id	sid	tid	token	lemma	pos
cord-308110-cco3aq4n	1	1	key	key	NN
cord-308110-cco3aq4n	1	2	:	:	:
cord-308110-cco3aq4n	1	3	cord-308110-cco3aq4n	cord-308110-cco3aq4n	NNP
cord-308110-cco3aq4n	2	1	authors	author	NNS
cord-308110-cco3aq4n	2	2	:	:	:
cord-308110-cco3aq4n	2	3	Okamoto	Okamoto	NNP
cord-308110-cco3aq4n	2	4	,	,	,
cord-308110-cco3aq4n	2	5	Mika	Mika	NNP
cord-308110-cco3aq4n	2	6	;	;	:
cord-308110-cco3aq4n	2	7	Toyama	Toyama	NNP
cord-308110-cco3aq4n	2	8	,	,	,
cord-308110-cco3aq4n	2	9	Masaaki	Masaaki	NNP
cord-308110-cco3aq4n	2	10	;	;	:
cord-308110-cco3aq4n	2	11	Baba	Baba	NNP
cord-308110-cco3aq4n	2	12	,	,	,
cord-308110-cco3aq4n	3	1	Masanori	Masanori	NNP
cord-308110-cco3aq4n	3	2	title	title	NN
cord-308110-cco3aq4n	3	3	:	:	:
cord-308110-cco3aq4n	4	1	The	the	DT
cord-308110-cco3aq4n	4	2	chemokine	chemokine	NN
cord-308110-cco3aq4n	4	3	receptor	receptor	NN
cord-308110-cco3aq4n	4	4	antagonist	antagonist	NN
cord-308110-cco3aq4n	4	5	cenicriviroc	cenicriviroc	NNP
cord-308110-cco3aq4n	4	6	inhibits	inhibit	VBZ
cord-308110-cco3aq4n	4	7	the	the	DT
cord-308110-cco3aq4n	4	8	replication	replication	NN
cord-308110-cco3aq4n	4	9	of	of	IN
cord-308110-cco3aq4n	4	10	SARS	SARS	NNP
cord-308110-cco3aq4n	4	11	-	-	HYPH
cord-308110-cco3aq4n	4	12	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	4	13	in	in	IN
cord-308110-cco3aq4n	4	14	vitro	vitro	FW
cord-308110-cco3aq4n	4	15	date	date	NN
cord-308110-cco3aq4n	4	16	:	:	:
cord-308110-cco3aq4n	4	17	2020	2020	CD
cord-308110-cco3aq4n	4	18	-	-	HYPH
cord-308110-cco3aq4n	4	19	07	07	CD
cord-308110-cco3aq4n	4	20	-	-	SYM
cord-308110-cco3aq4n	4	21	30	30	CD
cord-308110-cco3aq4n	4	22	journal	journal	NN
cord-308110-cco3aq4n	4	23	:	:	:
cord-308110-cco3aq4n	5	1	Antiviral	antiviral	JJ
cord-308110-cco3aq4n	5	2	Res	res	NN
cord-308110-cco3aq4n	5	3	DOI	doi	NN
cord-308110-cco3aq4n	5	4	:	:	:
cord-308110-cco3aq4n	6	1	10.1016	10.1016	CD
cord-308110-cco3aq4n	6	2	/	/	SYM
cord-308110-cco3aq4n	6	3	j.antiviral.2020.104902	j.antiviral.2020.104902	NN
cord-308110-cco3aq4n	6	4	sha	sha	NNP
cord-308110-cco3aq4n	6	5	:	:	:
cord-308110-cco3aq4n	6	6	5ad42051521231441f2fcb0fb078d18dcc80cee6	5ad42051521231441f2fcb0fb078d18dcc80cee6	CD
cord-308110-cco3aq4n	6	7	doc_id	doc_id	CD
cord-308110-cco3aq4n	6	8	:	:	:
cord-308110-cco3aq4n	6	9	308110	308110	CD
cord-308110-cco3aq4n	6	10	cord_uid	cord_uid	NNS
cord-308110-cco3aq4n	6	11	:	:	:
cord-308110-cco3aq4n	6	12	cco3aq4n	cco3aq4n	NFP
cord-308110-cco3aq4n	6	13	Cenicriviroc	Cenicriviroc	NNP
cord-308110-cco3aq4n	6	14	(	(	-LRB-
cord-308110-cco3aq4n	6	15	CVC	CVC	NNP
cord-308110-cco3aq4n	6	16	)	)	-RRB-
cord-308110-cco3aq4n	6	17	is	be	VBZ
cord-308110-cco3aq4n	6	18	a	a	DT
cord-308110-cco3aq4n	6	19	small	small	JJ
cord-308110-cco3aq4n	6	20	-	-	HYPH
cord-308110-cco3aq4n	6	21	molecule	molecule	NN
cord-308110-cco3aq4n	6	22	chemokine	chemokine	NN
cord-308110-cco3aq4n	6	23	receptor	receptor	NN
cord-308110-cco3aq4n	6	24	antagonist	antagonist	NN
cord-308110-cco3aq4n	6	25	with	with	IN
cord-308110-cco3aq4n	6	26	highly	highly	RB
cord-308110-cco3aq4n	6	27	potent	potent	JJ
cord-308110-cco3aq4n	6	28	and	and	CC
cord-308110-cco3aq4n	6	29	selective	selective	JJ
cord-308110-cco3aq4n	6	30	anti	anti	JJ
cord-308110-cco3aq4n	6	31	-	-	JJ
cord-308110-cco3aq4n	6	32	human	human	JJ
cord-308110-cco3aq4n	6	33	immunodeficiency	immunodeficiency	NN
cord-308110-cco3aq4n	6	34	virus	virus	NN
cord-308110-cco3aq4n	6	35	type	type	NN
cord-308110-cco3aq4n	6	36	1	1	CD
cord-308110-cco3aq4n	6	37	(	(	-LRB-
cord-308110-cco3aq4n	6	38	HIV-1	HIV-1	NNP
cord-308110-cco3aq4n	6	39	)	)	-RRB-
cord-308110-cco3aq4n	6	40	activity	activity	NN
cord-308110-cco3aq4n	6	41	through	through	IN
cord-308110-cco3aq4n	6	42	antagonizing	antagonize	VBG
cord-308110-cco3aq4n	6	43	C	C	NNP
cord-308110-cco3aq4n	6	44	-	-	HYPH
cord-308110-cco3aq4n	6	45	C	C	NNP
cord-308110-cco3aq4n	6	46	chemokine	chemokine	NN
cord-308110-cco3aq4n	6	47	receptor	receptor	NN
cord-308110-cco3aq4n	6	48	type	type	NN
cord-308110-cco3aq4n	6	49	5	5	CD
cord-308110-cco3aq4n	6	50	(	(	-LRB-
cord-308110-cco3aq4n	6	51	CCR5	CCR5	NNP
cord-308110-cco3aq4n	6	52	)	)	-RRB-
cord-308110-cco3aq4n	6	53	as	as	IN
cord-308110-cco3aq4n	6	54	a	a	DT
cord-308110-cco3aq4n	6	55	coreceptor	coreceptor	NN
cord-308110-cco3aq4n	6	56	of	of	IN
cord-308110-cco3aq4n	6	57	HIV-1	HIV-1	NNP
cord-308110-cco3aq4n	6	58	.	.	.
cord-308110-cco3aq4n	7	1	CVC	CVC	NNP
cord-308110-cco3aq4n	7	2	also	also	RB
cord-308110-cco3aq4n	7	3	strongly	strongly	RB
cord-308110-cco3aq4n	7	4	antagonizes	antagonize	VBZ
cord-308110-cco3aq4n	7	5	C	C	NNP
cord-308110-cco3aq4n	7	6	-	-	HYPH
cord-308110-cco3aq4n	7	7	C	C	NNP
cord-308110-cco3aq4n	7	8	chemokine	chemokine	NN
cord-308110-cco3aq4n	7	9	receptor	receptor	NN
cord-308110-cco3aq4n	7	10	type	type	NN
cord-308110-cco3aq4n	7	11	2b	2b	CD
cord-308110-cco3aq4n	7	12	(	(	-LRB-
cord-308110-cco3aq4n	7	13	CCR2b	CCR2b	NNP
cord-308110-cco3aq4n	7	14	)	)	-RRB-
cord-308110-cco3aq4n	7	15	,	,	,
cord-308110-cco3aq4n	7	16	thereby	thereby	RB
cord-308110-cco3aq4n	7	17	it	-PRON-	PRP
cord-308110-cco3aq4n	7	18	has	have	VBZ
cord-308110-cco3aq4n	7	19	potent	potent	JJ
cord-308110-cco3aq4n	7	20	anti	anti	JJ
cord-308110-cco3aq4n	7	21	-	-	JJ
cord-308110-cco3aq4n	7	22	inflammatory	inflammatory	JJ
cord-308110-cco3aq4n	7	23	and	and	CC
cord-308110-cco3aq4n	7	24	immunomodulatory	immunomodulatory	JJ
cord-308110-cco3aq4n	7	25	effects	effect	NNS
cord-308110-cco3aq4n	7	26	.	.	.
cord-308110-cco3aq4n	8	1	CVC	CVC	NNP
cord-308110-cco3aq4n	8	2	is	be	VBZ
cord-308110-cco3aq4n	8	3	currently	currently	RB
cord-308110-cco3aq4n	8	4	under	under	IN
cord-308110-cco3aq4n	8	5	clinical	clinical	JJ
cord-308110-cco3aq4n	8	6	trials	trial	NNS
cord-308110-cco3aq4n	8	7	in	in	IN
cord-308110-cco3aq4n	8	8	the	the	DT
cord-308110-cco3aq4n	8	9	patients	patient	NNS
cord-308110-cco3aq4n	8	10	for	for	IN
cord-308110-cco3aq4n	8	11	treatment	treatment	NN
cord-308110-cco3aq4n	8	12	of	of	IN
cord-308110-cco3aq4n	8	13	nonalcoholic	nonalcoholic	JJ
cord-308110-cco3aq4n	8	14	steatohepatitis	steatohepatitis	NN
cord-308110-cco3aq4n	8	15	,	,	,
cord-308110-cco3aq4n	8	16	in	in	IN
cord-308110-cco3aq4n	8	17	which	which	WDT
cord-308110-cco3aq4n	8	18	immune	immune	JJ
cord-308110-cco3aq4n	8	19	cell	cell	NN
cord-308110-cco3aq4n	8	20	activation	activation	NN
cord-308110-cco3aq4n	8	21	and	and	CC
cord-308110-cco3aq4n	8	22	dysregulation	dysregulation	NN
cord-308110-cco3aq4n	8	23	of	of	IN
cord-308110-cco3aq4n	8	24	proinflammatory	proinflammatory	JJ
cord-308110-cco3aq4n	8	25	cytokines	cytokine	NNS
cord-308110-cco3aq4n	8	26	play	play	VBP
cord-308110-cco3aq4n	8	27	an	an	DT
cord-308110-cco3aq4n	8	28	important	important	JJ
cord-308110-cco3aq4n	8	29	role	role	NN
cord-308110-cco3aq4n	8	30	in	in	IN
cord-308110-cco3aq4n	8	31	its	-PRON-	PRP$
cord-308110-cco3aq4n	8	32	pathogenesis	pathogenesis	NN
cord-308110-cco3aq4n	8	33	.	.	.
cord-308110-cco3aq4n	9	1	In	in	IN
cord-308110-cco3aq4n	9	2	this	this	DT
cord-308110-cco3aq4n	9	3	study	study	NN
cord-308110-cco3aq4n	9	4	,	,	,
cord-308110-cco3aq4n	9	5	CVC	CVC	NNP
cord-308110-cco3aq4n	9	6	was	be	VBD
cord-308110-cco3aq4n	9	7	examined	examine	VBN
cord-308110-cco3aq4n	9	8	for	for	IN
cord-308110-cco3aq4n	9	9	its	-PRON-	PRP$
cord-308110-cco3aq4n	9	10	inhibitory	inhibitory	JJ
cord-308110-cco3aq4n	9	11	effect	effect	NN
cord-308110-cco3aq4n	9	12	on	on	IN
cord-308110-cco3aq4n	9	13	the	the	DT
cord-308110-cco3aq4n	9	14	replication	replication	NN
cord-308110-cco3aq4n	9	15	of	of	IN
cord-308110-cco3aq4n	9	16	SARS	SARS	NNP
cord-308110-cco3aq4n	9	17	-	-	HYPH
cord-308110-cco3aq4n	9	18	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	9	19	,	,	,
cord-308110-cco3aq4n	9	20	the	the	DT
cord-308110-cco3aq4n	9	21	causative	causative	JJ
cord-308110-cco3aq4n	9	22	agent	agent	NN
cord-308110-cco3aq4n	9	23	of	of	IN
cord-308110-cco3aq4n	9	24	COVID-19	COVID-19	NNP
cord-308110-cco3aq4n	9	25	,	,	,
cord-308110-cco3aq4n	9	26	in	in	IN
cord-308110-cco3aq4n	9	27	cell	cell	NN
cord-308110-cco3aq4n	9	28	cultures	culture	NNS
cord-308110-cco3aq4n	9	29	and	and	CC
cord-308110-cco3aq4n	9	30	found	find	VBD
cord-308110-cco3aq4n	9	31	to	to	TO
cord-308110-cco3aq4n	9	32	be	be	VB
cord-308110-cco3aq4n	9	33	a	a	DT
cord-308110-cco3aq4n	9	34	selective	selective	JJ
cord-308110-cco3aq4n	9	35	inhibitor	inhibitor	NN
cord-308110-cco3aq4n	9	36	of	of	IN
cord-308110-cco3aq4n	9	37	the	the	DT
cord-308110-cco3aq4n	9	38	virus	virus	NN
cord-308110-cco3aq4n	9	39	.	.	.
cord-308110-cco3aq4n	10	1	The	the	DT
cord-308110-cco3aq4n	10	2	50	50	CD
cord-308110-cco3aq4n	10	3	%	%	NN
cord-308110-cco3aq4n	10	4	effective	effective	JJ
cord-308110-cco3aq4n	10	5	concentrations	concentration	NNS
cord-308110-cco3aq4n	10	6	of	of	IN
cord-308110-cco3aq4n	10	7	CVC	CVC	NNP
cord-308110-cco3aq4n	10	8	were	be	VBD
cord-308110-cco3aq4n	10	9	19.0	19.0	CD
cord-308110-cco3aq4n	10	10	and	and	CC
cord-308110-cco3aq4n	10	11	2.9	2.9	CD
cord-308110-cco3aq4n	10	12	μM	μm	CD
cord-308110-cco3aq4n	10	13	in	in	IN
cord-308110-cco3aq4n	10	14	the	the	DT
cord-308110-cco3aq4n	10	15	assays	assay	NNS
cord-308110-cco3aq4n	10	16	based	base	VBN
cord-308110-cco3aq4n	10	17	on	on	IN
cord-308110-cco3aq4n	10	18	the	the	DT
cord-308110-cco3aq4n	10	19	inhibition	inhibition	NN
cord-308110-cco3aq4n	10	20	of	of	IN
cord-308110-cco3aq4n	10	21	virus	virus	NN
cord-308110-cco3aq4n	10	22	-	-	HYPH
cord-308110-cco3aq4n	10	23	induced	induce	VBN
cord-308110-cco3aq4n	10	24	cell	cell	NN
cord-308110-cco3aq4n	10	25	destruction	destruction	NN
cord-308110-cco3aq4n	10	26	and	and	CC
cord-308110-cco3aq4n	10	27	viral	viral	JJ
cord-308110-cco3aq4n	10	28	RNA	RNA	NNP
cord-308110-cco3aq4n	10	29	levels	level	NNS
cord-308110-cco3aq4n	10	30	in	in	IN
cord-308110-cco3aq4n	10	31	culture	culture	NN
cord-308110-cco3aq4n	10	32	supernatants	supernatant	NNS
cord-308110-cco3aq4n	10	33	of	of	IN
cord-308110-cco3aq4n	10	34	the	the	DT
cord-308110-cco3aq4n	10	35	infected	infected	JJ
cord-308110-cco3aq4n	10	36	cells	cell	NNS
cord-308110-cco3aq4n	10	37	,	,	,
cord-308110-cco3aq4n	10	38	respectively	respectively	RB
cord-308110-cco3aq4n	10	39	.	.	.
cord-308110-cco3aq4n	11	1	Interestingly	interestingly	RB
cord-308110-cco3aq4n	11	2	,	,	,
cord-308110-cco3aq4n	11	3	the	the	DT
cord-308110-cco3aq4n	11	4	CCR5-specific	CCR5-specific	NNP
cord-308110-cco3aq4n	11	5	antagonist	antagonist	NN
cord-308110-cco3aq4n	11	6	maraviroc	maraviroc	NNP
cord-308110-cco3aq4n	11	7	did	do	VBD
cord-308110-cco3aq4n	11	8	not	not	RB
cord-308110-cco3aq4n	11	9	show	show	VB
cord-308110-cco3aq4n	11	10	any	any	DT
cord-308110-cco3aq4n	11	11	anti	anti	JJ
cord-308110-cco3aq4n	11	12	-	-	JJ
cord-308110-cco3aq4n	11	13	SARS	SARS	NNP
cord-308110-cco3aq4n	11	14	-	-	HYPH
cord-308110-cco3aq4n	11	15	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	11	16	activity	activity	NN
cord-308110-cco3aq4n	11	17	.	.	.
cord-308110-cco3aq4n	12	1	Although	although	IN
cord-308110-cco3aq4n	12	2	the	the	DT
cord-308110-cco3aq4n	12	3	mechanism	mechanism	NN
cord-308110-cco3aq4n	12	4	of	of	IN
cord-308110-cco3aq4n	12	5	SARS	SARS	NNP
cord-308110-cco3aq4n	12	6	-	-	HYPH
cord-308110-cco3aq4n	12	7	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	12	8	inhibition	inhibition	NN
cord-308110-cco3aq4n	12	9	by	by	IN
cord-308110-cco3aq4n	12	10	CVC	CVC	NNP
cord-308110-cco3aq4n	12	11	remains	remain	VBZ
cord-308110-cco3aq4n	12	12	to	to	TO
cord-308110-cco3aq4n	12	13	be	be	VB
cord-308110-cco3aq4n	12	14	elucidated	elucidate	VBN
cord-308110-cco3aq4n	12	15	,	,	,
cord-308110-cco3aq4n	12	16	CCR2b	CCR2b	NNP
cord-308110-cco3aq4n	12	17	does	do	VBZ
cord-308110-cco3aq4n	12	18	not	not	RB
cord-308110-cco3aq4n	12	19	seem	seem	VB
cord-308110-cco3aq4n	12	20	to	to	TO
cord-308110-cco3aq4n	12	21	be	be	VB
cord-308110-cco3aq4n	12	22	its	-PRON-	PRP$
cord-308110-cco3aq4n	12	23	target	target	NN
cord-308110-cco3aq4n	12	24	molecule	molecule	NN
cord-308110-cco3aq4n	12	25	.	.	.
cord-308110-cco3aq4n	13	1	Considering	consider	VBG
cord-308110-cco3aq4n	13	2	the	the	DT
cord-308110-cco3aq4n	13	3	fact	fact	NN
cord-308110-cco3aq4n	13	4	that	that	IN
cord-308110-cco3aq4n	13	5	the	the	DT
cord-308110-cco3aq4n	13	6	regulation	regulation	NN
cord-308110-cco3aq4n	13	7	of	of	IN
cord-308110-cco3aq4n	13	8	excessive	excessive	JJ
cord-308110-cco3aq4n	13	9	immune	immune	JJ
cord-308110-cco3aq4n	13	10	activation	activation	NN
cord-308110-cco3aq4n	13	11	is	be	VBZ
cord-308110-cco3aq4n	13	12	required	require	VBN
cord-308110-cco3aq4n	13	13	to	to	TO
cord-308110-cco3aq4n	13	14	treat	treat	VB
cord-308110-cco3aq4n	13	15	COVID-19	covid-19	JJ
cord-308110-cco3aq4n	13	16	patients	patient	NNS
cord-308110-cco3aq4n	13	17	at	at	IN
cord-308110-cco3aq4n	13	18	the	the	DT
cord-308110-cco3aq4n	13	19	late	late	JJ
cord-308110-cco3aq4n	13	20	stage	stage	NN
cord-308110-cco3aq4n	13	21	of	of	IN
cord-308110-cco3aq4n	13	22	the	the	DT
cord-308110-cco3aq4n	13	23	disease	disease	NN
cord-308110-cco3aq4n	13	24	,	,	,
cord-308110-cco3aq4n	13	25	CVC	CVC	NNP
cord-308110-cco3aq4n	13	26	should	should	MD
cord-308110-cco3aq4n	13	27	be	be	VB
cord-308110-cco3aq4n	13	28	further	further	RB
cord-308110-cco3aq4n	13	29	pursued	pursue	VBN
cord-308110-cco3aq4n	13	30	for	for	IN
cord-308110-cco3aq4n	13	31	its	-PRON-	PRP$
cord-308110-cco3aq4n	13	32	potential	potential	NN
cord-308110-cco3aq4n	13	33	in	in	IN
cord-308110-cco3aq4n	13	34	the	the	DT
cord-308110-cco3aq4n	13	35	treatment	treatment	NN
cord-308110-cco3aq4n	13	36	of	of	IN
cord-308110-cco3aq4n	13	37	SARS	SARS	NNP
cord-308110-cco3aq4n	13	38	-	-	HYPH
cord-308110-cco3aq4n	13	39	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	13	40	infection	infection	NN
cord-308110-cco3aq4n	13	41	.	.	.
cord-308110-cco3aq4n	14	1	The	the	DT
cord-308110-cco3aq4n	14	2	pandemic	pandemic	NN
cord-308110-cco3aq4n	14	3	of	of	IN
cord-308110-cco3aq4n	14	4	severe	severe	JJ
cord-308110-cco3aq4n	14	5	pneumonia	pneumonia	NN
cord-308110-cco3aq4n	14	6	caused	cause	VBN
cord-308110-cco3aq4n	14	7	by	by	IN
cord-308110-cco3aq4n	14	8	the	the	DT
cord-308110-cco3aq4n	14	9	transmission	transmission	NN
cord-308110-cco3aq4n	14	10	of	of	IN
cord-308110-cco3aq4n	14	11	the	the	DT
cord-308110-cco3aq4n	14	12	new	new	JJ
cord-308110-cco3aq4n	14	13	coronavirus	coronavirus	NN
cord-308110-cco3aq4n	14	14	SARS	SARS	NNP
cord-308110-cco3aq4n	14	15	-	-	HYPH
cord-308110-cco3aq4n	14	16	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	14	17	is	be	VBZ
cord-308110-cco3aq4n	14	18	a	a	DT
cord-308110-cco3aq4n	14	19	serious	serious	JJ
cord-308110-cco3aq4n	14	20	threat	threat	NN
cord-308110-cco3aq4n	14	21	to	to	IN
cord-308110-cco3aq4n	14	22	humanity	humanity	NN
cord-308110-cco3aq4n	14	23	(	(	-LRB-
cord-308110-cco3aq4n	14	24	Di	Di	NNP
cord-308110-cco3aq4n	14	25	Gennaro	Gennaro	NNP
cord-308110-cco3aq4n	14	26	et	et	FW
cord-308110-cco3aq4n	14	27	al	al	NNP
cord-308110-cco3aq4n	14	28	.	.	.
cord-308110-cco3aq4n	15	1	,	,	,
cord-308110-cco3aq4n	15	2	2020	2020	CD
cord-308110-cco3aq4n	15	3	;	;	:
cord-308110-cco3aq4n	15	4	Harapan	Harapan	NNP
cord-308110-cco3aq4n	15	5	et	et	NNP
cord-308110-cco3aq4n	15	6	al	al	NNP
cord-308110-cco3aq4n	15	7	.	.	NNP
cord-308110-cco3aq4n	15	8	,	,	,
cord-308110-cco3aq4n	15	9	2020	2020	CD
cord-308110-cco3aq4n	15	10	;	;	:
cord-308110-cco3aq4n	15	11	Helmy	Helmy	NNP
cord-308110-cco3aq4n	15	12	,	,	,
cord-308110-cco3aq4n	15	13	et	et	NNP
cord-308110-cco3aq4n	15	14	al	al	NNP
cord-308110-cco3aq4n	15	15	.	.	NNP
cord-308110-cco3aq4n	15	16	,	,	,
cord-308110-cco3aq4n	15	17	2020	2020	CD
cord-308110-cco3aq4n	15	18	)	)	-RRB-
cord-308110-cco3aq4n	15	19	.	.	.
cord-308110-cco3aq4n	16	1	At	at	IN
cord-308110-cco3aq4n	16	2	present	present	NN
cord-308110-cco3aq4n	16	3	,	,	,
cord-308110-cco3aq4n	16	4	no	no	DT
cord-308110-cco3aq4n	16	5	vaccines	vaccine	NNS
cord-308110-cco3aq4n	16	6	exist	exist	VBP
cord-308110-cco3aq4n	16	7	,	,	,
cord-308110-cco3aq4n	16	8	and	and	CC
cord-308110-cco3aq4n	16	9	the	the	DT
cord-308110-cco3aq4n	16	10	nucleoside	nucleoside	NN
cord-308110-cco3aq4n	16	11	analog	analog	NN
cord-308110-cco3aq4n	16	12	remdesivir	remdesivir	NNP
cord-308110-cco3aq4n	16	13	(	(	-LRB-
cord-308110-cco3aq4n	16	14	RDV	RDV	NNP
cord-308110-cco3aq4n	16	15	)	)	-RRB-
cord-308110-cco3aq4n	16	16	has	have	VBZ
cord-308110-cco3aq4n	16	17	recently	recently	RB
cord-308110-cco3aq4n	16	18	been	be	VBN
cord-308110-cco3aq4n	16	19	approved	approve	VBN
cord-308110-cco3aq4n	16	20	for	for	IN
cord-308110-cco3aq4n	16	21	treatment	treatment	NN
cord-308110-cco3aq4n	16	22	of	of	IN
cord-308110-cco3aq4n	16	23	SARS	SARS	NNP
cord-308110-cco3aq4n	16	24	-	-	HYPH
cord-308110-cco3aq4n	16	25	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	16	26	infection	infection	NN
cord-308110-cco3aq4n	17	1	(	(	-LRB-
cord-308110-cco3aq4n	17	2	Grein	Grein	NNP
cord-308110-cco3aq4n	17	3	et	et	NNP
cord-308110-cco3aq4n	17	4	al	al	NNP
cord-308110-cco3aq4n	17	5	.	.	NNP
cord-308110-cco3aq4n	17	6	,	,	,
cord-308110-cco3aq4n	17	7	2020	2020	CD
cord-308110-cco3aq4n	17	8	)	)	-RRB-
cord-308110-cco3aq4n	17	9	.	.	.
cord-308110-cco3aq4n	18	1	RDV	RDV	NNP
cord-308110-cco3aq4n	18	2	has	have	VBZ
cord-308110-cco3aq4n	18	3	broad	broad	JJ
cord-308110-cco3aq4n	18	4	-	-	HYPH
cord-308110-cco3aq4n	18	5	spectrum	spectrum	NN
cord-308110-cco3aq4n	18	6	antiviral	antiviral	JJ
cord-308110-cco3aq4n	18	7	activity	activity	NN
cord-308110-cco3aq4n	18	8	against	against	IN
cord-308110-cco3aq4n	18	9	several	several	JJ
cord-308110-cco3aq4n	18	10	viruses	virus	NNS
cord-308110-cco3aq4n	18	11	,	,	,
cord-308110-cco3aq4n	18	12	including	include	VBG
cord-308110-cco3aq4n	18	13	Ebola	Ebola	NNP
cord-308110-cco3aq4n	18	14	virus	virus	NN
cord-308110-cco3aq4n	18	15	and	and	CC
cord-308110-cco3aq4n	18	16	coronaviruses	coronaviruse	NNS
cord-308110-cco3aq4n	18	17	.	.	.
cord-308110-cco3aq4n	19	1	In	in	IN
cord-308110-cco3aq4n	19	2	addition	addition	NN
cord-308110-cco3aq4n	19	3	to	to	IN
cord-308110-cco3aq4n	19	4	RDV	RDV	NNP
cord-308110-cco3aq4n	19	5	,	,	,
cord-308110-cco3aq4n	19	6	there	there	EX
cord-308110-cco3aq4n	19	7	is	be	VBZ
cord-308110-cco3aq4n	19	8	an	an	DT
cord-308110-cco3aq4n	19	9	attempt	attempt	NN
cord-308110-cco3aq4n	19	10	to	to	TO
cord-308110-cco3aq4n	19	11	treat	treat	VB
cord-308110-cco3aq4n	19	12	COVID-19	COVID-19	NNP
cord-308110-cco3aq4n	19	13	with	with	IN
cord-308110-cco3aq4n	19	14	existing	exist	VBG
cord-308110-cco3aq4n	19	15	drugs	drug	NNS
cord-308110-cco3aq4n	19	16	developed	develop	VBN
cord-308110-cco3aq4n	19	17	for	for	IN
cord-308110-cco3aq4n	19	18	other	other	JJ
cord-308110-cco3aq4n	19	19	purposes	purpose	NNS
cord-308110-cco3aq4n	19	20	.	.	.
cord-308110-cco3aq4n	20	1	These	these	DT
cord-308110-cco3aq4n	20	2	include	include	VBP
cord-308110-cco3aq4n	20	3	hydroxychloroquine	hydroxychloroquine	NN
cord-308110-cco3aq4n	20	4	and	and	CC
cord-308110-cco3aq4n	20	5	chloroquine	chloroquine	NN
cord-308110-cco3aq4n	20	6	(	(	-LRB-
cord-308110-cco3aq4n	20	7	Pastick	Pastick	NNP
cord-308110-cco3aq4n	20	8	et	et	NNP
cord-308110-cco3aq4n	20	9	al	al	NNP
cord-308110-cco3aq4n	20	10	.	.	NNP
cord-308110-cco3aq4n	20	11	,	,	,
cord-308110-cco3aq4n	20	12	2020	2020	CD
cord-308110-cco3aq4n	20	13	)	)	-RRB-
cord-308110-cco3aq4n	20	14	,	,	,
cord-308110-cco3aq4n	20	15	the	the	DT
cord-308110-cco3aq4n	20	16	anti	anti	JJ
cord-308110-cco3aq4n	20	17	-	-	JJ
cord-308110-cco3aq4n	20	18	influenza	influenza	JJ
cord-308110-cco3aq4n	20	19	virus	virus	NN
cord-308110-cco3aq4n	20	20	agent	agent	NN
cord-308110-cco3aq4n	20	21	favipiravir	favipiravir	NNP
cord-308110-cco3aq4n	20	22	(	(	-LRB-
cord-308110-cco3aq4n	20	23	Pilkington	Pilkington	NNP
cord-308110-cco3aq4n	20	24	et	et	NNP
cord-308110-cco3aq4n	20	25	al	al	NNP
cord-308110-cco3aq4n	20	26	.	.	NNP
cord-308110-cco3aq4n	20	27	,	,	,
cord-308110-cco3aq4n	20	28	2020	2020	CD
cord-308110-cco3aq4n	20	29	)	)	-RRB-
cord-308110-cco3aq4n	20	30	,	,	,
cord-308110-cco3aq4n	20	31	and	and	CC
cord-308110-cco3aq4n	20	32	the	the	DT
cord-308110-cco3aq4n	20	33	human	human	JJ
cord-308110-cco3aq4n	20	34	immunodeficiency	immunodeficiency	NN
cord-308110-cco3aq4n	20	35	virus	virus	NN
cord-308110-cco3aq4n	20	36	type	type	NN
cord-308110-cco3aq4n	20	37	1	1	CD
cord-308110-cco3aq4n	20	38	(	(	-LRB-
cord-308110-cco3aq4n	20	39	HIV-1	HIV-1	NNP
cord-308110-cco3aq4n	20	40	)	)	-RRB-
cord-308110-cco3aq4n	20	41	protease	protease	NN
cord-308110-cco3aq4n	20	42	inhibitor	inhibitor	NN
cord-308110-cco3aq4n	20	43	lopinavir	lopinavir	NNS
cord-308110-cco3aq4n	20	44	/	/	SYM
cord-308110-cco3aq4n	20	45	ritonavir	ritonavir	NNS
cord-308110-cco3aq4n	20	46	.	.	.
cord-308110-cco3aq4n	21	1	More	more	RBR
cord-308110-cco3aq4n	21	2	recently	recently	RB
cord-308110-cco3aq4n	21	3	,	,	,
cord-308110-cco3aq4n	21	4	the	the	DT
cord-308110-cco3aq4n	21	5	anti	anti	JJ
cord-308110-cco3aq4n	21	6	-	-	JJ
cord-308110-cco3aq4n	21	7	parasitic	parasitic	JJ
cord-308110-cco3aq4n	21	8	agent	agent	NN
cord-308110-cco3aq4n	21	9	ivermectin	ivermectin	NNP
cord-308110-cco3aq4n	21	10	has	have	VBZ
cord-308110-cco3aq4n	21	11	been	be	VBN
cord-308110-cco3aq4n	21	12	shown	show	VBN
cord-308110-cco3aq4n	21	13	to	to	TO
cord-308110-cco3aq4n	21	14	inhibit	inhibit	VB
cord-308110-cco3aq4n	21	15	SARS	SARS	NNP
cord-308110-cco3aq4n	21	16	-	-	HYPH
cord-308110-cco3aq4n	21	17	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	21	18	replication	replication	NN
cord-308110-cco3aq4n	21	19	in	in	IN
cord-308110-cco3aq4n	21	20	cell	cell	NN
cord-308110-cco3aq4n	21	21	cultures	culture	NNS
cord-308110-cco3aq4n	22	1	(	(	-LRB-
cord-308110-cco3aq4n	22	2	Caly	Caly	NNP
cord-308110-cco3aq4n	22	3	et	et	NNP
cord-308110-cco3aq4n	22	4	al	al	NNP
cord-308110-cco3aq4n	22	5	.	.	NNP
cord-308110-cco3aq4n	22	6	,	,	,
cord-308110-cco3aq4n	22	7	2020	2020	CD
cord-308110-cco3aq4n	22	8	)	)	-RRB-
cord-308110-cco3aq4n	22	9	.	.	.
cord-308110-cco3aq4n	23	1	However	however	RB
cord-308110-cco3aq4n	23	2	,	,	,
cord-308110-cco3aq4n	23	3	these	these	DT
cord-308110-cco3aq4n	23	4	drugs	drug	NNS
cord-308110-cco3aq4n	23	5	are	be	VBP
cord-308110-cco3aq4n	23	6	not	not	RB
cord-308110-cco3aq4n	23	7	optimized	optimize	VBN
cord-308110-cco3aq4n	23	8	for	for	IN
cord-308110-cco3aq4n	23	9	SARS	SARS	NNP
cord-308110-cco3aq4n	23	10	-	-	HYPH
cord-308110-cco3aq4n	23	11	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	23	12	,	,	,
cord-308110-cco3aq4n	23	13	so	so	IN
cord-308110-cco3aq4n	23	14	that	that	IN
cord-308110-cco3aq4n	23	15	they	-PRON-	PRP
cord-308110-cco3aq4n	23	16	may	may	MD
cord-308110-cco3aq4n	23	17	have	have	VB
cord-308110-cco3aq4n	23	18	inevitable	inevitable	JJ
cord-308110-cco3aq4n	23	19	adverse	adverse	JJ
cord-308110-cco3aq4n	23	20	effects	effect	NNS
cord-308110-cco3aq4n	23	21	due	due	IN
cord-308110-cco3aq4n	23	22	to	to	IN
cord-308110-cco3aq4n	23	23	the	the	DT
cord-308110-cco3aq4n	23	24	requirement	requirement	NN
cord-308110-cco3aq4n	23	25	of	of	IN
cord-308110-cco3aq4n	23	26	higher	high	JJR
cord-308110-cco3aq4n	23	27	dosages	dosage	NNS
cord-308110-cco3aq4n	23	28	.	.	.
cord-308110-cco3aq4n	24	1	Furthermore	furthermore	RB
cord-308110-cco3aq4n	24	2	,	,	,
cord-308110-cco3aq4n	24	3	these	these	DT
cord-308110-cco3aq4n	24	4	antiviral	antiviral	JJ
cord-308110-cco3aq4n	24	5	agents	agent	NNS
cord-308110-cco3aq4n	24	6	must	must	MD
cord-308110-cco3aq4n	24	7	be	be	VB
cord-308110-cco3aq4n	24	8	used	use	VBN
cord-308110-cco3aq4n	24	9	at	at	IN
cord-308110-cco3aq4n	24	10	an	an	DT
cord-308110-cco3aq4n	24	11	early	early	JJ
cord-308110-cco3aq4n	24	12	stage	stage	NN
cord-308110-cco3aq4n	24	13	of	of	IN
cord-308110-cco3aq4n	24	14	infection	infection	NN
cord-308110-cco3aq4n	24	15	,	,	,
cord-308110-cco3aq4n	24	16	since	since	IN
cord-308110-cco3aq4n	24	17	severe	severe	JJ
cord-308110-cco3aq4n	24	18	deterioration	deterioration	NN
cord-308110-cco3aq4n	24	19	of	of	IN
cord-308110-cco3aq4n	24	20	pneumonia	pneumonia	NN
cord-308110-cco3aq4n	24	21	in	in	IN
cord-308110-cco3aq4n	24	22	some	some	DT
cord-308110-cco3aq4n	24	23	patients	patient	NNS
cord-308110-cco3aq4n	24	24	is	be	VBZ
cord-308110-cco3aq4n	24	25	considered	consider	VBN
cord-308110-cco3aq4n	24	26	to	to	TO
cord-308110-cco3aq4n	24	27	be	be	VB
cord-308110-cco3aq4n	24	28	closely	closely	RB
cord-308110-cco3aq4n	24	29	associated	associate	VBN
cord-308110-cco3aq4n	24	30	with	with	IN
cord-308110-cco3aq4n	24	31	not	not	RB
cord-308110-cco3aq4n	24	32	viral	viral	JJ
cord-308110-cco3aq4n	24	33	replication	replication	NN
cord-308110-cco3aq4n	24	34	but	but	CC
cord-308110-cco3aq4n	24	35	"	"	``
cord-308110-cco3aq4n	24	36	cytokine	cytokine	NN
cord-308110-cco3aq4n	24	37	storm	storm	NN
cord-308110-cco3aq4n	24	38	"	"	''
cord-308110-cco3aq4n	24	39	caused	cause	VBN
cord-308110-cco3aq4n	24	40	by	by	IN
cord-308110-cco3aq4n	24	41	dysregulated	dysregulated	JJ
cord-308110-cco3aq4n	24	42	and	and	CC
cord-308110-cco3aq4n	24	43	excessive	excessive	JJ
cord-308110-cco3aq4n	24	44	cytokine	cytokine	NN
cord-308110-cco3aq4n	24	45	release	release	NN
cord-308110-cco3aq4n	24	46	from	from	IN
cord-308110-cco3aq4n	24	47	activated	activate	VBN
cord-308110-cco3aq4n	24	48	immune	immune	JJ
cord-308110-cco3aq4n	24	49	cells	cell	NNS
cord-308110-cco3aq4n	24	50	(	(	-LRB-
cord-308110-cco3aq4n	24	51	Ye	Ye	NNP
cord-308110-cco3aq4n	24	52	et	et	NNP
cord-308110-cco3aq4n	24	53	al	al	NNP
cord-308110-cco3aq4n	24	54	.	.	NNP
cord-308110-cco3aq4n	24	55	,	,	,
cord-308110-cco3aq4n	24	56	2020	2020	CD
cord-308110-cco3aq4n	24	57	)	)	-RRB-
cord-308110-cco3aq4n	24	58	.	.	.
cord-308110-cco3aq4n	25	1	Therefore	therefore	RB
cord-308110-cco3aq4n	25	2	,	,	,
cord-308110-cco3aq4n	25	3	the	the	DT
cord-308110-cco3aq4n	25	4	use	use	NN
cord-308110-cco3aq4n	25	5	of	of	IN
cord-308110-cco3aq4n	25	6	anti	anti	JJ
cord-308110-cco3aq4n	25	7	-	-	JJ
cord-308110-cco3aq4n	25	8	inflammatory	inflammatory	JJ
cord-308110-cco3aq4n	25	9	and	and	CC
cord-308110-cco3aq4n	25	10	immunomodulatory	immunomodulatory	JJ
cord-308110-cco3aq4n	25	11	agents	agent	NNS
cord-308110-cco3aq4n	25	12	is	be	VBZ
cord-308110-cco3aq4n	25	13	mandatory	mandatory	JJ
cord-308110-cco3aq4n	25	14	in	in	IN
cord-308110-cco3aq4n	25	15	the	the	DT
cord-308110-cco3aq4n	25	16	late	late	JJ
cord-308110-cco3aq4n	25	17	stage	stage	NN
cord-308110-cco3aq4n	25	18	of	of	IN
cord-308110-cco3aq4n	25	19	this	this	DT
cord-308110-cco3aq4n	25	20	disease	disease	NN
cord-308110-cco3aq4n	25	21	(	(	-LRB-
cord-308110-cco3aq4n	25	22	Alijotas	Alijotas	NNP
cord-308110-cco3aq4n	25	23	-	-	HYPH
cord-308110-cco3aq4n	25	24	Reig	Reig	NNP
cord-308110-cco3aq4n	25	25	et	et	NNP
cord-308110-cco3aq4n	25	26	al	al	NNP
cord-308110-cco3aq4n	25	27	.	.	NNP
cord-308110-cco3aq4n	25	28	,	,	,
cord-308110-cco3aq4n	25	29	2020	2020	CD
cord-308110-cco3aq4n	25	30	)	)	-RRB-
cord-308110-cco3aq4n	25	31	.	.	.
cord-308110-cco3aq4n	26	1	We	-PRON-	PRP
cord-308110-cco3aq4n	26	2	have	have	VBP
cord-308110-cco3aq4n	26	3	examined	examine	VBN
cord-308110-cco3aq4n	26	4	several	several	JJ
cord-308110-cco3aq4n	26	5	compounds	compound	NNS
cord-308110-cco3aq4n	26	6	for	for	IN
cord-308110-cco3aq4n	26	7	their	-PRON-	PRP$
cord-308110-cco3aq4n	26	8	inhibitory	inhibitory	JJ
cord-308110-cco3aq4n	26	9	effect	effect	NN
cord-308110-cco3aq4n	26	10	on	on	IN
cord-308110-cco3aq4n	26	11	SARS	SARS	NNP
cord-308110-cco3aq4n	26	12	-	-	HYPH
cord-308110-cco3aq4n	26	13	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	26	14	replication	replication	NN
cord-308110-cco3aq4n	26	15	in	in	IN
cord-308110-cco3aq4n	26	16	cell	cell	NN
cord-308110-cco3aq4n	26	17	cultures	culture	NNS
cord-308110-cco3aq4n	26	18	and	and	CC
cord-308110-cco3aq4n	26	19	found	find	VBD
cord-308110-cco3aq4n	26	20	that	that	IN
cord-308110-cco3aq4n	26	21	the	the	DT
cord-308110-cco3aq4n	26	22	chemokine	chemokine	NN
cord-308110-cco3aq4n	26	23	receptor	receptor	NN
cord-308110-cco3aq4n	26	24	antagonist	antagonist	NN
cord-308110-cco3aq4n	26	25	cenicriviroc	cenicriviroc	NNP
cord-308110-cco3aq4n	26	26	(	(	-LRB-
cord-308110-cco3aq4n	26	27	CVC	CVC	NNP
cord-308110-cco3aq4n	26	28	)	)	-RRB-
cord-308110-cco3aq4n	26	29	inhibits	inhibit	VBZ
cord-308110-cco3aq4n	26	30	the	the	DT
cord-308110-cco3aq4n	26	31	replication	replication	NN
cord-308110-cco3aq4n	26	32	of	of	IN
cord-308110-cco3aq4n	26	33	SARS	SARS	NNP
cord-308110-cco3aq4n	26	34	-	-	HYPH
cord-308110-cco3aq4n	26	35	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	26	36	.	.	.
cord-308110-cco3aq4n	27	1	CVC	CVC	NNP
cord-308110-cco3aq4n	27	2	is	be	VBZ
cord-308110-cco3aq4n	27	3	a	a	DT
cord-308110-cco3aq4n	27	4	C	C	NNP
cord-308110-cco3aq4n	27	5	-	-	HYPH
cord-308110-cco3aq4n	27	6	C	c	NN
cord-308110-cco3aq4n	27	7	chemokine	chemokine	NN
cord-308110-cco3aq4n	27	8	receptor	receptor	NN
cord-308110-cco3aq4n	27	9	type	type	NN
cord-308110-cco3aq4n	27	10	5	5	CD
cord-308110-cco3aq4n	27	11	(	(	-LRB-
cord-308110-cco3aq4n	27	12	CCR5	CCR5	NNP
cord-308110-cco3aq4n	27	13	)	)	-RRB-
cord-308110-cco3aq4n	27	14	antagonist	antagonist	NN
cord-308110-cco3aq4n	27	15	with	with	IN
cord-308110-cco3aq4n	27	16	potent	potent	JJ
cord-308110-cco3aq4n	27	17	and	and	CC
cord-308110-cco3aq4n	27	18	selective	selective	JJ
cord-308110-cco3aq4n	27	19	anti	anti	JJ
cord-308110-cco3aq4n	27	20	-	-	JJ
cord-308110-cco3aq4n	27	21	HIV-1	hiv-1	JJ
cord-308110-cco3aq4n	27	22	activity	activity	NN
cord-308110-cco3aq4n	28	1	(	(	-LRB-
cord-308110-cco3aq4n	28	2	Baba	Baba	NNP
cord-308110-cco3aq4n	28	3	et	et	FW
cord-308110-cco3aq4n	28	4	al	al	NNP
cord-308110-cco3aq4n	28	5	.	.	.
cord-308110-cco3aq4n	29	1	,	,	,
cord-308110-cco3aq4n	29	2	2005	2005	CD
cord-308110-cco3aq4n	29	3	)	)	-RRB-
cord-308110-cco3aq4n	29	4	.	.	.
cord-308110-cco3aq4n	30	1	In	in	IN
cord-308110-cco3aq4n	30	2	addition	addition	NN
cord-308110-cco3aq4n	30	3	,	,	,
cord-308110-cco3aq4n	30	4	CVC	CVC	NNP
cord-308110-cco3aq4n	30	5	antagonizes	antagonize	VBZ
cord-308110-cco3aq4n	30	6	not	not	RB
cord-308110-cco3aq4n	30	7	only	only	RB
cord-308110-cco3aq4n	30	8	CCR5	CCR5	NNP
cord-308110-cco3aq4n	30	9	but	but	CC
cord-308110-cco3aq4n	30	10	also	also	RB
cord-308110-cco3aq4n	31	1	C	C	NNP
cord-308110-cco3aq4n	31	2	-	-	HYPH
cord-308110-cco3aq4n	31	3	C	C	NNP
cord-308110-cco3aq4n	31	4	chemokine	chemokine	NN
cord-308110-cco3aq4n	31	5	receptor	receptor	NN
cord-308110-cco3aq4n	31	6	type	type	NN
cord-308110-cco3aq4n	31	7	2b	2b	CD
cord-308110-cco3aq4n	31	8	(	(	-LRB-
cord-308110-cco3aq4n	31	9	CCR2b	CCR2b	NNP
cord-308110-cco3aq4n	31	10	)	)	-RRB-
cord-308110-cco3aq4n	31	11	.	.	.
cord-308110-cco3aq4n	32	1	Since	since	IN
cord-308110-cco3aq4n	32	2	CCR2b	CCR2b	NNP
cord-308110-cco3aq4n	32	3	is	be	VBZ
cord-308110-cco3aq4n	32	4	the	the	DT
cord-308110-cco3aq4n	32	5	receptor	receptor	NN
cord-308110-cco3aq4n	32	6	of	of	IN
cord-308110-cco3aq4n	32	7	monocyte	monocyte	NNP
cord-308110-cco3aq4n	32	8	chemoattractant	chemoattractant	NNP
cord-308110-cco3aq4n	32	9	protein	protein	NNP
cord-308110-cco3aq4n	32	10	1	1	CD
cord-308110-cco3aq4n	32	11	(	(	-LRB-
cord-308110-cco3aq4n	32	12	MCP-1	MCP-1	NNP
cord-308110-cco3aq4n	32	13	)	)	-RRB-
cord-308110-cco3aq4n	32	14	,	,	,
cord-308110-cco3aq4n	32	15	CVC	CVC	NNP
cord-308110-cco3aq4n	32	16	exerts	exert	VBZ
cord-308110-cco3aq4n	32	17	anti	anti	JJ
cord-308110-cco3aq4n	32	18	-	-	JJ
cord-308110-cco3aq4n	32	19	inflammatory	inflammatory	JJ
cord-308110-cco3aq4n	32	20	and	and	CC
cord-308110-cco3aq4n	32	21	immunomodulatory	immunomodulatory	JJ
cord-308110-cco3aq4n	32	22	effects	effect	NNS
cord-308110-cco3aq4n	32	23	in	in	IN
cord-308110-cco3aq4n	32	24	vivo	vivo	NN
cord-308110-cco3aq4n	32	25	(	(	-LRB-
cord-308110-cco3aq4n	32	26	Dawson	Dawson	NNP
cord-308110-cco3aq4n	32	27	et	et	NNP
cord-308110-cco3aq4n	32	28	al	al	NNP
cord-308110-cco3aq4n	32	29	.	.	NNP
cord-308110-cco3aq4n	32	30	,	,	,
cord-308110-cco3aq4n	32	31	2003	2003	CD
cord-308110-cco3aq4n	32	32	;	;	:
cord-308110-cco3aq4n	33	1	Xia	Xia	NNP
cord-308110-cco3aq4n	33	2	and	and	CC
cord-308110-cco3aq4n	33	3	Sui	Sui	NNP
cord-308110-cco3aq4n	33	4	,	,	,
cord-308110-cco3aq4n	33	5	2009	2009	CD
cord-308110-cco3aq4n	33	6	)	)	-RRB-
cord-308110-cco3aq4n	33	7	.	.	.
cord-308110-cco3aq4n	34	1	In	in	IN
cord-308110-cco3aq4n	34	2	fact	fact	NN
cord-308110-cco3aq4n	34	3	,	,	,
cord-308110-cco3aq4n	34	4	CVC	CVC	NNP
cord-308110-cco3aq4n	34	5	is	be	VBZ
cord-308110-cco3aq4n	34	6	currently	currently	RB
cord-308110-cco3aq4n	34	7	under	under	IN
cord-308110-cco3aq4n	34	8	clinical	clinical	JJ
cord-308110-cco3aq4n	34	9	trials	trial	NNS
cord-308110-cco3aq4n	34	10	for	for	IN
cord-308110-cco3aq4n	34	11	the	the	DT
cord-308110-cco3aq4n	34	12	treatment	treatment	NN
cord-308110-cco3aq4n	34	13	of	of	IN
cord-308110-cco3aq4n	34	14	nonalcoholic	nonalcoholic	JJ
cord-308110-cco3aq4n	34	15	steatohepatitis	steatohepatitis	NNP
cord-308110-cco3aq4n	34	16	(	(	-LRB-
cord-308110-cco3aq4n	34	17	NASH	NASH	NNP
cord-308110-cco3aq4n	34	18	)	)	-RRB-
cord-308110-cco3aq4n	34	19	,	,	,
cord-308110-cco3aq4n	34	20	in	in	IN
cord-308110-cco3aq4n	34	21	which	which	WDT
cord-308110-cco3aq4n	34	22	immune	immune	JJ
cord-308110-cco3aq4n	34	23	cell	cell	NN
cord-308110-cco3aq4n	34	24	activation	activation	NN
cord-308110-cco3aq4n	34	25	and	and	CC
cord-308110-cco3aq4n	34	26	dysregulation	dysregulation	NN
cord-308110-cco3aq4n	34	27	of	of	IN
cord-308110-cco3aq4n	34	28	proinflammatory	proinflammatory	JJ
cord-308110-cco3aq4n	34	29	cytokines	cytokine	NNS
cord-308110-cco3aq4n	34	30	play	play	VBP
cord-308110-cco3aq4n	34	31	an	an	DT
cord-308110-cco3aq4n	34	32	important	important	JJ
cord-308110-cco3aq4n	34	33	role	role	NN
cord-308110-cco3aq4n	34	34	in	in	IN
cord-308110-cco3aq4n	34	35	its	-PRON-	PRP$
cord-308110-cco3aq4n	34	36	pathogenesis	pathogenesis	NN
cord-308110-cco3aq4n	35	1	(	(	-LRB-
cord-308110-cco3aq4n	35	2	Pedrosa	Pedrosa	NNP
cord-308110-cco3aq4n	35	3	et	et	NNP
cord-308110-cco3aq4n	35	4	al	al	NNP
cord-308110-cco3aq4n	35	5	.	.	NNP
cord-308110-cco3aq4n	35	6	,	,	,
cord-308110-cco3aq4n	35	7	2020	2020	CD
cord-308110-cco3aq4n	35	8	)	)	-RRB-
cord-308110-cco3aq4n	35	9	.	.	.
cord-308110-cco3aq4n	36	1	VeroE6	veroe6	NN
cord-308110-cco3aq4n	36	2	cell	cell	NN
cord-308110-cco3aq4n	36	3	line	line	NN
cord-308110-cco3aq4n	36	4	expressing	express	VBG
cord-308110-cco3aq4n	36	5	transmembrane	transmembrane	NN
cord-308110-cco3aq4n	36	6	protease	protease	NN
cord-308110-cco3aq4n	36	7	serine	serine	NN
cord-308110-cco3aq4n	36	8	2	2	CD
cord-308110-cco3aq4n	36	9	(	(	-LRB-
cord-308110-cco3aq4n	36	10	VeroE6	VeroE6	NNP
cord-308110-cco3aq4n	36	11	/	/	SYM
cord-308110-cco3aq4n	36	12	TMPRSS2	TMPRSS2	NNP
cord-308110-cco3aq4n	36	13	)	)	-RRB-
cord-308110-cco3aq4n	36	14	highly	highly	RB
cord-308110-cco3aq4n	36	15	susceptible	susceptible	JJ
cord-308110-cco3aq4n	36	16	to	to	IN
cord-308110-cco3aq4n	36	17	SARS	SARS	NNP
cord-308110-cco3aq4n	36	18	-	-	HYPH
cord-308110-cco3aq4n	36	19	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	36	20	infection	infection	NN
cord-308110-cco3aq4n	36	21	was	be	VBD
cord-308110-cco3aq4n	36	22	obtained	obtain	VBN
cord-308110-cco3aq4n	36	23	from	from	IN
cord-308110-cco3aq4n	36	24	Japanese	Japanese	NNP
cord-308110-cco3aq4n	36	25	Collection	Collection	NNP
cord-308110-cco3aq4n	36	26	of	of	IN
cord-308110-cco3aq4n	36	27	Research	Research	NNP
cord-308110-cco3aq4n	36	28	Bioresources	Bioresources	NNPS
cord-308110-cco3aq4n	36	29	(	(	-LRB-
cord-308110-cco3aq4n	36	30	JCRB	JCRB	NNP
cord-308110-cco3aq4n	36	31	)	)	-RRB-
cord-308110-cco3aq4n	36	32	Cell	Cell	NNP
cord-308110-cco3aq4n	36	33	Bank	Bank	NNP
cord-308110-cco3aq4n	36	34	in	in	IN
cord-308110-cco3aq4n	36	35	Japan	Japan	NNP
cord-308110-cco3aq4n	36	36	(	(	-LRB-
cord-308110-cco3aq4n	36	37	JCRB	JCRB	NNP
cord-308110-cco3aq4n	36	38	no	no	UH
cord-308110-cco3aq4n	36	39	.	.	.
cord-308110-cco3aq4n	36	40	JCRB1819	jcrb1819	NN
cord-308110-cco3aq4n	36	41	)	)	-RRB-
cord-308110-cco3aq4n	36	42	and	and	CC
cord-308110-cco3aq4n	36	43	used	use	VBN
cord-308110-cco3aq4n	36	44	for	for	IN
cord-308110-cco3aq4n	36	45	virus	virus	NN
cord-308110-cco3aq4n	36	46	propagation	propagation	NN
cord-308110-cco3aq4n	36	47	and	and	CC
cord-308110-cco3aq4n	36	48	antiviral	antiviral	JJ
cord-308110-cco3aq4n	36	49	assays	assay	NNS
cord-308110-cco3aq4n	36	50	after	after	IN
cord-308110-cco3aq4n	36	51	removal	removal	NN
cord-308110-cco3aq4n	36	52	of	of	IN
cord-308110-cco3aq4n	36	53	mycoplasma	mycoplasma	NN
cord-308110-cco3aq4n	36	54	contamination	contamination	NN
cord-308110-cco3aq4n	36	55	.	.	.
cord-308110-cco3aq4n	37	1	Vero	Vero	NNP
cord-308110-cco3aq4n	37	2	cells	cell	NNS
cord-308110-cco3aq4n	37	3	were	be	VBD
cord-308110-cco3aq4n	37	4	also	also	RB
cord-308110-cco3aq4n	37	5	used	use	VBN
cord-308110-cco3aq4n	37	6	for	for	IN
cord-308110-cco3aq4n	37	7	experiments	experiment	NNS
cord-308110-cco3aq4n	37	8	.	.	.
cord-308110-cco3aq4n	38	1	The	the	DT
cord-308110-cco3aq4n	38	2	cells	cell	NNS
cord-308110-cco3aq4n	38	3	were	be	VBD
cord-308110-cco3aq4n	38	4	cultured	cultured	JJ
cord-308110-cco3aq4n	38	5	in	in	IN
cord-308110-cco3aq4n	38	6	Dulbecco	Dulbecco	NNP
cord-308110-cco3aq4n	38	7	's	's	POS
cord-308110-cco3aq4n	38	8	modified	modify	VBN
cord-308110-cco3aq4n	38	9	Eagle	Eagle	NNP
cord-308110-cco3aq4n	38	10	medium	medium	NN
cord-308110-cco3aq4n	38	11	(	(	-LRB-
cord-308110-cco3aq4n	38	12	Nacalai	Nacalai	NNP
cord-308110-cco3aq4n	38	13	Tesque	Tesque	NNP
cord-308110-cco3aq4n	38	14	,	,	,
cord-308110-cco3aq4n	38	15	Kyoto	Kyoto	NNP
cord-308110-cco3aq4n	38	16	,	,	,
cord-308110-cco3aq4n	38	17	Japan	Japan	NNP
cord-308110-cco3aq4n	38	18	)	)	-RRB-
cord-308110-cco3aq4n	38	19	supplemented	supplement	VBD
cord-308110-cco3aq4n	38	20	with	with	IN
cord-308110-cco3aq4n	38	21	5	5	CD
cord-308110-cco3aq4n	38	22	%	%	NN
cord-308110-cco3aq4n	38	23	heat	heat	NN
cord-308110-cco3aq4n	38	24	-	-	HYPH
cord-308110-cco3aq4n	38	25	inactivated	inactivate	VBN
cord-308110-cco3aq4n	38	26	fetal	fetal	JJ
cord-308110-cco3aq4n	38	27	bovine	bovine	NN
cord-308110-cco3aq4n	38	28	serum	serum	NN
cord-308110-cco3aq4n	38	29	(	(	-LRB-
cord-308110-cco3aq4n	38	30	FBS	FBS	NNP
cord-308110-cco3aq4n	38	31	)	)	-RRB-
cord-308110-cco3aq4n	38	32	,	,	.
cord-308110-cco3aq4n	39	1	100	100	CD
cord-308110-cco3aq4n	39	2	U	u	NN
cord-308110-cco3aq4n	39	3	/	/	SYM
cord-308110-cco3aq4n	39	4	ml	ml	IN
cord-308110-cco3aq4n	39	5	penicillin	penicillin	NN
cord-308110-cco3aq4n	39	6	G	G	NNP
cord-308110-cco3aq4n	39	7	,	,	,
cord-308110-cco3aq4n	39	8	100	100	CD
cord-308110-cco3aq4n	39	9	µg	µg	NN
cord-308110-cco3aq4n	39	10	/	/	SYM
cord-308110-cco3aq4n	39	11	ml	ml	NN
cord-308110-cco3aq4n	39	12	streptomycin	streptomycin	NNS
cord-308110-cco3aq4n	39	13	,	,	,
cord-308110-cco3aq4n	39	14	and	and	CC
cord-308110-cco3aq4n	39	15	1	1	CD
cord-308110-cco3aq4n	39	16	mg	mg	NNP
cord-308110-cco3aq4n	39	17	/	/	SYM
cord-308110-cco3aq4n	39	18	ml	ml	NN
cord-308110-cco3aq4n	39	19	G418	G418	NNP
cord-308110-cco3aq4n	39	20	(	(	-LRB-
cord-308110-cco3aq4n	39	21	Nacalai	Nacalai	NNP
cord-308110-cco3aq4n	39	22	Tesque	Tesque	NNP
cord-308110-cco3aq4n	39	23	)	)	-RRB-
cord-308110-cco3aq4n	39	24	.	.	.
cord-308110-cco3aq4n	40	1	For	for	IN
cord-308110-cco3aq4n	40	2	antiviral	antiviral	JJ
cord-308110-cco3aq4n	40	3	assays	assay	NNS
cord-308110-cco3aq4n	40	4	,	,	,
cord-308110-cco3aq4n	40	5	the	the	DT
cord-308110-cco3aq4n	40	6	cells	cell	NNS
cord-308110-cco3aq4n	40	7	were	be	VBD
cord-308110-cco3aq4n	40	8	cultured	culture	VBN
cord-308110-cco3aq4n	40	9	in	in	IN
cord-308110-cco3aq4n	40	10	the	the	DT
cord-308110-cco3aq4n	40	11	absence	absence	NN
cord-308110-cco3aq4n	40	12	of	of	IN
cord-308110-cco3aq4n	40	13	G418	G418	NNS
cord-308110-cco3aq4n	40	14	.	.	.
cord-308110-cco3aq4n	41	1	SARS	SARS	NNP
cord-308110-cco3aq4n	41	2	-	-	HYPH
cord-308110-cco3aq4n	41	3	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	41	4	(	(	-LRB-
cord-308110-cco3aq4n	41	5	WK-521	wk-521	JJ
cord-308110-cco3aq4n	41	6	strain	strain	NN
cord-308110-cco3aq4n	41	7	,	,	,
cord-308110-cco3aq4n	41	8	GISAID	GISAID	NNP
cord-308110-cco3aq4n	41	9	database	database	NN
cord-308110-cco3aq4n	41	10	ID	ID	NNP
cord-308110-cco3aq4n	41	11	EPI_ISL_408667	EPI_ISL_408667	NNP
cord-308110-cco3aq4n	41	12	)	)	-RRB-
cord-308110-cco3aq4n	41	13	,	,	,
cord-308110-cco3aq4n	41	14	a	a	DT
cord-308110-cco3aq4n	41	15	clinical	clinical	JJ
cord-308110-cco3aq4n	41	16	isolate	isolate	NN
cord-308110-cco3aq4n	41	17	from	from	IN
cord-308110-cco3aq4n	41	18	a	a	DT
cord-308110-cco3aq4n	41	19	COVID-19	covid-19	JJ
cord-308110-cco3aq4n	41	20	patient	patient	NN
cord-308110-cco3aq4n	41	21	,	,	,
cord-308110-cco3aq4n	41	22	was	be	VBD
cord-308110-cco3aq4n	41	23	provided	provide	VBN
cord-308110-cco3aq4n	41	24	by	by	IN
cord-308110-cco3aq4n	41	25	National	National	NNP
cord-308110-cco3aq4n	41	26	Institute	Institute	NNP
cord-308110-cco3aq4n	41	27	of	of	IN
cord-308110-cco3aq4n	41	28	Infectious	Infectious	NNP
cord-308110-cco3aq4n	41	29	Diseases	Diseases	NNPS
cord-308110-cco3aq4n	41	30	,	,	,
cord-308110-cco3aq4n	41	31	Tokyo	Tokyo	NNP
cord-308110-cco3aq4n	41	32	,	,	,
cord-308110-cco3aq4n	41	33	Japan	Japan	NNP
cord-308110-cco3aq4n	41	34	.	.	.
cord-308110-cco3aq4n	42	1	The	the	DT
cord-308110-cco3aq4n	42	2	infectious	infectious	JJ
cord-308110-cco3aq4n	42	3	virus	virus	NN
cord-308110-cco3aq4n	42	4	titer	titer	NN
cord-308110-cco3aq4n	42	5	was	be	VBD
cord-308110-cco3aq4n	42	6	determined	determine	VBN
cord-308110-cco3aq4n	42	7	in	in	IN
cord-308110-cco3aq4n	42	8	VeroE6	veroe6	NN
cord-308110-cco3aq4n	42	9	/	/	SYM
cord-308110-cco3aq4n	42	10	TMPRSS2	TMPRSS2	NNP
cord-308110-cco3aq4n	42	11	cells	cell	NNS
cord-308110-cco3aq4n	42	12	and	and	CC
cord-308110-cco3aq4n	42	13	expressed	express	VBD
cord-308110-cco3aq4n	42	14	as	as	IN
cord-308110-cco3aq4n	42	15	50	50	CD
cord-308110-cco3aq4n	42	16	%	%	NN
cord-308110-cco3aq4n	42	17	cell	cell	NN
cord-308110-cco3aq4n	42	18	culture	culture	NN
cord-308110-cco3aq4n	42	19	infectious	infectious	JJ
cord-308110-cco3aq4n	42	20	dose	dose	NN
cord-308110-cco3aq4n	42	21	(	(	-LRB-
cord-308110-cco3aq4n	42	22	CCID	CCID	NNP
cord-308110-cco3aq4n	42	23	50	50	CD
cord-308110-cco3aq4n	42	24	)	)	-RRB-
cord-308110-cco3aq4n	42	25	per	per	IN
cord-308110-cco3aq4n	42	26	ml	ml	NN
cord-308110-cco3aq4n	42	27	.	.	.
cord-308110-cco3aq4n	43	1	CVC	CVC	NNP
cord-308110-cco3aq4n	43	2	and	and	CC
cord-308110-cco3aq4n	43	3	maraviroc	maraviroc	NNP
cord-308110-cco3aq4n	43	4	(	(	-LRB-
cord-308110-cco3aq4n	43	5	MRV	MRV	NNP
cord-308110-cco3aq4n	43	6	)	)	-RRB-
cord-308110-cco3aq4n	43	7	were	be	VBD
cord-308110-cco3aq4n	43	8	purchased	purchase	VBN
cord-308110-cco3aq4n	43	9	from	from	IN
cord-308110-cco3aq4n	43	10	MedChemExpress	MedChemExpress	NNP
cord-308110-cco3aq4n	43	11	(	(	-LRB-
cord-308110-cco3aq4n	43	12	Monmouth	Monmouth	NNP
cord-308110-cco3aq4n	43	13	Junction	Junction	NNP
cord-308110-cco3aq4n	43	14	,	,	,
cord-308110-cco3aq4n	43	15	NJ	NJ	NNP
cord-308110-cco3aq4n	43	16	)	)	-RRB-
cord-308110-cco3aq4n	43	17	.	.	.
cord-308110-cco3aq4n	44	1	The	the	DT
cord-308110-cco3aq4n	44	2	nucleotide	nucleotide	JJ
cord-308110-cco3aq4n	44	3	/	/	SYM
cord-308110-cco3aq4n	44	4	nucleoside	nucleoside	NN
cord-308110-cco3aq4n	44	5	analogs	analog	NNS
cord-308110-cco3aq4n	44	6	RDV	RDV	NNP
cord-308110-cco3aq4n	44	7	and	and	CC
cord-308110-cco3aq4n	44	8	favipiravir	favipiravir	NNP
cord-308110-cco3aq4n	44	9	(	(	-LRB-
cord-308110-cco3aq4n	44	10	FPV	FPV	NNP
cord-308110-cco3aq4n	44	11	)	)	-RRB-
cord-308110-cco3aq4n	44	12	were	be	VBD
cord-308110-cco3aq4n	44	13	obtained	obtain	VBN
cord-308110-cco3aq4n	44	14	from	from	IN
cord-308110-cco3aq4n	44	15	ChemScence	ChemScence	NNP
cord-308110-cco3aq4n	44	16	(	(	-LRB-
cord-308110-cco3aq4n	44	17	Monmouth	Monmouth	NNP
cord-308110-cco3aq4n	44	18	Junction	Junction	NNP
cord-308110-cco3aq4n	44	19	,	,	,
cord-308110-cco3aq4n	44	20	NJ	NJ	NNP
cord-308110-cco3aq4n	44	21	)	)	-RRB-
cord-308110-cco3aq4n	44	22	and	and	CC
cord-308110-cco3aq4n	44	23	Selleck	Selleck	NNP
cord-308110-cco3aq4n	44	24	Chemicals	Chemicals	NNP
cord-308110-cco3aq4n	44	25	(	(	-LRB-
cord-308110-cco3aq4n	44	26	Houston	Houston	NNP
cord-308110-cco3aq4n	44	27	,	,	,
cord-308110-cco3aq4n	44	28	TX	TX	NNP
cord-308110-cco3aq4n	44	29	)	)	-RRB-
cord-308110-cco3aq4n	44	30	,	,	,
cord-308110-cco3aq4n	44	31	respectively	respectively	RB
cord-308110-cco3aq4n	44	32	.	.	.
cord-308110-cco3aq4n	45	1	MCP-1	MCP-1	NNP
cord-308110-cco3aq4n	45	2	was	be	VBD
cord-308110-cco3aq4n	45	3	purchased	purchase	VBN
cord-308110-cco3aq4n	45	4	from	from	IN
cord-308110-cco3aq4n	45	5	PetpoTech	PetpoTech	NNP
cord-308110-cco3aq4n	45	6	(	(	-LRB-
cord-308110-cco3aq4n	45	7	Rocky	Rocky	NNP
cord-308110-cco3aq4n	45	8	Hill	Hill	NNP
cord-308110-cco3aq4n	45	9	,	,	,
cord-308110-cco3aq4n	45	10	NJ	NJ	NNP
cord-308110-cco3aq4n	45	11	)	)	-RRB-
cord-308110-cco3aq4n	45	12	.	.	.
cord-308110-cco3aq4n	46	1	MRV	MRV	NNP
cord-308110-cco3aq4n	46	2	is	be	VBZ
cord-308110-cco3aq4n	46	3	the	the	DT
cord-308110-cco3aq4n	46	4	CCR5	CCR5	NNP
cord-308110-cco3aq4n	46	5	antagonist	antagonist	NN
cord-308110-cco3aq4n	46	6	clinically	clinically	RB
cord-308110-cco3aq4n	46	7	approved	approve	VBN
cord-308110-cco3aq4n	46	8	for	for	IN
cord-308110-cco3aq4n	46	9	treatment	treatment	NN
cord-308110-cco3aq4n	46	10	of	of	IN
cord-308110-cco3aq4n	46	11	HIV-1	HIV-1	NNP
cord-308110-cco3aq4n	46	12	infection	infection	NN
cord-308110-cco3aq4n	46	13	(	(	-LRB-
cord-308110-cco3aq4n	46	14	Woollard	Woollard	NNP
cord-308110-cco3aq4n	46	15	and	and	CC
cord-308110-cco3aq4n	46	16	Kanmogne	Kanmogne	NNP
cord-308110-cco3aq4n	46	17	,	,	,
cord-308110-cco3aq4n	46	18	2015	2015	CD
cord-308110-cco3aq4n	46	19	)	)	-RRB-
cord-308110-cco3aq4n	46	20	.	.	.
cord-308110-cco3aq4n	47	1	Except	except	IN
cord-308110-cco3aq4n	47	2	for	for	IN
cord-308110-cco3aq4n	47	3	MCP-1	MCP-1	NNP
cord-308110-cco3aq4n	47	4	,	,	,
cord-308110-cco3aq4n	47	5	these	these	DT
cord-308110-cco3aq4n	47	6	compounds	compound	NNS
cord-308110-cco3aq4n	47	7	were	be	VBD
cord-308110-cco3aq4n	47	8	dissolved	dissolve	VBN
cord-308110-cco3aq4n	47	9	in	in	IN
cord-308110-cco3aq4n	47	10	dimethyl	dimethyl	NN
cord-308110-cco3aq4n	47	11	sulfoxide	sulfoxide	NN
cord-308110-cco3aq4n	47	12	(	(	-LRB-
cord-308110-cco3aq4n	47	13	DMSO	DMSO	NNP
cord-308110-cco3aq4n	47	14	)	)	-RRB-
cord-308110-cco3aq4n	47	15	at	at	IN
cord-308110-cco3aq4n	47	16	a	a	DT
cord-308110-cco3aq4n	47	17	concentration	concentration	NN
cord-308110-cco3aq4n	47	18	of	of	IN
cord-308110-cco3aq4n	47	19	20	20	CD
cord-308110-cco3aq4n	47	20	mM	mm	CD
cord-308110-cco3aq4n	47	21	or	or	CC
cord-308110-cco3aq4n	47	22	higher	high	JJR
cord-308110-cco3aq4n	47	23	to	to	TO
cord-308110-cco3aq4n	47	24	exclude	exclude	VB
cord-308110-cco3aq4n	47	25	the	the	DT
cord-308110-cco3aq4n	47	26	cytotoxicity	cytotoxicity	NN
cord-308110-cco3aq4n	47	27	of	of	IN
cord-308110-cco3aq4n	47	28	DMSO	DMSO	NNP
cord-308110-cco3aq4n	47	29	and	and	CC
cord-308110-cco3aq4n	47	30	stored	store	VBN
cord-308110-cco3aq4n	47	31	at	at	IN
cord-308110-cco3aq4n	47	32	-20	-20	NNP
cord-308110-cco3aq4n	47	33	°	°	NN
cord-308110-cco3aq4n	47	34	C	C	NNP
cord-308110-cco3aq4n	47	35	until	until	IN
cord-308110-cco3aq4n	47	36	use	use	NN
cord-308110-cco3aq4n	47	37	.	.	.
cord-308110-cco3aq4n	48	1	MCP-1	MCP-1	NNP
cord-308110-cco3aq4n	48	2	was	be	VBD
cord-308110-cco3aq4n	48	3	dissolved	dissolve	VBN
cord-308110-cco3aq4n	48	4	in	in	IN
cord-308110-cco3aq4n	48	5	distilled	distilled	JJ
cord-308110-cco3aq4n	48	6	water	water	NN
cord-308110-cco3aq4n	48	7	.	.	.
cord-308110-cco3aq4n	49	1	VeroE6	VeroE6	NNP
cord-308110-cco3aq4n	49	2	/	/	SYM
cord-308110-cco3aq4n	49	3	TMPRSS2	TMPRSS2	NNP
cord-308110-cco3aq4n	49	4	cells	cell	NNS
cord-308110-cco3aq4n	49	5	(	(	-LRB-
cord-308110-cco3aq4n	49	6	2	2	CD
cord-308110-cco3aq4n	49	7	×	×	NN
cord-308110-cco3aq4n	49	8	10	10	CD
cord-308110-cco3aq4n	49	9	4	4	CD
cord-308110-cco3aq4n	49	10	cells	cell	NNS
cord-308110-cco3aq4n	49	11	/	/	SYM
cord-308110-cco3aq4n	49	12	well	well	RB
cord-308110-cco3aq4n	49	13	)	)	-RRB-
cord-308110-cco3aq4n	49	14	were	be	VBD
cord-308110-cco3aq4n	49	15	cultured	culture	VBN
cord-308110-cco3aq4n	49	16	in	in	IN
cord-308110-cco3aq4n	49	17	a	a	DT
cord-308110-cco3aq4n	49	18	96-well	96-well	CD
cord-308110-cco3aq4n	49	19	microtiter	microtiter	NN
cord-308110-cco3aq4n	49	20	plate	plate	NN
cord-308110-cco3aq4n	49	21	and	and	CC
cord-308110-cco3aq4n	49	22	incubated	incubate	VBD
cord-308110-cco3aq4n	49	23	at	at	IN
cord-308110-cco3aq4n	49	24	37	37	CD
cord-308110-cco3aq4n	49	25	°	°	NN
cord-308110-cco3aq4n	49	26	C	c	NN
cord-308110-cco3aq4n	49	27	.	.	.
cord-308110-cco3aq4n	50	1	After	after	IN
cord-308110-cco3aq4n	50	2	24	24	CD
cord-308110-cco3aq4n	50	3	h	h	NN
cord-308110-cco3aq4n	50	4	,	,	,
cord-308110-cco3aq4n	50	5	the	the	DT
cord-308110-cco3aq4n	50	6	cells	cell	NNS
cord-308110-cco3aq4n	50	7	were	be	VBD
cord-308110-cco3aq4n	50	8	mock	mock	JJ
cord-308110-cco3aq4n	50	9	-	-	HYPH
cord-308110-cco3aq4n	50	10	infected	infect	VBN
cord-308110-cco3aq4n	50	11	or	or	CC
cord-308110-cco3aq4n	50	12	infected	infect	VBN
cord-308110-cco3aq4n	50	13	with	with	IN
cord-308110-cco3aq4n	50	14	SARS	SARS	NNP
cord-308110-cco3aq4n	50	15	-	-	HYPH
cord-308110-cco3aq4n	50	16	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	50	17	at	at	IN
cord-308110-cco3aq4n	50	18	a	a	DT
cord-308110-cco3aq4n	50	19	multiplicity	multiplicity	NN
cord-308110-cco3aq4n	50	20	of	of	IN
cord-308110-cco3aq4n	50	21	infection	infection	NN
cord-308110-cco3aq4n	50	22	(	(	-LRB-
cord-308110-cco3aq4n	50	23	MOI	MOI	NNP
cord-308110-cco3aq4n	50	24	)	)	-RRB-
cord-308110-cco3aq4n	50	25	of	of	IN
cord-308110-cco3aq4n	50	26	0.01	0.01	CD
cord-308110-cco3aq4n	50	27	and	and	CC
cord-308110-cco3aq4n	50	28	cultured	culture	VBN
cord-308110-cco3aq4n	50	29	in	in	IN
cord-308110-cco3aq4n	50	30	the	the	DT
cord-308110-cco3aq4n	50	31	absence	absence	NN
cord-308110-cco3aq4n	50	32	or	or	CC
cord-308110-cco3aq4n	50	33	presence	presence	NN
cord-308110-cco3aq4n	50	34	of	of	IN
cord-308110-cco3aq4n	50	35	various	various	JJ
cord-308110-cco3aq4n	50	36	concentrations	concentration	NNS
cord-308110-cco3aq4n	50	37	of	of	IN
cord-308110-cco3aq4n	50	38	test	test	NN
cord-308110-cco3aq4n	50	39	compounds	compound	NNS
cord-308110-cco3aq4n	50	40	.	.	.
cord-308110-cco3aq4n	51	1	After	after	IN
cord-308110-cco3aq4n	51	2	3	3	CD
cord-308110-cco3aq4n	51	3	days	day	NNS
cord-308110-cco3aq4n	51	4	,	,	,
cord-308110-cco3aq4n	51	5	the	the	DT
cord-308110-cco3aq4n	51	6	number	number	NN
cord-308110-cco3aq4n	51	7	of	of	IN
cord-308110-cco3aq4n	51	8	viable	viable	JJ
cord-308110-cco3aq4n	51	9	cells	cell	NNS
cord-308110-cco3aq4n	51	10	was	be	VBD
cord-308110-cco3aq4n	51	11	determined	determine	VBN
cord-308110-cco3aq4n	51	12	by	by	IN
cord-308110-cco3aq4n	51	13	a	a	DT
cord-308110-cco3aq4n	51	14	tetrazolium	tetrazolium	NN
cord-308110-cco3aq4n	51	15	dye	dye	NN
cord-308110-cco3aq4n	51	16	method	method	NN
cord-308110-cco3aq4n	51	17	.	.	.
cord-308110-cco3aq4n	52	1	Briefly	briefly	RB
cord-308110-cco3aq4n	52	2	,	,	,
cord-308110-cco3aq4n	52	3	100	100	CD
cord-308110-cco3aq4n	52	4	μl	μl	NN
cord-308110-cco3aq4n	52	5	of	of	IN
cord-308110-cco3aq4n	52	6	culture	culture	NN
cord-308110-cco3aq4n	52	7	medium	medium	NN
cord-308110-cco3aq4n	52	8	was	be	VBD
cord-308110-cco3aq4n	52	9	removed	remove	VBN
cord-308110-cco3aq4n	52	10	from	from	IN
cord-308110-cco3aq4n	52	11	each	each	DT
cord-308110-cco3aq4n	52	12	well	well	RB
cord-308110-cco3aq4n	52	13	,	,	,
cord-308110-cco3aq4n	52	14	and	and	CC
cord-308110-cco3aq4n	52	15	10	10	CD
cord-308110-cco3aq4n	52	16	μl	μl	NN
cord-308110-cco3aq4n	52	17	of	of	IN
cord-308110-cco3aq4n	52	18	water	water	NN
cord-308110-cco3aq4n	52	19	-	-	HYPH
cord-308110-cco3aq4n	52	20	soluble	soluble	JJ
cord-308110-cco3aq4n	52	21	tetrazolium	tetrazolium	NN
cord-308110-cco3aq4n	52	22	dye	dye	NN
cord-308110-cco3aq4n	52	23	solution	solution	NN
cord-308110-cco3aq4n	52	24	(	(	-LRB-
cord-308110-cco3aq4n	52	25	Dojindo	Dojindo	NNP
cord-308110-cco3aq4n	52	26	,	,	,
cord-308110-cco3aq4n	52	27	Kumamoto	Kumamoto	NNP
cord-308110-cco3aq4n	52	28	,	,	,
cord-308110-cco3aq4n	52	29	Japan	Japan	NNP
cord-308110-cco3aq4n	52	30	)	)	-RRB-
cord-308110-cco3aq4n	52	31	was	be	VBD
cord-308110-cco3aq4n	52	32	added	add	VBN
cord-308110-cco3aq4n	52	33	.	.	.
cord-308110-cco3aq4n	53	1	After	after	IN
cord-308110-cco3aq4n	53	2	incubating	incubate	VBG
cord-308110-cco3aq4n	53	3	at	at	IN
cord-308110-cco3aq4n	53	4	37	37	CD
cord-308110-cco3aq4n	53	5	°	°	NN
cord-308110-cco3aq4n	53	6	C	c	NN
cord-308110-cco3aq4n	53	7	for	for	IN
cord-308110-cco3aq4n	53	8	2	2	CD
cord-308110-cco3aq4n	53	9	h	h	NN
cord-308110-cco3aq4n	53	10	,	,	,
cord-308110-cco3aq4n	53	11	100	100	CD
cord-308110-cco3aq4n	53	12	μl	μl	NN
cord-308110-cco3aq4n	53	13	of	of	IN
cord-308110-cco3aq4n	53	14	isopropanol	isopropanol	NN
cord-308110-cco3aq4n	53	15	acidified	acidify	VBN
cord-308110-cco3aq4n	53	16	with	with	IN
cord-308110-cco3aq4n	53	17	hydrochloric	hydrochloric	JJ
cord-308110-cco3aq4n	53	18	acid	acid	NN
cord-308110-cco3aq4n	53	19	was	be	VBD
cord-308110-cco3aq4n	53	20	added	add	VBN
cord-308110-cco3aq4n	53	21	,	,	,
cord-308110-cco3aq4n	53	22	and	and	CC
cord-308110-cco3aq4n	53	23	the	the	DT
cord-308110-cco3aq4n	53	24	absorbance	absorbance	NN
cord-308110-cco3aq4n	53	25	was	be	VBD
cord-308110-cco3aq4n	53	26	read	read	VBN
cord-308110-cco3aq4n	53	27	at	at	IN
cord-308110-cco3aq4n	53	28	two	two	CD
cord-308110-cco3aq4n	53	29	wavelengths	wavelength	NNS
cord-308110-cco3aq4n	53	30	(	(	-LRB-
cord-308110-cco3aq4n	53	31	450	450	CD
cord-308110-cco3aq4n	53	32	and	and	CC
cord-308110-cco3aq4n	53	33	620	620	CD
cord-308110-cco3aq4n	53	34	nm	nm	NN
cord-308110-cco3aq4n	53	35	)	)	-RRB-
cord-308110-cco3aq4n	53	36	with	with	IN
cord-308110-cco3aq4n	53	37	a	a	DT
cord-308110-cco3aq4n	53	38	microplate	microplate	JJ
cord-308110-cco3aq4n	53	39	reader	reader	NN
cord-308110-cco3aq4n	53	40	(	(	-LRB-
cord-308110-cco3aq4n	53	41	Pauwels	Pauwels	NNP
cord-308110-cco3aq4n	53	42	et	et	NNP
cord-308110-cco3aq4n	53	43	al	al	NNP
cord-308110-cco3aq4n	53	44	.	.	NNP
cord-308110-cco3aq4n	53	45	,	,	,
cord-308110-cco3aq4n	53	46	1988	1988	CD
cord-308110-cco3aq4n	53	47	)	)	-RRB-
cord-308110-cco3aq4n	53	48	.	.	.
cord-308110-cco3aq4n	54	1	The	the	DT
cord-308110-cco3aq4n	54	2	50	50	CD
cord-308110-cco3aq4n	54	3	%	%	NN
cord-308110-cco3aq4n	54	4	effective	effective	JJ
cord-308110-cco3aq4n	54	5	concentration	concentration	NN
cord-308110-cco3aq4n	54	6	(	(	-LRB-
cord-308110-cco3aq4n	54	7	EC	EC	NNP
cord-308110-cco3aq4n	54	8	50	50	CD
cord-308110-cco3aq4n	54	9	)	)	-RRB-
cord-308110-cco3aq4n	54	10	of	of	IN
cord-308110-cco3aq4n	54	11	each	each	DT
cord-308110-cco3aq4n	54	12	compound	compound	NN
cord-308110-cco3aq4n	54	13	was	be	VBD
cord-308110-cco3aq4n	54	14	calculated	calculate	VBN
cord-308110-cco3aq4n	54	15	from	from	IN
cord-308110-cco3aq4n	54	16	a	a	DT
cord-308110-cco3aq4n	54	17	dose	dose	NN
cord-308110-cco3aq4n	54	18	-	-	HYPH
cord-308110-cco3aq4n	54	19	dependent	dependent	JJ
cord-308110-cco3aq4n	54	20	curve	curve	NN
cord-308110-cco3aq4n	54	21	based	base	VBN
cord-308110-cco3aq4n	54	22	on	on	IN
cord-308110-cco3aq4n	54	23	the	the	DT
cord-308110-cco3aq4n	54	24	viability	viability	NN
cord-308110-cco3aq4n	54	25	of	of	IN
cord-308110-cco3aq4n	54	26	infected	infected	JJ
cord-308110-cco3aq4n	54	27	and	and	CC
cord-308110-cco3aq4n	54	28	uninfected	uninfected	JJ
cord-308110-cco3aq4n	54	29	cells	cell	NNS
cord-308110-cco3aq4n	54	30	.	.	.
cord-308110-cco3aq4n	55	1	All	all	DT
cord-308110-cco3aq4n	55	2	experiments	experiment	NNS
cord-308110-cco3aq4n	55	3	using	use	VBG
cord-308110-cco3aq4n	55	4	SARS	SARS	NNP
cord-308110-cco3aq4n	55	5	-	-	HYPH
cord-308110-cco3aq4n	55	6	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	55	7	were	be	VBD
cord-308110-cco3aq4n	55	8	conducted	conduct	VBN
cord-308110-cco3aq4n	55	9	in	in	IN
cord-308110-cco3aq4n	55	10	biosafety	biosafety	NN
cord-308110-cco3aq4n	55	11	level	level	NN
cord-308110-cco3aq4n	55	12	3	3	CD
cord-308110-cco3aq4n	55	13	(	(	-LRB-
cord-308110-cco3aq4n	55	14	BSL3	BSL3	NNP
cord-308110-cco3aq4n	55	15	)	)	-RRB-
cord-308110-cco3aq4n	55	16	facilities	facility	NNS
cord-308110-cco3aq4n	55	17	of	of	IN
cord-308110-cco3aq4n	55	18	Kagoshima	Kagoshima	NNP
cord-308110-cco3aq4n	55	19	University	University	NNP
cord-308110-cco3aq4n	55	20	.	.	.
cord-308110-cco3aq4n	56	1	For	for	IN
cord-308110-cco3aq4n	56	2	immunofluorescence	immunofluorescence	NN
cord-308110-cco3aq4n	56	3	microscopy	microscopy	NNS
cord-308110-cco3aq4n	56	4	,	,	,
cord-308110-cco3aq4n	56	5	Vero	Vero	NNP
cord-308110-cco3aq4n	56	6	cells	cell	NNS
cord-308110-cco3aq4n	56	7	(	(	-LRB-
cord-308110-cco3aq4n	56	8	2	2	CD
cord-308110-cco3aq4n	56	9	×	×	NN
cord-308110-cco3aq4n	56	10	10	10	CD
cord-308110-cco3aq4n	56	11	4	4	CD
cord-308110-cco3aq4n	56	12	cells	cell	NNS
cord-308110-cco3aq4n	56	13	/	/	SYM
cord-308110-cco3aq4n	56	14	well	well	RB
cord-308110-cco3aq4n	56	15	)	)	-RRB-
cord-308110-cco3aq4n	56	16	were	be	VBD
cord-308110-cco3aq4n	56	17	cultured	culture	VBN
cord-308110-cco3aq4n	56	18	in	in	IN
cord-308110-cco3aq4n	56	19	a	a	DT
cord-308110-cco3aq4n	56	20	microtiter	microtiter	NN
cord-308110-cco3aq4n	56	21	plate	plate	NN
cord-308110-cco3aq4n	56	22	and	and	CC
cord-308110-cco3aq4n	56	23	incubated	incubate	VBN
cord-308110-cco3aq4n	56	24	.	.	.
cord-308110-cco3aq4n	57	1	After	after	IN
cord-308110-cco3aq4n	57	2	24	24	CD
cord-308110-cco3aq4n	57	3	h	h	NN
cord-308110-cco3aq4n	57	4	,	,	,
cord-308110-cco3aq4n	57	5	the	the	DT
cord-308110-cco3aq4n	57	6	cells	cell	NNS
cord-308110-cco3aq4n	57	7	were	be	VBD
cord-308110-cco3aq4n	57	8	infected	infect	VBN
cord-308110-cco3aq4n	57	9	with	with	IN
cord-308110-cco3aq4n	57	10	SARS	SARS	NNP
cord-308110-cco3aq4n	57	11	-	-	HYPH
cord-308110-cco3aq4n	57	12	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	57	13	at	at	IN
cord-308110-cco3aq4n	57	14	a	a	DT
cord-308110-cco3aq4n	57	15	MOI	moi	NN
cord-308110-cco3aq4n	57	16	of	of	IN
cord-308110-cco3aq4n	57	17	0.1	0.1	CD
cord-308110-cco3aq4n	57	18	in	in	IN
cord-308110-cco3aq4n	57	19	the	the	DT
cord-308110-cco3aq4n	57	20	absence	absence	NN
cord-308110-cco3aq4n	57	21	of	of	IN
cord-308110-cco3aq4n	57	22	CVC	CVC	NNP
cord-308110-cco3aq4n	57	23	and	and	CC
cord-308110-cco3aq4n	57	24	incubated	incubate	VBN
cord-308110-cco3aq4n	57	25	.	.	.
cord-308110-cco3aq4n	58	1	After	after	IN
cord-308110-cco3aq4n	58	2	2	2	CD
cord-308110-cco3aq4n	58	3	h	h	NN
cord-308110-cco3aq4n	58	4	,	,	,
cord-308110-cco3aq4n	58	5	the	the	DT
cord-308110-cco3aq4n	58	6	cells	cell	NNS
cord-308110-cco3aq4n	58	7	were	be	VBD
cord-308110-cco3aq4n	58	8	washed	wash	VBN
cord-308110-cco3aq4n	58	9	with	with	IN
cord-308110-cco3aq4n	58	10	phosphate	phosphate	NN
cord-308110-cco3aq4n	58	11	buffered	buffer	VBN
cord-308110-cco3aq4n	58	12	saline	saline	NN
cord-308110-cco3aq4n	58	13	(	(	-LRB-
cord-308110-cco3aq4n	58	14	PBS	PBS	NNP
cord-308110-cco3aq4n	58	15	)	)	-RRB-
cord-308110-cco3aq4n	58	16	to	to	TO
cord-308110-cco3aq4n	58	17	remove	remove	VB
cord-308110-cco3aq4n	58	18	unadsorbed	unadsorbed	JJ
cord-308110-cco3aq4n	58	19	virus	virus	NN
cord-308110-cco3aq4n	58	20	particles	particle	NNS
cord-308110-cco3aq4n	58	21	and	and	CC
cord-308110-cco3aq4n	58	22	further	further	RB
cord-308110-cco3aq4n	58	23	incubated	incubate	VBN
cord-308110-cco3aq4n	58	24	in	in	IN
cord-308110-cco3aq4n	58	25	the	the	DT
cord-308110-cco3aq4n	58	26	absence	absence	NN
cord-308110-cco3aq4n	58	27	or	or	CC
cord-308110-cco3aq4n	58	28	presence	presence	NN
cord-308110-cco3aq4n	58	29	of	of	IN
cord-308110-cco3aq4n	58	30	40	40	CD
cord-308110-cco3aq4n	58	31	μM	μm	CD
cord-308110-cco3aq4n	58	32	CVC	CVC	NNP
cord-308110-cco3aq4n	58	33	.	.	.
cord-308110-cco3aq4n	59	1	After	after	IN
cord-308110-cco3aq4n	59	2	3	3	CD
cord-308110-cco3aq4n	59	3	days	day	NNS
cord-308110-cco3aq4n	59	4	,	,	,
cord-308110-cco3aq4n	59	5	the	the	DT
cord-308110-cco3aq4n	59	6	cells	cell	NNS
cord-308110-cco3aq4n	59	7	were	be	VBD
cord-308110-cco3aq4n	59	8	fixed	fix	VBN
cord-308110-cco3aq4n	59	9	with	with	IN
cord-308110-cco3aq4n	59	10	4	4	CD
cord-308110-cco3aq4n	59	11	%	%	NN
cord-308110-cco3aq4n	59	12	paraformaldehyde	paraformaldehyde	NNP
cord-308110-cco3aq4n	59	13	in	in	IN
cord-308110-cco3aq4n	59	14	PBS	PBS	NNP
cord-308110-cco3aq4n	59	15	for	for	IN
cord-308110-cco3aq4n	59	16	15	15	CD
cord-308110-cco3aq4n	59	17	min	min	NN
cord-308110-cco3aq4n	59	18	.	.	.
cord-308110-cco3aq4n	60	1	Then	then	RB
cord-308110-cco3aq4n	60	2	,	,	,
cord-308110-cco3aq4n	60	3	the	the	DT
cord-308110-cco3aq4n	60	4	solution	solution	NN
cord-308110-cco3aq4n	60	5	was	be	VBD
cord-308110-cco3aq4n	60	6	removed	remove	VBN
cord-308110-cco3aq4n	60	7	,	,	,
cord-308110-cco3aq4n	60	8	and	and	CC
cord-308110-cco3aq4n	60	9	the	the	DT
cord-308110-cco3aq4n	60	10	cells	cell	NNS
cord-308110-cco3aq4n	60	11	were	be	VBD
cord-308110-cco3aq4n	60	12	washed	wash	VBN
cord-308110-cco3aq4n	60	13	with	with	IN
cord-308110-cco3aq4n	60	14	PBS	PBS	NNP
cord-308110-cco3aq4n	60	15	and	and	CC
cord-308110-cco3aq4n	60	16	permeabilized	permeabilize	VBN
cord-308110-cco3aq4n	60	17	with	with	IN
cord-308110-cco3aq4n	60	18	methanol	methanol	NN
cord-308110-cco3aq4n	60	19	.	.	.
cord-308110-cco3aq4n	61	1	After	after	IN
cord-308110-cco3aq4n	61	2	washing	wash	VBG
cord-308110-cco3aq4n	61	3	with	with	IN
cord-308110-cco3aq4n	61	4	PBS	PBS	NNP
cord-308110-cco3aq4n	61	5	,	,	,
cord-308110-cco3aq4n	61	6	the	the	DT
cord-308110-cco3aq4n	61	7	cells	cell	NNS
cord-308110-cco3aq4n	61	8	were	be	VBD
cord-308110-cco3aq4n	61	9	treated	treat	VBN
cord-308110-cco3aq4n	61	10	with	with	IN
cord-308110-cco3aq4n	61	11	PBS	PBS	NNP
cord-308110-cco3aq4n	61	12	containing	contain	VBG
cord-308110-cco3aq4n	61	13	1	1	CD
cord-308110-cco3aq4n	61	14	%	%	NN
cord-308110-cco3aq4n	61	15	bovine	bovine	JJ
cord-308110-cco3aq4n	61	16	serum	serum	NN
cord-308110-cco3aq4n	61	17	albumin	albumin	NN
cord-308110-cco3aq4n	61	18	(	(	-LRB-
cord-308110-cco3aq4n	61	19	Sigma	Sigma	NNP
cord-308110-cco3aq4n	61	20	-	-	HYPH
cord-308110-cco3aq4n	61	21	Aldrich	Aldrich	NNP
cord-308110-cco3aq4n	61	22	,	,	,
cord-308110-cco3aq4n	61	23	St.	St.	NNP
cord-308110-cco3aq4n	61	24	Louis	Louis	NNP
cord-308110-cco3aq4n	61	25	,	,	,
cord-308110-cco3aq4n	61	26	MO	MO	NNP
cord-308110-cco3aq4n	61	27	)	)	-RRB-
cord-308110-cco3aq4n	61	28	and	and	CC
cord-308110-cco3aq4n	61	29	0.1	0.1	CD
cord-308110-cco3aq4n	61	30	%	%	NN
cord-308110-cco3aq4n	61	31	Tween	Tween	NNP
cord-308110-cco3aq4n	61	32	20	20	CD
cord-308110-cco3aq4n	62	1	(	(	-LRB-
cord-308110-cco3aq4n	62	2	Fujifilm	Fujifilm	NNP
cord-308110-cco3aq4n	62	3	Wako	Wako	NNP
cord-308110-cco3aq4n	62	4	,	,	,
cord-308110-cco3aq4n	62	5	Osaka	Osaka	NNP
cord-308110-cco3aq4n	62	6	,	,	,
cord-308110-cco3aq4n	62	7	Japan	Japan	NNP
cord-308110-cco3aq4n	62	8	)	)	-RRB-
cord-308110-cco3aq4n	62	9	and	and	CC
cord-308110-cco3aq4n	62	10	incubated	incubate	VBN
cord-308110-cco3aq4n	62	11	overnight	overnight	RB
cord-308110-cco3aq4n	62	12	at	at	IN
cord-308110-cco3aq4n	62	13	4	4	CD
cord-308110-cco3aq4n	62	14	°	°	NN
cord-308110-cco3aq4n	62	15	C	c	NN
cord-308110-cco3aq4n	62	16	with	with	IN
cord-308110-cco3aq4n	62	17	an	an	DT
cord-308110-cco3aq4n	62	18	anti	anti	JJ
cord-308110-cco3aq4n	62	19	-	-	JJ
cord-308110-cco3aq4n	62	20	SARS	SARS	NNP
cord-308110-cco3aq4n	62	21	-	-	HYPH
cord-308110-cco3aq4n	62	22	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	62	23	nucleocapsid	nucleocapsid	NN
cord-308110-cco3aq4n	62	24	rabbit	rabbit	NN
cord-308110-cco3aq4n	62	25	antibody	antibody	NN
cord-308110-cco3aq4n	62	26	(	(	-LRB-
cord-308110-cco3aq4n	62	27	GeneTex	GeneTex	NNP
cord-308110-cco3aq4n	62	28	,	,	,
cord-308110-cco3aq4n	62	29	Irvine	Irvine	NNP
cord-308110-cco3aq4n	62	30	,	,	,
cord-308110-cco3aq4n	62	31	CA	CA	NNP
cord-308110-cco3aq4n	62	32	)	)	-RRB-
cord-308110-cco3aq4n	62	33	.	.	.
cord-308110-cco3aq4n	63	1	After	after	IN
cord-308110-cco3aq4n	63	2	incubation	incubation	NN
cord-308110-cco3aq4n	63	3	,	,	,
cord-308110-cco3aq4n	63	4	the	the	DT
cord-308110-cco3aq4n	63	5	cells	cell	NNS
cord-308110-cco3aq4n	63	6	were	be	VBD
cord-308110-cco3aq4n	63	7	washed	wash	VBN
cord-308110-cco3aq4n	63	8	with	with	IN
cord-308110-cco3aq4n	63	9	PBS	PBS	NNP
cord-308110-cco3aq4n	63	10	and	and	CC
cord-308110-cco3aq4n	63	11	stained	stain	VBN
cord-308110-cco3aq4n	63	12	with	with	IN
cord-308110-cco3aq4n	63	13	the	the	DT
cord-308110-cco3aq4n	63	14	secondary	secondary	JJ
cord-308110-cco3aq4n	63	15	antibody	antibody	NN
cord-308110-cco3aq4n	63	16	goat	goat	NN
cord-308110-cco3aq4n	63	17	anti	anti	JJ
cord-308110-cco3aq4n	63	18	-	-	JJ
cord-308110-cco3aq4n	63	19	rabbit	rabbit	JJ
cord-308110-cco3aq4n	63	20	IgG	igg	NN
cord-308110-cco3aq4n	63	21	H&L	H&L	NNP
cord-308110-cco3aq4n	64	1	(	(	-LRB-
cord-308110-cco3aq4n	64	2	Alexa	Alexa	NNP
cord-308110-cco3aq4n	64	3	Fluoro	Fluoro	NNP
cord-308110-cco3aq4n	65	1	®	®	LS
cord-308110-cco3aq4n	65	2	488	488	CD
cord-308110-cco3aq4n	65	3	;	;	:
cord-308110-cco3aq4n	65	4	Abcam	Abcam	NNP
cord-308110-cco3aq4n	65	5	,	,	,
cord-308110-cco3aq4n	65	6	Cambridge	Cambridge	NNP
cord-308110-cco3aq4n	65	7	,	,	,
cord-308110-cco3aq4n	65	8	UK	UK	NNP
cord-308110-cco3aq4n	65	9	)	)	-RRB-
cord-308110-cco3aq4n	65	10	.	.	.
cord-308110-cco3aq4n	66	1	The	the	DT
cord-308110-cco3aq4n	66	2	cells	cell	NNS
cord-308110-cco3aq4n	66	3	were	be	VBD
cord-308110-cco3aq4n	66	4	washed	wash	VBN
cord-308110-cco3aq4n	66	5	with	with	IN
cord-308110-cco3aq4n	66	6	PBS	PBS	NNP
cord-308110-cco3aq4n	66	7	,	,	,
cord-308110-cco3aq4n	66	8	stained	stain	VBN
cord-308110-cco3aq4n	66	9	with	with	IN
cord-308110-cco3aq4n	66	10	4',6-diamidino-2-phenylindole	4',6-diamidino-2-phenylindole	CD
cord-308110-cco3aq4n	66	11	(	(	-LRB-
cord-308110-cco3aq4n	66	12	DAPI	DAPI	NNP
cord-308110-cco3aq4n	66	13	;	;	:
cord-308110-cco3aq4n	66	14	Bio	Bio	NNP
cord-308110-cco3aq4n	66	15	-	-	HYPH
cord-308110-cco3aq4n	66	16	Rad	Rad	NNP
cord-308110-cco3aq4n	66	17	,	,	,
cord-308110-cco3aq4n	66	18	Hercules	Hercules	NNP
cord-308110-cco3aq4n	66	19	,	,	,
cord-308110-cco3aq4n	66	20	CA	CA	NNP
cord-308110-cco3aq4n	66	21	)	)	-RRB-
cord-308110-cco3aq4n	66	22	,	,	,
cord-308110-cco3aq4n	66	23	and	and	CC
cord-308110-cco3aq4n	66	24	observed	observe	VBD
cord-308110-cco3aq4n	66	25	under	under	IN
cord-308110-cco3aq4n	66	26	a	a	DT
cord-308110-cco3aq4n	66	27	fluorescent	fluorescent	JJ
cord-308110-cco3aq4n	66	28	microscope	microscope	NN
cord-308110-cco3aq4n	66	29	(	(	-LRB-
cord-308110-cco3aq4n	66	30	BZ	BZ	NNP
cord-308110-cco3aq4n	66	31	-	-	HYPH
cord-308110-cco3aq4n	66	32	X800	X800	NNP
cord-308110-cco3aq4n	66	33	;	;	:
cord-308110-cco3aq4n	66	34	Keyence	Keyence	NNP
cord-308110-cco3aq4n	66	35	,	,	,
cord-308110-cco3aq4n	66	36	Osaka	Osaka	NNP
cord-308110-cco3aq4n	66	37	,	,	,
cord-308110-cco3aq4n	66	38	Japan	Japan	NNP
cord-308110-cco3aq4n	66	39	)	)	-RRB-
cord-308110-cco3aq4n	66	40	.	.	.
cord-308110-cco3aq4n	67	1	The	the	DT
cord-308110-cco3aq4n	67	2	inhibitory	inhibitory	JJ
cord-308110-cco3aq4n	67	3	effect	effect	NN
cord-308110-cco3aq4n	67	4	of	of	IN
cord-308110-cco3aq4n	67	5	compounds	compound	NNS
cord-308110-cco3aq4n	67	6	on	on	IN
cord-308110-cco3aq4n	67	7	SARS	SARS	NNP
cord-308110-cco3aq4n	67	8	-	-	HYPH
cord-308110-cco3aq4n	67	9	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	67	10	replication	replication	NN
cord-308110-cco3aq4n	67	11	was	be	VBD
cord-308110-cco3aq4n	67	12	also	also	RB
cord-308110-cco3aq4n	67	13	evaluated	evaluate	VBN
cord-308110-cco3aq4n	67	14	by	by	IN
cord-308110-cco3aq4n	67	15	the	the	DT
cord-308110-cco3aq4n	67	16	viral	viral	JJ
cord-308110-cco3aq4n	67	17	RNA	RNA	NNP
cord-308110-cco3aq4n	67	18	levels	level	NNS
cord-308110-cco3aq4n	67	19	in	in	IN
cord-308110-cco3aq4n	67	20	culture	culture	NN
cord-308110-cco3aq4n	67	21	supernatants	supernatant	NNS
cord-308110-cco3aq4n	67	22	of	of	IN
cord-308110-cco3aq4n	67	23	the	the	DT
cord-308110-cco3aq4n	67	24	infected	infected	JJ
cord-308110-cco3aq4n	67	25	cells	cell	NNS
cord-308110-cco3aq4n	67	26	.	.	.
cord-308110-cco3aq4n	68	1	VeroE6	VeroE6	NNP
cord-308110-cco3aq4n	68	2	/	/	SYM
cord-308110-cco3aq4n	68	3	TMPRSS2	TMPRSS2	NNP
cord-308110-cco3aq4n	68	4	cells	cell	NNS
cord-308110-cco3aq4n	68	5	were	be	VBD
cord-308110-cco3aq4n	68	6	infected	infect	VBN
cord-308110-cco3aq4n	68	7	with	with	IN
cord-308110-cco3aq4n	68	8	the	the	DT
cord-308110-cco3aq4n	68	9	virus	virus	NN
cord-308110-cco3aq4n	68	10	and	and	CC
cord-308110-cco3aq4n	68	11	incubated	incubate	VBN
cord-308110-cco3aq4n	68	12	for	for	IN
cord-308110-cco3aq4n	68	13	3	3	CD
cord-308110-cco3aq4n	68	14	days	day	NNS
cord-308110-cco3aq4n	68	15	in	in	IN
cord-308110-cco3aq4n	68	16	the	the	DT
cord-308110-cco3aq4n	68	17	absence	absence	NN
cord-308110-cco3aq4n	68	18	or	or	CC
cord-308110-cco3aq4n	68	19	presence	presence	NN
cord-308110-cco3aq4n	68	20	of	of	IN
cord-308110-cco3aq4n	68	21	test	test	NN
cord-308110-cco3aq4n	68	22	compounds	compound	NNS
cord-308110-cco3aq4n	68	23	,	,	,
cord-308110-cco3aq4n	68	24	as	as	IN
cord-308110-cco3aq4n	68	25	described	describe	VBN
cord-308110-cco3aq4n	68	26	above	above	RB
cord-308110-cco3aq4n	68	27	.	.	.
cord-308110-cco3aq4n	69	1	Ten	ten	CD
cord-308110-cco3aq4n	69	2	μl	μl	IN
cord-308110-cco3aq4n	69	3	of	of	IN
cord-308110-cco3aq4n	69	4	each	each	DT
cord-308110-cco3aq4n	69	5	culture	culture	NN
cord-308110-cco3aq4n	69	6	supernatant	supernatant	JJ
cord-308110-cco3aq4n	69	7	was	be	VBD
cord-308110-cco3aq4n	69	8	mixed	mix	VBN
cord-308110-cco3aq4n	69	9	with	with	IN
cord-308110-cco3aq4n	69	10	10	10	CD
cord-308110-cco3aq4n	69	11	μl	μl	NN
cord-308110-cco3aq4n	69	12	of	of	IN
cord-308110-cco3aq4n	69	13	SideStep	SideStep	NNP
cord-308110-cco3aq4n	69	14	Lysis	Lysis	NNP
cord-308110-cco3aq4n	69	15	and	and	CC
cord-308110-cco3aq4n	69	16	Stabilization	Stabilization	NNP
cord-308110-cco3aq4n	69	17	Buffer	Buffer	NNP
cord-308110-cco3aq4n	69	18	(	(	-LRB-
cord-308110-cco3aq4n	69	19	Agilent	Agilent	NNP
cord-308110-cco3aq4n	69	20	Technologies	Technologies	NNP
cord-308110-cco3aq4n	69	21	,	,	,
cord-308110-cco3aq4n	69	22	Santa	Santa	NNP
cord-308110-cco3aq4n	69	23	Clara	Clara	NNP
cord-308110-cco3aq4n	69	24	,	,	,
cord-308110-cco3aq4n	69	25	CA	CA	NNP
cord-308110-cco3aq4n	69	26	)	)	-RRB-
cord-308110-cco3aq4n	69	27	and	and	CC
cord-308110-cco3aq4n	69	28	diluted	dilute	VBN
cord-308110-cco3aq4n	69	29	with	with	IN
cord-308110-cco3aq4n	69	30	80	80	CD
cord-308110-cco3aq4n	69	31	μl	μl	NN
cord-308110-cco3aq4n	69	32	of	of	IN
cord-308110-cco3aq4n	69	33	distilled	distilled	JJ
cord-308110-cco3aq4n	69	34	water	water	NN
cord-308110-cco3aq4n	69	35	.	.	.
cord-308110-cco3aq4n	70	1	The	the	DT
cord-308110-cco3aq4n	70	2	amount	amount	NN
cord-308110-cco3aq4n	70	3	of	of	IN
cord-308110-cco3aq4n	70	4	viral	viral	JJ
cord-308110-cco3aq4n	70	5	RNA	RNA	NNP
cord-308110-cco3aq4n	70	6	was	be	VBD
cord-308110-cco3aq4n	70	7	measured	measure	VBN
cord-308110-cco3aq4n	70	8	by	by	IN
cord-308110-cco3aq4n	70	9	real	real	JJ
cord-308110-cco3aq4n	70	10	-	-	HYPH
cord-308110-cco3aq4n	70	11	time	time	NN
cord-308110-cco3aq4n	70	12	reverse	reverse	NN
cord-308110-cco3aq4n	70	13	transcription	transcription	NN
cord-308110-cco3aq4n	70	14	polymerase	polymerase	NN
cord-308110-cco3aq4n	70	15	chain	chain	NN
cord-308110-cco3aq4n	70	16	reaction	reaction	NN
cord-308110-cco3aq4n	70	17	(	(	-LRB-
cord-308110-cco3aq4n	70	18	RT	RT	NNP
cord-308110-cco3aq4n	70	19	-	-	HYPH
cord-308110-cco3aq4n	70	20	PCR	PCR	NNP
cord-308110-cco3aq4n	70	21	)	)	-RRB-
cord-308110-cco3aq4n	70	22	using	use	VBG
cord-308110-cco3aq4n	70	23	TaqMan	TaqMan	NNP
cord-308110-cco3aq4n	70	24	Gene	Gene	NNP
cord-308110-cco3aq4n	70	25	Expression	Expression	NNP
cord-308110-cco3aq4n	70	26	Cells	cell	NNS
cord-308110-cco3aq4n	70	27	-	-	HYPH
cord-308110-cco3aq4n	70	28	to	to	IN
cord-308110-cco3aq4n	70	29	-	-	HYPH
cord-308110-cco3aq4n	70	30	CT	CT	NNP
cord-308110-cco3aq4n	70	31	TM	TM	NNP
cord-308110-cco3aq4n	70	32	Kit	kit	NN
cord-308110-cco3aq4n	70	33	(	(	-LRB-
cord-308110-cco3aq4n	70	34	Thermo	Thermo	NNP
cord-308110-cco3aq4n	70	35	Fisher	Fisher	NNP
cord-308110-cco3aq4n	70	36	Scientific	Scientific	NNP
cord-308110-cco3aq4n	70	37	,	,	,
cord-308110-cco3aq4n	70	38	Waltham	Waltham	NNP
cord-308110-cco3aq4n	70	39	,	,	,
cord-308110-cco3aq4n	70	40	MA	MA	NNP
cord-308110-cco3aq4n	70	41	)	)	-RRB-
cord-308110-cco3aq4n	70	42	,	,	,
cord-308110-cco3aq4n	70	43	according	accord	VBG
cord-308110-cco3aq4n	70	44	to	to	IN
cord-308110-cco3aq4n	70	45	the	the	DT
cord-308110-cco3aq4n	70	46	manufacturer	manufacturer	NN
cord-308110-cco3aq4n	70	47	's	's	POS
cord-308110-cco3aq4n	70	48	protocol	protocol	NN
cord-308110-cco3aq4n	70	49	except	except	IN
cord-308110-cco3aq4n	70	50	for	for	IN
cord-308110-cco3aq4n	70	51	its	-PRON-	PRP$
cord-308110-cco3aq4n	70	52	cell	cell	NN
cord-308110-cco3aq4n	70	53	lysis	lysis	NN
cord-308110-cco3aq4n	70	54	step	step	NN
cord-308110-cco3aq4n	70	55	.	.	.
cord-308110-cco3aq4n	71	1	The	the	DT
cord-308110-cco3aq4n	71	2	primer	primer	NN
cord-308110-cco3aq4n	71	3	pair	pair	NN
cord-308110-cco3aq4n	71	4	5'-AAATTTTGGGGACCAGGAAC-3	5'-aaattttggggaccaggaac-3	CD
cord-308110-cco3aq4n	71	5	'	'	''
cord-308110-cco3aq4n	71	6	and	and	CC
cord-308110-cco3aq4n	71	7	5'-TGGCAGCTGTGTAGGTCAAC-3	5'-TGGCAGCTGTGTAGGTCAAC-3	NNP
cord-308110-cco3aq4n	71	8	'	'	''
cord-308110-cco3aq4n	71	9	and	and	CC
cord-308110-cco3aq4n	71	10	the	the	DT
cord-308110-cco3aq4n	71	11	probe	probe	NN
cord-308110-cco3aq4n	71	12	5'-FAM	5'-fam	CD
cord-308110-cco3aq4n	71	13	-	-	HYPH
cord-308110-cco3aq4n	71	14	ATGTCGCGCATTGGCATGGA	ATGTCGCGCATTGGCATGGA	NNP
cord-308110-cco3aq4n	71	15	-	-	HYPH
cord-308110-cco3aq4n	71	16	TAMRA-3	TAMRA-3	NNP
cord-308110-cco3aq4n	71	17	'	'	''
cord-308110-cco3aq4n	71	18	were	be	VBD
cord-308110-cco3aq4n	71	19	used	use	VBN
cord-308110-cco3aq4n	71	20	for	for	IN
cord-308110-cco3aq4n	71	21	real	real	JJ
cord-308110-cco3aq4n	71	22	-	-	HYPH
cord-308110-cco3aq4n	71	23	time	time	NN
cord-308110-cco3aq4n	71	24	PCR	PCR	NNP
cord-308110-cco3aq4n	71	25	reat	reat	JJ
cord-308110-cco3aq4n	71	26	-	-	HYPH
cord-308110-cco3aq4n	71	27	time	time	NN
cord-308110-cco3aq4n	71	28	RT	RT	NNP
cord-308110-cco3aq4n	71	29	-	-	HYPH
cord-308110-cco3aq4n	71	30	PCR	PCR	NNP
cord-308110-cco3aq4n	71	31	to	to	TO
cord-308110-cco3aq4n	71	32	determine	determine	VB
cord-308110-cco3aq4n	71	33	the	the	DT
cord-308110-cco3aq4n	71	34	amount	amount	NN
cord-308110-cco3aq4n	71	35	of	of	IN
cord-308110-cco3aq4n	71	36	viral	viral	JJ
cord-308110-cco3aq4n	71	37	RNA	RNA	NNP
cord-308110-cco3aq4n	71	38	,	,	,
cord-308110-cco3aq4n	71	39	as	as	IN
cord-308110-cco3aq4n	71	40	described	describe	VBN
cord-308110-cco3aq4n	71	41	above	above	RB
cord-308110-cco3aq4n	71	42	.	.	.
cord-308110-cco3aq4n	72	1	When	when	WRB
cord-308110-cco3aq4n	72	2	VeroE6	veroe6	NN
cord-308110-cco3aq4n	72	3	/	/	SYM
cord-308110-cco3aq4n	72	4	TMPRSS2	TMPRSS2	NNP
cord-308110-cco3aq4n	72	5	cells	cell	NNS
cord-308110-cco3aq4n	72	6	were	be	VBD
cord-308110-cco3aq4n	72	7	infected	infect	VBN
cord-308110-cco3aq4n	72	8	with	with	IN
cord-308110-cco3aq4n	72	9	SARS	SARS	NNP
cord-308110-cco3aq4n	72	10	-	-	HYPH
cord-308110-cco3aq4n	72	11	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	72	12	and	and	CC
cord-308110-cco3aq4n	72	13	incubated	incubate	VBN
cord-308110-cco3aq4n	72	14	in	in	IN
cord-308110-cco3aq4n	72	15	the	the	DT
cord-308110-cco3aq4n	72	16	absence	absence	NN
cord-308110-cco3aq4n	72	17	of	of	IN
cord-308110-cco3aq4n	72	18	compounds	compound	NNS
cord-308110-cco3aq4n	72	19	for	for	IN
cord-308110-cco3aq4n	72	20	3	3	CD
cord-308110-cco3aq4n	72	21	days	day	NNS
cord-308110-cco3aq4n	72	22	,	,	,
cord-308110-cco3aq4n	72	23	the	the	DT
cord-308110-cco3aq4n	72	24	cells	cell	NNS
cord-308110-cco3aq4n	72	25	were	be	VBD
cord-308110-cco3aq4n	72	26	completely	completely	RB
cord-308110-cco3aq4n	72	27	destroyed	destroy	VBN
cord-308110-cco3aq4n	72	28	by	by	IN
cord-308110-cco3aq4n	72	29	the	the	DT
cord-308110-cco3aq4n	72	30	virus	virus	NN
cord-308110-cco3aq4n	72	31	-	-	HYPH
cord-308110-cco3aq4n	72	32	induced	induce	VBN
cord-308110-cco3aq4n	72	33	cytopathic	cytopathic	JJ
cord-308110-cco3aq4n	72	34	effect	effect	NN
cord-308110-cco3aq4n	72	35	(	(	-LRB-
cord-308110-cco3aq4n	72	36	Fig	fig	NN
cord-308110-cco3aq4n	72	37	.	.	.
cord-308110-cco3aq4n	72	38	1B	1b	CD
cord-308110-cco3aq4n	72	39	)	)	-RRB-
cord-308110-cco3aq4n	72	40	.	.	.
cord-308110-cco3aq4n	73	1	Such	such	JJ
cord-308110-cco3aq4n	73	2	cell	cell	NN
cord-308110-cco3aq4n	73	3	destruction	destruction	NN
cord-308110-cco3aq4n	73	4	was	be	VBD
cord-308110-cco3aq4n	73	5	not	not	RB
cord-308110-cco3aq4n	73	6	observed	observe	VBN
cord-308110-cco3aq4n	73	7	for	for	IN
cord-308110-cco3aq4n	73	8	the	the	DT
cord-308110-cco3aq4n	73	9	infected	infected	JJ
cord-308110-cco3aq4n	73	10	cells	cell	NNS
cord-308110-cco3aq4n	73	11	in	in	IN
cord-308110-cco3aq4n	73	12	the	the	DT
cord-308110-cco3aq4n	73	13	presence	presence	NN
cord-308110-cco3aq4n	73	14	of	of	IN
cord-308110-cco3aq4n	73	15	20	20	CD
cord-308110-cco3aq4n	73	16	μM	μm	CD
cord-308110-cco3aq4n	73	17	CVC	CVC	NNP
cord-308110-cco3aq4n	73	18	,	,	,
cord-308110-cco3aq4n	73	19	although	although	IN
cord-308110-cco3aq4n	73	20	some	some	DT
cord-308110-cco3aq4n	73	21	morphological	morphological	JJ
cord-308110-cco3aq4n	73	22	changes	change	NNS
cord-308110-cco3aq4n	73	23	were	be	VBD
cord-308110-cco3aq4n	73	24	identified	identify	VBN
cord-308110-cco3aq4n	73	25	(	(	-LRB-
cord-308110-cco3aq4n	73	26	Fig	Fig	NNP
cord-308110-cco3aq4n	73	27	.	.	.
cord-308110-cco3aq4n	73	28	1D	1d	CD
cord-308110-cco3aq4n	73	29	)	)	-RRB-
cord-308110-cco3aq4n	73	30	.	.	.
cord-308110-cco3aq4n	74	1	In	in	IN
cord-308110-cco3aq4n	74	2	contrast	contrast	NN
cord-308110-cco3aq4n	74	3	,	,	,
cord-308110-cco3aq4n	74	4	MRV	MRV	NNP
cord-308110-cco3aq4n	74	5	did	do	VBD
cord-308110-cco3aq4n	74	6	not	not	RB
cord-308110-cco3aq4n	74	7	inhibit	inhibit	VB
cord-308110-cco3aq4n	74	8	the	the	DT
cord-308110-cco3aq4n	74	9	virus	virus	NN
cord-308110-cco3aq4n	74	10	-	-	HYPH
cord-308110-cco3aq4n	74	11	induced	induce	VBN
cord-308110-cco3aq4n	74	12	cell	cell	NN
cord-308110-cco3aq4n	74	13	destruction	destruction	NN
cord-308110-cco3aq4n	74	14	even	even	RB
cord-308110-cco3aq4n	74	15	at	at	IN
cord-308110-cco3aq4n	74	16	40	40	CD
cord-308110-cco3aq4n	74	17	μM	μm	CD
cord-308110-cco3aq4n	75	1	(	(	-LRB-
cord-308110-cco3aq4n	75	2	Fig	Fig	NNP
cord-308110-cco3aq4n	75	3	.	.	.
cord-308110-cco3aq4n	75	4	1F	1F	NNP
cord-308110-cco3aq4n	75	5	)	)	-RRB-
cord-308110-cco3aq4n	75	6	.	.	.
cord-308110-cco3aq4n	76	1	The	the	DT
cord-308110-cco3aq4n	76	2	EC	EC	NNP
cord-308110-cco3aq4n	76	3	50	50	CD
cord-308110-cco3aq4n	76	4	s	s	NNS
cord-308110-cco3aq4n	76	5	of	of	IN
cord-308110-cco3aq4n	76	6	CVC	CVC	NNP
cord-308110-cco3aq4n	76	7	and	and	CC
cord-308110-cco3aq4n	76	8	MRV	MRV	NNP
cord-308110-cco3aq4n	76	9	were	be	VBD
cord-308110-cco3aq4n	76	10	19	19	CD
cord-308110-cco3aq4n	76	11	±	±	NNP
cord-308110-cco3aq4n	76	12	0.2	0.2	CD
cord-308110-cco3aq4n	76	13	and	and	CC
cord-308110-cco3aq4n	76	14	>	>	XX
cord-308110-cco3aq4n	76	15	40	40	CD
cord-308110-cco3aq4n	76	16	μM	μm	CD
cord-308110-cco3aq4n	76	17	,	,	,
cord-308110-cco3aq4n	76	18	respectively	respectively	RB
cord-308110-cco3aq4n	76	19	,	,	,
cord-308110-cco3aq4n	76	20	based	base	VBN
cord-308110-cco3aq4n	76	21	on	on	IN
cord-308110-cco3aq4n	76	22	the	the	DT
cord-308110-cco3aq4n	76	23	inhibition	inhibition	NN
cord-308110-cco3aq4n	76	24	of	of	IN
cord-308110-cco3aq4n	76	25	virus	virus	NN
cord-308110-cco3aq4n	76	26	-	-	HYPH
cord-308110-cco3aq4n	76	27	induced	induce	VBN
cord-308110-cco3aq4n	76	28	cell	cell	NN
cord-308110-cco3aq4n	76	29	destruction	destruction	NN
cord-308110-cco3aq4n	76	30	(	(	-LRB-
cord-308110-cco3aq4n	76	31	Table	table	NN
cord-308110-cco3aq4n	76	32	1	1	CD
cord-308110-cco3aq4n	76	33	)	)	-RRB-
cord-308110-cco3aq4n	76	34	.	.	.
cord-308110-cco3aq4n	77	1	Both	both	DT
cord-308110-cco3aq4n	77	2	compounds	compound	NNS
cord-308110-cco3aq4n	77	3	did	do	VBD
cord-308110-cco3aq4n	77	4	not	not	RB
cord-308110-cco3aq4n	77	5	show	show	VB
cord-308110-cco3aq4n	77	6	apparent	apparent	JJ
cord-308110-cco3aq4n	77	7	cytotoxicity	cytotoxicity	NN
cord-308110-cco3aq4n	77	8	at	at	IN
cord-308110-cco3aq4n	77	9	concentrations	concentration	NNS
cord-308110-cco3aq4n	77	10	up	up	IN
cord-308110-cco3aq4n	77	11	to	to	TO
cord-308110-cco3aq4n	77	12	80	80	CD
cord-308110-cco3aq4n	77	13	μM.	μm.	NN
cord-308110-cco3aq4n	77	14	Dose	dose	NN
cord-308110-cco3aq4n	77	15	-	-	HYPH
cord-308110-cco3aq4n	77	16	dependent	dependent	JJ
cord-308110-cco3aq4n	77	17	protection	protection	NN
cord-308110-cco3aq4n	77	18	of	of	IN
cord-308110-cco3aq4n	77	19	the	the	DT
cord-308110-cco3aq4n	77	20	infected	infected	JJ
cord-308110-cco3aq4n	77	21	cells	cell	NNS
cord-308110-cco3aq4n	77	22	from	from	IN
cord-308110-cco3aq4n	77	23	virus	virus	NN
cord-308110-cco3aq4n	77	24	-	-	HYPH
cord-308110-cco3aq4n	77	25	induced	induce	VBN
cord-308110-cco3aq4n	77	26	cell	cell	NN
cord-308110-cco3aq4n	77	27	destruction	destruction	NN
cord-308110-cco3aq4n	77	28	was	be	VBD
cord-308110-cco3aq4n	77	29	observed	observe	VBN
cord-308110-cco3aq4n	77	30	for	for	IN
cord-308110-cco3aq4n	77	31	CVC	CVC	NNP
cord-308110-cco3aq4n	77	32	but	but	CC
cord-308110-cco3aq4n	77	33	not	not	RB
cord-308110-cco3aq4n	77	34	for	for	IN
cord-308110-cco3aq4n	77	35	MRV	MRV	NNP
cord-308110-cco3aq4n	77	36	(	(	-LRB-
cord-308110-cco3aq4n	77	37	Fig	Fig	NNP
cord-308110-cco3aq4n	77	38	.	.	NNP
cord-308110-cco3aq4n	77	39	2	2	CD
cord-308110-cco3aq4n	77	40	)	)	-RRB-
cord-308110-cco3aq4n	77	41	.	.	.
cord-308110-cco3aq4n	78	1	These	these	DT
cord-308110-cco3aq4n	78	2	results	result	NNS
cord-308110-cco3aq4n	78	3	indicate	indicate	VBP
cord-308110-cco3aq4n	78	4	that	that	IN
cord-308110-cco3aq4n	78	5	CVC	CVC	NNP
cord-308110-cco3aq4n	78	6	is	be	VBZ
cord-308110-cco3aq4n	78	7	a	a	DT
cord-308110-cco3aq4n	78	8	selective	selective	JJ
cord-308110-cco3aq4n	78	9	inhibitor	inhibitor	NN
cord-308110-cco3aq4n	78	10	of	of	IN
cord-308110-cco3aq4n	78	11	SARS	SARS	NNP
cord-308110-cco3aq4n	78	12	-	-	HYPH
cord-308110-cco3aq4n	78	13	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	78	14	replication	replication	NN
cord-308110-cco3aq4n	78	15	.	.	.
cord-308110-cco3aq4n	79	1	As	as	IN
cord-308110-cco3aq4n	79	2	previously	previously	RB
cord-308110-cco3aq4n	79	3	reported	report	VBN
cord-308110-cco3aq4n	79	4	,	,	,
cord-308110-cco3aq4n	79	5	RDV	RDV	NNP
cord-308110-cco3aq4n	79	6	proved	prove	VBD
cord-308110-cco3aq4n	79	7	to	to	TO
cord-308110-cco3aq4n	79	8	be	be	VB
cord-308110-cco3aq4n	79	9	a	a	DT
cord-308110-cco3aq4n	79	10	potent	potent	JJ
cord-308110-cco3aq4n	79	11	and	and	CC
cord-308110-cco3aq4n	79	12	selective	selective	JJ
cord-308110-cco3aq4n	79	13	inhibitor	inhibitor	NN
cord-308110-cco3aq4n	79	14	of	of	IN
cord-308110-cco3aq4n	79	15	SARS	SARS	NNP
cord-308110-cco3aq4n	79	16	-	-	HYPH
cord-308110-cco3aq4n	79	17	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	79	18	replication	replication	NN
cord-308110-cco3aq4n	79	19	in	in	IN
cord-308110-cco3aq4n	79	20	our	-PRON-	PRP$
cord-308110-cco3aq4n	79	21	assay	assay	NN
cord-308110-cco3aq4n	79	22	,	,	,
cord-308110-cco3aq4n	79	23	whereas	whereas	IN
cord-308110-cco3aq4n	79	24	FPV	FPV	NNP
cord-308110-cco3aq4n	79	25	did	do	VBD
cord-308110-cco3aq4n	79	26	not	not	RB
cord-308110-cco3aq4n	79	27	show	show	VB
cord-308110-cco3aq4n	79	28	any	any	DT
cord-308110-cco3aq4n	79	29	selective	selective	JJ
cord-308110-cco3aq4n	79	30	inhibition	inhibition	NN
cord-308110-cco3aq4n	79	31	even	even	RB
cord-308110-cco3aq4n	79	32	at	at	IN
cord-308110-cco3aq4n	79	33	a	a	DT
cord-308110-cco3aq4n	79	34	concentration	concentration	NN
cord-308110-cco3aq4n	79	35	of	of	IN
cord-308110-cco3aq4n	79	36	80	80	CD
cord-308110-cco3aq4n	79	37	μM	μm	NN
cord-308110-cco3aq4n	79	38	(	(	-LRB-
cord-308110-cco3aq4n	79	39	Table	table	NN
cord-308110-cco3aq4n	79	40	1	1	CD
cord-308110-cco3aq4n	79	41	and	and	CC
cord-308110-cco3aq4n	79	42	Fig	Fig	NNP
cord-308110-cco3aq4n	79	43	.	.	.
cord-308110-cco3aq4n	79	44	S1	S1	NNP
cord-308110-cco3aq4n	79	45	)	)	-RRB-
cord-308110-cco3aq4n	79	46	.	.	.
cord-308110-cco3aq4n	80	1	The	the	DT
cord-308110-cco3aq4n	80	2	anti	anti	JJ
cord-308110-cco3aq4n	80	3	-	-	JJ
cord-308110-cco3aq4n	80	4	SARS	SARS	NNP
cord-308110-cco3aq4n	80	5	-	-	HYPH
cord-308110-cco3aq4n	80	6	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	80	7	activity	activity	NN
cord-308110-cco3aq4n	80	8	was	be	VBD
cord-308110-cco3aq4n	80	9	also	also	RB
cord-308110-cco3aq4n	80	10	examined	examine	VBN
cord-308110-cco3aq4n	80	11	by	by	IN
cord-308110-cco3aq4n	80	12	the	the	DT
cord-308110-cco3aq4n	80	13	inhibition	inhibition	NN
cord-308110-cco3aq4n	80	14	of	of	IN
cord-308110-cco3aq4n	80	15	viral	viral	JJ
cord-308110-cco3aq4n	80	16	antigen	antigen	NN
cord-308110-cco3aq4n	80	17	expression	expression	NN
cord-308110-cco3aq4n	80	18	in	in	IN
cord-308110-cco3aq4n	80	19	Vero	Vero	NNP
cord-308110-cco3aq4n	80	20	cells	cell	NNS
cord-308110-cco3aq4n	80	21	.	.	.
cord-308110-cco3aq4n	81	1	Vero	Vero	NNP
cord-308110-cco3aq4n	81	2	cells	cell	NNS
cord-308110-cco3aq4n	81	3	is	be	VBZ
cord-308110-cco3aq4n	81	4	less	less	RBR
cord-308110-cco3aq4n	81	5	susceptible	susceptible	JJ
cord-308110-cco3aq4n	81	6	to	to	IN
cord-308110-cco3aq4n	81	7	SARS	SARS	NNP
cord-308110-cco3aq4n	81	8	-	-	HYPH
cord-308110-cco3aq4n	81	9	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	81	10	replication	replication	NN
cord-308110-cco3aq4n	81	11	than	than	IN
cord-308110-cco3aq4n	81	12	VeroE6	veroe6	NN
cord-308110-cco3aq4n	81	13	/	/	SYM
cord-308110-cco3aq4n	81	14	TMPRSS2	TMPRSS2	NNP
cord-308110-cco3aq4n	81	15	cells	cell	NNS
cord-308110-cco3aq4n	81	16	.	.	.
cord-308110-cco3aq4n	82	1	In	in	IN
cord-308110-cco3aq4n	82	2	fact	fact	NN
cord-308110-cco3aq4n	82	3	,	,	,
cord-308110-cco3aq4n	82	4	Vero	Vero	NNP
cord-308110-cco3aq4n	82	5	cells	cell	NNS
cord-308110-cco3aq4n	82	6	were	be	VBD
cord-308110-cco3aq4n	82	7	not	not	RB
cord-308110-cco3aq4n	82	8	destroyed	destroy	VBN
cord-308110-cco3aq4n	82	9	by	by	IN
cord-308110-cco3aq4n	82	10	the	the	DT
cord-308110-cco3aq4n	82	11	virus	virus	NN
cord-308110-cco3aq4n	82	12	-	-	HYPH
cord-308110-cco3aq4n	82	13	induced	induce	VBN
cord-308110-cco3aq4n	82	14	cytopathic	cytopathic	JJ
cord-308110-cco3aq4n	82	15	effect	effect	NN
cord-308110-cco3aq4n	82	16	on	on	IN
cord-308110-cco3aq4n	82	17	day	day	NN
cord-308110-cco3aq4n	82	18	3	3	CD
cord-308110-cco3aq4n	82	19	after	after	IN
cord-308110-cco3aq4n	82	20	infection	infection	NN
cord-308110-cco3aq4n	82	21	(	(	-LRB-
cord-308110-cco3aq4n	82	22	Fig	Fig	NNP
cord-308110-cco3aq4n	82	23	.	.	.
cord-308110-cco3aq4n	82	24	3A	3A	NNP
cord-308110-cco3aq4n	82	25	)	)	-RRB-
cord-308110-cco3aq4n	82	26	.	.	.
cord-308110-cco3aq4n	83	1	However	however	RB
cord-308110-cco3aq4n	83	2	,	,	,
cord-308110-cco3aq4n	83	3	viral	viral	JJ
cord-308110-cco3aq4n	83	4	antigen	antigen	NN
cord-308110-cco3aq4n	83	5	expression	expression	NN
cord-308110-cco3aq4n	83	6	was	be	VBD
cord-308110-cco3aq4n	83	7	observed	observe	VBN
cord-308110-cco3aq4n	83	8	for	for	IN
cord-308110-cco3aq4n	83	9	many	many	JJ
cord-308110-cco3aq4n	83	10	cells	cell	NNS
cord-308110-cco3aq4n	83	11	in	in	IN
cord-308110-cco3aq4n	83	12	the	the	DT
cord-308110-cco3aq4n	83	13	absence	absence	NN
cord-308110-cco3aq4n	83	14	of	of	IN
cord-308110-cco3aq4n	83	15	CVC	CVC	NNP
cord-308110-cco3aq4n	83	16	(	(	-LRB-
cord-308110-cco3aq4n	83	17	Fig	Fig	NNP
cord-308110-cco3aq4n	83	18	.	.	.
cord-308110-cco3aq4n	83	19	3B	3B	NNP
cord-308110-cco3aq4n	83	20	)	)	-RRB-
cord-308110-cco3aq4n	83	21	.	.	.
cord-308110-cco3aq4n	84	1	In	in	IN
cord-308110-cco3aq4n	84	2	contrast	contrast	NN
cord-308110-cco3aq4n	84	3	,	,	,
cord-308110-cco3aq4n	84	4	the	the	DT
cord-308110-cco3aq4n	84	5	antigen	antigen	NN
cord-308110-cco3aq4n	84	6	expression	expression	NN
cord-308110-cco3aq4n	84	7	was	be	VBD
cord-308110-cco3aq4n	84	8	completely	completely	RB
cord-308110-cco3aq4n	84	9	inhibited	inhibit	VBN
cord-308110-cco3aq4n	84	10	in	in	IN
cord-308110-cco3aq4n	84	11	the	the	DT
cord-308110-cco3aq4n	84	12	presence	presence	NN
cord-308110-cco3aq4n	84	13	of	of	IN
cord-308110-cco3aq4n	84	14	40	40	CD
cord-308110-cco3aq4n	84	15	μM	μm	CD
cord-308110-cco3aq4n	84	16	CVC	CVC	NNP
cord-308110-cco3aq4n	84	17	(	(	-LRB-
cord-308110-cco3aq4n	84	18	Fig	Fig	NNP
cord-308110-cco3aq4n	84	19	.	.	.
cord-308110-cco3aq4n	84	20	3D	3D	NNP
cord-308110-cco3aq4n	84	21	)	)	-RRB-
cord-308110-cco3aq4n	84	22	.	.	.
cord-308110-cco3aq4n	85	1	When	when	WRB
cord-308110-cco3aq4n	85	2	the	the	DT
cord-308110-cco3aq4n	85	3	anti	anti	JJ
cord-308110-cco3aq4n	85	4	-	-	JJ
cord-308110-cco3aq4n	85	5	SARS	SARS	NNP
cord-308110-cco3aq4n	85	6	-	-	HYPH
cord-308110-cco3aq4n	85	7	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	85	8	activity	activity	NN
cord-308110-cco3aq4n	85	9	of	of	IN
cord-308110-cco3aq4n	85	10	CVC	CVC	NNP
cord-308110-cco3aq4n	85	11	was	be	VBD
cord-308110-cco3aq4n	85	12	evaluated	evaluate	VBN
cord-308110-cco3aq4n	85	13	by	by	IN
cord-308110-cco3aq4n	85	14	the	the	DT
cord-308110-cco3aq4n	85	15	viral	viral	JJ
cord-308110-cco3aq4n	85	16	RNA	RNA	NNP
cord-308110-cco3aq4n	85	17	levels	level	NNS
cord-308110-cco3aq4n	85	18	in	in	IN
cord-308110-cco3aq4n	85	19	culture	culture	NN
cord-308110-cco3aq4n	85	20	supernatants	supernatant	NNS
cord-308110-cco3aq4n	85	21	of	of	IN
cord-308110-cco3aq4n	85	22	the	the	DT
cord-308110-cco3aq4n	85	23	infected	infected	JJ
cord-308110-cco3aq4n	85	24	cells	cell	NNS
cord-308110-cco3aq4n	85	25	,	,	,
cord-308110-cco3aq4n	85	26	CVC	CVC	NNP
cord-308110-cco3aq4n	85	27	significantly	significantly	RB
cord-308110-cco3aq4n	85	28	and	and	CC
cord-308110-cco3aq4n	85	29	dose	dose	RB
cord-308110-cco3aq4n	85	30	-	-	HYPH
cord-308110-cco3aq4n	85	31	dependently	dependently	RB
cord-308110-cco3aq4n	85	32	reduced	reduce	VBN
cord-308110-cco3aq4n	85	33	the	the	DT
cord-308110-cco3aq4n	85	34	amount	amount	NN
cord-308110-cco3aq4n	85	35	of	of	IN
cord-308110-cco3aq4n	85	36	viral	viral	JJ
cord-308110-cco3aq4n	85	37	RNA	RNA	NNP
cord-308110-cco3aq4n	85	38	in	in	IN
cord-308110-cco3aq4n	85	39	culture	culture	NN
cord-308110-cco3aq4n	85	40	supernatants	supernatant	NNS
cord-308110-cco3aq4n	85	41	(	(	-LRB-
cord-308110-cco3aq4n	85	42	Fig	Fig	NNP
cord-308110-cco3aq4n	85	43	.	.	.
cord-308110-cco3aq4n	85	44	4A	4a	CD
cord-308110-cco3aq4n	85	45	)	)	-RRB-
cord-308110-cco3aq4n	85	46	.	.	.
cord-308110-cco3aq4n	86	1	Its	-PRON-	PRP$
cord-308110-cco3aq4n	86	2	EC	EC	NNP
cord-308110-cco3aq4n	86	3	50	50	CD
cord-308110-cco3aq4n	86	4	in	in	IN
cord-308110-cco3aq4n	86	5	this	this	DT
cord-308110-cco3aq4n	86	6	assay	assay	NN
cord-308110-cco3aq4n	86	7	was	be	VBD
cord-308110-cco3aq4n	86	8	2.9	2.9	CD
cord-308110-cco3aq4n	86	9	μM	μM	NNP
cord-308110-cco3aq4n	86	10	,	,	,
cord-308110-cco3aq4n	86	11	and	and	CC
cord-308110-cco3aq4n	86	12	more	more	JJR
cord-308110-cco3aq4n	86	13	than	than	IN
cord-308110-cco3aq4n	86	14	95	95	CD
cord-308110-cco3aq4n	86	15	%	%	NN
cord-308110-cco3aq4n	86	16	inhibition	inhibition	NN
cord-308110-cco3aq4n	86	17	was	be	VBD
cord-308110-cco3aq4n	86	18	achieved	achieve	VBN
cord-308110-cco3aq4n	86	19	by	by	IN
cord-308110-cco3aq4n	86	20	CVC	CVC	NNP
cord-308110-cco3aq4n	86	21	at	at	IN
cord-308110-cco3aq4n	86	22	a	a	DT
cord-308110-cco3aq4n	86	23	concentration	concentration	NN
cord-308110-cco3aq4n	86	24	of	of	IN
cord-308110-cco3aq4n	86	25	10	10	CD
cord-308110-cco3aq4n	87	1	μM.	μM.	NNP
cord-308110-cco3aq4n	88	1	In	in	IN
cord-308110-cco3aq4n	88	2	contrast	contrast	NN
cord-308110-cco3aq4n	88	3	,	,	,
cord-308110-cco3aq4n	88	4	MRV	MRV	NNP
cord-308110-cco3aq4n	88	5	did	do	VBD
cord-308110-cco3aq4n	88	6	not	not	RB
cord-308110-cco3aq4n	88	7	reduce	reduce	VB
cord-308110-cco3aq4n	88	8	the	the	DT
cord-308110-cco3aq4n	88	9	viral	viral	JJ
cord-308110-cco3aq4n	88	10	RNA	RNA	NNP
cord-308110-cco3aq4n	88	11	levels	level	NNS
cord-308110-cco3aq4n	88	12	at	at	IN
cord-308110-cco3aq4n	88	13	concentrations	concentration	NNS
cord-308110-cco3aq4n	89	1	up	up	IN
cord-308110-cco3aq4n	89	2	to	to	TO
cord-308110-cco3aq4n	89	3	40	40	CD
cord-308110-cco3aq4n	89	4	μM	μm	CD
cord-308110-cco3aq4n	89	5	 	 	_SP
cord-308110-cco3aq4n	90	1	In	in	IN
cord-308110-cco3aq4n	90	2	2005	2005	CD
cord-308110-cco3aq4n	90	3	,	,	,
cord-308110-cco3aq4n	90	4	we	-PRON-	PRP
cord-308110-cco3aq4n	90	5	have	have	VBP
cord-308110-cco3aq4n	90	6	reported	report	VBN
cord-308110-cco3aq4n	90	7	that	that	IN
cord-308110-cco3aq4n	90	8	the	the	DT
cord-308110-cco3aq4n	90	9	small	small	JJ
cord-308110-cco3aq4n	90	10	molecule	molecule	NN
cord-308110-cco3aq4n	90	11	and	and	CC
cord-308110-cco3aq4n	90	12	orally	orally	RB
cord-308110-cco3aq4n	90	13	bioavailable	bioavailable	JJ
cord-308110-cco3aq4n	90	14	CCR5	CCR5	NNP
cord-308110-cco3aq4n	90	15	antagonist	antagonist	NN
cord-308110-cco3aq4n	90	16	CVC	CVC	NNP
cord-308110-cco3aq4n	90	17	inhibits	inhibit	VBZ
cord-308110-cco3aq4n	90	18	HIV-1	HIV-1	NNP
cord-308110-cco3aq4n	90	19	replication	replication	NN
cord-308110-cco3aq4n	90	20	at	at	IN
cord-308110-cco3aq4n	90	21	subnanomolar	subnanomolar	JJ
cord-308110-cco3aq4n	90	22	concentrations	concentration	NNS
cord-308110-cco3aq4n	90	23	in	in	IN
cord-308110-cco3aq4n	90	24	vitro	vitro	FW
cord-308110-cco3aq4n	90	25	(	(	-LRB-
cord-308110-cco3aq4n	90	26	Baba	Baba	NNP
cord-308110-cco3aq4n	90	27	et	et	FW
cord-308110-cco3aq4n	90	28	al	al	NNP
cord-308110-cco3aq4n	90	29	.	.	NNP
cord-308110-cco3aq4n	90	30	,	,	,
cord-308110-cco3aq4n	90	31	2005	2005	CD
cord-308110-cco3aq4n	90	32	)	)	-RRB-
cord-308110-cco3aq4n	90	33	.	.	.
cord-308110-cco3aq4n	91	1	The	the	DT
cord-308110-cco3aq4n	91	2	anti	anti	JJ
cord-308110-cco3aq4n	91	3	-	-	JJ
cord-308110-cco3aq4n	91	4	HIV-1	hiv-1	JJ
cord-308110-cco3aq4n	91	5	activity	activity	NN
cord-308110-cco3aq4n	91	6	of	of	IN
cord-308110-cco3aq4n	91	7	CVC	CVC	NNP
cord-308110-cco3aq4n	91	8	is	be	VBZ
cord-308110-cco3aq4n	91	9	attributed	attribute	VBN
cord-308110-cco3aq4n	91	10	to	to	IN
cord-308110-cco3aq4n	91	11	the	the	DT
cord-308110-cco3aq4n	91	12	inhibition	inhibition	NN
cord-308110-cco3aq4n	91	13	of	of	IN
cord-308110-cco3aq4n	91	14	viral	viral	JJ
cord-308110-cco3aq4n	91	15	entry	entry	NN
cord-308110-cco3aq4n	91	16	using	use	VBG
cord-308110-cco3aq4n	91	17	CCR5	CCR5	NNP
cord-308110-cco3aq4n	91	18	as	as	IN
cord-308110-cco3aq4n	91	19	a	a	DT
cord-308110-cco3aq4n	91	20	coreceptor	coreceptor	NN
cord-308110-cco3aq4n	91	21	.	.	.
cord-308110-cco3aq4n	92	1	However	however	RB
cord-308110-cco3aq4n	92	2	,	,	,
cord-308110-cco3aq4n	92	3	different	different	JJ
cord-308110-cco3aq4n	92	4	from	from	IN
cord-308110-cco3aq4n	92	5	other	other	JJ
cord-308110-cco3aq4n	92	6	anti	anti	JJ
cord-308110-cco3aq4n	92	7	-	-	NNP
cord-308110-cco3aq4n	92	8	HIV-1	HIV-1	NNP
cord-308110-cco3aq4n	92	9	CCR5	CCR5	NNP
cord-308110-cco3aq4n	92	10	antagonists	antagonist	NNS
cord-308110-cco3aq4n	92	11	such	such	JJ
cord-308110-cco3aq4n	92	12	as	as	IN
cord-308110-cco3aq4n	92	13	MRV	MRV	NNP
cord-308110-cco3aq4n	92	14	,	,	,
cord-308110-cco3aq4n	92	15	CVC	CVC	NNP
cord-308110-cco3aq4n	92	16	also	also	RB
cord-308110-cco3aq4n	92	17	suppresses	suppress	VBZ
cord-308110-cco3aq4n	92	18	the	the	DT
cord-308110-cco3aq4n	92	19	binding	binding	NN
cord-308110-cco3aq4n	92	20	of	of	IN
cord-308110-cco3aq4n	92	21	MCP-1	MCP-1	NNP
cord-308110-cco3aq4n	92	22	to	to	IN
cord-308110-cco3aq4n	92	23	CCR2b	CCR2b	NNP
cord-308110-cco3aq4n	92	24	-	-	HYPH
cord-308110-cco3aq4n	92	25	expressing	express	VBG
cord-308110-cco3aq4n	92	26	cells	cell	NNS
cord-308110-cco3aq4n	92	27	.	.	.
cord-308110-cco3aq4n	93	1	This	this	DT
cord-308110-cco3aq4n	93	2	unique	unique	JJ
cord-308110-cco3aq4n	93	3	feature	feature	NN
cord-308110-cco3aq4n	93	4	of	of	IN
cord-308110-cco3aq4n	93	5	CVC	CVC	NNP
cord-308110-cco3aq4n	93	6	encouraged	encourage	VBD
cord-308110-cco3aq4n	93	7	its	-PRON-	PRP$
cord-308110-cco3aq4n	93	8	manufacturer	manufacturer	NN
cord-308110-cco3aq4n	93	9	to	to	TO
cord-308110-cco3aq4n	93	10	develop	develop	VB
cord-308110-cco3aq4n	93	11	this	this	DT
cord-308110-cco3aq4n	93	12	compound	compound	NN
cord-308110-cco3aq4n	93	13	as	as	IN
cord-308110-cco3aq4n	93	14	an	an	DT
cord-308110-cco3aq4n	93	15	agent	agent	NN
cord-308110-cco3aq4n	93	16	for	for	IN
cord-308110-cco3aq4n	93	17	treatment	treatment	NN
cord-308110-cco3aq4n	93	18	of	of	IN
cord-308110-cco3aq4n	93	19	NASH	NASH	NNP
cord-308110-cco3aq4n	93	20	.	.	.
cord-308110-cco3aq4n	94	1	A	a	DT
cord-308110-cco3aq4n	94	2	recent	recent	JJ
cord-308110-cco3aq4n	94	3	randomized	randomized	JJ
cord-308110-cco3aq4n	94	4	,	,	,
cord-308110-cco3aq4n	94	5	placebo	placebo	NN
cord-308110-cco3aq4n	94	6	-	-	HYPH
cord-308110-cco3aq4n	94	7	controlled	control	VBN
cord-308110-cco3aq4n	94	8	trial	trial	NN
cord-308110-cco3aq4n	94	9	of	of	IN
cord-308110-cco3aq4n	94	10	CVC	CVC	NNP
cord-308110-cco3aq4n	94	11	for	for	IN
cord-308110-cco3aq4n	94	12	treatment	treatment	NN
cord-308110-cco3aq4n	94	13	of	of	IN
cord-308110-cco3aq4n	94	14	NASH	NASH	NNP
cord-308110-cco3aq4n	94	15	demonstrated	demonstrate	VBD
cord-308110-cco3aq4n	94	16	that	that	IN
cord-308110-cco3aq4n	94	17	twice	twice	PDT
cord-308110-cco3aq4n	94	18	as	as	RB
cord-308110-cco3aq4n	94	19	many	many	JJ
cord-308110-cco3aq4n	94	20	subjects	subject	NNS
cord-308110-cco3aq4n	94	21	achieved	achieve	VBD
cord-308110-cco3aq4n	94	22	improvement	improvement	NN
cord-308110-cco3aq4n	94	23	in	in	IN
cord-308110-cco3aq4n	94	24	fibrosis	fibrosis	NN
cord-308110-cco3aq4n	94	25	and	and	CC
cord-308110-cco3aq4n	94	26	no	no	DT
cord-308110-cco3aq4n	94	27	worsening	worsening	NN
cord-308110-cco3aq4n	94	28	of	of	IN
cord-308110-cco3aq4n	94	29	steatohepatitis	steatohepatitis	NN
cord-308110-cco3aq4n	94	30	compared	compare	VBN
cord-308110-cco3aq4n	94	31	with	with	IN
cord-308110-cco3aq4n	94	32	placebo	placebo	NN
cord-308110-cco3aq4n	94	33	(	(	-LRB-
cord-308110-cco3aq4n	94	34	Friedman	Friedman	NNP
cord-308110-cco3aq4n	94	35	et	et	NNP
cord-308110-cco3aq4n	94	36	al	al	NNP
cord-308110-cco3aq4n	94	37	.	.	NNP
cord-308110-cco3aq4n	94	38	,	,	,
cord-308110-cco3aq4n	94	39	2018	2018	CD
cord-308110-cco3aq4n	94	40	;	;	:
cord-308110-cco3aq4n	94	41	Tacke	Tacke	NNP
cord-308110-cco3aq4n	94	42	,	,	,
cord-308110-cco3aq4n	94	43	2018	2018	CD
cord-308110-cco3aq4n	94	44	)	)	-RRB-
cord-308110-cco3aq4n	94	45	.	.	.
cord-308110-cco3aq4n	95	1	Safety	safety	NN
cord-308110-cco3aq4n	95	2	and	and	CC
cord-308110-cco3aq4n	95	3	tolerability	tolerability	NN
cord-308110-cco3aq4n	95	4	of	of	IN
cord-308110-cco3aq4n	95	5	CVC	CVC	NNP
cord-308110-cco3aq4n	95	6	were	be	VBD
cord-308110-cco3aq4n	95	7	found	find	VBN
cord-308110-cco3aq4n	95	8	to	to	TO
cord-308110-cco3aq4n	95	9	be	be	VB
cord-308110-cco3aq4n	95	10	comparable	comparable	JJ
cord-308110-cco3aq4n	95	11	to	to	IN
cord-308110-cco3aq4n	95	12	placebo	placebo	NN
cord-308110-cco3aq4n	95	13	,	,	,
cord-308110-cco3aq4n	95	14	suggesting	suggest	VBG
cord-308110-cco3aq4n	95	15	that	that	IN
cord-308110-cco3aq4n	95	16	it	-PRON-	PRP
cord-308110-cco3aq4n	95	17	can	can	MD
cord-308110-cco3aq4n	95	18	be	be	VB
cord-308110-cco3aq4n	95	19	administered	administer	VBN
cord-308110-cco3aq4n	95	20	safely	safely	RB
cord-308110-cco3aq4n	95	21	to	to	TO
cord-308110-cco3aq4n	95	22	COVID-19	covid-19	VB
cord-308110-cco3aq4n	95	23	patients	patient	NNS
cord-308110-cco3aq4n	95	24	for	for	IN
cord-308110-cco3aq4n	95	25	preventing	prevent	VBG
cord-308110-cco3aq4n	95	26	severe	severe	JJ
cord-308110-cco3aq4n	95	27	deterioration	deterioration	NN
cord-308110-cco3aq4n	95	28	of	of	IN
cord-308110-cco3aq4n	95	29	pneumonia	pneumonia	NN
cord-308110-cco3aq4n	95	30	due	due	IN
cord-308110-cco3aq4n	95	31	to	to	IN
cord-308110-cco3aq4n	95	32	the	the	DT
cord-308110-cco3aq4n	95	33	cytokine	cytokine	NN
cord-308110-cco3aq4n	95	34	storm	storm	NN
cord-308110-cco3aq4n	95	35	.	.	.
cord-308110-cco3aq4n	96	1	In	in	IN
cord-308110-cco3aq4n	96	2	fact	fact	NN
cord-308110-cco3aq4n	96	3	,	,	,
cord-308110-cco3aq4n	96	4	alveolar	alveolar	JJ
cord-308110-cco3aq4n	96	5	macrophage	macrophage	NN
cord-308110-cco3aq4n	96	6	-	-	:
cord-308110-cco3aq4n	96	7	borne	bear	VBN
cord-308110-cco3aq4n	96	8	MCP-1	MCP-1	NNP
cord-308110-cco3aq4n	96	9	was	be	VBD
cord-308110-cco3aq4n	96	10	reported	report	VBN
cord-308110-cco3aq4n	96	11	to	to	TO
cord-308110-cco3aq4n	96	12	be	be	VB
cord-308110-cco3aq4n	96	13	a	a	DT
cord-308110-cco3aq4n	96	14	key	key	JJ
cord-308110-cco3aq4n	96	15	agent	agent	NN
cord-308110-cco3aq4n	96	16	in	in	IN
cord-308110-cco3aq4n	96	17	the	the	DT
cord-308110-cco3aq4n	96	18	initiation	initiation	NN
cord-308110-cco3aq4n	96	19	of	of	IN
cord-308110-cco3aq4n	96	20	the	the	DT
cord-308110-cco3aq4n	96	21	systemic	systemic	JJ
cord-308110-cco3aq4n	96	22	inflammation	inflammation	NN
cord-308110-cco3aq4n	96	23	of	of	IN
cord-308110-cco3aq4n	96	24	alveolar	alveolar	JJ
cord-308110-cco3aq4n	96	25	hypoxia	hypoxia	NN
cord-308110-cco3aq4n	96	26	in	in	IN
cord-308110-cco3aq4n	96	27	rats	rat	NNS
cord-308110-cco3aq4n	96	28	,	,	,
cord-308110-cco3aq4n	96	29	and	and	CC
cord-308110-cco3aq4n	96	30	a	a	DT
cord-308110-cco3aq4n	96	31	CCR2b	CCR2b	NNP
cord-308110-cco3aq4n	96	32	receptor	receptor	NN
cord-308110-cco3aq4n	96	33	antagonist	antagonist	NN
cord-308110-cco3aq4n	96	34	prevented	prevent	VBD
cord-308110-cco3aq4n	96	35	the	the	DT
cord-308110-cco3aq4n	96	36	mesenteric	mesenteric	JJ
cord-308110-cco3aq4n	96	37	inflammation	inflammation	NN
cord-308110-cco3aq4n	96	38	of	of	IN
cord-308110-cco3aq4n	96	39	alveolar	alveolar	NN
cord-308110-cco3aq4n	96	40	hypoxia	hypoxia	NN
cord-308110-cco3aq4n	96	41	(	(	-LRB-
cord-308110-cco3aq4n	96	42	Chao	Chao	NNP
cord-308110-cco3aq4n	96	43	et	et	NNP
cord-308110-cco3aq4n	96	44	al	al	NNP
cord-308110-cco3aq4n	96	45	.	.	NNP
cord-308110-cco3aq4n	96	46	2011	2011	CD
cord-308110-cco3aq4n	96	47	)	)	-RRB-
cord-308110-cco3aq4n	96	48	.	.	.
cord-308110-cco3aq4n	97	1	Furthermore	furthermore	RB
cord-308110-cco3aq4n	97	2	,	,	,
cord-308110-cco3aq4n	97	3	a	a	DT
cord-308110-cco3aq4n	97	4	recent	recent	JJ
cord-308110-cco3aq4n	97	5	study	study	NN
cord-308110-cco3aq4n	97	6	on	on	IN
cord-308110-cco3aq4n	97	7	transcriptome	transcriptome	NN
cord-308110-cco3aq4n	97	8	sequencing	sequencing	NN
cord-308110-cco3aq4n	97	9	of	of	IN
cord-308110-cco3aq4n	97	10	the	the	DT
cord-308110-cco3aq4n	97	11	RNAs	rna	NNS
cord-308110-cco3aq4n	97	12	isolated	isolate	VBN
cord-308110-cco3aq4n	97	13	from	from	IN
cord-308110-cco3aq4n	97	14	the	the	DT
cord-308110-cco3aq4n	97	15	bronchoalveolar	bronchoalveolar	NNP
cord-308110-cco3aq4n	97	16	lavage	lavage	NN
cord-308110-cco3aq4n	97	17	fluid	fluid	NN
cord-308110-cco3aq4n	97	18	and	and	CC
cord-308110-cco3aq4n	97	19	peripheral	peripheral	JJ
cord-308110-cco3aq4n	97	20	blood	blood	NN
cord-308110-cco3aq4n	97	21	mononuclear	mononuclear	NN
cord-308110-cco3aq4n	97	22	cells	cell	NNS
cord-308110-cco3aq4n	97	23	specimens	specimen	NNS
cord-308110-cco3aq4n	97	24	of	of	IN
cord-308110-cco3aq4n	97	25	COVID-19	covid-19	CD
cord-308110-cco3aq4n	97	26	patients	patient	NNS
cord-308110-cco3aq4n	97	27	revealed	reveal	VBD
cord-308110-cco3aq4n	97	28	the	the	DT
cord-308110-cco3aq4n	97	29	association	association	NN
cord-308110-cco3aq4n	97	30	between	between	IN
cord-308110-cco3aq4n	97	31	its	-PRON-	PRP$
cord-308110-cco3aq4n	97	32	pathogenesis	pathogenesis	NN
cord-308110-cco3aq4n	97	33	and	and	CC
cord-308110-cco3aq4n	97	34	excessive	excessive	JJ
cord-308110-cco3aq4n	97	35	cytokine	cytokine	NN
cord-308110-cco3aq4n	97	36	release	release	NN
cord-308110-cco3aq4n	97	37	including	include	VBG
cord-308110-cco3aq4n	97	38	MCP-1	MCP-1	NNP
cord-308110-cco3aq4n	98	1	(	(	-LRB-
cord-308110-cco3aq4n	98	2	Xiong	Xiong	NNP
cord-308110-cco3aq4n	98	3	et	et	NNP
cord-308110-cco3aq4n	98	4	al	al	NNP
cord-308110-cco3aq4n	98	5	.	.	NNP
cord-308110-cco3aq4n	98	6	2020	2020	CD
cord-308110-cco3aq4n	98	7	)	)	-RRB-
cord-308110-cco3aq4n	98	8	.	.	.
cord-308110-cco3aq4n	99	1	It	-PRON-	PRP
cord-308110-cco3aq4n	99	2	will	will	MD
cord-308110-cco3aq4n	99	3	be	be	VB
cord-308110-cco3aq4n	99	4	claimed	claim	VBN
cord-308110-cco3aq4n	99	5	that	that	IN
cord-308110-cco3aq4n	99	6	the	the	DT
cord-308110-cco3aq4n	99	7	anti	anti	JJ
cord-308110-cco3aq4n	99	8	-	-	JJ
cord-308110-cco3aq4n	99	9	SARS	SARS	NNP
cord-308110-cco3aq4n	99	10	-	-	HYPH
cord-308110-cco3aq4n	99	11	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	99	12	activity	activity	NN
cord-308110-cco3aq4n	99	13	of	of	IN
cord-308110-cco3aq4n	99	14	CVC	CVC	NNP
cord-308110-cco3aq4n	99	15	in	in	IN
cord-308110-cco3aq4n	99	16	vitro	vitro	FW
cord-308110-cco3aq4n	99	17	is	be	VBZ
cord-308110-cco3aq4n	99	18	insufficient	insufficient	JJ
cord-308110-cco3aq4n	99	19	for	for	IN
cord-308110-cco3aq4n	99	20	the	the	DT
cord-308110-cco3aq4n	99	21	treatment	treatment	NN
cord-308110-cco3aq4n	99	22	of	of	IN
cord-308110-cco3aq4n	99	23	COVID-19	covid-19	JJ
cord-308110-cco3aq4n	99	24	patients	patient	NNS
cord-308110-cco3aq4n	99	25	.	.	.
cord-308110-cco3aq4n	100	1	However	however	RB
cord-308110-cco3aq4n	100	2	,	,	,
cord-308110-cco3aq4n	100	3	our	-PRON-	PRP$
cord-308110-cco3aq4n	100	4	antiviral	antiviral	JJ
cord-308110-cco3aq4n	100	5	assay	assay	NN
cord-308110-cco3aq4n	100	6	system	system	NN
cord-308110-cco3aq4n	100	7	using	use	VBG
cord-308110-cco3aq4n	100	8	(	(	-LRB-
cord-308110-cco3aq4n	100	9	Table	table	NN
cord-308110-cco3aq4n	100	10	1	1	CD
cord-308110-cco3aq4n	100	11	and	and	CC
cord-308110-cco3aq4n	100	12	data	datum	NNS
cord-308110-cco3aq4n	100	13	not	not	RB
cord-308110-cco3aq4n	100	14	shown	show	VBN
cord-308110-cco3aq4n	100	15	)	)	-RRB-
cord-308110-cco3aq4n	100	16	.	.	.
cord-308110-cco3aq4n	101	1	The	the	DT
cord-308110-cco3aq4n	101	2	broad	broad	JJ
cord-308110-cco3aq4n	101	3	-	-	HYPH
cord-308110-cco3aq4n	101	4	spectrum	spectrum	NN
cord-308110-cco3aq4n	101	5	anti	anti	JJ
cord-308110-cco3aq4n	101	6	-	-	NNP
cord-308110-cco3aq4n	101	7	RNA	RNA	NNP
cord-308110-cco3aq4n	101	8	virus	virus	NN
cord-308110-cco3aq4n	101	9	agent	agent	NN
cord-308110-cco3aq4n	101	10	FPV	FPV	NNP
cord-308110-cco3aq4n	101	11	was	be	VBD
cord-308110-cco3aq4n	101	12	not	not	RB
cord-308110-cco3aq4n	101	13	inhibitory	inhibitory	JJ
cord-308110-cco3aq4n	101	14	to	to	IN
cord-308110-cco3aq4n	101	15	SARS	SARS	NNP
cord-308110-cco3aq4n	101	16	-	-	HYPH
cord-308110-cco3aq4n	101	17	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	101	18	replication	replication	NN
cord-308110-cco3aq4n	101	19	even	even	RB
cord-308110-cco3aq4n	101	20	at	at	IN
cord-308110-cco3aq4n	101	21	80	80	CD
cord-308110-cco3aq4n	101	22	μM	μm	CD
cord-308110-cco3aq4n	102	1	(	(	-LRB-
cord-308110-cco3aq4n	102	2	Table	table	NN
cord-308110-cco3aq4n	102	3	1	1	CD
cord-308110-cco3aq4n	102	4	and	and	CC
cord-308110-cco3aq4n	102	5	Fig	Fig	NNP
cord-308110-cco3aq4n	102	6	.	.	.
cord-308110-cco3aq4n	102	7	S1	S1	NNP
cord-308110-cco3aq4n	102	8	)	)	-RRB-
cord-308110-cco3aq4n	102	9	,	,	,
cord-308110-cco3aq4n	102	10	which	which	WDT
cord-308110-cco3aq4n	102	11	is	be	VBZ
cord-308110-cco3aq4n	102	12	consistent	consistent	JJ
cord-308110-cco3aq4n	102	13	with	with	IN
cord-308110-cco3aq4n	102	14	a	a	DT
cord-308110-cco3aq4n	102	15	previous	previous	JJ
cord-308110-cco3aq4n	102	16	report	report	NN
cord-308110-cco3aq4n	102	17	(	(	-LRB-
cord-308110-cco3aq4n	102	18	Choy	Choy	NNP
cord-308110-cco3aq4n	102	19	et	et	FW
cord-308110-cco3aq4n	102	20	al	al	NNP
cord-308110-cco3aq4n	102	21	.	.	NNP
cord-308110-cco3aq4n	102	22	2020	2020	CD
cord-308110-cco3aq4n	102	23	)	)	-RRB-
cord-308110-cco3aq4n	102	24	.	.	.
cord-308110-cco3aq4n	103	1	The	the	DT
cord-308110-cco3aq4n	103	2	anti	anti	JJ
cord-308110-cco3aq4n	103	3	-	-	JJ
cord-308110-cco3aq4n	103	4	SARS	SARS	NNP
cord-308110-cco3aq4n	103	5	-	-	HYPH
cord-308110-cco3aq4n	103	6	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	103	7	activity	activity	NN
cord-308110-cco3aq4n	103	8	of	of	IN
cord-308110-cco3aq4n	103	9	CVC	CVC	NNP
cord-308110-cco3aq4n	103	10	was	be	VBD
cord-308110-cco3aq4n	103	11	more	more	RBR
cord-308110-cco3aq4n	103	12	obvious	obvious	JJ
cord-308110-cco3aq4n	103	13	,	,	,
cord-308110-cco3aq4n	103	14	when	when	WRB
cord-308110-cco3aq4n	103	15	determined	determine	VBN
cord-308110-cco3aq4n	103	16	by	by	IN
cord-308110-cco3aq4n	103	17	the	the	DT
cord-308110-cco3aq4n	103	18	inhibition	inhibition	NN
cord-308110-cco3aq4n	103	19	of	of	IN
cord-308110-cco3aq4n	103	20	viral	viral	JJ
cord-308110-cco3aq4n	103	21	RNA	RNA	NNP
cord-308110-cco3aq4n	103	22	levels	level	NNS
cord-308110-cco3aq4n	103	23	in	in	IN
cord-308110-cco3aq4n	103	24	culture	culture	NN
cord-308110-cco3aq4n	103	25	supernatants	supernatant	NNS
cord-308110-cco3aq4n	103	26	.	.	.
cord-308110-cco3aq4n	104	1	Its	-PRON-	PRP$
cord-308110-cco3aq4n	104	2	EC	EC	NNP
cord-308110-cco3aq4n	104	3	50	50	CD
cord-308110-cco3aq4n	104	4	was	be	VBD
cord-308110-cco3aq4n	105	1	2.9	2.9	CD
cord-308110-cco3aq4n	105	2	μM	μm	CD
cord-308110-cco3aq4n	106	1	(	(	-LRB-
cord-308110-cco3aq4n	106	2	Fig	Fig	NNP
cord-308110-cco3aq4n	106	3	.	.	NNP
cord-308110-cco3aq4n	106	4	4	4	CD
cord-308110-cco3aq4n	106	5	)	)	-RRB-
cord-308110-cco3aq4n	106	6	,	,	,
cord-308110-cco3aq4n	106	7	which	which	WDT
cord-308110-cco3aq4n	106	8	was	be	VBD
cord-308110-cco3aq4n	106	9	similar	similar	JJ
cord-308110-cco3aq4n	106	10	to	to	IN
cord-308110-cco3aq4n	106	11	those	those	DT
cord-308110-cco3aq4n	106	12	of	of	IN
cord-308110-cco3aq4n	106	13	RDV	RDV	NNP
cord-308110-cco3aq4n	106	14	(	(	-LRB-
cord-308110-cco3aq4n	106	15	1.9	1.9	CD
cord-308110-cco3aq4n	106	16	μM	μM	NNP
cord-308110-cco3aq4n	106	17	)	)	-RRB-
cord-308110-cco3aq4n	106	18	and	and	CC
cord-308110-cco3aq4n	106	19	ivermectin	ivermectin	NNP
cord-308110-cco3aq4n	106	20	(	(	-LRB-
cord-308110-cco3aq4n	106	21	2.2	2.2	CD
cord-308110-cco3aq4n	106	22	-	-	SYM
cord-308110-cco3aq4n	106	23	2.8	2.8	CD
cord-308110-cco3aq4n	106	24	μM	μM	NNS
cord-308110-cco3aq4n	106	25	)	)	-RRB-
cord-308110-cco3aq4n	107	1	(	(	-LRB-
cord-308110-cco3aq4n	107	2	data	datum	NNS
cord-308110-cco3aq4n	107	3	not	not	RB
cord-308110-cco3aq4n	107	4	shown	show	VBN
cord-308110-cco3aq4n	107	5	and	and	CC
cord-308110-cco3aq4n	107	6	Caly	Caly	NNP
cord-308110-cco3aq4n	107	7	et	et	NNP
cord-308110-cco3aq4n	107	8	al	al	NNP
cord-308110-cco3aq4n	107	9	.	.	NNP
cord-308110-cco3aq4n	107	10	,	,	,
cord-308110-cco3aq4n	107	11	2020	2020	CD
cord-308110-cco3aq4n	107	12	,	,	,
cord-308110-cco3aq4n	107	13	respectively	respectively	RB
cord-308110-cco3aq4n	107	14	)	)	-RRB-
cord-308110-cco3aq4n	107	15	.	.	.
cord-308110-cco3aq4n	108	1	Thus	thus	RB
cord-308110-cco3aq4n	108	2	,	,	,
cord-308110-cco3aq4n	108	3	although	although	IN
cord-308110-cco3aq4n	108	4	the	the	DT
cord-308110-cco3aq4n	108	5	anti	anti	JJ
cord-308110-cco3aq4n	108	6	-	-	JJ
cord-308110-cco3aq4n	108	7	SARS	SARS	NNP
cord-308110-cco3aq4n	108	8	-	-	HYPH
cord-308110-cco3aq4n	108	9	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	108	10	activity	activity	NN
cord-308110-cco3aq4n	108	11	of	of	IN
cord-308110-cco3aq4n	108	12	CVC	CVC	NNP
cord-308110-cco3aq4n	108	13	in	in	IN
cord-308110-cco3aq4n	108	14	vitro	vitro	FW
cord-308110-cco3aq4n	108	15	is	be	VBZ
cord-308110-cco3aq4n	108	16	modest	modest	JJ
cord-308110-cco3aq4n	108	17	,	,	,
cord-308110-cco3aq4n	108	18	we	-PRON-	PRP
cord-308110-cco3aq4n	108	19	can	can	MD
cord-308110-cco3aq4n	108	20	not	not	RB
cord-308110-cco3aq4n	108	21	exclude	exclude	VB
cord-308110-cco3aq4n	108	22	the	the	DT
cord-308110-cco3aq4n	108	23	possibility	possibility	NN
cord-308110-cco3aq4n	108	24	that	that	IN
cord-308110-cco3aq4n	108	25	CVC	CVC	NNP
cord-308110-cco3aq4n	108	26	exhibits	exhibit	VBZ
cord-308110-cco3aq4n	108	27	some	some	DT
cord-308110-cco3aq4n	108	28	antiviral	antiviral	JJ
cord-308110-cco3aq4n	108	29	efficacy	efficacy	NN
cord-308110-cco3aq4n	108	30	in	in	IN
cord-308110-cco3aq4n	108	31	COVID-19	COVID-19	NNP
cord-308110-cco3aq4n	108	32	patients	patient	NNS
cord-308110-cco3aq4n	108	33	.	.	.
cord-308110-cco3aq4n	109	1	The	the	DT
cord-308110-cco3aq4n	109	2	target	target	NN
cord-308110-cco3aq4n	109	3	molecule	molecule	NN
cord-308110-cco3aq4n	109	4	of	of	IN
cord-308110-cco3aq4n	109	5	CVC	CVC	NNP
cord-308110-cco3aq4n	109	6	remains	remain	VBZ
cord-308110-cco3aq4n	109	7	to	to	TO
cord-308110-cco3aq4n	109	8	be	be	VB
cord-308110-cco3aq4n	109	9	elucidated	elucidate	VBN
cord-308110-cco3aq4n	109	10	.	.	.
cord-308110-cco3aq4n	110	1	Our	-PRON-	PRP$
cord-308110-cco3aq4n	110	2	preliminary	preliminary	JJ
cord-308110-cco3aq4n	110	3	studies	study	NNS
cord-308110-cco3aq4n	110	4	on	on	IN
cord-308110-cco3aq4n	110	5	its	-PRON-	PRP$
cord-308110-cco3aq4n	110	6	mechanism	mechanism	NN
cord-308110-cco3aq4n	110	7	of	of	IN
cord-308110-cco3aq4n	110	8	action	action	NN
cord-308110-cco3aq4n	110	9	revealed	reveal	VBD
cord-308110-cco3aq4n	110	10	that	that	IN
cord-308110-cco3aq4n	110	11	CVC	CVC	NNP
cord-308110-cco3aq4n	110	12	did	do	VBD
cord-308110-cco3aq4n	110	13	not	not	RB
cord-308110-cco3aq4n	110	14	interfere	interfere	VB
cord-308110-cco3aq4n	110	15	with	with	IN
cord-308110-cco3aq4n	110	16	the	the	DT
cord-308110-cco3aq4n	110	17	entry	entry	NN
cord-308110-cco3aq4n	110	18	of	of	IN
cord-308110-cco3aq4n	110	19	SARS	SARS	NNP
cord-308110-cco3aq4n	110	20	-	-	HYPH
cord-308110-cco3aq4n	110	21	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	110	22	(	(	-LRB-
cord-308110-cco3aq4n	110	23	data	datum	NNS
cord-308110-cco3aq4n	110	24	not	not	RB
cord-308110-cco3aq4n	110	25	shown	show	VBN
cord-308110-cco3aq4n	110	26	)	)	-RRB-
cord-308110-cco3aq4n	110	27	.	.	.
cord-308110-cco3aq4n	111	1	Unlike	unlike	IN
cord-308110-cco3aq4n	111	2	HIV-1	HIV-1	NNP
cord-308110-cco3aq4n	111	3	,	,	,
cord-308110-cco3aq4n	111	4	CCR5	CCR5	NNP
cord-308110-cco3aq4n	111	5	is	be	VBZ
cord-308110-cco3aq4n	111	6	not	not	RB
cord-308110-cco3aq4n	111	7	the	the	DT
cord-308110-cco3aq4n	111	8	target	target	NN
cord-308110-cco3aq4n	111	9	of	of	IN
cord-308110-cco3aq4n	111	10	CVC	CVC	NNP
cord-308110-cco3aq4n	111	11	for	for	IN
cord-308110-cco3aq4n	111	12	inhibition	inhibition	NN
cord-308110-cco3aq4n	111	13	of	of	IN
cord-308110-cco3aq4n	111	14	SARS	SARS	NNP
cord-308110-cco3aq4n	111	15	-	-	HYPH
cord-308110-cco3aq4n	111	16	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	111	17	replication	replication	NN
cord-308110-cco3aq4n	111	18	,	,	,
cord-308110-cco3aq4n	111	19	since	since	IN
cord-308110-cco3aq4n	111	20	another	another	DT
cord-308110-cco3aq4n	111	21	potent	potent	JJ
cord-308110-cco3aq4n	111	22	CCR5	CCR5	NNP
cord-308110-cco3aq4n	111	23	antagonist	antagonist	NN
cord-308110-cco3aq4n	111	24	MRV	MRV	NNP
cord-308110-cco3aq4n	111	25	was	be	VBD
cord-308110-cco3aq4n	111	26	totally	totally	RB
cord-308110-cco3aq4n	111	27	inactive	inactive	JJ
cord-308110-cco3aq4n	112	1	(	(	-LRB-
cord-308110-cco3aq4n	112	2	Fig	Fig	NNP
cord-308110-cco3aq4n	112	3	.	.	.
cord-308110-cco3aq4n	112	4	2B	2b	CD
cord-308110-cco3aq4n	112	5	and	and	CC
cord-308110-cco3aq4n	112	6	Fig	Fig	NNP
cord-308110-cco3aq4n	112	7	.	.	.
cord-308110-cco3aq4n	112	8	4B	4b	CD
cord-308110-cco3aq4n	112	9	)	)	-RRB-
cord-308110-cco3aq4n	112	10	.	.	.
cord-308110-cco3aq4n	113	1	Furthermore	furthermore	RB
cord-308110-cco3aq4n	113	2	,	,	,
cord-308110-cco3aq4n	113	3	MCP-1	MCP-1	NNP
cord-308110-cco3aq4n	113	4	could	could	MD
cord-308110-cco3aq4n	113	5	not	not	RB
cord-308110-cco3aq4n	113	6	block	block	VB
cord-308110-cco3aq4n	113	7	SARS	SARS	NNP
cord-308110-cco3aq4n	113	8	-	-	HYPH
cord-308110-cco3aq4n	113	9	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	113	10	infection	infection	NN
cord-308110-cco3aq4n	113	11	(	(	-LRB-
cord-308110-cco3aq4n	113	12	data	datum	NNS
cord-308110-cco3aq4n	113	13	not	not	RB
cord-308110-cco3aq4n	113	14	shown	show	VBN
cord-308110-cco3aq4n	113	15	)	)	-RRB-
cord-308110-cco3aq4n	113	16	,	,	,
cord-308110-cco3aq4n	113	17	suggesting	suggest	VBG
cord-308110-cco3aq4n	113	18	that	that	IN
cord-308110-cco3aq4n	113	19	CCR2b	CCR2b	NNP
cord-308110-cco3aq4n	113	20	is	be	VBZ
cord-308110-cco3aq4n	113	21	not	not	RB
cord-308110-cco3aq4n	113	22	the	the	DT
cord-308110-cco3aq4n	113	23	target	target	NN
cord-308110-cco3aq4n	113	24	molecule	molecule	NN
cord-308110-cco3aq4n	113	25	either	either	RB
cord-308110-cco3aq4n	113	26	.	.	.
cord-308110-cco3aq4n	114	1	Further	further	JJ
cord-308110-cco3aq4n	114	2	studies	study	NNS
cord-308110-cco3aq4n	114	3	,	,	,
cord-308110-cco3aq4n	114	4	such	such	JJ
cord-308110-cco3aq4n	114	5	as	as	IN
cord-308110-cco3aq4n	114	6	a	a	DT
cord-308110-cco3aq4n	114	7	time	time	NN
cord-308110-cco3aq4n	114	8	-	-	HYPH
cord-308110-cco3aq4n	114	9	of	of	IN
cord-308110-cco3aq4n	114	10	-	-	HYPH
cord-308110-cco3aq4n	114	11	addition	addition	NN
cord-308110-cco3aq4n	114	12	experiment	experiment	NN
cord-308110-cco3aq4n	114	13	and	and	CC
cord-308110-cco3aq4n	114	14	biochemical	biochemical	JJ
cord-308110-cco3aq4n	114	15	approaches	approach	NNS
cord-308110-cco3aq4n	114	16	,	,	,
cord-308110-cco3aq4n	114	17	are	be	VBP
cord-308110-cco3aq4n	114	18	required	require	VBN
cord-308110-cco3aq4n	114	19	to	to	TO
cord-308110-cco3aq4n	114	20	elucidate	elucidate	VB
cord-308110-cco3aq4n	114	21	the	the	DT
cord-308110-cco3aq4n	114	22	mechanism	mechanism	NN
cord-308110-cco3aq4n	114	23	of	of	IN
cord-308110-cco3aq4n	114	24	action	action	NN
cord-308110-cco3aq4n	114	25	,	,	,
cord-308110-cco3aq4n	114	26	and	and	CC
cord-308110-cco3aq4n	114	27	they	-PRON-	PRP
cord-308110-cco3aq4n	114	28	are	be	VBP
cord-308110-cco3aq4n	114	29	currently	currently	RB
cord-308110-cco3aq4n	114	30	in	in	IN
cord-308110-cco3aq4n	114	31	progress	progress	NN
cord-308110-cco3aq4n	114	32	.	.	.
cord-308110-cco3aq4n	115	1	In	in	IN
cord-308110-cco3aq4n	115	2	conclusion	conclusion	NN
cord-308110-cco3aq4n	115	3	,	,	,
cord-308110-cco3aq4n	115	4	in	in	IN
cord-308110-cco3aq4n	115	5	addition	addition	NN
cord-308110-cco3aq4n	115	6	to	to	IN
cord-308110-cco3aq4n	115	7	the	the	DT
cord-308110-cco3aq4n	115	8	potent	potent	JJ
cord-308110-cco3aq4n	115	9	anti	anti	JJ
cord-308110-cco3aq4n	115	10	-	-	JJ
cord-308110-cco3aq4n	115	11	inflammatory	inflammatory	JJ
cord-308110-cco3aq4n	115	12	activity	activity	NN
cord-308110-cco3aq4n	115	13	of	of	IN
cord-308110-cco3aq4n	115	14	CVC	CVC	NNP
cord-308110-cco3aq4n	115	15	in	in	IN
cord-308110-cco3aq4n	115	16	vivo	vivo	NN
cord-308110-cco3aq4n	115	17	,	,	,
cord-308110-cco3aq4n	115	18	the	the	DT
cord-308110-cco3aq4n	115	19	present	present	JJ
cord-308110-cco3aq4n	115	20	study	study	NN
cord-308110-cco3aq4n	115	21	has	have	VBZ
cord-308110-cco3aq4n	115	22	identified	identify	VBN
cord-308110-cco3aq4n	115	23	its	-PRON-	PRP$
cord-308110-cco3aq4n	115	24	anti	anti	JJ
cord-308110-cco3aq4n	115	25	-	-	JJ
cord-308110-cco3aq4n	115	26	SARS	SARS	NNP
cord-308110-cco3aq4n	115	27	-	-	HYPH
cord-308110-cco3aq4n	115	28	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	115	29	activity	activity	NN
cord-308110-cco3aq4n	115	30	in	in	IN
cord-308110-cco3aq4n	115	31	vitro	vitro	FW
cord-308110-cco3aq4n	115	32	.	.	.
cord-308110-cco3aq4n	116	1	Since	since	IN
cord-308110-cco3aq4n	116	2	not	not	RB
cord-308110-cco3aq4n	116	3	only	only	RB
cord-308110-cco3aq4n	116	4	the	the	DT
cord-308110-cco3aq4n	116	5	inhibition	inhibition	NN
cord-308110-cco3aq4n	116	6	of	of	IN
cord-308110-cco3aq4n	116	7	viral	viral	JJ
cord-308110-cco3aq4n	116	8	replication	replication	NN
cord-308110-cco3aq4n	116	9	but	but	CC
cord-308110-cco3aq4n	116	10	also	also	RB
cord-308110-cco3aq4n	116	11	the	the	DT
cord-308110-cco3aq4n	116	12	control	control	NN
cord-308110-cco3aq4n	116	13	of	of	IN
cord-308110-cco3aq4n	116	14	excessive	excessive	JJ
cord-308110-cco3aq4n	116	15	immune	immune	JJ
cord-308110-cco3aq4n	116	16	activation	activation	NN
cord-308110-cco3aq4n	116	17	is	be	VBZ
cord-308110-cco3aq4n	116	18	mandatory	mandatory	JJ
cord-308110-cco3aq4n	116	19	to	to	TO
cord-308110-cco3aq4n	116	20	save	save	VB
cord-308110-cco3aq4n	116	21	COVID-19	covid-19	JJ
cord-308110-cco3aq4n	116	22	patients	patient	NNS
cord-308110-cco3aq4n	116	23	at	at	IN
cord-308110-cco3aq4n	116	24	the	the	DT
cord-308110-cco3aq4n	116	25	late	late	JJ
cord-308110-cco3aq4n	116	26	stage	stage	NN
cord-308110-cco3aq4n	116	27	of	of	IN
cord-308110-cco3aq4n	116	28	the	the	DT
cord-308110-cco3aq4n	116	29	disease	disease	NN
cord-308110-cco3aq4n	116	30	,	,	,
cord-308110-cco3aq4n	116	31	CVC	CVC	NNP
cord-308110-cco3aq4n	116	32	should	should	MD
cord-308110-cco3aq4n	116	33	be	be	VB
cord-308110-cco3aq4n	116	34	further	further	RB
cord-308110-cco3aq4n	116	35	pursued	pursue	VBN
cord-308110-cco3aq4n	116	36	for	for	IN
cord-308110-cco3aq4n	116	37	its	-PRON-	PRP$
cord-308110-cco3aq4n	116	38	potential	potential	NN
cord-308110-cco3aq4n	116	39	in	in	IN
cord-308110-cco3aq4n	116	40	the	the	DT
cord-308110-cco3aq4n	116	41	treatment	treatment	NN
cord-308110-cco3aq4n	116	42	of	of	IN
cord-308110-cco3aq4n	116	43	SARS	SARS	NNP
cord-308110-cco3aq4n	116	44	-	-	HYPH
cord-308110-cco3aq4n	116	45	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	116	46	infection	infection	NN
cord-308110-cco3aq4n	116	47	.	.	.
cord-308110-cco3aq4n	117	1	The	the	DT
cord-308110-cco3aq4n	117	2	data	datum	NNS
cord-308110-cco3aq4n	117	3	of	of	IN
cord-308110-cco3aq4n	117	4	CVC	CVC	NNP
cord-308110-cco3aq4n	117	5	and	and	CC
cord-308110-cco3aq4n	117	6	RDV	RDV	NNP
cord-308110-cco3aq4n	117	7	represent	represent	VBP
cord-308110-cco3aq4n	117	8	mean	mean	JJ
cord-308110-cco3aq4n	117	9	±	±	CD
cord-308110-cco3aq4n	117	10	range	range	NN
cord-308110-cco3aq4n	117	11	for	for	IN
cord-308110-cco3aq4n	117	12	two	two	CD
cord-308110-cco3aq4n	117	13	separate	separate	JJ
cord-308110-cco3aq4n	117	14	experiments	experiment	NNS
cord-308110-cco3aq4n	117	15	and	and	CC
cord-308110-cco3aq4n	117	16	mean	mean	VB
cord-308110-cco3aq4n	117	17	±	±	NNP
cord-308110-cco3aq4n	117	18	standard	standard	JJ
cord-308110-cco3aq4n	117	19	deviation	deviation	NN
cord-308110-cco3aq4n	117	20	for	for	IN
cord-308110-cco3aq4n	117	21	three	three	CD
cord-308110-cco3aq4n	117	22	separate	separate	JJ
cord-308110-cco3aq4n	117	23	experiments	experiment	NNS
cord-308110-cco3aq4n	117	24	,	,	,
cord-308110-cco3aq4n	117	25	respectively	respectively	RB
cord-308110-cco3aq4n	117	26	.	.	.
cord-308110-cco3aq4n	117	27	 	 	_SP
cord-308110-cco3aq4n	118	1	Immunomodulatory	immunomodulatory	JJ
cord-308110-cco3aq4n	118	2	therapy	therapy	NN
cord-308110-cco3aq4n	118	3	for	for	IN
cord-308110-cco3aq4n	118	4	the	the	DT
cord-308110-cco3aq4n	118	5	management	management	NN
cord-308110-cco3aq4n	118	6	of	of	IN
cord-308110-cco3aq4n	118	7	severe	severe	JJ
cord-308110-cco3aq4n	118	8	COVID-19	COVID-19	NNP
cord-308110-cco3aq4n	118	9	.	.	.
cord-308110-cco3aq4n	119	1	Beyond	beyond	IN
cord-308110-cco3aq4n	119	2	the	the	DT
cord-308110-cco3aq4n	119	3	anti	anti	JJ
cord-308110-cco3aq4n	119	4	-	-	JJ
cord-308110-cco3aq4n	119	5	viral	viral	JJ
cord-308110-cco3aq4n	119	6	therapy	therapy	NN
cord-308110-cco3aq4n	119	7	:	:	:
cord-308110-cco3aq4n	119	8	a	a	DT
cord-308110-cco3aq4n	119	9	comprehensive	comprehensive	JJ
cord-308110-cco3aq4n	119	10	review	review	NN
cord-308110-cco3aq4n	119	11	TAK-652	TAK-652	NNP
cord-308110-cco3aq4n	119	12	inhibits	inhibit	VBZ
cord-308110-cco3aq4n	119	13	CCR5-mediated	ccr5-mediated	JJ
cord-308110-cco3aq4n	119	14	human	human	JJ
cord-308110-cco3aq4n	119	15	immunodeficiency	immunodeficiency	NN
cord-308110-cco3aq4n	119	16	virustype	virustype	NN
cord-308110-cco3aq4n	119	17	1	1	CD
cord-308110-cco3aq4n	119	18	infection	infection	NN
cord-308110-cco3aq4n	119	19	in	in	IN
cord-308110-cco3aq4n	119	20	vitro	vitro	FW
cord-308110-cco3aq4n	119	21	and	and	CC
cord-308110-cco3aq4n	119	22	has	have	VBZ
cord-308110-cco3aq4n	119	23	favorable	favorable	JJ
cord-308110-cco3aq4n	119	24	pharmacokinetics	pharmacokinetic	NNS
cord-308110-cco3aq4n	119	25	in	in	IN
cord-308110-cco3aq4n	119	26	humans	human	NNS
cord-308110-cco3aq4n	120	1	The	the	DT
cord-308110-cco3aq4n	120	2	FDA	FDA	NNP
cord-308110-cco3aq4n	120	3	-	-	HYPH
cord-308110-cco3aq4n	120	4	approved	approve	VBN
cord-308110-cco3aq4n	120	5	drug	drug	NN
cord-308110-cco3aq4n	120	6	ivermectin	ivermectin	NNP
cord-308110-cco3aq4n	120	7	inhibits	inhibit	VBZ
cord-308110-cco3aq4n	120	8	the	the	DT
cord-308110-cco3aq4n	120	9	replication	replication	NN
cord-308110-cco3aq4n	120	10	of	of	IN
cord-308110-cco3aq4n	120	11	SARS	SARS	NNP
cord-308110-cco3aq4n	120	12	-	-	HYPH
cord-308110-cco3aq4n	120	13	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	120	14	in	in	IN
cord-308110-cco3aq4n	120	15	vitro	vitro	FW
cord-308110-cco3aq4n	121	1	A	a	DT
cord-308110-cco3aq4n	121	2	trial	trial	NN
cord-308110-cco3aq4n	121	3	of	of	IN
cord-308110-cco3aq4n	121	4	lopinavir	lopinavir	NNS
cord-308110-cco3aq4n	121	5	-	-	HYPH
cord-308110-cco3aq4n	121	6	ritonavir	ritonavir	NNS
cord-308110-cco3aq4n	121	7	in	in	IN
cord-308110-cco3aq4n	121	8	adults	adult	NNS
cord-308110-cco3aq4n	121	9	hospitalized	hospitalize	VBN
cord-308110-cco3aq4n	121	10	with	with	IN
cord-308110-cco3aq4n	121	11	severe	severe	JJ
cord-308110-cco3aq4n	121	12	covid-19	covid-19	NNP
cord-308110-cco3aq4n	121	13	Monocyte	Monocyte	NNP
cord-308110-cco3aq4n	121	14	chemoattractant	chemoattractant	NN
cord-308110-cco3aq4n	121	15	protein-1	protein-1	NNP
cord-308110-cco3aq4n	121	16	released	release	VBD
cord-308110-cco3aq4n	121	17	from	from	IN
cord-308110-cco3aq4n	121	18	alveolar	alveolar	JJ
cord-308110-cco3aq4n	121	19	macrophages	macrophage	NNS
cord-308110-cco3aq4n	121	20	mediates	mediate	VBZ
cord-308110-cco3aq4n	121	21	the	the	DT
cord-308110-cco3aq4n	121	22	systemic	systemic	JJ
cord-308110-cco3aq4n	121	23	inflammation	inflammation	NN
cord-308110-cco3aq4n	121	24	of	of	IN
cord-308110-cco3aq4n	121	25	acute	acute	JJ
cord-308110-cco3aq4n	121	26	alveolar	alveolar	NN
cord-308110-cco3aq4n	121	27	hypoxia	hypoxia	NN
cord-308110-cco3aq4n	121	28	Remdesivir	Remdesivir	NNP
cord-308110-cco3aq4n	121	29	,	,	,
cord-308110-cco3aq4n	121	30	lopinavir	lopinavir	NNS
cord-308110-cco3aq4n	121	31	,	,	,
cord-308110-cco3aq4n	121	32	emetine	emetine	NNP
cord-308110-cco3aq4n	121	33	,	,	,
cord-308110-cco3aq4n	121	34	and	and	CC
cord-308110-cco3aq4n	121	35	homoharringtonine	homoharringtonine	NN
cord-308110-cco3aq4n	121	36	inhibit	inhibit	VB
cord-308110-cco3aq4n	121	37	SARS	SARS	NNP
cord-308110-cco3aq4n	121	38	-	-	HYPH
cord-308110-cco3aq4n	121	39	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	121	40	replication	replication	NN
cord-308110-cco3aq4n	121	41	in	in	IN
cord-308110-cco3aq4n	121	42	vitro	vitro	FW
cord-308110-cco3aq4n	122	1	Targeting	target	VBG
cord-308110-cco3aq4n	122	2	monocyte	monocyte	NNP
cord-308110-cco3aq4n	122	3	chemoattractant	chemoattractant	NNP
cord-308110-cco3aq4n	122	4	protein-1	protein-1	NNP
cord-308110-cco3aq4n	122	5	signaling	signal	VBG
cord-308110-cco3aq4n	122	6	in	in	IN
cord-308110-cco3aq4n	122	7	disease	disease	NN
cord-308110-cco3aq4n	122	8	Coronavirus	Coronavirus	NNP
cord-308110-cco3aq4n	122	9	diseases	disease	NNS
cord-308110-cco3aq4n	122	10	(	(	-LRB-
cord-308110-cco3aq4n	122	11	COVID-19	covid-19	VB
cord-308110-cco3aq4n	122	12	)	)	-RRB-
cord-308110-cco3aq4n	122	13	current	current	JJ
cord-308110-cco3aq4n	122	14	status	status	NN
cord-308110-cco3aq4n	122	15	and	and	CC
cord-308110-cco3aq4n	122	16	future	future	JJ
cord-308110-cco3aq4n	122	17	perspectives	perspective	NNS
cord-308110-cco3aq4n	122	18	:	:	:
cord-308110-cco3aq4n	122	19	a	a	DT
cord-308110-cco3aq4n	122	20	narrative	narrative	NN
cord-308110-cco3aq4n	122	21	review	review	NN
cord-308110-cco3aq4n	123	1	A	a	DT
cord-308110-cco3aq4n	123	2	randomized	randomized	JJ
cord-308110-cco3aq4n	123	3	,	,	,
cord-308110-cco3aq4n	123	4	placebo	placebo	NN
cord-308110-cco3aq4n	123	5	-	-	HYPH
cord-308110-cco3aq4n	123	6	controlled	control	VBN
cord-308110-cco3aq4n	123	7	trial	trial	NN
cord-308110-cco3aq4n	123	8	of	of	IN
cord-308110-cco3aq4n	123	9	cenicriviroc	cenicriviroc	NNP
cord-308110-cco3aq4n	123	10	for	for	IN
cord-308110-cco3aq4n	123	11	treatment	treatment	NN
cord-308110-cco3aq4n	123	12	of	of	IN
cord-308110-cco3aq4n	123	13	nonalcoholic	nonalcoholic	JJ
cord-308110-cco3aq4n	123	14	steatohepatitis	steatohepatitis	NN
cord-308110-cco3aq4n	123	15	with	with	IN
cord-308110-cco3aq4n	123	16	fibrosis	fibrosis	NN
cord-308110-cco3aq4n	123	17	Compassionate	compassionate	JJ
cord-308110-cco3aq4n	123	18	use	use	NN
cord-308110-cco3aq4n	123	19	of	of	IN
cord-308110-cco3aq4n	123	20	remdesivir	remdesivir	NNS
cord-308110-cco3aq4n	123	21	for	for	IN
cord-308110-cco3aq4n	123	22	patients	patient	NNS
cord-308110-cco3aq4n	123	23	with	with	IN
cord-308110-cco3aq4n	123	24	severe	severe	JJ
cord-308110-cco3aq4n	123	25	covid-19	covid-19	NNP
cord-308110-cco3aq4n	123	26	Coronavirus	Coronavirus	NNP
cord-308110-cco3aq4n	123	27	disease	disease	NN
cord-308110-cco3aq4n	123	28	2019	2019	CD
cord-308110-cco3aq4n	123	29	(	(	-LRB-
cord-308110-cco3aq4n	123	30	COVID-19	COVID-19	NNP
cord-308110-cco3aq4n	123	31	)	)	-RRB-
cord-308110-cco3aq4n	123	32	:	:	:
cord-308110-cco3aq4n	124	1	a	a	DT
cord-308110-cco3aq4n	124	2	literature	literature	NN
cord-308110-cco3aq4n	124	3	review	review	NN
cord-308110-cco3aq4n	124	4	The	the	DT
cord-308110-cco3aq4n	124	5	COVID-19	COVID-19	NNP
cord-308110-cco3aq4n	124	6	pandemic	pandemic	NN
cord-308110-cco3aq4n	124	7	:	:	:
cord-308110-cco3aq4n	124	8	a	a	DT
cord-308110-cco3aq4n	124	9	comprehensive	comprehensive	JJ
cord-308110-cco3aq4n	124	10	review	review	NN
cord-308110-cco3aq4n	124	11	of	of	IN
cord-308110-cco3aq4n	124	12	taxonomy	taxonomy	NN
cord-308110-cco3aq4n	124	13	,	,	,
cord-308110-cco3aq4n	124	14	genetics	genetics	NN
cord-308110-cco3aq4n	124	15	,	,	,
cord-308110-cco3aq4n	124	16	epidemiology	epidemiology	NN
cord-308110-cco3aq4n	124	17	,	,	,
cord-308110-cco3aq4n	124	18	diagnosis	diagnosis	NN
cord-308110-cco3aq4n	124	19	,	,	,
cord-308110-cco3aq4n	124	20	treatment	treatment	NN
cord-308110-cco3aq4n	124	21	,	,	,
cord-308110-cco3aq4n	124	22	and	and	CC
cord-308110-cco3aq4n	124	23	control	control	VB
cord-308110-cco3aq4n	124	24	Enhanced	enhanced	JJ
cord-308110-cco3aq4n	124	25	isolation	isolation	NN
cord-308110-cco3aq4n	124	26	of	of	IN
cord-308110-cco3aq4n	124	27	SARS	SARS	NNP
cord-308110-cco3aq4n	124	28	-	-	HYPH
cord-308110-cco3aq4n	124	29	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	124	30	by	by	IN
cord-308110-cco3aq4n	124	31	TMPRSS2-expressing	tmprss2-expresse	VBG
cord-308110-cco3aq4n	124	32	cells	cell	NNS
cord-308110-cco3aq4n	124	33	Rapid	rapid	JJ
cord-308110-cco3aq4n	124	34	and	and	CC
cord-308110-cco3aq4n	124	35	automated	automate	VBD
cord-308110-cco3aq4n	124	36	tetrazolium	tetrazolium	NN
cord-308110-cco3aq4n	124	37	-	-	HYPH
cord-308110-cco3aq4n	124	38	based	base	VBN
cord-308110-cco3aq4n	124	39	colorimetric	colorimetric	JJ
cord-308110-cco3aq4n	124	40	assay	assay	NN
cord-308110-cco3aq4n	124	41	for	for	IN
cord-308110-cco3aq4n	124	42	the	the	DT
cord-308110-cco3aq4n	124	43	detection	detection	NN
cord-308110-cco3aq4n	124	44	of	of	IN
cord-308110-cco3aq4n	124	45	anti	anti	JJ
cord-308110-cco3aq4n	124	46	-	-	JJ
cord-308110-cco3aq4n	124	47	HIV	hiv	JJ
cord-308110-cco3aq4n	124	48	compounds	compound	NNS
cord-308110-cco3aq4n	125	1	A	a	DT
cord-308110-cco3aq4n	125	2	randomized	randomized	JJ
cord-308110-cco3aq4n	125	3	,	,	,
cord-308110-cco3aq4n	125	4	double	double	JJ
cord-308110-cco3aq4n	125	5	-	-	HYPH
cord-308110-cco3aq4n	125	6	blind	blind	JJ
cord-308110-cco3aq4n	125	7	,	,	,
cord-308110-cco3aq4n	125	8	multicenter	multicenter	JJ
cord-308110-cco3aq4n	125	9	,	,	,
cord-308110-cco3aq4n	125	10	phase	phase	NN
cord-308110-cco3aq4n	125	11	2b	2b	CD
cord-308110-cco3aq4n	125	12	study	study	NN
cord-308110-cco3aq4n	125	13	to	to	TO
cord-308110-cco3aq4n	125	14	evaluate	evaluate	VB
cord-308110-cco3aq4n	125	15	the	the	DT
cord-308110-cco3aq4n	125	16	safety	safety	NN
cord-308110-cco3aq4n	125	17	and	and	CC
cord-308110-cco3aq4n	125	18	efficacy	efficacy	NN
cord-308110-cco3aq4n	125	19	of	of	IN
cord-308110-cco3aq4n	125	20	a	a	DT
cord-308110-cco3aq4n	125	21	combination	combination	NN
cord-308110-cco3aq4n	125	22	of	of	IN
cord-308110-cco3aq4n	125	23	tropifexor	tropifexor	NN
cord-308110-cco3aq4n	125	24	and	and	CC
cord-308110-cco3aq4n	125	25	cenicriviroc	cenicriviroc	NNP
cord-308110-cco3aq4n	125	26	in	in	IN
cord-308110-cco3aq4n	125	27	patients	patient	NNS
cord-308110-cco3aq4n	125	28	with	with	IN
cord-308110-cco3aq4n	125	29	nonalcoholic	nonalcoholic	JJ
cord-308110-cco3aq4n	125	30	steatohepatitis	steatohepatitis	NN
cord-308110-cco3aq4n	125	31	and	and	CC
cord-308110-cco3aq4n	125	32	liver	liver	NN
cord-308110-cco3aq4n	125	33	fibrosis	fibrosis	NN
cord-308110-cco3aq4n	125	34	:	:	:
cord-308110-cco3aq4n	126	1	Study	study	NN
cord-308110-cco3aq4n	126	2	design	design	NN
cord-308110-cco3aq4n	126	3	of	of	IN
cord-308110-cco3aq4n	126	4	the	the	DT
cord-308110-cco3aq4n	126	5	TANDEM	TANDEM	NNP
cord-308110-cco3aq4n	126	6	trial	trial	NN
cord-308110-cco3aq4n	127	1	A	a	DT
cord-308110-cco3aq4n	127	2	review	review	NN
cord-308110-cco3aq4n	127	3	of	of	IN
cord-308110-cco3aq4n	127	4	the	the	DT
cord-308110-cco3aq4n	127	5	safety	safety	NN
cord-308110-cco3aq4n	127	6	of	of	IN
cord-308110-cco3aq4n	127	7	favipiravir	favipiravir	NNP
cord-308110-cco3aq4n	127	8	-a	-a	:
cord-308110-cco3aq4n	127	9	potential	potential	JJ
cord-308110-cco3aq4n	127	10	treatment	treatment	NN
cord-308110-cco3aq4n	127	11	in	in	IN
cord-308110-cco3aq4n	127	12	the	the	DT
cord-308110-cco3aq4n	127	13	COVID-19	COVID-19	NNP
cord-308110-cco3aq4n	127	14	pandemic	pandemic	NN
cord-308110-cco3aq4n	127	15	?	?	.
cord-308110-cco3aq4n	128	1	Development	development	NN
cord-308110-cco3aq4n	128	2	of	of	IN
cord-308110-cco3aq4n	128	3	genetic	genetic	JJ
cord-308110-cco3aq4n	128	4	diagnostic	diagnostic	JJ
cord-308110-cco3aq4n	128	5	methods	method	NNS
cord-308110-cco3aq4n	128	6	for	for	IN
cord-308110-cco3aq4n	128	7	novel	novel	JJ
cord-308110-cco3aq4n	128	8	voronavirus	voronavirus	NNP
cord-308110-cco3aq4n	128	9	Cenicriviroc	Cenicriviroc	NNP
cord-308110-cco3aq4n	128	10	for	for	IN
cord-308110-cco3aq4n	128	11	the	the	DT
cord-308110-cco3aq4n	128	12	treatment	treatment	NN
cord-308110-cco3aq4n	128	13	of	of	IN
cord-308110-cco3aq4n	128	14	non	non	JJ
cord-308110-cco3aq4n	128	15	-	-	JJ
cord-308110-cco3aq4n	128	16	alcoholic	alcoholic	JJ
cord-308110-cco3aq4n	128	17	steatohepatitis	steatohepatitis	NN
cord-308110-cco3aq4n	128	18	and	and	CC
cord-308110-cco3aq4n	128	19	liver	liver	NN
cord-308110-cco3aq4n	128	20	fibrosis	fibrosis	NN
cord-308110-cco3aq4n	128	21	Remdesivir	Remdesivir	NNP
cord-308110-cco3aq4n	128	22	and	and	CC
cord-308110-cco3aq4n	128	23	chloroquine	chloroquine	NN
cord-308110-cco3aq4n	128	24	effectively	effectively	RB
cord-308110-cco3aq4n	128	25	inhibit	inhibit	VBP
cord-308110-cco3aq4n	128	26	the	the	DT
cord-308110-cco3aq4n	128	27	recently	recently	RB
cord-308110-cco3aq4n	128	28	emerged	emerge	VBN
cord-308110-cco3aq4n	128	29	novel	novel	JJ
cord-308110-cco3aq4n	128	30	coronavirus	coronavirus	NN
cord-308110-cco3aq4n	128	31	(	(	-LRB-
cord-308110-cco3aq4n	128	32	2019-nCoV	2019-ncov	CD
cord-308110-cco3aq4n	128	33	)	)	-RRB-
cord-308110-cco3aq4n	128	34	in	in	IN
cord-308110-cco3aq4n	128	35	vitro	vitro	FW
cord-308110-cco3aq4n	128	36	Maraviroc	Maraviroc	NNP
cord-308110-cco3aq4n	128	37	:	:	:
cord-308110-cco3aq4n	128	38	a	a	DT
cord-308110-cco3aq4n	128	39	review	review	NN
cord-308110-cco3aq4n	128	40	of	of	IN
cord-308110-cco3aq4n	128	41	its	-PRON-	PRP$
cord-308110-cco3aq4n	128	42	use	use	NN
cord-308110-cco3aq4n	128	43	in	in	IN
cord-308110-cco3aq4n	128	44	HIV	HIV	NNP
cord-308110-cco3aq4n	128	45	infection	infection	NN
cord-308110-cco3aq4n	128	46	and	and	CC
cord-308110-cco3aq4n	128	47	beyond	beyond	IN
cord-308110-cco3aq4n	128	48	Recent	recent	JJ
cord-308110-cco3aq4n	128	49	developments	development	NNS
cord-308110-cco3aq4n	128	50	in	in	IN
cord-308110-cco3aq4n	128	51	CCR2	CCR2	NNP
cord-308110-cco3aq4n	128	52	antagonists	antagonist	NNS
cord-308110-cco3aq4n	128	53	Transcriptomic	Transcriptomic	NNP
cord-308110-cco3aq4n	128	54	characteristics	characteristic	NNS
cord-308110-cco3aq4n	128	55	of	of	IN
cord-308110-cco3aq4n	128	56	bronchoalveolar	bronchoalveolar	NNP
cord-308110-cco3aq4n	128	57	lavage	lavage	NN
cord-308110-cco3aq4n	128	58	fluid	fluid	NN
cord-308110-cco3aq4n	128	59	and	and	CC
cord-308110-cco3aq4n	128	60	peripheral	peripheral	JJ
cord-308110-cco3aq4n	128	61	blood	blood	NN
cord-308110-cco3aq4n	128	62	mononuclear	mononuclear	NN
cord-308110-cco3aq4n	128	63	cells	cell	NNS
cord-308110-cco3aq4n	128	64	in	in	IN
cord-308110-cco3aq4n	128	65	COVID-19	covid-19	CD
cord-308110-cco3aq4n	128	66	patients	patient	NNS
cord-308110-cco3aq4n	129	1	The	the	DT
cord-308110-cco3aq4n	129	2	pathogenesis	pathogenesis	NN
cord-308110-cco3aq4n	129	3	and	and	CC
cord-308110-cco3aq4n	129	4	treatment	treatment	NN
cord-308110-cco3aq4n	129	5	of	of	IN
cord-308110-cco3aq4n	129	6	the	the	DT
cord-308110-cco3aq4n	129	7	`	`	``
cord-308110-cco3aq4n	129	8	Cytokine	Cytokine	NNP
cord-308110-cco3aq4n	129	9	Storm	Storm	NNP
cord-308110-cco3aq4n	129	10	'	'	''
cord-308110-cco3aq4n	129	11	in	in	IN
cord-308110-cco3aq4n	129	12	COVID-19	COVID-19	,
cord-308110-cco3aq4n	129	13	We	-PRON-	PRP
cord-308110-cco3aq4n	129	14	thank	thank	VBP
cord-308110-cco3aq4n	129	15	National	National	NNP
cord-308110-cco3aq4n	129	16	Institutes	Institutes	NNPS
cord-308110-cco3aq4n	129	17	of	of	IN
cord-308110-cco3aq4n	129	18	Biomedical	Biomedical	NNP
cord-308110-cco3aq4n	129	19	Innovation	Innovation	NNP
cord-308110-cco3aq4n	129	20	,	,	,
cord-308110-cco3aq4n	129	21	Health	Health	NNP
cord-308110-cco3aq4n	129	22	and	and	CC
cord-308110-cco3aq4n	129	23	Nutrition	Nutrition	NNP
cord-308110-cco3aq4n	129	24	and	and	CC
cord-308110-cco3aq4n	129	25	National	National	NNP
cord-308110-cco3aq4n	129	26	Institute	Institute	NNP
cord-308110-cco3aq4n	129	27	of	of	IN
cord-308110-cco3aq4n	129	28	Infectious	Infectious	NNP
cord-308110-cco3aq4n	129	29	Diseases	Diseases	NNPS
cord-308110-cco3aq4n	129	30	for	for	IN
cord-308110-cco3aq4n	129	31	kindly	kindly	RB
cord-308110-cco3aq4n	129	32	providing	provide	VBG
cord-308110-cco3aq4n	129	33	VeroE6	veroe6	NN
cord-308110-cco3aq4n	129	34	/	/	SYM
cord-308110-cco3aq4n	129	35	TMPRSS2	TMPRSS2	NNP
cord-308110-cco3aq4n	129	36	cells	cell	NNS
cord-308110-cco3aq4n	129	37	and	and	CC
cord-308110-cco3aq4n	129	38	SARS	SARS	NNP
cord-308110-cco3aq4n	129	39	-	-	HYPH
cord-308110-cco3aq4n	129	40	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	130	1	(	(	-LRB-
cord-308110-cco3aq4n	130	2	WK-521	wk-521	JJ
cord-308110-cco3aq4n	130	3	strain	strain	NN
cord-308110-cco3aq4n	130	4	)	)	-RRB-
cord-308110-cco3aq4n	130	5	,	,	,
cord-308110-cco3aq4n	130	6	respectively	respectively	RB
cord-308110-cco3aq4n	130	7	.	.	.
cord-308110-cco3aq4n	131	1	Kagoshima	Kagoshima	NNP
cord-308110-cco3aq4n	131	2	University	University	NNP
cord-308110-cco3aq4n	131	3	is	be	VBZ
cord-308110-cco3aq4n	131	4	applying	apply	VBG
cord-308110-cco3aq4n	131	5	for	for	IN
cord-308110-cco3aq4n	131	6	a	a	DT
cord-308110-cco3aq4n	131	7	patent	patent	NN
cord-308110-cco3aq4n	131	8	of	of	IN
cord-308110-cco3aq4n	131	9	CVC	CVC	NNP
cord-308110-cco3aq4n	131	10	as	as	IN
cord-308110-cco3aq4n	131	11	a	a	DT
cord-308110-cco3aq4n	131	12	SARS	SARS	NNP
cord-308110-cco3aq4n	131	13	-	-	HYPH
cord-308110-cco3aq4n	131	14	CoV-2	CoV-2	NNP
cord-308110-cco3aq4n	131	15	inhibitor	inhibitor	NN
cord-308110-cco3aq4n	131	16	,	,	,
cord-308110-cco3aq4n	131	17	and	and	CC
cord-308110-cco3aq4n	131	18	M.O.	M.O.	NNP
cord-308110-cco3aq4n	131	19	,	,	,
cord-308110-cco3aq4n	131	20	M.T.	M.T.	NNP
cord-308110-cco3aq4n	131	21	and	and	CC
cord-308110-cco3aq4n	131	22	M.B.	M.B.	NNP
cord-308110-cco3aq4n	131	23	are	be	VBP
cord-308110-cco3aq4n	131	24	its	-PRON-	PRP$
cord-308110-cco3aq4n	131	25	inventors	inventor	NNS
cord-308110-cco3aq4n	131	26	.	.	.