illustration the assessment of reliability evaluating structural equation models with unobservable variables and measurement error a primer on partial least squares structural equation modeling (pls-sem) on the convergence of the partial least squares path modeling algorithm structural equation modeling in practice: a review and recommended two-step approach statistical power analysis for the behavioral sciences asymptotic and resampling strategies for assessing and comparing indirect effects in multiple mediator models characteristics of partnership success: partnerschip attributes, communication behaviour, and conflict resolution techniques we would like to thank the following people: prof. dr. l.j. hellebrekers, for his support during the collection of data from veterinary healthcare professionals; prof. emer. dr. l. wigersma, for his support during the collection of data from human healthcare professionals; m.m. van houten msc ma, for revising the manuscript critically in terms of (intellectual) content and for textual corrections; l. kuipers ma, for editing the english text. not applicable. the dataset of the current study is available from the corresponding author upon reasonable request. avas: average variance extracted; big: dutch healthcare professions register; cdcp: usa centres for disease control and prevention; gdp: gross domestic product; knmg: royal dutch medical association; knmvd: royal dutch veterinary association; ols: ordinary least square; osio: overlap of self ingroup and outgroup; pls-sem: partial least squares path modelling; sars: severe acute respiratory syndrome; who: world health organization authors' contributions be is the study's initiator who carried out the data acquisition and drafted the article. be and js contributed to the conception and design of the study, provided input on the interpretation of the data and revised the article critically for important intellectual content. md performed the statistical analyses. rb contributed to the interpretation of data. all authors approved the final article. the authors declare that they have no competing interests. not applicable. no patients were involved in this study as all respondents were healthcare professionals (not being a patient). this means that written informed consent could not and did not need to be obtained from patients for the publication of this study. this study does not fall within the agreements of the helsinki declaration. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. submit your next manuscript to biomed central and we will help you at every step: key: cord- -ndrja os authors: arjin, chaiwat; pringproa, kidsadagon; hongsibsong, surat; ruksiriwanich, warintorn; seel-audom, mintra; mekchay, supamit; sringarm, korawan title: in vitro screening antiviral activity of thai medicinal plants against porcine reproductive and respiratory syndrome virus date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: ndrja os background: porcine reproductive and respiratory syndrome (prrs) caused by prrs virus (prrsv) results in economic losses in the swine industry globally. several studies have investigated the use of plant extracts in the prevention and control of prrs outbreaks. thai medicinal plants may be useful for treating prrsv infection in pigs. therefore, we investigated the in vitro anti-prrsv and antioxidant properties of seven thai medicinal plants: caesalpinia sappan linn., garcinia mangostana linn., houttuynia cordata, perilla frutescens, clinacanthus nutans, phyllanthus emblica, and tiliacora triandra. results: using antiviral screening, we observed that t. triandra extract strongly inhibited prrsv infectivity in marc- cells [virus titer . median tissue culture infective dose (tcid( ))/ml (log )] at h post-infection, whereas c. sappan extract strongly inhibited prrsv replication [virus titer . tcid( )/ml (log )] at h post-infection. c. sappan extract had the highest total phenolic content [ . mm gallic acid equivalent/g] and lowest half-maximal inhibitory concentration [ . mg/ml in , -diphenyl- -picrylhydrazyl and . mg/ml in , -azino-bis ( -ethylbenzothiazo-line- -sulfonic acid) diammonium salt]. conclusion: t. triandra extract could inhibit prrsv infectivity, whereas c. sappan extract was the most effective in inhibiting prrsv replication in marc- cells. this study elucidates the antiviral activities of thai medicinal plant extracts in vivo. the results promise that thai medicinal plant extracts, particularly t. triandra and c. sappan extracts, can be developed into pharmaceutical drugs for the prevention of prrs in pigs. porcine reproductive and respiratory syndrome virus (prrsv) is endemic in most pig-producing countries, and it results in enormous economic losses to the swine industry globally [ ] . this enveloped, positive-sense, singlestranded rna virus belongs to the arteriviridae family (order nidovirales), which also includes the equine arteritis virus, mouse lactate dehydrogenase-elevating virus, and simian hemorrhagic fever virus [ ] . in general, prrsv infection causes a disease that is characterized by reproductive failure in sows and respiratory infections in growing pigs [ ] , and this disease predisposes pigs to infection by bacteria and other viral pathogens [ , ] . this disease is known as porcine reproductive and respiratory syndrome (prrs) and has become endemic in many countries throughout the world following an epidemic phase [ , ] . its incidence was first reported in thailand in , and since then, several outbreaks have been reported [ ] . it has become a major infectious disease that causes high mortality in swine and production losses in the swine industry in this country. preventative measures such as gilt acclimatization, vigilant biosecurity, and vaccination have been shown to be useful in controlling prrs outbreaks, and supportive treatments are available for alleviating its severity; however, no specific treatment for prrs is available [ , ] . antiviral therapeutics are a critical tool for combating viral infections, particularly in cases wherein no vaccines are available against the circulating virus. thus, pharmacological intervention may represent an alternative approach in controlling prrsv. a number of natural compounds and compositions have been shown to possess antiviral activities against prrsv. gao et al. [ ] showed that cryptoporus volvatus extract exhibited antiviral activity against prrsv infection and replication. pringproa et al. [ ] reported that crude cynodon dactylon extract significantly inhibited prrsv replication as early as h post-infection (hpi). therefore, the antiviral activities of other thai medicinal plants against prrsv should also be investigated. thai medicinal plants such as caesalpinia sappan linn., garcinia mangostana linn., houttuynia cordata, perilla frutescens, clinacanthus nutans, phyllanthus emblica, and tiliacora triandra are known to have antioxidant and antiviral activities. these plants have already been promoted for use in primary health care and have been classified according to their pharmacological actions [ ] [ ] [ ] [ ] [ ] [ ] . therefore, the aim of this study was to determine the antiviral activities of thai medicinal plant extracts against prrsv infection in vitro and to measure their phytochemical contents to develop an alternative anti-prrsv therapy for use in veterinary medicine. prior to determining antiviral activity, we evaluated the cytotoxicity of the seven thai medicinal plant extracts on the viability of marc- cells, and viability is expressed as % cytotoxic concentration (cc ). the results showed that the cc of the seven plant extracts ranged from to μg/ml, and the effect of thai medicinal plant extract concentration on the tested cells increased in a dose-dependent manner (fig. ) . p. emblica extract had the lowest cc of μg/ml. the cc of g. mangostana extract was the second lowest ( . μg/ml) and that of c. sappan extract was μg/ ml. further, t. triandra and h. cordata extracts had cc of μg/ml, whereas c. nutans and p. frutescens extracts had the highest cc ( μg/ml). we treated prrsv with different concentrations of thai medicinal plant extracts that were determined based on their cc values so that these plant extracts did not affect the proliferative activity of marc- cells. the screening results of the inhibition of prrsv infectivity showed the potential of thai medicinal plant extracts to inhibit prrsv infectivity (fig. ) . t. triandra extract significantly inhibited prrsv infectivity in marc- cells at hpi when supplied at a concentration of μg/ ml (p < . ), and the observed virus titer at this concentration was . tcid /ml (log ). interestingly, p. emblica extract at a low concentration of μg/ml could inhibit prrsv infectivity [virus titer = . tcid /ml (log )]. as shown in fig. , immunoperoxidase monolayer assay (ipma) indicated that t. triandra and p. emblica extracts blocked prrsv infectivity in marc- cells, as shown by slight brown staining of cells. different thai medicinal plant extracts were tested in an in vitro inhibitor screening assay to determine inhibition of prrsv replication at three time intervals ( , , and hpi). at various time points after the infection, prrsv in supernatants was quantified for determining virus titer by ipma. results of screening were the same as those of the inhibition test of prrsv infectivity, i.e., prrsv replication was inhibited in a dose-dependent manner (fig. ) . interestingly, as shown in fig. , we found that c. sappan extract had significant potential to inhibit prrsv replication in vitro. as shown in fig. l , few cells that were stained brown showed the efficiency of c. sappan extract at a concentration of μg/ml, and the inhibition of prrsv replication by c. sappan extract was significantly stronger than that by other plant extracts at hpi [ . tcid /ml (log )]. the total phenolic contents of the seven thai medicinal plant extracts were determined using the folin-ciocalteu assay by constructing a standard curve of gallic acid. total phenolic content was the highest in c. sappan extract [mean ± standard error: . ± . mm gallic acid equivalent (gae)/g sample], followed by g. mangostana extract ( . ± . mm gae/g sample), with the lowest total phenolic content was observed in h. cordata extract ( . ± . mm gae/g sample) ( table ) . c. sappan extract had the highest antioxidant activity, with ic values of . ± . mg/ml in , -diphenyl- picrylhydrazyl (dpph) and . ± . mg/ml n , azino-bis( -ethylbenzothiazo-line- -sulfonic acid) diammonium salt (abts) and a reducing power of . ± . mm fe + /g in the ferric-reducing antioxidant power (frap) assay (table ) . p. emblica extract had the second strongest antioxidant activity against free radicals, with ic values of . ± . mg/ml in dpph and . ± . mg/ml in abts and a reducing power of . ± . mm fe + /g sample in the frap assay. prrsv outbreak causes significant economic loss in the swine industry worldwide. the current commercial prrsv vaccines are inadequate to protect pigs from prrsv infections [ ] . medicinal plants have progressively been explored as suitable alternative sources of antiviral agents [ ] . thai medicinal plants have widely been used as a source of herbal medicines because of their high bioactive compound contents that are effective against various diseases. in this study, seven thai medicinal plant extracts were screened for their antiviral activity against prrsv. before determining the antiviral properties of a compound, it is essential that a cytotoxicity assay is performed to determine the concentrations that can be used to avoid cell damage and ensure prrsv selectivity in vitro. in this study, we reported cytotoxicity as cc , which indicates the concentration of a substance that can inhibit virus activity by %. we found that p. emblica extract showed the highest cell toxicity ( . μg/ml). in this study, high-potential plant extracts were found to be c. sappan and t. triandra extracts, with cc of and μg/ml, respectively. antiviral compounds should be highly effective while showing minimal toxicity to normal cells and tissues [ ] . in this study, we investigated the antiviral activity of seven thai medicinal plant extracts against prrsv by assessing the inhibition of prrsv infection and replication in marc- cells. the range of plant extract concentrations was determined based on their cc values. p. emblica extract inhibited prrsv infection in marc- cells and in vitro. p. emblica extract at a concentration of μg/ml inhibited prrsv infectivity at a virus titer of . tcid /ml (log ). in this study, p. emblica extract showed the highest cytotoxicity to marc- cells with cc of < μg/ml. therefore, the antiviral activity of other plant extracts were investigated in this study. we found that t. triandra extract at a concentration of μg/ml significantly inhibited prrsv infectivity at a virus titer of . tcid (log ). while t. triandra extract has been used as anti-inflammatory [ ] , anticancer [ ] , and antimicrobial agents against mycobacterium tuberculosis [ ] , its antiviral activity, particularly against prrsv, has not been investigated previously. therefore, this is the first report to indicate that t. triandra extract could significantly prevent the entry of prrsv into marc- cells. however, t. triandra extract was not found to be effective in inhibiting prrsv replication. all studied plant extracts could inhibit prrsv replication when applied at high [ ] and the antimicrobial properties of c. sappan [ ] have previously been investigated, this is the first study to reveal the inhibitory activity of c. sappan extract on prrsv replication in marc- cells. regarding phytochemical content, c. sappan extract had the highest total phenolic content ( . ± . mm gae/g sample). the total phenolic content of a plant is considered an indicator of its antioxidant capacity because the redox properties of phenolic compounds allow them to act as reducing agents, hydrogen donors, and radical scavengers [ ] . previously, lee et al. [ ] reported that ethanolic c. sappan extract had a total phenolic content of . μg gae/mg. the values of total phenolic content in this study were slightly abu-jafar and huleihel [ ] reported that ethanolic eucalyptus camaldulensis leave extracts had strong antiviral activity against different members of the herpes virus family (hsv- , hsv- , and vzv). ramalingam et al. [ ] reported that the ethanolic extracts of andrographis paniculata have the highest antiviral inhibitory effects against dengue virus in vero cells. the screening of plants as possible sources of antiviral agents has led to the discovery of potent inhibitors of in vitro viral replication, thereby increasing the probability of identifying new bioactive plant compounds [ ] . these findings suggest the appropriate species and concentration of plant extract that could effectively inhibit prrsv replication, with both t. triandra and c. sappan extracts being highly effective in inhibiting prrsv infection in vitro by interfering with viral attachment and inhibiting viral replication and/or virus release, respectively. the modes of action of t. triandra and c. sappan extracts against pprsv require further investigation but are likely to be related to the natural compounds they contain. therefore, it was speculated that both t. triandra and c. sappan extracts are potential candidates for preventing prrsv infection in pigs. however, the plant extracts used for testing antiviral activity was crude extracts. in future, we plan to purify the most effective thai medicinal plant extracts (t. triandra and c. sappan extracts) for screening the active compound that is highly effective against prrsv. thai medicinal plant extracts exhibit antiviral activity against prrsv. t. triandra extract effectively inhibited prrsv infection. and c. sappan extract had the strongest antiviral activity against prrsv replication. these activities can be presumably attributed to the total phenolic contents and antioxidant activities of these plant extracts. although several previous studies have shown the antiviral activity of plant extracts against prrsv, there are no reports on the antiviral activities of t. triandra and c. sappan extracts against prrsv. to the best of our knowledge, this study is the first to report the inhibitory activity of t. triandra and c. sappan extracts against prrsv activity in vitro. further studies are required to elucidate the mechanisms of action of these plant extracts on prrsv. all chemicals used in this study were of analytical grade or higher. ethanol and methanol were obtained from merck (darmstadt, germany). abts, -hydroxy- , , , tetramethylchroman- -carboxylic acid (trolox), dpph, folin-ciocalteu phenol reagent, -( , -dimethylthiazol- -yl)- , -diphenyl tetrazolium bromide (mtt), sodium carbonate, and , , -tri-pyridyl-s-triazine were purchased from sigma chemical co. (st. louis, mo, usa). ferric chloride hexahydrate and potassium persulfate were procured from loba chemie pvt (mumbai, india). gallic acid was procured from fluka chemical co. (buchs, switzerland). dulbecco's modified eagle's medium (dmem) was procured from gibco (massachusetts, usa). ethanolic c. sappan, g. mangostana, h. cordata, p. frutescens, c. nutans, p. emblica, and t. triandra extracts were purchased from specialty natural product co. ltd. (thailand). marc- tissue culture cells were grown in dmem containing % fetal bovine serum (gibco) and % penicillin/streptomycin and incubated at °c in a % co atmosphere. to produce inoculated cells, prrsv (vr north american genotype) was propagated in marc- cells, and virus titer was quantified using ipma. the cytotoxicity of the seven thai medicinal plant extracts was determined using the mtt assay. briefly, marc- cells were plated at a density of cells/ well in -well plates and incubated in a % co atmosphere at °c for h. when cells had at least % confluence, the medium was removed and replaced with medium containing two-fold serial dilutions of the plant extracts. in addition, medium without plant extract was used as a positive control. incubation was then continued in a % co atmosphere at °c for h. after this, the medium was removed, μl of freshly prepared mtt solution ( mg/ml) was added to each well, and the plates were incubated at °c for h. then, the medium was replaced with μl dmso to dissolve the crystals, and the plates were incubated at °c for min to dissolve any air bubbles before measuring the mtt signal at an absorbance of nm. results are reported as cc . the inhibition of virus infection assay was performed as previously described [ ] . briefly, the plant extracts at the concentration that was determined in the cytotoxicity test outlined above and at two lower concentrations in two-fold dilution were mixed with prrsv at tcid /ml at a ratio of : and incubated at °c for h. dmso ( %) containing medium mixed with prrsv served as the control. thereafter, the mixture of prrsv and plant extracts as well as controls were inoculated in marc- cells at a density of cells/well in a well plate and incubated at °c for h. subsequently, the medium was removed and replaced with a fresh medium containing % fbs. the plates with marc- cells were cultured under standard conditions for h hpi, and supernatants were collected to quantify virus titer. the inhibition of viral replication assay was performed as previously described [ ] . briefly, marc- cells were plated at a density of cells/well in -well plates and infected with prrsv at a multiplicity of infection of at °c for h. then, prrsv was removed from each well and replaced with the diluted plant extracts at the concentration that was determined in the cytotoxicity test and at two lower concentrations ins two-fold dilution. further, % dmso was mixed to medium as the control. the plates were cultured under standard conditions; supernatants were collected at , , and hpi; and virus titer was quantified. virus titer was further assessed by ipma as previously described [ ] . briefly, cells were fixed with μl of % cold formalin for min at room temperature (rt), washed once with μl of phosphate-buffered saline (pbs) and twice with μl of . % pbs tween- (pbst), and blocked with μl of % bsa in . % pbst for min at rt. after blocking, the cells were stained with μl of anti-prrsv nc protein monoclonal antibody (median diagnostics, gangwon-do, korea) diluted at a ratio of : at rt for min, washed, and incubated with peroxidase-conjugated affinipure goat anti-mouse igg (h + l) (jackson immunoresearch, pennsylvania, usa) diluted at a ratio of : for min at rt. after washing thrice with pbs, the cells were counter stained with , -diaminopentane substrate and examined under a microscope. virus titer is expressed as tcid and was determined using the reed-muench method. the total phenolic contents of the plant extracts were determined using the folin-ciocalteu method [ ] , and their free radical-scavenging activities were determined using the dpph-scavenging and abts-scavenging assays, as previously reported [ , ] . antioxidant activities were determined using the frap assay, according to the benzie and strain method [ ] . differences in antiviral activities among the different concentrations of each plant extract were tested using one-way analysis of variance with tukey's post hoc test for a comparison of means. cc was calculated using regression analysis of dose-response curves for the mtt assay. all statistical analyses were performed using the spss . software (spss inc., chicago, il, usa) with a significance level of p-value of ≤ . . prrs virus receptors and their role for pathogenesis porcine reproductive and respiratory syndrome virus (prrsv): pathogenesis and interaction with the immune system porcine reproductive and respiratory syndrome virus characterization of swine infertility and respiratory syndrome (sirs) virus (isolate atcc vr- ) influence of hypericum perforatum extract on piglet infected with porcine respiratory and reproductive syndrome virus epidemiology of porcine reproductive and respiratory syndrome (prrs): an overview spatial epidemiology of porcine reproductive and respiratory syndrome in thailand serological studies and isolation of porcine reproductive and respiratory syndrome (prrs) virus in thailand respiratory tract protection upon challenge of pigs vaccinated with attenuated porcine reproductive and respiratory syndrome virus vaccines cryptoporus volvatus extract inhibits porcine reproductive and respiratory syndrome virus (prrsv) in vitro and in vivo in vitro virucidal and virustatic properties of the crude extract of cynodon dactylon against porcine reproductive and respiratory syndrome virus in vitro virucidal and virustatic properties of the crude extract of cynodon dactylon against porcine reprodu in vitro anti-influenza viral activities of constituents from caesalpinia sappan active constituents against hiv- protease from garcinia mangostana evaluation of antiviral activities of houttuynia cordata thunb. extract, quercetin, quercetrin and cinanserin on murine coronavirus and dengue virus infection a novel substance purified from perilla frutescens britton inhibits an early stage of hiv- replication without blocking viral adsorption antiviral activities of clinacanthus nutans (burm.f.) lindau extract against cyprinid herpesvirus in koi (cyprinus carpio koi) in vitro anti-herpes simplex virus activity of , , , -tetra-o-galloyl-β-d-glucose from phyllanthus emblica l. (euphorbiaceae) in vitro antiviral activity of germacrone against porcine reproductive and respiratory syndrome virus south african medicinal plant extracts active against influenza a virus virucidal activity of garcinia parvifolia leaf extracts in animal cell culture some phytochemicals and anti-inflammation effect of juice from tiliacora triandra leaves chemical constituents and in vitro anticancer activity of tiliacora triandra leaves antimycobacterial activity of bisbenzylisoquinoline alkaloids from tiliacora triandra against multidrug-resistant isolates of mycobacterium tuberculosis in vitro antimicrobial activity of caesalpinia sappan l retracted: antioxidant properties of benzylchroman derivatives from caesalpinia sappan l. against oxidative stress evaluated in vitro antiviral activity of eucalyptus camaldulensis leaves ethanolic extract on herpes viruses infection anti-dengue activity of andrographis paniculata extracts and quantification of dengue viral inhibition by sybr green reverse transcription polymerase chain reaction in-vitro antiviral activities of extracts of plants of the brazilian cerrado against the avian metapneumovirus (ampv) development of an immunoperoxidase monolayer assay for the detection of antibodies against peste des petits ruminants virus based on bhk- cell line stably expressing the goat signaling lymphocyte activation molecule total phenol analysis: automation ans comparison with manual methods use of a free radical method to evaluate antioxidant activity antioxidative activity of mungoong, an extract paste, from the cephalothorax of white shrimp (litopenaeus vannamei) ferric reducing/antioxidant power assay: direct measure of total antioxidant activity of biological fluids and modified version for simultaneous measurement of total antioxidant power and ascorbic acid concentration. in: oxidants and antioxidants part a: academic publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations the authors thank dr. wolfram spreer of the university of hohenheim for his critical comments on this article and thank enago (https://www.enago.com) for the english language review. authors' contributions kp, sh, and ks contributed to the study design. ca performed the experiments, carried out the statistical analysis, and drafted the manuscript. kp, sh and ks contributed to the statistical analysis and critically reviewed the manuscript. kp, ms, sm, wr, and ks conceived the study, coordinated the work described, and contributed to the manuscript preparation. all authors read and approved the final manuscript.funding ca was supported financially by a ph.d. scholarship of research and researcher for industries projects (rri), thailand science research and innovation, under contract no. phd i . the funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication. also, this project was partially supported by chiang mai university. the datasets supporting the results of this article are available in the figshere (https://figshare.com/s/ bfdb d a c ffaf).ethics approval and consent to participate not applicable. not applicable. the authors declare that they have no competing interests. key: cord- -u kv authors: chhetri, bimal k; berke, olaf; pearl, david l; bienzle, dorothee title: comparison of the geographical distribution of feline immunodeficiency virus and feline leukemia virus infections in the united states of america ( – ) date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: u kv background: although feline immunodeficiency virus (fiv) and feline leukemia virus (felv) have similar risk factors and control measures, infection rates have been speculated to vary in geographic distribution over north america. since both infections are endemic in north america, it was assumed as a working hypothesis that their geographic distributions were similar. hence, the purpose of this exploratory analysis was to investigate the comparative geographical distribution of both viral infections. counts of fiv (n= , ) and felv (n= , ) positive serology results (fiv antibody and felv elisa) were obtained for contiguous states and district of columbia of the united states of america (us) from the idexx laboratories website. the proportional morbidity ratio of fiv to felv infection was estimated for each administrative region and its geographic distribution pattern was visualized by a choropleth map. statistical evidence of an excess in the proportional morbidity ratio from unity was assessed using the spatial scan test under the normal probability model. results: this study revealed distinct spatial distribution patterns in the proportional morbidity ratio suggesting the presence of one or more relevant and geographically varying risk factors. the disease map indicates that there is a higher prevalence of fiv infections in the southern and eastern us compared to felv. in contrast, felv infections were observed to be more frequent in the western us compared to fiv. the respective excess in proportional morbidity ratio was significant with respect to the spatial scan test (p < . ). conclusions: the observed variability in the geographical distribution of the proportional morbidity ratio of fiv to felv may be related to the presence of an additional or unique, but yet unknown, spatial risk factor. putative factors may be geographic variations in specific virus strains and rate of vaccination. knowledge of these factors and the geographical distributions of these infections can inform recommendations for testing, management and prevention. however, further studies are required to investigate the potential association of these factors with fiv and felv. infections with feline immunodeficiency virus (fiv) and feline leukemia virus (felv) are common and important conditions in cats [ ] . both fiv and felv are immunosuppressive retroviruses and associated with a wide array of disease conditions affecting multiple organ systems and susceptibility to opportunistic infections. the most important mode of transmission of both retroviruses is through bites, although other less common modes of transmission such as nursing, mutual grooming or sharing dishes for felv [ ] ; and in utero [ ] , experimental infection via vaginal mucosa [ ] , and nursing in neonates [ ] for fiv have been reported. cats at high risk of encountering and fighting with infected cats, and thus getting infected, include those with outdoor lifestyles, and those that are male, adult and non-neutered [ ] [ ] [ ] [ ] [ ] [ ] . there is great interest in developing diagnostic tests to identify vaccinated and infected cats and to develop better vaccines to protect uninfected animals [ ] . however, little progress has been made in understanding the distribution and causes of felv and fiv infections in cat populations. such knowledge about the prevalence of both infections would assist in defining prophylactic, management and therapeutic measures for stray, feral, and owned cats [ ] . recent studies estimate a sero-prevalence of . % (felv) and . % (fiv) in the us [ ] , and . % (felv) and . % (fiv) in canada [ ] . a number of studies suggested that the prevalence of retroviral infections in domestic cat populations may represent regional patterns of infection, which is likely attributable to variable population density, reproductive status, age, gender and housing conditions [ ] [ ] [ ] . a study from vietnam reported fiv sero-prevalence to be higher in the south when compared to the north [ ] . similarly, in germany, differences in prevalence of fiv between northern and southern states have been reported and attributed to lifestyle, sex and health status of cats [ ] . however, regional differences in the us and canada were still present after adjusting for similar factors [ , ] . furthermore, even though both infections are known to share similar risk factors, it is unclear whether they also have unique risk factors. interestingly, in some studies cats tend to have co-infections with both viruses [ , ] , whereas in other studies the reverse was shown [ , ] . these contradictory results, and residual variation in sero-prevalence after adjusting for risk factors, might be expressions of geographic variation in the sero-prevalence [ ] or unknown spatial factors, which have not yet been explored. further, geographical variation in the distribution of fiv and felv infections has been suggested previously but has not yet been studied using spatial statistics [ , , , ] . in this study, we explored the geographical distribution of both viral infections relative to each other in administrative regions ( contiguous states and the district of columbia) of the us. if underlying known or unknown risk factors for fiv and felv infections vary geographically, then regions with excesses of one infection over the other should exist. the objective of this study was to a) describe the geographical distribution and b) detect high risk areas of fiv and felv infections relative to each other. counts of fiv (n= , ) and felv (n= , ) positive serological tests (fiv antibody and felv elisa) were obtained for each of the administrative regions of the us from the idexx laboratories' public access website on fiv, felv and heartworm infections [ ] . the data encompass positive test results for fiv and felv from idexx sponsored prevalence studies [ , ] , idexx vetlab station data reported from veterinary practices, and idexx reference laboratories' results collected from to [ ] . the screening serology for fiv and felv entails use of antigen and antibody capture enzyme-linked immunosorbent assays (elisa) [ ] , with sensitivities of % and . % and specificities of . % and . %, respectively. the assay tests for both viruses in a combined kit format. each administrative region was georeferenced to latitude and longitude coordinates of the respective administrative region centroid. these centroids were extracted from the digital map of the us states, in environmental system research institute (esri) shapefile format [ ] obtained from the us census bureau's geographic data website [ ] , using the r statistical software [ ] . the proportional morbidity ratio (pmr) of fiv to felv infection was estimated for each administrative region and a choropleth disease map was used to visualize the spatial pattern of pmr. choropleth maps represent regional values such as the prevalence by colour scales where each scale represents a discrete value or a range of values [ ] . all maps were displayed in albers equal area conic projection. conventionally, a proportional morbidity/mortality ratio for a particular disease is the observed proportion of illness/death due to a cause over the expected proportion. the expected proportion is the number of illness/death in a reference population from the specific cause over all illness/death in that population [ ] . the pmr is likewise defined as the ratio of two morbidity measures, such as the sero-prevalence for two infections: where m and m denote the number of cases for fiv and felv infections respectively, similarly n and n denote the number of tested cats for the respective infections. for the present study only the total number of cats that tested positive for either infection was available. however, cats are typically tested with a dual elisa test that is able to detect antibodies to fiv as well as felv antigens [ ] at the same time. furthermore, the american association of feline practitioners recommends testing for both infections at the same time [ , ] . therefore, on the assumption that a combination elisa was applied to test for both infections simultaneously, the number of tested individuals is the same for both infections (i.e., n = n ). therefore the pmr formula reduces to pmr = m /m . therefore, the pmr (fiv, felv) equals the number of cats testing positive for fiv over the number of cats testing positive for felv. an area, or administrative region, with pmr > represents an excess of fiv infections compared to felv infections. alternatively, a pmr < for an area indicates excess of felv infections relative to fiv infections in that area. respective pmrs for each administrative region were visualized as choropleth maps using breaks based on the quintiles of the empirical distribution of the administrative region pmrs. in order to compare the relative distribution of fiv to felv (i.e., the pmr), data were aggregated to administrative region centroids. statistically significant high risk clusters of fiv (or felv) infection were identified using a weighted normal spatial scan test [ ] as implemented in satscan ™ [ ] . since the pmr is a continuous variable and its geographical distribution was of interest, the spatial scan test based on the normal probability model was used to detect clusters of high or low pmrs. the normal spatial scan statistic applies to continuously distributed data and not just gaussian, i.e. normally distributed data [ ] . moreover, the "weighted" version of the normal spatial scan test was used, which allows to adjust for varying regional uncertainty in the pmr estimates, due to varying sample sizes. the weights for each of the administrative regions were estimated as the mean of the total number of cats testing positive for fiv and felv infections in each region. the spatial scan test identifies potential clusters of high or low risk by moving circular windows of varying radius (size) and location (region centroids) across the study area. the one-sided test was performed to identify significant high and low risk clusters. a high risk cluster was defined as an aggregation of administrative regions with mean pmr > (i.e. neighbouring regions in which fiv was more frequent), and a low risk cluster for mean pmr < (i.e. neighbouring regions in which felv was more frequent). the null hypothesis of the one-sided spatial scan test states the mean of the pmr as constant throughout the study area, i.e. not different inside and outside the scanning window [ ] . the weighted normal spatial scan statistic therefore identifies as a cluster a group of two or more regions with mean pmr higher or lower than outside the cluster. the maximum window size was set to % of all administrative areas. a p-value was obtained by monte carlo hypothesis testing with iterations and the significance level was chosen to be α = . . areas of relative fiv excess identified by the spatial scan statistic were visualized by highlighting the boundaries of the states included in the most likely cluster on a choropleth map of the pmr of fiv to felv infection. the same approach was used to visualize areas of felv excess. the descriptive statistics of the data are presented in table . a total of / administrative regions had a proportional morbidity ratio (pmr) > and / administrative regions had a pmr < . pmr ranged from . to . . the fiv and felv infections had distinct spatial distribution patterns. the choropleth map revealed more frequent infection with fiv compared to felv in the southern and eastern us. in contrast, felv infections were observed more frequently in the western and north-central us compared to fiv (figure ) . the spatial scan test detected two high risk clusters. one high risk cluster consisted of administrative regions having an excess of fiv infections (mean pmr = . , p < . , administrative regions), and the other high risk cluster consisted of administrative regions having an excess of felv infections (mean pmr = . , p < . , administrative regions) (table and figure ). this exploratory analysis identified that areas of relative excess of fiv and felv exist in the us. both the choropleth maps of pmr and the spatial scan test for evidence of high risk clusters identified similar areas of relative excess of one infection over the other. since it is assumed that both infections share similar risk factors, it would be expected that the occurrence of both infections relative to each other would be more or less uniform throughout the us. however, our spatial analyses show that higher numbers of fiv infections were reported in the southern and eastern us compared to felv infections. in contrast, reported felv infections were observed to be higher in the western and northcentral us compared to fiv infections. these results suggest that the relative excesses of one infection over the other may be the result of different factors affecting these geographical areas. the distinct pattern in the geographical variation of the pmr can be explained in a number of ways relating to the agent, environment and host factors. for example, the dominant viral strain might vary over the study area. furthermore, vaccination management, level of veterinary care, and thus the age and survival times of cats, may differ from place to place. factors that play a role in promoting aggression and bites are known to be most important in the transmission of infection from one cat to another for both fiv and felv. these known risk factors include feline population type (pet, stray and feral), cat density, sex, age, neutering status, and access to outdoors [ , , ] . previous studies indicated that felv infection is age dependent and primarily acquired by "friendly" cats through prolonged close contact between virus shedders and susceptible cats involving mutual grooming, sharing of food and water dishes, and use of common litter areas [ ] . however, other studies have indicated adulthood, outdoor lifestyle, neutering status, and fighting to be associated with felv as well [ , , ] . thus, it is difficult to discern whether these known risk factors, being unique to one infection or the other, could lead to such geographical variability, and results suggest the existence of an unknown spatial risk factor. further, previous studies have found differences in sero-prevalence across the us despite controlling for these factors [ ] . identification and segregation have been the most important tools in the control of both infections [ ] . although a fiv vaccine was introduced in in the us, its efficacy remains controversial; whereas vaccination has been attributed as a factor associated with the decreasing prevalence of felv [ ] . it is possible that the prevalence of vaccination may influence the infection patterns observed in this study. the decision to vaccinate a pet would be dependent on owner compliance and related to their socio-economic status, and these factors would vary geographically. previous studies have found that approximately % and % of felv infected cats in multi-cat households are likely to die in the two and three years following diagnosis, respectively [ , ] . on the other hand, [ ] . therefore, one would expect to find more fiv than felv survivors when sampling from, on average, older populations. further, cats testing positive for felv are likely to be much younger than those testing for fiv, which also implies that most older cats that are fiv positive are more likely to be pets, and therefore may belong to people of higher socioeconomic status than cats that are young, felv positive, and more likely to be owned by shelters or catteries. different viral clades or strains of fiv are known to predominate in different geographical regions and could reflect the patterns observed in this study. although clade-specific information was not available for this study, clade a viruses are common in the western us, whereas clade b viruses predominate in the eastern us [ ] . however, the association between viral clades and pathogenicity is unclear [ ] . it is important that limitations be considered when interpreting results from this study. the observed variability in infection could be reflective of diagnostic submissions specifically to idexx laboratories. this could lead to admission risk bias, a form of selection bias, as is common with registry or hospital based studies, particularly if preference of diagnostic lab by sample submitters in an area is related to the true prevalence of either fiv or felv. further, sero-prevalence of co-infections with fiv and felv ranging from . % to . % have been reported in north american cats [ , , , ] . however, estimation of the pmr assumes both the infections to be independent of each other. not accounting for coinfections would lead to biased estimates of the pmr. however, as the proportion of coinfections increases, the pmr converges to ; this means the bias is towards the null. thus, the pmr estimate in this study is rather conservative, i.e. less extreme. similarly, the result of the spatial scan test is believed to be conservative, i.e. any significant results are truly significant. the scan test used in this study implements circular shaped windows to detect clusters which may pose a problem when the outcome of interest is aggregated in a non-circular fashion. the scan test may, for example, detect a larger circular high risk cluster by including surrounding regions of low risk [ ] . though other non-circular scan tests have been proposed in the literature, none allow for continuously distributed spatial observations such as pmrs. for this study, an exploratory approach was applied to compare two similar infections and explore the areas of relative excess rather than derive risk estimates for each area primarily because the underlying population (total number of tested cats in each administrative region) was not known. such an approach has been reported in the veterinary literature to compare relative excess of one disease to the other [ ] . an advantage of these study designs (e.g. case-case study) is that factors may be identified as more important for one disease than the other. the evidence of distinct clusters of infection necessitates the need to investigate overall spatial dependence in the occurrence of cases (clustering), and if these are identified, to adjust for their presence when evaluating the association of putative risk factors to these infections. ignoring clustering may result in biased standard errors and thus can compromise risk factor studies [ ] . in this study we have identified geographical patterns in the distribution of the proportional morbidity ratio of fiv to felv infection among cats in the administrative regions of the us over the period to . these patterns might be an expression of geographic variation in the pathogenicity of viral strains that are not evenly distributed in the study area, reflect geographical differences in vaccination practices or relate to differences in survival times after infection. further studies are warranted to explore the association of these proposed factors with respective infections that allows for adjustment of spatial clustering if present in the data. little s: a review of feline leukemia virus and feline immunodeficiency virus seroprevalence in cats in canada feline leukemia virus and feline immunodeficiency virus. in infectious disease management in animal shelters feline immunodeficiency virus is shed in semen from experimentally and naturally infected cats mucosal infection and vaccination against feline immunodeficiency virus feline immunodeficiency virus is concentrated in milk early in lactation feline leukemia virus infection and diseases report of the national felv/fiv awareness project in kirk's current veterinary therapy xii american association of feline practitioners' feline retrovirus management guidelines feline leukemia virus seroprevalence of feline leukemia virus and feline immunodeficiency virus infection among cats in north america and risk factors for seropositivity feline leukemia virus and feline immunodeficiency virus in canada: recommendations for testing and management seroprevalence of feline leukemia virus and feline immunodeficiency virus infection among cats in canada feline leukaemia. abcd guidelines on prevention and management feline immunodeficiency virus, feline leukemia virus and toxoplasma gondii in stray and household cats in kerman-iran: seroprevalence and correlation with clinical and laboratory findings prevalence of feline immunodeficiency virus infection in domesticated and feral cats in eastern australia contrastive prevalence of feline retrovirus infections between northern and southern vietnam prevalence of feline immunodeficiency virus and feline leukaemia virus among client-owned cats and risk factors for infection in germany a trap, neuter, and release program for feral cats on prince edward island feline leukaemia virus (felv) and feline immunodeficiency virus infections in cats in the pisa district of tuscany, and attempts to control felv infection in a colony of domestic cats by vaccination prevalence of feline immunodeficiency virus and other retroviral infections in sick cats in italy feline immunodeficiency. abcd guidelines on prevention and management a seroepidemiological study of feline coronavirus, feline immunodeficiency virus and feline leukemia virus among cats in israel protect your cat -kittytest prevalence of fiv and felv in the united states a recombinant-based feline immunodeficiency virus antibody enzyme-linked immunosorbent assay us census bureau tiger/line w shapefiles team: r: a language and environment for statistical computing. r foundation for statistical computing choropleth mapping of regional count data of echinococcus multilocularis among red foxes in lower saxony a fresh look at proportional mortality ratios. public health naturally acquired feline immunodeficiency virus (fiv) infection in cats from western canada: prevalence, disease associations, and survival analysis seroprevalences of feline leukemia virus and feline immunodeficiency virus in cats with abscesses or bite wounds and rate of veterinarian compliance with current guidelines for retrovirus testing weighted normal spatial scan statistic for heterogeneous population data inc: satscan ™ v . : software for the spatial, temporal and space-time scan statistics feline leukemia virus infection feline viral neoplasia felv and non-neoplastic felv-related disease clinical aspects of feline immunodeficiency and feline leukemia virus infection retroviral infections of small animals a detailed phylogenetic analysis of fiv in the united states prevalence of feline leukemia virus infection and serum antibodies against feline immunodeficiency virus in unowned free-roaming cats a flexibly shaped spatial scan statistic for detecting clusters spatial and temporal clustering of calcium oxalate and magnesium ammonium phosphate uroliths in dogs living in ontario, canada between comparison of the geographical distribution of feline immunodeficiency virus and feline leukemia virus infections in the united states of america this research was supported through a phd fellowship from the ontario veterinary college and funds from the ovc pet trust foundation. the authors declare that they have no competing interests.authors' contributions bc carried out the data acquisition, statistical analysis and drafted the manuscript. ob conceived of the study, and participated in its data acquisition, analysis and helped to draft the manuscript. dp and db provided intellectual inputs on study design, analysis and contributed to manuscript revision. all authors read and approved the final manuscript. key: cord- -py awuav authors: willi, barbara; spiri, andrea m.; meli, marina l.; grimm, felix; beatrice, laura; riond, barbara; bley, tim; jordi, rolf; dennler, matthias; hofmann-lehmann, regina title: clinical and molecular investigation of a canine distemper outbreak and vector-borne infections in a group of rescue dogs imported from hungary to switzerland date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: py awuav background: canine distemper virus (cdv) is a major pathogen of dogs and wild carnivores worldwide. in switzerland, distemper in domestic dogs is rarely reported. in recent years, the import of dogs from eastern europe to switzerland has steadily increased. in the present study, we describe a distemper outbreak in rescue dogs that were imported from hungary to switzerland by an animal welfare organisation. the data on vaccination and medical history were recorded ( dogs), and the samples were collected to investigate cdv and vector-borne infections ( dogs) and canine parvovirus infection ( dogs). the dogs were monitored for six months. results: one dog was euthanised directly after import. thirteen dogs showed clinical signs after arrival, i.e., diarrhoea ( %), coughing ( %) and nasal and/or ocular discharge ( %); radiographic findings that were compatible with bronchopneumonia were present in four dogs. cdv infection was diagnosed in dogs ( %); dogs ( %) tested pcr-positive in conjunctival swabs. vector-borne infections (babesia spp., leishmania infantum, dirofilaria immitis) were found in dogs ( %). three dogs were hospitalized, and six dogs received ambulatory therapy for up to two months until recovery. none of the dogs developed neurological disease. cdv shedding was detected for a period of up to four months. because dogs were put under strict quarantine until cdv shedding ceased, cdv did not spread to any other dogs. the cdv isolates showed % sequence identity in the ha gene among each other and belonged to the arctic-like lineage of cdv. conclusions: the present study highlights the imminent risks of spreading contagious viral and vector-borne infections through the non-selective import of sick dogs and dogs with incomplete vaccination from eastern europe. cdv shedding was detected for several months after the cessation of clinical signs, which emphasised the roles of asymptomatic carriers in cdv epidemiology. a long-term follow-up using sensitive pcr and strict quarantine measures is of upmost importance in preventing the spread of infection. dog owners and animal welfare organisations should be educated regarding the importance of complete vaccinations and the impact of dog imports on the spread of viral and vector-borne pathogens. canine distemper virus (cdv) is one of the most important viral pathogens in domestic dogs and causes high morbidity and mortality worldwide, particularly in unvaccinated dogs or dogs with incomplete vaccination [ ] . cdv is a small, enveloped rna virus that belongs to the family paramyxoviridae and the genus morbillivirus [ ] . cdv has a wide natural host range that includes a variety of terrestrial carnivores [ ] . dogs are thought to be the major reservoir host for cdv [ , ] . infection occurs by direct contact with oronasal secretions of infected animals [ ] ; indirect transmission plays only a minor role in cdv epidemics because the virus is quickly inactivated in the environment [ ] . the course of the cdv infection is strongly dependent on the immune response in infected animals [ ] . in this context, vaccination is critically important. dogs that develop an adequate immune response can clear the virus from most tissues, whereas in dogs that show an intermediate immune response, cdv infects the epithelial tissues and induces clinical signs. in dogs that have a weak immune response, cdv disseminates to various tissues, and the clinical signs are usually severe with the persistence of the virus until death [ ] . invasion of the central nervous system occurs when viraemia is sufficiently high [ , ] . more than % of all cdv infections are perceived to be subclinical [ ] . in clinically affected dogs, the disease usually starts with fever and a serous-to-mucopurulent conjunctivitis, followed by a dry to productive cough, depression, anorexia, vomiting and diarrhoea [ ] . neurological signs usually develop within one to three weeks after recovery from systemic illness, but can occur weeks to months later [ ] . since the introduction of highly protective cdv modified live virus (mlv) vaccines more than years ago [ ] , the incidence of cdv infection in completely vaccinated dogs has decreased [ ] . however, in regions with a low proportion of vaccinated dogs, in stray dogs and in shelter environments, the incidence of cdv epidemics is high. in switzerland, the last cdv epidemic in domestic dogs occurred in - ; this outbreak was suspected to be attributed to an inadequate vaccination rate in the swiss dog population at that time [ ] . furthermore, a cdv epidemic associated with high morbidity and mortality commenced in the spring of in wild carnivores in switzerland [ ] . the latter was perceived to be part of a large transnational outbreak that spread from eastern to western europe. only one domestic dog was affected in switzerland during this outbreak [ ] . remarkably, the -year-old mixed breed dog died of a cdv-associated neurological disease, although it had received the standard anti-cdv vaccination protocol. according to the animal identity service (anis) in switzerland, the import of dogs increased by % within one year ( - ) [ ] . the imported dogs comprised primarily stray dogs that were adopted by animal welfare organizations or pure breed dogs to meet the increasing demand of miniature breeds in western europe. in the present study, we report on a distemper outbreak in rescue dogs that had been imported from hungary to switzerland. the study provides data on vaccination, medical history, clinical examinations and diagnostic imaging of the dogs and cdv testing, testing for canine parvovirus (cpv) and vector-borne infections. additionally, the study gives prospectively collected follow-up data on the treatment, clinical course and outcome of the infections and the period of cdv shedding. finally, a molecular characterization of the cdv isolates was performed. a group of rescue dogs that derived from a shelter in kecskemét, hungary, was imported to switzerland in october . one dog was euthanised within several days of import because of clinical deterioration; no data regarding this dog were available. the other dogs comprised nine female ( spayed) and five male ( castrated) mixed breed dogs, aged months to years old, and weighing kg to kg ( table ). all of the dogs had received rabies vaccination (rabisin®, biokema sa, crissier, switzerland) six to weeks before import and deworming (containing praziquantel, pyrantel and fenbendazol, uniwerm®, provet, beograd, serbia) seven to nine days before their arrival in switzerland. additionally, the dogs had been vaccinated with one shot of a combined mlv vaccine containing cdv, canine adenovirus- , cpv, leptospira spp. and canine parainfluenzavirus (biocan® dhppi & l, table ), either seven to eight days (dogs to and to ) or one month prior to arrival in switzerland (dog ); dog had been revaccinated in switzerland one week prior to sample collection for cdv pcr (table ) . after arrival on october , , the rescue dogs were directly distributed to private households throughout switzerland (table , fig. ). seven dogs (dogs , , , , , and ) were placed in multidog households. after arrival, the new owners observed clinical signs in of the dogs (table ) , i.e., diarrhoea ( %), coughing ( %), nasal and/or ocular discharge ( %), vomiting ( %), gagging ( %), lameness ( %), apathy and sneezing (each %). because of these symptoms, five dogs (dogs , , , and ) were presented to private veterinarians within one week of arrival. three of these dogs (dogs , and ) were subsequently referred to small animal clinics for additional investigations. haematology and blood biochemistry results were available for dogs (tables and ), of which were cdv-pcr positive (dogs to , see below). at initial presentation, anaemia ( / , %), leucocytosis ( / , %), eosinophilia ( / , %), neutrophilia ( / , %) and monocytosis ( / , %) were common ( table ) . dogs and showed severe pancytopenia and moderate bicytopenia, respectively; both were cdv pcr-positive, co-infected with babesia spp. (dog ) or positive for anti-leishmania infantum antibodies (dog , see below), and they exhibited fever, increased inspiratory lung sounds, purulent ocular and nasal discharge and radiographic signs that were compatible with bronchopneumonia (tables to ). dog showed slight anaemia and leucopenia ( table ) ; this animal was co-infected with cdv and babesia spp. (tables and ) . dog showed a pronounced eosinophilia ( table ) ; this animal was cdv-pcr negative but dirofilaria immitis positive (tables and ). blood biochemistry results revealed only unspecific changes in the dogs (table ) . the radiographic examinations of the thorax revealed moderate-to-severe interstitial lung changes with variable bronchial thickening in four dogs (dogs - ). the changes were generalised and most pronounced in the dorsal (dog ), perihilar (dogs and ) and caudal lung areas (dog , fig. ). the radiographic findings were compatible with bronchopneumonia in all four dogs, and all of the dogs tested cdv pcr-positive. the thoracic radiographs of dog revealed mild right-sided cardiomegaly and mild generalised bronchointerstitial lung changes; echocardiography showed mild tricuspid and aortic regurgitation but no signs of pulmonary hypertension or right ventricular pressure overload. dog tested d. immitis-positive but was negative for cdv. eleven of the dogs tested cdv pcr-positive during the initial examination ( table ). the positive pcr results were most commonly obtained from conjunctival swabs ( of the cdv-positive dogs, table ). the vaccine-specific real-time reverse transcription (rt)quantitative (q)pcr was negative for all ten dogs that were tested, which supports the finding of infection with a wild-type cdv strain. all three vaccines that were tested (biocan® dhppi & l, bioveta, ivanovice na hané, czech republic; nobivac® dhhpi, msd animal health, luzern, switzerland; canigen® sha ppi, vibac, glattbrugg, switzerland) exhibited a positive pcr result. in gel electrophoresis of the pcr products, a appropriate-sized band was detected for all ten dogs, as were the three vaccines, as expected [ ] . the sequence of the amplification product of the biocan® dhppi & l vaccine used in the dogs of the present study was clearly distinct from the sequence alb albumin; ap alkaline phosphatase; alat alanine aminotransferase; na sodium; k potassium; p phosphorus of the cdv isolates of the ten rescue dogs (fig. ) and most closely related to the cdv vaccine strain onderstepoort ( % nucleotide identity to ab ). sequencing of the ha gene of cdv isolates of five of the infected dogs revealed that the dogs were infected with a similar cdv strain ( . - % nucleotide identity among the ha gene of cdv isolates of dogs , , and ); the ha gene of the cdv isolate of dog differed in only one nucleotide position from the ha gene sequences of the other four cdv isolates. the phylogenetic analysis revealed that the isolates from the five import dogs belonged to the arctic-like lineage of cdv (fig. ) . the ha gene sequences of the cdv isolates were most similar to a published ha gene sequence of a cdv strain from a domestic dog from italy (kf , % nucleotide identity, fig. ) [ ] . they were only distantly related to cdv strains isolated during a cdv epidemic in wild carnivores in switzerland (jf and jf , . % nucleotide identity, fig. ) overall, two dogs (dogs and ) exhibited cdv pcrnegative results one month after the initial examination (table ). two months after the initial examination, another three dogs were found to be cdv pcr-negative (dogs to ); three months after the initial examination, dog was cdv-negative and the remaining three dogs tested cdv-negative four months (dog ) and five months (dogs and ) after the initial examination (table ) . all twelve dogs that were tested for cpv at the initial presentation were pcr-negative (table ) . vector-borne infections were detected in dogs ( %, table ): infection with babesia spp. was detected in dogs and ; infection with l. infantum was diagnosed in dog and infection with dirofilaria immitis was found in dog . dog , which tested positive in d. immitis antigen and knott tests, had received a certificate from a laboratory in budapest, hungary, that stated a negative result in the knott test in august . none of the rescue dogs tested positive for ehrlichia canis (table ) . the cdv-infected dogs , and were hospitalized for two to three days and received intravenous infusions of crystalloids, intravenous antibiotic therapy and inhalation (table ) . dog , which was co-infected with babesia spp., was treated with two imidocarb injections two weeks apart. dog , which was co-infected with l. infantum was treated using allopurinol. all three dogs showed rapid clinical improvement with treatment and were discharged with oral antibiotic therapy. repeated haematological examination in dog two weeks later revealed that the pancytopenia had resolved and had returned to moderate neutrophilia, eosinophilia and slight monocytosis. mild anaemia was still present in dog at that time (data not shown). repeated haematology in dog two weeks after the initial presentation showed normal platelets counts and nearly normal pcv values (data not shown). all three dogs were clinically asymptomatic in the -month follow-up period. dog was ambulatory and was treated with oral antibiotics and antibiotic eye drops ( table ). the dog showed several relapses with purulent nasal and ocular discharge after antibiotic therapy ceased and was repeatedly treated with antibiotics for two months. thereafter, there was no relapse, and the dog was clinically asymptomatic in the remaining -month follow-up period. five cdv pcr-positive dogs (dogs to and ) received oral antibiotic therapy (amoxicillin clavulanic acid or doxycycline) for seven to ten days after their arrival in switzerland. dog developed watery diarrhoea two weeks after arrival and was additionally treated with metronidazole, deworming and a highly digestible diet. dog , which was co-infected with babesia spp., received two injections of imidocarb diproprionate two weeks apart and antibiotic ear drops because of otitis externa. at the end of the -month follow-up period, all of the cdv pcr-positive dogs had recovered and none had developed neurological signs. all of the owners of the cdv pcr-positive dogs were instructed by the first author (bw) to quarantine the dogs until they tested cdv pcr-negative. the owners of the cdv-positive dogs in multidog households (dogs , , , and ) were instructed to separate the infected dog from the other dogs in the household. however, several dogs (dogs , , and ) had already had contact with adult dogs within the household at the time when the cdv diagnosis was made. all of the contact dogs had been vaccinated against cdv, although several dogs had only received the initial vaccination series as puppies and had received no booster vaccinations (data not shown). two dogs that were in close contact with dogs and were tested for the cdv infection with pcr one month and two months after the initial cdv diagnosis in dogs and . one contact dog exhibited a single, very weak cdv-positive result in the conjunctival swab in the first sampling but was negative in all of the swabs collected one month later (data not shown). the other contact dog tested pcr-negative in all of the collected samples (data not shown). in all of the other multidog households, no samples were collected for cdv pcr, but no clinical signs of the disease were noted in the month follow-up period. the present study describes a distemper outbreak in rescue dogs in switzerland that had been imported by an animal welfare organization. one dog had to be and of ten wild-type cdv isolates of the rescue dogs (dogs to and to ) is shown. grey-shaded letters: identical nucleotides between vaccine strains and wild-type isolates. black letters: nucleotides that differ between vaccine strains and wild-type isolates. grey bars: schematic drawing depicting the positions of the primers and the probe used in the cdv vaccine specific real-time rt-qpcr assay [ ] . consensus: consensus sequence of % identical bases matching all of the sequences (most of the ambiguities) euthanized directly after import for humane reasons, whereas nine dogs required therapy for up to two months; three of these dogs were hospitalized at veterinary clinics. the imported animals shed cdv for up to four months, which necessitated long-term quarantine measures. moreover, four of the dogs were infected with vector-borne pathogens. the present study underscores the risk of introducing contagious or vector-borne pathogens to central european countries by importing rescue dogs with incomplete vaccination. based on the data of the anis in switzerland, . % of the newly registered dogs in were imported [ ] . the imported dogs primarily comprised small and miniature purebred dogs to meet the increasing demand for these types of breeds in switzerland, and mixed breed dogs that are rescued by animal welfare organisations [ ] . the dogs of both groups are at risk for carrying infectious diseases because of the inadequate vaccination policies and quarantine measures in many breeding kennels and animal shelters in eastern europe. in the animal shelter in hungary where the dogs originate, no quarantine measures or reliable vaccination policies had been implemented. the dogs had only received a single cdv vaccination either one week or one month before importation to switzerland. at this time point, several dogs had likely been infected with cdv. after the outbreak, the rescue organisation was instructed to introduce vaccination policies and quarantine measures within the animal shelter. in switzerland, the vaccination rate in dogs is insufficiently high to provide population immunity against the cdv infection. the proportion of vaccinated dogs in a population must be > % to provide protection for the dog population, in contrast to protection of only a single vaccinated dog [ ] . a vaccination rate of - % has been estimated for swiss dogs based on the numbers of sold vaccine doses in [ ] . mandatory courses for new dog owners have been introduced in switzerland in which freshly adopted dogs come in close contact with each other. together with the decreasing vaccination rate and the increasing number of imported dogs, this situation has clearly increased the risk for canine distemper outbreaks. dog owners and animal welfare organisations should be informed concerning the critical importance of complete vaccination schedules in domestic dogs. in the present outbreak, the infection could be prevented from spreading to other dogs by extensive followup examinations of the dogs and a thorough education of the dog owners concerning the critical importance of strict quarantine measures. luckily, no cdv-positive dogs of this study had already had contact with young unvaccinated dogs at the time of diagnosis. the cdv vaccines are known to induce a strong and long-lasting immunity when no interference with maternally derived antibodies occurs [ , ] . cdv was reported to be shed by infected animals for up to three months [ , ] . we demonstrated cdv shedding in some dogs in the present study even for up to four months. shedding was detected for several months after the cessation of clinical disease. our results underscore the role of asymptomatic carriers in cdv epidemiology and the importance of a long-term followup of cdv-positive dogs for preventing the spread of infection. several studies have reported the excretion of vaccine strains after cdv vaccination [ , ] . this was not observed in the present study: the dogs that tested cdv pcr-positive were shown to be infected with wildtype cdv, although the majority of the dogs had received mlv cdv vaccination within one to seven weeks before pcr testing. consistent with the published data [ ] , pcr from conjunctival swabs was found to be most reliable for detecting cdv in acutely infected animals and during follow-up examinations. however, in one animal, only the nasal but not the conjunctival swab tested positive for cdv. nine of the dogs in the present study were hospitalized or required ambulatory therapy for up to two months. another animal was euthanised directly after import because of clinical deterioration. in all of the affected dogs, the respiratory and gastrointestinal symptoms predominated. in four dogs, signs of bronchopneumonia were evident. remarkably, none of the dogs developed a neurological disease. whether the latter was due to the intrinsic properties of the cdv strain or to the age and immune status of the dogs is unknown. the sequence analyses of the cdv strains detected in the rescue dogs indicated that all of the dogs were infected with the same wild-type cdv strain, which belongs to the arctic-like lineage of cdv [ , ] . the initial description of arctic-like lineage of cdv dates back to the late s, when epizootics were observed in seals in northern europe and siberia [ ] [ ] [ ] . (see figure on previous page.) fig. phylogenetic relationship between selected cdv strains based on the complete haemagglutinin (ha) gene sequence. the cdv isolates analysed in this study appear in bold. nine cdv lineages are shown: asia- , europe, america- , europe-wildlife, africa, arctic-like, asia- , asia- and america- . phocine distemper virus (pdv- ) was used as the outgroup. genbank accession numbers, host species and geographical origin are indicated, if known. the numbers at the nodes were generated from bootstrap resamplings; only values > are shown. the bar represents the mean number of differences per sites. strain af (giant panda isolate) is the resultant of a genetic recombination between "asia- " and a "europe-wildlife" strain [ ] the strains of the arctic-like lineage are closely related to the cdv strains in north america, china and greenland and were recently isolated from domestic dogs in hungary [ ] and domestic dogs and wolves in southern italy [ , ] . the present study shows how fast these strains can spread to central european countries by import of infected domestic dogs. the present study indicates that rescue dogs may also play an important role in the spread of vector-borne infections to central european countries. babesia spp., l. infantum or d. immitis infections were detected in four of the rescue dogs. several dogs were reported to be free of these pathogens based on the laboratory certificates provided by the animal welfare organisation. in the case of dog , d. immitis infection was diagnosed in this study using the antigen enzyme immunoassay and the knott test in november . the dog was found to be negative in the knott test in august . the d. immitis antigen and knott tests are known to turn positive not before five to eight months after infection [ ] ; therefore, the infection could have been missed in the first testing. l. infantum serology specimen, which was positive in dog , has similar limitations in that negative serological results cannot exclude infection and seroconversion can occur many months after infection [ ] . future dog owners should be properly informed concerning the limitations of these tests and the costs of treatment for vector-borne infections. the present study highlights the risks of spreading contagious viral and vector-borne infections by a nonselective import of sick and unvaccinated dogs or dogs with incomplete vaccination from eastern european countries. the animal welfare organisations should be thoroughly informed concerning the critical importance of complete vaccination schedules and quarantine measures in animal shelters to combat the outbreaks and the spread of viral pathogens to other countries. dog owners in switzerland should be educated regarding the risk of and the potential costs of adopting sick dogs or dogs with incomplete vaccination and the critical importance of sufficiently high vaccination rates in domestic dogs in switzerland. the present study describes a distemper outbreak in fifteen dogs originating from an animal shelter in kecskemét, hungary, and the prospective follow-up of the infected animals. the dogs were imported to switzerland by an animal welfare organisation on october , . one dog had to be euthanised within a several days of arrival. no data on that dog were available. of the remaining fourteen dogs, the signalment, vaccination and medical history and clinical signs were recorded (table ) and dogs were monitored for six months. sample and data collection and sample processing nasal and/or conjunctival swabs were collected from dogs for cdv-specific real-time rt-qpcr and rectal swabs from dogs for cpv real-time qpcr as indicated in tables and . edta blood and serum samples were collected to obtain haematology and blood biochemistry results, and for cdv real-time rt-qpcr and testing for vector-borne infections (babesia spp., e. canis, l. infantum and d. immitis) as indicated in tables through . all of the samples were processed within h of collection. in of the cdv-infected dogs (dogs to and to ), monthly follow-up examinations for cdv were performed from conjunctival, nasal and oropharyngeal swabs ( table ). the swabs were collected by the owner based on written and image instructions regarding how to collect and ship the samples. all of the swabs were sent by priority mail to the clinical laboratory, vetsuisse faculty, university of zurich, within one day of collection. follow-up was continued in each dog until the dog tested cdv pcrnegative, except for dog , in which the owner declined further testing despite a pcr-positive result at three months of follow-up. haematology and blood biochemistry tests were performed at the clinical laboratory, vetsuisse faculty, university of zurich (dogs and , to and ), at the clinical diagnostic laboratory, vetsuisse faculty, university of bern (dog ), at a private laboratory (dog : alomed, radolfzell-böhringen, germany) or by a private veterinarian (dog , tables and ). the laboratory's own device-specific reference intervals were applied; for dogs aged to months (dogs , to ), published reference intervals for phosphorous, alkaline phosphatase, urea and creatinine were used [ ] . at the time of the initial examinations, conjunctival, nasal or rectal swabs were incubated for min in μl of phosphate buffered saline (pbs) at °c; the swabs were subsequently turned upside down and centrifuged for min at × g and the supernatant was used for tna extraction (see below). for the follow-up examinations, the two conjunctival and the two nasal swabs, respectively, were pooled in a total of μl of pbs before incubation at °c for min and tna extraction. the tna extraction was performed from μl of edta blood, μl of swab supernatant or vaccine material that was resuspended in μl of pbs (see below) using the magna pure lc (roche diagnostics ag, rotkreuz, switzerland) and the magna pure lc tna isolation kit (roche diagnostics) following the manufacturer's instructions. with each batch of extraction, a negative control consisting of μl of pbs was used to monitor for cross-contamination. the tna was stored at − °c until pcr analysis was performed. for cdv testing, a published real-time rt-qpcr assay was used as previously described [ ] . for the detection of cpv, a published real-time qpcr assay developed for the detection of feline parvovirus (fpv) was applied [ ] . the assay amplifies a bp sequence of the highly conserved vp /vp gene region using the following primers and probe: pv f: ′-actgcatcattgat ggttgca- ′; pv r: ′-ggtatggttggtttc catgga- ′ pv p: ′-fam-cccaatgtctcaga tctcatagctgctgg- -tamra- ′. sequence comparison revealed that the primer and probe-binding sites in the vp /vp gene region of fpv and cpv showed > % sequence identity (genbank accession numbers m , m , m , m , m , m , m , km , jq ). during cdv follow-up, a published canine (c)gapdh pcr assay was applied to ensure that the quality of the swabs collected by the dog owners was adequate [ ] . during follow-up, dogs were stated cdv-negative if they tested pcr-negative for cdv in conjunctival, nasal and oropharyngeal swabs and the swabs showed a cgapdh threshold cycle below . all of the real-time pcr reactions were run using an abi fast real-time pcr system (applied biosystems, rotkreuz, switzerland). negative and positive controls were included in each pcr run. to ensure that the cdv real-time rt-qpcr signal was due to infection and was not due to a recent vaccination, a published real-time rt-qpcr system based on the cdv m gene and m-f intergenic region was used [ ] . the primers of the pcr assay amplify the mlv vaccine and wild type cdv strains, whereas the probe of the assay only binds to the mlv vaccine strains (fig. ) . because no sequence data have been published on the m gene and the m-f intergenic region of cdv u strain contained in the vaccine used in the rescue dogs (biocan® dhppi & l, bioveta), the latter vaccine, together with two other cdv vaccines that are commercially available in switzerland (nobivac® dhhpi, msd animal health; canigen® sha ppi, vibac) were tested to confirm that the cdv strains contained in these vaccines are detected by the assay. the tna from the three vaccines and from the conjunctival or nasal swabs from of cdv pcr-positive dogs (dogs to and to ) were subjected to real-time rt-qpcr. the pcr products were separated using . % agarose gel and appropriate-sized bands ( bp) cut out, extracted using the minelute® gel extraction kit (qiagen, hombrechtikon, switzerland) and sequenced (microsynth, balgach, switzerland). the complete haemagglutinin (ha) genes of the cdv isolates from five dogs were sequenced (dogs , , , and ). the tna extracted from the conjunctival swabs was used as a template. for amplification, five previously published primer pairs were used [ ] ; single nucleotides in one primer pair ( f and r) had to be changed because of mismatches within the primer binding sites for the five cdv isolates ( f_new: '-ctgtacat caccaagtcata- ' and r_new: '-tagaatac catcttgtgaat- '). reverse transcription was performed using the high capacity cdna reverse transcription kit (applied biosystems) according to the manufacturer's instructions. the pcr amplification was conducted using μl of x hf pcr buffer (finnzymes, bioconcept, allschwil, switzerland), nm each primer, μm each dntp (sigma-aldrich, buchs, switzerland), u phusion high-fidelity dna polymerase (finnzymes), and . μl template cdna made up to μl with water. the thermal cycling conditions comprised °c for min, cycles at °c for s, °c for s, °c for min, and a final elongation at °c for min. after the pcr run, the amplification products were separated using % agarose gel; appropriately sized products were excised and purified using the minelute gel extraction kit (qiagen). direct sequencing of the purified amplicons was performed using the amplification primers in a commercial laboratory (microsynth, balgach, switzerland) under standard conditions. vector-borne infections were tested in dogs, as shown in table . the analyses were performed at the clinical laboratory (for e. canis) and the institute of parasitology (for babesia spp., l. infantum and d. immitis) of the vetsuisse faculty, university of zurich, and at private laboratories (dog : labor am zugersee, hünenberg, switzerland; dog : alomed; dog : idexx diavet ag, bäch, switzerland) ( table ). the laboratories' own reference values were used for defining the positive, negative and intermediate results. the microscopic blood smear evaluation for the presence of babesia spp. organisms was conducted in dog by the private veterinarian and in dog by a commercial laboratory (alomed) ( table ) . the obtained sequences were edited and aligned with a consensus sequence using geneious version . . [ ] . only the nucleotides available for all of the included sequences ( nucleotides of the ha gene) were used to calculate the percent nucleotide identities and perform the phylogenetic analyses. for the phylogenetic analyses, the sequences were aligned with known distemper sequences from genbank (see fig. ) using geneious version . . . a bootstrap phylogenetic tree demonstrating the relationship between the isolates was created using the maximum-likelihood method [ ] and a distance matrix corrected for nucleotide substitutions based on the kimura -parameter model [ ] . the dataset was resampled times to generate bootstrap values. the phylogenetic and molecular evolutionary analyses were conducted using the mega version [ ] . nucleotide sequences obtained in this study have been submitted to genbank under accession numbers kr to kr . canine distemper spillover in domestic dogs from urban wildlife canine distemper in terrestrial carnivores: a review canine distemper virus-a morbillivirus in search of new hosts? serological and demographic evidence for domestic dogs as a source of canine distemper virus infection for serengeti wildlife pathogenesis of canine distemper inactivation of laboratory animal rna-viruses by physicochemical treatment lymphocyte-mediated immune cytotoxicity in dogs infected with virulent canine distemper virus canine distemper virus canine distemper virus uses both the anterograde and the hematogenous pathway for neuroinvasion acute canine distemper encephalitis is associated with rapid neuronal loss and local immune activation infectious diseases of the dog and cat neurological manifestations of canine distemper virus infection vaccination of dogs with modified distemper virus distemper epidemic in switzerland: epidemiology and anamnesis of vaccination emergence of canine distemper virus strains with modified molecular signature and enhanced neuronal tropism leading to high mortality in wild carnivores real-time reverse transcription polymerase chain reaction method for detection of canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains whole genome sequence analysis of the arctic-lineage strain responsible for distemper in italian wolves and dogs through a fast and robust next generation sequencing protocol vaccine use and disease prevalence in dogs and cats gst) und schweizerische vereinigung für kleintiermedizin (svk) duration of immunity induced by companion animal vaccines age and long-term protective immunity in dogs and cats detection of canine distemper virus in dogs by real-time rt-pcr comparison of the immunofluorescence assay with rt-pcr and nested pcr in the diagnosis of canine distemper comparison of tissue and fluid samples for the early detection of canine distemper virus in experimentally infected dogs occurrence of different canine distemper virus lineages in italian dogs an outbreak of dog distemper among seals ( ) baikal seal virus comparison of two morbilliviruses isolated from seals during outbreaks of distemper in north west europe and siberia genetic diversity of hungarian canine distemper virus strains heterogeneity within the hemagglutinin genes of canine distemper virus (cdv) strains detected in italy arctic lineage-canine distemper virus as a cause of death in apennine wolves (canis lupus) in italy canine and feline dirofilariasis: life cycle, pathophysiology, and diagnosis guidelines for diagnosis and clinical classification of leishmaniasis in dogs pediatric clinical pathology feline leukemia virus and other pathogens as important threats to the survival of the critically endangered iberian lynx (lynx pardinus) high viral loads despite absence of clinical and pathological findings in cats experimentally infected with feline coronavirus (fcov) type i and in naturally fcov-infected cats quantitative real-time pcr for the measurement of beta-hsd and beta-hsd mrna levels in tissues of healthy dogs emergence of canine distemper in bavarian wildlife associated with a specific amino acid exchange in the haemagglutinin protein geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data prospects for inferring very large phylogenies by using the neighbor-joining method a simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences molecular evolutionary genetics analysis version . cross-species recombination in the haemagglutinin gene of canine distemper virus evaluation of enzyme-linked immunosorbent assays, an immunofluorescent-antibody test, and two rapid tests (immunochromatographic-dipstick and gel tests) for serological diagnosis of symptomatic and asymptomatic leishmania infections in dogs submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution the authors thank the animal rescue organisation and the owners of the dogs for providing the data and supporting diagnostic work-up. we thank t. meili, e. goenczi, s. childers and the technicians of the clinical laboratory for their excellent laboratory assistance. the laboratory work was performed using the logistics of the center for clinical studies, vetsuisse faculty, university of zurich. as was supported by a research grant (forschungskredit, fk- - - ) from the university of zurich. the authors declare that they have no potential conflicts of interest to disclose.authors' contributions rhl and bw conceived the study. bw and ams were responsible for the study coordination and the data and sample collections. lb, tb and rj were responsible for the clinical work-up and medical care of the dogs. mlm was responsible for the molecular laboratory aspects, fg was responsible for the analyses of vector-borne infections, br was responsible for the haematology and blood biochemistry tests and md was responsible for all aspects of diagnostic imaging. rhl and bw drafted the manuscript. all of the authors read and approved the final manuscript. key: cord- -x uq authors: kongsted, hanne; jonach, beata; haugegaard, svend; angen, Øystein; jorsal, sven e; kokotovic, branko; larsen, lars e; jensen, tim k; nielsen, jens p title: microbiological, pathological and histological findings in four danish pig herds affected by a new neonatal diarrhoea syndrome date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: x uq background: neonatal diarrhoea is a frequent clinical condition in commercial swine herds, previously regarded to be uncomplicated to treat. however, since it seems that a new neonatal diarrhoeic syndrome unresponsive to antibiotics and common management practices has emerged. routine laboratory examinations have not detected any pathogen related to this syndrome. the primary purpose of this study was to evaluate if well-known enteric pathogens could be associated with outbreaks of neonatal diarrhoea, thus question the hypotheses of a new syndrome. furthermore, we wanted to evaluate macroscopic and microscopic findings associated with these outbreaks and if possible propose a preliminary piglet-level case-definition on syndrome new neonatal porcine diarrhoea syndrome (nnpds). results: four well-managed herds experiencing neonatal diarrhoea with no previously established laboratory conclusion and suspected to suffer from new neonatal porcine diarrhoea syndrome, were selected. within these herds, diarrhoeic and non-diarrhoeic piglets at the age of three to seven days were necropsied and subjected to histological and microbiological examination. faeces were non-haemorrhagic. neither enterotoxigenic e. coli, clostridium perfringens type a or c, clostridium difficile, rotavirus, coronavirus, cryptosporidium spp, giardia spp, cystoisospora suis nor strongyloides ransomi were associated with diarrhoea in the investigated outbreaks. macroscopically, the diarrhoeic piglets were characterized by filled stomachs and flaccid intestines without mucosal changes. the predominant histological lesions were villous atrophy in jejunum and ileum. epithelial lesions in colon were seen in one third of the case piglets. conclusions: the results of the study supported the hypothesis that a new neonatal porcine diarrhoea was present in the investigated herds, since no known pathogen(s) or management factors could explain the diarrhoeal outbreaks. based on the findings in the four herds the following case-definition of nnpds was suggested: non-haemorrhagic diarrhoea during the first week of life, without detection of known infectious pathogens, characterized by milk-filled stomachs and flaccid intestines at necropsy. neonatal diarrhoea is a well-known clinical condition, present at varying prevalence in most commercial swine herds. however, since field experiences on an apparently new diarrhoeic syndrome unresponsive to antibiotics and common management practices have been reported (personal communications, s.e. jorsal, national veterinary institute, technical university of denmark and b. svensmark, pig research centre, danish agriculture & food council, denmark). the emergence of a new neonatal diarrhoeic syndrome (by some authors referred to as new neonatal porcine diarrhoea (nnpd) has been suggested in different countries [ ] [ ] [ ] [ ] . a common feature of the reported cases is that known enteric pathogens cannot be associated with the clinical outbreaks in routine laboratory submissions. routine laboratory testing protocols may vary from region to region. disregarding local procedures, the following agents are usually included in diagnostic protocols for neonatal diarrhoea: enterotoxigenic escherichia coli (etec), clostridium perfringens type a (cpa), clostridium perfringens type c (cpc), clostridium difficile (cd) rotavirus group a (rv) and coronavirus [ , ] . parasites, which may be relevant to consider in relation to neonatal diarrhoea are cryptosporidium spp, giardia spp, cystoisospora suis and strongyloides ransomi [ ] [ ] [ ] . systematic investigations of piglets from herds affected by the apparently new diarrhoeic syndrome are lacking. the overall aim of this study was to investigate whether a detailed microbiological examination of a larger number of piglets from affected herds could link the presence of neonatal diarrhoea with known enteric pathogens. such associations would challenge the hypothesis that a new disease syndrome has evolved. another aim was to determine if diarrhoeic piglets from different herds had characteristic and consistent gross and microscopic lesions to support the elaboration of a joint case definition of nnpds. the article describes the prevalence of well-known enteric pathogens in age-matched diarrhoeic-and nondiarrhoeic piglets from four herds affected by neonatal diarrhoea with no previously established laboratory conclusion. furthermore, results of gross pathology and histopathology are presented. summarizing these findings, the article suggests a case-definition on nnpds. a total of diarrhoeic ( - pr . herd) and nondiarrhoeic piglets ( - pr . herd) at the age of three to seven days were included in the study. clinically, the diarrhoeas were non-haemorrhagic. eighty percent of diarrhoeic piglets had been diarrhoeic for either two or three days prior to euthanasia. diarrhoea for four days was seen in % of the diarrhoeic piglets whereas only % had been diarrhoeic for five days. table summarizes the microbiological findings in relation to diarrhoeic status. none of the microbiological agents was significantly more prevalent in diarrhoeic than in non-diarrhoeic piglets. non-haemolytic e. coli was the predominant finding in the aerobic culture from both diarrhoeic and nondiarrhoeic piglets, whereas haemolytic strains were found in only three piglets in total (all of them diarrhoeic). the main part of e. coli isolates were non-typeable. sixty-three e. coli isolates were subjected to virulence gene determination by pcr. fimbrial genes were detected in nine of isolates from diarrhoeic piglets. the fimbrial distribution among isolates was; f (n= ), f (n= ), f (n= ), f (n= ), f (n= ), f /f (n= ) and f /f (n= ). in nondiarrhoeic piglets fimbrial genes were detected in seven of isolates. the fimbrial distribution among these isolates was; f (n= ), f (n= ), f (n= ), f (n= ) and f (n= ). table gives an overview of toxin genes detected in fimbriated and non-fimbriated isolates from the two groups of piglets. classic etec with simultaneous occurrence of both fimbrial and toxin genes were detected in only one diarrhoeic piglet. in the anaerobic culture, cpa was a very frequent finding. these bacteria were more prevalent in non-diarrhoeic than in diarrhoeic piglets ( % vs. %). necropsy findings are presented in table . very few extra-intestinal lesions were observed (not shown), and only one of these; a pale or icteric liver, was observed in more than one piglet ( of the diarrhoeic vs. of the non-diarrhoeic piglets). as indicated in table , six findings showed a statistically significant higher prevalence in diarrhoeic versus non-diarrhoeic piglets. table outlines the prevalence of these six findings in the two groups of piglets within each herd. within all herds, a poor body condition, flaccidity of the small intestine, flaccidity of the large intestine and liquid large intestinal contents seemed positively associated with diarrhoea (though not statistically significant in all cases, see table ). flaccidity of the large intestine was in most cases ( of cases) seen in conjunction with small intestinal flaccidity. figure shows a flaccid and figure shows a normal intestine. in the small intestine, villous atrophy with crypt hyperplasia was the most frequently observed lesion. shows atrophic villi in ileum as compared to normal villi shown in figure . overall, an atrophic pattern was seen in the jejunal and/or ileal mucosa in % of diarrhoeic and % of non-diarrhoeic piglets. the severity of atrophy varied, with no obvious association with diarrhoeic status. in ileum, the villous atrophy was most pronounced over the peyer's patches. duodenal villi were not affected. a statistically significant association (p< . ) between villous atrophy and flaccidity of the small intestine at necropsy was seen. in % of piglets having villous atrophy, small intestinal flaccidity had been recorded at necropsy. irrespective of diarrhoeic status approximately % of piglets had a slight to moderate local infiltration of neutrophils in the lamina propria. occasionally, the lamina propria in the diarrhoeic piglets was congested and edematous. mild epithelial lesions were seen at the tip of the villi in % of the diarrhoeic and % of the non-diarrhoeic piglets and were usually associated with villous atrophy. crypts of lieberkühn epithelium were intact in both groups. foci of mucosal necrosis were seen in the small intestines of % of the diarrhoeic piglets versus none of the non-diarrhoeic ones. in colon, mild epithelial lesions were seen in % of the diarrhoeic piglets and % of the non-diarrhoeic piglets. occasionally, the colonic crypts in diarrhoeic piglets were irregular and elongated. mucosal necrosis in the colon was seen in one diarrhoeic piglet, which also had necrotic changes in the small intestine. no parasites were seen in the intestinal mucosa of any piglet. table depicts histopathological findings in diarrhoeic and non-diarrhoeic piglets within the four herds and summarizes the overall prevalences. both villous atrophy and large intestinal epithelial lesions showed an overall statistically significant positive association with diarrhoea, and seemed positively (or at least not negatively) associated with diarrhoea within all herds. non-enterotoxigenic (containing neither fimbrial nor toxin genes) e. coli was a frequent finding in both diarrhoeic and non-diarrhoeic piglets, whereas only one enterotoxigenic isolate was detected. hence, etec did not seem to play any pathogenic role in relation to the investigated outbreaks of diarrhoea. other studies have indicated that attaching and effacing e. coli (aeec), carrying neither fimbrial nor toxin genes, are able to induce diarrhoea in newborn piglets [ ] and to induce villous atrophy [ ] . the prevalence of aeec in the present study is currently being investigated. cpc was cultured in four piglets of the study. due to the low prevalence the significance of this bacterium in relation to the investigated outbreaks is probably minimal. the significance of cpa in relation to diarrhoea in table occurence of toxin genes within fimbriated and non-fimbriated e. coli isolates from diarrhoeic and non-diarrhoeic piglets from diarrhoeic piglets neonatal piglets is controversial, since it has been concomitantly recognized as part of the normal intestinal flora and as a potential intestinal pathogen [ , ] . in this study we found a significantly higher prevalence of cpa in non-diarrhoeic vs. diarrhoeic piglets. most likely, this finding merely reflects the intact intestinal flora within the non-diarrhoeic piglets. cd has been reported in cases of neonatal diarrhoea in piglets [ , ] . however, in this study, this bacterium was only detected in two piglets and the characteristic histopathological lesions previously reported to be associated with cd infections [ ] were not seen. accordingly, cd does not seem to be associated with the investigated outbreaks. the scarcity of known pathogens in the outbreaks of the study supports the hypothesis that the investigated herds experienced diarrhoea of unknown aetiology. therefore the outbreaks may be representative of the new syndrome nnpds. a poor body condition and dehydration were rather prevalent findings in diarrhoeic piglets in this study. however, unless very pronounced, these features are not characteristic for specific diarrhoeic syndromes, since they merely reflect the loss of nutrients and water associated with any diarrhoeic condition. milk-filled stomachs, in contrast, seem to be a characteristic finding associated with this syndrome. since neonatal diarrhoea is commonly associated with malabsorption caused by starvation, the filled stomachs seen in % of diarrhoeic piglets in this study are interesting findings which clearly differentiate this syndrome from outbreaks of neonatal diarrhoea related to starvation. however, since the vast majority ( %) of piglets in this study were diarrhoeic for two or three days only, we do not have information on the contents of stomachs at later stages of disease. obviously, one would expect long lasting diarrhoea to keep piglets from suckling due to malaise, and therefore this criterion is probably only valid at early stages of disease. intestinal flaccidity was the most prominent and consistent gross lesion. flaccidity of intestines is seen in different conditions, postweaning multisystemic wasting syndrome (pmws) [ ] and diet-induced malabsorption being the most obvious examples. liquid contents in colon are expected in all diarrhoeic conditions and are therefore not considered diagnostic to any specific syndrome. somewhat surprising, half of the diarrhoeic piglets did not have liquid content in colon at necropsy, which probably reflects that these piglets were in the recovery phase of disease. if so, this potentially implies a diagnostic problem due to less pronounced lesions and decreased excretion of infectious agents at this phase. however, since the clinical course of diarrhoea turned out to be very short (as evidenced by % of the selected piglets being diarrhoeic for only two or three days) it would not have been practically feasible to avoid selection of piglets in recovery. the most consistent and predominant histological lesion observed in diarrhoeic piglets was villous atrophy (seen in % of diarrhoeic vs. % of non-diarrhoeal piglets). villous atrophy is a very common finding in diarrhoeic conditions [ ] and in this study, the atrophy was neither associated with infection by well-known pathogens nor malnutrition. the strong association between villous atrophy and grossly visible intestinal flaccidity indicates that decreased mucosal thickness is reflected grossly as a thinwalled, atonic intestine. epithelial lesions in the large intestine also seemed to be consistently associated with diarrhoea in this study (seen in % of diarrhoeic vs. % of non-diarrhoeic piglets), but due to the low prevalence, these lesions do not seem to be relevant to include in a case definition. overall, the present study suffers from lack of comparable piglets from non-nnpds-affected herds in order to correctly classify findings as typical or diagnostic of nnpds. moreover, the selection of study herds posed some difficulties since the selection was basically based on a high prevalence of diarrhoea and absence of agents (in five piglets). obviously, potential misclassification of herds is an issue to considerthough hard to address or control at this stage of investigation. to our knowledge, this is the first study investigating outbreaks of diarrhoea in herds suspected to suffer from nnpds. the aetiology behind these outbreaks was either undetected pathogens or non-infectious factors. practical experience indicates that eg. high levels of protein in sow feed can lead to diarrhoea in neonatal pigs. however, all of the investigated herds used restricted levels of protein in sow feed, and had previously tried minimizing protein content with no preventive effect. as previously underlined, the diarrhoea seemed unrelated to postnatal starvation, bot intrauterine events may have affected the normal development of intestinal absorptive capacity. thus, the villous atrophy seen in the study may reflect prenatal under-development of villi. the unspecific nature of intestinal lesions seen in this study underlines the complexity of intestinal pathology in neonatal pigs. interestingly, even early studies from the seventies and eighties concluded that gross lesions seem similar and unspecific irrespective of the underlying aetiology in this age group of piglets [ , ] . moreover, in the study from no pathogens were detected in as many as % of fatal neonatal gastroenteropathies. thus, the existence of neonatal diarrhoa with unspecific lesions and without known pathogens is not a new phenomenon. it appears, however, that the clinical picture in the herds is new. at this point we do not know whether this clinical picture is a more severe manifestation of a syndrome already present but not recognized back in the seventies, or if we are experiencing a truly new syndrome. from a practical point of view, obviously the most urgent issue is to recognize the aetiology behind the current problems. this study disclaims associations with established agents, but yet unestablished agents or shifts in intestinal bacteral population dynamics may play a role. therefore, culture-independent methods like metagenomics and high-throughput qpcr may be rewarding in the future investigation. this study suggests the existence of a yet unexplained diarrhoea syndrome related to the first week of life. the syndrome is not related to starvation or infection by enterotoxigenic e. coli, clostridium perfringens type a or c, clostridium difficile, rotavirus, coronavirus, cryptosporidium spp, giardia spp, cystoisospora suis or strongyloides ransomi. characteristic postmortem findings are flaccid intestines without mucosal pathology or lymph node enlargement. histologically, villous atrophy in jejunum and ileum are the most prominent findings and epithelial lesions in colon also seem to be associated with the syndrome. apparently, the flaccidity of intestines seen at necropsy is a reflection of the reduced length of intestinal villi. for a preliminary piglet level case-definition we suggest the following; non-haemorrhagic diarrhoea during the first week of life, with no detection of known infectious agents and characterized by a milk-filled stomach and flaccid intestines at necropsy. since histopathological examination mainly revealed uncharacteristic lesions, this diagnostic approach does not seem to be rewarding at this stage of investigation. a case-control study on euthanized piglets selected from four danish production herds was performed during . a total of piglets from these herds were clinically evaluated from the day of birth and were euthanized at selected time points. herds were recommended by veterinary practitioners and included in accordance with the following criteria: ) presence of diarrhoea responding poorly to antibiotics during the first week of life (at least % affected litters for a period of minimum months), ) routine vaccination of sows against etec and cpc, ) failure of preventive management interventions, ) prrs negative farrowing unit as demonstrated in blood samples tested by elisa/ipt or pcr and ) negative results of routine diagnostic examinations for etec, cpc and rv in five diarrhoeic piglets aged one to four days. a total of four herds were selected. they all presented high standards of housing and management with all-in/ all-out practice in farrowing units and appropriate cleaning between farrowing batches. farrowing crates had partially slatted floors of plastic or iron bars with supplemental heat and cover provided for the piglets. : in diarrhoeic and non-diarrhoeic piglets samples from colon were missing or autolytic and therefore not included in the analysis. *denotes statistically significant positive associations with diarrhoea within herds (one-sided fisher's exact test (α= , )). findings having a statisticallly significant association with diarrhoea across herds are presented in bold. all four herds had been affected by neonatal diarrhoea for at least one year. preventive interventions which had failed included minimizing protein-levels in sow feed, optimization of hygiene procedures, immunization by faecal backfeeding and vaccination against cpa and porcine circovirus type (pcv ). in all herds, many different antibiotics and different treatment strategies had been tried out unsuccessfully. all herds used toltrazuril at day three to four of life to prevent coccidiosis. castration of males and iron-injections were carried out at the same day. descriptive data on the herds are presented in table . in each herd, approximately newly farrowed sows (half of a farrowing batch) with no clinical signs of disease prior to farrowing were selected. the selection procedure was designed to include all available first parity litters, since they were expected to exhibit the highest prevalence of diarrhoea. at the day of birth (day one), the included litters were standardized to or piglets by randomly selecting piglets weighing ≥ g. surplus piglets were removed during the first hours after birth and no cross-fostering was made during the suckling period. sows and piglets were clinically examined daily from day until day five to seven and again on day ten. in the same period, rectal swabs were taken. consistency of faeces was judged as fluid or normal from the appearance on the rectal swab. in each herd, age-matched case and control piglets were selected for necropsy at two different time-pointsearly and late in the course of disease. these time-points were based on previous experience with the syndrome in each herd. in herds experiencing diarrhoea starting at the second day of life, piglets were necropsied at day three and five of life. if diarrhoea occurred from the third day of life, piglets were necropsied at day four and six of life and so on. in the herds, clinical signs started at day two, three or four of life, resulting in necropsies being performed on piglets between three and seven days of age. selection criterion for diarrhoeic piglets was fluid consistency of faeces for at least two subsequent days, including the day of selection. selection criterion for non-diarrhoeic piglets was normal consistency of faeces at all days prior to selection. diarrhoeic piglets were selected from the litters having the highest prevalence of diarrhoea, whereas non-diarrhoeic piglets were selected from the litters exhibiting no or little diarrhoea. none of the piglets euthanized at the early stage (three to five days of age, depending on herd) had been treated by antibiotics. all diarrhoeic piglets euthanized at the late stage (five to seven days of age, depending on herd) had been medicated according to the individual herd routine. live piglets were transported to the laboratory and euthanized within six hours after selection. all organs were routinely examined for gross lesions. a poor body condition was recorded if protruding ribs and spine were observed. dehydration was recorded if eye balls were deeply positioned in the skull and muscles appeared dry on the cut surface. histopathological examination was carried out on samples from duodenum, jejunum, ileum and spiral colon. samples were fixed immediately after euthanasia in % neutral buffered formalin for at least hours. the samples were then embedded in paraffin wax, cut at μm, stained with haematoxylin and eosin (he) and examined by light microscopy. the intestinal mucosa of each specimen was histopathologically evaluated. villous atrophy was recorded when shortening of villi accompanied by decreased height of enterocytes and increased cellularity of the lamina propria was seen in at least one region of the intestinal sample. crypt hyperplasia was recorded when the intestinal crypts were elongated with an increased number of mitotic figures. disruptions in normal epithelial architecture with preserved integrity of the epithelium were recorded as mild epithelial lesions. diffuse necrotic changes in the epithelium and lamina propria were recorded as mucosal necrosis. the presence of parasites (cryptosporidium spp, giardia spp, cystoisospora suis and strongyloides ransomi) was examined using standard diagnostic criteria. sections of jejunum and colon were aerobically cultured for e. coli. parallel culturing on drigalski (in house selective and indicative medium for coliforms) and blood agar plates (columbia agar (oxoid) supplemented with % calf blood) was performed. plates were incubated for hours at °c. piglets were considered e. coli positive if any growth of haemolytic colonies or moderate/ massive growth of nonhaemolytic colonies was seen in any section of intestine. serogrouping of e. coli was performed -using one isolate per piglet -by agglutination with monovalent o-antisera (o , o , o , o , o , o , o and o , statens serum institut, copenhagen, denmark) [ ] and real-time pcr was performed for detection of virulence factor genes f , f , f , f , f , sta, stb, lt and vt e [ ] . if no agglutination with antisera was seen, the isolate was designated non-typeable. if agglutination occurred in all pools, the isolate was considered to be o-rough. culturing of cp was carried out using columbia agar (oxoid) supplemented with % calf blood and polymyxin incubated anaerobically for hours at °c. colonies were verified using tryptose-sulfite-cycloserine agar (oxoid). piglets were considered culture positive if moderate/ massive growth was observed in any section of intestine. typing of suspected samples was performed by pcr [ ] on a pool of four isolates having characteristic colony morphology on columbia agar (shiny, grey, double-haemolytic colonies). culturing of cd was performed using cycloserine cefoxitin fructose agar, incubated anaerobically for hours at °c. piglets were considered positive if yellow colonies with a characteristic horse-stable odour were detected in any section of intestine. contents of jejunum were examined for rotavirus group a by an enzyme immunoassay (prospectt® rotavirus) according to the manufacturer's instructions and for coronavirus by a pan-corona rt-pcr assay as previously described [ ] . positive associations between diarrhoea and microbiological and pathological findings were evaluated using one-sided fisher's exact tests (α= . ). when considered relevant, associations between histopathology and necropsy were also evaluated by fisher's exact tests (α= . ). since the piglets originated from four different herds, associations within herds were also assessed. the present study was not subject to ethical approval as danish laws do not require ethical approval for studies not involving different treatment groups or blood testing. the study only involved procedures normally used for routine diagnostics. new neonatal diarrhoea syndrome in denmark clinical and laboratory investigations in french pig herds dealing with enzootic neonatal diarrhoea neonatal diarrhoea in piglets from e. coli vaccinated sows in sweden new neonatal porcine diarrhoea. ii. aspects on etiology a survey of agents associated with neonatal diarrhea in iowa swine including clostridium difficile and porcine reproductive and respiratory syndrome virus pathogenesis of intestinal cryptosporidiosis in conventional and gnotobiotic piglets occurrence of isospora suis in larger piglet production units and on specialized piglet rearing farms cryptosporidium and giardia in different age groups of danish cattle and pigs -occurrence and management associated risk factors isolation and association of escherichia coli aida-i/stb, rather than east pathotype, with diarrhea in piglets and antibiotic sensitivity of isolates experimental infection of newborn pigs with an attaching and effacing escherichia coli o :k"e " strain clostridial enteric infections in pigs matched case-control study evaluating the frequency of the main agents associated with neonatal diarrhea in piglets the comparative pathology of clostridium difficileassociated disease postweaning multisystemic wasting syndrome in danish pig herds: productivity, clinical signs and pathology epithelial renewal in health and disease. villous atrophy neonatal diarrhoea of pigs in quebec: infectious causes of significant outbreaks preweaning mortality in pigs. . diseases of the gastrointestinal tract in pigs prevalence of serogroups and virulence genes in escherichia coli associated with postweaning diarrhoea and oedema disease in pigs and a comparison of diagnostic approaches diagnostic multiplex pcr for toxin genotyping of clostridium perfringens isolates a pancoronavirus rt-pcr assay for detection of all known coronaviruses submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution the study was supported by the danish ministry of food, agriculture and fisheries. the authors wish to thank birgitta svensmark and technical personnel at the laboratory of swine diseases, pig research centre and technical personnel at the national veterinary institute, technical university of denmark for their technical assistance. the authors declare that they have no competing interests. all authors contributed to the design of the study. inclusion of herds, clinical examination in the herds and selection of piglets was done by hk. necropsy was performed by sh and histological examinations were performed by bj. culturing of clostridium difficile was done by bk and virulence gene determination of e. coli isolates by Øa. lel did the pan-corona rt-pcr assays. hk conducted the statistical analysis. all authors participated in drafting the manuscript and proofreading of the final manuscript. key: cord- -zkwiag a authors: balboni, andrea; bassi, francesca; de arcangeli, stefano; zobba, rosanna; dedola, carla; alberti, alberto; battilani, mara title: molecular analysis of carnivore protoparvovirus detected in white blood cells of naturally infected cats date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: zkwiag a background: cats are susceptible to feline panleukopenia virus (fpv) and canine parvovirus (cpv) variants a, b and c. detection of fpv and cpv variants in apparently healthy cats and their persistence in white blood cells (wbc) and other tissues when neutralising antibodies are simultaneously present, suggest that parvovirus may persist long-term in the tissues of cats post-infection without causing clinical signs. the aim of this study was to screen a population of cats from sardinia (italy) for the presence of both fpv and cpv dna within buffy coat samples using polymerase chain reaction (pcr). the dna viral load, genetic diversity, phylogeny and antibody titres against parvoviruses were investigated in the positive cats. results: carnivore protoparvovirus dna was detected in nine cats ( . %). viral dna was reassembled to fpv in four cats and to cpv (cpv- b and c) in four cats; one subject showed an unusually high genetic complexity with mixed infection involving fpv and cpv- c. antibodies against parvovirus were detected in all subjects which tested positive to dna parvoviruses. conclusions: the identification of fpv and cpv dna in the wbc of asymptomatic cats, despite the presence of specific antibodies against parvoviruses, and the high genetic heterogeneity detected in one sample, confirmed the relevant epidemiological role of cats in parvovirus infection. parvoviruses are non-enveloped single-stranded dna viruses which infect a wide range of mammalian species, including several members of the order carnivora. the carnivore protoparvovirus , belonging to genus protoparvovirus, family parvoviridae, subfamily parvovirinae, includes several closely related autonomous viruses causing a range of serious conditions, especially in young animals: feline panleukopenia virus (fpv, the prototype virus of the former carnivore parvovirus), canine parvovirus (cpv), mink enteritis virus (mev), and raccoon parvovirus (rapv) [ ] . feline panleukopenia virus has been known to be a cause of disease in cats since the beginning of the twentieth century, although there are other similar parvovirus species affecting cats, such as mev and cpv. natural infections in cats with cpv have been reported but fpv remains the most prevalent parvovirus causing disease in cats [ ] [ ] [ ] . since cats are susceptible to fpv and cpv a, b, c variants, superinfection and co-infection with multiple parvovirus strains associated with high viral genetic heterogeneity can occur with relatively high frequency in feline hosts [ , [ ] [ ] [ ] . parvoviruses commonly cause acute infection with high levels of viral shedding which generally ceases within - weeks post-infection, after the development of high titres of virus-neutralising antibody [ , ] . nevertheless, parvoviruses can be detected in faeces forup to weeks after recovery, depending on the sensitivity of the diagnostic method used [ ] . cats experimentally infected with fpv shed the virus in both urine and faeces up to day - post-infection with parvovirus persisting in the lungs and kidneys for more than weeks in cats which have recovered [ ] . the detection of fpv and cpv variants in apparently healthy cats suggests that parvovirus infection may be common in some populations of clinically normal cats, and that asymptomatic cats may be able to shed parvovirus for prolonged periods of time [ ] [ ] [ ] . furthermore, the ability of fpv and cpv to persist in the peripheral blood mononuclear cells (pbmc) of cats irrespective of the presence of neutralising antibodies [ ] [ ] [ ] [ ] [ ] and the presence of parvoviral dna in the bone marrow of healthy cats [ ] , suggests that parvovirus may persist long term in the tissues of cats post-infection without causing clinical signs. the aim of this study was to screen a population of cats from sardinia (italy) for the presence of both fpv and cpv dna within buffy coat samples. the dna viral load, genetic diversity, phylogeny and antibody titres against parvoviruses were investigated in the cats testing positive to dna parvoviruses. this was a retrospective study, carried out on stored blood samples taken for routine diagnostic investigations undertaken at the department of veterinary medicine, university of sassari -uniss (sassari, no sardinia, italy). buffy coats from cats sampled between october and march were tested for the presence of feline and canine parvovirus dna using real-time polymerase chain reaction (pcr). the partial vp gene of the viruses identified was sequenced and used for statistical analyses and phylogenetic comparisons. in addition, the sera of the cats which were positive to dna parvoviruses were tested for the parvovirus antibody using the haemagglutination inhibition (hi) assay. samples of owned or stray cats with different life-style conditions (indoor or outdoor, living alone or in community) were tested to evaluate different exposure to parvoviruses. date of sampling, gender, age, breed, habitat and the clinical symptoms of the cats sampled are reported in table . according to these data, the animals were divided into two groups called a and b. the cats included in groups a were predominantly healthy cats from four multi-cat households. the cats in group b were sampled in the emergency room of the veterinary teaching hospital of the department of veterinary medicine (uniss) and were predominantly stray cats showing different clinical signs (sick cats). twenty-two of the ( . %) cats were clinically normal; / ( . %) showed clinical signs attributable to various diseases; / ( . %) showed gastrointestinal signs, such as vomiting and diarrhoea compatible with parvovirus infection; clinical status was unavailable for / ( . %) cats. the vaccination status of the cats included in the study was unknown, although it was hypothesised that the stray cats were unvaccinated. anti-coagulated peripheral blood samples in ethylenediaminetetraacetic acid (edta) and coagulated blood for serology were collected from each cat. the blood samples were stored a + °c and sera at − °c until use. buffy coat-containing mononuclear cells was isolated from ml of edta anti-coagulated peripheral blood samples using histopaque- (sigma aldrich, st. louis, mo, usa). the dna was extracted using the dneasy blood and tissue kit (qiagen, hilden, germany), according to the manufacturer's instructions. the extracted dna was eluted in μl of ultrapure rnasi and dnasi free water, and was stored at − °c after analysis. parvovirus screening was carried out using real-time pcr using two conserved primers (a-for and b-rev, table ) targeting a bp fragment of the vp gene. quantitative pcr (qpcr) was carried out using sybr premix ex taq ii (takara bio inc., shiga, japan) and the rotor-gene system (corbett research, mortlake, nsw, australia). the fluorescence signal was acquired on the fam channel (multi-channel machine, source, nm; detector, nm; gain set to ) with a fluorescence reading taken at the end of each elongation step. each run consisted of an initial incubation in order to activate the hot-start dna polymerase at °c for s followed by cycles of denaturation at °c for s, annealing at °c for s and polymerisation at °c for s. during the melt cycle, the temperature was increased by increments of °c from °c to °c. a pcr plasmid (invitrogen, carlsbad, california, usa) containing one copy of the vp target sequence was produced as the external standard for the construction of the assay standard curve for quantitative analysis. duplicates of six -fold dilutions of the standard plasmid, duplicates of the buffy coat dna extracts of the cats sampled and a no template control were simultaneously analysed. specimens were considered positive if the fluorescence curve in the amplification plot showed an exponential increase, and if a specific melting peak was observed. copies of viral dna were expressed per microlitre of dna extract. amplification and sequencing of the vp gene in order to differentiate between fpv and cpv variants a, b and c, a fragment of the vp gene coding for critical amino acid residues , , , and affecting the biological and antigenic proprieties was amplified and sequenced for each virus identified using real-time pcr. a hemi-nested pcr assay was developed by using three conserved primers (c-for, d-rev and e-rev, table ) for this purpose. both pcr reactions were carried out using taq dna polymerase (qiagen, hilden, germany) producing dna fragments of bp and bp in length for the first and the second reaction, respectively. the temperature cycling protocol of the first amplification consisted of °c for min, cycles with cycle at °c for s, at °c for min, and at °c for min, followed by a final elongation at °c for min. in the second amplification, the pcr conditions were °c for min, cycles with cycle at °c for s, at °c for min, and at °c for s, followed by a final elongation at °c for min. in both pcr reactions, fpv / [ ] was used as a positive control while ultrapure water was used in each experiment to avoid false positive results. the nucleotide sequences were obtained using both forward and reverse primers. direct sequencing of the pcr products of one virus identified (number / ) showed an unusually high number of ambiguities, suggesting a mixed viral population. therefore, the amplification product was cloned into the pcr /topo vector using the topo cloning kit (invitrogen, carlsbad, ca, usa), and was transformed into escherichia coli dh α-competent cells according to the manufacturer's protocol. ten recombinant clones were sequenced using both forward and reverse primers. the nucleotide sequences obtained were assembled and translated into amino acid sequences using bioedit sequence alignment editor version . . [ ] . the vp assembled nucleotide sequences were aligned with reference sequences of feline and canine parvoviruses available in the genbank (http://www.ncbi.nlm.nih.gov/genbank), including the modified live fpv vaccine strains available, using the clustalw method implemented with bioedit software. a variety of statistical analyses aiming to investigate nucleotide diversity, sequence variability and natural selection were carried out on the sequence data set using dnasp package version . . [ ] . statistical analysis was carried out on the subpopulations, grouping the sequence data in the fpv, cpv and / (all clones of sample / ) clusters. the following parameters were estimated for each cluster: total number of mutations (η), nucleotide diversity (π) and its standard error, total number of synonymous differences (syndif), and total number of non-synonymous differences (nsyndif). mutation frequency (total number of changes/total number of bases sequenced) and the percentage of mutated clones were used as indicators of genetic diversity of the viral population of virus / . phylogenetic relationships among the viruses detected and the parvovirus reference sequences were evaluated using mega version . . [ ] . the best-fit model of nucleotide substitution was determined using the find best dna/protein model function implemented in mega, and the tamura -parameter model was found to be optimal for all the sequence data (including reference strains). phylogenetic trees were constructed using the maximum likelihood method, and bootstrap values were determined by replicates to assess the confidence level of each branch pattern. the nucleotide sequences obtained in this study have been submitted to the genbank under accession numbers kt to kt . the parvovirus antibody titre was investigated using the haemagglutination inhibition (hi) test in the sera of the cats which tested positive to parvovirus dna by direct molecular diagnosis. a cpv- b isolate (number / ), recovered from the faeces of a dog with non-fatal enteritis, and isolated by the authors on the crandell rees felinekidney (crfk, cell line was obtained from the biobanking of veterinary resources of the istituto zooprofilattico sperimentale della lombardia e dell'emilia romagna izsler "bruno ubertini" http://www.ibvr.org/services/cellcultures.aspx) cell line, was used as the viral antigen. this strain was used in hi experiments because there are no significant differences in serum titres inhibiting the haemagglutination reaction when cats are infected by fpv or cpv, if cpv is used as an antigen [ ] . to calculate haemagglutinating units (hau) of the viral antigen, a haemagglutination (ha) assay was carried out on the cpv- b isolate following procedures described previously by carmichael et al. [ ] . porcine erythrocytes were washed three times in bis-tris buffered saline (btbs, ph . at °c) and suspended into . % (v/v) btbs containing % bovine serum albumin. to reveal the haemagglutination of both viruses, the test was conducted at a ph of - . and was incubated at °c [ , ] . the hi tests were carried out as previously reported by senda et al. [ ] . all sera were tested in duplicate on two different plates; two-fold dilutions of a commercial canine hyperimmune serum raised against canine distemper, canine hepatitis and canine parvovirosis (stagloban, ati, ozzano emilia, bo, italy), was used as positive controls. for all sera, the mean value of the results from the duplicate hi tests was calculated. if the mean value of the result from one sera was included between two successive dilutions, the lower titre was reported. cats with an hi titre ≥ : were considered positive and cats with an hi titre ≥ : were considered to be protected from infection. the buffy coat dna extracts of cats were tested in duplicate for the presence of parvovirus using a sybr green real-time pcr assay which showed a limit of detection of copy of the vp target dna per microlitre of extract. nine table ) ; no cat with gastrointestinal signs tested positive for parvovirus dna. in the positive samples, the amount of viral dna ranged from orders of magnitude to copies of dna/μl of extract. a melting curve analysis showed a solitary peak between . °and °c for standard plasmid dilutions and between °and °c for each positive cat sample. the nucleotide sequences of the partial vp gene obtained from positive samples were bp in length ( amino acid codons), and corresponded to residue - of the fpv reference strain cu- (genbank accession number m ). nucleotide sequences of the vp partial gene were also obtained for ten recombinant clones of sample / , numbered from c to c , respectively. clone c was an fpv which showed a change located in residue (lys → arg); clone c was an fpv which displayed two coding changes in thr -to-ala and pro -to-ser; c was a cpv- c with an amino acid change located at position (gly → arg); c was a typical cpv- c and clone / -c displayed amino acids identical to fpv in residues , , and while it showed glutamic acid typical of cpv- c in position . the predicted amino acid sequence changes are summarised in table . several synonymous and non-synonymous substitutions were detected by comparing the sequences as reported in table . feline panleukopenia viruses showed a total number of mutations slightly higher than cpv viruses, although synonymous changes predominated in the fpv sequences while non-synonymous changes were prevalent in the cpv viruses. sample / showed high genetic complexity generated within the host, and its sequence variability was higher than the variability of the other sequence data analysed as was seen by the values of parameter π. the non-synonymous fraction was greater for sample / , indicating clear prevalence of the number of non-synonymous mutations in the sample: non-synonymous mutations out of a total of mutations. the proportion of mutated viral clones was % for sample / and the mutation frequency was on the order of . × − (table ) . unrooted phylogenetic trees constructed from alignments of the nucleotide sequences obtained in this study with additional reference sequences showed two main clusters referable to fpv and cpv. the sequence of clone / -c formed a monophyletic branch inside the fpv clade (fig. ) . nucleotide sequences of the modified live fpv vaccine strains available from genbank were distinguishable from all the fpv and cpv sequences obtained in this study, and direct relationships between them were not evident from the phylogenetic tree. the hi titres obtained are reported in table . all the cats which tested positive for parvovirus dna were also positive for antibodies against parvoviruses; cats / and / showed a titre higher than : . the present study screened the occurrence of parvovirus dna and the feline host-immune status in a cat population. asymptomatic and symptomatic cats sampled in sardinia (italy) during - were tested for the presence of both fpv and cpv dna in wbc using qpcr, and the partial vp gene of the viruses identified was characterised. parvoviruses have commonly been titrated in the faeces of infected animals, insofar as the viruses shed in faeces reflect virus replication; the authors chose to analyse the wbc for the presence of viral dna as, in addition to the intestinal crypt cells, bone marrow and other lymphoid tissues are also a major target for parvoviruses in both dogs and cats [ ] . furthermore, since parvovirus can frequently be isolated in infected cats, even in the presence of high virus-neutralising antibodies [ , ] , antibody titres against parvovirus were established in the sera of positive cats using an hi assay. nine ( . %) out of a total of cats tested positive for parvovirus dna with viral dna quantities ranging from to copies/μl of extract, demonstrating that the viral genome was detectable, although at low levels, in the wbc of a relatively large number of cats. all the cats which tested positive for parvovirus dna had table change of amino acids to vp partial protein the presence of fpv and cpv dna in the faecal and peripheral blood samples of healthy cats has previously been reported [ , , [ ] [ ] [ ] , raising important questions regarding the role of cats in the epidemiology of parvoviruses. in our study, the absence of clinical signs consistent with parvovirosis in the cats which tested positive, together with the low amount of viral dna detected, suggested that the infection was asymptomatic or that residual viral dna remains in the organism after recovery from acute infection. furthermore, the detection of parvoviral dna in wbc reveals the presence of the virus in the bone marrow or in other lymphoid tissues which might reflect chronic or latent infection. the detection of cpv dna in apparently healthy domestic cats confirmed a previous survey in which a high prevalence ( %) of cpv in apparently healthy domestic cats living in rescue shelters was identified [ ] . canine parvovirus-like dna was also detected in the tissues of wildlife carnivores which had no fig. unrooted phylogenetic tree. the phylogenetic tree was constructed with the nucleotide sequences of the partial vp gene generated in this study and with feline and canine parvovirus reference sequences available on the genbank nucleotide database or analysed by the authors in a previous study (battilani et al., [ ] ). bootstrap values greater than %, calculated on replicates, are indicated on the respective branches. the feline and canine parvoviruses identified in italy not detected in this study but included in the phylogenetic analysis are designated by it. in bold: nucleotide sequences generated in this study. underlined: clone / -c clinical signs of active infection and, therefore, it was likely that this virus caused latent or persistent infection not only in domestic cats [ ] . animal parvoviruses, such as rodent protoparvovirus and aleutian mink disease parvovirus, have been shown to persist in their host [ , ] . persistence is a common feature also for human parvovirus b (b v) infection [ ] : b v parvoviral dna has been documented in a wide range of tissues and the bone marrow of asymptomatic adults, although the majority of people harbour parvoviral dna in a form which does not actively replicate [ , ] . of the nine cats testing positive for parvovirus dna, four showed fpv dna, four cpv dna (three cpv- b and one cpv- c), and cat / showed unusually high genetic diversity and evidenced dna belonging to two species of parvovirus in the same patient. the pathogenicity of cpv variants for cats is not fully understood. some studies have suggested that cpv had the same pathogenic potential as fpv in cats [ , [ ] [ ] [ ] [ ] ; in other studies, clinical signs were not observed in infected animals, with the exception of transient leukopenia [ , ] . these results led to the speculation that cpv, compared to fpv, can most frequently cause asymptomatic and persistent infection in cats, even if additional studies are clearly needed to fully understand the potential of cats as cpv carriers. in our study, an equivalent prevalence of fpv and cpv was found in the samples examined; this result might be related to the type of cat population sampled, which consisted mainly of healthy cats and cats showing clinical signs not related to parvovirosis. alternatively, it could be due to the biological matrix analysed since parvoviruses have commonly been investigated in the faeces of infected animals; instead, in our survey the wbc were analysed. the rates of variation of the fpv and cpv nucleotide sequences analysed in this study were similar, although genetic diversity in the fpv sequences was generated primarily by synonymous mutations which did not result in amino acid substitutions. this result was congruent with the evolutive behaviour of fpv which, since its emergence in , has not undergone significant changes in antigenic and biological properties. feline panleukopenia virus varied at a slow rate by random genetic drift and it maintained host-specificity [ ] . instead, in the cpv sequence data set, non-synonymous mutations were predominant. this finding is compatible with the pattern of evolution observed for cpv. since its emergence in the late s, cpv evolution has been driven by strong positive selection, giving rise to new antigenic variants which have replaced the original type [ ] . an unusual genetic complexity was reported for sample / , with six different viral dnas ascribable to two distinct species of parvovirus, fpv and cpv type c. although co-infection by more than one parvovirus species is a rare event, it has already been described in a cat simultaneously infected by fpv and cpv- a [ ] . carnivore protoparvoviruses show an estimated annual substitution rate on the order of − to − whereas the mutation frequency detected in sample / was on the order of . × − , a value which determines the quasispecies distribution in rna virus populations. carnivore parvoviruses are very prone to genetic evolution, showing substitution rates similar to those of rna viruses, with values of approximately − substitutions per site per year. this result, together with the detection of cpv- c, which has already been reported in multiple infections of high genetic complexity [ , , ] , confirmed that co-infection with different species of parvovirus in feline hosts led to a high genetic variability and to the potential emergence of new viruses [ ] . the presence of distinctive mutations between the fpv dna sequences detected and the sequences of modified live fpv vaccine strains available, together with the lack of information regarding the vaccination history of the cats sampled, allowed the authors to exclude the possibility that dna from vaccine strains was detected and did not allow speculation regarding the persistence of modified live vaccine strains in the cats sampled. however, viraemia persisting up to days post vaccination has been reported in dogs vaccinated with modified live canine parvovirus [ ] . additional studies are required to investigate the nature and clinical significance of the presence of parvovirus dna in the wbc of healthy cats and the potential of cats as parvovirus carriers. ideally, faeces for the examination of shedding should also be included in the sampling; viral isolation could be useful for testing viral vitality, and reverse transcription-pcr assay targeting international committee on taxonomy of viruses ictv genetic analysis of feline panleukopenia viruses from cats with gastroenteritis genetic complexity and multiple infections with more parvovirus species in naturally infected cats genetic analysis of feline panleukopenia virus full-length vp gene in domestic cats between high genetic diversity of the vp gene of a canine parvovirus strain detected in a domestic cat within-host genetic diversity of endemic and emerging parvoviruses of dogs and cats co-infection with feline and canine parvovirus in a cat infectious diseases of the dog and the cat infectious diseases of the dog and the cat canine parvovirus post-vaccination shedding: interference with diagnostic assays and correlation with host immune status immune carrier state of feline panleukopenia virus-infected cats antigenic and genomic variabilities among recently prevalent parvoviruses of canine and feline origin in japan feline host range of canine parvovirus: recent emergence of new antigenic types in cats canine parvovirus in asymptomatic feline carriers isolation of feline parvovirus from peripheral blood mononuclear cells of cats in northern vietnam predominance of canine parvovirus (cpv) in unvaccinated cat populations and emergence of new antigenic types of cpvs in cats characterisation of cross-reactivity of virus neutralising antibodies induced by feline panleukopenia virus and canine parvoviruses identification of parvovirus in the bone marrow of eight cats bioedit: a user-friendly biological sequence alignment editor and analysis program for windows / /nt. nucl acids symp ser dnasp v : a software for comprehensive analysis of dna polymorphism data mega : molecular evolutionary genetics analysis version . for bigger datasets hemagglutination by canine parvovirus: serologic studies and diagnostic applications canine parvovirus: strain difference in haemaglutination activity and antigenicity characterization of parvoviruses from domestic cats in brazil an improved hemagglutination test for study of canine parvovirus host-specific parvovirus evolution in nature is recapitulated by in vitro adaptation to different carnivore species pathogenesis of aleutian mink disease parvovirus and similarities to b infection minute virus of mice: antibody response, viral shedding, and persistence of viral dna in multiple strains of mice persistence of human parvovirus b in human tissues evidence for persistence of human parvovirus b dna in bone marrow tissue persistence of parvovirus b genotypes in asymptomatic persons isolation of canine parvovirus from a cat manifesting clinical signs of feline panleukopenia antigenic type distribution among canine parvoviruses in dogs and cats in germany characterisation of canine parvovirus strains isolated from cats with feline panleukopenia western european epidemiological survey for parvovirus and coronavirus infections in dogs efficacy of feline panleucopenia vaccine to prevent infection with an isolate of cpv b obtained from a cat pathogenic potential of canine parvovirus types a and c in domestic cats high rate of viral evolution associated with the emergence of carnivore parvovirus co-infection with multiple variants of canine parvovirus type (cpv- ) long-term viremia and fecal shedding in pups after modified-live canine parvovirus vaccination comparison of polymerase chain reaction with virus isolation and haemagglutination assays for the detection of canine parvoviruses in faecal specimens analysis of canine parvovirus sequences from wolves and dogs isolated in italy none. this research received no grant from any funding agency in the public or commercial sectors. the nucleotide sequences obtained in this study are available at genbank (no. kt -kt ). sequence alignment are available from the corresponding author (prof. mara battilani) upon request. alignment and phylogeny data were linked to the dryad repository via treebase search id: http://purl.org/phylo/treebase/phylows/study/tb :s . authors' contributions mb and aa designed the study. rz and cd collected the blood samples and the background information on the samples. preparation of buffy coat and dna extraction was performed by aa. the pcr and vp sequencing was carried out by aa, fb and sda under the supervision of mb. ab analysed the sequence data and drafted the manuscript. mb critically revised the manuscript for important intellectual content. all the authors read the manuscript and approved the final version. the study was carried out using stored blood samples which had been collected for clinical and laboratory purposes independent of the study with the agreement of the cat owners who presented their cats to the veterinary teaching hospital (university of sassari). as stored blood samples were used, no separate ethical approval was required for the study. all efforts were made to minimise the discomfort of the animals during sampling. not applicable. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.• we accept pre-submission inquiries • our selector tool helps you to find the most relevant journal submit your next manuscript to biomed central and we will help you at every step: key: cord- -qhc b x authors: kylie, jennifer; weese, j. scott; turner, patricia v. title: comparison of the fecal microbiota of domestic commercial meat, laboratory, companion, and shelter rabbits (oryctolagus cuniculi) date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: qhc b x background: rabbits are cecotrophic, hindgut-fermenters that rely heavily on their gastrointestinal microbiota for optimal digestion of plant-based diets. dysbiosis, caused by disruption of the gastrointestinal microbiota, is known to predispose rabbits to rabbit enteritis complex (rec), a major cause of morbidity and mortality. the objectives of this study were to describe the fecal microbiota of domestic rabbits from a variety of settings (commercial meat, companion, laboratory, and shelter) and to identify how factors such as age, season, and routine antimicrobial use affect the fecal microbiota composition. results: a total of pooled commercial meat, companion, pooled laboratory, and shelter rabbit fecal samples were evaluated using s rrna gene sequencing of the v region. in all sample types, the predominant bacterial phylum was firmicutes. other commonly identified phyla (composing ≥ % of the total microbiota composition) were verrucomicrobia, proteobacteria, and bacteroidetes. significant differences in composition were noted between commercial, companion, laboratory, and shelter rabbit samples for proportions of verrucomicrobia (p < . ), proteobacteria (p < . ), and lentisphaerae (p = . ) within the total microbiota. within the commercial meat rabbit samples, significant differences between the microbiota composition of growers (n = ) and does (n = ) were limited to one unclassified firmicutes (p = . ) and no differences were identified at the phylum level. significant differences were present between fecal samples taken from rabbits during the summer (n = ) compared to the winter (n = ), with firmicutes (p = . ), verrucomicrobia (p = . ), proteobacteria (p = . ), deinococcus-thermus (p = . ), armatimonadates (p = . ), and actinobacteria (p = . ) forming significantly different proportions of the microbiota. the only significant difference in composition between those farms that routinely reported antimicrobial use and those that did not was in one unclassified bacteroidetes (p < . ) and no differences were identified at the phylum level. conclusions: rabbit husbandry and diet, in addition to season, significantly influence the fecal microbiota composition of domestic rabbits, while age of the rabbit post-weaning has minimal impact. electronic supplementary material: the online version of this article ( . /s - - - ) contains supplementary material, which is available to authorized users. rabbits are herbivorous, monogastric, hindgut-fermenting mammals that rely on cecotrophy to ensure maximum nutrient absorption from their diet. management of this unique gastrointestinal (gi) physiology can be challenging, and, as a result, enteric disease is common in domestic rabbits. one of the most difficult aspects of managing rabbit digestion is maintaining the normal commensal gastrointestinal microbiota. in rabbits, disruption of the normal microbiota, termed dysbiosis, is commonly implicated as a cause of enteritis, with ensuing diarrhea, subsequent dehydration, inadequate nutrition, and, potentially, death as a result. the etiopathogenesis of enteritis in rabbits is complex and generally multifactorial. enteric pathogens such as escherichia coli, clostridium spiriforme, lawsonia intracellularis, rotavirus, and coronavirus are commonly associated with diarrhea outbreaks in rabbits, as are other agents such as clostridium piliforme, salmonella spp., parvovirus, and astrovirus [ ] [ ] [ ] [ ] [ ] [ ] . however, much is still unknown about initiating factors as infection with these organisms is not synonymous with disease and subclinical infection may occur with no overt clinical signs [ ] . most cases of enteritis in rabbits are caused by a combination of factors, including feeding of a low fiber diet, debility and overall health status, management-related stress, and age, along with the presence of one or more potentially pathogenic organisms [ ] [ ] [ ] . because of its critical importance in rabbit health, several studies have focused on understanding the composition of the rabbit enteric microbiota. historically, researchers used culture-based techniques; however, the development of culture-independent techniques has permitted much greater in-depth analysis [ , ] . culture-based studies concluded that bacteroidetes was the predominant bacterial phylum within the rabbit gastrointestinal tract, regardless of age [ ] . with culture-independent sequencing bacteroidetes are still reported as predominant in the intestinal tract of very young rabbits, but the predominant phylum in post-weaned and adult rabbits is firmicutes, with bacteroidetes accounting for only a small fraction [ ] [ ] [ ] [ ] . other predominant phyla routinely identified using culture-independent sequencing include verrucomicrobia and proteobacteria [ , ] . previous studies examining the fecal microbiota of rabbits have used small numbers of laboratory rabbits kept in wellcontrolled environments exposed to minimal environmental or husbandry variations, making broad applicability to other domestic rabbit conditions less likely. factors such as diet, husbandry, and seasonal effects have been demonstrated to have effects on the fecal microbiota in both humans and other animal species [ ] [ ] [ ] , but have not been explored in rabbits. the objectives of this study were to characterize the microbiota of domestic rabbits kept in a variety of environments and to identify factors contributing to enteric microbiota variations using a culture-independent, high-throughput sequencing method. we hypothesized that significant fecal microbiota differences would be seen between commercial meat rabbits and domestic rabbits kept in other settings, largely because of differences in husbandry, including dietary composition, routine use of antimicrobials, and environmental management. additionally, we hypothesized that these differences would be least significant between commercial meat rabbits and rabbits housed in a shelter environment (i.e., a facility where previously-owned animals have been surrendered for re-homing) due to the likely inconsistencies in the environment of both of these types of rabbits and diet (in the case of shelter rabbits), while differences would be most significant between commercial meat rabbits and both companion and laboratory rabbits due to more consistent environmental conditions, diet, care, and reduced infectious disease within these latter two groups of rabbits. a total of rabbit fecal samples from various sources were included in the final analysis: pooled commercial meat, companion, pooled laboratory, and shelter animals. twenty-three samples ( commercial meat, companion, and shelter) were not included in the final analysis either due to an inability to produce bands following dna extraction, amplification, and purification, an insufficient quantity of dna within the sample (< . nm) at the time of normalization prior to sequencing or an insufficient number of sequences (< ) present following the completion of all quality control filters. a total of , , v s rrna gene sequences passed all quality control filters. sequence numbers per sample ranged from to , , with a mean of , , median of , , and a standard deviation of , . the analysis was based on samples, with a subsample of sequences per sample for normalization. a total of bacterial phyla were identified; however, only five were present at a relative abundance of ≥ %. of these five phyla, firmicutes composed . % of the total microbiota, verrucomicrobia composed . %, proteobacteria composed . %, and bacteroidetes composed . % while . % of the sequences could not be identified at the phylum level (see additional file : table s for further information). there were several statistically significant differences in relative abundance of bacteria within all taxonomic levels based on animal source. these differences remained consistent regardless of whether the specific source from which the sample came was included as a random effect in the analysis; therefore, all relative abundance analyses that are reported below exclude specific source as a random effect. significant differences were identified between commercial rabbits, and companion and laboratory rabbits in relative abundances of proteobacteria (p < . ), between commercial rabbits, companion rabbits, and laboratory and shelter rabbits in relative abundances of verrucomicrobia (p < . ), and between commercial rabbits, and companion and shelter rabbits in relative abundances of lentisphaera (p < . ) when the p-value was corrected for false discovery rates (fig. ) . these differences were also reflected at all levels of taxonomic classification (see additional file : table s ). commercial meat and companion rabbits had distinctly different fecal microbiota community structures, while those of laboratory and shelter rabbits tended to overlap with those from companion rabbits (fig. ) . the dendrogram of community structure (yue and clayton index of dissimilarity) is presented in fig. . in both cases, clustering of ≥ samples can be seen within large numbers of commercial and pet samples, with the laboratory and shelter rabbit fecal samples scattered intermittently between, and primarily amongst, the companion samples. using the jaccard tree, significant differences were noted between all possible group pairings using a parsimony test (p < . for all comparisons), something that was also noted with unweighted uni-frac tests (p ≤ . for all comparisons), indicating that the fecal microbiota community membership differed significantly between all sources. using the parsimony test with the yue and clayton tree, significant differences were identified between commercial meat and laboratory samples (p = . ), commercial meat and companion animal samples (p < . ), and commercial meat and shelter samples (p < . ). these differences were also detected using unweighted unifrac (all p < . ), indicating that fecal microbiota community structure was significantly different between commercial meat rabbits and rabbits from all other sources, but the other sources did not differ amongst one another. thirty-seven otus were identified to be differentially abundant via lefse (p ≤ . ) with lda scores ≥ . ( table ) . forty-four samples, each consistently of pooled feces from does per commercial meat farm, and samples composed of pooled feces from growers per commercial meat farm, were compared, with a subsample of sequences per sample. no significant differences were observed in relative abundance between the two age groups at the bacterial phylum, order, family, and genus levels (all adjusted p > . ). at the class level, there was a significant difference between does and growers for an unclassified firmicutes, where the relative abundance in does was . % and in growers was . % (p = . ). community structure differences are visualised in the pcoa (fig. b ). there is significant overlap between the community structures of the two different age groups with no obvious grouping based on age. a significant fig. median relative abundances of predominant bacterial phyla of the rabbit fecal microbiota separated by animal source. significant differences (p ≤ . ) are present between sources for proteobacteria, verrucomicrobia, and lentisphaera (included in 'other' and composed < % of the total composition) difference between the fecal microbiota community structure of does and fryers was only noted using the yue and clayton tree with the parsimony test (p = . ); however, no more than five samples were noted to be clustered by age within commercial meat samples in the yue and clayton tree analysis (fig. ) . six otus were identified to be significantly different between ages (p ≤ . ) with lefse lda scores ≥ . (fig. a) . a comparison was conducted of pooled fecal samples collected from meat rabbits during winter months and pooled fecal samples collected during summer months, with a subsample of sequences per sample. significant differences at all taxonomic levels of classification were identified (table ) . principle co-ordinates analysis (pcoa) of the rabbit fecal microbiota based on the jaccard index. a blue circles = commercial meat rabbits, red circles = companion rabbits, yellow circles = laboratory rabbits, green circles = shelter rabbits; b) blue circles = does, red circles = fryers; c) blue circles = winter, red circles = summer; d) blue circles = routine antimicrobial use, red circles = no routine use of antimicrobials. clustering of markers within a plot indicates similarity in microbiota community membership. significant differences are present between rabbit sources and between seasons, but not between ages and antimicrobial use statuses the community structure differences are presented in the pcoa in fig. c . while there is significant visible overlap between the groups, there is a distinct subpopulation of samples from the summer group that is separate from the overlying samples. significant differences were identified between summer and winter fecal microbiota community membership and structure using a parsimony test (p < . ) , and unweighted unifrac tests (p < . ) with both the jaccard tree and the yue and clayton tree (p < . for both tests). one distinct cluster comprised of ≥ commercial meat rabbits samples collected during the winter months was present, as was one distinct cluster of ≥ samples fig. dendrogram of the rabbit fecal microbiota community structure based on the yue and clayton index of dissimilarity. blue = commercial rabbits, red = companion rabbits, yellow = laboratory rabbits, green = shelter rabbits. clustering of lines indicates similarity in microbiota community structure. significant differences are present between commercial meat rabbits and all other sources. the top cluster delineated by the vertical black line indicates clustering of samples collected from commercial meat rabbits during the winter months while the clusters indicated by the lower vertical black lines indicate clustering of samples collected from commercial meat rabbits during the summer months collected during the summer months within the yue and clayton tree calculated based on animal source (fig. ). twenty-three otus were identified to be significantly different between season (p ≤ . ) with lda scores ≥ . (fig. b) . comparison of the rabbit fecal microbiota based on routine antimicrobial use up questioning. farms for which antimicrobial use could not be confirmed were excluded from the analysis. antimicrobials reported to be used routinely included, in order of descending frequency of use, salinomycin sodium %, virginiamycin, tylosin, chlortetracycline, bacitracine methylene disalicylate, sulfamethazine, sulfadimethoxine, and one anti-coccidial agent that was not further specified. twelve of the ( . %) farms reporting routine antimicrobial use reported using ≥ antimicrobials in combination, making statistical analysis of the data beyond the general category of "routine antimicrobial use" not feasible. antimicrobials were not reported to be routinely used in any of the laboratory rabbits sampled, and antimicrobial use could not be confirmed for the companion or shelter rabbit samples; thus, results from these groups were also excluded from this analysis. seventy-five pooled commercial meat rabbit fecal samples were compared on the basis of routine antimicrobial use following sequence filtering and the removal of nonresponders, / ( . %) with routine antimicrobial use, with a subsample of sequences per sample. the only significant difference observed at all levels of taxonomic classification, aside from the phylum level where no significant differences were observed, was in one bacteroidetes unclassified at the class level (p < . at all taxonomic levels), which was significantly higher in samples from farms where no routine antimicrobial use occurred ( . , . , . , . % at class, order, family, and genus levels, respectively) compared to when routine use did occur ( . , . , . , . %, respectively). no significant differences in community membership or structure were identified using jaccard or yue and clayton trees with both the parsimony and unweighted unifrac tests (p ≥ . for all tests); samples from farms that did not report routine use of antimicrobials can be seen as well-distributed amongst samples from farms that did in the pcoa in fig. d . thirteen otus were identified to be significantly different between use status (p ≤ . ) with lda scores ≥ . ; single otus with an lda score ≥ . that were more frequently identified with routine antimicrobial use were from each of the following genera: ignatzschineria, erysipelothrix, and wohlfahrtiimonas. one otu with an lda score ≥ was significantly more prevalent when antimicrobials were not being routinely used was present from each of the following genera: acetitomaculum, clostridium cluster iii, and parasporobacterium, in addition to one unclassified ruminococcaceae, one unclassified desulfovibrionaceae, and one unclassified bacteroidetes. our study provides significant insight into the composition of fecal microbiota of domestic rabbits, as well as factors that may promote changes in its composition. the large number of animals sampled, combined with the variety of factors incorporated into the study, suggests that the results are applicable to rabbits in a variety of domestic settings. consistent with previous cultureindependent sequencing studies, such as those conducted by eshar and weese [ ] and zhu et al. [ ] , the predominant phylum identified in the rabbit fecal microbiota, regardless of source, age, season or reported antimicrobial use was firmicutes. within this phylum, the clostridia were the most abundant class identified, of which the ruminococcaceae and the lachnospiraceae were the most abundant families present. while the prevalence of firmicutes in our study is lower than that reported by eshar and weese ( % vs. %, respectively) , other studies report levels of firmicutes varying between and % with significant individual variation, suggesting that the relative abundance of firmicutes in the rabbit enteric microbiota falls somewhere within this range [ , ] . in addition to being identified as the predominant phylum present in the rabbit gut, firmicutes has been described as the most abundant phylum in the gastrointestinal microbiota of most healthy adult mammals, including humans [ ] [ ] [ ] [ ] , emphasizing its likely importance as a commensal in gi health. other predominant phyla identified include verrucomicrobia, proteobacteria, and bacteroidetes. the relative levels identified for these phyla are consistent with previous reports, although proportions of verrucomicrobia appear to vary considerably with the method of analysis [ , , , ] . while verrucomicrobia is still a relatively newly-defined group of organisms, akkermansia (within this phylum) has been suggested to have a key role in hydrolysis of diverse ingested polysaccharides, contributing to more complete digestion of dietary cellulose as well as methane metabolism [ ] [ ] [ ] . thus, its presence as an important constituent of the rabbit fecal microbiota is unsurprising. the most well-known species in this genus is akkermansia muciniphila, a mucindegrading bacterium that has been demonstrated to be beneficial in both human and animal health [ , ] . for example, increases in the proportion of fecal akkermansia mucinophila have been associated with a healthier metabolic status in both humans and mice [ , ] . while the impact of akkermansia muciniphila on rabbit health is still unknown, it is known that the ability to breakdown mucin is especially important during cecotrophy for optimal nutrient extraction [ ] . in vitro studies have also identified a positive correlation between the proportion of verrucomicrobiaceae and concentrations of proprionate and acetate, volatile fatty acids that are found in high concentrations within rabbit ceca following the breakdown of fiber-rich carbohydrates, and significant energy sources [ , ] . akkermansia mucinophila levels have also been inversely correlated with several inflammatory markers in mice [ ] , indicating that a decrease in akkermansia mucinophila levels may result in a more pro-inflammatory gut environment. a decreased proportion of verrucomicrobia within the fecal microbiota of commercial meat rabbits overall, and particularly during the summer months, as found in this study, suggests less optimal gut health and nutrient extraction in this group of rabbits, as well as a pro-inflammatory state. this most likely reflects the lack of hay in the diet of commercial meat rabbits, compared to rabbits from other sources, as well as metabolic distress potentially due to heat stress, discussed in further detail below. while small proportions of proteobacteria are routinely observed within the enteric microbiota of all mammals, it has been suggested that increased relative abundance of proteobacteria should be considered as a diagnostic indicator of underlying dysbiosis, predisposing individuals to enteric disease or indicating the presence of disease [ ] . relative increases in proteobacteria with or without a concurrent reduction in firmicutes have been observed in several species in cases of metabolic gastrointestinal disorders, such as geneticallyrelated and diet-induced obesity [ , ] , as well as in chronic intestinal inflammation, such as inflammatory bowel disease and ulcerative colitis [ , ] . it is hypothesized that the resultant bacterial population shift caused by increasing relative proportions of proteobacteria stimulates the host gastrointestinal immune system, resulting in a pro-inflammatory response [ ] . therefore, the increased relative proportion of proteobacteria observed within commercial meat rabbits overall, and specifically during the summer, suggests a shift away from the normal gut microbiota in these animals, increasing their risk for disease development. this idea is supported by the higher proportion of potentially pathogenic bacteria associated with rec identified in commercial meat rabbit fecal samples overall as well as in the summer at the otu level. in both cases, elevations in escherichia/shigella accounted for significant differences in fecal microbiota composition when compared to feces from rabbits from other sources. no significant differences were observed between does and growers in this study. this is consistent with previous reports suggesting that the rabbit fecal microbial community rapidly reaches a steady state at, or just after, weaning [ ] . this stabilization has been observed in several other species, including mice [ ] and pigs [ ] . additionally, no significant differences were observed between samples from farms in which antimicrobials were routinely used compared to farms where they were not. in , abecia et al. examined the effects of bacitracin and tiamulin on the cecal microbiota of lactating rabbit does. the study demonstrated that significant microbiota compositional changes were highly dependent on the specific antimicrobial used, with bacitracin having minimal effects on the cecal microbiota composition and tiamulin causing significant changes [ ] . in the current study, a variety of antimicrobials with different pharmacologic mechanisms were reported in use alone or in combination, including those with anticoccidial activity and those used to treat respiratory disease. effects of specific agents on the gut microbiota may have been masked by the concurrent use of other antimicrobial agents; additional studies into the effects of specific antimicrobial agents on the microbiota composition will help to differentiate those antimicrobials likely to have a significant effect versus those that have minimal effect. several factors that may contribute to gut microbiota composition are thought to differ significantly between domestic rabbit sourcesin particular, the diet. once animals are weaned, commercial meat rabbits are almost exclusively fed extruded pellet diets relatively low in fiber ( - %) and high in carbohydrates to encourage rapid growth prior to slaughter [ ] . this contrasts with recommended feeding practices for companion rabbits, which suggest a high fiber hay-based diet (e.g., timothy hay) that is supplemented (< %) by lower fiber pellets to ensure that all nutritional requirements are met while optimizing gastrointestinal function [ , ] . companion rabbit owners also frequently supplement this recommended dietary regimen with other fiber-rich fruits and vegetables. while the diet of laboratory rabbits is also primarily that of high carbohydrate pellets, the fiber content of many of the commercially available laboratory diets tends to be closer to %. laboratory rabbits are also frequently given hay and vegetables as enrichment, although generally at more restricted levels than companion rabbits, while the dietary history of domestic rabbits in shelters is largely unknown. there is also significant variation in how long these animals may have been in a shelter receiving a balanced diet. dietary fiber source, content, and digestibility are critical components of the rabbit diet, in which changes are directly and significantly correlated with enteritis and mortality in growing meat rabbits [ , ] . it was beyond the scope of this study to evaluate specific changes in dietary fiber source, content, and type in relation to the rabbit fecal microbiota; however, this likely contributes to the majority of differences noted in microbiota between commercial meat and other sources of rabbits and is an area of further investigation. studies in other species examining the influence of season on the gut microbiota have identified decreases in the relative abundance of verrucomicrobia during the summer as observed in the current study, but not relative increases in bacteroidetes and proteobacteria as were seen in this study [ ] . the seasonal changes in the microbiota of arctic ground squirrels observed in the stevenson et al. study were attributed to diet availability and variation between seasons. in the current study, seasonality was only examined in commercial meat rabbits, in which the diet remains relatively consistent with fixed content proportions year-round (although changes in plant source and feed quality may vary from batch to batch). thus, it is unlikely that the seasonal changes in relative abundance of different phyla were related to diet. rabbits are much more tolerant of colder temperatures and low humidity and they are especially prone to heat stress [ , ] . in general, canadian rabbit barns do not have environmental controls for temperature or relative humidity and rabbits are exposed to hot and humid ambient conditions in july and august. the relative reduction in levels of the two beneficial phyla (firmicutes and verrucomicrobia), and the relative increase in less beneficial phyla (proteobacteria) could relate to seasonal-related climate changes and directly impact rabbit health, susceptibility to enteritis, and possibly feed conversion efficiency. additional studies are needed to explore these possibilities. studies of potential seasonal differences in gut microbiota of rabbits from other sources are also needed. a potential limitation of this study is whether the fecal microbiota is reflective of the gastrointestinal microbiota of rabbits in general. michelland et al. [ ] demonstrated no significant differences in bacterial community diversity between soft and hard feces or cecal content in rabbits. in addition, schoster et al. [ ] demonstrated that while significant differences existed between the microbiota of the stomach, duodenum, ileum, large colon, and feces in healthy horses, another hindgut-fermenting species, the microbiota profile remained stable from the cecum to the feces. these studies suggest that, at least in the case of hindgut-fermenting species, the fecal microbiota is representative of the distal gastrointestinal tract. for rabbits, in which the cecal microbiota is of primary consideration for overall animal health, the fecal microbiota provides an accurate and non-invasive method for studying their gastrointestinal health. this study exclusively characterized the bacterial fecal microbiota of rabbits. it is well known that other prokaryotic and eukaryotic microorganisms, such as viruses, bacteriophages, protozoa, archaea and fungi, are essential components of the gastrointestinal microbiota, and can play significant roles in human and animal health [ , ] . as pathogenic viruses, in addition to pathogenic bacteria, are significant contributors to rabbit dysbiosis and rec, a greater understanding of the rabbit gut virome would provide further insight into understanding rabbit health. lastly, it is unknown whether the organisms identified using next generation sequencing methods are functionally or metabolically active. future computational studies are needed to specifically examine the metabolomics of the bacteria identified. this study characterized the composition of the domestic rabbit fecal microbiota, as well as potential factors influencing its composition, such as rabbit source, age, and season, and the routine use of antimicrobials. by gaining an increased understanding of the rabbit enteric microbiota and factors that influence its composition, rabbit health and welfare can be better managed. commercial meat rabbit producers were contacted through ontario rabbit, a rabbit producer group, and asked to voluntarily participate in the study. feces from domestic rabbits from commercial farms (representing approximately % of large rabbit farms in ontario, canada) were collected for this study. rabbit feces were sampled based on age (does and growers, aka fryers) and fecal samples were collected during summer and winter months. feces from an additional clinically healthy adult companion rabbits of varying ages and breeds were included. rabbit fecal samples from one commercial laboratory rabbit vendor and seven laboratory research facilities in ontario were also included, as were rabbit feces from four shelters in southwestern ontario. all known history for samples collected is listed in table . in all cases, participation in the study was voluntary, with companion, laboratory, and shelter organizations contacted directly by the researchers of the study. hard feces of commercial meat rabbits (n = samples) and laboratory rabbits (n = samples) were collected from pans beneath rabbit home cages. in all cases, attempts were made to collect the freshest samples from the top layer of feces in the collecting pan (i.e., the most recently voided samples) or by placing a clean pan within h prior to collection. pooled fecal samples were collected from separate cages per age group that were well-dispersed throughout each barn or facility and mixed thoroughly in sterile plastic bags. for commercial rabbits, one sample bag was submitted for each of two age groups, growers (aged - weeks) and does (reproductively active, adult, females) per farm. samples from commercial rabbits were collected during summer (july-aug) and winter (feb-mar) months, when possible. producers were also asked to verbally report any antimicrobial use, both routine and sporadic, at the time of collection; this information was later confirmed by email or telephone follow-up. at research facilities, when possible, multiple samples (up to ) were collected from the same facility if there were enough number of rabbits kept in the same room to allow for multiple collections ( facility), rabbits were kept in multiple rooms or multiple sites throughout the facility ( facility), significantly different age groups were present within the facility ( facility), an opportunity was provided to collect samples in repeated years ( facility), and an opportunity occurred to collect samples immediately following rabbit shipping/arrival to the facility and then following a period of acclimation ( facility). fecal samples from companion rabbits were collected from clinically normal rabbits whose owners attended a regional rabbit exposition (n = ) and from healthy patients visiting the ontario veterinary college's avian and exotic service for dental procedures (n = ). samples were chilled or placed on ice and transported for coding and processing to a central laboratory where . g of feces from each sample were isolated for dna extraction while the remaining sample was frozen at - °c. dna extraction and quality control dna extraction was performed using the e.n.z.a. stool dna kit (omega bio-tek inc., doraville, georgia, usa) following the manufacturer's protocol for pathogen detection. quantity and quality of extracted nucleic acids were assessed by spectrophotometry (nanodrop, roche, mississauga, on, canada). s rrna gene amplification, purification, and sequencing . for each extracted sample, a ul reaction was performed using . ul kapa ready mix, . ul sterile water, . ul each forward and reverse primers ( pm/ul), and . ul dna template ( ng/ul). the pcr conditions were as follows: ) min at °c for denaturation, ) s at °c for denaturation, ) s at °c for denaturation, ) . min at °c for elongation, and ) min at °c. steps - were repeated for a total of cycles. pcr products were stored at °c until purification was completed. electrophoresis of pcr products was conducted in % agarose gel to evaluate the products for the presence of bands of the appropriate length (~ bp). purification of pcr products was conducted using agencourt ampure xp (beckman coulter inc., mississauga, on, canada); ul of ampure xp was mixed with the pcr product on a well plate. following min at room temperature, the mixture was transferred to a magnetic plate, left for min, and then the supernatant was discarded. beads were then washed with ul freshly made % ethanol twice, air dried for min, and separated from the magnet. the beads were then rinsed with . ul of mm tris ph . buffer, placed back onto the magnetic plate, and ul of the supernatant of each sample was transferred to a new tube. a second reaction was performed using . ul purified product, . ul kapa ready mix, . ul sterile water, and . ul each illumina forward index primer (i -i or s , s -s , s -s ) ( pm/ul) and illumina reverse index primer (i - or n , n -n ) for each sample. an additional pcr was conducted with the following conditions: ) min at °c, ) s at °c, ) s at °c, ) . min at °c, and ) min at °c. steps - were repeated for a total of cycles completed. again, the second pcr product was purified using ampure xp using a similar procedure to that described above, with ul of ampure xp and ul mm tris ph . buffer. an evaluation of final products was completed using electrophoresis in % agarose gel, again observing for bands of the appropriate length. when bands were not visible or of an inappropriate length, spectrophotometry was performed to identify nucleic acid quantity; adjustments to the volumes of kapa ready mix, dna product, and sterile water were made based on the quantity of nucleic acids identified as needed to produce bands of the appropriate size. purified samples were normalized to a final concentration of . nm and submitted for sequencing to the university of guelph's advanced analysis centre. an illumina miseq (san diego, california, usa) and × chemistry were utilized for sequencing of the library pool. analysis of the sequencing results was conducted using mothur software (v . ) [ ] . paired-end reads were aligned some preliminary observations on rabbit mucoid enteritis the merck veterinary manual infectious agents associated with diarrhoea in commercial rabbits: a field study significance of clostridium spiroforme in the enteritis-complex of commercial rabbits the enteritis complex in domestic rabbits: a field study a review of non-specific enteritis in the rabbit impact of fibre deficiency and sanitary status on non-specific enteropathy of the growing rabbit rabbit gastrointestinal physiology harkness and wagner's biology and medicine of rabbits and rodents dna sequencing by ce s rrna gene sequencing for bacterial pathogen identification in the clinical laboratory changes in the digestive microflora of holoxenic rabbits from birth until adulthood coprophagous behavior of rabbit pups affects implantation of cecal microbiota and health status molecular analysis of the microbiota in hard feces from healthy rabbits (oryctolagus cuniculus) medicated with long term oral meloxicam potential core species and satellite species in the bacterial community within the rabbit caecum impact of dietary fiber/starch ratio in shaping caecal microbiota in rabbits seasonal variation in human gut microbiome composition analysis of factors contributing to variation in the c bl/ j fecal microbiota across german animal facilities effects of season and host physiological state on the diversity, density, and activity of the arctic ground squirrel cecal microbiota postnatal development of the rabbit caecal microbiota composition and activity comparison of the fecal microbiota of healthy horses and horses with colitis by high throughput sequencing of the v -v region of the s rrna gene role of the gut microbiota in health and chronic gastrointestinal disease: understanding a hidden metabolic organ early life dynamics of the human gut virome and bacterial microbiome in infants a catalog of the mouse gut metagenome the bacterial communities associated with fecal types and body weight of rex rabbits methane oxidation by an extremely acidophilic bacterium of the phylum verrucomicrobia capturing single cell genomes of active polysaccharide degraders: an unexpected contribution of verrucomicrobia genomic and physiological characterization of the verrucomicrobia isolate diplosphaera colitermitum gen. nov., sp. nov., reveals microaerophily and nitrogen fixation genes akkermansia muciniphila and improved metabolic health during a dietary intervention in obesity: relationship with gut microbiome richness and ecology crosstalk between akkermansia muciniphila and intestinal epithelium controls diet-induced obesity in vitro characterization of the impact of selected dietary fibers on fecal microbiota composition and short chain fatty acid production akkermansia muciniphila inversely correlates with the onset of inflammation, altered adipose tissue metabolism, and metabolic disorders during obesity in mice proteobacteria: microbial signature of dysbiosis in gut microbiota altered gut microbiota and endocannabinoid system tone in obese and diabetic leptin-resistant mice: impact on apelin regulation in adipose tissue structural resilience of the gut microbiota in adult mice under high-fat dietary perturbations spatial variation of the colonic microbiota in patients with ulcerative colitis and control volunteers dysfunction of the intestinal microbiome in inflammatory bowel disease and treatment transient inability to manage proteobacteria promotes chronic gut inflammation in tlr -deficient mice stabilization of the murine gut microbiome following weaning early-life establishment of the swine gut microbiome and impact on host phenotypes the effect of medicated diets and level of feeding on caecal microbiota of lactating rabbit does effect of the fattening diet on the development of the fatty acid profile in rabbits from weaning harkness and wagner's biology and medicine of rabbits and rodents effect of diet on feed intake and growth of rabbits from weaning to slaughter at different ages and weights fibres in rabbit feeding for digestive troubles prevention: respective role of low-digested and digestible fibre rabbits' productive, reproductive and physiological performance traits as affected by heat stress: a review molecular analysis of the bacterial community in digestive tract of rabbit comparison of microbial populations in the small intestine, large intestine and feces of healthy horses using terminal restriction fragment length polymorphism expanding the role of the virome: commensalism in the gut qiime allows analysis of high-throughput community sequencing data evaluation of general s ribosomal rna gene pcr primers for classical and nextgeneration sequencing-based diversity studies development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the miseq illumina sequencing platform we thank joyce rousseau, mackenzie slifierz, mohammed jalai, and jutta hammermeuller for technical assistance, and patrick boerlin and scott mcewen for editorial assistance. this project was funded by a grant from the ontario ministry of agriculture, food, and rural affairs ( ), farm and food care ontario, floradale feed mill, and bw feeds. the funding sources had no influence on the study design, outcomes or interpretation of results. the dataset used and analysed during the current study is available from the following site: kylie, jennifer; turner, patricia v.; weese, scott, , "prevalence of enteric disease agents in ontario commercial rabbits: zoonotic potential and impact on animal health", https://doi.org/ . /sp/bt hn , scholars portal dataverse, v .authors' contributions pvt and jsw conceived of the work and prepared the grant; pvt, jsw, and jk recruited samples for the study, reviewed and analyzed the results, and prepared and reviewed the manuscript; and jk conducted the work. all authors read and approved the final manuscript. the study was approved by the university of guelph animal care committee (e ). the facility is in compliance with the animals for research act of ontario and holds a good animal practice certificate conferred by the canadian council for animal care. all authors consent to publication of this original article. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. and sequences greater than bp or less than bp in length were removed from the data set. any sequences containing long runs (> bp) of holopolymers, as well as ambiguous base calls, sequences that did not align with the s rrna gene v region, or that were identified as chimeras were also removed. sequences from mitochondria, chloroplasts, archaea, and eukaryotes were also removed. sequences were binned into operational taxonomic units (otus) at the % dissimilarity level using nearest neighbour clustering using open otu picking. comparison of relative abundances of different taxa was conducted using one-way anovas within the jmp response screening platform (sas institute inc., cary, nc, usa). adjustment of p values to account for false discovery rate (fdr) was performed using the benjamini-hochberg technique. analysis was performed both with facility (i.e., where the animal came from) named as a random effect and without. follow-up post-hoc testing of taxa identified as significantly different between groups was conducted using the steel-dwass nonparametric test. results were considered significant when adjusted p values were ≤ . . differences in microbiota composition based on age (fryers versus does) and season (summer versus winter), were calculated exclusively for commercial meat rabbits.for subsequent analysis, subsampling was performed to normalize sequence numbers. good's coverage was used to assess coverage to ensure that the microbial population was adequately represented within the samples. population richness was assessed using chao to identify the number of different organisms present within each sample and the inverse simpson's index was used to describe population diversity to determine the abundance of the different organisms present within each sample. the jaccard index (which measures community membership by comparing the number of shared otus, but not their abundance) and yue and clayton measure of dissimilarity (which measures community structure by examining shared otus and their relative abundances) were used to assess population dissimilarity and to create dendrograms to compare how closely related the microbial communities of each sample were to one another. these were compared between groups for source, age and season using unweighted unifrac (which measures the phylogenetic distance between communities based on membership), as well as parsimony tests (which examines community membership similarily). figures were created using figtree (v . . ) (http://tree. bio.ed.ac.uk) and jmp . principal coordinate analysis (pcoa) was also performed to visualize data similarities and dissimilarities between microbial communities and figures were created in jmp . lefse was also performed to identify otus that were differentially abundant between groups. additional file : table s . relative abundance of predominant (≥ %) taxonomic classifications of bacteria isolated from the feces of domestic rabbits (n = ). (docx kb) additional file : table s . relative abundance and fdr p-values for significantly different bacterial phyla, classes, orders, families, and genera in the rabbit fecal microbiota when compared between commercial (n = ), companion (n = ), laboratory (n = ), and shelter (n = ) rabbit samples. key: cord- -mbg e j authors: hardstaff, jo l; häsler, barbara; rushton, jonathan r title: livestock trade networks for guiding animal health surveillance date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: mbg e j background: trade in live animals can contribute to the introduction of exotic diseases, the maintenance and spread endemic diseases. annually millions of animals are moved across europe for the purposes of breeding, fattening and slaughter. data on the number of animals moved were obtained from the directorate general sanco (dg sanco) for . these were converted to livestock units to enable direct comparison across species and their movements were mapped, used to calculate the indegrees and outdegrees of european countries and the density and transitivity of movements within europe. this provided the opportunity to discuss surveillance of european livestock movement taking into account stopping points en-route. results: high density and transitivity of movement for registered equines, breeding and fattening cattle, breeding poultry and pigs for breeding, fattening and slaughter indicates that hazards have the potential to spread quickly within these populations. this is of concern to highly connected countries particularly those where imported animals constitute a large proportion of their national livestock populations, and have a high indegree. the transport of poultry (older than hours) and unweaned animals would require more rest breaks than the movement of weaned animals, which may provide more opportunities for disease transmission. transitivity is greatest for animals transported for breeding purposes with cattle, pigs and poultry having values of over %. conclusions: this paper demonstrated that some species (pigs and poultry) are traded much more frequently and at a larger scale than species such as goats. some countries are more vulnerable than others due to importing animals from many countries, having imported animals requiring rest-breaks and importing large proportions of their national herd or flock. such knowledge about the vulnerability of different livestock systems related to trade movements can be used to inform the design of animal health surveillance systems to facilitate the trade in animals between european member states. electronic supplementary material: the online version of this article (doi: . /s - - - ) contains supplementary material, which is available to authorized users. animal trade is an effective way of introducing, maintaining and spreading animal diseases, as observed with the spread of different strains of foot and mouth disease (fmd) in africa, the middle-east and asia [ ] and the spread of bovine spongiform encephalopathy (bse), for example into oman and canada through the importation of infected cattle [ , ] . within a year, millions of live animals of many different species are transported between countries within europe for breeding, fattening, sports, companionship, conservation and slaughter. this creates opportunities for communicable diseases to be spread across the european union (eu), which is the focus of this study, even though animals must be in a fit state to be transported i.e. healthy animals without clinical signs of illness [ ] . however, animals with sub-clinical infections may go unnoticed, providing an opportunity to transport disease to different regions. live animal trade complicates tracing the origin of any disease outbreak that may occur due to an infected animal being displaced. for this reason, the eu has established a trade control and expert system (traces) to monitor imports, exports and trade in animals and animal products across the eu and to ensure traceability within the food chain [ ] , in addition to livestock movements recorded by the food and agricultural organisation of the united nations (fao). traces records the number of animals and consignments entering and leaving eu countries. despite the availability of this comprehensive database, animal health surveillance systems are rarely based on international live animal movements. to understand better livestock trade within europe with a view to inform disease surveillance we analysed trade networks across the eu for all major livestock species and purposes of movements. animal health surveillance includes the systematic, continuous or repeated, measurement, collection, collation, analysis, interpretation and timely dissemination of animal health and welfare related data from defined populations, essential for describing health hazard occurrence and to contribute to the planning, implementation and evaluation of risk mitigation measures [ ] . recent outbreaks and spread of exotic or emerging diseases such as avian influenza (ai), schmallenberg virus (sbv) and bluetongue virus (btv) in previously unaffected territories of the eu have emphasised the need for well-developed and adequately resourced health systems, including surveillance, to ensure early detection and rapid containment, the complexities of which are highlighted by braks et al. ( ) [ ] . at the same time investment is being constrained due to significant financial budget reductions in many european countries. livestock disease is important economically with regards to a loss of productivity, its potential impact on human and animal health, and the mitigation activities implemented when disease occurs (for example trade or movement bans, testing and culling). for example, the economic cost of bse in the uk accrued from the value loss in infected carcasses, disposal costs, and, most importantly, the sharp drop in domestic beef demand due to consumer scares (sales of beef products declined by % once the possible link between bse and new variant creutzfeldt-jakob disease (cjd) was announced, but the costs were partly offset by an increase in consumption of substitute meat), and a complete loss in export markets [ ] . further costs accrued from operating various public schemes, establishment and enforcement of new legislation and the adjustment of the industry to the new structure and markets [ ] . livestock disease can be spread directly for example the introduction of fmd from irish calves imported to the netherlands that were also held responsible for the infection of a farm near to the port of introduction to mainland europe [ ] . it can be spread by infected equipment, crates or transporter vehicles which can be contaminated by microbes. for example escherichia coli (e. coli) bacteria were detected on the sides and floors of lorries [ ] and contaminated transporters were found to be responsible for spreading classical swine fever to different farms in lithuania [ ] . by moving animals with latent or asymptomatic infections this enables disease to spread to wherever the animal travels or where the necessary vectors may be present. particularly in the case of epidemic diseases where the reduction of time from introduction of a hazard to its detection can enable early response and thereby lead to a reduction in intervention costs to contain an outbreak [ ] , effective surveillance is critical. few surveillance systems however, are designed based on international livestock movement data, even though such data can provide information on the quantity and seasonality of livestock movements, the types of movement (for example flows from production of point of lay birds to laying units), the route the animals take and associated stopover or resting points. surveillance for many livestock species occurs at the farm where it is the responsibility of the farmer (and veterinarian) to report notifiable diseases or at the abattoir where it is the role of the official veterinarian to inspect livestock according to council regulation (ec) / [ ] and report notifiable diseases to the national authorities, which in the uk is the department of the environment, food and rural affairs (defra), which in turn must inform the european food safety authority (efsa) as stated in council regulation (ec) / [ ] . network analyses are useful ways of visualising the countries that are importing animals from a great number of other countries (high level of indegree) and countries that are exporting to a high number of countries (outdegree), these are values that can change temporally. they have been used to find out movement between farms of different species, for example, fish movement between farms in scotland [ ] and a study of pig and cattle movement between farms in sweden [ ] . countries with a high indegree, which for the purposes of this study has a maximum number of (the number of countries, i.e. (nodes, within this study and the eu as of ) that could be used to rank countries, can be more vulnerable to introducing disease due to importing animals from a greater number of countries than those with a low indegree whilst countries with a high outdegree may have a great ability to be able to transmit a disease to many countries; this highlights the importance of understanding levels of disease within trading countries. information about the indegree and outdegree of farms was used by frössling et al. ( ) [ ] to investigate whether it could be used to target the surveillance of two cattle diseases in sweden, based on a threshold of in-and out-degrees. they found a positive association between a positive test result and the purchase of animals and proposed approaches to design risk-based surveillance based on cattle movement data. networks can also be used to quantify the proportion of international partners trading with each other (dyadic contacts) compared with the maximum number of national trading partners available for trade within an area allowing a comparison to be made between species and production systems [ ] . the higher the density the more connected countries are with respect to the animal being traded and the more countries that may be at risk from contracting a disease from buying in infected livestock. a measure of mixing within a network is to look at its transitivity which indicates whether countries that a country is trading animals to are also trading animals with each other (a triad) [ ] . the greater the level of transitivity the faster a disease can spread between countries and potentially infect many countries within the european area [ ] . transitivity and density for different communities of wild and domestic ungulates were investigated for the propensity to transmit e. coli by vanderwaal et al. ( ) [ ] . however, the network may only consider the point of origin and destination and not necessarily consider the route itself that may involve briefly stopping in other countries where a disease transmission event may occur, for example fmd in france [ ] . we hypothesise that the description of trade networks can inform the design of more efficient animal health surveillance systems that may enable a more rapid investigation or response to be implemented. different species being transported for different purposes will have networks of different densities and different countries with the greatest indegree or outdegree. the aim of this project was to map live animal trade networks in eu countries and assess potential differences between species and purposes of transport. this was done by illustrating the number of live animal imports and exports between eu countries including the number of country contacts and numbers of livestock units (lsu, a unit that takes into account the age, sex, purpose of animals with dairy cows having a reference number of ) moved determining the density of networks and similarities of networks between species. table illustrates the median livestock intra-community movements (expressed in livestock units) and the densities of the transport networks. by far the most heavily moved animal species within europe in were poultry for slaughter and breeding, followed by poultry for 'other' purposes, pigs for fattening, pigs for slaughter and cattle for fattening; goats were the least traded species. generally more lsus were transported for fattening than for slaughter. the density of movement (table ) shows that there was greater connectivity for cattle than for the heavily traded poultry. breeding networks were found to be denser than those for other purposes. this may be due to the number of consignments needed to move the relative units of animals. the geographical trade flows are shown in figures , , , , and . the transitivity indicates that disease would spread more slowly for 'other' purposes of animal movement than for breeding, fattening or slaughter with the exception of poultry and equines. figures , , , , and show the in-and outdegrees of livestock unit movements in the eu on the left and the geographical trade flows in the right, which are separated by species and by purpose of trade. the axes of the graphs of the in-and outdegrees reflect the numbers of trading partners. the countries in the top right received and exported animals with the greatest number of countries, whilst the bottom left indicates those that have little or no export or import trade with other countries. some countries are found in the top right corner with regards to many different animal movements e.g. germany, whilst others rarely buy or sell to the other countries considered in this study e.g. cyprus, finland and sweden, whilst other countries import from many countries and export to few e.g. italy. very few shipments of weaned cattle, sheep and goats require a rest period of hours (additional file ), whereas many unweaned animals would require a hour break in their journey from their point of origin to their figure the outdegree is shown against the indegree for the trade of cattle for different purposes on the left column of the table and the geographical movement across europe is shown on the right column of the table. the arrows between the countries indicate trade between the countries. the numbers in the figures refer to the corresponding countries: [ ] austria, [ ] belgium, [ ] bulgaria, [ ] cyprus, [ ] czech republic, [ ] denmark, [ ] estonia, [ ] finland, [ ] france, [ ] germany, [ ] greece, [ ] hungary, [ ] ireland, [ ] italy, [ ] lithuania, [ ] latvia, [ ] luxembourg, [ ] malta, [ ] netherlands, [ ] poland, [ ] portugal, [ ] romania, [ ] slovakia, [ ] slovenia, [ ] spain, [ ] sweden and [ ] uk. and exporting high proportions of their national population, the officially recorded number of animals of that species in the particular country. the poultry and pig sectors had the greatest number of lsu movements, which are being used to indicate breeding fattening slaughter other figure the outdegree is shown against the indegree for the trade of pigs for different purposes on the left column of the table and the geographical movement across europe is shown on the right column of the table. the arrows between the countries indicate trade between the countries. the numbers in the figures refer to the corresponding countries: [ ] austria, [ ] belgium, [ ] bulgaria, [ ] cyprus, [ ] czech republic, [ ] denmark, [ ] estonia, [ ] finland, [ ] france, [ ] germany, [ ] greece, [ ] hungary, [ ] ireland, [ ] italy, [ ] lithuania, [ ] latvia, [ ] luxembourg, [ ] malta, [ ] netherlands, [ ] poland, [ ] portugal, [ ] romania, [ ] slovakia, [ ] slovenia, [ ] spain, [ ] sweden and [ ] uk. the potential opportunities of pathogen introduction and spread, implying that they require more attention in terms of disease prevention and management, while the equine and goat sectors had the greatest and lowest densities of movements respectively. in addition to lsu movements larger proportions of national pig populations are imported breeding fattening slaughter other figure the outdegree is shown against the indegree for the trade of sheep for different purposes on the left column of the table and the geographical movement across europe is shown on the right column of the table. the arrows between the countries indicate trade between the countries. the numbers in the figures refer to the corresponding countries: [ ] austria, [ ] belgium, [ ] bulgaria, [ ] cyprus, [ ] czech republic, [ ] denmark, [ ] estonia, [ ] finland, [ ] france, [ ] germany, [ ] greece, [ ] hungary, [ ] ireland, [ ] italy, [ ] lithuania, [ ] latvia, [ ] luxembourg, [ ] malta, [ ] netherlands, [ ] poland, [ ] portugal, [ ] romania, [ ] slovakia, [ ] slovenia, [ ] spain, [ ] sweden and [ ] uk. compared with species such as goats increasing the possibility for the introduction of infected animals to an existing population. for poultry, the highest numbers of lsus moved were for slaughter, which may present less of a risk of introducing disease to an existing population, as the animals are likely to be transported from the production site directly to the slaughter point. however, many poultry journeys would require a break in transit emphasising the breeding fattening slaughter other figure the outdegree is shown against the indegree for the trade of goats for different purposes on the left column of the table and the geographical movement across europe is shown on the right column of the table. the arrows between the countries indicate trade between the countries. the numbers in the figures refer to the corresponding countries: [ ] austria, [ ] belgium, [ ] bulgaria, [ ] cyprus, [ ] czech republic, [ ] denmark, [ ] estonia, [ ] finland, [ ] france, [ ] germany, [ ] greece, [ ] hungary, [ ] ireland, [ ] italy, [ ] lithuania, [ ] latvia, [ ] luxembourg, [ ] malta, [ ] netherlands, [ ] poland, [ ] portugal, [ ] romania, [ ] slovakia, [ ] slovenia, [ ] spain, [ ] sweden and [ ] uk. vulnerability of the chain and need for adequate surveillance. poultry for breeding had the second highest lsu movements overall, which likely reflects the current structure of commercial poultry production. pure line grandparent and parent stock for breeding are produced by only a limited number of breeding organisations worldwide. for example, the two companies aviagen and cobb, have a market share of more than % of the commercial broilers produced in the eu and use their global network of distributors to serve almost all european countries [ ] . the breeder farms supplied with young breeding stock have links to hatcheries that produce day old chicks, broiler or layer farms, and slaughterhouses. this system leads to transport of young breeders, hatching eggs and day old chicks. in pigs, heavy movements were recorded for fattening, which reflects ongoing changes in production centres in the eu. in fact, more than two thirds of breeding pigs are produced in denmark, germany, spain, france, the netherlands and poland with half of the breeding pigs at regional level being concentrated in eleven regions in these six countries [ ] . germany is the main importer of fattening pigs, with an indegree of and denmark is the main exporter with an outdegree of . moreover, pigs for breeding and fattening as well as poultry for breeding were shown to have among the highest transitivities, indicating that disease spread in these networks would be fast if uncontained. hence, solely taking into breeding slaughter other figure the outdegree is shown against the indegree for the trade of poultry for different purposes on the left column of the table and the geographical movement across europe is shown on the right column of the table. the arrows between the countries indicate trade between the countries. the numbers in the figures refer to the corresponding countries: [ ] austria, [ ] belgium, [ ] bulgaria, [ ] cyprus, [ ] czech republic, [ ] denmark, [ ] estonia, [ ] finland, [ ] france, [ ] germany, [ ] greece, [ ] hungary, [ ] ireland, [ ] italy, [ ] lithuania, [ ] latvia, [ ] luxembourg, [ ] malta, [ ] netherlands, [ ] poland, [ ] portugal, [ ] romania, [ ] slovakia, [ ] slovenia, [ ] spain, [ ] sweden and [ ] uk. account trade data, surveillance efforts would need to focus on poultry for breeding and pigs for breeding and fattening. however, a mapping of surveillance in seven european countries showed that the highest proportion of surveillance components in place were for cattle [ ] . similarly, a recent literature review on animal health issues (including zoonoses) researched in the eu showed that cattle and buffalo were the species most breeding slaughter other registered figure the outdegree is shown against the indegree for the trade of equines for different purposes on the left column of the table and the geographical movement across europe is shown on the right column of the table. the arrows between the countries indicate trade between the countries. the numbers in the figures refer to the corresponding countries: [ ] austria, [ ] belgium, [ ] bulgaria, [ ] cyprus, [ ] czech republic, [ ] denmark, [ ] estonia, [ ] finland, [ ] france, [ ] germany, [ ] greece, [ ] hungary, [ ] ireland, [ ] italy, [ ] lithuania, [ ] latvia, [ ] luxembourg, [ ] malta, [ ] netherlands, [ ] poland, [ ] portugal, [ ] romania, [ ] slovakia, [ ] slovenia, [ ] spain, [ ] sweden and [ ] uk. frequently studied in the eu [ ] ; this may reflect differences in resource allocation for surveillance and disease mitigation. the reasons for this may be that cattle harbour or are perceived to harbour more pathogens than other species, that outbreaks in cattle systems have higher impact, that cattle receives more attention than other species for cultural or historical reasons, or that disease prevention and management in cattle systems are of lower quality. currently, there are no multipathogen, multi-species systematic risk assessments available at eu level that would allow a comparison of these factors. breeding networks were found to be more highly connected with more trade between countries indicating disease may spread more easily through them. this is of concern as these animals are not intended to be slaughtered on arrival and will produce new animals, therefore stringent precautions are needed to protect these populations, particularly if they are diseases not covered by eu legislation, for example the diseases listed in council regulation (ec) / [ ] . the density of international agri-trade calculated by ercsey-ravasz et al. ( ) [ ] was . which was comparable with density of many networks in this study. however, in national networks the densities and transitivities are smaller, which are due to the greater number of farms involved in national animal production compared with the number of countries involved in this study. the cattle trade network in france had a very low annual level of transitivity indicating that disease spread would be slower than that between european countries [ ] . the pig and cattle networks in sweden had lower transitivities than international networks of these species [ ] as did the transitivity of pig movements in denmark [ ] and the uk [ ] . the location of countries in figures , , , , and gave an indication of where surveillance could be targeted with countries in the upper right quadrant both importing and exporting high numbers of lsu, which means that they need to monitor both production to export healthy animals and import processes to avoid introduction of disease. countries in the lower right quadrant may need to consider strengthening surveillance related to import processes. many national studies have found that the majority of animal movements are between premises with lower indegrees and outdegrees as shown in a study by smith et al. [ ] , this reduces the likelihood of disease transmission to many different areas, reducing the level of surveillance needed. many countries trading cattle were found to have an in or out degree equal or greater than five. this was the threshold that was calculated to require enhanced surveillance for bovine coronavirus in a study on trade and cattle in sweden by frössling et al. [ ] . consequently, there seems to be ample opportunity to take advantage of trade network data to enhance surveillance. the evolution of trade networks over time at the eu level could be monitored using indegrees, outdegrees, and transitivity. such monitoring would provide information at the systems level and allow observations of changes in networks over time and where consequent surveillance efforts should be focused. higher-level surveillance capturing trends or changes in trade patterns could complement existing surveillance systems that are commonly disease centered. the differences across countries in terms of indegrees and outdegrees also bring up the question of who has the responsibility for disease control, including surveillance the buyer, the seller or relevant food business operator depending on the stage of livestock production [ ] . while the draft new eu animal health law [ ] refers to listed diseases and pre-dominantly supports disease centered surveillance, it also creates a framework for the better use of the synergies between surveillance undertaken by the different actors in the field to ensure the most effective and cost efficient use of surveillance resources as well as promotion of data availability and facilitation of data exchange. transportation itself is stressful for animals as indicated in many studies in many species for example cortisol in pigs [ ] ; heart rate and cortisol in cattle [ ] ; cortisol in lambs [ ] ; cortisol in horses [ ] ; increasing susceptibility to disease and may enhance the likelihood of shedding pathogenic agents in transit or in the receiving country, which may lead to infection in other animals. it is common to refer to malaise post-transportation as shipping illness [ ] . however, pathogens may be introduced or spread from transporters and not just from the animals that they transport. studies have demonstrated that transporters need to be thoroughly cleaned to prevent them from acting as a source of pathogens to subsequently carried animals, for example to prevent transmission of porcine reproductive and respiratory syndrome virus, that can survive in transporters, being transferred to pigs [ ] . rest stops are infrequent for some species, however, if animals from more than one origin are rested in the same place it may allow for disease spread. this is most likely to impact animals traded for breeding and fattening purposes that have more lsus and are more highly connected than animals already at slaughter weight. these are animals that will live in the receiving country for a period of time that may enable pathogen transfer. many of the highly connected countries (with high in and out degrees in the top right of figures , , , , and ) for example germany are geographically located in an area (central europe) that minimises the distances and therefore time that animals have to travel reducing the need for rest breaks and the consequent potential for pathogen transfer. many of the long distances are from countries that rarely trade with mainland europe for example cyprus. many animals undergo long journeys between countries. the time in transit is a concern with regards of the potential for disease to spread along trade routes [ ] . this has implications for policy around the planning of livestock production and slaughter. ideally, large production facilities would not be placed adjacent to well-known and used trade routes and or resting points. however, such information is only of use to policy makers if it is captured in a systematic and continuous way allowing to monitor trends, change and modify policies accordingly if deemed necessary. the analyses have only considered the spatial aspect of trade and not taken into account temporal variations that may occur altering the relationships between the countries (nodes) and the respective network, and affect the likelihood of an animal being infectious with a disease. animal populations fluctuate within a year and the population recorded in december was used to calculate the proportion of animals being imported or exported into a country, therefore it may have under or overestimated the actual population at the time of movement. for example the majority of lambs are born between january and april increasing the sheep population until they reach slaughter weight and are culled, which occurs before december. networks are highly dynamic and these changes in movements between countries will need to be considered by surveillance programs using this approach. one method that may address this is to use exponential random graph models that can incorporate a range of different distributions of connectivity between the nodes to create many different networks, which can be compared with the data to find a model that best fits the current trade pattern [ ] . the distances that animals are transported between countries may be shorter or longer than the distances between centroids. in addition, there are many different routes across europe that may be used and this may be worth investigating in future analyses with regards to distance, time and mixing between countries. this means that our calculations for whether particular species need a rest break for movement between particular countries are generalised so that there may be fewer or greater numbers of animals being rested en-route to their destination country altering the potential for pathogen exposure. the analyses did not take into account the numbers of convoys or animals and the mixing of animals: from different farms per convoy, at resting places, at borders, when received by individuals and at markets in the country of destination. these factors will have an impact on contact between potentially naïve and infectious animals, pathogen exposure and susceptibility. the analyses could not take into animals being bought and sold on to more than one country i.e. the chain of infection [ ] and assumed that an animal moved once between countries in its lifetime. creating networks has enabled us to visualise the countries that have a higher level of involvement in animal trade. using network analysis we were able to determine the extent to which a disease may spread, the production systems where disease spread may be more rapid, for example registered horses and breeding cattle, pigs and poultry, and facilitates comparisons with networks in other areas. similarities between countries, species and production purposes has the potential to inform international surveillance policies that take into account trade patterns. the study has highlighted the vulnerability of the pig network to disease, which is of increasing concern due to the proximity of african swine fever to the eu and the potential for wildlife to introduce the disease [ ] . this information could complement the national movement recording systems that are mandatory for cattle throughout the eu [ ] that will soon be implemented in sheep and goats now that their form of identification tags have been decided upon [ ] , and being planned for porcines [ ] to produce a more robust surveillance plan. data on numbers of live cattle, goats, horses, pigs, poultry and sheep movements in eu countries were obtained from directorate general sanco animal health dg sanco unit g activity report for the year obtained from http://ec.europa.eu/food/animal/resources/publications_en. htm. the data obtained related to the production purpose of the animals, which fell into five categories: breeding, fattening, slaughter, registered and other (e.g. pets, show animals). these categories were analysed separately and combined for each species. the numbers of animals were converted into livestock units to enable comparison between species using the following conversion factors derived from the eurostat glossary on statistics ( ) [ ] : pigs . (breeding), pigs . (other), goats . , sheep . , horses . and poultry . . all data were obtained at a national level from publically accessible databases and no animal experimentation occurred nor consultation with animal owners therefore ethical approval was not needed. all the analyses and associated network figures were created and carried out using r . . . [ ] . networks were created from adjacency matrices and their densities were calculated using network function found in r package network [ ] . the in and out degrees were calculated and respective graphs were produced using the degree and network.layout.degree functions in r package network [ ] . the transitivity of each network was calculated using the gtrans function in the sna package [ ] . trade maps in the figures , , , , and were produced by merging shapefiles of all the countries of europe downloaded from maplibrary.org (www.gadm.org/, , gadm version ) into one polygon (europe) using arcgis . [ ] . the map of europe was then read into r using the function readshapepoly found in the maptools package [ ] . centroids (the co-ordinates for the centre of a country) were calculated for each country and linked with respective importing and exporting countries were calculated using the calccentroid function in r package pbsmapping [ ] . curved lines and arrows were drawn between the centroids for each movement using the gcintermediate function found in the geosphere package [ ] . to be able to relate the numbers of animals being traded with the animal populations of the countries, the numbers of animals of each species were obtained for from the eurostat database. the data used was for december as this was the only calendar month available for all species. a movement:standing population ratio was calculated for both animal imports and exports through adding the total number of breeding, fattening, slaughter, registered and other animals being moved and dividing by the total population of animals of that species in the exporting or importing country. to illustrate the number of animal journeys that require hour rest periods during transit, distances that animals would have to travel were approximated by estimating arc distances from one capital city to the other using www.timeanddate.com. the time in transit before animals are required to have a hour rest period were obtained from council regulation ec / [ ] . the regulation states that unweaned cattle, goats, sheep, pigs and horses require a hour rest period after hours of travel. weaned cattle, goats and sheep can be in transit for hours without a rest, whereas weaned pigs and domestic horses need to be rested after hours of transportation. any animal being transported by boat should be rested for hours at the port after being unloaded. the law for poultry and rabbits states that they can travel for up to hours without food or water and whereas chicks within hours of hatching can travel for up to hours without food or water. to gauge whether a journey between two rest points would need a break the following equation was used given the assumption that a vehicle would be travelling at an average kilometres an hour. hour rest period ¼ distance between cities duration of travel before hours rest period à km=h combining livestock trade patterns with phylogenetics to help understand the spread of foot and mouth disease in sub-saharan africa, the middle east and southeast asia bovine spongiform encephalopathy identified in a cow imported to canada from the united kingdom-a case report european union council regulation (ec) / . the protection of animals during transport and related operations and amending directives / / eec and / /ec and regulation (ec) no / l european union council regulation (ec) / . commision decision of august concerning the development of an integrated computerised veterinary system known as traces proposed terms and concepts for describing and evaluating animal-health surveillance systems towards an integrated approach in surveillance of vector-borne diseases in europe the economic impact of bse on the uk beef industry the foot-and-mouth disease epidemic in the netherlands in the effects of transport and lairage on counts of escherichia coli o in the feces and on the hides of individual cattle international disease monitoring economic principles for resource allocation decisions at national level to mitigate the effects of disease in farm animal populations european union council regulation (ec) / . the laying down specific rules for the organisation of official controls on products of animal origin intended for human consumption council regulation (ec) / . laying down the general principles and requirements of food law, establishing the european food safety authority and laying down procedures in matters of food safety small-and large-scale network structure of live fish movements in scotland network analysis of cattle and pig movements in sweden: measures relevant for disease control and risk based surveillance application of network analysis parameters in risk-based surveillance -examples based on cattle trade data and bovine infections in sweden collective dynamics of "small-world" networks disease evolution on networks: the role of contact structure quantifying microbe transmission networks for wild and domestic ungulates in kenya chapter production and consumption of poultry meat and eggs in the european union pig farming in the eu, a changing sector mapping of surveillance and livestock systems, infrastructure, trade flows and decision-making processes to explore the potential of surveillance at a systems level review of the emerging animal health and food security issues council regulation (ec) / approving annumal and multiannual programmes and the financial contribution from the union for the eradication, control and monitoring of certain animal diseases and zoonoses presented by the member states for and the following years complexity of the international agro-food trade network and its impact on food safety vulnerability of animal trade networks to the spread of infectious diseases: a methodological approach applied to evaluation and emergency control strategies in cattle relationship of trade patterns of the danish swine industry animal movements network to potential disease spread descriptive and social network analysis of pig transport data recorded by quality assured pig farms in the uk european union council regulation (ec) / . laying down of specific hygiene rules on the hygiene of foodstuffs council regulation (ec) / . approving annual and multiannual programmes and the financial contribution from the union for the eradication, control and monitoring of certain animal diseases and zoonoses presented by the member states for and the following years shipping stress and social status effects on pig performance, plasma cortisol, natural killer cell activity, and leukocyte numbers a comparison of the welfare and meat quality of veal calves slaughtered on the farm with those subjected to transportation and lairage effects of weaning and h transport by road and ferry on some blood indicators of welfare in lambs effects of transport, lairage and stunning on the concentrations of some blood constituents in horses destined for slaughter isolation of respiratory bovine coronavirus, other cytocidal viruses, and pasteurella spp of shipping fever an evaluation of disinfectants for the sanitation of porcine reproductive and respiratory syndrome virus-contaminated transport vehicles at cold temperatures an introduction to exponential random graph (p*) models for social networks council regulation (ec) / : implementing regulation (ec) no / of the european parliament and of the council as regards eartags, passports and holding registers report from the commission to the council on the implementation of electronic identification in sheep and goats council regulation (ec) / : the identification and registration of pigs eurostat glossary: livestock unit (lsu) -statistics explained r core team: r. a language environment for statistical programming package network package sna desktop: release . environmental systems research institute maptools: tools for reading and handling spatial objects pbsmapping: mapping fisheries data and spatial analysis tools submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution acknowledgements bh acknowledges financial support from the leverhulme centre for integrative research on agriculture and health (lcirah). additional file : journeys that would require rest breaks due to being over hours long or over hours long. these data are displayed in tables.additional file : journeys that would require rest breaks for unweaned animals. the data are displayed in a table.additional file : journeys that would require rest breaks for poultry other than chicks < hours old. the data are displayed in a table.additional file : the proportions of national animal imports and exports compared with the national population. these data are displayed in separate tables for each species. the authors declare that they have no competing interests.authors' contributions jh obtained the data and undertook the analyses. jh, bh and jr interpreted the results and had an equal contribution to the manuscript. all authors have read and approved the final manuscript. key: cord- -qzf lw authors: andrés-lasheras, sara; martín-burriel, inma; mainar-jaime, raúl carlos; morales, mariano; kuijper, ed; blanco, josé l.; chirino-trejo, manuel; bolea, rosa title: preliminary studies on isolates of clostridium difficile from dogs and exotic pets date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: qzf lw background: clostridium difficile infection (cdi) is recognised as an emerging disease in both humans and some animal species. during the past few years, insights into human cdi epidemiology changed and c. difficile is also considered as an emerging community-acquired pathogen. certain ribotypes (rt) are possibly associated with zoonotic transmission. the objective of this study was to assess the presence of c. difficile in a population of pets and to characterise the isolates. results: faecal samples from a total of diarrhoeic dogs and from exotic animal species (both diarrhoeic and non-diarrhoeic) were analysed. clostridium difficile was isolated from ( . %) dogs and one reptile sample ( . %). four ( . %) of the six dog strains were capable of producing toxins. four known different rts were detected in dogs ( , , and ) and a new one was found in a faecal sample of an exotic animal. this new rt isolate was negative for all toxin genes tested and belonged to sequence type which has been proposed as a clade-iii member. importantly, two dog strains showed a stable resistance to metronidazole (initial mic values: and μg/ml). conclusions: the results obtained in this study suggest the implementation of antimicrobial susceptibility surveillance programs to assess the prevalence of metronidazole resistance in dogs; molecular studies to elucidate c. difficile metronidazole resistance mechanisms are warranted. based on the similarity between the ribotypes observed in dogs and those described in humans, the zoonotic transmission should be further explored. furthermore, exotic animals have shown to harbor uncommon c. difficile strains which require further genomic studies. electronic supplementary material: the online version of this article ( . /s - - - ) contains supplementary material, which is available to authorized users. clostridium difficile is a bacterium capable of producing enteric disease in different animal species included humans. toxigenic c. difficile strains are the most common cause of antibiotic-associated diarrhoea in people from developed countries through the synthesis of toxins a and b, its main virulence factors [ ] . the epidemiology of c. difficile has changed in the last years and it is now recognised as an emerging pathogen in both humans and animals. it is also considered an emerging community-acquired pathogen likely associated with a zoonotic and/or foodborne transmission [ ] . animals are an important source of many infectious diseases for humans. about % of emerging infectious diseases are zoonoses [ ] , and it is thought that pets could be implicated in the transmission of c. difficile to humans since similar genotypes have been recovered from them and humans [ ] . among the strains isolated from dogs, there are several ribotypes of international interest, such as rt , rt / and rt [ ] . likewise, exotic animals can act as vectors of many zoonotic diseases, including enteric diseases, and several zoonotic outbreaks have been associated with the trade of this type of animal species (either in a legal or illegal way) as their international trade has increased recently [ ] . however, there is limited information about toxigenic c. difficile carriage in exotic animals in the scientific literature [ ] . dogs can develop diarrhoea due to different bacteria or virus infections (e.g. salmonella spp., campylobacter spp., clostridium perfringens, c. difficile, or coronavirus), intestinal parasites (e.g. giardia spp.), nutritional factors, inflammation, allergies or neoplasia [ , ] . so far, the role of c. difficile in canine enteric disease is still unclear due to the presence of toxigenic strains or their toxins in asymptomatic animals and the failure to reproduce cdi in healthy dogs with and without antibiotic treatment [ , ] . it can be isolated from to % of healthy dogs with no diarrhoea [ ] . however, there are several studies which have reported an association between the presence of c. difficile toxins in faeces with diarrhoea, as well as with outbreaks of haemorrhagic diarrhoea in veterinary hospitals [ , [ ] [ ] [ ] . but it is still unknown whether c. difficile represents an opportunistic pathogen, or simply a fortuitous finding in this animal species [ ] . there is limited information about antimicrobial susceptibilities of c. difficile strains obtained from dogs or exotic animal species [ , ] . metronidazole, and less frequently vancomycin, are used to treat cdi in dogs following the recommendations for human episodes [ ] . these drugs are also commonly used to treat different kinds of exotic animal infections as well. the isolation of metronidazole-resistant strains or strains showing low susceptibility to this drug is growing in both humans and animals [ ] , particularly in ribotypes and [ , ] . in addition, resistance to metronidazole is heterogeneous and therefore c. difficile can show reduced susceptibility to this drug, which can be related to recurrent cdi cases [ ] . the objective of this study was to assess the presence of c. difficile in a population of diarrhoeic dogs and exotic animal species (both diarrhoeic and non-diarrhoeic), and to characterise the c. difficile isolates by the presence of toxin genes, their pcr-ribotype and toxinotype, and also their antimicrobial susceptibility pattern. diarrhoeic stool samples from dogs, submitted to a veterinary diagnostic laboratory located in the zaragoza, ne of spain were used. the samples were collected between october and november . all of them were analysed for the presence of c. difficile by microbiological culture in our laboratory. the specimens were collected using commercial swabs with amies transport medium (deltalab, barcelona, spain) by veterinary staff at the time of the animal clinical examination. the samples originated from primary veterinary clinics located at different spanish regions ( table ). all of them were sent under refrigerated conditions to the diagnostic laboratory, arrived within the h after collection, and were kept at − °c until c. difficile culture was performed. in addition to c. difficile, faecal samples were analysed for other enteric pathogens upon request of the veterinarian in charge of the case (analysis carried out in the diagnostic laboratory; data not published). dogs were classified by their age ( - months puppy; - months juvenile; - months adult; ≥ months mature), gender, breed, location and presence/absence of dysbiosis. in addition, other laboratory data were recorded for each case when available. additionally, faecal samples were cultured from exotic animals from a veterinary clinic laboratory specialised in that kind of animals located in barcelona, ne of spain. the sampling period covered june and july . the specimens derived from diarrhoeic and non-diarrhoeic animals. each sample was taken by the veterinary staff during the examination of the animals and submitted to our laboratory under refrigerated conditions within the first h after collection. as in the dog's study, the samples were kept at − °c until the culture for c. difficile was performed. exotic animals were identified by species and grouped into three main animal categories (i.e. reptiles, small mammals and birds). no other data were available except being sick or not. the isolation of c. difficile, molecular characterisation of the strains obtained (i.e. tpi housekeeping and toxin genes detection by pcr, identification of non-toxigenic strains, and pcr-ribotyping) and antimicrobial susceptibility testing was performed as described elsewhere [ ] . the variability of the genes coding for toxins a and b (a and b fragments respectively) of toxigenic strains obtained was assessed through toxinotyping by pcr-rflp [ ] . besides, those strains which showed unexpected results, i.e. negative pcr results for tcda and tcdb genes and also non-toxigenic assay, were further studied by toxinotyping as well (a , a , a , b , b and b fragments) to test the possible presence of toxin gene fragments. multilocus sequence typing (mlst) technique was used for characterisation of strains which did not belong to a known pcr ribotype. by this technique, seven housekeeping loci are studied by pcr and subsequent sequenced, providing a sequence type (st) profile and a clade [ ] based on these genes alleles [ ] . a maximum likelihood tree with bootstrap replicates was constructed based on the kimura -parameter model [ ] . a total of strains were used for this purpose: one from this study (e ), from previous works carried out by our team (hu, rc and rf isolates; data not published for hu isolates) [ ] , and from the pubmlst database to provide a context for c. difficile population (st , st , st , st , st , st - , st , st , st , st , st - , st and st ). initial tree(s) for the heuristic search were obtained by applying the neighbour-joining method to a matrix of pairwise distances estimated using the maximum composite likelihood approach. evolutionary analyses were conducted in mega [ ] . additionally, seven serial passages over days were performed on brucella blood agar plates without antibiotics in order to assess the stability of the initial metronidazoleresistant isolates, i.e. those which showed a breakpoint ≥ μg/ml [ ] . then, the mic to metronidazole was tested again by etest as described above. resistance was considered stable when the mic of metronidazole against c. difficile remained (within ± dilution) after the passages. resistance was considered unstable when resistant strains became susceptible (˂ μg/ml) after the passages. the prevalence of c. difficile was estimated for dogs and exotic pets separately. when possible, comparisons of c. difficile prevalence among the factors considered for dogs were assessed by univariable logistic regression. thus, the outcome variable was the presence/absence of c. difficile and the explanatory variable was the corresponding factor (age, gender, breed, location and dysbiosis). significance was set at p-values ≤ . . faecal samples from a total of dogs were analysed. the samples came from different veterinary clinics located in different autonomous communities in spain, most of them ( . %) located in the north/northeast of the country. the median age of dogs was . months (range - ) and . % of the animals were females. a total of dog breeds were included and grouped as large (e.g. german shepherd), medium (e.g. beagle) and small size (e.g. yorkshire). clostridium difficile was isolated from ( . %) out of the dogs analysed. all these results are summarised in table . cd clostridium difficile; a univariable logistic regression; b percentages calculated from the total number of samples; c age unknown for samples (two of them are positive to non-toxigenic c. difficile); d breed unknown for eight samples (one of them is positive to toxigenic c. difficile and another one to non-toxigenic c. difficile) four ( . %) strains with toxin genes (table ) yielded an a + b + cdt-genotype in all cases. non-toxigenic strains showed a positive result with lok / primers. four different ribotypes were detected, and all toxigenic strains belonged to toxinotype ( table ) . the four ( %) toxigenic c. difficile positive dogs showed dysbiosis and faeces without mucus, while only ( . %) out of of the c. difficile negative dogs showed this problem. however, this difference was not statistically significant (p = . ). no relationship was observed between the presence of c. difficile and any of the other factors considered ( table ) . none of the dogs presenting toxigenic c. difficile yielded a positive result for another enteric pathogen (data not shown). twenty-four faecal samples derived from exotic species, ( . %) from diarrhoeic animals, ( . %) from nondiarrhoeic animals and three with unknown clinical data ( . %). fifteen ( . %) were birds, mainly composed of different species of psittacines, ( . %) small mammals (lagomorphs, mustelids and rodents) and ( %) sauropsid reptiles. only one sample ( . %; e strain, table ) belonging to a reptile (pogona vitticeps) yielded a positive culture result for c. difficile. it was negative for all toxin genes tested (tcda, tcdb, cdta and cdtb) but also negative to the non-toxigenic pcr (see additional file ) and to the toxinotyping scheme (a , a , a , b , b and b fragments) (see additional files and ). interestingly, this isolate represented a new pcr-ribotyping type ( table ) and belonged to st , which was recently proposed as a clade c-iii member [ ] (fig. ) . all dog strains were susceptible to tetracycline and vancomycin (range between . - . μg/ml for vancomycin), whereas resistance to clindamycin, erythromycin, metronidazole and moxifloxacin varied ( %, . %, . % and . % respectively) ( table ) . two strains showed a mdr phenotype to clindamycin, erythromycin and metronidazole; resistance to metronidazole was unchanged and stable after a serial number of passages on antibiotic-free medium ( table ). the mics of the remaining strains (n = ) to metronidazole varied between . - . μg/ml. one strain (d ) was considered resistant (and stable) to metronidazole with a heterogeneous pattern. after the h incubation time, the isolate showed a fully susceptible phenotype to metronidazole (mic . μg/ml) (fig. , growth ii or gii; improved contrast image), but a subpopulation of tiny colonies (fig. , growth i or gi) was present inside the initial inhibition halo exhibiting a higher mic ( μg/ml). mic results remained unharmed after three extra days of incubation. after observing these results, the growth i and ii were sub-cultured separately in blood agar without antibiotics in order to repeat the susceptibility test to metronidazole following the protocol described above. after h of incubation, both isolates showed metronidazole resistance (mics and μg/ml, gi and gii respectively). the metronidazole resistance stability test was performed only for gi (table ) . a similar phenomenon was observed for this d isolate regarding its susceptibility to erythromycin and clindamycin. however, the subpopulations growing inside the initial halo reached a fully resistant phenotype to both antibiotics after h of incubation. when the susceptibilities were repeated for the two different growths, both showed a fully resistant phenotype to these antimicrobials after h. the reptile c. difficile isolate (e ) was susceptible to all antimicrobial drugs (mics range . - μg/ml) tested except to tetracycline, for which a decreased susceptibility was found (mic μg/ml). clostridium difficile was isolated from . % ( / ) of dogs with diarrhoea, but only four strains were toxigenic ( . %). overall, this prevalence was somewhat lower than that reported in previous studies of diarrheic dogs or dogs with various digestive disorders ( % - [ ] , . % - [ ] and % - [ ] ). however, these differences can be explained by variations of the study design (i.e. number and type of dogs included, geographical location, age distribution, etc.). they may be also due to the fact that samples were collected in veterinary clinics all around spain and submitted to a veterinary diagnostic laboratory before arriving at our laboratory. it is well known that the survival rate of c. difficile may be compromised if faecal samples are stored under aerobic conditions [ ] . it has also been reported that toxin-positive samples can yield a culture-negative result for c. difficile from dog faecal samples [ ] . in addition, there were several limitations in this study to consider: the lack of the information on previous or ongoing antibiotic treatment data at the time of sampling. among the ribotypes detected in this study the most frequent was the epidemic rt ( / ) which has been widely isolated from cdi cases in humans in several european countries, including spain [ ] . this ribotype has been also isolated from different animal species and types of samples, including dogs, retail meat and water [ ] [ ] [ ] . only one out of the six isolates from this study belonged to the non-toxigenic ribotype which has been largely associated with dogs [ , , ] and occasionally isolated from humans [ ] . these results add more evidence to a the breakpoints for resistance established by the clinical and laboratory standards institute (clsi) for anaerobic bacteria are those marked by b [ ] . the breakpoint for tetracycline was ≥ μg/ml [ ] . the remaining breakpoints were based on the literature [ ] possible inter-species c. difficile transmission as previously observed other authors [ , ] . however, to the author's knowledge, there are no available data regarding the epidemiology of ribotypes and in europe, which would suggest that they are not very common genotypes neither in humans nor in animals. metronidazole is the first choice to treat non-severe cdi in humans [ ] and a very common treatment for cdi and giardia spp. infections in dogs [ , ] . overall, the frequency of resistant c. difficile isolates to metronidazole is still low ( %- %) [ ] , and even lower after laboratory strain manipulation [ ] . in this study, a higher proportion of strains ( . %, ribotypes and ) revealed stable resistance to metronidazole. an increase in the number of metronidazole-resistance c. difficile isolates has been observed for the last years in both humans and animals strains [ ] . interestingly, higher mic averages to this drug are frequently associated with the non-toxigenic rt [ ] . thus, despite the low number of positive samples, these results could reflect this trend in dogs in spain. in addition, these two isolates were also multi-drug resistant to clindamycin, erythromycin and metronidazole, a pattern already described in dogs [ , ] . overall, these results suggest that antimicrobial susceptibility surveillance programs should be implemented in c. difficile strains isolated from dogs since they could be a possible source of metronidazole-resistant and mdr c. difficile. however, in vitro results should be interpreted with caution due to the limited information available regarding breakpoints for anaerobic microorganisms of veterinary relevance, and the fact that the antimicrobial intestinal concentrations are not known for all cases. the number of resistant isolates to moxifloxacin in this study was relatively low ( / ), which was expected due to the low use of this drug in companion animals in spain and the low prevalence of resistance to this drug reported in previous studies in dogs and other animal species [ ] . although the use of clindamycin and erythromycin in companion animals in spain is low [ ] , % and . % of the isolates, respectively, were resistant to them. the resistance to clindamycin and erythromycin is common among c. difficile isolates in dogs [ ] . this feature is mainly associated to ermb genes which are located in mobile elements, so these results probably reflect the spread of this determinant among c. difficile isolates regardless of their origin. the results regarding strain d were unexpected. heterogeneous and stable resistance to metronidazole was observed with high mic values. the in vitro detection of subpopulations with reduced susceptibility to this antibiotic may be related to treatment failure observed in humans [ ] . a similar phenomenon was observed on erythromycin and clindamycin susceptibility tests. the reason for these results is not clear and warrants further molecular studies. the strain isolated from the lizard (e ) represents a new ribotype and it belongs to st for which a new clade (c-iii) was proposed [ ] . a maximum likelihood tree was constructed using the e strain st, sequence types from our c. difficile strain collection and from pubmlst database (fig. ) , and it showed that e strain clade is completely apart from the rest of defined and proposed new clades described until the termination of this study [ , , ] . e seems to be a non-toxigenic isolate (tcda, tcdb, cdta and cdtb negative results by pcr), but it yielded also a negative result in nontoxigenic pcr which allows thinking that it has not the traditional non-coding region which replaces the paloc as it has been described before [ , , ] . besides, the possible presence of toxin a and b genes remnants was analysed by toxinotyping with negative results as well. therefore, it seems appropriate to perform whole genome sequencing analysis to verify the relationship of this isolate with c. difficile population and to examine its paloc insertion site organisation [ ] . it is reasonable to assume that a new genotype could be introduced in spain by an exotic animal species as has happened in the past with other c. difficile genotypes which have spread among different continents [ ] . in this study, . % toxigenic c. difficile strains were isolated from diarrhoeic dogs. since the ribotypes found in dogs are also commonly found in humans, it is possible fig. metronidazole susceptibility test of clostridium difficile d strain after h of incubation. gi, growth i; gii, growth ii that dogs may act as a source of contamination for human beings or vice versa. however, further studies are needed in particular to define the likely role of pets as vectors, especially in light of the spread of pet therapy practices. there is also a potential risk for the emergence of c. difficile strains resistant to the first line of antimicrobial drugs used for the treatment of cdi in people. metronidazole is widely used in dogs, thus animals treated with this drug could be a possible source of mdr strains for humans. clostridium difficile antimicrobial susceptibility surveillance programs should be advised in this animal species. exotic animals can harbour uncommon c. difficile strains, different than those already established in the country of destination. the molecular results observed for e c. difficile strain, which can be also found in companion animal species, prompt the need for genome sequencing analyses to study this unusual isolate. additional file : cdu -cdd pcr ( bp) agarose gel image from clostridium difficile field isolates. additional file : clostridium difficile field isolates and clostridium difficile atcc (positive control) toxinotyping in agarose gel. lanes - a fragment, kb: attc strain, e strain and negative control respectively; lanes - b fragment, kb: attc strain, e strain and negative control respectively; lanes - b fragment, kb: attc strain, e strain and negative control respectively. m: kb molecular mass (upper arrows point to kb fragment and lower arrows point to kb fragment) (jpeg kb) clostridium difficile infection: new developments in epidemiology and pathogenesis clostridium difficile in foods and animals: history and measures to reduce exposure risk factors for human disease emergence pcr ribotyping of clostridium difficile isolates originating from human and animal sources underdiagnosis of clostridium difficile across europe: the european, multicentre, prospective, biannual, point-prevalence study of clostridium difficile infection in hospitalised patients with diarrhoea (euclid) one health: zoonoses in the exotic animal practice shedding of clostridium difficile pcr ribotype by zoo animals, and report of an unstable metronidazole-resistant isolate from a zebra foal (equus quagga burchellii) evaluation of a routine diagnostic fecal panel for dogs with diarrhea the roles of clostridium difficile and enterotoxigenic clostridium perfringens in diarrhea in dogs enteropathogenic bacteria in dogs and cats: diagnosis, epidemiology, treatment, and control prevalence and distribution of clostridium difficile pcr ribotypes in cats and dogs from animal shelters in thuringia chronic diarrhoea in dogs associated with clostridium difficile infection genotypic and phenotypic characterization of clostridium perfringens and clostridium difficile in diarrheic and healthy dogs outbreak of clostridium difficile-associated disease in a small animal veterinary teaching hospital isolation of clostridium difficile from dogs with digestive disorders, including stable metronidazole-resistant strains antimicrobial susceptibilities of canine clostridium difficile and clostridium perfringens isolates to commonly utilized antimicrobial drugs recent advances in the understanding of antibiotic resistance in clostridium difficile infection antibiotic resistance patterns and pcr-ribotyping of clostridium difficile strains isolated from swine and dogs in italy analysis of metronidazole susceptibility in different clostridium difficile pcr ribotypes comparison of clostridium difficile isolates from individuals with recurrent and single episode of infection presence of clostridium difficile in pig faecal samples and wild animal species associated with pig farms an update on clostridium difficile toxinotyping multilocus sequence typing of clostridium difficile a simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences molecular analysis of three clostridium difficile strain genomes isolated from pig farm-related samples mega : molecular evolutionary genetics analysis version . for bigger datasets metronidazole resistance in clostridium difficile is heterogeneous highly divergent clostridium difficile strains isolated from the environment clostridium difficile in dutch animals: their presence, characteristics and similarities with human isolates clostridium difficile in faeces from healthy dogs and dogs with diarrhea survival of clostridium difficile and its toxins in equine feces: implications for diagnostic test selection and interpretation pan-european longitudinal surveillance of antibiotic resistance among prevalent clostridium difficile ribotypes international clostridium difficile animal strain collection and large diversity of animal associated strains possible seasonality of clostridium difficile in retail meat the occurrence and high diversity of clostridium difficile genotypes in rivers faecal shedding of antimicrobial-resistant clostridium difficile strains by dogs prevalence of pcr ribotypes among clostridium difficile isolates from pigs, calves, and other species clostridium difficile in food and domestic animals: a new foodborne pathogen more than % of clostridium difficile isolates from pet dogs in flagstaff, usa, carry toxigenic genotypes european society of clinical microbiology and infectious diseases: update of the treatment guidance document for clostridium difficile infection update on the diagnosis and management of giardia spp infections in dogs and cats antimicrobial susceptibility of animal and human isolates of clostridium difficile by broth microdilution sales of veterinary antimicrobial agents in eu/eea countries in . in: european surveillance of veterinary antimicrobial consumption evolutionary history of the clostridium difficile pathogenicity locus comparative analysis of an expanded clostridium difficile reference strain collection reveals genetic diversity and evolution through six lineages a new type of toxin a-negative, toxin b-positive clostridium difficile strain lacking a complete tcda gene clostridium difficile: new insights into the evolution of the pathogenicity locus emergence and global spread of epidemic healthcare-associated clostridium difficile performance standards for antimicrobial susceptibility testing; twentyfourth informational supplement. clsi document m -s tetracycline resistance gene tet(w) in the pathogenic bacterium clostridium difficile we very much appreciate the collaboration of laboratorios albéitar (zaragoza) and lourdes molina from veterinary diagnostic (barcelona). we also thank anabel sánchez bellido, eloisa sevilla, pablo magallón verde and yovana bolea albero for their technical assistance. this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. the datasets generated and/or analysed during the current study are available in the treebase repository, http://purl.org/phylo/treebase/phylows/ study/tb :s . the datasets generated and/or analysed during the current study are not publicly available due to the full clinical files from the animals whose samples were included in this work are confidential information (private diagnostic center), but are available from the corresponding author on reasonable request.authors' contributions rb and mct designed the study. mm analyzed and interpreted clinical dog data. sal performed bacterial culture and molecular analysis, interpreted the results and wrote the manuscript. ek conducted pcr-ribotyping analysis. imb performed molecular analysis. rcmj performed the statistical analysis and interpreted the results. rb, mct, rcmj, mm, jlb, ek and imb reviewed the work critically for important intellectual content. all authors read and approved the final manuscript.ethics approval and consent to participate not applicable. not applicable. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.• we accept pre-submission inquiries • our selector tool helps you to find the most relevant journal submit your next manuscript to biomed central and we will help you at every step: key: cord- -jkqg qal authors: dee, scott; clement, travis; schelkopf, adam; nerem, joel; knudsen, david; christopher-hennings, jane; nelson, eric title: an evaluation of contaminated complete feed as a vehicle for porcine epidemic diarrhea virus infection of naïve pigs following consumption via natural feeding behavior: proof of concept date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: jkqg qal background: since its initial detection in may , porcine epidemic diarrhea virus (pedv) has spread rapidly throughout the us swine industry. initially, contaminated feed was proposed as a risk factor for pedv; however, data were not available to support this theory. here we provide proof of concept of this risk by describing a novel means for recovering pedv-contaminated complete feed material from commercial swine sites and conducting an in vivo experiment to prove its infectivity. results: for on-farm detection of pedv rna in feed, paint rollers were used to collect material from at-risk feed bins from clinically affected breeding herds. this material was tested by pcr and determined to be positive for pedv-rna (ct = . - . range). to test infectivity, this material was pooled (ct = . ) and a treatment group of -week old pedv-naïve piglets were allowed to consume it via natural feeding behavior. for the purpose of a positive control, piglets were allowed to ingest feed spiked with stock pedv (ct = . ) while the negative control group received pedv-free feed. clinical signs of pedv infection (vomiting and diarrhea) and viral shedding were observed in both the positive control and treatment group’ post-consumption with virus and microscopic lesions detected in intestinal samples no evidence of infection was observed in the negative controls. conclusions: these data provide proof of concept that contaminated complete feed can serve as a vehicle for pedv infection of naïve pigs using natural feeding behavior. porcine epidemic diarrhea virus (pedv) is an enveloped single-stranded positive sense rna virus belonging to the order nidovirales, the family coronaviridae and the genus alphacoronavirus (saif et al. [ ] ). following detection in the us swine population during may, , the virus spread rapidly across the country and cases of porcine epidemic diarrhea (ped) have been confirmed in states as of may , [ , ] . while little information is known regarding the routes of pedv transmission between herds, potential risk factors include infected pigs, contaminated transport and pedv-positive aerosols [ ] [ ] [ ] . recently, contaminated feedstuffs have been proposed as a route of pedv transmission to naïve pigs but its current status is unclear [ ] . while an initial report from the canadian food inspection agency indicated that consumption of pedv-positive porcine blood plasma caused disease in pigs, a follow-up study could not demonstrate that the feed pellets (complete feed) containing the blood plasma in question were capable of causing disease [ , ] . despite this lack of evidence, dietary modifications to enhance the biosecurity of feed have been recommended to reduce this perceived risk [ ] . as more data regarding the risk of pedv transmission via complete feed are needed, we conducted a study to test the risk of pedv-contaminated complete feed using a novel on-farm sampling method for virus detection in feed along with an in vivo experiment (swine bioassay) using at-risk feed material. the study was based on the hypothesis that contaminated complete feed can serve as a vehicle for pedv infection of naïve swine. during the period of january - , , clinical porcine epidemic diarrhea was diagnosed in breeding herds following acute outbreaks of anorexia, diarrhea and vomiting in isolated groups of sows. these herds were part of an organized system of commercial pork production; farm a ( sows) was located in nw iowa, while farms b and c, sows and sows respectively, were located in sw minnesota. all herds emphasized strict biosecurity, using protocols previously validated to reduce the risk of prrsv infection [ , ] . once a diagnosis of pedv was confirmed, an investigation of each site was conducted to identify possible routes of viral entry. during the investigation, a consistent observation common to all herds was noted. specifically, from january - , , all farms experienced an unexpected feed outage which required an "emergency" delivery. the emergency delivery had been deposited into a designated external storage bin which sourced feed to a distinct subpopulation of the herd. following consumption of said feed, clinical signs became apparent only in the animals that had consumed this feed, i.e. no other signs were noted in other animals consuming other feed from other bins. based on this history, information regarding dates corresponding to recent feed deliveries, the location of the associated storage bin, the period of time between delivery of feed and clinical signs, the location of index cases in each farm, mill source and whether porcine byproducts were present in feed was collected during the investigation. in addition, all transport-related activities, diagnostic data pertaining to recent genetic introductions, and records of personnel and supply entry to each farm were reviewed. finally, as farms a and b were air filtered, an evaluation of filter integrity and inspection for the potential of air bypass (entry of non-filtered air through improperly sealed fans, etc.) was conducted. because of the potential link to feed, it was planned to sample the designated bin on each farm to determine whether pedv could be detected in "at-risk feed", which was defined as feed consumed by the index population. unfortunately, across all sites, the majority of feed defined as "at-risk" had been consumed, leaving the designated bins nearly (or completely) empty. however, upon inspection of the bin lumen it was observed that clusters of feed material (feed particles and feed dust) were adhered to the interior walls. to access this material, a modification of a published method for sampling contaminated transport for pedv rna was devised [ ] . specifically, synthetic woven paint roller pads, cm in length, . cm nap length (sherwin williams, cleveland oh, usa) were attached to . m extension poles to access the cylindrical surface area of interior bin walls at multiple heights. to minimize environmental contamination of the roller prior to placement within the bin interior, a . l plastic bag (ziploc, sc johnson & son inc, racine, wi, usa) covered the roller during ascension of the bin ladder. following insertion of the roller into the bin lumen, the bag was removed and the roller was drawn across the inner walls, forcing large quantities of the adhered feed material to attach to the pad. in addition, if stored feed was present in a bin, the pad was drawn across the top layer to collect more material. upon completion of sampling, the bag was replaced over the roller and the entire sampling apparatus was removed from the bin. once on the ground, ml of . % phosphate buffered saline was poured into the bag, immersing the pad and promoting absorption of liquid. using manual pressure, liquid was then forced from the pad into the bag and a ml aliquot was decanted into a ml plastic falcon tube (becton dickenson, franklin lakes, nj, usa) for diagnostic testing. in addition to the sampling of the "at risk feed bin" on each farm, an "on-farm control bin" was also sampled. control bins were located within m of the "at-risk bin" but had not received a recent feed delivery and animals consuming feed from these bins were not clinically affected. finally, to insure that the method did not generate false positive results, feed bins across pedv negative farms were also sampled. all samples were tested for the presence of pedv rna using a rt-pcr at the south dakota state university animal disease research and diagnostic laboratory (sdsu adrdl). a sample with a cycle threshold (ct) of less than was considered pedv positive. the swine bioassay component of this study was conducted in biosafety level + rooms at the animal resource wing (arw) at sdsu. all procedures involving animals throughout the study were performed under the guidance and approval of the sdsu institutional animal care and use committee. animals (n = , three-week old piglets) were sourced from a pedv-naïve herd and were tested on arrival to the arw via blood sampling and collection of rectal swabs from each pig. prior to animal arrival, all rooms (walls, ceilings, floors and drains) were monitored for the presence of pedv by pcr using sampling procedures previously described ( ) . in addition, feed was sourced from a pedv-naïve farm and screened by pcr prior to use. for the purpose of the swine bioassay, piglets were divided into groups and house each group in a pen within a designated room as follows: treatment group: piglets to be fed challenge material consisting of the pcr-positive feed bin samples from herds a, b and c. positive control group: piglets to be challenged with feed spiked with stock pedv [ ] . negative control group: piglets to be fed a placebo (feed + saline). the study encompassed an -day period with challenge (consumption of designated feed material) occurring on day , followed by days of diagnostic monitoring with necropsies conducted on day post-challenge. piglets were offered free-choice access to challenge material on day of the study, allowing for natural feeding behavior, rather than to administer the challenge via gavage. following iacuc approval, feed was withheld from all piglets for hours prior to challenge. for the preparation of challenge for the treatment group, grams of feed material from the pcr-positive bin samples from farms a, b and c was pooled and diluted in ml of sterile phosphate buffered saline. the solution was vortexed for minutes and then centrifuged at , g for minutes. the supernatant was used in the pcr extraction and was then mixed with grams of documented pedv-free feed. in the case of the positive control group, ml of stock pedv was added to grams of documented pedv-free feed. finally, for the negative control group, an equivalent quantity of saline was added to grams of pedv-negative feed. following consumption of challenge material, piglets were fed pedv-free feed ad libitum for the remainder of the study. following consumption of their respective challenge material on day , the pedv status in piglets across all groups was monitored over time. on a daily basis, arw personnel inspected animals for clinical signs of ped and collected samples as needed. personnel moved from the negative control group, to the treatment group to the positive control group every day. showers were taken between rooms and room-specific coveralls, footwear, hairnets, gloves and p masks were worn. in addition, each room was ventilated individually, and hepa filtration for both incoming and outgoing air was employed per room. if clinically affected animals were observed, rectal swabs (dacron swabs, fisher scientific, franklin lakes, nj, usa) were collected, along with swabs of any detectable diarrhea and vomiting. swabs were submitted to the sdsu adrdl and tested by pcr. on day of the study, animals were humanely euthanized with intravenous sodium pentobarbital and intestinal tracts submitted for pcr and immunohistochemistry (ihc) testing and microscopic evaluation. select samples were nucleic acid sequenced. all diagnostic testing was conducted using protocols developed and validated by the south dakota state university animal disease research and diagnostic laboratory. a commercially available real-time, single tube rt-pcr assay for the detection of pedv and tgev was used in this study per kit instruction (tetracore, rockville, md, usa). briefly, μl of the extracted rna was added to table temporal relationship between the delivery of "at-risk" feed and the onset of clinical ped in the index cases across the affected breeding herds μl of the master mix. the one-step real-time rt-pcr amplification conditions started with minutes at °c, followed by minutes at °c. the final cycles consisted of seconds at °c and then seconds at °c (data collection step). the program was run for cycles (cycle time) and the fam detector was used for pedv and the tamra detector was used for tgev. positive and negative controls were included on each run. all amplification was completed on the abi instrumentation (austin, tx, usa). a for select samples, it was planned to conduct nucleic acid sequencing of the pedv s gene. specifically, fragments of the s domain of the spike gene were amplified from extracted rna. product size of bp and primer pair and obtained a pcr product size of bp. fragments were assembled sing the vector nti software (life technologies, waltham, ma, usa) for a complete s domain. qiagen one-step master mix (valencia, ca, usa) was used per kit instructions with an annealing temperature of °c for seconds. immunohistochemistry slides were prepared using the standard sdsu adrdl ihc procedure, with the following modification being the use of pedv monoclonal antibody, of mouse ascites origin, courtesy of steve lawson, sdsu, at a : dilution. during the on-farm inspection, no obvious breaches in any of the biosecurity protocols were detected across all herds. no evidence of viral entry through genetic introduction, personnel error, contaminated transport or supplies were noted upon review of on-farm documentation. finally, no breaches in the air filtration system (filter integrity, air bypass etc.) were noted on farms a and b. in regards to feed, all herds received feed from different mills and diets contained corn, soybean meal, vitamins and trace minerals. no porcine by-products were included in any diet. upon review of the history, a temporal relationship between the delivery of at-risk feed and the onset of clinical signs in index cases was observed (table ) . across all herds, clinical signs were observed within days post-delivery of at-risk feed. in addition, index cases were isolated to isolated areas of each farm which only received at-risk feed. specifically, farm a cases were located in the exterior row of stalls in the east gestation room and in gilts housed in a single room in the developer facility. for farm b, index cases were located in the west farrowing room while the exterior row of stalls in the north gestation room housed index cases for farms c. assessment of feed material in the at-risk bins across the affected sites indicated the presence of pedv rna with ct values ranging from . - . (table ). in contrast, all samples from on-farm control bins and samples from bins on pedv-negative sites were pcr-negative. the in vivo phase of the study was conducted from january - and results are summarized in table . prior to initiation of the in vivo phase of the study, all samples from incoming piglets, arw facilities and feed were pcr negative. in regards to the treatment group, the pooling of feed material from farms a, b and c resulted in challenge material having a ct value of . . following challenge, clinical signs of diarrhea were observed in the index piglet in the treatment group on day post-ingestion. pedv-rna was detected in a rectal swab from this animal, along with swabs collected from diarrhea in the pen. this piglet continued to shed through the remainder of the study period and other piglet displayed clinical signs of diarrhea and vomiting on day post-ingestion (figures , and ). following euthanasia, rectal swabs and intestinal tract samples from all pigs were positive by pcr and ihc (figure ). in addition, microscopic evaluation of small intestinal tissues indicated re-epithelialization with diffuse villous blunting and fusion was noted ( figure ). in the positive control group, the ct of the stock virus used to spike its respective challenge feed was . . following consumption, shedding and clinical signs were observed in the index piglet on day post-consumption with subsequent evidence of viral shedding to other piglets on days and . similar to the treatment group, all rectal swab samples and intestinal tract samples were pcr and ihcpositive at necropsy, along with evidence of microscopic lesions. in contrast, clinical signs, viral shedding or pedv-positive intestinal tract samples were not observed in the negative control group. s pedv sequencing was completed on pcr-positive feed challenge material from both the positive control group and the treatment group, as well as an intestinal homogenate from the index piglet in the treatment group. the sequencing results of the intestine and the treatment feed material were similar, but different from the positive control sample, indicating intestinal infection from consumption of the feed material. the purpose of this paper was to provide proof of concept that complete feed that was contaminated with pedv could act as a vehicle for infection of naïve pigs. to accomplish this goal, we developed a novel means of figure presence of pedv antigen in a jejunal section from a treatment group piglet. this photomicrograph ( x) illustrates the presence of pedv antigen in multiple infected enterocytes following application of immunohistochemical staining. sampling at-risk feed material under controlled field conditions and conducted a swine bioassay to demonstrate transmission under controlled experimental conditions. under the conditions of this study, we successfully detected pedv rna in complete feed material across all sites and proved its infectivity using natural feeding behavior, a novel finding not yet reported. these results were strengthened through the inclusion of on-farm control feed bins and bins from naïve farms and the use of a negative control group and natural feeding behavior during the in vivo phase. the sequencing data also suggest that the intestinal infection in the treatment group resulted from ingestion of pooled feed material from the affected herds. an acknowledged limitation of the study was that the in vivo study was not designed to estimate the frequency of feed-related pedv infections. these results were based on very small populations of pigs and cannot be extrapolated to today's commercial farm conditions. however, the ability to complete a successful swine bioassay using a small number of animals cannot be ignored and the fact that our at-risk feed samples were collected from large commercial production sites adds to the credibility of this first attempt to investigate this risk factor. it was interesting to note the pattern of shedding (as detected by rectal swabs) in the treatment and positive control groups. despite the fact we employed small numbers of animals, shedding was first detected in an index case and spread occurred throughout the group of piglets and differences were observed between the groups. this suggests that when small groups are employed and/or field samples used for inoculation, the bioassay period may need to be extended to avoid the risk of false negative results. in closing, this is the first publication providing proof of concept of the risk of pedv-contaminated complete feed to naïve pigs. it was interesting to note that since neither feed source contained animal by-products, suggesting that contamination may have occurred post-processing, however, this was not proven. further studies should focus on understanding the possibility of post-processing contamination as well as evaluating the ability of intervention strategies, i.e. the application of heat and pressure through the pelleting process and/or the inclusion of select feed additives which may have anti-viral effects, for reduction of this risk. finally, it is the authors hope that the results from this study will assist in uniting the north american veterinary profession with the feed and swine industries as we collectively move forward in reducing the threat of this devastating transboundary disease. these data provide the initial proof of concept that contaminated complete feed can serve as a vehicle for pedv infection of naïve pigs. information from this study should be used to justify the need for further research towards the mitigation of said risk. the data set(s) supporting the results of this article is included within the article. diseases of swine isolation and characterization of porcine epidemic diarrhea viruses associated with the disease outbreak among swine in the united states usda aphis vs nvsl nahln umn swine health monitoring report: porcine epidemic diarrhea virus reporting prevalence of infections with enzootic respiratory and enteric virus in feeder pigs entering fattening units role of transportation in spread of porcine epidemic diarrhea virus infection, united states detection of porcine epidemic diarrhea virus in air samples at varying distances to epidemic farms in oklahoma american association of swine veterinarians and usda center for epidemiology and animal health: ped epidemiologic survey canadian food inspection agency: statement on porcine epidemic diarrhea virus in feed canadian food inspection agency: investigation into feed as a possible source of porcine epidemic diarrhea (ped) kansas state university applied swine nutrition team provides nursery diet options in response to pedv concerns use of a production region model to assess the airborne spread of porcine reproductive and respiratory syndrome virus use of a production region model to assess the efficacy of various air filtration systems for preventing the airborne transmission of porcine reproductive and respiratory syndrome virus and mycoplasma hyopneumoniae. results of a -year study environmental stability of a cell culture adapted u.s. isolate of pedv rd ipvs congress submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution the authors would like to recognize dr. michele mucciante and the animal resource wing team for their significant contributions to the success of this study. funding for this study was provided by pipestone applied research the authors declare that they have no competing interests.authors' contributions sd: developed study, co-wrote paper. tc: conducted molecular diagnostics, co-wrote paper. as: participated in on-farm collection. jn: participated in on-farm collection. dk: conducted pathological assessment of tissues and developed figures - . jch: provided critical review and revising of paper. en: provided virological expertise at the laboratory level and co-wrote paper. all authors read and approved the final manuscript. key: cord- - alsigxk authors: okda, faten; liu, xiaodong; singrey, aaron; clement, travis; nelson, julie; christopher-hennings, jane; nelson, eric a.; lawson, steven title: development of an indirect elisa, blocking elisa, fluorescent microsphere immunoassay and fluorescent focus neutralization assay for serologic evaluation of exposure to north american strains of porcine epidemic diarrhea virus date: - - journal: bmc vet res doi: . /s - - -z sha: doc_id: cord_uid: alsigxk background: recent, severe outbreaks of porcine epidemic diarrhea virus (pedv) in asia and north america highlight the need for well-validated diagnostic tests for the identification of pedv infected animals and evaluation of their immune status to this virus. pedv was first detected in the u.s. in may and spread rapidly across the country. some serological assays for pedv have been previously described, but few were readily available in the u.s. several u.s. laboratories quickly developed indirect fluorescent antibody (ifa) assays for the detection of antibodies to pedv in swine serum, indicating prior exposure. however, the ifa has several disadvantages, including low throughput and relatively subjective interpretation. different serologic test formats have advantages and disadvantages, depending on the questions being asked, so a full repertoire of tests is useful. therefore, the objective of this study was to develop and validate multiple improved serological assays for pedv, including an indirect elisa (ielisa); a highly specific monoclonal antibody-based blocking elisa (belisa); fluorescent microsphere immunoassays (fmia) that can be multiplexed to monitor exposure to multiple antigens and pathogens simultaneously; and a fluorescent focus neutralization assay (ffn) to measure functional virus neutralizing antibodies. results: a recombinant north american nucleoprotein (np) based ielisa was developed and validated along with a belisa using newly developed pedv-np specific biotinylated monoclonal antibodies (mabs) and an fmia using magnetic beads coupled with expressed na pedv-np. receiver operating characteristic (roc) analysis was performed using swine serum samples (ielisa n = , belisa n = , fmia n = ). the roc analysis for the fmia showed estimated sensitivity and specificity of . and . %, respectively. the ielisa and belisa showed a sensitivity and specificity of . and . %; and . and . %, respectively. inter-rater (kappa) agreement was calculated to be . between ielisa and ifa, . between belisa and ifa and . between fmia and ifa. similar comparative kappa values were observed between the ielisa, belisa and fmia, which demonstrated a significant level of testing agreement among the three assays. no cross-reactivity with the closely related coronaviruses, transmissible gastroenteritis virus (tgev) or porcine respiratory coronavirus (prcv) was noted with these assays. all three assays detected seroconversion of naïve animals within – days post exposure. the ffn assay allows relative quantitation of functional neutralizing antibodies in serum, milk or colostrum samples. conclusion: well-validated ielisa, belisa and fmia assays for the detection of pedv antibodies were developed and showed good correlation with ifa and each other. each assay format has advantages that dictate how they will be used in the field. newly developed mabs to the pedv-np were used in the belisa and for expediting ffn testing in the detection and quantitation of neutralizing antibodies. in addition, these pedv mabs are useful for immunohistochemistry, fluorescent antibody staining and other antigen-based tests. measurement of neutralizing antibody responses using the ffn assay may provide a valuable tool for assessment of vaccine candidates or protective immunity. porcine epidemic diarrhea virus (pedv) was first described in europe in the s with more recent and severe outbreaks in asia [ , ] . the virus was identified in the united states in may , causing severe diarrhea and vomiting in pigs across age groups, with high mortality of up to − % in suckling pigs [ ] . pedv is an enveloped, single stranded rna virus belonging to the coronaviridae family. the coronaviruses taxonomically form a subfamily (coronavirinae) within the order nidovirales. recently, the international committee on taxonomy of viruses (ictv) recognized four genera within the coronavirinae subfamily: alphacoronavirus, betacoronavirus, gammacoronavirus, and deltacoronavirus [ ] . pedv belongs to the genus alphacoronavirus along with other swine viruses including transmissible gastroenteritis virus (tgev) and porcine respiratory coronavirus (prcv). the genome is composed of a large~ kb molecule consisting of a ′ untranslated region (utr), a ′ utr, and at least seven open reading frames (orfs) encoding three nonstructural proteins: orf ab (pp a and pp ab) and orf , an accessory protein. the four major structural proteins of the mature virion include the spike (s) glycoprotein (mr - kda), the nucleoprotein (np) (mr - kda) that is associated with the positive stranded rna providing integral support for its helical structure, the glycosylated membrane protein (m) (mr - kda), and the glycosylated envelope protein (e) (mr kda) [ ] [ ] [ ] . coronaviruses are taxonomically assigned to different genera based on their rooted phylogeny and calculated evolutionary distance for seven highly conserved genomic domains within orf ab [ ] . the genetic diversity of coronaviruses may be due to their high frequency of recombination [ ] . the heterogeneity among coronavirus subfamilies is well documented [ ] , and the factors that contribute to pedv's ability to gain or lose parts of its transcriptome are believed to have contributed to quasispecies with novel traits that are able to adapt to new hosts, ecological niches and zoonotic events. the exact origin of pedv in north america is not entirely clear, but there is evidence of genetic similarities to chinese pedv strains [ ] . recently, a novel na pedv recombinant strain was identified (s indel) containing both insertions and deletions within the n-terminal domain of the orf and s genes. specifically, sequence alignment indicated spike gene nucleotide deletions at positions - that correspond to amino acid deletions at positions and in addition to substitutions at positions (i), (h), (k), and (e) as compared to the cv strain [ , ] . the relatedness of several pedv strains circulating in china was evaluated by li et al. [ ] using phylogenic analysis of the np gene and no insertions or deletions were noted. sequence comparison with other european and korean pedv strains obtained from genbank indicated that the np genes were highly conserved ( . − . %) even though these strains originated from different geographic regions [ ] . in addition to being highly conserved among pedv variants, the np is the most abundant viral protein expressed in pedv infected cells [ , ] . in contrast, the spike protein is presented on the viral surface and subject to various host immune pressures, which predisposes it to a greater range of genetic heterogeneity including insertions and deletions. because the np protein is highly abundant in virus infected cells, it provides an attractive target for the development of antigen-based serological assays. taken together, this evidence provided rationale for using it as our antigen of choice for the ielisa, belisa and fmia. in response to the recent outbreaks of highly virulent pedv in north america (na), pcr assays were quickly developed to detect the presence of pedv rna in intestine or fecal material. these assays provide an important tool in control of the virus; however, well-validated, high-throughput assays to detect antibodies following infection would provide additional valuable diagnostic tools for the swine industry. the ability to detect and evaluate antibody responses using serologic tests is important in efforts to answer basic production related questions. these questions may include whether a production site is naïve or has historically experienced a pedv exposure, even though a producer has not seen obvious clinical signs; the level of immune response sows may have in relation to vaccination, initial wildtype virus infection or intentional feedback exposure; and whether sow immunity is inadequate when clinical infection occurs in individual litters after initial pedv exposure in a herd. one of the most pressing issues of pedv disease is maintaining herd site biosecurity through exclusion measures to prevent viral entrance into swine units. however, pedv infection may not always be obvious in finishing pigs so the widespread transport of these animals may represent additional risks. thus, sensitive serological tests provide a valuable tool in the detection of recent infection to avoid the introduction of these animals into naïve herds. since pedv was widespread in europe in the s and s and more recently in asia, various serologic tests have been developed and subjected to varying degrees of validation [ ] [ ] [ ] [ ] [ ] [ ] [ ] . however, few assays have been developed using antigens associated with contemporary strains currently circulating across na. the need to develop more sensitive serological assays has become paramount in order to address questions regarding pedv infections and epidemiological transmission patterns, as well as to analyze disease progression. currently, serum virus neutralization (svn) tests are the most widely employed serological assays used to detect pedv antibodies. it is a test that is highly specific and useful for screening of antibody titer post vaccination [ , ] . however, the test is expensive and labor intensive, requiring manual reading and interpretation of virus induced cytopathic effect (cpe) endpoints. moreover, serum cytotoxicity can be mistaken for viral cpe, giving rise to false interpretations at lower serum dilutions. several laboratories have generated in-house indirect elisas using either virus derived antigen or recombinant structural proteins. early indirect elisas were developed using vero cell derived, whole virus preparations [ , ] or vero cell expressed viral proteins [ ] . these methods may be problematic because serum from animals vaccinated with cell culture derived pedv may cross-react with cellular components of elisa antigen, causing low specificity and high background. other groups have used recombinantly expressed, purified, structural s and np proteins for ielisa serodiagnosis, but because low numbers of experimentally derived samples were used to evaluate the performance of the assay, full validation of the diagnostic sensitivities and specificities could not be assessed [ , ] . both the ielisa and belisa formats have proven useful for the serodiagnosis of experimental and natural infections. blocking or competitive elisas have been shown to be especially useful where a higher level of specificity is required. the increased specificity has been shown to be dependent on both the isotype and on the target specificity of the monoclonal or polyclonal antibodies [ , , ] . various laboratories have developed sensitive blocking elisas, and carvajal et al. [ ] demonstrated their belisa was able to detect an antibody response to days earlier than ifa, which suggested higher sensitivity of the belisa. in addition, the belisa is valuable as a confirmatory test where unexpected positive results appear in presumably negative herds. the fluorescent microsphere immunoassay is based on fluidic, particle array technology (luminex corp., austin, tx) and has become increasingly standardized and accepted in applications involving the serologic diagnosis of autoimmune and animal infectious diseases [ , ] . there are distinct advantages of the fmia over the elisa, which include higher sensitivity, higher sample throughput analysis, and the ability to multiplex and monitor exposure to multiple pathogens simultaneously in a single sample. in addition, multiple bead sets in the fmia could be added to a standardized assay against newer virus subtypes that continue to emerge in the field or to assess antigenic/phylogenetic differences between genera of coronaviruses. in this study, we report the adaptation of a recombinant, highly purified, na pedv-np antigen to the development of ielisa, belisa and fmia platforms for the detection of pedv antibodies in serum. these assays provide high throughput serological tests designed to address pedv disease diagnostics. they were fully validated using a large number of serum samples of known status, and validation of the tests was detailed using methods for the validation of serological assays for the diagnosis of infectious diseases previously described by jacobson for the office international des epizooties [ ] . in addition, a fluorescent focus neutralization (ffn) assay was developed for the rapid evaluation of neutralizing antibody responses. procedures involving animals were approved by the south dakota state university institutional animal care and use committee (iacuc) under approval numbers - a and -a . time course swine serum samples provided by kansas state university were part of a separate pedv challenge study conducted at the biosecurity research institute approved by the kansas state university institutional animal care and use committee. all other serum samples were obtained as routine diagnostic sample submissions at the south dakota adrdl. for time course studies, serum samples from experimentally infected animals were obtained courtesy of dr. richard hesse (kansas state university veterinary diagnostic laboratory, national pork board grant # - ). thirty-three pedv naïve -week-old feeder pigs were obtained from a private, high-health status swine production farm. . of the pigs, were inoculated with pedv at weeks of age via intranasal and oral routes with a pool of gut derived intestinal contents that had been used as "feedback" inocula for controlled exposure of a sow herd. serum was collected prior to challenge and at days , , , , , , and days post-infection (dpi). multiple aliquots of all samples collected were shared with requesting laboratories to expand diagnostic testing and vaccine development capabilities. to accurately assess the diagnostic sensitivity and specificity of the assays, samples of known serostatus for pedv were used. this included sera from multiple animal populations including experimentally infected animals and serum samples from animals with known historical exposure to pedv that were submitted to the south dakota animal disease research and diagnostic laboratory (adrdl). pedv negative sample sets included samples from pedv negative control pigs used in experimental studies and selected high biosecurity herds with no history of pedv. in addition, archived serum samples collected prior to the emergence of pedv in the u.s., including samples testing positive for the related swine coronaviruses tgev and prcv (n= > ), were used. the exact number of positive and negative sera used for sensitivity and specificity calculations per assay with statistical testing agreement calculations based on serum numbers is listed in table . the majority of these sera were identical among assays, but limited serum volume did not allow for use of all sera samples among all assays. the development and validation of the ielisa and belisa made use of a recombinantly expressed full length na pedv-np. the np open reading frame (orf) of pedv was amplified from rna extracted directly from intestinal contents by rt-pcr from a case submitted to the south dakota adrdl. it was subsequently directionally cloned into the e. coli, pet a(+), plasmid expression vector (novagen, madison, wi), then transformed into bl -codon plus (de )-rp competent cells (stratagene, la jolla, ca) for protein expression. primers used for the amplification of the full length ( bp) nucleoprotein were: pedv-np-fwd ( ′-cg cggatccatggcttctgtcagttttcag- ′); ped v-np-rev ( ′-cacactcgagatttcctgtgtcgaa gatctc- ′). next, μl of transformed cells were plated onto luria-bertani agar plates containing μg of kanamycin/ml and incubated overnight. the following morning, colonies from the agar plates were added to l of pre-warmed x yeast extract tryptone (yt) culture medium containing μg kanamycin/ml and allowed to grow to an od of . at °c. pedv-np expression was induced using isopropyl β-d- -thiogalactopyranoside (iptg) at a final concentration of . mm to induce transcription of the lac operon, and the e. coli was allowed to incubate for an additional h at °c with shaking at rpm. the agar was strained out and bacteria pelleted by centrifugation at , g for min at °c. the pellet was resuspended in ml of lysis buffer solution (b-per, pierce, rockford, il), incubated for min at - °c, then centrifuged at , g to separate the soluble from insoluble proteins. the pedv-np recombinant protein was expressed as insoluble periplasmic inclusion bodies. the resulting amino acid recombinant protein was denatured using m urea, subsequently purified three times using nickel-nta affinity column chromatography and refolded back to its native conformational state. individual affinity column elutions were collected, pooled and confirmed by sds-page, then aliquoted/frozen at − °c. the correct nucleotide sequence was confirmed by sequence and restriction endonuclease analysis. the average protein yield produced by the pet a-pedv-np plasmid construct was calculated to be mg pedv-np per liter of xyt under the aforementioned conditions. the recombinant protein was detected and a predicted molecular weight of kda was confirmed via western blotting using convalescent sera, a x histidinespecific mab (novagen, madison, wi) and a pedv-np specific mab (figs. and ). two separate mabs were developed in our laboratory (sd - and sd - ) that recognize both the native conformation of the pedv-np and the full length, linear, recombinant protein used in all antibody capture assays. hybridomas were produced as previously described [ , ] . immunoglobulin isotyping of the resulting mabs was performed using a commercial lateral flow assay (serotec, raleigh, nc). subsequently, mouse ascites fluid was produced in pristane-primed mice, and the antibodies were purified and biotinylated for use as the detection moiety for the belisa [ ] . the conjugated antibody solution was quantified via the lowry protein method, and carrier bsa was added to a final concentration of mg/ml, then aliquoted and stored at − °c. after h of incubation at °c, plates were rinsed x with pbs and examined using fluorescent microscopy. for each individual test, each pedv infected well was compared to its respective uninfected partner well, and a positive sample was indicated if a pedv specific fluorescent signal was observed at a serum dilution of : or greater. all samples were tested in duplicate, and the antibody titer was expressed as the mean of all replicates. ielisa the serological pedv-np indirect elisa was performed by coating alternate wells of immulon b, -well, microtiter plates (thermo labsystems, franklin, ma) with ng/well of purified, recombinantly expressed pedv-np antigen. the optimal dilution of the recombinant protein and secondary detection antibody was determined by a checkerboard titration that gave the highest signal to noise ratio. in addition, a single lot of pooled convalescent serum from pedv infected pigs was used to generate quality control standards that gave high and low optical density (high od = . to . ; low od = . to . ; and negative od < . ). pedv-np recombinant protein was diluted to . μg/ml in mm sodium carbonate- mm sodium bicarbonate-antigen coating buffer (acb) ph . . odd-numbered columns were coated with μl of acb plus antigen, while the evennumbered columns were coated with acb without antigen, serving as background control. the plates were incubated for one hour at °c, then washed x with pbs plus . % tween (pbst). each well was then blocked with μl of sample milk diluent (pbst plus % nonfat dry milk, (smd)) and allowed to incubate overnight at °c. the following day, the plates were washed x with μl of pbst. test and control sera were diluted / in smd, mixed, and μl of the solution was added to each well. the plates were incubated for h at - °c. next, μl of biotinylated, goat anti-swine detection antibody (bethyl laboratories, tx) was added at a concentration of ng/ml of pbst and allowed to incubate at - °c for h. the plate was washed x with μl of pbst, then μl of streptavidin-hrp conjugate (pierce, rockford, il) was added and incubated for another hour at - °c, then washed and developed with , ′, , ′-tetramethylbenzidine, peroxidase substrate (tmb) (surmodics, eden prairie, mn). color development progressed until the positive control attained a standard od and was stopped using n h so . colorimetric development was quantified spectrophotometrically at nm with a elx microplate reader (biotek instruments inc., winooski, vt) controlled by xcheck software (idexx laboratories, westbrook, me). the raw data was normalized and transformed into an excel spreadsheet. sample to positive (s/p) ratios were calculated using the following formula: s/p = optical density (od) of sample -od of buffer/od of positive control -od of buffer. belisa the serological belisa was performed using immulon b, -well microtiter plates (thermo labsystems, franklin, ma). alternate wells of each plate were coated with ng per well of expressed pedv-np antigen. the optimal dilution of the recombinant protein and mab antibody was determined by a checkerboard titration that gave the highest signal to noise ratio with an od reading of approximately . , in the absence of swine serum/competitor antibody. first, pedv-np recombinant protein was diluted to . μg/ml of acb. odd-numbered columns were coated with μl of acb plus antigen, while the even-numbered columns were coated with acb without antigen serving as background control. the plates were incubated for h at °c, washed times with pbst, then placed at °c overnight. the following day, each well was blocked with μl of smd and incubated one hour at °c. plates were washed times with pbst, and μl of test and control sera were diluted / with pbst + . % nonfat dry milk and added to each of the duplicate wells. plates were incubated h at °c. during sample incubation, pedv-np specific biotinylated, mabs (sd - and sd - ) were adjusted to equal titers and mixed together in a : ratio. next, μl of a : , dilution of the antibody detection mixture was added to the microtiter plate containing the competitive swine antibody, then swirled and incubated for an additional min at °c. the plates were washed times, and μl of high sensitivity, streptavidin-horseradish peroxidase conjugate (pierce, rockford, il) was added to all wells of the microtiter plate for h at °c. plates were washed times with pbst, and μl of tmb was added to all wells and gently swirled. after ap-proximately min, color development progressed until the negative control attained a standard od of approximately . and was subsequently stopped using n h so . colorimetric development was quantified spectrophotometrically at nm with an elx microplate reader (biotek instruments inc., winooski, vt) controlled by xcheck software (idexx laboratories, westbrook, me). the raw data was normalized and transformed into a excel spreadsheet, and the percent inhibition (pi) ratio was calculated using the following formula: pi = -{(od of sample -od of buffer)/(od of negative control -od of buffer)} x . a two-step carbodiimide coupling procedure was used to couple na pedv-np protein to luminex™ microspheres. briefly, the coupling of fluorescent microsphere was performed by washing . × microspheres twice with μl activation buffer ( . mnah po , ph . ) and sonicating them for s after each wash. microspheres were activated for min at - °c in μl activation buffer containing . mg n-hydroxysulfosuccinimide (sulfo-nhs) and . mg n-( dimethylaminopropyl)-n-ethylcarbodiimide (edc) (pierce chemical, rockford, il). activated microspheres were washed twice with pbs and sonicated. coupling was initiated by the addition of . μg of recombinant na pedv-np protein, brought to a final volume of μl with pbs and incubated in the dark for h at - °c with rotation. coupled microspheres were washed once with ml of pbs plus . % nan and . % bovine serum albumin (pbs-nb). next, the microspheres were blocked with ml of pbs-nb for min to reduce nonspecific binding. microspheres were then washed twice with pbs-nb and resuspended in pbs-nb to a final concentration of . × antigen-coupled microspheres/ml. a -well hydrophilic membrane filter plate was blocked for min with μl of pbs-nb, and then the liquid was aspirated via vacuum manifold. the plates were wetted with μl of pbs-nb buffer to prevent drying. next, μl of serum (diluted : in pbs-nb) was added to duplicate wells of the filter plate along with μl of pbs-nb containing . × antigen-coupled microspheres. since the microspheres and reporter moieties are light sensitive, all incubations were performed in the dark by sealing the plate with foil. subsequently, the fmia plate was incubated at - °c for h on a plate shaker rotating at rpm. the plate was washed times with μl of pbst. next, μl of anti-swine, biotinylated iga (heavy & light chain, diluted in pbs-nb; bethyl laboratories) or igg-fc specific polyclonal antibodies (diluted : , dilution in pbs-nb; bethyl laboratories) were added to the filter plate and incubated at - °c for h. np igm and igg isotypespecific antibody levels were detected using pedv-np coated microspheres, but speciated by means of individual and separate igm and igg-specific secondary antibodies. since validation was performed using serum, and because iga is present in very low amounts, iga specific secondary antibodies were not used at this step. after incubation with the secondary antibodies, μl of streptavidin phycoerythrin ( . μg/ml in pbs-nb, molecular probes) was added to each well and incubated for min at - °c with shaking. the supernatant was aspirated, and the plate was washed times with pbst. finally, the microspheres were resuspended in μl of pbst per well and transferred to a clear -well polystyrene optical plate. coupled microspheres were analyzed through a dual-laser bio-rad bio-plex instrument. the median fluorescent intensity (mfi) for microspheres corresponding to each individual bead analyte was recorded for each well. all reported mfi measurements were normalized via f -f , where f was the background signal determined from the fluorescence measurement of a test sample in uncoated beads and f was the mfi for a serological test sample using antigencoated beads. four serological reference serum sets were constructed as standards termed high, medium, low and negative to serve as internal quality control standards and to mathematically normalize individual samples for objective comparisons between testing platforms. the high-labeled standard was designed to generate an od above . for the ielisa and belisa and an mfi of approximately , for the fmia. the high standard was used exclusively for the mathematical determination of the serological response (s/p ratio) of samples used for test validation. the medium standard generated a response of between . and . od for the two elisas and approximately , mfi for the fmia. the low standard was designed to deliver a signal slightly above threshold level for all tests, and the negative serum generated an od or mfi to a background level of less than . od for the elisas and mfi for the fmia. validation methods for the determination of diagnostic sensitivity, specificity, repeatability and threshold cutoff level to accurately assess the diagnostic sensitivity and specificity of the assays, samples of known serostatus for pedv were used. this included sera from multiple animal populations including experimentally infected animals and serum samples submitted to the south dakota adrdl. pedv negative sample sets included samples from selected high biosecurity herds with no history of pedv and archived serum samples collected prior to the emergence of pedv in the u.s., including samples testing positive for the related swine coronaviruses tgev and prcv. known positive samples were collected from pigs that were naturally infected at least weeks prior to collection and were previously positive by pcr. the negative-testing sample population (uninfected animals) consisted of maximally pedv negative serum samples, while the positive-testing (infected) population was composed of serum samples. receiver operating characteristic (roc) analysis was calculated for each assay to assess diagnostic performance, which included determination of sensitivity, specificity and threshold cutoff using medcalc version . . . (medcalc software, mariakerke, belgium). the repeatability of each assay was assessed by running the same internal quality control serum standards in multiple replicates within the same run or between runs. for the ielisa and the belisa, the intra-assay repeatability was calculated for replicates on separate plates, then repeated over a -day period for inter-assay repeatability assessment. the values for each assay were expressed as a mean, standard deviation and percent coefficient of variation (cv%) for repeated measure. multiple comparison, inter-rater agreement (kappa measure of association) was calculated among all four tests (belisa, ielisa, fmia and ifa) using ibm, spss version software (spss inc., chicago, il). the sample cohort used was a well-characterized set of serum samples collected from "positive testing" experimentally infected pigs over time courtesy of dr. richard hesse (n = ) and from archived experimental control uninfected pedv "negative testing" animals. the interpretation of kappa can be rated as follows: kappa less than . , "poor" agreement; between . and . , "slight" agreement; between . and . , "fair" agreement; between . and . , "moderate" agreement; between . and . , "substantial" agreement; and between . and . , "almost perfect" agreement [ , ] . a pedv virus neutralization assay using a ffn format was developed for rapid detection of neutralizing antibodies produced in response to pedv infection. the ffn was evaluated using serum samples or rennet treated milk and colostrum samples. heat-inactivated samples were diluted in a -fold dilution series starting at : in mem plus . μg/ml tpck-treated trypsin in -well plates. an equal amount of cell culture adapted pedv stock at a concentration of foci forming units/ μl was added to each well and plates incubated for h at °c. the virus/sample mixture was then added to washed confluent monolayers of vero- cells and incubated for h at °c. plates were washed again with mem/tpck-trypsin medium and incubated - h to allow for replication of non-neutralized virus. plates were then fixed with % acetone and stained with fitc conjugated mab sd - to allow visualization of infected cells. endpoint neutralization titers were determined as the highest serum, milk or colostrum dilution resulting in a % or greater reduction in fluorescent foci relative to controls. as shown in fig. , the purity of the recombinant protein was assessed via sds-page and gave a band that migrated corresponding to the expected molecular mass of kda upon staining with coomassie brilliant blue r . the protein yield of the iptg induced e. coli culture was calculated to be approximately mg pedv-np/liter of xyt medium with a purity of greater than %. the identity of the protein was further characterized by western blot using convalescent swine serum, an anti-his mab and an anti-pedv-np mab (fig. ) . to optimize the serologic assays, various antigen and serum dilutions were used to determine optimum concentrations. all tests were optimized in a checkerboard fashion to maximize signal-to-noise ratios. it was determined by antigen titration that the optimal coating of luminex™/fmia microspheres was achieved at a concentration of . μg protein per . × microspheres. similarly, the optimum coating of both the ielisa and belisa plates was achieved at a concentration of ng/well. in addition, to determine the optimum serum dilution for each of the testing platforms, a well-characterized pedv "high" positive serum standard was serially diluted in a log titration against antigen coated microspheres (fmia) or antigen coated elisa wells at a fixed concentration. figure shows concentration-dependent od or mfi signals of various serum standards. overall, sample absorbance increased inversely proportional to the serum dilution. however, based upon the highest signalto-noise ratio, it was determined that the optimal serum dilution for the belisa was / , while the ielisa and fmia each demonstrated an optimum dilution of / as indicated by arrows (fig. ) . roc analysis to determine sensitivity, specificity and threshold cut-off levels was performed using large numbers of swine serum samples and demonstrated excellent agreement (> . kappa scores) between assays with good intra and inter assay repeatability ( table ) . none of the known positive tgev or prcv samples tested was shown to cross-react. the optimal cutoff values and corresponding sensitivity and specificity of each individual test are presented in fig. . specifically, roc analysis for the ielisa and belisa showed similar sensitivity and specificity of . and . %; and . and . %, respectively. the roc analysis for the fmia showed estimated sensitivity and specificity of . and . %, respectively. although the fmia showed an identical sensitivity as the belisa, it demonstrated the highest degree of specificity of all three assays at . %. this observation was not surprising given that fmia technology inherently imparts greater sensitivity and a larger dynamic range than the elisa platform [ ] . in addition to determining cutoff values, sensitivities and specificities, multiple comparison tests were performed to calculate the degree of agreement among the elisa, fmia and ifa tests. specifically, the kappa test demonstrated all diagnostic platforms had kappa values greater than . , which demonstrates that all tests are in "almost perfect" agreement with each other. the ielisa and belisa demonstrated slightly lower %cvs than the fmia with . %, . %, . % intra-assay variability for belisa, ielisa and fmia respectively. inter-assay %cvs were . , . and . % for the belisa, ielisa and fmia respectively. nonetheless, all the cvs were . % or less, which demonstrated that the tests were highly repeatable in a diagnostic application. as shown in fig. , a mean antibody response to pedv-np could be detected as early as dpi for both the ielisa and belisa. the fmia detected pedv-np antibodies slightly earlier at dpi. all tests detected the duration of antibody out to the dpi time-point in this study but demonstrated a decline in detectable antibody after dpi. high levels of pedv-np specific igm antibodies were observed at dpi compared to igg (fig. ) . however, the igm antibodies decreased to barely detectable levels by dpi. igg continued to increase linearly to dpi. there is a concomitant appearance of neutralizing antibodies by dpi. the ffn assay was initially evaluated using sequential serum samples from experimentally inoculated piglets. additional evaluation was conducted using serum samples from known pedv naïve herds and samples from herds with documented pedv exposure, collected at least weeks after initial pcr diagnosis and whole herd feedback. experimentally inoculated piglets demonstrated detectable seroconversion by dpi (fig. ). essentially all samples from pedv naïve animals had serum ffn endpoint titers of < : while most samples from the pedv positive set had endpoint titers ranging from : to : (data not shown). further evaluation of the ffn included serum, milk and colostrum samples from sows from a herd that had experienced an acute pedv outbreak to weeks prior to farrowing. all animals were exposed to live virus twice within the first week of the outbreak, followed by one dose of harrisvaccines porcine epidemic diarrhea vaccine, rna (harrisvaccines, inc., ames, ia) at week pre-farrow. serum and colostrum samples were tested at the time of farrowing, followed by serum and milk samples at week and weeks later. as shown in fig. , mean colostrum titers were approximately -fold higher than serum titers at the time of farrowing. at later time-points, serum and milk titers were similar in magnitude, although substantial animal to animal variation was apparent. overall, this repertoire of assays is useful for initial identification and efficient, high throughput quantitation of pedv antibodies. we evaluated all three diagnostic platforms against a well characterized ifa and compared the individual serum igm and igg kinetic antibody responses in an fmia to the appearance of neutralizing antibody as detected by the ffn assay. each of the antibody-capture assays was validated using a large number of serum samples (n > ) based upon the assay validation methods of jacobson, which is supported by the office international des epizooties [ ] . since pedv was first identified in the u.s. in may , it has spread rapidly to at least states (www.aasv.org) and has been reported in mexico and canada [ ] . the virus causes severe gastroenteritis, destroying villus enterocytes in pigs of all ages, and is characterized by vomiting and diarrhea, leading to subsequent dehydration, high mortality rates and economic losses, particularly in nursery piglets [ , ] . a variety of serological tests have been developed against pedv, but they vary by antigen used and in the degree of validation. in addition, few have used north american np based antigens or compared the array of serologic assays described here. in the current study, four tests (ifa, belisa, ielisa, fmia) showed strong correlation. each has advantages, which dictate how they will be used in the field. in addition, newly developed np mabs were used in the belisa and for expediting ffn testing in the detection of neutralizing antibodies. in the development of the elisas and fmia, the full length na pedv-np gene was amplified directly from rna extracted from pedv-infected ileal tissue. multiple sequence alignment analysis showed that the amplified np gene shared a % nucleotide homology with that of the us colorado strain isolated in (genbank accession no. - ). several authors confirm that the np carries multiple antigenic determinants that are conserved among the coronaviridae [ , ] . however, we performed one-way cross-reactivity testing using serum from tgev and prcv, and no antibody crossreactivity was detected within any of our assays. in addition to being highly conserved among various pedv variants, the np is the most abundant viral protein expressed in pedv infected cells, making it an attractive target antigen [ , ] . using western blotting experiments, we confirmed the finding of hou et al. [ ] , in which they observed the level of expression of np protein to be significantly higher than the level of the spike protein. our study demonstrated that it is possible to achieve a protein yield of over mg per liter of culture with a purity of greater than %. the recombinant np has previously been identified as a useful antigen in other elisas developed to detect antibodies in pigs located in china and korea [ ] . in a study by hou et al. [ ] , the authors showed similar sensitivities and specificities of their ielisa compared to the ielisa described in this study. however, smaller numbers of known positive and negative samples were evaluated than in the current study. since no test has % specificity, a belisa was developed that is useful for confirmatory testing due to its higher inherent specificity than the ielisa [ ] . blocking or competitive elisas have been constructed using monoclonal antibodies in pedv serodiagnosis, and the specific methodology can affect the overall specificity and performance of the assay. our method was based upon coating plates with highly purified na pedv-np, then using a combination of two separate na, anti-pedv-np specific, biotinylated, monoclonal antibodies as the blocking/competitive detection step. this allows the capture of anti-np antibodies at higher quantities and those with a greater range of antigen specificities. the analytical specificity of the np-based belisa is also dependent on the affinity of the mabs used. the antibodies used in this study are directed against conserved epitopes on the nucleocapsid protein without any evidence of cross-reactivity to any other genera of alphacoronavirus tested. a previous assessment of antigenic cross-reactivity was performed using these same mabs against different strains of pedv and tgev [ ] . in that study, the authors reported that both mabs used in the belisa reacted with all pedv strains tested, namely the homologous us isolate pc a and the heterologous strains s indel iowa , s del pc and cv , at similar titers. neither of the pedv-np mabs cross-reacted with either the tgev miller or purdue strains. not only were the belisa mabs tested for heterologous cross-reactivity, but all three diagnostic platforms were evaluated in their ability to capture antibody against tgev and prcv, and there was no cross-reactivity to either heterologous virus. serology testing with ifa, ielisa, belisa or fmia is useful in determining whether pigs were previously infected with pedv, or if piglets have acquired antibodies through colostrum (eg. passive antibody transfer). however, tests that evaluate the functionality of the antibodies such as the ffn are needed to determine if the detected immune response could be helpful in providing protection to nursing piglets. neutralizing antibodies may be protective through actions including blocking uptake of the virus into cells, preventing virus binding to receptors on cells, preventing uncoating of the virus genomes in endosomes and/or causing aggregation of virus particles. for enveloped viruses, such as pedv, lysis of the virus may also occur when antiviral antibodies and serum complement disrupt the viral membrane. for these reasons, an ffn-based virus neutralization assay was developed to assess levels of pedv neutralizing antibodies in serum, milk or colostrum samples. the ffn provides a more rapid determination of neutralizing antibody levels than is possible with traditional virus neutralization assays that rely on visualization of virusinduced cpe after three or more days incubation to allow for full development of pedv cpe. the direct observation of fluorescent stained infected cells, or lack of stained infected cells in the case of virus neutralization, allows for simple endpoint determination. this feature is particularly valuable when dealing with a fastidious, trypsin-dependent virus such as pedv where cpe-based endpoints may not be obvious or may be confused with trypsin-induced cpe in the cell monolayer. although neutralizing antibodies present in the serum would not be expected to provide direct protection from a strictly enteric infection such as pedv, our data suggest a correlation between detectable neutralizing antibody levels in the serum and those present in milk and colostrum of previously exposed or vaccinated sows. some correlation between pedv neutralization results and elisa results exists as described in the literature. one study performed a comparative analysis between a whole-virus antigen elisa and a serum neutralization test for the serodiagnosis of pedv [ ] . the presence of antibodies was confirmed by each test, and an overall testing agreement of . % was demonstrated using field serum samples. furthermore, a pairwise correlation was performed that showed corrected cutoff values between the elisa od and sn titers having an r value of . , indicating that the cpe-based neutralization test had roughly the same reliability as the elisa test [ ] . newer technologies such as the fmia are useful for the detection of antibodies against multiple antigens simultaneously for surveillance purposes. fmia are bead based assays for simultaneous high throughput detection of antibodies to multiple antigens. the fmia differs from the elisa since it involves a fluid incubation step with "beads suspended in solution, which allows for higher surface area exposure in dimensions" [ ] . therefore, there is a shorter diffusion path to antibody binding sites on the antigen coated beads resulting in rapid reaction times. instead of a method using an enzymatic reaction such as with the elisa, the fmia detection is with laser technology, which results in a shorter detection time. this pedv antigen specific bead set can be "mixed" with additional coated beads to other antigens, such as siv, pcv , prrsv or other pathogens, for simultaneous detection of antibodies to these antigens. in addition, an fmia could be developed for differentiation of wild-type infected vs vaccinated animals (diva) if proteins used in the vaccine were different from those produced in a wild-type infection. individual kinetic serum igg and igm levels were measured by fmia in experimentally infected animals over time. the appearance of the igm subclass is considered an immunological parameter of early infection and generally appears prior to the appearance of igg, and this was confirmed in our study. this was in contrast to the data of woo et al. [ ] , which was unable to detect igm antibodies using their np-based indirect elisa. igg antibodies may be more easily detected as they are characterized by higher antigen affinity but lower avidity than igm [ ] . further understanding of various antibody profiles will provide important information on the ability of vaccines to stimulate a protective immune response. these well-validated na pedv ielisa, belisa, fmia and ffn assays are useful for a range of serological investigations. they can serve as a complement to nucleic acid detection and determine the pedv status of asymptomatic individuals for cost-effective tools in management strategies and monitoring virus exposure within the herd. the fmia will be useful for isotyping the antibody responses and in multiplexing for determining exposure to multiple pathogens simultaneously. in addition, the ffn is useful for determining whether the antibodies measured are providing a biological function of blocking virus infectivity. work is ongoing to further validate these assays on other sample matrices such as milk and colostrum for measuring passive transfer of antibodies and oral fluids for pen-based surveillance. porcine epidemic diarrhea virus; ifa: immunofluorescent assay; ielisa: indirect enzyme linked immunosorbent assay; belisa: blocking enzyme linked immunosorbent assay; fmia: fluorescent microsphere immunoassay; ffn: fluorescent focus neutralization; orf: open reading frame; utr: untranslated region tgev: transmissible gastroenteritis virus; prcv: porcine respiratory coronavirus; na: north american; cpe: cytopathic effect; dpi: days post-infection; adrdl: animal disease research and diagnostic laboratory sodium dodecyl sulfate-polyacrylamide gel electrophoresis iacuc: institutional animal care and use committee; hat medium: hypoxanthine-aminopterin-thymidine medium; dmso: dimethyl sulfoxide; bsa: bovine serum albumin fbs: fetal bovine serum; nvsl: national veterinary services laboratories moi: multiplicity of infection; tpck: l- -tosylamide- -phenylethyl chloromethyl ketone; fitc: fluorescein isothiocyanate; acb: antigen coating buffer; smd: sample milk diluent; hrp: horseradish peroxidase ′-tetramethylbenzidine; pi: percent inhibition; mfi: median fluorescent intensity; siv: swine influenza virus; pcv- : porcine circovirus type ; prrsv: porcine reproductive and respiratory syndrome virus evaluation of antibody response of killed and live vaccines against porcine epidemic diarrhea virus in a field study experimental infection of pigs with a new porcine enteric coronavirus, cv emergence of porcine epidemic diarrhea virus in the united states: clinical signs, lesions, and viral genomic sequences ratification vote on taxonomic proposals to the international committee on taxonomy of viruses sequence and phylogenetic analysis of nucleocapsid genes of porcine epidemic diarrhea virus (pedv) strains in china an elisa optimized for porcine epidemic diarrhoea virus detection in faeces antigenic relationships among porcine epidemic diarrhea virus and transmissible gastroenteritis virus strains genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans establishing a genetic recombination map for murine coronavirus strain a complementation groups origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the united states third strain of porcine epidemic diarrhea virus, united states coronavirus immunogens the molecular biology of coronaviruses a new coronavirus-like particle associated with diarrhea in swine enzyme-linked immunosorbent assay for the detection of porcine epidemic diarrhea coronavirus antibodies in swine sera an elisa for detection of antibodies against porcine epidemic diarrhoea virus (pedv) based on the specific solubility of the viral surface glycoprotein evaluation of a blocking elisa using monoclonal antibodies for the detection of porcine epidemic diarrhea virus and its antibodies development of a porcine epidemic diarrhea virus m protein-based elisa for virus detection development and evaluation of enzyme-linked immunosorbent assay based on recombinant nucleocapsid protein for detection of porcine epidemic diarrhea (pedv) antibodies detection of antibodies against porcine epidemic diarrhea virus in serum and colostrum by indirect elisa comparison of an enzyme-linked immunosorbent assay with serum neutralization test for serodiagnosis of porcine epidemic diarrhea virus infection porcine epidemic diarrhea: kinetics of actively and passively acquired serum antibodies and the effect of reinfection development of an -plex luminex assay to detect swine cytokines for vaccine development: assessment of immunity after porcine reproductive and respiratory syndrome virus (prrsv) vaccination development of a fluorescent microsphere immunoassay for detection of antibodies against prrsv using oral fluid samples as an alternative to serum-based assays validation of serological assays for diagnosis of infectious diseases differentiation of u.s. and european isolates of porcine reproductive and respiratory syndrome virus by monoclonal antibodies antibodies to major histocompatibility antigens produced by hybrid cell lines the measurement of observer agreement for categorical data development and laboratory evaluation of a lateral flow device (lfd) for the serodiagnosis of theileria annulata infection opportunities for bead-based multiplex assays in veterinary diagnostic laboratories distinct characteristics and complex evolution of pedv strains pathology of us porcine epidemic diarrhea virus strain pc a in gnotobiotic pigs antigenic relationships among homologous structural nucleotide sequences of porcine, feline and canine coronaviruses porcine epidemic diarrhea virus (cv ) and feline infectious peritonitis virus (fipv) are antigenically related critical factors affecting the diagnostic reliability of enzyme-linked immunosorbent assay formats longitudinal profile of immunoglobulin g (igg), igm, and iga antibodies against the severe acute respiratory syndrome (sars) coronavirus nucleocapsid protein in patients with pneumonia due to the sars coronavirus the distribution and functions of immunoglobulin classes the authors declare that they have no competing interests.authors' contributions fo: conducted elisa and fmia development/validation, statistical analysis and co-wrote paper. xl: conducted elisa and fmia development/validation. as: assisted with sample acquisition, assay development and study design. tc: assisted with sample acquisition and study design. jn: conducted virus neutralization assay development and testing. jch: assisted with study design and co-wrote paper. ean: developed study concept and design, edited paper. sl: directed assay development and validation, co-wrote paper. all authors read and approved the final manuscript. key: cord- -jaekryq authors: karte, claudia; platje, nadine; bullermann, johannes; beer, martin; höper, dirk; blome, sandra title: re-emergence of porcine epidemic diarrhea virus in a piglet-producing farm in northwestern germany in date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: jaekryq background: porcine epidemic diarrhea (ped) is a viral enteric disease of pigs. it affects all age classes of animals but lethality is mainly seen in suckling piglets. after its first appearance in england in , porcine epidemic diarrhea virus (pedv) has spread worldwide. while sporadic outbreaks prevailed in europe, the disease had high impact in asia. following particularly severe outbreaks in , high impact cases were also reported in the united states and neighboring countries in . subsequently, outbreaks were also reported in several european countries including germany. these outbreaks were less severe. this case report describes a recent case of ped re-emergence in germany and the sequence analyses of the causative pedv. case presentation: in spring years after re-introduction of ped into central europe, a piglet-producer in northwestern germany experienced an outbreak that affected sows, their suckling piglets, and weaners. after initial confirmation of pedv by real-time rt-pcr, fecal material and small intestine samples from affected pigs were subjected to metagenomic analyses employing next-generation sequencing. phylogenetic analyses showed high identities among the pedv sequences obtained from samples of different animals and a close relation to recent strains from hungary and france. compared to the pedv strains analyzed in , genetic drift could be confirmed. changes were mainly observed in the spike protein encoding s gene segment. in addition, metagenomic analyses showed multiple picobirnavirus reads in all investigated samples. conclusion: this case report shows that pedv is still circulating in europe. the causative strains are moderately virulent and are still closely related to the so-called indel strains reported previously in europe, including germany. however, a genetic drift has taken place that can be seen in a novel cluster comprising strains from germany, hungary and france in . relevance and impact of the detected picobirna sequences need further investigations. porcine epidemic diarrhea (ped) is an acute and highly contagious enteric disease of swine that results in severe enteritis, diarrhea, vomiting, and dehydration. especially in suckling pigs, lethality can be very high [ ] [ ] [ ] . the causative agent, porcine epidemic diarrhea virus (pedv), is an enveloped positive single-stranded rna virus that belongs to the family coronaviridae, genus alphacoronavirus [ ] . the complex coronavirus particles are pleomorphic and possess club-shaped surface projectors [ ] . the length of the genome ranges from to kilobases [ ] . coronaviruses have a low tenacity [ ] but are shed in high amounts and are thus easily transmitted by the fecal-oral route [ ] . after its first recognition in the s in europe [ , ] , the disease caused considerable economic losses especially in asia, where the disease remains endemic [ , ] . in europe, the disease disappeared quickly, and from most countries, only very sporadic cases were reported over the last three decades. after reports from asia, that a new pedv variant caused considerable losses [ , ] , that highly virulent pedv variant emerged also in the united states (us) in , with swine farms experiencing explosive epidemics affecting all age classes of animals, with up to % mortality in suckling pigs [ , ] . in , several cases of ped were also reported from southern and western germany. in most cases, fattening pigs were affected showing high morbidity with almost non-existent mortality [ ] . however, some breeding herds reported high mortality rates with up to % losses in suckling piglets [ ] . similar outbreaks were observed in several other central european countries including france, the netherlands, italy, slovenia, belgium, romania, portugal, spain, and austria [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . the characterization of the involved virus strains revealed that so-called s-indel variants of the virus were involved in central europe, which, in contrast to the highly virulent non-indel strains from asia and the usa, are characterized by deletions and insertions in the spike protein encoding s gene [ ] . in the majority of cases, the s-indel variants are associated with milder ped courses. in the absence of reporting obligations, and following the confirmation that the pedv strains in the eu did not belong to the highly virulent non-inde l type, notification and broader follow-up of cases decreased. however, sporadic outbreaks, sometimes with severe problems to get rid of the disease, were still reported from all production systems from different regions of germany and other countries (personal communications and unpublished data). from this time, pedv sequence information is largely missing. when a new wave of ped struck a piglet producer in northwestern germany in , questions were raised to what extent the virus might have changed and if a new emerging variant was causing the clinical case in sows, piglets and weaners. here, we report on the clinical presentation and the whole-genome sequencing of the causative pedv strain. the affected piglet producer is located in northwestern germany. the farm keeps approximately sows in seven groups ( sows each), and has a total of piglet rearing places ( on site and in a leased farm). on the premise, sows and piglets are kept in the same building complex. the farm also includes a fattening unit with fattening slots. this unit is in close proximity to the above-mentioned units but has its own building with a hygiene lock. three other pig farms are in the radius of m around the holding. prior to the disease event, the farm recorded weaned piglets per sow and year with suckling losses below %. loss in piglet rearing and fattening was < %. the animals were routinely screened for enteric pathogens and only rotavirus types a and c were detected every now and again (rotavirus type c only very sporadically). the farm was unsuspicious for dysentery and was tested negative for tgev and pdcov prior, during and after the disease event. the routinely applied immunization scheme included maternal vaccinations against colibacillosis, oedema disease, and necrotic enteritis. depending on the infection pressure, rotavirus a vaccines were used in gilts. piglets received vaccinations against porcine circovirus type (pcv- ), mycoplasma, and shiga toxin producing e. coli. sows in integration and reproduction received additional vaccination e.g. against porcine respiratory and reproductive syndrome virus, influenza virus, and parvovirus. in spring , massive diarrhea occurred in sows and suckling pigs. at first, nursing sows ( % of the sows in the unit) in the farrowing unit showed inappetence and shortly afterwards mushy diarrhoea. fever or increased temperature were not detected. the sows recovered completely after three to days. the suckling piglets, which were about days old, showed the first signs of diarrhea two to days after the mothers. about % of the litters of this first affected farrowing group showed diarrhea and losses rose to % (see table ). immediate investigations confirmed pedv (rt-qpcr from fecal samples and organs). sick piglets were treated with commercial electrolyte solution and additional water supply was given to sows. to increase maternal immunity, infection was enforced in the waiting area. weaned piglets with secondary infections received antibiotic treatment. in total, three farrowing groups (sows and suckling pigs) showed clinical signs of ped and increased loss rates in suckling pigs ( to %). morbidity reached to % in sows and to % in piglets (see table ). some of the weaned piglets also showed diarrhea, wasting, and growth retardation. the overall losses in piglet rearing rose to to % (details see table ). in the fourth farrowing group (approx. eight weeks after the first clinical signs) no clinical signs indicative for ped were recorded and up to now no further ped suspicions arose. in autumn, five suckling piglets were randomly selected and subjected to necropsy and ped screening. all samples were negative for pedv. in the connected fattening unit, no ped signs were recorded at any time. serological checks in the sow rearing unit (separate building) gave negative results. during the disease event, intensive cleaning and disinfection was carried out in the farrowing unit, on driveways, in the waiting areas, and all related stables. disinfectants were chosen in accordance with the list recommended by the germany veterinary society (dvg) for enveloped viruses. purchase of gilts was stopped and replaced by self-remounting. follow-up investigations showed that neighboring farms were also affected by ped shortly before the onset in the described farm. upon initial confirmation of ped by a private laboratory, fecal samples from five sows and feces and intestines from two affected piglets were sent to the friedrich-loeffler-institut (fli) for further analyses and nextgeneration sequencing. ribonucleic acids were extracted from fecal samples or supernatants from homogenized intestines using trizol reagent (lifetechnologies, darmstadt, germany) in combination with the rneasy mini kit (qiagen, hilden, germany) and dnase digestion on the spin column. all rnas were confirmed to be pedv positive by rt-qpcr [ , ] . subsequently, all samples were subjected to whole genome sequencing and metagenomic analyses using the illumina miseq platform as previously described [ ] . in brief, nucleic acids were processed into shotgun dna libraries and then deep-sequenced. the resulting raw data was taxonomically classified using the software pipeline riems [ ] . the obtained sequence reads were assembled to determine the genomes in full length. all sequences are available from the insdc databases under study accession prjeb . with the help of the geneious prime software suite (v. . . ; biomatters ltd., auckland, new zealand), phylogenetic analyses were performed (for details see legend fig. ). the genomes originating from the reported german case form a new and distinct cluster within the s-indel strains (see fig. ). close relatives are three virus strains reported in , two from hungary [ ] (accessions mh and kx ) and one from france (accession mn ). identity among the new german pedv strains was almost % (> . %) whereas identities of > . % were found with regard to the hungarian and french sequences. comparing the german strains from with the german strains detected in , identities are higher than . %. comparisons between german prototype strains from (the first reported strain, bh / - _l _ farm a) and ( _ _l _ger) show high similarities in the nucleotide sequence (see supplementary figure ). in total, nucleotides exchanges are the rna-shotgun sequencing approach allowed metagenomic analyses using riems. in this analysis, several reads were classified taxonomically as picobirnaviridae sequences. multiple reads of the rna-dependent rnapolymerase gene as well as the gene segment encoding the capsid were found in the fecal but not the intestine samples. porcine epidemic diarrhea can have a tremendous impact on the pig industry as was seen in the us following the introduction of pedv in [ , ] . critical losses occurred especially in piglet rearing companies and the losses impacted the whole pork industry [ , ] . following the devastating outbreaks on the american continent, re-emergence of pedv was also reported from europe after intensified surveillance [ ] . however, here, strains of lower virulence were circulating and the reporting and follow-up of cases abated quickly despite ongoing cases. one reason for the subsiding of official follow-up is that ped is neither notifiable nor reportable but still has impact on trade and reputation. against this background, most farmers had no interest to make their cases public. thus, official and published information on the german ped situation in general and viral evolution in particular is missing roughly from onwards. when pedv was introduced in a piglet-producing farm in northwestern germany in , clinical disease and losses were rather disturbing and the farmer and responsible veterinarian initiated a closer follow-up. one hypothesis for the observed impact was a change in virulence and thus, next-generation sequencing was employed to test this hypothesis. our data show that the causative virus strains are still s-indel variants with close relationship to those found in and the following years. however, viral evolution has taken place and the drift gave rise to a new cluster that comprises recent fig. phylogenetic tree of current pedv strains. phylogenetic tree of pedv strains from germany, hungary, and france as well as pedv strains from germany, usa, and china. the complete genome sequences were aligned using mafft and a phylogenetic analysis was performed using phyml, with a gtr substitution model and tree reconstruction supported by bootstrapping replicas [ , ] . green branches show the pedv isolates from germany, blue branches highlight the isolates from hungary and france and red branches are the highly virulent non-indel strains from the usa and china strains from germany, hungary, and france. given the accordant drift, one can speculate that pedv is still circulating in europe. there is no indication that these variants have a higher virulence per se. the previously observed variation seems still present. the affected farm described in this report was finally able to control the outbreak by forced infection in the waiting unit of sows, biosecurity and strict cleaning and disinfection. yet, the history of ped in neighboring fattening farms also shows that the virus was able to enter the farm and room for improvement was given in veterinary hygiene and biosafety. the exact route of introduction remained unclear. supplementary studies into the metagenomic data set showed picobirnaviral sequences in the fecal material. picobirnaviruses are non-enveloped double-stranded rna viruses. they are bisegmented with segment one consisting of . to . kilobases and segment two of . to . kilobases [ ] . picobirnaviruses are often associated with cases of gastroenteritis or infections in the respiratory tract [ ] . the role in diarrhea diseases in piglets is unclear, since picobirnaviruses were found in piglets with and without diarrhea [ ] . the transmission is fecal-oral [ ] and these viruses have so far been detected mainly in feces in various species [ , ] . impact and relevance of these findings remains to be clarified by future studies. in conclusion, ped re-emerged in northwestern germany in leading to high morbidity and substantial impact in a piglet-producing farm. the causative virus strains are still s-indel variants but a genetic drift occurred since . this drift is accordant with the evolution in other european countries. the relevance of picobirnavirus detections in fecal samples from pedvpositive animals remains unclear. supplementary information accompanies this paper at https://doi.org/ . /s - - - . emergence of porcine epidemic diarrhea virus in southern germany emergence of porcine epidemic diarrhea virus in the united states: clinical signs, lesions, and viral genomic sequences genetic properties of endemic chinese porcine epidemic diarrhea virus strains isolated since the springer index of viruses a new coronavirus-like partiele assoeiated with diarrhea in swine diagnostic notes: update on porcine epidemic diarrhea verlaufsuntersuchung über die ausscheidung von porcine epidemic diarrhea virus (pedv) und die serokonversion nach feldinfektion bei saugferkeln und mastschweinen porcine epidemic diarrhoea (ped) -neuausbrüche in deutschen mastschweinebeständen chinese-like strain of porcine epidemic diarrhea virus pig farming. letter to the editor new variant of porcine epidemic diarrhea virus the prevalence of intestinal trichomonads in chinese pigs isolation and characterization of porcine epidemic diarrhea viruses associated with the disease outbreak among swine in the united states comparison of porcine epidemic diarrhea viruses from germany and the united states isolation and characterisation of porcine epidemic diarrhoea virus in hungary -short communication complete genome sequence of a porcine epidemic diarrhea s gene indel strain isolated in france in complete genome sequence of a porcine epidemic diarrhea virus from a novel outbreak in belgium porcine epidemic diarrhea virus (pedv) introduction into a naive dutch pig population in outbreak of porcine epidemic diarrhea virus in portugal first detection, clinical presentation and phylogenetic characterization of porcine epidemic diarrhea virus in austria porcine epidemic diarrhoea virus in italy: disease spread and the role of transportation porcine epidemic diarrhea in europe: in-detail analyses of disease dynamics and molecular epidemiology genomnachweis des porzinen epidemischen diarrhoe virus (pedv) mittels real-time rt-pcr. avid-methodensammlung: avid-methode vir evidence of infectivity of airborne porcine epidemic diarrhea virus and detection of airborne viral rna at long distances from infected herds a versatile sample processing workflow for metagenomic pathogen detection riems: a software pipeline for sensitive and comprehensive taxonomic classification of reads from metagenomics datasets mafft: a novel method for rapid multiple sequence alignment based on fast fourier transform factors associated with time to elimination of porcine epidemic diarrhea virus in individual ontario swine herds based on surveillance data molecular detection and characterization of picobirnaviruses in piglets with diarrhea in thailand detection and molecular characterization of porcine picobirnavirus in feces of domestic pigs from kolkata, india publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations the authors thank patrick zitzow, robin brandt and ulrike kleinert for technical assistance. authors' contributions ck performed next-generation sequencing and was a major contributor in writing the manuscript, np and jb collected and analyzed clinical data, mb interpreted the overall dataset and critically revised the manuscript, sb conceived the study, assisted in interpreting the data and contributed in writing the manuscript, dh analyzed and interpreted whole-genome data and contributed to the manuscript. all authors read and approved the final manuscript. this study was funded by federal excellence initiative of mecklenburg western pomerania and european social fund (esf) grant koinfekt (esf_ -bm-a - xx_ ). the excellence initiative covered consumables for next-generation sequencing and the personnel costs of the major contributor (ck). open access funding provided by projekt deal.availability of data and materials sequence information was deposited at the european nucleotide archive (ena) under study id prjeb (accessions lr ; lr ; lr ; lr , lr , lr , and lr ). additional metadata are available from the authors upon reasonable request. the sample material was submitted to the friedrich-loeffler-institut for enhanced diagnostics and was taken by the responsible farm veterinarian in the context of the health monitoring program of the respective farm (in accordance with the regulation on hygiene requirements for the keeping of pigs; online available at http://www.gesetze-im-internet.de/schhalthygv/). in germany, every keeper of pigs must have his herd supervised by a veterinarian as part of the on-farm inspections, this includes clinical and laboratory checks to maintain and improve the health status of the herd. no permissions were necessary to collect the mainly non-invasive specimens. the farmer approved in-detail analyses of the ped case and shipment of samples (verbal agreement with the responsible veterinarian). all procedures were carried out in accordance with the relevant regulations. the owner of the case farm approved submission of the report. all authors have approved submission of the manuscript. the authors declare that they have no competing interests. key: cord- - v pjqt authors: zhao, jun; zhu, ling; xu, lei; huang, jianbo; sun, xiangang; xu, zhiwen title: porcine interferon lambda (ifn-λ ) shows potent anti-prrsv activity in primary porcine alveolar macrophages (pams) date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: v pjqt background: porcine reproductive and respiratory syndrome virus (prrsv) is a serious viral disease of swine. at present, there are vaccines for the control of prrsv infection, but the effect is not satisfactory. the recombination of attenuated vaccines causes significant difficulties with the prevention and control of prrsv. type iii interferons (ifns), also called ifn-λs, were newly identified and showed potent antiviral activity within the mucosal surface and immune organs. results: therefore, primary porcine alveolar macrophages (pams) were used for this investigation. to this end, we found that the replication of prrsv in pams was significantly reduced after pre-treatment with ifn-λ , and such inhibition was dose- and time-dependent. the plaque formation of prrsv abrogated entirely, and virus yields were reduced by four orders of magnitude when the primary pams were treated with ifn-λ at ng/ml. in addition, ifn-λ in our study was able to induce the expression of interferon-stimulated genes (isg ), ′- ′-oligoadenylate synthase (oas ), ifn-inducible transmembrane (ifitm ), and myxoma resistance protein (mx ) in primary pams. conclusions: ifn-λ had antiviral activity against prrsv and can stimulate the expression of pivotal interferon-stimulated genes (isgs), i.e., isg , mx , oas , and ifitm . so, ifn-λ may serve as a useful antiviral agent. supplementary information: the online version contains supplementary material available at . /s - - - . type i interferons (ifn-α/β) and type iii ifns (ifn-λs), as the first line of defence in innate immunity, play a crucial role in the body's resistance to exogenous pathogens [ ] . type iii ifns, also called ifn-λs, were first described in [ , ] , consist of ifn-λ , ifn-λ , ifn-λ and ifn-λ in humans [ , ] , ifn-λ and ifn-λ in mice [ , ] , ifn-λ and ifn-λ in swine [ ] [ ] [ ] . both ifn-α/β and ifn-λs bind to unique receptors and induce the previous signalling pathway and expression of the ifn-stimulated genes (isgs) to mediate antiviral activity. type i ifn interacts with a receptor formed by interferon alpha/beta receptor (ifnar ) and interferon alpha/beta receptor (ifnar ). type iii ifns bind to the specific receptor chain ifn-λr and il- r [ ] . type i ifn receptor is ubiquitously expressed in various types of cells and organs; however, ifn-λr is widely expressed on epithelial cells, dendritic cells, human peripheral blood monocytes or macrophages [ ] , which means that ifn-λs may provide a focused antiviral response against mucosal and immune organ infections. interferon bind to its receptors on the cell surface and induce the production of a large number of isgs, including isg , myxoma resistance protein (mx) family, ′- ′-oligoadenylate synthase (oas) family and the ifninducible transmembrane (ifitm) family, through jak-stat signal transcription [ ] . isg is one of the most highly induced isgs, isg can inhibit viral translation, replication, or egress [ ] . mx is a broadly inhibitor and inhibits a wide range of viruses by blocking the endocytic traffic of incoming virus particles and the uncoating of ribonucleocapsids [ ] . oas can recognise the dsrna produced by the virus in the infected cells and play an antiviral role by activating the ribonuclease l (rnase l) to degrade the diseased mrna [ ] . the ifn-inducible transmembrane (ifitm) family has a role in blocking virus entry [ ] . ifitm has high potency against influenza a virus and severe acute respiratory syndrome (sars) coronavirus [ ] . prrsv is a member of the family arteriviridae in the order nidovirales, which causes severe reproductive failure in sows and respiratory distress in piglets and growing pigs [ ] . also, prrsv is an immunosuppressive virus that can infect the lymphatic system of the whole body and produce viraemia after infection [ ] . prrsv mainly infects and destroys porcine alveolar macrophages and leads to severe immunosuppression, which promotes the infection of mycoplasma pneumoniae, streptococcus, a. pleuropneumoniae, and other pathogens [ , ] . the primary pams derived from piglet alveoli is an appropriate model for studying the interaction of prrsv immune responses and host-pathogen in vitro. an in vivo antiviral test of type iii interferons from pigs has not been reported. in this study, the antiviral activity of porcine ifn-λ against prrsv in primary pams was evaluated, and the expressions of isgs genes induced by ifn-λ was also investigated in primary pams. previous study has confirmed that porcine ifn-λ possess the high specific activity against porcine epidemic diarrhoea virus (pedv), classical swine fever virus (csfv), hepatitis e virus (hev) and so on [ , , ] . in this study, we verified the antiviral effect of ifn-λ against prrsv in vitro on pams. as shown in fig. , treatment of primary pams with ifn-λ could reduce the multiplication of prrsv. the degree of cytopathic effect (cpe) decreased with the increase in ifn-λ concentration ( fig. a-e) . the number and size of viral plaques also decreased with the increase in ifn-λ concentration ( fig. f-j) . the virus titre was significantly reduced with the increase of ifn-λ treatment dose ( , fig. the cpe of primary pams treated with porcine ifn-λ and infected with prrsv. the primary pams were untreated or pre-treated with ifn-λ ( , , ng/ml). b the primary pams not treated. b the primary pams treated with ng/ml ifn-λ . c the primary pams treated with ng/ml ifn-λ . d the primary pams treated with ng/ml ifn-λ . e control primary pams. k the primary pams were treated or untreated with ng/ml of ifn-λ for h and then were infected with prrsv nj strain at . moi. infected cells were cultured for , , or h after infection. f, g, h, i, j corresponds to a, b, c, d, e with the same treatment. magnifications, × , ng/ml), and the maximum treatment dose could reduce the virus titre by four orders of magnitude compared with the control group ( fig. k, the raw data are shown in supplementary table s ). these results indicate that the ifn-λ could significantly inhibit the replication of prrsv in a dose-dependent manner in primary pams. to investigate the time-dependent manner of the ifn-λ inhibits the replication of prrsv, we used ifn-λ of ng/ml concentration to treat pams cells and infected with the prrsv. cell cultures were collected at specific time and determine the virus titre. as shown in fig. (the raw data are shown in supplementary file , table s ), the inhibition of ifn-λ on prrsv decreased with time in primary pams, but the inhibition still existes. prrsv proliferation slowed down within h to h in primary pams that were treated with ifn-λ . the above results showed that ifn-λ could maintain a potent anti-prrsv activity in the later stage and significantly inhibit the replication of prrsv in a timedependent manner in primary pams. isg , mx , oas and ifitm have well-known antiviral properties and may affect prrsv replication. therefore, we accessed the quantification of isgs induce by ifn-λ . as seen in fig. a to d, a dose-dependent induction of isg , mx , oas and ifitm has been observed in primary pams treated with ifn-λ . the expression of mrna for isg , mx , oas , and ifit m was up-regulated by , , , and times respectively at the concentration of ng/ml in primary pams. as shown in fig. e and f (the full-length blots are presented in supplementary file ), a dosedependent induction of the antiviral proteins isg , mx and oas has been observed in primary pams treated with ifn-λ . the expression concentration of three antiviral proteins increased with the increasing ifn-λ concentration. both isg and mx showed low expression in the untreated condition, and ifn-λ induced a large amount of expression. the expression of isg , mx and oas tended to be stable when the concentration of ifn-λ was higher than ng/ml (fig. f ). the results in our research confirm that the porcine ifn-λ shows potent anti-prrsv activity in primary pams. pams are the first line of defence against pathogenic microbe infections in the lung. prrsv replicates in monocytic lineage cell types, particularly in pams, and causes immunosuppression in swine [ ] . therefore, we selected the primary pams to carry out the ifn-λ in vitro anti-prrsv study. alveolar macrophages are resident phagocytes of the alveolar space [ ] . the expression of the ifn-λ receptor in alveolar macrophages has been confirmed and reported [ ] . macrophages express il- rβ and il- rα at both the mrna and protein levels [ ] . ifn-λ has the strongest antiviral function in ifn-λs [ ] . in our study, the prrsv proliferation reduced when primary pams were treated with ifn-λ ( ng/ml) (fig. i) . ifn-λ treatment could significantly reduce the virus titre of prrsv proliferation on pams, and the virus titre of the ng/ml treatment group was four orders of magnitude lower than that of the control group (fig. b) . consistent with these results, treatment with , or [ ] . the study of two other kinds of viruses targeted porcine intestinal epithelial, pedv and csfv, confirming that ifn-λ inhibits their infection in vitro [ , ] . all of these imply that porcine ifn-λ can inhibit the proliferation of porcine viruses such as csfv, pedv and prrsv. the antiviral activities of ifn-λ are due to isg induction and ifn-λ can induce the expression of isg. ifn-λ exerts its anti-hiv function by activating jak-stat pathway-mediated innate immunity in macrophages [ ] . ifn-λ can bind to cell surface receptors and induce the high expression of interferon-stimulating genes of the mx, oas and ifitm families [ , , ] . the gene transcription profile induced by ifn-λ , particularly the gene transcription profile induced by ifn-λ in primary pams has not been reported. in our study, we assessed whether the antiviral efficacy of ifn-λ was caused by the levels of isg expression induced by ifn-λ . consistent with the expecting result, the expression of isg , oas , mx , and ifitm was provoked in primary pam cells. the mrna transcription and protein translation of the isg , oas and mx showed dose-dependence. however, the rangeability of mrna and protein expression levels of isg , oas and mx were different. the expression levels of protein reached its peak when treated with ng/ml ifn-λ while the expression of mrna continuous increased (fig. ) . in summary, our data demonstrated that ifn-λ could inhibit the replication of prrsv in primary pams, and such inhibition is dose-and time-dependent. alveolar macrophages are one of the earliest immune defence cells in the lungs that contact pathogenic microorganisms. they are essential components of the innate and specific immunity of the host [ ] . pams are an essential host cell for prrsv natural infection. ifn-λ can stimulate the expression of pivotal isgs, i.e. isg , mx , oas , and ifitm . this study indicated that porcine ifn-λ might serve as a promising therapeutic agent against prrsv and other viruses in swine in the future. supplementary file (a to d) . the grey value of protein bands was measured by image j (f). data were presented as mean ± sem (n = ). *p < . ; **p < . ; ***p < . ; ****p < . by unpaired t-test to determine the anti-prrsv activity of ifn-λ in the primary pams, the e. coli-derived ifn-λ was prepared in our laboratory. to explore the dose-dependent of ifn-λ antiviral, primary pams were untreated or pretreated with ifn-λ ( , , ng/ml) for h. then, the cells were infected with prrsv nj strain at . moi for - h, washed and replenished with fresh medium containing the indicated ifn-λ . infected cells were cultured for h after infection. to explore the time-dependent effect of ifn-λ antiviral, primary pams were pre-treated with ng/ml ifn-λ for h. then, the cells were infected with prrsv nj strain at . moi for - h, washed and replenished with fresh medium containing the indicated ifn-λ . infected cells were cultured for , , , h after infection. all of the cells were submitted to two freeze-thaw cycles and titrated by % tissue culture infective dose (tcid ) in marc- cells. the cytopathic effect (cpe) units in culture plates were counted, and the viral titre analysis made use of the reed-muench method. to examine the level of isg expression in primary pams following ifn-λ stimulation, the cells were stimulated with the indicated concentrations ( , , ng/ml) of ifn-λ in -well plates for h. cells were then lysed, total rna was extracted for subsequent qpcr analysis and total protein was extracted for western blot analysis. every treatment group in this study had three duplicate samples (n = ). total rna was extracted from the cellular supernatant or cell lysates using the ez- spin column total rna isolation kit (sangon biotech (shanghai) co., ltd., china) according to the manufacturer's instructions and the rna concentration was measured using a nucleic acid concentration analyzer (scandrop , analytik jena, germany). reverse transcription was performed using the prime script™ ii st strand cdna synthesis kit (takara), and qpcr was performed in a light cycler (roche, switzerland) with tb green® premix ex taq™ ii (tli rnaseh plus) (takara). the thermal cycling conditions were °c for s, followed by cycles of °c for s, and °c for s. all acquired data were obtained using light cycler real-time pcr machines (roche) and analysed with light cycler software . based on the cycle threshold (ΔΔct) method. primers were designed using oligo . software and are shown in table . total protein was extracted from the cell lysates using the western and ip cell lysis buffer (sangon biotech (shanghai) co., ltd., china) according to the manufacturer's instructions and protein concentration was determined using the bca protein assay kit (sangon biotech (shanghai) co., ltd., china). after gel electrophoresis, the proteins were transferred to nitrocellulose membranes (bio-rad, usa), and blocked in % skim milk at °c overnight. after washing with pbst ( . % tween- in pbs), the membrane was incubated with primary antibodies for h at °c. after washing, the membrane was incubated with horseradish peroxidase (hrp)-conjugated igg antibody (abcam, no: ab ) for h at °c. the protein bands were detected using supersignal™ west pico plus chemiluminescent substrate (thermo scientific, usa) and chemiluminescence imaging system (bio-rad, chemidoc mp, california, usa). the primary antibodies of isg (no: ab ), oas (no: ab ), mx (no: ab ) and β-actin (no: ab ) was purchased from abcam. statistical analysis was performed and histogram were drawn using graphpad prism™ . (graphpad software, usa), paired student t-test, and one-way anova was used to test differences between different groups. p values< . were considered significant. the gray intensity of protein bolts was analyzed by image j (national institutes of health, usa). the layouts and cropping of the pictures were completed by adobe illustrator cs (adobe systems incorporated, california, usa). the online version contains supplementary material available at https://doi. org/ . /s - - - . additional file : table s . the viral titer at h after the pams stimulated with different dose of ifn-λ . table s . the viral titer at , , or h after the pams stimulated with ifn-λ ( ng/ml). abbreviations ifn-λ : interferon lambda ; pams: porcine alveolar macrophages prrsv: porcine reproductive and respiratory syndrome virus; ifns: interferons isg : interferon-stimulated genes ; oas : ′- ′-oligoadenylate synthase ifitm : ifn-inducible transmembrane ; mx : myxoma resistance protein isgs: interferon-stimulated genes; ifn-α: interferon alpha; ifn-β: interferon beta; ifn-λs: interferon lambdas; ifn-λ : interferon lambda ; ifn-λ : interferon lambda ; ifn-λ : interferon lambda ; ifnar : interferon alpha/beta receptor ; ifnar : interferon alpha/beta receptor ; ifn-λr : interferon lambda receptor ; il- r : interleukin receptor ; mrna: messenger rna pedv: porcine epidemic diarrhoea virus; csfv: classical swine fever virus hev: hepatitis e virus; cpe: cytopathic effect; il- rβ: interleukin receptor beta; il- rα: interleukin receptor alpha; hiv: human immunodeficiency virus african green monkey embryonic kidney epithelial cells dmem: dulbecco's modified eagle's medium; fbs: foetal bovine serum pcv : porcine circovirus type ; prv: pseudorabies virus; moi: multiplicity of infection; tcid : % tissue culture infective dose; qpcr: real-time polymerase chain reaction; pbst: . % tween- in pbs; hrp: horseradish peroxidase interferon-inducible antiviral effectors il- , il- and their class ii cytokine receptor il- r ifn-lambdas mediate antiviral protection through a distinct class ii cytokine receptor complex ifn-λ : the paradoxical new member of the interferon lambda family interferon-lambda: a new addition to an old family murine interferon lambdas (type iii interferons) exhibit potent antiviral activity in vivo in a poxvirus infection model characterisation of the mouse ifn-lambda ligand-receptor system: ifnlambdas exhibit antitumor activity against b melanoma molecular cloning, expression and antiviral activity of porcine interleukin- (poil- ) antiviral activity of porcine ifn-λ against porcine epidemic diarrhea virus in vitro molecular characterisation and antiviral analyses of porcine type iii interferons contribution of type iii interferons to antiviral immunity: location, location, location interferon-stimulated genes: a complex web of host defences interferon-induced isg pathway: an ongoing virus-host battle structural basis of oligomerisation in the stalk region of dynamin-like mxa viral encounters with ′, ′-oligoadenylate synthetase and rnase l during the interferon antiviral response a diverse range of gene products are effectors of the type i interferon antiviral response distinct patterns of ifitm-mediated restriction of filoviruses, sars coronavirus, and influenza a virus porcine reproductive and respiratory syndrome emergence of a highly pathogenic porcine reproductive and respiratory syndrome virus in the mid-eastern region of china effects of porcine reproductive and respiratory syndrome virus (isolate tw ) on porcine alveolar macrophages in vitro alveolar macrophages: plasticity in a tissue-specific context emergence of fatal prrsv variants: unparalleled outbreaks of atypical prrs in china and molecular dissection of the unique hallmark ifn-lambda mediates antiviral protection against porcine epidemic diarrhoea virus by inducing a distinct antiviral transcript profile in porcine intestinal epithelia immune response of porcine alveolar macrophages to a concurrent infection with porcine reproductive and respiratory syndrome virus and haemophilus parasuis in vitro lambda interferon inhibits human immunodeficiency virus type infection of macrophages comparison of antiviral activity of lambda-interferons against hiv replication in macrophages lambda interferon inhibits hepatitis b and c virus replication short communication: antiviral activity of porcine ifn-k against porcine epidemic diarrhoea virus in vitro ifn-λ inhibits hiv infection of macrophages through the jak-stat pathway antiviral activity of type i and type iii interferons against porcine reproductive and respiratory syndrome virus (prrsv) ifnlambda preferably inhibits pedv infection of porcine intestinal epithelial cells compared with ifn-alpha alveolar macrophages: plasticity in a tissue-specific context quantitative nitric oxide production by rat, bovine and porcine macrophages publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations we thank prof. zhu for her insightful comments on the design of the study. all data generated during this study are included in supplementary file (table s , s ). however, the raw data is available from the corresponding author upon reasonable request. the sichuan provincial laboratory animal management committee (licence no: syxk (chuan) - ) approval has been received. the "guidelines for experimental animals" of the ministry of science and technology (beijing, china) were followed. not applicable. the authors declare that they have no competing interest.received: november accepted: october key: cord- -u r oh z authors: bian, hongfen; xu, fei; jia, yumin; wang, lei; deng, shengchao; jia, aiqing; tang, yong title: a new immunochromatographic assay for on-site detection of porcine epidemic diarrhea virus based on monoclonal antibodies prepared by using cell surface fluorescence immunosorbent assay date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: u r oh z background: porcine epidemic diarrhea virus (pedv) is a highly effective pathogen that can cause death of new-born piglet, resulting in big economical loss in pig farming industry. for rapid detection of pedv, a new immunochromatographic assay (ica) based on monoclonal antibodies (mabs) was developed in this study. results: the mabs were prepared by using pedv positive hybridoma cells that were selected by using cell surface fluorescence immunosorbent assay (csfia). fourteen mabs against pedv strain isolated from south of china were prepared. the optimal mab a was coated on nc membrane as the capturing reagent and the mab a h was coupled to gold nanoparticles (aunps) as detection reagent for the new ica. the new ica was used to measure pedv in phosphate buffer containing tween- . results indicated that the limit of detection (lod) of the new ica was . μg/ml ( . × ( ) tcid( )/ml) and the liner detection range of the ica was . – μg/ml ( . × ( )– ( ) tcid( )/ml). the specificity analysis results showed that this new ica had no cross reaction in the presence of other porcine viruses. the ica was also validated for the detection of pedv in swine stool samples with little interference from swine stool. to compare its accuracy to other traditional detection methods, swine stool samples from south of china were investigated with the new developed ica, commercial strip and rt-pcr. results showed that the new ica was more comparable to rt-pcr than commercial test strip. conclusions: a new ica based on mabs prepared by csfia was developed in this study. it was a sensitive, specific and rapid method that could be used for on-site detection of pedv and therefore was useful for the diagnosis and prevention of ped. electronic supplementary material: the online version of this article ( . /s - - - ) contains supplementary material, which is available to authorized users. porcine epidemic diarrhea virus (pedv), which belongs to the genus alphacoronavirus and the family coronaviridae, is an enveloped single-stranded positive-sense rna virus [ , ] . pedv is a highly effective pathogen responsible for causing porcine epidemic diarrhea (ped), a disease characterized by severe and acute watery diarrhea, dehydration and vomiting that results in high mortality rate of one-week-old piglets [ , ] . since the first appearance in england in the early s, outbreaks of ped have been reported in several european and asian countries [ , ] . ped was first reported in china in , followed by a large-scale outbreak of ped in december that led to heavy economic loss [ , ] . therefore, it is of great importance to properly and routinely monitor pedv. unfortunately, due to the fact that pedv and a different alphacoronavirus, transmissible gastroenteritis virus (tgev), have the same epidemiological and clinical features. these two viruses have led to complications in clinical diagnosis. therefore, it is of great importance to develop differential laboratory tests [ , ] . to date, several methods including rt-pcr [ ] , separation identification [ ] , serological method [ ] , enzyme-linked immunosorbent assay (elisa) [ ] and colloidal gold method [ ] [ ] [ ] have been used to detect the pedv antigen. although rt-pcr serves as a good standard due to its high sensitivity and accuracy, this method relies heavily on sophisticated equipment and expensive apparatus. several other common methods are also not suitable for on-site diagnosis due to the following reasons. separation identification means to isolate pedv in vero cell cultures from the small intestine of a pedv infected piglet. it is a classical method for pedv detection, but it is time-consuming for it needs at least one week. the serological method can only detect pedv antibody. however, whether the pedv antibody is from vaccine infection or wild infection is still unknown. elisa is a cheap and simple approach for pedv detection, however, it involves long incubation period, multiple washing steps, and the assistance of a microplate reader. in contrast, recently developed immunochromatographic assay (ica) is much more applicable for on-site diagnosis of pedv for it is simple, sensitive, specific and can be operated without training. therefore, this method could be useful for monitoring the infection of ped [ ] [ ] [ ] . currently, the most widely used commercial pedv test strip in china (bionote test strip), which is made by utilizing ica, is based on the pedv-dr strain. the strain was harvested from a suspension of minced small intestine from infected neonatal pigs in south of korea [ ] . considering regional differences in strains, it might not be the best choice for pedv detection in south of china. a pedv strain chyj was isolated from the fecal specimen of a -day-old dead piglet in march on a commercial swine farm in guangdong province in the south of china [ ] . in this study, we prepared monoclonal antibodies (mabs) using cell surface fluorescence immunosorbent assay (csfia) [ ] , a simple and rapid method for selecting positive hybridoma cells. fourteen mabs against this pedv strain were prepared. relying on signals emitted from gold nanoparticles labeled mab (aunps-mab), a new ica was developed for sensitive, specific and on-site detection of pedv in swine stool in china. a comparison between rt-pcr, bionote test strip and the ica was performed to confirm the applicability of the newly developed ica for on-site pedv detection. vero cell, porcine epidemic diarrhea virus (pedv) strain named chyj , pseudorabies virus (prv), classical swine fever virus (csfv), transmissible gastroenteritis virus (tgev) and swine stool were obtained from guangdong haid institute of animal husbandry & veterinary (guangdong, china). porcine reproductive and respiratory syndrome virus (prrsv) and porcine circovirus- (pcv- ) were obtained from winsun bio (guangdong, china). balb/c mice were purchased from southern medical university. myeloma cells (sp / ) were purchased from shanghai cell biology (shanghai, china). gibicorpmi- was purchased from asegene (guangzhou, china). ninety-six-well polystyrene plates were purchased from jet biofil (guangzhou, china). goat anti-mouse igg h&l (hrp) was purchased from abcam (cambridge, ma). mab subtype classification kit was purchased from sigma (usa). the hrp-labeling kit was purchased from galaxy-bio (beijing, china). bca kit was purchased from thermo (usa). nitrocellulose (nc) membrane (hf s ), conjugate pad, sample pad, plastic backing and absorbent pad were purchased from millipore (shanghai, china). pedv ag test kit was obtained from bionote (korea). ultrapure water produced by a milli-q ultra pure system (millipore, usa) was used throughout this study. all chemicals used were of analytical grade or higher. absorbance of the hrp-based elisa was measured using a synergy h hybrid multi-mode microplate reader (bio--tek instruments, inc., winooski, vt). the following equipments were also utilized in this study: centrifuge r (eppendort, germany), xw- avortex mixers (shanghai, china), magnetic stirrer (beike, beijing), dynabeads mx mixer (invitrogen, america), programmable strip cutter hgs (autokun, china), xyz platform (bio-dot scientific equipment, china), and electrothermal forced air convection drying oven (taisite instrument, china). pedv was inoculated onto a vero cell monolayer for min at °c. cell infection at a moi of . . then maintenance medium was added and cultured for or days. when the cytopathic changes reached above %, the cells were collected and repeatedly frozen and thawed for times. after ultrasonic cracking and centrifugation at rpm for h, the supernatant was further centrifuged at rpm for h and the precipitate was resuspended in pbs ( . m, ph . ). the crude extraction virus was successively added into %~ % sucrose-pbs and centrifuged at rpm for h. then it was resuspended in pbs and centrifuged at rpm for h to remove sucrose content. the purified virus was resuspended in pbs. the uninoculated vero cells were subjected to the same treatment and used as negative control. the pre-purification protein concentration was measured by nanodrop micro nucleic acid tester. virus titer was expressed as tcid , tcid /ml. viral protein concentration was measured using bca, μg/ml. . ml of the purified pedv antigen and an equal volume of freund's complete adjuvant, was injected into each mouse ( weeks, female, balb/c) for the first immunization. mice were immunized every weeks. tail blood was taken on the tenth day after the third immunization. mice with high titer were selected for fusion days after they were boosted with immune antigen pedv. to prepare the hybridomas, the mice were euthanized by cervical dislocation. all the mice were sent to huaqiao hospital for centralized treatment after the study. csfia, a simple and rapid method for selecting positive hybridoma cells, was used to screen for positive hybridoma cell clones. in this study, pedv antigens were first anchored to the hybridoma cell surface through a dual functioning molecular oleyl-peg -nhs. specific antibodies secreted from hybridoma cells were then captured by the antigens on the cell surface. positive hybridoma cells were stained using a fluorescently labeled anti-mouse igg-fc antibody (fig. ) . after the addition of a methylcellulose semisolid medium, positive clones were picked using a pipet. these positive cell clones were used to produce monoclonal antibodies after direct expansion [ ] . mabs were prepared by inducing ascites in mice. they were then purified by ammonium sulphate, desalt column, and protein g affinity chromatography column. mabs were preserved at − °c after freeze-drying. titer of mabs was determined by indirect elisa with pedv as coating antigen and hrp-goat anti-mouse igg as secondary antibody. the sensitivity of mabs was determined by indirect competition elisa with pedv as coating antigen and pedv specific hrp-monoclonal antibody as the competitors. the mab classification kit was used to identify the category and subclass of immunoglubulin. the mab pair for pedv detection was selected by double antibody sandwich elisa matrix fig. the mechanism of csfia based on the specific binding of antigens anchored on the positive hybridoma cell surface and capturing of secreted antibodies from the same cells method with hrp labeled mabs as secondary antibodies and mabs as coating substrates. the preparation of gold nanoparticles (aunps) and gold nanoparticles labeled mab (aunps-mab) to prepare aunps, trisodium citrate dehydrate was used to reduce gold chloride (haucl ). in brief, ml ultrapure water was added to a clean triangle flask and heated and stirred on a magnetic stirrer until boil. then, ml of % haucl was quickly added to the triangle flask and . ml trisodium citrate dihydrate ( mg/ml) was added after a few seconds. the solution was heated for min, and then moved to an unheated plate for continued stirring. the prepared aunps were then diluted with ultrapure water to ml. aunps-mab was prepared by labeling mab to aunps. first, ml of aunps ( . mg/ml) was added to a clean centrifuge tube, and μl of . m k co were added; the solution was mixed on an avortex mixers. then, μl mab was quickly added to the centrifuge tube with mixing. the mixture was rotated for min and then kept still for min at room temperature. subsequently, μl of % bsa were added to cover the unconjugated site. the mixture was rotated for another min and then kept still for min at room temperature. finally, the mixture was centrifuged at rcf for min and the precipitate was resuspended in μl pbs ( . m, ph . , containing % (w/v) sucrose, % (w/v) trehalose, . % (w/v) pvp k , . % (w/v) s- , % (w/v) bsa, and . % (w/v) tween- ). this new ica was sandwich type, in which two monoclonal antibodies were used separately as capture and detecting reagents to detect pedv (fig. ) . gray value corresponding to signal from the red t-line was obtained using image j [ ] [ ] [ ] . the assembly of the new ica was as follows: the new ica was made of pvc plate, nc membrane, sample pad, conjugate pad and absorbent pad. pbs ( . m, ph . ) diluted mab ( . mg/ml) and goat anti-mouse igg ( mg/ml) were dispensed on specific areas of nc membrane called the test line (t-line) and calibration line (c-line) using an automatic dispenser at a volume of μl/cm. the nc membrane was dried at °c and saved for later use. the aunps-mab was loaded onto the conjugate pad using an automatic dispense system set to . μl/cm and then dried at °c. the pretreatment of sample pad involved soaking in pbs ( . m, ph . , containing . % (w/v) sucrose, % (w/v) bsa, and % (w/v) tween- ) and drying at room temperature and then at °c. the pvc plate acted as the holder of the new ica, onto which sample pad, conjugate pad, nc membrane and absorbent pad were pasted with an overlap of mm between each part. after the assembly was completed, the new ica was cut into . -mm-wide and -mm-long strips using a programmable hgs strip cutter and kept in a suitable plastic cassette for further use. a fully assembled new ica is shown in fig. a . to optimize the quality of the new ica, some important single factors were optimized. they were capture and detection mab, the size of gold nanoparticles, the type of sample pad, the type of conjugate pad, the type of nitrocellulose membrane, the type of absorbent pad, the amount of tween- addition and the spray volume of aunps-mab. the optimization methods are shown in the supplemental materials. to verify the specificity of the new ica, pedv, prv, pcv- , prrsv, csfv, and tgev at the same concentrations were prepared and tested following similar procedures. the stability of the new ica was tested by comparing results from the experiments performed now to those from experiments performed a month later using the same icas. for the detection of pedv in spiked samples, negative samples with different pedv concentrations were prepared. first, μl pb ( . m, ph . , containing % (w/v) tween- ) was added to a . ml centrifuge tube. then, μl negative swine stool a was added to the solution and mixed for min. after centrifugation at rcf for min, the solution was kept still for min. the supernatant was collected and the precipitate was discarded. pedv was incorporated into the sample at . , , , and μg/ml. finally, μl of the spiked solutions were added to the sample holes of the new icas respectively. photos were taken to record the results after min of reaction. for detection of pedv in swine stool samples, μl of swine stool samples and μl of pb ( . m, ph . , containing % (w/v) tween- ) were mixed and incubated for min. after centrifugation at rcf for min, the solution was kept still for min. the supernatant was collected and the precipitate was discarded. the swine stool samples were analyzed using rt-pcr, bio-note test strips and the new ica, respectively. preparation and characterization of antibody to pedv cell lesion was above % after pedv was inoculated onto vero cell monolayer for h. after repeated freezing and thawing, cracking and sucrose-pbs gradient centrifugation, the virus bands between the and % interface were collected. after identification, protein concentration was determined to be mg/ml. the prepared pedv was used to immunize mice to generate mabs against pedv [ ] . from the hybridoma cells generated against pedv, clones that could produce mabs with strong pedv binding ability were selected. immunoglobulin isotyping suggested these clones were igg a. to select pedv mab pairs with high sensitivity and specificity, a double antibody sandwich elisa was used. the amount of capture antibody for coating and detecting antibody in both experimental and control group was μg/ml. μg/ml pedv was added to each well of experimental group while an equal volume of pbs was added to the control group. only the mab pairs which have strong signal (od ≥ . ) in pedv group and no obvious signal (od ≤ . ) in pbs group were marked as positive. all the mab pairs which have no strong signal in pedv group or have obvious signal in pbs group were marked as negative. as shown in tables , of the mabs were successfully paired using double antibody sandwich elisa matrix method. these successfully paired mabs ( a , h , a , a h and h ) were used in the new ica for their outstanding binding ability. first, the new ica was optimized by selecting the best pair from the selected mabs. the optimization results showed that a was the best capturing mab and a h was the best detection mab (see additiona file : figure s . in the supporting information, number represent a as capturing mab and a h as detection mab). in addition, since gold nanoparticles of suitable size is essential to a successful ica, an assay was performed to optimize the size of gold nanoparticles. in brief, nm, nm, nm and nm aunps were used to label mab a h . with increasing size of gold nanoparticles, the red signal of the t-line also increased, while the red signal of the c-line remained the same (see additional file : figure s . in the supporting information). in addition, the reaction was not blocked at any time during the process despite the increasing size of the gold nanoparticles. we found that aunps of nm was associated with the strongest red signal at the t-line with to no impairment to the reaction process. therefore, nm was chosen as the optimized size for aunps for subsequent experiments (see additional file : figure s . in the supporting information). interestingly, the type of sample pad, conjugate pad, nc membrane and absorbent pad also appeared to have great impact on reaction rate of the new ica. to optimize these factors of the ica, different types of sample pad, conjugate pad, nc membrane and absorbent pad were tested in the optimization experiment. as shown in additional file : figure s . in the supporting materials, the new ica with gl-b as sample pad showed the most uniform red c line without any break. therefore, gl-b was chosen as the optimized sample pad. it can be seen from additional file : figure s . in the supporting materials, the new ica with polyester film as conjugate pad showed the most uniform red c line without any break. thus, polyester film was selected as the optimized conjugate pad. what can be learned from additional file : figure s . was that the new ica with millipore as nc membrane showed the most uniform red c line without any break. therefore, millipore was chosen as the optimized nc membrane. as for the optimization of absorbent pad, the new ica with h as absorbent pad (see additional file : figure s . in the supporting materials) showed strong color signal at the t-line. therefore, h was chosen as the optimal absorbent pad for the new ica. as tween- can remove unbound aunps-mab on the t-line and reduce nonspecific binding. sample solutions with different volumes of tween- ( , , , and μl/ml) were added to icas. results confirmed that no red line on the t-line was observed in the negative sample. at μl/ml upward, stronger red color at the t line of negative sample was observed with increasing volume of tween- added (see additional file : figure s . in supporting information). results for positive sample remained almost the same with increasing volume of tween- . therefore, μl of tween- to ml of sample solution was chosen as the optimized ratio for subsequent experiments. furthermore, the spray volume of aunps-mab was also important to the new ica. as shown in additional file : figure s . in supporting information, no red line at the t-line of the negative sample ica was observed until the spray volume of aunps-mab was at μl/cm and the red color on the t-line of the negative sample ica was more intense with increasing spray volume. however, the red line at the t-line of positive sample test strip remained almost the same. taking nonspecific adsorption and sensitivity into consideration, μl/cm was chosen as the optimal spray volume for subsequent experiments. the new ica was designed for efficient detection of pedv. the performance of the new ica for detecting pedv at various concentrations was tested using a serial dilution of pedv in pbt ( , . , . , . , and μg/ml) under the optimized condition (fig. a) . the limit of detection (lod) was found to be . μg/ml ( . × tcid /ml). to quantitatively analyze the performance of the new ica, gray values obtained from image j were used to draw a standard curve in origin . (fig. b) . the liner detection table the selection results of paired antibodies in double antibody sandwich elisa capture antibody a h h d a e c h h g h a g c f c f detection antibody hrp-a h ---++ ---------- range was . μg/ml to μg/ml ( . × to tcid /ml) and the coefficient (r ) was . . the exact value of pedv concentration could be read directly by comparing results and the photos corresponding to the standard curve. these results indicated that this new ica could determine pedv in a precise and quantitative manner. to confirm the specificity of the new ica, kinds of swine viruses were tested and pedv was used as positive control. these swine viruses were assayed by the new ica at the same concentrations as pedv. the red line at the t-line was obvious in pedv sample, while it was invisible in samples containing other swine viruses (fig. a) . these results indicated high specificity of the new ica. results were further analyzed using gradation histogram made by origin . based on gray values obtained from image j. no significant cross-reaction of other swine viruses was observed in the developed new ica (fig. b) , which further confirmed its high specificity. to verify the stability of the new ica, experiments were carried out at different time points using the same ica and pedv. in both experiments, the positive sample solution showed a red line at t-line while the negative sample solution did not (see additional file : figure s . in the supporting information). these results indicated that the new ica was stable over time. negative swine stool was mixed with pedv to prepare the spiked samples in this study. spiked samples that included . , , , , or μl pedv were tested. the red color at the t-line became more intense with increasing pedv concentration. each spiked sample was analyzed in six repeated experiments and the gray values were calculated using the standard equation corresponding to the standard curve. as shown in table , the recoveries of the new ica ranged from to . % with the highest relative standard deviation (rsd) calculated to be . %. the result indicated that the new ica was ideal for detection of pedv in spiked samples. to analyze the performance of the new ica in detecting pedv in swine stool samples, swine stool samples were collected from different swine farms from south of china. rt-pcr, commercial bionote test strip and the new ica were used to test these swine stool samples, respectively. as shown in table , the total coincidence of bio-note test strip to rt-pcr was . % while that to the new ica was . %, indicating that the new ica was more accurate than bionote test strip. in the present study, an immunochromatographic assay for pedv detection was developed and tested with spiked samples and swim stool samples from field infected pigs. the assay was based on mabs to chyj , which is a new strain of pedv found in south of china and therefore is an appropriate target antigen for pedv detection. first, to prepare pedv specific monoclonal antibody, immune antigen pedv was cultured and purified in the normal way to ensure the quality of immune effect. t he well prepared pedv mabs were used to do a double antibody sandwich elisa matrix, in which these mabs were used as capture antibody and the same mabs labeled with hrp were used as detection antibody. the aim was to find which mab as capture antibody and which hrp-mab as detection antibody can produce the best detection result. that means, which mab pair had the best binding ability to pedv. results showed that a , h , a , a h and h were these mabs that can pair successfully. second, due to the fact that the paired antibodies selected by double antibody sandwich elisa matrix may not be suitable for the new ica due to the differences in materials and environment, the new ica was optimized by selecting the best pair from the selected mabs. a was proved to be the best capturing mab while a h was the best detection mab. this optimization experiment greatly improved the sensitivity of the new ica. third, gold nanoparticles were important for a successful ica. if they were too big, they would block nc membrane and weaken red signal of t and c line. on the other hand, if too small, the red signal of t and c line was weak and it was not easy to observe it. considering both, the aunps of nm were found to be the optimal aunps in this study. the spray volume of aunps-mab was also optimized. if the spray volume was too high, it was easy to produce nonspecific adsorption. however, if it was too low, the result would have low sensitivity. μl/cm was selected considering both sides. forth, different types of sample pad, conjugate pad, nc membrane and absorbent pad had different influences on running speed, releasing amount and nonspecific absorption. so they were optimized. results showed that the optimized condition was gl-b as sample pad, polyester film as conjugate pad, millipore as nc membrane and h as absorbent pad. fifth, tween- in sample solution acted as surface active agent, which can accelerate running speed. a high running speed may be not good because it can reduce sensitivity. therefore, the tween- concentration was optimized and results showed that μl of tween- added to ml of sample solution was the best choice. specific experiment showed that there was no cross reaction between this ica and other swine viruses, indicating that this ica can distinguish pedv from other swine viruses. when detecting pedv in pbt, the lod was . μg/ml ( . × tcid /ml) and the liner detection range was . - μg/ml ( . × - tcid /ml). the pedv concentration in cultured pedv was pretty high. therefore, it can be used to detect cultured pedv. the data obtained by the new ica were compared with those obtained by both rt-pcr and commercial strip. it has been described that rt-pcr is the most sensitive and trustworthy method for pedv detection. in this study, the commercial strip was included for comparison purpose. the data analyzed in the present work showed that the total coincidence of bionote test strip to rt-pcr was . % while that to the new ica was . %, indicating that the new ica was more comparable to rt-pcr than commercial test strip. these results suggested that the new ica was suitable for monitoring pedv. the new ics shows pretty good detection ability of detecting pedv in swine stools, which will help pig farms in diagnosis of pedv. based on the success of making this new ics, double pathogen detection is going to be done. it can satisfy the need of pig farm. in addition, pedv fluorescent test strips will be done for precise quantitative detection. we believe that these new icas will bring great help to agriculture. coronavirus genome structure and replication further analysis of the genome of porcine epidemic diarrhoea virus porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines porcine epidemic diarrhoea virus as a cause of persistent diarrhoea in a herd of breeding and finishing pigs an apparently new syndrome of porcine epidemic diarrhoea porcine epidemic diarrhea virus infection: etiology, epidemiology, pathogenesis and immunoprophylaxis complete genome sequence of porcine epidemic diarrhea virus strain aj isolated from a suckling piglet with acute diarrhea in china new variants of porcine epidemic diarrhea virus. china emerging infectious diseases multiplex reverse transcription-pcr for rapid differential detection of porcine epidemic diarrhea virus, transmissible gastroenteritis virus, and porcine group a rotavirus a rapid method for antigenspecific hybridoma clone isolation direct and rapid detection of porcine epidemic diarrhea virus by rt-pcr isolation and serial propagation of porcine epidemic diarrhea virus in cell cultures and partial characterization of the isolate porcine epidemic diarrhea virus: an overview of current virological and serological diagnostic methods an elisa optimized for porcine epidemic diarrhoea virus detection in faeces development of rapid immunochromatographic strip test for the detection of porcine epidemic diarrhoea virus reverse transcription crosspriming amplification-nucleic acid test strip for rapid detection of porcine epidemic diarrhea virus a novel diagnostic approach to detecting porcine epidemic diarrhea virus: the lateral immunochromatography assay triple lines gold nanoparticle-based lateral flow assay for enhanced and simultaneous detection of leishmania dna and endogenous control microchip based and immunochromatographic strip assays for the visual detection of interleukin- and of tumor necrosis factor alpha using gold nanoparticles as labels multicolor immunochromatographic strip test based on gold nanoparticles for the determination of aflatoxin b and fumonisins fecal shedding of a highly cell-cultureadapted porcine epidemic diarrhea virus after oral inoculation in pigs complete genome sequence of chyj , a highly virulent strain of porcine epidemic diarrhea virus in south china a new lateral-flow immunochromatographic strip combined with quantum dot nanobeads and gold nanoflowers for rapid detection of tetrodotoxin a turn-on competitive immunochromatographic strips integrated with quantum dots and gold nano-stars for cadmium ion detection identification and quantification of eight listeria monocytogene serotypes from listeria spp. using a gold nanoparticle-based lateral flow assay this work was conducted in the guangdong province key laboratory of molecular immunology and antibody engineering and guangdong haid institute of animal husbandry & veterinary. this manuscript has been thoroughly edited by a native english speaker from an editing company. editing certificate will be provided upon request. this work was supported by the national key research and development program of china ( yfd ). the funders had no role in study design, or the collection, analysis, and interpretation of data. in addition, they were not involved in the writing of the report or the decision to submit the article for publication. the datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. molecular immunology and antibody engineering, jinan university, guangzhou , people's republic of china. in conclusion, a new ica based on mabs prepared by csfia was developed in this study. the gold nanoparticle signal of the test strip was of superior strength with very low background noise. the lod of the new ica was . μg/ml ( . × tcid /ml) and the liner detection range was . to μg/ml ( . × to tcid /ml). in addition, the new ica exhibited high specificity with little interference from swine stool, and could achieve recoveries ranging from to . % in spiked samples. compared to rt-pcr and elisa, the new ica does not require sophisticated instruments and training. relative to commercial test strips, the new ica provides more accurate detection of pedv in swine stool samples from south of china. our study highlighted the potential of the on-site application of this new ica for diagnosis and prevention of ped. additional file : figure s . authors' contributions hb, fx and yj performed the laboratory tests and drafted the manuscript. yt and aj conceived the study and participated in its design. lw and sd participated in the data analysis and results interpretation. all authors critically read and contributed to the manuscript, approving its final version.ethics approval and consent to participate all samples were obtained from healthy or naturally infected animals in the field by qualifiers. therefore, no aggressive operation was conducted against pigs for sampling purpose and no pigs were sacrificed in this study. the study used mice for generation of mabs and those mice had to be sacrificed. the mice were euthanized by cervical dislocation. thumb and forefinger were used to press down on the mice's head. the other hand grabbed the mice's tail and pulled it slightly back to the top to make the cervical spine disengage. the spinal cord was separated from the brain and the animal died immediately. there was no destruction of brain or section of major blood vessels in the neck during the process. all animal experiments were performed using protocols approved by laboratory animal ethics committee of jinan university. not applicable. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. key: cord- -yoefyowv authors: sayama, yusuke; demetria, catalino; saito, mariko; azul, rachel r; taniguchi, satoshi; fukushi, shuetsu; yoshikawa, tomoki; iizuka, itoe; mizutani, tetsuya; kurane, ichiro; malbas, fidelino f; lupisan, socorro; catbagan, davinio p; animas, samuel b; morales, rieldrin g; lopez, emelinda l; dazo, karen rose c; cruz, magdalena s; olveda, remigio; saijo, masayuki; oshitani, hitoshi; morikawa, shigeru title: a seroepidemiologic study of reston ebolavirus in swine in the philippines date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: yoefyowv background: ebola viruses cause viral hemorrhagic fever in humans and non-human primates and are endemic in africa. reston ebolavirus (rebov) has caused several epizootics in cynomolgus monkeys (macaca fascicularis) but is not associated with any human disease. in late , rebov infections were identified in swine for the first time in the philippines. methods: a total of swine sera collected at two rebov-affected farms in , in pangasinan and bulacan, were tested for the presence of rebov-specific antibodies using multiple serodiagnosis systems. a total of swine sera collected in a non-epizootic region, tarlac, were also tested to clarify the prevalence of rebov infection in the general swine population in the philippines. results: some % of swine sera at the affected farms were positive for rebov antibodies in the multiple serodiagnosis systems. on the other hand, none of the swine sera collected in tarlac showed positive reactions in any of the diagnosis systems. conclusions: the high prevalence of rebov infection in swine in the affected farms in suggests that swine is susceptible for rebov infection. the multiple serological assays used in the study are thought to be useful for future surveillance of reobv infection in swine in the philippines. the ebola virus (ebov) is an enveloped, negativestrand rna virus belonging to the family filoviridae in the order of mononegavirale [ ] . four of the five ebolavirus species, zaire (zebov), sudan, tai forest, and the recently discovered bundibugyo ebolavirus, are endemic in continental africa and cause a severe form of viral hemorrhagic fever with high mortality in humans and non-human primates [ ] [ ] [ ] [ ] [ ] . reston ebolavirus (rebov) is sporadic in the philippines and has caused several epizootics in cynomolgus macaques [ ] . rebov was first isolated in from cynomolgus macaques imported from the philippines for medical research in the united states [ ] [ ] [ ] [ ] . about , monkeys died or were euthanized in a quarantine facility in reston, virginia. subsequently, animal handlers at the philippine exporter and four employees of the quarantine facility were found to have antibodies to the virus, indicating that they had been infected [ , ] . epizootics in monkeys in the philippines were then reported in and , and all the epizootics have been traced back to a single monkey facility, in calamba, laguna in the philippines [ , [ ] [ ] [ ] [ ] . since the closure of the facility in , no rebov epizootics in cynomolgus monkeys have been reported. in october , rebov infection was confirmed for the first time in swine associated with multiple epizootics of respiratory and abortion-related diseases in the philippines [ ] . in several pools of swine samples collected from geographically distant swine farms, co-infection with rebov and porcine reproductive and respiratory syndrome virus (prrsv) was confirmed [ ] . serological studies of limited scale on swine sera in the affected farms failed to detect rebov antibodies in elisa, although prrsv antibodies were detected [ ] . it is still unclear how rebov was spread among swine during the epizootic. moreover, it is not clear if rebov infection in the swine population is either sporadic and incidental or common in the philippines. to try to answer these questions, we prepared multiple serodiagnosis systems for detecting rebov infection in swine and analyzed swine sera obtained from the affected farms and from farms not associated with any epizootics in the philippines. the results showed a high prevalence of rebov infection in swine in the affected farms at the epizootics in ; however, rebov antibodies were not detected in the swine population not associated with the epizootics, indicating that rebov infection in swine in the philippines is not common, at least in some parts of tarlac. detection of rebov-np and -gp antibodies in swine using ifa swine sera were analyzed for the presence of rebov-np and -gp antibodies in ifa specific to rebov-np and -gp, respectively. in the ifa, none of the swine sera collected in japan showed a positive reaction (data not shown), and so they were considered to be rebov-np and -gp antibody negative. in the ifa specific to rebov-np, antibody positive swine sera showed characteristic granular staining patterns in the cytoplasm ( figure a ), which were indistinguishable from those of rebov-infected cynomolgus monkey sera [ ] and rebov-np immunized rabbit sera (data not shown). antibody-negative swine sera showed no reaction (figure b) . in the ifa specific to rebov-gp, antibody positive swine sera showed characteristic cellular surface staining patterns ( figure c ), which were indistinguishable from those of rebov-infected cynomolgus monkey sera and rebov-gp immunized rabbit sera (data not shown). antibody-negative swine sera showed no reaction ( figure d ). in bulacan, ( . %) and ( . %) of the swine sera showed positive reactions in the np-and gp-specific ifa, respectively. in pangasinan, each ( . %) of the swine sera showed positive reactions in the np-and gp-specific ifa. in total, ( . %) and ( . %) of the swine sera collected at the affected farms were rebov-np and -gp antibody positive in the ifa, respectively (table ) . on the other hand, none of the swine sera collected in tarlac in the philippines showed any positive reaction ( table ) . the vsv-pseudotype bearing rebov-gp efficiently infected vero e cells which are known to be susceptible to rebov infection. the infectious titer of the vsvpseudotype reached . x iu/ml when measured on vero e cells. infection with the vsv-pseudotype was neutralized with rabbit serum to rebov-gp (data not shown). swine sera were analyzed in the nt using the vsv-pseudotype. in the nt, none of the swine sera collected in japan neutralized the infection with the vsv-pseudotype on vero e cells at serum dilutions of in . these were therefore considered to be rebov nt antibody negative. in the affected farms, ( . %) of the swine sera in bulacan and ( . %) of the swine sera in pangasinan showed positive reactions in the nt, respectively at a serum dilution of in . in total, ( . %) of the swine sera in the affected farms showed nt antibody positive (table ). nt titers of the sera were then obtained for the nt antibody positive sera in the affected farms. nt titers ranged between and , with average of and median of (data not shown). in tarlac, none of the swine sera showed any positive reaction ( table ) . detection of rebov-np and -gp specific antibodies in swine using igg-elisa igg antibodies to the rebov-np and -gp were detected by recombinant rebov protein-based igg-elisa. the od values to the np and gp of each serum sample at a dilution of in were plotted ( figure a and b), and roc and tg-roc curves were also drawn ( figure c to f). since the od values of negative samples were very low, the cut off values defined as the values at intersection points of the sensitivity curve and specificity curve were . and . for rebov-np and -gp, respectively. at the cut off values, sensitivity and specificity of the assay are over % in both igg-elisas ( figure e and f). in bulacan, ( . %) and ( . %) of the swine sera showed positive reactions in the np-and gp-specific igg-elisa, respectively. in pangasinan, ( . %) and ( . %) of the swine sera showed positive reactions in the np-and gp-specific igg-elisa, respectively. in total, ( . %) and ( . %) of the swine sera collected at the affected farms were rebov-np and -gp antibody positive in the igg-elisa, respectively (table ) . conversely, of the swine sera collected in tarlac in the philippines showed a positive reaction in the gp specific igg-elisa and of the swine sera collected in japan showed a positive reaction in the np-and gp-specific igg-elisa (table ) . however, these results are considered to be false positives because the od values were close to the cut off level defined by the assay, additionally all the samples collected in tarlac and japan tested using the alternative serological assays were negative. we next examined the agreement between the serological assays used in the present study. the data obtained in each assay were binarized to either positive or negative result. these binarized data were then statistically analyzed by pair-wise comparisons in nonparametric one-way anova. this analysis showed that there were no significant differences between the serological assays (p > . , data not shown). the result supports the contention that all of the five serological assays used in the present study posses similar discriminatory capacity. thus we are confident that many rebov antibody positive samples showed a positive reaction in all of the five assays. zebov and marburg virus were identified in african fruit bat species [ , ] . more recently, marburg virus was successfully isolated from a fruit bat, rousettus aegyptiacus [ ] , suggesting that fruit bats are reservoir animals of filoviruses. in the philippines, we have recently demonstrated that an asian fruit bat, rousettus amplexicaudatus, has antibodies to rebov [ ] . since the rebov genome has not yet been detected in the bat, conclusive evidence that the bat species is a reservoir, or one of the reservoir animals, of rebov is not available. nevertheless, it is possible that rebov was transmitted to swine from these bats since these bats inhabit many areas of the country, including the regions around the affected facilities both in pangasinan and bulacan. in this study, we have aimed to clarify how rebov infection was spread among swine during the rebov epizootics. we have tested swine sera collected from the rebov affected farms using ifa and igg-elisa specific for rebov-np and -gp, and nt. nt is the gold standard of serological assay in many virus infections. however, since rebov needs to be cultured in highcontainment laboratories, we performed an alternative nt using the vsv-pseudotype bearing rebov-gp. this avoided the use of infectious rebov, enabling the work to be carried out at low containment. previously it has been shown that vsv-pseudotype bearing ebolavirus gp mimicks ebolavirus infection [ ] , approxymately % of the swine sera from rebov affected farms were rebov antibody positive. this indicated that swine are susceptible to rebov infection. unfortunately, we could not analyze the igm antibody responses in swine, since after the sera were heat inactivated the gamma globulin fractions were precipitated with ammonium sulfate, and reconstituted in pbs prior to be testing. an indication of the igm responses to rebov would have provided evidence of a recent infection. thus, it is still unclear if rebov infection was spread during epizootics or whether a population of the animals in the farms was infected with rebov prior to the epizootics. the swine not associated with the epizootics, in tarlac, are considered to be free from rebov infection. these samples were collected in , over years after the epizootic, and from animals born after the epizootic. moreover, we could not analyze the swine specimens near the affected farms in . thus, in this study, it is not clear if rebov infection in was limited in the affected farms. further study is necessary to conclude if the swine population in the philippines is generally free from rebov infection. recently, it has been shown that the experimental infection of swine with rebov alone resulted in subclinical infection with rapid clearance of the virus [ ] . alternatively, zebov has been shown to replicate to high titers in experimentally infected swine and to cause severe lung pathology resulting in transmission of the virus to naïve animals [ ] . thus, swine has been shown experimentally to be highly susceptible to zebov infection. furthermore, some amino acid mutations in np and/or vp in zebov resulted in adaptation of the virus to guinea pigs and mice [ , ] . thus, we cannot rule out the possibility that mutations introduced in the rebov genome during serial transmission in swine will result in adaptation of the virus to swine in future. in this regard, a regular serological survey of rebov infection in swine in the philippines is desirable. the serodiagnosis systems presented in this study might be useful for such a survey. the high prevalence of rebov infection in swine at the affected farms in suggests that swine are susceptible for rebov infection. the multiple serological assays used in the study are thought to be useful for future surveillance of reobv infection in swine in the philippines. a total of swine sera were collected from two rebov affected pig farms, located in pangasinan and bulacan in (figure ). of these, sera were collected from swine at the farm in bulacan, and were collected from those in pangasinan. swine samples in the affected farms were collected under quarantine of the philippines. the sera were kept frozen at the research institute for tropical medicine (ritm) in the philippines until use. ninety-eight swine sera were collected from july to september from swine aged between and months (median of . months) in tarlac in the philippines, where no swine epizootic has been documented. the swine specimens at tarlac were collected and used under approval of irb (no. - ) of ritm, and informed consent was obtained from the farm owners. forty-nine swine sera collected at slaughterhouse in - in japan, kindly supplied by dr. t-c li at the national institute of infectious diseases, were used as rebov antibody negative control sera. swine sera were inactivated at °c for minutes, and then the gamma globulin fractions were precipitated with ammonium sulfate and reconstituted in phosphate buffered saline (pbs). the entire cdna of rebov-gp orf was amplified from the swine lymph node specimen used for amplification of the cdna of np by rt-pcr using the primers rebov-gp/f ( '-cga agc ttc gaa cat ggg gtc agg ata tca act- ') and rebov-gp/r ( '-cga agc ttc aac aca aaa tct tac ata tac aaa g- ') (the hind iii site is underlined). the complete nucleotide sequence of the amplicon was determined to be identical to that of reston a (gen-bank accession number fj ), indicating that the specimen was collected from the same farm as that of sample group a from which reston a was isolated [ ] . the hind iii fragment of the amplicon was subsequently cloned into pks [ ] , and the pks plasmid with rebov-gp, pks -prebov-gp, was used for transfection. hela cells were transfected with pks -prebov-gp using a fugene hd (roche diagnostics, mannheim, germany) according to the manufacturer's instructions. the cells transfected with the plasmids were selected with μg/ml of blasticidin shydrochloride (invitrogen, ca, usa) in dulbecco's modified eagle medium (dmem) supplemented with % fetal calf serum (fcs). the selected cells were analyzed for the expression of rebov-gp in ifa using anti-rebov-gp rabbit serum. the cells expressing rebov-gp were spotted on multiwell slide glasses, fixed in acetone, and used as antigens for ifa specific to rebov-gp. the ifa specific to rebov-np was performed as described previously [ ] , with slight modifications. mock-transfected hela cells were used as negative control antigens in the ifa. the antigen slides were incubated with serially diluted swine sera under humidified conditions at °c for hour. the antigen slides were washed in pbs, then reacted with rabbit antipig igg conjugated with fluorescein isothiocianate (fitc) (bethyl, tx, usa) at a dilution of in at °c for hour. the slides were washed in pbs, covered with cover glasses, and examined for staining patterns under a fluorescence microscope fitted with appropriate barrier and excitation filters for fitc visualization. the antibody titer in the ifa was determined as the reciprocal of the highest dilution showing positive staining. generation of vsv-pseudotype bearing rebov-gp was performed as described previously [ ] [ ] [ ] . briefly, t cells were transfected with pks -prebov-gp and cultured for hours, and then the cells were infected with vsvΔg* (kindly supplied by prof. m.a. whitt, university of tennessee) [ , ] and cultured for hours. the culture supernatants were then collected, filtered through a . μm-pore-size filter, and stored at - °c until use. the infectious titer (infectious unit, iu) of vsv-pseudotype on vero e cells was determined by counting the number of green fluorescent protein (gfp)-expressing cells. the sera were diluted twofold from in with dmem containing % fcs and , iu of vsvpseudotype bearing rebov-gp. the mixture was incubated for hour at °c, then inoculated onto vero e cells seeded on -well plates. the numbers of vsvpseudotype infected cells were determined by counting of the number of gfp-positive cells according to the methods described previously [ , , ] . nt titers of the tested sera were defined as the reciprocals of the highest dilutions at which more than % inhibition of infectivity was observed. serum samples were considered to be nt antibody negative when less than % inhibition of infectivity was observed at a dilution of in . cdna of rebov nucleoprotein (np) open reading frame (orf) from a swine lymph node specimen collected at the farm in bulacan was amplified by reverse transcription polymerase chain reaction (rt-pcr), and the nucleotide sequence of the amplicon was determined to be identical to that of reston a. the cdna was subcloned into pgem-teasy (promega, wi, usa) and used for the following pcr template. pcr was performed using the plasmid clone to add bamhi linker with primers rebov-np/f ( '-ggg cta gcg gat cca agt cga tat gga tcg tgg gac c- ') and rebov-np/r ( '-ttg cgg ccg cgg atc cct gat ggt gct gca aga ttg- ') (the restriction site is underlined). a bamhi-digested fragment of the plasmid was then subcloned into pacym -c-his plasmid, a derivative of pacym plasmid [ ] carrying eight histidine coding sequences just downstream of the bamhi site, to construct pacym -his-prebov-np. a recombinant baculovirus, ac-his-prebov-np, was generated using a previously described method [ ] . the recombinant baculovirus, which expresses the ectodomain of rebovglycoprotein (gp) with a histidine-tag at its carboxyl terminus [ ] , was used to prepare recombinant rebov-gp for igg-elisa. a baculovirus (ac-Δp) that lacks the polyhedorin gene was used to prepare a negative-control antigen in insect cells. tn insect cells were infected with ac-his-prebov-np and ac-his-rebov-gp and then incubated at °c for hours and hours, respectively. the cells were washed in pbs, lyzed in pbs containing % np and m urea, and then clarified by centrifugation at , rpm for min. the supernatant fraction was collected, and recombinant rebov-np and rebov-gp were purified using a ni + -resin purification system (qiagen, düsseldorf, germany) according to the manufacturer's instructions. the expression and purification of rebov-np and rebov-gp were confirmed in % sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds-page) and coomassie brilliant blue r- staining tn cells infected with ac-Δp were processed similarly and used as negative control antigen in the elisas. the purified antigens and negative control antigen were kept at - °c until use. swine sera were analyzed for the presence of antibodies to rebov-np and rebov-gp in igg-elisa, essentially as described previously [ , , ] . briefly, half of the wells of the elisa plates (falcon, nj, usa) were coated with a predetermined optimal quantity (approximately ng/well) of each purified recombinant protein, and the rest of the wells were coated with the negative control antigens. after washing the plates three times in pbs containing . % tween- (t-pbs; sigma-aldrich, mo, usa), each well was incubated with μl of t-pbs containing % skim milk (mt-pbs; yukijirushi, hokkaido, japan) for hour at °c. after washing the plates three times in t-pbs, the antigencoated and negative-control-antigen-coated wells were inoculated with the test samples ( μl/well) in mt-pbs at a dilution of in , incubated for hour at °c , and washed in t-pbs. then, each well was incubated with a protein a/g conjugated with horseradish peroxidase at a dilution of in , (pierce, il, usa) in mt-pbs for hour at °c. the plates were washed three times, and μl of abts solution (roche diagnostics, mannheim, germany) was added to each well. the plates were incubated for min, and the optical density (od) was measured at nm with a reference at nm. the adjusted ods for each tested sample were calculated by subtracting the ods of the negativecontrol-antigen-coated wells from those of the corresponding rebov-antigen-coated wells. sensitivity, specificity and predictive values for positive and negative tests were calculated by standard methods. sensitivity and specificity were defined as the probability that the target assay result was positive when the ifas specific to rebov-np and -gp and nt showed positive and the probability that the target assay result was negative when the ifas and nt showed negative, respectively. receiver operating characteristics (roc) and two graph-roc (tg-roc) curves were analyzed using stat flex software (artech co. ltd., osaka, japan) [ , ] . to examine the agreement between the serological assays used in the present study, we employed friedman test with dunn's post-hoc test [ , ] using graphpad prism using pair-wise comparisons in nonparametric one-way anova. molecular biology and evolution of filoviruses bull world health organ the reemergence of ebola hemorrhagic fever, democratic republic of the congo, . commission de lutte contre les epidemies a kikwit ebola hemorrhagic fever, democratic republic of the congo, : determinants of survival outbreak of ebola haemorrhagic fever: uganda newly discovered ebola virus associated with hemorrhagic fever outbreak in uganda seroepidemiological study of filovirus related to ebola in the philippines rapid identification of ebola virus and related filoviruses in fluid specimens using indirect immunoelectron microscopy use of immunoelectron microscopy to show ebola virus during the united states epizootic association of ebola-related reston virus particles and antigen with tissue lesions of monkeys imported to the united states outbreak of fatal illness among captive macaques in the philippines caused by an ebola-related filovirus update: evidence of filovirus infection in an animal caretaker in a research/service facility histopathology of natural ebola virus subtype reston infection in cynomolgus macaques during the philippine outbreak in ebola (subtype reston) virus among quarantined nonhuman primates recently imported from the philippines to the united states experimental infection of cynomolgus macaques with ebola-reston filoviruses from the - u.s. epizootic reston ebolavirus in humans and animals in the philippines: a review discovery of swine as a host for the reston ebolavirus development of an immunofluorescence method for the detection of antibodies to ebola virus subtype reston by the use of recombinant nucleoproteinexpressing hela cells swanepoel r: fruit bats as reservoirs of ebola virus marburg virus infection detected in a common african bat isolation of genetically diverse marburg viruses from egyptian fruit bats reston ebolavirus antibodies in bats, the philippines. emerg infect dis ebola virus glycoprotein: proteolytic processing, acylation, cell tropism, and detection of neutralizing antibodies ebola reston virus infection of pigs: clinical significance and transmission potential replication, pathogenicity, shedding, and transmission of zaire ebolavirus in pigs molecular characterization of guinea pig-adapted variants of ebola virus molecular determinants of ebola virus virulence in mice immunofluorescence technique using hela cells expressing recombinant nucleoprotein for detection of immunoglobulin g antibodies to crimean-congo hemorrhagic fever virus evaluation of a novel vesicular stomatitis virus pseudotype-based assay for detection of neutralizing antibody responses to sars-cov pseudotyped vesicular stomatitis virus for functional analysis of sars coronavirus spike protein a system for functional analysis of ebola virus glycoprotein baculovirus expression vectors: the requirements for high level expression of proteins, including glycoproteins linearization of baculovirus dna enhances the recovery of recombinant virus expression vectors laboratory diagnostic systems for ebola and marburg hemorrhagic fevers developed with recombinant proteins immunoglobulin g enzyme-linked immunosorbent assay using truncated nucleoproteins of reston ebola virus a modified roc analysis for the selection of cut-off values and the definition of intermediate results of serodiagnostic tests receiver-operating characteristic (roc) plots: a fundamental evaluation tool in clinical medicine statistical comparisons of classifiers over multiple data sets multiple comparisons among means a seroepidemiologic study of reston ebolavirus in swine in the philippines we gratefully acknowledge ms momoko ogata at the national institute of infectious diseases, japan, and the staff of the research institute for tropical medicine and the bureau of animal industry, the philippines, for their technical assistance. we also acknowledge dr. tian cheng li at the national institute of infectious diseases, japan, for supplying the swine sera collected in japan. we sincerely acknowledge dr. roger hewson at the centre for emergency preparedness and response, health protection agency, uk, for critical reading the manuscript. this work was supported in part by a grant-in-aid to s.m. from the ministry of health, labor and welfare of japan (grants h -shinkou-ippan- ) and to h.o. for the japan initiative for global research network on infectious diseases (j-grid) from the ministry of education, culture, sports, science, and technology of japan. the authors declare that they have no competing interests.authors' contributions ys participated in the study design, the experimental work, the analysis interpretation of the data and drafted the manuscript. cd, ms (tohoku university) key: cord- -dnuu jok authors: bowman, andrew s; krogwold, roger a; price, todd; davis, matt; moeller, steven j title: investigating the introduction of porcine epidemic diarrhea virus into an ohio swine operation date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: dnuu jok background: porcine epidemic diarrhea virus (pedv) is a highly transmissible coronavirus that causes a severe enteric disease that is particularly deadly for neonatal piglets. since its introduction to the united states in , pedv has spread quickly across the country and has caused significant financial losses to pork producers. with no fully licensed vaccines currently available in the united states, prevention and control of pedv disease is heavily reliant on biosecurity measures. despite proven, effective biosecurity practices, multiple sites and production stages, within and across designated production flows in an ohio swine operation broke with confirmed pedv in january , leading the producer and attending veterinarian to investigate the route of introduction. case presentation: on january , , several sows within a production flow were noted with signs of enteric illness. within a few days, illness had spread to most of the sows in the facility and was confirmed by rt-pcr to be pedv. within a short time period, confirmed disease was present on multiple sites within and across breeding and post weaning production flows of the operation and mortality approached % in neonatal piglets. after an epidemiologic investigation, an outsourced, pelleted piglet diet was identified for assessment, and a bioassay, where naïve piglets were fed the suspected feed pellets, was initiated to test the pellets for infectious pedv. conclusions: the epidemiological investigation provided strong evidence for contaminated feed as the source of the outbreak. in addition, feed pellets collected from unopened bags at the affected sites tested positive for pedv using rt-pcr. however, the bioassay study was not able to show infectivity when feeding the suspected feed pellets to a small number of naïve piglets. the results highlight the critical need for surveillance of feed and feed components to further define transmission avenues in an effort to limit the spread of pedv throughout the u.s. swine industry. porcine epidemic diarrhea virus (pedv) is a coronavirus of the genus alphacoronavirus. disease from pedv is characterized by vomiting, anorexia, and watery diarrhea in swine. the virus is particularly deadly for neonatal pigs for which malabsorption and dehydration [ ] [ ] [ ] can result in mortality rates approaching %- % [ , ] . disease caused by pedv is clinically indistinguishable from transmissible gastroenteritis virus and cannot be diagnosed on presentation alone [ ] . because attempts at virus isolation have only resulted in limited or temporary success, with virus isolation rates as low as % [ ] , diagnosticians heavily rely upon rt-pcr tests to directly detect viral nucleic acid and diagnose pedv. pedv was first identified in belgium in and in the s and s, pedv was found throughout belgium, england, germany, france, the netherlands, and switzerland [ ] . since the european emergence, pedv has affected the pork industries in philippines, south korea, and china [ ] . in may , the united states confirmed the first cases of pedv on farms in iowa and indiana [ ] , after which the virus spread quickly throughout the country. while the mode of pedv introduction to the u.s. remains unknown, comparison of available sequence data indicates the pedv strains detected in the unites states have an ancestry linked to pedv strains detected in china. at the end of , sequenced u.s. strains had greater than . % sequence identity and several strains shared unique nucleotides with a chinese pedv strain isolated in the anhui province (ah ) [ , ] . unexpected genetic similarity of u.s. pedv strains to a bat coronavirus isolated in southeastern china may provide evidence for the role of cross-species transmission in the development of emergent strains that spread to the united states [ ] . transmission of pedv occurs via the fecal-oral route [ ] and fecal contamination of fomites may play a role in the introduction of the virus to swine. an investigation of livestock trailers at harvest facilities in the united states showed that all truck drivers stepped into the harvest facility at least once, and the proportion of pedv contaminated trailers increased from . % before unloading to . % after unloading [ ] . these data indicate that contaminated transport vehicles and personnel could be associated with the rapid spread of the virus throughout the us. at present, pedv prevention and control in the u.s. are heavily dependent on biosecurity procedures. while transportation equipment might play a role in the spread of pedv, on-farm investigations into several pedv outbreaks in the united states have indicated that contaminated feed could be a pathway of viral introduction; however, scientific support of this route is regularly debated. dee et al. showed that material collected from the inside of feed bins during a pedv outbreak was infectious when concentrated and inoculated into pigs [ ] . one canadian report showed spray-dried porcine plasma, a component used in some swine feed, was infectious to pigs, but the complete feed containing spray-dried porcine plasma was not infectious in an experimental setting [ ] . on the other hand, a study team has provided contrary evidence with an unsuccessful attempt to infect pigs with spray-dried porcine plasma and data that indicates pedv is inactivated during spray-dried porcine plasma production process [ , ] . in january , an outbreak of pedv was confirmed in a multi-site, multiple flow swine operation in ohio. after a thorough epidemiologic investigation, contaminated feed was identified as the likely source of pathogen introduction, a finding supported by a positive rt-pcr result from testing the feed source. of note, rt-pcr detects viral rna, and thus can only confirm the presence of viral nucleic acid in a sample, not necessarily presence of viable and infectious virus. since pedv isolation is very difficult in numerous testing and research laboratories, virus isolation attempts from feed pellets could not be relied on to detect viable, infectious virus. consequently, a bioassay was initiated where samples of feed cryopreserved by the attending veterinarian during the outbreak were later fed to naïve piglets in an attempt to demonstrate feed infectivity. this report will discuss the aforementioned epidemiologic investigation and subsequent bioassay findings. the ohio swine operation (figure ), consisting of multi-site, farrow-to-finish production flows (referred to as flows a-c, each having two breed-wean sites) and a multiplier herd (referred to as d, with a single breedwean site) had no prior cases of pedv and was determined to have effective biosecurity measures in place evidenced by the absence of porcine reproductive and respiratory syndrome virus (prrsv) during more than the prior seven years. routine oral fluid testing of pigs in flow b on january , and surveillance testing in flow c in november and december were all negative for pedv. at time of weaning, pigs move from breed-wean premises to wean-to-finish barns for flow a and to nursery facilities and then finisher sites for flows b and c. weaned pigs from flow d, the multiplier herd, are raised in gilt developer units or wean-to-finish barns. on the morning of january , , four lactating sows from the one of the breed-wean units in flow a (unit a ) were noted with vomiting and diarrhea. the illness spread rapidly and by : pm, litters showed signs of diarrhea, vomiting, and dehydration. within a few days, % of sows on the site showed similar clinical signs. fecal samples taken january , were positive for pedv using rt-pcr. forty-two percent mortality was observed in piglets in the a farrowing unit. beyond the sow unit, a wean-to-finish barn in flow a that received pigs on january th from both flow a breed-wean units (a and a ) reported loose stools on january th and had confirmation of pedv with rt-pcr positive fecal samples collected the same day. also within flow a, one wean-to-finish barn that was filled with piglets from both flow a breed-wean units (a and a ) on january th and th had fecal samples test pedv rt-pcr positive on january , . in addition, on january th , a third wean to finish barn that received pigs from both flow a sow farms on january th had fecal samples test pedv positive. a schematic of flow a is shown in figure a . while no pedv-like disease was observed in either breed-wean units in flow c, pigs in nurseries within flow c did test pedv rt-pcr positive between january th and january th , ( figure c ). on january , one breed-wean unit within flow b (b ) began experiencing pedv-like disease. on that same day, an oral fluid sample from one of the nurseries in flow b that received pigs from both flow b breed-wean units (b and b ) on january th , th , and th , tested pedv pcr positive ( figure b ). also on january nd , two finishing barns in flow b had a pedv pcr positive oral fluid test. by january th , the second breed-wean unit in flow b (b ) was also experiencing the disease. overall, mortality among neonatal piglets was close to % in flow b. five american association of swine veterinarians (aasv) pedv questionnaires were completed by a usda epidemiologist and an ohio department of agriculture veterinary medical officer in conjunction with swine operation representatives and the operation's local veterinarian. several potential pathways of pathogen introduction to the swine operation, including human introduction, delivery of contaminated supplies, aerosol spread, contaminated pig transport vehicles, and contaminated feed or feed ingredients were considered and evaluated. it is unlikely pedv was introduced to the operation by visitors or workers. there were no foreign visitors, and no employees had visited foreign countries within days of the outbreak. nor did any employee have swine at their place of residence or associated farm enterprises. all swine operation employees and non-employee contractors follow meticulous biosecurity procedures to enter a facility, and movement of people from one facility to another within the same day is limited to production managers only, which typically occur only within the same flow. effectiveness of the biosecurity measures in place was evidenced by the absence of prrs cases for over seven years. veterinary, vaccine, and semen supplies delivered by supply vendors were also considered as a potential source of pedv introduction to the swine operation, but were subsequently ruled out as likely sources for several reasons. first, supplies are delivered to buildings separate from the swine housing areas and they are not shared among different flows. disease, however, broke out separately in geographically and personnel isolated units from different flows. in addition, supplies were disinfected in a fume chamber within the enclosed room whereby the incoming materials were placed on an elevated metal grate and a mister system applied a quaternary ammonium/glutaraldehyde combination disinfectant (synergize, preserve international, reno, nv) and allowed to stand for minutes before entry into site. this practice was considered to greatly reduce the likelihood of contaminated supplies as the potential route of pedv introduction. airborne spread could be considered with pedv [ ] , as coronaviruses classified within the same group as pedv (group coronaviruses) include those that cause enteric or respiratory infection. porcine respiratory coronavirus is a mutant of transmissible gastroenteritis virus and is an example of a group coronavirus that is spread through droplets and aerosols [ ] . aerosols or droplets are unlikely to be responsible for the spread of disease on this swine operation because most units are not located geographically close to each other, and disease broke on multiple separate units from separate flows across a period of days. additional factors that could be involved in virus transmission such as water supply and shavings used during transport of young pigs are not probable because pigs on all sites have equal exposure to these factors but not all sites were involved in the outbreak. lowe et al. have shown that contaminated transport vehicles are likely to be involved in rapid spread of pedv because it is common to transport pigs to harvest facilities on vehicles that have not been disinfected between loads [ ] . in relation to the swine operation involved in this outbreak, it is improbable that contaminated vehicles were involved. first, the operation is closed, meaning no swine are brought on site unless they are owned by the entity and managed under the stringent biosecurity procedures displayed by the operation. second, the operation maintains truck wash facilities where written protocols are followed to thoroughly clean, wash and disinfect all company trucks. the production company regularly audits the truck wash facilities and was actively testing trucks, trailers, drying equipment, and wash bays for pedv; all samples taken prior to the outbreak and during the first week of the outbreak were negative for pedv. cull animals are hauled on cull-only trailers controlled by the production system and are washed, disinfected, dried and inspected prior to use. cull animals are transferred to a neutral location where the animals are transferred onto a third party hauler's washed and disinfected trailer for market delivery. finisher trucks are not disinfected at company truck washes but rather at truck washes external to the production system. given lack of production system control over these external truck washes, finishing trucks are perceived as a higher biosecurity risk to the operation; however, trucks transporting finisher swine go only to harvest facilities and do not come in contact with pigs or sows from breedwean units within the operation. this operation primarily uses feed produced by the operation's on-site feed mill, with exception of an outsourced starter pellet fed to piglets at the time of weaning and a commercial meal mix used to start nursery pigs on pellets. it was determined that neither feed supplied by the operation's own mill, nor the commercial meal mix were likely to be involved in the transmission of pedv to pigs on the operation. prior to the outbreak, the same internal feed ingredients and commercial meal mix had been used with no ill effects. also, internal feed ingredients were used across all swine units within the operation, but not all swine units were involved in the outbreak. because the timing of the outbreak seemed to coincide with the switch to a new source of starter pellet feed, the attending veterinarian and farm officials suspected the new supplier's starter pelleted diet was the source of pathogen introduction. results of the epidemiologic investigation indicated pedv genetic material presence in the starter feed, validating this suspicion. starter feed pellets from the new supplier were offered to piglets in the a farrowing facility during the week of january , . by january , , clinical signs of pedv were present among sows and piglets in the a facility. starter feed pellets were subjected to standard biosecurity procedures to enter into the facility. in short, feed bags are placed into clean bins from the facility, and bins loaded with feed are disinfected in a fume chamber as they are transferred into the facility. following this protocol eliminates contamination from the outer surface of the bag as the source and indicates feed ingredients are likely the source of contamination. supporting the introduced pellets as a likely source, the a breed-wean site within the same flow, which never received the new supply of feed pellets, remained pedv negative. pigs in one nursery in flow b (bn ), nurseries in flow c (cn , cn and cn west barn), and one wean-to-finish unit in the multiplier herd (d) were also started on the new supplier's feed pellets. all of these sites were subsequently found to be pcr positive for pedv except the flow d wean-to-finish unit. it is thought that differences in pellet storage conditions may account for this inconsistency from the flow d unit. flows b and c store their feed pellets in a room separate from the barn. during winter, these rooms are estimated to be at °f (approximately °c). the units in flow d store their pellets within the barn where temperatures are around °f (approximately °c). storage in higher temperatures may have inactivated the virus. this hypothesis is supported in a study by jung and chae where storage of fecal samples at temperatures °c and greater resulted in a decline in pedv nucleic acid detection by rt-pcr when compared to those stored at °c [ ] . another inconsistency was that two contract finisher facilities in flow b and both b flow breed-wean units also broke with disease or tested positive for pedv, even though these facilities did not receive the new supplier's pellets. because pedv is highly transmissible, spread of disease from the units where it broke to the breed-wean units by human error cannot be ruled out. of note, the same person does chores at the b farrowing unit and the bn nursery where pigs were fed the implicated pellets. also, the two flow b finisher facilities had just received pigs and do share a person who does chores between them, but that person did not have direct contact with any of the sow units. along with the timing of the outbreak that coincided with the switch to new supplier's feed pellets, strong evidence for these feed pellets as the source of the outbreak comes from pcr testing of the new supplier's pellets. pellets from the bn nursery tested pedv positive by rt-pcr on january , (c t value = . ). additionally, three lots of feed pellets from bn nursery, which had been cleaned and disinfected and was empty of pigs at the time, tested positive for pedv by rt-pcr (mean c t value = . ). pigs that had left this nursery and were now in a finisher facility tested negative for pedv, showing this nursery had been negative for pedv while it was housing pigs. similar findings result from testing of units within flow c. feeder pigs that left the facility at the end of december and beginning of january were tested and found to be pedv negative, confirming that no disease was present prior to january . one of the afflicted flow c nursery sites (cn ) consists of barns labeled east and west. cn west barn received new pigs, pellets from the new supplier, and subsequently broke with pedv. at the same time, the cn east barn housed pedv negative pigs weighing approximately lbs. from the previous placement. these pigs stayed pedv negative after moving offsite all the way through marketing. interestingly, cn west barn had pellets from both the old and new suppliers in the barn at the time of the outbreak. the test results showed swabs taken on the outside of both old and new suppliers' pellet feedbags were pedv rt-pcr positive (mean c t value = . ). therefore, pellet samples were collected with care to avoid contamination from the exterior of the bags. briefly, the top cm of the feedbags were wiped with a . % solution of sodium hypochlorite. bags were then opened by cutting the top of the bag off with a scalpel to ensure a minimum risk for potential dust contamination. feed samples were retrieved from the center of each bag by the attending veterinarian who was wearing a sterile obstetrical sleeve. the samples were placed into a sterile plastic bag, sealed, and submitted for testing. pedv rt-pcr was positive (mean c t value = . ) for the new supplier's pellets and pedv rt-pcr negative for the old supplier's pellets. these results were interpreted to mean that the exterior of the feedbags had become contaminated with pedv in the barn during the outbreak; however, since pedv was detected in the interior of the unopened bags of the new supplier's pellets, pedv contamination of this feed had to occur prior to delivery at the barn. building on the rt-pcr results from new supplier's feed pellets on the swine operation, back-up pellets of the same lots at the new supplier's manufacturing facility also tested rt-pcr positive (mean c t value = . ). testing of individual ingredients at the new supplier's facility yielded several positive results. strong evidence implicating pellets from the new supplier as the contamination source based on the pedv rt-pcr positive results is firmly supported by findings of the epidemiologic investigation. the epidemiologic investigation also concluded that virus isolation from pellets would be critical evidence that the pellets caused the outbreak. since pedv is very difficult to isolate, a bioassay was initiated to determine if the pellets in question could infect naïve piglets. during the outbreak at the swine operation, the attending herd veterinarian aseptically collected aliquots (as described above) of the rt-pcr positive pelleted feed from the farm and mixed them with sterile phosphate buffered saline to make a mash. these moistened, mash aliquots were stored at − °c until the bioassay could be performed. ten, -day-old pigs, were obtained from a commercial sow herd. sows from the source herd, the facility where the bioassay was performed, and the piglets were all confirmed to be negative for pedv by rt-pcr at the start of the bioassay. serum, collected from the pigs prior to leaving the source farm, tested negative for pedv antibodies using an indirect immunofluorescence assay. during a hour acclimation period, pigs were fed a commercial swine starter feed and rectal swabs from the pigs, feed samples, and environmental swabs were all collected on a daily basis. following the acclimation period, the pigs were provided ad libitum access to the rt-pcr positive mash along with dry pellets from the same lot for days, and observed for clinical signs of pedv. feed samples, environmental swabs, and rectal swabs were collected each day of the study. after days, the pigs were euthanized and intestinal tissues were submitted for diagnostic testing. the environment, starter feed, and pigs were pedv negative using rt-pcr prior to the study and during the hour acclimation period. mash aliquots and pelleted feed obtained from the swine operation site tested weakly pedv positive with rt-pcr during the day study (mean ct = . ). pigs were observed to be very healthy during the bioassay and no clinical signs of disease were observed in the pigs during the bioassay. environmental and rectal swabs collected daily during the study were negative for pedv using rt-pcr. microscopic examination of intestinal tissues collected from the piglets at the end of the study revealed no significant morphologic lesions. although the bioassay results did not confirm the feed pellets in question were infectious, feed cannot be ruled out as the cause of this outbreak. in the present study, the sensitivity of the bioassay was limited by the amount of feed the individual pigs and the small number of pigs collectively could consume during the trial period. even if infectious virus was present in the feed used for the bioassay, the mean c t value of . indicates it would be present at very low concentration. in addition, the pigs evaluated appeared healthy, with what was likely limited disease challenge resulting in little immune or digestive system compromise. in a field setting where there are thousands of pigs consuming tons of feed, and known, observable presence of unthrifty pigs with potentially compromised digestive or immune systems, it is conceivable that a very small amount of infectious pedv in a food source would be capable of initiating an outbreak that would rapidly spread through the population of susceptible animals. in addition, the present bioassay portion of the study may have been hindered by the day lag from the time the feed was manufactured and the initiation of the bioassay. the time lag likely decreased the viability of any infectious pedv that was present in the feed at the time of delivery to the farm. because the timing of this outbreak coincided with a switch to new out-sourced feed pellets and due to the strong evidence provided by pedv positive rt-pcr results of these feed pellets at both the swine operation and the supplier, it is believed that contaminated feed pellets were the source of this outbreak. a study reported subsequent to completion of the present study proved that contaminated feed can serve as a vehicle to transmit pedv to naïve pigs [ ] . the results of the epidemiologic investigation, proof of concept by other investigators and the presence of pedv rna from unopened bags of feed all support feed as the source of the outbreak. the inability of a bioassay to prove the feed pellets were infectious after the outbreak occurred must be considered, but the low sensitivity of this assay does not rule out feed as possible source. the results of the present and other studies demonstrate the need for strict biosecurity practices and thorough testing for feed and feed ingredients used in the pork industry for which, pedv outbreaks can cause devastating financial losses and pedv surveillance and prevention efforts are of the utmost importance. pathology of us porcine epidemic diarrhea virus strain pc a in gnotobiotic pigs emergence of porcine epidemic diarrhea virus in the united states: clinical signs, lesions, and viral genomic sequences origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the united states fighting a deadly pig disease. industry, veterinarians trying to contain ped virus, new to the us isolation and characterization of porcine epidemic diarrhea viruses associated with the disease outbreak among swine in the united states a new coronavirus-like particle associated with diarrhea in swine porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines role of transportation in spread of porcine epidemic diarrhea virus infection, united states an evaluation of contaminated complete feed as a vehicle for porcine epidemic diarrhea virus infection of naive pigs following consumption via natural feeding behavior: proof of concept investigation into the role of potentially contaminated feed as a source of the first-detected outbreaks of porcine epidemic diarrhea in canada the spray-drying process is sufficient to inactivate infectious porcine epidemic diarrhea virus in plasma porcine epidemic diarrhea virus rna present in commercial spray-dried porcine plasma is not infectious to naive pigs evidence of infectivity of airborne porcine epidemic diarrhea virus and detection of airborne viral rna at long distances from infected herds animal coronaviruses: what can they teach us about the severe acute respiratory syndrome? effect of temperature on the detection of porcine epidemic diarrhea virus and transmissible gastroenteritis virus in fecal samples by reverse transcription-polymerase chain reaction submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution submit your manuscript at www we thank jody edwards for her expertise in scientific writing and editing and tim vojt for his medical illustration services. funding was provided by the national pork checkoff, pic north america and the u.s. department of agriculture. partial funding for open access was provided by the ohio state university open access fund. any mention of trade names or commercial products is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the us department of agriculture. the contents herein are solely the responsibility of the authors and do not necessarily represent the official views of the national pork board, pic north america or the u.s. department of agriculture. the authors declare that they have no competing interests.authors' contributions asb performed the bioassay and drafted the manuscript. rak led the epidemiological investigation and assisted with preparation of the manuscript. tp and md performed field activities. sjm performed the bioassay and assisted with manuscript preparation. all authors read and approved the final manuscript. key: cord- - h mj w authors: wang, jinfeng; li, ruiwen; sun, xiaoxia; liu, libing; hao, xuepiao; wang, jianchang; yuan, wanzhe title: development and validation of the isothermal recombinase polymerase amplification assays for rapid detection of mycoplasma ovipneumoniae in sheep date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: h mj w background: mycoplasmal pneumonia is an important infectious disease that threatens sheep and goat production worldwide, and mycoplasma ovipneumoniae is one of major etiological agent causing mycoplasmal pneumonia. recombinase polymerase amplification (rpa) is an isothermal nucleic acid amplification technique, and rpa-based diagnostic assays have been described for the detection of different types of pathogens. results: the rpa assays using real-time fluorescence detection (real-time rpa) and lateral flow strip detection (lfs rpa) were developed to detect m. ovipneumoniae targeting a conserved region of the s rrna gene. real-time rpa was performed in a portable florescence scanner at °c for min. lfs rpa was performed in a portable metal bath incubator at °c for min, and the amplicons were visualized with the naked eyes within min on the lateral flow strip. both assays were highly specific for m. ovipneumoniae, as there were no cross-reactions with other microorganisms tested, especially the pathogens involved in respiratory complex and other mycoplasmas frequently identified in ruminants. the limit of detection of lfs rpa assay was . × ( ) copies per reaction using a recombinant plasmid containing target gene as template, which is times lower than the limit of detection of the real-time rpa and real-time pcr assays. the rpa assays were further validated on clinical sheep nasal swab and fresh lung samples, and m. ovipneumoniae dna was detected in samples in the real-time rpa, samples in the lfs rpa and samples in the real-time pcr assay. compared to real-time pcr, the real-time rpa and lfs rpa showed diagnostic specificity of and . %, diagnostic sensitivity of . and . %, and a kappa coefficient of . and . , respectively. conclusions: the developed real-time rpa and lfs rpa assays provide the attractive and promising tools for rapid, convenient and reliable detection of m. ovipneumoniae in sheep, especially in resource-limited settings. however, the effectiveness of the developed rpa assays in the detection of m. ovipneumoniae in goats needs to be further validated. mycoplasma ovipneumoniae is one of the major pathogens that cause mycoplasma pneumonia in sheep, goats, and wild ruminants [ ] [ ] [ ] [ ] [ ] . m. ovipneumoniae-associated respiratory disease is characterized by cough, gasp, runny noses, progressive weight loss, pulmonary interstitial hyperplasia inflammation, and variable morbidity and mortality rates between flocks [ , ] . moreover, upon m. ovipneumoniae infection, sheep and goats become susceptible to other common pathogens causing respiratory disease, such as mannheimia haemolytica, pasteurella multocida and parainfluenza- virus [ , ] . since first confirmed in australia in , infections by m. ovipneumoniae have been an endemic problem worldwide and have caused severe economic losses to the sheep and goat industry [ ] [ ] [ ] . bacteriological culture of m. ovipneumoniae is currently the gold standard for diagnosis, however, the culture is cumbersome and time-consuming due to the fastidious nature of the bacterium as well as that the follows required species identification by biochemical or serological tests, which make the assay burdensome for the routine applications [ ] [ ] [ ] . in addition, the bacterial isolation may be hampered by sample contamination and prior antibiotic treatments received by the diseased animals. serological tests, such as elisa, indirect hemagglutination assay, are the common and economic methods for m. ovipneumoniae herd surveillance [ , ] . however, seroconversion to m. ovipneumoniae is often delayed after natural infection, which makes the serology less effective in detecting early-stages of infection in herds, and unsuitable for detecting acute mycoplasmal pneumonia in the field [ , ] . it is an urgent need to develop a rapid and accurate method to detect m. ovipneumoniae. different nucleic acid amplificationbased methods have been described to be sensitive and specific for m. ovipneumoniae, i.e. pcr, real-time pcr, and loop-mediated isothermal amplification (lamp) [ , , ] . pcr assays require a well-equipped laboratory, expensive equipment and trained personnel, which limits their application in the under-equipped laboratories and the point-of-need (pon) diagnosis [ , ] . compared to the pcr assays, the isothermal amplification methods have advantages regarding convenience to perform and minimal equipment requirement. a lamp assay for the detection of m. ovipneumoniae has been described for low requirement of experimental conditions, however, the assay requires min to complete the reaction [ ] . recombinase polymerase amplification (rpa), an isothermal dna amplification technique, is rapid, reliable and considered to be a promising approach for pon diagnosis [ , ] . rpa-based diagnostic assays have been described for the detection of different pathogens from different clinical samples [ , ] . in this study, a real-time rpa assay using the exo probe and a lfs rpa assay using the nfo probe combined with lateral flow strip were developed for rapid, specific and sensitive detection of m. ovipneumoniae. the performance of the assays was further assessed by collecting and detecting the clinical sheep nasal swab and lung samples. analytical specificity and sensitivity of the rpa assays only m. ovipneumoniae was amplified in both real-time rpa and lfs rpa assays (fig. ) . the specificity analysis was repeated five times with similar results, which demonstrated the good repeatability of the rpa assays. the limit of detection of lfs rpa assay was . × copies m. ovipneumoniae standard dna per reaction ( fig. a) , while the lod of real-time rpa was . × copies per reaction (fig. b) , which was same as that of the real-time pcr (data not shown). the real-time rpa assay was further performed eight times on the standard dna, and . × - . × copies dna molecules were detected in / runs, . × - . × , / , which demonstrated the good reproducibility (fig. ) . of the sheep clinical samples, m. ovipneumoniae dna was detected in ( . %), ( . %) and ( . %) samples by the real-time rpa, lfs rpa and real-time pcr, respectively (table ). compared to the real-time pcr assay, the real-time rpa assay and lfs rpa assay showed diagnostic specificity (dsp) of and . %, diagnostic sensitivity (dse) of . and . %, positive predictive value (ppv) of and . %, negative predictive value (npv) of . and . %, and kappa value of . and . , respectively ( table ). the real-time rpa and lfs rpa assays demonstrated the comparable performance in detecting the sheep clinical samples. in the rpa assays, it took no more than min to obtain the positive results, while it need approximately min - min in the real-time pcr with the ct values ranging from . to . . the developed real-time rpa and lfs rpa assays are highly specific and sensitive for detection of m. ovipneumoniae in the sheep clinical samples. both rpa assays performed well at °c within min, which is faster than other common nucleic acid amplification methods. the real-time rpa assay and lfs rpa assay were performed on the tube scanner genie iii and a metal bath incubator, respectively. these two pieces of equipment are portable, lightweight, easily carried and can be charged by battery for working a whole day. for the rpa reagents, they are provided in the form of lyophilized powder and are independent of cold chains. several studies also demonstrated that rpa was tolerant to most of the pcr inhibitors [ , ] . the above characteristics make the developed rpa assays ideal for the detection of m. ovipneumoniae in field which is especially important for farms located in rural areas. the pcr and lamp assays targeted on the s rrna gene, elongation factor tu gene or adhesin p gene had demonstrated their efficacy in the detection of m. ovipneumoniae in different clinical specimens, including the nasal swabs and lung samples [ , , , ] . the rpa primers and probes were designed basing on the s rrna gene of m. ovipneumoniae in this study. to ensure that the target sequences were unique to m. ovipneumoniae, we screened the selected primers and probes in silico using the pattern searching tool function from the emboss package against the genomes of the common mycoplasmas causing infections in ruminants [ ] . the complementary regions could not be found when allowing or sequence mismatches for the primer sequences. furthermore, there was no mismatch in the reverse primers and probes in the m. ovipneumoniae strains available in genbank, and only one mismatch in the forward primer in two strains: - , - (accession number: mn ) and nctc (accession number: lr . ). according to the above in silico analysis, the designed primers and probes fulfilled the specificity requirements of rpa [ ] . in the specificity analysis, both the real-time rpa and lfs rpa only amplified the genomic dna of m. ovipneumoniae, and no other mycoplasmas, bacteria and pprv. most importantly, m. capricolum subsp. capripneumoniae, the etiological agent of contagious caprine pleuropneumonia, was not amplified by the new developed rpa assays. although the in silico sequence analysis support that all the m. ovipneumoniae strains are detectable, more genomic dna of different strains of m. ovipneumoniae should be tested for further confirmation. with the real-time pcr as the reference assay, the diagnostic performances of the developed real-time rpa and lfs rpa assays were evaluated. the performances of the rpa assays were comparable to the real-time pcr, while the rpa assays were faster to obtain the detection results. furthermore, the developed real-time rpa was slightly weak in the detection of the clinical samples containing low amounts of m. ovipneumoniae dna, as three nasal samples were negative in real-time rpa assay while positive in real-time pcr with ct values of . , . and . . the above results are in this study, we describe the development of the realtime rpa and lfs rpa assays for the simple, rapid and to generate a m. ovipneumoniae standard dna for the rpa assays, a pcr product containing bp covering the region of interest of s rrna gene was amplified from the m. ovipneumoniae dna using lmf and lmr as primers (table ) and cloned into the pmd -t (takara, dalian, china) for standards. the resulting plasmid, pmo- srrna, was transformed into escherichia coli dh α cells, purified with the sanprep plasmid miniprep kit (sangon biotech, shanghai, china) and quantified. the copy number of dna molecules was calculated by the following formula: amount (copies/ μl) = [dna concentration (g/μl)/ (plasmid length in base pairs× )] × . × . ten-fold dilutions of the pmo- srrna, ranging from . × to . × copies/μl, were prepared in nuclease-free water and aliquots of each dilution were stored at − °c. the s rrna gene of m. ovipneumoniae was determined as the amplification target for rpa. according to the reference sequences of m. ovipneumoniae (accession numbers: nr_ . , lr . , mn , mn , mn , mh ), the highly conserved region in the s rrna gene was identified, and the rpa primers, exo and nfo probes were designed following the rpa manufacturer guidelines (twistdx. cambridge, uk). primers and probe are listed in table and synthesized by a commercial company (sangon biotech, shanghai, china). the m. ovipneumoniae real-time rpa assay was performed as described previously [ ] . the total reaction volume was μl including . μl of buffer a (rehydration buffer), . μl of each rpa primers (mo-exo-f and mo-exo-r, μmol/l), . μl of exo probe (mo-exo-p, μmol/l) and . μl of buffer b (magnesium acetate, mmol/l). furthermore, μl of genomic dna or recombinant plasmid was used for the specificity and sensitivity analysis, or μl of sample dna was used for the clinical sample diagnosis. the m. ovipneumoniae lfs rpa assay was also performed as described previously [ ] . the total reaction volume was μl including . μl of rehydration buffer, . μl of each rpa primers (mo-nfo-f and monfo-r, μmol/l), . μl of exo probe (mo-nfo-p, μmol/l) and . μl of magnesium acetate ( mmol/ l). in addition, μl of bacterial genomic dna or recombinant plasmid was used for the specific and sensitive analysis, or μl of sample dna was used for the clinical sample diagnosis. the assay was performed in a metal bath incubator at °c for min. furthermore, the lateral flow strips (milenia biotec gmbh, germany) were used to detect the rpa amplicons dual-labeled with fam and biotin. both rpa assays were performed to amplify the nucleic acids of a panel of microorganisms including m. ovipneumoniae, flocculare, m. haemolytica, p. multocida, k. pneumoniae, pprv, which are considered to be dangerous to the sheep and goat respiratory system or frequently identified in the ruminants. the analytical specificity analysis was repeated five times. the standard dna of m. ovipneumoniae, ranging from . × to . × copies/μl, was used for the rpa analytical sensitivity analysis. one microliter of each dilution was amplified by both rpa assays to determine the limit of detection (lod). the analytical sensitivity analysis was repeated five times. furthermore, the real-time rpa was tested using the standard dna in replicates, the threshold time was plotted against the molecules detected and a semi-log regression was calculated using prism software . (graphpad software inc., sandiego, california). the rpa assays were validated with sheep nasal swabs and sheep fresh lungs. all samples tested with the two rpa assays were also tested by a real-time pcr in parallel. the real-time pcr for m. oviopneumoniae was performed on a abi instrument (applied biosystems, foster city, california), which was described previously [ ] . chronic non-progressive pneumonia of sheep in new zealand -a review of the role of mycoplasma ovipneumoniae mycoplasma ovipneumoniae in wildlife species beyond subfamily caprinae mycoplasma ovipneumoniae infection in zimbabwean goats and sheep mycoplasma ovipneumoniae--a primary cause of severe pneumonia epizootics in the norwegian muskox (ovibos moschatus) population mycoplasmas of goats and sheep association of mycoplasma ovipneumoniae infection with population-limiting respiratory disease in free-ranging rocky mountain bighorn sheep (ovis canadensis canadensis) mycoplasma ovipneumoniae associated with severe respiratory disease in goats an aetiopathological study of chronic bronchopneumonia in lambs in ireland detection of mycoplasma ovipneumoniae in pasteurella-vaccinated sheep flocks with respiratory disease in england isolation, propagation, and characterization studies of an ovine mycoplasma responsible for proliferative interstitial pneumonia seroepidemiological survey of sheep flocks from northern japan for mycoplasma ovipneumoniae and mycoplasma agalactiae serological and molecular survey of sheep infected with mycoplasma ovipneumoniae in xinjiang detection of mycoplasma ovipneumoniae and m. arginini in bighorn sheep using enrichment culture coupled with genus-and species-specific polymerase chain reaction loop-mediated isothermal amplification-lateral-flow dipstick (lamp-lfd) to detect mycoplasma ovipneumoniae a realtime pcr for detection and quantification of mycoplasma ovipneumoniae seroprevalence and molecular detection of mycoplasma ovipneumoniae in goats in tropical china dna detection using recombination proteins a new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay recombinase polymerase amplification for diagnostic applications review: a comprehensive summary of a decade development of the recombinase polymerase amplification factors influencing recombinase polymerase amplification (rpa) assay outcomes at point of care emboss: the european molecular biology open software suite influence of sequence mismatches on the specificity of recombinase polymerase amplification technology rapid and sensitive detection of mycoplasma hyopneumoniae by recombinase polymerase amplification assay publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations the authors thank the laboratory staff in the animal hospital of hebei agricultural university. we also thank dr. qingan han from the hebei animal disease prevention and control center for providing the nucleic acid samples. authors' contributions jcw and wzy conceived and designed the study. jfw and rwl developed the real-time rpa and lfs rpa assays and analyzed the data. xxs, lbl and xph performed the clinical samples testing, helped in the data analysis and manuscript revision. jcw and wzy wrote the manuscript. all authors read and approved the final manuscript. agro-industry technology research system (hbct ). the funding agencies had no role in study design; in the collection, analysis and interpretation of data; in the writing of the report; or in the decision to submit the article for publication. the dataset analyzed during the current study is available from the corresponding author on reasonable request. the nucleotide sequences under the relevant accession numbers (cp , nr_ , nr_ , nr_ , nr_ . , lr . , mn , mn , mn , mh , mn , lr . ) analysed during the current study are available in the genbank repository, https://www.ncbi.nlm.nih.gov/nuccore/. the sheep nasal swabs and sheep fresh lungs used in this study were collected in sheep husbandry farms and a slaughter house, respectively. the written consents for the use of the samples before participation in the study were obtained from the farmers and the slaughter house's owner. this study was approved by the institutional animal care and ethics committee of hebei agricultural university (approval no. iacechebau ). not applicable. the authors declare that they have no competing interests. key: cord- -ky mq y authors: velasquez-munoz, ana; manriquez, diego; paudyal, sushil; han, hyungchul; callan, robert; ryan, elizabeth p.; pinedo, pablo title: effect of prebiotic supplementation with stabilized rice bran in milk of pre-weaned organic holstein calves date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: ky mq y background: the first month of life possess significant challenges for dairy calves due to high susceptibility to digestive diseases. the objective of this study was to evaluate the effect of prebiotic supplementation with stabilized rice bran (srb) in milk on health, immunity, and performance of pre-weaned organic dairy calves. holstein heifer calves (n = ) were enrolled at ± days old and monitored for days, from july to august . calves were randomly assigned to a control (ctr; n = ) or a treatment group (srb; n = ). the ctr group received milk alone and the srb group received g of srb per day in milk to achieve a % w/w dose of the total calories. daily health evaluations were conducted to score health status and disease severity (healthy, slightly affected, moderately or severely sick) of calves, through integrated assessment of diarrhea, dehydration, attitude, and milk intake. body weights and fecal iga quantification were completed on the first and last day of the study. results: overall, weight gain and fecal iga concentrations were not affected by the dietary addition of srb. the total number of calf-days classified as healthy or sick were not different between treatment groups. similarly, the number of calf-days categorized as slightly affected, moderately sick, or severely sick did not differ between treatment groups. time to event analyses indicated a tendency for a treatment effect in the time to the first moderate case of diarrhea (p = . ), as well as in the time to recovery from diarrhea (p = . ), favoring control calves. conclusions: these results indicated that the dietary addition of srb in milk did not have an effect in health, immunity or performance of pre-weaned dairy calves. rearing healthy calves that maintain adequate growth rates is essential for the success of dairy operations. however, during the first month of life, calves face multiple stressors while the immune system is still developing, resulting in a high susceptibility to digestive diseases [ ] . during the first weeks of life of dairy calves, diarrhea is the most prevalent health disorder, as well as the main cause of death. a recent report in the us indicated that . % of calf mortality was a consequence of diarrhea and animals less than weeks old were the most affected [ ] . in , % of pre-weaned calves presented diarrhea and % of all pre-weaned calves were treated with antimicrobials [ ] . rehydration and antibiotic therapy are common treatments for calves with neonatal diarrhea. however, due to consumer concerns, regulations for the use of antibiotics in food animals are becoming more restrictive. consequently, research focused on alternatives to the use of antimicrobials, including strategies to prevent disease is required. prebiotics are defined as non-digestible feed ingredients that stabilize the intestinal microbiota, stimulating the growth of beneficial bacteria and inhibiting the colonization by pathogens [ , ] . prebiotic-probiotic interactions have been shown to improve immune responses [ , ] , contrasting with the action of antibiotics that eliminate and restrict the growth of detrimental and beneficial microorganisms with no distinction. the use of prebiotics has been studied in young ruminants as a prophylactic strategy to prevent disease and as an alternative to antibiotics and one of the most common products is mannanoligosaccharides (mos), a derivative of the cell wall of the yeast saccharomyces cerevisiae. however, the effects of prebiotics on performance, health, and immunity of calves has not been consistent. for example, the supplementation of mos resulted in a reduction in almost point on the severity of neonatal diarrhea in a to scale [ ] and decreased the number of days with high diarrhea scores [ ] . contrary, other studies reported no differences in diarrhea cases after the supplementation prebiotics [ ] [ ] [ ] in pre-weaned dairy calves. furthermore, some studies indicated no differences in weight gain [ , , ] , while greater gains were reported by others [ , , ] after a prebiotic supplementation in pre-weaned calves. heat stabilized rice bran (srb) contains prebiotics that have been tested in mice, chickens, pigs, horses, dogs and humans. this is a natural product that has been heat stabilized to prevent rancidity. as other prebiotics used in calf health, srb is a carbohydrate. however, srb contains ɣ-oryzanol (omega - ), antioxidants (tocopherols, tocotrienols, polyphenols, phytosterols), vitamin e and b, amino acids (tryptophan, histidine, methionine, cysteine, arginine) and micronutrients (magnesium, calcium, phosphorus, manganese), which may have the potential to enhance the host health, not only through a symbiotic effect with the probiotic bacteria in gi tract [ ] . previous research indicated that this product had positive effects reducing the presentation and duration of diarrhea from human rotavirus and human norovirus in pigs [ ] , increasing the production of local and systemic iga and enhancing the immune system in mice and pigs [ ] [ ] [ ] [ ] . the effect of srb has not been previously studied in young ruminants and its potential as a supplement or additive in whole milk of pre-weaned dairy calves has not been explored. we hypothesized that the addition of srb in milk of pre-weaned calves would reduce the presentation and severity of neonatal diarrhea, improving the immune response and consequently the overall calf performance. therefore, our specific objective was to determine the effect of srb on average daily gain (adg), fecal iga concentration, presentation of diseases, time to recovery from disease, and animal removal. overall, calves were included for the final analyses, as calves in the srb group did not consume the milk with added srb. all calves had baseline total serum protein (tsp) measurements above . g/dl, indicating no failure in passive immune transfer [ , ] . however, calves had tsp measurements above . g/dl and from these, presented diarrhea at the time of enrolment. consequently, % of the enrolled animals might have presented some degree of dehydration that could alter to some extent the values of tsp. no significant difference (p = . ) was found for the proportion of tsp above . g/dl between control (ctr) and srb calves (or = . , % ci = . - . ). additionally, at enrollment, ( %) calves presented signs of slight disease (diarrhea), which may also explain the high tsp level and possible dehydration. no differences (p = . ) were found in the odds ( % ci) of diarrheal disease at enrollment (or = . [ . - . ]) for ctr calves in comparison with the srb group. for the overall day study, total calf-days classified as "healthy" and "sick" ("slight", "moderate" or "severe") for calves were and , respectively. these cumulative days were analyzed according to disease severity and dietary treatment group ( table ). the repeated measures analyses for a binary response did not indicate a significant effect for treatment in the number of "healthy" or "sick" days for any of the disease categories ( table ). no differences between treatment groups were found for the time to the first "moderate" disease event (p = . ). the survival curve demonstrated a pronounced slope (fig. a) during the first days of study, with about % of srb calves and % of ctr calves presenting the first "moderate" disease status within this period. when the health status at enrollment was included as a covariate in the analysis, a tendency was determined in the survival function for the effect of health at day (p = . ; fig. b ). day "healthy" ctr and srb calves presented the first moderate subsequent diarrhea episode in ± days and ± days respectively. ctr control group not exposed to heat stabilized rice bran in the diet, srb group receiving a daily dose of g of stabilized rice bran corresponding to % of the daily calories contrary, d "sick" ctr and srb presented the first moderate diarrhea episode in ± and ± , respectively. the time to recovery from a "moderate" disease status to a "slight" or "healthy" status, indicated a significance trend for treatment group in the kaplan meier analysis (p = . ). calves in ctr group recovered from a "moderate" status in . ± . days, while srb calves recovered in . ± . days (fig. a) . importantly, when health at enrollment was added as a covariate, there were no longer differences found in time to recovery (p = . ). the survival curve considering health status at enrollment indicated that ctr calves classified as "healthy" at d recovered from a moderate diarrhea episode in . ± . days; d "sick" ctr calves recovered in . ± . days; d "healthy" srb calves in . ± . days; and d "sick" srb calves recovered in . ± days (fig. b) . all the fecal samples collected at enrollment and at the end of the study submitted for detection of coronavirus and rotavirus (n = ) were negative. treatment groups presented a similar adg in the days of study (ctr = . ± . kg; srb = . ± . kg. p = . ) and the concentrations of fecal iga did not differ between treatment groups and health status at enrollment (p = . ). mean iga concentrations for ctr and srb were . ± . ng/ml and . ± . ng/ml, respectively. seventy nine calves completed the days period of the study; out calves enrolled died (crt = , srb = ) and were culled (ctr = , srb = ). the odds of leaving the study due to death or culling did not differ between ctr and srb group (or = . [ . - . ]; p = . ). additionally, no differences were found in the time that calves left the study due to death or culling (p = . ). overall, (ctr = , srb = ) calves received organic certified treatment for at least one disease event during the follow up period. ten calves (ctr = , srb = ) presented more than disease event between d in study and weaning. no significant difference (p = . ) was found in the odds of presenting more than events of disease between treatment groups (or = . , % ci = . - . ). in addition, the time to a first disease event after completion of srb addition was similar in both treatment groups (p = . ). in total, out of calves were lost during the post treatment follow up period, between the end of the days study period and weaning. eleven calves were sold (ctr = , srb = ) and calves died (ctr = , srb = ). no differences were found in the odds of leaving the study by treatment group (p = . , or = . , % ci = . - . ). additionally, time to death or culling did not differ between groups (p = . ). the addition of prebiotics via srb into milk starting at - days of age was assessed for effects on health and performance of pre-weaned organic dairy calves over a days period. overall, this study resulted in no treatment differences in the number of days calves were sick or in the number of days by category of disease severity. notably, the addition of srb was tested in a challenging calf population, as the compromised health status of some calves was apparent at enrollment. the beginning of this study coincided with nutritional management adjustments made by the farm that resulted in high incidence of neonatal diarrhea. total serum protein determination in calves is a commonly used tool to measure passive immune transfer and, consequently, new born and colostrum management practices at farms [ ] . all the enrolled calves had tsp measurements above . g/dl. it has been described that concentrations ≥ . g/dl in healthy calves and ≥ . g/dl in clinically ill calves is considered a measure of adequate passive transfer of immunity [ , ] . however, the concentration of tsp in calves might be affected by dehydration and, although a cut-off point for high tsp readings in calves has not been established, readings above . have been linked to dehydration [ ] . notably, % of our calves presented tsp concentrations above . g/dl at enrollment, with close to % of the population showing signs of clinical disease (diarrhea or slight dehydration). however, no differences were found between treatment groups, indicating that both groups started in similar immune and health conditions. in addition, considering this issue, health at enrollment was included in the statistical models as a covariate. supporting our results, a previous study reported that the use of an oral electrolyte containing rice, promoted diarrhea in young calves less than weeks old [ ] . pre-ruminant calves lack the production of enzymes to digest maltose and starch from rice and this situation might lead to osmotic diarrhea when it is provided in milk replacers or in oral electrolytes [ , ] . this fact might explain the increase in the days srb calves spent in the moderate and severely sick categories in our study. published studies using prebiotics as a prophylactic or treatment therapy in pre-weaned calves are limited and there is not consensus on their effect on health and diarrhea presentation in young dairy calves. although positive effects were reported in the reduction of disease presentation or diarrhea scores by some authors [ , , , ] , other studies did not find significant differences [ , ] . the decision of analyzing the time to a first "moderate" status of disease was made considering the health situation of the study population at enrollment. calves presented a first "moderate" health condition as a result of diarrhea in the first days in study, when they were to days old. treatment groups did not differ in the time to a first "moderate" status and, as it was expected, calves that were sick at enrollment showed a tendency to present the first "moderate" health status before than calves that were healthy at that time point. contrary to our expectations, srb calves that were healthy at enrollment presented a moderate health status earlier than healthy ctr calves. even though these differences were not significant, we attribute this finding to a possible osmotic effect of srb on the large intestine of young animals [ ] . our results contrast with neonatal animal model research, where srb had a protective effect in the presentation of disease through the stimulation of the immune response and increases of probiotic bacteria in the gastrointestinal tract [ ] . a tendency for different times to recovery from a "moderate" to a "slight" health status between treatment groups was established; srb calves required more days to recover than ctr calves. this information is valuable and suggests that srb may have a potentially detrimental effect in young calves, explained by the incapacity to digest carbohydrates and starches from rice [ ] . control calves and srb calves had a similar adg during the days in study. published data is not consistent on resulting adg in calves fed with prebiotics. no differences in adg has been reported [ , , ] . conversely, some studies found a greater adg in pre-weaned calves fed with prebiotic (mos) in milk for days [ , ] . interestingly, rice protein has been used as a replacement of whey protein in milk replacers and the results are not conclusive in the effects on performance of pre-weaned calves [ , ] . a negative impact on adg was reported when calves were fed with rice protein replacing % and more of the whey protein in the milk replacer, these animals had a reduction of to % in body weight, although health parameters were not collected [ ] . conversely, no effects on adg or growth were reported in calves when % rice protein was added in the milk replacer of pre-weaned calves [ ] . immunoglobulin a is the major immunoglobulin class found in mucosal secretions and prevents mucosal infections by agglutinating pathogens [ ] . our study found similar iga concentrations in feces from the two treatment groups. the immunomodulatory response of dietary srb has been described in animal models. it was reported an increased production of mucosal iga in to weeks old mice fed % of the daily calories for days [ ] . in that study, rice bran enhanced the growth of lactobacillus ssp. and other beneficial bacteria that might have increased the iga concentration in intestine. similarly, an increase in the serum titer of iga in gnotobiotic pigs fed srb was found [ ] . however, previous reports are not consistent on the immunomodulatory response of prebiotic fed to pre-weaned calves and the quantification of fecal iga. no difference in fecal and salivary iga was reported when newborn calves were fed for days with a commercial prebiotic in milk replacer (prebio support, meiji feed co., ltd. tokyo, japan) [ ] . conversely, the same product had an effect increasing fecal iga of pre-weaned calves at specific time points [ ] . although the ctr group had twice as many calves leaving the study as the srb group, the odds of leaving the farm due to death or culling were not significantly different in our two groups. contrary to the expectations, the follow up period until weaning indicated that a similar number of animals were lost in each group (ctr = vs srb = ). additionally, a similar proportion of calves was treated for more than disease episode in the follow up period. consequently, the days of addition of srb in the milk of calves did not have influence in health outcomes in the pre-weaned life. our daily dose of srb was greater than that of published studies testing prebiotics on pre-weaned calves, where authors worked with commercial products in doses no greater than g/d [ , [ ] [ ] [ ] ] . we offered srb in its natural form in a dose of g/d (only heat stabilized to prevent rancidity) and one difficulty observed in this trial was the necessity of an intense mixing to suspend the srb dose in milk. furthermore, if milk was not served soon after mixing, srb started to decant in the bottom of the bottle, which was also reported in other study using a different product [ ] . the major finding from this study was that the addition of srb in the milk of newborn calves for days did not enhance performance, health, or immunity during the first month of life, a period characterized for the presentation of digestive diseases. furthermore, no differences were found from birth to weaning in the presentation of diseases or death and removal. further research is encouraged in older calves to investigate the potential beneficial effects of srb at more advanced stages of life. the study was conducted in a commercial certified organic dairy calf rearing facility located in northern colorado. calves were owned by this farm that provided consent for their inclusion in this study. pre-weaned holstein calves were managed during the study in accordance to the guidelines set by the institutional animal care and use committee of colorado state university (protocol id: - a). ninety pre-weaned holstein heifer calves, ± days old, were enrolled in this research. calves were monitored for days to assess the effect of srb addition in milk. after the days feeding period, a follow up period until weaning (around d of life) was completed to evaluate health outcomes based on farm records. the first stage of the study began in july and ended in august . the second stage was completed in october . after completion of this study, calves returned to the regular management for calves in this dairy farm. a detailed description of the calves' management at birth and in the rearing facility (housing, feeding, dehorning and vaccination program) was published [ ] . in general, calves were immediately separated from their dam at birth, fed . l of colostrum during the first hour of life and at and h of life. colostrum quality was at least mg/ml igg. after h of life, calves arrived in the rearing facility and they were housed in rows of individual hutches (agri-plastics, stoney creek, on, canada) with sand bedding and a wire panel pen attachment of . m . calves had visual but no physical contact with other animals until weaning. milk was provided in . l bottles (e-z nurse™) three times per day. during the study period the feeding schedules were : am, : pm, and : pm. milk collected from the hospital pen, and organic sealable milk delivered each day from an organic processing plant was pasteurized for calf feeding. also, organic certified powder milk was provided, following preparation instructions. milk composition was analyzed weekly during the study period. average ± sd fat, protein, lactose, and total solids were . ± . %, . ± . %, . ± . %, and . ± . %, respectively. organic certified calf starter was offered to the calves from day of life in clean buckets ( % organic calf starter, feedex companies, llc. south hutchimsin, ks) and water was offered ad libitum since the arrival of calves. total serum proteins were measured by trained personal to evaluate passive transfer of immunity. a ml blood sample was collected from the jugular vein in calves to days old in a tube without anticoagulant. the sample was allowed to clot before centrifugation. serum was analyzed in an optical engine digital refractometer (palm abbe™ , solon, oh) and all readings were kept in the farm recording system. the completion of the step-down weaning process took three weeks and it was based on calf starter consumption ( . to . kg per day) and fully weaned calves stayed during one week in the individual hutches to monitor health before transferring to collective pens. trained personnel had the responsibility to perform daily health evaluations to all the calves in the facility, with the objective of detecting and monitoring sick animals to apply treatments established in the farm standard operating procedures (sop). as the study farm is an organic certified dairy, calves that were not immediately responsive to initial treatment were sold to a conventional calf operation, where animals can receive antibiotic therapy. a paired comparison design with treatment groups was performed. calves were randomly assigned to a control (ctr, n = ) or a treatment group (srb, n = ) and a clinical examination was completed to determine the health status of each calf at enrolment. all calves were weighted at enrollment and at day using a mobile platform digital scale (caf-cart. raytec llc, ephrata, pa). this procedure was performed after the morning feeding. a subsample of calves from each group was randomly selected for fecal samples collection at enrollment and at day of the study, after the morning feeding. twenty grams of fecal matter were obtained by rectal stimulation with a gloved finger and stored in two separate sterile containers. one set of samples was submitted fresh to colorado state university, veterinary diagnostic laboratories for coronavirus and rotavirus screening. the second sample was frozen at − °c for subsequent iga analysis (iga bovine elisa kit, abnova corporation, taipei, taiwan.). a daily health assessment was performed for each calf every morning after the milk feeding. the calf health scoring chart by university of wisconsin [ ] was modified to assess fecal score. the scoring was categorized as healthy or for normal feces, as abnormal or for loose and pasty feces and as severe or for watery feces. dehydration status was assessed daily using a calf dehydration chart [ ] . the scores were assigned as for non-dehydrated animals (< % water body loss) with a normal attitude, strong suckle reflex, appetite, no eyeball retraction into the orbit and skin tent lower than s. score was described as moderate dehydration ( to % of water body loss) were the calf was depressed with weak suckle reflex, dropped ears, dry and slightly recessed eyes into the orbit and skin tent duration of to s. score was described as severe dehydration (> % of water body loss), when the calf showed signs of depression no suckle reflex, skin tent > s, dry and recessed eyes into the orbit and recumbency. calf attitude was assessed daily in conjunction with the health assessment. a depression scoring system to determine sickness [ , ] was modified. score corresponded to non-depressed animals. score corresponded to calves with noticeable depression and moderate signs of weakness but without altered gait. score corresponded to calves with severe depression marked signs of weakness and altered gait, in addition calves in recumbency were included. approximate milk intake was recorded after the am and pm feedings for all the calves that participated in the study. the intake was divided in categories, depending on milk refusal ( %; %; %; %; %) and an average daily intake was calculated. each animal was assigned with a daily health severity score, based on the combined morning health assessment (diarrhea score, dehydration score, attitude score) and the average milk intake. a status of "healthy" was determined when all the scores were (normal) and milk refusal was ≤ %. a "slight" disease status was applied to all the calves that had a milk refusal below % and at least one health score of . in the case of diarrhea, a score was also considered "slight" when the calf was not dehydrated and its attitude was not compromised. a "moderate" disease status was applied to the calves that presented more than two health scores of (or diarrhea score or ) and milk refusal above %. a "severe" disease status sick was given to calves in recumbency with more than two health scores in and milk refusal above %. organic certified jasmine stabilized rice bran was provided from urmatt thailand as a gift from rice bran technologies, sacramento, ca ( table ). the dose of srb was calculated to achieve % of the daily total calorie intake during the first weeks of life ( cal). this dose was calculated based on research with monogastric animals [ , , ] that indicated this level of inclusion as optimal. due to the milk feeding routine in this large rearing facility, reducing this % of the daily calories for the treatment group was not a possibility. the daily dose was divided into two feeding periods and mixed in the milk of the morning and the night feedings, as a higher milk intake was observed at these times compared with noon feeding. study personnel were responsible for the mixing and feeding of treatment calves. data were analyzed using sas statistical software ( . , sas institute inc., cary, nc usa). calf was considered the experimental unit of analyses. treatment group and health status at enrollment were included in the models unless otherwise specified. logistic regression analysis (proc logistic) was performed to determine differences between treatment groups in the frequency of events at enrollment, during the study period, and in the follow up until weaning. total sp measurements were categorized in two levels to detect failures in passive immune transfer or dehydration: < . g/dl and ≥ . g/dl. in addition, health status at enrollment was categorized as "healthy" or "diseased" and group differences were analyzed. these analyses were performed to assess the initial health condition of the treatment groups. additionally, logistic regression analysis was used to determine differences in frequencies of animal removal (death and culling aggregated in one variable) between treatment groups and to analyze differences in presentation of disease (< vs ≥ or more diseases) within the follow-up period. the association between the number of days sick (categorized by severity of disease) and treatment group was analyzed by use of repeated measures analysis for a binary response (proc genmod), assuming an exchangeable correlation structure. total calf days "healthy" were compared with total days "sick" (combining "slight", "moderate" and "severe"). in addition, total days calves spent with a "slight" disease condition were compared with the combination of "moderate" and "severe" days. finally, days in "severe" condition were compared combining days with "slight" and "moderate" condition. time to event analysis kaplan meier (proc lifet-est) was performed to evaluate differences in time to presentation and time to recovery from the first "moderate" case of disease between the groups. additionally, time to event analysis was used to evaluate differences in the time animals were removed and to evaluate differences in time to first disease after the end of the addition of srb. the wilcoxon test was used to determine statistical significance. least square means (proc glm) were calculated for adg and iga concentration. iga results were firstly log normalized. statistical significance was defined at p < . . tendency was defined at . < p < . . stress, immunity and the management of calves part iii: health and management practices in the u.s. dairy operations dietary modulation of the human colonic microbiota: introducing the concept of prebiotics prebiotics: why definitions matter prebiotics and resistance to gastrointestinal infections influence of dietary supplementation of prebiotics (mannanoligosaccharide) on the performance of crossbred calves fecal and saliva iga secretion when feeding a concentrated mannanoligosaccharide to neonatal dairy calves effects of a prebiotic supplement on health of neonatal dairy calves the effects of a prebiotic supplement (prebio support) on fecal and salivary iga in neonatal dairy calves effects of supplemental mannanoligosaccharides on growth performance, faecal characteristics and health in dairy calves evaluation of essential oils and prebiotics for newborn dairy calves effects of probiotic and prebiotic on average daily gain, fecal shedding of escherichia coli, and immune system status in newborn female calves body weight gain, feed efficiency, and fecal scores of dairy calves in response to galactosyl-lactose or antibiotics in milk replacers dietary rice bran protects against rotavirus diarrhea and promotes th -type immune responses to human rotavirus vaccine in gnotobiotic pigs consumption of rice bran increases mucosal immunoglobulin a concentrations and numbers of intestinal lactobacillus spp bioactive food components and health properties of rice bran dietary rice bran supplementation prevents salmonella colonization differentially across varieties and by priming intestinal immunity passive transfer of colostral immunoglobulins in calves managing the production, storage and delivery of colostrum tools to assess colostrum management. pennstate extension tolerance of a rice-based oral rehydration solution given to normal calves utilization of carbohydrates by the young calf effects of using wheat gluten and rice protein concentrate in dairy calf milk replacers effects of protein sources for milk replacers on growth performance and serum biochemical indexes of suckling calves effect of aluminized reflective hutch covers on calf health and performance calf health scoring chart heifer raising -birth to weaning. neonatal diarrhea. babcock institute for international dairy research and development clinical trial design in feedlots using calf depression score the authors also wish to express gratitude to rice bran technologies (sacramento, ca) for the donation of all the organic certified stabilized rice bran used in the study.funding usda-nifa orei award number - - funded the proposal "enhancing animal care strategies on organic dairy farms", providing resources for the completion of this study through graduate student support. the datasets generated and/or analyzed during the current study are not publicly available due to the extension of the daily health assessment but are available from the corresponding author on reasonable request. authors' contributions av: experimental design, data collection, laboratory analysis, statistical analysis, manuscript preparation. dm: data collection, laboratory analysis, statistical analysis. sp: data collection. hh and rc: manuscript preparation. epr: experimental design, srb procurement, manuscript preparation. pp: experimental design, statistical analysis, manuscript preparation. all authors have read and approved the manuscript.ethics approval and consent to participate animals were managed during the study in accordance to the guidelines stablished by the institutional animal care and use committee of colorado state university (protocol id: - a). a written consent, detailing all the animal related procedures, to use the cows in this study was provided by the owner. not applicable. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. key: cord- -iptfle b authors: harada, kazuki; shimizu, takae; tsuka, takeshi; imagawa, tomohiro; takeuchi, takashi title: first case of propionibacterium acnes urinary tract infection in a dog date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: iptfle b background: propionibacterium acnes has been rarely isolated as a commensal from dogs, but there is little evidence of pathogenicity. urinary tract infections are common in dogs and are typically caused by various commensal bacteria. here we present the first case report of a urinary tract infection caused by p. acnes. case presentation: a -year-old female japanese shiba inu was hospitalized for polyuria, polydipsia, and severe hematuria. at admission, blood tests revealed leukocytosis, slight anemia, decreased albumin, and slightly elevated blood urea nitrogen. computerized tomography showed gas accumulation on the inner side of the bladder wall. urinalysis revealed proteinuria and bilirubinuria without glycosuria. the urine sediment contained large numbers of erythrocytes and leukocytes. additionally, rod-shaped bacteria were detected by diff-quik staining. enrofloxacin and metronidazole were administered empirically; however, the renal function declined sharply and the patient died days later. bacteriological examination revealed that the causative agent was propionibacterium acnes, which was identified as sequence type via multilocus sequence typing. this isolate showed high susceptibility to ampicillin, amoxicillin/clavulanic acid, cefoxitin, imipenem, clindamycin, tetracycline, chloramphenicol, and enrofloxacin, but was resistant to metronidazole. conclusion: to the best of our knowledge, this is the first case report of a dog with urinary tract infection caused by p. acnes. propionibacterium acnes is an aerotolerant, anaerobic, gram-positive, rod-shaped bacterium commonly isolated from humans. it is often implicated in acne vulgaris and occasionally in postoperative and implant-associated infections [ ] . in dogs, this bacterium can be isolated as a commensal from the skin [ ] , intestinal tract [ ] , and oral cavity [ ] ; however, unlike humans, there is little evidence of pathogenicity. urinary tract infections (utis) are either temporary or permanent breaches in host defense mechanisms that allow microbes, mainly bacteria, to adhere, multiply, and persist within the urinary tract [ ] . the main clinical features of uti are dysuria, pollakiuria, and hematuria. these are most commonly caused by escherichia coli; other uropathogens include gram-positive cocci, proteus spp. klebsiella spp., pasteurella spp., mycoplasma spp., enterobacter spp. and pseudomonas spp. [ ] . however, p. acnes has not been previously reported as a causative agent of uti in dogs. here we report the presentation and clinical course of a uti in a dog due to p. acnes infection. a -year-old female japanese shiba inu was hospitalized in november for polyuria, polydipsia, severe hematuria, loss of appetite, weight loss, and lethargy. she had a recent history of hospital visits for cholestasis and hemorrhagic diarrhea due to severe whipworm infection. the owners granted permission for the publishing of this case report. at admission, blood tests revealed leukocytosis ( . × /l with % neutrophils), slight anemia (rbc . × /l and pcv of . %), decreased albumin ( . g/dl), elevated hepatobiliary enzymes, possibly owing to cholestasis, and minimal changes in renal function (blood urea nitrogen . mg/dl and creatinine . mg/dl). no bacteria were detected in the peripheral blood via blood smear examination. adrenocorticotropic hormone stimulation testing was negative. thyroid hormone levels remained within the normal range. igm antibody titers for coronavirus, adenovirus type , parvovirus, and canine distemper virus were below detectable limits (< , , , and , respectively). computerized tomography showed gas accumulation on the mucosal side of the bladder wall (fig. ) . urinalysis showed proteinuria and bilirubinuria without glycosuria. the urine sediment contained large numbers of erythrocytes and leucocytes including neutrophils and monocytes. rod-shaped bacteria were also detected via diff-quik ( fig. ) but not by gram staining. no urinary calculi, yeasts or fungal hyphae were detected. enrofloxacin ( mg/kg of body weight once a day) and metronidazole ( mg/kg twice a day) were administered empirically for the treatment of uti. on day , this case developed urinary retention and formed a blood clot in the bladder, which was found by echography. in addition, the patient's renal function declined sharply (blood urea nitrogen . mg/dl and creatinine . mg/dl). after being informed of the dog's condition, the owners decided to take the dog home; the patient died the next day. while a post-mortem examination would have been helpful in this case, this could not be performed as the owners declined post mortem examination. urine was obtained via catheterization on day and plated on sheep blood agar (eiken chemical co., ltd., tokyo, japan) under aerobic and anaerobic conditions at °c for h. small white colonies were observed only on plates incubated under anaerobic conditions; however, mycoplasma canis, which can grow on blood agar plates [ ] , was not detected. the growing bacteria were non-spore-forming gram-positive rods. the isolate was catalase-positive and identified as p. acnes using an api a (sysmex biomérieux co., ltd., tokyo, japan) with a . % probability. polymerase chain reaction (pcr) and dna sequencing of the s rrna gene confirmed the biochemical identification results. multilocus sequence typing (mlst) using nine housekeeping genes (cel, coa, fba, gms, lac, oxc, pak, reca, and zno) was performed according to previously published protocols [ ] . on the basis of these results, the isolate was determined to be of sequence type . susceptibility testing was performed by e-test (biomérieux, marcy l'etoile, france) per the manufacturer's directions against the following antimicrobials: ampicillin, amoxicillin/clavulanic acid, cefoxitin, imipenem, clindamycin, tetracycline, chloramphenicol, enrofloxacin, and metronidazole. briefly, an inoculum was prepared by suspending a -h culture in reduced brucella broth (becton dickinson microbiology systems, cockeysville, md, usa) to achieve a density of . on the mcfarland nephelometer standard. the inoculum was plated on brucella blood agar (biomérieux co., ltd.). minimum inhibitory concentrations (mics) were determined following a -h incubation at °c in an anaerobic chamber in accordance with clinical and laboratory standards institute guidelines [ ] . bacteroides fragilis atcc was used as a reference strain. the bacterium showed high susceptibility to ampicillin, amoxicillin/clavulanic acid, cefoxitin, imipenem, clindamycin, tetracycline, chloramphenicol, and enrofloxacin, but was resistant to metronidazole (table ) . there have been few reports of propionibacterium infection in animals. hodgin et al. [ ] reported a case of a dog with osteomyelitis and arthritis due to propionibacterium infection caused by a dog bite. in our case, there was no history of trauma and the route of infection could not be identified. several factors that predispose to uti, such as diabetes, cushing' disease, and hypothyroidism, were ruled out in this case based on urine and blood analyses. anatomic abnormalities were not identified by diagnostic imaging. concurrent infections with viruses, yeasts, fungi, and m. canis, were not identified by serological and microbiological tests. in addition, this patient did not have a history of steroid use. thus, we could not identify any factors to predispose this patient to p. acnes uti. one hypothesis is that this was an ascending urinary tract infection, a common source of uti [ ] , as p. acnes is as a part of the normal flora of the skin and feces. another possibility is translocation of bacteria from the intestinal tract [ ] , given that the patient had concurrent severe diarrhea caused by whipworm infection, which could have damaged the gut/blood barrier. a final possibility is that the whipworm infection may have made the dog more susceptible to anthroponotic infection and the bacteria may have been normal flora from a human in contact with the dog. in this case, p. acnes was not detected in urine via gram staining. this was also demonstrated in a previous study [ ] , and should be taken into account when considering p. acnes infection as a differential. our case was diagnosed as emphysematous cystitis (ec), a rare type of uti, based on several diagnostic imaging techniques. ec occasionally occurs in diabetic dogs [ ] but is relatively rare in nondiabetic dogs [ ] . ec results from an infection by gas-producing bacteria, including e. coli, proteus spp., aerobacter aerogenes, and clostridium spp. [ ] . while p. acnes has not been reported to cause ec in dogs previously, gas production was noted in a human with p. acnes infection [ ] . thus, p. acnes should be regarded as a gas-producing bacterium and a potential cause for ec in dogs. our p. acnes isolate was identified as sequence type . this type has been isolated from human cases of acne and meningitis and reported in the mlst database [ ] . in vitro antimicrobial susceptibility testing showed that our isolate was highly susceptible to most of the antimicrobials tested, except metronidazole, an agent to which p. acnes is consistently resistant [ ] . a similar finding was reported for isolates from human cases of implant-associated infection [ ] . thus, our isolate shared sequence type and antimicrobial susceptibility with human isolates. however, the mlst database of p. acnes only contains human isolates, which prevents determination as to whether the bacteria were from a human source. the addition of p. acnes strains from dogs and other animals to the mlst database would be helpful in future epidemiological analyses. this case's condition rapidly worsened despite administration of enrofloxacin, to which the p. acnes isolate was susceptible. this case developed urinary retention due to the formation of blood clot, which is a risk factor for pyelonephritis [ ] . in addition, in this case, renal function decreased concurrently with the development of urinary retention. therefore, antimicrobial treatment may have had poor efficacy as a result of the development of acute pyelonephritis. utis are common bacterial infections in dogs. to the best of our knowledge, this is the first case report of a dog with uti caused by p. acnes. propionibacterium acnes: infection beyond the skin distribution of propionibacteria on dogs: a preliminary report of the findings on dogs prevalence and identity of translocating bacteria in healthy dogs cultivable oral microbiota of domestic dogs utis in small animal patients: part : etiology and pathogenesis bacterial infections of the urinary tract mycoplasma canis and urogenital disease in dogs in norway population genetic analysis of propionibacterium acnes identifies a subpopulation and epidemic clones associated with acne methods for antimicrobial susceptibility testing of anaerobic bacteria anaerobic bacterial infections causing osteomyelitis/arthritis in a dog failure of gram stain to detect propionibacterium acnes in specimens from clinically significant infections emphysematous cyctitis and other radiographic manifestations of diabetes mellitus in dogs and cats radiographic and ultrasonographic findings of emphysematous cystitis in four nondiabetic female dogs emphysematous cystitis in two glycosuric dogs chronic propionibacterium acnes prosthesis joint infection manifesting as a large abscess with gas, without prosthesis loosening antibiotic susceptibility of propionibacterium acnes isolated from orthopaedic implant-associated infections utis in small animal patients: part : diagnosis, treatment, and complications we thank mr. masato kuroki for preparing plasma samples of the animal to outsource the measurement of viral antibody titers. abbreviations ec: emphysematous cyctitis; mic: minimum inhibitory concentration; mlst: multilocus sequence typing; pcr: polymerase chain reaction; pcv: packed cell volume; rbc: red blood cell count; uti: urinary tract infection. the authors declare that they have no competing interests.authors' contribution kh was responsible for the interpretation of test results, and drafted the manuscript. ts performed the antimicrobial susceptibility. tt (tsuka takeshi) and ti carried out diagnostic imaging. tt (takashi takeuchi) performed the clinical work-up and care. all authors read and approved the final manuscript.• we accept pre-submission inquiries • our selector tool helps you to find the most relevant journal submit your next manuscript to biomed central and we will help you at every step: key: cord- -uqezwbzn authors: dee, scott; neill, casey; clement, travis; christopher-hennings, jane; nelson, eric title: an evaluation of a liquid antimicrobial (sal curb®) for reducing the risk of porcine epidemic diarrhea virus infection of naïve pigs during consumption of contaminated feed date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: uqezwbzn background: since its initial detection in may , porcine epidemic diarrhea virus (pedv) has spread rapidly throughout the us swine industry. recently, contaminated feed was confirmed as a vehicle for pedv infection of naïve piglets. this research provides in vivo data supporting the ability of a liquid antimicrobial product to reduce this risk. results: sal curb® (kemin industries, des moines, ia, usa) is a fda-approved liquid antimicrobial used to control salmonella contamination in poultry and swine diets. to test its effect against pedv, sal curb®-treated feed was spiked with a stock isolate of pedv (ct = . ), which pedv-naïve piglets were allowed to ingest via natural feeding behavior (ad libitum) for a -day period. for the purpose of a positive control, a separate group of piglets was allowed to ingest non-treated (sal curb®-free) feed also spiked with stock pedv (ct = . ). a negative control group received pedv-free feed. clinical signs of pedv infection (vomiting and diarrhea) and viral shedding in feces were observed in the positive control group – days post-consumption of non-treated feed. in contrast, no evidence of infection was observed in pigs fed sal curb®-treated feed or in the negative controls throughout the -day study period. in addition, the sal curb®-treated feed samples had higher (p < . ) mean pedv ct values than samples from the positive control group. conclusions: these data provide proof of concept that feed treated with sal curb® can serve as a means to reduce the risk of pedv infection through contaminated feed. furthermore, the results from the positive control group provide additional proof of concept regarding the ability of contaminated feed to serve as a risk factor for pedv infection of naïve piglets. porcine epidemic diarrhea virus (pedv) is an enveloped single-stranded positive sense rna virus belonging to the order nidovirales, the family coronaviridae and the genus alphacoronavirus [ ] . following detection in the us swine population during may, , the virus spread rapidly across the country with cases of porcine epidemic diarrhea (ped) confirmed across states as of may , [ , ] . recently, proof of concept that contaminated feedstuffs can serve as a route of pedv transmission to naïve pigs was reported [ ] . this study evaluated the risk of pedv-contaminated complete feed through a novel on-farm sampling method for detection of virus in feed along with an in vivo experiment (swine bioassay) using at-risk feed material and normal feeding behavior [ ] . as this new information confirmed feed as a risk factor, it became imperative to seek solutions. therefore, a follow up study was conducted to evaluate whether a liquid antimicrobial product containing formaldehyde and organic acid could mitigate said risk. the rationale for this approach was based on previous publications indicating that products containing formaldehyde and organic acids have a positive effect on salmonella reduction in feed [ ] [ ] [ ] . furthermore, additional studies have demonstrated that formaldehyde treatment of organ inoculums containing turkey coronavirus (tcov) rendered this material non-pathogenic, whereas other treatments failed to ameliorate its negative effects [ , ] . as pedv and tcov are both coronaviruses, it was hypothesized that formaldehyde treatment of pedvcontaminated feed may induce an anti-viral effect and prevent infection of susceptible pigs. this study was conducted in biosafety level + rooms at the animal resource wing (arw) at south dakota state university (sdsu). all procedures involving animals throughout the study were performed under the guidance and approval of the sdsu institutional animal care and use committee. animals (n = , six-week old piglets) were sourced from a pedv-naïve herd and were tested on arrival to the arw via blood sampling and collection of rectal swabs from each pig. prior to animal arrival, all rooms (walls, ceilings, floors and drains) were monitored for the presence of pedv by pcr using sampling procedures previously described [ ] . using a validated swine bioassay method [ ] , the piglets were divided into groups and each group was housed in an individual room as follows: treatment group: five piglets consumed feed treated with sal curb® and spiked with stock pedv [ ] . positive control group: five piglets consumed saline-treated feed spiked with stock pedv. negative control group: two piglets consumed feed + saline without pedv. feed was sourced from a pedv-naïve farm and screened by pcr prior to use. for the purpose of the study, a . kg allotment of feed was treated with . ml of sal curb®, (kemin industries, des moines, ia usa), based on an inclusion rate (per label) of kg/ton of complete feed. sal curb® is a premix of aqueous formaldehyde solution % (for maintenance of complete animal feeds or feed ingredients salmonella-negative for up to days) and propionic acid (as a chemical preservative for control of mold in feed or feed ingredients). while sal curb® provides effective salmonella control for up to days, it is not approved for use by the u.s. food & drug administration or the u.s. department of agriculture as a treatment for pedv. the liquid antimicrobial was added to the feed using a syringe, injecting approximately ml in different locations within the . kg of feed. to promote proper mixing, the feed was stirred manually for minutes using wooden spoons and strainers. upon completion of the minute mixing period, treated feed was spiked with ml of a stock isolate of pedv at a cycle threshold (ct) value of . . twenty ml aliquots of virus were injected into different locations within the feed. this level of pedv contamination was selected based on data from actual field cases of pedv-contaminated feed as well as levels of challenge used in the proof of concept study [ ] . for the purpose of a positive control, a . kg quantity of feed was also spiked with ml of stock pedv (ct = . ) along with . ml of sterile saline. finally, feed for the negative control group was treated with . ml of sterile saline (no pedv and no sal curb®). the total time required for preparation of feed batches was minutes, followed by placement into the feeders of the respective rooms, allowing immediate adlibitum access to feed for a -day period [ ] . separate mixing instruments were used to prepare the feed for all groups of pigs. following access to treated feed, the pedv status of all groups was monitored. on a daily basis, arw personnel inspected animals for clinical signs of ped and collected rectal swabs (dacron swabs, fisher scientific, franklin lakes, nj, usa) from each pig. personnel moved from the negative control group, to the treatment group and then to the positive control group every day. showers were taken between rooms and room-specific coveralls, footwear, hairnets, gloves and p masks ( m, st. paul, mn usa) were worn. in addition, each room was ventilated individually and hepa filtration for both incoming and outgoing air was employed per room. if clinically affected animals were observed, swabs of diarrhea and/or vomiting, in conjunction with the daily rectal swab, were collected. swabs were submitted to the sdsu adrdl and tested by pcr. on day of the study, animals were humanely euthanized with intravenous sodium pentobarbital and small intestinal tracts submitted for pcr and immunohistochemistry (ihc) testing and microscopic evaluation. on designated days during the study period, (days , , , , , , , and ), feed samples were collected from the respective groups. the purpose of sampling was to document the presence of pedv in feed and to determine whether a change in viral load occurred over time. samples were collected from the material hopper from the feeder in each room. as these hoppers were rectangular in shape ( . cm deep × cm long × . cm wide), protocols used to sample feed from flatbottom trucks were referenced per the usda grain inspection, packers and stockyards administration [ ] . for collecting feed samples, a model of a grain probe was constructed [ ] . this model consisted of pvc tubes (heritage plastics inc., carrolton, oh, usa), one placed inside the other per standard probe design. the outer tube was cm in length with a diameter of . cm and the inner tube was cm in length with a diameter of . cm. to facilitate feed entry into the lumen of the probe, seven . cm slots were drilled into each tube. rotation of the outer tube aligned the slots across both tubes, resulting in the entry of feed into the probe via gravity flow. once sampling was complete, the outer tube was rotated in the opposite direction, thereby closing the slots. to maintain feed in the probe lumen during sampling, as well as facilitate sample removal post-collection, both ends of the model were covered by a . cm plastic cap. three models were constructed, one for each room. using the flat-bottom truck protocol, samples of feed were taken from each hopper, one from each corner (n = ) and one from the center. the goal was to collect approximately grams of feed per sampling time. at each point, the probe was inserted at an angle of to a depth of cm into the hopper, thereby "burying" the probe. during placement, the outer tube was rotated clockwise to close the slots and prevent feed entry. for sample collection, the outer tube was rotated counter-clockwise; opening the slots in both tubes and the model was moved in an up-and-down manner times [ ] . the outer tube was rotated to close the slots and the probe was removed. one end cap was removed and the sample was deposited into a gram plastic specimen container. once approximately grams of feed were collected, a ml aliquot of sterile saline was added to the specimen container. a sterile dacron swab was inserted into sample and rotated times clockwise and times counter-clockwise to contact any pedv present. the swab was removed, placed into a ml plastic tube (falcon, franklin lakes, nj, usa) containing ml of sterile saline and submitted for testing. all diagnostic testing was conducted using protocols developed and validated by the south dakota state university animal disease research and diagnostic laboratory. the magmax™ viral isolation kit (life technologies, waltham ma, usa) was used to obtain viral rna from the samples, as described in the instructions provided ( m revision f). a -μl volume of sample was used for the extraction. the magnetic bead extractions were completed on a kingfisher instrument (thermo scientific, waltham ma, usa). a commercially available real-time, single tube rt-pcr multiplex assay for the detection of pedv and transmissible gastroenteritis virus (tgev) was used in this study per kit instruction (tetracore, rockville, md, usa). briefly, μl of the extracted rna was added to μl of the master mix. the one-step real-time rt-pcr amplification conditions started with minutes at °c, followed by minutes at °c. the final cycles consisted of seconds at °c and then seconds at °c (data collection step). the program was run for cycles (cycle time) and the fam detector was used for pedv and the tamra detector was used for tgev. positive and negative controls were included on each run. all amplification was completed on the abi instrumentation (austin, tx, usa). for pedv propagation, vero cells (atcc crl- ) were maintained in mem plus % fetal bovine serum and antibiotics. three-day old confluent monolayers of vero cells in cm flasks were washed times with serum free minimum essential media (mem) prior to inoculation. monolayers were infected at~ . moi of pedv in mem containing . ug/ml tpck-treated trypsin, incubated at °c for approximately hours until obvious cpe was apparent. flasks were frozen at − °c until needed. immunohistochemistry slides of porcine gi tracts were prepared using the standard sdsu adrdl ihc procedure, with the following modification being the use of pedv monoclonal antibody sd- - , of mouse ascites origin, courtesy of steve lawson, sdsu, at a : dilution. the in vivo phase of the study was conducted from march to april , (table ). prior to initiation of the bioassay, all samples from incoming piglets, arw facilities and feed were pcr negative. throughout the day study period, pedv rna in rectal swabs and clinical signs of ped were not observed in the treatment group or the negative control group. in addition, small intestinal tract samples from all pigs in the treatment group and the pigs in the negative control group were negative by pcr and ihc and no evidence of microscopic lesions of ped was observed. in contrast, in the positive control group pedv rna was detected in a rectal swab from the index piglet on day post-ingestion (table ) . on day , clinical signs of diarrhea were observed in the index piglet and another piglet was pcr positive on rectal swab. from day - post-ingestion, pedv rna was detected in diarrhea and rectal swabs from piglets, with lethargy, vomiting and diarrhea noted. for the remainder of the day study period, sporadic shedding of pedv in feces was detected with poor condition in piglets. small intestinal tract samples from all pigs were positive by pcr and ihc. in addition, microscopic evaluation of small intestinal tissues indicated lesions indicative of ped, including re-epithelialization with diffuse villous blunting and fusion. the results of the feed sampling are summarized in figure with raw data provided in table . all feed samples from the positive control group were positive for the presence of pedv rna by pcr with a mean ct of . (range = . - . ). in contrast, the mean ct value of the feed from the treatment group was . (range . - ). when analyzed by t-test, the difference in the mean ct levels between the treatment group and the positive control group was significant at p < . . all samples were pcr-negative from the negative control group. based on the results of the bioassay, sal curb® treated feed prevented infection and clinical disease in naïve piglets. in contrast, pigs allowed to ingest non-treated feed spiked with pedv became infected. while both the treatment and the positive control feed contained a similar level of pedv immediately post-processing (day ), there was a significant difference in mean ct at the end of the sampling period (day ) across the groups. while ct values in treated feed changed over time, values detected in the positive control feed samples remained relatively constant. one interpretation of this observation, in conjunction with the swine bioassay data, is that the sal curb® product had an adverse effect of viral load and viability, while in the absence of sal curb® the quantity of pedv remained constant and that virus survived over time. an acknowledged limitation was that the results are based on very small populations of pigs housed under experimental conditions and cannot be extrapolated to today's large-scale commercial farm conditions until further testing can be conducted. in addition, the study was not designed to answer questions which still remain regarding the liquid antimicrobial product, such as the duration of activity against pedv, its effects on other viral pathogens, its effect on dietary nutrients and the logistics of application and daily use. in closing, this is the first publication providing evidence that a means to "biosecure" feed against a globally significant virus may be possible. future studies should investigate whether application of the liquid antimicrobial product may have broader application at the international level and could possibly reduce the risk of the introduction of emerging and re-emerging pathogens through feed and feed ingredients that cross borders. finally, as "feed biosecurity" is a new paradigm for the swine industry, veterinarians, producers and representatives from the feed industry will need to work together and pursue novel means to implement such a strategy. the results of this study provide initial proof of concept that the application of a liquid antimicrobial product (sal curb®) reduced the risk of pedv infection through contaminated feed. furthermore, data from the positive control group once again provide proof of concept regarding the ability of contaminated feed to serve as a risk factor for pedv infection of naïve piglets. the data set(s) supporting the results of this article is included within the article. diseases of swine isolation and characterization of porcine epidemic diarrhea viruses associated with the disease outbreak among swine in the united states usda aphis vs nvsl nahln umn swine health monitoring report: porcine epidemic diarrhea virus reporting an evaluation of contaminated complete feed as a vehicle for porcine epidemic diarrhea virus infection of naïve pigs following consumption via natural feeding behavior: proof of concept assessment of anti-salmonella activity of commercial formulations of organic acid products nutritional strategies to combat salmonella in mono-gastric food animal production chemical treatment of animal feeds and water for the control of salmonella spiking mortality of turkey poults: . effect of six different in vitro disinfection techniques on organ homogenates capable of reproducing smt spiking mortality of turkey poults: . experimental reproduction in isolation facilities role of transportation in spread of porcine epidemic diarrhea virus infection, united states environmental stability of a cell culture adapted u.s. isolate of pedv usda grain inspection, packers and stockyards administration: chapter : probing and sampling an evaluation of a liquid antimicrobial (sal curb®) for reducing the risk of porcine epidemic diarrhea virus infection of naïve pigs during consumption of contaminated feed the authors would like to recognize dr. michele mucciante and the animal resource wing team for their significant contributions to the success of this study. the authors would also like to thank dr. mark bienhoff and kemin industries for providing the technical expertise, funding and in-kind resources necessary to complete this project. the authors declare that they have no competing interest.authors' contributions sd: developed study, co-wrote paper. cn: identified sal curb product. tc: conducted molecular diagnostics, co-wrote paper. jch: provided critical review and revising of paper. en: provided virological expertise at the laboratory level and co-wrote paper. all authors read and approved the final manuscript. key: cord- -qbkkhfcb authors: paris, jasmin k; wills, sheila; balzer, hans-jörg; shaw, darren j; gunn-moore, danièlle a title: enteropathogen co-infection in uk cats with diarrhoea date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: qbkkhfcb background: individual enteropathogen infections in healthy and clinically ill cats are well described, but prevalence and patterns of enteropathogen co-infection have only been reported on a limited basis. we studied enteropathogen co-infection in diarrhoeic uk cats using results of a real time pcr assay for enteropathogenic species; feline coronavirus (co), feline panleukopenia virus (pa), clostridium perfringens (cl), salmonella enterica (sa), giardia spp. (gi), tritrichomonas foetus (tr), cryptosporidium spp. (cr), and toxoplasma gondii (to). age, gender, breed and history were recorded. pcr panels from diarrhoeic cats were available for analysis. results: overall enteropathogen prevalence was . % (co), . % (pa), . % (cl), . % (sa), . % (gi), . % (tr), . % (cr) and . % (to). prevalence of co, gi and tr was higher in pedigree cats compared to non-pedigree cats (dsh) and prevalence decreased with increasing age for co, pa, gi, cr and tr. co-infection was common: ≥ enteropathogens were detected in . % of cats, and . % of cats had ≥ enteropathogens. mean ( [formula: see text]) enteropathogen co-infection . (± . sd), was significantly higher in pedigree cats ( [formula: see text] = . ) compared to dsh ( [formula: see text] = . ) and decreased with age ( [formula: see text] = . < months, [formula: see text] = . for > yr). more cats were negative for all enteropathogens tested ( . %) than expected. when exact combinations of co-infection were examined, tr tended to be found in combinations with co, cl, and gi. conclusions: multiple infections should be considered the most likely result of faecal testing in cats, and case management needs to take this into account. in contrast, the relatively high percentage of cats negative for all enteropathogens tested could indicate an innate resistance to infection. alternatively it could indicate a lack of exposure to these enteropathogens or the presence of other enteropathogens not assessed by this assay. diarrhoea is common in domestic cats [ ] , and can occur as a result of gastrointestinal disease (including dietary causes, gastrointestinal infection, inflammation or neoplasia) or extra-gastrointestinal disease. a number of potential enteropathogens have been found in diarrhoeic and non-diarrhoeic feline faeces, including bacterial, viral, protozoal and other parasitic organisms [ ] [ ] [ ] [ ] [ ] . however, reports of co-infection with or more enteropathogens are surprisingly limited, and have predominantly involved giardia spp. and tritrichomonas foetus [ ] [ ] [ ] [ ] [ ] . reports of or more pathogens occurring simultaneously in feline faeces are scarce. however, a recent small study examined the faeces of diarrhoeic and non-diarrhoeic cats entering a florida animal shelter using a real-time pcr assay for a panel of enteropathogens. multiple organisms were identified in % of diarrhoeic cats in that study, but specific patterns of co-infection were not evaluated [ ] . co-infection can have clinical consequences, for example, presence of cryptosporidium spp. has been associated with an increased severity of diarrhoea in t. foetus positive cats [ ] , and enteropathogen interdependence has been implicated in a study examining the effects of fenbendazole treatment in cats with concurrent giardia spp. and cryptosporidium spp. infection [ ] . these results suggest a possible shared pathogenesis or symbiotic relationship involving selected feline enteropathogens. evaluating enteropathogen co-infection patterns could therefore provide important information on the pathogenesis, treatment options and prognosis in affected cats. detection of enteropathogen infection in cats has traditionally relied upon techniques such as faecal flotation, microscopic faecal examination, antigen detection by enzyme-linked immunosorbent assays (elisa), bacterial culture, viral isolation, immunofluorescence and electron microscopy. while these techniques are often still the most appropriate to diagnose the cause of diarrhoea in cats, they can be time consuming, costly and may require significant sample volumes, making testing for multiple enteropathogens impractical. the development of real-time pcr has enabled rapid screening of small quantities of faeces for potential enteropathogens. more recently, pcr assays capable of detecting multiple potential enteropathogens in a single faecal sample have become available for a variety of species including domestic pets [ ] [ ] [ ] . the results generated by these assays offer for the first time the opportunity to examine co-infection patterns for selected enteropathogen species, and may form the basis for further, targeted enteropathogen testing and subsequent treatment decisions. the primary objective of this study was therefore to identify and describe feline enteropathogen co-infection in a large population of diarrhoeic uk cats using the results obtained from the same pcr assay used in [ ] for a panel of enteropathogens (feline coronavirus, feline panleukopenia virus, clostridium perfringens, salmonella enterica, giardia spp., t. foetus, cryptosporidium spp. and toxoplasma gondii). co-infection was investigated via two approachesconsideration of which enteropathogens were co-occurring in samples, and the exact combination of enteropathogens present. in addition, considering that previous reports have documented a higher prevalence of enteropathogens in juvenile cats [ , [ ] [ ] [ ] [ ] [ ] [ ] [ ] and pedigree cats [ , , ] , secondary objectives were to evaluate individual enteropathogen prevalence and frequency of co-infection in association with pedigree status and age. the study showed that enteropathogen infection in diarrhoeic cats is common (> % prevalence for of the enteropathogens). prevalence of feline coronavirus, giardia spp. and t. foetus was higher in pedigree cats compared to non-pedigree cats (dsh) and decreased with age for feline coronavirus, feline panleukopenia virus, giardia spp., cryptosporidium spp. and t. foetus. in addition, while co-infection by enteropathogens was common ( . %), . % of cats were negative for all enteropathogenswhich was greater than expected by chance alone. mean ( x ) enteropathogen co-infection ( . ) was higher in pedigree cats ( x = . , dsh x = . ) and decreased with age ( x = . < months, x = . for > yr). t. foetus was more likely to occur together with feline coronavirus, c. perfringens and giardia spp.. multiple infections should therefore be considered the most likely result of testing in diarrhoeic cats; however, some diarrhoeic cats may be negative for all enteropathogens tested. between june and january , all , feline faecal samples submitted to a reference laboratory a by veterinary surgeons from first opinion small animal veterinary practices in the uk for a real-time pcr assay evaluating a panel of enteropathogens b were considered. however, only samples collected from diarrhoeic cats were included in the current study (n = ). additional data were recorded from the submission form when available, including age, gender and breed. total nucleic acid was extracted from faeces by using the qiaamp dna blood biorobot mdx kit on an automated qiagen platform (biorobot mdx) according to the manufacturer instructions with slight modifications. realtime pcr at idexx vet med lab was performed using the lightcycler system (roche) with proprietary forward and reverse primers and hydrolysis probes. target genes for enteropathogen detection using real-time pcr were as follows: feline coronavirus b gene (dq . ), feline panleukopenia virus vp gene (eu ), clostridium perfringens alpha toxin gene (am ), salmonella enterica invasion a gene (eu ), giardia smallsubunit rrna gene (dq ), tritrichomonas foetus . s rrna gene (af ), cryptosporidium smallsubunit rrna gene (a ), and toxoplasma gondii internal transcribed spacer- gene (l ). real-time pcr was run with quality controls, including pcr-positive controls, pcr negative controls, negative extraction controls, an internal positive control (ipc) spiked into the lysis solution to monitor the nucleic acid extraction efficiency and presence or absence of inhibitory substances, rna quality control, and an environmental contamination monitoring control. panels containing weak or borderline positive results (n = ) and those from pooled faecal samples (n = ) were excluded, resulting in samples being used in this study. enteropathogens were ordered for all analyses as follows: feline coronavirus (co), feline panleukopenia virus (pa), c. perfringens alpha toxin gene (cl), salmonella enterica (sa), giardia spp. (gi), t. foetus (tr), cryptosporidium spp. (cr), and t. gondii (to). univariate general linear models with binomial errors were used to assess for differences in the prevalence of the enteropathogen with pedigree status (dsh or pedigree) and age group (< months, - months and > months) and differences within factors were examined using standard post-hoc tukey pairwise comparisons (phtpc), which adjusted for the multiple pairwise testing within a factor. a multivariable model was then run to look at the interaction between age group and pedigree status, and whether taking one factor into account resulted in a change in statistical significance associated with the other factor. analyses of the number of enteropathogenic species detected in samples were examined in a similar way but general linear models with poisson errors were used instead. two approaches were adopted for the analysis of co-infection. first standard chi-square (χ ) analyses were carried out to look at the associations of enteropathogenic species co-occurrence (hereafter termed 'co-occurrence'). here the number of observed samples with particular species was compared to what would have been expected if the species being considered were randomly distributed in samples at the frequency observed for each species on its own. combinations of pairs, triplets etc. all the way up to all species were considered. for each comparison whether other species not being considered were present or not were ignored. for example, the co-occurrence 'c:pagi' indicates co-occurrence of pa and gi irrespective of whether the other species (co, cl, sa, tr, cr and to) were present or not. for the second approach the exact combination of absent or present enteropathogenic species was of interest (hereafter 'fingerprint' analysis). exact species profiles were created using results from all the enteropathogenic species tested and are described according to the species present, with unlisted species being negative. for example the fingerprint 'f:cotr' indicates that a faecal sample was positive for co and tr, and negative for all other species tested (pa, cl, sa, gi, cr and to). these fingerprints were first examined with hierarchical cluster analyses using ward's minimum variance method to produce a cluster dendrogram. the significance of each particular profile was then examined by comparing the number of observed samples with that particular profile to what would have been expected to have occurred if the species were randomly distributed in samples at the frequency observed for each species on its own (i.e. each species presence or absence was included in the estimation of what would be expected). to take into account the likelihood of type i errors increasing due to multiple testing, in all cases statistical significance was set as p < . , and all analyses were carried out in r (version . . © the r foundation for statistical computing). results of , pcr panels were available where a documented history of diarrhoea was recorded. other common clinical signs included weight loss, vomiting, anorexia, lethargy and haematochezia. available data accompanying faecal sample submissions from the cats with a history of diarrhoea included breed ( %), age ( , = . %), gender ( , = . %) and neuter status ( = . %). four hundred and thirtyseven samples ( . %) came from pedigree breeds, the remaining cats were dsh. samples were divided into groups according to the age of the cat sampled, in order to expose potential differences relating to immune competence and likelihood of pathogen exposure; < months ( cats, . %), - months ( cats, . %), or > months ( cats, . %). where recorded, there were ( . %) male neutered, ( . %) male entire, ( . %) female neutered, ( . %) female entire and ( . %) and ( . %) male and female cats respectively where neutered status was not recorded. the overall prevalences of enteropathogenic species were . % feline coronavirus, . % feline panleukopenia virus, . % c. perfringens, . % s. enterica, . % giardia spp., . % t. foetus, . % cryptosporidium spp. and . % t. gondii (figure a ). faecal samples from pedigree cats were significantly more likely than dsh to be positive for feline coronavirus ( . % vs. . %), giardia spp. ( . % vs. . %) and t. foetus ( . % vs. . %, p < . ), with no such differences for the other species (p > . , figure b ). there were also significant differences in the prevalence of infection between the three age groups for feline coronavirus, feline panleukopenia virus, giardia spp., t. foetus and cryptosporidium spp. (p < . , p > . for the other species, figure c ). in particular, young cats (< months) had significantly higher prevalences of infection than both the older cat groups for feline panleukopenia virus ( . % vs. . % ( - m) and . % (> m), p < . ). in addition, the youngest cats also had significantly higher prevalence of infection than the oldest cats for other species (co . % vs. . %, gi . % vs. . % and cr . % vs. . %, p < . ). furthermore, - month old cats had significantly higher prevalence of infection compared to the oldest cats for species (gi . % vs. . %; tr . % vs. . %, p < . , figure c ). there was no statistically significant interaction between any species found in a sample and age and pedigree status (p > . ). taking age into account made no qualitative differences to the univariate pedigree results, with differences still observed for feline coronavirus, giardia spp. and t. foetus (p < . ) and no other differences (p > . ). a similar lack of qualitative change in significance shown in figure c was observed for age groups taking into account pedigree status for all but of the enteropathogens, with the difference between - m and > m no longer different for t. foetus (p = . ). enteropathogenic species co-infection was a common finding, with . % of the , samples having or more species (mean x = . ± . sd, figure a ), and . % with or more species detected. however, . % of the samples submitted were negative for all species. no samples had species present but sample did have all . mean species carriage in pedigree cats ( x = . ± . ) was significantly higher than in dsh cats ( x = . ± . ) (p < . , figure b ), with . % of the cats with none of the species detected being dsh. furthermore, there were differences in mean carriage with age group, with cats > months old ( x = . ± . ) having significantly fewer species per sample compared to < months old ( x = . ± . , p < . ) and - months old cats ( x = . ± . , p < . , figure c ). in addition, . % of cats with none of the species detected were > months old and . % of were dsh cats > m old. the differences observed in age groups remained when differences in pedigree status were first taken into account, and vice versa (p < . ). the analysis of co-occurrence data found that of the possible co-occurrences were present more than would be expected if enteropathogens were present in samples at random (p < . , figure ). only of the possible co-occurrences were observed less than expected, but differences were ≤ (p > . ). pair-wise consideration revealed feline coronavirus co-occurred with giardia spp., and t. foetus, more frequently than expected, but not with c. perfringens (despite c:cocl being the most common co-occurrence - samples, p = . ) or feline panleukopenia virus. in contrast, there was greater co-occurrence of feline panleukopenia virus and giardia spp., and giardia spp. with both cryptosporidium spp. and t. foetus, respectively, figure ). there were significantly greater co-occurrence in / ( %) of -way co-occurrences, / ( %) of -way co-occurrences and / ( %) of -way co-occurrences ( figure ). no one enteropathogenic species dominated these combinationswith of the species occurring with similar frequencies in the combinations: feline coronavirus ( / ), feline panleukopenia virus ( ), c. perfringens ( ) , giardia spp. ( ) , t. foetus ( ) and cryptosporidium spp. ( ) , reflecting the most common enteropathogens observed (figure a ). after evaluating co-occurrence, analysis was carried out to evaluate the exact combination of enteropathogens (fingerprint) present or absent in samples. out of a possible faecal profiles, only ( %) were observed ( figure ) . the most striking result from the dendrogram is that % of all samples were clustered in profiles consisting of the . % samples which were not positive for any of the species and ( . %) samples in which either just feline coronavirus ( ) or c. perfringens ( ) was detected or both ( , figure [a]), with none of the other species detected. however, in terms of statistical significance the profiles of f:co, f:cl and f:cocl did not occur more than would be expected by chance given the overall prevalences of infection of the enteropathogenic species (p > . , figure ). in contrast, there were statistically more f:neg profiles ( ) than would be expected ( , p < . ). the next most common fingerprint was f:cocltr ( , figure ), which was observed significantly more than expected (p = . , figure ). the remaining samples (excluding f:cotr samples, and samples which represented profiles (figure <ix> ), including the f:sa (n = ) and f:to (n = ) mono infections) could be allocated into broad clusters representing other observed profiles ( figure ). there was a cluster of feline panleukopenia virus with cryptosporidium spp. and/or c. perfringens (n = , figure [b]) but levels were as expected for f:pa, f:paclcr and f:pacl (p > . , figure ). there was also another very broad cluster of feline coronavirus with feline panleukopenia virus and other enteropathogenic species (n = , figure [c]) with f:copacl and f:copa representing % of that cluster, though these profiles were not observed more or less than expected (p > . , figure ). there was another apparent cluster of cryptosporidium spp. with feline coronavirus and/or c. perfringens (n = , figure [d]), and a small cluster of giardia spp. and c. perfringens (n = , figure [e]), though none of the profiles in clusters [d] and [e] were present more or less than expected (p > . , figure ). the next cluster consisted of feline coronavirus with giardia spp. and other species (n = , figure [f]). however, in contrast to clusters [b]-[e], one profile was not as expected: f:coclgitr (n = ) occurred more than expected (p < . , figure ). there was a final small cluster of low numbers of samples mainly consisting of t. foetus with cryptosporidium spp. and/or c. perfringens and other species (n = , figure [g]). there were an additional fingerprints that were expected to occur given the relative occurrence of individual enteropathogenic species where none were observed (f:cosa, f: coclto, f:pagitr, f:patrcr, f:gitrcr, f:copatrcr, f: pacltrcr, f:pagicrto and f:paclgitrcr, figure ). however, these were each only expected to be observed in or fewer samples. this left potential profiles not observed and these profiles all contained the enteropathogenic species that occurred at very low (≤ %) frequencies (sa and to). if these species were excluded, then there were possible fingerprints with the other species and of these ( %) fingerprint profiles were observed (figure ) , with of the profiles described above expected but not observed. this is the first large scale study to evaluate enteropathogenic species co-infection patterns in cats. several methods were used to evaluate co-infection. a co-occurrence analysis was used to look at co-infection with - species, irrespective of the presence or absence of the other enteropathogens. this permitted evaluation of which of the enteropathogenic species were likely to occur in diarrhoeic cat samples submitted by first opinion veterinarians as determined by this type of diagnostic assay. however, the co-occurrence approach did not evaluate enteropathogen absence as a determinant of precise co-infection patterns. co-infection patterns were therefore also evaluated using fingerprint analysis, which took into account the absence or presence of each of the enteropathogens studied. this permitted consideration of the interaction between specific enteropathogens. this study demonstrated that multiple co-infections were common, with at least of the enteropathogens detected in . % cats. moreover, the results indicated that co-infection was often not a random event, in terms of which of the enteropathogens were observed to occur together. another interesting result was that . % of cats with reported diarrhoea had none of the enteropathogen species tested by this assay, which was significantly higher than would be expected based on chance alone. in this study, the prevalence of individual enteropathogens (figure a ) correlated well with previous reports. feline coronavirus was identified in . % of diarrhoeic faecal samples, consistent with previous reports of - % [ , ] . feline panleukopenia virus was detected in . % of samples, which is comparable to a detection rate of . % in faecal samples from cats with diarrhoea by electron microscopy in a previous study [ ] , but higher than the anecdotal incidence of clinical feline panleukopenia infection in the uk. possible explanations include asymptomatic infection, passive viral carriage, or false positive results occurring as a result of modified live vaccine administration within the preceding weeks [ ]. alternatively, pcr cross reactivity with canine parvovirus (cpv) could be responsible, given that cpv was detected by pcr in % of faecal samples from asymptomatic shelter cats in a recent study [ ] . the prevalence of c. perfringens alpha toxin gene was . %, consistent with previous data [ , ] . giardia spp. were detected in . % samples, corresponding to previous prevalence estimates ranging from . - % depending on the test population and detection method employed [ , , [ ] [ ] [ ] . t. foetus was identified in . % of samples, consistent with previous prevalence data of . - % [ , , ] . the prevalence of cryptosporidium spp. <i>. ( ) <ii>. ( ) <iii>. ( ) <iv>. ( ) <v>. ( ) <vi>. ( ) <vii>. ( ) <viii>. ( ) <ix>. ( ) <x>. ( ) <xi>. ( ) [a] [b] [c] [d] [e] [f] [g] in this study was . %, which is greater than the - . % reported previously [ , , ] . the discrepancy might reflect improved sensitivity of the pcr assay for detection of cryptosporidium spp. compared with traditional faecal evaluation and immunoassay methods [ ] . as in previous studies, t. gondii [ ] and salmonella enterica [ , ] were detected infrequently, with prevalence values of . % and . % respectively. in addition to showing that the enteropathogenic infections occur frequently individually, this study also identified frequent enteropathogen co-infection. using an -way pcr assay, co-infection with ≥ enteropathogenic species was observed in . % faecal samples, and overall mean species carriage was . ( figure a) . a higher mean enteropathogen carriage was identified in both pedigree (figure b ) and young cats (figure c) , consistent with the higher prevalence of both giardia spp. and t. foetus observed in these groups and also the higher prevalence of feline coronavirus, feline panleukopenia virus and cryptosporidium spp. in the youngest cats in this study and in previous reports [ , [ ] [ ] [ ] , ] . consistent with these observations, % of cats with no enteropathogens detected were found to be dsh cats > months of age. the increased enteropathogen carriage in pedigree and young cats could reflect genetic or age related reductions in immune-competence, or increased contact with other cats in cattery, breeding, and cat-show establishments. increased housing density has been identified as a risk factor for t. foetus [ ] , feline coronavirus [ ] [ ] [ ] and giardia spp. infections in cats [ ] , possibly reflecting the common faeco-oral route of infection. alternatively, housing conditions may influence disease risk in cats as a result of stress [ ] . in the case of gastrointestinal disease, the mechanism responsible is thought to involve alterations in epithelial barrier function [ ] . previous reports of feline enteropathogen co-infection have focused predominantly on infections observed along with t. foetus. several studies have described co-infection with t. foetus and giardia spp., with co-infection prevalence rates ranging from . % to % [ , , ] . in a study of experimentally-induced t. foetus infection in cats, the duration and severity of diarrhoea was significantly greater in cats with chronic pre-existing and asymptomatic c. parvum infection than in specific pathogen free cats. in addition, coinfected cats were more likely to suffer episodes of acute self-limiting diarrhoea in the chronic phase (> weeks) of t. foetus infection, particularly following diagnostic procedures or changes in antibiotic therapy [ ] . the authors of that study concluded that fluctuations in the intestinal microbiota may be necessary to produce the clinical manifestations of t. foetus infection. the intimate relationship between t. foetus and the intestinal microbiota is consistent with the observation that trichomonads are obligate parasites dependent on endogenous bacterial flora and host secretions for acquisition of essential nutrients [ ] . the results from the current study's fingerprint analysis are consistent with this observation: t. foetus was observed more commonly than expected as a fingerprint and co-associated with feline coronavirus and c. perfringens, with the potential addition of giardia spp. statistically, the most significant fingerprint analysis result indicated that a much greater proportion of faecal samples were negative for all of the enteropathogenic species than expected (observed , expected , figure ); this corresponded to an overall percentage of . % of the cats. since all the cats had documented diarrhoea on sample submission, this finding may indicate that some cats are intrinsically resistant to infection by these enteropathogenic species, but have diarrhoea caused by another mechanism. alternatively, some cats may not have been exposed to these species, and may have been infected with enteropathogenic species not assessed by this diagnostic panel (for example campylobacter spp. or isospora spp.). further studies will be required to identify potential common factors in this group of cats. however, it is of interest to note that % of the diarrhoeic cats with none of the species detected were > months old dsh cats. this is consistent with our finding of smaller numbers of enteropathogen species in older dsh cats. while fingerprint analysis was used to examine the exact combinations of the species present in the faecal samples, the association between individual sets of species was also examined separately, irrespective of the presence or absence of any enteropathogens not currently under consideration (co-occurrence analysis). feline coronavirus was identified more frequently than expected together with giardia spp., and t. foetus in this study. previous work has shown that a proportion of cats become chronic carriers following infection with feline coronavirus [ ] [ ] [ ] . these cats shed the same strain of coronavirus for years [ ] , suggesting this enteropathogen has developed mechanisms to suppress the host immune response, such as induction of tnfα release by infected cells and subsequent lymphocyte apoptosis [ , ] . a reduction in local host immune responses within the intestinal tract may explain the increased frequency of feline coronavirus co-occurrence with other enteropathogens. significant co-occurrence was also identified for giardia spp. with both cryptosporidium spp. and t. foetus, potentially reflecting shared protozoal features. similarities between t. foetus and giardia spp. have been identified at the molecular level, including molecular and genetic traits, suggesting that they are of sister lineages [ ] . pathogenic mechanisms are reported to be similar for cryptosporidium spp. and giardia spp., with common features including malabsorption, hypersecretion and disrupted epithelial barrier function [ , ] . considering that pathogenic mechanisms proposed for t. foetus include alterations in the normal flora, adherence to the epithelium, and elaboration of cytokines and enzymes [ ] , infection with giardia spp. and cryptosporidium spp. could predispose to t. foetus infection. there were several limitations to this study. given the retrospective nature of the study, there was no control over the data provided at the time of sample submission, and no follow up in terms of treatment and outcome. of the samples submitted, % were not accompanied by any historical information, and in the remaining % it was not possible to rule out clinical signs that were not mentioned on the submission form. for this reason, only cats with a documented history of diarrhoea were included. the lack of background information (for example: housing, diet, number of cats in household, geographical location, show attendance) prevented evaluation of additional risk factors for individual and multiple enteropathogen infection. in addition, the effect of prior treatment (antimicrobials, anthelmintics) on prevalence and patterns of enteropathogen co-infection could not be established. in the absence of a healthy control population, it was not possible to determine the clinical significance of individual or multiple enteropathogen infections in cats. future prospective studies which include a control population of healthy cats are therefore required. this study used pcr to investigate the presence of enteropathogenic species and explore their co-carriage. it is important to note that even though an organism is detected by pcr, it does not mean it is necessarily the cause of the documented diarrhoea. furthermore, the highly sensitive aspect of pcr assays may result in positive results in the presence of negligible enteropathogen burdens. pcr has been accepted as the gold standard technique for diagnosis of t. foetus infection in cats [ , ] , but alternative diagnostic techniques may be preferred for other enteropathogen infections. another approach to aid diagnosis of the cause of the diarrhoea would be to combine conventional faecal testing (using microscopy for parasitology, and bacterial faecal culture and toxin testing) with a modified pcr panel to document c perfringens alpha toxin gene (quantitative assay), c. perfringens enterotoxin gene (quantitative assay), plus c. coli, and c. jejuni. this is the first large scale study examining co-infection patterns of enteropathogenic species in diarrhoeic cats. the results show that co-infection by these species is common in cats, and that specific patterns of coinfection occur both more and less commonly than expected, indicating that infection by different species is not a random process but clustered. t. foetus is more likely to occur together with feline coronavirus, c. perfringens, and giardia spp. in diarrhoeic feline faeces. finally, the proportion of cats with none of the tested enteropathogenic species detected is greater than would be expected based on chance alone, suggesting that some cats may have an intrinsic resistance to infection to these species, or a lack of environmental exposure specific to these species. further work is required to establish whether different patterns would be observed in healthy cats and the relationship between the causes of diarrhoea and the detection of one or more enteropathogens in faeces. tr f:cr f:to f:copa f:cocl f:cogi f:cotr f:cocr f:coto f:pacl f:pagi f:patr f:pacr f:clsa f:clgi f:cltr f:clcr f:clto f:gitr f:gicr f:trcr f:crto f:copacl f:copagi f:copatr f:copacr f:coclsa f:coclgi f:cocltr # f:coclcr f:cogitr f:cogicr f:cotrcr f:paclgi f:pacltr f:paclcr f:paclto f:pagicr f:clsacr f:clgitr f:clgicr f:cltrcr f:clcrto f:copaclgi f:copacltr f:copaclcr f:copagitr f:copagicr f:coclgitr # f:coclgicr f:cocltrcr f:cocltrto f:coclcrto f:cogitrcr f:paclsagi f:paclgicr f:pasacrto f:clgitrcr f:copaclgitr f:copaclgicr f:copacltrcr f:copagitrcr f:coclgitrcr f:copaclsagitr f:copaclgitrcr f:copaclsagitrcrto health status and population characteristics of dogs and cats examined at private veterinary practices in the united states prevalence of selected bacterial and parasitic agents in feces from diarrheic and healthy control cats from northern california prevalence of enteric zoonotic agents in cats less than year old in central new york state prevalence of potentially pathogenic enteric organisms in clinically healthy kittens in the uk enteropathogenic bacteria in dogs and cats: diagnosis, epidemiology, treatment, and control prevalence of enteric zoonotic organisms in cats naturally occurring tritrichomonas foetus infections in australian cats: cases tritrichomonas foetus infection in purebred cats in germany: prevalence of clinical signs and the role of co-infection with other enteroparasites tritrichomonas foetus infections in surveyed pet cats observed occurrence of tritrichomonas foetus and other enteric parasites in australian cattery and shelter cats identification of tritrichomonas foetus and giardia spp. infection in pedigree show cats in new zealand enteropathogens identified in cats entering a florida animal shelter with normal feces or diarrhea experimental infection of cats with tritrichomonas foetus evaluation of fenbendazole for treatment of giardia infection in cats concurrently infected with cryptosporidium parvum simultaneous detection of viral and bacterial enteric pathogens using the seeplex(r) diarrhea ace detection system a multiplex polymerase chain reaction assay to simultaneously distinguish cryptosporidium species of veterinary and public health concern in cattle development of a multiplex pcr for detection of avian adenovirus, avian reovirus, infectious bursal disease virus, and chicken anemia virus prevalence of tritrichomonas foetus infection in cats with diarrhoea in the uk giardia in symptomatic dogs and cats in europe-results of a european study prevalence and risk factors for giardia and coccidia species of pet cats in - risk factors for feline infectious peritonitis among cats in multiple-cat environments with endemic feline enteric coronavirus patterns of feline coronavirus infection and fecal shedding from cats in multiple-cat environments fecal shedding of feline coronavirus in adult cats and kittens in an abyssinian cattery comparison of different in-house test systems to detect parvovirus in faeces of cats effect of vaccination on parvovirus antigen testing in kittens canine parvovirus in asymptomatic feline carriers prevalence of and risk factors for feline tritrichomonas foetus and giardia infection comparison of direct immunofluorescence, immunoassays, and fecal flotation for detection of cryptosporidium spp. and giardia spp northern california animal shelters high prevalence of giardia detected in cats by pcr cryptosporidium infection in farm cats in the glasgow area feline infectious peritonitis: a worldwide serosurvey a study of naturally occurring feline coronavirus infections in kittens clustering of feline coronaviruses in multicat households survey of giardiosis in household and shelter dogs from metropolitan areas of curitiba, parana state, southern brazil external and internal influences on disease risk in cats how stress induces intestinal hypersensitivity the establishment of various trichomonads of animals and man in axenic cultures persistence and transmission of natural type i feline coronavirus infection use of a reverse-transcriptase polymerase chain reaction for monitoring the shedding of feline coronavirus by healthy cats pathogenesis of feline enteric coronavirus infection apoptosis and t-cell depletion during feline infectious peritonitis a "possible" involvement of tnf-alpha in apoptosis induction in peripheral blood lymphocytes of cats with feline infectious peritonitis genomic minimalism in the early diverging intestinal parasite giardia lamblia pathophysiology of enteric infections with giardia duodenalius an updated review on cryptosporidium and giardia host-parasite interaction in bovine infection with tritrichomonas foetus single-tube nested pcr for detection of tritrichomonas foetus in feline feces enteropathogen co-infection in uk cats with diarrhoea the authors would like to thank the veterinarians who submitted feline faecal samples for the idexx -way pcr assay. competing interests jb works for idexx laboratories which offers the -way feline pcr assay as a commercial test.authors' contributions jb carried out pcr testing, sw retrieved patient signalment, history (where available) and pcr data from stored records, djs participated in the design of the study, performed the statistical analysis and helped to draft the manuscript, jp and dgm conceived of the study, participated in its design and co-ordination and helped draft to the manuscript. all authors read and approved the final manuscript. key: cord- -b vg ap authors: bonelli, f.; turini, l.; sarri, g.; serra, a.; buccioni, a.; mele, m. title: oral administration of chestnut tannins to reduce the duration of neonatal calf diarrhea date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: b vg ap background: neonatal calf diarrhea is generally caused by infectious agents and is a very common disease in bovine practice, leading to substantial economic losses. tannins are known for their astringent and anti-inflammatory properties in the gastro-enteric tract. the aim of this study was to evaluate the effect of the oral administration of chestnut tannins (castanea sativa mill.) in order to reduce the duration of calf neonatal diarrhea. twenty-four italian friesian calves affected by neonatal diarrhea were included. the duration of the diarrheic episode (dde) was recorded and the animals were divided into a control group (c), which received effydral® in l of warm water, and a tannin-treated group (t), which received effydral® in l of warm water plus g of extract of chestnut tannins powder. a mann-whitney test was performed to verify differences for the dde values between the two groups. results: the dde was significantly higher in group c than in group t (p = . ), resulting in . ± . and . ± . days, respectively. conclusions: phytotherapic treatments for various diseases have become more common both in human and in veterinary medicine, in order to reduce the presence of antibiotic molecules in the food chain and in the environment. administration of tannins in calves with diarrhea seemed to shorten the dde in t by almost days compared to c, suggesting an effective astringent action of chestnut tannins in the calf, as already reported in humans. the use of chestnut tannins in calves could represent an effective, low-impact treatment for neonatal diarrhea. calf diarrhea is a very common disease in bovine practice, and is generally caused by infectious agents [ ] . the most common pathogens involved are rotavirus, coronavirus, cryptosporidium parvum and escherichia coli, especially in animals less than one month old [ , ] . calf diarrhea causes substantial economic losses in the dairy industry, due treatment costs, a decreased growth rate in the calves, and a higher replacement rate due to culling or death [ ] . in order to reduce the presence of antibiotic molecules in the food chain and in the environment, phytotherapic treatments are now commonly used both in human [ ] and in veterinary medicine. various formulations of polyphenols, such as bacteriostatic, anti-clostridial and astringent, have been tested, especially in monogastric nutrition [ ] [ ] [ ] [ ] . some phytotherapic options have been evaluated for gastrointestinal diseases, such as gastric ulcers and gastric lesions, in rats, piglets, horses, and calves [ ] [ ] [ ] . pomegranate-residue supplements have been used in neonatal calves affected by cryptosporidium parvum, resulting in a reduction in the fecal oocyst count, as well as in intensity and duration of diarrhea [ ] . tannins are a complex group of polyphenolic compounds which are present in several plants as secondary metabolites against pathogens [ ] . in ruminants, in vitro and in vivo trials have demonstrated that tannins can improve animal performance and reduce the impact of gastrointestinal parasitism, nitrogen pollution, and methane emission from rumen fermentation [ , ] . tannins may interfere with digestive processes by binding dietary protein, by modulating the activity of rumen micro-organisms, and by reducing the growth of the bacterial population [ ] [ ] [ ] . in ruminants, tannins tend to decrease the rate of protein degradation in the rumen [ ] . tannins, in fact, inhibit the growth of proteolytic bacteria and form tannin-protein complexes in the rumen. this effect may significantly vary according to the chemical structure of the tannin and to the amount of tannin included in the diet. however, the reduction of protein degradation in the rumen increases the total amount of protein digested in the duodenum, because the tannin-protein complexes are dissociated in the abomasum, releasing protein. as a consequence, the use of moderate doses of tannins in the diet of ruminants usually improves animal performance [ , ] . the astringent and anti-inflammatory effects of tannins on the gastro-enteric tract have been demonstrated in avian [ , ] and swine species [ ] , and the effects of tannins on liver function have been evaluated in newborn calves [ ] . the aim of the present study was to evaluate the effect of oral administration of chestnut tannins (castanea sativa) in the treatment of calf neonatal diarrhea. this in vivo blinded study was approved by the institutional animal care and use committee (oba, pisa, prot. n. , / of . . ) and was carried out at the university of pisa's dairy farm, where nearly animals are maintained in free-stall conditions. during the study period, the population consisted of italian friesian calves aged between and days. all the calves underwent the same management condition. briefly, immediately after birth they were weighed and then housed in a single straw-bedding pen ( . × m) that leads contact between each other. two l of good colostrum (≥ g/l of ig) from their own dam, or from the colostrum bank, were administered as soon as the calf could drink ( min - h). another l were administered within the next - h in order to achieve a good passive transfer immunity [ ] . all the calves received a total of l of colostrum, twice a day, until the third day of life. then, they received l of whole milk at °c, twice a day until the third week of life. all the feeding procedures were conducted by an expert operator and by using a nipple bucket. even when there were cases of diarrhea, there were still no feeding restrictions or changes of feeding regime. from the third day of life, fresh and clean water were provided to each calf ad libitum. free choice-hay was administered after the first week of life. the calves were weighed and moved into a collective pen after the third week of life. the inclusion criteria were calves up to three weeks of life and the manifestation of diarrhea, defined as a fecal score ≥ [ ] . briefly, the fecal score represents the evaluation of feces fluidity as reported in literature: score means "normal", thus firm, but not hard and the original form is distorted slightly after dropping to the floor and settling; score means "soft", thus does not hold its form, but piles and spreads slightly (like soft-serve ice cream); score means "runny", thus spreads readily to about mm depth. (i.e., pancake batter); score means "watery", thus liquid consistency, splatters. (i.e., orange juice) [ ] . since the first day of diarrhea (t ), the fecal score (fs) was recorded daily by the same expert operator until the complete recovery from diarrhea, at the same time, the physical examination has been done. the duration of a diarrheic episode (dde) was defined as the period (in days) between the first diarrhea outbreak (fecal score ≥ ) and the normalizing of the fs (fecal score = ). once the diarrhea had started, a fecal sample was collected from each calf by manual restraint. a gloved, lubricated finger was passed gently through the anus in order to massage the rectal wall and to stimulate rectal evacuation. fresh feces were then collected in two different sterile tubes: one aliquot was immediately tested with a rapid elisa test (test strips for detection of rotavirus, coronavirus, e. coli f and c. parvum in bovine feces, biox diagnostics, belgium), while the second aliquot was stored in a refrigerated bag and evaluated within one hour for gastrointestinal parasites, according to izzo et al. ( ) [ ] . at the inclusion time, calves were randomly assigned to a control group (c) or a tannin-treated group (t), both made up of calves ( males and females in each of the two groups). all the calves enrolled in group c received effydral® (italy zoetis ltd.) (sodium chloride . g, potassium chloride . g, sodium bicarbonate . g, citric acid anhydrous . g, lactose monohydrate . g, glycine . g) in l of warm water q h. the calves assigned to group t received effydral® (italy zoetis ltd.) in l of warm water plus g of chestnut tannins as extract powder ( g/kg of dry matter equivalent of tannic acid; mauro saviola group srl, radicofani, siena, italy) q h. the chemical composition of the powder is described in campo et al. ( ) [ ] . the powder adopted in the present study was produced in a single batch and analyzed by the manufacturer at the beginning of the study. both solutions were administered using a graduated calves bottle in order to ensure the intake of the entire quantity. the bottle was equipped with a flexible rubber nipple ( cm of length) specific for calf feeding. calves in both groups received the solutions until the normalization of the fs. before the administration of the treatments, all the calves were daily submitted to a complete physical examination and fs evaluation until the resolution of diarrhea. physical examination included evaluation from a distance plus hands-on examination, focusing on: physical appearance, body weight, body condition, head, mouth, eyes, ears, neck and back, thorax, abdomen, umbilicus, musculoskeletal system, perianal region, body temperature, feces, urine, and external genitalia [ , ] . dehydration status was assessed with a score system [ ] . milk intake was recorded during the entire diarrheic episode. at the conclusion of the study, the female calves were raised in the farm as rearing cows, while the male calves were sold for fattening as meat animals. data concerning the weight at birth and at the third week of life, the age of diarrhea onset and the t fecal scores (t -fs) recorded for both groups were assessed for normal distribution by the shapiro-wilk normality test and then a mann-whitney test was applied in order to verify differences between the two groups at the inclusion time [ ] . the average daily gain between birth date and third week of life was calculated for all the calves in both groups. data concerning the average daily gain, the dde and fecal scores recorded throughout the dde were analyzed by a linear model including treatments and sex and their interaction as fixed factors. a shapiro-wilk normality test was performed to assess data distribution. a mann-whitney test was carried out to verify differences between the two groups regarding the average daily gain, the dde and the fecal scoring [ ] . values with p < . were considered statistically significant. twenty-four out of the calves, males and females met the inclusion criteria, and were thus included in this study. the average weight at birth was kg (minimum value of . kg and maximum value of kg) and . kg (minimum value of kg and maximum value of . kg) for groups c and t, respectively. the mean age at t was . ± . days for group c, and . ± . days for group t. the mean t -fs were . ± . and . ± . for groups c and t, respectively. no significant differences were found in terms of the weight at birth, the age of diarrhea onset, and the t -fs between the two groups (p > . ). there were no alterations at the physical examination, and the hydration status was normal for all calves during the entire study period. no differences between groups were found for milk intake. thus, no pharmacological treatments or fluid therapy were needed. seven out of twelve ( / ) calves belonging to group c resulted positive for cryptosporidium parvum, / for rotavirus and coronavirus, and / negative. nine/ calves belonging to group t were positive to cryptosporidium parvum, / for rotavirus and coronavirus, and / were negative to the rapid elisa test performed. fecal flotation did not show intestinal parasites. the average weight at the third week of life was kg (minimum value of kg and maximum value of kg) and . kg (minimum value of kg and maximum value of . kg) for groups c and t, respectively. the average daily gain was . kg/day (minimum value of . kg/day and maximum value of . kg/day), and . kg/day (minimum value of . kg/day and maximum value of . kg/day), for groups c and t, respectively. differences between the two groups were not significant. the mean dde in days was . ± . for group c, and . ± . for group t ( table ) . a significant difference between the two groups was found (p = . ). the mean fecal score recorded throughout the dde for group c was . ± . , while for group t the score was . ± . , with a statistically significant difference between the two groups (p = . ). no statistically significant differences were found between male and female calves for the dde and fecal score recorded throughout the dde. no calves refused the tannins solution. due to the high amount of antimicrobials used every year in the livestock industry and possible cross-resistance between human and animal pathogens [ , ] , for many years alternative treatments have been investigated [ ] . chestnut tannins have been proposed to modulate rumen fermentation and the degradability of food proteins in cattle [ , ] . however, there is little information on the effects of chestnut tannins on diarrhea in neonatal calves, especially in relation to different pathogens. the pathogen that was most isolated in our population of diarrheic calves was cryptosporidium parvum, in line with those reported in the literature [ , , ] . the mean age of diarrhea onset for all calves included was also in line with literature data [ , ] . it is well known that natural plant tannins are able to control intestinal parasites in ruminants [ ] and, more table duration of the diarrheic episode (dde), fecal score recorded throughout the dde of control group (c) and tannintreated group (t) expressed as mean (x) ± standard deviation (sd) in general, have antimicrobial properties [ ] . the supplementation of chestnut extract in grazing heifers has been shown to lead to a significant increase in the average daily gain due to a decrease in fecal parasites infections, above all nematodes [ ] . several mechanisms of actions have been proposed for tannins, including enzyme inhibition and substrate or metal ions deprivation, and bacterial cell membrane integrity [ ] . however, most studies have reported the effects of tannins (above all condensed tannins) on bacteria, fungi and nematode, whereas only few have investigated the effect of tannins on protozoa and, in particular, on cryptosporidium parvum [ , ] . the anti-protozoal activity of polyphenols has been reported for eimeria [ ] [ ] [ ] . a suggested mechanism is the ability of tannins to directly decrease the viability of the larval stage and disrupt egg hatching, as previously observed also for nematodes [ ] . however, there have been conflicting results. bhatta et al. ( ) found a decrease in protozoa when hydrolysable tannins from six different plant sources were applied [ ] . carulla et al. ( ) who reported that condensed tannins from leucaena, quebracho and from acacia mearnsii respectively, can decrease protozoal numbers [ ] [ ] [ ] . in contrast, vasta et al. ( ) found that quebracho tannins were able to increase protozoa in rumen liquor [ ] . differences in the concentration of tannins, plant sources, protozoal species and environment considered in such studies may explain the conflicting results obtained, because these parameters play an important role in the antiprotozoal activity of polyphenols. to the best of our knowledge this is the first study that has investigated orally administrating tannins as a treatment for calf diarrhea. tannins solution appeared to be pleasant for all the calves enrolled in the study and was easy to administer. the length of diarrhea was almost four days shorter in the group treated with tannins compared to the control group. chestnut tannins seem to shorten the length of diarrhea in calves, as already reported in humans [ ] . chestnut polyphenols are ellagitannins and those from wood distillation are particularly rich in ellagic acid, such as pomegranate polyphenols [ ] . few studies have reported on the absorption and metabolism of ellagitannins in animal models. studies of rat intestinal content demonstrated that at the caecum level ellagitannins are hydrolyzed to ellagic acid [ ] . other authors have detected free ellagic acid in human plasma after h post ingestion of pomegranate and attributed this to the release after hydrolysis of ellagitannins according to an optimal physiological ph and gut microbiota activity. in addition, cerdà et al. ( ; ; ) suggested a microbial involvement at the colon level in converting ellagic acid into urolithins, which are potent anti-inflammatory metabolites [ ] [ ] [ ] . although the length of diarrhea was significantly shorter in calves from group t, no significant difference was found in terms of average daily gain between control calves and calves that received chestnut tannins. similarly, a study based on tannins from pomegranate reported no effects of tannins on average daily gain in the first days of life in dairy calves [ ] . further studies are needed in order to investigate the possible effect of hydrolysable tannins on specific etiological pathogens, in particular on cryptosporidium parvum, as already reported for the extract of pomegranate polyphenols [ ] . also, increasing the number of animals included might clarify the effect of chestnut tannins on the average daily gain in calves affected by diarrhea. chestnut tannins might represent a low-impact treatment of neonatal diarrhea in calves. however, the effects of chestnut tannins on the onset of diarrhea and on the weight gain of calves need further investigation due to the lack of data on the metabolism of ellagitannins in ruminants. abbreviations c: control group; dde: duration of a diarrheic episode; elisa: enzyme-linked immunosorbent assay; fs: fecal score; t: tannin-treated group neonatal diarrhea an overview of calf diarrhea-infectious etiology, diagnosis, and intervention antibacterial potential of plant volatile oils: a review useful plants for animal therapy efficacy test of a hydrolysable tannin extract against necrotic enteritis in challenged broiler chickens metabolic and microbial modulation of the large intestine ecosystem by non-absorbed diet phenolic compounds: a review use of polyphenol-rich grape byproducts in monogastric nutrition a review antioxidant effect of dry olive (olea europaea l.) leaf extract on ethanol-induced gastric lesions in rats medicinal plants -prophylactic and therapeutic options for gastrointestinal and respiratory diseases in calves and piglets? a systematic review phylogastro in the treatment of equine gastric ulcer lesions effect of pomegrate-residue supplement on cryptosporidium parvum oocystis shedding in neonatal calves review. tannins and ruminant nutrition methane emission by goats consuming different sources of condensed tannins the influence of addition of gallic acid, tannic acid, or quebracho tannins to alfalfa hay on in vitro rumen fermentation and microbial protein synthesis tannins for suppression of internal parasites milk fatty acid composition, rumen microbial population, and animal performances in response to diets rich in linoleic acid supplemented with chestnut or quebracho tannins in dairy ewes milk production, composition, and milk fatty acid profile from grazing sheep fed diets supplemented with chestnut tannin extract and extruded linseed exploitation of dietary tannins to improve rumen metabolism and ruminant nutrition tannins are stringent in vitro anti-microbial activity of silva feed enc® tannin on bacterial strains of poultry origin a controlled trial on the effect of feeding dietary chestnut extract and glycerol monolaurate on liver function in newborn calves colostrum management for dairy calves guidelines toward more uniformity in measuring and reporting calf experimental data hydrolyzable tannins from sweet chestnut fractions obtained by a sustainable and eco-friendly industrial process evaluation of some physical, haemathological and clinical chemistry parameters in healthy newborn italian holstein calves initial management and clinical investigation of neonatal disease use of hypertonic salinedextran solution to resuscitate hypovolemic calves with diarrhea user's guide: statistics second joint fao/oie/who expert workshop on non-human antimicrobial usage and antimicrobial resistance: management options food animals and antimicrobials: impacts on human health antimicrobial properties of tannins effects of plant tannin supplementation on animal responses and in vivo ruminal bacterial populations associated with bloat in heifers grazing wheat forage pomegranate (punica granatum) peel is effective in a murine model of experimental cryptosporidium parvum anthelmintic activity of pistacia lentiscus foliage in two middle eastern breeds of goats differing in their propensity to consume tannin-rich browse consumption of pistacia lentiscus foliage alleviates coccidiosis in young goats sericea lespdeza as an aid in the control of emeria spp. in lambs difference in the nature of tannins on in vitro ruminal methane and volatile fatty acid production and on methanogenic archaea and protozoal populations supplementation of acacia mearnsii tannins decreases methanogenesis and urinary nitrogen in foragefed sheep digestion, ruminal fermentation, ciliate protozoal populations, and milk production from dairy cows fed cinnamaldehyde, quebracho condensed tannin, or yucca schidigera saponin extracts effects of condensed tannins from leucaena on methane production, rumen fermentation and populations of methanogens and protozoa in vitro bacterial and protozoal communities and fatty acid profile in the rumen of sheep fed a diet containing added tannins composition of european chestnut (castanea sativa mill.) and association with health effects:fresh and processed products the effects of ph and rat intestinal contents on the liberation of ellagic acid from purified and crude ellagitannins evaluation of the bioavailability and metabolism in the rat of punicalagin and antioxidant polyphenol from pomegranate juice the potent in vitro antioxidant ellagitannins from pomegranate juice are metabolized into bioavailable but poor antioxidant hydroxy- h-dibenzopyran- -one derivatives by the colonic microflora in healthy humans metabolism of antioxidant and chemopreventive ellagitannins from strawberries, raspberries, walnuts, and oak-aged wine in humans: identification of biomarkers and individual variability the authors would like to thank mauro saviola group srl, radicofani, siena, italy for providing the chestnut tannin extract. this research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. the datasets used and analyzed are available from the corresponding author upon reasonable request. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. key: cord- -d uvdnii authors: castanheira, pedro; duarte, ana; gil, solange; cartaxeiro, clara; malta, manuel; vieira, sara; tavares, luis title: molecular and serological surveillance of canine enteric viruses in stray dogs from vila do maio, cape verde date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: d uvdnii background: infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. prior to this study, no information was available concerning the incidence and prevalence of these viruses in cape verde archipelago. results: to provide information regarding the health status of the canine population in vila do maio, maio island, cape verde, rectal swabs were collected from stray dogs during and rectal swabs and blood samples were collected from stray dogs in . all rectal swabs ( n = ; n = ) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative pcr methods. specific antibodies against canine distemper virus and canine parvovirus were also assessed ( n = ). from the sampling, . % ( / ) were positive for canine parvovirus dna, . % ( / ) for canine distemper virus rna and . % ( / ) for canine coronavirus rna. in , the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively . % ( / ), and . % ( / ), but canine distemper virus was not detected in any of the samples analysed ( %, / ). antibodies against canine parvovirus were detected in . % ( / ) blood samples and the seroprevalence found for canine distemper virus was . % ( / ). conclusions: this study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. in addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. identification of susceptible wildlife of maio island is of upmost importance to evaluate the risk of pathogen spill over from domestic to wild animals in cape verde and to evaluate the associated threat to the wild susceptible species. over the past few years, efforts have been made towards a better understanding of the health status of animal populations, particularly regarding viral infections. due to their high mutation rate and replication strategies, viruses are responsible for recently recognized emerging diseases, posing a danger not only to domestic and wild animals, but also to humans [ , ] . the high density of domestic and stray animals in urban areas enables viral dissemination and maintenance in these populations. consequently, these animals can act as reservoirs of diseases, with the possibility of transmission to wildlife populations through occasional contact. canine parvovirus (cpv) was first identified in the late s and was responsible for severe hemorrhagic gastroenteritis and myocarditis in dogs [ ] . parvoviruses are extremely stable in the environment and indirect transmission assumes a critical role in spreading and maintenance of the virus in animal populations, especially in wild carnivores, in which contact rates between animals are lower [ ] . shortly after its initial detection, cpv- was replaced by two antigenic variants, cpv- a and cpv- b and more recently a third variant was described cpv- c [ , ] . canine distemper virus (cdv) is the etiological agent of canine distemper, a highly contagious disease, responsible for high mortality rates in dogs worldwide. sequence analysis of cdv strains originated in different geographical areas from several animal species, showed that the hemagglutinin gene has undergone a genetic drift according to the geographic location [ , ] . phylogenetic analysis based on this gene revealed the existence of at least nine strains in different geographical areas, namely america- , america- , asia- , asia- , europe- / south america , european wildlife, arctic-like, south america and southern africa [ , ] . canine coronavirus (ccov) causes a mild to moderate enteritis in dogs and its infection is characterized by high morbidity and low mortality. ccov is transmitted by faecal-oral route and spreads rapidly through a group of susceptible animals [ ] . stressful environments with large concentrations of animals and poor hygienic conditions, often seen in kennels, favour the development of this disease [ ] . although a higher mortality rate is observed in animals with multiple infections with other pathogens such as cpv- , canine adenovirus type and cdv, ccov represents per si a major infectious agent responsible for several epidemics [ , ] . virological surveys are conducted throughout the world, allowing the detection and analysis of a large variety of viruses in different animal populations. in cape verde archipelago to our knowledge, no similar study had been conducted so far. in order to detect the presence of canine viruses on maio island, samples collected from stray dogs from vila do maio were tested for canine parvovirus (cpv), canine distemper virus (cdv) and canine coronavirus (ccov), to estimate the viral prevalence in this population and investigate the role of these animals in the maintenance and potential spread of common viral pathogens. records were only available for the specimens sampled in . of the dogs, all them of undetermined or mixed breeds, were females ( %) and males ( %). for dogs ( %) no data was registered regarding gender. diaharreic feaces were described for animals ( %). only two dogs had been vaccinated, both with tetradog® vaccine and no information regarding vaccination of the rest of the animals was available (na). the percentage of positivity for cpv-dna was very similar in the and sampling; / ( . %) and / ( . %, respectively). from the sera sampling collected during , ( . %) tested positive for cpv antibodies, with animals included in the first elisa unit (eu) class ( - eu), in the second eu class ( - eu) and in the third eu class (> eu) (tables and ) . antibodies against cpv were detected in % of the animals aged less than months ( / ), in . % in dogs aged between months and year ( / ), in . % in dogs with to years ( / ), in . % in dogs with to years ( / ), in % in dogs with to years ( / ) and in / dog older than years ( figure ). the proportion of seropositive animals was significantly higher in older animals (p < . ). no differences were found between the seroprevalence and gender (p > . ). from the samples that were tested for virology and serology, . % ( / ) were positive for cpv-dna and . % ( / ) were seropositive. out of the dogs that were excreting the virus at the time of collection, were seronegative for cpv specific igg. regarding the samples tested for cdv-rna (n = ), animals were positive ( . %), of which were also co-infected with cpv. all samples from were found cdv-rna negative. as for serology, of the animals sampled during were seropositive for cdv ( . %). two groups were identified according to the antibody (ab) titer: ) low ab titer (iif values / - / : n = ( %)); and ) medium ab titer (iif values / - / : n = ( %)). antibodies against cdv were detected in % of animals aged less than months ( / ), in % of dogs aged between months and year ( / ), in . % of dogs with to years ( / ), in % of dogs with to years ( / ), in % in dogs with to years ( / ) and in / dog older than years ( samples) ( figure ). although there was a linear increase of seropositive animals with age, this association was not statistically significant (p > . ). the presence of antibodies was independent of gender (p > . ). only two samples, collected in each year of the survey, tested positive for ccov-rna, ( ( / , . %) and ( / , . %)). the percentage of positivity in each group is indicated between brackets. this study describes for the first time, the shedding of three common enteric canine viruses, cpv, cdv and ccov, in stray dogs from vila do maio, cape verde and reports data on cpv and cdv seroprevalence. samples were collected in two consecutive years, and . similar frequency of positive cpv animals was found, namely . % in and . % in , most probably reflecting the high environmental resistance of cpv. viral transmission and spread of cpv can occur easily, without direct contact between animals. the virus is shed at high titres in faeces and the excretion period may last longer, allowing a higher opportunity for contact between the virus and the new hosts. although most of the positive dogs did not show signals of diarrhoea, recovered animals may also serve as asymptomatic reservoirs and shed virus periodically, contributing for the persistence and continuous circulation of cpv in the environment, as already reported for cats [ ] . also, the cpv resistance to environmental conditions may explain the high seroprevalence obtained ( . %), similar to that reported in studies conducted with nonvaccinated dog populations [ , ] . the vast majority of the positive samples presented a high antibody titer (n = ) (table and ), even though it could not be correlated with hemagglutination inhibition values, the gold standard assay for titration of cpv antibodies, however we did not had the possibility to perform this assay. this observation suggests the persistence of the virus in the environment, which is in accordance with the high percentage of carrier animals found ( . %). within the animals from which both sample types were obtained, cpv-dna was detected in . % and seropositivity in . %. only of the dogs shedding the virus had no circulating antibodies. it is possible that these animals were at an early stage of infection. primary igms were not investigated by the elisa kit used in this study, which is specific for igg detection. the seroprevalence for cpv was significantly higher in older animals (p < . ), most probably reflecting a high likelihood of virus exposure over time. moreover, as younger dogs are more susceptible to the virus, they can succumb to the disease and therefore be removed from the population. progressive evolution of the cpv- led to the emergence of three antigenic variants, a, b and c, with different properties from the original strain [ ] . monitoring the prevalence of the different cpv in cape verde archipelago would be important, not only to assess the distribution of viral variants in this geographic location, but also to understand the evolutionary pattern of the virus in this circunscripted population. in addition, given the high nucleotide substitution rate of cpv, similar to the rna viruses [ ] and the terrain characteristics of cape verde as an island its possible transportation through people, goods and infected animals, should be considered. in the prevalence of cdv detected by real-time pcr was . % while in all the samples were cdv-rna negative. interestingly, in this year, the seroprevalence obtained for this virus was . %. as these animals were non-vaccinated the explanation for the seropositivity may lie with a previous contact with the virus through ill animals, which could have occurred the previous year. several factors may explain the absence of cdv shedding in faeces of dogs sampled in . taking into account the cdv poor resistance to dry and hot environments, it is possible that the virus did not resist the cape verde summer high temperatures, reducing the opportunity for dogs being exposed to the virus [ , ] . in addition, the high mortality rates caused by cdv contribute to the low virus spread in canine populations since the animals that succumbed to infection stop shedding. on the other hand, as the animal density of this city is low compared to larger cities, less contact rates between animals affect the virus maintenance and spread [ ] . still, . % of the animals had anti-cdv antibodies. comparing the presence of antibodies with the age of the dogs a linear increase in seroprevalence with age was found, which may be related to a possible past cdv outbreak in the population. although it is not statistically significant, the higher seroprevalence in older dogs has already been reported [ ] . the presence of cdv antibodies was not associated with gender. all cdv seropositive animals ( . %) showed a protective antibody titer, according to twark and dodds [ ] , by establishing a comparison between serum neutralization and iif assays. although % of these animals had low antibody titers (table and ), schultz et al. [ ] reported that in actively immunized dogs, either naturally or through vaccination, the antibody titer is not very relevant, provided that is detectable. nevertheless, and despite the good sensitivity and specificity of elisa, it would be advisable to test the samples using the serum neutralization test to confirm the presence and titer of neutralizing antibodies, to fully assess the immune status of these animal populations. relating to the genetic variability of cdv, it would interesting to identify the different cdv genotypes in positive samples, in order to differentiate between vaccine and field strains, and determine which lineages circulate on this island. regarding ccov, we found a low prevalence of . % in and . % in , which is in agreement with similar surveys conducted in areas with similar characteristics of vila do maio dog population [ , ] . the low prevalence may indicate a low viral circulation, probably due to the virus instability in normal environmental conditions and also to the reduced number viral particles in faeces. as for cpv, dogs recovered from a ccov infection may function as asymptomatic reservoirs and shed the virus periodically, resulting in a persistent and continued circulation of ccov in the environment. available data concerning the epidemiological mechanisms of ccov suggests that the environment provided by kennels can be fundamental in maintaining this infection in canine populations [ ] [ ] [ ] [ ] . seroprevalence against ccov was not performed due to the rapid decay of antibodies caused by natural exposure [ ] . moreover the available serological assays are based on the identification of antibodies against ccov-ii, and their efficacy is unknown for the detection of ccov-i antibodies [ ] , questioning the usefulness of these methods. the results presented in this study demonstrate that cpv, cdv and ccov are circulating in the canine population of vila do maio, cape verde. the presence of susceptible animals, the high frequency of infections, the prolonged period of virus shedding and environmental persistence of these agents, especially of cpv, contribute to their continuous circulation in this population. thus, information regarding the spatial distribution of circulating viruses and the risk factors associated with infections will definitely facilitate the planning of control strategies. to our knowledge no vaccination program is undertaken in this region and its implementation could contribute to increase the immunity of this population, reduce viral circulation, and consequently a decrease the population susceptibility to a future disease outbreaks. additionally, the absence of control measures may increase the risk of pathogen spill over, either for susceptible newcomers' hosts or for resident susceptible new hosts as sympatric carnivores' species. due to the wide range of cpv and cdv susceptible hosts, it would be important to identify maio island wildlife, to assess the potential risk of infection of these species. sampling was conducted in vila do maio, located on maio island, cape verde, under a neutering and health surveillance program developed by veterinarians without frontiers, portugal (vsf), in two distinct periods: with collection of rectal swabs from animals; and , including blood samples (n = ) and rectal swabs (n = ) from animals (table ) . biological samples were stored under refrigeration until processing. rectal swabs were homogenized in μl of pbs. after centrifugation at xg/ min, the supernatant was collected and stored at − °c. blood samples were centrifuged at xg/ min to separate plasma from blood cells. plasma was stored at − °c until processing. for viral nucleic acid extraction, μl of supernatant from each rectal swab, were processed with the qiamp minelute kit® (qiagen, germany) according to the manufacturer's instructions, for viral dna and rna co-extraction. although using a commercial kit for co-extraction of viral nucleic acids, from a non-recommended biological matrix may imply a reduced nucleic acid yield, it is sufficient in their experience [ , ] . detection of viral nucleic acids using real-time pcr (qpcr) and real-time rt-pcr (rt qpcr) cpv dna was amplified by qpcr using taqman® gene expression × master mix (applied biosystems); cdv and ccov rna were amplified by rt-qpcr using the taqman® rna-to-ct (tm) step kit in a μl reaction with ng of template. primers and taqman® probes were calculated using the primer designing tool of ncbi (http://www.ncbi. nlm.nih.gov/tools/primer-blast/). for cpv, primers were based on the nucleotide sequence of the vp gene, available through its access number (an) ab . . cdv primers were chosen within the nucleocapsid gene (an jn . ) [ ] and ccov primers targeted the highly conserved b gene (an jq . ) as already described by [ ] (table ) . a final concentration of nm for the forward primer, nm of reverse primer and nm of each taqman® probe was used ( table ) . the amplification was performed in the stepone plus thermocycler (applied biosystems) and the cycling conditions comprised an initial denaturation step at °c for minutes, followed by cycles at °c for seconds and minute at °c. when the template was rna the amplification cycle included a reverse transcription step at °c for minutes. table nucleotide sequences of the primers and probes used in qpcr (cpv) and rt-qpcr (cdv; ccov) assays for cpv tenfold dilutions of cpv- - cornell strain (tetradog®, merial) were used as positive control. regarding cdv, a bp fragment, including the targeted region was amplified from cdv rna (caniffa®, merial) [ ] and cloned in pgem® teasy vector (promega) according to the manufactures instructions. the cdv recombinant plasmid was used as positive control. a similar approach was used for ccov as already described [ ] . the assay specificity was confirmed by direct sequencing of the cpv amplicon. for cdv and ccov sequencing was performed after plasmid cloning. no cross reactivity was detected between cdv/ccov/cpv. the sensitivity of the rt-qpcr/qpcr for all three agents surpassed the detection of target copies/μl, assessed by conversion of the positive control mass (g/μl) in molecules/μl, based on the following formula: number of copies (molecules/μl) = [mass (g/μl)/(number of base pairs x bp ( )] x avogadro's number ( , x ). antibody (ab) detection was only performed for serum samples for cpv and cdv using an indirect elisa kit (ingezim canine parvo .cpv.k ® and ingezim moquillo . .cdg.k. ®-ingenasa), for specific igg detection, according to the manufactures instructions. this method allowed the quantification of the ab titer for cpv, using a formula provided by the kit, although it did not specify the correspondence with the hemagglutination inhibition assay for quantification of anti-cpv antibodies. the values were organized in three classes: ) - elisa units (eu); ) - eu and ) > eu. for cdv the od values had correspondence with the indirect immunofluorescence (iif) method, and the values were divided into three categories: ) low titer (iif values: / - / ), ) medium titer (iif values: / - / ) and ) high titer (iif values: ≥ / ). a possible association between serological findings and the age and gender of the animals was determined by chisquare statistical test (χ ) with ibm spss statistics . software. a p value < . was considered significant. viral threats and vaccination: disease management of endangered species cross-species virus transmission and the emergence of new epidemic diseases isolation and immunization studies of canine parvo-like virus from dogs with haemorrhagic enteritis the emergence of parvoviruses of carnivores characterisation of the canine parvovirus type variants using minor groove binder probe technology a novel antigenic variant of canine parvovirus from a vietnamese dog detection of canine distemper virus nucleoprotein rna by reverse transcription-pcr using serum, whole blood, and cerebrospinal fluid from dogs with distemper genotyping canine distemper virus (cdv) by a hemi-nested multiplex pcr provides a rapid approach for investigation of cdv outbreaks evidence of two co-circulating genetic lineages of canine distemper virus in south america phylogenetic analysis of the haemagglutinin gene of current wild-type canine distemper viruses from south africa: lineage africa canine viral enteritis canine coronavirus inactivation with physical and chemical agents an update on canine coronaviruses: viral evolution and pathobiology genetic evolution of canine coronavirus and recent advances in prophylaxis canine parvovirus in asymptomatic feline carriers the seroprevalence of canine parvovirus- in a selected sample of the canine population in ontario serological survey for canine parvovirus type a (cpv- a) in the stray dogs in south korea high rate of viral evolution associated with the emergence of carnivore parvovirus parvovirose et maladie de carré chez le chien: enquête séro-épidémiologique dans le sud tunisien prevalence of protective antibody titers for canine distemper virus and canine parvovirus in dogs entering a florida animal shelter urban domestic dog populations as a source of canine distemper virus for wild carnivores in the coquimbo region of chile clinical use of serum parvovirus and distemper virus antibody titers for determining revaccination strategies in healthy dogs age and long-term protective immunity in dogs and cats detection and genetic characterization of canine parvoviruses and coronaviruses in southern ireland cross sectional and longitudinal surveys of canine enteric coronavirus infection in kennelled dogs: a molecular marker for biosecurity studies on the epizootiology of canine coronavirus identification of canine coronavirus strains from feces by s gene nested pcr and molecular characterization of a new australian isolate an outbreak of canine coronavirus in puppies in a greek kennel serologic survey for canine coronavirus in wolves from alaska. jf wildlive dis prevalence of canine enteric coronavirus in a cross-sectional survey of dogs presenting at veterinary practices genetic diversity and phylogenetic analysis of feline coronavirus sequences from portugal virological survey in free-ranging wildcats (felis silvestris) and feral domestic cats in portugal relevance of feline interferon omega for clinical improvement and reduction of concurrent viral excretion in retrovirus infected cats from a rescue shelter utilização de um ensaio de rt-pcr-nested pcr para avaliação da infecção do coronavírus felino. rev port ciências vet molecular and serological surveillance of canine enteric viruses in stray dogs from vila do maio, cape verde this work was sponsored by ciisa/fct as part of an integrated master degree in veterinary medicine. we wish to acknowledge cristina pereira, raquel vilaça, conceição almeida, margarida simões, inês cunha, catarina vieira dvms of the veterinarians without frontiers, portugal, who helped providing the biological sampling. we also recognize margarida duarte (phd) for the revision of the manuscript and fátima cordeiro both from instituto nacional de investigação agrária e veterinária, i.p., laboratório de virologia and professora doutora isabel neto from fmv/ul. solange gil is a research assistant under programa ciência . the authors declare that they have no competing interests.authors' contributions pc, ad and lt were responsible for the conception and the study design and actively participated in the analysis and data interpretation. pc and ad were also involved in the drafting and revision of the article. sg and cc were involved in the data analysis. mm and sv were responsible for the organization of the field work and sample collection. key: cord- -slcvbzt authors: sugita, koji; yanuma, nanako; ohno, hikaru; takahashi, kaho; kawano, koji; morita, hidetoshi; ohmori, keitaro title: oral faecal microbiota transplantation for the treatment of clostridium difficile-associated diarrhoea in a dog: a case report date: - - journal: bmc vet res doi: . /s - - -z sha: doc_id: cord_uid: slcvbzt background: successful clinical outcomes of faecal microbiota transplantation (fmt) for recurrent clostridium difficile infection have been reported in humans and a marmoset. however, it has been unclear whether oral fmt was effective for the treatment of c. difficile-associated diarrhoea in dogs. case presentation: an -month-old, intact male french bulldog was presented with a -month history of intermittent large bowel diarrhoea. physical and clinical examinations did not identify any specific causes for diarrhoea. real-time pcr analysis and immunochromatography detected c. difficile antigen and toxin a&b genes and proteins in a faecal sample. based on these findings, diarrhoea in the dog was considered to be induced by c. difficile-associated colitis. the dog was treated with oral fmt, in which a faecal solution obtained from a healthy beagle was orally administered to the subject. stool consistency and frequency and faecal blood and mucus became normal – days after oral fmt, and real-time pcr analysis and immunochromatography was negative for c. difficile antigen and toxin a&b genes and proteins. no adverse events were observed. conclusion: the present case report demonstrated that oral fmt was an effective treatment for c. difficile-associated diarrhoea in a dog. the findings in this report provide a rationale to evaluate clinical efficacy of oral fmt for other gastrointestinal diseases in dogs. clostridium difficile is the most common cause of antibiotic-associated pseudomembranous colitis and induces severe and recurrent diarrhoea, especially in hospitalized human patients [ ] . c. difficile is also associated with enterocolitis and diarrhoea in animals including dogs [ ] and marmosets [ ] . metronidazole is an effective antibiotic for the treatment of c. difficile infection (cdi) in humans [ ] and animals [ ] . however, recurrent cdi after treatment with antibiotics including metronidazole has become a clinical problem in human patients [ ] . faecal microbiota transplantation (fmt) is a treatment option performed by introducing faecal microbiota obtained from a healthy donor into the gastrointestinal (gi) tract of a recipient [ , ] . successful clinical outcomes of fmt for recurrent cdi have been reported in humans [ ] [ ] [ ] and a marmoset [ ] . however, it has been unclear whether fmt was effective for the treatment of c. difficile-associated diarrhoea in dogs. here, we report persistent recovery from c. difficile-associated diarrhoea in a dog after oral fmt without any adverse events. an -month-old, . -kg, sexually intact male french bulldog was presented on day with a -month history of intermittent diarrhoea and a -day history of focal seizures that had been observed almost every day for days. stool consistency had been very soft to watery, and stool frequency had been > times/day. blood and mucus had been observed in the faeces. thus, diarrhoea was considered to be induced by colitis. four months prior to the current presentation, a faecal sample of the dog was subjected to real-time pcr analysis (idexx laboratories, inc., tokyo, japan) for cryptosporidium spp., giardia spp., clostridium perfringens α toxin, clostridium difficile toxin a&b, campylobacter jejuni, campylobacter coli, salmonella spp., canine parvovirus type , canine distemper virus and canine enteric coronavirus genes by a veterinary practitioner; a positive reaction for campylobacter jejuni was detected in the analysis. the dog was treated with tylosin (tylan, eli lilly japan k.k., kobe, japan; mg/kg po, q h) for days by a veterinary practitioner; however, stool conditions did not improve. administration of an antidiarrhoeal (diabuster, kyuritsu, tokyo, japan; tablet po, q h) containing berberine tannate, bismuth subnitrate, geranium herb, nutgalls and scopolia extract, and an antiflatulent (bioymbuster, kyuritsu, tokyo, japan; tablet po, q h) containing bacillus coagulans, bifidobacterium longuin, lactobacillus acidophilus, streptococcus faecalis and pancreatin, improved stool conditions. however, once these drugs were discontinued, the diarrhoea recurred. on day , physical and clinical examinations, including a complete blood count (cbc), a serum biochemical analysis, radiography, an abdominal ultrasound and faecal examination, did not reveal any specific causes for chronic diarrhoea and focal seizures. a faecal sample was subjected to real-time pcr analysis (idexx laboratories, inc.) to investigate an infectious cause of diarrhoea. meanwhile, the dog was administered erythromycin (erythromycin, sawai pharmaceutical, osaka, japan; mg/kg po, q h) for days based on the positive result for c. jejuni infection months earlier. on day , real-time pcr analysis of a faecal sample collected on day was found to be positive for c. difficile toxin a&b genes and negative for other pathogens. the presence of c. difficile antigen and toxin a&b proteins in a faecal sample collected on day was also confirmed by an immunochromatographic test kit (techlab c. diff quick chek complete, alere, chiba, japan). in the follow-up visit on day , stool conditions did not improve after administration of erythromycin in the dog. based on the clinical and investigative findings, diarrhoea in the dog was considered to be induced by c. difficile-associated colitis. treatment with metronidazole was proposed; however, the owner rejected this treatment because of the potential for metronidazole-induced neuropathy. to investigate the cause of focal seizures, computed tomography and magnetic resonance imaging were performed. mild ventriculomegaly was detected in the brain of the dog on imaging, but it was unclear whether the lesion was related to the seizures. after initiating treatment with zonisamide (consave, ds pharma animal health, osaka, japan; mg/kg po, q h), the seizure frequency decreased. on day , the dog still had large bowel diarrhoea. real-time pcr analysis and immunochromatography confirmed that c. difficile antigen and toxin a&b genes and proteins were still positive in a faecal sample collected on day . therefore, instead of treatment with metronidazole, oral faecal microbiota transplantation (fmt) was performed after obtaining written informed consent from the owner. this treatment was approved by the research ethics committee of tokyo university of agriculture and technology. fresh faeces were collected from a -year-old, . -kg, sexually intact healthy male beagle maintained for research purposes. the healthy dog was housed in a cage and fed a commercial diet (science diet adult, hill's-colgate ltd., tokyo, japan) once daily. water was provided ad libitum. physical and clinical examinations, including a cbc, a serum biochemical analysis, radiography, an abdominal ultrasound and faecal examination, did not find any abnormalities in the healthy dog, and real-time pcr analysis of a faecal sample did not detect any pathogens. immediately after faecal collection, approximately g of faeces was dissolved in ml of tap water. the faecal solution was filtered through a medical gauze pad twice. a total of ml of a filtered faecal solution was obtained and orally administered to the recipient dog using a syringe. stool consistency became normal, and stool frequency was reduced to - times/day - days after oral fmt. faecal blood and mucus were not observed after oral fmt. real-time pcr analysis of a faecal sample collected at days after oral fmt (day ) was negative for c. difficile toxin a&b genes. further real-time pcr analysis of faecal samples collected on days and confirmed that c. difficile toxin a&b genes were still negative. the absence of c. difficile antigen and toxin a&b proteins was also verified in the faecal samples by an immunochromatographic test kit after oral fmt. in addition, diarrhoea did not recur after oral fmt and further medications were unnecessary. stool conditions are still normal on day . the present case report demonstrated that c. difficile antigen and toxin a&b genes and proteins turned into negative, and stool consistency and frequency and faecal blood and mucus became normal after oral fmt in a dog with large bowel diarrhoea. successful clinical outcomes of fmt for recurrent cdi have been reported in humans [ ] [ ] [ ] and a marmoset [ ] . these findings collectively suggest that correction of gut microbiota with fmt can be a useful treatment option for c. difficile-associated diarrhoea across animal species. the pathogenesis of cdi is well established in humans, and involves toxin production by colonic c. difficile and depletion of non-c. difficile colonic microbiota [ ] . however, it is still controversial whether c. difficile plays a pathological role in the development of diarrhoea in dogs [ ] . c. difficile has been isolated both from the faeces of diarrheic dogs and those of healthy, non-diarrheic dogs, with various incidence rates depending on sample populations [ ] [ ] [ ] [ ] [ ] . several studies suggested a significant association between the presence of c. difficile toxins in faeces and canine diarrhoea [ ] [ ] [ ] . an outbreak of c. difficile-associated disease was also reported in a small animal veterinary teaching hospital [ ] . in contrast, a previous study failed to reproduce cdi in healthy adult dogs after administration of c. difficile with or without antibiotics [ ] . in the present report, real-time pcr analysis and immunochromatography detected c. difficile antigen and toxin a&b genes and proteins in a faecal sample. physical and clinical examinations did not identify any other causes for chronic large bowel diarrhoea. in addition, c. difficile antigen and toxin a&b genes and proteins became negative after oral fmt, and diarrhoea did not recur despite no further pharmacological treatment. based on these clinical and molecular findings, diarrhoea in this dog was considered to be induced by c. difficile-associated colitis. fmt can be performed via the upper or lower gi tract [ ] . theoretical guidelines for fmt have been recently proposed in dogs and cats [ ] . in a recent study that reported the clinical efficacy of fmt for puppies with canine parvovirus infection [ ] , faecal suspension was infused into the proximal portion of the rectum in puppies by retention enema. since clinical data of fmt are very limited in veterinary medicine, there is no consensus regarding the appropriate method of faecal administration in dogs. in the present case, fmt was performed by oral administration of faeces diluted with tap water. oral fmt was also shown to be effective for the treatment of cdi in a marmoset [ ] , whereby faeces were mixed with the marmoset's usual food and fed to the subject. in human patients with cdi, there was a report of cases refractory to lower gi delivery that responded to fmt via oral frozen faecal capsules [ ] . oral fmt is much easier than other methods of fmt, such as fmt with endoscopy, nasogastric/nasoenteric tubes and retention enema. although potential advantages and disadvantages exist for fmt via the upper or lower gi tract, the present report suggests that oral administration of a faecal solution can be a useful fmt method in dogs. the recipient dog in this report did not show any adverse events after oral fmt until day . the recipient dog was orally administered a fresh faecal solution prepared from a healthy beagle that did not have any abnormalities on physical and clinical examinations and any faecal pathogens. metronidazole is reported to be an effective antibiotic for the treatment of cdi in dogs [ ] and humans [ ] . however, in vitro analyses showed metronidazole-resistant strains in faeces of dogs [ , ] . in human patients, as many as % of cdi cases treated with antibiotics including metronidazole was reported to recur [ ] and a target for fmt. in this report, because metronidazole was not administered at the owner's request, it is unclear whether c. difficile detected in the dog was metronidazole-resistant. previous studies have shown that fmt was effective for the treatment of antibiotics-resistant recurrent cdi in humans, with cure rates of > % [ ] [ ] [ ] , and a marmoset [ ] . to evaluate the effect of fmt for metronidazole-resistant recurrent cdi in dogs, further studies are required. the mechanism underlying fmt is considered to be the reestablishment of the normal gut microbiota as a host defense against cdi [ ] . a previous study showed that faecal microbiota in human patients with cdi had a lower bacterial diversity than healthy humans; in these patients, fmt improved the microbiota diversity [ ] . in the current report, faecal microbiota was not analyzed in the dog with cdi. to clarify the mechanism by which oral fmt exerts a treatment effect on cdi in dogs, it is necessary to compare faecal microbiota in canine patients with those in healthy dogs, and to evaluate the microbiota in canine patients before and after oral fmt. in conclusion, the present report revealed that oral fmt was an effective treatment for c. difficile-associated diarrhoea in a dog. fmt can reintroduce normal microbiota from healthy individuals into patients, correcting the underlying dysbiosis in the gut. previous studies have reported dysbiosis was associated with acute and chronic gi diseases in dogs, including idiopathic inflammatory bowel disease [ ] [ ] [ ] . the findings in the present report provide a rationale to evaluate clinical efficacy of oral fmt for other gi diseases in dogs. treatment of clostridium difficile-associated disease: old therapies and new strategies enteric bacterial diseases faecal transplantation for the treatment of clostridium difficile infection in a marmoset faecal microbiota transplantation and emerging applications clinical practice and infrastructure review of faecal microbiota transplantation for clostridium difficile infection faecal microbiota transplantation for clostridium difficile infection: systematic review and meta-analysis duodenal infusion of donor faeces for recurrent clostridium difficile enteropathogenic bacteria in dogs and cats: diagnosis, epidemiology, treatment, and control evaluation of a routine diagnostic faecal panel for dogs with diarrhoea the roles of clostridium difficile and enterotoxigenic clostridium perfringens in diarrhoea in dogs genotypic and phenotypic characterization of clostridium perfringens and clostridium difficile in diarrheic and healthy dogs prevalence of enteropathogens in dogs attending regional dog parks in northern california evaluation of five enzyme immunoassays compared with the cytotoxicity assay for diagnosis of clostridium difficile-associated diarrhoea in dogs outbreak of clostridium difficile-associated disease in a small animal veterinary teaching hospital genotypic and phenotypic characterization of clostridium perfringens and clostridium difficile in diarrheic and healthy dogs role of the gastrointestinal microbiota in small animal health and disease faecal microbiota transplantation in puppies with canine parvovirus infection frozen encapsulated stool in recurrent clostridium difficile: exploring the role of pills in the treatment hierarchy of faecal microbiota transplant nonresponders isolation of clostridium difficile from dogs with digestive disorders, including stable metronidazole-resistant strains preliminary studies on isolates of clostridium difficile from dogs and exotic pets changes in the composition of the human faecal microbiome after bacteriotherapy for recurrent clostridium difficile-associated diarrhoea the faecal microbiome in dogs with acute diarrhoea and idiopathic inflammatory bowel disease molecular analysis of the bacterial microbiota in duodenal biopsies from dogs with idiopathic inflammatory bowel disease molecular-phylogenetic characterization of microbial communities imbalances in the small intestine of dogs with inflammatory bowel disease not applicable. availability of data and materials all data generated or analysed during this study are included in this published article. the authors declare that they have no competing interests. key: cord- -bgrgzfoo authors: hou, peili; wang, hongmei; zhao, guimin; he, chengqiang; he, hongbin title: rapid detection of infectious bovine rhinotracheitis virus using recombinase polymerase amplification assays date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: bgrgzfoo background: infectious bovine rhinotracheitis virus (ibrv) is a major pathogen in cattle and has led to significant economic losses to the dairy industry worldwide, and therefore a more optimal method for the rapid diagnosis of ibrv infection is highly needed. in this study, we described the development of a lateral flow dipstrip (lfd) of isothermal recombinase polymerase amplification (rpa) method for rapid detection of ibrv. methods: distinct regions were selected as a candidate target for designing the lfd-rpa primers and probes. the analytical sensitivity of the rpa assay was determined using ten-fold serially diluted ibrv dna. the specificity of the assay was assessed with other viral pathogens of cattle with similar clinic and other herpesviruses. the clinical performance was evaluated by testing acute-phase high fever clinical specimens. results: rpa primers and probe were designed to target the specific conserved ul region fragment of ibrv. the detection could be completed at a constant temperature of °c for min, and the amplification products were easily visualized on a simple lfd. the detection limit of this assay was copies per reaction of ibrv dna and there was no cross-reactivity with other viruses causing bovine gastrointestinal and respiratory infections or other herpesviruses. the assay performance on acute-phase high fever clinical samples collected from cattle with no vaccine against ibrv, which were suspected to be infected with ibrv, was validated by detecting fecal, blood, nasal swab and tissue specimens, and compared with sybr green i based real-time pcr. the coincidence between ibrv lfd-rpa and real-time pcr was %. conclusion: ibrv lfd-rpa was fast and much easier to serve as an alternative to the common measures used for ibrv diagnosis, as there is reduction in the use of instruments for identification of the infected animals. in addition, this assay may be the potential candidate to be used as point-of-care diagnostics in the field. infectious bovine rhinotracheitis virus (ibrv), often referred to as bovine herpesvirus (bohv- ), is responsible for infectious bovine rhinotracheitis (ibr). ibr is highly contagious, and can cause a diverse range of clinical manifestations from upper respiratory disease, rhinitis, vulvovaginitis, traeheitis, enteritis, conjunctivitis, abortion and encephalitis, to fatal systemic infection in neonatal calves [ ] . ibrv can also induce immune suppression that contributes to the severity of disease manifestation. in addition, ibrv is one of the bovine respiratory disease complex pathogens, which is the leading cause of cattle death around the world [ ] [ ] [ ] . taken together, it is a major disease of cattle leading to significant economic losses to the dairy industry worldwide [ , ] . several developed countries such as germany, have adopted immunization and eradication of pathogen-positive animals for ibr control [ ] . therefore, early identification of ibrv positive animals is critical for disease control and elimination programs to diminish its burden on the dairy industry. at present, ibrv can be routinely detected using cell culture, polymerase chain reaction (pcr), immunehistopathology, and enzyme-linked immunosorbent assay (elisa) as well as the virus neutralization test [ ] [ ] [ ] . however, currently available diagnostic tests remain laboratory-based and require sophisticated instruments operated by specially trained personnel. although isothermal amplification techniques such as the loop-mediated isothermal amplification (lamp) have been offered as a simple, rapid and alternative molecular pathogen diagnostic tool for point-of-care testing in the field [ , ] , the lamp assay needs four to six primers, leading to longer amplicons and possibly more difficult to design in the case of highly variable viruses. recombinase polymerase amplification (rpa), is a novel isothermal alternative to pcr, which targets and amplifies dna from clinical samples with high sensitivity and specificity [ ] . the technology takes advantage of three major proteins, including recombinase proteins, single-strand binding proteins (ssb), and polymerases, and relies on two specific oligonucleotide primers and a probe, and can specifically amplify nucleic acid sequences ranging from trace levels to detectable amounts of product in an isothermal format in less than min. rpa products can be detected by gel electrophoresis, probe-based fluorescence monitoring or lateral flow dipsticks depending on the specific primers and/or probe configuration. although rpa technology has been widely used for detection of various pathogens since its initial development [ ] [ ] [ ] [ ] [ ] [ ] , to date, there is no rpa assay developed for ibrv detection. in this study, rpa primer and probe combinations were designed, and screened to permit lfd-rpa detection of ibrv. the development of a combination of lfd-rpa detection for ibrv was described. finally, the performance of the rpa assay on acute phase fever clinical samples was evaluated and the results compared with sybr green i real time pcr. viruses, cell and clinical specimens ibrv/bohv- . /barthanu/ strain, bovine herpesvirus (bohv- )/n strain, bovine viral diarrhea virus (bvdv)/nadl strain, bovine parainfluenza virus type (bpiv- )/bn- strain were preserved in our laboratory, and the viruses were cultured in the madin-darby bovine kidney (mdbk) cell using the dulbecco's modified eagle medium (dmem, hyclone, usa), containing antibiotics ( ui/l penicillin, mg/l streptomycin) with % horse serum. other bovine virus strains for cross reactivity testing used in this study were provided by full-length cloned cdna: entire genome sequence of bovine respiratory syncytial virus (brsv)/a strain, bovine ephemeral fever virus (befv)/(gene bank no: nc_ . ), bovine enterovirus (bev)/vg- - strain, bovine coronavirus (bcov)/ent strain (gene bank no:nc_ . ), respectively. a total of acute-phase high fever clinical specimens ( fecal, blood, nasal swab and tissue specimens) were collected from cattle farms suspected to be infected with ibrv in shandong province, china. isolation of dna/rna, cdna synthesis ibrv and other herpesviruses dna were extracted from μl of infected cell culture supernatant using the uniq- viral dna extraction kit (sangon biotech co., ltd., shanghai, china). rna from bvdv, bpiv- was prepared from μl of infected cell culture supernatant using the qiaamp viral rna minikit according to manufacturer's instructions (qiagen, germany), respectively. the dna/rna was eluted in μl of nuclease-free water. the extracted rna was used as template for cdna synthesis using the revertaid™ first strand cdna synthesis kit (fermentas, canada). all templates were stored at − °c until further needed. the ibrv ul region fragment ( bp) were synthesized by jierui biotech (shanghai, china) and cloned into peasy-t vector, designated as ul-t -rpa. the ul-t -rpa standard dna was extracted with plasmiad mini kit (tiangen, beijing) and measured using a nanodrop nd- spectrophotometer (thermo scientific, dreieich, germany). the dna copy number was calculated by the equation: dna cope number = (m × . × × − )/(n × ) , m: molecular weight, n: plasmid concentration measured at nm. dna standard was stored at − °c until further used. the highly conserved region of ibrv was screened and selected in genbank database (genbank: aj . , e . , nc_ . , jx . , km . ). eight forward primers and reverse primers, and nine lf probes (table ) were designed according to rpa instruction manual from twistdx (twistdx, ltd., cambridge, united kingdom). in summary, the length of bp to bp for rpa primers is recommended. twistamp™ lf probe oligonucleotide backbone includes a ′-antigenic label fam group, an internal abasic nucleotide analogue 'dspacer' and a ′-polymerase extension blocking group c spacer. one amplification primer opposing twistamp™ lf probe is labeled with biotin at its ′ end, thus dual-labeled amplicon can be detected simultaneously. oligonucleotide rpa primers and lf probes used in the study were synthesized by sangon biotech (shanghai, china). twistamp™ nfo kits were supplied as dry enzyme pellets in eight strips within vacuum-sealed pouches (twistdx, ltd., cambridge, united kingdom). the ibrv rpa was performed in a μl final reaction volume according to the instructions outlined in the twist amp nfo kit manual. the rehydration solution contained an optimized blend of dna template and primers and a lf probe. each reconstituted reaction mixture contained μl dna template, . μl ( μm) primer, . μl ( μm) twistamp™ lf probe, . μl rehydration buffer. resuspend the reaction pellet with . μl of the rehydration solution, and then the reaction was initiated by adding . μl of magnesium acetate ( mm). the tubes were then incubated at °c in an incubator block for min. as recommended, the samples were blended up and down - times after min' incubation, and an additional incubation was continued for min. in addition, in each run, a positive template control supplied with the twist amp nfo kit (primers/probe and template) and a negative template control (nuclease-free) water were included. the amplicon of twistamp™ lf probe system was visualised using a simple 'sandwich' lfd assay. milenia's genline hybridetect- or hybridetect- lateral flow strips duplexes labeled with anti-fam gold conjugates and anti-biotin antibodies from milenia gmbh (germany) were used in this study for detection of lfd-rpa amplified nucleic acids. μl of hybridization products were mixed with μl of pbst ( × phosphate buffered saline with . % tween- ) running buffer. the lfd were then placed into the pbst dilution in a -well plate. the positive amplification product might be indicated by both test line and control line on the strip visualized simultaneously after min, the negative control (no template) should generate a separate control line found further up test line on the strip. the absence of a control line on the lfd indicates the strip could not work correctly. the outcome of twistamp™ lf probe systems were also analyzed by agarose gel-electrophoresis (age). in brief, the amplification product was purified by commercial pcr purification kits. the comparable size of required amount of the amplification products were visualized by electrophoresis on a % agarose-gel. determination of sensitivity and specificity of the assay to determine the limit of ibrv genomic dna copies, ten-fold serial dilutions of the standard ul-t -rpa plasmid ranging from × to × − dna copies per reaction were detected within the same sample run. the operation steps were performed according to section of laboratory based rpa assays. the assay sensitivity assessment was also carried out by pcr assay, and the ibrv dna amplification condition were previously described [ ] . briefly, the nucleotide sequences of the primers were as follows: bf: ′-agaccccagttgtgatgaatgc- ′ and br: ′-acacgtccagcacgaacacc- ′. the amplification conditions consisted of a preliminary denaturation step of °c for min, cycles of denaturation at °c for min, primer annealing at °c for s, and extension at °c for s and a final cycle of °c for min, and the size of amplification product is bp. two methods were operated with the same amount of template. the specificity of the assay was assessed among other viral pathogens of cattle with similar clinical signs or other herpesviruses. dna and rna extracts were prepared from cell culture supernatant of bohv- , bvdv, bpiv- , respectively, and cdna of bvdv, bpiv- were prepared as mentioned above. clone of full-length genome of brsv, befv, bev and bcov were supplied as templates in the lfd-rpa reaction. additionally, dna extracted from × dna copies per reaction of ibrv and ibrv-free samples were used as a positive control and a negative control respectively. a total of acute-phase high fever clinical specimens including fecal, blood specimens, nasal swabs and tissue specimens were collected from in nonvaccinated herds suspected to be infected with ibrv in shandong province, china. tissue specimens were homogenized in mm phosphate buffered saline (pbs) with a dilution of : (w/v), centrifuged at , ×g at °c for min, sample suspension was collected until used. fecal and swabs were placed immediately in ml pbs and mixed by pulse-vortexing for s after collection. μl sample suspension was separated for dna extraction using magnetic beads (dynabeads®silane viral na kit, life technologies, darmstadt, germany) according to the manufacturer's instructions. in summary, μl of sample suspension was incubated with μl ( mgml − ) of proteinase k and μl of lysis/ binding buffer (viral na) for min at room temperature, and then μl of isopropanol and μl ( mg) of dynabeads were added and incubated at room temperature for min followed by two washing steps. viral dna bound to the dynabeads was left to dry at room temperature for min before eluting in μl of elution buffer. a volume of μl of dna extracted from each swab specimen was used as a template in the rpa reactions. the minute was how long before a test line was observed on the lfd. the primer pairs for sybr green i real-time pcr used for amplification of ibrv were ibrv-f: ′-acggacg acgagctgggact- ′, ibrv-r: ′-cggcagcgaaa ccatgaaat- ′. real-time pcr was performed on a lightcycler real-time pcr system using sybr® premix ex taq™ ii (tlirnaseh plus) reagents (takara bioinc, japan) according to the manufacturer's instructions. the reaction was carried out in a μl volume containing μl × sybr premix ex taq ii, . μl of forward and reverse primers ( μm), respectively, μl of dna and μl dnase-free water. the real-time pcr was performed as follows: cycle of °c for min, followed by cycles of °c for s and °c for s. fluorescent signal was collected during the elongation step. in diagnostic real-time pcr assay, it was customary to regard results between c t and as equivocal and above c t as negative. based on alignment analysis of infections bovine rhinotracheltis virus (genbank: aj . , e . , nc_ . , jx . , km . ), six distinct regions were selected as a candidate target for designing the lfd-rpa primers and probes. eight forward primers and eight reverse primers labeled at the ′ end with biotin for the detection of ibrv were designed to screen candidate primer pairs and probe (table ) . then nine lf probe combinations with primers were employed for further validation in this study. the candidate primers/probe for the lfd-rpa assay were screened by performing with twistamp™ nfo reactions and preliminarily analyzed on % agarose gel with labeled amplicons. the initial agarose gel result showed that primer set - f/ - r/ - lf yielded specific amplification efficiency for the rpa assay, and produced the expected size of the product was base-pairs (fig. a) , while the primers/probe targeting glycoprotein gb of the ibrv genome in this study could not be used to amplify effectively in the initial screen (data not show). in order to determine the best pairs of primers/probe for maximum effective amplification, a series of staggered primers with - base intervals upstream and downstream of the original - f/ - r/ - lf sequences were designed to obtain optimal primers for ibrv rpa, lfd-rpa results indicated that primer set f/ r/ lf presented the most efficient amplification with expected size of bp (table ) , showing a test line within min on the lfd (fig. b) . the analytical sensitivity of the rpa assay was determined using the ibrv dna extracted from ten-fold serially diluted ibrv dna ranging from × − to × copies per reaction, and the minimum virus detection limits of rpa were as low as copies per reaction (fig. a) . the amplified products in the ibrv lfd rpa reaction were also detected by subsequent agarose gel electrophoresis (fig. b) . to detect the stability of the rpa method, the stability of the assay using dna extracted from × dna copies per reaction of ibrv and negative controls were also evaluated in replicates, respectively. the detection limits of the method showed the same result (fig. c) . as compared, all these ten-fold serially diluted templates were detected by conventional pcr, the sensitivity of the gold standard conventional pcr was × dna copies per reaction. therefore, the sensitivity of our rpa-lfd assay was at least times higher than that of the routine pcr assay (fig. d) . the specificity of the assay was assessed with other viral pathogens of cattle with similar clinic and other herpesviruses such as bovine herpesvirus (bohv- ).as shown in fig. a , no cross-reactions of the bvdv, bpiv- , brsv, befv, bev, bcov, and bohv- were observed and the amplicons in these viruses examined by the ibrv rpa-lfd assay were also tested with agarose gel electrophoresis fig. b . one hundred six clinical specimens were collected from suspected cases, and viral dna extracted using magnetic beads were used as templates for detection. in all cases, clinical specimens were subjected to conventional pcr, rpa, and compared with the real-time pcr assay. the results of those assays showed that a total of clinical specimens were tested positive by conventional pcr, while the same performance that specimens were detected positive by ibrv rpa nucleic acid amplification assays on lfd within min, and with the cycle threshold (c t ) values below using the sybr green i real-time pcr assay. this particular rpa therefore was highly sensitive compared with the real-time pcr, and there was very good correlation between the results from rpa and sybr green i real-time pcr of the same sample (table ). in addition, the results show that ibrv rpa-lfd may be an ideal method to detect the ibrv genome in low resource settings. rapid and reliable nucleic acid tests are the gold-standard for the detection of a wide variety of infectious pathogens. recent studies have shown that isothermal amplification techniques such as rpa and lamp could be developed to amplify nucleic acids, which require neither high precision instrument for amplification nor elaborate methods for detection of the amplified products [ ] . among those isothermal amplification assays, rpa is a powerful, innovative nucleic acid test, which could be useful for low resource settings [ , ] . rpa outperforms over lamp currently developed for ibrv diagnosis. one advantage is that rpa reaction only utilizes two primers and one probe and three binding sites, in contrast, the lamp assay needs at least four primers and six binding sites. in addition, rpa reagents provided in a lyophilized pellet are stable fig. sensitivity of the lfd-rpa assay. a molecular sensitivity of rpa using total dna extracted from -fold serially diluted ibrv-infected cell as template. ibrv templates of lane to in these reactions extracted from ten-fold serially diluted virus range from × to × − dna copies per reaction. samples were tested in triplicate with one reaction displayed in figure for each triplicate. b ibrv rpa reaction products ( bp) could be detected on a % agarose gel. lane to were represented ibrv rpa reactions extracted from ten-fold serially diluted ibrv templates range from × to × − dna copies per reaction. c repeatability of limits detection. the sensitivity of the assay using ibrv dna extracted from copies per reaction of ibrv dna and negative control (dnase-free water) were also evaluated in replicates, respectively. d sensitivity of conventional pcr. molecular sensitivity of conventional pcr uses the same template amount as the ibrv lfd-rpa assay. templates of lane to in these reactions extracted from ten-fold serially diluted virus genome dna range from × to × − copies per reaction. samples were tested in triplicate with one reaction displayed in figure for each triplicate even when stored for weeks at °c, which allow independence from the cooling chain [ , ] . the most important step of rpa is to identify the appropriate primers and probes. however, there is no ideal design support software available for rpa. in this study, different conserved genomic regions were selected for olignucleotide design (table ) . several primer and probe combinations were initially evaluated for target sequences and two products generated by rpa primer pair and probe were distinct in size on an agarose gel to exclude non-specific amplification (fig. a) . it is worth mentioning that, unlike pcr-based dna amplification assays, it should be noted that the primer and probe set of rpa is much more stringent as it requires longer primers ( - bases) and probes ( - bases) leading to the potential of formation of secondary structures. moreover, after several optimization screening, one optimal set of the primers and probe limited to the ul regions functioning dna replication can be successfully used to amplify an exact sequence-matched template (fig. b) since replacement, increase, decrease or mismatch of single base will have a significant impact on the result of amplification [ ] . furthermore, we also found that ibrv molecular detection with rpa assay poses unique challenges because the genome of ibrv was rich in gc content. in retrospect, given recently published data describing glycoprotein-based ibrv detection assay, loop-mediated isothermal amplification (lamp) or pcrbased assays have been reported to detect ibrv in biological samples [ , ] . in the present study, none of the primers targeting glycoprotein gb within the same region of the genome of lamp and pcr could be used to amplify effectively in the initial screen (table ) , this may be due to the long probe formed folded secondary structures and had an impact upon hybridization to target, or perhaps there are different regions for primer design between rpa and lamp/pcr. with regard to analytical sensitivity, the rpa developed in this study showed a performance limit of detection of copies per reaction of ibrv dna ( fig. a and b ) equaled to real time pcr, which was at least times higher than that of the routine pcr assay (fig. d) . the study of specificity showed that no cross-detection between ibrv and other bovine infectious virus or bovine herpesvirus ( fig. a and b) . it should be noted that the high sensitivity and specificity of this assay gave the credit to good use of gold-labeled anti-fam and anti-biotin antibodies to capture rpa product simultaneously. the clinical performance of pcr, lfd-rpa and sybr green i based pcr assays were detected using suspected clinical specimens, the clinical sensitivity of both lfd-rpa and sybr green i real-time assays was %, while pcr showing the lower detection might be due to some clinical samples containing low viral titers. although lfd-rpa is not appropriate for the quantitative analysis of nucleic acid, an important feature of the method is the lfd-rpa assay under normal circumstances outperforms other isothermal amplification assays in terms of simplicity and sensitivity, because it only requires a simple heat block to run and the results can also be visualized by lfd with naked eyes inspection. this methodology of lfd-rpa might be uniquely appropriate for application of visual field testing due wholly to the rpa enzymes can be short-term storage and transport at ambient temperatures in a lyophilized pellet, and conducted without a precise incubation temperature (body temperature) [ ] . moreover, some samples only require simple preparation and processing before rpa. it has also been shown that rpa tolerates multiple known pcr inhibitors, including hemoglobin ( gl − ), heparin ( . u), undiluted serum, and ethanol ( %v/v) [ ] . however, some components of nucleic acids extracted from clinical sample have an influence on rpa reaction such as the concentrations of background dna in whole blood [ ] . to fulfill the full potential of developed ibrv lfd-rpa at the point of care in field conditions, we evaluated several simple methods for clinical sample extraction including direct sample lysis with heat lysis, alkaline lysis ( . m koh or . % sds) and dynabeads® magnetic separation. we found that dynabeads® magnetic separation worked well. similar heat and alkaline lysis did not result insufficient recovery of positive dna (data not shown). although dynabeads® magnetic separation technology is easily adapted to automated liquid handling platforms, other methodology platform to perform sample preparation will be further required to optimize. this workpackage has developed a rapid, robust, costeffective and highly sensitive lfd-rpa assay for the detection of ibrv. in addition, the rapid lfd-rpa for ibrv may save much time in epidemiological surveillance and aid in identification of latent ibrv infected individuals in beef and dairy farms. furthermore, it may be serves as a model platform for detecting other bovine pathogens. advances in bhv (ibr) research three viruses of the bovine respiratory disease complex apply different strategies to initiate infection bovine herpesvirus infection and infectious bovine rhinotracheitis bovine herpes virus infections in cattle epidemiology and control of bovine herpesvirus infection in europe diagnosis and control of viral diseases of reproductive importance: infectious bovine rhinotracheitis and bovine viral diarrhea dynamics of infection and immunity in a dairy cattle population undergoing an eradication programme for infectious bovine rhinotracheitis (ibr) bovine herpesvirus- (bhv- ) -a re-emerging concern in livestock: a revisit to its biology, epidemiology, diagnosis, and prophylaxis standardization of enzyme-linked immunosorbent assays (elisas) for quantitative estimation of antibodies specific for infectious bovine rhinotracheitis virus, respiratory syncytial virus, parainfluenza- virus, and bovine viral diarrhea virus fast diagnosis of ibrv by nested-pcr method applications of loop-mediated isothermal dna amplification evaluation of loopmediated isothermal amplification method (lamp) for pathogenic leptospira spp. detection with leptospires isolation and real-time pcr dna detection using recombination proteins rapid detection of hiv- proviral dna for early infant diagnosis using recombinase polymerase amplification recombinase polymerase amplification assay for rapid detection of rift valley fever virus development of a panel of recombinase polymerase amplification assays for detection of biothreat agents nickisch-rosenegk v. m: rapid detection of plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis real-time isothermal detection of shiga toxin-producing escherichia coli using recombinase polymerase amplification rapid detection of infectious hypodermal and hematopoietic necrosis virus (ihhnv) by realtime, isothermal recombinase polymerase amplification assay establishment of conditions for the detection of bovine herpesvirus- by polymerase chain reaction using primers in the thymidine kinase region point-of-care nucleic acid testing for infectious diseases recombinase polymerase amplification as a promising tool in hepatitis c virus diagnosis recombinase polymerase amplification: emergence as a critical molecular technology for rapid, low-resource diagnostics loop-mediated isothermal amplification of dna factors influencing recombinase polymerase amplification (rpa) assay outcomes at point of care influence of sequence mismatches on the specificity of recombinase polymerase amplification technology rapid detection of bohv- genomic dna by loop-mediated isothermal amplification assay rapid detection of bovine herpesvirus in bovine semen by loop-mediated isothermal amplification (lamp) assay equipment-free incubation of recombinase polymerase amplification reactions using body heat inhibition of recombinase polymerase amplification by background dna: a lateral flow-based method for enriching target dna not applicable. the data supporting our findings of this article are included within the manuscript. experimental protocols for obtaining cattle clinical samples used in this study were carried out in strict accordance with the animal ethics procedures and guidelines of the people's republic of china, and the animal study proposal was approved by shandong normal university animal care and use committee. all cattle owners signed an informed consent before participation in the study. not applicable. the authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. submit your next manuscript to biomed central and we will help you at every step: key: cord- -aaxvlktp authors: cortey, martí; díaz, ivan; vidal, anna; martín-valls, gerard; franzo, giovanni; gómez de nova, pedro josé; darwich, laila; puente, héctor; carvajal, ana; martín, marga; mateu, enric title: high levels of unreported intraspecific diversity among rna viruses in faeces of neonatal piglets with diarrhoea date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: aaxvlktp background: diarrhoea is a major cause of death in neonate pigs and most of the viruses that cause it are rna viruses. next generation sequencing (ngs) deeply characterize the genetic diversity among rapidly mutating virus populations at the interspecific as well as the intraspecific level. the diversity of rna viruses present in faeces of neonatal piglets suffering from diarrhoea in farms, plus samples from non-diarrhoeic piglets has been evaluated by ngs. samples were selected among the cases submitted to the veterinary diagnostic laboratories of infectious diseases of the universitat autònoma de barcelona (barcelona, spain) and universidad de león (león, spain). results: the analyses identified the presence of virus species corresponding to genera of rna viruses. most samples were co-infected by several viruses. kobuvirus and rotavirus were more commonly reported, with sapovirus, astrovirus , and , enterovirus g, porcine epidemic diarrhoea virus, pasivirus and posavirus being less frequently detected. most sequences showed a low identity with the sequences deposited in genbank, allowing us to propose several new vp and vp genotypes for rotavirus b and rotavirus c. conclusions: among the cases analysed, rotaviruses were the main aetiological agents of diarrhoea in neonate pigs. besides, in a small number of cases kobuvirus and sapovirus may also have an aetiological role. even most animals were co-infected in early life, the association with enteric disease among the other examined viruses was unclear. the ngs method applied successfully characterized the rna virome present in faeces and detected a high level of unreported intraspecific diversity. diarrhoea in neonatal piglets is a common problem in many pig herds. usually, this condition is seen either in the offspring of gilts or as an epidemic problem affecting litters from sows of any parity. in the first case, the problem is usually attributed to an inadequate acclimation protocol for gilts while in the latter, the most often cause is the introduction of a new enteric pathogen. these patterns reflect the immune status of sows against the causing agents and the transfer of colostral and lactogenic immunity to piglets. the agents involved in neonatal diarrhoea of piglets are diverse and include bacterial (escherichia coli, clostridium perfringens, etc.) and viral pathogens (coronaviruses, rotaviruses, etc.). less commonly neonates can suffer from diarrhoea caused by parasites [ ] . most of the viruses causing outbreaks of diarrhoea in neonate piglets are rna viruses such as porcine epidemic diarrhoea virus (pedv), transmissible gastroenteritis virus (tgev), porcine deltacoronavirus (pdcov) or rotavirus a, b, c or h (rva, rvb, rvc, rvh) [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . among them, rotavirus a, b and c are a major cause of diarrhoea in pigs worldwide, having a significant impact in health and productivity, plus the potential of zoonotic transmission to humans [ ] . the virus is transmitted by the faecal-oral route and large number of viral particles is excreted during rotavirus infection. in contrast, other rna viruses including kobuvirus, astrovirus, sapovirus, sapelovirus, teschovirus, and torovirus, have been detected in pig faeces but its role as causative agents of neonatal diarrhoea has not so far been fully elucidated [ ] [ ] [ ] [ ] [ ] . for instance, porcine kobuvirus (kobuv) has been found frequently ( - %) in faecal samples of pigs worldwide [ ] . in some cases, the presence of the virus was associated with diarrhoea, but in others no significant differences between infection rates in healthy or diarrhoeic animals was found. frequently kobuv were present concomitantly with other viruses making difficult a precise assessment of its role as agent of disease [ , ] . next generation sequencing (ngs) allows for an indepth characterization of the genetic diversity among rapidly mutating virus populations by directly sequencing viral strains at the interspecific as well as the intraspecific level [ , ] . the technology has been successfully applied to identify the diversity in the viral genome of pigs' faeces [ , [ ] [ ] [ ] . the aim of the present study is to explore the diversity of rna viruses present in faeces of neonatal piglets suffering from diarrhoea in spain, applying a tailor-made ngs protocol using the total rna extracted, without any amplification step, where the results obtained represent not only the rna viruses present in a sample, but also their relative abundances. the results reported among the diarrhoeic samples analysed include representatives of virus species corresponding to genera of rna viruses (additional file ): kobuvirus, rotavirus (rva, rvb and rvc), sapovirus (sav), mamastrovirus (porcine astrovirus types -astv -, -astv -and -astv -), alphacoronavirus (pedv), enterovirus (enterovirus g, entvg), pasivirus (pasiv) and posavirus (posav). the most commonly reported rna virus was kobuv, followed by rva, rvc, sav, rvb and astv (n values in fig. ). among the diarrhoeic samples where a single virus was detected, rva was present in samples and kobuv was present in . thirty-eight samples ( %) presented more than one virus and in one sample seven rna viruses were identified: kobuv, rvc, astv , and , sav and pedv. rotavirus (either rva, rvb or rvc) plus kobuv was the combination present in out of the ( %) samples infected with viruses. rva, rvb, rvc or a combination of two or three rotavirus were also present in out of the ( %) diarrhoeic samples analysed. for the rotavirus-negative samples kobuv was present in all ; being the single virus present in of them. in the other two samples astrovirus , , and , sav, pasiv, posav and entvg were detected (additional file ). the ngs approach used allowed the comparison of the relative frequencies of each viral species in the examined samples. thus, when the number of reads for a given virus was compared to the total number of reads attributable to a mammalian rna virus in the sample, it was evident that rotaviruses, particularly rva and rvb, clearly outnumbered any other virus that could be present (fig. ). in only nine cases, kobuv or sav reads were predominant among viral reads ( and cases, fig. the box-and-whisker plots show, for the samples from diarrhoeic animals, the distribution of the proportion of reads for a given mammalian viral species over the total number of mammalian viral reads (viral reads in a sample/total viral reads). minimum, maximum, median, respectively). in all cases, one virus represented at least % of the total viral reads. interestingly, when mixed rotavirus infections were detected (rva-rvc or rvb-rvc), the proportion of one virus clearly predominated against the other. when coupled with the viral load, the relative frequencies per virus (fig. ) showed that for a majority of cases ( / , . %), the predominant virus in the sample represented read proportions higher than . and viral reads figures larger than e . nearly all of them ( / , . %) corresponded to rotaviruseither rva ( ), rvb ( ) or rvc ( ) -, with kobuv and sav being much less frequent ( and cases, respectively). besides, few cases ( kobuv and rva) represented simultaneously high proportions with viral reads below e . in the four non-diarrhoeic samples, the number of viral reads obtained and indexed was lower compared to those of the diarrhoeic samples, none of the mammalian virus detected surpasses e to e reads (additional file ). in contrast, a large number of reads were indexed against rna viruses of plants (i.e. fabavirus, bromovirus, fijivirus, luteovirus) and fungi (i.e. hypovirus, alphapartivirus). the filtering results included both whole genome (complete) and partial (less than % of the genome covered) sequences of the virus listed above (additional file ). despite kobuv was more commonly reported than rva, the number of full-length genome sequences obtained was higher in rva (n = ) than in kobuv (n = ). the full-length sequences obtained - kobuv, rva, rvc, rvb, sav and astv were deposited in genbank with the accession numbers mh to mh , mk to mk , mk to mk , and mk to mk . considering the segmented nature of the rotavirus genome, every segment for every genome was uploaded separately. for the remaining rna viruses, every complete genome was uploaded in a single file. regarding the phylogenetic analysis of kobuv (fig. ), all spanish sequences formed a monophyletic cluster where a hungarian sequence was also included. the average nucleotide identity among spanish isolates was . %. it is worth noting that the depth of the terminal branches in the phylogenetic tree was very high compared to the inner branches, indicating a low number of shared mutations. the genotyping of the rva genomes obtained indicated that the most common combination was g p [ ] ( cases; %), with g p [ ] ( cases; %) and g p [ ] ( cases; %) being much less frequent. the genotypes g p [ ] , g p [ ] , g p [ ] , g p [ ] , g p [ ] and g p [ ] were reported only once (fig. ) . the nucleotide identities reported for the rva segments compared to the existing genbank sequences ranged between and %. in contrast, for the rvb complete genomes characterized in this work (fig. ) , the overall nucleotide identities (among the segments of the rvb genome) with the closest genbank sequences ranged from between and %. in fact, according to the proposed nucleotide cut-off values for for rvc (fig. ) , the nucleotide identities with the sequences available in genbank ranged between and %. the most common genotype was g p [ ] ( samples), while the remaining genomes would present two new rvc vp genotypes in combination with p [ ]one with gx p [ ] and one with gx p [ ] and one gx p [ ] . for other viruses, nucleotide identities with the closest sequences deposited were low: astv ( %), astv ( %), sav ( %), entvg ( %) and pasiv ( %) except for posav ( %), astv ( %) and pedv ( %) which were very similar to other european sequences reported. figures and show the phylogenetic trees for sav and astv , respectively. the de novo assembler and virus detection analyses performed did not detect contigs that could be related to the presence of an unknown rna virus, as all of them where positively indexed against the reference rna sequences dataset and/or the refseq genome database available at the blast resource of the ncbi website. diarrhoea is the most common infectious cause of neonatal death in pigs [ ] . prevention of this condition can be achieved by immunization of the sow with the aim of ensuring transfer of immunoglobulin a in colostrum and milk. indeed, outbreaks of infectious diarrhoea in neonates are associated to the lack of specific immunity in the sow. classically, infectious neonatal diarrhoea has been seen as a problem caused by single aetiological agents. however, with the development of molecular techniques, a growing number of evidences indicated that many agents can be found in the faeces of affected animals [ , ] . the problem now is to distinguish which of those agents primary cause diarrhoea, which others act as secondary or associated agents and which of them are part of the enteric microbiome without involvement in the disease. in this work, we examined the rna virome present in faecal samples from cases of diarrhoea plus four non-diarrhoeic negative controls in which specific bacteriological agents were excluded. the approach taken using ngs did not include any previous enrichment or pcr step; hence, the results obtained represented not only the rna viruses present in a sample analysed but also their relative abundances. this may contribute to our understanding of the role of each virus in a given case. in the samples examined, the predominance of rotaviruses reads reinforce the notion of these viruses as primary agents of neonatal diarrhoea; although, occasionally, kobuv and sav may have a role in this process. the examination of the relative proportions of viral reads versus the number of reads showed that for any given case always one virus predominated, representing more than % of the mammalian viral reads obtained. this value can be tentatively proposed as a cutoff for the assignment of an etiological agent. in contrast, for all the other viruses examined, the relative abundance of their genomes would be more consistent with a subclinical infection. whether this could be the consequence of a limited virulence, because of some level of passive immunity, or other causes, cannot be addressed in the present study. since the ngs filtering method used in the present study could only detect known agents, additional analyses to screen for potential viral motifs were performed. the de novo assembly and virus detection analyses were not able to identify any contig that could be related to the presence of an unknown rna virus. interestingly, in the non-diarrhoeic samples analysed the number of mammalian reads was very scarce, but a higher number of plant and fungi viruses was reported. this is somewhat surprising, since the examined animal were suckling piglets (less than week of age) that do not eat feedstuff. it is difficult to explain the origin of those viruses, since samples were taken from the rectum and thus, environmental contamination is little likely. our results agree with a number of studies that reported different rotavirus species as agents of neonatal diarrhoea (reviewed in [ ] ). one interesting observation from the present study is that coinfections or rva-rvc and rvb-rvc was very common, suggesting the need for simultaneous testing all three agents in cases of neonatal diarrhoea. regarding kobuv, our results also agree with an increased prevalence of this agent observed in cases of diarrhoea in suckling piglets worldwide: brazil [ ] , korea [ ] and vietnam [ ] ; despite several (see figure on previous page.) fig. neighbor-joining phylogenetic tree based on the p-distance among the nucleotide sequences of the vp segment for rotavirus b. along the branches, percentage of bootstrap values based on , replicates. only values equal or larger than % are shown. the dataset contains reference sequences representing the rvb vp genotypes described plus the sequencesmarked with a circlereported in this work. the division of genotypes is based on the % nucleotide cut-off value proposed by [ ] ; accordingly, two new genotypes (labelled as gx and gx in the figure) are tentatively proposed studies have observed non-significant differences in kobuv infection between diarrheic and healthy piglets in several european countries [ , , ] . as mentioned above, two different patterns were observed in cases where kobuv was present: one with high proportion of kobuv reads and high number of viral reads, and others where these two circumstances were not fulfilled. the first pattern could correspond to clinical cases caused by fig. neighbor-joining phylogenetic tree based on the p-distance among the nucleotide sequences of the vp segment for rotavirus c. along the branches, percentage of bootstrap values based on , replicates. only values equal or larger than % are shown. the dataset contains reference sequences representing the rvc vp genotypes described plus the sequencesmarked with a circlereported in this work. the division of genotypes is based on the - % nucleotide cut-off value proposed by [ ] ; accordingly, two new genotypes (labelled as gx and gx in the figure) are tentatively proposed kobuv, while the second could correspond to secondary or concomitant infections by this agent. a similar pattern would apply to sav. regarding the other agents, since they were always in combination and their reads were not preeminent, its role must be seen as secondary at best. for instance, no differences in astrovirus prevalence between diarrheic and non-diarrheic piglets were reported [ , ] , nor for enterovirus prevalence between healthy and diarrheic pigs [ ] . interestingly, pedv was seldom found in our samples and when found only traces could be detected. prior to this, a higher frequency for this pathogen could be expected. however, while pedv has caused recently severe epidemics in america [ ] , in europe the incidence seems to be much lower [ ] . of note is the total absence of tgev, a virus which was widespread in europe, but has consistently declined, or even disappeared, after the apparition and fast spread worldwide in the nineties of porcine respiratory coronavirus [ ] . in any case, it is somewhat surprising to detect that many different viruses (up to seven in a single sample) in so young animals, even though the pattern was already observed in diarrhoeic piglets [ ] . while it is easy to understand that the introduction of a new enteric virus in the farm will result in its rapid spread and the eventual development of an epidemic, it is more difficult to understand how so many viruses can be present in the maternities without generating a herd immunity resulting in colostral and lactogenic protection of suckling piglets. one possibility is that, most often, maternal immunity could be enough to limit the replication of those agents but not to completely prevent the infection; namely only provided partial immunity. in other cases, on farms reporting disease even in sows, rva was present. this is compatible with its assumed role as primary agent. we have recently described the introduction of a new rva strain that rapidly spread across pig farms in spain and that was also present in the samples of this study as well [ ] . it is worth noting that the phylogenetic analyses for all the examined viruses indicated the existence of local clusters except for rva (discussed above). this, together with the depth of the corresponding branches in the trees, suggested a long evolutionary history on a local basis. certainly, we cannot discard the existence of other clusters for any of the reported viruses. however, the detection of several new genotypes for rvb and rvc plus the relative low nucleotide identity with other available (see figure on previous page.) fig. neighbor-joining phylogenetic tree based on the p-distance among the nucleotide sequences of the complete genomes of porcine sapovirus. along the branches, percentage of bootstrap values based on , replicates. only values equal or larger than % are shown. the dataset contains reference genomes representing the sapovirus genogroups described so far in swine plus the complete sequencesmarked with a circlereported in this work. the division of genotypes is based on the classification proposed by [ ] fig. neighbor-joining phylogenetic tree based on the p-distance among the nucleotide sequences of the complete genomes of porcine astrovirus . along the branches, percentage of bootstrap values based on , replicates. only values equal or larger than % are shown. the dataset contains the complete genomes available so far in swine plus the complete sequencesmarked with a circlereported in this work sequences in genbank reinforces the idea of local evolution at least for these two viruses. moreover, with the results obtained we propose to define for rvb one new vp (p [ ] ) and two new vp (g and g ) genotypes; as well as genotypes g and g for rvc. the geographical pattern observed in the rvb phylogenetic trees agrees with the notion that rvb genotypes may be specific for host species and region [ ] . regarding kobuv, no differences in the clustering pattern were observed between those strains coming from cases in which kobuv was predominant or not. this suggests that phylogenetic clustering probably is not predictive of virulence for this virus and most probably, other causes (i.e. immunity) are more relevant with regards to the clinical expression of the disease. similarly, for sav no differences were seen, and all isolates clustered together within genogroup iii, the most commonly reported porcine sav [ ] . the results of this study suggested that based on the abundance among the cases analysed, rotaviruses were the main rna viruses involved in neonatal diarrhoea in pigs. although kobuvirus was the most common virus detected, probably it was the primary agent of diarrhoea only in a small number of cases. similarly, sapovirus would be responsible of a single diarrhoea case. for the other examined viruses, the results indicated that many animals were infected in early life but the association with enteric disease was unclear. the ngs approach applied permit not only the detection rna viruses present in a sample, but also to determine their relative abundances. this approach can be used for a more comprehensive diagnosis of neonatal diarrhoea and is useful for the examination of the rna virome in faeces. the study was conducted with samples selected from cases of neonatal diarrhoea (less than days old) routinely submitted for diagnosis during to the veterinary diagnostic laboratories of infectious diseases of the universitat autònoma de barcelona (uab, barcelona, spain) and universidad de león (ul, león, spain). four samples from healthy non-diarrhoeic piglets were also included to be used as negative controls. in the cases studied, a bacteriological cause for the diarrhoea had been excluded after a microbiological culture for aerobes and anaerobes and molecular analyses (pcr for e. coli virulence factors and c. perfringens and c. difficile toxins). only cases apparently unrelated (different farms with no evident connection) were included. finally, faecal samples, each one representing an outbreak of neonatal diarrhoea in farms from catalonia, castile and leon, aragon, galicia and valencia were analysed (additional file ). faecal samples were kept frozen at − °c until used. when needed, samples were thawed and diluted : in sterile distilled water. then, to remove debris, diluted samples were sequentially clarified for min at g, min at g and min at , g. total rna extraction was performed using the trizol reagent (thermo-fischer scientific) following the manufacturer's instructions. for each reaction, μl of the diluted faeces was used. the assessment of the diversity of viral rna within each sample was directly characterised from the total rna extracted, without any previous amplification step (no primers were required), applying a ngs approach previously applied to faeces [ ] . briefly, the procedures included: (i) the construction of a genomic library for illumina ngs sequencing from the total rna extracted, using a commercial protocol and reagents (protocol for use with purified mrna or rrna depleted rna and nebnext® ultra™ ii rna library prep kit for illumina®, new england biolabs); ii) the ngs runs using an illumina miseq platform available at the genomics and bioinformatics service of the uab and a read length of bp; iii) the trimming of low quality reads (those showing a qc score < as determined by fastqc©software, babraham informatics), using trimmomatic© [ ] ; iv) the taxonomic classification of the quality reads against a pre-built database containing the viral genomes available at genbank with kraken [ ] ; v) the initial filtering of quality reads against a reference file containing the concatenated sequences of a panel of rna viruses described in faeces (additional file ); vi) the mapping of quality reads against the complete genomes of the rna virus identified in the steps iv) and v), with the burrows-wheeler aligner [ ] , applying the bwa-mem algorithm for long reads [ ] ; and vii) the assembly of a consensus sequence in fasta format for every sample and rna species identified, using the program quasr [ ] . for the software programs used in steps iii), iv), vi) and vii) -fastqc©software, kraken, burrows-wheeler aligner and quasr, respectively -, the default parameters of every program were applied. next, a database for every rna species identified was constructed by downloading the available complete genome sequences from genbank. finally, the sequences obtained were aligned and phylogenetically compared with the datasets constructed for every complete genome, or segment in the segmented genomes identified. the phylogenetic relationships among sequences were analysed using the software mega [ ] , by means of a neighbor-joining (nj) algorithm, using the matrix of pairwise p-distances and , bootstrap replicates to estimate the confidence of the internal branches of the trees. in the cases where a presumptive aetiological agent could not be clearly established, further analysis to detect unknown rna viruses were undertaken with the program rnaspades [ ] , an rnaseq de novo assembler included in the package spades [ ] . also, the rnaseq outputs were analysed with virfind, a web-based bioinformatic pipeline specifically designed for virus detection and discovery [ ] . in both cases, the default parameters provided by the programs were used. supplementary information accompanies this paper at https://doi.org/ . /s - - - . additional file : summary of the samples analyzed: name, origin, rna viruses detected and number of reads indexed. additional file : summary of the rna viruses and accession numbers of the strains used to filter the quality reads in the step iv) of the ngs approach, used together with step iii), to identify the rna virus species present in a given sample. the role of the funding bodies not included the design of the study, the sample collection or the analysis, neither the interpretation of data, nor the writing of the manuscript. the complete genome sequences obtained and analysed during the current study are available in the national center for biotechnology information database repository, (https://www.ncbi.nlm.nih.gov/) with the accession numbers mh to mh , mk to mk , mk to mk , and mk to mk . ethics approval and consent to participate samples submitted for diagnosis to the veterinary diagnostic laboratories of infectious diseases at the universitat autònoma de barcelona and universidad de león comply with institutional, national, and international guidelines regarding ethics on research. a retrospective study on the etiological diagnoses of diarrhea in neonatal piglets in ontario diarrhoea in neonatal piglets: a case control study on microbiological findings identification, phylogenetic analysis and classification of porcine group c rotavirus vp sequences from the united states and canada rapid detection and high occurrence of porcine rotavirus a, b, and c by rt-qpcr in diagnostic samples viral and bacterial investigations on the aetiology of recurrent pig neonatal diarrhoea cases in spain casecontrol study of pathogens involved in piglet diarrhea porcine rotaviruses: epidemiology, immune responses and control strategies porcine rotavirus closely related to novel group of human rotaviruses development and evaluation of a duplex realtime rt-pcr for detection and differentiation of virulent and variant strains of porcine epidemic diarrhea viruses from the united states genome sequence of torovirus identified from a pig with porcine epidemic diarrhea virus from the united states no evidence of enteric viral involvement in the new neonatal porcine diarrhoea syndrome in danish pigs nanopore sequencing as a revolutionary diagnostic tool for porcine viral enteric disease complexes identifies porcine kobuvirus as an important enteric virus repeated examination of natural sapovirus infections in pig litters raised under experimental conditions longitudinal survey of teschovirus a, sapelovirus a, and enterovirus g fecal excretion in suckling and weaned pigs molecular and phylogenetic analysis of the porcine kobuvirus vp region using infected pigs from sichuan province porcine kobuvirus in healthy and diarrheic pigs: genetic detection and characterization of virus and co-infection with rotavirus a understanding the complex evolution of rapidly mutating viruses with deep sequencing: beyond the analysis of viral diversity recent advances in inferring viral diversity from high-throughput sequencing data metagenomic analysis of the rna fraction of the fecal virome indicates high diversity in pigs infected by porcine endemic diarrhea virus in the united states simultaneous identification of dna and rna viruses present in pig faeces using process-controlled deep sequencing viral metagenomics analysis demonstrates the diversity of viral flora in piglet diarrhoeic faeces in china first detection of kobuvirus in farm animals in brazil and the netherlands rotac: a web-based tool for the complete genome classification of group a rotaviruses rva genotype determination tool: virus pathogen resource detection of substantial porcine group b rotavirus genetic diversity in the united states, resulting in a modified classification proposal for g genotypes whole genome sequences of japanese porcine species c rotaviruses reveal a high diversity of genotypes of individual genes and will contribute to a comprehensive, generally accepted classification system prevalence of porcine noroviruses, molecular characterization of emerging porcine sapoviruses from finisher swine in the united states, and unified classification scheme for sapoviruses chapter : prewening mortality molecular detection of porcine kobuviruses in pigs in korea and their association with diarrhea large-scale screening and characterization of enteroviruses and kobuviruses infecting pigs in vietnam molecular investigations on the prevalence and viral load of enteric viruses in pigs from five european countries detection and genetic characterization of porcine astroviruses in piglets with and without diarrhea in thailand astrovirus infections in humans and animals -molecular biology, genetic diversity, and interspecies transmissions porcine epidemic diarrhoea: new insights into an old disease decline of transmissible gastroenteritis virus and its complex evolutionary relationship with porcine respiratory coronavirus in the united states full-genome characterization by deep sequencing of rotavirus a isolates from outbreaks of neonatal diarrhoea in pigs in spain genetically divergent porcine sapovirus identified in pigs, united states trimmomatic: a flexible trimmer for illumina sequence data kraken: ultrafast metagenomic sequence classification using exact alignments fast and accurate long-read alignment with burrowswheeler transform lofreq: a sequence-quality aware, ultra-sensitive variant caller for uncovering cell-population heterogeneity from highthroughput sequencing datasets quasr: quantification and annotation of short reads in r mega : molecular evolutionary genetics analysis version . for bigger datasets rnaspades: a de novo transcriptome assembler and its application to rna-seq data spades: a new genome assembly algorithm and its applications to single-cell sequencing development of a virus detection and discovery pipeline using next generation sequencing publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations our grateful thanks to the participating veterinarians that kindly provided the field samples. the authors declare that they have no competing interests. key: cord- -toen nvr authors: alves, f.; prata, s.; nunes, t.; gomes, j.; aguiar, s.; aires da silva, f.; tavares, l.; almeida, v.; gil, s. title: canine parvovirus: a predicting canine model for sepsis date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: toen nvr background: sepsis is a severe condition associated with high prevalence and mortality rates. parvovirus enteritis is a predisposing factor for sepsis, as it promotes intestinal bacterial translocation and severe immunosuppression. this makes dogs infected by parvovirus a suitable study population as far as sepsis is concerned. the main objective of the present study was to evaluate the differences between two sets of sirs (systemic inflammatory response syndrome) criteria in outcome prediction: sirs and sirs . the possibility of stratifying and classifying septic dogs was assessed using a proposed animal adapted piro (predisposition, infection, response and organ dysfunction) scoring system. results: the dogs enrolled in this study were scored for each of the piro elements, except for infection, as all were considered to have the same infection score, and subjected to two sets of sirs criteria, in order to measure their correlation with the outcome. concerning sirs criteria, it was found that the proposed alterations on sirs (capillary refill time or mucous membrane colour alteration) were significantly associated with the outcome (or = . , p < . ), contrasting with the sirs criteria (p = . ) that did not correlate with the outcome. no significant statistical association was found between predisposition (p = ), response (p = . ), organ dysfunction (p = . ), total piro score (p = . ) and outcome. to explore the possibility of using the sirs criteria as a fast decision-making tool, a fast-and-frugal tree (fft) was created with a sensitivity of % and a specificity of %. conclusion: these results suggest that increasing the sirs criteria specificity may improve their prognostic value and their clinical usefulness. in order to improve the proposed piro scoring system outcome prediction ability, more specific criteria should be added, mainly inflammatory and organ dysfunction biomarkers. according to the most recent scientific consensus, the term sepsis should be used to describe the organ dysfunction triggered by a deleterious inflammatory host response to infection [ ] . after the release of bacteria into the bloodstream as a result of an infection, sepsis only takes place if the host immune system is overpowered resulting in clinically significant bacteraemia [ ] . with the goal to establish the correlation between the systemic inflammatory response and sepsis a conference was held in in which the criteria to assess if a systemic inflammatory response syndrome (sirs) is taking place were defined [ ] . since the first adaptation of these criteria to animals [ ] they have been subjected to a series of modifications and the cut off values slightly vary among investigations. to increase the sensitivity (se) and specificity (sp) of these parameters, it is important to use them in association with the clinical judgement when screening animals for sepsis, as they are not sufficiently accurate to establish a definitive diagnosis [ ] . for a dog to be diagnosed with sirs at least two of the following four criteria need to be met: body temperature < . °c or > . °c, hr > bpm, rr > breaths/min or pco < mmhg (venous or arterial), wbc < or > , cells/μl, or > % band neutrophils. cats need to meet three of the four criteria for sirs to be diagnosed: body temperature < . °c or > . °c, hr < or > bpm, rr > breaths/min, wbc > , or < cells/μl, or > % band neutrophils [ ] . when the circulatory and cellular/metabolic abnormalities are severe enough to increase mortality, septic shock should be considered [ ] . this translates into a sepsis associated hypotension non-responsive to intravascular volume expansion, that is, dogs with systolic blood pressure < mmhg or mean arterial pressure < mmhg that only respond to vasopressor therapy [ ] . the definition of multiple organ dysfunction syndrome (mods) has remained unchanged since the first sepsis consensus conference in [ ] , where it was defined as "the presence of altered organ function in an acutely ill patient such that homeostasis cannot be maintained without intervention". during sepsis mods can be considered when at least two organ systems, distant from the infection site, become dysfunctional [ ] . in the suspicion of sepsis, vital parameters including temperature (temp.), heart rate (hr) and respiratory rate (rr) should be measured and compared with the sirs criteria, as sepsis is diagnosed when the sirs criteria are fulfilled and an infection is confirmed. the clinical signs tend to be unspecific as they correlate not only with the organ system originally affected by the infectious agent but also with secondary organ dysfunctions. some dogs may already be in septic shock upon hospital admission. in the initial phase of shock patients´present with pale mucous membranes, prolonged capillary refill time (crt) and weak pulses. later, in the hyperdynamic phase of shock, vasodilation subsists with resulting hyperaemic mucous membranes, a decreased crt (< s), and strong or bounding pulses. blood pressure should always be part of physical examination of a suspected sirs patient as hypotension may be present [ , ] . the diagnostic approach to a septic animal should include a complete blood count, biochemistry profile and coagulation tests. the hemogram may reveal abnormalities in different cellular lineages. the hematocrit most frequently reveals anaemia secondary to blood loss, haemolysis, oxidative damage and reduced erythrocyte production. polycythaemia can also be present in hypovolemic animals due to hemoconcentration and splenic contraction. most animals present leucocytosis and band neutrophils and the blood smear reveal toxic changes to the neutrophils. due to the immunosuppression and lymphocyte apoptosis, it is also possible for lymphopenia and leukopenia to persist. platelet consumption and disseminated intravascular coagulation (dic) resulting in thrombocytopenia is a usual finding. biochemical abnormalities vary and reflect the organ dysfunctions taking place, either primarily affected by the infection or secondary to the inflammatory state. common findings include hypoalbuminemia, glycaemia alterations, hypocalcaemia and hyperbilirubinemia [ , , ] . multiple factors contribute to the development of sepsis in canine parvovirus infections. cellular destruction, intestinal hypomotility, dysbiosis, gut inflammation and tissue necrosis all contribute to cause disruption of the gastrointestinal mucosal barrier, allowing gram-negative and anaerobic bacteria translocation from the intestinal lumen to the bloodstream developing bacteraemia [ , ] . along with the mucosal barrier disruption, impaired immunity develops increasing the susceptibility to secondary infections. marked leukopenia (mostly neutropenia and lymphopenia) is often observed in cpv infected dogs, as the virus also targets the mitotically active precursors of leukocytes and lymphoid cells of the bone marrow and lymphoid tissue. neutropenia and bacteria overload impair the elimination of luminal bacteria from the bloodstream in contrast to healthy animals [ , , ] . with the sirs progression and the release of inflammatory mediators, the gastrointestinal barrier is compromised again, contributing for the cycle of bacterial translocation [ ] . in order to stage septic patients by their risk of mortality/adverse outcome and their potential to respond to treatment, a new stratification system, acronym piro, was introduced in . this system allows to stratify patients based on their predisposing conditions, the nature and characteristics of the insult/infection, the extent of the host immune response to it, and the associated organ dysfunction [ ] . the purpose of piro is to help in the enrolment of individuals in clinical studies and prognosis of septic patients, allowing adapting the therapy offered and improving survival. the main objective of the current study was to assess the prognostic value of the presenting vital signs as well as to evaluate the possibility of stratifying and classifying septic animals according to a proposed piro classification system, using parvovirus infection as a natural model for sepsis study [ ] . in addition developing a fast-and-frugal tree to reinforce and speed the decisionmaking process. this methodology could help to assess prognosis and be part of the clinical decision making, as well as helping in the enrolment of study populations in future sepsis studies. for that purpose, parvovirus naturally infected dogs hospitalized in the infectious disease isolation unit (idiu) of the veterinary teaching hospital (vth) of the faculty of veterinary medicine (fmv) of the university of lisbon (ulisboa), were subjected to two sets of sirs criteria. the first set, named sirs , considered sirs criteria as they were originally proposed [ ] . the second set, named sirs , keeps the same criteria of sirs plus capillary refill time or mucous membrane colour alteration [ ] to attempt to improve the criteria specificity. then patients were classified by a piro classification system adapted from humans to dogs. finally, all individual variables of piro, the total piro score and both sirs criteria were correlated with the outcome. all dogs included in this study were evaluated by a veterinarian from the vth. the target population included dogs hospitalized in the idiu from november until june , with a positive laboratory diagnosis of canine parvovirosis either by elisa or pcr faecal antigen detection, with clinical exam, haemogram, biochemistry records and known outcome, discharge or death. all dogs that did not fulfil the previous inclusion criteria or had concomitant diseases able to induce gastrointestinal signs were excluded. the sample size was dogs. concerning the outcome ( . %) dogs were discharged and ( . %) dogs died. regarding gender ( . %) were male and ( . %) female. the majority of the dogs, ( . %), fell under the described susceptible age group of over weeks and under months, ( . %) dogs were over months old, ( . %) were under weeks old and ( . %) were of unknown age. as far as vaccination status is concerned, most dogs, ( . %) had no vaccination history, ( . %) an incomplete vaccination programme, ( . %) an unknown vaccination history and only ( . %) were considered to have a complete vaccination status for parvovirus infection. most dogs, ( . %) had no defined breed. table gathers all leucocyte counts, a selection of clinical examination parameters (temperature, heart rate and respiratory rate), all individual variables of piro (p=predisposition, i=infection, r = response, o=organ dysfunction), the total piro score and both sirs criteria for survivors and non-survivors dogs. no significant statistical association was found between the fulfilment of the sirs criteria and the outcome (p = . ). however, when considering the new criteria sirs requiring crt or mucous membrane colour alteration, a statistical association was found between sirs criteria and the outcome (or = . , p = . ). this suggests that dogs fulfilling the sirs criteria upon admission were approximately times more likely to die than those who did not ( table ) . for the current study, the predisposing factors included were age, breed and vaccination status ( table ). the sample was composed mainly by undefined breed dogs ( . %) and dogs were considered to have a breed predisposition for parvovirus enteritis ( labrador, german shepherd, rottweiler and alaskan malamute) [ ] . most dogs ( . %) were aged between weeks and months and the majority of the animals included had no vaccination history ( . %) or an incomplete/incorrect vaccination ( . %). as far as age and vaccination status are concerned, this sample reflects descriptions in the literature about parvovirus infection predisposition, with young unvaccinated dogs being the most susceptible to infection. in the present study no significant statistical association was found between predisposition and outcome (p = ) ( table ). in our study parvovirus was considered to be the only infection inducing element and, since all the animals were considered to have the same infection score of " ", its' correlation with the outcome was not statistically evaluated. to explore the possibility of using the sirs criteria as a fast decision-making tool, a fast-and-frugal tree (fft) ( fig. ) was created using the criteria considered to characterize the response (r) element. this fft revealed a sensitivity of % and a specificity of %. factors considered for the characterization of the host inflammatory response were the sirs diagnosis criteria (hr, rr, t and leucocytes count) ( table ). no significant statistical association was found between response (r) and outcome (p = . ) ( table ). regarding organ dysfunction from the dogs enrolled in this study, only were considered to have some kind of organ dysfunction, each scoring " " (table ). hepatic dysfunction was the most frequent cause of organ dysfunction with dogs falling under this classification, due to hypoalbuminemia and with elevated alp. regarding these dogs were deceased and the other survived. from the remaining dogs two were considered to have renal dysfunction, one with a creatinine increment and the other with both creatinine and urea elevation. only the first of these dogs died. three dogs with low platelet count were included on the coagulation dysfunction group and they all survived. none of the animals included showed signs of cardiovascular or respiratory dysfunction. since it was first adapted for veterinary medicine, sirs has been widely used by clinicians and researchers to diagnose sepsis in animals. on a sepsis survey, % of veterinarians acknowledged to use sirs criteria [ ] . a pioneer study to propose sirs classification criteria for animals and to assess their ability to diagnose sepsis accurately was carried out by hauptman et al. [ ] . the meeting of at least two of the four criteria method revealed a se of % and sp of %. even though the high sensitivity found indicates that almost all septic animals could be detected, the low specificity implies an over diagnosing of sepsis due to % false positives (fp). in an attempt to enhance the criteria specificity in sepsis diagnosis, the sccm/esicm/accp/ats/sis international sepsis definitions conference task force proposed a list of possible signs of inflammatory response to infection that could be added to the existing sirs criteria, hence augmenting their specificity [ ] . in the present study one of the proposed variables was added to the existing sirs criteria in order to create a new set of criteria denominated sirs . accordingly, the sirs criteria would only be applied upon an increased capillary refill time or a mucous membrane colour alteration. in our study, when the new classification criteria were applied, a significant statistical association with the outcome was found (or = . , p < . ). in fact, according to our results, dogs that met the sirs criteria on alves et al. bmc veterinary research ( ) : admission were about times more likely to die than those who did not ( table ). this improved mortality forecast in medical emergency ward canine patients may be due to an increased specificity of the criteria applied, as they might be indicators of hemodynamic instability and tissue perfusion compromise. even though none of the proposed parameters are specific for sepsis, they can be indicators of an onset of organ dysfunction, which is consistent with the most recent sepsis definition, as a "life-threatening organ dysfunction caused by a dysregulated host response to infection", thus helping to increase the specificity of the diagnosing criteria [ ] . sepsis predisposition takes into account all the factors that are present before the onset of sepsis and that may influence the outcome upon an infectious insult. apart from genetic factors, both age and medical co-morbidities were reported in various studies to be associated with hospital mortality [ ] [ ] [ ] . further studies are needed to increase knowledge about the influence of predisposing factors in the systemic inflammatory response of animal species. one study concluded that geriatric dogs had a weaker il- production upon bacterial lps stimulation, which may turn into an exacerbated inflammatory response and greater risk of mortality when compared to younger dogs [ ] . breed has also been shown to influence the inflammatory response. nemzek et al. [ ] found that cpv highly susceptible breeds such as rottweiler and doberman pinscher showed an increase in tumour necrosis factor-α (tnf-α) production in response to lps stimulation when compared to mixed breeds. in the current study, the predisposing factors investigated were age, breed and vaccination status ( table ) . the sample was composed mainly by undefined breed dogs ( . %) and dogs were considered to have a breed predisposition for cpv enteritis ( labrador, german shepherd, rottweiler and alaskan malamute) [ ] . most dogs ( . %) were aged between weeks and months and most of the animals had no vaccination history ( . %) or an incomplete/incorrect vaccination ( . %). as far as age and vaccination status are concerned, this sample reflects what has been previously reported about cpv epidemiology, with young unvaccinated dogs being the most susceptible to infection [ ] . no significant statistical association was found between predisposition and outcome (p = ) ( table ). this result differs from most human medicine studies that have shown a significant statistical association between predisposition and outcome, with granja et al. [ ] and howell et al. [ ] reporting a strong correlation with mortality (p < . ). when considering the predisposition (p) discriminatory ability for predicting outcome, a poor to fair accuracy was described by rathour et al. [ ] reporting an area under the receiver operating characteristics curve (auc-roc) of . , while granja et al. [ ] reported an auc-roc of just . . these results suggest that predisposition alone is not a good outcome prediction element but, since it is associated with the outcome, it should be included in the total piro classification in order to improve its overall accuracy. population characteristics including an overrepresentation of animals within the susceptible age group and underrepresentation of death among the susceptible breeds may also have contributed for the discrepancy between the results obtained in this study and the ones previously cited. on the other hand, our findings come into agreement with the results observed by kalli et al. [ ] on cpv infected dogs, where no correlation between any particular breed or age group and the outcome was found. only purebreds were . times more likely to develop the disease. it might be the case that the parameters chosen to characterize the dogs´predisposition in this study, for example breed, were not the most suitable to evaluate the predisposition influence on sepsis mortality. for the current study cpv was considered to be the only infection inducing element and, since all the dogs were considered to have the same infection score of " ", its' correlation with the outcome could not be statistically evaluated. moreover, this was a limitation of the study, because whenever a dog exhibited clinical examination results, haematological and serum biochemistry compatible with parvovirosis, other agents of acute gastroenteritis of infectious or parasitic origin were not investigated. yet when the pattern of clinical signs or haematological and serum biochemistry suggested the possibility of another disease, these dogs were always tested and rejected according to the exclusion criteria described in methods. one interesting use of sirs criteria is the possibility to construct a fast-and-frugal tree (fft) to predict sepsis outcome, thus helping to speed decision-making. figure represents one fft that may be helpful to characterize and score the response (r) element of the piro system. this fft was not tested on another sample and so the results may only reflect the tree's performance for this particular sample [ ] . this fft has a sensitivity of % and a specificity of %. sensitivity was primed over specificity in the making of this fft, as it is more important to have a higher sensitivity when considering life-threatening conditions like sepsis, in order to reduce the number of false negatives and the risk of missing critically ill animals. the high sensitivity obtained means a good prediction might be expected % of the times, when attributing a good prognosis. the low specificity observed implies that % of the dogs would be wrongly given a poor prognosis but would end up surviving. using this fft for prognosis attribution may imply a high number of false alarms. however, while the consequences of a low specificity would be a closer monitoring of not so critically ill animals, if specificity was privileged over sensitivity, we would risk attributing a good prognosis to critically ill dogs. this could lead to a less rigorous clinical monitoring of these animals, reducing their survival chances. decision aids, like this fft, may contribute to define clinical parameters and to establish cut off values for them, making them a valuable tool in sepsis research. the inflammatory response is also accountable for the clinical changes observed during sepsis and can have predictive value. variables proven to be related with mortality include heart and respiratory rate, leucocyte and band neutrophils count [ , [ ] [ ] [ ] . in this study the factors used for the characterization of the host inflammatory response were the sirs diagnosis criteria: hr, rr, t and leucocytes count (table ) . no significant statistical association was found between response (r) and outcome (p = . ) ( table ). these results differ from what has been reported in human medicine studies, in which response was positively associated with mortality. granja et al. [ ] and howell et al. [ ] both observed a strong correlation between response and outcome, with a p = . and a p < . being reported respectively. on another study the only two response variables related with hospital mortality were increased respiratory rate (> breaths/min) and bandemia (> % immature band neutrophils). in that study a fair outcome prediction accuracy was reported for the response element, with an auc-roc = . [ ] . the same limitations described above for the sirs criteria may be pointed (higher respiratory and heart rate in puppies and lower leukocyte count due to viral destruction) as the same criteria were used to characterize both [ , ] . to improve the outcome prediction ability of the response element, biochemical markers of inflammation such as inflammatory cytokines (il- and tnf), c-reactive protein (crp) or coagulation proteins should be included in future investigations [ , ] . the retrospective nature of the present study made it impossible to include biochemical markers of inflammation, as they are not part of routine biochemical analyses. the presence of organ systems dysfunction caused by a deleterious inflammatory response is what differentiates sepsis from an infection, and the presence of organ failure has been shown to correlate with the outcome. yet in this study, no statistical association was found between organ dysfunction and outcome (p = . ) ( table ) , diverging from the results reported in other studies. kenney et al. [ ] reported that cardiovascular dysfunction, coagulation dysfunction, renal dysfunction (p < . ) and respiratory dysfunction (p < . ) in dogs, were all independently associated with the outcome. they reported that mortality rate rose as the number of organ systems affected increased. for the overall organ dysfunction score and its' correlation with the outcome, rathour et al. [ ] described a good outcome prediction accuracy, with an auc-roc = . . a statistical association between overall organ dysfunction score and outcome was also reported by granja et al. [ ] . from the dogs enrolled in this study, only were considered to have some kind of organ dysfunction, each scoring " " (table ) . hepatic dysfunction was the most frequent cause of organ dysfunction with dogs falling under this classification, due to hypoalbuminemia and with elevated alp. of these eight dogs, four died and the other four survived. hypoalbuminemia is a rather nonspecific parameter to access hepatic function especially during sepsis, as increased vascular permeability and shifting to acute phase proteins production also contribute to the albumin decrease [ , ] . considering that our study population was composed of cpv infected dogs, hypoalbuminemia may even be less specific as an hepatic function marker, with the most probable cause for hypoalbuminemia being gastrointestinal protein loss. alkaline phosphatase (alp) is not directly related with impaired liver function, even though it can be increased during sepsis due to cholestasis [ ] . the alp increment was slight in both dogs suggesting it could result from individual variation. the low specificity of the variables chosen to evaluate liver function and the reported inconsistency of hepatic dysfunction as a mortality predictor, may have affected the results of the present study. two remaining dogs were considered to have renal dysfunction, one with a creatinine increment and the other with both creatinine and urea raise. only the first of these dogs died. based on renal dysfunction consensus the criteria that should be included in the definition of renal dysfunction include serum creatinine concentration, glomerular filtration rate and urine output. in the present study only creatinine and urea were considered as renal dysfunction markers, which may have impaired the ability to identify the presence of renal dysfunction on this sample [ ] . nonetheless, kenney et al. [ ] reported a strong association between renal dysfunction and outcome even when using serum creatinine concentration as the only renal dysfunction marker. finally, three dogs with low platelet count were included on the coagulation dysfunction group and they all survived. even though coagulation dysfunction has been independently associated with mortality, there are still conflicting results when it comes to platelets count. while hauptman et al. [ ] reported thrombocytopenia as a good sepsis marker, laforcade et al. [ ] found no significant difference on platelet counts between dogs with sepsis and the control group. the measurement of other coagulation markers like prothrombin time (pt), partial thromboplastin time (ptt), fibrin degradation products (fdp) and d-dimer (dd) concentrations, could have helped on the detection of more animals suffering from coagulation disorders. none of the animals investigated showed signs of cardiovascular or respiratory dysfunction so it was impossible to assess their influence on the outcome. the fact that the criteria proposed to characterize both of these organ systems dysfunctions were rather subjective, as they require clinical judgment, may contribute for the results obtained. future studies should consider other cardiovascular and respiratory function markers. as far as the respiratory function is concerned there are, since , veterinary medicine criteria to assess the presence of acute lung injury and acute respiratory distress syndrome [ ] . helpful clinical exams for the characterization of cardiac dysfunction should include echocardiography as it would identify the presence of biventricular dilatation or a decreased ejection fraction [ ] . other classification systems like the sequential organ failure assessment (sofa) may be used to improve the scoring of organ dysfunction (o) and contribute to a more accurate overall piro scoring system. in the present study no significant statistical association was found between the total piro score and the outcome (p = . ). different studies described a fair to good outcome prediction capacity. rubulotta et al. [ ] , reported an area under the curve of . . even though this result defines only a fair mortality prediction ability for piro, it was equivalent to the auc published for other scoring systems at the time, which ranged from . to . [ ] . howell et al. [ ] conducted a study that validated piro's utility. the proposed classification system was created based on the variables found to be independently statistically significant associated with mortality, which increased the outcome prediction accuracy. the scoring system was applied to a sample group and to two validation cohorts. results revealed that mortality was strongly related to an increased piro score in all groups, with an auc-roc of . , . and . , respectively. on another study carried out by nguyen et al. [ ] piro performed better (auc-roc = . ) than meds (mortality in emergency department sepsis) and was comparable to the apache ii (acute physiology and chronic health evaluation). li [ ] conducted a study on community-acquired sepsis in which an auc of . for piro -day mortality prediction was reported, outperforming the apache ii. recently, results reported by songsangjinda and khwannimit [ ] on septic patients admitted over a year period, showed that the moreno piro had the best discriminating capacity with an auc-roc of . , outperforming all the other classification systems and only closely followed by sofa (auc-roc = . ). the best discriminative capacity for piro mortality prediction was described by rathour et al. [ ] with an auc of . . the mortality rate on this study was . %, which may indicate an underrepresentation of the death group thus contributing to the results obtained, as sepsis mortality rates have been reported to go up to % and reaching % in the presence of septic shock [ , ] . the relatively narrow range of the total piro score may also have contributed to a worse outcome prediction capacity. future studies should include more parameters to better characterize the systemic inflammatory response and distinguish animals based on severity of illness. the individual assessment of the parameters and how they independently affect the outcome, as well as the addition of other biomarkers [ , ] , that may help to characterize the inflammatory response, could contribute to a better outcome prediction accuracy of the proposed piro scoring system. even though no significant statistical association was found between the total piro score and the outcome in this study, this is the first version of the dog piro model and may serve as reference for future studies. the present study stands as a contribution for the development of a robust and validated classification system for sepsis in dogs. to our knowledge, this is the first study to propose and assess the implementation of a piro classification system in dogs, adapting it from what has been used in human medicine and testing it on a sepsis predisposed population of parvovirus naturally infected dogs. concerning the sirs criteria, this study confirms the potential of including animals with altered mucous membrane colour or prolonged capillary refill time. this increased the system specificity, allowing for the identification of a statistical association with the outcome. this was an attempt to address the need for more specific sepsis related systemic inflammatory criteria. to explore the possibility of using the sirs criteria as a fast decision-making tool, a fast-and-frugal tree (fft) was created. in our study no significant statistical association was found between piro's elements and outcome. nevertheless, it demonstrates that defining and applying a classification system for sepsis suspected canine patients is possible. future studies should include more inflammation and organ dysfunction biomarkers, that may help to characterize each of the piro's components and consequently its´overall performance. further adjustments to overcome the weakness reported in this study are necessary to improve its´outcome prediction capacity and to turn it into a useful tool in the clinical management of sepsis. all patients also diagnosed with other viral infections compatible with acute gastroenteritis, namely, distemper (n = ), infectious canine hepatitis (n = ) and canine coronavirus (n = ), were excluded from the study, amounting to six dogs with dual viral infectious diseases. the same criteria applied to all dogs with concomitant internal parasitic infections (n = ). the remaining dogs excluded from the study population (n = ) missed either the hemogram, biochemistry results, some clinical examination parameters or the outcome. in order to evaluate if a sirs was taking place, the animals were subjected to two sets of criteria. the first set was denominated sirs based upon the originally proposed sirs criteria, still currently used in clinical practice. the values considered for each variable are those described above in the background. the second set of criteria, designated sirs , is a combination of sirs plus crt or mucous membrane colour alteration. sirs was created in an attempt to increase the specificity of said criteria, as suggested by levy et al. [ ] . the proposed criteria applied for the piro scoring, and for each of its' individual components -p, r and o -were extrapolated from an array of bibliographic references, from human and veterinary medicine studies. these criteria were already compiled in a previous study [ ] . the parameters proposed for each of the piro's components are described in tables , and . for predisposition (p) age, breed and vaccination status were considered. response (r) was characterized by temperature, heart rate, respiratory rate and leucocytes count. organ dysfunction (o) by biochemical and clinical markers of renal, cardiovascular, respiratory, hepatic and coagulation system dysfunction. since dogs naturally infected with canine parvovirus were enrolled in this study, all animals had the same infection (i) score (equal to ). the total piro score was obtained by adding all piro's components score. all dogs that participated in this study were clientowned animals and joined the study after owner's written consent and ethical committee approval (cebea). to evaluate the correlation between the fulfilment of the sirs criteria and the outcome, all dogs were classified according to the original sirs and to the proposed sirs criteria. fisher's exact test was used. a % confidence interval was considered. to assess the correlation between the piro scoring and the outcome, the scores for total piro and each of its' components were split into two groups, a fisher's exact test requirement. for each variable, one of the groups contained the dogs in the lower half of the values and the other comprised the animals in the upper half. a % confidence interval was used in fisher's exact test. the third international consensus definitions for sepsis and septic shock (sepsis- ) definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis systemic inflammatory response syndrome: septic shock evaluation of the sensitivity and specificity of diagnostic criteria for sepsis in dogs textbook of small animal emergency medicine apoptosis-induced lymphopenia in sepsis and other severe injuries canine parvoviral enteritis : an update on the clinical diagnosis , treatment, and prevention bacterial translocation in critical illness characterisation of lipid profiles in dogs with parvoviral enteritis sccm/esicm/accp/ats/sis international sepsis definitions conference infectious diseases of the dog and cat modelo canino para sépsis : contribuição para a classificação e estratificação em doentes sépticosno title breed-related risk factors for canine parvovirus enteritis risk factors associated with parvovirus entiritis in dogs: cases ( - ) breed-specific pro-inflammatory cytokine production as a predisposing factor for susceptibility to sepsis in the dog microbial infection and the septic response in critical surgical illness sepsis in veterinary patients: what do we know and where can we go? the predisposition, infection, response and organ failure (piro) sepsis classification system: results of hospital mortality using a novel concept and methodological approach proof of principle: the predisposition, infection, response, organ failure sepsis staging system piro concept: staging of sepsis age-associated changes to pathogen-associated molecular pattern-induced inflammatory mediator production in dogs research in veterinary science factors affecting the occurrence , duration of hospitalization and final outcome in canine parvovirus infection fftrees: a toolbox to create, visualize, and evaluate fast-and-frugal decision trees c-reactive protein , tumor necrosis factor a , and interleukin- in dogs with pyometra and sirs use of oseltamivir in the treatment of canine parvoviral enteritis association between outcome and organ system dysfunction in dogs with sepsis: cases acute renal failuredefinition , outcome measures , animal models , fluid therapy and information technology needs hemostatic changes in dogs with naturally occurring sepsis acute lung injury and acute respiratory distress syndromes in veterinary medicine: consensus definitions : the dorothy russell havemeyer working group on ali and ards in veterinary medicine multiple organ dysfunction syndrome in humans and animals predisposition, insult/infection, response, and organ dysfunction: a new model for staging severe sepsis promoting global research excellence in severe sepsis (progress): lessons from an international sepsis registry comparison of predisposition, insult / infection, response, and organ dysfunction, acute physiology and chronic health evaluation ii , and mortality in emergency department sepsis in patients meeting criteria for early goal-directed therapy and the se evaluation of community-acquired sepsis by piro system in the emergency department comparison of severity score models based on different sepsis definitions to predict in-hospital mortality among sepsis patients in the intensive care comparison of dogs with septic peritonitis : ^ versus changes in salivary analytes in canine parvovirus: a highresolution quantitative proteomic study publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations not applicable. authors' contributions fa and sp performed the experiments and analyzed the data. tn performed the statistical analysis and helped drafting and revising the manuscript. jg, sa and fas helped to perform the experiments and to analyze the data. lt and va contributed to the analysis and interpretation of data. sg conceived the study and participated in its coordination, helped to draft the manuscript and supervised throughout. all authors read and approved the final manuscript. the datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. all dogs that participated in this study were client-owned animals and joined the study after owner's written consent and ethical committee approval approved by the committee for ethics and animal welfare (cebea) of the faculty of veterinary medicine, university of lisbon. not applicable. the authors declare that they have no competing interests. key: cord- -la sy vq authors: liu, chuanmin; wen, libin; xiao, qi; he, kongwang title: nitric oxide-generating compound gsno suppresses porcine circovirus type infection in vitro and in vivo date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: la sy vq background: nitric oxide (no), an important signaling molecule with biological functions, has antimicrobial activity against a variety of pathogens including viruses. to our knowledge, little information is available about the regulatory effect of no on porcine circovirus type (pcv ) infection. this study was conducted to investigate the antiviral activity of no generated from s-nitrosoglutathione (gsno), during pcv infection of pk- cells and balb/c mice. results: gsno released considerable no in the culture medium of pk- cells, and no was scavenged by its scavenger hemoglobin (hb) in a dose-dependent manner. no strongly inhibited pcv replication in pk- cells, and the antiviral effect was reversed by hb. an in vivo assay indicated that gsno treatment reduced the progression of pcv infection in mice, evident as reductions in the percentages of pcv -positive sera and tissue samples and in the viral dna copies in serum samples. gsno also improved the growth performance and immune organs (spleens and thymuses) of the pcv -infected mice to some degree. conclusions: our data demonstrate that the no-generating compound gsno suppresses pcv infection in pk- cells and balb/c mice, indicating that no and its donor, gsno, have potential value as antiviral drugs against pcv infection. porcine circovirus type (pcv ), which belongs to the family circoviridae, is a small, non-enveloped virus with a circular, single-stranded dna genome [ ] . pcv is the primary causative agent of porcine circovirus-associated disease (pcvad) [ ] , a globally emerging disease, currently causing great economic losses in the global swine industry today [ ] . the most significant pathological conditions considered to be pcvads are post-weaning multisystemic wasting syndrome, porcine dermatitis and nephropathy syndrome, and pcv -reproductive disease [ , ] . pcv -infected piglets are readily contract concomitant infections, including porcine respiratory and reproductive syndrome virus, porcine parvovirus and haemophilus parasuis, suggesting that pcvad is actually an immunosuppressive disease [ ] . besides piglets, mice and calves are also found to be able to infect this virus [ , ] . the control of pcvd is based on management strategies, control of coinfections, and vaccination [ ] . vaccination is traditionally considered the most effective method for preventing viral diseases, but the period of protection afforded by a vaccine is limited and the virus cannot be eradicated by vaccination [ ] . furthermore, no effective vaccines are available for preventing multifactorial diseases such as pcvad [ ] . therefore, alternative effective measures to control the disease are urgently required. no is an important molecule with key roles in a broad range of biological processes including neurotransmission, vasodilatation and immune responses [ ] . no is generated by mammalian cells from the guanidino nitrogen of l-arginine in a reaction catalyzed by a family of no synthase enzymes [ ] . no can also be released from exogenous donors, such as sodium nitroprusside (snp), s-nitroso-acetylpenicillamine (snap) and gsno [ ] . previous studies have presented considerable evidence that no can prevent viral infections [ ] [ ] [ ] [ ] [ ] [ ] . however, the antiviral effects of no against pcv infection are so far poorly studied. in this study, the no-generating compound gsno was used to analyze the kinetics of no production in the culture supernatant of pk- cells. the antiviral activity mediated by gsno during pcv infection was also investigated in pk- cells and balb/c mice. pcv-free pk- cells, purchased from the china institute of veterinary drug control (beijing, china), were grown at °c in an atmosphere of % co in dulbecco's modified eagle's medium (dmem; sigma, usa) supplemented with % fetal bovine serum (gibco, usa) and % penicillinstreptomycin antibiotics (sangon, china). the pcv -haian strain (genbank accession number: fj . ) is maintained by institute of veterinary medicine, jiangsu academy agricultural sciences, jiangsu, china. pcv was propagated in pk- cells, harvested after incubation for h, and stored at − °c until use. the safe concentrations of the drugs were determined in pk- cells with a -( , -dimethylthiazol- -yl)- , -diphenyltetrazolium bromide (mtt) assay, and the kinetics of no production in the culture supernatant were assessed from to h after drug treatment. to investigate the antiviral activity of the no-generating compound gsno during pcv infection in vitro, % confluent pk- cells in -well cell culture plates were pretreated with gsno or gsno plus hemoglobin (hb) for h, and then infected with pcv (multiplicity of infection (moi) of ) in the presence of the drugs for an additional h. untreated cells, cultured in medium alone, were used as the mock control, and cells infected with pcv alone (moi = ) were used as the pcv infected control. the antiviral activity of gsno was determined from the appearance of pcv -infected cells, viral titers, and pcv dna copy numbers. the no levels in the various groups were also determined. seventy-eight -week-old specific-pathogen-free balb/c mice were purchased from the comparative medicine centre, yangzhou university, jiangsu, china. the mice were maintained in isolation rooms, in which the temperature was maintained at °c under a -h light cycle. the experimental animals were allowed to acclimatize for days. the protocols for the care and use of animals in this study were approved by the committee on the ethics of animal experiments of jiangsu academy of agricultural sciences. the mice were randomly divided into three groups, each containing animals. the mice in group i were injected intraperitoneally with . ml of phosphate-buffered saline (pbs) and intranasally with . ml of pbs, and used as negative control(nc). mice in group ii were inoculated intraperitoneally with . ml of pcv ( tcid /ml) and intranasally with . ml of pcv ( tcid /ml), and used as the pcv -infected control. the mice in group iii were inoculated intraperitoneally with . ml of pcv ( tcid /ml) and intranasally with . ml of pcv ( tcid /ml), and injected intraperitoneally with . ml of gsno ( mm) once daily from to days postinoculation (dpi). to exclude the stress induced by the injection, the mice in groups i and ii were also injected intraperitoneally with . ml of pbs once daily at - dpi. at - , , , , , and dpi, all the mice were weighed, and necropsies were performed on four mice from each group. at dpi, blood samples were withdrawn from the orbital venous plexus of each mouse to isolate serum for the detection of no. at the time of necropsy, serum samples and tissue samples were collected and stored at − °c for pcv polymerase chain reaction (pcr) or real-time pcr. the spleen and thymus from each killed mouse were weighed to calculate the organ indexes. the mice were monitored daily and evaluated for clinical signs throughout the trial. in this study, we used gsno (sigma, usa) as the exogenous no donor; hb (sigma, usa), as the no scavenger to scavenge the no released from gsno. the cytotoxicity of the drugs was evaluated with a mtt assay. in brief, pk- cells were seeded in -well cell culture plates at a density of × cells/well. when the cells in each well reached % confluence, they were washed twice with pbs and treated with different concentrations of the drugs as serial two-fold dilutions, with eight wells for each concentration. after incubation for h, the viability of pk- cells was evaluated with a colorimetric mtt assay, as reported previously [ ] . the absorbance at nm (a ) of each well was measured with a microliter enzyme-linked immunosorbent assay reader (sunrise, tecan co., switzerland). no production was measured with a colorimetric assay using the griess reaction [ ] . briefly, at various time points during cell culture, the supernatants ( μl/well) were harvested, and incubated with an equal volume of griess solution ( % sulfanilamide, and . % naphthyl ethylene diamine dihydrochloride in % phosphoric acid) (sigma, usa) for min at room temperature. the absorbance was read at nm, and the concentrations of no were determined from a least squares linear regression analysis of a standard curve for sodium nitrite. pcv -based ifa was performed according to previously described procedures [ ] . in brief, cells were fixed in frozen methanol at °c for - min. the fixed cells were washed with pbs, and incubated with porcine anti-pcv antibody (vmrd, usa) at °c for h. the cells were washed with pbs again, incubated with fitcconjugated goat anti-pig antibody (abcam, uk) at °c for min, washed again with pbs, and examined under a fluorescence microscope (olympus, japan). the cells positive for pcv viral antigens were counted in six fields of view. samples collected from the cell culture plates were frozen and thawed three times, then serially diluted -fold in dmem ( : to : ). pk- cells were seeded in -well plates, and when the cells in each well reached %- % confluence, they were inoculated with the diluted samples, with eight wells used for each dilution. after incubation for h, the pcv -positive samples were detected by ifa, as mentioned above, and the viral titers were calculated by reed-muench method [ ] . dna was extracted by using the column viral dnaout kit (tiandz, beijing, china), according to the manufacturer's instructions. the total dna was stored at − °c until use. to evaluate pcv viremia or viral loading in the pcv infected tissues of mice, a pair of primers was designed based on the published sequences of pcv (forward primer ′-ttaccggcgcacttcggcag- ′, reverse primer ′-actccgttgtccctgagat- ′), and pcr was performed with the thermal cycling parameters: °c for min followed by cycles of °c for min, °c for min, and °c for . min, with a final extension step for at °c for min. the pcr products were subjected to electrophoresis on a % agarose gel. to analyze the viral dna copy numbers in the cell and serum samples, primers and a taqman probe specific for the pcv sequence were designed: forward primer ′-taaatctcatcatgtccacattcca- ′, reverse primer ′-cgttaccgctggagaaggaa- ′ and taqman probe ′- the differences among different treatment groups were analyzed and compared by one-way analysis of variance (anova), followed by a least-significant difference test, using the statistical package spss ver. . for windows. a value of p < . was considered statistically significant. as shown in fig. a , the a value of pk- cells treated with μm gsno did not differ significantly from that of the control cells in the mtt assay (p > . ). therefore, μm gsno was used as a safe fig. cytotoxicity of gsno and hb on pk- cells tested by mtt assay. after incubation with the drugs for h, mtt was added into each well. the cells were cultured for another h, and μl dmso was added into each well for dissolving formazan, then a of the samples were determined by a microplate reader. relative viability was calculated according to the equation: relative viability (%) = a of the drug-treated sample / a of the untreated sample × . data shown were means ± sd from three independent experiments. a cytotoxicity of gsno on pk- cells. b cytotoxicity of hb on pk- cells. * p < . , ** p < . vs untreated control group concentration for the cells in this study. the safe concentration of hb for pk- cells was determined to be μm (fig. b) . to determine the kinetics of no production, the supernatants of the samples from -well cell culture plates was collected at different time points after drug treatment, and the no levels were assayed by the griess reaction. the no production was significantly higher in gsno-treated groups, with or without pvc infection, than the control group (p < . ; figs. and b) . the no levels tended to increase in the gsno-treated groups at - h after drug treatment, reaching a plateau at around h (fig. ) . however, the no generated from gsno was effectively and dose-dependently scavenged by the noscavenger hb (fig. b) . the inhibitory effect of the no-generating compound gsno on pcv replication was shown in fig. . the pcv -positive cells detected by ifa indicated that treatment with gsno reduced the progression of pcv infection (fig. a) . the percentage of pcv -infected cells decreased to . % after treatment with μm gsno relative to the infected control (p < . ; fig. c ), whereas the percentage of pcv -infected cells in the groups incubated with μm gsno plus , , or μm hb was . %, . % or . % respectively (fig. c) . the viral titers and viral dna copy numbers in the pcv -infected groups decreased significantly after gsno treatment relative to those in the pcv -infected control (p < . or p < . ; fig. d, e) . however, the reductions in the viral titers and viral dna copy numbers induced by gsno were dose-dependently reversed by the no scavenger hb (fig. d, e) . all the mice survived pcv inoculation with or without gsno treatment and none of the mice were clinically affected during the study. there were no obvious gross lesions in the tissues of the experimental animals. gsno treatment caused a significant increase in serum no levels in the mice during pcv infection (p < . ; fig. ). as shown in fig. a , the average daily weight gain (adwg) tended to decrease in the pcv -inoculated control mice at - dpi, and was lower than that in the nc mice (p > . ). however, the adwg of the pcv inoculated mice treated with gsno was significantly higher than that of pcv -inoculated control mice (p < . ) at and dpi. an analysis of the kinetics of spleen index (si) and thymus index (ti) demonstrated some gsno-induced improvement in the mouse spleens and thymuses during pcv infection from − to dpi. as shown in fig. b and c, si and ti were significantly higher in the gsno-treated mice at dpi than that in the untreated mice during pcv infection (p < . or p < . ). si of the pcv -inoculated control mice also decreased significantly at , and dpi compared with that of the nc mice (p < . or p < . ) (fig. b) , whereas ti decreased significantly in the pcv -inoculated control mice at dpi (p < . ; fig. c ). however, there were no significant differences in the si and ti of the gsno-treated mice and nc mice at − - dpi (p > . ). throughout the experiment, all the serum samples obtained from the nc mice were negative for pcv specific nucleic acids when analyzed by gel-based pcr and quantitative real-time pcr assays. in the pcv inoculated mice, pcv dna was detected by gel-based pcr in the pooled tissue samples and serum samples, and pcv dna was determined in % ( / ) of the tissue samples and in % ( / ) of the serum samples from the pcv -inoculated control mice between and dpi (tables and ) . however, the percentages of pcv -positive tissue samples and serum samples from the gsno-treated mice infected with pcv decreased to % ( / ) and % ( / ) respectively (tables and ). significant differences were also noted in the pcv positive tissue samples (p = . ) and pcv -positive serum samples (p = . ) from the pcv -inoculated control mice and pcv -inoculated mice treated with gsno (tables and ). as described in fig. , the number of pcv dna copies reached a plateau at dpi, but declined to some extent between and dpi in the pcv -inoculated mice treated with or without gsno. fig. kinetics of no production in the culture supernatants of pk- cells. when % confluent monolayers formed, μm gsno or μm gsno plus hb ( , , μm) were added into -well cell culture plates, with four wells for each concentration, and untreated cells served as the control. the supernatant from each sample was collected at different time points, and the no levels were determined by griess reaction with a microplate reader at nm according to a standard curve made from sodium nitrite. data were presented as means ± sd from three independent experiments. *p < . , **p < . vs μm gsno-treated group however, at - dpi, the number of pcv dna copies xwas significantly lower in the pcv -inoculated mice treated with gsno at each time point compared with those in the pcv -inoculated control mice (p < . ; fig. ). no, an important cellular messenger, is involved in complex and diverse functions in various physiological and pathological processes, displaying a broad spectrum of antimicrobial activities in vitro and in vivo [ ] . in this study, we verified the antiviral activity of the nogenerating compound gsno during pcv infection in pk- cells and balb/c mice. the in vitro experiment showed that treatment with gsno induced significant declines in pcv -infected cells, viral titers and viral dna copy numbers compared with those of the pcv -infected samples, whereas the effect of gsno was dose-dependently reversed by the no scavenger hb. these results demonstrate that the fig. effects of gsno on pcv replication in pk- cells. when monolayers reached about % in each well of -well cell culture plates, the cells were incubated with μm gsno or μm gsno plus hb ( , , μm) for h, with four wells for each treatment, then the cells were infected with pcv ( moi) in the presence of various drugs for another h. non-treated cells served as the mock, and the infected cells without drug treatment were considered as the pcv -infected control. pcv -positive cells were detected by ifa (a), and the appearance of infected cells was judged by fitc staining intensity. the culture supernatant from each well was collected for determination of no production (b), in addition, the cells in each sample were also gathered for assay of the percentage of infected cells (c), virus titers (d), and viral dna copies (e). relative infected cells (%) = number of pcv -positive cells from experimental samples / number of pcv -positive cells from pcv -infected control × . data were presented as means ± sd from three independent experiments. *p < . , **p < . vs pcv -infected control no donor gsno exerts significant antiviral activity against pcv replication in pk- cells. similarly, in previous studies, the no donor snap has been shown to block the replication of severe acute respiratory syndrome coronavirus (sars coronavirus) [ ] , porcine parvovirus [ ] and porcine respiratory coronavirus [ ] . although the inhibition of pcv by no was clearly demonstrated here, it is unclear whether the antiviral effect of the no donor gsno was actually attributable to other factors. to address this question, convincing evidence has been presented in this study. first, the data from a mtt assay clearly excluded the possibility that antiviral effects of the no donor gsno on pcv replication might have resulted from its toxicity to the cells. second, gsno generated no in the culture supernatant of pk- cells and no dose-dependently suppressed pcv replication. finally, the inhibitory effect of gsno on pcv replication was reversed by the no scavenger, hb. overall, these results strongly suggest that no, generated from the donor gsno, inhibits the replication of pcv in pk- cells. the mechanisms involved in the antiviral properties of no have partly been clarified in previous studies, which have suggested that no plays important roles in the regulation of a viral protease [ ] , the innate immunity of the host [ ] , and the synthesis of viral proteins and nucleic acids [ ] . depending on its concentration, no exerts its antimicrobial effects in two ways: at low concentrations, no acts as a signaling molecule that promotes the growth and activity of immune cells, whereas at high concentrations, no covalently binds dna, proteins and lipids, thereby inhibiting or killing the target fig. no production in serum from the experimental mice. at dpi, serum samples were obtained from six mice in each group for no detection by griess reaction. data were presented as means ± sd. **p < . vs infected control fig. kinetics of adwg, si and ti from the experimental mice. four samples were obtained from each group at the time of necropsy. a adwg (g/day) = (final weightinitial weight) / days; b si =spleen weight (g) / the weight of mice (g) × . c ti =thymus weight (g) / the weight of mice (g) × . kinetics of adwg, si and ti demonstrated that, to some extent, gsno improved growth performance and protected the immune organs (spleens and thymuses) of the mice during pcv infection. data were presented as means ± sd. * p < . , ** p < . vs pv -inoculated control; # p < . , ## p < . vs nc pathogen [ ] . the antiviral activity of no against pcv was demonstrated in vitro by its reduction of the numbers of virus-infected cells, viral titers and dna copy numbers. the decline in the number of virally infected cells is probably attributable to the blockage of viral penetration to the cytoplasm or to the suppression of transcriptional steps mediated by no [ ] , whereas the reduced viral titers and viral dna copy numbers are probably attributable to the inhibition of viral protein and nucleic acid synthesis by no [ ] . however, the binding, cell entry and transcription characteristics of pcv that are influenced by no were not investigated in this study. therefore, the mechanisms underlying the inhibition of pcv replication by no remain to be evaluated in future studies. although the antiviral activity of gsno was clearly demonstrated in vitro, in vivo studies are also essential to confirm the effects of gsno on pcv infection under clinical conditions. mice, including balb/c, c bl/ , c h/hej and kunming mice, are susceptible to pcv , although susceptibility to pcv is limited among the above-mentioned mouse lines [ ] [ ] [ ] . therefore, the mouse is important in the epidemiology of pcv and can be used as an experimental model of pcv . in this study, balb/c mice were artificially inoculated with pcv and treated with or without gsno. our data showed that gsno treatment released a large amount of no, which contributed to the effective inhibition of pcv replication in the mice. the poor growth performance and immune organ (spleen and thymus) dysfunction induced by pcv infection were also improved to some extent by gsno. previous reports have demonstrated that dietary l-arginine supplementation induces significant increase in serum no production and suppresses pcv infection in mice [ , ] , suggesting that the antiviral effects of l-arginine are predominantly mediated by no because l-arginine is the sole substrate for no synthesis [ ] . this hypothesis was confirmed in our in vivo study, because gsno was the exogenous no donor and released no in mice. although no weight loss or wasting was observed in the pcv -inoculated mice, as has been described previously, the adwg of the mice infected with pcv decreased to some extent in the present study, which might be be attributable to the different mouse line used there. since kiupel et al. ( ) demonstrated that pcv induces apoptosis by activating caspases and in the spleens of infected mice [ ] . therefore, the impaired immune organs detected in the pcv -inoculated control mice in our study might be attributable to the apoptosis induced by pcv . interestingly, the gsno treatment improved growth performance and protected the immune organs (spleen and thymus) of the pcv -inoculated mice. as we know, no acts as a key molecule in inflammation and the immune response [ , ] , so the no-generating compound gsno may play a critical role in the regulation of inflammation and immunity during pcv infection, as well as inhibiting pcv replication, in mice. more research is required to confirm this hypothesis. gsno, an exogenous no donor, released no into the culture supernatants of pk- cells and the sera of balb/c mice. the antiviral effects of gsno on pcv were also demonstrated in both pk- cells and balb/c mice. as well as the significant inhibition of pcv , gsno also positively regulated the growth performance and immune organs of the pcv -infected mice. therefore, no and its donor gsno have potential valve as antiviral the tissue pools consisted of liver, thymus, lung and spleen. data were presented as number of pcv pcr positive tissue pools/total number tissue pools analyzed reagents during pcv infection. however, the mechanisms underlying the antiviral activity of gsno remain to be investigated in our future studies. the effects of gsno on pcv infection in the target animal, the pig, must also be evaluated. a very small porcine virus with circular single-stranded dna porcine circovirus type associated disease: update on current terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies porcine circovirus type and porcine circovirus-associated disease epidemiology and transmission of porcine circovirus type (pcv ) porcine circovirus type (pcv ) infections: clinical signs, pathology and laboratory diagnosis porcine circovirus type activates pi k/akt and p mapk pathways to promote interleukin- production in macrophages via cap interaction of gc qr viral distribution and lesions in kunming mice experimentally infected with porcine circovirus type b susceptibility of calves to porcine circovirus- (pcv ) recent advances in the epidemiology, diagnosis and control of diseases caused by porcine circovirus type can porcine circovirus type (pcv ) infection be eradicated by mass vaccination? matrine displayed antiviral activity in porcine alveolar macrophages coinfected by porcine reproductive and respiratory syndrome virus and porcine circovirus type dual effect of nitric oxide on sars-cov replication: viral rna production and palmitoylation of the s protein are affected nitric oxide synthases, s-nitrosylation and cardiovascular health: from molecular mechanisms to therapeutic opportunities (review) nitric oxide: a key regulator of myeloid inflammatory cell apoptosis astrovirus-induced synthesis of nitric oxide contributes to virus control during infection nitric oxide inhibits the replication cycle of severe acute respiratory syndrome coronavirus nitric oxide and peroxynitrite have different antiviral effects against hantavirus replication and free mature virions ifn-γ production depends on il- and il- combined action and mediates host resistance to dengue virus infection in a nitric oxide-dependent manner the nitric oxide pathway provides innate antiviral protection in conjunction with the type i interferon pathway in fibroblasts control of early theiler's murine encephalomyelitis virus replication in macrophages by interleukin- occurs in conjunction with stat activation and nitric oxide production nitric oxide is involved in the upregulation of ifn-γ and il- mrna expression by cd + t cells during the blood stages of p. chabaudi as infection in cba/ca mice a candidate inactivated chimeric vaccine pcv - constructed based on pcv and pcv isolates originating in china and its evaluation in conventional pigs in regard to protective efficacy against pcv infection a simple method of estimating fifty percent endpoints nitric oxide and virus infection nitric oxide inhibits the replication cycle of porcine parvovirus in vitro nitric oxide is elicited and inhibits viral replication in pigs infected with porcine respiratory coronavirus but not porcine reproductive and respiratory syndrome virus an antiviral mechanism of nitric oxide: inhibition of a viral protease the potential of nitric oxide releasing therapies as antimicrobial agents a radical form of nitric oxide suppresses rna synthesis of rabies virus viral replication and lesions in balb/c mice experimentally inoculated with porcine circovirus isolated from a pig with postweaning multisystemic wasting disease limited susceptibility of three different mouse (mus musculus) lines to porcine circovirus- infection and associated lesions a mouse model to study infection against porcine circovirus type : viral distribution and lesions in mouse dietary l-arginine supplementation improves the immune responses in mouse model infected porcine circovirus types effect of dietary arginine supplementation on reproductive performance of mice with porcine circovirus type infection l-arginine, the natural precursor of no, is not effective for preventing bone loss in postmenopausal women porcine circovirus type (pcv ) causes apoptosis in experimentally inoculated balb/c mice nitric oxide in immunity and inflammation spotlights on immunological effects of reactive nitrogen species: when inflammation says nitric oxide all data is presented in this article and available upon request. authors' contributions kwh directed the research, reviewed the data and manuscript; and directed revisions. cml conducted research, compiled data, and wrote paper. lbw provided clinical diagnostics and participated in drafting the manuscript. qx was involved in data analysis and participated in drafting the manuscript. all authors have read and approved the manuscript. the authors declare that they have no competing interest. not applicable. the protocols for the care and use of animals in this study were approved by the committee on the ethics of animal experiments of jiangsu academy of agricultural sciences. submit your next manuscript to biomed central and we will help you at every step: key: cord- -qqohijqi authors: smith, jacqueline; sadeyen, jean-remy; cavanagh, david; kaiser, pete; burt, david w. title: the early immune response to infection of chickens with infectious bronchitis virus (ibv) in susceptible and resistant birds date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: qqohijqi background: infectious bronchitis is a highly contagious respiratory disease which causes tracheal lesions and also affects the reproductive tract and is responsible for large economic losses to the poultry industry every year. this is due to both mortality (either directly provoked by ibv itself or due to subsequent bacterial infection) and lost egg production. the virus is difficult to control by vaccination, so new methods to curb the impact of the disease need to be sought. here, we seek to identify genes conferring resistance to this coronavirus, which could help in selective breeding programs to rear chickens which do not succumb to the effects of this disease. methods: whole genome gene expression microarrays were used to analyse the gene expression differences, which occur upon infection of birds with infectious bronchitis virus (ibv). tracheal tissue was examined from control and infected birds at , and days post-infection in birds known to be either susceptible or resistant to the virus. the host innate immune response was evaluated over these days and differences between the susceptible and resistant lines examined. results: genes and biological pathways involved in the early host response to ibv infection were determined andgene expression differences between susceptible and resistant birds were identified. potential candidate genes for resistance to ibv are highlighted. conclusions: the early host response to ibv is analysed and potential candidate genes for disease resistance are identified. these putative resistance genes can be used as targets for future genetic and functional studies to prove a causative link with resistance to ibv. electronic supplementary material: the online version of this article (doi: . /s - - - ) contains supplementary material, which is available to authorized users. infectious bronchitis (ib) is a highly contagious respiratory disease of chickens first described in the usa in the 's [ ] [ ] [ ] . clinical signs include: coughing, sneezing, rales and nasal discharge. the disease can also affect the reproductive organs, which leads to a decrease in egg quality and production, thus making it a major cause of economic losses within the poultry industry [ ] . the causative virus, infectious bronchitis virus (ibv) is a coronavirus, which is an enveloped virus with a single positive-stranded rna genome, which replicates in the host cell cytoplasm [ ] . proteins encoded by ibv include the viral rna polymerase, structural spike proteins, membrane and nucleocapsid and various other regulatory proteins. the spike glycoprotein mediates cell attachment and plays a significant role in host cell specificity [ ] . the existence of many different ibv serotypes, which are not cross-protective means that control of ib, is very difficult. mortality is usually fairly low (~ %), however some strains of the virus can also cause nephritis meaning that, depending on strain, mortality can be greater than % [ , ] or even up to % with some australian isolates [ ] . ibv infection leaves birds more susceptible to colibacillosis [ ] and subsequent bacterial infections can also lead to a high level of mortality [ ] . currently, attenuated live vaccines are used in broilers and pullets, and killed vaccines are used in layers and breeders [ ] . however, virus control is very difficult, as there are only a few vaccine types and many different strains of ibv. the virus also continues to mutate rapidly, generating more virulent strains of the disease [ ] [ ] [ ] . coronaviruses have now also been detected in other avian species such as turkey, duck, goose, pheasant, guinea fowl, teal, pigeon, peafowl and partridge [ ] . the extent to which the virus affects the host is highly dependent on the chicken breed [ ] and the mhc b locus is known to play a role in susceptibility to the virus [ ] . in this study we attempt to identify non-mhc genes, which may be involved in resistance to ibv. no genetic analyses have thus far been undertaken in order to try and do this and no quantitative trait loci or genes associated with resistance have been determined, so far. based on differential gene expression in susceptible and resistant lines of chickens, we identify potential candidate genes for disease resistance towards ibv (virulent m strain). building on the previous work by dar et al. [ ] and wang et al. [ ] we used affymetrix wholegenome chicken microarrays to examine the tracheal gene expression profiles of a line of birds known to be susceptible to ibv infection (line i) and a line known to show resistance (line n). we determined the early host response to infection and propose possible candidate genes for involvement in disease resistance towards ibv. understanding how coronaviruses infect the host and identifying genes involved in resistance is important not only for the poultry industry but also has important implications for human health, as diseases such as sars are also caused by coronaviruses [ , ] . all animal work was conducted according to uk home office guidelines and approved by the roslin institute animal welfare and ethical review body. the lines used in these experiments are an ibv susceptible lineline i (inbred white leghorn strain) [ ] and an ibv resistant lineline n (non-inbred cornell strain). line i was developed at east lansing in the usa in the s [ ] and line n at cornell, usa in the s [ ] . the lines have since been maintained at the institute for animal health in compton, uk. twoweek-old chicks from each line ( i and n) were separated into two experimental rooms, with ad libitum access to food and water. in one room, birds ( from each line) were infected with log cid ( cid ) of virulent ibv-m strain in a total of μl of . % bsa in pbs equally by intra nasal and ocular routes. in the other room, control birds ( from each line) received ul pbs via the same route. trachea samples (upper half ) were collected at , and days postinfection ( individual birds from each line at each time point). the trachea of infected and control birds from each line were analysed for viral load using taqman real-time quantitative rt-pcr assays. tissue samples (~ mg) were stabilized in rnalater (ambion, life technologies, paisley, uk) and disrupted using a bead mill (retsch mm , retsch, haan, germany) at hz for min. total rna was prepared using an rneasy kit (qiagen, crawley, uk) extraction method as per the manufacturer's protocol. samples were resuspended in a final volume of μl of rnasefree water. concentrations of the samples were calculated by measuring od and od on a spectrophotometer (nanodrop, thermo scientific, paisley, uk). quality of the rna was checked on a bioanalyser (agilent technologies, south queensferry, uk). an rna integrity number (rin) > proved the integrity of the rna. biotinylated fragmented crna was hybridized to the affymetrix chicken genome array. this array contains comprehensive coverage of , transcripts corresponding to over , chicken genes. the chicken genome array also contains probe sets for detecting transcripts from avian viruses. for each experimental group (control and infected birds in each of the two lines at each of , and dpi), three biological replicates ( rna pools from birds) were hybridized. thus, arrays were used in total. hybridization was performed at °c for hours in a hybridization oven with constant rotation ( rpm). the microarrays were then automatically washed and stained with streptavidin-phycoerythrin conjugate (sape; invitrogen, paisley, uk) in a genechip fluidics station (affymetrix, santa clara, ca). fluorescence intensities were scanned with a genearray scanner (affymetrix, santa clara, ca). the scanned images were inspected and analyzed using established quality control measures. array data have been submitted to array express (http://www.ebi.ac.uk/arrayexpress/) under the accession number e-tabm- . gene expression data generated from the genechip operating software (gcos) was normalised using the plier (probe logarithmic intensity error) method [ ] within the affymetrix expression console software package. this normalised data was then analysed using the limma and farms [ ] packages within r in bioconductor [ ] . probes with a false discovery rate (fdr) value < . and a fold change ≥ . were deemed to be biologically significant. in order to determine which biological pathways are involved in the responses to viral infection, we analysed our differentially-expressed (de) genes using pathway express [ , ] which uses kegg pathways [ ] to pictorially display up/down regulation of genes. (nb. these diagrams are based on the human pathways and so are not completely representative of the chicken pathways). genes differentially expressed during the host response (fdr < . ) were analysed against a reference background consisting of all genes expressed in the experiment. factors considered by pathway express include the magnitude of a gene's expression change and its position and interactions in any given pathway, thus including an 'impact factor' when calculating statistically significant pathways. anything with a p-value < . is deemed significant when using this software. use of the ingenuity pathway analysis (ipa) program [ ] revealed which canonical pathways are being switched on by ibv infection in the host (with benjamini-hochberg multiple testing correction) and allowed us to analyze the gene interaction networks involved in the host response. genes were clustered by similar expression pattern and analysed for enriched go-terms and transcription factor binding sites (tfbs) using expander (v . ) [ ]. normalised expression data from control samples were compared with infected samples to examine the host response to ibv infection. enrichment analysis of particular go terms or tfbs within clusters was done using the tango and prima functions, respectively, within the expander package. taqman real-time quantitative rt-pcr (qrt-pcr) was used to quantify viral rna levels and for confirmation of the microarray results for the mrna levels of selected genes. this was performed on replicate pools of samples ( birds). primers (sigma) and probe (pe applied biosystems, warrington, uk) ( table ) were designed using primer express (pe applied biosystems). briefly, the assays were performed using μl of total rna and the taqman fast universal pcr master mix and one-step rt-pcr mastermix reagents (pe applied biosystems) in a μl reaction. amplification and detection of specific products were performed using the applied biosystems fast real-time pcr system with the following cycle profile: one cycle at °c for min and °c for sec, followed by cycles at °c for sec and °c for sec. data are expressed in terms of the cycle threshold (ct) value, normalised for each sample using the ct value of s rrna product for the same sample, as well described previously [ ] [ ] [ ] . final results are shown as -ct using the normalised value, or as fold-change from uninfected controls. taqman real-time quantitative rt-pcr analysis was used to measure viral load in trachea samples from both control and infected birds from both lines i and n. tracheal tissue was chosen for examination in this study as the target of ibv is the epithelial surface of the respiratory tract. viral rna was detected in infected birds, but no significant difference in viral load was detected between lines at any of the days , or post infection (fig. ) . this would indicate that the resistance to the virus seen in line n is due to how the birds respond to the virus once it has entered the body and is not a measure of how the birds can prevent initial infection by the virus itself. when resistance to ibv infection was originally determined in these lines, it was noted that they were equally susceptible to infection, but a variation in outcome was seen. in line n, % of birds showed air sac lesions whereas % of i birds presented lesions. mortality was in line n, but % within line i birds. it was hypothesized that the different lines were producing different immunological responses upon infection [ ] . gene expression differences found in the susceptible i line between infected and control birds over days , and post infection were analysed, with a view to examining the innate host response to infection by ibv. genes seen to be induced during the host response to infection include c s, irf , stat , mx , tlr and ctss as previously recognised by guo et al. [ ] . we also identified ifit , oasl, sca , lyg , isg - , ddx , ifih , irf , table s . to elucidate which biological pathways are being perturbed during the host response to ibv infection, we analysed our data using pathway express [ ] . the resulting pathway diagrams are extremely useful in establishing which gene networks are involved in a particular experimental response. as seen in fig. , genes involved in antigen presentation and the toll-like receptor (tlr) pathway are up-regulated. tlrs identify pathogen associated molecular patterns (pamps) and are crucial to the innate immune system. in this study tlr is shown to be induced at dpi. tlr recognizes double-stranded rna intermediates produced during viral replication and has previously been shown to be induced in the trachea at this time after ibv infection [ ] . another pathway involved is the phosphatidylinositol signalling pathway (table ) . phosphatidylinositol kinases are known to play an important role in the viral life cycle after infection of the host and pi kb is known to be exploited by coronaviruses for viral entry. the product of pi kb catalysis is phosphatidylinositol -phosphate (pi p) and coronavirus entry into the host is mediated by the pi p lipid microenvironment [ ] . genes involved in the complement system are also highlighted as being up-regulated in response to ibv infection. complement-mediated lysis of viruses is an important facet of the host innate immune system and its role in defence against viral infection [ ] as reflected in the induction of these genes in this study. use of ingenuity pathway analysis (ipa) software also allowed us to determine which biological systems are active during the host response. up-regulated genes are seen to be part of the canonical biological pathways shown in fig. a . biological processes involving pattern recognition receptors and interferon signalling feature heavily. the interferon response is a powerful antiviral mechanism, which has previously been shown to be involved in the host response after ibv infection. a very early induction of ifn-γ has been reported in splenocytes [ ] , and in peripheral blood mononuclear cells (pbmcs) and lung leukocytes [ ] . ifnb expression has also been reported in trachea between and dpi [ ] . we do not see this increase in expression of interferon genes (due to the absence of data earlier than dpi), but we do see the downstream effects, with increased expression of many interferon-induced genes. specific physiological processes activated upon ibv infection can also be seen in fig. b . the stimulation of various different immune cells is seen along with the indication of reproductive abnormality, which would reflect the problems seen with egg-laying upon ibv infection. in order to cluster genes seen to be involved in the host response to infectious bronchitis into groups with similar expression profiles and probably sharing similar functions or gene regulatory pathways, we utilised the click algorithm within the expander program [ ] . figure a shows the expression profile of genes upregulated during the response to virus. the expander program was also used to analyse the gene ontology (go) functional annotations of the genes being differentially expressed. figure b shows the biological process terms, which are significantly enriched in the genes responding during the host response to infection. as would be expected, these include terms like 'innate immune response' and 'antigen processing and presentation'. 'nad + adp-ribosyltransferase activity' and 'phosphoinositide binding' are also highlighted. transcription factor binding sites present in de genes which are significantly over-represented were also predicted. figure c shows that genes up-regulated during the host response have a high proportion of irf and isre binding sites. irf is a transcriptional activator, which binds to the interferon-stimulated response element (isre) in ifn promoters and functions as a molecular switch for antiviral activity. analysis of the gene expression differences between infected and control birds across the two lines has provided us with information on how these lines differ in their response to infection. examination of the gene expression profiles in the control birds of the two different lines also allowed us to identify genes, which are inherently different between the susceptible and resistant birds. it can be seen that there are numerous genes, which show large expression differences between the two lines, even before infection. dramatic differences in gene expression of certain genes, including ddt, sri, blb , hscb, bf , bf , suclg , mx and sri, which are more highly expressed in the resistant n line table s shows all de probes) so, it can be seen that these are genes which have inherently different expression levels between susceptible and resistant birds, even before infection occurs. we therefore postulate that some of these genes may play an important role in disease resistance. the potential interactome of ibv has recently been investigated by stable isotope labelling with amino acids in cell culture (silac) coupled to a green fluorescent proteinnanotrap pull-down methodology [ ] . host proteins, which bind to the ibv n protein were identified, some of the genes for which, we see as being inherently expressed at higher levels in susceptible birds in this study. these genes include myh , caprin , dhx , hnrnph , rpl a, fmr , c orf , hnrpdl, sfrs , rpl , npm and rpsa. this may therefore be one of the reasons why line i is more susceptible to ibv infectionthere are more host proteins to which the virus binds, compared with the resistant line n. upon infection, differences in response are also seen between the two lines. interestingly, apart from cd and cd at dpi and fkbp at dpi, all other differential gene expression between the lines is seen at dpi in this study (additional file : table s ). cd is a glycoprotein found on the surface of many immune cells including cd +, cd +, b lymphocytes and natural killer cells and is a marker of cell activation. it functions in cell adhesion, signal transduction and calcium signalling. cd is found on the surface of immune cells such as t helper cells, monocytes, macrophages and dendritic cells. it is a membrane glycoprotein which interacts with mhcii antigens. the protein functions to initiate or augment the early phase of t-cell activation. the protein encoded by fkbp is a member of the immunophilin protein family, which play a role in immuno-regulation and basic cellular processes involving protein folding and trafficking. early defence by the host is a key mechanism for combatting viral infection, and induction of ifnb and other innate genes in response to ibv infection has been shown to peak around - hr post infection [ ] . in this study, genes more highly expressed (or less down-regulated) in the resistant n line at dpi include a number of collagen genes (col a , col a , col a , col a , col a and col a ) and other genes such as acan, fstl , comp, eif a, stat and igfbp . genes seen to be more highly expressed (or less down-regulated) in the susceptible i line include rbm , mafb, nnk , ccn , mgat and thrap . one consequence of ibv infection is the production of poor quality, misshapen eggs by infected birds [ ] . some of the genes previously identified as being important for the creation of a healthy eggshell are seen to be more highly expressed by the resistant n line birds after infection in this study. these genes include col a , creld , hsp b , p hb and erp [ ] . for a full list of genes differentially expressed between the two lines in trachea ( de probes) see additional file : table s . ipa analysis of genes showing different inherent expression between lines i and n shows that the molecular functions of these genes is primarily concerned with their involvement in cell death and cell adhesion (fig. ) , two processes previously shown to be significant in infected kidneys [ ] . when the differential host responses to infection are examined, it is seen that genes involved in proliferation of t-lymphocytes and genes concerned with cell attachment and cytoplasmic organization are more highly expressed in the resistant line n. other processes significantly involved are apoptosis and necrosis (fig. a) , which have been previously documented in ibv-infected vero cells by liu et al. [ ] . one of the most perturbed biological networks noted in this analysis is that involving genes related to connective tissue disorders and involve many collagen genes. these genes are more highly expressed in susceptible line i birds compared to resistant line n birds (fig. b) suggesting that ibv infection might cause more disorder of eggshell formation in this line [ ] . the production of poor quality eggs by ibv infected birds may, in part be a reflection of the expression of these kinds of gene networks compared to that seen in resistant birds. twenty-one genes were selected for qrt-pcr validation ( table ) . these genes were chosen based on their involvement in the host response and whether they were differentially expressed between the susceptible and resistant lines (either inherently or during the course of infection). of the genes tested, showed comparable higher expression in response to infection in the resistant than in the susceptible line c inherently higher expression in the resistant line differential expression to that determined by the arrays. however, the results for ifnar and igfbp were not confirmed (additional file : figure s ). besides knowing that the mhc b locus has a bearing on disease resistance, the lack of any genetic information or identified qtl meant that we had to rely upon the gene expression differences we saw between susceptible and resistant lines to give us clues as to genes potentially involved in resistance to ibv infection. identifying genes which were expressed at different levels in the two lines of birds highlighted b-locus genes (blb , bf , bf , b-g) as well as bringing to our attention various other non-mhc genes which, due to their known biology, could be candidates for being involved in resistance to ibv infection (table ) . mx , c s, irf , tlr , c r, ccli , isg - and ifitm are all strongly induced during the host response to ibv infection. they are all innate immune genes which could potentially have a role in determining susceptibility to the virus. mx and ifitm are already established as anti-viral molecules [ ] [ ] [ ] . cd , cd , fkbp and stat all show a higher level of expression during the host response in the resistant birds compared to that of the susceptible birds, indicating their involvement in the host defence mechanism. cd and cd , with their role as receptors on immune cells, as described above, are obvious candidates, along with fkbp as an immune-regulator. stat is activated by various cytokines and growth factors and functions in cellular processes such as cell growth and apoptosis. even before infection, many genes are seen to be highly differentially expressed between lines i and n. oasl is an interferon-induced molecule known to have anti-viral activity against certain viruses such as hepatitis c virus. ddt is highly homologous to the macrophage migration inhibition factor, mif. we have also shown it to be highly differentially expressed in other chicken lines, which are susceptible or resistant to marek's disease virus [ ] . ifnar is an obvious candidate prediction, as the interferon response is central to the host's defence against ibv infection. tpd l , bcl l , faim and ciapin are all known to be involved in regulation of apoptosis, a process seen to be important during ibv infection. hscb, sri, and suclg , although not having an obvious potential biological role in disease resistance, are highly differentially expressed between susceptible and resistant lines and should thus be considered as potential candidates. resistance to ibv infection is brought about by the immune response after the virus has entered the host and is not due to prevention of initial viral infection. there is a small initial innate response at dpi, with much more gene expression seen at and dpi. analysis of genes being activated or inhibited upon infection shows that the biological pathways primarily affected during ibv infection include mapk signalling, those involved in the interferon response and those involving pattern recognition receptors. susceptible and resistant lines show a differential host response mostly at dpi. there are also genes which are inherently different between the two lines studied, including many genes, which control the apoptotic potential of the host. these differences seen in gene expression levels, allow us to postulate on many candidate genes for disease resistance. some potential candidates for involvement in disease resistance include genes already known to confer resistance to other viral infections (mhc-b locus genes, mx , oasl and ifitm ), genes involved in apoptotic processes (tpd l , bcl l , faim and ciapin ) and others which could be potential candidates due to their known biology (e.g. ddt and cd ). array data have been submitted to array express (http://www.ebi.ac.uk/arrayexpress/) under the accession number e-tabm- . additional file : table s . gene expression seen during the host response to ibv infection in the trachea of susceptible birds. (xlsx kb) additional file : table s . gene expression differences found to be inherent between susceptible and resistant lines in the trachea. (xls kb) additional file : table s . genes found to be differentially expressed between susceptible and resistant lines in response to ibv infection in the trachea. (xls kb) additional file : figure s . the authors declare no conflicts of interest and no competing financial interests. an apparently new respiratory disease in baby chicks studies of infectious coryza of chickens with special reference to its etiology cultivation of the virus of infectious bronchitis coronavirus avian infectious bronchitis virus coronavirus replication and interaction with host recombinant avian infectious bronchitis virus expressing a heterologous spike gene demonstrates that the spike protein is a determinant of cell tropism interleukin- expression after infectious bronchitis virus infection in chickens review of infectious bronchitis virus around the world nephropathogenic avian infectious bronchitis viruses the role of phagocytic cells in enhanced susceptibility of broilers to colibacillosis after infectious bronchitis virus infection ability of massachusetts-type infectious bronchitis virus to increase colibacillosis susceptibility in commercial broilers: a comparison between vaccine and virulent field virus diseases of poultry a reverse transcriptase-polymerase chain reaction survey of infectious ibv infection bronchitis virus genotypes in western europe from isolation of a variant infectious bronchitis virus in australia that further illustrates diversity among emerging strains a novel genotype of avian infectious bronchitis virus isolated in japan in association of the chicken mhc b haplotypes with resistance to avian coronavirus transcriptional analysis of avian embryonic tissues following infection with avian infectious bronchitis virus transcriptome of local innate and adaptive immunity during early phase of infectious bronchitis viral infection identification of a novel coronavirus in patients with severe acute respiratory syndrome a novel coronavirus associated with severe acute respiratory syndrome investigations into resistance of chicken lines to infection with infectious bronchitis virus use of highly inbred chickens in research studies on genetic resistance to marek's disease guide to probe logarithmic intensity error (plier) estimation. santa clara: affymetrix i i/ni-calls for the exclusion of non-informative genes: a highly effective filtering tool for microarray data r: a language and environment for statistical computing recent additions and improvements to the onto-tools kegg: kyoto encyclopedia of genes and genomes ingenuity pathway analysis infectious bursal disease virus: strains that differ in virulence differentially modulate the innate immune response to infection in the chicken bursa re-evaluation of chicken cxcr determines the true gene structure: cxcli (k ) and cxcli (caf/ interleukin- ) are ligands for this receptor chicken interleukin- is costimulatory for t cells and blocks maturation of dendritic cells molecular mechanisms of primary and secondary mucosal immunity using avian infectious bronchitis virus as a model system a systems biology approach for pathway level analysis induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens phosphatidylinositol -kinase iiiβ is required for severe acute respiratory syndrome coronavirus spike-mediated cell entry virus complement evasion strategies infectious bronchitis virus induces acute interferon-gamma production through polyclonal stimulation of chicken leukocytes rapid nkcell activation in chicken after infection with infectious bronchitis virus m activation of the chicken type i ifn response by infectious bronchitis coronavirus click and expander: a system for clustering and visualizing gene expression data the cellular interactome of the coronavirus infectious bronchitis virus nucleocapsid protein and functional implications for virus biology egg quality and production following infectious bronchitis virus exposure at one day old hen uterine gene expression profiling during eggshell formation reveals putative proteins involved in the supply of minerals or in the shell mineralization process transcriptome analysis of chicken kidney tissues following coronavirus avian infectious bronchitis virus infection induction of caspase-dependent apoptosis in cultured cells by the avian coronavirus infectious bronchitis virus effects of avian infectious bronchitis virus antigen on eggshell formation and immunoreaction in hen oviduct interferons: cell signalling, immune modulation, antiviral response and virus countermeasures mx proteins: mediators of innate resistance to rna viruses ifitms restrict the replication of multiple pathogenic viruses submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution this work was supported by the biotechnology and biological science research council (bbsrc), as part of grant numbers bb/d / , bb/ d / and bb/d / . the authors would like to thank alison downing (edinburgh genomics, edinburgh, uk) for excellent technical assistance with the affymetrix microarray experiments. authors' contributions js performed the arrays, analysed the results and wrote the manuscript; dc carried out challenge experiments, j-rs prepared rna, measured viral load and performed qrt-pcr; db and pk conceived and supervised the project and revised the manuscript. all authors read and approved the final manuscript. key: cord- -y mxcj authors: hoppe, ingrid bortolin affonso lux; medeiros, andréa souza ramos de; arns, clarice weis; samara, samir issa title: bovine respiratory syncytial virus seroprevalence and risk factors in non-vaccinated dairy cattle herds in brazil date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: y mxcj background: the cattle industry is one of the most important brazilian agribusiness sectors and is a strong contributor to the national economy. annually about . million calves are bred, which makes the optimal management of these animals extremely important. several diseases can affect the initial stages of the bovine production chain, being the bovine respiratory syncytial virus (brsv) one of the most relevant pathogens. this study aimed to characterize the epidemiology of brsv infection in dairy cattle herds of são paulo state, brazil, using serological and risk factors analyses. for that, blood samples were collected of animals from farms and a questionnaire about possible risk factors for brsv prevalence was performed. the obtained blood sera were analyzed using virus neutralization test (vnt). results: vnt results showed high brsv prevalence in dairy cattle herds, reaching . % of seropositivity. the brsv seroprevalence among studied farms ranged from to %. the analysis of risk factors indicated that the age group and the occurrence of coinfection with bovine herpesvirus (bohv- ) and bovine viral diarrhea virus (bvdv- ) should be associated with a higher prevalence of brsv, while natural suckling was considered a protective factor. conclusions: the study showed that adult animals over year old are an important risk factor for the high seroprevalence of brsv in herds. the high brsv prevalence associated with bohv- and bvdv- suggests that biosecurity measures should be applied in order to reduce viral dissemination. additionally, the natural suckling may be an important management to protect calves from high brsv seroprevalence. bovine respiratory syncytial virus (brsv) is an economically significant pathogen in cattle production [ ] , as it is one of the most important causes of lower respiratory tract infections in calves [ ] . in dairy cattle, brsv infection usually occurs in young calves aged between weeks and months [ ] . adult animals with subclinical infection are the main source of infection, since reinfections are common in the herds [ , , ] . brsv, bovine herpesvirus (bohv- ), bovine viral diarrhea virus (bvdv) and bovine parainfluenza type- (pi- ) are considered primary agents involved in the bovine respiratory complex. additionally, secondary infection by pasteurella multocida, histophilus somni and mycoplasmas contribute to the aggravation of the disease [ ] . clinical signs are characterized by respiratory symptoms, initially with moderated intensity, such as nasal and ocular discharges which can be aggravated leading to pneumonia. however, mainly in calves, an acute and severe onset is also observed, due to maternal antibodies not effectively protect against brsv infection [ ] . considering the high prevalence of the disease, several studies determined risk factors involved in the epidemiology of brsv. in europe, risk factors were mainly attributed to herd size, herd density, purchasing of new animals, geographic location of the farms, herd type and concomitant bvdv infection [ ] [ ] [ ] [ ] [ ] . similar studies have also been performed in some latin american countries and they showed that most of the animals probably have already been exposed to the virus with consequent high brsv prevalence in cattle herds. in these countries, herd size, age group, presence of bordering farms, herd type and geographic location of the farms were the main risk factors associated with brsv infection [ ] [ ] [ ] [ ] [ ] . in brazil, brsv was first diagnosed in calves in the state of rio grande do sul [ ] and some studies have shown that brsv infection is widespread in southern and southeastern brazil, with high serological prevalence rates [ ] [ ] [ ] . nevertheless, research has not been conducted in order to verify possible risk factors involved in brsv epidemiology. due to this, the current study aimed to determine antibody prevalence against brsv and investigate some risk factors associated with brsv seroprevalence in herds of an important milk producing region in são paulo state, brazil. the study was performed on dairy cattle herds in municipalities in the northern region of the são paulo state, southeastern brazil. this region produces about million liters of milk annually [ ] . the evaluated herds had between and animals and no animals were vaccinated against the pathogens associated with respiratory diseases. the farms were located in a region classified as aw by the climatic classification of koeppen, characterized by dry winter with average temperature higher than °c in the coldest month and precipitation below mm in the driest month. the altitude of these areas was to m above sea level [ ] . sampling of each farm was calculated [ ] with an expected brsv prevalence of % [ ] with acceptable error of % and confidence level of %. after setting the number of samples, bovines of all categories and age group were randomly selected. according to the management adopted in the herds, the age group was defined as ≤ months old "calf" and > months old "adult". in some farms, the number of samples collected was higher than that suggested by the mathematical calculation, once it was also used for serodiagnosis of bohv- and bvdv- . on farms with a small herd size, up to animals, all of them were sampled. the samples from animals were collected from april to june as shown in table . blood samples were collected by jugular or coccygeal vein puncture using disposable needles and vacuum tubes. samples remained at room temperature for h for coagulation and after being transported refrigerated to the laboratory, they were centrifuged at ×g for min to obtain the sera. the sera were aliquoted in . ml identified microtubes that were stored in freezer at − °c until analyses. the presence of antibodies to brsv was tested by virus neutralization test (vnt). serum samples were thawed, inactivated in water bath at °c for min, and diluted in duplicates from : to : in -well microplates with μl of tcid brsv suspended in eagle's minimum essential medium (difco e-mem®). the viral strain was previously titrated [ ] . following during the sample collection, a questionnaire was administered to the owner or manager of each farm with the purpose of identifying potential risk factors related to epidemiology of brsv. thus, the questionnaire was designed according to data of risk factors described in the literature [ , , , ] in addition to the information of the management adopted in dairy farms of são paulo state. the variables explored were: herd size (≤ , > animals), herd density (≤ , > animals/hectare), age group (≤ months old "calf", > months old "adult"), breed (holstein, mixed), type of reproduction (natural mating, artificial insemination), purchase of animals (last months: yes, no), cleaning of facilities (often, rarely), historical of respiratory disease (last months: yes, no), quarantine (yes, no), abortions (yes, no), bohv- infection (serodiagnosis: yes, no), bvdv- infection (serodiagnosis: yes, no), type of calves housing (individual, collective), type of calves feeding (natural suckling, artificial), presence of others domestic animals (yes, no), presence of wild ruminant animals (yes, no). the variables "herd size" and "herd density" were based on the average data; "age group" was defined from the management adopted on the farms; "quarantine" refers to the isolation of purchased animals before adding them to the herd. the serodiagnosis of bohv- and bvdv- was performed at the same time as brsv (unpublished data). the variables "disinfection of the umbilical cord" and "colostrum feeding" were not analyzed because these practices were applied in all dairy farms visited. additionally, the data related to climatic classification and altitude were not included in the analysis because they were similar in all farms. the chi-square tests were employed to compare the brsv, bohv- and bvdv- seropositivity and also with "age group". fisher's exact test was used to compare brsv status according to the expected prevalence of % (≥ %, "high"; < %, "low") and the other variables. only the variables with p < , (two-tailed fisher) were analyzed by a logistic regression model. the analyses were performed using the epi info™ program v. . . serum samples from animals belonging to dairy cattle herds were taken and tested by vnt, in which ( . %) were seropositive to brsv. regarding the age group, % ( / ) of the serum samples were positives for adult animals while the prevalence rate in calves was . % ( / ). antibodies to brsv were detected in all cattle herds, with prevalence rates ranging from to %. the mean antibody titers for adult animals was to , and for calves, to . therefore, prevalence of brsv both in herds and animals was considered high. the chi-square test showed association of brsv seropositivity with "age group" and animals tested seropositives to bohv- and bvdv- (table ). nevertheless, the fisher's exact test only detected statistical difference with the variable "type of calves feeding" (table ). in this case, the relative risk (rr) value was less than one, i.e., the factor "natural suckling" was considered protective. logistic regression (values of p < . , two-tailed fisher) did not show significant results, suggesting that the variables analyzed were not risk factors for the high seroprevalence of brsv in the studied population. this is the first epidemiological study to assess risk factors for brsv seroprevalence carried out in brazil. even though brsv prevalence of . % in the animals sampled was similar to that estimated, the prevalence in adult animals was higher than that expected, reaching % of samples. in calves, the seroprevalence was lower than that found in adult animals ( . %) and could be even lower once vnt does not allow the distinction between antibodies from colostrum and natural infection. thus, this study demonstrated that the prevalence of brsv antibodies was higher in adult animals, as previously reported in other countries [ , ] . adult animals are associated with high seroprevalence of brsv as consequence of a repeated exposure to the virus infection throughout their life and possibility of reinfections. similarly, the highest antibody titers were associated with non-vaccinated adult cattle, probably due to the exposure to successive viral reinfections, which results in a booster effect on antibody titers [ ] . other factor related to high antibody titers is recent brsv infections, which can be confirmed only by paired serology, antibody screening in calves after the period of colostral antibody detection or viral detection by direct methods. as respiratory disease was not reported in half of the herds studied, it is indicative that brsv infection can be subclinical. this is consistent with previous reports [ ] . herds can remain free of clinical brsv infection for many years even in areas of high prevalence of the virus [ ] . the presence of other pathogens is also associated with the prevalence of brsv [ , , , ] . this information explains the association of brsv serological prevalence with the prevalences of bohv- and bvdv- . the infection by these viral agents is also reported in brazilian herds, with high prevalences [ , ] . bvdv infection can cause impairment of the animal's immune function and thereby decrease resistance to other infections [ ] . the synergistic effects of bvdv with other respiratory pathogens have been observed [ , ] . thus, health status of the herds may also be affected indirectly by bvdv control measures [ ] . dairy cattle herds in são paulo state usually have poor biosecurity measures, such as the lack of quarantine of newly purchased animals, lack of diagnosis of respiratory diseases (particularly for brsv) and vaccination is rarely performed against these viruses. therefore, we hypothesized that risk factors for the seroprevalence of bohv- , bvdv- and brsv in the studied population likely to overlap. despite the logistic regression not confirming "type of calves feeding" variable as a risk factor for high prevalence of brsv, the fisher's exact test detected "natural suckling" as a protective factor. "natural suckling" would be important as it may be able to reduce the risk of calves becoming infected by brsv. weaning can be stressful and results in impaired immune function, which may further exacerbate a brsv exposure. suckling reduces the occurrence of diarrhea, prevents the abnormal behavior of cross-suckling of other calves and improves animal health [ , ] . prior to the current study there have been no report about "natural suckling" and its relationship with brsv seroprevalence or its role as a protective factor, therefore, based on the results presented, it has the potential to decrease seroprevalence to brsv. similarities were observed among the results found at the present study and those previously obtained by others conducted in brazil [ ] [ ] [ ] . in latin america countries, equivalents prevalences of brsv have also been reported [ , [ ] [ ] [ ] , as well as difficulties in detecting the risk factors involved in the dissemination of the agent, even using different forms of sampling and analyzing a considerable number of variables. thus, the dynamics of infection may differ even in a particular country or geographic area [ ] . the high serological prevalence of brsv found in this study shows the importance to know more about this infection since it is not considered important in the country, mainly due to the lack of diagnosis. the awareness of the risk factors involved in the brsv dissemination can allow understanding its mechanisms, even though, as in other studies, these factors were not very clear. thereby, further studies as a complement to the current one should be performed until concrete information has been found. adult animals over year old can present high seroprevalences of brsv and are an important risk factor for the virus maintenance in herds. additionally, the concomitant seroprevalence of bohv- and bvdv- leads us to suggest that biosecurity measures to reduce viral dissemination could be applied. non-stressful management, like keeping calves with their mothers promoting natural suckling, may constitute a practical management strategy to reduce the seroprevalence of brsv in brazilian dairy herds. bovine respiratory syncytial virus bovine respiratory syncytial virus (brsv): a review bovine respiratory syncytial virus) infection: its pathogenesis, diagnosis, prevention and treatment seroepizootiologic study of bovine respiratory syncytial virus in a dairy herd respiratory syncytial virus: brief review identificación de agentes virales por inmunohistoquímica en enfermedades respiratórias de bovinos en corral de engorda severe respiratory disease in dairy cows caused by infection with bovine respiratory syncytial virus bovine respiratory syncytial virus seroprevalence and risk factors in endemic dairy cattle herds risk factors for epidemic respiratory disease in norwegian cattle herds risk factors for seropositivity to bovine coronavirus and bovine respiratory syncytial virus in dairy herds seroprevalence of bovine respiratory viruses in north-western turkey bovine respiratory syncytial virus: first serological evidence in uruguay detection on antibodies and risk factors for infection with bovine respiratory syncytial virus and parainfluenza virus in dual purpose farms in colima seroprevalence to bovine virus diarrhoea virus and other viruses of the bovine respiratory complex in venezuela (apure state) prevalence of and risk factors for bovine respiratory syncytial virus (brsv) infection in non-vaccinated dairy and dual-purpose cattle herds in ecuador detection of antibodies and risk factors for infections with bovine respiratory syncytial vírus and parainfluenza virus- in beef cattle of yucatan detection of bovine respiratory syncytial virus in calves of rio grande do sul detection of antibodies against bovine respiratory syncytial virus (brsv) in dairy cattle with different prevalences of bovine herpesvirus type (bhv- ) in são paulo state vírus respiratório sincicial dos bovinos (brsv): situação no brasil serological evidence of bovine respiratory syncytial virus in brazil produção da pecuária municipal campinas: unicamp encuestas por muestreo para estudios epidemiologicos en poblaciones animales simple method of estimating per cent end point dynamics of bovine respiratory syncytial virus infections: a longitudinal epidemiological study in dairy herds a longitudinal study of the dynamics of bovine corona virus and respiratory syncytial virus infections in dairy herds herpesvirus bovino tipo (hvb- ): revisão e situação atual no brasil a infecção pelo vírus da diarreia viral bovina (bvdv) no brasil -histórico, situação atual e perspectivas synergistic effects of bovine respiratory syncytial virus and noncytopathic bovine viral diarrhea virus infection on selected bovine alveolar macrophage functions prevalence, outcome and health consequences associated with persistent infection with bovine viral diarrhoea virus in feedlot cattle the effects of early separation on the dairy cow and calf practical implications of increasing natural living through suckling systems in organic dairy calf rearing the authors thank coordenadoria de assistência técnica integral (cati/ saasp) for providing the dairy cattle herds for the study, dr. estevam g. lux hoppe and andressa de souza pollo for assistance with manuscript revision. this work was supported by fundação de amparo à pesquisa do estado de são paulo, fapesp (financial grant / - and doctoral scholarship / - ). the datasets analyzed within the current study are available from the corresponding author upon request.authors' contributions ibalh and asrm performed the experiment. ibalh analyzed the data and prepared the manuscript. ibalh, cwa and sis designed the study and revised the manuscript. all authors read and approved the final manuscript. the work is in accordance with ethical principles in animal experimentation, adopted by the brazilian code of experimentation (cobea) and approved by the ethics committee on animal use (ceua). protocol / . not applicable. the authors declare that they have no competing interests. key: cord- - c wttxg authors: lin, huixing; zhou, hong; gao, lu; li, bin; he, kongwang; fan, hongjie title: development and application of an indirect elisa for the detection of antibodies to porcine epidemic diarrhea virus based on a recombinant spike protein date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: c wttxg background: as the major causative agent of swine viral diarrhea, porcine epidemic diarrhea virus (pedv) has caused massive losses to the economies of swine raising countries. accordingly, the serological detection of corresponding antibodies would be beneficial to diagnose pedv indirectly to control the disease. in this study, an indirect enzyme-linked immunosorbent assay (elisa) based on the recombinant truncated spike (s) protein of pedv was developed and validated. results: the reaction conditions of the developed indirect elisa were optimized. this indirect elisa was compared to indirect immunoinfluscent assay (ifa), and the overall coincidence rate was . % based on testing clinical serum samples with different pedv antibody levels. no cross-reactivity with other common swine pathogens was detected for the developed s indirect elisa. finally, the s indirect elisa was applied to detect serum antibodies of field samples collected from different pig farms in eastern china, and it presented an overall substantial agreement on the pedv infection status. conclusions: this established s indirect elisa is capable of detecting serum antibodies against pedv, and due to its high sensitivity and specificity, it could be applied for serological evaluation and indirect diagnosis of pedv infection. porcine epidemic diarrhea (ped) is a highly contagious swine enteritis caused by porcine epidemic diarrhea virus (pedv), which belongs to the order nidovirales and family coronaviridae. the typical symptoms of ped are diarrhea, vomiting, and dehydration, which can be especially dangerous to suckling piglets [ , ] . the mortality of neonatal piglets younger than days old can approach % [ ] [ ] [ ] . ped first appeared in britain in , followed by an outbreak of diarrhea in several pig farms in belgium in [ ] . these outbreaks led to identification of a coronavirus-like particle named cv , which is now recognized as the classic pedv strain. in recent years, ped epidemics have become prevalent in swine-raising countries in asia, including south korea, china, japan, and vietnam, and can cause enormous economic loss [ , ] . pedv is a single-stranded rna virus composed primarily of four structural proteins: the spike protein (s, - kda), membrane protein (m, - kda), envelope protein (e, kda) and nucleocapsid protein (n, - kda). s protein is located on the surface of the virus particle. it is categorized as a type i membrane fusion protein and has the significant biological effect of binding to target cell receptors and entering the cell through plasma membrane fusion [ , ] . the s protein has higher antigenicity than any of the other pedv proteins, and anti-s antibodies detected in pedv-infected pigs persist longer than anti-n antibodies [ ] . the s protein can be separated into the s ( - aa) subunit and the s ( - aa) subunit [ ] . the s subunit is the extracellular domain and can recognize and bind to target cell receptors [ ] , and it is closely linked to the formation of neutralizing antibodies. therefore, this study selected a gene fragment within the s subunit as a coating antigen to develop an indirect enzyme-linked immunosorbent assay (elisa) method for the detection of pedv antibodies. the pedv yc strain was isolated on a breeding farm in yancheng city in (genbank: ku . ). the prokaryotic expression vector pet- a(+) was purchased from biovector ntcc inc. (beijing, china). the hrp-goat anti-pig iga, hrp-goat anti-pig igg, and fitc-goat anti-pig iga was purchased from abcam plc. (shanghai, china). the standard pedv negative serum were collected from specific pathogen free (spf) pigs. the standard pedv positive serum were collected from experimentally pedv immunized spf pigs, at , , , , , and day post-inoculation (dpi). these standard serum were identified of pedv-specific antibodies positive by both indirect immunoinfluscent assay (ifa) and seroneutralization assay (sn) as previously described [ , ] . the swine porv antibody elisa kit and the swine tgev elisa kit were obtained from ingenasa (madrid, spain). the gene sequence of truncated spike protein (named s ) was amplified from the genomic rna of pedv yc strain (genbank: ku . ) by reverse-transcriptase (rt)-pcr. the forward primer was ' cgcggat ccgtcactaggtgccagtccactattaa- 'and the reverse primer was '-cccaagctttcaattgtaaa tatccactttaagaaaacaataa- ′. underlined portions represent bamh i and hind iii restriction sites, respectively. the target gene was bp in length and subcloned into the prokaryotic expression vector pet- a(+), then transformed into a strain of competent e. coli cells, dh α. transformed colonies were selected from luria-bertani (lb) agar plates containing kanamycin ( μg/ml) and were identified by pcr. the resulting recombinant expression plasmid was named a-s and was identified by double enzyme digestion and dna sequence analysis. subsequently, the recombinant expression plasmid a-s was transformed into e. coli bl (de ). the positive transformants were cultured in lb medium containing μg/ml kanamycin with vigorous shaking at °c until the nm optical density (od ) of bacteria cultures reached approximately . . then, by adding isopropyl-β-d-thiogalactopyranoside (iptg), the recombinant protein s was induced for - h at °c. the expression of recombinant proteins was analyzed by % (v/v) sodium dodecyl sulfate-polyacrylamide gel electrophoresis (sds-page) and the gels were stained with coomassie brilliant blue. induced cells were pelleted and washed in phosphate-buffered saline (pbs) three times, then lysed by sonication in an ice-water bath. the lysed cells were centrifuged at , g for min, then the precipitate (inclusion body) was dissolved with binding buffer containing m urea. the supernatant and the precipitate were then subjected to sds-page analysis. the recombinant protein was purified through affinity chromatography using a ni-nta spin column following the manufacturer's recommendations. purified recombinant protein s was subjected to % (v/v) sds-page, and the gel was prepared for western blotting as follows. recombinant proteins separated in the gel were electrically transferred to a nitrocellulose membrane and the membrane was blocked overnight at °c with tris-buffered saline containing tween- (tbst) which contained % (w/v) skimmed milk powder. the composition of tbst is as follows: mm tris-hcl, mm nacl, and . % tween- . the membrane was then incubated with pig anti-pedv polyclonal antibody ( : dilution in blocking buffer) for h at °c on a plate shaker. following this incubation, the membrane was washed three times with tbst buffer and reacted with hrp-goat anti-pig igg ( : dilution in tbst) at °c for min. after three washes, the final color reaction was developed with a solution of , ′-diaminobenzidine (dab). conventional indirect elisa was performed with the following steps. elisa plates with wells (costar, usa) were coated with μl purified recombinant s protein in bicarbonate buffer (ph = . ) for h at °c. then, plates were washed three times with pbst (pbs containing . % tween- ) and blocked with % skimmed milk in pbs for h at °c. after plates were washed, μl porcine serum samples diluted in pbs containing % (w/v) skimmed milk was added and incubated for min at °c. plates were washed four times and reacted with μl diluted secondary antibody (hrp-goat anti-pig iga or hrp-goat anti-pig igg) for min at °c for the purpose of detecting iga or igg against pedv in serum samples. plates were then washed four times and μl tetramethylbenzidine (tmb) substrate solution was added to each well for a chromogenic reaction at room temperature for min in complete darkness. the color reaction was stopped by the addition μl of m h so to each well. finally, the od was measured and recorded immediately using an infinite pro microplatereader (tecan, männedorf, switzerland). the optimal dilution of recombinant protein s and standard serum was determined by a checkerboard titration based on the method mentioned above. briefly, the concentration of s protein was gradually reduced in the following series: , . , , . , . , and . μg/ml. the standard pedv positive and negative serum were serially diluted in a -fold series from : to : . when the od ratio of positive serum to negative serum was highest, and the od of positive serum was closest to . , the corresponding dilutions of coated antigen and serum sample were considered optimal. in addition to optimal protein dilution, the coating conditions, blocking solution, and reaction time of various materials was explored. furthermore, the optimal concentration of hrp-goat anti-pig iga was tested using the following dilutions: : , : , : , : , and : . two hundred and seventy serum samples were collected for the purpose of determining the positive-negative cut-off value, of which serum samples were collected from spf pigs, serum samples were collected from grow-finish pigs from five farms between and . these five farms were located in areas with no previous history of enteric signs compatible with viral diarrhea, and were pedv rna negative by real-time rt-pcr based on a single collection. these serum samples were confirmed pedv-negative by both ifa and sn assays as previously described [ , ] , and then were used to define the cut-off value in the s indirect elisa. the od value of these pedv-negative serum samples obtained in this s indirect elisa were recorded to calculate the cut-off value. the mean od value of these negative samples (n) + × standard deviations (sd) was defined as the cut-off value. serum samples showing od value greater than or equal to this cut-off were considered pedv-seropositive. to assess the accuracy of this developed s indirect elisa, serum samples from different pig farms were tested using this elisa method. as a comparison, ifa was applied to test these samples and act as a reference method to distinguish positive or negative samples. briefly, vero cells grown on -well plates were infected with the pedv yc strain at multiplicity of infection (m. o. i) of . at h post-infection, cells were washed three times with pbst and fixed with cold methanol for min at − °c. cells were then washed three times with pbst and blocked with % bovine serum albumin (bsa) at °c for h. after been double diluted for six consecutive dilutions in dilution buffer ( % bsa in pbst), the serum samples with varied pedv antibody status were added in the wells of -well plate, and were incubated for h at °c. after three washes with pbst, cells were treated with a fitc-conjugated goat anti-pig iga (thermo scientific) at a : dilution with pbs for min at °c. after a final four washes with pbst, all wells were examined using fluorescence microscopy (axio observer z , zeiss, germany). the pedv antibody titers of the serum samples were expressed as the highest dilution of serum samples producing green fluorescent in the wells of -well plates. the results of this two methods were compared, and the sensitivity and specificity of detection were calculated to evaluate the accuracy of the s indirect elisa. sensitivity was defined as the ratio of positive tests from the developed s indirect elisa to the positive tests from the ifa. specificity was defined as the ratio of negative tests from the developed elisa to the negative tests from the reference ifa. serum cross-reactivity of s indirect elisa to other pathogens to validate the cross-reactivity, this s indirect elisa was utilized to test porcine serum positive for other swine pathogens, namely, porcine transmissible gastroenteritis virus (tgev), swine rotavirus (porv), porcine kobuvirus (pkv), porcine bocavirus (pbov), porcine norovirus (pnov), porcine circovirus type (pcv ), porcine reproductive and respiratory syndrome virus (prrsv), and enterotoxigenic e. coli (etec), jerson prand of the small intestine, clostridium welchii type c. the positive sera were prepared by our lab, by immunizing the specific pathogen free (spf) piglets with purified virus or bacteria. thirty positive serum samples for each virus were tested, and each sample was repeated in triplicate. to test the repeatability of this elisa, serum samples with different pedv antibody levels were chosen. for inter-assay variability, each sample was tested in replicates on plates of different occasions. for intra-assay variability, each sample was tested in replicates on plates within the same occasion. the results were presented as the coefficient of variation (cv), which is the ratio of the standard deviation (sd) to the mean od value of each group of samples (s). a cv value criterion of % was used to meet the repeatability requirement of the test. this s indirect elisa was applied to seroepidemiological analysis of a total of clinical swine serum samples collected from thirty seven farms in eastern china. the pedv infection status of a given farm was determined based on demonstration of pedv rna in fecal samples by real-time rt-pcr and presence of enteric signs [ ] . one thousand one hundred and twenty five serum samples were collected from nursery and grow-finish pigs from ten farms between and at - weeks after the start of pedv outbreaks in these farms. four hundred and eighty two serum samples were collected from nursery and grow-finish pigs from five farms between and . these five farms were located in areas with no previous history of enteric signs compatible with viral diarrhea, were pedv rna negative by real-time rt-pcr based on a single collection, and were considered non-exposed to pedv. three hundred and forty four serum samples from nursery pigs without pedv exposure were collected from six farms between and . these samples were confirmed to be positive for anti-porv antibodies ( farms, n = ) or anti-tgev antibodies ( farms, n = ) by both ifa and commercial elisa kits (obtained from ingenasa). one thousand three hundred and fifty three porcine serum samples with unknown pedv exposure status were randomly selected from sixteen farms from nursery and grow-finish pigs between and . the gene of pedv truncated s fragment ( - nt) was amplified by rt-pcr (fig. a) . a bp pcr product was obtained and subcloned to prokaryotic fig. amplification, sds-page and western blotting analysis of the recombinant protein s . a rt-pcr amplification of the truncated s gene fragment. lane m, dl dna marker. lane and , the truncated s gene fragment. b identifiction of the recombinant expression plasmid a-s by double enzyme digestion. lane m, dl dna marker. lane , the recombinant expression plasmid a-s digested by bamh i/sal i. c sds-page analysis of s protein. lane m, prestained protein molecular weight standard. lane , transformed cells of bl /pet- a(+) after iptg induction for h. lane , transformed cells of bl / a-s after iptg induction for h. lane , purified recombinant protein s by affinity chromatography of ni-nta spin column. d western blotting analysis of s protein. lane m, prestained protein molecular weight standard. lane , e. coli bl with empty vector pet- a(+) reacted with polyclonal mouse anti-pedv antibody. lane , purified s protein reacted with polyclonal mouse anti-pedv antibody. a prominent band with the expected size kda appeared after incubation expression vector pet- a(+), and the inserted gene was sequenced to ensure the correctness of the reading frame. as shown by sds-page (fig. c) , the recombinant protein s was expressed in the form of inclusion body, resulting in a × his-tag fusion protein whose molecular mass was approximately kda. sonicated lysates from recombinant e. coli were harvested, and the precipitate was dissolved in m urea and purified by affinity chromatography of ni + -nta agarose. the immunoreactivity of s protein was examined by western blotting. an obvious band revealed that s protein was specifically bound by pig anti-pedv polyclonal antibody (fig. d) . as expected with checkerboard titration, with concentrations of antigen and serum regularly decreasing, absorbance values of corresponding samples declined. the optimal dilution of coated antigen s protein was measured at . μg/well ( . μg/ml), and optimal serum sample dilution was : (table ) . furthermore, other reaction conditions of the developed elisa were optimized. in brief, the optimum coating condition was h at °c. the best blocking solution was selected as % skimmed milk in pbs. the optimal reaction times for serum, secondary antibodies, and tmb solution were min, min and min, respectively. finally, the best working dilution of the hrp-goat anti-pig iga was : , . to determine the cut-off value of the s indirect elisa, pedv-seronegative samples, verified by both ifa and sn assays, were tested by this elisa method. the average optical density of these negative serum samples (n) was calculated as . , and the standard deviation (sd) of these samples was . . consequently, the cut-off threshold value of s indirect elisa was calculated to be . , indicating that the sample od ≥ . was identified as pedv-seropositive and vice versa. this developed s indirect elisa was applied to serum samples with varied pedv antibody status ( table ). in these samples, the s indirect elisa detected pedv-positive samples, of which tested pedv-positive by ifa. on the other hand, of the remaining samples that tested pedv-seronegative by this s indirect elisa, of them were tested pedv-negative by ifa. hence, the sensitivity of s indirect elisa was . % among pedv-seropositive individuals, and the specificity was . % among pedv-seronegative individuals using ifa as standard evaluation method. in summary, the overall coincidence rate of the s indirect elisa to ifa was . %. to test the cross-reactivity of this s indirect elisa, other viruses known to cause swine diarrhea were examined. the average od of positive serum samples for tgev, porv, pkv, pbov, pnov, pcv , prrsv, etec, jerson prand of the small intestine, and clostridium welchii type c were . , . , . , . , . , . , . , . , . and . , respectively. the results showed that these serum samples were pedv-seronegative and non-cross-reactive with this s indirect elisa, indicating that the established elisa was an effective method for detecting pedv antibodies. the repeatability of s indirect elisa intra-assay variability of the s indirect elisa was assessed by testing swine serum samples, each with replicates. this analysis produced cvs ranging from . - . %, with an average value of . %. inter-assay variability of four batches using identical samples produced cvs ranging from . - . %, with an average value of . %. the results demonstrated that this elisa method yielded low levels of variation, and its repeatability was in the credible range. this s indirect elisa method was used on swine serum samples of different pedv exposure status collected from farms (table this s indirect elisa was applied to test the sera of pedv immunized pigs at , , , , , and day post-inoculation (dpi). the results (fig. ) showed that, both the iga and the igg were positive at dpi. at early infection stage ( dpi), the iga titer was significantly higher than the igg titer; at dpi the iga titer was equivalent to the igg titer; and after dpi, the iga titer was significantly lower than the igg titer. the igg could exist in the sera of infection recovered stage for more time than iga. since december , a large-scale outbreak of diarrhea has been observed in swine farms in china. accumulated evidence indicates that this large-scale outbreak of diarrhea were caused by highly virulent pedv variants [ , ] . serological assays can quickly detect large numbers of samples with both high sensitivity and specificity. several indirect elisa have been developed based on either whole pedv preparations or recombinant viral proteins [ ] [ ] [ ] . the s protein of pedv has numerous epitopes and highly antigenic index regions that induce the production of neutralizing antibodies [ , , ] , and anti-s antibodies detected in pedv-infected pigs persist longer than anti-n antibodies [ ] , thus, we choose s protein as the diagnostic antigen. the recombinant s protein was applied to establish an indirect elisa, and its reaction conditions were optimized. as pedv is an enteric virus, it directly infects and damages enterocytes. mucosal iga, but not systemic igg, plays a crucial role in protection [ , ] . in this research, the titers of iga in the serum were tested for serological evaluation and indirect diagnosis of pedv infection. of the serum samples which were pedv exposed, the overall positive rate of the antibody is . %, which were varied from to % between farms. of the serum samples which were pedv non-exposed, the overall positive rate of the antibody is . %, which were varied from . to . % between farms. the evaluated elisa presented an overall substantial agreement on the pedv infection status of the field swine serum samples. the intra-and inter-assay variability tests proved that this elisa method had good repeatability. when testing other positive serum related to swine viral pathogens, this established elisa demonstrated no cross-reactivity to them. further, the overall rate of coincidence of this elisa was calculated at . % compared with ifa, proving that the diagnostic sensitivity and specificity of this elisa method were favorable. of the numerous pathogens which can cause swine viral diarrhea, pedv, tgev, and porv account for the largest proportion [ ] . in the present study, / anti-porv antibody positive sample and / anti-tgev antibody positive samples were tested pedv antibody positive, which indicated there may be co-infection of pedv and other virus. in conclusion, this established s indirect elisa is capable of detecting serum antibodies against pedv, and due to its high sensitivity and specificity, it could be applied for serological evaluation and indirect diagnosis of pedv infection. fig. determination of iga and igg in the sera of pedv immunized pigs. the sera of pedv immunized pigs were tested by this s indirect elisa at , , , , , and day post-inoculation (dpi). both the iga and the igg were positive at dpi. the igg could exist in the sera for longer time than iga. different letters (a, and b) indicate significant difference between the groups porcine epidemic diarrhea in europe: in-detail analyses of disease dynamics and molecular epidemiology nursery pig growth performance and tissue accretion modulation due to porcine epidemic diarrhea virus or porcine deltacoronavirus challenge in situ hybridization for the detection and localization of porcine epidemic diarrhea virus in the intestinal tissues from naturally infected piglets poly (d,l-lactide-coglycolide) nanoparticle-entrapped vaccine induces a protective immune response against porcine epidemic diarrhea virus infection in piglets cross protective immune responses in nursing piglets infected with a us spike-insertion deletion porcine epidemic diarrhea virus strain and challenged with an original us pedv strain an apparently new syndrome of porcine epidemic diarrhoea isolation of porcine epidemic diarrhea virus during outbreaks in south korea heterogeneity in membrane protein genes of porcine epidemic diarrhea viruses isolated in china structure of a proteolytically resistant core from the severe acute respiratory syndrome coronavirus s fusion protein identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus an elisa for detection of antibodies against porcine epidemic diarrhoea virus (pedv) based on the specific solubility of the viral surface glycoprotein spike protein region (aa ) of porcine epidemic diarrhea virus is essential for induction of neutralizing antibodies identification and comparison of receptor binding characteristics of the spike protein of two porcine epidemic diarrhea virus strains comparison of serum neutralization and enzyme-linked immunosorbent assay on sera from porcine epidemic diarrhea virus vaccinated pigs. the veterinary quarterly epidemic strain yc of porcine epidemic diarrhea virus could provide piglets against homologous challenge multiplex real-time rt-pcr for the simultaneous detection and quantification of transmissible gastroenteritis virus and porcine epidemic diarrhea virus new variants of porcine epidemic diarrhea virus, china sequence and phylogenetic analysis of nucleocapsid genes of porcine epidemic diarrhea virus (pedv) strains in china comparison of an enzyme-linked immunosorbent assay with serum neutralization test for serodiagnosis of porcine epidemic diarrhea virus infection development and application of an elisa for the detection of porcine deltacoronavirus igg antibodies detection of antibodies against porcine epidemic diarrhea virus in serum and colostrum by indirect elisa phage-displayed peptides having antigenic similarities with porcine epidemic diarrhea virus (pedv) neutralizing epitopes identification of two novel b cell epitopes on porcine epidemic diarrhea virus spike protein porcine epidemic diarrhea virus infection: etiology, epidemiology, pathogenesis and immunoprophylaxis does circulating antibody play a role in the protection of piglets against porcine epidemic diarrhea virus? antigenic relationships among porcine epidemic diarrhea virus and transmissible gastroenteritis virus strains the data analyzed during the current study are available from the corresponding author on reasonable request. authors' contributions hl, kh and hf designed the study. hl, hz, lg and bl performed and collected data from experiment and analyzed data. hl, hz wrote the manuscript. all authors read and approved the final manuscript. this study was performed in accordance with the recommendations in the guide for the care and use of laboratory animals of the ministry of health, china. all experimental protocols were approved by the institutional animal care and use committee of nanjing agricultural university (no. syxk - ) and performed accordingly. samples were collected only from animals for laboratory analyses, avoiding unnecessary pain and suffering of the animals. the owners gave their written consent for sample collection, and the locations where we sampled are not privately owned or protected in any way. the studies did not involve endangered or protected species. not applicable. the authors declare that they have no competing interests. key: cord- -fgn rps authors: miller, laura c; fleming, damarius; arbogast, andrew; bayles, darrell o; guo, baoqing; lager, kelly m; henningson, jamie n; schlink, sarah n; yang, han-chun; faaberg, kay s; kehrli, marcus e title: analysis of the swine tracheobronchial lymph node transcriptomic response to infection with a chinese highly pathogenic strain of porcine reproductive and respiratory syndrome virus date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: fgn rps background: porcine reproductive and respiratory syndrome virus (prrsv) is a major pathogen of swine worldwide. emergence in of a novel highly pathogenic prrsv (hp-prrsv) isolate in china necessitated a comparative investigation into the host transcriptome response in tracheobronchial lymph nodes (tbln) days post-infection with hp-prrsv rjxwn , prrsv strain vr- or sham inocula. rna from each was prepared for next-generation sequencing. amplified library constructs were directly sequenced and a list of sequence transcripts and counts was generated using an rnaseq analysis pipeline to determine differential gene expression. transcripts were annotated and relative abundance was calculated based upon the number of times a given transcript was represented in the library. results: major changes in transcript abundance occurred in response to infection with either prrsv strain, each with over differentially expressed transcripts. the largest increase in transcript level for either virus versus sham-inoculated controls were three serum amyloid a acute-phase isoforms. however, the degree of up or down-regulation of transcripts following infection with hp-prrsv rjxwn was greater than transcript changes observed with us prrsv vr- . also, of significantly altered transcripts within the hp-prrsv rjxwn library were up-regulated and were down-regulated more than -fold, whilst in the us prrsv vr- library only transcripts were up-regulated and were down-regulated more than -fold. conclusions: the magnitude of differentially expressed gene profiles detected in hp-prrsv rjxwn infected pigs as compared to vr- infected pigs was consistent with the increased pathogenicity of the hp-prrsv in vivo. porcine reproductive and respiratory syndrome virus (prrsv), the causative agent of prrs in swine, is a member of the arteriviridae family in the order nidovirales. prrsv causes highly significant economic losses to the swine industry worldwide [ ] as a result of both reproductive failure (late-term abortions and stillbirths) in pregnant sows and respiratory disease (pneumonia) in nursery and grower/finishing pigs [ ] . infection with prrsv also predisposes pigs to infection by bacterial pathogens as well as other viral pathogens [ ] [ ] [ ] [ ] [ ] , as such, prrsv is a key etiological agent of the porcine respiratory disease complex (prdc). clinical disease caused by prrsv is highly variable, ranging from mild, subclinical infection to acute death of adult animals [ ] . differences in virulence have been attributed to numerous factors including host genetics, management practices, and virus strain heterogeneity [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . relatively little is known about the interactions of prrsv and host cells. the lymph node is an anatomic site where the innate immune response and adaptive immune system interface. tracheobronchial lymph nodes (tbln) in swine drain the lung field and provide the focal structure that can reproducibly be identified. although the tbln contains a number of cell types, sampling this tissue allows study of direct and indirect effects of an infectious agent on the lung and cells within the lymph node. in a unique syndrome with high morbidity and mortality was recognized in growing pigs in china that was originally known as porcine high fever disease (phfd) due to its uncertain etiology [ ] . experimental infection of pigs in china with these novel viral isolates reproduced the clinical disease providing strong evidence for the role of prrsv as the causal agent of phfd. however, there was still a question as to whether there was some unknown agent in the prrsv preparations that increased the severity of the clinical disease over what was expected for a "routine" prrsv infection. this question was resolved when phfd was reproduced in china with virus derived from an infectious clone of the jx prrsv isolate [ ] demonstrating that prrsv isolates with a common genetic motif had a causal role in phfd leading to this lineage of virus being called highly pathogenic prrsv (hp-prrsv). we imported a plasmid containing a full-length clone of the jxwn hp-prrsv isolate [ ] from which infectious virus (rjxwn ) was rescued. an animal study was conducted comparing the pathogenicity of hp-prrsv isolate rjxwn with the north american prototype strain vr- prrsv [ ] . the objective of this report was to investigate gene expression profiles in porcine tracheobronchial lymph node (tbln) during viral infection with hp-prrsv rjxwn strain alongside of us prrsv strain vr- at a snapshot of days post-infection using bioinformatics. mapping short rna-seq reads and estimating transcript expression levels genomic short-read nucleotide alignment program (gsnap) was used for alignment and genome construction, and cufflinks to determine if differential expression and changes in transcript abundance were statistically significant [ , ] . the rnaseq yielded , , reads for the control, , , reads for the hp-prrsv, and , , for vr- libraries after quality trimming and excluding any reads less than bp. cufflinks was used to measure transcript abundances in fragments per kilobase of exon per million fragments mapped (fpkm). the cuffdiff output contained normalized fpkm for comparison between libraries (additional file ). these values were used to calculate the fold change (log transformed) in expression between the experimental unit and the control. examination of the rnaseq data indicated that there were major changes in transcript abundance occurring in the prrsv-infected tbln-based unique transcripts [cuffdiff output (additional file )]. of these total transcripts, were found to be significant hits in the hp-prrsv rjxwn library and were significant in the us prrsv vr- library (table ) . of those significant hits within the hp-prrsv rjxwn library hits were up-regulated and were down-regulated more than -fold whilst in the us prrsv vr- library hits were up-regulated and were downregulated more than -fold. this derived catalog of expressed genes represents the first comparative analysis of the hp-prrsv rjxwn and vr- -infected tbln transcript abundance profiles and provides a database that informs us of genes involved in normal tbln physiology, as well as genes whose abundance is altered by prrsv infection. gene annotation of all significant hits (additional files and ) was then carried out using a mysql database matching the ensmbl (sscrofa . ) chromosome location of aligned transcripts to gene names. gene ids and log fold-change expression values for significant hits, that had fpkm values in both the control and the infected differential expression testing for transcripts (cuffdiff output files), were then analyzed using the ingenuity pathway analysis software. when comparing the tbln transcriptome from sham-inoculated controls vs. the hp-prrsv rjxwn -infected pigs, of the gene ids mapped to the ingenuity knowledge base and were up-regulated while were down-regulated. in the tbln of control vs. vr- -infected pigs, of the gene ids mapped to the ingenuity knowledge base and only were up-regulated while were down-regulated. table lists the top ten genes (named by the hugo gene nomenclature committee (hgnc) [ ] ) we detected that had a significant value in both hp-prrsv rjxwn and vr- -infected tbln rnaseq cuffdiff output and a fold-change increase or decrease of greater than . transcripts up-regulated in both hp-prrsv rjxwn and vr- -infected tbln by > -fold and > -fold vs. control tbln, respectively, were three serum amyloid a (saa ) acute-phase isoforms, as well as gene enssscg f s c _pig serum amyloid protein (no hgnc annotation), that are expressed in response to inflammatory stimuli ( table ). other annotated genes ( table ) that were up-regulated in hp-prrsv rjxwn tbln vs. control were resistin (retn) which is secreted by immune and epithelial cells and participates in the immune response by increasing transcriptional events that increase expression of several proinflammatory cytokines [ ] ; three members of the s family (s a , s a , s a ) of calcium-binding proteins localized in the cytoplasm and/or nucleus of a wide range of cells, involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation, and mediators of inflammatory and protective anti-infection responses [ ] ; xanthine dehydrogenase (xdh) a generator of reactive oxygen species and possible cause of hypoxia-mediated lung injury [ ] ; and peptidylarginine deiminase, type iv, (padi ) which may play a role in granulocyte and macrophage development leading to inflammation and immune responses [ ] . also in the top ten up-regulated transcripts were two genes without a hgnc symbol, trem _pig (enssscg ) trigger receptor, which is expressed on myeliod cells, and the interleukin- receptor, type ii gene (il r ) which is associated with host responses to subdue inflammation as a consequence of disease. down-regulated in hp-prrsv tbln vs. control tbln were diacylglycerol oacyltransferase (dgat ) which catalyzes triglyceride synthesis which is critical for formation of adipose tissue [ ] ; perilipin- (plin ) an important regulator of lipid storage; a member of the cytochrome p monooxygenases (cyp b ) of unknown specific function; soluble galactosebinding lectin (lgals ), cell death-inducing dffalike effector c (cidec), tumor suppressor candidate (tusc ), protein phosphatase , regulatory (inhibitor) subunit a (ppp r a), c-type lectin domain family , member g, that encodes a glycan-binding receptor and a member of the c-type lectin family which plays a role in t-cell immune responses (clec g). also in the top ten down-regulated transcripts were the following genes without projected hgnc symbols: ces liver carboxylesterase (enssscg ) and f sty _pig thyroid hormone-responsive protein (enssscg ). in vr- -infected pig tbln vs. control tbln, transcript abundance was down-regulated to a lesser extent and featured genes linked to metabolism in adipose tissue and regulation in neuronal activity functions including dermatopontin (dpt) extracellular matrix protein with possible functions in cell-matrix interactions and matrix assembly which enhances transforming growth factor beta (tgfb ) activity; beta- adrenergic receptor (adrb ); solute carrier family , facilitated glucose transporter member (slc a ); uncharacterized mlx interacting protein-like protein (mlxipl); basic helix-loop-helix transcription factor (tcf ); forkhead box transcription factor protein c (foxc ); protein phosphatase regulatory subunit b also known as dopamine-and camp-regulated neuronal phosphoprotein (ppp r b); potassium voltage-gated channel, kqt-like subfamily, member (kcnq ) that is thought to play a critical role in the regulation of neuronal excitability; plexin domain containing (plxdc ); and adenosine a receptor (adora ). analysis of the genomic data in the context of gene ontology, by ingenuity pathway analysis (ipa), allowed us to ascribe biological functional networks to the differentiated transcript abundance dataset. the top functions identified with the ingenuity canonical pathway list, filtered to apoptosis, cellular immune response, cytokine signalling, humoral immune responses and pathogeninfluenced signalling, based on differentially expressed genes were: granzyme a signalling, crosstalk between dendritic cells and natural killer cells, il- signalling, role of pattern recognition receptors in recognition of bacteria and viruses, il- signalling and production in macrophages, complement system, interferon signalling, communication between innate and adaptive immune cells, il- a signalling in fibroblasts, granzyme b signalling, production of nitric oxide and reactive oxygen species in macrophages, differential regulation of cytokine production in macrophages and t helper cells by il- a lgals and il- f that were above the threshold of p value < . , as calculated by fischer's test representing the ratio of number of genes from the dataset that map to the pathway and the number of all known genes ascribed to the pathway. the genes up-regulated in the hp-prrsv rjxwn infected pigs' tbln were associated in networks: from biological networks with functions associated with cell death, antimicrobial responses and cancer, with the highest network score of , i.e. the likelihood of genes in this network would have approximately a - chance of occurring randomly, and focus molecules, i.e. the starting points for generating biological networks; to networks with functions associated with nervous system development and function, organ morphology and reproductive system disease with a score of and focus molecule. many of the upregulated networks related to cell death and inflammatory response functions fit with the results previously reported [ , ] where hp-prrsv strain rjxwn caused severe disease, resulted in up to x higher abundance of virus and produced an exacerbated release of cytokines, including pro-inflammatory cytokines, when compared to type prototype strain vr- . wide spread tissue damage [ ] and cell death were observed as predicted by up-regulation of celldeath associated genes (circled in orange in figure ) in the network representation of the mostly highly rated network for hp-prrsv rjxwn by ipa. the downregulated network functions in the hp-prrsv rjxwn infected tbln included activities associated with cellular function and maintenance, tissue morphology, metabolic disease, organismal development, carbohydrate metabolism, lipid metabolism, small molecule biochemistry, post-translational modification, protein folding, developmental disorder, which may be associated with cell death and reflects a severe disease state. similarly, the down-regulated network functions in the vr- infected tbln were associated with cellular function, maintenance, development and organization. this study produced transcriptional profiles of tblns from non-infected, hp-prrsv rjxwn and us prrsv vr- -infected pigs that provides insight into immune figure ingenuity pathways analysis summary. to investigate possible interactions of differently regulated genes, datasets representing genes with altered expression profile obtained from the rnaseq data for hp-prrsv rjxwn were imported into the ingenuity pathway analysis tool and the following data is illustrated: the network representation of the most highly rated network (gene expression, cell death, lipid metabolism). the genes that are shaded were determined to be significant from the statistical analysis. the genes shaded red are up-regulated and those that are green are down-regulated. the intensity of the shading shows to what degree each gene was up or down-regulated. a solid line represents a direct interaction between the two gene products and a dotted line means there is an indirect interaction. genes associated with cell death are circled with orange color. dysregulation elicited by the virus on host transcript abundance levels necessary for a effective immune response. this rna-seq compendium extends the analyses of previous gene expression atlases performed using affymetrix genechip technology and provides an example of new methods to accommodate the increase in transcriptome data obtained from next generation sequencing [ , , ] . it is well established that many pathogens cause changes in expression of specific genes that act to protect the host and clear the infection. prrsv strains differ in their dysregulation of the immune response to infection and delay in development of a protective immune response in vaccinated pigs [ , ] . a higher number of significantly differentially expressed gene instances were detected in hp-prrsv rjxwn than vr- when normalized to control samples at a snapshot of days post inoculation (dpi). as anticipated, some of the genes (e.g., resistin) and pathways identified would be expected to be involved in the host response to a severe disease. in the case of resistin, it would be expected that adipose tissue stores are being mobilized as part of the host response to infection, which includes a high fever typical of infection with hp-prrsv. there are specific cellular proteins that regulate a protective immune response, for example the pro-inflammatory genes that were upregulated to a greater extent in hp-prrsv rjxwn than vr- when normalized to control samples as observed when comparing the pathogenicity of hp-prrsv isolate rjxwn with the north american prototype strain vr- prrsv. at dpi hp-prrsv rjxwn inoculated pigs had an interstitial pneumonia that was significantly more severe than thevr- inoculated group which appeared to be convalescing [ ] . future studies of these differentially expressed genes, their transcript abundance, protein level, and protein function will enhance our understanding of the interaction of prrsv with the host. identification of new virulence mechanisms of prrsv may improve the prospects for rational design of more effective vaccines to limit viral replication and shedding. marc- cells were cultured in minimum essential medium (emem, safc c) with % fetal bovine serum at °c, % co . wild-type (wt) type prrsv strain vr- (genbank u ), passage on marc- cells, was titrated and used for the swine study. virus (rescued jxwn ; rjxwn ) was rescued from a cloned cdna of chinese highly pathogenic type prrsv strain jxwn [pwsk-jxwn; genbank ef , [ ] ] and passaged times on marc- cells for use in the swine study. the animal use protocol was reviewed and approved by the institutional animal care and use committee (iacuc) of the national animal disease center-usda-agricultural research service. thirty-two -week-old cross-bred pigs were obtained from a u.s. high-health herd and were found to be free of prrsv and influenza virus antibodies using commercially available enzymelinked immunosorbent assay (elisa) kits (herdchek prrs xr; idexx laboratories, westbrook, maine) and np elisa (multis elisa, idexx, westbrook, maine), respectively. pigs were also confirmed negative for porcine circovirus type by quantitative real-time pcr [ ] . one day prior to starting the experiment, pigs were bled, weighed and randomly assigned to one of four groups. group (n = ) consisted of negative control pigs, which received an intranasal ml sham inoculum of minimum essential media (mem) on dpi. group pigs (n = ) were challenged intranasally with ml of × % tissue culture infective dose (tcid )/ml of chinese prrsv strain rjxwn in animal biosafety level- -agriculture (absl- -ag) housing, where they remained for the duration of the experiment. group consisted of naïve pigs (n = ) that were placed in contact with group swine on dpi. group pigs (n = ) were challenged intranasally with ml of × tcid /ml of type prototype strain vr- . groups and were housed in separate isolation rooms in an absl facility. animal care and euthanasia were conducted in accordance with the report of the avma panel on euthansia and under the supervision of iacuc of nadc. serum and bronchoalveolar lung lavage fluid (balf) were tested for infectious virus as described previously [ ] . lungs were scored for gross lesions [ ] and sections fixed for histopathology. swabs were collected from balf, and various sites for bacterial isolation [ ] . following humane euthanasia, tracheobronchial lymph nodes (tbln) from in vivo hp-prrsv rjxwn (n = ), us prrsv vr- (n = ), or sham-infected pigs (n = ) were harvested at days post-infection and total cellular rna was prepared as follows. one gram of tbln from each pig was collected immediately upon necropsy, minced and stored in rnalater (life technologies, grand island, ny) at − °c until homogenized for extraction of total rna with magmax ™ - for microarrays total rna isolation kit (applied biosystems, carlsbad, ca) using the manufacturer's protocol. the integrity of the rna was confirmed with a bioanalyzer and rna nano-chip (agilent, santa clara, ca). the samples used had an average rna integrity number (rin) value of . and s: s rrna ratio of . . cdna library construction cdna libraries were constructed from pooled total cellular rna from the tbln in each treatment group using truseq sample prep kits (illumina inc., san diego, ca) and sequenced by × paired-end sequencing on an illumina hiseq instrument. in order to analyze the illumina reads, a series of bioinformatics methods were used to investigate gene expression profiles in tbln during prrsv infection with hp-prrsv rjxwn and us prrsv vr- at a snapshot of dpi. this was carried out with the construction of a rnaseq analysis pipeline ( figure ) comprised of gsnap for alignment and genome construction, and cufflinks to determine if differential expression and changes in transcript abundance were statistically significant. three files of transcriptome data from the sham, hp-prrsv rjxwn and us prrsv vr- inoculated groups were aligned to the ucsc pig genome build using the gsnap alignment program in preparation for differential expression analysis. the next step in the pipeline was to put the gsnap output into the cufflinks program and run it through three separate utilities or tools within the software package; cufflinks, cuffmerge, and cuffdiff. first the three files were run through cufflinks in order to assemble the aligned rna sequence reads into transcripts and estimate the abundances in fpkm of the paired-end reads. the cufflinks q-value was the false discovery rate (fdr)-adjusted p-value of the uncorrected test statistic. the q-value used in this study was . . the significance status was "yes" when p was greater than q after benjamini-hochberg correction for multiple-testing (additional file ). cuffmerge was then used to create a single transcript dataset from the multiple reconstructions. two runs were then conducted using the hp-prrsv rjxwn vs. control and the us prrsv vr- vs. control datasets using the cuffdiff program to test for differential expression and regulation amongst the two disease states. gene annotation of all significant hits was then carried out using a mysql database matching to the ensembl sscrofa . reference genome currently supported by the integrative genomics viewer (broad institute). datasets representing genes with altered expression profile derived from rnaseq analyses were imported into the ingenuity pathway analysis tool (ipa tool; figure computational pipeline. rnaseq analysis pipeline comprised of gsnap for alignment and cufflinks to determine if differential expression, and changes in transcript abundance were statistically significant (adapted from [ ] ). ingenuity w systems, redwood city, ca, usa; http:// www.ingenuity.com). in ipa, differentially expressed genes were mapped to genetic networks available in the ingenuity database and then ranked by score. the basis of the ipa program consists of the ingenuity pathway knowledge base (ipkb) that is derived from known functions and interactions of genes published in the literature. thus, the ipa tool allows the identification of biological networks, global functions within the host and functional pathways of a particular dataset. the program also gives the significance value of the differentially expressed genes, the other genes with which it interacts, and how the products of the genes directly or indirectly act on each other, including those not involved in the microarray analysis. the networks created are ranked depending on the number of significantly expressed genes they contain and also list diseases that were most significant ( figure ). assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the united states general overview of prrsv: a perspective from the united states porcine reproductive and respiratory syndrome: clinical disease, pathology and immunosuppression in utero infection by porcine reproductive and respiratory syndrome virus is sufficient to increase susceptibility of piglets to challenge by streptococcus suis type ii pathogenesis of porcine reproductive and respiratory syndrome virus infection in gnotobiotic pigs synergism between porcine reproductive and respiratory syndrome virus (prrsv) and salmonella choleraesuis in swine laboratory investigation of prrs virus infection in three swine herds a brief review of procedures and potential problems associated with the diagnosis of porcine reproductive and respiratory syndrome genetic, geographical and temporal variation of porcine reproductive and respiratory syndrome virus in illinois associations between genetics, farm characteristics and clinical disease in field outbreaks of porcine reproductive and respiratory syndrome virus comparison of the pathogenicity of two us porcine reproductive and respiratory syndrome virus isolates with that of the lelystad virus comparative pathogenicity of nine us porcine reproductive and respiratory syndrome virus (prrsv) isolates in a five-week-old cesarean-derived, colostrumdeprived pig model reproductive failure of unknown etiology genetic perspectives on host responses to porcine reproductive and respiratory syndrome (prrs) heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development lelystad virus and the porcine epidemic abortion and respiratory syndrome emergence of fatal prrsv variants: unparalleled outbreaks of atypical prrs in china and molecular dissection of the unique hallmark an infectious cdna clone of a highly pathogenic porcine reproductive and respiratory syndrome virus variant associated with porcine high fever syndrome the -amino-acid deletion in the nsp of highly pathogenic porcine reproductive and respiratory syndrome virus emerging in china is not related to its virulence experimental infection of united states swine with a chinese highly pathogenic strain of porcine reproductive and respiratory syndrome virus de novo assembly and analysis of rnaseq data transcript assembly and quantification by rna-seq reveals unannotated transcripts and isoform switching during cell differentiation genenames.org: the hgnc resources in cloning and characterization of porcine resistin gene porcine s a and s a : molecular characterizations and crucial functions in response to haemophilus parasuis infection effect of hypoxia and reoxygenation on the formation and release of reactive oxygen species by porcine pulmonary artery endothelial cells citrullination by peptidylarginine deiminase in rheumatoid arthritis identification of a gene encoding an acyl coa: diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis aberrant host immune response induced by highly virulent prrsv identified by digital gene expression tag profiling hp-prrsv challenge of and -week-old pigs indepth global analysis of transcript abundance levels in porcine alveolar macrophages following infection with porcine reproductive and respiratory syndrome virus molecular characterization of transcriptome-wide interactions between highly pathogenic porcine reproductive and respiratory syndrome virus and porcine alveolar macrophages in vivo lymphoid hyperplasia resulting in immune dysregulation is caused by porcine reproductive and respiratory syndrome virus infection in neonatal pigs infection with porcine reproductive and respiratory syndrome virus stimulates an early gamma interferon response in the serum of pigs effect of vaccination with selective bacterins on conventional pigs infected with type porcine circovirus in vivo growth of porcine reproductive and respiratory syndrome virus engineered nsp deletion mutants coinfection of pigs with porcine respiratory coronavirus and bordetella bronchiseptica uncovering the complexity of transcriptomes with rna-seq submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution we thank the following members of the virus and prion research unit at the national animal disease center: j. huegel, j. crabtree, a. burow, d. adolphson, s. anderson, m. kappes and a. vorwald for technical assistance. we also gratefully acknowledge d. alt of the genomics unit at the national animal disease center, and a. severin of iowa state university ngs bioinformatics, for assistance in data analysis. mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the u.s. department of agriculture. additional file : cuffdiff output of all significant hits for comparison, using the hp-prrsv rjxwn vs. control and the us prrsv vr- vs. control datasets, to test for differential expression and regulation amongst the two disease states. gene annotation (symbol) was carried out using a mysql database matching to the ensembl sscrofa . reference genome currently supported by the integrative genomics viewer (broad institute). location (row.names); gene annotation (symbol); entrez gene name; treatment (sample_ , sample_ ); status; abundance in fpkm (value_ , value_ ); differential expression (log _fold_change); test statistic (test_stat); p-value (p_value); false discovery rate (fdr)-adjusted p-value of the uncorrected test statistic (q_value); significance status after benjamini-hochberg correction for multiple-testing (significant).additional file : transcript sequences of all significant hits inthe hp-prrsv rjxwn vs. control and the us prrsv vr- vs. control datasets. the authors declare that they have no competing interests.authors' contributions lcm: study conception, data collection and analysis, research design, manuscript writing. df: research design, data analysis. aa: data analysis. dob: rnaseq interpretation discussions and data analysis. bg: infectious clone and production of virus stocks. kml: study conception, animal study execution, virus stocks, data collection, and manuscript preparation and writing. jnh: data collection. sns: data collection. h-cy: infectious clone of hp-prrsv strain jxwn . ksf: study conception, rescue of hp-prrsv infectious clone, and production of virus stocks. mek: study conception and manuscript preparation and writing. all authors read and approved the final manuscript. key: cord- - qslo qh authors: gizzi, aline baumann da rocha; oliveira, simone tostes; leutenegger, christian m; estrada, marko; kozemjakin, denise adamczyk; stedile, rafael; marcondes, mary; biondo, alexander welker title: presence of infectious agents and co-infections in diarrheic dogs determined with a real-time polymerase chain reaction-based panel date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: qslo qh background: infectious diarrhea can be caused by bacteria, viruses, or protozoan organisms, or a combination of these. the identification of co-infections in dogs is important to determine the prognosis and to plan strategies for their treatment and prophylaxis. although many pathogens have been individually detected with real-time polymerase chain reaction (pcr), a comprehensive panel of agents that cause diarrhea in privately owned dogs has not yet been established. the objective of this study was to use a real-time pcr diarrhea panel to survey the frequencies of pathogens and co-infections in owned dogs attended in a veterinary hospital with and without diarrhea, as well the frequency in different countries. feces samples were tested for canine distemper virus, canine coronavirus, canine parvovirus type (cpv- ), clostridium perfringens alpha toxin (cpa), cryptosporidium spp., giardia spp., and salmonella spp. using molecular techniques. results: in total, diarrheic and control dogs that were presented consecutively at a major private veterinary hospital were included in the study. overall, / ( . %) dogs with diarrhea were positive for at least one pathogen: a single infection in / dogs ( . %) and co-infections in / dogs ( . %), including / dogs ( . %) with dual, / ( . %) with triple, and / ( . %) with quadruple infections. in the control group, / ( . %) dogs were positive, all with single infections only. the most prevalent pathogens in the diarrheic dogs were cpa ( / dogs, . %), cpv- ( / dogs, . %), and giardia spp. ( / dogs, . %). cpv- was the most prevalent pathogen in the dual co-infections, associated with cpa, cryptosporidium spp., or giardia spp. no statistical difference (p = . ) was observed in the duration of diarrhea or the number of deaths (p = . ) in the presence or absence of single or co-infections. conclusions: diarrheic dogs showed a higher prevalence of pathogen infections than the controls. whereas the healthy dogs had only single infections, about half the diarrheic dogs had co-infections. therefore, multiple pathogens should be investigated in dogs presenting with diarrhea. the effects of multiple pathogens on the disease outcomes remain unclear because the rate of death and the duration of diarrhea did not seem to be affected by these factors. canine infectious diarrhea has been considered a challenge for veterinarians because of its pathogenic variability and the concurrent presence of viral, bacterial, and protozoan co-infections [ , ] . whereas some pathogens remain on the mucosal surface and produce potent enterotoxins that can disrupt the fluid flux, others penetrate and replicate within intact epithelial cells, producing inflammatory damage and/or destroying the host cells, which are overlapping pathological processes [ ] . however, many dogs harbor potential pathogens without any clinical signs, so the cause-effect relationships are far from clear. molecular tools have been used for the identification and diagnosis of infectious diseases, in addition to conventional culture techniques and antibody-based tools [ , ] . among these molecular approaches, the use of real-time polymerase chain reaction (pcr) has greatly improved the sensitivity and sensibility of standard pcr assays of pathogens in canine fecal samples [ ] . therefore, although a number of pathogens have been individually detected with real-time pcr, including salmonella spp. [ ] and pathogenic escherichia coli strains [ ] , a comprehensive panel of potentially diarrhea-causing pathogens in owned dogs is yet to be established. therefore, the aim of this study was to investigate pathogenic co-infections in populations of diarrheic and control owned dogs using a real-time pcr analysis of a panel of diarrhea-causing agents. potential enteropathogens were identified in / ( . %) diarrheic samples in the present study, most of which contained multiples pathogens. single infections were observed in / ( . %) positive samples and coinfection in / ( . %) possible samples. dual, triple, and quadruple infections were observed among the coinfections ( table ). the most prevalent agent involved in co-infections was canine parvovirus type (cpv- ), and / ( . %) of the diarrheic samples positive for cpv- were associated with others agents, most commonly with clostridium perfringens alpha toxin (cpa), cryptosporidium spp., and giardia spp. although / ( . %) of the feces samples from the control dogs were positive for the panel of diarrhea-causing pathogens, no co-infection was observed in any of these samples. of the / ( . %) dogs with diarrhea and positive results, . %, . %, and . % had pure viral, bacterial, and protozoan infections, respectively, whereas . %, . %, and . % of samples from the control dogs were positive for viral, bacterial, and protozoan infections, respectively. the association of viral and bacterial infections was the most prevalent type of co-infection in the diarrheic group ( . %), with cpv- and canine coronavirus (ccov) constituting . % of this type of co-infection. viral and protozoan co-infections accounted for . % of these associations, bacterial and protozoan for . %, and viral, bacterial, and protozoan co-infections for . % (table ) . a significant association was found between dogs with diarrhea and positive results on the real-time pcr diarrhea panel compared with the control dogs with normal feces (p < . ). the detection of individual pathogens in the panel with real-time pcr (table ) showed that cpa was the most prevalent pathogen in the fecal samples, infecting / ( . %) diarrheic dogs and / ( . %) control dogs, and the difference between the groups was highly statistically significant (p = . ). despite this, it was necessary to quantify cpa to consider its probable role. when the pre-established cutoff of > , copies/g of feces was applied [ ] , a significant difference (p = . ) between the control group ( / , . %) and the diarrheic group ( / , . %) was observed. cpv- was the second most prevalent pathogen, found in / ( . %) diarrheic dogs and / (none) control dogs, and also showed a highly significant difference between the groups (p < . ). although / ( . %) diarrheic dogs were positive for canine distemper virus (cdv), the difference between the diarrheic and control dogs was not significant (p = . ). similarly, / ( . %) diarrheic and / ( . %) control dogs were positive for ccov, and these rates were not significantly different (p = . ). only / ( . %) and / ( . %) diarrheic dogs were positive for salmonella spp. and cryptosporidium spp., respectively. in the control group only / ( . %) were positive for cryptosporidium spp., and the two groups did not differ significantly (p = . ). although giardia spp. were detected in / ( . %) diarrheic dogs and / ( . %) control dogs, the difference was not significant (p = . ). among the diarrheic samples, / were from - year-old dogs, / from - -year-old dogs, and / from dogs > years old. the pcr results were positive in / ( . %) samples from animals - years old, in / ( . %) samples from those - years old, and / ( . %) samples from those > years old. a significant association was observed between dog age and the pathogens cpv- (p < . ), giardia spp. (p = . ), and ccov (p = . ), which were most prevalent among the - -year-old dogs. although cpv- is considered to be primarily a disease of puppies, it also occurred in / ( . %) animals aged - years and in / ( . %) dogs aged > years. only / ( . %) of the positive animals for cpv- had no history of vaccination, in which / ( %) and / ( . %) were adults with - years and years respectively. details of dates and brands of the vaccines were not obtained. there was a highly significant association between age and co-infection (p < . ), which was more prevalent among the - -year-old dogs, of which / ( . %) had co-infections with two or more pathogens. co-infection occurred less often in the other age groups, occurring in / ( . %) dogs in the - -year-old group and / ( %) dogs > years old. a significantly higher prevalence (p = . ) of viral and protozoan associations was observed in the - -year-old diarrheic dogs than in the other age groups. however, no significant associations between the other co-infections and age were observed. no significant association (p = . ) was observed between the duration of diarrhea and the presence of single or co-infections. the presence of co-infection did not increase the number of deaths (p = . ) more than the presence of a single infection. in this study, even when diarrhea lasted for more than days, an infectious disease was still clinically suspected (p = . ). during the period from sample collection to the generation of results for the diarrhea panel analysis (approximately five days), / ( . %) dogs received empirical treatment with combinations of two to four antibiotics. in total, / ( . %) diarrheic dogs with positive pcr results were treated with antibiotics that were, according to the literature, inappropriate for the pathogens ultimately identified. in total, / ( . %) and / ( . %) fecal samples from diarrheic and control dogs, respectively, were positive on parasitological tests. the most prevalent intestinal parasites found in the diarrheic samples were protozoa (giardia spp. and/or isospora spp.), which affected / ( . %) dogs, and helminths (ancylostoma sp. and/or toxocara sp.), which affected / ( . %) dogs. all the parasites found in the three positive control samples were identified as ancylostoma sp. when all the samples from diarrheic and control dogs were considered, / ( . %) positive fecal samples and / ( . %) negative fecal samples on parasitological tests were also positive on the real-time pcr diarrhea panel. of the / ( . %) samples positive for helminths (ancylostoma sp. and/or toxocara sp.), / ( . %) were also positive on the real-time pcr. among the / ( . %) samples negative for helminths, / ( . %) were positive on the real-time pcr. dogs positive for helminths were . times more likely to be positive on the real-time pcr diarrhea panel, which indicates a statistically significant association (p = . ) between the infections detected with real-time pcr and the presence of helminths. of the / ( . %) samples shown to be positive for giardia spp. with real-time pcr, only five were positive on the parasitological tests. considering that real-time pcr is the gold standard for the detection of pathogenic agents, the parasitological test showed . % sensitivity ( % confidence interval, . %- . %). isospora spp. were found in / ( . %) samples with the parasitological test, and all of these samples were also positive for the agents detected with real-time pcr, suggesting that isospora spp. are usually involved in co-infections. the prevalence of diarrheic dogs observed in the brazilian samples ( . %) was similar to that observed in the united states ( . %), australia ( . %), canada ( . %), united kingdom ( . %), and japan ( . %), as shown in table . the rate of co-infection observed in brazilian diarrheic dogs ( . %) was also higher than those in the other countries tested (table ) and a significant difference was observed between united states (p < . ), australia (p = . ) and canada (p = . ). a high prevalence ( . %) of diarrheic dogs, shown to harbor at least one pathogen by real-time pcr, was observed in the brazilian samples, which exceeded those in the united states ( . %), australia ( . %), canada ( . %), united kingdom ( . %), and japan ( . %), as shown in table . the rate of co-infection observed here in diarrheic dogs ( . %) was also higher than those in the other countries tested. despite the higher prevalence of enteropathogens and co-infections in brazil, the rates in the other countries are also relevant, indicating that infectious diarrhea may be a global phenomenon rather than a phenomenon specific to a particular country. because all dogs with co-infections belonged to the diarrheic group and co-infections were observed in all age categories, this study highlights the importance of investigating multipathogen co-infections, especially in dogs aged - years, in which the rate of co-infection was -fold higher than in the other age groups. many enteric viruses, bacterial pathogens, and parasites probably contribute to disease both individually and in combination [ ] , and together, co-infecting pathogens may cause more severe diarrhea than infections with each pathogen alone [ ] . the pathogens involved in a co-infection can interact synergistically, for example via the host's immune system, with the presence of one enhancing the abundance and/or virulence of the other, resulting in even greater pathogenesis and a greater contribution to the overall disease burden [ , ] . therefore, interspecific pathogen interactions can alter the pathogen dynamics, host health, and the success of control strategies [ , ] . in this study, co-infection did not increase the duration of diarrhea and there was no significant difference in the number of deaths in animals with or without co-infections. because there was no reliable correlation between the interaction of enteropathogens in co-infections in this study, the cause-effect relationship between the presence of an organism and the occurrence of diarrhea is still unclear. opportunistic or commensal organisms may be identified from an imbalance in the intestinal flora or dysbiosis, and not all the co-infecting agents present must be treated to produce a good outcome. however, because all the infectious agents evaluated here have been described as causing diarrhea in experimental studies, knowledge of their presence allows treatments and prevention strategies to be planned. in this study, even when diarrhea persisted for more than days, the infectious diseases were still present in the differential diagnosis. empirical treatments and the use of several antibiotics are common in routine veterinary practice and the use of a panel to detect multiples pathogens prevents the incorrect or excessive use of antimicrobial drugs, which could cause resistance. furthermore, some of these pathogens are potential zoonotic agents, including hookworms, giardia spp., cryptosporidium spp., and salmonella spp., and the identification of these organisms can reduce the risk of their transmission to humans and others animals. although this study focused on client-owned dogs, dogs received in animal shelters are also expected to carry pathogen co-infections, including zoonotic agents [ ] . however, differences have been observed in the prevalence of each agent, especially in terms of the co-infection rates, and dogs from shelters with diarrhea showed a higher prevalence of co-infection ( . %) [ ] than was observed in this study ( . %). that heterogeneous dog population had a higher rate of crowding, and the dogs may have been immunocompromised for clinical, nutritional, and/or psychological reasons, exposed to more environmental pathogens, and sometimes with inadequate health care, so their high co-infection rate cannot be compared validly with that of owned dogs in households. the highest rate of co-infection in this study involved the association of viral and bacterial agents, in contrast to the highest co-infection in dogs in the united states, which was caused by viruses and protozoans. the highest co-infection rates were for cpv- and cpa, observed in / ( . %) samples from dogs in brazil, and for ccov and giardia spp., which occurred together in . % of dogs from the united states. these co-infections may have clinical effects and may require more-intensive efforts to ensure the appropriate treatments to eliminate specific pathogens and to correct electrolyte, acid-base, and nutritional disturbances, potential sepsis, and other metabolic consequences [ ] . the alpha toxin gene is present in all strains of clostridium perfringens and may be found in asymptomatic dogs as part of the normal intestinal microflora [ ] , as in % of the control dogs in the present study. data from some studies indicate that conventional pcr that targets only cpa will almost always be positive and of virtually no clinical use [ ] . however, a recent study demonstrated that the quantification of cpa may be used as a diagnostic marker for association of the agent in patients with diarrhea [ ] . using the same methodology and cutoff value as a previous study [ ] , we observed a significant difference between the control group ( / , . %) and in the diarrheic group ( / , . %; p = . ) in the proportion of animals positive for > , copies of cpa. the higher amount of cpa in the diarrheic dogs than in the control dogs suggests that the high concentrations of toxins produced by this organism exert a pathogenic effect on the gastrointestinal tract. in the present study, diarrheic dogs co-infected with cpa had -fold more copies than those that were infected with only cpa. we hypothesize that in these cases, c. perfringens overgrowth in the bacterial flora increases the toxin expressed, which contributes to the dog's diarrhea. all the control dogs were negative for cpv- , which was strongly associated with diarrhea (p = . ), with an overall occurrence of / ( . %) in the diarrheic dogs. the same prevalence ( / , . %) was observed in a study also conducted in brazil but performed only with puppies up to months old [ ] and corroborated with previous surveys, which reported rates varying from % [ ] to % [ ] . although cpv- has been considered to be primarily disease of puppies, the present study has shown the importance of also investigating adult dogs for cpv- , since occurred in . % of - year old dogs and in . % of dogs older than years. the cpv- was most prevalent agent involved in co-infections in this study, in which . % of the diarrheic samples positive for cpv- were associated with others agents, contrasting with only . % cpv- co-infection observed in the study with puppies [ ] . this variability may be related to the geographic regions examined, the populations studied, agents investigated and the diagnostic techniques used [ ] . although the date of live-modified vaccination was not the focus of this study, the cpv- cutoff value used was able to differentiate vaccine strains from wild-type infections. despite the use of vaccination, the cpv- was still spread among the dogs as observed in this study, in which only / ( . %) of the positive animals for cpv- had no history of vaccination. still remains unclear whether type- vaccines can provide protection against the new variants of the cpv, but a recent study observed that the cases of vaccine failure are most likely not associated to the mutations detected in the sequenced regions [ ] . thus, further studies should elucidate whether local parvovirus strains are effectively controlled by the currently available vaccines and which factors may be associated with the vaccination efficacy. cpv- was the most prevalent agent associated with dual co-infections in the present study, which may be attributable to highly contaminated environments or low dog immunity [ ] . although the detection rate of ccov was higher in the diarrheic dogs ( . %) than in the control dogs ( . %), the lack of a statistically significant difference in these rates may indicate a secondary role for ccov as an intestinal pathogen in dogs. although the shedding of cpv- seemed to be associated with clinical signs of gastroenteritis, ccov was also detected in healthy dogs, as previously reported [ ] . although ccov infections are characterized by high morbidity and low mortality, with typically mild enteritis in dogs [ , ] , / ( . %) diarrheic dogs with ccov were co-infected with other enteric pathogens, which may have aggravated their clinical signs and even caused higher mortality, as reported earlier for cpv- [ ] , canine adenovirus type [ ] , and cdv [ ] . cdv tended to be significantly higher in the diarrheic dogs than in the control dogs; although not significant, the p value was very close to the limit of significance (p = . ). whereas some enteropathogens, such as salmonella spp., cryptosporidium spp., and giardia spp., showed similar prevalences in the various countries tested (table ) , cdv and cpv- were approximately -fold more prevalent in brazil, indicating that the higher incidence of viral diseases may be related to differences in strain pathogenicity, vaccination status, and environmental factors. although the cpv- strain and vaccine status/response may play important roles in viral infection and host immunity, further studies are required to fully understand this specific pattern of cpv- infections in brazil. although intestinal parasites contribute to diarrhea, . % of positive and . % negative samples on the parasitological tests were also positive on the real-time pcr diarrhea panel, indicating that fecal parasitological tests alone should not be used as a single diagnostic tool. to the best of our knowledge, this is the first real-time pcr-based analysis of a panel of diarrhea-causing pathogens performed in brazil. our results indicate that dogs with diarrhea show a relatively high prevalence of pathogenic infections, highlighting the importance of investigating infectious pathogens in dogs with diarrhea. whereas asymptomatic dogs had single infections only, approximately half the diarrheic dogs presented with co-infections, emphasizing the importance of the simultaneous investigation of multiple pathogens in individual samples. the most prevalent pathogens in diarrheic dogs in brazil were c. perfringens alpha toxin, cpv- , and giardia spp. among the dual co-infections observed, cpv- was most commonly associated with c. perfringens alpha toxin, cryptosporidium spp., and giardia spp. in this study, co-infection did not increase the duration of diarrhea or increase the risk of death. however, considering that all the infectious agents examined have been described as causing diarrhea in experimental studies, knowledge of their presence should allow us to plan treatments and prevention strategies. the effects of multiple pathogens on the disease outcomes remain unclear, because neither the death rate nor the duration of diarrhea seemed to be affected by these factors. a total of ( diarrheic and asymptomatic) dogs consecutively presented by owners to the largest private veterinary hospital of curitiba city, southern brazil, were included in the study for the realization of the real-time pcr diarrhea panel, parasitological diagnosis and clinical data collection. fresh fecal samples were collected from all brazilian dogs, placed in plastic vials, and kept refrigerated at °c until processing. at sampling, the fecal specimens were scored according to a five-point fecal scoring system for dogs, as previously described [ ] : , liquid or watery feces with no form; , very soft, unformed feces; , very soft, moderately formed feces; , firm, well-shaped and cylindrical feces. diarrheic dog feces included those with scores from to , whereas the control dogs had no history of gastrointestinal disorders (vomiting, diarrhea, or anorexia) and fecal samples with a score of . additionally, results from , commercial samples using the same real-time pcr diarrhea panel performed in the brazilian samples were obtained from samples originated from united states ( ), australia ( ), canada ( ), united kingdom ( ) and japan ( ). the real-time pcr results for samples collected in different countries (table ) were obtained either by shipping the samples to the united states for commercial realtime pcr analysis (samples from brazil, united states, australia, united kingdom, and japan) or by allowing the diagnostic samples to be analyzed with the same real-time pcr procedure by the same service provider in the country of origin (canada). nucleic acid quantities, stability, and quality were assessed using internal sample controls when the samples were shipped to the united states for real-time pcr analysis. the study was approved by the ethics committee in animal experimentation and animal welfare of the federal university of parana curitiba campus, paraná state, southern brazil (protocol number / ). the diarrheic dogs were evaluated for the duration of diarrhea and death in relation to the presence of single or co-infections. was also evaluated whether the clinical suspicion of association with infectious agents was related to the duration of diarrhea (≤ days, days to months, and > months) and whether the correct antibiotics were used (for empirical treatment after sample collection but before the results were obtained) based on the pathogen ultimately detected. total nucleic acids were extracted with standard protocols using a commercial platform (corbett xtractor-gene, qiagen, valencia, ca, usa). a housekeeping gene ( s rrna) was used to determine the amounts of genomic dna and cdna after reverse transcription and to confirm dna integrity. the pcr tests were based on the idexx proprietary realpcr™ service platform (idexx laboratories, inc., westbrook, me, usa). briefly, conserved nucleotide regions were selected and two primers and a hydrolysis probe were designed to hybridize to them, using commercial software (primerexpress version . , applied biosystems, foster city, ca, usa). an additional two primers flanking the fragment amplified in the real-time pcr assay were designed for sequence verification purposes. fecal samples were tested by hydrolysis probe-based realtime pcr assay for a panel of potential enteropathogens, including cdv (phosphoprotein g, genbank acccession number ay . ), ccov (m gene, type i, af ; typ eii d ), cpv- (vp , u ), cpa (alpha toxin, l ), cryptosporidium spp. (ssrrna, a ), giardia spp. (ssrrna, dq ), and salmonella spp. (invasion a gene, eu ) at a reference laboratory within days after collection. cpa was quantified using a pre-established cutoff of > , copies/g of feces [ ] . for cpv- a cutoff value was used to discriminate vaccine strains from wildtype infections ( . million cpv- gene equivalents per gram of stool). real-time pcr was performed with standard primer and probe concentrations using a commercially available mastermix (lc probesmaster, roche applied science, indianapolis, in, usa) on a commercially available real-time pcr platform (roche lightcycler ). real-time pcrs were validated analytically and clinically. for the analytical validation, each assay was required to meet six validation criteria: amplification efficiency, linearity, intra-run reproducibility, inter-run reproducibility, r value, and signal-to-noise ratio of the fluorescent signal using a specific synthetic positive control. each assay had an analytical sensitivity of molecules and an amplification efficiency between % and %. clinical samples were selected based on a reference method for each test and a correlation study was performed. the analytical specificity of all real-time pcr tests was confirmed by resequencing the clinical sample material using additional primer pairs positioned outside the synthetic positive control. diagnostic sensitivity and specificity based on comparisons with reference testing methods were in the high % for each real-time pcr test. gold standard tests included the immunofluorescence antibody assay for cdv, enzyme-linked immunosorbent assay for cpv- and giardia, and real-time pcr performed at the university of california davis for ccov, cryptosporidium, and salmonella. to validate each pcr panel test result, seven quality controls were used for each sample tested: ) pcr positive controls (quantitative); ) pcr negative controls; ) negative extraction controls (five per -well plate); ) dna internal sample control targeting the host s rrna to quantify the dna in the submitted diagnostic sample; ) rna internal sample control targeting the host s rrna to quantify the cdna in the submitted diagnostic sample after reverse transcription; ) control to monitor environmental contamination; and ) spike in the internal positive control to monitor pcr inhibition. these controls were used to assess the functionality of the pcr test protocol ( ), the absence of contamination in the reagents ( ) and laboratory ( ) , the absence of cross-contamination during the extraction process ( ), the quality and integrity of the dna and rna as a measure of sample quality ( and ), the rt protocol ( ), the absence of random positive pcr signals within the pcr laboratory ( ) , and the absence of pcr inhibitory substances carried over from the sample matrix ( ). a fecal flotation procedure was performed with zinc sulfate [ ] and saturated sodium chloride [ ] flotation solutions, as described previously. the parasitological test was performed with light microscopy by identifying the parasite eggs, larvae, cysts, and oocysts, according to their morphological characteristics [ , ] . the results were subjected to statistical analysis with the χ test or fisher's exact probability. differences were considered significant when p < . . the statistical analysis was performed at a website for statistical computation (vassarstats, vassar college, poughkeepsie, ny, usa). abbreviations cdv: canine distemper virus; ccov: canine coronavirus; cpv- : canine parvovirus type ; cpa: clostridium perfringens alpha toxin. the authors declare that they have no competing interests. gastric disease laboratory evaluation of gastrointestinal disease gastrointestinal and intra-abdominal infections a technological update of molecular diagnostics for infectious diseases real-time pcr in the microbiology laboratory detection of salmonella spp in fecal specimens by use of real-time polymerase chain reaction assay prevalence of urovirulence genes cnf, hlyd, sfa/foc, and papgiii in fecal escherichia coli from healthy dogs and their owners toxin quantification of clostridium perfringens is a predictor for diarrhea in dogs and cats a millennium update on pediatric diarrheal illness in the developing world rotavirus disease: impact of coinfections the nature and consequences of coinfection in humans synergistic effects between rotavirus and coinfecting pathogens on diarrheal disease: evidence from a community-based study in northwestern ecuador pathogen interactions population cycles, and phase shifts emphasizing the ecology in parasite community ecology enteropathogens identified in dogs entering a florida animal shelter with normal feces or diarrhea clinical evaluation of dogs and cats with specific clinical singns genotypic and phenotypic characterization of clostridium perfringens and clostridium difficile in diarrheic and healthy dogs canine parvovirus (cpv) and intestinal parasites: laboratorial diagnosis and clinical signs from puppies with gastroenteritis comparison of the prevalence of enteric viruses in healthy dogs and those with acute haemorrhagic diarrhoea by electron microscopy epidemiology of canine parvovirus and coronavirus in dogs presented with severe diarrhoea to pdsa petaid hospitals cubel garcia rc: monitoring of canine parvovirus (cpv) strains detected in vaccinated puppies in brazil canine parvovirus -a review of epidemiological and diagnostic aspects, with emphasis on type c an update on canine coronaviruses: viral evolution and pathobiology western european epidemiological survey for parvovirus and coronavirus infections in dogs first detection of canine parvovirus type c in pups with haemorrhagic enteritis in spain infectious canine hepatitis: an "old" disease reemerging in italy canine distemper and related diseases: report of a severe outbreak in a kennel clinical evaluation of patients with chronic diarrhea comparison of common fecal flotation techniques for the recovery of parasite eggs and oocysts exame de fezes para diagnostico de parasitas common laboratory procedures for diagnosing parasitism presence of infectious agents and coinfections in diarrheic dogs determined with a real-time polymerase chain reaction-based panel the authors thank dr. marcelus sanson, dr. david powolny, dr. daphine m. albino, dr. mariana c. oliveira and dr. marcel preindl for the technical assistance. authors' contributions abrg, sto, awb, cl conceived the study, participated in its design and coordination. abrg, dak, cl, me participated in data acquisition and performed the laboratory assays. rs conducted the statistical analyses. all authors participated in drafting the manuscript, read and approved the final manuscript. key: cord- -a r xh c authors: cornelissen, jan b. w. j.; de bree, freddy m.; van der wal, fimme j.; kooi, engbert a.; koene, miriam g. j.; bossers, alex; smid, bregtje; antonis, adriaan f.; wisselink, henk j. title: mycoplasma detection by triplex real-time pcr in bronchoalveolar lavage fluid from bovine respiratory disease complex cases date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: a r xh c background: in this study we evaluated the respocheck mycoplasma triplex real-time pcr for the detection in bronchoalveolar lavage fluid (balf) of mycoplasma (m.) dispar, m. bovis and m. bovirhinis, all three associated with bovine respiratory disease (brd). primers and probes of the respocheck mycoplasma triplex real-time pcr are based on the v /v region of the s rrna gene of the three mycoplasma species. results: the analytical sensitivity of the respocheck triplex real-time pcr was, as determined by spiking experiments of the mycoplasma strains in phosphate buffered saline, colony forming units (cfu)/ml for m. dispar, and cfu/ml for m. bovis or m. bovirhinis. the analytical sensitivity of the respocheck mycoplasma triplex real-time pcrwas, as determined on purified dna, fg dna per assay for m. dispar and fg fo rm. bovis and m. bovirhinis. the analytical specificity of the respocheck mycoplasma triplex real-time pcr was, as determined by testing mycoplasmas strains (n = ) and other bacterial strains (n = ), , . and . % for m. bovis, m. dispar and m. bovirhinis respectively. the respocheck mycoplasma triplex real-time pcr was compared with the pcr/dgge analysis for m. bovis, m. dispar and m. bovirhinis respectively by testing balf samples from calves. conclusion: in conclusion, the respocheck pcr assay can be a valuable tool for timely and accurate detection of three mycoplasma species associated with in bovine respiratory disease. bovine respiratory disease complex (brdc) is a global problem causing severe economic losses to the cattle farming industry through mortality, loss of production, and treatment costs [ , ] . it has a complex etiology that involves various pathogens, host factors, and environmental factors. viruses such as bovine herpes virus (bohv- , parainfluenza virus (pbiv- ), bovine respiratory syncytial virus (brsv), respiratory bovine coronavirus (bocov) and bovine viral diarrhoea virus (bvdv) in conjunction with stress factors have been implicated as causes of respiratory tract infections of cattle by immunosuppression and damage to the respiratory epithelium [ ] . a primary viral infection can be followed by an opportunistic secondary infection with bacteria like mannheimia haemolytica, pasteurella multocida, histophilus somni, or trueperella pyogenes [ , , ] , but these bacteria could also act as primary pathogen. in addition it has become increasingly clear that mycoplasmas are important contributors to brd, either as primary pathogens or in co-infection [ , [ ] [ ] [ ] [ ] . m. bovis is the best known mycoplasma species causing respiratory disease [ , ] , but also m. dispar and m. bovirhinis have been associated with brd [ , [ ] [ ] [ ] . m. bovis has not only been identified as a primary or opportunistic pathogen in brd in beef cattle worldwide, but it has also been implicated in other clinical manifestations in cattle, such as mastitis, otitis, arthritis, and reproductive disorders [ ] . m. bovirhinis and m. dispar are regularly isolated from the nasal cavity of cattle with respiratory disease and are usually regarded as an opportunistic pathogen in respiratory diseases [ , ] . bacteriological, serological and histopathological examinations are important tools to detect particular animal-carriers of mycoplasma [ ] , however, these assays are time-consuming, insensitive and can give false positive results. bronchoalveolar lavage fluid (balf) from calves with brd may contain various potential pathogens, but additional antibiotic use in the affected herds can inhibit cultivation and thereby can cause falsenegative test results. in brd, differential diagnosis of these pathogens with rapid turnaround time procedure is essential to implement appropriate treatment and intervention measures in a timely manner. rapid detection of these pathogens at the early stage of outbreak can contribute substantially to minimize the spread of infection and increase treatment efficiency. today quick, highly sensitive and species-specific pcrs are used in the diagnosis of mycoplasma-associated diseases for m. dispar [ , ] , m. bovis [ , ] and m. bovirhinis [ ] in balf or nasal swabs. combining a s ribosomal dna pcr with denaturing gradient gel electrophoresis fingerprinting (pcr/dgge) enabled the simultaneous detection of mixed mycoplasma populations, however information about the detection limit in clinical samples is limited [ ] . additionally, a dna microarray assay was developed for the parallel detection of mycoplasma species [ ] , in which species-specific probes derived from the s rrna and tuf genes were used for species differentiation. multiplex real-time pcr could be a promising and practical approach to speed up the differential diagnosis from to weeks for traditional culture to h, with limited expenses. this will make diagnostic testing more accessible for veterinary practitioners and thereby improve brd diagnosis. this report describes the respocheck triplex pcr developed by central veterinary institute (cvi, lelystad, the netherlands) for detection of three mycoplasma species. m. bovis (atcc ) and m. bovirhinis (atcc ) were purchased from the atcc (united kingdom (u.k.), guernsey, ireland, jersey and liechtenstein) and cultured in heart infusion broth medium (difco, detroit, mich.). all isolates were grown at °c and % co for seven days in a modified standard mycoplasma broth medium [ ] calves (n = ) with or without brd (increased respiratory rate and/or dyspnoea) were sampled for diagnostic purposes. sampling of the calves was granted an exemption from requiring ethics approval by the institutional animal experiment commission "dier experimenten commissie (dec) lelystad ( .b)" because sampling was performed for diagnostic purposes. bal samples were obtained as described [ ] . approximately - ml bal was obtained from each calf after instillation of ml pbs with % fetal calf serum (fcs). foam, large purulent exudates and blood clots were removed from the balf samples under aseptic conditions. balf ( ml) was centrifuged ( ×g, min, °c). sediment was resuspended in . ml dulbecco's minimal essential medium (dmem) with % fcs, carefully added to ml freeze medium (dmem, % fcs and % dmso) and frozen at − °c. the balf supernatants were also stored at − °c. for testing the influence of centrifugation of balf samples ( ×g, min, °c) on the pcr results we tested three variants of balf samples: without centrifugation, supernatant and pellet obtained after centrifugation ( times concentrated). dna was extracted from μl aliquots of balf samples. we used the magna pure lc total nucleic acid isolation kit (roche applied science), with the total na external_lysis" protocol (version . ). with the magna pure lc total nucleic acid isolation kit) samples can processed per run. in all runs a positive control (a mix of . × cfu/ml m. bovis, . × cfu/ml m dispar and . × cfu/ml m. bovirhinis) and a negative water control (ntc) was included. to enable testing of testing for brd associated pathogens in a routine setting, real-time pcrs for detection of viral, bacterial and mycoplasma pathogens in bronchoalveolar lavage fluid (balf) of calves have been set up by the central veterinary institute (lelystad, the netherlands) under the name respocheck. primers and probes specific for the bacterial s, v and v regions were based on the full length, bacterial s sequences ( , in july ) were used from the nuccore database at the national center for biotechnology information (ncbi, usa, http://www.ncbi.nlm.nih.gov/nuccore). for m. bovirhinis and m. dispar the nearly full length s sequences were used. these sequences and their taxonomic information were used to build an insigniabased database [ ] from which pathogen-specific sequence regions were extracted with special interest for the v and v region because these sequences are often targeted for metagenomic next-generation sequencing (ngs) [ ] . using the identified regions, primers and probes were designed with alleleid . . (premier biosoft, palo alto, usa). the resulting triplex pcr was designated respocheck mycoplasma triplex real-time pcr the specificity of the mycoplasma primers and probes was also verified against v -v partial sequences of m. flocculare, m. ovipneumonia and m. hyopneumonia. the quantifast triplex kit real time-pcr kit (qiagen) was used for the respocheck mycoplasma triplex realtime pcr. the assays were conducted in a μl reaction mix containing μl of the nucleic acid sample, nm of each primer, nm of each mgb probe, × quantifast triplex real time-pcr master mix and sterile deionised water. all reactions were conducted with an abi- with the following cycling parameters: °c for min, followed by cycles of °c for s and °c for s. the machine was set to acquire fluorescence on the fam, vic, and ned channels for respectively m. bovis, m. dispar and m. bovirhinis all primers and probes were obtained from life technologies europe bv (bleiswijk, the netherlands). the final results were analysed using abi- software (version . ). samples with a ct of cycles or less were considered to be positive. the analytical sensitivity of the respocheck triplex pcr was defined as the ability to detect the lowest concentration of m. bovis, m. dispar and m. bovirhinis expressed as a concentration (cfu/ml) [ ] . the analytical bovirhinis ( × cfu/ml) in seven -fold serial dilutions in balf of specific pathogen free (spf) calves of - weeks old. dilution resulted in a series of m. bovis, m. dispar and m. bovirhinis spiked balf samples, ranging from × cfu/ml down to . cfu/ml. total dna was isolated from each μl sample with the magna pure isolation kit and the ct was determined for each sample ( μl) by both the single and respocheck triplex pcr assays. the slope of the curve, the efficiency and the detection limit (for dna ng/μl; for cells cfu/ml) for each pcr was determined. to determine the analytical specificity of the designed respocheck triplex pcr, mycoplasma isolates and bacterial strains (table ) were tested. diagnostic sensitivity and specificity in balf samples from calves. for determining the diagnostic specificity, balf samples were analysed with the pcr/dgge method by the animal and plant health agency (apha, mycoplasma team, addlestone surrey, uk) as earlier described [ , ] . to determine the analytical sensitivity of the pcr/ dgge analysis, four -fold serial dilutions of m. bovis ( × cfu/ml), m. dispar ( × cfu/ml), and m. bovirhinis ( . × cfu/ml), were prepared in pbs. samples were sent to the apha and analysed using the pcr/dgge method. s rdna pcr-sequencing was used for confirmation of the results of respocheck mycoplasma triplex realtime pcr. s rdna of the dgge positive /pcr positive (n = ) and dgge negative /pcr positive (n = ) was amplified using the specific mycoplasma primers of the respocheck mycoplasma triplex realtime pcr. dna was sequenced by baseclear (leiden, the netherlands) by an automated dna sequencer. the nucleotide sequences were compared with genbank sequences using the basic local-alignment search tool(blast) of the ncbi-nih for homology [ ] . pairwise sequence alignments were performed using the clustal algorithm implemented in the program dna star (dnastar inc., madison, wi). the analytical sensitivity of the respocheck triplex pcr was determined by its ability to detect a low concentration of m. bovis, m. dispar and m. bovirhinis and therefore expressed as a concentration (ng/assay and cfu/ml) [ ] . the analytical specificity of the assay was calculated for each target microorganism using the following definition for specificity as the percentage of true negative samples/ the number of true negative samples and the number of false positive samples [ ] . calculation of diagnostic sensitivity, specificity and cohen's kappa coefficient was performed as described [ ] . we therefore used the results of the pcr/dgge analysis as reference standard. differences in pcr results were analysed for statistical significance by the non-parametric mann-whitney u test in the graphpad prism version . software, with p < . considered significant. the linearity of quantification of the respocheck triplex mycoplasma real-time pcr was established through a linear regression plot by plotting the ct-values against the values of log dna concentration tested per reaction. the m. dispar single and respocheck triplex realtime pcr showed a linear detection range from ng to fg dna per assay with a linear correlation (r ) value of . (table ; fig. .) . the m. bovis and m. bovirhinis single and respocheck real-time pcr showed a linear detection range from from ng to fg dna per assay, with a r value of . (table ; fig. ). in balf to study the influence of centrifugation of the balf samples on the pcr results we compared the pcr results from the balf samples before and after centrifugation ( min at ×g). a significant lower ct-value (p < . ; non-parametric wilcoxon statistics) in the respocheck mycoplasma triplex realtime pcr was found for m. bovis and m. dispar in the pellet of the centrifuged balf samples. several m. bovis, m. bovirhinis and m. dispar mix-infections could be detected in one balf sample with a difference of ct-values between the three species and were in accordance with the pcr/dgge analysis (fig ) . therefore we used the pellet of the centrifuged balf samples ( × concentrated) to determine the presence of the three mycoplasma species in balf samples by real-time pcr. the calculated diagnostic sensitivity and specificity the respocheck triplex pcr is reported in table . as the diagnostic specificity is very low ( . , . , . for m. dispar, m. bovis and m. bovirhinis respectively) we analysed the sequence of the produced amplicon of five dgge negative /pcr positive and five dgge positive pcr positive samples. the sequence of both products was confirmed as m. bovis, m. dispar or m. bovirhinis, as all sequences had a high e-value ( e- ) and % query cover ( %) against the homologue sequence using the blast of the ncbi-nih. comparison of the ctvalues of pcr positive/ dgge negative and the pcr positive/ dgge positive samples with a nonparametric mann whitney test, showed that the ct values of m. dispar and m. bovis were significantly lower, p = . and . , respectively. in the m. bovis and m. dispar pcr, the difference in ct value between pcr positive/ dgge positive and pcr positive/ dgge negative samples is at least . , which indicates a factor of difference in concentration of m. bovis and m. dispar dna between these two groups (fig. ) . as a consequence the diagnostic pcr assays for the detection of mycoplasmas generally target sequences on the s rrna gene [ , ] . in this study we used the highly conserved s rrna sequence to set up the respocheck mycoplasma triplex real-time pcr assay for the specific detection of m. bovis, m. dispar and m. bovirhinis in balf samples of calves. the lowest concentration of m. dispar which could be detected with the respocheck triplex pcr assay is around cfu/ml. with a copy number of s rrna of one or two (https://rrndb.umms.med.umich.edu/) and with a test volume of μl the lowest concentration which could be detected is around - cfu/assay. the lowest concentration of m. bovis and m. bovirhinis which could be detected with the respocheck triplex for m. bovis, and m. bovirhinis is around . cfu/assay. from the calculated analytical sensitivity of the m. bovis, m dispar and m. bovirhinis respocheck triplex pcr ( . - cfu/assay) we conclude that the respocheck triplex pcr has a good analytical sensitivity. it was shown that the use of a pellet from ml balf after centrifugation instead of not-centrifuged balf samples increased the analytical sensitivity of the respocheck triplex pcr assay. in order to determine the analytical specificity of the respocheck triplex pcr we analysed the dnas from panels of mycoplasma and bacterial strains. in the m. bovis respocheck mycoplasma triplex real-time pcr we found a cross-reaction with m. agalactiae. phylogenetic analyses on s rrna sequences and comparing the s rrna sequences of m. bovis and m. agalactiae [ ] at ncbi (www.ncbi.nlm.nih.gov), we found a close relationship between m. agalactiae and m. bovis, with a % nucleotide identity between their s rrna sequences. however, m. bovis causes calf pneumonia, mastitis, and arthritis in cattle [ , ] , m. agalactiae is the causal agent of contagious agalactia in goats and sheep [ ] . although unusual, m. agalactiae has been detected from cattle samples [ , ] . therefore the cross reactivity for m. agalactiae might be a problem for the intended balf samples in the m. bovis monitoring for mycoplasma species in balf samples through collection and testing of balf samples by culture is hampered by the fastidious nutritional requirements, lengthy culture of mycoplasmas, and their susceptibility to growth inhibitors. as a consequence, mycoplasma culture is time-consuming, costly, and requires specific expertise. moreover, mycoplasma species may easily be overgrown by bacterial contaminants or by more rapidly growing mollicutes, notably acholeplasmas. the pcr/dgge method of the apha can differentiate bovine mycoplasma species [ ] including the target mycoplasmas of the respocheck mycoplasma triplex real-time pcr and in contrary to the respocheck can differentiate between m. bovis and m. canis. additional the pcr/dgge is capable of detecting mixed cultures, which would have been difficult to detect by culture methods [ ] . therefore we used this method as a reference for determining the diagnostic sensitivity and specificity of the respocheck mycoplasma triplex real-time pcr. possibly due to the lower sensitivity of the dgge analysis compared to the respocheck triplex pcr (almost factor ) and its use as reference method to validate the respocheck triplex pcr, the latter test method scores , and m. dispar, m. bovis and m. bovirhinis respectively out of more samples as false-positive and therefore the diagnostic specificity of the respocheck triplex pcr is underestimated. the transport and storage conditions or differences in dna preparation of particularly the more diluted balf samples for the pcr/ dgge method could have induced a lower sensitivity of the pcr/dgge analysis. the ct values of the m. bovis, and m. dispar pcr positive and dgge positive samples are significant (p < . mann whitney test) lower than the m. bovis, and m. dispar pcr positive dgge negative samples, which confirms the difference in the analytical sensitivity between the respocheck triplex pcr and dgge analyse. in the m. bovis and m. dispar pcr, we found a fold difference in the ct values between the dgge positive/ pcr positive and dgge negative/ pcr positive samples, which indicates a higher diagnostic sensitivity of m. bovis and m. dispar pcr than the dgge analyses. results by dgge from balf samples with mixed infections could be reproduced by the triplex pcr, suggesting that there is no significant pcr bias when the triplex pcr is used for mycoplasma detection in field samples. the pcr has thus a higher analytical sensitivity than the dgge. in conclusion, the respocheck mycoplasma triplex pcrtest appears to be a sensitive and specific test for the detection of m. bovis, m. dispar and m. bovirhinis in balf samples of calves. abbreviations balf: bronchoalveolar lavage fluid; brdc: bovine respiratory disease complex; pcr/dgge: pcr with denaturing gradient gel electrophoresis fingerprinting respiratory disease of the bovine neonate bacterial pathogens of the bovine respiratory disease complex immune evasion by pathogens of bovine respiratory disease complex investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease the bronchopneumonias (respiratory disease complex of cattle, sheep and goats) mycoplasma bovis: disease, diagnosis, and control bovine mycoplasmosis: silent and deadly synergism between mycoplasma bovis and pasteurella haemolytica in calf pneumonia mycoplasma bovis pneumonia in cattle pathogenesis and pathology of bovine pneumonia respiratory disease in calves: microbiological investigations on trans-tracheally aspirated bronchoalveolar fluid and acute phase protein response isolation of mycoplasmas from nasal swabs of calves affected with respiratory diseases and antimicrobial susceptibility of their isolates laboratory diagnosis of mycoplasma infection in young cattle use of a polymerase chain reaction for detection of mycoplasma dispar in the nasal mucus of calves rapid detection of mycoplasma dispar and m. bovirhinis using allele specific polymerase chain reaction protocols use of a novel real-time pcr technique to monitor and quantitate mycoplasma bovis infection in cattle herds with mastitis and respiratory disease in vitro amplification of the s rrna genes from mycoplasma bovirhinis, mycoplasma alkalescens and mycoplasma bovigenitalium by pcr nicholas ra s rdna pcr and denaturing gradient gel electrophoresis; a single generic test for detecting and differentiating mycoplasma species a novel rapid dna microarray assay enables identification of mycoplasma species and highlights multiple mycoplasma infections standardized bacteriologic techniques for the characterization of mycoplasma species bronchopulmonary lavage in the calf: a new technique comprehensive dna signature discovery and validation a quantitative map of nucleotide substitution rates in bacterial rna sensitivity" and "specificity" reconsidered: the meaning of these terms in analytical and diagnostic settings phylogeny of some mycoplasmas from ruminants based on s rrna sequences and definition of a new cluster within the hominis group basic local alignment search tool estimating disease prevalence and the interpretation of screening test results a spreadsheet for the calculation of comprehensive statistics for the assessment of diagnostic tests and inter-rater agreement in vitro amplification of the s rrna genes from mycoplasma bovis and mycoplasma agalactiae by pcr genus and species-specific identification of mycoplasmas by s rrna amplification mycoplasma bovis as an agent of mastitis, pneumonia, arthritis and genital disorders in cattle contagious agalactia of sheep and goats severe otitis and pneumonia in adult cattle with mixed infection of mycoplasma bovis and mycoplasma agalactiae evaluation of pcr systems for the identification and differentiation of mycoplasma agalactiae and mycoplasma bovis: a collaborative trial mycoplasma infections in growing cattle biochemical characterization of mycoplasma bovirhinis, mycoplasma dispar and recent bovine isolates of mycoplasma canis mycoplasma species and related organisms isolated from ruminants in britain between the authors thank prof. konrad sachse (friedrich-loeffler-institut, federal research institute for animal health, jena, germany) for providing us with dna from mycoplasma isolates. the authors thank also the mycoplasma team (apha woodham lane addlestone, surrey, uk) for performing the pcr/dgge analysis. this research was part of the project "development and application of diagnostics" within the public-private partnership "one health for food" in the netherlands. the research was funded by the dutch ministry of economic affairs, productschap vee en vlees / stichting brancheorganisatie kalversector (sbk) and supported by the van drie group, msd animal health and denkavit. the datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.authors' contributions jc authored the manuscript, designed the study, performed the qpcr and analysed the data. ab and fb build an insignia-based database from which pathogen-specific sequence regions were extracted, designed the oligonucleotide primers and probes and assisted in drafting and editing the manuscript. hw and fw assisted in study design, interpretation of data and editing the manuscript. mk was involved in the microbiological analyses of the samples and participated in the drafting of the manuscript. aa designed and coordinated the field study for the collection of balf samples and also helped to draft this manuscript. bs conducted and coordinated the field sample collection, performed microbiological analysis of samples and managing the database with results. bk participated in the design of the study and helped in the interpretation of the triplex pcr data. all authors read and critically revised and approved the final manuscript. the authors declare that they have no competing interests. ethics approval and consent to participate sampling of the calves was granted an exemption from requiring ethics approval by the institutional animal experiment commission "dier experimenten commissie (dec) lelystad ( .b)" because sampling was performed for diagnostic purposes. ethics approval is not applicable. animal handling, including balf sample collection, was performed or supervised by approved veterinarians consent was obtained from the farmers for the samples collected at their farm. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. submit your next manuscript to biomed central and we will help you at every step: key: cord- -r ev br authors: englund, stina; hård af segerstad, carl; arnlund, frida; westergren, eva; jacobson, magdalena title: the occurrence of chlamydia spp. in pigs with and without clinical disease date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: r ev br background: within the genera chlamydia, the development of refined diagnostic techniques has allowed the identification of four species that are capable of infecting pigs. the epidemiology, clinical, and zoonotic impacts of these species are however largely unknown. the study aimed to investigate the presence of chlamydia spp. in the intestines of growing pigs and in conjunctival swabs from finisher pigs, and relate the findings to clinical signs. results: by histology, of pigs had intestinal lesions that may be consistent with chlamydial infection. by pcr, forty-six of the pigs were positive whereas two samples were inhibited. sequencing of dna extracts identified these as chlamydia suis. by immunohistochemistry, of samples were positive and a significant relationship was detected between macroscopically visible intestinal lesions and a high degree of infection. by real-time pcr, a significant difference was detected between pigs with and without conjunctivitis when a ct value of was employed but not when a ct value of was employed. conclusions: chlamydia suis was demonstrated in most samples and overall, no correlation to clinical signs was detected. however, a correlation was noted between samples with a high degree of infection and the presence of clinical signs. it is possible, that the intensive pig production systems studied might predispose for the transmission and maintenance of the infection thus increasing the infectious load and the risk for disease in the pig. the chlamydiaceae family including the genera chlamydia is a well-recognised cause of disease in many animal species including cats, ruminants, birds and humans [ , ] . within the genera, nine distinct species have been identified. four of these have been described in pigs (chlamydia (c.) abortus, c. psittaci, c. pecorum, and c. suis) and related to reproductive disorders, conjunctivitis, enteritis, pneumonia, polyarthritis, pleuritis and polyserositis [ , [ ] [ ] [ ] . the epidemiology, clinical, and zoonotic importance of these species are however largely unknown [ ] [ ] [ ] . however, c. suis seems to be both common and widespread, often occurring in mixed infections with c. abortus and c. pecorum [ ] . in gnotobiotic pig challenge studies from usa, c. suis caused dose-dependent diarrhoea in young piglets. histologically, villi atrophy, tip erosions, necrosis, inflammatory changes and lymphangitis were noted in the distal small intestine. chlamydial antigens were demonstrated in enterocytes and chlamydiae were reisolated from tissue specimens and faecal swabs [ , ] . however, weaned pigs developed microscopical lesions but remained clinically healthy [ ] . similar lesions have also been demonstrated in clinical cases of diarrhoea in weaned pigs [ ] . however, other studies have not been able to confirm a causal relationship [ , ] . a few studies have addressed conjunctivitis [ ] . chlamydiae were seen in eight pigs by ultrastructural examination and were isolated in two pigs [ ] , and subclinical conjunctivitis was experimentally induced in -day-old gnotobiotic piglets [ ] . isolation is the gold standard for diagnosis but many strains are difficult to cultivate [ , ] . other methods includes serology, immunohistochemistry, histology, and pcr on faeces, mucosal swabs or tissue specimens [ ] . because of cross-reactivity, some tests may lack sensitivity and specificity [ , , ] . in a study comparing four diagnostic methods, c. suis were demonstrated in % of the samples by pcr and in % by culture. the sensitivity was . % and specificity . %, whereas the two elisas performed considerably weaker. pcr was concluded to be a reliable, highly sensitive and specific tool for detection of c. suis [ ] . the present study aimed to investigate the presence of chlamydia spp in the intestines of growing pigs and in conjunctival swabs from finisher pigs, and relate those findings to the occurrence of clinical signs. the study was approved by the ethical committee for animal experiments, uppsala, sweden. all herd owners had given an informed consent prior to the study. dna from enteric specimens originated from a previous study on growing pigs with diarrhoea [ ] . the samples originated from the major pig producing areas of sweden, i.e. in the south-western and eastern parts of the country, and included pigs from six herds with poor performance and diarrhoea in growing pigs, and pigs from four herds with good performance and no diarrhoea. from each of the poor performance herds, three case and three control pigs were chosen, and from each of the four good performance herds, three control pigs were chosen. the case pigs had diarrhoea that had commenced within days and no other diseases were evident. the control pigs were matched to the case pigs for age and sex, but showed no signs of clinical disease. the control pigs had a mean age of days and a mean weight of . kg, and the case pigs had a mean weight of . kg. the pigs submitted from the good performance herds had a mean age of days and a mean weight of . kg. all animals were weaned at approximately weeks of age and none of the pigs had been treated with antibiotics. the pigs were transported to the laboratory and euthanized within min prior to necropsy. further, animals from three finisher herds were sampled based on the present occurrence of conjunctivitis. the pigs originated from several piglet-producing herds and were introduced to the finisher herds at - kg. b.w., i.e. - weeks prior to sampling. they were kept pigs per pen in units of pigs each. in two herds, case and control pigs were selected from each of units, and in one herd, case and control pigs from one unit were selected. the case pigs were selected based on clinical signs of moderate to severe conjunctivitis, defined as hyperaemia and chemosis with epiphora and/or muco-purulent secretion. the control pigs were selected from the same pens as the case pigs but showed no or only mild conjunctivitis, i.e. none to slight hyperaemia in the conjunctiva and no chemosis or epiphora. the necropsies were carried out at the department of pathology at the national veterinary institute, uppsala, or at analycen, skara. the animals were stunned with electricity, weighed and exsanguinated, and necropsy was immediately performed. all gross lesions were noted, and specimens for histological examination were taken from ileum and from all macroscopically visible lesions. the samples were fixed in % buffered formalin, embedded in paraffin blocks, sectioned and stained with haematoxylin and eosin according to standard protocols. the finisher pigs were snared and sterile cotton swabs were rubbed against the conjunctiva in the conjunctival sac in the left and right eye, respectively. the swabs were placed in sterile tubes and transported to the laboratory. intestinal samples were prepared from a . cm piece of frozen mucosa from the distal ileum. dna was extracted by phenol/chloroform and precipitated by ethanol [ , ] . dna from the conjunctival swabs was extracted according to k. sachse [ ] and all samples were analysed by real-time pcr according to everett and others [ ] . the primers tqf and tqr targeted the s ribosomal dna and detected all members of the family chlamydiaceae. multiple negative controls were included and dna from cp. abortus and c. suis (kindly provided by k. sachse, friedrich-loeffler-institute, jena, germany) were used as positive controls. to detect false negative pcr results due to inhibiting agents, an internal amplification control (mimic) was constructed and used as previously described [ ] . the primers used in the mimic producing pcr were tqfactin ( 'gaaaagaacccttgttaagggagc-catgtaccctggcattg- ') and tqractin ( '-cttaactccctggctcatcatggatccacacg-gagtacttgc- '). the sequence of the rox-labelled mimic probe used in real-time pcr was '-ccgacag-gatgcagaaggagatca- '. the conjunctival swabs were analysed both undiluted and diluted : in accordance with the standard protocol applied at the nvi, and a positive reaction in at least one of these dilutions was regarded as positive. in the statistical analyses, threshold values below ct were regarded as positive whereas values between ct and ct were regarded as doubtful. the results were calculated separately for the respective thresholds. values above ct were regarded as negative or were excluded in the calculations. the difference in detection rate of chlamydia spp. between pigs with moderate to severe conjunctivitis and the control pigs were analysed by chi-square test. sequence analysis was performed on samples from the intestinal specimens giving a strong positive reaction in the pcr. pcr was performed with primers sf and r according to everett and andersen [ ] on dna samples from seven case pigs and six control pigs from poor performance herds and six pigs from good performance herds. the predicted pcr product of bp as well as one pcr product of larger and one of smaller size was purified prior to sequencing by using the gfx pcr dna and gel band purification kit (amersham bioscience europe, gmbh germany). the purified products were sequenced with the same primers used in the pcr and by using the bigdye terminator v . cycle sequencing kit (applied biosystems, foster city, ca, usa) in combination with ethanol/edta/ sodium acetate precipitation, according to the protocol supplied. thermocycling was performed in a geneamp thermocycler (applied biosystems). the sequencing products were subjected to electrophoretic separation and on-line detection on an abi prism genetic analyzer (applied biosystems), followed by blast search. paraffin-embedded intestinal specimens were available from of the growing pigs. -μm thick sections of the formalin-fixed, paraffin-embedded blocks where cut and placed onto positively charged slides (polysine™, menzel-gläser, braunschweig, germany). prior to immunostaining, deparaffinisation and hydration where done in xylene and graded ethanol to distilled water. after hydration, a blocking for endogenous peroxidase where done in . % h o in tris-buffered saline (tbs) and nonspecific binding sites where blocked with % bovine serum albumin (bsa). antigen retrieval was performed by heat induced epitope retrieval (hier) in retrieval buffer ph = (tbs-edta), using microwave as heat source. hier was performed by heating the polysine™-slides immersed in retrieval buffer for min at w followed by min at w. after completed heating procedure, the slides remained in the retrieval buffer at room temperature for min. the slides where incubated with a mouse monoclonal antibody against chlamydia, clone aci (progen biotechnik gmbh, germany) diluted : . visualisation of the bound primary antibody was achieved by using dako envision™ + system utilising an hcp-labelled antimouse monoclonal antibody (glostrup, denmark), and the presence of the relevant antigen was detected with , '-diaminobenzidine (dab, nvi, sweden). slides were weakly counterstained with haematoxylin. the staining included at least one positive and one negative control section. the positive control originated from previously confirmed routine cases. the results were graded as negative (-), sparse (+), moderate (++) or abundant (++ +) occurrence. no gross lesions were observed in the pigs from the good performance herds. in the pigs from the poor performance herds, five control pigs and pigs with diarrhoea had macroscopic lesions consistent with lawsonia (l.) intracellularis infection and one had a parasitic colitis. by histology, lesions that may be consistent with chlamydial infection [ ] were noted in pigs: villus atrophy was noted in six pigs with diarrhoea and in ten control pigs from the poor performance herds. epithelial exocytosis or necroses were noted in five pigs with diarrhoea, in one control pig from the poor performance herds, and in one pig from the good performance herds (table ) . in the previous study [ ] , brachyspira pilosicoli were demonstrated in eight case pigs and five control pigs, campylobacter jejuni; in one case pig and four control pigs, yersinia enterocolitica in three case and five control pigs, haemolytic escherichia (e.) coli in two case and two control pigs, clostridium perfringens in two case pigs, and l. intracellularis were previously demonstrated in case and eight control pigs from the poor performance herds. in addition, haemolytic e. coli had been demonstrated in two pigs from the good performance herds. rotavirus had been demonstrated in one case pig. coronavirus was not included in the study, since sweden has previously been shown to be free from table the findings in intestinal specimens from growing pigs with diarrhoea (case), clinically healthy control pigs from the same poor performance herds (casecontrol), and from healthy pigs originating from good performance herds (control), examined by immunohistochemistry (ihc), necropsy, and pcr. transmissible gastroenteritis and porcine epidemic diarrhoea. balantidium coli were demonstrated in one case and three control pigs from the poor performance herds, and in one pig from the good performance herds. of the enteric samples analysed, were positive for chlamydiaceae (table ) . two samples could not be evaluated due to amplification inhibition. the major band of b.p. found in all samples was confirmed as c. suis in the samples subjected to sequence analysis. the larger pcr product described in the methods' section was - % identical to escherichia coli whereas the smaller pcr product did not match any sequence in the blast search. in the pcr analyses on the conjunctival swabs, one pig with conjunctivitis and three control animals together with their matched counterparts were excluded from the statistical calculations, since the pcr was partially or totally inhibited. thus, in total, conjunctival swabs were included in the statistical analyses. of these, three samples from pigs with conjunctivitis gave weakly positive reactions (ct > in undiluted samples) and were judged as negative. employing a cut-off value of ct , samples from pigs with conjunctivitis and control pigs were determined as positive by pcr. using a cut-off value of ct , samples from pigs with conjunctivitis and control pigs were determined as positive. a statistically significant difference (p = . ) was detected between pigs with and without conjunctivitis when a ct value of was employed. the difference was mainly related to one of the herds ( positive pigs with conjunctivitis and positive control pigs). when a ct of was employed, no significant differences were noted. the results are shown in table . among the case pigs, ( %) were negative or were carrying a low-grade infection. among the control pigs from good performance herds, ( %) were negative or sparsely (+) infected. the two control specimens in which the pcr analyses had been inhibited were graded as + and ++, respectively, by immunohistochemistry. a significant (p < . ) relationship was detected between the presence of clinical signs and a high degree (++ or +++) of infection. no relationship was detected between the occurrence of histological lesions and the demonstration of chlamydial antigen by immunohistochemistry. the pig intestine is considered as the natural reservoir for c. suis, and the microbe seems generally to be well adapted to its host [ ] . in the present study, chlamydia spp. were demonstrated in high prevalence in all herds investigated. this is consistent with the few studies that have previously addressed the occurrence of chlamydia spp. in pig herds. overall, it was not possible to relate the demonstration of the microbe to the presence of diarrhoea. however, based on the immunohistochemistry, pigs with diarrhoea might have been more heavily infected than the healthy pigs. this is in consistency with the results from another study on pigs submitted for necropsy, where it was not possible to relate the presence of chlamydia spp. to the occurrence of diarrhoea, but in cases, it was the only pathogen found [ ] . similar experiences have also been noted in calves and sheep [ ] [ ] [ ] . in the study by becker et al. [ ] , c. suis was significantly (p < . ) related to conjunctivitis in extensive pig production systems, whereas in intensive farming systems, high prevalences ( - %) were found in both pigs with conjunctivitis and in clinically asymptomatic pigs. this is in accordance with the findings in the present study. becker et al. discussed, that environmental factors might predispose to infection. however, in one of the herds in the present study, factors such as emission of ammonium and carbon dioxide gases, air movements and overcrowding were investigated, but it was not possible to relate any environmental factor to the occurrence of conjunctivitis (data not shown). however, in one stable a high relative humidity ( %) was noted that might facilitate microbial survival. in the present study, the pigs originated from several piglet producing herds and it should be emphasized that intensive farming systems with the mixing of pigs from several sources also imply increased opportunities for microbial spread among animals of different immunological status. in fact, in one herd a significant relationship was noted between conjunctivitis and the presence of chlamydia spp. when the lower threshold value was applied in the real-time pcr. this might further indicate that the infectious load is important in the development of disease. although chlamydia spp. was demonstrated in the ileal sections by immunohistochemistry in the present study, lesions compatible to those described in gnotobiotic pigs [ ] were only noted in % of the pigs. several authors speculate that the development of lesions may depend on different factors such as the virulence of the strain, the infectious dose, the route of infection, or the age and the immunological status of the host [ , , , , , ] . since young, naive pigs seem to develop lesions in response to an experimental infection [ ] , host immunity might be induced at an early age in the field [ , ] . it is also possible that co-infections with other presumptive pathogens might act synergistically to exacerbate the lesions or that lesions induced by one microbe might increase the susceptibility to other infections. several pathogens have been discussed in this respect [ , , , , , ] . most of the intestinal lesions described in the present study were shown to be related to infections with l. intracellularis or b. pilosicoli [ ] . some studies also report the occurrence of mixed infection with several chlamydial species [ , [ ] [ ] [ ] . in wild boars, c. psittaci was the dominating species but c. suis and c. abortus was also demonstrated by sequencing [ ] . in the present study, preliminary data obtained by pcr-rflp indicated the co-infection by other species [ ] . however, sequencing of the amplicons revealed the involvement of c. suis only, whereas other bands detected by pcr originated from e. coli and un-identified bacterial species. the results underline the difficulties involved in the diagnosis and a large variation in reported prevalences between various detection methods exist [ , , , ] . in the present study, the problem was circumvented by the use of an internal probe and a high melting temperature in the real-time pcr, combined with sequencing of the amplicons that assured a high specificity. chlamydia suis was found in high prevalences in growing pigs with or without diarrhoea, and in finisher pigs with or without conjunctivitis. overall, no correlation to clinical signs was detected. however, a correlation was noted between samples with a high degree of infection and the presence of clinical signs. it is possible, that the intensive pig producing systems investigated in the present study might predispose for the transmission and survival of the microbe, thus increasing the infectious load and the risk for disease in the pig. interestingly, no other species of the chlamydiaceae family were detected, as also supported by the findings in other animal species in swedish surveys [ ] . chlamydial infection in animals: a review chlamydiaceae infections in pig pcr-based detection of chlamydial infection in swine and subsequent pcr-coupled genotyping of chlamydial omp--gene amplicons by dna-hybridization, rflpanalysis, and nucleotide sequence analysis conjunctivitis and keratoconjunctivitis associated with chlamydiae in swine chlamydial infections of domestic ruminants and swine: new nomenclature and new knowledge prevalence of intestinal chlamydial infection in pigs in the midwest, as determined by immunoperoxidase staining intestinal chlamydia in finishing pigs immunohistologischer nachweis von chlamydia psittaci/pecorum und c. trachomatis im ferkel-darm intestinal lesions caused by two swine chlamydial isolates in gnotobiotic pigs experimental enteric infection of gnotobiotic piglets with chlamydia suis strain s intestinal lesions caused by a strain of chlamydia suis in weanling pigs infected at days of age small intestinal chlamydia infection in piglets intensively kept pigs pre-disposed to chlamydial associated conjunctivitis conjunctivitis caused by a swine chlamydia trachomatis-like organism in gnotobiotic pigs chlamydial zoonoses. dtsch Ärtzebl int detection of chlamydia suis from clinical specimens: comparison of pcr, antigen elisa, and culture diarrhoea in the growing pig-a comparison of clinical, morphological and microbial findings between animals from good and poor performance herds routine diagnostics of lawsonia intracellularis performed by pcr, serological and post mortem examination, with special emphasis on sample preparation methods for pcr diagnosis of contagious caprine and contagious bovine pleuropneumonia by pcr and restriction enzyme analysis. int symp diagn contr livestock dis nucl tech int atomic energy agency detection and differentiation of chlamydiae by nested pcr rapid detection of the chlamydiaceae and other families in the order chlamydiales: three pcr tests detection of mycobacterium avium subsp. paratuberculosis in tissue samples by single, fluorescent and nested pcr based on the is gene identification of nine species of the chlamydiaceae using pcr-rflp behavior of different bovine chlamydial agents in newborn calves pathologic changes in intestinal chlamydial infection of newborn calves high frequency of chlamydial co-infections in clinically healthy sheep flocks an experimentally induced chlamydia suis infection in pigs results in severe lung function disorders and pulmonary inflammation experimental chlamydia psittaci serotype enteric infection in gnotobiotic piglets: histopathological, immunohistochemical and microbiological findings intestinal chlamydia in pigs concurrent infection of enterocytes with eimeria scabra and other enteropathogens in swine occurrence of chlamydiaceae spp. in a wild boar (sus scrofa l.) population in thuringia (germany) mixed infections with porcine chlamydia trachomatis/ pecorum and infections with ruminant chlamydia psittaci serovar associated with abortions in swine detection of all chlamydophila and chlamydia spp. of veterinary interest using speciesspecific real-time pcr assays the occurrence of chlamydia species in intestinal specimens from swedish grower pigs. the th international pig veterinary society congress prevalence of chlamydial infection in breeding sows investigation of chlamydophila spp. in dairy cows with reproductive disorders the occurrence of chlamydia spp. in pigs with and without clinical disease we wish to thank marianne persson for skilful technical assistance. we also wish to thank the herd owners who kindly supplied the pigs and allowed us to enter the herds. authors' contributions se was responsible for the pcr investigation and sequencing of dna from the intestinal specimens, analysis and interpretation of these data, and revised the manuscript. chs made an intellectual contribution by drafting the manuscript and revising it critically. fa was responsible for collecting of the conjunctival swabs, pcr analysis and interpretation of these data, and revised the manuscript. ew was responsible for the immunohistochemical analyses, interpretations of these data, and revised the manuscript. mj was planning the studies, collected and prepared the intestinal specimens, and was responsible for drafting and writing the manuscript. all authors read and approved the final manuscript. the authors declare that they have no competing interests. key: cord- -qriqtv y authors: charoenkul, kamonpan; janetanakit, taveesak; chaiyawong, supassama; bunpapong, napawan; boonyapisitsopa, supanat; tangwangvivat, ratanaporn; amonsin, alongkorn title: first detection and genetic characterization of canine kobuvirus in domestic dogs in thailand date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: qriqtv y background: canine kobuvirus (cakov) has been detected both in healthy and diarrheic dogs and in asymptomatic wild carnivores. in this study, we conducted a survey of cakov at small animal hospitals in bangkok and vicinity of thailand during september to september . results: three hundred and seven rectal swab samples were collected from healthy dogs (n = ) and dogs with gastroenteritis symptoms (n = ). of swab samples tested by using one-step rt-pcr specific to d gene, we found cakov positivity at . % ( / ). cakovs could be detected in both sick ( . %) and healthy ( . %) animals. in relation to age group, cakov could be frequently detected in younger dogs ( . %). our result showed no seasonal pattern of cakov infection in domestic dogs. in this study, we characterized cakovs by whole genome sequencing (n = ) or d and vp gene sequencing (n = ). genetic and phylogenetic analyses showed that whole genomes of thai cakovs were closely related to chinese cakovs with highest . % amino acid identity suggesting possible origin of cakovs in thailand. conclusions: in conclusion, this study was the first to report the detection and genetic characteristics of cakovs in domestic dogs in thailand. cakovs could be detected in both sick and healthy dogs. the virus is frequently detected in younger dogs. thai cakovs were genetically closely related and grouped with chinese cakovs. our result raises the concerns to vet practitioners that diarrhea in dogs due to canine kobuvirus infection should not be ignored. electronic supplementary material: the online version of this article ( . /s - - - ) contains supplementary material, which is available to authorized users. a survey of canine kobuvirus in domestic dogs at small animal hospitals in provinces of thailand. the survey was conducted under the chulalongkorn university's animal use and care protocol # . the result of this study provided the first detection and genetic characterization of cakov isolated from domestic dogs in thailand. during september to september , we conducted a survey of viral enteric diseases in domestic dogs in small animal hospitals in provinces of thailand (bangkok, nakhon ratchasima, ratchaburi, suphanburi, and tak). we tested rectal swab samples for cakov by using one-step rt-pcr specific to d gene. based on a two-year survey, we found cakov positivity at . % ( / ). cakovs could be detected in both sick ( . % ( / )) and healthy ( . % ( / )) animals. our result showed no seasonal pattern of cakov infection in dogs (figs. and ). in relation to age group, cakov could be frequently detected in younger dogs at . % ( / ) (additional file : table s ). the coinfections of cakov with other enteric viral pathogens were observed including cakov/canine parvovirus/canine coronavirus (n = ), cakov/canine parvovirus (n = ) and cakov/canine coronavirus (n = ). in this study, cakovs were selected and characterized by whole genome sequencing (n = ) or d and vp gene sequencing (n = ). the viruses were selected to represent epidemiological and demographic data such as age, date of isolation and breed. in this study, nucleotide sequences of the cakov were submitted to the genbank database under the accession numbers mk -mk (table ) . phylogenetic analysis of whole genome of cakovs showed that the thai cakovs were closely related to each other and clustered with aichivirus a. the cluster aichivirus a contains kobuviruses from dogs, cats, rodents, bats and human. while aichivirus b and c contain kobuviruses from cattle and pigs, respectively. based on whole genome sequence, thai cakovs were closely related to chinese cakovs sub-cluster but in separated sub-cluster from the viruses from the us, uk, brazil and tanzania (fig. ) . phylogenetic analysis of d and vp of thai cakovs and reference cakovs from various animal species were also performed. similarly, d gene of thai cakovs were grouped together with chinese cakovs (g sub-cluster) but separated from the viruses in sub-clusters g as well as g (fig. ). phylogenetic analysis of vp gene, the viruses can be clustered into major subgroups, us/eu/africa subgroup and china/thailand subgroup (fig. ). we compared the nucleotide and deduced amino acid sequences of thai cakovs against those of reference viruses from the us, uk, italy, china, and korea (tables and most variable region of vp is position - , especially proline rich region. putative proline rich region at vp - - (p xppppxppxpxp ) was also observed in thai cakovs as well as reference viruses (table ). in this study, unique amino acids were found in thai and chinese cakovs at the position, v, d, l, t, p, m, d, s, q, q, q, t and e ( table ). analysis of predicted amino acid cleavage sits of whole genome were conserved among thai cakovs (table ). canine kobuvirus (cakov) is an emerging pathogen in thailand. to the best of our knowledge, the cakov was described in asia in retrospective study in korea in and have been reported in japan, china and australia, respectively [ , , , ] . however, the cakov have never been reported in the country or south east asia region. in this study, during the year-survey program, we found cakov positivity at . % in both sick ( . %) and healthy ( . %) animals. compare to other studies, cakov % positivity in this study was lower than those in china ( %) and korea ( . %) [ , ] . our result showed that the cakov could be frequently detected in younger dogs at % which consistence with previous reports [ ] . similar to other previous studies, co-infections with other enteric viral pathogens were observed such as cakov/canine parvovirus and cakov/ canine coronavirus [ , , ] . moreover, cakovs were detected in both diarrheic and non-diarrheic dogs which consistent with other studies [ , ] . our result supported that this virus may not be the only cause of enteric disease in dogs. nevertheless, the cakov infection have still been identified in symptomatic dogs without other enteric pathogen infections [ ] . our observation supported that the role of cakov as a primary pathogen of acute gastroenteritis remain unclear. in this study, the genome size of thai cakovs is , bp with one orf encoding , amino acids of a putative polyprotein, which comparable to previous reports. genome organization of cakov includes leader protein (l), structural proteins (vp , vp , vp ), nonstructural proteins ( a, b, c, a, b, c, d). phylogenetic analyses showed that the thai cakovs were closely related to each other and clustered with aichivirus a. it is noted that thai cakovs were closely related to chinese cakovs sub-cluster but in separated sub-cluster from the viruses from the us, uk, brazil and tanzania (fig. ) . phylogenetic analyses of d gene showed similar result which thai cakovs were grouped together with chinese cakovs (g sub-cluster). this observation regarding to the sub-clusters of cakovs was in agreement with the previous study [ ] . on the other hand, based on vp gene, the viruses can be clustered into major subgroups, us/eu/africa subgroup and china/thailand subgroup which similar to the previous reports [ , ] (figs. and ) . genetic analyses of thai cakovs showed that whole genome of thai cakovs posed highest nucleotide similarity to chinese cakovs including smcd- and ch- . this observation supported phylogenetic analysis that thai cakovs were closely related to chinese cakovs sub-cluster but in separated sub-cluster from ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) . ( ) . ( ) ( ) ( ) ( ) ( ) ( ) the viruses from the us, uk, brazil and tanzania. of all viral genes, the vp gene was the most diverse gene among thai cakovs and other reference cakovs. similar observation was also reported in previous study that vp protein is the most variable capsid protein [ ] . it is noted that the putative proline rich region at vp - - (p xppppxppxpxp ) was observed both in thai cakovs and reference viruses. previous studies indicated that proline rich region may associate with enteric receptor binding of the viruses [ , ] . it is noted that thai cakovs posed unique ppp (vp ; - ), which also observed most reference viruses from china, korea, japan, us, uk suggesting unique characteristic. these unique amino acids were not observed in the cakov from the australia (ce ), brazil (bra/ ) and tanzania (tz/ , tz ) [ , ] . however, the association of these unique amino acids and viral pathogenesis is still need to be further investigated. based on genetic analysis, unique amino acids at the position, v, d, l, t, p, m, d, s, q, q, q, t and e were observed. these unique amino acids of china/ thailand sub-cluster could be benefit for the detection of virus origin or diagnostic purpose in the future. similar to previous study, analysis of predicted amino acid cleavage sits of whole genome were conserved among cakovs except one variation at / (vp /vp ) which unique in wild carnivores [ ] . in conclusion, this study is the first to report of canine kobuvirus in dogs in thailand. cakovs were mostly detected in clinical dogs of young age. however, the viruses sample collection was conducted in domestic dogs at small animal hospitals in bangkok and vicinity of thailand during september to september . rectal swab samples were collected from healthy dogs (n = ) and dogs with gastroenteritis symptoms (n = ) including vomiting, watery diarrhea, hemorrhagic diarrhea and dehydration. the swab samples were collected from dogs of young age (< year) (n = ), adult ( - years) (n = ) and older (> years) (n = ). the animal demographic data including age, sex, breed, and vaccination history were also recorded. the ethics was conducted under the chulalongkorn university's animal use and care protocol # . the consent to participate of the owners of the animals used in this study was obtained in writing. all samples were subjected to canine kobuvirus identification by one step rt-pcr using primers specific to d gene of cakov [ ] . first, rna extraction was performed using the qiasymphony dsp viral/pathogen mini kit (qiagen, hilden, germany) following manufacturer's instructions. to detect cakov, rna samples were screened for d gene of cakov by using one step rt-pcr assay. the primers used in this study were previously described including u f ( ′-catgctcctcggtggtctca- ′) and u r ( ′-gtccgggtccatcacagggt - ′) [ the phylogenetic and genetic analyses were performed by comparing nucleotide sequences of thai cakovs with those of kobuvirus available from the genbank database. the reference nucleotide sequences of cakovs were retrived based on their different geographic locations, host species and date of isolation. phylogenetic analysis of cakov was performed by using mega v. . (tempe, az, usa) [ ] with neighbor-joining method with kimura -parameter with , bootstrap replicates and beast program with bayesian markov chain monte carlo (bmcmc) with , , generations and an average standard deviation of split frequencies < . [ ] . for genetic analysis, the nucleotide sequences and deduced amino acids of cakov were aligned and compared using megalign software v. . (dnastar inc.; wisconsin, usa). pairwise comparison of nucleotides and amino acids of thai cakov and those of reference cakovs were conducted. the variable and unique amino acids related to receptor binding of the viruses and host preferences of cakovs were monitored. additional file : cakov/ce /aus/ mh australia . ( . ) . ( . ) novel kobuvirus species identified from black goat with diarrhea isolation and characterization of a new species of kobuvirus associated with cattle phylogeny and prevalence of kobuviruses in dogs and cats in the uk characterization of a canine homolog of human aichivirus porcine kobuvirus in piglets bat guano virome: predominance of dietary viruses from insects and plants plus novel mammalian viruses first report and genetic characterization of feline kobuvirus in diarrhoeic cats in china detection and genetic characterization of bovine kobuvirus from calves in egypt the fecal viral flora of wild rodents viruses in diarrhoeic dogs include novel kobuviruses and sapoviruses canine kobuviruses in diarrhoeic dogs in italy molecular characterization of new described kobuvirus in dogs with diarrhea in china canine kobuvirus infections in korean dogs detection of kobuvirus rna in japanese domestic dogs molecular characterization of canine kobuvirus in wild carnivores and the domestic dog in africa viral metagenomic analysis of feces of wild small carnivores molecular evidence of kobuviruses in free-ranging red foxes (vulpes vulpes) first molecular identification of kobuviruses in wolves (canis lupus) in italy extra-intestinal detection of canine kobuvirus in a puppy from southern brazil genetic characteristics of the complete feline kobuvirus genome prevalence and genomic characteristics of canine kobuvirus in southwest china prevalence and phylogenetic analysis of canine kobuviruses in diarrhoetic dogs in northeast china molecular and phylogenetic analysis of the porcine kobuvirus vp region using infected pigs from sichuan province development of a nested pcr assay for the detection of canine coronavirus evidence for evolution of canine parvovirus type in italy identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in mexico enhancements and modifications of primer design program primer mega : molecular evolutionary genetics analysis version . bayesian phylogenetics with beauti and the beast . publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations we would like to thank the staffs of the center of excellence for emerging and re-emerging infectious diseases in animals, department of veterinary public health for sample collection and data analysis. animals, faculty of veterinary science, chulalongkorn university, bangkok, thailand. authors' contributions aa supervised and principle investigator of the project. kc, tj, sc and rt conducted and coordinated the study, sample collection, virus identification and virus characterization. kc, nb, sb conducted data analysis and drafting the manuscript. aa drafting, revising and corresponding the manuscript. all authors read and approved the final manuscript. this project was financial supported by the research fund under the th anniversary chulalongkorn university (ratchadaphiseksomphot endowment fund) (gcugr d). chulalongkorn university provided financial support to the center of excellence for emerging and re-emerging infectious diseases in animals for study design, sample collection, analysis and interpretation. the thailand research fund supported the royal golden jubilee (rgj) ph.d. program, for first author scholarship (rgj-phd/ / ) and trf senior scholar to the corresponding author (rta ). all data generated or analyzed during this study are included in this published article and supplement tables. ethics and consent to participate in the study was conducted under the chulalongkorn university's animal use and care protocol (iacuc) # . the consent to participate of the owners of the animals used in this study was obtained in writing. all authors in this paper declare that they have no competing interests.author details center of excellence for emerging and re-emerging infectious diseases in key: cord- -zs ez q authors: geng, yunyun; wang, jianchang; liu, libing; lu, yan; tan, ke; chang, yan-zhong title: development of real-time recombinase polymerase amplification assay for rapid and sensitive detection of canine parvovirus date: - - journal: bmc vet res doi: . /s - - -z sha: doc_id: cord_uid: zs ez q background: canine parvovirus , a linear single-stranded dna virus belonging to the genus parvovirus within the family parvoviridae, is a highly contagious pathogen of domestic dogs and several wild canidae species. early detection of canine parvovirus (cpv- ) is crucial to initiating appropriate outbreak control strategies. recombinase polymerase amplification (rpa), a novel isothermal gene amplification technique, has been developed for the molecular detection of diverse pathogens. in this study, a real-time rpa assay was developed for the detection of cpv- using primers and an exo probe targeting the cpv- nucleocapsid protein gene. results: the real-time rpa assay was performed successfully at °c, and the results were obtained within – min for ( )– ( ) molecules of template dna. the assay only detected cpv- , and did not show cross-detection of other viral pathogens, demonstrating a high level of specificity. the analytical sensitivity of the real-time rpa was ( ) copies/reaction of a standard dna template, which was times more sensitive than the common rpa method. the clinical sensitivity of the real-time rpa assay matched % (n = ) to the real-time pcr results. conclusion: the real-time rpa assay is a simple, rapid, reliable and affordable method that can potentially be applied for the detection of cpv- in the research laboratory and point-of-care diagnosis. electronic supplementary material: the online version of this article ( . /s - - -z) contains supplementary material, which is available to authorized users. canine parvovirus diseases, caused by canine parvovirus type (cpv- ), is highly contagious and prevalent worldwide in domestic and wild canids. cpv- emerged as a novel pathogen in and spread rapidly worldwide [ , ] . within a few years, the original type virus underwent a rapid and extensive evolution, and was replaced by two antigenic types, termed cpv- a and cpv- b. recently, a new antigenic variant, cpv- c, was reported in dogs [ ] . cpv- is a small non-enveloped, linear single-stranded dna virus belonging to the family parvoviridae, genus parvovirus, and is considered as a major cause for large numbers of animal deaths worldwide [ ] . cpv -infected dogs are characterized by a gastroenteritis disorder with clinical signs of anorexia, lethargy, vomiting, fever and diarrhea (from mucoid to hemorrhagic) [ , ] . because of infection and damage to the bone marrow, parvovirus can also cause acute leukopenia with lymphopenia and neutropenia. when cpv- shed into the feces, it can be spread by direct oral or nasal contact. furthermore, cpv- is extremely stable in the environment and can survive for several months. therefore, early, rapid and accurate diagnosis of cpv- infection would help veterinarians to implement appropriate strategies in time to improve disease management and prevent outbreaks, particularly within a shelter environment. several traditional diagnosis methods exist for cpv- , including direct observation by electron microscopy, virus isolation in a suitable cell culture system, serological tests such as the latex agglutination test (lat), hemaghaemagglutination (ha) test, elisa and so on. these methods are often time-consuming, laborious, and have low sensitivity [ , ] . with the advances in molecular detection techniques, a substantial number of gene amplification-based assays have been described for cpv- diagnosis such as polymerase chain reaction (pcr), nested pcr, real-time pcr, reverse-transcription loop-mediated isothermal amplification (rt-lamp) and insulated isothermal pcr (iipcr) [ ] [ ] [ ] [ ] [ ] [ ] [ ] . among these methods, nested pcr, real-time pcr and rt-lamp have shown high sensitivity. however, due to the requirement of an expensive thermocycler and well-experienced technicians, implementation of these assays is limited in the field and at the point-of -care (poc). the iipcr method was reported for its sensitive detection of cpv- , but the reaction time was about min [ ] . in addition, the snap test based on elisa protocols for detection of viral antigens is commonly used for cpv- diagnosis and can be completed in about min by employing the commercial kit, whereas pcr seems to be more sensitive than snap [ , , , ] . recently we reported on recombinase polymerase amplification (rpa) as a rapid, specific, sensitive and cost-effective molecular method for poc diagnosis of cpv- infection [ ] . rpa is an isothermal gene amplification technique [ ] . similar to conventional pcr, the use of two opposing primers allows exponential amplification of the target sequence in rpa, but the latter is tolerant to - mismatches in the primer and probe without influencing the performance of the assay. rpa possesses superiority in speed, portability and accessibility compared to pcr, and it has been used to replace the pcr method for the molecular detection of diverse pathogens, such as fungi, parasites, bacteria and viruses [ ] [ ] [ ] . based on our previous study, we developed here a real-time rpa assay for simple, rapid, convenient and poc detection of cpv- , which utilizes an exo probe and a portable, userfriendly poc tube scanner. cpv- a, cpv- b, cdv, ccov and cpiv (shown in table ) were propagated in madin-darby canine kidney (mdck, crl- ™) cells and pseudorabies virus (prv) in syrian baby hamster kidney (bhk- , ccl- ™) cells (atcc, manassas, usa). two hundred microliters of cell culture medium, after brief centrifugation to remove cell debris, was used for viral dna and rna extraction using the tianamp virus dna kit (tiangen biotech co., ltd., beijing, china) and trizol reagent (invitrogen, beijing, china), respectively. viral dna and rna were quantified using a nd- c spectrophotometer (nano-drop, wilmington, de, usa). one hundred nanograms of extracted viral rna was reverse transcribed to cdna using the primescript™ ii st strand cdna synthesis kit (takara) according to the manufacturer's instructions. the synthesized cdna was then purified using the cdna purification kit (takara, dalian, china) and quantified using a nd- c spectrophotometer. for viral dna extraction from the clinical samples, the starting material consisting of mg of feces for each sample was emulsified in ml sterile phosphate-buffered saline (pbs) and centrifuged at rpm for min at °c. the supernatant was collected and used for viral dna extraction using the tianamp virus dna kit. viral dna extracted from each fecal sample was finally eluted in μl of nuclease-free water. all dna and cdna templates were stored at − °c until assayed. to generate a cpv- standard dna for the real-time rpa, a pcr product containing bp covering the region of interest of vp was amplified from the cpv- a dna using vp -forward and vp -reverse as primers (table ) and cloned into the pmd -t vector using the pmd -t vector cloning kit (takara) according to manufacturer's instructions. the resulting plasmid, pcpv-vp , was transformed into escherichia coli dh α cells, and the positive clones were confirmed by sequencing using m primers (invitrogen®, carlsbad, ca, usa). pcpv-vp was purified with the sanprep plasmid miniprep kit (sangon biotech co., ltd., shanghai, china) and quantified using a nd- c spectrophotometer. the copy number of dna molecules was calculated by the following formula: amount (copies/μl) = [dna concentration (g/μl) / (plasmid length in base pairs × )] × . × . the primers used in this study have been described previously [ ] . nucleotide sequences of cpv- a (genbank: ninety-one fecal swab samples were collected from the dogs sent to our laboratory from to and snap-frozen for storage at − °c. seventysix of the above clinical samples were detected as cpv- positive, and fifteen of them were cpv- negative by real-time pcr m , ab , kf ), − b (genbank: m , ay , kf ) and - c (genbank: fj , km ) were aligned to identify conserved regions of the vp gene. three exo probes were designed based on the conserved region of the vp gene. both primer and probe sequences were % identical to their target sequences in the cpv- a, b and c genomic dna. the real-time rpa primers and probes were selected by testing the combination to yield the highest sensitivity (table ) . primers and exo probes were synthesized by sangon biotech co., ltd. the real-time rpa reactions were performed in a μl volume using a twistamp™ exo kit (twistdx, cambridge, uk). other components included nm each rpa primer, nm exo probe, mm magnesium acetate, and μl of viral or sample dna. all reagents except for the viral template and magnesium acetate were prepared in a master mix, which was distributed into each . ml freeze-dried reaction tube containing a dried enzyme pellet. one microliter of viral dna was added to the tubes. subsequently, magnesium acetate was pipetted into the tube lids, and then the lids were closed carefully. the magnesium acetate was centrifuged into the rehydrated material using a mini spin centrifuge. after briefly vortexing and centrifuging the reaction tubes once again, they were immediately placed in the genie iii scanner device to start the reaction at °c for min. the fluorescence signal was collected in real-time and increased markedly upon successful amplification. real-time pcr specific for cpv- was performed on the abi instruments described previously with some modifications [ ] . premix ex taq™ (takara co., ltd., dalian, china) was applied in the real-time pcr and the reaction was performed as follows: °c for min, followed by cycles of °c for s and °c for s. ten nanograms of viral dna or cdna was used as the template for the specificity analysis of the real-time rpa assay. the assay was evaluated against a panel of pathogens considered important in dogs, i.e. cpv- a, cpv- b, cdv, ccov, cpiv and prv. the recombinant plasmid, pcpv-vp , was -fold serially diluted to achieve dna concentrations ranging from to copies/μl, which were used as the standard dna for the cpv- rpa sensitivity assay. the real-time rpa was tested using the standard dna in eight replicates. the threshold time was plotted against the molecules detected. viral dna extracted from clinical swab samples were detected by real-time rpa, and the results were compared with those obtained using real-time pcr as previously described [ ] . for the determination of analytical sensitivity of the real-time pra assay by the molecular dna standard, a semi-log regression was calculated using prism software . (graphpad software inc., sandiego, ca). for exact determination, a probit regression was performed using the statistical product and service solutions software (ibm, armonk, ny, usa). the evaluation of exo rpa with clinical samples data is presented as r value. the specificity and analytical sensitivity of the real-time rpa assay were analyzed (figs. and ). using ng of viral dna, cdna or canine genome as template, the results showed that only cpv- a and cpv- b were detected by the real-time rpa assay, while the other four viruses, including cdv, ccov, cpiv and prv, and canine genome, were not (fig. , n = ) . thus, the realtime rpa assay results demonstrated good specificity for the detection of cpv- . to evaluate the sensitivity of the real-time rpa method, a dilution range of - copies/μl of standard dna was used as templates, and the real-time rpa and realtime pcr were performed simultaneously. the limit of detection of the real-time rpa was copies ( fig. a and b) . a probit regression analysis using the results of eight complete molecular standard runs calculated that the limit of detection (lod) of the real-time rpa was copies per reaction in % of cases (fig. c) , which was the same as that of the real-time pcr applied in the study (data not shown). with the data from eight runs on the quantitative dna standards, a semi-log regression analysis for the real-time rpa and real-time pcr was made. run times of the real-time rpa assay were about - min for - copies, respectively (fig. b) , while the real-time pcr with ct values between and (data not shown) required about - min to obtain the final results. results of the evaluation of exo rpa with clinical samples are shown in table and fig. . the diagnostic performance of the real-time rpa assay to detect cpv- in the clinical swab samples was compared to that of the real-time pcr. these two assays showed the same results ( positive and negative cases), and further analysis demonstrated that the real-time rpa had a diagnostic agreement of % with the real-time pcr (table ) . no discrepancy was found in samples ( / ) containing low levels of cpv- dna (ct > , real-time pcr), indicating that the established real-time rpa reliably detected low amounts of cpv- in clinical samples. positive samples had real-time rpa ct values ranging from . to . , indicating that the method was able to detect cpv- dna across the entire range of the assay. twenty-three positive samples were selected randomly, and the threshold time (tt) and cycle threshold (ct) values of real-time rpa and real-time pcr, respectively, were well correlated with an r value of . (fig. ) . the relative sensitivity of the real-time rpa assay was further evaluated by comparing with the snap test. a total of fecal swab samples were collected for this experiment. twenty-four of the above tested clinical samples displayed cpv- positive, six of them were cpv- negative by real-time pcr assay. the result showed that the snap test was able to detect cpv antigen in / ( . %) of analyzed samples. a higher detection rate ( / , %) was obtained using real-time rpa for cpv- dna. the relative sensitivity of the snap test was . % ( / ) , when compared to real-time rpa. the best correlation was observed again between conventional realtime pcr and real-time rpa analysis (shown in the additional file : table s ). the detection results of the swab samples showed that the real-time rpa method we developed was effective in detecting cpv- . in this study, a real-time rpa method was developed based on an exo probe for the rapid and sensitive detection of cpv- . with real-time rpa, only cpv- a and cpv- b among multiple viruses infectious to canines tested could be amplified, demonstrating the high specificity of this assay (fig. ) . using the cpv- plasmid dna as a template, it was detected between and min for - copies of dna (fig. a) . the limit of detection of the real-time assay was copies/reaction, which was times higher than that of the conventional rpa [ ] . further validation of this method was performed using clinical samples. the detection rate of the real-time rpa assay was comparable of that of the realtime pcr, although the former assay was much faster than the latter. the real-time rpa assay detected the positive samples within - min. while the cpv- detection results by real-time rpa could be obtained in about min including the time for nucleic acid extraction, the reaction time for positive samples reached up to h with real-time pcr. additionally, the cost per reaction performed in the real-time rpa, real-time pcr assays and commercial snap tests including the cost of the reagents and the samples preparation was about . , . and . us dollars, respectively. the cost of realtime rpa decreased . %, when the method was compared to real-time pcr, and % respectively, when compared to snap tests. rpa has been widely explored for the molecular detection of diverse pathogens, including h n virus and dengue virus infection, and real field testing also has been achieved [ , ] . moreover, the portable poc tube scanner (genie iii, optigene limited, west sussex, united kingdom) used in the study, weighing only . kg with the dimensions of cm × . cm × . cm, is much more simple and less expensive than a real-time pcr machine and can be run on battery power for use in the field. for cpv- , it is often sufficient to simply boil the fecal samples before running diagnostic pcr. in our subsequent experiments we obtained similar results using boiling only to extract cpv- from clinical samples. in recent years, a number of isothermal dna amplification methods have been developed as a simple, rapid technique alternative to pcrbased amplification. in the lamp assay for the rapid and sensitive detection of cpv- , a set of four primers was needed, and the optimum time and temperature were min and °c, respectively [ ] . the developed iipcr could detect as low as copies of cpv- dna in about min [ ] . for the real-time rpa assay described in this work, copies of cpv- dna could be detected in min, which was much more rapid than the above assays, including the common rpa assay. compared to other isothermal amplification techniques, rpa does not require initial heating for dna denaturation, and the results can be obtained in less than min. the major advantages of rpa compared with other isothermal dna amplification methods are that it ( ) shows a certain degree of tolerance to common pcr inhibitors, ( ) can tolerate a wide range of biological samples [ ] and ( ) utilizes reagents stored in lyophilized pellets, fig. performance of the cpv- real-time rpa. a fluorescence development over time using a dilution range of - copies of the cpv- standard dna. b semi-logarithmic regression of the data collected from eight cpv- real-time rpa test runs on the standard dna using prism software . . run times of the real-time rpa were - min to detect and copies, respectively. c probit regression analysis using spss software on data from eight runs. the limit of detection of % probability ( copies) is indicated by a rhomboid which are very stable and can react satisfactory at °c for up to weeks and at °c for up to weeks [ ] . the snap test based on elisa protocols for rapid detection of viral antigen is commonly used for cpv- clinical diagnosis, but it is less sensitive than rcr-based methods, especially rap assay we developed in this study. the lower sensitivity of the snap test is generally associated with the host immune response, such as the very small amounts of virus shed in the feces during the late stage of infection and/or the presence of high cpv antibody titres in the gut lumen and so on. in our rpa assay, the detecting target was the nucleic acid of cpv- . the virus-specific gene was amplified first, and its amplification products were tested. in this process, the detection signal is magnified hundreds of thousands of times. more importantly, it is not affected by the host immune response. one limitation of our assay is that it fails to distinguish cpv- vaccine from wild type stains. if vaccine strain is shed post vaccination it will be detected by this assay. all in all, these distinguishing features of the rpa assay and hands-on experience of real field testing using rpa from other research groups make us believe that rpa could work well in a clinical diagnostic setting. it may also be the most applicable approach for the field and poc diagnosis of infectious diseases. in conclusion, the real-time rpa method based on an exo probe was successfully developed for the detection of cpv- . with high sensitivity and specificity, the assay could be completed within min. more importantly, the portability of the real-time rpa assay renders it applicable at quarantine stations, ports or sites of outbreaks. the effective and rapid real-time rpa assay developed in this study would be highly useful in the control of cpv- , especially in resource-limited settings. genotyping and pathobiologic characterization of canine parvovirus circulating in nanjing, china phylogenetic analysis reveals the emergence, evolution and dispersal of carnivore parvoviruses. the journal of general virology phylogenetic and genome-wide deep-sequencing analyses of canine parvovirus reveal co-infection with field variants and emergence of a recent recombinant strain molecular and serological surveillance of canine enteric viruses in stray dogs from vila do maio, cape verde molecular characterization of canine parvovirus (cpv) infection in dogs in turkey journal of veterinary diagnostic investigation : official publication of the american association of veterinary laboratory diagnosticians canine parvovirus-a review of epidemiological and diagnostic aspects, with emphasis on type c canine parvovirus infection: which diagnostic test for virus? an insulated isothermal pcr method on a field-deployable device for rapid and sensitive detection of canine parvovirus type at points of need a real-time pcr assay for rapid detection and quantitation of canine parvovirus type in the feces of dogs presence of infectious agents and co-infections in diarrheic dogs determined with a real-time polymerase chain reactionbased panel visual detection of canine parvovirus based on loop-mediated isothermal amplification combined with enzyme-linked immunosorbent assay and with lateral flow dipstick journal of veterinary diagnostic investigation : official publication of the american association of veterinary laboratory diagnosticians detection by pcr of wild-type canine parvovirus which contaminates dog vaccines rapid and sensitive detection of canine distemper virus by one-tube reverse transcriptioninsulated isothermal polymerase chain reaction visual detection of canine parvovirus based on loopmediated isothermal amplification combined with enzyme-linked immunosorbent assay and with lateral flow dipstick evaluation of an in-clinic assay for the diagnosis of canine parvovirus rapid and sensitive detection of canine parvovirus type by recombinase polymerase amplification recombinase polymerase amplification for diagnostic applications identification of fungal pathogens by visible microarray system in combination with isothermal gene amplification rapid detection of mycobacterium tuberculosis by recombinase polymerase amplification recombinase polymerase amplification-based assay to diagnose giardia in stool samples. the american journal of tropical medicine and hygiene recombinase polymerase amplification assay for rapid diagnostics of dengue infection diagnostics-in-a-suitcase: development of a portable and rapid assay for the detection of the emerging avian influenza a (h n ) virus factors influencing recombinase polymerase amplification (rpa) assay outcomes at point of care we thank dr. rui zhang at the china agricultural university for valuable comments, and we also thank dr. an-wen shao for language review and editing. the dataset analyzed during the current study is available from the corresponding author on reasonable request.authors' contributions yyg, jcw, kt and yzc designed and conducted the experiment. yyg, jcw, lbl and yl performed the experiments and analyzed the data. yyg drafted the manuscript. all authors read, revised, and approved the final manuscript.ethics approval and consent to participate not applicable. not applicable. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. submit your next manuscript to biomed central and we will help you at every step: key: cord- -qjtifwhd authors: van diep, nguyen; sueyoshi, masuo; norimine, junzo; hirai, takuya; myint, ohnmar; teh, angeline ping ping; izzati, uda zahli; fuke, naoyuki; yamaguchi, ryoji title: molecular characterization of us-like and asian non-s indel strains of porcine epidemic diarrhea virus (pedv) that circulated in japan during – and pedvs collected from recurrent outbreaks date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: qjtifwhd background: since late , porcine epidemic diarrhea virus (pedv) has reemerged in japan and caused severe economic losses to the swine industry. although pedv vaccines have been used widely, the disease has swept rapidly across the county, and is commonly observed in ped-vaccinated farms, and has recurred in domestic herds. to better understand pedvs responsible for the reemerging outbreaks in japan, full-length spike (s), membrane (m), and nucleocapsid (n) genes of pedvs collected in japan during – , were sequenced and analyzed. results: phylogenetic analysis based on s gene sequences revealed that all the recent field pedvs were genetically distinct from the classical japanese strains, and were classified into three genotypes: north american (na), s indel, and asian non-s indel. our data suggested a possibility that multiple parental pedv strains were introduced into japan from abroad at the same time or similar times. the newly identified japanese strains showed the closest relationship to the us strains. two sublineages of japanese strains circulating in japan were similar to two sublineages identified in the us, suggesting common ancestors for these strains. in comparison with two vaccine strains used in japan, the field strains had various changes in epitope regions, glycosylation sites, and phosphorylation sites. these substitutions, particularly observed in epitope regions of the s ( , , , and ), m ( ), and n ( , , and ) proteins, may have affected antigenicity and vaccine efficacy, resulting in an unsuccessful pedv control. sequence comparisons between pedvs collected from primary and secondary outbreaks in three herds revealed that the disease has developed to an endemic stage in which pedv could persist for nearly two years in the herds or local regions, causing subsequent epidemics. conclusions: these results elucidate the genetic characteristics, origin, and molecular epidemiology of pedvs circulating in japan, as well as the pedv strains causing recurrent outbreaks. this study provides a better insight into the pedvs responsible for recent outbreaks in japan, and could potentially help to develop measures for controlling and preventing the disease. electronic supplementary material: the online version of this article ( . /s - - - ) contains supplementary material, which is available to authorized users. porcine epidemic diarrhea virus (pedv) is the etiologic agent of porcine epidemic diarrhea (ped), an acute enteritis disease that is characterized by vomiting and watery diarrhea and usually leads to high morbidity and mortality, especially in piglets [ ] . the disease was first recognized in england in [ ] , and the prototype virus, which was designated as pedv cv , was identified in belgium [ ] . subsequently, pedv has been reported in several other european countries, causing only sporadic outbreaks. since the s, it has been widespread in asia and has become an economic concern for the swine industry in many asian countries such as japan, china, south korea, thailand, and taiwan [ , ] . in late , new chinese strains of pedv were detected. these new strains were clinically more severe than the classical strains, resulting in %- % illness among infected swine herds and a %- % mortality rate among infected suckling piglets [ ] . in april , a pedv outbreak was confirmed in the us for the first time. it swept across more than states in the country, causing deaths of more than million newborn piglets during the one-year-epidemic period, and subsequently spread throughout north america, including canada and mexico [ ] . afterward, us-like ped epidemics have been reported in south korea, taiwan, japan, germany, france, and belgium [ , ] . belonging to the coronaviridae family in the nidovirale order, pedv has a single-stranded positive-sense rna genome of approximately kb in size that encodes four structural proteins (s, e, m, and n) and nonstructural proteins ( a, ab, and orf ) [ ] . among the viral proteins, the s glycoprotein is the most diverse [ ] , and plays a critical role in the process of inducing neutralizing antibodies and binding specific receptors [ ] . at least two b cell epitopes (ss and ss ) and two regions containing neutralizing epitopes (coe and c ) have been identified on this protein [ ] [ ] [ ] . the s gene is also associated with growth adaptation in vitro and attenuation of virulence in vivo [ ] , and was used as an important component in studies for understanding genetic relatedness among pedv isolates, the epidemiological status, and vaccine development [ , ] . the m protein is the most abundant component of viral protein in the envelope, and is responsible for morphogenesis, assembly, and budding [ ] . the n protein of coronavirus interacts with viral genomic rna, serving as the critical basis for the helical nucleocapsid during the viral assembly [ ] . two antigenic epitopes (nep-d and nep-d ) have been identified in the n protein of pedv [ ] . in japan, the ped-like disease was observed from late to early , but was not reported again until the outbreaks that occurred between september and june [ ] . in an epidemic of diarrhea caused by a pedv infection in , more than , suckling pigs died [ ] . afterward, there were no ped cases reported from until the first half of [ , ] . ped outbreaks first reemerged in october from a southern location (okinawa island) and spread rapidly throughout the country. until may , pedv infections were reported from more than farms in of prefectures; the infections affected over . million pigs and led to the death of half a million pigs, according to the ministry of agriculture, forestry, and fisheries of japan (http://www.maff.go.jp). currently, pedv infections and piglet mortality has decreased significantly. however, ped still occurred and frequently recurred in pig farms in japan. therefore, better insight into the causes for the reemergence of ped outbreaks is required for more efficient control and prevention of the disease. toward this goal, we sequenced and analyzed the full-length s, m, and n genes of the japanese field pedvs in comparison with those of vaccine strains used in japan, classical japanese pedv strains, and isolates from other countries. sample collection, rna extraction, and pedv detection small intestine or stool specimens were obtained from suckling piglets, post-weaning piglets, and sows presenting acute watery diarrhea at pig farms in japan, between december and february . intestinal samples were collected from dead piglets, and fecal samples were non-invasively collected immediately after excretion. thus, no aggressive actions toward the pigs were carried out for sampling purpose. samples of two major vaccine strains that have been employed in japan, p -v (nisseiken co., ltd) and -p c (kaketsuken co., ltd., japan), were collected from commercial vaccine bottles used in the swine farms. sample preparation, rna extraction, and pedv detection were performed as previously described [ ] . japanese field samples may contain both pedv variants with large deletions in the ′terminus of the s gene and pedv strains with an intact s gene [ ] . due to the complexity in discriminating, isolating, and individually sequencing pedv strains, only specimens containing pedvs with an intact s gene were used in our study. finally, pedv-positive field samples were collected from farms, located in five different prefectures in japan. these samples, along with the two vaccine samples described above, were sequenced to determine the full-length sequence of the s, m, and n genes ( table ) . all these field pedvs were confirmed to possess an intact ′-terminus of the s gene, showing only the expected prominent single dna band from pcr products on a . % agarose gel [ ] . after producing cdna, as previously described [ ] , the full-length s gene of pedv was amplified using the primer pair fs-f/fs-r ( table ) and kod fx kit (toyobo co., japan). the pcr products were used as templates for nested pcr reactions that amplified five dna fragments spanning the entire s gene using primer sets (cs -cs ), as previously reported [ ] . the m and n genes of the pedv were also amplified from the cdna using two newly designed primer sets, fmf/fmr and fnf/fnr ( table ). emeraldamp max pcr master mix kit (takara bio, japan) was used for pcr amplifications of the cs -cs fragments, as well as the m and n genes. the amplified pcr products were purified using a fastgene gel/pcr extraction kit (nippon genetics co., ltd., japan) according to the manufacturer's protocol. all sequencing reactions were carried out in duplicate, and sequences were determined in both directions using bigdye® terminator v . cycle sequencing kits (applied biosystems, ca, usa). products were analyzed using abi prism xl genetic analyzers (applied biosystems). nucleotide (nt) and deduced amino acid (aa) sequences were edited, assembled, and aligned using geneious v . . software (http://www.geneious.com), and percentage sequence divergences at the nt and aa levels were further calculated by using the same software. the obtained nt sequences were deposited in genbank under the following accession numbers: ky -ky as shown in table . unrooted phylogenetic trees were constructed using molecular evolutionary genetics analysis (mega) software, version . [ ] , with the maximum likelihood method and bootstrap tests of replicates. the best-fit nt substitution models for analysis were assessed. phylogenetic trees based on the nt sequences of the full-length s and n genes were generated using the tamura-nei substitution model with a discrete gamma distribution (tn + g). a phylogenetic tree based on the nt sequences of the m gene was created using the kimura -parameter substitution method with a discrete gamma distribution (k + g). n-glycosylation sites were predicted using a service available on http://www.cbs.dtu.dk/services/ netnglyc. phosphorylation sites were predicted using the netphos . server (http://www.cbs.dtu.dk/services/netphos) and netphosbac . server (http:// www.cbs.dtu.dk/services/netphosbac- . ). prediction of antigenic regions was performed using the emboss protein analysis tool [ ] integrated into the geneious software. identical nt sequences of the s gene were distinguished and excluded, resulting in the identification of individual sequences from the total collected field strains. phylogenetic analysis based on the s gene sequences from the japanese strains and reference strains identified from various countries revealed two major clusters: genogroup g divided into subgroups g a and g b, and genogroup g divided into subgroups g a and g b (fig. ). all japanese field pedvs in the present study fell into subgroups g a, g b, and g b. the most dominant strains belonged to g b, which comprised of current japanese strains, along with the highly virulent (north american type) pedvs isolated in the us, canada, mexico, south korea, and taiwan. two pedv of the field pedvs, jm- from miyazaki and other strains from aomori, aichi, kagoshima, and miyazaki were grouped into a monophyletic branch designated as ped-j , and they shared high nt and aa sequence identities ( . %- % and . %- %, respectively) with each other. another subclade, designated as ped-j , including japanese strains collected in miyazaki were also clustered into a segregated branch as shown in fig. the sequence data revealed that s genes from the japanese field pedvs are of - nt long, and encode proteins with - aa residues. this consequence was due to the presence of several deletions or insertions that accumulated primarily in the n-terminus of the s protein. multiple alignments of the s gene demonstrated that jm- and jm- exhibited insertions and deletions ( -nt, -nt, and -nt deletions at positions , , and , respectively, and a -nt insertion between positions and ), which are typical for s indel strains [ , ] . compared to the two vaccine strains, all japanese field pedvs were highly conserved in epitopes c and ss , except for strain jm- that had an aa substitution (l i) within c (fig. ) . additionally, compared to the vaccine strains, all the japanese field pedvs had two aa changes (l s and d s) in the epitope ss , and three serine substitutions (a s, t s, and g s) in the neutralizing domain coe (excluding jm and jm- ). notably, the aa substitutions at positions and resulted in predictable phosphorylation sites in the s protein of the japanese field strains. furthermore, different amino acids were found at the sites within the coe domain (fig. ) . regarding the prediction of high-specificity n-glycosylation sites in the s protein, most japanese strains belonging to g b exhibited eight n-glycosylation sites over the entire s protein (additional file : table s ). jm- had one additional n-glycosylation site at residue , and jm- possessed an additionally unique n-glycosylation site at position of the aa chain. two japanese s indel strains ( jm- and jm- ) had seven n-glycosylation sites, while jm- had eight n-glycosylation sites. compared with the vaccine strain, -p c , most of the japanese non-s indel strains in g b lost three n-glycosylation sites (at , , and ) and gained another nglycosylation site (at ). compared with p- v, these g b japanese strains lost three n-glycosylation sites (at , , and ) and gained four other nglycosylation sites (at , , , and ). the m gene sequences from all the japanese field pedvs and the two vaccine strains consisted of nucleotides, encoding a protein of aa. identical nt sequences were distinguished and excluded, resulting in the identification of seven unique sequences from the total collected pedvs (table ) . a phylogenetic tree based on the m gene of the japanese strains and reference strains revealed that all the sequences were divided into groups (g and g ); g was further divided into two subgroups g a and g b (fig. a) . all the current japanese pedvs fell into g , and showed the closest relatedness to the na strains and emerging strains identified in europe, south korea, and china. these field pedvs were phylogenetically distant from the vaccine strains and a classical japanese strain (jme ) of g . the m genes of field pedvs had . %- % nt identity to each other and . %- . % nt identity with the vaccine strains. the b cell epitope, wafyvr [ ] , located at position - of the m protein, was conserved in all field and vaccine strains. compared with the vaccine strains, all japanese field strains had an aa substitution (a s) belonging to an antigenic region (aa - ), as predicted by the emboss protein analysis tool (additional file : figure s a ). strain jm- had a different aa (s n) leading to the loss of a predicted serine phosphorylation site. in another predicted epitope region (aa - ), the field pedvs had one different aa (v i) compared to p- v, and two aa substitutions (f s and q e) compared to -p c . these substitutions (f s) resulted in gaining a predicted high-specificity n-glycosylation site. the n gene of all the field pedvs and vaccine strains was nt in length encoding a protein of aa. identical nt sequences of the n gene were distinguished and excluded, resulting in the identification of unique sequences. phylogenetic analysis based on the n genes from the japanese strains and reference strains revealed the classification of pedv strains into three groups: g , g , and g (fig. b) . all japanese field strains were closely clustered together into subgroup g with other us and us-like strains. the japanese field pedvs shared . %- % n gene nt sequence identity to each other and . %- . % to the vaccine strains. strain -jm from the first outbreak in miyazaki had % nt identity to eight other field strains collected in miyazaki, aichi, and kagoshima, and this is likely to be the most dominant sequence of n gene among the field strains. compared to the vaccine strains, all the field strains in the present study had aa substitutions (additional file : figure s b ); the substitution k n resulted in forming a predicted n-glycosylation site on the n protein from the field strains, while the aa substitutions a t and n s observed in field strains formed two predicted phosphorylation sites. of note, the substitutions k n and n s belong to the reported antigenic epitopes nep-d (aa - ) and nep-d (aa - ), respectively [ ] . there were three swine farms where ped outbreaks first occurred in , and then recurred in , as shown in table . farm is located in aomori prefecture, while farms and are located in the same town in miyazaki prefecture. phylogenetic analysis based on the s gene sequences revealed that three pedv strains ( jm- , jm- , and jm- ) collected from two different outbreaks on farm were closest to each other and segregated into a distinct minor branch. pedvs from the primary ped outbreaks on farm ( jm- , jm- on farm , the s, m, and n genes of pedvs identified from the recurrent outbreak ( jm- and jm- ) shared the highest ( . %, %, and . % respectively) nt sequence identities to a strain ( jm- ) collected table information of primary and recurrent ped outbreaks occurred in the three pig farms in this study farm mortality rate of piglets less than two weeks-old; b mortality rate of the piglets less than one-week-old all the information for mortality and morbidity was kindly supplied by the veterinarians responsible for these farms from the primary outbreak. the s genes of pedvs from the primary outbreak on farms and had high ( . %- . %) nt identity to each other. these strains also had identical sequences for the m and n genes. in the secondary outbreaks, pedvs from farms and also shared highly homologous genes. the s and m genes of two strains ( jm- and jm- ) from farm shared % nt sequence identities with those of a strain ( jm- ) from farm . compared with the strain collected from the primary outbreak on farm , two strains from the recurrent outbreak had aa substitutions in their s proteins (additional file : figure s ) . notably, the substitution s n lead to the loss of a predicted serine phosphorylation site. these recurrent strains also had two aa substitutions (r s and t n) in the n protein; the r s substitution formed a predicted serine phosphorylation site. comparison to pedvs from the primary outbreak on farms and , pedvs from the recurrent outbreaks had aa substitutions in the s proteins, in addition to a single aa change (a v) in the m protein and two aa changes (l i and s f) in the n protein. notably, the substitutions l i and s f occurred in the reported epitope nep-d of the n protein. since late , massive ped outbreaks have recurred in japan causing tremendous financial losses in the swine industry. despite the nationwide use of available attenuated vaccines developed decades ago [ ] , pedv has rapidly swept across the county. our sequencing data revealed that the prevailing japanese pedvs are genetically heterogeneous and can be classified into genotypes: na, s indel, and asian non-s indel. both the na and s indel types, which have been identified in recent studies in japan [ ] [ ] [ ] ] were also responsible for recent outbreaks in the us and south korea. in our study, besides the two previously reported pedv types, we identified another type of japanese pedv (designated as asian non-s indel) that is closely related to the vietnamese, thai, and chinese strains. the asian non-s indel type was collected from an early ped epidemic that occurred in southern japan where the recent ped pandemic began spreading. moreover, the asian non-s indel type appeared at a similar time to the appearance of the na and s indel types in japan [ ] . together with the absence of ped cases from to in japan [ , ] , we speculated a possibility that the three types of japanese pedv originated from one source and emerged at the same or similar time in the southern region of japan before spreading across the country. the result of this study revealed that all the field pedv strains (except jm- ) were closely related to emerging strains identified in the us, south korea, taiwan, and in european countries. of note, the japanese pedvs were genetically most closely related to the us strains; some even had identical s gene. since the recent ped pandemics in japan started to reemerge six months after those in the us, the close genetic relationship indicated that the current japanese pedv might have been introduced directly from the us, or both the us and japanese pedvs were derived from one source of origin. since april , the na type of pedv has emerged in the us. the na strains were identified subsequently in south korea, taiwan, and japan from late . another pedv type possessing typical insertions and deletions in the n-terminus of the s gene when compared to the prototype na type was first discovered in ohio in the us [ ] . this pedv type, therefore, was designated as s indel. the s indel pedvs were also identified later in recent outbreaks in japan, south korea, canada, belgium, france, germany, portugal, slovenia, and the netherlands [ ] . both highly virulent and s indel pedvs prevailing in the us are supposed to be derived from chinese pedvs as a result of recombinant events [ , , ] . in accordance with these findings, our sequence analysis showed that the s indel strains, such as ch/hbqx/ and js , had already appeared in chinese ped outbreaks during - [ , ] . with the prevalence of both na and s indel strains in the us, south korea, and japan since , we suggested that there are two major possibilities of origin for the reemerging japanese pedv strains. first, us-like strains have been directly transmitted to japan from the us or south korea. second, the same source of the us strains could have introduced the pedv into japan, from china, shortly after the us outbreaks. however, our study revealed the prevalence of the asian none-s idel pedv strain in japan, which has not been reported in the us or south korea. thus, we incline toward the possibility that multiple parent pedv strains have been introduced into japan, from china or china's neighboring countries (such as the southeast asian region), causing the recent ped pandemic. further investigation and surveillance are required to specifically identify the source of origin for the reemerging japanese pedvs. sixteen pedv strains from four different prefectures including miyazaki, kagoshima, aomori, and aichi formed a well-supported subclade (ped-j ). fourteen pedv strains from various farms in miyazaki prefecture were also grouped into a distinct subclade (ped-j ). these results suggested that strains of those japanese sublineages (ped-j and ped-j ) may derive from two common ancestral pedvs whose progeny have spread in the regions. two genetic sublineages of us strains, namely ia -co/ and mn-ia [ ] , were identified from the us outbreaks in . notably, the japanese pedv of the japanese sublineage ped-j in this study showed a close relationship with the us sublineage ia -co/ , and pedvs of the japanese sublineage ped-j showed close relatedness with the us sublineage mn-ia . this data revealed the common pattern of genetic diversity as well as the close relationship between the japanese strains and the us strains, suggesting a common ancestor for these strains. in our previous study [ ] , by sequencing a partial s gene containing a neutralizing epitope region (coe domain), we suggested that jm- may belong to the s indel type that has been circulating in japan together with the highly virulent us-like strains. in this study, by sequencing the full-length s gene, we confirmed jm- to be an s indel strain. we also identified another strain that belonged to the s indel type, jm- , although it was not predicted to be an s indel pedv in the previous study. this discrepancy arose due to the region of the partial s gene utilized in the previous report that lack the typical insertions and deletions of the s indel type. our data revealed the circulation of s indel strains in ped outbreaks occurring in japan, but these strains compose only a minor population of the reemerging japanese pedvs. these results are consistent with two recent reports of japanese pedv [ , ] . phosphorylation of viral proteins is a reversible posttranslational modification that can have major impacts on viral infection, replication, and cytotoxicity in a host cell [ ] . for infectious bronchitis virus, belonging to the coronaviruses, the phosphorylation of the nucleocapsid protein has a dramatic influence on rna binding capability and the recognition of viral rna from nonviral rna in the process of viral replication [ ] . along with phosphorylation, glycosylation is another posttranslational modification that often strongly affects the protein functions of viruses. n-glycosylation sites in the spike gene of the severe acute respiratory syndrome coronavirus were demonstrated to be crucial for viral infection [ ] . on the other hand, mutations observed in the neutralizing regions have been proposed as presenting a viral evolution, allowing escape from antibodies developed against vaccine or classical pedv strains [ ] . in this study, we characterized differences in epitope regions, high-specificity n-glycosylation and phosphorylation sites, between the vaccine and recent field strains. various substitutions observed in the s ( , , , and ), m ( ) , and n ( , , and ) proteins may have affected the antigenicity, conferring the capacity for immune evasion in the pedv field strains, and consequently, influencing the efficacy of the vaccines. in fact, despite vaccination, pedv infections still spread rapidly and are commonly observed on ped-vaccinated farms in japan [ ] . vaccination showed very low efficacy and could not mitigate the severe losses caused by ped [ ] . based on the antigenicity analysis of the vaccine and field strains, as well as the recent performance of the ped vaccines on the japanese pig farms, we suggest that the development of novel vaccines based on reemerging pedvs is necessary to control current ped outbreaks. the first ped epidemic on farm was a severe occurrence in may (table ) . afterward, obvious clinical symptoms and death caused by ped were not observed in pigs of the herd until february when the subsequent outbreak recurred with less severity than the first. although the pigs did not show any obvious symptoms of ped, the presence of pedv on this farm was detected in piglets several times by rt-pcr during the period from june to january , according to the information supplied by veterinarians responsible for this farm. phylogenetic analysis based on the sequences of the s and n genes showed that pedv strains from the primary and secondary outbreaks formed monophyletic branches. they also shared with each other the highest sequence identity of the s, m, and n genes compared to other strains used in this study. additionally, ped outbreaks were not observed on other farms within a km radius of farm , and many strict measures for establishing a high level of security were implemented on this farm. taken together, we speculated that pedv strains causing the primary outbreak induced partial protective immunity but persisted in the herd for nearly two years. subsequently, the persisted pedvs caused the secondary epidemic. this is the first report of a two-year-long persistence of pedv in a pig herd. it has been proposed that the popular circulation of pedv variants with large deletions in the s gene is associated with the persistence of the pedv on the infected farms in japan [ ] . however, we did not detect the presence of the large s deletion variants in the fecal and intestinal samples collected from this farm. other factors, including the genetic variation of causative pedv strains, may play a more important role in the disease recurrence. on farms and , ped first occurred in may , despite all the sows receiving antepartum pedv vaccinations in . afterward, the disease disappeared until early when the subsequent outbreaks recurred. there was no detection of the pedv during the interval between these two outbreaks. phylogenetic analysis based on the s and n genes revealed that the strains collected from the first outbreaks on farms and formed a monophyletic branch. moreover, these two farms were located close to each other with a distance of . km (separated by a small mountain), and the outbreaks occurred at the same time. this suggests that the pedv strains introduced onto these farms that induced the first outbreaks were derived from a common source of pedv. likewise, in the secondary outbreaks, the strains collected from these two farms also have the highest genetic identity to each other and formed minor monophyletic branches, as shown in the phylogenetic trees for the s and n genes. all the strains collected from the primary and recurrent outbreaks on these farms were closely clustered into the subclade ped-j , together with other strains collected from other farms located in miyazaki prefecture (fig. ) . this data suggested that the pedv strains causing the subsequent outbreaks on farms and evolved from pedvs that had been circulating in the miyazaki region since . there are two possibilities for the origin of the strains that caused the subsequent outbreaks on farms and . first, pedvs may have persisted silently on these farms since , evolving, and then causing the subsequent outbreaks when suitable conditions arrived in early . another possibility is that pedvs may have persisted on other pig farms, circulating in the miyazaki region since the ped occurrence, after which the pedvs were introduced again onto farms and , causing the secondary epidemics. more data is needed to elucidate exactly the origin of these pedvs strains. the occurrence of ped in these herds has partially indicated the failure of using the current pedv vaccines, which are based on old seed stock of classical japanese strains. besides, the repeated outbreaks in these herds indicate that the disease has developed to an endemic stage. these results could be used to elucidate the prevalence of pedvs and to contribute to the prevention of ped in the region. in conclusion, our study revealed that japanese field pedvs causing ped outbreaks during - could be classified into three types, and these pedvs might have been introduced from overseas at the same time or during similar periods. the disease has developed to an endemic stage in which the pedv can persist for a long time in these herds or these local regions causing subsequent epidemics. the distant genetic relationships and various aa substitutions between the japanese field pedvs and vaccine strains may be responsible for the unsuccessful ped control in japan. our findings will be useful in understanding the origin and molecular epidemiology of the pedv, and helping to develop measures for the control of the disease. additional file : table s . highly-specific n-glycosylation sites in the spike protein of the vaccine and field strains. (docx kb) additional file : figure s . amino acid substitutions in the m and n proteins between the field and vaccine strains. porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines letter to the editor a new coronavirus-like particle associated with diarrhea in swine evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains new variants of porcine epidemic diarrhea virus, china cell culture isolation and sequence analysis of genetically diverse us porcine epidemic diarrhea virus strains including a novel strain with a large deletion in the spike gene porcine epidemic diarrhea virus: an emerging and re-emerging epizootic swine virus detection and molecular diversity of spike gene of porcine epidemic diarrhea virus in china the coronavirus spike protein is a class i virus fusion protein: structural and functional characterization of the fusion core complex identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus the gprlqpy motif located at the carboxy-terminal of the spike protein induces antibodies that neutralize porcine epidemic diarrhea virus identification of two novel b cell epitopes on porcine epidemic diarrhea virus spike protein mutations in the spike gene of porcine epidemic diarrhea virus associated with growth adaptation in vitro and attenuation of virulence in vivo heterogeneity in spike protein genes of porcine epidemic diarrhea viruses isolated in korea genetic diversity of orf and spike genes of porcine epidemic diarrhea virus in thailand incorporation of spike and membrane glycoproteins into coronavirus virions the coronavirus nucleocapsid is a multifunctional protein the identification and characterization of two novel epitopes on the nucleocapsid protein of the porcine epidemic diarrhea virus an immunohistochemical investigation of porcine epidemic diarrhoea porcine epidemic diarrhea: its diagnosis and control molecular characterization of pig epidemic diarrhoea viruses isolated in japan from isolation and molecular characterization of porcine epidemic diarrhea viruses collected in japan in us-like isolates of porcine epidemic diarrhea virus from japanese outbreaks between novel porcine epidemic diarrhea virus (pedv) variants with large deletions in the spike (s) gene coexist with pedv strains possessing an intact s gene in domestic pigs in japan: a new disease situation mega : molecular evolutionary genetics analysis version . emboss: the european molecular biology open software suite emergence of porcine epidemic diarrhea virus in the united states: clinical signs, lesions, and viral genomic sequences distinct characteristics and complex evolution of pedv strains new variant of porcine epidemic diarrhea virus identification of a conserved linear b-cell epitope in the m protein of porcine epidemic diarrhea virus isolation and experimental inoculation of an s indel strain of porcine epidemic diarrhea virus in japan origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the united states genetic variation analyses of porcine epidemic diarrhea virus isolated in mid-eastern china from to molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus field strains in central china during - outbreaks phosphorylation events during viral infections provide potential therapeutic targets role of phosphorylation clusters in the biology of the coronavirus infectious bronchitis virus nucleocapsid protein specific asparagine-linked glycosylation sites are critical for dc-sign-and l-sign-mediated severe acute respiratory syndrome coronavirus entry bioinformatics insight into the spike glycoprotein gene of field porcine epidemic diarrhea strains during - in guangdong, china measure to mitigate loss caused by ped (porcine epidemic diarrhea) using maternal immunity the work was conducted with funding from the university of miyazaki (grant number - ) and japan society for the promotion of science (kakenhi program, grant number h ). the funders had no role in the design of the study and collection, analysis, and interpretation of data and in preparation of the manuscript. data supporting the conclusions of this article are included within the article and its additional files table s , figure s , and figure s . sequence data supporting the conclusions of this article are available in the genbank repository under the accession numbers ky -ky .authors' contributions ry and nd designed the study. ry, ms, zn, and th provided the viral samples and other materials. nd, nf, at, ui, and om conducted experiments. nd designed the primers, interpreted the sequencing data and wrote the manuscript draft. ry, ms, zn, th, at, ui, nf, and om analysis the data and revise the manuscript. all authors prepared and approved the final manuscript. in this study, the intestinal samples were collected after the death of pigs due to the virus infection in the pig farms. no pig was culled for sampling purpose in this study the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. • we accept pre-submission inquiries • our selector tool helps you to find the most relevant journal submit your next manuscript to biomed central and we will help you at every step: key: cord- -kldpmws authors: pan, qing; liu, aijing; zhang, faming; ling, yong; ou, changbo; hou, na; he, cheng title: co-infection of broilers with ornithobacterium rhinotracheale and h n avian influenza virus date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: kldpmws background: since , a progressive pneumonia has become prevalent in broilers and laying hens. this disease occurrs the first day after hatching and lasts more than days, resulting in approximately % morbidity and % mortality in broilers. the objective of this study was to isolate and identify the pathogens that are responsible for the progressive pneumonia and establish an animal model for drug screening. results: serum samples were collected from intensive farms from provinces in china and analysed in the current research. our clinical survey showed that . % to % of breeding broilers, breeding layers, broilers and laying hens were seropositive for ort antibodies. from intensive farms, six ort isolates were identified by pcr and biochemical assays, and two h n viruses were isolated. newcastle disease virus (ndv) and infectious bronchitisvirus (ibv) were excluded. typical pneumonia and airsacculitis were observed both in broilers inoculated intraperitoneally with an ort isolate alone and in those co-infected with ort and h n virus isolates. specifically, the survival rate was %, %, %, % and % in birds inoculated with ort+h n virus, ort followed by h n virus, h n virus followed by ort, and ort or h n virus alone, respectively. conclusions: the results of this study suggest that ort infections of domestic poultry have been occurring frequently in china. ort infection can induce higher economic losses and mortality if h n aiv is also present. although the isolation of ort and h n virus has been reported previously, there have been no reported co-infections of poultry with these two pathogens. this is the first report of co-infection of broilers with ort and h n virus, and this co-infection is probably associated with the outbreak of broiler airsacculitis in china, which has caused extensive economic losses. ornithobacterium rhinotracheale(ort) causes respiratory infections, such as airsacculitis and pneumonia, in birds all over the world. ort can be a primary or secondary etiological agent, depending on the strain virulence, environmental factors, the immune status of the host, and the presence of other infectious agents [ ] . in recent years, outbreaks of respiratory disease associated with ort have been reported all over the world, including the usa, france, netherlands, belgium, spain, germany, hungary, israel, korea, japan, taiwan, turkey, brazil, iran and south africa [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . this pathogen can cause economic losses in the poultry industry due to growth retardation and the designation of infected carcasses as unacceptable for human consumption [ , , ] . the h n avian influenza virus (aiv) is not only widespread in poultry, but it also has important implications for human health as a zoonotic infection [ , ] . previous studies demonstrate that h n virus infection contributes to respiratory distress and is involved in diseases caused by other respiratory pathogens in the poultry industry [ , ] . more recent reports indicate that two virulent chinese isolates of h n virus induced acute respiratory distress in mice [ ] , which are widely used in biomedical research, suggesting a potential public health risk. since , progressive pneumonia has become prevalent in broilers and laying hens. this disease occurs on the first day after hatching and lasts for more than days, resulting in approximately % morbidity and % mortality in broilers. in total, we isolated six ort strains and ten h n aiv strains from the field samples. five of the six ort strains were presented simultaneously with h n and the other ort was isolated from the breeder's eggs. although ort and h n have been isolated and identified separately in previous reports, there have been no reported co-infections of poultry with these two pathogens. in the current report, we present the characterisation of ort and h n isolates obtained from co-infected broilers, with the objective of understanding the aetiology of severe avian pneumonia. in this study, a total of , chickens from intensive farms in provinces of china were evaluated, including , affected breeding broilers, , affected breeding layers, , broilers with pneumonia and , affected layers. in addition, , unaffected broilers were used as controls. in total, serum samples were collected for the detection of antibodies against ort using a commercial testing kit. the samples originated from liaoning, inner mongolia, hebei, shandong and beijing represented the ort prevalence in northern china. serum samples were tested for the presence of ort antibodies using the flockchek* ornithobacterium rhinotracheale antibody test kit (idexx gmbh, switzerland) in accordance with the manufacturer's instructions. all of the measurements were performed in duplicate, and the matching serum pairs were analysed on the same microtitre plate. the results were normalised using the positive and negative control sera provided in the kits and were expressed as the s/p value according to the following formula: s=p ¼ od sample À ð od negative controlÞ = od positive control À od ð negative controlÞ. sera with s/p values less than or equal to . were considered negative, and sera with s/p values greater than . were considered positive. the current study was approved by the animal care and use committee at china agricultural university and was carried out in accredited animal biosafety level facilities. the trachea and lungs were aseptically obtained from ort serum-positive broilers. streak cultures were performed using standard i nutrient agar (merck, germany) with % sheep blood and were incubated at °c under aerophilic conditions for - h. the positive colonies were identified by gram stain and biochemical assays [ ] . the biochemical tests assayed for oxidase, catalase, lysine, urea, indole, sulphuric acid (h s), nitrate, gelatinase, motility, and carbohydrate fermentations, including glucose, mannose, lactose, sucrose, maltose, and galactose [ , ] . dna samples were extracted from the positive ort isolates using the dneasy tissue kit (qiagen, germany) following the manufacturer's instructions. the primers used in the study were designed based on the available gene sequence [ ] . the forward primer was ′-gag aat taa ttt acg gat taa g- ′, and the reverse primer was ′-ttc gct tgg tct ccg aag at- ′. a -bp fragment of the s rrna was amplified and subjected to electrophoresis in a % (w/v) agarose gel. the pcr procedure included an initial incubation for min at °c, cycles for s each at °c, annealing at °c for s, and extension at °c for s, with a final extension at °c for min. the pcr product was sequenced, and the gene sequence was submitted to genbank. the ort isolates were designated by ort/ species/location/time. tissue samples, including lungs, pancreas and brain, were obtained aseptically from h n -positive broilers (detected by pcr). approximately mg of minced tissue was suspended in sterile physiological saline. gentamycin ( μg/ml) was added to the suspension. the undiluted supernatant ( . ml) was inoculated into day-old specific-pathogen-free (spf) chicken embryos. the eggs were candled daily, and the embryos that died within h post inoculation (pi) were discarded. the allantoic fluid was collected, and virus was detected using a haemagglutination assay (ha). if no embryo death occurred, additional three blind passages were performed before designating any samples as negative. the antigenic characteristics of the virus subtype were determined by standard haemagglutination inhibition (hi), and the allantoic fluid containing virus was harvested and stored at − °c until use [ ] . the viral rna was extracted from the allantoic fluid using the qiaamp viral rna mini kit (qiagen, germany) in accordance with the manufacturer's instruction. reverse-transcription (rt) pcr was performed using specific primers [ ] . the forward primer was ′-cty cac aca gar cac aat grr atg- ′, and the reverse primer was ′-gtc aca ctt gtt gtt gtr tc- ′. the rt-pcr was performed in a μl reaction mixture containing μl of × reaction buffer, μl of mixed dntps, μl of amv enzyme, μl of each primer, μl of the rna template, . μl of dtt, and . μl of distilled water. the pcr procedure was °c for min, cycles of °c for min, °c for min, °c for min, and finally °c for min. the pcr products were subjected to electrophoresis in a % (w/v) agarose gel and sequenced. the gene sequence was submitted to genbank. the h n virus isolate was designated by h n /species/location/time. determination of the ld of ort/chicken/shandong/ and the eld of h n /chicken/shandong/ after single colony purification in % sheep blood agar, the positive colonies were grown in bouillon medium for h at °c, and the number of colony formation units (cfu) in the culture was calculated post the inoculation. sixty -day-old healthy broilers were randomly assigned to six groups with chickens per group and maintained in negative pressure isolators. the chickens were infected intraperitoneally with different dilutions of ort/chicken/ shandong/ in . ml, including , - , - , - and - cfu. broilers inoculated intraperitoneally with sterile physiological saline served as a control group. each group was observed daily for days, and the ld was determined using the reed-muench method [ ] . in another experiment, fifty -day-old spf chicken embryos were randomly assigned to five groups with eggs per group. different dilutions of h n /chicken/ shandong/ ( . ml) were injected into the allantoic space of the embryos. the eggs were incubated in a humidified atmosphere ( %) at °c. the allantoic fluid was harvested hpi, and the eld was determined using the reed-muench method [ ] . sixty -day-old healthy broilers were randomly divided into six groups with birds in each group. all of the birds were kept in negative pressure isolators. group was inoculated intraperitoneally with ld of ort/ chicken/shandong/ in . ml, and at the same time, eld of h n /chicken/shandong/ was administrated intranasally [ ] . group received ld of ort/chicken/shandong/ intraperitoneally in . ml and, three days later, received eld of h n / chicken/shandong/ intranasally. group was inoculated intranasally with eld of h n / chicken/shandong/ and, three days later, received ld of ort/chicken/shandong/ intraperitoneally. group birds were inoculated intraperitoneally with ld of ort/chicken/shandong/ , and group was administered eld of h n /chicken/ shandong/ intranasally. group received an intraperitoneal injection of the sterile physiological saline as a negative control. each group was observed daily, and all were sacrificed on day pi. the broilers were euthanised by intraperitoneal injection of sodium pentobarbital. the gross lesions were inspected, and the main organs were collected for pathogen recovery. a total of , birds, including , breeding broilers, , breeding layers, , broilers, , layers and , unaffected broilers were evaluated in this study. we totally collected serum samples from the chickens for detection. of the birds presenting with clinical signs, of a total of ( %) sera were positive and of apparently healthy birds of ( %) samples were seropositive (table ) . with regards to age and seropositivity, the breeding species seroconverted at age days to days, the laying hens were around days and the broilers were at day to day of age. ort strain was successfully isolated from the lungs of diseased broilers by single colony purification. subsequently, the isolate was classified using biochemical assays and a pcr assay. the strain was named ort/ chicken/shandong/ . the colony formed by ort/ chicken/shandong/ was circular and small in size ( - mm in diameter), opaque to grey in colour and nonhaemolytic in sheep blood agar. the ort isolate was found to be gram negative and multi-form upon microscopic inspection (figure ) . furthermore, ort/chicken/ shandong/ showed the typical phenotypic traits of ort ( table ). the dna extracted from the ort/ chicken/shandong/ colony produced the expected -bp pcr product from the s rrna. the sequence of the s rrna was submitted to genbank (accession number jn ). a sequence analysis of the s rrna segment showed that the sequence from this isolate was %- % homologous with the ort reference strains (genbank # hq . , u . and dq . ). the allantoic fluid of the inoculated embryos was positive by ha after the second passage of the virus in the spf chicken embryos. the h n virus was identified using a standard hi assay. subsequently, the isolate was detected by rt-pcr, which yielded -bp amplicons. the gene sequence was submitted to genbank (accession number jn ). corona virus-like particles were not detected in the allantoic fluid by rt-pcr. the sequence was %- % homologous with h n viruses, with accession numbers gu . and jf . in genbank. in five severe cases, both ort and h n were isolated and identified in lungs from geographical distribution. moreover, the presence of ort was often identified while positive h n isolates alone were confirmed in the diseased poultry with lower mortality. ld of ort/chicken/shandong/ and eld of h n / chicken/shandong/ after growing in medium for h at °c, the concentration of ort/chicken/shandong/ was . × cfu/ml. the highest mortality occurred in group and group post inoculated with the ort/chicken/shandong/ strain (table ) , and the ld of ort/chicken/ shandong/ was determined to be . × cfu/ml in broilers. the eld of h n /chicken/shandong/ was . /ml (table ) . some birds showed ruffled the feathers, inactivity and reduced appetite on day pi with ort and h n virus simultaneously, ort followed by h n virus or ort alone. by day pi, most of the chickens abruptly showed clinical signs of respiratory disease, including respiratory distress, and exhibited more severe anorexia and emaciation. the infected birds died between days and pi. the survival rate was %, % and % in the ort+h n virus group, ort/h n virus group, and ort group, respectively. in contrast, birds inoculated with h n virus followed by ort or the h n virus alone displayed typical pneumonia for days, and no mortality occurred within days pi. the infected chickens died quickly after inoculation with ort alone, and the survival rate was up to %, compared to % in the h n group ( table ) . the infected birds displayed the typical lesions, such as fibrinous airsacculitis, pericarditis, peritonitis and scattered areas of haemorrhage in the lungs upon necropsy. no obvious gross lesions were observed in the liver and kidneys of the infected birds. in the current study, . % of clinical blood samples from poultry farms were positive for ort antibodies by elisa. the ort isolated from the infected lungs of a -day-old broiler grew on sheep blood agar, and the h n virus was isolated from the same broiler and identified by hi and rt-pcr. based on the sequence analysis, the chinese ort isolate is . to % homologous to other ort isolates in genbank. broilers inoculated intraperitoneally with ort/chicken/shandong/ alone displayed pneumonia and typical airsacculitis, and coinfection of the broilers with ort and h n virus isolates induced higher mortality than infection with ort or h n virus alone. therefore, these results satisfy koch's postulates for confirming the role of a suspected bacterial pathogen in disease. the results of this study strongly suggest that co-infection with ort and h n virus is responsible for the current severe pneumonia with high mortality in broilers of china. in our clinical setting, ort was associated with - % and - % mortality in broilers and layers, respectively. however, the birds infected with the ort isolated in this study had a % mortality rate, and a co-infection with the h n virus resulted in % death. our findings suggest that primary infection with ort might play a major role in the development of severe pneumonia, and secondary infection with h n further increases the mortality. these findings are different from previous reports in which no pneumonia or airsacculitis was induced by aerosol, intra-tracheal or intra-thoracic inoculation with ort alone [ ] . only intravenous inoculation has been reported to induce clinical signs in spf chickens, with at most % mortality [ ] , and no airsacculitis has been previously seen in the field. given these conflicting results, it is uncertain if ort should be regarded as a primary pathogen [ ] . additionally, it is generally acknowledged that ort and avian pneumovirusvirus (apv) infections synergistically aggravate respiratory symptoms in turkeys. an aerosol inoculation of ort without a viral primer did not result in lesions [ , ] . furthermore, viral agents could trigger higher mortality independent of ort infection, such as ndv [ ] and apv [ , ] . a recent report confirmed that ibv and e. coli infection exacerbated ort pathogenesis in adult laying hens [ ] . however, none of the above-mentioned viruses were identified in the present study. interestingly, the birds infected with ort alone developed an exudative pneumonia and extensive haemorrhage in the lungs and kidneys. this pattern of pathology is not consistent with previous reports. these histological results indicate that this newly isolated ort is different from formerly reported ort serotypes [ ] [ ] [ ] ] . because the serotype of the ort isolated in this study is unclear, further investigation is needed to identify its specific serotype and characterise ort pathogenesis based on serotype. after inoculation of broilers with ort and h n virus together, widespread haemorrhage and fibrosis in the respiratory tract were the most notable features of the infection, which led to occlusion of the air capillaries, respiratory distress and the increased mortality. these histopathological lesions are analogous to those described in birds late during the course of avian influenza h n infection alone [ , ] . notably, the severe pulmonary fibrosis was observed in the animals inoculated first with ort followed by the h n virus. the clinical signs and the respiratory lesions observed during necropsy of the birds infected with the h n +ort combination and the h n group confirm that ort, not a viral agent, triggers the overt respiratory symptoms. our findings are also different from previous reports in which ort could be involved in infections with e. coli o :k [ ] , bordetella avium [ ] , and chlamydophila psittaci [ ] as well as a combination of e. coli and apv [ ] . in our pilot study (unpublished data), e. coli and chlamydophila psittaci were occasionally identified in the latter phase of the ort infection. however, coinfection of ort and e. coli or chlamydophila psittaci could not reproduce the typical pathology of the pneumonia and airsacculitis, such as clots of fibrin in the air sacs and haemorrhage in lungs. in the co-infection, ort may dominate the primary infection, followed by secondary bacterial infections. ort was isolated and identified in birds with clinical signs immediately after hatching in the previous reports [ ] . in current study, ort/chicken/liaoning/ was isolated from the egg yolks of the breeder's eggs, suggesting the possibility of vertical transmission from parents to offspring. our data show that ort infections have been occurring frequently in china. the current experimental study confirmed that ort infection alone could induce high mortality. moreover, ort infection could produce a higher level of mortality and economic loss if h n aiv was also present. although ort and the h n virus have been isolated and identified separately in previous reports, this is the first report of co-infection of broilers with ort and h n aiv, and this co-infection might be probably associated with the outbreak of broiler airsacculitis in china, which caused an extensive economic loss. therefore, further investigation of the resistance and pathogenesis of ort is urgently needed. ornithobacterium rhinotracheale: a review isolation and characterization of ornithobacterium rhinotracheale from chickens in brazil preliminary characterization of a pleomorphic gram-negative rod associated with avian respiratory disease in vitro antibiotic sensitivity of ornithobacterium rhinotracheale strains from poultry and wild birds isolation of ornithobacterium rhinotracheale from chickens and turkeys control approaches of respiratory disease of poultry molecular characterization of ornithobacterium rhinotracheale isolated from broiler chicken flocks in iran identification and serotyping of ornithobacterium rhinotracheal ornithobacterium rhinotracheale gen. nov. sp. nov., isolated from the avian respiratory tract human infection with an avian h n influenza a virus in hong kang in characterization of the pathogenicity of members of the newly established h n influenza virus lineage in asia coinfection of avian influenza virus (h n subtype) with infectious bronchitis live vaccine isolation and identification of avian pathogens acute respiratory distress syndrome induced by h n virus the world organisation for animal health (oie): avian influenza, manual of diagnostic tests and vaccines for terrestrial animals isolation and characterization of avian influenza virus h n subtype in guangxi province of china a simple method of estimation of % end points immunohistochemical and serological investigation of experimental ornithobacterium rhinotracheale infection in chickens immunohistochemical and bacteriological investigation of the pathogenesis of ornithobacterium rhinotracheale infection in south africa in chickens with osteitis and encephalitis syndrome seroprevalence of ornithobacterium rhinotracheale infection in broiler and broiler breeder chickens in west azerbaijan province, iran experimental infection in turkeys and chickens with ornithobacterium rhinotracheale efficacy of enrofloxacin, florfenicol and amoxicillin against ornithobacterium rhinotracheale and escherichia coli o :k dual infection in turkeys following apv priming pathogenesis of ornithobacterium rhinotracheale in egg-laying hens with coexisting infectious bronchitis virus and escherichia coli infections isolation of ornithobacterium rhinotracheale from chickens, hens and turkeys showing respiratory symptoms majed al-attar: studies on the bacterial etiology of airsacculitis of broilers in northern and middle jordan with special reference to escherichia coli, ornithobacterium rhinotracheale, and bordetella avium key role of chlamydophila psittaci on belgian turkey farms in association with other respiratory pathogens co-infection of broilers with ornithobacterium rhinotracheale and h n avian influenza virus this work was supported by the university's research project for college students (urp). the authors appreciated the assistance from professor xiaoling chen (beijing academy of agriculture and forestry sciences, china) for her kind donation of two ort reference strains. authors' contributions qp contributed to the study design, evaluated the data, and drafted and wrote the manuscript. al isolated and characterised the ort. fz isolated and characterised the aiv h n . yl collected the samples and helped contact the chicken farmers. co performed the statistical analyses. nh helped with the elisa.ch contributed to the study design, obtained the funding, and evaluated the microarray. all authors have read and approved the final manuscript. key: cord- - kiekksx authors: khare, sangeeta; alali, walid; zhang, shuping; hunter, doris; pugh, roberta; fang, ferric c; libby, stephen j; adams, l garry title: vaccination with attenuated salmonella enterica dublin expressing e coli o :h outer membrane protein intimin induces transient reduction of fecal shedding of e coli o :h in cattle date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: kiekksx background: escherichia coli serogroup o :h has emerged as an important zoonotic bacterial pathogen, causing a range of symptoms from self-limiting bloody diarrhea to severe hemorrhagic colitis and hemolytic-uremic syndrome in humans. beef and dairy cattle are considered the most important animal reservoirs for this pathogen. one of the important virulence characteristics of e. coli o :h is the eaea gene encoding the kda surface protein intimin. intimin is required for attachment and effacement during the interaction of enterohemorrhagic e. coli with human and bovine neonatal enterocytes. the present study was undertaken to test the hypothesis that an adaptive mucosal immune response directed against intimin will reduce or prevent enteric colonization and fecal shedding of e. coli o :h in cattle. results: cattle were orally inoculated with either milk (control), milk with live attenuated salmonella enterica serovar dublin (vector), or milk with live attenuated recombinant s. dublin expressing intimin (vaccinated) on days , and . on day , all calves were challenged orally with e. coli o :h to evaluate whether vaccination with the recombinant s. dublin expressing intimin would reduce the level of e. coli o :h fecal shedding. during the first days, vaccinated calves shed both the vector strain and the intimin-expressing s. dublin strain at a similar level. the vector strain was shed for a significantly longer period as compared to the level of recombinant vaccine strain. calves that received the intimin-expressed vaccine ceased shedding s. dublin from day to day . all calves were challenged with e. coli o :h on day to determine the effect on fecal shedding of e. coli o :h . the amount of e. coli o :h in feces was measured for days post-challenge. we observed a transient clearance of e. coli o :h from the feces in the vaccinated calves. the magnitude of fecal e. coli o :h shedding did not correlate with the presence of intimin-specific fecal iga. conclusion: oral vaccination with live attenuated recombinant s. dublin expressing intimin reduced enteric colonization and fecal shedding of e. coli o :h . however, the transient clearance of e. coli o :h was not associated with an enhanced iga-mediated mucosal immune response. important animal reservoirs of e. coli o :h [ ] [ ] [ ] [ ] [ ] [ ] [ ] . transmission of e. coli o :h by fecal contaminated water [ , ] is thought to be a major source of infection. some person-to-person transmission has been also reported [ , ] , but the main source of human infection with e. coli o :h is contamination of food products. the infective dose of e. coli o :h is low for both calves and humans, in some cases approximately only organisms are required to cause infection [ ] . neonatal calves are particularly susceptible to e. coli o :h , but adult cattle do not generally exhibit clinical signs following experimental or natural infection. adult cattle typically continue to shed bacteria in their feces for weeks to months, or for the lifetime of the animal. carcasses of non-colonized cattle have sometimes been found to contain e. coli o :h in the abattoir, suggesting that crosscontamination during meat processing can be a major source of contamination of beef products and subsequent infection of humans [ ] . one of the important virulence factors of e. coli o :h is the eaea gene that encodes the kda surface protein intimin. intimin is required for e. coli o :h colonization, the development of attaching and effacing epithelial lesions, and disease in neonatal calves, pigs, and mice [ ] . intimin-specific antiserum can block adherence of e. coli o :h to hep- cells in tissue culture [ ] . calves challenged with intimin-deficient mutant bacteria do not develop diarrhea or attaching/ effacing lesions, nor are colonized to the same extent as animals infected with wild type or complemented mutant strains [ ] . earlier studies have proposed that mucosal iga directed against intimin might serve an analogous function in vivo [ ] . however, experimental challenge of cattle previously infected with e. coli o :h has failed to demonstrate protective immune responses [ ] , perhaps because e. coli o :h generate very low titers of specific mucosal iga responses directed against intimin or other e. coli o :h antigens [ ] . e. coli o :h colonization of mice can be reduced when the animals are fed recombinant tobacco expressing intimin [ ] . it is suggested that intimin on the surface of ehec would bind to nucleolin [ ] . the present study was undertaken to test the hypothesis that a specific adaptive mucosal immune response directed against the surface antigen intimin might prevent or reduce the colonization of e. coli o :h in cattle. the eaea gene was amplified from peb using primers sw h : '-cgcccaagcttcgttgttaagt-caatgg- ' and eaea ': '-cgcggatccagtagta-gatttgattataagagg- ' by pcr and cloned into the hindiii/smai site of prb . plasmid dna was introduced into s. dublin aroa::tet by electroporation. his-tagged eaea was produced by cloning the coding region of eaea into pet b (novagen, gibbstown, nj). expression and purification of his-tagged eaea on nta-nickel resin (qiagen, valencia, ca) was performed according to the manufacturer's instructions. his-tagged eaea was concentrated and stored in mm tris-hcl mm nacl, . mm edta and mm dtt. clinically healthy male holstein/friesian calves, aged to weeks, were obtained from a local supplier. the weight of the calves ranged between and kg. animals were cared for according to the association for assessment and accreditation of laboratory animal care guidelines under the oversight of the texas a&m university institutional animal care and use committee aup - . calves were fed liters of antibiotic-free whey-based milk replacer twice daily and given water ad libitum. before being used for experiments, calves were clinically evaluated for fever and infection with salmonella and e. coli :h . the presence of salmonella was evaluated by incubation of fecal samples in tetrathionate broth (difco), followed by enrichment in rappaport-vassiliadis r broth (difco), then by plating onto xlt- plates (bbl). all calves were free of salmonella and e. coli o :h . calves were divided into treatment groups. the control group consisted of calves that were fed only milk replacer ( ml) and ml of inoculum buffer (a suspension of % magnesium trisilicate, % sodium bicarbonate, and % magnesium carbonate) on the inoculation days. the second group consisted of the vector group ( animals). the calves in this group were inoculated with colony forming units (cfu) of the s. dublin aroa strain with the empty prb vector suspended in ml of inoculum buffer in milk replacer. the third group (hereafter called the vaccinated group) consisted of calves inoculated with - cfu s. dublin aroa prb ::eaea suspended in ml of inoculum buffer in milk replacer. overnight cultures were grown in lb broth, and the optical density at nm was determined. a volume containing the desired quantity of bacteria was added to ml inoculum buffer. the inoculum was added to ml of milk replacer and used to orally inoculate calves on days , and . for all experiments, the bacterial titer of the inoculum was determined by plating serial dilutions onto lb agar plates, incubating plates overnight at °c, and enumerating the colonies. all calves were challenged orally with cfu e. coli o :h strain - [ ] (kindly provided by dr. rod moxley from the university of nebraska, lincoln-nebraska) on day . animals were inoculated with one liter of milk replacer containing cfu e. coli o :h strain - that had been suspended in ml of % magnesium trisilicate, % sodium bicarbonate, and % magnesium carbonate inoculum buffer. fecal samples from all the calves were collected daily from day to day post-inoculation to determine the level of vaccine strain shedding. after days, fecal samples were collected weekly to determine the presence of s. dublin vaccine strain shedding. fecal samples were collected daily for days to determine the amount of e. coli shedding following oral challenge with e. coli o :h strain - on day . peripheral blood was collected weekly for serum iga and elispot assays. blood was collected in serum separator tubes, kept at °c for hours, and centrifuged at rpm for min. clarified serum was collected and stored at - °c for serum iga detection. an immulon -hb flat bottom -well microtiter plate (thermo labsystems, franklin, ma) was coated overnight at °c with μl/well ( μg/ml) his-tagged intimin. the plate was washed times with wash buffer (pbs with . % tween ), then blocked for h at °c with μl/well pbs containing % (wt/vol) dried nonfat milk powder (carnation, nestle, glendale, ca). bovine serum was diluted to : with blocking buffer, and μl/well volume of diluted serum was added to the plate and incubated for h at °c. wells were washed times with wash buffer. one-hundred μl rabbit of anti-bovine iga-horseradish peroxidase conjugate (bethyl, montgomery, tx) diluted : in wash buffer with % (wt/ vol) dried nonfat milk powder were added to each well. the plates were then incubated for h at °c. following incubation, the plates were washed times with wash buffer, then incubated with μl/well of a : mixture of , '-azino-bis( -ethylbenzthiazoline- -sulphonic acid) (abts) peroxidase substrate and peroxidase solution b (kpl, gaithersburg, md) for h at °c. after color development ( min at rt), absorbance was measured at nm on a microplate reader (fluostar optima, bmg labtechnologies, inc, durham, nc). for the detection of mucosal iga, feces were collected in individual sterile ml centrifuge tubes from all calves. fecal samples were weighed and liquefied by the addition of ice-cold . m sodium acetate buffer ph . (ratio : ). this fecal sample-buffer mixture was incubated at °c for min. to inactivate proteolytic enzymes, a cocktail of soybean trypsin inhibitor, aprotinin, and phenylmethylsulphonyl chloride (pmsf) was added to this mixture and incubated for min on ice [ ] . after incubation, the fecal suspension was centrifuged at , g at °c for min. clarified supernatant was filtered through a low binding sterile filter ( . mm). titers of intimin-specific iga in the fecal sample were detected essentially the same way as described above for the intimin-specific iga in serum, using fecal supernatant instead of serum samples. peripheral blood samples were collected directly into ml bd vacutainer cpt (becton dickinson vacutainer systems, franklin lakes, nj) that contained . ml of . m sodium citrate, ml of ficoll-hypaque and a gel barrier. peripheral blood mononuclear cells (pbmc) were isolated as described earlier [ ] . tubes were centrifuged at rpm for min. the buffy coat containing white blood cells was collected and washed in pbs-citrate. red blood cells were lysed by incubating the cell suspension in rbc lysis buffer (analytical genetic testing central, inc. denver, co) for min. cells were washed times with pbs-citrate and finally resuspended in rpmi medium (gibco brl, life technologies, inc., grand island, ny) supplemented with % fetal bovine serum, l-glutamine and sodium pyruvate. viable cells were counted using trypan blue exclusion dye and a hemacytometer. cells were kept on ice until they were aliquoted for the elispot assay. for the detection of intimin-specfic iga-secreting cells, individual wells of an elispot plate (millipore cooperation, concord road billerica, massachusetts) were incubated at °c overnight with . ug affinity purified bovine iga diluted in coating buffer ( mm carbonate buffer, ph . ). the coated plate was emptied and rinsed once with supplemented rpmi medium, then blocked with supplemented rpmi media at rt for hrs. for elispot assays, pbmc were plated in duplicate wells. cells were stimulated with histagged intimin ( ng per well) or pha ( ng/well from the sigma chemical company, st. louis, mo) and incubated for hrs at °c in a humidified incubator containing % co . after incubation, cells were rinsed once with distilled water, then washed times with pbs containing . % tween (pbs-t). anti-iga antibodies conjugated to hrpo ( ul of : dilution in pbs-t) were added to each well, and the plate was further incubated for hrs at °c. the plate was washed again with pbs-t and spots developed using ul of substrate solution ( -amino- -ethylcarbazol tablet from sigma chemicals, st. louis, mo, reconstituted as per the manufacturer's recommendation). after development, the plate was emptied and rinsed ten times with distilled water. antigen stimulated spots were reported by subtracting the number of spots obtained from wells without stimulant from the number of spots obtained in stimulant-added wells. shedding of salmonella was monitored by collecting daily fecal swabs, followed by enrichment in tetrathionate broth (beckton dickinson and company, franklin lakes, nj), and in rappaport-vassiliadis r broth (beckton dickinson and company, franklin lakes, nj). bacteria were enumerated by plating serial dilutions onto xlt- plates (beckton dickinson and company, franklin lakes, nj). quantitative e. coli o :h fecal culture ten g samples of feces were immediately processed in a stomacher, serially diluted in sterile phosphate-buffered saline, and plated in triplicate onto sorbitol-macconkey agar. the sensitivity of the direct plating was cfu/g. a g fecal sample was also added to enrichment broth (tryptic soy broth with . % bile salts), incubated overnight at °c, and plated onto selective medium. colonies isolated on selective medium were confirmed as e. coli o :h following the instructions of latex agglutination kit (bd difco™e. coli antisera kit from becton, dickinson and company, cockeysville, md). calves were euthanized by captive bolt, and a complete necropsy was performed. at necropsy, tissue samples for bacteriology and histopathology were collected from abomasum, omasum, duodenum, jejunum, ileum, cecum spiral colon, distal colon, rectum and mesenteric lymph node. homogenates of each tissue were prepared in the stomacher by mincing two mm biopsy punches of each sample in phosphate-buffered saline. the tissue homogenates were then plated and incubated overnight at °c for enumeration of bacteria. data were analyzed using sas version . (sas institute, cary, nc). statistical analysis was performed by repeated measures analysis test for between-subject effects (trt), within-subject effects (time), and within-subject-bybetween-subject interaction effect (trt*time). interaction effects are the joint effects of pairs, triplets, or higher-order combinations of the independent variables, different from what would be predicted from any of the independent variables acting alone. when an interaction is present, the effect of an independent on a dependent varies according to the values of another independent. if the probability of f is less than . for any such combination, we conclude that the interaction of the combina-tion has an effect on the dependent. note that the concept of interaction between two independents is not related to the issue of whether the two variables are correlated. the eaea gene including the upstream promoter region from e. coli o :h - was amplified by pcr from peb and cloned into the low copy, rk -based plasmid prb [ ] . this plasmid contains the par (partition) locus from rk and insures plasmid segregation and stable maintenance even in the absence of selection. this plasmid has been previously used for in vivo complementation of s. typhimurium mutations in mice [ , ] . western blot analysis revealed the production of full length eaea as well as a smaller ~ - kd protein in e. coli k carrying peb . an immunoreactive protein corresponding to the smaller protein was also present in s. dublin aroa with prb ::eaea, but the full length kd eaea protein was not seen (figure ). the presence of the smaller protein in both e. coli and s. dublin suggests that eaea is subject to proteolytic cleavage. a significant quantity of the smaller immunoreactive protein was expressed in s. dublin aroa prb ::eaea, and this strain was used for subsequent vaccine trials. all calves were orally inoculated with the non-recombinant s. dublin aroa vector or with intimin-expressing s. dublin aroa on days , and . a detailed time line for the experiment is provided in figure . calves that received s. dublin strains shed for variable amounts of time following vaccination. most calves shed the vaccine strains intermittently until the end of the experiment ( days post-immunization), indicating the establishment of the vector/vaccine strain in the host. figure depicts fecal shedding of s. dublin strains until days post-immunization. following the first immunization, both vector and vaccinated groups had similar percentages of calves positive for shedding of s. dublin aroa (vector %, vaccinated %). however, after the third immunization, the vector group contained significantly higher numbers of calves positive for s. dublin shedding as compared to animals immunized with intimin-expressing s. dublin. in order to normalize short-term fluctuations and highlight longer-term trends, we calculated the moving average for the shedding of salmonella after immunization ( figure ). by the end of the experiment, the frequency of positive shedders in both the groups was similar (~ %). intimin-specific iga was measured weekly in the serum of all calves throughout the experiment (figure ) . we observed an increase in intimin-specific iga in calves receiving either the vector or the intimin-expressing strain. statistical analyses revealed a significant time effect (p = . ), but no significant treatment effect (p = . ) or treatment × time interaction (p = . ). also, prior to the e. coli o :h challenge, there was a significant time effect (p = . ), but no significant treatment effect (p = . ) or treatment × time interaction (p = . ). a sporadic increase in intimin-specific iga levels was observed in the control group. however, we did not notice any symptoms of clinical infection in these animals. mucosal (fecal) iga responses with intimin-specific iga antibody were observed in all animals ( figure ). there was a significant time effect (p < . ), but no significant treatment effect (p = . ) or treatment × time effect (p = . ). fecal anti-intimin iga levels prior to the all calves were challenged orally with e. coli o :h on day postvaccination. fecal samples from calves were collected daily from all calves from day to day post-inoculation for salmonella culture, and fecal samples were collected weekly thereafter. after oral e. coli o :h challenge, fecal samples were collected daily to monitor e. coli o :h shedding. peripheral blood samples were collected weekly after inoculation to measure levels of serum iga and to detect intimin-specific iga-secreting cells by elispot assay. e. coli o :h challenge showed a significant time effect (p < . ) and treatment × time interaction (p = . ), but no significant treatment effect (p = . ). an increase in intimin-specific iga secreting cells was measured by the elispot assay ( figure ). there was a significant treatment effect (p = . ) and time effect (p = . ), but no significant treatment × time interaction (p = . ). using multiple comparisons, there was a significant difference between control and vaccinated animals, and between control and vector animals. however, before the e. coli o :h challenge, there was a significant time effect (p < . ) and treatment × time interaction (p = . ), but no significant treatment effect (p = . ). all calves were challenged orally with e. coli o :h on day post-vaccination. e. coli o :h shedding was measured after the challenge (figure ). there was a significant time effect (p < . ) and treatment × time interaction (p = < . ), but no significant treatment effect (p = . ). however, when the trend of shedding e. coli o :h was calculated as a polynomial trendline, the trend revealed that the vaccinated calves descended into the "valley" of the trendline earlier than those who received the vector, whereas the control group never reached the valley of the trendline during the entire study period. moreover, levels of shedding were lower in animals receiving the intimin-expressing vaccine strain. this indicates an early, albeit transient, clearance of the challenge strain in vaccinated calves. none of the examined tissue was positive for the colonization of bacteria. no notable differences were detected in the histopathology among the treatment groups. enterohemorrhagic escherichia coli (ehec) such as strain o :h is an etiologic agent of acute enteric diseases in both humans and neonatal calves [ ] ; however, mature cattle are not affected. e. coli o :h can enter the human food supply from cattle via fecal contamination of beef carcasses at slaughter [ ] . intimin is an outer membrane protein expressed by several human and animal enteric pathogens, including enteropathogenic e. coli and ehec [ ] [ ] [ ] [ ] [ ] . antibodies to intimin may prevent the initial steps of ehec colonization in the gastrointesti- nal tract [ ] [ ] [ ] . anti-intimin immune responses can modulate the outcome of experimental infection with the epec-like bacterium citrobacter rodentium in rabbits and supports the inclusion of intimin as a component of an epec or ehec vaccine [ ] . vaccination of cattle has significant potential as a pre-harvest intervention strategy to reduce e. coli o :h shedding. however, the ability of intimin to elicit protective immune responses in the bovine intestinal tract has not previously been demonstrated. we hypothesized that the mucosal immune response elicited by live attenuated salmonella enterica serovar dublin expressing the intimin protein of e. coli o :h would reduce the magnitude and duration of e. coli o :h colonization and fecal shedding. in the present study, orally-administered s. dublin vector or s. dublin expressing e. coli o :h intimin were recovered for up to days post-inoculation in the feces of calves, confirmed the establishment of intestinal carriage. the frequency of positive s. dublin shedders in both vaccinated groups at the end of experiment were similar as observed in other studies in which vaccine strains administered to cattle were shed for a considerable period of time [ ] . from - days post-inoculation, the s. dublin vector control strain was detectable in a significantly higher proportion of calves than the intimin-expressing s. dublin vaccine strain. levels of intimin-specific iga in serum and feces were not significantly higher in calves receiving intimin-expressing s. dublin. however, cattle immunized with the intiminexpressing strain group exhibited a reduced magnitude and duration of e. coli o :h shedding following oral challenge. earlier studies reported that infection of seropositive adult cattle with e. coli o :h increases serum antibody titers to intimin and to the translocated intimin receptor (tir) [ ] . intimin interacts not only with tir, but also with host cell intimin receptor(s) on the luminal surface of intestinal epithelia, including integrin and nucleolin [ , ] . these receptors are potentially accessible as binding sites for intimin during vaccination with recombinant s. dublin. while antibodies directed against either tir or intimin might impede intimin-tir interactions, antibodies to intimin might be anticipated to inhibit ehec binding to alternative host receptors as well. recently, it has been shown that vaccination with a combination of antigens associated with type iii secretion system-mediated adherence; the translocon filament protein, espa, the extracellular region of the outer membrane adhesin, intimin, and tir significantly reduced shedding of ehec o from experimentally infected animals [ ] . in our study, initial shedding of e. coli o :h after challenge was comparable in the groups receiving either vector or intimin-expressing s. dublin, and significantly lower than in the control group. earlier studies have indicated that e. coli persists (a challenge dose of ) for days to weeks in the bovine intestinal tract before being cleared [ ] . similar results were observed in this study; however, it is important to note that the challenge dose in the present study was higher ( ). the polynomial trendline revealed that e. coli o :h was cleared more rapidly from vaccinated calves than from control or vector-vaccinated animals. this provides evidence in support of the principle that potentiation of immune responses to intimin at the mucosal surface can reduce shedding of the pathogenic e. coli o :h strain. also, the possibility of interaction of various components of adaptive immunity due to initial salmonella (vector) infection could not be ruled out [ ] . we originally hypothesized that the protective responses would be related to fecal concentrations of intimin-specific iga. however, the mechanism of vaccine protection is clearly more complex, as anti-intimin fecal iga levels did not correlate with fecal shedding. enteric mucosal iga responses against intimin and type iii secreted proteins were identified in rectal mucus and in the rectal tissue respectively [ , ] . these studies definitely indicate the importance of other clinical samples (tissue and rectal mucus) for studying the mucosal immune response. moreover, protection against enteric pathogens by immunization does not essentially require secretory iga [ ] , and intestinal clearance of intimin-expressing citrobacter rodentium has been shown to require b cells and igg antibodies, but not secretory iga [ ] . importantly, intimin-specific antibody titers in colostrum and serum of dams were found to be increased after parenteral vaccination with intimin [ ] . in another study, immunization of calves with the cell-binding domain of intimin subtypes beta or gamma via the intramuscular route induced antigen-specific serum igg and, in some cases salivary iga responses, but did not reduce the magnitude or duration of faecal excretion of ehec upon subsequent experimental challenge [ ] . the role of igg in intiminexpressing vaccine induced protection of calves is worthy of further investigation. of note, reduction in colonization and shedding was obtained in this study by oral vaccination without a preceding parenteral inoculation. however, oral vaccines can significantly boost mucosal immune responses when primed by parenteral vaccine administration [ , ] . parenteral priming of the immune system facilitates the gut associated lymphoid tissue to react more rapidly to antigens delivered by oral immunization, and may decrease the likelihood of inducing oral immune tolerance [ ] . another possible explanation for the modest degree of reduction in colonization and shedding of e. coli o :h may be that intimin-specific mucosal iga was already present prior to immunization. thus, this anti-body may have interfered with ability of the intiminexpressing s. dublin vaccine strain to effectively reach gut-associated lymphoid tissue and augment local immune responses. one limitation to the present study is the need for replication in outbred populations of cattle having a more defined immune status. in summary, a live s. dublin vaccine strain expressing the e. coli o :h intimin protein effectively colonized the intestines of calves after vaccination. immunization resulted in a transient clearance and subsequently reduced colonization and shedding of e. coli o :h following challenge. authors' contributions sk coordinated sampling of animals, completed immunological assays, analyzed data and drafted the manuscript. sz cultured s. dublin. fcf and sjl designed and constructed the s. dublin vaccine strain. dh and rp isolated pbmc from blood and evaluated shedding of bacteria. wa performed statistical analyses. lga, fcf, and sjl are funded co-applicants who designed the study and edited the manuscript. all authors read and approved the final manuscript. emerging foodborne pathogens: escherichia coli o :h as a model of entry of a new pathogen into the food supply of the developed world emerging infectious diseases in the united states update on escherichia coli o :h the genetics and pathogenesis of haemolytic uraemic syndrome and thrombotic thrombocytopenic purpura bacterial crosscontamination of meat during liquid nitrogen immersion freezing characterisation of e. coli o isolates from bovine hide and beef trimming in irish abattoirs by pulsed field gel electrophoresis transfer coefficient models for escherichia coli o :h on contacts between beef tissue and high-density polyethylene surfaces survival of escherichia coli o in abattoir waste products survival and growth of escherichia coli o :h in roast beef and salami after exposure to an alkaline cleaner presence of escherichia coli o :h in ground beef and ground baby beef meat cross-contamination of lettuce (lactuca sativa l.) with escherichia coli o :h via contaminated ground beef persistent silver disinfectant for the environmental control of pathogenic bacteria the survival of foodborne pathogens during domestic washing-up and subsequent transfer onto washing-up sponges, kitchen surfaces and food the emerging nosocomial pathogens cryptosporidium, escherichia coli o :h , helicobacter pylori, and hepatitis c: epidemiology, environmental survival, efficacy of disinfection, and control measures illness outbreak associated with escherichia coli o :h in genoa salami. e. coli o :h working group escherichia coli o :h infection of calves: infectious dose and direct contact transmission escherichia coli o :h requires intimin for enteropathogenicity in calves truncated enterohemorrhagic escherichia coli (ehec) o :h intimin (eaea) fusion proteins promote adherence of ehec strains to hep- cells intimin facilitates colonization by escherichia coli o :h in adult ruminants mucosal immune network in the gut for the control of infectious diseases experimental infection of calves and adult cattle with escherichia coli o :h isotype-specific antibody responses against escherichia coli o :h locus of enterocyte effacement proteins in adult beef cattle following experimental infection plant cell-based intimin vaccine given orally to mice primed with intimin reduces time of escherichia coli o :h shedding in feces cell surface-localized nucleolin is a eukaryotic receptor for the adhesin intimin-gamma of enterohemorrhagic escherichia coli o :h illnesses associated with escherichia coli o :h infections. a broad clinical spectrum isotype-specific antibodysecreting cells to transmissible gastroenteritis virus and porcine respiratory coronavirus in gut-and bronchus-associated lymphoid tissues of suckling pigs mycobacterium bovis deltaleud auxotroph-induced protective immunity against tissue colonization, burden and distribution in cattle intranasally challenged with mycobacterium bovis ravenel s. vaccine hiv gp -specific cell-mediated immune responses in mice received: the ferritinlike dps protein is required for salmonella enterica serovar typhimurium oxidative stress resistance and virulence the alternative sigma factor sigmae controls antioxidant defences required for salmonella virulence and stationary-phase survival bovine infection with shiga toxin-producing escherichia coli invited review: effects of diet shifts on escherichia coli in cattle enteropathogenic escherichia coli: a pathogen that inserts its own receptor into host cells rosenshine i: enteropathogenic e. coli exploitation of host epithelial cells intimin and the host cell--is it bound to end in tir(s)? new insights into the epidemiology of enteropathogenic escherichia coli infection protection against hemorrhagic colitis in an animal model by oral immunization with isogeneic rabbit enteropathogenic escherichia coli attenuated by truncating intimin human colostrum contains iga antibodies reactive to enteropathogenic escherichia coli virulence-associated proteins: intimin, bfpa, espa, and espb seric and secretory antibodies reactive to alpha, beta and gamma intimins of escherichia coli in healthy brazilian adults intimin-specific immune responses prevent bacterial colonization by the attaching-effacing pathogen citrobacter rodentium binding of intimin from enteropathogenic escherichia coli to lymphocytes and its functional consequences the established intimin receptor tir and the putative eucaryotic intimin receptors nucleolin and beta integrin localize at or near the site of enterohemorrhagic escherichia coli o :h adherence to enterocytes in vivo immunization of cattle with a combination of purified intimin- , espa and tir significantly reduces shedding of escherichia coli o :h following oral challenge reduced intestinal colonization of adult beef cattle by escherichia coli o :h tir deletion and nalidixic-acid-resistant mutants lacking flagellar expression immunity to salmonella typhimurium infection in c h/hej and c h/hencrlbr mice: studies with an aromaticdependent live s. typhimurium strain as a vaccine enteric mucosal antibodies to escherichia coli o :h in adult cattle mucosal antibody responses of colonized cattle to escherichia coli o -secreted proteins, flagellin, outer membrane proteins and lipopolysaccharide ad: vaccination of pregnant dams with intimin(o ) protects suckling piglets from escherichia coli o :h infection subunit vaccines based on intimin and efa- polypeptides induce humoral immunity in cattle but do not protect against intestinal colonisation by enterohaemorrhagic escherichia coli o :h or o :h. vet immunol immunopathol oral immunisation of naive and primed animals with transgenic potato tubers expressing lt-b. vaccine conversion of orally induced suppression of the mucosal immune response to ovalbumin into stimulation by conjugating ovalbumin to cholera toxin or its b subunit. vaccine vaccination with attenuated salmonella enterica dublin expressing e coli o :h outer membrane protein intimin induces transient reduction of fecal shedding of e coli o :h in cattle we acknowledge funding from usda csrees national research initiative number and grant number - - to support the project. we are grateful for the active contribution of all student workers and the farm manager (mr. alan patranella) who provided animal care. key: cord- - mq aije authors: wang, zhilin; li, xuerui; shang, youjun; wu, jinyan; dong, zhen; cao, xiaoan; liu, yongsheng; lan, xi title: rapid differentiation of pedv wild-type strains and classical attenuated vaccine strains by fluorescent probe-based reverse transcription recombinase polymerase amplification assay date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: mq aije background: porcine epidemic diarrhea virus (pedv), an intestinal coronavirus that causes acute diarrhea and high mortality in suckling piglets, can result in high economic losses in the swine industry. in recent years, despite the use of china’s current vaccine immunization strategy, multiple types of pedv strains were still found in immunized swine herds. our research aims to explore a new rapid differentiation method to distinguish the different types of pedv strains and assess the safety evaluation of classical attenuated vaccine strains in swine herds. results: in the study, a differential one-step quantitative real-time fluorescent reverse transcription recombinase polymerase amplification (real-time rt-rpa) method based on the pedv universal real-time rt-rpa assay was established according to the orf deletion sequences of three classical attenuated vaccine strains (pedv attenuated vaccine kc , attenuated cv and dr ) and five vero cell-adapted isolates (js , sdm, sq , sc , hljby), which could effectively differentiate pedv classical attenuated vaccine strains from wild-type strains (pedv classical wild strains and variant strains). the detection limits of pedv rna in the both pedv real-time rt-rpa assays were copies within min at °c, and the detection limits of classical attenuated vaccine strain cv , vero-cell-adapted isolate js , and pedv wild-type strain dx were ( . ) tcid( )/ μl, ( . ) tcid( )/ μl, and ( . ) tcid( )/ μl, respectively. both assays were highly specific for pedv, showing no cross-reactivity with other enteral viruses. conclusion: this rpa method we developed is simple, time-effective, and safe and provides a reliable technical tool for the differential diagnosis and clinical epidemic surveillance of pedv classical attenuated vaccine strains and wild-type strains. porcine epidemic diarrhea virus (pedv) is a serious pathogen which is characterized by severe diarrhea, vomiting, and dehydration in pigs [ , ] . pedv is an enveloped, single-stranded, positive-sense rna virus belonging to the alpha coronavirus genus of the coronaviridae family [ ] . the entire genome sequence of pedv is approximately kb, which consists of seven open reading frames, encoding four structural proteins [spike protein (s, - kda), membrane protein (m, - kda), envelope protein (e, kda), and nucleocapsid protein (n, kda)], and three non-structural proteins (replicases a and b and orf ) [ ] [ ] [ ] . ped was first reported in the united kingdom in [ ] . in , pedv was isolated in belgium and named cv [ ] . in china, a diarrheal disease caused by pedv was first observed in [ ] . since the winter of , large-scale outbreaks of ped caused by highly pathogenic pedv strains have resulted in the death of a large number of pigs in south china [ , ] . subsequently, this highly pathogenic pedv strains were discovered in other countries including the united states and south korea, etc. [ ] [ ] [ ] [ ] . since the s, both inactivated and live attenuated pedv vaccines have been widely used to prevent dissemination of the virus in asia, including cv strain-based inactivated or attenuated live vaccines and bivalent inactivated vaccine using attenuated pedv and tgev in china [ , ] , the kped- and dr strainbased attenuated live vaccines in south korea [ , ] , and the p- v strain-based live attenuated vaccine in japan [ ] . however, despite the emergence of china's current vaccine immunization strategy, multiple types of pedv strains were still found in immunized swine herds [ , [ ] [ ] [ ] [ ] . an analysis of pedv whole-genome differences whose sequences were available in genbank indicated that four hypervariable regions were present in pedv, comprising the c terminus of the nsp gene and the n terminus of the nsp gene, the spike gene, the open reading frame (orf ), and the n gene region [ ] . these gene mutations might alter the antigenicity of vaccines derived from classical attenuated vaccine strains and consequently resulted in inefficient vaccination in many pig farms [ ] . at present, a variety of strains already exists in china, including classical strains (classical wild strains and classical attenuated vaccine strains, genotype ) [ , ] , highly virulent strains (genotype ) [ ] , the s-indel-pedv strains (genotype b) [ , , ] , recombinant variants of attenuated vaccine strains and wild-type strains [ , ] , and the variant with a large deletion in the s n-terminal domain, etc. [ ] . moreover, multiple types of pedv strains coexisted in the same environment and even co-infected the same pig [ ] , with a potential risk of recombination between wild-type strain and the classical attenuated vaccine strain [ , ] . this could potentially result in the enhancement of the recombinant attenuated vaccine strains in virulence and increase the difficulty of identifying different types of strains. therefore, it was particularly important to establish a new detection method to distinguish pedv classical attenuated vaccine strains and wild-type strains and to monitor the prevalence of classical attenuated vaccine strains in pigs and evaluate attenuated vaccine safety. in recent years, the sequence characteristics of the spike (s) gene in pedv strains, including insertion and deletion in the s gene (s-indel) and only the s deletion gene, have been used as genetic markers to distinguish to distinguish different types of pedv strains [ , ] . the research showed that nucleotide deletions of the orf gene in the vero cell-adapted attenuated vaccine strain were used to distinguish pedv attenuated vaccine strains and wild-type strains [ , ] . based on the variation characteristics of the s gene and orf gene, many methods including traditional pcr [ ] , real time rt-pcr [ , , ] and nanoparticleassisted rt-pcr [ ] have been established. however, there are difficulties in the monitoring, diagnosis and prevention of different types of pedv strains. in the present study, compared with the genome sequence of pedv wild-type strains and vero cell-adapted strains whose sequences were available in genbank ( fig. and table s ), we found that three vero cell-adapted classical attenuated vaccine strains (pedv attenuated vaccine kc , attenuated cv and dr ) derived from classical strains and five vero cell-adapted isolates (js , sdm, sq , sc , hljby) have a -nucleotide deletion sequence of nonstructural protein (nsp ) gene in the orf . these eight vero cell-adapted strains were artificially cell-passaged and did not naturally exist in the field unless they were used as attenuated live vaccines to be inoculated into pigs. based on these discoveries, a real time rt-rpa method was developed to effectively differentiate pedv classical attenuated vaccine strains from wild-type strains. this method contained not only a pedv universal real-time rt-rpa assay targeting the nucleocapsid gene that can identify all types of pedv strains but also included another pedv vaccine real-time rt-rpa assay targeting the nucleotides deletion sequence in the orf of three classical attenuated vaccine strains that specifically identified pedv classical attenuated vaccine strains. this method was shown to be an excellent alternative tools for the preliminary differentiation of pedv classical attenuated vaccine strains and wild-type strains, with potential use as a diagnostic method in clinical samples. the specificity, sensitivity, and repeatability analysis of the pedv real-time rt-rpa method as shown in fig. , pedv wild-type strain dx, classical attenuated vaccine strain cv , and vero-cell-adapted isolate js showed fluorescent signals in the pedv universal real-time rt-rpa assay, and only the pedv classical attenuated vaccine strain cv and vero-celladapted isolate js showed fluorescent signals in the pedv vaccine real-time rt-rpa assay. no fluorescent signals were obtained for tgev, pcv- , pdcov, ppv or pkv, indicating the high specificity of the two assays. pedv universal real-time rt-rpa and pedv vaccine real-time rt-rpa standard curves were established using different copy numbers of standard rna as templates for sensitivity analysis. the detection limits of both the pedv universal real-time rt-rpa assay (fig. ) and the pedv vaccine real-time rt-rpa assay (fig. ) were . × copies/reaction. as shown in table , the detection limits of both pedv standard rnas were . × rna copies/reaction. repeatability was evaluated using two standard rnas of the pedv attenuated vaccine strain cv n gene and the orf region, respectively, with coefficients of variation . - . (table ). for the viruses that infect in vero-e , the detection limits of pedv wild-type strain dx, classical attenuated vaccine strain cv , and vero-celladapted isolate js were . tcid / μl, . tcid / μl, and . tcid / μl, respectively. the viral load originally contained in the sample was calculated as y u = − . x + . (r = . ) (fig. b) for the pedv universal real-time rt-rpa assay and y v = − . x + . (r = . ) (fig. b) for the pedv vaccine real-time rt-rpa assay. evaluation of pedv real-time rt-rpa method, real-time rt-pcr, and one-step rt-pcr assays with clinical samples to verify the reliability of the established real time rt-rpa method, a total of suspected pedv samples were assessed by pedv real-time rt-rpa method, real-time rt-pcr assay, and rt-pcr assay, giving positive rates of . , . , and . % for pedv wild-type strains, and . , . , and . % for pedv classical attenuated vaccine strains, respectively (table ) . of the samples that tested negative in the rt-pcr assay, samples were negative and the other were positive (one classical attenuated vaccine strain and two wild-type strains) as tested by the real time rt-rpa method, and samples were negative and the other were positive (one classical attenuated vaccine strain and three wild-type strains) as tested by the real time rt-pcr assay. all positive amplified products were sequenced, which confirmed the presence of pedv in the samples and the viral load of all pedv positive samples was measured by real-time rt-rpa method in this study (fig. ). the pedv real-time rt-rpa method has highly positive diagnosis agreement with real-time rt-pcr ( . %) and rt-pcr assays ( . %). these indicated the high specificity and sensitivity of these assays. in addition, transmissible gastroenteritis virus (tgev) and porcine kobuvirus (pkv) were detected in the pedvnegative samples (data not shown). the growth curve for the pedv classical attenuated vaccine strain cv in vero-e cells determined by pedv real-time rt-pcr, pedv universal real-time rt-rpa, and pedv vaccine real-time rt-rpa indicated that viruses replicated rapidly during the first h post-infection (hpi), achieving the highest titer at approximately hpi (fig. ) . the virus titer gradually decreased because vero-e cells breakdown after h. these results showed that real-time rt-pcr and real-time rt-rpa are two alternative assays for the differentiation and characterization of pedv properties in vero-e cells. phylogenetic tree analysis of pedv strains in china demonstrated that the entire pedv genomes evolved into two separate genogroups, gi (classical strains, gi-a and gi-b) and gii (variant strains) [ , ] . classical cv (accession number: af ) and dr (accession number: jq ) belonged to the gi-a subgroup. the gi-b subgroup included vero cell-adapted vaccine strains (pedv attenuated vaccine kc , attenuated cv and dr ) derived from classical strains, a recombinant vero cell-adapted isolate (js ) of pedv attenuated vaccine and mutants [ ] , and four other vero cell-adapted isolates (sdm, sq , sc , hljby) [ , , [ ] [ ] [ ] [ ] . pedv strains in the gi-b subgroup not only have nucleotide variations in the orf or spike gene [ , , ] but also have -nt deletions of the nsp gene in the orf region in our study (fig. ) . these nucleotides deletion in the orf may have occurred in cell-adapted viruses during adaptation and attenuation through serial passage in vero cells, which is identical to nucleotide deletion of spike or orf genes in the cell-adapted isolates and attenuated live vaccines [ , ] , and thus would be unlikely to be detected in wild-type strains. based on the above findings, a differential pedv real-time rt-rpa method was established to distinguish pedv classical attenuated vaccine strains from the wild-type strains. this method contained two real-time rt-rpas, a universal real time rt-rpa assay targeting nucleocapsid gene was used to detect all types of pedv strains and another pedv vaccine real time rt-rpa could identity pedv classical attenuated vaccine strains according to orf -nucleotides deletion region of three classical attenuated vaccine strains (pedv attenuated vaccine kc , attenuated cv and dr ) and five vero cell-adapted isolates (js , sdm, sq , sc , hljby) genome sequences, which were compared to pedv wild-type strains published by genbank (fig. ). the two real-time rt-rpa assays have good specificity, with fluorescent signals only visible for pedv positive rna amplicons. the pedv detection limits of both real-time rt-rpa assays were copies, reflecting good sensitivity. clinical samples tests indicated that the pedv real-time rt-rpa method has a highly overall agreement with real-time rt-pcr ( . %) and rt-pcr assays ( . %) ( table ) , respectively, but require less than half the time of them, suggesting that the real-time rt-rpa method could be used as an alternative detection method. sequencing results of samples that were positive in the pedv vaccine real time rt-rpa assay were the same as the nucleotide deletion positions of the orf and orf fragments in classical attenuated vaccine cv . it is worth noting that among the seven classical attenuated vaccine strains in all samples, six were from the piglets that were orally inoculated with the classical attenuated vaccine cv , and none of the live pedv strain was successfully isolated in vero-e cells. this may be because the stool samples contained less viral load or only contains nucleic acids. due to orf of some vaccine candidates have not been reported, especially the vaccine candidates from highly virulent strains (genotype a) emerged after , we are not sure whether these vaccine candidates derived from non-classical attenuated vaccine strains have the same nucleotides deletion of nsp gene in the orf . if these vaccine candidates do not have the nt deletions pattern, they can not be detected by our method. similarly, if the wild-type virus may repair the nsp gene -nt-deletion region of classical attenuated vaccine strain in a co-infection event, the nucleotides-repaired strain not be detected by our method. nevertheless, commercial vaccines widely used in pig farms of china are developed based on classical attenuated strains, while vaccines derived from non-classical attenuated vaccine candidates are being developed but not yet commercialized, our method is safe, accurate and reliable for the detection and identification of classical attenuated vaccine strains in pig farms. therefore, our method can be used to distinguish classical attenuated vaccine strains and wild-type strains, while vaccine candidates derived from other nonclassical attenuated vaccine strains may not be detected. this real-time rt-rpa method was established to distinguish between classical attenuated vaccine strains that were artificially vaccinated and wild-type strain during epidemiological surveillance, thereby obtaining more accurate epidemiological data. additionally, because the real-time rt-rpa is more rapid than real-time rt-pcr and isothermal loop-mediated isothermal amplification (lamp) technology. it is also more efficient, requiring only a pair of primers and a low running temperature ( - °c) for a short period ( - min) [ ] [ ] [ ] . this compares with lamp requirements of - primers and a high running temperature ( °c) for h [ ] [ ] [ ] , and real-time rt-pcr of a pair of primers and a high running temperature ( °c) for over h [ ] . additionally, there are no melting temperature requirements for rpa primers and probes because their annealing and elongation are enzyme-mediated rather than temperature-driven [ , ] . moreover, the combination of rpa and real-time fluorescence quantification with gel electrophoresis results in high simplicity, specificity, and accuracy [ , , ] . finally, the portability of the assays means that they can be used in the field and in areas where resources are limited [ ] . in conclusion, we developed a simple, rapid, and reliable real time rt-rpa method for the differentiation of pedv classical attenuated vaccine strains and wild-type strains. these assays were analyzed using fluorescent dyes and shown to be highly specific and sensitive. they provide a reliable technical tool for the differentiation of the pedv classical attenuated vaccine strains and wildtype strains, as well as the surveillance of the clinical epidemic status of the disease. pedv attenuated vaccine strain cv and vero-cell-adapted isolates js were passaged in vero e cells. pedv wild strain dx, transmissible gastroenteritis virus (tgev), porcine circovirus type (pcv- ), porcine deltacoronavirus (pdcov), porcine kobuvirus (pkv), and porcine parvovirus (ppv) were maintained in our laboratory. fecal samples were collected from piglets suspected of being infected with pedv from five pig farms in dingxi, jiayuguan, linxia, and tianshui, gansu province, china. clinical samples were centrifuged at g for min, and the supernatant was stored at − °c. viral rna and dna were extracted using the takara minibest viral rna/dna extraction kit ver. . (takara co., ltd., dalian, china) according to the manufacturer's instructions, and then quantified using an nd- c spectrophotometer (thermo scientific, wilmington, de, usa). for clinical samples, extracted viral rna was eluted in μl of rnase-free water. all rna and dna templates were stored at − °c until required. real-time rpa primers and probes (synthesized by sangon biotech, shanghai, china) were designed and verified by blast analysis (https://blast.ncbi.nlm.nih.gov/ blast.cgi) according to the nucleocapsid gene conserved sequence and replicase gene orf region (containing a -nucleotide deletion) of the pedv classical attenuated vaccine cv strain (table ) (table ) from pedv classical attenuated vaccine cv cdna and named pedv-v/qrt-rpa. synthesis of the first-strand pedv classical attenuated vaccine strain cv cdna was performed by reverse transcription using the primescript™ st strand cdna synthesis kit (takara, dalian, china), and the pcr conditions were as follows: °c for s, followed by cycles of °c for s, °c for s, and °c for s, with a final extension at °c for min. the amplified pcr product was then linked to the pgem-t easy vector to construct the standard plasmid for use in the pedv vaccine real-time rt-rpa assay. both plasmids were sequenced by tsingke biological technology, linearized by digestion with nde i (takara co., ltd.), purified using the takara minibest dna fragment purification kit ver. . (takara co., ltd.), and transcribed in vitro with the ribomax large scale rna production system-t (promega, madison, wi, usa). agarose gel electrophoresis was used to verify the length and integrity of transcribed standard pedv rna in vitro. the number of standard rna copies was calculated using an nd- c spectrophotometer and the rna copy number was calculated as follows: ( . € y copy number/mole number) × ( rna concentration)/( × base number). the real-time rt-rpa assay was performed using twis-tamp® exo rt (twistdx) in the following assay reaction system: nm ( . μl) of each rpa primer ( μm), nm ( . μl) exo probe ( μm), mm ( . μl) rehydration buffer, μl of viral rna or μl sample rna, μl of rnase inhibitor, and ddh o to a total volume of . μl. after mixing, this was added to the recombinase reaction pellet with . μl mm magnesium acetate and mixed well. the sample was vortexed, briefly centrifuged, and the tubes were immediately placed in the agilent technologies mx p thermocycler device (life technologies, carlsbad, ca, usa) to start the reaction at °c for min ( s per cycle, a total of cycles). real-time rt-pcr was performed to identify pedv wildtype strains and classical attenuated vaccine strains in an agilent mx p thermocycler machine (life technologies) using the primers and probe based on the pedv spike gene [ ] with the one step primescript® rt-pcr kit (perfect real time; takara co., ltd). the assay was performed as follows: °c for min, then °c for s, followed by cycles of °c for s and °c for s. the specificity and sensitivity analysis of pedv real-time rt-rpa method a total of ng of rna or dna extracted from pedv dx, cv , and js , and tgev, pkv, pdcov, ppv, and pcv- was used as a template to analyze the specificity of pedv real-time rt-rpa method on an agilent mx p thermocycler machine (life technologies). this was repeated three times. sensitivity analysis of two pedv real-time rt-rpa assays was conducted using -serial dilutions of standard rna as the original template ranging from × to × copies. a total of μl of each serial dilution was used to evaluate the dynamic detection range of the two pedv real-time rt-rpa assays. meanwhile, . tcid / μl of classical attenuated vaccine strain cv , . tcid / μl of vero-cell-adapted isolate js , and . tcid / μl wild dx strain were -fold serially diluted with modified eagle medium (mem) and used as original templates in the rt-rpa method to determine the detection limitation. each run was repeated four times, and a probabilistic regression analysis was performed with an agilent mx p thermocycler machine (life technologies) to determine the limits of the assay. the standard curve was calculated using graphpad prism . software (graphpad software inc., san diego, ca, usa). two pairs of primers, f -v/r and f -c/r [ ] , were used for rt-pcr with the primescript™ one step rt-pcr kit ver. . (takara co., ltd., dalian, china) to detect samples with suspected pedv infection from four locations in gansu province, china. the fecal samples were obtained from five pig farms that have a history of inoculating the attenuated vaccine cv , six of which from the piglets orally inoculated with the attenuated vaccine cv and show no clinical symptoms of diarrhea, and other fecal samples were collected from piglets with symptoms of diarrhea. all fecal samples underwent pedv real-time rt-rpa, pedv real-time rt-pcr, and rt-pcr assays. finally, all pedv-positive products were sequenced by tsingke biological technology. supplementary information accompanies this paper at https://doi.org/ . /s - - - . additional file : table s . the name, accession number, and search website of the pedv strain in the study. a new coronavirus-like particle associated with diarrhea in swine outbreak of porcine epidemic diarrhea in suckling piglets further analysis of the genome of porcine epidemic diarrhoea virus sequence analysis of the porcine epidemic diarrhea virus genome between the nucleocapsid and spike protein genes reveals a polymorphic orf completion of the porcine epidemic diarrhoea coronavirus (pedv) genome sequence an apparently new syndrome of porcine epidemic diarrhoea porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines complete genome sequence of a variant porcine epidemic diarrhea virus strain isolated in china complete genome sequence of a porcine epidemic diarrhea virus variant isolation and characterization of porcine epidemic diarrhea viruses associated with the disease outbreak among swine in the united states prevalence, complete genome sequencing and phylogenetic analysis of porcine deltacoronavirus in south korea reverse transcription-pcr assays for the differentiation of various us porcine epidemic diarrhea virus strains cell culture isolation and sequence analysis of genetically diverse us porcine epidemic diarrhea virus strains including a novel strain with a large deletion in the spike gene molecular characterizations of subcellular localization signals in the nucleocapsid protein of porcine epidemic diarrhea virus coexistence of multiple genotypes of porcine epidemic diarrhea virus with novel mutant s genes in the hubei province of china in differentiation of a vero cell adapted porcine epidemic diarrhea virus from korean field strains by restriction fragment length polymorphism analysis of orf mutations in the spike gene of porcine epidemic diarrhea virus associated with growth adaptation in vitro and attenuation of virulence in vivo detection and molecular diversity of spike gene of porcine epidemic diarrhea virus in china rt-pcr-based dot blot hybridization for the detection and differentiation between porcine epidemic diarrhea virus and transmissible gastroenteritis virus in fecal samples using a non-radioactive digoxigenin cdna probe isolation, molecular characterization and an artificial infection model for a variant porcine epidemic diarrhea virus strain from establishment of a nanoparticle-assisted rt-pcr assay to distinguish field strains and attenuated strains of porcine epidemic diarrhea virus genomic and epidemiological characteristics provide new insights into the phylogeographical and spatiotemporal spread of porcine epidemic diarrhea virus in asia establishment and application of a multiplex rt-pcr to differentiate wild-type and vaccine strains of porcine epidemic diarrhea virus a taqman probebased real-time pcr to differentiate porcine epidemic diarrhea virus virulent strains from attenuated vaccine strains porcine epidemic diarrhea in china molecular characterization of the orf and s genes of porcine epidemic diarrhea virus non s-indel strains in seven regions of china complete genome sequence of a recombinant porcine epidemic diarrhea virus strain from eastern china genome sequencing and analysis of a novel recombinant porcine epidemic diarrhea virus strain from henan epidemiology and vaccine of porcine epidemic diarrhea virus in china: a mini-review cloning and further sequence analysis of the orf gene of wild-and attenuated-type porcine epidemic diarrhea viruses a novel duplex taqman probe-based real-time rt-qpcr for detecting and differentiating classical and variant porcine epidemic diarrhea viruses development of a multiplex taqman probe-based real-time pcr for discrimination of variant and classical porcine epidemic diarrhea virus evolutionary and genotypic analyses of global porcine epidemic diarrhea virus strains complete genome sequence of a vero cell-adapted isolate of porcine epidemic diarrhea virus in eastern china phylogeny and expression of the nucleocapsid gene of porcine epidemic diarrhoea virus characterization and evolution of the coronavirus porcine epidemic diarrhoea virus hljby isolated in china a portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus rapid detection of hiv- proviral dna for early infant diagnosis using recombinase polymerase amplification recombinase polymerase amplification for diagnostic applications loop-mediated isothermal amplification (lamp): principle, features, and future prospects lava: an open-source approach to designing lamp (loop-mediated isothermal amplification) dna signatures development of reverse transcription loop-mediated isothermal amplification for rapid detection of porcine epidemic diarrhea virus evaluation of two real-time polymerase chain reaction assays for porcine epidemic diarrhea virus (pedv) to assess pedv transmission in growing pigs dna detection using recombination proteins real-time reverse transcription recombinase polymerase amplification assay for rapid detection of porcine epidemic diarrhea virus factors influencing recombinase polymerase amplification (rpa) assay outcomes at point of care publisher's note springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations we thank aje english editing experts for revising the grammar and language. authors' contributions x l collected the samples in gansu province and designed the study. zlw, z d, and jy w performed the experiments. zl w, xr l, yj s, xa c and ys l analyzed the data. zl w drafted the manuscript. all the authors read and approved the final paper. this study was funded by national key research and development program ( yfd ). the design of this study, sample collections, data analysis, and the writing of this manuscript were supported by this funding ( yfd ). all data generated or analysed during this study are included in this published article (and its additional file table s ). not applicable. the authors declare that they have no competing interests. the work is an original paper and is not under consideration in other journals.author details key: cord- - shnkrto authors: kang, jeongwoo; park, hae-chul; jang, yang ho; hossain, md akil; jeong, kyunghun; jeong, mi young; yun, seon-jong; park, sung-won; kim, dae gyun; lee, kwang-jick title: national post-market surveillance assessment of veterinary medicines in korea during the past decade date: - - journal: bmc vet res doi: . /s - - -z sha: doc_id: cord_uid: shnkrto background: veterinary medicines have been widely used for the prevention and treatment of diseases, growth promotion, and to promote feeding efficacy in livestock. as the veterinary medicine industry has steadily grown, it is crucial to set up a baseline for the quality of medicine as well as the insufficiency or excessiveness of the active ingredients in drug products to ensure the compliance, safety and efficacy of these medicines. thus, the years data of post-marketing quality control study was summarized to determine the rate and extent of non-compliance of these medicines and to establish baseline data for future quality control measures of veterinary medicine. results: in this study, drugs for veterinary use were collected per year from each city and province in korea and analysed for the quantity of active ingredients according to the “national post-market surveillance (npms) system” over the past decade. the npms assessment was performed using liquid and gas chromatography, titration, uv/vis spectrophotometry, and bioassays. a total of cases were deemed noncompliant, with the average noncompliance rate for all medicine types being . %. the average noncompliance rates for antibiotics, biologics and other chemical drugs except antibiotics (ocd) were . %, . %, and . %, respectively. the first leading cause for noncompliant products was insufficient quantity of major ingredients ( cases), and the second leading cause was the existence of excess amount of active ingredients ( cases). tylosin, spiramycin, ampicillin, tetracyclines and penicillins were most frequently found to be noncompliant among antibiotics. among the ocd, the noncompliance was found commonly in vitamin a. conclusion: the overall trend presented gradually decreasing violation rates, suggesting that the quality of veterinary medicines has improved. consistent application of the npms assessment and the establishment of the korea veterinary good manufacturing practice (kvgmp) will help to maintain the good quality of medicine. veterinary medicines are concerned with the prevention, control, diagnosis, and treatment of diseases that affect the health of companion, domestic, exotic, wildlife, and production animals. they are also used to improve feed efficiency, promote growth of livestock, and prevent the transmission of animal diseases to people. the veterinary medicine industry in korea has grown following the expansion of livestock industry, and reached a market size of millions usd by . as of , the total number of domestic manufacturers and importers of livestock are , consisting of manufacturers, importers, and repair shops of medical devices, while the number of approved products reached a total of ( antibiotics, biologicals and other veterinary drugs except antibiotics and biologics [ocd] ). in korea, national product quality control measures for veterinary medicine consists of pre-market government testing system (pmgts) and the national post-market surveillance (npms) assessment on veterinary medicine before and after the distribution. quality controls of antibiotics and biologics are performed by pmgts prior to reach the products in open market, ensuring that stringent efficacy and safety requirements are met in accordance with the "handling rules of veterinary medicinal products" [ , ] . meanwhile, local manufacturing facilities and veterinary medicinal products quality have improved owing to the implementation of korea veterinary good manufacturing practice (kvgmp) on - - in accordance with the "kvgmp requirement for quality control" resulting in the gradual decrease of the government testing rejection rate [ , ] . accordingly, testing of antibiotics by pmgts was abolished from to - , while some biologics received partial exemptions from pmgts as of - - . the latter exemptions are limited to kvgmp-designated manufacturers. for biologics, pmgts is performed on newly approved products, which become exempt from government testing after or more consecutive lots are found to be acceptable. following acquisition of exempt status, these products are still subject to spot-check government testing when necessary. moreover, in the case of new antibiotics, the first manufactured lots are designated as priority collection items and collected for testing [ , ] . in the case of veterinary medicines currently in distribution, the active ingredient quantities of more than medicines are tested each year in accordance with "tips for inspecting a veterinary pharmaceutical affair" [ ] . the korean ministry of agriculture, food, and rural affairs (mafra) has established collection and testing plans designating the number of products, types of active ingredients, and locations from which sampling should take place (fig. ). the korea animal and plant quarantine agency (qia) and each individual city/ province collects antibiotics, biologics and ocd currently in distribution from manufacturers, importers, and wholesalers of veterinary medicine, veterinary pharmacies, and veterinary hospitals in accordance with these testing plans. during this process, products are collected, with priority given to products with questionable quality, products with sale prices below the cost of production which disrupt the distribution order, identical products sold at widely disparate prices, and products with high market share. postmarketing quality control measures are implemented on these products through qia testing and levying of administrative measures such as suspension of marketing authorization and withdrawal of marketing authorization [ , ] . the present study was performed to analyse the results of these veterinary medicine collections and tests over the past years, between and , for the purpose of establishing baseline data for future veterinary medicine quality control measures. the tested samples consisted of veterinary medicines stored or distributed by manufacturers, importers, and wholesalers of veterinary medicine, veterinary pharmacies, and veterinary hospitals, and were collected by qia and local municipalities throughout korea ( provinces and cities). in total, , products were collected and tested from to . all the drug samples were analysed three times immediately after collecting them, and the results were documented. reference standards were purchased from sigma-aldrich (st. louis, mo, usa) for all the veterinary drugs. all solvents used in chromatographic analysis were of hplc collected veterinary medicine samples were tested by the qia using various certified methods such as the korean standards of veterinary pharmaceuticals [ ] , the korean pharmacopoeia [ ] , the standards of national certification assay of the veterinary biological products [ ] and other foreign test methods which are summarized in "compendial analysis method for veterinary medicines, animal and plant quarantine agency (qia), south korea" (table ) . [ ] [ ] [ ] [ ] [ ] high performance liquid chromatography (hplc) and microbial assays were used for antibiotics while hplc, ph, and titration methods were used for other chemical agents. finally, vaccines, classified as biologics, were tested using microbial and viral assays. testing results for the veterinary medicine samples collected throughout korea between and are shown in table . a total of , samples, comprising antibiotics, ocd, and biologics, were tested, among which a total of samples were found to be noncompliant (average noncompliance rate of . %). the number of noncompliant samples found in different drug groups are antibiotics ( . %), ocd ( . %), and biologics ( . %). the average noncompliance rate by year steadily decreased over the years (fig. ) . reasons for noncompliance in collected and tested veterinary medicines table outlines the causes for noncompliance in veterinary medicines collected and tested between and . from a total of cases, ( . %) and ( . %) cases were deemed noncompliant owing to "insufficiency of major ingredient quantity" and "excess of major ingredient quantity", respectively. moreover, ( . %), ( . %), ( . %), and ( . %) cases were marked as "inadequate ph," "abnormal characteristics," "violation of marking standards," and "others", respectively. noncompliance rate by active ingredient in collected and tested veterinary medicines table shows the noncompliance rates for individual compounds in veterinary medicines collected and tested between and . for antibiotics, the highest number of noncompliant cases (n = ) were found concerning macrolide drugs, such as tylosin, spiramycin, and erythromycin, followed by cases concerning beta-lactams, such as ampicillin, amoxicillin, and penicillin, and cases concerning tetracyclines. for ocd, the ingredients found to be noncompliant included vitamin a (n = ), probiotics (n = ), and topically applied products such as pet shampoos (n = ), disinfectants (n = ), and glucocorticoids (n = ). for biologics, bovine rota-coronavirus live mixed vaccine, canine parvo and coronavirus live mixed vaccines, an investigation of noncompliant veterinary medicines collected and tested between and showed that out of total cases, the highest number of noncompliant cases (n = ) were found during the summer months (june to august). during spring and fall (march to may and september to november, respectively), the number of noncompliant cases were and , respectively, while a relatively lower number of noncompliant cases ( ) were found during winter (december to february) (fig. ). veterinary medicines are essential for the advancement of the livestock industry, and the importance of quality control is emphasizing more due to the increase in the availability and demand of different types of veterinary medicines. concentration of active ingredient is the most important characteristic of a drug product, as the amount of active ingredient allows to determine the intensities of treatment and toxicity of that particular drug. moreover, the noncompliance rates of veterinary medicines are also pertaining in the elevation of contamination and drugs residues in the food products of animal origin [ , ] . the npms assessment was initiated in for the quality control of ocd which are in distribution. antibiotics and biologics were previously assessed by both pmgts and npms. the control of antibiotics was abolished from pmgts on - - and the exception biologics which pass ten times consecutively by pmgts have been incorporated into the npms assessment system on - - [ ] . so, npms is very important for the quality control of veterinary medicines as there is no other assessment system except npms. testing methods have greatly improved from traditional bioassay examination owing to continued research and development. improved hplc and titration methods are now being used for analysis based on the compendia as shown in table . a small surveillance study in taiwan in the year of accounted noncompliant cases out of cases ( . %), which is comparable with our study [ ] . the overall violation rate in korea in the year was same as the violation rate in taiwan in . as shown in fig. , noncompliance rates by year showed an annual trend of gradual decrease from . % to . % which indicates that the implication of npms in veterinary medicine is helping to improve the quality of them. in particular, antibiotics have shown very dramatic decrease in noncompliance rates ( table ), illustrating that veterinary medicine manufacturing facilities and quality control standards have significantly improved over time [ , ] . that such annual trend reflects the effectiveness of the npms assessment and kvgmp programs. meanwhile, no noncompliant cases for ocd were found in , which was due to the testing of a large proportion of disinfectant samples ( disinfectants out of ocd) compared to the previous years. the disinfectant reinforcement measure due to the avian influenza outbreak was the behind cause to test many samples only for disinfectants. vitamin a, which was often found as a noncompliant product in previous years, did not appear in the list of noncompliant products, as we have tested very few samples of vitamin a among the ocd in . of the noncompliant cases, "insufficiency of active ingredient quantity" was the reason for cases, accounting for approximately . % of all noncompliant cases. the next most frequently observed reason was "excess of active ingredient quantity," with cases observed (approximately . %). in fact, manufacturing facilities cannot always give uniform products. they should have the quality control system and need to check the quality-related parameters batch-wise to comply with the recommended specifications. but, most of the manufacturers do not have quality control system and are unintentionally producing some products which contain less or excess amount of active ingredients. these companies are not also accredited by kvgmp. the second important cause of noncompliance is the using of low quality or potency of active ingredients in veterinary medicine by the manufacturers to reduce the production costs which is investigated by the audit of "veterinary management division" of qia. so, this report is suggesting to the manufacturers to establish their own quality assurance facilities to produce quality products. another cause of noncompliance is the storing of the products in improper storage condition particularly in summer season by the sellers and veterinary pharmacies (fig. ) . it was also recorded in the previous years that the noncompliance rate was increased in summer season due to not maintaining the proper storage condition. this indicates that the seasonal factors, including temperaturerelated issues during storage and distribution, may act as key factors of noncompliance. thus, it is suggested to the sellers and distributors to maintain the veterinary medicine in proper storage condition as mention in guidelines. as shown in table , the noncompliance rate was high among antibiotics with higher molecular weight. the antibiotics were also found to be noncompliant whose active ingredient contain for each dose are high such as tylosin and spiramycin. among the nutritional supplements, noncompliance was the highest for fat soluble vitamins, such as vitamin a, which has low titre owing to being easily oxidized, as well as a few probiotics, whose cell count drops quickly when preservation conditions are not adequate. currently, an average of - cases of biologics both subject to and exempt from national testing are assessed each year, and among these, noncompliance was reported for cases of bovine rota-coronavirus live mixed vaccine, and case each of newcastle live attenuated vaccine, canine parvo and coronavirus live mixed vaccines, porcine transmissible gastroenteritis rotavirus live mixed vaccine, porcine epidemic diarrhoea vaccine, and classic swine fever virus vaccine. significant improvements in the manufacturing environment and quality control standards have been achieved through the implementation of kvgmp. however, voluntary efforts by manufacturers are still needed to continue the application of kvgmp for the improvement of the quality of veterinary medicines. in particular, ocd showed a high noncompliance rate of about %. the ministry of agriculture, food and rural affairs (mafra) of korea is expecting to analyse the sales figures from the korea animal health products association, and the npms assay results from qia accordingly, to increase the statistical feasibility of the npms assessment results. the mafra is also expecting to increase the number of test samples for ocd, as they present relatively high noncompliance rates. it is also expected by mafra to reinforce testing during the vulnerable summer season. proactive self-quality control by manufacturers for improved veterinary medicine quality must be promoted; while simultaneously, the efforts to establish an effective quality control system must continue as well. handling rules of veterinary medicinal products. notification no. postmarket surveillance of medical devices: a comparison of strategies in the us, eu, japan, and china gmp guideline lecture of veterinary drugs post-market surveillance assay of veterinary medicines in korea tip for inspecting a veterinary pharmaceutical affair. directive no. korean pharmacopoeia of veterinary medicinal products standards of national certification assay of the veterinary biological products the united states pharmacopoeia. th revision british pharmacopoeia commission society of japanese pharmacopoeia. the japanese pharmacopoeia compendia of analysis method for veterinary medicines chemical residues and contaminants in foods of animal origin in korea during the past decade veterinary drug residues in domestic and imported foods of animal origin in the republic of korea issn no.: - . food and drug administration, ministry of health and welfare not applicable. all data generated or analyzed during this study are included in this published article.author's contributions jwk designed the study, analysed the data and submitted the manuscript. kjl was involved in the design of the study and review of the manuscript. hcp, yhj, mah, khj, myj, sjy and swp contributed to the various assay and analyzed preliminary data. dgk was involved in the critical review and approval of the revised manuscript. the authors declare that they have no competing interest. ethics approval and consent to participate not applicable.• we accept pre-submission inquiries • our selector tool helps you to find the most relevant journal submit your next manuscript to biomed central and we will help you at every step: key: cord- - zu e y authors: piñeyro, pablo enrique; lozada, maria inez; alarcón, laura valeria; sanguinetti, ramon; cappuccio, javier alejandro; pérez, estefanía marisol; vannucci, fabio; armocida, alberto; madson, darin michael; perfumo, carlos juan; quiroga, maria alejandra title: first retrospective studies with etiological confirmation of porcine transmissible gastroenteritis virus infection in argentina date: - - journal: bmc vet res doi: . /s - - - sha: doc_id: cord_uid: zu e y background: in , a notification of porcine transmissible gastroenteritis virus (tgev) was made by the national services of animal health of argentina (senasa) to the world organization of animal health (oie). the notification was based on a serological diagnosis in a small farm with a morbidity rate of . % without enteric clinical signs. in order to determine if tgev was circulating before the official report, a retrospective study on cases of neonatal diarrhea was performed. the selection criteria was a sudden increase in mortality in - to -day-old piglets with watery diarrhea that did not respond to antibiotics. based on these criteria, three clinical cases were identified during – . results: all animals that were evaluated presented histological lesions consistent with enteric viral infection. the feces and ultrathin sections of intestine that were evaluated by electron microscopy confirmed the presence of round particles of approximately nm in size and characterized by finely granular electrodense nucleoids consistent with complete particles of coronavirus. the presence of the tgev antigen was confirmed by monoclonal specific immunohistochemistry, and final confirmation of a metabolically-active virus was performed by in situ hybridization to detect a tge mrna encoding spike protein. all sections evaluated in this case were negative for pedv and rotavirus a. conclusions: this is the first case series describing neonatal mortality with etiological confirmation of tgev in argentina. the clinical diagnosis of tgev infections in endemic regions is challenging due to the epidemiological distribution and coinfection with other enteric pathogens that mask the clinical presentation. electronic supplementary material: the online version of this article ( . /s - - - ) contains supplementary material, which is available to authorized users. there are five coronaviruses (covs) known to infect swine, and the clinical disease is mainly associated with neonatal diarrhea, but respiratory and neurological signs have also been reported [ ] [ ] [ ] [ ] . porcine transmissible gastroenteritis virus (tgev) and porcine epidemic diarrhea virus (pedv) belong to the coronaviridae family, coronavirinae subfamily, and genus alphacoronavirus [ ] . a new coronavirus genetically distinct from tgev and pedv, porcine deltacoronavirus (pdcov) (genus deltacoronavirus), has recently been associated with enteric disease in pigs [ ] . enteric porcine coronaviruses including tgev, pedv and pdcov are characterized by acute diarrhea and anorexia with rapid dissemination in naïve populations. the severities of clinical diarrhea, vomiting, and anorexia can vary based on the age of the affected pigs [ , ] . without adequate passive lactogenic immunity, the mortality rate in neonatal piglets can reach up to % [ , [ ] [ ] [ ] . etiological diagnosis relies mainly on molecular tools like pcr and serology, as the clinical signs and enteric lesions associated with tgev and pedv are indistinguishable [ , , ] . the epidemiology of tgev is rather complex, and infection in neonates can arise from multiple sources. in addition to swine, it has be documented that cats, dogs, and foxes can host tgev [ ] . the virus can be shed in feces for approximately months, and milk shedding from infected sows can result in vertical transmission. historically, tgev infection has followed a seasonal pattern, becoming more prevalent during winter months perhaps due to increased viral survival in colder temperatures and with less exposure to sunlight. tgev is susceptible to most commercial disinfectants, but resistant to digestive bile and stable at ph [ ] . only one tgev genotype has been described, however differences in pathogenicity among strains has been reported in field outbreaks, although not confirmed by an experimental study [ ] . infection with tgev has two different clinical presentations: epidemic and endemic. in epidemics, tgev enters a naïve herd and all pig categories are affected, particularly piglets that are - weeks old. the duration of the clinical presentation is short, approximately weeks, and in small, farrow-to-finish herd, the infection can be self-limiting [ , ] . endemic disease scenarios, those occurring after the epidemic phase, are observed in farms with incomplete aiao management or in breeding farms that have a continuous flow of naïve gilts. in breeding herds, the varying levels of humoral and lactogenic immunity lowers piglet mortality, but may lengthen the course of the disease [ ] . since the first description provided in the united states [ ] , tgev infections have been reported all over the world. in south america, it has been reported in colombia [ ] , venezuela [ ] , bolivia, and is currently seen in brazil [ ] . in argentina, an episode of high pre-weaning mortality related to isospora suis infection alone or in association with an unknown enteric virus was reported in [ ] . further studies using negative stain electron microscopy demonstrate the presence of viral particles consistent with coronavirus in feces of pre-weaning diarrheic ( . %) and post-weaning ( %) piglets [ ] . a retrospective histopathological study performed on cases of neonatal diarrhea at our laboratory during showed that % of neonatal diarrhea cases had lesions consistent with viral enteritis [ ] . in , a notification of tgev infection was reported by the national services of animal health of argentina (senasa) to the world organization of animal health (oie). it was detected by serology in a small farm with an apparent morbidity rate of . % without clinical signs [ ] . this is an unusual presentation of tgev infection and might be related to passed infection or interspecies transmission [ ] . in order to clarify the situation prior to the first official report of tgev infection in argentina, a retrospective study was performed on cases suspected of tgev-like disease recorded at the laboratory of special veterinary pathology at the college of veterinary sciences, la plata university. benchmarking analyses of epidemiological behavior and clinical histories were the criteria for herd selection. etiological diagnosis was confirmed by electron microscopy (em), immunohistochemistry (ihc), and in situ hybridization (ish-rna) of archived paraffin blocks. clinical, pathological and etiological findings case thirteen -to -day-old piglets with body weights ranging from to . kg were submitted for pathological investigation. pigs with clinical diarrhea were dirty, wet, had stained perinea, and showed moderate dehydration characterized by sunken eyes and diffusely pale mucosa. their small intestinal walls were thin with unremarkable mesenteric lymphatic vessels, and were distended by gas or occasionally contained yellow watery digesta with a ph of - ( fig. a) . their stomachs were empty or contained floccules of undigested milk. no other macroscopic findings were observed. the histopathological evaluation showed a shortening of intestinal villi with a crypt-villous ratio of : ( fig. b) , that villi were fused and lined by vacuolated cuboidal or attenuated epithelium, and that the lamina propria was expanded by moderate edema. microscopic lesions were limited to the jejunum and ileum. immunohistochemistry and ish-rna against tgev showed strong staining in the epithelium of sections that presented minimal epithelial villous changes (fig. c, d) . conversely, sections with the most severe epithelial damages were ihc negative. all sections evaluated in this case were negative for pedv and rotavirus. a gross evaluation of five piglets between and days old showed marked dehydration, wet and stool-stained perinea, and poor body conditions ( . kg average body weight) (fig. a) . the small intestine contained abundant yellow-watery diarrhea with a ph of - in two pigs and alkaline ph in three pigs (fig. b) . a histopathology examination of multiple sections of jejunum and ileum showed mild to moderate villous shortening and fusion (fig. c) . the villous enterocytes showed a marked cytoplasmic vacuolization (fig. d) . the lamina propria was minimally infiltrated by lymphocytes and plasma cells, and was expanded by edema. the superficial villous enterocytes in the ileum showed strong hybridization signals characterized by active-replicating tgev (fig. e) . no microscopic lesions were seen in the sections of colon. all sections evaluated in this case were negative for pedv and rotavirus a. in the ultrathin sections, rounded particles measuring approximately nm in diameter were located in the cytoplasm of the intestinal epithelial cells. the particles were characterized by finely granular electrodense nucleoids with electron lucent centers compatible with complete particles of coronavirus (fig. f ) . three neonatal piglets that died naturally presented with fecal stained perinea and were markedly dehydrated. the stomachs were empty, the small intestinal wall was thin/translucent, and scant yellow watery contents were sometimes apparent. the histopathology examination of the jejunum and ileum showed moderate villous fusion and shortening, and the villi were lined by low-cuboidal to flattened/attenuated epithelium (fig. a) . the lamina propria was infiltrated by numerous lymphocytes and plasma cells, was expanded by edema, and exhibited lymphangiectasia (fig. b) . the tgev antigen was detected by ihc in multiple sections of the jejunum and ileum (fig. c) . no significant lesions were observed in the section of colon. all sections evaluated in this case were negative for pedv and rotavirus a. the epidemiological and clinical presentations of outbreaks of neonatal mortality associated with enteritis and the detection of tgev started in the gestation units. both gilts and sows showed anorexia, diarrhea, and vomiting before enteric signs were observed in neonatal piglets. however, the prevalence of clinical signs in the breeding stock was low and no mortality was reported. when tgev enters in a naïve herds, an epizootic form characterized by a % mortality of pre-weaning piglets due to diarrhea and dehydration is normally observed [ , ] . although in the present study, the farms had a high prevalence of diarrhea in suckling pigs, only farms a and c showed almost % neonatal mortality, while in farm b had approximately % neonatal mortality. the clinical presentation and epidemiological pattern observed in farm b resembled the tge endemic form. although no other etiological diagnosis was confirmed, the low mortality associated with tgev that was observed in farm b might be the result of previous exposure to prcv. prcv infection can confer cross-protection against tgev, reducing the enteric clinical signs and pre-weaning mortality [ ] . therefore, herds concomitantly infected with prcv and tgev develop less severe clinical signs, making the clinical differentiation from other enteric infections such as rotavirus or e. coli infections more challenging [ , ] . another potential reason for the low mortality rate due to tge infection that was observed in farm b could be the intermittent viral exposure of the breeding stock that provided partial immunity to the neonatal piglets [ ] . in all herds in this study, it was suspected that the virus entered the farms through the subclinically infected replacement animals although the pre-weaning mortality rate in farm b was lower than that in farm a and c, the pre-weaning mortality was higher in this farm than the mortality rate seen in similar production systems due to other enteric causes such us i suis [ , ] , c. perfringes type a [ ] , or c. difficile [ ] . according to a previous study, the pre-weaning mortality due to diarrhea should not exceed % [ ] . usually, in porcine covs infections, the course of the clinical disease is short and normally does not exceed - weeks [ ] due to the establishment of a rapid herd immunity, as early as one week post-infection. however, in farm b the clinical presentation persisted for approximately months. potential reinfection due to poor husbandry and incomplete aiao management are just few potential causes of viral persistence in the environment that can predispose reinfection of the farrowing units. in clinically affected litters, most of the pigs are dirty, wet, and dehydrated, with diminished body weights. diarrhea is watery, yellowish, and with an acidic smell from the presence of undigested milk [ ] . the mortality rate is inversely correlated with the age of the piglets, reaching % in - day-old piglets. this predisposition is due to the slow replacement rate of villus epithelial cells (around days) in neonatal piglets compared with the replacement rate of -week-old piglets (around - days) [ ] . in this study, mortality varied from to %. the jejunum and ileum are the target segments of the small intestine for virus multiplication. however, tgev infection is segmental, so multiple segments should be included for histopathology or etiological diagnoses in situ such as ihc or ish-rna. due to the retrospective nature of this study, fixed tissue was used to confirm the presence of tgev and the morphological changes consistent with viral infection in the intestinal mucosa. it is important to highlight that although tgev was detected by different means in each farm, due to the segmental nature of the lesions and viral distribution, viral arn or viral antigen was not detected in all of the intestinal segments that were evaluated. in piglets that are less than weeks old, the reduction of villus length and the fusion of jejunum and proximal ileum are the main histological changes [ ] . the normal villous/crypt length ratio is : , however, after - h post-infection, the villous/ crypt ratio can be reduced to : or : [ ] . since tgev replicates in mature absorptive epithelial cells [ ] , a false negative diagnosis can be observed by ihc or ish in specimens that display villous shortening. few absorptive vacuolated cells are seen normally in the intestine, however, during tgev infection, they are found in great numbers with a cuboidal shape [ ] . in endemic tgev infection, histopathological diagnosis is more difficult because only % of pigs display typical tge lesions. in addition, immunofluorescence tests and ihc often fail in endemic farms due to a low number of enterocytes in the tgev-infected because of partial protection conferred by colostral antibodies [ , ] . different diagnostic techniques have been used to detect tgev infection such as ihc, ish, electron microscopy, and immunoelectron microscopy and pcr [ ] ; however, histopathology remains the most useful tool for screening diagnosis [ ] . in this study, although all cases were selected using clinical features and epidemiological information, the histological evaluation consistently showed lesions compatible with viral infection. the application of ihc and ish-rna on archived paraffin blocks from cases of neonatal diarrhea with high morbidity and mortality allowed retrospective identification of tgev infection. diagnosis of tgev infection in endemic regions, such as in argentina, is complicated due to the epidemiological distribution and clinical signs that might be masked with other enteric infections. further studies are necessary to determine the true prevalence of this pathogen and the correlation with neonatal enteric cases observed in confined production systems. case selection was based on the clinical history reported by the farm managers and referring veterinarians. the selection criteria was a sudden increase in mortality that included, significant increment of more than sd from average pre-weaning mortality and last for a period of a week. in addition reported mortality should be associated with the presence of watery diarrhea in -to -day-old piglets that did not respond to antibiotics. first screening of cases was done by histopathological evaluation, and only cases presenting features of viral enteritis with no other detected pathogen were included. based on these criteria, three clinical cases were identified from to . a -sow farrow-to-finishing herd located in buenos aires served as the first case. the farm produced its own replacement breeding stock, however, two months before the outbreak, gilts were introduced from a breeding company. the parity of the breeding stock was distributed as % gilts while the rest of the reproductive stock parity varied from to . on september , approximately % of the pregnant sows presented acute vomiting while % of the pregnant sows presented acute diarrhea. during the period when the sows showed gastro-enteric clinical signs, -to -day-old piglets presented vomiting ( - %) and diarrhea ( %), and the mortality rate of suckling pigs reached %. the course of the disease in both breeder stock and piglets lasted for approximately three weeks. case involved a one-site herd of sows with its own replacement gilts and the following parity distribution: % gilts, % parity - , and . % distributed amongst parity - . boars were purchased from a breeding company and were incorporated into the reproductive herd without quarantine. the farm was located within a few miles of a swine slaughterhouse in buenos aires. in february , the pregnant sows showed anorexia ( - %) and diarrhea ( %) associated with heat returns and abortions ( . %). in the farrowing houses, approximately % of the lactating sows presented with anorexia. pre-weaning mortality associated with the presence of diarrhea varied from . % at the beginning of the outbreak to . % to weeks after the initial clinical signs. an anatomopathological evaluation showed that . % of the total pre-weaning mortality was due to diarrhea. a one-site herd of sows was the subject of case . in july , two boars were located close to the gestation unit. a week later, gestation sows showed anorexia ( . %) and diarrhea ( . %). thereafter, in the gilts, diarrhea was evident in the nursery ( - %) and fattener ( - %). two-day-old piglets showed watery diarrhea ( %) with a mortality rate of %. affected piglets died from severe dehydration within two days of the onset of clinical signs. the course of the disease lasted approximately two months with an overall pre-weaning mortality of % during that period. at the onset of the outbreak, clinically affected suckling pigs were submitted for postmortem examination. tissue samples from different organs, including multiple segments of small intestine (duodenum, jejunum, and ileum) and large intestine, were fixed in % buffered formalin, processed for routine histopathologic examination, and stained with hematoxylin and eosin. etiological diagnosis in tissues and feces by immunohistochemistry, in situ hybridization, and electron microscopy immunohistochemestry ihc was carried-out briefly to differentiate tgev [ ] from pedv [ ] . monoclonal antibodies against tgev (osu: #. e - c) and pedv (osu c ) at dilutions of : were used. antigen retrieval was performed with humid heat and revealed with peroxidase (novocastra a , leica biosystems, il, usa). to rule out other potential viral enteritis, rotavirus a was evaluated in all sections by ihc [ ] . rotavirus ihc was performed using a monoclonal antibody against rotavirus a (santa cruz: sc- ) at a : dilution. antigen retrieval was performed with epitope retrieval solution for min, as programmed on leica bond iii, and revealed with powervision poly-hrp anti-mouse (leica pv ). all samples were tested in duplicate and sections were controlled appropriately for tgev, pedv and rotavirus a with positive and negative controls (additional file : figure s ). in situ hybridization ish-rna was developed through the rnascope platform (advanced cell diagnostics, inc., ca), targeting the specific reverse complementary nucleotide sequence of the tge viral mrna ( - region of spike gene, genbank: kc . ). therefore, positive hybridization signals represent a metabolically-active virus characterized by the tge mrna encoding spike protein. unstained paraffin tissue sections were processed as previously described [ ] . briefly, tissues were deparaffinized and treated with hydrogen peroxide at room temperature for min. the slides were hybridized using a hybridization buffer, and sequence amplifiers were added. the red colorimetric staining detected the tge hybridization signal, and counterstaining occurred with hematoxylin. representative sections of small intestine were fixed in . % glutaraldehyde and % paraformaldehyde in . m, ph . phosphate buffer (pbs) and post-fixed in % osmium tetroxide in pbs. after dehydration in an alcohol series, the fragments were embedded in epoxy resin, quetol (nisshin em co., ltd., tokyo). ultrathin sections were cut, double-stained with uranyl acetate-lead citrate, and observed under a jem- ex (jeol co. ltd., tokyo). diseases of swine new variant of porcine epidemic diarrhea virus hemagglutinating encephalomyelitis coronavirus infection in pigs porcine respiratory coronavirus: molecular features and virus-host interactions a comparative sequence analysis to revise the current taxonomy of the family coronaviridae pathogenicity and pathogenesis of a united states porcine deltacoronavirus cell culture isolate in -day-old neonatal piglets retrospective testing and case series study of porcine delta coronavirus in u.s. swine herds porcine epidemic diarrhea: a review of current epidemiology and available vaccines emergence of porcine epidemic diarrhea virus in the united states: clinical signs, lesions, and viral genomic sequences porcine epidemic diarrhea virus infection: etiology, epidemiology, pathogenesis and immunoprophylaxis does circulating antibody play a role in the protection of piglets against porcine epidemic diarrhea virus? molecular characterization and pathogenesis of transmissible gastroenteritis coronavirus (tgev) and porcine respiratory coronavirus (prcv) field isolates co-circulating in a swine herd development of pcr-based techniques to identify porcine transmissible gastroenteritis coronavirus isolates porcine coronavirus. in: trends in emerging viral infections of swine a transmissible gastroenteritis in pigs coronavirus en porcinos: importancia y presentación del virus de la diarrea epidémica porcina (pedv) en colombia detección de focos de gastroenteritis transmisible en venezuela diagnosis to detect porcine transmissible gastroenteritis virus (tgev) by optical and transmission electron microscopy techniques infección por isospora suis sola o asociada a virus entéricos como causa de alta morbimortalidad en lechones lactantes identificación e índice de detección de partículas virales en materia fecal por microscopía electrónica análisis de los cuadros entéricos en cerdos remitidos al laboratorio de patología especial veterinaria transmissible gastroenteritis, argentina. in: oie, editor. servicio nacional de sanidad y calidad agroalimentaria (senasa), ministerio de agricultura, ganadería y pesca: world organization of animal health endemic transmissible gastroenteritis: difficulty in diagnosis and attempted confirmation using a transmission trial fibrinonecrotic enteritis of piglets in a commercial farm: a postmortem study of the prevalence and the role of lesion associated agents isospora suis and clostridium perfringens neonatal piglets mesocolon edema and colitis due to clostridium difficile infection: prevalence, clinical disease and pathological studies why should piglets dead at the pre-weaning period be postmortem examined and statistically analysed at weekly intervals? lesions of the gastrointestinal tract of pigs infected with transmissible gastroenteritis mechanisms of porcine diarrheal disease transmissible gastroenteritis in endemically infected breeding herds of pigs in east anglia immunohistochemistry of transmissible gastroenteritis virus antigens in fixed paraffin-embedded tissues monoclonal antibody-based immunohistochemical detection of porcine epidemic diarrhea virus antigen in formalin-fixed, paraffin-embedded intestinal tissues immunohistochemical detection of porcine rotavirus using immunogold silver staining (igss) rnascope: a novel in situ rna analysis platform for formalin-fixed, paraffin-embedded tissues additional file : figure s . panel of pathogens used as control for detection of tgev by immunohistochemistry. row one include immunostaining of tgev clinical cases against tgev, pedv, and rotavirus specific antibodies. a moderate to severe immunostaining is observe only reacting against tgev. in row two include positive controls for each pathogen detected by immunohistochemistry. row three present section tested negative by pcr for tgev, pedv, and rotavirus that were used as negative control of the immunohistochemistry techniques. ( the authors declare that all the data supporting the findings of this report is available in the article.authors' contributions pep, cjp, maq performed histological examination, data analysis and conclusion and were the major contributors in writing the manuscript; dmm, performed ihc; fv, performed ish; mil, rs, jac, emp, aa, lva field data collection and case identification. all authors read and approved the final manuscript.ethics approval and consent to participate not applicable. not applicable. the authors declare that they have no competing interests. springer nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. key: cord- -kcl xb authors: soares magalhães, ricardo j; ortiz-pelaez, angel; thi, kim lan lai; dinh, quoc hoang; otte, joachim; pfeiffer, dirk u title: associations between attributes of live poultry trade and hpai h n outbreaks: a descriptive and network analysis study in northern vietnam date: - - journal: bmc vet res doi: . / - - - sha: doc_id: cord_uid: kcl xb background: the structure of contact between individuals plays an important role in the incursion and spread of contagious diseases in both human and animal populations. in the case of avian influenza, the movement of live birds is a well known risk factor for the geographic dissemination of the virus among poultry flocks. live bird markets (lbm's) contribute to the epidemiology of avian influenza due to their demographic characteristics and the presence of hpai h n virus lineages. the relationship between poultry producers and live poultry traders (lpt's) that operate in lbm's has not been adequately documented in hpai h n -affected se asian countries. the aims of this study were to document and study the flow of live poultry in a poultry trade network in northern vietnam, and explore its potential role in the risk for hpai h n during to . results: our results indicate that lpt's trading for less than a year and operating at retail markets are more likely to source poultry from flocks located in communes with a past history of hpai h n outbreaks during to than lpt's trading longer than a year and operating at wholesale markets. the results of the network analysis indicate that lpt's tend to link communes of similar infection status. conclusions: our study provides evidence which can be used for informing policies aimed at encouraging more biosecure practices of lpt's operating at authorised lbm's. the results suggest that lpt's play a role in hpai h n transmission and may contribute to perpetuating hpai h n virus circulation amongst certain groups of communes. the impact of current disease prevention and control interventions could be enhanced by disseminating information about outbreak risk and the implementation of a formal data recording scheme at lbm's for all incoming and outgoing lpt's. the recurrence of poultry outbreaks of highly pathogenic avian influenza of the h n subtype (hpai h n ) in some parts of the world, and the occasional spillover of infection to humans, is a significant global health concern. poultry rearing is an important enterprise in countries across the greater mekong region. in vietnam, poultry rearing is closely linked with people's livelihoods and traditional culture [ , ] . five epidemic waves of hpai h n occurred in vietnam between late and mid- , causing the second highest human case incidence and case-fatality rates in the world. the proximity of poultry flocks to water courses and paddy fields, and keeping of other poultry species all have an important role in sustaining and perpetuating infection [ ] [ ] [ ] [ ] [ ] . poultry outbreaks are primarily reported in the red and mekong river deltas, and the majority of outbreaks are recorded in the predominant small-holder chicken and duck flocks. agro-ecological factors related to poultry husbandry, trade and socialcultural customs are suggested to be associated with the maintenance of the hpai h n infection cycle in vietnam [ , [ ] [ ] [ ] . the daily outbreak incidence during the first two epidemic waves ( - and - ) peaked around the annual "tet" holiday festivities in february, when poultry movement is increased [ , ] . however, the temporal distribution of h n outbreaks has changed since the introduction of vaccination in , and since mid- reported outbreaks have not shown a regular pattern [ ] . in both human and animal populations, the structure of contact between individuals contributes to the incursion and spread of contagious diseases [ ] [ ] [ ] . in the case of avian influenza, the movement of live birds is a risk factor for the dissemination of the virus to poultry flocks [ ] . in particular, live bird markets have long been considered to be an important link in the pathways that lead to the emergence and reintroduction of infection. these markets facilitate the congregation of large populations of animals-that have originated from a diversity of sources in a fairly large geographical areain relatively small spaces [ ] [ ] [ ] . this becomes particularly noteworthy as avian influenza surveillance studies in the united states and in southeast (se) asia have provided evidence of presence of virus lineages in live bird markets [ ] [ ] [ ] [ ] [ ] [ ] . similarly, a virological survey in ten live bird markets in ha noi has shown that the hpai h n virus was already circulating in healthy geese as early as [ ] . also, evidence suggests that live bird markets can be suitable environments for potential virus re-assortment and transmission [ , ] . the viruses found in in ha noi's live bird markets have been reported to be genetically related to virus isolated in hong kong in , but are genetically distinct from those isolated in northern vietnam in early [ , , ] . this supports the hypothesis that separate virus introductions via trade of live poultry might be responsible for different outbreak periods. this is further supported by a recent molecular study of hpai h n viruses that suggested that outbreaks in the north of vietnam are likely to be attributable to multiple introductions of virus primarily through transboundary trade with southern china [ ] . factors such as ( ) culturally-driven seasonal patterns of poultry demand and ( ) the close inter-linkage of poultry production with other seasonal agricultural activities ( ) and disease control interventions are expected to influence the production levels of different species and therefore their marketing patterns [ , ] . in relation to disease control, policies applied during the outbreak waves included movement restrictions, restrictions to breeding of certain poultry, and market bans that were fundamentally similar to the ones applied in hong kong lbm's after [ , ] . the intended effect of restrictions to live poultry trade was to reduce the exposure of humans at markets, market contamination and opportunities for virus recombination [ , , ] . to date, the relationship between small-holder poultry production and trade, and in particular, between smallscale poultry holders, poultry traders and live bird markets has been insufficiently studied and documented in hpai h n -affected se asian countries. this information is difficult to obtain but is essential for understanding outbreak recurrence associated with poultry trade. the available information for vietnam does not provide substantive evidence on the association between production and trade in smallholder poultry and its role on outbreak occurrence. the objective of the present study is to better understand the flow of live poultry, as investigated in a poultry trade network of northern vietnam, and explore its potential role in the risk for hpai h n introduction and spread and the resulting implications for disease control policies. the characteristics of lpt's are presented in table . the lpt's that sell and buy poultry on the same day often leave the lbm and distribute poultry to several destinations other than slaughter; this trade type is performed by individuals more experienced in poultry trade. the number of communes visited by lpt's was not large (maximum: ) nor was the number of contact flocks in them (maximum: ). the communes included in the current study have significantly larger numbers of flocks and smaller commune areas when compared to other areas in the country (p < . ). the distances from commune to lbm were generally quite short (median = km, range: - km), except for ha vi and bac tan long markets. our results also suggest that more experienced lpt's tend to trade in retail markets (χ for trend = . ; p = . ) and that lpt's operating at wholesale markets tend to contact larger flocks (χ for trend = . , p < . ) and trade more poultry than those operating at retail markets (χ for trend = . ; p < . ). the frequencies of the number of poultry traded do not differ by species of poultry (χ for trend = . ; p = . ) but the chicken flocks contacted by lpt's tend to have large numbers of poultry than duck and muscovy duck flocks (χ for trend . ; p < . ). tables and respectively. none of the tested biologically plausible first-order interactions resulted in improvement of model fit. the goodness-of-fit test showed a suboptimal fitness of the model (p = . ). the potential impact of clustering of data due to multiple measurements from each lpt resulted in an intra-cluster correlation coefficient of . (p < . ). networks of poultry trade and occurrence of hpai outbreaks trader-commune network (network ) the geographical distribution of the communes included in the analysis of associations with commune infection status is shown in figure . the network is very fragmented with components, but there is a highly connected core of communes, consisting of a giant weak component and a sparse periphery (containing numerous table attributes of "sell only" and "buy and sell" live poultry traders operating in all (total of ) authorised live bird markets serving the northern provinces of vietnam. this network is as equally fragmented as network , consisting of components; the locations of the communes in the two main components are shown in figure . the symmetric binary -mode commune network includes nodes, has . % density and links. the average degree is . (std: . , range: - ) so that an average commune is connected to more than three other communes via common lpt's. the giant weak component includes nodes ( . %), and a second component has nodes ( %). the remaining components have or less nodes with components of five or less nodes. network contains cliques: -cliques, -cliques, -cliques, -clique and -clique. the clique overlap network (network ) contains the same number of communes, , with a density of . % and links. the average number of communes that share a clique with any other is . (mean degree: . std: . range: - ). applying significance tests to the subset of communes with attribute data, there was no significant difference in the mean degree of the nodes of network and between the ones infected during at least one of the epidemic waves or in any single one ( table ). the test of autocorrelation for network and showed that the proportion of links between infected and non-infected communes (type ) is significantly lower than expected for the variable "infected - " (p = . and p = . , respectively). the number of type and links was not significantly different for the same variable (data not shown). being a member of the giant component in network is significantly associated with not having been infected in any wave (χ test: . , df, p < . ). the geographical location of the catchment areas of each lbm is presented in figure . there are five communes linked to more than one lbm: two linked to ha vi and bac thang long, one linked to ha vi and cho ni and two linked to bac than long and yen thuong and cho to, respectively. these five communes experi- in terms of trade volume, the two distinctive types of lbm, wholesale and retail, in network determine the network structure with one component linking the two wholesale lbm's and two retail lbm's as well as four to the best of our knowledge, this study represents the first investigation of the association between poultry trade and hpai outbreaks in northern vietnam. the results of this study highlight the advantage of combining a descriptive study with a network analysis of the characteristics of the poultry trade pattern of lpt's, and demonstrate that this methodology can improve our understanding of the epidemiology of hpai h n in affected countries. although trade is usually difficult to quantify, the network analysis provided insight into the relational nature of the live poultry trade and its potential relationship with the spread and maintenance of ai in northern vietnam. this study supports previous research findings indicating that lbm's may constitute an important source of infection for poultry [ , ] . in particular, our analyses indicate that new lpt's (i.e. those trading for less than a year) and those operating in authorised retail lbm's have increased odds of sourcing poultry from flocks located in communes with past history of h n outbreaks during to , when compared to older lpt's (i.e. those trading for more than a year) and to those operating in wholesale markets. this suggests that individuals who are relatively new to the poultry trading business are more likely to operate in areas with previous infection history, perhaps due to their inexperience. it is also possible that experienced traders consciously avoid high disease risk areas, thereby providing new traders with an opportunity to set up their business in these areas. although this finding does not allow inferences in relation to the source of the outbreaks amongst infected communes, it provides evidence for advocating modifiable practices directed towards new traders at retail markets. these could include the dissemination of historical and upto-date information on the geographical distribution of outbreaks and the development of more biosecure poultry trading practices such as crate cleaning and disinfection. further, while it is a legal requirement that traders visiting an lbm for the purpose of selling poultry report to the market inspectors (mi) at the lbm's veterinary check point, those that leave the lbm with poultry are currently not required to report. as identified in our study, poultry are in some occasions introduced back to other flocks which present a risk for further virus transmission. we recommend that at the market-level, this type of poultry trade should be discouraged, or at least monitored by mis. the implementation of a poultry traceability scheme would provide a mechanism for the links between specific communes in northern vietnam were described using social network analysis. the lpt-commune network and the commune-commune networks showed low density of links and a typical core-periphery structure. while the presence of low density of links is beneficial from a disease control point of view, the presence of a highly connected core may pose considerable challenges for the geographical containment of disease when infected birds flow through these trade channels. furthermore, we found that increasing numbers of lpt's operating in communes does not increase the risk of ai outbreaks during the period - nor does being linked to many other communes via the same lpt's. although centrality measures at node level (such as the degree and membership of the giant component) have been suggested to be of practical use in the development of effective targeted disease control strategies [ , ] , the investigation of the links within and between subgroups of nodes has provided better insight into the relationship between the disease status and network structure. the randomly permuted networks indicate that the observed number of links between communes of similar disease status is higher than the random distribution of links between communes, whereas the observed number of links between infected and non-infected communes is lower than expected. these results suggest that there is a separation in terms of the lpt's trading between infected and non-infected communes. since in our network analysis the links between communes are defined by trading events of lpt's, these results indicate that the observed outbreak pattern in - appeared to be associated to subgroups of lpt's, with communes linked by them having the same disease status. this finding was also supported by the analysis of the cliqueoverlap membership matrix. the lbm-commune network showed that only a few communes (n = ) traded poultry in both retail and wholesale markets. nevertheless, all of these communes experienced ai outbreaks during to , in contrast to . % infection level amongst the other communes (n = ). in addition, the travel distances from communes linked to retail markets are quite short compared to those linked to wholesale markets. this is consistent with the local emphasis of trade, where most of the lpt's in retail markets transport poultry in motorcycles fitted with baskets. evidence from other livestock diseases suggests that fast long-range dissemination of infectious diseases can occur through live animal trade at large livestock markets [ ] . our descriptive analysis has shown that lpt's operating in wholesale markets tend to contact larger flocks and trade more poultry than those operating in retail markets. lpt's in wholesale markets generally travel by motorcycles with fitted crates, vans or lorries that enable larger distances and transport more animals than those operating in retail markets. consequently, large wholesale markets can source and disseminate large quantities of poultry throughout a large area of northern vietnam on the same day, further complicating disease control operations if infection were to flow through these channels. the dispersion of infection over a relatively large geographical space could be assisted by the trade with flocks in the few communes in the giant weak component that are geographically distant from its core. our results should be interpreted taking account the study's assumptions and limitations. firstly, potential biases may have been introduced during the selection of lbm's and the lpt's. for example, by the time we carried out our surveys, only lbm's in the five outer districts of the capital city were allowed to trade poultry. nevertheless, market selection was based on a history of recurrent hpai h n outbreaks, and on regional importance with respect to the magnitude of poultry production and trade within the red river delta. in relation to the lpt's, the "buy only" was underrepresented because individuals leaving the lbm with live poultry do not have to report at the market veterinary check point. secondly, while we conducted our survey during a period when poultry trade and therefore potential outbreak risk were both expected to be at their peak, the trade pattern may vary across seasons and years. also, hpai h n disease control measures may change the trade pattern of live birds in and around the affected areas [ , ] . however, it is very difficult to deal with the uncertainty of the contact structure and its stability over time and through ai outbreaks. even if the observed contact structure was different than prior to the ai outbreaks, it would be very difficult to ascertain whether this change was due to the impact of the disease, the control measure or pure changes in the trading behaviour caused by other reasons unaccounted for in this study (e.g. market value, changes in production). only by simulating stochastically alternative network structures the impact of a wider range of outputs on the disease status could have been analyzed. however, there is not a network model that could represent a "standard" contact structure of live poultry trade in this area to which to compare the observed one. thus, the poultry trade networks presented by this study are representative of the time period of peak poultry trade in north vietnam and of the year when the study was conducted. thirdly, our analyses are based on the assumption that the ai risk profile of a given lpt-flock link is associated with the historical infection status of the commune where the flock was located. this relationship is convenient because it enables the use of publicly available disease surveillance data aggregated at commune level. however, assuming that all flocks are a single population at risk could introduce systematic error to the interpretation of results. factors such as commune area size and number of flocks in the communes may have an impact on the validity of this assumption by influencing the geographic dissemination of the virus within a commune. currently in vietnam, disease control policies based on flock depopulation consider village level depopulation as the main control measure for containing local virus dissemination, and thereby make the assumption that flocks in a village are a single population at risk. this decision represents a compromise between the logistic constraints of disease control and the known heterogeneity of poultry flocks among the approximately , communes of vietnam. moreover, analysis of population and area data of the communes included in this study, together with the known infectious properties of ai viruses, suggests that poultry flocks within communes may indeed be homogenous with respect to hpaiv h n risk. finally, the validity of a social network analysis based on our ego-centric data collection methods may have been influenced by sampling errors and lack of representativeness [ ] . the statistical analysis could not include all nodes of the networks due to the lack of response of some lpt's and inability to correctly identify some communes named by them. the estimation of the standard errors and significance levels were affected by the fact that there were very few infected communes during the later ai epidemic wave ( - ). taking these limitations into account, the results of this study indicate that the association of some lpt's to specific communes within the catchment area of authorised lbm's may support transmission of ai infection. this is particularly important where inadequate protection conferred by vaccination allows residual infection to remain in communes linked by lpt's of the trade network. these findings may support the need to promote policies encouraging more biosecure practices of lpt's operating through authorised lbm's. these could include a) the dissemination of information with respect to the geographic locations of high outbreak risk communes and b) the implementation of a formal data recording scheme for all incoming and outgoing lpt's. the former could be implemented by providing maps describing areas with previous history of outbreaks, and making them available, for example, at market veterinary checkpoints. data recording systems should include regular data capture by the mis concerning contextual characteristics of contact flocks (i.e. geographical location and type) and demographic characteristics of the trade (i.e. number of poultry traded and type). these interventions should be combined with enhanced flocklevel biosecurity and disease monitoring and evaluation strategies to mitigate the risks associated with the modification of the lpts' trade patterns. these interventions would have important implications for disease control efforts. at the local level, making disease outbreak information available to lpt's (particularly new traders and those at retail markets) would enhance their decisionmaking capacity when selecting geographical areas for trade. in addition, providing mis with a data collection tool would formalise market access and contribute to their empowerment. these benefits would extend to the national-level by promoting enhanced knowledge of disease control operational managers regarding the live poultry trade structure in authorized lbm's. our study provides evidence which is potentially important for informing policies intended to encourage more biosecure practices of lpt operating at authorised lbm's. our study, which combined descriptive and network analyses, showed that: • less experienced traders (i.e. operating for less than a year) and those trading in retail markets are more likely to trade with areas with a history of hpai h n infection. • some lpt's introduce poultry to other flocks as part of their normal trade practice. • larger quantities of poultry are transported from a wider geographical area to wholesale markets when compared to retail markets. • the association of some lpt's with a limited set of communes within the catchment area of authorised lbm's may support hpai h n transmission and may contribute to perpetuating hpai h n virus circulation among certain groups of communes. given the above, current disease prevention and control interventions would benefit from dissemination of information about outbreak risk and the implementation of a formal data recording scheme at lbm's for all incoming and outgoing lpt's. in march , a total of live bird markets (lbm) were formally operating in greater ha noi: ten retail markets (cho ni, cho phu lo, cho to, da ton, sui, yen thuong, dong ngac, ngoc hoi, ngu hiep and tan trieu) and two wholesale markets (ha vi and bac thang long) that were located in the five outer districts of the capital city. a cross-sectional survey was carried out in all markets between december and march , which corresponds to peak poultry movement in vietnam, due to high poultry demand around the traditional annual "tet" festival holiday period. based on informal interviews of market authorities conducted by the researchers and by officials of the department of animal health of the ministry of agriculture and rural development, it was ascertained that a total of approximately , poultry are traded daily in these markets. this is estimated to represent approximately % of the total number of poultry traded during a day in the northern provinces of vietnam. the market inspectors (mi) of the participating markets collected the data as they occupy a position of authority and accessibility to the lbm's and are the institutional link with the best knowledge of the local conditions of the lbm's. in vietnam, official lbm's have at least one veterinary health worker who performs the activities of a mi. the mis are employed by the district department of animal health and posted at market veterinary checkpoints where they conduct and document animal health checks of poultry brought by incoming individuals. these individuals, by law, have to report to the market veterinary checkpoint prior to being allowed entry to the market. an interview was conducted by the mis who had been previously trained in interview skills to enable a standardized data collection process. the interview was administered using a pre-tested structured questionnaire. the survey was conducted in each market for two days (i.e. a day prior to and on the day when poultry trade was considered more intense) in order to capture a representative sample of lpt's operating in each lbm. based on a previous assessment of the trading pattern at each lbm it was noticed that despite lbm's usually operating daily, there is typically one day of the week when poultry trade is more intense [ ] . during that day it is expected that most lpt's would be present. in that study it was also noticed that, with few exceptions, the same traders were operating in each market on a given day. data collection has followed an ego-centric approach whereby all trading activities of selected lpt's were collected. the survey elicited information from a total of incoming and outgoing lpt's concerning ( ) [ ] . based on previous knowledge of poultry husbandry practices at commune level and the available data from northern vietnam on commune size and number of flocks per commune, the commune was considered an epidemiological compartment for disease status purposes [ ] . for the statistical analysis of associations of lpt trade attributes with commune infection status during to , and for the analysis of the poultry trade network we used the information generated from the "buy and sell" and "buy only" lpt's. this corresponded to a total of lpt's (out of initially interviewed) who had visited a total of communes. of the communes reported by lpt's it was possible to link the commune names to location data for ( %) lpt's. these lpt's considered in the analyses were operating in eight lbm's (bac thang long, cho ni, cho phu lo, cho to, da ton, ha vi, sui, and yen thuong). the remaining four markets (dong ngac, ngoc hoi, ngu hiep and tan trieu) were visited by the lpt's for which the location information was incomplete. from a total of communes initially available we were able to ascertain ai outbreak status for the three waves for ( . %) communes. associations between attributes of the lpt's were tested using the chi-squared test for trend when at least one of the attributes had more than two ordered categories. in addition, the association between attributes of the lpt's and the h n infection status of communes where flocks were located was tested by fitting a random effect logistic regression model. the h n infection status of the commune in the period to ("no outbreak" vs. "infection at least once") was considered as the outcome variable. the explanatory variables included "market type" ("wholesale" vs. "retail" markets), "time trading poultry", "direction of poultry trade" ("buy and sell" vs. "sell only"), "type of poultry traded", "usual number of poultry traded", "flock size of contact flocks", "frequency of poultry trade" and "usually sells all poultry at market". the effect of clustering due to multiple measurements at lpt's was assessed by including this variable as a random effect in the model. the statistical analysis was carried out in two phases using the lpt id as the unit of analysis. firstly, all lpt trade behaviour attributes were screened statistically using univariable logistic regression with commune infection status based on a p-value of . , using the likelihood-ratio test. all continuous-scale variables were re-categorized into their quartiles. secondly, all factors significant in the screening phase were considered for inclusion through a manual backward stepwise variable selection process using a multivariable logistic regression model. the criterion for removal of risk factors was based on the likelihood ratio statistic with a significance level of p > . . the screening for the presence of confounding variables in the final model was performed by stepwise removal of variables which at some stage were not significant at p-value level of . , and noting the impact on the coefficients of the remaining variables in the model. if one of the coefficients of the other variables had changed by more than % the eliminated variable was assumed to be a confounder and forced into the model [ ] . biologically meaningful first-order interaction terms were also tested for statistical significance. model assumptions and goodness of fit were assessed following the methods described in hosmer and lemeshow ( ) [ ] . all statistical analyses were performed using stata . (stata® corporation ). social network analysis was used to describe the connectivity pattern within the dataset consisting of records of paired trading events. each pair represented the link between a particular lpt or lbm and the commune in which the source flock of the purchased poultry was located. two symmetric -mode networks, valued and binary (network ), were built linking lpt's and communes so that two communes are linked via a lpt if they reported to have sourced from flocks in both communes during the study period. in this network nodes are divided into classes, lpt and communes, and in the case of the valued network includes the number of flocks in a commune the lpt traded with. the -mode trader-commune network was converted to a -mode binary symmetric network of communes linked via a common trader (network ). basic descriptive measures of network and were extracted: size, number of links, density and average non-normalized degree per class. the non-normalized degree measures the absolute number of unique links of a given node to the other node class. the components of the network were extracted and a binary variable was created identifying the communes included in the giant weak component (yes/no). a component is a maximal connected subgraph where all nodes (i.e. communes) are connected through paths [ ] . cliques of minimum size were extracted and a symmetrised binary clique-overlap network (network ) was built where two communes are linked if they share at least one clique. a clique is a maximal complete sub-graph where each node is connected to all other nodes and the clique is not contained in any other clique [ ] . this provided information about which nodes are more closely linked to one another than to other nodes of the network in tightly knit groups within the network [ , ] . finally, two mode symmetric networks, valued and binary (network ), were built linking communes and markets by replacing the mode 'trader' in network by the market where each lpt was identified and interviewed. communes with degree greater than one were identified as a proxy for the identification of communes which are within the catchment area of more than one market. to test the association of some network parameters and variables of commune infection status in three consecutive epidemic waves ("infection in - ", "infection in - " and "infection in - " and "infection in any of the three waves"), several statistical tests adapted to network data were applied. the means of the degree distribution between infected and non-infected communes in the three outbreak waves were compared using the t-test with a permutation-based significance test involving , random permutations. the association between the density of the links in network and and disease status of the commune was tested by applying a randomization test of autocorrelation for a symmetric adjacency matrix using two classes and , random permutations. the test of autocorrelation for network and compared the observed number of links between two groups of nodes and the expected number obtained through random permutations of the network. the use of randomization tests of autocorrelation within symmetric adjacency matrices allows statistical significance testing of associations between dyadic binary variables such as represented by the links within the network and the disease status attributes of the commune nodes. the three types of links based on the different variables of disease status are: type -between infected communes, type -between infected and non-infected communes, and type between non-infected communes. the association between disease status and membership in the giant component and the degree of commune in the network were tested using the pearson's chi-square test and the fisher exact test (using the latter when the number of observations in any cell was less than ). all social network analyses were performed using ucinet . ( © analytic technologies, inc. ). maps of the study area and the location of the communes included in the networks were produced using arc-view . ( © esri). missions for data collection and analysis under the research grant with project code vcj . special thanks go to dr. jeff gilbert and davide ferrardi of the fao -vietnam office. hanoi: general statistics office -vietnam the country life in the red river delta. hanoi: vietnam national university -centre for vietnamese and intercultural studies free-grazing ducks and highly pathogenic avian influenza, thailand. emerging infectious diseases the ecology of highly pathogenic avian influenza in east and southeast asia: outbreak distribution, risk factors and policy implications mapping h n highly pathogenic avian influenza risk in southeast asia an analysis of the spatial and temporal patterns of highly pathogenic avian influenza occurrence in vietnam using national surveillance data risk factors and characteristics of h n highly pathogenic avian influenza (hpai) post-vaccination outbreaks origin and evolution of highly pathogenic h n avian influenza in asia. the veterinary record the - h n avian influenza outbreak in vietnam. the threat of pandemic influenza: are we ready? update of highly pathogenic avian influenza in animals (type h and h ) network theory and sars: predicting outbreak diversity the network of sheep movements within great britain: network properties and their implications for infectious disease spread use of social network analysis to characterize the pattern of animal movements in the initial phases of the foot and mouth disease (fmd) epidemic in the uk. preventive veterinary medicine risk for infection with highly pathogenic influenza a virus (h n ) in chickens avian influenza in north and south america molecular and biological characteristics of h and h avian influenza viruses in live-bird markets of the northeastern united states wet markets-a continuing source of severe acute respiratory syndrome and influenza isolation and characterization of avian influenza viruses, including highly pathogenic h n , from poultry in live bird markets in hanoi avian influenza viruses in korean live poultry markets and their pathogenic potential food markets with live birds as source of avian influenza. emerging infectious diseases epidemiologic and surveillance studies on avian influenza in live-bird markets in new york and new jersey avian influenza virus subtypes inside and outside the live bird markets, - : a spatial and temporal relationship the influenza virus gene pool in a poultry market in south central china the impact of a monthly rest day on avian influenza virus isolation rates in retail live poultry markets in hong kong pathogenicity of h n influenza a viruses isolated in vietnam between late and . the journal of veterinary medical science/the molecular characterization of the hemagglutinin and neuraminidase genes of h n influenza a viruses isolated from poultry in vietnam from to . the journal of veterinary medical science/the identification of the progenitors of indonesian and vietnamese avian influenza a (h n ) viruses from southern china avian influenza in hong kong description of live poultry markets in the united states and factors associated with repeated presence of h /h low-pathogenicity avian influenza virus. avian diseases effect of interventions on influenza a (h n ) isolation in hong kong's live poultry markets exploring the role of auction markets in cattle movements within great britain. preventive veterinary medicine prepared for the food and agriculture organization of the united nations and the world health organization, agrifood consulting international the reliability of network density and composition measures farm gate trade patterns and trade at live poultry markets supplying ha noi: results of a rapid rural appraisal applied logistic regression social network analysis: a handbook social network analysis: methods and applications introduction to social networks submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution we are very grateful for the valuable contribution of all live poultry traders who participated in the study and all market inspectors who conducted the interviews. we are also grateful for the valuable contribution of all senior officials and epidemiologists of the department of animal health of the ministry of agriculture and rural development of vietnam. special thanks go to dr. van nam and dr. dung do for their hard work and dedication to hpai h n control in vietnam. we would like to thank the valuable contribution of kate van dooren for editing and proofreading the final manuscript. we would like to also acknowledge the funding received by the food agriculture organization of the united nations to carry out field authors' contributions rjsm designed the study, conducted the analysis and drafted the manuscript. ao-p conducted the analysis and drafted the manuscript. dup conceived the study, supervised the study and critically revised the manuscript. jo conceived the study and critically revised the manuscript. kllt and qhd conducted the field work and performed data collection. all authors read and approved the final manuscript.